#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ARHGEF16	27237	hgsc.bcm.edu	37	1	3390035	3390035	+	Silent	SNP	C	C	T			TCGA-2Y-A9GV-01A-11D-A382-10	TCGA-2Y-A9GV-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bbb0ee98-a0a5-4308-96f6-1ba7f5b71fef	c00cd9c3-fd3e-497f-94dd-30cfb18e4aa2	g.chr1:3390035C>T	ENST00000378378.4	+	8	1659	c.1254C>T	c.(1252-1254)tcC>tcT	p.S418S	ARHGEF16_ENST00000378371.2_Silent_p.S130S|ARHGEF16_ENST00000413250.2_Silent_p.S122S|ARHGEF16_ENST00000378373.1_Silent_p.S130S	NM_014448.3	NP_055263.2	Q5VV41	ARHGG_HUMAN	Rho guanine nucleotide exchange factor (GEF) 16	418	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.|Required for RHOG activation and mediates interaction with EPHA2.				activation of Cdc42 GTPase activity (GO:0032864)|activation of Rac GTPase activity (GO:0032863)|apoptotic signaling pathway (GO:0097190)|cell chemotaxis (GO:0060326)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	PDZ domain binding (GO:0030165)|receptor tyrosine kinase binding (GO:0030971)|Rho GTPase binding (GO:0017048)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			lung(6)|ovary(1)	7	all_cancers(77;0.00276)|all_epithelial(69;0.00102)|Ovarian(185;0.0634)|Lung NSC(156;0.0969)|all_lung(157;0.101)	all_epithelial(116;7.14e-21)|all_lung(118;2.24e-08)|Lung NSC(185;3.55e-06)|Breast(487;0.000765)|Renal(390;0.00121)|Hepatocellular(190;0.0046)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0308)|Lung SC(97;0.0847)|Medulloblastoma(700;0.211)		Epithelial(90;8.62e-38)|OV - Ovarian serous cystadenocarcinoma(86;3.62e-22)|GBM - Glioblastoma multiforme(42;2.49e-12)|Colorectal(212;4.25e-05)|COAD - Colon adenocarcinoma(227;0.000196)|Kidney(185;0.000342)|BRCA - Breast invasive adenocarcinoma(365;0.000681)|KIRC - Kidney renal clear cell carcinoma(229;0.00549)|STAD - Stomach adenocarcinoma(132;0.00644)|Lung(427;0.201)		CCATGCTCTCCTTCCTGATCC	0.672																																					p.S418S		Atlas-SNP	.											.	ARHGEF16	76	.	0			c.C1254T						.						50.0	64.0	59.0					1																	3390035		2203	4298	6501	SO:0001819	synonymous_variant	27237	exon8			GCTCTCCTTCCTG	D89016	CCDS46.2	1p36.3	2013-01-10	2010-04-13		ENSG00000130762	ENSG00000130762		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	15515	protein-coding gene	gene with protein product	"""putative neuroblastoma protein"""						Standard	NM_014448		Approved	NBR, GEF16	uc001akg.4	Q5VV41	OTTHUMG00000000625	ENST00000378378.4:c.1254C>T	chr1.hg19:g.3390035C>T		90.0	0.0		80.0	12.0	NM_014448	Q86TF0|Q99434	Silent	SNP	ENST00000378378.4	hg19	CCDS46.2																																																																																			.	.		0.672	ARHGEF16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000001515.1	NM_014448	
SPOCD1	90853	hgsc.bcm.edu	37	1	32256885	32256885	+	Missense_Mutation	SNP	C	C	G			TCGA-2Y-A9GV-01A-11D-A382-10	TCGA-2Y-A9GV-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bbb0ee98-a0a5-4308-96f6-1ba7f5b71fef	c00cd9c3-fd3e-497f-94dd-30cfb18e4aa2	g.chr1:32256885C>G	ENST00000360482.2	-	16	3099	c.2970G>C	c.(2968-2970)tgG>tgC	p.W990C	RP11-84A19.3_ENST00000527035.1_RNA|SPOCD1_ENST00000257100.3_Intron|SPOCD1_ENST00000373648.2_3'UTR|SPOCD1_ENST00000533231.1_Intron	NM_144569.4	NP_653170.3	Q6ZMY3	SPOC1_HUMAN	SPOC domain containing 1	990					negative regulation of phosphatase activity (GO:0010923)|transcription, DNA-templated (GO:0006351)					NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|liver(1)|lung(7)|ovary(6)|prostate(1)|skin(3)|stomach(1)|urinary_tract(2)	37		Myeloproliferative disorder(586;0.0393)|all_neural(195;0.186)|Ovarian(437;0.199)		STAD - Stomach adenocarcinoma(196;0.18)		CAGGAAGAGCCCAAAGGCCTG	0.577																																					p.W990C		Atlas-SNP	.											.	SPOCD1	109	.	0			c.G2970C						.						21.0	24.0	23.0					1																	32256885		2203	4299	6502	SO:0001583	missense	90853	exon16			AAGAGCCCAAAGG	AK058077	CCDS347.1, CCDS60066.1, CCDS72748.1	1p35.1	2014-06-13			ENSG00000134668	ENSG00000134668			26338	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 146"""					12477932	Standard	NM_144569		Approved	FLJ25348, PPP1R146	uc001bts.1	Q6ZMY3	OTTHUMG00000003879	ENST00000360482.2:c.2970G>C	chr1.hg19:g.32256885C>G	ENSP00000353670:p.Trp990Cys	85.0	0.0		62.0	14.0	NM_144569	Q24JU3|Q6PI90|Q8N869|Q8N8U0|Q8NBC6|Q96LN6	Missense_Mutation	SNP	ENST00000360482.2	hg19	CCDS347.1	.	.	.	.	.	.	.	.	.	.	C	8.624	0.892083	0.17613	.	.	ENSG00000134668	ENST00000360482	T	0.22743	1.94	4.44	2.06	0.26882	.	.	.	.	.	T	0.14527	0.0351	N	0.14661	0.345	0.09310	N	1	D	0.58620	0.983	P	0.46975	0.533	T	0.12142	-1.0559	9	0.45353	T	0.12	12.3231	7.7734	0.29021	0.0:0.8254:0.0:0.1746	.	990	Q6ZMY3	SPOC1_HUMAN	C	990	ENSP00000353670:W990C	ENSP00000353670:W990C	W	-	3	0	SPOCD1	32029472	0.000000	0.05858	0.000000	0.03702	0.042000	0.13812	0.588000	0.23924	0.335000	0.23614	0.655000	0.94253	TGG	.	.		0.577	SPOCD1-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000381912.1	NM_144569	
KIAA0907	22889	hgsc.bcm.edu	37	1	155896529	155896529	+	Missense_Mutation	SNP	G	G	C			TCGA-2Y-A9GV-01A-11D-A382-10	TCGA-2Y-A9GV-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bbb0ee98-a0a5-4308-96f6-1ba7f5b71fef	c00cd9c3-fd3e-497f-94dd-30cfb18e4aa2	g.chr1:155896529G>C	ENST00000368321.3	-	6	642	c.619C>G	c.(619-621)Cag>Gag	p.Q207E	KIAA0907_ENST00000368320.3_Missense_Mutation_p.Q207E|KIAA0907_ENST00000482337.1_5'UTR|KIAA0907_ENST00000368319.3_Missense_Mutation_p.Q207E|SCARNA4_ENST00000516999.1_RNA	NM_014949.2	NP_055764.2	Q7Z7F0	K0907_HUMAN	KIAA0907	207							RNA binding (GO:0003723)			breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|liver(1)|lung(11)|urinary_tract(1)	21	Hepatocellular(266;0.133)|all_hematologic(923;0.145)|all_neural(408;0.195)		OV - Ovarian serous cystadenocarcinoma(3;8.82e-06)			GGTGCTGGCTGGTGATAGACA	0.463																																					p.Q207E		Atlas-SNP	.											.	KIAA0907	58	.	0			c.C619G						.						164.0	146.0	152.0					1																	155896529		2203	4300	6503	SO:0001583	missense	22889	exon6			CTGGCTGGTGATA	BC062637	CCDS30885.1	1q22	2012-11-30			ENSG00000132680	ENSG00000132680			29145	protein-coding gene	gene with protein product						10048485	Standard	NM_014949		Approved	BLOM7	uc001fmi.1	Q7Z7F0	OTTHUMG00000014103	ENST00000368321.3:c.619C>G	chr1.hg19:g.155896529G>C	ENSP00000357304:p.Gln207Glu	258.0	0.0		262.0	67.0	NM_014949	O94981|Q7L7Q2|Q7Z7E9|Q8TBQ0	Missense_Mutation	SNP	ENST00000368321.3	hg19	CCDS30885.1	.	.	.	.	.	.	.	.	.	.	G	18.75	3.689962	0.68271	.	.	ENSG00000132680	ENST00000368321;ENST00000368320;ENST00000368319	.	.	.	5.64	5.64	0.86602	.	0.000000	0.85682	D	0.000000	T	0.50650	0.1628	L	0.46157	1.445	0.80722	D	1	D;P;P;P	0.57257	0.979;0.73;0.677;0.949	P;B;B;P	0.56563	0.801;0.35;0.309;0.641	T	0.48658	-0.9016	9	0.02654	T	1	-6.8505	19.4873	0.95035	0.0:0.0:1.0:0.0	.	207;207;207;207	Q7Z7F0-4;Q7Z7F0-3;Q7Z7F0-2;Q7Z7F0	.;.;.;K0907_HUMAN	E	207	.	ENSP00000357302:Q207E	Q	-	1	0	KIAA0907	154163153	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	8.218000	0.89768	2.937000	0.99478	0.650000	0.86243	CAG	.	.		0.463	KIAA0907-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039583.1	NM_014949	
TEX35	84066	hgsc.bcm.edu	37	1	178491567	178491567	+	Missense_Mutation	SNP	G	G	A			TCGA-2Y-A9GV-01A-11D-A382-10	TCGA-2Y-A9GV-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bbb0ee98-a0a5-4308-96f6-1ba7f5b71fef	c00cd9c3-fd3e-497f-94dd-30cfb18e4aa2	g.chr1:178491567G>A	ENST00000319416.2	+	9	806	c.694G>A	c.(694-696)Gga>Aga	p.G232R	TEX35_ENST00000367642.3_3'UTR|TEX35_ENST00000258298.2_Intron|TEX35_ENST00000367641.3_3'UTR|TEX35_ENST00000367639.1_Intron	NM_032126.4	NP_115502.2			testis expressed 35																		ccagactgagggaaggtgaag	0.522																																					p.G232R		Atlas-SNP	.											.	TEX35	15	.	0			c.G694A						.						33.0	28.0	30.0					1																	178491567		2203	4300	6503	SO:0001583	missense	84066	exon9			ACTGAGGGAAGGT	AL136694	CCDS1323.1, CCDS53433.1, CCDS53434.1	1q25.2	2014-01-28	2012-06-29	2012-06-29	ENSG00000240021	ENSG00000240021			25366	protein-coding gene	gene with protein product	"""Testis-Specific Conserved gene 24kDa"""		"""chromosome 1 open reading frame 49"""	C1orf49		11230166, 17077512	Standard	NM_032126		Approved	DKFZP564J047, TSC24	uc001glt.2	Q5T0J7	OTTHUMG00000035023	ENST00000319416.2:c.694G>A	chr1.hg19:g.178491567G>A	ENSP00000323795:p.Gly232Arg	81.0	0.0		92.0	30.0	NM_032126		Missense_Mutation	SNP	ENST00000319416.2	hg19	CCDS1323.1	.	.	.	.	.	.	.	.	.	.	G	12.38	1.920638	0.33908	.	.	ENSG00000240021	ENST00000319416	T	0.24538	1.85	2.47	0.564	0.17302	.	.	.	.	.	T	0.11836	0.0288	N	0.08118	0	0.09310	N	0.999998	B	0.13145	0.007	B	0.15870	0.014	T	0.25950	-1.0117	9	0.87932	D	0	6.3536	4.5613	0.12161	0.3277:0.0:0.6723:0.0	.	232	Q5T0J7	CA049_HUMAN	R	232	ENSP00000323795:G232R	ENSP00000323795:G232R	G	+	1	0	C1orf49	176758190	0.036000	0.19791	0.004000	0.12327	0.070000	0.16714	0.551000	0.23361	0.150000	0.19136	-0.324000	0.08512	GGA	.	.		0.522	TEX35-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000084917.1	NM_032126	
OR2M2	391194	hgsc.bcm.edu	37	1	248343868	248343868	+	Missense_Mutation	SNP	T	T	C			TCGA-2Y-A9GV-01A-11D-A382-10	TCGA-2Y-A9GV-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bbb0ee98-a0a5-4308-96f6-1ba7f5b71fef	c00cd9c3-fd3e-497f-94dd-30cfb18e4aa2	g.chr1:248343868T>C	ENST00000359682.2	+	1	581	c.581T>C	c.(580-582)aTa>aCa	p.I194T		NM_001004688.1	NP_001004688.1	Q96R28	OR2M2_HUMAN	olfactory receptor, family 2, subfamily M, member 2	194						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(45)|ovary(3)|prostate(1)|skin(3)	70	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0245)			GACACATCAATATTTGAAGAG	0.413																																					p.I194T		Atlas-SNP	.											.	OR2M2	149	.	0			c.T581C						.						229.0	223.0	225.0					1																	248343868		2203	4300	6503	SO:0001583	missense	391194	exon1			CATCAATATTTGA	AF399616	CCDS31106.1	1q44	2012-08-09			ENSG00000198601	ENSG00000198601		"""GPCR / Class A : Olfactory receptors"""	8268	protein-coding gene	gene with protein product						12213199	Standard	NM_001004688		Approved	OST423, OR2M2Q	uc010pzf.2	Q96R28	OTTHUMG00000040460	ENST00000359682.2:c.581T>C	chr1.hg19:g.248343868T>C	ENSP00000352710:p.Ile194Thr	159.0	0.0		159.0	10.0	NM_001004688	A3KFT4	Missense_Mutation	SNP	ENST00000359682.2	hg19	CCDS31106.1	.	.	.	.	.	.	.	.	.	.	t	0.391	-0.923547	0.02377	.	.	ENSG00000198601	ENST00000359682	T	0.00183	8.6	1.88	-3.75	0.04372	GPCR, rhodopsin-like superfamily (1);	0.265846	0.19632	N	0.109647	T	0.00073	0.0002	N	0.17901	0.54	0.09310	N	1	B	0.12013	0.005	B	0.16289	0.015	T	0.30822	-0.9965	10	0.30078	T	0.28	.	4.1381	0.10181	0.5105:0.2708:0.0:0.2187	.	194	Q96R28	OR2M2_HUMAN	T	194	ENSP00000352710:I194T	ENSP00000352710:I194T	I	+	2	0	OR2M2	246410491	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.006000	0.12833	-1.226000	0.02574	-0.478000	0.04885	ATA	.	.		0.413	OR2M2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097356.2	NM_001004688	
TMEM150A	129303	hgsc.bcm.edu	37	2	85827014	85827014	+	Splice_Site	SNP	C	C	A			TCGA-2Y-A9GV-01A-11D-A382-10	TCGA-2Y-A9GV-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bbb0ee98-a0a5-4308-96f6-1ba7f5b71fef	c00cd9c3-fd3e-497f-94dd-30cfb18e4aa2	g.chr2:85827014C>A	ENST00000409668.1	-	5	863	c.396G>T	c.(394-396)caG>caT	p.Q132H	TMEM150A_ENST00000334462.5_Splice_Site_p.Q132H|TMEM150A_ENST00000306353.3_Splice_Site_p.Q79H			Q86TG1	T150A_HUMAN	transmembrane protein 150A	132					catabolic process (GO:0009056)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(2)|kidney(2)|lung(1)|skin(1)	7						GGGGAAGCACCTGAAAGTTGC	0.582																																					p.Q132H		Atlas-SNP	.											.	TMEM150A	15	.	0			c.G396T						.						95.0	89.0	91.0					2																	85827014		2203	4300	6503	SO:0001630	splice_region_variant	129303	exon6			AAGCACCTGAAAG	AK098152	CCDS33233.1	2p11.2	2009-06-12	2009-06-12	2009-06-12	ENSG00000168890	ENSG00000168890			24677	protein-coding gene	gene with protein product			"""transmembrane protein 150"""	TMEM150		10858565	Standard	NM_001031738		Approved	TM6P1, FLJ90024	uc002spy.2	Q86TG1	OTTHUMG00000130168	ENST00000409668.1:c.396+1G>T	chr2.hg19:g.85827014C>A		136.0	0.0		121.0	37.0	NM_001031738	A8K764|B7WPQ9|D6W5L2|Q8N2R6	Missense_Mutation	SNP	ENST00000409668.1	hg19	CCDS33233.1	.	.	.	.	.	.	.	.	.	.	C	19.97	3.924894	0.73213	.	.	ENSG00000168890	ENST00000306353;ENST00000334462;ENST00000409668	T;T;T	0.50277	0.75;0.75;0.75	5.27	5.27	0.74061	.	0.000000	0.85682	D	0.000000	T	0.75354	0.3838	M	0.91459	3.21	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.997	T	0.81210	-0.1036	9	.	.	.	-8.9487	16.3731	0.83371	0.0:1.0:0.0:0.0	.	79;132	Q86TG1-2;Q86TG1	.;T150A_HUMAN	H	79;132;132	ENSP00000302715:Q79H;ENSP00000334708:Q132H;ENSP00000387292:Q132H	.	Q	-	3	2	TMEM150A	85680525	1.000000	0.71417	1.000000	0.80357	0.751000	0.42716	3.570000	0.53834	2.472000	0.83506	0.561000	0.74099	CAG	.	.		0.582	TMEM150A-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329474.1	NM_153342	Missense_Mutation
TRIP12	9320	hgsc.bcm.edu	37	2	230723842	230723842	+	Missense_Mutation	SNP	C	C	T			TCGA-2Y-A9GV-01A-11D-A382-10	TCGA-2Y-A9GV-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bbb0ee98-a0a5-4308-96f6-1ba7f5b71fef	c00cd9c3-fd3e-497f-94dd-30cfb18e4aa2	g.chr2:230723842C>T	ENST00000283943.5	-	3	725	c.547G>A	c.(547-549)Gcc>Acc	p.A183T	TRIP12_ENST00000409677.1_Missense_Mutation_p.A225T|TRIP12_ENST00000389045.3_Intron|TRIP12_ENST00000543084.1_Missense_Mutation_p.A225T|TRIP12_ENST00000389044.4_Missense_Mutation_p.A225T	NM_001284214.1|NM_004238.1	NP_001271143.1|NP_004229.1	Q14669	TRIPC_HUMAN	thyroid hormone receptor interactor 12	183					cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|embryo development (GO:0009790)|negative regulation of double-strand break repair (GO:2000780)|negative regulation of histone H2A K63-linked ubiquitination (GO:1901315)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligase activity (GO:0016874)|thyroid hormone receptor binding (GO:0046966)|ubiquitin-protein transferase activity (GO:0004842)			breast(2)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(19)|lung(32)|ovary(5)|prostate(4)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	87		Renal(207;0.025)|all_hematologic(139;0.122)|all_lung(227;0.126)|Acute lymphoblastic leukemia(138;0.164)		Epithelial(121;4.76e-13)|all cancers(144;4.34e-10)|LUSC - Lung squamous cell carcinoma(224;0.00864)|Lung(119;0.0116)		GCTGAGGTGGCTGATTTTGAA	0.512																																					p.A183T		Atlas-SNP	.											.	TRIP12	207	.	0			c.G547A						.						59.0	54.0	55.0					2																	230723842		2203	4300	6503	SO:0001583	missense	9320	exon3			AGGTGGCTGATTT	L40383	CCDS33391.1, CCDS63145.1, CCDS63146.1	2q36.3	2008-05-27			ENSG00000153827	ENSG00000153827			12306	protein-coding gene	gene with protein product		604506				7776974	Standard	XM_005246961		Approved	KIAA0045	uc002vpw.1	Q14669	OTTHUMG00000153623	ENST00000283943.5:c.547G>A	chr2.hg19:g.230723842C>T	ENSP00000283943:p.Ala183Thr	91.0	0.0		86.0	27.0	NM_004238	D4HL82|Q14CA3|Q14CF1|Q15644|Q53R87|Q53TE7	Missense_Mutation	SNP	ENST00000283943.5	hg19	CCDS33391.1	.	.	.	.	.	.	.	.	.	.	C	27.8	4.860452	0.91433	.	.	ENSG00000153827	ENST00000283943;ENST00000389044;ENST00000543084;ENST00000409677;ENST00000453485	T;T	0.52295	0.67;0.67	5.72	5.72	0.89469	.	0.051447	0.85682	D	0.000000	T	0.35158	0.0922	N	0.24115	0.695	0.80722	D	1	B;B;B	0.26635	0.155;0.155;0.084	B;B;B	0.25759	0.063;0.063;0.063	T	0.19160	-1.0314	10	0.07644	T	0.81	.	19.8788	0.96888	0.0:1.0:0.0:0.0	.	183;225;183	D4HL82;Q14CA3;Q14669	.;.;TRIPC_HUMAN	T	183;225;225;225;53	ENSP00000283943:A183T;ENSP00000373696:A225T	ENSP00000283943:A183T	A	-	1	0	TRIP12	230432086	1.000000	0.71417	0.997000	0.53966	0.990000	0.78478	7.456000	0.80751	2.704000	0.92352	0.563000	0.77884	GCC	.	.		0.512	TRIP12-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000331861.3	NM_004238	
SLC22A14	9389	hgsc.bcm.edu	37	3	38347652	38347652	+	Silent	SNP	C	C	T			TCGA-2Y-A9GV-01A-11D-A382-10	TCGA-2Y-A9GV-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bbb0ee98-a0a5-4308-96f6-1ba7f5b71fef	c00cd9c3-fd3e-497f-94dd-30cfb18e4aa2	g.chr3:38347652C>T	ENST00000273173.4	+	1	226	c.135C>T	c.(133-135)caC>caT	p.H45H	RNU6-235P_ENST00000362644.1_RNA|SLC22A14_ENST00000448498.1_Silent_p.H45H	NM_004803.3	NP_004794.2	Q9Y267	S22AE_HUMAN	solute carrier family 22, member 14	45					organic cation transport (GO:0015695)	integral component of plasma membrane (GO:0005887)	organic cation transmembrane transporter activity (GO:0015101)			central_nervous_system(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(5)|prostate(2)|skin(1)	21				KIRC - Kidney renal clear cell carcinoma(284;0.0554)|Kidney(284;0.0696)		GGGCTGTCCACACCAAGCAGG	0.542																																					p.H45H		Atlas-SNP	.											.	SLC22A14	64	.	0			c.C135T						.						194.0	166.0	176.0					3																	38347652		2203	4300	6503	SO:0001819	synonymous_variant	9389	exon1			TGTCCACACCAAG	AB011082	CCDS2677.1	3p21.3	2013-05-22	2008-01-11	2003-10-15	ENSG00000144671	ENSG00000144671		"""Solute carriers"""	8495	protein-coding gene	gene with protein product		604048	"""organic cationic transporter-like 4"", ""solute carrier family 22 (organic cation transporter), member 14"""	ORCTL4		10072596	Standard	NM_004803		Approved	OCTL2	uc003cib.2	Q9Y267	OTTHUMG00000131082	ENST00000273173.4:c.135C>T	chr3.hg19:g.38347652C>T		190.0	0.0		140.0	35.0	NM_004803	A0AVS9|A1L4H6|B2RCX3|Q6DJT3	Silent	SNP	ENST00000273173.4	hg19	CCDS2677.1																																																																																			.	.		0.542	SLC22A14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253742.3	NM_004803	
