#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
AAMP	14	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	219134700	219134700	+	Missense_Mutation	SNP	G	G	C			TCGA-PD-A5DF-01A-11D-A27I-10	TCGA-PD-A5DF-10A-01D-A27I-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f1a4f60a-5228-47cd-883f-ff8d2dfe1633	ce137c9c-43df-49e8-82f8-3530d13eecfd	g.chr2:219134700G>C	ENST00000248450.4	-	1	280	c.110C>G	c.(109-111)cCg>cGg	p.P37R	AAMP_ENST00000444053.1_Missense_Mutation_p.P37R|PNKD_ENST00000273077.4_5'Flank|PNKD_ENST00000248451.3_5'Flank|AAMP_ENST00000420660.1_5'Flank			Q13685	AAMP_HUMAN	angio-associated, migratory cell protein	37					angiogenesis (GO:0001525)|cell differentiation (GO:0030154)|positive regulation of endothelial cell migration (GO:0010595)|smooth muscle cell migration (GO:0014909)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	heparin binding (GO:0008201)			haematopoietic_and_lymphoid_tissue(2)|kidney(2)|lung(4)|ovary(2)|skin(1)	11		Renal(207;0.0474)		Epithelial(149;7.19e-07)|all cancers(144;0.000131)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		TGGGTCCGGCGGACCGGGATC	0.622																																					p.P37R		.											.	AAMP	91	0			c.C110G						.						97.0	103.0	101.0					2																	219134700		2203	4300	6503	SO:0001583	missense	14	exon1			TCCGGCGGACCGG	AB209790	CCDS33378.1	2q	2013-01-10			ENSG00000127837	ENSG00000127837		"""WD repeat domain containing"""	18	protein-coding gene	gene with protein product		603488				7743515	Standard	XM_005246325		Approved		uc002vhk.3	Q13685	OTTHUMG00000155202	ENST00000248450.4:c.110C>G	2.37:g.219134700G>C	ENSP00000248450:p.Pro37Arg	245.0	1.0		475.0	172.0	NM_001087	Q8WUJ9|Q96H92	Missense_Mutation	SNP	ENST00000248450.4	37	CCDS33378.1	.	.	.	.	.	.	.	.	.	.	G	12.55	1.971609	0.34754	.	.	ENSG00000127837	ENST00000248450;ENST00000444053	T;T	0.53206	0.63;0.67	5.05	5.05	0.67936	.	0.225081	0.46145	D	0.000319	T	0.45337	0.1337	L	0.34521	1.04	0.80722	D	1	P;P	0.50066	0.931;0.931	P;P	0.49477	0.612;0.612	T	0.16897	-1.0387	10	0.23302	T	0.38	-15.9908	15.2759	0.73742	0.0:0.0:1.0:0.0	.	37;37	C9JEH3;Q13685	.;AAMP_HUMAN	R	37	ENSP00000248450:P37R;ENSP00000403343:P37R	ENSP00000248450:P37R	P	-	2	0	AAMP	218842944	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.953000	0.56699	2.624000	0.88883	0.655000	0.94253	CCG	.		0.622	AAMP-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000338756.1	NM_001087	
ACPT	93650	hgsc.bcm.edu;mdanderson.org	37	19	51298384	51298384	+	Missense_Mutation	SNP	G	G	A			TCGA-PD-A5DF-01A-11D-A27I-10	TCGA-PD-A5DF-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f1a4f60a-5228-47cd-883f-ff8d2dfe1633	ce137c9c-43df-49e8-82f8-3530d13eecfd	g.chr19:51298384G>A	ENST00000270593.1	+	11	1250	c.1250G>A	c.(1249-1251)gGg>gAg	p.G417E	CTD-2568A17.8_ENST00000594114.1_RNA|ACPT_ENST00000270594.3_Missense_Mutation_p.G324E	NM_033068.2	NP_149059.1	Q9BZG2	PPAT_HUMAN	acid phosphatase, testicular	417						integral component of membrane (GO:0016021)	acid phosphatase activity (GO:0003993)			central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|lung(6)|skin(3)	11		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.00641)|GBM - Glioblastoma multiforme(134;0.028)		TGGAGACCAGGGTGCCTGCGG	0.662																																					p.G417E		.											.	ACPT	90	0			c.G1250A						.						12.0	14.0	13.0					19																	51298384		2152	4243	6395	SO:0001583	missense	93650	exon11			GACCAGGGTGCCT	AF321918	CCDS12802.1	19q13.33	2012-10-02			ENSG00000142513	ENSG00000142513			14376	protein-coding gene	gene with protein product		606362				11414767	Standard	NM_033068		Approved		uc002pta.1	Q9BZG2		ENST00000270593.1:c.1250G>A	19.37:g.51298384G>A	ENSP00000270593:p.Gly417Glu	8.0	0.0		14.0	10.0	NM_033068	C0H3P7|Q9BZG3|Q9BZG4	Missense_Mutation	SNP	ENST00000270593.1	37	CCDS12802.1	.	.	.	.	.	.	.	.	.	.	g	13.25	2.180031	0.38511	.	.	ENSG00000142513	ENST00000270593;ENST00000270594	T;T	0.12465	2.9;2.68	4.14	3.1	0.35709	.	3.229290	0.01729	N	0.028745	T	0.12433	0.0302	L	0.27053	0.805	0.09310	N	1	B	0.27823	0.19	B	0.21360	0.034	T	0.25328	-1.0135	10	0.62326	D	0.03	-26.4165	8.0273	0.30444	0.1161:0.0:0.8839:0.0	.	417	Q9BZG2	PPAT_HUMAN	E	417;324	ENSP00000270593:G417E;ENSP00000270594:G324E	ENSP00000270593:G417E	G	+	2	0	ACPT	55990196	0.030000	0.19436	0.145000	0.22337	0.787000	0.44495	0.824000	0.27379	0.877000	0.35895	0.561000	0.74099	GGG	.		0.662	ACPT-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464434.1	NM_033068	
AP4E1	23431	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	51223097	51223097	+	Silent	SNP	C	C	T			TCGA-PD-A5DF-01A-11D-A27I-10	TCGA-PD-A5DF-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f1a4f60a-5228-47cd-883f-ff8d2dfe1633	ce137c9c-43df-49e8-82f8-3530d13eecfd	g.chr15:51223097C>T	ENST00000261842.5	+	7	904	c.798C>T	c.(796-798)caC>caT	p.H266H	AP4E1_ENST00000560508.1_Silent_p.H191H	NM_001252127.1|NM_007347.4	NP_001239056.1|NP_031373.2	Q9UPM8	AP4E1_HUMAN	adaptor-related protein complex 4, epsilon 1 subunit	266					intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)	coated pit (GO:0005905)|Golgi apparatus (GO:0005794)|membrane coat (GO:0030117)				breast(1)|endometrium(6)|kidney(3)|large_intestine(10)|lung(5)|skin(2)	27				all cancers(107;0.000893)|GBM - Glioblastoma multiforme(94;0.00364)		TCAATTACCACAGTGTGCCAG	0.378																																					p.H266H		.											.	AP4E1	90	0			c.C798T						.						110.0	111.0	110.0					15																	51223097		2196	4294	6490	SO:0001819	synonymous_variant	23431	exon7			TTACCACAGTGTG	AB030653	CCDS32240.1, CCDS58362.1	15q21.2	2014-09-17			ENSG00000081014	ENSG00000081014			573	protein-coding gene	gene with protein product		607244				10436028, 21620353	Standard	NM_007347		Approved	AP-4-EPSILON, SPG51	uc001zyx.2	Q9UPM8	OTTHUMG00000172458	ENST00000261842.5:c.798C>T	15.37:g.51223097C>T		70.0	0.0		107.0	40.0	NM_007347	A0AVD6|A1L4A9|A6NNX7|H0YKX4|Q68D31|Q9Y588	Silent	SNP	ENST00000261842.5	37	CCDS32240.1																																																																																			.		0.378	AP4E1-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418656.1		
BARD1	580	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	215617259	215617259	+	Missense_Mutation	SNP	G	G	A			TCGA-PD-A5DF-01A-11D-A27I-10	TCGA-PD-A5DF-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f1a4f60a-5228-47cd-883f-ff8d2dfe1633	ce137c9c-43df-49e8-82f8-3530d13eecfd	g.chr2:215617259G>A	ENST00000260947.4	-	7	1723	c.1589C>T	c.(1588-1590)cCt>cTt	p.P530L	BARD1_ENST00000449967.2_Missense_Mutation_p.P386L	NM_000465.2|NM_001282543.1|NM_001282545.1|NM_001282548.1	NP_000456.2|NP_001269472.1|NP_001269474.1|NP_001269477.1	Q99728	BARD1_HUMAN	BRCA1 associated RING domain 1	530					cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|negative regulation of apoptotic process (GO:0043066)|negative regulation of mRNA 3'-end processing (GO:0031441)|negative regulation of protein export from nucleus (GO:0046826)|positive regulation of apoptotic process (GO:0043065)|positive regulation of protein catabolic process (GO:0045732)|protein K6-linked ubiquitination (GO:0085020)|protein ubiquitination (GO:0016567)|regulation of phosphorylation (GO:0042325)|tissue homeostasis (GO:0001894)	BRCA1-A complex (GO:0070531)|BRCA1-BARD1 complex (GO:0031436)|cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)	kinase binding (GO:0019900)|ligase activity (GO:0016874)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|RNA binding (GO:0003723)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(2)|breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(1)|lung(14)|prostate(4)|upper_aerodigestive_tract(1)	35		Renal(323;0.0243)		Epithelial(149;3.2e-06)|all cancers(144;0.000461)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.011)		ATAATCGACAGGCCGCAGACC	0.368									Neuroblastoma, Familial Clustering of;Congenital Central Hypoventilation Syndrome																												p.P530L		.											.	BARD1	415	0			c.C1589T						.						97.0	94.0	95.0					2																	215617259		2203	4300	6503	SO:0001583	missense	580	exon7	Familial Cancer Database	Familial Neuroblastoma;CCHS, Ondine Curse, incl. Ondine-Hirschsprung Disease	TCGACAGGCCGCA		CCDS2397.1, CCDS74645.1, CCDS74646.1, CCDS74647.1, CCDS74648.1	2q34-q35	2013-01-10			ENSG00000138376	ENSG00000138376		"""Ankyrin repeat domain containing"""	952	protein-coding gene	gene with protein product		601593				8944023, 9425226, 15159397	Standard	NM_001282548		Approved		uc002veu.2	Q99728	OTTHUMG00000133016	ENST00000260947.4:c.1589C>T	2.37:g.215617259G>A	ENSP00000260947:p.Pro530Leu	51.0	0.0		80.0	36.0	NM_000465	F6MDH7|F6MDH8|F6MDH9|O43574|Q53SS5	Missense_Mutation	SNP	ENST00000260947.4	37	CCDS2397.1	.	.	.	.	.	.	.	.	.	.	G	16.36	3.100709	0.56183	.	.	ENSG00000138376	ENST00000260947;ENST00000449967;ENST00000421162	T;T;D	0.88818	-0.41;-0.41;-2.43	4.64	4.64	0.57946	Ankyrin repeat-containing domain (2);	0.000000	0.85682	D	0.000000	D	0.93949	0.8063	M	0.70275	2.135	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	D	0.94683	0.7867	10	0.87932	D	0	-18.4088	17.7245	0.88361	0.0:0.0:1.0:0.0	.	386;530	E7EUI3;Q99728	.;BARD1_HUMAN	L	530;386;79	ENSP00000260947:P530L;ENSP00000406752:P386L;ENSP00000392245:P79L	ENSP00000260947:P530L	P	-	2	0	BARD1	215325504	1.000000	0.71417	1.000000	0.80357	0.291000	0.27294	6.257000	0.72480	2.411000	0.81874	0.460000	0.39030	CCT	.		0.368	BARD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256602.1	NM_000465	
CACNA2D3	55799	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	54905638	54905638	+	Silent	SNP	C	C	A			TCGA-PD-A5DF-01A-11D-A27I-10	TCGA-PD-A5DF-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f1a4f60a-5228-47cd-883f-ff8d2dfe1633	ce137c9c-43df-49e8-82f8-3530d13eecfd	g.chr3:54905638C>A	ENST00000474759.1	+	18	1747	c.1699C>A	c.(1699-1701)Cga>Aga	p.R567R	CACNA2D3_ENST00000288197.5_Silent_p.R567R|CACNA2D3_ENST00000415676.2_Silent_p.R567R|CACNA2D3_ENST00000490478.1_Silent_p.R473R|CACNA2D3-AS1_ENST00000471265.1_RNA	NM_018398.2	NP_060868.2	Q8IZS8	CA2D3_HUMAN	calcium channel, voltage-dependent, alpha 2/delta subunit 3	567						integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(17)|ovary(1)|prostate(1)|skin(5)|stomach(1)|urinary_tract(3)	59				KIRC - Kidney renal clear cell carcinoma(284;0.00287)|Kidney(284;0.00327)	Amlodipine(DB00381)|Nilvadipine(DB06712)|Spironolactone(DB00421)	GTGGGAAGACCGAGATGACGT	0.493																																					p.R567R		.											.	CACNA2D3	138	0			c.C1699A						.						178.0	176.0	177.0					3																	54905638		1968	4148	6116	SO:0001819	synonymous_variant	55799	exon18			GAAGACCGAGATG	AJ272268	CCDS54598.1	3p21.1	2010-10-05	2008-02-26		ENSG00000157445	ENSG00000157445		"""Calcium channel subunits"""	15460	protein-coding gene	gene with protein product		606399				11245980	Standard	XM_005265318		Approved	HSA272268	uc003dhf.3	Q8IZS8	OTTHUMG00000158580	ENST00000474759.1:c.1699C>A	3.37:g.54905638C>A		141.0	0.0		198.0	69.0	NM_018398	B2RPL6|Q9NY16|Q9NY18	Silent	SNP	ENST00000474759.1	37	CCDS54598.1																																																																																			.		0.493	CACNA2D3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351402.1		
CASR	846	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	121994752	121994752	+	Missense_Mutation	SNP	A	A	G			TCGA-PD-A5DF-01A-11D-A27I-10	TCGA-PD-A5DF-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f1a4f60a-5228-47cd-883f-ff8d2dfe1633	ce137c9c-43df-49e8-82f8-3530d13eecfd	g.chr3:121994752A>G	ENST00000490131.1	+	5	1843	c.1471A>G	c.(1471-1473)Atc>Gtc	p.I491V	CASR_ENST00000498619.1_Missense_Mutation_p.I491V|CASR_ENST00000296154.5_Missense_Mutation_p.I491V	NM_000388.3	NP_000379	P41180	CASR_HUMAN	calcium-sensing receptor	491					anatomical structure morphogenesis (GO:0009653)|calcium ion import (GO:0070509)|cellular calcium ion homeostasis (GO:0006874)|chemosensory behavior (GO:0007635)|detection of calcium ion (GO:0005513)|G-protein coupled receptor signaling pathway (GO:0007186)|metabolic process (GO:0008152)|ossification (GO:0001503)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|phosphatidylinositol phospholipase C activity (GO:0004435)			NS(1)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(45)|ovary(4)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	84				GBM - Glioblastoma multiforme(114;0.226)	Cinacalcet(DB01012)	GAACTATTCCATCATCAACTG	0.478																																					p.I491V		.											.	CASR	97	0			c.A1471G						.						166.0	148.0	154.0					3																	121994752		2203	4300	6503	SO:0001583	missense	846	exon5			TATTCCATCATCA	U20760	CCDS3010.1, CCDS54632.1	3q21.1	2012-08-29	2008-08-01		ENSG00000036828	ENSG00000036828		"""GPCR / Class C : Calcium-sensing receptors"""	1514	protein-coding gene	gene with protein product	"""severe neonatal hyperparathyroidism"""	601199	"""hypocalciuric hypercalcemia 1"""	HHC, HHC1		7677761	Standard	NM_000388		Approved	FHH, NSHPT, GPRC2A	uc003eew.4	P41180	OTTHUMG00000159491	ENST00000490131.1:c.1471A>G	3.37:g.121994752A>G	ENSP00000418685:p.Ile491Val	168.0	0.0		241.0	96.0	NM_001178065	Q13912|Q16108|Q16109|Q16110|Q16379|Q2M1T0|Q4PJ19	Missense_Mutation	SNP	ENST00000490131.1	37	CCDS3010.1	.	.	.	.	.	.	.	.	.	.	A	15.62	2.886349	0.51908	.	.	ENSG00000036828	ENST00000490131;ENST00000498619;ENST00000296154	D;D;D	0.87103	-2.21;-2.21;-2.21	5.69	5.69	0.88448	Extracellular ligand-binding receptor (1);	0.000000	0.85682	D	0.000000	D	0.91260	0.7245	L	0.55103	1.725	0.80722	D	1	P;D	0.63880	0.689;0.993	B;D	0.76071	0.265;0.987	D	0.89659	0.3875	10	0.30078	T	0.28	.	15.4289	0.75077	1.0:0.0:0.0:0.0	.	491;491	E7ENE0;P41180	.;CASR_HUMAN	V	491	ENSP00000418685:I491V;ENSP00000420194:I491V;ENSP00000296154:I491V	ENSP00000296154:I491V	I	+	1	0	CASR	123477442	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.013000	0.70776	2.291000	0.77112	0.533000	0.62120	ATC	.		0.478	CASR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355761.1	NM_000388	
CCNB3	85417	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	50090667	50090667	+	Missense_Mutation	SNP	A	A	G			TCGA-PD-A5DF-01A-11D-A27I-10	TCGA-PD-A5DF-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f1a4f60a-5228-47cd-883f-ff8d2dfe1633	ce137c9c-43df-49e8-82f8-3530d13eecfd	g.chrX:50090667A>G	ENST00000376042.1	+	11	4151	c.3853A>G	c.(3853-3855)Atc>Gtc	p.I1285V	CCNB3_ENST00000276014.7_Missense_Mutation_p.I1285V|CCNB3_ENST00000376038.1_Missense_Mutation_p.I181V|CCNB3_ENST00000348603.2_Missense_Mutation_p.I181V			Q8WWL7	CCNB3_HUMAN	cyclin B3	1285					meiotic nuclear division (GO:0007126)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)	nucleus (GO:0005634)				breast(3)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(9)|lung(41)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	75	Ovarian(276;0.236)					GTCCCGCTACATCTGCGAGAT	0.498																																					p.I1285V		.											.	CCNB3	482	0			c.A3853G						.						124.0	91.0	102.0					X																	50090667		2203	4300	6503	SO:0001583	missense	85417	exon10			CGCTACATCTGCG	AJ314764	CCDS14331.1, CCDS14332.1	Xp11	2008-07-03			ENSG00000147082	ENSG00000147082			18709	protein-coding gene	gene with protein product		300456				11846420, 12185076	Standard	XM_006724610		Approved		uc004doy.3	Q8WWL7	OTTHUMG00000021519	ENST00000376042.1:c.3853A>G	X.37:g.50090667A>G	ENSP00000365210:p.Ile1285Val	131.0	0.0		183.0	22.0	NM_033031	B1AQI5|B1AQI6|Q96SB5|Q96SB6|Q96SB7|Q9NT38	Missense_Mutation	SNP	ENST00000376042.1	37	CCDS14331.1	.	.	.	.	.	.	.	.	.	.	A	10.94	1.493431	0.26774	.	.	ENSG00000147082	ENST00000376042;ENST00000376038;ENST00000348603;ENST00000276014	T;T;T;T	0.23348	1.91;1.91;1.91;1.91	4.79	3.62	0.41486	Cyclin, C-terminal (1);Cyclin-like (3);	0.335186	0.29692	N	0.011459	T	0.28234	0.0697	L	0.42487	1.325	0.36374	D	0.861493	P;P;P	0.45428	0.722;0.858;0.549	P;B;P	0.51777	0.679;0.386;0.604	T	0.20273	-1.0280	9	.	.	.	.	5.6864	0.17805	0.7373:0.1679:0.0948:0.0	.	1285;181;1285	A8K8T9;Q8WWL7-2;Q8WWL7	.;.;CCNB3_HUMAN	V	1285;181;181;1285	ENSP00000365210:I1285V;ENSP00000365206:I181V;ENSP00000338682:I181V;ENSP00000276014:I1285V	.	I	+	1	0	CCNB3	50107407	1.000000	0.71417	1.000000	0.80357	0.671000	0.39405	1.981000	0.40628	0.611000	0.30052	0.413000	0.27773	ATC	.		0.498	CCNB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056558.1		
