#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ABCC3	8714	ucsc.edu;bcgsc.ca	37	17	48753410	48753410	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A3CJ-01A-11D-A20W-10	TCGA-G3-A3CJ-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b064bc29-9a26-41f6-b49a-ae77a15d4967	fe4fd074-ca2d-42c3-9851-1c874d1f51fd	g.chr17:48753410C>T	ENST00000285238.8	+	22	3106	c.3026C>T	c.(3025-3027)tCc>tTc	p.S1009F	ABCC3_ENST00000510891.1_3'UTR	NM_003786.3	NP_003777.2	O15438	MRP3_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 3	1009	ABC transmembrane type-1 2. {ECO:0000255|PROSITE-ProRule:PRU00441}.				bile acid and bile salt transport (GO:0015721)|bile acid metabolic process (GO:0008206)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|organic anion transmembrane transporter activity (GO:0008514)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(6)|liver(1)|lung(11)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	33			BRCA - Breast invasive adenocarcinoma(22;3.05e-09)		Cisplatin(DB00515)|Clotrimazole(DB00257)|Conjugated Estrogens(DB00286)|Cyclosporine(DB00091)|Doxorubicin(DB00997)|Etoposide(DB00773)|Ezetimibe(DB00973)|Fluorouracil(DB00544)|Folic Acid(DB00158)|Gadoxetate(DB08884)|Glutathione(DB00143)|Glyburide(DB01016)|Indomethacin(DB00328)|Lamivudine(DB00709)|Leucovorin(DB00650)|Methotrexate(DB00563)|Metyrapone(DB01011)|Nifedipine(DB01115)|Omeprazole(DB00338)|Phenobarbital(DB01174)|Probenecid(DB01032)|Rifampicin(DB01045)|Sulfinpyrazone(DB01138)|Verapamil(DB00661)|Vincristine(DB00541)	AACAACACTTCCCTGAGGCTG	0.547																																					p.S1009F		.											.	ABCC3	93	0			c.C3026T						.						94.0	83.0	87.0					17																	48753410		2203	4300	6503	SO:0001583	missense	8714	exon22			ACACTTCCCTGAG	Y17151	CCDS32681.1, CCDS45739.1	17q21	2012-03-14			ENSG00000108846	ENSG00000108846		"""ATP binding cassette transporters / subfamily C"""	54	protein-coding gene	gene with protein product	"""canalicular multispecific organic anion transporter 2"""	604323				8894702, 9827529	Standard	NM_003786		Approved	MRP3, cMOAT2, EST90757, MLP2, MOAT-D	uc002isl.3	O15438	OTTHUMG00000162245	ENST00000285238.8:c.3026C>T	17.37:g.48753410C>T	ENSP00000285238:p.Ser1009Phe	175.0	1.0		150.0	61.0	NM_003786	B2RPA9|D3DTX9|O60265|O60922|O75621|O95078|O95289|O95290|Q86X85|Q9UN52	Missense_Mutation	SNP	ENST00000285238.8	37	CCDS32681.1	.	.	.	.	.	.	.	.	.	.	C	12.68	2.011713	0.35511	.	.	ENSG00000108846	ENST00000285238	D	0.94280	-3.39	5.88	3.83	0.44106	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);ABC transporter, transmembrane domain (1);	0.894418	0.09834	N	0.749886	D	0.94751	0.8306	L	0.58583	1.82	0.09310	N	1	D	0.56746	0.977	P	0.57960	0.83	D	0.86988	0.2108	10	0.87932	D	0	-27.316	11.1371	0.48381	0.2154:0.6396:0.145:0.0	.	1009	O15438	MRP3_HUMAN	F	1009	ENSP00000285238:S1009F	ENSP00000285238:S1009F	S	+	2	0	ABCC3	46108409	0.012000	0.17670	0.759000	0.31340	0.026000	0.11368	2.324000	0.43831	1.470000	0.48102	-0.182000	0.12963	TCC	.		0.547	ABCC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368083.2	NM_020038	
ALB	213	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	74282071	74282071	+	Splice_Site	SNP	G	G	A			TCGA-G3-A3CJ-01A-11D-A20W-10	TCGA-G3-A3CJ-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b064bc29-9a26-41f6-b49a-ae77a15d4967	fe4fd074-ca2d-42c3-9851-1c874d1f51fd	g.chr4:74282071G>A	ENST00000503124.1	+	8	1046		c.e8+1		ALB_ENST00000295897.4_Splice_Site|ALB_ENST00000509063.1_Splice_Site|ALB_ENST00000401494.3_Splice_Site|ALB_ENST00000505649.1_Splice_Site|ALB_ENST00000415165.2_Splice_Site			Q8TES7	FBF1_HUMAN	albumin						apical junction assembly (GO:0043297)|cilium assembly (GO:0042384)|establishment of epithelial cell polarity (GO:0090162)	cell junction (GO:0030054)|centriole (GO:0005814)|ciliary transition fiber (GO:0097539)|spindle pole (GO:0000922)				NS(1)|endometrium(4)|kidney(1)|large_intestine(6)|liver(9)|lung(16)|ovary(3)|prostate(2)|skin(4)|stomach(1)|urinary_tract(1)	48	Breast(15;0.00102)		Epithelial(6;4.8e-05)|OV - Ovarian serous cystadenocarcinoma(6;0.000263)|all cancers(17;0.000472)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			TCCAGAATGCGTAAGTAATTT	0.294																																					.		.											.	ALB	96	0			c.1289+1G>A						.						37.0	37.0	37.0					4																	74282071		2202	4298	6500	SO:0001630	splice_region_variant	213	exon10			GAATGCGTAAGTA	V00494	CCDS3555.1	4q13.3	2008-02-05	2006-06-30	2006-06-30	ENSG00000163631	ENSG00000163631			399	protein-coding gene	gene with protein product		103600				6292049, 6192711	Standard	NM_000477		Approved		uc003hgs.4	P02768	OTTHUMG00000129919	ENST00000503124.1:c.839+1G>A	4.37:g.74282071G>A		118.0	0.0		113.0	43.0	NM_000477	B5MEM5|Q96IF6|Q96JG4|Q96MA8	Splice_Site	SNP	ENST00000503124.1	37		.	.	.	.	.	.	.	.	.	.	G	11.43	1.637194	0.29157	.	.	ENSG00000163631	ENST00000295897;ENST00000415165;ENST00000329326;ENST00000503124;ENST00000509063;ENST00000401494;ENST00000430202;ENST00000511370	.	.	.	5.74	4.89	0.63831	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.8057	0.69952	0.0:0.0:0.8546:0.1454	.	.	.	.	.	-1	.	.	.	+	.	.	ALB	74500935	1.000000	0.71417	0.547000	0.28179	0.272000	0.26649	3.923000	0.56469	1.414000	0.47017	0.591000	0.81541	.	.		0.294	ALB-011	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000365419.1	NM_000477	Intron
ANKRD12	23253	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	18	9257082	9257082	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A3CJ-01A-11D-A20W-10	TCGA-G3-A3CJ-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b064bc29-9a26-41f6-b49a-ae77a15d4967	fe4fd074-ca2d-42c3-9851-1c874d1f51fd	g.chr18:9257082A>G	ENST00000262126.4	+	9	4057	c.3817A>G	c.(3817-3819)Att>Gtt	p.I1273V	RP11-888D10.4_ENST00000609701.1_RNA|ANKRD12_ENST00000383440.2_Missense_Mutation_p.I1250V|ANKRD12_ENST00000400020.3_Missense_Mutation_p.I1250V	NM_015208.4	NP_056023.3	Q6UB98	ANR12_HUMAN	ankyrin repeat domain 12	1273						cytoplasm (GO:0005737)|nucleus (GO:0005634)				NS(1)|breast(3)|central_nervous_system(2)|endometrium(8)|kidney(2)|large_intestine(20)|lung(18)|ovary(3)|pancreas(1)|prostate(4)|skin(1)|urinary_tract(2)	65						GCCGGAGCGGATTAAACCACC	0.433																																					p.I1273V		.											.	ANKRD12	92	0			c.A3817G						.						77.0	75.0	75.0					18																	9257082		2203	4300	6503	SO:0001583	missense	23253	exon9			GAGCGGATTAAAC	AY373757	CCDS11843.1, CCDS42411.1	18p11.22	2013-01-10			ENSG00000101745	ENSG00000101745		"""Ankyrin repeat domain containing"""	29135	protein-coding gene	gene with protein product		610616				10048485	Standard	NM_001204056		Approved	KIAA0874, FLJ20053, GAC-1	uc002knv.3	Q6UB98	OTTHUMG00000131595	ENST00000262126.4:c.3817A>G	18.37:g.9257082A>G	ENSP00000262126:p.Ile1273Val	309.0	1.0		235.0	85.0	NM_015208	O94951|Q658K1|Q6QMF7|Q9H231|Q9H784	Missense_Mutation	SNP	ENST00000262126.4	37	CCDS11843.1	.	.	.	.	.	.	.	.	.	.	A	3.217	-0.160324	0.06502	.	.	ENSG00000101745	ENST00000383440;ENST00000262126	T;T	0.63913	-0.07;-0.07	5.89	3.49	0.39957	.	0.298503	0.36338	N	0.002644	T	0.39784	0.1091	N	0.16478	0.41	0.22675	N	0.998865	B;B	0.11235	0.004;0.003	B;B	0.10450	0.005;0.002	T	0.18053	-1.0349	10	0.21540	T	0.41	-30.3326	6.0617	0.19842	0.7172:0.1433:0.1395:0.0	.	1250;1273	Q6UB98-2;Q6UB98	.;ANR12_HUMAN	V	1250;1273	ENSP00000372932:I1250V;ENSP00000262126:I1273V	ENSP00000262126:I1273V	I	+	1	0	ANKRD12	9247082	0.384000	0.25164	0.983000	0.44433	0.746000	0.42486	0.790000	0.26900	0.478000	0.27488	0.533000	0.62120	ATT	.		0.433	ANKRD12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254478.2	NM_015208	
ANKRD30A	91074	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	10	37508232	37508232	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A3CJ-01A-11D-A20W-10	TCGA-G3-A3CJ-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b064bc29-9a26-41f6-b49a-ae77a15d4967	fe4fd074-ca2d-42c3-9851-1c874d1f51fd	g.chr10:37508232C>A	ENST00000602533.1	+	34	3523	c.3424C>A	c.(3424-3426)Cac>Aac	p.H1142N	ANKRD30A_ENST00000374660.1_Missense_Mutation_p.H1261N|ANKRD30A_ENST00000361713.1_Missense_Mutation_p.H1142N			Q9BXX3	AN30A_HUMAN	ankyrin repeat domain 30A	1198					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(8)|endometrium(14)|kidney(21)|large_intestine(13)|lung(70)|ovary(8)|pancreas(1)|prostate(3)|skin(15)|stomach(1)|urinary_tract(3)	158						AATTGAATCACACCATCCTAG	0.393																																					p.H1142N		.											.	ANKRD30A	161	0			c.C3424A						.						68.0	66.0	67.0					10																	37508232		1867	4098	5965	SO:0001583	missense	91074	exon34			GAATCACACCATC	AF269087	CCDS7193.1	10p11.21	2013-01-10			ENSG00000148513	ENSG00000148513		"""Ankyrin repeat domain containing"""	17234	protein-coding gene	gene with protein product	"""breast cancer antigen NY-BR-1"""	610856				11280766	Standard	NM_052997		Approved	NY-BR-1	uc001iza.1	Q9BXX3	OTTHUMG00000017968	ENST00000602533.1:c.3424C>A	10.37:g.37508232C>A	ENSP00000473551:p.His1142Asn	244.0	0.0		164.0	51.0	NM_052997	Q5W025	Missense_Mutation	SNP	ENST00000602533.1	37		.	.	.	.	.	.	.	.	.	.	c	0.428	-0.904682	0.02453	.	.	ENSG00000148513	ENST00000361713;ENST00000374660	T;T	0.13778	2.56;2.56	2.81	0.189	0.15119	.	.	.	.	.	T	0.09862	0.0242	L	0.40543	1.245	0.09310	N	1	B	0.06786	0.001	B	0.01281	0.0	T	0.34625	-0.9821	9	0.66056	D	0.02	.	2.4956	0.04621	0.4258:0.1339:0.0:0.4403	.	1198	Q9BXX3	AN30A_HUMAN	N	1142;1261	ENSP00000354432:H1142N;ENSP00000363792:H1261N	ENSP00000354432:H1142N	H	+	1	0	ANKRD30A	37548238	0.803000	0.28956	0.051000	0.19133	0.001000	0.01503	1.569000	0.36428	-0.172000	0.10779	-1.930000	0.00511	CAC	.		0.393	ANKRD30A-001	KNOWN	NMD_exception|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000047588.2	NM_052997	
APOB	338	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	2	21235238	21235238	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A3CJ-01A-11D-A20W-10	TCGA-G3-A3CJ-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b064bc29-9a26-41f6-b49a-ae77a15d4967	fe4fd074-ca2d-42c3-9851-1c874d1f51fd	g.chr2:21235238T>C	ENST00000233242.1	-	26	4629	c.4502A>G	c.(4501-4503)tAt>tGt	p.Y1501C		NM_000384.2	NP_000375	P04114	APOB_HUMAN	apolipoprotein B	1501					artery morphogenesis (GO:0048844)|blood coagulation (GO:0007596)|cellular response to prostaglandin stimulus (GO:0071379)|cellular response to tumor necrosis factor (GO:0071356)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle remodeling (GO:0034374)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol biosynthetic process (GO:0045540)|response to carbohydrate (GO:0009743)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to virus (GO:0009615)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|triglyceride catabolic process (GO:0019433)|triglyceride mobilization (GO:0006642)|very-low-density lipoprotein particle assembly (GO:0034379)	actin cytoskeleton (GO:0015629)|chylomicron (GO:0042627)|chylomicron remnant (GO:0034360)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome lumen (GO:0031904)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate-density lipoprotein particle (GO:0034363)|intracellular membrane-bounded organelle (GO:0043231)|low-density lipoprotein particle (GO:0034362)|mature chylomicron (GO:0034359)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|lipase binding (GO:0035473)|low-density lipoprotein particle receptor binding (GO:0050750)|phospholipid binding (GO:0005543)			NS(5)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(19)|kidney(10)|large_intestine(63)|liver(5)|lung(125)|ovary(16)|pancreas(1)|prostate(5)|skin(31)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(6)	305	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					AGACAGGCCATATGTGCCTTT	0.458																																					p.Y1501C		.											.	APOB	175	0			c.A4502G						.						144.0	137.0	140.0					2																	21235238		2203	4300	6503	SO:0001583	missense	338	exon26			AGGCCATATGTGC	M14162	CCDS1703.1	2p24-p23	2013-05-29	2013-05-29		ENSG00000084674	ENSG00000084674		"""Apolipoproteins"""	603	protein-coding gene	gene with protein product		107730	"""apolipoprotein B (including Ag(x) antigen)"""				Standard	NM_000384		Approved		uc002red.3	P04114	OTTHUMG00000090785	ENST00000233242.1:c.4502A>G	2.37:g.21235238T>C	ENSP00000233242:p.Tyr1501Cys	260.0	0.0		192.0	78.0	NM_000384	O00502|P78479|P78480|P78481|Q13779|Q13785|Q13786|Q13787|Q13788|Q4ZG63|Q53QC8|Q7Z600|Q9UMN0	Missense_Mutation	SNP	ENST00000233242.1	37	CCDS1703.1	.	.	.	.	.	.	.	.	.	.	T	10.21	1.286329	0.23478	.	.	ENSG00000084674	ENST00000233242;ENST00000535079	T	0.00840	5.63	5.88	3.47	0.39725	.	0.243265	0.29139	N	0.013031	T	0.02727	0.0082	L	0.56769	1.78	0.26805	N	0.969117	D	0.71674	0.998	P	0.60173	0.87	T	0.31724	-0.9933	10	0.72032	D	0.01	.	7.505	0.27540	0.1345:0.0681:0.0:0.7974	.	1501	P04114	APOB_HUMAN	C	1501	ENSP00000233242:Y1501C	ENSP00000233242:Y1501C	Y	-	2	0	APOB	21088743	0.677000	0.27577	0.007000	0.13788	0.036000	0.12997	1.291000	0.33330	0.458000	0.26988	0.533000	0.62120	TAT	.		0.458	APOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207571.1		
ARHGEF12	23365	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	120310884	120310884	+	Missense_Mutation	SNP	A	A	G	rs187048571	byFrequency	TCGA-G3-A3CJ-01A-11D-A20W-10	TCGA-G3-A3CJ-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b064bc29-9a26-41f6-b49a-ae77a15d4967	fe4fd074-ca2d-42c3-9851-1c874d1f51fd	g.chr11:120310884A>G	ENST00000397843.2	+	13	1212	c.1046A>G	c.(1045-1047)cAt>cGt	p.H349R	ARHGEF12_ENST00000356641.3_Missense_Mutation_p.H330R|ARHGEF12_ENST00000532993.1_Missense_Mutation_p.H246R	NM_015313.2	NP_056128.1	Q9NZN5	ARHGC_HUMAN	Rho guanine nucleotide exchange factor (GEF) 12	349					apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|G-protein coupled receptor signaling pathway (GO:0007186)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	G-protein coupled receptor binding (GO:0001664)|GTPase activator activity (GO:0005096)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(5)|endometrium(6)|kidney(5)|large_intestine(13)|lung(23)|ovary(4)|pancreas(1)|prostate(1)|skin(2)	61		Breast(109;0.000813)|Medulloblastoma(222;0.0425)|Hepatocellular(160;0.0831)|all_hematologic(192;0.107)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.231)		ATAGCACCTCATATTATTGGA	0.368			T	MLL	AML								A|||	2	0.000399361	0.0008	0.0014	5008	,	,		17823	0.0		0.0	False		,,,				2504	0.0				p.H349R		.		Dom	yes		11	11q23.3	23365	RHO guanine nucleotide exchange factor (GEF) 12 (LARG)		L	.	ARHGEF12	661	0			c.A1046G						.	A	ARG/HIS,ARG/HIS	2,3760		0,2,1879	200.0	183.0	188.0		989,1046	6.0	1.0	11		188	8,8200		0,8,4096	yes	missense,missense	ARHGEF12	NM_001198665.1,NM_015313.2	29,29	0,10,5975	GG,GA,AA		0.0975,0.0532,0.0835	benign,benign	330/1526,349/1545	120310884	10,11960	1881	4104	5985	SO:0001583	missense	23365	exon13			CACCTCATATTAT	AF180681	CCDS41727.1, CCDS55794.1	11q23.3	2011-11-16			ENSG00000196914	ENSG00000196914		"""Rho guanine nucleotide exchange factors"""	14193	protein-coding gene	gene with protein product		604763				10681437, 9205841	Standard	NM_001198665		Approved	KIAA0382, LARG	uc001pxl.2	Q9NZN5	OTTHUMG00000166143	ENST00000397843.2:c.1046A>G	11.37:g.120310884A>G	ENSP00000380942:p.His349Arg	253.0	0.0		149.0	56.0	NM_015313	O15086|Q6P526	Missense_Mutation	SNP	ENST00000397843.2	37	CCDS41727.1	2	9.157509157509158E-4	1	0.0020325203252032522	1	0.0027624309392265192	0	0.0	0	0.0	A	12.83	2.056544	0.36277	5.32E-4	9.75E-4	ENSG00000196914	ENST00000397843;ENST00000356641;ENST00000532993	T;T;T	0.64803	-0.01;-0.12;-0.01	5.98	5.98	0.97165	.	0.135863	0.34025	N	0.004330	T	0.51295	0.1666	L	0.29908	0.895	0.32426	N	0.548677	B;B;B	0.25609	0.018;0.13;0.08	B;B;B	0.29077	0.021;0.098;0.045	T	0.59032	-0.7530	10	0.30854	T	0.27	-18.4347	12.9218	0.58237	0.8648:0.1352:0.0:0.0	.	246;330;349	B4DGW2;Q9NZN5-2;Q9NZN5	.;.;ARHGC_HUMAN	R	349;330;246	ENSP00000380942:H349R;ENSP00000349056:H330R;ENSP00000432984:H246R	ENSP00000349056:H330R	H	+	2	0	ARHGEF12	119816094	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.309000	0.65774	2.289000	0.77006	0.482000	0.46254	CAT	A|0.999;G|0.001		0.368	ARHGEF12-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388052.1	NM_015313	
ARSG	22901	hgsc.bcm.edu;bcgsc.ca	37	17	66391287	66391287	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A3CJ-01A-11D-A20W-10	TCGA-G3-A3CJ-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b064bc29-9a26-41f6-b49a-ae77a15d4967	fe4fd074-ca2d-42c3-9851-1c874d1f51fd	g.chr17:66391287G>T	ENST00000448504.2	+	10	1961	c.1165G>T	c.(1165-1167)Gtg>Ttg	p.V389L	ARSG_ENST00000452479.2_Missense_Mutation_p.V225L|ARSG_ENST00000582154.1_3'UTR	NM_014960.4	NP_055775.2	Q96EG1	ARSG_HUMAN	arylsulfatase G	389					cellular protein metabolic process (GO:0044267)|glycosphingolipid metabolic process (GO:0006687)|post-translational protein modification (GO:0043687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)|sulfur compound metabolic process (GO:0006790)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|extracellular space (GO:0005615)|lysosome (GO:0005764)	arylsulfatase activity (GO:0004065)|metal ion binding (GO:0046872)			NS(2)|endometrium(3)|kidney(1)|large_intestine(8)|lung(8)|ovary(1)|prostate(1)|stomach(1)|urinary_tract(1)	26			BRCA - Breast invasive adenocarcinoma(8;5.34e-07)|LUSC - Lung squamous cell carcinoma(166;0.24)			CTTTGATGGTGTGGACGTCTC	0.572																																					p.V389L		.											.	ARSG	91	0			c.G1165T						.						161.0	125.0	137.0					17																	66391287		2203	4300	6503	SO:0001583	missense	22901	exon10			GATGGTGTGGACG	AB023218	CCDS11676.1	17q24.2	2013-07-15	2006-02-15		ENSG00000141337	ENSG00000141337		"""Arylsulfatase family"""	24102	protein-coding gene	gene with protein product		610008				12461688, 16174644	Standard	NM_014960		Approved	KIAA1001	uc002jhc.2	Q96EG1	OTTHUMG00000179810	ENST00000448504.2:c.1165G>T	17.37:g.66391287G>T	ENSP00000407193:p.Val389Leu	289.0	0.0		282.0	19.0	NM_001267727	Q6UXF2|Q9Y2K4	Missense_Mutation	SNP	ENST00000448504.2	37	CCDS11676.1	.	.	.	.	.	.	.	.	.	.	G	7.084	0.570898	0.13623	.	.	ENSG00000141337	ENST00000452479;ENST00000448504	.	.	.	5.25	-0.499	0.12015	Alkaline phosphatase-like, alpha/beta/alpha (1);Sulfatase (1);Alkaline-phosphatase-like, core domain (1);	0.892392	0.09618	N	0.777970	T	0.14485	0.0350	N	0.05280	-0.08	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.31833	-0.9929	9	0.14656	T	0.56	.	5.2398	0.15465	0.0:0.3568:0.3588:0.2844	.	389	Q96EG1	ARSG_HUMAN	L	389;288	.	ENSP00000407193:V288L	V	+	1	0	ARSG	63902882	0.003000	0.15002	0.033000	0.17914	0.907000	0.53573	-0.117000	0.10708	-0.169000	0.10834	0.555000	0.69702	GTG	.		0.572	ARSG-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448369.1	NM_014960	
ATAD2B	54454	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	24042637	24042637	+	Frame_Shift_Del	DEL	T	T	-			TCGA-G3-A3CJ-01A-11D-A20W-10	TCGA-G3-A3CJ-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b064bc29-9a26-41f6-b49a-ae77a15d4967	fe4fd074-ca2d-42c3-9851-1c874d1f51fd	g.chr2:24042637delT	ENST00000238789.5	-	17	2590	c.2247delA	c.(2245-2247)aaafs	p.K749fs	ATAD2B_ENST00000474583.1_5'UTR	NM_001242338.1|NM_017552.2	NP_001229267.1|NP_060022.1	Q9ULI0	ATD2B_HUMAN	ATPase family, AAA domain containing 2B	749						nucleus (GO:0005634)	ATP binding (GO:0005524)|lysine-acetylated histone binding (GO:0070577)			central_nervous_system(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GAAGGTAGGGTTTATGTATAG	0.294																																					p.K749fs		.											.	ATAD2B	68	0			c.2247delA						.						124.0	114.0	117.0					2																	24042637		1852	4095	5947	SO:0001589	frameshift_variant	54454	exon17			GTAGGGTTTATGT	AB033066	CCDS46227.1	2p24.1-p23.3	2010-04-21		2007-02-08	ENSG00000119778	ENSG00000119778		"""ATPases / AAA-type"""	29230	protein-coding gene	gene with protein product		615347					Standard	XM_005264372		Approved	KIAA1240	uc002rek.4	Q9ULI0	OTTHUMG00000151902	ENST00000238789.5:c.2247delA	2.37:g.24042637delT	ENSP00000238789:p.Lys749fs	120.0	0.0		86.0	23.0	NM_001242338	B9ZVQ5|Q6ZNA6|Q8N9E7	Frame_Shift_Del	DEL	ENST00000238789.5	37	CCDS46227.1																																																																																			.		0.294	ATAD2B-001	KNOWN	mRNA_end_NF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324333.1	NM_017552	
ATP10A	57194	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	26026311	26026311	+	Missense_Mutation	SNP	C	C	T	rs146522541	byFrequency	TCGA-G3-A3CJ-01A-11D-A20W-10	TCGA-G3-A3CJ-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b064bc29-9a26-41f6-b49a-ae77a15d4967	fe4fd074-ca2d-42c3-9851-1c874d1f51fd	g.chr15:26026311C>T	ENST00000356865.6	-	2	620	c.509G>A	c.(508-510)cGt>cAt	p.R170H		NM_024490.3	NP_077816.1	O60312	AT10A_HUMAN	ATPase, class V, type 10A	170					ion transmembrane transport (GO:0034220)|phospholipid translocation (GO:0045332)|regulation of cell shape (GO:0008360)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			NS(1)|breast(2)|endometrium(8)|kidney(2)|large_intestine(33)|liver(1)|lung(41)|ovary(3)|pancreas(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	103		all_cancers(20;5.16e-25)|all_lung(180;1.51e-14)|Acute lymphoblastic leukemia(1;2.53e-05)|all_hematologic(1;0.000267)|Breast(32;0.00125)		all cancers(64;9.48e-07)|Epithelial(43;1.69e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0252)|Lung(196;0.244)		GCAGCGAAGACGCACAAAGTC	0.493													C|||	6	0.00119808	0.0008	0.0029	5008	,	,		17764	0.001		0.001	False		,,,				2504	0.001				p.R170H		.											.	ATP10A	139	0			c.G509A						.	C	HIS/ARG	1,4405	2.1+/-5.4	0,1,2202	108.0	107.0	107.0		509	1.4	0.5	15	dbSNP_134	107	5,8595	4.3+/-15.6	0,5,4295	yes	missense	ATP10A	NM_024490.3	29	0,6,6497	TT,TC,CC		0.0581,0.0227,0.0461	benign	170/1500	26026311	6,13000	2203	4300	6503	SO:0001583	missense	57194	exon2			CGAAGACGCACAA	AB011138	CCDS32178.1	15q12	2010-04-20	2007-09-19		ENSG00000206190	ENSG00000206190		"""ATPases / P-type"""	13542	protein-coding gene	gene with protein product		605855	"""ATPase, Class V, type 10C"", ""ATPase, Class V, type 10A"""	ATP10C		11015572, 9628581	Standard	NM_024490		Approved	ATPVA, ATPVC, KIAA0566	uc010ayu.3	O60312		ENST00000356865.6:c.509G>A	15.37:g.26026311C>T	ENSP00000349325:p.Arg170His	216.0	0.0		146.0	60.0	NM_024490	Q4G0S9|Q969I4	Missense_Mutation	SNP	ENST00000356865.6	37	CCDS32178.1	0	0.0	0	0.0	0	0.0	0	0.0	0	0.0	C	3.367	-0.129259	0.06753	2.27E-4	5.81E-4	ENSG00000206190	ENST00000356865	D	0.90504	-2.68	4.67	1.42	0.22433	ATPase, P-type, ATPase-associated domain (1);ATPase,  P-type, cytoplasmic transduction domain A (1);	0.403315	0.26297	N	0.025190	D	0.84808	0.5554	L	0.60067	1.865	0.09310	N	1	B	0.19583	0.037	B	0.20955	0.032	T	0.69273	-0.5188	10	0.23302	T	0.38	-5.6136	5.5059	0.16854	0.0:0.4267:0.0:0.5733	.	170	O60312	AT10A_HUMAN	H	170	ENSP00000349325:R170H	ENSP00000349325:R170H	R	-	2	0	ATP10A	23577404	0.018000	0.18449	0.451000	0.26982	0.386000	0.30323	0.265000	0.18515	0.530000	0.28619	-0.254000	0.11334	CGT	C|1.000;T|0.000		0.493	ATP10A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414830.1	NM_024490	
C3P1	388503	ucsc.edu;bcgsc.ca;mdanderson.org	37	19	10157808	10157808	+	RNA	SNP	C	C	T			TCGA-G3-A3CJ-01A-11D-A20W-10	TCGA-G3-A3CJ-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b064bc29-9a26-41f6-b49a-ae77a15d4967	fe4fd074-ca2d-42c3-9851-1c874d1f51fd	g.chr19:10157808C>T	ENST00000495140.1	+	0	1124							Q6ZMU1	C3P1_HUMAN	complement component 3 precursor pseudogene							extracellular space (GO:0005615)	endopeptidase inhibitor activity (GO:0004866)			endometrium(4)|large_intestine(2)|lung(6)|urinary_tract(1)	13						CAGCATCTCCCATTACCCCAT	0.522																																					.		.											.	C3P1	90	0			.						.						391.0	370.0	377.0					19																	10157808		2078	4210	6288			388503	.			ATCTCCCATTACC	AK131489		19p13.2	2009-04-08			ENSG00000167798	ENSG00000167798			34414	pseudogene	pseudogene							Standard	NR_027300		Approved	CPLP	uc010dwx.2	Q6ZMU1	OTTHUMG00000158555		19.37:g.10157808C>T		371.0	0.0		218.0	63.0	.		RNA	SNP	ENST00000495140.1	37																																																																																				.		0.522	C3P1-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000351284.1	NR_027300	
CACNB2	783	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	18439889	18439889	+	Silent	SNP	T	T	C			TCGA-G3-A3CJ-01A-11D-A20W-10	TCGA-G3-A3CJ-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b064bc29-9a26-41f6-b49a-ae77a15d4967	fe4fd074-ca2d-42c3-9851-1c874d1f51fd	g.chr10:18439889T>C	ENST00000324631.7	+	2	258	c.198T>C	c.(196-198)aaT>aaC	p.N66N	CACNB2_ENST00000377328.1_Silent_p.N66N|CACNB2_ENST00000377331.2_Silent_p.N38N|CACNB2_ENST00000467034.1_3'UTR|CACNB2_ENST00000352115.6_Silent_p.N66N|CACNB2_ENST00000282343.8_Silent_p.N38N	NM_201593.2|NM_201596.2	NP_963887.2|NP_963890.2	Q08289	CACB2_HUMAN	calcium channel, voltage-dependent, beta 2 subunit	66					axon guidance (GO:0007411)|calcium ion import (GO:0070509)|neuromuscular junction development (GO:0007528)|positive regulation of calcium ion transport (GO:0051928)|synaptic transmission (GO:0007268)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|voltage-gated calcium channel complex (GO:0005891)	calcium channel activity (GO:0005262)|voltage-gated calcium channel activity (GO:0005245)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(12)|prostate(1)|skin(3)|stomach(2)	31					Amlodipine(DB00381)|Dronedarone(DB04855)|Felodipine(DB01023)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	CTACCTCAAATAGTTTTGTTC	0.313																																					p.N66N		.											.	CACNB2	154	0			c.T198C						.						131.0	138.0	135.0					10																	18439889		2203	4300	6503	SO:0001819	synonymous_variant	783	exon2			CTCAAATAGTTTT	U95019	CCDS7125.1, CCDS7126.1, CCDS7127.1, CCDS7128.1, CCDS7129.1, CCDS41493.1, CCDS41494.1	10p12	2014-09-17			ENSG00000165995	ENSG00000165995		"""Calcium channel subunits"""	1402	protein-coding gene	gene with protein product		600003		MYSB, CACNLB2		9254841, 8494331	Standard	NM_201596		Approved		uc001ipr.2	Q08289	OTTHUMG00000017764	ENST00000324631.7:c.198T>C	10.37:g.18439889T>C		169.0	0.0		127.0	48.0	NM_201596	A6PVM5|A6PVM7|A6PVM8|O00304|Q5QJ99|Q5QJA0|Q5VVG9|Q5VVH0|Q5VWV6|Q6TME1|Q6TME2|Q6TME3|Q8WX81|Q96NZ3|Q96NZ4|Q96NZ5|Q9BWU2|Q9HD32|Q9Y340|Q9Y341	Silent	SNP	ENST00000324631.7	37	CCDS7125.1																																																																																			.		0.313	CACNB2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047072.2	NM_000724	
CAMK2A	815	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	5	149629865	149629865	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A3CJ-01A-11D-A20W-10	TCGA-G3-A3CJ-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b064bc29-9a26-41f6-b49a-ae77a15d4967	fe4fd074-ca2d-42c3-9851-1c874d1f51fd	g.chr5:149629865G>T	ENST00000348628.6	-	11	1489	c.824C>A	c.(823-825)tCc>tAc	p.S275Y	CAMK2A_ENST00000398376.3_Missense_Mutation_p.S275Y	NM_015981.3|NM_171825.2	NP_057065.2|NP_741960.1	Q9UQM7	KCC2A_HUMAN	calcium/calmodulin-dependent protein kinase II alpha	275					calcium ion transport (GO:0006816)|cytokine-mediated signaling pathway (GO:0019221)|G1/S transition of mitotic cell cycle (GO:0000082)|interferon-gamma-mediated signaling pathway (GO:0060333)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of neuronal synaptic plasticity (GO:0048168)|regulation of neurotransmitter secretion (GO:0046928)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|synapse (GO:0045202)	ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|calmodulin-dependent protein kinase activity (GO:0004683)|kinase activity (GO:0016301)|protein homodimerization activity (GO:0042803)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(6)|skin(1)|stomach(1)	15		all_hematologic(541;0.224)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			TGCCACGGTGGAGCGGTGCTG	0.587																																					p.S275Y		.											.	CAMK2A	333	0			c.C824A						.						73.0	73.0	73.0					5																	149629865		2132	4259	6391	SO:0001583	missense	815	exon11			ACGGTGGAGCGGT	AB023185	CCDS43386.1, CCDS43387.1	5q32	2013-09-20	2008-10-30		ENSG00000070808	ENSG00000070808	2.7.11.17		1460	protein-coding gene	gene with protein product	"""CaM-kinase II alpha chain"", ""calcium/calmodulin-dependent protein kinase II alpha-B subunit"", ""CaM kinase II alpha subunit"", ""CaMK-II alpha subunit"", ""calcium/calmodulin-dependent protein kinase type II alpha chain"""	114078	"""calcium/calmodulin-dependent protein kinase (CaM kinase) II alpha"""	CAMKA		10231032, 3475713	Standard	NM_015981		Approved	KIAA0968, CaMKIINalpha	uc003lrt.2	Q9UQM7	OTTHUMG00000134281	ENST00000348628.6:c.824C>A	5.37:g.149629865G>T	ENSP00000261793:p.Ser275Tyr	106.0	0.0		80.0	26.0	NM_171825	Q9UL21|Q9Y2H4|Q9Y352	Missense_Mutation	SNP	ENST00000348628.6	37	CCDS43386.1	.	.	.	.	.	.	.	.	.	.	G	33	5.201341	0.94997	.	.	ENSG00000070808	ENST00000348628;ENST00000398376	T;T	0.69306	-0.37;-0.39	5.38	5.38	0.77491	Protein kinase-like domain (1);	0.075620	0.53938	D	0.000047	T	0.81725	0.4883	M	0.82323	2.585	0.80722	D	1	D;D;D	0.58268	0.982;0.981;0.969	P;P;P	0.58331	0.837;0.822;0.692	D	0.84634	0.0691	10	0.87932	D	0	.	19.1203	0.93360	0.0:0.0:1.0:0.0	.	275;275;275	Q9UQM7-2;Q9UQM7;A8K161	.;KCC2A_HUMAN;.	Y	275	ENSP00000261793:S275Y;ENSP00000381412:S275Y	ENSP00000261793:S275Y	S	-	2	0	CAMK2A	149610058	1.000000	0.71417	1.000000	0.80357	0.950000	0.60333	9.750000	0.98875	2.539000	0.85634	0.655000	0.94253	TCC	.		0.587	CAMK2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258869.2	NM_015981	
CCDC144B	284047	ucsc.edu;bcgsc.ca	37	17	18498058	18498058	+	RNA	SNP	T	T	C			TCGA-G3-A3CJ-01A-11D-A20W-10	TCGA-G3-A3CJ-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b064bc29-9a26-41f6-b49a-ae77a15d4967	fe4fd074-ca2d-42c3-9851-1c874d1f51fd	g.chr17:18498058T>C	ENST00000442583.1	-	0	900							Q3MJ40	C144B_HUMAN	coiled-coil domain containing 144B (pseudogene)											NS(3)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(6)|ovary(1)|prostate(2)|skin(2)|urinary_tract(2)	36						TCTAAGTTGTTCATCAGCAAC	0.413																																					.		.											.	CCDC144B	70	0			.						.						21.0	46.0	38.0					17																	18498058		1730	3966	5696			284047	.			AGTTGTTCATCAG	AK093811		17p11.2	2012-11-19	2011-09-02		ENSG00000154874	ENSG00000154874			26704	pseudogene	pseudogene			"""coiled-coil domain containing 144B"""			11997339	Standard	NR_036647		Approved	FLJ36492	uc002guc.2	Q3MJ40	OTTHUMG00000059531		17.37:g.18498058T>C		137.0	2.0		243.0	32.0	.	Q6P5Q3|Q8N200	RNA	SNP	ENST00000442583.1	37																																																																																				.		0.413	CCDC144B-006	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000132102.1	NM_182568	
CCDC73	493860	broad.mit.edu;bcgsc.ca	37	11	32739625	32739625	+	Silent	SNP	T	T	C			TCGA-G3-A3CJ-01A-11D-A20W-10	TCGA-G3-A3CJ-10A-01D-A20W-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b064bc29-9a26-41f6-b49a-ae77a15d4967	fe4fd074-ca2d-42c3-9851-1c874d1f51fd	g.chr11:32739625T>C	ENST00000335185.5	-	3	247	c.204A>G	c.(202-204)caA>caG	p.Q68Q	CCDC73_ENST00000531481.1_Silent_p.Q68Q|CCDC73_ENST00000534415.1_5'UTR	NM_001008391.2	NP_001008392.2	Q6ZRK6	CCD73_HUMAN	coiled-coil domain containing 73	68										NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(9)|lung(20)|ovary(2)|prostate(2)|skin(2)|stomach(1)|urinary_tract(2)	51	Breast(20;0.112)					taCTCACCTTTTGCCATTTAA	0.398																																					p.E68E		.											.	CCDC73	91	0			c.A204G						.						151.0	154.0	153.0					11																	32739625		1863	4107	5970	SO:0001819	synonymous_variant	493860	exon3			CACCTTTTGCCAT	AK128159	CCDS41630.1	11p13	2006-02-11			ENSG00000186714	ENSG00000186714			23261	protein-coding gene	gene with protein product		612328					Standard	NM_001008391		Approved	NY-SAR-79	uc001mtv.4	Q6ZRK6	OTTHUMG00000166279	ENST00000335185.5:c.204A>G	11.37:g.32739625T>C		63.0	0.0		45.0	5.0	NM_001008391	Q6P5Q7|Q6ZMW0|Q86WE7	Silent	SNP	ENST00000335185.5	37	CCDS41630.1																																																																																			.		0.398	CCDC73-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388874.2	NM_001008391	
