#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ACIN1	22985	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	23530298	23530298	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A5SL-01A-11D-A27I-10	TCGA-G3-A5SL-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70422e6d-cb1f-4284-8be9-1d4517ffad60	a38d4467-c3e5-4639-ad4f-88bcd7ab9f26	g.chr14:23530298T>C	ENST00000262710.1	-	18	4021	c.3694A>G	c.(3694-3696)Agc>Ggc	p.S1232G	ACIN1_ENST00000605057.1_Missense_Mutation_p.S1174G|ACIN1_ENST00000397341.3_Missense_Mutation_p.S474G|ACIN1_ENST00000357481.2_Missense_Mutation_p.S474G|ACIN1_ENST00000557515.1_Missense_Mutation_p.S473G|ACIN1_ENST00000555053.1_Missense_Mutation_p.S1219G|ACIN1_ENST00000457657.1_Missense_Mutation_p.S1192G|ACIN1_ENST00000338631.6_Missense_Mutation_p.S505G	NM_001164814.1|NM_014977.3	NP_001158286.1|NP_055792	Q9UKV3	ACINU_HUMAN	apoptotic chromatin condensation inducer 1	1232	Arg/Asp/Glu/Lys-rich.|Sufficient for interaction with RNPS1 and SAP18 and formation of th ASAP complex. {ECO:0000250}.				apoptotic chromosome condensation (GO:0030263)|apoptotic process (GO:0006915)|ATP catabolic process (GO:0006200)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|erythrocyte differentiation (GO:0030218)|mRNA processing (GO:0006397)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|positive regulation of apoptotic process (GO:0043065)|positive regulation of monocyte differentiation (GO:0045657)|RNA splicing (GO:0008380)	ASAP complex (GO:0061574)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATPase activity (GO:0016887)|enzyme binding (GO:0019899)|nucleic acid binding (GO:0003676)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(6)|kidney(4)|large_intestine(9)|lung(10)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	37	all_cancers(95;1.36e-05)			GBM - Glioblastoma multiforme(265;0.00816)		CTCACCTGGCTGTCAGTCAGT	0.582																																					p.S1232G		.											.	ACIN1	156	0			c.A3694G						.						104.0	88.0	93.0					14																	23530298		2203	4300	6503	SO:0001583	missense	22985	exon18			CCTGGCTGTCAGT	AB014570	CCDS9587.1, CCDS53887.1, CCDS53888.1, CCDS53889.1, CCDS55905.1	14q11.2	2008-11-25	2004-03-31	2004-04-01	ENSG00000100813	ENSG00000100813			17066	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 152"""	604562	"""apoptotic chromatin condensation inducer in the nucleus"""	ACINUS		9734811, 10490026	Standard	NM_014977		Approved	KIAA0670, fSAP152	uc001wit.4	Q9UKV3	OTTHUMG00000028716	ENST00000262710.1:c.3694A>G	14.37:g.23530298T>C	ENSP00000262710:p.Ser1232Gly	156.0	0.0		93.0	40.0	NM_014977	B2RTT4|D3DS45|O75158|Q9UG91|Q9UKV1|Q9UKV2	Missense_Mutation	SNP	ENST00000262710.1	37	CCDS9587.1	.	.	.	.	.	.	.	.	.	.	T	14.82	2.650550	0.47362	.	.	ENSG00000100813	ENST00000557515;ENST00000338631;ENST00000357481;ENST00000262710;ENST00000457657;ENST00000397341;ENST00000555053	T;T;T;T;T;T;T	0.22336	1.96;1.96;1.96;1.96;1.96;1.96;1.96	5.03	3.81	0.43845	.	0.000000	0.47455	D	0.000240	T	0.10723	0.0262	N	0.14661	0.345	0.29355	N	0.865089	P;B;B;B;B	0.36249	0.545;0.41;0.41;0.065;0.065	B;B;B;B;B	0.35770	0.21;0.104;0.104;0.031;0.031	T	0.05500	-1.0881	10	0.46703	T	0.11	-8.5987	5.4923	0.16783	0.1548:0.0852:0.0:0.76	.	1219;1232;1192;505;474	G3V3M7;Q9UKV3;E7EQT4;Q9UKV3-2;Q9UKV3-3	.;ACINU_HUMAN;.;.;.	G	473;505;474;1232;1192;474;1219	ENSP00000451138:S473G;ENSP00000345541:S505G;ENSP00000350073:S474G;ENSP00000262710:S1232G;ENSP00000405677:S1192G;ENSP00000380502:S474G;ENSP00000451328:S1219G	ENSP00000262710:S1232G	S	-	1	0	ACIN1	22600138	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	3.357000	0.52277	2.237000	0.73441	0.460000	0.39030	AGC	.		0.582	ACIN1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000071707.3	NM_014977	
ADORA2A	135	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	24837383	24837383	+	Missense_Mutation	SNP	G	G	A	rs201827862		TCGA-G3-A5SL-01A-11D-A27I-10	TCGA-G3-A5SL-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70422e6d-cb1f-4284-8be9-1d4517ffad60	a38d4467-c3e5-4639-ad4f-88bcd7ab9f26	g.chr22:24837383G>A	ENST00000337539.7	+	3	1624	c.1165G>A	c.(1165-1167)Gag>Aag	p.E389K	ADORA2A-AS1_ENST00000543438.1_RNA|ADORA2A-AS1_ENST00000427813.2_RNA|ADORA2A-AS1_ENST00000326341.4_RNA|SPECC1L-ADORA2A_ENST00000358654.2_3'UTR	NM_000675.4|NM_001278497.1|NM_001278498.1|NM_001278499.1|NM_001278500.1	NP_000666.2|NP_001265426.1|NP_001265427.1|NP_001265428.1|NP_001265429.1	P29274	AA2AR_HUMAN	adenosine A2a receptor	389					activation of adenylate cyclase activity (GO:0007190)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|apoptotic process (GO:0006915)|blood circulation (GO:0008015)|blood coagulation (GO:0007596)|cAMP biosynthetic process (GO:0006171)|cell-cell signaling (GO:0007267)|cellular defense response (GO:0006968)|central nervous system development (GO:0007417)|inflammatory response (GO:0006954)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phagocytosis (GO:0006909)|positive regulation of adenylate cyclase activity involved in G-protein coupled receptor signaling pathway (GO:0010579)|sensory perception (GO:0007600)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	enzyme binding (GO:0019899)|G-protein coupled adenosine receptor activity (GO:0001609)|identical protein binding (GO:0042802)			breast(1)|endometrium(2)|kidney(2)|large_intestine(7)|liver(1)|lung(7)|skin(1)	21	Colorectal(2;0.196)				Adenosine(DB00640)|Caffeine(DB00201)|Defibrotide(DB04932)|Dyphylline(DB00651)|Enprofylline(DB00824)|Mefloquine(DB00358)|Oxtriphylline(DB01303)|Pentoxifylline(DB00806)|Regadenoson(DB06213)|Theobromine(DB01412)|Theophylline(DB00277)	CCTTAGCCATGAGCTCAAGGG	0.632																																					p.E389K		.											.	ADORA2A	90	0			c.G1165A						.						28.0	27.0	27.0					22																	24837383		2203	4300	6503	SO:0001583	missense	135	exon3			AGCCATGAGCTCA	X68486	CCDS13826.1	22q11.23	2012-08-08			ENSG00000128271	ENSG00000128271		"""GPCR / Class A : Adenosine receptors"""	263	protein-coding gene	gene with protein product		102776		ADORA2		1662665, 2541503	Standard	NM_001278497		Approved	RDC8	uc002zzy.4	P29274	OTTHUMG00000150761	ENST00000337539.7:c.1165G>A	22.37:g.24837383G>A	ENSP00000336630:p.Glu389Lys	234.0	0.0		160.0	59.0	NM_000675	B2R7E0	Missense_Mutation	SNP	ENST00000337539.7	37	CCDS13826.1	.	.	.	.	.	.	.	.	.	.	G	25.9	4.686871	0.88639	.	.	ENSG00000128271	ENST00000541988;ENST00000337539;ENST00000417596	T	0.64438	-0.1	4.41	4.41	0.53225	.	0.468674	0.18687	N	0.133987	T	0.54208	0.1844	L	0.56769	1.78	0.23221	N	0.998092	B	0.27498	0.18	B	0.25884	0.064	T	0.45396	-0.9264	10	0.06757	T	0.87	-13.0096	14.5397	0.67984	0.0:0.0:1.0:0.0	.	389	P29274	AA2AR_HUMAN	K	389	ENSP00000336630:E389K	ENSP00000336630:E389K	E	+	1	0	ADORA2A	23167383	1.000000	0.71417	0.055000	0.19348	0.919000	0.55068	4.367000	0.59498	2.206000	0.71126	0.462000	0.41574	GAG	.		0.632	ADORA2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319971.2	NM_000675	
ADSS	159	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	244582115	244582115	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A5SL-01A-11D-A27I-10	TCGA-G3-A5SL-10A-01D-A27I-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70422e6d-cb1f-4284-8be9-1d4517ffad60	a38d4467-c3e5-4639-ad4f-88bcd7ab9f26	g.chr1:244582115T>C	ENST00000366535.3	-	9	1208	c.892A>G	c.(892-894)Aaa>Gaa	p.K298E	ADSS_ENST00000462358.1_5'Flank	NM_001126.3	NP_001117.2			adenylosuccinate synthase											endometrium(2)|kidney(1)|large_intestine(3)|lung(1)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	12	all_cancers(71;2.17e-05)|all_epithelial(71;0.00015)|all_neural(11;0.0269)|Breast(184;0.0654)|Glioma(6;0.0724)|Ovarian(71;0.0761)|all_lung(81;0.0874)|Lung NSC(105;0.121)	all_cancers(173;0.0896)|all_epithelial(177;0.172)	all cancers(7;9.71e-08)|GBM - Glioblastoma multiforme(7;1.28e-05)|OV - Ovarian serous cystadenocarcinoma(106;0.0014)			GTATAAGCTTTCACAACTCCA	0.363																																					p.K298E		.											.	ADSS	229	0			c.A892G						.						99.0	92.0	94.0					1																	244582115		2203	4300	6503	SO:0001583	missense	159	exon9			AAGCTTTCACAAC	BC012356	CCDS1624.1	1q44	2008-02-05			ENSG00000035687	ENSG00000035687	6.3.4.4		292	protein-coding gene	gene with protein product		103060				2004783, 1592113	Standard	NM_001126		Approved		uc001iaj.3	P30520	OTTHUMG00000040102	ENST00000366535.3:c.892A>G	1.37:g.244582115T>C	ENSP00000355493:p.Lys298Glu	238.0	1.0		329.0	35.0	NM_001126		Missense_Mutation	SNP	ENST00000366535.3	37	CCDS1624.1	.	.	.	.	.	.	.	.	.	.	T	34	5.331415	0.95733	.	.	ENSG00000035687	ENST00000366535;ENST00000449326	T	0.64803	-0.12	5.98	5.98	0.97165	.	0.000000	0.85682	D	0.000000	D	0.86863	0.6035	H	0.97611	4.04	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.91438	0.5171	10	0.87932	D	0	-25.1357	16.4696	0.84102	0.0:0.0:0.0:1.0	.	298	P30520	PURA2_HUMAN	E	298;277	ENSP00000355493:K298E	ENSP00000355493:K298E	K	-	1	0	ADSS	242648738	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	8.040000	0.89188	2.289000	0.77006	0.482000	0.46254	AAA	.		0.363	ADSS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096697.1	NM_001126	
AIPL1	23746	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	6328940	6328940	+	Missense_Mutation	SNP	G	G	C			TCGA-G3-A5SL-01A-11D-A27I-10	TCGA-G3-A5SL-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70422e6d-cb1f-4284-8be9-1d4517ffad60	a38d4467-c3e5-4639-ad4f-88bcd7ab9f26	g.chr17:6328940G>C	ENST00000381129.3	-	6	1075	c.995C>G	c.(994-996)aCg>aGg	p.T332R	AIPL1_ENST00000250087.5_Missense_Mutation_p.T269R|AIPL1_ENST00000576776.1_Missense_Mutation_p.T308R|AIPL1_ENST00000575265.1_3'UTR|AIPL1_ENST00000576307.1_Missense_Mutation_p.T272R|AIPL1_ENST00000570466.1_Missense_Mutation_p.T310R|AIPL1_ENST00000574506.1_Missense_Mutation_p.T320R	NM_001033055.1|NM_014336.3	NP_001028227.1|NP_055151.3	Q9NZN9	AIPL1_HUMAN	aryl hydrocarbon receptor interacting protein-like 1	332					negative regulation of apoptotic process (GO:0043066)|phototransduction, visible light (GO:0007603)|protein farnesylation (GO:0018343)|protein folding (GO:0006457)|regulation of cGMP metabolic process (GO:0030823)|retina homeostasis (GO:0001895)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|photoreceptor inner segment (GO:0001917)	farnesylated protein binding (GO:0001918)|unfolded protein binding (GO:0051082)			NS(1)|kidney(1)|large_intestine(2)|liver(1)|lung(5)|ovary(1)|skin(1)	12				COAD - Colon adenocarcinoma(228;0.141)		gggaggctGCGTGGCACCCTG	0.677																																					p.T332R		.											.	AIPL1	90	0			c.C995G						.						91.0	79.0	83.0					17																	6328940		2203	4300	6503	SO:0001583	missense	23746	exon6			GGCTGCGTGGCAC	AF148864	CCDS11075.1, CCDS32539.1, CCDS32540.1, CCDS67130.1, CCDS67131.1, CCDS67132.1, CCDS67133.1	17p13.1	2013-01-08	2001-11-29		ENSG00000129221	ENSG00000129221			359	protein-coding gene	gene with protein product		604392	"""aryl hydrocarbon receptor-interacting protein-like 1"""	LCA4		10615133, 14555765, 15365173	Standard	NM_001285402		Approved		uc002gcp.3	Q9NZN9	OTTHUMG00000102043	ENST00000381129.3:c.995C>G	17.37:g.6328940G>C	ENSP00000370521:p.Thr332Arg	26.0	0.0		26.0	11.0	NM_014336	D3DTM4|Q659W3|Q659W4|Q6ZZB6|Q8N6A0|Q9H873|Q9NS10	Missense_Mutation	SNP	ENST00000381129.3	37	CCDS11075.1	.	.	.	.	.	.	.	.	.	.	G	9.013	0.982945	0.18889	.	.	ENSG00000129221	ENST00000381129;ENST00000381128;ENST00000250087	D;D	0.88124	-2.34;-2.23	2.78	-1.75	0.08031	.	1.682670	0.06116	U	0.668047	T	0.69006	0.3063	N	0.08118	0	0.09310	N	1	B;B;P;P;B	0.35307	0.361;0.233;0.494;0.494;0.233	B;B;B;B;B	0.19666	0.008;0.008;0.026;0.018;0.008	T	0.56691	-0.7937	10	0.23302	T	0.38	.	9.6405	0.39835	0.0:0.6617:0.3383:0.0	.	308;310;269;272;332	Q659W3;Q659W4;Q9NZN9-3;Q9NZN9-2;Q9NZN9	.;.;.;.;AIPL1_HUMAN	R	332;272;269	ENSP00000370521:T332R;ENSP00000250087:T269R	ENSP00000250087:T269R	T	-	2	0	AIPL1	6269664	0.000000	0.05858	0.001000	0.08648	0.023000	0.10783	-1.401000	0.02502	-0.037000	0.13646	0.462000	0.41574	ACG	.		0.677	AIPL1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000219828.3	NM_014336	
AKAP3	10566	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	4737496	4737496	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A5SL-01A-11D-A27I-10	TCGA-G3-A5SL-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70422e6d-cb1f-4284-8be9-1d4517ffad60	a38d4467-c3e5-4639-ad4f-88bcd7ab9f26	g.chr12:4737496G>A	ENST00000545990.2	-	5	1096	c.572C>T	c.(571-573)gCc>gTc	p.A191V	RP11-500M8.7_ENST00000536588.1_Intron|AKAP3_ENST00000228850.1_Missense_Mutation_p.A191V	NM_001278309.1	NP_001265238.1	O75969	AKAP3_HUMAN	A kinase (PRKA) anchor protein 3	191					acrosome reaction (GO:0007340)|cellular component movement (GO:0006928)|protein localization (GO:0008104)|single fertilization (GO:0007338)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	acrosomal vesicle (GO:0001669)|nucleus (GO:0005634)|sperm fibrous sheath (GO:0035686)|sperm principal piece (GO:0097228)	protein kinase A binding (GO:0051018)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(13)|liver(1)|lung(17)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)	51						CTTGTCTGGGGCAGCATTCCT	0.493																																					p.A191V		.											.	AKAP3	292	0			c.C572T						.						111.0	106.0	107.0					12																	4737496		2203	4300	6503	SO:0001583	missense	10566	exon4			TCTGGGGCAGCAT	U85715	CCDS8531.1	12p13.3	2009-03-12				ENSG00000111254		"""A-kinase anchor proteins"""	373	protein-coding gene	gene with protein product	"""Fibrous Sheath Protein of 95 kDa"", ""cancer/testis antigen 82"""	604689				10334916, 10319321	Standard	NM_001278309		Approved	FSP95, SOB1, AKAP110, CT82	uc001qnb.4	O75969		ENST00000545990.2:c.572C>T	12.37:g.4737496G>A	ENSP00000440994:p.Ala191Val	102.0	0.0		94.0	37.0	NM_006422	O75945|Q86X01|Q9UM61	Missense_Mutation	SNP	ENST00000545990.2	37	CCDS8531.1	.	.	.	.	.	.	.	.	.	.	G	0.181	-1.061810	0.01950	.	.	ENSG00000111254	ENST00000228850;ENST00000545990	T;T	0.07800	3.16;3.16	4.87	-7.05	0.01573	A-kinase anchor 110kDa, C-terminal (1);	1.874110	0.02385	N	0.079148	T	0.05364	0.0142	N	0.22421	0.69	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.32719	-0.9896	10	0.48119	T	0.1	.	4.711	0.12872	0.3967:0.0:0.2755:0.3278	.	191	O75969	AKAP3_HUMAN	V	191	ENSP00000228850:A191V;ENSP00000440994:A191V	ENSP00000228850:A191V	A	-	2	0	AKAP3	4607757	0.000000	0.05858	0.000000	0.03702	0.035000	0.12851	-0.142000	0.10311	-1.754000	0.01321	-0.806000	0.03193	GCC	.		0.493	AKAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398911.2	NM_006422	
AKR7A2	8574	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	19634996	19634996	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A5SL-01A-11D-A27I-10	TCGA-G3-A5SL-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70422e6d-cb1f-4284-8be9-1d4517ffad60	a38d4467-c3e5-4639-ad4f-88bcd7ab9f26	g.chr1:19634996T>C	ENST00000235835.3	-	2	460	c.439A>G	c.(439-441)Acc>Gcc	p.T147A		NM_003689.3	NP_003680.2	O43488	ARK72_HUMAN	aldo-keto reductase family 7, member A2 (aflatoxin aldehyde reductase)	147					carbohydrate metabolic process (GO:0005975)|cellular aldehyde metabolic process (GO:0006081)|daunorubicin metabolic process (GO:0044597)|doxorubicin metabolic process (GO:0044598)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)	alditol:NADP+ 1-oxidoreductase activity (GO:0004032)|electron carrier activity (GO:0009055)|phenanthrene-9,10-epoxide hydrolase activity (GO:0019119)			central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(2)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	9		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000321)|Lung NSC(340;0.000398)|Breast(348;0.00049)|Ovarian(437;0.00764)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00461)|BRCA - Breast invasive adenocarcinoma(304;1.83e-05)|Kidney(64;0.000167)|GBM - Glioblastoma multiforme(114;0.00115)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)		TCCACCGGGGTGCCGTGGTCA	0.612																																					p.T147A		.											.	AKR7A2	90	0			c.A439G						.						60.0	61.0	61.0					1																	19634996		2203	4300	6503	SO:0001583	missense	8574	exon2			CCGGGGTGCCGTG	AF026947	CCDS194.1	1p36.13	2010-09-30			ENSG00000053371	ENSG00000053371		"""Aldo-keto reductases"""	389	protein-coding gene	gene with protein product		603418				9576847	Standard	NM_003689		Approved	AFAR	uc001bbw.3	O43488	OTTHUMG00000002522	ENST00000235835.3:c.439A>G	1.37:g.19634996T>C	ENSP00000235835:p.Thr147Ala	163.0	0.0		115.0	41.0	NM_003689	O75749|Q5TG63	Missense_Mutation	SNP	ENST00000235835.3	37	CCDS194.1	.	.	.	.	.	.	.	.	.	.	T	14.96	2.691947	0.48097	.	.	ENSG00000053371	ENST00000235835;ENST00000330072	T;T	0.04862	3.54;3.54	4.09	4.09	0.47781	NADP-dependent oxidoreductase domain (3);	0.048531	0.85682	D	0.000000	T	0.19406	0.0466	M	0.87971	2.92	0.38686	D	0.952661	B;B;B	0.32573	0.376;0.376;0.245	B;B;B	0.44315	0.353;0.446;0.353	T	0.03231	-1.1058	10	0.66056	D	0.02	.	12.3145	0.54948	0.0:0.0:0.0:1.0	.	118;118;147	C9JSL3;B4DZX4;O43488	.;.;ARK72_HUMAN	A	147;137	ENSP00000235835:T147A;ENSP00000339084:T137A	ENSP00000235835:T147A	T	-	1	0	AKR7A2	19507583	1.000000	0.71417	0.608000	0.28969	0.029000	0.11900	5.663000	0.68038	1.834000	0.53371	0.459000	0.35465	ACC	.		0.612	AKR7A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007165.2	NM_003689	
ANAPC7	51434	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	110819712	110819712	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A5SL-01A-11D-A27I-10	TCGA-G3-A5SL-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70422e6d-cb1f-4284-8be9-1d4517ffad60	a38d4467-c3e5-4639-ad4f-88bcd7ab9f26	g.chr12:110819712T>C	ENST00000455511.3	-	8	1079	c.1079A>G	c.(1078-1080)tAt>tGt	p.Y360C	ANAPC7_ENST00000450008.2_Missense_Mutation_p.Y360C|ANAPC7_ENST00000481473.1_5'Flank	NM_016238.2	NP_057322.2	Q9UJX3	APC7_HUMAN	anaphase promoting complex subunit 7	360					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	protein phosphatase binding (GO:0019903)			breast(3)|endometrium(3)|kidney(1)|large_intestine(5)|lung(6)|prostate(1)	19						GGCTCCTAAATAGAGGGCCCG	0.433																																					p.Y360C		.											.	ANAPC7	226	0			c.A1079G						.						58.0	48.0	52.0					12																	110819712		2203	4300	6503	SO:0001583	missense	51434	exon8			CCTAAATAGAGGG	AF191340	CCDS9145.2, CCDS44971.1	12q13.12	2013-01-10			ENSG00000196510	ENSG00000196510		"""Anaphase promoting complex subunits"", ""Tetratricopeptide (TTC) repeat domain containing"""	17380	protein-coding gene	gene with protein product		606949					Standard	NM_016238		Approved	APC7	uc001tqo.2	Q9UJX3	OTTHUMG00000157009	ENST00000455511.3:c.1079A>G	12.37:g.110819712T>C	ENSP00000394394:p.Tyr360Cys	64.0	0.0		47.0	18.0	NM_016238	Q96AC4|Q96GF4|Q9BU24|Q9NT16	Missense_Mutation	SNP	ENST00000455511.3	37	CCDS9145.2	.	.	.	.	.	.	.	.	.	.	T	22.5	4.298069	0.81025	.	.	ENSG00000196510	ENST00000455511;ENST00000450008;ENST00000471602;ENST00000548234	T;T	0.59364	0.27;0.27	6.17	6.17	0.99709	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.000000	0.85682	D	0.000000	T	0.69744	0.3145	M	0.62723	1.935	0.58432	D	0.999999	D;P	0.61697	0.99;0.86	P;P	0.56474	0.799;0.516	T	0.71144	-0.4678	10	0.54805	T	0.06	-23.3973	16.8222	0.85835	0.0:0.0:0.0:1.0	.	360;360	Q9UJX3-2;Q9UJX3	.;APC7_HUMAN	C	360;360;53;62	ENSP00000394394:Y360C;ENSP00000402314:Y360C	ENSP00000402314:Y360C	Y	-	2	0	ANAPC7	109304095	1.000000	0.71417	1.000000	0.80357	0.807000	0.45602	7.698000	0.84413	2.371000	0.80710	0.533000	0.62120	TAT	.		0.433	ANAPC7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000347075.3	NM_016238	
ANGPTL3	27329	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	63063267	63063267	+	Silent	SNP	T	T	A			TCGA-G3-A5SL-01A-11D-A27I-10	TCGA-G3-A5SL-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70422e6d-cb1f-4284-8be9-1d4517ffad60	a38d4467-c3e5-4639-ad4f-88bcd7ab9f26	g.chr1:63063267T>A	ENST00000371129.3	+	1	110	c.30T>A	c.(28-30)atT>atA	p.I10I	DOCK7_ENST00000251157.5_Intron|DOCK7_ENST00000404627.2_Intron|DOCK7_ENST00000340370.5_Intron	NM_014495.2	NP_055310.1	Q9Y5C1	ANGL3_HUMAN	angiopoietin-like 3	10					acylglycerol homeostasis (GO:0055090)|artery morphogenesis (GO:0048844)|cell-matrix adhesion (GO:0007160)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|fatty acid metabolic process (GO:0006631)|glycerol metabolic process (GO:0006071)|integrin-mediated signaling pathway (GO:0007229)|lipid homeostasis (GO:0055088)|lipid storage (GO:0019915)|negative regulation of lipoprotein lipase activity (GO:0051005)|negative regulation of phospholipase activity (GO:0010519)|phospholipid catabolic process (GO:0009395)|phospholipid homeostasis (GO:0055091)|phospholipid metabolic process (GO:0006644)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell migration (GO:0030335)|positive regulation of lipid catabolic process (GO:0050996)|response to hormone (GO:0009725)|signal transduction (GO:0007165)|triglyceride homeostasis (GO:0070328)	cell surface (GO:0009986)|extracellular space (GO:0005615)	enzyme inhibitor activity (GO:0004857)|growth factor activity (GO:0008083)|integrin binding (GO:0005178)|phospholipase inhibitor activity (GO:0004859)			breast(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(3)|urinary_tract(1)	13						TTCTTTTTATTGTTCCTCTAG	0.338																																					p.X10X		.											.	ANGPTL3	130	0			c.A30A						.						93.0	85.0	88.0					1																	63063267		2203	4299	6502	SO:0001819	synonymous_variant	27329	exon1			TTTTATTGTTCCT	AF152562	CCDS622.1	1p31.3	2013-02-06			ENSG00000132855	ENSG00000132855		"""Fibrinogen C domain containing"""	491	protein-coding gene	gene with protein product	"""angiopoietin 5"""	604774		ANGPT5		10644446	Standard	NM_014495		Approved		uc001das.2	Q9Y5C1	OTTHUMG00000009146	ENST00000371129.3:c.30T>A	1.37:g.63063267T>A		54.0	0.0		47.0	16.0	NM_014495	A0JLS0|B1ALJ0|B2RCW1	Silent	SNP	ENST00000371129.3	37	CCDS622.1																																																																																			.		0.338	ANGPTL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025344.1	NM_014495	
ANKRD50	57182	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	125591958	125591958	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A5SL-01A-11D-A27I-10	TCGA-G3-A5SL-10A-01D-A27I-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70422e6d-cb1f-4284-8be9-1d4517ffad60	a38d4467-c3e5-4639-ad4f-88bcd7ab9f26	g.chr4:125591958C>T	ENST00000504087.1	-	4	3511	c.2474G>A	c.(2473-2475)gGa>gAa	p.G825E	ANKRD50_ENST00000515641.1_Missense_Mutation_p.G646E	NM_020337.2	NP_065070.1	Q9ULJ7	ANR50_HUMAN	ankyrin repeat domain 50	825										NS(1)|breast(3)|central_nervous_system(1)|endometrium(7)|kidney(4)|large_intestine(14)|lung(18)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)	55						CTCAACATTTCCTTGTGCTGA	0.443																																					p.G825E		.											.	ANKRD50	90	0			c.G2474A						.						171.0	151.0	158.0					4																	125591958		2203	4300	6503	SO:0001583	missense	57182	exon4			ACATTTCCTTGTG	AB033049	CCDS34060.1, CCDS54802.1	4q28.1	2013-01-10			ENSG00000151458	ENSG00000151458		"""Ankyrin repeat domain containing"""	29223	protein-coding gene	gene with protein product							Standard	NM_020337		Approved	KIAA1223	uc010inw.3	Q9ULJ7	OTTHUMG00000161398	ENST00000504087.1:c.2474G>A	4.37:g.125591958C>T	ENSP00000425658:p.Gly825Glu	143.0	2.0		277.0	52.0	NM_020337	A8K4V3|B4DHJ6|E9PDW0|Q6N064|Q6ZSE6	Missense_Mutation	SNP	ENST00000504087.1	37	CCDS34060.1	.	.	.	.	.	.	.	.	.	.	C	20.5	3.996151	0.74703	.	.	ENSG00000151458	ENST00000504087;ENST00000515641	T;T	0.70399	-0.48;-0.48	5.1	5.1	0.69264	Ankyrin repeat-containing domain (3);	0.000000	0.85682	D	0.000000	D	0.87744	0.6254	M	0.91249	3.19	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	D	0.90257	0.4298	10	0.87932	D	0	.	18.7084	0.91646	0.0:1.0:0.0:0.0	.	825	Q9ULJ7	ANR50_HUMAN	E	825;646	ENSP00000425658:G825E;ENSP00000425355:G646E	ENSP00000425658:G825E	G	-	2	0	ANKRD50	125811408	1.000000	0.71417	0.973000	0.42090	0.989000	0.77384	7.164000	0.77533	2.664000	0.90586	0.561000	0.74099	GGA	.		0.443	ANKRD50-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364775.1	NM_020337	
APLP1	333	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	36363455	36363455	+	Silent	SNP	C	C	T			TCGA-G3-A5SL-01A-11D-A27I-10	TCGA-G3-A5SL-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70422e6d-cb1f-4284-8be9-1d4517ffad60	a38d4467-c3e5-4639-ad4f-88bcd7ab9f26	g.chr19:36363455C>T	ENST00000221891.4	+	7	1113	c.921C>T	c.(919-921)caC>caT	p.H307H	APLP1_ENST00000537454.2_Silent_p.H268H|APLP1_ENST00000586861.1_Silent_p.H301H	NM_001024807.1|NM_005166.3	NP_001019978.1|NP_005157.1	P51693	APLP1_HUMAN	amyloid beta (A4) precursor-like protein 1	307					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|apoptotic process (GO:0006915)|cell adhesion (GO:0007155)|cellular response to norepinephrine stimulus (GO:0071874)|endocytosis (GO:0006897)|extracellular matrix organization (GO:0030198)|forebrain development (GO:0030900)|mRNA polyadenylation (GO:0006378)|negative regulation of cAMP biosynthetic process (GO:0030818)|nervous system development (GO:0007399)|organ morphogenesis (GO:0009887)|regulation of translation (GO:0006417)	basement membrane (GO:0005604)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	alpha-2A adrenergic receptor binding (GO:0031694)|alpha-2B adrenergic receptor binding (GO:0031695)|alpha-2C adrenergic receptor binding (GO:0031696)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|transition metal ion binding (GO:0046914)			breast(4)|endometrium(2)|kidney(2)|large_intestine(12)|liver(1)|lung(9)|ovary(2)|upper_aerodigestive_tract(1)	33	all_lung(56;7.14e-07)|Lung NSC(56;1.12e-06)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			TCAGTGAGCACGAGGGGTTCC	0.572																																					p.H307H		.											.	APLP1	92	0			c.C921T						.						146.0	143.0	144.0					19																	36363455		2203	4300	6503	SO:0001819	synonymous_variant	333	exon7			TGAGCACGAGGGG	U48437	CCDS32997.1	19q	2008-07-15							597	protein-coding gene	gene with protein product	"""amyloid-like protein 1"", ""amyloid precursor-like protein 1"""	104775				8432545	Standard	NM_001024807		Approved	APLP	uc002ocf.3	P51693		ENST00000221891.4:c.921C>T	19.37:g.36363455C>T		160.0	0.0		126.0	50.0	NM_005166	O00113|Q96A92	Silent	SNP	ENST00000221891.4	37	CCDS32997.1																																																																																			.		0.572	APLP1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452564.1	NM_001024807	
ARID2	196528	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	12	46245723	46245723	+	Nonsense_Mutation	SNP	C	C	T			TCGA-G3-A5SL-01A-11D-A27I-10	TCGA-G3-A5SL-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70422e6d-cb1f-4284-8be9-1d4517ffad60	a38d4467-c3e5-4639-ad4f-88bcd7ab9f26	g.chr12:46245723C>T	ENST00000334344.6	+	15	3989	c.3817C>T	c.(3817-3819)Cga>Tga	p.R1273*	ARID2_ENST00000444670.1_Nonsense_Mutation_p.R883*|ARID2_ENST00000479608.1_3'UTR|ARID2_ENST00000422737.1_Nonsense_Mutation_p.R1124*|ARID2_ENST00000457135.1_5'Flank	NM_152641.2	NP_689854.2	Q68CP9	ARID2_HUMAN	AT rich interactive domain 2 (ARID, RFX-like)	1273					chromatin modification (GO:0016568)|nucleosome disassembly (GO:0006337)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(3)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(21)|liver(20)|lung(34)|ovary(7)|pancreas(1)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	116	Lung SC(27;0.192)|Renal(347;0.236)	Lung NSC(34;0.106)|all_lung(34;0.22)	OV - Ovarian serous cystadenocarcinoma(5;0.00691)	GBM - Glioblastoma multiforme(48;0.0153)		GTCCTGCCGACGAGGAGCCAC	0.428			"""N, S, F"""		hepatocellular carcinoma																																p.R1273X		.		Rec	yes		12	12q12	196528	AT rich interactive domain 2		E	.	ARID2	100	0			c.C3817T						.						51.0	51.0	51.0					12																	46245723		2203	4300	6503	SO:0001587	stop_gained	196528	exon15			TGCCGACGAGGAG		CCDS31783.1	12q13.11	2013-02-07			ENSG00000189079	ENSG00000189079		"""-"""	18037	protein-coding gene	gene with protein product		609539					Standard	NM_152641		Approved	KIAA1557, DKFZp686G052, FLJ30619, BAF200	uc001ros.1	Q68CP9	OTTHUMG00000150487	ENST00000334344.6:c.3817C>T	12.37:g.46245723C>T	ENSP00000335044:p.Arg1273*	64.0	0.0		67.0	17.0	NM_152641	Q15KG9|Q5EB51|Q645I3|Q6ZRY5|Q7Z3I5|Q86T28|Q96SJ6|Q9HCL5	Nonsense_Mutation	SNP	ENST00000334344.6	37	CCDS31783.1	.	.	.	.	.	.	.	.	.	.	C	43	9.856911	0.99281	.	.	ENSG00000189079	ENST00000334344;ENST00000549153;ENST00000338636;ENST00000422737;ENST00000444670	.	.	.	6.17	5.21	0.72293	.	0.237030	0.43110	D	0.000616	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-11.2899	16.5817	0.84717	0.1917:0.8083:0.0:0.0	.	.	.	.	X	1273;390;390;1124;883	.	ENSP00000335044:R1273X	R	+	1	2	ARID2	44531990	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	2.429000	0.44758	2.941000	0.99782	0.655000	0.94253	CGA	.		0.428	ARID2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318380.2	XM_350875	
ATL2	64225	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	38525447	38525447	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A5SL-01A-11D-A27I-10	TCGA-G3-A5SL-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70422e6d-cb1f-4284-8be9-1d4517ffad60	a38d4467-c3e5-4639-ad4f-88bcd7ab9f26	g.chr2:38525447G>T	ENST00000378954.4	-	12	1472	c.1471C>A	c.(1471-1473)Ctg>Atg	p.L491M	ATL2_ENST00000546051.1_Missense_Mutation_p.L320M|ATL2_ENST00000419554.2_Missense_Mutation_p.L491M|ATL2_ENST00000332337.4_Missense_Mutation_p.L473M|ATL2_ENST00000406122.1_Missense_Mutation_p.L320M|ATL2_ENST00000539122.1_Missense_Mutation_p.L320M|ATL2_ENST00000452935.2_Missense_Mutation_p.L473M|ATL2_ENST00000402054.1_Missense_Mutation_p.L320M	NM_001135673.1|NM_022374.2	NP_001129145.1|NP_071769.2	Q8NHH9	ATLA2_HUMAN	atlastin GTPase 2	491					endoplasmic reticulum organization (GO:0007029)|Golgi organization (GO:0007030)|GTP catabolic process (GO:0006184)|protein homooligomerization (GO:0051260)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)			breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(7)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	22						AAGCCAGTCAGTCCTGAGATT	0.393																																					p.L491M		.											.	ATL2	228	0			c.C1471A						.						134.0	117.0	123.0					2																	38525447		2203	4300	6503	SO:0001583	missense	64225	exon12			CAGTCAGTCCTGA		CCDS1795.1, CCDS46260.1	2p22.3	2008-09-17	2008-09-17	2008-09-17	ENSG00000119787	ENSG00000119787			24047	protein-coding gene	gene with protein product		609368	"""ADP-ribosylation factor-like 6 interacting protein 2"""	ARL6IP2		10508919, 18270207	Standard	NM_022374		Approved		uc002rqq.3	Q8NHH9	OTTHUMG00000102074	ENST00000378954.4:c.1471C>A	2.37:g.38525447G>T	ENSP00000368237:p.Leu491Met	73.0	0.0		59.0	5.0	NM_001135673	B7Z1X2|B7Z7X8|Q4ZG30|Q7Z630|Q8NHH8|Q9H5M7	Missense_Mutation	SNP	ENST00000378954.4	37	CCDS46260.1	.	.	.	.	.	.	.	.	.	.	G	18.03	3.531447	0.64972	.	.	ENSG00000119787	ENST00000378954;ENST00000406122;ENST00000402054;ENST00000539122;ENST00000332337;ENST00000419554;ENST00000452935;ENST00000546051	D;D;D;D;D;D;D;D	0.91631	-2.88;-2.88;-2.88;-2.88;-2.88;-2.88;-2.88;-2.88	5.81	5.81	0.92471	.	0.198315	0.44285	D	0.000472	D	0.94079	0.8102	M	0.80183	2.485	0.54753	D	0.999982	P;B;P;P;B	0.51351	0.944;0.417;0.553;0.553;0.417	P;B;B;B;B	0.48063	0.565;0.146;0.281;0.281;0.146	D	0.94198	0.7447	10	0.56958	D	0.05	-9.7897	19.0794	0.93175	0.0:0.0:1.0:0.0	.	320;473;473;491;491	B5MCN0;B7Z7X8;Q8NHH9-4;Q8NHH9-2;Q8NHH9	.;.;.;.;ATLA2_HUMAN	M	491;320;320;320;473;491;473;320	ENSP00000368237:L491M;ENSP00000385446:L320M;ENSP00000384062:L320M;ENSP00000446192:L320M;ENSP00000333393:L473M;ENSP00000415336:L491M;ENSP00000390743:L473M;ENSP00000438938:L320M	ENSP00000333393:L473M	L	-	1	2	ATL2	38378951	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.805000	0.62561	2.746000	0.94184	0.591000	0.81541	CTG	.		0.393	ATL2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219886.2	NM_022374	
BAI1	575	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	8	143623422	143623422	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A5SL-01A-11D-A27I-10	TCGA-G3-A5SL-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70422e6d-cb1f-4284-8be9-1d4517ffad60	a38d4467-c3e5-4639-ad4f-88bcd7ab9f26	g.chr8:143623422T>C	ENST00000517894.1	+	28	4721	c.3827T>C	c.(3826-3828)tTc>tCc	p.F1276S	BAI1_ENST00000323289.5_Missense_Mutation_p.F1276S			O14514	BAI1_HUMAN	brain-specific angiogenesis inhibitor 1	1276					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell proliferation (GO:0008285)|neuropeptide signaling pathway (GO:0007218)|peripheral nervous system development (GO:0007422)|signal transduction (GO:0007165)	cell-cell junction (GO:0005911)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(2)|lung(28)|ovary(4)|pancreas(1)|prostate(7)	57	all_cancers(97;2.84e-12)|all_epithelial(106;5.91e-09)|Lung NSC(106;0.000322)|all_lung(105;0.000616)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0315)|Acute lymphoblastic leukemia(118;0.155)					CCCACCAATTTCAACAGCCTG	0.677																																					p.F1276S		.											.	BAI1	1129	0			c.T3827C						.						19.0	24.0	23.0					8																	143623422		2102	4205	6307	SO:0001583	missense	575	exon27			CCAATTTCAACAG	AB005297	CCDS64985.1	8q24.3	2014-08-08			ENSG00000181790	ENSG00000181790		"""-"", ""GPCR / Class B : Orphans"""	943	protein-coding gene	gene with protein product		602682				9533023	Standard	NM_001702		Approved		uc003ywm.3	O14514	OTTHUMG00000164732	ENST00000517894.1:c.3827T>C	8.37:g.143623422T>C	ENSP00000430945:p.Phe1276Ser	85.0	0.0		138.0	13.0	NM_001702		Missense_Mutation	SNP	ENST00000517894.1	37		.	.	.	.	.	.	.	.	.	.	t	22.2	4.257991	0.80246	.	.	ENSG00000181790	ENST00000517894;ENST00000323289	T;T	0.44482	0.92;0.92	4.26	4.26	0.50523	.	0.000000	0.85682	U	0.000000	T	0.60418	0.2267	M	0.65975	2.015	0.42471	D	0.992823	D	0.76494	0.999	D	0.80764	0.994	T	0.63453	-0.6634	10	0.52906	T	0.07	.	12.565	0.56304	0.0:0.0:0.0:1.0	.	1276	E9PBK0	.	S	1276	ENSP00000430945:F1276S;ENSP00000313046:F1276S	ENSP00000313046:F1276S	F	+	2	0	BAI1	143620424	1.000000	0.71417	0.998000	0.56505	0.987000	0.75469	3.840000	0.55843	1.555000	0.49500	0.478000	0.44815	TTC	.		0.677	BAI1-001	KNOWN	non_canonical_conserved|not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000379963.3	NM_001702	
BASP1	10409	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	5	17275846	17275846	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A5SL-01A-11D-A27I-10	TCGA-G3-A5SL-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70422e6d-cb1f-4284-8be9-1d4517ffad60	a38d4467-c3e5-4639-ad4f-88bcd7ab9f26	g.chr5:17275846C>A	ENST00000322611.3	+	2	781	c.521C>A	c.(520-522)cCc>cAc	p.P174H		NM_001271606.1|NM_006317.3	NP_001258535.1|NP_006308.3	P80723	BASP1_HUMAN	brain abundant, membrane attached signal protein 1	174					diaphragm development (GO:0060539)|glomerular visceral epithelial cell differentiation (GO:0072112)|gonad development (GO:0008406)|mesenchymal to epithelial transition (GO:0060231)|metanephric mesenchyme development (GO:0072075)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of heart growth (GO:0060421)|positive regulation of metanephric ureteric bud development (GO:2001076)|substantia nigra development (GO:0021762)|thorax and anterior abdomen determination (GO:0007356)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	protein domain specific binding (GO:0019904)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)			endometrium(1)|lung(8)	9						GACTCAAAACCCGGCAGCTCG	0.662																																					p.P174H		.											.	BASP1	90	0			c.C521A						.						8.0	11.0	10.0					5																	17275846		2132	4200	6332	SO:0001583	missense	10409	exon2			CAAAACCCGGCAG	AF039656	CCDS3888.1	5p15.1	2010-12-03			ENSG00000176788	ENSG00000176788			957	protein-coding gene	gene with protein product		605940				9310187, 9749536	Standard	NM_001271606		Approved	NAP-22, NAP22, CAP23, CAP-23	uc031siz.1	P80723	OTTHUMG00000131061	ENST00000322611.3:c.521C>A	5.37:g.17275846C>A	ENSP00000319281:p.Pro174His	52.0	0.0		35.0	16.0	NM_006317	B4DJA8|D3DTD5|O43596|Q5U0S0|Q9BWA5	Missense_Mutation	SNP	ENST00000322611.3	37	CCDS3888.1	.	.	.	.	.	.	.	.	.	.	C	16.85	3.236152	0.58886	.	.	ENSG00000176788	ENST00000322611;ENST00000447228	T	0.67345	-0.26	4.51	4.51	0.55191	.	0.000000	0.51477	U	0.000098	T	0.78110	0.4232	L	0.54323	1.7	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	T	0.81072	-0.1098	10	0.87932	D	0	-7.1627	15.7977	0.78424	0.0:1.0:0.0:0.0	.	174	P80723	BASP1_HUMAN	H	174;120	ENSP00000319281:P174H	ENSP00000319281:P174H	P	+	2	0	BASP1	17328846	1.000000	0.71417	0.981000	0.43875	0.609000	0.37215	6.437000	0.73421	2.053000	0.61076	0.491000	0.48974	CCC	.		0.662	BASP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253716.2		
BAZ2B	29994	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	160287506	160287506	+	Missense_Mutation	SNP	C	C	G			TCGA-G3-A5SL-01A-11D-A27I-10	TCGA-G3-A5SL-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70422e6d-cb1f-4284-8be9-1d4517ffad60	a38d4467-c3e5-4639-ad4f-88bcd7ab9f26	g.chr2:160287506C>G	ENST00000392783.2	-	10	2557	c.2062G>C	c.(2062-2064)Ggt>Cgt	p.G688R	BAZ2B_ENST00000343439.5_Intron|BAZ2B_ENST00000392782.1_Missense_Mutation_p.G686R|BAZ2B_ENST00000355831.2_Missense_Mutation_p.G688R	NM_013450.2	NP_038478.2	Q9UIF8	BAZ2B_HUMAN	bromodomain adjacent to zinc finger domain, 2B	688					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(7)|liver(2)|lung(41)|ovary(3)|prostate(1)|skin(2)|soft_tissue(1)|urinary_tract(1)	82						GTTGAGTGACCTGTGAGACTC	0.448																																					p.G688R		.											.	BAZ2B	94	0			c.G2062C						.						230.0	221.0	224.0					2																	160287506		1919	4129	6048	SO:0001583	missense	29994	exon10			AGTGACCTGTGAG	AB032255	CCDS2209.2, CCDS74594.1	2q24.2	2013-01-28			ENSG00000123636	ENSG00000123636		"""Zinc fingers, PHD-type"""	963	protein-coding gene	gene with protein product		605683				10662543	Standard	XM_005246488		Approved	WALp4	uc002uao.3	Q9UIF8	OTTHUMG00000132027	ENST00000392783.2:c.2062G>C	2.37:g.160287506C>G	ENSP00000376534:p.Gly688Arg	122.0	0.0		135.0	8.0	NM_013450	D3DPA8|Q96EA1|Q96SQ8|Q9P252|Q9Y4N8	Missense_Mutation	SNP	ENST00000392783.2	37	CCDS2209.2	.	.	.	.	.	.	.	.	.	.	C	14.15	2.449032	0.43531	.	.	ENSG00000123636	ENST00000392782;ENST00000392783;ENST00000355831	T;T;T	0.25250	2.05;1.81;2.05	5.86	5.86	0.93980	.	0.209070	0.23281	U	0.049912	T	0.21590	0.0520	N	0.08118	0	0.80722	D	1	B;B;B	0.25441	0.058;0.126;0.093	B;B;B	0.34873	0.058;0.191;0.045	T	0.17198	-1.0377	10	0.59425	D	0.04	-4.9903	20.178	0.98191	0.0:1.0:0.0:0.0	.	492;686;688	Q9UIF8-4;Q9UIF8-5;Q9UIF8	.;.;BAZ2B_HUMAN	R	686;688;688	ENSP00000376533:G686R;ENSP00000376534:G688R;ENSP00000348087:G688R	ENSP00000348087:G688R	G	-	1	0	BAZ2B	159995752	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	6.279000	0.72620	2.770000	0.95276	0.643000	0.83706	GGT	.		0.448	BAZ2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255037.2		
BCL9	607	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	147086412	147086412	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A5SL-01A-11D-A27I-10	TCGA-G3-A5SL-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70422e6d-cb1f-4284-8be9-1d4517ffad60	a38d4467-c3e5-4639-ad4f-88bcd7ab9f26	g.chr1:147086412A>G	ENST00000234739.3	+	6	1297	c.557A>G	c.(556-558)aAt>aGt	p.N186S	BCL9_ENST00000473292.1_3'UTR	NM_004326.2	NP_004317.2	O00512	BCL9_HUMAN	B-cell CLL/lymphoma 9	186	Interacts with PYGO1.				canonical Wnt signaling pathway (GO:0060070)|myotube differentiation involved in skeletal muscle regeneration (GO:0014908)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|skeletal muscle cell differentiation (GO:0035914)|somatic stem cell maintenance (GO:0035019)	cis-Golgi network (GO:0005801)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)				breast(1)|large_intestine(2)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	7	all_hematologic(923;0.115)					GAGATGGCCAATAAGTAAGTT	0.473			T	"""IGH@, IGL@"""	B-ALL																																p.N186S		.		Dom	yes		1	1q21	607	B-cell CLL/lymphoma 9		L	.	BCL9	707	0			c.A557G						.						79.0	72.0	74.0					1																	147086412		2203	4300	6503	SO:0001583	missense	607	exon6			TGGCCAATAAGTA	Y13620	CCDS30833.1	1q21	2008-02-05			ENSG00000116128	ENSG00000116128			1008	protein-coding gene	gene with protein product		602597				9490669	Standard	NM_004326		Approved		uc001epq.3	O00512	OTTHUMG00000014031	ENST00000234739.3:c.557A>G	1.37:g.147086412A>G	ENSP00000234739:p.Asn186Ser	162.0	0.0		180.0	63.0	NM_004326	Q5T489	Missense_Mutation	SNP	ENST00000234739.3	37	CCDS30833.1	.	.	.	.	.	.	.	.	.	.	A	25.9	4.687915	0.88639	.	.	ENSG00000116128	ENST00000234739	T	0.67171	-0.25	5.55	5.55	0.83447	.	0.000000	0.85682	D	0.000000	T	0.74535	0.3729	L	0.57536	1.79	0.80722	D	1	D;D	0.63880	0.993;0.993	D;D	0.72625	0.978;0.978	T	0.77970	-0.2387	10	0.87932	D	0	-13.7433	15.8615	0.79026	1.0:0.0:0.0:0.0	.	186;186	Q1JQ81;O00512	.;BCL9_HUMAN	S	186	ENSP00000234739:N186S	ENSP00000234739:N186S	N	+	2	0	BCL9	145553036	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	8.735000	0.91549	2.333000	0.79357	0.533000	0.62120	AAT	.		0.473	BCL9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039468.1	NM_004326	
BPIFC	254240	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	22	32810334	32810335	+	Frame_Shift_Ins	INS	-	-	A			TCGA-G3-A5SL-01A-11D-A27I-10	TCGA-G3-A5SL-10A-01D-A27I-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70422e6d-cb1f-4284-8be9-1d4517ffad60	a38d4467-c3e5-4639-ad4f-88bcd7ab9f26	g.chr22:32810334_32810335insA	ENST00000397452.1	-	16	1589_1590	c.1479_1480insT	c.(1477-1482)ggtctgfs	p.L494fs	RTCB_ENST00000451746.2_5'Flank|BPIFC_ENST00000432451.2_Frame_Shift_Ins_p.L251fs|BPIFC_ENST00000534972.1_Frame_Shift_Ins_p.L218fs|BPIFC_ENST00000300399.3_Frame_Shift_Ins_p.L494fs|RTCB_ENST00000216038.5_5'Flank			Q8NFQ6	BPIFC_HUMAN	BPI fold containing family C	494						extracellular region (GO:0005576)	lipopolysaccharide binding (GO:0001530)|phospholipid binding (GO:0005543)										ATCAGGTTCAGACCTTCCCATA	0.475																																					p.L494fs		.											.	.	.	0			c.1480_1481insT						.																																			SO:0001589	frameshift_variant	254240	exon15			GGTTCAGACCTTC	AF465766	CCDS13906.1	22q12.3	2011-08-04	2011-08-01	2011-08-01	ENSG00000184459	ENSG00000184459		"""BPI fold containing"""	16503	protein-coding gene	gene with protein product		614109	"""bactericidal/permeability-increasing protein-like 2"""	BPIL2			Standard	NM_174932		Approved	dJ149A16.7	uc003amn.2	Q8NFQ6	OTTHUMG00000058273	ENST00000397452.1:c.1480dupT	22.37:g.32810335_32810335dupA	ENSP00000380594:p.Leu494fs	202.0	0.0		209.0	22.0	NM_174932	A2RRF1	Frame_Shift_Ins	INS	ENST00000397452.1	37	CCDS13906.1																																																																																			.		0.475	BPIFC-010	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000129029.2	NM_174932	
BTBD1	53339	hgsc.bcm.edu;broad.mit.edu;mdanderson.org	37	15	83698992	83698992	+	Nonsense_Mutation	SNP	G	G	T			TCGA-G3-A5SL-01A-11D-A27I-10	TCGA-G3-A5SL-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70422e6d-cb1f-4284-8be9-1d4517ffad60	a38d4467-c3e5-4639-ad4f-88bcd7ab9f26	g.chr15:83698992G>T	ENST00000261721.4	-	5	1153	c.951C>A	c.(949-951)taC>taA	p.Y317*	RP11-382A20.6_ENST00000568441.1_RNA|BTBD1_ENST00000379403.2_Nonsense_Mutation_p.Y317*|BTBD1_ENST00000560015.1_5'UTR|RP11-382A20.5_ENST00000566841.1_RNA|RP11-382A20.7_ENST00000570202.1_RNA	NM_001011885.1|NM_025238.3	NP_001011885.1|NP_079514.1	Q9H0C5	BTBD1_HUMAN	BTB (POZ) domain containing 1	317					protein ubiquitination (GO:0016567)|regulation of protein binding (GO:0043393)	cytoplasmic mRNA processing body (GO:0000932)|protein complex (GO:0043234)				central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(2)|ovary(1)|prostate(1)	10				all cancers(203;0.000186)		GTCGGTCAATGTATTCAACTC	0.453																																					p.Y317X		.											.	BTBD1	91	0			c.C951A						.						198.0	198.0	198.0					15																	83698992		2203	4300	6503	SO:0001587	stop_gained	53339	exon5			GTCAATGTATTCA	AF355402	CCDS10322.1, CCDS32313.1	15q24	2013-01-08			ENSG00000064726	ENSG00000064726		"""BTB/POZ domain containing"""	1120	protein-coding gene	gene with protein product		608530					Standard	XM_006720573		Approved		uc002bjn.3	Q9H0C5	OTTHUMG00000147364	ENST00000261721.4:c.951C>A	15.37:g.83698992G>T	ENSP00000261721:p.Tyr317*	140.0	0.0		132.0	10.0	NM_025238	A6NMI8|Q9BX71|Q9NWN4	Nonsense_Mutation	SNP	ENST00000261721.4	37	CCDS10322.1	.	.	.	.	.	.	.	.	.	.	G	28.5	4.926990	0.92319	.	.	ENSG00000064726	ENST00000261721;ENST00000379403	.	.	.	5.15	3.28	0.37604	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.28530	T	0.3	-17.0624	7.0222	0.24920	0.3853:0.0:0.6147:0.0	.	.	.	.	X	317	.	ENSP00000261721:Y317X	Y	-	3	2	BTBD1	81489996	1.000000	0.71417	0.998000	0.56505	0.990000	0.78478	1.730000	0.38125	0.691000	0.31592	0.561000	0.74099	TAC	.		0.453	BTBD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000304008.1		
C16orf46	123775	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	81097428	81097428	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A5SL-01A-11D-A27I-10	TCGA-G3-A5SL-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70422e6d-cb1f-4284-8be9-1d4517ffad60	a38d4467-c3e5-4639-ad4f-88bcd7ab9f26	g.chr16:81097428G>A	ENST00000299578.5	-	3	368	c.133C>T	c.(133-135)Ctc>Ttc	p.L45F	C16orf46_ENST00000444657.3_Intron|RP11-303E16.8_ENST00000564536.1_RNA|C16orf46_ENST00000378611.4_Missense_Mutation_p.L45F	NM_152337.2	NP_689550.2	Q6P387	CP046_HUMAN	chromosome 16 open reading frame 46	45						cytoplasm (GO:0005737)|nucleus (GO:0005634)				NS(1)|endometrium(2)|large_intestine(3)|lung(9)|prostate(1)|stomach(1)|urinary_tract(1)	18						CTGACATCGAGAAGACAATAA	0.358																																					p.L45F		.											.	C16orf46	90	0			c.C133T						.						202.0	185.0	191.0					16																	81097428		2202	4300	6502	SO:0001583	missense	123775	exon2			CATCGAGAAGACA	BC064143	CCDS10932.1, CCDS42201.1	16q23.2	2012-10-09			ENSG00000166455	ENSG00000166455			26525	protein-coding gene	gene with protein product							Standard	NM_152337		Approved	FLJ32702	uc002fgc.4	Q6P387	OTTHUMG00000137629	ENST00000299578.5:c.133C>T	16.37:g.81097428G>A	ENSP00000299578:p.Leu45Phe	94.0	0.0		68.0	29.0	NM_001100873	Q96MA7	Missense_Mutation	SNP	ENST00000299578.5	37	CCDS10932.1	.	.	.	.	.	.	.	.	.	.	G	14.32	2.499950	0.44455	.	.	ENSG00000166455	ENST00000378611;ENST00000299578	T;T	0.31247	1.5;1.5	5.65	5.65	0.86999	.	0.000000	0.56097	D	0.000031	T	0.43853	0.1266	L	0.36672	1.1	0.37331	D	0.909981	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.46176	-0.9210	10	0.66056	D	0.02	.	11.0249	0.47739	0.0853:0.0:0.9147:0.0	.	45;45	Q6P387-2;Q6P387	.;CP046_HUMAN	F	45	ENSP00000367874:L45F;ENSP00000299578:L45F	ENSP00000299578:L45F	L	-	1	0	C16orf46	79654929	0.998000	0.40836	0.938000	0.37757	0.061000	0.15899	2.015000	0.40961	2.822000	0.97130	0.563000	0.77884	CTC	.		0.358	C16orf46-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000269054.2	NM_152337	
