#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
TMEM201	199953	hgsc.bcm.edu	37	1	9661209	9661209	+	Missense_Mutation	SNP	G	G	T			TCGA-2Y-A9GT-01A-11D-A382-10	TCGA-2Y-A9GT-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38c5baf0-5376-42d2-b545-89f5c606b05e	76f29a85-4ade-4630-b69b-5a23a1c16628	g.chr1:9661209G>T	ENST00000340381.6	+	5	662	c.653G>T	c.(652-654)cGt>cTt	p.R218L	TMEM201_ENST00000340305.5_Missense_Mutation_p.R218L|TMEM201_ENST00000377376.4_Missense_Mutation_p.R218L	NM_001130924.2	NP_001124396.2	Q5SNT2	TM201_HUMAN	transmembrane protein 201	218					fibroblast migration (GO:0010761)|nuclear migration (GO:0007097)	integral component of membrane (GO:0016021)|nuclear membrane (GO:0031965)				lung(3)|upper_aerodigestive_tract(1)	4	all_lung(157;0.222)	all_epithelial(116;2.09e-14)|Renal(390;0.000469)|all_lung(118;0.000521)|Lung NSC(185;0.000744)|Colorectal(325;0.0062)|Breast(348;0.0157)|Hepatocellular(190;0.0228)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.104)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;5.5e-08)|COAD - Colon adenocarcinoma(227;1.36e-05)|Kidney(185;0.000249)|KIRC - Kidney renal clear cell carcinoma(229;0.000911)|BRCA - Breast invasive adenocarcinoma(304;0.00185)|STAD - Stomach adenocarcinoma(132;0.00345)|READ - Rectum adenocarcinoma(331;0.0419)		ATCCTGCTCCGTGCCCTCGCC	0.667																																					p.R218L		Atlas-SNP	.											.	TMEM201	63	.	0			c.G653T						.						75.0	75.0	75.0					1																	9661209		2203	4300	6503	SO:0001583	missense	199953	exon5			TGCTCCGTGCCCT		CCDS30579.1, CCDS44055.1, CCDS44055.2	1p36.22	2009-11-06			ENSG00000188807	ENSG00000188807			33719	protein-coding gene	gene with protein product							Standard	NM_001130924		Approved	RP13-15M17.2, NET5	uc021ofy.1	Q5SNT2	OTTHUMG00000057457	ENST00000340381.6:c.653G>T	chr1.hg19:g.9661209G>T	ENSP00000344503:p.Arg218Leu	167.0	0.0		100.0	25.0	NM_001010866	B9EH90|Q5SNT3	Missense_Mutation	SNP	ENST00000340381.6	hg19	CCDS44055.2	.	.	.	.	.	.	.	.	.	.	G	27.5	4.837633	0.91117	.	.	ENSG00000188807	ENST00000377376;ENST00000340305;ENST00000340381	.	.	.	4.98	4.98	0.66077	.	0.000000	0.85682	D	0.000000	T	0.66867	0.2833	L	0.36672	1.1	0.53688	D	0.999976	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	T	0.65643	-0.6118	9	0.38643	T	0.18	-15.9352	15.4399	0.75176	0.0:0.0:1.0:0.0	.	218;218	E9PBR6;Q5SNT2-2	.;.	L	218	.	ENSP00000344772:R218L	R	+	2	0	TMEM201	9583796	1.000000	0.71417	0.936000	0.37596	0.974000	0.67602	8.751000	0.91628	2.314000	0.78098	0.563000	0.77884	CGT	.	.		0.667	TMEM201-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000127672.1	NM_001010866	
MIIP	60672	hgsc.bcm.edu	37	1	12082273	12082273	+	Missense_Mutation	SNP	C	C	T			TCGA-2Y-A9GT-01A-11D-A382-10	TCGA-2Y-A9GT-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38c5baf0-5376-42d2-b545-89f5c606b05e	76f29a85-4ade-4630-b69b-5a23a1c16628	g.chr1:12082273C>T	ENST00000235332.4	+	3	405	c.236C>T	c.(235-237)gCc>gTc	p.A79V	MIIP_ENST00000436478.2_Missense_Mutation_p.A79V|Y_RNA_ENST00000365591.1_RNA	NM_021933.3	NP_068752.2	Q5JXC2	MIIP_HUMAN	migration and invasion inhibitory protein	79										autonomic_ganglia(1)|kidney(1)|large_intestine(4)|lung(5)|ovary(1)|prostate(2)|skin(1)	15						CCACCAGATGCCTGTCGAGGG	0.657																																					p.A79V		Atlas-SNP	.											.	MIIP	34	.	0			c.C236T						.						52.0	56.0	55.0					1																	12082273		2203	4300	6503	SO:0001583	missense	60672	exon3			CAGATGCCTGTCG	AK022500	CCDS143.1	1p36.22	2009-07-09			ENSG00000116691	ENSG00000116691			25715	protein-coding gene	gene with protein product	"""invasion inhibitory protein 45"""	608772				15867349, 14617774	Standard	NM_021933		Approved	FLJ12438, IIp45	uc001ato.2	Q5JXC2	OTTHUMG00000002439	ENST00000235332.4:c.236C>T	chr1.hg19:g.12082273C>T	ENSP00000235332:p.Ala79Val	178.0	0.0		133.0	43.0	NM_021933	C0KL22|Q96HU6|Q9H839|Q9HA00	Missense_Mutation	SNP	ENST00000235332.4	hg19	CCDS143.1	.	.	.	.	.	.	.	.	.	.	C	4.461	0.085321	0.08583	.	.	ENSG00000116691	ENST00000235332;ENST00000436478	T;T	0.19938	2.11;2.11	4.49	-2.92	0.05615	.	1.072830	0.07298	N	0.873639	T	0.10551	0.0258	L	0.36672	1.1	0.09310	N	1	B	0.20550	0.046	B	0.19666	0.026	T	0.36601	-0.9741	10	0.02654	T	1	0.0728	1.4506	0.02374	0.1343:0.3715:0.1397:0.3545	.	79	Q5JXC2	MIIP_HUMAN	V	79	ENSP00000235332:A79V;ENSP00000392417:A79V	ENSP00000235332:A79V	A	+	2	0	MIIP	12004860	0.000000	0.05858	0.000000	0.03702	0.009000	0.06853	0.338000	0.19858	-0.687000	0.05162	-0.229000	0.12294	GCC	.	.		0.657	MIIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006941.1	NM_021933	
NECAP2	55707	hgsc.bcm.edu	37	1	16767319	16767319	+	Silent	SNP	C	C	T			TCGA-2Y-A9GT-01A-11D-A382-10	TCGA-2Y-A9GT-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38c5baf0-5376-42d2-b545-89f5c606b05e	76f29a85-4ade-4630-b69b-5a23a1c16628	g.chr1:16767319C>T	ENST00000337132.5	+	1	153	c.63C>T	c.(61-63)atC>atT	p.I21I	NECAP2_ENST00000504551.2_Silent_p.I21I|NECAP2_ENST00000443980.2_Silent_p.I21I|NECAP2_ENST00000486390.1_3'UTR|NECAP2_ENST00000406746.1_Silent_p.I21I|NECAP2_ENST00000457722.2_Intron	NM_001145278.1|NM_018090.4	NP_001138750.1|NP_060560.1	Q9NVZ3	NECP2_HUMAN	NECAP endocytosis associated 2	21					endocytosis (GO:0006897)|protein transport (GO:0015031)	clathrin vesicle coat (GO:0030125)|coated pit (GO:0005905)|intracellular (GO:0005622)|plasma membrane (GO:0005886)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	9		Colorectal(325;0.000147)|Renal(390;0.00145)|Lung NSC(340;0.00215)|Breast(348;0.00224)|all_lung(284;0.00351)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0646)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0182)|COAD - Colon adenocarcinoma(227;1.13e-05)|BRCA - Breast invasive adenocarcinoma(304;4.13e-05)|Kidney(64;0.000181)|KIRC - Kidney renal clear cell carcinoma(64;0.00268)|STAD - Stomach adenocarcinoma(196;0.012)|READ - Rectum adenocarcinoma(331;0.0649)		TCTACCGCATCCCTCCGCGGG	0.637											OREG0013136	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.I21I		Atlas-SNP	.											.	NECAP2	24	.	0			c.C63T						.						120.0	95.0	103.0					1																	16767319		2203	4300	6503	SO:0001819	synonymous_variant	55707	exon1			CCGCATCCCTCCG	AK021938	CCDS173.1, CCDS44066.1, CCDS44067.1	1p36.13	2008-02-05			ENSG00000157191	ENSG00000157191			25528	protein-coding gene	gene with protein product		611624				14555962, 15494011	Standard	NM_001145277		Approved	FLJ10420	uc001ayq.3	Q9NVZ3	OTTHUMG00000002313	ENST00000337132.5:c.63C>T	chr1.hg19:g.16767319C>T		97.0	0.0	712	72.0	13.0	NM_001145277	B4DY19|E9PGQ8|Q5VSU4|Q5VSU5|Q9H7L1|Q9H8L1	Silent	SNP	ENST00000337132.5	hg19	CCDS173.1																																																																																			.	.		0.637	NECAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006680.2	NM_018090	
ZC3H12A	80149	hgsc.bcm.edu	37	1	37941375	37941375	+	Missense_Mutation	SNP	A	A	G			TCGA-2Y-A9GT-01A-11D-A382-10	TCGA-2Y-A9GT-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38c5baf0-5376-42d2-b545-89f5c606b05e	76f29a85-4ade-4630-b69b-5a23a1c16628	g.chr1:37941375A>G	ENST00000373087.6	+	2	394	c.278A>G	c.(277-279)gAg>gGg	p.E93G	RP11-422J8.1_ENST00000424989.1_RNA	NM_025079.2	NP_079355.2			zinc finger CCCH-type containing 12A											NS(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(3)|lung(5)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)				ACAGCCACCGAGCGGGAGCGC	0.657																																					p.E93G		Atlas-SNP	.											.	ZC3H12A	58	.	0			c.A278G						.						42.0	41.0	41.0					1																	37941375		2203	4299	6502	SO:0001583	missense	80149	exon2			CCACCGAGCGGGA		CCDS417.1	1p34.3	2012-07-05			ENSG00000163874	ENSG00000163874		"""Zinc fingers, CCCH-type domain containing"""	26259	protein-coding gene	gene with protein product	"""MCP induced protein 1"""	610562				18178554, 22055188	Standard	NM_025079		Approved	FLJ23231, MCPIP1	uc001cbb.4	Q5D1E8	OTTHUMG00000004221	ENST00000373087.6:c.278A>G	chr1.hg19:g.37941375A>G	ENSP00000362179:p.Glu93Gly	183.0	0.0		80.0	19.0	NM_025079		Missense_Mutation	SNP	ENST00000373087.6	hg19	CCDS417.1	.	.	.	.	.	.	.	.	.	.	A	12.04	1.819342	0.32145	.	.	ENSG00000163874	ENST00000373087;ENST00000373082	T	0.24538	1.85	4.8	4.8	0.61643	.	0.474047	0.22726	N	0.056384	T	0.22475	0.0542	L	0.41492	1.28	0.48040	D	0.99957	B	0.14438	0.01	B	0.15484	0.013	T	0.03433	-1.1037	10	0.25106	T	0.35	-26.5589	14.3326	0.66566	1.0:0.0:0.0:0.0	.	93	Q5D1E8	ZC12A_HUMAN	G	93	ENSP00000362179:E93G	ENSP00000362174:E93G	E	+	2	0	ZC3H12A	37713962	0.185000	0.23213	0.552000	0.28243	0.006000	0.05464	1.923000	0.40055	1.785000	0.52413	0.460000	0.39030	GAG	.	.		0.657	ZC3H12A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012154.2	NM_025079	
MROH7	374977	hgsc.bcm.edu	37	1	55118680	55118680	+	Silent	SNP	G	G	A	rs371606173		TCGA-2Y-A9GT-01A-11D-A382-10	TCGA-2Y-A9GT-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38c5baf0-5376-42d2-b545-89f5c606b05e	76f29a85-4ade-4630-b69b-5a23a1c16628	g.chr1:55118680G>A	ENST00000421030.2	+	3	366	c.81G>A	c.(79-81)ccG>ccA	p.P27P	MROH7_ENST00000545244.1_Intron|MROH7_ENST00000339553.5_Silent_p.P27P|MROH7_ENST00000409996.1_Intron|MROH7_ENST00000395690.2_Silent_p.P27P|MROH7_ENST00000454855.2_Intron|MROH7_ENST00000472987.1_3'UTR|MROH7-TTC4_ENST00000414150.2_Silent_p.P27P	NM_001039464.2	NP_001034553	Q68CQ1	MROH7_HUMAN	maestro heat-like repeat family member 7	27						extracellular space (GO:0005615)|integral component of membrane (GO:0016021)											GTGGGGCCCCGGGATTAGGGT	0.592													G|||	1	0.000199681	0.0008	0.0	5008	,	,		17658	0.0		0.0	False		,,,				2504	0.0				p.P27P		Atlas-SNP	.											.	.	.	.	0			c.G81A						.	G		1,3737		0,1,1868	57.0	58.0	58.0		81	-7.0	0.0	1		58	1,8171		0,1,4085	no	coding-synonymous	HEATR8	NM_001039464.2		0,2,5953	AA,AG,GG		0.0122,0.0268,0.0168		27/1324	55118680	2,11908	1869	4086	5955	SO:0001819	synonymous_variant	374977	exon3			GGCCCCGGGATTA	AL832492	CCDS41342.2	1p32.3	2012-12-19	2012-12-19	2012-12-19	ENSG00000184313	ENSG00000184313		"""maestro heat-like repeat containing"""	24802	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 175"", ""HEAT repeat containing 8"""	C1orf175, HEATR8		12477932	Standard	NM_001039464		Approved	FLJ46354	uc010ooe.1	Q68CQ1	OTTHUMG00000009890	ENST00000421030.2:c.81G>A	chr1.hg19:g.55118680G>A		105.0	0.0		99.0	35.0	NM_001039464	A0AUX8|Q5TA99|Q6ZP40|Q6ZRH6|Q8N311|Q8NA14	Silent	SNP	ENST00000421030.2	hg19	CCDS41342.2																																																																																			.	.		0.592	MROH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346978.1	NM_198547	
CLCA1	1179	hgsc.bcm.edu	37	1	86954813	86954813	+	Silent	SNP	C	C	T			TCGA-2Y-A9GT-01A-11D-A382-10	TCGA-2Y-A9GT-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38c5baf0-5376-42d2-b545-89f5c606b05e	76f29a85-4ade-4630-b69b-5a23a1c16628	g.chr1:86954813C>T	ENST00000234701.3	+	9	1668	c.1317C>T	c.(1315-1317)ccC>ccT	p.P439P	CLCA1_ENST00000394711.1_Silent_p.P439P			A8K7I4	CLCA1_HUMAN	chloride channel accessory 1	439	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				calcium ion transport (GO:0006816)|cellular response to hypoxia (GO:0071456)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|transport (GO:0006810)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|microvillus (GO:0005902)|zymogen granule membrane (GO:0042589)	chloride channel activity (GO:0005254)			NS(1)|breast(3)|endometrium(1)|kidney(3)|large_intestine(9)|lung(14)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	38		Lung NSC(277;0.239)		all cancers(265;0.0249)|Epithelial(280;0.0476)		CTTTGGGGCCCTCTGCAGCTC	0.512																																					p.P439P		Atlas-SNP	.											.	CLCA1	109	.	0			c.C1317T						.						70.0	69.0	69.0					1																	86954813		2203	4300	6503	SO:0001819	synonymous_variant	1179	exon8			GGGGCCCTCTGCA		CCDS709.1	1p22.3	2012-02-26	2009-01-29		ENSG00000016490	ENSG00000016490			2015	protein-coding gene	gene with protein product		603906	"""chloride channel, calcium activated, family member 1"", ""chloride channel regulator 1"""			9828122	Standard	NM_001285		Approved	CaCC, CLCRG1	uc001dlt.3	A8K7I4	OTTHUMG00000010254	ENST00000234701.3:c.1317C>T	chr1.hg19:g.86954813C>T		101.0	0.0		129.0	31.0	NM_001285	B2RAV5|O95151|Q5TDF4|Q9UNF6|Q9UPC6	Silent	SNP	ENST00000234701.3	hg19	CCDS709.1																																																																																			.	.		0.512	CLCA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000028277.1	NM_001285	
COL11A1	1301	hgsc.bcm.edu	37	1	103496801	103496801	+	Splice_Site	SNP	C	C	A			TCGA-2Y-A9GT-01A-11D-A382-10	TCGA-2Y-A9GT-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38c5baf0-5376-42d2-b545-89f5c606b05e	76f29a85-4ade-4630-b69b-5a23a1c16628	g.chr1:103496801C>A	ENST00000370096.3	-	5	964		c.e5-1		COL11A1_ENST00000358392.2_Splice_Site|COL11A1_ENST00000353414.4_Splice_Site|COL11A1_ENST00000512756.1_Splice_Site	NM_001854.3	NP_001845.3	P12107	COBA1_HUMAN	collagen, type XI, alpha 1						cartilage condensation (GO:0001502)|chondrocyte development (GO:0002063)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|embryonic skeletal system morphogenesis (GO:0048704)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|inner ear morphogenesis (GO:0042472)|proteoglycan metabolic process (GO:0006029)|sensory perception of sound (GO:0007605)|tendon development (GO:0035989)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|visual perception (GO:0007601)	collagen type XI trimer (GO:0005592)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix binding (GO:0050840)|extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)|protein binding, bridging (GO:0030674)	p.?(2)		NS(3)|biliary_tract(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(17)|kidney(8)|large_intestine(28)|lung(157)|ovary(6)|pancreas(2)|prostate(6)|skin(9)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(1)	258		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)		GAATGTCCCCCTGGGAAAAAA	0.383																																					.		Atlas-SNP	.											COL11A1_ENST00000370096,NS,carcinoma,0,2	COL11A1	972	.	2	Unknown(2)	lung(2)	c.652-1G>T						.						46.0	44.0	45.0					1																	103496801		2203	4300	6503	SO:0001630	splice_region_variant	1301	exon6			GTCCCCCTGGGAA	J04177	CCDS778.1, CCDS780.1, CCDS780.2, CCDS53348.1	1p21	2013-01-16			ENSG00000060718	ENSG00000060718		"""Collagens"""	2186	protein-coding gene	gene with protein product	"""collagen XI, alpha-1 polypeptide"""	120280		COLL6		3182841	Standard	NM_080630		Approved	STL2, CO11A1	uc001dul.3	P12107	OTTHUMG00000010872	ENST00000370096.3:c.652-1G>T	chr1.hg19:g.103496801C>A		27.0	0.0		36.0	8.0	NM_001190709	B1ASK7|D3DT73|E9PCU0|Q14034|Q149N0|Q9UIT4|Q9UIT5|Q9UIT6	Splice_Site	SNP	ENST00000370096.3	hg19	CCDS778.1	.	.	.	.	.	.	.	.	.	.	C	20.6	4.015912	0.75161	.	.	ENSG00000060718	ENST00000370096;ENST00000358392;ENST00000353414;ENST00000512756;ENST00000427239;ENST00000447608	.	.	.	5.59	5.59	0.84812	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.5892	0.95501	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	COL11A1	103269389	1.000000	0.71417	1.000000	0.80357	0.771000	0.43674	7.372000	0.79612	2.631000	0.89168	0.551000	0.68910	.	.	.		0.383	COL11A1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000029997.1	NM_080630	Intron
SEMA6C	10500	hgsc.bcm.edu	37	1	151105214	151105214	+	Missense_Mutation	SNP	C	C	T			TCGA-2Y-A9GT-01A-11D-A382-10	TCGA-2Y-A9GT-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38c5baf0-5376-42d2-b545-89f5c606b05e	76f29a85-4ade-4630-b69b-5a23a1c16628	g.chr1:151105214C>T	ENST00000341697.3	-	19	4230	c.2539G>A	c.(2539-2541)Ggc>Agc	p.G847S	SEMA6C_ENST00000479820.1_Intron|RP11-68I18.10_ENST00000563624.1_RNA			Q9H3T2	SEM6C_HUMAN	sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6C	847					axon guidance (GO:0007411)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(5)|lung(15)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	28	Lung SC(34;0.00471)|Ovarian(49;0.0147)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.211)			CGGCCTCCGCCGACGCCCAGC	0.791																																					p.G879S		Atlas-SNP	.											.	SEMA6C	70	.	0			c.G2635A						.						1.0	1.0	1.0					1																	151105214		902	2002	2904	SO:0001583	missense	10500	exon20			CTCCGCCGACGCC	AF339154	CCDS984.1, CCDS53363.1, CCDS53364.1	1q21.2	2008-02-05			ENSG00000143434	ENSG00000143434		"""Semaphorins"""	10740	protein-coding gene	gene with protein product	"""m-Sema Y2"""	609294				12110693	Standard	NM_030913		Approved	KIAA1869	uc001ewv.3	Q9H3T2	OTTHUMG00000012261	ENST00000341697.3:c.2539G>A	chr1.hg19:g.151105214C>T	ENSP00000344148:p.Gly847Ser	202.0	0.0		124.0	38.0	NM_001178061	D3DV15|Q5JR71|Q5JR72|Q5JR73|Q8WXT8|Q8WXT9|Q8WXU0|Q96JF8	Missense_Mutation	SNP	ENST00000341697.3	hg19	CCDS984.1	.	.	.	.	.	.	.	.	.	.	C	9.742	1.165184	0.21538	.	.	ENSG00000143434	ENST00000368914;ENST00000368912;ENST00000368913;ENST00000341697	T;T;T;T	0.18810	2.24;2.38;2.19;2.24	3.33	2.39	0.29439	.	12.152400	0.00166	U	0.000005	T	0.05090	0.0136	N	0.19112	0.55	0.23653	N	0.997192	B;B;B	0.26577	0.153;0.153;0.039	B;B;B	0.23716	0.048;0.048;0.022	T	0.24657	-1.0154	10	0.36615	T	0.2	.	6.6826	0.23129	0.0:0.8619:0.0:0.1381	.	839;879;847	Q9H3T2-2;Q9H3T2-3;Q9H3T2	.;.;SEM6C_HUMAN	S	847;839;879;847	ENSP00000357910:G847S;ENSP00000357908:G839S;ENSP00000357909:G879S;ENSP00000344148:G847S	ENSP00000344148:G847S	G	-	1	0	SEMA6C	149371838	0.221000	0.23642	0.024000	0.17045	0.210000	0.24377	0.455000	0.21843	0.569000	0.29329	0.455000	0.32223	GGC	.	.		0.791	SEMA6C-004	KNOWN	alternative_5_UTR|mRNA_start_NF|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000034074.1	NM_030913	
TPR	7175	hgsc.bcm.edu	37	1	186295267	186295267	+	Missense_Mutation	SNP	C	C	T			TCGA-2Y-A9GT-01A-11D-A382-10	TCGA-2Y-A9GT-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38c5baf0-5376-42d2-b545-89f5c606b05e	76f29a85-4ade-4630-b69b-5a23a1c16628	g.chr1:186295267C>T	ENST00000367478.4	-	41	6286	c.5990G>A	c.(5989-5991)gGc>gAc	p.G1997D		NM_003292.2	NP_003283.2	P12270	TPR_HUMAN	translocated promoter region, nuclear basket protein	1997					carbohydrate metabolic process (GO:0005975)|cellular response to heat (GO:0034605)|cellular response to interferon-alpha (GO:0035457)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|MAPK import into nucleus (GO:0000189)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic nuclear envelope disassembly (GO:0007077)|mitotic spindle assembly checkpoint (GO:0007094)|mRNA export from nucleus in response to heat stress (GO:0031990)|negative regulation of RNA export from nucleus (GO:0046832)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of translational initiation (GO:0045947)|nuclear pore organization (GO:0006999)|positive regulation of heterochromatin assembly (GO:0031453)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of mitotic cell cycle spindle assembly checkpoint (GO:0090267)|positive regulation of protein export from nucleus (GO:0046827)|positive regulation of protein import into nucleus (GO:0042307)|protein import into nucleus (GO:0006606)|regulation of glucose transport (GO:0010827)|regulation of mitotic sister chromatid separation (GO:0010965)|regulation of spindle assembly involved in mitosis (GO:1901673)|response to epidermal growth factor (GO:0070849)|RNA export from nucleus (GO:0006405)|RNA import into nucleus (GO:0006404)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoplasmic dynein complex (GO:0005868)|extrinsic component of membrane (GO:0019898)|kinetochore (GO:0000776)|mitotic spindle (GO:0072686)|nuclear envelope (GO:0005635)|nuclear inclusion body (GO:0042405)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)|nuclear pore nuclear basket (GO:0044615)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|dynein complex binding (GO:0070840)|heat shock protein binding (GO:0031072)|mitogen-activated protein kinase binding (GO:0051019)|mRNA binding (GO:0003729)|nucleocytoplasmic transporter activity (GO:0005487)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)|tubulin binding (GO:0015631)			autonomic_ganglia(1)|breast(5)|central_nervous_system(4)|cervix(2)|endometrium(9)|kidney(12)|large_intestine(23)|liver(1)|lung(45)|ovary(2)|pancreas(1)|prostate(6)|skin(3)|stomach(1)|urinary_tract(8)	123		Breast(1374;0.000659)|Lung SC(1967;0.0262)|Prostate(1639;0.157)		Colorectal(1306;1.12e-05)|KIRC - Kidney renal clear cell carcinoma(1967;0.00553)		accatcattgccatcggcact	0.408			T	NTRK1	papillary thyroid																																p.G1997D		Atlas-SNP	.		Dom	yes		1	1q25	7175	translocated promoter region		E	.	TPR	441	.	0			c.G5990A						.						159.0	159.0	159.0					1																	186295267		2080	4214	6294	SO:0001583	missense	7175	exon41			TCATTGCCATCGG	U69668	CCDS41446.1	1q25	2012-03-13	2012-03-13		ENSG00000047410	ENSG00000047410			12017	protein-coding gene	gene with protein product		189940	"""translocated promoter region (to activated MET oncogene)"""			1611909, 15229283	Standard	NM_003292		Approved		uc001grv.3	P12270	OTTHUMG00000035580	ENST00000367478.4:c.5990G>A	chr1.hg19:g.186295267C>T	ENSP00000356448:p.Gly1997Asp	90.0	0.0		63.0	11.0	NM_003292	Q15655|Q5SWY0|Q99968	Missense_Mutation	SNP	ENST00000367478.4	hg19	CCDS41446.1	.	.	.	.	.	.	.	.	.	.	C	18.98	3.737583	0.69304	.	.	ENSG00000047410	ENST00000367478	T	0.21543	2.0	4.27	4.27	0.50696	.	0.143201	0.64402	D	0.000006	T	0.26448	0.0646	L	0.28740	0.885	0.52501	D	0.999958	D	0.64830	0.994	P	0.52646	0.705	T	0.01600	-1.1315	10	0.41790	T	0.15	.	17.6148	0.88064	0.0:1.0:0.0:0.0	.	1997	P12270	TPR_HUMAN	D	1997	ENSP00000356448:G1997D	ENSP00000356448:G1997D	G	-	2	0	TPR	184561890	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.650000	0.37292	2.660000	0.90430	0.655000	0.94253	GGC	.	.		0.408	TPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086353.2	NM_003292	
ESRRG	2104	hgsc.bcm.edu	37	1	216680527	216680527	+	Splice_Site	SNP	T	T	A			TCGA-2Y-A9GT-01A-11D-A382-10	TCGA-2Y-A9GT-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38c5baf0-5376-42d2-b545-89f5c606b05e	76f29a85-4ade-4630-b69b-5a23a1c16628	g.chr1:216680527T>A	ENST00000408911.3	-	7	1286		c.e7-2		ESRRG_ENST00000366938.2_Splice_Site|ESRRG_ENST00000359162.2_Splice_Site|ESRRG_ENST00000463665.1_Splice_Site|ESRRG_ENST00000366940.2_Splice_Site|ESRRG_ENST00000487276.1_Splice_Site|ESRRG_ENST00000361525.3_Splice_Site|ESRRG_ENST00000493603.1_Splice_Site|ESRRG_ENST00000360012.3_Splice_Site|ESRRG_ENST00000366937.1_Splice_Site|ESRRG_ENST00000361395.2_Splice_Site|ESRRG_ENST00000493748.1_Splice_Site|ESRRG_ENST00000391890.3_Splice_Site	NM_001438.3	NP_001429.2	P62508	ERR3_HUMAN	estrogen-related receptor gamma						gene expression (GO:0010467)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)	AF-2 domain binding (GO:0050682)|retinoic acid receptor activity (GO:0003708)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|steroid binding (GO:0005496)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			endometrium(5)|kidney(1)|large_intestine(8)|liver(1)|lung(29)|ovary(1)|skin(2)|stomach(1)|urinary_tract(1)	49				OV - Ovarian serous cystadenocarcinoma(81;0.0358)|all cancers(67;0.0693)|GBM - Glioblastoma multiforme(131;0.0713)	Diethylstilbestrol(DB00255)	GCATGGAGTCTGTGCAATGAA	0.348																																					.		Atlas-SNP	.											.	ESRRG	111	.	0			c.1064-2A>T						.						74.0	71.0	72.0					1																	216680527		2203	4300	6503	SO:0001630	splice_region_variant	2104	exon9			GGAGTCTGTGCAA	AF058291	CCDS1517.1, CCDS41468.1, CCDS58060.1, CCDS58061.1	1q41	2014-02-18			ENSG00000196482	ENSG00000196482		"""Nuclear hormone receptors"""	3474	protein-coding gene	gene with protein product		602969				9676434, 10072763	Standard	NM_001243505		Approved	NR3B3	uc001hkw.2	P62508	OTTHUMG00000037025	ENST00000408911.3:c.1133-2A>T	chr1.hg19:g.216680527T>A		165.0	0.0		170.0	48.0	NM_001243510	A8K4I0|A8K6I2|B3KY84|E9PGB7|F8W8J3|O75454|O96021|Q68DA0|Q6P274|Q6PK28|Q6TS38|Q9R1F3|Q9UNJ4	Splice_Site	SNP	ENST00000408911.3	hg19	CCDS41468.1	.	.	.	.	.	.	.	.	.	.	T	14.84	2.655255	0.47467	.	.	ENSG00000196482	ENST00000361525;ENST00000366940;ENST00000366937;ENST00000408911;ENST00000359162;ENST00000361395;ENST00000366938;ENST00000360012;ENST00000493603;ENST00000391890;ENST00000463665;ENST00000487276;ENST00000354407;ENST00000493748	.	.	.	5.49	5.49	0.81192	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.5982	0.76602	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	ESRRG	214747150	1.000000	0.71417	0.987000	0.45799	0.610000	0.37248	8.040000	0.89188	2.098000	0.63641	0.459000	0.35465	.	.	.		0.348	ESRRG-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000089882.2	NM_206595	Intron
ESRRG	2104	hgsc.bcm.edu	37	1	216737654	216737654	+	Missense_Mutation	SNP	C	C	T			TCGA-2Y-A9GT-01A-11D-A382-10	TCGA-2Y-A9GT-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38c5baf0-5376-42d2-b545-89f5c606b05e	76f29a85-4ade-4630-b69b-5a23a1c16628	g.chr1:216737654C>T	ENST00000408911.3	-	5	922	c.769G>A	c.(769-771)Gtc>Atc	p.V257I	ESRRG_ENST00000366938.2_Missense_Mutation_p.V234I|ESRRG_ENST00000359162.2_Missense_Mutation_p.V234I|ESRRG_ENST00000463665.1_Missense_Mutation_p.V195I|ESRRG_ENST00000366940.2_Missense_Mutation_p.V234I|ESRRG_ENST00000487276.1_Missense_Mutation_p.V234I|ESRRG_ENST00000361525.3_Missense_Mutation_p.V234I|ESRRG_ENST00000493603.1_Missense_Mutation_p.V234I|ESRRG_ENST00000360012.3_Missense_Mutation_p.V234I|ESRRG_ENST00000366937.1_Missense_Mutation_p.V269I|ESRRG_ENST00000361395.2_Missense_Mutation_p.V234I|ESRRG_ENST00000493748.1_Missense_Mutation_p.V234I|ESRRG_ENST00000391890.3_Missense_Mutation_p.V241I	NM_001438.3	NP_001429.2	P62508	ERR3_HUMAN	estrogen-related receptor gamma	257					gene expression (GO:0010467)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)	AF-2 domain binding (GO:0050682)|retinoic acid receptor activity (GO:0003708)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|steroid binding (GO:0005496)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			endometrium(5)|kidney(1)|large_intestine(8)|liver(1)|lung(29)|ovary(1)|skin(2)|stomach(1)|urinary_tract(1)	49				OV - Ovarian serous cystadenocarcinoma(81;0.0358)|all cancers(67;0.0693)|GBM - Glioblastoma multiforme(131;0.0713)	Diethylstilbestrol(DB00255)	CTGTCGGGGACAGTAGGGTCA	0.493																																					p.V269I		Atlas-SNP	.											.	ESRRG	111	.	0			c.G805A						.						179.0	151.0	160.0					1																	216737654		2203	4300	6503	SO:0001583	missense	2104	exon6			CGGGGACAGTAGG	AF058291	CCDS1517.1, CCDS41468.1, CCDS58060.1, CCDS58061.1	1q41	2014-02-18			ENSG00000196482	ENSG00000196482		"""Nuclear hormone receptors"""	3474	protein-coding gene	gene with protein product		602969				9676434, 10072763	Standard	NM_001243505		Approved	NR3B3	uc001hkw.2	P62508	OTTHUMG00000037025	ENST00000408911.3:c.769G>A	chr1.hg19:g.216737654C>T	ENSP00000386171:p.Val257Ile	96.0	0.0		149.0	41.0	NM_001243518	A8K4I0|A8K6I2|B3KY84|E9PGB7|F8W8J3|O75454|O96021|Q68DA0|Q6P274|Q6PK28|Q6TS38|Q9R1F3|Q9UNJ4	Missense_Mutation	SNP	ENST00000408911.3	hg19	CCDS41468.1	.	.	.	.	.	.	.	.	.	.	C	20.6	4.011126	0.75046	.	.	ENSG00000196482	ENST00000361525;ENST00000366940;ENST00000366937;ENST00000408911;ENST00000359162;ENST00000361395;ENST00000366938;ENST00000360012;ENST00000493603;ENST00000391890;ENST00000463665;ENST00000487276;ENST00000354407;ENST00000493748;ENST00000475275	D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.98701	-5.08;-5.08;-5.08;-5.08;-5.08;-5.08;-5.08;-5.08;-5.08;-5.08;-4.05;-5.08;-5.08;-5.08	5.56	5.56	0.83823	Nuclear hormone receptor, ligand-binding (2);Nuclear hormone receptor, ligand-binding, core (1);	0.055638	0.64402	D	0.000001	D	0.98052	0.9358	N	0.17922	0.545	0.80722	D	1	B;P;D	0.53885	0.001;0.917;0.963	B;P;D	0.65874	0.007;0.781;0.939	D	0.98472	1.0601	10	0.34782	T	0.22	.	19.5216	0.95187	0.0:1.0:0.0:0.0	.	195;269;257	E9PGB7;F8W8J3;P62508	.;.;ERR3_HUMAN	I	234;234;269;257;234;234;234;234;234;241;195;234;234;234;234	ENSP00000355225:V234I;ENSP00000355907:V234I;ENSP00000355904:V269I;ENSP00000386171:V257I;ENSP00000352077:V234I;ENSP00000354584:V234I;ENSP00000355905:V234I;ENSP00000353108:V234I;ENSP00000419594:V234I;ENSP00000375761:V241I;ENSP00000418629:V195I;ENSP00000419155:V234I;ENSP00000417374:V234I;ENSP00000419514:V234I	ENSP00000346386:V234I	V	-	1	0	ESRRG	214804277	1.000000	0.71417	0.974000	0.42286	0.990000	0.78478	6.079000	0.71291	2.605000	0.88082	0.655000	0.94253	GTC	.	.		0.493	ESRRG-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000089882.2	NM_206595	