CCDC88A	55704	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	55536323	55536323	+	Missense_Mutation	SNP	A	A	C			TCGA-G3-A3CJ-01A-11D-A20W-10	TCGA-G3-A3CJ-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b064bc29-9a26-41f6-b49a-ae77a15d4967	fe4fd074-ca2d-42c3-9851-1c874d1f51fd	g.chr2:55536323A>C	ENST00000436346.1	-	24	4988	c.4147T>G	c.(4147-4149)Ttt>Gtt	p.F1383V	AC012358.8_ENST00000366287.4_RNA|CCDC88A_ENST00000422883.2_Missense_Mutation_p.F6V|CCDC88A_ENST00000263630.8_Missense_Mutation_p.F1383V|CCDC88A_ENST00000413716.2_Missense_Mutation_p.F1382V|CCDC88A_ENST00000336838.6_Missense_Mutation_p.F1382V	NM_001135597.1|NM_001254943.1	NP_001129069.1|NP_001241872.1	Q3V6T2	GRDN_HUMAN	coiled-coil domain containing 88A	1383					activation of protein kinase B activity (GO:0032148)|cell migration (GO:0016477)|DNA replication (GO:0006260)|lamellipodium assembly (GO:0030032)|membrane organization (GO:0061024)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cell proliferation (GO:0042127)|regulation of DNA replication (GO:0006275)|regulation of neuron projection development (GO:0010975)|regulation of protein phosphorylation (GO:0001932)|TOR signaling (GO:0031929)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|membrane (GO:0016020)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|microtubule binding (GO:0008017)|phosphatidylinositol binding (GO:0035091)|protein homodimerization activity (GO:0042803)|protein kinase B binding (GO:0043422)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(22)|lung(23)|ovary(3)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|urinary_tract(1)	69						GGGTCATAAAATTTGTATTGA	0.289																																					p.F1383V		.											.	CCDC88A	94	0			c.T4147G						.						46.0	47.0	47.0					2																	55536323		2197	4283	6480	SO:0001583	missense	55704	exon24			CATAAAATTTGTA	AB033038, AF112218	CCDS33203.1, CCDS46288.1, CCDS58710.1	2p16.3	2013-03-13	2007-05-31	2007-05-31	ENSG00000115355	ENSG00000115355			25523	protein-coding gene	gene with protein product	"""Galpha-interacting vesicle-associated protein"", ""Akt-phosphorylation enhancer"", ""girdin"", ""girders of actin filaments"""	609736	"""KIAA1212"""	KIAA1212		15749703, 15753085	Standard	NM_001135597		Approved	FLJ10392, APE, GIV, HkRP1, GRDN	uc002ryv.2	Q3V6T2	OTTHUMG00000151915	ENST00000436346.1:c.4147T>G	2.37:g.55536323A>C	ENSP00000410608:p.Phe1383Val	187.0	0.0		195.0	83.0	NM_018084	A1IGE7|B7ZM78|C9JG83|Q53SF1|Q581G3|Q5HYD0|Q7Z339|Q7Z3C5	Missense_Mutation	SNP	ENST00000436346.1	37		.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	A|A|A	24.0|24.0|24.0	4.481486|4.481486|4.481486	0.84747|0.84747|0.84747	.|.|.	.|.|.	ENSG00000115355|ENSG00000115355|ENSG00000115355	ENST00000336838;ENST00000263630;ENST00000436346;ENST00000422883;ENST00000412148;ENST00000413716;ENST00000426576|ENST00000456975|ENST00000444458	T;T;T;T;T;T|.|.	0.58210|.|.	0.35;0.35;0.35;0.35;0.35;0.35|.|.	5.84|5.84|5.84	5.84|5.84|5.84	0.93424|0.93424|0.93424	.|.|.	0.000000|.|.	0.49916|.|.	U|.|.	0.000140|.|.	T|T|T	0.76248|0.76248|0.76248	0.3961|0.3961|0.3961	M|M|M	0.76838|0.76838|0.76838	2.35|2.35|2.35	0.37274|0.37274|0.37274	D|D|D	0.907559|0.907559|0.907559	D;D;D;D;P;D;D|.|.	0.89917|.|.	0.987;0.997;0.992;1.0;0.931;0.992;0.99|.|.	P;D;P;D;P;D;P|.|.	0.85130|.|.	0.893;0.99;0.844;0.997;0.782;0.925;0.897|.|.	T|T|T	0.80329|0.80329|0.80329	-0.1428|-0.1428|-0.1428	10|5|5	0.31617|.|.	T|.|.	0.26|.|.	-17.7153|-17.7153|-17.7153	16.2055|16.2055|16.2055	0.82126|0.82126|0.82126	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.|.	1382;1383;1328;6;1383;1382;1382|.|.	B7ZM78;Q3V6T2-2;D6W5D1;B3KW94;Q3V6T2;Q3V6T2-3;Q3V6T2-4|.|.	.;.;.;.;GRDN_HUMAN;.;.|.|.	V|S|K	1382;1383;1383;6;428;1382;558|363|7	ENSP00000338728:F1382V;ENSP00000263630:F1383V;ENSP00000410608:F1383V;ENSP00000390012:F428V;ENSP00000404431:F1382V;ENSP00000405080:F558V|.|.	ENSP00000263630:F1383V|.|.	F|I|N	-|-|-	1|2|3	0|0|2	CCDC88A|CCDC88A|CCDC88A	55389827|55389827|55389827	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	1.000000|1.000000|1.000000	0.80357|0.80357|0.80357	0.991000|0.991000|0.991000	0.79684|0.79684|0.79684	9.210000|9.210000|9.210000	0.95106|0.95106|0.95106	2.226000|2.226000|2.226000	0.72624|0.72624|0.72624	0.482000|0.482000|0.482000	0.46254|0.46254|0.46254	TTT|ATT|AAT	.		0.289	CCDC88A-203	KNOWN	basic	protein_coding	protein_coding		NM_017571	
CNTRL	11064	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	123935974	123935974	+	Missense_Mutation	SNP	G	G	A	rs151059757	byFrequency	TCGA-G3-A3CJ-01A-11D-A20W-10	TCGA-G3-A3CJ-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b064bc29-9a26-41f6-b49a-ae77a15d4967	fe4fd074-ca2d-42c3-9851-1c874d1f51fd	g.chr9:123935974G>A	ENST00000373855.1	+	42	6966	c.6706G>A	c.(6706-6708)Gca>Aca	p.A2236T	CNTRL_ENST00000373845.2_3'UTR|CNTRL_ENST00000373850.1_Missense_Mutation_p.A1684T|CNTRL_ENST00000238341.5_Missense_Mutation_p.A2236T			Q7Z7A1	CNTRL_HUMAN	centriolin	2236	Sufficient for interaction with HOOK2.				cell division (GO:0051301)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)				haematopoietic_and_lymphoid_tissue(2)|large_intestine(9)|lung(2)|ovary(4)|skin(3)	20						GCGTGGAGAAGCACTCCGGGA	0.488																																					p.A2236T		.											.	CNTRL	661	0			c.G6706A						.	G	THR/ALA	4,4402	8.1+/-20.4	0,4,2199	145.0	153.0	151.0		6706	5.1	1.0	9	dbSNP_134	151	0,8600		0,0,4300	yes	missense	CNTRL	NM_007018.4	58	0,4,6499	AA,AG,GG		0.0,0.0908,0.0308	probably-damaging	2236/2326	123935974	4,13002	2203	4300	6503	SO:0001583	missense	11064	exon40			GGAGAAGCACTCC	AF513978	CCDS35118.1	9q33.2	2014-02-20	2011-05-23	2011-05-23	ENSG00000119397	ENSG00000119397			1858	protein-coding gene	gene with protein product		605496	"""centrosomal protein 1"", ""centrosomal protein 110kDa"""	CEP1, CEP110		10688839	Standard	XM_005251679		Approved		uc004bkx.1	Q7Z7A1	OTTHUMG00000020581	ENST00000373855.1:c.6706G>A	9.37:g.123935974G>A	ENSP00000362962:p.Ala2236Thr	109.0	0.0		80.0	28.0	NM_007018	A2A2Y1|B2RP67|Q3MN79|Q5FWF8|Q5JVD0|Q6MZR3|Q6PKC1|Q8TEP3|Q9Y489	Missense_Mutation	SNP	ENST00000373855.1	37	CCDS35118.1	.	.	.	.	.	.	.	.	.	.	G	24.1	4.498461	0.85069	9.08E-4	0.0	ENSG00000119397	ENST00000373855;ENST00000238341;ENST00000454238;ENST00000394368;ENST00000373850;ENST00000373845	T;T;T	0.44881	1.08;1.08;0.91	6.03	5.13	0.70059	.	.	.	.	.	T	0.47377	0.1442	M	0.61703	1.905	0.41315	D	0.987135	D	0.62365	0.991	P	0.53490	0.727	T	0.45396	-0.9264	9	0.14656	T	0.56	.	9.1873	0.37178	0.0736:0.0:0.782:0.1444	.	2236	Q7Z7A1	CNTRL_HUMAN	T	2236;2236;2236;393;1684;918	ENSP00000362962:A2236T;ENSP00000238341:A2236T;ENSP00000362956:A1684T	ENSP00000238341:A2236T	A	+	1	0	CNTRL	122975795	1.000000	0.71417	0.999000	0.59377	0.916000	0.54674	5.857000	0.69525	1.558000	0.49541	0.655000	0.94253	GCA	G|1.000;A|0.000		0.488	CNTRL-010	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250216.1	NM_007018	
COL2A1	1280	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	12	48387630	48387630	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A3CJ-01A-11D-A20W-10	TCGA-G3-A3CJ-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b064bc29-9a26-41f6-b49a-ae77a15d4967	fe4fd074-ca2d-42c3-9851-1c874d1f51fd	g.chr12:48387630C>T	ENST00000380518.3	-	14	1050	c.886G>A	c.(886-888)Gac>Aac	p.D296N	COL2A1_ENST00000337299.6_Missense_Mutation_p.D227N	NM_001844.4|NM_033150.2	NP_001835.3|NP_149162.2	P02458	CO2A1_HUMAN	collagen, type II, alpha 1	296	Triple-helical region.				axon guidance (GO:0007411)|cartilage condensation (GO:0001502)|cartilage development (GO:0051216)|cartilage development involved in endochondral bone morphogenesis (GO:0060351)|cellular response to BMP stimulus (GO:0071773)|central nervous system development (GO:0007417)|chondrocyte differentiation (GO:0002062)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|embryonic skeletal joint morphogenesis (GO:0060272)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|heart morphogenesis (GO:0003007)|inner ear morphogenesis (GO:0042472)|limb bud formation (GO:0060174)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|notochord development (GO:0030903)|otic vesicle development (GO:0071599)|palate development (GO:0060021)|proteoglycan metabolic process (GO:0006029)|regulation of gene expression (GO:0010468)|sensory perception of sound (GO:0007605)|skeletal system development (GO:0001501)|tissue homeostasis (GO:0001894)|visual perception (GO:0007601)	basement membrane (GO:0005604)|collagen type II trimer (GO:0005585)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(9)|lung(25)|ovary(1)|prostate(1)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(3)	64		Acute lymphoblastic leukemia(13;0.108)|all_hematologic(14;0.214)			Collagenase(DB00048)	TTAGCACCGTCCAGGCCTGGA	0.532																																					p.D296N		.											.	COL2A1	92	0			c.G886A						.						79.0	76.0	77.0					12																	48387630		2203	4300	6503	SO:0001583	missense	1280	exon14			CACCGTCCAGGCC	X16468	CCDS8759.1, CCDS41778.1	12q12-q13.2	2013-11-14	2008-02-04		ENSG00000139219	ENSG00000139219		"""Collagens"""	2200	protein-coding gene	gene with protein product		120140	"""collagen, type II, alpha 1 (primary osteoarthritis, spondyloepiphyseal dysplasia, congenital)"", ""arthroophthalmopathy, progressive (Stickler syndrome)"""	SEDC, AOM		1677770	Standard	NM_033150		Approved	STL1	uc001rqu.3	P02458	OTTHUMG00000149896	ENST00000380518.3:c.886G>A	12.37:g.48387630C>T	ENSP00000369889:p.Asp296Asn	253.0	0.0		170.0	70.0	NM_001844	A6NGA0|Q12985|Q14009|Q14044|Q14045|Q14046|Q14047|Q14056|Q14058|Q16672|Q1JQ82|Q2V4X7|Q6LBY1|Q6LBY2|Q6LBY3|Q96IT5|Q99227|Q9UE38|Q9UE39|Q9UE40|Q9UE41|Q9UE42|Q9UE43	Missense_Mutation	SNP	ENST00000380518.3	37	CCDS41778.1	.	.	.	.	.	.	.	.	.	.	C	15.74	2.921489	0.52653	.	.	ENSG00000139219	ENST00000380518;ENST00000395281;ENST00000337299	D;D	0.92699	-3.09;-3.09	5.12	4.22	0.49857	.	0.000000	0.85682	D	0.000000	D	0.86485	0.5944	N	0.26092	0.79	0.53688	D	0.999973	B;B	0.11235	0.003;0.004	B;B	0.15484	0.005;0.013	T	0.83200	-0.0079	10	0.72032	D	0.01	.	12.5558	0.56252	0.0:0.9185:0.0:0.0815	.	227;296	P02458-1;P02458	.;CO2A1_HUMAN	N	296;227;227	ENSP00000369889:D296N;ENSP00000338213:D227N	ENSP00000338213:D227N	D	-	1	0	COL2A1	46673897	1.000000	0.71417	0.819000	0.32651	0.778000	0.44026	5.679000	0.68160	1.384000	0.46424	0.655000	0.94253	GAC	.		0.532	COL2A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313810.2	NM_001844	
CTNNB1	1499	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	3	41266104	41266104	+	Missense_Mutation	SNP	G	G	T	rs28931589|rs121913416		TCGA-G3-A3CJ-01A-11D-A20W-10	TCGA-G3-A3CJ-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b064bc29-9a26-41f6-b49a-ae77a15d4967	fe4fd074-ca2d-42c3-9851-1c874d1f51fd	g.chr3:41266104G>T	ENST00000349496.5	+	3	381	c.101G>T	c.(100-102)gGa>gTa	p.G34V	CTNNB1_ENST00000405570.1_Missense_Mutation_p.G34V|CTNNB1_ENST00000396183.3_Missense_Mutation_p.G34V|CTNNB1_ENST00000453024.1_Missense_Mutation_p.G27V|CTNNB1_ENST00000396185.3_Missense_Mutation_p.G34V	NM_001904.3	NP_001895.1	P35222	CTNB1_HUMAN	catenin (cadherin-associated protein), beta 1, 88kDa	34			G -> E (in PTR). {ECO:0000269|PubMed:10192393}.|G -> R (in hepatocellular carcinoma). {ECO:0000269|PubMed:10435629}.|G -> V (in hepatoblastoma; dbSNP:rs28931589). {ECO:0000269|PubMed:9927029}.		adherens junction assembly (GO:0034333)|androgen receptor signaling pathway (GO:0030521)|anterior/posterior axis specification (GO:0009948)|apoptotic process (GO:0006915)|bone resorption (GO:0045453)|branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of cardiac outflow tract cell proliferation (GO:0061324)|canonical Wnt signaling pathway involved in positive regulation of epithelial to mesenchymal transition (GO:0044334)|cell adhesion (GO:0007155)|cell fate specification (GO:0001708)|cell maturation (GO:0048469)|cell-matrix adhesion (GO:0007160)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to growth factor stimulus (GO:0071363)|cellular response to indole-3-methanol (GO:0071681)|cellular response to mechanical stimulus (GO:0071260)|central nervous system vasculogenesis (GO:0022009)|cytoskeletal anchoring at plasma membrane (GO:0007016)|determination of dorsal/ventral asymmetry (GO:0048262)|dorsal/ventral axis specification (GO:0009950)|ectoderm development (GO:0007398)|embryonic axis specification (GO:0000578)|embryonic digit morphogenesis (GO:0042733)|embryonic foregut morphogenesis (GO:0048617)|embryonic forelimb morphogenesis (GO:0035115)|embryonic heart tube development (GO:0035050)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal limb joint morphogenesis (GO:0036023)|endodermal cell fate commitment (GO:0001711)|endothelial tube morphogenesis (GO:0061154)|epithelial cell differentiation involved in prostate gland development (GO:0060742)|epithelial to mesenchymal transition (GO:0001837)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|fungiform papilla formation (GO:0061198)|gastrulation with mouth forming second (GO:0001702)|genitalia morphogenesis (GO:0035112)|glial cell fate determination (GO:0007403)|hair cell differentiation (GO:0035315)|hair follicle morphogenesis (GO:0031069)|hair follicle placode formation (GO:0060789)|hindbrain development (GO:0030902)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|layer formation in cerebral cortex (GO:0021819)|lens morphogenesis in camera-type eye (GO:0002089)|liver development (GO:0001889)|lung cell differentiation (GO:0060479)|lung induction (GO:0060492)|lung-associated mesenchyme development (GO:0060484)|male genitalia development (GO:0030539)|mesenchymal cell proliferation involved in lung development (GO:0060916)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|midgut development (GO:0007494)|muscle cell differentiation (GO:0042692)|myoblast differentiation (GO:0045445)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of heart induction by canonical Wnt signaling pathway (GO:0003136)|negative regulation of neuron death (GO:1901215)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein sumoylation (GO:0033234)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephron tubule formation (GO:0072079)|neural plate development (GO:0001840)|neuron migration (GO:0001764)|odontogenesis of dentin-containing tooth (GO:0042475)|oocyte development (GO:0048599)|osteoclast differentiation (GO:0030316)|oviduct development (GO:0060066)|pancreas development (GO:0031016)|patterning of blood vessels (GO:0001569)|positive regulation of apoptotic process (GO:0043065)|positive regulation of branching involved in lung morphogenesis (GO:0061047)|positive regulation of determination of dorsal identity (GO:2000017)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of epithelial cell proliferation involved in prostate gland development (GO:0060769)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of heparan sulfate proteoglycan biosynthetic process (GO:0010909)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein heterooligomerization (GO:0051291)|protein localization to cell surface (GO:0034394)|proximal/distal pattern formation (GO:0009954)|regulation of angiogenesis (GO:0045765)|regulation of calcium ion import (GO:0090279)|regulation of centriole-centriole cohesion (GO:0030997)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of fibroblast proliferation (GO:0048145)|regulation of myelination (GO:0031641)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of protein localization to cell surface (GO:2000008)|regulation of secondary heart field cardioblast proliferation (GO:0003266)|regulation of smooth muscle cell proliferation (GO:0048660)|regulation of T cell proliferation (GO:0042129)|renal inner medulla development (GO:0072053)|renal outer medulla development (GO:0072054)|renal vesicle formation (GO:0072033)|response to cadmium ion (GO:0046686)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|Schwann cell proliferation (GO:0014010)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle cell differentiation (GO:0051145)|synapse organization (GO:0050808)|synaptic vesicle transport (GO:0048489)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tongue morphogenesis (GO:0043587)|trachea formation (GO:0060440)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	adherens junction (GO:0005912)|apical part of cell (GO:0045177)|basolateral plasma membrane (GO:0016323)|beta-catenin destruction complex (GO:0030877)|beta-catenin-TCF7L2 complex (GO:0070369)|catenin complex (GO:0016342)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell periphery (GO:0071944)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microvillus membrane (GO:0031528)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein-DNA complex (GO:0032993)|Scrib-APC-beta-catenin complex (GO:0034750)|synapse (GO:0045202)|tight junction (GO:0005923)|transcription factor complex (GO:0005667)|Z disc (GO:0030018)|zonula adherens (GO:0005915)	alpha-catenin binding (GO:0045294)|androgen receptor binding (GO:0050681)|cadherin binding (GO:0045296)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|I-SMAD binding (GO:0070411)|ion channel binding (GO:0044325)|kinase binding (GO:0019900)|nuclear hormone receptor binding (GO:0035257)|protein C-terminus binding (GO:0008022)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|R-SMAD binding (GO:0070412)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|structural molecule activity (GO:0005198)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.G34E(73)|p.G34V(72)|p.A5_A80del(53)|p.A5_Q143del(7)|p.A5_A80>D(7)|p.Q28_H134del(5)|p.?(4)|p.V22_G38del(3)|p.W25_I140del(3)|p.T3_A126del(2)|p.A5fs*7(2)|p.D32_S47del(2)|p.M5_N141>D(2)|p.L10_N141del(2)|p.A5_Y142>D(2)|p.A5_Q143>E(1)|p.A13_R151del(1)|p.D32_H36>D(1)|p.M14_S45del(1)|p.A20_N141del(1)|p.M1_A87del(1)|p.D11_Y142>H(1)|p.H24_G38del(1)|p.S23_I35del(1)|p.Y30_A97del(1)|p.V22_T102del(1)|p.A20_A80del(1)|p.V22_S71>A(1)|p.Q28_A43del(1)|p.A5_T59del(1)|p.A20_I35del(1)|p.M1_V173del(1)|p.E15_I140>V(1)|p.S23_A39del(1)|p.H24_M131del(1)|p.A21_A80del(1)|p.D32fs*9(1)|p.A5_T40del(1)|p.S29_H36del(1)|p.A5_E54del(1)|p.W25_I35del(1)|p.S33_S37del(1)|p.M8_A80del(1)|p.P16_K133del(1)|p.V22_Y64del(1)|p.Q28_Q61del(1)|p.A20_S111del(1)|p.Y30_T40del(1)|p.GIHS34?(1)|p.A5_I35del(1)|p.D32_H36del(1)|p.Y30_A80del(1)	CTNNB1/PLAG1(60)	NS(4)|adrenal_gland(103)|biliary_tract(43)|bone(21)|breast(7)|central_nervous_system(260)|cervix(9)|endometrium(293)|eye(1)|haematopoietic_and_lymphoid_tissue(60)|kidney(202)|large_intestine(269)|liver(1010)|lung(63)|oesophagus(6)|ovary(106)|pancreas(126)|parathyroid(11)|pituitary(111)|pleura(2)|prostate(31)|salivary_gland(13)|skin(103)|small_intestine(17)|soft_tissue(792)|stomach(165)|thyroid(55)|upper_aerodigestive_tract(2)|urinary_tract(8)	3893				KIRC - Kidney renal clear cell carcinoma(284;0.0028)|Kidney(284;0.00294)		CTGGACTCTGGAATCCATTCT	0.488	G34E(AGS_STOMACH)	15	"""H, Mis, T"""	PLAG1	"""colorectal, cvarian,  hepatoblastoma, others, pleomorphic salivary adenoma"""				Pilomatrixoma, Familial Clustering of																												p.G34V	Colon(6;3 56 14213 18255)	.		Dom	yes		3	3p22-p21.3	1499	"""catenin (cadherin-associated protein), beta 1"""		"""E, M, O"""	CTNNB1,gallbladder,other,0	CTNNB1	24361	276	Substitution - Missense(145)|Deletion - In frame(105)|Complex - deletion inframe(16)|Unknown(7)|Deletion - Frameshift(3)	liver(146)|endometrium(30)|large_intestine(27)|stomach(21)|central_nervous_system(20)|skin(8)|pancreas(8)|ovary(6)|small_intestine(2)|lung(2)|adrenal_gland(1)|haematopoietic_and_lymphoid_tissue(1)|biliary_tract(1)|pituitary(1)|prostate(1)|bone(1)	c.G101T						.						93.0	78.0	83.0					3																	41266104		2203	4300	6503	SO:0001583	missense	1499	exon3	Familial Cancer Database	Pilomatricoma, Familial Clustering of, Epithelioma Calcificans of Malherbe	ACTCTGGAATCCA	X87838	CCDS2694.1	3p21	2013-02-15	2002-08-29		ENSG00000168036	ENSG00000168036		"""Armadillo repeat containing"""	2514	protein-coding gene	gene with protein product		116806	"""catenin (cadherin-associated protein), beta 1 (88kD)"""	CTNNB		7829088	Standard	NM_001098210		Approved	beta-catenin, armadillo	uc003ckr.2	P35222	OTTHUMG00000131393	ENST00000349496.5:c.101G>T	3.37:g.41266104G>T	ENSP00000344456:p.Gly34Val	491.0	0.0		303.0	112.0	NM_001098209	A8K1L7|Q8NEW9|Q8NI94|Q9H391	Missense_Mutation	SNP	ENST00000349496.5	37	CCDS2694.1	.	.	.	.	.	.	.	.	.	.	G	23.7	4.450603	0.84101	.	.	ENSG00000168036	ENST00000426215;ENST00000405570;ENST00000431914;ENST00000396183;ENST00000349496;ENST00000453024;ENST00000396185;ENST00000450969;ENST00000441708	T;T;T;T;T;T;T;T;T	0.53206	0.63;0.63;0.63;0.63;0.63;0.63;0.63;0.63;0.63	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	T	0.72053	0.3413	M	0.79258	2.445	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.74188	-0.3746	10	0.87932	D	0	-31.2232	19.9596	0.97236	0.0:0.0:1.0:0.0	rs28931589	34	P35222	CTNB1_HUMAN	V	27;34;34;34;34;27;34;34;34	ENSP00000400508:G27V;ENSP00000385604:G34V;ENSP00000412219:G34V;ENSP00000379486:G34V;ENSP00000344456:G34V;ENSP00000411226:G27V;ENSP00000379488:G34V;ENSP00000409302:G34V;ENSP00000401599:G34V	ENSP00000344456:G34V	G	+	2	0	CTNNB1	41241108	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.869000	0.99810	2.726000	0.93360	0.655000	0.94253	GGA	G|1.000;T|0.000		0.488	CTNNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254182.2	NM_001098210	
COL7A1	1294	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	48608294	48608294	+	Splice_Site	SNP	C	C	T			TCGA-G3-A3CJ-01A-11D-A20W-10	TCGA-G3-A3CJ-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b064bc29-9a26-41f6-b49a-ae77a15d4967	fe4fd074-ca2d-42c3-9851-1c874d1f51fd	g.chr3:48608294C>T	ENST00000328333.8	-	94	7379	c.7272G>A	c.(7270-7272)cgG>cgA	p.R2424R	COL7A1_ENST00000454817.1_Splice_Site_p.R2392R	NM_000094.3	NP_000085.1	Q02388	CO7A1_HUMAN	collagen, type VII, alpha 1	2424	Triple-helical region.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|endodermal cell differentiation (GO:0035987)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	basement membrane (GO:0005604)|collagen type VII trimer (GO:0005590)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	serine-type endopeptidase inhibitor activity (GO:0004867)			NS(3)|breast(8)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(57)|ovary(7)|prostate(5)|skin(9)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(5)	137				BRCA - Breast invasive adenocarcinoma(193;0.000293)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)		AGCCCCTCACCCGCTCTCCAC	0.662																																					p.R2424R		.											.	COL7A1	160	0			c.G7272A						.						34.0	28.0	30.0					3																	48608294		2202	4300	6502	SO:0001630	splice_region_variant	1294	exon94			CCTCACCCGCTCT	L02870	CCDS2773.1	3p21.1	2014-09-17	2008-08-01		ENSG00000114270	ENSG00000114270		"""Collagens"", ""Fibronectin type III domain containing"""	2214	protein-coding gene	gene with protein product	"""collagen VII, alpha-1 polypeptide"", ""LC collagen"""	120120	"""epidermolysis bullosa, dystrophic, dominant and recessive"""	EBDCT, EBD1, EBR1		1871109	Standard	NM_000094		Approved		uc003ctz.2	Q02388	OTTHUMG00000133541	ENST00000328333.8:c.7272+1G>A	3.37:g.48608294C>T		210.0	0.0		173.0	74.0	NM_000094	Q14054|Q16507	Silent	SNP	ENST00000328333.8	37	CCDS2773.1																																																																																			.		0.662	COL7A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257519.1	NM_000094	Silent
CYFIP2	26999	hgsc.bcm.edu;bcgsc.ca	37	5	156721861	156721861	+	Missense_Mutation	SNP	A	A	T			TCGA-G3-A3CJ-01A-11D-A20W-10	TCGA-G3-A3CJ-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b064bc29-9a26-41f6-b49a-ae77a15d4967	fe4fd074-ca2d-42c3-9851-1c874d1f51fd	g.chr5:156721861A>T	ENST00000347377.6	+	4	708	c.277A>T	c.(277-279)Att>Ttt	p.I93F	CYFIP2_ENST00000522463.1_Intron|CYFIP2_ENST00000521420.1_Intron|CYFIP2_ENST00000377576.3_Missense_Mutation_p.I93F|CYFIP2_ENST00000442283.2_5'UTR|CYFIP2_ENST00000318218.6_Missense_Mutation_p.I93F|CYFIP2_ENST00000541131.1_Intron	NM_001037332.2	NP_001032409.2			cytoplasmic FMR1 interacting protein 2											breast(1)|endometrium(12)|kidney(2)|lung(23)	38	Renal(175;0.00212)	Medulloblastoma(196;0.0306)|all_neural(177;0.0897)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			TTCCCGGGCCATTCCCAGGTG	0.527																																					p.I93F		.											.	CYFIP2	22	0			c.A277T						.						114.0	122.0	120.0					5																	156721861		2143	4280	6423	SO:0001583	missense	26999	exon4			CGGGCCATTCCCA	AF160973	CCDS75364.1	5q34	2008-07-18				ENSG00000055163			13760	protein-coding gene	gene with protein product	"""p53 inducible protein"""	606323				11438699	Standard	NM_001037333		Approved	PIR121	uc021ygm.1	Q96F07		ENST00000347377.6:c.277A>T	5.37:g.156721861A>T	ENSP00000313567:p.Ile93Phe	327.0	0.0		237.0	24.0	NM_001037332		Missense_Mutation	SNP	ENST00000347377.6	37		.	.	.	.	.	.	.	.	.	.	A	18.19	3.569200	0.65765	.	.	ENSG00000055163	ENST00000318218;ENST00000347377;ENST00000377576	T;T;T	0.44482	0.92;0.92;0.92	4.94	4.94	0.65067	.	0.000000	0.85682	D	0.000000	T	0.45836	0.1362	M	0.79475	2.455	0.80722	D	1	P;B;P	0.38250	0.624;0.01;0.462	B;B;B	0.36534	0.188;0.026;0.227	T	0.49370	-0.8947	10	0.37606	T	0.19	-16.029	14.6003	0.68435	1.0:0.0:0.0:0.0	.	93;93;93	E7EVF4;Q96F07-2;Q96F07	.;.;CYFP2_HUMAN	F	93	ENSP00000325817:I93F;ENSP00000313567:I93F;ENSP00000366799:I93F	ENSP00000325817:I93F	I	+	1	0	CYFIP2	156654439	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.245000	0.95431	1.852000	0.53769	0.460000	0.39030	ATT	.		0.527	CYFIP2-202	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_001037332	
DHX34	9704	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	47880440	47880440	+	Missense_Mutation	SNP	T	T	A			TCGA-G3-A3CJ-01A-11D-A20W-10	TCGA-G3-A3CJ-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b064bc29-9a26-41f6-b49a-ae77a15d4967	fe4fd074-ca2d-42c3-9851-1c874d1f51fd	g.chr19:47880440T>A	ENST00000328771.4	+	13	3032	c.2683T>A	c.(2683-2685)Tgc>Agc	p.C895S		NM_014681.5	NP_055496.2	Q14147	DHX34_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 34	895					negative regulation of nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:2000623)|nuclear-transcribed mRNA catabolic process (GO:0000956)	membrane (GO:0016020)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(8)|ovary(5)|prostate(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	36		all_cancers(25;1.65e-09)|all_epithelial(76;9.95e-08)|all_lung(116;7.27e-07)|Lung NSC(112;1.6e-06)|Ovarian(192;0.0139)|all_neural(266;0.026)|Breast(70;0.0503)		all cancers(93;7.16e-05)|OV - Ovarian serous cystadenocarcinoma(262;0.000489)|GBM - Glioblastoma multiforme(486;0.00413)|Epithelial(262;0.0132)		CCTGGTGAACTGCGTCCGCAT	0.637																																					p.C895S		.											.	DHX34	231	0			c.T2683A						.						72.0	60.0	64.0					19																	47880440		2203	4300	6503	SO:0001583	missense	9704	exon13			GTGAACTGCGTCC	D50924	CCDS12700.1	19q13.3	2003-06-13	2003-06-13	2003-06-13	ENSG00000134815	ENSG00000134815		"""DEAH-boxes"""	16719	protein-coding gene	gene with protein product		615475	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 34"""	DDX34		10708517, 8590280	Standard	NM_014681		Approved	KIAA0134	uc010xyn.2	Q14147	OTTHUMG00000149959	ENST00000328771.4:c.2683T>A	19.37:g.47880440T>A	ENSP00000331907:p.Cys895Ser	134.0	0.0		76.0	30.0	NM_014681	B4DMY8	Missense_Mutation	SNP	ENST00000328771.4	37	CCDS12700.1	.	.	.	.	.	.	.	.	.	.	T	16.64	3.179885	0.57800	.	.	ENSG00000134815	ENST00000328771	T	0.02579	4.24	3.43	3.43	0.39272	Domain of unknown function DUF1605 (1);	0.229124	0.29767	N	0.011260	T	0.03783	0.0107	L	0.58669	1.825	0.51482	D	0.999926	P	0.36086	0.536	B	0.31686	0.134	T	0.50056	-0.8872	10	0.40728	T	0.16	-23.6463	11.2761	0.49168	0.0:0.0:0.0:1.0	.	895	Q14147	DHX34_HUMAN	S	895	ENSP00000331907:C895S	ENSP00000331907:C895S	C	+	1	0	DHX34	52572238	1.000000	0.71417	0.999000	0.59377	0.986000	0.74619	5.151000	0.64875	1.561000	0.49584	0.459000	0.35465	TGC	.		0.637	DHX34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000314313.3	NM_014681	
DLGAP2	9228	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	1497492	1497492	+	Silent	SNP	C	C	T	rs375164454		TCGA-G3-A3CJ-01A-11D-A20W-10	TCGA-G3-A3CJ-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b064bc29-9a26-41f6-b49a-ae77a15d4967	fe4fd074-ca2d-42c3-9851-1c874d1f51fd	g.chr8:1497492C>T	ENST00000421627.2	+	2	767	c.633C>T	c.(631-633)ccC>ccT	p.P211P		NM_004745.3	NP_004736.2	Q9P1A6	DLGP2_HUMAN	discs, large (Drosophila) homolog-associated protein 2	290					neuron-neuron synaptic transmission (GO:0007270)	cell junction (GO:0030054)|neurofilament (GO:0005883)|postsynaptic membrane (GO:0045211)				breast(1)|endometrium(6)|lung(31)|prostate(3)	41		Ovarian(12;0.0271)|Hepatocellular(245;0.0838)|Colorectal(14;0.0846)		BRCA - Breast invasive adenocarcinoma(11;0.000169)|READ - Rectum adenocarcinoma(644;0.171)		AGCCCCGGCCCGGCATGAGCA	0.706																																					p.P211P		.											.	DLGAP2	22	0			c.C633T						.	C		1,4383		0,1,2191	27.0	38.0	34.0		633	-10.8	0.0	8		34	0,8584		0,0,4292	no	coding-synonymous	DLGAP2	NM_004745.3		0,1,6483	TT,TC,CC		0.0,0.0228,0.0077		211/976	1497492	1,12967	2192	4292	6484	SO:0001819	synonymous_variant	9228	exon2			CCGGCCCGGCATG	AB000275	CCDS47760.1, CCDS75689.1	8p23	2007-12-06	2001-11-28		ENSG00000198010	ENSG00000198010			2906	protein-coding gene	gene with protein product		605438	"""discs, large (Drosophila) homolog-associated protein 2"""			9286858, 10854099	Standard	NM_004745		Approved	DAP-2	uc003wpl.4	Q9P1A6	OTTHUMG00000163599	ENST00000421627.2:c.633C>T	8.37:g.1497492C>T		103.0	0.0		61.0	42.0	NM_004745	A1QCF8|A1QCF9|A5D8Y2|O14488|O14664|Q9P1A7	Silent	SNP	ENST00000421627.2	37	CCDS47760.1	.	.	.	.	.	.	.	.	.	.	C	0.053	-1.245796	0.01481	2.28E-4	0.0	ENSG00000198010	ENST00000520901	T	0.39592	1.07	5.42	-10.8	0.00216	.	0.299402	0.37715	N	0.001974	T	0.40473	0.1118	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.69544	-0.5117	7	0.87932	D	0	-3.4284	7.252	0.26154	0.0744:0.2286:0.5326:0.1644	.	.	.	.	L	228	ENSP00000430563:P228L	ENSP00000430563:P228L	P	+	2	0	DLGAP2	1484899	0.181000	0.23161	0.000000	0.03702	0.004000	0.04260	-0.751000	0.04803	-2.976000	0.00284	-2.530000	0.00182	CCG	.		0.706	DLGAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374478.1	NM_004745	
DLGAP5	9787	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	55647496	55647496	+	Splice_Site	SNP	A	A	G			TCGA-G3-A3CJ-01A-11D-A20W-10	TCGA-G3-A3CJ-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b064bc29-9a26-41f6-b49a-ae77a15d4967	fe4fd074-ca2d-42c3-9851-1c874d1f51fd	g.chr14:55647496A>G	ENST00000247191.2	-	6	797	c.581T>C	c.(580-582)gTt>gCt	p.V194A	DLGAP5_ENST00000395425.2_Splice_Site_p.V194A	NM_014750.4	NP_055565.3	Q15398	DLGP5_HUMAN	discs, large (Drosophila) homolog-associated protein 5	194					cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|dephosphorylation (GO:0016311)|mitotic chromosome movement towards spindle pole (GO:0007079)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)	cytoplasm (GO:0005737)|microtubule organizing center (GO:0005815)|nucleus (GO:0005634)|spindle pole centrosome (GO:0031616)	phosphoprotein phosphatase activity (GO:0004721)			biliary_tract(1)|breast(2)|cervix(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(8)|lung(10)|ovary(2)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	44						AGGCTGCACAACTGTGGGAAA	0.453																																					p.V194A		.											.	DLGAP5	92	0			c.T581C						.						132.0	121.0	124.0					14																	55647496		2203	4300	6503	SO:0001630	splice_region_variant	9787	exon6			TGCACAACTGTGG	D13633	CCDS9723.1, CCDS53897.1	14q22.3	2008-05-30	2008-05-30	2008-05-30	ENSG00000126787	ENSG00000126787			16864	protein-coding gene	gene with protein product			"""discs, large homolog 7 (Drosophila)"""	DLG7		7584026, 7584028	Standard	NM_014750		Approved	KIAA0008, DLG1, HURP	uc001xbs.3	Q15398	OTTHUMG00000140310	ENST00000247191.2:c.581-1T>C	14.37:g.55647496A>G		172.0	0.0		126.0	48.0	NM_014750	A8MTM6|B4DRM8|Q86T11|Q8NG58	Missense_Mutation	SNP	ENST00000247191.2	37	CCDS9723.1	.	.	.	.	.	.	.	.	.	.	A	2.792	-0.251016	0.05867	.	.	ENSG00000126787	ENST00000395425;ENST00000247191;ENST00000557645	T;T;T	0.19806	2.12;2.12;2.12	5.03	1.91	0.25777	.	1.660750	0.03176	N	0.171367	T	0.12092	0.0294	N	0.17082	0.46	0.23966	N	0.996324	B;B	0.19200	0.007;0.034	B;B	0.15052	0.006;0.012	T	0.24261	-1.0165	10	0.07325	T	0.83	.	5.2921	0.15733	0.6005:0.0:0.3994:0.0	.	194;194	A8MTM6;Q15398	.;DLGP5_HUMAN	A	194	ENSP00000378815:V194A;ENSP00000247191:V194A;ENSP00000451747:V194A	ENSP00000247191:V194A	V	-	2	0	DLGAP5	54717249	0.004000	0.15560	0.083000	0.20561	0.004000	0.04260	-0.405000	0.07196	0.139000	0.18822	0.533000	0.62120	GTT	.		0.453	DLGAP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276908.2	NM_014750	Missense_Mutation