C7orf26	79034	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	7	6631388	6631388	+	Nonsense_Mutation	SNP	C	C	T			TCGA-G3-A5SL-01A-11D-A27I-10	TCGA-G3-A5SL-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70422e6d-cb1f-4284-8be9-1d4517ffad60	a38d4467-c3e5-4639-ad4f-88bcd7ab9f26	g.chr7:6631388C>T	ENST00000344417.5	+	2	571	c.304C>T	c.(304-306)Caa>Taa	p.Q102*	C7orf26_ENST00000359073.5_Nonsense_Mutation_p.Q83*|C7orf26_ENST00000472693.1_3'UTR|AC079742.4_ENST00000434951.1_RNA	NM_024067.2	NP_076972.2	Q96N11	CG026_HUMAN	chromosome 7 open reading frame 26	102										endometrium(2)|large_intestine(2)|lung(5)|ovary(1)|skin(1)	11		Ovarian(82;0.232)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0986)		TTTCAGCCCTCAAGGGAACAA	0.498																																					p.Q102X		.											.	C7orf26	91	0			c.C304T						.						145.0	149.0	148.0					7																	6631388		2203	4300	6503	SO:0001587	stop_gained	79034	exon2			AGCCCTCAAGGGA	BC005121	CCDS5353.1	7p22.1	2011-11-24			ENSG00000146576	ENSG00000146576			21702	protein-coding gene	gene with protein product							Standard	NM_024067		Approved	MGC2718	uc003sqo.1	Q96N11	OTTHUMG00000125517	ENST00000344417.5:c.304C>T	7.37:g.6631388C>T	ENSP00000340220:p.Gln102*	202.0	0.0		163.0	20.0	NM_024067	Q9BQ43	Nonsense_Mutation	SNP	ENST00000344417.5	37	CCDS5353.1	.	.	.	.	.	.	.	.	.	.	c	42	9.527965	0.99196	.	.	ENSG00000146576	ENST00000344417;ENST00000359073	.	.	.	5.24	5.24	0.73138	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.29301	T	0.29	-12.79	16.766	0.85524	0.0:1.0:0.0:0.0	.	.	.	.	X	102;83	.	ENSP00000340220:Q102X	Q	+	1	0	C7orf26	6597913	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.760000	0.85248	2.627000	0.88993	0.632000	0.83419	CAA	.		0.498	C7orf26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000246844.2	NM_024067	
CARD10	29775	hgsc.bcm.edu;broad.mit.edu	37	22	37888678	37888678	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A5SL-01A-11D-A27I-10	TCGA-G3-A5SL-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70422e6d-cb1f-4284-8be9-1d4517ffad60	a38d4467-c3e5-4639-ad4f-88bcd7ab9f26	g.chr22:37888678G>A	ENST00000403299.1	-	18	2824	c.2608C>T	c.(2608-2610)Cgg>Tgg	p.R870W	CARD10_ENST00000406271.3_Missense_Mutation_p.R584W|CARD10_ENST00000251973.5_Missense_Mutation_p.R870W			Q9BWT7	CAR10_HUMAN	caspase recruitment domain family, member 10	870					activation of NF-kappaB-inducing kinase activity (GO:0007250)|protein complex assembly (GO:0006461)|regulation of apoptotic process (GO:0042981)	CBM complex (GO:0032449)|cytoplasm (GO:0005737)	receptor signaling complex scaffold activity (GO:0030159)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	17	Melanoma(58;0.0574)					AAGTCCAGCCGGGAGCTGGGC	0.687																																					p.R870W		.											.	CARD10	662	0			c.C2608T						.						25.0	25.0	25.0					22																	37888678		2201	4296	6497	SO:0001583	missense	29775	exon17			CCAGCCGGGAGCT	AF086324	CCDS13948.1	22q13.1	2008-05-22			ENSG00000100065	ENSG00000100065			16422	protein-coding gene	gene with protein product		607209				11259443, 11356195	Standard	NM_014550		Approved	CARMA3, BIMP1	uc003asu.1	Q9BWT7	OTTHUMG00000150592	ENST00000403299.1:c.2608C>T	22.37:g.37888678G>A	ENSP00000384570:p.Arg870Trp	154.0	0.0		119.0	5.0	NM_014550	Q14CQ8|Q5TFG6|Q8NC81|Q9UGR5|Q9UGR6|Q9Y3H0	Missense_Mutation	SNP	ENST00000403299.1	37	CCDS13948.1	.	.	.	.	.	.	.	.	.	.	G	18.79	3.698057	0.68386	.	.	ENSG00000100065	ENST00000403299;ENST00000406271;ENST00000251973	T;T;T	0.41400	1.0;2.69;1.0	4.81	2.67	0.31697	.	0.072818	0.56097	D	0.000024	T	0.49304	0.1549	L	0.41236	1.265	0.33332	D	0.56865	D;P	0.71674	0.998;0.669	P;B	0.58970	0.849;0.049	T	0.62426	-0.6857	10	0.62326	D	0.03	-24.5752	13.536	0.61646	0.0:0.0:0.7112:0.2888	.	870;584	Q9BWT7;Q8NC81	CAR10_HUMAN;.	W	870;584;870	ENSP00000384570:R870W;ENSP00000385799:R584W;ENSP00000251973:R870W	ENSP00000251973:R870W	R	-	1	2	CARD10	36218624	1.000000	0.71417	0.998000	0.56505	0.919000	0.55068	2.526000	0.45607	0.222000	0.20900	-0.808000	0.03180	CGG	.		0.687	CARD10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318997.1	NM_014550	
CCDC129	223075	broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	31683405	31683405	+	Silent	SNP	C	C	A			TCGA-G3-A5SL-01A-11D-A27I-10	TCGA-G3-A5SL-10A-01D-A27I-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70422e6d-cb1f-4284-8be9-1d4517ffad60	a38d4467-c3e5-4639-ad4f-88bcd7ab9f26	g.chr7:31683405C>A	ENST00000407970.3	+	11	2459	c.2421C>A	c.(2419-2421)atC>atA	p.I807I	CCDC129_ENST00000319386.3_Silent_p.I659I|CCDC129_ENST00000451887.2_Silent_p.I833I|CCDC129_ENST00000409210.1_Silent_p.I715I	NM_001257967.1|NM_194300.3	NP_001244896.1|NP_919276.2	Q6ZRS4	CC129_HUMAN	coiled-coil domain containing 129	807	Cys-rich.									cervix(1)|endometrium(3)|kidney(3)|large_intestine(6)|lung(31)	44						ACTGCTGCATCTGCTGTCATC	0.587																																					p.I833I		.											.	.	.	0			c.C2499A						.						91.0	80.0	84.0					7																	31683405		2203	4300	6503	SO:0001819	synonymous_variant	223075	exon11			CTGCATCTGCTGT	AK128026	CCDS5435.2, CCDS59050.1, CCDS75577.1	7p14.3	2006-08-21			ENSG00000180347	ENSG00000180347			27363	protein-coding gene	gene with protein product						14702039	Standard	NM_001257967		Approved	FLJ38344	uc011kad.1	Q6ZRS4	OTTHUMG00000128611	ENST00000407970.3:c.2421C>A	7.37:g.31683405C>A		106.0	1.0		190.0	96.0	NM_001257968	A2RU17|B3KTI9|B4DHB0|B4E2R1|F5H3V5	Silent	SNP	ENST00000407970.3	37	CCDS5435.2																																																																																			.		0.587	CCDC129-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318975.1	NM_194300	
CEP104	9731	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	3750533	3750533	+	Missense_Mutation	SNP	T	T	A			TCGA-G3-A5SL-01A-11D-A27I-10	TCGA-G3-A5SL-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70422e6d-cb1f-4284-8be9-1d4517ffad60	a38d4467-c3e5-4639-ad4f-88bcd7ab9f26	g.chr1:3750533T>A	ENST00000378230.3	-	12	1876	c.1552A>T	c.(1552-1554)Agt>Tgt	p.S518C	CEP104_ENST00000460038.1_5'UTR	NM_014704.3	NP_055519.1	O60308	CE104_HUMAN	centrosomal protein 104kDa	518						centriole (GO:0005814)	glutamate binding (GO:0016595)|glycine binding (GO:0016594)|thienylcyclohexylpiperidine binding (GO:0016596)			breast(2)|cervix(1)|endometrium(9)|kidney(1)|large_intestine(14)|lung(8)|prostate(1)|skin(3)	39						TCAAGTTTACTCAGTTTATGT	0.408																																					p.S518C		.											.	CEP104	92	0			c.A1552T						.						125.0	116.0	119.0					1																	3750533		2203	4300	6503	SO:0001583	missense	9731	exon12			GTTTACTCAGTTT	AB011134	CCDS30571.1	1p36.32	2014-02-20	2011-05-06	2011-05-06	ENSG00000116198	ENSG00000116198			24866	protein-coding gene	gene with protein product	"""glycine, glutamate, thienylcyclohexylpiperidine binding protein"""		"""KIAA0562"""	KIAA0562		7488117, 21399614	Standard	NM_014704		Approved	GlyBP, RP1-286D6.4	uc001aky.2	O60308	OTTHUMG00000003507	ENST00000378230.3:c.1552A>T	1.37:g.3750533T>A	ENSP00000367476:p.Ser518Cys	148.0	0.0		93.0	30.0	NM_014704	Q5JSQ3|Q5SR24|Q5SR25|Q6PKF5|Q86W32|Q86X14	Missense_Mutation	SNP	ENST00000378230.3	37	CCDS30571.1	.	.	.	.	.	.	.	.	.	.	T	11.57	1.677602	0.29783	.	.	ENSG00000116198	ENST00000378230	T	0.35048	1.33	5.03	-3.6	0.04570	Armadillo-like helical (1);Armadillo-type fold (1);	0.242072	0.41605	D	0.000856	T	0.44540	0.1298	L	0.50333	1.59	0.26083	N	0.98106	D;P	0.61697	0.99;0.793	P;B	0.58970	0.849;0.386	T	0.51957	-0.8639	10	0.59425	D	0.04	.	15.3311	0.74212	0.0:0.8128:0.0:0.1872	.	518;518	O60308-3;O60308	.;CE104_HUMAN	C	518	ENSP00000367476:S518C	ENSP00000367476:S518C	S	-	1	0	CEP104	3740393	0.660000	0.27420	0.040000	0.18447	0.046000	0.14306	0.560000	0.23500	-0.605000	0.05753	0.383000	0.25322	AGT	.		0.408	CEP104-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000009747.3	NM_014704	
CD1C	911	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	158262506	158262506	+	Missense_Mutation	SNP	A	A	T			TCGA-G3-A5SL-01A-11D-A27I-10	TCGA-G3-A5SL-10A-01D-A27I-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70422e6d-cb1f-4284-8be9-1d4517ffad60	a38d4467-c3e5-4639-ad4f-88bcd7ab9f26	g.chr1:158262506A>T	ENST00000368170.3	+	4	1010	c.731A>T	c.(730-732)cAg>cTg	p.Q244L		NM_001765.2	NP_001756.2	P29017	CD1C_HUMAN	CD1c molecule	244	Ig-like.				antigen processing and presentation (GO:0019882)|T cell activation involved in immune response (GO:0002286)	endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	endogenous lipid antigen binding (GO:0030883)|exogenous lipid antigen binding (GO:0030884)|glycolipid binding (GO:0051861)|lipopeptide binding (GO:0071723)			NS(1)|endometrium(3)|large_intestine(4)|lung(21)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|urinary_tract(1)	39	all_hematologic(112;0.0378)					CGGAATGAACAGGAGCAACTG	0.547																																					p.Q244L		.											.	CD1C	94	0			c.A731T						.						135.0	132.0	133.0					1																	158262506		2203	4300	6503	SO:0001583	missense	911	exon4			ATGAACAGGAGCA	M28827	CCDS1175.1	1q23.1	2014-01-14	2006-03-28		ENSG00000158481	ENSG00000158481		"""CD molecules"", ""Immunoglobulin superfamily / C1-set domain containing"""	1636	protein-coding gene	gene with protein product		188340	"""CD1C antigen, c polypeptide"", ""CD1c antigen"""	CD1		2447586	Standard	NM_001765		Approved		uc001fru.3	P29017	OTTHUMG00000017514	ENST00000368170.3:c.731A>T	1.37:g.158262506A>T	ENSP00000357152:p.Gln244Leu	103.0	1.0		245.0	24.0	NM_001765	Q5TDJ7|Q6IAS4|Q9UMM0|Q9UN96	Missense_Mutation	SNP	ENST00000368170.3	37	CCDS1175.1	.	.	.	.	.	.	.	.	.	.	-	15.38	2.816685	0.50633	.	.	ENSG00000158481	ENST00000368169;ENST00000368170;ENST00000454192	T	0.03301	3.98	3.68	3.68	0.42216	Immunoglobulin-like (1);MHC class I-like antigen recognition (1);Immunoglobulin C1-set (2);	0.216185	0.23680	N	0.045623	T	0.09555	0.0235	M	0.87097	2.86	0.09310	N	1	D;D	0.67145	0.99;0.996	D;D	0.68483	0.958;0.925	T	0.04593	-1.0940	10	0.87932	D	0	.	8.9662	0.35879	1.0:0.0:0.0:0.0	.	244;244	E9PGC9;P29017	.;CD1C_HUMAN	L	244;244;47	ENSP00000357152:Q244L	ENSP00000357151:Q244L	Q	+	2	0	CD1C	156529130	0.362000	0.24980	0.260000	0.24451	0.010000	0.07245	0.985000	0.29578	1.681000	0.50988	0.454000	0.30748	CAG	.		0.547	CD1C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046351.2	NM_001765	
CHL1	10752	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	439928	439928	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A5SL-01A-11D-A27I-10	TCGA-G3-A5SL-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70422e6d-cb1f-4284-8be9-1d4517ffad60	a38d4467-c3e5-4639-ad4f-88bcd7ab9f26	g.chr3:439928T>C	ENST00000256509.2	+	25	3755	c.3113T>C	c.(3112-3114)aTa>aCa	p.I1038T	CHL1_ENST00000397491.2_Missense_Mutation_p.I1022T	NM_001253387.1|NM_001253388.1|NM_006614.3	NP_001240316.1|NP_001240317.1|NP_006605.2	Q96FC9	DDX11_HUMAN	cell adhesion molecule L1-like	0					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|ATP catabolic process (GO:0006200)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|sister chromatid cohesion (GO:0007062)|viral process (GO:0016032)	midbody (GO:0030496)|nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle pole (GO:0000922)	4 iron, 4 sulfur cluster binding (GO:0051539)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA-dependent ATPase activity (GO:0008094)|double-stranded DNA binding (GO:0003690)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|RNA binding (GO:0003723)|single-stranded DNA binding (GO:0003697)			NS(1)|central_nervous_system(5)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(25)|lung(31)|ovary(1)|prostate(4)|skin(10)|stomach(1)	93		all_cancers(2;1.14e-06)|all_epithelial(2;0.00367)|all_lung(1;0.061)|Lung NSC(2;0.201)		Epithelial(13;5.36e-06)|all cancers(10;1.4e-05)|OV - Ovarian serous cystadenocarcinoma(96;0.00323)|COAD - Colon adenocarcinoma(1;0.00925)|Colorectal(20;0.0198)		ATCGGGAAGATATCAGGAGTA	0.358																																					p.I1038T		.											.	CHL1	583	0			c.T3113C						.						64.0	63.0	63.0					3																	439928		2203	4300	6503	SO:0001583	missense	10752	exon25			GGAAGATATCAGG	AF002246	CCDS2556.1, CCDS58812.1, CCDS74887.1	3p26	2013-05-01	2013-05-01		ENSG00000134121	ENSG00000134121		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	1939	protein-coding gene	gene with protein product	"""neural cell adhesion molecule"", ""close homolog of L1"""	607416	"""cell adhesion molecule with homology to L1CAM (close homologue of L1)"", ""cell adhesion molecule with homology to L1CAM (close homolog of L1)"""			9799093	Standard	NM_006614		Approved	CALL, L1CAM2, FLJ44930, MGC132578	uc003bot.3	O00533	OTTHUMG00000090601	ENST00000256509.2:c.3113T>C	3.37:g.439928T>C	ENSP00000256509:p.Ile1038Thr	83.0	0.0		69.0	12.0	NM_006614	Q13333|Q86VQ4|Q86W62|Q92498|Q92770|Q92998|Q92999	Missense_Mutation	SNP	ENST00000256509.2	37	CCDS2556.1	.	.	.	.	.	.	.	.	.	.	T	10.21	1.287976	0.23478	.	.	ENSG00000134121	ENST00000256509;ENST00000397491	T;T	0.60424	0.19;0.2	5.72	4.52	0.55395	.	0.242716	0.39407	N	0.001367	T	0.39886	0.1095	L	0.29908	0.895	0.33202	D	0.552258	B;B	0.27679	0.085;0.185	B;B	0.27380	0.015;0.079	T	0.44620	-0.9316	10	0.12103	T	0.63	.	7.9446	0.29978	0.1351:0.0:0.1414:0.7235	.	1022;1038	O00533;O00533-2	CHL1_HUMAN;.	T	1038;1022	ENSP00000256509:I1038T;ENSP00000380628:I1022T	ENSP00000256509:I1038T	I	+	2	0	CHL1	414928	1.000000	0.71417	0.905000	0.35620	0.998000	0.95712	2.422000	0.44696	0.953000	0.37825	0.528000	0.53228	ATA	.		0.358	CHL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207155.2	NM_006614	
CLCA1	1179	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	86964423	86964423	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A5SL-01A-11D-A27I-10	TCGA-G3-A5SL-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70422e6d-cb1f-4284-8be9-1d4517ffad60	a38d4467-c3e5-4639-ad4f-88bcd7ab9f26	g.chr1:86964423C>T	ENST00000234701.3	+	14	2633	c.2282C>T	c.(2281-2283)gCg>gTg	p.A761V	CLCA1_ENST00000394711.1_Missense_Mutation_p.A761V			A8K7I4	CLCA1_HUMAN	chloride channel accessory 1	761					calcium ion transport (GO:0006816)|cellular response to hypoxia (GO:0071456)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|transport (GO:0006810)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|microvillus (GO:0005902)|zymogen granule membrane (GO:0042589)	chloride channel activity (GO:0005254)			NS(1)|breast(3)|endometrium(1)|kidney(3)|large_intestine(9)|lung(14)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	38		Lung NSC(277;0.239)		all cancers(265;0.0249)|Epithelial(280;0.0476)		GACCTGAAGGCGGAAATTCAC	0.517																																					p.A761V		.											.	CLCA1	91	0			c.C2282T						.						108.0	98.0	101.0					1																	86964423		2203	4300	6503	SO:0001583	missense	1179	exon13			TGAAGGCGGAAAT		CCDS709.1	1p22.3	2012-02-26	2009-01-29		ENSG00000016490	ENSG00000016490			2015	protein-coding gene	gene with protein product		603906	"""chloride channel, calcium activated, family member 1"", ""chloride channel regulator 1"""			9828122	Standard	NM_001285		Approved	CaCC, CLCRG1	uc001dlt.3	A8K7I4	OTTHUMG00000010254	ENST00000234701.3:c.2282C>T	1.37:g.86964423C>T	ENSP00000234701:p.Ala761Val	138.0	0.0		132.0	25.0	NM_001285	B2RAV5|O95151|Q5TDF4|Q9UNF6|Q9UPC6	Missense_Mutation	SNP	ENST00000234701.3	37	CCDS709.1	.	.	.	.	.	.	.	.	.	.	C	17.27	3.346440	0.61073	.	.	ENSG00000016490	ENST00000234701;ENST00000394711	T;T	0.38240	1.15;1.15	5.79	4.86	0.63082	.	0.000000	0.85682	D	0.000000	T	0.46308	0.1386	M	0.67953	2.075	0.37364	D	0.911347	D	0.89917	1.0	D	0.91635	0.999	T	0.45789	-0.9237	10	0.30854	T	0.27	-16.0434	14.7865	0.69808	0.1455:0.8545:0.0:0.0	.	761	A8K7I4	CLCA1_HUMAN	V	761	ENSP00000234701:A761V;ENSP00000378200:A761V	ENSP00000234701:A761V	A	+	2	0	CLCA1	86737011	0.962000	0.33011	0.878000	0.34440	0.469000	0.32828	3.238000	0.51352	1.400000	0.46741	0.655000	0.94253	GCG	.		0.517	CLCA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000028277.1	NM_001285	
CNNM4	26504	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	97428070	97428070	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A5SL-01A-11D-A27I-10	TCGA-G3-A5SL-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70422e6d-cb1f-4284-8be9-1d4517ffad60	a38d4467-c3e5-4639-ad4f-88bcd7ab9f26	g.chr2:97428070A>G	ENST00000377075.2	+	1	1432	c.1334A>G	c.(1333-1335)tAt>tGt	p.Y445C		NM_020184.3	NP_064569.3	Q6P4Q7	CNNM4_HUMAN	cyclin and CBS domain divalent metal cation transport mediator 4	445	CBS 2. {ECO:0000255|PROSITE- ProRule:PRU00703}.				biomineral tissue development (GO:0031214)|ion transport (GO:0006811)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	adenyl nucleotide binding (GO:0030554)			breast(2)|endometrium(4)|kidney(1)|large_intestine(1)|lung(9)|ovary(1)|prostate(2)	20						ACTCGCTTCTATAACCACCCG	0.493																																					p.Y445C		.											.	CNNM4	154	0			c.A1334G						.						127.0	122.0	124.0					2																	97428070		2203	4300	6503	SO:0001583	missense	26504	exon1			GCTTCTATAACCA	AB046812	CCDS2024.2	2q11.2	2014-08-08	2014-08-07		ENSG00000158158	ENSG00000158158			105	protein-coding gene	gene with protein product		607805	"""cyclin M4"""	ACDP4		21393841, 24194943	Standard	XM_005263914		Approved	KIAA1592	uc002swx.3	Q6P4Q7	OTTHUMG00000130532	ENST00000377075.2:c.1334A>G	2.37:g.97428070A>G	ENSP00000366275:p.Tyr445Cys	266.0	0.0		198.0	79.0	NM_020184	B7Z1U0|C7SQM3|C7SQM4|C7SQM5|Q53RE5|Q9H9G3|Q9HCI0|Q9NRN1	Missense_Mutation	SNP	ENST00000377075.2	37	CCDS2024.2	.	.	.	.	.	.	.	.	.	.	A	17.60	3.429345	0.62844	.	.	ENSG00000158158	ENST00000377075	D	0.93247	-3.19	5.13	5.13	0.70059	Cystathionine beta-synthase, core (2);	0.000000	0.64402	D	0.000001	D	0.96482	0.8852	M	0.81112	2.525	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.97029	0.9749	10	0.87932	D	0	-0.0098	13.9468	0.64089	1.0:0.0:0.0:0.0	.	445	Q6P4Q7	CNNM4_HUMAN	C	445	ENSP00000366275:Y445C	ENSP00000366275:Y445C	Y	+	2	0	CNNM4	96791797	1.000000	0.71417	0.990000	0.47175	0.820000	0.46376	9.281000	0.95811	1.941000	0.56285	0.460000	0.39030	TAT	.		0.493	CNNM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252954.1	NM_020184	
CNTRL	11064	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	123937425	123937425	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A5SL-01A-11D-A27I-10	TCGA-G3-A5SL-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70422e6d-cb1f-4284-8be9-1d4517ffad60	a38d4467-c3e5-4639-ad4f-88bcd7ab9f26	g.chr9:123937425G>A	ENST00000373855.1	+	43	7137	c.6877G>A	c.(6877-6879)Gca>Aca	p.A2293T	CNTRL_ENST00000238341.5_Missense_Mutation_p.A2293T|CNTRL_ENST00000373845.2_3'UTR|CNTRL_ENST00000373850.1_Missense_Mutation_p.A1741T			Q7Z7A1	CNTRL_HUMAN	centriolin	2293	Sufficient for interaction with HOOK2.				cell division (GO:0051301)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)				haematopoietic_and_lymphoid_tissue(2)|large_intestine(9)|lung(2)|ovary(4)|skin(3)	20						CAGCACCTCTGCAGATTCAGC	0.463																																					p.A2293T		.											.	CNTRL	661	0			c.G6877A						.						118.0	110.0	113.0					9																	123937425		2203	4300	6503	SO:0001583	missense	11064	exon41			ACCTCTGCAGATT	AF513978	CCDS35118.1	9q33.2	2014-02-20	2011-05-23	2011-05-23	ENSG00000119397	ENSG00000119397			1858	protein-coding gene	gene with protein product		605496	"""centrosomal protein 1"", ""centrosomal protein 110kDa"""	CEP1, CEP110		10688839	Standard	XM_005251679		Approved		uc004bkx.1	Q7Z7A1	OTTHUMG00000020581	ENST00000373855.1:c.6877G>A	9.37:g.123937425G>A	ENSP00000362962:p.Ala2293Thr	71.0	0.0		105.0	14.0	NM_007018	A2A2Y1|B2RP67|Q3MN79|Q5FWF8|Q5JVD0|Q6MZR3|Q6PKC1|Q8TEP3|Q9Y489	Missense_Mutation	SNP	ENST00000373855.1	37	CCDS35118.1	.	.	.	.	.	.	.	.	.	.	G	3.106	-0.183703	0.06340	.	.	ENSG00000119397	ENST00000373855;ENST00000238341;ENST00000454238;ENST00000394368;ENST00000373850;ENST00000373845	T;T;T	0.30714	1.82;1.82;1.52	5.33	1.28	0.21552	.	.	.	.	.	T	0.10294	0.0252	N	0.03608	-0.345	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.33675	-0.9859	9	0.13470	T	0.59	.	2.4271	0.04462	0.2299:0.1294:0.5078:0.1329	.	2293	Q7Z7A1	CNTRL_HUMAN	T	2293;2293;2293;450;1741;975	ENSP00000362962:A2293T;ENSP00000238341:A2293T;ENSP00000362956:A1741T	ENSP00000238341:A2293T	A	+	1	0	CNTRL	122977246	0.002000	0.14202	0.132000	0.22025	0.218000	0.24690	0.196000	0.17176	0.201000	0.20466	-0.266000	0.10368	GCA	.		0.463	CNTRL-010	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250216.1	NM_007018	
COL18A1	80781	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	21	46888317	46888317	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A5SL-01A-11D-A27I-10	TCGA-G3-A5SL-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70422e6d-cb1f-4284-8be9-1d4517ffad60	a38d4467-c3e5-4639-ad4f-88bcd7ab9f26	g.chr21:46888317C>T	ENST00000359759.4	+	2	1534	c.1513C>T	c.(1513-1515)Cgt>Tgt	p.R505C	COL18A1_ENST00000355480.5_Missense_Mutation_p.R270C|COL18A1_ENST00000400337.2_Missense_Mutation_p.R90C			P39060	COIA1_HUMAN	collagen, type XVIII, alpha 1	505	Laminin G-like.				angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|endothelial cell morphogenesis (GO:0001886)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of cell proliferation (GO:0008285)|organ morphogenesis (GO:0009887)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell apoptotic process (GO:2000353)|response to drug (GO:0042493)|response to hydrostatic pressure (GO:0051599)|visual perception (GO:0007601)	basement membrane (GO:0005604)|collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|structural molecule activity (GO:0005198)			breast(1)|central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(4)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	25				Colorectal(79;0.0157)|READ - Rectum adenocarcinoma(84;0.0929)		CCTCTTCTTCCGTGACTTCTC	0.647																																					p.R270C		.											.	COL18A1	90	0			c.C808T						.						81.0	94.0	90.0					21																	46888317		2072	4208	6280	SO:0001583	missense	80781	exon2			TTCTTCCGTGACT		CCDS42971.1, CCDS42972.1	21q22.3	2013-01-16			ENSG00000182871	ENSG00000182871		"""Collagens"""	2195	protein-coding gene	gene with protein product	"""endostatin"""	120328	"""Knobloch syndrome, type 1"""	KNO		8188291, 8776601, 10942434, 17546652	Standard	NM_130445		Approved	KS, KNO1	uc002zhi.3	P39060	OTTHUMG00000090407	ENST00000359759.4:c.1513C>T	21.37:g.46888317C>T	ENSP00000352798:p.Arg505Cys	226.0	0.0		126.0	38.0	NM_030582	A8MVI4|Q58EX6|Q6RZ39|Q6RZ40|Q6RZ41|Q8N4S4|Q8WXI5|Q96T70|Q9UK38|Q9Y6Q7|Q9Y6Q8	Missense_Mutation	SNP	ENST00000359759.4	37		.	.	.	.	.	.	.	.	.	.	C	11.31	1.599866	0.28534	.	.	ENSG00000182871	ENST00000400337;ENST00000400347;ENST00000355480;ENST00000359759;ENST00000539645	T;T;T	0.74002	-0.8;-0.8;-0.8	4.65	2.44	0.29823	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (1);Laminin G, thrombospondin-type, N-terminal (1);	0.067657	0.56097	D	0.000021	T	0.81278	0.4789	M	0.64997	1.995	0.58432	D	0.99999	D;D;D	0.89917	1.0;0.999;0.999	D;P;P	0.64595	0.927;0.88;0.809	T	0.82737	-0.0309	10	0.87932	D	0	.	11.7042	0.51587	0.4477:0.5523:0.0:0.0	.	505;270;90	P39060;P39060-1;P39060-2	COIA1_HUMAN;.;.	C	90;90;270;505;505	ENSP00000383191:R90C;ENSP00000347665:R270C;ENSP00000352798:R505C	ENSP00000347665:R270C	R	+	1	0	COL18A1	45712745	0.976000	0.34144	0.820000	0.32676	0.457000	0.32468	0.952000	0.29149	1.051000	0.40369	0.655000	0.94253	CGT	.		0.647	COL18A1-201	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000206827.1		
COL1A1	1277	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	48264129	48264129	+	Missense_Mutation	SNP	A	A	T			TCGA-G3-A5SL-01A-11D-A27I-10	TCGA-G3-A5SL-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70422e6d-cb1f-4284-8be9-1d4517ffad60	a38d4467-c3e5-4639-ad4f-88bcd7ab9f26	g.chr17:48264129A>T	ENST00000225964.5	-	48	3804	c.3686T>A	c.(3685-3687)cTc>cAc	p.L1229H		NM_000088.3	NP_000079	P02452	CO1A1_HUMAN	collagen, type I, alpha 1	1229	Fibrillar collagen NC1. {ECO:0000255|PROSITE-ProRule:PRU00793}.				blood coagulation (GO:0007596)|blood vessel development (GO:0001568)|bone trabecula formation (GO:0060346)|cartilage development involved in endochondral bone morphogenesis (GO:0060351)|cellular response to amino acid stimulus (GO:0071230)|cellular response to mechanical stimulus (GO:0071260)|cellular response to retinoic acid (GO:0071300)|cellular response to transforming growth factor beta stimulus (GO:0071560)|collagen biosynthetic process (GO:0032964)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|embryonic skeletal system development (GO:0048706)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|face morphogenesis (GO:0060325)|intramembranous ossification (GO:0001957)|leukocyte migration (GO:0050900)|negative regulation of cell-substrate adhesion (GO:0010812)|osteoblast differentiation (GO:0001649)|platelet activation (GO:0030168)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of transcription, DNA-templated (GO:0045893)|protein heterotrimerization (GO:0070208)|protein localization to nucleus (GO:0034504)|protein transport (GO:0015031)|response to cAMP (GO:0051591)|response to corticosteroid (GO:0031960)|response to estradiol (GO:0032355)|response to hydrogen peroxide (GO:0042542)|response to nutrient (GO:0007584)|response to peptide hormone (GO:0043434)|sensory perception of sound (GO:0007605)|skeletal system development (GO:0001501)|skin morphogenesis (GO:0043589)|tooth mineralization (GO:0034505)|visual perception (GO:0007601)	collagen type I trimer (GO:0005584)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	extracellular matrix structural constituent (GO:0005201)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)		COL1A1/PDGFB(429)	NS(1)|breast(3)|central_nervous_system(8)|endometrium(3)|kidney(4)|large_intestine(17)|liver(3)|lung(18)|ovary(1)|pancreas(1)|prostate(4)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	71					Collagenase(DB00048)	GTCCACCTCGAGGTCACGGTC	0.627			T	"""PDGFB, USP6"""	"""dermatofibrosarcoma protuberans, aneurysmal bone cyst """		Osteogenesis imperfecta																														p.L1229H		.		Dom	yes		17	17q21.31-q22	1277	"""collagen, type I, alpha 1"""	yes	M	.	COL1A1	986	0			c.T3686A						.						158.0	150.0	152.0					17																	48264129		2203	4300	6503	SO:0001583	missense	1277	exon48			ACCTCGAGGTCAC	Z74615	CCDS11561.1	17q21.33	2014-09-17			ENSG00000108821	ENSG00000108821		"""Collagens"""	2197	protein-coding gene	gene with protein product		120150				3178743, 2857713	Standard	NM_000088		Approved	OI4	uc002iqm.3	P02452	OTTHUMG00000148674	ENST00000225964.5:c.3686T>A	17.37:g.48264129A>T	ENSP00000225964:p.Leu1229His	137.0	0.0		87.0	41.0	NM_000088	O76045|P78441|Q13896|Q13902|Q13903|Q14037|Q14992|Q15176|Q15201|Q16050|Q59F64|Q7KZ30|Q7KZ34|Q8IVI5|Q8N473|Q9UML6|Q9UMM7	Missense_Mutation	SNP	ENST00000225964.5	37	CCDS11561.1	.	.	.	.	.	.	.	.	.	.	A	9.353	1.066030	0.20067	.	.	ENSG00000108821	ENST00000225964	D	0.89681	-2.55	4.03	4.03	0.46877	Fibrillar collagen, C-terminal (2);	0.083285	0.49305	D	0.000142	D	0.84763	0.5544	M	0.71036	2.16	0.38553	D	0.949504	B	0.10296	0.003	B	0.04013	0.001	T	0.77659	-0.2505	10	0.13853	T	0.58	.	7.8053	0.29198	0.8138:0.0:0.0:0.1862	.	1229	P02452	CO1A1_HUMAN	H	1229	ENSP00000225964:L1229H	ENSP00000225964:L1229H	L	-	2	0	COL1A1	45619128	0.999000	0.42202	1.000000	0.80357	0.985000	0.73830	3.972000	0.56838	1.676000	0.50930	0.260000	0.18958	CTC	.		0.627	COL1A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000309036.2		
COL2A1	1280	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	48391816	48391816	+	Splice_Site	SNP	T	T	C			TCGA-G3-A5SL-01A-11D-A27I-10	TCGA-G3-A5SL-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70422e6d-cb1f-4284-8be9-1d4517ffad60	a38d4467-c3e5-4639-ad4f-88bcd7ab9f26	g.chr12:48391816T>C	ENST00000380518.3	-	5	538	c.374A>G	c.(373-375)cAg>cGg	p.Q125R	COL2A1_ENST00000337299.6_Splice_Site_p.Q56R	NM_001844.4|NM_033150.2	NP_001835.3|NP_149162.2	P02458	CO2A1_HUMAN	collagen, type II, alpha 1	125					axon guidance (GO:0007411)|cartilage condensation (GO:0001502)|cartilage development (GO:0051216)|cartilage development involved in endochondral bone morphogenesis (GO:0060351)|cellular response to BMP stimulus (GO:0071773)|central nervous system development (GO:0007417)|chondrocyte differentiation (GO:0002062)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|embryonic skeletal joint morphogenesis (GO:0060272)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|heart morphogenesis (GO:0003007)|inner ear morphogenesis (GO:0042472)|limb bud formation (GO:0060174)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|notochord development (GO:0030903)|otic vesicle development (GO:0071599)|palate development (GO:0060021)|proteoglycan metabolic process (GO:0006029)|regulation of gene expression (GO:0010468)|sensory perception of sound (GO:0007605)|skeletal system development (GO:0001501)|tissue homeostasis (GO:0001894)|visual perception (GO:0007601)	basement membrane (GO:0005604)|collagen type II trimer (GO:0005585)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(9)|lung(25)|ovary(1)|prostate(1)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(3)	64		Acute lymphoblastic leukemia(13;0.108)|all_hematologic(14;0.214)			Collagenase(DB00048)	CTCTCTTACCTGAGGCCCAGG	0.527																																					p.Q125R		.											.	COL2A1	92	0			c.A374G						.						107.0	112.0	110.0					12																	48391816		2203	4300	6503	SO:0001630	splice_region_variant	1280	exon5			CTTACCTGAGGCC	X16468	CCDS8759.1, CCDS41778.1	12q12-q13.2	2013-11-14	2008-02-04		ENSG00000139219	ENSG00000139219		"""Collagens"""	2200	protein-coding gene	gene with protein product		120140	"""collagen, type II, alpha 1 (primary osteoarthritis, spondyloepiphyseal dysplasia, congenital)"", ""arthroophthalmopathy, progressive (Stickler syndrome)"""	SEDC, AOM		1677770	Standard	NM_033150		Approved	STL1	uc001rqu.3	P02458	OTTHUMG00000149896	ENST00000380518.3:c.375+1A>G	12.37:g.48391816T>C		156.0	0.0		100.0	39.0	NM_001844	A6NGA0|Q12985|Q14009|Q14044|Q14045|Q14046|Q14047|Q14056|Q14058|Q16672|Q1JQ82|Q2V4X7|Q6LBY1|Q6LBY2|Q6LBY3|Q96IT5|Q99227|Q9UE38|Q9UE39|Q9UE40|Q9UE41|Q9UE42|Q9UE43	Missense_Mutation	SNP	ENST00000380518.3	37	CCDS41778.1	.	.	.	.	.	.	.	.	.	.	T	12.79	2.044709	0.36085	.	.	ENSG00000139219	ENST00000380518;ENST00000395281;ENST00000337299	D;D	0.92858	-3.12;-3.12	5.04	5.04	0.67666	.	0.277618	0.32301	N	0.006292	T	0.81153	0.4763	N	0.04724	-0.175	0.46874	D	0.999238	B;B	0.33919	0.231;0.432	B;B	0.31016	0.075;0.123	T	0.80238	-0.1465	10	0.16896	T	0.51	.	14.0685	0.64847	0.0:0.0:0.0:1.0	.	56;125	P02458-1;P02458	.;CO2A1_HUMAN	R	125;56;56	ENSP00000369889:Q125R;ENSP00000338213:Q56R	ENSP00000338213:Q56R	Q	-	2	0	COL2A1	46678083	1.000000	0.71417	1.000000	0.80357	0.953000	0.61014	3.777000	0.55364	2.047000	0.60756	0.454000	0.30748	CAG	.		0.527	COL2A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313810.2	NM_001844	Missense_Mutation
COLGALT1	79709	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	17691557	17691557	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A5SL-01A-11D-A27I-10	TCGA-G3-A5SL-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70422e6d-cb1f-4284-8be9-1d4517ffad60	a38d4467-c3e5-4639-ad4f-88bcd7ab9f26	g.chr19:17691557C>T	ENST00000252599.4	+	11	1564	c.1444C>T	c.(1444-1446)Cct>Tct	p.P482S		NM_024656.2	NP_078932.2	Q8NBJ5	GT251_HUMAN	collagen beta(1-O)galactosyltransferase 1	482					extracellular matrix organization (GO:0030198)|lipopolysaccharide biosynthetic process (GO:0009103)	endoplasmic reticulum lumen (GO:0005788)|membrane (GO:0016020)	procollagen galactosyltransferase activity (GO:0050211)										GAAGGCTGTGCCTCGCGTGAG	0.662																																					p.P482S		.											.	.	.	0			c.C1444T						.						72.0	64.0	66.0					19																	17691557		2203	4300	6503	SO:0001583	missense	79709	exon11			GCTGTGCCTCGCG	AK075541	CCDS12363.1	19p13.11	2013-02-27	2013-02-27	2013-02-27	ENSG00000130309	ENSG00000130309			26182	protein-coding gene	gene with protein product			"""glycosyltransferase 25 domain containing 1"""	GLT25D1		19075007	Standard	NM_024656		Approved	FLJ22329	uc002nhc.1	Q8NBJ5		ENST00000252599.4:c.1444C>T	19.37:g.17691557C>T	ENSP00000252599:p.Pro482Ser	99.0	0.0		71.0	29.0	NM_024656	Q8NC64	Missense_Mutation	SNP	ENST00000252599.4	37	CCDS12363.1	.	.	.	.	.	.	.	.	.	.	C	25.7	4.661793	0.88154	.	.	ENSG00000130309	ENST00000379714;ENST00000252599	T	0.78924	-1.22	5.24	5.24	0.73138	.	0.107265	0.64402	D	0.000004	D	0.84229	0.5426	L	0.55481	1.735	0.80722	D	1	B;D;P	0.67145	0.275;0.996;0.949	B;D;P	0.68621	0.147;0.959;0.719	T	0.81805	-0.0764	10	0.28530	T	0.3	4.5113	16.2945	0.82763	0.0:1.0:0.0:0.0	.	11;210;482	B3KQ10;E9PC06;Q8NBJ5	.;.;GT251_HUMAN	S	210;482	ENSP00000252599:P482S	ENSP00000252599:P482S	P	+	1	0	GLT25D1	17552557	0.993000	0.37304	0.998000	0.56505	0.971000	0.66376	2.437000	0.44828	2.456000	0.83038	0.491000	0.48974	CCT	.		0.662	COLGALT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464216.1	NM_024656	
CTNNB1	1499	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	41266098	41266098	+	Missense_Mutation	SNP	A	A	G	rs121913396|rs121913416		TCGA-G3-A5SL-01A-11D-A27I-10	TCGA-G3-A5SL-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70422e6d-cb1f-4284-8be9-1d4517ffad60	a38d4467-c3e5-4639-ad4f-88bcd7ab9f26	g.chr3:41266098A>G	ENST00000349496.5	+	3	375	c.95A>G	c.(94-96)gAc>gGc	p.D32G	CTNNB1_ENST00000396183.3_Missense_Mutation_p.D32G|CTNNB1_ENST00000405570.1_Missense_Mutation_p.D32G|CTNNB1_ENST00000396185.3_Missense_Mutation_p.D32G|CTNNB1_ENST00000453024.1_Missense_Mutation_p.D25G	NM_001904.3	NP_001895.1	P35222	CTNB1_HUMAN	catenin (cadherin-associated protein), beta 1, 88kDa	32			D -> A (in hepatocellular carcinoma). {ECO:0000269|PubMed:10435629}.|D -> G (in PTR and hepatocellular carcinoma). {ECO:0000269|PubMed:10192393, ECO:0000269|PubMed:10435629}.|D -> Y (in PTR, hepatoblastoma and hepatocellular carcinoma; dbSNP:rs28931588). {ECO:0000269|PubMed:10192393, ECO:0000269|PubMed:10435629, ECO:0000269|PubMed:11703283, ECO:0000269|PubMed:9927029}.|Missing (in hepatocellular carcinoma). {ECO:0000269|PubMed:10435629}.		adherens junction assembly (GO:0034333)|androgen receptor signaling pathway (GO:0030521)|anterior/posterior axis specification (GO:0009948)|apoptotic process (GO:0006915)|bone resorption (GO:0045453)|branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of cardiac outflow tract cell proliferation (GO:0061324)|canonical Wnt signaling pathway involved in positive regulation of epithelial to mesenchymal transition (GO:0044334)|cell adhesion (GO:0007155)|cell fate specification (GO:0001708)|cell maturation (GO:0048469)|cell-matrix adhesion (GO:0007160)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to growth factor stimulus (GO:0071363)|cellular response to indole-3-methanol (GO:0071681)|cellular response to mechanical stimulus (GO:0071260)|central nervous system vasculogenesis (GO:0022009)|cytoskeletal anchoring at plasma membrane (GO:0007016)|determination of dorsal/ventral asymmetry (GO:0048262)|dorsal/ventral axis specification (GO:0009950)|ectoderm development (GO:0007398)|embryonic axis specification (GO:0000578)|embryonic digit morphogenesis (GO:0042733)|embryonic foregut morphogenesis (GO:0048617)|embryonic forelimb morphogenesis (GO:0035115)|embryonic heart tube development (GO:0035050)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal limb joint morphogenesis (GO:0036023)|endodermal cell fate commitment (GO:0001711)|endothelial tube morphogenesis (GO:0061154)|epithelial cell differentiation involved in prostate gland development (GO:0060742)|epithelial to mesenchymal transition (GO:0001837)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|fungiform papilla formation (GO:0061198)|gastrulation with mouth forming second (GO:0001702)|genitalia morphogenesis (GO:0035112)|glial cell fate determination (GO:0007403)|hair cell differentiation (GO:0035315)|hair follicle morphogenesis (GO:0031069)|hair follicle placode formation (GO:0060789)|hindbrain development (GO:0030902)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|layer formation in cerebral cortex (GO:0021819)|lens morphogenesis in camera-type eye (GO:0002089)|liver development (GO:0001889)|lung cell differentiation (GO:0060479)|lung induction (GO:0060492)|lung-associated mesenchyme development (GO:0060484)|male genitalia development (GO:0030539)|mesenchymal cell proliferation involved in lung development (GO:0060916)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|midgut development (GO:0007494)|muscle cell differentiation (GO:0042692)|myoblast differentiation (GO:0045445)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of heart induction by canonical Wnt signaling pathway (GO:0003136)|negative regulation of neuron death (GO:1901215)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein sumoylation (GO:0033234)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephron tubule formation (GO:0072079)|neural plate development (GO:0001840)|neuron migration (GO:0001764)|odontogenesis of dentin-containing tooth (GO:0042475)|oocyte development (GO:0048599)|osteoclast differentiation (GO:0030316)|oviduct development (GO:0060066)|pancreas development (GO:0031016)|patterning of blood vessels (GO:0001569)|positive regulation of apoptotic process (GO:0043065)|positive regulation of branching involved in lung morphogenesis (GO:0061047)|positive regulation of determination of dorsal identity (GO:2000017)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of epithelial cell proliferation involved in prostate gland development (GO:0060769)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of heparan sulfate proteoglycan biosynthetic process (GO:0010909)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein heterooligomerization (GO:0051291)|protein localization to cell surface (GO:0034394)|proximal/distal pattern formation (GO:0009954)|regulation of angiogenesis (GO:0045765)|regulation of calcium ion import (GO:0090279)|regulation of centriole-centriole cohesion (GO:0030997)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of fibroblast proliferation (GO:0048145)|regulation of myelination (GO:0031641)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of protein localization to cell surface (GO:2000008)|regulation of secondary heart field cardioblast proliferation (GO:0003266)|regulation of smooth muscle cell proliferation (GO:0048660)|regulation of T cell proliferation (GO:0042129)|renal inner medulla development (GO:0072053)|renal outer medulla development (GO:0072054)|renal vesicle formation (GO:0072033)|response to cadmium ion (GO:0046686)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|Schwann cell proliferation (GO:0014010)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle cell differentiation (GO:0051145)|synapse organization (GO:0050808)|synaptic vesicle transport (GO:0048489)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tongue morphogenesis (GO:0043587)|trachea formation (GO:0060440)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	adherens junction (GO:0005912)|apical part of cell (GO:0045177)|basolateral plasma membrane (GO:0016323)|beta-catenin destruction complex (GO:0030877)|beta-catenin-TCF7L2 complex (GO:0070369)|catenin complex (GO:0016342)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell periphery (GO:0071944)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microvillus membrane (GO:0031528)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein-DNA complex (GO:0032993)|Scrib-APC-beta-catenin complex (GO:0034750)|synapse (GO:0045202)|tight junction (GO:0005923)|transcription factor complex (GO:0005667)|Z disc (GO:0030018)|zonula adherens (GO:0005915)	alpha-catenin binding (GO:0045294)|androgen receptor binding (GO:0050681)|cadherin binding (GO:0045296)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|I-SMAD binding (GO:0070411)|ion channel binding (GO:0044325)|kinase binding (GO:0019900)|nuclear hormone receptor binding (GO:0035257)|protein C-terminus binding (GO:0008022)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|R-SMAD binding (GO:0070412)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|structural molecule activity (GO:0005198)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.D32G(65)|p.A5_A80del(53)|p.D32V(33)|p.D32A(16)|p.A5_Q143del(7)|p.A5_A80>D(7)|p.Q28_H134del(5)|p.WQQQSYLD25?(5)|p.W25_D32del(4)|p.?(4)|p.V22_G38del(3)|p.W25_I140del(3)|p.T3_A126del(2)|p.S23_S33del(2)|p.V22_S33del(2)|p.A5fs*7(2)|p.D32_S47del(2)|p.M5_N141>D(2)|p.L10_N141del(2)|p.A5_Y142>D(2)|p.Y30_S33del(2)|p.A5_Q143>E(1)|p.A13_R151del(1)|p.S29_H36del(1)|p.D32del(1)|p.M14_S45del(1)|p.Q28_D32>H(1)|p.A20_N141del(1)|p.M1_A87del(1)|p.D11_Y142>H(1)|p.H24_G38del(1)|p.S23_I35del(1)|p.Y30_A97del(1)|p.W25_S33del(1)|p.V22_T102del(1)|p.A20_A80del(1)|p.V22_S71>A(1)|p.Q28_A43del(1)|p.A5_T59del(1)|p.D32fs*9(1)|p.A20_I35del(1)|p.M1_V173del(1)|p.E15_I140>V(1)|p.S23_A39del(1)|p.H24_M131del(1)|p.A21_A80del(1)|p.Y30_A80del(1)|p.A5_T40del(1)|p.A5_E54del(1)|p.W25_I35del(1)|p.M8_A80del(1)|p.P16_K133del(1)|p.V22_Y64del(1)|p.Q28_Q61del(1)|p.A20_S111del(1)|p.Y30_T40del(1)|p.A5_I35del(1)|p.D32_H36del(1)	CTNNB1/PLAG1(60)	NS(4)|adrenal_gland(103)|biliary_tract(43)|bone(21)|breast(7)|central_nervous_system(260)|cervix(9)|endometrium(293)|eye(1)|haematopoietic_and_lymphoid_tissue(60)|kidney(202)|large_intestine(269)|liver(1010)|lung(63)|oesophagus(6)|ovary(106)|pancreas(126)|parathyroid(11)|pituitary(111)|pleura(2)|prostate(31)|salivary_gland(13)|skin(103)|small_intestine(17)|soft_tissue(792)|stomach(165)|thyroid(55)|upper_aerodigestive_tract(2)|urinary_tract(8)	3893				KIRC - Kidney renal clear cell carcinoma(284;0.0028)|Kidney(284;0.00294)		TCTTACCTGGACTCTGGAATC	0.483	D32V(HEC265_ENDOMETRIUM)|D32V(HEC6_ENDOMETRIUM)	15	"""H, Mis, T"""	PLAG1	"""colorectal, cvarian,  hepatoblastoma, others, pleomorphic salivary adenoma"""				Pilomatrixoma, Familial Clustering of																												p.D32G	Colon(6;3 56 14213 18255)	.		Dom	yes		3	3p22-p21.3	1499	"""catenin (cadherin-associated protein), beta 1"""		"""E, M, O"""	CTNNB1,gallbladder,other,+1	CTNNB1	24361	260	Deletion - In frame(120)|Substitution - Missense(114)|Complex - deletion inframe(16)|Unknown(7)|Deletion - Frameshift(3)	liver(154)|large_intestine(24)|pancreas(19)|central_nervous_system(16)|stomach(14)|endometrium(7)|skin(7)|ovary(4)|prostate(3)|pituitary(3)|small_intestine(2)|NS(2)|adrenal_gland(1)|soft_tissue(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|urinary_tract(1)	c.A95G						.						92.0	77.0	82.0					3																	41266098		2203	4300	6503	SO:0001583	missense	1499	exon3	Familial Cancer Database	Pilomatricoma, Familial Clustering of, Epithelioma Calcificans of Malherbe	ACCTGGACTCTGG	X87838	CCDS2694.1	3p21	2013-02-15	2002-08-29		ENSG00000168036	ENSG00000168036		"""Armadillo repeat containing"""	2514	protein-coding gene	gene with protein product		116806	"""catenin (cadherin-associated protein), beta 1 (88kD)"""	CTNNB		7829088	Standard	NM_001098210		Approved	beta-catenin, armadillo	uc003ckr.2	P35222	OTTHUMG00000131393	ENST00000349496.5:c.95A>G	3.37:g.41266098A>G	ENSP00000344456:p.Asp32Gly	170.0	0.0		232.0	73.0	NM_001098209	A8K1L7|Q8NEW9|Q8NI94|Q9H391	Missense_Mutation	SNP	ENST00000349496.5	37	CCDS2694.1	.	.	.	.	.	.	.	.	.	.	A	22.6	4.308122	0.81247	.	.	ENSG00000168036	ENST00000426215;ENST00000405570;ENST00000431914;ENST00000396183;ENST00000349496;ENST00000453024;ENST00000396185;ENST00000450969;ENST00000441708	T;T;T;T;T;T;T;T;T	0.50001	0.76;0.76;0.76;0.76;0.76;0.76;0.76;0.76;0.76	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	T	0.69788	0.3150	M	0.79614	2.46	0.80722	D	1	D	0.89917	1.0	D	0.74674	0.984	T	0.74137	-0.3762	10	0.87932	D	0	0.3843	16.0676	0.80897	1.0:0.0:0.0:0.0	.	32	P35222	CTNB1_HUMAN	G	25;32;32;32;32;25;32;32;32	ENSP00000400508:D25G;ENSP00000385604:D32G;ENSP00000412219:D32G;ENSP00000379486:D32G;ENSP00000344456:D32G;ENSP00000411226:D25G;ENSP00000379488:D32G;ENSP00000409302:D32G;ENSP00000401599:D32G	ENSP00000344456:D32G	D	+	2	0	CTNNB1	41241102	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.339000	0.96797	2.201000	0.70794	0.533000	0.62120	GAC	.		0.483	CTNNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254182.2	NM_001098210	
CPB1	1360	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	148552327	148552327	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A5SL-01A-11D-A27I-10	TCGA-G3-A5SL-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70422e6d-cb1f-4284-8be9-1d4517ffad60	a38d4467-c3e5-4639-ad4f-88bcd7ab9f26	g.chr3:148552327C>A	ENST00000491148.1	+	4	524	c.190C>A	c.(190-192)Cac>Aac	p.H64N	CPB1_ENST00000282957.4_Missense_Mutation_p.H64N			P15086	CBPB1_HUMAN	carboxypeptidase B1 (tissue)	64						extracellular region (GO:0005576)	carboxypeptidase activity (GO:0004180)|metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(15)|ovary(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	38			LUSC - Lung squamous cell carcinoma(72;0.0934)|Lung(72;0.115)			AATCAAACCTCACAGTACAGT	0.348																																					p.H64N		.											.	CPB1	92	0			c.C190A						.						110.0	103.0	105.0					3																	148552327		2203	4300	6503	SO:0001583	missense	1360	exon3			AAACCTCACAGTA	AJ224866	CCDS33874.1	3q24	2012-02-10			ENSG00000153002	ENSG00000153002	3.4.17.2		2299	protein-coding gene	gene with protein product	"""pancreatic carboxypeptidase B"", ""tissue carboxypeptidase B"", ""protaminase"""	114852					Standard	XM_005247124		Approved		uc003ewl.3	P15086	OTTHUMG00000159520	ENST00000491148.1:c.190C>A	3.37:g.148552327C>A	ENSP00000417222:p.His64Asn	191.0	0.0		190.0	89.0	NM_001871	O60834|Q53XJ0|Q96BQ8	Missense_Mutation	SNP	ENST00000491148.1	37	CCDS33874.1	.	.	.	.	.	.	.	.	.	.	C	0.928	-0.713536	0.03206	.	.	ENSG00000153002	ENST00000491148;ENST00000462345;ENST00000282957;ENST00000468341	T;T;T;T	0.11930	2.73;2.73;2.73;2.73	5.03	4.13	0.48395	Proteinase inhibitor, propeptide (1);Proteinase inhibitor, carboxypeptidase propeptide (2);	0.398596	0.29846	N	0.011044	T	0.05960	0.0155	N	0.13098	0.295	0.27374	N	0.955609	B	0.02656	0.0	B	0.04013	0.001	T	0.40001	-0.9586	10	0.05620	T	0.96	.	7.1853	0.25797	0.163:0.5278:0.3092:0.0	.	64	P15086	CBPB1_HUMAN	N	64	ENSP00000417222:H64N;ENSP00000417117:H64N;ENSP00000282957:H64N;ENSP00000419427:H64N	ENSP00000282957:H64N	H	+	1	0	CPB1	150035017	0.983000	0.35010	0.828000	0.32881	0.517000	0.34286	2.134000	0.42102	2.319000	0.78375	0.471000	0.43371	CAC	.		0.348	CPB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355928.1	NM_001871	
