#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
CYP4A22	284541	hgsc.bcm.edu	37	1	47606450	47606450	+	Splice_Site	SNP	A	A	C			TCGA-2Y-A9GX-01A-11D-A382-10	TCGA-2Y-A9GX-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e1ab7d98-d4e4-47e9-bcbd-a616ec8e29bb	e977b5c2-99d4-4352-b892-10503efd33a7	g.chr1:47606450A>C	ENST00000371891.3	+	2	226		c.e2-1		CYP4A22-AS1_ENST00000444042.2_lincRNA|CYP4A22_ENST00000294337.3_Splice_Site|CYP4A22_ENST00000485117.1_Splice_Site|CYP4A22_ENST00000371890.3_Splice_Site	NM_001010969.2	NP_001010969.2	Q5TCH4	CP4AM_HUMAN	cytochrome P450, family 4, subfamily A, polypeptide 22							endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)	alkane 1-monooxygenase activity (GO:0018685)|arachidonic acid omega-hydroxylase activity (GO:0052869)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(4)|ovary(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	22						CCTCGTTGACAGTTCCAACAC	0.502																																					.	Pancreas(88;1240 1470 2099 14214 37557)	Atlas-SNP	.											.	CYP4A22	60	.	0			c.196-2A>C						.						153.0	134.0	140.0					1																	47606450		2203	4300	6503	SO:0001630	splice_region_variant	284541	exon2			GTTGACAGTTCCA		CCDS30707.1	1p33	2007-12-14			ENSG00000162365	ENSG00000162365		"""Cytochrome P450s"""	20575	protein-coding gene	gene with protein product		615341					Standard	XM_005270768		Approved		uc001cqv.1	Q5TCH4	OTTHUMG00000007845	ENST00000371891.3:c.196-1A>C	chr1.hg19:g.47606450A>C		92.0	0.0		78.0	11.0	NM_001010969	Q5TCH3|Q6JXK7|Q6JXK8|Q9NRM4	Splice_Site	SNP	ENST00000371891.3	hg19	CCDS30707.1	.	.	.	.	.	.	.	.	.	.	a	3.871	-0.027890	0.07589	.	.	ENSG00000162365	ENST00000371890;ENST00000371891;ENST00000294337	.	.	.	1.19	-0.103	0.13609	.	.	.	.	.	.	.	.	.	.	.	0.20403	N	0.999907	.	.	.	.	.	.	.	.	.	.	.	.	.	.	4.2145	0.10528	0.6951:0.0:0.0:0.3049	.	.	.	.	.	-1	.	.	.	+	.	.	CYP4A22	47379037	0.071000	0.21146	0.005000	0.12908	0.105000	0.19272	2.149000	0.42244	-0.049000	0.13379	0.172000	0.16884	.	.	.		0.502	CYP4A22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021635.1	XM_208213	Intron
EVI5	7813	hgsc.bcm.edu	37	1	93091357	93091357	+	Missense_Mutation	SNP	G	G	C			TCGA-2Y-A9GX-01A-11D-A382-10	TCGA-2Y-A9GX-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e1ab7d98-d4e4-47e9-bcbd-a616ec8e29bb	e977b5c2-99d4-4352-b892-10503efd33a7	g.chr1:93091357G>C	ENST00000370331.1	-	13	1623	c.1614C>G	c.(1612-1614)caC>caG	p.H538Q	EVI5_ENST00000540033.1_Missense_Mutation_p.H538Q|EVI5_ENST00000491940.1_5'UTR|EVI5_ENST00000543509.1_Missense_Mutation_p.H549Q	NM_005665.4	NP_005656.4	O60447	EVI5_HUMAN	ecotropic viral integration site 5	538	Dimerization.|Interaction with AURKB and INCENP.|Targeting to the centrosomes.				cell cycle (GO:0007049)|cell division (GO:0051301)|cell proliferation (GO:0008283)|multicellular organismal development (GO:0007275)|positive regulation of GTP catabolic process (GO:0033126)|positive regulation of Rab GTPase activity (GO:0032851)|retrograde transport, endosome to Golgi (GO:0042147)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	Rab GTPase activator activity (GO:0005097)|Rab GTPase binding (GO:0017137)			breast(1)|endometrium(6)|kidney(2)|large_intestine(8)|lung(18)|ovary(1)|prostate(1)|skin(1)	38		all_lung(203;0.00146)|Lung NSC(277;0.00565)|all_neural(321;0.185)|Melanoma(281;0.193)|Glioma(108;0.203)		Epithelial(280;8.09e-25)|OV - Ovarian serous cystadenocarcinoma(397;1.27e-22)|all cancers(265;1.74e-21)|GBM - Glioblastoma multiforme(16;0.00233)|BRCA - Breast invasive adenocarcinoma(282;0.211)		ATACCTGCCAGTGTTCCTCTA	0.358																																					p.H538Q		Atlas-SNP	.											.	EVI5	94	.	0			c.C1614G						.						135.0	136.0	136.0					1																	93091357		2202	4300	6502	SO:0001583	missense	7813	exon13			CTGCCAGTGTTCC	AF008915	CCDS30774.1	1p22	2013-07-09			ENSG00000067208	ENSG00000067208			3501	protein-coding gene	gene with protein product	"""neuroblastoma stage 4S gene"""	602942				9618176	Standard	XM_005271180		Approved	NB4S	uc001dox.3	O60447	OTTHUMG00000010895	ENST00000370331.1:c.1614C>G	chr1.hg19:g.93091357G>C	ENSP00000359356:p.His538Gln	289.0	0.0		301.0	25.0	NM_005665	A6NKX8|B9A6J0|Q9H1Y9	Missense_Mutation	SNP	ENST00000370331.1	hg19	CCDS30774.1	.	.	.	.	.	.	.	.	.	.	G	1.040	-0.679072	0.03378	.	.	ENSG00000067208	ENST00000370331;ENST00000540033;ENST00000543509;ENST00000338689	T;T;T	0.29655	1.56;1.56;1.56	5.61	-0.176	0.13311	.	0.000000	0.85682	D	0.000000	T	0.10035	0.0246	L	0.33792	1.035	0.40241	D	0.977968	P;P	0.45902	0.868;0.67	P;P	0.50825	0.651;0.449	T	0.16748	-1.0392	10	0.02654	T	1	-12.2788	7.0901	0.25279	0.3719:0.1194:0.5087:0.0	.	549;538	F5H4R0;O60447	.;EVI5_HUMAN	Q	538;538;549;237	ENSP00000359356:H538Q;ENSP00000440826:H538Q;ENSP00000445019:H549Q	ENSP00000345500:H237Q	H	-	3	2	EVI5	92863945	1.000000	0.71417	0.999000	0.59377	0.509000	0.34042	1.128000	0.31369	0.065000	0.16485	-0.196000	0.12772	CAC	.	.		0.358	EVI5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030047.1	NM_005665	
ABCA4	24	hgsc.bcm.edu	37	1	94476366	94476366	+	Missense_Mutation	SNP	G	G	A			TCGA-2Y-A9GX-01A-11D-A382-10	TCGA-2Y-A9GX-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e1ab7d98-d4e4-47e9-bcbd-a616ec8e29bb	e977b5c2-99d4-4352-b892-10503efd33a7	g.chr1:94476366G>A	ENST00000370225.3	-	40	5790	c.5704C>T	c.(5704-5706)Ctc>Ttc	p.L1902F	ABCA4_ENST00000465352.1_5'UTR|ABCA4_ENST00000535881.1_Missense_Mutation_p.L21F|ABCA4_ENST00000536513.1_Missense_Mutation_p.L172F	NM_000350.2	NP_000341.2	P78363	ABCA4_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 4	1902					phospholipid transfer to membrane (GO:0006649)|photoreceptor cell maintenance (GO:0045494)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|transmembrane transport (GO:0055085)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|photoreceptor disc membrane (GO:0097381)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|phospholipid-translocating ATPase activity (GO:0004012)|transporter activity (GO:0005215)			NS(2)|breast(6)|central_nervous_system(5)|endometrium(9)|haematopoietic_and_lymphoid_tissue(5)|kidney(10)|large_intestine(25)|lung(57)|ovary(4)|pancreas(1)|prostate(4)|skin(10)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(2)	147		all_lung(203;0.000757)|Lung NSC(277;0.00335)		all cancers(265;0.00432)|GBM - Glioblastoma multiforme(16;0.00715)|Epithelial(280;0.171)		CATTGGGAGAGGAAGAAGTGG	0.572																																					p.L1902F		Atlas-SNP	.											.	ABCA4	275	.	0			c.C5704T						.						166.0	129.0	141.0					1																	94476366		2203	4300	6503	SO:0001583	missense	24	exon40			GGGAGAGGAAGAA	U88667	CCDS747.1	1p22	2013-01-23			ENSG00000198691	ENSG00000198691		"""ATP binding cassette transporters / subfamily A"""	34	protein-coding gene	gene with protein product	"""Stargardt disease"""	601691	"""ATP-binding cassette transporter, retinal-specific"""	STGD1, ABCR, RP19, STGD		9490294	Standard	NM_000350		Approved	FFM, ARMD2, CORD3	uc001dqh.3	P78363	OTTHUMG00000010622	ENST00000370225.3:c.5704C>T	chr1.hg19:g.94476366G>A	ENSP00000359245:p.Leu1902Phe	111.0	0.0		99.0	8.0	NM_000350	O15112|O60438|O60915|Q0QD48|Q4LE31	Missense_Mutation	SNP	ENST00000370225.3	hg19	CCDS747.1	.	.	.	.	.	.	.	.	.	.	G	8.785	0.929285	0.18131	.	.	ENSG00000198691	ENST00000546054;ENST00000370225;ENST00000536513;ENST00000535881	D;D;D	0.91521	-2.86;-2.35;-2.39	4.74	0.647	0.17796	.	0.520502	0.22207	N	0.063143	T	0.74107	0.3673	L	0.43923	1.385	0.80722	D	1	B;B;B	0.06786	0.001;0.0;0.0	B;B;B	0.10450	0.005;0.001;0.002	T	0.62445	-0.6853	10	0.18710	T	0.47	.	9.7315	0.40363	0.5594:0.0:0.4406:0.0	.	172;21;1902	B4DWY6;B4DX12;P78363	.;.;ABCA4_HUMAN	F	694;1902;172;21	ENSP00000359245:L1902F;ENSP00000439707:L172F;ENSP00000443203:L21F	ENSP00000359245:L1902F	L	-	1	0	ABCA4	94248954	0.094000	0.21725	0.991000	0.47740	0.936000	0.57629	-0.453000	0.06778	0.027000	0.15297	0.585000	0.79938	CTC	.	.		0.572	ABCA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029320.1	NM_000350	
CAPZA1	829	hgsc.bcm.edu	37	1	113202330	113202330	+	Missense_Mutation	SNP	C	C	T	rs145898509		TCGA-2Y-A9GX-01A-11D-A382-10	TCGA-2Y-A9GX-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e1ab7d98-d4e4-47e9-bcbd-a616ec8e29bb	e977b5c2-99d4-4352-b892-10503efd33a7	g.chr1:113202330C>T	ENST00000263168.3	+	7	1186	c.514C>T	c.(514-516)Cgt>Tgt	p.R172C	CAPZA1_ENST00000476936.1_3'UTR	NM_006135.2	NP_006126.1	P52907	CAZA1_HUMAN	capping protein (actin filament) muscle Z-line, alpha 1	172					actin cytoskeleton organization (GO:0030036)|actin filament capping (GO:0051693)|blood coagulation (GO:0007596)|cellular component movement (GO:0006928)|innate immune response (GO:0045087)|protein complex assembly (GO:0006461)	actin cytoskeleton (GO:0015629)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|F-actin capping protein complex (GO:0008290)|WASH complex (GO:0071203)	actin binding (GO:0003779)			breast(1)|kidney(2)|large_intestine(2)|lung(3)|prostate(1)	9	Lung SC(450;0.246)	all_cancers(81;1.44e-07)|all_epithelial(167;7.64e-07)|all_lung(203;2.16e-05)|Lung NSC(69;3.86e-05)		Lung(183;0.0234)|all cancers(265;0.0246)|Epithelial(280;0.0342)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		TAGGAATGGTCGTTGGAGATC	0.438																																					p.R172C		Atlas-SNP	.											.	CAPZA1	16	.	0			c.C514T						.						92.0	85.0	87.0					1																	113202330		2203	4300	6503	SO:0001583	missense	829	exon7			AATGGTCGTTGGA	U56637	CCDS30805.1	1p13.2	2014-05-09			ENSG00000116489	ENSG00000116489			1488	protein-coding gene	gene with protein product		601580				7665558, 9119363	Standard	NM_006135		Approved		uc001ecj.1	P52907	OTTHUMG00000011769	ENST00000263168.3:c.514C>T	chr1.hg19:g.113202330C>T	ENSP00000263168:p.Arg172Cys	65.0	0.0		69.0	9.0	NM_006135	Q53FQ6|Q6FHD5	Missense_Mutation	SNP	ENST00000263168.3	hg19	CCDS30805.1	.	.	.	.	.	.	.	.	.	.	C	23.7	4.447848	0.84101	.	.	ENSG00000116489	ENST00000263168	.	.	.	5.49	5.49	0.81192	.	0.000000	0.85682	D	0.000000	T	0.61652	0.2364	M	0.73319	2.225	0.80722	D	1	B	0.29612	0.251	B	0.31946	0.138	T	0.65158	-0.6236	9	0.62326	D	0.03	-28.1951	19.3394	0.94335	0.0:1.0:0.0:0.0	.	172	P52907	CAZA1_HUMAN	C	172	.	ENSP00000263168:R172C	R	+	1	0	CAPZA1	113003853	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	4.895000	0.63214	2.739000	0.93911	0.655000	0.94253	CGT	.	C|1.000;A|0.000		0.438	CAPZA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032567.2	NM_006135	
