#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
TNFRSF25	8718	hgsc.bcm.edu	37	1	6524730	6524730	+	Silent	SNP	A	A	G			TCGA-2Y-A9GS-01A-12D-A382-10	TCGA-2Y-A9GS-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ce44141-64e4-4d9d-9971-4dc79b316d4a	27ea2725-9c48-4965-a503-91d2302923b4	g.chr1:6524730A>G	ENST00000356876.3	-	4	432	c.345T>C	c.(343-345)tgT>tgC	p.C115C	TNFRSF25_ENST00000461703.2_5'UTR|TNFRSF25_ENST00000348333.3_Silent_p.C70C|TNFRSF25_ENST00000377782.3_Silent_p.C115C|TNFRSF25_ENST00000351748.3_Intron|TNFRSF25_ENST00000351959.5_Silent_p.C115C	NM_003790.2|NM_148967.1	NP_003781.1|NP_683868.1	Q93038	TNR25_HUMAN	tumor necrosis factor receptor superfamily, member 25	115					apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cell surface receptor signaling pathway (GO:0007166)|regulation of apoptotic process (GO:0042981)|signal transduction (GO:0007165)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	cytosol (GO:0005829)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)|tumor necrosis factor-activated receptor activity (GO:0005031)			breast(1)|central_nervous_system(2)|endometrium(1)|lung(4)|prostate(1)|stomach(1)	10	Ovarian(185;0.0386)|all_lung(157;0.154)	all_cancers(23;1.7e-35)|all_epithelial(116;2.78e-22)|all_lung(118;7.57e-07)|Lung NSC(185;4.26e-06)|Colorectal(325;4.47e-05)|all_hematologic(16;0.00014)|Breast(487;0.000688)|Renal(390;0.0007)|Acute lymphoblastic leukemia(12;0.00157)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0448)		Epithelial(90;4.58e-35)|GBM - Glioblastoma multiforme(13;3.06e-27)|Colorectal(212;6.01e-08)|COAD - Colon adenocarcinoma(227;1.3e-05)|Kidney(185;4.88e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000871)|BRCA - Breast invasive adenocarcinoma(365;0.00105)|STAD - Stomach adenocarcinoma(132;0.00158)|READ - Rectum adenocarcinoma(331;0.0419)		GCTTACAGCCACAGCGGGTGT	0.622																																					p.C115C		Atlas-SNP	.											.	TNFRSF25	22	.	0			c.T345C						.						47.0	48.0	48.0					1																	6524730		2203	4300	6503	SO:0001819	synonymous_variant	8718	exon4			ACAGCCACAGCGG	U72763	CCDS71.1, CCDS72.1, CCDS73.1, CCDS74.1, CCDS75.1	1p36.2	2008-02-05	2002-12-20	2002-12-20	ENSG00000215788	ENSG00000215788		"""Tumor necrosis factor receptor superfamily"""	11910	protein-coding gene	gene with protein product		603366	"""tumor necrosis factor receptor superfamily, member 12 (translocating chain-association membrane protein)"""	TNFRSF12		9052839, 8934525	Standard	NM_003790		Approved	DR3, TRAMP, WSL-1, LARD, WSL-LR, DDR3, TR3, APO-3	uc001anh.3	Q93038	OTTHUMG00000000831	ENST00000356876.3:c.345T>C	chr1.hg19:g.6524730A>G		83.0	0.0		139.0	14.0	NM_148966	B1ALX2|B1ALX3|B7ZLL7|O00275|O00276|O00277|O00278|O00279|O00280|O14865|O14866|P78507|P78515|Q17RU4|Q92983|Q93036|Q93037|Q99722|Q99830|Q99831|Q9BY86|Q9UME0|Q9UME1|Q9UME5	Silent	SNP	ENST00000356876.3	hg19	CCDS71.1																																																																																			.	.		0.622	TNFRSF25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000002259.1	NM_148965	
LPHN2	23266	hgsc.bcm.edu	37	1	82302739	82302739	+	Missense_Mutation	SNP	G	G	A			TCGA-2Y-A9GS-01A-12D-A382-10	TCGA-2Y-A9GS-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ce44141-64e4-4d9d-9971-4dc79b316d4a	27ea2725-9c48-4965-a503-91d2302923b4	g.chr1:82302739G>A	ENST00000370728.1	+	5	715	c.70G>A	c.(70-72)Gaa>Aaa	p.E24K	LPHN2_ENST00000271029.4_Missense_Mutation_p.E24K|LPHN2_ENST00000359929.3_Missense_Mutation_p.E24K|LPHN2_ENST00000319517.6_Missense_Mutation_p.E24K|LPHN2_ENST00000394879.1_Missense_Mutation_p.E24K|LPHN2_ENST00000370713.1_Missense_Mutation_p.E24K|LPHN2_ENST00000370725.1_Missense_Mutation_p.E24K|LPHN2_ENST00000370730.1_Missense_Mutation_p.E24K|LPHN2_ENST00000370717.2_Missense_Mutation_p.E24K|LPHN2_ENST00000370723.1_Missense_Mutation_p.E24K|LPHN2_ENST00000335786.5_Missense_Mutation_p.E24K|LPHN2_ENST00000370727.1_Missense_Mutation_p.E24K|LPHN2_ENST00000370715.1_Missense_Mutation_p.E24K|LPHN2_ENST00000469377.2_3'UTR|LPHN2_ENST00000370721.1_Missense_Mutation_p.E24K			O95490	LPHN2_HUMAN	latrophilin 2	24					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|G-protein coupled receptor activity (GO:0004930)|latrotoxin receptor activity (GO:0016524)			NS(3)|breast(6)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(18)|liver(2)|lung(37)|ovary(3)|pancreas(1)|prostate(3)|skin(22)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	119				all cancers(265;0.00142)|Epithelial(280;0.00829)|OV - Ovarian serous cystadenocarcinoma(397;0.077)|STAD - Stomach adenocarcinoma(256;0.248)		ACCAAATACAGAAGGTAAGAT	0.308																																					p.E24K		Atlas-SNP	.											.	LPHN2	464	.	0			c.G70A						.						139.0	135.0	136.0					1																	82302739		2203	4299	6502	SO:0001583	missense	23266	exon2			AATACAGAAGGTA	AJ131581	CCDS689.1, CCDS72811.1	1p31.1	2014-08-08	2003-03-17	2003-05-02	ENSG00000117114	ENSG00000117114		"""-"", ""GPCR / Class B : Orphans"""	18582	protein-coding gene	gene with protein product		607018	"""latrophilin 1"""	LPHH1		10760572	Standard	XR_248786		Approved	KIAA0786, LEC1	uc001diu.3	O95490	OTTHUMG00000009844	ENST00000370728.1:c.70G>A	chr1.hg19:g.82302739G>A	ENSP00000359763:p.Glu24Lys	83.0	0.0		176.0	28.0	NM_012302	A5XEI2|B1ALT8|B1ALT9|B1ALU0|B1ALU2|B1ALU4|B1ALU5|B1ALU6|O94882|Q5VX76|Q9UKY5|Q9UKY6	Missense_Mutation	SNP	ENST00000370728.1	hg19		.	.	.	.	.	.	.	.	.	.	G	13.01	2.108296	0.37242	.	.	ENSG00000117114	ENST00000370721;ENST00000370728;ENST00000370730;ENST00000370727;ENST00000370725;ENST00000370723;ENST00000359929;ENST00000370715;ENST00000370713;ENST00000319517;ENST00000370717;ENST00000394879;ENST00000271029;ENST00000335786	T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.68479	-0.3;-0.33;-0.32;-0.26;-0.27;-0.22;-0.28;-0.29;-0.28;-0.28;-0.27;-0.22;-0.26;-0.32	5.44	5.44	0.79542	.	0.630568	0.15695	N	0.249227	T	0.36220	0.0959	N	0.14661	0.345	0.37340	D	0.910351	B;B;B;B	0.12013	0.0;0.0;0.0;0.005	B;B;B;B	0.21546	0.001;0.0;0.001;0.035	T	0.24404	-1.0161	10	0.12103	T	0.63	.	19.2609	0.93967	0.0:0.0:1.0:0.0	.	24;24;24;24	O95490-3;O95490-4;O95490-2;B3KVU1	.;.;.;.	K	24	ENSP00000359756:E24K;ENSP00000359763:E24K;ENSP00000359765:E24K;ENSP00000359762:E24K;ENSP00000359760:E24K;ENSP00000359758:E24K;ENSP00000353006:E24K;ENSP00000359750:E24K;ENSP00000359748:E24K;ENSP00000322270:E24K;ENSP00000359752:E24K;ENSP00000378344:E24K;ENSP00000271029:E24K;ENSP00000337306:E24K	ENSP00000271029:E24K	E	+	1	0	LPHN2	82075327	1.000000	0.71417	0.992000	0.48379	0.792000	0.44763	5.308000	0.65768	2.560000	0.86352	0.467000	0.42956	GAA	.	.		0.308	LPHN2-007	KNOWN	non_canonical_conserved|not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000027188.1	NM_012302	
CTBS	1486	hgsc.bcm.edu	37	1	85040007	85040007	+	Missense_Mutation	SNP	A	A	C	rs142534762|rs3217269|rs199701060	byFrequency	TCGA-2Y-A9GS-01A-12D-A382-10	TCGA-2Y-A9GS-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ce44141-64e4-4d9d-9971-4dc79b316d4a	27ea2725-9c48-4965-a503-91d2302923b4	g.chr1:85040007A>C	ENST00000370630.5	-	1	140	c.92T>G	c.(91-93)cTg>cGg	p.L31R	CTBS_ENST00000477677.1_5'UTR	NM_004388.2	NP_004379.1	Q01459	DIAC_HUMAN	chitobiase, di-N-acetyl-	31					chitin catabolic process (GO:0006032)|oligosaccharide catabolic process (GO:0009313)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	chitinase activity (GO:0004568)			breast(1)|endometrium(1)|large_intestine(4)|lung(2)|ovary(1)	9				all cancers(265;0.00727)|Epithelial(280;0.0192)|OV - Ovarian serous cystadenocarcinoma(397;0.166)		CCgcagcgccagcagcgccag	0.721																																					p.L31R		Atlas-SNP	.											.	CTBS	24	.	0			c.T92G						.						3.0	4.0	3.0					1																	85040007		1460	3157	4617	SO:0001583	missense	1486	exon1			AGCGCCAGCAGCG	M95767	CCDS698.1	1p22	2010-05-04			ENSG00000117151	ENSG00000117151	3.2.1.-		2496	protein-coding gene	gene with protein product		600873		CTB		1549114, 7606925	Standard	NM_004388		Approved		uc001dka.2	Q01459	OTTHUMG00000009922	ENST00000370630.5:c.92T>G	chr1.hg19:g.85040007A>C	ENSP00000359664:p.Leu31Arg	94.0	0.0		132.0	10.0	NM_004388	Q5VX50	Missense_Mutation	SNP	ENST00000370630.5	hg19	CCDS698.1	.	.	.	.	.	.	.	.	.	.	A	11.47	1.648232	0.29336	.	.	ENSG00000117151	ENST00000370630	T	0.37235	1.21	5.0	3.89	0.44902	.	406.533000	0.01622	U	0.023085	T	0.39358	0.1075	L	0.59436	1.845	0.25105	N	0.990754	D	0.58268	0.982	P	0.60236	0.871	T	0.15093	-1.0449	10	0.41790	T	0.15	-0.1024	8.619	0.33849	0.9087:0.0:0.0913:0.0	.	31	Q01459	DIAC_HUMAN	R	31	ENSP00000359664:L31R	ENSP00000359664:L31R	L	-	2	0	CTBS	84812595	0.406000	0.25344	0.074000	0.20217	0.092000	0.18411	1.052000	0.30429	2.225000	0.72522	0.482000	0.46254	CTG	.	.		0.721	CTBS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027457.2	NM_004388	
ZNF326	284695	hgsc.bcm.edu	37	1	90473296	90473296	+	Missense_Mutation	SNP	G	G	T			TCGA-2Y-A9GS-01A-12D-A382-10	TCGA-2Y-A9GS-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ce44141-64e4-4d9d-9971-4dc79b316d4a	27ea2725-9c48-4965-a503-91d2302923b4	g.chr1:90473296G>T	ENST00000340281.4	+	5	745	c.602G>T	c.(601-603)gGc>gTc	p.G201V	ZNF326_ENST00000455342.2_Intron|ZNF326_ENST00000370447.3_Missense_Mutation_p.G112V	NM_182976.2	NP_892021.1	Q5BKZ1	ZN326_HUMAN	zinc finger protein 326	201	Gly-rich.				mRNA processing (GO:0006397)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of DNA-templated transcription, elongation (GO:0032784)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	DBIRD complex (GO:0044609)|nuclear matrix (GO:0016363)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|RNA polymerase II core binding (GO:0000993)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(12)|lung(7)|ovary(1)	25		all_lung(203;0.0116)|Lung NSC(277;0.0417)		all cancers(265;0.00728)|Epithelial(280;0.0265)		ACAGGCAGAGGCCGAGGCCGA	0.453																																					p.G201V		Atlas-SNP	.											.	ZNF326	60	.	0			c.G602T						.						68.0	70.0	70.0					1																	90473296		2203	4300	6503	SO:0001583	missense	284695	exon5			GCAGAGGCCGAGG	BC013102	CCDS727.1, CCDS728.1	1p22	2012-04-19			ENSG00000162664	ENSG00000162664		"""Zinc fingers, C2H2-type"""	14104	protein-coding gene	gene with protein product	"""ZNF-protein interacting with nuclear mRNPs and DBC1"""	614601				22446626	Standard	NM_182976		Approved	Zfp326, ZAN75, FLJ20403, ZIRD	uc001dnq.2	Q5BKZ1	OTTHUMG00000010675	ENST00000340281.4:c.602G>T	chr1.hg19:g.90473296G>T	ENSP00000340796:p.Gly201Val	118.0	0.0		177.0	60.0	NM_182976	A8MYX1|B4DLN0|B4E179|Q5VW93|Q5VW94|Q5VW96|Q5VW97|Q6NSA2|Q7Z638|Q7Z6C2	Missense_Mutation	SNP	ENST00000340281.4	hg19	CCDS727.1	.	.	.	.	.	.	.	.	.	.	G	16.68	3.190093	0.58017	.	.	ENSG00000162664	ENST00000394590;ENST00000340281;ENST00000370447	T;T	0.47177	0.85;0.85	5.84	5.84	0.93424	.	0.118601	0.64402	D	0.000017	T	0.58293	0.2112	L	0.43152	1.355	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.59295	-0.7481	10	0.72032	D	0.01	-6.5508	20.1319	0.98001	0.0:0.0:1.0:0.0	.	201;201	A8MYX1;Q5BKZ1	.;ZN326_HUMAN	V	201;201;112	ENSP00000340796:G201V;ENSP00000359476:G112V	ENSP00000340796:G201V	G	+	2	0	ZNF326	90245884	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.863000	0.69568	2.747000	0.94245	0.655000	0.94253	GGC	.	.		0.453	ZNF326-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029428.2	NM_181781	
NES	10763	hgsc.bcm.edu	37	1	156640363	156640363	+	Missense_Mutation	SNP	C	C	A			TCGA-2Y-A9GS-01A-12D-A382-10	TCGA-2Y-A9GS-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ce44141-64e4-4d9d-9971-4dc79b316d4a	27ea2725-9c48-4965-a503-91d2302923b4	g.chr1:156640363C>A	ENST00000368223.3	-	4	3749	c.3617G>T	c.(3616-3618)gGg>gTg	p.G1206V		NM_006617.1	NP_006608.1	P48681	NEST_HUMAN	nestin	1206	Tail.				brain development (GO:0007420)|cell projection morphogenesis (GO:0048858)|central nervous system development (GO:0007417)|embryonic camera-type eye development (GO:0031076)|G2/M transition of mitotic cell cycle (GO:0000086)|negative regulation of catalytic activity (GO:0043086)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of protein binding (GO:0032091)|positive regulation of intermediate filament depolymerization (GO:0030844)|positive regulation of neural precursor cell proliferation (GO:2000179)|stem cell proliferation (GO:0072089)	cytoplasm (GO:0005737)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)	intermediate filament binding (GO:0019215)|structural molecule activity (GO:0005198)			central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(30)|ovary(6)|prostate(1)|skin(3)|stomach(1)|urinary_tract(4)	64	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					TTCCTCTGACCCCAGAGGCCA	0.647																																					p.G1206V		Atlas-SNP	.											.	NES	196	.	0			c.G3617T						.						78.0	77.0	78.0					1																	156640363		2203	4300	6503	SO:0001583	missense	10763	exon4			TCTGACCCCAGAG	X65964	CCDS1151.1	1q23	2013-01-16			ENSG00000132688	ENSG00000132688		"""Intermediate filaments type IV"""	7756	protein-coding gene	gene with protein product		600915				1478958, 9104587	Standard	NM_006617		Approved	FLJ21841	uc001fpq.3	P48681	OTTHUMG00000034299	ENST00000368223.3:c.3617G>T	chr1.hg19:g.156640363C>A	ENSP00000357206:p.Gly1206Val	94.0	0.0		84.0	29.0	NM_006617	O00552|Q3LIF5|Q5SYZ6	Missense_Mutation	SNP	ENST00000368223.3	hg19	CCDS1151.1	.	.	.	.	.	.	.	.	.	.	C	16.43	3.120368	0.56613	.	.	ENSG00000132688	ENST00000368223	D	0.86432	-2.12	3.63	0.478	0.16789	.	.	.	.	.	D	0.83450	0.5257	L	0.59436	1.845	0.20196	N	0.99993	D	0.69078	0.997	P	0.60682	0.878	T	0.72931	-0.4142	9	0.87932	D	0	.	5.6659	0.17695	0.0:0.4756:0.0:0.5244	.	1206	P48681	NEST_HUMAN	V	1206	ENSP00000357206:G1206V	ENSP00000357206:G1206V	G	-	2	0	NES	154906987	0.000000	0.05858	0.001000	0.08648	0.635000	0.38103	0.317000	0.19487	0.145000	0.18977	0.455000	0.32223	GGG	.	.		0.647	NES-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000082844.2	NM_006617	
FCRL4	83417	hgsc.bcm.edu	37	1	157559113	157559113	+	Missense_Mutation	SNP	C	C	A			TCGA-2Y-A9GS-01A-12D-A382-10	TCGA-2Y-A9GS-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ce44141-64e4-4d9d-9971-4dc79b316d4a	27ea2725-9c48-4965-a503-91d2302923b4	g.chr1:157559113C>A	ENST00000271532.1	-	3	323	c.188G>T	c.(187-189)tGg>tTg	p.W63L	FCRL4_ENST00000448509.2_5'Flank	NM_031282.2	NP_112572.1	Q96PJ5	FCRL4_HUMAN	Fc receptor-like 4	63	Ig-like C2-type 1.				immune system process (GO:0002376)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(2)|endometrium(1)|kidney(3)|large_intestine(5)|lung(20)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	40	all_hematologic(112;0.0378)|Hepatocellular(266;0.178)	Prostate(1639;0.245)				CTTTTCTCCCCAGTAGTGCCG	0.517																																					p.W63L		Atlas-SNP	.											.	FCRL4	95	.	0			c.G188T						.						107.0	92.0	97.0					1																	157559113		2203	4300	6503	SO:0001583	missense	83417	exon3			TCTCCCCAGTAGT	AF343661	CCDS1166.1	1q21	2013-01-14			ENSG00000163518	ENSG00000163518		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	18507	protein-coding gene	gene with protein product		605876				11290337, 11493702	Standard	NM_031282		Approved	FCRH4, IRTA1, IGFP2, CD307d	uc001fqw.3	Q96PJ5	OTTHUMG00000035488	ENST00000271532.1:c.188G>T	chr1.hg19:g.157559113C>A	ENSP00000271532:p.Trp63Leu	202.0	0.0		250.0	80.0	NM_031282	Q96PJ3|Q96RE0	Missense_Mutation	SNP	ENST00000271532.1	hg19	CCDS1166.1	.	.	.	.	.	.	.	.	.	.	C	2.009	-0.427543	0.04701	.	.	ENSG00000163518	ENST00000271532	T	0.18960	2.18	4.06	-0.104	0.13605	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	3.056910	0.01476	N	0.016467	T	0.02380	0.0073	N	0.08118	0	0.09310	N	1	B	0.18863	0.031	B	0.11329	0.006	T	0.28554	-1.0040	10	0.13470	T	0.59	.	2.7602	0.05305	0.2055:0.4492:0.0:0.3453	.	63	Q96PJ5	FCRL4_HUMAN	L	63	ENSP00000271532:W63L	ENSP00000271532:W63L	W	-	2	0	FCRL4	155825737	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-1.011000	0.03652	0.097000	0.17492	0.557000	0.71058	TGG	.	.		0.517	FCRL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086180.1	NM_031282	
RXRG	6258	hgsc.bcm.edu	37	1	165386442	165386442	+	Missense_Mutation	SNP	A	A	G			TCGA-2Y-A9GS-01A-12D-A382-10	TCGA-2Y-A9GS-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ce44141-64e4-4d9d-9971-4dc79b316d4a	27ea2725-9c48-4965-a503-91d2302923b4	g.chr1:165386442A>G	ENST00000359842.5	-	4	760	c.458T>C	c.(457-459)gTa>gCa	p.V153A	RXRG_ENST00000470566.1_5'UTR	NM_001256570.1|NM_006917.4	NP_001243499.1|NP_008848.1	P48443	RXRG_HUMAN	retinoid X receptor, gamma	153					gene expression (GO:0010467)|heart development (GO:0007507)|neuron differentiation (GO:0030182)|peripheral nervous system development (GO:0007422)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of myelination (GO:0031641)|response to retinoic acid (GO:0032526)|skeletal muscle tissue development (GO:0007519)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)	9-cis retinoic acid receptor activity (GO:0004886)|sequence-specific DNA binding (GO:0043565)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(3)|large_intestine(6)|lung(22)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	38	all_hematologic(923;0.0773)|Acute lymphoblastic leukemia(8;0.155)				Acitretin(DB00459)|Adapalene(DB00210)|Alitretinoin(DB00523)|Bexarotene(DB00307)|Tretinoin(DB00755)	ACAACTGTATACCCCGTAGTG	0.433																																					p.V153A		Atlas-SNP	.											.	RXRG	91	.	0			c.T458C						.						149.0	140.0	143.0					1																	165386442		2203	4300	6503	SO:0001583	missense	6258	exon4			CTGTATACCCCGT	U38480	CCDS1248.1, CCDS72970.1	1q22-q23	2013-01-16			ENSG00000143171	ENSG00000143171		"""Nuclear hormone receptors"""	10479	protein-coding gene	gene with protein product	"""nuclear receptor subfamily 2 group B member 3"""	180247				8034312	Standard	NR_033824		Approved	NR2B3	uc001gda.3	P48443	OTTHUMG00000034626	ENST00000359842.5:c.458T>C	chr1.hg19:g.165386442A>G	ENSP00000352900:p.Val153Ala	135.0	0.0		154.0	51.0	NM_006917	A6NIP1|Q6IBU7	Missense_Mutation	SNP	ENST00000359842.5	hg19	CCDS1248.1	.	.	.	.	.	.	.	.	.	.	A	22.3	4.277335	0.80580	.	.	ENSG00000143171	ENST00000359842	D	0.97665	-4.48	4.96	4.96	0.65561	Zinc finger, NHR/GATA-type (1);Zinc finger, nuclear hormone receptor-type (5);	0.000000	0.85682	D	0.000000	D	0.95758	0.8620	N	0.21324	0.655	0.58432	D	0.999998	D	0.76494	0.999	D	0.87578	0.998	D	0.96016	0.9005	9	0.39692	T	0.17	.	13.6338	0.62210	1.0:0.0:0.0:0.0	.	153	P48443	RXRG_HUMAN	A	153	ENSP00000352900:V153A	ENSP00000352900:V153A	V	-	2	0	RXRG	163653066	1.000000	0.71417	0.997000	0.53966	0.873000	0.50193	7.040000	0.76551	2.076000	0.62316	0.533000	0.62120	GTA	.	.		0.433	RXRG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083794.2	NM_006917	
ASTN1	460	hgsc.bcm.edu	37	1	176918372	176918372	+	Missense_Mutation	SNP	A	A	C			TCGA-2Y-A9GS-01A-12D-A382-10	TCGA-2Y-A9GS-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ce44141-64e4-4d9d-9971-4dc79b316d4a	27ea2725-9c48-4965-a503-91d2302923b4	g.chr1:176918372A>C	ENST00000367654.3	-	12	2238	c.2027T>G	c.(2026-2028)aTg>aGg	p.M676R	ASTN1_ENST00000424564.2_Missense_Mutation_p.M668R|ASTN1_ENST00000281881.3_5'UTR|ASTN1_ENST00000361833.2_Missense_Mutation_p.M668R|ASTN1_ENST00000367657.3_Missense_Mutation_p.M668R	NM_004319.1	NP_004310.1	O14525	ASTN1_HUMAN	astrotactin 1	676	EGF-like 3.				locomotory behavior (GO:0007626)|neuron cell-cell adhesion (GO:0007158)|neuron migration (GO:0001764)	endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)				NS(4)|breast(5)|central_nervous_system(2)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(23)|liver(1)|lung(81)|ovary(6)|prostate(5)|skin(10)|urinary_tract(3)	153						GAAGGGCGCCATCTGCTGGAG	0.617											OREG0014004	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.M668R		Atlas-SNP	.											.	ASTN1	314	.	0			c.T2003G						.						74.0	72.0	73.0					1																	176918372		2203	4300	6503	SO:0001583	missense	460	exon12			GGCGCCATCTGCT	AB006627	CCDS1319.1, CCDS44280.1, CCDS65732.1	1q25.2	2008-02-05	2006-08-24	2006-08-24	ENSG00000152092	ENSG00000152092			773	protein-coding gene	gene with protein product		600904	"""astrotactin"""	ASTN		9070947	Standard	NM_001286164		Approved		uc001glc.3	O14525	OTTHUMG00000035041	ENST00000367654.3:c.2027T>G	chr1.hg19:g.176918372A>C	ENSP00000356626:p.Met676Arg	60.0	0.0	1934	94.0	8.0	NM_004319	A5PL12|B4DHI9|E9PFR8|O60799|Q5W0V7|Q5W0V8	Missense_Mutation	SNP	ENST00000367654.3	hg19		.	.	.	.	.	.	.	.	.	.	A	14.56	2.572003	0.45798	.	.	ENSG00000152092	ENST00000367657;ENST00000361833;ENST00000367654;ENST00000424564;ENST00000541808	D;D;D;D	0.96200	-3.94;-3.94;-3.94;-3.94	5.3	5.3	0.74995	.	0.268407	0.46145	D	0.000307	D	0.85017	0.5601	N	0.03608	-0.345	0.52501	D	0.999958	P;B;B	0.38420	0.63;0.015;0.015	B;B;B	0.29353	0.101;0.029;0.029	D	0.85667	0.1292	10	0.33940	T	0.23	-20.4559	10.2105	0.43138	0.8517:0.0:0.0:0.1482	.	676;668;668	O14525;O14525-2;B1AJS1	ASTN1_HUMAN;.;.	R	668;668;676;668;668	ENSP00000356629:M668R;ENSP00000354536:M668R;ENSP00000356626:M676R;ENSP00000395041:M668R	ENSP00000354536:M668R	M	-	2	0	ASTN1	175184995	1.000000	0.71417	1.000000	0.80357	0.824000	0.46624	4.443000	0.59994	2.008000	0.58898	0.533000	0.62120	ATG	.	.		0.617	ASTN1-201	KNOWN	basic	protein_coding	protein_coding		NM_004319	