ZNF669	79862	hgsc.bcm.edu	37	1	247263872	247263872	+	Missense_Mutation	SNP	C	C	T			TCGA-2Y-A9GT-01A-11D-A382-10	TCGA-2Y-A9GT-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38c5baf0-5376-42d2-b545-89f5c606b05e	76f29a85-4ade-4630-b69b-5a23a1c16628	g.chr1:247263872C>T	ENST00000343381.6	-	4	1371	c.1199G>A	c.(1198-1200)aGt>aAt	p.S400N	ZNF669_ENST00000358785.4_3'UTR|ZNF669_ENST00000448299.2_Missense_Mutation_p.S314N	NM_024804.2	NP_079080.2	Q96BR6	ZN669_HUMAN	zinc finger protein 669	400					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(3)|kidney(4)|large_intestine(2)|lung(6)	17	all_cancers(71;4.09e-05)|all_epithelial(71;6.72e-06)|Breast(184;0.0226)|Ovarian(71;0.0283)|all_lung(81;0.0488)|Lung NSC(105;0.053)		OV - Ovarian serous cystadenocarcinoma(106;0.00427)			ACTGAGGCGACTGAAGGCTTG	0.433																																					p.S400N		Atlas-SNP	.											.	ZNF669	46	.	0			c.G1199A						.						151.0	152.0	151.0					1																	247263872		2203	4300	6503	SO:0001583	missense	79862	exon4			AGGCGACTGAAGG		CCDS31088.1, CCDS44345.1	1q44	2013-01-08			ENSG00000188295	ENSG00000188295		"""Zinc fingers, C2H2-type"", ""-"""	25736	protein-coding gene	gene with protein product						12477932	Standard	NM_024804		Approved	FLJ12606	uc001ice.2	Q96BR6	OTTHUMG00000040869	ENST00000343381.6:c.1199G>A	chr1.hg19:g.247263872C>T	ENSP00000342818:p.Ser400Asn	246.0	0.0		158.0	49.0	NM_024804	B3KP94|Q5VT39|Q9H9Q6	Missense_Mutation	SNP	ENST00000343381.6	hg19	CCDS31088.1	.	.	.	.	.	.	.	.	.	.	C	5.453	0.268687	0.10349	.	.	ENSG00000188295	ENST00000535105;ENST00000448299;ENST00000343381	T;T	0.07567	3.18;3.18	0.544	0.544	0.17185	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.12347	0.0300	L	0.33668	1.02	0.09310	N	0.999998	D;D	0.56746	0.977;0.977	P;D	0.65443	0.905;0.935	T	0.28996	-1.0026	9	0.26408	T	0.33	.	4.3293	0.11055	1.0E-4:0.5644:0.4356:0.0	.	314;400	B3KP94;Q96BR6	.;ZN669_HUMAN	N	314;314;400	ENSP00000404370:S314N;ENSP00000342818:S400N	ENSP00000342818:S400N	S	-	2	0	ZNF669	245330495	0.000000	0.05858	0.010000	0.14722	0.027000	0.11550	-6.805000	0.00053	0.543000	0.28864	0.289000	0.19496	AGT	.	.		0.433	ZNF669-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000098394.4	NM_024804	
PXDN	7837	hgsc.bcm.edu	37	2	1648512	1648512	+	Silent	SNP	C	C	G	rs61731247	byFrequency	TCGA-2Y-A9GT-01A-11D-A382-10	TCGA-2Y-A9GT-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38c5baf0-5376-42d2-b545-89f5c606b05e	76f29a85-4ade-4630-b69b-5a23a1c16628	g.chr2:1648512C>G	ENST00000252804.4	-	18	3671	c.3621G>C	c.(3619-3621)tcG>tcC	p.S1207S		NM_012293.1	NP_036425.1	Q92626	PXDN_HUMAN	peroxidasin homolog (Drosophila)	1207					extracellular matrix organization (GO:0030198)|hydrogen peroxide catabolic process (GO:0042744)|immune response (GO:0006955)|negative regulation of cytokine-mediated signaling pathway (GO:0001960)|oxidation-reduction process (GO:0055114)	endoplasmic reticulum (GO:0005783)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|heme binding (GO:0020037)|interleukin-1 receptor antagonist activity (GO:0005152)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)			breast(1)|cervix(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(24)|lung(48)|ovary(3)|pancreas(8)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	112	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.0845)|Lung NSC(108;0.00641)|all_epithelial(98;0.00716)		all cancers(51;0.0492)|OV - Ovarian serous cystadenocarcinoma(76;0.0973)|Epithelial(75;0.17)|GBM - Glioblastoma multiforme(21;0.228)		TGTTGAGTGTCGAGCCATACA	0.468																																					p.S1207S		Atlas-SNP	.											.	PXDN	255	.	0			c.G3621C						.						19.0	24.0	22.0					2																	1648512		1880	4122	6002	SO:0001819	synonymous_variant	7837	exon18			GAGTGTCGAGCCA	AF200348	CCDS46221.1	2p25.3	2013-01-11			ENSG00000130508	ENSG00000130508		"""Immunoglobulin superfamily / I-set domain containing"""	14966	protein-coding gene	gene with protein product		605158				10441517, 9039502	Standard	XM_005264707		Approved	KIAA0230, PRG2, MG50, D2S448, D2S448E, PXN	uc002qxa.3	Q92626	OTTHUMG00000059697	ENST00000252804.4:c.3621G>C	chr2.hg19:g.1648512C>G		762.0	0.0		453.0	125.0	NM_012293	A8QM65|D6W4Y0|Q4KMG2	Silent	SNP	ENST00000252804.4	hg19	CCDS46221.1																																																																																			.	C|0.989;A|0.011		0.468	PXDN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322505.1	XM_056455	
VWA3B	200403	hgsc.bcm.edu	37	2	98779440	98779440	+	Splice_Site	SNP	G	G	A			TCGA-2Y-A9GT-01A-11D-A382-10	TCGA-2Y-A9GT-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38c5baf0-5376-42d2-b545-89f5c606b05e	76f29a85-4ade-4630-b69b-5a23a1c16628	g.chr2:98779440G>A	ENST00000477737.1	+	8	1318		c.e8+1		VWA3B_ENST00000451075.2_Splice_Site|VWA3B_ENST00000435344.1_Splice_Site	NM_144992.4	NP_659429.4	Q502W6	VWA3B_HUMAN	von Willebrand factor A domain containing 3B											NS(3)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(10)|lung(33)|ovary(3)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	70						GTGGACTGCGGTTGGTGCTAT	0.577																																					.		Atlas-SNP	.											.	VWA3B	138	.	0			c.1114+1G>A						.						65.0	71.0	69.0					2																	98779440		2008	4187	6195	SO:0001630	splice_region_variant	200403	exon8			ACTGCGGTTGGTG	AL832761	CCDS42718.1	2q11.2	2008-02-05			ENSG00000168658	ENSG00000168658			28385	protein-coding gene	gene with protein product						12477932	Standard	NM_144992		Approved	DKFZp686F2227, MGC26733	uc002syo.3	Q502W6	OTTHUMG00000153104	ENST00000477737.1:c.1114+1G>A	chr2.hg19:g.98779440G>A		58.0	0.0		46.0	14.0	NM_144992	B9EK71|Q86T73|Q8N2D0|Q8N770|Q8NA79|Q8ND63|Q8ND65|Q8WW02	Splice_Site	SNP	ENST00000477737.1	hg19	CCDS42718.1	.	.	.	.	.	.	.	.	.	.	G	18.25	3.582617	0.65992	.	.	ENSG00000168658	ENST00000435344;ENST00000477737;ENST00000451075	.	.	.	4.68	4.68	0.58851	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.9809	0.58564	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	VWA3B	98145872	1.000000	0.71417	0.743000	0.31040	0.364000	0.29643	4.235000	0.58666	2.428000	0.82296	0.650000	0.86243	.	.	.		0.577	VWA3B-020	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353469.2	NM_144992	Intron
NCK2	8440	hgsc.bcm.edu	37	2	106497846	106497846	+	Missense_Mutation	SNP	G	G	A			TCGA-2Y-A9GT-01A-11D-A382-10	TCGA-2Y-A9GT-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38c5baf0-5376-42d2-b545-89f5c606b05e	76f29a85-4ade-4630-b69b-5a23a1c16628	g.chr2:106497846G>A	ENST00000233154.4	+	4	731	c.289G>A	c.(289-291)Gcc>Acc	p.A97T	NCK2_ENST00000393349.2_Missense_Mutation_p.A97T|NCK2_ENST00000522586.1_Intron|NCK2_ENST00000451463.2_Intron	NM_003581.4	NP_003572.2	O43639	NCK2_HUMAN	NCK adaptor protein 2	97					actin filament organization (GO:0007015)|axon guidance (GO:0007411)|cell migration (GO:0016477)|epidermal growth factor receptor signaling pathway (GO:0007173)|lamellipodium assembly (GO:0030032)|negative regulation of cell proliferation (GO:0008285)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of epidermal growth factor-activated receptor activity (GO:0007176)|regulation of translation (GO:0006417)|signal complex assembly (GO:0007172)|signal transduction (GO:0007165)|T cell activation (GO:0042110)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|vesicle membrane (GO:0012506)	cytoskeletal adaptor activity (GO:0008093)|receptor signaling complex scaffold activity (GO:0030159)			endometrium(1)|lung(3)|ovary(1)	5						CAGCACGGACGCCGAGTACCC	0.672																																					p.A97T		Atlas-SNP	.											.	NCK2	75	.	0			c.G289A						.						31.0	32.0	32.0					2																	106497846		2203	4299	6502	SO:0001583	missense	8440	exon3			ACGGACGCCGAGT	AF043119	CCDS33266.1	2q12	2013-02-14			ENSG00000071051	ENSG00000071051		"""SH2 domain containing"""	7665	protein-coding gene	gene with protein product		604930				9737977, 16752908	Standard	NM_001004720		Approved	NCKbeta	uc002tdi.3	O43639	OTTHUMG00000153116	ENST00000233154.4:c.289G>A	chr2.hg19:g.106497846G>A	ENSP00000233154:p.Ala97Thr	61.0	0.0		46.0	18.0	NM_001004720	D3DVK1|Q9BWN9|Q9UIC3	Missense_Mutation	SNP	ENST00000233154.4	hg19	CCDS33266.1	.	.	.	.	.	.	.	.	.	.	G	13.74	2.326148	0.41197	.	.	ENSG00000071051	ENST00000233154;ENST00000393348;ENST00000425756;ENST00000393349	T;T;T;T	0.44083	0.93;0.93;0.93;0.93	5.64	4.76	0.60689	.	0.102236	0.64402	D	0.000002	T	0.29093	0.0723	N	0.21448	0.665	0.80722	D	1	B	0.17667	0.023	B	0.11329	0.006	T	0.06516	-1.0822	10	0.15499	T	0.54	.	14.8665	0.70419	0.0691:0.0:0.9309:0.0	.	97	O43639	NCK2_HUMAN	T	97	ENSP00000233154:A97T;ENSP00000377017:A97T;ENSP00000408040:A97T;ENSP00000377018:A97T	ENSP00000233154:A97T	A	+	1	0	NCK2	105864278	1.000000	0.71417	0.751000	0.31187	0.754000	0.42855	6.109000	0.71528	1.524000	0.49035	0.563000	0.77884	GCC	.	.		0.672	NCK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329634.1	NM_003581	
GLI2	2736	hgsc.bcm.edu	37	2	121745883	121745883	+	Missense_Mutation	SNP	T	T	C			TCGA-2Y-A9GT-01A-11D-A382-10	TCGA-2Y-A9GT-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38c5baf0-5376-42d2-b545-89f5c606b05e	76f29a85-4ade-4630-b69b-5a23a1c16628	g.chr2:121745883T>C	ENST00000452319.1	+	14	2453	c.2393T>C	c.(2392-2394)aTg>aCg	p.M798T	GLI2_ENST00000361492.4_Missense_Mutation_p.M798T|GLI2_ENST00000314490.11_Missense_Mutation_p.M470T					GLI family zinc finger 2											NS(1)|breast(3)|central_nervous_system(4)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(7)|lung(24)|ovary(8)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	64	Renal(3;0.0496)	Prostate(154;0.0623)				GAGGTGACCATGCTGAGCCAG	0.706																																					p.M798T		Atlas-SNP	.											.	GLI2	187	.	0			c.T2393C						.						6.0	8.0	7.0					2																	121745883		2117	4190	6307	SO:0001583	missense	2736	exon13			TGACCATGCTGAG		CCDS33283.1	2q14	2013-01-25	2009-03-05		ENSG00000074047	ENSG00000074047		"""Zinc fingers, C2H2-type"""	4318	protein-coding gene	gene with protein product	"""tax-responsive element-2 holding protein"", ""tax helper protein 1"", ""tax helper protein 2"""	165230	"""GLI-Kruppel family member GLI2"", ""glioma-associated oncogene family zinc finger 2"""			2850480, 9557682	Standard	NM_005270		Approved	THP2, HPE9, THP1	uc010flp.3	P10070	OTTHUMG00000153741	ENST00000452319.1:c.2393T>C	chr2.hg19:g.121745883T>C	ENSP00000390436:p.Met798Thr	829.0	0.0		479.0	133.0	NM_005270		Missense_Mutation	SNP	ENST00000452319.1	hg19	CCDS33283.1	.	.	.	.	.	.	.	.	.	.	T	13.89	2.370595	0.42003	.	.	ENSG00000074047	ENST00000452319;ENST00000361492;ENST00000314490	D;D;D	0.90563	-2.69;-2.69;-2.69	4.58	4.58	0.56647	.	0.579086	0.18934	N	0.127133	D	0.88477	0.6447	M	0.62723	1.935	0.30838	N	0.735947	B;B;B;B	0.28783	0.094;0.152;0.222;0.152	B;B;B;B	0.25614	0.026;0.058;0.062;0.036	D	0.86669	0.1909	10	0.40728	T	0.16	.	14.1388	0.65306	0.0:0.0:0.0:1.0	.	798;453;453;470	P10070;P10070-2;P10070-4;P10070-3	GLI2_HUMAN;.;.;.	T	798;798;470	ENSP00000390436:M798T;ENSP00000354586:M798T;ENSP00000312694:M470T	ENSP00000312694:M470T	M	+	2	0	GLI2	121462353	1.000000	0.71417	0.966000	0.40874	0.987000	0.75469	3.215000	0.51169	1.918000	0.55548	0.459000	0.35465	ATG	.	.		0.706	GLI2-009	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000332293.3	NM_005270	
MBD5	55777	hgsc.bcm.edu	37	2	149227600	149227600	+	Missense_Mutation	SNP	T	T	G			TCGA-2Y-A9GT-01A-11D-A382-10	TCGA-2Y-A9GT-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38c5baf0-5376-42d2-b545-89f5c606b05e	76f29a85-4ade-4630-b69b-5a23a1c16628	g.chr2:149227600T>G	ENST00000407073.1	+	9	3085	c.2088T>G	c.(2086-2088)ttT>ttG	p.F696L	MBD5_ENST00000404807.1_Missense_Mutation_p.F696L	NM_018328.4	NP_060798.2	Q9P267	MBD5_HUMAN	methyl-CpG binding domain protein 5	696					glucose homeostasis (GO:0042593)|nervous system development (GO:0007399)|positive regulation of growth hormone receptor signaling pathway (GO:0060399)|regulation of multicellular organism growth (GO:0040014)|single-organism behavior (GO:0044708)	chromocenter (GO:0010369)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	chromatin binding (GO:0003682)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(8)|kidney(1)|large_intestine(16)|lung(22)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)	62				BRCA - Breast invasive adenocarcinoma(221;0.0569)		AGGGTTCATTTCCCATCAGTT	0.463																																					p.F696L		Atlas-SNP	.											.	MBD5	164	.	0			c.T2088G						.						89.0	88.0	88.0					2																	149227600		2203	4300	6503	SO:0001583	missense	55777	exon9			TTCATTTCCCATC	AB040894	CCDS33302.1	2q23.2	2009-04-17			ENSG00000204406	ENSG00000204406			20444	protein-coding gene	gene with protein product		611472				12529184	Standard	NM_018328		Approved	FLJ11113, KIAA1461	uc002twm.4	Q9P267	OTTHUMG00000150440	ENST00000407073.1:c.2088T>G	chr2.hg19:g.149227600T>G	ENSP00000386049:p.Phe696Leu	72.0	0.0		89.0	36.0	NM_018328	A5HMQ4|A7E2B1|Q53SR1|Q9NUV6	Missense_Mutation	SNP	ENST00000407073.1	hg19	CCDS33302.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	9.326|9.326	1.059272|1.059272	0.19987|0.19987	.|.	.|.	ENSG00000204406|ENSG00000204406	ENST00000416015|ENST00000407073;ENST00000404807	T|T;T	0.48836|0.38887	0.8|1.11;1.13	4.84|4.84	2.39|2.39	0.29439|0.29439	.|.	0.000000|0.000000	0.64402|0.64402	D|D	0.000016|0.000016	T|T	0.20292|0.20292	0.0488|0.0488	N|N	0.08118|0.08118	0|0	0.36271|0.36271	D|D	0.855151|0.855151	.|B;B	.|0.33103	.|0.04;0.397	.|B;B	.|0.33960	.|0.038;0.173	T|T	0.14420|0.14420	-1.0473|-1.0473	8|10	0.66056|0.27082	D|T	0.02|0.32	-6.1341|-6.1341	7.9096|7.9096	0.29782|0.29782	0.0:0.2612:0.0:0.7388|0.0:0.2612:0.0:0.7388	.|.	.|696;696	.|Q9P267-2;Q9P267	.|.;MBD5_HUMAN	C|L	436|696	ENSP00000393168:F436C|ENSP00000386049:F696L;ENSP00000384672:F696L	ENSP00000393168:F436C|ENSP00000384672:F696L	F|F	+|+	2|3	0|2	MBD5|MBD5	148944070|148944070	1.000000|1.000000	0.71417|0.71417	0.999000|0.999000	0.59377|0.59377	0.991000|0.991000	0.79684|0.79684	2.480000|2.480000	0.45206|0.45206	0.408000|0.408000	0.25621|0.25621	-0.408000|-0.408000	0.06270|0.06270	TTC|TTT	.	.		0.463	MBD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318111.2		
PTPRN	5798	hgsc.bcm.edu	37	2	220167512	220167512	+	Missense_Mutation	SNP	A	A	G			TCGA-2Y-A9GT-01A-11D-A382-10	TCGA-2Y-A9GT-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38c5baf0-5376-42d2-b545-89f5c606b05e	76f29a85-4ade-4630-b69b-5a23a1c16628	g.chr2:220167512A>G	ENST00000295718.2	-	5	665	c.425T>C	c.(424-426)tTa>tCa	p.L142S	AC114803.3_ENST00000417355.1_RNA|PTPRN_ENST00000423636.2_Missense_Mutation_p.L52S|PTPRN_ENST00000409251.3_Missense_Mutation_p.L142S	NM_002846.3	NP_002837.1	Q16849	PTPRN_HUMAN	protein tyrosine phosphatase, receptor type, N	142					cytokine-mediated signaling pathway (GO:0019221)|peptidyl-tyrosine dephosphorylation (GO:0035335)|response to cAMP (GO:0051591)|response to estrogen (GO:0043627)|response to glucose (GO:0009749)|response to insulin (GO:0032868)|response to reactive oxygen species (GO:0000302)	integral component of plasma membrane (GO:0005887)	spectrin binding (GO:0030507)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(3)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(28)|ovary(3)|prostate(4)|skin(11)|upper_aerodigestive_tract(1)|urinary_tract(1)	65		Renal(207;0.0474)		Epithelial(149;4.22e-07)|all cancers(144;8.82e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)|STAD - Stomach adenocarcinoma(1183;0.0875)		GATGTCCTGTAAAAGCAGCTC	0.607																																					p.L142S		Atlas-SNP	.											.	PTPRN	138	.	0			c.T425C						.						62.0	70.0	67.0					2																	220167512		2203	4300	6503	SO:0001583	missense	5798	exon5			TCCTGTAAAAGCA		CCDS2440.1, CCDS56167.1, CCDS56168.1	2q35-q36.1	2011-06-09			ENSG00000054356	ENSG00000054356		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"""	9676	protein-coding gene	gene with protein product		601773				8024693	Standard	NM_001199763		Approved	IA-2	uc002vkz.3	Q16849	OTTHUMG00000133129	ENST00000295718.2:c.425T>C	chr2.hg19:g.220167512A>G	ENSP00000295718:p.Leu142Ser	161.0	0.0		90.0	19.0	NM_002846	B4DK12|F5GZS3|Q08319|Q53QD6|Q6NSL1	Missense_Mutation	SNP	ENST00000295718.2	hg19	CCDS2440.1	.	.	.	.	.	.	.	.	.	.	A	0.010	-1.754351	0.00663	.	.	ENSG00000054356	ENST00000409251;ENST00000295718;ENST00000539342;ENST00000537666;ENST00000536579;ENST00000412847;ENST00000446182;ENST00000440552;ENST00000442029;ENST00000451506	T;T;T	0.03242	4.03;4.0;4.08	4.79	-0.283	0.12874	.	1.419410	0.04937	N	0.458049	T	0.02610	0.0079	N	0.11427	0.14	0.09310	N	1	B;B	0.06786	0.001;0.0	B;B	0.06405	0.002;0.002	T	0.47100	-0.9143	10	0.28530	T	0.3	.	8.6577	0.34073	0.3482:0.0:0.6518:0.0	.	142;142	Q6NSL1;Q16849	.;PTPRN_HUMAN	S	142;142;142;52;142;52;52;109;52;52	ENSP00000386638:L142S;ENSP00000295718:L142S;ENSP00000444244:L52S	ENSP00000295718:L142S	L	-	2	0	PTPRN	219875756	0.062000	0.20869	0.885000	0.34714	0.254000	0.26022	0.579000	0.23788	0.034000	0.15491	0.459000	0.35465	TTA	.	.		0.607	PTPRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256819.2		
DIS3L2	129563	hgsc.bcm.edu	37	2	233208273	233208273	+	Missense_Mutation	SNP	G	G	C			TCGA-2Y-A9GT-01A-11D-A382-10	TCGA-2Y-A9GT-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38c5baf0-5376-42d2-b545-89f5c606b05e	76f29a85-4ade-4630-b69b-5a23a1c16628	g.chr2:233208273G>C	ENST00000273009.6	+	14	2414	c.1800G>C	c.(1798-1800)caG>caC	p.Q600H		NM_001257281.1	NP_001244210.1			DIS3 like 3'-5' exoribonuclease 2											breast(2)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(7)|lung(18)|ovary(1)|prostate(2)|urinary_tract(1)	40		all_hematologic(139;0.00809)|Renal(207;0.0113)|Acute lymphoblastic leukemia(138;0.0195)|all_lung(227;0.0465)|Lung NSC(271;0.136)		Epithelial(121;1.6e-13)|BRCA - Breast invasive adenocarcinoma(100;0.00104)|LUSC - Lung squamous cell carcinoma(224;0.0109)|Lung(119;0.0149)		AGACAACCCAGTTGCAGATTT	0.448																																					p.Q600H		Atlas-SNP	.											.	DIS3L2	77	.	0			c.G1800C						.																																			SO:0001583	missense	129563	exon14			AACCCAGTTGCAG	BC026166	CCDS42834.1, CCDS58752.1, CCDS58753.1	2q37.1	2014-09-17	2014-03-05		ENSG00000144535	ENSG00000144535			28648	protein-coding gene	gene with protein product		614184	"""family with sequence similarity 6, member A"", ""DIS3 mitotic control homolog (S. cerevisiae)-like 2"""	FAM6A		22306653, 23503588	Standard	NM_152383		Approved	FLJ36974, MGC42174	uc010fxz.3	Q8IYB7	OTTHUMG00000153385	ENST00000273009.6:c.1800G>C	chr2.hg19:g.233208273G>C	ENSP00000273009:p.Gln600His	234.0	0.0		160.0	61.0	NM_001257281		Missense_Mutation	SNP	ENST00000273009.6	hg19	CCDS58752.1	.	.	.	.	.	.	.	.	.	.	G	2.886	-0.230798	0.05983	.	.	ENSG00000144535	ENST00000273009	T	0.34072	1.38	0.122	0.122	0.14702	.	.	.	.	.	T	0.37598	0.1009	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.33979	-0.9847	6	0.87932	D	0	.	2.6679	0.05058	0.471:0.0:0.529:0.0	.	.	.	.	H	600	ENSP00000273009:Q600H	ENSP00000273009:Q600H	Q	+	3	2	DIS3L2	232916517	1.000000	0.71417	0.072000	0.20136	0.073000	0.16967	0.984000	0.29565	0.193000	0.20303	0.196000	0.17591	CAG	.	.		0.448	DIS3L2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000330974.1	NM_152383	
EPM2AIP1	9852	hgsc.bcm.edu	37	3	37033593	37033593	+	Missense_Mutation	SNP	C	C	T			TCGA-2Y-A9GT-01A-11D-A382-10	TCGA-2Y-A9GT-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38c5baf0-5376-42d2-b545-89f5c606b05e	76f29a85-4ade-4630-b69b-5a23a1c16628	g.chr3:37033593C>T	ENST00000322716.5	-	1	1202	c.976G>A	c.(976-978)Gaa>Aaa	p.E326K	MLH1_ENST00000458205.2_5'Flank|MLH1_ENST00000231790.2_5'Flank|MLH1_ENST00000536378.1_5'Flank|MLH1_ENST00000539477.1_5'Flank|MLH1_ENST00000435176.1_5'Flank|MLH1_ENST00000455445.2_5'Flank	NM_014805.3	NP_055620.1	Q7L775	EPMIP_HUMAN	EPM2A (laforin) interacting protein 1	326					positive regulation of glycogen (starch) synthase activity (GO:2000467)|positive regulation of glycogen biosynthetic process (GO:0045725)|response to insulin (GO:0032868)	endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)				breast(1)|endometrium(3)|kidney(1)|large_intestine(7)|liver(1)|lung(12)|ovary(2)	27						TGCTCTGATTCAGATTCCGTT	0.368																																					p.E326K		Atlas-SNP	.											.	EPM2AIP1	47	.	0			c.G976A						.						87.0	88.0	88.0					3																	37033593		1858	4102	5960	SO:0001583	missense	9852	exon1			CTGATTCAGATTC	AB018309	CCDS46790.1	3p22.1	2003-03-26							19735	protein-coding gene	gene with protein product		607911					Standard	NM_014805		Approved	KIAA0766, FLJ11207	uc003cgk.3	Q7L775		ENST00000322716.5:c.976G>A	chr3.hg19:g.37033593C>T	ENSP00000406027:p.Glu326Lys	128.0	0.0		110.0	24.0	NM_014805	O94866|Q9H3L3	Missense_Mutation	SNP	ENST00000322716.5	hg19	CCDS46790.1	.	.	.	.	.	.	.	.	.	.	C	16.10	3.026606	0.54683	.	.	ENSG00000178567	ENST00000322716	D	0.83335	-1.71	4.68	3.8	0.43715	.	.	.	.	.	T	0.74261	0.3693	N	0.19112	0.55	0.20764	N	0.999856	P	0.50528	0.936	P	0.45167	0.472	T	0.63305	-0.6667	9	0.35671	T	0.21	-12.5695	11.8881	0.52615	0.1757:0.8243:0.0:0.0	.	326	Q7L775	EPMIP_HUMAN	K	326	ENSP00000406027:E326K	ENSP00000406027:E326K	E	-	1	0	EPM2AIP1	37008597	0.965000	0.33210	0.786000	0.31890	0.722000	0.41435	2.978000	0.49305	1.158000	0.42547	0.467000	0.42956	GAA	.	.		0.368	EPM2AIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000470593.1	NM_014805	
NBEAL2	23218	hgsc.bcm.edu	37	3	47046579	47046579	+	Silent	SNP	A	A	C			TCGA-2Y-A9GT-01A-11D-A382-10	TCGA-2Y-A9GT-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38c5baf0-5376-42d2-b545-89f5c606b05e	76f29a85-4ade-4630-b69b-5a23a1c16628	g.chr3:47046579A>C	ENST00000450053.3	+	39	6591	c.6412A>C	c.(6412-6414)Agg>Cgg	p.R2138R	NBEAL2_ENST00000292309.5_Silent_p.R1954R|NBEAL2_ENST00000383740.2_Silent_p.R417R	NM_015175.2	NP_055990.1	Q6ZNJ1	NBEL2_HUMAN	neurobeachin-like 2	2138	BEACH. {ECO:0000255|PROSITE- ProRule:PRU00026}.				blood coagulation (GO:0007596)|megakaryocyte development (GO:0035855)|platelet alpha granule organization (GO:0070889)|platelet formation (GO:0030220)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)				NS(1)|breast(1)|central_nervous_system(3)|cervix(2)|endometrium(8)|kidney(5)|large_intestine(9)|lung(9)|ovary(4)|pancreas(1)|prostate(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	51		Acute lymphoblastic leukemia(5;0.0534)		BRCA - Breast invasive adenocarcinoma(193;0.0012)|KIRC - Kidney renal clear cell carcinoma(197;0.00575)|Kidney(197;0.00656)		CCAGCTCGTGAGGGAGAAGTG	0.627																																					p.R2138R		Atlas-SNP	.											.	NBEAL2	267	.	0			c.A6412C						.						58.0	64.0	62.0					3																	47046579		2083	4206	6289	SO:0001819	synonymous_variant	23218	exon39			CTCGTGAGGGAGA	AB011112	CCDS46817.1	3p21.31	2014-09-17			ENSG00000160796	ENSG00000160796		"""WD repeat domain containing"""	31928	protein-coding gene	gene with protein product		614169					Standard	NM_015175		Approved	KIAA0540	uc003cqp.3	Q6ZNJ1	OTTHUMG00000156497	ENST00000450053.3:c.6412A>C	chr3.hg19:g.47046579A>C		174.0	0.0		89.0	16.0	NM_015175	O60288|Q6P994|Q6UX91|Q8NAC9	Silent	SNP	ENST00000450053.3	hg19	CCDS46817.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	9.590|9.590	1.125767|1.125767	0.20959|0.20959	.|.	.|.	ENSG00000160796|ENSG00000160796	ENST00000443829|ENST00000416683	.|.	.|.	.|.	4.86|4.86	0.792|0.792	0.18625|0.18625	.|.	.|.	.|.	.|.	.|.	T|.	0.61185|.	0.2327|.	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.58375|.	-0.7647|.	4|.	.|.	.|.	.|.	.|.	12.2457|12.2457	0.54568|0.54568	0.5882:0.4118:0.0:0.0|0.5882:0.4118:0.0:0.0	.|.	.|.	.|.	.|.	A|C	506|1425	.|.	.|.	E|X	+|+	2|3	0|0	NBEAL2|NBEAL2	47021583|47021583	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.985000|0.985000	0.73830|0.73830	2.003000|2.003000	0.40844|0.40844	0.296000|0.296000	0.22592|0.22592	0.459000|0.459000	0.35465|0.35465	GAG|TGA	.	.		0.627	NBEAL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344363.3	XM_291064	
DOCK3	1795	hgsc.bcm.edu	37	3	51284221	51284221	+	Missense_Mutation	SNP	A	A	G			TCGA-2Y-A9GT-01A-11D-A382-10	TCGA-2Y-A9GT-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38c5baf0-5376-42d2-b545-89f5c606b05e	76f29a85-4ade-4630-b69b-5a23a1c16628	g.chr3:51284221A>G	ENST00000266037.9	+	22	2190	c.2167A>G	c.(2167-2169)Att>Gtt	p.I723V		NM_004947.4	NP_004938.1	Q8IZD9	DOCK3_HUMAN	dedicator of cytokinesis 3	723					small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)	guanyl-nucleotide exchange factor activity (GO:0005085)	p.I712F(1)|p.I723F(1)		breast(2)|cervix(1)|endometrium(10)|kidney(4)|lung(22)|prostate(5)|urinary_tract(1)	45				BRCA - Breast invasive adenocarcinoma(193;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00449)|Kidney(197;0.00518)		ACAGGACCACATTCAAGAAGC	0.443																																					p.I723V		Atlas-SNP	.											DOCK3_ENST00000266037,NS,carcinoma,0,2	DOCK3	397	.	2	Substitution - Missense(2)	lung(2)	c.A2167G						.						103.0	95.0	97.0					3																	51284221		1897	4132	6029	SO:0001583	missense	1795	exon22			GACCACATTCAAG	AB002297	CCDS46835.1	3p21	2008-02-01			ENSG00000088538	ENSG00000088538			2989	protein-coding gene	gene with protein product		603123	"""dedicator of cyto-kinesis 3"""			9205841	Standard	NM_004947		Approved	KIAA0299, MOCA, PBP	uc011bds.2	Q8IZD9	OTTHUMG00000156892	ENST00000266037.9:c.2167A>G	chr3.hg19:g.51284221A>G	ENSP00000266037:p.Ile723Val	147.0	0.0		93.0	23.0	NM_004947	O15017	Missense_Mutation	SNP	ENST00000266037.9	hg19	CCDS46835.1	.	.	.	.	.	.	.	.	.	.	A	19.32	3.805807	0.70682	.	.	ENSG00000088538	ENST00000266037	T	0.65178	-0.14	6.13	6.13	0.99165	.	0.000000	0.85682	D	0.000000	T	0.61652	0.2364	M	0.65975	2.015	0.58432	D	0.999999	B	0.33212	0.402	B	0.29942	0.109	T	0.61917	-0.6964	10	0.44086	T	0.13	.	16.4676	0.84087	1.0:0.0:0.0:0.0	.	723	Q8IZD9	DOCK3_HUMAN	V	723	ENSP00000266037:I723V	ENSP00000266037:I723V	I	+	1	0	DOCK3	51259261	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	8.926000	0.92839	2.367000	0.80283	0.529000	0.55759	ATT	.	.		0.443	DOCK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346478.5	NM_004947	