CYP11B2	1585	broad.mit.edu;bcgsc.ca;mdanderson.org	37	8	143996507	143996507	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A5SL-01A-11D-A27I-10	TCGA-G3-A5SL-10A-01D-A27I-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70422e6d-cb1f-4284-8be9-1d4517ffad60	a38d4467-c3e5-4639-ad4f-88bcd7ab9f26	g.chr8:143996507G>T	ENST00000323110.2	-	3	552	c.550C>A	c.(550-552)Ctg>Atg	p.L184M		NM_000498.3	NP_000489.3	P19099	C11B2_HUMAN	cytochrome P450, family 11, subfamily B, polypeptide 2	184					aldosterone biosynthetic process (GO:0032342)|C21-steroid hormone biosynthetic process (GO:0006700)|cellular response to hormone stimulus (GO:0032870)|cellular response to potassium ion (GO:0035865)|cortisol biosynthetic process (GO:0034651)|mineralocorticoid biosynthetic process (GO:0006705)|potassium ion homeostasis (GO:0055075)|regulation of blood volume by renal aldosterone (GO:0002017)|renal water homeostasis (GO:0003091)|small molecule metabolic process (GO:0044281)|sodium ion homeostasis (GO:0055078)|steroid metabolic process (GO:0008202)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	corticosterone 18-monooxygenase activity (GO:0047783)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|steroid 11-beta-monooxygenase activity (GO:0004507)			cervix(1)|endometrium(2)|kidney(3)|large_intestine(5)|lung(22)|ovary(3)|upper_aerodigestive_tract(3)	39	all_cancers(97;5.56e-11)|all_epithelial(106;2.49e-08)|Lung NSC(106;0.000228)|all_lung(105;0.000633)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)				Eplerenone(DB00700)|Etomidate(DB00292)|Hydrocortisone(DB00741)|Metoclopramide(DB01233)|Metyrapone(DB01011)|Spironolactone(DB00421)	TCCAGGGTCAGGCTCCCCCGG	0.647									Familial Hyperaldosteronism type I																												p.L184M		.											.	CYP11B2	90	0			c.C550A						.						47.0	45.0	46.0					8																	143996507		2203	4296	6499	SO:0001583	missense	1585	exon3	Familial Cancer Database	Dexamethasone Sensitive Aldosteronism, FH-I	GGGTCAGGCTCCC	X54741	CCDS6393.1	8q21-q22	2013-06-19	2003-01-14		ENSG00000179142	ENSG00000179142	1.14.15.4	"""Cytochrome P450s"""	2592	protein-coding gene	gene with protein product	"""steroid 11-beta-monooxygenase"""	124080	"""cytochrome P450, subfamily XIB (steroid 11-beta-hydroxylase), polypeptide 2"""	CYP11B		1303253	Standard	NM_000498		Approved	CYP11BL, CPN2, P-450C18, P450aldo, ALDOS	uc003yxk.1	P19099	OTTHUMG00000160254	ENST00000323110.2:c.550C>A	8.37:g.143996507G>T	ENSP00000325822:p.Leu184Met	284.0	1.0		531.0	56.0	NM_000498	B0ZBE4|Q16726	Missense_Mutation	SNP	ENST00000323110.2	37	CCDS6393.1	.	.	.	.	.	.	.	.	.	.	.	6.937	0.542629	0.13250	.	.	ENSG00000179142	ENST00000323110	T	0.74947	-0.89	3.44	1.61	0.23674	.	0.348836	0.20837	N	0.084771	T	0.72145	0.3424	M	0.69523	2.12	0.36768	D	0.883634	B	0.24043	0.096	B	0.34536	0.185	T	0.67979	-0.5530	10	0.35671	T	0.21	.	8.7961	0.34881	0.1022:0.1599:0.738:0.0	.	184	P19099	C11B2_HUMAN	M	184	ENSP00000325822:L184M	ENSP00000325822:L184M	L	-	1	2	CYP11B2	143993509	0.995000	0.38212	0.797000	0.32132	0.191000	0.23601	3.141000	0.50593	0.269000	0.21961	-1.268000	0.01426	CTG	.		0.647	CYP11B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359904.1		
CYP8B1	1582	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	42916920	42916920	+	Missense_Mutation	SNP	T	T	A			TCGA-G3-A5SL-01A-11D-A27I-10	TCGA-G3-A5SL-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70422e6d-cb1f-4284-8be9-1d4517ffad60	a38d4467-c3e5-4639-ad4f-88bcd7ab9f26	g.chr3:42916920T>A	ENST00000316161.4	-	1	713	c.389A>T	c.(388-390)cAt>cTt	p.H130L	KRBOX1_ENST00000426937.1_Intron|CYP8B1_ENST00000437102.1_Missense_Mutation_p.H130L|RP11-141M3.5_ENST00000471537.1_RNA	NM_004391.2	NP_004382.2	Q9UNU6	CP8B1_HUMAN	cytochrome P450, family 8, subfamily B, polypeptide 1	130					bile acid biosynthetic process (GO:0006699)|bile acid metabolic process (GO:0008206)|lipid metabolic process (GO:0006629)|small molecule metabolic process (GO:0044281)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	7alpha-hydroxycholest-4-en-3-one 12alpha-hydroxylase activity (GO:0033778)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxygen binding (GO:0019825)|sterol 12-alpha-hydroxylase activity (GO:0008397)			NS(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(5)|ovary(2)|prostate(2)|skin(5)	23				KIRC - Kidney renal clear cell carcinoma(284;0.213)|Kidney(284;0.249)		CCCCCTCAGATGCTTGGTGCT	0.498																																					p.H130L		.											.	CYP8B1	92	0			c.A389T						.						118.0	110.0	112.0					3																	42916920		2203	4300	6503	SO:0001583	missense	1582	exon1			CTCAGATGCTTGG	AF090318	CCDS2707.1	3p22.1	2004-02-27	2003-01-14		ENSG00000180432	ENSG00000180432		"""Cytochrome P450s"""	2653	protein-coding gene	gene with protein product		602172	"""cytochrome P450, subfamily VIIIB (sterol 12-alpha-hydroxylase), polypeptide 1"""			10051404	Standard	NM_004391		Approved	CYP12	uc003cmh.3	Q9UNU6	OTTHUMG00000133047	ENST00000316161.4:c.389A>T	3.37:g.42916920T>A	ENSP00000318867:p.His130Leu	158.0	0.0		133.0	39.0	NM_004391	B2RCY3|O75958|Q6NWT2|Q6NWT3	Missense_Mutation	SNP	ENST00000316161.4	37	CCDS2707.1	.	.	.	.	.	.	.	.	.	.	T	12.01	1.809007	0.31961	.	.	ENSG00000180432	ENST00000437102;ENST00000316161	T;T	0.68025	-0.3;-0.3	5.57	4.38	0.52667	.	0.303187	0.34245	N	0.004136	T	0.62134	0.2403	L	0.35341	1.055	0.23346	N	0.997864	P;P	0.46142	0.873;0.787	P;P	0.54431	0.752;0.672	T	0.51834	-0.8655	10	0.08837	T	0.75	-0.7324	9.4875	0.38940	0.2818:0.0:0.0:0.7182	.	130;130	C9JFR9;Q9UNU6	.;CP8B1_HUMAN	L	130	ENSP00000404499:H130L;ENSP00000318867:H130L	ENSP00000318867:H130L	H	-	2	0	CYP8B1	42891924	0.991000	0.36638	0.035000	0.18076	0.013000	0.08279	3.800000	0.55537	0.911000	0.36747	0.459000	0.35465	CAT	.		0.498	CYP8B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256653.1	NM_004391	
DDX42	11325	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	17	61864631	61864631	+	Splice_Site	DEL	G	G	-			TCGA-G3-A5SL-01A-11D-A27I-10	TCGA-G3-A5SL-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70422e6d-cb1f-4284-8be9-1d4517ffad60	a38d4467-c3e5-4639-ad4f-88bcd7ab9f26	g.chr17:61864631delG	ENST00000578681.1	+	3	822		c.e3+1		DDX42_ENST00000359353.5_Intron|DDX42_ENST00000583590.1_Splice_Site|DDX42_ENST00000457800.2_Splice_Site|DDX42_ENST00000389924.2_Splice_Site	NM_007372.2	NP_031398.2	Q86XP3	DDX42_HUMAN	DEAD (Asp-Glu-Ala-Asp) box helicase 42						protein localization (GO:0008104)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|central_nervous_system(1)|cervix(2)|endometrium(12)|kidney(3)|large_intestine(6)|lung(12)|ovary(2)|prostate(2)|skin(3)	46						AAGAAAATGCGTAAGTGGTAA	0.378																																					.		.											.	DDX42	230	0			c.221+1G>-						.						60.0	62.0	61.0					17																	61864631		2203	4300	6503	SO:0001630	splice_region_variant	11325	exon2			AAATGCGTAAGTG	BC015505	CCDS32704.1	17q23	2014-02-14	2013-05-13			ENSG00000198231		"""DEAD-boxes"""	18676	protein-coding gene	gene with protein product	"""splicing factor 3b, subunit 8"""	613369	"""DEAD (Asp-Glu-Ala-Asp) box polypeptide 42"""			10727850, 16397294	Standard	NM_007372		Approved	RNAHP, RHELP, SF3b125, SF3B8	uc002jbv.3	Q86XP3		ENST00000578681.1:c.221+1G>-	17.37:g.61864631delG		117.0	0.0		95.0	25.0	NM_203499	A6NML1|A8KA43|O75619|Q68G51|Q96BK1|Q96HR7|Q9Y3V8	Splice_Site	DEL	ENST00000578681.1	37	CCDS32704.1																																																																																			.		0.378	DDX42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444368.1	NM_007372	Intron
DNAAF1	123872	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	16	84209627	84209627	+	Frame_Shift_Del	DEL	A	A	-			TCGA-G3-A5SL-01A-11D-A27I-10	TCGA-G3-A5SL-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70422e6d-cb1f-4284-8be9-1d4517ffad60	a38d4467-c3e5-4639-ad4f-88bcd7ab9f26	g.chr16:84209627delA	ENST00000378553.5	+	11	1911	c.1787delA	c.(1786-1788)gaafs	p.E596fs	DNAAF1_ENST00000563818.1_3'UTR	NM_178452.4	NP_848547.4	Q8NEP3	DAAF1_HUMAN	dynein, axonemal, assembly factor 1	596					axonemal dynein complex assembly (GO:0070286)|cilium morphogenesis (GO:0060271)|cilium movement (GO:0003341)|determination of digestive tract left/right asymmetry (GO:0071907)|determination of liver left/right asymmetry (GO:0071910)|determination of pancreatic left/right asymmetry (GO:0035469)|epithelial cilium movement involved in determination of left/right asymmetry (GO:0060287)|heart looping (GO:0001947)|inner dynein arm assembly (GO:0036159)|left/right pattern formation (GO:0060972)|lung development (GO:0030324)|motile cilium assembly (GO:0044458)|outer dynein arm assembly (GO:0036158)|regulation of cilium beat frequency (GO:0003356)	axoneme (GO:0005930)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	dynein binding (GO:0045502)			NS(1)|endometrium(7)|kidney(1)|large_intestine(6)|lung(15)|ovary(4)|pancreas(1)|prostate(1)|stomach(4)|urinary_tract(1)	41						CCTGTGCTGGAAAACCTCCCC	0.458											OREG0023983	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.E596fs		.											.	DNAAF1	73	0			c.1787delA						.						83.0	75.0	77.0					16																	84209627		2200	4300	6500	SO:0001589	frameshift_variant	123872	exon11			TGCTGGAAAACCT	BC024009	CCDS10943.2	16q24.1	2012-05-03	2011-06-09	2011-06-09	ENSG00000154099	ENSG00000154099			30539	protein-coding gene	gene with protein product	"""outer row dynein assembly 7 homolog (Chlamydomonas)"""	613190	"""leucine rich repeat containing 50"""	LRRC50		19944405	Standard	NM_178452		Approved	FLJ25330, ODA7, CILD13	uc002fhl.4	Q8NEP3	OTTHUMG00000128517	ENST00000378553.5:c.1787delA	16.37:g.84209627delA	ENSP00000367815:p.Glu596fs	195.0	0.0	1227	101.0	33.0	NM_178452	B4DJA3|Q69YI8|Q69YJ0|Q69YW5|Q96LP3|Q96MB6	Frame_Shift_Del	DEL	ENST00000378553.5	37	CCDS10943.2																																																																																			.		0.458	DNAAF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250328.3	NM_178452	
DNAH11	8701	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	21784074	21784074	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A5SL-01A-11D-A27I-10	TCGA-G3-A5SL-10A-01D-A27I-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70422e6d-cb1f-4284-8be9-1d4517ffad60	a38d4467-c3e5-4639-ad4f-88bcd7ab9f26	g.chr7:21784074C>T	ENST00000409508.3	+	50	8204	c.8173C>T	c.(8173-8175)Cct>Tct	p.P2725S	DNAH11_ENST00000328843.6_Missense_Mutation_p.P2732S	NM_001277115.1	NP_001264044.1	Q96DT5	DYH11_HUMAN	dynein, axonemal, heavy chain 11	2732	AAA 3. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(1)|autonomic_ganglia(1)|breast(13)|central_nervous_system(3)|cervix(4)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(50)|lung(101)|ovary(10)|pancreas(4)|prostate(7)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	230						ATTTGCTTCTCCTGAGTGTTT	0.348									Kartagener syndrome																												.		.											.	DNAH11	146	0			.						.						247.0	237.0	240.0					7																	21784074		1834	4087	5921	SO:0001583	missense	8701	.	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	GCTTCTCCTGAGT	U83569	CCDS64602.1	7p21	2008-07-18	2006-09-04					"""Axonemal dyneins"""	2942	protein-coding gene	gene with protein product	"""dynein, ciliary, heavy chain 11"", ""dynein, heavy chain beta-like"""	603339	"""dynein, axonemal, heavy polypeptide 11"""			9256245	Standard	NM_001277115		Approved	Dnahc11, DPL11, CILD7, DNAHC11, DNAHBL, DNHBL	uc031swp.1	Q96DT5		ENST00000409508.3:c.8173C>T	7.37:g.21784074C>T	ENSP00000475939:p.Pro2725Ser	77.0	0.0		77.0	15.0	.	Q9UJ82	Missense_Mutation	SNP	ENST00000409508.3	37		.	.	.	.	.	.	.	.	.	.	C	11.78	1.741469	0.30865	.	.	ENSG00000105877	ENST00000328843	T	0.34859	1.34	5.91	5.91	0.95273	.	0.000000	0.85682	D	0.000000	T	0.28001	0.0690	.	.	.	0.49798	D	0.999823	P	0.38300	0.626	B	0.39876	0.312	T	0.03433	-1.1037	9	0.13108	T	0.6	.	13.4829	0.61348	0.0:0.9291:0.0:0.0708	.	2732	Q96DT5	DYH11_HUMAN	S	2732	ENSP00000330671:P2732S	ENSP00000330671:P2732S	P	+	1	0	DNAH11	21750599	0.989000	0.36119	1.000000	0.80357	0.838000	0.47535	2.129000	0.42055	2.793000	0.96121	0.655000	0.94253	CCT	.		0.348	DNAH11-001	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000326582.6	NM_003777	
DSCAML1	57453	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	117321317	117321317	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A5SL-01A-11D-A27I-10	TCGA-G3-A5SL-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70422e6d-cb1f-4284-8be9-1d4517ffad60	a38d4467-c3e5-4639-ad4f-88bcd7ab9f26	g.chr11:117321317C>T	ENST00000321322.6	-	20	3837	c.3836G>A	c.(3835-3837)gGg>gAg	p.G1279E	DSCAML1_ENST00000527706.1_Missense_Mutation_p.G1009E	NM_020693.2	NP_065744.2	Q8TD84	DSCL1_HUMAN	Down syndrome cell adhesion molecule like 1	1219	Fibronectin type-III 4. {ECO:0000255|PROSITE-ProRule:PRU00316}.|Ig-like C2-type 10.				axonogenesis (GO:0007409)|brain development (GO:0007420)|cell fate determination (GO:0001709)|central nervous system development (GO:0007417)|dendrite self-avoidance (GO:0070593)|dorsal/ventral pattern formation (GO:0009953)|embryonic skeletal system morphogenesis (GO:0048704)|homophilic cell adhesion (GO:0007156)|negative regulation of cell adhesion (GO:0007162)	cell surface (GO:0009986)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein homodimerization activity (GO:0042803)			breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(24)|lung(49)|ovary(6)|pancreas(1)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	110	all_hematologic(175;0.0487)	Breast(348;0.0424)|Medulloblastoma(222;0.0523)|all_hematologic(192;0.232)		BRCA - Breast invasive adenocarcinoma(274;9.12e-06)|Epithelial(105;0.00172)		GCGGATCACCCCGTTGGGCTT	0.567																																					p.G1279E		.											.	DSCAML1	159	0			c.G3836A						.						61.0	57.0	58.0					11																	117321317		2201	4296	6497	SO:0001583	missense	57453	exon20			ATCACCCCGTTGG		CCDS8384.1	11q22.2-q22.3	2013-02-11			ENSG00000177103	ENSG00000177103		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	14656	protein-coding gene	gene with protein product		611782				11453658	Standard	NM_020693		Approved	KIAA1132	uc001prh.1	Q8TD84	OTTHUMG00000167071	ENST00000321322.6:c.3836G>A	11.37:g.117321317C>T	ENSP00000315465:p.Gly1279Glu	69.0	0.0		47.0	9.0	NM_020693	Q76MU9|Q8IZY3|Q8IZY4|Q8WXU7|Q9ULT7	Missense_Mutation	SNP	ENST00000321322.6	37	CCDS8384.1	.	.	.	.	.	.	.	.	.	.	C	27.1	4.802243	0.90538	.	.	ENSG00000177103	ENST00000527706;ENST00000321322;ENST00000446508	T;T	0.64991	-0.13;-0.13	4.42	4.42	0.53409	Fibronectin, type III (4);Immunoglobulin-like fold (1);	.	.	.	.	D	0.84745	0.5540	H	0.94462	3.54	0.80722	D	1	D	0.67145	0.996	D	0.72625	0.978	D	0.89180	0.3543	9	0.87932	D	0	.	18.3455	0.90321	0.0:1.0:0.0:0.0	.	1219	Q8TD84	DSCL1_HUMAN	E	1009;1279;986	ENSP00000434335:G1009E;ENSP00000315465:G1279E	ENSP00000315465:G1279E	G	-	2	0	DSCAML1	116826527	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.643000	0.83403	2.741000	0.93983	0.585000	0.79938	GGG	.		0.567	DSCAML1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392907.2	NM_020693	
DUSP22	56940	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	6	348175	348175	+	Missense_Mutation	SNP	G	G	C			TCGA-G3-A5SL-01A-11D-A27I-10	TCGA-G3-A5SL-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70422e6d-cb1f-4284-8be9-1d4517ffad60	a38d4467-c3e5-4639-ad4f-88bcd7ab9f26	g.chr6:348175G>C	ENST00000344450.5	+	6	779	c.336G>C	c.(334-336)gaG>gaC	p.E112D	DUSP22_ENST00000604971.1_Missense_Mutation_p.E9D|DUSP22_ENST00000605863.1_Missense_Mutation_p.E9D|DUSP22_ENST00000605315.1_Missense_Mutation_p.E9D|DUSP22_ENST00000605035.1_Missense_Mutation_p.E9D|DUSP22_ENST00000603453.1_Missense_Mutation_p.E9D|DUSP22_ENST00000419235.2_Missense_Mutation_p.E112D	NM_020185.3	NP_064570.1	Q9NRW4	DUS22_HUMAN	dual specificity phosphatase 22	112	Tyrosine-protein phosphatase.				apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|inactivation of MAPK activity (GO:0000188)|multicellular organismal development (GO:0007275)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of JNK cascade (GO:0046330)|protein dephosphorylation (GO:0006470)|regulation of cell proliferation (GO:0042127)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(16)|ovary(1)|skin(2)	26	all_hematologic(77;0.228)	Breast(5;0.0249)|all_hematologic(90;0.0489)		OV - Ovarian serous cystadenocarcinoma(45;0.0277)|BRCA - Breast invasive adenocarcinoma(62;0.0669)		TTGGCTGGGAGGATGCCCTGC	0.602																																					p.E112D		.											.	DUSP22	252	0			c.G336C						.						179.0	162.0	168.0					6																	348175		2203	4300	6503	SO:0001583	missense	56940	exon6			CTGGGAGGATGCC	AF165519	CCDS4468.1, CCDS69035.1	6p25.3	2013-09-19			ENSG00000112679	ENSG00000112679		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Atypical dual specificity phosphatases"""	16077	protein-coding gene	gene with protein product						9205128, 11717427	Standard	NM_001286555		Approved	MKPX, JSP1, JKAP, VHX	uc003msx.3	Q9NRW4	OTTHUMG00000014113	ENST00000344450.5:c.336G>C	6.37:g.348175G>C	ENSP00000345281:p.Glu112Asp	305.0	0.0		273.0	15.0	NM_020185	B4DK56|Q59GW2|Q5VWR2|Q96AR1	Missense_Mutation	SNP	ENST00000344450.5	37	CCDS4468.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	17.01|17.01	3.280523|3.280523	0.59758|0.59758	.|.	.|.	ENSG00000112679|ENSG00000112679	ENST00000344450|ENST00000419235	D|.	0.85702|.	-2.02|.	5.82|5.82	-2.83|-2.83	0.05769|0.05769	Dual specificity phosphatase, catalytic domain (1);Protein-tyrosine/Dual-specificity phosphatase (1);Dual specificity phosphatase, subgroup, catalytic domain (2);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.25901|0.25901	0.0631|0.0631	N|N	0.16862|0.16862	0.45|0.45	0.50171|0.50171	D|D	0.999852|0.999852	B;B;B|.	0.13145|.	0.003;0.007;0.004|.	B;B;B|.	0.19391|.	0.009;0.025;0.008|.	T|T	0.15492|0.15492	-1.0435|-1.0435	10|5	0.30078|.	T|.	0.28|.	.|.	13.5495|13.5495	0.61723|0.61723	0.4799:0.0:0.5201:0.0|0.4799:0.0:0.5201:0.0	.|.	112;69;112|.	Q9NRW4-2;B3KSA8;Q9NRW4|.	.;.;DUS22_HUMAN|.	D|R	112|50	ENSP00000345281:E112D|.	ENSP00000345281:E112D|.	E|G	+|+	3|1	2|0	DUSP22|DUSP22	293175|293175	0.996000|0.996000	0.38824|0.38824	0.835000|0.835000	0.33067|0.33067	0.983000|0.983000	0.72400|0.72400	0.436000|0.436000	0.21526|0.21526	-0.521000|-0.521000	0.06426|0.06426	0.655000|0.655000	0.94253|0.94253	GAG|GGA	.		0.602	DUSP22-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000039621.1	NM_020185	
EDNRA	1909	ucsc.edu;bcgsc.ca	37	4	148407017	148407017	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A5SL-01A-11D-A27I-10	TCGA-G3-A5SL-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	70422e6d-cb1f-4284-8be9-1d4517ffad60	a38d4467-c3e5-4639-ad4f-88bcd7ab9f26	g.chr4:148407017A>G	ENST00000324300.5	+	2	699	c.184A>G	c.(184-186)Aat>Gat	p.N62D	EDNRA_ENST00000339690.5_Missense_Mutation_p.N62D|EDNRA_ENST00000358556.4_Missense_Mutation_p.N62D|EDNRA_ENST00000506066.1_Missense_Mutation_p.N62D|EDNRA_ENST00000511804.1_Intron	NM_001957.3	NP_001948.1	P25101	EDNRA_HUMAN	endothelin receptor type A	62					activation of adenylate cyclase activity (GO:0007190)|activation of phospholipase C activity (GO:0007202)|aging (GO:0007568)|artery smooth muscle contraction (GO:0014824)|cell proliferation (GO:0008283)|cellular response to mechanical stimulus (GO:0071260)|endothelin receptor signaling pathway (GO:0086100)|enteric nervous system development (GO:0048484)|fibroblast proliferation (GO:0048144)|G-protein coupled receptor signaling pathway (GO:0007186)|glomerular filtration (GO:0003094)|glucose transport (GO:0015758)|head development (GO:0060322)|heart development (GO:0007507)|histamine secretion (GO:0001821)|in utero embryonic development (GO:0001701)|maternal process involved in parturition (GO:0060137)|metabolic process (GO:0008152)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cAMP biosynthetic process (GO:0030818)|neural crest cell development (GO:0014032)|patterning of blood vessels (GO:0001569)|penile erection (GO:0043084)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of inflammatory response (GO:0050729)|positive regulation of kidney development (GO:0090184)|positive regulation of neutrophil chemotaxis (GO:0090023)|positive regulation of odontogenesis (GO:0042482)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of blood pressure (GO:0008217)|regulation of epithelial cell proliferation (GO:0050678)|respiratory gaseous exchange (GO:0007585)|response to hypoxia (GO:0001666)|response to lipopolysaccharide (GO:0032496)|response to morphine (GO:0043278)|Rho protein signal transduction (GO:0007266)|sensory perception of pain (GO:0019233)|signal transduction (GO:0007165)|smooth muscle cell proliferation (GO:0048659)|smooth muscle contraction (GO:0006939)|vasoconstriction (GO:0042310)	integral component of plasma membrane (GO:0005887)|nuclear membrane (GO:0031965)|plasma membrane (GO:0005886)|T-tubule (GO:0030315)	endothelin receptor activity (GO:0004962)|phosphatidylinositol phospholipase C activity (GO:0004435)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|large_intestine(4)|lung(3)|ovary(1)	17	all_hematologic(180;0.151)			GBM - Glioblastoma multiforme(119;0.154)	Acetylsalicylic acid(DB00945)|Bosentan(DB00559)|MACITENTAN(DB08932)|Sitaxentan(DB06268)	CCTACCCAGCAATGGCTCAAT	0.408																																					p.N62D		.											.	EDNRA	586	0			c.A184G						.						145.0	128.0	134.0					4																	148407017		2203	4300	6503	SO:0001583	missense	1909	exon2			CCCAGCAATGGCT	D90348	CCDS3769.1, CCDS54810.1, CCDS58927.1	4q31.22	2013-09-20			ENSG00000151617	ENSG00000151617		"""GPCR / Class A : Endothelin receptors"""	3179	protein-coding gene	gene with protein product		131243				1659806	Standard	NM_001957		Approved		uc003iky.3	P25101	OTTHUMG00000161354	ENST00000324300.5:c.184A>G	4.37:g.148407017A>G	ENSP00000315011:p.Asn62Asp	259.0	2.0		289.0	121.0	NM_001166055	B2R723|B4E2V6|B7Z9G6|D3DP03|E7ER36|O43441|Q16432|Q16433|Q8TBH2	Missense_Mutation	SNP	ENST00000324300.5	37	CCDS3769.1	.	.	.	.	.	.	.	.	.	.	A	15.12	2.740511	0.49045	.	.	ENSG00000151617	ENST00000358556;ENST00000339690;ENST00000394047;ENST00000324300;ENST00000506066	T;T;T;T	0.63417	-0.04;-0.04;-0.04;-0.04	5.82	5.82	0.92795	.	0.301827	0.35838	N	0.002942	T	0.62011	0.2393	L	0.43152	1.355	0.37656	D	0.922586	B;D;B	0.56521	0.341;0.976;0.018	B;P;B	0.53266	0.107;0.722;0.013	T	0.61652	-0.7019	10	0.15952	T	0.53	-21.988	11.9077	0.52721	0.8623:0.0:0.0:0.1376	.	62;62;62	P25101-4;P25101-2;P25101	.;.;EDNRA_HUMAN	D	62	ENSP00000351359:N62D;ENSP00000341556:N62D;ENSP00000315011:N62D;ENSP00000425281:N62D	ENSP00000315011:N62D	N	+	1	0	EDNRA	148626467	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.318000	0.51975	2.222000	0.72286	0.533000	0.62120	AAT	.		0.408	EDNRA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364635.1		
EPAS1	2034	broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	46611722	46611722	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A5SL-01A-11D-A27I-10	TCGA-G3-A5SL-10A-01D-A27I-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70422e6d-cb1f-4284-8be9-1d4517ffad60	a38d4467-c3e5-4639-ad4f-88bcd7ab9f26	g.chr2:46611722G>T	ENST00000263734.3	+	16	3046	c.2536G>T	c.(2536-2538)Gtg>Ttg	p.V846L		NM_001430.4	NP_001421.2	Q99814	EPAS1_HUMAN	endothelial PAS domain protein 1	846	CTAD.				angiogenesis (GO:0001525)|blood vessel remodeling (GO:0001974)|cell maturation (GO:0048469)|cellular response to hypoxia (GO:0071456)|embryonic placenta development (GO:0001892)|erythrocyte differentiation (GO:0030218)|lung development (GO:0030324)|mitochondrion organization (GO:0007005)|myoblast fate commitment (GO:0048625)|norepinephrine metabolic process (GO:0042415)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of heart rate (GO:0002027)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription from RNA polymerase II promoter in response to oxidative stress (GO:0043619)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|surfactant homeostasis (GO:0043129)|transcription from RNA polymerase II promoter (GO:0006366)|visual perception (GO:0007601)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|histone acetyltransferase binding (GO:0035035)|protein heterodimerization activity (GO:0046982)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|signal transducer activity (GO:0004871)|transcription factor binding (GO:0008134)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(2)|lung(11)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	39		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.18)	LUSC - Lung squamous cell carcinoma(58;0.151)			TGACTGTGAGGTGAACGTGCC	0.612																																					p.V846L		.											.	EPAS1	227	0			c.G2536T						.						73.0	72.0	72.0					2																	46611722		2203	4300	6503	SO:0001583	missense	2034	exon16			TGTGAGGTGAACG	U81984	CCDS1825.1	2p21-p16	2013-05-21			ENSG00000116016	ENSG00000116016		"""Basic helix-loop-helix proteins"""	3374	protein-coding gene	gene with protein product	"""HIF-1 alpha-like factor"""	603349				9000051, 9079689, 18378852	Standard	NM_001430		Approved	MOP2, PASD2, HIF2A, HLF, bHLHe73	uc002ruv.3	Q99814	OTTHUMG00000128818	ENST00000263734.3:c.2536G>T	2.37:g.46611722G>T	ENSP00000263734:p.Val846Leu	131.0	2.0		78.0	25.0	NM_001430	Q86VA2|Q99630	Missense_Mutation	SNP	ENST00000263734.3	37	CCDS1825.1	.	.	.	.	.	.	.	.	.	.	G	33	5.253883	0.95336	.	.	ENSG00000116016	ENST00000263734	T	0.76839	-1.05	5.0	5.0	0.66597	HIF-1 alpha, transactivation domain, C-terminal (1);	0.929997	0.08950	N	0.870221	D	0.89375	0.6697	M	0.75264	2.295	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.86422	0.1755	10	0.87932	D	0	.	18.6557	0.91453	0.0:0.0:1.0:0.0	.	846	Q99814	EPAS1_HUMAN	L	846	ENSP00000263734:V846L	ENSP00000263734:V846L	V	+	1	0	EPAS1	46465226	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.804000	0.99143	2.440000	0.82611	0.655000	0.94253	GTG	.		0.612	EPAS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250752.2	NM_001430	
EPHA5	2044	broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	66280067	66280067	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A5SL-01A-11D-A27I-10	TCGA-G3-A5SL-10A-01D-A27I-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70422e6d-cb1f-4284-8be9-1d4517ffad60	a38d4467-c3e5-4639-ad4f-88bcd7ab9f26	g.chr4:66280067C>T	ENST00000273854.3	-	7	2222	c.1622G>A	c.(1621-1623)cGa>cAa	p.R541Q	EPHA5_ENST00000511294.1_Missense_Mutation_p.R541Q|EPHA5_ENST00000432638.2_Missense_Mutation_p.R377Q|EPHA5_ENST00000354839.4_Missense_Mutation_p.R541Q	NM_001281765.1|NM_004439.5	NP_001268694.1|NP_004430.4	P54756	EPHA5_HUMAN	EPH receptor A5	541	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axon guidance (GO:0007411)|cAMP-mediated signaling (GO:0019933)|ephrin receptor signaling pathway (GO:0048013)|hippocampus development (GO:0021766)|negative regulation of synapse assembly (GO:0051964)|neuron development (GO:0048666)|positive regulation of CREB transcription factor activity (GO:0032793)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|regulation of Rac GTPase activity (GO:0032314)	dendrite (GO:0030425)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|rough endoplasmic reticulum (GO:0005791)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)|GPI-linked ephrin receptor activity (GO:0005004)|transmembrane-ephrin receptor activity (GO:0005005)			autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(25)|liver(1)|lung(76)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	142						TGTACGTGCTCGAATTTGGAA	0.433										TSP Lung(17;0.13)																											p.R541Q		.											.	EPHA5	1430	0			c.G1622A						.						191.0	154.0	167.0					4																	66280067		2203	4300	6503	SO:0001583	missense	2044	exon7			CGTGCTCGAATTT	L36644	CCDS3513.1, CCDS3514.1, CCDS75131.1, CCDS75132.1, CCDS75133.1	4q13.1	2013-02-11	2004-10-28		ENSG00000145242	ENSG00000145242		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3389	protein-coding gene	gene with protein product		600004	"""EphA5"""			9267020, 7528718	Standard	NM_004439		Approved	Hek7, TYRO4, CEK7, EHK1	uc003hcy.3	P54756	OTTHUMG00000129273	ENST00000273854.3:c.1622G>A	4.37:g.66280067C>T	ENSP00000273854:p.Arg541Gln	96.0	1.0		140.0	54.0	NM_004439	Q7Z3F2	Missense_Mutation	SNP	ENST00000273854.3	37	CCDS3513.1	.	.	.	.	.	.	.	.	.	.	C	27.9	4.874646	0.91664	.	.	ENSG00000145242	ENST00000273854;ENST00000432638;ENST00000354839;ENST00000511294	T;T;T;T	0.55588	0.51;0.51;0.51;0.51	6.17	6.17	0.99709	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.49305	D	0.000144	T	0.73992	0.3658	M	0.71871	2.18	0.47698	D	0.999494	D;D;D;D	0.89917	1.0;0.999;1.0;1.0	D;D;D;D	0.91635	0.999;0.981;0.999;0.999	T	0.70278	-0.4916	10	0.45353	T	0.12	.	20.8794	0.99867	0.0:1.0:0.0:0.0	.	541;541;541;541	B7ZKW7;B7ZKJ3;P54756-2;P54756	.;.;.;EPHA5_HUMAN	Q	541;377;541;541	ENSP00000273854:R541Q;ENSP00000389208:R377Q;ENSP00000346899:R541Q;ENSP00000427638:R541Q	ENSP00000273854:R541Q	R	-	2	0	EPHA5	65962662	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.049000	0.71053	2.941000	0.99782	0.655000	0.94253	CGA	.		0.433	EPHA5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251388.2	NM_004439	
BRINP2	57795	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	177245347	177245347	+	Silent	SNP	G	G	A			TCGA-G3-A5SL-01A-11D-A27I-10	TCGA-G3-A5SL-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70422e6d-cb1f-4284-8be9-1d4517ffad60	a38d4467-c3e5-4639-ad4f-88bcd7ab9f26	g.chr1:177245347G>A	ENST00000361539.4	+	6	1101	c.789G>A	c.(787-789)ctG>ctA	p.L263L	BRINP2_ENST00000478325.1_3'UTR	NM_021165.2	NP_066988.1	Q9C0B6	BRNP2_HUMAN	bone morphogenetic protein/retinoic acid inducible neural-specific 2	263	MACPF.				cell cycle arrest (GO:0007050)|cellular response to retinoic acid (GO:0071300)|negative regulation of mitotic cell cycle (GO:0045930)|positive regulation of neuron differentiation (GO:0045666)	extracellular region (GO:0005576)											TTCAGGTGCTGCTGCCTGAGT	0.557																																					p.L263L		.											.	FAM5B	28	0			c.G789A						.						64.0	62.0	63.0					1																	177245347		2203	4300	6503	SO:0001819	synonymous_variant	57795	exon6			GGTGCTGCTGCCT		CCDS1320.1	1q24	2013-08-06	2013-08-06	2013-07-31	ENSG00000198797	ENSG00000198797			13746	protein-coding gene	gene with protein product			"""family with sequence similarity 5, member B"""	FAM5B		15193423	Standard	NM_021165		Approved	DBCCR1L2	uc001glf.3	Q9C0B6	OTTHUMG00000034953	ENST00000361539.4:c.789G>A	1.37:g.177245347G>A		143.0	0.0		240.0	27.0	NM_021165	O95560|Q6ZWC1|Q7LCZ9|Q8N360	Silent	SNP	ENST00000361539.4	37	CCDS1320.1																																																																																			.		0.557	BRINP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084599.1	NM_021165	
FARP2	9855	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	242430491	242430491	+	Silent	SNP	A	A	G			TCGA-G3-A5SL-01A-11D-A27I-10	TCGA-G3-A5SL-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70422e6d-cb1f-4284-8be9-1d4517ffad60	a38d4467-c3e5-4639-ad4f-88bcd7ab9f26	g.chr2:242430491A>G	ENST00000264042.3	+	23	2690	c.2520A>G	c.(2518-2520)aaA>aaG	p.K840K		NM_014808.2	NP_055623.1	O94887	FARP2_HUMAN	FERM, RhoGEF and pleckstrin domain protein 2	840	PH 1. {ECO:0000255|PROSITE- ProRule:PRU00145}.				actin cytoskeleton reorganization (GO:0031532)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|neuron remodeling (GO:0016322)|osteoclast differentiation (GO:0030316)|podosome assembly (GO:0071800)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rho GTPase activity (GO:0032321)|Rac protein signal transduction (GO:0016601)|regulation of integrin activation (GO:0033623)|regulation of Rac GTPase activity (GO:0032314)|semaphorin-plexin signaling pathway (GO:0071526)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extrinsic component of membrane (GO:0019898)	Rac guanyl-nucleotide exchange factor activity (GO:0030676)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(8)|lung(18)|ovary(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	43		all_cancers(19;4.88e-34)|all_epithelial(40;4.81e-14)|Breast(86;0.000141)|Renal(207;0.0143)|all_lung(227;0.0344)|Lung NSC(271;0.0886)|Ovarian(221;0.0905)|Esophageal squamous(248;0.131)|all_hematologic(139;0.182)|Melanoma(123;0.238)		Epithelial(32;1.81e-33)|all cancers(36;1.61e-30)|OV - Ovarian serous cystadenocarcinoma(60;6.83e-15)|Kidney(56;1.19e-08)|KIRC - Kidney renal clear cell carcinoma(57;8.98e-08)|BRCA - Breast invasive adenocarcinoma(100;1.49e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00125)|Colorectal(34;0.0199)|COAD - Colon adenocarcinoma(134;0.121)		GGCTGGAGAAAGAGAAGTGGA	0.647																																					p.K840K		.											.	FARP2	93	0			c.A2520G						.						82.0	82.0	82.0					2																	242430491		2203	4300	6503	SO:0001819	synonymous_variant	9855	exon23			GGAGAAAGAGAAG	AB018336	CCDS33424.1, CCDS63197.1	2q37.3	2013-01-10			ENSG00000006607	ENSG00000006607		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	16460	protein-coding gene	gene with protein product						9872452, 12351724	Standard	NM_001282984		Approved	KIAA0793, FIR, PLEKHC3, FRG	uc002wbi.2	O94887	OTTHUMG00000151574	ENST00000264042.3:c.2520A>G	2.37:g.242430491A>G		442.0	1.0		243.0	79.0	NM_014808	B7Z6J8|F5GZ84|Q53QM5|Q8WU27|Q9UFE7	Silent	SNP	ENST00000264042.3	37	CCDS33424.1	.	.	.	.	.	.	.	.	.	.	A	7.670	0.686802	0.14973	.	.	ENSG00000006607	ENST00000444371	.	.	.	4.15	1.2	0.21068	.	.	.	.	.	T	0.57917	0.2086	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.50931	-0.8769	4	.	.	.	.	9.7023	0.40194	0.2242:0.0:0.7758:0.0	.	.	.	.	G	34	.	.	R	+	1	2	FARP2	242079164	1.000000	0.71417	0.878000	0.34440	0.688000	0.40055	5.588000	0.67517	0.138000	0.18790	-0.904000	0.02843	AGA	.		0.647	FARP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323153.1		
FASN	2194	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	17	80040959	80040959	+	Silent	SNP	C	C	T			TCGA-G3-A5SL-01A-11D-A27I-10	TCGA-G3-A5SL-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70422e6d-cb1f-4284-8be9-1d4517ffad60	a38d4467-c3e5-4639-ad4f-88bcd7ab9f26	g.chr17:80040959C>T	ENST00000306749.2	-	33	5816	c.5598G>A	c.(5596-5598)aaG>aaA	p.K1866K	FASN_ENST00000579758.1_5'UTR	NM_004104.4	NP_004095.4	P49327	FAS_HUMAN	fatty acid synthase	1866	Beta-ketoacyl reductase. {ECO:0000250}.				acetyl-CoA metabolic process (GO:0006084)|cellular lipid metabolic process (GO:0044255)|cellular response to interleukin-4 (GO:0071353)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|fatty acid metabolic process (GO:0006631)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|osteoblast differentiation (GO:0001649)|pantothenate metabolic process (GO:0015939)|positive regulation of cellular metabolic process (GO:0031325)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|glycogen granule (GO:0042587)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	3-hydroxyoctanoyl-[acyl-carrier-protein] dehydratase activity (GO:0047451)|3-hydroxypalmitoyl-[acyl-carrier-protein] dehydratase activity (GO:0004317)|3-oxoacyl-[acyl-carrier-protein] reductase (NADPH) activity (GO:0004316)|3-oxoacyl-[acyl-carrier-protein] synthase activity (GO:0004315)|[acyl-carrier-protein] S-acetyltransferase activity (GO:0004313)|[acyl-carrier-protein] S-malonyltransferase activity (GO:0004314)|drug binding (GO:0008144)|enoyl-[acyl-carrier-protein] reductase (NADPH, A-specific) activity (GO:0047117)|enoyl-[acyl-carrier-protein] reductase (NADPH, B-specific) activity (GO:0004319)|fatty acid synthase activity (GO:0004312)|myristoyl-[acyl-carrier-protein] hydrolase activity (GO:0016295)|NADPH binding (GO:0070402)|oleoyl-[acyl-carrier-protein] hydrolase activity (GO:0004320)|palmitoyl-[acyl-carrier-protein] hydrolase activity (GO:0016296)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			central_nervous_system(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(12)|prostate(3)|skin(2)|urinary_tract(1)	34	all_neural(118;0.0878)|Ovarian(332;0.227)|all_lung(278;0.246)		OV - Ovarian serous cystadenocarcinoma(97;0.0211)|BRCA - Breast invasive adenocarcinoma(99;0.0237)		Cerulenin(DB01034)|Orlistat(DB01083)	GTTTGGCCCCCTTCAGCACTG	0.667																																					p.K1866K	Colon(59;314 1043 11189 28578 32273)	.											.	FASN	90	0			c.G5598A						.						80.0	78.0	79.0					17																	80040959		2198	4298	6496	SO:0001819	synonymous_variant	2194	exon33			GGCCCCCTTCAGC	U26644	CCDS11801.1	17q25	2012-01-31			ENSG00000169710	ENSG00000169710	2.3.1.85	"""Short chain dehydrogenase/reductase superfamily / Atypical members"""	3594	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 27X, member 1"""	600212				7835891, 7567999, 19027726	Standard	NM_004104		Approved	FAS, SDR27X1	uc002kdu.3	P49327		ENST00000306749.2:c.5598G>A	17.37:g.80040959C>T		80.0	0.0		69.0	35.0	NM_004104	Q13479|Q16702|Q4LE83|Q6P4U5|Q6SS02|Q969R1|Q96C68|Q96IT0	Silent	SNP	ENST00000306749.2	37	CCDS11801.1																																																																																			.		0.667	FASN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442369.1	NM_004104	
FCRL1	115350	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	157768011	157768011	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A5SL-01A-11D-A27I-10	TCGA-G3-A5SL-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70422e6d-cb1f-4284-8be9-1d4517ffad60	a38d4467-c3e5-4639-ad4f-88bcd7ab9f26	g.chr1:157768011G>T	ENST00000368176.3	-	8	1121	c.1054C>A	c.(1054-1056)Caa>Aaa	p.Q352K	FCRL1_ENST00000358292.3_Missense_Mutation_p.Q313K|FCRL1_ENST00000489998.1_5'UTR|FCRL1_ENST00000491942.1_Missense_Mutation_p.Q352K	NM_001159398.1|NM_052938.4	NP_001152870.1|NP_443170.1	Q96LA6	FCRL1_HUMAN	Fc receptor-like 1	352						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(2)|cervix(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(1)|lung(24)|ovary(4)|prostate(1)|skin(6)	42	all_hematologic(112;0.0378)		LUSC - Lung squamous cell carcinoma(543;0.24)			GTGAACTCTTGGGGTAGAGGG	0.498																																					p.Q352K	GBM(54;482 1003 11223 30131 35730)	.											.	FCRL1	153	0			c.C1054A						.						118.0	113.0	114.0					1																	157768011		2203	4300	6503	SO:0001583	missense	115350	exon8			ACTCTTGGGGTAG	BC033690	CCDS1170.1, CCDS53382.1, CCDS53383.1	1q21-q22	2013-01-14			ENSG00000163534	ENSG00000163534		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	18509	protein-coding gene	gene with protein product		606508				11493702, 11929751	Standard	NM_052938		Approved	FCRH1, IRTA5, IFGP1, CD307a	uc001frg.3	Q96LA6	OTTHUMG00000019398	ENST00000368176.3:c.1054C>A	1.37:g.157768011G>T	ENSP00000357158:p.Gln352Lys	78.0	0.0		173.0	10.0	NM_001159398	B2RE05|Q8N759|Q8NDI0|Q96PJ6	Missense_Mutation	SNP	ENST00000368176.3	37	CCDS1170.1	.	.	.	.	.	.	.	.	.	.	G	16.40	3.113035	0.56398	.	.	ENSG00000163534	ENST00000358292;ENST00000368176;ENST00000491942	T;T;T	0.42131	0.98;1.1;1.11	4.79	2.9	0.33743	.	3.842740	0.00397	N	0.000042	T	0.41190	0.1148	M	0.82323	2.585	0.09310	N	0.999997	P;D;B	0.61080	0.573;0.989;0.437	B;P;B	0.58620	0.23;0.842;0.115	T	0.16394	-1.0404	10	0.11794	T	0.64	.	6.0588	0.19826	0.0959:0.0:0.7183:0.1859	.	313;352;352	Q96LA6-3;Q96LA6-2;Q96LA6	.;.;FCRL1_HUMAN	K	313;352;352	ENSP00000351039:Q313K;ENSP00000357158:Q352K;ENSP00000418130:Q352K	ENSP00000351039:Q313K	Q	-	1	0	FCRL1	156034635	0.186000	0.23225	0.096000	0.21009	0.225000	0.24961	2.491000	0.45303	0.715000	0.32103	0.591000	0.81541	CAA	.		0.498	FCRL1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000051401.1	NM_052938	
FGA	2243	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	155505929	155505929	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A5SL-01A-11D-A27I-10	TCGA-G3-A5SL-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70422e6d-cb1f-4284-8be9-1d4517ffad60	a38d4467-c3e5-4639-ad4f-88bcd7ab9f26	g.chr4:155505929T>C	ENST00000302053.3	-	6	2026	c.1948A>G	c.(1948-1950)Atc>Gtc	p.I650V		NM_000508.3	NP_000499.1	P02671	FIBA_HUMAN	fibrinogen alpha chain	650	Fibrinogen C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00739}.				blood coagulation (GO:0007596)|blood coagulation, common pathway (GO:0072377)|cell-matrix adhesion (GO:0007160)|cellular protein complex assembly (GO:0043623)|extracellular matrix organization (GO:0030198)|negative regulation of blood coagulation, common pathway (GO:2000261)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of exocytosis (GO:0045921)|positive regulation of heterotypic cell-cell adhesion (GO:0034116)|positive regulation of peptide hormone secretion (GO:0090277)|positive regulation of protein secretion (GO:0050714)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|positive regulation of vasoconstriction (GO:0045907)|protein polymerization (GO:0051258)|response to calcium ion (GO:0051592)|signal transduction (GO:0007165)	blood microparticle (GO:0072562)|cell cortex (GO:0005938)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|fibrinogen complex (GO:0005577)|plasma membrane (GO:0005886)|platelet alpha granule (GO:0031091)|platelet alpha granule lumen (GO:0031093)|vesicle (GO:0031982)	structural molecule activity (GO:0005198)			NS(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(14)|liver(2)|lung(20)|ovary(3)|pancreas(1)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(6)	73	all_hematologic(180;0.215)	Renal(120;0.0458)			Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Sucralfate(DB00364)|Tenecteplase(DB00031)	GGTAGCTTGATATTGAAAATG	0.388																																					p.I650V	NSCLC(143;340 1922 20892 22370 48145)	.											.	FGA	93	0			c.A1948G						.						47.0	48.0	48.0					4																	155505929		2203	4300	6503	SO:0001583	missense	2243	exon6			GCTTGATATTGAA		CCDS3787.1, CCDS47152.1	4q28	2014-09-17			ENSG00000171560	ENSG00000171560		"""Fibrinogen C domain containing"", ""Endogenous ligands"""	3661	protein-coding gene	gene with protein product		134820	"""fibrinogen, A alpha polypeptide"""				Standard	NM_000508		Approved		uc003iod.1	P02671	OTTHUMG00000150330	ENST00000302053.3:c.1948A>G	4.37:g.155505929T>C	ENSP00000306361:p.Ile650Val	29.0	0.0		39.0	18.0	NM_000508	A8K3E4|D3DP14|D3DP15|Q4QQH7|Q9BX62|Q9UCH2	Missense_Mutation	SNP	ENST00000302053.3	37	CCDS3787.1	.	.	.	.	.	.	.	.	.	.	T	11.35	1.613373	0.28712	.	.	ENSG00000171560	ENST00000302053	D	0.98207	-4.79	5.46	1.72	0.24424	Fibrinogen, alpha/beta/gamma chain, C-terminal globular (4);Fibrinogen, alpha/beta/gamma chain, C-terminal globular, subdomain 1 (1);	0.088574	0.85682	N	0.000000	D	0.96488	0.8854	L	0.49455	1.56	0.80722	D	1	B	0.32526	0.374	B	0.40329	0.326	D	0.92665	0.6145	10	0.44086	T	0.13	.	9.1746	0.37105	0.0:0.2086:0.0:0.7914	.	650	P02671	FIBA_HUMAN	V	650	ENSP00000306361:I650V	ENSP00000306361:I650V	I	-	1	0	FGA	155725379	1.000000	0.71417	0.998000	0.56505	0.679000	0.39708	2.129000	0.42055	0.065000	0.16485	-0.280000	0.10049	ATC	.		0.388	FGA-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317593.1	NM_000508	
FRMD4A	55691	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	13708157	13708157	+	Missense_Mutation	SNP	T	T	G			TCGA-G3-A5SL-01A-11D-A27I-10	TCGA-G3-A5SL-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70422e6d-cb1f-4284-8be9-1d4517ffad60	a38d4467-c3e5-4639-ad4f-88bcd7ab9f26	g.chr10:13708157T>G	ENST00000357447.2	-	18	1911	c.1543A>C	c.(1543-1545)Aat>Cat	p.N515H	FRMD4A_ENST00000358621.4_Missense_Mutation_p.N500H|FRMD4A_ENST00000378503.1_Missense_Mutation_p.N515H	NM_018027.3	NP_060497.3	Q9P2Q2	FRM4A_HUMAN	FERM domain containing 4A	515					establishment of epithelial cell polarity (GO:0090162)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|tight junction (GO:0005923)				breast(4)|endometrium(9)|kidney(2)|large_intestine(11)|lung(9)|ovary(2)|pancreas(1)|prostate(2)|skin(1)	41						CGGTTCTCATTGATTGCATTT	0.522																																					p.N515H		.											.	FRMD4A	229	0			c.A1543C						.						143.0	143.0	143.0					10																	13708157		2203	4300	6503	SO:0001583	missense	55691	exon18			TCTCATTGATTGC	AB037715	CCDS7101.1	10p14	2004-07-15	2004-07-15	2004-07-15	ENSG00000151474	ENSG00000151474			25491	protein-coding gene	gene with protein product			"""FERM domain containing 4"""	FRMD4		10718198	Standard	NM_018027		Approved	FLJ10210, KIAA1294, bA295P9.4	uc001ims.3	Q9P2Q2	OTTHUMG00000017708	ENST00000357447.2:c.1543A>C	10.37:g.13708157T>G	ENSP00000350032:p.Asn515His	81.0	0.0		64.0	28.0	NM_018027	A7E2Y3|Q5T377	Missense_Mutation	SNP	ENST00000357447.2	37	CCDS7101.1	.	.	.	.	.	.	.	.	.	.	T	18.46	3.629759	0.67015	.	.	ENSG00000151474	ENST00000358621;ENST00000357447;ENST00000378503	D;D;D	0.84800	-1.89;-1.9;-1.9	5.05	5.05	0.67936	.	0.042246	0.85682	D	0.000000	D	0.83413	0.5249	L	0.56199	1.76	0.80722	D	1	P	0.36495	0.556	B	0.38921	0.285	D	0.84349	0.0531	10	0.51188	T	0.08	-30.3368	14.9598	0.71147	0.0:0.0:0.0:1.0	.	515	Q9P2Q2	FRM4A_HUMAN	H	500;515;515	ENSP00000351438:N500H;ENSP00000350032:N515H;ENSP00000367764:N515H	ENSP00000350032:N515H	N	-	1	0	FRMD4A	13748163	1.000000	0.71417	1.000000	0.80357	0.924000	0.55760	7.867000	0.87062	2.134000	0.65973	0.459000	0.35465	AAT	.		0.522	FRMD4A-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000046889.1	NM_018027	
GFAP	2670	broad.mit.edu;bcgsc.ca;mdanderson.org	37	17	42988813	42988813	+	Silent	SNP	C	C	T			TCGA-G3-A5SL-01A-11D-A27I-10	TCGA-G3-A5SL-10A-01D-A27I-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70422e6d-cb1f-4284-8be9-1d4517ffad60	a38d4467-c3e5-4639-ad4f-88bcd7ab9f26	g.chr17:42988813C>T	ENST00000253408.5	-	6	983	c.918G>A	c.(916-918)ctG>ctA	p.L306L	GFAP_ENST00000435360.2_Silent_p.L306L|GFAP_ENST00000588735.1_Intron|GFAP_ENST00000591327.1_5'Flank|GFAP_ENST00000586793.1_Silent_p.L306L	NM_002055.4	NP_002046.1	P14136	GFAP_HUMAN	glial fibrillary acidic protein	306	Coil 2B.|Rod.				astrocyte development (GO:0014002)|Bergmann glial cell differentiation (GO:0060020)|extracellular matrix organization (GO:0030198)|intermediate filament organization (GO:0045109)|long-term synaptic potentiation (GO:0060291)|negative regulation of neuron projection development (GO:0010977)|neuron projection regeneration (GO:0031102)|positive regulation of Schwann cell proliferation (GO:0010625)|regulation of neurotransmitter uptake (GO:0051580)|response to wounding (GO:0009611)	astrocyte projection (GO:0097449)|cell body (GO:0044297)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intermediate filament (GO:0005882)|membrane (GO:0016020)	structural constituent of cytoskeleton (GO:0005200)			endometrium(3)|kidney(1)|large_intestine(2)|liver(1)|lung(11)|ovary(1)|pancreas(1)|skin(2)|urinary_tract(1)	23		Prostate(33;0.0959)				TCTGCCTCTCCAGGGACTCGT	0.731																																					p.L306L		.											.	GFAP	516	0			c.G918A						.						26.0	28.0	27.0					17																	42988813		2201	4298	6499	SO:0001819	synonymous_variant	2670	exon6			CCTCTCCAGGGAC	S40719	CCDS11491.1, CCDS45708.1, CCDS59296.1	17q21	2013-01-16						"""Intermediate filaments type III"""	4235	protein-coding gene	gene with protein product	"""intermediate filament protein"""	137780				9693047	Standard	NM_002055		Approved	FLJ45472	uc002ihq.3	P14136		ENST00000253408.5:c.918G>A	17.37:g.42988813C>T		27.0	0.0		18.0	8.0	NM_001131019	B2RD44|D3DX59|E9PAX3|Q53H98|Q5D055|Q6ZQS3|Q7Z5J6|Q7Z5J7|Q96KS4|Q96P18|Q9UFD0	Silent	SNP	ENST00000253408.5	37	CCDS11491.1																																																																																			.		0.731	GFAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448701.1	NM_002055	