SUCO	51430	hgsc.bcm.edu	37	1	172548362	172548362	+	Missense_Mutation	SNP	A	A	G			TCGA-2Y-A9GX-01A-11D-A382-10	TCGA-2Y-A9GX-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e1ab7d98-d4e4-47e9-bcbd-a616ec8e29bb	e977b5c2-99d4-4352-b892-10503efd33a7	g.chr1:172548362A>G	ENST00000263688.3	+	15	1672	c.1453A>G	c.(1453-1455)Act>Gct	p.T485A	SUCO_ENST00000367723.4_Missense_Mutation_p.T636A|SUCO_ENST00000610051.1_Missense_Mutation_p.T448A|SUCO_ENST00000608151.1_Missense_Mutation_p.T637A	NM_014283.3	NP_055098.1	Q9UBS9	SUCO_HUMAN	SUN domain containing ossification factor	485					multicellular organismal development (GO:0007275)|ossification (GO:0001503)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of osteoblast differentiation (GO:0045669)|regulation of bone remodeling (GO:0046850)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|rough endoplasmic reticulum (GO:0005791)											GGATTATAATACTGGAGAGGA	0.308																																					p.T485A		Atlas-SNP	.											.	.	.	.	0			c.A1453G						.						59.0	63.0	61.0					1																	172548362		2202	4296	6498	SO:0001583	missense	51430	exon15			TATAATACTGGAG	AF097535	CCDS1303.1, CCDS65726.1, CCDS65727.1, CCDS72984.1	1q24	2012-07-10	2012-07-10	2012-07-10	ENSG00000094975	ENSG00000094975			1240	protein-coding gene	gene with protein product	"""SUN-like protein 1"", ""osteopotentia"""		"""chromosome 1 open reading frame 9"""	C1orf9		10673381, 20440000	Standard	NM_001282750		Approved	CH1, SLP1, OPT	uc001giq.4	Q9UBS9	OTTHUMG00000034839	ENST00000263688.3:c.1453A>G	chr1.hg19:g.172548362A>G	ENSP00000263688:p.Thr485Ala	162.0	0.0		231.0	17.0	NM_014283	B2RNU4|Q9BQB9|Q9BXQ2|Q9UL04	Missense_Mutation	SNP	ENST00000263688.3	hg19	CCDS1303.1	.	.	.	.	.	.	.	.	.	.	A	15.30	2.792243	0.50102	.	.	ENSG00000094975	ENST00000367723;ENST00000263688	.	.	.	5.22	5.22	0.72569	.	0.155109	0.56097	D	0.000023	T	0.18964	0.0455	N	0.14661	0.345	0.38557	D	0.949613	B;B;P;B	0.36315	0.084;0.03;0.547;0.125	B;B;B;B	0.32928	0.014;0.008;0.155;0.05	T	0.08848	-1.0702	9	0.24483	T	0.36	-5.1596	13.9322	0.64003	1.0:0.0:0.0:0.0	.	448;485;637;485	B4DYM4;B4DZJ3;Q5H945;Q9UBS9	.;.;.;OSPT_HUMAN	A	637;485	.	ENSP00000263688:T485A	T	+	1	0	C1orf9	170814985	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	4.257000	0.58816	1.980000	0.57719	0.377000	0.23210	ACT	.	.		0.308	SUCO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084273.1	NM_016227	
OR2G6	391211	hgsc.bcm.edu	37	1	248685675	248685675	+	Missense_Mutation	SNP	C	C	A			TCGA-2Y-A9GX-01A-11D-A382-10	TCGA-2Y-A9GX-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e1ab7d98-d4e4-47e9-bcbd-a616ec8e29bb	e977b5c2-99d4-4352-b892-10503efd33a7	g.chr1:248685675C>A	ENST00000343414.4	+	1	760	c.728C>A	c.(727-729)tCt>tAt	p.S243Y		NM_001013355.1	NP_001013373.1	Q5TZ20	OR2G6_HUMAN	olfactory receptor, family 2, subfamily G, member 6	243						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|cervix(1)|endometrium(2)|large_intestine(7)|lung(40)|ovary(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	61	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)	all_cancers(173;0.0156)	OV - Ovarian serous cystadenocarcinoma(106;0.0265)			ACCTGTTCGTCTCACCTGGTT	0.458																																					p.S243Y		Atlas-SNP	.											.	OR2G6	124	.	0			c.C728A						.						114.0	114.0	114.0					1																	248685675		2203	4300	6503	SO:0001583	missense	391211	exon1			GTTCGTCTCACCT		CCDS31119.1	1q44	2012-08-09			ENSG00000188558	ENSG00000188558		"""GPCR / Class A : Olfactory receptors"""	27019	protein-coding gene	gene with protein product							Standard	NM_001013355		Approved		uc001ien.1	Q5TZ20	OTTHUMG00000040462	ENST00000343414.4:c.728C>A	chr1.hg19:g.248685675C>A	ENSP00000341291:p.Ser243Tyr	58.0	0.0		83.0	10.0	NM_001013355	B2RP33	Missense_Mutation	SNP	ENST00000343414.4	hg19	CCDS31119.1	.	.	.	.	.	.	.	.	.	.	N	18.49	3.635631	0.67130	.	.	ENSG00000188558	ENST00000343414	T	0.39406	1.08	3.83	3.83	0.44106	GPCR, rhodopsin-like superfamily (1);	0.000000	0.44097	U	0.000486	T	0.79246	0.4413	H	0.99435	4.565	0.34104	D	0.662163	D	0.89917	1.0	D	0.85130	0.997	D	0.91307	0.5071	10	0.87932	D	0	.	14.6536	0.68817	0.0:1.0:0.0:0.0	.	243	Q5TZ20	OR2G6_HUMAN	Y	243	ENSP00000341291:S243Y	ENSP00000341291:S243Y	S	+	2	0	OR2G6	246752298	0.206000	0.23470	0.952000	0.39060	0.693000	0.40251	5.535000	0.67173	1.964000	0.57103	0.400000	0.26472	TCT	.	.		0.458	OR2G6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097358.1	XM_372842	
NBAS	51594	hgsc.bcm.edu	37	2	15614384	15614384	+	Missense_Mutation	SNP	C	C	T			TCGA-2Y-A9GX-01A-11D-A382-10	TCGA-2Y-A9GX-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e1ab7d98-d4e4-47e9-bcbd-a616ec8e29bb	e977b5c2-99d4-4352-b892-10503efd33a7	g.chr2:15614384C>T	ENST00000281513.5	-	15	1431	c.1406G>A	c.(1405-1407)gGa>gAa	p.G469E	NBAS_ENST00000441750.1_Missense_Mutation_p.G469E	NM_015909.3	NP_056993.2	A2RRP1	NBAS_HUMAN	neuroblastoma amplified sequence	469					negative regulation of nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:2000623)|nuclear-transcribed mRNA catabolic process (GO:0000956)	cytoplasm (GO:0005737)|membrane (GO:0016020)				NS(4)|breast(4)|central_nervous_system(3)|endometrium(6)|kidney(5)|large_intestine(12)|liver(1)|lung(54)|ovary(2)|pancreas(3)|prostate(9)|skin(6)|stomach(3)	112						ATCCTCTTCTCCTTCATCTTC	0.388																																					p.G469E		Atlas-SNP	.											.	NBAS	246	.	0			c.G1406A						.						69.0	66.0	67.0					2																	15614384		2203	4300	6503	SO:0001583	missense	51594	exon15			TCTTCTCCTTCAT	BC051792	CCDS1685.1	2p24.3	2009-02-23			ENSG00000151779	ENSG00000151779			15625	protein-coding gene	gene with protein product		608025				9926938, 12706883	Standard	NM_015909		Approved	NAG	uc002rcc.2	A2RRP1	OTTHUMG00000121153	ENST00000281513.5:c.1406G>A	chr2.hg19:g.15614384C>T	ENSP00000281513:p.Gly469Glu	100.0	0.0		109.0	10.0	NM_015909	O95790|Q2VPJ7|Q53TK6|Q86V39|Q8NFY8|Q9Y3W5	Missense_Mutation	SNP	ENST00000281513.5	hg19	CCDS1685.1	.	.	.	.	.	.	.	.	.	.	C	17.80	3.477767	0.63849	.	.	ENSG00000151779	ENST00000441750;ENST00000281513	T;T	0.09350	2.99;3.14	5.74	5.74	0.90152	.	0.052751	0.85682	D	0.000000	T	0.32102	0.0818	L	0.54323	1.7	0.43863	D	0.996467	D	0.89917	1.0	D	0.91635	0.999	T	0.00587	-1.1657	10	0.87932	D	0	.	19.9219	0.97089	0.0:1.0:0.0:0.0	.	469	A2RRP1	NBAS_HUMAN	E	469	ENSP00000413201:G469E;ENSP00000281513:G469E	ENSP00000281513:G469E	G	-	2	0	NBAS	15531835	0.987000	0.35691	0.976000	0.42696	0.998000	0.95712	2.729000	0.47327	2.716000	0.92895	0.655000	0.94253	GGA	.	.		0.388	NBAS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241638.1	NM_015909	
PASK	23178	hgsc.bcm.edu	37	2	242075394	242075394	+	Silent	SNP	A	A	G			TCGA-2Y-A9GX-01A-11D-A382-10	TCGA-2Y-A9GX-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e1ab7d98-d4e4-47e9-bcbd-a616ec8e29bb	e977b5c2-99d4-4352-b892-10503efd33a7	g.chr2:242075394A>G	ENST00000405260.1	-	8	1896	c.1198T>C	c.(1198-1200)Tta>Cta	p.L400L	PASK_ENST00000358649.4_Silent_p.L400L|PASK_ENST00000234040.4_Silent_p.L400L|PASK_ENST00000539818.1_Silent_p.L184L|PASK_ENST00000403638.3_Silent_p.L400L|PASK_ENST00000544142.1_Silent_p.L214L	NM_001252120.1	NP_001239049.1	Q96RG2	PASK_HUMAN	PAS domain containing serine/threonine kinase	400	PAS 2. {ECO:0000255|PROSITE- ProRule:PRU00140}.				negative regulation of glycogen biosynthetic process (GO:0045719)|positive regulation of translation (GO:0045727)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of energy homeostasis (GO:2000505)|regulation of glucagon secretion (GO:0070092)|regulation of respiratory gaseous exchange (GO:0043576)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	ATP binding (GO:0005524)|phosphatidylinositol binding (GO:0035091)|protein serine/threonine kinase activity (GO:0004674)|signal transducer activity (GO:0004871)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(6)|lung(20)|ovary(4)|prostate(4)|skin(1)|stomach(1)|urinary_tract(2)	53		all_cancers(19;4.46e-39)|all_epithelial(40;1.34e-17)|Breast(86;1.53e-05)|Renal(207;0.00179)|all_lung(227;0.00481)|Lung NSC(271;0.017)|Ovarian(221;0.0228)|Esophageal squamous(248;0.129)|all_hematologic(139;0.158)|Melanoma(123;0.16)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;1.34e-31)|all cancers(36;1e-28)|OV - Ovarian serous cystadenocarcinoma(60;3.53e-14)|Kidney(56;4.31e-09)|KIRC - Kidney renal clear cell carcinoma(57;4.35e-08)|BRCA - Breast invasive adenocarcinoma(100;5.64e-06)|Lung(119;0.000596)|LUSC - Lung squamous cell carcinoma(224;0.00481)|Colorectal(34;0.014)|COAD - Colon adenocarcinoma(134;0.0968)		GGGAGCTGTAATGAGCTGTTG	0.547																																					p.L400L		Atlas-SNP	.											.	PASK	230	.	0			c.T1198C						.						146.0	144.0	145.0					2																	242075394		2203	4300	6503	SO:0001819	synonymous_variant	23178	exon8			GCTGTAATGAGCT	U79240	CCDS2545.1, CCDS58758.1, CCDS58759.1	2q37.3	2008-05-23			ENSG00000115687	ENSG00000115687			17270	protein-coding gene	gene with protein product		607505				11688972, 11459942, 15148392	Standard	NM_001252119		Approved	PASKIN, KIAA0135, STK37	uc010fzl.2	Q96RG2	OTTHUMG00000133392	ENST00000405260.1:c.1198T>C	chr2.hg19:g.242075394A>G		103.0	0.0		108.0	12.0	NM_015148	G5E9F1|Q05BE4|Q68DY3|Q6GSJ5|Q86XH6|Q99763|Q9UFR7	Silent	SNP	ENST00000405260.1	hg19	CCDS2545.1																																																																																			.	.		0.547	PASK-003	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000323753.1	NM_015148	