ZBED2	79413	hgsc.bcm.edu	37	3	111312572	111312572	+	Missense_Mutation	SNP	C	C	A			TCGA-2Y-A9GT-01A-11D-A382-10	TCGA-2Y-A9GT-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38c5baf0-5376-42d2-b545-89f5c606b05e	76f29a85-4ade-4630-b69b-5a23a1c16628	g.chr3:111312572C>A	ENST00000317012.4	-	2	1485	c.477G>T	c.(475-477)gaG>gaT	p.E159D	CD96_ENST00000283285.5_Intron|CD96_ENST00000438817.2_Intron|CD96_ENST00000352690.4_Intron	NM_024508.4	NP_078784.2	Q9BTP6	ZBED2_HUMAN	zinc finger, BED-type containing 2	159							DNA binding (GO:0003677)|metal ion binding (GO:0046872)			large_intestine(3)|lung(1)|skin(2)	6						TCCTAAGCACCTCCTTTTCCC	0.617																																					p.E159D		Atlas-SNP	.											.	ZBED2	22	.	0			c.G477T						.						91.0	81.0	84.0					3																	111312572		2203	4300	6503	SO:0001583	missense	79413	exon2			AAGCACCTCCTTT	BC003536	CCDS2960.2	3p13-q13.2	2013-05-03			ENSG00000177494	ENSG00000177494		"""Zinc fingers, BED-type"""	20710	protein-coding gene	gene with protein product		615246				23533661	Standard	NM_024508		Approved	MGC10796	uc003dxy.3	Q9BTP6	OTTHUMG00000074061	ENST00000317012.4:c.477G>T	chr3.hg19:g.111312572C>A	ENSP00000321370:p.Glu159Asp	66.0	0.0		60.0	14.0	NM_024508	D3DN62	Missense_Mutation	SNP	ENST00000317012.4	hg19	CCDS2960.2	.	.	.	.	.	.	.	.	.	.	C	11.32	1.602509	0.28534	.	.	ENSG00000177494	ENST00000317012	.	.	.	3.74	0.155	0.14906	.	0.000000	0.32161	U	0.006498	T	0.35393	0.0930	L	0.61218	1.895	0.09310	N	1	P	0.52842	0.956	P	0.47528	0.549	T	0.24548	-1.0157	9	0.87932	D	0	-7.7783	5.7	0.17877	0.0:0.5138:0.0:0.4862	.	159	Q9BTP6	ZBED2_HUMAN	D	159	.	ENSP00000321370:E159D	E	-	3	2	ZBED2	112795262	0.000000	0.05858	0.357000	0.25798	0.781000	0.44180	-2.266000	0.01171	0.143000	0.18926	0.460000	0.39030	GAG	.	.		0.617	ZBED2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157228.2	NM_024508	
ATR	545	hgsc.bcm.edu	37	3	142272131	142272131	+	Missense_Mutation	SNP	C	C	T			TCGA-2Y-A9GT-01A-11D-A382-10	TCGA-2Y-A9GT-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38c5baf0-5376-42d2-b545-89f5c606b05e	76f29a85-4ade-4630-b69b-5a23a1c16628	g.chr3:142272131C>T	ENST00000350721.4	-	13	2864	c.2743G>A	c.(2743-2745)Gtt>Att	p.V915I	ATR_ENST00000383101.3_Missense_Mutation_p.V851I	NM_001184.3	NP_001175.2	Q13535	ATR_HUMAN	ATR serine/threonine kinase	915					cell cycle (GO:0007049)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|cellular response to UV (GO:0034644)|DNA damage checkpoint (GO:0000077)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|multicellular organismal development (GO:0007275)|negative regulation of DNA replication (GO:0008156)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|protein autophosphorylation (GO:0046777)|regulation of protein binding (GO:0043393)|replicative senescence (GO:0090399)|response to drug (GO:0042493)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)|PML body (GO:0016605)|XY body (GO:0001741)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|MutLalpha complex binding (GO:0032405)|MutSalpha complex binding (GO:0032407)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(10)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(20)|liver(2)|lung(45)|ovary(3)|skin(10)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(4)	122						TTAGCTGCAACCAGAGCTCTA	0.413								Other conserved DNA damage response genes																													p.V915I		Atlas-SNP	.											.	ATR	285	.	0			c.G2743A						.						79.0	79.0	79.0					3																	142272131		2203	4300	6503	SO:0001583	missense	545	exon13			CTGCAACCAGAGC	U76308	CCDS3124.1	3q23	2014-06-17	2014-06-17		ENSG00000175054	ENSG00000175054			882	protein-coding gene	gene with protein product	"""MEC1, mitosis entry checkpoint 1, homolog (S. cerevisiae)"""	601215	"""ataxia telangiectasia and Rad3 related"""			8978690, 8610130	Standard	NM_001184		Approved	FRP1, SCKL, SCKL1, MEC1	uc003eux.4	Q13535	OTTHUMG00000159234	ENST00000350721.4:c.2743G>A	chr3.hg19:g.142272131C>T	ENSP00000343741:p.Val915Ile	133.0	0.0		124.0	26.0	NM_001184	Q59HB2|Q7KYL3|Q93051|Q9BXK4	Missense_Mutation	SNP	ENST00000350721.4	hg19	CCDS3124.1	.	.	.	.	.	.	.	.	.	.	C	19.33	3.806545	0.70682	.	.	ENSG00000175054	ENST00000350721;ENST00000383101	T;T	0.63913	-0.07;-0.07	5.53	5.53	0.82687	Armadillo-like helical (1);Armadillo-type fold (1);	0.178956	0.47852	D	0.000214	T	0.46560	0.1399	N	0.08118	0	0.37655	D	0.92254	B	0.27791	0.189	B	0.24541	0.054	T	0.52946	-0.8507	10	0.66056	D	0.02	-16.5228	19.8241	0.96610	0.0:1.0:0.0:0.0	.	915	Q13535	ATR_HUMAN	I	915;851	ENSP00000343741:V915I;ENSP00000372581:V851I	ENSP00000343741:V915I	V	-	1	0	ATR	143754821	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.587000	0.82613	2.758000	0.94735	0.655000	0.94253	GTT	.	.		0.413	ATR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353995.2	NM_001184	
C4orf26	152816	hgsc.bcm.edu	37	4	76489697	76489697	+	3'UTR	SNP	T	T	C			TCGA-2Y-A9GT-01A-11D-A382-10	TCGA-2Y-A9GT-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38c5baf0-5376-42d2-b545-89f5c606b05e	76f29a85-4ade-4630-b69b-5a23a1c16628	g.chr4:76489697T>C	ENST00000311623.4	+	0	476				C4orf26_ENST00000435974.2_Missense_Mutation_p.F162S	NM_001257072.1|NM_178497.3	NP_001244001.1|NP_848592.2	Q17RF5	CD026_HUMAN	chromosome 4 open reading frame 26							extracellular region (GO:0005576)				kidney(1)|large_intestine(4)|stomach(1)	6			Lung(101;0.0973)|LUSC - Lung squamous cell carcinoma(112;0.122)			AGCCTATCCTTCAGAAAAAAG	0.368																																					p.F162S		Atlas-SNP	.											.	C4orf26	24	.	0			c.T485C						.						42.0	47.0	45.0					4																	76489697		2171	4286	6457	SO:0001624	3_prime_UTR_variant	152816	exon3			TATCCTTCAGAAA	AK074237	CCDS3569.1, CCDS56334.1, CCDS75142.1	4q21.1	2012-10-31			ENSG00000174792	ENSG00000174792			26300	protein-coding gene	gene with protein product		614829				22901946	Standard	NM_001206981		Approved	FLJ23657	uc011cbo.2	Q17RF5	OTTHUMG00000130104	ENST00000311623.4:c.*48T>C	chr4.hg19:g.76489697T>C		78.0	0.0		75.0	12.0	NM_001206981	B4DTI3|E7ETQ0|Q8TEC3	Missense_Mutation	SNP	ENST00000311623.4	hg19	CCDS3569.1	.	.	.	.	.	.	.	.	.	.	T	7.384	0.629476	0.14257	.	.	ENSG00000174792	ENST00000435974	T	0.54866	0.55	4.72	-3.33	0.04958	.	.	.	.	.	T	0.25344	0.0616	N	0.08118	0	0.09310	N	1	B	0.15930	0.015	B	0.16722	0.016	T	0.20505	-1.0273	9	0.87932	D	0	.	1.7586	0.02987	0.5025:0.0935:0.1316:0.2723	.	162	E7ETQ0	.	S	162	ENSP00000406925:F162S	ENSP00000406925:F162S	F	+	2	0	C4orf26	76708721	0.000000	0.05858	0.007000	0.13788	0.087000	0.18053	0.145000	0.16157	-0.245000	0.09625	0.528000	0.53228	TTC	.	.		0.368	C4orf26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252410.1	NM_178497	
MAST4	375449	hgsc.bcm.edu	37	5	66461632	66461632	+	Missense_Mutation	SNP	G	G	T			TCGA-2Y-A9GT-01A-11D-A382-10	TCGA-2Y-A9GT-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38c5baf0-5376-42d2-b545-89f5c606b05e	76f29a85-4ade-4630-b69b-5a23a1c16628	g.chr5:66461632G>T	ENST00000403625.2	+	29	6920	c.6625G>T	c.(6625-6627)Gac>Tac	p.D2209Y	MAST4_ENST00000261569.7_Missense_Mutation_p.D2015Y|MAST4_ENST00000403666.1_Missense_Mutation_p.D2020Y|MAST4_ENST00000404260.3_Missense_Mutation_p.D2212Y|MAST4_ENST00000405643.1_Missense_Mutation_p.D2030Y	NM_001164664.1	NP_001158136.1	O15021	MAST4_HUMAN	microtubule associated serine/threonine kinase family member 4	2212	Pro-rich.					cytoplasm (GO:0005737)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|central_nervous_system(1)|kidney(2)|lung(6)|ovary(2)	13		Lung NSC(167;8.56e-06)|Prostate(74;0.00637)|Ovarian(174;0.0563)|Breast(144;0.0586)|Colorectal(97;0.245)		Lung(70;0.011)		TAAGCACCCCGACCGGTCCCT	0.652																																					p.D2209Y		Atlas-SNP	.											.	MAST4	218	.	0			c.G6625T						.						13.0	16.0	15.0					5																	66461632		1858	4099	5957	SO:0001583	missense	375449	exon29			CACCCCGACCGGT	AY830839	CCDS47224.1, CCDS47225.1, CCDS54861.1, CCDS75254.1	5q12.3	2007-06-20			ENSG00000069020	ENSG00000069020			19037	protein-coding gene	gene with protein product						9205841	Standard	NM_198828		Approved	KIAA0303	uc021xzk.1	O15021	OTTHUMG00000152471	ENST00000403625.2:c.6625G>T	chr5.hg19:g.66461632G>T	ENSP00000385727:p.Asp2209Tyr	139.0	0.0		94.0	23.0	NM_001164664	A6NL49|B5ME48|Q05EE6|Q6ZN07|Q8N4X4|Q96LY3	Missense_Mutation	SNP	ENST00000403625.2	hg19	CCDS54861.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	12.28|12.28	1.890139|1.890139	0.33348|0.33348	.|.	.|.	ENSG00000069020|ENSG00000069020	ENST00000404260;ENST00000403625;ENST00000403666;ENST00000405643;ENST00000380908;ENST00000261569|ENST00000443808	T;T;T;T;T|.	0.71934|.	-0.59;-0.59;-0.61;-0.61;-0.58|.	4.86|4.86	3.99|3.99	0.46301|0.46301	.|.	0.471987|.	0.19841|.	N|.	0.104851|.	T|T	0.37376|0.37376	0.1001|0.1001	L|L	0.32530|0.32530	0.975|0.975	0.09310|0.09310	N|N	0.999999|0.999999	D;D|.	0.56968|.	0.963;0.978|.	P;P|.	0.60415|.	0.752;0.874|.	T|T	0.21381|0.21381	-1.0247|-1.0247	10|5	0.87932|.	D|.	0|.	-19.2308|-19.2308	11.5466|11.5466	0.50696|0.50696	0.0832:0.0:0.9168:0.0|0.0832:0.0:0.9168:0.0	.|.	2212;2020|.	O15021;O15021-3|.	MAST4_HUMAN;.|.	Y|L	2212;2209;2020;2030;2030;2015|1265	ENSP00000385048:D2212Y;ENSP00000385727:D2209Y;ENSP00000384313:D2020Y;ENSP00000384099:D2030Y;ENSP00000261569:D2015Y|.	ENSP00000261569:D2015Y|.	D|R	+|+	1|2	0|0	MAST4|MAST4	66497388|66497388	1.000000|1.000000	0.71417|0.71417	0.847000|0.847000	0.33407|0.33407	0.009000|0.009000	0.06853|0.06853	4.745000|4.745000	0.62125|0.62125	1.270000|1.270000	0.44297|0.44297	0.561000|0.561000	0.74099|0.74099	GAC|CGA	.	.		0.652	MAST4-001	NOVEL	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000326324.2		
PCDHB4	56131	hgsc.bcm.edu	37	5	140501893	140501893	+	Missense_Mutation	SNP	T	T	C			TCGA-2Y-A9GT-01A-11D-A382-10	TCGA-2Y-A9GT-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38c5baf0-5376-42d2-b545-89f5c606b05e	76f29a85-4ade-4630-b69b-5a23a1c16628	g.chr5:140501893T>C	ENST00000194152.1	+	1	313	c.313T>C	c.(313-315)Ttc>Ctc	p.F105L	AC005754.8_ENST00000606030.1_lincRNA	NM_018938.2	NP_061761.1	Q9Y5E5	PCDB4_HUMAN	protocadherin beta 4	105	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			autonomic_ganglia(1)|breast(2)|endometrium(4)|kidney(2)|large_intestine(12)|lung(35)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	67			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TGTACTGCATTTCCAAGTGTT	0.463																																					p.F105L		Atlas-SNP	.											.	PCDHB4	177	.	0			c.T313C						.						54.0	59.0	57.0					5																	140501893		2203	4300	6503	SO:0001583	missense	56131	exon1			CTGCATTTCCAAG	AF152497	CCDS4246.1	5q31	2010-01-26			ENSG00000081818	ENSG00000081818		"""Cadherins / Protocadherins : Clustered"""	8689	other	protocadherin		606330				10380929	Standard	NM_018938		Approved	PCDH-BETA4	uc003lip.1	Q9Y5E5	OTTHUMG00000129617	ENST00000194152.1:c.313T>C	chr5.hg19:g.140501893T>C	ENSP00000194152:p.Phe105Leu	91.0	0.0		81.0	4.0	NM_018938	Q4V761	Missense_Mutation	SNP	ENST00000194152.1	hg19	CCDS4246.1	.	.	.	.	.	.	.	.	.	.	T	15.10	2.732086	0.48939	.	.	ENSG00000081818	ENST00000194152	T	0.25579	1.79	4.66	4.66	0.58398	Cadherin, N-terminal (1);	.	.	.	.	T	0.40448	0.1117	L	0.37750	1.13	0.32996	D	0.525613	D	0.69078	0.997	D	0.80764	0.994	T	0.50154	-0.8861	9	0.46703	T	0.11	.	14.2182	0.65807	0.0:0.0:0.0:1.0	.	105	Q9Y5E5	PCDB4_HUMAN	L	105	ENSP00000194152:F105L	ENSP00000194152:F105L	F	+	1	0	PCDHB4	140482077	0.013000	0.17824	1.000000	0.80357	0.917000	0.54804	0.850000	0.27737	2.078000	0.62432	0.533000	0.62120	TTC	.	.		0.463	PCDHB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251812.2	NM_018938	
DOCK2	1794	hgsc.bcm.edu	37	5	169496161	169496161	+	Nonsense_Mutation	SNP	T	T	A			TCGA-2Y-A9GT-01A-11D-A382-10	TCGA-2Y-A9GT-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38c5baf0-5376-42d2-b545-89f5c606b05e	76f29a85-4ade-4630-b69b-5a23a1c16628	g.chr5:169496161T>A	ENST00000256935.8	+	46	4745	c.4665T>A	c.(4663-4665)taT>taA	p.Y1555*	DOCK2_ENST00000520908.1_Nonsense_Mutation_p.Y1047*|DOCK2_ENST00000540750.1_Nonsense_Mutation_p.Y616*|DOCK2_ENST00000523351.1_3'UTR	NM_004946.2	NP_004937.1	Q92608	DOCK2_HUMAN	dedicator of cytokinesis 2	1555	DHR-2.				actin cytoskeleton organization (GO:0030036)|alpha-beta T cell proliferation (GO:0046633)|chemotaxis (GO:0006935)|establishment of T cell polarity (GO:0001768)|immunological synapse formation (GO:0001771)|macropinocytosis (GO:0044351)|membrane raft polarization (GO:0001766)|myeloid dendritic cell activation involved in immune response (GO:0002277)|negative thymic T cell selection (GO:0045060)|positive regulation of phagocytosis (GO:0050766)|positive thymic T cell selection (GO:0045059)|regulation of defense response to virus by virus (GO:0050690)|small GTPase mediated signal transduction (GO:0007264)|viral process (GO:0016032)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|T cell receptor binding (GO:0042608)			NS(2)|breast(5)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(42)|liver(2)|lung(63)|ovary(5)|pancreas(3)|prostate(7)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)	160	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			CTGAAGAGTATGTCAGGGACC	0.567																																					p.Y1555X		Atlas-SNP	.											.	DOCK2	389	.	0			c.T4665A						.						79.0	62.0	68.0					5																	169496161		2203	4300	6503	SO:0001587	stop_gained	1794	exon46			AGAGTATGTCAGG	BC016996	CCDS4371.1	5q35.1	2008-02-05			ENSG00000134516	ENSG00000134516			2988	protein-coding gene	gene with protein product		603122	"""dedicator of cyto-kinesis 2"""				Standard	NM_004946		Approved	KIAA0209	uc003maf.3	Q92608	OTTHUMG00000130437	ENST00000256935.8:c.4665T>A	chr5.hg19:g.169496161T>A	ENSP00000256935:p.Tyr1555*	246.0	0.0		174.0	41.0	NM_004946	Q2M3I0|Q96AK7	Nonsense_Mutation	SNP	ENST00000256935.8	hg19	CCDS4371.1	.	.	.	.	.	.	.	.	.	.	T	50	17.150584	0.99880	.	.	ENSG00000134516	ENST00000256935;ENST00000520908;ENST00000540750	.	.	.	4.62	-0.486	0.12064	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	10.1691	0.42900	0.0:0.1661:0.0:0.8339	.	.	.	.	X	1555;1047;616	.	ENSP00000256935:Y1555X	Y	+	3	2	DOCK2	169428739	0.027000	0.19231	0.779000	0.31741	0.953000	0.61014	0.328000	0.19681	-0.136000	0.11475	-0.132000	0.14878	TAT	.	.		0.567	DOCK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252828.2	NM_004946	
EEF1A1	1915	hgsc.bcm.edu	37	6	74227933	74227933	+	Missense_Mutation	SNP	C	C	A			TCGA-2Y-A9GT-01A-11D-A382-10	TCGA-2Y-A9GT-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38c5baf0-5376-42d2-b545-89f5c606b05e	76f29a85-4ade-4630-b69b-5a23a1c16628	g.chr6:74227933C>A	ENST00000316292.9	-	6	2075	c.1084G>T	c.(1084-1086)Gat>Tat	p.D362Y	EEF1A1_ENST00000491404.1_Intron|EEF1A1_ENST00000309268.6_Missense_Mutation_p.D362Y|EEF1A1_ENST00000331523.2_Missense_Mutation_p.D362Y	NM_001402.5	NP_001393.1	P68104	EF1A1_HUMAN	eukaryotic translation elongation factor 1 alpha 1	362					cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|gene expression (GO:0010467)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|translation (GO:0006412)|translational elongation (GO:0006414)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|eukaryotic translation elongation factor 1 complex (GO:0005853)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)|translation elongation factor activity (GO:0003746)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(6)|prostate(2)|skin(3)	18						GTGTGGCAATCCAATACAGGG	0.448																																					p.D362Y		Atlas-SNP	.											EEF1A1,NS,carcinoma,0,1	EEF1A1	56	.	0			c.G1084T						.						34.0	38.0	37.0					6																	74227933		2197	4298	6495	SO:0001583	missense	1915	exon7			GGCAATCCAATAC	BC019669	CCDS4980.1	6q14.1	2010-06-30	2004-11-19		ENSG00000156508	ENSG00000156508			3189	protein-coding gene	gene with protein product		130590	"""leukocyte receptor cluster (LRC) member 7"""	EF1A, EEF1A, LENG7		8812466, 10941842	Standard	NM_001402		Approved	EE1A1	uc003phj.3	P68104	OTTHUMG00000015031	ENST00000316292.9:c.1084G>T	chr6.hg19:g.74227933C>A	ENSP00000339063:p.Asp362Tyr	190.0	0.0		190.0	40.0	NM_001402	P04719|P04720|Q6IQ15	Missense_Mutation	SNP	ENST00000316292.9	hg19	CCDS4980.1	.	.	.	.	.	.	.	.	.	.	C	19.45	3.830719	0.71258	.	.	ENSG00000156508	ENST00000316292;ENST00000358190;ENST00000309268;ENST00000331523;ENST00000391977	T;T;T	0.44482	0.92;0.92;0.92	4.81	4.81	0.61882	Translation elongation factor EF1A/initiation factor IF2gamma, C-terminal (2);Translation elongation factor EFTu/EF1A, C-terminal (2);	0.058657	0.64402	U	0.000003	T	0.79776	0.4504	H	0.99847	4.84	0.80722	D	1	D;D;D	0.76494	0.999;0.999;0.999	D;D;D	0.77004	0.989;0.989;0.989	D	0.89972	0.4094	10	0.87932	D	0	.	18.3119	0.90203	0.0:1.0:0.0:0.0	.	362;362;362	P68104;Q6IPS9;Q5VTE0	EF1A1_HUMAN;.;EF1A3_HUMAN	Y	362;360;362;362;341	ENSP00000339063:D362Y;ENSP00000339053:D362Y;ENSP00000330054:D362Y	ENSP00000339053:D362Y	D	-	1	0	EEF1A1	74284654	1.000000	0.71417	1.000000	0.80357	0.764000	0.43329	7.441000	0.80485	2.381000	0.81170	0.556000	0.70494	GAT	.	.		0.448	EEF1A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041210.2	NM_001402	
SOGA3	387104	hgsc.bcm.edu	37	6	127834064	127834064	+	Missense_Mutation	SNP	A	A	G			TCGA-2Y-A9GT-01A-11D-A382-10	TCGA-2Y-A9GT-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38c5baf0-5376-42d2-b545-89f5c606b05e	76f29a85-4ade-4630-b69b-5a23a1c16628	g.chr6:127834064A>G	ENST00000525778.1	-	4	2202	c.1457T>C	c.(1456-1458)tTa>tCa	p.L486S	SOGA3_ENST00000368268.2_Missense_Mutation_p.L486S|SOGA3_ENST00000481848.2_Missense_Mutation_p.L486S|SOGA3_ENST00000556132.1_Missense_Mutation_p.L486S|SOGA3_ENST00000465909.2_Missense_Mutation_p.L486S			Q5TF21	SOGA3_HUMAN	SOGA family member 3	486					regulation of autophagy (GO:0010506)	extracellular space (GO:0005615)|integral component of membrane (GO:0016021)											TTCATTCTGTAAAGCTTGCTT	0.318																																					p.L486S		Atlas-SNP	.											.	.	.	.	0			c.T1457C						.						146.0	128.0	133.0					6																	127834064		1821	4075	5896	SO:0001583	missense	387104	exon4			TTCTGTAAAGCTT	AK096490	CCDS43505.1	6q22.33	2013-03-28	2012-02-27	2012-02-27	ENSG00000214338	ENSG00000214338			21494	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 174"""	C6orf174			Standard	NM_001012279		Approved	dJ403A15.3	uc003qbd.3	Q5TF21	OTTHUMG00000166438	ENST00000525778.1:c.1457T>C	chr6.hg19:g.127834064A>G	ENSP00000434570:p.Leu486Ser	142.0	0.0		137.0	18.0	NM_001012279		Missense_Mutation	SNP	ENST00000525778.1	hg19	CCDS43505.1	.	.	.	.	.	.	.	.	.	.	A	24.3	4.520032	0.85495	.	.	ENSG00000214338	ENST00000556132;ENST00000368268;ENST00000525778;ENST00000465909	T;T;T;T	0.41400	1.0;1.0;1.0;1.0	5.82	5.82	0.92795	.	0.000000	0.85682	D	0.000000	T	0.59810	0.2221	M	0.79926	2.475	0.58432	D	0.999998	D	0.89917	1.0	D	0.91635	0.999	T	0.62548	-0.6831	10	0.44086	T	0.13	-4.2364	16.1814	0.81903	1.0:0.0:0.0:0.0	.	486	Q5TF21	CF174_HUMAN	S	486	ENSP00000451768:L486S;ENSP00000357251:L486S;ENSP00000434570:L486S;ENSP00000435559:L486S	ENSP00000435559:L486S	L	-	2	0	C6orf174	127875757	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.339000	0.96797	2.234000	0.73211	0.533000	0.62120	TTA	.	.		0.318	SOGA3-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388246.1	NM_001012279	
CSMD1	64478	hgsc.bcm.edu	37	8	3245023	3245023	+	Missense_Mutation	SNP	G	G	T			TCGA-2Y-A9GT-01A-11D-A382-10	TCGA-2Y-A9GT-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38c5baf0-5376-42d2-b545-89f5c606b05e	76f29a85-4ade-4630-b69b-5a23a1c16628	g.chr8:3245023G>T	ENST00000520002.1	-	19	3333	c.2778C>A	c.(2776-2778)agC>agA	p.S926R	CSMD1_ENST00000539096.1_Missense_Mutation_p.S925R|CSMD1_ENST00000537824.1_Missense_Mutation_p.S925R|CSMD1_ENST00000602723.1_Missense_Mutation_p.S926R|CSMD1_ENST00000400186.3_Missense_Mutation_p.S926R|CSMD1_ENST00000542608.1_Missense_Mutation_p.S925R|CSMD1_ENST00000602557.1_Missense_Mutation_p.S926R			Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1	926	Sushi 5. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		TACCGTCGCAGCTGGGCAAGG	0.587																																					p.S925R		Atlas-SNP	.											.	CSMD1	1469	.	0			c.C2775A						.						37.0	42.0	40.0					8																	3245023		2108	4225	6333	SO:0001583	missense	64478	exon18			GTCGCAGCTGGGC			8p23.2	2012-04-17			ENSG00000183117	ENSG00000183117		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14026	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 24"""	608397					Standard	NM_033225		Approved	KIAA1890, PPP1R24	uc022aqr.1	Q96PZ7	OTTHUMG00000163605	ENST00000520002.1:c.2778C>A	chr8.hg19:g.3245023G>T	ENSP00000430733:p.Ser926Arg	78.0	0.0		70.0	18.0	NM_033225	Q0H0J5|Q96QU9|Q96RM4	Missense_Mutation	SNP	ENST00000520002.1	hg19		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	13.84|13.84	2.357566|2.357566	0.41801|0.41801	.|.	.|.	ENSG00000183117|ENSG00000183117	ENST00000335551|ENST00000400186;ENST00000520002;ENST00000318252;ENST00000537824;ENST00000542608;ENST00000539096	.|T;T;T;T;T	.|0.63913	.|-0.07;-0.07;-0.07;-0.07;-0.07	5.11|5.11	4.22|4.22	0.49857|0.49857	.|Complement control module (2);Sushi/SCR/CCP (3);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.62708|0.62708	0.2450|0.2450	L|L	0.31294|0.31294	0.92|0.92	0.45837|0.45837	D|D	0.998706|0.998706	.|D;P;P	.|0.76494	.|0.999;0.956;0.876	.|D;D;P	.|0.85130	.|0.997;0.93;0.541	T|T	0.56074|0.56074	-0.8039|-0.8039	5|10	.|0.13853	.|T	.|0.58	.|.	8.8091|8.8091	0.34956|0.34956	0.2268:0.0:0.7732:0.0|0.2268:0.0:0.7732:0.0	.|.	.|926;926;926	.|E5RIG2;Q96PZ7;Q96PZ7-4	.|.;CSMD1_HUMAN;.	M|R	406|926;926;788;925;925;925	.|ENSP00000383047:S926R;ENSP00000430733:S926R;ENSP00000441462:S925R;ENSP00000446243:S925R;ENSP00000441675:S925R	.|ENSP00000320445:S788R	L|S	-|-	1|3	2|2	CSMD1|CSMD1	3232430|3232430	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.568000|0.568000	0.35870|0.35870	1.904000|1.904000	0.39868|0.39868	2.374000|2.374000	0.81015|0.81015	0.650000|0.650000	0.86243|0.86243	CTG|AGC	.	.		0.587	CSMD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000374500.2	NM_033225	
PPAPDC2	403313	hgsc.bcm.edu	37	9	4662813	4662813	+	Missense_Mutation	SNP	G	G	T			TCGA-2Y-A9GT-01A-11D-A382-10	TCGA-2Y-A9GT-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38c5baf0-5376-42d2-b545-89f5c606b05e	76f29a85-4ade-4630-b69b-5a23a1c16628	g.chr9:4662813G>T	ENST00000381883.2	+	1	516	c.438G>T	c.(436-438)tgG>tgT	p.W146C	SPATA6L_ENST00000223517.5_Intron|SPATA6L_ENST00000454239.2_Intron|SPATA6L_ENST00000381890.5_Intron|SPATA6L_ENST00000475086.1_Intron|SPATA6L_ENST00000381895.5_Intron	NM_203453.3	NP_982278.3	Q8IY26	PPAC2_HUMAN	phosphatidic acid phosphatase type 2 domain containing 2	146						integral component of membrane (GO:0016021)	hydrolase activity (GO:0016787)			endometrium(1)|large_intestine(2)|lung(1)	4	all_hematologic(13;0.137)	Breast(48;0.238)		GBM - Glioblastoma multiforme(50;0.026)		GCATCCCCTGGCTGCTGGGCA	0.662																																					p.W146C	Melanoma(187;1057 3809 8526)	Atlas-SNP	.											.	PPAPDC2	12	.	0			c.G438T						.						45.0	42.0	43.0					9																	4662813		2203	4300	6503	SO:0001583	missense	403313	exon1			CCCCTGGCTGCTG	AK128369	CCDS34981.1	9p24	2010-04-23			ENSG00000205808	ENSG00000205808			23682	protein-coding gene	gene with protein product	"""polyisoprenoid diphosphate phosphatase type 1"""	611666				16464866	Standard	NM_203453		Approved	FLJ90191, FLJ46512, PDP1	uc003zin.4	Q8IY26	OTTHUMG00000019466	ENST00000381883.2:c.438G>T	chr9.hg19:g.4662813G>T	ENSP00000371307:p.Trp146Cys	61.0	0.0		50.0	13.0	NM_203453	B3KY05|Q5JVJ6|Q8NCK9	Missense_Mutation	SNP	ENST00000381883.2	hg19	CCDS34981.1	.	.	.	.	.	.	.	.	.	.	G	21.5	4.154749	0.78114	.	.	ENSG00000205808	ENST00000381883;ENST00000537542	T	0.75367	-0.93	5.35	4.45	0.53987	Phosphatidic acid phosphatase/chloroperoxidase, N-terminal (1);	0.138236	0.52532	U	0.000065	T	0.82171	0.4979	M	0.82056	2.57	0.80722	D	1	D	0.64830	0.994	P	0.53722	0.733	D	0.85271	0.1056	10	0.72032	D	0.01	-6.9783	13.9758	0.64273	0.0:0.1524:0.8476:0.0	.	146	Q8IY26	PPAC2_HUMAN	C	146;55	ENSP00000371307:W146C	ENSP00000371307:W146C	W	+	3	0	PPAPDC2	4652813	1.000000	0.71417	0.997000	0.53966	0.988000	0.76386	7.351000	0.79395	1.480000	0.48289	0.655000	0.94253	TGG	.	.		0.662	PPAPDC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051567.1	NM_203453	
C9orf84	158401	hgsc.bcm.edu	37	9	114476836	114476836	+	Missense_Mutation	SNP	T	T	A			TCGA-2Y-A9GT-01A-11D-A382-10	TCGA-2Y-A9GT-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38c5baf0-5376-42d2-b545-89f5c606b05e	76f29a85-4ade-4630-b69b-5a23a1c16628	g.chr9:114476836T>A	ENST00000318737.4	-	15	2240	c.2112A>T	c.(2110-2112)agA>agT	p.R704S	C9orf84_ENST00000394777.4_Missense_Mutation_p.R630S|C9orf84_ENST00000394779.3_Missense_Mutation_p.R665S|C9orf84_ENST00000374287.3_Missense_Mutation_p.R704S	NM_173521.3	NP_775792.3	Q5VXU9	CI084_HUMAN	chromosome 9 open reading frame 84	704										breast(1)|cervix(1)|endometrium(3)|kidney(7)|large_intestine(10)|liver(1)|lung(7)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	35						TCTCCAGCTGTCTCCAAATGT	0.363																																					p.R704S		Atlas-SNP	.											.	C9orf84	207	.	0			c.A2112T						.						115.0	109.0	111.0					9																	114476836		2203	4300	6503	SO:0001583	missense	158401	exon15			CAGCTGTCTCCAA	AL833535	CCDS6781.3, CCDS43863.1	9q32	2012-03-16			ENSG00000165181	ENSG00000165181			26535	protein-coding gene	gene with protein product							Standard	XM_005251738		Approved	FLJ32779	uc004bfr.3	Q5VXU9	OTTHUMG00000020495	ENST00000318737.4:c.2112A>T	chr9.hg19:g.114476836T>A	ENSP00000322108:p.Arg704Ser	124.0	0.0		126.0	28.0	NM_173521	A2A2V3|Q2M1H8|Q96M73	Missense_Mutation	SNP	ENST00000318737.4	hg19	CCDS6781.3	.	.	.	.	.	.	.	.	.	.	T	13.97	2.394642	0.42512	.	.	ENSG00000165181	ENST00000394779;ENST00000394777;ENST00000394778;ENST00000374287;ENST00000318737	T;T;T;T	0.15718	2.4;2.52;2.42;2.42	5.87	2.26	0.28386	.	0.000000	0.64402	D	0.000018	T	0.25457	0.0619	L	0.34521	1.04	0.33138	D	0.544041	D;D;D	0.76494	0.999;0.999;0.999	D;D;D	0.67382	0.951;0.951;0.951	T	0.22487	-1.0215	10	0.52906	T	0.07	-12.5672	9.6397	0.39831	0.0:0.2812:0.0:0.7188	.	630;704;665	A6PVK7;Q5VXU9;A2A2V3	.;CI084_HUMAN;.	S	665;630;318;704;704	ENSP00000378259:R665S;ENSP00000378257:R630S;ENSP00000363405:R704S;ENSP00000322108:R704S	ENSP00000322108:R704S	R	-	3	2	C9orf84	113516657	1.000000	0.71417	0.997000	0.53966	0.057000	0.15508	0.632000	0.24583	0.138000	0.18790	-0.912000	0.02778	AGA	.	.		0.363	C9orf84-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000053656.2	NM_173521	