DALRD3	55152	hgsc.bcm.edu	37	3	49055466	49055466	+	Missense_Mutation	SNP	G	G	C			TCGA-2Y-A9GV-01A-11D-A382-10	TCGA-2Y-A9GV-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bbb0ee98-a0a5-4308-96f6-1ba7f5b71fef	c00cd9c3-fd3e-497f-94dd-30cfb18e4aa2	g.chr3:49055466G>C	ENST00000341949.4	-	2	457	c.451C>G	c.(451-453)Cgc>Ggc	p.R151G	NDUFAF3_ENST00000326912.4_5'Flank|DALRD3_ENST00000441576.2_Missense_Mutation_p.R151G|DALRD3_ENST00000313778.5_5'UTR|DALRD3_ENST00000395462.4_5'UTR|NDUFAF3_ENST00000326925.6_5'Flank|MIR191_ENST00000384873.1_RNA|MIR425_ENST00000362162.1_RNA|DALRD3_ENST00000496568.1_5'UTR|DALRD3_ENST00000440857.1_5'UTR	NM_001009996.1	NP_001009996.1	Q5D0E6	DALD3_HUMAN	DALR anticodon binding domain containing 3	151					arginyl-tRNA aminoacylation (GO:0006420)		arginine-tRNA ligase activity (GO:0004814)|ATP binding (GO:0005524)			breast(2)|endometrium(2)|large_intestine(2)|lung(5)|skin(1)	12				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00218)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)		CCGTGAGCGCGCAGGGCTCGC	0.706																																					p.R151G		Atlas-SNP	.											.	DALRD3	57	.	0			c.C451G						.						5.0	6.0	6.0					3																	49055466		1921	3893	5814	SO:0001583	missense	55152	exon2			GAGCGCGCAGGGC	BC014099	CCDS2783.1, CCDS33754.1, CCDS63632.1	3p21.31	2005-01-10			ENSG00000178149	ENSG00000178149			25536	protein-coding gene	gene with protein product						12477932	Standard	NM_001009996		Approved	FLJ10496	uc003cvk.2	Q5D0E6	OTTHUMG00000156748	ENST00000341949.4:c.451C>G	chr3.hg19:g.49055466G>C	ENSP00000344989:p.Arg151Gly	57.0	0.0		42.0	16.0	NM_001009996	Q7Z5S7|Q86WY1|Q8N105|Q8NA89|Q9NVU8	Missense_Mutation	SNP	ENST00000341949.4	hg19	CCDS33754.1	.	.	.	.	.	.	.	.	.	.	G	22.4	4.286814	0.80803	.	.	ENSG00000178149	ENST00000441576;ENST00000341949;ENST00000420952	T;T;T	0.56941	0.48;0.53;0.43	4.92	3.98	0.46160	.	0.184247	0.44097	D	0.000491	T	0.51975	0.1706	L	0.50333	1.59	0.80722	D	1	P;P;P	0.46512	0.879;0.667;0.796	P;B;P	0.45343	0.452;0.397;0.477	T	0.59899	-0.7367	10	0.72032	D	0.01	-8.3772	13.9758	0.64273	0.0:0.0:0.8478:0.1522	.	151;151;151	B7Z727;Q5D0E6-2;Q5D0E6	.;.;DALD3_HUMAN	G	151;151;116	ENSP00000410623:R151G;ENSP00000344989:R151G;ENSP00000397385:R116G	ENSP00000344989:R151G	R	-	1	0	DALRD3	49030470	0.359000	0.24955	0.094000	0.20943	0.010000	0.07245	2.099000	0.41767	2.270000	0.75569	0.655000	0.94253	CGC	.	.		0.706	DALRD3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345581.1	NM_018114	
GPM6A	2823	hgsc.bcm.edu	37	4	176556177	176556177	+	Missense_Mutation	SNP	C	C	A			TCGA-2Y-A9GV-01A-11D-A382-10	TCGA-2Y-A9GV-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bbb0ee98-a0a5-4308-96f6-1ba7f5b71fef	c00cd9c3-fd3e-497f-94dd-30cfb18e4aa2	g.chr4:176556177C>A	ENST00000280187.7	-	8	761	c.716G>T	c.(715-717)tGg>tTg	p.W239L	GPM6A_ENST00000506219.1_5'UTR|GPM6A_ENST00000506894.1_Missense_Mutation_p.W228L|GPM6A_ENST00000515090.1_Missense_Mutation_p.W232L|GPM6A_ENST00000393658.2_Missense_Mutation_p.W239L	NM_005277.4	NP_005268.1	P51674	GPM6A_HUMAN	glycoprotein M6A	239					neural retina development (GO:0003407)|neuron migration (GO:0001764)|neuron projection morphogenesis (GO:0048812)|positive regulation of filopodium assembly (GO:0051491)|stem cell differentiation (GO:0048863)|synapse assembly (GO:0007416)	axonal growth cone (GO:0044295)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	calcium channel activity (GO:0005262)			NS(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(16)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	33		Breast(14;7.35e-05)|Melanoma(52;0.00909)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;9.21e-19)|Epithelial(43;3.01e-17)|OV - Ovarian serous cystadenocarcinoma(60;2.02e-09)|STAD - Stomach adenocarcinoma(60;0.00083)|GBM - Glioblastoma multiforme(59;0.00168)|LUSC - Lung squamous cell carcinoma(193;0.0388)		CACATAGGCCCAGTTGGCAGA	0.428																																					p.W239L		Atlas-SNP	.											.	GPM6A	70	.	0			c.G716T						.						78.0	73.0	75.0					4																	176556177		2203	4300	6503	SO:0001583	missense	2823	exon7			TAGGCCCAGTTGG		CCDS3824.1, CCDS54822.1, CCDS58936.1	4q34	2008-08-29				ENSG00000150625			4460	protein-coding gene	gene with protein product		601275		GPM6		8661015, 18574501	Standard	NM_005277		Approved		uc003iug.4	P51674		ENST00000280187.7:c.716G>T	chr4.hg19:g.176556177C>A	ENSP00000280187:p.Trp239Leu	75.0	0.0		73.0	14.0	NM_201591	B7Z642|E9PHI5|Q92602	Missense_Mutation	SNP	ENST00000280187.7	hg19	CCDS3824.1	.	.	.	.	.	.	.	.	.	.	C	33	5.212976	0.95069	.	.	ENSG00000150625	ENST00000280187;ENST00000393658;ENST00000506894;ENST00000515090	D;D;D;D	0.99207	-5.56;-5.56;-5.56;-5.56	5.77	5.77	0.91146	.	0.000000	0.85682	D	0.000000	D	0.99165	0.9711	L	0.46157	1.445	0.80722	D	1	D;D;D	0.69078	0.997;0.997;0.997	D;D;D	0.81914	0.995;0.995;0.995	D	0.99906	1.1182	10	0.72032	D	0.01	-12.5234	20.3627	0.98863	0.0:1.0:0.0:0.0	.	232;228;239	B7Z642;E9PHI5;P51674	.;.;GPM6A_HUMAN	L	239;239;228;232	ENSP00000280187:W239L;ENSP00000377268:W239L;ENSP00000421578:W228L;ENSP00000423984:W232L	ENSP00000280187:W239L	W	-	2	0	GPM6A	176793171	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.445000	0.80570	2.885000	0.99019	0.655000	0.94253	TGG	.	.		0.428	GPM6A-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362163.1		
IRX4	50805	hgsc.bcm.edu	37	5	1878600	1878600	+	Missense_Mutation	SNP	T	T	A			TCGA-2Y-A9GV-01A-11D-A382-10	TCGA-2Y-A9GV-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bbb0ee98-a0a5-4308-96f6-1ba7f5b71fef	c00cd9c3-fd3e-497f-94dd-30cfb18e4aa2	g.chr5:1878600T>A	ENST00000505790.1	-	6	1499	c.1043A>T	c.(1042-1044)gAg>gTg	p.E348V	IRX4_ENST00000505938.1_5'Flank|IRX4_ENST00000231357.2_Missense_Mutation_p.E348V|IRX4_ENST00000513692.1_Missense_Mutation_p.E348V	NM_001278634.1	NP_001265563.1	P78413	IRX4_HUMAN	iroquois homeobox 4	348					establishment of organ orientation (GO:0048561)|heart development (GO:0007507)|regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			endometrium(1)|lung(7)|ovary(1)|prostate(1)	10				GBM - Glioblastoma multiforme(108;0.242)		CAGCTTGGCCTCGCAGACCTG	0.771																																					p.E348V		Atlas-SNP	.											.	IRX4	45	.	0			c.A1043T						.						2.0	3.0	2.0					5																	1878600		1347	2831	4178	SO:0001583	missense	50805	exon5			TTGGCCTCGCAGA	AF124733	CCDS3867.1, CCDS75225.1	5p15.33	2011-06-20	2007-07-13		ENSG00000113430	ENSG00000113430		"""Homeoboxes / TALE class"""	6129	protein-coding gene	gene with protein product		606199	"""iroquois homeobox protein 4"""			10625552	Standard	NM_016358		Approved		uc003jcz.2	P78413	OTTHUMG00000090411	ENST00000505790.1:c.1043A>T	chr5.hg19:g.1878600T>A	ENSP00000423161:p.Glu348Val	47.0	0.0		33.0	9.0	NM_016358	B2RMW5|D3DTC5|H1AFL0|H1AFL1|Q2NL64|Q9UHR2	Missense_Mutation	SNP	ENST00000505790.1	hg19	CCDS3867.1	.	.	.	.	.	.	.	.	.	.	t	12.68	2.011184	0.35511	.	.	ENSG00000113430	ENST00000231357;ENST00000505790;ENST00000513692	T;T;T	0.66099	-0.19;-0.19;-0.19	3.37	3.37	0.38596	.	0.290011	0.22703	U	0.056665	T	0.53786	0.1818	L	0.50333	1.59	0.44149	D	0.996948	B	0.14438	0.01	B	0.06405	0.002	T	0.52480	-0.8570	10	0.35671	T	0.21	-15.3684	11.6433	0.51246	0.0:0.0:0.0:1.0	.	348	P78413	IRX4_HUMAN	V	348	ENSP00000231357:E348V;ENSP00000423161:E348V;ENSP00000424235:E348V	ENSP00000231357:E348V	E	-	2	0	IRX4	1931600	1.000000	0.71417	0.776000	0.31678	0.008000	0.06430	3.155000	0.50700	1.399000	0.46721	0.373000	0.22412	GAG	.	.		0.771	IRX4-004	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365500.1	NM_016358	
ZSWIM6	57688	hgsc.bcm.edu	37	5	60839733	60839733	+	Silent	SNP	C	C	T			TCGA-2Y-A9GV-01A-11D-A382-10	TCGA-2Y-A9GV-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bbb0ee98-a0a5-4308-96f6-1ba7f5b71fef	c00cd9c3-fd3e-497f-94dd-30cfb18e4aa2	g.chr5:60839733C>T	ENST00000252744.5	+	14	3237	c.3237C>T	c.(3235-3237)agC>agT	p.S1079S		NM_020928.1	NP_065979.1	Q9HCJ5	ZSWM6_HUMAN	zinc finger, SWIM-type containing 6	1079					neuron projection morphogenesis (GO:0048812)|regulation of neuron migration (GO:2001222)		zinc ion binding (GO:0008270)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)	8						GTGCGCTTAGCCACTCCCTTG	0.507																																					p.S1079S		Atlas-SNP	.											.	ZSWIM6	51	.	0			c.C3237T						.						74.0	64.0	67.0					5																	60839733		692	1591	2283	SO:0001819	synonymous_variant	57688	exon14			GCTTAGCCACTCC	BC039438	CCDS47215.1	5q12.1	2011-03-17			ENSG00000130449	ENSG00000130449		"""Zinc fingers, SWIM-type"""	29316	protein-coding gene	gene with protein product		615951				10997877, 16427614	Standard	NM_020928		Approved	KIAA1577	uc003jsr.3	Q9HCJ5	OTTHUMG00000162388	ENST00000252744.5:c.3237C>T	chr5.hg19:g.60839733C>T		140.0	0.0		103.0	12.0	NM_020928		Silent	SNP	ENST00000252744.5	hg19	CCDS47215.1																																																																																			.	.		0.507	ZSWIM6-001	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368710.1	NM_020928	
GPR98	84059	hgsc.bcm.edu	37	5	90106847	90106847	+	Missense_Mutation	SNP	T	T	C			TCGA-2Y-A9GV-01A-11D-A382-10	TCGA-2Y-A9GV-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bbb0ee98-a0a5-4308-96f6-1ba7f5b71fef	c00cd9c3-fd3e-497f-94dd-30cfb18e4aa2	g.chr5:90106847T>C	ENST00000405460.2	+	74	15866	c.15770T>C	c.(15769-15771)aTa>aCa	p.I5257T	GPR98_ENST00000425867.2_Missense_Mutation_p.I918T	NM_032119.3	NP_115495.3	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98	5257					detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|G-protein coupled receptor signaling pathway (GO:0007186)|inner ear receptor stereocilium organization (GO:0060122)|maintenance of organ identity (GO:0048496)|nervous system development (GO:0007399)|neurological system process (GO:0050877)|neuropeptide signaling pathway (GO:0007218)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|visual perception (GO:0007601)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|stereocilia ankle link complex (GO:0002142)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(4)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(3)|kidney(18)|large_intestine(46)|liver(2)|lung(80)|ovary(12)|pancreas(5)|prostate(1)|skin(50)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(6)	269		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		AATGTCAGCATAACAGTTAAA	0.418																																					p.I5257T		Atlas-SNP	.											.	GPR98	605	.	0			c.T15770C						.						141.0	131.0	134.0					5																	90106847		1915	4127	6042	SO:0001583	missense	84059	exon74			TCAGCATAACAGT	AB014586	CCDS47246.1	5q13	2014-08-08	2006-05-26	2006-05-26	ENSG00000164199	ENSG00000164199		"""-"", ""GPCR / Class B : Orphans"""	17416	protein-coding gene	gene with protein product		602851	"""monogenic, audiogenic seizure susceptibility 1 homolog (mouse)"""	USH2C, MASS1		10976914, 14740321	Standard	NM_032119		Approved	DKFZp761P0710, KIAA0686, FEB4, VLGR1b	uc003kju.3	Q8WXG9	OTTHUMG00000162668	ENST00000405460.2:c.15770T>C	chr5.hg19:g.90106847T>C	ENSP00000384582:p.Ile5257Thr	264.0	0.0		221.0	52.0	NM_032119	O75171|Q8TF58|Q9H0X5|Q9UL61	Missense_Mutation	SNP	ENST00000405460.2	hg19	CCDS47246.1	.	.	.	.	.	.	.	.	.	.	T	13.56	2.274796	0.40194	.	.	ENSG00000164199	ENST00000405460;ENST00000296619;ENST00000425867	T;T	0.30448	1.53;1.53	5.5	5.5	0.81552	.	0.477226	0.23369	N	0.048938	T	0.28400	0.0702	L	0.40543	1.245	0.09310	N	0.999999	B;B;B	0.28636	0.139;0.09;0.218	B;B;B	0.30572	0.055;0.024;0.117	T	0.14839	-1.0458	9	.	.	.	.	15.6013	0.76628	0.0:0.0:0.0:1.0	.	918;5257;918	E7EML1;Q8WXG9;Q8WXG9-2	.;GPR98_HUMAN;.	T	5257;5257;918	ENSP00000384582:I5257T;ENSP00000392618:I918T	.	I	+	2	0	GPR98	90142603	0.967000	0.33354	0.034000	0.17996	0.909000	0.53808	3.998000	0.57024	2.096000	0.63516	0.533000	0.62120	ATA	.	.		0.418	GPR98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369993.2	NM_032119	
RFESD	317671	hgsc.bcm.edu	37	5	94988893	94988893	+	Intron	SNP	A	A	T			TCGA-2Y-A9GV-01A-11D-A382-10	TCGA-2Y-A9GV-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bbb0ee98-a0a5-4308-96f6-1ba7f5b71fef	c00cd9c3-fd3e-497f-94dd-30cfb18e4aa2	g.chr5:94988893A>T	ENST00000311364.4	+	2	1416				SPATA9_ENST00000477047.2_5'UTR|RFESD_ENST00000380005.4_Missense_Mutation_p.I45F|RFESD_ENST00000458310.1_Missense_Mutation_p.I45F|RFESD_ENST00000513950.2_5'Flank	NM_173362.3	NP_775498.1	Q8TAC1	RFESD_HUMAN	Rieske (Fe-S) domain containing								2 iron, 2 sulfur cluster binding (GO:0051537)|metal ion binding (GO:0046872)|oxidoreductase activity (GO:0016491)			autonomic_ganglia(2)|endometrium(1)|large_intestine(1)|lung(1)|urinary_tract(1)	6		all_cancers(142;0.000215)|all_epithelial(76;7.43e-07)|all_lung(232;0.0318)|Lung NSC(167;0.041)|Ovarian(225;0.051)|Colorectal(57;0.162)		all cancers(79;5.94e-17)		ctcagctgtcatctcagtgaC	0.413																																					p.I45F		Atlas-SNP	.											.	RFESD	22	.	0			c.A133T						.						235.0	176.0	194.0					5																	94988893		692	1591	2283	SO:0001627	intron_variant	317671	exon3			GCTGTCATCTCAG	BC035110	CCDS4075.1, CCDS47248.1	5q15	2010-12-07			ENSG00000175449	ENSG00000175449			29587	protein-coding gene	gene with protein product						12477932	Standard	NM_173362		Approved		uc003klg.3	Q8TAC1	OTTHUMG00000121168	ENST00000311364.4:c.-2+858A>T	chr5.hg19:g.94988893A>T		95.0	0.0		73.0	17.0	NM_001131066	J3KPH1	Missense_Mutation	SNP	ENST00000311364.4	hg19	CCDS4075.1	.	.	.	.	.	.	.	.	.	.	A	14.71	2.615569	0.46631	.	.	ENSG00000175449	ENST00000380005;ENST00000458310	.	.	.	1.11	1.11	0.20524	.	.	.	.	.	T	0.28300	0.0699	.	.	.	0.09310	N	0.999996	.	.	.	.	.	.	T	0.22977	-1.0201	5	0.40728	T	0.16	.	4.4223	0.11486	1.0:0.0:0.0:0.0	.	.	.	.	F	45	.	ENSP00000369341:I45F	I	+	1	0	RFESD	95014649	0.029000	0.19370	0.057000	0.19452	0.190000	0.23558	-0.112000	0.10791	0.747000	0.32809	0.379000	0.24179	ATC	.	.		0.413	RFESD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241654.1	NM_173362	
CAMLG	819	hgsc.bcm.edu	37	5	134076873	134076873	+	Missense_Mutation	SNP	A	A	T			TCGA-2Y-A9GV-01A-11D-A382-10	TCGA-2Y-A9GV-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bbb0ee98-a0a5-4308-96f6-1ba7f5b71fef	c00cd9c3-fd3e-497f-94dd-30cfb18e4aa2	g.chr5:134076873A>T	ENST00000297156.2	+	2	413	c.293A>T	c.(292-294)cAg>cTg	p.Q98L	CAMLG_ENST00000514518.1_Intron	NM_001745.3	NP_001736.1	P49069	CAMLG_HUMAN	calcium modulating ligand	98					defense response (GO:0006952)|epidermal growth factor receptor signaling pathway (GO:0007173)|receptor recycling (GO:0001881)|signal transduction (GO:0007165)|viral process (GO:0016032)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)				NS(1)|cervix(1)|kidney(3)|lung(3)|prostate(1)	9			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)		Cyclosporine(DB00091)	ACAACTGACCAGCAGGGTGGT	0.507																																					p.Q98L		Atlas-SNP	.											.	CAMLG	27	.	0			c.A293T						.						86.0	85.0	85.0					5																	134076873		2203	4300	6503	SO:0001583	missense	819	exon2			CTGACCAGCAGGG	AF068179.1	CCDS4178.1	5q23	2008-07-18			ENSG00000164615	ENSG00000164615			1471	protein-coding gene	gene with protein product	"""calcium-modulating cyclophilin ligand"", ""calcium-signal modulating cyclophilin ligand"", ""cyclophilin B-binding protein"""	601118				8824814	Standard	NM_001745		Approved	CAML	uc003kzt.3	P49069	OTTHUMG00000129116	ENST00000297156.2:c.293A>T	chr5.hg19:g.134076873A>T	ENSP00000297156:p.Gln98Leu	248.0	0.0		245.0	68.0	NM_001745	A1L3Y3	Missense_Mutation	SNP	ENST00000297156.2	hg19	CCDS4178.1	.	.	.	.	.	.	.	.	.	.	A	14.55	2.570005	0.45798	.	.	ENSG00000164615	ENST00000297156	T	0.29397	1.57	5.74	4.56	0.56223	.	0.296779	0.37955	N	0.001865	T	0.26629	0.0651	L	0.34521	1.04	0.80722	D	1	B	0.25609	0.13	B	0.32624	0.149	T	0.04281	-1.0963	10	0.39692	T	0.17	-6.6662	11.6308	0.51173	0.8514:0.1486:0.0:0.0	.	98	P49069	CAMLG_HUMAN	L	98	ENSP00000297156:Q98L	ENSP00000297156:Q98L	Q	+	2	0	CAMLG	134104772	0.974000	0.33945	0.990000	0.47175	0.986000	0.74619	1.498000	0.35660	0.970000	0.38263	0.533000	0.62120	CAG	.	.		0.507	CAMLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251161.1	NM_001745	
PCDHGB1	56104	hgsc.bcm.edu	37	5	140731303	140731303	+	Silent	SNP	G	G	A			TCGA-2Y-A9GV-01A-11D-A382-10	TCGA-2Y-A9GV-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bbb0ee98-a0a5-4308-96f6-1ba7f5b71fef	c00cd9c3-fd3e-497f-94dd-30cfb18e4aa2	g.chr5:140731303G>A	ENST00000523390.1	+	1	1476	c.1476G>A	c.(1474-1476)ctG>ctA	p.L492L	PCDHGA1_ENST00000517417.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA3_ENST00000253812.6_Intron	NM_018922.2|NM_032095.1	NP_061745.1|NP_115266.1	Q9Y5G3	PCDGD_HUMAN	protocadherin gamma subfamily B, 1	492	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(6)|lung(3)|ovary(2)|prostate(1)	16			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CCAGTGACCTGGAGCCGCGGG	0.647																																					p.L492L		Atlas-SNP	.											.	PCDHGB1	198	.	0			c.G1476A						.						35.0	41.0	39.0					5																	140731303		1977	4160	6137	SO:0001819	synonymous_variant	56104	exon1			TGACCTGGAGCCG	AF152517	CCDS54923.1, CCDS75330.1	5q31	2010-01-26				ENSG00000254221		"""Cadherins / Protocadherins : Clustered"""	8708	other	protocadherin	"""protocadherin gamma subfamily B, 1, isoform 2"""	606299				10380929	Standard	NM_018922		Approved	PCDH-GAMMA-B1		Q9Y5G3		ENST00000523390.1:c.1476G>A	chr5.hg19:g.140731303G>A		139.0	0.0		107.0	31.0	NM_018922	Q3SY75|Q9Y5C8	Silent	SNP	ENST00000523390.1	hg19	CCDS54923.1																																																																																			.	.		0.647	PCDHGB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374740.1	NM_018922	
SLIT3	6586	hgsc.bcm.edu	37	5	168135071	168135071	+	Silent	SNP	A	A	G			TCGA-2Y-A9GV-01A-11D-A382-10	TCGA-2Y-A9GV-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bbb0ee98-a0a5-4308-96f6-1ba7f5b71fef	c00cd9c3-fd3e-497f-94dd-30cfb18e4aa2	g.chr5:168135071A>G	ENST00000519560.1	-	26	3173	c.2754T>C	c.(2752-2754)aaT>aaC	p.N918N	SLIT3_ENST00000332966.8_Silent_p.N925N|SLIT3_ENST00000404867.3_Silent_p.N918N|CTC-558O2.1_ENST00000521870.1_RNA|CTC-558O2.1_ENST00000522615.1_RNA	NM_001271946.1|NM_003062.2	NP_001258875.1|NP_003053	O75094	SLIT3_HUMAN	slit homolog 3 (Drosophila)	918	EGF-like 1. {ECO:0000255|PROSITE- ProRule:PRU00076}.				apoptotic process involved in luteolysis (GO:0061364)|axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|cellular response to hormone stimulus (GO:0032870)|negative chemotaxis (GO:0050919)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of gene expression (GO:0010629)|organ morphogenesis (GO:0009887)|response to cortisol (GO:0051414)|Roundabout signaling pathway (GO:0035385)	extracellular space (GO:0005615)|mitochondrion (GO:0005739)	calcium ion binding (GO:0005509)|Roundabout binding (GO:0048495)			endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(15)|liver(2)|lung(48)|ovary(4)|prostate(7)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	100	Renal(175;0.000159)|Lung NSC(126;0.0174)|all_lung(126;0.0392)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			AGAGGCAGGCATTGCATTTGG	0.582																																					p.N925N	Ovarian(29;311 847 10864 17279 24903)	Atlas-SNP	.											.	SLIT3	224	.	0			c.T2775C						.						155.0	108.0	124.0					5																	168135071		2203	4300	6503	SO:0001819	synonymous_variant	6586	exon26			GCAGGCATTGCAT	AB011538	CCDS4369.1, CCDS64311.1	5q35	2008-07-18	2001-11-28		ENSG00000184347	ENSG00000184347			11087	protein-coding gene	gene with protein product		603745	"""slit (Drosophila) homolog 3"""	SLIL2		9693030, 9813312	Standard	NM_001271946		Approved	slit2, MEGF5, SLIT1, Slit-3	uc010jjg.4	O75094	OTTHUMG00000130409	ENST00000519560.1:c.2754T>C	chr5.hg19:g.168135071A>G		275.0	0.0		230.0	67.0	NM_001271946	A6H8U9|J3KNP3|O95804|Q9UFH5	Silent	SNP	ENST00000519560.1	hg19	CCDS4369.1																																																																																			.	.		0.582	SLIT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252792.4	NM_003062	