DMKN	93099	ucsc.edu;bcgsc.ca	37	19	36000834	36000834	+	Silent	SNP	C	C	T			TCGA-G3-A3CJ-01A-11D-A20W-10	TCGA-G3-A3CJ-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b064bc29-9a26-41f6-b49a-ae77a15d4967	fe4fd074-ca2d-42c3-9851-1c874d1f51fd	g.chr19:36000834C>T	ENST00000339686.3	-	7	1193	c.1017G>A	c.(1015-1017)ggG>ggA	p.G339G	DMKN_ENST00000451297.2_Intron|DMKN_ENST00000419602.1_Silent_p.G278G|DMKN_ENST00000436012.1_Intron|DMKN_ENST00000462126.1_Intron|DMKN_ENST00000472252.2_Intron|DMKN_ENST00000424570.2_Silent_p.G339G|DMKN_ENST00000443640.1_Silent_p.G52G|DMKN_ENST00000414866.2_Silent_p.G52G|DMKN_ENST00000480502.1_Silent_p.G52G|DMKN_ENST00000488892.1_Intron|DMKN_ENST00000461300.1_Intron|DMKN_ENST00000474928.1_5'UTR|DMKN_ENST00000429837.1_Silent_p.G278G|DMKN_ENST00000440396.1_Silent_p.G339G|DMKN_ENST00000402589.2_Silent_p.G52G|DMKN_ENST00000418261.1_Silent_p.G339G|DMKN_ENST00000447113.2_Silent_p.G339G|DMKN_ENST00000492341.2_Intron|DMKN_ENST00000392206.2_Silent_p.G52G|DMKN_ENST00000602781.1_Silent_p.G52G|DMKN_ENST00000467637.1_Silent_p.G52G|DMKN_ENST00000458071.1_Silent_p.G52G	NM_033317.4	NP_201574	Q6E0U4	DMKN_HUMAN	dermokine	339	Gly-rich.					extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)				NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(7)|ovary(1)|prostate(1)|skin(2)	27	all_lung(56;1.89e-08)|Lung NSC(56;2.9e-08)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0724)			ATTCCCCGCTCCCGCGGGCTT	0.592											OREG0025431	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.G339G		.											.	DMKN	155	0			c.G1017A						.						74.0	78.0	77.0					19																	36000834		2203	4300	6503	SO:0001819	synonymous_variant	93099	exon7			CCCGCTCCCGCGG	BC035311	CCDS12463.1, CCDS42549.1, CCDS46051.1, CCDS46052.1, CCDS46053.1, CCDS46054.1, CCDS46054.2, CCDS54250.1, CCDS54251.1, CCDS54252.1	19q13.12	2008-10-27			ENSG00000161249	ENSG00000161249			25063	protein-coding gene	gene with protein product						16374476	Standard	NM_001035516		Approved	ZD52F10	uc002nzm.4	Q6E0U4	OTTHUMG00000048101	ENST00000339686.3:c.1017G>A	19.37:g.36000834C>T		174.0	1.0	859	81.0	35.0	NM_001126058	A3EZ79|A3EZ80|A3EZ81|A3EZ82|A3EZ83|C9J4P6|C9J5N8|C9JAL3|Q32W58|Q32W62|Q32W63|Q32W64|Q32W65|Q32W66|Q32W67|Q6E0U5|Q6UXC7|Q96EW8|Q9BSY6	Silent	SNP	ENST00000339686.3	37	CCDS12463.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	0.396|0.396	-0.920949|-0.920949	0.02396|0.02396	.|.	.|.	ENSG00000161249|ENSG00000161249	ENST00000434389|ENST00000443857	.|.	.|.	.|.	3.97|3.97	-0.832|-0.832	0.10785|0.10785	.|.	.|0.867999	.|0.09575	.|N	.|0.783606	T|T	0.27594|0.27594	0.0678|0.0678	.|.	.|.	.|.	0.09310|0.09310	N|N	0.999994|0.999994	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.33471|0.33471	-0.9867|-0.9867	4|6	.|0.49607	.|T	.|0.09	0.1426|0.1426	3.0535|3.0535	0.06176|0.06176	0.1902:0.467:0.0:0.3428|0.1902:0.467:0.0:0.3428	.|.	.|.	.|.	.|.	K|E	20|13	.|.	.|ENSP00000398405:G13E	E|G	-|-	1|2	0|0	DMKN|DMKN	40692674|40692674	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.003000|0.003000	0.03518|0.03518	-2.038000|-2.038000	0.01419|0.01419	-0.027000|-0.027000	0.13873|0.13873	0.491000|0.491000	0.48974|0.48974	GAG|GGA	.		0.592	DMKN-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000109461.2	NM_033317	
DNAH8	1769	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	38690855	38690855	+	5'Flank	SNP	G	G	A	rs180723141	byFrequency	TCGA-G3-A3CJ-01A-11D-A20W-10	TCGA-G3-A3CJ-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b064bc29-9a26-41f6-b49a-ae77a15d4967	fe4fd074-ca2d-42c3-9851-1c874d1f51fd	g.chr6:38690855G>A	ENST00000359357.3	+	0	0				DNAH8_ENST00000449981.2_Silent_p.P90P			Q96JB1	DYH8_HUMAN	dynein, axonemal, heavy chain 8						cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.P90P(1)		NS(7)|breast(9)|central_nervous_system(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(3)|kidney(16)|large_intestine(44)|liver(4)|lung(101)|ovary(7)|pancreas(2)|prostate(8)|skin(28)|stomach(4)|upper_aerodigestive_tract(6)|urinary_tract(4)	260						GGCTTGCACCGCGACCGGTTC	0.527																																					p.P90P		.											.	DNAH8	615	1	Substitution - coding silent(1)	large_intestine(1)	c.G270A						.						108.0	98.0	101.0					6																	38690855		876	1991	2867	SO:0001631	upstream_gene_variant	1769	exon2			TGCACCGCGACCG	Z83806	CCDS75447.1	6p21.2	2012-04-19	2006-09-04		ENSG00000124721	ENSG00000124721		"""Axonemal dyneins"""	2952	protein-coding gene	gene with protein product		603337	"""dynein, axonemal, heavy polypeptide 8"""			9373155	Standard	NM_001206927		Approved	hdhc9	uc021yzh.1	Q96JB1	OTTHUMG00000016253		6.37:g.38690855G>A	Exception_encountered	168.0	0.0		118.0	44.0	NM_001206927	O00438|Q5JYI2|Q5T2M3|Q5T2M4|Q5TG00|Q9UEM4	Silent	SNP	ENST00000359357.3	37																																																																																				G|0.997;C|0.003		0.527	DNAH8-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000043574.1	NM_001206927	
ECHDC3	79746	broad.mit.edu;ucsc.edu;mdanderson.org	37	10	11805436	11805436	+	Missense_Mutation	SNP	C	C	G			TCGA-G3-A3CJ-01A-11D-A20W-10	TCGA-G3-A3CJ-10A-01D-A20W-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b064bc29-9a26-41f6-b49a-ae77a15d4967	fe4fd074-ca2d-42c3-9851-1c874d1f51fd	g.chr10:11805436C>G	ENST00000379215.4	+	5	1016	c.805C>G	c.(805-807)Ctc>Gtc	p.L269V	ECHDC3_ENST00000496136.1_3'UTR	NM_024693.4	NP_078969	Q96DC8	ECHD3_HUMAN	enoyl CoA hydratase domain containing 3	269						mitochondrion (GO:0005739)	catalytic activity (GO:0003824)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)	4						GGCTTACTACCTCACCTCCCA	0.632																																					p.L269V		.											.	ECHDC3	90	0			c.C805G						.						42.0	36.0	38.0					10																	11805436		2203	4300	6503	SO:0001583	missense	79746	exon5			TACTACCTCACCT	AF275677	CCDS7084.1	10p14	2010-04-30	2010-04-30		ENSG00000134463	ENSG00000134463			23489	protein-coding gene	gene with protein product			"""enoyl Coenzyme A hydratase domain containing 3"""			12477932	Standard	NM_024693		Approved	FLJ20909	uc001ikw.4	Q96DC8	OTTHUMG00000017675	ENST00000379215.4:c.805C>G	10.37:g.11805436C>G	ENSP00000368517:p.Leu269Val	19.0	0.0		14.0	8.0	NM_024693	Q53HR9|Q5W0J7|Q8WYY8|Q9BVL8|Q9H7G4	Missense_Mutation	SNP	ENST00000379215.4	37	CCDS7084.1	.	.	.	.	.	.	.	.	.	.	C	10.58	1.391327	0.25118	.	.	ENSG00000134463	ENST00000379215	T	0.68025	-0.3	5.73	5.73	0.89815	.	0.119726	0.56097	D	0.000030	T	0.65749	0.2721	M	0.66297	2.02	0.28320	N	0.922283	B	0.18166	0.026	B	0.20384	0.029	T	0.60383	-0.7274	10	0.44086	T	0.13	.	14.3734	0.66857	0.1572:0.8428:0.0:0.0	.	269	Q96DC8	ECHD3_HUMAN	V	269	ENSP00000368517:L269V	ENSP00000368517:L269V	L	+	1	0	ECHDC3	11845442	0.996000	0.38824	0.673000	0.29887	0.709000	0.40893	2.466000	0.45084	2.706000	0.92434	0.561000	0.74099	CTC	.		0.632	ECHDC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046771.1	NM_024693	
ERI1	90459	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	8865648	8865648	+	Missense_Mutation	SNP	C	C	G			TCGA-G3-A3CJ-01A-11D-A20W-10	TCGA-G3-A3CJ-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b064bc29-9a26-41f6-b49a-ae77a15d4967	fe4fd074-ca2d-42c3-9851-1c874d1f51fd	g.chr8:8865648C>G	ENST00000523898.1	+	3	956	c.277C>G	c.(277-279)Ctt>Gtt	p.L93V	ERI1_ENST00000250263.7_Missense_Mutation_p.L93V|ERI1_ENST00000519292.1_Missense_Mutation_p.L93V			Q8IV48	ERI1_HUMAN	exoribonuclease 1	93	SAP. {ECO:0000255|PROSITE- ProRule:PRU00186}.				gene silencing by RNA (GO:0031047)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|rRNA 3'-end processing (GO:0031125)	cytoplasm (GO:0005737)|histone pre-mRNA 3'end processing complex (GO:0071204)|nucleolus (GO:0005730)|nucleus (GO:0005634)	3'-5' exonuclease activity (GO:0008408)|histone pre-mRNA stem-loop binding (GO:0071207)|metal ion binding (GO:0046872)|ribosome binding (GO:0043022)|rRNA binding (GO:0019843)			NS(1)|endometrium(2)|large_intestine(1)|lung(6)|prostate(1)	11						AGAATTCAAGCTTGAAACTAG	0.294																																					p.L93V		.											.	ERI1	68	0			c.C277G						.						35.0	37.0	37.0					8																	8865648		2203	4297	6500	SO:0001583	missense	90459	exon2			TTCAAGCTTGAAA	BC035279	CCDS5972.1	8p23.1	2008-12-16	2008-12-16	2008-12-16	ENSG00000104626	ENSG00000104626		"""Enhanced RNAi three prime mRNA exonucleases"""	23994	protein-coding gene	gene with protein product	"""exoribonuclease 1"", ""enhanced RNAi three prime mRNA exonuclease homolog 1 (C.elegans)"""	608739	"""three prime histone mRNA exonuclease 1"""	THEX1		14536070	Standard	NM_153332		Approved	3'HEXO	uc003wsk.2	Q8IV48	OTTHUMG00000129328	ENST00000523898.1:c.277C>G	8.37:g.8865648C>G	ENSP00000429615:p.Leu93Val	77.0	0.0		50.0	31.0	NM_153332	A8K4U7|Q9NSX3	Missense_Mutation	SNP	ENST00000523898.1	37	CCDS5972.1	.	.	.	.	.	.	.	.	.	.	C	19.46	3.831148	0.71258	.	.	ENSG00000104626	ENST00000523898;ENST00000250263;ENST00000519292	T;T;T	0.53857	0.6;0.6;0.6	4.82	4.82	0.62117	DNA-binding SAP (3);	0.000000	0.85682	D	0.000000	T	0.58821	0.2149	L	0.59436	1.845	0.80722	D	1	P	0.34684	0.463	B	0.42959	0.403	T	0.62483	-0.6845	10	0.54805	T	0.06	-21.7298	17.2738	0.87109	0.0:1.0:0.0:0.0	.	93	Q8IV48	ERI1_HUMAN	V	93	ENSP00000429615:L93V;ENSP00000250263:L93V;ENSP00000430190:L93V	ENSP00000250263:L93V	L	+	1	0	ERI1	8903058	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.304000	0.78882	2.374000	0.81015	0.563000	0.77884	CTT	.		0.294	ERI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251471.2	NM_153332	
FBXL4	26235	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	99328458	99328458	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A3CJ-01A-11D-A20W-10	TCGA-G3-A3CJ-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b064bc29-9a26-41f6-b49a-ae77a15d4967	fe4fd074-ca2d-42c3-9851-1c874d1f51fd	g.chr6:99328458G>T	ENST00000369244.2	-	8	1788	c.1360C>A	c.(1360-1362)Cag>Aag	p.Q454K	FBXL4_ENST00000229971.1_Missense_Mutation_p.Q454K	NM_001278716.1	NP_001265645.1	Q9UKA2	FBXL4_HUMAN	F-box and leucine-rich repeat protein 4	454					ubiquitin-dependent protein catabolic process (GO:0006511)	mitochondrial intermembrane space (GO:0005758)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)				central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(4)|prostate(3)|skin(2)	18		all_cancers(76;1.56e-06)|Acute lymphoblastic leukemia(125;4.93e-10)|all_hematologic(75;3.55e-07)|all_epithelial(107;0.00893)|Colorectal(196;0.069)|Lung NSC(302;0.197)		BRCA - Breast invasive adenocarcinoma(108;0.0413)		CTGAGGTGCTGAAGCTCTGAA	0.393																																					p.Q454K		.											.	FBXL4	227	0			c.C1360A						.						109.0	92.0	98.0					6																	99328458		2203	4300	6503	SO:0001583	missense	26235	exon7			GGTGCTGAAGCTC	AF176699	CCDS5041.1	6q16.1-q16.3	2011-06-09			ENSG00000112234	ENSG00000112234		"""F-boxes / Leucine-rich repeats"""	13601	protein-coding gene	gene with protein product		605654				10531035	Standard	NM_012160		Approved	FBL4, FBL5	uc003ppf.1	Q9UKA2	OTTHUMG00000015259	ENST00000369244.2:c.1360C>A	6.37:g.99328458G>T	ENSP00000358247:p.Gln454Lys	78.0	0.0		77.0	28.0	NM_012160	B2R7Q5|E1P530|O95919|Q5BJH0|Q9UJU0	Missense_Mutation	SNP	ENST00000369244.2	37	CCDS5041.1	.	.	.	.	.	.	.	.	.	.	G	8.948	0.967438	0.18659	.	.	ENSG00000112234	ENST00000369244;ENST00000229971	T;T	0.17213	2.29;2.29	5.58	5.58	0.84498	.	0.104710	0.64402	D	0.000003	T	0.05181	0.0138	L	0.28192	0.835	0.45607	D	0.998547	B	0.06786	0.001	B	0.08055	0.003	T	0.27571	-1.0070	10	0.16896	T	0.51	.	12.8495	0.57850	0.0744:0.0:0.9256:0.0	.	454	Q9UKA2	FBXL4_HUMAN	K	454	ENSP00000358247:Q454K;ENSP00000229971:Q454K	ENSP00000229971:Q454K	Q	-	1	0	FBXL4	99435179	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.673000	0.61604	2.650000	0.89964	0.591000	0.81541	CAG	.		0.393	FBXL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041587.2		
GABRG2	2566	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	5	161569294	161569294	+	Silent	SNP	G	G	A			TCGA-G3-A3CJ-01A-11D-A20W-10	TCGA-G3-A3CJ-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b064bc29-9a26-41f6-b49a-ae77a15d4967	fe4fd074-ca2d-42c3-9851-1c874d1f51fd	g.chr5:161569294G>A	ENST00000361925.4	+	7	1114	c.894G>A	c.(892-894)aaG>aaA	p.K298K	GABRG2_ENST00000393933.4_Silent_p.K203K|GABRG2_ENST00000414552.2_Silent_p.K338K|GABRG2_ENST00000356592.3_Silent_p.K298K			P18507	GBRG2_HUMAN	gamma-aminobutyric acid (GABA) A receptor, gamma 2	298					adult behavior (GO:0030534)|cellular response to histamine (GO:0071420)|chloride transmembrane transport (GO:1902476)|gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|post-embryonic development (GO:0009791)|synaptic transmission (GO:0007268)|synaptic transmission, GABAergic (GO:0051932)|transmembrane transport (GO:0055085)|transport (GO:0006810)	axon (GO:0030424)|cell junction (GO:0030054)|chloride channel complex (GO:0034707)|cytoplasm (GO:0005737)|dendrite membrane (GO:0032590)|GABA-A receptor complex (GO:1902711)|inhibitory synapse (GO:0060077)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	benzodiazepine receptor activity (GO:0008503)|chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			NS(1)|breast(1)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(15)|lung(24)|ovary(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	62	Renal(175;0.000319)	Medulloblastoma(196;0.0208)|all_neural(177;0.0672)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0734)|OV - Ovarian serous cystadenocarcinoma(192;0.135)|Epithelial(171;0.136)	Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Ginkgo biloba(DB01381)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	GGATCAATAAGGATGCTGTTC	0.403																																					p.K338K		.											.	GABRG2	95	0			c.G1014A						.						218.0	183.0	195.0					5																	161569294		2203	4300	6503	SO:0001819	synonymous_variant	2566	exon8			CAATAAGGATGCT		CCDS4358.1, CCDS4359.1, CCDS47333.1	5q34	2012-06-22			ENSG00000113327	ENSG00000113327		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4087	protein-coding gene	gene with protein product	"""GABA(A) receptor, gamma 2"""	137164					Standard	NM_198904		Approved		uc010jjc.3	P18507	OTTHUMG00000130350	ENST00000361925.4:c.894G>A	5.37:g.161569294G>A		240.0	0.0		167.0	63.0	NM_198903	F5HB82|Q6GRL6|Q6PCC3|Q9UDB3|Q9UN15	Silent	SNP	ENST00000361925.4	37	CCDS4358.1																																																																																			.		0.403	GABRG2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000252706.1		
GCLM	2730	ucsc.edu;bcgsc.ca;mdanderson.org	37	1	94354636	94354636	+	Silent	SNP	C	C	T	rs79501187	byFrequency	TCGA-G3-A3CJ-01A-11D-A20W-10	TCGA-G3-A3CJ-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b064bc29-9a26-41f6-b49a-ae77a15d4967	fe4fd074-ca2d-42c3-9851-1c874d1f51fd	g.chr1:94354636C>T	ENST00000370238.3	-	7	981	c.735G>A	c.(733-735)ctG>ctA	p.L245L		NM_002061.2	NP_002052.1	P48507	GSH0_HUMAN	glutamate-cysteine ligase, modifier subunit	245					apoptotic mitochondrial changes (GO:0008637)|cellular nitrogen compound metabolic process (GO:0034641)|cysteine metabolic process (GO:0006534)|glutamate metabolic process (GO:0006536)|glutathione biosynthetic process (GO:0006750)|glutathione derivative biosynthetic process (GO:1901687)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of neuron apoptotic process (GO:0043524)|positive regulation of glutamate-cysteine ligase activity (GO:0035229)|regulation of blood vessel size (GO:0050880)|regulation of mitochondrial depolarization (GO:0051900)|response to drug (GO:0042493)|response to nitrosative stress (GO:0051409)|response to oxidative stress (GO:0006979)|small molecule metabolic process (GO:0044281)|sulfur amino acid metabolic process (GO:0000096)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)|glutamate-cysteine ligase complex (GO:0017109)	glutamate-cysteine ligase activity (GO:0004357)|glutamate-cysteine ligase catalytic subunit binding (GO:0035226)			endometrium(2)|kidney(1)|large_intestine(1)|lung(3)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	10		all_lung(203;0.000815)|Lung NSC(277;0.00363)		all cancers(265;0.00566)|GBM - Glioblastoma multiforme(16;0.0203)|Epithelial(280;0.131)	L-Cysteine(DB00151)	GCAGTAGCCACAGCGGCACCC	0.418																																					p.L245L		.											.	GCLM	91	0			c.G735A						.						57.0	65.0	62.0					1																	94354636		2203	4300	6503	SO:0001819	synonymous_variant	2730	exon7			TAGCCACAGCGGC	L35546	CCDS746.1	1p21	2008-02-05			ENSG00000023909	ENSG00000023909	6.3.2.2		4312	protein-coding gene	gene with protein product	"""gamma-glutamylcysteine synthetase"""	601176		GLCLR		7826375	Standard	NM_002061		Approved		uc001dqg.1	P48507	OTTHUMG00000010562	ENST00000370238.3:c.735G>A	1.37:g.94354636C>T		163.0	1.0		91.0	32.0	NM_002061	A8K334|D3DT45|M5A959|Q6FHC1|Q9NPX9|Q9NU74	Silent	SNP	ENST00000370238.3	37	CCDS746.1																																																																																			C|0.996;G|0.004		0.418	GCLM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029169.1	NM_002061	
GCN1L1	10985	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	120582745	120582745	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A3CJ-01A-11D-A20W-10	TCGA-G3-A3CJ-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b064bc29-9a26-41f6-b49a-ae77a15d4967	fe4fd074-ca2d-42c3-9851-1c874d1f51fd	g.chr12:120582745G>T	ENST00000300648.6	-	40	5149	c.5137C>A	c.(5137-5139)Cgc>Agc	p.R1713S		NM_006836.1	NP_006827	Q92616	GCN1L_HUMAN	GCN1 general control of amino-acid synthesis 1-like 1 (yeast)	1713					regulation of translation (GO:0006417)|translation (GO:0006412)	cytoplasm (GO:0005737)|membrane (GO:0016020)|ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)|translation factor activity, nucleic acid binding (GO:0008135)			NS(2)|breast(2)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(13)|liver(1)|lung(36)|ovary(4)|prostate(7)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	94	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					GCGCCTGAGCGATCCACAGAG	0.602																																					p.R1713S		.											.	GCN1L1	94	0			c.C5137A						.						73.0	78.0	76.0					12																	120582745		2129	4250	6379	SO:0001583	missense	10985	exon40			CTGAGCGATCCAC	U77700	CCDS41847.1	12q24.2	2008-07-03	2001-11-28						4199	protein-coding gene	gene with protein product		605614	"""GCN1 (general control of amino-acid synthesis 1, yeast)-like 1"""			9234705	Standard	NM_006836		Approved	KIAA0219, GCN1, GCN1L	uc001txo.3	Q92616	OTTHUMG00000169338	ENST00000300648.6:c.5137C>A	12.37:g.120582745G>T	ENSP00000300648:p.Arg1713Ser	129.0	0.0		87.0	34.0	NM_006836	A8KAY1|O95001|O95651|Q6P2S3|Q86X65|Q8N5I5|Q8WU80|Q99736|Q9UE60	Missense_Mutation	SNP	ENST00000300648.6	37	CCDS41847.1	.	.	.	.	.	.	.	.	.	.	G	29.4	5.004690	0.93287	.	.	ENSG00000089154	ENST00000300648	T	0.67523	-0.27	5.5	5.5	0.81552	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	D	0.87253	0.6131	M	0.93375	3.41	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.89906	0.4048	10	0.87932	D	0	-16.5971	19.7578	0.96301	0.0:0.0:1.0:0.0	.	1713	Q92616	GCN1L_HUMAN	S	1713	ENSP00000300648:R1713S	ENSP00000300648:R1713S	R	-	1	0	GCN1L1	119067128	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	9.554000	0.98121	2.748000	0.94277	0.655000	0.94253	CGC	.		0.602	GCN1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403592.1		
GPRASP2	114928	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	101971961	101971961	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A3CJ-01A-11D-A20W-10	TCGA-G3-A3CJ-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b064bc29-9a26-41f6-b49a-ae77a15d4967	fe4fd074-ca2d-42c3-9851-1c874d1f51fd	g.chrX:101971961G>A	ENST00000535209.1	+	4	2995	c.2164G>A	c.(2164-2166)Ggg>Agg	p.G722R	GPRASP2_ENST00000543253.1_Missense_Mutation_p.G722R|GPRASP2_ENST00000332262.5_Missense_Mutation_p.G722R			Q96D09	GASP2_HUMAN	G protein-coupled receptor associated sorting protein 2	722						cytoplasm (GO:0005737)	beta-amyloid binding (GO:0001540)			breast(3)|endometrium(5)|kidney(2)|large_intestine(6)|lung(12)|ovary(1)|upper_aerodigestive_tract(1)	30						CTATATGTCCGGGTTTCTCTC	0.413																																					p.G722R		.											.	GPRASP2	131	0			c.G2164A						.						103.0	93.0	97.0					X																	101971961		2203	4300	6503	SO:0001583	missense	114928	exon4			ATGTCCGGGTTTC	AK094646	CCDS14501.1	Xq22.1	2014-03-21			ENSG00000158301	ENSG00000158301		"""Armadillo repeat containing"""	25169	protein-coding gene	gene with protein product						15086532, 16221301	Standard	NM_138437		Approved	GASP2, FLJ37327		Q96D09	OTTHUMG00000022059	ENST00000535209.1:c.2164G>A	X.37:g.101971961G>A	ENSP00000437394:p.Gly722Arg	215.0	0.0		167.0	138.0	NM_138437	D3DXA0|Q8NAB4	Missense_Mutation	SNP	ENST00000535209.1	37	CCDS14501.1	.	.	.	.	.	.	.	.	.	.	G	11.37	1.619652	0.28801	.	.	ENSG00000158301	ENST00000543253;ENST00000535209;ENST00000332262	T;T;T	0.28666	1.6;1.6;1.6	4.31	4.31	0.51392	Armadillo-like helical (1);Armadillo-type fold (1);	0.150817	0.31279	N	0.007934	T	0.49541	0.1563	M	0.69823	2.125	0.24777	N	0.992834	D	0.89917	1.0	D	0.73708	0.981	T	0.35051	-0.9804	10	0.28530	T	0.3	.	11.1272	0.48325	0.0:0.0:1.0:0.0	.	722	Q96D09	GASP2_HUMAN	R	722	ENSP00000437872:G722R;ENSP00000437394:G722R;ENSP00000339057:G722R	ENSP00000339057:G722R	G	+	1	0	GPRASP2	101858617	0.940000	0.31905	0.596000	0.28811	0.313000	0.28021	3.680000	0.54641	2.394000	0.81467	0.513000	0.50165	GGG	.		0.413	GPRASP2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057626.2	NM_138437	
GSK3A	2931	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	19	42736820	42736820	+	Silent	SNP	T	T	G			TCGA-G3-A3CJ-01A-11D-A20W-10	TCGA-G3-A3CJ-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b064bc29-9a26-41f6-b49a-ae77a15d4967	fe4fd074-ca2d-42c3-9851-1c874d1f51fd	g.chr19:42736820T>G	ENST00000222330.3	-	9	1240	c.1113A>C	c.(1111-1113)cgA>cgC	p.R371R	GSK3A_ENST00000398249.4_Silent_p.R289R	NM_019884.2	NP_063937.2	P49840	GSK3A_HUMAN	glycogen synthase kinase 3 alpha	371	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cardiac left ventricle morphogenesis (GO:0003214)|cell migration (GO:0016477)|cellular protein metabolic process (GO:0044267)|cellular response to insulin stimulus (GO:0032869)|cellular response to interleukin-3 (GO:0036016)|cellular response to lithium ion (GO:0071285)|cellular response to organic cyclic compound (GO:0071407)|endoplasmic reticulum unfolded protein response (GO:0030968)|epidermal growth factor receptor signaling pathway (GO:0007173)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glycogen metabolic process (GO:0005977)|hypermethylation of CpG island (GO:0044027)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell growth involved in cardiac muscle cell development (GO:0061052)|negative regulation of glucose import (GO:0046325)|negative regulation of glycogen (starch) synthase activity (GO:2000466)|negative regulation of glycogen biosynthetic process (GO:0045719)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of TOR signaling (GO:0032007)|negative regulation of transferase activity (GO:0051348)|negative regulation of type B pancreatic cell development (GO:2000077)|negative regulation of UDP-glucose catabolic process (GO:0010905)|nervous system development (GO:0007399)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of adrenergic receptor signaling pathway (GO:0071879)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of glycogen (starch) synthase activity (GO:2000467)|positive regulation of heart contraction (GO:0045823)|positive regulation of mitochondrial outer membrane permeabilization involved in apoptotic signaling pathway (GO:1901030)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein phosphorylation (GO:0006468)|regulation of gene expression by genetic imprinting (GO:0006349)|regulation of systemic arterial blood pressure (GO:0003073)|Wnt signaling pathway (GO:0016055)	beta-catenin destruction complex (GO:0030877)|cytosol (GO:0005829)	ATP binding (GO:0005524)|protein kinase A catalytic subunit binding (GO:0034236)|protein serine/threonine kinase activity (GO:0004674)|tau-protein kinase activity (GO:0050321)			endometrium(3)|large_intestine(3)|lung(6)|ovary(3)|prostate(2)|skin(1)|urinary_tract(1)	19		Prostate(69;0.00682)				CTGGCGGCGTTCGAGATTTGA	0.597																																					p.R371R		.											.	GSK3A	981	0			c.A1113C						.						50.0	51.0	51.0					19																	42736820		2203	4300	6503	SO:0001819	synonymous_variant	2931	exon9			CGGCGTTCGAGAT		CCDS12599.1	19q13	2008-02-15			ENSG00000105723	ENSG00000105723			4616	protein-coding gene	gene with protein product		606784				9809441	Standard	NM_019884		Approved		uc002otb.1	P49840	OTTHUMG00000150722	ENST00000222330.3:c.1113A>C	19.37:g.42736820T>G		126.0	0.0		130.0	59.0	NM_019884	O14959	Silent	SNP	ENST00000222330.3	37	CCDS12599.1																																																																																			.		0.597	GSK3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319782.1		
HELZ2	85441	broad.mit.edu;mdanderson.org	37	20	62203679	62203679	+	Silent	SNP	G	G	T			TCGA-G3-A3CJ-01A-11D-A20W-10	TCGA-G3-A3CJ-10A-01D-A20W-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b064bc29-9a26-41f6-b49a-ae77a15d4967	fe4fd074-ca2d-42c3-9851-1c874d1f51fd	g.chr20:62203679G>T	ENST00000467148.1	-	1	129	c.60C>A	c.(58-60)ccC>ccA	p.P20P	HELZ2_ENST00000479540.1_5'UTR	NM_001037335.2	NP_001032412.2	Q9BYK8	HELZ2_HUMAN	helicase with zinc finger 2, transcriptional coactivator	20					cellular lipid metabolic process (GO:0044255)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	membrane (GO:0016020)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)										CAGGGGCAGGGGGTGTGAGCA	0.721																																					p.P20P		.											.	.	.	0			c.C60A						.						8.0	9.0	8.0					20																	62203679		2154	4233	6387	SO:0001819	synonymous_variant	85441	exon2			GGCAGGGGGTGTG	AB201715	CCDS13527.1, CCDS33508.1	20q13.33	2012-09-26			ENSG00000130589	ENSG00000130589			30021	protein-coding gene	gene with protein product	"""peroxisomal proliferator activated receptor A interacting complex 285"", ""PPARG-DBD-interacting protein 1"""	611265				11214970, 12189208, 16239304	Standard	NM_001037335		Approved	PDIP1, PRIC285, KIAA1769	uc002yfm.2	Q9BYK8	OTTHUMG00000032969	ENST00000467148.1:c.60C>A	20.37:g.62203679G>T		18.0	0.0		11.0	4.0	NM_001037335	Q3C2G2|Q4VXQ1|Q8TEF3|Q96ND3|Q9C094	Silent	SNP	ENST00000467148.1	37	CCDS33508.1																																																																																			.		0.721	HELZ2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354127.1	NM_001037335	
HERC4	26091	hgsc.bcm.edu;bcgsc.ca	37	10	69785411	69785411	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A3CJ-01A-11D-A20W-10	TCGA-G3-A3CJ-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b064bc29-9a26-41f6-b49a-ae77a15d4967	fe4fd074-ca2d-42c3-9851-1c874d1f51fd	g.chr10:69785411C>A	ENST00000395198.3	-	8	1047	c.800G>T	c.(799-801)gGa>gTa	p.G267V	HERC4_ENST00000412272.2_Missense_Mutation_p.G267V|HERC4_ENST00000395187.2_3'UTR|HERC4_ENST00000373700.4_Missense_Mutation_p.G267V|HERC4_ENST00000277817.6_Missense_Mutation_p.G157V	NM_022079.2	NP_071362.1	Q5GLZ8	HERC4_HUMAN	HECT and RLD domain containing E3 ubiquitin protein ligase 4	267					cell differentiation (GO:0030154)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			NS(1)|breast(1)|cervix(1)|endometrium(1)|large_intestine(6)|lung(13)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	27						CCCTCCAGCTCCAAAAGTAAA	0.373																																					p.G267V		.											.	HERC4	659	0			c.G800T						.						114.0	117.0	116.0					10																	69785411		2203	4300	6503	SO:0001583	missense	26091	exon8			CCAGCTCCAAAAG	AY221963	CCDS7274.1, CCDS41533.1, CCDS60541.1, CCDS60542.1	10q21.3	2013-09-20	2012-02-23		ENSG00000148634	ENSG00000148634			24521	protein-coding gene	gene with protein product		609248	"""hect domain and RLD 4"""			10997877	Standard	NM_022079		Approved	DKFZP564G092, KIAA1593	uc001jng.4	Q5GLZ8	OTTHUMG00000018343	ENST00000395198.3:c.800G>T	10.37:g.69785411C>A	ENSP00000378624:p.Gly267Val	133.0	0.0		107.0	43.0	NM_022079	Q5GC98|Q5GC99|Q5GCA0|Q8IXP9|Q9HCH9	Missense_Mutation	SNP	ENST00000395198.3	37	CCDS41533.1	.	.	.	.	.	.	.	.	.	.	C	27.1	4.804013	0.90623	.	.	ENSG00000148634	ENST00000277817;ENST00000412272;ENST00000395198;ENST00000373700	D;D;D;D	0.99957	-9.01;-9.01;-9.01;-9.01	5.31	5.31	0.75309	Regulator of chromosome condensation/beta-lactamase-inhibitor protein II (2);	0.000000	0.85682	D	0.000000	D	0.99971	0.9990	H	0.99668	4.69	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0	D	0.96953	0.9696	10	0.87932	D	0	.	18.969	0.92708	0.0:1.0:0.0:0.0	.	267;267;117;267;267	Q5GLZ8-3;A8K9U4;Q5VXS9;Q5GLZ8-2;Q5GLZ8	.;.;.;.;HERC4_HUMAN	V	157;267;267;267	ENSP00000277817:G157V;ENSP00000416504:G267V;ENSP00000378624:G267V;ENSP00000362804:G267V	ENSP00000277817:G157V	G	-	2	0	HERC4	69455417	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.770000	0.85390	2.472000	0.83506	0.655000	0.94253	GGA	.		0.373	HERC4-009	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359262.1	NM_015601	
HIF3A	64344	ucsc.edu;bcgsc.ca	37	19	46832575	46832575	+	Missense_Mutation	SNP	G	G	A	rs562383855		TCGA-G3-A3CJ-01A-11D-A20W-10	TCGA-G3-A3CJ-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b064bc29-9a26-41f6-b49a-ae77a15d4967	fe4fd074-ca2d-42c3-9851-1c874d1f51fd	g.chr19:46832575G>A	ENST00000377670.4	+	12	1583	c.1552G>A	c.(1552-1554)Gct>Act	p.A518T	HIF3A_ENST00000300862.3_Missense_Mutation_p.A516T|HIF3A_ENST00000244303.6_Missense_Mutation_p.A449T|HIF3A_ENST00000472815.1_Intron|HIF3A_ENST00000339613.2_Missense_Mutation_p.A462T|AC007193.10_ENST00000596807.1_RNA|HIF3A_ENST00000420102.2_Missense_Mutation_p.A467T|HIF3A_ENST00000600383.1_Missense_Mutation_p.A449T	NM_152795.3	NP_690008.2	Q9Y2N7	HIF3A_HUMAN	hypoxia inducible factor 3, alpha subunit	518	ODD.				cellular response to hypoxia (GO:0071456)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|transcription from RNA polymerase II promoter (GO:0006366)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(7)|lung(14)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)	33		Ovarian(192;0.00965)|all_neural(266;0.0887)		OV - Ovarian serous cystadenocarcinoma(262;0.00204)|all cancers(93;0.0107)|GBM - Glioblastoma multiforme(486;0.0489)|Epithelial(262;0.136)		ACCTCTGGGGGCTGTCCCCCG	0.657																																					p.A518T		.											.	HIF3A	228	0			c.G1552A						.						43.0	46.0	45.0					19																	46832575		2203	4299	6502	SO:0001583	missense	64344	exon12			CTGGGGGCTGTCC	AK027725	CCDS12681.2, CCDS12682.1, CCDS42580.1, CCDS42580.2	19q13	2013-05-21			ENSG00000124440	ENSG00000124440		"""Basic helix-loop-helix proteins"""	15825	protein-coding gene	gene with protein product		609976				11573933, 11734856	Standard	NM_152794		Approved	IPAS, MOP7, PASD7, bHLHe17	uc002peh.3	Q9Y2N7	OTTHUMG00000141296	ENST00000377670.4:c.1552G>A	19.37:g.46832575G>A	ENSP00000366898:p.Ala518Thr	198.0	1.0		159.0	54.0	NM_152795	B0M185|B4DNA2|Q58A43|Q66K72|Q8WXA1|Q96K34|Q9H7Z9|Q9HAI2	Missense_Mutation	SNP	ENST00000377670.4	37	CCDS12681.2	.	.	.	.	.	.	.	.	.	.	G	11.26	1.586318	0.28268	.	.	ENSG00000124440	ENST00000244302;ENST00000377670;ENST00000244303;ENST00000339613;ENST00000291300;ENST00000300862;ENST00000420102	T;T;T;T;T	0.66460	0.53;-0.2;0.42;0.54;-0.21	4.82	-1.3	0.09259	.	1.274830	0.06052	N	0.656795	T	0.47021	0.1423	N	0.24115	0.695	0.09310	N	1	B;B;B;B;B;B	0.06786	0.001;0.001;0.0;0.0;0.0;0.0	B;B;B;B;B;B	0.10450	0.005;0.001;0.003;0.001;0.001;0.001	T	0.18713	-1.0328	10	0.20519	T	0.43	.	4.5762	0.12234	0.3635:0.1545:0.482:0.0	.	467;449;516;462;518;518	F5H884;B4DNA2;Q9Y2N7-2;A8MPQ1;Q9Y2N7;B0M185	.;.;.;.;HIF3A_HUMAN;.	T	518;518;449;462;462;516;467	ENSP00000366898:A518T;ENSP00000244303:A449T;ENSP00000341877:A462T;ENSP00000300862:A516T;ENSP00000407771:A467T	ENSP00000244302:A518T	A	+	1	0	HIF3A	51524415	0.171000	0.23029	0.001000	0.08648	0.800000	0.45204	0.291000	0.18994	-0.292000	0.08999	-0.165000	0.13383	GCT	.		0.657	HIF3A-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000280556.3		