CHST9	83539	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	18	24497007	24497007	+	Missense_Mutation	SNP	T	T	A			TCGA-PD-A5DF-01A-11D-A27I-10	TCGA-PD-A5DF-10A-01D-A27I-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f1a4f60a-5228-47cd-883f-ff8d2dfe1633	ce137c9c-43df-49e8-82f8-3530d13eecfd	g.chr18:24497007T>A	ENST00000284224.8	-	6	825	c.548A>T	c.(547-549)cAg>cTg	p.Q183L	CHST9_ENST00000581714.1_Missense_Mutation_p.Q183L|AQP4-AS1_ENST00000578701.1_RNA|AQP4-AS1_ENST00000579964.1_RNA|AQP4-AS1_ENST00000568797.1_RNA|AQP4-AS1_ENST00000582605.1_RNA|CHST9_ENST00000580774.1_3'UTR	NM_031422.5	NP_113610.2	Q7L1S5	CHST9_HUMAN	carbohydrate (N-acetylgalactosamine 4-0) sulfotransferase 9	183					carbohydrate biosynthetic process (GO:0016051)|carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|hormone biosynthetic process (GO:0042446)|proteoglycan biosynthetic process (GO:0030166)|small molecule metabolic process (GO:0044281)|sulfur compound metabolic process (GO:0006790)	extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	N-acetylgalactosamine 4-O-sulfotransferase activity (GO:0001537)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(7)|ovary(2)|pancreas(1)|skin(3)	28	all_lung(6;0.0145)|Ovarian(20;0.124)					GCAAAACTCCTGAAGGAAAGA	0.363																																					p.Q183L		.											.	CHST9	93	0			c.A548T						.						128.0	121.0	123.0					18																	24497007		1848	4088	5936	SO:0001583	missense	83539	exon6			AACTCCTGAAGGA	AF239821	CCDS42422.1, CCDS58618.1	18q11.2	2011-04-28			ENSG00000154080	ENSG00000154080		"""Sulfotransferases, membrane-bound"""	19898	protein-coding gene	gene with protein product		610191				11139592, 11445554	Standard	NM_031422		Approved	GALNAC4ST-2, GALNAC-4-ST2	uc002kwe.4	Q7L1S5		ENST00000284224.8:c.548A>T	18.37:g.24497007T>A	ENSP00000284224:p.Gln183Leu	73.0	1.0		88.0	19.0	NM_031422	Q6UX69|Q9BXH3|Q9BXH4|Q9BZW9	Missense_Mutation	SNP	ENST00000284224.8	37	CCDS42422.1	.	.	.	.	.	.	.	.	.	.	T	10.56	1.385052	0.25031	.	.	ENSG00000154080	ENST00000284224	T	0.65732	-0.17	6.16	2.46	0.29980	.	0.679440	0.14729	N	0.301891	T	0.47619	0.1455	L	0.27053	0.805	0.26392	N	0.976554	B	0.25521	0.128	B	0.25987	0.065	T	0.40496	-0.9560	10	0.56958	D	0.05	-1.1667	9.0449	0.36341	0.0:0.2615:0.0:0.7385	.	183	Q7L1S5	CHST9_HUMAN	L	183	ENSP00000284224:Q183L	ENSP00000284224:Q183L	Q	-	2	0	CHST9	22751005	0.531000	0.26338	0.997000	0.53966	0.987000	0.75469	1.205000	0.32308	0.189000	0.20188	0.528000	0.53228	CAG	.		0.363	CHST9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446549.1	NM_031422	
COL14A1	7373	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	121381587	121381587	+	Missense_Mutation	SNP	G	G	A			TCGA-PD-A5DF-01A-11D-A27I-10	TCGA-PD-A5DF-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f1a4f60a-5228-47cd-883f-ff8d2dfe1633	ce137c9c-43df-49e8-82f8-3530d13eecfd	g.chr8:121381587G>A	ENST00000297848.3	+	47	5444	c.5174G>A	c.(5173-5175)cGg>cAg	p.R1725Q	COL14A1_ENST00000247781.3_Missense_Mutation_p.R1630Q|COL14A1_ENST00000309791.4_Missense_Mutation_p.R1725Q	NM_021110.1	NP_066933.1			collagen, type XIV, alpha 1									p.R1725Q(1)		NS(1)|autonomic_ganglia(1)|breast(11)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(9)|large_intestine(31)|lung(42)|ovary(5)|pancreas(1)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)	119	Lung NSC(37;6.52e-07)|Ovarian(258;0.00769)|Hepatocellular(40;0.161)		OV - Ovarian serous cystadenocarcinoma(1;6.47e-38)|STAD - Stomach adenocarcinoma(47;0.00503)			GGGGAGAGTCGGCCTGGCAGC	0.562																																					p.R1725Q		.											.	COL14A1	543	1	Substitution - Missense(1)	large_intestine(1)	c.G5174A						.						49.0	53.0	52.0					8																	121381587		2203	4300	6503	SO:0001583	missense	7373	exon47			AGAGTCGGCCTGG		CCDS34938.1	8q23	2013-02-11	2008-02-04		ENSG00000187955	ENSG00000187955		"""Collagens"", ""Fibronectin type III domain containing"""	2191	protein-coding gene	gene with protein product		120324	"""undulin"""	UND		1716629, 9427527	Standard	NM_021110		Approved		uc003yox.4	Q05707	OTTHUMG00000149877	ENST00000297848.3:c.5174G>A	8.37:g.121381587G>A	ENSP00000297848:p.Arg1725Gln	22.0	0.0		40.0	13.0	NM_021110		Missense_Mutation	SNP	ENST00000297848.3	37	CCDS34938.1	.	.	.	.	.	.	.	.	.	.	G	32	5.115046	0.94339	.	.	ENSG00000187955	ENST00000309791;ENST00000297848;ENST00000247781;ENST00000440844	D;D;D;D	0.94184	-2.16;-2.2;-3.14;-3.37	4.84	4.84	0.62591	.	0.058095	0.64402	D	0.000003	D	0.89371	0.6696	L	0.28740	0.885	0.80722	D	1	D	0.59357	0.985	P	0.44447	0.45	D	0.87133	0.2198	10	0.13470	T	0.59	.	18.4389	0.90658	0.0:0.0:1.0:0.0	.	1725	Q05707	COEA1_HUMAN	Q	1725;1725;1630;72	ENSP00000311809:R1725Q;ENSP00000297848:R1725Q;ENSP00000247781:R1630Q;ENSP00000403640:R72Q	ENSP00000247781:R1630Q	R	+	2	0	COL14A1	121450768	1.000000	0.71417	0.999000	0.59377	0.980000	0.70556	7.673000	0.83973	2.618000	0.88619	0.561000	0.74099	CGG	.		0.562	COL14A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313657.2	NM_021110	
COL20A1	57642	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	20	61937235	61937235	+	Nonsense_Mutation	SNP	G	G	T			TCGA-PD-A5DF-01A-11D-A27I-10	TCGA-PD-A5DF-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f1a4f60a-5228-47cd-883f-ff8d2dfe1633	ce137c9c-43df-49e8-82f8-3530d13eecfd	g.chr20:61937235G>T	ENST00000358894.6	+	5	440	c.340G>T	c.(340-342)Gag>Tag	p.E114*	COL20A1_ENST00000435874.1_Nonsense_Mutation_p.E114*|COL20A1_ENST00000422202.1_Nonsense_Mutation_p.E114*|COL20A1_ENST00000326996.6_Nonsense_Mutation_p.E114*	NM_020882.2	NP_065933.2	Q9P218	COKA1_HUMAN	collagen, type XX, alpha 1	114	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)				NS(3)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(21)|ovary(1)|prostate(3)|urinary_tract(2)	36	all_cancers(38;1.39e-10)					CCCTGCAGTTGAGGATCTGAA	0.657																																					p.E114X		.											.	COL20A1	90	0			c.G340T						.						41.0	43.0	42.0					20																	61937235		1986	4164	6150	SO:0001587	stop_gained	57642	exon5			GCAGTTGAGGATC	BC043183	CCDS46628.1	20q13.33	2014-02-12			ENSG00000101203	ENSG00000101203		"""Collagens"", ""Fibronectin type III domain containing"""	14670	protein-coding gene	gene with protein product						10819331	Standard	NM_020882		Approved	KIAA1510	uc011aau.2	Q9P218	OTTHUMG00000032964	ENST00000358894.6:c.340G>T	20.37:g.61937235G>T	ENSP00000351767:p.Glu114*	41.0	0.0		125.0	19.0	NM_020882	Q4VXQ4|Q6PI59|Q8WUT2|Q96CY9|Q9BQU6|Q9BQU7	Nonsense_Mutation	SNP	ENST00000358894.6	37	CCDS46628.1	.	.	.	.	.	.	.	.	.	.	G	17.00	3.278003	0.59758	.	.	ENSG00000101203	ENST00000358894;ENST00000326996;ENST00000435874;ENST00000422202	.	.	.	3.95	1.93	0.25924	.	0.065070	0.64402	U	0.000011	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.07030	T	0.85	.	8.0499	0.30572	0.2036:0.0:0.7964:0.0	.	.	.	.	X	114	.	ENSP00000323077:E114X	E	+	1	0	COL20A1	61407680	0.005000	0.15991	0.057000	0.19452	0.113000	0.19764	0.145000	0.16157	0.265000	0.21872	0.467000	0.42956	GAG	.		0.657	COL20A1-006	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000144595.2	NM_020882	
CORO2B	10391	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	69011111	69011111	+	Missense_Mutation	SNP	G	G	T			TCGA-PD-A5DF-01A-11D-A27I-10	TCGA-PD-A5DF-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f1a4f60a-5228-47cd-883f-ff8d2dfe1633	ce137c9c-43df-49e8-82f8-3530d13eecfd	g.chr15:69011111G>T	ENST00000566799.1	+	9	1071	c.1042G>T	c.(1042-1044)Ggc>Tgc	p.G348C	CORO2B_ENST00000540068.1_Missense_Mutation_p.G343C|CORO2B_ENST00000261861.5_Missense_Mutation_p.G343C|CORO2B_ENST00000543950.1_Missense_Mutation_p.G343C			Q9UQ03	COR2B_HUMAN	coronin, actin binding protein, 2B	348					actin cytoskeleton organization (GO:0030036)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|membrane (GO:0016020)	actin binding (GO:0003779)|actin filament binding (GO:0051015)			kidney(3)|large_intestine(13)|lung(11)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	36						GACTCTCAAGGGCCTGATCGA	0.627																																					p.G348C		.											.	CORO2B	158	0			c.G1042T						.						84.0	63.0	71.0					15																	69011111		2200	4298	6498	SO:0001583	missense	10391	exon9			CTCAAGGGCCTGA	AB010098	CCDS53952.1, CCDS10229.2	15q22.31	2013-01-10	2001-11-28		ENSG00000103647	ENSG00000103647		"""Coronins"", ""WD repeat domain containing"""	2256	protein-coding gene	gene with protein product	"""clipin C"", ""coronin, actin-binding, 2B"""	605002	"""coronin, actin-binding protein, 2B"""			10224093, 10231032	Standard	NM_001190456		Approved	ClipinC, KIAA0925	uc021spj.1	Q9UQ03	OTTHUMG00000133288	ENST00000566799.1:c.1042G>T	15.37:g.69011111G>T	ENSP00000454783:p.Gly348Cys	78.0	0.0		175.0	64.0	NM_006091	A8K0W3|O94767|Q8TAN1	Missense_Mutation	SNP	ENST00000566799.1	37	CCDS10229.2	.	.	.	.	.	.	.	.	.	.	G	22.2	4.260590	0.80246	.	.	ENSG00000103647	ENST00000261861;ENST00000540068;ENST00000543950	T;T	0.60040	0.22;0.22	5.48	5.48	0.80851	Domain of unknown function DUF1900 (1);	0.096141	0.64402	D	0.000001	T	0.76421	0.3985	M	0.85777	2.775	0.58432	D	0.999995	D	0.71674	0.998	D	0.73708	0.981	T	0.79841	-0.1633	10	0.87932	D	0	-28.3831	11.3953	0.49838	0.0835:0.0:0.9165:0.0	.	348	Q9UQ03	COR2B_HUMAN	C	348;343;343	ENSP00000446250:G343C;ENSP00000443819:G343C	ENSP00000261861:G348C	G	+	1	0	CORO2B	66798165	1.000000	0.71417	1.000000	0.80357	0.832000	0.47134	6.298000	0.72763	2.575000	0.86900	0.467000	0.42956	GGC	.		0.627	CORO2B-203	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_006091	
DCC	1630	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	18	51025826	51025826	+	Missense_Mutation	SNP	C	C	G			TCGA-PD-A5DF-01A-11D-A27I-10	TCGA-PD-A5DF-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f1a4f60a-5228-47cd-883f-ff8d2dfe1633	ce137c9c-43df-49e8-82f8-3530d13eecfd	g.chr18:51025826C>G	ENST00000442544.2	+	27	4673	c.4057C>G	c.(4057-4059)Cca>Gca	p.P1353A	DCC_ENST00000581580.1_Missense_Mutation_p.P986A|RP11-671P2.1_ENST00000582064.1_RNA	NM_005215.3	NP_005206.2	P43146	DCC_HUMAN	DCC netrin 1 receptor	1353					anterior/posterior axon guidance (GO:0033564)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|axonogenesis (GO:0007409)|dorsal/ventral axon guidance (GO:0033563)|negative regulation of collateral sprouting (GO:0048671)|negative regulation of dendrite development (GO:2000171)|negative regulation of neuron projection development (GO:0010977)|neuron migration (GO:0001764)|positive regulation of apoptotic process (GO:0043065)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of neuron projection development (GO:0010976)|regulation of apoptotic process (GO:0042981)|response to amphetamine (GO:0001975)|spinal cord ventral commissure morphogenesis (GO:0021965)	axon (GO:0030424)|cytosol (GO:0005829)|growth cone membrane (GO:0032584)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	netrin receptor activity (GO:0005042)|transcription coactivator activity (GO:0003713)|transmembrane signaling receptor activity (GO:0004888)			NS(3)|breast(2)|central_nervous_system(1)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(23)|liver(1)|lung(56)|ovary(7)|pancreas(3)|prostate(2)|skin(16)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(6)	148		all_cancers(7;0.11)|all_epithelial(6;0.00126)		Colorectal(16;0.0251)|COAD - Colon adenocarcinoma(17;0.0942)		GCTACCTCCACCAATGAGTGC	0.468																																					p.P1353A		.											.	DCC	225	0			c.C4057G						.						192.0	157.0	169.0					18																	51025826		2203	4300	6503	SO:0001583	missense	1630	exon27			CCTCCACCAATGA	X76132	CCDS11952.1	18q21.1	2014-06-20	2014-06-20		ENSG00000187323	ENSG00000187323		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2701	protein-coding gene	gene with protein product	"""immunoglobulin superfamily, DCC subclass, member 1"""	120470	"""deleted in colorectal carcinoma"""			2294591, 24400119	Standard	NM_005215		Approved	IGDCC1, NTN1R1	uc002lfe.2	P43146	OTTHUMG00000132698	ENST00000442544.2:c.4057C>G	18.37:g.51025826C>G	ENSP00000389140:p.Pro1353Ala	204.0	0.0		290.0	90.0	NM_005215		Missense_Mutation	SNP	ENST00000442544.2	37	CCDS11952.1	.	.	.	.	.	.	.	.	.	.	C	13.99	2.402506	0.42613	.	.	ENSG00000187323	ENST00000442544	T	0.40476	1.03	6.17	6.17	0.99709	Neogenin, C-terminal (1);	0.233791	0.35407	N	0.003236	T	0.36963	0.0986	L	0.34521	1.04	0.58432	D	0.999999	B	0.24186	0.099	B	0.28305	0.088	T	0.11084	-1.0602	10	0.15499	T	0.54	-7.2902	19.6509	0.95805	0.0:1.0:0.0:0.0	.	1353	P43146	DCC_HUMAN	A	1353	ENSP00000389140:P1353A	ENSP00000389140:P1353A	P	+	1	0	DCC	49279824	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.259000	0.72494	2.941000	0.99782	0.655000	0.94253	CCA	.		0.468	DCC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255996.3	NM_005215	
EED	8726	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	11	85975252	85975260	+	In_Frame_Del	DEL	CTGGTGGCA	CTGGTGGCA	-			TCGA-PD-A5DF-01A-11D-A27I-10	TCGA-PD-A5DF-10A-01D-A27I-10	CTGGTGGCA	CTGGTGGCA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f1a4f60a-5228-47cd-883f-ff8d2dfe1633	ce137c9c-43df-49e8-82f8-3530d13eecfd	g.chr11:85975252_85975260delCTGGTGGCA	ENST00000263360.6	+	7	1359_1367	c.673_681delCTGGTGGCA	c.(673-681)ctggtggcadel	p.LVA225del	EED_ENST00000528180.1_In_Frame_Del_p.LVA225del|EED_ENST00000351625.6_In_Frame_Del_p.LVA225del|EED_ENST00000327320.4_In_Frame_Del_p.LVA225del	NM_003797.3	NP_003788.2	O75530	EED_HUMAN	embryonic ectoderm development	225	Interaction with EZH2. {ECO:0000250}.|Required for interaction with the matrix protein MA of HIV-1.				negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of histone H3-K27 methylation (GO:0061087)|regulation of gene expression by genetic imprinting (GO:0006349)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|ESC/E(Z) complex (GO:0035098)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|pronucleus (GO:0045120)|sex chromatin (GO:0001739)	chromatin binding (GO:0003682)|histone methyltransferase activity (GO:0042054)|identical protein binding (GO:0042802)			haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(2)|lung(7)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|stomach(1)	21		Acute lymphoblastic leukemia(157;7.24e-07)|all_hematologic(158;0.00092)				GACGGACACTCTGGTGGCAATATTTGGAG	0.388																																					p.225_227del		.											.	EED	227	0			c.673_681del						.																																			SO:0001651	inframe_deletion	8726	exon7			GACACTCTGGTGG	AF078933	CCDS8273.1, CCDS8274.1	11q14.2-q22.3	2013-01-10			ENSG00000074266	ENSG00000074266		"""WD repeat domain containing"""	3188	protein-coding gene	gene with protein product	"""WD protein associating with integrin cytoplasmic tails 1"""	605984				9765275, 9806832	Standard	NM_003797		Approved	WAIT-1, HEED	uc001pbp.3	O75530	OTTHUMG00000167209	ENST00000263360.6:c.673_681delCTGGTGGCA	11.37:g.85975252_85975260delCTGGTGGCA	ENSP00000263360:p.Leu225_Ala227del	113.0	0.0		118.0	15.0	NM_003797	A8K7V5|O00149|Q6NTH2|Q7LDA5|Q7LDG8|Q86VV2|Q9UNY7	In_Frame_Del	DEL	ENST00000263360.6	37	CCDS8273.1																																																																																			.		0.388	EED-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393733.1	NM_003797	