ADAMTS2	9509	hgsc.bcm.edu	37	5	178634533	178634533	+	Missense_Mutation	SNP	A	A	G			TCGA-2Y-A9GV-01A-11D-A382-10	TCGA-2Y-A9GV-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bbb0ee98-a0a5-4308-96f6-1ba7f5b71fef	c00cd9c3-fd3e-497f-94dd-30cfb18e4aa2	g.chr5:178634533A>G	ENST00000251582.7	-	4	973	c.872T>C	c.(871-873)cTg>cCg	p.L291P	ADAMTS2_ENST00000274609.5_Missense_Mutation_p.L291P	NM_014244.4	NP_055059.2	O95450	ATS2_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 2	291	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.				collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|lung development (GO:0030324)|protein processing (GO:0016485)|skin development (GO:0043588)|spermatogenesis (GO:0007283)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(31)|ovary(1)|pancreas(3)|prostate(2)|skin(7)	72	all_cancers(89;0.000456)|all_epithelial(37;0.000138)|Renal(175;0.000159)|Lung NSC(126;0.00184)|all_lung(126;0.00326)	all_cancers(40;0.00604)|all_neural(177;0.00411)|Medulloblastoma(196;0.00508)|Lung NSC(249;0.0569)|all_lung(500;0.129)|all_hematologic(541;0.211)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	GBM - Glioblastoma multiforme(465;0.0473)		GAGTGTCAGCAGGTACTTCTG	0.637																																					p.L291P		Atlas-SNP	.											.	ADAMTS2	190	.	0			c.T872C						.						125.0	103.0	110.0					5																	178634533		2203	4300	6503	SO:0001583	missense	9509	exon4			GTCAGCAGGTACT	AJ003125	CCDS4444.1, CCDS34311.1	5q23-q24	2008-07-18	2005-08-19		ENSG00000087116	ENSG00000087116		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	218	protein-coding gene	gene with protein product	"""procollagen I N-proteinase"", ""procollagen N-endopeptidase"""	604539	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 2"""			10094461, 15373769	Standard	NM_014244		Approved	ADAMTS-3, hPCPNI, PCINP, ADAM-TS2, NPI	uc003mjw.3	O95450	OTTHUMG00000130915	ENST00000251582.7:c.872T>C	chr5.hg19:g.178634533A>G	ENSP00000251582:p.Leu291Pro	77.0	0.0		72.0	30.0	NM_021599		Missense_Mutation	SNP	ENST00000251582.7	hg19	CCDS4444.1	.	.	.	.	.	.	.	.	.	.	A	21.0	4.083629	0.76642	.	.	ENSG00000087116	ENST00000251582;ENST00000274609	T;T	0.65364	-0.15;-0.15	5.39	5.39	0.77823	Metallopeptidase, catalytic domain (1);Peptidase M12B, ADAM/reprolysin (2);	0.000000	0.41605	D	0.000855	T	0.81054	0.4743	M	0.85859	2.78	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	D	0.84451	0.0588	10	0.87932	D	0	.	14.8751	0.70488	1.0:0.0:0.0:0.0	.	291;291	O95450-2;O95450	.;ATS2_HUMAN	P	291	ENSP00000251582:L291P;ENSP00000274609:L291P	ENSP00000251582:L291P	L	-	2	0	ADAMTS2	178567139	1.000000	0.71417	1.000000	0.80357	0.906000	0.53458	9.051000	0.93849	2.171000	0.68590	0.459000	0.35465	CTG	.	.		0.637	ADAMTS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253507.1	NM_014244	
PHIP	55023	hgsc.bcm.edu	37	6	79727292	79727292	+	Missense_Mutation	SNP	A	A	G			TCGA-2Y-A9GV-01A-11D-A382-10	TCGA-2Y-A9GV-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bbb0ee98-a0a5-4308-96f6-1ba7f5b71fef	c00cd9c3-fd3e-497f-94dd-30cfb18e4aa2	g.chr6:79727292A>G	ENST00000275034.4	-	11	1170	c.1003T>C	c.(1003-1005)Ttt>Ctt	p.F335L		NM_017934.5	NP_060404	Q8WWQ0	PHIP_HUMAN	pleckstrin homology domain interacting protein	335					cytoskeleton organization (GO:0007010)|insulin receptor signaling pathway (GO:0008286)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell proliferation (GO:0008284)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|positive regulation of mitosis (GO:0045840)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein import into nucleus (GO:0006606)|regulation of cell morphogenesis (GO:0022604)|regulation of growth (GO:0040008)|regulation of protein phosphorylation (GO:0001932)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	insulin receptor binding (GO:0005158)|lysine-acetylated histone binding (GO:0070577)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(10)|kidney(4)|large_intestine(20)|lung(20)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	68		all_cancers(76;0.00125)|Acute lymphoblastic leukemia(125;1.1e-05)|all_hematologic(105;0.00117)|all_epithelial(107;0.219)		BRCA - Breast invasive adenocarcinoma(397;0.231)		GTCGCCAGAAACATTCCACCT	0.313																																					p.F335L		Atlas-SNP	.											.	PHIP	177	.	0			c.T1003C						.						36.0	37.0	36.0					6																	79727292		2203	4296	6499	SO:0001583	missense	55023	exon11			CCAGAAACATTCC	AF310250	CCDS4987.1	6q14	2013-01-09			ENSG00000146247	ENSG00000146247		"""WD repeat domain containing"", ""DDB1 and CUL4 associated factors"""	15673	protein-coding gene	gene with protein product	"""DDB1 and CUL4 associated factor 14"""	612870		WDR11		11018022	Standard	NM_017934		Approved	ndrp, FLJ20705, DCAF14, BRWD2	uc003pir.3	Q8WWQ0	OTTHUMG00000015071	ENST00000275034.4:c.1003T>C	chr6.hg19:g.79727292A>G	ENSP00000275034:p.Phe335Leu	369.0	0.0		374.0	105.0	NM_017934	A7J992|B2RPK4|Q05CQ9|Q5VVH4|Q66I29|Q69YV1|Q8NBZ5|Q96H52|Q96ME2|Q9H261	Missense_Mutation	SNP	ENST00000275034.4	hg19	CCDS4987.1	.	.	.	.	.	.	.	.	.	.	A	29.5	5.014604	0.93404	.	.	ENSG00000146247	ENST00000275034	T	0.15256	2.44	5.14	5.14	0.70334	WD40/YVTN repeat-like-containing domain (1);Quinonprotein alcohol dehydrogenase-like (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.33352	0.0860	M	0.83483	2.645	0.80722	D	1	P;P	0.52842	0.956;0.956	D;D	0.65010	0.931;0.931	T	0.17018	-1.0383	9	.	.	.	-15.1063	14.1281	0.65235	1.0:0.0:0.0:0.0	.	335;335	A7J992;Q8WWQ0	.;PHIP_HUMAN	L	335	ENSP00000275034:F335L	.	F	-	1	0	PHIP	79784011	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	8.962000	0.93254	1.918000	0.55548	0.454000	0.30748	TTT	.	.		0.313	PHIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041297.2		
TSPYL1	7259	hgsc.bcm.edu	37	6	116600549	116600549	+	Missense_Mutation	SNP	C	C	G			TCGA-2Y-A9GV-01A-11D-A382-10	TCGA-2Y-A9GV-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bbb0ee98-a0a5-4308-96f6-1ba7f5b71fef	c00cd9c3-fd3e-497f-94dd-30cfb18e4aa2	g.chr6:116600549C>G	ENST00000368608.3	-	1	517	c.445G>C	c.(445-447)Gag>Cag	p.E149Q	RP1-93H18.1_ENST00000449314.1_lincRNA|DSE_ENST00000540275.1_Intron|DSE_ENST00000452085.3_5'Flank	NM_003309.3	NP_003300.1	Q9H0U9	TSYL1_HUMAN	TSPY-like 1	149					nucleosome assembly (GO:0006334)	nucleus (GO:0005634)	enzyme binding (GO:0019899)			breast(1)|endometrium(2)|large_intestine(2)|lung(2)|ovary(3)|urinary_tract(1)	11		all_cancers(87;0.0144)|all_epithelial(87;0.021)|Colorectal(196;0.234)		all cancers(137;0.0235)|OV - Ovarian serous cystadenocarcinoma(136;0.0469)|GBM - Glioblastoma multiforme(226;0.0503)|Epithelial(106;0.094)		GCCTCAGCCTCCGCCCCCGCC	0.657																																					p.E149Q		Atlas-SNP	.											.	TSPYL1	28	.	0			c.G445C						.						49.0	56.0	54.0					6																	116600549		2202	4300	6502	SO:0001583	missense	7259	exon1			CAGCCTCCGCCCC	AF042181	CCDS34518.1	6q22.1	2014-09-17	2004-04-05	2004-04-07	ENSG00000189241	ENSG00000189241			12382	protein-coding gene	gene with protein product		604714	"""TSPY-like"""	TSPYL		9730615	Standard	NM_003309		Approved		uc003pwp.4	Q9H0U9	OTTHUMG00000015427	ENST00000368608.3:c.445G>C	chr6.hg19:g.116600549C>G	ENSP00000357597:p.Glu149Gln	37.0	0.0		26.0	8.0	NM_003309	O75885|Q5TFE6	Missense_Mutation	SNP	ENST00000368608.3	hg19	CCDS34518.1	.	.	.	.	.	.	.	.	.	.	C	9.084	0.999976	0.19121	.	.	ENSG00000189241	ENST00000368608;ENST00000545830	T	0.22743	1.94	1.42	-0.998	0.10212	.	.	.	.	.	T	0.03739	0.0106	N	0.22421	0.69	0.09310	N	1	B	0.12013	0.005	B	0.04013	0.001	T	0.41858	-0.9485	9	0.49607	T	0.09	.	4.6634	0.12653	0.0:0.6187:0.0:0.3813	.	149	Q9H0U9	TSYL1_HUMAN	Q	149	ENSP00000357597:E149Q	ENSP00000357597:E149Q	E	-	1	0	TSPYL1	116707242	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.178000	0.16820	-0.328000	0.08539	-0.367000	0.07326	GAG	.	.		0.657	TSPYL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041929.1		
CCR6	1235	hgsc.bcm.edu	37	6	167549735	167549735	+	Missense_Mutation	SNP	T	T	C			TCGA-2Y-A9GV-01A-11D-A382-10	TCGA-2Y-A9GV-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bbb0ee98-a0a5-4308-96f6-1ba7f5b71fef	c00cd9c3-fd3e-497f-94dd-30cfb18e4aa2	g.chr6:167549735T>C	ENST00000341935.5	+	3	569	c.17T>C	c.(16-18)aTg>aCg	p.M6T	CCR6_ENST00000349984.4_Missense_Mutation_p.M6T|CCR6_ENST00000400926.2_Missense_Mutation_p.M6T|RP11-517H2.6_ENST00000609590.1_RNA	NM_031409.3	NP_113597.2	P51684	CCR6_HUMAN	chemokine (C-C motif) receptor 6	6					cellular component movement (GO:0006928)|cellular defense response (GO:0006968)|chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|dendritic cell chemotaxis (GO:0002407)|humoral immune response (GO:0006959)|immune response (GO:0006955)|innate immune response (GO:0045087)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	C-C chemokine receptor activity (GO:0016493)|chemokine receptor activity (GO:0004950)|receptor activity (GO:0004872)			endometrium(3)|kidney(2)|large_intestine(2)|lung(5)|ovary(1)|prostate(1)	14		Breast(66;1.53e-05)|Ovarian(120;0.0606)		OV - Ovarian serous cystadenocarcinoma(33;8.21e-20)|BRCA - Breast invasive adenocarcinoma(81;4.55e-06)|GBM - Glioblastoma multiforme(31;0.00507)		CAGGAATCAATGAATTTCAGC	0.378																																					p.M6T		Atlas-SNP	.											.	CCR6	36	.	0			c.T17C						.						154.0	153.0	153.0					6																	167549735		2203	4300	6503	SO:0001583	missense	1235	exon3			AATCAATGAATTT	U68030	CCDS5298.1	6q27	2012-08-08			ENSG00000112486	ENSG00000112486		"""GPCR / Class A : Chemokine receptors : C-C motif"", ""CD molecules"""	1607	protein-coding gene	gene with protein product		601835		STRL22		8886020	Standard	NM_031409		Approved	CKR-L3, GPR-CY4, CMKBR6, GPR29, DRY-6, DCR2, BN-1, CD196	uc010kkm.3	P51684	OTTHUMG00000016015	ENST00000341935.5:c.17T>C	chr6.hg19:g.167549735T>C	ENSP00000343952:p.Met6Thr	78.0	0.0		91.0	34.0	NM_004367	E1P5C6|P78553|Q92846	Missense_Mutation	SNP	ENST00000341935.5	hg19	CCDS5298.1	.	.	.	.	.	.	.	.	.	.	T	7.859	0.725632	0.15439	.	.	ENSG00000112486	ENST00000400926;ENST00000341935;ENST00000349984	T;T;T	0.64991	-0.13;-0.13;-0.13	4.57	-1.22	0.09494	.	10.835500	0.00520	U	0.000196	T	0.16471	0.0396	N	0.08118	0	0.09310	N	1	B	0.23937	0.094	B	0.14023	0.01	T	0.14531	-1.0469	10	0.72032	D	0.01	.	1.0637	0.01606	0.1439:0.2519:0.149:0.4552	.	6	P51684	CCR6_HUMAN	T	6	ENSP00000383715:M6T;ENSP00000343952:M6T;ENSP00000339393:M6T	ENSP00000343952:M6T	M	+	2	0	CCR6	167469725	0.000000	0.05858	0.018000	0.16275	0.061000	0.15899	-0.287000	0.08388	-0.511000	0.06514	-0.496000	0.04628	ATG	.	.		0.378	CCR6-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043118.1		
TBP	6908	hgsc.bcm.edu	37	6	170871004	170871004	+	Silent	SNP	G	G	A			TCGA-2Y-A9GV-01A-11D-A382-10	TCGA-2Y-A9GV-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bbb0ee98-a0a5-4308-96f6-1ba7f5b71fef	c00cd9c3-fd3e-497f-94dd-30cfb18e4aa2	g.chr6:170871004G>A	ENST00000392092.2	+	3	459	c.180G>A	c.(178-180)caG>caA	p.Q60Q	TBP_ENST00000230354.6_Silent_p.Q60Q|TBP_ENST00000540980.1_Silent_p.Q40Q	NM_003194.4	NP_003185.1	P20226	TBP_HUMAN	TATA box binding protein	60	Poly-Gln.				cell death (GO:0008219)|gene expression (GO:0010467)|positive regulation of transcription, DNA-templated (GO:0045893)|spermatogenesis (GO:0007283)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription from RNA polymerase III promoter (GO:0006383)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	cytoplasm (GO:0005737)|female pronucleus (GO:0001939)|male pronucleus (GO:0001940)|nuclear euchromatin (GO:0005719)|nucleoplasm (GO:0005654)|transcription factor TFIIA complex (GO:0005672)|transcription factor TFIID complex (GO:0005669)	repressing transcription factor binding (GO:0070491)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(9)|ovary(1)|prostate(4)|urinary_tract(1)	26		Breast(66;5.08e-05)|Ovarian(120;0.125)|Esophageal squamous(34;0.246)		OV - Ovarian serous cystadenocarcinoma(33;1.07e-22)|BRCA - Breast invasive adenocarcinoma(81;5.01e-06)|GBM - Glioblastoma multiforme(31;0.00591)		Ggcagcagcagcaacaacaac	0.542																																					p.Q60Q		Atlas-SNP	.											.	TBP	58	.	0			c.G180A						.						43.0	45.0	44.0					6																	170871004		2203	4300	6503	SO:0001819	synonymous_variant	6908	exon3			GCAGCAGCAACAA	M55654	CCDS5315.1, CCDS55077.1	6q27	2014-04-02			ENSG00000112592	ENSG00000112592		"""General transcription factors"""	11588	protein-coding gene	gene with protein product		600075		GTF2D1, SCA17		2194289, 11448935	Standard	NM_003194		Approved	TFIID	uc003qxu.3	P20226	OTTHUMG00000016084	ENST00000392092.2:c.180G>A	chr6.hg19:g.170871004G>A		81.0	0.0		66.0	7.0	NM_003194	B4E3B3|F5H869|Q16845|Q6IBM6|Q9UC02	Silent	SNP	ENST00000392092.2	hg19	CCDS5315.1																																																																																			.	.		0.542	TBP-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000043271.2	NM_003194	
SSPO	23145	hgsc.bcm.edu	37	7	149494390	149494390	+	RNA	SNP	C	C	A			TCGA-2Y-A9GV-01A-11D-A382-10	TCGA-2Y-A9GV-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bbb0ee98-a0a5-4308-96f6-1ba7f5b71fef	c00cd9c3-fd3e-497f-94dd-30cfb18e4aa2	g.chr7:149494390C>A	ENST00000378016.2	+	0	6861							A2VEC9	SSPO_HUMAN	SCO-spondin						cell adhesion (GO:0007155)	extracellular space (GO:0005615)	peptidase inhibitor activity (GO:0030414)					Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			CCCTGGCCCTCTCCTCTGCCC	0.667																																					p.L2287L		Atlas-SNP	.											.	.	.	.	0			c.C6861A						.						53.0	61.0	59.0					7																	149494390		1972	4147	6119			23145	exon46			GGCCCTCTCCTCT	AK093431		7q36.1	2013-08-07	2013-08-06		ENSG00000197558	ENSG00000197558			21998	protein-coding gene	gene with protein product	"""subcommissural organ spondin"", ""SCO protein, thrombospondin domain containing"""		"""SCO-spondin homolog (Bos taurus)"""			8743952, 11008217	Standard	NM_198455		Approved	SCO-spondin, KIAA0543, FLJ36112	uc010lpk.3	A2VEC9	OTTHUMG00000157884		chr7.hg19:g.149494390C>A		83.0	0.0		99.0	19.0	NM_198455	Q76B61	Silent	SNP	ENST00000378016.2	hg19																																																																																				.	.		0.667	SSPO-202	KNOWN	basic	processed_transcript	processed_transcript			
CSMD3	114788	hgsc.bcm.edu	37	8	113812406	113812406	+	Missense_Mutation	SNP	T	T	C			TCGA-2Y-A9GV-01A-11D-A382-10	TCGA-2Y-A9GV-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bbb0ee98-a0a5-4308-96f6-1ba7f5b71fef	c00cd9c3-fd3e-497f-94dd-30cfb18e4aa2	g.chr8:113812406T>C	ENST00000297405.5	-	13	2201	c.1957A>G	c.(1957-1959)Aag>Gag	p.K653E	CSMD3_ENST00000343508.3_Missense_Mutation_p.K613E|CSMD3_ENST00000455883.2_Missense_Mutation_p.K549E|CSMD3_ENST00000352409.3_Missense_Mutation_p.K653E	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	653	CUB 3. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						TAGTTAACCTTGAAACCAACA	0.363										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																											p.K653E		Atlas-SNP	.											.	CSMD3	2325	.	0			c.A1957G						.						124.0	113.0	117.0					8																	113812406		2203	4300	6503	SO:0001583	missense	114788	exon13			TAACCTTGAAACC	AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.1957A>G	chr8.hg19:g.113812406T>C	ENSP00000297405:p.Lys653Glu	118.0	0.0		118.0	31.0	NM_198123	Q96PZ3	Missense_Mutation	SNP	ENST00000297405.5	hg19	CCDS6315.1	.	.	.	.	.	.	.	.	.	.	T	27.1	4.804756	0.90623	.	.	ENSG00000164796	ENST00000343508;ENST00000297405;ENST00000455883;ENST00000352409	T;T;T;T	0.18960	2.18;2.18;2.18;2.18	5.83	5.83	0.93111	CUB (5);	0.000000	0.85682	D	0.000000	T	0.37892	0.1020	L	0.58354	1.805	0.40474	D	0.980372	D;D;D	0.67145	0.989;0.996;0.992	P;D;D	0.67382	0.736;0.95;0.951	T	0.18178	-1.0345	10	0.07175	T	0.84	.	16.2002	0.82067	0.0:0.0:0.0:1.0	.	549;653;613	Q7Z407-3;Q7Z407;Q7Z407-2	.;CSMD3_HUMAN;.	E	613;653;549;653	ENSP00000345799:K613E;ENSP00000297405:K653E;ENSP00000412263:K549E;ENSP00000343124:K653E	ENSP00000297405:K653E	K	-	1	0	CSMD3	113881582	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.864000	0.87037	2.231000	0.72958	0.454000	0.30748	AAG	.	.		0.363	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347141.1	NM_052900	
NRARP	441478	hgsc.bcm.edu	37	9	140196211	140196211	+	Missense_Mutation	SNP	T	T	C			TCGA-2Y-A9GV-01A-11D-A382-10	TCGA-2Y-A9GV-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bbb0ee98-a0a5-4308-96f6-1ba7f5b71fef	c00cd9c3-fd3e-497f-94dd-30cfb18e4aa2	g.chr9:140196211T>C	ENST00000356628.2	-	1	492	c.170A>G	c.(169-171)cAg>cGg	p.Q57R		NM_001004354.2	NP_001004354.1	Q7Z6K4	NRARP_HUMAN	NOTCH-regulated ankyrin repeat protein	57					blood vessel endothelial cell proliferation involved in sprouting angiogenesis (GO:0002043)|negative regulation of Notch signaling pathway (GO:0045746)|negative regulation of Notch signaling pathway involved in somitogenesis (GO:1902367)|negative regulation of T cell differentiation (GO:0045581)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|patterning of blood vessels (GO:0001569)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of endothelial cell proliferation (GO:0001938)|regulation of cell-cell adhesion (GO:0022407)|somite rostral/caudal axis specification (GO:0032525)					lung(3)	3	all_cancers(76;0.0926)		STAD - Stomach adenocarcinoma(284;0.185)	OV - Ovarian serous cystadenocarcinoma(145;9.07e-05)|Epithelial(140;0.000273)		GATGACCGACTGGTGCAGCGC	0.647																																					p.Q57R		Atlas-SNP	.											.	NRARP	7	.	0			c.A170G						.						47.0	36.0	40.0					9																	140196211		2202	4298	6500	SO:0001583	missense	441478	exon1			ACCGACTGGTGCA		CCDS35188.1	9q34.3	2013-01-10			ENSG00000198435	ENSG00000198435		"""Ankyrin repeat domain containing"""	33843	protein-coding gene	gene with protein product							Standard	NM_001004354		Approved	MGC61598	uc004cmo.2	Q7Z6K4	OTTHUMG00000156150	ENST00000356628.2:c.170A>G	chr9.hg19:g.140196211T>C	ENSP00000349041:p.Gln57Arg	117.0	0.0		87.0	26.0	NM_001004354	B8A4K5	Missense_Mutation	SNP	ENST00000356628.2	hg19	CCDS35188.1	.	.	.	.	.	.	.	.	.	.	T	14.72	2.618422	0.46736	.	.	ENSG00000198435	ENST00000356628	T	0.63913	-0.07	3.57	3.57	0.40892	Ankyrin repeat-containing domain (4);	0.000000	0.85682	U	0.000000	T	0.47284	0.1437	N	0.03608	-0.345	0.48511	D	0.999662	P	0.52061	0.95	P	0.54629	0.757	T	0.43814	-0.9368	10	0.25106	T	0.35	.	10.1757	0.42937	0.0:0.0:0.0:1.0	.	57	Q7Z6K4	NRARP_HUMAN	R	57	ENSP00000349041:Q57R	ENSP00000349041:Q57R	Q	-	2	0	NRARP	139316032	1.000000	0.71417	0.998000	0.56505	0.012000	0.07955	1.744000	0.38268	1.517000	0.48917	0.439000	0.28862	CAG	.	.		0.647	NRARP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343196.1	NM_001004354	