SUSD1	64420	hgsc.bcm.edu	37	9	114905792	114905792	+	Missense_Mutation	SNP	G	G	A			TCGA-2Y-A9GT-01A-11D-A382-10	TCGA-2Y-A9GT-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38c5baf0-5376-42d2-b545-89f5c606b05e	76f29a85-4ade-4630-b69b-5a23a1c16628	g.chr9:114905792G>A	ENST00000374270.3	-	4	657	c.485C>T	c.(484-486)cCt>cTt	p.P162L	SUSD1_ENST00000374264.2_Missense_Mutation_p.P162L|SUSD1_ENST00000374263.3_Missense_Mutation_p.P162L|SUSD1_ENST00000482851.1_5'UTR	NM_022486.3	NP_071931.2	Q6UWL2	SUSD1_HUMAN	sushi domain containing 1	162	EGF-like 3; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.					integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)		SUSD1/ROD1(2)	central_nervous_system(1)|endometrium(4)|large_intestine(8)|lung(11)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	28						GAAAGGTTCAGGTCCATTCCT	0.502																																					p.P162L		Atlas-SNP	.											.	SUSD1	51	.	0			c.C485T						.						171.0	154.0	159.0					9																	114905792		2203	4300	6503	SO:0001583	missense	64420	exon4			GGTTCAGGTCCAT	AL137432	CCDS6783.1, CCDS65105.1, CCDS65106.1	9q31.3-q33.1	2008-02-05			ENSG00000106868	ENSG00000106868			25413	protein-coding gene	gene with protein product						12975309	Standard	NM_022486		Approved	DKFZP761E1824	uc004bfu.3	Q6UWL2	OTTHUMG00000020499	ENST00000374270.3:c.485C>T	chr9.hg19:g.114905792G>A	ENSP00000363388:p.Pro162Leu	109.0	0.0		74.0	23.0	NM_022486	A1A4C5|A8KA03|Q5T8V6|Q5T8V7|Q6P9G7|Q8WU83|Q96DM9|Q9H6V2|Q9NTA7	Missense_Mutation	SNP	ENST00000374270.3	hg19	CCDS6783.1	.	.	.	.	.	.	.	.	.	.	G	9.265	1.044158	0.19748	.	.	ENSG00000106868	ENST00000374270;ENST00000374263;ENST00000374264	T;T;T	0.74632	-0.81;-0.81;-0.86	5.87	5.87	0.94306	EGF-like calcium-binding (1);Epidermal growth factor-like, type 3 (1);	0.165825	0.28940	N	0.013646	T	0.57829	0.2080	N	0.04203	-0.255	0.29651	N	0.843962	P;P;P	0.36354	0.493;0.493;0.549	B;B;B	0.38378	0.178;0.079;0.272	T	0.54827	-0.8235	10	0.22109	T	0.4	-7.6297	18.9906	0.92789	0.0:0.0:1.0:0.0	.	162;162;162	F8WAQ1;Q6UWL2-2;Q6UWL2	.;.;SUSD1_HUMAN	L	162	ENSP00000363388:P162L;ENSP00000363381:P162L;ENSP00000363382:P162L	ENSP00000363381:P162L	P	-	2	0	SUSD1	113945613	0.263000	0.24083	0.938000	0.37757	0.045000	0.14185	1.901000	0.39838	2.780000	0.95670	0.655000	0.94253	CCT	.	.		0.502	SUSD1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053668.3	NM_022486	
MAPKAP1	79109	hgsc.bcm.edu	37	9	128206874	128206874	+	Missense_Mutation	SNP	T	T	C			TCGA-2Y-A9GT-01A-11D-A382-10	TCGA-2Y-A9GT-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38c5baf0-5376-42d2-b545-89f5c606b05e	76f29a85-4ade-4630-b69b-5a23a1c16628	g.chr9:128206874T>C	ENST00000373498.1	-	10	1417	c.1349A>G	c.(1348-1350)cAc>cGc	p.H450R	MAPKAP1_ENST00000265960.3_Missense_Mutation_p.H450R|MAPKAP1_ENST00000394063.1_Missense_Mutation_p.H258R|MAPKAP1_ENST00000350766.3_Missense_Mutation_p.H414R|MAPKAP1_ENST00000373497.5_Missense_Mutation_p.H163R|MAPKAP1_ENST00000373511.2_Missense_Mutation_p.H403R|MAPKAP1_ENST00000373503.3_Missense_Mutation_p.H258R|MAPKAP1_ENST00000483937.1_5'UTR			Q9BPZ7	SIN1_HUMAN	mitogen-activated protein kinase associated protein 1	450					epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|negative regulation of Ras protein signal transduction (GO:0046580)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|substantia nigra development (GO:0021762)|T cell costimulation (GO:0031295)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	phosphatidic acid binding (GO:0070300)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|protein kinase binding (GO:0019901)|Ras GTPase binding (GO:0017016)			endometrium(2)|kidney(1)|large_intestine(2)|lung(15)|ovary(3)	23						AAATATTGCGTGACCTGCAGA	0.463																																					p.H450R		Atlas-SNP	.											.	MAPKAP1	68	.	0			c.A1349G						.						140.0	123.0	129.0					9																	128206874		2203	4300	6503	SO:0001583	missense	79109	exon11			ATTGCGTGACCTG	M37191	CCDS6864.1, CCDS35139.1, CCDS35140.1, CCDS35141.1, CCDS48020.1	9q34.11	2008-02-05			ENSG00000119487	ENSG00000119487			18752	protein-coding gene	gene with protein product	"""stress-activated protein kinase-interacting 1"""	610558				15363842	Standard	NM_001006620		Approved	MGC2745, SIN1, MIP1	uc004bpv.3	Q9BPZ7	OTTHUMG00000020683	ENST00000373498.1:c.1349A>G	chr9.hg19:g.128206874T>C	ENSP00000362597:p.His450Arg	82.0	0.0		40.0	12.0	NM_001006617	A8K1Z5|B1AMA4|B7Z309|Q00426|Q5JSV5|Q5JSV6|Q5JSV9|Q658R0|Q699U1|Q699U2|Q699U3|Q699U4|Q6GVJ0|Q6GVJ1|Q6GVJ2	Missense_Mutation	SNP	ENST00000373498.1	hg19	CCDS35140.1	.	.	.	.	.	.	.	.	.	.	T	11.71	1.718635	0.30503	.	.	ENSG00000119487	ENST00000373511;ENST00000350766;ENST00000373503;ENST00000373498;ENST00000265960;ENST00000394063;ENST00000373497;ENST00000420643	.	.	.	5.91	4.76	0.60689	.	0.000000	0.85682	D	0.000000	T	0.45558	0.1348	L	0.45137	1.4	0.80722	D	1	B;P;B;B	0.35011	0.04;0.48;0.42;0.321	B;B;B;B	0.28465	0.05;0.09;0.061;0.09	T	0.29640	-1.0005	9	0.20519	T	0.43	-12.7454	13.3363	0.60520	0.0:0.0:0.1318:0.8682	.	163;403;414;450	B7Z5E5;Q9BPZ7-3;Q9BPZ7-2;Q9BPZ7	.;.;.;SIN1_HUMAN	R	403;414;258;450;450;258;163;222	.	ENSP00000265960:H450R	H	-	2	0	MAPKAP1	127246695	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.409000	0.80053	1.038000	0.40049	0.533000	0.62120	CAC	.	.		0.463	MAPKAP1-009	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000054092.1		
EHMT1	79813	hgsc.bcm.edu	37	9	140669567	140669567	+	Missense_Mutation	SNP	C	C	T			TCGA-2Y-A9GT-01A-11D-A382-10	TCGA-2Y-A9GT-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38c5baf0-5376-42d2-b545-89f5c606b05e	76f29a85-4ade-4630-b69b-5a23a1c16628	g.chr9:140669567C>T	ENST00000460843.1	+	11	1681	c.1654C>T	c.(1654-1656)Cgg>Tgg	p.R552W	EHMT1_ENST00000334856.6_Missense_Mutation_p.R521W|EHMT1_ENST00000371394.2_3'UTR|EHMT1_ENST00000462484.1_Missense_Mutation_p.R552W	NM_024757.4	NP_079033.4	Q9H9B1	EHMT1_HUMAN	euchromatic histone-lysine N-methyltransferase 1	552					chromatin modification (GO:0016568)|DNA methylation (GO:0006306)|embryo development (GO:0009790)|histone methylation (GO:0016571)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|peptidyl-lysine dimethylation (GO:0018027)|peptidyl-lysine monomethylation (GO:0018026)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	histone methyltransferase activity (H3-K27 specific) (GO:0046976)|histone methyltransferase activity (H3-K9 specific) (GO:0046974)|histone-lysine N-methyltransferase activity (GO:0018024)|methyltransferase activity (GO:0008168)|p53 binding (GO:0002039)|protein-lysine N-methyltransferase activity (GO:0016279)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(2)|cervix(2)|endometrium(3)|kidney(2)|large_intestine(4)|lung(16)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	41	all_cancers(76;0.164)			OV - Ovarian serous cystadenocarcinoma(145;0.000183)|Epithelial(140;0.000728)		GCAGTTGGGCCGGTGCACAAA	0.612																																					p.R552W		Atlas-SNP	.											.	EHMT1	196	.	0			c.C1654T						.						131.0	105.0	114.0					9																	140669567		2203	4300	6503	SO:0001583	missense	79813	exon11			TTGGGCCGGTGCA	AY083210	CCDS7050.1, CCDS7050.2, CCDS56595.1	9q34.3	2013-09-20			ENSG00000181090	ENSG00000181090	2.1.1.43	"""Chromatin-modifying enzymes / K-methyltransferases"", ""Ankyrin repeat domain containing"""	24650	protein-coding gene	gene with protein product		607001	"""euchromatic histone methyltransferase 1"""			11347906, 12004135	Standard	NM_024757		Approved	Eu-HMTase1, FLJ12879, KIAA1876, bA188C12.1, KMT1D	uc011mfc.2	Q9H9B1	OTTHUMG00000020995	ENST00000460843.1:c.1654C>T	chr9.hg19:g.140669567C>T	ENSP00000417980:p.Arg552Trp	101.0	0.0		69.0	18.0	NM_001145527	B1AQ58|B1AQ59|Q86X08|Q8TCN7|Q96F53|Q96JF1|Q96KH4	Missense_Mutation	SNP	ENST00000460843.1	hg19	CCDS7050.2	.	.	.	.	.	.	.	.	.	.	C	20.2	3.948844	0.73787	.	.	ENSG00000181090	ENST00000334856;ENST00000371400;ENST00000462484;ENST00000460843	T;T;T	0.71103	1.53;0.76;-0.54	5.34	1.94	0.25998	.	0.099176	0.64402	D	0.000004	D	0.82875	0.5132	M	0.71581	2.175	0.46298	D	0.998972	D;D;D	0.89917	0.998;1.0;1.0	P;D;D	0.73708	0.881;0.957;0.981	D	0.85071	0.0940	10	0.72032	D	0.01	.	18.6479	0.91418	0.1736:0.8264:0.0:0.0	.	552;521;552	Q9H9B1;Q9H9B1-2;Q9H9B1-4	EHMT1_HUMAN;.;.	W	521;521;552;552	ENSP00000334476:R521W;ENSP00000417328:R552W;ENSP00000417980:R552W	ENSP00000334476:R521W	R	+	1	2	EHMT1	139789388	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	1.316000	0.33620	0.207000	0.20607	0.491000	0.48974	CGG	.	.		0.612	EHMT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055371.2	NM_024757	
DIP2C	22982	hgsc.bcm.edu	37	10	468861	468861	+	Silent	SNP	G	G	A	rs145952021		TCGA-2Y-A9GT-01A-11D-A382-10	TCGA-2Y-A9GT-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38c5baf0-5376-42d2-b545-89f5c606b05e	76f29a85-4ade-4630-b69b-5a23a1c16628	g.chr10:468861G>A	ENST00000280886.6	-	5	594	c.507C>T	c.(505-507)caC>caT	p.H169H	DIP2C_ENST00000381496.3_Silent_p.H62H	NM_014974.2	NP_055789.1	Q9Y2E4	DIP2C_HUMAN	DIP2 disco-interacting protein 2 homolog C (Drosophila)	169						nucleus (GO:0005634)	catalytic activity (GO:0003824)			breast(8)|endometrium(6)|kidney(10)|large_intestine(13)|lung(26)|ovary(3)|prostate(6)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(4)	81		all_cancers(4;0.00336)|all_lung(4;0.00732)|Lung NSC(4;0.00785)|all_epithelial(10;0.0159)|Colorectal(49;0.235)	OV - Ovarian serous cystadenocarcinoma(33;0.136)	Epithelial(11;0.0123)|all cancers(11;0.0467)|Lung(33;0.0864)|OV - Ovarian serous cystadenocarcinoma(14;0.106)		TGGTGGAGCCGTGGATGGCCT	0.657																																					p.H169H		Atlas-SNP	.											.	DIP2C	195	.	0			c.C507T						.	G		0,4406		0,0,2203	110.0	112.0	112.0		507	-6.0	0.9	10	dbSNP_134	112	2,8598	2.2+/-6.3	0,2,4298	no	coding-synonymous	DIP2C	NM_014974.2		0,2,6501	AA,AG,GG		0.0233,0.0,0.0154		169/1557	468861	2,13004	2203	4300	6503	SO:0001819	synonymous_variant	22982	exon5			GGAGCCGTGGATG	BC035216	CCDS7054.1	10p15.3	2006-01-13	2006-01-13	2006-01-13	ENSG00000151240	ENSG00000151240			29150	protein-coding gene	gene with protein product		611380	"""KIAA0934"""	KIAA0934			Standard	NM_014974		Approved		uc001ifp.3	Q9Y2E4	OTTHUMG00000017532	ENST00000280886.6:c.507C>T	chr10.hg19:g.468861G>A		101.0	0.0		64.0	19.0	NM_014974	B4DPI5|Q5SS78	Silent	SNP	ENST00000280886.6	hg19	CCDS7054.1																																																																																			.	G|1.000;A|0.000		0.657	DIP2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046389.1	NM_014974	
NEBL	10529	hgsc.bcm.edu	37	10	21178791	21178791	+	Missense_Mutation	SNP	C	C	A	rs369862013		TCGA-2Y-A9GT-01A-11D-A382-10	TCGA-2Y-A9GT-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38c5baf0-5376-42d2-b545-89f5c606b05e	76f29a85-4ade-4630-b69b-5a23a1c16628	g.chr10:21178791C>A	ENST00000377122.4	-	3	637	c.241G>T	c.(241-243)Ggt>Tgt	p.G81C	NEBL_ENST00000377119.1_Missense_Mutation_p.G81C|NEBL_ENST00000417816.2_Intron|NEBL_ENST00000377159.4_Intron	NM_006393.2	NP_006384.1	O76041	NEBL_HUMAN	nebulette	81					cardiac muscle thin filament assembly (GO:0071691)	extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|cytoskeletal protein binding (GO:0008092)|filamin binding (GO:0031005)|structural constituent of muscle (GO:0008307)|tropomyosin binding (GO:0005523)			NS(2)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(14)|lung(22)|ovary(2)|pancreas(1)|prostate(2)|skin(8)|stomach(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	70						ATAAAAGCACCGATATTTTTT	0.318																																					p.G81C		Atlas-SNP	.											.	NEBL	199	.	0			c.G241T						.						91.0	93.0	93.0					10																	21178791		2202	4300	6502	SO:0001583	missense	10529	exon3			AAGCACCGATATT	Y16241	CCDS7133.1, CCDS7134.1	10p12	2014-09-17			ENSG00000078114	ENSG00000078114			16932	protein-coding gene	gene with protein product		605491				9733644, 10470015	Standard	NM_213569		Approved		uc001iqi.3	O76041	OTTHUMG00000017788	ENST00000377122.4:c.241G>T	chr10.hg19:g.21178791C>A	ENSP00000366326:p.Gly81Cys	207.0	0.0		196.0	40.0	NM_006393	B0YJ45|Q2TBD0|Q70I54|Q9UIC4	Missense_Mutation	SNP	ENST00000377122.4	hg19	CCDS7134.1	.	.	.	.	.	.	.	.	.	.	C	15.38	2.816913	0.50633	.	.	ENSG00000078114	ENST00000377122;ENST00000377119;ENST00000434381	T;T;T	0.32515	1.45;1.45;1.45	6.17	4.25	0.50352	.	0.246860	0.41712	D	0.000824	T	0.30603	0.0770	L	0.51422	1.61	0.22866	N	0.998638	P	0.44521	0.837	P	0.45856	0.495	T	0.22068	-1.0227	10	0.72032	D	0.01	.	5.9825	0.19415	0.255:0.5988:0.0:0.1462	.	81	O76041	NEBL_HUMAN	C	81;81;65	ENSP00000366326:G81C;ENSP00000366323:G81C;ENSP00000396512:G65C	ENSP00000366323:G81C	G	-	1	0	NEBL	21218797	0.002000	0.14202	0.596000	0.28811	0.764000	0.43329	0.043000	0.13971	0.851000	0.35264	0.655000	0.94253	GGT	.	.		0.318	NEBL-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000047113.1	NM_006393	
TSPAN4	7106	hgsc.bcm.edu	37	11	850322	850322	+	Silent	SNP	C	C	T			TCGA-2Y-A9GT-01A-11D-A382-10	TCGA-2Y-A9GT-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38c5baf0-5376-42d2-b545-89f5c606b05e	76f29a85-4ade-4630-b69b-5a23a1c16628	g.chr11:850322C>T	ENST00000397404.1	+	3	277	c.18C>T	c.(16-18)ctC>ctT	p.L6L	TSPAN4_ENST00000397396.1_Intron|TSPAN4_ENST00000397411.2_Silent_p.L6L|TSPAN4_ENST00000525201.1_Intron|TSPAN4_ENST00000409543.2_Silent_p.L6L|TSPAN4_ENST00000409531.1_Silent_p.L25L|TSPAN4_ENST00000346501.4_Silent_p.L6L|TSPAN4_ENST00000397406.1_Silent_p.L6L|TSPAN4_ENST00000397408.1_Silent_p.L6L|TSPAN4_ENST00000397397.2_Silent_p.L6L	NM_001025237.1	NP_001020408.1	O14817	TSN4_HUMAN	tetraspanin 4	6					protein complex assembly (GO:0006461)	focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	antigen binding (GO:0003823)|integrin binding (GO:0005178)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)	3		all_cancers(49;2.64e-08)|all_epithelial(84;4.17e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)|all_lung(207;0.24)		all cancers(45;4.32e-25)|Epithelial(43;3.29e-24)|BRCA - Breast invasive adenocarcinoma(625;4.23e-05)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		GCGCCTGCCTCCAGGCCGTCA	0.647																																					p.L6L		Atlas-SNP	.											.	TSPAN4	14	.	0			c.C18T						.						18.0	20.0	19.0					11																	850322		2194	4297	6491	SO:0001819	synonymous_variant	7106	exon3			CTGCCTCCAGGCC	AF022813	CCDS7721.1, CCDS41589.1	11p15.5	2013-02-14	2005-03-21	2005-03-21	ENSG00000214063	ENSG00000214063		"""Tetraspanins"""	11859	protein-coding gene	gene with protein product		602644	"""transmembrane 4 superfamily member 7"""	TM4SF7		9360996	Standard	XM_005253102		Approved	NAG-2, TSPAN-4, TETRASPAN	uc001lsf.1	O14817	OTTHUMG00000133305	ENST00000397404.1:c.18C>T	chr11.hg19:g.850322C>T		66.0	0.0		47.0	9.0	NM_001025235	Q6IAP6	Silent	SNP	ENST00000397404.1	hg19	CCDS7721.1																																																																																			.	.		0.647	TSPAN4-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257102.2		
DCHS1	8642	hgsc.bcm.edu	37	11	6662511	6662511	+	Missense_Mutation	SNP	G	G	A	rs367639691		TCGA-2Y-A9GT-01A-11D-A382-10	TCGA-2Y-A9GT-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38c5baf0-5376-42d2-b545-89f5c606b05e	76f29a85-4ade-4630-b69b-5a23a1c16628	g.chr11:6662511G>A	ENST00000299441.3	-	2	745	c.334C>T	c.(334-336)Cgg>Tgg	p.R112W		NM_003737.2	NP_003728.1	Q96JQ0	PCD16_HUMAN	dachsous cadherin-related 1	112	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|calcium-dependent cell-cell adhesion (GO:0016339)|cochlea development (GO:0090102)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|neural tube development (GO:0021915)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|post-anal tail morphogenesis (GO:0036342)	apical part of cell (GO:0045177)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(16)|liver(1)|lung(41)|ovary(4)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	103		Medulloblastoma(188;0.00263)|all_neural(188;0.026)		Epithelial(150;6.35e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		TAGCGGTCCCGCTGCTCACGG	0.607																																					p.R112W		Atlas-SNP	.											.	DCHS1	277	.	0			c.C334T						.	G	TRP/ARG	1,4401	2.1+/-5.4	0,1,2200	79.0	63.0	68.0		334	4.5	1.0	11		68	0,8592		0,0,4296	no	missense	DCHS1	NM_003737.2	101	0,1,6496	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging	112/3299	6662511	1,12993	2201	4296	6497	SO:0001583	missense	8642	exon2			GGTCCCGCTGCTC	AB000895	CCDS7771.1	11p15.4	2013-10-04	2013-10-04	2004-09-03	ENSG00000166341	ENSG00000166341		"""Cadherins / Cadherin-related"""	13681	protein-coding gene	gene with protein product	"""cadherin-related family member 6"""	603057	"""protocadherin 16"", ""dachsous 1 (Drosophila)"""	CDH25, PCDH16		9199196	Standard	XM_005253207		Approved	FIB1, KIAA1773, FLJ11790, CDHR6	uc001mem.1	Q96JQ0	OTTHUMG00000133398	ENST00000299441.3:c.334C>T	chr11.hg19:g.6662511G>A	ENSP00000299441:p.Arg112Trp	117.0	0.0		84.0	6.0	NM_003737	O15098	Missense_Mutation	SNP	ENST00000299441.3	hg19	CCDS7771.1	.	.	.	.	.	.	.	.	.	.	G	16.91	3.253238	0.59212	2.27E-4	0.0	ENSG00000166341	ENST00000299441	T	0.39056	1.1	5.41	4.48	0.54585	Cadherin (3);Cadherin-like (1);	0.000000	0.42294	D	0.000728	T	0.68915	0.3053	M	0.88979	2.995	0.49915	D	0.999834	D	0.89917	1.0	D	0.80764	0.994	T	0.75682	-0.3233	10	0.66056	D	0.02	.	14.1642	0.65466	0.0:0.0:0.8443:0.1557	.	112	Q96JQ0	PCD16_HUMAN	W	112	ENSP00000299441:R112W	ENSP00000299441:R112W	R	-	1	2	DCHS1	6619087	0.998000	0.40836	1.000000	0.80357	0.996000	0.88848	2.692000	0.47018	1.218000	0.43458	0.643000	0.83706	CGG	.	.		0.607	DCHS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257258.1	NM_003737	
OR4A15	81328	hgsc.bcm.edu	37	11	55135909	55135909	+	Missense_Mutation	SNP	T	T	C			TCGA-2Y-A9GT-01A-11D-A382-10	TCGA-2Y-A9GT-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38c5baf0-5376-42d2-b545-89f5c606b05e	76f29a85-4ade-4630-b69b-5a23a1c16628	g.chr11:55135909T>C	ENST00000314706.3	+	1	550	c.550T>C	c.(550-552)Tca>Cca	p.S184P		NM_001005275.1	NP_001005275.1	Q8NGL6	O4A15_HUMAN	olfactory receptor, family 4, subfamily A, member 15	184						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(2)|breast(2)|endometrium(2)|kidney(2)|large_intestine(7)|lung(48)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	71						CTTTCTTCACTCATTGGTTCA	0.423																																					p.S184P		Atlas-SNP	.											.	OR4A15	161	.	0			c.T550C						.						183.0	166.0	172.0					11																	55135909		2201	4296	6497	SO:0001583	missense	81328	exon1			CTTCACTCATTGG	AB065776	CCDS31500.1	11q11	2012-08-09			ENSG00000181958	ENSG00000181958		"""GPCR / Class A : Olfactory receptors"""	15152	protein-coding gene	gene with protein product							Standard	NM_001005275		Approved		uc010rif.2	Q8NGL6	OTTHUMG00000166711	ENST00000314706.3:c.550T>C	chr11.hg19:g.55135909T>C	ENSP00000325065:p.Ser184Pro	69.0	0.0		73.0	22.0	NM_001005275	Q6IFL4|Q96R65	Missense_Mutation	SNP	ENST00000314706.3	hg19	CCDS31500.1	.	.	.	.	.	.	.	.	.	.	-	13.35	2.210424	0.39003	.	.	ENSG00000181958	ENST00000314706	T	0.46063	0.88	3.48	-1.26	0.09376	GPCR, rhodopsin-like superfamily (1);	0.000000	0.42294	D	0.000729	T	0.53834	0.1821	M	0.70108	2.13	0.09310	N	1	D	0.67145	0.996	D	0.75020	0.985	T	0.48031	-0.9070	10	0.87932	D	0	.	5.9819	0.19411	0.1397:0.0:0.4134:0.4469	.	184	Q8NGL6	O4A15_HUMAN	P	184	ENSP00000325065:S184P	ENSP00000325065:S184P	S	+	1	0	OR4A15	54892485	0.000000	0.05858	0.000000	0.03702	0.635000	0.38103	-0.523000	0.06230	-0.550000	0.06183	0.403000	0.27427	TCA	.	.		0.423	OR4A15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391161.1	NM_001005275	
OR5B17	219965	hgsc.bcm.edu	37	11	58126247	58126247	+	Missense_Mutation	SNP	A	A	G			TCGA-2Y-A9GT-01A-11D-A382-10	TCGA-2Y-A9GT-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38c5baf0-5376-42d2-b545-89f5c606b05e	76f29a85-4ade-4630-b69b-5a23a1c16628	g.chr11:58126247A>G	ENST00000357377.3	-	1	295	c.296T>C	c.(295-297)aTg>aCg	p.M99T		NM_001005489.1	NP_001005489.1	Q8NGF7	OR5BH_HUMAN	olfactory receptor, family 5, subfamily B, member 17	99						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|autonomic_ganglia(1)|endometrium(1)|large_intestine(5)|lung(12)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	30	Esophageal squamous(5;0.0027)	Breast(21;0.0778)				ACAAAAGAACATCTGAGCAGC	0.478																																					p.M99T		Atlas-SNP	.											.	OR5B17	64	.	0			c.T296C						.						101.0	91.0	94.0					11																	58126247		2201	4295	6496	SO:0001583	missense	219965	exon1			AAGAACATCTGAG	AB065849	CCDS31548.1	11q12.1	2012-08-09			ENSG00000197786	ENSG00000197786		"""GPCR / Class A : Olfactory receptors"""	15267	protein-coding gene	gene with protein product				OR5B20P			Standard	NM_001005489		Approved		uc010rke.2	Q8NGF7	OTTHUMG00000167465	ENST00000357377.3:c.296T>C	chr11.hg19:g.58126247A>G	ENSP00000349945:p.Met99Thr	182.0	0.0		136.0	35.0	NM_001005489	Q6IEX1	Missense_Mutation	SNP	ENST00000357377.3	hg19	CCDS31548.1	.	.	.	.	.	.	.	.	.	.	a	9.218	1.032665	0.19590	.	.	ENSG00000197786	ENST00000357377	T	0.00402	7.56	3.6	3.6	0.41247	GPCR, rhodopsin-like superfamily (1);	0.000000	0.44902	U	0.000404	T	0.00412	0.0013	M	0.62016	1.91	0.25300	N	0.989287	B	0.27229	0.172	B	0.24269	0.052	T	0.38866	-0.9641	10	0.66056	D	0.02	-15.3883	11.1791	0.48616	1.0:0.0:0.0:0.0	.	99	Q8NGF7	OR5BH_HUMAN	T	99	ENSP00000349945:M99T	ENSP00000349945:M99T	M	-	2	0	OR5B17	57882823	0.010000	0.17322	1.000000	0.80357	0.367000	0.29736	2.608000	0.46308	1.505000	0.48720	0.378000	0.23410	ATG	.	.		0.478	OR5B17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394708.2	NM_001005489	
GPR152	390212	hgsc.bcm.edu	37	11	67220097	67220097	+	Silent	SNP	C	C	A			TCGA-2Y-A9GT-01A-11D-A382-10	TCGA-2Y-A9GT-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38c5baf0-5376-42d2-b545-89f5c606b05e	76f29a85-4ade-4630-b69b-5a23a1c16628	g.chr11:67220097C>A	ENST00000312457.2	-	1	103	c.99G>T	c.(97-99)acG>acT	p.T33T	CABP4_ENST00000542025.2_3'UTR|CABP4_ENST00000438189.2_De_novo_Start_InFrame|CABP4_ENST00000325656.5_5'Flank	NM_206997.1	NP_996880.1	Q8TDT2	GP152_HUMAN	G protein-coupled receptor 152	33						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(7)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	16			BRCA - Breast invasive adenocarcinoma(15;8.18e-06)			CCAGGAAGACCGTGTCCCAGC	0.652																																					p.T33T	Pancreas(102;800 1581 2723 7382 33622)	Atlas-SNP	.											.	GPR152	41	.	0			c.G99T						.						43.0	44.0	44.0					11																	67220097		2198	4290	6488	SO:0001819	synonymous_variant	390212	exon1			GAAGACCGTGTCC	AY255600	CCDS8165.1	11q13.2	2013-09-20			ENSG00000175514	ENSG00000175514		"""GPCR / Class A : Orphans"""	23622	protein-coding gene	gene with protein product						12679517	Standard	NM_206997		Approved	PGR5	uc001olm.3	Q8TDT2	OTTHUMG00000168032	ENST00000312457.2:c.99G>T	chr11.hg19:g.67220097C>A		326.0	0.0		193.0	55.0	NM_206997	Q0VD88|Q86SM0	Silent	SNP	ENST00000312457.2	hg19	CCDS8165.1																																																																																			.	.		0.652	GPR152-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397623.1		
WNT11	7481	hgsc.bcm.edu	37	11	75907729	75907729	+	Silent	SNP	C	C	T			TCGA-2Y-A9GT-01A-11D-A382-10	TCGA-2Y-A9GT-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38c5baf0-5376-42d2-b545-89f5c606b05e	76f29a85-4ade-4630-b69b-5a23a1c16628	g.chr11:75907729C>T	ENST00000322563.3	-	2	241	c.117G>A	c.(115-117)ctG>ctA	p.L39L	RP11-619A14.2_ENST00000527314.1_RNA	NM_004626.2	NP_004617.2	O96014	WNT11_HUMAN	wingless-type MMTV integration site family, member 11	39					adrenal gland development (GO:0030325)|artery morphogenesis (GO:0048844)|bone mineralization (GO:0030282)|canonical Wnt signaling pathway (GO:0060070)|cell fate commitment (GO:0045165)|cellular response to retinoic acid (GO:0071300)|cloacal septation (GO:0060197)|embryonic skeletal system development (GO:0048706)|lung-associated mesenchyme development (GO:0060484)|mesonephric duct development (GO:0072177)|negative regulation of apoptotic process (GO:0043066)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cartilage development (GO:0061037)|negative regulation of cell death (GO:0060548)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of fibroblast growth factor production (GO:0090272)|negative regulation of mesenchymal cell proliferation (GO:0072201)|negative regulation of transcription, DNA-templated (GO:0045892)|neuroendocrine cell differentiation (GO:0061101)|neuron differentiation (GO:0030182)|non-canonical Wnt signaling pathway (GO:0035567)|osteoblast differentiation (GO:0001649)|outflow tract morphogenesis (GO:0003151)|palate development (GO:0060021)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell migration (GO:0030335)|positive regulation of gene expression (GO:0010628)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein kinase C signaling (GO:0090037)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta2 production (GO:0032915)|protein localization to cell surface (GO:0034394)|protein phosphorylation (GO:0006468)|response to nutrient levels (GO:0031667)|tight junction assembly (GO:0070830)|ureteric bud morphogenesis (GO:0060675)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	frizzled binding (GO:0005109)|protein kinase activator activity (GO:0030295)|Ras GTPase activator activity (GO:0005099)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|large_intestine(5)|lung(6)|ovary(2)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	20						GCGTCTGGTTCAGTGCCAGGG	0.627																																					p.L39L		Atlas-SNP	.											.	WNT11	44	.	0			c.G117A						.						53.0	36.0	42.0					11																	75907729		2200	4292	6492	SO:0001819	synonymous_variant	7481	exon2			CTGGTTCAGTGCC	Y12692	CCDS8242.1	11q13.5	2008-02-05			ENSG00000085741	ENSG00000085741		"""Wingless-type MMTV integration sites"""	12776	protein-coding gene	gene with protein product		603699				9757009	Standard	NM_004626		Approved		uc001oxe.3	O96014	OTTHUMG00000165264	ENST00000322563.3:c.117G>A	chr11.hg19:g.75907729C>T		150.0	0.0		109.0	25.0	NM_004626	B2R8Z6|Q14DE8|Q8WZ98	Silent	SNP	ENST00000322563.3	hg19	CCDS8242.1																																																																																			.	.		0.627	WNT11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383083.1	NM_004626	
ARHGAP32	9743	hgsc.bcm.edu	37	11	128868356	128868356	+	Silent	SNP	T	T	C			TCGA-2Y-A9GT-01A-11D-A382-10	TCGA-2Y-A9GT-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38c5baf0-5376-42d2-b545-89f5c606b05e	76f29a85-4ade-4630-b69b-5a23a1c16628	g.chr11:128868356T>C	ENST00000310343.9	-	11	1010	c.1011A>G	c.(1009-1011)aaA>aaG	p.K337K	ARHGAP32_ENST00000524655.1_Silent_p.K263K|ARHGAP32_ENST00000527272.1_5'Flank|ARHGAP32_ENST00000392657.3_5'UTR	NM_001142685.1	NP_001136157.1	A7KAX9	RHG32_HUMAN	Rho GTPase activating protein 32	337					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell projection (GO:0042995)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|postsynaptic membrane (GO:0045211)	GTPase activator activity (GO:0005096)|phosphatidylinositol binding (GO:0035091)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(12)|lung(28)|ovary(3)|prostate(6)|urinary_tract(3)	60						TGCCGTGCTTTTTAGACACTA	0.388																																					p.K337K		Atlas-SNP	.											.	ARHGAP32	307	.	0			c.A1011G						.						67.0	62.0	63.0					11																	128868356		2201	4297	6498	SO:0001819	synonymous_variant	9743	exon11			GTGCTTTTTAGAC	AB018255	CCDS31718.1, CCDS44769.1	11q24.3	2011-06-29			ENSG00000134909	ENSG00000134909		"""Rho GTPase activating proteins"""	17399	protein-coding gene	gene with protein product		608541				12446789, 12819203, 17663722	Standard	NM_014715		Approved	GRIT, KIAA0712, MGC1892, RICS, GC-GAP	uc009zcp.3	A7KAX9	OTTHUMG00000165774	ENST00000310343.9:c.1011A>G	chr11.hg19:g.128868356T>C		78.0	0.0		59.0	12.0	NM_001142685	I7H0B0|O94820|Q86YL6|Q8IUG4|Q9BWG3	Silent	SNP	ENST00000310343.9	hg19	CCDS44769.1																																																																																			.	.		0.388	ARHGAP32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386151.3	NM_014715	