EED	8726	ucsc.edu;bcgsc.ca	37	11	85975264	85975264	+	Missense_Mutation	SNP	T	T	G			TCGA-PD-A5DF-01A-11D-A27I-10	TCGA-PD-A5DF-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	f1a4f60a-5228-47cd-883f-ff8d2dfe1633	ce137c9c-43df-49e8-82f8-3530d13eecfd	g.chr11:85975264T>G	ENST00000263360.6	+	7	1371	c.685T>G	c.(685-687)Ttt>Gtt	p.F229V	EED_ENST00000528180.1_Missense_Mutation_p.F229V|EED_ENST00000351625.6_Missense_Mutation_p.F229V|EED_ENST00000327320.4_Missense_Mutation_p.F229V	NM_003797.3	NP_003788.2	O75530	EED_HUMAN	embryonic ectoderm development	229	Interaction with EZH2. {ECO:0000250}.|Required for interaction with the matrix protein MA of HIV-1.				negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of histone H3-K27 methylation (GO:0061087)|regulation of gene expression by genetic imprinting (GO:0006349)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|ESC/E(Z) complex (GO:0035098)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|pronucleus (GO:0045120)|sex chromatin (GO:0001739)	chromatin binding (GO:0003682)|histone methyltransferase activity (GO:0042054)|identical protein binding (GO:0042802)			haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(2)|lung(7)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|stomach(1)	21		Acute lymphoblastic leukemia(157;7.24e-07)|all_hematologic(158;0.00092)				GGTGGCAATATTTGGAGGCGT	0.398																																					p.F229V		.											.	EED	227	0			c.T685G						.						144.0	143.0	143.0					11																	85975264		2202	4299	6501	SO:0001583	missense	8726	exon7			GCAATATTTGGAG	AF078933	CCDS8273.1, CCDS8274.1	11q14.2-q22.3	2013-01-10			ENSG00000074266	ENSG00000074266		"""WD repeat domain containing"""	3188	protein-coding gene	gene with protein product	"""WD protein associating with integrin cytoplasmic tails 1"""	605984				9765275, 9806832	Standard	NM_003797		Approved	WAIT-1, HEED	uc001pbp.3	O75530	OTTHUMG00000167209	ENST00000263360.6:c.685T>G	11.37:g.85975264T>G	ENSP00000263360:p.Phe229Val	129.0	0.0		135.0	25.0	NM_003797	A8K7V5|O00149|Q6NTH2|Q7LDA5|Q7LDG8|Q86VV2|Q9UNY7	Missense_Mutation	SNP	ENST00000263360.6	37	CCDS8273.1	.	.	.	.	.	.	.	.	.	.	T	31	5.080895	0.94050	.	.	ENSG00000074266	ENST00000263360;ENST00000528180;ENST00000351625;ENST00000327320;ENST00000533228	T;T;T;T	0.30981	1.51;1.51;1.51;1.51	5.2	5.2	0.72013	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.112563	0.64402	D	0.000003	T	0.55194	0.1905	M	0.74647	2.275	0.80722	D	1	D;P;D;D	0.76494	0.997;0.91;0.993;0.999	D;B;D;D	0.73380	0.98;0.388;0.939;0.974	T	0.57112	-0.7867	9	.	.	.	-16.0665	15.355	0.74421	0.0:0.0:0.0:1.0	.	229;229;229;229	O75530-3;E9PJK2;O75530-2;O75530	.;.;.;EED_HUMAN	V	229;229;229;229;22	ENSP00000263360:F229V;ENSP00000431778:F229V;ENSP00000338186:F229V;ENSP00000315587:F229V	.	F	+	1	0	EED	85652912	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	6.135000	0.71696	2.089000	0.63090	0.383000	0.25322	TTT	.		0.398	EED-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393733.1	NM_003797	
EN2	2020	hgsc.bcm.edu;mdanderson.org	37	7	155251239	155251239	+	Missense_Mutation	SNP	C	C	A			TCGA-PD-A5DF-01A-11D-A27I-10	TCGA-PD-A5DF-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f1a4f60a-5228-47cd-883f-ff8d2dfe1633	ce137c9c-43df-49e8-82f8-3530d13eecfd	g.chr7:155251239C>A	ENST00000297375.4	+	1	416	c.167C>A	c.(166-168)gCg>gAg	p.A56E	AC008060.8_ENST00000419225.1_lincRNA	NM_001427.3	NP_001418.2	P19622	HME2_HUMAN	engrailed homeobox 2	56					hindbrain development (GO:0030902)|midbrain development (GO:0030901)|multicellular organismal development (GO:0007275)|neuron development (GO:0048666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	membrane (GO:0016020)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			central_nervous_system(1)|large_intestine(1)|lung(2)	4	all_neural(206;0.119)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.011)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		GTCCTGCAGGCGCCCGGCAAC	0.741																																					p.A56E		.											.	EN2	90	0			c.C167A						.						7.0	6.0	7.0					7																	155251239		1949	3820	5769	SO:0001583	missense	2020	exon1			TGCAGGCGCCCGG		CCDS5940.1	7q36.2	2011-06-20	2007-02-15		ENSG00000164778	ENSG00000164778		"""Homeoboxes / ANTP class : NKL subclass"""	3343	protein-coding gene	gene with protein product		131310					Standard	NM_001427		Approved		uc003wmb.3	P19622	OTTHUMG00000151354	ENST00000297375.4:c.167C>A	7.37:g.155251239C>A	ENSP00000297375:p.Ala56Glu	13.0	0.0		12.0	6.0	NM_001427	A4D252|Q549U3|Q9UD58	Missense_Mutation	SNP	ENST00000297375.4	37	CCDS5940.1	.	.	.	.	.	.	.	.	.	.	C	10.46	1.355211	0.24512	.	.	ENSG00000164778	ENST00000297375	D	0.91464	-2.85	3.6	1.7	0.24286	.	0.426630	0.22570	U	0.058359	D	0.83275	0.5219	N	0.19112	0.55	0.42593	D	0.993253	D	0.54397	0.966	P	0.45946	0.498	T	0.80248	-0.1461	10	0.66056	D	0.02	-2.4522	7.9384	0.29944	0.0:0.7436:0.1622:0.0942	.	56	P19622	HME2_HUMAN	E	56	ENSP00000297375:A56E	ENSP00000297375:A56E	A	+	2	0	EN2	154944000	1.000000	0.71417	0.012000	0.15200	0.127000	0.20565	3.570000	0.53834	0.209000	0.20645	-0.510000	0.04470	GCG	.		0.741	EN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322337.1	NM_001427	
EP400	57634	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	132512744	132512744	+	Silent	SNP	G	G	T	rs34531099	byFrequency	TCGA-PD-A5DF-01A-11D-A27I-10	TCGA-PD-A5DF-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f1a4f60a-5228-47cd-883f-ff8d2dfe1633	ce137c9c-43df-49e8-82f8-3530d13eecfd	g.chr12:132512744G>T	ENST00000333577.4	+	28	5509	c.5400G>T	c.(5398-5400)gcG>gcT	p.A1800A	EP400_ENST00000330386.6_Silent_p.A1683A|EP400_ENST00000389561.2_Silent_p.A1764A|EP400_ENST00000389562.2_Silent_p.A1763A|EP400_ENST00000332482.4_Silent_p.A1727A			Q96L91	EP400_HUMAN	E1A binding protein p400	1800					chromatin organization (GO:0006325)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)	NuA4 histone acetyltransferase complex (GO:0035267)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|Swr1 complex (GO:0000812)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			NS(1)|breast(6)|central_nervous_system(10)|cervix(1)|endometrium(21)|kidney(13)|large_intestine(25)|lung(56)|ovary(5)|prostate(8)|skin(6)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	161	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.198)		OV - Ovarian serous cystadenocarcinoma(86;3.01e-08)|Epithelial(86;3.43e-07)|all cancers(50;2.01e-06)		CCGGGCCAGCGCACAGTTACA	0.557																																					p.A1764A		.											.	EP400	520	0			c.G5292T						.						155.0	138.0	144.0					12																	132512744		2203	4300	6503	SO:0001819	synonymous_variant	57634	exon27			GCCAGCGCACAGT	U80743	CCDS31929.1, CCDS31929.2	12q24.33	2008-02-01	2002-02-05	2002-02-08		ENSG00000183495			11958	protein-coding gene	gene with protein product		606265	"""trinucleotide repeat containing 12"""	TNRC12		9225980, 11509179	Standard	NM_015409		Approved	CAGH32, KIAA1498, P400, KIAA1818, DKFZP434I225	uc001ujn.3	Q96L91		ENST00000333577.4:c.5400G>T	12.37:g.132512744G>T		135.0	0.0		329.0	141.0	NM_015409	O15411|Q6P2F5|Q8N8Q7|Q8NE05|Q96JK7|Q9P230	Silent	SNP	ENST00000333577.4	37																																																																																				G|0.997;A|0.003		0.557	EP400-203	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_015409	
FGD5	152273	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	14861791	14861791	+	Missense_Mutation	SNP	G	G	T			TCGA-PD-A5DF-01A-11D-A27I-10	TCGA-PD-A5DF-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f1a4f60a-5228-47cd-883f-ff8d2dfe1633	ce137c9c-43df-49e8-82f8-3530d13eecfd	g.chr3:14861791G>T	ENST00000285046.5	+	1	1323	c.1213G>T	c.(1213-1215)Gcc>Tcc	p.A405S	FGD5_ENST00000543601.1_Missense_Mutation_p.A164S	NM_152536.3	NP_689749.3	Q6ZNL6	FGD5_HUMAN	FYVE, RhoGEF and PH domain containing 5	405					actin cytoskeleton organization (GO:0030036)|cytoskeleton organization (GO:0007010)|filopodium assembly (GO:0046847)|positive regulation of GTPase activity (GO:0043547)|regulation of Cdc42 GTPase activity (GO:0043088)|regulation of cell shape (GO:0008360)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|small GTPase binding (GO:0031267)			NS(2)|breast(2)|endometrium(3)|kidney(5)|large_intestine(10)|lung(25)|ovary(3)|pancreas(1)|prostate(2)|urinary_tract(1)	54						GGGTGGAGCGGCCGAGGGTCC	0.647																																					p.A405S		.											.	FGD5	231	0			c.G1213T						.						24.0	29.0	27.0					3																	14861791		2032	4157	6189	SO:0001583	missense	152273	exon1			GGAGCGGCCGAGG	AK097276	CCDS46767.1	3p25.1	2013-01-10			ENSG00000154783	ENSG00000154783		"""Zinc fingers, FYVE domain containing"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	19117	protein-coding gene	gene with protein product		614788					Standard	NM_152536		Approved	ZFYVE23, FLJ39957, FLJ00274	uc003bzc.3	Q6ZNL6	OTTHUMG00000155556	ENST00000285046.5:c.1213G>T	3.37:g.14861791G>T	ENSP00000285046:p.Ala405Ser	74.0	0.0		84.0	37.0	NM_152536	B3KVQ3|Q6MZY1|Q7Z303|Q8IYP3|Q8N861|Q8N8G4	Missense_Mutation	SNP	ENST00000285046.5	37	CCDS46767.1	.	.	.	.	.	.	.	.	.	.	G	7.241	0.601229	0.13939	.	.	ENSG00000154783	ENST00000285046;ENST00000543601	T;T	0.75050	-0.9;-0.75	4.54	2.4	0.29515	.	1.862650	0.02991	N	0.146895	T	0.57110	0.2031	N	0.14661	0.345	0.09310	N	1	B;B	0.18741	0.009;0.03	B;B	0.14578	0.007;0.011	T	0.44907	-0.9297	10	0.14656	T	0.56	-0.9812	6.0863	0.19968	0.1159:0.0:0.6372:0.2469	.	164;405	B7ZM68;Q6ZNL6	.;FGD5_HUMAN	S	405;164	ENSP00000285046:A405S;ENSP00000445949:A164S	ENSP00000285046:A405S	A	+	1	0	FGD5	14836795	0.000000	0.05858	0.002000	0.10522	0.002000	0.02628	0.084000	0.14891	0.831000	0.34780	0.491000	0.48974	GCC	.		0.647	FGD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340628.1	NM_152536	
FSIP2	401024	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	186673528	186673528	+	Missense_Mutation	SNP	G	G	A			TCGA-PD-A5DF-01A-11D-A27I-10	TCGA-PD-A5DF-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f1a4f60a-5228-47cd-883f-ff8d2dfe1633	ce137c9c-43df-49e8-82f8-3530d13eecfd	g.chr2:186673528G>A	ENST00000424728.1	+	17	19495	c.19495G>A	c.(19495-19497)Gtg>Atg	p.V6499M	FSIP2_ENST00000343098.5_Missense_Mutation_p.V6588M			Q5CZC0	FSIP2_HUMAN	fibrous sheath interacting protein 2	6499										NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(4)|kidney(1)|large_intestine(11)|lung(46)|pancreas(1)|urinary_tract(2)	69						TGCTTTTAATGTGATTCCTGA	0.323																																					p.V6588M		.											.	FSIP2	90	0			c.G19762A						.						58.0	57.0	57.0					2																	186673528		1816	4064	5880	SO:0001583	missense	401024	exon17			TTTAATGTGATTC	AK092099	CCDS54426.1	2q32.1	2010-06-18			ENSG00000188738	ENSG00000188738			21675	protein-coding gene	gene with protein product		615796				14702039	Standard	NM_173651		Approved	FLJ34780	uc002upl.3	Q5CZC0	OTTHUMG00000153874	ENST00000424728.1:c.19495G>A	2.37:g.186673528G>A	ENSP00000401306:p.Val6499Met	90.0	0.0		67.0	20.0	NM_173651	Q53TL3|Q53TN5|Q5HYH2|Q6ZTZ5|Q6ZU14|Q6ZU21	Missense_Mutation	SNP	ENST00000424728.1	37		.	.	.	.	.	.	.	.	.	.	G	0.082	-1.181143	0.01633	.	.	ENSG00000188738	ENST00000343098;ENST00000424728	T;T	0.39787	1.06;1.06	5.46	0.147	0.14838	.	1.007950	0.07960	N	0.982250	T	0.15478	0.0373	N	0.01874	-0.695	0.09310	N	1	.	.	.	.	.	.	T	0.21415	-1.0246	8	0.20519	T	0.43	.	7.6903	0.28565	0.65:0.0:0.35:0.0	.	.	.	.	M	6588;6499	ENSP00000344403:V6588M;ENSP00000401306:V6499M	ENSP00000344403:V6588M	V	+	1	0	FSIP2	186381773	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	0.879000	0.28146	-0.063000	0.13065	-0.423000	0.05987	GTG	.		0.323	FSIP2-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000332778.3	NM_173651	
HNRNPM	4670	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	8520429	8520429	+	Missense_Mutation	SNP	A	A	G			TCGA-PD-A5DF-01A-11D-A27I-10	TCGA-PD-A5DF-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f1a4f60a-5228-47cd-883f-ff8d2dfe1633	ce137c9c-43df-49e8-82f8-3530d13eecfd	g.chr19:8520429A>G	ENST00000325495.4	+	2	295	c.254A>G	c.(253-255)cAg>cGg	p.Q85R	HNRNPM_ENST00000348943.3_Missense_Mutation_p.Q85R	NM_005968.4	NP_005959.2	P52272	HNRPM_HUMAN	heterogeneous nuclear ribonucleoprotein M	85	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.				alternative mRNA splicing, via spliceosome (GO:0000380)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|extracellular matrix (GO:0031012)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|paraspeckles (GO:0042382)|spliceosomal complex (GO:0005681)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|protein domain specific binding (GO:0019904)|RNA binding (GO:0003723)			endometrium(5)|kidney(2)|large_intestine(7)|lung(10)|ovary(1)	25						GTGAAATGGCAGTCACTTAAA	0.388																																					p.Q85R		.											.	HNRNPM	68	0			c.A254G						.						97.0	92.0	94.0					19																	8520429		2203	4300	6503	SO:0001583	missense	4670	exon2			AATGGCAGTCACT	L03532	CCDS12203.1, CCDS12204.1	19p13.2	2013-06-12		2008-04-18	ENSG00000099783	ENSG00000099783		"""RNA binding motif (RRM) containing"""	5046	protein-coding gene	gene with protein product	"""CEA receptor"""	160994		NAGR1, HNRPM		8441656, 7558047	Standard	NM_005968		Approved	HTGR1, HNRNPM4, HNRPM4, CEAR	uc010dwe.3	P52272	OTTHUMG00000182383	ENST00000325495.4:c.254A>G	19.37:g.8520429A>G	ENSP00000325376:p.Gln85Arg	70.0	0.0		117.0	39.0	NM_031203	Q15584|Q8WZ44|Q96H56|Q9BWL9|Q9Y492	Missense_Mutation	SNP	ENST00000325495.4	37	CCDS12203.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	20.2|20.2	3.954341|3.954341	0.73902|0.73902	.|.	.|.	ENSG00000099783|ENSG00000099783	ENST00000325495;ENST00000348943|ENST00000544159	T;T|.	0.17054|.	2.3;2.3|.	6.04|6.04	6.04|6.04	0.98038|0.98038	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.65471|0.65471	0.2694|0.2694	L|L	0.47716|0.47716	1.5|1.5	0.80722|0.80722	D|D	1|1	D;D;B|.	0.76494|.	0.99;0.999;0.387|.	D;D;B|.	0.79108|.	0.985;0.992;0.246|.	T|T	0.67772|0.67772	-0.5584|-0.5584	10|6	0.72032|0.87932	D|D	0.01|0	.|.	15.4125|15.4125	0.74937|0.74937	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	85;85;85|.	P52272;P52272-2;B4DEG4|.	HNRPM_HUMAN;.;.|.	R|G	85|3	ENSP00000325376:Q85R;ENSP00000325732:Q85R|.	ENSP00000325376:Q85R|ENSP00000442876:S3G	Q|S	+|+	2|1	0|0	HNRNPM|HNRNPM	8426429|8426429	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.988000|0.988000	0.76386|0.76386	8.962000|8.962000	0.93254|0.93254	2.317000|2.317000	0.78254|0.78254	0.460000|0.460000	0.39030|0.39030	CAG|AGT	.		0.388	HNRNPM-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000460894.1		