PPRC1	23082	hgsc.bcm.edu	37	10	103906507	103906507	+	Missense_Mutation	SNP	C	C	G			TCGA-2Y-A9GV-01A-11D-A382-10	TCGA-2Y-A9GV-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bbb0ee98-a0a5-4308-96f6-1ba7f5b71fef	c00cd9c3-fd3e-497f-94dd-30cfb18e4aa2	g.chr10:103906507C>G	ENST00000278070.2	+	9	3797	c.3758C>G	c.(3757-3759)tCt>tGt	p.S1253C	PPRC1_ENST00000489648.1_Intron|PPRC1_ENST00000370012.1_Missense_Mutation_p.S220C|PPRC1_ENST00000413464.2_Intron	NM_015062.3	NP_055877.3	Q5VV67	PPRC1_HUMAN	peroxisome proliferator-activated receptor gamma, coactivator-related 1	1253					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(5)|large_intestine(10)|lung(19)|ovary(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	56		Colorectal(252;0.122)		Epithelial(162;4.97e-08)|all cancers(201;8.99e-07)		AAAGCCAAATCTCCTAAGTCC	0.617																																					p.S1253C		Atlas-SNP	.											.	PPRC1	151	.	0			c.C3758G						.						71.0	67.0	68.0					10																	103906507		2203	4300	6503	SO:0001583	missense	23082	exon9			CCAAATCTCCTAA	AF325193	CCDS7529.1, CCDS73186.1	10q24.32	2013-02-12	2006-10-17		ENSG00000148840	ENSG00000148840		"""RNA binding motif (RRM) containing"""	30025	protein-coding gene	gene with protein product			"""peroxisome proliferative activated receptor, gamma, coactivator-related 1"""			9628581, 11340167	Standard	XM_005269656		Approved	PRC, KIAA0595, MGC74642	uc001kum.3	Q5VV67	OTTHUMG00000018948	ENST00000278070.2:c.3758C>G	chr10.hg19:g.103906507C>G	ENSP00000278070:p.Ser1253Cys	118.0	0.0		92.0	27.0	NM_015062	Q5VV66|Q6P3U5|Q6P3W1|Q76N31|Q9BUJ3|Q9BZE5|Q9Y4E0	Missense_Mutation	SNP	ENST00000278070.2	hg19	CCDS7529.1	.	.	.	.	.	.	.	.	.	.	C	17.37	3.373013	0.61624	.	.	ENSG00000148840	ENST00000278070;ENST00000370012	T;T	0.35236	1.67;1.32	5.31	5.31	0.75309	.	0.507716	0.22087	N	0.064812	T	0.57784	0.2077	L	0.56769	1.78	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.71870	0.975;0.945	T	0.59542	-0.7435	10	0.72032	D	0.01	.	17.9755	0.89126	0.0:1.0:0.0:0.0	.	1133;1253	Q5VV67-2;Q5VV67	.;PPRC1_HUMAN	C	1253;220	ENSP00000278070:S1253C;ENSP00000359029:S220C	ENSP00000278070:S1253C	S	+	2	0	PPRC1	103896497	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	2.458000	0.45014	2.492000	0.84095	0.462000	0.41574	TCT	.	.		0.617	PPRC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050021.1	NM_015062	
TDRD1	56165	hgsc.bcm.edu	37	10	115981225	115981225	+	Silent	SNP	A	A	G			TCGA-2Y-A9GV-01A-11D-A382-10	TCGA-2Y-A9GV-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bbb0ee98-a0a5-4308-96f6-1ba7f5b71fef	c00cd9c3-fd3e-497f-94dd-30cfb18e4aa2	g.chr10:115981225A>G	ENST00000369280.1	+	20	3340	c.2880A>G	c.(2878-2880)aaA>aaG	p.K960K	TDRD1_ENST00000251864.2_Silent_p.K960K|TDRD1_ENST00000369282.1_Silent_p.K960K|TDRD1_ENST00000369281.2_Silent_p.K846K|TDRD1_ENST00000422662.1_Silent_p.K564K			Q9BXT4	TDRD1_HUMAN	tudor domain containing 1	960					DNA methylation involved in gamete generation (GO:0043046)|gene silencing by RNA (GO:0031047)|germ cell development (GO:0007281)|meiotic nuclear division (GO:0007126)|multicellular organismal development (GO:0007275)|piRNA metabolic process (GO:0034587)|spermatogenesis (GO:0007283)	chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|P granule (GO:0043186)|pi-body (GO:0071546)	metal ion binding (GO:0046872)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(15)|ovary(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(5)	48		Colorectal(252;0.172)|Breast(234;0.188)		Epithelial(162;0.0343)|all cancers(201;0.0754)		CTCTACCAAAAGGGATGCCAG	0.368																																					p.K960K		Atlas-SNP	.											.	TDRD1	126	.	0			c.A2880G						.						99.0	103.0	101.0					10																	115981225		2203	4300	6503	SO:0001819	synonymous_variant	56165	exon20			ACCAAAAGGGATG	AF285606	CCDS7588.1	10q26.11	2013-01-23			ENSG00000095627	ENSG00000095627		"""Tudor domain containing"""	11712	protein-coding gene	gene with protein product	"""cancer/testis antigen 41.1"""	605796				11279525	Standard	NM_198795		Approved	CT41.1	uc001lbg.1	Q9BXT4	OTTHUMG00000019083	ENST00000369280.1:c.2880A>G	chr10.hg19:g.115981225A>G		189.0	0.0		112.0	5.0	NM_198795	A6NEN3|A6NMN2|B3KVI4|B4E2L5|D3DRC2|Q4G0Y8|Q6P518|Q9H7B3	Silent	SNP	ENST00000369280.1	hg19																																																																																				.	.		0.368	TDRD1-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000050457.2		
ZNF143	7702	hgsc.bcm.edu	37	11	9494252	9494252	+	Silent	SNP	C	C	T			TCGA-2Y-A9GV-01A-11D-A382-10	TCGA-2Y-A9GV-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bbb0ee98-a0a5-4308-96f6-1ba7f5b71fef	c00cd9c3-fd3e-497f-94dd-30cfb18e4aa2	g.chr11:9494252C>T	ENST00000396602.2	+	3	260	c.141C>T	c.(139-141)ggC>ggT	p.G47G	ZNF143_ENST00000299606.2_Silent_p.G47G|ZNF143_ENST00000396597.3_Intron|ZNF143_ENST00000396604.1_Silent_p.G47G|ZNF143_ENST00000530463.1_Silent_p.G47G	NM_001282656.1|NM_001282657.1|NM_003442.5	NP_001269585.1|NP_001269586.1|NP_003433.3	P52747	ZN143_HUMAN	zinc finger protein 143	47					gene expression (GO:0010467)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|transcription from RNA polymerase II promoter (GO:0006366)|transcription from RNA polymerase III promoter (GO:0006383)	nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|large_intestine(5)|lung(4)|skin(2)|upper_aerodigestive_tract(1)	13				all cancers(16;4.12e-09)|Epithelial(150;2.29e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0212)		ATATGGAAGGCGTAAGCTTGC	0.338																																					p.G47G		Atlas-SNP	.											.	ZNF143	38	.	0			c.C141T						.						143.0	138.0	140.0					11																	9494252		2201	4294	6495	SO:0001819	synonymous_variant	7702	exon3			GGAAGGCGTAAGC	U09850	CCDS7799.2, CCDS60720.1, CCDS60721.1	11p15.4	2013-01-08	2006-06-13		ENSG00000166478	ENSG00000166478		"""Zinc fingers, C2H2-type"""	12928	protein-coding gene	gene with protein product		603433	"""zinc finger protein 143 (clone pHZ-1)"""				Standard	NM_003442		Approved	SBF, pHZ-1, STAF	uc001mhr.3	P52747	OTTHUMG00000149922	ENST00000396602.2:c.141C>T	chr11.hg19:g.9494252C>T		135.0	0.0		101.0	23.0	NM_003442	A8K518|B4DLY5|E7ER34|O75559|Q8WUK9	Silent	SNP	ENST00000396602.2	hg19	CCDS7799.2																																																																																			.	.		0.338	ZNF143-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000313921.2	NM_003442	
P4HA3	283208	hgsc.bcm.edu	37	11	74013578	74013578	+	Missense_Mutation	SNP	C	C	G			TCGA-2Y-A9GV-01A-11D-A382-10	TCGA-2Y-A9GV-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bbb0ee98-a0a5-4308-96f6-1ba7f5b71fef	c00cd9c3-fd3e-497f-94dd-30cfb18e4aa2	g.chr11:74013578C>G	ENST00000331597.4	-	3	448	c.403G>C	c.(403-405)Gga>Cga	p.G135R	P4HA3_ENST00000427714.2_Missense_Mutation_p.G135R	NM_182904.3	NP_878907.1	Q7Z4N8	P4HA3_HUMAN	prolyl 4-hydroxylase, alpha polypeptide III	135						endoplasmic reticulum (GO:0005783)	iron ion binding (GO:0005506)|L-ascorbic acid binding (GO:0031418)|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen (GO:0016702)|procollagen-proline 4-dioxygenase activity (GO:0004656)			NS(1)|biliary_tract(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|liver(1)|lung(5)|skin(1)	15	Breast(11;2.31e-05)					CTTGCTGCTCCCTCAAGGTCC	0.522																																					p.G135R		Atlas-SNP	.											.	P4HA3	43	.	0			c.G403C						.						106.0	103.0	104.0					11																	74013578		2200	4293	6493	SO:0001583	missense	283208	exon3			CTGCTCCCTCAAG	AY327887	CCDS8230.1, CCDS73347.1	11q13	2008-12-09	2008-12-09			ENSG00000149380			30135	protein-coding gene	gene with protein product	"""collagen prolyl 4-hydroxylase alpha(III)"""	608987	"""procollagen-proline, 2-oxoglutarate 4-dioxygenase (proline 4-hydroxylase), alpha polypeptide III"""			14500733	Standard	XM_005273924		Approved	C-P4Halpha(III)	uc001ouz.3	Q7Z4N8		ENST00000331597.4:c.403G>C	chr11.hg19:g.74013578C>G	ENSP00000332170:p.Gly135Arg	129.0	0.0		113.0	37.0	NM_182904	A0AV13|B4DUD3|Q5EBL3|Q5JPA9	Missense_Mutation	SNP	ENST00000331597.4	hg19	CCDS8230.1	.	.	.	.	.	.	.	.	.	.	C	25.6	4.651672	0.88056	.	.	ENSG00000149380	ENST00000331597;ENST00000427714	T;T	0.61859	0.2;0.07	4.96	4.96	0.65561	Prolyl 4-hydroxylase alpha-subunit, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.79179	0.4402	M	0.87328	2.875	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.82705	-0.0325	10	0.87932	D	0	-16.4985	16.0853	0.81042	0.0:1.0:0.0:0.0	.	135;135	B4DUD3;Q7Z4N8	.;P4HA3_HUMAN	R	135	ENSP00000332170:G135R;ENSP00000401749:G135R	ENSP00000332170:G135R	G	-	1	0	P4HA3	73691226	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	6.520000	0.73773	2.727000	0.93392	0.563000	0.77884	GGA	.	.		0.522	P4HA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382988.1	NM_182904	
GRIK4	2900	hgsc.bcm.edu	37	11	120690494	120690494	+	Missense_Mutation	SNP	T	T	C			TCGA-2Y-A9GV-01A-11D-A382-10	TCGA-2Y-A9GV-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bbb0ee98-a0a5-4308-96f6-1ba7f5b71fef	c00cd9c3-fd3e-497f-94dd-30cfb18e4aa2	g.chr11:120690494T>C	ENST00000527524.2	+	6	663	c.376T>C	c.(376-378)Ttc>Ctc	p.F126L	GRIK4_ENST00000438375.2_Missense_Mutation_p.F126L	NM_001282470.1	NP_001269399.1	Q16099	GRIK4_HUMAN	glutamate receptor, ionotropic, kainate 4	126					glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|response to corticosteroid (GO:0031960)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|kainate selective glutamate receptor complex (GO:0032983)|nucleus (GO:0005634)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	extracellular-glutamate-gated ion channel activity (GO:0005234)|kainate selective glutamate receptor activity (GO:0015277)	p.F126L(1)		NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(20)|liver(1)|lung(29)|ovary(2)|pancreas(1)|prostate(4)|skin(2)|urinary_tract(1)	69		Breast(109;0.000868)|Medulloblastoma(222;0.0453)|all_neural(223;0.116)|all_hematologic(192;0.21)		BRCA - Breast invasive adenocarcinoma(274;1.24e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.116)		CCCAGAGGAGTTCGTCAAGTT	0.532																																					p.F126L		Atlas-SNP	.											GRIK4,NS,carcinoma,-2,1	GRIK4	149	.	1	Substitution - Missense(1)	large_intestine(1)	c.T376C						.						235.0	241.0	239.0					11																	120690494		2203	4299	6502	SO:0001583	missense	2900	exon4			GAGGAGTTCGTCA	S67803	CCDS8433.1	11q23.3	2012-08-29			ENSG00000149403	ENSG00000149403		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4582	protein-coding gene	gene with protein product		600282		GRIK			Standard	NM_001282470		Approved	GluK4, KA1	uc009zax.1	Q16099	OTTHUMG00000048255	ENST00000527524.2:c.376T>C	chr11.hg19:g.120690494T>C	ENSP00000435648:p.Phe126Leu	131.0	1.0		95.0	24.0	NM_014619	A8K9L1	Missense_Mutation	SNP	ENST00000527524.2	hg19	CCDS8433.1	.	.	.	.	.	.	.	.	.	.	T	10.26	1.300088	0.23650	.	.	ENSG00000149403	ENST00000527524;ENST00000438375	T;T	0.21361	2.01;2.01	4.27	4.27	0.50696	Extracellular ligand-binding receptor (1);	0.099966	0.64402	D	0.000002	T	0.12178	0.0296	N	0.16478	0.41	0.38613	D	0.950951	B;B	0.06786	0.0;0.001	B;B	0.08055	0.003;0.003	T	0.09662	-1.0664	10	0.09843	T	0.71	.	13.5674	0.61826	0.0:0.0:0.0:1.0	.	126;126	A6H8K8;Q16099	.;GRIK4_HUMAN	L	126	ENSP00000435648:F126L;ENSP00000404063:F126L	ENSP00000404063:F126L	F	+	1	0	GRIK4	120195704	1.000000	0.71417	1.000000	0.80357	0.852000	0.48524	5.933000	0.70130	1.782000	0.52362	0.459000	0.35465	TTC	.	.		0.532	GRIK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109760.4	NM_014619	
KRT1	3848	hgsc.bcm.edu	37	12	53069229	53069229	+	Silent	SNP	G	G	A	rs540699806|rs267607656	byFrequency	TCGA-2Y-A9GV-01A-11D-A382-10	TCGA-2Y-A9GV-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bbb0ee98-a0a5-4308-96f6-1ba7f5b71fef	c00cd9c3-fd3e-497f-94dd-30cfb18e4aa2	g.chr12:53069229G>A	ENST00000252244.3	-	9	1741	c.1683C>T	c.(1681-1683)tcC>tcT	p.S561S		NM_006121.3	NP_006112.3	P04264	K2C1_HUMAN	keratin 1	561	Gly/Ser-rich.|Tail.		Missing (in allele 1B). {ECO:0000269|PubMed:1281859}.		complement activation, lectin pathway (GO:0001867)|establishment of skin barrier (GO:0061436)|fibrinolysis (GO:0042730)|negative regulation of inflammatory response (GO:0050728)|regulation of angiogenesis (GO:0045765)|response to oxidative stress (GO:0006979)|retina homeostasis (GO:0001895)	blood microparticle (GO:0072562)|cytoskeleton (GO:0005856)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)|structural molecule activity (GO:0005198)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(7)|lung(11)|ovary(1)|prostate(7)|skin(3)	39						tgccacctccggagccgtagc	0.692																																					p.S561S		Atlas-SNP	.											.	KRT1	110	.	0			c.C1683T						.						4.0	4.0	4.0					12																	53069229		1797	3656	5453	SO:0001819	synonymous_variant	3848	exon9			ACCTCCGGAGCCG	X69725	CCDS8836.1	12q13.13	2014-06-05	2008-08-01		ENSG00000167768	ENSG00000167768		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6412	protein-coding gene	gene with protein product		139350	"""epidermolytic hyperkeratosis 1"""	EHK1		2461420, 2470667, 16831889	Standard	NM_006121		Approved	KRT1A	uc001sau.1	P04264	OTTHUMG00000169749	ENST00000252244.3:c.1683C>T	chr12.hg19:g.53069229G>A		51.0	0.0		42.0	8.0	NM_006121	B2RA01|P85925|P86104|Q14720|Q6GSJ0|Q9H298	Silent	SNP	ENST00000252244.3	hg19	CCDS8836.1																																																																																			.	.		0.692	KRT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405706.1	NM_006121	
KRT79	338785	hgsc.bcm.edu	37	12	53225368	53225368	+	Missense_Mutation	SNP	A	A	G			TCGA-2Y-A9GV-01A-11D-A382-10	TCGA-2Y-A9GV-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bbb0ee98-a0a5-4308-96f6-1ba7f5b71fef	c00cd9c3-fd3e-497f-94dd-30cfb18e4aa2	g.chr12:53225368A>G	ENST00000330553.5	-	2	554	c.520T>C	c.(520-522)Tgg>Cgg	p.W174R		NM_175834.2	NP_787028.1	Q5XKE5	K2C79_HUMAN	keratin 79	174	Coil 1A.|Rod.					extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)	enzyme binding (GO:0019899)|structural molecule activity (GO:0005198)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(11)|ovary(2)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	30						AGCAGTGCCCACTTGGTCTCC	0.607																																					p.W174R		Atlas-SNP	.											.	KRT79	78	.	0			c.T520C						.						72.0	63.0	66.0					12																	53225368		2203	4300	6503	SO:0001583	missense	338785	exon2			GTGCCCACTTGGT	AJ564105	CCDS8839.1	12q13.13	2014-02-12	2007-07-03		ENSG00000185640	ENSG00000185640		"""-"", ""Intermediate filaments type II, keratins (basic)"""	28930	protein-coding gene	gene with protein product	"""keratin 6-like"""	611160				11683385	Standard	NM_175834		Approved	K6L, KRT6L	uc001sbb.3	Q5XKE5	OTTHUMG00000169878	ENST00000330553.5:c.520T>C	chr12.hg19:g.53225368A>G	ENSP00000328358:p.Trp174Arg	58.0	0.0		66.0	25.0	NM_175834	Q6P465|Q7Z793	Missense_Mutation	SNP	ENST00000330553.5	hg19	CCDS8839.1	.	.	.	.	.	.	.	.	.	.	A	21.5	4.155441	0.78114	.	.	ENSG00000185640	ENST00000330553	T	0.77229	-1.08	4.39	4.39	0.52855	Filament (1);	0.000000	0.46442	D	0.000287	D	0.88771	0.6527	M	0.86953	2.85	0.53688	D	0.99997	D	0.89917	1.0	D	0.85130	0.997	D	0.90735	0.4645	10	0.87932	D	0	.	13.8135	0.63276	1.0:0.0:0.0:0.0	.	174	Q5XKE5	K2C79_HUMAN	R	174	ENSP00000328358:W174R	ENSP00000328358:W174R	W	-	1	0	KRT79	51511635	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	9.139000	0.94554	2.200000	0.70718	0.459000	0.35465	TGG	.	.		0.607	KRT79-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406376.1	NM_175834	
GNPTAB	79158	hgsc.bcm.edu	37	12	102190473	102190473	+	Missense_Mutation	SNP	C	C	A			TCGA-2Y-A9GV-01A-11D-A382-10	TCGA-2Y-A9GV-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bbb0ee98-a0a5-4308-96f6-1ba7f5b71fef	c00cd9c3-fd3e-497f-94dd-30cfb18e4aa2	g.chr12:102190473C>A	ENST00000299314.7	-	2	447	c.185G>T	c.(184-186)gGa>gTa	p.G62V	GNPTAB_ENST00000549165.1_Missense_Mutation_p.G62V|GNPTAB_ENST00000392919.4_Missense_Mutation_p.G62V|RNU6-172P_ENST00000411000.1_RNA|GNPTAB_ENST00000549940.1_Missense_Mutation_p.G62V	NM_024312.4	NP_077288.2	Q3T906	GNPTA_HUMAN	N-acetylglucosamine-1-phosphate transferase, alpha and beta subunits	62					carbohydrate phosphorylation (GO:0046835)|cell differentiation (GO:0030154)|lysosome organization (GO:0007040)|protein secretion (GO:0009306)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|UDP-N-acetylglucosamine-lysosomal-enzyme N-acetylglucosaminephosphotransferase activity (GO:0003976)			NS(1)|breast(3)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(8)|lung(8)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	37						AAAGGACTTTCCAGCAATATT	0.353																																					p.G62V		Atlas-SNP	.											.	GNPTAB	120	.	0			c.G185T						.						119.0	118.0	118.0					12																	102190473		2203	4300	6503	SO:0001583	missense	79158	exon2			GACTTTCCAGCAA	AY687932	CCDS9088.1	12q23.3	2013-01-10				ENSG00000111670		"""EF-hand domain containing"""	29670	protein-coding gene	gene with protein product		607840		GNPTA		10574462, 16116615	Standard	NM_024312		Approved	KIAA1208, MGC4170	uc001tit.3	Q3T906	OTTHUMG00000170444	ENST00000299314.7:c.185G>T	chr12.hg19:g.102190473C>A	ENSP00000299314:p.Gly62Val	134.0	0.0		127.0	40.0	NM_024312	A2RRQ9|Q3ZQK2|Q6IPW5|Q86TQ2|Q96N13|Q9ULL2	Missense_Mutation	SNP	ENST00000299314.7	hg19	CCDS9088.1	.	.	.	.	.	.	.	.	.	.	C	25.4	4.635587	0.87760	.	.	ENSG00000111670	ENST00000299314;ENST00000549940;ENST00000547090;ENST00000392919;ENST00000549165	T;T;T;T	0.63580	-0.05;-0.05;-0.05;-0.05	5.83	5.83	0.93111	.	0.000000	0.85682	D	0.000000	T	0.80586	0.4651	M	0.76328	2.33	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.992;0.999	T	0.81493	-0.0908	10	0.87932	D	0	-22.1692	19.7169	0.96124	0.0:1.0:0.0:0.0	.	62;62	Q3T906-2;Q3T906	.;GNPTA_HUMAN	V	62	ENSP00000299314:G62V;ENSP00000449150:G62V;ENSP00000376651:G62V;ENSP00000450413:G62V	ENSP00000299314:G62V	G	-	2	0	GNPTAB	100714604	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.271000	0.78506	2.763000	0.94921	0.561000	0.74099	GGA	.	.		0.353	GNPTAB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409182.1		