KCNA5	3741	hgsc.bcm.edu	37	12	5153915	5153915	+	Missense_Mutation	SNP	G	G	C			TCGA-2Y-A9GT-01A-11D-A382-10	TCGA-2Y-A9GT-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38c5baf0-5376-42d2-b545-89f5c606b05e	76f29a85-4ade-4630-b69b-5a23a1c16628	g.chr12:5153915G>C	ENST00000252321.3	+	1	831	c.602G>C	c.(601-603)cGc>cCc	p.R201P		NM_002234.3	NP_002225.2	P22460	KCNA5_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 5	201					atrial cardiac muscle cell action potential (GO:0086014)|membrane hyperpolarization (GO:0060081)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|negative regulation of potassium ion transport (GO:0043267)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|positive regulation of myoblast proliferation (GO:2000288)|potassium ion export (GO:0071435)|potassium ion homeostasis (GO:0055075)|potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|regulation of atrial cardiac muscle cell membrane repolarization (GO:0060372)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of insulin secretion (GO:0050796)|regulation of membrane potential (GO:0042391)|regulation of potassium ion transport (GO:0043266)|regulation of vasoconstriction (GO:0019229)|response to hypoxia (GO:0001666)|synaptic transmission (GO:0007268)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|intercalated disc (GO:0014704)|intracellular canaliculus (GO:0046691)|membrane raft (GO:0045121)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|delayed rectifier potassium channel activity (GO:0005251)|outward rectifier potassium channel activity (GO:0015271)|potassium channel inhibitor activity (GO:0019870)|protein kinase binding (GO:0019901)|scaffold protein binding (GO:0097110)|voltage-gated potassium channel activity involved in atrial cardiac muscle cell action potential repolarization (GO:0086089)			NS(1)|breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|liver(1)|lung(21)|ovary(5)|prostate(2)|upper_aerodigestive_tract(2)	52					Dalfampridine(DB06637)	GACGAGATACGCTTCTACCAG	0.637																																					p.R201P		Atlas-SNP	.											KCNA5,NS,carcinoma,0,1	KCNA5	138	.	0			c.G602C						.						46.0	49.0	48.0					12																	5153915		2203	4300	6503	SO:0001583	missense	3741	exon1			AGATACGCTTCTA	M83254	CCDS8536.1	12p13	2012-07-05				ENSG00000130037		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6224	protein-coding gene	gene with protein product		176267				16382104	Standard	NM_002234		Approved	Kv1.5, HK2, HPCN1	uc001qni.4	P22460		ENST00000252321.3:c.602G>C	chr12.hg19:g.5153915G>C	ENSP00000252321:p.Arg201Pro	98.0	0.0		52.0	16.0	NM_002234	Q4KKT8|Q4VAJ1|Q4VAJ2|Q9UDA4	Missense_Mutation	SNP	ENST00000252321.3	hg19	CCDS8536.1	.	.	.	.	.	.	.	.	.	.	G	19.24	3.790425	0.70337	.	.	ENSG00000130037	ENST00000252321	T	0.77620	-1.11	4.77	4.77	0.60923	BTB/POZ-like (1);BTB/POZ fold (2);Potassium channel, voltage dependent, Kv, tetramerisation (1);	0.000000	0.64402	U	0.000002	D	0.88522	0.6459	M	0.86953	2.85	0.53005	D	0.999961	D	0.58970	0.984	P	0.62382	0.901	D	0.90614	0.4554	10	0.72032	D	0.01	.	16.9696	0.86295	0.0:0.0:1.0:0.0	.	201	P22460	KCNA5_HUMAN	P	201	ENSP00000252321:R201P	ENSP00000252321:R201P	R	+	2	0	KCNA5	5024176	0.177000	0.23109	1.000000	0.80357	0.993000	0.82548	0.851000	0.27751	2.478000	0.83669	0.561000	0.74099	CGC	.	.		0.637	KCNA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398925.2	NM_002234	
KLRC3	3823	hgsc.bcm.edu	37	12	10573090	10573090	+	Missense_Mutation	SNP	C	C	G			TCGA-2Y-A9GT-01A-11D-A382-10	TCGA-2Y-A9GT-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38c5baf0-5376-42d2-b545-89f5c606b05e	76f29a85-4ade-4630-b69b-5a23a1c16628	g.chr12:10573090C>G	ENST00000396439.2	-	1	104	c.60G>C	c.(58-60)caG>caC	p.Q20H	KLRC3_ENST00000381903.2_Missense_Mutation_p.Q20H|NKG2-E_ENST00000539033.1_Intron|KLRC3_ENST00000381904.2_Missense_Mutation_p.Q20H	NM_002261.2	NP_002252.2	Q07444	NKG2E_HUMAN	killer cell lectin-like receptor subfamily C, member 3	20					cellular defense response (GO:0006968)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|transmembrane signaling receptor activity (GO:0004888)			large_intestine(2)|lung(5)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	11						GTTTCCTTTGCTGCCACTTTG	0.428																																					p.Q20H		Atlas-SNP	.											.	KLRC3	25	.	0			c.G60C						.						91.0	88.0	89.0					12																	10573090		2203	4297	6500	SO:0001583	missense	3823	exon1			CCTTTGCTGCCAC	L14542	CCDS31744.1, CCDS41755.1	12p13	2008-08-05			ENSG00000205810	ENSG00000205810		"""Killer cell lectin-like receptors"""	6376	protein-coding gene	gene with protein product		602892				9598306	Standard	NM_002261		Approved	NKG2-E	uc001qyi.1	Q07444	OTTHUMG00000167149	ENST00000396439.2:c.60G>C	chr12.hg19:g.10573090C>G	ENSP00000379716:p.Gln20His	57.0	0.0		70.0	19.0	NM_007333	Q8WXA4|Q96RL0|Q9UP04	Missense_Mutation	SNP	ENST00000396439.2	hg19	CCDS41755.1	.	.	.	.	.	.	.	.	.	.	c	10.72	1.429946	0.25726	.	.	ENSG00000205810	ENST00000396439;ENST00000381904;ENST00000381903	T;T;T	0.06768	3.26;3.26;3.26	2.55	-3.38	0.04883	.	0.975336	0.08397	N	0.952023	T	0.26195	0.0639	M	0.90082	3.085	0.09310	N	1	P;D	0.65815	0.927;0.995	P;D	0.68353	0.681;0.957	T	0.15122	-1.0448	10	0.87932	D	0	.	2.6543	0.05008	0.3645:0.2247:0.0:0.4108	.	20;20	Q07444-2;Q07444	.;NKG2E_HUMAN	H	20	ENSP00000379716:Q20H;ENSP00000371329:Q20H;ENSP00000371328:Q20H	ENSP00000371328:Q20H	Q	-	3	2	KLRC3	10464357	0.000000	0.05858	0.000000	0.03702	0.009000	0.06853	-0.574000	0.05868	-0.946000	0.03677	-0.302000	0.09304	CAG	.	.		0.428	KLRC3-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000393471.1	NM_002261	
ALG10B	144245	hgsc.bcm.edu	37	12	38710750	38710750	+	Missense_Mutation	SNP	G	G	C			TCGA-2Y-A9GT-01A-11D-A382-10	TCGA-2Y-A9GT-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38c5baf0-5376-42d2-b545-89f5c606b05e	76f29a85-4ade-4630-b69b-5a23a1c16628	g.chr12:38710750G>C	ENST00000308742.4	+	1	371	c.55G>C	c.(55-57)Gtg>Ctg	p.V19L	ALG10B_ENST00000551464.1_Missense_Mutation_p.V19L	NM_001013620.3	NP_001013642.1	Q5I7T1	AG10B_HUMAN	ALG10B, alpha-1,2-glucosyltransferase	19					cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transferase activity, transferring hexosyl groups (GO:0016758)			breast(2)|kidney(3)|large_intestine(7)|lung(8)|ovary(4)|skin(1)	25	Esophageal squamous(101;0.187)	Lung NSC(34;0.204)|all_lung(34;0.235)				TACCTTTTTAGTGTCCTGCCT	0.597											OREG0021733	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.V19L		Atlas-SNP	.											.	ALG10B	58	.	0			c.G55C						.						197.0	203.0	201.0					12																	38710750		2203	4300	6503	SO:0001583	missense	144245	exon1			TTTTTAGTGTCCT	AY845858	CCDS31772.1	12q12	2013-03-04	2013-03-04		ENSG00000175548	ENSG00000175548	2.4.1.256		31088	protein-coding gene	gene with protein product	"""potassium channel regulator 1"", ""dolichyl-P-Glc:Glc(2)Man(9)GlcNAc(2)-PP-dolichol alpha-1,2- glucosyltransferase"""		"""asparagine-linked glycosylation 10, alpha-1,2-glucosyltransferase homolog B (yeast)"""				Standard	NM_001013620		Approved	KCR1	uc001rln.4	Q5I7T1	OTTHUMG00000169298	ENST00000308742.4:c.55G>C	chr12.hg19:g.38710750G>C	ENSP00000310120:p.Val19Leu	124.0	0.0	880	92.0	33.0	NM_001013620	B2RPF4	Missense_Mutation	SNP	ENST00000308742.4	hg19	CCDS31772.1	.	.	.	.	.	.	.	.	.	.	g	9.706	1.155724	0.21454	.	.	ENSG00000175548	ENST00000308742;ENST00000551464	T;T	0.42131	1.56;0.98	3.64	2.69	0.31865	.	0.276731	0.34484	N	0.003939	T	0.13243	0.0321	N	0.01789	-0.72	0.26874	N	0.967691	B	0.02656	0.0	B	0.04013	0.001	T	0.31916	-0.9926	10	0.02654	T	1	.	8.5725	0.33578	0.0:0.0:0.7473:0.2527	.	19	Q5I7T1	AG10B_HUMAN	L	19	ENSP00000310120:V19L;ENSP00000448819:V19L	ENSP00000310120:V19L	V	+	1	0	ALG10B	36997017	0.406000	0.25344	0.388000	0.26195	0.771000	0.43674	0.650000	0.24858	1.011000	0.39340	0.655000	0.94253	GTG	.	.		0.597	ALG10B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403349.1	NM_001013620	
GLIPR1L2	144321	hgsc.bcm.edu	37	12	75807475	75807475	+	Missense_Mutation	SNP	C	C	T	rs550463995		TCGA-2Y-A9GT-01A-11D-A382-10	TCGA-2Y-A9GT-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38c5baf0-5376-42d2-b545-89f5c606b05e	76f29a85-4ade-4630-b69b-5a23a1c16628	g.chr12:75807475C>T	ENST00000550916.1	+	3	625	c.578C>T	c.(577-579)gCg>gTg	p.A193V	GLIPR1L2_ENST00000320460.4_Missense_Mutation_p.A193V|GLIPR1L2_ENST00000547164.1_Intron|GLIPR1L2_ENST00000378692.3_Missense_Mutation_p.A86V|GLIPR1L2_ENST00000441218.1_Missense_Mutation_p.A128V|GLIPR1L2_ENST00000435775.1_Intron	NM_001270396.1	NP_001257325.1	Q4G1C9	GRPL2_HUMAN	GLI pathogenesis-related 1 like 2	193						integral component of membrane (GO:0016021)				kidney(1)|large_intestine(3)|lung(8)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	16						TGCAACTATGCGCCAGGGTAA	0.289													C|||	1	0.000199681	0.0	0.0	5008	,	,		11243	0.001		0.0	False		,,,				2504	0.0				p.A193V		Atlas-SNP	.											GLIPR1L2_ENST00000550916,colon,carcinoma,0,2	GLIPR1L2	54	.	0			c.C578T						.						81.0	86.0	84.0					12																	75807475		2202	4295	6497	SO:0001583	missense	144321	exon3			ACTATGCGCCAGG	BC029557	CCDS9010.1, CCDS58258.1	12q21.1	2014-06-03				ENSG00000180481			28592	protein-coding gene	gene with protein product		610394				12477932	Standard	NM_001270396		Approved	MGC39497	uc001sxr.2	Q4G1C9	OTTHUMG00000169756	ENST00000550916.1:c.578C>T	chr12.hg19:g.75807475C>T	ENSP00000448248:p.Ala193Val	120.0	0.0		154.0	48.0	NM_152436	Q6MZS1|Q8N6N0|Q8NA43	Missense_Mutation	SNP	ENST00000550916.1	hg19	CCDS58258.1	.	.	.	.	.	.	.	.	.	.	C	16.90	3.250561	0.59212	.	.	ENSG00000180481	ENST00000550916;ENST00000378692;ENST00000320460;ENST00000441218	T;T;T;T	0.10099	2.91;2.91;2.91;2.91	5.14	3.16	0.36331	CAP domain (2);	0.062202	0.64402	D	0.000005	T	0.12603	0.0306	L	0.49350	1.555	0.31845	N	0.622947	D;D	0.58620	0.983;0.972	B;P	0.48400	0.353;0.576	T	0.07770	-1.0755	10	0.38643	T	0.18	.	6.321	0.21217	0.0:0.5334:0.3665:0.1001	.	193;193	Q4G1C9;Q4G1C9-2	GRPL2_HUMAN;.	V	193;86;193;128	ENSP00000448248:A193V;ENSP00000367963:A86V;ENSP00000317385:A193V;ENSP00000405273:A128V	ENSP00000317385:A193V	A	+	2	0	GLIPR1L2	74093742	0.809000	0.29036	1.000000	0.80357	0.987000	0.75469	0.328000	0.19681	1.376000	0.46267	0.591000	0.81541	GCG	.	.		0.289	GLIPR1L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405718.1	NM_152436	
PTPRQ	374462	hgsc.bcm.edu	37	12	81007565	81007565	+	Missense_Mutation	SNP	G	G	A	rs566874843	byFrequency	TCGA-2Y-A9GT-01A-11D-A382-10	TCGA-2Y-A9GT-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38c5baf0-5376-42d2-b545-89f5c606b05e	76f29a85-4ade-4630-b69b-5a23a1c16628	g.chr12:81007565G>A	ENST00000266688.5	+	34	5101	c.5101G>A	c.(5101-5103)Gtc>Atc	p.V1701I				Q9UMZ3	PTPRQ_HUMAN	protein tyrosine phosphatase, receptor type, Q	1747	Fibronectin type-III 18. {ECO:0000255|PROSITE-ProRule:PRU00316}.				regulation of fat cell differentiation (GO:0045598)	integral component of membrane (GO:0016021)	protein tyrosine phosphatase activity (GO:0004725)			breast(1)|endometrium(7)|kidney(9)|lung(2)|prostate(1)|skin(2)|stomach(2)	24						CAACACATTCGTCATTGCAAT	0.373													G|||	3	0.000599042	0.0	0.0	5008	,	,		15797	0.0		0.0	False		,,,				2504	0.0031				p.V1533I		Atlas-SNP	.											.	PTPRQ	119	.	0			c.G4597A						.						85.0	64.0	70.0					12																	81007565		692	1590	2282	SO:0001583	missense	374462	exon26			ACATTCGTCATTG	AF169351	CCDS73501.1	12q21.31	2013-02-11	2001-12-04		ENSG00000139304	ENSG00000139304		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9679	protein-coding gene	gene with protein product		603317	"""deafness, autosomal recessive 84"""	DFNB84		20346435	Standard	NM_001145026		Approved		uc001sze.2	Q9UMZ3	OTTHUMG00000170171	ENST00000266688.5:c.5101G>A	chr12.hg19:g.81007565G>A	ENSP00000266688:p.Val1701Ile	93.0	0.0		139.0	43.0	NM_001145026		Missense_Mutation	SNP	ENST00000266688.5	hg19		.	.	.	.	.	.	.	.	.	.	G	6.745	0.506360	0.12883	.	.	ENSG00000139304	ENST00000266688	T	0.43688	0.94	6.16	5.25	0.73442	Fibronectin, type III (4);Immunoglobulin-like fold (1);	.	.	.	.	T	0.28863	0.0716	.	.	.	0.33308	D	0.565775	B	0.13594	0.008	B	0.14023	0.01	T	0.34403	-0.9830	8	0.21540	T	0.41	.	9.882	0.41238	0.1607:0.0:0.8393:0.0	.	1747	Q9UMZ3	PTPRQ_HUMAN	I	1701	ENSP00000266688:V1701I	ENSP00000266688:V1701I	V	+	1	0	PTPRQ	79531696	0.673000	0.27539	0.918000	0.36340	0.150000	0.21749	0.864000	0.27926	1.534000	0.49203	0.650000	0.86243	GTC	.	.		0.373	PTPRQ-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_001145026	
CIT	11113	hgsc.bcm.edu	37	12	120213641	120213641	+	Missense_Mutation	SNP	G	G	C			TCGA-2Y-A9GT-01A-11D-A382-10	TCGA-2Y-A9GT-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38c5baf0-5376-42d2-b545-89f5c606b05e	76f29a85-4ade-4630-b69b-5a23a1c16628	g.chr12:120213641G>C	ENST00000261833.7	-	16	1942	c.1890C>G	c.(1888-1890)atC>atG	p.I630M	CIT_ENST00000537607.1_5'UTR|CIT_ENST00000392521.2_Missense_Mutation_p.I630M	NM_007174.2	NP_009105.1	O14578	CTRO_HUMAN	citron rho-interacting serine/threonine kinase	630					cytokinesis (GO:0000910)|dendrite development (GO:0016358)|G2/M transition of mitotic cell cycle (GO:0000086)|generation of neurons (GO:0048699)|Golgi organization (GO:0007030)|intracellular signal transduction (GO:0035556)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic nuclear division (GO:0007067)|mitotic sister chromatid segregation (GO:0000070)|negative regulation of dendrite morphogenesis (GO:0050774)|regulation of actin polymerization or depolymerization (GO:0008064)|spermatogenesis (GO:0007283)	actin cytoskeleton (GO:0015629)|Golgi cisterna (GO:0031985)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|vacuole (GO:0005773)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|PDZ domain binding (GO:0030165)|protein serine/threonine kinase activity (GO:0004674)|small GTPase regulator activity (GO:0005083)			breast(6)|endometrium(9)|kidney(4)|large_intestine(15)|liver(1)|lung(29)|ovary(7)|prostate(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(6)	86	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)	Myeloproliferative disorder(1001;0.0255)		BRCA - Breast invasive adenocarcinoma(302;0.211)		GCTCAGCATTGATCTATAATT	0.418																																					p.I630M		Atlas-SNP	.											.	CIT	535	.	0			c.C1890G						.						59.0	58.0	59.0					12																	120213641		2203	4300	6503	SO:0001583	missense	11113	exon16			AGCATTGATCTAT	AB023166	CCDS9192.1, CCDS55891.1	12q24.23	2014-04-23	2014-04-23		ENSG00000122966	ENSG00000122966			1985	protein-coding gene	gene with protein product	"""serine/threonine kinase 21"""	605629	"""citron (rho-interacting, serine/threonine kinase 21)"""			9792683	Standard	NM_001206999		Approved	KIAA0949, STK21, CRIK	uc001txj.2	O14578	OTTHUMG00000134325	ENST00000261833.7:c.1890C>G	chr12.hg19:g.120213641G>C	ENSP00000261833:p.Ile630Met	95.0	0.0		81.0	25.0	NM_001206999	Q2M5E1|Q6XUH8|Q86UQ9|Q9UPZ7	Missense_Mutation	SNP	ENST00000261833.7	hg19	CCDS9192.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	14.97|14.97	2.695389|2.695389	0.48202|0.48202	.|.	.|.	ENSG00000122966|ENSG00000122966	ENST00000392521;ENST00000261833|ENST00000392520	T;T|.	0.78364|.	-1.17;-0.08|.	5.96|5.96	3.99|3.99	0.46301|0.46301	.|.	0.275955|.	0.36268|.	N|.	0.002689|.	T|.	0.45316|.	0.1336|.	N|N	0.08118|0.08118	0|0	0.80722|0.80722	D|D	1|1	B;B;B|.	0.27791|.	0.087;0.087;0.189|.	B;B;B|.	0.25614|.	0.062;0.062;0.06|.	T|.	0.40156|.	-0.9578|.	10|.	0.36615|.	T|.	0.2|.	.|.	18.2029|18.2029	0.89844|0.89844	0.0:0.2399:0.7601:0.0|0.0:0.2399:0.7601:0.0	.|.	630;630;163|.	Q2M5E1;O14578;O14578-3|.	.;CTRO_HUMAN;.|.	M|X	630|258	ENSP00000376306:I630M;ENSP00000261833:I630M|.	ENSP00000261833:I630M|.	I|S	-|-	3|2	3|0	CIT|CIT	118698024|118698024	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.990000|0.990000	0.78478|0.78478	1.463000|1.463000	0.35277|0.35277	1.477000|1.477000	0.48234|0.48234	0.655000|0.655000	0.94253|0.94253	ATC|TCA	.	.		0.418	CIT-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000259410.4	NM_007174	
RIMBP2	23504	hgsc.bcm.edu	37	12	130926753	130926753	+	Missense_Mutation	SNP	G	G	T			TCGA-2Y-A9GT-01A-11D-A382-10	TCGA-2Y-A9GT-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38c5baf0-5376-42d2-b545-89f5c606b05e	76f29a85-4ade-4630-b69b-5a23a1c16628	g.chr12:130926753G>T	ENST00000261655.4	-	8	1256	c.1093C>A	c.(1093-1095)Cgc>Agc	p.R365S	RIMBP2_ENST00000536002.1_Missense_Mutation_p.R273S|RIMBP2_ENST00000535703.1_Missense_Mutation_p.R273S	NM_015347.4	NP_056162.4	O15034	RIMB2_HUMAN	RIMS binding protein 2	365	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				negative regulation of phosphatase activity (GO:0010923)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|synapse (GO:0045202)		p.R365S(1)		NS(2)|breast(1)|central_nervous_system(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(33)|ovary(3)|pancreas(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(5)|urinary_tract(1)	96	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.213)		OV - Ovarian serous cystadenocarcinoma(86;4.29e-06)|all cancers(50;4.56e-05)|Epithelial(86;5.41e-05)		ACGGAGATGCGGTAGGTGCAG	0.627																																					p.R365S		Atlas-SNP	.											RIMBP2,NS,carcinoma,0,1	RIMBP2	220	.	1	Substitution - Missense(1)	lung(1)	c.C1093A						.						158.0	151.0	153.0					12																	130926753		2203	4300	6503	SO:0001583	missense	23504	exon8			AGATGCGGTAGGT	AB002316	CCDS31925.1	12q24.33	2014-06-13				ENSG00000060709			30339	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 133"""	611602				10748113	Standard	NM_015347		Approved	KIAA0318, RBP2, MGC15831, RIM-BP2, PPP1R133	uc001uil.2	O15034		ENST00000261655.4:c.1093C>A	chr12.hg19:g.130926753G>T	ENSP00000261655:p.Arg365Ser	120.0	0.0		99.0	31.0	NM_015347	Q96ID2	Missense_Mutation	SNP	ENST00000261655.4	hg19	CCDS31925.1	.	.	.	.	.	.	.	.	.	.	g	23.4	4.415541	0.83449	.	.	ENSG00000060709	ENST00000261655;ENST00000392375;ENST00000535703;ENST00000536002	T;T;T	0.52754	0.65;0.65;0.65	4.09	4.09	0.47781	Fibronectin, type III (3);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.70587	0.3241	M	0.85859	2.78	0.80722	D	1	D;D;D	0.69078	0.997;0.983;0.997	P;D;D	0.76071	0.866;0.921;0.987	T	0.73814	-0.3864	10	0.34782	T	0.22	-31.2126	16.3122	0.82883	0.0:0.0:1.0:0.0	.	273;273;365	C9JWN3;O15034-2;O15034	.;.;RIMB2_HUMAN	S	365;273;273;273	ENSP00000261655:R365S;ENSP00000440347:R273S;ENSP00000439159:R273S	ENSP00000261655:R365S	R	-	1	0	RIMBP2	129492706	1.000000	0.71417	1.000000	0.80357	0.901000	0.52897	5.581000	0.67471	1.795000	0.52594	0.431000	0.28591	CGC	.	.		0.627	RIMBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399520.1	NM_015347	
AKAP11	11215	hgsc.bcm.edu	37	13	42873655	42873655	+	Missense_Mutation	SNP	A	A	G			TCGA-2Y-A9GT-01A-11D-A382-10	TCGA-2Y-A9GT-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38c5baf0-5376-42d2-b545-89f5c606b05e	76f29a85-4ade-4630-b69b-5a23a1c16628	g.chr13:42873655A>G	ENST00000025301.2	+	8	948	c.773A>G	c.(772-774)cAt>cGt	p.H258R		NM_016248.3	NP_057332.1	Q9UKA4	AKA11_HUMAN	A kinase (PRKA) anchor protein 11	258	Ser-rich.				intracellular signal transduction (GO:0035556)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	protein kinase A binding (GO:0051018)|protein phosphatase 1 binding (GO:0008157)			breast(3)|central_nervous_system(4)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(10)|liver(1)|lung(22)|ovary(1)|skin(3)|stomach(2)	56		Lung NSC(96;1.86e-05)|Prostate(109;0.0165)|Lung SC(185;0.0262)|Breast(139;0.0707)|Hepatocellular(98;0.114)		OV - Ovarian serous cystadenocarcinoma(117;0.000365)|GBM - Glioblastoma multiforme(144;0.00116)|BRCA - Breast invasive adenocarcinoma(63;0.19)		GTCCTGGGACATAAAGAACTA	0.398																																					p.H258R		Atlas-SNP	.											.	AKAP11	146	.	0			c.A773G						.						103.0	98.0	99.0					13																	42873655		2203	4300	6503	SO:0001583	missense	11215	exon8			TGGGACATAAAGA	AB014529	CCDS9383.1	13q	2012-04-17			ENSG00000023516	ENSG00000023516		"""A-kinase anchor proteins"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	369	protein-coding gene	gene with protein product	"""AKAP 220"", ""A-kinase anchoring protein, 220kDa"", ""protein kinase A anchoring protein 11"", ""protein phosphatase 1, regulatory subunit 44"""	604696				9734811, 8621616	Standard	NM_016248		Approved	KIAA0629, AKAP220, PRKA11, FLJ11304, DKFZp781I12161, PPP1R44	uc001uys.2	Q9UKA4	OTTHUMG00000016805	ENST00000025301.2:c.773A>G	chr13.hg19:g.42873655A>G	ENSP00000025301:p.His258Arg	147.0	0.0		169.0	49.0	NM_016248	O75124|Q9NUK7	Missense_Mutation	SNP	ENST00000025301.2	hg19	CCDS9383.1	.	.	.	.	.	.	.	.	.	.	A	0.004	-2.305891	0.00240	.	.	ENSG00000023516	ENST00000025301	T	0.44083	0.93	5.43	-0.549	0.11829	.	0.930262	0.09166	N	0.839504	T	0.19406	0.0466	N	0.13043	0.29	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.24764	-1.0151	10	0.15952	T	0.53	.	2.4728	0.04568	0.579:0.0899:0.1468:0.1843	.	258	Q9UKA4	AKA11_HUMAN	R	258	ENSP00000025301:H258R	ENSP00000025301:H258R	H	+	2	0	AKAP11	41771655	0.035000	0.19736	0.799000	0.32177	0.032000	0.12392	0.327000	0.19663	-0.089000	0.12484	-1.256000	0.01477	CAT	.	.		0.398	AKAP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044700.2	NM_016248	
NPAS3	64067	hgsc.bcm.edu	37	14	34145492	34145492	+	Missense_Mutation	SNP	A	A	C			TCGA-2Y-A9GT-01A-11D-A382-10	TCGA-2Y-A9GT-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38c5baf0-5376-42d2-b545-89f5c606b05e	76f29a85-4ade-4630-b69b-5a23a1c16628	g.chr14:34145492A>C	ENST00000356141.4	+	6	634	c.634A>C	c.(634-636)Atg>Ctg	p.M212L	NPAS3_ENST00000551492.1_Missense_Mutation_p.M217L|NPAS3_ENST00000551008.1_Missense_Mutation_p.M110L|NPAS3_ENST00000548645.1_Missense_Mutation_p.M182L|NPAS3_ENST00000357798.5_Missense_Mutation_p.M199L|NPAS3_ENST00000341321.4_Missense_Mutation_p.M212L|NPAS3_ENST00000346562.2_Missense_Mutation_p.M180L|NPAS3_ENST00000547068.1_Missense_Mutation_p.M108L			Q8IXF0	NPAS3_HUMAN	neuronal PAS domain protein 3	212	PAS 1. {ECO:0000255|PROSITE- ProRule:PRU00140}.				locomotory behavior (GO:0007626)|maternal behavior (GO:0042711)|positive regulation of transcription, DNA-templated (GO:0045893)|startle response (GO:0001964)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|signal transducer activity (GO:0004871)			breast(4)|endometrium(3)|kidney(1)|large_intestine(6)|liver(2)|lung(14)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	40	Breast(36;0.0102)|Hepatocellular(127;0.133)		LUAD - Lung adenocarcinoma(48;0.00169)|Lung(238;0.00968)	GBM - Glioblastoma multiforme(1;1.31e-09)|all cancers(1;0.000112)|OV - Ovarian serous cystadenocarcinoma(311;0.115)		GCAGCTGGGCATGAAGCTCCC	0.632																																					p.M212L		Atlas-SNP	.											.	NPAS3	266	.	0			c.A634C						.						73.0	72.0	73.0					14																	34145492		2203	4300	6503	SO:0001583	missense	64067	exon6			CTGGGCATGAAGC	AF164438	CCDS9645.1, CCDS53891.1, CCDS53892.1, CCDS55912.1	14q13.1	2013-08-23			ENSG00000151322	ENSG00000151322		"""Basic helix-loop-helix proteins"""	19311	protein-coding gene	gene with protein product		609430					Standard	NM_022123		Approved	MOP6, PASD6, bHLHe12	uc001wru.3	Q8IXF0	OTTHUMG00000140215	ENST00000356141.4:c.634A>C	chr14.hg19:g.34145492A>C	ENSP00000348460:p.Met212Leu	69.0	0.0		58.0	18.0	NM_001164749	Q86US6|Q86US7|Q8IXF2|Q9BY81|Q9H323|Q9Y4L8	Missense_Mutation	SNP	ENST00000356141.4	hg19	CCDS53891.1	.	.	.	.	.	.	.	.	.	.	A	3.275	-0.148321	0.06627	.	.	ENSG00000151322	ENST00000551634;ENST00000551492;ENST00000346562;ENST00000341321;ENST00000548645;ENST00000356141;ENST00000357798;ENST00000547068;ENST00000551008	T;T;T;T;T;T;T	0.40225	2.24;2.24;2.24;1.04;2.24;2.24;2.24	5.62	5.62	0.85841	PAS (2);PAS fold (1);	0.000000	0.85682	D	0.000000	T	0.13243	0.0321	N	0.00408	-1.53	0.80722	D	1	B;B;B;B;B	0.18310	0.002;0.022;0.027;0.022;0.022	B;B;B;B;B	0.21151	0.007;0.02;0.033;0.02;0.02	T	0.35025	-0.9805	10	0.02654	T	1	.	15.8164	0.78604	1.0:0.0:0.0:0.0	.	110;182;212;180;199	F8W0C2;Q8IXF0-2;Q8IXF0;Q8IXF0-4;Q8IXF0-3	.;.;NPAS3_HUMAN;.;.	L	189;217;180;212;182;212;199;108;110	ENSP00000448373:M189L;ENSP00000450392:M217L;ENSP00000319610:M180L;ENSP00000344158:M212L;ENSP00000448916:M182L;ENSP00000348460:M212L;ENSP00000350446:M199L	ENSP00000344158:M212L	M	+	1	0	NPAS3	33215243	1.000000	0.71417	1.000000	0.80357	0.936000	0.57629	7.487000	0.81328	2.141000	0.66446	0.459000	0.35465	ATG	.	.		0.632	NPAS3-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000276645.1		
DNAAF2	55172	hgsc.bcm.edu	37	14	50092384	50092384	+	Missense_Mutation	SNP	T	T	C			TCGA-2Y-A9GT-01A-11D-A382-10	TCGA-2Y-A9GT-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38c5baf0-5376-42d2-b545-89f5c606b05e	76f29a85-4ade-4630-b69b-5a23a1c16628	g.chr14:50092384T>C	ENST00000298292.8	-	3	2470	c.2390A>G	c.(2389-2391)aAt>aGt	p.N797S	RP11-649E7.5_ENST00000555043.1_RNA|DNAAF2_ENST00000406043.3_Missense_Mutation_p.N749S	NM_018139.2	NP_060609.2	Q9NVR5	KTU_HUMAN	dynein, axonemal, assembly factor 2	797					axonemal dynein complex assembly (GO:0070286)|bacterial-type flagellum-dependent cell motility (GO:0071973)|cilium-dependent cell motility (GO:0060285)|response to retinoic acid (GO:0032526)	cytoplasm (GO:0005737)				kidney(1)|lung(4)	5						TCCAGGTATATTGTGAACCGT	0.358																																					p.N797S		Atlas-SNP	.											.	DNAAF2	47	.	0			c.A2390G						.						192.0	176.0	182.0					14																	50092384		2203	4300	6503	SO:0001583	missense	55172	exon3			GGTATATTGTGAA	AK001425	CCDS9691.2, CCDS45100.1	14q21.3	2012-05-03	2011-06-09	2011-06-09	ENSG00000165506	ENSG00000165506			20188	protein-coding gene	gene with protein product	"""kintoun"""	612517	"""chromosome 14 open reading frame 104"""	C14orf104			Standard	NM_001083908		Approved	FLJ10563, KTU, PF13, CILD10	uc001wws.4	Q9NVR5	OTTHUMG00000152331	ENST00000298292.8:c.2390A>G	chr14.hg19:g.50092384T>C	ENSP00000298292:p.Asn797Ser	153.0	0.0		108.0	23.0	NM_018139	B9WS54|C0JAP7|Q86TR1|Q86TY8|Q969Z5	Missense_Mutation	SNP	ENST00000298292.8	hg19	CCDS9691.2	.	.	.	.	.	.	.	.	.	.	T	6.121	0.390592	0.11581	.	.	ENSG00000165506	ENST00000298292;ENST00000406043	T;T	0.15139	2.45;2.45	5.17	-1.41	0.08941	.	0.960570	0.08691	N	0.908019	T	0.10508	0.0257	N	0.17474	0.49	0.09310	N	1	B;B	0.16603	0.018;0.01	B;B	0.14578	0.011;0.005	T	0.35871	-0.9771	10	0.34782	T	0.22	.	10.709	0.45971	0.0:0.4501:0.0:0.5499	.	749;797	Q9NVR5-2;Q9NVR5	.;KTU_HUMAN	S	797;749	ENSP00000298292:N797S;ENSP00000384862:N749S	ENSP00000298292:N797S	N	-	2	0	DNAAF2	49162134	0.000000	0.05858	0.001000	0.08648	0.272000	0.26649	0.238000	0.18004	-0.302000	0.08869	-0.388000	0.06559	AAT	.	.		0.358	DNAAF2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000276813.1		