COL7A1	1294	hgsc.bcm.edu	37	3	48608074	48608074	+	Missense_Mutation	SNP	C	C	T			TCGA-2Y-A9GX-01A-11D-A382-10	TCGA-2Y-A9GX-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e1ab7d98-d4e4-47e9-bcbd-a616ec8e29bb	e977b5c2-99d4-4352-b892-10503efd33a7	g.chr3:48608074C>T	ENST00000328333.8	-	95	7449	c.7342G>A	c.(7342-7344)Gtg>Atg	p.V2448M	COL7A1_ENST00000454817.1_Missense_Mutation_p.V2416M	NM_000094.3	NP_000085.1	Q02388	CO7A1_HUMAN	collagen, type VII, alpha 1	2448	Triple-helical region.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|endodermal cell differentiation (GO:0035987)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	basement membrane (GO:0005604)|collagen type VII trimer (GO:0005590)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	serine-type endopeptidase inhibitor activity (GO:0004867)			NS(3)|breast(8)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(57)|ovary(7)|prostate(5)|skin(9)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(5)	137				BRCA - Breast invasive adenocarcinoma(193;0.000293)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)		CTACTCACCACTGACCCCGGT	0.627																																					p.V2448M		Atlas-SNP	.											.	COL7A1	320	.	0			c.G7342A						.						18.0	19.0	19.0					3																	48608074		2201	4296	6497	SO:0001583	missense	1294	exon95			TCACCACTGACCC	L02870	CCDS2773.1	3p21.1	2014-09-17	2008-08-01		ENSG00000114270	ENSG00000114270		"""Collagens"", ""Fibronectin type III domain containing"""	2214	protein-coding gene	gene with protein product	"""collagen VII, alpha-1 polypeptide"", ""LC collagen"""	120120	"""epidermolysis bullosa, dystrophic, dominant and recessive"""	EBDCT, EBD1, EBR1		1871109	Standard	NM_000094		Approved		uc003ctz.2	Q02388	OTTHUMG00000133541	ENST00000328333.8:c.7342G>A	chr3.hg19:g.48608074C>T	ENSP00000332371:p.Val2448Met	98.0	0.0		97.0	12.0	NM_000094	Q14054|Q16507	Missense_Mutation	SNP	ENST00000328333.8	hg19	CCDS2773.1	.	.	.	.	.	.	.	.	.	.	C	10.92	1.485734	0.26686	.	.	ENSG00000114270	ENST00000328333;ENST00000454817;ENST00000422991	D;D;D	0.94457	-3.43;-3.43;-3.21	4.35	1.42	0.22433	.	1.380920	0.05217	N	0.507854	D	0.90208	0.6939	L	0.32530	0.975	0.09310	N	0.999999	B	0.16802	0.019	B	0.19666	0.026	T	0.78984	-0.1988	10	0.46703	T	0.11	.	5.6707	0.17721	0.0:0.6566:0.1619:0.1815	.	2448	Q02388	CO7A1_HUMAN	M	2448;2416;113	ENSP00000332371:V2448M;ENSP00000412569:V2416M;ENSP00000391608:V113M	ENSP00000332371:V2448M	V	-	1	0	COL7A1	48583078	0.005000	0.15991	0.522000	0.27862	0.935000	0.57460	1.626000	0.37039	0.371000	0.24564	0.655000	0.94253	GTG	.	.		0.627	COL7A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257519.1	NM_000094	
FRMD4B	23150	hgsc.bcm.edu	37	3	69225699	69225699	+	Missense_Mutation	SNP	T	T	C			TCGA-2Y-A9GX-01A-11D-A382-10	TCGA-2Y-A9GX-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e1ab7d98-d4e4-47e9-bcbd-a616ec8e29bb	e977b5c2-99d4-4352-b892-10503efd33a7	g.chr3:69225699T>C	ENST00000398540.3	-	22	3043	c.2960A>G	c.(2959-2961)tAt>tGt	p.Y987C	FRMD4B_ENST00000478263.1_Missense_Mutation_p.Y639C|FRMD4B_ENST00000542259.1_Missense_Mutation_p.Y933C	NM_015123.1	NP_055938	Q9Y2L6	FRM4B_HUMAN	FERM domain containing 4B	987					establishment of epithelial cell polarity (GO:0090162)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular space (GO:0005615)|ruffle (GO:0001726)				NS(2)|central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(3)|lung(1)|ovary(3)|prostate(3)|skin(2)	19		Lung NSC(201;0.0138)|Prostate(884;0.11)		BRCA - Breast invasive adenocarcinoma(55;0.000201)|Epithelial(33;0.00141)|LUSC - Lung squamous cell carcinoma(21;0.00999)|Lung(16;0.0182)		TAAAGGATTATAGACATTGCC	0.458																																					p.Y987C		Atlas-SNP	.											.	FRMD4B	90	.	0			c.A2960G						.						144.0	145.0	145.0					3																	69225699		1936	4124	6060	SO:0001583	missense	23150	exon22			GGATTATAGACAT	AL832231	CCDS46863.1	3p14.2	2006-04-12			ENSG00000114541	ENSG00000114541			24886	protein-coding gene	gene with protein product						10231032, 11445584	Standard	XM_005264720		Approved	KIAA1013, GRSP1	uc003dnv.2	Q9Y2L6	OTTHUMG00000158772	ENST00000398540.3:c.2960A>G	chr3.hg19:g.69225699T>C	ENSP00000381549:p.Tyr987Cys	126.0	0.0		145.0	11.0	NM_015123	Q8TAI3	Missense_Mutation	SNP	ENST00000398540.3	hg19	CCDS46863.1	.	.	.	.	.	.	.	.	.	.	T	13.72	2.320496	0.41096	.	.	ENSG00000114541	ENST00000398540;ENST00000542259;ENST00000478263	D;D	0.84146	-1.81;-1.81	5.69	5.69	0.88448	.	0.552403	0.18903	N	0.127996	D	0.90021	0.6884	L	0.60455	1.87	0.39400	D	0.966574	D;B	0.76494	0.999;0.017	D;B	0.64321	0.924;0.012	D	0.91129	0.4936	10	0.72032	D	0.01	-14.9811	14.5303	0.67920	0.0:0.0:0.0:1.0	.	831;987	B4DHD5;Q9Y2L6	.;FRM4B_HUMAN	C	987;933;639	ENSP00000381549:Y987C;ENSP00000437658:Y933C	ENSP00000381549:Y987C	Y	-	2	0	FRMD4B	69308389	1.000000	0.71417	0.996000	0.52242	0.996000	0.88848	2.031000	0.41117	2.180000	0.69256	0.482000	0.46254	TAT	.	.		0.458	FRMD4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352111.1		
SEMA5B	54437	hgsc.bcm.edu	37	3	122645524	122645524	+	Splice_Site	SNP	T	T	C			TCGA-2Y-A9GX-01A-11D-A382-10	TCGA-2Y-A9GX-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e1ab7d98-d4e4-47e9-bcbd-a616ec8e29bb	e977b5c2-99d4-4352-b892-10503efd33a7	g.chr3:122645524T>C	ENST00000357599.3	-	9	1237	c.851A>G	c.(850-852)gAg>gGg	p.E284G	AC078794.1_ENST00000408284.1_RNA|SEMA5B_ENST00000195173.4_Splice_Site_p.E284G|SEMA5B_ENST00000451055.2_Splice_Site_p.E338G	NM_001031702.3|NM_001256348.1	NP_001026872.2|NP_001243277.1	Q9P283	SEM5B_HUMAN	sema domain, seven thrombospondin repeats (type 1 and type 1-like), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 5B	284	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				cell differentiation (GO:0030154)|nervous system development (GO:0007399)	integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(13)|lung(26)|ovary(2)|pancreas(3)|skin(2)|upper_aerodigestive_tract(3)	55				GBM - Glioblastoma multiforme(114;0.0367)		GAAGTTTGGCTCTGGGTGGGC	0.577																																					p.E338G		Atlas-SNP	.											.	SEMA5B	303	.	0			c.A1013G						.						44.0	38.0	40.0					3																	122645524		2203	4300	6503	SO:0001630	splice_region_variant	54437	exon9			TTTGGCTCTGGGT	AB040878	CCDS35491.1, CCDS58848.1, CCDS74995.1	3q21.1	2008-07-18			ENSG00000082684	ENSG00000082684		"""Semaphorins"""	10737	protein-coding gene	gene with protein product		609298		SEMAG		8817451	Standard	NM_001256346		Approved	SemG, KIAA1445, FLJ10372	uc031sbm.1	Q9P283	OTTHUMG00000140392	ENST00000357599.3:c.851-1A>G	chr3.hg19:g.122645524T>C		129.0	0.0		132.0	15.0	NM_001256347	A8K5U2|B7Z393|F8W9U8|Q6DD89|Q6UY12|Q9NW17	Missense_Mutation	SNP	ENST00000357599.3	hg19	CCDS35491.1	.	.	.	.	.	.	.	.	.	.	T	21.8	4.199646	0.79015	.	.	ENSG00000082684	ENST00000357599;ENST00000195173;ENST00000418793;ENST00000451055;ENST00000393583	T;T;T;T	0.24908	1.83;1.83;1.83;1.83	4.69	4.69	0.59074	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	0.000000	0.85682	D	0.000000	T	0.45216	0.1331	M	0.65498	2.005	0.80722	D	1	D;D;D	0.71674	0.998;0.996;0.996	D;D;D	0.66351	0.939;0.943;0.943	T	0.31052	-0.9957	10	0.30854	T	0.27	.	13.5066	0.61486	0.0:0.0:0.0:1.0	.	226;284;284	D3YTI7;B5ME80;Q9P283	.;.;SEM5B_HUMAN	G	284;284;226;338;284	ENSP00000350215:E284G;ENSP00000195173:E284G;ENSP00000389588:E338G;ENSP00000377208:E284G	ENSP00000195173:E284G	E	-	2	0	SEMA5B	124128214	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.545000	0.82128	1.971000	0.57363	0.528000	0.53228	GAG	.	.		0.577	SEMA5B-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000277165.1	NM_001031702	Missense_Mutation