HIST1H1C	3006	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	6	26056377	26056377	+	Missense_Mutation	SNP	C	C	T	rs186228942		TCGA-G3-A3CJ-01A-11D-A20W-10	TCGA-G3-A3CJ-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b064bc29-9a26-41f6-b49a-ae77a15d4967	fe4fd074-ca2d-42c3-9851-1c874d1f51fd	g.chr6:26056377C>T	ENST00000343677.2	-	1	322	c.280G>A	c.(280-282)Gtg>Atg	p.V94M		NM_005319.3	NP_005310.1	P16403	H12_HUMAN	histone cluster 1, H1c	94	H15. {ECO:0000255|PROSITE- ProRule:PRU00837}.				nucleosome assembly (GO:0006334)|nucleosome positioning (GO:0016584)	nuclear euchromatin (GO:0005719)|nucleosome (GO:0000786)|nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(6)|kidney(1)|large_intestine(1)|lung(8)|ovary(4)|prostate(3)|skin(3)|upper_aerodigestive_tract(3)	34						TTCGTTTGCACCAGAGTGCCC	0.537																																					p.V94M		.											.	HIST1H1C	231	0			c.G280A						.						108.0	113.0	111.0					6																	26056377		2203	4300	6503	SO:0001583	missense	3006	exon1			TTTGCACCAGAGT	X57129	CCDS4577.1	6p21.3	2012-10-02	2006-10-11	2003-02-21	ENSG00000187837	ENSG00000187837		"""Histones / Replication-dependent"""	4716	protein-coding gene	gene with protein product		142710	"""H1 histone family, member 2"", ""histone 1, H1c"""	H1F2		2759094, 12408966	Standard	NM_005319		Approved	H1.2, H1s-1, H1c	uc003nfw.3	P16403	OTTHUMG00000016140	ENST00000343677.2:c.280G>A	6.37:g.26056377C>T	ENSP00000339566:p.Val94Met	318.0	1.0		243.0	103.0	NM_005319	A8K4I2	Missense_Mutation	SNP	ENST00000343677.2	37	CCDS4577.1	.	.	.	.	.	.	.	.	.	.	C	17.76	3.468828	0.63625	.	.	ENSG00000187837	ENST00000343677	T	0.09817	2.94	5.63	5.63	0.86233	Histone H1/H5 (3);Winged helix-turn-helix transcription repressor DNA-binding (1);	0.210714	0.39909	N	0.001234	T	0.34308	0.0893	M	0.93328	3.405	0.58432	D	0.999999	D	0.71674	0.998	D	0.77004	0.989	T	0.38308	-0.9667	10	0.87932	D	0	-29.6342	12.3739	0.55269	0.0:0.9231:0.0:0.0768	.	94	P16403	H12_HUMAN	M	94	ENSP00000339566:V94M	ENSP00000339566:V94M	V	-	1	0	HIST1H1C	26164356	1.000000	0.71417	1.000000	0.80357	0.282000	0.26991	2.516000	0.45520	2.814000	0.96858	0.655000	0.94253	GTG	C|0.999;G|0.000		0.537	HIST1H1C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043372.1	NM_005319	
HIST1H4G	8369	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	6	26246913	26246913	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A3CJ-01A-11D-A20W-10	TCGA-G3-A3CJ-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b064bc29-9a26-41f6-b49a-ae77a15d4967	fe4fd074-ca2d-42c3-9851-1c874d1f51fd	g.chr6:26246913A>G	ENST00000244537.4	-	1	346	c.293T>C	c.(292-294)cTg>cCg	p.L98P		NM_003547.2	NP_003538.1	Q99525	H4G_HUMAN	histone cluster 1, H4g	98						nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|endometrium(1)|large_intestine(1)|lung(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	7		all_hematologic(11;0.0945)|Acute lymphoblastic leukemia(11;0.167)				AAAGCCTTACAGGGTTCTTCC	0.562																																					p.L98P		.											.	HIST1H4G	68	0			c.T293C						.						53.0	44.0	47.0					6																	26246913		2203	4300	6503	SO:0001583	missense	8369	exon1			CCTTACAGGGTTC	Z80788	CCDS4599.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000124578	ENSG00000275663		"""Histones / Replication-dependent"""	4792	protein-coding gene	gene with protein product		602832	"""H4 histone family, member L"", ""histone 1, H4g"""	H4FL		9119399, 12408966	Standard	NM_003547		Approved	H4/l	uc003nhf.3	Q99525	OTTHUMG00000014444	ENST00000244537.4:c.293T>C	6.37:g.26246913A>G	ENSP00000244537:p.Leu98Pro	138.0	0.0		117.0	39.0	NM_003547		Missense_Mutation	SNP	ENST00000244537.4	37	CCDS4599.1	.	.	.	.	.	.	.	.	.	.	.	9.569	1.120585	0.20877	.	.	ENSG00000124578	ENST00000244537	.	.	.	3.05	3.05	0.35203	Histone-fold (1);	.	.	.	.	T	0.70290	0.3207	.	.	.	0.58432	D	0.999995	D	0.89917	1.0	D	0.70227	0.968	T	0.75133	-0.3425	7	0.87932	D	0	.	11.2158	0.48825	1.0:0.0:0.0:0.0	.	98	Q99525	H4G_HUMAN	P	98	.	ENSP00000244537:L98P	L	-	2	0	HIST1H4G	26354892	1.000000	0.71417	0.853000	0.33588	0.003000	0.03518	8.352000	0.90075	1.376000	0.46267	0.321000	0.21382	CTG	.		0.562	HIST1H4G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040107.1	NM_003547	
HIST2H2AC	8338	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	149858905	149858905	+	Silent	SNP	A	A	G			TCGA-G3-A3CJ-01A-11D-A20W-10	TCGA-G3-A3CJ-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b064bc29-9a26-41f6-b49a-ae77a15d4967	fe4fd074-ca2d-42c3-9851-1c874d1f51fd	g.chr1:149858905A>G	ENST00000331380.2	+	1	381	c.381A>G	c.(379-381)aaA>aaG	p.K127K	BOLA1_ENST00000369153.2_5'Flank|HIST2H2BE_ENST00000369155.2_5'Flank	NM_003517.2	NP_003508.1	Q16777	H2A2C_HUMAN	histone cluster 2, H2ac	127						extracellular vesicular exosome (GO:0070062)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(1)|breast(3)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(11)|ovary(1)|skin(1)	20	Breast(34;0.0124)|all_hematologic(923;0.127)		STAD - Stomach adenocarcinoma(528;0.133)|LUSC - Lung squamous cell carcinoma(543;0.221)			ACAAAGCCAAAAGCAAATAAA	0.463																																					p.K127K		.											.	HIST2H2AC	92	0			c.A381G						.						67.0	71.0	70.0					1																	149858905		2203	4300	6503	SO:0001819	synonymous_variant	8338	exon1			AGCCAAAAGCAAA	AY131973	CCDS937.1	1q21.2	2011-01-27	2006-10-11	2003-02-21	ENSG00000184260	ENSG00000184260		"""Histones / Replication-dependent"""	4738	protein-coding gene	gene with protein product		602797	"""H2A histone family, member Q"", ""histone 2, H2ac"""	H2A, H2AFQ		1469070, 9439656, 12408966	Standard	NM_003517		Approved	H2A/q	uc001etd.3	Q16777	OTTHUMG00000035825	ENST00000331380.2:c.381A>G	1.37:g.149858905A>G		281.0	0.0		394.0	78.0	NM_003517	Q6DRA7|Q8IUE5	Silent	SNP	ENST00000331380.2	37	CCDS937.1																																																																																			.		0.463	HIST2H2AC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087128.1	NM_003517	
HSD17B13	345275	hgsc.bcm.edu;bcgsc.ca	37	4	88231395	88231395	+	Splice_Site	SNP	T	T	C			TCGA-G3-A3CJ-01A-11D-A20W-10	TCGA-G3-A3CJ-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b064bc29-9a26-41f6-b49a-ae77a15d4967	fe4fd074-ca2d-42c3-9851-1c874d1f51fd	g.chr4:88231395T>C	ENST00000328546.4	-	6	876	c.812A>G	c.(811-813)aAg>aGg	p.K271R	HSD17B13_ENST00000302219.6_Splice_Site_p.K235R	NM_178135.3	NP_835236.2	Q7Z5P4	DHB13_HUMAN	hydroxysteroid (17-beta) dehydrogenase 13	271						extracellular region (GO:0005576)	oxidoreductase activity (GO:0016491)			endometrium(1)|large_intestine(3)|lung(2)|prostate(1)|urinary_tract(1)	8		Acute lymphoblastic leukemia(40;0.244)|all_hematologic(202;0.248)		OV - Ovarian serous cystadenocarcinoma(123;0.000308)		CTGTACTTACTTCTGTAGTCT	0.348																																					p.K271R		.											.	HSD17B13	90	0			c.A812G						.						120.0	119.0	120.0					4																	88231395		2202	4300	6502	SO:0001630	splice_region_variant	345275	exon6			ACTTACTTCTGTA		CCDS3618.1, CCDS47097.1	4q22.1	2011-09-20			ENSG00000170509	ENSG00000170509	1.1.-.-	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 3"""	18685	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 16C, member 3"""	612127				19027726	Standard	NM_178135		Approved	SCDR9, SDR16C3	uc003hqo.2	Q7Z5P4	OTTHUMG00000130602	ENST00000328546.4:c.812+1A>G	4.37:g.88231395T>C		316.0	0.0		207.0	11.0	NM_178135	A8K9R9|Q2M1L5|Q86W22|Q86W23	Missense_Mutation	SNP	ENST00000328546.4	37	CCDS3618.1	.	.	.	.	.	.	.	.	.	.	T	0.480	-0.880125	0.02530	.	.	ENSG00000170509	ENST00000302219;ENST00000328546	D;D	0.88664	-2.41;-2.41	4.93	-6.93	0.01638	.	1.396580	0.04919	N	0.454676	T	0.72078	0.3416	N	0.04043	-0.29	0.09310	N	0.999999	B;B	0.02656	0.0;0.0	B;B	0.06405	0.002;0.001	T	0.62627	-0.6814	9	.	.	.	.	9.6211	0.39721	0.0898:0.2755:0.0:0.6347	.	235;271	Q7Z5P4-2;Q7Z5P4	.;DHB13_HUMAN	R	235;271	ENSP00000305438:K235R;ENSP00000333300:K271R	.	K	-	2	0	HSD17B13	88450419	0.085000	0.21516	0.015000	0.15790	0.019000	0.09904	-0.728000	0.04925	-1.601000	0.01601	-1.010000	0.02471	AAG	.		0.348	HSD17B13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253052.1	NM_178135	Missense_Mutation
IMMT	10989	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	2	86385804	86385804	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A3CJ-01A-11D-A20W-10	TCGA-G3-A3CJ-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b064bc29-9a26-41f6-b49a-ae77a15d4967	fe4fd074-ca2d-42c3-9851-1c874d1f51fd	g.chr2:86385804T>C	ENST00000410111.3	-	10	1460	c.1073A>G	c.(1072-1074)tAt>tGt	p.Y358C	IMMT_ENST00000254636.5_Missense_Mutation_p.Y259C|IMMT_ENST00000449247.2_Missense_Mutation_p.Y347C|IMMT_ENST00000442664.2_Missense_Mutation_p.Y357C|IMMT_ENST00000409051.2_Missense_Mutation_p.Y311C|Y_RNA_ENST00000363371.1_RNA|IMMT_ENST00000490238.1_5'UTR	NM_001100169.1|NM_001100170.1|NM_006839.2	NP_001093639.1|NP_001093640.1|NP_006830.2	Q16891	MIC60_HUMAN	inner membrane protein, mitochondrial	358					mitochondrial calcium ion homeostasis (GO:0051560)|response to cold (GO:0009409)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(1)|kidney(3)|large_intestine(9)|lung(12)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	30						CAGCTCATGATACTGAGATAC	0.438																																					p.Y358C		.											.	IMMT	91	0			c.A1073G						.						60.0	55.0	57.0					2																	86385804		1879	4124	6003	SO:0001583	missense	10989	exon10			TCATGATACTGAG	D21094	CCDS46355.1, CCDS46356.1, CCDS46357.1	2p11.2	2011-10-04	2010-04-29		ENSG00000132305	ENSG00000132305			6047	protein-coding gene	gene with protein product	"""mitofilin"", ""mitochondrial inner membrane organizing system 2"""	600378	"""inner membrane protein, mitochondrial (mitofilin)"""			9168817, 8039717	Standard	NM_001100169		Approved	P87, P89, HMP, MINOS2	uc002sqz.4	Q16891	OTTHUMG00000153170	ENST00000410111.3:c.1073A>G	2.37:g.86385804T>C	ENSP00000387262:p.Tyr358Cys	173.0	0.0		137.0	58.0	NM_006839	B1H0U5|B2R5N6|Q14539|Q15092|Q68D41|Q69HW5|Q6IBL0|Q7Z3X1|Q8TAJ5|Q9P0V2	Missense_Mutation	SNP	ENST00000410111.3	37	CCDS46355.1	.	.	.	.	.	.	.	.	.	.	T	26.2	4.715540	0.89112	.	.	ENSG00000132305	ENST00000254636;ENST00000449247;ENST00000410111;ENST00000442664;ENST00000409051;ENST00000545283;ENST00000377310	T;T;T;T;T	0.36520	1.25;1.25;1.25;1.25;1.25	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	T	0.63153	0.2487	M	0.81341	2.54	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0;1.0;1.0	T	0.66122	-0.6002	10	0.51188	T	0.08	-11.236	16.0709	0.80928	0.0:0.0:0.0:1.0	.	311;346;326;260;347;326;358	B9A067;B4DKR1;F8W9I1;B4DS66;Q16891-2;Q16891-3;Q16891	.;.;.;.;.;.;IMMT_HUMAN	C	259;347;358;357;311;347;326	ENSP00000254636:Y259C;ENSP00000396899:Y347C;ENSP00000387262:Y358C;ENSP00000407788:Y357C;ENSP00000387227:Y311C	ENSP00000254636:Y259C	Y	-	2	0	IMMT	86239315	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.519000	0.81809	2.198000	0.70561	0.528000	0.53228	TAT	.		0.438	IMMT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000329909.2	NM_006839	
KCNK10	54207	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	14	88693828	88693828	+	Frame_Shift_Del	DEL	A	A	-			TCGA-G3-A3CJ-01A-11D-A20W-10	TCGA-G3-A3CJ-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b064bc29-9a26-41f6-b49a-ae77a15d4967	fe4fd074-ca2d-42c3-9851-1c874d1f51fd	g.chr14:88693828delA	ENST00000340700.5	-	4	1008	c.557delT	c.(556-558)ttafs	p.L186fs	KCNK10_ENST00000312350.5_Frame_Shift_Del_p.L191fs|KCNK10_ENST00000319231.5_Frame_Shift_Del_p.L191fs	NM_021161.4	NP_066984.1	P57789	KCNKA_HUMAN	potassium channel, subfamily K, member 10	186					signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transport (GO:0006810)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	potassium channel activity (GO:0005267)|voltage-gated ion channel activity (GO:0005244)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(25)|ovary(3)|pancreas(2)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	47						GATGGCATATAAAATACAAAA	0.413																																					p.L191fs		.											.	KCNK10	95	0			c.572delT						.						117.0	122.0	120.0					14																	88693828		2203	4300	6503	SO:0001589	frameshift_variant	54207	exon4			GCATATAAAATAC	AF279890	CCDS9880.1, CCDS9881.1, CCDS9882.1	14q31	2014-06-12						"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	6273	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 97"""	605873				10880510, 16382106	Standard	NM_021161		Approved	K2p10.1, TREK-2, TREK2, PPP1R97	uc001xwn.3	P57789		ENST00000340700.5:c.557delT	14.37:g.88693828delA	ENSP00000343104:p.Leu186fs	80.0	0.0		97.0	40.0	NM_138318	B2R8T4|B2RCT3|B5TJL4|Q6B014|Q8TDK7|Q8TDK8|Q9HB59	Frame_Shift_Del	DEL	ENST00000340700.5	37	CCDS9880.1																																																																																			.		0.413	KCNK10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410167.1	NM_021161	
KCNK2	3776	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	215297991	215297991	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A3CJ-01A-11D-A20W-10	TCGA-G3-A3CJ-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b064bc29-9a26-41f6-b49a-ae77a15d4967	fe4fd074-ca2d-42c3-9851-1c874d1f51fd	g.chr1:215297991A>G	ENST00000444842.2	+	3	523	c.373A>G	c.(373-375)Ata>Gta	p.I125V	KCNK2_ENST00000391894.2_Missense_Mutation_p.I110V|KCNK2_ENST00000391895.2_Missense_Mutation_p.I121V	NM_001017425.2|NM_014217.3	NP_001017425.2|NP_055032.1	O95069	KCNK2_HUMAN	potassium channel, subfamily K, member 2	125					G-protein coupled receptor signaling pathway (GO:0007186)|potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	endoplasmic reticulum (GO:0005783)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	outward rectifier potassium channel activity (GO:0015271)|potassium channel inhibitor activity (GO:0019870)|potassium ion leak channel activity (GO:0022841)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(15)|upper_aerodigestive_tract(1)	30				OV - Ovarian serous cystadenocarcinoma(81;0.0399)|all cancers(67;0.0556)|GBM - Glioblastoma multiforme(131;0.068)	Dofetilide(DB00204)|Dronedarone(DB04855)	AGTGGCAGCAATAAATGCAGG	0.388																																					p.I125V		.											.	KCNK2	90	0			c.A373G						.						138.0	136.0	137.0					1																	215297991		2203	4300	6503	SO:0001583	missense	3776	exon3			GCAGCAATAAATG	AF004711	CCDS31024.1, CCDS41466.1, CCDS41467.1	1q41	2012-03-07			ENSG00000082482	ENSG00000082482		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	6277	protein-coding gene	gene with protein product		603219				9721223, 16382106	Standard	NM_001017424		Approved	K2p2.1, TREK-1	uc001hkr.4	O95069	OTTHUMG00000037017	ENST00000444842.2:c.373A>G	1.37:g.215297991A>G	ENSP00000394033:p.Ile125Val	310.0	0.0		391.0	106.0	NM_001017425	A1Z1V3|A8K618|B2RCS4|B7ZL56|D3DTA5|Q5DP47|Q5DP48|Q9NRT2|Q9UNE3	Missense_Mutation	SNP	ENST00000444842.2	37	CCDS41467.1	.	.	.	.	.	.	.	.	.	.	A	7.878	0.729600	0.15507	.	.	ENSG00000082482	ENST00000391895;ENST00000478774;ENST00000391894;ENST00000444842;ENST00000457122	T;T;T;T;T	0.20069	2.1;2.29;2.11;2.1;2.55	5.91	3.6	0.41247	Ion transport 2 (1);	0.140469	0.64402	N	0.000005	T	0.11623	0.0283	N	0.17278	0.47	0.42989	D	0.994483	B;B;B	0.14012	0.001;0.009;0.003	B;B;B	0.14023	0.006;0.01;0.006	T	0.13737	-1.0498	10	0.14252	T	0.57	.	10.2248	0.43218	0.8663:0.0:0.1337:0.0	.	110;125;121	O95069-2;O95069;O95069-3	.;KCNK2_HUMAN;.	V	121;69;110;125;69	ENSP00000375765:I121V;ENSP00000420569:I69V;ENSP00000375764:I110V;ENSP00000394033:I125V;ENSP00000413460:I69V	ENSP00000375764:I110V	I	+	1	0	KCNK2	213364614	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.845000	0.55880	0.502000	0.28037	0.524000	0.50904	ATA	.		0.388	KCNK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089856.2	NM_014217	
KHDRBS2	202559	broad.mit.edu;bcgsc.ca	37	6	62604676	62604676	+	Frame_Shift_Del	DEL	C	C	-			TCGA-G3-A3CJ-01A-11D-A20W-10	TCGA-G3-A3CJ-10A-01D-A20W-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b064bc29-9a26-41f6-b49a-ae77a15d4967	fe4fd074-ca2d-42c3-9851-1c874d1f51fd	g.chr6:62604676delC	ENST00000281156.4	-	6	952	c.674delG	c.(673-675)ggafs	p.G225fs		NM_152688.2	NP_689901.2	Q5VWX1	KHDR2_HUMAN	KH domain containing, RNA binding, signal transduction associated 2	225	Pro-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	poly(A) binding (GO:0008143)|poly(U) RNA binding (GO:0008266)			NS(1)|breast(2)|endometrium(4)|kidney(2)|large_intestine(5)|liver(1)|lung(13)|ovary(3)|prostate(3)|skin(12)|upper_aerodigestive_tract(2)|urinary_tract(1)	49				BRCA - Breast invasive adenocarcinoma(397;0.149)		TACAGTGCTTCCCCGAGGGGT	0.607																																					p.G225fs		.											.	KHDRBS2	272	0			c.674delG						.						40.0	42.0	41.0					6																	62604676		2203	4300	6503	SO:0001589	frameshift_variant	202559	exon6			GTGCTTCCCCGAG	BC034043	CCDS4963.1	6q11.1	2013-09-20			ENSG00000112232	ENSG00000112232			18114	protein-coding gene	gene with protein product	"""Sam68-like mammalian protein 1"""	610487					Standard	NM_152688		Approved	SLM1, SLM-1, MGC26664	uc003peg.2	Q5VWX1	OTTHUMG00000014936	ENST00000281156.4:c.674delG	6.37:g.62604676delC	ENSP00000281156:p.Gly225fs	45.0	0.0		30.0	9.0	NM_152688	A8K7M8|Q8N4I4|Q8TCZ4	Frame_Shift_Del	DEL	ENST00000281156.4	37	CCDS4963.1																																																																																			.		0.607	KHDRBS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041066.2	NM_152688	
KRT5	3852	ucsc.edu;bcgsc.ca	37	12	52913639	52913639	+	Missense_Mutation	SNP	T	T	A	rs57739872		TCGA-G3-A3CJ-01A-11D-A20W-10	TCGA-G3-A3CJ-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b064bc29-9a26-41f6-b49a-ae77a15d4967	fe4fd074-ca2d-42c3-9851-1c874d1f51fd	g.chr12:52913639T>A	ENST00000252242.4	-	1	832	c.442A>T	c.(442-444)Agt>Tgt	p.S148C		NM_000424.3	NP_000415.2	P13647	K2C5_HUMAN	keratin 5	148	Head.				cell junction assembly (GO:0034329)|epidermis development (GO:0008544)|hemidesmosome assembly (GO:0031581)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|keratin filament (GO:0045095)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	scaffold protein binding (GO:0097110)|structural constituent of cytoskeleton (GO:0005200)			endometrium(5)|kidney(1)|large_intestine(8)|lung(15)|prostate(4)|skin(2)	35				BRCA - Breast invasive adenocarcinoma(357;0.189)		GTCAGGAGACTCTGGTTGACA	0.592																																					p.S148C		.											.	KRT5	90	0			c.A442T						.						175.0	165.0	168.0					12																	52913639		2203	4300	6503	SO:0001583	missense	3852	exon1			GGAGACTCTGGTT		CCDS8830.1	12q13.13	2013-01-16	2008-08-01		ENSG00000186081	ENSG00000186081		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6442	protein-coding gene	gene with protein product		148040	"""epidermolysis bullosa simplex 2 Dowling-Meara/Kobner/Weber-Cockayne types"", ""keratin 5 (epidermolysis bullosa simplex, Dowling-Meara/Kobner/Weber-Cockayne types)"""	EBS2		1713141, 16831889	Standard	NM_000424		Approved	KRT5A	uc001san.3	P13647	OTTHUMG00000169657	ENST00000252242.4:c.442A>T	12.37:g.52913639T>A	ENSP00000252242:p.Ser148Cys	518.0	2.0		361.0	138.0	NM_000424	Q6PI71|Q6UBJ0|Q8TA91	Missense_Mutation	SNP	ENST00000252242.4	37	CCDS8830.1	.	.	.	.	.	.	.	.	.	.	T	23.3	4.401546	0.83120	.	.	ENSG00000186081	ENST00000252242;ENST00000456000;ENST00000549420;ENST00000551275	D;D;D	0.91894	-2.93;-1.56;-2.93	5.45	5.45	0.79879	.	0.167248	0.42294	D	0.000725	D	0.96090	0.8726	M	0.84511	2.7	0.39357	D	0.965853	D	0.76494	0.999	D	0.66847	0.947	D	0.97314	0.9939	10	0.87932	D	0	.	15.5185	0.75846	0.0:0.0:0.0:1.0	.	148	P13647	K2C5_HUMAN	C	148;113;38;113	ENSP00000252242:S148C;ENSP00000447209:S38C;ENSP00000448041:S113C	ENSP00000252242:S148C	S	-	1	0	KRT5	51199906	.	.	0.958000	0.39756	0.992000	0.81027	.	.	2.070000	0.61991	0.533000	0.62120	AGT	.		0.592	KRT5-001	KNOWN	overlapping_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405312.1		
KRTAP2-3	730755	broad.mit.edu;mdanderson.org	37	17	39216037	39216037	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A3CJ-01A-11D-A20W-10	TCGA-G3-A3CJ-10A-01D-A20W-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b064bc29-9a26-41f6-b49a-ae77a15d4967	fe4fd074-ca2d-42c3-9851-1c874d1f51fd	g.chr17:39216037C>A	ENST00000391418.2	-	1	307	c.266G>T	c.(265-267)tGc>tTc	p.C89F		NM_001165252.1	NP_001158724.1	P0C7H8	KRA23_HUMAN	keratin associated protein 2-3	89	10 X 5 AA repeats of C-C-[CDPQRWG]- [APRS]-[CIPSTVD].					keratin filament (GO:0045095)											GCAGGGCCTGCACACCACAGC	0.731																																					p.C89F		.											.	.	.	0			c.G266T						.						5.0	6.0	6.0					17																	39216037		673	1561	2234	SO:0001583	missense	730755	exon1			GGCCTGCACACCA	BC012486	CCDS54123.1	17q21.2	2012-08-03			ENSG00000212724	ENSG00000212724		"""Keratin associated proteins"""	18906	protein-coding gene	gene with protein product							Standard	NM_001165252		Approved	KAP2.3	uc002hvx.3	P0C7H8	OTTHUMG00000133655	ENST00000391418.2:c.266G>T	17.37:g.39216037C>A	ENSP00000375237:p.Cys89Phe	37.0	0.0		32.0	16.0	NM_001165252		Missense_Mutation	SNP	ENST00000391418.2	37	CCDS54123.1	.	.	.	.	.	.	.	.	.	.	.	16.19	3.054342	0.55218	.	.	ENSG00000212724	ENST00000391418	.	.	.	5.63	5.63	0.86233	.	0.000000	0.44688	D	0.000428	T	0.62986	0.2473	.	.	.	0.48975	D	0.999733	P	0.44877	0.845	P	0.46659	0.523	T	0.67268	-0.5713	8	0.87932	D	0	.	15.2393	0.73455	0.0:1.0:0.0:0.0	.	89	Q9BYR9	KRA24_HUMAN	F	89	.	ENSP00000375237:C89F	C	-	2	0	KRTAP2-3	36469563	1.000000	0.71417	1.000000	0.80357	0.948000	0.59901	2.701000	0.47094	2.672000	0.90937	0.556000	0.70494	TGC	.		0.731	KRTAP2-3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257692.1	NM_001165252	
LAMA2	3908	hgsc.bcm.edu;ucsc.edu;mdanderson.org	37	6	129636958	129636958	+	Nonsense_Mutation	SNP	G	G	T			TCGA-G3-A3CJ-01A-11D-A20W-10	TCGA-G3-A3CJ-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b064bc29-9a26-41f6-b49a-ae77a15d4967	fe4fd074-ca2d-42c3-9851-1c874d1f51fd	g.chr6:129636958G>T	ENST00000421865.2	+	26	3836	c.3787G>T	c.(3787-3789)Gaa>Taa	p.E1263*		NM_000426.3|NM_001079823.1	NP_000417|NP_001073291.1	P24043	LAMA2_HUMAN	laminin, alpha 2	1263	Laminin IV type A 2. {ECO:0000255|PROSITE-ProRule:PRU00458}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|muscle organ development (GO:0007517)|myelination in peripheral nervous system (GO:0022011)|positive regulation of synaptic transmission, cholinergic (GO:0032224)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)	basement membrane (GO:0005604)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|sarcolemma (GO:0042383)	structural molecule activity (GO:0005198)			NS(2)|biliary_tract(2)|breast(10)|central_nervous_system(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(35)|lung(84)|ovary(10)|prostate(4)|skin(9)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(2)	194				OV - Ovarian serous cystadenocarcinoma(136;0.178)|all cancers(137;0.245)		CGAGGCTCGGGAAGAAACAGG	0.418																																					p.E1263X		.											.	LAMA2	162	0			c.G3787T						.						109.0	110.0	109.0					6																	129636958		2203	4300	6503	SO:0001587	stop_gained	3908	exon26			GCTCGGGAAGAAA	Z26653	CCDS5138.1	6q22-q23	2014-09-17	2008-08-01		ENSG00000196569	ENSG00000196569		"""Laminins"""	6482	protein-coding gene	gene with protein product	"""merosin"", ""congenital muscular dystrophy"""	156225		LAMM		2185464, 8294519	Standard	NM_000426		Approved		uc003qbn.3	P24043	OTTHUMG00000015545	ENST00000421865.2:c.3787G>T	6.37:g.129636958G>T	ENSP00000400365:p.Glu1263*	70.0	0.0		69.0	30.0	NM_000426	Q14736|Q5VUM2|Q93022	Nonsense_Mutation	SNP	ENST00000421865.2	37	CCDS5138.1	.	.	.	.	.	.	.	.	.	.	G	44	10.630437	0.99440	.	.	ENSG00000196569	ENST00000358023;ENST00000354729;ENST00000421865	.	.	.	5.55	5.55	0.83447	.	0.178129	0.49305	D	0.000142	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.22109	T	0.4	.	19.8741	0.96863	0.0:0.0:1.0:0.0	.	.	.	.	X	1263	.	ENSP00000346769:E1263X	E	+	1	0	LAMA2	129678651	1.000000	0.71417	1.000000	0.80357	0.938000	0.57974	9.416000	0.97383	2.761000	0.94854	0.655000	0.94253	GAA	.		0.418	LAMA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042180.1		
LMTK2	22853	hgsc.bcm.edu;ucsc.edu	37	7	97821054	97821054	+	Nonsense_Mutation	SNP	G	G	A			TCGA-G3-A3CJ-01A-11D-A20W-10	TCGA-G3-A3CJ-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b064bc29-9a26-41f6-b49a-ae77a15d4967	fe4fd074-ca2d-42c3-9851-1c874d1f51fd	g.chr7:97821054G>A	ENST00000297293.5	+	11	1570	c.1277G>A	c.(1276-1278)tGg>tAg	p.W426*		NM_014916.3	NP_055731.2	Q8IWU2	LMTK2_HUMAN	lemur tyrosine kinase 2	426					early endosome to late endosome transport (GO:0045022)|endocytic recycling (GO:0032456)|negative regulation of catalytic activity (GO:0043086)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|receptor recycling (GO:0001881)|transferrin transport (GO:0033572)	early endosome (GO:0005769)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|recycling endosome (GO:0055037)	ATP binding (GO:0005524)|myosin VI binding (GO:0070853)|protein phosphatase inhibitor activity (GO:0004864)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(13)|lung(25)|ovary(1)|pancreas(2)|skin(2)|stomach(3)	59	all_cancers(62;3.23e-09)|all_epithelial(64;7.65e-10)|Lung NSC(181;0.00902)|all_lung(186;0.0104)|Esophageal squamous(72;0.0125)					GAACAGCAGTGGAACGCTCTG	0.562																																					p.W426X		.											.	LMTK2	1381	0			c.G1277A						.						95.0	82.0	87.0					7																	97821054		2203	4300	6503	SO:0001587	stop_gained	22853	exon11			AGCAGTGGAACGC	AB029002	CCDS5654.1	7q22.1	2014-06-12			ENSG00000164715	ENSG00000164715			17880	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 100"""	610989				15005709	Standard	NM_014916		Approved	KIAA1079, KPI2, KPI-2, cprk, LMR2, BREK, AATYK2, PPP1R100	uc003upd.2	Q8IWU2	OTTHUMG00000154256	ENST00000297293.5:c.1277G>A	7.37:g.97821054G>A	ENSP00000297293:p.Trp426*	220.0	1.0		219.0	111.0	NM_014916	A4D272|Q75MG7|Q9UPS3	Nonsense_Mutation	SNP	ENST00000297293.5	37	CCDS5654.1	.	.	.	.	.	.	.	.	.	.	G	40	8.350838	0.98772	.	.	ENSG00000164715	ENST00000297293	.	.	.	5.41	5.41	0.78517	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	18.551	0.91065	0.0:0.0:1.0:0.0	.	.	.	.	X	426	.	ENSP00000297293:W426X	W	+	2	0	LMTK2	97658990	1.000000	0.71417	1.000000	0.80357	0.880000	0.50808	9.420000	0.97426	2.710000	0.92621	0.655000	0.94253	TGG	.		0.562	LMTK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334560.1	NM_014916	
MAGED1	9500	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	X	51637805	51637806	+	Intron	DEL	TG	TG	-			TCGA-G3-A3CJ-01A-11D-A20W-10	TCGA-G3-A3CJ-10A-01D-A20W-10	TG	TG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b064bc29-9a26-41f6-b49a-ae77a15d4967	fe4fd074-ca2d-42c3-9851-1c874d1f51fd	g.chrX:51637805_51637806delTG	ENST00000375722.1	+	3	297				MAGED1_ENST00000494718.1_Intron|MAGED1_ENST00000326587.7_Intron|MAGED1_ENST00000375695.2_Frame_Shift_Del_p.L43fs|MAGED1_ENST00000375772.3_Intron			Q9Y5V3	MAGD1_HUMAN	melanoma antigen family D, 1						apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|circadian regulation of gene expression (GO:0032922)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of transcription, DNA-templated (GO:0045892)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of apoptotic process (GO:0042981)|regulation of circadian rhythm (GO:0042752)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	transcription coactivator activity (GO:0003713)			breast(1)|endometrium(4)|large_intestine(10)|lung(13)|ovary(3)|upper_aerodigestive_tract(1)	32	Ovarian(276;0.236)					TTCCCCACTCTGTGCGACCCCC	0.584										Multiple Myeloma(10;0.10)																											p.43_43del		.											.	MAGED1	133	0			c.128_129del						.																																			SO:0001627	intron_variant	9500	exon3			CCACTCTGTGCGA	AF124440	CCDS14337.1, CCDS35279.1	Xp11.23	2008-08-01			ENSG00000179222	ENSG00000179222			6813	protein-coding gene	gene with protein product		300224				10409427	Standard	NM_006986		Approved	NRAGE, DLXIN-1	uc004dpn.3	Q9Y5V3	OTTHUMG00000021540	ENST00000375722.1:c.46-343TG>-	X.37:g.51637807_51637808delTG		224.0	0.0		131.0	85.0	NM_001005333	Q5VSH6|Q8IZ84|Q8WY92|Q9H352|Q9HBT4|Q9UF36	Frame_Shift_Del	DEL	ENST00000375722.1	37	CCDS14337.1																																																																																			.		0.584	MAGED1-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056593.1	NM_001005332	
MAPKAPK5	8550	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	112330837	112330837	+	Missense_Mutation	SNP	A	A	T			TCGA-G3-A3CJ-01A-11D-A20W-10	TCGA-G3-A3CJ-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b064bc29-9a26-41f6-b49a-ae77a15d4967	fe4fd074-ca2d-42c3-9851-1c874d1f51fd	g.chr12:112330837A>T	ENST00000551404.2	+	14	1502	c.1394A>T	c.(1393-1395)gAg>gTg	p.E465V	MAPKAPK5_ENST00000550735.2_Missense_Mutation_p.E463V			Q8IW41	MAPK5_HUMAN	mitogen-activated protein kinase-activated protein kinase 5	465					activation of MAPK activity (GO:0000187)|MAPK cascade (GO:0000165)|negative regulation of TOR signaling (GO:0032007)|protein autophosphorylation (GO:0046777)|Ras protein signal transduction (GO:0007265)|regulation of translation (GO:0006417)|signal transduction (GO:0007165)|stress-induced premature senescence (GO:0090400)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|MAP kinase kinase activity (GO:0004708)|p53 binding (GO:0002039)|protein serine/threonine kinase activity (GO:0004674)			endometrium(1)|lung(11)|ovary(1)	13						GTGATAGAAGAGCAAACCACG	0.338																																					p.E465V		.											.	MAPKAPK5	1215	0			c.A1394T						.						79.0	79.0	79.0					12																	112330837		1888	4122	6010	SO:0001583	missense	8550	exon14			TAGAAGAGCAAAC	AF032437	CCDS44975.1, CCDS44976.1	12q24.13	2012-05-30			ENSG00000089022	ENSG00000089022			6889	protein-coding gene	gene with protein product		606723				9628874	Standard	NM_003668		Approved	PRAK	uc001tta.4	Q8IW41	OTTHUMG00000169605	ENST00000551404.2:c.1394A>T	12.37:g.112330837A>T	ENSP00000449381:p.Glu465Val	143.0	0.0		95.0	40.0	NM_139078	B3KVA5|O60491|Q86X46|Q9BVX9|Q9UG86	Missense_Mutation	SNP	ENST00000551404.2	37	CCDS44975.1	.	.	.	.	.	.	.	.	.	.	A	22.2	4.262163	0.80358	.	.	ENSG00000089022	ENST00000550735;ENST00000202788;ENST00000428907;ENST00000551404;ENST00000547067	T;T	0.57595	0.4;0.39	5.74	5.74	0.90152	.	0.000000	0.85682	D	0.000000	T	0.59676	0.2211	N	0.19112	0.55	0.80722	D	1	D;D;D	0.61080	0.981;0.981;0.989	D;D;D	0.72625	0.95;0.95;0.978	T	0.65512	-0.6150	10	0.87932	D	0	.	16.0382	0.80645	1.0:0.0:0.0:0.0	.	459;465;463	C9J458;Q8IW41;Q8IW41-2	.;MAPK5_HUMAN;.	V	463;465;463;465;126	ENSP00000449667:E463V;ENSP00000449381:E465V	ENSP00000202788:E465V	E	+	2	0	MAPKAPK5	110815220	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	8.613000	0.90913	2.194000	0.70268	0.533000	0.62120	GAG	.		0.338	MAPKAPK5-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000405019.2	NM_139078	