GOLGA1	2800	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	127685398	127685398	+	Missense_Mutation	SNP	C	C	A	rs138655913		TCGA-G3-A5SL-01A-11D-A27I-10	TCGA-G3-A5SL-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70422e6d-cb1f-4284-8be9-1d4517ffad60	a38d4467-c3e5-4639-ad4f-88bcd7ab9f26	g.chr9:127685398C>A	ENST00000373555.4	-	8	870	c.537G>T	c.(535-537)caG>caT	p.Q179H		NM_002077.3	NP_002068	Q92805	GOGA1_HUMAN	golgin A1	179					protein targeting to Golgi (GO:0000042)	Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|trans-Golgi network (GO:0005802)				NS(1)|endometrium(5)|kidney(2)|large_intestine(3)|lung(7)|ovary(1)|stomach(1)	20						TACTTAGTTCCTGCTGCTGGA	0.348																																					p.Q179H		.											.	GOLGA1	91	0			c.G537T						.						166.0	149.0	155.0					9																	127685398		2203	4300	6503	SO:0001583	missense	2800	exon8			TAGTTCCTGCTGC	U51587	CCDS6860.1	9q34.11	2010-02-12	2010-02-12		ENSG00000136935	ENSG00000136935			4424	protein-coding gene	gene with protein product		602502	"""golgi autoantigen, golgin subfamily a, 1"""			9324025	Standard	NM_002077		Approved	golgin-97, MGC33154	uc004bpc.3	Q92805	OTTHUMG00000020665	ENST00000373555.4:c.537G>T	9.37:g.127685398C>A	ENSP00000362656:p.Gln179His	27.0	0.0		33.0	15.0	NM_002077	Q5T164|Q8IYZ9	Missense_Mutation	SNP	ENST00000373555.4	37	CCDS6860.1	.	.	.	.	.	.	.	.	.	.	C	20.1	3.931437	0.73442	.	.	ENSG00000136935	ENST00000373555	T	0.18016	2.24	5.42	4.53	0.55603	.	0.000000	0.42172	U	0.000752	T	0.41351	0.1155	M	0.76328	2.33	0.58432	D	0.999997	D;D	0.76494	0.999;0.998	D;D	0.85130	0.997;0.993	T	0.31364	-0.9946	10	0.52906	T	0.07	-15.526	13.3943	0.60840	0.0:0.924:0.0:0.076	.	78;179	Q59HA1;Q92805	.;GOGA1_HUMAN	H	179	ENSP00000362656:Q179H	ENSP00000362656:Q179H	Q	-	3	2	GOLGA1	126725219	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.108000	0.41854	1.296000	0.44742	0.591000	0.81541	CAG	C|1.000;T|0.000		0.348	GOLGA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054049.1	NM_002077	
HBE1	3046	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	5291042	5291042	+	Missense_Mutation	SNP	C	C	G			TCGA-G3-A5SL-01A-11D-A27I-10	TCGA-G3-A5SL-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70422e6d-cb1f-4284-8be9-1d4517ffad60	a38d4467-c3e5-4639-ad4f-88bcd7ab9f26	g.chr11:5291042C>G	ENST00000380237.1	-	3	423	c.79G>C	c.(79-81)Gaa>Caa	p.E27Q	HBG2_ENST00000380252.1_Intron|HBG2_ENST00000380259.2_Intron|HBE1_ENST00000292896.2_Missense_Mutation_p.E27Q			P02100	HBE_HUMAN	hemoglobin, epsilon 1	27					blood coagulation (GO:0007596)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|protein heterooligomerization (GO:0051291)	blood microparticle (GO:0072562)|cytosol (GO:0005829)|hemoglobin complex (GO:0005833)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxygen binding (GO:0019825)|oxygen transporter activity (GO:0005344)			breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(12)|skin(1)	20		Medulloblastoma(188;0.00225)|Breast(177;0.0155)|all_neural(188;0.0212)		Epithelial(150;1.34e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		CCCAAGGCTTCACCTCCAGCC	0.493																																					p.E27Q		.											.	HBE1	90	0			c.G79C						.						116.0	103.0	108.0					11																	5291042		2201	4297	6498	SO:0001583	missense	3046	exon1			AGGCTTCACCTCC	BC015537	CCDS7756.1	11p15.5	2012-10-02			ENSG00000213931	ENSG00000213931			4830	protein-coding gene	gene with protein product		142100				2649166	Standard	NM_005330		Approved	HBE	uc001mal.1	P02100	OTTHUMG00000066675	ENST00000380237.1:c.79G>C	11.37:g.5291042C>G	ENSP00000369586:p.Glu27Gln	58.0	0.0		90.0	10.0	NM_005330	Q6FH44	Missense_Mutation	SNP	ENST00000380237.1	37	CCDS7756.1	.	.	.	.	.	.	.	.	.	.	C	19.30	3.800573	0.70567	.	.	ENSG00000213931	ENST00000380237;ENST00000292896;ENST00000396895	D;D;D	0.89617	-2.54;-2.54;-2.54	5.97	5.97	0.96955	Globin-like (1);Globin, structural domain (1);	0.397031	0.24016	U	0.042321	D	0.88566	0.6471	M	0.64630	1.985	0.43613	D	0.995989	B	0.31790	0.34	B	0.31390	0.129	D	0.86563	0.1842	10	0.51188	T	0.08	-29.7236	18.9809	0.92755	0.0:1.0:0.0:0.0	.	27	P02100	HBE_HUMAN	Q	27	ENSP00000369586:E27Q;ENSP00000292896:E27Q;ENSP00000380104:E27Q	ENSP00000292896:E27Q	E	-	1	0	HBE1	5247618	0.920000	0.31207	0.941000	0.38009	0.869000	0.49853	1.962000	0.40442	2.832000	0.97577	0.585000	0.79938	GAA	.		0.493	HBE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142973.2	NM_005330	
HGF	3082	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	81372744	81372744	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A5SL-01A-11D-A27I-10	TCGA-G3-A5SL-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70422e6d-cb1f-4284-8be9-1d4517ffad60	a38d4467-c3e5-4639-ad4f-88bcd7ab9f26	g.chr7:81372744C>A	ENST00000222390.5	-	7	1016	c.790G>T	c.(790-792)Gat>Tat	p.D264Y	HGF_ENST00000444829.2_Missense_Mutation_p.D264Y|HGF_ENST00000453411.1_Missense_Mutation_p.D259Y|HGF_ENST00000457544.2_Missense_Mutation_p.D259Y	NM_000601.4	NP_000592.3	P14210	HGF_HUMAN	hepatocyte growth factor (hepapoietin A; scatter factor)	264	Kringle 2. {ECO:0000255|PROSITE- ProRule:PRU00121}.				activation of MAPK activity (GO:0000187)|blood coagulation (GO:0007596)|cell chemotaxis (GO:0060326)|cellular response to hepatocyte growth factor stimulus (GO:0035729)|epithelial to mesenchymal transition (GO:0001837)|hepatocyte growth factor receptor signaling pathway (GO:0048012)|hyaluronan metabolic process (GO:0030212)|liver development (GO:0001889)|mitotic nuclear division (GO:0007067)|myoblast proliferation (GO:0051450)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of hydrogen peroxide-mediated programmed cell death (GO:1901299)|negative regulation of release of cytochrome c from mitochondria (GO:0090201)|organ regeneration (GO:0031100)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive chemotaxis (GO:0050918)|positive regulation of cell migration (GO:0030335)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of branching involved in salivary gland morphogenesis by mesenchymal-epithelial signaling (GO:0060665)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)|platelet alpha granule lumen (GO:0031093)	catalytic activity (GO:0003824)|chemoattractant activity (GO:0042056)|growth factor activity (GO:0008083)|identical protein binding (GO:0042802)			NS(2)|breast(1)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|liver(2)|lung(41)|ovary(2)|prostate(2)|skin(6)|urinary_tract(1)	75						GGCTGGCCATCGGGATTGCGG	0.488																																					p.D264Y		.											.	HGF	516	0			c.G790T						.						95.0	86.0	89.0					7																	81372744		2203	4300	6503	SO:0001583	missense	3082	exon7			GGCCATCGGGATT		CCDS5597.1, CCDS47626.1, CCDS47627.1, CCDS47628.1, CCDS47629.1	7q21.1	2009-09-11			ENSG00000019991	ENSG00000019991			4893	protein-coding gene	gene with protein product	"""hepatopoietin A"", ""fibroblast-derived tumor cytotoxic factor"", ""scatter factor"", ""lung fibroblast-derived mitogen"""	142409	"""deafness, autosomal recessive 39"""	DFNB39		1837206, 19576567	Standard	XM_006715956		Approved	SF, F-TCF, HGFB, HPTA	uc003uhl.3	P14210	OTTHUMG00000023804	ENST00000222390.5:c.790G>T	7.37:g.81372744C>A	ENSP00000222390:p.Asp264Tyr	85.0	0.0		181.0	23.0	NM_000601	A1L3U6|Q02935|Q13494|Q14519|Q3KRB2|Q8TCE2|Q9BYL9|Q9BYM0|Q9UDU6	Missense_Mutation	SNP	ENST00000222390.5	37	CCDS5597.1	.	.	.	.	.	.	.	.	.	.	C	22.3	4.265404	0.80358	.	.	ENSG00000019991	ENST00000222390;ENST00000457544;ENST00000444829;ENST00000453411;ENST00000394769	T;T;T;T	0.74002	-0.8;-0.8;-0.8;-0.8	5.75	5.75	0.90469	Kringle (5);Kringle-like fold (1);Kringle, conserved site (1);	0.049605	0.85682	D	0.000000	D	0.92397	0.7587	H	0.98333	4.205	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.996;0.992;0.993	D	0.94808	0.7976	10	0.87932	D	0	.	19.9474	0.97186	0.0:1.0:0.0:0.0	.	259;264;259;264	P14210-5;P14210-2;P14210-3;P14210	.;.;.;HGF_HUMAN	Y	264;259;264;259;264	ENSP00000222390:D264Y;ENSP00000391238:D259Y;ENSP00000389854:D264Y;ENSP00000408270:D259Y	ENSP00000222390:D264Y	D	-	1	0	HGF	81210680	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	4.386000	0.59620	2.724000	0.93272	0.655000	0.94253	GAT	.		0.488	HGF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253315.2	NM_000601	
HIATL1	84641	broad.mit.edu;bcgsc.ca	37	9	97216242	97216242	+	Silent	SNP	G	G	A			TCGA-G3-A5SL-01A-11D-A27I-10	TCGA-G3-A5SL-10A-01D-A27I-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70422e6d-cb1f-4284-8be9-1d4517ffad60	a38d4467-c3e5-4639-ad4f-88bcd7ab9f26	g.chr9:97216242G>A	ENST00000375344.3	+	9	1187	c.918G>A	c.(916-918)acG>acA	p.T306T	HIATL1_ENST00000428393.2_Silent_p.T241T	NM_032558.2	NP_115947.2	Q5SR56	HIAL1_HUMAN	hippocampus abundant transcript-like 1	306					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)			endometrium(1)|large_intestine(2)|lung(5)|ovary(2)|pancreas(1)	11		Acute lymphoblastic leukemia(62;0.136)				CTTTGCAGACGGCCTTTCTTA	0.443																																					p.T306T	Pancreas(77;1260 1915 1973 10423)	.											.	HIATL1	92	0			c.G918A						.						121.0	110.0	114.0					9																	97216242		2203	4300	6503	SO:0001819	synonymous_variant	84641	exon9			GCAGACGGCCTTT	AK027659	CCDS6710.2	9q22.32	2009-12-04			ENSG00000148110	ENSG00000148110			23376	protein-coding gene	gene with protein product							Standard	XM_005252277		Approved	FLJ14753	uc004aur.3	Q5SR56	OTTHUMG00000020265	ENST00000375344.3:c.918G>A	9.37:g.97216242G>A		83.0	2.0		84.0	28.0	NM_032558	B4DUE6|E9PD58|Q3KQT4|Q53GU5|Q8WU95|Q96SM4	Silent	SNP	ENST00000375344.3	37	CCDS6710.2																																																																																			.		0.443	HIATL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053184.1	NM_032558	
HOOK2	29911	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	12886218	12886218	+	Splice_Site	DEL	C	C	-			TCGA-G3-A5SL-01A-11D-A27I-10	TCGA-G3-A5SL-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70422e6d-cb1f-4284-8be9-1d4517ffad60	a38d4467-c3e5-4639-ad4f-88bcd7ab9f26	g.chr19:12886218delC	ENST00000397668.3	-	1	119		c.e1+1		HOOK2_ENST00000589965.1_Splice_Site|HOOK2_ENST00000264827.5_Splice_Site	NM_013312.2	NP_037444.2	Q96ED9	HOOK2_HUMAN	hook microtubule-tethering protein 2						early endosome to late endosome transport (GO:0045022)|endocytosis (GO:0006897)|endosome organization (GO:0007032)|endosome to lysosome transport (GO:0008333)|lysosome organization (GO:0007040)|protein transport (GO:0015031)	centrosome (GO:0005813)|FHF complex (GO:0070695)|microtubule (GO:0005874)	identical protein binding (GO:0042802)			breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)|prostate(5)|skin(1)	20						CCACGACCTACCCAGGTGAGC	0.682																																					.		.											.	HOOK2	92	0			c.45+1G>-						.						23.0	29.0	27.0					19																	12886218		1943	4125	6068	SO:0001630	splice_region_variant	29911	exon2			GACCTACCCAGGT	AF044924	CCDS42507.1, CCDS42508.1	19p13.2	2013-08-21	2013-08-21						19885	protein-coding gene	gene with protein product		607824	"""hook homolog 2 (Drosophila)"""			9927460	Standard	NM_013312		Approved	HK2	uc002muy.2	Q96ED9		ENST00000397668.3:c.45+1G>-	19.37:g.12886218delC		132.0	0.0		96.0	26.0	NM_001100176	O60562	Splice_Site	DEL	ENST00000397668.3	37	CCDS42508.1																																																																																			.		0.682	HOOK2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000451008.1	NM_013312	Intron
IL36A	27179	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	113763592	113763592	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A5SL-01A-11D-A27I-10	TCGA-G3-A5SL-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70422e6d-cb1f-4284-8be9-1d4517ffad60	a38d4467-c3e5-4639-ad4f-88bcd7ab9f26	g.chr2:113763592A>G	ENST00000259211.6	+	2	463	c.52A>G	c.(52-54)Atc>Gtc	p.I18V		NM_014440.1	NP_055255.1	Q9UHA7	IL36A_HUMAN	interleukin 36, alpha	18					immune response (GO:0006955)|inflammatory response (GO:0006954)|positive regulation of interleukin-6 production (GO:0032755)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	interleukin-1 receptor binding (GO:0005149)			large_intestine(1)|lung(3)|ovary(2)|skin(1)|stomach(2)	9						CATTCAGGATATCAATCATCG	0.478																																					p.I18V		.											.	IL36A	93	0			c.A52G						.						102.0	106.0	105.0					2																	113763592		1949	4137	6086	SO:0001583	missense	27179	exon2			CAGGATATCAATC	AF201831	CCDS42734.1	2q12-q14.1	2011-07-14	2011-06-06	2011-06-06	ENSG00000136694	ENSG00000136694		"""Interleukins and interleukin receptors"""	15562	protein-coding gene	gene with protein product		605509	"""interleukin 1 family, member 6 (epsilon)"""	IL1F6		10625660	Standard	XM_005263639		Approved	FIL1, FIL1E, IL-1F6, IL1(EPSILON), MGC129553, MGC129552	uc010yxr.2	Q9UHA7	OTTHUMG00000153320	ENST00000259211.6:c.52A>G	2.37:g.113763592A>G	ENSP00000259211:p.Ile18Val	119.0	0.0		95.0	38.0	NM_014440	B2RAD9|Q53SR7|Q5BLR4|Q7RTZ8	Missense_Mutation	SNP	ENST00000259211.6	37	CCDS42734.1	.	.	.	.	.	.	.	.	.	.	A	1.173	-0.640291	0.03557	.	.	ENSG00000136694	ENST00000259211	T	0.16897	2.31	4.99	1.36	0.22044	.	0.995923	0.08141	N	0.991647	T	0.07188	0.0182	N	0.04260	-0.245	0.09310	N	1	B	0.18461	0.028	B	0.16722	0.016	T	0.39921	-0.9590	10	0.27082	T	0.32	-30.939	3.859	0.08988	0.4396:0.2648:0.0:0.2956	.	18	Q9UHA7	IL36A_HUMAN	V	18	ENSP00000259211:I18V	ENSP00000259211:I18V	I	+	1	0	IL36A	113480063	0.003000	0.15002	0.087000	0.20705	0.412000	0.31113	0.086000	0.14935	0.451000	0.26802	0.477000	0.44152	ATC	.		0.478	IL36A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330711.1	NM_014440	
ITGA8	8516	hgsc.bcm.edu;broad.mit.edu	37	10	15559170	15559170	+	Missense_Mutation	SNP	G	G	C			TCGA-G3-A5SL-01A-11D-A27I-10	TCGA-G3-A5SL-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70422e6d-cb1f-4284-8be9-1d4517ffad60	a38d4467-c3e5-4639-ad4f-88bcd7ab9f26	g.chr10:15559170G>C	ENST00000378076.3	-	30	3532	c.3179C>G	c.(3178-3180)aCc>aGc	p.T1060S		NM_003638.1	NP_003629	P53708	ITA8_HUMAN	integrin, alpha 8	1060					brain development (GO:0007420)|cell projection organization (GO:0030030)|cell-matrix adhesion (GO:0007160)|establishment of protein localization (GO:0045184)|extracellular matrix organization (GO:0030198)|inner ear morphogenesis (GO:0042472)|integrin-mediated signaling pathway (GO:0007229)|kidney development (GO:0001822)|memory (GO:0007613)|mesodermal cell differentiation (GO:0048333)|metanephros development (GO:0001656)|positive regulation of transcription from RNA polymerase II promoter involved in smooth muscle cell differentiation (GO:2000721)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle tissue development (GO:0048745)|substrate adhesion-dependent cell spreading (GO:0034446)	apical part of cell (GO:0045177)|cell surface (GO:0009986)|dendritic spine membrane (GO:0032591)|endoplasmic reticulum (GO:0005783)|focal adhesion (GO:0005925)|integrin alpha8-beta1 complex (GO:0034678)|integrin complex (GO:0008305)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	metal ion binding (GO:0046872)			NS(2)|breast(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(57)|ovary(3)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	96						TGCCTCAGGGGTCTTGTCATT	0.418																																					p.T1060S		.											.	ITGA8	230	0			c.C3179G						.						73.0	71.0	72.0					10																	15559170		2203	4300	6503	SO:0001583	missense	8516	exon30			TCAGGGGTCTTGT	L36531	CCDS31155.1	10p13	2010-03-23			ENSG00000077943	ENSG00000077943		"""Integrins"""	6144	protein-coding gene	gene with protein product		604063				7768999	Standard	XM_005252633		Approved		uc001ioc.1	P53708	OTTHUMG00000017733	ENST00000378076.3:c.3179C>G	10.37:g.15559170G>C	ENSP00000367316:p.Thr1060Ser	25.0	0.0		36.0	5.0	NM_003638	B0YJ31|Q5VX94	Missense_Mutation	SNP	ENST00000378076.3	37	CCDS31155.1	.	.	.	.	.	.	.	.	.	.	G	11.72	1.723763	0.30593	.	.	ENSG00000077943	ENST00000378076;ENST00000538044	T	0.68181	-0.31	5.89	2.6	0.31112	.	0.295809	0.36134	N	0.002776	T	0.41811	0.1175	N	0.12746	0.255	0.32435	N	0.547541	B;B	0.12013	0.005;0.003	B;B	0.15052	0.012;0.005	T	0.39881	-0.9592	10	0.11794	T	0.64	.	8.9387	0.35715	0.1507:0.1264:0.7228:0.0	.	1045;1060	F5H818;P53708	.;ITA8_HUMAN	S	1060;1045	ENSP00000367316:T1060S	ENSP00000367316:T1060S	T	-	2	0	ITGA8	15599176	1.000000	0.71417	0.899000	0.35326	0.632000	0.37999	3.859000	0.55987	0.835000	0.34877	0.563000	0.77884	ACC	.		0.418	ITGA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046987.1	NM_003638	
ITSN1	6453	broad.mit.edu;ucsc.edu;bcgsc.ca	37	21	35169914	35169914	+	Splice_Site	SNP	T	T	C			TCGA-G3-A5SL-01A-11D-A27I-10	TCGA-G3-A5SL-10A-01D-A27I-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70422e6d-cb1f-4284-8be9-1d4517ffad60	a38d4467-c3e5-4639-ad4f-88bcd7ab9f26	g.chr21:35169914T>C	ENST00000381318.3	+	18	2470		c.e18+2		ITSN1_ENST00000399352.1_Splice_Site|ITSN1_ENST00000399355.2_Splice_Site|ITSN1_ENST00000399353.1_Splice_Site|AP000304.12_ENST00000429238.1_Intron|ITSN1_ENST00000399349.1_Splice_Site|ITSN1_ENST00000437442.2_Splice_Site|ITSN1_ENST00000381285.4_Splice_Site|ITSN1_ENST00000399367.3_Splice_Site|ITSN1_ENST00000399326.3_Splice_Site|ITSN1_ENST00000379960.5_Splice_Site|ITSN1_ENST00000381291.4_Splice_Site|ITSN1_ENST00000399338.4_Splice_Site	NM_003024.2	NP_003015.2	Q15811	ITSN1_HUMAN	intersectin 1 (SH3 domain protein)						apoptotic signaling pathway (GO:0097190)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|positive regulation of protein kinase B signaling (GO:0051897)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|synaptic vesicle endocytosis (GO:0048488)	cell junction (GO:0030054)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|lamellipodium (GO:0030027)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|synapse (GO:0045202)	calcium ion binding (GO:0005509)|guanyl-nucleotide exchange factor activity (GO:0005085)|kinase activator activity (GO:0019209)|proline-rich region binding (GO:0070064)|protein complex scaffold (GO:0032947)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(1)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(16)|lung(26)|ovary(4)|prostate(1)|skin(4)|stomach(1)|urinary_tract(2)	67						CCACTGCAGGTATTAGAAGCC	0.453																																					.		.											.	ITSN1	94	0			c.2182+2T>C						.						53.0	54.0	53.0					21																	35169914		2203	4300	6503	SO:0001630	splice_region_variant	6453	exon18			TGCAGGTATTAGA	AF064244	CCDS33545.1, CCDS33546.1	21q22.1-q22.2	2013-01-10			ENSG00000205726	ENSG00000205726		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"", ""EF-hand domain containing"""	6183	protein-coding gene	gene with protein product	"""SH3 domain protein-1A"", ""human intersectin-SH3 domain-containing protein SH3P17"", ""Src homology 3 domain-containing protein"", ""intersectin 1 short form variant, 11"", ""intersectin 1 short form variant 3"", ""intersectin short variant 12"""	602442		SH3D1A, ITSN		9799604, 9813051	Standard	NM_003024		Approved	SH3P17, MGC134948, MGC134949	uc002yta.1	Q15811	OTTHUMG00000065284	ENST00000381318.3:c.2182+2T>C	21.37:g.35169914T>C		185.0	1.0		149.0	57.0	NM_003024	A7Y322|A8CTX8|A8CTY3|A8CTY7|A8D7D0|A8DCP3|B4DTM2|E7ERJ1|E9PE44|E9PG01|E9PHV2|O95216|Q0PW94|Q0PW95|Q0PW97|Q14BD3|Q1ED40|Q20BK3|Q9UET5|Q9UK60|Q9UNK1|Q9UNK2|Q9UQ92	Splice_Site	SNP	ENST00000381318.3	37	CCDS33545.1	.	.	.	.	.	.	.	.	.	.	T	16.40	3.113638	0.56398	.	.	ENSG00000205726	ENST00000399353;ENST00000381318;ENST00000381291;ENST00000381285;ENST00000381288;ENST00000381289;ENST00000399367;ENST00000399352;ENST00000399355;ENST00000399349;ENST00000399338;ENST00000437442;ENST00000399326;ENST00000379960	.	.	.	5.74	4.57	0.56435	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.109	0.59263	0.0:0.0:0.1339:0.8661	.	.	.	.	.	-1	.	.	.	+	.	.	ITSN1	34091784	1.000000	0.71417	0.986000	0.45419	0.846000	0.48090	6.278000	0.72614	1.074000	0.40909	0.460000	0.39030	.	.		0.453	ITSN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000140070.4	NM_003024	Intron
KCNK2	3776	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	215408294	215408294	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A5SL-01A-11D-A27I-10	TCGA-G3-A5SL-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70422e6d-cb1f-4284-8be9-1d4517ffad60	a38d4467-c3e5-4639-ad4f-88bcd7ab9f26	g.chr1:215408294C>T	ENST00000444842.2	+	7	1237	c.1087C>T	c.(1087-1089)Cgg>Tgg	p.R363W	KCNK2_ENST00000391894.2_Missense_Mutation_p.R348W|KCNK2_ENST00000391895.2_Missense_Mutation_p.R359W	NM_001017425.2|NM_014217.3	NP_001017425.2|NP_055032.1	O95069	KCNK2_HUMAN	potassium channel, subfamily K, member 2	363	Required for basal channel activity. {ECO:0000250}.				G-protein coupled receptor signaling pathway (GO:0007186)|potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	endoplasmic reticulum (GO:0005783)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	outward rectifier potassium channel activity (GO:0015271)|potassium channel inhibitor activity (GO:0019870)|potassium ion leak channel activity (GO:0022841)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(15)|upper_aerodigestive_tract(1)	30				OV - Ovarian serous cystadenocarcinoma(81;0.0399)|all cancers(67;0.0556)|GBM - Glioblastoma multiforme(131;0.068)	Dofetilide(DB00204)|Dronedarone(DB04855)	CTCCATCAAGCGGAAGCTCTC	0.547																																					p.R363W		.											.	KCNK2	90	0			c.C1087T						.						66.0	65.0	65.0					1																	215408294		2203	4300	6503	SO:0001583	missense	3776	exon7			ATCAAGCGGAAGC	AF004711	CCDS31024.1, CCDS41466.1, CCDS41467.1	1q41	2012-03-07			ENSG00000082482	ENSG00000082482		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	6277	protein-coding gene	gene with protein product		603219				9721223, 16382106	Standard	NM_001017424		Approved	K2p2.1, TREK-1	uc001hkr.4	O95069	OTTHUMG00000037017	ENST00000444842.2:c.1087C>T	1.37:g.215408294C>T	ENSP00000394033:p.Arg363Trp	62.0	0.0		146.0	39.0	NM_001017425	A1Z1V3|A8K618|B2RCS4|B7ZL56|D3DTA5|Q5DP47|Q5DP48|Q9NRT2|Q9UNE3	Missense_Mutation	SNP	ENST00000444842.2	37	CCDS41467.1	.	.	.	.	.	.	.	.	.	.	C	18.27	3.587659	0.66105	.	.	ENSG00000082482	ENST00000391895;ENST00000391894;ENST00000444842	T;T;T	0.26957	1.7;1.72;1.7	5.72	2.48	0.30137	.	0.873374	0.09247	U	0.828466	T	0.40522	0.1120	L	0.29908	0.895	0.51482	D	0.999922	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.75484	0.986;0.952;0.986	T	0.27400	-1.0075	10	0.87932	D	0	.	13.9309	0.63994	0.5192:0.4808:0.0:0.0	.	348;363;359	O95069-2;O95069;O95069-3	.;KCNK2_HUMAN;.	W	359;348;363	ENSP00000375765:R359W;ENSP00000375764:R348W;ENSP00000394033:R363W	ENSP00000375764:R348W	R	+	1	2	KCNK2	213474917	0.999000	0.42202	0.999000	0.59377	0.969000	0.65631	1.624000	0.37018	0.726000	0.32339	-0.314000	0.08810	CGG	.		0.547	KCNK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089856.2	NM_014217	
KCNQ3	3786	broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	133153487	133153487	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A5SL-01A-11D-A27I-10	TCGA-G3-A5SL-10A-01D-A27I-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70422e6d-cb1f-4284-8be9-1d4517ffad60	a38d4467-c3e5-4639-ad4f-88bcd7ab9f26	g.chr8:133153487C>T	ENST00000388996.4	-	10	1774	c.1354G>A	c.(1354-1356)Gcc>Acc	p.A452T	KCNQ3_ENST00000521134.1_Missense_Mutation_p.A332T|KCNQ3_ENST00000519445.1_Missense_Mutation_p.A452T	NM_004519.3	NP_004510.1	O43525	KCNQ3_HUMAN	potassium voltage-gated channel, KQT-like subfamily, member 3	452					axon guidance (GO:0007411)|membrane hyperpolarization (GO:0060081)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	axon initial segment (GO:0043194)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|potassium channel activity (GO:0005267)|voltage-gated potassium channel activity (GO:0005249)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(21)|lung(22)|ovary(2)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	70	Esophageal squamous(12;0.00507)|Ovarian(258;0.00579)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000311)		Amitriptyline(DB00321)|Diclofenac(DB00586)|Ezogabine(DB04953)|Meclofenamic acid(DB00939)	TCTTCTATGGCATCTACATTC	0.453																																					p.A452T		.											.	KCNQ3	138	0			c.G1354A						.						130.0	138.0	136.0					8																	133153487		2203	4300	6503	SO:0001583	missense	3786	exon10			CTATGGCATCTAC	AB208890	CCDS34943.1, CCDS56554.1	8q24	2012-07-05			ENSG00000184156	ENSG00000184156		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6297	protein-coding gene	gene with protein product		602232		EBN2		9425900, 16382104	Standard	NM_004519		Approved	Kv7.3	uc003ytj.3	O43525	OTTHUMG00000137472	ENST00000388996.4:c.1354G>A	8.37:g.133153487C>T	ENSP00000373648:p.Ala452Thr	131.0	1.0		231.0	58.0	NM_004519	A2VCT8|B4DJY4|E7EQ89	Missense_Mutation	SNP	ENST00000388996.4	37	CCDS34943.1	.	.	.	.	.	.	.	.	.	.	C	18.24	3.581265	0.65992	.	.	ENSG00000184156	ENST00000388996;ENST00000521134;ENST00000519445;ENST00000542679;ENST00000423790	D;D;D	0.99619	-6.28;-6.28;-6.28	5.63	5.63	0.86233	Potassium channel, voltage dependent, KCNQ, C-terminal (1);	0.113541	0.64402	D	0.000011	D	0.98623	0.9539	L	0.38175	1.15	0.34745	D	0.73114	P;P	0.49559	0.925;0.925	P;P	0.48270	0.572;0.572	D	0.99977	1.2288	10	0.08837	T	0.75	-23.7503	18.6978	0.91607	0.0:1.0:0.0:0.0	.	452;452	E7ET42;O43525	.;KCNQ3_HUMAN	T	452;332;452;441;331	ENSP00000373648:A452T;ENSP00000429799:A332T;ENSP00000428790:A452T	ENSP00000373648:A452T	A	-	1	0	KCNQ3	133222669	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	3.133000	0.50531	2.652000	0.90054	0.655000	0.94253	GCC	.		0.453	KCNQ3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268621.2	NM_004519	
KIAA0141	9812	broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	141313823	141313823	+	Silent	SNP	T	T	C			TCGA-G3-A5SL-01A-11D-A27I-10	TCGA-G3-A5SL-10A-01D-A27I-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70422e6d-cb1f-4284-8be9-1d4517ffad60	a38d4467-c3e5-4639-ad4f-88bcd7ab9f26	g.chr5:141313823T>C	ENST00000432126.2	+	9	1050	c.916T>C	c.(916-918)Ttg>Ctg	p.L306L	KIAA0141_ENST00000194118.4_Silent_p.L306L	NM_001142603.1|NM_014773.3	NP_001136075.1|NP_055588.3	Q14154	DELE_HUMAN	KIAA0141	306					extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)	mitochondrion (GO:0005739)				endometrium(3)|large_intestine(4)|lung(5)|skin(1)|urinary_tract(3)	16		all_hematologic(541;0.118)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TTATTATCAGTTGGCTGCCAG	0.532																																					p.L306L		.											.	KIAA0141	91	0			c.T916C						.						33.0	35.0	34.0					5																	141313823		2203	4300	6503	SO:0001819	synonymous_variant	9812	exon9			TATCAGTTGGCTG	BC011269	CCDS4268.1	5q31	2011-05-05			ENSG00000081791	ENSG00000081791			28969	protein-coding gene	gene with protein product	"""death ligand signal enhancer"""	615741				20563667	Standard	XM_005268549		Approved	DELE	uc003llt.3	Q14154	OTTHUMG00000129662	ENST00000432126.2:c.916T>C	5.37:g.141313823T>C		196.0	2.0		134.0	47.0	NM_001142603	Q969R4|Q96EU9	Silent	SNP	ENST00000432126.2	37	CCDS4268.1																																																																																			.		0.532	KIAA0141-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251863.2	NM_014773	
KIAA1429	25962	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	95523540	95523540	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A5SL-01A-11D-A27I-10	TCGA-G3-A5SL-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70422e6d-cb1f-4284-8be9-1d4517ffad60	a38d4467-c3e5-4639-ad4f-88bcd7ab9f26	g.chr8:95523540T>C	ENST00000297591.5	-	13	3338	c.3263A>G	c.(3262-3264)aAt>aGt	p.N1088S	KIAA1429_ENST00000437199.1_Missense_Mutation_p.N1088S|KIAA1429_ENST00000421249.2_Missense_Mutation_p.N1088S|KIAA1429_ENST00000523405.1_5'UTR	NM_015496.4	NP_056311.2	Q69YN4	VIR_HUMAN	KIAA1429	1088					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|kidney(5)|large_intestine(16)|lung(28)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	66	Breast(36;3.29e-05)		BRCA - Breast invasive adenocarcinoma(8;0.00185)			CCAAGTATTATTGGCCAGAGT	0.343																																					p.N1088S		.											.	KIAA1429	92	0			c.A3263G						.						43.0	44.0	43.0					8																	95523540		2203	4300	6503	SO:0001583	missense	25962	exon13			GTATTATTGGCCA	AB037850	CCDS34923.1, CCDS47894.1	8q22.1	2008-11-25			ENSG00000164944	ENSG00000164944			24500	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 121"""					10718198	Standard	NM_015496		Approved	DKFZP434I116, fSAP121	uc003ygo.2	Q69YN4	OTTHUMG00000164426	ENST00000297591.5:c.3263A>G	8.37:g.95523540T>C	ENSP00000297591:p.Asn1088Ser	58.0	0.0		180.0	23.0	NM_015496	Q2M1N0|Q6AHX9|Q6NT78|Q7Z6C7|Q8IXH4|Q9BTH4|Q9H9C9|Q9NWR3|Q9P2B8|Q9UFW1	Missense_Mutation	SNP	ENST00000297591.5	37	CCDS34923.1	.	.	.	.	.	.	.	.	.	.	T	10.61	1.397966	0.25205	.	.	ENSG00000164944	ENST00000297591;ENST00000437199;ENST00000421249	T;T;T	0.43294	0.95;0.95;0.95	5.38	2.95	0.34219	.	0.192146	0.53938	N	0.000056	T	0.21062	0.0507	N	0.12182	0.205	0.36989	D	0.894691	B;B	0.02656	0.0;0.0	B;B	0.06405	0.002;0.001	T	0.10894	-1.0610	10	0.17369	T	0.5	-20.6318	8.1915	0.31370	0.0:0.0699:0.1349:0.7952	.	1088;1088	Q69YN4-4;Q69YN4	.;VIR_HUMAN	S	1088	ENSP00000297591:N1088S;ENSP00000395600:N1088S;ENSP00000398390:N1088S	ENSP00000297591:N1088S	N	-	2	0	KIAA1429	95592716	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.565000	0.60836	0.413000	0.25759	0.528000	0.53228	AAT	.		0.343	KIAA1429-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378720.2	NM_015496	
KIAA1429	25962	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	95543221	95543221	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A5SL-01A-11D-A27I-10	TCGA-G3-A5SL-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70422e6d-cb1f-4284-8be9-1d4517ffad60	a38d4467-c3e5-4639-ad4f-88bcd7ab9f26	g.chr8:95543221C>T	ENST00000297591.5	-	6	652	c.577G>A	c.(577-579)Gat>Aat	p.D193N	KIAA1429_ENST00000437199.1_Missense_Mutation_p.D193N|KIAA1429_ENST00000421249.2_Missense_Mutation_p.D193N|RP11-267M23.3_ENST00000521010.1_RNA	NM_015496.4	NP_056311.2	Q69YN4	VIR_HUMAN	KIAA1429	193	Pro-rich.				mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|kidney(5)|large_intestine(16)|lung(28)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	66	Breast(36;3.29e-05)		BRCA - Breast invasive adenocarcinoma(8;0.00185)			TCTTCATCATCATCAGGTGGA	0.453																																					p.D193N		.											.	KIAA1429	92	0			c.G577A						.						121.0	111.0	115.0					8																	95543221		2203	4300	6503	SO:0001583	missense	25962	exon6			CATCATCATCAGG	AB037850	CCDS34923.1, CCDS47894.1	8q22.1	2008-11-25			ENSG00000164944	ENSG00000164944			24500	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 121"""					10718198	Standard	NM_015496		Approved	DKFZP434I116, fSAP121	uc003ygo.2	Q69YN4	OTTHUMG00000164426	ENST00000297591.5:c.577G>A	8.37:g.95543221C>T	ENSP00000297591:p.Asp193Asn	47.0	0.0		116.0	82.0	NM_015496	Q2M1N0|Q6AHX9|Q6NT78|Q7Z6C7|Q8IXH4|Q9BTH4|Q9H9C9|Q9NWR3|Q9P2B8|Q9UFW1	Missense_Mutation	SNP	ENST00000297591.5	37	CCDS34923.1	.	.	.	.	.	.	.	.	.	.	C	29.0	4.971393	0.92919	.	.	ENSG00000164944	ENST00000297591;ENST00000437199;ENST00000421249	T;T;T	0.46063	0.89;0.89;0.88	5.24	5.24	0.73138	.	0.114985	0.56097	D	0.000021	T	0.59115	0.2170	L	0.44542	1.39	0.80722	D	1	D;D	0.67145	0.996;0.996	D;D	0.77557	0.99;0.99	T	0.61574	-0.7035	10	0.72032	D	0.01	-17.1239	18.8146	0.92072	0.0:1.0:0.0:0.0	.	193;193	Q69YN4-4;Q69YN4	.;VIR_HUMAN	N	193	ENSP00000297591:D193N;ENSP00000395600:D193N;ENSP00000398390:D193N	ENSP00000297591:D193N	D	-	1	0	KIAA1429	95612397	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	6.944000	0.75940	2.435000	0.82474	0.585000	0.79938	GAT	.		0.453	KIAA1429-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378720.2	NM_015496	
KIAA1522	57648	broad.mit.edu;mdanderson.org	37	1	33236026	33236026	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A5SL-01A-11D-A27I-10	TCGA-G3-A5SL-10A-01D-A27I-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70422e6d-cb1f-4284-8be9-1d4517ffad60	a38d4467-c3e5-4639-ad4f-88bcd7ab9f26	g.chr1:33236026T>C	ENST00000373480.1	+	6	1172	c.1069T>C	c.(1069-1071)Tgg>Cgg	p.W357R	KIAA1522_ENST00000373481.3_Missense_Mutation_p.W368R|KIAA1522_ENST00000401073.2_Missense_Mutation_p.W416R|KIAA1522_ENST00000294521.3_Intron	NM_001198972.1	NP_001185901.1	Q9P206	K1522_HUMAN	KIAA1522	357	Ser-rich.									breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(2)|lung(5)|ovary(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	24		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Breast(348;0.244)				CAGTGACACCTGGAGCCACTC	0.657																																					p.W416R		.											.	KIAA1522	90	0			c.T1246C						.						20.0	24.0	23.0					1																	33236026		2077	4203	6280	SO:0001583	missense	57648	exon6			GACACCTGGAGCC	AL713671	CCDS41298.1, CCDS55588.1, CCDS55589.1	1p35.1	2009-02-18			ENSG00000162522	ENSG00000162522			29301	protein-coding gene	gene with protein product						10819331	Standard	NM_020888		Approved		uc001bvu.1	Q9P206	OTTHUMG00000008088	ENST00000373480.1:c.1069T>C	1.37:g.33236026T>C	ENSP00000362579:p.Trp357Arg	29.0	0.0		22.0	5.0	NM_020888	B4DQU8|B5MDY0|C9JH84|Q8TCQ0	Missense_Mutation	SNP	ENST00000373480.1	37	CCDS55588.1	.	.	.	.	.	.	.	.	.	.	T	11.15	1.553092	0.27739	.	.	ENSG00000162522	ENST00000401073;ENST00000373481;ENST00000373480	T;T;T	0.17854	2.25;2.27;2.29	4.42	4.42	0.53409	.	0.000000	0.64402	D	0.000012	T	0.26702	0.0653	L	0.43152	1.355	0.38423	D	0.946234	D;D;D	0.56521	0.976;0.976;0.976	P;P;P	0.55391	0.775;0.775;0.775	T	0.04440	-1.0951	10	0.41790	T	0.15	-9.5395	13.9719	0.64245	0.0:0.0:0.0:1.0	.	368;357;416	Q9P206-3;Q9P206;Q9P206-2	.;K1522_HUMAN;.	R	416;368;357	ENSP00000383851:W416R;ENSP00000362580:W368R;ENSP00000362579:W357R	ENSP00000362579:W357R	W	+	1	0	KIAA1522	33008613	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.653000	0.61462	1.741000	0.51731	0.459000	0.35465	TGG	.		0.657	KIAA1522-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000022130.1		
KLHL26	55295	broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	18779891	18779891	+	Missense_Mutation	SNP	T	T	G			TCGA-G3-A5SL-01A-11D-A27I-10	TCGA-G3-A5SL-10A-01D-A27I-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70422e6d-cb1f-4284-8be9-1d4517ffad60	a38d4467-c3e5-4639-ad4f-88bcd7ab9f26	g.chr19:18779891T>G	ENST00000300976.4	+	3	1774	c.1684T>G	c.(1684-1686)Tac>Gac	p.Y562D	KLHL26_ENST00000599006.1_Intron	NM_018316.1	NP_060786.1	Q53HC5	KLH26_HUMAN	kelch-like family member 26	562										breast(1)|central_nervous_system(1)|kidney(1)|lung(10)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	17						GAGGAAGATCTACATCGTCGG	0.632																																					p.Y562D		.											.	KLHL26	91	0			c.T1684G						.						32.0	35.0	34.0					19																	18779891		2203	4299	6502	SO:0001583	missense	55295	exon3			AAGATCTACATCG		CCDS12384.1	19p13.11	2013-10-15	2013-02-22		ENSG00000167487	ENSG00000167487		"""Kelch-like"", ""BTB/POZ domain containing"""	25623	protein-coding gene	gene with protein product			"""kelch-like 26 (Drosophila)"""				Standard	XM_006722785		Approved		uc002njz.1	Q53HC5	OTTHUMG00000183114	ENST00000300976.4:c.1684T>G	19.37:g.18779891T>G	ENSP00000300976:p.Tyr562Asp	123.0	2.0		64.0	26.0	NM_018316	Q8TAP0|Q9NUX3	Missense_Mutation	SNP	ENST00000300976.4	37	CCDS12384.1	.	.	.	.	.	.	.	.	.	.	T	16.12	3.032767	0.54790	.	.	ENSG00000167487	ENST00000300976	D	0.91686	-2.89	4.21	4.21	0.49690	Galactose oxidase, beta-propeller (1);	0.000000	0.64402	D	0.000001	D	0.96703	0.8924	M	0.93978	3.48	0.80722	D	1	D	0.89917	1.0	D	0.79108	0.992	D	0.97332	0.9951	9	.	.	.	.	12.4741	0.55803	0.0:0.0:0.0:1.0	.	562	Q53HC5	KLH26_HUMAN	D	562	ENSP00000300976:Y562D	.	Y	+	1	0	KLHL26	18640891	1.000000	0.71417	0.984000	0.44739	0.693000	0.40251	7.796000	0.85898	1.559000	0.49555	0.260000	0.18958	TAC	.		0.632	KLHL26-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465145.1	NM_018316	
KRT72	140807	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	12	52979943	52979943	+	Frame_Shift_Del	DEL	G	G	-	rs200611701		TCGA-G3-A5SL-01A-11D-A27I-10	TCGA-G3-A5SL-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70422e6d-cb1f-4284-8be9-1d4517ffad60	a38d4467-c3e5-4639-ad4f-88bcd7ab9f26	g.chr12:52979943delG	ENST00000537672.2	-	9	1369	c.1359delC	c.(1357-1359)agcfs	p.S453fs	KRT72_ENST00000398066.3_Frame_Shift_Del_p.S265fs|KRT72_ENST00000293745.2_Frame_Shift_Del_p.S453fs|KRT72_ENST00000354310.4_Frame_Shift_Del_p.S411fs	NM_001146225.1	NP_001139697.1	Q14CN4	K2C72_HUMAN	keratin 72	453	Tail.					extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(14)|ovary(5)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(2)	36				BRCA - Breast invasive adenocarcinoma(357;0.195)		CAGCATTGGTGCTGCTGATGA	0.587																																					p.S453fs		.											.	KRT72	96	0			c.1359delC						.						42.0	39.0	40.0					12																	52979943		2203	4300	6503	SO:0001589	frameshift_variant	140807	exon9			ATTGGTGCTGCTG	AY033495	CCDS8833.1, CCDS53795.1	12q13.13	2013-06-25			ENSG00000170486	ENSG00000170486		"""-"", ""Intermediate filaments type II, keratins (basic)"""	28932	protein-coding gene	gene with protein product		608246				12648212, 11703281, 16831889	Standard	NM_080747		Approved	K6IRS2, KRT6IRS2, KRT6, K6irs	uc001saq.2	Q14CN4	OTTHUMG00000169744	ENST00000537672.2:c.1359delC	12.37:g.52979943delG	ENSP00000441160:p.Ser453fs	68.0	0.0		82.0	28.0	NM_001146225	B4DEI8|H9KV51|Q8NA87|Q8WWY9|Q8WWZ0	Frame_Shift_Del	DEL	ENST00000537672.2	37	CCDS8833.1																																																																																			.		0.587	KRT72-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405693.1	NM_080747	
LAMA3	3909	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	18	21441703	21441703	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A5SL-01A-11D-A27I-10	TCGA-G3-A5SL-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70422e6d-cb1f-4284-8be9-1d4517ffad60	a38d4467-c3e5-4639-ad4f-88bcd7ab9f26	g.chr18:21441703C>A	ENST00000313654.9	+	35	4757	c.4516C>A	c.(4516-4518)Ctc>Atc	p.L1506I	LAMA3_ENST00000399516.3_Missense_Mutation_p.L1506I	NM_198129.1	NP_937762.1	Q16787	LAMA3_HUMAN	laminin, alpha 3	1506	Laminin IV type A. {ECO:0000255|PROSITE- ProRule:PRU00458}.				cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|endodermal cell differentiation (GO:0035987)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-5 complex (GO:0005610)	structural molecule activity (GO:0005198)			NS(2)|breast(4)|central_nervous_system(3)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(24)|lung(54)|ovary(8)|prostate(6)|skin(7)|urinary_tract(4)	128	all_cancers(21;7.81e-05)|all_epithelial(16;4.45e-07)|Lung NSC(20;0.00156)|all_lung(20;0.00508)|Colorectal(14;0.0202)|Ovarian(20;0.17)					GGTGGCGGATCTCCAGGAGCT	0.587																																					p.L1506I		.											.	LAMA3	100	0			c.C4516A						.						41.0	44.0	43.0					18																	21441703		2032	4186	6218	SO:0001583	missense	3909	exon35			GCGGATCTCCAGG	L34155	CCDS11880.1, CCDS42419.1, CCDS45838.1, CCDS59307.1	18q11.2	2013-03-01	2002-08-29		ENSG00000053747	ENSG00000053747		"""Laminins"""	6483	protein-coding gene	gene with protein product		600805	"""laminin, alpha 3 (nicein (150kD), kalinin (165kD), BM600 (150kD), epilegrin)"""	LAMNA		8077230	Standard	NM_000227		Approved	nicein-150kDa, kalinin-165kDa, BM600-150kDa, epiligrin	uc002kuq.3	Q16787	OTTHUMG00000131874	ENST00000313654.9:c.4516C>A	18.37:g.21441703C>A	ENSP00000324532:p.Leu1506Ile	125.0	0.0		136.0	58.0	NM_001127717	B0YJ33|Q13679|Q13680|Q6VU67|Q6VU68|Q6VU69|Q76E14|Q96TG0	Missense_Mutation	SNP	ENST00000313654.9	37	CCDS42419.1	.	.	.	.	.	.	.	.	.	.	C	11.35	1.613046	0.28712	.	.	ENSG00000053747	ENST00000313654;ENST00000399516;ENST00000416669	T;T	0.19806	2.13;2.12	5.5	1.38	0.22167	Laminin B type IV (1);Growth factor, receptor (1);	.	.	.	.	T	0.14960	0.0361	L	0.39898	1.24	0.80722	D	1	B;B	0.10296	0.002;0.003	B;B	0.09377	0.002;0.004	T	0.06661	-1.0814	9	0.36615	T	0.2	.	6.6861	0.23146	0.3415:0.291:0.3675:0.0	.	1506;1506	Q6VU67;Q16787	.;LAMA3_HUMAN	I	1506;1506;1504	ENSP00000324532:L1506I;ENSP00000382432:L1506I	ENSP00000324532:L1506I	L	+	1	0	LAMA3	19695701	1.000000	0.71417	0.988000	0.46212	0.251000	0.25915	1.414000	0.34736	0.589000	0.29677	0.555000	0.69702	CTC	.		0.587	LAMA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254824.3	NM_000227, NM_198129	
LDOC1L	84247	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	44893045	44893045	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A5SL-01A-11D-A27I-10	TCGA-G3-A5SL-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70422e6d-cb1f-4284-8be9-1d4517ffad60	a38d4467-c3e5-4639-ad4f-88bcd7ab9f26	g.chr22:44893045G>A	ENST00000341255.3	-	2	901	c.392C>T	c.(391-393)cCg>cTg	p.P131L		NM_032287.2	NP_115663.2	Q6ICC9	LDOCL_HUMAN	leucine zipper, down-regulated in cancer 1-like	131										breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(2)|ovary(3)|prostate(2)	11		Ovarian(80;0.024)|all_neural(38;0.0416)		LUAD - Lung adenocarcinoma(64;0.0161)		GGCCTCACCCGGGAAGCGGGA	0.637																																					p.P131L		.											.	LDOC1L	69	0			c.C392T						.						38.0	42.0	41.0					22																	44893045		2203	4300	6503	SO:0001583	missense	84247	exon2			TCACCCGGGAAGC	CR456439	CCDS33662.1	22q13.3	2006-09-06			ENSG00000188636	ENSG00000188636			13343	protein-coding gene	gene with protein product						15716091, 16093683	Standard	NM_032287		Approved	dJ1033E15.2, DKFZp761O17121, Mart6, Mar6	uc003beu.1	Q6ICC9	OTTHUMG00000150465	ENST00000341255.3:c.392C>T	22.37:g.44893045G>A	ENSP00000340434:p.Pro131Leu	64.0	0.0		55.0	30.0	NM_032287	Q6ZTR1	Missense_Mutation	SNP	ENST00000341255.3	37	CCDS33662.1	.	.	.	.	.	.	.	.	.	.	G	19.26	3.793126	0.70452	.	.	ENSG00000188636	ENST00000341255	T	0.22539	1.95	3.27	3.27	0.37495	.	0.284835	0.22798	N	0.055509	T	0.29223	0.0727	L	0.29908	0.895	0.40101	D	0.976373	D	0.89917	1.0	D	0.66716	0.946	T	0.03157	-1.1066	10	0.51188	T	0.08	-18.2845	10.3019	0.43656	0.0:0.0:1.0:0.0	.	131	Q6ICC9	LDOCL_HUMAN	L	131	ENSP00000340434:P131L	ENSP00000340434:P131L	P	-	2	0	LDOC1L	43271709	0.992000	0.36948	0.728000	0.30774	0.956000	0.61745	3.769000	0.55303	2.139000	0.66308	0.591000	0.81541	CCG	.		0.637	LDOC1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318222.1	NM_032287	
LGI2	55203	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	25005084	25005084	+	Missense_Mutation	SNP	A	A	C			TCGA-G3-A5SL-01A-11D-A27I-10	TCGA-G3-A5SL-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70422e6d-cb1f-4284-8be9-1d4517ffad60	a38d4467-c3e5-4639-ad4f-88bcd7ab9f26	g.chr4:25005084A>C	ENST00000382114.4	-	8	1812	c.1627T>G	c.(1627-1629)Tta>Gta	p.L543V		NM_018176.3	NP_060646.2	Q8N0V4	LGI2_HUMAN	leucine-rich repeat LGI family, member 2	543						extracellular region (GO:0005576)				breast(2)|endometrium(2)|kidney(2)|large_intestine(6)|lung(15)|prostate(1)|skin(3)|stomach(2)	33		Breast(46;0.173)				CACAAACTTAAGTCAACAATT	0.388																																					p.L543V		.											.	LGI2	90	0			c.T1627G						.						47.0	49.0	49.0					4																	25005084		2203	4299	6502	SO:0001583	missense	55203	exon8			AACTTAAGTCAAC	AJ487516	CCDS3431.1	4p15.31	2008-07-28			ENSG00000153012	ENSG00000153012			18710	protein-coding gene	gene with protein product		608301				12023020, 16014869	Standard	NM_018176		Approved	KIAA1916, FLJ10675	uc003grf.2	Q8N0V4	OTTHUMG00000097749	ENST00000382114.4:c.1627T>G	4.37:g.25005084A>C	ENSP00000371548:p.Leu543Val	77.0	0.0		46.0	15.0	NM_018176	Q3MIN2|Q8NDW6|Q96PX2|Q9NVK4	Missense_Mutation	SNP	ENST00000382114.4	37	CCDS3431.1	.	.	.	.	.	.	.	.	.	.	A	15.29	2.788376	0.49997	.	.	ENSG00000153012	ENST00000382114;ENST00000282970	T	0.69561	-0.41	5.57	0.42	0.16444	.	0.000000	0.64402	D	0.000001	T	0.76414	0.3984	M	0.77313	2.365	0.47065	D	0.999305	D	0.61080	0.989	D	0.63488	0.915	T	0.75028	-0.3462	10	0.87932	D	0	-18.4185	9.2079	0.37300	0.649:0.0:0.351:0.0	.	543	Q8N0V4	LGI2_HUMAN	V	543;191	ENSP00000371548:L543V	ENSP00000282970:L191V	L	-	1	2	LGI2	24614182	1.000000	0.71417	0.992000	0.48379	0.963000	0.63663	2.803000	0.47924	-0.127000	0.11661	-0.385000	0.06624	TTA	.		0.388	LGI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214978.1		
METTL16	79066	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	2310348	2310348	+	Missense_Mutation	SNP	T	T	A			TCGA-G3-A5SL-01A-11D-A27I-10	TCGA-G3-A5SL-10A-01D-A27I-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70422e6d-cb1f-4284-8be9-1d4517ffad60	a38d4467-c3e5-4639-ad4f-88bcd7ab9f26	g.chr17:2310348T>A	ENST00000609667.1	-	3	503	c.424A>T	c.(424-426)Att>Ttt	p.I142F																								AGGAAAGAAATGCAGTTCAGA	0.537																																					.		.											.	.	.	0			.						.						70.0	71.0	71.0					17																	2310348		1919	4119	6038	SO:0001583	missense	0	.			AAGAAATGCAGTT																												ENST00000609667.1:c.424A>T	17.37:g.2310348T>A	ENSP00000476359:p.Ile142Phe	106.0	0.0		70.0	29.0	.		RNA	SNP	ENST00000609667.1	37		.	.	.	.	.	.	.	.	.	.	T	15.90	2.970034	0.53614	.	.	ENSG00000205821	ENST00000381977	.	.	.	4.75	2.4	0.29515	.	.	.	.	.	T	0.60418	0.2267	.	.	.	.	.	.	D	0.76494	0.999	D	0.74674	0.984	T	0.65524	-0.6147	6	0.87932	D	0	.	3.9062	0.09183	0.0:0.1163:0.2187:0.6649	.	142	Q4G0H6	.	F	142	.	ENSP00000371404:I142F	I	-	1	0	AC006435.1	2257098	0.996000	0.38824	0.995000	0.50966	0.971000	0.66376	0.089000	0.15002	0.805000	0.34159	0.533000	0.62120	ATT	.		0.537	AC006435.1-201	KNOWN	basic|appris_principal	protein_coding	protein_coding			
LRP5	4041	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	68181295	68181295	+	Missense_Mutation	SNP	T	T	G			TCGA-G3-A5SL-01A-11D-A27I-10	TCGA-G3-A5SL-10A-01D-A27I-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70422e6d-cb1f-4284-8be9-1d4517ffad60	a38d4467-c3e5-4639-ad4f-88bcd7ab9f26	g.chr11:68181295T>G	ENST00000294304.7	+	12	2748	c.2642T>G	c.(2641-2643)cTc>cGc	p.L881R		NM_002335.2	NP_002326.2	O75197	LRP5_HUMAN	low density lipoprotein receptor-related protein 5	881	Beta-propeller 3.				adipose tissue development (GO:0060612)|anatomical structure regression (GO:0060033)|anterior/posterior pattern specification (GO:0009952)|apoptotic process involved in patterning of blood vessels (GO:1902262)|bone marrow development (GO:0048539)|bone morphogenesis (GO:0060349)|bone remodeling (GO:0046849)|branching involved in mammary gland duct morphogenesis (GO:0060444)|canonical Wnt signaling pathway (GO:0060070)|cell migration involved in gastrulation (GO:0042074)|cell-cell signaling involved in mammary gland development (GO:0060764)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic digit morphogenesis (GO:0042733)|embryonic limb morphogenesis (GO:0030326)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|endocytosis (GO:0006897)|extracellular matrix-cell signaling (GO:0035426)|gastrulation with mouth forming second (GO:0001702)|glucose catabolic process (GO:0006007)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of protein serine/threonine kinase activity (GO:0071901)|osteoblast development (GO:0002076)|positive regulation of cell proliferation (GO:0008284)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of mitosis (GO:0045840)|positive regulation of osteoblast proliferation (GO:0033690)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of apoptotic process (GO:0042981)|regulation of blood pressure (GO:0008217)|regulation of bone remodeling (GO:0046850)|regulation of canonical Wnt signaling pathway (GO:0060828)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|response to peptide hormone (GO:0043434)|retina morphogenesis in camera-type eye (GO:0060042)|retinal blood vessel morphogenesis (GO:0061304)|somatic stem cell maintenance (GO:0035019)|Wnt signaling pathway (GO:0016055)|Wnt signaling pathway involved in dorsal/ventral axis specification (GO:0044332)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	coreceptor activity (GO:0015026)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			autonomic_ganglia(1)|breast(3)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(24)|ovary(5)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	63						AACCGCACCCTCATCCAGGGC	0.582																																					p.L881R		.											.	LRP5	661	0			c.T2642G						.						90.0	79.0	83.0					11																	68181295		2200	4294	6494	SO:0001583	missense	4041	exon12			GCACCCTCATCCA	AF064548	CCDS8181.1	11q13.4	2014-01-28	2003-03-12		ENSG00000162337	ENSG00000162337		"""Low density lipoprotein receptors"""	6697	protein-coding gene	gene with protein product		603506	"""osteoporosis pseudoglioma syndrome"", ""exudative vitreoretinopathy 1"""	LRP7, OPPG, EVR1		9714764, 10049586	Standard	XM_005273994		Approved	LR3, BMND1, HBM, OPS, OPTA1, VBCH2, EVR4	uc001ont.3	O75197	OTTHUMG00000167570	ENST00000294304.7:c.2642T>G	11.37:g.68181295T>G	ENSP00000294304:p.Leu881Arg	137.0	1.0		83.0	29.0	NM_002335	Q96TD6|Q9UES7|Q9UP66	Missense_Mutation	SNP	ENST00000294304.7	37	CCDS8181.1	.	.	.	.	.	.	.	.	.	.	T	15.80	2.941009	0.53079	.	.	ENSG00000162337	ENST00000294304	D	0.97642	-4.47	5.02	5.02	0.67125	Six-bladed beta-propeller, TolB-like (1);	0.000000	0.39544	U	0.001325	D	0.92077	0.7489	N	0.17278	0.47	0.58432	D	0.999999	B;B	0.12013	0.005;0.005	B;B	0.20384	0.029;0.029	D	0.88573	0.3131	10	0.07813	T	0.8	.	14.9048	0.70709	0.0:0.0:0.0:1.0	.	881;881	Q9UES7;O75197	.;LRP5_HUMAN	R	881	ENSP00000294304:L881R	ENSP00000294304:L881R	L	+	2	0	LRP5	67937871	0.996000	0.38824	0.997000	0.53966	0.980000	0.70556	5.773000	0.68898	2.102000	0.63906	0.459000	0.35465	CTC	.		0.582	LRP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395088.1	NM_002335	