MCM2	4171	hgsc.bcm.edu	37	3	127327292	127327292	+	Missense_Mutation	SNP	T	T	A			TCGA-2Y-A9GX-01A-11D-A382-10	TCGA-2Y-A9GX-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e1ab7d98-d4e4-47e9-bcbd-a616ec8e29bb	e977b5c2-99d4-4352-b892-10503efd33a7	g.chr3:127327292T>A	ENST00000265056.7	+	7	1413	c.1169T>A	c.(1168-1170)cTg>cAg	p.L390Q		NM_004526.2	NP_004517.2	P49736	MCM2_HUMAN	minichromosome maintenance complex component 2	390					cell cycle (GO:0007049)|cellular response to interleukin-4 (GO:0071353)|DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA strand elongation involved in DNA replication (GO:0006271)|DNA unwinding involved in DNA replication (GO:0006268)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|nucleosome assembly (GO:0006334)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|MCM complex (GO:0042555)|microtubule cytoskeleton (GO:0015630)|nuclear origin of replication recognition complex (GO:0005664)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA replication origin binding (GO:0003688)|metal ion binding (GO:0046872)			ovary(3)|skin(2)|stomach(1)	6						GCTGGCCGGCTGCCCCGCTCC	0.602																																					p.L390Q		Atlas-SNP	.											.	MCM2	79	.	0			c.T1169A						.						75.0	81.0	79.0					3																	127327292		2203	4300	6503	SO:0001583	missense	4171	exon7			GCCGGCTGCCCCG	X67334	CCDS3043.1	3q21	2007-04-04	2007-04-04		ENSG00000073111	ENSG00000073111			6944	protein-coding gene	gene with protein product	"""mitotin"""	116945	"""minichromosome maintenance deficient (S. cerevisiae) 2 (mitotin)"", ""MCM2 minichromosome maintenance deficient 2, mitotin (S. cerevisiae)"""	CCNL1, CDCL1		1710453, 8258304	Standard	NM_004526		Approved	D3S3194, KIAA0030, BM28, cdc19	uc003ejp.4	P49736	OTTHUMG00000159637	ENST00000265056.7:c.1169T>A	chr3.hg19:g.127327292T>A	ENSP00000265056:p.Leu390Gln	173.0	0.0		164.0	18.0	NM_004526	Q14577|Q15023|Q8N2V1|Q969W7|Q96AE1|Q9BRM7	Missense_Mutation	SNP	ENST00000265056.7	hg19	CCDS3043.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	24.3|24.3	4.512029|4.512029	0.85389|0.85389	.|.	.|.	ENSG00000073111|ENSG00000073111	ENST00000491422|ENST00000265056;ENST00000539922;ENST00000543142	.|T	.|0.29142	.|1.58	5.31|5.31	5.31|5.31	0.75309|0.75309	.|Nucleic acid-binding, OB-fold-like (1);Nucleic acid-binding, OB-fold (1);	.|0.067804	.|0.64402	.|D	.|0.000010	T|T	0.62588|0.62588	0.2440|0.2440	H|H	0.95079|0.95079	3.62|3.62	0.80722|0.80722	D|D	1|1	.|D;P;P	.|0.57571	.|0.98;0.763;0.558	.|P;P;P	.|0.56700	.|0.804;0.764;0.664	T|T	0.76132|0.76132	-0.3071|-0.3071	5|10	.|0.87932	.|D	.|0	-21.8617|-21.8617	15.2532|15.2532	0.73564|0.73564	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|371;260;390	.|F5H1E9;B4DSV5;P49736	.|.;.;MCM2_HUMAN	S|Q	253|390;294;371	.|ENSP00000265056:L390Q	.|ENSP00000265056:L390Q	C|L	+|+	1|2	0|0	MCM2|MCM2	128809982|128809982	1.000000|1.000000	0.71417|0.71417	0.908000|0.908000	0.35775|0.35775	0.978000|0.978000	0.69477|0.69477	5.899000|5.899000	0.69846|0.69846	2.004000|2.004000	0.58718|0.58718	0.482000|0.482000	0.46254|0.46254	TGC|CTG	.	.		0.602	MCM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356612.1		
RTP1	132112	hgsc.bcm.edu	37	3	186917601	186917601	+	Missense_Mutation	SNP	A	A	T			TCGA-2Y-A9GX-01A-11D-A382-10	TCGA-2Y-A9GX-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e1ab7d98-d4e4-47e9-bcbd-a616ec8e29bb	e977b5c2-99d4-4352-b892-10503efd33a7	g.chr3:186917601A>T	ENST00000312295.4	+	2	565	c.535A>T	c.(535-537)Agc>Tgc	p.S179C	RP11-208N14.4_ENST00000356133.3_RNA	NM_153708.2	NP_714919.2	P59025	RTP1_HUMAN	receptor (chemosensory) transporter protein 1	179					protein insertion into membrane (GO:0051205)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	olfactory receptor binding (GO:0031849)			breast(2)|endometrium(4)|large_intestine(5)|lung(6)|ovary(3)|skin(2)	22	all_cancers(143;5.33e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;5.56e-18)	GBM - Glioblastoma multiforme(93;0.0269)		CCACGTGGCCAGCCGCCAGGA	0.682																																					p.S179C		Atlas-SNP	.											.	RTP1	51	.	0			c.A535T						.						24.0	25.0	25.0					3																	186917601		2200	4294	6494	SO:0001583	missense	132112	exon2			GTGGCCAGCCGCC	BC034744	CCDS3287.2	3q27.3	2014-02-20	2006-11-21		ENSG00000175077	ENSG00000175077		"""Receptor transporter proteins"""	28580	protein-coding gene	gene with protein product	"""receptor transporting protein 1"", ""zinc finger, 3CxxC-type 1"""	609137	"""receptor transporter protein 1"""			16271481, 15550249, 16720576	Standard	NM_153708		Approved	MGC35450, Z3CXXC1	uc003frg.3	P59025	OTTHUMG00000149886	ENST00000312295.4:c.535A>T	chr3.hg19:g.186917601A>T	ENSP00000311712:p.Ser179Cys	132.0	0.0		112.0	14.0	NM_153708		Missense_Mutation	SNP	ENST00000312295.4	hg19	CCDS3287.2	.	.	.	.	.	.	.	.	.	.	A	19.30	3.801615	0.70682	.	.	ENSG00000175077	ENST00000312295	T	0.24151	1.87	5.7	1.97	0.26223	.	0.683764	0.16626	N	0.206267	T	0.28499	0.0705	L	0.42245	1.32	0.25792	N	0.984601	P	0.44195	0.828	P	0.49752	0.621	T	0.07751	-1.0756	10	0.66056	D	0.02	.	7.6186	0.28173	0.7481:0.0:0.2519:0.0	.	179	P59025	RTP1_HUMAN	C	179	ENSP00000311712:S179C	ENSP00000311712:S179C	S	+	1	0	RTP1	188400295	0.953000	0.32496	1.000000	0.80357	0.969000	0.65631	0.640000	0.24705	0.443000	0.26582	0.459000	0.35465	AGC	.	.		0.682	RTP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313731.2	NM_153708	
ZFYVE28	57732	hgsc.bcm.edu	37	4	2321941	2321941	+	Missense_Mutation	SNP	C	C	A			TCGA-2Y-A9GX-01A-11D-A382-10	TCGA-2Y-A9GX-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e1ab7d98-d4e4-47e9-bcbd-a616ec8e29bb	e977b5c2-99d4-4352-b892-10503efd33a7	g.chr4:2321941C>A	ENST00000290974.2	-	7	1098	c.759G>T	c.(757-759)atG>atT	p.M253I	RP11-478C1.7_ENST00000510632.1_RNA|ZFYVE28_ENST00000511071.1_Missense_Mutation_p.M223I|ZFYVE28_ENST00000515312.1_Missense_Mutation_p.M183I	NM_020972.2	NP_066023.2	Q9HCC9	LST2_HUMAN	zinc finger, FYVE domain containing 28	253					negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of epidermal growth factor-activated receptor activity (GO:0007175)	cytosol (GO:0005829)|early endosome membrane (GO:0031901)	metal ion binding (GO:0046872)|phosphatidylinositol-3-phosphate binding (GO:0032266)			NS(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(17)|ovary(1)|pancreas(1)|prostate(1)|skin(4)	31						ACAGCTCGGACATGTCTTCCA	0.607																																					p.M253I		Atlas-SNP	.											.	ZFYVE28	79	.	0			c.G759T						.						116.0	101.0	106.0					4																	2321941		2203	4300	6503	SO:0001583	missense	57732	exon7			CTCGGACATGTCT	AK126692	CCDS33942.1, CCDS54708.1, CCDS54709.1, CCDS54710.1, CCDS54711.1, CCDS54712.1	4p16.3	2008-05-02			ENSG00000159733	ENSG00000159733		"""Zinc fingers, FYVE domain containing"""	29334	protein-coding gene	gene with protein product		614176				10997877	Standard	NM_020972		Approved	KIAA1643	uc003gex.2	Q9HCC9	OTTHUMG00000160292	ENST00000290974.2:c.759G>T	chr4.hg19:g.2321941C>A	ENSP00000290974:p.Met253Ile	66.0	0.0		85.0	14.0	NM_020972	B2RP83|B3KX50|B7Z1Q7|B7Z2G9|B7Z2M2|B7ZB19|E9PB54|E9PB64|E9PG77|Q7Z6J3	Missense_Mutation	SNP	ENST00000290974.2	hg19	CCDS33942.1	.	.	.	.	.	.	.	.	.	.	C	17.40	3.379583	0.61845	.	.	ENSG00000159733	ENST00000290974;ENST00000511071;ENST00000515312	T;T;T	0.32023	1.47;1.47;1.47	5.41	5.41	0.78517	.	0.039280	0.85682	D	0.000000	T	0.46983	0.1421	L	0.41710	1.295	0.80722	D	1	D;P	0.61080	0.989;0.533	D;B	0.72982	0.979;0.083	T	0.17899	-1.0354	10	0.30854	T	0.27	.	17.8039	0.88596	0.0:1.0:0.0:0.0	.	223;253	Q9HCC9-2;Q9HCC9	.;LST2_HUMAN	I	253;223;183	ENSP00000290974:M253I;ENSP00000425706:M223I;ENSP00000426299:M183I	ENSP00000290974:M253I	M	-	3	0	ZFYVE28	2291739	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	5.942000	0.70203	2.536000	0.85505	0.650000	0.86243	ATG	.	.		0.607	ZFYVE28-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000360078.1	XM_035371	
PRKG2	5593	hgsc.bcm.edu	37	4	82031670	82031670	+	Silent	SNP	G	G	A			TCGA-2Y-A9GX-01A-11D-A382-10	TCGA-2Y-A9GX-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e1ab7d98-d4e4-47e9-bcbd-a616ec8e29bb	e977b5c2-99d4-4352-b892-10503efd33a7	g.chr4:82031670G>A	ENST00000395578.1	-	15	1988	c.1872C>T	c.(1870-1872)aaC>aaT	p.N624N	PRKG2_ENST00000264399.1_Silent_p.N624N|PRKG2_ENST00000418486.2_Silent_p.N595N|PRKG2_ENST00000509169.1_5'UTR|PRKG2_ENST00000545647.1_Silent_p.N204N			Q13237	KGP2_HUMAN	protein kinase, cGMP-dependent, type II	624	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				blood coagulation (GO:0007596)|circadian regulation of gene expression (GO:0032922)|nitric oxide metabolic process (GO:0046209)|protein phosphorylation (GO:0006468)|regulation of nitric-oxide synthase activity (GO:0050999)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cGMP binding (GO:0030553)|cGMP-dependent protein kinase activity (GO:0004692)|protein kinase activity (GO:0004672)			NS(1)|breast(4)|central_nervous_system(2)|endometrium(3)|kidney(3)|large_intestine(7)|lung(14)|ovary(1)|skin(2)	37						CATGTCCCTTGTTGAGAATGA	0.448																																					p.N624N		Atlas-SNP	.											.	PRKG2	195	.	0			c.C1872T						.						123.0	120.0	121.0					4																	82031670		2203	4300	6503	SO:0001819	synonymous_variant	5593	exon14			TCCCTTGTTGAGA	X94612	CCDS3589.1, CCDS75150.1	4q13.1-q21.1	2009-07-10			ENSG00000138669	ENSG00000138669	2.7.11.1		9416	protein-coding gene	gene with protein product		601591				7498513	Standard	XM_005263126		Approved	cGKII, PRKGR2	uc003hmh.2	Q13237	OTTHUMG00000130296	ENST00000395578.1:c.1872C>T	chr4.hg19:g.82031670G>A		77.0	0.0		106.0	12.0	NM_006259	B4DMX3|E7EPE6|O00125|O60916	Silent	SNP	ENST00000395578.1	hg19	CCDS3589.1																																																																																			.	.		0.448	PRKG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252639.1	NM_006259	