DDX24	57062	hgsc.bcm.edu	37	14	94545834	94545834	+	Silent	SNP	C	C	T			TCGA-2Y-A9GT-01A-11D-A382-10	TCGA-2Y-A9GT-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38c5baf0-5376-42d2-b545-89f5c606b05e	76f29a85-4ade-4630-b69b-5a23a1c16628	g.chr14:94545834C>T	ENST00000330836.5	-	2	386	c.255G>A	c.(253-255)gaG>gaA	p.E85E	IFI27L1_ENST00000557066.1_5'Flank|IFI27L1_ENST00000553664.1_5'Flank|IFI27L1_ENST00000556381.1_5'Flank|DDX24_ENST00000544005.1_Intron|IFI27L1_ENST00000393115.3_5'Flank|IFI27L1_ENST00000557218.1_5'Flank|DDX24_ENST00000555054.1_Silent_p.E42E|IFI27L1_ENST00000554544.1_5'Flank|IFI27L1_ENST00000555523.1_5'Flank	NM_020414.3	NP_065147.1	Q9GZR7	DDX24_HUMAN	DEAD (Asp-Glu-Ala-Asp) box helicase 24	85	Poly-Glu.				RNA metabolic process (GO:0016070)	membrane (GO:0016020)|nucleolus (GO:0005730)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)|RNA helicase activity (GO:0003724)			cervix(3)|endometrium(4)|kidney(4)|large_intestine(5)|lung(3)|ovary(2)|skin(1)|urinary_tract(1)	23		all_cancers(154;0.12)		Epithelial(152;0.114)|all cancers(159;0.19)|COAD - Colon adenocarcinoma(157;0.207)		CCTCCTCCTCCTCTTCTTCTG	0.438																																					p.E85E		Atlas-SNP	.											.	DDX24	82	.	0			c.G255A						.						165.0	161.0	163.0					14																	94545834		2203	4300	6503	SO:0001819	synonymous_variant	57062	exon2			CTCCTCCTCTTCT	AF214731	CCDS9918.1	14q32	2013-07-16	2013-07-16			ENSG00000089737		"""DEAD-boxes"""	13266	protein-coding gene	gene with protein product		606181	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 24"", ""DEAD (Asp-Glu-Ala-Asp) box polypeptide 24"""			10936056, 18289627	Standard	NM_020414		Approved		uc001ycj.3	Q9GZR7		ENST00000330836.5:c.255G>A	chr14.hg19:g.94545834C>T		80.0	0.0		92.0	6.0	NM_020414	E7EMJ4|Q4V9L5	Silent	SNP	ENST00000330836.5	hg19	CCDS9918.1																																																																																			.	.		0.438	DDX24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412861.1	NM_020414	
PLCB2	5330	hgsc.bcm.edu	37	15	40588548	40588548	+	Silent	SNP	G	G	A			TCGA-2Y-A9GT-01A-11D-A382-10	TCGA-2Y-A9GT-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38c5baf0-5376-42d2-b545-89f5c606b05e	76f29a85-4ade-4630-b69b-5a23a1c16628	g.chr15:40588548G>A	ENST00000260402.3	-	16	1894	c.1645C>T	c.(1645-1647)Cta>Tta	p.L549L	PLCB2_ENST00000557821.1_Silent_p.L545L|PLCB2_ENST00000456256.2_Silent_p.L549L	NM_001284297.1|NM_004573.2	NP_001271226.1|NP_004564.2	Q00722	PLCB2_HUMAN	phospholipase C, beta 2	549	PI-PLC Y-box. {ECO:0000255|PROSITE- ProRule:PRU00271}.				activation of phospholipase C activity (GO:0007202)|inositol phosphate metabolic process (GO:0043647)|intracellular signal transduction (GO:0035556)|lipid catabolic process (GO:0016042)|phospholipid metabolic process (GO:0006644)|sensory perception of bitter taste (GO:0050913)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)	calcium ion binding (GO:0005509)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|signal transducer activity (GO:0004871)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(13)|ovary(4)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(3)	39		all_cancers(109;9.35e-19)|all_epithelial(112;1.18e-15)|Lung NSC(122;2.45e-11)|all_lung(180;6.47e-10)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;9.38e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0508)		TAATTGACTAGGCTGGACATC	0.537																																					p.L549L		Atlas-SNP	.											.	PLCB2	177	.	0			c.C1645T						.						64.0	65.0	65.0					15																	40588548		1977	4163	6140	SO:0001819	synonymous_variant	5330	exon16			TGACTAGGCTGGA		CCDS42020.1, CCDS61591.1, CCDS61592.1, CCDS73704.1	15q15.1	2012-01-23			ENSG00000137841	ENSG00000137841	3.1.4.11		9055	protein-coding gene	gene with protein product		604114				1644792, 9925923	Standard	XM_005254448		Approved	FLJ38135	uc001zld.3	Q00722	OTTHUMG00000172412	ENST00000260402.3:c.1645C>T	chr15.hg19:g.40588548G>A		131.0	0.0		72.0	17.0	NM_004573	A8K6J2|B9EGH5	Silent	SNP	ENST00000260402.3	hg19	CCDS42020.1																																																																																			.	.		0.537	PLCB2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000418430.1		
TSPAN3	10099	hgsc.bcm.edu	37	15	77345132	77345132	+	Missense_Mutation	SNP	T	T	C			TCGA-2Y-A9GT-01A-11D-A382-10	TCGA-2Y-A9GT-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38c5baf0-5376-42d2-b545-89f5c606b05e	76f29a85-4ade-4630-b69b-5a23a1c16628	g.chr15:77345132T>C	ENST00000267970.4	-	5	845	c.572A>G	c.(571-573)gAc>gGc	p.D191G	TSPAN3_ENST00000424443.3_Missense_Mutation_p.D127G|TSPAN3_ENST00000558745.1_5'UTR|TSPAN3_ENST00000561277.1_5'UTR|TSPAN3_ENST00000559494.1_Missense_Mutation_p.D102G|TSPAN3_ENST00000346495.2_Missense_Mutation_p.D166G|TSPAN3_ENST00000558394.1_5'Flank	NM_001168412.1|NM_005724.5|NM_198902.2	NP_001161884.1|NP_005715.1|NP_944492.1	O60637	TSN3_HUMAN	tetraspanin 3	191						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				kidney(1)|large_intestine(2)|lung(6)|urinary_tract(1)	10				all cancers(203;1.14e-19)		AGCATAGAGGTCGGAAGGGTG	0.478																																					p.D191G		Atlas-SNP	.											.	TSPAN3	21	.	0			c.A572G						.						99.0	79.0	85.0					15																	77345132		2196	4294	6490	SO:0001583	missense	10099	exon5			TAGAGGTCGGAAG		CCDS10292.1, CCDS10293.1, CCDS53963.1	15q23	2013-02-14	2005-03-21	2005-03-21	ENSG00000140391	ENSG00000140391		"""Tetraspanins"""	17752	protein-coding gene	gene with protein product		613134	"""transmembrane 4 superfamily member 8"""	TM4SF8			Standard	NM_005724		Approved	TM4-A, TSPAN-3	uc002bcj.3	O60637	OTTHUMG00000143728	ENST00000267970.4:c.572A>G	chr15.hg19:g.77345132T>C	ENSP00000267970:p.Asp191Gly	174.0	0.0		133.0	6.0	NM_005724	A6NEH4|B3KQQ2|B4DP19|Q9BW22|Q9NVX9	Missense_Mutation	SNP	ENST00000267970.4	hg19	CCDS10292.1	.	.	.	.	.	.	.	.	.	.	T	17.77	3.470899	0.63625	.	.	ENSG00000140391	ENST00000267970;ENST00000424443;ENST00000423920;ENST00000346495	T;T;T	0.78924	-1.22;-1.22;-1.22	6.16	6.16	0.99307	Tetraspanin, EC2 domain (1);	0.177290	0.64402	D	0.000017	T	0.81083	0.4749	M	0.62723	1.935	0.80722	D	1	P;B;B;B	0.49559	0.925;0.367;0.018;0.018	P;B;B;B	0.49922	0.626;0.253;0.026;0.043	T	0.78411	-0.2214	10	0.25106	T	0.35	.	16.8061	0.85666	0.0:0.0:0.0:1.0	.	127;153;166;191	B4DP19;B4DEK8;A6NEH4;O60637	.;.;.;TSN3_HUMAN	G	191;127;153;166	ENSP00000267970:D191G;ENSP00000407243:D127G;ENSP00000341329:D166G	ENSP00000267970:D191G	D	-	2	0	TSPAN3	75132187	1.000000	0.71417	0.954000	0.39281	0.838000	0.47535	6.285000	0.72658	2.367000	0.80283	0.528000	0.53228	GAC	.	.		0.478	TSPAN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000289792.3	NM_005724	
HMG20A	10363	hgsc.bcm.edu	37	15	77750751	77750751	+	Start_Codon_SNP	SNP	T	T	G			TCGA-2Y-A9GT-01A-11D-A382-10	TCGA-2Y-A9GT-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38c5baf0-5376-42d2-b545-89f5c606b05e	76f29a85-4ade-4630-b69b-5a23a1c16628	g.chr15:77750751T>G	ENST00000381714.3	+	3	430	c.2T>G	c.(1-3)aTg>aGg	p.M1R	HMG20A_ENST00000336216.4_Start_Codon_SNP_p.M1R	NM_018200.2	NP_060670.1	Q9NP66	HM20A_HUMAN	high mobility group 20A	1					chromatin modification (GO:0016568)|chromatin organization (GO:0006325)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(4)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	18						TTCAGAGAGATGGAAAACTTG	0.403																																					p.M1R		Atlas-SNP	.											.	HMG20A	48	.	0			c.T2G						.						77.0	76.0	77.0					15																	77750751		2196	4294	6490	SO:0001582	initiator_codon_variant	10363	exon3			GAGAGATGGAAAA	AF146222	CCDS10295.1	15q24	2011-07-01	2011-04-05		ENSG00000140382	ENSG00000140382		"""High mobility group / Non-canonical"""	5001	protein-coding gene	gene with protein product	"""HMG box domain containing 1"""	605534	"""high-mobility group 20A"""			10773667	Standard	NM_018200		Approved	HMGX1, FLJ10739, HMGXB1	uc002bcr.3	Q9NP66	OTTHUMG00000143729	ENST00000381714.3:c.2T>G	chr15.hg19:g.77750751T>G	ENSP00000371133:p.Met1Arg	44.0	0.0		30.0	7.0	NM_018200	A6NHY3|D3DW78|Q53G31|Q9NSF6	Missense_Mutation	SNP	ENST00000381714.3	hg19	CCDS10295.1	.	.	.	.	.	.	.	.	.	.	T	11.52	1.663200	0.29515	.	.	ENSG00000140382	ENST00000336216;ENST00000381714	T;T	0.70164	-0.46;-0.46	5.86	4.73	0.59995	.	0.000000	0.85682	D	0.000000	T	0.57829	0.2080	.	.	.	0.28877	N	0.894648	B;B	0.14805	0.0;0.011	B;B	0.14578	0.0;0.011	T	0.57382	-0.7821	9	0.87932	D	0	-19.3831	11.7031	0.51581	0.0:0.0:0.148:0.852	.	1;1	Q9NP66;Q9NP66-2	HM20A_HUMAN;.	R	1	ENSP00000336856:M1R;ENSP00000371133:M1R	ENSP00000336856:M1R	M	+	2	0	HMG20A	75537806	1.000000	0.71417	0.999000	0.59377	0.800000	0.45204	4.844000	0.62846	1.028000	0.39785	0.460000	0.39030	ATG	.	.		0.403	HMG20A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419512.2	NM_018200	Missense_Mutation
TM6SF1	53346	hgsc.bcm.edu	37	15	83781634	83781634	+	Silent	SNP	C	C	A	rs371581703		TCGA-2Y-A9GT-01A-11D-A382-10	TCGA-2Y-A9GT-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38c5baf0-5376-42d2-b545-89f5c606b05e	76f29a85-4ade-4630-b69b-5a23a1c16628	g.chr15:83781634C>A	ENST00000322019.9	+	2	452	c.178C>A	c.(178-180)Cgg>Agg	p.R60R	TM6SF1_ENST00000379386.4_Silent_p.R60R|TM6SF1_ENST00000564988.1_3'UTR|RP11-382A20.2_ENST00000565513.1_RNA|TM6SF1_ENST00000379390.6_Silent_p.R60R|TM6SF1_ENST00000565774.1_Silent_p.R60R			Q9BZW5	TM6S1_HUMAN	transmembrane 6 superfamily member 1	60						integral component of membrane (GO:0016021)				endometrium(1)|kidney(3)|large_intestine(3)|lung(4)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	15						AAAACCACCCCGGGACCCACT	0.478																																					p.R60R		Atlas-SNP	.											.	TM6SF1	38	.	0			c.C178A						.						131.0	118.0	122.0					15																	83781634		2203	4300	6503	SO:0001819	synonymous_variant	53346	exon2			CCACCCCGGGACC	AF255922	CCDS10323.1, CCDS45338.1	15q24-q26	2003-04-04			ENSG00000136404	ENSG00000136404			11860	protein-coding gene	gene with protein product		606562				11124529	Standard	NM_001144903		Approved		uc002bjp.3	Q9BZW5	OTTHUMG00000147365	ENST00000322019.9:c.178C>A	chr15.hg19:g.83781634C>A		190.0	0.0		113.0	26.0	NM_001144903	A8K7T5|H3BU56|Q4U0U5	Silent	SNP	ENST00000322019.9	hg19	CCDS10323.1																																																																																			.	.		0.478	TM6SF1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000304009.1	NM_023003	
AGBL1	123624	hgsc.bcm.edu	37	15	86800184	86800184	+	Missense_Mutation	SNP	G	G	T			TCGA-2Y-A9GT-01A-11D-A382-10	TCGA-2Y-A9GT-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38c5baf0-5376-42d2-b545-89f5c606b05e	76f29a85-4ade-4630-b69b-5a23a1c16628	g.chr15:86800184G>T	ENST00000441037.2	+	7	793	c.698G>T	c.(697-699)aGc>aTc	p.S233I	AGBL1_ENST00000421325.2_Missense_Mutation_p.S233I	NM_152336.2	NP_689549.2	Q96MI9	CBPC4_HUMAN	ATP/GTP binding protein-like 1	233					C-terminal protein deglutamylation (GO:0035609)|protein side chain deglutamylation (GO:0035610)	cytoplasm (GO:0005737)	metallocarboxypeptidase activity (GO:0004181)|tubulin binding (GO:0015631)|zinc ion binding (GO:0008270)			NS(3)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|liver(2)|lung(28)|ovary(2)|prostate(4)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	62						GTCACAGCCAGCAGTGCCTAT	0.522																																					p.S233I		Atlas-SNP	.											.	AGBL1	151	.	0			c.G698T						.						86.0	87.0	87.0					15																	86800184		2061	4202	6263	SO:0001583	missense	123624	exon7			CAGCCAGCAGTGC	AK056872	CCDS58398.1	15q25.3	2014-06-23			ENSG00000166748	ENSG00000166748			26504	protein-coding gene	gene with protein product	"""cytosolic carboxypeptidase 4"""	615496				21074048, 24094747	Standard	NM_152336		Approved	FLJ32310, CCP4	uc002blz.1	Q96MI9	OTTHUMG00000149978	ENST00000441037.2:c.698G>T	chr15.hg19:g.86800184G>T	ENSP00000413001:p.Ser233Ile	77.0	0.0		81.0	19.0	NM_152336	A1A4X5|A6NJH6|C9JHL5	Missense_Mutation	SNP	ENST00000441037.2	hg19	CCDS58398.1	.	.	.	.	.	.	.	.	.	.	G	13.47	2.245803	0.39697	.	.	ENSG00000166748	ENST00000441037;ENST00000421325	T	0.43294	0.95	5.93	5.02	0.67125	Armadillo-type fold (1);	0.319446	0.27851	N	0.017583	T	0.37210	0.0995	L	0.60455	1.87	0.80722	D	1	P	0.45902	0.868	B	0.34242	0.178	T	0.38478	-0.9659	10	0.54805	T	0.06	-8.8623	14.4644	0.67472	0.0:0.1559:0.844:0.0	.	233	Q96MI9	CBPC4_HUMAN	I	262;233	ENSP00000397173:S233I	ENSP00000397173:S233I	S	+	2	0	AGBL1	84601188	0.042000	0.20092	0.973000	0.42090	0.385000	0.30292	0.742000	0.26216	1.495000	0.48549	0.655000	0.94253	AGC	.	.		0.522	AGBL1-001	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000314929.5	NM_152336	
SYNGR3	9143	hgsc.bcm.edu	37	16	2042999	2042999	+	Missense_Mutation	SNP	G	G	C			TCGA-2Y-A9GT-01A-11D-A382-10	TCGA-2Y-A9GT-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38c5baf0-5376-42d2-b545-89f5c606b05e	76f29a85-4ade-4630-b69b-5a23a1c16628	g.chr16:2042999G>C	ENST00000248121.2	+	4	774	c.616G>C	c.(616-618)Gag>Cag	p.E206Q	SYNGR3_ENST00000562045.1_3'UTR	NM_004209.5	NP_004200.2	O43761	SNG3_HUMAN	synaptogyrin 3	206					positive regulation of transporter activity (GO:0032411)|substantia nigra development (GO:0021762)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|neuromuscular junction (GO:0031594)|synaptic vesicle (GO:0008021)				endometrium(1)|lung(2)	3						GGAGGGCACCGAGACCTACCA	0.692																																					p.E206Q		Atlas-SNP	.											.	SYNGR3	10	.	0			c.G616C						.						28.0	26.0	27.0					16																	2042999		2192	4294	6486	SO:0001583	missense	9143	exon4			GGCACCGAGACCT	AJ002309	CCDS10456.1	16p13.3	2008-05-19			ENSG00000127561	ENSG00000127561			11501	protein-coding gene	gene with protein product		603927				9760194	Standard	NM_004209		Approved		uc002cod.3	O43761	OTTHUMG00000128711	ENST00000248121.2:c.616G>C	chr16.hg19:g.2042999G>C	ENSP00000248121:p.Glu206Gln	199.0	0.0		104.0	24.0	NM_004209	B2R9S0	Missense_Mutation	SNP	ENST00000248121.2	hg19	CCDS10456.1	.	.	.	.	.	.	.	.	.	.	g	23.9	4.475559	0.84640	.	.	ENSG00000127561	ENST00000248121	T	0.14640	2.49	3.39	3.39	0.38822	.	0.188390	0.45606	D	0.000346	T	0.16981	0.0408	L	0.31664	0.95	0.80722	D	1	D	0.65815	0.995	P	0.56278	0.795	T	0.01172	-1.1429	10	0.59425	D	0.04	.	8.0574	0.30612	0.1132:0.0:0.8868:0.0	.	206	O43761	SNG3_HUMAN	Q	206	ENSP00000248121:E206Q	ENSP00000248121:E206Q	E	+	1	0	SYNGR3	1983000	1.000000	0.71417	0.998000	0.56505	0.991000	0.79684	7.640000	0.83355	1.733000	0.51620	0.462000	0.41574	GAG	.	.		0.692	SYNGR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250616.1		
EDC4	23644	hgsc.bcm.edu	37	16	67916488	67916488	+	Missense_Mutation	SNP	A	A	G			TCGA-2Y-A9GT-01A-11D-A382-10	TCGA-2Y-A9GT-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38c5baf0-5376-42d2-b545-89f5c606b05e	76f29a85-4ade-4630-b69b-5a23a1c16628	g.chr16:67916488A>G	ENST00000358933.5	+	25	3672	c.3433A>G	c.(3433-3435)Aca>Gca	p.T1145A	CTC-479C5.10_ENST00000572067.1_lincRNA|NRN1L_ENST00000339176.3_5'Flank|NRN1L_ENST00000576147.1_5'Flank	NM_014329.4	NP_055144.3	Q6P2E9	EDC4_HUMAN	enhancer of mRNA decapping 4	1145					exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)				breast(3)|central_nervous_system(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(4)|lung(8)|ovary(4)|skin(2)|upper_aerodigestive_tract(4)|urinary_tract(2)	41		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0042)|Epithelial(162;0.0185)|all cancers(182;0.121)		CCGGCTGGGGACACAGGAATG	0.562																																					p.T1145A		Atlas-SNP	.											.	EDC4	101	.	0			c.A3433G						.						62.0	61.0	61.0					16																	67916488		2198	4300	6498	SO:0001583	missense	23644	exon25			CTGGGGACACAGG	U17474	CCDS10849.1	16q22.1	2008-02-05			ENSG00000038358	ENSG00000038358			17157	protein-coding gene	gene with protein product		606030				9067524	Standard	NM_014329		Approved	RCD-8, Ge-1, HEDLS	uc002eur.3	Q6P2E9	OTTHUMG00000137543	ENST00000358933.5:c.3433A>G	chr16.hg19:g.67916488A>G	ENSP00000351811:p.Thr1145Ala	170.0	0.0		100.0	29.0	NM_014329	A6NGM1|A8K4T4|Q13025|Q13826|Q6ZR12|Q7Z6H7	Missense_Mutation	SNP	ENST00000358933.5	hg19	CCDS10849.1	.	.	.	.	.	.	.	.	.	.	A	21.9	4.222523	0.79464	.	.	ENSG00000038358	ENST00000358933	.	.	.	5.94	5.94	0.96194	.	0.000000	0.85682	D	0.000000	T	0.67822	0.2934	M	0.65975	2.015	0.80722	D	1	D	0.63880	0.993	P	0.57911	0.829	T	0.64249	-0.6452	9	0.10902	T	0.67	-12.9179	16.0566	0.80812	1.0:0.0:0.0:0.0	.	1145	Q6P2E9	EDC4_HUMAN	A	1145	.	ENSP00000351811:T1145A	T	+	1	0	EDC4	66473989	1.000000	0.71417	1.000000	0.80357	0.797000	0.45037	9.258000	0.95555	2.272000	0.75746	0.460000	0.39030	ACA	.	.		0.562	EDC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268874.2	NM_014329	
G6PC	2538	hgsc.bcm.edu	37	17	41056030	41056030	+	Missense_Mutation	SNP	T	T	C			TCGA-2Y-A9GT-01A-11D-A382-10	TCGA-2Y-A9GT-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38c5baf0-5376-42d2-b545-89f5c606b05e	76f29a85-4ade-4630-b69b-5a23a1c16628	g.chr17:41056030T>C	ENST00000253801.2	+	2	392	c.313T>C	c.(313-315)Ttc>Ctc	p.F105L	G6PC_ENST00000585489.1_Missense_Mutation_p.F105L|G6PC_ENST00000592383.1_Missense_Mutation_p.F105L	NM_000151.3	NP_000142.2	P35575	G6PC_HUMAN	glucose-6-phosphatase, catalytic subunit	105					carbohydrate metabolic process (GO:0005975)|cholesterol homeostasis (GO:0042632)|dephosphorylation (GO:0016311)|gluconeogenesis (GO:0006094)|glucose 6-phosphate metabolic process (GO:0051156)|glucose homeostasis (GO:0042593)|glucose transport (GO:0015758)|glucose-6-phosphate transport (GO:0015760)|glycogen catabolic process (GO:0005980)|glycogen metabolic process (GO:0005977)|hexose transport (GO:0008645)|multicellular organism growth (GO:0035264)|regulation of gene expression (GO:0010468)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|transmembrane transport (GO:0055085)|triglyceride metabolic process (GO:0006641)|urate metabolic process (GO:0046415)	endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)	glucose-6-phosphatase activity (GO:0004346)|phosphate ion binding (GO:0042301)|phosphotransferase activity, alcohol group as acceptor (GO:0016773)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(9)|ovary(1)|prostate(1)|skin(1)	23		Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.113)		GATAAAGCAGTTCCCTGTAAC	0.493																																					p.F105L		Atlas-SNP	.											.	G6PC	48	.	0			c.T313C						.						143.0	122.0	129.0					17																	41056030		2203	4300	6503	SO:0001583	missense	2538	exon2			AAGCAGTTCCCTG	U01120	CCDS11446.1, CCDS59291.1	17q21	2014-09-17	2006-06-28			ENSG00000131482	3.1.3.9		4056	protein-coding gene	gene with protein product	"""glycogen storage disease type I, von Gierke disease"""	613742	"""glucose-6-phosphatase, catalytic (glycogen storage disease type I, von Gierke disease)"""	G6PT		7774924	Standard	NM_000151		Approved	GSD1a	uc002icb.2	P35575		ENST00000253801.2:c.313T>C	chr17.hg19:g.41056030T>C	ENSP00000253801:p.Phe105Leu	112.0	0.0		79.0	20.0	NM_001270397	A1L4C0|B4E1C3|K7EL82	Missense_Mutation	SNP	ENST00000253801.2	hg19	CCDS11446.1	.	.	.	.	.	.	.	.	.	.	T	28.7	4.940465	0.92526	.	.	ENSG00000131482	ENST00000253801	T	0.79033	-1.23	4.74	4.74	0.60224	Phosphatidic acid phosphatase/chloroperoxidase, N-terminal (1);	0.059538	0.64402	D	0.000002	D	0.85314	0.5668	L	0.58101	1.795	0.53688	D	0.999979	D;D	0.76494	0.991;0.999	P;D	0.85130	0.881;0.997	D	0.86342	0.1705	10	0.56958	D	0.05	.	14.389	0.66965	0.0:0.0:0.0:1.0	.	107;105	E7ENG5;P35575	.;G6PC_HUMAN	L	105	ENSP00000253801:F105L	ENSP00000253801:F105L	F	+	1	0	G6PC	38309556	1.000000	0.71417	1.000000	0.80357	0.795000	0.44927	7.819000	0.86621	1.987000	0.57996	0.402000	0.26972	TTC	.	.		0.493	G6PC-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452451.1	NM_000151	
EPN3	55040	hgsc.bcm.edu	37	17	48614268	48614268	+	Missense_Mutation	SNP	G	G	C			TCGA-2Y-A9GT-01A-11D-A382-10	TCGA-2Y-A9GT-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38c5baf0-5376-42d2-b545-89f5c606b05e	76f29a85-4ade-4630-b69b-5a23a1c16628	g.chr17:48614268G>C	ENST00000268933.3	+	2	930	c.351G>C	c.(349-351)aaG>aaC	p.K117N	RP11-94C24.8_ENST00000513017.1_RNA|EPN3_ENST00000537145.1_Missense_Mutation_p.K172N|EPN3_ENST00000541226.1_Missense_Mutation_p.K61N	NM_017957.2	NP_060427.2	Q9H201	EPN3_HUMAN	epsin 3	117	ENTH. {ECO:0000255|PROSITE- ProRule:PRU00243}.					clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|extracellular vesicular exosome (GO:0070062)|extrinsic component of plasma membrane (GO:0019897)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	lipid binding (GO:0008289)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(1)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	14	Breast(11;1.23e-18)		BRCA - Breast invasive adenocarcinoma(22;2.88e-09)			GCGACGGCAAGGACCAGGGCG	0.637																																					p.K117N		Atlas-SNP	.											.	EPN3	32	.	0			c.G351C						.						99.0	78.0	85.0					17																	48614268		2203	4300	6503	SO:0001583	missense	55040	exon2			CGGCAAGGACCAG	AF324241	CCDS11570.1	17q21.33	2008-07-18				ENSG00000049283			18235	protein-coding gene	gene with protein product		607264				10951261, 11359770	Standard	NM_017957		Approved	FLJ20778, MGC129899	uc002ira.4	Q9H201		ENST00000268933.3:c.351G>C	chr17.hg19:g.48614268G>C	ENSP00000268933:p.Lys117Asn	222.0	0.0		119.0	5.0	NM_017957	A8K6J3|A8KAB2|Q9BVN6|Q9NWK2	Missense_Mutation	SNP	ENST00000268933.3	hg19	CCDS11570.1	.	.	.	.	.	.	.	.	.	.	G	17.96	3.515288	0.64634	.	.	ENSG00000049283	ENST00000268933;ENST00000503246;ENST00000442715;ENST00000537145;ENST00000541226;ENST00000507467;ENST00000411703	T;T;T;T;T	0.53206	0.63;0.63;0.63;0.63;0.63	5.47	1.06	0.20224	Epsin domain, N-terminal (1);ENTH/VHS (2);Epsin-like, N-terminal (2);	0.319446	0.32970	N	0.005439	T	0.69886	0.3161	M	0.90977	3.165	0.40759	D	0.982988	D;D;D	0.76494	0.985;0.982;0.999	P;P;D	0.80764	0.893;0.828;0.994	T	0.72408	-0.4303	10	0.87932	D	0	-28.2328	9.1479	0.36944	0.398:0.0:0.602:0.0	.	172;172;117	B4DK18;F6QWW5;Q9H201	.;.;EPN3_HUMAN	N	117;117;172;172;61;117;117	ENSP00000268933:K117N;ENSP00000426762:K117N;ENSP00000439512:K172N;ENSP00000440540:K61N;ENSP00000421515:K117N	ENSP00000268933:K117N	K	+	3	2	EPN3	45969267	1.000000	0.71417	0.997000	0.53966	0.640000	0.38277	0.836000	0.27545	0.216000	0.20781	0.561000	0.74099	AAG	.	.		0.637	EPN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367573.1	NM_017957	
CDR2L	30850	hgsc.bcm.edu	37	17	72999276	72999276	+	Splice_Site	SNP	A	A	T			TCGA-2Y-A9GT-01A-11D-A382-10	TCGA-2Y-A9GT-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38c5baf0-5376-42d2-b545-89f5c606b05e	76f29a85-4ade-4630-b69b-5a23a1c16628	g.chr17:72999276A>T	ENST00000337231.5	+	5	918		c.e5-1			NM_014603.2	NP_055418.2	Q86X02	CDR2L_HUMAN	cerebellar degeneration-related protein 2-like													all_lung(278;0.226)					ACTACCCGCCAGGTGCAAGGA	0.697																																					.		Atlas-SNP	.											.	.	.	.	0			c.507-2A>T						.						17.0	17.0	17.0					17																	72999276		2144	4196	6340	SO:0001630	splice_region_variant	30850	exon5			CCCGCCAGGTGCA		CCDS11710.2	17q25.1	2006-03-28			ENSG00000109089	ENSG00000109089			29999	protein-coding gene	gene with protein product	"""paraneoplastic antigen"""						Standard	NM_014603		Approved	HUMPPA	uc002jml.4	Q86X02	OTTHUMG00000150435	ENST00000337231.5:c.507-1A>T	chr17.hg19:g.72999276A>T		222.0	0.0		132.0	37.0	NM_014603	B4DFA7|Q15175	Splice_Site	SNP	ENST00000337231.5	hg19	CCDS11710.2	.	.	.	.	.	.	.	.	.	.	A	19.46	3.832381	0.71258	.	.	ENSG00000109089	ENST00000337231	.	.	.	4.71	4.71	0.59529	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.4553	0.67413	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	CDR2L	70510871	1.000000	0.71417	0.989000	0.46669	0.835000	0.47333	8.620000	0.90943	1.876000	0.54355	0.379000	0.24179	.	.	.		0.697	CDR2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318080.1	NM_014603	Intron
ZNF556	80032	hgsc.bcm.edu	37	19	2877815	2877815	+	Missense_Mutation	SNP	T	T	A			TCGA-2Y-A9GT-01A-11D-A382-10	TCGA-2Y-A9GT-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38c5baf0-5376-42d2-b545-89f5c606b05e	76f29a85-4ade-4630-b69b-5a23a1c16628	g.chr19:2877815T>A	ENST00000307635.2	+	4	946	c.859T>A	c.(859-861)Tat>Aat	p.Y287N	ZNF556_ENST00000586426.1_Missense_Mutation_p.Y286N	NM_024967.1	NP_079243.1	Q9HAH1	ZN556_HUMAN	zinc finger protein 556	287					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(2)|kidney(1)|large_intestine(7)|lung(10)|pancreas(1)|prostate(3)|skin(7)	31				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		AGGGAGACCGTATGAGTGCAA	0.522																																					p.Y287N		Atlas-SNP	.											.	ZNF556	73	.	0			c.T859A						.						61.0	55.0	57.0					19																	2877815		2203	4300	6503	SO:0001583	missense	80032	exon4			AGACCGTATGAGT	BC009374	CCDS12097.1, CCDS74254.1	19p13.3	2013-09-20			ENSG00000172000	ENSG00000172000		"""Zinc fingers, C2H2-type"", ""-"""	25669	protein-coding gene	gene with protein product						12477932	Standard	XM_005259647		Approved	FLJ11637	uc002lwp.1	Q9HAH1	OTTHUMG00000180501	ENST00000307635.2:c.859T>A	chr19.hg19:g.2877815T>A	ENSP00000302603:p.Tyr287Asn	167.0	0.0		131.0	42.0	NM_024967	Q96GM3	Missense_Mutation	SNP	ENST00000307635.2	hg19	CCDS12097.1	.	.	.	.	.	.	.	.	.	.	T	13.26	2.184038	0.38609	.	.	ENSG00000172000	ENST00000307635	T	0.15017	2.46	2.3	1.17	0.20885	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.40619	0.1124	M	0.88310	2.945	0.09310	N	1	D	0.67145	0.996	D	0.67382	0.951	T	0.10989	-1.0606	9	0.87932	D	0	.	5.5901	0.17297	0.0:0.1618:0.0:0.8382	.	287	Q9HAH1	ZN556_HUMAN	N	287	ENSP00000302603:Y287N	ENSP00000302603:Y287N	Y	+	1	0	ZNF556	2828815	0.001000	0.12720	0.002000	0.10522	0.009000	0.06853	0.956000	0.29202	0.902000	0.36520	0.334000	0.21626	TAT	.	.		0.522	ZNF556-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000451638.2	NM_024967	
SLC8A2	6543	hgsc.bcm.edu	37	19	47960478	47960478	+	Missense_Mutation	SNP	C	C	T			TCGA-2Y-A9GT-01A-11D-A382-10	TCGA-2Y-A9GT-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38c5baf0-5376-42d2-b545-89f5c606b05e	76f29a85-4ade-4630-b69b-5a23a1c16628	g.chr19:47960478C>T	ENST00000236877.6	-	3	1444	c.1049G>A	c.(1048-1050)cGc>cAc	p.R350H	SLC8A2_ENST00000539381.1_Intron|SLC8A2_ENST00000542837.1_Missense_Mutation_p.R106H	NM_015063.2	NP_055878.1	Q9UPR5	NAC2_HUMAN	solute carrier family 8 (sodium/calcium exchanger), member 2	350					blood coagulation (GO:0007596)|cell communication (GO:0007154)|ion transport (GO:0006811)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium:sodium antiporter activity (GO:0005432)			breast(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(10)|ovary(2)|prostate(2)|skin(5)|stomach(1)	31		all_cancers(25;3.05e-07)|all_lung(116;4.19e-06)|Lung NSC(112;7.16e-06)|all_epithelial(76;7.65e-06)|all_neural(266;0.0652)|Ovarian(192;0.086)|Breast(70;0.173)		OV - Ovarian serous cystadenocarcinoma(262;0.000501)|all cancers(93;0.00058)|Epithelial(262;0.0181)|GBM - Glioblastoma multiforme(486;0.0457)		GTAGAAGGCGCGGCTCTTCTG	0.687																																					p.R350H		Atlas-SNP	.											.	SLC8A2	77	.	0			c.G1049A						.						6.0	5.0	6.0					19																	47960478		2038	3910	5948	SO:0001583	missense	6543	exon3			AAGGCGCGGCTCT	AB029010	CCDS33065.1	19q13.32	2013-07-15	2008-09-02		ENSG00000118160	ENSG00000118160		"""Solute carriers"""	11069	protein-coding gene	gene with protein product		601901				8021246	Standard	NM_015063		Approved	NCX2, KIAA1087	uc002pgx.3	Q9UPR5	OTTHUMG00000183529	ENST00000236877.6:c.1049G>A	chr19.hg19:g.47960478C>T	ENSP00000236877:p.Arg350His	106.0	0.0		62.0	13.0	NM_015063	B4DYQ9	Missense_Mutation	SNP	ENST00000236877.6	hg19	CCDS33065.1	.	.	.	.	.	.	.	.	.	.	C	18.69	3.677031	0.68042	.	.	ENSG00000118160	ENST00000391903;ENST00000236877;ENST00000542837	T;T	0.55760	0.69;0.5	3.69	3.69	0.42338	.	0.000000	0.85682	D	0.000000	T	0.76321	0.3971	M	0.90542	3.125	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.994;0.997	T	0.82810	-0.0273	10	0.87932	D	0	.	14.3677	0.66817	0.0:1.0:0.0:0.0	.	178;350	E9PGS7;Q9UPR5	.;NAC2_HUMAN	H	178;350;106	ENSP00000236877:R350H;ENSP00000437536:R106H	ENSP00000236877:R350H	R	-	2	0	SLC8A2	52652290	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	7.349000	0.79376	1.914000	0.55421	0.313000	0.20887	CGC	.	.		0.687	SLC8A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466997.1		