HSPG2	3339	hgsc.bcm.edu;mdanderson.org	37	1	22182073	22182073	+	Missense_Mutation	SNP	A	A	G			TCGA-PD-A5DF-01A-11D-A27I-10	TCGA-PD-A5DF-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f1a4f60a-5228-47cd-883f-ff8d2dfe1633	ce137c9c-43df-49e8-82f8-3530d13eecfd	g.chr1:22182073A>G	ENST00000374695.3	-	46	5876	c.5797T>C	c.(5797-5799)Tgc>Cgc	p.C1933R	HSPG2_ENST00000430507.1_5'Flank	NM_005529.5	NP_005520.4	P98160	PGBM_HUMAN	heparan sulfate proteoglycan 2	1933	Ig-like C2-type 4.				angiogenesis (GO:0001525)|brain development (GO:0007420)|carbohydrate metabolic process (GO:0005975)|cardiac muscle tissue development (GO:0048738)|cartilage development involved in endochondral bone morphogenesis (GO:0060351)|chondrocyte differentiation (GO:0002062)|chondroitin sulfate metabolic process (GO:0030204)|embryonic skeletal system morphogenesis (GO:0048704)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|lipoprotein metabolic process (GO:0042157)|phototransduction, visible light (GO:0007603)|protein localization (GO:0008104)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	basal lamina (GO:0005605)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)			breast(6)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(15)|liver(1)|lung(44)|ovary(10)|pancreas(1)|prostate(10)|skin(9)|upper_aerodigestive_tract(3)|urinary_tract(3)	127		Colorectal(325;3.46e-05)|all_lung(284;7.93e-05)|Lung NSC(340;8.71e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0498)|OV - Ovarian serous cystadenocarcinoma(117;1.14e-26)|Colorectal(126;4.18e-07)|COAD - Colon adenocarcinoma(152;1.82e-05)|GBM - Glioblastoma multiforme(114;3.13e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000756)|STAD - Stomach adenocarcinoma(196;0.00656)|KIRC - Kidney renal clear cell carcinoma(1967;0.00942)|READ - Rectum adenocarcinoma(331;0.0721)|Lung(427;0.223)	Palifermin(DB00039)	TGGGCTCGGCACAAGTACTGG	0.711																																					p.C1933R		.											.	HSPG2	141	0			c.T5797C						.						13.0	14.0	14.0					1																	22182073		2194	4291	6485	SO:0001583	missense	3339	exon46			CTCGGCACAAGTA	M85289	CCDS30625.1	1p36.1-p35	2013-01-29	2007-02-16	2007-02-16	ENSG00000142798	ENSG00000142798		"""Proteoglycans / Extracellular Matrix : Other"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5273	protein-coding gene	gene with protein product	"""perlecan proteoglycan"""	142461	"""Schwartz-Jampel syndrome 1 (chondrodystrophic myotonia)"""	SJS1		1685141, 11941538	Standard	XM_005245863		Approved	perlecan, PRCAN	uc001bfj.3	P98160	OTTHUMG00000002674	ENST00000374695.3:c.5797T>C	1.37:g.22182073A>G	ENSP00000363827:p.Cys1933Arg	8.0	0.0		16.0	4.0	NM_005529	Q16287|Q5SZI3|Q9H3V5	Missense_Mutation	SNP	ENST00000374695.3	37	CCDS30625.1	.	.	.	.	.	.	.	.	.	.	A	20.7	4.030646	0.75504	.	.	ENSG00000142798	ENST00000374695	T	0.61627	0.09	5.12	5.12	0.69794	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.43579	D	0.000547	D	0.84547	0.5496	H	0.98466	4.24	0.80722	D	1	D	0.76494	0.999	D	0.87578	0.998	D	0.89903	0.4046	10	0.87932	D	0	.	12.8664	0.57941	1.0:0.0:0.0:0.0	.	1933	P98160	PGBM_HUMAN	R	1933	ENSP00000363827:C1933R	ENSP00000363827:C1933R	C	-	1	0	HSPG2	22054660	1.000000	0.71417	0.996000	0.52242	0.880000	0.50808	7.787000	0.85759	1.943000	0.56356	0.379000	0.24179	TGC	.		0.711	HSPG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007598.1	NM_005529	
IL10RA	3587	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	117860190	117860190	+	Missense_Mutation	SNP	C	C	A			TCGA-PD-A5DF-01A-11D-A27I-10	TCGA-PD-A5DF-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f1a4f60a-5228-47cd-883f-ff8d2dfe1633	ce137c9c-43df-49e8-82f8-3530d13eecfd	g.chr11:117860190C>A	ENST00000227752.3	+	3	342	c.222C>A	c.(220-222)aaC>aaA	p.N74K	IL10RA_ENST00000541785.1_Missense_Mutation_p.N54K|IL10RA_ENST00000533700.1_3'UTR|IL10RA_ENST00000545409.1_Intron	NM_001558.3	NP_001549.2	Q13651	I10R1_HUMAN	interleukin 10 receptor, alpha	74					cytokine-mediated signaling pathway (GO:0019221)|response to lipopolysaccharide (GO:0032496)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	interleukin-10 receptor activity (GO:0004920)|receptor activity (GO:0004872)|signal transducer activity (GO:0004871)			NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(10)|ovary(2)|prostate(1)	19	all_hematologic(175;0.0487)	Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;3.07e-05)|Epithelial(105;0.00108)		CCATCTCCAACTGTAGCCAGA	0.562																																					p.N74K		.											.	IL10RA	91	0			c.C222A						.						160.0	131.0	141.0					11																	117860190		2200	4296	6496	SO:0001583	missense	3587	exon3			CTCCAACTGTAGC	U00672	CCDS8388.1	11q23	2014-09-17			ENSG00000110324	ENSG00000110324		"""Interleukins and interleukin receptors"", ""CD molecules"""	5964	protein-coding gene	gene with protein product		146933		IL10R		8120391	Standard	NR_026691		Approved	HIL-10R, CDW210A, CD210a, CD210	uc001prv.3	Q13651	OTTHUMG00000166523	ENST00000227752.3:c.222C>A	11.37:g.117860190C>A	ENSP00000227752:p.Asn74Lys	231.0	0.0		308.0	100.0	NM_001558	A8K6I0|B0YJ27	Missense_Mutation	SNP	ENST00000227752.3	37	CCDS8388.1	.	.	.	.	.	.	.	.	.	.	C	9.135	1.012470	0.19277	.	.	ENSG00000110324	ENST00000227752;ENST00000541785;ENST00000536858	T;T	0.72725	-0.68;-0.68	5.14	3.26	0.37387	Fibronectin, type III (1);Immunoglobulin-like fold (1);	1.049110	0.07325	N	0.878265	T	0.55784	0.1942	L	0.27053	0.805	0.80722	D	1	B;B	0.21381	0.045;0.055	B;B	0.28139	0.032;0.086	T	0.36237	-0.9756	10	0.05620	T	0.96	-0.0674	8.5193	0.33266	0.0:0.7638:0.1531:0.0831	.	54;74	F5GYV8;Q13651	.;I10R1_HUMAN	K	74;54;54	ENSP00000227752:N74K;ENSP00000441397:N54K	ENSP00000227752:N74K	N	+	3	2	IL10RA	117365400	0.693000	0.27728	0.158000	0.22627	0.014000	0.08584	0.960000	0.29253	0.675000	0.31264	-0.244000	0.11960	AAC	.		0.562	IL10RA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390167.1		
KAT2B	8850	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	20113881	20113881	+	Silent	SNP	C	C	G			TCGA-PD-A5DF-01A-11D-A27I-10	TCGA-PD-A5DF-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f1a4f60a-5228-47cd-883f-ff8d2dfe1633	ce137c9c-43df-49e8-82f8-3530d13eecfd	g.chr3:20113881C>G	ENST00000263754.4	+	2	815	c.360C>G	c.(358-360)ccC>ccG	p.P120P	KAT2B_ENST00000426228.1_3'UTR	NM_003884.4	NP_003875.3	Q92831	KAT2B_HUMAN	K(lysine) acetyltransferase 2B	120					cell cycle arrest (GO:0007050)|cellular response to insulin stimulus (GO:0032869)|chromatin organization (GO:0006325)|chromatin remodeling (GO:0006338)|gene expression (GO:0010467)|histone H3 acetylation (GO:0043966)|histone H3-K9 acetylation (GO:0043970)|internal peptidyl-lysine acetylation (GO:0018393)|N-terminal peptidyl-lysine acetylation (GO:0018076)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|Notch signaling pathway (GO:0007219)|peptidyl-lysine acetylation (GO:0018394)|positive regulation of gluconeogenesis (GO:0045722)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein acetylation (GO:0006473)|regulation of protein ADP-ribosylation (GO:0010835)|rhythmic process (GO:0048511)|transcription from RNA polymerase I promoter (GO:0006360)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	A band (GO:0031672)|actomyosin (GO:0042641)|Ada2/Gcn5/Ada3 transcription activator complex (GO:0005671)|I band (GO:0031674)|kinetochore (GO:0000776)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PCAF complex (GO:0000125)	acetyltransferase activity (GO:0016407)|cyclin-dependent protein serine/threonine kinase inhibitor activity (GO:0004861)|histone acetyltransferase activity (GO:0004402)|histone deacetylase binding (GO:0042826)|lysine N-acetyltransferase activity, acting on acetyl phosphate as donor (GO:0004468)|protein complex binding (GO:0032403)|protein kinase binding (GO:0019901)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|transcription factor binding (GO:0008134)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(1)	40						CACCCACTCCCCCCAGAGCCG	0.438																																					p.P120P		.											.	KAT2B	228	0			c.C360G						.						107.0	117.0	113.0					3																	20113881		2203	4300	6503	SO:0001819	synonymous_variant	8850	exon2			CACTCCCCCCAGA	U57316	CCDS2634.1	3p24	2011-07-01	2008-07-04	2008-07-04	ENSG00000114166	ENSG00000114166		"""Chromatin-modifying enzymes / K-acetyltransferases"""	8638	protein-coding gene	gene with protein product		602303	"""p300/CBP-associated factor"""	PCAF		8684459, 9722949	Standard	NM_003884		Approved	P/CAF, GCN5, GCN5L	uc003cbq.3	Q92831	OTTHUMG00000130481	ENST00000263754.4:c.360C>G	3.37:g.20113881C>G		71.0	0.0		87.0	31.0	NM_003884	Q6NSK1	Silent	SNP	ENST00000263754.4	37	CCDS2634.1																																																																																			.		0.438	KAT2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252880.1	NM_003884	
KLHL32	114792	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	97561726	97561726	+	Missense_Mutation	SNP	G	G	A			TCGA-PD-A5DF-01A-11D-A27I-10	TCGA-PD-A5DF-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f1a4f60a-5228-47cd-883f-ff8d2dfe1633	ce137c9c-43df-49e8-82f8-3530d13eecfd	g.chr6:97561726G>A	ENST00000369261.4	+	7	1058	c.695G>A	c.(694-696)cGc>cAc	p.R232H	KLHL32_ENST00000539200.1_Missense_Mutation_p.R163H|KLHL32_ENST00000536676.1_Missense_Mutation_p.R196H|KLHL32_ENST00000544166.1_Intron	NM_052904.3	NP_443136.2	Q96NJ5	KLH32_HUMAN	kelch-like family member 32	232										breast(2)|endometrium(3)|kidney(4)|large_intestine(9)|lung(13)|ovary(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	38		all_cancers(76;1.19e-06)|Acute lymphoblastic leukemia(125;5.83e-10)|all_hematologic(75;3.67e-07)|all_epithelial(107;0.00778)|Colorectal(196;0.122)		BRCA - Breast invasive adenocarcinoma(108;0.0558)		CAATACATCCGCTTTGGCCTA	0.532																																					p.R232H		.											.	KLHL32	94	0			c.G695A						.						190.0	161.0	171.0					6																	97561726		2203	4300	6503	SO:0001583	missense	114792	exon7			ACATCCGCTTTGG	AB067487	CCDS5038.1, CCDS69154.1, CCDS69155.1, CCDS75495.1	6q16.3	2013-02-22	2013-02-22	2007-01-09	ENSG00000186231	ENSG00000186231		"""Kelch-like"", ""BTB/POZ domain containing"""	21221	protein-coding gene	gene with protein product			"""BTB and kelch domain containing 5"", ""KIAA1900"", ""kelch-like 32 (Drosophila)"""	BKLHD5, KIAA1900			Standard	NM_052904		Approved		uc010kcm.1	Q96NJ5	OTTHUMG00000015247	ENST00000369261.4:c.695G>A	6.37:g.97561726G>A	ENSP00000358265:p.Arg232His	183.0	0.0		180.0	95.0	NM_052904	B7Z346|B7Z4E2|E1P528|Q5THT0|Q96PY7	Missense_Mutation	SNP	ENST00000369261.4	37	CCDS5038.1	.	.	.	.	.	.	.	.	.	.	G	16.47	3.132779	0.56828	.	.	ENSG00000186231	ENST00000369261;ENST00000536676;ENST00000539200	T;T;T	0.80738	-1.41;-1.41;-1.41	5.09	5.09	0.68999	BTB/Kelch-associated (2);	0.000000	0.85682	D	0.000000	D	0.89487	0.6729	M	0.85630	2.765	0.80722	D	1	D;D;P;D	0.89917	0.997;0.999;0.947;1.0	D;P;P;D	0.69307	0.916;0.903;0.606;0.963	D	0.90725	0.4638	10	0.87932	D	0	.	18.6745	0.91524	0.0:0.0:1.0:0.0	.	163;196;232;232	B7Z4E2;B7Z346;Q96NJ5;Q6IQ08	.;.;KLH32_HUMAN;.	H	232;196;163	ENSP00000358265:R232H;ENSP00000440382:R196H;ENSP00000441527:R163H	ENSP00000358265:R232H	R	+	2	0	KLHL32	97668447	1.000000	0.71417	1.000000	0.80357	0.721000	0.41392	9.229000	0.95273	2.632000	0.89209	0.655000	0.94253	CGC	.		0.532	KLHL32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041570.1	NM_052904	
MLLT10	8028	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	21901356	21901356	+	Missense_Mutation	SNP	G	G	T			TCGA-PD-A5DF-01A-11D-A27I-10	TCGA-PD-A5DF-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f1a4f60a-5228-47cd-883f-ff8d2dfe1633	ce137c9c-43df-49e8-82f8-3530d13eecfd	g.chr10:21901356G>T	ENST00000307729.7	+	6	663	c.485G>T	c.(484-486)tGt>tTt	p.C162F	MLLT10_ENST00000377072.3_Missense_Mutation_p.C162F|MLLT10_ENST00000377059.3_Missense_Mutation_p.C162F|MLLT10_ENST00000446906.2_Missense_Mutation_p.C162F|MLLT10_ENST00000495130.1_3'UTR			P55197	AF10_HUMAN	myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 10	162	Interaction with FSTL3.|Self-association.				positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			NS(1)|large_intestine(2)|lung(1)|skin(1)|upper_aerodigestive_tract(1)	6						AAACATGGATGTCGACAGGCT	0.373			T	"""MLL, PICALM, CDK6"""	AL																																p.C162F		.		Dom	yes		10	10p12	8028	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 10 (AF10)"""		L	.	MLLT10	658	0			c.G485T						.						116.0	103.0	107.0					10																	21901356		2203	4300	6503	SO:0001583	missense	8028	exon5			ATGGATGTCGACA	U13948	CCDS7135.1, CCDS55706.1, CCDS55707.1, CCDS55708.1	10p12	2013-01-28	2001-11-28		ENSG00000078403	ENSG00000078403		"""Zinc fingers, PHD-type"""	16063	protein-coding gene	gene with protein product		602409	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog); translocated to, 10"""			7888665	Standard	NM_004641		Approved	AF10	uc021pny.1	P55197	OTTHUMG00000017799	ENST00000307729.7:c.485G>T	10.37:g.21901356G>T	ENSP00000307411:p.Cys162Phe	50.0	0.0		48.0	20.0	NM_001195626	B1ANA8|Q5JT37|Q5VX90|Q66K63	Missense_Mutation	SNP	ENST00000307729.7	37	CCDS55708.1	.	.	.	.	.	.	.	.	.	.	G	32	5.162787	0.94727	.	.	ENSG00000078403	ENST00000377072;ENST00000446906;ENST00000307729;ENST00000396529;ENST00000377059	T;T;T;T	0.53206	0.63;0.63;0.63;0.63	5.98	5.98	0.97165	Zinc finger, PHD-finger (1);Zinc finger, PHD-type (1);	0.000000	0.85682	D	0.000000	D	0.83640	0.5298	H	0.99249	4.485	0.80722	D	1	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.87578	0.998;0.998;0.998	D	0.89840	0.4002	10	0.87932	D	0	.	20.4434	0.99119	0.0:0.0:1.0:0.0	.	162;162;162	E9PBP4;Q5VX90;P55197	.;.;AF10_HUMAN	F	162;162;162;8;162	ENSP00000366272:C162F;ENSP00000401406:C162F;ENSP00000307411:C162F;ENSP00000366258:C162F	ENSP00000307411:C162F	C	+	2	0	MLLT10	21941362	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.869000	0.99810	2.838000	0.97847	0.655000	0.94253	TGT	.		0.373	MLLT10-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047136.1		
LINC00619	414260	bcgsc.ca;mdanderson.org	37	10	44340850	44340850	+	lincRNA	SNP	C	C	T			TCGA-PD-A5DF-01A-11D-A27I-10	TCGA-PD-A5DF-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_1	WXS	none	.		Illumina HiSeq	f1a4f60a-5228-47cd-883f-ff8d2dfe1633	ce137c9c-43df-49e8-82f8-3530d13eecfd	g.chr10:44340850C>T	ENST00000374432.3	+	0	97					NR_033923.1				long intergenic non-protein coding RNA 619																		CGGACCTCTCCTCCAGGTACT	0.637																																					.		.											.	.	.	0			.						.																																					414260	.			CCTCTCCTCCAGG	BC017939		10q11.21	2012-10-12	2012-07-12	2012-07-12	ENSG00000204187	ENSG00000204187		"""Long non-coding RNAs"""	31657	non-coding RNA	RNA, long non-coding			"""chromosome 10 open reading frame 136"""	C10orf136			Standard	NR_033923		Approved	bA168P8.1	uc021ppi.1		OTTHUMG00000018048		10.37:g.44340850C>T		146.0	0.0		205.0	74.0	.		RNA	SNP	ENST00000374432.3	37																																																																																				.		0.637	LINC00619-001	KNOWN	basic|exp_conf	lincRNA	lincRNA	OTTHUMT00000047731.2	NR_033923	
MTERF1	7978	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	7	91503047	91503053	+	Frame_Shift_Del	DEL	GAATCCA	GAATCCA	-	rs138162673		TCGA-PD-A5DF-01A-11D-A27I-10	TCGA-PD-A5DF-10A-01D-A27I-10	GAATCCA	GAATCCA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f1a4f60a-5228-47cd-883f-ff8d2dfe1633	ce137c9c-43df-49e8-82f8-3530d13eecfd	g.chr7:91503047_91503053delGAATCCA	ENST00000351870.3	-	3	1148_1154	c.1055_1061delTGGATTC	c.(1054-1062)ctggattcafs	p.LDS352fs	MTERF_ENST00000406735.2_Frame_Shift_Del_p.LDS332fs|MTERF_ENST00000419292.1_Frame_Shift_Del_p.LDS332fs	NM_006980.3	NP_008911.1	Q99551	MTEF1_HUMAN		352					DNA geometric change (GO:0032392)|DNA-templated transcription, termination (GO:0006353)|gene expression (GO:0010467)|regulation of transcription, DNA-templated (GO:0006355)|termination of mitochondrial transcription (GO:0006393)|transcription from mitochondrial promoter (GO:0006390)	mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)	double-stranded DNA binding (GO:0003690)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(4)|liver(1)|lung(2)|skin(1)	14	all_cancers(62;2.28e-09)|all_epithelial(64;1.07e-07)|Breast(17;0.00371)|all_hematologic(106;0.091)|all_lung(186;0.178)|Lung NSC(181;0.235)		STAD - Stomach adenocarcinoma(171;6.16e-05)|Lung(22;0.0993)|Kidney(17;0.118)|Epithelial(20;0.136)|LUSC - Lung squamous cell carcinoma(200;0.176)			ACTTATGCTTGAATCCAGAACCCGAGG	0.333																																					p.352_354del		.											.	MTERF	90	0			c.1055_1061del						.																																			SO:0001589	frameshift_variant	7978	exon3			ATGCTTGAATCCA																												ENST00000351870.3:c.1055_1061delTGGATTC	7.37:g.91503047_91503053delGAATCCA	ENSP00000248643:p.Leu352fs	75.0	0.0		72.0	11.0	NM_006980	A4D1E3|Q32NF8|Q53H51|Q9BVR7	Frame_Shift_Del	DEL	ENST00000351870.3	37	CCDS5621.1																																																																																			.		0.333	MTERF-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000342896.1		