GRID2	2895	hgsc.bcm.edu	37	4	94693257	94693257	+	Missense_Mutation	SNP	C	C	T			TCGA-2Y-A9GX-01A-11D-A382-10	TCGA-2Y-A9GX-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e1ab7d98-d4e4-47e9-bcbd-a616ec8e29bb	e977b5c2-99d4-4352-b892-10503efd33a7	g.chr4:94693257C>T	ENST00000282020.4	+	16	2890	c.2632C>T	c.(2632-2634)Cat>Tat	p.H878Y	GRID2_ENST00000510992.1_Missense_Mutation_p.H783Y	NM_001510.2	NP_001501.2	O43424	GRID2_HUMAN	glutamate receptor, ionotropic, delta 2	878					cellular protein localization (GO:0034613)|cerebellar granule cell differentiation (GO:0021707)|glutamate receptor signaling pathway (GO:0007215)|heterophilic cell-cell adhesion (GO:0007157)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|prepulse inhibition (GO:0060134)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of neuron apoptotic process (GO:0043523)|regulation of neuron projection development (GO:0010975)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|integral component of plasma membrane (GO:0005887)|ionotropic glutamate receptor complex (GO:0008328)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	extracellular-glutamate-gated ion channel activity (GO:0005234)|glutamate receptor activity (GO:0008066)|ionotropic glutamate receptor activity (GO:0004970)|PDZ domain binding (GO:0030165)|scaffold protein binding (GO:0097110)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(6)|kidney(4)|large_intestine(18)|lung(45)|ovary(3)|prostate(6)|skin(9)|upper_aerodigestive_tract(3)|urinary_tract(1)	100		Hepatocellular(203;0.114)|all_hematologic(202;0.177)		OV - Ovarian serous cystadenocarcinoma(123;3.22e-06)|LUSC - Lung squamous cell carcinoma(81;0.185)|Lung(65;0.191)		GGAGCACCTCCATAGACGTGT	0.413																																					p.H878Y		Atlas-SNP	.											.	GRID2	233	.	0			c.C2632T						.						144.0	133.0	137.0					4																	94693257		2203	4300	6503	SO:0001583	missense	2895	exon16			CACCTCCATAGAC	AF009014	CCDS3637.1, CCDS68758.1	4q22	2012-08-29			ENSG00000152208	ENSG00000152208		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4576	protein-coding gene	gene with protein product		602368				9465309	Standard	NM_001510		Approved	GluD2, GluR-delta-2	uc011cdt.2	O43424	OTTHUMG00000130975	ENST00000282020.4:c.2632C>T	chr4.hg19:g.94693257C>T	ENSP00000282020:p.His878Tyr	73.0	0.0		71.0	9.0	NM_001510	E9PH24|Q4KKU8|Q4KKU9|Q4KKV0|Q59FZ1	Missense_Mutation	SNP	ENST00000282020.4	hg19	CCDS3637.1	.	.	.	.	.	.	.	.	.	.	C	25.4	4.632972	0.87660	.	.	ENSG00000152208	ENST00000282020;ENST00000510992	T;T	0.15256	2.48;2.44	5.42	5.42	0.78866	.	0.763557	0.12699	N	0.446513	T	0.34106	0.0886	L	0.34521	1.04	0.80722	D	1	P;D	0.57899	0.851;0.981	P;D	0.65140	0.775;0.932	T	0.07731	-1.0757	10	0.72032	D	0.01	.	19.2246	0.93814	0.0:1.0:0.0:0.0	.	783;878	E9PH24;O43424	.;GRID2_HUMAN	Y	878;783	ENSP00000282020:H878Y;ENSP00000421257:H783Y	ENSP00000282020:H878Y	H	+	1	0	GRID2	94912280	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.484000	0.81180	2.531000	0.85337	0.650000	0.86243	CAT	.	.		0.413	GRID2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253588.2		
MAP1B	4131	hgsc.bcm.edu	37	5	71492333	71492333	+	Nonsense_Mutation	SNP	A	A	T			TCGA-2Y-A9GX-01A-11D-A382-10	TCGA-2Y-A9GX-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e1ab7d98-d4e4-47e9-bcbd-a616ec8e29bb	e977b5c2-99d4-4352-b892-10503efd33a7	g.chr5:71492333A>T	ENST00000296755.7	+	5	3449	c.3151A>T	c.(3151-3153)Aag>Tag	p.K1051*		NM_005909.3	NP_005900.2	P46821	MAP1B_HUMAN	microtubule-associated protein 1B	1051					axon extension (GO:0048675)|cellular process (GO:0009987)|dendrite development (GO:0016358)|establishment of monopolar cell polarity (GO:0061162)|microtubule bundle formation (GO:0001578)|mitochondrion transport along microtubule (GO:0047497)|negative regulation of intracellular transport (GO:0032387)|positive regulation of axon extension (GO:0045773)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|plasma membrane (GO:0005886)|synapse (GO:0045202)	structural molecule activity (GO:0005198)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(42)|liver(1)|lung(28)|ovary(1)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	104		Lung NSC(167;0.00202)|Ovarian(174;0.0175)|Prostate(461;0.142)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;7.99e-54)		TGTGGTCGACAAGGCTGCAGA	0.542																																					p.K1051X	Melanoma(17;367 822 11631 31730 47712)	Atlas-SNP	.											.	MAP1B	243	.	0			c.A3151T						.						119.0	123.0	121.0					5																	71492333		2203	4300	6503	SO:0001587	stop_gained	4131	exon5			GTCGACAAGGCTG	L06237	CCDS4012.1	5q13	2014-06-12			ENSG00000131711	ENSG00000131711			6836	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 102"""	157129				1881920	Standard	NM_005909		Approved	MAP5, PPP1R102	uc003kbw.4	P46821	OTTHUMG00000100952	ENST00000296755.7:c.3151A>T	chr5.hg19:g.71492333A>T	ENSP00000296755:p.Lys1051*	54.0	0.0		50.0	6.0	NM_005909	A2BDK5	Nonsense_Mutation	SNP	ENST00000296755.7	hg19	CCDS4012.1	.	.	.	.	.	.	.	.	.	.	A	41	8.928517	0.99006	.	.	ENSG00000131711	ENST00000296755	.	.	.	5.86	4.64	0.57946	.	0.000000	0.64402	D	0.000004	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-25.627	11.6874	0.51494	0.8674:0.0:0.0:0.1326	.	.	.	.	X	1051	.	ENSP00000296755:K1051X	K	+	1	0	MAP1B	71528089	1.000000	0.71417	1.000000	0.80357	0.716000	0.41182	4.948000	0.63590	2.246000	0.74042	0.533000	0.62120	AAG	.	.		0.542	MAP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000218561.6	NM_005909	
MAP1B	4131	hgsc.bcm.edu	37	5	71495123	71495123	+	Nonsense_Mutation	SNP	A	A	T			TCGA-2Y-A9GX-01A-11D-A382-10	TCGA-2Y-A9GX-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e1ab7d98-d4e4-47e9-bcbd-a616ec8e29bb	e977b5c2-99d4-4352-b892-10503efd33a7	g.chr5:71495123A>T	ENST00000296755.7	+	5	6239	c.5941A>T	c.(5941-5943)Aga>Tga	p.R1981*		NM_005909.3	NP_005900.2	P46821	MAP1B_HUMAN	microtubule-associated protein 1B	1981					axon extension (GO:0048675)|cellular process (GO:0009987)|dendrite development (GO:0016358)|establishment of monopolar cell polarity (GO:0061162)|microtubule bundle formation (GO:0001578)|mitochondrion transport along microtubule (GO:0047497)|negative regulation of intracellular transport (GO:0032387)|positive regulation of axon extension (GO:0045773)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|plasma membrane (GO:0005886)|synapse (GO:0045202)	structural molecule activity (GO:0005198)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(42)|liver(1)|lung(28)|ovary(1)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	104		Lung NSC(167;0.00202)|Ovarian(174;0.0175)|Prostate(461;0.142)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;7.99e-54)		TGAGAGGTCTAGAAGGCTTCT	0.498																																					p.R1981X	Melanoma(17;367 822 11631 31730 47712)	Atlas-SNP	.											.	MAP1B	243	.	0			c.A5941T						.						101.0	107.0	105.0					5																	71495123		2203	4300	6503	SO:0001587	stop_gained	4131	exon5			AGGTCTAGAAGGC	L06237	CCDS4012.1	5q13	2014-06-12			ENSG00000131711	ENSG00000131711			6836	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 102"""	157129				1881920	Standard	NM_005909		Approved	MAP5, PPP1R102	uc003kbw.4	P46821	OTTHUMG00000100952	ENST00000296755.7:c.5941A>T	chr5.hg19:g.71495123A>T	ENSP00000296755:p.Arg1981*	59.0	0.0		52.0	11.0	NM_005909	A2BDK5	Nonsense_Mutation	SNP	ENST00000296755.7	hg19	CCDS4012.1	.	.	.	.	.	.	.	.	.	.	A	46	12.891367	0.99704	.	.	ENSG00000131711	ENST00000296755	.	.	.	5.11	0.985	0.19779	.	0.184821	0.37348	N	0.002137	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.09590	T	0.72	-6.3131	6.8591	0.24058	0.5445:0.317:0.0:0.1385	.	.	.	.	X	1981	.	ENSP00000296755:R1981X	R	+	1	2	MAP1B	71530879	0.103000	0.21917	0.967000	0.41034	0.992000	0.81027	0.713000	0.25794	0.243000	0.21327	0.450000	0.29827	AGA	.	.		0.498	MAP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000218561.6	NM_005909	