LRP5	4041	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	68216342	68216342	+	Missense_Mutation	SNP	A	A	T			TCGA-G3-A5SL-01A-11D-A27I-10	TCGA-G3-A5SL-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70422e6d-cb1f-4284-8be9-1d4517ffad60	a38d4467-c3e5-4639-ad4f-88bcd7ab9f26	g.chr11:68216342A>T	ENST00000294304.7	+	23	4758	c.4652A>T	c.(4651-4653)gAc>gTc	p.D1551V	LRP5_ENST00000529481.1_3'UTR	NM_002335.2	NP_002326.2	O75197	LRP5_HUMAN	low density lipoprotein receptor-related protein 5	1551	Pro-rich.				adipose tissue development (GO:0060612)|anatomical structure regression (GO:0060033)|anterior/posterior pattern specification (GO:0009952)|apoptotic process involved in patterning of blood vessels (GO:1902262)|bone marrow development (GO:0048539)|bone morphogenesis (GO:0060349)|bone remodeling (GO:0046849)|branching involved in mammary gland duct morphogenesis (GO:0060444)|canonical Wnt signaling pathway (GO:0060070)|cell migration involved in gastrulation (GO:0042074)|cell-cell signaling involved in mammary gland development (GO:0060764)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic digit morphogenesis (GO:0042733)|embryonic limb morphogenesis (GO:0030326)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|endocytosis (GO:0006897)|extracellular matrix-cell signaling (GO:0035426)|gastrulation with mouth forming second (GO:0001702)|glucose catabolic process (GO:0006007)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of protein serine/threonine kinase activity (GO:0071901)|osteoblast development (GO:0002076)|positive regulation of cell proliferation (GO:0008284)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of mitosis (GO:0045840)|positive regulation of osteoblast proliferation (GO:0033690)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of apoptotic process (GO:0042981)|regulation of blood pressure (GO:0008217)|regulation of bone remodeling (GO:0046850)|regulation of canonical Wnt signaling pathway (GO:0060828)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|response to peptide hormone (GO:0043434)|retina morphogenesis in camera-type eye (GO:0060042)|retinal blood vessel morphogenesis (GO:0061304)|somatic stem cell maintenance (GO:0035019)|Wnt signaling pathway (GO:0016055)|Wnt signaling pathway involved in dorsal/ventral axis specification (GO:0044332)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	coreceptor activity (GO:0015026)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			autonomic_ganglia(1)|breast(3)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(24)|ovary(5)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	63						TGTGACAGCGACTACAGCGCC	0.617																																					p.D1551V		.											.	LRP5	661	0			c.A4652T						.						79.0	59.0	66.0					11																	68216342		2200	4294	6494	SO:0001583	missense	4041	exon23			ACAGCGACTACAG	AF064548	CCDS8181.1	11q13.4	2014-01-28	2003-03-12		ENSG00000162337	ENSG00000162337		"""Low density lipoprotein receptors"""	6697	protein-coding gene	gene with protein product		603506	"""osteoporosis pseudoglioma syndrome"", ""exudative vitreoretinopathy 1"""	LRP7, OPPG, EVR1		9714764, 10049586	Standard	XM_005273994		Approved	LR3, BMND1, HBM, OPS, OPTA1, VBCH2, EVR4	uc001ont.3	O75197	OTTHUMG00000167570	ENST00000294304.7:c.4652A>T	11.37:g.68216342A>T	ENSP00000294304:p.Asp1551Val	92.0	0.0		62.0	24.0	NM_002335	Q96TD6|Q9UES7|Q9UP66	Missense_Mutation	SNP	ENST00000294304.7	37	CCDS8181.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	15.95|15.95	2.984412|2.984412	0.53934|0.53934	.|.	.|.	ENSG00000162337|ENSG00000162337	ENST00000294304|ENST00000529702	D|.	0.94723|.	-3.5|.	4.73|4.73	4.73|4.73	0.59995|0.59995	.|.	0.000000|.	0.47455|.	U|.	0.000223|.	T|T	0.70351|0.70351	0.3214|0.3214	M|M	0.63428|0.63428	1.95|1.95	0.80722|0.80722	D|D	1|1	P;P|.	0.48294|.	0.908;0.908|.	P;P|.	0.46885|.	0.53;0.53|.	T|T	0.70230|0.70230	-0.4929|-0.4929	10|5	0.48119|.	T|.	0.1|.	.|.	14.4536|14.4536	0.67401|0.67401	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	1551;1551|.	Q9UES7;O75197|.	.;LRP5_HUMAN|.	V|S	1551|108	ENSP00000294304:D1551V|.	ENSP00000294304:D1551V|.	D|T	+|+	2|1	0|0	LRP5|LRP5	67972918|67972918	1.000000|1.000000	0.71417|0.71417	0.995000|0.995000	0.50966|0.50966	0.077000|0.077000	0.17291|0.17291	6.865000|6.865000	0.75500|0.75500	2.003000|2.003000	0.58678|0.58678	0.454000|0.454000	0.30748|0.30748	GAC|ACT	.		0.617	LRP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395088.1	NM_002335	
MAGEE2	139599	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	75003638	75003638	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A5SL-01A-11D-A27I-10	TCGA-G3-A5SL-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70422e6d-cb1f-4284-8be9-1d4517ffad60	a38d4467-c3e5-4639-ad4f-88bcd7ab9f26	g.chrX:75003638G>A	ENST00000373359.2	-	1	1441	c.1249C>T	c.(1249-1251)Cgt>Tgt	p.R417C		NM_138703.4	NP_619648.1	Q8TD90	MAGE2_HUMAN	melanoma antigen family E, 2	417	MAGE 2. {ECO:0000255|PROSITE- ProRule:PRU00127}.									autonomic_ganglia(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(17)|ovary(1)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34						TCTTTGACACGGTTGCCCATC	0.473																																					p.R417C		.											.	MAGEE2	132	0			c.C1249T						.						146.0	124.0	132.0					X																	75003638		2203	4300	6503	SO:0001583	missense	139599	exon1			TGACACGGTTGCC	AF490509	CCDS14431.1	Xq13	2008-02-05			ENSG00000186675	ENSG00000186675			24935	protein-coding gene	gene with protein product		300760				11454705	Standard	NM_138703		Approved	HCA3	uc004ecj.2	Q8TD90	OTTHUMG00000021870	ENST00000373359.2:c.1249C>T	X.37:g.75003638G>A	ENSP00000362457:p.Arg417Cys	96.0	0.0		91.0	62.0	NM_138703	Q5JSI5	Missense_Mutation	SNP	ENST00000373359.2	37	CCDS14431.1	.	.	.	.	.	.	.	.	.	.	G	10.23	1.292589	0.23564	.	.	ENSG00000186675	ENST00000373359	T	0.04862	3.54	2.5	1.62	0.23740	.	.	.	.	.	T	0.03608	0.0103	N	0.16708	0.43	0.37083	D	0.899066	B	0.29671	0.254	B	0.24848	0.056	T	0.44174	-0.9345	9	0.56958	D	0.05	.	4.583	0.12267	0.1922:0.0:0.8078:0.0	.	417	Q8TD90	MAGE2_HUMAN	C	417	ENSP00000362457:R417C	ENSP00000362457:R417C	R	-	1	0	MAGEE2	74920363	1.000000	0.71417	0.988000	0.46212	0.697000	0.40408	1.339000	0.33885	0.468000	0.27243	0.422000	0.28245	CGT	.		0.473	MAGEE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057288.1	NM_138703	
PCNXL3	399909	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	65380716	65380716	+	5'Flank	SNP	A	A	T			TCGA-G3-A5SL-01A-11D-A27I-10	TCGA-G3-A5SL-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70422e6d-cb1f-4284-8be9-1d4517ffad60	a38d4467-c3e5-4639-ad4f-88bcd7ab9f26	g.chr11:65380716A>T	ENST00000355703.3	+	0	0				MAP3K11_ENST00000309100.3_Missense_Mutation_p.L171Q|MAP3K11_ENST00000530153.1_5'Flank	NM_032223.2	NP_115599.2	Q9H6A9	PCX3_HUMAN	pecanex-like 3 (Drosophila)							integral component of membrane (GO:0016021)				breast(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(6)|prostate(1)	13						GGGGTGTGCCAGCATGGCGAA	0.647																																					p.L171Q		.											.	MAP3K11	980	0			c.T512A						.						49.0	48.0	49.0					11																	65380716		2201	4297	6498	SO:0001631	upstream_gene_variant	4296	exon1			TGTGCCAGCATGG	BX640978	CCDS44650.1	11q12.1	2008-07-21			ENSG00000197136	ENSG00000197136			18760	protein-coding gene	gene with protein product						15146197	Standard	NM_032223		Approved	FLJ22427	uc001oey.2	Q9H6A9	OTTHUMG00000166539		11.37:g.65380716A>T	Exception_encountered	149.0	0.0		85.0	31.0	NM_002419	Q6MZN8	Missense_Mutation	SNP	ENST00000355703.3	37	CCDS44650.1	.	.	.	.	.	.	.	.	.	.	A	21.0	4.084318	0.76642	.	.	ENSG00000173327	ENST00000309100	D	0.95518	-3.73	3.79	3.79	0.43588	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.51477	D	0.000090	D	0.98036	0.9353	H	0.94503	3.545	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.98344	1.0540	10	0.87932	D	0	.	10.5536	0.45103	1.0:0.0:0.0:0.0	.	171	Q16584	M3K11_HUMAN	Q	171	ENSP00000309597:L171Q	ENSP00000309597:L171Q	L	-	2	0	MAP3K11	65137292	1.000000	0.71417	0.998000	0.56505	0.929000	0.56500	8.951000	0.93025	1.594000	0.50039	0.460000	0.39030	CTG	.		0.647	PCNXL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390321.1	NM_032223	
MAP3K8	1326	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	30747090	30747090	+	Silent	SNP	C	C	A			TCGA-G3-A5SL-01A-11D-A27I-10	TCGA-G3-A5SL-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70422e6d-cb1f-4284-8be9-1d4517ffad60	a38d4467-c3e5-4639-ad4f-88bcd7ab9f26	g.chr10:30747090C>A	ENST00000263056.1	+	7	1647	c.951C>A	c.(949-951)ctC>ctA	p.L317L	MAP3K8_ENST00000542547.1_Silent_p.L317L|MAP3K8_ENST00000375321.1_Silent_p.L317L	NM_001244134.1|NM_005204.3	NP_001231063.1|NP_005195.2	P41279	M3K8_HUMAN	mitogen-activated protein kinase kinase kinase 8	317	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell cycle (GO:0007049)|protein phosphorylation (GO:0006468)|T cell costimulation (GO:0031295)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|MAP kinase kinase kinase activity (GO:0004709)|protein serine/threonine kinase activity (GO:0004674)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	23		Prostate(175;0.151)				GGGCCACGCTCATCCACATGC	0.557																																					p.L317L		.											.	MAP3K8	981	0			c.C951A						.						79.0	78.0	78.0					10																	30747090		2203	4300	6503	SO:0001819	synonymous_variant	1326	exon6			CACGCTCATCCAC	D14497	CCDS7166.1	10p11.2	2011-06-09			ENSG00000107968	ENSG00000107968		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6860	protein-coding gene	gene with protein product		191195		COT, ESTF		2072910, 8479752	Standard	NM_005204		Approved	Tpl-2, EST, c-COT, MEKK8	uc009xlf.2	P41279	OTTHUMG00000017889	ENST00000263056.1:c.951C>A	10.37:g.30747090C>A		147.0	0.0		150.0	54.0	NM_001244134	A8K2Q5|D3DRX1|Q14275|Q5T855|Q9HC81	Silent	SNP	ENST00000263056.1	37	CCDS7166.1																																																																																			.		0.557	MAP3K8-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047416.2	NM_005204	
MIR518C	574477	broad.mit.edu;ucsc.edu;mdanderson.org	37	19	54214331	54214331	+	RNA	SNP	T	T	C			TCGA-G3-A5SL-01A-11D-A27I-10	TCGA-G3-A5SL-10A-01D-A27I-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70422e6d-cb1f-4284-8be9-1d4517ffad60	a38d4467-c3e5-4639-ad4f-88bcd7ab9f26	g.chr19:54214331T>C	ENST00000384822.1	+	0	101				MIR524_ENST00000385242.1_RNA|MIR517A_ENST00000385001.1_RNA|MIR519D_ENST00000385246.1_RNA	NR_030199.1				microRNA 518c																		TTTGGAGTGTTACGGTTTGAG	0.458																																					.		.											.	.	.	0			.						.						104.0	96.0	98.0					19																	54214331		1568	3582	5150			574478	.			GAGTGTTACGGTT			19q13.42	2011-09-12		2008-12-18	ENSG00000207553	ENSG00000207553		"""ncRNAs / Micro RNAs"""	32109	non-coding RNA	RNA, micro				MIRN518C			Standard	NR_030199		Approved	hsa-mir-518c	uc021vac.1				19.37:g.54214331T>C		171.0	0.0		86.0	23.0	.		RNA	SNP	ENST00000384822.1	37																																																																																				.		0.458	MIR518C-201	KNOWN	basic	miRNA	miRNA		NR_030199	
MNDA	4332	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	158813151	158813151	+	Silent	SNP	C	C	T			TCGA-G3-A5SL-01A-11D-A27I-10	TCGA-G3-A5SL-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70422e6d-cb1f-4284-8be9-1d4517ffad60	a38d4467-c3e5-4639-ad4f-88bcd7ab9f26	g.chr1:158813151C>T	ENST00000368141.4	+	3	609	c.348C>T	c.(346-348)ccC>ccT	p.P116P		NM_002432.1	NP_002423.1	P41218	MNDA_HUMAN	myeloid cell nuclear differentiation antigen	116					B cell receptor signaling pathway (GO:0050853)|cellular defense response (GO:0006968)|cellular response to DNA damage stimulus (GO:0006974)|negative regulation of B cell proliferation (GO:0030889)|positive regulation of apoptotic process (GO:0043065)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	DNA binding (GO:0003677)	p.P116P(1)		NS(2)|breast(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|liver(1)|lung(26)|ovary(2)|prostate(4)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	65	all_hematologic(112;0.0378)					CACCTGCACCCACCGCAAGAA	0.438																																					p.P116P		.											.	MNDA	94	1	Substitution - coding silent(1)	lung(1)	c.C348T						.						60.0	54.0	56.0					1																	158813151		2203	4300	6503	SO:0001819	synonymous_variant	4332	exon3			TGCACCCACCGCA	BC032319	CCDS1177.1	1q22	2008-02-05			ENSG00000163563	ENSG00000163563			7183	protein-coding gene	gene with protein product		159553				1644857, 7512843	Standard	NM_002432		Approved	PYHIN3	uc001fsz.1	P41218	OTTHUMG00000022776	ENST00000368141.4:c.348C>T	1.37:g.158813151C>T		181.0	0.0		315.0	65.0	NM_002432		Silent	SNP	ENST00000368141.4	37	CCDS1177.1																																																																																			.		0.438	MNDA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059069.1	NM_002432	
MPI	4351	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	15	75182913	75182914	+	Frame_Shift_Ins	INS	-	-	G			TCGA-G3-A5SL-01A-11D-A27I-10	TCGA-G3-A5SL-10A-01D-A27I-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70422e6d-cb1f-4284-8be9-1d4517ffad60	a38d4467-c3e5-4639-ad4f-88bcd7ab9f26	g.chr15:75182913_75182914insG	ENST00000352410.4	+	2	129_130	c.62_63insG	c.(61-66)atgggtfs	p.MG21fs	MPI_ENST00000562606.1_Start_Codon_Ins|MPI_ENST00000323744.6_Frame_Shift_Ins_p.MG21fs|MPI_ENST00000535694.1_Intron|MPI_ENST00000566377.1_Frame_Shift_Ins_p.MG21fs|MPI_ENST00000564003.1_Intron|MPI_ENST00000565576.1_Frame_Shift_Ins_p.MG21fs|MPI_ENST00000563786.1_Start_Codon_Ins|MPI_ENST00000563422.1_Frame_Shift_Ins_p.MG21fs			P34949	MPI_HUMAN	mannose phosphate isomerase	21					cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|GDP-mannose biosynthetic process (GO:0009298)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	mannose-6-phosphate isomerase activity (GO:0004476)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(1)|large_intestine(1)|lung(2)|ovary(2)|upper_aerodigestive_tract(1)	9						TGGGGGAAGATGGGTTCCAACA	0.609																																					p.M21fs		.											.	MPI	92	0			c.62_63insG						.																																			SO:0001589	frameshift_variant	4351	exon2			GGAAGATGGGTTC		CCDS10272.1, CCDS73756.1, CCDS73757.1, CCDS73758.1	15q24.1	2013-09-19			ENSG00000178802	ENSG00000178802	5.3.1.8		7216	protein-coding gene	gene with protein product	"""mannose-6-phosphate isomerase"""	154550					Standard	NM_002435		Approved		uc002azc.1	P34949	OTTHUMG00000142826	ENST00000352410.4:c.65dupG	15.37:g.75182916_75182916dupG	ENSP00000318318:p.Met21fs	112.0	0.0		80.0	21.0	NM_002435	A8K8K9|Q96AB0	Frame_Shift_Ins	INS	ENST00000352410.4	37	CCDS10272.1																																																																																			.		0.609	MPI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286418.4		
MYH7	4625	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	23898464	23898464	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A5SL-01A-11D-A27I-10	TCGA-G3-A5SL-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70422e6d-cb1f-4284-8be9-1d4517ffad60	a38d4467-c3e5-4639-ad4f-88bcd7ab9f26	g.chr14:23898464C>T	ENST00000355349.3	-	13	1393	c.1231G>A	c.(1231-1233)Gtc>Atc	p.V411I		NM_000257.2	NP_000248.2	P12883	MYH7_HUMAN	myosin, heavy chain 7, cardiac muscle, beta	411	Myosin motor.		V -> I (in CMH1). {ECO:0000269|PubMed:12974739, ECO:0000269|PubMed:12975413, ECO:0000269|PubMed:15858117}.		adult heart development (GO:0007512)|ATP catabolic process (GO:0006200)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|regulation of heart rate (GO:0002027)|regulation of the force of heart contraction (GO:0002026)|striated muscle contraction (GO:0006941)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|muscle myosin complex (GO:0005859)|myosin complex (GO:0016459)|myosin filament (GO:0032982)|nucleus (GO:0005634)|sarcomere (GO:0030017)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)			NS(3)|breast(4)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(19)|lung(57)|ovary(5)|prostate(9)|skin(5)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	137	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00725)		CCCTTGGTGACGTACTCATTG	0.567																																					p.V411I		.											.	MYH7	94	0			c.G1231A	GRCh37	CM032602	MYH7	M		.						158.0	134.0	142.0					14																	23898464		2203	4300	6503	SO:0001583	missense	4625	exon13			TGGTGACGTACTC	M58018	CCDS9601.1	14q11.2-q13	2014-09-17	2006-09-29		ENSG00000092054	ENSG00000092054		"""Myosins / Myosin superfamily : Class II"""	7577	protein-coding gene	gene with protein product		160760	"""myopathy, distal 1"", ""myosin, heavy polypeptide 7, cardiac muscle, beta"""	CMH1, MPD1		2494889, 8483915, 15322983	Standard	XM_005267696		Approved	CMD1S	uc001wjx.3	P12883	OTTHUMG00000028755	ENST00000355349.3:c.1231G>A	14.37:g.23898464C>T	ENSP00000347507:p.Val411Ile	215.0	0.0		169.0	62.0	NM_000257	A2TDB6|B6D424|Q14836|Q14837|Q14904|Q16579|Q2M1Y6|Q92679|Q9H1D5|Q9UDA2|Q9UMM8	Missense_Mutation	SNP	ENST00000355349.3	37	CCDS9601.1	.	.	.	.	.	.	.	.	.	.	c	20.6	4.025763	0.75390	.	.	ENSG00000092054	ENST00000355349;ENST00000544444	D	0.88896	-2.44	4.04	4.04	0.47022	Myosin head, motor domain (2);	.	.	.	.	D	0.92218	0.7532	L	0.48362	1.52	0.80722	D	1	D	0.57571	0.98	D	0.77004	0.989	D	0.93171	0.6566	9	0.66056	D	0.02	.	16.3734	0.83374	0.0:1.0:0.0:0.0	.	411	P12883	MYH7_HUMAN	I	411	ENSP00000347507:V411I	ENSP00000347507:V411I	V	-	1	0	MYH7	22968304	1.000000	0.71417	0.937000	0.37676	0.551000	0.35334	5.787000	0.69013	2.077000	0.62373	0.455000	0.32223	GTC	.		0.567	MYH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071798.3	NM_000257	
NELFE	7936	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	6	31926222	31926223	+	Start_Codon_Ins	INS	-	-	T			TCGA-G3-A5SL-01A-11D-A27I-10	TCGA-G3-A5SL-10A-01D-A27I-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70422e6d-cb1f-4284-8be9-1d4517ffad60	a38d4467-c3e5-4639-ad4f-88bcd7ab9f26	g.chr6:31926222_31926223insT	ENST00000375429.3	-	0	227_228				NELFE_ENST00000444811.2_Start_Codon_Ins|NELFE_ENST00000375425.5_Frame_Shift_Ins_p.M8fs|MIR1236_ENST00000408340.1_RNA|SKIV2L_ENST00000375394.2_5'Flank|SKIV2L_ENST00000544581.1_5'Flank	NM_002904.5	NP_002895.3	P18615	NELFE_HUMAN	negative elongation factor complex member E						gene expression (GO:0010467)|negative regulation of transcription elongation from RNA polymerase II promoter (GO:0034244)|positive regulation of viral transcription (GO:0050434)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	NELF complex (GO:0032021)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)										TATCACCAACATGGTGGCTCCT	0.564																																					p.M1fs		.											.	.	.	0			c.2_3insA						.																																			SO:0001582	initiator_codon_variant	7936	exon2			ACCAACATGGTGG	M33230	CCDS4730.1	6p21.3	2013-02-12	2013-01-31	2013-01-31	ENSG00000204356	ENSG00000204356		"""RNA binding motif (RRM) containing"""	13974	protein-coding gene	gene with protein product		154040	"""RD RNA-binding protein"", ""RD RNA binding protein"""	RDBP			Standard	XM_006715205		Approved	RD, D6S45, NELF-E, RDP	uc003nyk.3	P18615	OTTHUMG00000031046	ENST00000375429.3:c.2dupA	6.37:g.31926223_31926223dupT		93.0	0.0		111.0	28.0	NM_002904	A2BE08|B4DUN1|B4DYX9|Q5JP74|Q5JP75|Q96F56|Q9NPK2	Frame_Shift_Ins	INS	ENST00000375429.3	37	CCDS4730.1																																																																																			.		0.564	NELFE-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000076047.4		
NELL1	4745	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	21555918	21555918	+	Splice_Site	SNP	A	A	G			TCGA-G3-A5SL-01A-11D-A27I-10	TCGA-G3-A5SL-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70422e6d-cb1f-4284-8be9-1d4517ffad60	a38d4467-c3e5-4639-ad4f-88bcd7ab9f26	g.chr11:21555918A>G	ENST00000357134.5	+	16	1797		c.e16-1		NELL1_ENST00000298925.5_Splice_Site|NELL1_ENST00000529218.1_Splice_Site|NELL1_ENST00000325319.5_Splice_Site|NELL1_ENST00000532434.1_Intron	NM_006157.3|NM_201551.1	NP_006148.2|NP_963845.1	Q92832	NELL1_HUMAN	NEL-like 1 (chicken)						cell differentiation (GO:0030154)|negative regulation of cyclin catabolic process (GO:2000599)|negative regulation of osteoblast proliferation (GO:0033689)|nervous system development (GO:0007399)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|regulation of gene expression (GO:0010468)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|nuclear envelope (GO:0005635)|perinuclear region of cytoplasm (GO:0048471)	calcium ion binding (GO:0005509)			NS(1)|breast(3)|endometrium(5)|kidney(3)|large_intestine(15)|lung(36)|ovary(2)|prostate(3)|skin(1)|urinary_tract(1)	70						TCTCTGAGGCAGATATTGATG	0.433																																					.		.											.	NELL1	155	0			c.1646-2A>G						.						129.0	121.0	124.0					11																	21555918		2203	4300	6503	SO:0001630	splice_region_variant	4745	exon16			TGAGGCAGATATT	AK127805	CCDS7855.1, CCDS44555.1, CCDS73267.1, CCDS73268.1	11p15.1	2008-02-01	2001-11-28		ENSG00000165973	ENSG00000165973			7750	protein-coding gene	gene with protein product		602319	"""nel (chicken)-like 1"""			8975702	Standard	NM_006157		Approved	IDH3GL, FLJ45906	uc001mqe.3	Q92832	OTTHUMG00000166042	ENST00000357134.5:c.1646-1A>G	11.37:g.21555918A>G		66.0	0.0		103.0	29.0	NM_006157	B2CKC1|Q4VB90|Q4VB91|Q6NSY8|Q9Y472	Splice_Site	SNP	ENST00000357134.5	37	CCDS7855.1	.	.	.	.	.	.	.	.	.	.	A	23.1	4.378103	0.82682	.	.	ENSG00000165973	ENST00000298925;ENST00000357134;ENST00000325319	.	.	.	5.37	5.37	0.77165	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.3703	0.74557	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	NELL1	21512494	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.581000	0.90788	2.040000	0.60383	0.377000	0.23210	.	.		0.433	NELL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387588.1	NM_006157	Intron
NFATC4	4776	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	24839776	24839776	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A5SL-01A-11D-A27I-10	TCGA-G3-A5SL-10A-01D-A27I-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70422e6d-cb1f-4284-8be9-1d4517ffad60	a38d4467-c3e5-4639-ad4f-88bcd7ab9f26	g.chr14:24839776T>C	ENST00000250373.4	+	2	1313	c.1172T>C	c.(1171-1173)aTt>aCt	p.I391T	NFATC4_ENST00000554966.1_Missense_Mutation_p.I404T|NFATC4_ENST00000553879.1_Missense_Mutation_p.I321T|NFATC4_ENST00000555590.1_Missense_Mutation_p.I404T|NFATC4_ENST00000413692.2_Missense_Mutation_p.I454T|NFATC4_ENST00000539237.2_Missense_Mutation_p.I423T|NFATC4_ENST00000554591.1_Missense_Mutation_p.I454T|NFATC4_ENST00000553469.1_Missense_Mutation_p.I423T|NFATC4_ENST00000554661.1_Missense_Mutation_p.I321T|NFATC4_ENST00000556279.1_Missense_Mutation_p.I423T|NFATC4_ENST00000554473.1_5'Flank|NFATC4_ENST00000554344.1_Missense_Mutation_p.I321T|NFATC4_ENST00000553708.1_Missense_Mutation_p.I391T|NFATC4_ENST00000440487.2_3'UTR|NFATC4_ENST00000556169.1_Missense_Mutation_p.I379T|NFATC4_ENST00000557451.1_Missense_Mutation_p.I321T|NFATC4_ENST00000556759.1_5'Flank|NFATC4_ENST00000422617.3_Missense_Mutation_p.I379T|NFATC4_ENST00000554050.1_Missense_Mutation_p.I391T|NFATC4_ENST00000555167.1_5'Flank|NFATC4_ENST00000555453.1_Missense_Mutation_p.I379T|NFATC4_ENST00000424781.2_Missense_Mutation_p.I404T	NM_004554.4	NP_004545.2	Q14934	NFAC4_HUMAN	nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 4	391					cellular respiration (GO:0045333)|cellular response to lithium ion (GO:0071285)|cellular response to UV (GO:0034644)|heart development (GO:0007507)|inflammatory response (GO:0006954)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|muscle cell development (GO:0055001)|patterning of blood vessels (GO:0001569)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|regulation of synaptic plasticity (GO:0048167)|smooth muscle cell differentiation (GO:0051145)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|transcription coactivator activity (GO:0003713)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(7)|liver(4)|lung(12)|ovary(1)|skin(2)	34				GBM - Glioblastoma multiforme(265;0.018)		AAGGCCCGGATTGGGGGACAC	0.622																																					p.I454T		.											.	NFATC4	92	0			c.T1361C						.						40.0	39.0	39.0					14																	24839776		2203	4300	6503	SO:0001583	missense	4776	exon3			CCCGGATTGGGGG	BC053855	CCDS9629.1, CCDS45089.1, CCDS55909.1, CCDS55910.1, CCDS55911.1, CCDS73625.1	14q11.2	2009-11-24			ENSG00000100968	ENSG00000100968		"""Nuclear factor of activated T-cells"""	7778	protein-coding gene	gene with protein product		602699				7749981	Standard	NM_004554		Approved	NFAT3	uc010tok.2	Q14934	OTTHUMG00000029351	ENST00000250373.4:c.1172T>C	14.37:g.24839776T>C	ENSP00000250373:p.Ile391Thr	70.0	1.0		58.0	20.0	NM_001198967	B4DDG5|B4DY55|B5B2U7|B5B2U8|B5B2U9|B5B2V0|B5B2V1|B5B2V2|B5B2V3|B5B2V4|B5B2V5|B5B2V7|B5B2V8|B5B2V9|B5B2W0|B5B2W1|B5B2W2|B5B2W3|B5B2W4|B5B2W5|B5B2W6|B5B2W7|B5B2W8|B5B2W9|B5B2X0|Q7Z598|Q96H68	Missense_Mutation	SNP	ENST00000250373.4	37	CCDS9629.1	.	.	.	.	.	.	.	.	.	.	T	10.74	1.434373	0.25813	.	.	ENSG00000100968	ENST00000413692;ENST00000554591;ENST00000555590;ENST00000554966;ENST00000424781;ENST00000539237;ENST00000556279;ENST00000553469;ENST00000554050;ENST00000250373;ENST00000553708;ENST00000553879;ENST00000554344;ENST00000554661;ENST00000556169;ENST00000557451;ENST00000422617;ENST00000555453	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.10192	3.22;3.24;3.24;3.25;3.23;3.23;3.24;3.25;3.26;3.24;3.23;2.92;2.92;2.94;2.92;2.92;2.9;2.91	4.58	3.4	0.38934	.	0.150221	0.45867	D	0.000335	T	0.06005	0.0156	N	0.22421	0.69	0.80722	D	1	B;B;B;B;B;B;B;B;B;B;B;B;B;B	0.14805	0.001;0.001;0.003;0.008;0.003;0.003;0.003;0.008;0.008;0.001;0.008;0.011;0.008;0.0	B;B;B;B;B;B;B;B;B;B;B;B;B;B	0.12156	0.005;0.003;0.005;0.007;0.005;0.005;0.005;0.007;0.007;0.005;0.007;0.005;0.007;0.002	T	0.20338	-1.0278	10	0.06494	T	0.89	-3.1861	8.7492	0.34605	0.0:0.0924:0.0:0.9076	.	379;379;423;423;404;404;404;454;454;379;423;368;454;391	Q14934-17;Q14934-9;Q14934-14;Q14934-4;Q14934-15;Q14934-6;Q14934-7;Q14934-2;Q14934-3;Q14934-10;Q14934-5;B4DU09;Q14934-11;Q14934	.;.;.;.;.;.;.;.;.;.;.;.;.;NFAC4_HUMAN	T	454;454;404;404;404;423;423;423;391;391;391;321;321;321;379;321;379;379	ENSP00000388910:I454T;ENSP00000452039:I454T;ENSP00000451224:I404T;ENSP00000450644:I404T;ENSP00000388668:I404T;ENSP00000439350:I423T;ENSP00000452270:I423T;ENSP00000451502:I423T;ENSP00000451151:I391T;ENSP00000250373:I391T;ENSP00000450590:I391T;ENSP00000452349:I321T;ENSP00000450469:I321T;ENSP00000450733:I321T;ENSP00000451454:I379T;ENSP00000451284:I321T;ENSP00000396788:I379T;ENSP00000450686:I379T	ENSP00000250373:I391T	I	+	2	0	NFATC4	23909616	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.071000	0.50041	0.865000	0.35603	0.482000	0.46254	ATT	.		0.622	NFATC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000073206.6	NM_004554	
NIPBL	25836	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	5	37017238	37017238	+	Missense_Mutation	SNP	G	G	C			TCGA-G3-A5SL-01A-11D-A27I-10	TCGA-G3-A5SL-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70422e6d-cb1f-4284-8be9-1d4517ffad60	a38d4467-c3e5-4639-ad4f-88bcd7ab9f26	g.chr5:37017238G>C	ENST00000282516.8	+	24	5393	c.4894G>C	c.(4894-4896)Gga>Cga	p.G1632R	NIPBL_ENST00000448238.2_Missense_Mutation_p.G1632R	NM_015384.4|NM_133433.3	NP_056199.2|NP_597677.2	Q6KC79	NIPBL_HUMAN	Nipped-B homolog (Drosophila)	1632					brain development (GO:0007420)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to X-ray (GO:0071481)|cognition (GO:0050890)|developmental growth (GO:0048589)|ear morphogenesis (GO:0042471)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic forelimb morphogenesis (GO:0035115)|embryonic viscerocranium morphogenesis (GO:0048703)|external genitalia morphogenesis (GO:0035261)|eye morphogenesis (GO:0048592)|face morphogenesis (GO:0060325)|fat cell differentiation (GO:0045444)|forelimb morphogenesis (GO:0035136)|gall bladder development (GO:0061010)|heart morphogenesis (GO:0003007)|maintenance of mitotic sister chromatid cohesion (GO:0034088)|metanephros development (GO:0001656)|mitotic cell cycle (GO:0000278)|mitotic sister chromatid cohesion (GO:0007064)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|outflow tract morphogenesis (GO:0003151)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of ossification (GO:0045778)|regulation of developmental growth (GO:0048638)|regulation of embryonic development (GO:0045995)|regulation of hair cycle (GO:0042634)|sensory perception of sound (GO:0007605)|stem cell maintenance (GO:0019827)|uterus morphogenesis (GO:0061038)	extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMC loading complex (GO:0032116)	chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|histone deacetylase binding (GO:0042826)|protein C-terminus binding (GO:0008022)|protein N-terminus binding (GO:0047485)			autonomic_ganglia(1)|breast(4)|endometrium(9)|kidney(22)|large_intestine(21)|liver(1)|lung(47)|ovary(7)|pancreas(1)|prostate(1)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(4)	128	all_lung(31;0.000447)|Hepatocellular(1;0.108)		Epithelial(62;0.072)|COAD - Colon adenocarcinoma(61;0.14)|all cancers(62;0.191)|Colorectal(62;0.202)			AATGGATCAAGGATCTATAGA	0.343																																					p.G1632R		.											.	NIPBL	293	0			c.G4894C						.						57.0	54.0	55.0					5																	37017238		2203	4300	6503	SO:0001583	missense	25836	exon24			GATCAAGGATCTA	AB019494	CCDS3920.1, CCDS47198.1	5p13.2	2009-08-28			ENSG00000164190	ENSG00000164190			28862	protein-coding gene	gene with protein product	"""sister chromatid cohesion 2 homolog (yeast)"""	608667				15146186, 15146185	Standard	NM_133433		Approved	IDN3, DKFZp434L1319, FLJ11203, FLJ12597, FLJ13354, FLJ13648, Scc2	uc003jkl.4	Q6KC79	OTTHUMG00000090795	ENST00000282516.8:c.4894G>C	5.37:g.37017238G>C	ENSP00000282516:p.Gly1632Arg	206.0	0.0		169.0	13.0	NM_015384	Q6KCD6|Q6N080|Q6ZT92|Q7Z2E6|Q8N4M5|Q9Y6Y3|Q9Y6Y4	Missense_Mutation	SNP	ENST00000282516.8	37	CCDS3920.1	.	.	.	.	.	.	.	.	.	.	G	11.46	1.645605	0.29246	.	.	ENSG00000164190	ENST00000282516;ENST00000448238	T;T	0.65732	-0.17;-0.17	5.45	5.45	0.79879	Armadillo-type fold (1);	0.181312	0.49305	D	0.000146	T	0.40839	0.1133	N	0.03324	-0.35	0.44660	D	0.997649	B;B	0.17852	0.024;0.005	B;B	0.15484	0.013;0.004	T	0.32798	-0.9893	10	0.14252	T	0.57	.	19.6495	0.95795	0.0:0.0:1.0:0.0	.	1632;1632	Q6KC79;Q6KC79-2	NIPBL_HUMAN;.	R	1632	ENSP00000282516:G1632R;ENSP00000406266:G1632R	ENSP00000282516:G1632R	G	+	1	0	NIPBL	37052995	1.000000	0.71417	0.997000	0.53966	0.996000	0.88848	5.298000	0.65710	2.717000	0.92951	0.585000	0.79938	GGA	.		0.343	NIPBL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207582.1	NM_015384	
NOD2	64127	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	50745410	50745410	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A5SL-01A-11D-A27I-10	TCGA-G3-A5SL-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70422e6d-cb1f-4284-8be9-1d4517ffad60	a38d4467-c3e5-4639-ad4f-88bcd7ab9f26	g.chr16:50745410T>C	ENST00000300589.2	+	4	1693	c.1588T>C	c.(1588-1590)Tca>Cca	p.S530P	RP11-327F22.6_ENST00000602304.1_RNA	NM_022162.1	NP_071445.1	Q9HC29	NOD2_HUMAN	nucleotide-binding oligomerization domain containing 2	530	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.				activation of MAPK activity (GO:0000187)|activation of MAPK activity involved in innate immune response (GO:0035419)|cellular response to muramyl dipeptide (GO:0071225)|cellular response to peptidoglycan (GO:0071224)|cytokine production involved in immune response (GO:0002367)|defense response (GO:0006952)|defense response to bacterium (GO:0042742)|defense response to Gram-positive bacterium (GO:0050830)|detection of bacterium (GO:0016045)|detection of biotic stimulus (GO:0009595)|detection of muramyl dipeptide (GO:0032498)|immunoglobulin production involved in immunoglobulin mediated immune response (GO:0002381)|innate immune response (GO:0045087)|innate immune response in mucosa (GO:0002227)|intracellular signal transduction (GO:0035556)|JNK cascade (GO:0007254)|macrophage inflammatory protein-1 alpha production (GO:0071608)|maintenance of gastrointestinal epithelium (GO:0030277)|microglial cell activation involved in immune response (GO:0002282)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of growth of symbiont in host (GO:0044130)|negative regulation of inflammatory response to antigenic stimulus (GO:0002862)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of interleukin-18 production (GO:0032701)|negative regulation of interleukin-2 production (GO:0032703)|negative regulation of macrophage apoptotic process (GO:2000110)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of T cell mediated immunity (GO:0002710)|negative regulation of toll-like receptor 2 signaling pathway (GO:0034136)|negative regulation of tumor necrosis factor production (GO:0032720)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing 2 signaling pathway (GO:0070431)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|pathogen-associated molecular pattern dependent induction by symbiont of host innate immune response (GO:0052033)|positive regulation of B cell activation (GO:0050871)|positive regulation of biosynthetic process of antibacterial peptides active against Gram-positive bacteria (GO:0006965)|positive regulation of dendritic cell antigen processing and presentation (GO:0002606)|positive regulation of dendritic cell cytokine production (GO:0002732)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of gamma-delta T cell activation (GO:0046645)|positive regulation of humoral immune response mediated by circulating immunoglobulin (GO:0002925)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-1 beta production (GO:0032731)|positive regulation of interleukin-1 beta secretion (GO:0050718)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-17 production (GO:0032740)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of JNK cascade (GO:0046330)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of oxidoreductase activity (GO:0051353)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phagocytosis (GO:0050766)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of prostaglandin-E synthase activity (GO:2000363)|positive regulation of prostaglandin-endoperoxide synthase activity (GO:0060585)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of stress-activated MAPK cascade (GO:0032874)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of type 2 immune response (GO:0002830)|protein oligomerization (GO:0051259)|regulation of inflammatory response (GO:0050727)|regulation of neutrophil chemotaxis (GO:0090022)|response to exogenous dsRNA (GO:0043330)|response to lipopolysaccharide (GO:0032496)|response to muramyl dipeptide (GO:0032495)|response to nutrient (GO:0007584)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|vesicle (GO:0031982)	ATP binding (GO:0005524)|CARD domain binding (GO:0050700)|enzyme binding (GO:0019899)|muramyl dipeptide binding (GO:0032500)|peptidoglycan binding (GO:0042834)|protein kinase binding (GO:0019901)			cervix(1)|endometrium(5)|kidney(3)|large_intestine(7)|lung(30)|ovary(3)|skin(3)	52		all_cancers(37;0.0156)				CCCCCCAGACTCAGCTTCCCA	0.617																																					p.S530P		.											.	NOD2	231	0			c.T1588C						.						43.0	47.0	46.0					16																	50745410		2198	4300	6498	SO:0001583	missense	64127	exon4			CCAGACTCAGCTT	AF178930	CCDS10746.1	16q12	2014-09-17	2006-12-08	2006-12-08	ENSG00000167207	ENSG00000167207		"""Nucleotide-binding domain and leucine rich repeat containing"""	5331	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and CARD domain containing 2"", ""NOD-like receptor C2"", ""NLR family, CARD domain containing 2"""	605956	"""caspase recruitment domain family, member 15"""	IBD1, CARD15		7809109, 8587604	Standard	XM_005256084		Approved	BLAU, CD, PSORAS1, CLR16.3, NLRC2	uc002egm.1	Q9HC29	OTTHUMG00000133171	ENST00000300589.2:c.1588T>C	16.37:g.50745410T>C	ENSP00000300589:p.Ser530Pro	80.0	0.0		47.0	17.0	NM_022162	E2JEQ6|Q96RH5|Q96RH6|Q96RH8	Missense_Mutation	SNP	ENST00000300589.2	37	CCDS10746.1	.	.	.	.	.	.	.	.	.	.	T	4.331	0.060833	0.08339	.	.	ENSG00000167207	ENST00000526417;ENST00000300589	T	0.70399	-0.48	4.59	-9.19	0.00685	.	2.365230	0.01528	N	0.018640	T	0.57051	0.2027	L	0.57536	1.79	0.09310	N	1	B;P;P	0.34909	0.393;0.467;0.475	B;B;B	0.32864	0.099;0.154;0.073	T	0.49762	-0.8905	10	0.28530	T	0.3	.	3.403	0.07331	0.3258:0.0795:0.4293:0.1654	.	314;503;530	D6CHF9;Q9HC29-2;Q9HC29	.;.;NOD2_HUMAN	P	503;530	ENSP00000300589:S530P	ENSP00000300589:S530P	S	+	1	0	NOD2	49302911	0.000000	0.05858	0.000000	0.03702	0.048000	0.14542	-1.130000	0.03241	-1.404000	0.02050	-0.501000	0.04562	TCA	.		0.617	NOD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256876.2	NM_022162	
NPBWR1	2831	broad.mit.edu;ucsc.edu	37	8	53853329	53853329	+	Missense_Mutation	SNP	A	A	T	rs141356626		TCGA-G3-A5SL-01A-11D-A27I-10	TCGA-G3-A5SL-10A-01D-A27I-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70422e6d-cb1f-4284-8be9-1d4517ffad60	a38d4467-c3e5-4639-ad4f-88bcd7ab9f26	g.chr8:53853329A>T	ENST00000331251.3	+	1	2339	c.862A>T	c.(862-864)Atc>Ttc	p.I288F		NM_005285.3	NP_005276.2	P48145	NPBW1_HUMAN	neuropeptides B/W receptor 1	288					G-protein coupled receptor signaling pathway (GO:0007186)|opioid receptor signaling pathway (GO:0038003)|regulation of metabolic process (GO:0019222)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	neuropeptide receptor activity (GO:0008188)|opioid receptor activity (GO:0004985)			breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(8)|ovary(2)	17		Lung NSC(129;0.0222)|all_epithelial(80;0.0301)|all_lung(136;0.0431)				GGTCATCGCTATCTCCTACTT	0.647																																					p.I288F		.											.	NPBWR1	155	0			c.A862T						.						58.0	49.0	52.0					8																	53853329		2203	4300	6503	SO:0001583	missense	2831	exon1			ATCGCTATCTCCT	BC033145	CCDS6151.1	8p22-q21.13	2012-08-08	2006-02-15	2006-02-15		ENSG00000183729		"""GPCR / Class A : Neuropeptide receptors : W/B"""	4522	protein-coding gene	gene with protein product		600730	"""G protein-coupled receptor 7"""	GPR7		7590751, 12401809	Standard	NM_005285		Approved		uc011ldu.2	P48145		ENST00000331251.3:c.862A>T	8.37:g.53853329A>T	ENSP00000330284:p.Ile288Phe	123.0	2.0		269.0	40.0	NM_005285	Q6NTC7	Missense_Mutation	SNP	ENST00000331251.3	37	CCDS6151.1	.	.	.	.	.	.	.	.	.	.	a	15.79	2.936647	0.52972	.	.	ENSG00000183729	ENST00000331251	T	0.37235	1.21	4.86	-1.13	0.09775	GPCR, rhodopsin-like superfamily (1);	0.487974	0.16213	U	0.224385	T	0.29684	0.0741	L	0.45744	1.44	0.33179	D	0.549246	P	0.35714	0.517	B	0.40228	0.323	T	0.33854	-0.9852	10	0.45353	T	0.12	.	6.7019	0.23230	0.4782:0.4024:0.1194:0.0	.	288	P48145	NPBW1_HUMAN	F	288	ENSP00000330284:I288F	ENSP00000330284:I288F	I	+	1	0	NPBWR1	54015882	0.002000	0.14202	0.666000	0.29783	0.986000	0.74619	0.704000	0.25661	-0.434000	0.07275	0.454000	0.30748	ATC	A|1.000;G|0.000		0.647	NPBWR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378047.1	NM_005285	
NPR2	4882	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	35809218	35809218	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A5SL-01A-11D-A27I-10	TCGA-G3-A5SL-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70422e6d-cb1f-4284-8be9-1d4517ffad60	a38d4467-c3e5-4639-ad4f-88bcd7ab9f26	g.chr9:35809218G>A	ENST00000342694.2	+	21	3307	c.3052G>A	c.(3052-3054)Gag>Aag	p.E1018K	AL133410.1_ENST00000582432.1_RNA|SPAG8_ENST00000340291.2_Intron|SPAG8_ENST00000479751.1_5'Flank	NM_003995.3	NP_003986.2	P20594	ANPRB_HUMAN	natriuretic peptide receptor 2	1018					bone development (GO:0060348)|cell surface receptor signaling pathway (GO:0007166)|cellular response to granulocyte macrophage colony-stimulating factor stimulus (GO:0097011)|cGMP biosynthetic process (GO:0006182)|intracellular signal transduction (GO:0035556)|negative regulation of meiotic cell cycle (GO:0051447)|negative regulation of oocyte maturation (GO:1900194)|ossification (GO:0001503)|receptor guanylyl cyclase signaling pathway (GO:0007168)|regulation of blood pressure (GO:0008217)|signal transduction (GO:0007165)|single organism reproductive process (GO:0044702)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|hormone binding (GO:0042562)|natriuretic peptide receptor activity (GO:0016941)|peptide hormone binding (GO:0017046)|protein kinase activity (GO:0004672)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(14)|ovary(2)|prostate(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	45	all_epithelial(49;0.161)		LUSC - Lung squamous cell carcinoma(32;0.00521)|Lung(28;0.00697)|STAD - Stomach adenocarcinoma(86;0.194)		Erythrityl Tetranitrate(DB01613)|Nesiritide(DB04899)	CTTCCAGCTAGAGCTTCGGGG	0.547																																					p.E1018K		.											.	NPR2	335	0			c.G3052A						.						108.0	109.0	108.0					9																	35809218		2203	4300	6503	SO:0001583	missense	4882	exon21			CAGCTAGAGCTTC	AJ005282	CCDS6590.1	9p21-p12	2014-03-03	2014-03-03		ENSG00000159899	ENSG00000159899			7944	protein-coding gene	gene with protein product	"""guanylate cyclase B"""	108961	"""acromesomelic dysplasia, Maroteaux type"", ""atrionatriuretic peptide receptor B"", ""natriuretic peptide receptor B"""	ANPRB, NPRB, AMDM		9634515, 15146390	Standard	XM_005251478		Approved	GUCY2B, ANPb	uc003zyd.3	P20594	OTTHUMG00000019871	ENST00000342694.2:c.3052G>A	9.37:g.35809218G>A	ENSP00000341083:p.Glu1018Lys	48.0	0.0		49.0	18.0	NM_003995	B0ZBF2|B0ZBF3|D3DRP3|D3DRP4|O60871|Q4VAK7|Q5TCV2|Q8TA93|Q9UQ50	Missense_Mutation	SNP	ENST00000342694.2	37	CCDS6590.1	.	.	.	.	.	.	.	.	.	.	G	22.1	4.248090	0.80024	.	.	ENSG00000159899	ENST00000342694	T	0.81163	-1.46	5.97	5.97	0.96955	Adenylyl cyclase class-3/4/guanylyl cyclase (4);	0.000000	0.43747	D	0.000537	T	0.81772	0.4893	M	0.66297	2.02	0.80722	D	1	P	0.42456	0.78	B	0.40782	0.34	T	0.83351	-0.0003	10	0.62326	D	0.03	.	19.0168	0.92897	0.0:0.0:1.0:0.0	.	1018	P20594	ANPRB_HUMAN	K	1018	ENSP00000341083:E1018K	ENSP00000341083:E1018K	E	+	1	0	NPR2	35799218	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.985000	0.70556	2.836000	0.97738	0.655000	0.94253	GAG	.		0.547	NPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052345.1		
NR0B2	8431	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	27240341	27240341	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A5SL-01A-11D-A27I-10	TCGA-G3-A5SL-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70422e6d-cb1f-4284-8be9-1d4517ffad60	a38d4467-c3e5-4639-ad4f-88bcd7ab9f26	g.chr1:27240341C>T	ENST00000254227.3	-	1	116	c.91G>A	c.(91-93)Gct>Act	p.A31T		NM_021969.2	NP_068804.1	Q15466	NR0B2_HUMAN	nuclear receptor subfamily 0, group B, member 2	31					cholesterol metabolic process (GO:0008203)|gene expression (GO:0010467)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|organ regeneration (GO:0031100)|positive regulation of insulin secretion (GO:0032024)|response to glucose (GO:0009749)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|protein domain specific binding (GO:0019904)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|transcription corepressor activity (GO:0003714)			NS(1)|large_intestine(1)|lung(3)	5		all_cancers(24;1.23e-26)|all_epithelial(13;1.19e-23)|Colorectal(325;3.46e-05)|all_lung(284;5.94e-05)|Lung NSC(340;7.26e-05)|Breast(348;0.00017)|Renal(390;0.0007)|Ovarian(437;0.00764)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Epithelial(14;1.01e-51)|OV - Ovarian serous cystadenocarcinoma(117;8.22e-30)|Colorectal(126;5.31e-09)|COAD - Colon adenocarcinoma(152;9.31e-07)|BRCA - Breast invasive adenocarcinoma(304;0.000272)|STAD - Stomach adenocarcinoma(196;0.000588)|KIRC - Kidney renal clear cell carcinoma(1967;0.000716)|READ - Rectum adenocarcinoma(331;0.0419)		CGGGGGACAGCCTTGAGGCTG	0.652																																					p.A31T		.											.	NR0B2	186	0			c.G91A						.						42.0	43.0	42.0					1																	27240341		2203	4300	6503	SO:0001583	missense	8431	exon1			GGACAGCCTTGAG	AF044316	CCDS291.1	1p36.1	2013-01-16			ENSG00000131910	ENSG00000131910		"""Nuclear hormone receptors"""	7961	protein-coding gene	gene with protein product		604630				9603951	Standard	NM_021969		Approved	SHP	uc001bnf.3	Q15466	OTTHUMG00000004231	ENST00000254227.3:c.91G>A	1.37:g.27240341C>T	ENSP00000254227:p.Ala31Thr	41.0	0.0		34.0	10.0	NM_021969	F1D8P5|Q5QP36	Missense_Mutation	SNP	ENST00000254227.3	37	CCDS291.1	.	.	.	.	.	.	.	.	.	.	C	7.499	0.652276	0.14580	.	.	ENSG00000131910	ENST00000254227	D	0.84730	-1.89	5.15	0.621	0.17643	Nuclear hormone receptor, ligand-binding (2);	0.721913	0.14257	N	0.331062	T	0.65790	0.2725	N	0.16478	0.41	0.23043	N	0.99839	B	0.06786	0.001	B	0.04013	0.001	T	0.48234	-0.9053	10	0.08179	T	0.78	-11.7277	3.7527	0.08573	0.2341:0.2409:0.4392:0.0857	.	31	Q15466	NR0B2_HUMAN	T	31	ENSP00000254227:A31T	ENSP00000254227:A31T	A	-	1	0	NR0B2	27112928	0.017000	0.18338	0.990000	0.47175	0.711000	0.40976	-0.441000	0.06879	0.131000	0.18576	-0.311000	0.09066	GCT	.		0.652	NR0B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012185.1		