OBSCN	84033	hgsc.bcm.edu	37	1	228506637	228506637	+	Silent	SNP	C	C	A			TCGA-2Y-A9GS-01A-12D-A382-10	TCGA-2Y-A9GS-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ce44141-64e4-4d9d-9971-4dc79b316d4a	27ea2725-9c48-4965-a503-91d2302923b4	g.chr1:228506637C>A	ENST00000422127.1	+	54	14228	c.14184C>A	c.(14182-14184)ccC>ccA	p.P4728P	OBSCN_ENST00000284548.11_Silent_p.P4728P|OBSCN_ENST00000366707.4_Silent_p.P2362P|OBSCN_ENST00000366709.4_Silent_p.P1847P|OBSCN_ENST00000570156.2_Silent_p.P5685P	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	4728					apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				GCTTGCCCCCCGAGGCAGCCC	0.637																																					p.P5685P		Atlas-SNP	.											.	OBSCN	2142	.	0			c.C17055A						.						12.0	15.0	14.0					1																	228506637		2090	4211	6301	SO:0001819	synonymous_variant	84033	exon65			GCCCCCCGAGGCA	AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.14184C>A	chr1.hg19:g.228506637C>A		101.0	0.0		144.0	43.0	NM_001271223	Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Silent	SNP	ENST00000422127.1	hg19	CCDS58065.1																																																																																			.	.		0.637	OBSCN-204	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_052843	
CEP68	23177	hgsc.bcm.edu	37	2	65309718	65309718	+	Missense_Mutation	SNP	A	A	C			TCGA-2Y-A9GS-01A-12D-A382-10	TCGA-2Y-A9GS-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ce44141-64e4-4d9d-9971-4dc79b316d4a	27ea2725-9c48-4965-a503-91d2302923b4	g.chr2:65309718A>C	ENST00000377990.2	+	6	2356	c.2153A>C	c.(2152-2154)gAg>gCg	p.E718A	CEP68_ENST00000546106.1_3'UTR|CEP68_ENST00000260569.4_Missense_Mutation_p.E581A|RAB1A_ENST00000494188.1_Intron	NM_015147.2	NP_055962.2	Q76N32	CEP68_HUMAN	centrosomal protein 68kDa	718					centriole-centriole cohesion (GO:0010457)|centrosome organization (GO:0051297)|protein localization to organelle (GO:0033365)	centrosome (GO:0005813)|cytoplasm (GO:0005737)	protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)			breast(1)|endometrium(6)|kidney(8)|large_intestine(5)|lung(8)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	32						GGTGAGCTGGAGAGCCACGCA	0.493																																					p.E718A		Atlas-SNP	.											.	CEP68	69	.	0			c.A2153C						.						163.0	150.0	154.0					2																	65309718		2203	4300	6503	SO:0001583	missense	23177	exon6			AGCTGGAGAGCCA	BC004873	CCDS1880.2	2p14	2014-02-20	2005-12-01	2005-12-01	ENSG00000011523	ENSG00000011523			29076	protein-coding gene	gene with protein product			"""KIAA0582"""	KIAA0582		9628581, 9847074, 14654843	Standard	NM_015147		Approved		uc002sdl.4	Q76N32	OTTHUMG00000129538	ENST00000377990.2:c.2153A>C	chr2.hg19:g.65309718A>C	ENSP00000367229:p.Glu718Ala	115.0	0.0		151.0	37.0	NM_015147	B4DRQ1|D6W5F1|D6W5F2|O60326|Q9BQ18|Q9UDM9	Missense_Mutation	SNP	ENST00000377990.2	hg19	CCDS1880.2	.	.	.	.	.	.	.	.	.	.	A	21.9	4.211784	0.79240	.	.	ENSG00000011523	ENST00000377990;ENST00000260569	T;T	0.80566	-1.39;-1.39	5.73	4.56	0.56223	.	0.000000	0.64402	D	0.000003	T	0.77336	0.4115	M	0.62723	1.935	0.80722	D	1	P;P	0.40211	0.707;0.707	B;B	0.38655	0.278;0.278	T	0.74256	-0.3724	10	0.32370	T	0.25	-13.5397	12.9728	0.58522	0.8648:0.1352:0.0:0.0	.	718;581	Q76N32;Q76N32-2	CEP68_HUMAN;.	A	718;581	ENSP00000367229:E718A;ENSP00000260569:E581A	ENSP00000260569:E581A	E	+	2	0	CEP68	65163222	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.878000	0.75567	0.977000	0.38444	0.459000	0.35465	GAG	.	.		0.493	CEP68-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251727.2	NM_015147	
MRPL19	9801	hgsc.bcm.edu	37	2	75881940	75881940	+	Missense_Mutation	SNP	A	A	G			TCGA-2Y-A9GS-01A-12D-A382-10	TCGA-2Y-A9GS-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ce44141-64e4-4d9d-9971-4dc79b316d4a	27ea2725-9c48-4965-a503-91d2302923b4	g.chr2:75881940A>G	ENST00000393909.2	+	5	579	c.554A>G	c.(553-555)gAt>gGt	p.D185G	MRPL19_ENST00000409374.1_Missense_Mutation_p.D185G|MRPL19_ENST00000358788.6_Intron	NM_014763.3	NP_055578.2	P49406	RM19_HUMAN	mitochondrial ribosomal protein L19	185					translation (GO:0006412)	mitochondrion (GO:0005739)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|ribosome (GO:0005840)	structural constituent of ribosome (GO:0003735)			kidney(1)|large_intestine(1)|lung(6)	8						CGGCTGGATGATAGCTTGCTA	0.388																																					p.D185G		Atlas-SNP	.											.	MRPL19	21	.	0			c.A554G						.						137.0	127.0	131.0					2																	75881940		1871	4099	5970	SO:0001583	missense	9801	exon5			TGGATGATAGCTT	AB051621	CCDS1960.2	2p11.1-q11.2	2012-09-13			ENSG00000115364	ENSG00000115364		"""Mitochondrial ribosomal proteins / large subunits"""	14052	protein-coding gene	gene with protein product	"""39S ribosomal protein L19"""	611832				11543634, 17309879	Standard	XM_006712155		Approved	MRP-L15, RPML15, KIAA0104, RLX1	uc002snl.3	P49406	OTTHUMG00000129990	ENST00000393909.2:c.554A>G	chr2.hg19:g.75881940A>G	ENSP00000377486:p.Asp185Gly	113.0	0.0		155.0	43.0	NM_014763	Q53TX9|Q96Q52	Missense_Mutation	SNP	ENST00000393909.2	hg19	CCDS1960.2	.	.	.	.	.	.	.	.	.	.	A	13.29	2.192787	0.38707	.	.	ENSG00000115364	ENST00000393909;ENST00000409374	.	.	.	5.18	5.18	0.71444	Translation protein SH3-like (1);	0.233777	0.49916	D	0.000137	T	0.44244	0.1284	L	0.40543	1.245	0.80722	D	1	B	0.12013	0.005	B	0.14578	0.011	T	0.34453	-0.9828	9	0.21540	T	0.41	-12.0197	7.96	0.30066	0.9076:0.0:0.0924:0.0	.	185	P49406	RM19_HUMAN	G	185	.	ENSP00000377486:D185G	D	+	2	0	MRPL19	75735448	1.000000	0.71417	0.931000	0.37212	0.874000	0.50279	4.164000	0.58190	2.087000	0.62958	0.460000	0.39030	GAT	.	.		0.388	MRPL19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252256.1	NM_014763	
MGAT5	4249	hgsc.bcm.edu	37	2	135075151	135075151	+	Missense_Mutation	SNP	A	A	G			TCGA-2Y-A9GS-01A-12D-A382-10	TCGA-2Y-A9GS-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ce44141-64e4-4d9d-9971-4dc79b316d4a	27ea2725-9c48-4965-a503-91d2302923b4	g.chr2:135075151A>G	ENST00000409645.1	+	4	710	c.458A>G	c.(457-459)tAc>tGc	p.Y153C	MGAT5_ENST00000281923.2_Missense_Mutation_p.Y153C			Q09328	MGT5A_HUMAN	mannosyl (alpha-1,6-)-glycoprotein beta-1,6-N-acetyl-glucosaminyltransferase	153					cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	alpha-1,6-mannosylglycoprotein 6-beta-N-acetylglucosaminyltransferase activity (GO:0030144)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(3)|liver(1)|lung(18)|ovary(3)|pancreas(1)|skin(3)	36				BRCA - Breast invasive adenocarcinoma(221;0.0964)		ATGGACGGCTACCCTCACTGT	0.428																																					p.Y153C		Atlas-SNP	.											.	MGAT5	84	.	0			c.A458G						.						105.0	91.0	96.0					2																	135075151		2203	4300	6503	SO:0001583	missense	4249	exon3			ACGGCTACCCTCA	D17716	CCDS2171.1	2q21	2013-02-25			ENSG00000152127	ENSG00000152127	2.4.1.155	"""Mannosyl-glycoprotein beta N-acetylglucosaminyltransferases"""	7049	protein-coding gene	gene with protein product		601774				8292036	Standard	NM_002410		Approved	GNT-V	uc002ttw.4	Q09328	OTTHUMG00000131681	ENST00000409645.1:c.458A>G	chr2.hg19:g.135075151A>G	ENSP00000386377:p.Tyr153Cys	60.0	0.0		78.0	25.0	NM_002410	D3DP70	Missense_Mutation	SNP	ENST00000409645.1	hg19	CCDS2171.1	.	.	.	.	.	.	.	.	.	.	A	17.80	3.477450	0.63849	.	.	ENSG00000152127	ENST00000409645;ENST00000281923	.	.	.	5.44	4.24	0.50183	.	0.100947	0.64402	D	0.000002	T	0.50429	0.1615	L	0.52905	1.665	0.52501	D	0.999956	P	0.49447	0.924	P	0.45829	0.494	T	0.56408	-0.7984	9	0.87932	D	0	-19.619	9.5823	0.39495	0.7565:0.0:0.0:0.2434	.	153	Q09328	MGT5A_HUMAN	C	153	.	ENSP00000281923:Y153C	Y	+	2	0	MGAT5	134791621	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	3.879000	0.56138	2.068000	0.61886	0.533000	0.62120	TAC	.	.		0.428	MGAT5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254584.3	NM_002410	
LY75	4065	hgsc.bcm.edu	37	2	160708822	160708822	+	Nonsense_Mutation	SNP	T	T	A			TCGA-2Y-A9GS-01A-12D-A382-10	TCGA-2Y-A9GS-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ce44141-64e4-4d9d-9971-4dc79b316d4a	27ea2725-9c48-4965-a503-91d2302923b4	g.chr2:160708822T>A	ENST00000263636.4	-	21	2800	c.2773A>T	c.(2773-2775)Aag>Tag	p.K925*	LY75_ENST00000553424.1_Nonsense_Mutation_p.K925*|LY75-CD302_ENST00000504764.1_Nonsense_Mutation_p.K925*|LY75-CD302_ENST00000505052.1_Nonsense_Mutation_p.K925*|LY75_ENST00000554112.1_Nonsense_Mutation_p.K925*	NM_002349.3	NP_002340.2	O60449	LY75_HUMAN	lymphocyte antigen 75	925	C-type lectin 5. {ECO:0000255|PROSITE- ProRule:PRU00040}.				endocytosis (GO:0006897)|immune response (GO:0006955)|inflammatory response (GO:0006954)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)			NS(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(22)|prostate(7)|skin(6)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	59				COAD - Colon adenocarcinoma(177;0.132)		AAGGGCAACTTGGTACTACAG	0.358																																					p.K925X		Atlas-SNP	.											.	LY75	151	.	0			c.A2773T						.						82.0	85.0	84.0					2																	160708822		2203	4300	6503	SO:0001587	stop_gained	4065	exon21			GCAACTTGGTACT	AF011333	CCDS2211.1	2q24	2011-08-30			ENSG00000054219	ENSG00000054219		"""CD molecules"", ""C-type lectin domain containing"""	6729	protein-coding gene	gene with protein product		604524				9553150	Standard	NM_002349		Approved	DEC-205, CLEC13B, CD205		O60449	OTTHUMG00000132025	ENST00000263636.4:c.2773A>T	chr2.hg19:g.160708822T>A	ENSP00000263636:p.Lys925*	129.0	0.0		158.0	51.0	NM_002349	O75913|Q53R46|Q53TF5|Q7Z575|Q7Z577	Nonsense_Mutation	SNP	ENST00000263636.4	hg19	CCDS2211.1	.	.	.	.	.	.	.	.	.	.	T	39	7.675614	0.98425	.	.	ENSG00000054219;ENSG00000054219;ENSG00000054219;ENSG00000248672;ENSG00000248672	ENST00000554112;ENST00000553424;ENST00000263636;ENST00000504764;ENST00000505052	.	.	.	5.12	3.88	0.44766	.	0.000000	0.33496	U	0.004843	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.40728	T	0.16	-11.251	8.5401	0.33388	0.0:0.0:0.1955:0.8045	.	.	.	.	X	925	.	ENSP00000423463:K925X	K	-	1	0	LY75;LY75-CD302	160417068	0.994000	0.37717	1.000000	0.80357	0.862000	0.49288	1.919000	0.40015	2.058000	0.61347	0.477000	0.44152	AAG	.	.		0.358	LY75-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000255035.1		
TTN	7273	hgsc.bcm.edu	37	2	179474818	179474818	+	Splice_Site	SNP	C	C	A			TCGA-2Y-A9GS-01A-12D-A382-10	TCGA-2Y-A9GS-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ce44141-64e4-4d9d-9971-4dc79b316d4a	27ea2725-9c48-4965-a503-91d2302923b4	g.chr2:179474818C>A	ENST00000591111.1	-	221	46736	c.46512G>T	c.(46510-46512)aaG>aaT	p.K15504N	TTN_ENST00000359218.5_Splice_Site_p.K8205N|TTN_ENST00000460472.2_Splice_Site_p.K8080N|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000589907.1_RNA|TTN_ENST00000342175.6_Splice_Site_p.K8272N|TTN-AS1_ENST00000589487.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000589234.1_RNA|TTN_ENST00000589042.1_Splice_Site_p.K17145N|TTN_ENST00000342992.6_Splice_Site_p.K14577N|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000589830.1_RNA			Q8WZ42	TITIN_HUMAN	titin	15504					adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CAAACTTACGCTTTGGATCTT	0.358																																					p.K17145N		Atlas-SNP	.											.	TTN	18412	.	0			c.G51435T						.						60.0	60.0	60.0					2																	179474818		1898	4116	6014	SO:0001630	splice_region_variant	7273	exon271			CTTACGCTTTGGA	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.46513+1G>T	chr2.hg19:g.179474818C>A		70.0	0.0		96.0	37.0	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	hg19		.	.	.	.	.	.	.	.	.	.	C	10.10	1.257136	0.22965	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.53640	0.61;0.61;0.61;0.61	5.48	2.6	0.31112	Fibronectin, type III (1);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.57080	0.2029	L	0.45422	1.42	0.43890	D	0.996515	D;D;D;D	0.76494	0.999;0.999;0.999;0.999	D;D;D;D	0.80764	0.994;0.994;0.994;0.994	T	0.56980	-0.7889	9	0.87932	D	0	.	10.0869	0.42423	0.0:0.694:0.0:0.306	.	8080;8205;8272;15504	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	N	14577;8080;8272;8205;8080	ENSP00000343764:K14577N;ENSP00000434586:K8080N;ENSP00000340554:K8272N;ENSP00000352154:K8205N	ENSP00000340554:K8272N	K	-	3	2	TTN	179183063	0.984000	0.35163	1.000000	0.80357	0.997000	0.91878	0.225000	0.17757	0.632000	0.30432	0.655000	0.94253	AAG	.	.		0.358	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	Missense_Mutation
ANKRD44	91526	hgsc.bcm.edu	37	2	197948210	197948210	+	Missense_Mutation	SNP	G	G	A			TCGA-2Y-A9GS-01A-12D-A382-10	TCGA-2Y-A9GS-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ce44141-64e4-4d9d-9971-4dc79b316d4a	27ea2725-9c48-4965-a503-91d2302923b4	g.chr2:197948210G>A	ENST00000328737.2	-	14	1341	c.1265C>T	c.(1264-1266)gCg>gTg	p.A422V	ANKRD44_ENST00000539527.1_Missense_Mutation_p.A375V|ANKRD44_ENST00000450567.1_Missense_Mutation_p.A422V|ANKRD44_ENST00000477852.1_5'UTR|ANKRD44_ENST00000282272.8_Missense_Mutation_p.A439V|ANKRD44_ENST00000337207.5_Missense_Mutation_p.A422V|ANKRD44_ENST00000409153.1_Missense_Mutation_p.A447V			Q8N8A2	ANR44_HUMAN	ankyrin repeat domain 44	447										NS(1)|endometrium(3)|kidney(2)|large_intestine(9)|lung(20)|ovary(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	45			OV - Ovarian serous cystadenocarcinoma(117;0.246)			ATGACAATTCGCAGCTGCATA	0.473																																					p.A447V		Atlas-SNP	.											.	ANKRD44	281	.	0			c.C1340T						.						119.0	104.0	109.0					2																	197948210		2203	4300	6503	SO:0001583	missense	91526	exon14			CAATTCGCAGCTG	AK097086	CCDS33355.1, CCDS33355.2, CCDS74619.1	2q33.1	2013-01-10			ENSG00000065413	ENSG00000065413		"""Serine/threonine phosphatases / Protein phosphatase 6, regulatory subunits"", ""Ankyrin repeat domain containing"""	25259	protein-coding gene	gene with protein product	"""protein phosphatase 6 ankyrin repeat subunit B"""						Standard	NM_153697		Approved	PP6-ARS-B	uc021vuj.1	Q8N8A2	OTTHUMG00000154411	ENST00000328737.2:c.1265C>T	chr2.hg19:g.197948210G>A	ENSP00000331516:p.Ala422Val	97.0	0.0		89.0	39.0	NM_001195144	Q53SL9|Q6P480|Q86VL5|Q8IZ72|Q9UFA4	Missense_Mutation	SNP	ENST00000328737.2	hg19		.	.	.	.	.	.	.	.	.	.	G	19.96	3.923121	0.73213	.	.	ENSG00000065413	ENST00000424317;ENST00000282272;ENST00000328737;ENST00000450567;ENST00000337207;ENST00000422886;ENST00000409153;ENST00000539527	T;T;T;T;T;T;T;T	0.65916	-0.07;-0.18;-0.14;-0.14;-0.18;-0.18;-0.16;-0.18	5.65	4.77	0.60923	.	0.000000	0.85682	D	0.000000	T	0.50326	0.1609	L	0.37750	1.13	0.58432	D	0.999994	P;B;B	0.37731	0.607;0.053;0.022	B;B;B	0.32677	0.15;0.032;0.02	T	0.51293	-0.8724	10	0.35671	T	0.21	.	15.0175	0.71597	0.0679:0.0:0.9321:0.0	.	375;447;465	F5H682;Q8N8A2-3;Q8N8A2-2	.;.;.	V	262;439;422;422;422;122;447;375	ENSP00000403415:A262V;ENSP00000282272:A439V;ENSP00000331516:A422V;ENSP00000402420:A422V;ENSP00000338794:A422V;ENSP00000416319:A122V;ENSP00000387141:A447V;ENSP00000437825:A375V	ENSP00000282272:A439V	A	-	2	0	ANKRD44	197656455	1.000000	0.71417	0.979000	0.43373	0.941000	0.58515	7.827000	0.86722	1.627000	0.50400	0.655000	0.94253	GCG	.	.		0.473	ANKRD44-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000335113.1	NM_153697	
CTDSP1	58190	hgsc.bcm.edu	37	2	219268014	219268014	+	Missense_Mutation	SNP	T	T	G			TCGA-2Y-A9GS-01A-12D-A382-10	TCGA-2Y-A9GS-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ce44141-64e4-4d9d-9971-4dc79b316d4a	27ea2725-9c48-4965-a503-91d2302923b4	g.chr2:219268014T>G	ENST00000273062.2	+	6	867	c.531T>G	c.(529-531)ttT>ttG	p.F177L	CTDSP1_ENST00000488627.1_3'UTR|CTDSP1_ENST00000443891.1_Missense_Mutation_p.F176L|MIR26B_ENST00000362251.2_RNA	NM_021198.2|NM_182642.2	NP_067021.1|NP_872580.1	Q9GZU7	CTDS1_HUMAN	CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase 1	177	FCP1 homology. {ECO:0000255|PROSITE- ProRule:PRU00336}.				negative regulation of neurogenesis (GO:0050768)|negative regulation of neuron differentiation (GO:0045665)|protein dephosphorylation (GO:0006470)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	CTD phosphatase activity (GO:0008420)|metal ion binding (GO:0046872)			NS(1)|large_intestine(2)|lung(3)|ovary(1)|skin(1)	8		Renal(207;0.0915)		Epithelial(149;9.96e-07)|all cancers(144;0.00017)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		CCCGGCTGTTTCGAGAGTCCT	0.642																																					p.F177L		Atlas-SNP	.											.	CTDSP1	19	.	0			c.T531G						.						50.0	58.0	55.0					2																	219268014		2203	4300	6503	SO:0001583	missense	58190	exon6			GCTGTTTCGAGAG	AF229162	CCDS2416.1, CCDS56166.1	2q35	2010-06-21			ENSG00000144579	ENSG00000144579		"""Serine/threonine phosphatases / CTD aspartate-based phosphatases"""	21614	protein-coding gene	gene with protein product	"""nuclear LIM interactor-interacting factor"", ""small CTD phosphatase 1"""	605323				11950066, 12721286	Standard	NM_021198		Approved	NLIIF, SCP1	uc021vwv.1	Q9GZU7	OTTHUMG00000133109	ENST00000273062.2:c.531T>G	chr2.hg19:g.219268014T>G	ENSP00000273062:p.Phe177Leu	90.0	0.0		126.0	52.0	NM_021198	C9IYG0|Q7Z5Q3|Q7Z5Q4	Missense_Mutation	SNP	ENST00000273062.2	hg19	CCDS2416.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	24.5|24.5	4.540554|4.540554	0.85917|0.85917	.|.	.|.	ENSG00000144579|ENSG00000144579	ENST00000452977;ENST00000428361|ENST00000443891;ENST00000273062	T;T|T;T	0.19105|0.18502	2.17;2.17|2.21;2.21	4.64|4.64	-0.283|-0.283	0.12874|0.12874	.|NLI interacting factor (3);Dullard phosphatase domain, eukaryotic (1);HAD-like domain (2);	0.000000|0.000000	0.85682|0.85682	D|D	0.000000|0.000000	T|T	0.52435|0.52435	0.1734|0.1734	H|H	0.98388|0.98388	4.22|4.22	0.58432|0.58432	D|D	0.999999|0.999999	.|D;D	.|0.89917	.|1.0;1.0	.|D;D	.|0.87578	.|0.998;0.998	T|T	0.61312|0.61312	-0.7088|-0.7088	8|10	0.87932|0.87932	D|D	0|0	-15.0159|-15.0159	8.764|8.764	0.34692|0.34692	0.0:0.6021:0.0:0.3979|0.0:0.6021:0.0:0.3979	.|.	.|177;176	.|Q9GZU7;C9IYG0	.|CTDS1_HUMAN;.	C|L	170;178|176;177	ENSP00000404301:F170C;ENSP00000403256:F178C|ENSP00000392248:F176L;ENSP00000273062:F177L	ENSP00000403256:F178C|ENSP00000273062:F177L	F|F	+|+	2|3	0|2	CTDSP1|CTDSP1	218976258|218976258	0.996000|0.996000	0.38824|0.38824	0.974000|0.974000	0.42286|0.42286	0.975000|0.975000	0.68041|0.68041	0.522000|0.522000	0.22909|0.22909	0.173000|0.173000	0.19788|0.19788	0.402000|0.402000	0.26972|0.26972	TTC|TTT	.	.		0.642	CTDSP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256774.1	NM_182642, NM_021198	
PTPRN	5798	hgsc.bcm.edu	37	2	220167459	220167459	+	Missense_Mutation	SNP	G	G	A			TCGA-2Y-A9GS-01A-12D-A382-10	TCGA-2Y-A9GS-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ce44141-64e4-4d9d-9971-4dc79b316d4a	27ea2725-9c48-4965-a503-91d2302923b4	g.chr2:220167459G>A	ENST00000295718.2	-	5	718	c.478C>T	c.(478-480)Cca>Tca	p.P160S	AC114803.3_ENST00000417355.1_RNA|PTPRN_ENST00000409251.3_Missense_Mutation_p.P160S|PTPRN_ENST00000423636.2_Missense_Mutation_p.P70S	NM_002846.3	NP_002837.1	Q16849	PTPRN_HUMAN	protein tyrosine phosphatase, receptor type, N	160					cytokine-mediated signaling pathway (GO:0019221)|peptidyl-tyrosine dephosphorylation (GO:0035335)|response to cAMP (GO:0051591)|response to estrogen (GO:0043627)|response to glucose (GO:0009749)|response to insulin (GO:0032868)|response to reactive oxygen species (GO:0000302)	integral component of plasma membrane (GO:0005887)	spectrin binding (GO:0030507)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(3)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(28)|ovary(3)|prostate(4)|skin(11)|upper_aerodigestive_tract(1)|urinary_tract(1)	65		Renal(207;0.0474)		Epithelial(149;4.22e-07)|all cancers(144;8.82e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)|STAD - Stomach adenocarcinoma(1183;0.0875)		CCCACTGGTGGTTGTGGAAGC	0.647																																					p.P160S		Atlas-SNP	.											.	PTPRN	138	.	0			c.C478T						.						46.0	53.0	51.0					2																	220167459		2203	4299	6502	SO:0001583	missense	5798	exon5			CTGGTGGTTGTGG		CCDS2440.1, CCDS56167.1, CCDS56168.1	2q35-q36.1	2011-06-09			ENSG00000054356	ENSG00000054356		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"""	9676	protein-coding gene	gene with protein product		601773				8024693	Standard	NM_001199763		Approved	IA-2	uc002vkz.3	Q16849	OTTHUMG00000133129	ENST00000295718.2:c.478C>T	chr2.hg19:g.220167459G>A	ENSP00000295718:p.Pro160Ser	93.0	0.0		124.0	37.0	NM_002846	B4DK12|F5GZS3|Q08319|Q53QD6|Q6NSL1	Missense_Mutation	SNP	ENST00000295718.2	hg19	CCDS2440.1	.	.	.	.	.	.	.	.	.	.	G	3.391	-0.124350	0.06795	.	.	ENSG00000054356	ENST00000409251;ENST00000295718;ENST00000539342;ENST00000537666;ENST00000412847;ENST00000446182;ENST00000440552;ENST00000442029	T;T;T	0.03580	3.88;3.97;3.99	4.79	3.91	0.45181	.	0.214419	0.31566	N	0.007434	T	0.03827	0.0108	L	0.44542	1.39	0.09310	N	0.999995	B;B	0.11235	0.004;0.002	B;B	0.10450	0.005;0.003	T	0.42732	-0.9434	10	0.12430	T	0.62	.	10.4929	0.44760	0.0916:0.0:0.9084:0.0	.	160;160	Q6NSL1;Q16849	.;PTPRN_HUMAN	S	160;160;160;70;70;70;127;70	ENSP00000386638:P160S;ENSP00000295718:P160S;ENSP00000444244:P70S	ENSP00000295718:P160S	P	-	1	0	PTPRN	219875703	0.994000	0.37717	0.118000	0.21660	0.021000	0.10359	2.871000	0.48459	1.231000	0.43661	0.561000	0.74099	CCA	.	.		0.647	PTPRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256819.2		