CMYA5	202333	hgsc.bcm.edu	37	5	79034864	79034864	+	Missense_Mutation	SNP	T	T	A			TCGA-2Y-A9GX-01A-11D-A382-10	TCGA-2Y-A9GX-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e1ab7d98-d4e4-47e9-bcbd-a616ec8e29bb	e977b5c2-99d4-4352-b892-10503efd33a7	g.chr5:79034864T>A	ENST00000446378.2	+	2	10307	c.10276T>A	c.(10276-10278)Tcc>Acc	p.S3426T		NM_153610.3	NP_705838.3	Q8N3K9	CMYA5_HUMAN	cardiomyopathy associated 5	3426					negative regulation of calcineurin-NFAT signaling cascade (GO:0070885)|negative regulation of protein phosphatase type 2B activity (GO:0032513)|regulation of skeletal muscle adaptation (GO:0014733)	costamere (GO:0043034)				NS(2)|breast(4)|central_nervous_system(1)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(37)|lung(34)|ovary(6)|pancreas(2)|prostate(5)|skin(5)|stomach(11)|upper_aerodigestive_tract(3)|urinary_tract(1)	128		Lung NSC(167;0.00296)|all_lung(232;0.00327)|Ovarian(174;0.0262)		OV - Ovarian serous cystadenocarcinoma(54;9.85e-46)|Epithelial(54;3.38e-40)|all cancers(79;3.43e-35)		ATTTACAGAATCCCTGCATAA	0.418																																					p.S3426T		Atlas-SNP	.											.	CMYA5	643	.	0			c.T10276A						.						87.0	83.0	84.0					5																	79034864		1888	4098	5986	SO:0001583	missense	202333	exon2			ACAGAATCCCTGC	AW755254, AL831986	CCDS47238.1	5q14.1	2013-02-11			ENSG00000164309	ENSG00000164309		"""Tripartite motif containing / Tripartite motif containing"", ""A-kinase anchor proteins"", ""Fibronectin type III domain containing"""	14305	protein-coding gene	gene with protein product	"""genethonin-3"", ""tripartite motif-containing 76"""	612193	"""chromosome 5 open reading frame 10"""	C5orf10		14688250	Standard	NM_153610		Approved	myospryn, SPRYD2, DKFZp451G223, TRIM76	uc003kgc.3	Q8N3K9	OTTHUMG00000162548	ENST00000446378.2:c.10276T>A	chr5.hg19:g.79034864T>A	ENSP00000394770:p.Ser3426Thr	103.0	0.0		101.0	7.0	NM_153610	A0PJB7|Q05CT4|Q2NKX1|Q2T9G9|Q69YQ8|Q69YQ9|Q6P517|Q6P5U3|Q7Z4I1|Q86T34|Q86T49|Q8N3S4|Q8N3S7|Q8NAG8|Q9UK88	Missense_Mutation	SNP	ENST00000446378.2	hg19	CCDS47238.1	.	.	.	.	.	.	.	.	.	.	T	7.625	0.677716	0.14841	.	.	ENSG00000164309	ENST00000446378	T	0.39229	1.09	5.48	3.08	0.35506	.	0.528214	0.17980	N	0.155542	T	0.53932	0.1827	M	0.65975	2.015	0.28432	N	0.917212	D	0.62365	0.991	P	0.58454	0.839	T	0.49560	-0.8927	10	0.59425	D	0.04	.	8.9859	0.35994	0.0:0.2113:0.0:0.7887	.	3426	Q8N3K9	CMYA5_HUMAN	T	3426	ENSP00000394770:S3426T	ENSP00000394770:S3426T	S	+	1	0	CMYA5	79070620	0.520000	0.26250	0.123000	0.21794	0.016000	0.09150	0.242000	0.18087	0.469000	0.27268	-0.256000	0.11100	TCC	.	.		0.418	CMYA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369497.1	NM_153610	
GPR98	84059	hgsc.bcm.edu	37	5	90052872	90052872	+	Missense_Mutation	SNP	C	C	G			TCGA-2Y-A9GX-01A-11D-A382-10	TCGA-2Y-A9GX-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e1ab7d98-d4e4-47e9-bcbd-a616ec8e29bb	e977b5c2-99d4-4352-b892-10503efd33a7	g.chr5:90052872C>G	ENST00000405460.2	+	57	11930	c.11834C>G	c.(11833-11835)gCt>gGt	p.A3945G		NM_032119.3	NP_115495.3	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98	3945	Calx-beta 26. {ECO:0000255}.				detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|G-protein coupled receptor signaling pathway (GO:0007186)|inner ear receptor stereocilium organization (GO:0060122)|maintenance of organ identity (GO:0048496)|nervous system development (GO:0007399)|neurological system process (GO:0050877)|neuropeptide signaling pathway (GO:0007218)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|visual perception (GO:0007601)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|stereocilia ankle link complex (GO:0002142)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(4)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(3)|kidney(18)|large_intestine(46)|liver(2)|lung(80)|ovary(12)|pancreas(5)|prostate(1)|skin(50)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(6)	269		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		GTCCGGCTGGCTGGAAGCTTT	0.448																																					p.A3945G		Atlas-SNP	.											.	GPR98	605	.	0			c.C11834G						.						93.0	92.0	92.0					5																	90052872		1857	4098	5955	SO:0001583	missense	84059	exon57			GGCTGGCTGGAAG	AB014586	CCDS47246.1	5q13	2014-08-08	2006-05-26	2006-05-26	ENSG00000164199	ENSG00000164199		"""-"", ""GPCR / Class B : Orphans"""	17416	protein-coding gene	gene with protein product		602851	"""monogenic, audiogenic seizure susceptibility 1 homolog (mouse)"""	USH2C, MASS1		10976914, 14740321	Standard	NM_032119		Approved	DKFZp761P0710, KIAA0686, FEB4, VLGR1b	uc003kju.3	Q8WXG9	OTTHUMG00000162668	ENST00000405460.2:c.11834C>G	chr5.hg19:g.90052872C>G	ENSP00000384582:p.Ala3945Gly	125.0	0.0		145.0	19.0	NM_032119	O75171|Q8TF58|Q9H0X5|Q9UL61	Missense_Mutation	SNP	ENST00000405460.2	hg19	CCDS47246.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	22.8|22.8	4.341999|4.341999	0.81911|0.81911	.|.	.|.	ENSG00000164199|ENSG00000164199	ENST00000405460;ENST00000296619|ENST00000509621	T|.	0.21031|.	2.03|.	5.3|5.3	5.3|5.3	0.74995|0.74995	Na-Ca exchanger/integrin-beta4 (2);|.	0.048166|.	0.85682|.	D|.	0.000000|.	T|T	0.60143|0.60143	0.2246|0.2246	L|L	0.33339|0.33339	1.005|1.005	0.80722|0.80722	D|D	1|1	D;D|.	0.76494|.	0.998;0.999|.	D;D|.	0.74348|.	0.977;0.983|.	T|T	0.53995|0.53995	-0.8359|-0.8359	10|5	0.19147|.	T|.	0.46|.	.|.	19.3122|19.3122	0.94192|0.94192	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	3945;3945|.	E7ETI5;Q8WXG9|.	.;GPR98_HUMAN|.	G|V	3945|1511	ENSP00000384582:A3945G|.	ENSP00000296619:A3945G|.	A|L	+|+	2|1	0|2	GPR98|GPR98	90088628|90088628	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	6.921000|6.921000	0.75805|0.75805	2.636000|2.636000	0.89361|0.89361	0.467000|0.467000	0.42956|0.42956	GCT|CTG	.	.		0.448	GPR98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369993.2	NM_032119	
SYNPO	11346	hgsc.bcm.edu	37	5	150029676	150029676	+	Silent	SNP	G	G	A			TCGA-2Y-A9GX-01A-11D-A382-10	TCGA-2Y-A9GX-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e1ab7d98-d4e4-47e9-bcbd-a616ec8e29bb	e977b5c2-99d4-4352-b892-10503efd33a7	g.chr5:150029676G>A	ENST00000394243.1	+	3	2945	c.2571G>A	c.(2569-2571)ctG>ctA	p.L857L	SYNPO_ENST00000519664.1_Silent_p.L613L|SYNPO_ENST00000522122.1_Silent_p.L857L|SYNPO_ENST00000307662.4_Silent_p.L613L	NM_001166208.1	NP_001159680.1	Q8N3V7	SYNPO_HUMAN	synaptopodin	857	Pro-rich.				positive regulation of actin filament bundle assembly (GO:0032233)|regulation of stress fiber assembly (GO:0051492)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|postsynaptic membrane (GO:0045211)|stress fiber (GO:0001725)|tight junction (GO:0005923)	actin binding (GO:0003779)			NS(1)|cervix(1)|endometrium(3)|large_intestine(6)|lung(4)|prostate(1)|urinary_tract(2)	18		Medulloblastoma(196;0.134)|all_hematologic(541;0.224)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			CTCCTGCCCTGCCTCGGCCCT	0.697																																					p.L857L		Atlas-SNP	.											.	SYNPO	147	.	0			c.G2571A						.						58.0	64.0	62.0					5																	150029676		2203	4299	6502	SO:0001819	synonymous_variant	11346	exon3			TGCCCTGCCTCGG	AF499137	CCDS4308.1, CCDS54937.1, CCDS54938.1	5q33.1	2008-02-05			ENSG00000171992	ENSG00000171992			30672	protein-coding gene	gene with protein product		608155				9314539, 10470851	Standard	NM_007286		Approved	KIAA1029	uc003lsn.3	Q8N3V7	OTTHUMG00000130078	ENST00000394243.1:c.2571G>A	chr5.hg19:g.150029676G>A		108.0	0.0		105.0	16.0	NM_001166209	A5PKZ8|D3DQG8|O15271|Q9UPX1	Silent	SNP	ENST00000394243.1	hg19	CCDS54937.1																																																																																			.	.		0.697	SYNPO-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000252371.1	NM_007286	
SLC17A4	10050	hgsc.bcm.edu	37	6	25776866	25776866	+	Missense_Mutation	SNP	G	G	T	rs560726056		TCGA-2Y-A9GX-01A-11D-A382-10	TCGA-2Y-A9GX-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e1ab7d98-d4e4-47e9-bcbd-a616ec8e29bb	e977b5c2-99d4-4352-b892-10503efd33a7	g.chr6:25776866G>T	ENST00000377905.4	+	9	1150	c.1031G>T	c.(1030-1032)tGc>tTc	p.C344F	SLC17A4_ENST00000439485.2_Missense_Mutation_p.C114F|SLC17A4_ENST00000397076.2_Missense_Mutation_p.C114F	NM_005495.2	NP_005486.1	Q9Y2C5	S17A4_HUMAN	solute carrier family 17, member 4	344					phosphate ion transmembrane transport (GO:0035435)|phosphate-containing compound metabolic process (GO:0006796)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	sodium:phosphate symporter activity (GO:0005436)			breast(4)|endometrium(1)|kidney(4)|large_intestine(3)|lung(21)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	39						GGATGTATCTGCATTATCCTT	0.507																																					p.C344F		Atlas-SNP	.											.	SLC17A4	79	.	0			c.G1031T						.						270.0	251.0	257.0					6																	25776866		2203	4300	6503	SO:0001583	missense	10050	exon9			GTATCTGCATTAT	AB020527	CCDS4564.1, CCDS75411.1	6p22.2	2013-07-18	2013-07-18		ENSG00000146039	ENSG00000146039		"""Solute carriers"""	10932	protein-coding gene	gene with protein product		604216	"""solute carrier family 17 (sodium phosphate), member 4"""			10319585	Standard	NM_005495		Approved	KIAA2138	uc003nfe.3	Q9Y2C5	OTTHUMG00000014410	ENST00000377905.4:c.1031G>T	chr6.hg19:g.25776866G>T	ENSP00000367137:p.Cys344Phe	87.0	0.0		75.0	11.0	NM_005495	B4DDV9|E7EPE8|E7EU17|Q32MB7|Q32MB8	Missense_Mutation	SNP	ENST00000377905.4	hg19	CCDS4564.1	.	.	.	.	.	.	.	.	.	.	G	13.28	2.189166	0.38707	.	.	ENSG00000146039	ENST00000377905;ENST00000439485;ENST00000397076	T;T;T	0.57436	0.4;0.61;0.4	5.48	1.53	0.23141	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.352612	0.24825	N	0.035286	T	0.11367	0.0277	N	0.11313	0.125	0.09310	N	1	B;B;B	0.31790	0.002;0.34;0.0	B;B;B	0.29862	0.011;0.108;0.01	T	0.28459	-1.0043	10	0.24483	T	0.36	.	8.5519	0.33458	0.0:0.1428:0.4155:0.4417	.	114;114;344	E7EPE8;E7EU17;Q9Y2C5	.;.;S17A4_HUMAN	F	344;114;114	ENSP00000367137:C344F;ENSP00000391345:C114F;ENSP00000380266:C114F	ENSP00000367137:C344F	C	+	2	0	SLC17A4	25884845	0.000000	0.05858	0.008000	0.14137	0.996000	0.88848	0.415000	0.21181	0.057000	0.16193	0.655000	0.94253	TGC	.	.		0.507	SLC17A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040068.1		