CARKD	55739	hgsc.bcm.edu	37	13	111287890	111287890	+	Missense_Mutation	SNP	G	G	T			TCGA-2Y-A9GV-01A-11D-A382-10	TCGA-2Y-A9GV-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bbb0ee98-a0a5-4308-96f6-1ba7f5b71fef	c00cd9c3-fd3e-497f-94dd-30cfb18e4aa2	g.chr13:111287890G>T	ENST00000309957.2	+	8	741	c.727G>T	c.(727-729)Gtg>Ttg	p.V243L	CARKD_ENST00000470164.2_3'UTR|CARKD_ENST00000424185.2_Missense_Mutation_p.V133L|CARKD_ENST00000458711.2_Missense_Mutation_p.V112L	NM_001242881.1|NM_018210.3	NP_001229810.1|NP_060680.2			carbohydrate kinase domain containing											NS(1)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(6)|ovary(1)|prostate(2)|skin(1)	15						CAACGTGACGGTGGTCCAGAA	0.602																																					p.V243L		Atlas-SNP	.											.	CARKD	36	.	0			c.G727T						.						155.0	140.0	145.0					13																	111287890		2203	4300	6503	SO:0001583	missense	55739	exon8			GTGACGGTGGTCC	AF151071	CCDS9513.1, CCDS55903.1	13q34	2008-12-19			ENSG00000213995	ENSG00000213995			25576	protein-coding gene	gene with protein product		615910					Standard	NM_018210		Approved	LP3298, FLJ10769	uc001vrc.3	Q8IW45	OTTHUMG00000017345	ENST00000309957.2:c.727G>T	chr13.hg19:g.111287890G>T	ENSP00000311984:p.Val243Leu	107.0	0.0		98.0	27.0	NM_018210		Missense_Mutation	SNP	ENST00000309957.2	hg19	CCDS9513.1	.	.	.	.	.	.	.	.	.	.	G	8.494	0.862762	0.17178	.	.	ENSG00000213995	ENST00000458711;ENST00000424185;ENST00000439607;ENST00000309957	T;T;T	0.32515	1.45;1.45;1.45	4.86	-0.414	0.12359	Uncharacterised domain, carbohydrate kinase-related (3);	0.546729	0.18973	N	0.126094	T	0.20047	0.0482	L	0.35542	1.07	0.36066	D	0.841801	B;B;B;B;B	0.30824	0.008;0.033;0.04;0.296;0.04	B;B;B;B;B	0.29353	0.022;0.044;0.06;0.101;0.074	T	0.14615	-1.0466	10	0.38643	T	0.18	-9.5232	10.0796	0.42381	0.596:0.0:0.404:0.0	.	112;133;225;243;243	B4DQR1;Q8IW45-4;B4DKX7;Q8IW45-2;Q8IW45	.;.;.;.;CARKD_HUMAN	L	112;133;225;243	ENSP00000412789:V112L;ENSP00000413191:V133L;ENSP00000311984:V243L	ENSP00000311984:V243L	V	+	1	0	CARKD	110085891	0.000000	0.05858	0.001000	0.08648	0.234000	0.25298	-0.335000	0.07873	0.044000	0.15775	0.462000	0.41574	GTG	.	.		0.602	CARKD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045764.1	NM_018210	
JPH4	84502	hgsc.bcm.edu	37	14	24044991	24044991	+	Missense_Mutation	SNP	G	G	A			TCGA-2Y-A9GV-01A-11D-A382-10	TCGA-2Y-A9GV-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bbb0ee98-a0a5-4308-96f6-1ba7f5b71fef	c00cd9c3-fd3e-497f-94dd-30cfb18e4aa2	g.chr14:24044991G>A	ENST00000397118.3	-	4	1956	c.1054C>T	c.(1054-1056)Cgg>Tgg	p.R352W	JPH4_ENST00000544177.1_5'Flank|JPH4_ENST00000356300.4_Missense_Mutation_p.R352W	NM_032452.2	NP_115828.2	Q96JJ6	JPH4_HUMAN	junctophilin 4	352					calcium ion transport into cytosol (GO:0060402)|learning (GO:0007612)|neuromuscular process controlling balance (GO:0050885)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of synaptic plasticity (GO:0048167)	dendritic shaft (GO:0043198)|integral component of membrane (GO:0016021)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|smooth endoplasmic reticulum (GO:0005790)				endometrium(1)|large_intestine(2)|lung(13)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	22	all_cancers(95;0.000251)			GBM - Glioblastoma multiforme(265;0.00654)		TTGCCCCGCCGAAGGGCCAGA	0.721																																					p.R352W		Atlas-SNP	.											.	JPH4	64	.	0			c.C1054T						.						6.0	6.0	6.0					14																	24044991		1924	3854	5778	SO:0001583	missense	84502	exon3			CCCGCCGAAGGGC	AB058734	CCDS9603.1	14q11	2004-05-28	2004-05-28	2004-05-28	ENSG00000092051	ENSG00000092051			20156	protein-coding gene	gene with protein product			"""junctophilin like 1"""	JPHL1		11347906	Standard	NM_032452		Approved	KIAA1831	uc001wkr.2	Q96JJ6	OTTHUMG00000028769	ENST00000397118.3:c.1054C>T	chr14.hg19:g.24044991G>A	ENSP00000380307:p.Arg352Trp	156.0	0.0		139.0	39.0	NM_001146028	D3DS53|Q8ND44|Q96DQ0	Missense_Mutation	SNP	ENST00000397118.3	hg19	CCDS9603.1	.	.	.	.	.	.	.	.	.	.	.	11.05	1.524308	0.27299	.	.	ENSG00000092051	ENST00000356300;ENST00000397118;ENST00000543864;ENST00000267407	T;T	0.61859	0.07;0.07	4.07	0.146	0.14833	.	.	.	.	.	T	0.64713	0.2623	M	0.66439	2.03	0.09310	N	1	D;D	0.76494	0.999;0.981	P;P	0.57679	0.825;0.639	T	0.54788	-0.8241	9	0.87932	D	0	.	7.3026	0.26430	0.0:0.1334:0.4568:0.4098	.	352;352	A8K396;Q96JJ6	.;JPH4_HUMAN	W	352;352;352;353	ENSP00000348648:R352W;ENSP00000380307:R352W	ENSP00000267407:R353W	R	-	1	2	JPH4	23114831	0.002000	0.14202	0.235000	0.24058	0.002000	0.02628	0.410000	0.21098	0.190000	0.20209	-0.176000	0.13171	CGG	.	.		0.721	JPH4-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413853.1	NM_032452	
RGS6	9628	hgsc.bcm.edu	37	14	72976961	72976961	+	Missense_Mutation	SNP	G	G	T			TCGA-2Y-A9GV-01A-11D-A382-10	TCGA-2Y-A9GV-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bbb0ee98-a0a5-4308-96f6-1ba7f5b71fef	c00cd9c3-fd3e-497f-94dd-30cfb18e4aa2	g.chr14:72976961G>T	ENST00000553530.1	+	14	1272	c.1065G>T	c.(1063-1065)gaG>gaT	p.E355D	RGS6_ENST00000407322.4_Missense_Mutation_p.E355D|RGS6_ENST00000555571.1_Missense_Mutation_p.E355D|RGS6_ENST00000343854.6_Missense_Mutation_p.E318D|RGS6_ENST00000355512.6_Missense_Mutation_p.E355D|RGS6_ENST00000434263.2_Missense_Mutation_p.E286D|RGS6_ENST00000554782.1_Missense_Mutation_p.E216D|RGS6_ENST00000404301.2_Missense_Mutation_p.E355D|RGS6_ENST00000402788.2_Missense_Mutation_p.E355D|RGS6_ENST00000406236.4_Missense_Mutation_p.E355D|RGS6_ENST00000553525.1_Missense_Mutation_p.E355D|RGS6_ENST00000556437.1_Missense_Mutation_p.E355D	NM_001204417.1|NM_001204418.1|NM_001204420.1|NM_001204421.1|NM_001204422.1|NM_004296.5	NP_001191346.1|NP_001191347.1|NP_001191349.1|NP_001191350.1|NP_001191351.1|NP_004287.3	P49758	RGS6_HUMAN	regulator of G-protein signaling 6	355	RGS. {ECO:0000255|PROSITE- ProRule:PRU00171}.				G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|positive regulation of GTPase activity (GO:0043547)|positive regulation of neuron differentiation (GO:0045666)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|heterotrimeric G-protein complex (GO:0005834)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)|signal transducer activity (GO:0004871)			endometrium(2)|kidney(3)|large_intestine(6)|lung(14)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	33				all cancers(60;0.00309)|BRCA - Breast invasive adenocarcinoma(234;0.0281)|STAD - Stomach adenocarcinoma(64;0.0302)|OV - Ovarian serous cystadenocarcinoma(108;0.0476)		GATTCCTGGAGTCCGAATTCA	0.473																																					p.E355D	Ovarian(143;1926 2468 21071 48641)	Atlas-SNP	.											.	RGS6	92	.	0			c.G1065T						.						97.0	109.0	105.0					14																	72976961		2203	4300	6503	SO:0001583	missense	9628	exon14			CCTGGAGTCCGAA	AF073920	CCDS9808.1, CCDS55924.1, CCDS73655.1	14q24.3	2008-07-28	2007-08-14			ENSG00000182732		"""Regulators of G-protein signaling"""	10002	protein-coding gene	gene with protein product		603894	"""regulator of G-protein signalling 6"""			10083744, 14734556	Standard	NM_004296		Approved		uc010ttn.2	P49758		ENST00000553530.1:c.1065G>T	chr14.hg19:g.72976961G>T	ENSP00000452331:p.Glu355Asp	110.0	0.0		89.0	27.0	NM_001204424	C9JE95|F8W7W5|O75576|O75577|Q7Z4K3|Q7Z4K4|Q7Z4K5|Q7Z4K6|Q8TE13|Q8TE14|Q8TE15|Q8TE16|Q8TE17|Q8TE18|Q8TE19|Q8TE20|Q8TE21|Q8TE22|Q9UDS8|Q9UDT0|Q9Y245|Q9Y647	Missense_Mutation	SNP	ENST00000553530.1	hg19	CCDS9808.1	.	.	.	.	.	.	.	.	.	.	G	13.94	2.385715	0.42308	.	.	ENSG00000182732	ENST00000553525;ENST00000555571;ENST00000553530;ENST00000556437;ENST00000355512;ENST00000404301;ENST00000406236;ENST00000407322;ENST00000402788;ENST00000343854;ENST00000453330;ENST00000434263;ENST00000554782;ENST00000535521	T;T;T;T;T;T;T;T;T;T;T;T	0.32988	1.43;1.43;1.43;1.43;1.43;1.43;1.43;1.43;1.43;1.43;1.43;1.43	5.72	3.88	0.44766	Regulator of G protein signalling (4);Regulator of G protein signalling superfamily (1);Regulator of G-protein signaling, domain 1 (1);	0.000000	0.85682	D	0.000000	T	0.40595	0.1123	L	0.41124	1.26	0.58432	D	0.999993	D;B;D;B	0.63880	0.993;0.002;0.993;0.001	D;B;D;B	0.66084	0.941;0.028;0.941;0.026	T	0.10497	-1.0627	10	0.33141	T	0.24	-0.5822	10.4952	0.44772	0.2123:0.0:0.7877:0.0	.	286;355;360;355	B7Z7N5;P49758-2;Q59FJ8;P49758	.;.;.;RGS6_HUMAN	D	355;355;355;355;355;355;355;355;355;318;327;286;216;216	ENSP00000451030:E355D;ENSP00000450936:E355D;ENSP00000452331:E355D;ENSP00000451855:E355D;ENSP00000347699:E355D;ENSP00000385243:E355D;ENSP00000384218:E355D;ENSP00000384612:E355D;ENSP00000383953:E355D;ENSP00000341199:E318D;ENSP00000412144:E286D;ENSP00000451912:E216D	ENSP00000341199:E318D	E	+	3	2	RGS6	72046714	1.000000	0.71417	1.000000	0.80357	0.916000	0.54674	2.134000	0.42102	1.566000	0.49654	-0.140000	0.14226	GAG	.	.		0.473	RGS6-003	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000413033.2		
TTBK2	146057	hgsc.bcm.edu	37	15	43045067	43045067	+	Missense_Mutation	SNP	A	A	C			TCGA-2Y-A9GV-01A-11D-A382-10	TCGA-2Y-A9GV-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bbb0ee98-a0a5-4308-96f6-1ba7f5b71fef	c00cd9c3-fd3e-497f-94dd-30cfb18e4aa2	g.chr15:43045067A>C	ENST00000267890.6	-	14	2485	c.2377T>G	c.(2377-2379)Tta>Gta	p.L793V		NM_173500.3	NP_775771.3	Q6IQ55	TTBK2_HUMAN	tau tubulin kinase 2	793					cell death (GO:0008219)|cilium assembly (GO:0042384)|peptidyl-serine phosphorylation (GO:0018105)|smoothened signaling pathway (GO:0007224)	centriole (GO:0005814)|ciliary basal body (GO:0036064)|ciliary transition zone (GO:0035869)|cytosol (GO:0005829)|extracellular space (GO:0005615)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|cervix(2)|endometrium(4)|kidney(2)|large_intestine(8)|lung(17)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|stomach(2)	43		all_cancers(109;6.11e-16)|all_epithelial(112;5.5e-14)|Lung NSC(122;1.76e-08)|all_lung(180;6.04e-08)|Melanoma(134;0.0179)|Colorectal(260;0.216)		GBM - Glioblastoma multiforme(94;3.23e-07)		CCTCTACTTAACTTCTCATCT	0.408																																					p.L793V		Atlas-SNP	.											.	TTBK2	82	.	0			c.T2377G						.						143.0	130.0	134.0					15																	43045067		1880	4111	5991	SO:0001583	missense	146057	exon14			TACTTAACTTCTC	AB020654	CCDS42029.1	15q15.2	2014-01-21			ENSG00000128881	ENSG00000128881			19141	protein-coding gene	gene with protein product		611695	"""spinocerebellar ataxia 11"""	SCA11		10048485	Standard	NM_173500		Approved	KIAA0847	uc001zqo.2	Q6IQ55	OTTHUMG00000175802	ENST00000267890.6:c.2377T>G	chr15.hg19:g.43045067A>C	ENSP00000267890:p.Leu793Val	110.0	0.0		113.0	41.0	NM_173500	O94932|Q6ZN52|Q8IVV1	Missense_Mutation	SNP	ENST00000267890.6	hg19	CCDS42029.1	.	.	.	.	.	.	.	.	.	.	A	9.946	1.218788	0.22373	.	.	ENSG00000128881	ENST00000267890;ENST00000399479;ENST00000263802	T	0.38560	1.13	5.87	3.54	0.40534	.	0.509864	0.19169	N	0.120996	T	0.29976	0.0750	L	0.41236	1.265	0.44668	D	0.997651	B;B	0.20052	0.041;0.024	B;B	0.14578	0.011;0.007	T	0.09422	-1.0675	10	0.37606	T	0.19	.	5.7807	0.18304	0.7151:0.0:0.2849:0.0	.	724;793	Q6IQ55-2;Q6IQ55	.;TTBK2_HUMAN	V	793;723;1198	ENSP00000267890:L793V	ENSP00000263802:L1198V	L	-	1	2	TTBK2	40832359	0.681000	0.27614	0.981000	0.43875	0.814000	0.46013	1.522000	0.35921	1.009000	0.39289	0.533000	0.62120	TTA	.	.		0.408	TTBK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000431106.2	NM_173500	
C16orf45	89927	hgsc.bcm.edu	37	16	15609232	15609232	+	Missense_Mutation	SNP	A	A	C			TCGA-2Y-A9GV-01A-11D-A382-10	TCGA-2Y-A9GV-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bbb0ee98-a0a5-4308-96f6-1ba7f5b71fef	c00cd9c3-fd3e-497f-94dd-30cfb18e4aa2	g.chr16:15609232A>C	ENST00000300006.4	+	2	536	c.177A>C	c.(175-177)aaA>aaC	p.K59N	C16orf45_ENST00000452191.2_Missense_Mutation_p.K42N|C16orf45_ENST00000566490.1_Missense_Mutation_p.K59N|C16orf45_ENST00000561692.1_Missense_Mutation_p.K11N	NM_033201.2	NP_149978.1	Q96MC5	CP045_HUMAN	chromosome 16 open reading frame 45	59										endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(3)|ovary(1)	11						AGATGGCAAAAATTCAGCGTC	0.522																																					p.K59N		Atlas-SNP	.											.	C16orf45	24	.	0			c.A177C						.						130.0	110.0	116.0					16																	15609232		2197	4300	6497	SO:0001583	missense	89927	exon2			GGCAAAAATTCAG	AK057180	CCDS10561.1, CCDS45422.1	16p13.2	2012-10-09			ENSG00000166780	ENSG00000166780			19213	protein-coding gene	gene with protein product							Standard	NM_033201		Approved	FLJ32618	uc002ddo.3	Q96MC5	OTTHUMG00000129883	ENST00000300006.4:c.177A>C	chr16.hg19:g.15609232A>C	ENSP00000300006:p.Lys59Asn	99.0	0.0		74.0	5.0	NM_033201	O00223|O75769|Q8IZ36|Q96H25	Missense_Mutation	SNP	ENST00000300006.4	hg19	CCDS10561.1	.	.	.	.	.	.	.	.	.	.	A	18.86	3.712557	0.68730	.	.	ENSG00000166780	ENST00000300006;ENST00000452191	T;T	0.47177	0.85;0.85	5.14	0.287	0.15714	Domain of unknown function DUF3585 (1);	0.050263	0.85682	D	0.000000	T	0.53158	0.1779	L	0.46741	1.465	0.42261	D	0.992014	D;P	0.67145	0.996;0.922	D;P	0.67382	0.951;0.537	T	0.48246	-0.9052	10	0.48119	T	0.1	-15.9761	8.0631	0.30644	0.6129:0.0:0.3871:0.0	.	3;59	B4DE25;Q96MC5	.;CP045_HUMAN	N	59;42	ENSP00000300006:K59N;ENSP00000408976:K42N	ENSP00000300006:K59N	K	+	3	2	C16orf45	15516733	0.997000	0.39634	0.998000	0.56505	0.982000	0.71751	0.251000	0.18257	-0.013000	0.14199	-0.250000	0.11733	AAA	.	.		0.522	C16orf45-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252130.2	NM_033201	
CES2	8824	hgsc.bcm.edu	37	16	66971949	66971949	+	Nonsense_Mutation	SNP	C	C	G			TCGA-2Y-A9GV-01A-11D-A382-10	TCGA-2Y-A9GV-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bbb0ee98-a0a5-4308-96f6-1ba7f5b71fef	c00cd9c3-fd3e-497f-94dd-30cfb18e4aa2	g.chr16:66971949C>G	ENST00000317091.4	+	2	1262	c.278C>G	c.(277-279)tCa>tGa	p.S93*	CES2_ENST00000417689.1_Nonsense_Mutation_p.S93*	NM_003869.5	NP_003860.2	O00748	EST2_HUMAN	carboxylesterase 2	29					catabolic process (GO:0009056)	endoplasmic reticulum (GO:0005783)	carboxylic ester hydrolase activity (GO:0052689)|methylumbelliferyl-acetate deacetylase activity (GO:0047374)			breast(1)|kidney(1)|large_intestine(2)|liver(2)|lung(4)|prostate(1)|urinary_tract(1)	12		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0663)|Epithelial(162;0.166)	Dabigatran etexilate(DB06695)|Irinotecan(DB00762)|Mycophenolate mofetil(DB00688)|Prasugrel(DB06209)	GGCCAGGACTCAGCCAGTCCC	0.587																																					p.S93X	Ovarian(70;1230 1691 37888 38351)	Atlas-SNP	.											.	CES2	43	.	0			c.C278G						.						57.0	60.0	59.0					16																	66971949		2200	4300	6500	SO:0001587	stop_gained	8824	exon2			AGGACTCAGCCAG	BC032095	CCDS10825.1, CCDS45507.1	16q22.1	2010-10-12	2010-10-12		ENSG00000172831	ENSG00000172831		"""Carboxylesterases"""	1864	protein-coding gene	gene with protein product		605278	"""carboxylesterase 2 (intestine, liver)"""			9169443, 9144407, 20931200	Standard	NM_198061		Approved	CE-2, iCE, CES2A1	uc002eqr.3	O00748	OTTHUMG00000137517	ENST00000317091.4:c.278C>G	chr16.hg19:g.66971949C>G	ENSP00000317842:p.Ser93*	92.0	0.0		98.0	34.0	NM_003869	A8K367|Q16859|Q5MAB8|Q7Z366|Q8IUP4|Q8TCP8	Nonsense_Mutation	SNP	ENST00000317091.4	hg19	CCDS10825.1	.	.	.	.	.	.	.	.	.	.	C	44	10.684086	0.99449	.	.	ENSG00000172831	ENST00000417689;ENST00000317091	.	.	.	5.49	5.49	0.81192	.	0.478367	0.16025	N	0.233139	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	11.8073	0.52163	0.1747:0.8253:0.0:0.0	.	.	.	.	X	93	.	ENSP00000317842:S93X	S	+	2	0	CES2	65529450	0.001000	0.12720	0.981000	0.43875	0.819000	0.46315	0.725000	0.25970	2.878000	0.98634	0.650000	0.86243	TCA	.	.		0.587	CES2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000268838.2	NM_003869	
ZNF469	84627	hgsc.bcm.edu	37	16	88503444	88503444	+	Missense_Mutation	SNP	T	T	A			TCGA-2Y-A9GV-01A-11D-A382-10	TCGA-2Y-A9GV-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bbb0ee98-a0a5-4308-96f6-1ba7f5b71fef	c00cd9c3-fd3e-497f-94dd-30cfb18e4aa2	g.chr16:88503444T>A	ENST00000437464.1	+	2	9482	c.9482T>A	c.(9481-9483)aTg>aAg	p.M3161K	ZNF469_ENST00000565624.1_Missense_Mutation_p.M3189K	NM_001127464.1	NP_001120936.1	Q96JG9	ZN469_HUMAN	zinc finger protein 469	3161					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|endometrium(6)|kidney(3)|large_intestine(1)|skin(6)	20						GACGTCTGGATGTACAACGAG	0.731																																					p.M3161K		Atlas-SNP	.											.	ZNF469	121	.	0			c.T9482A						.						2.0	3.0	3.0					16																	88503444		577	1414	1991	SO:0001583	missense	84627	exon2			TCTGGATGTACAA	AB058761	CCDS45544.1	16q24	2010-08-04				ENSG00000225614		"""Zinc fingers, C2H2-type"""	23216	protein-coding gene	gene with protein product		612078				11347906	Standard	NM_001127464		Approved	KIAA1858	uc002fku.2	Q96JG9		ENST00000437464.1:c.9482T>A	chr16.hg19:g.88503444T>A	ENSP00000402343:p.Met3161Lys	87.0	0.0		62.0	16.0	NM_001127464		Missense_Mutation	SNP	ENST00000437464.1	hg19	CCDS45544.1	.	.	.	.	.	.	.	.	.	.	T	16.20	3.054570	0.55218	.	.	ENSG00000225614	ENST00000437464	T	0.06218	3.33	4.99	2.73	0.32206	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (1);	.	.	.	.	T	0.12347	0.0300	L	0.29908	0.895	0.30651	N	0.755461	D	0.76494	0.999	D	0.66716	0.946	T	0.07083	-1.0791	9	0.72032	D	0.01	.	8.2765	0.31874	0.0:0.1648:0.0:0.8352	.	3161	Q96JG9	ZN469_HUMAN	K	3161	ENSP00000402343:M3161K	ENSP00000402343:M3161K	M	+	2	0	ZNF469	87030945	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.605000	0.82844	0.266000	0.21894	0.459000	0.35465	ATG	.	.		0.731	ZNF469-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NG_012236	
ATAD5	79915	hgsc.bcm.edu	37	17	29203505	29203505	+	Missense_Mutation	SNP	T	T	A			TCGA-2Y-A9GV-01A-11D-A382-10	TCGA-2Y-A9GV-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bbb0ee98-a0a5-4308-96f6-1ba7f5b71fef	c00cd9c3-fd3e-497f-94dd-30cfb18e4aa2	g.chr17:29203505T>A	ENST00000321990.4	+	15	4099	c.3721T>A	c.(3721-3723)Ttt>Att	p.F1241I		NM_024857.3	NP_079133.3	Q96QE3	ATAD5_HUMAN	ATPase family, AAA domain containing 5	1241					cellular response to DNA damage stimulus (GO:0006974)	nucleus (GO:0005634)	ATP binding (GO:0005524)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(8)|kidney(3)|large_intestine(18)|lung(13)|ovary(3)|pancreas(1)	51		all_hematologic(16;0.0202)|Acute lymphoblastic leukemia(14;0.0238)|Myeloproliferative disorder(56;0.0393)				GGCAAATTATTTTAAAGTATC	0.323																																					p.F1241I		Atlas-SNP	.											.	ATAD5	150	.	0			c.T3721A						.						56.0	58.0	57.0					17																	29203505		2203	4300	6503	SO:0001583	missense	79915	exon15			AATTATTTTAAAG		CCDS11260.1	17q11.2	2010-04-21	2007-02-08	2007-02-08	ENSG00000176208	ENSG00000176208		"""ATPases / AAA-type"""	25752	protein-coding gene	gene with protein product	"""enhanced level of genomic instability 1 homolog (S. cerevisiae)"""	609534	"""chromosome 17 open reading frame 41"""	C17orf41		15983387, 11468690, 19755857	Standard	NM_024857		Approved	FLJ12735, FRAG1, ELG1	uc002hfs.1	Q96QE3	OTTHUMG00000132794	ENST00000321990.4:c.3721T>A	chr17.hg19:g.29203505T>A	ENSP00000313171:p.Phe1241Ile	444.0	1.0		386.0	121.0	NM_024857	Q05DH0|Q69YR6|Q9H9I1	Missense_Mutation	SNP	ENST00000321990.4	hg19	CCDS11260.1	.	.	.	.	.	.	.	.	.	.	T	32	5.115396	0.94339	.	.	ENSG00000176208	ENST00000321990	T	0.12774	2.65	5.21	5.21	0.72293	ATPase, AAA+ type, core (1);	0.000000	0.85682	D	0.000000	T	0.37489	0.1005	M	0.69823	2.125	0.48696	D	0.999697	D	0.89917	1.0	D	0.87578	0.998	T	0.16100	-1.0414	10	0.66056	D	0.02	.	15.4007	0.74838	0.0:0.0:0.0:1.0	.	1241	Q96QE3	ATAD5_HUMAN	I	1241	ENSP00000313171:F1241I	ENSP00000313171:F1241I	F	+	1	0	ATAD5	26227631	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.230000	0.72301	2.088000	0.63022	0.533000	0.62120	TTT	.	.		0.323	ATAD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256206.2	NM_024857	