NLE1	54475	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	33467033	33467033	+	Missense_Mutation	SNP	G	G	A			TCGA-PD-A5DF-01A-11D-A27I-10	TCGA-PD-A5DF-10A-01D-A27I-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f1a4f60a-5228-47cd-883f-ff8d2dfe1633	ce137c9c-43df-49e8-82f8-3530d13eecfd	g.chr17:33467033G>A	ENST00000442241.4	-	3	254	c.215C>T	c.(214-216)tCa>tTa	p.S72L	NLE1_ENST00000593176.1_5'UTR|NLE1_ENST00000360831.5_Missense_Mutation_p.S72L|NLE1_ENST00000586869.1_5'UTR	NM_001014445.1|NM_018096.3	NP_001014445.1|NP_060566.2	Q9NVX2	NLE1_HUMAN	notchless homolog 1 (Drosophila)	72					hematopoietic stem cell homeostasis (GO:0061484)|inner cell mass cell differentiation (GO:0001826)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic signaling pathway (GO:2001268)|negative regulation of mitotic cell cycle (GO:0045930)|Notch signaling pathway (GO:0007219)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|ribosomal large subunit biogenesis (GO:0042273)	nucleolus (GO:0005730)|nucleus (GO:0005634)				NS(1)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(4)|ovary(1)|prostate(2)	22		Ovarian(249;0.17)				CTTCCCCAGTGAGGAGACGAT	0.552																																					p.S72L		.											.	NLE1	290	0			c.C215T						.						92.0	75.0	81.0					17																	33467033		2203	4300	6503	SO:0001583	missense	54475	exon3			CCCAGTGAGGAGA		CCDS11291.1, CCDS45647.1	17q12	2013-01-10		2005-08-09	ENSG00000073536	ENSG00000073536		"""WD repeat domain containing"""	19889	protein-coding gene	gene with protein product	"""Notchless gene homolog, (Drosophila)"""						Standard	XM_005257989		Approved	FLJ10458	uc002hiy.1	Q9NVX2	OTTHUMG00000132928	ENST00000442241.4:c.215C>T	17.37:g.33467033G>A	ENSP00000413572:p.Ser72Leu	175.0	1.0		288.0	94.0	NM_018096	O60868|Q59GJ8|Q9BU54	Missense_Mutation	SNP	ENST00000442241.4	37	CCDS11291.1	.	.	.	.	.	.	.	.	.	.	G	20.7	4.026867	0.75390	.	.	ENSG00000073536	ENST00000442241;ENST00000537697	T	0.59083	0.29	5.22	5.22	0.72569	NLE (1);	0.113791	0.64402	D	0.000011	T	0.74435	0.3716	M	0.82517	2.595	0.80722	D	1	D	0.57571	0.98	P	0.58130	0.833	T	0.78016	-0.2369	10	0.62326	D	0.03	-9.8751	16.3212	0.82951	0.0:0.0:1.0:0.0	.	72	Q9NVX2	NLE1_HUMAN	L	72	ENSP00000413572:S72L	ENSP00000413572:S72L	S	-	2	0	NLE1	30491146	1.000000	0.71417	0.861000	0.33841	0.701000	0.40568	6.822000	0.75277	2.732000	0.93576	0.650000	0.86243	TCA	.		0.552	NLE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256441.2	NM_018096	
NME5	8382	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	137465065	137465065	+	Missense_Mutation	SNP	C	C	T			TCGA-PD-A5DF-01A-11D-A27I-10	TCGA-PD-A5DF-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f1a4f60a-5228-47cd-883f-ff8d2dfe1633	ce137c9c-43df-49e8-82f8-3530d13eecfd	g.chr5:137465065C>T	ENST00000265191.2	-	3	271	c.222G>A	c.(220-222)atG>atA	p.M74I	NME5_ENST00000508252.1_5'UTR	NM_003551.2	NP_003542.1	P56597	NDK5_HUMAN	NME/NM23 family member 5	74					cilium assembly (GO:0042384)|CTP biosynthetic process (GO:0006241)|epithelial cilium movement (GO:0003351)|GTP biosynthetic process (GO:0006183)|negative regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902176)|nucleoside metabolic process (GO:0009116)|spermatid development (GO:0007286)|spermatogenesis (GO:0007283)|UTP biosynthetic process (GO:0006228)|ventricular system development (GO:0021591)	sperm flagellum (GO:0036126)	ATP binding (GO:0005524)|nucleoside diphosphate kinase activity (GO:0004550)			kidney(1)|large_intestine(1)|lung(2)|skin(1)	5			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0109)			GTCCAGAACTCATGTAAGCTG	0.378																																					p.M74I		.											.	NME5	115	0			c.G222A						.						136.0	128.0	131.0					5																	137465065		2203	4300	6503	SO:0001583	missense	8382	exon3			AGAACTCATGTAA	Y14992	CCDS4197.1	5q31.2	2012-05-18	2012-05-18		ENSG00000112981	ENSG00000112981			7853	protein-coding gene	gene with protein product	"""radial spoke 23 homolog (Chlamydomonas)"""	603575	"""non-metastatic cells 5, protein expressed in (nucleoside-diphosphate kinase)"""			9742940, 19852809	Standard	NM_003551		Approved	nm23-H5, RSPH23	uc003lce.3	P56597	OTTHUMG00000129207	ENST00000265191.2:c.222G>A	5.37:g.137465065C>T	ENSP00000265191:p.Met74Ile	144.0	0.0		135.0	41.0	NM_003551	B2R5G7	Missense_Mutation	SNP	ENST00000265191.2	37	CCDS4197.1	.	.	.	.	.	.	.	.	.	.	C	31	5.074894	0.94000	.	.	ENSG00000112981	ENST00000265191	T	0.54071	0.59	5.55	5.55	0.83447	.	0.000000	0.85682	D	0.000000	T	0.61035	0.2315	L	0.42686	1.345	0.58432	D	0.999999	P	0.43578	0.811	P	0.52646	0.705	T	0.56733	-0.7930	10	0.39692	T	0.17	.	19.5106	0.95140	0.0:1.0:0.0:0.0	.	74	P56597	NDK5_HUMAN	I	74	ENSP00000265191:M74I	ENSP00000265191:M74I	M	-	3	0	NME5	137492964	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	7.743000	0.85020	2.600000	0.87896	0.655000	0.94253	ATG	.		0.378	NME5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251286.1	NM_003551	
NOTCH2NL	388677	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	1	145281614	145281614	+	Silent	SNP	C	C	T			TCGA-PD-A5DF-01A-11D-A27I-10	TCGA-PD-A5DF-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f1a4f60a-5228-47cd-883f-ff8d2dfe1633	ce137c9c-43df-49e8-82f8-3530d13eecfd	g.chr1:145281614C>T	ENST00000369340.3	+	5	988	c.544C>T	c.(544-546)Ctg>Ttg	p.L182L	NOTCH2NL_ENST00000344859.3_Silent_p.L182L|RP11-458D21.5_ENST00000468030.1_Silent_p.L182L|NOTCH2NL_ENST00000362074.6_Silent_p.L182L			Q7Z3S9	NT2NL_HUMAN	notch 2 N-terminal like	182	EGF-like 6. {ECO:0000255|PROSITE- ProRule:PRU00076}.				cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|Notch signaling pathway (GO:0007219)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)	calcium ion binding (GO:0005509)			NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(10)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	27						CTGTGACAGCCTGTATGTGCC	0.577																																					p.L182L		.											.	NOTCH2NL	211	0			c.C544T						.						176.0	177.0	176.0					1																	145281614		2203	4300	6503	SO:0001819	synonymous_variant	388677	exon4			GACAGCCTGTATG		CCDS72880.1	1q21.2	2010-06-24	2010-06-24		ENSG00000213240	ENSG00000213240			31862	protein-coding gene	gene with protein product			"""Notch homolog 2 (Drosophila) N-terminal like"""			14673143	Standard	NM_203458		Approved	N2N	uc001emn.4	Q7Z3S9	OTTHUMG00000013754	ENST00000369340.3:c.544C>T	1.37:g.145281614C>T		1284.0	1.0		2183.0	249.0	NM_203458	Q5BKT8|Q5VTG9|Q5XG84|Q6P192|Q8NC23|Q8WUQ9|Q96FY1	Silent	SNP	ENST00000369340.3	37	CCDS909.1																																																																																			.		0.577	NOTCH2NL-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000038546.1	NM_203458	
OR51B6	390058	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	5372775	5372775	+	Missense_Mutation	SNP	C	C	T			TCGA-PD-A5DF-01A-11D-A27I-10	TCGA-PD-A5DF-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f1a4f60a-5228-47cd-883f-ff8d2dfe1633	ce137c9c-43df-49e8-82f8-3530d13eecfd	g.chr11:5372775C>T	ENST00000380219.1	+	1	38	c.38C>T	c.(37-39)aCt>aTt	p.T13I	HBG2_ENST00000380252.1_Intron|AC104389.28_ENST00000415970.1_RNA|HBG2_ENST00000380259.2_Intron|HBE1_ENST00000380237.1_Intron	NM_001004750.1	NP_001004750.1	Q9H340	O51B6_HUMAN	olfactory receptor, family 51, subfamily B, member 6	13					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(3)|large_intestine(3)|lung(10)|ovary(1)|skin(2)|urinary_tract(1)	21		Medulloblastoma(188;0.0075)|all_neural(188;0.0572)|Breast(177;0.0675)		Epithelial(150;2.9e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		TTCCAGCTTACTGGCTTCCCA	0.443																																					p.T13I		.											.	OR51B6	70	0			c.C38T						.						91.0	77.0	82.0					11																	5372775		2201	4297	6498	SO:0001583	missense	390058	exon1			AGCTTACTGGCTT		CCDS31379.1	11p15.4	2012-08-09			ENSG00000176239	ENSG00000176239		"""GPCR / Class A : Olfactory receptors"""	19600	protein-coding gene	gene with protein product							Standard	NM_001004750		Approved		uc010qzb.2	Q9H340	OTTHUMG00000066669	ENST00000380219.1:c.38C>T	11.37:g.5372775C>T	ENSP00000369568:p.Thr13Ile	148.0	0.0		229.0	87.0	NM_001004750		Missense_Mutation	SNP	ENST00000380219.1	37	CCDS31379.1	.	.	.	.	.	.	.	.	.	.	C	15.10	2.733416	0.48939	.	.	ENSG00000176239	ENST00000537299;ENST00000380219	T	0.00289	8.28	4.93	4.93	0.64822	.	0.420400	0.20173	N	0.097698	T	0.00412	0.0013	L	0.58510	1.815	0.27040	N	0.964047	D	0.59357	0.985	P	0.61070	0.883	T	0.55134	-0.8188	10	0.46703	T	0.11	.	6.9526	0.24554	0.0:0.7309:0.1775:0.0916	.	13	Q9H340	O51B6_HUMAN	I	12;13	ENSP00000369568:T13I	ENSP00000369568:T13I	T	+	2	0	OR51B6	5329351	0.018000	0.18449	0.991000	0.47740	0.823000	0.46562	0.948000	0.29096	2.554000	0.86153	0.557000	0.71058	ACT	.		0.443	OR51B6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142960.1	NM_001004750	
OVCH1	341350	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	29626033	29626033	+	Missense_Mutation	SNP	G	G	A			TCGA-PD-A5DF-01A-11D-A27I-10	TCGA-PD-A5DF-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f1a4f60a-5228-47cd-883f-ff8d2dfe1633	ce137c9c-43df-49e8-82f8-3530d13eecfd	g.chr12:29626033G>A	ENST00000318184.5	-	15	1603	c.1604C>T	c.(1603-1605)tCt>tTt	p.S535F	OVCH1-AS1_ENST00000549411.1_Intron|OVCH1-AS1_ENST00000551108.1_Intron	NM_183378.2	NP_899234.2	Q7RTY7	OVCH1_HUMAN	ovochymase 1	535						extracellular region (GO:0005576)	metal ion binding (GO:0046872)|serine-type endopeptidase activity (GO:0004252)			NS(2)|breast(4)|central_nervous_system(3)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(15)|lung(43)|ovary(5)|pancreas(3)|prostate(2)|skin(1)|soft_tissue(1)|stomach(3)	92	Lung NSC(12;1.84e-09)|Acute lymphoblastic leukemia(23;0.00885)|all_hematologic(23;0.0155)					TTTGTTTAAAGACTCTGTAGA	0.348																																					p.S535F		.											.	OVCH1	210	0			c.C1604T						.						86.0	81.0	82.0					12																	29626033		1818	4077	5895	SO:0001583	missense	341350	exon15			TTTAAAGACTCTG	BN000128		12p11.23	2012-11-08			ENSG00000187950	ENSG00000187950			23080	protein-coding gene	gene with protein product						12838346	Standard	NM_183378		Approved	OVCH	uc001rix.1	Q7RTY7	OTTHUMG00000167741	ENST00000318184.5:c.1604C>T	12.37:g.29626033G>A	ENSP00000326708:p.Ser535Phe	63.0	0.0		51.0	17.0	NM_183378		Missense_Mutation	SNP	ENST00000318184.5	37		.	.	.	.	.	.	.	.	.	.	G	9.533	1.111348	0.20714	.	.	ENSG00000187950	ENST00000318184	D	0.87103	-2.21	2.46	-1.93	0.07594	.	.	.	.	.	T	0.69450	0.3112	N	0.08118	0	0.09310	N	1	B	0.15930	0.015	B	0.14578	0.011	T	0.55211	-0.8176	9	0.45353	T	0.12	.	3.8777	0.09064	0.2632:0.3973:0.3395:0.0	.	535	Q7RTY7	OVCH1_HUMAN	F	535	ENSP00000326708:S535F	ENSP00000326708:S535F	S	-	2	0	OVCH1	29517300	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.268000	0.08607	-0.516000	0.06470	-0.176000	0.13171	TCT	.		0.348	OVCH1-001	KNOWN	non_canonical_TEC|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000395997.2	NM_183378	
PIK3R1	5295	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	5	67591127	67591129	+	In_Frame_Del	DEL	AGA	AGA	-			TCGA-PD-A5DF-01A-11D-A27I-10	TCGA-PD-A5DF-10A-01D-A27I-10	AGA	AGA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f1a4f60a-5228-47cd-883f-ff8d2dfe1633	ce137c9c-43df-49e8-82f8-3530d13eecfd	g.chr5:67591127_67591129delAGA	ENST00000521381.1	+	13	2336_2338	c.1720_1722delAGA	c.(1720-1722)agadel	p.R574del	PIK3R1_ENST00000320694.8_In_Frame_Del_p.R274del|PIK3R1_ENST00000521657.1_In_Frame_Del_p.R574del|PIK3R1_ENST00000274335.5_In_Frame_Del_p.R574del|PIK3R1_ENST00000523872.1_In_Frame_Del_p.R211del|PIK3R1_ENST00000396611.1_In_Frame_Del_p.R574del|PIK3R1_ENST00000336483.5_In_Frame_Del_p.R304del	NM_181523.2	NP_852664.1	P27986	P85A_HUMAN	phosphoinositide-3-kinase, regulatory subunit 1 (alpha)	574					B cell differentiation (GO:0030183)|blood coagulation (GO:0007596)|cellular response to UV (GO:0034644)|epidermal growth factor receptor signaling pathway (GO:0007173)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|growth hormone receptor signaling pathway (GO:0060396)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin-like growth factor receptor signaling pathway (GO:0048009)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|leukocyte migration (GO:0050900)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of osteoclast differentiation (GO:0045671)|neurotrophin TRK receptor signaling pathway (GO:0048011)|NFAT protein import into nucleus (GO:0051531)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of cell migration (GO:0030335)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of glucose import (GO:0046326)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|protein phosphorylation (GO:0006468)|regulation of phosphatidylinositol 3-kinase activity (GO:0043551)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|viral process (GO:0016032)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|membrane (GO:0016020)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	ErbB-3 class receptor binding (GO:0043125)|insulin binding (GO:0043559)|insulin receptor binding (GO:0005158)|insulin receptor substrate binding (GO:0043560)|insulin-like growth factor receptor binding (GO:0005159)|neurotrophin TRKA receptor binding (GO:0005168)|phosphatidylinositol 3-kinase binding (GO:0043548)|phosphatidylinositol 3-kinase regulator activity (GO:0035014)|protein phosphatase binding (GO:0019903)|transmembrane receptor protein tyrosine kinase adaptor activity (GO:0005068)	p.R574_T576del(2)|p.R574T(2)|p.R574I(1)|p.R574fs*27(1)|p.0?(1)|p.?(1)|p.L570_D578del(1)		breast(12)|central_nervous_system(31)|cervix(1)|endometrium(68)|haematopoietic_and_lymphoid_tissue(5)|kidney(1)|large_intestine(32)|lung(10)|ovary(9)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	178		Lung NSC(167;1.99e-05)|Prostate(74;0.00308)|Ovarian(174;0.00473)|Colorectal(97;0.0176)		OV - Ovarian serous cystadenocarcinoma(47;3.76e-51)|Lung(70;0.0211)	Isoprenaline(DB01064)	TATCCAGCTGAGAAAGACGAGAG	0.379			"""Mis, F, O"""		"""gliobastoma, ovarian, colorectal"""					TCGA GBM(4;<1E-08)																											p.574_574del		.		Rec	yes		5	5q13.1	5295	"""phosphoinositide-3-kinase, regulatory subunit 1 (alpha)"""		"""E, O"""	PIK3R1,bladder,carcinoma,-1	PIK3R1	4332	9	Substitution - Missense(3)|Deletion - In frame(3)|Whole gene deletion(1)|Deletion - Frameshift(1)|Unknown(1)	large_intestine(2)|endometrium(2)|central_nervous_system(1)|urinary_tract(1)|lung(1)|breast(1)|ovary(1)	c.1720_1722del						.																																			SO:0001651	inframe_deletion	5295	exon13			CAGCTGAGAAAGA	M61906	CCDS3993.1, CCDS3994.1, CCDS3995.1, CCDS56374.1	5q13.1	2014-09-17	2008-02-04		ENSG00000145675	ENSG00000145675		"""SH2 domain containing"""	8979	protein-coding gene	gene with protein product		171833				1314371, 18387942	Standard	NM_181524		Approved	GRB1, p85-ALPHA, p85	uc003jva.3	P27986	OTTHUMG00000131251	ENST00000521381.1:c.1720_1722delAGA	5.37:g.67591127_67591129delAGA	ENSP00000428056:p.Arg574del	101.0	0.0		108.0	65.0	NM_181523	B3KT19|D3DWA0|E7EX19|Q15747|Q4VBZ7|Q53EM6|Q8IXA2|Q8N1C5	In_Frame_Del	DEL	ENST00000521381.1	37	CCDS3993.1																																																																																			.		0.379	PIK3R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254013.2	NM_181504	