PKHD1	5314	hgsc.bcm.edu	37	6	51890835	51890835	+	Missense_Mutation	SNP	G	G	C			TCGA-2Y-A9GX-01A-11D-A382-10	TCGA-2Y-A9GX-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e1ab7d98-d4e4-47e9-bcbd-a616ec8e29bb	e977b5c2-99d4-4352-b892-10503efd33a7	g.chr6:51890835G>C	ENST00000371117.3	-	32	4048	c.3773C>G	c.(3772-3774)cCc>cGc	p.P1258R	PKHD1_ENST00000340994.4_Missense_Mutation_p.P1258R	NM_138694.3	NP_619639.3	P08F94	PKHD1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)	1258	IPT/TIG 7.				cellular calcium ion homeostasis (GO:0006874)|cilium assembly (GO:0042384)|homeostatic process (GO:0042592)|kidney development (GO:0001822)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cellular component movement (GO:0051271)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein kinase B signaling (GO:0051898)|positive regulation of cell proliferation (GO:0008284)|regulation of centrosome duplication (GO:0010824)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of TOR signaling (GO:0032006)|single organismal cell-cell adhesion (GO:0016337)	anchored component of external side of plasma membrane (GO:0031362)|apical plasma membrane (GO:0016324)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitotic spindle (GO:0072686)|perinuclear region of cytoplasm (GO:0048471)|primary cilium (GO:0072372)	receptor activity (GO:0004872)			NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(5)|cervix(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(59)|lung(139)|ovary(16)|prostate(8)|skin(20)|soft_tissue(1)|stomach(2)|upper_aerodigestive_tract(7)|urinary_tract(5)	304	Lung NSC(77;0.0605)					GCCCGCATCGGGTATCTGGGG	0.597																																					p.P1258R		Atlas-SNP	.											.	PKHD1	927	.	0			c.C3773G						.						39.0	42.0	41.0					6																	51890835		2203	4300	6503	SO:0001583	missense	5314	exon32			GCATCGGGTATCT	AF480064	CCDS4935.1, CCDS4936.1	6p21.2-p12	2012-11-26	2003-04-16		ENSG00000170927	ENSG00000170927			9016	protein-coding gene	gene with protein product	"""tigmin"", ""polyductin"", ""fibrocystin"""	606702	"""TIG multiple domains 1"""	TIGM1		9503014	Standard	NM_138694		Approved	ARPKD, FCYT	uc003pah.1	P08F94	OTTHUMG00000014841	ENST00000371117.3:c.3773C>G	chr6.hg19:g.51890835G>C	ENSP00000360158:p.Pro1258Arg	90.0	0.0		86.0	9.0	NM_170724	Q5VUA2|Q5VUA3|Q5VWV1|Q86Z26|Q8TCZ9	Missense_Mutation	SNP	ENST00000371117.3	hg19	CCDS4935.1	.	.	.	.	.	.	.	.	.	.	G	16.05	3.011948	0.54468	.	.	ENSG00000170927	ENST00000371117;ENST00000340994;ENST00000393616	D;D	0.87491	-2.09;-2.26	5.69	4.82	0.62117	Cell surface receptor IPT/TIG (2);Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.678460	0.14908	N	0.291409	D	0.87517	0.6197	M	0.77103	2.36	0.09310	N	1	P;D	0.54772	0.834;0.968	P;P	0.58331	0.483;0.837	T	0.80099	-0.1524	10	0.26408	T	0.33	.	12.0941	0.53744	0.0791:0.0:0.9209:0.0	.	1258;1258	P08F94-2;P08F94	.;PKHD1_HUMAN	R	1258	ENSP00000360158:P1258R;ENSP00000341097:P1258R	ENSP00000341097:P1258R	P	-	2	0	PKHD1	51998794	0.008000	0.16893	0.006000	0.13384	0.004000	0.04260	1.637000	0.37155	1.409000	0.46915	0.655000	0.94253	CCC	.	.		0.597	PKHD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040893.1	NM_138694	
EYS	346007	hgsc.bcm.edu	37	6	65301270	65301270	+	Missense_Mutation	SNP	G	G	T			TCGA-2Y-A9GX-01A-11D-A382-10	TCGA-2Y-A9GX-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e1ab7d98-d4e4-47e9-bcbd-a616ec8e29bb	e977b5c2-99d4-4352-b892-10503efd33a7	g.chr6:65301270G>T	ENST00000370621.3	-	26	5016	c.4490C>A	c.(4489-4491)gCt>gAt	p.A1497D	EYS_ENST00000503581.1_Missense_Mutation_p.A1497D|EYS_ENST00000370616.2_Missense_Mutation_p.A1497D			Q5T1H1	EYS_HUMAN	eyes shut homolog (Drosophila)	1497					detection of light stimulus involved in visual perception (GO:0050908)|skeletal muscle tissue regeneration (GO:0043403)	extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(42)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)	69						AATTACCTTAGCAGGAAAAAT	0.413																																					p.A1497D		Atlas-SNP	.											.	EYS	527	.	0			c.C4490A						.						35.0	32.0	33.0					6																	65301270		692	1590	2282	SO:0001583	missense	346007	exon26			ACCTTAGCAGGAA		CCDS4967.1, CCDS47445.1, CCDS47446.1	6q12	2014-01-28	2008-10-20	2008-10-20	ENSG00000188107	ENSG00000188107			21555	protein-coding gene	gene with protein product		612424	"""chromosome 6 open reading frame 180"", ""EGF-like-domain, multiple 11"", ""retinitis pigmentosa 25 (autosomal recessive)"", ""EGF-like-domain, multiple 10"", ""chromosome 6 open reading frame 178"", ""chromosome 6 open reading frame 179"""	C6orf180, EGFL11, RP25, EGFL10, C6orf178, C6orf179		18836446, 18976725	Standard	NM_001142800		Approved	dJ1018A4.2, bA166P24.2, SPAM, bA307F22.3, dJ303F19.1, bA74E24.1	uc011dxu.1	Q5T1H1	OTTHUMG00000014971	ENST00000370621.3:c.4490C>A	chr6.hg19:g.65301270G>T	ENSP00000359655:p.Ala1497Asp	84.0	0.0		109.0	8.0	NM_001142800	A2RUR2|A8MVE7|B7TYK8|B7UUQ3|B7ZBE7|B7ZBE8|B7ZBR3|B9ZVD2|Q5SZM4|Q5T3C8|Q5T669|Q5TEL3|Q5TEL4|Q5VVG4|Q6UY05|Q9H557|Q9NQ15	Missense_Mutation	SNP	ENST00000370621.3	hg19		.	.	.	.	.	.	.	.	.	.	G	17.12	3.307836	0.60305	.	.	ENSG00000188107	ENST00000503581;ENST00000370621;ENST00000370616	D;D;D	0.84660	-1.88;-1.85;-1.85	5.84	4.02	0.46733	.	.	.	.	.	T	0.69088	0.3072	N	0.08118	0	0.80722	D	1	D;D	0.76494	0.999;0.986	D;P	0.66979	0.948;0.809	T	0.69778	-0.5053	9	0.07175	T	0.84	.	9.3914	0.38374	0.0762:0.1453:0.7785:0.0	.	1497;1497	Q5T1H1-1;Q5T1H1	.;EYS_HUMAN	D	1497	ENSP00000424243:A1497D;ENSP00000359655:A1497D;ENSP00000359650:A1497D	ENSP00000359650:A1497D	A	-	2	0	EYS	65357991	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	2.041000	0.41213	1.447000	0.47661	0.591000	0.81541	GCT	.	.		0.413	EYS-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000351351.3	XM_294050	
SCIN	85477	hgsc.bcm.edu	37	7	12684320	12684320	+	Missense_Mutation	SNP	G	G	T			TCGA-2Y-A9GX-01A-11D-A382-10	TCGA-2Y-A9GX-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e1ab7d98-d4e4-47e9-bcbd-a616ec8e29bb	e977b5c2-99d4-4352-b892-10503efd33a7	g.chr7:12684320G>T	ENST00000297029.5	+	13	1972	c.1871G>T	c.(1870-1872)gGa>gTa	p.G624V	SCIN_ENST00000519209.1_Missense_Mutation_p.G377V|SCIN_ENST00000445618.2_Missense_Mutation_p.G377V	NM_001112706.2	NP_001106177.1	Q9Y6U3	ADSV_HUMAN	scinderin	624	Ca(2+)-dependent actin binding.				actin filament capping (GO:0051693)|actin filament severing (GO:0051014)|actin nucleation (GO:0045010)|calcium ion-dependent exocytosis (GO:0017156)|negative regulation of cell proliferation (GO:0008285)|positive regulation of apoptotic process (GO:0043065)|positive regulation of megakaryocyte differentiation (GO:0045654)|positive regulation of secretion (GO:0051047)|regulation of chondrocyte differentiation (GO:0032330)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|protein complex (GO:0043234)	1-phosphatidylinositol binding (GO:0005545)|actin binding (GO:0003779)|actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|phosphatidylserine binding (GO:0001786)			endometrium(3)|kidney(1)|large_intestine(2)|lung(9)|ovary(2)	17				UCEC - Uterine corpus endometrioid carcinoma (126;0.195)		AACAAAACTGGAAGATTTGTT	0.507																																					p.G624V		Atlas-SNP	.											.	SCIN	105	.	0			c.G1871T						.						38.0	39.0	39.0					7																	12684320		1874	4105	5979	SO:0001583	missense	85477	exon13			AAACTGGAAGATT	AF276507	CCDS47545.1, CCDS47546.1	7p21.3	2006-04-25			ENSG00000006747	ENSG00000006747			21695	protein-coding gene	gene with protein product		613416					Standard	NM_033128		Approved	adseverin, KIAA1905	uc003ssn.4	Q9Y6U3	OTTHUMG00000152385	ENST00000297029.5:c.1871G>T	chr7.hg19:g.12684320G>T	ENSP00000297029:p.Gly624Val	75.0	0.0		53.0	6.0	NM_001112706	A8K2U8|Q8NBZ6|Q8WU97|Q96JC7|Q96PY2	Missense_Mutation	SNP	ENST00000297029.5	hg19	CCDS47545.1	.	.	.	.	.	.	.	.	.	.	G	37	6.355118	0.97498	.	.	ENSG00000006747	ENST00000297029;ENST00000519209;ENST00000445618	T;T;T	0.33216	1.42;1.42;1.42	5.07	5.07	0.68467	.	0.000000	0.85682	D	0.000000	T	0.69070	0.3070	H	0.95365	3.66	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.80381	-0.1406	10	0.87932	D	0	-17.1973	18.4559	0.90720	0.0:0.0:1.0:0.0	.	624	Q9Y6U3	ADSV_HUMAN	V	624;377;377	ENSP00000297029:G624V;ENSP00000430997:G377V;ENSP00000390189:G377V	ENSP00000297029:G624V	G	+	2	0	SCIN	12650845	1.000000	0.71417	1.000000	0.80357	0.153000	0.21895	9.325000	0.96381	2.353000	0.79882	0.462000	0.41574	GGA	.	.		0.507	SCIN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326041.1	NM_033128	
CCDC136	64753	hgsc.bcm.edu	37	7	128450355	128450355	+	Nonsense_Mutation	SNP	C	C	T			TCGA-2Y-A9GX-01A-11D-A382-10	TCGA-2Y-A9GX-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e1ab7d98-d4e4-47e9-bcbd-a616ec8e29bb	e977b5c2-99d4-4352-b892-10503efd33a7	g.chr7:128450355C>T	ENST00000297788.4	+	12	2330	c.1963C>T	c.(1963-1965)Cag>Tag	p.Q655*	CCDC136_ENST00000464832.1_Intron|CCDC136_ENST00000487361.1_Intron|CCDC136_ENST00000378685.4_Intron	NM_022742.4	NP_073579	Q96JN2	CC136_HUMAN	coiled-coil domain containing 136	655						integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)				breast(2)|endometrium(3)|kidney(1)|large_intestine(4)|lung(11)|ovary(3)	24						GTCTCATTTCCAGGAAGTGTT	0.433																																					p.Q655X		Atlas-SNP	.											.	CCDC136	170	.	0			c.C1963T						.						66.0	64.0	65.0					7																	128450355		1948	4146	6094	SO:0001587	stop_gained	64753	exon12			CATTTCCAGGAAG		CCDS47704.1, CCDS56510.1	7q33	2007-08-01			ENSG00000128596	ENSG00000128596			22225	protein-coding gene	gene with protein product		611902				15112360	Standard	NM_022742		Approved	KIAA1793, NAG6, DKFZP434G156	uc003vnv.2	Q96JN2	OTTHUMG00000158310	ENST00000297788.4:c.1963C>T	chr7.hg19:g.128450355C>T	ENSP00000297788:p.Gln655*	147.0	0.0		138.0	18.0	NM_022742	A4D1K1|A7MCY7|A8MYA7|Q6ZVK7|Q9H8M3|Q9UFE1	Nonsense_Mutation	SNP	ENST00000297788.4	hg19	CCDS47704.1	.	.	.	.	.	.	.	.	.	.	C	38	7.063842	0.98036	.	.	ENSG00000128596	ENST00000297788;ENST00000397697;ENST00000320524;ENST00000464672	.	.	.	4.94	4.06	0.47325	.	0.782188	0.11602	N	0.547695	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-6.0858	9.393	0.38386	0.0:0.9033:0.0:0.0967	.	.	.	.	X	655;655;655;246	.	ENSP00000297788:Q655X	Q	+	1	0	CCDC136	128237591	0.983000	0.35010	0.885000	0.34714	0.012000	0.07955	1.171000	0.31896	1.448000	0.47680	-0.140000	0.14226	CAG	.	.		0.433	CCDC136-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000350641.1	NM_022742	