MED12L	116931	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	151107817	151107817	+	Silent	SNP	C	C	A	rs541597798		TCGA-G3-A3CJ-01A-11D-A20W-10	TCGA-G3-A3CJ-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b064bc29-9a26-41f6-b49a-ae77a15d4967	fe4fd074-ca2d-42c3-9851-1c874d1f51fd	g.chr3:151107817C>A	ENST00000474524.1	+	36	5435	c.5397C>A	c.(5395-5397)atC>atA	p.I1799I	MED12L_ENST00000273432.4_Silent_p.I1659I	NM_053002.4	NP_443728.3	Q86YW9	MD12L_HUMAN	mediator complex subunit 12-like	1799						mediator complex (GO:0016592)	RNA polymerase II transcription cofactor activity (GO:0001104)			NS(1)|breast(3)|central_nervous_system(3)|cervix(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(27)|lung(50)|ovary(6)|prostate(3)|skin(4)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	128			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			ACTCGCCTATCTCCTCCCAAA	0.463																																					p.I1799I		.											.	MED12L	576	0			c.C5397A						.						175.0	171.0	172.0					3																	151107817		2203	4300	6503	SO:0001819	synonymous_variant	116931	exon36			GCCTATCTCCTCC	AB046855, AF388364	CCDS33876.1	3q25.1	2007-07-30	2007-07-30		ENSG00000144893	ENSG00000144893			16050	protein-coding gene	gene with protein product		611318	"""mediator of RNA polymerase II transcription, subunit 12 homolog (S. cerevisiae)-like"""			11524702	Standard	XM_006713487		Approved	KIAA1635, TNRC11L, TRALPUSH, TRALP	uc003eyp.3	Q86YW9	OTTHUMG00000159844	ENST00000474524.1:c.5397C>A	3.37:g.151107817C>A		166.0	0.0		86.0	32.0	NM_053002	Q96PC7|Q96PC8|Q9H9M5|Q9HCD7|Q9UI69	Silent	SNP	ENST00000474524.1	37	CCDS33876.1																																																																																			.		0.463	MED12L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357707.2	NM_053002	
METTL18	92342	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	1	169762228	169762228	+	Silent	SNP	T	T	G			TCGA-G3-A3CJ-01A-11D-A20W-10	TCGA-G3-A3CJ-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b064bc29-9a26-41f6-b49a-ae77a15d4967	fe4fd074-ca2d-42c3-9851-1c874d1f51fd	g.chr1:169762228T>G	ENST00000310392.4	-	2	962	c.609A>C	c.(607-609)atA>atC	p.I203I	C1orf112_ENST00000498289.1_Intron|C1orf112_ENST00000456684.1_5'Flank|C1orf112_ENST00000413811.2_5'Flank|C1orf112_ENST00000359326.4_5'Flank|METTL18_ENST00000303469.2_Silent_p.I203I|C1orf112_ENST00000286031.6_5'Flank	NM_033418.2	NP_219486.1	O95568	MET18_HUMAN	methyltransferase like 18	203						cytoplasm (GO:0005737)	protein methyltransferase activity (GO:0008276)			kidney(1)|large_intestine(3)|lung(4)	8						TGAATGCAGTTATACCTAGTA	0.383																																					p.I203I		.											.	METTL18	90	0			c.A609C						.						126.0	129.0	128.0					1																	169762228		2203	4299	6502	SO:0001819	synonymous_variant	92342	exon2			TGCAGTTATACCT	AL035369	CCDS1284.1	1q24.2	2013-10-11	2011-03-02	2011-03-02	ENSG00000171806	ENSG00000171806			28793	protein-coding gene	gene with protein product	"""histidine protein methyltransferase 1"""	615255	"""chromosome 1 open reading frame 156"""	C1orf156		20864530	Standard	NM_033418		Approved	MGC9084, AsTP2, HPM1	uc001ggn.4	O95568	OTTHUMG00000035813	ENST00000310392.4:c.609A>C	1.37:g.169762228T>G		208.0	0.0		294.0	55.0	NM_033418	B2R9T5	Silent	SNP	ENST00000310392.4	37	CCDS1284.1																																																																																			.		0.383	METTL18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087109.1	NM_033418	
MGA	23269	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	42035016	42035016	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A3CJ-01A-11D-A20W-10	TCGA-G3-A3CJ-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b064bc29-9a26-41f6-b49a-ae77a15d4967	fe4fd074-ca2d-42c3-9851-1c874d1f51fd	g.chr15:42035016G>A	ENST00000570161.1	+	14	4858	c.4858G>A	c.(4858-4860)Gac>Aac	p.D1620N	MGA_ENST00000219905.7_Missense_Mutation_p.D1620N|MGA_ENST00000545763.1_Intron|MGA_ENST00000566586.1_Intron|MGA_ENST00000389936.4_Missense_Mutation_p.D1620N			O43451	MGA_HUMAN	MGA, MAX dimerization protein	0	Glucoamylase.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)|starch catabolic process (GO:0005983)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|amylase activity (GO:0016160)|carbohydrate binding (GO:0030246)|catalytic activity (GO:0003824)|glucan 1,4-alpha-glucosidase activity (GO:0004339)|maltose alpha-glucosidase activity (GO:0032450)			NS(1)|breast(4)|central_nervous_system(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(18)|lung(33)|ovary(8)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95		all_cancers(109;0.00356)|all_epithelial(112;0.0413)|all_lung(180;0.18)|Ovarian(310;0.238)		OV - Ovarian serous cystadenocarcinoma(18;1.41e-18)|GBM - Glioblastoma multiforme(113;2.15e-06)|COAD - Colon adenocarcinoma(120;0.031)|Lung(196;0.0721)|BRCA - Breast invasive adenocarcinoma(123;0.0964)|Colorectal(105;0.0998)|LUSC - Lung squamous cell carcinoma(244;0.235)	Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)	TGCTATTTCTGACGTGGAAAC	0.453																																					p.D1620N		.											.	MGA	522	0			c.G4858A						.						88.0	84.0	85.0					15																	42035016		1891	4122	6013	SO:0001583	missense	23269	exon15			ATTTCTGACGTGG	AB011090	CCDS55959.1, CCDS55960.1	15q15	2012-11-15	2012-11-15		ENSG00000174197	ENSG00000174197		"""MAX dimerization proteins"", ""T-boxes"""	14010	protein-coding gene	gene with protein product			"""MAX gene associated"""				Standard	NM_001080541		Approved	KIAA0518, MAD5, MXD5, FLJ12634	uc010ucy.2	Q8IWI9		ENST00000570161.1:c.4858G>A	15.37:g.42035016G>A	ENSP00000457035:p.Asp1620Asn	70.0	0.0		48.0	19.0	NM_001164273	Q0VAX6|Q75ME7|Q86UM5	Missense_Mutation	SNP	ENST00000570161.1	37	CCDS55959.1	.	.	.	.	.	.	.	.	.	.	G	13.82	2.352171	0.41700	.	.	ENSG00000174197	ENST00000219905;ENST00000389936	D;D	0.84800	-1.9;-1.81	4.96	3.97	0.46021	.	1.710450	0.03356	N	0.196836	T	0.71693	0.3370	N	0.14661	0.345	0.80722	D	1	B;B	0.33694	0.421;0.421	B;B	0.27500	0.08;0.058	T	0.67833	-0.5568	10	0.25106	T	0.35	.	4.8545	0.13552	0.187:0.271:0.542:0.0	.	236;1620	B4DVS1;E7ENI0	.;.	N	1620	ENSP00000219905:D1620N;ENSP00000374586:D1620N	ENSP00000219905:D1620N	D	+	1	0	MGA	39822308	0.998000	0.40836	1.000000	0.80357	0.995000	0.86356	2.443000	0.44881	2.577000	0.86979	0.563000	0.77884	GAC	.		0.453	MGA-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000420229.1	NM_001164273.1	
MIP	4284	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	12	56848277	56848277	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A3CJ-01A-11D-A20W-10	TCGA-G3-A3CJ-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b064bc29-9a26-41f6-b49a-ae77a15d4967	fe4fd074-ca2d-42c3-9851-1c874d1f51fd	g.chr12:56848277C>A	ENST00000257979.4	-	1	149	c.121G>T	c.(121-123)Gtt>Ttt	p.V41F	MIP_ENST00000555551.1_Intron	NM_012064.3	NP_036196.1	P30301	MIP_HUMAN	major intrinsic protein of lens fiber	41					canalicular bile acid transport (GO:0015722)|lens development in camera-type eye (GO:0002088)|response to stimulus (GO:0050896)|transmembrane transport (GO:0055085)|visual perception (GO:0007601)|water transport (GO:0006833)	gap junction (GO:0005921)|integral component of plasma membrane (GO:0005887)|intracellular canaliculus (GO:0046691)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)	calmodulin binding (GO:0005516)|structural constituent of eye lens (GO:0005212)|transporter activity (GO:0005215)|water channel activity (GO:0015250)			kidney(1)|large_intestine(2)|lung(8)|prostate(1)|skin(3)|urinary_tract(1)	16						ACCTGCAGAACATGCAGGGGT	0.572																																					p.V41F		.											.	MIP	91	0			c.G121T						.						84.0	80.0	81.0					12																	56848277		2203	4300	6503	SO:0001583	missense	4284	exon1			GCAGAACATGCAG		CCDS8919.1	12q13	2012-10-02				ENSG00000135517		"""Ion channels / Aquaporins"""	7103	protein-coding gene	gene with protein product	aquaporin 0	154050				1840563, 7536742	Standard	NM_012064		Approved	MP26, LIM1, AQP0	uc001slh.3	P30301		ENST00000257979.4:c.121G>T	12.37:g.56848277C>A	ENSP00000257979:p.Val41Phe	439.0	0.0		334.0	127.0	NM_012064	Q17R41	Missense_Mutation	SNP	ENST00000257979.4	37	CCDS8919.1	.	.	.	.	.	.	.	.	.	.	C	18.63	3.665011	0.67700	.	.	ENSG00000135517	ENST00000257979	D	0.85171	-1.95	5.31	3.49	0.39957	Aquaporin-like (2);	0.058543	0.64402	D	0.000002	T	0.79896	0.4525	N	0.16368	0.405	0.58432	D	0.999999	P	0.39376	0.67	P	0.48770	0.589	T	0.78575	-0.2151	10	0.59425	D	0.04	-20.4468	9.2039	0.37278	0.0:0.7625:0.0:0.2375	.	41	P30301	MIP_HUMAN	F	41	ENSP00000257979:V41F	ENSP00000257979:V41F	V	-	1	0	MIP	55134544	0.767000	0.28508	0.978000	0.43139	0.901000	0.52897	0.272000	0.18644	0.749000	0.32854	0.655000	0.94253	GTT	.		0.572	MIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409620.1	NM_012064	
KMT2B	9757	ucsc.edu;bcgsc.ca	37	19	36214634	36214634	+	Splice_Site	SNP	C	C	G	rs373624638		TCGA-G3-A3CJ-01A-11D-A20W-10	TCGA-G3-A3CJ-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b064bc29-9a26-41f6-b49a-ae77a15d4967	fe4fd074-ca2d-42c3-9851-1c874d1f51fd	g.chr19:36214634C>G	ENST00000222270.7	+	8	3060	c.3060C>G	c.(3058-3060)ggC>ggG	p.G1020G	KMT2B_ENST00000607650.1_RNA|KMT2B_ENST00000420124.1_Splice_Site_p.G1020G	NM_014727.1	NP_055542.1	Q9UMN6	KMT2B_HUMAN	lysine (K)-specific methyltransferase 2B	1020					chromatin-mediated maintenance of transcription (GO:0048096)|gene silencing (GO:0016458)|histone H3-K4 methylation (GO:0051568)|histone H3-K4 trimethylation (GO:0080182)|oocyte differentiation (GO:0009994)|ovarian follicle development (GO:0001541)|ovulation (GO:0030728)|regulation of histone H3-K4 methylation (GO:0051569)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)										GTTCCCGCAGCCGGACGATAG	0.637																																					p.G1020G		.											.	MLL4	697	0			c.C3060G						.						11.0	12.0	11.0					19																	36214634		1825	3889	5714	SO:0001630	splice_region_variant	8085	exon8			CCGCAGCCGGACG	AJ007041	CCDS46055.1	19q13.1	2014-02-18			ENSG00000105663	ENSG00000272333		"""Chromatin-modifying enzymes / K-methyltransferases"""	15840	protein-coding gene	gene with protein product	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila) 4"""	606834				10409430, 10637508	Standard	XM_006723513		Approved	KIAA0304, MLL2, TRX2, HRX2, WBP7, MLL1B, MLL4		Q9UMN6	OTTHUMG00000048119	ENST00000222270.7:c.3059-1C>G	19.37:g.36214634C>G		110.0	0.0		49.0	6.0	NM_014727	O15022|O95836|Q96GP2|Q96IP3|Q9UK25|Q9Y668|Q9Y669	Silent	SNP	ENST00000222270.7	37	CCDS46055.1																																																																																			.		0.637	KMT2B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_014727	Silent
MLLT6	4302	hgsc.bcm.edu;bcgsc.ca;mdanderson.org	37	17	36861960	36861960	+	Silent	SNP	C	C	T			TCGA-G3-A3CJ-01A-11D-A20W-10	TCGA-G3-A3CJ-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b064bc29-9a26-41f6-b49a-ae77a15d4967	fe4fd074-ca2d-42c3-9851-1c874d1f51fd	g.chr17:36861960C>T	ENST00000325718.7	+	1	166	c.75C>T	c.(73-75)tgC>tgT	p.C25C	MLLT6_ENST00000378137.5_Silent_p.C25C|CTB-58E17.1_ENST00000563897.1_lincRNA|CTB-58E17.3_ENST00000583409.1_RNA	NM_005937.3	NP_005928	P55198	AF17_HUMAN	myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 6	25					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	zinc ion binding (GO:0008270)			breast(3)|lung(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	8	Breast(7;4.43e-21)					TGGTCTACTGCGATGGGCACG	0.736			T	MLL	AL																																p.C25C		.		Dom	yes		17	17q21	4302	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 6 (AF17)"""		L	.	MLLT6	659	0			c.C75T						.						53.0	46.0	48.0					17																	36861960		2203	4300	6503	SO:0001819	synonymous_variant	4302	exon1			CTACTGCGATGGG		CCDS11327.1	17q21	2014-04-10	2001-11-28		ENSG00000108292	ENSG00000275023		"""Zinc fingers, PHD-type"""	7138	protein-coding gene	gene with protein product	"""Myeloid/lymphoid or mixed-lineage leukemia, translocated to, 6"", ""trithorax homolog"""	600328	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog); translocated to, 6"""			8058765	Standard	NM_005937		Approved	AF17, FLJ23480	uc002hqi.4	P55198	OTTHUMG00000188498	ENST00000325718.7:c.75C>T	17.37:g.36861960C>T		166.0	0.0		88.0	29.0	NM_005937	Q59F28|Q96IU3|Q9H5F6|Q9UF49	Silent	SNP	ENST00000325718.7	37	CCDS11327.1																																																																																			.		0.736	MLLT6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256799.1	NM_005937	
OBSCN	84033	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	228560756	228560756	+	Missense_Mutation	SNP	C	C	G			TCGA-G3-A3CJ-01A-11D-A20W-10	TCGA-G3-A3CJ-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b064bc29-9a26-41f6-b49a-ae77a15d4967	fe4fd074-ca2d-42c3-9851-1c874d1f51fd	g.chr1:228560756C>G	ENST00000422127.1	+	94	22321	c.22277C>G	c.(22276-22278)tCc>tGc	p.S7426C	OBSCN_ENST00000366707.4_Missense_Mutation_p.S5060C|OBSCN_ENST00000570156.2_Missense_Mutation_p.S8383C	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	7426					apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				GAGCACATCTCCCGGATCCTG	0.637																																					p.S8383C		.											.	OBSCN	403	0			c.C25148G						.						21.0	25.0	23.0					1																	228560756		2070	4184	6254	SO:0001583	missense	84033	exon105			ACATCTCCCGGAT	AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.22277C>G	1.37:g.228560756C>G	ENSP00000409493:p.Ser7426Cys	125.0	0.0		184.0	40.0	NM_001271223	Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Missense_Mutation	SNP	ENST00000422127.1	37	CCDS58065.1	.	.	.	.	.	.	.	.	.	.	C	27.1	4.799630	0.90538	.	.	ENSG00000154358	ENST00000422127;ENST00000366707	T;T	0.79033	-1.14;-1.23	5.44	5.44	0.79542	.	.	.	.	.	D	0.82388	0.5026	L	0.32530	0.975	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.81618	-0.0851	9	0.39692	T	0.17	.	16.4183	0.83750	0.0:1.0:0.0:0.0	.	7426	Q5VST9	OBSCN_HUMAN	C	7426;5060	ENSP00000409493:S7426C;ENSP00000355668:S5060C	ENSP00000355668:S5060C	S	+	2	0	OBSCN	226627379	1.000000	0.71417	1.000000	0.80357	0.769000	0.43574	4.248000	0.58760	2.550000	0.86006	0.462000	0.41574	TCC	.		0.637	OBSCN-204	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_052843	
OR2AT4	341152	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	74799967	74799967	+	Silent	SNP	G	G	A			TCGA-G3-A3CJ-01A-11D-A20W-10	TCGA-G3-A3CJ-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b064bc29-9a26-41f6-b49a-ae77a15d4967	fe4fd074-ca2d-42c3-9851-1c874d1f51fd	g.chr11:74799967G>A	ENST00000305159.3	-	1	832	c.792C>T	c.(790-792)taC>taT	p.Y264Y		NM_001005285.1	NP_001005285.1	A6NND4	O2AT4_HUMAN	olfactory receptor, family 2, subfamily AT, member 4	264						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(3)|large_intestine(3)|lung(3)|ovary(1)|upper_aerodigestive_tract(2)	12						TGTAGGCCACGTAGGCTATGG	0.527																																					p.Y264Y		.											.	OR2AT4	69	0			c.C792T						.						93.0	85.0	88.0					11																	74799967		2200	4293	6493	SO:0001819	synonymous_variant	341152	exon1			GGCCACGTAGGCT	BK004820	CCDS31639.1	11q13.4	2012-08-09			ENSG00000171561	ENSG00000171561		"""GPCR / Class A : Olfactory receptors"""	19620	protein-coding gene	gene with protein product							Standard	NM_001005285		Approved		uc010rro.2	A6NND4	OTTHUMG00000165370	ENST00000305159.3:c.792C>T	11.37:g.74799967G>A		235.0	0.0		146.0	69.0	NM_001005285	B9EGZ8	Silent	SNP	ENST00000305159.3	37	CCDS31639.1																																																																																			.		0.527	OR2AT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383734.1	NM_001005285	
OR10G9	219870	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	123894415	123894415	+	Silent	SNP	G	G	C	rs150463109	byFrequency	TCGA-G3-A3CJ-01A-11D-A20W-10	TCGA-G3-A3CJ-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b064bc29-9a26-41f6-b49a-ae77a15d4967	fe4fd074-ca2d-42c3-9851-1c874d1f51fd	g.chr11:123894415G>C	ENST00000375024.1	+	1	696	c.696G>C	c.(694-696)ggG>ggC	p.G232G		NM_001001953.1	NP_001001953.1	Q8NGN4	O10G9_HUMAN	olfactory receptor, family 10, subfamily G, member 9	232						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(33)|prostate(2)|skin(4)|stomach(8)|urinary_tract(1)	61		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0399)		CCTCAGAGGGGAGGCACAGAG	0.542																																					p.G232G		.											.	OR10G9	92	0			c.G696C						.						166.0	144.0	152.0					11																	123894415		2201	4299	6500	SO:0001819	synonymous_variant	219870	exon1			AGAGGGGAGGCAC	AB065756	CCDS31703.1	11q24.1	2012-08-09			ENSG00000236981	ENSG00000236981		"""GPCR / Class A : Olfactory receptors"""	15129	protein-coding gene	gene with protein product				OR10G10P			Standard	NM_001001953		Approved		uc010sad.2	Q8NGN4	OTTHUMG00000165967	ENST00000375024.1:c.696G>C	11.37:g.123894415G>C		441.0	0.0		376.0	172.0	NM_001001953		Silent	SNP	ENST00000375024.1	37	CCDS31703.1																																																																																			G|0.997;T|0.003		0.542	OR10G9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387269.1	NM_001001953	
PCDHGA2	56113	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	5	140720687	140720687	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A3CJ-01A-11D-A20W-10	TCGA-G3-A3CJ-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b064bc29-9a26-41f6-b49a-ae77a15d4967	fe4fd074-ca2d-42c3-9851-1c874d1f51fd	g.chr5:140720687C>T	ENST00000394576.2	+	1	2149	c.2149C>T	c.(2149-2151)Cgg>Tgg	p.R717W	PCDHGA3_ENST00000253812.6_5'Flank|PCDHGA1_ENST00000517417.1_Intron	NM_018915.2	NP_061738.1	Q9Y5H1	PCDG2_HUMAN	protocadherin gamma subfamily A, 2	717					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(20)|lung(32)|ovary(1)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	77			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCACAGGCTGCGGCGCTGGCA	0.642																																					p.R717W		.											.	PCDHGA2	71	0			c.C2149T						.						84.0	88.0	87.0					5																	140720687		2203	4300	6503	SO:0001583	missense	56113	exon1			AGGCTGCGGCGCT	AF152508	CCDS47289.1	5q31	2011-03-28			ENSG00000081853	ENSG00000081853		"""Cadherins / Protocadherins : Clustered"""	8700	other	protocadherin		606289				10380929	Standard	NM_018915		Approved	PCDH-GAMMA-A2		Q9Y5H1	OTTHUMG00000163679	ENST00000394576.2:c.2149C>T	5.37:g.140720687C>T	ENSP00000378077:p.Arg717Trp	399.0	0.0		344.0	131.0	NM_018915	Q52LL6|Q9Y5D5	Missense_Mutation	SNP	ENST00000394576.2	37	CCDS47289.1	.	.	.	.	.	.	.	.	.	.	.	11.29	1.594846	0.28445	.	.	ENSG00000081853	ENST00000394576	T	0.17054	2.3	4.88	-5.05	0.02955	.	0.000000	0.38548	U	0.001643	T	0.16685	0.0401	M	0.66560	2.04	0.19775	N	0.99995	B;B	0.31599	0.33;0.107	B;B	0.33750	0.169;0.03	T	0.19063	-1.0317	10	0.49607	T	0.09	.	12.2431	0.54555	0.4631:0.4704:0.0:0.0665	.	717;717	Q9Y5H1-2;Q9Y5H1	.;PCDG2_HUMAN	W	717	ENSP00000378077:R717W	ENSP00000378077:R717W	R	+	1	2	PCDHGA2	140700871	0.000000	0.05858	0.691000	0.30163	0.028000	0.11728	-0.359000	0.07632	-0.673000	0.05259	0.306000	0.20318	CGG	.		0.642	PCDHGA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374738.1	NM_018915	
PCNXL2	80003	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	1	233334767	233334767	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A3CJ-01A-11D-A20W-10	TCGA-G3-A3CJ-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b064bc29-9a26-41f6-b49a-ae77a15d4967	fe4fd074-ca2d-42c3-9851-1c874d1f51fd	g.chr1:233334767C>A	ENST00000258229.9	-	15	3218	c.2984G>T	c.(2983-2985)gGg>gTg	p.G995V	PCNXL2_ENST00000488780.2_Missense_Mutation_p.G128V	NM_014801.3	NP_055616.3	A6NKB5	PCX2_HUMAN	pecanex-like 2 (Drosophila)	995						integral component of membrane (GO:0016021)				NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(16)|kidney(7)|large_intestine(19)|lung(30)|pancreas(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	86		all_cancers(173;0.0347)|Prostate(94;0.137)				CGAGGTTATCCCAGACACAGC	0.502																																					p.G995V		.											.	PCNXL2	91	0			c.G2984T						.						18.0	19.0	18.0					1																	233334767		1969	4160	6129	SO:0001583	missense	80003	exon15			GTTATCCCAGACA	AK055374	CCDS44335.1	1q42.2	2008-02-05	2001-11-28		ENSG00000135749	ENSG00000135749			8736	protein-coding gene	gene with protein product			"""pecanex (Drosophila)-like 2"""			12477932	Standard	NM_014801		Approved	KIAA0435, FLJ11383	uc001hvl.2	A6NKB5	OTTHUMG00000037824	ENST00000258229.9:c.2984G>T	1.37:g.233334767C>A	ENSP00000258229:p.Gly995Val	398.0	0.0		478.0	312.0	NM_014801	O43162|Q5T9Z8|Q5TDF1|Q8TEP4|Q96HP9|Q9HAL8	Missense_Mutation	SNP	ENST00000258229.9	37	CCDS44335.1	.	.	.	.	.	.	.	.	.	.	C	17.36	3.368733	0.61624	.	.	ENSG00000135749	ENST00000258229;ENST00000488780;ENST00000518351	T;T	0.46819	2.95;0.86	5.33	5.33	0.75918	.	.	.	.	.	T	0.66973	0.2844	M	0.64997	1.995	0.80722	D	1	D	0.71674	0.998	D	0.68621	0.959	T	0.68447	-0.5406	9	0.59425	D	0.04	.	19.0247	0.92927	0.0:1.0:0.0:0.0	.	995	A6NKB5	PCX2_HUMAN	V	995;128;164	ENSP00000258229:G995V;ENSP00000429231:G164V	ENSP00000258229:G995V	G	-	2	0	PCNXL2	231401390	0.998000	0.40836	0.912000	0.35992	0.178000	0.23041	6.539000	0.73856	2.512000	0.84698	0.591000	0.81541	GGG	.		0.502	PCNXL2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092480.3	NM_014801	
PFKL	5211	broad.mit.edu;bcgsc.ca	37	21	45744776	45744776	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A3CJ-01A-11D-A20W-10	TCGA-G3-A3CJ-10A-01D-A20W-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b064bc29-9a26-41f6-b49a-ae77a15d4967	fe4fd074-ca2d-42c3-9851-1c874d1f51fd	g.chr21:45744776A>G	ENST00000349048.4	+	18	1908	c.1853A>G	c.(1852-1854)gAc>gGc	p.D618G	PFKL_ENST00000403390.1_Missense_Mutation_p.D665G	NM_002626.4	NP_002617.3	P17858	PFKAL_HUMAN	phosphofructokinase, liver	618	C-terminal regulatory PFK domain 2.				carbohydrate metabolic process (GO:0005975)|carbohydrate phosphorylation (GO:0046835)|fructose 1,6-bisphosphate metabolic process (GO:0030388)|fructose 6-phosphate metabolic process (GO:0006002)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|negative regulation of insulin secretion (GO:0046676)|protein homotetramerization (GO:0051289)|protein oligomerization (GO:0051259)|response to glucose (GO:0009749)|small molecule metabolic process (GO:0044281)	6-phosphofructokinase complex (GO:0005945)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	6-phosphofructokinase activity (GO:0003872)|ATP binding (GO:0005524)|fructose binding (GO:0070061)|fructose-6-phosphate binding (GO:0070095)|identical protein binding (GO:0042802)|kinase binding (GO:0019900)|metal ion binding (GO:0046872)			cervix(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(10)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	23				Colorectal(79;0.0811)		ATGAAGACAGACATTCAGAGG	0.672																																					p.D618G		.											.	PFKL	251	0			c.A1853G						.						41.0	35.0	37.0					21																	45744776		2194	4297	6491	SO:0001583	missense	5211	exon18			AGACAGACATTCA		CCDS33582.1	21q22.3	1992-12-17			ENSG00000141959	ENSG00000141959	2.7.1.11		8876	protein-coding gene	gene with protein product		171860					Standard	NR_024108		Approved		uc002zel.3	P17858	OTTHUMG00000086910	ENST00000349048.4:c.1853A>G	21.37:g.45744776A>G	ENSP00000269848:p.Asp618Gly	261.0	1.0		190.0	8.0	NM_002626	Q96A64|Q96IH4|Q9BR91	Missense_Mutation	SNP	ENST00000349048.4	37	CCDS33582.1	.	.	.	.	.	.	.	.	.	.	A	5.834	0.338119	0.11013	.	.	ENSG00000141959	ENST00000349048;ENST00000534847;ENST00000403390	T;T	0.75938	-0.98;-0.98	4.74	3.56	0.40772	Phosphofructokinase domain (2);	0.164348	0.52532	D	0.000069	T	0.41488	0.1161	N	0.02973	-0.45	0.41768	D	0.98975	B;B	0.02656	0.0;0.0	B;B	0.12837	0.001;0.008	T	0.36768	-0.9734	10	0.02654	T	1	-24.8737	5.6084	0.17392	0.7353:0.1748:0.0899:0.0	.	618;665	P17858;P17858-2	K6PL_HUMAN;.	G	618;411;665	ENSP00000269848:D618G;ENSP00000384038:D665G	ENSP00000269848:D618G	D	+	2	0	PFKL	44569204	0.949000	0.32298	0.173000	0.22940	0.973000	0.67179	2.849000	0.48286	0.651000	0.30788	0.482000	0.46254	GAC	.		0.672	PFKL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195805.1		
PGM2L1	283209	ucsc.edu;bcgsc.ca	37	11	74056546	74056546	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A3CJ-01A-11D-A20W-10	TCGA-G3-A3CJ-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b064bc29-9a26-41f6-b49a-ae77a15d4967	fe4fd074-ca2d-42c3-9851-1c874d1f51fd	g.chr11:74056546C>A	ENST00000298198.4	-	9	1497	c.1186G>T	c.(1186-1188)Gca>Tca	p.A396S		NM_173582.3	NP_775853.2	Q6PCE3	PGM2L_HUMAN	phosphoglucomutase 2-like 1	396					glucose metabolic process (GO:0006006)|phosphorylation (GO:0016310)	cytosol (GO:0005829)	glucose-1,6-bisphosphate synthase activity (GO:0047933)|intramolecular transferase activity, phosphotransferases (GO:0016868)			NS(2)|breast(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(11)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	26	Breast(11;3.32e-06)					AGTGCAATTGCCTTCAGAATT	0.328																																					p.A396S		.											.	PGM2L1	91	0			c.G1186T						.						100.0	95.0	97.0					11																	74056546		2200	4293	6493	SO:0001583	missense	283209	exon9			CAATTGCCTTCAG	AB019210	CCDS8231.1	11q13.3	2008-12-01			ENSG00000165434	ENSG00000165434			20898	protein-coding gene	gene with protein product	"""glucose-1,6-bisphosphate synthase"""	611610				17804405	Standard	NM_173582		Approved	FLJ32029, BM32A	uc001ovb.1	Q6PCE3	OTTHUMG00000168132	ENST00000298198.4:c.1186G>T	11.37:g.74056546C>A	ENSP00000298198:p.Ala396Ser	110.0	2.0		90.0	38.0	NM_173582	Q96MQ7|Q9UIK3	Missense_Mutation	SNP	ENST00000298198.4	37	CCDS8231.1	.	.	.	.	.	.	.	.	.	.	C	15.50	2.852187	0.51270	.	.	ENSG00000165434	ENST00000298198	T	0.41400	1.0	5.25	5.25	0.73442	Alpha-D-phosphohexomutase, alpha/beta/alpha I/II/III (2);Alpha-D-phosphohexomutase, alpha/beta/alpha domain III (1);	0.172658	0.50627	D	0.000106	T	0.47600	0.1454	M	0.61703	1.905	0.52501	D	0.99995	B	0.24721	0.11	B	0.35114	0.196	T	0.39057	-0.9632	10	0.31617	T	0.26	-15.5412	16.7012	0.85349	0.0:1.0:0.0:0.0	.	396	Q6PCE3	PGM2L_HUMAN	S	396	ENSP00000298198:A396S	ENSP00000298198:A396S	A	-	1	0	PGM2L1	73734194	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.982000	0.56909	2.591000	0.87537	0.650000	0.86243	GCA	.		0.328	PGM2L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398324.1	NM_173582	
PKP3	11187	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	11	397014	397014	+	Silent	SNP	G	G	A			TCGA-G3-A3CJ-01A-11D-A20W-10	TCGA-G3-A3CJ-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b064bc29-9a26-41f6-b49a-ae77a15d4967	fe4fd074-ca2d-42c3-9851-1c874d1f51fd	g.chr11:397014G>A	ENST00000331563.2	+	3	589	c.513G>A	c.(511-513)ggG>ggA	p.G171G		NM_007183.2	NP_009114.1	Q9Y446	PKP3_HUMAN	plakophilin 3	171					desmosome assembly (GO:0002159)|establishment of protein localization to plasma membrane (GO:0090002)|single organismal cell-cell adhesion (GO:0016337)	cell-cell junction (GO:0005911)|desmosome (GO:0030057)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	cell adhesion molecule binding (GO:0050839)			breast(1)|central_nervous_system(1)|endometrium(3)|lung(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	11		all_cancers(49;3.02e-09)|all_epithelial(84;2.09e-06)|Breast(177;0.000162)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.0538)|all_lung(207;0.0713)		all cancers(45;1.56e-27)|Epithelial(43;9.31e-27)|OV - Ovarian serous cystadenocarcinoma(40;1.11e-20)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.0182)|LUSC - Lung squamous cell carcinoma(625;0.0703)		GTGGGGTTGGGAGCCGGGCCG	0.731																																					p.G171G		.											.	PKP3	91	0			c.G513A						.						20.0	23.0	22.0					11																	397014		2190	4283	6473	SO:0001819	synonymous_variant	11187	exon3			GGTTGGGAGCCGG	Z98265	CCDS7695.1	11p15	2013-02-14			ENSG00000184363	ENSG00000184363		"""Armadillo repeat containing"""	9025	protein-coding gene	gene with protein product		605561				10374265	Standard	XM_005252760		Approved		uc001lpc.3	Q9Y446	OTTHUMG00000119068	ENST00000331563.2:c.513G>A	11.37:g.397014G>A		37.0	0.0		40.0	17.0	NM_007183	F8J390|Q53EX8	Silent	SNP	ENST00000331563.2	37	CCDS7695.1																																																																																			.		0.731	PKP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239281.1	NM_007183	
PHLDB1	23187	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	118526376	118526376	+	Silent	SNP	C	C	T			TCGA-G3-A3CJ-01A-11D-A20W-10	TCGA-G3-A3CJ-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b064bc29-9a26-41f6-b49a-ae77a15d4967	fe4fd074-ca2d-42c3-9851-1c874d1f51fd	g.chr11:118526376C>T	ENST00000361417.2	+	22	4347	c.3936C>T	c.(3934-3936)taC>taT	p.Y1312Y	PHLDB1_ENST00000356063.5_Silent_p.Y1265Y|PHLDB1_ENST00000527898.1_Silent_p.Y363Y|PHLDB1_ENST00000524713.1_Silent_p.Y455Y|PHLDB1_ENST00000534672.1_3'UTR	NM_015157.3	NP_055972.1	Q86UU1	PHLB1_HUMAN	pleckstrin homology-like domain, family B, member 1	1312	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.									breast(3)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(10)|liver(3)|lung(14)|ovary(2)|pancreas(1)|prostate(3)|skin(1)	46	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0523)|all_hematologic(192;0.0735)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;3.4e-05)		AAGTGTACTACGACCACCTGC	0.607																																					p.Y1312Y		.											.	PHLDB1	90	0			c.C3936T						.						110.0	93.0	99.0					11																	118526376		2200	4295	6495	SO:0001819	synonymous_variant	23187	exon21			GTACTACGACCAC		CCDS8401.1, CCDS44750.1	11q23.3	2013-01-10			ENSG00000019144	ENSG00000019144		"""Pleckstrin homology (PH) domain containing"""	23697	protein-coding gene	gene with protein product		612834				14532993	Standard	NM_015157		Approved	FLJ00141, LL5a, KIAA0638	uc001pts.3	Q86UU1	OTTHUMG00000166341	ENST00000361417.2:c.3936C>T	11.37:g.118526376C>T		88.0	0.0		64.0	27.0	NM_001144758	B0YJ63|B0YJ64|O75133|Q4KMF8|Q8TEQ2	Silent	SNP	ENST00000361417.2	37	CCDS8401.1																																																																																			.		0.607	PHLDB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389279.1	NM_015157	
PLEKHB2	55041	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	131884342	131884342	+	Silent	SNP	A	A	G			TCGA-G3-A3CJ-01A-11D-A20W-10	TCGA-G3-A3CJ-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b064bc29-9a26-41f6-b49a-ae77a15d4967	fe4fd074-ca2d-42c3-9851-1c874d1f51fd	g.chr2:131884342A>G	ENST00000403716.1	+	4	836	c.276A>G	c.(274-276)gaA>gaG	p.E92E	PLEKHB2_ENST00000303908.3_Silent_p.E92E|PLEKHB2_ENST00000404460.1_Silent_p.E92E|PLEKHB2_ENST00000409612.1_Silent_p.E92E|PLEKHB2_ENST00000538982.1_Silent_p.E44E|PLEKHB2_ENST00000438882.2_Silent_p.E92E|PLEKHB2_ENST00000409279.1_Silent_p.E92E|PLEKHB2_ENST00000234115.6_Silent_p.E92E|PLEKHB2_ENST00000439822.2_Silent_p.E92E|PLEKHB2_ENST00000409158.1_Silent_p.E92E	NM_001100623.1|NM_001267062.1|NM_001267063.1|NM_001267064.1|NM_001267065.1|NM_001267066.1|NM_017958.2	NP_001094093.1|NP_001253991.1|NP_001253992.1|NP_001253993.1|NP_001253994.1|NP_001253995.1|NP_060428.2	Q96CS7	PKHB2_HUMAN	pleckstrin homology domain containing, family B (evectins) member 2	92	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.					endosome (GO:0005768)|membrane (GO:0016020)				large_intestine(1)|lung(3)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	9				BRCA - Breast invasive adenocarcinoma(221;0.0828)		TTTGTGCAGAAAGCACAGATG	0.343																																					p.E92E		.											.	PLEKHB2	92	0			c.A276G						.						109.0	108.0	108.0					2																	131884342		2203	4300	6503	SO:0001819	synonymous_variant	55041	exon4			TGCAGAAAGCACA		CCDS2166.1, CCDS46413.1, CCDS58729.1, CCDS58730.1, CCDS74576.1, CCDS74577.1	2q22.1	2013-01-10			ENSG00000115762	ENSG00000115762		"""Pleckstrin homology (PH) domain containing"""	19236	protein-coding gene	gene with protein product						10200314	Standard	NM_017958		Approved	EVT2, FLJ20783	uc031rpd.1	Q96CS7	OTTHUMG00000131656	ENST00000403716.1:c.276A>G	2.37:g.131884342A>G		102.0	0.0		94.0	36.0	NM_001267062	B4DF08|B4DZ66|B8ZZN1|Q53FF1|Q53TH7|Q86W37|Q9BV75|Q9NWK1	Silent	SNP	ENST00000403716.1	37	CCDS46413.1																																																																																			.		0.343	PLEKHB2-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000331304.2	NM_017958	