PRR21	643905	hgsc.bcm.edu	37	2	240981415	240981415	+	Missense_Mutation	SNP	A	A	G	rs113785129		TCGA-2Y-A9GS-01A-12D-A382-10	TCGA-2Y-A9GS-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ce44141-64e4-4d9d-9971-4dc79b316d4a	27ea2725-9c48-4965-a503-91d2302923b4	g.chr2:240981415A>G	ENST00000408934.1	-	1	984	c.985T>C	c.(985-987)Tct>Cct	p.S329P		NM_001080835.1	NP_001074304.1	Q8WXC7	PRR21_HUMAN	proline rich 21	329										NS(1)|breast(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(3)|lung(7)|ovary(2)|prostate(5)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)	29						GGGTGAAGAGACGTGGATGAA	0.597																																					p.S329P		Atlas-SNP	.											.	PRR21	53	.	0			c.T985C						.						196.0	173.0	181.0					2																	240981415		2203	4300	6503	SO:0001583	missense	643905	exon1			GAAGAGACGTGGA	AF453950	CCDS33417.1	2q37.3	2009-04-20			ENSG00000221961	ENSG00000221961			33866	protein-coding gene	gene with protein product							Standard	NM_001080835		Approved		uc010zod.2	Q8WXC7	OTTHUMG00000159174	ENST00000408934.1:c.985T>C	chr2.hg19:g.240981415A>G	ENSP00000386166:p.Ser329Pro	72.0	0.0		96.0	5.0	NM_001080835		Missense_Mutation	SNP	ENST00000408934.1	hg19	CCDS33417.1	.	.	.	.	.	.	.	.	.	.	-	1.195	-0.634159	0.03584	.	.	ENSG00000221961	ENST00000408934;ENST00000486799	T;T	0.14391	2.51;2.51	0.698	-1.4	0.08968	.	.	.	.	.	T	0.05456	0.0144	N	0.08118	0	0.09310	N	1	B	0.09022	0.002	B	0.01281	0.0	T	0.34925	-0.9809	8	0.44086	T	0.13	.	.	.	.	.	329	Q8WXC7	PRR21_HUMAN	P	329	ENSP00000386166:S329P;ENSP00000418240:S329P	ENSP00000386166:S329P	S	-	1	0	PRR21	240630088	0.000000	0.05858	0.000000	0.03702	0.016000	0.09150	-5.007000	0.00160	-1.155000	0.02822	0.138000	0.15974	TCT	.	A|0.500;G|0.500		0.597	PRR21-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001080835	
CLASP2	23122	hgsc.bcm.edu	37	3	33725916	33725916	+	Missense_Mutation	SNP	C	C	G			TCGA-2Y-A9GS-01A-12D-A382-10	TCGA-2Y-A9GS-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ce44141-64e4-4d9d-9971-4dc79b316d4a	27ea2725-9c48-4965-a503-91d2302923b4	g.chr3:33725916C>G	ENST00000468888.2	-	6	625	c.579G>C	c.(577-579)gaG>gaC	p.E193D	CLASP2_ENST00000307312.7_5'UTR|CLASP2_ENST00000359576.5_Missense_Mutation_p.E193D|CLASP2_ENST00000399362.4_Missense_Mutation_p.E193D			O75122	CLAP2_HUMAN	cytoplasmic linker associated protein 2	1246					axon guidance (GO:0007411)|establishment or maintenance of cell polarity (GO:0007163)|fucosylation (GO:0036065)|microtubule anchoring (GO:0034453)|microtubule nucleation (GO:0007020)|microtubule organizing center organization (GO:0031023)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of microtubule depolymerization (GO:0007026)|regulation of microtubule polymerization or depolymerization (GO:0031110)|regulation of microtubule-based process (GO:0032886)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|kinetochore (GO:0000776)|kinetochore microtubule (GO:0005828)|membrane (GO:0016020)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|trans-Golgi network (GO:0005802)	galactoside 2-alpha-L-fucosyltransferase activity (GO:0008107)|microtubule plus-end binding (GO:0051010)			breast(2)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(19)|ovary(3)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	48						GTCTATAAATCTCCACTATAG	0.323																																					p.E193D		Atlas-SNP	.											.	CLASP2	138	.	0			c.G579C						.						137.0	136.0	137.0					3																	33725916		1819	4079	5898	SO:0001583	missense	23122	exon6			ATAAATCTCCACT	AB014527		3p24.3	2013-01-18			ENSG00000163539	ENSG00000163539			17078	protein-coding gene	gene with protein product		605853				9734811, 10899121	Standard	NM_015097		Approved	KIAA0627	uc021wvc.1	O75122	OTTHUMG00000156489	ENST00000468888.2:c.579G>C	chr3.hg19:g.33725916C>G	ENSP00000419974:p.Glu193Asp	296.0	0.0		327.0	133.0	NM_015097	Q7L8F6|Q8N6R6|Q9BQT3|Q9BQT4|Q9H7A3|Q9NSZ2	Missense_Mutation	SNP	ENST00000468888.2	hg19		.	.	.	.	.	.	.	.	.	.	C	14.02	2.411477	0.42817	.	.	ENSG00000163539	ENST00000468888;ENST00000399362;ENST00000359576	T;T;T	0.45668	0.89;0.89;0.89	5.12	2.33	0.28932	.	0.062472	0.64402	D	0.000006	T	0.29491	0.0735	L	0.35854	1.095	0.80722	D	1	B	0.11235	0.004	B	0.11329	0.006	T	0.06991	-1.0796	10	0.35671	T	0.21	-13.6418	8.0237	0.30425	0.0:0.7373:0.0:0.2627	.	193	F5H604	.	D	193	ENSP00000419974:E193D;ENSP00000382297:E193D;ENSP00000352581:E193D	ENSP00000352581:E193D	E	-	3	2	CLASP2	33700920	0.999000	0.42202	1.000000	0.80357	0.970000	0.65996	0.412000	0.21131	0.677000	0.31305	0.650000	0.86243	GAG	.	.		0.323	CLASP2-001	NOVEL	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000344320.4	NM_001207044	
FRMD4B	23150	hgsc.bcm.edu	37	3	69230791	69230791	+	Missense_Mutation	SNP	C	C	T	rs527581690	byFrequency	TCGA-2Y-A9GS-01A-12D-A382-10	TCGA-2Y-A9GS-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ce44141-64e4-4d9d-9971-4dc79b316d4a	27ea2725-9c48-4965-a503-91d2302923b4	g.chr3:69230791C>T	ENST00000398540.3	-	21	2193	c.2110G>A	c.(2110-2112)Gag>Aag	p.E704K	FRMD4B_ENST00000542259.1_Missense_Mutation_p.E650K|FRMD4B_ENST00000478263.1_Missense_Mutation_p.E356K	NM_015123.1	NP_055938	Q9Y2L6	FRM4B_HUMAN	FERM domain containing 4B	704					establishment of epithelial cell polarity (GO:0090162)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular space (GO:0005615)|ruffle (GO:0001726)				NS(2)|central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(3)|lung(1)|ovary(3)|prostate(3)|skin(2)	19		Lung NSC(201;0.0138)|Prostate(884;0.11)		BRCA - Breast invasive adenocarcinoma(55;0.000201)|Epithelial(33;0.00141)|LUSC - Lung squamous cell carcinoma(21;0.00999)|Lung(16;0.0182)		CTGTCCATCTCGGAGAGCAGG	0.517													C|||	2	0.000399361	0.0015	0.0	5008	,	,		19136	0.0		0.0	False		,,,				2504	0.0				p.E704K		Atlas-SNP	.											.	FRMD4B	90	.	0			c.G2110A						.						54.0	53.0	53.0					3																	69230791		1974	4153	6127	SO:0001583	missense	23150	exon21			CCATCTCGGAGAG	AL832231	CCDS46863.1	3p14.2	2006-04-12			ENSG00000114541	ENSG00000114541			24886	protein-coding gene	gene with protein product						10231032, 11445584	Standard	XM_005264720		Approved	KIAA1013, GRSP1	uc003dnv.2	Q9Y2L6	OTTHUMG00000158772	ENST00000398540.3:c.2110G>A	chr3.hg19:g.69230791C>T	ENSP00000381549:p.Glu704Lys	136.0	0.0		132.0	45.0	NM_015123	Q8TAI3	Missense_Mutation	SNP	ENST00000398540.3	hg19	CCDS46863.1	.	.	.	.	.	.	.	.	.	.	C	23.0	4.361359	0.82353	.	.	ENSG00000114541	ENST00000398540;ENST00000542259;ENST00000478263	D;D	0.86627	-2.15;-2.12	5.98	5.98	0.97165	.	0.100920	0.64402	D	0.000003	D	0.90068	0.6898	M	0.69823	2.125	0.58432	D	0.999999	D;D	0.62365	0.991;0.975	P;B	0.48089	0.566;0.434	D	0.90614	0.4554	10	0.72032	D	0.01	-27.5628	20.452	0.99131	0.0:1.0:0.0:0.0	.	548;704	B4DHD5;Q9Y2L6	.;FRM4B_HUMAN	K	704;650;356	ENSP00000381549:E704K;ENSP00000437658:E650K	ENSP00000381549:E704K	E	-	1	0	FRMD4B	69313481	1.000000	0.71417	0.975000	0.42487	0.877000	0.50540	5.750000	0.68712	2.838000	0.97847	0.591000	0.81541	GAG	.	.		0.517	FRMD4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352111.1		
MUC4	4585	hgsc.bcm.edu	37	3	195509689	195509689	+	Missense_Mutation	SNP	G	G	T	rs59620726		TCGA-2Y-A9GS-01A-12D-A382-10	TCGA-2Y-A9GS-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ce44141-64e4-4d9d-9971-4dc79b316d4a	27ea2725-9c48-4965-a503-91d2302923b4	g.chr3:195509689G>T	ENST00000463781.3	-	2	9221	c.8762C>A	c.(8761-8763)gCa>gAa	p.A2921E	MUC4_ENST00000346145.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.A2921E|MUC4_ENST00000349607.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)	p.A2921V(2)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		ACCTGTGGATGCTGAGGAAGT	0.577																																					p.A2921E		Atlas-SNP	.											MUC4_ENST00000463781,NS,carcinoma,0,2	MUC4	1505	.	2	Substitution - Missense(2)	stomach(2)	c.C8762A						.						13.0	9.0	10.0					3																	195509689		673	1544	2217	SO:0001583	missense	4585	exon2			GTGGATGCTGAGG	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.8762C>A	chr3.hg19:g.195509689G>T	ENSP00000417498:p.Ala2921Glu	50.0	1.0		53.0	4.0	NM_018406	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	hg19	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	g	5.873	0.345156	0.11126	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.33216	1.42;1.47	.	.	.	.	.	.	.	.	T	0.27629	0.0679	N	0.19112	0.55	0.09310	N	1	D	0.57257	0.979	P	0.60789	0.879	T	0.11348	-1.0591	7	.	.	.	.	2.1665	0.03838	0.3292:0.3381:0.3327:0.0	.	2793	E7ESK3	.	E	2921	ENSP00000417498:A2921E;ENSP00000420243:A2921E	.	A	-	2	0	MUC4	196994468	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.843000	0.01680	-0.000000	0.14550	0.000000	0.15137	GCA	.	G|0.997;A|0.003		0.577	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
GABRG1	2565	hgsc.bcm.edu	37	4	46043212	46043212	+	Silent	SNP	C	C	T			TCGA-2Y-A9GS-01A-12D-A382-10	TCGA-2Y-A9GS-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ce44141-64e4-4d9d-9971-4dc79b316d4a	27ea2725-9c48-4965-a503-91d2302923b4	g.chr4:46043212C>T	ENST00000295452.4	-	9	1358	c.1191G>A	c.(1189-1191)ccG>ccA	p.P397P		NM_173536.3	NP_775807.2	Q8N1C3	GBRG1_HUMAN	gamma-aminobutyric acid (GABA) A receptor, gamma 1	397					gamma-aminobutyric acid signaling pathway (GO:0007214)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|postsynaptic membrane (GO:0045211)|receptor complex (GO:0043235)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)	p.P397P(1)		breast(2)|central_nervous_system(5)|endometrium(3)|kidney(4)|large_intestine(11)|liver(1)|lung(37)|ovary(2)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	76				Lung(65;0.106)|LUSC - Lung squamous cell carcinoma(721;0.23)	Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Ketazolam(DB01587)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	CATCTTCTTGCGGCACAGAAA	0.408																																					p.P397P		Atlas-SNP	.											GABRG1,NS,lymphoid_neoplasm,-1,1	GABRG1	172	.	1	Substitution - coding silent(1)	prostate(1)	c.G1191A						.						82.0	84.0	83.0					4																	46043212		2203	4300	6503	SO:0001819	synonymous_variant	2565	exon9			TTCTTGCGGCACA	BC031087	CCDS3470.1	4p12	2012-06-22			ENSG00000163285	ENSG00000163285		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4086	protein-coding gene	gene with protein product	"""GABA(A) receptor, gamma"""	137166				1321425	Standard	NM_173536		Approved		uc003gxb.3	Q8N1C3	OTTHUMG00000128609	ENST00000295452.4:c.1191G>A	chr4.hg19:g.46043212C>T		102.0	1.0		90.0	40.0	NM_173536	Q5H9T8	Silent	SNP	ENST00000295452.4	hg19	CCDS3470.1																																																																																			.	.		0.408	GABRG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250470.1	NM_173536	
BASP1	10409	hgsc.bcm.edu	37	5	17275720	17275720	+	Missense_Mutation	SNP	G	G	A			TCGA-2Y-A9GS-01A-12D-A382-10	TCGA-2Y-A9GS-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ce44141-64e4-4d9d-9971-4dc79b316d4a	27ea2725-9c48-4965-a503-91d2302923b4	g.chr5:17275720G>A	ENST00000322611.3	+	2	655	c.395G>A	c.(394-396)aGc>aAc	p.S132N		NM_001271606.1|NM_006317.3	NP_001258535.1|NP_006308.3	P80723	BASP1_HUMAN	brain abundant, membrane attached signal protein 1	132				APAES -> GPRPR (in Ref. 1; AAC67374). {ECO:0000305}.	diaphragm development (GO:0060539)|glomerular visceral epithelial cell differentiation (GO:0072112)|gonad development (GO:0008406)|mesenchymal to epithelial transition (GO:0060231)|metanephric mesenchyme development (GO:0072075)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of heart growth (GO:0060421)|positive regulation of metanephric ureteric bud development (GO:2001076)|substantia nigra development (GO:0021762)|thorax and anterior abdomen determination (GO:0007356)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	protein domain specific binding (GO:0019904)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)			endometrium(1)|lung(8)	9						ccggccgagagcgcggcccct	0.761																																					p.S132N		Atlas-SNP	.											.	BASP1	29	.	0			c.G395A						.						2.0	2.0	2.0					5																	17275720		1319	2883	4202	SO:0001583	missense	10409	exon2			CCGAGAGCGCGGC	AF039656	CCDS3888.1	5p15.1	2010-12-03			ENSG00000176788	ENSG00000176788			957	protein-coding gene	gene with protein product		605940				9310187, 9749536	Standard	NM_001271606		Approved	NAP-22, NAP22, CAP23, CAP-23	uc031siz.1	P80723	OTTHUMG00000131061	ENST00000322611.3:c.395G>A	chr5.hg19:g.17275720G>A	ENSP00000319281:p.Ser132Asn	78.0	0.0		103.0	43.0	NM_006317	B4DJA8|D3DTD5|O43596|Q5U0S0|Q9BWA5	Missense_Mutation	SNP	ENST00000322611.3	hg19	CCDS3888.1	.	.	.	.	.	.	.	.	.	.	G	9.050	0.991905	0.18966	.	.	ENSG00000176788	ENST00000322611	T	0.49432	0.78	4.16	3.29	0.37713	.	0.828878	0.09610	U	0.779067	T	0.28566	0.0707	N	0.08118	0	0.09310	N	1	B	0.30211	0.273	B	0.22601	0.04	T	0.18840	-1.0324	10	0.62326	D	0.03	-0.0563	11.2865	0.49224	0.0:0.7283:0.2717:0.0	.	132	P80723	BASP1_HUMAN	N	132	ENSP00000319281:S132N	ENSP00000319281:S132N	S	+	2	0	BASP1	17328720	0.033000	0.19621	0.005000	0.12908	0.696000	0.40369	1.555000	0.36277	0.743000	0.32719	0.298000	0.19748	AGC	.	.		0.761	BASP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253716.2		
PDZD2	23037	hgsc.bcm.edu	37	5	31983276	31983276	+	Silent	SNP	G	G	A			TCGA-2Y-A9GS-01A-12D-A382-10	TCGA-2Y-A9GS-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ce44141-64e4-4d9d-9971-4dc79b316d4a	27ea2725-9c48-4965-a503-91d2302923b4	g.chr5:31983276G>A	ENST00000438447.1	+	3	880	c.492G>A	c.(490-492)caG>caA	p.Q164Q	PDZD2_ENST00000282493.3_Silent_p.Q164Q			O15018	PDZD2_HUMAN	PDZ domain containing 2	164	PDZ 1. {ECO:0000255|PROSITE- ProRule:PRU00143}.				cell adhesion (GO:0007155)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|nucleus (GO:0005634)				NS(2)|breast(4)|central_nervous_system(5)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(31)|lung(58)|ovary(6)|prostate(2)|skin(8)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	148						TGGCTGAGCAGTGCTGGAATG	0.532																																					p.Q164Q		Atlas-SNP	.											.	PDZD2	306	.	0			c.G492A						.						93.0	98.0	97.0					5																	31983276		2203	4300	6503	SO:0001819	synonymous_variant	23037	exon2			TGAGCAGTGCTGG	AB002298	CCDS34137.1	5p14.1	2008-02-05	2006-01-24	2006-01-24		ENSG00000133401			18486	protein-coding gene	gene with protein product		610697	"""PDZ domain containing 3"""	PDZK3		9205841	Standard	XM_005248271		Approved	KIAA0300	uc003jhm.3	O15018		ENST00000438447.1:c.492G>A	chr5.hg19:g.31983276G>A		61.0	0.0		80.0	26.0	NM_178140	Q9BXD4	Silent	SNP	ENST00000438447.1	hg19	CCDS34137.1																																																																																			.	.		0.532	PDZD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366608.1		
EDIL3	10085	hgsc.bcm.edu	37	5	83433153	83433153	+	Silent	SNP	A	A	C			TCGA-2Y-A9GS-01A-12D-A382-10	TCGA-2Y-A9GS-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ce44141-64e4-4d9d-9971-4dc79b316d4a	27ea2725-9c48-4965-a503-91d2302923b4	g.chr5:83433153A>C	ENST00000296591.5	-	5	793	c.375T>G	c.(373-375)gtT>gtG	p.V125V	EDIL3_ENST00000380138.3_Silent_p.V115V	NM_005711.3	NP_005702.3	O43854	EDIL3_HUMAN	EGF-like repeats and discoidin I-like domains 3	125	EGF-like 3. {ECO:0000255|PROSITE- ProRule:PRU00076}.				cell adhesion (GO:0007155)|multicellular organismal development (GO:0007275)|positive regulation of cell-substrate adhesion (GO:0010811)	extracellular vesicular exosome (GO:0070062)|vesicle (GO:0031982)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)			cervix(1)|endometrium(2)|kidney(3)|large_intestine(6)|lung(10)|ovary(1)|prostate(5)|skin(3)	31		Lung NSC(167;0.000121)|all_lung(232;0.000154)|Ovarian(174;0.0425)		OV - Ovarian serous cystadenocarcinoma(54;4.3e-40)|Epithelial(54;4.79e-32)|all cancers(79;1.54e-26)		TGCAAGGCTCAACTTCGCATT	0.333																																					p.V125V		Atlas-SNP	.											.	EDIL3	94	.	0			c.T375G						.						172.0	153.0	159.0					5																	83433153		2203	4300	6503	SO:0001819	synonymous_variant	10085	exon5			AGGCTCAACTTCG	U70312	CCDS4062.1, CCDS64195.1	5q14	2008-02-05			ENSG00000164176	ENSG00000164176			3173	protein-coding gene	gene with protein product		606018				9420328	Standard	NM_005711		Approved	DEL1	uc003kio.1	O43854	OTTHUMG00000119047	ENST00000296591.5:c.375T>G	chr5.hg19:g.83433153A>C		41.0	0.0		72.0	25.0	NM_005711	B2R763|O43855|Q5D094|Q8N610	Silent	SNP	ENST00000296591.5	hg19	CCDS4062.1																																																																																			.	.		0.333	EDIL3-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239258.1	NM_005711	
SNCAIP	9627	hgsc.bcm.edu	37	5	121759066	121759066	+	Missense_Mutation	SNP	C	C	A			TCGA-2Y-A9GS-01A-12D-A382-10	TCGA-2Y-A9GS-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ce44141-64e4-4d9d-9971-4dc79b316d4a	27ea2725-9c48-4965-a503-91d2302923b4	g.chr5:121759066C>A	ENST00000261368.8	+	4	896	c.634C>A	c.(634-636)Ccc>Acc	p.P212T	SNCAIP_ENST00000261367.7_Missense_Mutation_p.P259T|SNCAIP_ENST00000379536.2_Missense_Mutation_p.P212T|SNCAIP_ENST00000542191.1_Intron|SNCAIP_ENST00000379533.2_Missense_Mutation_p.P259T|SNCAIP_ENST00000504884.2_Intron|SNCAIP_ENST00000503116.2_Missense_Mutation_p.P259T|SNCAIP_ENST00000379538.3_Intron|SNCAIP_ENST00000414317.2_Intron	NM_005460.2	NP_005451.2	Q9Y6H5	SNCAP_HUMAN	synuclein, alpha interacting protein	212					cell death (GO:0008219)|dopamine metabolic process (GO:0042417)|regulation of inclusion body assembly (GO:0090083)|regulation of neurotransmitter secretion (GO:0046928)	cytoplasm (GO:0005737)|neuronal cell body (GO:0043025)|presynaptic membrane (GO:0042734)|synaptic vesicle (GO:0008021)	identical protein binding (GO:0042802)|ubiquitin protein ligase binding (GO:0031625)			NS(3)|breast(2)|endometrium(4)|kidney(1)|large_intestine(5)|lung(9)|ovary(2)|pancreas(1)|prostate(4)|skin(7)|urinary_tract(1)	39		all_cancers(142;0.00787)|Prostate(80;0.0327)	KIRC - Kidney renal clear cell carcinoma(527;0.206)	OV - Ovarian serous cystadenocarcinoma(64;0.000625)|Epithelial(69;0.00216)|all cancers(49;0.0232)		TGTTCTTTCTCCCGTGAAAAG	0.488																																					p.P212T		Atlas-SNP	.											.	SNCAIP	308	.	0			c.C634A						.						86.0	88.0	87.0					5																	121759066		2203	4300	6503	SO:0001583	missense	9627	exon4			CTTTCTCCCGTGA	AF167306	CCDS4131.1, CCDS58964.1	5q23.2	2013-01-10	2008-07-31		ENSG00000064692	ENSG00000064692		"""Ankyrin repeat domain containing"""	11139	protein-coding gene	gene with protein product	"""synphilin"""	603779				10319874	Standard	NM_001242935		Approved	SYPH1	uc003ksw.1	Q9Y6H5	OTTHUMG00000128915	ENST00000261368.8:c.634C>A	chr5.hg19:g.121759066C>A	ENSP00000261368:p.Pro212Thr	120.0	0.0		172.0	25.0	NM_005460	D3DSZ1|Q05BS1|Q1PSC2|Q49AC6|Q504U9|Q6L984|Q6L985|Q6L986|Q9HC59	Missense_Mutation	SNP	ENST00000261368.8	hg19	CCDS4131.1	.	.	.	.	.	.	.	.	.	.	C	19.27	3.795912	0.70452	.	.	ENSG00000064692	ENST00000509154;ENST00000261368;ENST00000379533;ENST00000379536;ENST00000261367;ENST00000503116	T;T;T;T;T;T	0.41758	3.2;1.18;0.99;3.2;0.99;2.7	5.88	5.88	0.94601	.	0.000000	0.85682	D	0.000000	T	0.57330	0.2046	L	0.36672	1.1	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.998;0.999;0.996;0.997	T	0.48293	-0.9048	9	.	.	.	-20.4124	20.2405	0.98372	0.0:1.0:0.0:0.0	.	212;259;259;212	D6R9G8;Q9Y6H5-6;Q9Y6H5-3;Q9Y6H5	.;.;.;SNCAP_HUMAN	T	212;212;259;212;259;259	ENSP00000422106:P212T;ENSP00000261368:P212T;ENSP00000368848:P259T;ENSP00000368851:P212T;ENSP00000261367:P259T;ENSP00000423199:P259T	.	P	+	1	0	SNCAIP	121786965	1.000000	0.71417	0.999000	0.59377	0.684000	0.39900	5.915000	0.69973	2.797000	0.96272	0.561000	0.74099	CCC	.	.		0.488	SNCAIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250888.1		
MEGF10	84466	hgsc.bcm.edu	37	5	126734452	126734452	+	Missense_Mutation	SNP	C	C	A	rs190469012		TCGA-2Y-A9GS-01A-12D-A382-10	TCGA-2Y-A9GS-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ce44141-64e4-4d9d-9971-4dc79b316d4a	27ea2725-9c48-4965-a503-91d2302923b4	g.chr5:126734452C>A	ENST00000274473.6	+	8	1011	c.744C>A	c.(742-744)caC>caA	p.H248Q	MEGF10_ENST00000418761.2_Missense_Mutation_p.H248Q|MEGF10_ENST00000508365.1_Missense_Mutation_p.H248Q|MEGF10_ENST00000503335.2_Missense_Mutation_p.H248Q	NM_032446.2	NP_115822.1	Q96KG7	MEG10_HUMAN	multiple EGF-like-domains 10	248	EGF-like 4. {ECO:0000255|PROSITE- ProRule:PRU00076}.|Necessary for interaction with AP2M1, self-assembly and formation of the irregular, mosaic-like adhesion pattern.				homotypic cell-cell adhesion (GO:0034109)|muscle cell development (GO:0055001)|recognition of apoptotic cell (GO:0043654)|regulation of muscle cell differentiation (GO:0051147)|regulation of skeletal muscle tissue development (GO:0048641)|skeletal muscle satellite cell activation (GO:0014719)|skeletal muscle satellite cell differentiation (GO:0014816)|skeletal muscle satellite cell proliferation (GO:0014841)	cell projection (GO:0042995)|integral component of membrane (GO:0016021)|phagocytic cup (GO:0001891)		p.H248H(1)		breast(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(28)|ovary(4)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	68		Prostate(80;0.165)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0657)|Epithelial(69;0.123)		TGTGTCATCACGTCACTGGAG	0.527																																					p.H248Q		Atlas-SNP	.											MEGF10,rectum,carcinoma,0,1	MEGF10	152	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C744A						.						265.0	198.0	220.0					5																	126734452		2203	4300	6503	SO:0001583	missense	84466	exon8			TCATCACGTCACT	AK021631	CCDS4142.1	5q33	2008-02-05			ENSG00000145794	ENSG00000145794			29634	protein-coding gene	gene with protein product		612453				11347906	Standard	NM_032446		Approved	KIAA1780	uc003kui.4	Q96KG7	OTTHUMG00000128984	ENST00000274473.6:c.744C>A	chr5.hg19:g.126734452C>A	ENSP00000274473:p.His248Gln	127.0	0.0		139.0	38.0	NM_032446	Q68DE5|Q8WUL3	Missense_Mutation	SNP	ENST00000274473.6	hg19	CCDS4142.1	.	.	.	.	.	.	.	.	.	.	C	13.31	2.198873	0.38806	.	.	ENSG00000145794	ENST00000503335;ENST00000508365;ENST00000418761;ENST00000274473	T;T;T;T	0.32515	2.18;1.45;1.45;2.18	5.75	-4.53	0.03462	Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);	0.000000	0.85682	D	0.000000	T	0.44603	0.1301	M	0.73430	2.235	0.51767	D	0.999939	D;D	0.76494	0.97;0.999	P;D	0.63381	0.866;0.914	T	0.59440	-0.7454	10	0.13470	T	0.59	-21.0905	16.5156	0.84299	0.0:0.1875:0.0:0.8125	.	248;248	Q96KG7-2;Q96KG7	.;MEG10_HUMAN	Q	248	ENSP00000423354:H248Q;ENSP00000423195:H248Q;ENSP00000416284:H248Q;ENSP00000274473:H248Q	ENSP00000274473:H248Q	H	+	3	2	MEGF10	126762351	0.099000	0.21834	0.976000	0.42696	0.970000	0.65996	-0.593000	0.05740	-0.662000	0.05338	-0.769000	0.03391	CAC	.	C|1.000;T|0.000		0.527	MEGF10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250973.2	NM_032446	