PLEKHA4	57664	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	49364729	49364729	+	Missense_Mutation	SNP	C	C	T	rs369244059		TCGA-PD-A5DF-01A-11D-A27I-10	TCGA-PD-A5DF-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f1a4f60a-5228-47cd-883f-ff8d2dfe1633	ce137c9c-43df-49e8-82f8-3530d13eecfd	g.chr19:49364729C>T	ENST00000263265.6	-	5	850	c.295G>A	c.(295-297)Gtc>Atc	p.V99I	PLEKHA4_ENST00000596713.1_5'Flank|PLEKHA4_ENST00000355496.5_Missense_Mutation_p.V99I	NM_020904.2	NP_065955.2	Q9H4M7	PKHA4_HUMAN	pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 4	99	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.					cytoplasm (GO:0005737)|membrane (GO:0016020)	1-phosphatidylinositol binding (GO:0005545)			NS(1)|breast(5)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(5)|ovary(1)|prostate(3)|skin(2)|urinary_tract(2)	30		all_lung(116;4.89e-05)|Lung NSC(112;8.3e-05)|all_epithelial(76;0.000108)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.00027)|all cancers(93;0.00084)|GBM - Glioblastoma multiforme(486;0.0244)|Epithelial(262;0.0364)		GGGAGCAGGACGCTGCCTAGG	0.602																																					p.V99I		.											.	PLEKHA4	227	0			c.G295A						.		ILE/VAL,ILE/VAL	0,4406		0,0,2203	45.0	55.0	51.0		295,295	4.6	1.0	19		51	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	PLEKHA4	NM_001161354.1,NM_020904.2	29,29	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	possibly-damaging,possibly-damaging	99/584,99/780	49364729	1,13005	2203	4300	6503	SO:0001583	missense	57664	exon5			GCAGGACGCTGCC	AY007233	CCDS12737.1, CCDS54291.1	19q13.33	2013-01-10	2002-01-14			ENSG00000105559		"""Pleckstrin homology (PH) domain containing"""	14339	protein-coding gene	gene with protein product		607769	"""pleckstrin homology domain-containing, family A (phosphoinositide binding specific) member 4"""			11001876	Standard	NM_020904		Approved	PEPP1	uc002pkx.3	Q9H4M7		ENST00000263265.6:c.295G>A	19.37:g.49364729C>T	ENSP00000263265:p.Val99Ile	22.0	0.0		36.0	10.0	NM_001161354	Q8N4M8|Q8N658	Missense_Mutation	SNP	ENST00000263265.6	37	CCDS12737.1	.	.	.	.	.	.	.	.	.	.	c	10.34	1.321866	0.23994	0.0	1.16E-4	ENSG00000105559	ENST00000263265;ENST00000355496	T;T	0.64438	-0.1;-0.1	4.56	4.56	0.56223	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.075469	0.49916	D	0.000128	T	0.31295	0.0792	N	0.00224	-1.81	0.34981	D	0.754097	P;P	0.44627	0.839;0.476	P;P	0.51777	0.484;0.679	T	0.46020	-0.9221	10	0.15499	T	0.54	.	8.7517	0.34620	0.0:0.8987:0.0:0.1013	.	99;99	Q9H4M7-2;Q9H4M7	.;PKHA4_HUMAN	I	99	ENSP00000263265:V99I;ENSP00000347683:V99I	ENSP00000263265:V99I	V	-	1	0	PLEKHA4	54056541	1.000000	0.71417	0.998000	0.56505	0.945000	0.59286	3.633000	0.54295	2.548000	0.85928	0.457000	0.33378	GTC	.		0.602	PLEKHA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466216.1		
POTEH	23784	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	22	16287641	16287641	+	Missense_Mutation	SNP	G	G	A			TCGA-PD-A5DF-01A-11D-A27I-10	TCGA-PD-A5DF-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f1a4f60a-5228-47cd-883f-ff8d2dfe1633	ce137c9c-43df-49e8-82f8-3530d13eecfd	g.chr22:16287641G>A	ENST00000343518.6	-	1	296	c.245C>T	c.(244-246)aCt>aTt	p.T82I		NM_001136213.1	NP_001129685.1	Q6S545	POTEH_HUMAN	POTE ankyrin domain family, member H	82										NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|lung(20)|ovary(1)|skin(7)|urinary_tract(2)	37						GTCTCCAGAAGTGCCCACGTT	0.597																																					p.T82I		.											.	POTEH	1	0			c.C245T						.																																			SO:0001583	missense	23784	exon1			CCAGAAGTGCCCA	AY462874	CCDS74808.1	22q11.1	2013-01-10	2008-11-26	2008-11-26	ENSG00000198062	ENSG00000198062		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	133	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 7"""	608913	"""actin, beta-like 1"", ""ANKRD26-like family C, member 3"""	ACTBL1, A26C3		10591208, 15276201, 21439273	Standard	NM_001136213		Approved	POTE22, CT104.7	uc010gqp.2	Q6S545	OTTHUMG00000140314	ENST00000343518.6:c.245C>T	22.37:g.16287641G>A	ENSP00000340610:p.Thr82Ile	368.0	0.0		550.0	152.0	NM_001136213	A2CEK4|A6NCI1|A9Z1W0	Missense_Mutation	SNP	ENST00000343518.6	37	CCDS46658.1	.	.	.	.	.	.	.	.	.	.	.	8.790	0.930427	0.18131	.	.	ENSG00000198062	ENST00000343518;ENST00000355872	T	0.32753	1.44	.	.	.	.	.	.	.	.	T	0.22399	0.0540	L	0.43152	1.355	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.22695	-1.0209	7	0.37606	T	0.19	.	.	.	.	.	82	Q6S545	POTEH_HUMAN	I	82	ENSP00000340610:T82I	ENSP00000340610:T82I	T	-	2	0	POTEH	14667641	0.002000	0.14202	0.024000	0.17045	0.024000	0.10985	0.327000	0.19663	0.149000	0.19098	0.152000	0.16155	ACT	.		0.597	POTEH-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000276918.4	NM_001136213	
PPP1R1B	84152	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	37792089	37792089	+	Missense_Mutation	SNP	C	C	T			TCGA-PD-A5DF-01A-11D-A27I-10	TCGA-PD-A5DF-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f1a4f60a-5228-47cd-883f-ff8d2dfe1633	ce137c9c-43df-49e8-82f8-3530d13eecfd	g.chr17:37792089C>T	ENST00000254079.4	+	7	1055	c.586C>T	c.(586-588)Cgc>Tgc	p.R196C	STARD3_ENST00000580611.1_5'Flank|PPP1R1B_ENST00000580825.1_Missense_Mutation_p.R196C|PPP1R1B_ENST00000394265.1_Missense_Mutation_p.R160C|PPP1R1B_ENST00000579000.1_Missense_Mutation_p.R163C|STARD3_ENST00000394250.4_5'Flank|STARD3_ENST00000336308.5_5'Flank|PPP1R1B_ENST00000394267.2_Missense_Mutation_p.R160C|STARD3_ENST00000544210.2_5'Flank	NM_032192.3	NP_115568.2	Q9UD71	PPR1B_HUMAN	protein phosphatase 1, regulatory (inhibitor) subunit 1B	196					intracellular signal transduction (GO:0035556)|negative regulation of catalytic activity (GO:0043086)|negative regulation of female receptivity (GO:0007621)|negative regulation of protein kinase activity (GO:0006469)|regulation of catalytic activity (GO:0050790)|response to amphetamine (GO:0001975)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)|visual learning (GO:0008542)	cytosol (GO:0005829)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)	protein kinase inhibitor activity (GO:0004860)|protein phosphatase inhibitor activity (GO:0004864)|protein phosphatase type 1 regulator activity (GO:0008599)			kidney(1)|large_intestine(1)|liver(1)|lung(2)	5	Lung NSC(9;1.15e-09)|all_lung(9;6.24e-09)|Colorectal(19;0.000442)|Esophageal squamous(10;0.052)		UCEC - Uterine corpus endometrioid carcinoma (11;0.000126)|BRCA - Breast invasive adenocarcinoma(8;1.04e-44)|Lung(15;0.00193)|LUAD - Lung adenocarcinoma(14;0.0664)|LUSC - Lung squamous cell carcinoma(15;0.171)			GGAACCTCAGCGCCCTTCCCC	0.632																																					p.R196C		.											.	PPP1R1B	658	0			c.C586T						.						47.0	45.0	46.0					17																	37792089		2203	4300	6503	SO:0001583	missense	84152	exon7			CCTCAGCGCCCTT	AI124650	CCDS11339.1, CCDS11340.1	17q12	2012-04-17	2008-07-31		ENSG00000131771	ENSG00000131771	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	9287	protein-coding gene	gene with protein product	"""dopamine and cAMP regulated phosphoprotein"""	604399				8120638	Standard	NM_032192		Approved	DARPP-32, FLJ20940	uc002hrz.3	Q9UD71	OTTHUMG00000133210	ENST00000254079.4:c.586C>T	17.37:g.37792089C>T	ENSP00000254079:p.Arg196Cys	29.0	0.0		75.0	27.0	NM_032192	Q547V9|Q547W0|Q9H7G1	Missense_Mutation	SNP	ENST00000254079.4	37	CCDS11339.1	.	.	.	.	.	.	.	.	.	.	C	14.77	2.634286	0.47049	.	.	ENSG00000131771	ENST00000254079;ENST00000357165;ENST00000394271;ENST00000394267;ENST00000394265	T	0.48836	0.8	4.79	2.77	0.32553	.	0.877205	0.09779	N	0.756886	T	0.30572	0.0769	N	0.14661	0.345	0.31765	N	0.632832	B;B;B	0.06786	0.001;0.001;0.001	B;B;B	0.04013	0.001;0.001;0.001	T	0.31888	-0.9927	10	0.72032	D	0.01	-11.8428	7.3081	0.26459	0.0:0.7177:0.1885:0.0938	.	196;207;196	B3KVQ9;E7ENN5;Q9UD71	.;.;PPR1B_HUMAN	C	196;196;207;160;160	ENSP00000254079:R196C	ENSP00000254079:R196C	R	+	1	0	PPP1R1B	35045615	0.066000	0.20996	0.554000	0.28268	0.629000	0.37895	1.413000	0.34725	0.609000	0.30018	0.555000	0.69702	CGC	.		0.632	PPP1R1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256925.2	NM_032192	
PRICKLE2	166336	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	3	64148733	64148742	+	Frame_Shift_Del	DEL	TTCGCAGTTT	TTCGCAGTTT	-			TCGA-PD-A5DF-01A-11D-A27I-10	TCGA-PD-A5DF-10A-01D-A27I-10	TTCGCAGTTT	TTCGCAGTTT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f1a4f60a-5228-47cd-883f-ff8d2dfe1633	ce137c9c-43df-49e8-82f8-3530d13eecfd	g.chr3:64148733_64148742delTTCGCAGTTT	ENST00000295902.6	-	3	793_802	c.208_217delAAACTGCGAA	c.(208-219)aaactgcgaatcfs	p.KLRI70fs	PRICKLE2_ENST00000564377.1_Frame_Shift_Del_p.KLRI126fs	NM_198859.3	NP_942559.1	Q7Z3G6	PRIC2_HUMAN	prickle homolog 2 (Drosophila)	70	PET. {ECO:0000255|PROSITE- ProRule:PRU00636}.				establishment or maintenance of epithelial cell apical/basal polarity (GO:0045197)|neuron projection development (GO:0031175)	apicolateral plasma membrane (GO:0016327)|cytoplasm (GO:0005737)|lateral plasma membrane (GO:0016328)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)	p.R72*(1)		breast(2)|endometrium(1)|large_intestine(9)|liver(1)|lung(10)|ovary(4)|prostate(2)|skin(2)|stomach(1)	32		Lung NSC(201;0.136)		BRCA - Breast invasive adenocarcinoma(55;0.000971)|KIRC - Kidney renal clear cell carcinoma(15;0.00443)|Kidney(15;0.00497)		AGCTGCTTGATTCGCAGTTTCTCTCCAGGA	0.462																																					p.70_73del		.											.	PRICKLE2	95	1	Substitution - Nonsense(1)	stomach(1)	c.208_217del						.																																			SO:0001589	frameshift_variant	166336	exon3			GCTTGATTCGCAG	AK127839	CCDS2902.1	3p14.3	2006-09-12	2006-09-12		ENSG00000163637	ENSG00000163637			20340	protein-coding gene	gene with protein product		608501	"""prickle-like 2 (Drosophila)"""			12525887	Standard	NM_198859		Approved	DKFZp686D143	uc003dmf.3	Q7Z3G6	OTTHUMG00000158789	ENST00000295902.6:c.208_217delAAACTGCGAA	3.37:g.64148733_64148742delTTCGCAGTTT	ENSP00000295902:p.Lys70fs	121.0	0.0		156.0	34.0	NM_198859	Q0VF44	Frame_Shift_Del	DEL	ENST00000295902.6	37	CCDS2902.1																																																																																			.		0.462	PRICKLE2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000352219.1	NM_198859	
QRICH2	84074	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	17	74289942	74289954	+	Frame_Shift_Del	DEL	CCAGATCCTGATG	CCAGATCCTGATG	-			TCGA-PD-A5DF-01A-11D-A27I-10	TCGA-PD-A5DF-10A-01D-A27I-10	CCAGATCCTGATG	CCAGATCCTGATG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f1a4f60a-5228-47cd-883f-ff8d2dfe1633	ce137c9c-43df-49e8-82f8-3530d13eecfd	g.chr17:74289942_74289954delCCAGATCCTGATG	ENST00000262765.5	-	4	535_547	c.356_368delCATCAGGATCTGG	c.(355-369)gcatcaggatctggtfs	p.ASGSG119fs		NM_032134.1	NP_115510.1	Q9H0J4	QRIC2_HUMAN	glutamine rich 2	119										breast(3)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(6)|lung(17)|ovary(4)|pancreas(2)|prostate(3)|skin(2)|stomach(4)	62						TGCTGTGCCACCAGATCCTGATGCAGTCCGATC	0.563																																					p.119_123del		.											.	QRICH2	94	0			c.356_368del						.																																			SO:0001589	frameshift_variant	84074	exon4			GTGCCACCAGATC	AK058102	CCDS32741.1	17q25.1	2009-03-19			ENSG00000129646	ENSG00000129646			25326	protein-coding gene	gene with protein product							Standard	NM_032134		Approved	DKFZP434P0316	uc002jrd.1	Q9H0J4	OTTHUMG00000167578	ENST00000262765.5:c.356_368delCATCAGGATCTGG	17.37:g.74289942_74289954delCCAGATCCTGATG	ENSP00000262765:p.Ala119fs	76.0	0.0		115.0	22.0	NM_032134	A2RRE1|Q96LM3	Frame_Shift_Del	DEL	ENST00000262765.5	37	CCDS32741.1																																																																																			.		0.563	QRICH2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395140.1	NM_032134	
RFX6	222546	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	117237178	117237178	+	Missense_Mutation	SNP	C	C	T			TCGA-PD-A5DF-01A-11D-A27I-10	TCGA-PD-A5DF-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f1a4f60a-5228-47cd-883f-ff8d2dfe1633	ce137c9c-43df-49e8-82f8-3530d13eecfd	g.chr6:117237178C>T	ENST00000332958.2	+	8	804	c.788C>T	c.(787-789)aCg>aTg	p.T263M	RFX6_ENST00000471966.1_3'UTR	NM_173560.3	NP_775831.2	Q8HWS3	RFX6_HUMAN	regulatory factor X, 6	263					endocrine pancreas development (GO:0031018)|glucose homeostasis (GO:0042593)|pancreatic A cell differentiation (GO:0003310)|pancreatic D cell differentiation (GO:0003311)|pancreatic epsilon cell differentiation (GO:0090104)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of insulin secretion (GO:0050796)|transcription, DNA-templated (GO:0006351)|type B pancreatic cell differentiation (GO:0003309)	nucleus (GO:0005634)	transcription regulatory region DNA binding (GO:0044212)			cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(29)|ovary(1)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	59						TAGGTTGATACGCTCATAATG	0.333																																					p.T263M		.											.	RFX6	93	0			c.C788T						.						136.0	135.0	135.0					6																	117237178		2203	4300	6503	SO:0001583	missense	222546	exon8			TTGATACGCTCAT	BC039248	CCDS5113.1	6q22.31	2008-08-04	2008-08-04	2008-08-04	ENSG00000185002	ENSG00000185002			21478	protein-coding gene	gene with protein product		612659	"""regulatory factor X domain containing 1"""	RFXDC1			Standard	NM_173560		Approved	MGC33442, dJ955L16.1	uc003pxm.3	Q8HWS3	OTTHUMG00000015449	ENST00000332958.2:c.788C>T	6.37:g.117237178C>T	ENSP00000332208:p.Thr263Met	104.0	0.0		143.0	53.0	NM_173560	Q5T6B3	Missense_Mutation	SNP	ENST00000332958.2	37	CCDS5113.1	.	.	.	.	.	.	.	.	.	.	C	27.3	4.823219	0.90873	.	.	ENSG00000185002	ENST00000332958	T	0.59772	0.24	5.97	5.97	0.96955	.	0.050665	0.85682	D	0.000000	T	0.75428	0.3848	M	0.78049	2.395	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.76556	-0.2916	10	0.87932	D	0	-21.3208	20.4324	0.99085	0.0:1.0:0.0:0.0	.	263	Q8HWS3	RFX6_HUMAN	M	263	ENSP00000332208:T263M	ENSP00000332208:T263M	T	+	2	0	RFX6	117343871	1.000000	0.71417	0.998000	0.56505	0.981000	0.71138	7.487000	0.81328	2.833000	0.97629	0.585000	0.79938	ACG	.		0.333	RFX6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041970.2	NM_173560	