NR2C2	7182	hgsc.bcm.edu;bcgsc.ca	37	3	15062430	15062430	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A5SL-01A-11D-A27I-10	TCGA-G3-A5SL-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70422e6d-cb1f-4284-8be9-1d4517ffad60	a38d4467-c3e5-4639-ad4f-88bcd7ab9f26	g.chr3:15062430A>G	ENST00000425241.1	+	5	909	c.547A>G	c.(547-549)Aaa>Gaa	p.K183E	NR2C2_ENST00000323373.6_Missense_Mutation_p.K202E|NR2C2_ENST00000406272.2_Missense_Mutation_p.K183E|NR2C2_ENST00000393102.3_Missense_Mutation_p.K183E			P49116	NR2C2_HUMAN	nuclear receptor subfamily 2, group C, member 2	183					cell differentiation (GO:0030154)|gene expression (GO:0010467)|nervous system development (GO:0007399)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	protein heterodimerization activity (GO:0046982)|receptor activity (GO:0004872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|large_intestine(5)|lung(5)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	16						GATGGGCATGAAAATGGAATG	0.413																																					p.K202E		.											.	NR2C2	226	0			c.A604G						.						74.0	71.0	72.0					3																	15062430		2203	4300	6503	SO:0001583	missense	7182	exon6			GGCATGAAAATGG	L27586	CCDS2621.1, CCDS74905.1	3p25	2013-01-16			ENSG00000177463	ENSG00000177463		"""Nuclear hormone receptors"""	7972	protein-coding gene	gene with protein product		601426		TR4		8661150, 8016112	Standard	XM_005265428		Approved	TAK1, TR2R1, hTAK1	uc003bzi.3	P49116	OTTHUMG00000129839	ENST00000425241.1:c.547A>G	3.37:g.15062430A>G	ENSP00000388387:p.Lys183Glu	68.0	0.0		77.0	4.0	NM_003298	A8K3H5|B6ZGT8|P55092	Missense_Mutation	SNP	ENST00000425241.1	37		.	.	.	.	.	.	.	.	.	.	A	26.7	4.759891	0.89932	.	.	ENSG00000177463	ENST00000425241;ENST00000323373;ENST00000393102;ENST00000437120;ENST00000406272	T;T;T;D;T	0.97186	0.4;0.4;0.4;-4.28;0.4	5.78	5.78	0.91487	Nuclear hormone receptor, ligand-binding (2);Zinc finger, nuclear hormone receptor-type (3);	0.000000	0.85682	D	0.000000	D	0.98372	0.9459	M	0.79926	2.475	0.80722	D	1	D;D	0.71674	0.998;0.997	D;D	0.79108	0.978;0.992	D	0.99521	1.0958	10	0.87932	D	0	.	16.4053	0.83662	1.0:0.0:0.0:0.0	.	183;202	P49116;F2YGU2	NR2C2_HUMAN;.	E	183;202;183;202;183	ENSP00000388387:K183E;ENSP00000320447:K202E;ENSP00000376814:K183E;ENSP00000401807:K202E;ENSP00000384463:K183E	ENSP00000320447:K202E	K	+	1	0	NR2C2	15037434	1.000000	0.71417	0.997000	0.53966	0.998000	0.95712	9.249000	0.95470	2.333000	0.79357	0.482000	0.46254	AAA	.		0.413	NR2C2-002	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000340729.1	NM_003298	
NT5C3A	51251	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	7	33057096	33057100	+	Frame_Shift_Del	DEL	ATGAT	ATGAT	-	rs104894027		TCGA-G3-A5SL-01A-11D-A27I-10	TCGA-G3-A5SL-10A-01D-A27I-10	ATGAT	ATGAT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70422e6d-cb1f-4284-8be9-1d4517ffad60	a38d4467-c3e5-4639-ad4f-88bcd7ab9f26	g.chr7:33057096_33057100delATGAT	ENST00000242210.7	-	7	735_739	c.659_663delATCAT	c.(658-663)tatcatfs	p.YH220fs	NT5C3A_ENST00000409787.1_Frame_Shift_Del_p.YH181fs|NT5C3A_ENST00000405342.1_Frame_Shift_Del_p.YH181fs|AVL9_ENST00000404479.1_Intron|NT5C3A_ENST00000381626.2_Frame_Shift_Del_p.YH169fs|NT5C3A_ENST00000396152.2_Frame_Shift_Del_p.YH181fs|NT5C3A_ENST00000610140.1_Frame_Shift_Del_p.YH215fs|NT5C3A_ENST00000409467.1_Frame_Shift_Del_p.YH169fs	NM_001002009.2|NM_001002010.2	NP_001002009.1|NP_001002010.1	Q9H0P0	5NT3A_HUMAN	5'-nucleotidase, cytosolic IIIA	220					dephosphorylation (GO:0016311)|nucleobase-containing small molecule metabolic process (GO:0055086)|nucleotide metabolic process (GO:0009117)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside catabolic process (GO:0046135)|pyrimidine nucleoside metabolic process (GO:0006213)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)	2'-phosphotransferase activity (GO:0008665)|5'-nucleotidase activity (GO:0008253)|magnesium ion binding (GO:0000287)|nucleotide binding (GO:0000166)										TGACATTGGGATGATAAACACCAGC	0.332																																					p.220_221del		.											.	.	.	0			c.659_663del	GRCh37	CM032297	NT5C3	M	rs104894027	.																																			SO:0001589	frameshift_variant	0	exon7			ATTGGGATGATAA	AF312735	CCDS34616.1, CCDS34617.1, CCDS55101.1	7p14.3	2013-03-06	2013-03-06	2013-03-06	ENSG00000122643	ENSG00000122643	3.1.3.5		17820	protein-coding gene	gene with protein product	"""lupin"""	606224	"""5'-nucleotidase, cytosolic III"""	NT5C3		11042152, 10942414	Standard	NM_001002010		Approved	UMPH1, PSN1, PN-I, UMPH, P5'N-1, cN-III, p36, POMP, hUMP1	uc003tdk.4	Q9H0P0	OTTHUMG00000152983	ENST00000242210.7:c.659_663delATCAT	7.37:g.33057096_33057100delATGAT	ENSP00000242210:p.Tyr220fs	156.0	0.0		134.0	24.0	NM_001002010	A8K253|B2RAA5|B8ZZC4|Q6IPZ1|Q6NXS6|Q7L3G6|Q9P0P5|Q9UC42|Q9UC43|Q9UC44|Q9UC45	Frame_Shift_Del	DEL	ENST00000242210.7	37	CCDS34616.1																																																																																			.		0.332	NT5C3A-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000328880.1	NM_016489	
NUP98	4928	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	3797196	3797196	+	Silent	SNP	A	A	T			TCGA-G3-A5SL-01A-11D-A27I-10	TCGA-G3-A5SL-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70422e6d-cb1f-4284-8be9-1d4517ffad60	a38d4467-c3e5-4639-ad4f-88bcd7ab9f26	g.chr11:3797196A>T	ENST00000324932.7	-	5	831	c.411T>A	c.(409-411)tcT>tcA	p.S137S	NUP98_ENST00000359171.4_Silent_p.S137S|NUP98_ENST00000397004.4_Silent_p.S137S|NUP98_ENST00000397007.4_Silent_p.S137S|NUP98_ENST00000355260.3_Silent_p.S137S	NM_016320.4|NM_139132.3	NP_057404.2|NP_624358.2	P52948	NUP98_HUMAN	nucleoporin 98kDa	137	FG repeats 1.|Gly/Thr-rich.				carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|DNA replication (GO:0006260)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|nuclear pore complex assembly (GO:0051292)|nuclear pore organization (GO:0006999)|nucleocytoplasmic transport (GO:0006913)|protein import into nucleus, docking (GO:0000059)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|nuclear envelope (GO:0005635)|nuclear inclusion body (GO:0042405)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)|nuclear pore nuclear basket (GO:0044615)|nuclear pore outer ring (GO:0031080)|nucleoplasm (GO:0005654)	peptide binding (GO:0042277)|structural constituent of nuclear pore (GO:0017056)|transporter activity (GO:0005215)	p.S137S(1)		NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(1)|endometrium(5)|kidney(5)|large_intestine(13)|liver(1)|lung(15)|ovary(2)|prostate(2)|skin(9)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	66		Medulloblastoma(188;0.0025)|Breast(177;0.00328)|all_neural(188;0.0227)		BRCA - Breast invasive adenocarcinoma(625;0.0403)|LUSC - Lung squamous cell carcinoma(625;0.116)|Lung(200;0.199)		CAAAAGGATTAGAGGTGGTAT	0.383			T	"""HOXA9, NSD1, WHSC1L1, DDX10, TOP1, HOXD13, PMX1, HOXA13, HOXD11, HOXA11, RAP1GDS1, HOXC11"""	AML																																p.S137S		.		Dom	yes		11	11p15	4928	nucleoporin 98kDa		L	.	NUP98	703	1	Substitution - coding silent(1)	endometrium(1)	c.T411A						.						149.0	159.0	156.0					11																	3797196		2201	4298	6499	SO:0001819	synonymous_variant	4928	exon5			AGGATTAGAGGTG	AF071076, AF231130, BC012906, BG773331	CCDS7746.1, CCDS31347.1, CCDS41605.1, CCDS41606.1	11p15	2008-02-26	2002-08-29		ENSG00000110713	ENSG00000110713			8068	protein-coding gene	gene with protein product		601021	"""nucleoporin 98kD"""			9166830	Standard	NM_139131		Approved	NUP96	uc001lyh.3	P52948	OTTHUMG00000011846	ENST00000324932.7:c.411T>A	11.37:g.3797196A>T		200.0	0.0		163.0	37.0	NM_016320	Q8IUT2|Q8WYB0|Q96E54|Q9H3Q4|Q9NT02|Q9UF57|Q9UHX0|Q9Y6J4|Q9Y6J5	Silent	SNP	ENST00000324932.7	37	CCDS7746.1																																																																																			.		0.383	NUP98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032766.3	NM_016320	
PCDHB10	56126	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	140572647	140572647	+	Silent	SNP	C	C	T			TCGA-G3-A5SL-01A-11D-A27I-10	TCGA-G3-A5SL-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70422e6d-cb1f-4284-8be9-1d4517ffad60	a38d4467-c3e5-4639-ad4f-88bcd7ab9f26	g.chr5:140572647C>T	ENST00000239446.4	+	1	706	c.522C>T	c.(520-522)ccC>ccT	p.P174P		NM_018930.3	NP_061753.1	Q9UN67	PCDBA_HUMAN	protocadherin beta 10	174	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(14)|lung(30)|ovary(4)|prostate(5)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	76			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CGATCAGCCCCAACTCTTTTT	0.448																																					p.P174P		.											.	PCDHB10	92	0			c.C522T						.						131.0	149.0	143.0					5																	140572647		2203	4300	6503	SO:0001819	synonymous_variant	56126	exon1			CAGCCCCAACTCT	AF152489	CCDS4252.1	5q31.3	2010-06-15			ENSG00000120324	ENSG00000120324		"""Cadherins / Protocadherins : Clustered"""	8681	other	protocadherin		606336				10380929	Standard	NM_018930		Approved		uc003lix.3	Q9UN67	OTTHUMG00000129626	ENST00000239446.4:c.522C>T	5.37:g.140572647C>T		323.0	0.0		186.0	67.0	NM_018930	Q96T99	Silent	SNP	ENST00000239446.4	37	CCDS4252.1																																																																																			.		0.448	PCDHB10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251821.1	NM_018930	
PCLO	27445	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	82545309	82545309	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A5SL-01A-11D-A27I-10	TCGA-G3-A5SL-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70422e6d-cb1f-4284-8be9-1d4517ffad60	a38d4467-c3e5-4639-ad4f-88bcd7ab9f26	g.chr7:82545309G>A	ENST00000333891.9	-	7	12330	c.11993C>T	c.(11992-11994)gCt>gTt	p.A3998V	PCLO_ENST00000423517.2_Missense_Mutation_p.A3998V|PCLO_ENST00000437081.1_Missense_Mutation_p.A718V	NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein											breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						ATGGGAAACAGCAAATGTGTT	0.393																																					p.A3998V		.											.	PCLO	29	0			c.C11993T						.						354.0	331.0	338.0					7																	82545309		1910	4137	6047	SO:0001583	missense	27445	exon7			GAAACAGCAAATG	AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.11993C>T	7.37:g.82545309G>A	ENSP00000334319:p.Ala3998Val	27.0	0.0		51.0	22.0	NM_014510		Missense_Mutation	SNP	ENST00000333891.9	37	CCDS47630.1	.	.	.	.	.	.	.	.	.	.	G	15.56	2.870130	0.51588	.	.	ENSG00000186472	ENST00000333891;ENST00000423517;ENST00000437081	T;T	0.19394	2.15;2.15	5.85	5.85	0.93711	.	.	.	.	.	T	0.39911	0.1096	L	0.54323	1.7	0.42635	D	0.99339	P;D;D	0.59767	0.799;0.986;0.986	B;P;P	0.56398	0.343;0.797;0.797	T	0.08911	-1.0699	9	0.87932	D	0	.	20.1542	0.98100	0.0:0.0:1.0:0.0	.	3929;3998;3998	Q9Y6V0;Q9Y6V0-5;Q9Y6V0-6	PCLO_HUMAN;.;.	V	3998;3998;718	ENSP00000334319:A3998V;ENSP00000388393:A3998V	ENSP00000334319:A3998V	A	-	2	0	PCLO	82383245	1.000000	0.71417	0.969000	0.41365	0.743000	0.42351	5.154000	0.64894	2.767000	0.95098	0.563000	0.77884	GCT	.		0.393	PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337368.5	NM_014510	
PDGFD	80310	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	103814257	103814257	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A5SL-01A-11D-A27I-10	TCGA-G3-A5SL-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70422e6d-cb1f-4284-8be9-1d4517ffad60	a38d4467-c3e5-4639-ad4f-88bcd7ab9f26	g.chr11:103814257C>A	ENST00000393158.2	-	5	874	c.695G>T	c.(694-696)tGg>tTg	p.W232L	RP11-617B3.2_ENST00000527804.1_RNA|PDGFD_ENST00000302251.5_Missense_Mutation_p.W226L			Q9GZP0	PDGFD_HUMAN	platelet derived growth factor D	232					cellular response to amino acid stimulus (GO:0071230)|multicellular organismal development (GO:0007275)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of cell division (GO:0051781)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)	endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)				biliary_tract(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(8)|prostate(3)|upper_aerodigestive_tract(1)	23		Acute lymphoblastic leukemia(157;0.000994)|all_hematologic(158;0.0017)|Melanoma(852;0.0563)|all_neural(303;0.165)		BRCA - Breast invasive adenocarcinoma(274;0.00136)|Epithelial(105;0.111)		ATCTTCTTGCCATGACTCTGG	0.443																																					p.W232L		.											.	PDGFD	723	0			c.G695T						.						135.0	110.0	119.0					11																	103814257		2202	4299	6501	SO:0001583	missense	80310	exon5			TCTTGCCATGACT	AF113216	CCDS8326.1, CCDS41703.1	11q22.3	2008-02-05			ENSG00000170962	ENSG00000170962			30620	protein-coding gene	gene with protein product	"""spinal cord derived growth factor B"""	609673				11162582, 11980634	Standard	NM_033135		Approved	SCDGF-B, MSTP036, IEGF	uc001phq.3	Q9GZP0	OTTHUMG00000165953	ENST00000393158.2:c.695G>T	11.37:g.103814257C>A	ENSP00000376865:p.Trp232Leu	82.0	0.0		119.0	27.0	NM_025208	A8K9T6|Q9BWV5	Missense_Mutation	SNP	ENST00000393158.2	37	CCDS41703.1	.	.	.	.	.	.	.	.	.	.	C	18.22	3.575276	0.65878	.	.	ENSG00000170962	ENST00000393158;ENST00000302251	T;T	0.37411	1.2;1.22	5.53	5.53	0.82687	.	0.121611	0.64402	D	0.000011	T	0.42063	0.1186	M	0.63843	1.955	0.80722	D	1	B;B	0.19583	0.012;0.037	B;B	0.19148	0.006;0.024	T	0.30937	-0.9961	10	0.66056	D	0.02	-16.338	19.823	0.96605	0.0:1.0:0.0:0.0	.	232;226	Q9GZP0;Q9GZP0-2	PDGFD_HUMAN;.	L	232;226	ENSP00000376865:W232L;ENSP00000302193:W226L	ENSP00000302193:W226L	W	-	2	0	PDGFD	103319467	1.000000	0.71417	0.999000	0.59377	0.995000	0.86356	5.628000	0.67791	2.770000	0.95276	0.650000	0.86243	TGG	.		0.443	PDGFD-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000387231.2	NM_025208	
PEX5L	51555	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	179592187	179592187	+	Silent	SNP	T	T	C			TCGA-G3-A5SL-01A-11D-A27I-10	TCGA-G3-A5SL-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70422e6d-cb1f-4284-8be9-1d4517ffad60	a38d4467-c3e5-4639-ad4f-88bcd7ab9f26	g.chr3:179592187T>C	ENST00000467460.1	-	7	984	c.654A>G	c.(652-654)ccA>ccG	p.P218P	PEX5L_ENST00000263962.8_Silent_p.P216P|PEX5L-AS1_ENST00000466064.1_RNA|PEX5L_ENST00000392649.3_Silent_p.P110P|PEX5L_ENST00000467440.2_5'UTR|PEX5L_ENST00000465751.1_Silent_p.P194P|PEX5L_ENST00000476138.1_Silent_p.P175P|PEX5L_ENST00000485199.1_Silent_p.P183P|PEX5L_ENST00000472994.1_Silent_p.P159P|PEX5L_ENST00000464614.1_Silent_p.P110P|PEX5L_ENST00000468741.1_Silent_p.P26P	NM_001256751.1|NM_016559.2	NP_001243680.1|NP_057643.1	Q8IYB4	PEX5R_HUMAN	peroxisomal biogenesis factor 5-like	218					maintenance of protein location (GO:0045185)|protein import into peroxisome matrix (GO:0016558)|protein import into peroxisome matrix, docking (GO:0016560)|regulation of cAMP-mediated signaling (GO:0043949)|regulation of membrane potential (GO:0042391)	cytosol (GO:0005829)|dendrite (GO:0030425)|peroxisomal membrane (GO:0005778)|receptor complex (GO:0043235)	peroxisome matrix targeting signal-1 binding (GO:0005052)|peroxisome targeting sequence binding (GO:0000268)|small GTPase binding (GO:0031267)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(23)|ovary(3)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	49	all_cancers(143;3.94e-14)|Ovarian(172;0.0338)|Breast(254;0.183)		OV - Ovarian serous cystadenocarcinoma(80;1.75e-26)|GBM - Glioblastoma multiforme(14;0.000518)			CACTCAGTTCTGGTTGAGATC	0.408																																					p.P218P		.											.	PEX5L	156	0			c.A654G						.						122.0	117.0	118.0					3																	179592187		2203	4300	6503	SO:0001819	synonymous_variant	51555	exon7			CAGTTCTGGTTGA	AJ245503	CCDS3236.1, CCDS58861.1, CCDS58862.1, CCDS58863.1, CCDS58864.1, CCDS58865.1, CCDS58866.1, CCDS58867.1	3q27.1	2013-01-10			ENSG00000114757	ENSG00000114757		"""Tetratricopeptide (TTC) repeat domain containing"""	30024	protein-coding gene	gene with protein product		611058				11463335	Standard	NM_016559		Approved	PEX5R, PXR2	uc003fki.2	Q8IYB4	OTTHUMG00000157363	ENST00000467460.1:c.654A>G	3.37:g.179592187T>C		39.0	0.0		51.0	17.0	NM_016559	B7Z2A5|B7Z305|B7Z318|B7Z5Z5|B7Z8P2|E7EUV8|E7EUZ0|E9PEC1|E9PH97|Q9NQD1|Q9P2U3|Q9P2U4	Silent	SNP	ENST00000467460.1	37	CCDS3236.1																																																																																			.		0.408	PEX5L-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000348577.1	NM_016559	
PHF10	55274	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	6	170112622	170112622	+	Nonsense_Mutation	SNP	C	C	A			TCGA-G3-A5SL-01A-11D-A27I-10	TCGA-G3-A5SL-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70422e6d-cb1f-4284-8be9-1d4517ffad60	a38d4467-c3e5-4639-ad4f-88bcd7ab9f26	g.chr6:170112622C>A	ENST00000339209.4	-	8	940	c.817G>T	c.(817-819)Gag>Tag	p.E273*	PHF10_ENST00000366780.4_Nonsense_Mutation_p.E271*	NM_018288.3|NM_133325.2	NP_060758.2|NP_579866.2	Q8WUB8	PHF10_HUMAN	PHD finger protein 10	273	SAY.				nervous system development (GO:0007399)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	npBAF complex (GO:0071564)	zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(2)|liver(3)|lung(4)|prostate(2)|urinary_tract(1)	14		Breast(66;5.08e-05)|Ovarian(120;0.208)		OV - Ovarian serous cystadenocarcinoma(33;1.4e-21)|BRCA - Breast invasive adenocarcinoma(81;1.4e-07)|GBM - Glioblastoma multiforme(31;0.00176)		TACCGCAGCTCATCTGGTGAG	0.428																																					p.E273X		.											.	PHF10	226	0			c.G817T						.						116.0	113.0	114.0					6																	170112622		2203	4300	6503	SO:0001587	stop_gained	55274	exon8			GCAGCTCATCTGG	AF338735	CCDS5308.2, CCDS5309.2	6q27	2014-05-13			ENSG00000130024	ENSG00000130024		"""Zinc fingers, PHD-type"""	18250	protein-coding gene	gene with protein product		613069				11827455	Standard	NM_018288		Approved	FLJ10975, XAP135, BAF45a	uc011egy.2	Q8WUB8	OTTHUMG00000016058	ENST00000339209.4:c.817G>T	6.37:g.170112622C>A	ENSP00000341805:p.Glu273*	129.0	0.0		63.0	14.0	NM_018288	Q2YDA3|Q53HG8|Q9BXD2|Q9NV26	Nonsense_Mutation	SNP	ENST00000339209.4	37	CCDS5308.2	.	.	.	.	.	.	.	.	.	.	C	37	6.100383	0.97281	.	.	ENSG00000130024	ENST00000366780;ENST00000339209	.	.	.	5.35	5.35	0.76521	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.62326	D	0.03	-30.6999	18.4165	0.90572	0.0:1.0:0.0:0.0	.	.	.	.	X	271;273	.	ENSP00000341805:E273X	E	-	1	0	PHF10	169854547	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.211000	0.77933	2.673000	0.90976	0.585000	0.79938	GAG	.		0.428	PHF10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000346732.1	NM_018288	
PIK3C2G	5288	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	18691110	18691110	+	Missense_Mutation	SNP	T	T	G			TCGA-G3-A5SL-01A-11D-A27I-10	TCGA-G3-A5SL-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70422e6d-cb1f-4284-8be9-1d4517ffad60	a38d4467-c3e5-4639-ad4f-88bcd7ab9f26	g.chr12:18691110T>G	ENST00000266497.5	+	23	3259	c.3221T>G	c.(3220-3222)tTt>tGt	p.F1074C	PIK3C2G_ENST00000433979.1_Missense_Mutation_p.F1074C|PIK3C2G_ENST00000538779.1_Missense_Mutation_p.F1115C			O75747	P3C2G_HUMAN	phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 gamma	1074	PI3K/PI4K. {ECO:0000255|PROSITE- ProRule:PRU00269}.				chemotaxis (GO:0006935)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|phosphatidylinositol binding (GO:0035091)|phosphatidylinositol phosphate kinase activity (GO:0016307)			breast(5)|central_nervous_system(6)|endometrium(2)|kidney(4)|large_intestine(8)|lung(31)|ovary(2)|prostate(1)|skin(2)|stomach(4)|upper_aerodigestive_tract(1)	66		Hepatocellular(102;0.194)				CCTTTCATTTTTACTTCAGAG	0.368																																					p.F1074C		.											.	PIK3C2G	1312	0			c.T3221G						.						103.0	95.0	97.0					12																	18691110		1801	4074	5875	SO:0001583	missense	5288	exon24			TCATTTTTACTTC	AJ000008	CCDS44839.1, CCDS73452.1	12p12	2012-07-13	2012-07-13		ENSG00000139144	ENSG00000139144	2.7.1.154		8973	protein-coding gene	gene with protein product		609001	"""phosphoinositide-3-kinase, class 2, gamma polypeptide"""			9878262	Standard	XM_005253393		Approved		uc001rdt.3	O75747	OTTHUMG00000168841	ENST00000266497.5:c.3221T>G	12.37:g.18691110T>G	ENSP00000266497:p.Phe1074Cys	25.0	0.0		70.0	26.0	NM_004570	A1L3U0	Missense_Mutation	SNP	ENST00000266497.5	37	CCDS44839.1	.	.	.	.	.	.	.	.	.	.	T	17.24	3.338549	0.60963	.	.	ENSG00000139144	ENST00000433979;ENST00000266497;ENST00000538779	T;T;T	0.76186	-1.0;-1.0;-1.0	3.78	3.78	0.43462	Protein kinase-like domain (1);Phosphatidylinositol 3-/4-kinase, catalytic (4);	0.069387	0.56097	D	0.000021	D	0.85344	0.5675	M	0.81239	2.535	0.58432	D	0.999997	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.87468	0.2412	10	0.87932	D	0	-18.26	12.7158	0.57113	0.0:0.0:0.0:1.0	.	1114;1115;1074	B7ZLY6;F5H369;O75747	.;.;P3C2G_HUMAN	C	1074;1074;1115	ENSP00000404845:F1074C;ENSP00000266497:F1074C;ENSP00000445381:F1115C	ENSP00000266497:F1074C	F	+	2	0	PIK3C2G	18582377	1.000000	0.71417	1.000000	0.80357	0.813000	0.45954	7.700000	0.84556	1.955000	0.56771	0.482000	0.46254	TTT	.		0.368	PIK3C2G-002	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401316.1	NM_004570	
PKHD1	5314	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	51907882	51907882	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A5SL-01A-11D-A27I-10	TCGA-G3-A5SL-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70422e6d-cb1f-4284-8be9-1d4517ffad60	a38d4467-c3e5-4639-ad4f-88bcd7ab9f26	g.chr6:51907882C>A	ENST00000371117.3	-	27	3147	c.2872G>T	c.(2872-2874)Gac>Tac	p.D958Y	PKHD1_ENST00000340994.4_Missense_Mutation_p.D958Y	NM_138694.3	NP_619639.3	P08F94	PKHD1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)	958	IPT/TIG 4.				cellular calcium ion homeostasis (GO:0006874)|cilium assembly (GO:0042384)|homeostatic process (GO:0042592)|kidney development (GO:0001822)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cellular component movement (GO:0051271)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein kinase B signaling (GO:0051898)|positive regulation of cell proliferation (GO:0008284)|regulation of centrosome duplication (GO:0010824)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of TOR signaling (GO:0032006)|single organismal cell-cell adhesion (GO:0016337)	anchored component of external side of plasma membrane (GO:0031362)|apical plasma membrane (GO:0016324)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitotic spindle (GO:0072686)|perinuclear region of cytoplasm (GO:0048471)|primary cilium (GO:0072372)	receptor activity (GO:0004872)			NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(5)|cervix(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(59)|lung(139)|ovary(16)|prostate(8)|skin(20)|soft_tissue(1)|stomach(2)|upper_aerodigestive_tract(7)|urinary_tract(5)	304	Lung NSC(77;0.0605)					AACTGGGAGTCACCAGAGAAA	0.368																																					p.D958Y		.											.	PKHD1	603	0			c.G2872T						.						74.0	73.0	74.0					6																	51907882		2203	4300	6503	SO:0001583	missense	5314	exon27			GGGAGTCACCAGA	AF480064	CCDS4935.1, CCDS4936.1	6p21.2-p12	2012-11-26	2003-04-16		ENSG00000170927	ENSG00000170927			9016	protein-coding gene	gene with protein product	"""tigmin"", ""polyductin"", ""fibrocystin"""	606702	"""TIG multiple domains 1"""	TIGM1		9503014	Standard	NM_138694		Approved	ARPKD, FCYT	uc003pah.1	P08F94	OTTHUMG00000014841	ENST00000371117.3:c.2872G>T	6.37:g.51907882C>A	ENSP00000360158:p.Asp958Tyr	55.0	0.0		139.0	33.0	NM_170724	Q5VUA2|Q5VUA3|Q5VWV1|Q86Z26|Q8TCZ9	Missense_Mutation	SNP	ENST00000371117.3	37	CCDS4935.1	.	.	.	.	.	.	.	.	.	.	C	15.72	2.916313	0.52546	.	.	ENSG00000170927	ENST00000371117;ENST00000340994;ENST00000393616	D;D	0.90324	-2.65;-2.65	5.98	5.12	0.69794	Cell surface receptor IPT/TIG (1);Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.429815	0.25984	N	0.027054	D	0.92254	0.7543	M	0.72118	2.19	0.09310	N	1	D;D	0.76494	0.996;0.999	P;D	0.72982	0.899;0.979	D	0.87537	0.2456	10	0.72032	D	0.01	.	12.1659	0.54129	0.0:0.9211:0.0:0.0789	.	958;958	P08F94-2;P08F94	.;PKHD1_HUMAN	Y	958	ENSP00000360158:D958Y;ENSP00000341097:D958Y	ENSP00000341097:D958Y	D	-	1	0	PKHD1	52015841	0.112000	0.22096	0.012000	0.15200	0.820000	0.46376	1.204000	0.32296	1.558000	0.49541	0.650000	0.86243	GAC	.		0.368	PKHD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040893.1	NM_138694	
PLA2G4A	5321	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	186948508	186948508	+	Silent	SNP	A	A	G			TCGA-G3-A5SL-01A-11D-A27I-10	TCGA-G3-A5SL-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70422e6d-cb1f-4284-8be9-1d4517ffad60	a38d4467-c3e5-4639-ad4f-88bcd7ab9f26	g.chr1:186948508A>G	ENST00000367466.3	+	17	2174	c.2022A>G	c.(2020-2022)ccA>ccG	p.P674P	PLA2G4A_ENST00000442353.2_Silent_p.P614P	NM_024420.2	NP_077734	P47712	PA24A_HUMAN	phospholipase A2, group IVA (cytosolic, calcium-dependent)	674	PLA2c. {ECO:0000255|PROSITE- ProRule:PRU00555}.				arachidonic acid metabolic process (GO:0019369)|arachidonic acid secretion (GO:0050482)|blood coagulation (GO:0007596)|cardiolipin acyl-chain remodeling (GO:0035965)|cellular response to antibiotic (GO:0071236)|glycerophospholipid biosynthetic process (GO:0046474)|icosanoid biosynthetic process (GO:0046456)|icosanoid metabolic process (GO:0006690)|phosphatidic acid biosynthetic process (GO:0006654)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylglycerol acyl-chain remodeling (GO:0036148)|phosphatidylinositol acyl-chain remodeling (GO:0036149)|phosphatidylserine acyl-chain remodeling (GO:0036150)|phospholipid catabolic process (GO:0009395)|phospholipid metabolic process (GO:0006644)|platelet activating factor biosynthetic process (GO:0006663)|platelet activation (GO:0030168)|regulation of cell proliferation (GO:0042127)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|mitochondrial inner membrane (GO:0005743)	calcium ion binding (GO:0005509)|calcium-dependent phospholipase A2 activity (GO:0047498)|calcium-dependent phospholipid binding (GO:0005544)|lysophospholipase activity (GO:0004622)|phospholipase A2 activity (GO:0004623)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(9)|lung(22)|ovary(1)|prostate(3)|skin(4)|stomach(1)	53					Aldesleukin(DB00041)|Carbachol(DB00411)|Carbenicillin(DB00578)|Epirubicin(DB00445)|Fluocinolone Acetonide(DB00591)|Fluticasone Propionate(DB00588)|Niflumic Acid(DB04552)|Orlistat(DB01083)|Quinacrine(DB01103)|Streptokinase(DB00086)|Suramin(DB04786)	TTGATGACCCAGAATCACCAT	0.343																																					p.P674P		.											.	PLA2G4A	721	0			c.A2022G						.						120.0	116.0	117.0					1																	186948508		2203	4300	6503	SO:0001819	synonymous_variant	5321	exon17			TGACCCAGAATCA	M72393	CCDS1372.1	1q25	2014-09-17			ENSG00000116711	ENSG00000116711	3.1.1.4, 3.1.1.5		9035	protein-coding gene	gene with protein product		600522		PLA2G4		8175726	Standard	NM_024420		Approved	cPLA2-alpha	uc001gsc.3	P47712	OTTHUMG00000035512	ENST00000367466.3:c.2022A>G	1.37:g.186948508A>G		180.0	0.0		168.0	80.0	NM_024420	B1AKG4|Q29R80	Silent	SNP	ENST00000367466.3	37	CCDS1372.1																																																																																			.		0.343	PLA2G4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086236.1	NM_024420	
PPP2R4	5524	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	131898785	131898785	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A5SL-01A-11D-A27I-10	TCGA-G3-A5SL-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70422e6d-cb1f-4284-8be9-1d4517ffad60	a38d4467-c3e5-4639-ad4f-88bcd7ab9f26	g.chr9:131898785A>G	ENST00000337738.1	+	8	968	c.701A>G	c.(700-702)tAc>tGc	p.Y234C	PPP2R4_ENST00000348141.5_Missense_Mutation_p.Y205C|PPP2R4_ENST00000524946.2_5'Flank|PPP2R4_ENST00000347048.4_Intron|PPP2R4_ENST00000452489.2_Missense_Mutation_p.Y234C|PPP2R4_ENST00000355007.3_Missense_Mutation_p.Y157C|PPP2R4_ENST00000393370.2_Missense_Mutation_p.Y199C|PPP2R4_ENST00000357197.4_Missense_Mutation_p.Y170C|PPP2R4_ENST00000423100.1_5'Flank|PPP2R4_ENST00000358994.4_Missense_Mutation_p.Y199C	NM_178001.2	NP_821068.1	Q15257	PTPA_HUMAN	protein phosphatase 2A activator, regulatory subunit 4	234					ATP catabolic process (GO:0006200)|mitotic spindle organization in nucleus (GO:0030472)|negative regulation of phosphoprotein phosphatase activity (GO:0032515)|negative regulation of protein dephosphorylation (GO:0035308)|positive regulation of apoptotic process (GO:0043065)|positive regulation of phosphoprotein phosphatase activity (GO:0032516)|positive regulation of protein dephosphorylation (GO:0035307)|protein folding (GO:0006457)|protein peptidyl-prolyl isomerization (GO:0000413)|regulation of phosphoprotein phosphatase activity (GO:0043666)	calcium channel complex (GO:0034704)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|protein phosphatase type 2A complex (GO:0000159)	ATP binding (GO:0005524)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase type 2A regulator activity (GO:0008601)|protein tyrosine phosphatase activator activity (GO:0008160)|receptor binding (GO:0005102)			breast(3)|endometrium(1)|kidney(1)|lung(3)|ovary(1)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	12		Medulloblastoma(224;0.235)		UCEC - Uterine corpus endometrioid carcinoma (4;0.0178)		CAGAAAACATACAGGATGGAG	0.537																																					p.Y234C	Colon(158;2158 2504 4450 20433)	.											.	PPP2R4	660	0			c.A701G						.						184.0	196.0	192.0					9																	131898785		2203	4300	6503	SO:0001583	missense	5524	exon8			AAACATACAGGAT	X73478	CCDS6920.1, CCDS65156.1, CCDS75917.1	9q34	2010-06-18	2007-01-22		ENSG00000119383	ENSG00000119383		"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"""	9308	protein-coding gene	gene with protein product	"""phosphotyrosyl phosphatase activator"", ""PP2A phosphatase activator"""	600756	"""protein phosphatase 2A, regulatory subunit B' (PR 53)"""			8530035	Standard	NM_021131		Approved	PTPA, PR53	uc004bxm.2	Q15257	OTTHUMG00000020774	ENST00000337738.1:c.701A>G	9.37:g.131898785A>G	ENSP00000337448:p.Tyr234Cys	179.0	0.0		134.0	51.0	NM_178001	A2A347|A9IZU4|B4DXM4|Q15258|Q53GZ3|Q5TZQ2|Q9BUK1|Q9NNZ7|Q9NNZ8|Q9NNZ9	Missense_Mutation	SNP	ENST00000337738.1	37		.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	A|A|A	24.3|24.3|24.3	4.513174|4.513174|4.513174	0.85389|0.85389|0.85389	.|.|.	.|.|.	ENSG00000119383|ENSG00000119383|ENSG00000119383	ENST00000455240|ENST00000411917|ENST00000358994;ENST00000455292;ENST00000393370;ENST00000337738;ENST00000348141;ENST00000452489;ENST00000357197;ENST00000445241;ENST00000355007;ENST00000417728	.|.|T;T;T;T;T;T;T;T;T;T	.|.|0.60424	.|.|0.19;0.19;0.19;0.19;0.19;0.19;0.19;0.19;0.19;0.19	5.62|5.62|5.62	5.62|5.62|5.62	0.85841|0.85841|0.85841	.|.|.	.|.|0.000000	.|.|0.85682	.|.|D	.|.|0.000000	D|D|D	0.83954|0.83954|0.83954	0.5366|0.5366|0.5366	H|H|H	0.97240|0.97240|0.97240	3.965|3.965|3.965	0.80722|0.80722|0.80722	D|D|D	1|1|1	.|.|D;D;D;D;D;D	.|.|0.89917	.|.|1.0;1.0;1.0;0.996;1.0;0.996	.|.|D;D;D;P;D;D	.|.|0.97110	.|.|1.0;0.999;1.0;0.908;1.0;0.959	D|D|D	0.89290|0.89290|0.89290	0.3618|0.3618|0.3618	5|5|10	.|.|0.87932	.|.|D	.|.|0	-24.3755|-24.3755|-24.3755	13.5753|13.5753|13.5753	0.61870|0.61870|0.61870	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.|.	.|.|157;170;234;157;234;199	.|.|B4DLX5;Q15257-3;B4DZF8;Q15257-4;Q15257;Q15257-2	.|.|.;.;.;.;PTPA_HUMAN;.	M|A|C	12|4|199;234;199;234;205;234;170;234;157;164	.|.|ENSP00000351885:Y199C;ENSP00000395499:Y234C;ENSP00000377036:Y199C;ENSP00000337448:Y234C;ENSP00000335200:Y205C;ENSP00000394338:Y234C;ENSP00000349726:Y170C;ENSP00000406997:Y234C;ENSP00000347109:Y157C;ENSP00000403542:Y164C	.|.|ENSP00000337448:Y234C	I|T|Y	+|+|+	3|1|2	3|0|0	PPP2R4|PPP2R4|PPP2R4	130938606|130938606|130938606	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	0.984000|0.984000|0.984000	0.44739|0.44739|0.44739	0.981000|0.981000|0.981000	0.71138|0.71138|0.71138	8.918000|8.918000|8.918000	0.92759|0.92759|0.92759	2.133000|2.133000|2.133000	0.65898|0.65898|0.65898	0.455000|0.455000|0.455000	0.32223|0.32223|0.32223	ATA|ACA|TAC	.		0.537	PPP2R4-201	KNOWN	basic	protein_coding	protein_coding		NM_021131	
PQLC3	130814	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	11300640	11300640	+	Silent	SNP	G	G	C			TCGA-G3-A5SL-01A-11D-A27I-10	TCGA-G3-A5SL-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70422e6d-cb1f-4284-8be9-1d4517ffad60	a38d4467-c3e5-4639-ad4f-88bcd7ab9f26	g.chr2:11300640G>C	ENST00000295083.3	+	2	367	c.192G>C	c.(190-192)ctG>ctC	p.L64L	PQLC3_ENST00000402361.1_Silent_p.L64L|PQLC3_ENST00000441908.2_Silent_p.L64L|PQLC3_ENST00000476787.1_3'UTR	NM_152391.3	NP_689604.1	Q8N755	PQLC3_HUMAN	PQ loop repeat containing 3	64						integral component of membrane (GO:0016021)				kidney(2)|large_intestine(2)|lung(1)|upper_aerodigestive_tract(1)	6	all_hematologic(175;0.0797)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.0978)|OV - Ovarian serous cystadenocarcinoma(76;0.132)		ATCCGCCGCTGACCTACCTGG	0.612																																					p.L64L		.											.	PQLC3	90	0			c.G192C						.						159.0	135.0	143.0					2																	11300640		2203	4300	6503	SO:0001819	synonymous_variant	130814	exon2			GCCGCTGACCTAC	BC027625	CCDS1679.1, CCDS62856.1, CCDS62857.1	2p25.1	2004-02-05	2005-07-19	2005-07-19	ENSG00000162976	ENSG00000162976			28503	protein-coding gene	gene with protein product			"""chromosome 2 open reading frame 22"""	C2orf22		12477932	Standard	NM_001282711		Approved	MGC33602	uc002rbc.3	Q8N755	OTTHUMG00000119055	ENST00000295083.3:c.192G>C	2.37:g.11300640G>C		212.0	0.0		134.0	7.0	NM_152391	B2R8K1|B4DWA4	Silent	SNP	ENST00000295083.3	37	CCDS1679.1	.	.	.	.	.	.	.	.	.	.	G	10.12	1.263258	0.23051	.	.	ENSG00000162976	ENST00000428481	.	.	.	5.01	-0.0192	0.13961	.	.	.	.	.	T	0.50854	0.1640	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.35943	-0.9768	4	.	.	.	-25.8568	5.5394	0.17030	0.3671:0.3815:0.2514:0.0	.	.	.	.	H	44	.	.	D	+	1	0	PQLC3	11218091	0.990000	0.36364	0.996000	0.52242	0.988000	0.76386	0.143000	0.16115	-0.090000	0.12462	0.561000	0.74099	GAC	.		0.612	PQLC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239266.4	NM_152391	
PRDM15	63977	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	21	43221871	43221871	+	Silent	SNP	G	G	A			TCGA-G3-A5SL-01A-11D-A27I-10	TCGA-G3-A5SL-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70422e6d-cb1f-4284-8be9-1d4517ffad60	a38d4467-c3e5-4639-ad4f-88bcd7ab9f26	g.chr21:43221871G>A	ENST00000269844.3	-	31	4163	c.4053C>T	c.(4051-4053)acC>acT	p.T1351T	PRDM15_ENST00000470586.1_5'UTR|PRDM15_ENST00000422911.1_Silent_p.T1042T|PRDM15_ENST00000398548.1_Silent_p.T1022T|PRDM15_ENST00000538201.1_Silent_p.T1005T|PRDM15_ENST00000447207.2_Silent_p.T985T	NM_022115.3	NP_071398.3	P57071	PRD15_HUMAN	PR domain containing 15	1351					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(11)|ovary(3)|skin(2)|stomach(2)|urinary_tract(1)	43						GGTCACCCAGGGTCACCACTA	0.527																																					p.T1351T		.											.	PRDM15	90	0			c.C4053T						.						66.0	69.0	68.0					21																	43221871		2203	4300	6503	SO:0001819	synonymous_variant	63977	exon31			ACCCAGGGTCACC	AF276513	CCDS13676.1, CCDS42932.1, CCDS63370.1	21q22.3	2013-01-08	2002-07-31		ENSG00000141956	ENSG00000141956		"""Zinc fingers, C2H2-type"""	13999	protein-coding gene	gene with protein product			"""chromosome 21 open reading frame 83"""	ZNF298, C21orf83		12036297, 12036298	Standard	NM_022115		Approved		uc002yzq.1	P57071	OTTHUMG00000086781	ENST00000269844.3:c.4053C>T	21.37:g.43221871G>A		271.0	0.0		182.0	31.0	NM_022115	E9PDJ6|E9PF37|E9PGL3|Q4W8S0|Q4W8S3|Q4W8S4|Q4W8S5|Q8N0X3|Q8NEX0|Q9NQV3	Silent	SNP	ENST00000269844.3	37	CCDS13676.1																																																																																			.		0.527	PRDM15-201	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_022115	
PRKG1	5592	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	54031194	54031194	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A5SL-01A-11D-A27I-10	TCGA-G3-A5SL-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70422e6d-cb1f-4284-8be9-1d4517ffad60	a38d4467-c3e5-4639-ad4f-88bcd7ab9f26	g.chr10:54031194C>T	ENST00000401604.2	+	11	1407	c.1213C>T	c.(1213-1215)Cac>Tac	p.H405Y	PRKG1_ENST00000373980.4_Missense_Mutation_p.H420Y|PRKG1-AS1_ENST00000426785.2_RNA|PRKG1_ENST00000373975.2_Missense_Mutation_p.H123Y|PRKG1-AS1_ENST00000452247.2_RNA|PRKG1_ENST00000373985.1_Missense_Mutation_p.H393Y			Q13976	KGP1_HUMAN	protein kinase, cGMP-dependent, type I	405	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				actin cytoskeleton organization (GO:0030036)|blood coagulation (GO:0007596)|cGMP-mediated signaling (GO:0019934)|dendrite development (GO:0016358)|forebrain development (GO:0030900)|negative regulation of platelet aggregation (GO:0090331)|neuron migration (GO:0001764)|protein phosphorylation (GO:0006468)|regulation of GTPase activity (GO:0043087)|relaxation of vascular smooth muscle (GO:0060087)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium channel regulator activity (GO:0005246)|cGMP binding (GO:0030553)|cGMP-dependent protein kinase activity (GO:0004692)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(23)|ovary(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	53		all_cancers(4;2.13e-08)|all_epithelial(4;2.44e-08)|all_lung(4;0.000173)		all cancers(4;1.18e-05)|GBM - Glioblastoma multiforme(4;0.000359)|Epithelial(53;0.00532)|Lung(62;0.0606)		ACAGCAGGAGCACATCCGCTC	0.468																																					p.H420Y		.											.	PRKG1	523	0			c.C1258T						.						85.0	79.0	81.0					10																	54031194		2203	4300	6503	SO:0001583	missense	5592	exon11			CAGGAGCACATCC		CCDS7244.1	10q11.2	2009-07-10			ENSG00000185532	ENSG00000185532	2.7.11.1		9414	protein-coding gene	gene with protein product		176894		PRKGR1B, PRKG1B		2792381, 1544322	Standard	NM_001098512		Approved	PGK, PKG	uc001jjo.3	Q13976	OTTHUMG00000018248	ENST00000401604.2:c.1213C>T	10.37:g.54031194C>T	ENSP00000384200:p.His405Tyr	42.0	0.0		100.0	32.0	NM_006258	A5YM56|B3KSF3|E2PU10|P14619|Q5JP05|Q5JSJ6|Q6P5T7	Missense_Mutation	SNP	ENST00000401604.2	37	CCDS44399.1	.	.	.	.	.	.	.	.	.	.	C	25.9	4.688039	0.88639	.	.	ENSG00000185532	ENST00000401604;ENST00000373985;ENST00000373980;ENST00000332193;ENST00000373975	T;T;T	0.65549	-0.16;-0.16;-0.16	4.92	4.92	0.64577	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.76307	0.3969	L	0.53671	1.685	0.80722	D	1	P;D;D	0.89917	0.908;1.0;1.0	P;D;D	0.91635	0.838;0.997;0.999	T	0.78909	-0.2018	10	0.87932	D	0	-14.0481	18.0731	0.89417	0.0:1.0:0.0:0.0	.	123;420;405	B3KSF3;Q13976-2;Q13976	.;.;KGP1_HUMAN	Y	405;393;420;123;17	ENSP00000384200:H405Y;ENSP00000363097:H393Y;ENSP00000363092:H420Y	ENSP00000327642:H123Y	H	+	1	0	PRKG1	53701200	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.349000	0.79376	2.435000	0.82474	0.551000	0.68910	CAC	.		0.468	PRKG1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			
PTPRA	5786	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	3002002	3002002	+	Silent	SNP	G	G	A			TCGA-G3-A5SL-01A-11D-A27I-10	TCGA-G3-A5SL-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70422e6d-cb1f-4284-8be9-1d4517ffad60	a38d4467-c3e5-4639-ad4f-88bcd7ab9f26	g.chr20:3002002G>A	ENST00000216877.6	+	13	1462	c.1062G>A	c.(1060-1062)ggG>ggA	p.G354G	PTPRA_ENST00000318266.5_Silent_p.G354G|PTPRA_ENST00000356147.3_Silent_p.G354G|PTPRA_ENST00000399903.2_Silent_p.G363G|PTPRA_ENST00000380393.3_Silent_p.G363G|PTPRA_ENST00000425918.2_Silent_p.G374G|PTPRA_ENST00000358719.4_Silent_p.G219G	NM_080840.2	NP_543030.1	P18433	PTPRA_HUMAN	protein tyrosine phosphatase, receptor type, A	363	Tyrosine-protein phosphatase 1. {ECO:0000255|PROSITE-ProRule:PRU00160}.				axon guidance (GO:0007411)|insulin receptor signaling pathway (GO:0008286)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein phosphorylation (GO:0006468)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|breast(1)|endometrium(3)|large_intestine(3)|lung(5)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	17						GGACCTATGGGAATATTCGGG	0.522																																					p.G363G		.											.	PTPRA	227	0			c.G1089A						.						203.0	165.0	178.0					20																	3002002		2203	4300	6503	SO:0001819	synonymous_variant	5786	exon18			CTATGGGAATATT		CCDS13038.1, CCDS13039.1	20p13	2011-06-09			ENSG00000132670	ENSG00000132670		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"""	9664	protein-coding gene	gene with protein product		176884		PTPRL2, PTPA		2172030, 2169617	Standard	NM_080840		Approved	LRP, HLPR, HPTPA, RPTPA	uc002whn.3	P18433	OTTHUMG00000031718	ENST00000216877.6:c.1062G>A	20.37:g.3002002G>A		264.0	0.0		223.0	78.0	NM_002836	A8K2G8|D3DVX5|Q14513|Q7Z2I2|Q96TD9	Silent	SNP	ENST00000216877.6	37	CCDS13039.1																																																																																			.		0.522	PTPRA-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077682.3		
RAI14	26064	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	34824058	34824058	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A5SL-01A-11D-A27I-10	TCGA-G3-A5SL-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70422e6d-cb1f-4284-8be9-1d4517ffad60	a38d4467-c3e5-4639-ad4f-88bcd7ab9f26	g.chr5:34824058C>T	ENST00000265109.3	+	15	2398	c.2111C>T	c.(2110-2112)tCt>tTt	p.S704F	RAI14_ENST00000397449.1_Missense_Mutation_p.S697F|RAI14_ENST00000428746.2_Missense_Mutation_p.S704F|RAI14_ENST00000515799.1_Missense_Mutation_p.S707F|RAI14_ENST00000512629.1_Missense_Mutation_p.S675F|RAI14_ENST00000506376.1_Missense_Mutation_p.S696F|RAI14_ENST00000503673.1_Missense_Mutation_p.S704F	NM_001145522.1|NM_015577.2	NP_001138994.1|NP_056392.2	Q9P0K7	RAI14_HUMAN	retinoic acid induced 14	704						actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nucleus (GO:0005634)				breast(2)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(19)|lung(22)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	56	all_lung(31;0.000191)					GAAATGAAGTCTCAGTATTCA	0.408																																					p.S707F		.											.	RAI14	91	0			c.C2120T						.						89.0	87.0	87.0					5																	34824058		2203	4300	6503	SO:0001583	missense	26064	exon17			TGAAGTCTCAGTA	AB037755	CCDS34142.1, CCDS54837.1, CCDS54838.1, CCDS54839.1	5p13.3-p13.2	2013-01-10			ENSG00000039560	ENSG00000039560		"""Ankyrin repeat domain containing"""	14873	protein-coding gene	gene with protein product	"""novel retinal pigment epithelial"""	606586				11042181	Standard	NM_015577		Approved	NORPEG, KIAA1334, RAI13, DKFZp564G013	uc011coj.2	Q9P0K7	OTTHUMG00000162019	ENST00000265109.3:c.2111C>T	5.37:g.34824058C>T	ENSP00000265109:p.Ser704Phe	297.0	0.0		252.0	40.0	NM_001145525	E9PED3|Q6V1W9|Q7Z5I4|Q7Z733|Q9P2L2|Q9Y3T5	Missense_Mutation	SNP	ENST00000265109.3	37	CCDS34142.1	.	.	.	.	.	.	.	.	.	.	C	22.7	4.327857	0.81690	.	.	ENSG00000039560	ENST00000265109;ENST00000512629;ENST00000428746;ENST00000503673;ENST00000515799;ENST00000506376;ENST00000397449	T;T;T;T;T;T;T	0.37752	1.21;1.18;1.21;1.21;1.21;1.26;1.25	5.68	5.68	0.88126	.	.	.	.	.	T	0.47469	0.1447	L	0.32530	0.975	0.54753	D	0.999986	P;P;D;P	0.55385	0.937;0.938;0.971;0.938	P;P;P;P	0.57204	0.628;0.58;0.815;0.58	T	0.43766	-0.9371	9	0.72032	D	0.01	-4.0981	19.7964	0.96487	0.0:1.0:0.0:0.0	.	696;675;707;704	Q9P0K7-3;E9PED3;Q9P0K7-2;Q9P0K7	.;.;.;RAI14_HUMAN	F	704;675;704;704;707;696;697	ENSP00000265109:S704F;ENSP00000422377:S675F;ENSP00000388725:S704F;ENSP00000422942:S704F;ENSP00000427123:S707F;ENSP00000423854:S696F;ENSP00000380591:S697F	ENSP00000265109:S704F	S	+	2	0	RAI14	34859815	0.996000	0.38824	1.000000	0.80357	0.992000	0.81027	3.326000	0.52037	2.683000	0.91414	0.555000	0.69702	TCT	.		0.408	RAI14-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366786.1	NM_015577	
RASA1	5921	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	5	86672363	86672363	+	Missense_Mutation	SNP	A	A	C			TCGA-G3-A5SL-01A-11D-A27I-10	TCGA-G3-A5SL-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70422e6d-cb1f-4284-8be9-1d4517ffad60	a38d4467-c3e5-4639-ad4f-88bcd7ab9f26	g.chr5:86672363A>C	ENST00000274376.6	+	16	2729	c.2165A>C	c.(2164-2166)gAg>gCg	p.E722A	RASA1_ENST00000456692.2_Missense_Mutation_p.E545A|CTC-428H11.2_ENST00000607486.1_RNA|RASA1_ENST00000512763.1_Missense_Mutation_p.E555A|RASA1_ENST00000506290.1_Missense_Mutation_p.E556A	NM_002890.2	NP_002881.1	P20936	RASA1_HUMAN	RAS p21 protein activator (GTPase activating protein) 1	722					blood vessel morphogenesis (GO:0048514)|embryo development (GO:0009790)|intracellular signal transduction (GO:0035556)|mitotic cytokinesis (GO:0000281)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of Ras GTPase activity (GO:0032320)|regulation of actin filament polymerization (GO:0030833)|regulation of cell shape (GO:0008360)|regulation of RNA metabolic process (GO:0051252)|signal transduction (GO:0007165)|vasculogenesis (GO:0001570)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|ruffle (GO:0001726)	glycoprotein binding (GO:0001948)|GTPase binding (GO:0051020)|potassium channel inhibitor activity (GO:0019870)|Ras GTPase activator activity (GO:0005099)|receptor binding (GO:0005102)			NS(1)|cervix(1)|endometrium(7)|kidney(4)|large_intestine(12)|lung(13)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	48		all_cancers(142;8.25e-07)|Lung NSC(167;0.000185)|all_lung(232;0.000222)|Colorectal(57;0.00542)|Ovarian(174;0.0423)		OV - Ovarian serous cystadenocarcinoma(54;4.72e-41)|Epithelial(54;1.51e-36)|all cancers(79;3.76e-31)		CCAGAAGAAGAGTACAGTGAA	0.338																																					p.E722A		.											.	RASA1	661	0			c.A2165C						.						70.0	69.0	70.0					5																	86672363		2203	4300	6503	SO:0001583	missense	5921	exon16			AAGAAGAGTACAG		CCDS34200.1, CCDS47243.1	5q13	2013-02-14			ENSG00000145715	ENSG00000145715		"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	9871	protein-coding gene	gene with protein product	"""capillary malformation-arteriovenous malformation"""	139150		RASA		15917201	Standard	NM_022650		Approved	GAP, CM-AVM, p120GAP, p120RASGAP	uc003kiw.3	P20936	OTTHUMG00000162605	ENST00000274376.6:c.2165A>C	5.37:g.86672363A>C	ENSP00000274376:p.Glu722Ala	55.0	0.0		94.0	9.0	NM_002890	B2R6W3|Q9UDI1	Missense_Mutation	SNP	ENST00000274376.6	37	CCDS34200.1	.	.	.	.	.	.	.	.	.	.	A	17.67	3.447359	0.63178	.	.	ENSG00000145715	ENST00000274376;ENST00000534133;ENST00000456692;ENST00000512763;ENST00000506290	T;T;T;T	0.71461	-0.57;-0.57;-0.57;-0.57	5.54	5.54	0.83059	Rho GTPase activation protein (1);C2 calcium/lipid-binding domain, CaLB (1);Ras GTPase-activating protein (1);	0.195432	0.53938	D	0.000053	T	0.79452	0.4448	M	0.73962	2.25	0.80722	D	1	P;P;P;P;P	0.46578	0.797;0.477;0.797;0.871;0.88	P;B;P;P;P	0.51833	0.482;0.242;0.482;0.681;0.501	T	0.82275	-0.0538	10	0.72032	D	0.01	.	15.6717	0.77283	1.0:0.0:0.0:0.0	.	556;555;556;545;722	E9PGC0;B4DTL2;B4DTX4;P20936-2;P20936	.;.;.;.;RASA1_HUMAN	A	722;755;545;555;556	ENSP00000274376:E722A;ENSP00000411221:E545A;ENSP00000422008:E555A;ENSP00000420905:E556A	ENSP00000274376:E722A	E	+	2	0	RASA1	86708119	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.339000	0.96797	2.102000	0.63906	0.460000	0.39030	GAG	.		0.338	RASA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000369729.1	NM_002890	
RBMS3	27303	broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	30032668	30032668	+	Silent	SNP	A	A	G			TCGA-G3-A5SL-01A-11D-A27I-10	TCGA-G3-A5SL-10A-01D-A27I-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70422e6d-cb1f-4284-8be9-1d4517ffad60	a38d4467-c3e5-4639-ad4f-88bcd7ab9f26	g.chr3:30032668A>G	ENST00000383767.2	+	14	1611	c.1275A>G	c.(1273-1275)gaA>gaG	p.E425E	RBMS3_ENST00000383766.2_Silent_p.E407E|RBMS3_ENST00000273139.9_Silent_p.E409E|RBMS3_ENST00000434693.2_Silent_p.E424E|RBMS3_ENST00000473799.1_3'UTR|RBMS3_ENST00000452462.1_Silent_p.E409E|RBMS3_ENST00000456853.1_Silent_p.E422E|RBMS3_ENST00000396583.3_Silent_p.E422E			Q6XE24	RBMS3_HUMAN	RNA binding motif, single stranded interacting protein 3	425					positive regulation of translation (GO:0045727)	cytoplasm (GO:0005737)	mRNA 3'-UTR binding (GO:0003730)|nucleotide binding (GO:0000166)			breast(1)|central_nervous_system(1)|large_intestine(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	11		Ovarian(412;0.0956)				CATCCAACGAACATGCACCTG	0.488																																					p.E425E		.											.	RBMS3	90	0			c.A1275G						.						259.0	185.0	210.0					3																	30032668		2203	4300	6503	SO:0001819	synonymous_variant	27303	exon14			CAACGAACATGCA	AF023259	CCDS33724.1, CCDS33725.1, CCDS33726.1, CCDS54557.1, CCDS54558.1	3p24-p23	2013-02-12	2010-04-20		ENSG00000144642	ENSG00000144642		"""RNA binding motif (RRM) containing"""	13427	protein-coding gene	gene with protein product	"""RNA-binding protein"""	605786	"""RNA binding motif, single stranded interacting protein"""			10675610	Standard	NM_001003793		Approved		uc003cel.3	Q6XE24	OTTHUMG00000155699	ENST00000383767.2:c.1275A>G	3.37:g.30032668A>G		169.0	1.0		204.0	86.0	NM_001003793	A8K9S4|B7ZL17|G5E9J9|O75876|Q17RI0|Q6XE23	Silent	SNP	ENST00000383767.2	37	CCDS33724.1																																																																																			.		0.488	RBMS3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000341306.1	NM_001003792	