SLC25A48	153328	hgsc.bcm.edu	37	5	135188365	135188365	+	Silent	SNP	C	C	T	rs368023667		TCGA-2Y-A9GS-01A-12D-A382-10	TCGA-2Y-A9GS-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ce44141-64e4-4d9d-9971-4dc79b316d4a	27ea2725-9c48-4965-a503-91d2302923b4	g.chr5:135188365C>T	ENST00000420621.1	+	4	448	c.276C>T	c.(274-276)tgC>tgT	p.C92C	SLC25A48_ENST00000433282.2_Silent_p.C38C|SLC25A48_ENST00000274513.5_Silent_p.C92C|SLC25A48_ENST00000425402.1_Intron|SLC25A48_ENST00000412661.2_Silent_p.C92C			Q6ZT89	S2548_HUMAN	solute carrier family 25, member 48	92					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)				NS(1)|breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(3)|skin(1)	10						AGCACCGCTGCGGGGAGCCAG	0.667													C|||	1	0.000199681	0.0008	0.0	5008	,	,		17722	0.0		0.0	False		,,,				2504	0.0				p.C92C		Atlas-SNP	.											.	SLC25A48	37	.	0			c.C276T						.						58.0	69.0	65.0					5																	135188365		1946	4122	6068	SO:0001819	synonymous_variant	153328	exon4			CCGCTGCGGGGAG		CCDS43366.2	5q31.1	2013-05-22			ENSG00000145832	ENSG00000145832		"""Solute carriers"""	30451	protein-coding gene	gene with protein product	"""HCC-down-regulated mitochondrial carrier protein"""					15322095, 19303656	Standard	NM_145282		Approved	FLJ44862, HDMCP	uc003lba.3	Q6ZT89	OTTHUMG00000157007	ENST00000420621.1:c.276C>T	chr5.hg19:g.135188365C>T		104.0	0.0		125.0	43.0	NM_145282	Q8TAV9	Silent	SNP	ENST00000420621.1	hg19																																																																																				.	.		0.667	SLC25A48-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_145282	
WNT8A	7478	hgsc.bcm.edu	37	5	137420203	137420203	+	Missense_Mutation	SNP	C	C	T	rs528082347		TCGA-2Y-A9GS-01A-12D-A382-10	TCGA-2Y-A9GS-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ce44141-64e4-4d9d-9971-4dc79b316d4a	27ea2725-9c48-4965-a503-91d2302923b4	g.chr5:137420203C>T	ENST00000398754.1	+	3	124	c.119C>T	c.(118-120)aCg>aTg	p.T40M	WNT8A_ENST00000506684.1_Missense_Mutation_p.T58M	NM_058244.2	NP_490645.1	Q9H1J5	WNT8A_HUMAN	wingless-type MMTV integration site family, member 8A	40					canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in cardiac muscle cell fate commitment (GO:0061317)|canonical Wnt signaling pathway involved in neural crest cell differentiation (GO:0044335)|endoderm development (GO:0007492)|establishment of organ orientation (GO:0048561)|neural crest cell fate commitment (GO:0014034)|neuron differentiation (GO:0030182)|palate development (GO:0060021)|polarity specification of anterior/posterior axis (GO:0009949)|polarity specification of proximal/distal axis (GO:0010085)|regulation of protein localization (GO:0032880)|regulation of transcription involved in anterior/posterior axis specification (GO:0044324)|response to retinoic acid (GO:0032526)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	frizzled binding (GO:0005109)|receptor agonist activity (GO:0048018)			breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(7)|ovary(1)|skin(2)	18			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0109)			CTGACCTACACGACTAGTGTG	0.577													C|||	1	0.000199681	0.0008	0.0	5008	,	,		20974	0.0		0.0	False		,,,				2504	0.0				p.T40M		Atlas-SNP	.											.	WNT8A	36	.	0			c.C119T						.						73.0	75.0	74.0					5																	137420203		2024	4215	6239	SO:0001583	missense	7478	exon3			CCTACACGACTAG	AB057725	CCDS43368.1, CCDS75311.1	5q31	2008-07-18			ENSG00000061492	ENSG00000061492		"""Wingless-type MMTV integration sites"""	12788	protein-coding gene	gene with protein product		606360				11408932	Standard	XM_005272076		Approved	WNT8D	uc003lcd.1	Q9H1J5	OTTHUMG00000129196	ENST00000398754.1:c.119C>T	chr5.hg19:g.137420203C>T	ENSP00000381739:p.Thr40Met	84.0	0.0		89.0	33.0	NM_058244	Q96S51	Missense_Mutation	SNP	ENST00000398754.1	hg19	CCDS43368.1	.	.	.	.	.	.	.	.	.	.	C	13.47	2.245629	0.39697	.	.	ENSG00000061492	ENST00000506684;ENST00000504809;ENST00000398754	T;T;T	0.75154	-0.91;-0.91;-0.91	4.96	4.09	0.47781	.	0.215692	0.49305	D	0.000144	T	0.66557	0.2801	N	0.02403	-0.565	0.41715	D	0.989479	D;D;D	0.76494	0.999;0.999;0.999	D;D;D	0.68621	0.953;0.953;0.959	T	0.71279	-0.4640	10	0.30078	T	0.28	.	13.7291	0.62776	0.0:0.9259:0.0:0.0741	.	58;58;40	D6RF47;D6RF94;Q9H1J5	.;.;WNT8A_HUMAN	M	58;58;40	ENSP00000426653:T58M;ENSP00000424809:T58M;ENSP00000381739:T40M	ENSP00000354726:T40M	T	+	2	0	WNT8A	137448102	0.804000	0.28969	0.387000	0.26183	0.095000	0.18619	7.320000	0.79064	1.465000	0.48006	0.655000	0.94253	ACG	.	.		0.577	WNT8A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000280395.1	NM_058244	
PCDHGA6	56109	hgsc.bcm.edu	37	5	140755818	140755818	+	Missense_Mutation	SNP	G	G	A			TCGA-2Y-A9GS-01A-12D-A382-10	TCGA-2Y-A9GS-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ce44141-64e4-4d9d-9971-4dc79b316d4a	27ea2725-9c48-4965-a503-91d2302923b4	g.chr5:140755818G>A	ENST00000517434.1	+	1	2168	c.2168G>A	c.(2167-2169)cGc>cAc	p.R723H	PCDHGB2_ENST00000522605.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA1_ENST00000517417.1_Intron	NM_018919.2|NM_032086.1	NP_061742.1|NP_114475.1	Q9Y5G7	PCDG6_HUMAN	protocadherin gamma subfamily A, 6	723					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|large_intestine(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CACAAGTCACGCCTGCTGCAG	0.647																																					p.R723H		Atlas-SNP	.											.	PCDHGA6	219	.	0			c.G2168A						.						82.0	89.0	87.0					5																	140755818		2203	4300	6503	SO:0001583	missense	56109	exon1			AGTCACGCCTGCT	AF152513	CCDS54926.1, CCDS75335.1	5q31	2010-01-26				ENSG00000253731		"""Cadherins / Protocadherins : Clustered"""	8704	other	protocadherin		606293				10380929	Standard	NM_018919		Approved	PCDH-GAMMA-A6		Q9Y5G7		ENST00000517434.1:c.2168G>A	chr5.hg19:g.140755818G>A	ENSP00000429601:p.Arg723His	164.0	0.0		164.0	59.0	NM_018919	A6H8K7|B2RN55|Q9Y5D1	Missense_Mutation	SNP	ENST00000517434.1	hg19	CCDS54926.1	.	.	.	.	.	.	.	.	.	.	.	13.25	2.182335	0.38511	.	.	ENSG00000253731	ENST00000517434	T	0.15372	2.43	5.15	-0.662	0.11413	.	0.819212	0.09410	U	0.805991	T	0.15349	0.0370	L	0.48935	1.535	0.09310	N	1	B;B	0.14438	0.01;0.005	B;B	0.13407	0.008;0.009	T	0.31280	-0.9949	10	0.48119	T	0.1	.	8.9657	0.35874	0.6259:0.0:0.3741:0.0	.	723;723	Q9Y5G7-2;Q9Y5G7	.;PCDG6_HUMAN	H	723	ENSP00000429601:R723H	ENSP00000429601:R723H	R	+	2	0	PCDHGA6	140736002	0.000000	0.05858	0.000000	0.03702	0.071000	0.16799	0.057000	0.14279	-0.047000	0.13423	-0.137000	0.14449	CGC	.	.		0.647	PCDHGA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374743.1	NM_018919	
DRD1	1812	hgsc.bcm.edu	37	5	174869971	174869971	+	Silent	SNP	G	G	C			TCGA-2Y-A9GS-01A-12D-A382-10	TCGA-2Y-A9GS-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ce44141-64e4-4d9d-9971-4dc79b316d4a	27ea2725-9c48-4965-a503-91d2302923b4	g.chr5:174869971G>C	ENST00000393752.2	-	2	1124	c.132C>G	c.(130-132)gtC>gtG	p.V44V		NM_000794.3	NP_000785.1	P21728	DRD1_HUMAN	dopamine receptor D1	44					activation of adenylate cyclase activity (GO:0007190)|adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adult walking behavior (GO:0007628)|astrocyte development (GO:0014002)|behavioral fear response (GO:0001662)|behavioral response to cocaine (GO:0048148)|cellular response to catecholamine stimulus (GO:0071870)|cerebral cortex GABAergic interneuron migration (GO:0021853)|conditioned taste aversion (GO:0001661)|dentate gyrus development (GO:0021542)|dopamine metabolic process (GO:0042417)|dopamine transport (GO:0015872)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|glucose import (GO:0046323)|grooming behavior (GO:0007625)|habituation (GO:0046959)|long term synaptic depression (GO:0060292)|long-term synaptic potentiation (GO:0060291)|maternal behavior (GO:0042711)|mating behavior (GO:0007617)|memory (GO:0007613)|neuronal action potential (GO:0019228)|operant conditioning (GO:0035106)|peristalsis (GO:0030432)|phospholipase C-activating dopamine receptor signaling pathway (GO:0060158)|positive regulation of adenylate cyclase activity involved in G-protein coupled receptor signaling pathway (GO:0010579)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cell migration (GO:0030335)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|positive regulation of potassium ion transport (GO:0043268)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|prepulse inhibition (GO:0060134)|protein import into nucleus (GO:0006606)|regulation of dopamine metabolic process (GO:0042053)|regulation of dopamine uptake involved in synaptic transmission (GO:0051584)|response to amphetamine (GO:0001975)|response to drug (GO:0042493)|sensitization (GO:0046960)|striatum development (GO:0021756)|synapse assembly (GO:0007416)|synaptic transmission, dopaminergic (GO:0001963)|temperature homeostasis (GO:0001659)|transmission of nerve impulse (GO:0019226)|vasodilation (GO:0042311)|visual learning (GO:0008542)	endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	dopamine binding (GO:0035240)|dopamine neurotransmitter receptor activity (GO:0004952)|dopamine neurotransmitter receptor activity, coupled via Gs (GO:0001588)	p.V44V(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(10)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	23	all_cancers(89;0.00895)|Renal(175;0.000159)|Lung NSC(126;0.00625)|all_lung(126;0.0104)	Medulloblastoma(196;0.0208)|all_neural(177;0.0277)|all_hematologic(541;0.214)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)		Acepromazine(DB01614)|Acetophenazine(DB01063)|Amoxapine(DB00543)|Apomorphine(DB00714)|Aripiprazole(DB01238)|Asenapine(DB06216)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Chlorpromazine(DB00477)|Chlorprothixene(DB01239)|Cinnarizine(DB00568)|Clozapine(DB00363)|Dopamine(DB00988)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Fenoldopam(DB00800)|Flupentixol(DB00875)|Fluphenazine(DB00623)|Haloperidol(DB00502)|Iloperidone(DB04946)|Imipramine(DB00458)|L-DOPA(DB01235)|Lisuride(DB00589)|Loxapine(DB00408)|Methotrimeprazine(DB01403)|Methylergometrine(DB00353)|Mianserin(DB06148)|Minaprine(DB00805)|Mirtazapine(DB00370)|Olanzapine(DB00334)|Paliperidone(DB01267)|Pergolide(DB01186)|Perphenazine(DB00850)|Phenylpropanolamine(DB00397)|Pipotiazine(DB01621)|Pramipexole(DB00413)|Promazine(DB00420)|Propericiazine(DB01608)|Propiomazine(DB00777)|Quetiapine(DB01224)|Risperidone(DB00734)|Ropinirole(DB00268)|Rotigotine(DB05271)|Thioproperazine(DB01622)|Thioridazine(DB00679)|Thiothixene(DB01623)|Triflupromazine(DB00508)|Trimipramine(DB00726)|Ziprasidone(DB00246)	CGGCAGCACAGACCAGCGTGT	0.577																																					p.V44V		Atlas-SNP	.											DRD1,colon,carcinoma,0,2	DRD1	56	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C132G						.						97.0	84.0	88.0					5																	174869971		2203	4300	6503	SO:0001819	synonymous_variant	1812	exon2			AGCACAGACCAGC	X55760	CCDS4393.1	5q34-q35	2012-08-08			ENSG00000184845	ENSG00000184845		"""GPCR / Class A : Dopamine receptors"""	3020	protein-coding gene	gene with protein product		126449					Standard	NM_000794		Approved		uc003mcz.3	P21728	OTTHUMG00000130557	ENST00000393752.2:c.132C>G	chr5.hg19:g.174869971G>C		168.0	0.0		140.0	55.0	NM_000794	B2RA44|Q4QRJ0	Silent	SNP	ENST00000393752.2	hg19	CCDS4393.1																																																																																			.	.		0.577	DRD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252982.2	NM_000794	
GFRAL	389400	hgsc.bcm.edu	37	6	55216306	55216306	+	Missense_Mutation	SNP	C	C	G			TCGA-2Y-A9GS-01A-12D-A382-10	TCGA-2Y-A9GS-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ce44141-64e4-4d9d-9971-4dc79b316d4a	27ea2725-9c48-4965-a503-91d2302923b4	g.chr6:55216306C>G	ENST00000340465.2	+	5	712	c.626C>G	c.(625-627)aCa>aGa	p.T209R		NM_207410.2	NP_997293.2	Q6UXV0	GFRAL_HUMAN	GDNF family receptor alpha like	209					negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of neuron apoptotic process (GO:0043524)|stress-activated protein kinase signaling cascade (GO:0031098)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|breast(1)|endometrium(2)|kidney(5)|large_intestine(2)|liver(1)|lung(31)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)	48	Lung NSC(77;0.0875)|Renal(3;0.122)		LUSC - Lung squamous cell carcinoma(124;0.23)			CACAGCAAGACATGTGCAGTG	0.428																																					p.T209R		Atlas-SNP	.											.	GFRAL	91	.	0			c.C626G						.						115.0	112.0	113.0					6																	55216306		2203	4300	6503	SO:0001583	missense	389400	exon5			GCAAGACATGTGC	AY358198	CCDS4957.1	6p12.1	2007-06-22			ENSG00000187871	ENSG00000187871			32789	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 144"""	C6orf144		16086688	Standard	NM_207410		Approved	GRAL, UNQ9356, bA360D14.1	uc003pcm.1	Q6UXV0	OTTHUMG00000014900	ENST00000340465.2:c.626C>G	chr6.hg19:g.55216306C>G	ENSP00000343636:p.Thr209Arg	97.0	0.0		112.0	43.0	NM_207410	Q5VTF6	Missense_Mutation	SNP	ENST00000340465.2	hg19	CCDS4957.1	.	.	.	.	.	.	.	.	.	.	C	14.09	2.431963	0.43122	.	.	ENSG00000187871	ENST00000340465	T	0.62498	0.02	6.05	4.22	0.49857	GDNF/GAS1 (2);	0.190419	0.45606	D	0.000352	T	0.25791	0.0628	N	0.08118	0	0.22947	N	0.998528	B	0.06786	0.001	B	0.06405	0.002	T	0.25082	-1.0142	10	0.56958	D	0.05	-2.7163	16.8145	0.85730	0.0:0.7721:0.2279:0.0	.	209	Q6UXV0	GFRAL_HUMAN	R	209	ENSP00000343636:T209R	ENSP00000343636:T209R	T	+	2	0	GFRAL	55324265	1.000000	0.71417	1.000000	0.80357	0.949000	0.60115	2.335000	0.43929	0.824000	0.34613	0.650000	0.86243	ACA	.	.		0.428	GFRAL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040995.2	NM_207410	
ABCA13	154664	hgsc.bcm.edu	37	7	48626793	48626793	+	Missense_Mutation	SNP	C	C	T	rs563692415		TCGA-2Y-A9GS-01A-12D-A382-10	TCGA-2Y-A9GS-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ce44141-64e4-4d9d-9971-4dc79b316d4a	27ea2725-9c48-4965-a503-91d2302923b4	g.chr7:48626793C>T	ENST00000435803.1	+	57	14573	c.14549C>T	c.(14548-14550)gCg>gTg	p.A4850V	ABCA13_ENST00000544596.1_Missense_Mutation_p.A580V	NM_152701.3	NP_689914.2	Q86UQ4	ABCAD_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 13	4850	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.				transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(13)|central_nervous_system(8)|endometrium(25)|haematopoietic_and_lymphoid_tissue(4)|kidney(20)|large_intestine(51)|lung(100)|ovary(5)|pancreas(2)|prostate(22)|skin(10)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	270						GAAGCCCACGCGGACAAACCT	0.557																																					p.A4850V		Atlas-SNP	.											ABCA13_ENST00000435803,rectum,carcinoma,+1,2	ABCA13	1192	.	0			c.C14549T						.						43.0	48.0	46.0					7																	48626793		2024	4188	6212	SO:0001583	missense	154664	exon57			CCCACGCGGACAA	AY204751	CCDS47584.1	7p12.3	2012-03-14			ENSG00000179869	ENSG00000179869		"""ATP binding cassette transporters / subfamily A"""	14638	protein-coding gene	gene with protein product		607807				12697998	Standard	NM_152701		Approved	FLJ33876, FLJ33951	uc003toq.2	Q86UQ4	OTTHUMG00000155840	ENST00000435803.1:c.14549C>T	chr7.hg19:g.48626793C>T	ENSP00000411096:p.Ala4850Val	54.0	0.0		53.0	19.0	NM_152701	K9LC76|K9LC79|K9LCX7|K9LDK8|K9LDY4|Q6ZTT7|Q86WI2|Q8N248	Missense_Mutation	SNP	ENST00000435803.1	hg19	CCDS47584.1	.	.	.	.	.	.	.	.	.	.	C	1.942	-0.443420	0.04604	.	.	ENSG00000179869	ENST00000435803;ENST00000411975;ENST00000544596	D;D;D	0.94184	-3.37;-3.37;-3.37	5.71	-0.712	0.11226	ATPase, AAA+ type, core (1);ABC transporter-like (2);	0.760684	0.11485	N	0.559299	D	0.89174	0.6640	L	0.58428	1.81	0.09310	N	1	B;B;B	0.06786	0.0;0.001;0.001	B;B;B	0.06405	0.001;0.002;0.002	T	0.76105	-0.3081	10	0.30854	T	0.27	.	7.0876	0.25266	0.1224:0.1475:0.0:0.7301	.	580;2552;4850	F5H7B7;Q86UQ4-3;Q86UQ4	.;.;ABCAD_HUMAN	V	4850;623;580	ENSP00000411096:A4850V;ENSP00000391042:A623V;ENSP00000442634:A580V	ENSP00000391042:A623V	A	+	2	0	ABCA13	48597339	0.097000	0.21791	0.017000	0.16124	0.151000	0.21798	0.423000	0.21313	-0.283000	0.09115	-0.143000	0.13931	GCG	.	.		0.557	ABCA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341964.2	NM_152701	
TECPR1	25851	hgsc.bcm.edu	37	7	97863212	97863212	+	Missense_Mutation	SNP	A	A	C	rs375012059		TCGA-2Y-A9GS-01A-12D-A382-10	TCGA-2Y-A9GS-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ce44141-64e4-4d9d-9971-4dc79b316d4a	27ea2725-9c48-4965-a503-91d2302923b4	g.chr7:97863212A>C	ENST00000447648.2	-	11	1492	c.1193T>G	c.(1192-1194)tTc>tGc	p.F398C	TECPR1_ENST00000379795.3_Missense_Mutation_p.F398C|TECPR1_ENST00000542604.1_Missense_Mutation_p.F328C			Q7Z6L1	TCPR1_HUMAN	tectonin beta-propeller repeat containing 1	398					autophagic vacuole fusion (GO:0000046)|autophagy (GO:0006914)	autophagic vacuole membrane (GO:0000421)|cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)	phosphatidylinositol-3-phosphate binding (GO:0032266)			central_nervous_system(2)|endometrium(8)|kidney(1)|large_intestine(1)|lung(9)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	26						ATCACCGAAGAAGCAGCCGGC	0.642																																					p.F398C		Atlas-SNP	.											.	TECPR1	77	.	0			c.T1193G						.	A	CYS/PHE	1,4241		0,1,2120	8.0	8.0	8.0		1193	4.7	1.0	7		8	0,8346		0,0,4173	no	missense	TECPR1	NM_015395.1	205	0,1,6293	CC,CA,AA		0.0,0.0236,0.0079	probably-damaging	398/1166	97863212	1,12587	2121	4173	6294	SO:0001583	missense	25851	exon11			CCGAAGAAGCAGC		CCDS47648.1	7q21.3	2009-01-30			ENSG00000205356	ENSG00000205356			22214	protein-coding gene	gene with protein product		614781					Standard	NM_015395		Approved	DKFZP434B0335, FLJ23419, FLJ90593, KIAA1358	uc003upg.4	Q7Z6L1	OTTHUMG00000154273	ENST00000447648.2:c.1193T>G	chr7.hg19:g.97863212A>C	ENSP00000404923:p.Phe398Cys	214.0	0.0		252.0	42.0	NM_015395	A8KAD1|B3KPZ1|C9J024|F5GX57|Q96EB0|Q9P2I9|Q9UFR6	Missense_Mutation	SNP	ENST00000447648.2	hg19	CCDS47648.1	.	.	.	.	.	.	.	.	.	.	A	15.04	2.715654	0.48622	2.36E-4	0.0	ENSG00000205356	ENST00000447648;ENST00000379795;ENST00000542604	T;T;T	0.37584	1.19;1.2;1.2	4.7	4.7	0.59300	.	0.051780	0.85682	D	0.000000	T	0.51907	0.1702	L	0.55990	1.75	0.47737	D	0.999501	D;B	0.89917	1.0;0.198	D;B	0.65573	0.936;0.04	T	0.51537	-0.8693	10	0.46703	T	0.11	-35.9513	13.3404	0.60540	1.0:0.0:0.0:0.0	.	328;398	F5GX57;Q7Z6L1	.;TCPR1_HUMAN	C	398;398;328	ENSP00000404923:F398C;ENSP00000369121:F398C;ENSP00000441121:F328C	ENSP00000369121:F398C	F	-	2	0	TECPR1	97701148	1.000000	0.71417	1.000000	0.80357	0.355000	0.29361	5.680000	0.68168	1.761000	0.52028	0.379000	0.24179	TTC	.	.		0.642	TECPR1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000334661.1	NM_015395	
LAMB4	22798	hgsc.bcm.edu	37	7	107696204	107696204	+	Silent	SNP	G	G	A			TCGA-2Y-A9GS-01A-12D-A382-10	TCGA-2Y-A9GS-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ce44141-64e4-4d9d-9971-4dc79b316d4a	27ea2725-9c48-4965-a503-91d2302923b4	g.chr7:107696204G>A	ENST00000388781.3	-	25	3711	c.3628C>T	c.(3628-3630)Ctg>Ttg	p.L1210L	LAMB4_ENST00000205386.4_Silent_p.L1210L|LAMB4_ENST00000388780.3_Silent_p.L1210L	NM_007356.2	NP_031382.2	A4D0S4	LAMB4_HUMAN	laminin, beta 4	1210	Domain II.				cell adhesion (GO:0007155)	basement membrane (GO:0005604)				NS(1)|breast(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(22)|lung(40)|ovary(4)|prostate(5)|skin(4)	97						CAGACAGGCAGGGTCTCTCTT	0.453																																					p.L1210L		Atlas-SNP	.											.	LAMB4	253	.	0			c.C3628T						.						77.0	75.0	76.0					7																	107696204		2203	4300	6503	SO:0001819	synonymous_variant	22798	exon25			CAGGCAGGGTCTC	AF028816	CCDS34732.1	7q31	2013-03-01			ENSG00000091128	ENSG00000091128		"""Laminins"""	6491	protein-coding gene	gene with protein product							Standard	NM_007356		Approved		uc010ljo.1	A4D0S4	OTTHUMG00000154874	ENST00000388781.3:c.3628C>T	chr7.hg19:g.107696204G>A		90.0	0.0		138.0	20.0	NM_007356	A5PKU6|B2RTT3|B5MEB9|Q86TP7|Q86XN2|Q8NBX5	Silent	SNP	ENST00000388781.3	hg19	CCDS34732.1																																																																																			.	.		0.453	LAMB4-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337442.1	XM_209857	