RMDN1	51115	hgsc.bcm.edu;broad.mit.edu;mdanderson.org	37	8	87520767	87520767	+	Nonsense_Mutation	SNP	G	G	T			TCGA-PD-A5DF-01A-11D-A27I-10	TCGA-PD-A5DF-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f1a4f60a-5228-47cd-883f-ff8d2dfe1633	ce137c9c-43df-49e8-82f8-3530d13eecfd	g.chr8:87520767G>T	ENST00000406452.3	-	1	242	c.83C>A	c.(82-84)tCg>tAg	p.S28*	RMDN1_ENST00000430676.2_Nonsense_Mutation_p.S28*|RMDN1_ENST00000518772.1_5'UTR|CPNE3_ENST00000198765.4_Intron|RMDN1_ENST00000519966.1_Nonsense_Mutation_p.S28*|RMDN1_ENST00000523911.1_Intron	NM_016033.2	NP_057117.2	Q96DB5	RMD1_HUMAN	regulator of microtubule dynamics 1	28						microtubule (GO:0005874)|mitochondrion (GO:0005739)											GCGGCTGCCCGAAGTCCCCGC	0.697																																					p.S28X		.											.	.	.	0			c.C83A						.						10.0	13.0	12.0					8																	87520767		2175	4257	6432	SO:0001587	stop_gained	51115	exon1			CTGCCCGAAGTCC	AK000672	CCDS34918.1, CCDS69509.1, CCDS69510.1	8q21.3	2013-01-11	2013-01-11	2013-01-11	ENSG00000176623	ENSG00000176623			24285	protein-coding gene	gene with protein product		611871	"""family with sequence similarity 82, member B"""	FAM82B		10810093	Standard	NM_016033		Approved	CGI-90, FLJ20665, RMD1	uc003ydu.3	Q96DB5	OTTHUMG00000163692	ENST00000406452.3:c.83C>A	8.37:g.87520767G>T	ENSP00000385927:p.Ser28*	20.0	0.0		9.0	5.0	NM_016033	A9UMZ8|B4DNF5|B4DZW6|B5MC61|C9JSC6|E7EVI2|Q9Y398	Nonsense_Mutation	SNP	ENST00000406452.3	37	CCDS34918.1	.	.	.	.	.	.	.	.	.	.	g	18.51	3.640460	0.67244	.	.	ENSG00000176623	ENST00000406452;ENST00000519966;ENST00000430676	.	.	.	3.87	0.886	0.19194	.	2.004110	0.02652	N	0.106541	.	.	.	.	.	.	0.09310	N	0.999993	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	3.7802	6.7219	0.23334	0.1135:0.2801:0.6065:0.0	.	.	.	.	X	28	.	ENSP00000385927:S28X	S	-	2	0	FAM82B	87589883	0.001000	0.12720	0.000000	0.03702	0.001000	0.01503	0.828000	0.27435	0.043000	0.15746	-0.119000	0.15052	TCG	.		0.697	RMDN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374770.2	NM_016033	
SLC47A1	55244	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	19452981	19452981	+	Silent	SNP	A	A	T			TCGA-PD-A5DF-01A-11D-A27I-10	TCGA-PD-A5DF-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f1a4f60a-5228-47cd-883f-ff8d2dfe1633	ce137c9c-43df-49e8-82f8-3530d13eecfd	g.chr17:19452981A>T	ENST00000270570.4	+	5	575	c.489A>T	c.(487-489)ccA>ccT	p.P163P	SLC47A1_ENST00000542886.1_Silent_p.P163P|SLC47A1_ENST00000584348.1_3'UTR|SLC47A1_ENST00000436810.2_Silent_p.P140P|SLC47A1_ENST00000575023.1_Silent_p.P163P|SLC47A1_ENST00000395585.1_Silent_p.P163P|SLC47A1_ENST00000457293.1_Silent_p.P163P|SLC47A1_ENST00000571335.1_Missense_Mutation_p.Q15L	NM_018242.2	NP_060712.2	Q96FL8	S47A1_HUMAN	solute carrier family 47 (multidrug and toxin extrusion), member 1	163					organic cation transport (GO:0015695)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|membrane-bounded vesicle (GO:0031988)|plasma membrane (GO:0005886)	drug transmembrane transporter activity (GO:0015238)|monovalent cation:proton antiporter activity (GO:0005451)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(4)|lung(5)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)	23	all_cancers(12;2.49e-05)|all_epithelial(12;0.00263)|Hepatocellular(7;0.00345)				Aciclovir(DB00787)|Bromodiphenhydramine(DB01237)|Cephalexin(DB00567)|Cimetidine(DB00501)|Metformin(DB00331)|Sirolimus(DB00877)	TCTTCATTCCAGCTCTTCCTG	0.463																																					p.P163P		.											.	SLC47A1	90	0			c.A489T						.						205.0	179.0	188.0					17																	19452981		2203	4300	6503	SO:0001819	synonymous_variant	55244	exon5			CATTCCAGCTCTT		CCDS11209.1	17p11.2	2013-07-17	2013-07-17		ENSG00000142494	ENSG00000142494		"""Solute carriers"""	25588	protein-coding gene	gene with protein product	"""multidrug and toxin extrusion 1"""	609832				16330770, 16996621, 16928787	Standard	NM_018242		Approved	FLJ10847, MATE1	uc002gvy.1	Q96FL8	OTTHUMG00000059466	ENST00000270570.4:c.489A>T	17.37:g.19452981A>T		94.0	0.0		102.0	65.0	NM_018242	Q53HF5|Q6PD77|Q86VL4|Q9NVA3	Silent	SNP	ENST00000270570.4	37	CCDS11209.1																																																																																			.		0.463	SLC47A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132250.1	NM_018242	
SNX9	51429	broad.mit.edu;bcgsc.ca	37	6	158296186	158296186	+	Missense_Mutation	SNP	C	C	T	rs374744867		TCGA-PD-A5DF-01A-11D-A27I-10	TCGA-PD-A5DF-10A-01D-A27I-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f1a4f60a-5228-47cd-883f-ff8d2dfe1633	ce137c9c-43df-49e8-82f8-3530d13eecfd	g.chr6:158296186C>T	ENST00000392185.3	+	4	449	c.278C>T	c.(277-279)tCg>tTg	p.S93L	RP11-52J3.2_ENST00000422776.1_RNA|RP11-52J3.2_ENST00000457427.1_RNA	NM_016224.3	NP_057308.1	Q9Y5X1	SNX9_HUMAN	sorting nexin 9	93					cleavage furrow formation (GO:0036089)|endocytosis (GO:0006897)|endosomal transport (GO:0016197)|intracellular protein transport (GO:0006886)|lipid tube assembly (GO:0060988)|mitotic cytokinesis (GO:0000281)|mitotic nuclear division (GO:0007067)|positive regulation of GTPase activity (GO:0043547)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)|positive regulation of protein oligomerization (GO:0032461)|receptor-mediated endocytosis (GO:0006898)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytoplasmic vesicle membrane (GO:0030659)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	1-phosphatidylinositol binding (GO:0005545)|protein homodimerization activity (GO:0042803)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(10)|skin(1)|upper_aerodigestive_tract(1)	20		Breast(66;0.000776)|Ovarian(120;0.0303)|Prostate(117;0.167)		OV - Ovarian serous cystadenocarcinoma(65;8.06e-18)|BRCA - Breast invasive adenocarcinoma(81;4.48e-05)		GCCAGTTCGTCGGCTGCCAGC	0.488																																					p.S93L		.											.	SNX9	226	0			c.C278T						.	C	LEU/SER	0,4406		0,0,2203	85.0	72.0	77.0		278	5.6	0.0	6		77	1,8599	1.2+/-3.3	0,1,4299	no	missense	SNX9	NM_016224.3	145	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	benign	93/596	158296186	1,13005	2203	4300	6503	SO:0001583	missense	51429	exon4			GTTCGTCGGCTGC	AF121859	CCDS5253.1	6q25.1-q26	2008-05-22			ENSG00000130340	ENSG00000130340		"""Sorting nexins"""	14973	protein-coding gene	gene with protein product		605952				10531379, 17609109	Standard	NM_016224		Approved	SH3PX1, SDP1, SH3PXD3A	uc003qqv.1	Q9Y5X1	OTTHUMG00000015903	ENST00000392185.3:c.278C>T	6.37:g.158296186C>T	ENSP00000376024:p.Ser93Leu	118.0	1.0		171.0	59.0	NM_016224	Q9BSI7|Q9BVM1|Q9UJH6|Q9UP20	Missense_Mutation	SNP	ENST00000392185.3	37	CCDS5253.1	.	.	.	.	.	.	.	.	.	.	C	8.150	0.787097	0.16189	0.0	1.16E-4	ENSG00000130340	ENST00000539592;ENST00000392185	T	0.48522	0.81	5.62	5.62	0.85841	.	7.051160	0.02245	U	0.066112	T	0.12646	0.0307	N	0.08118	0	0.38626	D	0.95126	B	0.33120	0.398	B	0.22880	0.042	T	0.14309	-1.0477	10	0.29301	T	0.29	-4.3729	12.1658	0.54129	0.1707:0.8293:0.0:0.0	.	93	Q9Y5X1	SNX9_HUMAN	L	93	ENSP00000376024:S93L	ENSP00000376024:S93L	S	+	2	0	SNX9	158216174	0.003000	0.15002	0.049000	0.19019	0.016000	0.09150	1.641000	0.37197	-1.418000	0.02014	-0.484000	0.04775	TCG	.		0.488	SNX9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042856.1		
SORCS2	57537	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	7714544	7714544	+	Silent	SNP	G	G	A			TCGA-PD-A5DF-01A-11D-A27I-10	TCGA-PD-A5DF-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f1a4f60a-5228-47cd-883f-ff8d2dfe1633	ce137c9c-43df-49e8-82f8-3530d13eecfd	g.chr4:7714544G>A	ENST00000507866.2	+	15	2062	c.1953G>A	c.(1951-1953)gaG>gaA	p.E651E	SORCS2_ENST00000329016.9_Silent_p.E479E	NM_020777.2	NP_065828.2	Q96PQ0	SORC2_HUMAN	sortilin-related VPS10 domain containing receptor 2	651					neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	neuropeptide receptor activity (GO:0008188)			autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(4)|large_intestine(8)|lung(8)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	42						AGTGCGGCGAGGAGGACTACA	0.637																																					p.E651E		.											.	SORCS2	91	0			c.G1953A						.						44.0	49.0	48.0					4																	7714544		2014	4192	6206	SO:0001819	synonymous_variant	57537	exon15			CGGCGAGGAGGAC	AB037750	CCDS47008.1	4p16.1	2008-02-05			ENSG00000184985	ENSG00000184985			16698	protein-coding gene	gene with protein product		606284				11499680	Standard	NM_020777		Approved	KIAA1329	uc003gkb.4	Q96PQ0	OTTHUMG00000159981	ENST00000507866.2:c.1953G>A	4.37:g.7714544G>A		87.0	0.0		170.0	70.0	NM_020777	Q9P2L7	Silent	SNP	ENST00000507866.2	37	CCDS47008.1																																																																																			.		0.637	SORCS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358685.4	NM_020777	
STRIP2	57464	broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	129122874	129122874	+	Missense_Mutation	SNP	G	G	C			TCGA-PD-A5DF-01A-11D-A27I-10	TCGA-PD-A5DF-10A-01D-A27I-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f1a4f60a-5228-47cd-883f-ff8d2dfe1633	ce137c9c-43df-49e8-82f8-3530d13eecfd	g.chr7:129122874G>C	ENST00000249344.2	+	20	2281	c.2241G>C	c.(2239-2241)tgG>tgC	p.W747C	RNU1-72P_ENST00000362976.1_RNA|STRIP2_ENST00000435494.2_Missense_Mutation_p.W747C	NM_020704.2	NP_065755.1	Q9ULQ0	STRP2_HUMAN	striatin interacting protein 2	747					cell migration (GO:0016477)|cytoskeleton organization (GO:0007010)|regulation of cell shape (GO:0008360)	cytoplasm (GO:0005737)											ACGATGACTGGGCTTACGGGA	0.453																																					p.W747C		.											.	.	.	0			c.G2241C						.						69.0	61.0	64.0					7																	129122874		2203	4300	6503	SO:0001583	missense	57464	exon20			TGACTGGGCTTAC	AB032996	CCDS34752.1, CCDS47709.1	7q32.3	2012-11-05	2012-11-05	2012-11-05	ENSG00000128578	ENSG00000128578			22209	protein-coding gene	gene with protein product	"""FAR11 factor arrest 11 homolog B (yeast)"""		"""family with sequence similarity 40, member B"""	FAM40B		22782902, 22298706, 18782753	Standard	NM_020704		Approved	KIAA1170, FAR11B	uc011koy.2	Q9ULQ0	OTTHUMG00000157695	ENST00000249344.2:c.2241G>C	7.37:g.129122874G>C	ENSP00000249344:p.Trp747Cys	129.0	2.0		203.0	76.0	NM_020704	Q8WUZ4	Missense_Mutation	SNP	ENST00000249344.2	37	CCDS34752.1	.	.	.	.	.	.	.	.	.	.	G	22.2	4.260950	0.80246	.	.	ENSG00000128578	ENST00000249344;ENST00000435494	T;T	0.80480	-0.92;-1.38	5.32	5.32	0.75619	.	0.000000	0.85682	D	0.000000	D	0.92551	0.7634	M	0.93197	3.39	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.998;1.0	D	0.94124	0.7382	10	0.87932	D	0	-13.1984	18.3428	0.90311	0.0:0.0:1.0:0.0	.	747;747	Q9ULQ0;Q9ULQ0-2	FA40B_HUMAN;.	C	747	ENSP00000249344:W747C;ENSP00000392393:W747C	ENSP00000249344:W747C	W	+	3	0	FAM40B	128910110	1.000000	0.71417	1.000000	0.80357	0.954000	0.61252	9.797000	0.99108	2.662000	0.90505	0.655000	0.94253	TGG	.		0.453	STRIP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349418.1	NM_001134336	
SSPO	23145	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	7	149523815	149523815	+	RNA	SNP	C	C	G			TCGA-PD-A5DF-01A-11D-A27I-10	TCGA-PD-A5DF-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f1a4f60a-5228-47cd-883f-ff8d2dfe1633	ce137c9c-43df-49e8-82f8-3530d13eecfd	g.chr7:149523815C>G	ENST00000378016.2	+	0	14628							A2VEC9	SSPO_HUMAN	SCO-spondin						cell adhesion (GO:0007155)	extracellular space (GO:0005615)	peptidase inhibitor activity (GO:0030414)					Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			GCCCCTGCACCCAGCATTCTC	0.672																																					p.T4875T		.											.	.	.	0			c.C14625G						.						21.0	27.0	25.0					7																	149523815		2154	4256	6410			23145	exon103			CTGCACCCAGCAT	AK093431		7q36.1	2013-08-07	2013-08-06		ENSG00000197558	ENSG00000197558			21998	protein-coding gene	gene with protein product	"""subcommissural organ spondin"", ""SCO protein, thrombospondin domain containing"""		"""SCO-spondin homolog (Bos taurus)"""			8743952, 11008217	Standard	NM_198455		Approved	SCO-spondin, KIAA0543, FLJ36112	uc010lpk.3	A2VEC9	OTTHUMG00000157884		7.37:g.149523815C>G		24.0	0.0		37.0	11.0	NM_198455	Q76B61	Silent	SNP	ENST00000378016.2	37																																																																																				.		0.672	SSPO-202	KNOWN	basic	processed_transcript	processed_transcript			
SYNE3	161176	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	95909555	95909555	+	Silent	SNP	G	G	A			TCGA-PD-A5DF-01A-11D-A27I-10	TCGA-PD-A5DF-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f1a4f60a-5228-47cd-883f-ff8d2dfe1633	ce137c9c-43df-49e8-82f8-3530d13eecfd	g.chr14:95909555G>A	ENST00000334258.5	-	10	1862	c.1848C>T	c.(1846-1848)ccC>ccT	p.P616P	SYNE3_ENST00000557275.1_Silent_p.P616P|SYNE3_ENST00000554873.1_Silent_p.P373P	NM_152592.3	NP_689805.3	Q6ZMZ3	SYNE3_HUMAN	spectrin repeat containing, nuclear envelope family member 3	616					cytoskeletal anchoring at nuclear membrane (GO:0090286)|cytoskeleton organization (GO:0007010)|establishment of protein localization to membrane (GO:0090150)|regulation of cell shape (GO:0008360)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear outer membrane (GO:0005640)|SUN-KASH complex (GO:0034993)	actin filament binding (GO:0051015)			breast(1)|endometrium(2)|lung(25)	28						GCTGGTGGTTGGGGTTCTCCT	0.602																																					p.P616P		.											.	.	.	0			c.C1848T						.						116.0	121.0	119.0					14																	95909555		2203	4300	6503	SO:0001819	synonymous_variant	161176	exon10			GTGGTTGGGGTTC	AK098471	CCDS9935.1	14q32.13	2012-05-31	2012-05-31	2012-05-31	ENSG00000176438	ENSG00000176438			19861	protein-coding gene	gene with protein product		610861	"""chromosome 14 open reading frame 49"""	C14orf49			Standard	NM_152592		Approved	FLJ25605, NET53, Nesprin-3, Nesp3	uc001yei.4	Q6ZMZ3	OTTHUMG00000171632	ENST00000334258.5:c.1848C>T	14.37:g.95909555G>A		103.0	0.0		170.0	58.0	NM_152592	A6H8H3|Q86SX5|Q8N7G8	Silent	SNP	ENST00000334258.5	37	CCDS9935.1																																																																																			.		0.602	SYNE3-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000420529.2	NM_152592	
TPO	7173	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	1520727	1520727	+	Missense_Mutation	SNP	G	G	T			TCGA-PD-A5DF-01A-11D-A27I-10	TCGA-PD-A5DF-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f1a4f60a-5228-47cd-883f-ff8d2dfe1633	ce137c9c-43df-49e8-82f8-3530d13eecfd	g.chr2:1520727G>T	ENST00000345913.4	+	15	2682	c.2591G>T	c.(2590-2592)gGt>gTt	p.G864V	TPO_ENST00000497517.2_3'UTR|TPO_ENST00000349624.3_Missense_Mutation_p.G691V|TPO_ENST00000337415.3_Missense_Mutation_p.G864V|TPO_ENST00000329066.4_Missense_Mutation_p.G864V|TPO_ENST00000382201.3_Missense_Mutation_p.G807V|TPO_ENST00000346956.3_Missense_Mutation_p.G820V|TPO_ENST00000382198.1_Missense_Mutation_p.G691V	NM_000547.5	NP_000538.3	P07202	PERT_HUMAN	thyroid peroxidase	864					cellular nitrogen compound metabolic process (GO:0034641)|embryonic hemopoiesis (GO:0035162)|hormone biosynthetic process (GO:0042446)|hydrogen peroxide catabolic process (GO:0042744)|small molecule metabolic process (GO:0044281)|thyroid hormone generation (GO:0006590)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|heme binding (GO:0020037)|iodide peroxidase activity (GO:0004447)|peroxidase activity (GO:0004601)			breast(1)|central_nervous_system(3)|endometrium(8)|kidney(4)|large_intestine(14)|liver(2)|lung(33)|ovary(8)|pancreas(6)|prostate(4)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	95	all_hematologic(175;0.0487)|Acute lymphoblastic leukemia(172;0.0627)	all_cancers(51;0.0338)		all cancers(51;0.0356)|OV - Ovarian serous cystadenocarcinoma(76;0.0748)|Epithelial(75;0.12)	Carbimazole(DB00389)|Dextrothyroxine(DB00509)|Methimazole(DB00763)|Propylthiouracil(DB00550)	GGCTTCGCAGGTCTCACCTCG	0.537																																					p.G864V		.											.	TPO	332	0			c.G2591T						.						79.0	71.0	74.0					2																	1520727		2203	4300	6503	SO:0001583	missense	7173	exon15			TCGCAGGTCTCAC		CCDS1643.1, CCDS1644.1, CCDS1646.1	2p25	2008-02-05			ENSG00000115705	ENSG00000115705	1.11.1.7		12015	protein-coding gene	gene with protein product		606765					Standard	NM_175722		Approved	TPX	uc002qww.3	P07202	OTTHUMG00000090271	ENST00000345913.4:c.2591G>T	2.37:g.1520727G>T	ENSP00000318820:p.Gly864Val	70.0	0.0		116.0	36.0	NM_001206744	P09934|P09935|Q8IUL0|Q8NF94|Q8NF95|Q8NF96|Q8NF97|Q8TCI9	Missense_Mutation	SNP	ENST00000345913.4	37	CCDS1643.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	4.395|4.395	0.072996|0.072996	0.08485|0.08485	.|.	.|.	ENSG00000115705|ENSG00000115705	ENST00000337415;ENST00000345913;ENST00000346956;ENST00000349624;ENST00000329066;ENST00000382201;ENST00000382198;ENST00000422464;ENST00000469607;ENST00000425083|ENST00000446278	T;T;T;T;T;T;T;T;T;T|.	0.70399|.	-0.31;-0.24;-0.36;0.04;-0.24;-0.2;0.04;-0.4;0.41;-0.48|.	5.52|5.52	-4.48|-4.48	0.03515|0.03515	.|.	703.491000|.	0.00397|.	N|.	0.000056|.	T|T	0.17238|0.17238	0.0414|0.0414	N|N	0.08118|0.08118	0|0	0.09310|0.09310	N|N	1|1	B;P;B;B|.	0.35011|.	0.021;0.48;0.084;0.012|.	B;B;B;B|.	0.30782|.	0.022;0.12;0.022;0.01|.	T|T	0.32771|0.32771	-0.9894|-0.9894	10|5	0.37606|.	T|.	0.19|.	-2.5756|-2.5756	11.3787|11.3787	0.49743|0.49743	0.0:0.6074:0.1582:0.2344|0.0:0.6074:0.1582:0.2344	.|.	820;691;807;864|.	P07202-4;P07202-5;P07202-2;P07202|.	.;.;.;PERT_HUMAN|.	V|F	864;864;820;691;864;807;691;749;294;85|339	ENSP00000337263:G864V;ENSP00000318820:G864V;ENSP00000263886:G820V;ENSP00000332044:G691V;ENSP00000329869:G864V;ENSP00000371636:G807V;ENSP00000371633:G691V;ENSP00000405788:G749V;ENSP00000419461:G294V;ENSP00000389659:G85V|.	ENSP00000329869:G864V|.	G|V	+|+	2|1	0|0	TPO|TPO	1499734|1499734	0.001000|0.001000	0.12720|0.12720	0.000000|0.000000	0.03702|0.03702	0.005000|0.005000	0.04900|0.04900	0.104000|0.104000	0.15313|0.15313	-0.660000|-0.660000	0.05352|0.05352	-0.181000|-0.181000	0.13052|0.13052	GGT|GTC	.		0.537	TPO-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000206594.2	NM_000547	