LILRB5	10990	hgsc.bcm.edu	37	19	54756264	54756264	+	Missense_Mutation	SNP	G	G	T	rs34318516		TCGA-2Y-A9GT-01A-11D-A382-10	TCGA-2Y-A9GT-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38c5baf0-5376-42d2-b545-89f5c606b05e	76f29a85-4ade-4630-b69b-5a23a1c16628	g.chr19:54756264G>T	ENST00000316219.5	-	11	1645	c.1538C>A	c.(1537-1539)gCc>gAc	p.A513D	LILRB5_ENST00000450632.1_Missense_Mutation_p.A505D|CTD-2337J16.1_ENST00000595133.1_lincRNA|LILRB5_ENST00000345866.6_Missense_Mutation_p.A414D|LILRB5_ENST00000449561.2_Missense_Mutation_p.A514D	NM_001081442.1|NM_006840.3	NP_001074911.1|NP_006831.1	O75023	LIRB5_HUMAN	leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 5	513					cell surface receptor signaling pathway (GO:0007166)|defense response (GO:0006952)|immune system process (GO:0002376)	integral component of membrane (GO:0016021)	transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(1)|endometrium(3)|kidney(5)|large_intestine(12)|lung(25)|ovary(1)|pancreas(1)|prostate(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	56	all_cancers(19;0.00681)|all_epithelial(19;0.00368)|all_lung(19;0.016)|Lung NSC(19;0.0296)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		AACTGGGCTGGCCCTGGGGGA	0.587																																					p.A514D		Atlas-SNP	.											.	LILRB5	176	.	0			c.C1541A						.						91.0	90.0	91.0					19																	54756264		2203	4300	6503	SO:0001583	missense	10990	exon11			GGGCTGGCCCTGG	AF025534	CCDS12885.1, CCDS42611.1, CCDS46176.1	19q13.4	2013-01-11			ENSG00000105609	ENSG00000105609		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6609	protein-coding gene	gene with protein product		604814				9548455	Standard	NM_006840		Approved	LIR-8, LIR8, CD85c	uc002qey.3	O75023	OTTHUMG00000066636	ENST00000316219.5:c.1538C>A	chr19.hg19:g.54756264G>T	ENSP00000320390:p.Ala513Asp	100.0	0.0		84.0	14.0	NM_001081442	Q8N760	Missense_Mutation	SNP	ENST00000316219.5	hg19	CCDS12885.1	.	.	.	.	.	.	.	.	.	.	G	12.76	2.034677	0.35893	.	.	ENSG00000105609	ENST00000316219;ENST00000450632;ENST00000449561;ENST00000345866	T;T;T;T	0.00479	7.16;7.12;7.15;7.14	2.08	0.93	0.19454	.	.	.	.	.	T	0.00695	0.0023	L	0.44542	1.39	0.09310	N	1	P;D;B;P	0.62365	0.799;0.991;0.003;0.751	B;P;B;B	0.62885	0.214;0.908;0.01;0.17	T	0.55970	-0.8056	9	0.72032	D	0.01	.	5.5071	0.16860	0.0:0.0:0.6715:0.3285	.	505;414;514;513	C9JMK7;O75023-2;O75023-3;O75023	.;.;.;LIRB5_HUMAN	D	513;505;514;414	ENSP00000320390:A513D;ENSP00000414225:A505D;ENSP00000406478:A514D;ENSP00000263430:A414D	ENSP00000320390:A513D	A	-	2	0	LILRB5	59448076	0.786000	0.28738	0.004000	0.12327	0.030000	0.12068	0.905000	0.28504	0.363000	0.24346	0.585000	0.79938	GCC	.	.		0.587	LILRB5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000142877.2		
BRSK1	84446	hgsc.bcm.edu	37	19	55815039	55815039	+	Silent	SNP	C	C	T			TCGA-2Y-A9GT-01A-11D-A382-10	TCGA-2Y-A9GT-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38c5baf0-5376-42d2-b545-89f5c606b05e	76f29a85-4ade-4630-b69b-5a23a1c16628	g.chr19:55815039C>T	ENST00000309383.1	+	12	1408	c.1131C>T	c.(1129-1131)ccC>ccT	p.P377P	BRSK1_ENST00000590333.1_Silent_p.P393P|BRSK1_ENST00000326848.7_Silent_p.P72P	NM_032430.1	NP_115806.1	Q8TDC3	BRSK1_HUMAN	BR serine/threonine kinase 1	377					axonogenesis (GO:0007409)|cellular response to DNA damage stimulus (GO:0006974)|centrosome duplication (GO:0051298)|establishment of cell polarity (GO:0030010)|G2 DNA damage checkpoint (GO:0031572)|neuron differentiation (GO:0030182)|neurotransmitter secretion (GO:0007269)|protein phosphorylation (GO:0006468)|response to UV (GO:0009411)	cell junction (GO:0030054)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)	ATP binding (GO:0005524)|gamma-tubulin binding (GO:0043015)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)|tau-protein kinase activity (GO:0050321)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(15)|ovary(2)|prostate(2)|skin(6)|stomach(1)	48		Renal(1328;0.245)	BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0474)		CCTCAGACCCCCCCCGGAAGC	0.582																																					p.P377P		Atlas-SNP	.											.	BRSK1	192	.	0			c.C1131T						.						56.0	65.0	62.0					19																	55815039		2203	4300	6503	SO:0001819	synonymous_variant	84446	exon12			AGACCCCCCCCGG	AB058714	CCDS12921.1	19q13.4	2008-02-05				ENSG00000160469			18994	protein-coding gene	gene with protein product		609235				14976552	Standard	NM_032430		Approved	KIAA1811	uc002qkg.3	Q8TDC3		ENST00000309383.1:c.1131C>T	chr19.hg19:g.55815039C>T		371.0	0.0		217.0	59.0	NM_032430	F1DG44|Q5J5B5|Q8NDD0|Q8NDR4|Q8TDC2|Q96AV4|Q96JL4	Silent	SNP	ENST00000309383.1	hg19	CCDS12921.1																																																																																			.	.		0.582	BRSK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452787.1	NM_032430	
ABHD12	26090	hgsc.bcm.edu	37	20	25319898	25319898	+	Missense_Mutation	SNP	G	G	A	rs546873766		TCGA-2Y-A9GT-01A-11D-A382-10	TCGA-2Y-A9GT-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38c5baf0-5376-42d2-b545-89f5c606b05e	76f29a85-4ade-4630-b69b-5a23a1c16628	g.chr20:25319898G>A	ENST00000339157.5	-	2	553	c.281C>T	c.(280-282)cCt>cTt	p.P94L	ABHD12_ENST00000376542.3_Missense_Mutation_p.P94L	NM_001042472.2	NP_001035937.1	Q8N2K0	ABD12_HUMAN	abhydrolase domain containing 12	94					adult walking behavior (GO:0007628)|phosphatidylserine catabolic process (GO:0006660)|response to auditory stimulus (GO:0010996)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)	acylglycerol lipase activity (GO:0047372)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|liver(1)|lung(1)|skin(1)|urinary_tract(1)	12						CTGTATTCCAGGACATAGTTT	0.408													G|||	1	0.000199681	0.0	0.0	5008	,	,		19215	0.001		0.0	False		,,,				2504	0.0				p.P94L		Atlas-SNP	.											.	ABHD12	46	.	0			c.C281T						.						116.0	103.0	107.0					20																	25319898		2203	4300	6503	SO:0001583	missense	26090	exon2			ATTCCAGGACATA	AL117442	CCDS13172.1, CCDS42857.1	20p11.21	2007-04-24	2006-03-10	2006-03-10	ENSG00000100997	ENSG00000100997		"""Abhydrolase domain containing"""	15868	protein-coding gene	gene with protein product		613599	"""chromosome 20 open reading frame 22"""	C20orf22			Standard	NM_015600		Approved	DKFZP434P106, dJ965G21.2, BEM46L2, ABHD12A	uc002wuq.3	Q8N2K0	OTTHUMG00000032121	ENST00000339157.5:c.281C>T	chr20.hg19:g.25319898G>A	ENSP00000341408:p.Pro94Leu	390.0	0.0		346.0	91.0	NM_001042472	A6NED4|A6NJ90|A8K450|B4DE71|Q5T710|Q5T711|Q96CR1|Q9BX05|Q9NPX7|Q9UFV6	Missense_Mutation	SNP	ENST00000339157.5	hg19	CCDS42857.1	.	.	.	.	.	.	.	.	.	.	G	25.8	4.672359	0.88348	.	.	ENSG00000100997	ENST00000376542;ENST00000339157;ENST00000526543;ENST00000450393	T;T;T	0.29655	1.56;1.56;1.56	5.51	5.51	0.81932	.	0.000000	0.85682	D	0.000000	T	0.55577	0.1929	M	0.78456	2.415	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.992;0.996;0.998	T	0.50988	-0.8762	10	0.12430	T	0.62	.	18.2043	0.89850	0.0:0.0:1.0:0.0	.	49;94;94	Q5T712;Q8N2K0;Q8N2K0-2	.;ABD12_HUMAN;.	L	94;94;56;49	ENSP00000365725:P94L;ENSP00000341408:P94L;ENSP00000413311:P49L	ENSP00000341408:P94L	P	-	2	0	ABHD12	25267898	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	6.692000	0.74578	2.584000	0.87258	0.563000	0.77884	CCT	.	.		0.408	ABHD12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078423.2	NM_015600	
KRTAP6-1	337966	hgsc.bcm.edu	37	21	31986208	31986208	+	Missense_Mutation	SNP	A	A	G			TCGA-2Y-A9GT-01A-11D-A382-10	TCGA-2Y-A9GT-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38c5baf0-5376-42d2-b545-89f5c606b05e	76f29a85-4ade-4630-b69b-5a23a1c16628	g.chr21:31986208A>G	ENST00000329122.2	-	1	41	c.16T>C	c.(16-18)Tac>Cac	p.Y6H	KRTAP20-1_ENST00000334664.2_5'Flank	NM_181602.1	NP_853633.1	Q3LI64	KRA61_HUMAN	keratin associated protein 6-1	6						cytosol (GO:0005829)|intermediate filament (GO:0005882)				breast(2)|endometrium(1)|lung(7)	10						TAGTTTCCGTAGTAGCTGCCA	0.552																																					p.Y6H		Atlas-SNP	.											.	KRTAP6-1	21	.	0			c.T16C						.						193.0	187.0	189.0					21																	31986208		2203	4300	6503	SO:0001583	missense	337966	exon1			TTCCGTAGTAGCT	AP001708	CCDS13602.1	21q22.1	2006-03-13			ENSG00000184724	ENSG00000184724		"""Keratin associated proteins"""	18931	protein-coding gene	gene with protein product						12359730	Standard	NM_181602		Approved	KAP6.1, C21orf103	uc002yop.3	Q3LI64	OTTHUMG00000057788	ENST00000329122.2:c.16T>C	chr21.hg19:g.31986208A>G	ENSP00000332690:p.Tyr6His	126.0	0.0		114.0	40.0	NM_181602		Missense_Mutation	SNP	ENST00000329122.2	hg19	CCDS13602.1	.	.	.	.	.	.	.	.	.	.	A	11.14	1.551515	0.27739	.	.	ENSG00000184724	ENST00000329122;ENST00000399871	T	0.26957	1.7	5.24	4.09	0.47781	.	0.248600	0.20725	U	0.086839	T	0.20700	0.0498	.	.	.	0.24342	N	0.994951	B	0.06786	0.001	B	0.12837	0.008	T	0.18777	-1.0326	9	0.87932	D	0	.	9.4424	0.38677	0.9163:0.0:0.0837:0.0	.	6	Q3LI64	KRA61_HUMAN	H	6;4	ENSP00000332690:Y6H	ENSP00000332690:Y6H	Y	-	1	0	KRTAP6-1	30908079	0.950000	0.32346	0.851000	0.33527	0.854000	0.48673	1.556000	0.36288	1.132000	0.42129	0.523000	0.50628	TAC	.	.		0.552	KRTAP6-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128240.2	NM_181602	
SERPIND1	3053	hgsc.bcm.edu	37	22	21140349	21140349	+	Missense_Mutation	SNP	G	G	T			TCGA-2Y-A9GT-01A-11D-A382-10	TCGA-2Y-A9GT-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38c5baf0-5376-42d2-b545-89f5c606b05e	76f29a85-4ade-4630-b69b-5a23a1c16628	g.chr22:21140349G>T	ENST00000215727.5	+	4	1504	c.1221G>T	c.(1219-1221)gaG>gaT	p.E407D	PI4KA_ENST00000572273.1_Intron|SERPIND1_ENST00000406799.1_Missense_Mutation_p.E407D|PI4KA_ENST00000466162.1_Intron|PI4KA_ENST00000255882.6_Intron	NM_000185.3	NP_000176.2	P05546	HEP2_HUMAN	serpin peptidase inhibitor, clade D (heparin cofactor), member 1	407					blood coagulation (GO:0007596)|chemotaxis (GO:0006935)|negative regulation of endopeptidase activity (GO:0010951)|regulation of proteolysis (GO:0030162)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	endopeptidase inhibitor activity (GO:0004866)|heparin binding (GO:0008201)|serine-type endopeptidase inhibitor activity (GO:0004867)			breast(2)|endometrium(3)|kidney(1)|large_intestine(2)|lung(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	13	all_cancers(11;6.16e-25)|all_epithelial(7;1.02e-22)|Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.000536)|Lung(15;0.0108)|Epithelial(17;0.196)		Ardeparin(DB00407)|Sulodexide(DB06271)	ATCTAGTGGAGTCCCTGAAGT	0.483																																					p.E407D		Atlas-SNP	.											.	SERPIND1	92	.	0			c.G1221T						.						190.0	174.0	180.0					22																	21140349		2203	4300	6503	SO:0001583	missense	3053	exon4			AGTGGAGTCCCTG	M12849	CCDS13783.1	22q11.21	2014-02-18	2005-08-18		ENSG00000099937	ENSG00000099937		"""Serine (or cysteine) peptidase inhibitors"""	4838	protein-coding gene	gene with protein product	"""heparin cofactor II"""	142360	"""serine (or cysteine) proteinase inhibitor, clade D (heparin cofactor), member 1"""	HCF2		1671335, 24172014	Standard	XM_005261597		Approved	HC-II, HLS2, HC2, D22S673	uc002ztb.1	P05546	OTTHUMG00000150755	ENST00000215727.5:c.1221G>T	chr22.hg19:g.21140349G>T	ENSP00000215727:p.Glu407Asp	167.0	0.0		93.0	33.0	NM_000185	B2RAI1|D3DX34|Q6IBZ5	Missense_Mutation	SNP	ENST00000215727.5	hg19	CCDS13783.1	.	.	.	.	.	.	.	.	.	.	G	12.23	1.875187	0.33162	.	.	ENSG00000099937	ENST00000215727;ENST00000406799	D;D	0.87571	-2.27;-2.27	5.28	1.85	0.25348	Serpin domain (3);	0.346134	0.33916	N	0.004427	T	0.70116	0.3187	N	0.17723	0.515	0.39723	D	0.971491	B;B	0.06786	0.001;0.001	B;B	0.06405	0.002;0.002	T	0.56177	-0.8022	10	0.20519	T	0.43	.	0.9117	0.01296	0.2544:0.1241:0.4104:0.2111	.	407;407	Q8IVC0;P05546	.;HEP2_HUMAN	D	407	ENSP00000215727:E407D;ENSP00000384050:E407D	ENSP00000215727:E407D	E	+	3	2	SERPIND1	19470349	0.385000	0.25172	1.000000	0.80357	0.887000	0.51463	0.352000	0.20113	0.801000	0.34066	0.655000	0.94253	GAG	.	.		0.483	SERPIND1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319961.1	NM_000185	
ZNF280B	140883	hgsc.bcm.edu	37	22	22842186	22842186	+	Missense_Mutation	SNP	C	C	A			TCGA-2Y-A9GT-01A-11D-A382-10	TCGA-2Y-A9GT-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38c5baf0-5376-42d2-b545-89f5c606b05e	76f29a85-4ade-4630-b69b-5a23a1c16628	g.chr22:22842186C>A	ENST00000406426.1	-	4	2280	c.1538G>T	c.(1537-1539)gGa>gTa	p.G513V	ZNF280B_ENST00000360412.2_Missense_Mutation_p.G513V			Q86YH2	Z280B_HUMAN	zinc finger protein 280B	513					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.G513E(1)		autonomic_ganglia(1)|endometrium(2)|kidney(1)|large_intestine(6)|liver(1)|lung(9)|ovary(2)	22	all_hematologic(9;0.0135)|Acute lymphoblastic leukemia(84;0.17)	all_hematologic(6;1.74e-30)|Acute lymphoblastic leukemia(6;7.75e-22)		READ - Rectum adenocarcinoma(21;0.145)		ATCCACTGATCCTGGCTGAAG	0.408																																					p.G513V		Atlas-SNP	.											ZNF280B,NS,carcinoma,0,1	ZNF280B	67	.	1	Substitution - Missense(1)	kidney(1)	c.G1538T						.						144.0	131.0	135.0					22																	22842186		2203	4300	6503	SO:0001583	missense	140883	exon4			ACTGATCCTGGCT	AK097608	CCDS13799.1	22q11.2	2007-09-20	2007-09-20	2007-09-20	ENSG00000198477	ENSG00000275004			23022	protein-coding gene	gene with protein product			"""zinc finger protein 279"", ""suppressor of hairy wing homolog 2 (Drosophila)"""	ZNF279, SUHW2		9074928	Standard	NM_080764		Approved	5'OY11.1, ZNF632	uc002zwc.1	Q86YH2	OTTHUMG00000151066	ENST00000406426.1:c.1538G>T	chr22.hg19:g.22842186C>A	ENSP00000385998:p.Gly513Val	99.0	0.0		89.0	26.0	NM_080764		Missense_Mutation	SNP	ENST00000406426.1	hg19	CCDS13799.1	.	.	.	.	.	.	.	.	.	.	C	8.185	0.794612	0.16327	.	.	ENSG00000198477	ENST00000406426;ENST00000360412	T;T	0.03386	3.95;3.95	4.32	-0.452	0.12205	.	.	.	.	.	T	0.07728	0.0194	L	0.46157	1.445	0.21220	N	0.999759	D	0.64830	0.994	P	0.61070	0.883	T	0.30794	-0.9966	9	0.45353	T	0.12	-0.0804	4.1382	0.10181	0.0:0.412:0.1715:0.4165	.	513	Q86YH2	Z280B_HUMAN	V	513	ENSP00000385998:G513V;ENSP00000353586:G513V	ENSP00000353586:G513V	G	-	2	0	ZNF280B	21172186	0.000000	0.05858	0.149000	0.22428	0.155000	0.21991	-0.325000	0.07976	0.019000	0.15079	-0.345000	0.07892	GGA	.	.		0.408	ZNF280B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321170.2	NM_080764	
CELSR1	9620	hgsc.bcm.edu	37	22	46776800	46776800	+	Missense_Mutation	SNP	T	T	C			TCGA-2Y-A9GT-01A-11D-A382-10	TCGA-2Y-A9GT-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38c5baf0-5376-42d2-b545-89f5c606b05e	76f29a85-4ade-4630-b69b-5a23a1c16628	g.chr22:46776800T>C	ENST00000262738.3	-	22	7140	c.7141A>G	c.(7141-7143)Agc>Ggc	p.S2381G		NM_014246.1	NP_055061.1	Q9NYQ6	CELR1_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 1	2381					anterior/posterior pattern specification (GO:0009952)|apical protein localization (GO:0045176)|central nervous system development (GO:0007417)|establishment of body hair planar orientation (GO:0048105)|establishment of planar polarity (GO:0001736)|establishment of planar polarity of embryonic epithelium (GO:0042249)|G-protein coupled receptor signaling pathway (GO:0007186)|hair follicle development (GO:0001942)|homophilic cell adhesion (GO:0007156)|inner ear morphogenesis (GO:0042472)|lateral sprouting involved in lung morphogenesis (GO:0060490)|locomotory behavior (GO:0007626)|neural tube closure (GO:0001843)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|orthogonal dichotomous subdivision of terminal units involved in lung branching morphogenesis (GO:0060488)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|planar dichotomous subdivision of terminal units involved in lung branching morphogenesis (GO:0060489)|protein localization involved in establishment of planar polarity (GO:0090251)|regulation of actin cytoskeleton organization (GO:0032956)|Rho protein signal transduction (GO:0007266)|wound healing (GO:0042060)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)|protein dimerization activity (GO:0046983)|transmembrane signaling receptor activity (GO:0004888)			breast(8)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(5)|kidney(4)|large_intestine(13)|lung(27)|ovary(2)|pancreas(2)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(3)	95		Ovarian(80;0.00142)|Breast(42;0.00296)|all_neural(38;0.0416)|Colorectal(5;0.0766)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00643)|BRCA - Breast invasive adenocarcinoma(115;0.171)		GCCCCCTCGCTGTACACCAGC	0.617																																					p.S2381G		Atlas-SNP	.											.	CELSR1	242	.	0			c.A7141G						.						39.0	40.0	40.0					22																	46776800		2203	4300	6503	SO:0001583	missense	9620	exon22			CCTCGCTGTACAC	AF231024	CCDS14076.1	22q13.31	2014-08-08	2013-02-18		ENSG00000075275	ENSG00000075275		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	1850	protein-coding gene	gene with protein product	"""flamingo homolog 2 (Drosophila)"""	604523	"""cadherin, EGF LAG seven-pass G-type receptor 1, flamingo (Drosophila) homolog"""			9339365	Standard	XM_006724383		Approved	ME2, HFMI2, FMI2, CDHF9	uc003bhw.1	Q9NYQ6	OTTHUMG00000150423	ENST00000262738.3:c.7141A>G	chr22.hg19:g.46776800T>C	ENSP00000262738:p.Ser2381Gly	103.0	0.0		70.0	17.0	NM_014246	O95722|Q5TH47|Q9BWQ5|Q9Y506|Q9Y526	Missense_Mutation	SNP	ENST00000262738.3	hg19	CCDS14076.1	.	.	.	.	.	.	.	.	.	.	T	10.62	1.400084	0.25291	.	.	ENSG00000075275	ENST00000262738	T	0.10960	2.82	4.28	1.92	0.25849	Domain of unknown function DUF3497 (1);	0.123909	0.52532	U	0.000079	T	0.16727	0.0402	M	0.66939	2.045	0.80722	D	1	P;P	0.51933	0.949;0.542	P;B	0.49922	0.626;0.309	T	0.05115	-1.0905	10	0.25106	T	0.35	.	10.2336	0.43268	0.0:0.0:0.3183:0.6817	.	702;2381	B7Z7U7;Q9NYQ6	.;CELR1_HUMAN	G	2381	ENSP00000262738:S2381G	ENSP00000262738:S2381G	S	-	1	0	CELSR1	45155464	0.952000	0.32445	0.330000	0.25442	0.582000	0.36321	1.028000	0.30128	0.516000	0.28340	0.260000	0.18958	AGC	.	.		0.617	CELSR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318037.1	NM_014246	
PPP6R2	9701	hgsc.bcm.edu	37	22	50874856	50874856	+	Missense_Mutation	SNP	C	C	A			TCGA-2Y-A9GT-01A-11D-A382-10	TCGA-2Y-A9GT-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38c5baf0-5376-42d2-b545-89f5c606b05e	76f29a85-4ade-4630-b69b-5a23a1c16628	g.chr22:50874856C>A	ENST00000216061.5	+	15	1947	c.1577C>A	c.(1576-1578)aCg>aAg	p.T526K	PPP6R2_ENST00000359139.3_Missense_Mutation_p.T526K|PPP6R2_ENST00000395741.3_Missense_Mutation_p.T527K|PPP6R2_ENST00000395744.3_Missense_Mutation_p.T526K			O75170	PP6R2_HUMAN	protein phosphatase 6, regulatory subunit 2	526						cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)				NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(2)|liver(1)|lung(6)|ovary(2)|skin(1)|urinary_tract(1)	22						CTGACGGAGACGAACCGCAGG	0.692																																					p.T527K		Atlas-SNP	.											.	PPP6R2	71	.	0			c.C1580A						.						54.0	35.0	41.0					22																	50874856		2193	4291	6484	SO:0001583	missense	9701	exon14			CGGAGACGAACCG	AB014585	CCDS33681.1, CCDS56235.1, CCDS56236.1, CCDS74881.1	22q13.33	2012-04-17	2010-06-28	2010-06-28	ENSG00000100239	ENSG00000100239		"""Serine/threonine phosphatases / Protein phosphatase 6, regulatory subunits"""	19253	protein-coding gene	gene with protein product		610877	"""KIAA0685"", ""SAPS domain family, member 2"""	KIAA0685, SAPS2		16769727	Standard	NM_014678		Approved	dJ579N16.1, SAP190	uc003blc.3	O75170	OTTHUMG00000150199	ENST00000216061.5:c.1577C>A	chr22.hg19:g.50874856C>A	ENSP00000216061:p.Thr526Lys	451.0	0.0		265.0	63.0	NM_001242899	A6PVG3|B7Z7T3|Q5U5P3|Q7Z2L2|Q7Z5G5|Q7Z731|Q9UGB9	Missense_Mutation	SNP	ENST00000216061.5	hg19		.	.	.	.	.	.	.	.	.	.	C	24.0	4.479350	0.84747	.	.	ENSG00000100239	ENST00000359139;ENST00000395741;ENST00000395744;ENST00000216061	T;T;T;T	0.38887	1.19;1.19;1.19;1.11	4.92	4.92	0.64577	.	0.049728	0.85682	D	0.000000	T	0.67804	0.2932	M	0.84511	2.7	0.51012	D	0.9999	D;D;D;D;D;D	0.76494	0.999;0.998;0.998;0.988;0.998;0.996	D;D;D;D;D;D	0.72625	0.976;0.973;0.978;0.956;0.963;0.972	T	0.74444	-0.3663	10	0.87932	D	0	-15.805	15.6017	0.76631	0.0:1.0:0.0:0.0	.	85;526;526;527;526;526	F2Z3M7;O75170-5;O75170;O75170-3;O75170-4;O75170-2	.;.;PP6R2_HUMAN;.;.;.	K	526;527;526;526	ENSP00000352051:T526K;ENSP00000379090:T527K;ENSP00000379093:T526K;ENSP00000216061:T526K	ENSP00000216061:T526K	T	+	2	0	PPP6R2	49221722	1.000000	0.71417	0.985000	0.45067	0.764000	0.43329	4.428000	0.59894	2.285000	0.76669	0.561000	0.74099	ACG	.	.		0.692	PPP6R2-004	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000316809.1	NM_014678	
ZNF645	158506	hgsc.bcm.edu	37	X	22291149	22291149	+	Missense_Mutation	SNP	A	A	G			TCGA-2Y-A9GT-01A-11D-A382-10	TCGA-2Y-A9GT-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38c5baf0-5376-42d2-b545-89f5c606b05e	76f29a85-4ade-4630-b69b-5a23a1c16628	g.chrX:22291149A>G	ENST00000323684.1	+	1	85	c.41A>G	c.(40-42)aAc>aGc	p.N14S		NM_152577.3	NP_689790.1	Q8N7E2	ZN645_HUMAN	zinc finger protein 645	14					protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			cervix(1)|endometrium(4)|large_intestine(8)|lung(9)|ovary(2)|pancreas(1)|skin(1)|urinary_tract(1)	27						TGTGAATATAACAAAGAAGGG	0.358																																					p.N14S		Atlas-SNP	.											.	ZNF645	67	.	0			c.A41G						.						83.0	81.0	82.0					X																	22291149		2203	4300	6503	SO:0001583	missense	158506	exon1			AATATAACAAAGA	AK098601	CCDS14205.1	Xp22.11	2014-01-21			ENSG00000175809	ENSG00000175809			26371	protein-coding gene	gene with protein product							Standard	NM_152577		Approved	FLJ25735, HAKAIL, CT138	uc004dai.2	Q8N7E2	OTTHUMG00000021242	ENST00000323684.1:c.41A>G	chrX.hg19:g.22291149A>G	ENSP00000323348:p.Asn14Ser	327.0	0.0		201.0	111.0	NM_152577	A0AV29|A0AV31|E3SBK4|Q6DJY9	Missense_Mutation	SNP	ENST00000323684.1	hg19	CCDS14205.1	.	.	.	.	.	.	.	.	.	.	A	10.25	1.297863	0.23650	.	.	ENSG00000175809	ENST00000323684	T	0.30182	1.54	3.15	1.93	0.25924	.	0.146969	0.44483	U	0.000441	T	0.15652	0.0377	N	0.17474	0.49	0.09310	N	1	P	0.46512	0.879	B	0.42827	0.399	T	0.07635	-1.0762	10	0.32370	T	0.25	.	3.3512	0.07153	0.52:0.2417:0.0:0.2383	.	14	Q8N7E2	ZN645_HUMAN	S	14	ENSP00000323348:N14S	ENSP00000323348:N14S	N	+	2	0	ZNF645	22201070	0.004000	0.15560	0.000000	0.03702	0.001000	0.01503	1.226000	0.32563	0.434000	0.26340	0.430000	0.28490	AAC	.	.		0.358	ZNF645-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056037.1	NM_152577	
CXorf36	79742	hgsc.bcm.edu	37	X	45017000	45017000	+	Missense_Mutation	SNP	A	A	G			TCGA-2Y-A9GT-01A-11D-A382-10	TCGA-2Y-A9GT-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38c5baf0-5376-42d2-b545-89f5c606b05e	76f29a85-4ade-4630-b69b-5a23a1c16628	g.chrX:45017000A>G	ENST00000398000.2	-	3	706	c.632T>C	c.(631-633)cTc>cCc	p.L211P	CXorf36_ENST00000477281.1_Intron	NM_176819.3	NP_789789.2	Q9H7Y0	DIA1R_HUMAN	chromosome X open reading frame 36	211						extracellular region (GO:0005576)				endometrium(1)|large_intestine(2)|lung(4)	7						CAGCGTGTAGAGCAGGCGCAG	0.617																																					p.L211P		Atlas-SNP	.											.	CXorf36	53	.	0			c.T632C						.						55.0	50.0	51.0					X																	45017000		1567	3578	5145	SO:0001583	missense	79742	exon3			GTGTAGAGCAGGC	AF289581	CCDS14266.1, CCDS48096.1	Xp11.3-p11.23	2012-08-03			ENSG00000147113	ENSG00000147113			25866	protein-coding gene	gene with protein product						11944989, 21283809	Standard	NM_176819		Approved	FLJ14103, DIA1R	uc004dgg.2	Q9H7Y0	OTTHUMG00000021403	ENST00000398000.2:c.632T>C	chrX.hg19:g.45017000A>G	ENSP00000381086:p.Leu211Pro	92.0	0.0		59.0	32.0	NM_176819	A8MUU5|B2RPN7|Q6UWJ5	Missense_Mutation	SNP	ENST00000398000.2	hg19	CCDS48096.1	.	.	.	.	.	.	.	.	.	.	A	22.6	4.304888	0.81247	.	.	ENSG00000147113	ENST00000398000	T	0.39997	1.05	4.8	4.8	0.61643	.	0.000000	0.56097	D	0.000026	T	0.64886	0.2639	M	0.78801	2.425	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.70066	-0.4974	10	0.87932	D	0	.	13.5808	0.61901	1.0:0.0:0.0:0.0	.	211	Q9H7Y0	CX036_HUMAN	P	211	ENSP00000381086:L211P	ENSP00000381086:L211P	L	-	2	0	CXorf36	44901944	1.000000	0.71417	1.000000	0.80357	0.937000	0.57800	8.305000	0.89960	1.580000	0.49851	0.350000	0.21858	CTC	.	.		0.617	CXorf36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056333.2	NM_024689	
CLCN5	1184	hgsc.bcm.edu	37	X	49840465	49840465	+	Nonsense_Mutation	SNP	T	T	A			TCGA-2Y-A9GT-01A-11D-A382-10	TCGA-2Y-A9GT-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38c5baf0-5376-42d2-b545-89f5c606b05e	76f29a85-4ade-4630-b69b-5a23a1c16628	g.chrX:49840465T>A	ENST00000307367.2	+	4	512	c.221T>A	c.(220-222)tTg>tAg	p.L74*	CLCN5_ENST00000376088.3_Nonsense_Mutation_p.L144*|CLCN5_ENST00000376091.3_Nonsense_Mutation_p.L144*|CLCN5_ENST00000376108.3_Nonsense_Mutation_p.L74*			P51795	CLCN5_HUMAN	chloride channel, voltage-sensitive 5	74					chloride transmembrane transport (GO:1902476)|endocytosis (GO:0006897)|excretion (GO:0007588)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical part of cell (GO:0045177)|endosome membrane (GO:0010008)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)	antiporter activity (GO:0015297)|ATP binding (GO:0005524)|chloride channel activity (GO:0005254)|voltage-gated chloride channel activity (GO:0005247)			central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(11)|lung(8)|ovary(2)|skin(1)	30	Ovarian(276;0.236)					TTAGCTGGTTTGATAGACATC	0.428																																					p.L144X		Atlas-SNP	.											.	CLCN5	137	.	0			c.T431A						.						124.0	113.0	116.0					X																	49840465		2203	4300	6503	SO:0001587	stop_gained	1184	exon7			CTGGTTTGATAGA	X91906	CCDS14328.1, CCDS48115.1, CCDS69763.1	Xp11.23-p11.22	2012-09-26	2012-02-23		ENSG00000171365	ENSG00000171365		"""Ion channels / Chloride channels : Voltage-sensitive"""	2023	protein-coding gene	gene with protein product	"""Dent disease"""	300008	"""nephrolithiasis 2, X-linked"", ""nephrolithiasis 1 (X-linked)"", ""chloride channel 5"""	NPHL2, NPHL1		7874126, 8111383, 8099916, 8559248, 9602200	Standard	NM_001272102		Approved	DENTS, XLRH, hClC-K2, hCIC-K2, CLC5, XRN, ClC-5	uc004doq.1	P51795	OTTHUMG00000021514	ENST00000307367.2:c.221T>A	chrX.hg19:g.49840465T>A	ENSP00000304257:p.Leu74*	101.0	0.0		102.0	51.0	NM_001127898	A1L475|B3KPN6|Q5JQD5|Q7RTN8	Nonsense_Mutation	SNP	ENST00000307367.2	hg19	CCDS14328.1	.	.	.	.	.	.	.	.	.	.	T	39	7.431091	0.98279	.	.	ENSG00000171365	ENST00000376088;ENST00000376091;ENST00000376108;ENST00000307367	.	.	.	5.27	5.27	0.74061	.	0.199991	0.43579	D	0.000545	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-0.003	13.4109	0.60942	0.0:0.0:0.0:1.0	.	.	.	.	X	144;144;74;74	.	ENSP00000304257:L74X	L	+	2	0	CLCN5	49727205	0.999000	0.42202	0.999000	0.59377	0.984000	0.73092	2.938000	0.48987	1.878000	0.54408	0.430000	0.28490	TTG	.	.		0.428	CLCN5-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056544.1		