GEM	2669	hgsc.bcm.edu	37	8	95262710	95262710	+	Missense_Mutation	SNP	C	C	T			TCGA-2Y-A9GS-01A-12D-A382-10	TCGA-2Y-A9GS-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ce44141-64e4-4d9d-9971-4dc79b316d4a	27ea2725-9c48-4965-a503-91d2302923b4	g.chr8:95262710C>T	ENST00000297596.2	-	5	983	c.719G>A	c.(718-720)cGc>cAc	p.R240H	GEM_ENST00000396194.2_Missense_Mutation_p.R240H	NM_005261.3	NP_005252.1	P55040	GEM_HUMAN	GTP binding protein overexpressed in skeletal muscle	240					cell surface receptor signaling pathway (GO:0007166)|chromosome organization (GO:0051276)|immune response (GO:0006955)|metaphase plate congression (GO:0051310)|mitotic nuclear division (GO:0007067)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytoplasmic side of plasma membrane (GO:0009898)|midbody (GO:0030496)|mitotic spindle (GO:0072686)|nucleus (GO:0005634)|spindle midzone (GO:0051233)	GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|magnesium ion binding (GO:0000287)			endometrium(3)|kidney(1)|large_intestine(7)|lung(9)|prostate(1)|upper_aerodigestive_tract(1)	22	Breast(36;4.65e-06)	Myeloproliferative disorder(644;0.204)	BRCA - Breast invasive adenocarcinoma(8;0.00691)			CCGCCGAAGGCGCACCTGTCG	0.577																																					p.R240H	GBM(125;80 1653 28655 32188 47338)|Esophageal Squamous(19;97 579 13602 49091 51766)	Atlas-SNP	.											.	GEM	40	.	0			c.G719A						.						65.0	61.0	62.0					8																	95262710		2203	4300	6503	SO:0001583	missense	2669	exon5			CGAAGGCGCACCT		CCDS6261.1	8q13-q21	2014-05-09	2001-11-28		ENSG00000164949	ENSG00000164949			4234	protein-coding gene	gene with protein product	"""kinase-inducible Ras-like protein"""	600164	"""GTP-binding protein overexpressed in skeletal muscle"""			7912851, 11956230	Standard	NM_005261		Approved	KIR	uc003ygj.3	P55040	OTTHUMG00000164392	ENST00000297596.2:c.719G>A	chr8.hg19:g.95262710C>T	ENSP00000297596:p.Arg240His	89.0	0.0		103.0	42.0	NM_181702	B2RA31	Missense_Mutation	SNP	ENST00000297596.2	hg19	CCDS6261.1	.	.	.	.	.	.	.	.	.	.	C	25.9	4.683966	0.88639	.	.	ENSG00000164949	ENST00000396194;ENST00000297596	T;T	0.80123	-1.34;-1.34	5.47	5.47	0.80525	.	0.000000	0.85682	D	0.000000	D	0.92280	0.7551	M	0.91717	3.235	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.93393	0.6753	10	0.87932	D	0	.	19.6814	0.95965	0.0:1.0:0.0:0.0	.	240	P55040	GEM_HUMAN	H	240	ENSP00000379497:R240H;ENSP00000297596:R240H	ENSP00000297596:R240H	R	-	2	0	GEM	95331886	1.000000	0.71417	0.998000	0.56505	0.800000	0.45204	7.445000	0.80570	2.733000	0.93635	0.557000	0.71058	CGC	.	.		0.577	GEM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378566.1	NM_181702	
RGS22	26166	hgsc.bcm.edu	37	8	101076177	101076177	+	Silent	SNP	T	T	A	rs538962849	byFrequency	TCGA-2Y-A9GS-01A-12D-A382-10	TCGA-2Y-A9GS-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ce44141-64e4-4d9d-9971-4dc79b316d4a	27ea2725-9c48-4965-a503-91d2302923b4	g.chr8:101076177T>A	ENST00000360863.6	-	8	1013	c.819A>T	c.(817-819)ggA>ggT	p.G273G	RGS22_ENST00000523437.1_Silent_p.G261G|RGS22_ENST00000523287.1_Silent_p.G92G	NM_015668.3	NP_056483.3	Q8NE09	RGS22_HUMAN	regulator of G-protein signaling 22	273	Poly-Glu.				positive regulation of GTPase activity (GO:0043547)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)		RGS22/SYCP1(2)	breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(9)|lung(33)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	68			Epithelial(11;6.71e-08)|all cancers(13;4.19e-06)|OV - Ovarian serous cystadenocarcinoma(57;0.000469)|STAD - Stomach adenocarcinoma(118;0.169)			cttcttcttctccttcttctt	0.373																																					p.G273G		Atlas-SNP	.											.	RGS22	319	.	0			c.A819T						.						105.0	108.0	107.0					8																	101076177		1822	4073	5895	SO:0001819	synonymous_variant	26166	exon8			TTCTTCTCCTTCT	AY009106	CCDS43758.1, CCDS69521.1, CCDS75775.1	8q22.2	2014-01-21	2007-08-14		ENSG00000132554	ENSG00000132554		"""Regulators of G-protein signaling"""	24499	protein-coding gene	gene with protein product		615650	"""regulator of G-protein signalling 22"""				Standard	XM_005250856		Approved	DKFZP434I092, PRTD-NY2, CT145	uc003yjb.1	Q8NE09	OTTHUMG00000164802	ENST00000360863.6:c.819A>T	chr8.hg19:g.101076177T>A		59.0	0.0		57.0	7.0	NM_015668	A8K944|Q569L2|Q86Y71|Q9BYZ4|Q9UFN6	Silent	SNP	ENST00000360863.6	hg19	CCDS43758.1																																																																																			.	.		0.373	RGS22-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000380365.1	NM_015668	
ABRA	137735	hgsc.bcm.edu	37	8	107773510	107773510	+	Missense_Mutation	SNP	G	G	T	rs182944429		TCGA-2Y-A9GS-01A-12D-A382-10	TCGA-2Y-A9GS-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ce44141-64e4-4d9d-9971-4dc79b316d4a	27ea2725-9c48-4965-a503-91d2302923b4	g.chr8:107773510G>T	ENST00000311955.3	-	2	955	c.901C>A	c.(901-903)Cgt>Agt	p.R301S		NM_139166.4	NP_631905.1			actin-binding Rho activating protein											breast(1)|kidney(4)|large_intestine(7)|lung(11)|ovary(2)|prostate(2)	27			OV - Ovarian serous cystadenocarcinoma(57;3.83e-09)			TCCTCAGCACGCTTGGCCCTT	0.517																																					p.R301S		Atlas-SNP	.											.	ABRA	57	.	0			c.C901A						.						140.0	110.0	120.0					8																	107773510		2203	4300	6503	SO:0001583	missense	137735	exon2			CAGCACGCTTGGC	AF503617	CCDS6305.1	8q23.1	2012-02-06			ENSG00000174429	ENSG00000174429			30655	protein-coding gene	gene with protein product	"""striated muscle activator of Rho-dependent signaling"""	609747				11983702	Standard	NM_139166		Approved	STARS	uc003ymm.4	Q8N0Z2	OTTHUMG00000164809	ENST00000311955.3:c.901C>A	chr8.hg19:g.107773510G>T	ENSP00000311436:p.Arg301Ser	118.0	0.0		114.0	51.0	NM_139166		Missense_Mutation	SNP	ENST00000311955.3	hg19	CCDS6305.1	.	.	.	.	.	.	.	.	.	.	G	17.55	3.418291	0.62622	.	.	ENSG00000174429	ENST00000311955	.	.	.	6.06	2.03	0.26663	.	0.000000	0.85682	D	0.000000	T	0.69324	0.3098	L	0.59912	1.85	0.58432	D	0.999997	D	0.76494	0.999	D	0.73380	0.98	T	0.70457	-0.4866	9	0.72032	D	0.01	-10.8748	12.4501	0.55673	0.0:0.0924:0.3144:0.5932	.	301	Q8N0Z2	ABRA_HUMAN	S	301	.	ENSP00000311436:R301S	R	-	1	0	ABRA	107842686	0.731000	0.28111	0.921000	0.36526	0.724000	0.41520	0.772000	0.26647	0.396000	0.25283	-0.169000	0.13324	CGT	.	G|1.000;A|0.000		0.517	ABRA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380416.1	NM_139166	
CYC1	1537	hgsc.bcm.edu	37	8	145150769	145150769	+	Missense_Mutation	SNP	C	C	G			TCGA-2Y-A9GS-01A-12D-A382-10	TCGA-2Y-A9GS-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ce44141-64e4-4d9d-9971-4dc79b316d4a	27ea2725-9c48-4965-a503-91d2302923b4	g.chr8:145150769C>G	ENST00000318911.4	+	2	236	c.163C>G	c.(163-165)Cga>Gga	p.R55G		NM_001916.3	NP_001907	P08574	CY1_HUMAN	cytochrome c-1	55					cellular metabolic process (GO:0044237)|respiratory electron transport chain (GO:0022904)|response to glucagon (GO:0033762)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|respiratory chain (GO:0070469)	electron transporter, transferring electrons from CoQH2-cytochrome c reductase complex and cytochrome c oxidase complex activity (GO:0045155)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			endometrium(1)|kidney(1)|large_intestine(2)|lung(8)|ovary(1)|prostate(2)	15	all_cancers(97;2.87e-11)|all_epithelial(106;2.16e-09)|Lung NSC(106;5.89e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;3.38e-41)|Epithelial(56;8.71e-40)|all cancers(56;3e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			TGGCCTTTCCCGAGGCCGGAA	0.652											OREG0019052	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.R55G		Atlas-SNP	.											.	CYC1	34	.	0			c.C163G						.						88.0	86.0	87.0					8																	145150769		2203	4300	6503	SO:0001583	missense	1537	exon2			CTTTCCCGAGGCC	BC001006	CCDS6415.1	8q24	2011-07-04			ENSG00000179091	ENSG00000179091		"""Mitochondrial respiratory chain complex / Complex III"""	2579	protein-coding gene	gene with protein product		123980					Standard	NM_001916		Approved	UQCR4	uc003zaz.4	P08574	OTTHUMG00000165242	ENST00000318911.4:c.163C>G	chr8.hg19:g.145150769C>G	ENSP00000317159:p.Arg55Gly	28.0	0.0	1692	45.0	15.0	NM_001916	Q5U062|Q6FHS7	Missense_Mutation	SNP	ENST00000318911.4	hg19	CCDS6415.1	.	.	.	.	.	.	.	.	.	.	C	14.61	2.586119	0.46110	.	.	ENSG00000179091	ENST00000318911	T	0.32515	1.45	4.3	3.34	0.38264	.	0.075574	0.49916	D	0.000125	T	0.25158	0.0611	L	0.55990	1.75	0.40657	D	0.982093	P	0.48016	0.904	B	0.37601	0.254	T	0.10706	-1.0618	10	0.39692	T	0.17	-13.0053	11.0888	0.48104	0.1965:0.8035:0.0:0.0	.	55	P08574	CY1_HUMAN	G	55	ENSP00000317159:R55G	ENSP00000317159:R55G	R	+	1	2	CYC1	145222757	0.996000	0.38824	0.983000	0.44433	0.915000	0.54546	2.303000	0.43646	2.242000	0.73789	0.561000	0.74099	CGA	.	.		0.652	CYC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382895.1	NM_001916	
OR1L4	254973	hgsc.bcm.edu	37	9	125486542	125486542	+	Missense_Mutation	SNP	A	A	T	rs143746640	byFrequency	TCGA-2Y-A9GS-01A-12D-A382-10	TCGA-2Y-A9GS-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ce44141-64e4-4d9d-9971-4dc79b316d4a	27ea2725-9c48-4965-a503-91d2302923b4	g.chr9:125486542A>T	ENST00000259466.1	+	1	274	c.274A>T	c.(274-276)Att>Ttt	p.I92F		NM_001005235.1	NP_001005235.1	Q8NGR5	OR1L4_HUMAN	olfactory receptor, family 1, subfamily L, member 4	92						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|large_intestine(3)|lung(13)|prostate(1)|skin(1)	20						AGAGACAAAGATTATCTCTTA	0.453																																					p.I92F		Atlas-SNP	.											.	OR1L4	38	.	0			c.A274T						.						142.0	136.0	138.0					9																	125486542		2203	4300	6503	SO:0001583	missense	254973	exon1			ACAAAGATTATCT		CCDS35129.1	9q33.2	2013-09-20			ENSG00000136939	ENSG00000136939		"""GPCR / Class A : Olfactory receptors"""	8216	protein-coding gene	gene with protein product				OR1L5			Standard	NM_001005235		Approved	OR9-E	uc004bmu.1	Q8NGR5	OTTHUMG00000020620	ENST00000259466.1:c.274A>T	chr9.hg19:g.125486542A>T	ENSP00000259466:p.Ile92Phe	82.0	0.0		78.0	47.0	NM_001005235	Q6IFN0|Q96R81	Missense_Mutation	SNP	ENST00000259466.1	hg19	CCDS35129.1	.	.	.	.	.	.	.	.	.	.	.	5.611	0.297509	0.10622	.	.	ENSG00000136939	ENST00000259466	T	0.01838	4.61	4.01	-8.02	0.01118	GPCR, rhodopsin-like superfamily (1);	1.445290	0.04270	N	0.341889	T	0.01835	0.0058	L	0.28458	0.855	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.43278	-0.9401	10	0.48119	T	0.1	0.0814	5.607	0.17385	0.4363:0.0:0.2515:0.3122	.	92	Q8NGR5	OR1L4_HUMAN	F	92	ENSP00000259466:I92F	ENSP00000259466:I92F	I	+	1	0	OR1L4	124526363	0.000000	0.05858	0.160000	0.22671	0.110000	0.19582	-0.375000	0.07475	-1.904000	0.01092	-0.711000	0.03637	ATT	.	A|0.984;G|0.016		0.453	OR1L4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053951.1		
SFMBT2	57713	hgsc.bcm.edu	37	10	7212949	7212949	+	Missense_Mutation	SNP	C	C	T			TCGA-2Y-A9GS-01A-12D-A382-10	TCGA-2Y-A9GS-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ce44141-64e4-4d9d-9971-4dc79b316d4a	27ea2725-9c48-4965-a503-91d2302923b4	g.chr10:7212949C>T	ENST00000361972.4	-	20	2575	c.2485G>A	c.(2485-2487)Gtg>Atg	p.V829M	SFMBT2_ENST00000397167.1_Missense_Mutation_p.V829M	NM_001018039.1	NP_001018049.1	Q5VUG0	SMBT2_HUMAN	Scm-like with four mbt domains 2	829	SAM.				negative regulation of gene expression (GO:0010629)|regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	histone binding (GO:0042393)			NS(2)|breast(3)|central_nervous_system(4)|endometrium(7)|kidney(2)|large_intestine(26)|lung(34)|ovary(5)|pancreas(2)|skin(9)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	99						AACCTCACCACGTCGGTGACC	0.562																																					p.V829M		Atlas-SNP	.											.	SFMBT2	209	.	0			c.G2485A						.						275.0	230.0	246.0					10																	7212949		2203	4300	6503	SO:0001583	missense	57713	exon20			TCACCACGTCGGT	AB046837	CCDS31138.1	10p15.1	2013-01-10	2003-11-14		ENSG00000198879	ENSG00000198879		"""Sterile alpha motif (SAM) domain containing"""	20256	protein-coding gene	gene with protein product		615392	"""Scm-related gene containing four mbt domains 2"""			10997877	Standard	NM_001029880		Approved	KIAA1617	uc009xio.2	Q5VUG0	OTTHUMG00000017630	ENST00000361972.4:c.2485G>A	chr10.hg19:g.7212949C>T	ENSP00000355109:p.Val829Met	99.0	0.0		150.0	47.0	NM_001029880	A7MD09|Q9HCF5	Missense_Mutation	SNP	ENST00000361972.4	hg19	CCDS31138.1	.	.	.	.	.	.	.	.	.	.	C	29.2	4.985910	0.93044	.	.	ENSG00000198879	ENST00000361972;ENST00000397167	T;T	0.69926	-0.44;-0.44	5.09	5.09	0.68999	Sterile alpha motif domain (1);Sterile alpha motif/pointed domain (2);Sterile alpha motif, type 1 (1);	0.000000	0.85682	D	0.000000	D	0.87337	0.6152	H	0.94503	3.545	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.90882	0.4754	10	0.87932	D	0	.	18.8635	0.92282	0.0:1.0:0.0:0.0	.	829	Q5VUG0	SMBT2_HUMAN	M	829	ENSP00000355109:V829M;ENSP00000380353:V829M	ENSP00000355109:V829M	V	-	1	0	SFMBT2	7252955	1.000000	0.71417	0.990000	0.47175	0.994000	0.84299	7.651000	0.83577	2.532000	0.85374	0.555000	0.69702	GTG	.	.		0.562	SFMBT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046673.1	NM_001029880	
ST8SIA6	338596	hgsc.bcm.edu	37	10	17363216	17363216	+	Silent	SNP	C	C	G			TCGA-2Y-A9GS-01A-12D-A382-10	TCGA-2Y-A9GS-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ce44141-64e4-4d9d-9971-4dc79b316d4a	27ea2725-9c48-4965-a503-91d2302923b4	g.chr10:17363216C>G	ENST00000377602.4	-	8	932	c.858G>C	c.(856-858)acG>acC	p.T286T		NM_001004470.1	NP_001004470.1	P61647	SIA8F_HUMAN	ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 6	286					carbohydrate biosynthetic process (GO:0016051)|cellular protein metabolic process (GO:0044267)|ganglioside biosynthetic process (GO:0001574)|glycolipid biosynthetic process (GO:0009247)|glycoprotein metabolic process (GO:0009100)|oligosaccharide metabolic process (GO:0009311)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|protein O-linked glycosylation (GO:0006493)|sialylation (GO:0097503)	Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)	sialyltransferase activity (GO:0008373)			endometrium(3)|kidney(3)|large_intestine(4)|liver(1)|lung(24)|ovary(1)|skin(1)	37						ACTCTTCGAGCGTGTAGTATA	0.433																																					p.T286T		Atlas-SNP	.											.	ST8SIA6	85	.	0			c.G858C						.						139.0	146.0	144.0					10																	17363216		2203	4300	6503	SO:0001819	synonymous_variant	338596	exon8			TTCGAGCGTGTAG		CCDS31158.1	10p13	2013-03-01	2005-02-07	2005-02-07	ENSG00000148488	ENSG00000148488		"""Sialyltransferases"""	23317	protein-coding gene	gene with protein product	"""ST8Sia VI"""	610139	"""sialyltransferase 8F (alpha-2, 8-sialyltransferase)"""	SIAT8F		11980897	Standard	XR_242697		Approved		uc001ipd.3	P61647	OTTHUMG00000017748	ENST00000377602.4:c.858G>C	chr10.hg19:g.17363216C>G		223.0	0.0		252.0	98.0	NM_001004470	B0YJ97|B9EH72|Q5VZH4	Silent	SNP	ENST00000377602.4	hg19	CCDS31158.1	.	.	.	.	.	.	.	.	.	.	C	0.015	-1.543833	0.00934	.	.	ENSG00000148488	ENST00000440449	.	.	.	5.18	-7.5	0.01351	.	.	.	.	.	T	0.30978	0.0782	.	.	.	0.32042	N	0.598104	.	.	.	.	.	.	T	0.36359	-0.9751	4	.	.	.	0.8831	5.9037	0.18980	0.2924:0.3042:0.0:0.4034	.	.	.	.	P	107	.	.	A	-	1	0	ST8SIA6	17403222	0.002000	0.14202	0.002000	0.10522	0.018000	0.09664	-1.684000	0.01932	-1.523000	0.01767	-1.154000	0.01816	GCT	.	.		0.433	ST8SIA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047036.1	NM_001004470	
CWF19L1	55280	hgsc.bcm.edu	37	10	102020773	102020773	+	Missense_Mutation	SNP	C	C	G			TCGA-2Y-A9GS-01A-12D-A382-10	TCGA-2Y-A9GS-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ce44141-64e4-4d9d-9971-4dc79b316d4a	27ea2725-9c48-4965-a503-91d2302923b4	g.chr10:102020773C>G	ENST00000354105.4	-	3	223	c.137G>C	c.(136-138)gGc>gCc	p.G46A	RNU6-422P_ENST00000384632.1_RNA	NM_018294.4	NP_060764.3	Q69YN2	C19L1_HUMAN	CWF19-like 1, cell cycle control (S. pombe)	46							catalytic activity (GO:0003824)			cervix(1)|endometrium(2)|kidney(1)|large_intestine(4)|liver(1)|lung(4)|pancreas(1)|prostate(1)|stomach(2)	17		Colorectal(252;0.117)		Epithelial(162;3.78e-10)|all cancers(201;3.1e-08)		TTGGGTGGAGCCAAAGAAATT	0.289																																					p.G46A		Atlas-SNP	.											.	CWF19L1	39	.	0			c.G137C						.						54.0	53.0	53.0					10																	102020773		2203	4299	6502	SO:0001583	missense	55280	exon3			GTGGAGCCAAAGA	AK001860	CCDS7489.1	10q24.31	2008-11-24			ENSG00000095485	ENSG00000095485			25613	protein-coding gene	gene with protein product						14702039	Standard	NM_018294		Approved	FLJ10998	uc001kqq.1	Q69YN2	OTTHUMG00000018901	ENST00000354105.4:c.137G>C	chr10.hg19:g.102020773C>G	ENSP00000326411:p.Gly46Ala	484.0	1.0		403.0	232.0	NM_018294	B4DHX1|D3DR66|Q5W0I3|Q96HC3|Q9H865|Q9NV13	Missense_Mutation	SNP	ENST00000354105.4	hg19	CCDS7489.1	.	.	.	.	.	.	.	.	.	.	C	17.57	3.421660	0.62622	.	.	ENSG00000095485	ENST00000354105	T	0.38887	1.11	5.83	4.93	0.64822	.	0.087163	0.85682	D	0.000000	T	0.38268	0.1034	L	0.39633	1.23	0.80722	D	1	P	0.50156	0.932	P	0.47206	0.541	T	0.09975	-1.0650	10	0.14252	T	0.57	-5.1579	12.8254	0.57716	0.0:0.9208:0.0:0.0792	.	46	Q69YN2	C19L1_HUMAN	A	46	ENSP00000326411:G46A	ENSP00000326411:G46A	G	-	2	0	CWF19L1	102010763	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	5.275000	0.65575	1.477000	0.48234	0.484000	0.47621	GGC	.	.		0.289	CWF19L1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_018294	
OR52R1	119695	hgsc.bcm.edu	37	11	4824698	4824698	+	Missense_Mutation	SNP	T	T	C			TCGA-2Y-A9GS-01A-12D-A382-10	TCGA-2Y-A9GS-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ce44141-64e4-4d9d-9971-4dc79b316d4a	27ea2725-9c48-4965-a503-91d2302923b4	g.chr11:4824698T>C	ENST00000356069.2	-	1	912	c.913A>G	c.(913-915)Agg>Ggg	p.R305G	OR52R1_ENST00000380382.1_Missense_Mutation_p.R384G|MMP26_ENST00000477339.1_Intron|MMP26_ENST00000380390.1_Intron	NM_001005177.3	NP_001005177.3	Q8NGF1	O52R1_HUMAN	olfactory receptor, family 52, subfamily R, member 1	305						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(14)|prostate(1)|skin(3)	29		Medulloblastoma(188;0.0025)|Breast(177;0.0184)|all_neural(188;0.0227)		Epithelial(150;4.77e-12)|BRCA - Breast invasive adenocarcinoma(625;0.00435)|LUSC - Lung squamous cell carcinoma(625;0.19)		TGGATAACCCTGTCCCCGATC	0.463																																					p.R305G		Atlas-SNP	.											.	OR52R1	81	.	0			c.A913G						.						87.0	87.0	87.0					11																	4824698		2201	4298	6499	SO:0001583	missense	119695	exon1			TAACCCTGTCCCC	BK004282	CCDS31360.1, CCDS31360.2	11p15.4	2012-08-09			ENSG00000176937	ENSG00000176937		"""GPCR / Class A : Olfactory receptors"""	15235	protein-coding gene	gene with protein product							Standard	NM_001005177		Approved		uc021qcs.1	Q8NGF1	OTTHUMG00000066510	ENST00000356069.2:c.913A>G	chr11.hg19:g.4824698T>C	ENSP00000348368:p.Arg305Gly	117.0	0.0		152.0	56.0	NM_001005177	Q6IFI0	Missense_Mutation	SNP	ENST00000356069.2	hg19	CCDS31360.2	.	.	.	.	.	.	.	.	.	.	T	13.30	2.195947	0.38806	.	.	ENSG00000176937	ENST00000356069;ENST00000380382	T;T	0.37584	1.19;1.19	5.43	5.43	0.79202	.	0.000000	0.53938	D	0.000045	T	0.33352	0.0860	M	0.63208	1.945	0.32803	D	0.500364	P	0.42078	0.77	B	0.36186	0.219	T	0.52624	-0.8551	10	0.34782	T	0.22	.	11.7962	0.52102	0.0:0.0:0.0:1.0	.	305	Q8NGF1	O52R1_HUMAN	G	305;384	ENSP00000348368:R305G;ENSP00000369742:R384G	ENSP00000348368:R305G	R	-	1	2	OR52R1	4781274	0.000000	0.05858	0.611000	0.29010	0.009000	0.06853	0.239000	0.18023	2.271000	0.75665	0.528000	0.53228	AGG	.	.		0.463	OR52R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142183.1	NM_001005177	
NLRP14	338323	hgsc.bcm.edu	37	11	7091576	7091576	+	Missense_Mutation	SNP	G	G	A			TCGA-2Y-A9GS-01A-12D-A382-10	TCGA-2Y-A9GS-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ce44141-64e4-4d9d-9971-4dc79b316d4a	27ea2725-9c48-4965-a503-91d2302923b4	g.chr11:7091576G>A	ENST00000299481.4	+	11	3381	c.3035G>A	c.(3034-3036)tGc>tAc	p.C1012Y		NM_176822.3	NP_789792.1	Q86W24	NAL14_HUMAN	NLR family, pyrin domain containing 14	1012					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)		ATP binding (GO:0005524)			breast(3)|large_intestine(7)|lung(1)|ovary(3)|pancreas(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	21				Epithelial(150;4.62e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0871)		GCTCTTATCTGCAACAAAAGA	0.348																																					p.C1012Y		Atlas-SNP	.											.	NLRP14	187	.	0			c.G3035A						.						104.0	100.0	101.0					11																	7091576		2201	4296	6497	SO:0001583	missense	338323	exon11			TTATCTGCAACAA	BK001107	CCDS7776.1	11p15.4	2006-12-08	2006-12-08	2006-12-08		ENSG00000158077		"""Nucleotide-binding domain and leucine rich repeat containing"""	22939	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 14"""	609665	"""NACHT, leucine rich repeat and PYD containing 14"""	NALP14		12563287	Standard	NM_176822		Approved	NOD5, GC-LRR, Nalp-iota, PAN8, CLR11.2	uc001mfb.1	Q86W24		ENST00000299481.4:c.3035G>A	chr11.hg19:g.7091576G>A	ENSP00000299481:p.Cys1012Tyr	72.0	0.0		99.0	35.0	NM_176822	Q7RTR6	Missense_Mutation	SNP	ENST00000299481.4	hg19	CCDS7776.1	.	.	.	.	.	.	.	.	.	.	G	8.559	0.877223	0.17395	.	.	ENSG00000158077	ENST00000299481	T	0.41065	1.01	4.13	1.67	0.24075	.	0.504141	0.18557	N	0.137736	T	0.28928	0.0718	L	0.48362	1.52	0.23607	N	0.997302	B	0.30542	0.284	B	0.27887	0.084	T	0.13176	-1.0519	10	0.35671	T	0.21	.	3.9463	0.09350	0.1833:0.221:0.5956:0.0	.	1012	Q86W24	NAL14_HUMAN	Y	1012	ENSP00000299481:C1012Y	ENSP00000299481:C1012Y	C	+	2	0	NLRP14	7048152	0.000000	0.05858	0.473000	0.27253	0.026000	0.11368	-0.991000	0.03728	0.421000	0.25980	0.557000	0.71058	TGC	.	.		0.348	NLRP14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384551.1	NM_176822	