TTPA	7274	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	63973814	63973814	+	Silent	SNP	T	T	C			TCGA-PD-A5DF-01A-11D-A27I-10	TCGA-PD-A5DF-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f1a4f60a-5228-47cd-883f-ff8d2dfe1633	ce137c9c-43df-49e8-82f8-3530d13eecfd	g.chr8:63973814T>C	ENST00000260116.4	-	5	865	c.834A>G	c.(832-834)caA>caG	p.Q278Q	TTPA_ENST00000521138.1_Intron	NM_000370.3	NP_000361.1	P49638	TTPA_HUMAN	tocopherol (alpha) transfer protein	278					embryonic placenta development (GO:0001892)|intermembrane transport (GO:0046909)|intracellular pH reduction (GO:0051452)|lipid metabolic process (GO:0006629)|negative regulation of cell death (GO:0060548)|negative regulation of establishment of blood-brain barrier (GO:0090212)|response to nutrient (GO:0007584)|response to pH (GO:0009268)|response to toxic substance (GO:0009636)|transport (GO:0006810)|vitamin E metabolic process (GO:0042360)|vitamin transport (GO:0051180)	cytosol (GO:0005829)|late endosome (GO:0005770)	phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|transporter activity (GO:0005215)|vitamin E binding (GO:0008431)			breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(8)	15	Breast(64;0.0716)	all_cancers(86;0.145)|Lung NSC(129;0.0324)|all_lung(136;0.0593)|all_epithelial(80;0.123)			Vitamin E(DB00163)	TAACTTCTCATTGAATGCTCT	0.348																																					p.Q278Q		.											.	TTPA	90	0			c.A834G						.						62.0	60.0	61.0					8																	63973814		2203	4300	6503	SO:0001819	synonymous_variant	7274	exon5			TTCTCATTGAATG	BC058000	CCDS6178.1	8q12.3	2007-07-18	2007-07-16			ENSG00000137561			12404	protein-coding gene	gene with protein product		600415	"""ataxia (Friedreich-like) with vitamin E deficiency"""	AVED		7719340, 7887897	Standard	NM_000370		Approved		uc003xux.2	P49638		ENST00000260116.4:c.834A>G	8.37:g.63973814T>C		31.0	0.0		45.0	17.0	NM_000370	Q71V64	Silent	SNP	ENST00000260116.4	37	CCDS6178.1																																																																																			.		0.348	TTPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378460.1	NM_000370	
VPS13D	55187	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	12422877	12422877	+	Missense_Mutation	SNP	T	T	C			TCGA-PD-A5DF-01A-11D-A27I-10	TCGA-PD-A5DF-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f1a4f60a-5228-47cd-883f-ff8d2dfe1633	ce137c9c-43df-49e8-82f8-3530d13eecfd	g.chr1:12422877T>C	ENST00000358136.3	+	51	10373	c.10243T>C	c.(10243-10245)Ttt>Ctt	p.F3415L	VPS13D_ENST00000356315.4_Missense_Mutation_p.F3390L	NM_015378.2	NP_056193.2			vacuolar protein sorting 13 homolog D (S. cerevisiae)											NS(1)|breast(6)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(28)|lung(44)|ovary(5)|pancreas(1)|prostate(8)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(4)	130	Ovarian(185;0.249)	Lung NSC(185;4.08e-05)|all_lung(284;4.55e-05)|Renal(390;0.000147)|Colorectal(325;0.00058)|Breast(348;0.00093)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0327)|Colorectal(212;4.63e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000289)|COAD - Colon adenocarcinoma(227;0.000801)|Kidney(185;0.00216)|KIRC - Kidney renal clear cell carcinoma(229;0.00544)|STAD - Stomach adenocarcinoma(313;0.012)|READ - Rectum adenocarcinoma(331;0.0476)|Lung(427;0.209)		CAAGCTTGCATTTGCACAGAG	0.428																																					p.F3415L		.											.	VPS13D	95	0			c.T10243C						.						179.0	174.0	176.0					1																	12422877		2203	4300	6503	SO:0001583	missense	55187	exon51			CTTGCATTTGCAC	AJ608774	CCDS30588.1, CCDS30589.1	1p36.21	2008-02-05	2006-04-04		ENSG00000048707	ENSG00000048707			23595	protein-coding gene	gene with protein product		608877	"""vacuolar protein sorting 13D (yeast)"""				Standard	NM_015378		Approved	FLJ10619, KIAA0453	uc001atv.3	Q5THJ4	OTTHUMG00000013155	ENST00000358136.3:c.10243T>C	1.37:g.12422877T>C	ENSP00000350854:p.Phe3415Leu	110.0	0.0		199.0	103.0	NM_015378		Missense_Mutation	SNP	ENST00000358136.3	37	CCDS30588.1	.	.	.	.	.	.	.	.	.	.	T	21.4	4.136323	0.77662	.	.	ENSG00000048707	ENST00000356315;ENST00000358136	T;T	0.29655	1.56;1.56	5.7	5.7	0.88788	Vacuolar protein sorting-associated protein (1);	0.000000	0.85682	D	0.000000	T	0.37404	0.1002	L	0.47716	1.5	0.80722	D	1	B;P	0.41498	0.323;0.752	B;P	0.47891	0.348;0.56	T	0.04579	-1.0941	10	0.23302	T	0.38	.	15.9745	0.80049	0.0:0.0:0.0:1.0	.	3390;3414	Q5THJ4-2;Q5THJ4	.;VP13D_HUMAN	L	3390;3415	ENSP00000348666:F3390L;ENSP00000350854:F3415L	ENSP00000348666:F3390L	F	+	1	0	VPS13D	12345464	1.000000	0.71417	0.998000	0.56505	0.932000	0.56968	7.393000	0.79851	2.168000	0.68352	0.533000	0.62120	TTT	.		0.428	VPS13D-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000036897.2	NM_015378	
YPEL1	29799	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	22064931	22064931	+	Missense_Mutation	SNP	C	C	T			TCGA-PD-A5DF-01A-11D-A27I-10	TCGA-PD-A5DF-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f1a4f60a-5228-47cd-883f-ff8d2dfe1633	ce137c9c-43df-49e8-82f8-3530d13eecfd	g.chr22:22064931C>T	ENST00000339468.3	-	2	486	c.103G>A	c.(103-105)Gag>Aag	p.E35K	YPEL1_ENST00000403503.1_Missense_Mutation_p.E35K	NM_013313.3	NP_037445.1	O60688	YPEL1_HUMAN	yippee-like 1 (Drosophila)	35						nucleus (GO:0005634)				breast(1)|large_intestine(1)|lung(1)	3	Colorectal(54;0.105)					GAGATGAGCTCGTCATGATTG	0.443																																					p.E35K		.											.	YPEL1	90	0			c.G103A						.						314.0	267.0	283.0					22																	22064931		2203	4300	6503	SO:0001583	missense	29799	exon2			TGAGCTCGTCATG	AF060862	CCDS13794.1	22q11.2	2008-02-04	2001-11-28		ENSG00000100027	ENSG00000100027			12845	protein-coding gene	gene with protein product		608082	"""yippee (Drosophila) homolog-like 1"""			11473580	Standard	NM_013313		Approved		uc002zvl.3	O60688	OTTHUMG00000150830	ENST00000339468.3:c.103G>A	22.37:g.22064931C>T	ENSP00000342832:p.Glu35Lys	231.0	0.0		398.0	43.0	NM_013313	Q65ZA1|Q6GLI6	Missense_Mutation	SNP	ENST00000339468.3	37	CCDS13794.1	.	.	.	.	.	.	.	.	.	.	C	35	5.557313	0.96514	.	.	ENSG00000100027	ENST00000339468;ENST00000403503	.	.	.	4.86	4.86	0.63082	.	0.000000	0.85682	D	0.000000	T	0.67287	0.2877	M	0.88704	2.975	0.80722	D	1	P	0.43477	0.808	B	0.34452	0.183	T	0.78265	-0.2271	9	0.72032	D	0.01	.	18.5625	0.91105	0.0:1.0:0.0:0.0	.	35	O60688	YPEL1_HUMAN	K	35	.	ENSP00000342832:E35K	E	-	1	0	YPEL1	20394931	1.000000	0.71417	0.975000	0.42487	0.832000	0.47134	7.564000	0.82326	2.704000	0.92352	0.561000	0.74099	GAG	.		0.443	YPEL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320245.1	NM_013313	
ZBTB2	57621	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	151694605	151694605	+	Missense_Mutation	SNP	C	C	G			TCGA-PD-A5DF-01A-11D-A27I-10	TCGA-PD-A5DF-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f1a4f60a-5228-47cd-883f-ff8d2dfe1633	ce137c9c-43df-49e8-82f8-3530d13eecfd	g.chr6:151694605C>G	ENST00000325144.4	-	2	308	c.168G>C	c.(166-168)caG>caC	p.Q56H		NM_020861.1	NP_065912.1	Q8N680	ZBTB2_HUMAN	zinc finger and BTB domain containing 2	56	BTB. {ECO:0000255|PROSITE- ProRule:PRU00037}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|large_intestine(2)|lung(6)|skin(1)	12			BRCA - Breast invasive adenocarcinoma(37;0.175)	OV - Ovarian serous cystadenocarcinoma(155;2.63e-11)		GTTACCTGGTCTGATGGACAA	0.443																																					p.Q56H		.											.	ZBTB2	91	0			c.G168C						.						143.0	124.0	130.0					6																	151694605		2203	4300	6503	SO:0001583	missense	57621	exon2			CCTGGTCTGATGG	BC020172	CCDS5231.1	6q25.1	2013-01-09			ENSG00000181472	ENSG00000181472		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	20868	protein-coding gene	gene with protein product						10819331	Standard	NM_020861		Approved	KIAA1483, ZNF437, bA351K16.2	uc003qoh.3	Q8N680	OTTHUMG00000015834	ENST00000325144.4:c.168G>C	6.37:g.151694605C>G	ENSP00000323183:p.Gln56His	153.0	0.0		256.0	86.0	NM_020861	A8K7C7|Q5SZ81|Q9P245	Missense_Mutation	SNP	ENST00000325144.4	37	CCDS5231.1	.	.	.	.	.	.	.	.	.	.	C	23.3	4.402003	0.83120	.	.	ENSG00000181472	ENST00000325144	T	0.22336	1.96	5.4	5.4	0.78164	BTB/POZ-like (2);BTB/POZ (1);BTB/POZ fold (2);	0.000000	0.85682	D	0.000000	T	0.23572	0.0570	L	0.49571	1.57	0.80722	D	1	P	0.48503	0.911	P	0.57548	0.823	T	0.00920	-1.1514	10	0.59425	D	0.04	-33.2641	10.3457	0.43906	0.0:0.8789:0.0:0.1211	.	56	Q8N680	ZBTB2_HUMAN	H	56	ENSP00000323183:Q56H	ENSP00000323183:Q56H	Q	-	3	2	ZBTB2	151736298	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.738000	0.47401	2.515000	0.84797	0.462000	0.41574	CAG	.		0.443	ZBTB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042715.1	NM_020861	
ZNF280C	55609	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	129349844	129349844	+	Missense_Mutation	SNP	A	A	T			TCGA-PD-A5DF-01A-11D-A27I-10	TCGA-PD-A5DF-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f1a4f60a-5228-47cd-883f-ff8d2dfe1633	ce137c9c-43df-49e8-82f8-3530d13eecfd	g.chrX:129349844A>T	ENST00000370978.4	-	14	1912	c.1759T>A	c.(1759-1761)Tcc>Acc	p.S587T		NM_017666.4	NP_060136.1	Q8ND82	Z280C_HUMAN	zinc finger protein 280C	587					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|kidney(4)|large_intestine(9)|lung(6)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	26						TTTGCTTTGGACTTAGCTATA	0.368																																					p.S587T		.											.	ZNF280C	132	0			c.T1759A						.						319.0	283.0	295.0					X																	129349844		2203	4300	6503	SO:0001583	missense	55609	exon14			CTTTGGACTTAGC	AL834333	CCDS14622.1	Xq25	2008-05-02	2007-09-20	2007-09-20	ENSG00000056277	ENSG00000056277			25955	protein-coding gene	gene with protein product			"""suppressor of hairy wing homolog 3 (Drosophila)"""	SUHW3		12477932	Standard	NM_017666		Approved	FLJ20095, ZNF633	uc004evm.3	Q8ND82	OTTHUMG00000022393	ENST00000370978.4:c.1759T>A	X.37:g.129349844A>T	ENSP00000360017:p.Ser587Thr	155.0	0.0		222.0	89.0	NM_017666	A8K2V8|Q9NXR3	Missense_Mutation	SNP	ENST00000370978.4	37	CCDS14622.1	.	.	.	.	.	.	.	.	.	.	A	5.828	0.336966	0.11013	.	.	ENSG00000056277	ENST00000066465;ENST00000370978;ENST00000447817	T;T	0.04809	4.31;3.55	3.85	-0.259	0.12971	.	.	.	.	.	T	0.03348	0.0097	L	0.32530	0.975	0.09310	N	1	B;B	0.19200	0.005;0.034	B;B	0.22386	0.004;0.039	T	0.47749	-0.9093	9	0.22706	T	0.39	.	1.4371	0.02345	0.5415:0.1778:0.1058:0.175	.	538;587	Q9UJJ2;Q8ND82	.;Z280C_HUMAN	T	538;587;538	ENSP00000360017:S587T;ENSP00000408521:S538T	ENSP00000066465:S538T	S	-	1	0	ZNF280C	129177525	0.001000	0.12720	0.000000	0.03702	0.009000	0.06853	-0.356000	0.07661	-0.239000	0.09710	0.350000	0.21858	TCC	.		0.368	ZNF280C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058251.1	NM_017666	
ZSCAN21	7589	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	7	99662525	99662525	+	3'UTR	SNP	G	G	A			TCGA-PD-A5DF-01A-11D-A27I-10	TCGA-PD-A5DF-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f1a4f60a-5228-47cd-883f-ff8d2dfe1633	ce137c9c-43df-49e8-82f8-3530d13eecfd	g.chr7:99662525G>A	ENST00000292450.4	+	0	1871				ZSCAN21_ENST00000543588.1_3'UTR|ZSCAN21_ENST00000456748.2_3'UTR|ZNF3_ENST00000413658.2_Silent_p.H94H	NM_145914.2	NP_666019.1	Q9Y5A6	ZSC21_HUMAN	zinc finger and SCAN domain containing 21						positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(3)|endometrium(2)|kidney(1)|large_intestine(2)|lung(8)|ovary(3)|skin(1)	21	Lung NSC(181;0.0211)|all_lung(186;0.0323)|Esophageal squamous(72;0.0439)		STAD - Stomach adenocarcinoma(171;0.129)			TTAAACAGACGTGTATCCAGT	0.393																																					p.H94H		.											.	ZNF3	91	0			c.C282T						.						130.0	129.0	129.0					7																	99662525		1990	4158	6148	SO:0001624	3_prime_UTR_variant	7551	exon6			ACAGACGTGTATC	AL136865	CCDS5681.1	7q11.1	2013-01-08	2006-10-06	2006-10-06	ENSG00000166529	ENSG00000166529		"""-"", ""Zinc fingers, C2H2-type"""	13104	protein-coding gene	gene with protein product		601261	"""zinc finger protein 38 (KOX 25)"", ""zinc finger protein 38"""	ZNF38		2288909, 2014798	Standard	NM_145914		Approved	DKFZp434L134, NY-REN-21, Zipro1	uc003uso.3	Q9Y5A6	OTTHUMG00000154583	ENST00000292450.4:c.*285G>A	7.37:g.99662525G>A		100.0	0.0		214.0	64.0	NM_017715	A4D2A6|D6W5T9|Q9H0B5	Silent	SNP	ENST00000292450.4	37	CCDS5681.1																																																																																			.		0.393	ZSCAN21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336166.1	NM_145914	
ZSCAN1	284312	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	58565260	58565260	+	Frame_Shift_Del	DEL	C	C	-			TCGA-PD-A5DF-01A-11D-A27I-10	TCGA-PD-A5DF-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	f1a4f60a-5228-47cd-883f-ff8d2dfe1633	ce137c9c-43df-49e8-82f8-3530d13eecfd	g.chr19:58565260delC	ENST00000282326.1	+	6	1315	c.1068delC	c.(1066-1068)ggcfs	p.G356fs		NM_182572.3	NP_872378.3	Q8NBB4	ZSCA1_HUMAN	zinc finger and SCAN domain containing 1	356					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|transcription coactivator activity (GO:0003713)			NS(1)|breast(3)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(25)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	48		Colorectal(82;5.46e-05)|all_neural(62;0.0182)|Breast(46;0.0389)|Ovarian(87;0.0443)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0152)		GGAGCAAGGGCCCCCGGGAGT	0.662																																					p.G356fs		.											.	ZSCAN1	92	0			c.1068delC						.						33.0	34.0	34.0					19																	58565260		2203	4300	6503	SO:0001589	frameshift_variant	284312	exon6			CAAGGGCCCCCGG	AK091098	CCDS12969.1	19q13.43	2013-06-13	2004-04-21		ENSG00000152467	ENSG00000152467		"""-"", ""Zinc fingers, C2H2-type"""	23712	protein-coding gene	gene with protein product			"""zinc finger with SCAN domain 1"""			12477932	Standard	NM_182572		Approved	FLJ33779, ZNF915	uc002qrc.1	Q8NBB4	OTTHUMG00000183381	ENST00000282326.1:c.1068delC	19.37:g.58565260delC	ENSP00000282326:p.Gly356fs	101.0	0.0		155.0	54.0	NM_182572	Q3B798|Q6WLH8|Q86WS8	Frame_Shift_Del	DEL	ENST00000282326.1	37	CCDS12969.1																																																																																			.		0.662	ZSCAN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466427.1	NM_182572	