RDH12	145226	bcgsc.ca;mdanderson.org	37	14	68195937	68195937	+	Missense_Mutation	SNP	C	C	G	rs104894476		TCGA-G3-A5SL-01A-11D-A27I-10	TCGA-G3-A5SL-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_1	WXS	none	.		Illumina HiSeq	70422e6d-cb1f-4284-8be9-1d4517ffad60	a38d4467-c3e5-4639-ad4f-88bcd7ab9f26	g.chr14:68195937C>G	ENST00000551171.1	+	8	1012	c.688C>G	c.(688-690)Cca>Gca	p.P230A	RDH12_ENST00000539142.1_Missense_Mutation_p.P230A|RDH12_ENST00000267502.3_Missense_Mutation_p.P230A	NM_152443.2	NP_689656.2	Q96NR8	RDH12_HUMAN	retinol dehydrogenase 12 (all-trans/9-cis/11-cis)	230			P -> A (in LCA13). {ECO:0000269|PubMed:15322982}.|P -> L (in retinal dystrophy; unknown pathological significance). {ECO:0000269|PubMed:16269441}.		photoreceptor cell maintenance (GO:0045494)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|retinol metabolic process (GO:0042572)|visual perception (GO:0007601)	intracellular (GO:0005622)|photoreceptor inner segment membrane (GO:0060342)	retinol dehydrogenase activity (GO:0004745)			large_intestine(3)|lung(3)|ovary(1)|prostate(1)|skin(4)	12				all cancers(60;0.000704)|OV - Ovarian serous cystadenocarcinoma(108;0.00161)|BRCA - Breast invasive adenocarcinoma(234;0.00953)	Vitamin A(DB00162)	CGCAGTGCACCCAGGCGTCGT	0.632																																					p.P230A		.											.	RDH12	91	0			c.C688G	GRCh37	CM042470	RDH12	M	rs104894476	.						104.0	104.0	104.0					14																	68195937		2203	4300	6503	SO:0001583	missense	145226	exon8			GTGCACCCAGGCG	AK054835	CCDS9787.1	14q24.1	2013-02-14	2006-05-09		ENSG00000139988	ENSG00000139988	1.1.1.-	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 2"""	19977	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 7C, member 2"""	608830	"""retinol dehydrogenase 12 (all-trans and 9-cis)"""			12226107, 19027726	Standard	NM_152443		Approved	FLJ30273, SDR7C2, LCA13, RP53	uc001xjz.4	Q96NR8		ENST00000551171.1:c.688C>G	14.37:g.68195937C>G	ENSP00000449079:p.Pro230Ala	37.0	1.0		37.0	16.0	NM_152443	B2RDA2|Q8TAW6	Missense_Mutation	SNP	ENST00000551171.1	37	CCDS9787.1	.	.	.	.	.	.	.	.	.	.	C	19.35	3.811194	0.70797	.	.	ENSG00000139988	ENST00000551171;ENST00000267502;ENST00000539142	D;D;D	0.94723	-3.5;-3.5;-3.5	5.74	5.74	0.90152	NAD(P)-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.98785	0.9591	H	0.99555	4.625	0.80722	A	1	D	0.89917	1.0	D	0.91635	0.999	D	0.99222	1.0879	9	0.87932	D	0	.	19.9351	0.97137	0.0:1.0:0.0:0.0	.	230	Q96NR8	RDH12_HUMAN	A	230	ENSP00000449079:P230A;ENSP00000267502:P230A;ENSP00000438715:P230A	ENSP00000267502:P230A	P	+	1	0	RDH12	67265690	1.000000	0.71417	1.000000	0.80357	0.106000	0.19336	7.601000	0.82783	2.703000	0.92315	0.655000	0.94253	CCA	.		0.632	RDH12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406918.1		
RELN	5649	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	103179563	103179563	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A5SL-01A-11D-A27I-10	TCGA-G3-A5SL-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70422e6d-cb1f-4284-8be9-1d4517ffad60	a38d4467-c3e5-4639-ad4f-88bcd7ab9f26	g.chr7:103179563T>C	ENST00000428762.1	-	45	7301	c.7142A>G	c.(7141-7143)gAc>gGc	p.D2381G	RELN_ENST00000424685.2_Missense_Mutation_p.D2381G|RELN_ENST00000343529.5_Missense_Mutation_p.D2381G	NM_005045.3	NP_005036.2	P78509	RELN_HUMAN	reelin	2381					associative learning (GO:0008306)|axon guidance (GO:0007411)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cell morphogenesis involved in differentiation (GO:0000904)|central nervous system development (GO:0007417)|cerebral cortex tangential migration (GO:0021800)|dendrite development (GO:0016358)|glial cell differentiation (GO:0010001)|hippocampus development (GO:0021766)|lateral motor column neuron migration (GO:0097477)|layer formation in cerebral cortex (GO:0021819)|long-term memory (GO:0007616)|N-methyl-D-aspartate receptor clustering (GO:0097114)|neuron migration (GO:0001764)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000969)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of lateral motor column neuron migration (GO:1902078)|positive regulation of long-term synaptic potentiation (GO:1900273)|positive regulation of neuron projection development (GO:0010976)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of TOR signaling (GO:0032008)|postsynaptic density protein 95 clustering (GO:0097119)|receptor localization to synapse (GO:0097120)|reelin-mediated signaling pathway (GO:0038026)|regulation of behavior (GO:0050795)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of synaptic transmission (GO:0050804)|response to pain (GO:0048265)|spinal cord patterning (GO:0021511)|ventral spinal cord development (GO:0021517)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	lipoprotein particle receptor binding (GO:0070325)|metal ion binding (GO:0046872)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|serine-type peptidase activity (GO:0008236)|very-low-density lipoprotein particle receptor binding (GO:0070326)			NS(3)|breast(8)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|lung(101)|ovary(9)|pancreas(2)|prostate(4)|skin(14)|stomach(2)|upper_aerodigestive_tract(12)|urinary_tract(2)	227				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)		GGCAGCGAAGTCTATCTGTAG	0.542																																					p.D2381G	NSCLC(146;835 1944 15585 22231 52158)	.											.	RELN	574	0			c.A7142G						.						106.0	88.0	94.0					7																	103179563		2203	4300	6503	SO:0001583	missense	5649	exon45			GCGAAGTCTATCT		CCDS34722.1, CCDS47680.1	7q22	2008-07-18			ENSG00000189056	ENSG00000189056			9957	protein-coding gene	gene with protein product		600514				9049633	Standard	NM_005045		Approved	RL, PRO1598	uc010liz.3	P78509	OTTHUMG00000157247	ENST00000428762.1:c.7142A>G	7.37:g.103179563T>C	ENSP00000392423:p.Asp2381Gly	104.0	0.0		150.0	68.0	NM_173054	A4D0P9|A4D0Q0|Q86UJ0|Q86UJ8|Q8NDV0|Q9UDQ2	Missense_Mutation	SNP	ENST00000428762.1	37	CCDS47680.1	.	.	.	.	.	.	.	.	.	.	T	17.80	3.478959	0.63849	.	.	ENSG00000189056	ENST00000428762;ENST00000343529;ENST00000424685;ENST00000448171	T;T;T	0.18657	2.2;2.2;2.2	5.35	5.35	0.76521	Neuraminidase (1);	0.000000	0.85682	D	0.000000	T	0.44705	0.1306	M	0.63843	1.955	0.58432	D	0.999999	D;D	0.89917	1.0;0.999	D;D	0.91635	0.999;0.992	T	0.40136	-0.9579	10	0.66056	D	0.02	.	15.3372	0.74266	0.0:0.0:0.0:1.0	.	2381;2381	P78509-2;P78509	.;RELN_HUMAN	G	2381	ENSP00000392423:D2381G;ENSP00000345694:D2381G;ENSP00000388446:D2381G	ENSP00000345694:D2381G	D	-	2	0	RELN	102966799	1.000000	0.71417	0.998000	0.56505	0.861000	0.49209	7.698000	0.84413	2.032000	0.59987	0.533000	0.62120	GAC	.		0.542	RELN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000348148.1	NM_005045	
RP1	6101	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	8	55534004	55534004	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A5SL-01A-11D-A27I-10	TCGA-G3-A5SL-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70422e6d-cb1f-4284-8be9-1d4517ffad60	a38d4467-c3e5-4639-ad4f-88bcd7ab9f26	g.chr8:55534004A>G	ENST00000220676.1	+	2	626	c.478A>G	c.(478-480)Agg>Ggg	p.R160G		NM_006269.1	NP_006260.1	P56715	RP1_HUMAN	retinitis pigmentosa 1 (autosomal dominant)	160	Doublecortin 2. {ECO:0000255|PROSITE- ProRule:PRU00072}.				axoneme assembly (GO:0035082)|cellular response to light stimulus (GO:0071482)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|photoreceptor cell outer segment organization (GO:0035845)|phototransduction, visible light (GO:0007603)|retinal cone cell development (GO:0046549)|retinal rod cell development (GO:0046548)|visual perception (GO:0007601)	axoneme (GO:0005930)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|photoreceptor connecting cilium (GO:0032391)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)	microtubule binding (GO:0008017)			NS(4)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(29)|lung(69)|ovary(6)|pancreas(1)|prostate(9)|skin(17)|upper_aerodigestive_tract(3)|urinary_tract(2)	169		all_lung(136;0.0831)|Lung NSC(129;0.109)|all_epithelial(80;0.123)	OV - Ovarian serous cystadenocarcinoma(7;4.4e-07)|Epithelial(17;3.37e-05)|all cancers(17;0.000285)			AGTGGTCTTCAGGAATGGCGA	0.662																																					p.R160G	Colon(91;1014 1389 7634 14542 40420)	.											.	RP1	102	0			c.A478G						.						63.0	66.0	65.0					8																	55534004		2203	4300	6503	SO:0001583	missense	6101	exon2			GTCTTCAGGAATG	AF146592	CCDS6160.1	8q12.1	2013-01-08				ENSG00000104237			10263	protein-coding gene	gene with protein product		603937				1783394	Standard	NM_006269		Approved	DCDC4A	uc003xsd.1	P56715		ENST00000220676.1:c.478A>G	8.37:g.55534004A>G	ENSP00000220676:p.Arg160Gly	97.0	0.0		243.0	37.0	NM_006269		Missense_Mutation	SNP	ENST00000220676.1	37	CCDS6160.1	.	.	.	.	.	.	.	.	.	.	A	13.08	2.129640	0.37630	.	.	ENSG00000104237	ENST00000220676	D	0.88975	-2.45	5.14	-2.13	0.07144	Doublecortin domain (4);	0.118204	0.37136	N	0.002238	D	0.91794	0.7404	M	0.84948	2.725	0.28950	N	0.890472	D	0.57257	0.979	P	0.52554	0.702	D	0.89781	0.3961	10	0.72032	D	0.01	-1.0676	16.2331	0.82357	0.4237:0.5763:0.0:0.0	.	160	P56715	RP1_HUMAN	G	160	ENSP00000220676:R160G	ENSP00000220676:R160G	R	+	1	2	RP1	55696557	0.732000	0.28121	0.119000	0.21687	0.172000	0.22775	0.880000	0.28159	-0.704000	0.05042	0.528000	0.53228	AGG	.		0.662	RP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378532.2	NM_006269	
SBF1	6305	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	50886721	50886721	+	Silent	SNP	A	A	T			TCGA-G3-A5SL-01A-11D-A27I-10	TCGA-G3-A5SL-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70422e6d-cb1f-4284-8be9-1d4517ffad60	a38d4467-c3e5-4639-ad4f-88bcd7ab9f26	g.chr22:50886721A>T	ENST00000390679.3	-	37	5410	c.5226T>A	c.(5224-5226)gcT>gcA	p.A1742A	SBF1_ENST00000380817.3_Silent_p.A1768A|SBF1_ENST00000348911.6_Silent_p.A1743A			O95248	MTMR5_HUMAN	SET binding factor 1	1742					cell death (GO:0008219)|positive regulation of Rab GTPase activity (GO:0032851)|protein dephosphorylation (GO:0006470)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)	protein tyrosine/serine/threonine phosphatase activity (GO:0008138)|Rab guanyl-nucleotide exchange factor activity (GO:0017112)			breast(1)|central_nervous_system(2)|endometrium(6)|kidney(8)|large_intestine(3)|lung(18)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	43		all_cancers(38;5.78e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.206)|LUAD - Lung adenocarcinoma(64;0.247)		TGCGGCGGGCAGCCTGACGGG	0.642																																					p.A1768A		.											.	SBF1	90	0			c.T5304A						.						39.0	47.0	44.0					22																	50886721		2083	4209	6292	SO:0001819	synonymous_variant	6305	exon38			GCGGGCAGCCTGA	U93181	CCDS14091.1, CCDS14091.2	22q13.33	2013-01-10			ENSG00000100241	ENSG00000100241		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"", ""DENN/MADD domain containing"", ""Pleckstrin homology (PH) domain containing"""	10542	protein-coding gene	gene with protein product	"""myotubularin related 5"", ""DENN/MADD domain containing 7A"""	603560				9537414, 9736772	Standard	NM_002972		Approved	MTMR5, DENND7A	uc003blh.3	O95248	OTTHUMG00000150204	ENST00000390679.3:c.5226T>A	22.37:g.50886721A>T		161.0	1.0		90.0	61.0	NM_002972	A6PVG9|O60228|Q5JXD8|Q5PPM2|Q96GR9|Q9UGB8	Silent	SNP	ENST00000390679.3	37		.	.	.	.	.	.	.	.	.	.	A	11.59	1.685202	0.29872	.	.	ENSG00000100241	ENST00000418590	.	.	.	3.61	-7.22	0.01485	.	.	.	.	.	T	0.43456	0.1248	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.45687	-0.9244	4	.	.	.	.	4.7953	0.13269	0.4376:0.0:0.3039:0.2585	.	.	.	.	S	290	.	.	C	-	1	0	SBF1	49233587	0.000000	0.05858	0.972000	0.41901	0.982000	0.71751	-3.375000	0.00493	-1.290000	0.02372	0.402000	0.26972	TGC	.		0.642	SBF1-201	KNOWN	basic	protein_coding	protein_coding			
SEC24B	10427	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	4	110442575	110442575	+	Splice_Site	SNP	G	G	A			TCGA-G3-A5SL-01A-11D-A27I-10	TCGA-G3-A5SL-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70422e6d-cb1f-4284-8be9-1d4517ffad60	a38d4467-c3e5-4639-ad4f-88bcd7ab9f26	g.chr4:110442575G>A	ENST00000265175.5	+	14	2356		c.e14-1		SEC24B_ENST00000399100.2_Splice_Site|SEC24B_ENST00000504968.2_Splice_Site	NM_006323.2	NP_006314.2	O95487	SC24B_HUMAN	SEC24 family member B						antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|aorta morphogenesis (GO:0035909)|auditory receptor cell stereocilium organization (GO:0060088)|cellular protein metabolic process (GO:0044267)|cochlear nucleus development (GO:0021747)|COPII vesicle coating (GO:0048208)|coronary artery morphogenesis (GO:0060982)|ER to Golgi vesicle-mediated transport (GO:0006888)|intracellular protein transport (GO:0006886)|lung lobe morphogenesis (GO:0060463)|membrane organization (GO:0061024)|neural tube closure (GO:0001843)|outflow tract morphogenesis (GO:0003151)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|pulmonary artery morphogenesis (GO:0061156)|regulation of cargo loading into COPII-coated vesicle (GO:1901301)|regulation of establishment of planar polarity involved in neural tube closure (GO:0090178)|small molecule metabolic process (GO:0044281)|vesicle-mediated transport (GO:0016192)	COPII vesicle coat (GO:0030127)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)|membrane (GO:0016020)	transporter activity (GO:0005215)|zinc ion binding (GO:0008270)			breast(1)|endometrium(7)|kidney(1)|large_intestine(10)|lung(12)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	36		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;3.03e-05)		TGTTTTCTCAGCTTATAAAAG	0.353																																					.		.											.	SEC24B	137	0			c.2302-1G>A						.						86.0	79.0	81.0					4																	110442575		1874	4089	5963	SO:0001630	splice_region_variant	10427	exon14			TTCTCAGCTTATA	AJ131245	CCDS43260.1, CCDS47124.1, CCDS75179.1	4q25	2013-10-21	2013-10-21		ENSG00000138802	ENSG00000138802			10704	protein-coding gene	gene with protein product		607184	"""SEC24 (S. cerevisiae) related gene family, member B"", ""SEC24 family, member B (S. cerevisiae)"""			10075675, 10329445	Standard	XM_005262688		Approved		uc003hzk.3	O95487	OTTHUMG00000161372	ENST00000265175.5:c.2302-1G>A	4.37:g.110442575G>A		123.0	0.0		70.0	16.0	NM_006323	B7ZKM8|B7ZKN4|Q0VG08	Splice_Site	SNP	ENST00000265175.5	37	CCDS47124.1	.	.	.	.	.	.	.	.	.	.	G	26.9	4.784398	0.90282	.	.	ENSG00000138802	ENST00000504968;ENST00000399100;ENST00000265175	.	.	.	5.78	5.78	0.91487	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.0139	0.97470	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	SEC24B	110662024	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.807000	0.99171	2.724000	0.93272	0.563000	0.77884	.	.		0.353	SEC24B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000364693.2		Intron
SGPP1	81537	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	64165361	64165361	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A5SL-01A-11D-A27I-10	TCGA-G3-A5SL-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70422e6d-cb1f-4284-8be9-1d4517ffad60	a38d4467-c3e5-4639-ad4f-88bcd7ab9f26	g.chr14:64165361C>T	ENST00000247225.6	-	2	794	c.700G>A	c.(700-702)Gga>Aga	p.G234R		NM_030791.2	NP_110418.1	Q9BX95	SGPP1_HUMAN	sphingosine-1-phosphate phosphatase 1	234					extrinsic apoptotic signaling pathway (GO:0097191)|intrinsic apoptotic signaling pathway (GO:0097193)|small molecule metabolic process (GO:0044281)|sphinganine-1-phosphate metabolic process (GO:0006668)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)|sphingosine metabolic process (GO:0006670)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	sphingosine-1-phosphate phosphatase activity (GO:0042392)	p.G234*(1)		central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(4)|skin(2)	10				OV - Ovarian serous cystadenocarcinoma(108;0.0056)|all cancers(60;0.0141)|BRCA - Breast invasive adenocarcinoma(234;0.103)		AGAATCAGTCCATATATAAGA	0.299																																					p.G234R		.											.	SGPP1	90	1	Substitution - Nonsense(1)	lung(1)	c.G700A						.						61.0	61.0	61.0					14																	64165361		2203	4294	6497	SO:0001583	missense	81537	exon2			TCAGTCCATATAT	AJ293294	CCDS9760.1	14q23.1	2003-09-17			ENSG00000126821	ENSG00000126821			17720	protein-coding gene	gene with protein product		612826				10859351	Standard	NM_030791		Approved		uc001xgj.3	Q9BX95	OTTHUMG00000029080	ENST00000247225.6:c.700G>A	14.37:g.64165361C>T	ENSP00000247225:p.Gly234Arg	158.0	0.0		94.0	24.0	NM_030791	B2RAH0|Q9H189	Missense_Mutation	SNP	ENST00000247225.6	37	CCDS9760.1	.	.	.	.	.	.	.	.	.	.	C	24.8	4.566056	0.86439	.	.	ENSG00000126821	ENST00000247225	T	0.54479	0.57	5.6	5.6	0.85130	Phosphatidic acid phosphatase/chloroperoxidase, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.76948	0.4059	M	0.86573	2.825	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.75144	-0.3421	10	0.32370	T	0.25	-8.1847	19.5805	0.95465	0.0:1.0:0.0:0.0	.	234	Q9BX95	SGPP1_HUMAN	R	234	ENSP00000247225:G234R	ENSP00000247225:G234R	G	-	1	0	SGPP1	63235114	1.000000	0.71417	0.999000	0.59377	0.958000	0.62258	6.071000	0.71229	2.806000	0.96561	0.655000	0.94253	GGA	.		0.299	SGPP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000072626.3	NM_030791	
SIRT3	23410	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	230535	230535	+	Missense_Mutation	SNP	A	A	C			TCGA-G3-A5SL-01A-11D-A27I-10	TCGA-G3-A5SL-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70422e6d-cb1f-4284-8be9-1d4517ffad60	a38d4467-c3e5-4639-ad4f-88bcd7ab9f26	g.chr11:230535A>C	ENST00000382743.4	-	4	826	c.724T>G	c.(724-726)Tca>Gca	p.S242A	SIRT3_ENST00000528702.1_5'UTR|SIRT3_ENST00000532956.1_Missense_Mutation_p.S242A|SIRT3_ENST00000529382.1_Missense_Mutation_p.S100A|SIRT3_ENST00000525319.1_Missense_Mutation_p.S161A|SIRT3_ENST00000524564.1_Missense_Mutation_p.S178A	NM_001017524.2|NM_012239.5	NP_001017524.1|NP_036371.1	Q9NTG7	SIR3_HUMAN	sirtuin 3	242	Deacetylase sirtuin-type. {ECO:0000255|PROSITE-ProRule:PRU00236}.				aerobic respiration (GO:0009060)|peptidyl-lysine deacetylation (GO:0034983)|protein ADP-ribosylation (GO:0006471)|protein deacetylation (GO:0006476)	membrane (GO:0016020)|mitochondrion (GO:0005739)	NAD+ ADP-ribosyltransferase activity (GO:0003950)|NAD+ binding (GO:0070403)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|zinc ion binding (GO:0008270)			endometrium(1)|lung(5)|urinary_tract(1)	7		all_cancers(49;1.58e-09)|all_epithelial(84;2.71e-06)|Breast(177;0.000162)|Ovarian(85;0.000626)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.0538)|all_lung(207;0.0713)		all cancers(45;3.66e-27)|Epithelial(43;2.02e-26)|OV - Ovarian serous cystadenocarcinoma(40;2.9e-21)|BRCA - Breast invasive adenocarcinoma(625;3.88e-05)|Lung(200;0.111)|LUSC - Lung squamous cell carcinoma(625;0.129)		ACCAGCTTTGAGGCAGGGATG	0.562																																					p.S242A		.											.	SIRT3	650	0			c.T724G						.						101.0	88.0	92.0					11																	230535		2203	4300	6503	SO:0001583	missense	23410	exon4			GCTTTGAGGCAGG	AF083108	CCDS7691.1, CCDS53590.1	11p15.5	2010-06-25	2010-06-25		ENSG00000142082	ENSG00000142082			14931	protein-coding gene	gene with protein product		604481	"""sirtuin (silent mating type information regulation 2, S.cerevisiae, homolog) 3"", ""sirtuin (silent mating type information regulation 2 homolog) 3 (S. cerevisiae)"""			10381378, 18215119	Standard	NM_012239		Approved	SIR2L3	uc001lok.4	Q9NTG7	OTTHUMG00000119074	ENST00000382743.4:c.724T>G	11.37:g.230535A>C	ENSP00000372191:p.Ser242Ala	165.0	0.0		111.0	37.0	NM_012239	B7Z5U6|Q9Y6E8	Missense_Mutation	SNP	ENST00000382743.4	37	CCDS7691.1	.	.	.	.	.	.	.	.	.	.	A	18.17	3.563550	0.65651	.	.	ENSG00000142082	ENST00000382743;ENST00000525319;ENST00000524564;ENST00000532956;ENST00000529382	T;T;T;T;T	0.17854	2.25;2.25;2.25;2.25;2.25	5.31	2.81	0.32909	.	0.768733	0.11544	N	0.553454	T	0.23926	0.0579	L	0.56280	1.765	0.19300	N	0.999974	P;B;B;B;B	0.45986	0.87;0.142;0.026;0.211;0.13	P;P;B;P;B	0.49421	0.61;0.467;0.211;0.451;0.237	T	0.08827	-1.0703	10	0.56958	D	0.05	-1.8921	7.5964	0.28050	0.4772:0.3996:0.0:0.1232	.	242;242;161;178;242	E9PM75;B7Z7G4;E9PK80;E9PN58;Q9NTG7	.;.;.;.;SIRT3_HUMAN	A	242;161;178;242;100	ENSP00000372191:S242A;ENSP00000435464:S161A;ENSP00000432937:S178A;ENSP00000433077:S242A;ENSP00000437216:S100A	ENSP00000372191:S242A	S	-	1	0	SIRT3	220535	0.638000	0.27225	0.987000	0.45799	0.912000	0.54170	1.491000	0.35583	0.822000	0.34565	0.533000	0.62120	TCA	.		0.562	SIRT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239288.3		
SLC38A3	10991	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	3	50251707	50251707	+	RNA	SNP	C	C	T			TCGA-G3-A5SL-01A-11D-A27I-10	TCGA-G3-A5SL-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70422e6d-cb1f-4284-8be9-1d4517ffad60	a38d4467-c3e5-4639-ad4f-88bcd7ab9f26	g.chr3:50251707C>T	ENST00000420502.1	+	0	229									solute carrier family 38, member 3											breast(1)|cervix(1)|endometrium(1)|lung(3)	6				BRCA - Breast invasive adenocarcinoma(193;0.000275)|KIRC - Kidney renal clear cell carcinoma(197;0.00548)|Kidney(197;0.00615)		TGCTCCCGGTCATCACCCCCA	0.622																																					p.V25V		.											.	SLC38A3	67	0			c.C75T						.						42.0	44.0	44.0					3																	50251707		2065	4215	6280			10991	exon2			CCCGGTCATCACC	U49082	CCDS74940.1	3p21.3	2013-05-22			ENSG00000188338	ENSG00000188338		"""Solute carriers"""	18044	protein-coding gene	gene with protein product		604437				10619430, 10823827	Standard	XM_006712954		Approved	G17, SN1	uc003cyn.4	Q99624	OTTHUMG00000156764		3.37:g.50251707C>T		207.0	0.0		135.0	58.0	NM_006841		Silent	SNP	ENST00000420502.1	37																																																																																				.		0.622	SLC38A3-001	KNOWN	sequence_error|basic	processed_transcript	processed_transcript	OTTHUMT00000345635.2	NM_006841	
SLC47A1	55244	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	19445791	19445791	+	Missense_Mutation	SNP	T	T	G			TCGA-G3-A5SL-01A-11D-A27I-10	TCGA-G3-A5SL-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70422e6d-cb1f-4284-8be9-1d4517ffad60	a38d4467-c3e5-4639-ad4f-88bcd7ab9f26	g.chr17:19445791T>G	ENST00000270570.4	+	2	307	c.221T>G	c.(220-222)gTc>gGc	p.V74G	SLC47A1_ENST00000457293.1_Missense_Mutation_p.V74G|SLC47A1_ENST00000542886.1_Missense_Mutation_p.V74G|SLC47A1_ENST00000584348.1_3'UTR|SLC47A1_ENST00000575023.1_Missense_Mutation_p.V74G|SLC47A1_ENST00000395585.1_Missense_Mutation_p.V74G|SLC47A1_ENST00000436810.2_Missense_Mutation_p.V74G|SLC47A1_ENST00000571335.1_5'UTR	NM_018242.2	NP_060712.2	Q96FL8	S47A1_HUMAN	solute carrier family 47 (multidrug and toxin extrusion), member 1	74					organic cation transport (GO:0015695)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|membrane-bounded vesicle (GO:0031988)|plasma membrane (GO:0005886)	drug transmembrane transporter activity (GO:0015238)|monovalent cation:proton antiporter activity (GO:0005451)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(4)|lung(5)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)	23	all_cancers(12;2.49e-05)|all_epithelial(12;0.00263)|Hepatocellular(7;0.00345)				Aciclovir(DB00787)|Bromodiphenhydramine(DB01237)|Cephalexin(DB00567)|Cimetidine(DB00501)|Metformin(DB00331)|Sirolimus(DB00877)	CTGGATGCAGTCACGCTGGCA	0.512																																					p.V74G		.											.	SLC47A1	90	0			c.T221G						.						172.0	129.0	143.0					17																	19445791		2203	4300	6503	SO:0001583	missense	55244	exon2			ATGCAGTCACGCT		CCDS11209.1	17p11.2	2013-07-17	2013-07-17		ENSG00000142494	ENSG00000142494		"""Solute carriers"""	25588	protein-coding gene	gene with protein product	"""multidrug and toxin extrusion 1"""	609832				16330770, 16996621, 16928787	Standard	NM_018242		Approved	FLJ10847, MATE1	uc002gvy.1	Q96FL8	OTTHUMG00000059466	ENST00000270570.4:c.221T>G	17.37:g.19445791T>G	ENSP00000270570:p.Val74Gly	148.0	0.0		94.0	13.0	NM_018242	Q53HF5|Q6PD77|Q86VL4|Q9NVA3	Missense_Mutation	SNP	ENST00000270570.4	37	CCDS11209.1	.	.	.	.	.	.	.	.	.	.	T	16.16	3.045646	0.55110	.	.	ENSG00000142494	ENST00000436810;ENST00000270570;ENST00000457293;ENST00000542886;ENST00000395585	T;T;T;T;T	0.38077	1.3;1.16;1.16;1.16;1.16	5.19	5.19	0.71726	.	0.000000	0.85682	D	0.000000	T	0.57169	0.2035	M	0.63843	1.955	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;0.998;0.997	D;D;D;D	0.97110	1.0;1.0;0.989;0.987	T	0.60414	-0.7268	10	0.66056	D	0.02	-22.0268	14.2177	0.65805	0.0:0.0:0.0:1.0	.	74;74;74;74	E7EX57;B4DYV3;Q96FL8;Q96FL8-3	.;.;S47A1_HUMAN;.	G	74	ENSP00000407155:V74G;ENSP00000270570:V74G;ENSP00000415586:V74G;ENSP00000440435:V74G;ENSP00000378951:V74G	ENSP00000270570:V74G	V	+	2	0	SLC47A1	19386383	1.000000	0.71417	0.988000	0.46212	0.172000	0.22775	7.207000	0.77899	1.975000	0.57531	0.528000	0.53228	GTC	.		0.512	SLC47A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132250.1	NM_018242	
SLC4A3	6508	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	220503556	220503556	+	Silent	SNP	C	C	A			TCGA-G3-A5SL-01A-11D-A27I-10	TCGA-G3-A5SL-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70422e6d-cb1f-4284-8be9-1d4517ffad60	a38d4467-c3e5-4639-ad4f-88bcd7ab9f26	g.chr2:220503556C>A	ENST00000358055.3	+	19	3500	c.2988C>A	c.(2986-2988)gtC>gtA	p.V996V	SLC4A3_ENST00000373762.3_Silent_p.V1023V|SLC4A3_ENST00000373760.2_Silent_p.V996V|SLC4A3_ENST00000317151.3_Silent_p.V996V|SLC4A3_ENST00000273063.6_Silent_p.V1023V			P48751	B3A3_HUMAN	solute carrier family 4 (anion exchanger), member 3	996	Membrane (anion exchange).				bicarbonate transport (GO:0015701)|ion transport (GO:0006811)|regulation of intracellular pH (GO:0051453)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	inorganic anion exchanger activity (GO:0005452)			breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(20)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(2)	51		Renal(207;0.0183)		Epithelial(149;2.53e-07)|all cancers(144;5.57e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		CCCTCCTCGTCCTCATCCTGA	0.627																																					p.V1023V		.											.	SLC4A3	157	0			c.C3069A						.						50.0	42.0	45.0					2																	220503556		2203	4300	6503	SO:0001819	synonymous_variant	6508	exon19			CCTCGTCCTCATC		CCDS2445.1, CCDS2446.1	2q35	2013-07-19	2013-07-19		ENSG00000114923	ENSG00000114923		"""Solute carriers"""	11029	protein-coding gene	gene with protein product	"""Anion exchanger 3, neuronal"""	106195	"""solute carrier family 4, anion exchanger, member 3"""			8001971	Standard	NM_005070		Approved	AE3, SLC2C	uc002vmo.4	P48751	OTTHUMG00000059238	ENST00000358055.3:c.2988C>A	2.37:g.220503556C>A		139.0	0.0		81.0	25.0	NM_201574	A6H8L2|A8K1Q9|B7ZVX6|B9EGD1|Q6YIQ9	Silent	SNP	ENST00000358055.3	37	CCDS2445.1																																																																																			.		0.627	SLC4A3-009	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316472.1	NM_005070	
SPTA1	6708	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	158614175	158614175	+	Frame_Shift_Del	DEL	C	C	-			TCGA-G3-A5SL-01A-11D-A27I-10	TCGA-G3-A5SL-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70422e6d-cb1f-4284-8be9-1d4517ffad60	a38d4467-c3e5-4639-ad4f-88bcd7ab9f26	g.chr1:158614175delC	ENST00000368147.4	-	30	4386	c.4206delG	c.(4204-4206)gggfs	p.G1402fs		NM_003126.2	NP_003117.2	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	1402					actin filament capping (GO:0051693)|actin filament organization (GO:0007015)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|lymphocyte homeostasis (GO:0002260)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of protein binding (GO:0032092)|positive regulation of T cell proliferation (GO:0042102)|regulation of cell shape (GO:0008360)	actin cytoskeleton (GO:0015629)|cuticular plate (GO:0032437)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)			NS(3)|breast(7)|cervix(1)|endometrium(22)|kidney(9)|large_intestine(29)|liver(2)|lung(183)|ovary(5)|prostate(18)|skin(11)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(6)	307	all_hematologic(112;0.0378)					GATCACAGTTCCCCTGGAACA	0.453																																					p.G1402fs		.											.	SPTA1	142	0			c.4206delG						.						93.0	90.0	91.0					1																	158614175		1953	4149	6102	SO:0001589	frameshift_variant	6708	exon30			ACAGTTCCCCTGG	M61877	CCDS41423.1	1q21	2014-06-23	2014-06-23		ENSG00000163554	ENSG00000163554		"""EF-hand domain containing"""	11272	protein-coding gene	gene with protein product	"""elliptocytosis 2"""	182860	"""spectrin, alpha, erythrocytic 1 (elliptocytosis 2)"""				Standard	NM_003126		Approved	EL2	uc001fst.1	P02549	OTTHUMG00000019636	ENST00000368147.4:c.4206delG	1.37:g.158614175delC	ENSP00000357129:p.Gly1402fs	77.0	0.0		165.0	42.0	NM_003126	Q15514|Q5VYL1|Q5VYL2|Q6LDY5	Frame_Shift_Del	DEL	ENST00000368147.4	37	CCDS41423.1																																																																																			.		0.453	SPTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051851.3	NM_003126	
SMG7	9887	broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	183515162	183515162	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A5SL-01A-11D-A27I-10	TCGA-G3-A5SL-10A-01D-A27I-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70422e6d-cb1f-4284-8be9-1d4517ffad60	a38d4467-c3e5-4639-ad4f-88bcd7ab9f26	g.chr1:183515162G>T	ENST00000347615.2	+	17	2551	c.2432G>T	c.(2431-2433)gGg>gTg	p.G811V	SMG7_ENST00000515829.2_Missense_Mutation_p.G765V|SMG7_ENST00000456731.2_Missense_Mutation_p.G723V|SMG7_ENST00000507469.1_Missense_Mutation_p.G765V|SMG7_ENST00000508461.1_Missense_Mutation_p.G769V|SMG7_ENST00000367537.3_Missense_Mutation_p.G794V	NM_173156.2	NP_775179.1	Q92540	SMG7_HUMAN	SMG7 nonsense mediated mRNA decay factor	811	Gln/Pro-rich.				gene expression (GO:0010467)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|regulation of dephosphorylation (GO:0035303)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)	protein phosphatase 2A binding (GO:0051721)			breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(7)|lung(16)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	46						GGCCCATTAGGGAAAATTATG	0.473																																					p.G811V		.											.	SMG7	92	0			c.G2432T						.						68.0	75.0	73.0					1																	183515162		2203	4300	6503	SO:0001583	missense	9887	exon17			CATTAGGGAAAAT	D87437	CCDS1355.1, CCDS41445.1, CCDS41445.2, CCDS53444.1, CCDS53445.1	1q25	2013-07-02	2013-07-02	2006-02-16	ENSG00000116698	ENSG00000116698			16792	protein-coding gene	gene with protein product	"""EST1 telomerase component homolog C (S. cerevisiae)"""	610964	"""chromosome 1 open reading frame 16"", ""smg-7 homolog, nonsense mediated mRNA decay factor (C. elegans)"""	C1orf16		14636577, 15721257	Standard	NM_173156		Approved	KIAA0250, EST1C, SGA56M, SMG-7	uc001gqf.3	Q92540	OTTHUMG00000035221	ENST00000347615.2:c.2432G>T	1.37:g.183515162G>T	ENSP00000340766:p.Gly811Val	140.0	2.0		240.0	47.0	NM_173156	B4DRB2|E9PCI0|E9PEH2|Q5T1Q0|Q6PIE0|Q7Z7H9|Q8IXC1|Q8IXC2	Missense_Mutation	SNP	ENST00000347615.2	37	CCDS1355.1	.	.	.	.	.	.	.	.	.	.	G	17.53	3.411919	0.62511	.	.	ENSG00000116698	ENST00000456731;ENST00000367537;ENST00000508461;ENST00000419169;ENST00000347615;ENST00000507469;ENST00000515829	T;T;T;T;T;T;T	0.23950	2.22;2.21;2.22;1.88;2.22;2.2;2.22	5.62	5.62	0.85841	.	0.439975	0.25447	N	0.030614	T	0.30070	0.0753	N	0.24115	0.695	0.80722	D	1	D;D;P;P;D;D	0.60575	0.988;0.969;0.933;0.904;0.966;0.969	P;P;P;P;P;P	0.50934	0.654;0.561;0.518;0.625;0.518;0.561	T	0.02758	-1.1114	10	0.52906	T	0.07	-10.3858	19.6614	0.95875	0.0:0.0:1.0:0.0	.	769;794;723;765;811;765	E9PCI0;E9PD50;E9PCE5;Q92540-2;Q92540;E9PEH2	.;.;.;.;SMG7_HUMAN;.	V	723;794;769;723;811;765;765	ENSP00000407629:G723V;ENSP00000356507:G794V;ENSP00000426915:G769V;ENSP00000388390:G723V;ENSP00000340766:G811V;ENSP00000425133:G765V;ENSP00000421358:G765V	ENSP00000340766:G811V	G	+	2	0	SMG7	181781785	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.702000	0.54800	2.633000	0.89246	0.655000	0.94253	GGG	.		0.473	SMG7-002	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000085432.1	NM_014837	
SRR	63826	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	2227109	2227109	+	Missense_Mutation	SNP	C	C	G			TCGA-G3-A5SL-01A-11D-A27I-10	TCGA-G3-A5SL-10A-01D-A27I-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70422e6d-cb1f-4284-8be9-1d4517ffad60	a38d4467-c3e5-4639-ad4f-88bcd7ab9f26	g.chr17:2227109C>G	ENST00000344595.5	+	8	1283	c.965C>G	c.(964-966)tCc>tGc	p.S322C	TSR1_ENST00000301364.5_3'UTR|SRR_ENST00000576848.1_Missense_Mutation_p.S96C	NM_021947.1	NP_068766.1	Q9GZT4	SRR_HUMAN	serine racemase	322					aging (GO:0007568)|brain development (GO:0007420)|D-serine biosynthetic process (GO:0070179)|D-serine metabolic process (GO:0070178)|L-serine metabolic process (GO:0006563)|protein homotetramerization (GO:0051289)|pyruvate biosynthetic process (GO:0042866)|response to drug (GO:0042493)|response to lipopolysaccharide (GO:0032496)|response to morphine (GO:0043278)|serine family amino acid metabolic process (GO:0009069)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|D-serine ammonia-lyase activity (GO:0008721)|glycine binding (GO:0016594)|L-serine ammonia-lyase activity (GO:0003941)|magnesium ion binding (GO:0000287)|PDZ domain binding (GO:0030165)|protein homodimerization activity (GO:0042803)|pyridoxal phosphate binding (GO:0030170)|serine racemase activity (GO:0030378)|threonine racemase activity (GO:0018114)			NS(1)|large_intestine(3)|lung(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	8		Colorectal(1115;3.46e-05)|Myeloproliferative disorder(207;0.0255)		COAD - Colon adenocarcinoma(228;3.24e-06)|READ - Rectum adenocarcinoma(1115;0.0649)	L-Serine(DB00133)	TTAACCTCCTCCATAACTTGG	0.413																																					p.S322C		.											.	SRR	90	0			c.C965G						.						85.0	79.0	81.0					17																	2227109		2203	4300	6503	SO:0001583	missense	63826	exon8			CCTCCTCCATAAC	AF169974	CCDS11017.1	17p13	2007-01-18			ENSG00000167720	ENSG00000167720			14398	protein-coding gene	gene with protein product		606477				17067558, 15953485, 15193426	Standard	NM_021947		Approved	ILV1, ISO1	uc002fue.1	Q9GZT4	OTTHUMG00000090583	ENST00000344595.5:c.965C>G	17.37:g.2227109C>G	ENSP00000339435:p.Ser322Cys	135.0	1.0		118.0	15.0	NM_021947	D3DTI5|Q6IA55	Missense_Mutation	SNP	ENST00000344595.5	37	CCDS11017.1	.	.	.	.	.	.	.	.	.	.	C	1.318	-0.600204	0.03744	.	.	ENSG00000167720	ENST00000344595	D	0.99382	-5.8	0.225	0.225	0.15325	.	0.376195	0.31290	N	0.007916	D	0.95114	0.8417	N	0.08118	0	0.09310	N	0.999999	B	0.18968	0.032	B	0.12837	0.008	D	0.91974	0.5589	9	0.56958	D	0.05	-1.7973	.	.	.	.	322	Q9GZT4	SRR_HUMAN	C	322	ENSP00000339435:S322C	ENSP00000339435:S322C	S	+	2	0	SRR	2173859	0.078000	0.21339	0.177000	0.23020	0.658000	0.38924	-0.959000	0.03853	0.300000	0.22699	0.305000	0.20034	TCC	.		0.413	SRR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207129.2	NM_021947	
TAGLN2	8407	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	159888612	159888612	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A5SL-01A-11D-A27I-10	TCGA-G3-A5SL-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70422e6d-cb1f-4284-8be9-1d4517ffad60	a38d4467-c3e5-4639-ad4f-88bcd7ab9f26	g.chr1:159888612C>T	ENST00000368097.4	-	5	888	c.578G>A	c.(577-579)gGg>gAg	p.G193E	TAGLN2_ENST00000368096.1_Missense_Mutation_p.G214E|TAGLN2_ENST00000478033.1_5'UTR|TAGLN2_ENST00000320307.4_Missense_Mutation_p.G193E	NM_001277223.1|NM_003564.1	NP_001264152.1|NP_003555.1	P37802	TAGL2_HUMAN	transgelin 2	193					epithelial cell differentiation (GO:0030855)	extracellular vesicular exosome (GO:0070062)|vesicle (GO:0031982)				endometrium(1)|large_intestine(2)|lung(6)	9	all_hematologic(112;0.0597)		BRCA - Breast invasive adenocarcinoma(70;0.111)			GCGTGGCATCCCGTAGCCAGT	0.547																																					p.G193E		.											.	TAGLN2	90	0			c.G578A						.						74.0	70.0	72.0					1																	159888612		2203	4300	6503	SO:0001583	missense	8407	exon5			GGCATCCCGTAGC	D21261	CCDS1189.1, CCDS60314.1	1q21-q25	2008-07-18			ENSG00000158710	ENSG00000158710			11554	protein-coding gene	gene with protein product	"""SM22-alpha homolog"""	604634				9693045	Standard	NM_001277223		Approved	KIAA0120, HA1756	uc031pqu.1	P37802	OTTHUMG00000022793	ENST00000368097.4:c.578G>A	1.37:g.159888612C>T	ENSP00000357077:p.Gly193Glu	151.0	0.0		134.0	84.0	NM_003564	E9KL39|Q5JRQ6|Q5JRQ7|Q6FGI1|Q9BUH5|Q9H4P0	Missense_Mutation	SNP	ENST00000368097.4	37	CCDS1189.1	.	.	.	.	.	.	.	.	.	.	C	28.2	4.897766	0.91962	.	.	ENSG00000158710	ENST00000368097;ENST00000368096;ENST00000320307	D;D;D	0.95307	-3.67;-3.67;-3.67	4.65	4.65	0.58169	Calponin homology domain (1);	0.000000	0.44688	U	0.000439	D	0.97920	0.9316	H	0.95504	3.68	0.80722	D	1	D	0.59767	0.986	D	0.72338	0.977	D	0.98696	1.0698	9	.	.	.	-20.4017	15.3984	0.74816	0.0:1.0:0.0:0.0	.	193	P37802	TAGL2_HUMAN	E	193;214;193	ENSP00000357077:G193E;ENSP00000357076:G214E;ENSP00000357075:G193E	.	G	-	2	0	TAGLN2	158155236	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.015000	0.76387	2.573000	0.86826	0.655000	0.94253	GGG	.		0.547	TAGLN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059105.1	NM_003564	
TINF2	26277	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	24709083	24709083	+	Missense_Mutation	SNP	A	A	C			TCGA-G3-A5SL-01A-11D-A27I-10	TCGA-G3-A5SL-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70422e6d-cb1f-4284-8be9-1d4517ffad60	a38d4467-c3e5-4639-ad4f-88bcd7ab9f26	g.chr14:24709083A>C	ENST00000267415.7	-	9	1617	c.1276T>G	c.(1276-1278)Tgt>Ggt	p.C426G	TINF2_ENST00000558510.1_5'Flank|TINF2_ENST00000538777.1_3'UTR|TINF2_ENST00000558566.1_3'UTR|TINF2_ENST00000540705.1_Missense_Mutation_p.C391G|TINF2_ENST00000399423.4_3'UTR	NM_001099274.1	NP_001092744.1	Q9BSI4	TINF2_HUMAN	TERF1 (TRF1)-interacting nuclear factor 2	426					negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of protein ADP-ribosylation (GO:0010836)|negative regulation of telomere maintenance via telomerase (GO:0032211)|positive regulation of telomere maintenance (GO:0032206)|protein localization to chromosome (GO:0034502)|protein localization to chromosome, telomeric region (GO:0070198)|telomere assembly (GO:0032202)|telomere maintenance (GO:0000723)|telomere maintenance via telomere lengthening (GO:0010833)	chromosome, telomeric region (GO:0000781)|nuclear telomere cap complex (GO:0000783)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinucleolar chromocenter (GO:0010370)	telomeric DNA binding (GO:0042162)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|prostate(1)|urinary_tract(1)	7				GBM - Glioblastoma multiforme(265;0.0185)		AGGTATTCACAGAGAGTGGGT	0.468									Congenital Dyskeratosis;Ataxia Pancytopenia syndrome																												p.C426G		.											.	TINF2	227	0			c.T1276G						.						109.0	110.0	110.0					14																	24709083		1890	4120	6010	SO:0001583	missense	26277	exon9	Familial Cancer Database	Zinsser-Engman-Cole syndrome, Dyskeratosis Congenita;Myelocerebellar disorder	ATTCACAGAGAGT	AF195512	CCDS41936.1, CCDS41937.1	14q12	2008-07-29				ENSG00000092330			11824	protein-coding gene	gene with protein product		604319				10581025, 18252230	Standard	NM_012461		Approved	TIN2	uc001woa.4	Q9BSI4		ENST00000267415.7:c.1276T>G	14.37:g.24709083A>C	ENSP00000267415:p.Cys426Gly	228.0	0.0		171.0	69.0	NM_001099274	B3W5Q7|Q9H904|Q9UHC2	Missense_Mutation	SNP	ENST00000267415.7	37	CCDS41936.1	.	.	.	.	.	.	.	.	.	.	A	9.587	1.125149	0.20959	.	.	ENSG00000092330	ENST00000267415;ENST00000540705	D;D	0.86627	-2.14;-2.15	5.76	4.62	0.57501	.	0.412421	0.20928	N	0.083148	D	0.82820	0.5120	L	0.53249	1.67	0.80722	D	1	B;B	0.25609	0.13;0.13	B;B	0.35039	0.194;0.194	T	0.71437	-0.4593	10	0.08179	T	0.78	-9.7461	8.3296	0.32178	0.9115:0.0:0.0885:0.0	.	391;426	B4DFJ1;Q9BSI4	.;TINF2_HUMAN	G	426;391	ENSP00000267415:C426G;ENSP00000442154:C391G	ENSP00000267415:C426G	C	-	1	0	TINF2	23778923	0.966000	0.33281	0.997000	0.53966	0.282000	0.26991	1.247000	0.32815	1.005000	0.39183	0.460000	0.39030	TGT	.		0.468	TINF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415406.2		
TLR4	7099	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	9	120476662	120476662	+	Missense_Mutation	SNP	G	G	C			TCGA-G3-A5SL-01A-11D-A27I-10	TCGA-G3-A5SL-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70422e6d-cb1f-4284-8be9-1d4517ffad60	a38d4467-c3e5-4639-ad4f-88bcd7ab9f26	g.chr9:120476662G>C	ENST00000355622.6	+	3	2357	c.2256G>C	c.(2254-2256)gaG>gaC	p.E752D	TLR4_ENST00000472304.1_3'UTR|TLR4_ENST00000394487.4_Missense_Mutation_p.E712D	NM_138554.4|NM_138557.2	NP_612564.1|NP_612567.1	O00206	TLR4_HUMAN	toll-like receptor 4	752	TIR. {ECO:0000255|PROSITE- ProRule:PRU00204}.				activation of MAPK activity (GO:0000187)|B cell proliferation involved in immune response (GO:0002322)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to lipoteichoic acid (GO:0071223)|cellular response to mechanical stimulus (GO:0071260)|defense response to bacterium (GO:0042742)|defense response to Gram-negative bacterium (GO:0050829)|detection of fungus (GO:0016046)|detection of lipopolysaccharide (GO:0032497)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|I-kappaB phosphorylation (GO:0007252)|immune response (GO:0006955)|innate immune response (GO:0045087)|interferon-gamma production (GO:0032609)|intestinal epithelial structure maintenance (GO:0060729)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|macrophage activation (GO:0042116)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-17 production (GO:0032700)|negative regulation of interleukin-23 production (GO:0032707)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of tumor necrosis factor production (GO:0032720)|nitric oxide production involved in inflammatory response (GO:0002537)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of chemokine production (GO:0032722)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-beta biosynthetic process (GO:0045359)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-1 production (GO:0032732)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of interleukin-12 biosynthetic process (GO:0045084)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of interleukin-8 biosynthetic process (GO:0045416)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of JNK cascade (GO:0046330)|positive regulation of macrophage cytokine production (GO:0060907)|positive regulation of MHC class II biosynthetic process (GO:0045348)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of nucleotide-binding oligomerization domain containing 1 signaling pathway (GO:0070430)|positive regulation of nucleotide-binding oligomerization domain containing 2 signaling pathway (GO:0070434)|positive regulation of platelet activation (GO:0010572)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor biosynthetic process (GO:0042535)|positive regulation of tumor necrosis factor production (GO:0032760)|regulation of cytokine secretion (GO:0050707)|response to lipopolysaccharide (GO:0032496)|T-helper 1 type immune response (GO:0042088)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|endosome membrane (GO:0010008)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|lipopolysaccharide receptor complex (GO:0046696)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	lipopolysaccharide binding (GO:0001530)|lipopolysaccharide receptor activity (GO:0001875)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(12)|lung(66)|ovary(4)|pancreas(1)|skin(6)|upper_aerodigestive_tract(5)|urinary_tract(1)	103					Naloxone(DB01183)	TTGAATATGAGATTGCTCAGA	0.502																																					p.E752D		.											.	TLR4	577	0			c.G2256C						.						71.0	70.0	70.0					9																	120476662		2203	4300	6503	SO:0001583	missense	7099	exon3			ATATGAGATTGCT	U88880	CCDS6818.1	9q33.1	2013-01-23			ENSG00000136869	ENSG00000136869		"""CD molecules"""	11850	protein-coding gene	gene with protein product		603030				9435236, 9237759	Standard	NM_138554		Approved	hToll, CD284, TLR-4, ARMD10	uc004bjz.4	O00206	OTTHUMG00000021046	ENST00000355622.6:c.2256G>C	9.37:g.120476662G>C	ENSP00000363089:p.Glu752Asp	53.0	0.0		73.0	5.0	NM_138554	A8K1Y8|A9XLP9|A9XLQ0|A9XLQ1|B4E194|D1CS52|D1CS53|Q5VZI8|Q5VZI9|Q9UK78|Q9UM57	Missense_Mutation	SNP	ENST00000355622.6	37	CCDS6818.1	.	.	.	.	.	.	.	.	.	.	G	13.65	2.300056	0.40694	.	.	ENSG00000136869	ENST00000394487;ENST00000355622	T;T	0.08546	3.08;3.08	6.03	1.2	0.21068	Toll/interleukin-1 receptor homology (TIR) domain (4);	0.077760	0.53938	D	0.000043	T	0.04724	0.0128	N	0.11724	0.165	0.37533	D	0.918001	B	0.30889	0.299	B	0.37833	0.259	T	0.48864	-0.8997	10	0.19147	T	0.46	.	6.2635	0.20913	0.483:0.1392:0.3778:0.0	.	752	O00206	TLR4_HUMAN	D	712;752	ENSP00000377997:E712D;ENSP00000363089:E752D	ENSP00000363089:E752D	E	+	3	2	TLR4	119516483	0.993000	0.37304	1.000000	0.80357	0.998000	0.95712	0.274000	0.18680	0.305000	0.22832	0.655000	0.94253	GAG	.		0.502	TLR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055549.3	NM_138554	
TMEM67	91147	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	8	94817076	94817076	+	Silent	SNP	A	A	G			TCGA-G3-A5SL-01A-11D-A27I-10	TCGA-G3-A5SL-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70422e6d-cb1f-4284-8be9-1d4517ffad60	a38d4467-c3e5-4639-ad4f-88bcd7ab9f26	g.chr8:94817076A>G	ENST00000453321.3	+	23	2467	c.2409A>G	c.(2407-2409)gaA>gaG	p.E803E	TMEM67_ENST00000409623.3_Silent_p.E722E	NM_153704.5	NP_714915.3	Q5HYA8	MKS3_HUMAN	transmembrane protein 67	803					cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|negative regulation of centrosome duplication (GO:0010826)	centrosome (GO:0005813)|ciliary membrane (GO:0060170)|cytoplasmic vesicle membrane (GO:0030659)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|TCTN-B9D complex (GO:0036038)	filamin binding (GO:0031005)|unfolded protein binding (GO:0051082)			breast(3)|endometrium(8)|kidney(5)|large_intestine(4)|liver(2)|lung(15)|ovary(2)|skin(1)|urinary_tract(1)	41	Breast(36;4.14e-07)		BRCA - Breast invasive adenocarcinoma(8;0.00896)			CTAATATGGAAGAAATGAATA	0.303																																					p.E803E		.											.	TMEM67	92	0			c.A2409G						.						113.0	110.0	111.0					8																	94817076		2203	4295	6498	SO:0001819	synonymous_variant	91147	exon23			TATGGAAGAAATG	BX648768	CCDS6258.2, CCDS47893.1	8q22.1	2014-09-17			ENSG00000164953	ENSG00000164953			28396	protein-coding gene	gene with protein product	"""Meckelin"""	609884	"""Meckel syndrome, type 3"""	MKS3		12384791, 16415887, 19508969	Standard	NM_153704		Approved	MGC26979, JBTS6, NPHP11	uc011lgk.2	Q5HYA8	OTTHUMG00000153119	ENST00000453321.3:c.2409A>G	8.37:g.94817076A>G		49.0	0.0		120.0	7.0	NM_153704	B3KRU5|B3KT47|G5E9H2|Q3ZCX3|Q7Z5T8|Q8IZ06	Silent	SNP	ENST00000453321.3	37	CCDS6258.2																																																																																			.		0.303	TMEM67-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329641.2	NM_153704	