DAK	26007	hgsc.bcm.edu	37	11	61113934	61113934	+	Missense_Mutation	SNP	G	G	T			TCGA-2Y-A9GS-01A-12D-A382-10	TCGA-2Y-A9GS-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ce44141-64e4-4d9d-9971-4dc79b316d4a	27ea2725-9c48-4965-a503-91d2302923b4	g.chr11:61113934G>T	ENST00000394900.3	+	18	1916	c.1687G>T	c.(1687-1689)Gct>Tct	p.A563S	CYB561A3_ENST00000540317.1_5'Flank	NM_015533.3	NP_056348.2	Q3LXA3	DHAK_HUMAN	dihydroxyacetone kinase 2 homolog (S. cerevisiae)	563	DhaL. {ECO:0000255|PROSITE- ProRule:PRU00813}.				carbohydrate phosphorylation (GO:0046835)|cellular carbohydrate metabolic process (GO:0044262)|glycerol metabolic process (GO:0006071)|innate immune response (GO:0045087)|regulation of innate immune response (GO:0045088)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ATP binding (GO:0005524)|FAD-AMP lyase (cyclizing) activity (GO:0034012)|glycerone kinase activity (GO:0004371)|metal ion binding (GO:0046872)|triokinase activity (GO:0050354)			NS(1)|breast(3)|endometrium(3)|large_intestine(5)|lung(8)|prostate(2)|upper_aerodigestive_tract(1)	23						GGTGGCAGCTGCTGCCATCCT	0.622																																					p.A563S		Atlas-SNP	.											.	DAK	52	.	0			c.G1687T						.						73.0	86.0	82.0					11																	61113934		2203	4299	6502	SO:0001583	missense	26007	exon18			GCAGCTGCTGCCA		CCDS8003.1	11q12.2	2009-11-06	2006-04-04		ENSG00000149476	ENSG00000149476			24552	protein-coding gene	gene with protein product		615844	"""dihydroxyacetone kinase 2 homolog (yeast)"""				Standard	XM_005273898		Approved	DKFZP586B1621, NET45	uc001nre.3	Q3LXA3	OTTHUMG00000168076	ENST00000394900.3:c.1687G>T	chr11.hg19:g.61113934G>T	ENSP00000378360:p.Ala563Ser	26.0	0.0		28.0	15.0	NM_015533	Q2L9C1|Q53EQ9|Q9BVA7|Q9H895	Missense_Mutation	SNP	ENST00000394900.3	hg19	CCDS8003.1	.	.	.	.	.	.	.	.	.	.	G	20.6	4.012156	0.75046	.	.	ENSG00000149476	ENST00000394900	T	0.32988	1.43	5.67	5.67	0.87782	Dak phosphatase (3);	0.049597	0.85682	D	0.000000	T	0.45836	0.1362	L	0.41492	1.28	0.58432	D	0.999998	D	0.67145	0.996	D	0.63192	0.912	T	0.17992	-1.0351	10	0.44086	T	0.13	-17.6	17.9412	0.89027	0.0:0.0:1.0:0.0	.	563	Q3LXA3	DHAK_HUMAN	S	563	ENSP00000378360:A563S	ENSP00000378360:A563S	A	+	1	0	DAK	60870510	1.000000	0.71417	0.192000	0.23308	0.960000	0.62799	4.875000	0.63072	2.686000	0.91538	0.561000	0.74099	GCT	.	.		0.622	DAK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394425.4	NM_015533	
MAP4K2	5871	hgsc.bcm.edu	37	11	64567661	64567661	+	Missense_Mutation	SNP	G	G	A			TCGA-2Y-A9GS-01A-12D-A382-10	TCGA-2Y-A9GS-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ce44141-64e4-4d9d-9971-4dc79b316d4a	27ea2725-9c48-4965-a503-91d2302923b4	g.chr11:64567661G>A	ENST00000294066.2	-	12	926	c.835C>T	c.(835-837)Cgg>Tgg	p.R279W	MAP4K2_ENST00000468062.1_5'Flank|MAP4K2_ENST00000377350.3_Missense_Mutation_p.R279W	NM_004579.3	NP_004570.2	Q12851	M4K2_HUMAN	mitogen-activated protein kinase kinase kinase kinase 2	279					activation of JUN kinase activity (GO:0007257)|immune response (GO:0006955)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|JNK cascade (GO:0007254)|positive regulation of JNK cascade (GO:0046330)|protein phosphorylation (GO:0006468)|vesicle targeting (GO:0006903)	Golgi membrane (GO:0000139)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|mitogen-activated protein kinase kinase kinase binding (GO:0031435)|protein serine/threonine kinase activity (GO:0004674)|small GTPase regulator activity (GO:0005083)			cervix(1)|lung(3)|ovary(1)|pancreas(1)|urinary_tract(2)	8						AGGAGGGCCCGAGGGAGCTGC	0.642																																					p.R279W		Atlas-SNP	.											.	MAP4K2	83	.	0			c.C835T						.						28.0	33.0	31.0					11																	64567661		2201	4297	6498	SO:0001583	missense	5871	exon12			GGGCCCGAGGGAG	BC047865	CCDS8082.1	11q13.1	2011-06-09			ENSG00000168067	ENSG00000168067		"""Mitogen-activated protein kinase cascade / Kinase kinase kinase kinases"""	6864	protein-coding gene	gene with protein product		603166		RAB8IP		7515885	Standard	NM_004579		Approved	GCK, BL44	uc001obh.3	Q12851	OTTHUMG00000045328	ENST00000294066.2:c.835C>T	chr11.hg19:g.64567661G>A	ENSP00000294066:p.Arg279Trp	35.0	0.0		30.0	6.0	NM_004579	Q86VU3	Missense_Mutation	SNP	ENST00000294066.2	hg19	CCDS8082.1	.	.	.	.	.	.	.	.	.	.	G	16.59	3.165594	0.57476	.	.	ENSG00000168067	ENST00000294066;ENST00000377350;ENST00000439069	T;T;T	0.27557	1.66;1.66;1.66	4.12	3.19	0.36642	Protein kinase-like domain (1);	0.240072	0.30762	N	0.008928	T	0.35068	0.0919	L	0.31476	0.935	0.37252	D	0.90658	P;D	0.69078	0.955;0.997	B;P	0.57468	0.354;0.821	T	0.39272	-0.9622	10	0.72032	D	0.01	.	11.1656	0.48541	0.0:0.0:0.8144:0.1856	.	279;279	Q86VU3;Q12851	.;M4K2_HUMAN	W	279;279;235	ENSP00000294066:R279W;ENSP00000366567:R279W;ENSP00000403563:R235W	ENSP00000294066:R279W	R	-	1	2	MAP4K2	64324237	0.994000	0.37717	0.996000	0.52242	0.994000	0.84299	1.813000	0.38962	1.090000	0.41315	0.456000	0.33151	CGG	.	.		0.642	MAP4K2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000105239.1	NM_004579	
KRT81	3887	hgsc.bcm.edu	37	12	52681039	52681039	+	Missense_Mutation	SNP	C	C	T			TCGA-2Y-A9GS-01A-12D-A382-10	TCGA-2Y-A9GS-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ce44141-64e4-4d9d-9971-4dc79b316d4a	27ea2725-9c48-4965-a503-91d2302923b4	g.chr12:52681039C>T	ENST00000327741.5	-	7	1162	c.1094G>A	c.(1093-1095)cGc>cAc	p.R365H	KRT86_ENST00000423955.2_Intron|KRT86_ENST00000544024.1_Intron	NM_002281.3	NP_002272.2	Q14533	KRT81_HUMAN	keratin 81	365	Coil 2.|Rod.					extracellular space (GO:0005615)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)			breast(2)|endometrium(3)|large_intestine(3)|lung(6)|prostate(1)|stomach(1)	16				BRCA - Breast invasive adenocarcinoma(357;0.189)		CAGCTTGCAGCGGGCATCACT	0.612																																					p.R365H		Atlas-SNP	.											.	KRT81	46	.	0			c.G1094A						.						37.0	36.0	37.0					12																	52681039		2202	4297	6499	SO:0001583	missense	3887	exon7			TTGCAGCGGGCAT	X81420	CCDS31805.1	12q13	2013-01-16	2006-07-17	2006-07-17	ENSG00000205426	ENSG00000205426		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6458	protein-coding gene	gene with protein product	"""hard keratin type II 1"""	602153	"""keratin, hair, basic, 1"""	KRTHB1		7556444, 16831889	Standard	NM_002281		Approved	Hb-1	uc001sab.3	Q14533	OTTHUMG00000167574	ENST00000327741.5:c.1094G>A	chr12.hg19:g.52681039C>T	ENSP00000369349:p.Arg365His	89.0	0.0		92.0	22.0	NM_002281	Q14846|Q16274|Q17R48|Q8WU52|Q9BR74	Missense_Mutation	SNP	ENST00000327741.5	hg19	CCDS31805.1	.	.	.	.	.	.	.	.	.	.	C	12.54	1.967990	0.34754	.	.	ENSG00000205426	ENST00000327741;ENST00000389388	D	0.90004	-2.6	5.1	-1.06	0.10002	Filament (1);	3.356480	0.01608	U	0.022403	D	0.87462	0.6183	M	0.62088	1.915	0.18873	N	0.999989	B	0.26602	0.154	B	0.24269	0.052	T	0.71066	-0.4700	10	0.37606	T	0.19	.	10.7506	0.46207	0.0:0.4193:0.0:0.5807	.	365	Q14533	KRT81_HUMAN	H	365	ENSP00000369349:R365H	ENSP00000369349:R365H	R	-	2	0	KRT81	50967306	0.000000	0.05858	0.095000	0.20976	0.658000	0.38924	-0.067000	0.11579	-0.036000	0.13669	0.561000	0.74099	CGC	.	.		0.612	KRT81-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395128.2	NM_002281	
BAZ2A	11176	hgsc.bcm.edu	37	12	56995571	56995571	+	Missense_Mutation	SNP	T	T	C	rs367656362		TCGA-2Y-A9GS-01A-12D-A382-10	TCGA-2Y-A9GS-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ce44141-64e4-4d9d-9971-4dc79b316d4a	27ea2725-9c48-4965-a503-91d2302923b4	g.chr12:56995571T>C	ENST00000551812.1	-	20	4029	c.3836A>G	c.(3835-3837)cAt>cGt	p.H1279R	BAZ2A_ENST00000553222.1_5'Flank|BAZ2A_ENST00000549884.1_Missense_Mutation_p.H1277R|BAZ2A_ENST00000379441.3_Missense_Mutation_p.H1249R|BAZ2A_ENST00000179765.5_Missense_Mutation_p.H1247R	NM_013449.3	NP_038477.2	Q9UIF9	BAZ2A_HUMAN	bromodomain adjacent to zinc finger domain, 2A	1279					chromatin remodeling (GO:0006338)|chromatin silencing at rDNA (GO:0000183)|DNA methylation (GO:0006306)|heterochromatin assembly involved in chromatin silencing (GO:0070869)|histone deacetylation (GO:0016575)|histone H3-K9 methylation (GO:0051567)|histone H4 deacetylation (GO:0070933)|histone H4-K20 methylation (GO:0034770)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	chromatin silencing complex (GO:0005677)|nucleolus (GO:0005730)|rDNA heterochromatin (GO:0033553)	DNA binding (GO:0003677)|ligand-dependent nuclear receptor binding (GO:0016922)|lysine-acetylated histone binding (GO:0070577)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			breast(1)|cervix(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(15)|urinary_tract(1)	31						CAGGGAGCTATGGCTCTGAGT	0.587																																					p.H1279R		Atlas-SNP	.											.	BAZ2A	263	.	0			c.A3836G						.	T	ARG/HIS	0,4090		0,0,2045	103.0	109.0	107.0		3836	2.7	0.8	12		107	1,8399		0,1,4199	no	missense	BAZ2A	NM_013449.3	29	0,1,6244	CC,CT,TT		0.0119,0.0,0.0080	possibly-damaging	1279/1906	56995571	1,12489	2045	4200	6245	SO:0001583	missense	11176	exon20			GAGCTATGGCTCT	AB032254	CCDS44924.1, CCDS73483.1	12q13.3	2013-01-28				ENSG00000076108		"""Zinc fingers, PHD-type"""	962	protein-coding gene	gene with protein product	"""TTF-I interacting peptide 5"""	605682				10662543, 11532953	Standard	XM_005268596		Approved	KIAA0314, TIP5, WALp3	uc001slq.1	Q9UIF9	OTTHUMG00000170332	ENST00000551812.1:c.3836A>G	chr12.hg19:g.56995571T>C	ENSP00000446880:p.His1279Arg	72.0	0.0		108.0	31.0	NM_013449	B3KN66|O00536|O15030|Q68DI8|Q96H26	Missense_Mutation	SNP	ENST00000551812.1	hg19	CCDS44924.1	.	.	.	.	.	.	.	.	.	.	T	9.935	1.215842	0.22373	0.0	1.19E-4	ENSG00000076108	ENST00000379441;ENST00000179765;ENST00000551812;ENST00000549787;ENST00000549884	T;T;T;T;T	0.69435	-0.14;-0.15;-0.16;-0.4;-0.15	5.23	2.72	0.32119	.	0.147753	0.31660	N	0.007278	T	0.62368	0.2422	L	0.44542	1.39	0.09310	N	0.999998	D;D;D;D	0.56968	0.978;0.978;0.963;0.978	P;P;P;P	0.53649	0.731;0.731;0.543;0.731	T	0.51012	-0.8759	10	0.30854	T	0.27	-32.7742	5.5369	0.17016	0.0:0.0919:0.264:0.6442	.	1277;1279;1279;1252	F8VU39;Q9UIF9-3;Q9UIF9;Q9UIF9-2	.;.;BAZ2A_HUMAN;.	R	1249;1247;1279;215;1277	ENSP00000368754:H1249R;ENSP00000179765:H1247R;ENSP00000446880:H1279R;ENSP00000448760:H215R;ENSP00000447941:H1277R	ENSP00000179765:H1247R	H	-	2	0	BAZ2A	55281838	0.751000	0.28327	0.757000	0.31301	0.746000	0.42486	0.858000	0.27845	0.952000	0.37798	-0.353000	0.07706	CAT	.	.		0.587	BAZ2A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000408561.1	NM_013449	
HSP90B1	7184	hgsc.bcm.edu	37	12	104337556	104337556	+	Missense_Mutation	SNP	C	C	A			TCGA-2Y-A9GS-01A-12D-A382-10	TCGA-2Y-A9GS-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ce44141-64e4-4d9d-9971-4dc79b316d4a	27ea2725-9c48-4965-a503-91d2302923b4	g.chr12:104337556C>A	ENST00000299767.5	+	14	2113	c.1931C>A	c.(1930-1932)cCg>cAg	p.P644Q		NM_003299.2	NP_003290.1	P14625	ENPL_HUMAN	heat shock protein 90kDa beta (Grp94), member 1	644					actin rod assembly (GO:0031247)|activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|cellular response to ATP (GO:0071318)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|innate immune response (GO:0045087)|negative regulation of apoptotic process (GO:0043066)|protein folding (GO:0006457)|protein transport (GO:0015031)|regulation of phosphoprotein phosphatase activity (GO:0043666)|response to hypoxia (GO:0001666)|sequestering of calcium ion (GO:0051208)|toll-like receptor signaling pathway (GO:0002224)	cytosol (GO:0005829)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|midbody (GO:0030496)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|low-density lipoprotein particle receptor binding (GO:0050750)|protein phosphatase binding (GO:0019903)|RNA binding (GO:0003723)|virion binding (GO:0046790)			central_nervous_system(1)|kidney(5)|large_intestine(7)|lung(8)|ovary(2)|prostate(1)|skin(1)|urinary_tract(4)	29					Rifabutin(DB00615)	ACAGAATCTCCGTGTGCTTTG	0.443																																					p.P644Q		Atlas-SNP	.											.	HSP90B1	72	.	0			c.C1931A						.						82.0	75.0	77.0					12																	104337556		2203	4300	6503	SO:0001583	missense	7184	exon14			AATCTCCGTGTGC	AY040226	CCDS9094.1	12q24.2-q24.3	2011-09-02	2006-02-24	2006-02-24		ENSG00000166598		"""Heat shock proteins / HSPC"""	12028	protein-coding gene	gene with protein product		191175	"""tumor rejection antigen (gp96) 1"""	TRA1		16269234	Standard	NM_003299		Approved	GP96, GRP94	uc001tkb.2	P14625	OTTHUMG00000170118	ENST00000299767.5:c.1931C>A	chr12.hg19:g.104337556C>A	ENSP00000299767:p.Pro644Gln	93.0	0.0		86.0	18.0	NM_003299	Q96A97	Missense_Mutation	SNP	ENST00000299767.5	hg19	CCDS9094.1	.	.	.	.	.	.	.	.	.	.	C	32	5.139105	0.94560	.	.	ENSG00000166598	ENST00000299767;ENST00000421266	T	0.70986	-0.53	5.59	5.59	0.84812	.	0.000000	0.85682	D	0.000000	D	0.92499	0.7618	H	0.99863	4.86	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.95613	0.8674	10	0.87932	D	0	.	19.961	0.97250	0.0:1.0:0.0:0.0	.	644	P14625	ENPL_HUMAN	Q	644;394	ENSP00000299767:P644Q	ENSP00000299767:P644Q	P	+	2	0	HSP90B1	102861686	1.000000	0.71417	0.970000	0.41538	0.979000	0.70002	7.818000	0.86416	2.783000	0.95769	0.655000	0.94253	CCG	.	.		0.443	HSP90B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407349.1	NM_003299	
EXD1	161829	hgsc.bcm.edu	37	15	41476594	41476594	+	Silent	SNP	A	A	G			TCGA-2Y-A9GS-01A-12D-A382-10	TCGA-2Y-A9GS-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ce44141-64e4-4d9d-9971-4dc79b316d4a	27ea2725-9c48-4965-a503-91d2302923b4	g.chr15:41476594A>G	ENST00000314992.5	-	10	1270	c.1080T>C	c.(1078-1080)ttT>ttC	p.F360F	EXD1_ENST00000458580.2_Silent_p.F418F	NM_152596.2	NP_689809.2	Q8NHP7	EXD1_HUMAN	exonuclease 3'-5' domain containing 1	360							3'-5' exonuclease activity (GO:0008408)|nucleic acid binding (GO:0003676)			large_intestine(5)|liver(1)|lung(4)|ovary(2)|prostate(2)|skin(2)	16						TATCTATCCTAAAATTTTTAC	0.378																																					p.F360F		Atlas-SNP	.											.	EXD1	52	.	0			c.T1080C						.						117.0	128.0	124.0					15																	41476594		2202	4300	6502	SO:0001819	synonymous_variant	161829	exon10			TATCCTAAAATTT	BC030628	CCDS10072.1, CCDS66738.1	15q15.1	2009-02-24	2009-02-24	2009-02-24	ENSG00000178997	ENSG00000178997			28507	protein-coding gene	gene with protein product			"""exonuclease 3'-5' domain-like 1"""	EXDL1		12477932	Standard	NM_001286441		Approved	MGC33637	uc001znk.3	Q8NHP7	OTTHUMG00000130232	ENST00000314992.5:c.1080T>C	chr15.hg19:g.41476594A>G		104.0	0.0		159.0	22.0	NM_152596	A8K909|B7Z839|Q6ZW94	Silent	SNP	ENST00000314992.5	hg19	CCDS10072.1																																																																																			.	.		0.378	EXD1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000252553.2	NM_152596	
PDE8A	5151	hgsc.bcm.edu	37	15	85634396	85634396	+	Missense_Mutation	SNP	G	G	T			TCGA-2Y-A9GS-01A-12D-A382-10	TCGA-2Y-A9GS-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ce44141-64e4-4d9d-9971-4dc79b316d4a	27ea2725-9c48-4965-a503-91d2302923b4	g.chr15:85634396G>T	ENST00000310298.4	+	9	1088	c.836G>T	c.(835-837)tGc>tTc	p.C279F	PDE8A_ENST00000339708.5_Intron|PDE8A_ENST00000557819.2_Intron|PDE8A_ENST00000394553.1_Missense_Mutation_p.C279F|PDE8A_ENST00000557957.1_Missense_Mutation_p.C207F			O60658	PDE8A_HUMAN	phosphodiesterase 8A	279	PAS. {ECO:0000255|PROSITE- ProRule:PRU00140}.				cAMP catabolic process (GO:0006198)|cyclic nucleotide metabolic process (GO:0009187)|phosphorelay signal transduction system (GO:0000160)|regulation of transcription, DNA-templated (GO:0006355)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)			NS(1)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(4)|lung(8)|ovary(2)|pancreas(1)|prostate(1)|skin(2)	25	Colorectal(223;0.227)		BRCA - Breast invasive adenocarcinoma(143;0.0608)		Caffeine(DB00201)|Ketotifen(DB00920)	ATAAATTCATGCATCAGGATA	0.388																																					p.C279F		Atlas-SNP	.											.	PDE8A	50	.	0			c.G836T						.						78.0	76.0	76.0					15																	85634396		2203	4299	6502	SO:0001583	missense	5151	exon8			ATTCATGCATCAG	AF056490	CCDS10336.1, CCDS10337.1, CCDS58397.1	15q25.3	2008-05-14			ENSG00000073417	ENSG00000073417	3.1.4.17	"""Phosphodiesterases"""	8793	protein-coding gene	gene with protein product		602972				9618252	Standard	NM_001243137		Approved	HsT19550	uc002blh.3	O60658	OTTHUMG00000148670	ENST00000310298.4:c.836G>T	chr15.hg19:g.85634396G>T	ENSP00000311453:p.Cys279Phe	173.0	0.0		271.0	77.0	NM_002605	B3KXE6|H0YMZ7|Q6P9H3|Q969I1|Q96PC9|Q96PD0|Q96PD1|Q96T71|Q9UMB7|Q9UMC3	Missense_Mutation	SNP	ENST00000310298.4	hg19	CCDS10336.1	.	.	.	.	.	.	.	.	.	.	G	10.74	1.434826	0.25813	.	.	ENSG00000073417	ENST00000310298;ENST00000394553	T;T	0.76186	-1.0;-1.0	4.61	1.11	0.20524	PAS (3);PAS fold (1);	0.461207	0.26804	N	0.022411	T	0.70011	0.3175	M	0.78637	2.42	0.52099	D	0.999947	P	0.47106	0.89	P	0.45071	0.468	T	0.66736	-0.5848	10	0.10111	T	0.7	.	7.4282	0.27111	0.3635:0.0:0.6365:0.0	.	279	O60658	PDE8A_HUMAN	F	279	ENSP00000311453:C279F;ENSP00000378056:C279F	ENSP00000311453:C279F	C	+	2	0	PDE8A	83435400	1.000000	0.71417	0.979000	0.43373	0.933000	0.57130	3.564000	0.53791	0.136000	0.18733	0.563000	0.77884	TGC	.	.		0.388	PDE8A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000309018.1	NM_002605	
GSG1L	146395	hgsc.bcm.edu	37	16	28074601	28074601	+	Missense_Mutation	SNP	G	G	A			TCGA-2Y-A9GS-01A-12D-A382-10	TCGA-2Y-A9GS-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ce44141-64e4-4d9d-9971-4dc79b316d4a	27ea2725-9c48-4965-a503-91d2302923b4	g.chr16:28074601G>A	ENST00000447459.2	-	1	229	c.145C>T	c.(145-147)Cgc>Tgc	p.R49C	GSG1L_ENST00000380898.2_5'UTR|GSG1L_ENST00000395724.3_Missense_Mutation_p.R49C	NM_001109763.1	NP_001103233.1	Q6UXU4	GSG1L_HUMAN	GSG1-like	49					regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)	asymmetric synapse (GO:0032279)|cell junction (GO:0030054)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				endometrium(2)|large_intestine(2)|lung(8)|ovary(1)|prostate(4)	17						CAGTTGGCGCGCCCGCCCTGG	0.786																																					p.R49C		Atlas-SNP	.											.	GSG1L	82	.	0			c.C145T						.						1.0	2.0	1.0					16																	28074601		903	1984	2887	SO:0001583	missense	146395	exon1			TGGCGCGCCCGCC	AK128775	CCDS10631.1, CCDS45450.1	16p11.2	2014-01-20			ENSG00000169181	ENSG00000169181			28283	protein-coding gene	gene with protein product						22813734	Standard	NM_001109763		Approved	MGC18079, PRO19651, KTSR5831	uc002doz.2	Q6UXU4	OTTHUMG00000131676	ENST00000447459.2:c.145C>T	chr16.hg19:g.28074601G>A	ENSP00000394954:p.Arg49Cys	4.0	0.0		8.0	6.0	NM_001109763	Q7Z6F8|Q8TB81	Missense_Mutation	SNP	ENST00000447459.2	hg19	CCDS45450.1	.	.	.	.	.	.	.	.	.	.	G	16.19	3.053134	0.55218	.	.	ENSG00000169181	ENST00000447459;ENST00000395724	T;T	0.32023	1.47;1.47	2.95	-5.52	0.02560	.	0.771763	0.10741	U	0.639421	T	0.20333	0.0489	L	0.27053	0.805	0.80722	D	1	D;D	0.56035	0.969;0.974	B;P	0.48114	0.34;0.567	T	0.47711	-0.9096	10	0.59425	D	0.04	.	4.7527	0.13068	0.0:0.2233:0.2526:0.5241	.	49;49	Q6UXU4-3;Q6UXU4	.;GSG1L_HUMAN	C	49	ENSP00000394954:R49C;ENSP00000379074:R49C	ENSP00000379074:R49C	R	-	1	0	GSG1L	27982102	.	.	0.988000	0.46212	0.980000	0.70556	.	.	-0.552000	0.06167	0.305000	0.20034	CGC	.	.		0.786	GSG1L-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433832.2	NM_144675	
APOBR	55911	hgsc.bcm.edu	37	16	28511194	28511194	+	IGR	SNP	C	C	T			TCGA-2Y-A9GS-01A-12D-A382-10	TCGA-2Y-A9GS-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ce44141-64e4-4d9d-9971-4dc79b316d4a	27ea2725-9c48-4965-a503-91d2302923b4	g.chr16:28511194C>T	ENST00000431282.1	+	0	3414				IL27_ENST00000356897.1_Silent_p.E170E			Q0VD83	APOBR_HUMAN	apolipoprotein B receptor						cholesterol metabolic process (GO:0008203)|lipid transport (GO:0006869)|triglyceride metabolic process (GO:0006641)	chylomicron (GO:0042627)|low-density lipoprotein particle (GO:0034362)|membrane (GO:0016020)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	very-low-density lipoprotein particle receptor activity (GO:0030229)			breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(11)|prostate(1)|skin(2)|stomach(1)	29						cctcctcctcctcttcctcct	0.677																																					p.E170E		Atlas-SNP	.											.	IL27	27	.	0			c.G510A						.						9.0	10.0	9.0					16																	28511194		2158	4227	6385	SO:0001628	intergenic_variant	246778	exon5			CTCCTCCTCTTCC	AK025123	CCDS58442.1	16p11.2	2011-02-14			ENSG00000184730	ENSG00000184730			24087	protein-coding gene	gene with protein product	"""apolipoprotein B48 receptor"", ""apolipoprotein B100 receptor"""	605220				10852956	Standard	NM_018690		Approved	APOB48R, APOB100R	uc002dqb.2	Q0VD83			chr16.hg19:g.28511194C>T		67.0	0.0		94.0	5.0	NM_145659	H3BU97|Q0VD81|Q8NC15|Q9NPJ9	Silent	SNP	ENST00000431282.1	hg19																																																																																				.	.		0.677	APOBR-202	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_182804	