PKP4	8502	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	2	159499020	159499020	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A3CJ-01A-11D-A20W-10	TCGA-G3-A3CJ-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b064bc29-9a26-41f6-b49a-ae77a15d4967	fe4fd074-ca2d-42c3-9851-1c874d1f51fd	g.chr2:159499020A>G	ENST00000389759.3	+	11	1830	c.1718A>G	c.(1717-1719)aAg>aGg	p.K573R	PKP4_ENST00000389757.3_Missense_Mutation_p.K573R	NM_003628.3	NP_003619.2	Q99569	PKP4_HUMAN	plakophilin 4	573					cell-cell junction assembly (GO:0007043)|cell-cell signaling (GO:0007267)|positive regulation of cytokinesis (GO:0032467)|positive regulation of gene expression (GO:0010628)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of cell adhesion (GO:0030155)|single organismal cell-cell adhesion (GO:0016337)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytoskeleton (GO:0005856)|desmosome (GO:0030057)|midbody (GO:0030496)|mitotic spindle (GO:0072686)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|spindle midzone (GO:0051233)|spindle pole (GO:0000922)				breast(2)|central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(9)|lung(21)|ovary(6)|skin(5)|upper_aerodigestive_tract(6)|urinary_tract(1)	61						GGGGGAATCAAGCATCTGGTT	0.418										HNSCC(62;0.18)																											p.K573R		.											.	PKP4	97	0			c.A1718G						.						110.0	112.0	111.0					2																	159499020		2203	4300	6503	SO:0001583	missense	8502	exon11			GAATCAAGCATCT	X81889	CCDS33305.1, CCDS33306.1	2q24.1	2013-02-14			ENSG00000144283	ENSG00000144283		"""Armadillo repeat containing"""	9026	protein-coding gene	gene with protein product		604276				9342840, 8937994	Standard	NM_003628		Approved	p0071	uc002tzv.3	Q99569	OTTHUMG00000153969	ENST00000389759.3:c.1718A>G	2.37:g.159499020A>G	ENSP00000374409:p.Lys573Arg	130.0	0.0		126.0	43.0	NM_001005476	Q86W91	Missense_Mutation	SNP	ENST00000389759.3	37	CCDS33305.1	.	.	.	.	.	.	.	.	.	.	A	14.97	2.693650	0.48202	.	.	ENSG00000144283	ENST00000428353;ENST00000389757;ENST00000389759;ENST00000389756	T;T	0.68765	-0.35;-0.35	5.87	5.87	0.94306	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.55705	0.1937	N	0.12182	0.205	0.49299	D	0.999776	B;B;B;B;B	0.32302	0.363;0.107;0.073;0.053;0.313	B;B;B;B;B	0.38194	0.267;0.078;0.031;0.039;0.137	T	0.60434	-0.7264	10	0.56958	D	0.05	-16.9594	16.2813	0.82687	1.0:0.0:0.0:0.0	.	425;528;573;573;424	Q6LCG8;Q4W5T8;Q99569-2;Q99569;F8W7E2	.;.;.;PKP4_HUMAN;.	R	424;573;573;61	ENSP00000374407:K573R;ENSP00000374409:K573R	ENSP00000374406:K61R	K	+	2	0	PKP4	159207266	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.100000	0.71473	2.244000	0.73946	0.533000	0.62120	AAG	.		0.418	PKP4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333250.1		
POLR2B	5431	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	57883331	57883331	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A3CJ-01A-11D-A20W-10	TCGA-G3-A3CJ-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b064bc29-9a26-41f6-b49a-ae77a15d4967	fe4fd074-ca2d-42c3-9851-1c874d1f51fd	g.chr4:57883331A>G	ENST00000381227.1	+	16	2491	c.2078A>G	c.(2077-2079)tAt>tGt	p.Y693C	POLR2B_ENST00000314595.5_Missense_Mutation_p.Y693C|POLR2B_ENST00000441246.2_Missense_Mutation_p.Y686C|POLR2B_ENST00000431623.2_Missense_Mutation_p.Y618C			P30876	RPB2_HUMAN	polymerase (RNA) II (DNA directed) polypeptide B, 140kDa	693					7-methylguanosine mRNA capping (GO:0006370)|DNA repair (GO:0006281)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|nucleotide-excision repair (GO:0006289)|positive regulation of viral transcription (GO:0050434)|RNA splicing (GO:0008380)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription-coupled nucleotide-excision repair (GO:0006283)|viral process (GO:0016032)	DNA-directed RNA polymerase II, core complex (GO:0005665)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|ribonucleoside binding (GO:0032549)			breast(1)|central_nervous_system(2)|endometrium(6)|kidney(10)|large_intestine(9)|lung(17)|ovary(2)|prostate(4)|skin(1)	52	Glioma(25;0.08)|all_neural(26;0.181)					TGTTCCACATATACACACTGT	0.408																																					p.Y693C		.											.	POLR2B	92	0			c.A2078G						.						324.0	298.0	307.0					4																	57883331		2203	4300	6503	SO:0001583	missense	5431	exon15			CCACATATACACA		CCDS3511.1	4q12	2013-01-21	2002-08-29		ENSG00000047315	ENSG00000047315		"""RNA polymerase subunits"""	9188	protein-coding gene	gene with protein product		180661	"""polymerase (RNA) II (DNA directed) polypeptide B (140kD)"""			1518060, 8034326	Standard	NM_000938		Approved	RPB2	uc003hcl.1	P30876	OTTHUMG00000128771	ENST00000381227.1:c.2078A>G	4.37:g.57883331A>G	ENSP00000370625:p.Tyr693Cys	440.0	1.0		357.0	153.0	NM_000938	A8K1A8|Q8IZ61	Missense_Mutation	SNP	ENST00000381227.1	37	CCDS3511.1	.	.	.	.	.	.	.	.	.	.	A	19.18	3.776910	0.70107	.	.	ENSG00000047315	ENST00000381227;ENST00000431623;ENST00000441246;ENST00000314595	T;T;T;T	0.78126	-1.15;-1.15;-1.15;-1.15	4.91	4.91	0.64330	RNA polymerase Rpb2, domain 5 (1);	0.000000	0.85682	D	0.000000	D	0.90473	0.7016	H	0.94345	3.525	0.80722	D	1	D;D	0.69078	0.993;0.997	D;D	0.66351	0.943;0.943	D	0.93205	0.6595	10	0.87932	D	0	.	14.828	0.70128	1.0:0.0:0.0:0.0	.	618;693	C9J4M6;P30876	.;RPB2_HUMAN	C	693;618;686;693	ENSP00000370625:Y693C;ENSP00000391096:Y618C;ENSP00000391452:Y686C;ENSP00000312735:Y693C	ENSP00000312735:Y693C	Y	+	2	0	POLR2B	57578088	1.000000	0.71417	0.151000	0.22473	0.886000	0.51366	9.283000	0.95860	1.956000	0.56807	0.379000	0.24179	TAT	.		0.408	POLR2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250692.1	NM_000938	
PPA1	5464	hgsc.bcm.edu;bcgsc.ca	37	10	71969338	71969338	+	Silent	SNP	C	C	A	rs79719906	byFrequency	TCGA-G3-A3CJ-01A-11D-A20W-10	TCGA-G3-A3CJ-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b064bc29-9a26-41f6-b49a-ae77a15d4967	fe4fd074-ca2d-42c3-9851-1c874d1f51fd	g.chr10:71969338C>A	ENST00000373232.3	-	7	714	c.615G>T	c.(613-615)gcG>gcT	p.A205A		NM_021129.3	NP_066952.1	Q15181	IPYR_HUMAN	pyrophosphatase (inorganic) 1	205					diphosphate metabolic process (GO:0071344)|gene expression (GO:0010467)|phosphate-containing compound metabolic process (GO:0006796)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	inorganic diphosphatase activity (GO:0004427)|magnesium ion binding (GO:0000287)			breast(2)|endometrium(1)|large_intestine(2)|lung(3)|skin(2)	10						CTGCATTAAACGCAAACTCAT	0.358																																					p.A205A		.											.	PPA1	153	0			c.G615T						.						113.0	110.0	111.0					10																	71969338		2203	4300	6503	SO:0001819	synonymous_variant	5464	exon7			ATTAAACGCAAAC	AF154065	CCDS7299.1	10q11.1-q24	2012-10-02	2005-10-07	2005-10-07	ENSG00000180817	ENSG00000180817	3.6.1.1		9226	protein-coding gene	gene with protein product	"""cytosolic inorganic pyrophosphatase"", ""inorganic pyrophosphatase 1"", ""pyrophosphate phospho-hydrolase"""	179030	"""pyrophosphatase (inorganic)"""	PP		10542310, 975879	Standard	NM_021129		Approved	SID6-8061, Ppase, IOPPP, PP1	uc001jqv.1	Q15181	OTTHUMG00000018399	ENST00000373232.3:c.615G>T	10.37:g.71969338C>A		246.0	0.0		174.0	18.0	NM_021129	Q2M348|Q5SQT7|Q6P7P4|Q9UQJ5|Q9Y5B1	Silent	SNP	ENST00000373232.3	37	CCDS7299.1																																																																																			C|0.987;A|0.013		0.358	PPA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048490.2	NM_021129	
PPA1	5464	hgsc.bcm.edu;bcgsc.ca	37	10	71969401	71969401	+	Silent	SNP	T	T	C	rs150430650		TCGA-G3-A3CJ-01A-11D-A20W-10	TCGA-G3-A3CJ-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b064bc29-9a26-41f6-b49a-ae77a15d4967	fe4fd074-ca2d-42c3-9851-1c874d1f51fd	g.chr10:71969401T>C	ENST00000373232.3	-	7	651	c.552A>G	c.(550-552)gaA>gaG	p.E184E		NM_021129.3	NP_066952.1	Q15181	IPYR_HUMAN	pyrophosphatase (inorganic) 1	184					diphosphate metabolic process (GO:0071344)|gene expression (GO:0010467)|phosphate-containing compound metabolic process (GO:0006796)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	inorganic diphosphatase activity (GO:0004427)|magnesium ion binding (GO:0000287)			breast(2)|endometrium(1)|large_intestine(2)|lung(3)|skin(2)	10						CCACAGTAGCTTCTAAGTAGC	0.343																																					p.E184E		.											.	PPA1	153	0			c.A552G						.						108.0	111.0	110.0					10																	71969401		2203	4300	6503	SO:0001819	synonymous_variant	5464	exon7			AGTAGCTTCTAAG	AF154065	CCDS7299.1	10q11.1-q24	2012-10-02	2005-10-07	2005-10-07	ENSG00000180817	ENSG00000180817	3.6.1.1		9226	protein-coding gene	gene with protein product	"""cytosolic inorganic pyrophosphatase"", ""inorganic pyrophosphatase 1"", ""pyrophosphate phospho-hydrolase"""	179030	"""pyrophosphatase (inorganic)"""	PP		10542310, 975879	Standard	NM_021129		Approved	SID6-8061, Ppase, IOPPP, PP1	uc001jqv.1	Q15181	OTTHUMG00000018399	ENST00000373232.3:c.552A>G	10.37:g.71969401T>C		337.0	0.0		252.0	18.0	NM_021129	Q2M348|Q5SQT7|Q6P7P4|Q9UQJ5|Q9Y5B1	Silent	SNP	ENST00000373232.3	37	CCDS7299.1																																																																																			.		0.343	PPA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048490.2	NM_021129	
PRICKLE1	144165	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	12	42858256	42858256	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A3CJ-01A-11D-A20W-10	TCGA-G3-A3CJ-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b064bc29-9a26-41f6-b49a-ae77a15d4967	fe4fd074-ca2d-42c3-9851-1c874d1f51fd	g.chr12:42858256A>G	ENST00000455697.1	-	7	1865	c.1580T>C	c.(1579-1581)cTg>cCg	p.L527P	PRICKLE1_ENST00000552240.1_Missense_Mutation_p.L527P|RP11-328C8.4_ENST00000547824.1_RNA|PRICKLE1_ENST00000445766.2_Missense_Mutation_p.L527P|PRICKLE1_ENST00000345127.3_Missense_Mutation_p.L527P|PRICKLE1_ENST00000548696.1_Missense_Mutation_p.L527P	NM_001144882.1|NM_001144883.1	NP_001138354.1|NP_001138355.1	Q96MT3	PRIC1_HUMAN	prickle homolog 1 (Drosophila)	527					negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cardiac muscle cell myoblast differentiation (GO:2000691)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube closure (GO:0001843)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein ubiquitination (GO:0031398)|protein import into nucleus (GO:0006606)	cytosol (GO:0005829)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)			NS(1)|breast(2)|endometrium(4)|kidney(2)|large_intestine(12)|liver(1)|lung(13)|ovary(3)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	47	all_cancers(12;4.25e-05)|Breast(8;0.176)			GBM - Glioblastoma multiforme(48;0.2)		CTCTGGTTTCAGGTCTGACAG	0.443																																					p.L527P		.											.	PRICKLE1	518	0			c.T1580C						.						140.0	137.0	138.0					12																	42858256		2203	4300	6503	SO:0001583	missense	144165	exon7			GGTTTCAGGTCTG	AK056499	CCDS8742.1	12p11-q12	2010-08-13	2006-09-12			ENSG00000139174			17019	protein-coding gene	gene with protein product		608500	"""prickle-like 1 (Drosophila)"""			12525887, 18976727	Standard	NM_153026		Approved	FLJ31937, EPM1B	uc010skv.2	Q96MT3		ENST00000455697.1:c.1580T>C	12.37:g.42858256A>G	ENSP00000401060:p.Leu527Pro	328.0	0.0		266.0	96.0	NM_001144882	Q14C83|Q71QF8|Q96N00	Missense_Mutation	SNP	ENST00000455697.1	37	CCDS8742.1	.	.	.	.	.	.	.	.	.	.	A	17.45	3.391579	0.62066	.	.	ENSG00000139174	ENST00000455697;ENST00000445766;ENST00000548696;ENST00000345127;ENST00000552240	T;T;T;T;T	0.66280	-0.2;-0.2;-0.2;-0.2;-0.2	5.55	5.55	0.83447	.	0.079095	0.56097	D	0.000038	T	0.77301	0.4110	M	0.72894	2.215	0.80722	D	1	D	0.89917	1.0	D	0.66351	0.943	T	0.79999	-0.1566	10	0.72032	D	0.01	-10.8538	15.993	0.80220	1.0:0.0:0.0:0.0	.	527	Q96MT3	PRIC1_HUMAN	P	527	ENSP00000401060:L527P;ENSP00000398947:L527P;ENSP00000448359:L527P;ENSP00000345064:L527P;ENSP00000449819:L527P	ENSP00000345064:L527P	L	-	2	0	PRICKLE1	41144523	1.000000	0.71417	0.995000	0.50966	0.983000	0.72400	8.910000	0.92685	2.236000	0.73375	0.528000	0.53228	CTG	.		0.443	PRICKLE1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404069.1		
PSMD12	5718	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	65346351	65346351	+	Silent	SNP	T	T	C			TCGA-G3-A3CJ-01A-11D-A20W-10	TCGA-G3-A3CJ-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b064bc29-9a26-41f6-b49a-ae77a15d4967	fe4fd074-ca2d-42c3-9851-1c874d1f51fd	g.chr17:65346351T>C	ENST00000356126.3	-	4	506	c.399A>G	c.(397-399)gaA>gaG	p.E133E	PSMD12_ENST00000581618.1_5'Flank|PSMD12_ENST00000357146.4_Silent_p.E113E	NM_002816.3	NP_002807.1	O00232	PSD12_HUMAN	proteasome (prosome, macropain) 26S subunit, non-ATPase, 12	133					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)|proteasome regulatory particle (GO:0005838)				breast(1)|large_intestine(4)|lung(6)|pancreas(1)|urinary_tract(1)	13	all_cancers(12;2.38e-11)|all_epithelial(3;8.27e-13)					TTACCTTGCCTTCGGTAACCA	0.318																																					p.E133E		.											.	PSMD12	90	0			c.A399G						.						76.0	70.0	72.0					17																	65346351		2203	4300	6503	SO:0001819	synonymous_variant	5718	exon4			CTTGCCTTCGGTA	AB003103	CCDS11669.1, CCDS11670.1	17q24.3	2008-05-22			ENSG00000197170	ENSG00000197170		"""Proteasome (prosome, macropain) subunits"""	9557	protein-coding gene	gene with protein product		604450				9426256	Standard	NM_002816		Approved	p55, Rpn5	uc002jfy.3	O00232	OTTHUMG00000140376	ENST00000356126.3:c.399A>G	17.37:g.65346351T>C		137.0	0.0		154.0	47.0	NM_002816	A6NP15|Q53HA2|Q6P053	Silent	SNP	ENST00000356126.3	37	CCDS11669.1																																																																																			.		0.318	PSMD12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000277103.1	NM_002816, NM_174871	
PTPN13	5783	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	87735675	87735675	+	Missense_Mutation	SNP	C	C	A	rs373179030		TCGA-G3-A3CJ-01A-11D-A20W-10	TCGA-G3-A3CJ-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b064bc29-9a26-41f6-b49a-ae77a15d4967	fe4fd074-ca2d-42c3-9851-1c874d1f51fd	g.chr4:87735675C>A	ENST00000411767.2	+	48	7492	c.7429C>A	c.(7429-7431)Caa>Aaa	p.Q2477K	PTPN13_ENST00000436978.1_Missense_Mutation_p.Q2482K|PTPN13_ENST00000316707.6_Missense_Mutation_p.Q2286K|PTPN13_ENST00000511467.1_Missense_Mutation_p.Q2482K|PTPN13_ENST00000427191.2_Missense_Mutation_p.Q2458K			Q12923	PTN13_HUMAN	protein tyrosine phosphatase, non-receptor type 13 (APO-1/CD95 (Fas)-associated phosphatase)	2477					peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cell body (GO:0044297)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|lamellipodium (GO:0030027)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein tyrosine phosphatase activity (GO:0004725)			NS(4)|breast(3)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(12)|large_intestine(23)|lung(24)|ovary(4)|prostate(3)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(2)	93		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.242)		OV - Ovarian serous cystadenocarcinoma(123;0.00082)		AGAAGAAGAGCAAAAACAGCA	0.413																																					p.Q2482K		.											.	PTPN13	230	0			c.C7444A						.						90.0	84.0	86.0					4																	87735675		1880	4115	5995	SO:0001583	missense	5783	exon48			GAAGAGCAAAAAC		CCDS47093.1, CCDS47094.1, CCDS47095.1, CCDS47096.1	4q21.3	2011-06-09			ENSG00000163629	ENSG00000163629		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9646	protein-coding gene	gene with protein product		600267				8287977	Standard	NM_006264		Approved	PTP1E, PTP-BAS, PTPL1, PTP-BL	uc003hpy.3	Q12923	OTTHUMG00000160968	ENST00000411767.2:c.7429C>A	4.37:g.87735675C>A	ENSP00000407249:p.Gln2477Lys	565.0	0.0		404.0	180.0	NM_080685	B2RTR0|Q15159|Q15263|Q15264|Q15265|Q15674|Q16826|Q8IWH7|Q9NYN9|Q9UDA8	Missense_Mutation	SNP	ENST00000411767.2	37	CCDS47094.1	.	.	.	.	.	.	.	.	.	.	C	14.56	2.572041	0.45798	.	.	ENSG00000163629	ENST00000427191;ENST00000436978;ENST00000316707;ENST00000411767;ENST00000511467;ENST00000357349	T;T;T;T;T	0.52295	0.67;0.7;0.78;0.67;0.7	5.64	4.79	0.61399	.	0.353216	0.21743	N	0.069799	T	0.26666	0.0652	N	0.04508	-0.205	0.24922	N	0.991978	B;B;B;B	0.12630	0.006;0.006;0.004;0.006	B;B;B;B	0.10450	0.005;0.005;0.002;0.005	T	0.18116	-1.0347	10	0.46703	T	0.11	.	11.7022	0.51577	0.1389:0.7275:0.1336:0.0	.	2286;2458;2477;2482	Q12923-2;Q12923-3;Q12923;Q12923-4	.;.;PTN13_HUMAN;.	K	2458;2482;2286;2477;2482;2426	ENSP00000408368:Q2458K;ENSP00000394794:Q2482K;ENSP00000322675:Q2286K;ENSP00000407249:Q2477K;ENSP00000426626:Q2482K	ENSP00000322675:Q2286K	Q	+	1	0	PTPN13	87954699	0.945000	0.32115	0.339000	0.25562	0.917000	0.54804	2.537000	0.45702	1.510000	0.48803	0.563000	0.77884	CAA	.		0.413	PTPN13-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000363191.1		
RABGAP1	23637	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	125772702	125772702	+	Missense_Mutation	SNP	G	G	C			TCGA-G3-A3CJ-01A-11D-A20W-10	TCGA-G3-A3CJ-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b064bc29-9a26-41f6-b49a-ae77a15d4967	fe4fd074-ca2d-42c3-9851-1c874d1f51fd	g.chr9:125772702G>C	ENST00000373647.4	+	11	1578	c.1444G>C	c.(1444-1446)Gaa>Caa	p.E482Q		NM_012197.3	NP_036329.3	Q9Y3P9	RBGP1_HUMAN	RAB GTPase activating protein 1	482					cell cycle (GO:0007049)|positive regulation of GTPase activity (GO:0043547)|regulation of GTP catabolic process (GO:0033124)	centrosome (GO:0005813)|cytosol (GO:0005829)|microtubule associated complex (GO:0005875)	DNA binding (GO:0003677)|GTPase activator activity (GO:0005096)|Rab GTPase activator activity (GO:0005097)|Rab GTPase binding (GO:0017137)|tubulin binding (GO:0015631)			breast(3)|endometrium(3)|kidney(5)|large_intestine(8)|lung(11)|ovary(3)|prostate(4)|stomach(3)|upper_aerodigestive_tract(1)	41						AAGTGAATCAGAAAGAGAGAG	0.383																																					p.E482Q		.											.	RABGAP1	500	0			c.G1444C						.						108.0	103.0	105.0					9																	125772702		2203	4300	6503	SO:0001583	missense	23637	exon11			GAATCAGAAAGAG	AJ011679	CCDS6848.2	9q34.11	2013-07-09			ENSG00000011454	ENSG00000011454			17155	protein-coding gene	gene with protein product	"""rab6 GTPase activating protein (GAP and centrosome-associated)"", ""TBC1 domain family, member 11"""	615882				10202141	Standard	NM_012197		Approved	GAPCenA, TBC1D11	uc011lzh.2	Q9Y3P9	OTTHUMG00000020633	ENST00000373647.4:c.1444G>C	9.37:g.125772702G>C	ENSP00000362751:p.Glu482Gln	84.0	0.0		75.0	30.0	NM_012197	B9A6L2|Q05CW2|Q6ZMY1|Q9HA28|Q9P0E2|Q9UG67	Missense_Mutation	SNP	ENST00000373647.4	37	CCDS6848.2	.	.	.	.	.	.	.	.	.	.	G	19.71	3.878331	0.72294	.	.	ENSG00000011454	ENST00000373647	T	0.06608	3.28	5.71	5.71	0.89125	.	0.059702	0.64402	D	0.000004	T	0.08268	0.0206	L	0.38953	1.18	0.80722	D	1	B	0.26672	0.156	B	0.21546	0.035	T	0.23226	-1.0194	10	0.42905	T	0.14	-19.9126	19.85	0.96736	0.0:0.0:1.0:0.0	.	482	Q9Y3P9	RBGP1_HUMAN	Q	482	ENSP00000362751:E482Q	ENSP00000362751:E482Q	E	+	1	0	RABGAP1	124812523	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.842000	0.92136	2.697000	0.92050	0.563000	0.77884	GAA	.		0.383	RABGAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053976.3	NM_012197	
RAD54B	25788	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	95390864	95390864	+	Splice_Site	SNP	T	T	C			TCGA-G3-A3CJ-01A-11D-A20W-10	TCGA-G3-A3CJ-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b064bc29-9a26-41f6-b49a-ae77a15d4967	fe4fd074-ca2d-42c3-9851-1c874d1f51fd	g.chr8:95390864T>C	ENST00000336148.5	-	13	2372		c.e13-2			NM_012415.3	NP_036547.1	Q9Y620	RA54B_HUMAN	RAD54 homolog B (S. cerevisiae)						ATP catabolic process (GO:0006200)|DNA duplex unwinding (GO:0032508)|double-strand break repair via homologous recombination (GO:0000724)|mitotic recombination (GO:0006312)|reciprocal meiotic recombination (GO:0007131)	nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA translocase activity (GO:0015616)|RNA helicase activity (GO:0003724)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(10)|lung(15)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	39	Breast(36;4.5e-05)		BRCA - Breast invasive adenocarcinoma(8;0.00217)			AGACATTGCCTATAGAAAATA	0.348								Direct reversal of damage;Homologous recombination																													.		.											.	RAD54B	539	0			c.1696-2A>G						.						73.0	74.0	74.0					8																	95390864		2203	4299	6502	SO:0001630	splice_region_variant	25788	exon12			ATTGCCTATAGAA	AF112481	CCDS6262.1, CCDS56546.1, CCDS75768.1	8q22.1	2014-08-08			ENSG00000197275	ENSG00000197275			17228	protein-coding gene	gene with protein product		604289				10362364, 10851248	Standard	NM_012415		Approved	RDH54	uc003ygk.3	Q9Y620	OTTHUMG00000133658	ENST00000336148.5:c.2248-2A>G	8.37:g.95390864T>C		101.0	0.0		97.0	28.0	NM_001205263	F6WBS8	Splice_Site	SNP	ENST00000336148.5	37	CCDS6262.1	.	.	.	.	.	.	.	.	.	.	T	24.7	4.560588	0.86335	.	.	ENSG00000197275	ENST00000336148;ENST00000546218	.	.	.	5.57	5.57	0.84162	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.7397	0.77882	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	RAD54B	95460040	1.000000	0.71417	0.982000	0.44146	0.982000	0.71751	7.582000	0.82546	2.121000	0.65114	0.533000	0.62120	.	.		0.348	RAD54B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257806.3	NM_012415	Intron
RFC5	5985	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	118464801	118464801	+	Missense_Mutation	SNP	A	A	C			TCGA-G3-A3CJ-01A-11D-A20W-10	TCGA-G3-A3CJ-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b064bc29-9a26-41f6-b49a-ae77a15d4967	fe4fd074-ca2d-42c3-9851-1c874d1f51fd	g.chr12:118464801A>C	ENST00000454402.2	+	8	889	c.771A>C	c.(769-771)caA>caC	p.Q257H	RFC5_ENST00000543153.1_3'UTR|RFC5_ENST00000229043.3_Missense_Mutation_p.Q172H|RFC5_ENST00000392542.2_Missense_Mutation_p.Q236H	NM_001206801.1|NM_007370.5	NP_001193730.1|NP_031396.1	P40937	RFC5_HUMAN	replication factor C (activator 1) 5, 36.5kDa	257					DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA strand elongation involved in DNA replication (GO:0006271)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA gap filling (GO:0006297)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|transcription-coupled nucleotide-excision repair (GO:0006283)	DNA replication factor C complex (GO:0005663)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)			NS(1)|breast(1)|endometrium(1)|large_intestine(3)|lung(3)	9	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					TGTTGAATCAAGATTTCACCA	0.547																																					p.Q257H		.											.	RFC5	227	0			c.A771C						.						141.0	139.0	140.0					12																	118464801		2203	4300	6503	SO:0001583	missense	5985	exon8			GAATCAAGATTTC		CCDS9185.1, CCDS41843.2	12q24.3	2010-04-21	2002-08-29		ENSG00000111445	ENSG00000111445		"""ATPases / AAA-type"""	9973	protein-coding gene	gene with protein product		600407	"""replication factor C (activator 1) 5 (36.5kD)"""			7774928	Standard	NM_007370		Approved	RFC36	uc001twq.3	P40937	OTTHUMG00000156438	ENST00000454402.2:c.771A>C	12.37:g.118464801A>C	ENSP00000408295:p.Gln257His	123.0	0.0		72.0	30.0	NM_007370	A8MZ62|B3KSX8	Missense_Mutation	SNP	ENST00000454402.2	37	CCDS9185.1	.	.	.	.	.	.	.	.	.	.	A	14.60	2.582831	0.46006	.	.	ENSG00000111445	ENST00000229043;ENST00000454402;ENST00000392542	T;T;T	0.43688	0.94;0.94;0.94	5.75	-2.69	0.06022	Replication factor C (1);DNA polymerase III, clamp loader complex, gamma/delta/delta subunit, C-terminal (1);	0.387817	0.30483	N	0.009530	T	0.20780	0.0500	N	0.14661	0.345	0.33998	D	0.649963	B;B;B	0.06786	0.0;0.001;0.001	B;B;B	0.12837	0.005;0.008;0.008	T	0.03249	-1.1056	10	0.52906	T	0.07	-8.3921	7.9384	0.29944	0.3877:0.1176:0.4947:0.0	.	236;271;257	A8MZ62;Q59GW7;P40937	.;.;RFC5_HUMAN	H	172;257;236	ENSP00000229043:Q172H;ENSP00000408295:Q257H;ENSP00000376325:Q236H	ENSP00000229043:Q172H	Q	+	3	2	RFC5	116949184	0.971000	0.33674	0.938000	0.37757	0.930000	0.56654	0.192000	0.17096	-0.374000	0.07967	-0.316000	0.08728	CAA	.		0.547	RFC5-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344196.2	NM_007370	
RFC5	5985	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	12	118464813	118464813	+	Silent	SNP	A	A	G			TCGA-G3-A3CJ-01A-11D-A20W-10	TCGA-G3-A3CJ-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b064bc29-9a26-41f6-b49a-ae77a15d4967	fe4fd074-ca2d-42c3-9851-1c874d1f51fd	g.chr12:118464813A>G	ENST00000454402.2	+	8	901	c.783A>G	c.(781-783)acA>acG	p.T261T	RFC5_ENST00000543153.1_3'UTR|RFC5_ENST00000229043.3_Silent_p.T176T|RFC5_ENST00000392542.2_Silent_p.T240T	NM_001206801.1|NM_007370.5	NP_001193730.1|NP_031396.1	P40937	RFC5_HUMAN	replication factor C (activator 1) 5, 36.5kDa	261					DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA strand elongation involved in DNA replication (GO:0006271)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA gap filling (GO:0006297)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|transcription-coupled nucleotide-excision repair (GO:0006283)	DNA replication factor C complex (GO:0005663)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)			NS(1)|breast(1)|endometrium(1)|large_intestine(3)|lung(3)	9	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					ATTTCACCACAGCCTACAGAA	0.552																																					p.T261T		.											.	RFC5	227	0			c.A783G						.						135.0	135.0	135.0					12																	118464813		2203	4300	6503	SO:0001819	synonymous_variant	5985	exon8			CACCACAGCCTAC		CCDS9185.1, CCDS41843.2	12q24.3	2010-04-21	2002-08-29		ENSG00000111445	ENSG00000111445		"""ATPases / AAA-type"""	9973	protein-coding gene	gene with protein product		600407	"""replication factor C (activator 1) 5 (36.5kD)"""			7774928	Standard	NM_007370		Approved	RFC36	uc001twq.3	P40937	OTTHUMG00000156438	ENST00000454402.2:c.783A>G	12.37:g.118464813A>G		116.0	0.0		69.0	23.0	NM_007370	A8MZ62|B3KSX8	Silent	SNP	ENST00000454402.2	37	CCDS9185.1																																																																																			.		0.552	RFC5-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344196.2	NM_007370	
DST	667	ucsc.edu;bcgsc.ca;mdanderson.org	37	6	56473249	56473249	+	Silent	SNP	A	A	T			TCGA-G3-A3CJ-01A-11D-A20W-10	TCGA-G3-A3CJ-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b064bc29-9a26-41f6-b49a-ae77a15d4967	fe4fd074-ca2d-42c3-9851-1c874d1f51fd	g.chr6:56473249A>T	ENST00000361203.3	-	36	5551	c.5544T>A	c.(5542-5544)gcT>gcA	p.A1848A	DST_ENST00000370754.5_Silent_p.A2026A|DST_ENST00000446842.2_Silent_p.A1522A|DST_ENST00000370788.2_Intron|DST_ENST00000370769.4_Silent_p.A1848A|DST_ENST00000244364.6_Intron|DST_ENST00000312431.6_Silent_p.A1848A|DST_ENST00000421834.2_Intron			Q03001	DYST_HUMAN	dystonin	1848					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cytoplasmic microtubule organization (GO:0031122)|cytoskeleton organization (GO:0007010)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|maintenance of cell polarity (GO:0030011)|microtubule cytoskeleton organization (GO:0000226)|regulation of microtubule polymerization or depolymerization (GO:0031110)|response to wounding (GO:0009611)|retrograde axon cargo transport (GO:0008090)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integral component of membrane (GO:0016021)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|neurofilament cytoskeleton (GO:0060053)|nucleus (GO:0005634)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|microtubule plus-end binding (GO:0051010)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)			NS(1)|breast(5)|central_nervous_system(8)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(43)|ovary(7)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	105	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			GGACCAGAAGAGCACTGCTGG	0.448																																					.		.											.	.	.	0			.						.						73.0	71.0	72.0					6																	56473249		1925	4132	6057	SO:0001819	synonymous_variant	100873774	.			CAGAAGAGCACTG	M22942, M69225	CCDS4959.1, CCDS47443.1, CCDS75474.1	6p12.1	2013-01-10	2004-06-25	2004-07-01	ENSG00000151914	ENSG00000151914		"""EF-hand domain containing"""	1090	protein-coding gene	gene with protein product		113810	"""bullous pemphigoid antigen 1, 230/240kDa"""	BPAG1		2461961, 2276744	Standard	NM_001144770		Approved	BP240, KIAA0728, FLJ21489, FLJ13425, FLJ32235, FLJ30627, CATX-15, BPA, MACF2	uc021zba.2	Q03001	OTTHUMG00000014913	ENST00000361203.3:c.5544T>A	6.37:g.56473249A>T		95.0	0.0		66.0	32.0	.	B7Z3H1|O94833|Q12825|Q13266|Q13267|Q13775|Q5TBT0|Q5TBT2|Q5TF23|Q5TF24|Q8N1T8|Q8N8J3|Q8WXK8|Q8WXK9|Q96AK9|Q96DQ5|Q96J76|Q96QT5|Q9H555|Q9UGD7|Q9UGD8|Q9UN10	RNA	SNP	ENST00000361203.3	37																																																																																				.		0.448	DST-004	NOVEL	not_organism_supported|basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000041021.3	NM_001723	