GGNBP2	79893	hgsc.bcm.edu	37	17	34945743	34945743	+	Nonsense_Mutation	SNP	C	C	T			TCGA-2Y-A9GV-01A-11D-A382-10	TCGA-2Y-A9GV-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bbb0ee98-a0a5-4308-96f6-1ba7f5b71fef	c00cd9c3-fd3e-497f-94dd-30cfb18e4aa2	g.chr17:34945743C>T	ENST00000304718.4	+	14	2312	c.1996C>T	c.(1996-1998)Cga>Tga	p.R666*	DHRS11_ENST00000590554.1_5'Flank|DHRS11_ENST00000251312.5_5'Flank	NM_024835.3	NP_079111.1	Q9H3C7	GGNB2_HUMAN	gametogenetin binding protein 2	666					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	cytoplasmic vesicle (GO:0031410)|nucleus (GO:0005634)		p.R666R(1)		breast(1)|endometrium(4)|kidney(3)|large_intestine(7)|liver(1)|lung(14)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|stomach(1)	38		Breast(25;0.00957)|Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0193)		AGAACAATACCGACAGCATCT	0.378																																					p.R666X		Atlas-SNP	.											.	GGNBP2	72	.	1	Substitution - coding silent(1)	lung(1)	c.C1996T						.						137.0	150.0	146.0					17																	34945743		2203	4300	6503	SO:0001587	stop_gained	79893	exon14			CAATACCGACAGC	AF126964	CCDS11314.1	17q21.1	2014-05-06	2007-08-20	2007-08-20	ENSG00000005955	ENSG00000278311			19357	protein-coding gene	gene with protein product		612275	"""zinc finger protein 403"""	ZNF403		11728448	Standard	NM_024835		Approved	ZFP403, LZK1, FLJ22561, FLJ21230, DIF-3, DIF3	uc002hnb.3	Q9H3C7	OTTHUMG00000188440	ENST00000304718.4:c.1996C>T	chr17.hg19:g.34945743C>T	ENSP00000307617:p.Arg666*	179.0	0.0		162.0	17.0	NM_024835	B2RPK7|Q96T90|Q9GZR8|Q9H767	Nonsense_Mutation	SNP	ENST00000304718.4	hg19	CCDS11314.1	.	.	.	.	.	.	.	.	.	.	C	38	6.947687	0.97956	.	.	ENSG00000005955	ENST00000304718	.	.	.	5.85	4.88	0.63580	.	0.124466	0.52532	D	0.000077	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-5.4774	11.9307	0.52845	0.1375:0.7305:0.1321:0.0	.	.	.	.	X	666	.	ENSP00000307617:R666X	R	+	1	2	GGNBP2	32019856	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.286000	0.51724	1.469000	0.48083	0.561000	0.74099	CGA	.	.		0.378	GGNBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256684.2	NM_024835	
PTRF	284119	hgsc.bcm.edu	37	17	40574761	40574761	+	Missense_Mutation	SNP	C	C	T			TCGA-2Y-A9GV-01A-11D-A382-10	TCGA-2Y-A9GV-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bbb0ee98-a0a5-4308-96f6-1ba7f5b71fef	c00cd9c3-fd3e-497f-94dd-30cfb18e4aa2	g.chr17:40574761C>T	ENST00000357037.5	-	1	774	c.355G>A	c.(355-357)Gtc>Atc	p.V119I		NM_012232.5	NP_036364.2			polymerase I and transcript release factor											breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(5)|ovary(1)|prostate(2)|urinary_tract(1)	17		all_cancers(22;0.00146)|Breast(137;0.00116)|all_epithelial(22;0.0134)		BRCA - Breast invasive adenocarcinoma(366;0.193)		TTCACGTTGACGCTGACCTTG	0.642																																					p.V119I		Atlas-SNP	.											.	PTRF	48	.	0			c.G355A						.						41.0	28.0	33.0					17																	40574761		2203	4300	6503	SO:0001583	missense	284119	exon1			CGTTGACGCTGAC	AF000421	CCDS11425.1	17q21.31	2011-04-20				ENSG00000177469			9688	protein-coding gene	gene with protein product		603198				9582279	Standard	NM_012232		Approved	cavin-1, CAVIN1	uc002hzo.3	Q6NZI2		ENST00000357037.5:c.355G>A	chr17.hg19:g.40574761C>T	ENSP00000349541:p.Val119Ile	138.0	0.0		120.0	34.0	NM_012232		Missense_Mutation	SNP	ENST00000357037.5	hg19	CCDS11425.1	.	.	.	.	.	.	.	.	.	.	C	28.6	4.937490	0.92458	.	.	ENSG00000177469	ENST00000357037;ENST00000357684	T	0.60299	0.2	5.13	5.13	0.70059	.	0.061560	0.64402	D	0.000005	T	0.56140	0.1965	L	0.61218	1.895	0.58432	D	0.999999	B;P	0.35411	0.348;0.5	B;B	0.30401	0.115;0.115	T	0.60541	-0.7243	10	0.48119	T	0.1	-35.7366	18.5736	0.91145	0.0:1.0:0.0:0.0	.	101;119	B4DNU9;Q6NZI2	.;PTRF_HUMAN	I	119;74	ENSP00000349541:V119I	ENSP00000349541:V119I	V	-	1	0	PTRF	37828287	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.967000	0.70403	2.373000	0.80994	0.561000	0.74099	GTC	.	.		0.642	PTRF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449938.1	NM_012232	
ITGB3	3690	hgsc.bcm.edu	37	17	45369918	45369918	+	Missense_Mutation	SNP	G	G	T			TCGA-2Y-A9GV-01A-11D-A382-10	TCGA-2Y-A9GV-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bbb0ee98-a0a5-4308-96f6-1ba7f5b71fef	c00cd9c3-fd3e-497f-94dd-30cfb18e4aa2	g.chr17:45369918G>T	ENST00000559488.1	+	10	1690	c.1674G>T	c.(1672-1674)aaG>aaT	p.K558N	ITGB3_ENST00000435993.2_Missense_Mutation_p.K511N|ITGB3_ENST00000560629.1_Missense_Mutation_p.G547W	NM_000212.2	NP_000203.2	P05106	ITB3_HUMAN	integrin, beta 3 (platelet glycoprotein IIIa, antigen CD61)	558	Cysteine-rich tandem repeats.				activation of protein kinase activity (GO:0032147)|angiogenesis involved in wound healing (GO:0060055)|apolipoprotein A-I-mediated signaling pathway (GO:0038027)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell growth (GO:0016049)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|cell-substrate adhesion (GO:0031589)|cell-substrate junction assembly (GO:0007044)|extracellular matrix organization (GO:0030198)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|mesodermal cell differentiation (GO:0048333)|negative chemotaxis (GO:0050919)|negative regulation of lipid storage (GO:0010888)|negative regulation of lipid transport (GO:0032369)|negative regulation of lipoprotein metabolic process (GO:0050748)|negative regulation of low-density lipoprotein particle receptor biosynthetic process (GO:0045715)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|protein folding (GO:0006457)|regulation of bone resorption (GO:0045124)|smooth muscle cell migration (GO:0014909)|substrate adhesion-dependent cell spreading (GO:0034446)|tube development (GO:0035295)|viral entry into host cell (GO:0046718)|wound healing (GO:0042060)	alphav-beta3 integrin-vitronectin complex (GO:0071062)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|integrin alphav-beta3 complex (GO:0034683)|integrin complex (GO:0008305)|lamellipodium membrane (GO:0031258)|melanosome (GO:0042470)|microvillus membrane (GO:0031528)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|platelet alpha granule membrane (GO:0031092)|receptor complex (GO:0043235)|ruffle membrane (GO:0032587)	cell adhesion molecule binding (GO:0050839)|extracellular matrix binding (GO:0050840)|fibronectin binding (GO:0001968)|identical protein binding (GO:0042802)|platelet-derived growth factor receptor binding (GO:0005161)|protease binding (GO:0002020)|protein disulfide isomerase activity (GO:0003756)|receptor activity (GO:0004872)|vascular endothelial growth factor receptor 2 binding (GO:0043184)			breast(3)|central_nervous_system(5)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(10)|lung(9)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	39					Abciximab(DB00054)|Antithymocyte globulin(DB00098)|Eptifibatide(DB00063)|Tirofiban(DB00775)	TCCGCTACAAGGGGGAGATGT	0.572																																					p.K558N		Atlas-SNP	.											.	ITGB3	157	.	0			c.G1674T						.						103.0	94.0	97.0					17																	45369918		2203	4300	6503	SO:0001583	missense	3690	exon10			CTACAAGGGGGAG		CCDS11511.1	17q21.32	2014-09-17			ENSG00000259207	ENSG00000259207		"""CD molecules"", ""Integrins"""	6156	protein-coding gene	gene with protein product	"""platelet glycoprotein IIIa"""	173470		GP3A		2454952	Standard	NM_000212		Approved	CD61, GPIIIa	uc002ilj.3	P05106	OTTHUMG00000171956	ENST00000559488.1:c.1674G>T	chr17.hg19:g.45369918G>T	ENSP00000452786:p.Lys558Asn	1609.0	1.0		1317.0	420.0	NM_000212	A0PJW2|D3DXJ8|O15495|Q12806|Q13413|Q14648|Q16499	Missense_Mutation	SNP	ENST00000559488.1	hg19	CCDS11511.1	.	.	.	.	.	.	.	.	.	.	G	12.02	1.811619	0.32053	.	.	ENSG00000178852	ENST00000262017;ENST00000435993	D	0.99023	-5.34	5.38	1.83	0.25207	.	0.088163	0.85682	D	0.000000	D	0.95404	0.8508	N	0.10629	0.0099999999999999	0.58432	D	0.999992	P	0.48350	0.909	P	0.45881	0.496	D	0.92662	0.6142	10	0.19147	T	0.46	.	10.8838	0.46955	0.2516:0.0:0.7484:0.0	.	558	P05106	ITB3_HUMAN	N	558;511	ENSP00000407801:K511N	ENSP00000262017:K558N	K	+	3	2	C17orf57	42724917	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	1.253000	0.32886	0.647000	0.30713	0.462000	0.41574	AAG	.	.		0.572	ITGB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416111.3	NM_000212	
MARCH10	162333	hgsc.bcm.edu	37	17	60814029	60814029	+	Silent	SNP	A	A	T			TCGA-2Y-A9GV-01A-11D-A382-10	TCGA-2Y-A9GV-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bbb0ee98-a0a5-4308-96f6-1ba7f5b71fef	c00cd9c3-fd3e-497f-94dd-30cfb18e4aa2	g.chr17:60814029A>T	ENST00000311269.5	-	6	1474	c.1200T>A	c.(1198-1200)ccT>ccA	p.P400P	MARCH10_ENST00000544856.2_Silent_p.P399P|RP11-156L14.1_ENST00000582564.1_RNA|RP11-156L14.1_ENST00000584597.1_RNA|RP11-156L14.1_ENST00000577270.1_RNA|MARCH10_ENST00000583600.1_Silent_p.P438P|RP11-156L14.1_ENST00000579201.1_RNA|MARCH10_ENST00000456609.2_Silent_p.P400P	NM_152598.2	NP_689811.2	Q8NA82	MARHA_HUMAN	membrane-associated ring finger (C3HC4) 10, E3 ubiquitin protein ligase	400					protein ubiquitination (GO:0016567)		ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(11)|liver(1)|lung(15)	38						CCCACGAAAGAGGGCTCTTTT	0.517																																					p.P400P		Atlas-SNP	.											.	MARCH10	102	.	0			c.T1200A						.						86.0	73.0	78.0					17																	60814029		2203	4300	6503	SO:0001819	synonymous_variant	162333	exon6			CGAAAGAGGGCTC	AK093076	CCDS11635.1, CCDS74122.1, CCDS74123.1	17q23.3	2013-01-09	2012-02-23	2007-08-20		ENSG00000173838		"""RING-type (C3HC4) zinc fingers"", ""MARCH membrane-associated ring fingers"""	26655	protein-coding gene	gene with protein product		613337	"""ring finger protein 190"", ""membrane-associated ring finger (C3HC4) 10"""	RNF190		17604280	Standard	XM_005257103		Approved	FLJ35757, MARCH-X	uc002jag.4	Q8NA82		ENST00000311269.5:c.1200T>A	chr17.hg19:g.60814029A>T		98.0	0.0		117.0	42.0	NM_001100875	D3DU09|Q8IYS7|Q8N7Z7	Silent	SNP	ENST00000311269.5	hg19	CCDS11635.1																																																																																			.	.		0.517	MARCH10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000445252.1	NM_152598	
DYM	54808	hgsc.bcm.edu	37	18	46798586	46798586	+	Missense_Mutation	SNP	T	T	C			TCGA-2Y-A9GV-01A-11D-A382-10	TCGA-2Y-A9GV-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bbb0ee98-a0a5-4308-96f6-1ba7f5b71fef	c00cd9c3-fd3e-497f-94dd-30cfb18e4aa2	g.chr18:46798586T>C	ENST00000269445.6	-	11	1670	c.1213A>G	c.(1213-1215)Acg>Gcg	p.T405A	DYM_ENST00000442713.2_Missense_Mutation_p.T215A	NM_017653.3	NP_060123.3	Q7RTS9	DYM_HUMAN	dymeclin	405					bone development (GO:0060348)|Golgi organization (GO:0007030)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)	enzyme binding (GO:0019899)			NS(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(6)|skin(1)|upper_aerodigestive_tract(1)	18						TCATCTTCCGTAAGGATCAAC	0.358																																					p.T405A		Atlas-SNP	.											.	DYM	52	.	0			c.A1213G						.						130.0	117.0	121.0					18																	46798586		2203	4299	6502	SO:0001583	missense	54808	exon11			CTTCCGTAAGGAT	AK000078	CCDS11937.1	18q21.1	2008-03-12			ENSG00000141627	ENSG00000141627			21317	protein-coding gene	gene with protein product		607461					Standard	NM_017653		Approved	FLJ20071, DMC, SMC	uc002ldi.1	Q7RTS9	OTTHUMG00000132659	ENST00000269445.6:c.1213A>G	chr18.hg19:g.46798586T>C	ENSP00000269445:p.Thr405Ala	297.0	0.0		274.0	67.0	NM_017653	A8K5I8|B2RCF9|B4DKI7|Q3ZTS8|Q6P2P5|Q8N2M0|Q9BVE9|Q9NPU7	Missense_Mutation	SNP	ENST00000269445.6	hg19	CCDS11937.1	.	.	.	.	.	.	.	.	.	.	T	22.6	4.311599	0.81358	.	.	ENSG00000141627	ENST00000418472;ENST00000442713;ENST00000269445	D;D	0.83591	-1.74;-1.74	5.21	5.21	0.72293	.	0.000000	0.85682	D	0.000000	D	0.90400	0.6995	M	0.76328	2.33	0.80722	D	1	P;D;P	0.69078	0.762;0.997;0.9	B;D;P	0.80764	0.445;0.994;0.622	D	0.91568	0.5269	10	0.72032	D	0.01	-14.8141	15.0753	0.72071	0.0:0.0:0.0:1.0	.	215;227;405	Q7RTS9-2;Q9NXS9;Q7RTS9	.;.;DYM_HUMAN	A	10;215;405	ENSP00000395942:T215A;ENSP00000269445:T405A	ENSP00000269445:T405A	T	-	1	0	DYM	45052584	1.000000	0.71417	0.985000	0.45067	0.940000	0.58332	7.659000	0.83766	1.981000	0.57761	0.477000	0.44152	ACG	.	.		0.358	DYM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255912.3	NM_017653	
PLIN4	729359	hgsc.bcm.edu	37	19	4511406	4511406	+	Missense_Mutation	SNP	T	T	C			TCGA-2Y-A9GV-01A-11D-A382-10	TCGA-2Y-A9GV-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bbb0ee98-a0a5-4308-96f6-1ba7f5b71fef	c00cd9c3-fd3e-497f-94dd-30cfb18e4aa2	g.chr19:4511406T>C	ENST00000301286.3	-	3	2523	c.2524A>G	c.(2524-2526)Aat>Gat	p.N842D		NM_001080400.1	NP_001073869.1	Q96Q06	PLIN4_HUMAN	perilipin 4	842	27 X 33 AA approximate tandem repeat.			GLKTTQNIA -> SVDTTKTVL (in Ref. 2; BAB67774). {ECO:0000305}.		cytoplasm (GO:0005737)|lipid particle (GO:0005811)|plasma membrane (GO:0005886)				NS(2)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(14)|ovary(1)|skin(2)|soft_tissue(1)|stomach(2)	41						GTTGCGATATTTTGGGTCGTT	0.597																																					p.N842D		Atlas-SNP	.											.	PLIN4	191	.	0			c.A2524G						.						74.0	87.0	83.0					19																	4511406		1915	4169	6084	SO:0001583	missense	729359	exon3			CGATATTTTGGGT	AB067468	CCDS45927.1	19p13.3	2009-10-06	2009-08-12	2009-08-12	ENSG00000167676	ENSG00000167676		"""Perilipins"""	29393	protein-coding gene	gene with protein product		613247	"""KIAA1881"""	KIAA1881		11572484, 19638644	Standard	NM_001080400		Approved	S3-12	uc002mar.1	Q96Q06	OTTHUMG00000167571	ENST00000301286.3:c.2524A>G	chr19.hg19:g.4511406T>C	ENSP00000301286:p.Asn842Asp	167.0	0.0		125.0	12.0	NM_001080400	A6NEI2	Missense_Mutation	SNP	ENST00000301286.3	hg19	CCDS45927.1	.	.	.	.	.	.	.	.	.	.	T	7.397	0.632036	0.14322	.	.	ENSG00000167676	ENST00000301286	T	0.05319	3.46	4.46	-0.135	0.13477	.	1.776240	0.03525	U	0.221644	T	0.04907	0.0132	L	0.34521	1.04	0.09310	N	1	B	0.21821	0.061	B	0.22386	0.039	T	0.39840	-0.9594	10	0.15952	T	0.53	-4.3924	0.8331	0.01134	0.1661:0.2976:0.1711:0.3651	.	842	Q96Q06	PLIN4_HUMAN	D	842	ENSP00000301286:N842D	ENSP00000301286:N842D	N	-	1	0	PLIN4	4462406	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.733000	0.01850	-0.150000	0.11195	0.379000	0.24179	AAT	.	.		0.597	PLIN4-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395095.1	XM_170901	
PLIN4	729359	hgsc.bcm.edu	37	19	4511426	4511426	+	Missense_Mutation	SNP	G	G	A			TCGA-2Y-A9GV-01A-11D-A382-10	TCGA-2Y-A9GV-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bbb0ee98-a0a5-4308-96f6-1ba7f5b71fef	c00cd9c3-fd3e-497f-94dd-30cfb18e4aa2	g.chr19:4511426G>A	ENST00000301286.3	-	3	2503	c.2504C>T	c.(2503-2505)aCt>aTt	p.T835I		NM_001080400.1	NP_001073869.1	Q96Q06	PLIN4_HUMAN	perilipin 4	835	27 X 33 AA approximate tandem repeat.					cytoplasm (GO:0005737)|lipid particle (GO:0005811)|plasma membrane (GO:0005886)				NS(2)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(14)|ovary(1)|skin(2)|soft_tissue(1)|stomach(2)	41						TTTCAGCCCAGTTTGCACAGC	0.597																																					p.T835I		Atlas-SNP	.											.	PLIN4	191	.	0			c.C2504T						.						81.0	95.0	90.0					19																	4511426		1941	4187	6128	SO:0001583	missense	729359	exon3			AGCCCAGTTTGCA	AB067468	CCDS45927.1	19p13.3	2009-10-06	2009-08-12	2009-08-12	ENSG00000167676	ENSG00000167676		"""Perilipins"""	29393	protein-coding gene	gene with protein product		613247	"""KIAA1881"""	KIAA1881		11572484, 19638644	Standard	NM_001080400		Approved	S3-12	uc002mar.1	Q96Q06	OTTHUMG00000167571	ENST00000301286.3:c.2504C>T	chr19.hg19:g.4511426G>A	ENSP00000301286:p.Thr835Ile	157.0	0.0		114.0	9.0	NM_001080400	A6NEI2	Missense_Mutation	SNP	ENST00000301286.3	hg19	CCDS45927.1	.	.	.	.	.	.	.	.	.	.	G	14.75	2.628418	0.46944	.	.	ENSG00000167676	ENST00000301286	T	0.05319	3.46	4.61	-2.63	0.06133	.	0.782001	0.10634	N	0.651842	T	0.09113	0.0225	M	0.83852	2.665	0.09310	N	1	B	0.29716	0.255	B	0.28991	0.097	T	0.28396	-1.0045	10	0.37606	T	0.19	-0.7363	6.6746	0.23087	0.1849:0.3787:0.4364:0.0	.	835	Q96Q06	PLIN4_HUMAN	I	835	ENSP00000301286:T835I	ENSP00000301286:T835I	T	-	2	0	PLIN4	4462426	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.362000	0.07602	0.023000	0.15187	0.462000	0.41574	ACT	.	.		0.597	PLIN4-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395095.1	XM_170901	
EMR1	2015	hgsc.bcm.edu	37	19	6937618	6937618	+	Missense_Mutation	SNP	T	T	A			TCGA-2Y-A9GV-01A-11D-A382-10	TCGA-2Y-A9GV-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bbb0ee98-a0a5-4308-96f6-1ba7f5b71fef	c00cd9c3-fd3e-497f-94dd-30cfb18e4aa2	g.chr19:6937618T>A	ENST00000312053.4	+	20	2651	c.2614T>A	c.(2614-2616)Tca>Aca	p.S872T	EMR1_ENST00000450315.3_Missense_Mutation_p.S695T|EMR1_ENST00000250572.8_Missense_Mutation_p.S807T|EMR1_ENST00000381407.5_Missense_Mutation_p.S731T|EMR1_ENST00000381404.4_Missense_Mutation_p.S853T	NM_001974.4	NP_001965.3	Q14246	EMR1_HUMAN	egf-like module containing, mucin-like, hormone receptor-like 1	872					cell adhesion (GO:0007155)|G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(11)|lung(31)|ovary(3)|prostate(1)|skin(8)	62	all_hematologic(4;0.166)					GTCCCAGACCTCAAGGATCTT	0.567																																					p.S872T		Atlas-SNP	.											.	EMR1	153	.	0			c.T2614A						.						168.0	137.0	148.0					19																	6937618		2203	4300	6503	SO:0001583	missense	2015	exon20			CAGACCTCAAGGA	X81479	CCDS12175.1, CCDS58643.1, CCDS58644.1, CCDS58645.1, CCDS58646.1	19p13.3	2014-08-08	2003-11-26					"""-"", ""GPCR / Class B : Orphans"""	3336	protein-coding gene	gene with protein product		600493	"""egf-like module containing, mucin-like, hormone receptor-like sequence 1"""	TM7LN3		7601460, 9500513	Standard	NM_001974		Approved		uc002mfw.4	Q14246		ENST00000312053.4:c.2614T>A	chr19.hg19:g.6937618T>A	ENSP00000311545:p.Ser872Thr	113.0	0.0		93.0	30.0	NM_001974	A6NHV2|B7Z486|B7Z489|E7EPX9|E9PD45|H9KV79|Q2I7G5|Q6ZMN0|Q8NGA7	Missense_Mutation	SNP	ENST00000312053.4	hg19	CCDS12175.1	.	.	.	.	.	.	.	.	.	.	t	10.05	1.244819	0.22796	.	.	ENSG00000174837	ENST00000543519;ENST00000312053;ENST00000381404;ENST00000250572;ENST00000381407;ENST00000450315	T;T;T;T;T	0.39592	1.07;1.07;1.07;1.07;1.07	4.64	3.58	0.41010	.	.	.	.	.	T	0.57681	0.2070	M	0.73962	2.25	0.28012	N	0.934863	D;D;D;D;D	0.76494	0.999;0.999;0.996;0.997;0.997	D;D;D;D;D	0.83275	0.996;0.918;0.987;0.985;0.985	T	0.49826	-0.8898	9	0.17832	T	0.49	.	7.246	0.26121	0.1976:0.0:0.0:0.8024	.	695;731;807;853;872	E7EPX9;B7Z486;Q14246-2;E9PD45;Q14246	.;.;.;.;EMR1_HUMAN	T	807;872;853;807;731;695	ENSP00000311545:S872T;ENSP00000370811:S853T;ENSP00000250572:S807T;ENSP00000370814:S731T;ENSP00000405974:S695T	ENSP00000250572:S807T	S	+	1	0	EMR1	6888618	0.007000	0.16637	0.615000	0.29064	0.012000	0.07955	0.735000	0.26115	0.593000	0.29745	0.529000	0.55759	TCA	.	.		0.567	EMR1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458485.1		