TP53	7157	hgsc.bcm.edu	37	17	7577534	7577534	+	Missense_Mutation	SNP	C	C	A	rs28934571		TCGA-2Y-A9GS-01A-12D-A382-10	TCGA-2Y-A9GS-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ce44141-64e4-4d9d-9971-4dc79b316d4a	27ea2725-9c48-4965-a503-91d2302923b4	g.chr17:7577534C>A	ENST00000269305.4	-	7	936	c.747G>T	c.(745-747)agG>agT	p.R249S	TP53_ENST00000420246.2_Missense_Mutation_p.R249S|TP53_ENST00000445888.2_Missense_Mutation_p.R249S|TP53_ENST00000359597.4_Missense_Mutation_p.R249S|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000455263.2_Missense_Mutation_p.R249S|TP53_ENST00000413465.2_Missense_Mutation_p.R249S	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	249	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		R -> G (in sporadic cancers; somatic mutation).|R -> I (in a sporadic cancer; somatic mutation).|R -> K (in sporadic cancers; somatic mutation).|R -> M (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:17224074}.|R -> N (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|R -> S (in sporadic cancers; somatic mutation; does not induce SNAI1 degradation; dbSNP:rs28934571). {ECO:0000269|PubMed:1694291, ECO:0000269|PubMed:16959974}.|R -> T (in sporadic cancers; somatic mutation).|R -> W (in sporadic cancers; somatic mutation).|RP -> SA (in a sporadic cancer; somatic mutation).|RP -> SS (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R249S(348)|p.0?(8)|p.R249R(5)|p.?(5)|p.M246_P250delMNRRP(2)|p.R248_P250delRRP(1)|p.R249_P250delRP(1)|p.R249_P250insR(1)|p.R249_P250>SS(1)|p.N247_R249delNRR(1)|p.N247_P250delNRRP(1)|p.R249fs*14(1)|p.R249_T256delRPILTIIT(1)|p.P250fs*14(1)|p.R249_I251delRPI(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TGAGGATGGGCCTCCGGTTCA	0.572		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.R249S	Pancreas(47;798 1329 9957 10801)	Atlas-SNP	.	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53_ENST00000455263,right_lower_lobe,carcinoma,-2,1	TP53	33396	.	378	Substitution - Missense(348)|Deletion - In frame(8)|Whole gene deletion(8)|Unknown(5)|Substitution - coding silent(5)|Insertion - Frameshift(1)|Insertion - In frame(1)|Deletion - Frameshift(1)|Complex - compound substitution(1)	liver(240)|lung(44)|upper_aerodigestive_tract(12)|breast(12)|central_nervous_system(10)|stomach(7)|ovary(6)|prostate(6)|cervix(5)|haematopoietic_and_lymphoid_tissue(5)|large_intestine(5)|biliary_tract(5)|urinary_tract(5)|bone(4)|endometrium(3)|oesophagus(3)|skin(2)|peritoneum(1)|kidney(1)|salivary_gland(1)|pancreas(1)	c.G747T						.						155.0	113.0	127.0					17																	7577534		2203	4300	6503	SO:0001583	missense	7157	exon7	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	GATGGGCCTCCGG	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.747G>T	chr17.hg19:g.7577534C>A	ENSP00000269305:p.Arg249Ser	94.0	0.0		87.0	40.0	NM_000546	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	hg19	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	C	17.26	3.344264	0.61073	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	D;D;D;D;D;D;D	0.99865	-7.29;-7.29;-7.29;-7.29;-7.29;-7.29;-7.29	4.62	-0.0929	0.13654	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99792	0.9912	M	0.92367	3.3	0.50039	D	0.999848	D;D;D;D;D	0.89917	0.996;0.996;0.997;0.99;1.0	D;D;D;D;D	0.79108	0.968;0.966;0.981;0.955;0.992	D	0.98720	1.0708	10	0.72032	D	0.01	-3.0658	3.2479	0.06803	0.1392:0.5551:0.1362:0.1695	rs28934571	249;249;249;249;249	P04637-2;P04637-3;P04637;Q1MSW8;E7EQX7	.;.;P53_HUMAN;.;.	S	249;249;249;249;249;249;238;117	ENSP00000410739:R249S;ENSP00000352610:R249S;ENSP00000269305:R249S;ENSP00000398846:R249S;ENSP00000391127:R249S;ENSP00000391478:R249S;ENSP00000425104:R117S	ENSP00000269305:R249S	R	-	3	2	TP53	7518259	0.011000	0.17503	0.998000	0.56505	0.783000	0.44284	-1.379000	0.02554	0.253000	0.21552	0.462000	0.41574	AGG	.	.		0.572	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
PTRF	284119	hgsc.bcm.edu	37	17	40556985	40556985	+	Missense_Mutation	SNP	C	C	T	rs144331065		TCGA-2Y-A9GS-01A-12D-A382-10	TCGA-2Y-A9GS-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ce44141-64e4-4d9d-9971-4dc79b316d4a	27ea2725-9c48-4965-a503-91d2302923b4	g.chr17:40556985C>T	ENST00000357037.5	-	2	1312	c.893G>A	c.(892-894)cGc>cAc	p.R298H		NM_012232.5	NP_036364.2			polymerase I and transcript release factor									p.R298H(1)		breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(5)|ovary(1)|prostate(2)|urinary_tract(1)	17		all_cancers(22;0.00146)|Breast(137;0.00116)|all_epithelial(22;0.0134)		BRCA - Breast invasive adenocarcinoma(366;0.193)		GAAGGATTTGCGCAACTTGTC	0.642																																					p.R298H		Atlas-SNP	.											PTRF,brain,primitive_neuroectodermal_tumour-medulloblastoma,0,1	PTRF	48	.	1	Substitution - Missense(1)	central_nervous_system(1)	c.G893A						.	C	HIS/ARG	1,4405	2.1+/-5.4	0,1,2202	113.0	97.0	103.0		893	5.1	1.0	17	dbSNP_134	103	0,8600		0,0,4300	no	missense	PTRF	NM_012232.5	29	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	possibly-damaging	298/391	40556985	1,13005	2203	4300	6503	SO:0001583	missense	284119	exon2			GATTTGCGCAACT	AF000421	CCDS11425.1	17q21.31	2011-04-20				ENSG00000177469			9688	protein-coding gene	gene with protein product		603198				9582279	Standard	NM_012232		Approved	cavin-1, CAVIN1	uc002hzo.3	Q6NZI2		ENST00000357037.5:c.893G>A	chr17.hg19:g.40556985C>T	ENSP00000349541:p.Arg298His	85.0	0.0		106.0	11.0	NM_012232		Missense_Mutation	SNP	ENST00000357037.5	hg19	CCDS11425.1	.	.	.	.	.	.	.	.	.	.	C	21.4	4.148153	0.78001	2.27E-4	0.0	ENSG00000177469	ENST00000357037;ENST00000357684	T	0.60040	0.22	5.12	5.12	0.69794	.	0.065401	0.64402	D	0.000012	T	0.63200	0.2491	L	0.50333	1.59	0.38284	D	0.942509	D;D	0.69078	0.997;0.997	P;P	0.57548	0.823;0.823	T	0.68603	-0.5365	10	0.87932	D	0	-18.1461	9.4221	0.38557	0.0:0.8439:0.0:0.1561	.	280;298	B4DNU9;Q6NZI2	.;PTRF_HUMAN	H	298;253	ENSP00000349541:R298H	ENSP00000349541:R298H	R	-	2	0	PTRF	37810511	1.000000	0.71417	1.000000	0.80357	0.943000	0.58893	3.157000	0.50716	2.673000	0.90976	0.544000	0.68410	CGC	.	C|1.000;T|0.000		0.642	PTRF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449938.1	NM_012232	
AATK	9625	hgsc.bcm.edu	37	17	79093297	79093297	+	Missense_Mutation	SNP	C	C	T			TCGA-2Y-A9GS-01A-12D-A382-10	TCGA-2Y-A9GS-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ce44141-64e4-4d9d-9971-4dc79b316d4a	27ea2725-9c48-4965-a503-91d2302923b4	g.chr17:79093297C>T	ENST00000326724.4	-	13	3991	c.3967G>A	c.(3967-3969)Gcc>Acc	p.A1323T	AATK_ENST00000417379.1_Missense_Mutation_p.A1220T	NM_001080395.2	NP_001073864.2	Q6ZMQ8	LMTK1_HUMAN	apoptosis-associated tyrosine kinase	1323					brain development (GO:0007420)|negative regulation of axon extension (GO:0030517)|neuron apoptotic process (GO:0051402)|peptidyl-tyrosine autophosphorylation (GO:0038083)|Rab protein signal transduction (GO:0032482)	axonal growth cone (GO:0044295)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|recycling endosome (GO:0055037)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)			endometrium(2)|kidney(2)|lung(8)|ovary(3)|prostate(1)|stomach(4)|upper_aerodigestive_tract(1)	21	all_neural(118;0.101)		BRCA - Breast invasive adenocarcinoma(99;0.0228)|OV - Ovarian serous cystadenocarcinoma(97;0.0524)			GCAGCCGGGGCGGGTGCGGCC	0.721																																					p.A1323T		Atlas-SNP	.											.	AATK	102	.	0			c.G3967A						.						11.0	16.0	15.0					17																	79093297		1997	4087	6084	SO:0001583	missense	9625	exon13			CCGGGGCGGGTGC	AB014541	CCDS45807.1, CCDS58607.1	17q25.3	2014-06-12			ENSG00000181409	ENSG00000181409			21	protein-coding gene	gene with protein product	"""lemur tyrosine kinase 1"", ""protein phosphatase 1, regulatory subunit 77"""	605276				9734811, 10083745	Standard	NM_001080395		Approved	AATYK, KIAA0641, LMTK1, LMR1, AATYK1, PPP1R77	uc010dia.3	Q6ZMQ8	OTTHUMG00000132717	ENST00000326724.4:c.3967G>A	chr17.hg19:g.79093297C>T	ENSP00000324196:p.Ala1323Thr	141.0	0.0		178.0	51.0	NM_001080395	O75136|Q6ZN31|Q86X28	Missense_Mutation	SNP	ENST00000326724.4	hg19	CCDS45807.1	.	.	.	.	.	.	.	.	.	.	C	9.251	1.040858	0.19669	.	.	ENSG00000181409	ENST00000326724	T	0.10005	2.92	3.52	-5.79	0.02354	.	0.670270	0.13734	N	0.366449	T	0.04318	0.0119	N	0.14661	0.345	0.09310	N	1	B	0.10296	0.003	B	0.04013	0.001	T	0.41233	-0.9520	10	0.15952	T	0.53	.	8.0776	0.30726	0.1043:0.3037:0.0:0.592	.	1323	Q6ZMQ8	LMTK1_HUMAN	T	1323	ENSP00000324196:A1323T	ENSP00000324196:A1323T	A	-	1	0	AATK	76707892	0.000000	0.05858	0.000000	0.03702	0.115000	0.19883	-2.052000	0.01401	-1.228000	0.02568	-0.898000	0.02899	GCC	.	.		0.721	AATK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256055.1	NM_004920	
ZBTB7C	201501	hgsc.bcm.edu	37	18	45555810	45555810	+	Missense_Mutation	SNP	G	G	A			TCGA-2Y-A9GS-01A-12D-A382-10	TCGA-2Y-A9GS-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ce44141-64e4-4d9d-9971-4dc79b316d4a	27ea2725-9c48-4965-a503-91d2302923b4	g.chr18:45555810G>A	ENST00000588982.1	-	4	2182	c.1681C>T	c.(1681-1683)Cgc>Tgc	p.R561C	ZBTB7C_ENST00000535628.2_Missense_Mutation_p.R561C|ZBTB7C_ENST00000590800.1_Missense_Mutation_p.R561C|ZBTB7C_ENST00000586438.1_Missense_Mutation_p.R561C|ZBTB7C_ENST00000332053.2_Missense_Mutation_p.R561C			A1YPR0	ZBT7C_HUMAN	zinc finger and BTB domain containing 7C	561							metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			endometrium(8)|kidney(1)|large_intestine(7)|lung(3)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	23						AGCTGCGCGCGCCCGAACAGC	0.721																																					p.R561C		Atlas-SNP	.											.	ZBTB7C	73	.	0			c.C1681T						.						10.0	11.0	11.0					18																	45555810		2188	4265	6453	SO:0001583	missense	201501	exon3			GCGCGCGCCCGAA	Y14591	CCDS32830.1	18q21.1	2013-01-08		2005-04-07	ENSG00000184828	ENSG00000184828		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	31700	protein-coding gene	gene with protein product			"""zinc finger and BTB domain containing 36"""	ZBTB36			Standard	NM_001039360		Approved	ZNF857C	uc002ldb.3	A1YPR0		ENST00000588982.1:c.1681C>T	chr18.hg19:g.45555810G>A	ENSP00000468782:p.Arg561Cys	53.0	0.0		89.0	33.0	NM_001039360	O73453	Missense_Mutation	SNP	ENST00000588982.1	hg19	CCDS32830.1	.	.	.	.	.	.	.	.	.	.	G	15.20	2.761613	0.49468	.	.	ENSG00000184828	ENST00000535628;ENST00000332053	T;T	0.11604	2.76;2.76	4.51	2.45	0.29901	.	0.659005	0.12970	N	0.424205	T	0.06690	0.0171	N	0.14661	0.345	0.43852	D	0.996445	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.18209	-1.0344	10	0.87932	D	0	.	7.5778	0.27946	0.0966:0.0:0.6156:0.2878	.	561;561	B2RG49;A1YPR0	.;ZBT7C_HUMAN	C	561	ENSP00000439781:R561C;ENSP00000328732:R561C	ENSP00000328732:R561C	R	-	1	0	ZBTB7C	43809808	1.000000	0.71417	0.994000	0.49952	0.977000	0.68977	3.350000	0.52224	0.886000	0.36113	0.555000	0.69702	CGC	.	.		0.721	ZBTB7C-025	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450731.1	NM_001039360	
DNAJB1	3337	hgsc.bcm.edu	37	19	14627395	14627395	+	Missense_Mutation	SNP	G	G	T			TCGA-2Y-A9GS-01A-12D-A382-10	TCGA-2Y-A9GS-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ce44141-64e4-4d9d-9971-4dc79b316d4a	27ea2725-9c48-4965-a503-91d2302923b4	g.chr19:14627395G>T	ENST00000254322.2	-	2	745	c.675C>A	c.(673-675)gaC>gaA	p.D225E	DNAJB1_ENST00000396969.4_Missense_Mutation_p.D125E	NM_006145.1	NP_006136.1	P25685	DNJB1_HUMAN	DnaJ (Hsp40) homolog, subfamily B, member 1	225					chaperone cofactor-dependent protein refolding (GO:0070389)|chaperone mediated protein folding requiring cofactor (GO:0051085)|negative regulation of inclusion body assembly (GO:0090084)|positive regulation of ATPase activity (GO:0032781)|response to unfolded protein (GO:0006986)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ATPase activator activity (GO:0001671)|ATPase binding (GO:0051117)|chaperone binding (GO:0051087)|Hsp70 protein binding (GO:0030544)|unfolded protein binding (GO:0051082)			NS(1)|breast(1)|cervix(3)|endometrium(1)|kidney(1)|lung(7)|prostate(1)|urinary_tract(1)	16				GBM - Glioblastoma multiforme(1328;0.0476)		TGGAGGTCTGGTCTCCTTCCT	0.438																																					p.D225E		Atlas-SNP	.											.	DNAJB1	38	.	0			c.C675A						.						131.0	119.0	123.0					19																	14627395		2203	4300	6503	SO:0001583	missense	3337	exon2			GGTCTGGTCTCCT	D49547	CCDS12312.1, CCDS74295.1	19p13.12	2014-08-12			ENSG00000132002	ENSG00000132002		"""Heat shock proteins / DNAJ (HSP40)"""	5270	protein-coding gene	gene with protein product	"""radial spoke 16 homolog B (Chlamydomonas)"""	604572		HSPF1		8975727, 8250930	Standard	XM_006722733		Approved	Hsp40, Sis1, RSPH16B	uc002myz.1	P25685	OTTHUMG00000183289	ENST00000254322.2:c.675C>A	chr19.hg19:g.14627395G>T	ENSP00000254322:p.Asp225Glu	81.0	0.0		52.0	15.0	NM_006145	B4DX52	Missense_Mutation	SNP	ENST00000254322.2	hg19	CCDS12312.1	.	.	.	.	.	.	.	.	.	.	g	22.3	4.265305	0.80358	.	.	ENSG00000132002	ENST00000254322;ENST00000396969	D;D	0.85013	-1.93;-1.93	5.19	5.19	0.71726	HSP40/DnaJ peptide-binding (1);	0.000000	0.85682	D	0.000000	D	0.87346	0.6154	M	0.73217	2.22	0.80722	D	1	P	0.40000	0.698	P	0.44477	0.451	D	0.89060	0.3462	10	0.87932	D	0	.	16.1946	0.82018	0.0:0.0:1.0:0.0	.	225	P25685	DNJB1_HUMAN	E	225;125	ENSP00000254322:D225E;ENSP00000444212:D125E	ENSP00000254322:D225E	D	-	3	2	DNAJB1	14488395	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.112000	0.41892	2.424000	0.82194	0.561000	0.74099	GAC	.	.		0.438	DNAJB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465987.1	NM_006145	
LILRA4	23547	hgsc.bcm.edu	37	19	54849337	54849337	+	Missense_Mutation	SNP	C	C	A			TCGA-2Y-A9GS-01A-12D-A382-10	TCGA-2Y-A9GS-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ce44141-64e4-4d9d-9971-4dc79b316d4a	27ea2725-9c48-4965-a503-91d2302923b4	g.chr19:54849337C>A	ENST00000291759.4	-	4	581	c.525G>T	c.(523-525)aaG>aaT	p.K175N	AC008984.2_ENST00000507363.1_RNA	NM_012276.3	NP_036408.3	P59901	LIRA4_HUMAN	leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 4	175	Ig-like C2-type 2.				immune system process (GO:0002376)	integral component of membrane (GO:0016021)				NS(2)|breast(1)|central_nervous_system(2)|endometrium(2)|large_intestine(5)|lung(13)|prostate(3)|skin(1)|upper_aerodigestive_tract(3)	32	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.0565)		GGGCCTGGAACTTTCCATGGT	0.567																																					p.K175N		Atlas-SNP	.											.	LILRA4	91	.	0			c.G525T						.						91.0	80.0	84.0					19																	54849337		2203	4300	6503	SO:0001583	missense	23547	exon4			CTGGAACTTTCCA	AF041261	CCDS12890.1	19q13.4	2013-01-11			ENSG00000239961	ENSG00000239961		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	15503	protein-coding gene	gene with protein product		607517				10941842	Standard	NM_012276		Approved	ILT7, CD85g	uc002qfj.3	P59901	OTTHUMG00000065355	ENST00000291759.4:c.525G>T	chr19.hg19:g.54849337C>A	ENSP00000291759:p.Lys175Asn	129.0	0.0		161.0	64.0	NM_012276	Q32MC4	Missense_Mutation	SNP	ENST00000291759.4	hg19	CCDS12890.1	.	.	.	.	.	.	.	.	.	.	.	6.917	0.538785	0.13250	.	.	ENSG00000239961	ENST00000291759	T	0.02944	4.1	2.76	2.76	0.32466	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.03348	0.0097	N	0.24115	0.695	0.09310	N	1	B	0.29301	0.241	B	0.38755	0.281	T	0.46555	-0.9183	9	0.36615	T	0.2	.	9.1771	0.37118	0.0:1.0:0.0:0.0	.	175	P59901	LIRA4_HUMAN	N	175	ENSP00000291759:K175N	ENSP00000291759:K175N	K	-	3	2	LILRA4	59541149	0.000000	0.05858	0.002000	0.10522	0.278000	0.26855	0.026000	0.13599	1.855000	0.53841	0.563000	0.77884	AAG	.	.		0.567	LILRA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000140229.2	NM_012276	
PLAGL2	5326	hgsc.bcm.edu	37	20	30785139	30785139	+	Missense_Mutation	SNP	G	G	T			TCGA-2Y-A9GS-01A-12D-A382-10	TCGA-2Y-A9GS-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ce44141-64e4-4d9d-9971-4dc79b316d4a	27ea2725-9c48-4965-a503-91d2302923b4	g.chr20:30785139G>T	ENST00000246229.4	-	3	871	c.607C>A	c.(607-609)Cgt>Agt	p.R203S		NM_002657.3	NP_002648.1	Q9UPG8	PLAL2_HUMAN	pleiomorphic adenoma gene-like 2	203					chylomicron assembly (GO:0034378)|lipid metabolic process (GO:0006629)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|post-embryonic development (GO:0009791)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|cervix(1)|endometrium(2)|kidney(2)|liver(1)|lung(11)|ovary(1)|skin(1)|urinary_tract(1)	21			UCEC - Uterine corpus endometrioid carcinoma (5;0.0241)			ACATCCTTACGAGTATAGAAC	0.627																																					p.R203S	Colon(163;15 1893 11280 16306 47518)	Atlas-SNP	.											.	PLAGL2	56	.	0			c.C607A						.						23.0	19.0	20.0					20																	30785139		2203	4300	6503	SO:0001583	missense	5326	exon3			CCTTACGAGTATA		CCDS13197.1	20q11.21	2013-01-08			ENSG00000126003	ENSG00000126003		"""Zinc fingers, C2H2-type"""	9047	protein-coding gene	gene with protein product	"""C2H2-type zinc finger protein"""	604866				15585652, 17950244	Standard	NM_002657		Approved	ZNF900	uc002wxn.2	Q9UPG8	OTTHUMG00000032210	ENST00000246229.4:c.607C>A	chr20.hg19:g.30785139G>T	ENSP00000246229:p.Arg203Ser	85.0	0.0		98.0	4.0	NM_002657	A8K8T5|E1P5M3|Q92584	Missense_Mutation	SNP	ENST00000246229.4	hg19	CCDS13197.1	.	.	.	.	.	.	.	.	.	.	G	17.67	3.447620	0.63178	.	.	ENSG00000126003	ENST00000246229	T	0.59906	0.23	5.13	4.12	0.48240	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.57651	0.2068	N	0.11789	0.175	0.58432	D	0.999997	D	0.89917	1.0	D	0.76575	0.988	T	0.55315	-0.8160	10	0.22706	T	0.39	.	16.2439	0.82431	0.0:0.0:0.8586:0.1414	.	203	Q9UPG8	PLAL2_HUMAN	S	203	ENSP00000246229:R203S	ENSP00000246229:R203S	R	-	1	0	PLAGL2	30248800	1.000000	0.71417	0.998000	0.56505	0.997000	0.91878	7.695000	0.84257	2.675000	0.91044	0.555000	0.69702	CGT	.	.		0.627	PLAGL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078615.2	NM_002657	
DIDO1	11083	hgsc.bcm.edu	37	20	61510865	61510865	+	Missense_Mutation	SNP	T	T	C			TCGA-2Y-A9GS-01A-12D-A382-10	TCGA-2Y-A9GS-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ce44141-64e4-4d9d-9971-4dc79b316d4a	27ea2725-9c48-4965-a503-91d2302923b4	g.chr20:61510865T>C	ENST00000266070.4	-	16	6768	c.6443A>G	c.(6442-6444)gAc>gGc	p.D2148G	DIDO1_ENST00000395343.1_Missense_Mutation_p.D2148G	NM_033081.2	NP_149072.2	Q9BTC0	DIDO1_HUMAN	death inducer-obliterator 1	2148	Arg-rich.				apoptotic signaling pathway (GO:0097190)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			NS(6)|breast(5)|central_nervous_system(1)|cervix(3)|endometrium(6)|kidney(1)|large_intestine(17)|lung(39)|ovary(8)|prostate(3)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)	99	Breast(26;5.68e-08)					ccggtttctgtcccagtcccg	0.726																																					p.D2148G	Melanoma(25;381 482 3385 5362 7955 17159 17174 40604 47095)	Atlas-SNP	.											.	DIDO1	321	.	0			c.A6443G						.						18.0	16.0	17.0					20																	61510865		2177	4223	6400	SO:0001583	missense	11083	exon16			TTTCTGTCCCAGT	AB002331	CCDS13508.2, CCDS13509.1, CCDS33506.1	20q13.33	2013-01-28	2005-11-11	2005-11-11	ENSG00000101191	ENSG00000101191		"""Zinc fingers, PHD-type"""	2680	protein-coding gene	gene with protein product		604140	"""chromosome 20 open reading frame 158"", ""death associated transcription factor 1"""	C20orf158, DATF1		10393935	Standard	NM_033081		Approved	DIO1, dJ885L7.8, FLJ11265, KIAA0333, DIO-1, BYE1	uc002ydr.2	Q9BTC0	OTTHUMG00000032945	ENST00000266070.4:c.6443A>G	chr20.hg19:g.61510865T>C	ENSP00000266070:p.Asp2148Gly	81.0	0.0		102.0	35.0	NM_001193369	A8MY65|B9EH82|E1P5I1|O15043|Q3ZTL7|Q3ZTL8|Q4VXS1|Q4VXS2|Q4VXV8|Q4VXV9|Q96D72|Q9BQW0|Q9BW03|Q9H4G6|Q9H4G7|Q9NTU8|Q9NUM8|Q9UFB6	Missense_Mutation	SNP	ENST00000266070.4	hg19	CCDS33506.1	.	.	.	.	.	.	.	.	.	.	T	16.27	3.076536	0.55753	.	.	ENSG00000101191	ENST00000266070;ENST00000395343	T;T	0.47528	0.84;0.84	4.81	4.81	0.61882	.	.	.	.	.	T	0.64951	0.2645	M	0.61703	1.905	0.80722	D	1	D	0.89917	1.0	D	0.72075	0.976	T	0.69018	-0.5256	9	0.87932	D	0	-28.9568	14.0427	0.64687	0.0:0.0:0.0:1.0	.	2148	Q9BTC0	DIDO1_HUMAN	G	2148	ENSP00000266070:D2148G;ENSP00000378752:D2148G	ENSP00000266070:D2148G	D	-	2	0	DIDO1	60981310	1.000000	0.71417	0.918000	0.36340	0.073000	0.16967	3.241000	0.51376	1.794000	0.52575	0.533000	0.62120	GAC	.	.		0.726	DIDO1-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000080091.2	NM_080796	
KRTAP13-3	337960	hgsc.bcm.edu	37	21	31798109	31798109	+	Missense_Mutation	SNP	C	C	A			TCGA-2Y-A9GS-01A-12D-A382-10	TCGA-2Y-A9GS-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ce44141-64e4-4d9d-9971-4dc79b316d4a	27ea2725-9c48-4965-a503-91d2302923b4	g.chr21:31798109C>A	ENST00000390690.2	-	1	177	c.122G>T	c.(121-123)tGc>tTc	p.C41F		NM_181622.1	NP_853653.1	Q3SY46	KR133_HUMAN	keratin associated protein 13-3	41						intermediate filament (GO:0005882)				endometrium(1)|large_intestine(1)|lung(10)|ovary(1)|upper_aerodigestive_tract(1)	14						GCTGGGAGAGCAGAGGTCAGT	0.587																																					p.C41F		Atlas-SNP	.											.	KRTAP13-3	47	.	0			c.G122T						.						67.0	73.0	71.0					21																	31798109		2203	4300	6503	SO:0001583	missense	337960	exon1			GGAGAGCAGAGGT	AP001708	CCDS13591.1	21q22.1	2006-03-13			ENSG00000240432	ENSG00000240432		"""Keratin associated proteins"""	18925	protein-coding gene	gene with protein product						12359730	Standard	NM_181622		Approved	KAP13.3	uc002yob.1	Q3SY46	OTTHUMG00000057776	ENST00000390690.2:c.122G>T	chr21.hg19:g.31798109C>A	ENSP00000375109:p.Cys41Phe	134.0	0.0		135.0	27.0	NM_181622	Q3LI78	Missense_Mutation	SNP	ENST00000390690.2	hg19	CCDS13591.1	.	.	.	.	.	.	.	.	.	.	-	9.141	1.013918	0.19277	.	.	ENSG00000240432	ENST00000390690;ENST00000448917	T	0.04454	3.62	4.78	3.89	0.44902	.	0.000000	0.45606	U	0.000359	T	0.06554	0.0168	L	0.56769	1.78	0.24308	N	0.995092	P	0.51653	0.947	B	0.41374	0.355	T	0.26121	-1.0112	10	0.62326	D	0.03	-4.7465	9.4006	0.38431	0.0:0.8982:0.0:0.1018	.	41	Q3SY46	KR133_HUMAN	F	41	ENSP00000375109:C41F	ENSP00000375109:C41F	C	-	2	0	KRTAP13-3	30719980	0.651000	0.27340	0.820000	0.32676	0.140000	0.21249	0.621000	0.24418	1.315000	0.45114	0.650000	0.86243	TGC	.	.		0.587	KRTAP13-3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128228.2		