RIMS1	22999	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	73102485	73102485	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A3CJ-01A-11D-A20W-10	TCGA-G3-A3CJ-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b064bc29-9a26-41f6-b49a-ae77a15d4967	fe4fd074-ca2d-42c3-9851-1c874d1f51fd	g.chr6:73102485C>T	ENST00000521978.1	+	31	4591	c.4591C>T	c.(4591-4593)Cgc>Tgc	p.R1531C	RIMS1_ENST00000538414.1_Missense_Mutation_p.R337C|RIMS1_ENST00000431478.2_3'UTR|RIMS1_ENST00000348717.5_Missense_Mutation_p.R1314C|RIMS1_ENST00000518273.1_Missense_Mutation_p.R1210C|RIMS1_ENST00000517960.1_Missense_Mutation_p.R1314C|RIMS1_ENST00000264839.7_Missense_Mutation_p.R1380C|RIMS1_ENST00000517827.1_Missense_Mutation_p.R665C|RIMS1_ENST00000401910.3_Missense_Mutation_p.R851C|RIMS1_ENST00000522291.1_Missense_Mutation_p.R1130C|RIMS1_ENST00000523963.1_Missense_Mutation_p.R656C|RIMS1_ENST00000520567.1_Missense_Mutation_p.R1181C|RIMS1_ENST00000414192.2_Missense_Mutation_p.R58C|RIMS1_ENST00000425662.2_Missense_Mutation_p.R599C|RIMS1_ENST00000491071.2_Missense_Mutation_p.R1354C	NM_014989.5	NP_055804.2	Q86UR5	RIMS1_HUMAN	regulating synaptic membrane exocytosis 1	1531					calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|glutamate secretion (GO:0014047)|intracellular protein transport (GO:0006886)|membrane fusion (GO:0061025)|neurotransmitter secretion (GO:0007269)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of gene expression (GO:0010628)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|protein complex assembly (GO:0006461)|regulated secretory pathway (GO:0045055)|regulation of catalytic activity (GO:0050790)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of neurotransmitter secretion (GO:0046928)|response to stimulus (GO:0050896)|secretion (GO:0046903)|synaptic transmission (GO:0007268)|synaptic vesicle exocytosis (GO:0016079)|visual perception (GO:0007601)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|Rab GTPase binding (GO:0017137)|small GTPase regulator activity (GO:0005083)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(25)|liver(4)|lung(35)|ovary(9)|pancreas(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	102		all_epithelial(107;0.179)|all_hematologic(105;0.212)				GCTTGTTGGCCGCCAAACCCT	0.388																																					p.R1531C		.											.	RIMS1	144	0			c.C4591T						.						86.0	82.0	83.0					6																	73102485		1840	4103	5943	SO:0001583	missense	22999	exon31			GTTGGCCGCCAAA	AB002338	CCDS47449.1, CCDS55029.1, CCDS55030.1, CCDS55031.1, CCDS55032.1, CCDS55033.1	6q12-q13	2008-10-16	2002-06-12	2002-06-14	ENSG00000079841	ENSG00000079841			17282	protein-coding gene	gene with protein product	"""Rab3-interacting molecule"""	606629	"""RAB3 interacting protein 2"""	RAB3IP2, CORD7		9205841, 11438518	Standard	NM_001168407		Approved	RIM, KIAA0340, RIM1	uc003pga.4	Q86UR5	OTTHUMG00000015009	ENST00000521978.1:c.4591C>T	6.37:g.73102485C>T	ENSP00000428417:p.Arg1531Cys	143.0	0.0		80.0	33.0	NM_014989	A7MBN6|B7Z2M0|B7Z2Q9|B7Z3S3|B7Z6S2|E7EX08|E9PCB7|E9PCZ1|E9PF48|E9PHF5|E9PHR1|O15048|Q5JY21|Q5JY25|Q5SZK1|Q8TDY9|Q8TDZ5|Q9HBA1|Q9HBA2|Q9HBA3|Q9HBA4|Q9HBA5|Q9HBA6	Missense_Mutation	SNP	ENST00000521978.1	37	CCDS47449.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	18.72|18.72	3.683389|3.683389	0.68157|0.68157	.|.	.|.	ENSG00000079841|ENSG00000079841	ENST00000517433|ENST00000491071;ENST00000350827;ENST00000352008;ENST00000348717;ENST00000349908;ENST00000346609;ENST00000264839;ENST00000517960;ENST00000518273;ENST00000520567;ENST00000522291;ENST00000521978;ENST00000401910;ENST00000523963;ENST00000425662;ENST00000453976;ENST00000517827;ENST00000370420;ENST00000538414;ENST00000414192	.|T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	.|0.43294	.|0.95;2.12;2.05;2.13;2.32;2.35;2.35;2.0;2.07;2.34;2.26;1.41;2.26;1.71;1.67;1.96	5.5|5.5	2.56|2.56	0.30785|0.30785	.|.	.|0.000000	.|0.64402	.|D	.|0.000020	T|T	0.58552|0.58552	0.2130|0.2130	M|M	0.84683|0.84683	2.71|2.71	0.80722|0.80722	D|D	1|1	.|D;D;D;D;D;D;D;D;D;D;D;D;D	.|0.89917	.|1.0;1.0;1.0;0.998;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0	.|D;D;D;D;D;D;D;D;D;D;D;D;D	.|0.97110	.|0.999;0.996;0.992;0.969;0.996;0.998;0.994;1.0;0.995;0.996;0.979;0.998;0.979	T|T	0.69000|0.69000	-0.5261|-0.5261	5|10	.|0.87932	.|D	.|0	-10.7348|-10.7348	14.3795|14.3795	0.66902|0.66902	0.467:0.533:0.0:0.0|0.467:0.533:0.0:0.0	.|.	.|155;337;665;656;1380;851;1130;434;1210;1314;607;1354;1531	.|B7Z6K9;B7Z7W2;B7Z3S3;E9PHF5;E9PHR1;E9PF48;E7EX08;Q5JY22;E7ERQ1;E7ENC2;Q5JY21;C9JNW6;Q86UR5	.|.;.;.;.;.;.;.;.;.;.;.;.;RIMS1_HUMAN	L|C	876|1354;1380;1354;1314;1210;1130;1380;1314;1210;1181;1130;1531;851;656;599;696;665;579;337;58	.|ENSP00000430101:R1354C;ENSP00000275037:R1314C;ENSP00000264839:R1380C;ENSP00000429959:R1314C;ENSP00000430408:R1210C;ENSP00000430502:R1181C;ENSP00000430932:R1130C;ENSP00000428417:R1531C;ENSP00000385649:R851C;ENSP00000428328:R656C;ENSP00000411235:R599C;ENSP00000389503:R696C;ENSP00000428367:R665C;ENSP00000359448:R579C;ENSP00000439730:R337C;ENSP00000402273:R58C	.|ENSP00000264839:R1380C	P|R	+|+	2|1	0|0	RIMS1|RIMS1	73159206|73159206	0.877000|0.877000	0.30153|0.30153	0.998000|0.998000	0.56505|0.56505	0.984000|0.984000	0.73092|0.73092	1.520000|1.520000	0.35899|0.35899	0.646000|0.646000	0.30693|0.30693	0.591000|0.591000	0.81541|0.81541	CCG|CGC	.		0.388	RIMS1-011	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374968.1		
SACS	26278	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	23929049	23929049	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A3CJ-01A-11D-A20W-10	TCGA-G3-A3CJ-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b064bc29-9a26-41f6-b49a-ae77a15d4967	fe4fd074-ca2d-42c3-9851-1c874d1f51fd	g.chr13:23929049C>A	ENST00000382292.3	-	7	1975	c.1702G>T	c.(1702-1704)Gac>Tac	p.D568Y	SACS_ENST00000382298.3_Missense_Mutation_p.D568Y|SACS_ENST00000476776.1_5'Flank|SACS_ENST00000402364.1_5'UTR			Q9NZJ4	SACS_HUMAN	sacsin molecular chaperone	568					cell death (GO:0008219)|negative regulation of inclusion body assembly (GO:0090084)|protein folding (GO:0006457)	axon (GO:0030424)|cell body fiber (GO:0070852)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	chaperone binding (GO:0051087)|Hsp70 protein binding (GO:0030544)|proteasome binding (GO:0070628)			NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(54)|lung(49)|ovary(7)|pancreas(1)|prostate(4)|skin(10)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(11)	189		all_cancers(29;1.51e-22)|all_epithelial(30;7.82e-19)|all_lung(29;4.71e-18)|Lung SC(185;0.0225)|Breast(139;0.128)		all cancers(112;0.00197)|Epithelial(112;0.00854)|OV - Ovarian serous cystadenocarcinoma(117;0.0298)|Lung(94;0.189)		CTGACCCAGTCACAGCTAATT	0.473																																					p.D568Y		.											.	SACS	298	0			c.G1702T						.						102.0	97.0	98.0					13																	23929049		2203	4300	6503	SO:0001583	missense	26278	exon8			CCCAGTCACAGCT	AF193556	CCDS9300.2	13q11	2014-06-13	2014-01-30		ENSG00000151835	ENSG00000151835		"""Heat shock proteins / DNAJ (HSP40)"""	10519	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 138"""	604490	"""spastic ataxia of Charlevoix-Saguenay (sacsin)"""			10610707, 15057823, 21726565	Standard	NM_001278055		Approved	ARSACS, KIAA0730, DKFZp686B15167, DNAJC29, SPAX6, PPP1R138	uc001uon.3	Q9NZJ4	OTTHUMG00000016562	ENST00000382292.3:c.1702G>T	13.37:g.23929049C>A	ENSP00000371729:p.Asp568Tyr	180.0	0.0		143.0	46.0	NM_014363	O94835|Q5T9J5|Q5T9J7|Q5T9J8|Q68DF5|Q6MZR4|Q8NBF9	Missense_Mutation	SNP	ENST00000382292.3	37	CCDS9300.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	3.352|3.352	-0.132318|-0.132318	0.06753|0.06753	.|.	.|.	ENSG00000151835|ENSG00000151835	ENST00000382292;ENST00000382298;ENST00000423156|ENST00000455470	T;T;T|.	0.17054|.	2.3;2.3;2.3|.	5.74|5.74	3.05|3.05	0.35203|0.35203	.|.	0.784986|.	0.13011|.	N|.	0.420898|.	T|.	0.23289|.	0.0563|.	N|N	0.19112|0.19112	0.55|0.55	0.09310|0.09310	N|N	1|1	B;B;B|.	0.31290|.	0.318;0.098;0.0|.	B;B;B|.	0.32624|.	0.149;0.123;0.004|.	T|.	0.22068|.	-1.0227|.	10|.	0.48119|.	T|.	0.1|.	.|.	6.9614|6.9614	0.24599|0.24599	0.0788:0.5348:0.2873:0.0991|0.0788:0.5348:0.2873:0.0991	.|.	467;355;568|.	B2REB1;E9PAL4;Q9NZJ4|.	.;.;SACS_HUMAN|.	Y|L	568;568;192|467	ENSP00000371729:D568Y;ENSP00000371735:D568Y;ENSP00000390925:D192Y|.	ENSP00000371729:D568Y|.	D|X	-|-	1|2	0|2	SACS|SACS	22827049|22827049	0.483000|0.483000	0.25956|0.25956	0.000000|0.000000	0.03702|0.03702	0.017000|0.017000	0.09413|0.09413	2.444000|2.444000	0.44890|0.44890	0.426000|0.426000	0.26116|0.26116	0.561000|0.561000	0.74099|0.74099	GAC|TGA	.		0.473	SACS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044148.3	NM_014363	
SHISA2	387914	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	13	26620702	26620702	+	Frame_Shift_Del	DEL	G	G	-			TCGA-G3-A3CJ-01A-11D-A20W-10	TCGA-G3-A3CJ-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b064bc29-9a26-41f6-b49a-ae77a15d4967	fe4fd074-ca2d-42c3-9851-1c874d1f51fd	g.chr13:26620702delG	ENST00000319420.3	-	2	892	c.837delC	c.(835-837)cccfs	p.P279fs		NM_001007538.1	NP_001007539.1	Q6UWI4	SHSA2_HUMAN	shisa family member 2	279					multicellular organismal development (GO:0007275)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(7)|ovary(1)|prostate(2)|skin(1)	17						TGTGAGGGAAGGGGGACTGAA	0.572																																					p.P279fs		.											.	SHISA2	69	0			c.837delC						.						103.0	91.0	95.0					13																	26620702		2203	4300	6503	SO:0001589	frameshift_variant	387914	exon2			AGGGAAGGGGGAC		CCDS31951.1	13q12.13	2013-07-31	2013-07-31	2008-04-01	ENSG00000180730	ENSG00000180730		"""Shisa homologs"""	20366	protein-coding gene	gene with protein product			"""chromosome 13 open reading frame 13"", ""transmembrane protein 46"", ""shisa homolog 2 (Xenopus laevis)"""	C13orf13, TMEM46			Standard	NM_001007538		Approved	bA398O19.2, PRO28631, WGAR9166, hShisa	uc001uqm.1	Q6UWI4	OTTHUMG00000016612	ENST00000319420.3:c.837delC	13.37:g.26620702delG	ENSP00000313079:p.Pro279fs	97.0	0.0		91.0	27.0	NM_001007538	B9EH70|Q5W0G8	Frame_Shift_Del	DEL	ENST00000319420.3	37	CCDS31951.1																																																																																			.		0.572	SHISA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044239.2	NM_001007538	
SORBS2	8470	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	4	186598269	186598273	+	Intron	DEL	TCCTG	TCCTG	-			TCGA-G3-A3CJ-01A-11D-A20W-10	TCGA-G3-A3CJ-10A-01D-A20W-10	TCCTG	TCCTG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b064bc29-9a26-41f6-b49a-ae77a15d4967	fe4fd074-ca2d-42c3-9851-1c874d1f51fd	g.chr4:186598269_186598273delTCCTG	ENST00000284776.7	-	4	465				SORBS2_ENST00000448662.2_Intron|RP11-626E13.1_ENST00000447277.1_RNA|SORBS2_ENST00000355634.5_Intron|SORBS2_ENST00000437304.2_Frame_Shift_Del_p.QD124fs|SORBS2_ENST00000393528.3_Intron|SORBS2_ENST00000449407.2_Intron|SORBS2_ENST00000431808.1_Intron|SORBS2_ENST00000319471.9_Intron	NM_021069.4	NP_066547.1	O94875	SRBS2_HUMAN	sorbin and SH3 domain containing 2						actin filament organization (GO:0007015)|cell adhesion (GO:0007155)|cell migration (GO:0016477)	actin cytoskeleton (GO:0015629)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|Z disc (GO:0030018)	cytoskeletal adaptor activity (GO:0008093)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)			endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(9)|lung(21)|ovary(2)|prostate(2)|skin(4)|urinary_tract(1)	53		all_cancers(14;4.27e-52)|all_epithelial(14;6.58e-39)|all_lung(41;1.42e-13)|Lung NSC(41;3.73e-13)|Melanoma(20;1.91e-06)|Colorectal(36;0.00692)|Hepatocellular(41;0.00826)|Renal(120;0.00994)|Prostate(90;0.0101)|all_hematologic(60;0.0174)|all_neural(102;0.244)		OV - Ovarian serous cystadenocarcinoma(60;1.54e-09)|BRCA - Breast invasive adenocarcinoma(30;0.000232)|GBM - Glioblastoma multiforme(59;0.000385)|STAD - Stomach adenocarcinoma(60;0.00109)|LUSC - Lung squamous cell carcinoma(40;0.0205)		GCTTTCAAGATCCTGTCCTGAAAGG	0.498																																					p.124_125del	Esophageal Squamous(153;41 2433 9491 36028)	.											.	SORBS2	91	0			c.370_374del						.																																			SO:0001627	intron_variant	8470	exon5			TCAAGATCCTGTC		CCDS3845.1, CCDS43289.2, CCDS47173.1, CCDS47174.1, CCDS47175.1, CCDS47176.1, CCDS54825.1, CCDS59482.1	4q35.1	2008-02-05			ENSG00000154556	ENSG00000154556			24098	protein-coding gene	gene with protein product	"""Arg/Abl interacting protein"""					9211900, 9872452	Standard	NM_021069		Approved	ARGBP2, KIAA0777	uc003iym.3	O94875	OTTHUMG00000157215	ENST00000284776.7:c.44+1303CAGGA>-	4.37:g.186598274_186598278delTCCTG		169.0	0.0		126.0	41.0	NM_001145673	A6NEK9|B3KPQ7|B7Z1G5|B7Z3X6|C9JKV9|D3DP62|D3DP63|E9PAS5|E9PAW4|G3XAI0|H7BXR4|J3KNZ5|O60592|O60593|Q96EX0	Frame_Shift_Del	DEL	ENST00000284776.7	37	CCDS3845.1																																																																																			.		0.498	SORBS2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000347944.3	NM_003603	
SSPO	23145	hgsc.bcm.edu;bcgsc.ca	37	7	149506213	149506213	+	RNA	SNP	T	T	C			TCGA-G3-A3CJ-01A-11D-A20W-10	TCGA-G3-A3CJ-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b064bc29-9a26-41f6-b49a-ae77a15d4967	fe4fd074-ca2d-42c3-9851-1c874d1f51fd	g.chr7:149506213T>C	ENST00000378016.2	+	0	9204							A2VEC9	SSPO_HUMAN	SCO-spondin						cell adhesion (GO:0007155)	extracellular space (GO:0005615)	peptidase inhibitor activity (GO:0030414)					Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			AGGCAGCAGCTGCGCAGCCTC	0.672																																					.		.											.	.	.	0			c.9204+1T>C						.						12.0	19.0	17.0					7																	149506213		2031	4171	6202			23145	exon63			AGCAGCTGCGCAG	AK093431		7q36.1	2013-08-07	2013-08-06		ENSG00000197558	ENSG00000197558			21998	protein-coding gene	gene with protein product	"""subcommissural organ spondin"", ""SCO protein, thrombospondin domain containing"""		"""SCO-spondin homolog (Bos taurus)"""			8743952, 11008217	Standard	NM_198455		Approved	SCO-spondin, KIAA0543, FLJ36112	uc010lpk.3	A2VEC9	OTTHUMG00000157884		7.37:g.149506213T>C		539.0	0.0		412.0	33.0	NM_198455	Q76B61	Splice_Site	SNP	ENST00000378016.2	37																																																																																				.		0.672	SSPO-202	KNOWN	basic	processed_transcript	processed_transcript			
SYNE2	23224	ucsc.edu;bcgsc.ca;mdanderson.org	37	14	64465664	64465664	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A3CJ-01A-11D-A20W-10	TCGA-G3-A3CJ-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b064bc29-9a26-41f6-b49a-ae77a15d4967	fe4fd074-ca2d-42c3-9851-1c874d1f51fd	g.chr14:64465664A>G	ENST00000344113.4	+	27	3598	c.3386A>G	c.(3385-3387)cAc>cGc	p.H1129R	SYNE2_ENST00000358025.3_Missense_Mutation_p.H1129R|SYNE2_ENST00000357395.3_5'UTR|SYNE2_ENST00000554584.1_Missense_Mutation_p.H1129R	NM_015180.4	NP_055995.4	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2	1129					centrosome localization (GO:0051642)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment or maintenance of cell polarity (GO:0007163)|fibroblast migration (GO:0010761)|nuclear envelope organization (GO:0006998)|nuclear migration (GO:0007097)|nuclear migration along microfilament (GO:0031022)|positive regulation of cell migration (GO:0030335)|protein localization to nucleus (GO:0034504)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intermediate filament cytoskeleton (GO:0045111)|lamellipodium membrane (GO:0031258)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nuclear lumen (GO:0031981)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|sarcoplasmic reticulum (GO:0016529)|SUN-KASH complex (GO:0034993)|Z disc (GO:0030018)	actin binding (GO:0003779)			NS(5)|breast(17)|central_nervous_system(3)|cervix(8)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(21)|large_intestine(34)|lung(75)|ovary(10)|pancreas(2)|prostate(8)|skin(8)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(4)	224				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		CTTGAACACCACCTGCAAAAC	0.383																																					p.H1129R		.											.	SYNE2	164	0			c.A3386G						.						126.0	119.0	121.0					14																	64465664		1867	4132	5999	SO:0001583	missense	23224	exon27			AACACCACCTGCA	AB023228	CCDS9761.2, CCDS41963.1, CCDS45124.1, CCDS45125.1	14q22.1-q22.3	2014-09-17			ENSG00000054654	ENSG00000054654			17084	protein-coding gene	gene with protein product	"""nuclear envelope spectrin repeat-2"", ""nucleus and actin connecting element"""	608442				10231032, 10878022	Standard	NM_182910		Approved	SYNE-2, DKFZP434H2235, Nesprin-2, NUANCE, NUA, KIAA1011, Nesp2	uc001xgl.3	Q8WXH0	OTTHUMG00000140349	ENST00000344113.4:c.3386A>G	14.37:g.64465664A>G	ENSP00000341781:p.His1129Arg	202.0	2.0		153.0	56.0	NM_182914	Q540G1|Q8N1S3|Q8NF49|Q8TER7|Q8WWW3|Q8WWW4|Q8WWW5|Q8WXH1|Q9NU50|Q9UFQ4|Q9Y2L4|Q9Y4R1	Missense_Mutation	SNP	ENST00000344113.4	37	CCDS41963.1	.	.	.	.	.	.	.	.	.	.	A	2.564	-0.301072	0.05495	.	.	ENSG00000054654	ENST00000358025;ENST00000344113;ENST00000554584;ENST00000261678	T;T;T	0.56275	0.84;0.85;0.47	5.32	4.16	0.48862	.	0.646369	0.14353	N	0.324936	T	0.37100	0.0991	L	0.36672	1.1	0.19300	N	0.999975	B;P	0.36183	0.407;0.542	B;B	0.34385	0.088;0.181	T	0.16305	-1.0407	10	0.25751	T	0.34	.	5.177	0.15141	0.7569:0.0:0.0858:0.1573	.	1129;1129	Q8WXH0;Q8WXH0-2	SYNE2_HUMAN;.	R	1129	ENSP00000350719:H1129R;ENSP00000341781:H1129R;ENSP00000452570:H1129R	ENSP00000261678:H1129R	H	+	2	0	SYNE2	63535417	0.188000	0.23250	0.056000	0.19401	0.150000	0.21749	2.738000	0.47401	0.965000	0.38133	0.533000	0.62120	CAC	.		0.383	SYNE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276994.2	NM_182914	
TALDO1	6888	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	759019	759019	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A3CJ-01A-11D-A20W-10	TCGA-G3-A3CJ-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b064bc29-9a26-41f6-b49a-ae77a15d4967	fe4fd074-ca2d-42c3-9851-1c874d1f51fd	g.chr11:759019G>T	ENST00000319006.3	+	3	444	c.291G>T	c.(289-291)aaG>aaT	p.K97N	TALDO1_ENST00000528097.1_Missense_Mutation_p.K97N			P37837	TALDO_HUMAN	transaldolase 1	97					carbohydrate metabolic process (GO:0005975)|energy reserve metabolic process (GO:0006112)|fructose 6-phosphate metabolic process (GO:0006002)|glyceraldehyde-3-phosphate metabolic process (GO:0019682)|pentose-phosphate shunt (GO:0006098)|pentose-phosphate shunt, non-oxidative branch (GO:0009052)|small molecule metabolic process (GO:0044281)|xylulose biosynthetic process (GO:0005999)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	monosaccharide binding (GO:0048029)|sedoheptulose-7-phosphate:D-glyceraldehyde-3-phosphate glyceronetransferase activity (GO:0004801)			breast(1)|kidney(2)|large_intestine(5)|lung(4)|prostate(2)	14		all_cancers(49;1.13e-08)|all_epithelial(84;2.95e-05)|Breast(177;0.000286)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.159)|all_lung(207;0.198)		all cancers(45;4.66e-26)|Epithelial(43;2.97e-25)|OV - Ovarian serous cystadenocarcinoma(40;1.48e-19)|BRCA - Breast invasive adenocarcinoma(625;4.41e-05)|Lung(200;0.0595)|LUSC - Lung squamous cell carcinoma(625;0.0712)		AAATACTAAAGAAGATTCCGG	0.443																																					p.K97N		.											.	TALDO1	90	0			c.G291T						.						134.0	144.0	141.0					11																	759019		2203	4300	6503	SO:0001583	missense	6888	exon3			ACTAAAGAAGATT		CCDS7712.1	11p15.5-p15.4	2009-12-02			ENSG00000177156	ENSG00000177156	2.2.1.2		11559	protein-coding gene	gene with protein product		602063				9339383	Standard	NM_006755		Approved		uc001lqz.3	P37837	OTTHUMG00000133318	ENST00000319006.3:c.291G>T	11.37:g.759019G>T	ENSP00000321259:p.Lys97Asn	160.0	0.0		121.0	47.0	NM_006755	B2R8M2|O00751|Q8WV32|Q8WZ45	Missense_Mutation	SNP	ENST00000319006.3	37	CCDS7712.1	.	.	.	.	.	.	.	.	.	.	G	33	5.207784	0.95033	.	.	ENSG00000177156	ENST00000319006;ENST00000528097	D;D	0.86230	-2.09;-2.09	4.9	4.9	0.64082	Aldolase-type TIM barrel (1);	0.000000	0.85682	D	0.000000	D	0.88706	0.6509	M	0.70275	2.135	0.80722	D	1	P;B	0.35363	0.497;0.339	B;B	0.40982	0.345;0.236	D	0.89509	0.3770	10	0.59425	D	0.04	-16.3143	17.2585	0.87064	0.0:0.0:1.0:0.0	.	97;97	F2Z393;P37837	.;TALDO_HUMAN	N	97	ENSP00000321259:K97N;ENSP00000437098:K97N	ENSP00000321259:K97N	K	+	3	2	TALDO1	749019	1.000000	0.71417	0.999000	0.59377	0.979000	0.70002	6.731000	0.74785	2.437000	0.82529	0.561000	0.74099	AAG	.		0.443	TALDO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257116.1	NM_006755	
TCEAL6	158931	hgsc.bcm.edu;broad.mit.edu	37	X	101395774	101395774	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A3CJ-01A-11D-A20W-10	TCGA-G3-A3CJ-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b064bc29-9a26-41f6-b49a-ae77a15d4967	fe4fd074-ca2d-42c3-9851-1c874d1f51fd	g.chrX:101395774T>C	ENST00000372774.3	-	3	779	c.530A>G	c.(529-531)gAc>gGc	p.D177G	TCEAL6_ENST00000372773.1_Missense_Mutation_p.D177G	NM_001006938.2	NP_001006939.2	Q6IPX3	TCAL6_HUMAN	transcription elongation factor A (SII)-like 6	0					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(6)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)	14						CACCCCGTTGTCCCCTTGGGC	0.507																																					p.D177G		.											.	TCEAL6	91	0			c.A530G						.						19.0	18.0	19.0					X																	101395774		2197	4274	6471	SO:0001583	missense	158931	exon3			CCGTTGTCCCCTT	BC071675	CCDS43978.1	Xq22.1	2014-03-21			ENSG00000204071	ENSG00000204071			24553	protein-coding gene	gene with protein product						16221301	Standard	NM_001006938		Approved	WEX2	uc004eiq.3	Q6IPX3	OTTHUMG00000022050	ENST00000372774.3:c.530A>G	X.37:g.101395774T>C	ENSP00000361860:p.Asp177Gly	108.0	0.0		170.0	12.0	NM_001006938	Q5H9J8	Missense_Mutation	SNP	ENST00000372774.3	37	CCDS43978.1	.	.	.	.	.	.	.	.	.	.	A	0.755	-0.771235	0.02951	.	.	ENSG00000204071	ENST00000372774;ENST00000372773	T;T	0.23147	1.92;1.92	2.82	-3.23	0.05109	.	0.272209	0.20313	N	0.094788	T	0.11836	0.0288	N	0.24115	0.695	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.08186	-1.0734	10	0.48119	T	0.1	.	3.3698	0.07216	0.1211:0.4969:0.222:0.1599	.	177	Q6IPX3-2	.	G	177	ENSP00000361860:D177G;ENSP00000361859:D177G	ENSP00000361859:D177G	D	-	2	0	TCEAL6	101282430	0.001000	0.12720	0.010000	0.14722	0.828000	0.46876	-1.039000	0.03550	-1.000000	0.03438	-0.742000	0.03525	GAC	.		0.507	TCEAL6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057609.1	NM_001006938	
TCEAL6	158931	hgsc.bcm.edu;bcgsc.ca	37	X	101395778	101395778	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A3CJ-01A-11D-A20W-10	TCGA-G3-A3CJ-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b064bc29-9a26-41f6-b49a-ae77a15d4967	fe4fd074-ca2d-42c3-9851-1c874d1f51fd	g.chrX:101395778C>T	ENST00000372774.3	-	3	775	c.526G>A	c.(526-528)Ggg>Agg	p.G176R	TCEAL6_ENST00000372773.1_Missense_Mutation_p.G176R	NM_001006938.2	NP_001006939.2	Q6IPX3	TCAL6_HUMAN	transcription elongation factor A (SII)-like 6	0					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(6)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)	14						CCGTTGTCCCCTTGGGCGAAT	0.502																																					p.G176R		.											.	TCEAL6	91	0			c.G526A						.						13.0	13.0	13.0					X																	101395778		2197	4251	6448	SO:0001583	missense	158931	exon3			TGTCCCCTTGGGC	BC071675	CCDS43978.1	Xq22.1	2014-03-21			ENSG00000204071	ENSG00000204071			24553	protein-coding gene	gene with protein product						16221301	Standard	NM_001006938		Approved	WEX2	uc004eiq.3	Q6IPX3	OTTHUMG00000022050	ENST00000372774.3:c.526G>A	X.37:g.101395778C>T	ENSP00000361860:p.Gly176Arg	108.0	0.0		164.0	23.0	NM_001006938	Q5H9J8	Missense_Mutation	SNP	ENST00000372774.3	37	CCDS43978.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	9.605|9.605	1.129729|1.129729	0.21041|0.21041	.|.	.|.	ENSG00000204071|ENSG00000204071	ENST00000372774;ENST00000372773|ENST00000536102	T;T|.	0.40225|.	1.04;1.04|.	2.82|2.82	2.82|2.82	0.32997|0.32997	.|.	0.000000|.	0.39341|.	N|.	0.001392|.	T|T	0.27832|0.27832	0.0685|0.0685	L|L	0.32530|0.32530	0.975|0.975	0.09310|0.09310	N|N	1|1	D|.	0.57257|.	0.979|.	P|.	0.56563|.	0.801|.	T|T	0.22243|0.22243	-1.0222|-1.0222	10|6	0.54805|0.06365	T|T	0.06|0.9	.|.	8.3639|8.3639	0.32374|0.32374	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	176|.	Q6IPX3-2|.	.|.	R|K	176|175	ENSP00000361860:G176R;ENSP00000361859:G176R|.	ENSP00000361859:G176R|ENSP00000437364:R175K	G|R	-|-	1|2	0|0	TCEAL6|TCEAL6	101282434|101282434	0.007000|0.007000	0.16637|0.16637	0.089000|0.089000	0.20774|0.20774	0.743000|0.743000	0.42351|0.42351	1.059000|1.059000	0.30517|0.30517	1.692000|1.692000	0.51112|0.51112	0.468000|0.468000	0.43344|0.43344	GGG|AGG	.		0.502	TCEAL6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057609.1	NM_001006938	
TCEB3B	51224	hgsc.bcm.edu;ucsc.edu	37	18	44560926	44560926	+	Nonsense_Mutation	SNP	A	A	T	rs373872961		TCGA-G3-A3CJ-01A-11D-A20W-10	TCGA-G3-A3CJ-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b064bc29-9a26-41f6-b49a-ae77a15d4967	fe4fd074-ca2d-42c3-9851-1c874d1f51fd	g.chr18:44560926A>T	ENST00000332567.4	-	1	1062	c.710T>A	c.(709-711)tTg>tAg	p.L237*	KATNAL2_ENST00000356157.7_Intron|KATNAL2_ENST00000245121.5_Intron|KATNAL2_ENST00000592005.1_Intron	NM_016427.2	NP_057511.2	Q8IYF1	ELOA2_HUMAN	transcription elongation factor B polypeptide 3B (elongin A2)	237					regulation of DNA-templated transcription, elongation (GO:0032784)|transcription from RNA polymerase II promoter (GO:0006366)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|cervix(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(15)|lung(24)|ovary(2)|pancreas(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	58						CTGGGCACACAAGGGGCGTTT	0.602																																					p.L237X		.											.	TCEB3B	156	0			c.T710A						.						40.0	42.0	41.0					18																	44560926		2203	4300	6503	SO:0001587	stop_gained	51224	exon1			GCACACAAGGGGC	BC036022	CCDS11932.1	18q21.1	2009-08-04			ENSG00000206181	ENSG00000206181			30771	protein-coding gene	gene with protein product	"""transcription elongation factor (SIII) elongin A2"", ""elongin A2"""	609522				7660129, 8244996	Standard	NM_016427		Approved	HsT832, TCEB3L	uc002lcr.1	Q8IYF1	OTTHUMG00000132649	ENST00000332567.4:c.710T>A	18.37:g.44560926A>T	ENSP00000331302:p.Leu237*	255.0	1.0		225.0	100.0	NM_016427	Q9P2V9	Nonsense_Mutation	SNP	ENST00000332567.4	37	CCDS11932.1	.	.	.	.	.	.	.	.	.	.	A	22.8	4.334294	0.81801	.	.	ENSG00000206181	ENST00000332567	.	.	.	1.37	0.185	0.15096	.	2.229110	0.03378	U	0.200007	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	3.1294	0.06418	0.7396:0.0:0.2604:0.0	.	.	.	.	X	237	.	ENSP00000331302:L237X	L	-	2	0	TCEB3B	42814924	0.001000	0.12720	0.000000	0.03702	0.002000	0.02628	1.249000	0.32839	0.044000	0.15775	0.379000	0.24179	TTG	.		0.602	TCEB3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255900.1	NM_016427	
TEAD4	7004	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	12	3126664	3126664	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A3CJ-01A-11D-A20W-10	TCGA-G3-A3CJ-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b064bc29-9a26-41f6-b49a-ae77a15d4967	fe4fd074-ca2d-42c3-9851-1c874d1f51fd	g.chr12:3126664G>A	ENST00000397122.2	+	4	353	c.68G>A	c.(67-69)cGg>cAg	p.R23Q	TEAD4_ENST00000358409.2_Intron|TEAD4_ENST00000359864.2_Missense_Mutation_p.R152Q	NM_201443.2	NP_958851.1	Q15561	TEAD4_HUMAN	TEA domain family member 4	152					gene expression (GO:0010467)|hippo signaling (GO:0035329)|muscle organ development (GO:0007517)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|skeletal system development (GO:0001501)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|large_intestine(3)|lung(4)|upper_aerodigestive_tract(1)	10	Ovarian(42;0.211)		OV - Ovarian serous cystadenocarcinoma(31;0.000563)|COAD - Colon adenocarcinoma(12;0.0831)			GCCCTcgcccggggccccggc	0.667																																					p.R152Q		.											.	TEAD4	90	0			c.G455A						.						30.0	29.0	30.0					12																	3126664		2203	4300	6503	SO:0001583	missense	7004	exon6			TCGCCCGGGGCCC	X94438	CCDS31729.1, CCDS31730.1, CCDS41737.1	12p13.3-p13.2	2008-05-14				ENSG00000197905			11717	protein-coding gene	gene with protein product		601714		TCF13L1		9889009, 8921372	Standard	NM_003213		Approved	TEF-3, TEFR-1, EFTR-2, RTEF-1	uc010sej.2	Q15561		ENST00000397122.2:c.68G>A	12.37:g.3126664G>A	ENSP00000380311:p.Arg23Gln	304.0	0.0		197.0	77.0	NM_003213	H0Y308|Q6MZR9|Q8NEV5|Q92883|Q96BK2	Missense_Mutation	SNP	ENST00000397122.2	37	CCDS41737.1	.	.	.	.	.	.	.	.	.	.	G	14.17	2.455934	0.43634	.	.	ENSG00000197905	ENST00000359864;ENST00000543035;ENST00000397122	T;T;T	0.54479	0.57;1.61;0.58	5.95	3.18	0.36537	.	0.133068	0.49305	N	0.000157	T	0.34542	0.0901	N	0.19112	0.55	0.23101	N	0.998292	.	.	.	.	.	.	T	0.20438	-1.0275	8	0.16420	T	0.52	-17.3336	8.9551	0.35812	0.2792:0.0:0.7208:0.0	.	.	.	.	Q	152;152;23	ENSP00000352926:R152Q;ENSP00000444528:R152Q;ENSP00000380311:R23Q	ENSP00000352926:R152Q	R	+	2	0	TEAD4	2996925	1.000000	0.71417	1.000000	0.80357	0.208000	0.24298	1.921000	0.40035	0.433000	0.26313	-0.793000	0.03317	CGG	.		0.667	TEAD4-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398477.1	NM_003213	
THSD7B	80731	ucsc.edu;bcgsc.ca;mdanderson.org	37	2	138413197	138413197	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A3CJ-01A-11D-A20W-10	TCGA-G3-A3CJ-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b064bc29-9a26-41f6-b49a-ae77a15d4967	fe4fd074-ca2d-42c3-9851-1c874d1f51fd	g.chr2:138413197A>G	ENST00000409968.1	+	22	4250	c.4072A>G	c.(4072-4074)Atc>Gtc	p.I1358V	THSD7B_ENST00000413152.2_Missense_Mutation_p.I1330V|THSD7B_ENST00000272643.3_Missense_Mutation_p.I1361V|THSD7B_ENST00000543459.1_Intron			Q9C0I4	THS7B_HUMAN	thrombospondin, type I, domain containing 7B	1360	TSP type-1 17. {ECO:0000255|PROSITE- ProRule:PRU00210}.					integral component of membrane (GO:0016021)				NS(3)|breast(3)|central_nervous_system(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(14)|lung(57)|ovary(4)|pancreas(3)|prostate(11)|skin(4)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(3)	134				BRCA - Breast invasive adenocarcinoma(221;0.19)		TCAGGACAGCATCCTGAAGCA	0.498																																					.		.											.	THSD7B	75	0			.						.						71.0	72.0	71.0					2																	138413197		2083	4220	6303	SO:0001583	missense	80731	.			GACAGCATCCTGA			2q22.1	2006-11-24			ENSG00000144229	ENSG00000144229			29348	protein-coding gene	gene with protein product						11214970	Standard	NM_001080427		Approved	KIAA1679	uc002tva.1	Q9C0I4	OTTHUMG00000153590	ENST00000409968.1:c.4072A>G	2.37:g.138413197A>G	ENSP00000387145:p.Ile1358Val	285.0	0.0		192.0	76.0	.		Missense_Mutation	SNP	ENST00000409968.1	37		.	.	.	.	.	.	.	.	.	.	A	0.078	-1.188851	0.01607	.	.	ENSG00000144229	ENST00000409968;ENST00000272643;ENST00000413152	T;T;T	0.20598	2.61;2.44;2.06	5.26	-1.68	0.08212	.	0.723858	0.12102	N	0.499445	T	0.06462	0.0166	N	0.03253	-0.375	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.41179	-0.9523	10	0.11182	T	0.66	.	4.9707	0.14113	0.4116:0.2851:0.3033:0.0	.	1330	C9JKN6	.	V	1358;1361;1330	ENSP00000387145:I1358V;ENSP00000272643:I1361V;ENSP00000413841:I1330V	ENSP00000272643:I1361V	I	+	1	0	THSD7B	138129667	0.000000	0.05858	0.032000	0.17829	0.681000	0.39784	0.300000	0.19156	-0.147000	0.11254	-0.297000	0.09499	ATC	.		0.498	THSD7B-001	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000331769.2	XM_046570.9	
TLR1	7096	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	38799868	38799868	+	Silent	SNP	C	C	G			TCGA-G3-A3CJ-01A-11D-A20W-10	TCGA-G3-A3CJ-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b064bc29-9a26-41f6-b49a-ae77a15d4967	fe4fd074-ca2d-42c3-9851-1c874d1f51fd	g.chr4:38799868C>G	ENST00000502213.2	-	3	814	c.585G>C	c.(583-585)gtG>gtC	p.V195V	TLR1_ENST00000308979.2_Silent_p.V195V			Q15399	TLR1_HUMAN	toll-like receptor 1	195					cellular response to triacyl bacterial lipopeptide (GO:0071727)|detection of triacyl bacterial lipopeptide (GO:0042495)|immune response (GO:0006955)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|macrophage activation (GO:0042116)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|positive regulation of interleukin-6 biosynthetic process (GO:0045410)|positive regulation of tumor necrosis factor biosynthetic process (GO:0042535)|regulation of cytokine secretion (GO:0050707)|signal transduction (GO:0007165)|toll-like receptor 1 signaling pathway (GO:0034130)	cytoplasmic vesicle (GO:0031410)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|Toll-like receptor 1-Toll-like receptor 2 protein complex (GO:0035354)	protein heterodimerization activity (GO:0046982)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(11)|ovary(1)|prostate(1)|skin(4)|stomach(2)	28						TTGTGGGGAACACAATGTGCA	0.398																																					p.V195V	GBM(5;216 373 40795 46382)	.											.	TLR1	524	0			c.G585C						.						63.0	63.0	63.0					4																	38799868		2203	4300	6503	SO:0001819	synonymous_variant	7096	exon4			GGGGAACACAATG	U88540	CCDS33973.1	4p14	2008-02-05				ENSG00000174125		"""CD molecules"""	11847	protein-coding gene	gene with protein product		601194				9435236, 7584026	Standard	NM_003263		Approved	rsc786, KIAA0012, CD281	uc003gtl.3	Q15399		ENST00000502213.2:c.585G>C	4.37:g.38799868C>G		190.0	0.0		146.0	62.0	NM_003263	D1CS39|D1CS41|O15452|Q32MK3|Q32MK4|Q9UG90	Silent	SNP	ENST00000502213.2	37	CCDS33973.1																																																																																			.		0.398	TLR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360510.3		