FGD1	2245	hgsc.bcm.edu	37	X	54496732	54496732	+	Missense_Mutation	SNP	C	C	A			TCGA-2Y-A9GT-01A-11D-A382-10	TCGA-2Y-A9GT-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38c5baf0-5376-42d2-b545-89f5c606b05e	76f29a85-4ade-4630-b69b-5a23a1c16628	g.chrX:54496732C>A	ENST00000375135.3	-	4	1551	c.818G>T	c.(817-819)cGg>cTg	p.R273L		NM_004463.2	NP_004454.2	P98174	FGD1_HUMAN	FYVE, RhoGEF and PH domain containing 1	273	Pro-rich.				actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|cytoskeleton organization (GO:0007010)|filopodium assembly (GO:0046847)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ morphogenesis (GO:0009887)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of Cdc42 GTPase activity (GO:0043088)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|ruffle (GO:0001726)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|small GTPase binding (GO:0031267)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(10)|lung(8)|ovary(3)|pancreas(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	39						CTCACCGTCCCGGGGCCCAGG	0.662																																					p.R273L		Atlas-SNP	.											.	FGD1	99	.	0			c.G818T						.						31.0	25.0	27.0					X																	54496732		2198	4298	6496	SO:0001583	missense	2245	exon4			CCGTCCCGGGGCC	U11690	CCDS14359.1	Xp11.21	2013-01-10	2008-08-01		ENSG00000102302	ENSG00000102302		"""Zinc fingers, FYVE domain containing"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	3663	protein-coding gene	gene with protein product		300546	"""faciogenital dysplasia (Aarskog-Scott syndrome)"""	FGDY			Standard	NM_004463		Approved	ZFYVE3	uc004dtg.3	P98174	OTTHUMG00000021627	ENST00000375135.3:c.818G>T	chrX.hg19:g.54496732C>A	ENSP00000364277:p.Arg273Leu	88.0	0.0		60.0	4.0	NM_004463	Q5H999|Q8N4D9	Missense_Mutation	SNP	ENST00000375135.3	hg19	CCDS14359.1	.	.	.	.	.	.	.	.	.	.	C	12.49	1.952697	0.34471	.	.	ENSG00000102302	ENST00000375135	T	0.78003	-1.14	4.33	3.46	0.39613	.	0.000000	0.43110	D	0.000611	T	0.52757	0.1754	N	0.08118	0	0.34493	D	0.705188	B;P	0.35242	0.166;0.492	B;B	0.30029	0.02;0.11	T	0.60742	-0.7203	10	0.30078	T	0.28	-10.4729	8.1452	0.31108	0.0:0.7969:0.0:0.2031	.	31;273	B4DS99;P98174	.;FGD1_HUMAN	L	273	ENSP00000364277:R273L	ENSP00000364277:R273L	R	-	2	0	FGD1	54513457	0.961000	0.32948	1.000000	0.80357	0.855000	0.48748	2.565000	0.45939	1.186000	0.42985	0.436000	0.28706	CGG	.	.		0.662	FGD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056801.1	NM_004463	
TAF1	6872	hgsc.bcm.edu	37	X	70643062	70643062	+	Silent	SNP	C	C	T			TCGA-2Y-A9GT-01A-11D-A382-10	TCGA-2Y-A9GT-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38c5baf0-5376-42d2-b545-89f5c606b05e	76f29a85-4ade-4630-b69b-5a23a1c16628	g.chrX:70643062C>T	ENST00000373790.4	+	30	4596	c.4545C>T	c.(4543-4545)gtC>gtT	p.V1515V	TAF1_ENST00000276072.3_Silent_p.V1536V|TAF1_ENST00000423759.1_Silent_p.V1536V|TAF1_ENST00000449580.1_Silent_p.V1515V|TAF1_ENST00000461764.1_3'UTR	NM_004606.3|NM_138923.2	NP_004597.2|NP_620278.1	P21675	TAF1_HUMAN	TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 250kDa	1515	Interaction with ASF1A and ASF1B.|Protein kinase 2.				cellular response to DNA damage stimulus (GO:0006974)|DNA-templated transcription, initiation (GO:0006352)|gene expression (GO:0010467)|histone acetylation (GO:0016573)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription initiation from RNA polymerase II promoter (GO:0060261)|protein autophosphorylation (GO:0046777)|regulation of transcription involved in G2/M transition of mitotic cell cycle (GO:0000117)|RNA polymerase II transcriptional preinitiation complex assembly (GO:0051123)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	MLL1 complex (GO:0071339)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor TFIID complex (GO:0005669)	ATP binding (GO:0005524)|histone acetyltransferase activity (GO:0004402)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)|protein serine/threonine kinase activity (GO:0004674)|sequence-specific DNA binding (GO:0043565)|TBP-class protein binding (GO:0017025)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)			breast(13)|central_nervous_system(6)|cervix(1)|endometrium(25)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(16)|lung(34)|ovary(9)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(3)	124	Renal(35;0.156)	all_lung(315;0.000321)				ACAACATTGTCACCCAGAAAA	0.438																																					p.V1536V		Atlas-SNP	.											.	TAF1	439	.	0			c.C4608T						.						154.0	117.0	129.0					X																	70643062		2203	4300	6503	SO:0001819	synonymous_variant	6872	exon30			CATTGTCACCCAG		CCDS14412.1, CCDS35325.1, CCDS69783.1	Xq13.1	2011-07-01	2002-08-29	2001-12-07	ENSG00000147133	ENSG00000147133		"""Chromatin-modifying enzymes / K-acetyltransferases"""	11535	protein-coding gene	gene with protein product		313650	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, A, 250kD"", ""dystonia 3 (with Parkinsonism)"""	TAF2A, BA2R, CCG1, CCGS, DYT3		3556424, 12928496, 17952504	Standard	XM_005262295		Approved	NSCL2, TAFII250, KAT4, DYT3/TAF1	uc004dzt.4	P21675	OTTHUMG00000022723	ENST00000373790.4:c.4545C>T	chrX.hg19:g.70643062C>T		97.0	0.0		93.0	38.0	NM_004606	A5CVC8|A5CVC9|A5CVD0|A5CVD1|B1Q2X3|Q59FZ3|Q6IUZ1|Q70Q86|Q70Q87|Q70T00|Q70T01|Q70T02|Q70T03	Silent	SNP	ENST00000373790.4	hg19	CCDS35325.1	.	.	.	.	.	.	.	.	.	.	.	9.798	1.179681	0.21787	.	.	ENSG00000147133	ENST00000437147	.	.	.	4.75	2.98	0.34508	.	.	.	.	.	T	0.54029	0.1833	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.44174	-0.9345	4	.	.	.	.	5.6669	0.17700	0.0:0.6168:0.1381:0.2451	.	.	.	.	L	170	.	.	S	+	2	0	TAF1	70559787	0.995000	0.38212	1.000000	0.80357	0.990000	0.78478	0.379000	0.20585	0.386000	0.24997	0.544000	0.68410	TCA	.	.		0.438	TAF1-009	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000058995.2	NM_004606	
ARMCX6	54470	hgsc.bcm.edu	37	X	100871590	100871590	+	Silent	SNP	C	C	A			TCGA-2Y-A9GT-01A-11D-A382-10	TCGA-2Y-A9GT-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38c5baf0-5376-42d2-b545-89f5c606b05e	76f29a85-4ade-4630-b69b-5a23a1c16628	g.chrX:100871590C>A	ENST00000361910.4	-	3	365	c.21G>T	c.(19-21)gtG>gtT	p.V7V	ARMCX6_ENST00000497931.1_Intron|ARMCX6_ENST00000538627.1_Silent_p.V7V|ARMCX6_ENST00000539247.1_Silent_p.V7V	NM_019007.3	NP_061880.2	Q7L4S7	ARMX6_HUMAN	armadillo repeat containing, X-linked 6	7						integral component of membrane (GO:0016021)				endometrium(3)|kidney(1)|liver(2)|lung(3)	9						CCATCCAACCCACTTCCCGAG	0.592																																					p.V7V		Atlas-SNP	.											.	ARMCX6	21	.	0			c.G21T						.						55.0	47.0	50.0					X																	100871590		2203	4300	6503	SO:0001819	synonymous_variant	54470	exon4			CCAACCCACTTCC	BC007677	CCDS14488.1	Xq21.33-q22.3	2014-03-21			ENSG00000198960	ENSG00000198960		"""Armadillo repeat containing"""	26094	protein-coding gene	gene with protein product						16221301, 22569362	Standard	NM_001184768		Approved	FLJ20811, GASP10	uc004ehy.3	Q7L4S7	OTTHUMG00000022034	ENST00000361910.4:c.21G>T	chrX.hg19:g.100871590C>A		96.0	0.0		120.0	49.0	NM_001184768	Q9NWJ3	Silent	SNP	ENST00000361910.4	hg19	CCDS14488.1																																																																																			.	.		0.592	ARMCX6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057562.1	NM_019007	
SLC6A14	11254	hgsc.bcm.edu	37	X	115577963	115577963	+	Silent	SNP	A	A	G			TCGA-2Y-A9GT-01A-11D-A382-10	TCGA-2Y-A9GT-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38c5baf0-5376-42d2-b545-89f5c606b05e	76f29a85-4ade-4630-b69b-5a23a1c16628	g.chrX:115577963A>G	ENST00000371900.4	+	7	934	c.846A>G	c.(844-846)cgA>cgG	p.R282R		NM_007231.3	NP_009162.1	Q9UN76	S6A14_HUMAN	solute carrier family 6 (amino acid transporter), member 14	282					amino acid transmembrane transport (GO:0003333)|amino acid transport (GO:0006865)|cellular amino acid metabolic process (GO:0006520)|ion transport (GO:0006811)|response to toxic substance (GO:0009636)|transmembrane transport (GO:0055085)|transport (GO:0006810)	brush border membrane (GO:0031526)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	amino acid transmembrane transporter activity (GO:0015171)|neurotransmitter:sodium symporter activity (GO:0005328)			breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(8)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(1)	23					L-Proline(DB00172)|Valaciclovir(DB00577)|Valganciclovir(DB01610)	TGTTAGTACGAGGTGCAACTC	0.363																																					p.R282R		Atlas-SNP	.											.	SLC6A14	56	.	0			c.A846G						.						107.0	105.0	106.0					X																	115577963		2203	4300	6503	SO:0001819	synonymous_variant	11254	exon7			AGTACGAGGTGCA	AF151978	CCDS14570.1	Xq23	2013-05-22			ENSG00000087916	ENSG00000268104		"""Solute carriers"""	11047	protein-coding gene	gene with protein product		300444	"""solute carrier family 6 (neurotransmitter transporter), member 14"""			10446133	Standard	NM_007231		Approved		uc004eqi.3	Q9UN76	OTTHUMG00000022245	ENST00000371900.4:c.846A>G	chrX.hg19:g.115577963A>G		190.0	0.0		249.0	101.0	NM_007231	Q5H942	Silent	SNP	ENST00000371900.4	hg19	CCDS14570.1																																																																																			.	.		0.363	SLC6A14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057986.1		
MT-CO3	4514	hgsc.bcm.edu	37	M	9343	9343	+	Missense_Mutation	SNP	G	G	A			TCGA-2Y-A9GT-01A-11D-A382-10	TCGA-2Y-A9GT-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38c5baf0-5376-42d2-b545-89f5c606b05e	76f29a85-4ade-4630-b69b-5a23a1c16628	g.chrM:9343G>A	ENST00000362079.2	+	1	137	c.137G>A	c.(136-138)gGc>gAc	p.G46D	MT-TS2_ENST00000387449.1_RNA|MT-TL2_ENST00000387456.1_RNA|MT-TH_ENST00000387441.1_RNA|MT-TD_ENST00000387419.1_RNA|MT-TK_ENST00000387421.1_RNA|MT-ND5_ENST00000361567.2_5'Flank|MT-TG_ENST00000387429.1_RNA|MT-ND3_ENST00000361227.2_5'Flank|MT-ND4L_ENST00000361335.1_5'Flank|MT-TR_ENST00000387439.1_RNA|MT-ND4_ENST00000361381.2_5'Flank|MT-TS1_ENST00000387416.2_RNA			P00414	COX3_HUMAN	mitochondrially encoded cytochrome c oxidase III	46					aerobic electron transport chain (GO:0019646)|cellular metabolic process (GO:0044237)|respiratory chain complex IV assembly (GO:0008535)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|respiratory chain complex IV (GO:0045277)	cytochrome-c oxidase activity (GO:0004129)			breast(1)|endometrium(10)|kidney(14)|lung(1)|urinary_tract(1)	27						CCTCATACTAGGCCTACTAAC	0.532																																					p.G46D		Atlas-SNP	.											.	.	.	.	0			c.G137A						.																																			SO:0001583	missense	5742	exon1			TACTAGGCCTACT			mitochondria	2012-11-16	2005-02-15	2005-02-16	ENSG00000198938	ENSG00000198938		"""Mitochondrial respiratory chain complex / Complex IV"""	7422	protein-coding gene	gene with protein product		516050	"""cytochrome c oxidase III"""	MTCO3			Standard			Approved	COX3, COIII, CO3		P00414		ENST00000362079.2:c.137G>A	chrM.hg19:g.9343G>A	ENSP00000354982:p.Gly46Asp	4.0	0.0		31.0	9.0	ENST00000362079	Q14Y83	Missense_Mutation	SNP	ENST00000362079.2	hg19																																																																																				.	.		0.532	MT-CO3-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024032	
INO80	54617	hgsc.bcm.edu	37	15	41280125	41280125	+	Frame_Shift_Del	DEL	G	G	-			TCGA-2Y-A9GT-01A-11D-A382-10	TCGA-2Y-A9GT-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38c5baf0-5376-42d2-b545-89f5c606b05e	76f29a85-4ade-4630-b69b-5a23a1c16628	g.chr15:41280125delG	ENST00000361937.3	-	30	4042	c.3618delC	c.(3616-3618)gccfs	p.A1206fs	INO80_ENST00000561244.1_5'UTR|INO80_ENST00000401393.3_Frame_Shift_Del_p.A1206fs			Q9ULG1	INO80_HUMAN	INO80 complex subunit	1206	Assembles INO80 complex module consisting of conserved components INO80B, INO80C, ACTR5, RVBL1, RVBL2.|Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				ATP catabolic process (GO:0006200)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|chromatin remodeling (GO:0006338)|DNA duplex unwinding (GO:0032508)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|mitotic sister chromatid segregation (GO:0000070)|positive regulation of cell growth (GO:0030307)|positive regulation of nuclear cell cycle DNA replication (GO:0010571)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of G1/S transition of mitotic cell cycle (GO:2000045)|spindle assembly (GO:0051225)|UV-damage excision repair (GO:0070914)	Ino80 complex (GO:0031011)|microtubule (GO:0005874)|nucleus (GO:0005634)	alpha-tubulin binding (GO:0043014)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)			NS(1)|breast(4)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(10)|ovary(3)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	49						CCCTGTCCATGGCCTGCTGGT	0.498																																					p.M1207fs		Atlas-Indel,Pindel	.											.	INO80	122	.	0			c.3619delA						.						143.0	141.0	141.0					15																	41280125		2203	4300	6503	SO:0001589	frameshift_variant	54617	exon30			.	AB033085	CCDS10071.1	15q15.1	2013-08-21	2013-08-21	2008-08-07	ENSG00000128908	ENSG00000128908	3.6.1.3	"""INO80 complex subunits"""	26956	protein-coding gene	gene with protein product	"""INO80 complex subunit A"""	610169	"""INO80 complex homolog 1 (S. cerevisiae)"", ""INO80 homolog (S. cerevisiae)"""	INOC1		16298340, 16230350, 20237820	Standard	NM_017553		Approved	KIAA1259, Ino80, hINO80, INO80A	uc001zni.3	Q9ULG1	OTTHUMG00000130209	ENST00000361937.3:c.3618delC	chr15.hg19:g.41280125delG	ENSP00000355205:p.Ala1206fs	178.0	0.0		151.0	37.0	NM_017553	A6H8X4|Q9NTG6	Frame_Shift_Del	DEL	ENST00000361937.3	hg19	CCDS10071.1																																																																																			.	.		0.498	INO80-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252527.2	NM_017553	
MTSS1	9788	hgsc.bcm.edu	37	8	125565324	125565324	+	Frame_Shift_Del	DEL	G	G	-			TCGA-2Y-A9GT-01A-11D-A382-10	TCGA-2Y-A9GT-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38c5baf0-5376-42d2-b545-89f5c606b05e	76f29a85-4ade-4630-b69b-5a23a1c16628	g.chr8:125565324delG	ENST00000518547.1	-	14	2650	c.2177delC	c.(2176-2178)ccafs	p.P726fs	MTSS1_ENST00000325064.5_Frame_Shift_Del_p.P730fs|MTSS1_ENST00000354184.4_Frame_Shift_Del_p.P444fs|NDUFB9_ENST00000522532.1_Intron|MTSS1_ENST00000523587.1_5'UTR|MTSS1_ENST00000431961.2_Frame_Shift_Del_p.P444fs|MTSS1_ENST00000395508.2_Frame_Shift_Del_p.P500fs|MTSS1_ENST00000378017.3_Frame_Shift_Del_p.P701fs|MTSS1_ENST00000524090.1_Frame_Shift_Del_p.P616fs	NM_001282971.1|NM_014751.4	NP_001269900.1|NP_055566.3	O43312	MTSS1_HUMAN	metastasis suppressor 1	726	Pro-rich.				actin cytoskeleton organization (GO:0030036)|actin filament polymerization (GO:0030041)|adherens junction maintenance (GO:0034334)|bone mineralization (GO:0030282)|cell adhesion (GO:0007155)|cellular component movement (GO:0006928)|cellular response to fluid shear stress (GO:0071498)|epithelial cell proliferation involved in renal tubule morphogenesis (GO:2001013)|filopodium assembly (GO:0046847)|glomerulus morphogenesis (GO:0072102)|in utero embryonic development (GO:0001701)|magnesium ion homeostasis (GO:0010960)|microspike assembly (GO:0030035)|negative regulation of epithelial cell proliferation (GO:0050680)|nephron tubule epithelial cell differentiation (GO:0072160)|positive regulation of actin filament bundle assembly (GO:0032233)|renal tubule morphogenesis (GO:0061333)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	actin cytoskeleton (GO:0015629)|adherens junction (GO:0005912)|cytoplasm (GO:0005737)|endocytic vesicle (GO:0030139)|ruffle (GO:0001726)	actin monomer binding (GO:0003785)|identical protein binding (GO:0042802)|receptor binding (GO:0005102)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(5)|lung(14)|ovary(1)|prostate(2)|skin(1)|stomach(1)|urinary_tract(1)	37	Ovarian(258;0.00438)|all_neural(195;0.00459)|Hepatocellular(40;0.108)		STAD - Stomach adenocarcinoma(47;0.00288)			TTCTCCTTGTGGAGTATCCCT	0.557																																					p.P726fs	Esophageal Squamous(160;622 1893 3862 8546 12509)	Atlas-Indel,Pindel	.											.	MTSS1	79	.	0			c.2178delA						.						220.0	216.0	217.0					8																	125565324		2203	4300	6503	SO:0001589	frameshift_variant	9788	exon14			.	AF086645	CCDS6353.1, CCDS64968.1, CCDS64969.1	8p22	2008-02-05			ENSG00000170873	ENSG00000170873			20443	protein-coding gene	gene with protein product		608486				12482861, 12082544	Standard	XM_005251111		Approved	KIAA0429, MIMA, MIMB, MIM	uc003yrk.2	O43312	OTTHUMG00000048189	ENST00000518547.1:c.2177delC	chr8.hg19:g.125565324delG	ENSP00000429064:p.Pro726fs	148.0	0.0		110.0	23.0	NM_014751	J3KNK6|Q8TCA2|Q96RX2	Frame_Shift_Del	DEL	ENST00000518547.1	hg19	CCDS6353.1																																																																																			.	.		0.557	MTSS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109625.3	NM_014751	
SLC7A9	11136	hgsc.bcm.edu	37	19	33355006	33355008	+	In_Frame_Del	DEL	GGC	GGC	-	rs140134166	byFrequency	TCGA-2Y-A9GT-01A-11D-A382-10	TCGA-2Y-A9GT-10A-01D-A385-10	GGC	GGC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38c5baf0-5376-42d2-b545-89f5c606b05e	76f29a85-4ade-4630-b69b-5a23a1c16628	g.chr19:33355006_33355008delGGC	ENST00000023064.4	-	4	663_665	c.472_474delGCC	c.(472-474)gccdel	p.A158del	RN7SKP22_ENST00000365097.1_RNA|SLC7A9_ENST00000590341.1_In_Frame_Del_p.A158del|SLC7A9_ENST00000587772.1_In_Frame_Del_p.A158del	NM_001126335.1|NM_001243036.1|NM_014270.4	NP_001119807.1|NP_001229965.1|NP_055085.1	P82251	BAT1_HUMAN	solute carrier family 7 (amino acid transporter light chain, bo,+ system), member 9	158			A -> AA (in CSNU). {ECO:0000269|PubMed:11157794}.		amino acid transport (GO:0006865)|blood coagulation (GO:0007596)|cellular amino acid metabolic process (GO:0006520)|ion transport (GO:0006811)|L-cystine transport (GO:0015811)|leukocyte migration (GO:0050900)|neutral amino acid transport (GO:0015804)|protein complex assembly (GO:0006461)|transmembrane transport (GO:0055085)|transport (GO:0006810)	brush border membrane (GO:0031526)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	amino acid transmembrane transporter activity (GO:0015171)|L-cystine transmembrane transporter activity (GO:0015184)|neutral amino acid transmembrane transporter activity (GO:0015175)|peptide antigen binding (GO:0042605)	p.A158T(1)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(12)|ovary(1)|prostate(1)|skin(3)|urinary_tract(1)	32	Esophageal squamous(110;0.137)				L-Cystine(DB00138)	ACTCACAGATGGCGGCGGCGGCC	0.606																																					p.158_159del	GBM(181;1335 2108 9644 44178 46689)	Atlas-Indel,Pindel	.											.	SLC7A9	78	.	1	Substitution - Missense(1)	large_intestine(1)	c.473_475del						.																																			SO:0001651	inframe_deletion	11136	exon4			.	AF141289	CCDS12425.1	19q13.11	2013-07-19	2013-07-19		ENSG00000021488	ENSG00000021488		"""Solute carriers"""	11067	protein-coding gene	gene with protein product		604144		CSNU3		10471498	Standard	NM_014270		Approved		uc021usa.1	P82251	OTTHUMG00000180287	ENST00000023064.4:c.472_474delGCC	chr19.hg19:g.33355015_33355017delGGC	ENSP00000023064:p.Ala158del	142.0	0.0		72.0	23.0	NM_001243036	B2R9A6	In_Frame_Del	DEL	ENST00000023064.4	hg19	CCDS12425.1																																																																																			.	.		0.606	SLC7A9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450585.1		
L3MBTL1	26013	hgsc.bcm.edu	37	20	42164801	42164808	+	Frame_Shift_Del	DEL	TGCCTCTC	TGCCTCTC	-			TCGA-2Y-A9GT-01A-11D-A382-10	TCGA-2Y-A9GT-10A-01D-A385-10	TGCCTCTC	TGCCTCTC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38c5baf0-5376-42d2-b545-89f5c606b05e	76f29a85-4ade-4630-b69b-5a23a1c16628	g.chr20:42164801_42164808delTGCCTCTC	ENST00000427442.2	+	18	2083_2090	c.1924_1931delTGCCTCTC	c.(1924-1932)tgcctctcafs	p.CLS642fs	L3MBTL1_ENST00000373135.3_Frame_Shift_Del_p.CLS574fs|L3MBTL1_ENST00000444063.1_Frame_Shift_Del_p.CLS574fs|L3MBTL1_ENST00000418998.1_Frame_Shift_Del_p.CLS642fs|L3MBTL1_ENST00000373134.1_Frame_Shift_Del_p.CLS579fs			Q9Y468	LMBL1_HUMAN	l(3)mbt-like 1 (Drosophila)	574					chromatin modification (GO:0016568)|hemopoiesis (GO:0030097)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of cell cycle (GO:0051726)|regulation of megakaryocyte differentiation (GO:0045652)|regulation of mitosis (GO:0007088)|transcription, DNA-templated (GO:0006351)	chromatin (GO:0000785)|condensed chromosome (GO:0000793)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|histone binding (GO:0042393)|identical protein binding (GO:0042802)|methylated histone binding (GO:0035064)|nucleosomal histone binding (GO:0031493)|nucleosome binding (GO:0031491)|SAM domain binding (GO:0032093)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(1)|large_intestine(3)|ovary(1)|skin(2)	7						AGCTCACCATTGCCTCTCAGGCTGCCCA	0.591																																					p.641_644del		Atlas-Indel,Pindel	.											.	L3MBTL1	105	.	0			c.1923_1930del						.																																			SO:0001589	frameshift_variant	26013	exon18			.	U89358	CCDS13319.1, CCDS46602.1, CCDS46602.2	20q13.12	2013-01-10	2010-09-03	2010-09-03	ENSG00000185513	ENSG00000185513		"""Zinc fingers, C2HC-type containing"", ""Sterile alpha motif (SAM) domain containing"""	15905	protein-coding gene	gene with protein product	"""lethal (3) malignant brain tumor l(3)"""	608802	"""l(3)mbt (Drosophila)-like"", ""l(3)mbt-like (Drosophila)"""	L3MBTL		10445843, 17540172	Standard	NM_032107		Approved	ZC2HC3, dJ138B7.3, DKFZp586P1522, KIAA0681	uc010zwh.2	Q9Y468	OTTHUMG00000032503	ENST00000427442.2:c.1924_1931delTGCCTCTC	chr20.hg19:g.42164801_42164808delTGCCTCTC	ENSP00000402107:p.Cys642fs	108.0	0.0		88.0	17.0	NM_032107	B4DRC9|E1P5W7|Q5H8Y8|Q5H8Y9|Q8IUV7|Q9H1E6|Q9H1G5|Q9UG06|Q9UJB9|Q9Y4C9	Frame_Shift_Del	DEL	ENST00000427442.2	hg19	CCDS46602.2																																																																																			.	.		0.591	L3MBTL1-007	KNOWN	upstream_ATG|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000079300.3	NM_032107	
NEFH	4744	hgsc.bcm.edu	37	22	29885589	29885590	+	In_Frame_Ins	INS	-	-	CCCCTGAGAAGGCCAAGT	rs200984527|rs267607533		TCGA-2Y-A9GT-01A-11D-A382-10	TCGA-2Y-A9GT-10A-01D-A385-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38c5baf0-5376-42d2-b545-89f5c606b05e	76f29a85-4ade-4630-b69b-5a23a1c16628	g.chr22:29885589_29885590insCCCCTGAGAAGGCCAAGT	ENST00000310624.6	+	4	1993_1994	c.1960_1961insCCCCTGAGAAGGCCAAGT	c.(1960-1962)tcc>tCCCCTGAGAAGGCCAAGTcc	p.654_654S>SPEKAKS		NM_021076.3	NP_066554.2	P12036	NFH_HUMAN	neurofilament, heavy polypeptide	660	30 X 6 AA repeats of K-S-P-[AEPV]-[EAK]- [AEVK].|Tail.				axon development (GO:0061564)|axonogenesis (GO:0007409)|cell death (GO:0008219)|cell projection assembly (GO:0030031)|microtubule cytoskeleton organization (GO:0000226)|neurofilament bundle assembly (GO:0033693)|peripheral nervous system neuron axonogenesis (GO:0048936)|regulation of organelle transport along microtubule (GO:1902513)	axon (GO:0030424)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|neurofibrillary tangle (GO:0097418)|neurofilament (GO:0005883)	dynein binding (GO:0045502)|kinesin binding (GO:0019894)|microtubule binding (GO:0008017)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(12)|ovary(2)|skin(3)	30						GAAGGCCAAGTCCCCAGAGAAG	0.559																																					p.S654delinsSPEKAKS		Atlas-INDEL	.											.,4	NEFH	178	.	0			c.1960_1961insCCCCTGAGAAGGCCAAGT						.																																			SO:0001652	inframe_insertion	4744	exon4			.		CCDS13858.1	22q12.2	2013-01-16	2008-09-19		ENSG00000100285	ENSG00000100285		"""Intermediate filaments type IV"""	7737	protein-coding gene	gene with protein product		162230	"""neurofilament, heavy polypeptide 200kDa"""				Standard	NM_021076		Approved		uc003afo.3	P12036	OTTHUMG00000151155	ENST00000310624.6:c.1943_1960dupCCCCTGAGAAGGCCAAGT	chr22.hg19:g.29885589_29885590insCCCCTGAGAAGGCCAAGT	ENSP00000311997:p.ProGluLysAlaLysSer654dup	309.0	0.0		249.0	66.0	NM_021076	B4DYY4|Q96HF8|Q9UJS7|Q9UQ14	In_Frame_Ins	INS	ENST00000310624.6	hg19	CCDS13858.1																																																																																			.	.		0.559	NEFH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321553.2	NM_021076	
PVRL1	5818	hgsc.bcm.edu	37	11	119508882	119508883	+	Frame_Shift_Ins	INS	-	-	G			TCGA-2Y-A9GT-01A-11D-A382-10	TCGA-2Y-A9GT-10A-01D-A385-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38c5baf0-5376-42d2-b545-89f5c606b05e	76f29a85-4ade-4630-b69b-5a23a1c16628	g.chr11:119508882_119508883insG	ENST00000341398.2	-	8	1301_1302	c.1302_1303insC	c.(1300-1305)ccctacfs	p.Y435fs	RP11-196E1.3_ENST00000601999.1_RNA|RP11-196E1.3_ENST00000532153.1_RNA	NM_203285.1	NP_976030.1	Q15223	PVRL1_HUMAN	poliovirus receptor-related 1 (herpesvirus entry mediator C)	0					adherens junction organization (GO:0034332)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|desmosome organization (GO:0002934)|enamel mineralization (GO:0070166)|heterophilic cell-cell adhesion (GO:0007157)|homophilic cell adhesion (GO:0007156)|immune response (GO:0006955)|iron ion transport (GO:0006826)|lens morphogenesis in camera-type eye (GO:0002089)|regulation of synapse assembly (GO:0051963)|retina development in camera-type eye (GO:0060041)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|viral entry into host cell (GO:0046718)	adherens junction (GO:0005912)|axon (GO:0030424)|cell-cell adherens junction (GO:0005913)|extracellular region (GO:0005576)|growth cone membrane (GO:0032584)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|plasma membrane (GO:0005886)|synapse (GO:0045202)	carbohydrate binding (GO:0030246)|cell adhesion molecule binding (GO:0050839)|coreceptor activity (GO:0015026)|protein homodimerization activity (GO:0042803)|virion binding (GO:0046790)|virus receptor activity (GO:0001618)			breast(1)|endometrium(3)|kidney(2)|large_intestine(9)|liver(1)|lung(7)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	27		Breast(348;0.037)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;4.29e-05)		AGATCATAGTAGGGGGGCTGCA	0.629																																					p.Y435fs		Atlas-Indel,Pindel	.											.	PVRL1	133	.	0			c.1303_1304insC						.																																			SO:0001589	frameshift_variant	5818	exon8			.	X76400	CCDS8425.1, CCDS8426.1, CCDS8427.1	11q23-q24	2013-01-29	2007-06-07		ENSG00000110400	ENSG00000110400		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9706	protein-coding gene	gene with protein product	"""nectin"""	600644		HVEC, ED4		7721102, 9616127	Standard	NM_203285		Approved	PRR, PRR1, PVRR1, SK-12, HIgR, CLPED1, CD111, OFC7	uc001pwv.3	Q15223	OTTHUMG00000166177	ENST00000341398.2:c.1303dupC	chr11.hg19:g.119508888_119508888dupG	ENSP00000344974:p.Tyr435fs	104.0	0.0		51.0	16.0	NM_203285	O75465|Q2M3D3|Q9HBE6|Q9HBW2	Frame_Shift_Ins	INS	ENST00000341398.2	hg19	CCDS8425.1																																																																																			.	.		0.629	PVRL1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000388230.1		