DOPEY2	9980	hgsc.bcm.edu	37	21	37617781	37617781	+	Missense_Mutation	SNP	A	A	T			TCGA-2Y-A9GS-01A-12D-A382-10	TCGA-2Y-A9GS-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ce44141-64e4-4d9d-9971-4dc79b316d4a	27ea2725-9c48-4965-a503-91d2302923b4	g.chr21:37617781A>T	ENST00000399151.3	+	19	3588	c.3503A>T	c.(3502-3504)gAa>gTa	p.E1168V		NM_005128.2	NP_005119.2	Q9Y3R5	DOP2_HUMAN	dopey family member 2	1168					cognition (GO:0050890)|endoplasmic reticulum organization (GO:0007029)|Golgi to endosome transport (GO:0006895)|multicellular organismal development (GO:0007275)|protein transport (GO:0015031)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)				autonomic_ganglia(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(5)|large_intestine(6)|lung(25)|ovary(2)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	58						TTCCAGTCAGAAAGCTTCAAG	0.637																																					p.E1168V		Atlas-SNP	.											.	DOPEY2	184	.	0			c.A3503T						.						36.0	40.0	39.0					21																	37617781		2203	4300	6503	SO:0001583	missense	9980	exon19			AGTCAGAAAGCTT	AJ237839	CCDS13643.1	21q22.2	2013-03-05	2006-02-02	2006-02-02	ENSG00000142197	ENSG00000142197			1291	protein-coding gene	gene with protein product		604803	"""chromosome 21 open reading frame 5"""	C21orf5		16301316, 16303751, 10931277	Standard	NM_005128		Approved	KIAA0933	uc002yvg.3	Q9Y3R5	OTTHUMG00000086619	ENST00000399151.3:c.3503A>T	chr21.hg19:g.37617781A>T	ENSP00000382104:p.Glu1168Val	64.0	0.0		63.0	23.0	NM_005128	D3DSG5|Q6PJQ7|Q9UEZ3	Missense_Mutation	SNP	ENST00000399151.3	hg19	CCDS13643.1	.	.	.	.	.	.	.	.	.	.	A	3.484	-0.105369	0.06967	.	.	ENSG00000142197	ENST00000399151	T	0.34072	1.38	4.61	0.639	0.17747	.	0.412728	0.20393	N	0.093212	T	0.23210	0.0561	L	0.36672	1.1	0.09310	N	1	B;B	0.32753	0.383;0.265	B;B	0.29785	0.107;0.05	T	0.11421	-1.0588	10	0.37606	T	0.19	.	7.609	0.28118	0.6649:0.2621:0.073:0.0	.	1168;1168	Q9Y3R5-2;Q9Y3R5	.;DOP2_HUMAN	V	1168	ENSP00000382104:E1168V	ENSP00000382104:E1168V	E	+	2	0	DOPEY2	36539651	0.564000	0.26602	0.005000	0.12908	0.011000	0.07611	1.715000	0.37971	0.374000	0.24650	0.528000	0.53228	GAA	.	.		0.637	DOPEY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000194636.1	NM_005128	
DOPEY2	9980	hgsc.bcm.edu	37	21	37617797	37617797	+	Silent	SNP	G	G	T			TCGA-2Y-A9GS-01A-12D-A382-10	TCGA-2Y-A9GS-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ce44141-64e4-4d9d-9971-4dc79b316d4a	27ea2725-9c48-4965-a503-91d2302923b4	g.chr21:37617797G>T	ENST00000399151.3	+	19	3604	c.3519G>T	c.(3517-3519)ggG>ggT	p.G1173G		NM_005128.2	NP_005119.2	Q9Y3R5	DOP2_HUMAN	dopey family member 2	1173					cognition (GO:0050890)|endoplasmic reticulum organization (GO:0007029)|Golgi to endosome transport (GO:0006895)|multicellular organismal development (GO:0007275)|protein transport (GO:0015031)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)				autonomic_ganglia(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(5)|large_intestine(6)|lung(25)|ovary(2)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	58						TCAAGGCTGGGGCCAAGTTAA	0.642																																					p.G1173G		Atlas-SNP	.											.	DOPEY2	184	.	0			c.G3519T						.						36.0	40.0	39.0					21																	37617797		2203	4300	6503	SO:0001819	synonymous_variant	9980	exon19			GGCTGGGGCCAAG	AJ237839	CCDS13643.1	21q22.2	2013-03-05	2006-02-02	2006-02-02	ENSG00000142197	ENSG00000142197			1291	protein-coding gene	gene with protein product		604803	"""chromosome 21 open reading frame 5"""	C21orf5		16301316, 16303751, 10931277	Standard	NM_005128		Approved	KIAA0933	uc002yvg.3	Q9Y3R5	OTTHUMG00000086619	ENST00000399151.3:c.3519G>T	chr21.hg19:g.37617797G>T		53.0	0.0		55.0	26.0	NM_005128	D3DSG5|Q6PJQ7|Q9UEZ3	Silent	SNP	ENST00000399151.3	hg19	CCDS13643.1																																																																																			.	.		0.642	DOPEY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000194636.1	NM_005128	
BACE2	25825	hgsc.bcm.edu	37	21	42551433	42551433	+	Intron	SNP	G	G	A			TCGA-2Y-A9GS-01A-12D-A382-10	TCGA-2Y-A9GS-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ce44141-64e4-4d9d-9971-4dc79b316d4a	27ea2725-9c48-4965-a503-91d2302923b4	g.chr21:42551433G>A	ENST00000330333.6	+	1	775				BACE2_ENST00000328735.6_Intron|PLAC4_ENST00000430327.2_RNA|BACE2_ENST00000347667.5_Intron|PLAC4_ENST00000440221.2_RNA|BACE2-IT1_ENST00000433378.1_RNA|PLAC4_ENST00000536486.1_RNA|PLAC4_ENST00000414699.1_RNA	NM_012105.3	NP_036237.2	Q9Y5Z0	BACE2_HUMAN	beta-site APP-cleaving enzyme 2						membrane protein ectodomain proteolysis (GO:0006509)|negative regulation of amyloid precursor protein biosynthetic process (GO:0042985)|peptide hormone processing (GO:0016486)|proteolysis (GO:0006508)	endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	aspartic-type endopeptidase activity (GO:0004190)			endometrium(2)|large_intestine(3)|lung(4)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	14		Prostate(19;1.57e-07)|all_epithelial(19;0.0251)				GACGGTGTCTGGGGTGAGTGA	0.607																																					p.P41P		Atlas-SNP	.											.	.	.	.	0			c.C123T						.						124.0	109.0	114.0					21																	42551433		2196	4275	6471	SO:0001627	intron_variant	191585	exon1			GTGTCTGGGGTGA	AF117892	CCDS13668.1, CCDS13669.1, CCDS13670.1	21q22.3	2011-08-11			ENSG00000182240	ENSG00000182240			934	protein-coding gene	gene with protein product		605668		AEPLC		10965118, 10830953	Standard	NM_138991		Approved	CEAP1, DRAP, ALP56	uc002yyw.3	Q9Y5Z0	OTTHUMG00000086742	ENST00000330333.6:c.312+10931G>A	chr21.hg19:g.42551433G>A		92.0	0.0		85.0	6.0	NM_182832	A8K7P1|Q5DIH8|Q8N2D4|Q9H2V8|Q9NZL1|Q9NZL2|Q9UJT6	Silent	SNP	ENST00000330333.6	hg19	CCDS13668.1																																																																																			.	.		0.607	BACE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195056.1		
SMTN	6525	hgsc.bcm.edu	37	22	31494787	31494787	+	Missense_Mutation	SNP	A	A	G			TCGA-2Y-A9GS-01A-12D-A382-10	TCGA-2Y-A9GS-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ce44141-64e4-4d9d-9971-4dc79b316d4a	27ea2725-9c48-4965-a503-91d2302923b4	g.chr22:31494787A>G	ENST00000347557.2	+	17	2512	c.2294A>G	c.(2293-2295)aAg>aGg	p.K765R	SMTN_ENST00000333137.7_Missense_Mutation_p.K765R|SMTN_ENST00000358743.1_Missense_Mutation_p.K765R|SMTN_ENST00000404574.1_Missense_Mutation_p.K288R	NM_001207017.1|NM_006932.4	NP_001193946.1|NP_008863.3	P53814	SMTN_HUMAN	smoothelin	765					muscle organ development (GO:0007517)|smooth muscle contraction (GO:0006939)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	actin binding (GO:0003779)|structural constituent of muscle (GO:0008307)			breast(2)|endometrium(2)|large_intestine(5)|lung(9)|ovary(3)|pancreas(1)|prostate(3)	25						CAGGCGCGCAAGGCCATGATT	0.682																																					p.K850R		Atlas-SNP	.											.	SMTN	219	.	0			c.A2549G						.						13.0	18.0	16.0					22																	31494787		2198	4287	6485	SO:0001583	missense	6525	exon18			CGCGCAAGGCCAT	AY061972	CCDS13886.1, CCDS13887.1, CCDS13888.1, CCDS74845.1, CCDS74846.1	22q12	2006-01-27			ENSG00000183963	ENSG00000183963			11126	protein-coding gene	gene with protein product		602127				9244445, 8707825	Standard	NM_006932		Approved		uc011ale.2	P53814	OTTHUMG00000151203	ENST00000347557.2:c.2294A>G	chr22.hg19:g.31494787A>G	ENSP00000328635:p.Lys765Arg	112.0	0.0		74.0	15.0	NM_001207017	O00569|O95769|O95937|Q8N4H8|Q8WWW1|Q8WWW2|Q9P1S8|Q9UIT1|Q9UIT2	Missense_Mutation	SNP	ENST00000347557.2	hg19	CCDS13886.1	.	.	.	.	.	.	.	.	.	.	A	28.3	4.907692	0.92107	.	.	ENSG00000183963	ENST00000358743;ENST00000347557;ENST00000333137;ENST00000329852;ENST00000404496;ENST00000455608;ENST00000404574;ENST00000403419	T;T;T;T;D	0.93659	-0.15;-0.55;-0.55;1.8;-3.26	5.34	5.34	0.76211	.	0.000000	0.39759	N	0.001269	D	0.94991	0.8379	L	0.41961	1.31	0.80722	D	1	P;D;D;D;D;P;D;P	0.76494	0.741;0.998;0.997;0.997;0.999;0.578;0.999;0.832	P;D;D;D;D;P;D;P	0.81914	0.545;0.995;0.985;0.985;0.991;0.458;0.991;0.733	D	0.95279	0.8384	10	0.56958	D	0.05	-39.4047	15.6299	0.76899	1.0:0.0:0.0:0.0	.	821;850;145;288;788;765;765;765	E7ETT8;B4E229;B5MBZ4;B5MCI0;B5MC56;E7EWD0;P53814;P53814-5	.;.;.;.;.;.;SMTN_HUMAN;.	R	765;765;765;763;788;166;288;145	ENSP00000351593:K765R;ENSP00000328635:K765R;ENSP00000329532:K765R;ENSP00000392329:K166R;ENSP00000383919:K288R	ENSP00000329393:K763R	K	+	2	0	SMTN	29824787	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	5.803000	0.69129	2.169000	0.68431	0.459000	0.35465	AAG	.	.		0.682	SMTN-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000321766.1	NM_134270	
TKTL1	8277	hgsc.bcm.edu	37	X	153556300	153556300	+	Silent	SNP	G	G	A			TCGA-2Y-A9GS-01A-12D-A382-10	TCGA-2Y-A9GS-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ce44141-64e4-4d9d-9971-4dc79b316d4a	27ea2725-9c48-4965-a503-91d2302923b4	g.chrX:153556300G>A	ENST00000369915.3	+	12	1803	c.1614G>A	c.(1612-1614)ccG>ccA	p.P538P	TKTL1_ENST00000369912.2_Silent_p.P482P|TKTL1_ENST00000217905.7_Silent_p.P278P	NM_001145933.1|NM_012253.3	NP_001139405.1|NP_036385.3	P51854	TKTL1_HUMAN	transketolase-like 1	538					glucose catabolic process (GO:0006007)|thiamine metabolic process (GO:0006772)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|transketolase activity (GO:0004802)			NS(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(8)|ovary(5)|prostate(1)|skin(1)|urinary_tract(2)	34	all_cancers(53;5.05e-16)|all_epithelial(53;1.82e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					ATCACTACCCGCAAGGTGTGT	0.493																																					p.P538P		Atlas-SNP	.											.	TKTL1	61	.	0			c.G1614A						.						171.0	139.0	150.0					X																	153556300		2203	4300	6503	SO:0001819	synonymous_variant	8277	exon12			CTACCCGCAAGGT	X91817	CCDS35448.1, CCDS55541.1	Xq28	2008-02-05			ENSG00000007350	ENSG00000007350			11835	protein-coding gene	gene with protein product		300044				8838793	Standard	NM_012253		Approved	TKR, TKT2	uc004fkg.3	P51854	OTTHUMG00000022707	ENST00000369915.3:c.1614G>A	chrX.hg19:g.153556300G>A		143.0	1.0		159.0	112.0	NM_012253	A8K896|Q5TYJ8|Q5TYJ9|Q8TC75	Silent	SNP	ENST00000369915.3	hg19	CCDS35448.1																																																																																			.	.		0.493	TKTL1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058923.1	NM_012253	
KEAP1	9817	hgsc.bcm.edu	37	19	10602490	10602514	+	Frame_Shift_Del	DEL	CTCCGCGGCACCTGCAGGTCCGCCA	CTCCGCGGCACCTGCAGGTCCGCCA	-	rs35450620		TCGA-2Y-A9GS-01A-12D-A382-10	TCGA-2Y-A9GS-10A-01D-A385-10	CTCCGCGGCACCTGCAGGTCCGCCA	CTCCGCGGCACCTGCAGGTCCGCCA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ce44141-64e4-4d9d-9971-4dc79b316d4a	27ea2725-9c48-4965-a503-91d2302923b4	g.chr19:10602490_10602514delCTCCGCGGCACCTGCAGGTCCGCCA	ENST00000171111.5	-	3	1611_1635	c.1064_1088delTGGCGGACCTGCAGGTGCCGCGGAG	c.(1063-1089)ttggcggacctgcaggtgccgcggagcfs	p.LADLQVPRS355fs	KEAP1_ENST00000393623.2_Frame_Shift_Del_p.LADLQVPRS355fs|CTC-429L19.3_ENST00000592671.1_RNA|KEAP1_ENST00000588024.1_5'Flank	NM_203500.1	NP_987096.1	Q14145	KEAP1_HUMAN	kelch-like ECH-associated protein 1	355					cellular response to interleukin-4 (GO:0071353)|in utero embryonic development (GO:0001701)|proteasomal ubiquitin-independent protein catabolic process (GO:0010499)|protein ubiquitination (GO:0016567)|regulation of epidermal cell differentiation (GO:0045604)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|microtubule organizing center (GO:0005815)|midbody (GO:0030496)|nucleus (GO:0005634)		p.R362Q(1)		breast(3)|endometrium(2)|kidney(4)|large_intestine(4)|liver(2)|lung(69)|ovary(2)|pancreas(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	92			OV - Ovarian serous cystadenocarcinoma(20;2.71e-09)|Epithelial(33;2.32e-06)|all cancers(31;1.42e-05)		Dimethyl fumarate(DB08908)	GGCCAGGCCGCTCCGCGGCACCTGCAGGTCCGCCAACCGGAGCCA	0.693																																					p.355_363del		Atlas-Indel,Pindel	.											.	KEAP1	182	.	1	Substitution - Missense(1)	lung(1)	c.1065_1089del						.																																			SO:0001589	frameshift_variant	9817	exon3			.	AF361886	CCDS12239.1	19p13.2	2013-01-30				ENSG00000079999		"""Kelch-like"", ""BTB/POZ domain containing"""	23177	protein-coding gene	gene with protein product	"""kelch-like family member 19"""	606016					Standard	NM_012289		Approved	KIAA0132, MGC10630, MGC1114, MGC20887, MGC4407, MGC9454, INrf2, KLHL19	uc002mor.1	Q14145		ENST00000171111.5:c.1064_1088delTGGCGGACCTGCAGGTGCCGCGGAG	chr19.hg19:g.10602490_10602514delCTCCGCGGCACCTGCAGGTCCGCCA	ENSP00000171111:p.Leu355fs	110.0	0.0		58.0	30.0	NM_012289	B3KPD5|Q6LEP0|Q8WTX1|Q9BPY9	Frame_Shift_Del	DEL	ENST00000171111.5	hg19	CCDS12239.1																																																																																			.	.		0.693	KEAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452000.1	NM_012289	
IL1RAP	3556	hgsc.bcm.edu	37	3	190362044	190362045	+	Frame_Shift_Ins	INS	-	-	C			TCGA-2Y-A9GS-01A-12D-A382-10	TCGA-2Y-A9GS-10A-01D-A385-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ce44141-64e4-4d9d-9971-4dc79b316d4a	27ea2725-9c48-4965-a503-91d2302923b4	g.chr3:190362044_190362045insC	ENST00000412504.2	+	9	1311_1312	c.1059_1060insC	c.(1060-1062)ccafs	p.P354fs	IL1RAP_ENST00000317757.3_Frame_Shift_Ins_p.P354fs|RN7SKP296_ENST00000411185.1_RNA|IL1RAP_ENST00000443369.2_Frame_Shift_Ins_p.P354fs|IL1RAP_ENST00000439062.1_Frame_Shift_Ins_p.P354fs|IL1RAP_ENST00000447382.1_Frame_Shift_Ins_p.P354fs|IL1RAP_ENST00000072516.3_Frame_Shift_Ins_p.P354fs			Q9NPH3	IL1AP_HUMAN	interleukin 1 receptor accessory protein	354					immune response (GO:0006955)|inflammatory response (GO:0006954)|interleukin-2 biosynthetic process (GO:0042094)|protein complex assembly (GO:0006461)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	interleukin-1 receptor activity (GO:0004908)|signal transducer activity (GO:0004871)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|lung(8)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	20	all_cancers(143;3.61e-10)|Ovarian(172;0.0733)|Breast(254;0.21)		Lung(62;1.95e-06)|LUSC - Lung squamous cell carcinoma(58;2.05e-06)	GBM - Glioblastoma multiforme(93;0.00851)		CAGTGCCAGCTCCAAGATACAC	0.47																																					p.A353fs		Atlas-Indel,Pindel	.											.	IL1RAP	96	.	0			c.1059_1060insC						.																																			SO:0001589	frameshift_variant	3556	exon10			.	AB006537	CCDS3298.1, CCDS46982.1, CCDS54696.1	3q28	2013-01-11			ENSG00000196083	ENSG00000196083		"""Interleukins and interleukin receptors"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5995	protein-coding gene	gene with protein product		602626				9479509, 9065432	Standard	NM_002182		Approved	IL-1RAcP, IL1R3, C3orf13	uc003fsq.3	Q9NPH3	OTTHUMG00000156211	ENST00000412504.2:c.1061dupC	chr3.hg19:g.190362046_190362046dupC	ENSP00000412053:p.Pro354fs	71.0	0.0		109.0	35.0	NM_001167931	B1NLD0|D3DNW0|O14915|Q86WJ7	Frame_Shift_Ins	INS	ENST00000412504.2	hg19	CCDS3298.1																																																																																			.	.		0.470	IL1RAP-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000343497.1		
JMJD8	339123	hgsc.bcm.edu	37	16	731861	731892	+	3'UTR	DEL	CCTGCATTGAGGCCAAGCACGTGAGGGTGCCC	CCTGCATTGAGGCCAAGCACGTGAGGGTGCCC	-	rs201741662|rs111699688|rs544433451	byFrequency	TCGA-2Y-A9GS-01A-12D-A382-10	TCGA-2Y-A9GS-10A-01D-A385-10	CCTGCATTGAGGCCAAGCACGTGAGGGTGCCC	CCTGCATTGAGGCCAAGCACGTGAGGGTGCCC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ce44141-64e4-4d9d-9971-4dc79b316d4a	27ea2725-9c48-4965-a503-91d2302923b4	g.chr16:731861_731892delCCTGCATTGAGGCCAAGCACGTGAGGGTGCCC	ENST00000293882.4	-	0	1906_1937				JMJD8_ENST00000609261.1_3'UTR|LA16c-313D11.9_ENST00000571933.1_RNA|STUB1_ENST00000566181.2_3'UTR|JMJD8_ENST00000412368.2_3'UTR|STUB1_ENST00000564370.1_Splice_Site_p.ACIEAKH126fs|STUB1_ENST00000219548.4_Splice_Site_p.ACIEAKH198fs|LA16c-313D11.9_ENST00000567091.1_RNA|JMJD8_ENST00000454700.1_3'UTR|STUB1_ENST00000565677.1_Splice_Site_p.ACIEAKH126fs			Q96S16	JMJD8_HUMAN	jumonji domain containing 8							extracellular vesicular exosome (GO:0070062)				breast(1)	1						GCCCAGCAGGCCTGCATTGAGGCCAAGCACGTGAGGGTGCCCCCCACCCACA	0.659																																					p.198_204del		Atlas-Indel,Pindel	.											.	STUB1	26	.	0			c.592_612del						.																																			SO:0001624	3_prime_UTR_variant	10273	exon4			.		CCDS45369.1	16p13.3	2008-07-28	2008-07-28	2008-07-28		ENSG00000161999			14148	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 20"""	C16orf20			Standard	NM_001005920		Approved		uc002ciw.1	Q96S16		ENST00000293882.4:c.*933GGGCACCCTCACGTGCTTGGCCTCAATGCAGG>-	chr16.hg19:g.731861_731892delCCTGCATTGAGGCCAAGCACGTGAGGGTGCCC		151.0	0.0		169.0	21.0	NM_005861	B2RNS7|D3DU58|Q4PKE3|Q4VBY1|Q6GMW5|Q71RB8	In_Frame_Del	DEL	ENST00000293882.4	hg19																																																																																				.	.		0.659	JMJD8-201	KNOWN	basic	protein_coding	protein_coding		NM_001005920	
KIAA1244	57221	hgsc.bcm.edu	37	6	138613011	138613012	+	Frame_Shift_Ins	INS	-	-	G			TCGA-2Y-A9GS-01A-12D-A382-10	TCGA-2Y-A9GS-10A-01D-A385-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ce44141-64e4-4d9d-9971-4dc79b316d4a	27ea2725-9c48-4965-a503-91d2302923b4	g.chr6:138613011_138613012insG	ENST00000251691.4	+	19	3355_3356	c.3189_3190insG	c.(3190-3192)gagfs	p.E1064fs		NM_020340.4	NP_065073.3			KIAA1244											NS(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(11)|lung(17)|ovary(2)|skin(2)	44	Breast(32;0.135)			OV - Ovarian serous cystadenocarcinoma(155;0.00102)|GBM - Glioblastoma multiforme(68;0.00259)		GCTCGCCCCCCGAGCACAGCCC	0.728																																					p.P1063fs		Atlas-Indel,Pindel	.											.	KIAA1244	236	.	0			c.3189_3190insG						.																																			SO:0001589	frameshift_variant	57221	exon19			.	AB033070	CCDS5189.2	6q23.3	2012-04-17			ENSG00000112379	ENSG00000112379		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	21213	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 33"""		"""chromosome 6 open reading frame 92"""	C6orf92			Standard	NM_020340		Approved	dJ171N11.1, BIG3, PPP1R33	uc003qhu.3	Q5TH69	OTTHUMG00000015670	ENST00000251691.4:c.3190dupG	chr6.hg19:g.138613012_138613012dupG	ENSP00000251691:p.Glu1064fs	164.0	0.0		184.0	63.0	NM_020340		Frame_Shift_Ins	INS	ENST00000251691.4	hg19	CCDS5189.2																																																																																			.	.		0.728	KIAA1244-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042425.4	NM_020340	
ALB	213	hgsc.bcm.edu	37	4	74283353	74283360	+	Frame_Shift_Del	DEL	TGAAGCAA	TGAAGCAA	-			TCGA-2Y-A9GS-01A-12D-A382-10	TCGA-2Y-A9GS-10A-01D-A385-10	TGAAGCAA	TGAAGCAA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ce44141-64e4-4d9d-9971-4dc79b316d4a	27ea2725-9c48-4965-a503-91d2302923b4	g.chr4:74283353_74283360delTGAAGCAA	ENST00000503124.1	+	9	1152_1159	c.945_952delTGAAGCAA	c.(943-954)cctgaagcaaaafs	p.EAK316fs	ALB_ENST00000415165.2_Frame_Shift_Del_p.EAK274fs|ALB_ENST00000509063.1_Frame_Shift_Del_p.EAK466fs|ALB_ENST00000505649.1_Intron|ALB_ENST00000295897.4_Frame_Shift_Del_p.EAK466fs|ALB_ENST00000401494.3_Frame_Shift_Del_p.EAK351fs			Q8TES7	FBF1_HUMAN	albumin	0					apical junction assembly (GO:0043297)|cilium assembly (GO:0042384)|establishment of epithelial cell polarity (GO:0090162)	cell junction (GO:0030054)|centriole (GO:0005814)|ciliary transition fiber (GO:0097539)|spindle pole (GO:0000922)				NS(1)|endometrium(4)|kidney(1)|large_intestine(6)|liver(9)|lung(16)|ovary(3)|prostate(2)|skin(4)|stomach(1)|urinary_tract(1)	48	Breast(15;0.00102)		Epithelial(6;4.8e-05)|OV - Ovarian serous cystadenocarcinoma(6;0.000263)|all cancers(17;0.000472)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			GTAAACATCCTGAAGCAAAAAGAATGCC	0.341																																					p.465_467del		Atlas-Indel,Pindel	.											.	ALB	132	.	0			c.1394_1401del						.																																			SO:0001589	frameshift_variant	213	exon11			.	V00494	CCDS3555.1	4q13.3	2008-02-05	2006-06-30	2006-06-30	ENSG00000163631	ENSG00000163631			399	protein-coding gene	gene with protein product		103600				6292049, 6192711	Standard	NM_000477		Approved		uc003hgs.4	P02768	OTTHUMG00000129919	ENST00000503124.1:c.945_952delTGAAGCAA	chr4.hg19:g.74283353_74283360delTGAAGCAA	ENSP00000421027:p.Glu316fs	193.0	0.0		153.0	72.0	NM_000477	B5MEM5|Q96IF6|Q96JG4|Q96MA8	Frame_Shift_Del	DEL	ENST00000503124.1	hg19																																																																																				.	.		0.341	ALB-011	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000365419.1	NM_000477	