TNXB	7148	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	6	32037394	32037394	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A5SL-01A-11D-A27I-10	TCGA-G3-A5SL-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70422e6d-cb1f-4284-8be9-1d4517ffad60	a38d4467-c3e5-4639-ad4f-88bcd7ab9f26	g.chr6:32037394C>A	ENST00000375244.3	-	15	5724	c.5523G>T	c.(5521-5523)aaG>aaT	p.K1841N	TNXB_ENST00000375247.2_Missense_Mutation_p.K1841N			P22105	TENX_HUMAN	tenascin XB	1923	Fibronectin type-III 10. {ECO:0000255|PROSITE-ProRule:PRU00316}.				actin cytoskeleton organization (GO:0030036)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|collagen fibril organization (GO:0030199)|collagen metabolic process (GO:0032963)|elastic fiber assembly (GO:0048251)|extracellular fibril organization (GO:0043206)|fatty acid metabolic process (GO:0006631)|regulation of JUN kinase activity (GO:0043506)|single organismal cell-cell adhesion (GO:0016337)|triglyceride metabolic process (GO:0006641)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|proteinaceous extracellular matrix (GO:0005578)	heparin binding (GO:0008201)|integrin binding (GO:0005178)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|prostate(1)	8						AGAGCAGCAGCTTGTACCTGT	0.667																																					p.K1841N		.											.	TNXB	90	0			c.G5523T						.						27.0	33.0	31.0					6																	32037394		2173	4278	6451	SO:0001583	missense	7148	exon15			CAGCAGCTTGTAC	X71923	CCDS4736.1	6p21.3	2013-02-11			ENSG00000168477	ENSG00000168477		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	11976	protein-coding gene	gene with protein product		600985		TNXB1, TNXB2		8530023	Standard	NM_019105		Approved	TNXBS, XBS, XB	uc021yvf.2	P22105	OTTHUMG00000031088	ENST00000375244.3:c.5523G>T	6.37:g.32037394C>A	ENSP00000364393:p.Lys1841Asn	55.0	0.0		79.0	8.0	NM_019105	P78530|P78531|Q08424|Q08AM0|Q08AM1|Q59GU7|Q5SQD3|Q5ST74|Q7L8Q4|Q8N4R1|Q9NPK9|Q9UC10|Q9UC11|Q9UC12|Q9UC13|Q9UMG7	Missense_Mutation	SNP	ENST00000375244.3	37		.	.	.	.	.	.	.	.	.	.	C	21.3	4.134760	0.77662	.	.	ENSG00000168477	ENST00000375244;ENST00000375247	T;T	0.56444	0.46;0.46	5.5	5.5	0.81552	.	0.000000	0.50627	D	0.000115	T	0.65037	0.2653	M	0.91872	3.25	0.25924	N	0.983075	D	0.89917	1.0	D	0.87578	0.998	T	0.63457	-0.6633	10	0.18710	T	0.47	.	10.4202	0.44346	0.0:0.9109:0.0:0.0891	.	1841	P22105-3	.	N	1841	ENSP00000364393:K1841N;ENSP00000364396:K1841N	ENSP00000364393:K1841N	K	-	3	2	TNXB	32145372	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	2.120000	0.41968	2.598000	0.87819	0.591000	0.81541	AAG	.		0.667	TNXB-001	PUTATIVE	not_organism_supported|basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000268927.2	NM_019105	
TNXB	7148	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	32041646	32041646	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A5SL-01A-11D-A27I-10	TCGA-G3-A5SL-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70422e6d-cb1f-4284-8be9-1d4517ffad60	a38d4467-c3e5-4639-ad4f-88bcd7ab9f26	g.chr6:32041646G>T	ENST00000375244.3	-	12	4660	c.4459C>A	c.(4459-4461)Ccc>Acc	p.P1487T	TNXB_ENST00000375247.2_Missense_Mutation_p.P1487T			P22105	TENX_HUMAN	tenascin XB	1574	Fibronectin type-III 7. {ECO:0000255|PROSITE-ProRule:PRU00316}.				actin cytoskeleton organization (GO:0030036)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|collagen fibril organization (GO:0030199)|collagen metabolic process (GO:0032963)|elastic fiber assembly (GO:0048251)|extracellular fibril organization (GO:0043206)|fatty acid metabolic process (GO:0006631)|regulation of JUN kinase activity (GO:0043506)|single organismal cell-cell adhesion (GO:0016337)|triglyceride metabolic process (GO:0006641)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|proteinaceous extracellular matrix (GO:0005578)	heparin binding (GO:0008201)|integrin binding (GO:0005178)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|prostate(1)	8						ACAGAGTTGGGGGTCACATCT	0.612																																					p.P1487T		.											.	TNXB	90	0			c.C4459A						.						30.0	33.0	32.0					6																	32041646		1268	2563	3831	SO:0001583	missense	7148	exon12			AGTTGGGGGTCAC	X71923	CCDS4736.1	6p21.3	2013-02-11			ENSG00000168477	ENSG00000168477		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	11976	protein-coding gene	gene with protein product		600985		TNXB1, TNXB2		8530023	Standard	NM_019105		Approved	TNXBS, XBS, XB	uc021yvf.2	P22105	OTTHUMG00000031088	ENST00000375244.3:c.4459C>A	6.37:g.32041646G>T	ENSP00000364393:p.Pro1487Thr	111.0	0.0		134.0	31.0	NM_019105	P78530|P78531|Q08424|Q08AM0|Q08AM1|Q59GU7|Q5SQD3|Q5ST74|Q7L8Q4|Q8N4R1|Q9NPK9|Q9UC10|Q9UC11|Q9UC12|Q9UC13|Q9UMG7	Missense_Mutation	SNP	ENST00000375244.3	37		.	.	.	.	.	.	.	.	.	.	G	11.56	1.674536	0.29693	.	.	ENSG00000168477	ENST00000375244;ENST00000375247	T;T	0.56941	0.43;0.43	5.46	4.56	0.56223	.	0.414082	0.18364	N	0.143489	T	0.46737	0.1408	M	0.83384	2.64	0.27156	N	0.961295	B	0.34226	0.443	P	0.47299	0.543	T	0.51919	-0.8644	10	0.30854	T	0.27	.	6.0664	0.19866	0.1026:0.0:0.7139:0.1835	.	1487	P22105-3	.	T	1487	ENSP00000364393:P1487T;ENSP00000364396:P1487T	ENSP00000364393:P1487T	P	-	1	0	TNXB	32149624	0.985000	0.35326	0.926000	0.36857	0.533000	0.34776	1.184000	0.32053	1.212000	0.43366	0.543000	0.68304	CCC	.		0.612	TNXB-001	PUTATIVE	not_organism_supported|basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000268927.2	NM_019105	
TP73	7161	broad.mit.edu;bcgsc.ca;mdanderson.org	37	1	3649427	3649427	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A5SL-01A-11D-A27I-10	TCGA-G3-A5SL-10A-01D-A27I-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70422e6d-cb1f-4284-8be9-1d4517ffad60	a38d4467-c3e5-4639-ad4f-88bcd7ab9f26	g.chr1:3649427C>A	ENST00000378295.4	+	14	1850	c.1695C>A	c.(1693-1695)aaC>aaA	p.N565K	TP73_ENST00000378290.4_Missense_Mutation_p.N494K|TP73_ENST00000378288.4_Missense_Mutation_p.N516K|TP73_ENST00000378280.1_3'UTR|TP73_ENST00000354437.4_3'UTR|TP73_ENST00000357733.3_Missense_Mutation_p.N484K|TP73_ENST00000604479.1_Missense_Mutation_p.N469K|TP73_ENST00000603362.1_Missense_Mutation_p.N484K|TP73_ENST00000346387.4_Missense_Mutation_p.N469K|TP73_ENST00000378285.1_3'UTR|TP73_ENST00000604074.1_3'UTR	NM_001204185.1|NM_005427.3	NP_001191114.1|NP_005418.1	O15350	P73_HUMAN	tumor protein p73	565					activation of MAPK activity (GO:0000187)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to UV (GO:0034644)|cerebrospinal fluid secretion (GO:0033326)|digestive tract morphogenesis (GO:0048546)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|hippocampus development (GO:0021766)|inflammatory response (GO:0006954)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|kidney development (GO:0001822)|mismatch repair (GO:0006298)|mitotic G1 DNA damage checkpoint (GO:0031571)|negative regulation of JUN kinase activity (GO:0043508)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron development (GO:0048666)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell size (GO:0045793)|positive regulation of intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:1902167)|positive regulation of oligodendrocyte differentiation (GO:0048714)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|post-embryonic development (GO:0009791)|protein tetramerization (GO:0051262)|release of cytochrome c from mitochondria (GO:0001836)|response to gamma radiation (GO:0010332)|response to organonitrogen compound (GO:0010243)|response to X-ray (GO:0010165)|transcription, DNA-templated (GO:0006351)	chromatin (GO:0000785)|cytosol (GO:0005829)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|damaged DNA binding (GO:0003684)|double-stranded DNA binding (GO:0003690)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|p53 binding (GO:0002039)|protein kinase binding (GO:0019901)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|lung(8)|ovary(1)|prostate(1)	20	all_cancers(77;0.0395)|Ovarian(185;0.0634)|Lung NSC(156;0.188)|all_lung(157;0.198)	all_epithelial(116;7.42e-17)|all_lung(118;1.86e-06)|Lung NSC(185;0.000163)|Renal(390;0.00357)|Breast(487;0.00446)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Lung SC(97;0.109)|Ovarian(437;0.127)		Epithelial(90;5.57e-38)|OV - Ovarian serous cystadenocarcinoma(86;1.87e-22)|GBM - Glioblastoma multiforme(42;5.72e-16)|Colorectal(212;2.22e-05)|COAD - Colon adenocarcinoma(227;8.48e-05)|Kidney(185;0.000539)|BRCA - Breast invasive adenocarcinoma(365;0.000868)|STAD - Stomach adenocarcinoma(132;0.0072)|KIRC - Kidney renal clear cell carcinoma(229;0.00751)|Lung(427;0.226)		GCTCTAGCAACGCGGCCACCA	0.672																																					p.N565K		.											.	TP73	415	0			c.C1695A						.						21.0	22.0	22.0					1																	3649427		2188	4268	6456	SO:0001583	missense	7161	exon14			TAGCAACGCGGCC	AB055065	CCDS49.1, CCDS44049.1, CCDS44050.1, CCDS44051.1, CCDS55566.1, CCDS55567.1, CCDS55568.1, CCDS55569.1, CCDS59965.1	1p36.3	2010-06-15			ENSG00000078900	ENSG00000078900			12003	protein-coding gene	gene with protein product		601990				9296498, 9288759	Standard	NM_001204186		Approved	P73	uc001akp.3	O15350	OTTHUMG00000000610	ENST00000378295.4:c.1695C>A	1.37:g.3649427C>A	ENSP00000367545:p.Asn565Lys	40.0	0.0		18.0	4.0	NM_005427	B7Z7J4|B7Z8Z1|B7Z9C1|C9J521|O15351|Q17RN8|Q5TBV5|Q5TBV6|Q8NHW9|Q8TDY5|Q8TDY6|Q9NTK8	Missense_Mutation	SNP	ENST00000378295.4	37	CCDS49.1	.	.	.	.	.	.	.	.	.	.	C	15.55	2.867885	0.51588	.	.	ENSG00000078900	ENST00000378295;ENST00000357733;ENST00000346387;ENST00000378288;ENST00000378290	D;D;D;D;D	0.90788	-2.73;-2.73;-2.73;-2.73;-2.73	4.71	3.78	0.43462	.	0.000000	0.85682	D	0.000000	D	0.91365	0.7276	L	0.29908	0.895	0.58432	D	0.999998	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	D	0.91905	0.5535	10	0.72032	D	0.01	-45.9631	12.333	0.55049	0.0:0.9151:0.0:0.0849	.	516;565	O15350-8;O15350	.;P73_HUMAN	K	565;484;469;516;494	ENSP00000367545:N565K;ENSP00000350366:N484K;ENSP00000340740:N469K;ENSP00000367537:N516K;ENSP00000367539:N494K	ENSP00000340740:N469K	N	+	3	2	TP73	3639287	0.964000	0.33143	1.000000	0.80357	0.242000	0.25591	0.364000	0.20325	2.166000	0.68216	0.313000	0.20887	AAC	.		0.672	TP73-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000001468.4	NM_005427	
TRAPPC9	83696	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	141468638	141468638	+	5'Flank	SNP	C	C	T			TCGA-G3-A5SL-01A-11D-A27I-10	TCGA-G3-A5SL-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70422e6d-cb1f-4284-8be9-1d4517ffad60	a38d4467-c3e5-4639-ad4f-88bcd7ab9f26	g.chr8:141468638C>T	ENST00000438773.2	-	0	0				TRAPPC9_ENST00000389327.3_5'Flank|TRAPPC9_ENST00000389328.4_Missense_Mutation_p.R9H	NM_001160372.1	NP_001153844.1	Q96Q05	TPPC9_HUMAN	trafficking protein particle complex 9						cell differentiation (GO:0030154)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)				breast(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(1)|lung(16)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	47						GTGTGGCGCGCGGTCTTGATC	0.682																																					p.R9H		.											.	TRAPPC9	228	0			c.G26A						.						9.0	10.0	9.0					8																	141468638		2156	4236	6392	SO:0001631	upstream_gene_variant	83696	exon1			GGCGCGCGGTCTT	BC006206	CCDS34946.1, CCDS55278.1	8q24.3	2010-10-22			ENSG00000167632	ENSG00000167632		"""Trafficking protein particle complex"""	30832	protein-coding gene	gene with protein product	"""TRAPP 120 kDa subunit"", ""tularik gene 1"""	611966				11572484	Standard	NM_031466		Approved	IKBKBBP, NIBP, KIAA1882, T1, TRS120, MRT13	uc003yvh.2	Q96Q05	OTTHUMG00000164187		8.37:g.141468638C>T	Exception_encountered	24.0	0.0		59.0	11.0	NM_031466	Q4VTT3|Q658K7|Q6P149|Q6ZQT3|Q7L5C4|Q86Y21|Q96SL2|Q9BQA2	Missense_Mutation	SNP	ENST00000438773.2	37	CCDS55278.1	.	.	.	.	.	.	.	.	.	.	C	9.421	1.083006	0.20309	.	.	ENSG00000167632	ENST00000389328	.	.	.	1.06	-0.054	0.13816	.	.	.	.	.	T	0.16171	0.0389	N	0.08118	0	0.09310	N	0.999994	B	0.02656	0.0	B	0.01281	0.0	T	0.20907	-1.0261	8	0.87932	D	0	.	2.7452	0.05264	0.0:0.3774:0.0:0.6226	.	9	Q96Q05-2	.	H	9	.	ENSP00000373979:R9H	R	-	2	0	TRAPPC9	141537820	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-1.268000	0.02836	-0.027000	0.13873	0.297000	0.19635	CGC	.		0.682	TRAPPC9-002	PUTATIVE	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000377749.1	NM_031466	
TRIM51	84767	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	55659022	55659022	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A5SL-01A-11D-A27I-10	TCGA-G3-A5SL-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70422e6d-cb1f-4284-8be9-1d4517ffad60	a38d4467-c3e5-4639-ad4f-88bcd7ab9f26	g.chr11:55659022G>A	ENST00000449290.2	+	7	1365	c.1273G>A	c.(1273-1275)Gtt>Att	p.V425I	TRIM51_ENST00000244891.3_Missense_Mutation_p.V282I	NM_032681.3	NP_116070.2	Q9BSJ1	TRI51_HUMAN	tripartite motif-containing 51	425	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.					intracellular (GO:0005622)	zinc ion binding (GO:0008270)										CTTTGTTGATGTTGATCAAAG	0.458																																					p.V425I		.											.	.	.	0			c.G1273A						.						119.0	114.0	116.0					11																	55659022		2182	4238	6420	SO:0001583	missense	84767	exon7			GTTGATGTTGATC	BC005014		11p11	2013-01-09	2012-05-18	2012-05-18	ENSG00000124900	ENSG00000124900		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	19023	protein-coding gene	gene with protein product			"""SPRY domain containing 5"""	SPRYD5			Standard	NM_032681		Approved	TRIM51A	uc010rip.2	Q9BSJ1	OTTHUMG00000156437	ENST00000449290.2:c.1273G>A	11.37:g.55659022G>A	ENSP00000395086:p.Val425Ile	34.0	0.0		39.0	12.0	NM_032681	A6NMG2	Missense_Mutation	SNP	ENST00000449290.2	37		.	.	.	.	.	.	.	.	.	.	.	15.40	2.823183	0.50739	.	.	ENSG00000124900	ENST00000449290;ENST00000244891	T;T	0.68903	-0.36;-0.36	1.36	1.36	0.22044	Concanavalin A-like lectin/glucanase (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);	.	.	.	.	T	0.78188	0.4244	M	0.80616	2.505	0.09310	N	1	D	0.76494	0.999	D	0.73380	0.98	T	0.63143	-0.6703	9	0.49607	T	0.09	.	6.5498	0.22427	0.0:0.0:1.0:0.0	.	425	Q9BSJ1	SPRY5_HUMAN	I	425;282	ENSP00000395086:V425I;ENSP00000244891:V282I	ENSP00000244891:V282I	V	+	1	0	SPRYD5	55415598	0.983000	0.35010	0.004000	0.12327	0.355000	0.29361	2.035000	0.41155	0.646000	0.30693	0.162000	0.16502	GTT	.		0.458	TRIM51-004	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000391522.1	NM_032681	
TTN	7273	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	179590290	179590290	+	Frame_Shift_Del	DEL	G	G	-			TCGA-G3-A5SL-01A-11D-A27I-10	TCGA-G3-A5SL-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70422e6d-cb1f-4284-8be9-1d4517ffad60	a38d4467-c3e5-4639-ad4f-88bcd7ab9f26	g.chr2:179590290delG	ENST00000591111.1	-	69	19914	c.19690delC	c.(19690-19692)cagfs	p.Q6564fs	TTN_ENST00000589042.1_Frame_Shift_Del_p.Q6881fs|TTN_ENST00000342992.6_Frame_Shift_Del_p.Q5637fs|TTN-AS1_ENST00000585451.1_RNA|RP11-171I2.1_ENST00000590024.1_RNA|TTN_ENST00000342175.6_Intron|TTN_ENST00000359218.5_Intron|TTN_ENST00000460472.2_Intron			Q8WZ42	TITIN_HUMAN	titin	12167	Ig-like 47.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			AAAATAGGCTGGGCGCCTTCT	0.428																																					p.Q6881fs		.											.	TTN	636	0			c.20641delC						.						104.0	95.0	98.0					2																	179590290		1844	4107	5951	SO:0001589	frameshift_variant	7273	exon71			TAGGCTGGGCGCC	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.19690delC	2.37:g.179590290delG	ENSP00000465570:p.Gln6564fs	59.0	0.0		41.0	11.0	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Frame_Shift_Del	DEL	ENST00000591111.1	37																																																																																				.		0.428	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
UAP1L1	91373	broad.mit.edu;bcgsc.ca	37	9	139973543	139973543	+	Silent	SNP	G	G	A			TCGA-G3-A5SL-01A-11D-A27I-10	TCGA-G3-A5SL-10A-01D-A27I-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70422e6d-cb1f-4284-8be9-1d4517ffad60	a38d4467-c3e5-4639-ad4f-88bcd7ab9f26	g.chr9:139973543G>A	ENST00000409858.3	+	4	818	c.786G>A	c.(784-786)ctG>ctA	p.L262L	UAP1L1_ENST00000476184.1_3'UTR|UAP1L1_ENST00000360271.3_Silent_p.L139L	NM_207309.2	NP_997192.2	Q3KQV9	UAP1L_HUMAN	UDP-N-acetylglucosamine pyrophosphorylase 1 like 1	262							uridylyltransferase activity (GO:0070569)			kidney(1)|large_intestine(1)|lung(3)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	8	all_cancers(76;0.0926)	Myeloproliferative disorder(178;0.0821)	STAD - Stomach adenocarcinoma(284;0.0878)	OV - Ovarian serous cystadenocarcinoma(145;2.96e-05)|Epithelial(140;0.000486)		TGGTGCGGCTGGCGGACCCTG	0.657																																					p.L262L		.											.	UAP1L1	91	0			c.G786A						.						77.0	76.0	77.0					9																	139973543		2203	4300	6503	SO:0001819	synonymous_variant	91373	exon4			GCGGCTGGCGGAC	AK022632	CCDS7028.2	9q34.3	2014-07-31	2014-07-31		ENSG00000197355	ENSG00000197355			28082	protein-coding gene	gene with protein product							Standard	NM_207309		Approved		uc010ncb.3	Q3KQV9	OTTHUMG00000020962	ENST00000409858.3:c.786G>A	9.37:g.139973543G>A		183.0	0.0		108.0	5.0	NM_207309	A2AMJ8|Q5SPZ2|Q69YQ3|Q6ZR38	Silent	SNP	ENST00000409858.3	37	CCDS7028.2																																																																																			.		0.657	UAP1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055216.2	XM_038063	
UNC80	285175	broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	210824368	210824368	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A5SL-01A-11D-A27I-10	TCGA-G3-A5SL-10A-01D-A27I-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70422e6d-cb1f-4284-8be9-1d4517ffad60	a38d4467-c3e5-4639-ad4f-88bcd7ab9f26	g.chr2:210824368A>G	ENST00000439458.1	+	50	7624	c.7544A>G	c.(7543-7545)cAa>cGa	p.Q2515R	UNC80_ENST00000539183.1_5'Flank|UNC80_ENST00000272845.6_Missense_Mutation_p.Q2510R	NM_032504.1	NP_115893.1	Q8N2C7	UNC80_HUMAN	unc-80 homolog (C. elegans)	2515					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(9)|ovary(1)|prostate(1)	20						AAGATCTTGCAAAATCTGGCT	0.527																																					p.Q2515R		.											.	UNC80	90	0			c.A7544G						.						113.0	109.0	110.0					2																	210824368		692	1591	2283	SO:0001583	missense	285175	exon50			TCTTGCAAAATCT	AK090815	CCDS2387.1, CCDS46504.1, CCDS2387.2	2q35	2009-08-17	2009-08-17	2009-08-17	ENSG00000144406	ENSG00000144406			26582	protein-coding gene	gene with protein product		612636	"""chromosome 2 open reading frame 21"""	C2orf21		19092807	Standard	NM_032504		Approved	FLJ33496, KIAA1843, UNC-80	uc010zjc.1	Q8N2C7	OTTHUMG00000132963	ENST00000439458.1:c.7544A>G	2.37:g.210824368A>G	ENSP00000391088:p.Gln2515Arg	78.0	1.0		90.0	33.0	NM_032504	B2RN50|B4DQY9|B4DZB3|C4IXS8|C9J1U3|Q96JI4|Q96SS0	Missense_Mutation	SNP	ENST00000439458.1	37	CCDS46504.1	.	.	.	.	.	.	.	.	.	.	A	24.1	4.497303	0.85069	.	.	ENSG00000144406	ENST00000439458;ENST00000272845;ENST00000333907	T;T	0.66815	-0.23;-0.23	5.72	5.72	0.89469	.	0.000000	0.85682	D	0.000000	T	0.68155	0.2970	N	0.14661	0.345	0.80722	D	1	P	0.48294	0.908	D	0.64144	0.922	T	0.70278	-0.4916	10	0.39692	T	0.17	-15.5001	16.0023	0.80306	1.0:0.0:0.0:0.0	.	2515	Q8N2C7	UNC80_HUMAN	R	2515;2510;41	ENSP00000391088:Q2515R;ENSP00000272845:Q2510R	ENSP00000272845:Q2510R	Q	+	2	0	UNC80	210532613	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.262000	0.95591	2.177000	0.69029	0.533000	0.62120	CAA	.		0.527	UNC80-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_182587	
UQCRB	7381	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	97245396	97245396	+	Missense_Mutation	SNP	A	A	C	rs376775585		TCGA-G3-A5SL-01A-11D-A27I-10	TCGA-G3-A5SL-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70422e6d-cb1f-4284-8be9-1d4517ffad60	a38d4467-c3e5-4639-ad4f-88bcd7ab9f26	g.chr8:97245396A>C	ENST00000287022.5	-	2	182	c.79T>G	c.(79-81)Ttc>Gtc	p.F27V	UQCRB_ENST00000523920.1_Missense_Mutation_p.F27V|UQCRB_ENST00000518406.1_Missense_Mutation_p.F27V|UQCRB_ENST00000517523.1_5'UTR|KB-1043D8.6_ENST00000520575.1_RNA	NM_001199975.2|NM_006294.4	NP_001186904.1|NP_006285.1	P14927	QCR7_HUMAN	ubiquinol-cytochrome c reductase binding protein	27					aerobic respiration (GO:0009060)|cellular metabolic process (GO:0044237)|mitochondrial electron transport, ubiquinol to cytochrome c (GO:0006122)|oxidation-reduction process (GO:0055114)|oxidative phosphorylation (GO:0006119)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain (GO:0005746)|mitochondrial respiratory chain complex III (GO:0005750)				kidney(1)|large_intestine(3)|lung(3)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	10	Breast(36;5.16e-05)					AGTTTATTGAATCCTGCAGCA	0.328																																					p.F27V		.											.	UQCRB	91	0			c.T79G						.	A	,VAL/PHE	0,4406		0,0,2203	115.0	107.0	110.0		,79	4.8	1.0	8		110	1,8599	1.2+/-3.3	0,1,4299	no	utr-5,missense	UQCRB	NM_001199975.1,NM_006294.3	,50	0,1,6502	CC,CA,AA		0.0116,0.0,0.0077	,possibly-damaging	,27/112	97245396	1,13005	2203	4300	6503	SO:0001583	missense	7381	exon2			TATTGAATCCTGC	X13585	CCDS6269.1, CCDS59107.1	8q22	2011-07-04			ENSG00000156467	ENSG00000156467		"""Mitochondrial respiratory chain complex / Complex III"""	12582	protein-coding gene	gene with protein product	"""ubiquinol-cytochrome c reductase, complex III subunit VI"", ""cytochrome b-c1 complex subunit 7"""	191330		UQBP		2167087, 2543413, 3056408	Standard	NM_006294		Approved	QP-C, QCR7, UQCR6	uc022ayx.1	P14927	OTTHUMG00000164711	ENST00000287022.5:c.79T>G	8.37:g.97245396A>C	ENSP00000287022:p.Phe27Val	40.0	0.0		145.0	14.0	NM_001254752	E5RJU0|Q6FGD1	Missense_Mutation	SNP	ENST00000287022.5	37	CCDS6269.1	.	.	.	.	.	.	.	.	.	.	A	23.5	4.428722	0.83667	0.0	1.16E-4	ENSG00000156467	ENST00000287022;ENST00000518406;ENST00000523920	T;T;T	0.48836	0.8;0.8;0.8	4.78	4.78	0.61160	.	0.048891	0.85682	D	0.000000	T	0.67059	0.2853	M	0.85945	2.785	0.80722	D	1	P	0.52842	0.956	P	0.58660	0.843	T	0.73760	-0.3881	10	0.87932	D	0	-0.4207	13.0389	0.58887	1.0:0.0:0.0:0.0	.	27	P14927	QCR7_HUMAN	V	27	ENSP00000287022:F27V;ENSP00000430494:F27V;ENSP00000430560:F27V	ENSP00000287022:F27V	F	-	1	0	UQCRB	97314572	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	8.413000	0.90235	2.030000	0.59900	0.533000	0.62120	TTC	.		0.328	UQCRB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379863.1	NM_006294	
UTP6	55813	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	17	30190389	30190389	+	Missense_Mutation	SNP	C	C	G			TCGA-G3-A5SL-01A-11D-A27I-10	TCGA-G3-A5SL-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70422e6d-cb1f-4284-8be9-1d4517ffad60	a38d4467-c3e5-4639-ad4f-88bcd7ab9f26	g.chr17:30190389C>G	ENST00000261708.4	-	19	1920	c.1783G>C	c.(1783-1785)Ggc>Cgc	p.G595R		NM_018428.2	NP_060898.2	Q9NYH9	UTP6_HUMAN	UTP6, small subunit (SSU) processome component, homolog (yeast)	595					rRNA processing (GO:0006364)	nucleolus (GO:0005730)				breast(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(8)|ovary(1)|skin(1)	21		all_hematologic(16;0.0149)|Ovarian(249;0.021)|Myeloproliferative disorder(56;0.0255)|Acute lymphoblastic leukemia(14;0.0257)|Breast(31;0.231)				CATAAATGGCCAGTCTGATGC	0.438																																					p.G595R		.											.	UTP6	91	0			c.G1783C						.						168.0	166.0	167.0					17																	30190389		2203	4300	6503	SO:0001583	missense	55813	exon19			AATGGCCAGTCTG	AF116631	CCDS11269.1	17q11.2	2010-06-24	2006-05-16	2006-05-16	ENSG00000108651	ENSG00000108651			18279	protein-coding gene	gene with protein product	"""hepatocellular carcinoma associated antigen 66"""		"""chromosome 17 open reading frame 40"""	C17orf40		10843809, 16138909	Standard	NM_018428		Approved	HCA66	uc002hgr.3	Q9NYH9	OTTHUMG00000132815	ENST00000261708.4:c.1783G>C	17.37:g.30190389C>G	ENSP00000261708:p.Gly595Arg	132.0	0.0		101.0	6.0	NM_018428	Q8IX96|Q96BL2|Q9NQ91	Missense_Mutation	SNP	ENST00000261708.4	37	CCDS11269.1	.	.	.	.	.	.	.	.	.	.	c	24.1	4.498991	0.85069	.	.	ENSG00000108651	ENST00000261708	T	0.43294	0.95	5.54	5.54	0.83059	.	0.243352	0.47852	D	0.000207	T	0.66992	0.2846	M	0.79805	2.47	0.80722	D	1	D;D	0.71674	0.998;0.998	D;D	0.64506	0.926;0.926	T	0.71227	-0.4655	10	0.87932	D	0	-1.2623	19.0741	0.93151	0.0:1.0:0.0:0.0	.	595;595	B3KQ21;Q9NYH9	.;UTP6_HUMAN	R	595	ENSP00000261708:G595R	ENSP00000261708:G595R	G	-	1	0	UTP6	27214502	1.000000	0.71417	1.000000	0.80357	0.520000	0.34377	3.781000	0.55394	2.606000	0.88127	0.586000	0.80456	GGC	.		0.438	UTP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256265.2	NM_018428	
VSIG10	54621	broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	118504496	118504496	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A5SL-01A-11D-A27I-10	TCGA-G3-A5SL-10A-01D-A27I-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70422e6d-cb1f-4284-8be9-1d4517ffad60	a38d4467-c3e5-4639-ad4f-88bcd7ab9f26	g.chr12:118504496T>C	ENST00000359236.5	-	9	1847	c.1571A>G	c.(1570-1572)gAc>gGc	p.D524G		NM_019086.5	NP_061959.2	Q8N0Z9	VSI10_HUMAN	V-set and immunoglobulin domain containing 10	524						integral component of membrane (GO:0016021)				endometrium(5)|large_intestine(3)|lung(6)|skin(1)|stomach(1)|urinary_tract(1)	17						CTCACTGCTGTCATCTGTATG	0.443																																					p.D524G		.											.	.	.	0			c.A1571G						.						299.0	279.0	285.0					12																	118504496		1971	4157	6128	SO:0001583	missense	54621	exon9			CTGCTGTCATCTG		CCDS44992.1	12q24.23	2013-01-29			ENSG00000176834	ENSG00000176834		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	26078	protein-coding gene	gene with protein product						12477932	Standard	NM_019086		Approved		uc001tws.3	Q8N0Z9		ENST00000359236.5:c.1571A>G	12.37:g.118504496T>C	ENSP00000352172:p.Asp524Gly	209.0	2.0		185.0	71.0	NM_019086	Q9NWQ7	Missense_Mutation	SNP	ENST00000359236.5	37	CCDS44992.1	.	.	.	.	.	.	.	.	.	.	T	16.03	3.006545	0.54361	.	.	ENSG00000176834	ENST00000359236	T	0.60040	0.22	3.85	3.85	0.44370	.	0.180007	0.26967	N	0.021588	T	0.48537	0.1505	L	0.60455	1.87	0.31091	N	0.710789	P	0.42908	0.793	B	0.35655	0.207	T	0.62789	-0.6780	10	0.72032	D	0.01	-36.1768	9.3377	0.38060	0.0:0.0:0.0:1.0	.	524	Q8N0Z9	VSI10_HUMAN	G	524	ENSP00000352172:D524G	ENSP00000352172:D524G	D	-	2	0	VSIG10	116988879	1.000000	0.71417	0.993000	0.49108	0.668000	0.39293	1.902000	0.39848	1.983000	0.57843	0.383000	0.25322	GAC	.		0.443	VSIG10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401273.2	NM_019086	
WDR17	116966	broad.mit.edu;ucsc.edu	37	4	177067183	177067183	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A5SL-01A-11D-A27I-10	TCGA-G3-A5SL-10A-01D-A27I-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70422e6d-cb1f-4284-8be9-1d4517ffad60	a38d4467-c3e5-4639-ad4f-88bcd7ab9f26	g.chr4:177067183C>T	ENST00000280190.4	+	13	1795	c.1639C>T	c.(1639-1641)Cgt>Tgt	p.R547C	WDR17_ENST00000508596.1_Missense_Mutation_p.R523C|WDR17_ENST00000393643.2_Missense_Mutation_p.R523C|WDR17_ENST00000507824.2_Missense_Mutation_p.R530C			Q8IZU2	WDR17_HUMAN	WD repeat domain 17	547										breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(18)|lung(46)|ovary(2)|pancreas(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(1)	92		Breast(14;0.00015)|Melanoma(52;0.00886)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;2.21e-20)|Epithelial(43;9.71e-18)|OV - Ovarian serous cystadenocarcinoma(60;2.38e-09)|GBM - Glioblastoma multiforme(59;0.000295)|STAD - Stomach adenocarcinoma(60;0.000703)|LUSC - Lung squamous cell carcinoma(193;0.0232)		CACAAATGTTCGTGTTTATTA	0.358																																					p.R547C		.											.	WDR17	95	0			c.C1639T						.						120.0	113.0	115.0					4																	177067183		2203	4300	6503	SO:0001583	missense	116966	exon13			AATGTTCGTGTTT	AF492460	CCDS3825.1, CCDS43284.1, CCDS43284.2	4q34	2013-01-09			ENSG00000150627	ENSG00000150627		"""WD repeat domain containing"""	16661	protein-coding gene	gene with protein product		609005				12401215	Standard	NM_170710		Approved		uc003iuj.3	Q8IZU2	OTTHUMG00000160791	ENST00000280190.4:c.1639C>T	4.37:g.177067183C>T	ENSP00000280190:p.Arg547Cys	75.0	2.0		93.0	16.0	NM_170710	E7EQX0|Q0QD35	Missense_Mutation	SNP	ENST00000280190.4	37	CCDS3825.1	.	.	.	.	.	.	.	.	.	.	C	26.4	4.731452	0.89390	.	.	ENSG00000150627	ENST00000508596;ENST00000393643;ENST00000280190;ENST00000507824	T;T;T	0.68025	-0.3;-0.3;-0.3	5.49	5.49	0.81192	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	D	0.83995	0.5375	M	0.84082	2.675	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.85526	0.1206	10	0.62326	D	0.03	-20.7818	19.3758	0.94508	0.0:1.0:0.0:0.0	.	523;547	E7EQX0;Q8IZU2	.;WDR17_HUMAN	C	523;523;547;530	ENSP00000422763:R523C;ENSP00000377258:R523C;ENSP00000280190:R547C	ENSP00000280190:R547C	R	+	1	0	WDR17	177304177	1.000000	0.71417	0.980000	0.43619	0.951000	0.60555	7.138000	0.77305	2.579000	0.87056	0.563000	0.77884	CGT	.		0.358	WDR17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362334.2		
XPO4	64328	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	21361634	21361634	+	Missense_Mutation	SNP	G	G	C			TCGA-G3-A5SL-01A-11D-A27I-10	TCGA-G3-A5SL-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70422e6d-cb1f-4284-8be9-1d4517ffad60	a38d4467-c3e5-4639-ad4f-88bcd7ab9f26	g.chr13:21361634G>C	ENST00000255305.6	-	21	3222	c.3151C>G	c.(3151-3153)Cgg>Ggg	p.R1051G	XPO4_ENST00000400602.2_Missense_Mutation_p.R1051G			Q9C0E2	XPO4_HUMAN	exportin 4	1051					positive regulation of protein export from nucleus (GO:0046827)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(1)|endometrium(10)|kidney(4)|large_intestine(7)|lung(14)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)	41		all_cancers(29;5.05e-24)|all_epithelial(30;5.56e-20)|all_lung(29;2.38e-16)|Lung SC(185;0.0262)|Hepatocellular(188;0.244)		all cancers(112;0.000521)|Epithelial(112;0.000892)|OV - Ovarian serous cystadenocarcinoma(117;0.0148)|Lung(94;0.0189)|LUSC - Lung squamous cell carcinoma(192;0.0548)		AGAAAGTGCCGTGTTGCTAGA	0.453																																					p.R1051G		.											.	XPO4	272	0			c.C3151G						.						126.0	125.0	126.0					13																	21361634		1923	4140	6063	SO:0001583	missense	64328	exon21			AGTGCCGTGTTGC	AB051508	CCDS41872.1	13q11	2011-04-13			ENSG00000132953	ENSG00000132953		"""Exportins"""	17796	protein-coding gene	gene with protein product		611449				11214970, 10944119	Standard	NM_022459		Approved	FLJ13046, KIAA1721	uc001unq.4	Q9C0E2	OTTHUMG00000016528	ENST00000255305.6:c.3151C>G	13.37:g.21361634G>C	ENSP00000255305:p.Arg1051Gly	139.0	0.0		92.0	31.0	NM_022459	Q5VUZ5|Q8N3V6|Q9H934	Missense_Mutation	SNP	ENST00000255305.6	37	CCDS41872.1	.	.	.	.	.	.	.	.	.	.	G	12.66	2.006111	0.35415	.	.	ENSG00000132953	ENST00000400602;ENST00000255305	T;T	0.25579	1.79;1.79	5.69	3.68	0.42216	Armadillo-like helical (1);Armadillo-type fold (1);Exportin 1, C-terminal (1);	0.119565	0.52532	D	0.000064	T	0.21387	0.0515	L	0.40543	1.245	0.58432	D	0.999992	B	0.14438	0.01	B	0.18871	0.023	T	0.04481	-1.0948	10	0.23302	T	0.38	-12.4956	13.6545	0.62330	0.0:0.0:0.6152:0.3848	.	1051	Q9C0E2	XPO4_HUMAN	G	1051	ENSP00000383444:R1051G;ENSP00000255305:R1051G	ENSP00000255305:R1051G	R	-	1	2	XPO4	20259634	0.986000	0.35501	0.996000	0.52242	0.977000	0.68977	1.802000	0.38853	1.524000	0.49035	0.655000	0.94253	CGG	.		0.453	XPO4-001	KNOWN	non_canonical_conserved|non_canonical_U12|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000044096.1	NM_022459	
ZC3H12C	85463	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	11	110034060	110034060	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A5SL-01A-11D-A27I-10	TCGA-G3-A5SL-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70422e6d-cb1f-4284-8be9-1d4517ffad60	a38d4467-c3e5-4639-ad4f-88bcd7ab9f26	g.chr11:110034060A>G	ENST00000278590.3	+	5	1262	c.1211A>G	c.(1210-1212)aAg>aGg	p.K404R	ZC3H12C_ENST00000528673.1_Missense_Mutation_p.K405R|ZC3H12C_ENST00000453089.2_Missense_Mutation_p.K373R	NM_033390.1	NP_203748.1	Q9C0D7	ZC12C_HUMAN	zinc finger CCCH-type containing 12C	404							endonuclease activity (GO:0004519)|metal ion binding (GO:0046872)			endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|lung(16)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	37		all_cancers(61;3.24e-13)|all_epithelial(67;1.27e-07)|Melanoma(852;1.46e-05)|all_hematologic(158;3.66e-05)|Acute lymphoblastic leukemia(157;3.95e-05)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)|Breast(348;0.0544)		Epithelial(105;1.72e-06)|BRCA - Breast invasive adenocarcinoma(274;1.17e-05)|all cancers(92;9e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.0279)		TTTCTGAGGAAGAAACCTATT	0.388																																					p.K404R		.											.	ZC3H12C	68	0			c.A1211G						.						53.0	50.0	51.0					11																	110034060		1852	4090	5942	SO:0001583	missense	85463	exon5			TGAGGAAGAAACC		CCDS44727.1	11q22.3	2012-07-05			ENSG00000149289	ENSG00000149289		"""Zinc fingers, CCCH-type domain containing"""	29362	protein-coding gene	gene with protein product	"""MCP induced protein 3"""	615001				11214970, 18178554	Standard	NM_033390		Approved	KIAA1726, MCPIP3	uc009yxw.3	Q9C0D7	OTTHUMG00000166572	ENST00000278590.3:c.1211A>G	11.37:g.110034060A>G	ENSP00000278590:p.Lys404Arg	90.0	0.0		73.0	5.0	NM_033390	B4DI65|B4DR47	Missense_Mutation	SNP	ENST00000278590.3	37	CCDS44727.1	.	.	.	.	.	.	.	.	.	.	A	20.9	4.072879	0.76415	.	.	ENSG00000149289	ENST00000278590;ENST00000528673;ENST00000453089	T;T;T	0.38077	1.16;1.16;1.16	5.82	5.82	0.92795	.	0.000000	0.85682	D	0.000000	T	0.60340	0.2261	M	0.69823	2.125	0.53688	D	0.999975	P;D;P	0.76494	0.473;0.999;0.473	B;D;B	0.80764	0.081;0.994;0.081	T	0.62714	-0.6796	10	0.59425	D	0.04	-26.7066	16.1818	0.81909	1.0:0.0:0.0:0.0	.	405;404;404	B4DR47;B4DI65;Q9C0D7	.;.;ZC12C_HUMAN	R	404;405;373	ENSP00000278590:K404R;ENSP00000431821:K405R;ENSP00000413094:K373R	ENSP00000278590:K404R	K	+	2	0	ZC3H12C	109539270	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.339000	0.96797	2.225000	0.72522	0.459000	0.35465	AAG	.		0.388	ZC3H12C-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000390491.1	NM_033390	
ZEB1	6935	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	31809696	31809696	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A5SL-01A-11D-A27I-10	TCGA-G3-A5SL-10A-01D-A27I-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70422e6d-cb1f-4284-8be9-1d4517ffad60	a38d4467-c3e5-4639-ad4f-88bcd7ab9f26	g.chr10:31809696G>A	ENST00000320985.10	+	7	1543	c.1433G>A	c.(1432-1434)aGt>aAt	p.S478N	ZEB1_ENST00000559858.1_3'UTR|ZEB1_ENST00000542815.3_Missense_Mutation_p.S411N|ZEB1_ENST00000560721.2_Missense_Mutation_p.S458N|ZEB1_ENST00000361642.5_Missense_Mutation_p.S479N|ZEB1_ENST00000446923.2_Missense_Mutation_p.S462N			P37275	ZEB1_HUMAN	zinc finger E-box binding homeobox 1	478					cartilage development (GO:0051216)|cell proliferation (GO:0008283)|cellular response to amino acid stimulus (GO:0071230)|cellular response to transforming growth factor beta stimulus (GO:0071560)|cochlea morphogenesis (GO:0090103)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic skeletal system morphogenesis (GO:0048704)|forebrain development (GO:0030900)|immune response (GO:0006955)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epithelial cell differentiation (GO:0030857)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|pattern specification process (GO:0007389)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of mesenchymal cell proliferation (GO:0010464)|regulation of smooth muscle cell differentiation (GO:0051150)|regulation of T cell differentiation in thymus (GO:0033081)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|response to activity (GO:0014823)|response to nutrient levels (GO:0031667)|semicircular canal morphogenesis (GO:0048752)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|E-box binding (GO:0070888)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			NS(2)|breast(4)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(14)|lung(38)|ovary(3)|skin(6)|upper_aerodigestive_tract(4)	77		Prostate(175;0.0156)				ATCAACTACAGTCTTGAGCAG	0.373																																					p.S479N	Ovarian(40;423 959 14296 36701 49589)	.											.	ZEB1	518	0			c.G1436A						.						66.0	67.0	67.0					10																	31809696		2203	4300	6503	SO:0001583	missense	6935	exon7			ACTACAGTCTTGA	AK091478	CCDS7169.1, CCDS44370.1, CCDS53505.1, CCDS53506.1, CCDS53507.1	10p11.22	2014-02-14	2007-02-15	2007-02-15	ENSG00000148516	ENSG00000148516		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	11642	protein-coding gene	gene with protein product		189909	"""transcription factor 8 (represses interleukin 2 expression)"", ""posterior polymorphous corneal dystrophy 3"""	TCF8, PPCD3		1427828, 1840704, 15384081, 16252232	Standard	NM_001128128		Approved	BZP, ZEB, AREB6, NIL-2-A, Zfhep, Zfhx1a, FECD6	uc001ivu.4	P37275	OTTHUMG00000017907	ENST00000320985.10:c.1433G>A	10.37:g.31809696G>A	ENSP00000319248:p.Ser478Asn	66.0	1.0		67.0	36.0	NM_001174096	B4DJV0|B4DUW9|E9PCM7|F5H4I8|Q12924|Q13800|Q2KJ05|Q5T968|Q5VZ84|Q8NB68	Missense_Mutation	SNP	ENST00000320985.10	37	CCDS7169.1	.	.	.	.	.	.	.	.	.	.	G	18.74	3.687728	0.68157	.	.	ENSG00000148516	ENST00000542879;ENST00000537225;ENST00000361642;ENST00000546250;ENST00000542815;ENST00000320985;ENST00000437844;ENST00000541037;ENST00000543514;ENST00000446923	T;T;T;T;T	0.76968	-1.06;-1.06;-1.06;-1.06;-1.06	5.63	5.63	0.86233	.	0.000000	0.85682	D	0.000000	D	0.85911	0.5807	L	0.52364	1.645	0.80722	D	1	B;D;D;D;D;B;D;D	0.76494	0.313;0.999;0.997;0.997;0.995;0.33;0.995;0.997	B;D;D;D;P;B;P;D	0.81914	0.209;0.995;0.986;0.931;0.866;0.103;0.866;0.931	D	0.84836	0.0805	10	0.49607	T	0.09	-18.8846	20.0572	0.97657	0.0:0.0:1.0:0.0	.	411;478;462;478;478;458;479;478	F5H4I8;F5H1R1;E9PCM7;B2RBI8;A0JLS9;Q5VZ84;Q2KJ05;P37275	.;.;.;.;.;.;.;ZEB1_HUMAN	N	260;478;479;478;411;478;458;337;369;462	ENSP00000444282:S260N;ENSP00000354487:S479N;ENSP00000444891:S411N;ENSP00000319248:S478N;ENSP00000391612:S462N	ENSP00000319248:S478N	S	+	2	0	ZEB1	31849702	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.276000	0.72601	2.826000	0.97356	0.655000	0.94253	AGT	.		0.373	ZEB1-018	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000419083.2	NM_030751	
ZFYVE26	23503	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	68265045	68265045	+	Missense_Mutation	SNP	A	A	T			TCGA-G3-A5SL-01A-11D-A27I-10	TCGA-G3-A5SL-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70422e6d-cb1f-4284-8be9-1d4517ffad60	a38d4467-c3e5-4639-ad4f-88bcd7ab9f26	g.chr14:68265045A>T	ENST00000347230.4	-	11	2072	c.1934T>A	c.(1933-1935)aTg>aAg	p.M645K	ZFYVE26_ENST00000555452.1_Missense_Mutation_p.M645K	NM_015346.3	NP_056161.2	Q68DK2	ZFY26_HUMAN	zinc finger, FYVE domain containing 26	645					cell death (GO:0008219)|cytokinesis (GO:0000910)|double-strand break repair via homologous recombination (GO:0000724)	centrosome (GO:0005813)|lysosomal membrane (GO:0005765)|midbody (GO:0030496)	metal ion binding (GO:0046872)|phosphatidylinositol-3-phosphate binding (GO:0032266)			NS(1)|breast(3)|cervix(1)|endometrium(6)|kidney(8)|large_intestine(8)|lung(39)|ovary(12)|pancreas(1)|prostate(7)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)	94				all cancers(60;0.000763)|OV - Ovarian serous cystadenocarcinoma(108;0.0011)|BRCA - Breast invasive adenocarcinoma(234;0.0115)		ATGGCTTGGCATTGTATAAGC	0.493																																					p.M645K		.											.	ZFYVE26	162	0			c.T1934A						.						92.0	94.0	93.0					14																	68265045		2203	4300	6503	SO:0001583	missense	23503	exon11			CTTGGCATTGTAT	AB002319	CCDS9788.1	14q23.3	2012-11-23				ENSG00000072121		"""Zinc fingers, FYVE domain containing"""	20761	protein-coding gene	gene with protein product	"""spastizin"", ""FYVE-CENT"""	612012	"""spastic paraplegia 15 (complicated, autosomal recessive)"""	SPG15		9205841, 18394578	Standard	NM_015346		Approved	KIAA0321	uc001xka.2	Q68DK2		ENST00000347230.4:c.1934T>A	14.37:g.68265045A>T	ENSP00000251119:p.Met645Lys	163.0	0.0		121.0	54.0	NM_015346	B1B5Y3|B4E2U3|O15035|Q68DT9|Q6AW90|Q6ZR50|Q7Z3A4|Q7Z3I1|Q8N4W7	Missense_Mutation	SNP	ENST00000347230.4	37	CCDS9788.1	.	.	.	.	.	.	.	.	.	.	A	6.695	0.496957	0.12762	.	.	ENSG00000072121	ENST00000347230;ENST00000411699;ENST00000555452	T;T	0.26067	1.9;1.76	5.71	-1.1	0.09872	.	2.042190	0.01925	N	0.040776	T	0.11537	0.0281	N	0.08118	0	0.09310	N	1	B;B;B	0.19583	0.037;0.008;0.002	B;B;B	0.16722	0.003;0.016;0.0	T	0.20907	-1.0261	10	0.06099	T	0.92	7.9523	6.0455	0.19758	0.4395:0.1463:0.4143:0.0	.	645;645;645	Q68DK2-4;G3V2D8;Q68DK2	.;.;ZFY26_HUMAN	K	645;624;645	ENSP00000251119:M645K;ENSP00000450603:M645K	ENSP00000251119:M645K	M	-	2	0	ZFYVE26	67334798	0.000000	0.05858	0.000000	0.03702	0.582000	0.36321	0.479000	0.22228	-0.128000	0.11641	-0.250000	0.11733	ATG	.		0.493	ZFYVE26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412736.2	NM_015346	
ZNF816	125893	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	53453569	53453569	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A5SL-01A-11D-A27I-10	TCGA-G3-A5SL-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70422e6d-cb1f-4284-8be9-1d4517ffad60	a38d4467-c3e5-4639-ad4f-88bcd7ab9f26	g.chr19:53453569C>A	ENST00000357666.4	-	5	1759	c.1459G>T	c.(1459-1461)Ggc>Tgc	p.G487C	ZNF816_ENST00000434371.2_Intron|ZNF321P_ENST00000391777.3_Intron|ZNF816_ENST00000444460.2_Missense_Mutation_p.G487C	NM_001031665.2	NP_001026835.1	Q0VGE8	ZN816_HUMAN	zinc finger protein 816	487					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(10)|lung(9)|stomach(1)|urinary_tract(2)	27						AAAACCTTGCCACATTCATTA	0.403																																					p.G487C		.											.	ZNF816	68	0			c.G1459T						.						96.0	96.0	96.0					19																	53453569		2203	4300	6503	SO:0001583	missense	125893	exon4			CCTTGCCACATTC	BC063805	CCDS33096.1	19q13.41	2013-01-08	2010-07-23	2010-07-23		ENSG00000180257		"""Zinc fingers, C2H2-type"", ""-"""	26995	protein-coding gene	gene with protein product			"""zinc finger protein 816A"""	ZNF816A			Standard	NM_001031665		Approved		uc002qam.2	Q0VGE8		ENST00000357666.4:c.1459G>T	19.37:g.53453569C>A	ENSP00000350295:p.Gly487Cys	68.0	0.0		52.0	10.0	NM_001202457	A8K7H5|Q3KR39|Q659B3	Missense_Mutation	SNP	ENST00000357666.4	37	CCDS33096.1	.	.	.	.	.	.	.	.	.	.	-	10.83	1.461443	0.26248	.	.	ENSG00000180257	ENST00000357666;ENST00000444460	T;T	0.23754	1.89;1.89	1.85	1.85	0.25348	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.57636	0.2067	H	0.94734	3.575	0.80722	D	1	D	0.89917	1.0	D	0.74674	0.984	T	0.67738	-0.5593	9	0.87932	D	0	.	10.6734	0.45772	0.0:1.0:0.0:0.0	.	487	Q0VGE8	ZN816_HUMAN	C	487	ENSP00000350295:G487C;ENSP00000403266:G487C	ENSP00000350295:G487C	G	-	1	0	ZNF816	58145381	0.319000	0.24607	0.501000	0.27601	0.074000	0.17049	1.906000	0.39887	1.006000	0.39211	0.313000	0.20887	GGC	.		0.403	ZNF816-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396132.1	NM_001031665	
ZNF471	57573	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	57036179	57036179	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A5SL-01A-11D-A27I-10	TCGA-G3-A5SL-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70422e6d-cb1f-4284-8be9-1d4517ffad60	a38d4467-c3e5-4639-ad4f-88bcd7ab9f26	g.chr19:57036179A>G	ENST00000308031.5	+	5	876	c.743A>G	c.(742-744)cAc>cGc	p.H248R	ZNF471_ENST00000593197.1_Intron|ZNF471_ENST00000591537.1_Missense_Mutation_p.T108A	NM_020813.2	NP_065864.2	Q9BX82	ZN471_HUMAN	zinc finger protein 471	248					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|liver(2)|lung(8)|ovary(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	36		Colorectal(82;5.46e-05)|Ovarian(87;0.0822)|Renal(1328;0.157)		GBM - Glioblastoma multiforme(193;0.0307)		CAAAGGCAACACCTTGCTCAA	0.388																																					p.H248R	Colon(65;957 1402 6678 10163)|Esophageal Squamous(159;2295 2541 15408 21211)	.											.	ZNF471	154	0			c.A743G						.						83.0	89.0	87.0					19																	57036179		2203	4300	6503	SO:0001583	missense	57573	exon5			GGCAACACCTTGC	AB037817	CCDS12945.1	19q13.43	2013-01-08				ENSG00000196263		"""Zinc fingers, C2H2-type"", ""-"""	23226	protein-coding gene	gene with protein product						10718198	Standard	NM_020813		Approved	KIAA1396, Z1971	uc002qnh.3	Q9BX82		ENST00000308031.5:c.743A>G	19.37:g.57036179A>G	ENSP00000309161:p.His248Arg	79.0	0.0		80.0	34.0	NM_020813	B4DF32|O75260|Q08AD6|Q08AD7|Q8N3V1|Q9P2F1	Missense_Mutation	SNP	ENST00000308031.5	37	CCDS12945.1	.	.	.	.	.	.	.	.	.	.	A	9.469	1.095196	0.20471	.	.	ENSG00000196263	ENST00000308031	T	0.12984	2.63	4.29	2.05	0.26809	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.16300	0.0392	N	0.17838	0.53	0.09310	N	1	D	0.89917	1.0	D	0.83275	0.996	T	0.20438	-1.0275	9	0.20519	T	0.43	.	4.0866	0.09950	0.6715:0.0:0.1647:0.1638	.	248	Q9BX82	ZN471_HUMAN	R	248	ENSP00000309161:H248R	ENSP00000309161:H248R	H	+	2	0	ZNF471	61727991	.	.	0.295000	0.24960	0.953000	0.61014	.	.	0.652000	0.30806	0.379000	0.24179	CAC	.		0.388	ZNF471-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458405.1	NM_020813	
ZNF17	7565	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	57931234	57931234	+	Missense_Mutation	SNP	T	T	G			TCGA-G3-A5SL-01A-11D-A27I-10	TCGA-G3-A5SL-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70422e6d-cb1f-4284-8be9-1d4517ffad60	a38d4467-c3e5-4639-ad4f-88bcd7ab9f26	g.chr19:57931234T>G	ENST00000601808.1	+	3	587	c.374T>G	c.(373-375)cTc>cGc	p.L125R	ZNF17_ENST00000595206.1_3'UTR|AC004076.7_ENST00000597410.1_Intron|AC003002.6_ENST00000596400.1_Missense_Mutation_p.L137R|ZNF17_ENST00000307658.7_Missense_Mutation_p.L127R	NM_006959.2	NP_008890.2	P17021	ZNF17_HUMAN	zinc finger protein 17	125					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(6)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	16		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0694)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.0234)|GBM - Glioblastoma multiforme(193;0.000426)|Lung(386;0.176)		AGAGAGAAGCTCACCAGAAGT	0.502																																					p.L125R	Melanoma(149;1637 1853 29914 42869 44988)	.											.	ZNF17	90	0			c.T374G						.						124.0	126.0	125.0					19																	57931234		2203	4300	6503	SO:0001583	missense	7565	exon3			AGAAGCTCACCAG	X52341	CCDS42636.1	19q13.43	2013-01-08	2006-05-10			ENSG00000186272		"""Zinc fingers, C2H2-type"", ""-"""	12958	protein-coding gene	gene with protein product			"""zinc finger protein 17 (HPF3, KOX 10)"""			2115127, 2014798	Standard	NM_006959		Approved	HPF3, KOX10, KIAA1947, FLJ40864, FLJ46058, FLJ46615	uc002qoo.1	P17021		ENST00000601808.1:c.374T>G	19.37:g.57931234T>G	ENSP00000471905:p.Leu125Arg	187.0	0.0		162.0	10.0	NM_006959	B3KXU2|B3KY20|Q8N7M1|Q8N893|Q8TF54	Missense_Mutation	SNP	ENST00000601808.1	37	CCDS42636.1	.	.	.	.	.	.	.	.	.	.	T	8.816	0.936305	0.18206	.	.	ENSG00000186272	ENST00000307658	.	.	.	1.7	0.503	0.16940	.	.	.	.	.	T	0.28830	0.0715	L	0.33137	0.985	0.09310	N	1	P;B	0.50066	0.931;0.114	P;B	0.47430	0.547;0.021	T	0.11941	-1.0567	8	0.39692	T	0.17	.	5.0105	0.14310	0.627:0.0:0.0:0.373	.	127;125	P17021-2;P17021	.;ZNF17_HUMAN	R	125	.	ENSP00000302455:L125R	L	+	2	0	ZNF17	62623046	0.000000	0.05858	0.001000	0.08648	0.315000	0.28087	-2.175000	0.01263	0.037000	0.15575	0.528000	0.53228	CTC	.		0.502	ZNF17-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000466384.1	NM_006959	