APLP1	333	hgsc.bcm.edu	37	19	36363437	36363437	+	Silent	SNP	T	T	A			TCGA-2Y-A9GV-01A-11D-A382-10	TCGA-2Y-A9GV-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bbb0ee98-a0a5-4308-96f6-1ba7f5b71fef	c00cd9c3-fd3e-497f-94dd-30cfb18e4aa2	g.chr19:36363437T>A	ENST00000221891.4	+	7	1095	c.903T>A	c.(901-903)ccT>ccA	p.P301P	APLP1_ENST00000586861.1_Silent_p.P295P|APLP1_ENST00000537454.2_Silent_p.P262P	NM_001024807.1|NM_005166.3	NP_001019978.1|NP_005157.1	P51693	APLP1_HUMAN	amyloid beta (A4) precursor-like protein 1	301	O-glycosylated at three sites.				adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|apoptotic process (GO:0006915)|cell adhesion (GO:0007155)|cellular response to norepinephrine stimulus (GO:0071874)|endocytosis (GO:0006897)|extracellular matrix organization (GO:0030198)|forebrain development (GO:0030900)|mRNA polyadenylation (GO:0006378)|negative regulation of cAMP biosynthetic process (GO:0030818)|nervous system development (GO:0007399)|organ morphogenesis (GO:0009887)|regulation of translation (GO:0006417)	basement membrane (GO:0005604)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	alpha-2A adrenergic receptor binding (GO:0031694)|alpha-2B adrenergic receptor binding (GO:0031695)|alpha-2C adrenergic receptor binding (GO:0031696)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|transition metal ion binding (GO:0046914)			breast(4)|endometrium(2)|kidney(2)|large_intestine(12)|liver(1)|lung(9)|ovary(2)|upper_aerodigestive_tract(1)	33	all_lung(56;7.14e-07)|Lung NSC(56;1.12e-06)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			TTGGCATGCCTGGGGAAATCA	0.587																																					p.P301P		Atlas-SNP	.											.	APLP1	77	.	0			c.T903A						.						155.0	151.0	152.0					19																	36363437		2203	4300	6503	SO:0001819	synonymous_variant	333	exon7			CATGCCTGGGGAA	U48437	CCDS32997.1	19q	2008-07-15							597	protein-coding gene	gene with protein product	"""amyloid-like protein 1"", ""amyloid precursor-like protein 1"""	104775				8432545	Standard	NM_001024807		Approved	APLP	uc002ocf.3	P51693		ENST00000221891.4:c.903T>A	chr19.hg19:g.36363437T>A		178.0	0.0		120.0	35.0	NM_005166	O00113|Q96A92	Silent	SNP	ENST00000221891.4	hg19	CCDS32997.1																																																																																			.	.		0.587	APLP1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452564.1	NM_001024807	
ZNF780A	284323	hgsc.bcm.edu	37	19	40581433	40581433	+	Missense_Mutation	SNP	C	C	T			TCGA-2Y-A9GV-01A-11D-A382-10	TCGA-2Y-A9GV-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bbb0ee98-a0a5-4308-96f6-1ba7f5b71fef	c00cd9c3-fd3e-497f-94dd-30cfb18e4aa2	g.chr19:40581433C>T	ENST00000595687.2	-	6	1125	c.916G>A	c.(916-918)Gta>Ata	p.V306I	ZNF780A_ENST00000414720.2_Intron|ZNF780A_ENST00000450241.2_Missense_Mutation_p.V272I|ZNF780A_ENST00000340963.5_Missense_Mutation_p.V306I|AC005614.5_ENST00000595508.1_RNA|ZNF780A_ENST00000455521.1_Missense_Mutation_p.V307I|ZNF780A_ENST00000594395.1_Missense_Mutation_p.V307I	NM_001010880.2	NP_001010880.2	O75290	Z780A_HUMAN	zinc finger protein 780A	306					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|endometrium(1)|kidney(1)|large_intestine(7)|lung(16)|upper_aerodigestive_tract(3)|urinary_tract(1)	31	all_cancers(60;9.55e-06)|all_lung(34;1.17e-07)|Lung NSC(34;1.41e-07)|Ovarian(47;0.0925)					TCCTTACATACAAAGGGTTTC	0.383																																					p.V307I		Atlas-SNP	.											.	ZNF780A	156	.	0			c.G919A						.						175.0	171.0	173.0					19																	40581433		2203	4300	6503	SO:0001583	missense	284323	exon6			TACATACAAAGGG	AK091274	CCDS33026.2, CCDS46078.1, CCDS46079.1	19q13.2	2014-02-12	2006-08-15		ENSG00000197782	ENSG00000197782		"""Zinc fingers, C2H2-type"", ""-"""	27603	protein-coding gene	gene with protein product							Standard	NM_001142577		Approved	ZNF780	uc010xvh.2	O75290	OTTHUMG00000155119	ENST00000595687.2:c.916G>A	chr19.hg19:g.40581433C>T	ENSP00000472189:p.Val306Ile	216.0	0.0		186.0	69.0	NM_001142577	E9PB48|Q6ZN87	Missense_Mutation	SNP	ENST00000595687.2	hg19	CCDS33026.2	.	.	.	.	.	.	.	.	.	.	C	14.17	2.454668	0.43634	.	.	ENSG00000197782	ENST00000450241;ENST00000455521;ENST00000340963	T;T	0.07567	3.18;3.18	1.53	1.53	0.23141	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.13970	0.0338	L	0.31845	0.965	0.09310	N	1	P;B	0.49185	0.92;0.064	D;B	0.65443	0.935;0.027	T	0.15549	-1.0433	9	0.66056	D	0.02	.	3.9199	0.09239	0.0:0.7579:0.0:0.2421	.	307;306	E9PB48;O75290	.;Z780A_HUMAN	I	306;307;306	ENSP00000400997:V307I;ENSP00000341507:V306I	ENSP00000341507:V306I	V	-	1	0	ZNF780A	45273273	.	.	0.589000	0.28718	0.967000	0.64934	.	.	0.795000	0.33922	0.305000	0.20034	GTA	.	.		0.383	ZNF780A-009	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000470066.1	NM_001010880	
ZNF225	7768	hgsc.bcm.edu	37	19	44635631	44635631	+	Silent	SNP	C	C	T			TCGA-2Y-A9GV-01A-11D-A382-10	TCGA-2Y-A9GV-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bbb0ee98-a0a5-4308-96f6-1ba7f5b71fef	c00cd9c3-fd3e-497f-94dd-30cfb18e4aa2	g.chr19:44635631C>T	ENST00000262894.6	+	5	1144	c.864C>T	c.(862-864)ttC>ttT	p.F288F	ZNF225_ENST00000590612.1_Silent_p.F288F|ZNF225_ENST00000592780.1_3'UTR	NM_013362.2	NP_037494.2	Q9UK10	ZN225_HUMAN	zinc finger protein 225	288					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(7)|skin(1)|stomach(1)	16		Prostate(69;0.0352)|all_neural(266;0.202)				AGAAGCCATTCAAATGTGATA	0.413																																					p.F288F		Atlas-SNP	.											.	ZNF225	41	.	0			c.C864T						.						94.0	99.0	97.0					19																	44635631		2200	4298	6498	SO:0001819	synonymous_variant	7768	exon5			GCCATTCAAATGT	AF187991	CCDS46100.1	19q13.31	2013-01-08				ENSG00000256294		"""Zinc fingers, C2H2-type"", ""-"""	13018	protein-coding gene	gene with protein product							Standard	NM_013362		Approved		uc002oyj.1	Q9UK10		ENST00000262894.6:c.864C>T	chr19.hg19:g.44635631C>T		160.0	0.0		133.0	38.0	NM_013362	A8K8S2|Q53F12|Q9NS46|Q9UID8	Silent	SNP	ENST00000262894.6	hg19	CCDS46100.1																																																																																			.	.		0.413	ZNF225-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460581.1		
SLC23A2	9962	hgsc.bcm.edu	37	20	4854660	4854660	+	Nonsense_Mutation	SNP	T	T	A			TCGA-2Y-A9GV-01A-11D-A382-10	TCGA-2Y-A9GV-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bbb0ee98-a0a5-4308-96f6-1ba7f5b71fef	c00cd9c3-fd3e-497f-94dd-30cfb18e4aa2	g.chr20:4854660T>A	ENST00000379333.1	-	11	1416	c.1024A>T	c.(1024-1026)Aag>Tag	p.K342*	SLC23A2_ENST00000338244.1_Nonsense_Mutation_p.K342*|SLC23A2_ENST00000468355.1_5'UTR|SLC23A2_ENST00000424750.2_Nonsense_Mutation_p.K228*	NM_203327.1	NP_976072.1	Q9UGH3	S23A2_HUMAN	solute carrier family 23 (ascorbic acid transporter), member 2	342					L-ascorbic acid metabolic process (GO:0019852)|L-ascorbic acid transport (GO:0015882)|molecular hydrogen transport (GO:0015993)|nucleobase transport (GO:0015851)|nucleobase-containing compound metabolic process (GO:0006139)|response to oxidative stress (GO:0006979)|small molecule metabolic process (GO:0044281)|transepithelial L-ascorbic acid transport (GO:0070904)|vitamin metabolic process (GO:0006766)|vitamin transmembrane transport (GO:0035461)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|basal plasma membrane (GO:0009925)|basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	L-ascorbate:sodium symporter activity (GO:0008520)|L-ascorbic acid transporter activity (GO:0015229)|nucleobase transmembrane transporter activity (GO:0015205)|sodium-dependent L-ascorbate transmembrane transporter activity (GO:0070890)|sodium-dependent multivitamin transmembrane transporter activity (GO:0008523)			endometrium(1)|kidney(3)|large_intestine(9)|lung(7)|ovary(3)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	27						AAGCCATACTTTGTGCTGTCG	0.532																																					p.K342X		Atlas-SNP	.											.	SLC23A2	62	.	0			c.A1024T						.						131.0	115.0	120.0					20																	4854660		2203	4300	6503	SO:0001587	stop_gained	9962	exon11			CATACTTTGTGCT	AF058319	CCDS13085.1	20p13	2013-07-18	2013-07-18	2003-03-21	ENSG00000089057	ENSG00000089057		"""Solute carriers"""	10973	protein-coding gene	gene with protein product		603791	"""solute carrier family 23 (nucleobase transporters), member 1"""	SLC23A1		9804989, 10331392	Standard	NM_005116		Approved	SVCT2, KIAA0238, YSPL2	uc002wlh.1	Q9UGH3	OTTHUMG00000031793	ENST00000379333.1:c.1024A>T	chr20.hg19:g.4854660T>A	ENSP00000368637:p.Lys342*	127.0	0.0		114.0	35.0	NM_203327	B4DJZ1|Q8WWR4|Q92512|Q96D54|Q9UNU1|Q9UP85	Nonsense_Mutation	SNP	ENST00000379333.1	hg19	CCDS13085.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	11.61|11.61	1.690244|1.690244	0.29962|0.29962	.|.	.|.	ENSG00000089057|ENSG00000089057	ENST00000423430|ENST00000379333;ENST00000338244;ENST00000424750	.|.	.|.	.|.	5.72|5.72	2.25|2.25	0.28309|0.28309	.|.	0.090711|0.090711	0.85682|0.85682	D|D	0.000000|0.000000	T|.	0.21227|.	0.0511|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.38090|.	-0.9677|.	4|.	.|0.02654	.|T	.|1	-6.499|-6.499	8.3503|8.3503	0.32299|0.32299	0.0:0.2351:0.0:0.7649|0.0:0.2351:0.0:0.7649	.|.	.|.	.|.	.|.	I|X	98|342;342;228	.|.	.|ENSP00000344322:K342X	K|K	-|-	2|1	0|0	SLC23A2|SLC23A2	4802660|4802660	1.000000|1.000000	0.71417|0.71417	0.029000|0.029000	0.17559|0.17559	0.001000|0.001000	0.01503|0.01503	3.357000|3.357000	0.52277|0.52277	0.125000|0.125000	0.18397|0.18397	-0.256000|-0.256000	0.11100|0.11100	AAA|AAG	.	.		0.532	SLC23A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077832.1		
PREX1	57580	hgsc.bcm.edu	37	20	47317318	47317318	+	Missense_Mutation	SNP	A	A	C			TCGA-2Y-A9GV-01A-11D-A382-10	TCGA-2Y-A9GV-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bbb0ee98-a0a5-4308-96f6-1ba7f5b71fef	c00cd9c3-fd3e-497f-94dd-30cfb18e4aa2	g.chr20:47317318A>C	ENST00000371941.3	-	7	912	c.890T>G	c.(889-891)cTt>cGt	p.L297R	PREX1_ENST00000396220.1_Missense_Mutation_p.L297R	NM_020820.3	NP_065871	Q8TCU6	PREX1_HUMAN	phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 1	297	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				actin filament polymerization (GO:0030041)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|neutrophil activation (GO:0042119)|neutrophil chemotaxis (GO:0030593)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|regulation of actin filament polymerization (GO:0030833)|regulation of dendrite development (GO:0050773)|superoxide metabolic process (GO:0006801)|T cell differentiation (GO:0030217)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|growth cone (GO:0030426)|intracellular membrane-bounded organelle (GO:0043231)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	enzyme binding (GO:0019899)|phospholipid binding (GO:0005543)|Rho GTPase activator activity (GO:0005100)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(3)|central_nervous_system(1)|endometrium(4)|kidney(6)|large_intestine(27)|lung(53)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|stomach(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	110			BRCA - Breast invasive adenocarcinoma(12;0.0135)|Colorectal(8;0.198)			GTAGACGAGAAGGTTGTCGAA	0.557																																					p.L297R		Atlas-SNP	.											.	PREX1	441	.	0			c.T890G						.						172.0	162.0	165.0					20																	47317318		2203	4300	6503	SO:0001583	missense	57580	exon7			ACGAGAAGGTTGT	AB037836	CCDS13410.1	20q13.13	2013-01-10	2008-09-15		ENSG00000124126	ENSG00000124126		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	32594	protein-coding gene	gene with protein product		606905				11955434, 15545267, 16301320	Standard	NM_020820		Approved	KIAA1415, P-REX1	uc002xtw.1	Q8TCU6	OTTHUMG00000032685	ENST00000371941.3:c.890T>G	chr20.hg19:g.47317318A>C	ENSP00000361009:p.Leu297Arg	165.0	0.0		128.0	38.0	NM_020820	E1P5X9|Q5JS95|Q5JS96|Q69YL2|Q7Z2L9|Q9BQH0|Q9BX55|Q9H4Q6|Q9P2D2|Q9UGQ4	Missense_Mutation	SNP	ENST00000371941.3	hg19	CCDS13410.1	.	.	.	.	.	.	.	.	.	.	A	21.1	4.104309	0.76983	.	.	ENSG00000124126	ENST00000371941;ENST00000396220	T;T	0.74209	-0.82;-0.82	5.11	5.11	0.69529	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.000000	0.43919	U	0.000512	D	0.83229	0.5209	L	0.54323	1.7	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.85217	0.1024	10	0.87932	D	0	.	15.1983	0.73112	1.0:0.0:0.0:0.0	.	297	Q8TCU6	PREX1_HUMAN	R	297	ENSP00000361009:L297R;ENSP00000379522:L297R	ENSP00000361009:L297R	L	-	2	0	PREX1	46750725	1.000000	0.71417	0.998000	0.56505	0.655000	0.38815	9.277000	0.95755	2.043000	0.60533	0.374000	0.22700	CTT	.	.		0.557	PREX1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000079623.1	NM_020820	
KRTAP27-1	643812	hgsc.bcm.edu	37	21	31709506	31709506	+	Missense_Mutation	SNP	A	A	G			TCGA-2Y-A9GV-01A-11D-A382-10	TCGA-2Y-A9GV-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bbb0ee98-a0a5-4308-96f6-1ba7f5b71fef	c00cd9c3-fd3e-497f-94dd-30cfb18e4aa2	g.chr21:31709506A>G	ENST00000382835.2	-	1	506	c.481T>C	c.(481-483)Tgt>Cgt	p.C161R		NM_001077711.1	NP_001071179.1	Q3LI81	KR271_HUMAN	keratin associated protein 27-1	161						intermediate filament (GO:0005882)				endometrium(2)|large_intestine(3)|lung(9)|ovary(2)|prostate(1)|skin(1)	18						TGACACTGACATTGGCTAGAT	0.498																																					p.C161R		Atlas-SNP	.											.	KRTAP27-1	53	.	0			c.T481C						.						138.0	134.0	135.0					21																	31709506		2203	4300	6503	SO:0001583	missense	643812	exon1			ACTGACATTGGCT	AB096937	CCDS33532.1	21q22.11	2007-11-23			ENSG00000206107	ENSG00000206107		"""Keratin associated proteins"""	33864	protein-coding gene	gene with protein product							Standard	NM_001077711		Approved		uc002ynx.1	Q3LI81	OTTHUMG00000059577	ENST00000382835.2:c.481T>C	chr21.hg19:g.31709506A>G	ENSP00000372286:p.Cys161Arg	167.0	0.0		133.0	53.0	NM_001077711		Missense_Mutation	SNP	ENST00000382835.2	hg19	CCDS33532.1	.	.	.	.	.	.	.	.	.	.	A	8.463	0.855791	0.17106	.	.	ENSG00000206107	ENST00000382835	T	0.03468	3.92	4.44	-1.24	0.09435	.	0.379473	0.08080	U	1.000000	T	0.09247	0.0228	M	0.75777	2.31	0.09310	N	1	D	0.55172	0.97	P	0.54100	0.742	T	0.27400	-1.0075	10	0.34782	T	0.22	1.1589	4.6064	0.12380	0.3442:0.2988:0.0:0.357	.	161	Q3LI81	KR271_HUMAN	R	161	ENSP00000372286:C161R	ENSP00000372286:C161R	C	-	1	0	KRTAP27-1	30631377	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.049000	0.11924	-0.171000	0.10797	-0.449000	0.05564	TGT	.	.		0.498	KRTAP27-1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000132470.3	NM_001077711	
HLCS	3141	hgsc.bcm.edu	37	21	38126652	38126652	+	Silent	SNP	A	A	G			TCGA-2Y-A9GV-01A-11D-A382-10	TCGA-2Y-A9GV-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bbb0ee98-a0a5-4308-96f6-1ba7f5b71fef	c00cd9c3-fd3e-497f-94dd-30cfb18e4aa2	g.chr21:38126652A>G	ENST00000399120.1	-	12	3306	c.2076T>C	c.(2074-2076)tcT>tcC	p.S692S	HLCS_ENST00000336648.4_Silent_p.S692S	NM_001242784.1	NP_001229713.1	P50747	BPL1_HUMAN	holocarboxylase synthetase (biotin-(proprionyl-CoA-carboxylase (ATP-hydrolysing)) ligase)	692					biotin metabolic process (GO:0006768)|cell proliferation (GO:0008283)|histone biotinylation (GO:0071110)|histone modification (GO:0016570)|protein biotinylation (GO:0009305)|response to biotin (GO:0070781)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nuclear lamina (GO:0005652)|nuclear matrix (GO:0016363)	ATP binding (GO:0005524)|biotin binding (GO:0009374)|biotin-[acetyl-CoA-carboxylase] ligase activity (GO:0004077)|biotin-[methylcrotonoyl-CoA-carboxylase] ligase activity (GO:0004078)|biotin-[methylmalonyl-CoA-carboxytransferase] ligase activity (GO:0004079)|biotin-[propionyl-CoA-carboxylase (ATP-hydrolyzing)] ligase activity (GO:0004080)|biotin-protein ligase activity (GO:0018271)|enzyme binding (GO:0019899)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(8)|liver(1)|lung(8)|ovary(2)|upper_aerodigestive_tract(1)	24		Myeloproliferative disorder(46;0.0422)			Biotin(DB00121)	GGAGGAAGCCAGAATCGTCCA	0.597																																					p.S692S		Atlas-SNP	.											.	HLCS	64	.	0			c.T2076C						.						75.0	56.0	63.0					21																	38126652		2203	4300	6503	SO:0001819	synonymous_variant	3141	exon12			GAAGCCAGAATCG		CCDS13647.1	21q22.1	2012-07-13	2010-04-30		ENSG00000159267	ENSG00000159267	6.3.4.9, 6.3.4.10, 6.3.4.11, 6.3.4.15		4976	protein-coding gene	gene with protein product		609018	"""holocarboxylase synthetase (biotin-[proprionyl-Coenzyme A-carboxylase (ATP-hydrolysing)] ligase)"", ""holocarboxylase synthetase (biotin-(proprionyl-Coenzyme A-carboxylase (ATP-hydrolysing)) ligase)"""			7842009	Standard	NM_000411		Approved	HCS	uc021wjb.1	P50747	OTTHUMG00000086636	ENST00000399120.1:c.2076T>C	chr21.hg19:g.38126652A>G		2054.0	1.0		1851.0	154.0	NM_000411	B2RAH1|D3DSG6|Q99451	Silent	SNP	ENST00000399120.1	hg19	CCDS13647.1																																																																																			.	.		0.597	HLCS-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000194687.2		
FBLN1	2192	hgsc.bcm.edu	37	22	45931160	45931160	+	Missense_Mutation	SNP	C	C	G			TCGA-2Y-A9GV-01A-11D-A382-10	TCGA-2Y-A9GV-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bbb0ee98-a0a5-4308-96f6-1ba7f5b71fef	c00cd9c3-fd3e-497f-94dd-30cfb18e4aa2	g.chr22:45931160C>G	ENST00000327858.6	+	8	960	c.865C>G	c.(865-867)Cga>Gga	p.R289G	FBLN1_ENST00000340923.5_Missense_Mutation_p.R289G|FBLN1_ENST00000402984.3_Missense_Mutation_p.R327G|FBLN1_ENST00000442170.2_Missense_Mutation_p.R289G|FBLN1_ENST00000348697.2_Missense_Mutation_p.R289G|FBLN1_ENST00000262722.7_Missense_Mutation_p.R289G	NM_006486.2	NP_006477	P23142	FBLN1_HUMAN	fibulin 1	289	EGF-like 3; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				embryo implantation (GO:0007566)|extracellular matrix organization (GO:0030198)|viral process (GO:0016032)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)|peptidase activator activity (GO:0016504)			biliary_tract(1)|central_nervous_system(1)|endometrium(4)|kidney(5)|large_intestine(7)|lung(8)|ovary(2)|prostate(1)|skin(1)	30		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0182)		CTTCCGCTGCCGACCCAAGCT	0.473																																					p.R289G		Atlas-SNP	.											.	FBLN1	143	.	0			c.C865G						.						102.0	91.0	95.0					22																	45931160		2203	4300	6503	SO:0001583	missense	2192	exon8			CGCTGCCGACCCA		CCDS14067.1, CCDS14068.1, CCDS14069.1, CCDS43028.1	22q13.31	2010-06-15			ENSG00000077942	ENSG00000077942		"""Fibulins"""	3600	protein-coding gene	gene with protein product		135820				2269669, 1400330	Standard	NM_006485		Approved	FBLN	uc003bgj.1	P23142	OTTHUMG00000151340	ENST00000327858.6:c.865C>G	chr22.hg19:g.45931160C>G	ENSP00000331544:p.Arg289Gly	133.0	0.0		119.0	7.0	NM_006487	B0QY42|B1AHL4|P23143|P23144|P37888|Q5TIC4|Q8TBH8|Q9HBQ5|Q9UC21|Q9UGR4|Q9UH41	Missense_Mutation	SNP	ENST00000327858.6	hg19	CCDS14067.1	.	.	.	.	.	.	.	.	.	.	c	16.89	3.247191	0.59103	.	.	ENSG00000077942	ENST00000348697;ENST00000402984;ENST00000262722;ENST00000327858;ENST00000442170;ENST00000340923	D;D;D;D;D;D	0.92495	-3.05;-3.05;-3.05;-3.05;-3.05;-3.05	5.56	1.98	0.26296	EGF-like calcium-binding (2);	0.176916	0.49916	D	0.000132	D	0.90400	0.6995	N	0.11284	0.12	0.35086	D	0.763899	D;D;D;D	0.89917	1.0;1.0;0.99;1.0	D;D;D;D	0.97110	1.0;0.999;0.964;0.999	D	0.90623	0.4561	10	0.33141	T	0.24	.	14.5479	0.68044	0.3537:0.6463:0.0:0.0	.	327;289;289;289	B1AHL2;P23142;B1AHL4;P23142-4	.;FBLN1_HUMAN;.;.	G	289;327;289;289;289;289	ENSP00000262723:R289G;ENSP00000385521:R327G;ENSP00000262722:R289G;ENSP00000331544:R289G;ENSP00000393812:R289G;ENSP00000342212:R289G	ENSP00000262722:R289G	R	+	1	2	FBLN1	44309824	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	0.900000	0.28431	0.388000	0.25054	-0.455000	0.05494	CGA	.	.		0.473	FBLN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000322287.1	NM_006486	