TMEM2	23670	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	74347404	74347404	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A3CJ-01A-11D-A20W-10	TCGA-G3-A3CJ-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b064bc29-9a26-41f6-b49a-ae77a15d4967	fe4fd074-ca2d-42c3-9851-1c874d1f51fd	g.chr9:74347404T>C	ENST00000377044.4	-	7	1965	c.1426A>G	c.(1426-1428)Ata>Gta	p.I476V	TMEM2_ENST00000377066.5_Missense_Mutation_p.I413V	NM_001135820.1|NM_013390.2	NP_001129292.1|NP_037522.1	Q9UHN6	TMEM2_HUMAN	transmembrane protein 2	476					multicellular organismal development (GO:0007275)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(15)|liver(1)|lung(19)|ovary(2)|prostate(5)|skin(1)|stomach(1)|urinary_tract(2)	56		all_epithelial(88;4.56e-14)|Myeloproliferative disorder(762;0.0255)		GBM - Glioblastoma multiforme(74;7.45e-21)|OV - Ovarian serous cystadenocarcinoma(323;1.02e-16)		ACACCGTCTATGATCTCACCC	0.418																																					p.I476V		.											.	TMEM2	92	0			c.A1426G						.						94.0	85.0	88.0					9																	74347404		2203	4300	6503	SO:0001583	missense	23670	exon7			CGTCTATGATCTC		CCDS6638.1, CCDS47979.1	9q21.13	2011-07-19			ENSG00000135048	ENSG00000135048			11869	protein-coding gene	gene with protein product		605835					Standard	NM_013390		Approved		uc011lsa.1	Q9UHN6	OTTHUMG00000020000	ENST00000377044.4:c.1426A>G	9.37:g.74347404T>C	ENSP00000366243:p.Ile476Val	174.0	0.0		113.0	41.0	NM_013390	A6H8W9|B2RTQ6|Q5T838|Q5T839|Q5T840|Q5T841|Q8NBP6|Q9P2D5	Missense_Mutation	SNP	ENST00000377044.4	37	CCDS6638.1	.	.	.	.	.	.	.	.	.	.	T	5.804	0.332631	0.10956	.	.	ENSG00000135048	ENST00000377044;ENST00000377066	D;T	0.92752	-3.1;-0.55	5.54	-6.81	0.01704	Pectin lyase fold/virulence factor (1);	0.763445	0.13367	N	0.393239	T	0.77745	0.4176	N	0.05158	-0.105	0.23162	N	0.998199	B;B	0.02656	0.0;0.0	B;B	0.08055	0.001;0.003	T	0.62455	-0.6851	10	0.27082	T	0.32	.	11.4444	0.50114	0.0:0.5174:0.1002:0.3824	.	476;413	Q9UHN6;Q9UHN6-2	TMEM2_HUMAN;.	V	476;413	ENSP00000366243:I476V;ENSP00000366266:I413V	ENSP00000366243:I476V	I	-	1	0	TMEM2	73537224	0.002000	0.14202	0.704000	0.30370	0.992000	0.81027	-0.542000	0.06091	-1.195000	0.02680	-0.263000	0.10527	ATA	.		0.418	TMEM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052618.2	NM_013390	
TMEM237	65062	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	202501540	202501540	+	Missense_Mutation	SNP	T	T	A	rs376226585		TCGA-G3-A3CJ-01A-11D-A20W-10	TCGA-G3-A3CJ-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b064bc29-9a26-41f6-b49a-ae77a15d4967	fe4fd074-ca2d-42c3-9851-1c874d1f51fd	g.chr2:202501540T>A	ENST00000409883.2	-	5	321	c.205A>T	c.(205-207)Act>Tct	p.T69S	TMEM237_ENST00000409444.2_Missense_Mutation_p.T61S	NM_001044385.2	NP_001037850.1	Q96Q45	TM237_HUMAN	transmembrane protein 237	69					cilium assembly (GO:0042384)|regulation of Wnt signaling pathway (GO:0030111)	ciliary transition zone (GO:0035869)|integral component of membrane (GO:0016021)|membrane (GO:0016020)				endometrium(2)|kidney(1)|large_intestine(1)|lung(3)	7						AGTTCTTTAGTTGATGGCTCA	0.438																																					p.T69S		.											.	.	.	0			c.A205T						.	T	SER/THR,SER/THR	0,3676		0,0,1838	63.0	59.0	60.0		181,205	0.4	0.5	2		60	1,8177		0,1,4088	no	missense,missense	TMEM237	NM_152388.2,NM_001044385.1	58,58	0,1,5926	AA,AT,TT		0.0122,0.0,0.0084	benign,benign	61/401,69/409	202501540	1,11853	1838	4089	5927	SO:0001583	missense	65062	exon4			CTTTAGTTGATGG	AB053301	CCDS46489.1, CCDS46490.1	2q33	2012-05-08	2011-05-20	2011-05-20	ENSG00000155755	ENSG00000155755			14432	protein-coding gene	gene with protein product		614423	"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 4"""	ALS2CR4		11586298, 20375344	Standard	NM_001044385		Approved	JBTS14	uc021vvg.2	Q96Q45	OTTHUMG00000154526	ENST00000409883.2:c.205A>T	2.37:g.202501540T>A	ENSP00000386264:p.Thr69Ser	53.0	0.0		44.0	18.0	NM_001044385	B4E1R8|B4E2R8|E9PAR8|E9PBF8|E9PG24|E9PGX0|Q53TS9|Q53TT2|Q7Z3B6|Q8IZ18|Q8NBF8|Q96CY1	Missense_Mutation	SNP	ENST00000409883.2	37	CCDS46489.1	.	.	.	.	.	.	.	.	.	.	T	8.241	0.806894	0.16467	0.0	1.22E-4	ENSG00000155755	ENST00000409444;ENST00000409883;ENST00000435876;ENST00000426684	T;T	0.44083	0.93;0.93	5.27	0.376	0.16193	.	0.122859	0.53938	N	0.000044	T	0.26557	0.0649	L	0.39397	1.21	0.09310	N	1	B;B	0.12013	0.005;0.0	B;B	0.09377	0.004;0.003	T	0.11348	-1.0591	10	0.33141	T	0.24	-3.1583	4.4306	0.11525	0.1405:0.3118:0.0:0.5477	.	69;93	E9PAR8;Q96Q45	.;TM237_HUMAN	S	61;69;69;91	ENSP00000387203:T61S;ENSP00000386264:T69S	ENSP00000387203:T61S	T	-	1	0	TMEM237	202209785	0.966000	0.33281	0.460000	0.27093	0.309000	0.27889	0.146000	0.16180	-0.071000	0.12886	0.528000	0.53228	ACT	.		0.438	TMEM237-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000335753.1	NM_152388	
TNRC6B	23112	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	40657900	40657900	+	Silent	SNP	A	A	G	rs376736908		TCGA-G3-A3CJ-01A-11D-A20W-10	TCGA-G3-A3CJ-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b064bc29-9a26-41f6-b49a-ae77a15d4967	fe4fd074-ca2d-42c3-9851-1c874d1f51fd	g.chr22:40657900A>G	ENST00000454349.2	+	4	391	c.180A>G	c.(178-180)ccA>ccG	p.P60P	TNRC6B_ENST00000301923.9_Silent_p.P96P|TNRC6B_ENST00000335727.9_Silent_p.P60P|TNRC6B_ENST00000402203.1_Silent_p.P96P	NM_001162501.1	NP_001155973.1	Q9UPQ9	TNR6B_HUMAN	trinucleotide repeat containing 6B	60	Interaction with argonaute proteins.				epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|innate immune response (GO:0045087)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|regulation of translation (GO:0006417)	cytosol (GO:0005829)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)	1						GCAGCTCTCCATCGCCACCAG	0.582																																					p.P96P		.											.	TNRC6B	22	0			c.A288G						.	A	,,	2,3814		0,2,1906	22.0	26.0	25.0		288,180,180	5.9	1.0	22		25	0,8162		0,0,4081	no	coding-synonymous,coding-synonymous,coding-synonymous	TNRC6B	NM_001024843.1,NM_001162501.1,NM_015088.2	,,	0,2,5987	GG,GA,AA		0.0,0.0524,0.0167	,,	96/1030,60/1834,60/1724	40657900	2,11976	1908	4081	5989	SO:0001819	synonymous_variant	23112	exon7			CTCTCCATCGCCA	AB029016	CCDS46712.1, CCDS46713.1, CCDS54533.1	22q13	2006-08-22			ENSG00000100354	ENSG00000100354		"""Trinucleotide (CAG) repeat containing"""	29190	protein-coding gene	gene with protein product		610740					Standard	NM_015088		Approved	KIAA1093	uc011aor.2	Q9UPQ9	OTTHUMG00000151114	ENST00000454349.2:c.180A>G	22.37:g.40657900A>G		248.0	0.0		181.0	69.0	NM_001024843	B0QY73|B0QY78|B4DGC0|Q5TH52|Q8TBX2	Silent	SNP	ENST00000454349.2	37	CCDS54533.1																																																																																			.		0.582	TNRC6B-202	KNOWN	basic|CCDS	protein_coding	protein_coding			
TP53	7157	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	17	7578503	7578503	+	Missense_Mutation	SNP	C	C	T	rs587782620		TCGA-G3-A3CJ-01A-11D-A20W-10	TCGA-G3-A3CJ-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b064bc29-9a26-41f6-b49a-ae77a15d4967	fe4fd074-ca2d-42c3-9851-1c874d1f51fd	g.chr17:7578503C>T	ENST00000269305.4	-	5	616	c.427G>A	c.(427-429)Gtg>Atg	p.V143M	TP53_ENST00000455263.2_Missense_Mutation_p.V143M|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000413465.2_Missense_Mutation_p.V143M|TP53_ENST00000420246.2_Missense_Mutation_p.V143M|TP53_ENST00000359597.4_Missense_Mutation_p.V143M|TP53_ENST00000445888.2_Missense_Mutation_p.V143M	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	143	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		V -> A (in sporadic cancers; somatic mutation; strong DNA binding ability at 32.5 degrees Celsius; strong reduction of transcriptional activity at 37.5 degrees Celsius; severely represses interaction with ZNF385A).|V -> E (in sporadic cancers; somatic mutation).|V -> G (in sporadic cancers; somatic mutation).|V -> L (in sporadic cancers; somatic mutation).|V -> M (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.V143M(19)|p.0?(8)|p.V143L(4)|p.V143fs*27(2)|p.V11M(1)|p.L137_W146del10(1)|p.V143fs*29(1)|p.P142_Q144delPVQ(1)|p.K139fs*4(1)|p.A138_V143delAKTCPV(1)|p.V50M(1)|p.V143_S149del(1)|p.C141fs*5(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CACAGCTGCACAGGGCAGGTC	0.587		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.V143M	Pancreas(47;798 1329 9957 10801)	.	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53,NS,carcinoma,+1	TP53	70225	42	Substitution - Missense(25)|Whole gene deletion(8)|Deletion - In frame(4)|Deletion - Frameshift(4)|Insertion - Frameshift(1)	haematopoietic_and_lymphoid_tissue(8)|breast(6)|bone(4)|upper_aerodigestive_tract(3)|central_nervous_system(3)|urinary_tract(3)|lung(3)|ovary(3)|salivary_gland(2)|large_intestine(2)|oesophagus(2)|cervix(1)|stomach(1)|prostate(1)	c.G427A						.						56.0	56.0	56.0					17																	7578503		2203	4300	6503	SO:0001583	missense	7157	exon5	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	GCTGCACAGGGCA	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.427G>A	17.37:g.7578503C>T	ENSP00000269305:p.Val143Met	167.0	0.0		125.0	51.0	NM_000546	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	C	13.43	2.235817	0.39498	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315;ENST00000508793	D;D;D;D;D;D;D;D;D	0.99837	-7.06;-7.06;-7.06;-7.06;-7.06;-7.06;-7.06;-7.06;-7.06	5.48	4.51	0.55191	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.343688	0.28219	N	0.016151	D	0.99684	0.9881	M	0.76328	2.33	0.43018	D	0.994566	D;D;D;D;D;D;D	0.89917	1.0;1.0;0.999;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.87578	0.995;0.994;0.985;0.994;0.998;0.998;0.995	D	0.98175	1.0454	10	0.87932	D	0	-32.0412	7.6505	0.28346	0.1615:0.7548:0.0:0.0837	.	104;143;143;50;143;143;143	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	M	143;143;143;143;143;143;132;50;11;50;11;143	ENSP00000410739:V143M;ENSP00000352610:V143M;ENSP00000269305:V143M;ENSP00000398846:V143M;ENSP00000391127:V143M;ENSP00000391478:V143M;ENSP00000425104:V11M;ENSP00000423862:V50M;ENSP00000424104:V143M	ENSP00000269305:V143M	V	-	1	0	TP53	7519228	0.854000	0.29725	0.596000	0.28811	0.011000	0.07611	1.561000	0.36342	1.448000	0.47680	0.655000	0.94253	GTG	.		0.587	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
TRIM65	201292	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	17	73887372	73887372	+	Missense_Mutation	SNP	G	G	A	rs144407004		TCGA-G3-A3CJ-01A-11D-A20W-10	TCGA-G3-A3CJ-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b064bc29-9a26-41f6-b49a-ae77a15d4967	fe4fd074-ca2d-42c3-9851-1c874d1f51fd	g.chr17:73887372G>A	ENST00000269383.3	-	6	1107	c.1042C>T	c.(1042-1044)Cgc>Tgc	p.R348C		NM_001256124.1|NM_173547.3	NP_001243053.1|NP_775818.2	Q6PJ69	TRI65_HUMAN	tripartite motif containing 65	348	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.					intracellular (GO:0005622)	zinc ion binding (GO:0008270)			endometrium(1)|kidney(1)|lung(5)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	12			Epithelial(20;7.53e-06)|all cancers(21;9.11e-06)|BRCA - Breast invasive adenocarcinoma(9;0.00092)|LUSC - Lung squamous cell carcinoma(166;0.154)			TGGTCCTGGCGCGACAGATAG	0.612																																					p.R348C		.											.	TRIM65	90	0			c.C1042T						.	G	CYS/ARG	1,4387		0,1,2193	25.0	28.0	27.0		1042	-0.2	0.0	17	dbSNP_134	27	1,8535		0,1,4267	no	missense	TRIM65	NM_173547.2	180	0,2,6460	AA,AG,GG		0.0117,0.0228,0.0155	benign	348/518	73887372	2,12922	2194	4268	6462	SO:0001583	missense	201292	exon6			CCTGGCGCGACAG	BC006138	CCDS11732.1	17q25.1	2013-01-09	2011-01-25		ENSG00000141569	ENSG00000141569		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	27316	protein-coding gene	gene with protein product			"""tripartite motif-containing 65"""			12477932	Standard	NM_173547		Approved		uc002jpx.4	Q6PJ69	OTTHUMG00000132127	ENST00000269383.3:c.1042C>T	17.37:g.73887372G>A	ENSP00000269383:p.Arg348Cys	131.0	0.0		115.0	34.0	NM_173547	Q4G0F0|Q6DKJ6|Q9BRP6	Missense_Mutation	SNP	ENST00000269383.3	37	CCDS11732.1	.	.	.	.	.	.	.	.	.	.	G	2.643	-0.283636	0.05642	2.28E-4	1.17E-4	ENSG00000141569	ENST00000269383	T	0.73789	-0.78	5.2	-0.155	0.13395	Concanavalin A-like lectin/glucanase (1);B30.2/SPRY domain (1);	1.244230	0.05581	N	0.572948	T	0.61578	0.2358	L	0.35723	1.085	0.09310	N	1	B	0.11235	0.004	B	0.06405	0.002	T	0.49995	-0.8879	10	0.54805	T	0.06	.	2.7844	0.05370	0.3849:0.1102:0.3925:0.1124	.	348	Q6PJ69	TRI65_HUMAN	C	348	ENSP00000269383:R348C	ENSP00000269383:R348C	R	-	1	0	TRIM65	71398967	0.000000	0.05858	0.025000	0.17156	0.016000	0.09150	-0.389000	0.07342	0.241000	0.21283	-0.986000	0.02555	CGC	G|1.000;A|0.000		0.612	TRIM65-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255170.2	NM_173547	
VPS35	55737	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	16	46696258	46696258	+	Missense_Mutation	SNP	A	A	C			TCGA-G3-A3CJ-01A-11D-A20W-10	TCGA-G3-A3CJ-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b064bc29-9a26-41f6-b49a-ae77a15d4967	fe4fd074-ca2d-42c3-9851-1c874d1f51fd	g.chr16:46696258A>C	ENST00000299138.7	-	15	2022	c.1964T>G	c.(1963-1965)cTt>cGt	p.L655R	RP11-93O14.2_ENST00000569353.1_RNA	NM_018206.4	NP_060676.2	Q96QK1	VPS35_HUMAN	vacuolar protein sorting 35 homolog (S. cerevisiae)	655					cell death (GO:0008219)|protein transport (GO:0015031)|retrograde transport, endosome to Golgi (GO:0042147)	cytosol (GO:0005829)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|retromer complex (GO:0030904)				breast(2)|endometrium(2)|kidney(2)|large_intestine(3)|lung(11)|pancreas(1)|prostate(1)|urinary_tract(1)	23		all_cancers(37;7.65e-05)|all_epithelial(9;0.000154)|all_lung(18;0.00585)|Lung NSC(13;0.0496)|Breast(268;0.116)				GGATGCAGCAAGGGCACACTG	0.493																																					p.L655R		.											.	VPS35	90	0			c.T1964G						.						99.0	87.0	91.0					16																	46696258		2203	4300	6503	SO:0001583	missense	55737	exon15			GCAGCAAGGGCAC	AF175265	CCDS10721.1	16q12	2012-06-27	2006-12-19		ENSG00000069329	ENSG00000069329		"""Parkinson disease"""	13487	protein-coding gene	gene with protein product		601501	"""vacuolar protein sorting 35 (yeast homolog)"", ""vacuolar protein sorting 35 (yeast)"""			11112353, 21763482	Standard	NM_018206		Approved	FLJ10752, MEM3, PARK17	uc002eef.4	Q96QK1	OTTHUMG00000132542	ENST00000299138.7:c.1964T>G	16.37:g.46696258A>C	ENSP00000299138:p.Leu655Arg	211.0	0.0		143.0	52.0	NM_018206	Q561W2|Q9H016|Q9H096|Q9H4P3|Q9H8J0|Q9NRS7|Q9NVG2|Q9NX80|Q9NZK2	Missense_Mutation	SNP	ENST00000299138.7	37	CCDS10721.1	.	.	.	.	.	.	.	.	.	.	.	23.7	4.444215	0.83993	.	.	ENSG00000069329	ENST00000299138;ENST00000541330	T	0.64260	-0.09	5.49	5.49	0.81192	.	0.000000	0.85682	D	0.000000	T	0.78528	0.4297	M	0.86502	2.82	0.80722	D	1	D;D	0.76494	0.999;0.981	D;P	0.70227	0.968;0.557	T	0.78125	-0.2326	10	0.07482	T	0.82	-16.6205	15.624	0.76833	1.0:0.0:0.0:0.0	.	655;520	Q96QK1;F5GYF5	VPS35_HUMAN;.	R	655;520	ENSP00000299138:L655R	ENSP00000299138:L655R	L	-	2	0	VPS35	45253759	1.000000	0.71417	0.993000	0.49108	0.994000	0.84299	9.339000	0.96797	2.090000	0.63153	0.459000	0.35465	CTT	.		0.493	VPS35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255742.3		
VSIG10L	147645	hgsc.bcm.edu;bcgsc.ca	37	19	51835894	51835894	+	Splice_Site	SNP	C	C	G	rs200336358		TCGA-G3-A3CJ-01A-11D-A20W-10	TCGA-G3-A3CJ-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b064bc29-9a26-41f6-b49a-ae77a15d4967	fe4fd074-ca2d-42c3-9851-1c874d1f51fd	g.chr19:51835894C>G	ENST00000335624.4	-	10	2574	c.2575G>C	c.(2575-2577)Gca>Cca	p.A859P		NM_001163922.1	NP_001157394.1	Q86VR7	VS10L_HUMAN	V-set and immunoglobulin domain containing 10 like	859						integral component of membrane (GO:0016021)				breast(1)|endometrium(2)|kidney(1)	4						GGGGTCTGTGCCTGGAAGAGA	0.537																																					p.A859P		.											.	.	.	0			c.G2575C						.						104.0	119.0	114.0					19																	51835894		692	1591	2283	SO:0001630	splice_region_variant	147645	exon10			TCTGTGCCTGGAA		CCDS54300.1	19q13.41	2013-01-11				ENSG00000186806		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	27111	protein-coding gene	gene with protein product						12477932	Standard	NM_001163922		Approved		uc002pwf.3	Q86VR7		ENST00000335624.4:c.2575-1G>C	19.37:g.51835894C>G		132.0	0.0		94.0	11.0	NM_001163922		Missense_Mutation	SNP	ENST00000335624.4	37	CCDS54300.1	.	.	.	.	.	.	.	.	.	.	C	12.42	1.931521	0.34096	.	.	ENSG00000186806	ENST00000335624	T	0.23950	1.88	4.66	0.994	0.19832	.	.	.	.	.	T	0.18593	0.0446	L	0.36672	1.1	0.20403	N	0.999906	B	0.14438	0.01	B	0.11329	0.006	T	0.24693	-1.0153	9	0.62326	D	0.03	0.0	5.9891	0.19450	0.0:0.516:0.3777:0.1063	rs11402251;rs33944140;rs58614229	859	Q86VR7	VS10L_HUMAN	P	859	ENSP00000335623:A859P	ENSP00000335623:A859P	A	-	1	0	VSIG10L	56527706	0.783000	0.28701	0.602000	0.28890	0.172000	0.22775	0.703000	0.25646	0.385000	0.24970	0.462000	0.41574	GCA	.		0.537	VSIG10L-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464535.1	NM_001163922	Missense_Mutation
WNK4	65266	broad.mit.edu;bcgsc.ca;mdanderson.org	37	17	40932748	40932748	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A3CJ-01A-11D-A20W-10	TCGA-G3-A3CJ-10A-01D-A20W-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b064bc29-9a26-41f6-b49a-ae77a15d4967	fe4fd074-ca2d-42c3-9851-1c874d1f51fd	g.chr17:40932748T>C	ENST00000246914.5	+	1	53	c.32T>C	c.(31-33)gTc>gCc	p.V11A		NM_032387.4	NP_115763.2	Q96J92	WNK4_HUMAN	WNK lysine deficient protein kinase 4	11					chloride transport (GO:0006821)|distal tubule morphogenesis (GO:0072156)|intracellular signal transduction (GO:0035556)|ion homeostasis (GO:0050801)|ion transport (GO:0006811)|negative regulation of pancreatic juice secretion (GO:0090188)|protein localization (GO:0008104)|protein phosphorylation (GO:0006468)|regulation of cellular process (GO:0050794)|renal sodium ion absorption (GO:0070294)	cytoplasm (GO:0005737)|tight junction (GO:0005923)	ATP binding (GO:0005524)|chloride channel inhibitor activity (GO:0019869)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(10)|ovary(3)|prostate(1)|skin(5)|stomach(1)	35		Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.0749)		GAGACCACCGTCCTCATGTCC	0.716																																					p.V11A	Esophageal Squamous(6;201 374 4964 23855 42828)	.											.	WNK4	336	0			c.T32C						.						21.0	23.0	22.0					17																	40932748		2185	4270	6455	SO:0001583	missense	65266	exon1			CCACCGTCCTCAT	AJ309861	CCDS11439.1	17q21-q22	2005-01-19	2005-01-19	2005-01-19		ENSG00000126562			14544	protein-coding gene	gene with protein product		601844	"""protein kinase, lysine deficient 4"""	PRKWNK4			Standard	NM_032387		Approved		uc002ibj.3	Q96J92		ENST00000246914.5:c.32T>C	17.37:g.40932748T>C	ENSP00000246914:p.Val11Ala	93.0	1.0		46.0	19.0	NM_032387	B0LPI0|Q8N8X3|Q8N8Z2|Q96DT8|Q9BYS5	Missense_Mutation	SNP	ENST00000246914.5	37	CCDS11439.1	.	.	.	.	.	.	.	.	.	.	T	11.74	1.729299	0.30684	.	.	ENSG00000126562	ENST00000246914	T	0.71222	-0.55	4.41	3.18	0.36537	.	0.363091	0.19855	N	0.104552	T	0.51381	0.1671	L	0.32530	0.975	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.28396	-1.0045	10	0.11182	T	0.66	-14.3014	5.2161	0.15344	0.0:0.1777:0.0:0.8223	.	11	Q96J92	WNK4_HUMAN	A	11	ENSP00000246914:V11A	ENSP00000246914:V11A	V	+	2	0	WNK4	38186274	0.000000	0.05858	0.759000	0.31340	0.031000	0.12232	-0.233000	0.09041	0.594000	0.29761	0.260000	0.18958	GTC	.		0.716	WNK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452389.1		
WT1-AS	51352	ucsc.edu;mdanderson.org	37	11	32460561	32460561	+	RNA	SNP	G	G	A			TCGA-G3-A3CJ-01A-11D-A20W-10	TCGA-G3-A3CJ-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b064bc29-9a26-41f6-b49a-ae77a15d4967	fe4fd074-ca2d-42c3-9851-1c874d1f51fd	g.chr11:32460561G>A	ENST00000395900.1	+	0	1439				WT1-AS_ENST00000459866.1_RNA|WT1-AS_ENST00000426618.2_RNA|WT1-AS_ENST00000442957.1_RNA|WT1-AS_ENST00000478367.1_RNA|WT1-AS_ENST00000494911.1_RNA|WT1-AS_ENST00000525436.1_RNA	NR_023920.1		Q06250	WIT1_HUMAN	WT1 antisense RNA											endometrium(1)|large_intestine(2)|lung(2)|prostate(1)	6						AGGGCAGTGAGGATTTCTCAA	0.577																																					.		.											.	WT1-AS	68	0			.						.						54.0	51.0	52.0					11																	32460561		2202	4299	6501			51352	.			CAGTGAGGATTTC	BC002734		11p13	2012-10-19	2012-08-15	2012-01-25	ENSG00000183242	ENSG00000183242		"""Long non-coding RNAs"", ""-"""	18135	non-coding RNA	RNA, long non-coding	"""Wilms tumor associated protein"""	607899	"""Wilms tumor upstream neighbor 1"", ""WT1 antisense RNA (non-protein coding)"""	WIT1		2173145, 8406502, 17210670	Standard	NR_120546		Approved	WIT-1, WT1AS, WT1-AS1	uc010red.2	Q06250	OTTHUMG00000039557		11.37:g.32460561G>A		133.0	0.0		96.0	33.0	.	Q4KMY0|Q96A27	RNA	SNP	ENST00000395900.1	37																																																																																				.		0.577	WT1-AS-001	KNOWN	basic	antisense	antisense	OTTHUMT00000095437.1	NR_023920	
ZNF429	353088	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	19	21719985	21719985	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A3CJ-01A-11D-A20W-10	TCGA-G3-A3CJ-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b064bc29-9a26-41f6-b49a-ae77a15d4967	fe4fd074-ca2d-42c3-9851-1c874d1f51fd	g.chr19:21719985C>A	ENST00000358491.4	+	4	1338	c.1130C>A	c.(1129-1131)gCt>gAt	p.A377D	ZNF429_ENST00000597078.1_Intron	NM_001001415.2	NP_001001415.2	Q86V71	ZN429_HUMAN	zinc finger protein 429	377					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|kidney(2)|large_intestine(13)|lung(10)|ovary(2)|pancreas(1)|prostate(1)|soft_tissue(1)|upper_aerodigestive_tract(2)	34						TGTGGCAAAGCTTTTAACCAG	0.373																																					p.A377D		.											.	ZNF429	516	0			c.C1130A						.						41.0	47.0	45.0					19																	21719985		2099	4257	6356	SO:0001583	missense	353088	exon4			GCAAAGCTTTTAA	AY269786	CCDS42537.1	19p12	2014-02-14			ENSG00000197013	ENSG00000197013		"""Zinc fingers, C2H2-type"", ""-"""	20817	protein-coding gene	gene with protein product							Standard	NM_001001415		Approved		uc002nqd.1	Q86V71	OTTHUMG00000182848	ENST00000358491.4:c.1130C>A	19.37:g.21719985C>A	ENSP00000351280:p.Ala377Asp	33.0	0.0		28.0	9.0	NM_001001415	A6NLV7|Q9BZE6	Missense_Mutation	SNP	ENST00000358491.4	37	CCDS42537.1	.	.	.	.	.	.	.	.	.	.	.	7.998	0.754724	0.15778	.	.	ENSG00000197013	ENST00000358491	T	0.14266	2.52	0.876	0.876	0.19138	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.12433	0.0302	L	0.48877	1.53	0.09310	N	1	B	0.22541	0.071	B	0.23574	0.047	T	0.28839	-1.0031	9	0.87932	D	0	.	6.2723	0.20961	0.0:0.4389:0.5611:0.0	.	377	Q86V71	ZN429_HUMAN	D	377	ENSP00000351280:A377D	ENSP00000351280:A377D	A	+	2	0	ZNF429	21511825	0.000000	0.05858	0.467000	0.27180	0.469000	0.32828	0.344000	0.19962	0.293000	0.22520	0.298000	0.19748	GCT	.		0.373	ZNF429-003	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463981.1	NM_001001415	
ZNF208	7757	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	22155940	22155940	+	Silent	SNP	A	A	G			TCGA-G3-A3CJ-01A-11D-A20W-10	TCGA-G3-A3CJ-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b064bc29-9a26-41f6-b49a-ae77a15d4967	fe4fd074-ca2d-42c3-9851-1c874d1f51fd	g.chr19:22155940A>G	ENST00000397126.4	-	4	2044	c.1896T>C	c.(1894-1896)gcT>gcC	p.A632A	ZNF208_ENST00000601773.1_Intron|ZNF208_ENST00000599916.1_Intron	NM_007153.3	NP_009084.2	O43345	ZN208_HUMAN	zinc finger protein 208	632					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(18)|liver(1)|lung(71)|ovary(6)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	113		all_lung(12;0.0961)|Lung NSC(12;0.103)				GCTTCTCTCCAGCATGAATTG	0.398																																					p.A632A		.											.	ZNF208	7	0			c.T1896C						.						78.0	86.0	83.0					19																	22155940		2120	4248	6368	SO:0001819	synonymous_variant	7757	exon4			CTCTCCAGCATGA	BC038199	CCDS54240.1	19p12	2013-01-08				ENSG00000160321		"""Zinc fingers, C2H2-type"", ""-"""	12999	protein-coding gene	gene with protein product	"""zinc finger protein 95"""	603977				9724325	Standard	NM_007153		Approved	PMIDP, ZNF95	uc021urr.1	O43345		ENST00000397126.4:c.1896T>C	19.37:g.22155940A>G		69.0	0.0		83.0	28.0	NM_007153		Silent	SNP	ENST00000397126.4	37	CCDS54240.1																																																																																			.		0.398	ZNF208-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464302.1	NM_007153	
ZNF536	9745	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	30935925	30935925	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A3CJ-01A-11D-A20W-10	TCGA-G3-A3CJ-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b064bc29-9a26-41f6-b49a-ae77a15d4967	fe4fd074-ca2d-42c3-9851-1c874d1f51fd	g.chr19:30935925C>A	ENST00000355537.3	+	2	1603	c.1456C>A	c.(1456-1458)Cac>Aac	p.H486N		NM_014717.1	NP_055532.1	O15090	ZN536_HUMAN	zinc finger protein 536	486					negative regulation of neuron differentiation (GO:0045665)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|retinoic acid-responsive element binding (GO:0044323)			NS(3)|breast(6)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|lung(119)|ovary(7)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(3)	182	Esophageal squamous(110;0.0834)					GGGGGACAAGCACTCCCTCCT	0.652																																					p.H486N		.											.	ZNF536	144	0			c.C1456A						.						35.0	39.0	37.0					19																	30935925		2203	4299	6502	SO:0001583	missense	9745	exon2			GACAAGCACTCCC		CCDS32984.1	19q13.11	2013-01-08				ENSG00000198597		"""Zinc fingers, C2H2-type"""	29025	protein-coding gene	gene with protein product						9205841	Standard	XM_005259445		Approved	KIAA0390	uc002nsu.1	O15090		ENST00000355537.3:c.1456C>A	19.37:g.30935925C>A	ENSP00000347730:p.His486Asn	75.0	0.0		60.0	19.0	NM_014717	A2RU18	Missense_Mutation	SNP	ENST00000355537.3	37	CCDS32984.1	.	.	.	.	.	.	.	.	.	.	C	10.58	1.390145	0.25118	.	.	ENSG00000198597	ENST00000355537	T	0.07908	3.15	5.53	5.53	0.82687	.	0.048823	0.85682	D	0.000000	T	0.11580	0.0282	L	0.40543	1.245	0.51482	D	0.999923	D;D	0.53151	0.958;0.958	P;P	0.45276	0.475;0.475	T	0.13710	-1.0499	10	0.24483	T	0.36	-36.3673	19.4573	0.94900	0.0:1.0:0.0:0.0	.	486;486	A7E228;O15090	.;ZN536_HUMAN	N	486	ENSP00000347730:H486N	ENSP00000347730:H486N	H	+	1	0	ZNF536	35627765	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.788000	0.85771	2.582000	0.87167	0.655000	0.94253	CAC	.		0.652	ZNF536-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459667.2	NM_014717	
ARHGEF33	100271715	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	2	39181520	39181521	+	Missense_Mutation	DNP	GA	GA	AT			TCGA-G3-A3CJ-01A-11D-A20W-10	TCGA-G3-A3CJ-10A-01D-A20W-10	GA	GA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b064bc29-9a26-41f6-b49a-ae77a15d4967	fe4fd074-ca2d-42c3-9851-1c874d1f51fd	g.chr2:39181520_39181521GA>AT	ENST00000536934.1	+	11	1229_1230	c.1144_1145GA>AT	c.(1144-1146)GAa>ATa	p.E382I	ARHGEF33_ENST00000409978.1_Missense_Mutation_p.E382I|ARHGEF33_ENST00000398800.4_Missense_Mutation_p.E382I			A8MVX0	ARG33_HUMAN	Rho guanine nucleotide exchange factor (GEF) 33	382	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.						Rho guanyl-nucleotide exchange factor activity (GO:0005089)			endometrium(3)|pancreas(1)|prostate(1)	5						TCAGGGTGATGAAGAGATTAAA	0.475																																					p.E382I		.											.	.	.	0			.						.																																			SO:0001583	missense	100271715	.			GGTGATGAAGAGA		CCDS46263.1, CCDS46263.2	2p22.1	2012-07-24			ENSG00000214694	ENSG00000214694		"""Rho guanine nucleotide exchange factors"""	37252	protein-coding gene	gene with protein product							Standard	NM_001145451		Approved		uc021vgd.1	A8MVX0	OTTHUMG00000153540	Exception_encountered	2.37:g.39181520_39181521delinsAT	ENSP00000445586:p.Glu382Ile	201.0	0.0		120.0	36.0	.	J3KPX2	Missense_Mutation	DNP	ENST00000536934.1	37																																																																																				.		0.475	ARHGEF33-202	KNOWN	basic	protein_coding	protein_coding		NM_001145451	
ZRANB3	84083	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	2	135985575	135985575	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A3CJ-01A-11D-A20W-10	TCGA-G3-A3CJ-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b064bc29-9a26-41f6-b49a-ae77a15d4967	fe4fd074-ca2d-42c3-9851-1c874d1f51fd	g.chr2:135985575T>C	ENST00000264159.6	-	14	2081	c.1965A>G	c.(1963-1965)atA>atG	p.I655M	ZRANB3_ENST00000412849.1_5'UTR|ZRANB3_ENST00000401392.1_Missense_Mutation_p.I655M|ZRANB3_ENST00000536680.1_Missense_Mutation_p.I655M	NM_032143.2	NP_115519.2	Q5FWF4	ZRAB3_HUMAN	zinc finger, RAN-binding domain containing 3	655					cellular response to DNA damage stimulus (GO:0006974)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA repair (GO:0006281)|DNA rewinding (GO:0036292)|DNA strand renaturation (GO:0000733)|negative regulation of DNA recombination (GO:0045910)|replication fork processing (GO:0031297)|replication fork protection (GO:0048478)|response to UV (GO:0009411)	nuclear replication fork (GO:0043596)	annealing helicase activity (GO:0036310)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|endodeoxyribonuclease activity (GO:0004520)|helicase activity (GO:0004386)|K63-linked polyubiquitin binding (GO:0070530)|zinc ion binding (GO:0008270)			NS(2)|endometrium(2)|kidney(2)|large_intestine(3)|lung(10)|upper_aerodigestive_tract(1)	20				BRCA - Breast invasive adenocarcinoma(221;0.135)		TGAGGCTATCTATTTGCATAA	0.284																																					p.I655M		.											.	ZRANB3	658	0			c.A1965G						.						45.0	35.0	38.0					2																	135985575		1576	3543	5119	SO:0001583	missense	84083	exon14			GCTATCTATTTGC	AL136824	CCDS46419.1, CCDS67963.1, CCDS74580.1	2q21.3	2013-05-13			ENSG00000121988	ENSG00000121988		"""Zinc fingers, RAN-binding domain containing"""	25249	protein-coding gene	gene with protein product						11230166	Standard	XM_005263809		Approved	DKFZP434B1727	uc002tum.3	Q5FWF4	OTTHUMG00000150475	ENST00000264159.6:c.1965A>G	2.37:g.135985575T>C	ENSP00000264159:p.Ile655Met	92.0	0.0		104.0	37.0	NM_032143	B3KYA1|B4E375|B5MDI3|D3DP76|E9PBP0|Q53SM1|Q6P2C4|Q8N1P4|Q9H0E8	Missense_Mutation	SNP	ENST00000264159.6	37	CCDS46419.1	.	.	.	.	.	.	.	.	.	.	T	7.579	0.668435	0.14776	.	.	ENSG00000121988	ENST00000538542;ENST00000283060;ENST00000401392;ENST00000264159;ENST00000536680	D;D;D	0.90676	-2.71;-2.71;-2.7	4.45	4.45	0.53987	.	0.393053	0.24568	N	0.037409	T	0.77363	0.4119	N	0.08118	0	0.22571	N	0.998979	P;P	0.41345	0.63;0.746	B;B	0.33196	0.076;0.159	T	0.72057	-0.4405	10	0.48119	T	0.1	-8.633	10.2931	0.43608	0.0:0.0:0.0:1.0	.	655;655	Q5FWF4;Q5FWF4-3	ZRAB3_HUMAN;.	M	120;120;655;655;655	ENSP00000383979:I655M;ENSP00000264159:I655M;ENSP00000441320:I655M	ENSP00000264159:I655M	I	-	3	3	ZRANB3	135702045	0.802000	0.28943	0.359000	0.25824	0.351000	0.29236	1.326000	0.33735	1.987000	0.57996	0.454000	0.30748	ATA	.		0.284	ZRANB3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000318254.1	NM_032143	
WHSC1L1	54904	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	8	38148152	38148153	+	Missense_Mutation	DNP	TC	TC	AG			TCGA-G3-A3CJ-01A-11D-A20W-10	TCGA-G3-A3CJ-10A-01D-A20W-10	TC	TC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b064bc29-9a26-41f6-b49a-ae77a15d4967	fe4fd074-ca2d-42c3-9851-1c874d1f51fd	g.chr8:38148152_38148153TC>AG	ENST00000317025.8	-	17	3475_3476	c.2958_2959GA>CT	c.(2956-2961)ctGAac>ctCTac	p.N987Y	WHSC1L1_ENST00000433384.2_Missense_Mutation_p.N938Y|WHSC1L1_ENST00000527502.1_Missense_Mutation_p.N987Y	NM_023034.1	NP_075447.1	Q9BZ95	NSD3_HUMAN	Wolf-Hirschhorn syndrome candidate 1-like 1	987	PWWP 2. {ECO:0000255|PROSITE- ProRule:PRU00162}.				histone lysine methylation (GO:0034968)|histone methylation (GO:0016571)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|nucleus (GO:0005634)	histone-lysine N-methyltransferase activity (GO:0018024)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|endometrium(3)|kidney(3)|large_intestine(2)|lung(10)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	24	Colorectal(12;0.000442)|Esophageal squamous(3;0.0725)	all_lung(54;0.00787)|Lung NSC(58;0.0295)|Hepatocellular(245;0.065)	Epithelial(3;3.12e-43)|all cancers(3;1.72e-38)|BRCA - Breast invasive adenocarcinoma(5;2.84e-27)|LUSC - Lung squamous cell carcinoma(2;2.79e-25)|Lung(2;5.03e-23)|COAD - Colon adenocarcinoma(9;0.0511)			CCCTGGATGTTCAGTGGCACAG	0.455			T	NUP98	AML																																p.N987Y		.		Dom	yes		8	8p12	54904	Wolf-Hirschhorn syndrome candidate 1-like 1 (NSD3)		L	.	.	.	0			.						.																																			SO:0001583	missense	54904	.			GGATGTTCAGTGG	AF332469	CCDS6105.1, CCDS43729.1	8p11.2	2013-05-20			ENSG00000147548	ENSG00000147548			12767	protein-coding gene	gene with protein product		607083				10802047, 23269674	Standard	NM_023034		Approved	FLJ20353, NSD3	uc003xli.3	Q9BZ95		ENST00000317025.8:c.2958_2959delinsAG	8.37:g.38148152_38148153delinsAG	ENSP00000313983:p.Asn987Tyr	173.0	0.0		150.0	53.0	.	B7ZL11|D3DSX1|Q1RMD3|Q3B796|Q6ZSA5|Q9BYU8|Q9BYU9|Q9H2M8|Q9H9W9|Q9NXA6	Missense_Mutation	DNP	ENST00000317025.8	37	CCDS43729.1																																																																																			.		0.455	WHSC1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381924.3	NM_023034	