CXorf30	645090	hgsc.bcm.edu	37	X	36317241	36317241	+	Silent	SNP	A	A	T			TCGA-2Y-A9GV-01A-11D-A382-10	TCGA-2Y-A9GV-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bbb0ee98-a0a5-4308-96f6-1ba7f5b71fef	c00cd9c3-fd3e-497f-94dd-30cfb18e4aa2	g.chrX:36317241A>T	ENST00000378657.4	+	6	822	c.174A>T	c.(172-174)ccA>ccT	p.P58P		NM_001098843.4	NP_001092313.2	A6PW82	CX030_HUMAN	chromosome X open reading frame 30	58										breast(1)|lung(2)|stomach(1)	4						GGTATTCTCCAGCAACTACAG	0.358																																					p.P58P		Atlas-SNP	.											.	CXorf30	76	.	0			c.A174T						.						107.0	85.0	91.0					X																	36317241		692	1591	2283	SO:0001819	synonymous_variant	645090	exon7			TTCTCCAGCAACT		CCDS55396.1	Xp21.1	2014-08-07			ENSG00000205081	ENSG00000205081			27298	protein-coding gene	gene with protein product							Standard	NM_001098843		Approved		uc011mkc.3	A6PW82	OTTHUMG00000021353	ENST00000378657.4:c.174A>T	chrX.hg19:g.36317241A>T		733.0	0.0		612.0	182.0	NM_001098843		Silent	SNP	ENST00000378657.4	hg19	CCDS55396.1																																																																																			.	.		0.358	CXorf30-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NP_001092313	
IRS4	8471	hgsc.bcm.edu	37	X	107977611	107977611	+	Missense_Mutation	SNP	A	A	T			TCGA-2Y-A9GV-01A-11D-A382-10	TCGA-2Y-A9GV-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bbb0ee98-a0a5-4308-96f6-1ba7f5b71fef	c00cd9c3-fd3e-497f-94dd-30cfb18e4aa2	g.chrX:107977611A>T	ENST00000372129.2	-	1	2040	c.1964T>A	c.(1963-1965)cTt>cAt	p.L655H	RP6-24A23.6_ENST00000563887.1_5'Flank|RP6-24A23.3_ENST00000608811.1_RNA|RP6-24A23.3_ENST00000436013.1_RNA	NM_003604.2	NP_003595.1	O14654	IRS4_HUMAN	insulin receptor substrate 4	655					positive regulation of signal transduction (GO:0009967)|signal transduction (GO:0007165)	plasma membrane (GO:0005886)	SH3/SH2 adaptor activity (GO:0005070)|signal transducer activity (GO:0004871)			NS(1)|breast(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|lung(30)|ovary(5)|pancreas(2)|prostate(1)|skin(1)	78						ACAAAAATAAAGTCTGAATCT	0.522																																					p.L655H		Atlas-SNP	.											.	IRS4	253	.	0			c.T1964A						.						241.0	252.0	248.0					X																	107977611		2203	4300	6503	SO:0001583	missense	8471	exon1			AAATAAAGTCTGA	AF007567	CCDS14544.1	Xq22.3	2008-08-01			ENSG00000133124	ENSG00000133124			6128	protein-coding gene	gene with protein product		300904				9261155, 9553137	Standard	NM_003604		Approved	PY160, IRS-4	uc004eoc.2	O14654	OTTHUMG00000022181	ENST00000372129.2:c.1964T>A	chrX.hg19:g.107977611A>T	ENSP00000361202:p.Leu655His	246.0	0.0		197.0	9.0	NM_003604		Missense_Mutation	SNP	ENST00000372129.2	hg19	CCDS14544.1	.	.	.	.	.	.	.	.	.	.	A	11.13	1.549324	0.27652	.	.	ENSG00000133124	ENST00000372129	T	0.38240	1.15	4.9	4.9	0.64082	.	0.588692	0.15430	N	0.262757	T	0.47116	0.1428	L	0.51422	1.61	0.25666	N	0.985949	D	0.76494	0.999	D	0.68192	0.956	T	0.39121	-0.9629	10	0.41790	T	0.15	-7.0606	4.7439	0.13028	0.7413:0.0:0.0886:0.17	.	655	O14654	IRS4_HUMAN	H	655	ENSP00000361202:L655H	ENSP00000361202:L655H	L	-	2	0	IRS4	107864267	1.000000	0.71417	1.000000	0.80357	0.857000	0.48899	2.298000	0.43602	1.807000	0.52817	0.486000	0.48141	CTT	.	.		0.522	IRS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057879.1	NM_003604	
FMR1	2332	hgsc.bcm.edu	37	X	147014109	147014109	+	Missense_Mutation	SNP	G	G	A			TCGA-2Y-A9GV-01A-11D-A382-10	TCGA-2Y-A9GV-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bbb0ee98-a0a5-4308-96f6-1ba7f5b71fef	c00cd9c3-fd3e-497f-94dd-30cfb18e4aa2	g.chrX:147014109G>A	ENST00000370475.4	+	8	924	c.796G>A	c.(796-798)Gga>Aga	p.G266R	FMR1_ENST00000334557.6_Missense_Mutation_p.G266R|FMR1_ENST00000218200.8_Missense_Mutation_p.G266R|FMR1_ENST00000440235.2_5'UTR|FMR1_ENST00000439526.2_Missense_Mutation_p.G266R|FMR1_ENST00000370471.3_Missense_Mutation_p.G266R|FMR1_ENST00000370470.1_Missense_Mutation_p.G266R|FMR1_ENST00000370477.1_Missense_Mutation_p.G266R	NM_002024.5	NP_002015.1	Q06787	FMR1_HUMAN	fragile X mental retardation 1	266					central nervous system development (GO:0007417)|mRNA transport (GO:0051028)|negative regulation of translational initiation (GO:0045947)	cytoplasm (GO:0005737)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytoplasmic stress granule (GO:0010494)|dendritic shaft (GO:0043198)|dendritic spine (GO:0043197)|membrane (GO:0016020)|mRNA cap binding complex (GO:0005845)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|synapse (GO:0045202)	mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			NS(1)|breast(1)|endometrium(7)|kidney(1)|large_intestine(8)|lung(13)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)	35	Acute lymphoblastic leukemia(192;6.56e-05)					TCATATTTATGGAGAGGTAAA	0.353									Fragile X syndrome																												p.G266R		Atlas-SNP	.											.	FMR1	93	.	0			c.G796A						.						133.0	129.0	131.0					X																	147014109		2203	4300	6503	SO:0001583	missense	2332	exon8	Familial Cancer Database	Martin-Bell syndrome, FRAXA syndrome	ATTTATGGAGAGG	X69962	CCDS14682.1, CCDS55518.1, CCDS55519.1, CCDS76039.1	Xq27.3	2014-09-17			ENSG00000102081	ENSG00000102081			3775	protein-coding gene	gene with protein product		309550	"""premature ovarian failure 1"""	POF1, POF		1572655	Standard	NM_002024		Approved	FMRP, FRAXA, MGC87458	uc010nst.3	Q06787	OTTHUMG00000022606	ENST00000370475.4:c.796G>A	chrX.hg19:g.147014109G>A	ENSP00000359506:p.Gly266Arg	689.0	1.0		666.0	200.0	NM_002024	A6NNH4|D3DWT0|D3DWT1|D3DWT2|G8JL90|Q16578|Q5PQZ6|Q99054	Missense_Mutation	SNP	ENST00000370475.4	hg19	CCDS14682.1	.	.	.	.	.	.	.	.	.	.	G	28.3	4.905707	0.92107	.	.	ENSG00000102081	ENST00000218200;ENST00000370471;ENST00000370477;ENST00000370475;ENST00000334557;ENST00000439526;ENST00000370470	T;T;T;T;T;T;T	0.60672	0.17;0.17;0.17;0.17;0.17;0.17;0.17	5.78	5.78	0.91487	K Homology (1);K Homology, type 1, subgroup (1);K Homology, type 1 (1);	0.000000	0.85682	D	0.000000	T	0.79707	0.4492	M	0.85542	2.76	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;1.0;0.999;1.0;1.0	T	0.82839	-0.0259	10	0.87932	D	0	-36.5954	17.8786	0.88833	0.0:0.0:1.0:0.0	.	266;266;182;266;266	Q8IXW7;Q06787;Q59GC1;Q06787-8;G3V0J0	.;FMR1_HUMAN;.;.;.	R	266	ENSP00000218200:G266R;ENSP00000359502:G266R;ENSP00000359508:G266R;ENSP00000359506:G266R;ENSP00000355115:G266R;ENSP00000395923:G266R;ENSP00000359501:G266R	ENSP00000218200:G266R	G	+	1	0	FMR1	146821801	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	9.400000	0.97290	2.443000	0.82685	0.538000	0.68166	GGA	.	.		0.353	FMR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058655.1	NM_002024	
ABCC12	94160	hgsc.bcm.edu	37	16	48139142	48139159	+	In_Frame_Del	DEL	ACACCATGCTTGCAGTGT	ACACCATGCTTGCAGTGT	-	rs139979809		TCGA-2Y-A9GV-01A-11D-A382-10	TCGA-2Y-A9GV-10A-01D-A385-10	ACACCATGCTTGCAGTGT	ACACCATGCTTGCAGTGT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bbb0ee98-a0a5-4308-96f6-1ba7f5b71fef	c00cd9c3-fd3e-497f-94dd-30cfb18e4aa2	g.chr16:48139142_48139159delACACCATGCTTGCAGTGT	ENST00000311303.3	-	19	2909_2926	c.2564_2581delACACTGCAAGCATGGTGT	c.(2563-2583)tacactgcaagcatggtgttc>ttc	p.YTASMV855del	ABCC12_ENST00000448542.1_In_Frame_Del_p.YTASMV852del|ABCC12_ENST00000416054.1_3'UTR	NM_033226.2	NP_150229.2	Q96J65	MRP9_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 12	855	ABC transmembrane type-1 2. {ECO:0000255|PROSITE-ProRule:PRU00441}.					integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)			NS(1)|breast(5)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(15)|liver(1)|lung(43)|ovary(2)|prostate(3)|skin(7)|urinary_tract(1)	90		all_cancers(37;0.0474)|all_lung(18;0.047)				ACCAGCATGAACACCATGCTTGCAGTGTACACCCACTG	0.555																																					p.855_861del		Atlas-Indel,Pindel	.											.	ABCC12	190	.	0			c.2565_2582del						.																																			SO:0001651	inframe_deletion	94160	exon19			.	AY040220	CCDS10730.1	16q12.1	2012-03-14			ENSG00000140798	ENSG00000140798		"""ATP binding cassette transporters / subfamily C"""	14640	protein-coding gene	gene with protein product		607041				11435397, 11483364	Standard	NM_033226		Approved	MRP9	uc002efc.1	Q96J65	OTTHUMG00000133143	ENST00000311303.3:c.2564_2581delACACTGCAAGCATGGTGT	chr16.hg19:g.48139142_48139159delACACCATGCTTGCAGTGT	ENSP00000311030:p.Tyr855_Val860del	119.0	0.0		94.0	18.0	NM_033226	Q49AL2|Q8TAF0|Q8TEY2	In_Frame_Del	DEL	ENST00000311303.3	hg19	CCDS10730.1																																																																																			.	.		0.555	ABCC12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256837.1	NM_033226	
MSH3	4437	hgsc.bcm.edu	37	5	79950707	79950733	+	In_Frame_Del	DEL	CTGCAGCGGCCGCAGCGGCCGCAGCGC	CTGCAGCGGCCGCAGCGGCCGCAGCGC	-	rs2431220|rs2001675|rs2405876|rs201874762|rs2405875|rs144776112|rs1574197|rs148550291|rs201906899|rs535056167|rs60484572|rs70991168|rs201149584	byFrequency	TCGA-2Y-A9GV-01A-11D-A382-10	TCGA-2Y-A9GV-10A-01D-A385-10	CTGCAGCGGCCGCAGCGGCCGCAGCGC	CTGCAGCGGCCGCAGCGGCCGCAGCGC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bbb0ee98-a0a5-4308-96f6-1ba7f5b71fef	c00cd9c3-fd3e-497f-94dd-30cfb18e4aa2	g.chr5:79950707_79950733delCTGCAGCGGCCGCAGCGGCCGCAGCGC	ENST00000265081.6	+	1	241_267	c.161_187delCTGCAGCGGCCGCAGCGGCCGCAGCGC	c.(160-189)gctgcagcggccgcagcggccgcagcgccc>gcc	p.AAAAAAAAP55del	DHFR_ENST00000511032.1_5'Flank|DHFR_ENST00000513048.1_5'Flank|DHFR_ENST00000505337.1_5'Flank|DHFR_ENST00000504396.1_5'Flank|DHFR_ENST00000439211.2_5'UTR	NM_002439.4	NP_002430.3	P20585	MSH3_HUMAN	mutS homolog 3	55	Poly-Ala.				ATP catabolic process (GO:0006200)|DNA repair (GO:0006281)|maintenance of DNA repeat elements (GO:0043570)|meiotic mismatch repair (GO:0000710)|mismatch repair (GO:0006298)|negative regulation of DNA recombination (GO:0045910)|positive regulation of helicase activity (GO:0051096)|reciprocal meiotic recombination (GO:0007131)|somatic recombination of immunoglobulin gene segments (GO:0016447)	membrane (GO:0016020)|MutSbeta complex (GO:0032302)|nuclear chromosome (GO:0000228)|nucleus (GO:0005634)	ATP binding (GO:0005524)|centromeric DNA binding (GO:0019237)|damaged DNA binding (GO:0003684)|DNA-dependent ATPase activity (GO:0008094)|double-strand/single-strand DNA junction binding (GO:0000406)|enzyme binding (GO:0019899)|heteroduplex DNA loop binding (GO:0000404)|Y-form DNA binding (GO:0000403)			NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(12)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	29		Lung NSC(167;0.00479)|all_lung(232;0.00507)|Ovarian(174;0.0261)|Breast(144;0.244)		OV - Ovarian serous cystadenocarcinoma(54;2.38e-45)|Epithelial(54;1.58e-38)|all cancers(79;4.93e-33)		GCTgcagcggctgcagcggccgcagcggccgcagcgCCCCCAGCGCC	0.709								Mismatch excision repair (MMR)																													p.54_62del	Melanoma(88;1010 1399 13793 26548 36275)	Atlas-INDEL	.											.	MSH3	129	.	0			c.160_186del						.																																			SO:0001651	inframe_deletion	4437	exon1			.	U61981	CCDS34195.1	5q11-q12	2013-09-12	2013-09-12		ENSG00000113318	ENSG00000113318			7326	protein-coding gene	gene with protein product	"""Divergent upstream protein"", ""Mismatch repair protein 1"""	600887	"""mutS (E. coli) homolog 3"", ""mutS homolog 3 (E. coli)"""				Standard	NM_002439		Approved	DUP, MRP1	uc003kgz.4	P20585	OTTHUMG00000162540	ENST00000265081.6:c.161_187delCTGCAGCGGCCGCAGCGGCCGCAGCGC	chr5.hg19:g.79950707_79950733delCTGCAGCGGCCGCAGCGGCCGCAGCGC	ENSP00000265081:p.Ala55_Pro63del	119.0	0.0		111.0	49.0	NM_002439	A1L480|A1L482|A6NMM6|Q6PJT5|Q86UQ6|Q92867	In_Frame_Del	DEL	ENST00000265081.6	hg19	CCDS34195.1																																																																																			.	.		0.709	MSH3-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369471.1	NM_002439	
ATP1A1	476	hgsc.bcm.edu	37	1	116935513	116935514	+	Frame_Shift_Ins	INS	-	-	A			TCGA-2Y-A9GV-01A-11D-A382-10	TCGA-2Y-A9GV-10A-01D-A385-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bbb0ee98-a0a5-4308-96f6-1ba7f5b71fef	c00cd9c3-fd3e-497f-94dd-30cfb18e4aa2	g.chr1:116935513_116935514insA	ENST00000295598.5	+	11	1622_1623	c.1370_1371insA	c.(1369-1374)ttaaagfs	p.LK457fs	ATP1A1_ENST00000537345.1_Frame_Shift_Ins_p.LK457fs|ATP1A1_ENST00000369496.4_Frame_Shift_Ins_p.LK426fs	NM_000701.7	NP_000692.2	P05023	AT1A1_HUMAN	ATPase, Na+/K+ transporting, alpha 1 polypeptide	457					ATP biosynthetic process (GO:0006754)|cardiac muscle contraction (GO:0060048)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular potassium ion homeostasis (GO:0030007)|cellular response to mechanical stimulus (GO:0071260)|cellular response to steroid hormone stimulus (GO:0071383)|cellular sodium ion homeostasis (GO:0006883)|ion transmembrane transport (GO:0034220)|membrane hyperpolarization (GO:0060081)|membrane repolarization (GO:0086009)|membrane repolarization during cardiac muscle cell action potential (GO:0086013)|negative regulation of glucocorticoid biosynthetic process (GO:0031947)|negative regulation of heart contraction (GO:0045822)|positive regulation of heart contraction (GO:0045823)|positive regulation of striated muscle contraction (GO:0045989)|potassium ion import (GO:0010107)|regulation of blood pressure (GO:0008217)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of sodium ion transport (GO:0002028)|regulation of the force of heart contraction (GO:0002026)|relaxation of cardiac muscle (GO:0055119)|response to drug (GO:0042493)|sodium ion export from cell (GO:0036376)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|caveola (GO:0005901)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|sodium:potassium-exchanging ATPase complex (GO:0005890)|T-tubule (GO:0030315)|vesicle (GO:0031982)	ADP binding (GO:0043531)|ATP binding (GO:0005524)|chaperone binding (GO:0051087)|phosphatase activity (GO:0016791)|potassium ion binding (GO:0030955)|sodium ion binding (GO:0031402)|sodium:potassium-exchanging ATPase activity (GO:0005391)|steroid hormone binding (GO:1990239)			NS(2)|breast(2)|cervix(3)|endometrium(2)|kidney(5)|large_intestine(9)|lung(17)|ovary(1)|prostate(1)|skin(3)|stomach(1)|urinary_tract(1)	47	Lung SC(450;0.225)	all_cancers(81;1.28e-06)|all_epithelial(167;3.48e-07)|all_lung(203;2.64e-06)|Lung NSC(69;1.98e-05)		Lung(183;0.0164)|LUSC - Lung squamous cell carcinoma(189;0.0548)|Colorectal(144;0.0825)|COAD - Colon adenocarcinoma(174;0.127)|all cancers(265;0.24)	Acetyldigitoxin(DB00511)|Almitrine(DB01430)|Aluminium(DB01370)|Bepridil(DB01244)|Bretylium(DB01158)|Ciclopirox(DB01188)|Deslanoside(DB01078)|Diazoxide(DB01119)|Digitoxin(DB01396)|Digoxin(DB00390)|Ethacrynic acid(DB00903)|Hydroflumethiazide(DB00774)|Ouabain(DB01092)|Trichlormethiazide(DB01021)	TCAGCACTCTTAAAGTGCATAG	0.45																																					p.L457fs		Atlas-Indel,Pindel	.											.	ATP1A1	87	.	0			c.1370_1371insA						.																																			SO:0001589	frameshift_variant	476	exon11			.	D00099	CCDS887.1, CCDS53351.1, CCDS53352.1	1p13	2012-10-22			ENSG00000163399	ENSG00000163399	3.6.3.9	"""ATPases / P-type"""	799	protein-coding gene	gene with protein product	"""sodium/potassium-transporting ATPase subunit alpha-1"", ""sodium pump subunit alpha-1"", ""sodium-potassium ATPase catalytic subunit alpha-1"""	182310					Standard	NM_000701		Approved		uc001ege.3	P05023	OTTHUMG00000012109	ENST00000295598.5:c.1373dupA	chr1.hg19:g.116935516_116935516dupA	ENSP00000295598:p.Leu457fs	141.0	0.0		88.0	25.0	NM_000701	B2RBR6|B7Z2T5|B7Z3U6|F5H3A1|Q16689|Q6LDM4|Q9UCN1|Q9UJ20|Q9UJ21	Frame_Shift_Ins	INS	ENST00000295598.5	hg19	CCDS887.1																																																																																			.	.		0.450	ATP1A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000033481.5	NM_001160233	
NRBP2	340371	hgsc.bcm.edu	37	8	144917875	144917876	+	Frame_Shift_Ins	INS	-	-	AGGCGGCCAGCTTCAT			TCGA-2Y-A9GV-01A-11D-A382-10	TCGA-2Y-A9GV-10A-01D-A385-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bbb0ee98-a0a5-4308-96f6-1ba7f5b71fef	c00cd9c3-fd3e-497f-94dd-30cfb18e4aa2	g.chr8:144917875_144917876insAGGCGGCCAGCTTCAT	ENST00000442628.2	-	18	1601_1602	c.1462_1463insATGAAGCTGGCCGCCT	c.(1462-1464)ttcfs	p.F488fs	RP11-299M14.2_ENST00000534006.1_RNA|NRBP2_ENST00000327830.5_Frame_Shift_Ins_p.F245fs	NM_178564.3	NP_848659.2			nuclear receptor binding protein 2											central_nervous_system(2)|kidney(1)|large_intestine(2)	5	all_cancers(97;2.31e-11)|all_epithelial(106;1.58e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;1.23e-39)|all cancers(56;6.82e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.18)			GCTCTCCAGGAAGGCGGCCAGC	0.738																																					p.F488fs		Atlas-Indel,Pindel	.											.	NRBP2	20	.	0			c.1463_1464insATGAAGCTGGCCGCCT						.																																			SO:0001589	frameshift_variant	340371	exon18			.	BC037396	CCDS34959.1, CCDS34959.2	8q24.3	2005-01-24							19339	protein-coding gene	gene with protein product		615563				14702039	Standard	NM_178564		Approved	DKFZp434P086	uc011lkt.2	Q9NSY0		ENST00000442628.2:c.1447_1462dupATGAAGCTGGCCGCCT	chr8.hg19:g.144917875_144917876insAGGCGGCCAGCTTCAT	ENSP00000414055:p.Phe488fs	181.0	0.0		126.0	10.0	NM_178564		Frame_Shift_Ins	INS	ENST00000442628.2	hg19	CCDS34959.2																																																																																			.	.		0.738	NRBP2-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382247.1	NM_178564	