LRGUK	136332	hgsc.bcm.edu	37	7	133906659	133906659	+	Missense_Mutation	SNP	A	A	G			TCGA-2Y-A9GX-01A-11D-A382-10	TCGA-2Y-A9GX-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e1ab7d98-d4e4-47e9-bcbd-a616ec8e29bb	e977b5c2-99d4-4352-b892-10503efd33a7	g.chr7:133906659A>G	ENST00000285928.2	+	16	2041	c.1972A>G	c.(1972-1974)Aaa>Gaa	p.K658E		NM_144648.1	NP_653249.1	Q96M69	LRGUK_HUMAN	leucine-rich repeats and guanylate kinase domain containing	658						cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|kinase activity (GO:0016301)			breast(1)|endometrium(2)|kidney(2)|large_intestine(12)|lung(23)|ovary(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	49						TTCAGCCAAAAAAACACCAGC	0.388																																					p.K658E		Atlas-SNP	.											.	LRGUK	113	.	0			c.A1972G						.						52.0	53.0	53.0					7																	133906659		2203	4300	6503	SO:0001583	missense	136332	exon16			GCCAAAAAAACAC	AK057348	CCDS5830.1	7q33	2006-10-27			ENSG00000155530	ENSG00000155530			21964	protein-coding gene	gene with protein product							Standard	NM_144648		Approved	FLJ32786	uc003vrm.1	Q96M69	OTTHUMG00000155320	ENST00000285928.2:c.1972A>G	chr7.hg19:g.133906659A>G	ENSP00000285928:p.Lys658Glu	74.0	0.0		70.0	6.0	NM_144648	Q2M3I1	Missense_Mutation	SNP	ENST00000285928.2	hg19	CCDS5830.1	.	.	.	.	.	.	.	.	.	.	A	7.096	0.573080	0.13623	.	.	ENSG00000155530	ENST00000285928	T	0.42513	0.97	5.77	1.95	0.26073	.	0.775105	0.12121	N	0.497673	T	0.33147	0.0853	L	0.55103	1.725	0.09310	N	1	B	0.24721	0.11	B	0.19148	0.024	T	0.35051	-0.9804	10	0.72032	D	0.01	-2.2053	3.5337	0.07786	0.5946:0.2001:0.2052:0.0	.	658	Q96M69	LRGUK_HUMAN	E	658	ENSP00000285928:K658E	ENSP00000285928:K658E	K	+	1	0	LRGUK	133557199	0.060000	0.20803	0.005000	0.12908	0.033000	0.12548	0.591000	0.23969	1.026000	0.39733	0.528000	0.53228	AAA	.	.		0.388	LRGUK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339442.1	NM_144648	
SLC26A7	115111	hgsc.bcm.edu	37	8	92346665	92346665	+	Missense_Mutation	SNP	A	A	G			TCGA-2Y-A9GX-01A-11D-A382-10	TCGA-2Y-A9GX-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e1ab7d98-d4e4-47e9-bcbd-a616ec8e29bb	e977b5c2-99d4-4352-b892-10503efd33a7	g.chr8:92346665A>G	ENST00000276609.3	+	6	1024	c.785A>G	c.(784-786)gAt>gGt	p.D262G	SLC26A7_ENST00000523719.1_Missense_Mutation_p.D262G|SLC26A7_ENST00000309536.2_Missense_Mutation_p.D262G	NM_001282356.1|NM_052832.2	NP_001269285.1|NP_439897.1			solute carrier family 26 (anion exchanger), member 7											breast(1)|cervix(1)|endometrium(4)|large_intestine(10)|lung(26)|ovary(3)|skin(4)|upper_aerodigestive_tract(1)	50			BRCA - Breast invasive adenocarcinoma(11;0.00802)			CTTCCTGTAGATTTAGTTTTG	0.353																																					p.D262G		Atlas-SNP	.											.	SLC26A7	207	.	0			c.A785G						.						92.0	88.0	89.0					8																	92346665		2202	4298	6500	SO:0001583	missense	115111	exon6			CTGTAGATTTAGT	AF331521	CCDS6254.1, CCDS6255.1, CCDS75765.1	8q23	2013-07-18	2013-07-18		ENSG00000147606	ENSG00000147606		"""Solute carriers"""	14467	protein-coding gene	gene with protein product		608479	"""solute carrier family 26, member 7"""			11834742, 11829495, 16524946	Standard	NM_134266		Approved	SUT2	uc003yez.3	Q8TE54	OTTHUMG00000164062	ENST00000276609.3:c.785A>G	chr8.hg19:g.92346665A>G	ENSP00000276609:p.Asp262Gly	42.0	0.0		48.0	14.0	NM_134266		Missense_Mutation	SNP	ENST00000276609.3	hg19	CCDS6254.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	20.6|20.6	4.023216|4.023216	0.75275|0.75275	.|.	.|.	ENSG00000147606|ENSG00000147606	ENST00000523719;ENST00000276609;ENST00000309536|ENST00000520818	D;D;D|.	0.92752|.	-3.1;-3.1;-3.1|.	5.73|5.73	5.73|5.73	0.89815|0.89815	Sulphate transporter (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.68952|0.68952	0.3057|0.3057	L|L	0.52573|0.52573	1.65|1.65	0.47214|0.47214	D|D	0.999357|0.999357	D;D|.	0.89917|.	1.0;1.0|.	D;D|.	0.91635|.	0.998;0.999|.	T|T	0.66496|0.66496	-0.5909|-0.5909	10|5	0.72032|.	D|.	0.01|.	.|.	16.3197|16.3197	0.82945|0.82945	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	262;262|.	Q8TE54-2;Q8TE54|.	.;S26A7_HUMAN|.	G|V	262|130	ENSP00000428849:D262G;ENSP00000276609:D262G;ENSP00000309504:D262G|.	ENSP00000276609:D262G|.	D|I	+|+	2|1	0|0	SLC26A7|SLC26A7	92415841|92415841	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.993000|0.993000	0.82548|0.82548	6.072000|6.072000	0.71238|0.71238	2.302000|2.302000	0.77476|0.77476	0.533000|0.533000	0.62120|0.62120	GAT|ATT	.	.		0.353	SLC26A7-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377011.1		
NIPAL2	79815	hgsc.bcm.edu	37	8	99208234	99208234	+	Splice_Site	SNP	C	C	G			TCGA-2Y-A9GX-01A-11D-A382-10	TCGA-2Y-A9GX-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e1ab7d98-d4e4-47e9-bcbd-a616ec8e29bb	e977b5c2-99d4-4352-b892-10503efd33a7	g.chr8:99208234C>G	ENST00000341166.3	-	9	1136		c.e9-1		NIPAL2_ENST00000430223.2_Splice_Site|NIPAL2_ENST00000520545.1_Splice_Site	NM_024759.1	NP_079035.1	Q9H841	NPAL2_HUMAN	NIPA-like domain containing 2							integral component of membrane (GO:0016021)	magnesium ion transmembrane transporter activity (GO:0015095)			cervix(3)|kidney(1)|large_intestine(2)|lung(5)|stomach(1)	12						AATATGATACCTGTAACACAG	0.269																																					.		Atlas-SNP	.											.	NIPAL2	23	.	0			c.881-1G>C						.						48.0	48.0	48.0					8																	99208234		2203	4297	6500	SO:0001630	splice_region_variant	79815	exon10			TGATACCTGTAAC	AK024017	CCDS6278.1	8q22.2	2009-03-24		2009-03-24	ENSG00000104361	ENSG00000104361			25854	protein-coding gene	gene with protein product				NPAL2		14702039	Standard	NM_024759		Approved	FLJ13955	uc003yil.1	Q9H841	OTTHUMG00000164668	ENST00000341166.3:c.881-1G>C	chr8.hg19:g.99208234C>G		495.0	0.0		670.0	71.0	NM_024759	A2RTY8	Splice_Site	SNP	ENST00000341166.3	hg19	CCDS6278.1	.	.	.	.	.	.	.	.	.	.	C	17.42	3.385091	0.61956	.	.	ENSG00000104361	ENST00000430223;ENST00000341166	.	.	.	5.47	5.47	0.80525	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.4977	0.87723	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	NIPAL2	99277410	1.000000	0.71417	0.988000	0.46212	0.749000	0.42624	6.634000	0.74290	2.553000	0.86117	0.563000	0.77884	.	.	.		0.269	NIPAL2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000379677.1	NM_024759	Intron
SLC45A4	57210	hgsc.bcm.edu	37	8	142222517	142222517	+	Missense_Mutation	SNP	C	C	A			TCGA-2Y-A9GX-01A-11D-A382-10	TCGA-2Y-A9GX-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e1ab7d98-d4e4-47e9-bcbd-a616ec8e29bb	e977b5c2-99d4-4352-b892-10503efd33a7	g.chr8:142222517C>A	ENST00000024061.3	-	7	2234	c.1927G>T	c.(1927-1929)Gtc>Ttc	p.V643F	SLC45A4_ENST00000519067.1_Missense_Mutation_p.V643F|SLC45A4_ENST00000433583.2_Missense_Mutation_p.V636F|SLC45A4_ENST00000517878.1_Missense_Mutation_p.V694F	NM_001080431.1	NP_001073900.1	Q5BKX6	S45A4_HUMAN	solute carrier family 45, member 4						transport (GO:0006810)	integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(6)|lung(9)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	31	all_cancers(97;1.52e-15)|all_epithelial(106;2.92e-14)|Lung NSC(106;1.23e-05)|all_lung(105;1.75e-05)|Ovarian(258;0.01)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0493)			ATGGGGATGACGCGGACAGTC	0.612																																					p.V643F		Atlas-SNP	.											.	SLC45A4	71	.	0			c.G1927T						.						67.0	68.0	68.0					8																	142222517		2203	4300	6503	SO:0001583	missense	57210	exon7			GGATGACGCGGAC	AB032952	CCDS34948.1, CCDS69550.1, CCDS75795.1	8q24.3	2013-05-22						"""Solute carriers"""	29196	protein-coding gene	gene with protein product							Standard	NM_001080431		Approved	KIAA1126	uc003ywd.1	Q5BKX6		ENST00000024061.3:c.1927G>T	chr8.hg19:g.142222517C>A	ENSP00000024061:p.Val643Phe	86.0	0.0		70.0	16.0	NM_001080431	Q6ZRI2|Q9ULU3	Missense_Mutation	SNP	ENST00000024061.3	hg19	CCDS34948.1	.	.	.	.	.	.	.	.	.	.	C	21.1	4.097849	0.76870	.	.	ENSG00000022567	ENST00000519067;ENST00000517878;ENST00000433583;ENST00000024061	T;T;T;T	0.80994	-1.44;-1.44;-1.44;-1.44	5.27	5.27	0.74061	.	0.000000	0.85682	D	0.000000	D	0.90618	0.7058	M	0.82323	2.585	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.999;0.999	D	0.91079	0.4898	10	0.52906	T	0.07	-63.0162	18.9005	0.92440	0.0:1.0:0.0:0.0	.	694;643;643	E7EV90;Q5BKX6-3;Q5BKX6-2	.;.;.	F	643;694;636;643	ENSP00000429059:V643F;ENSP00000428137:V694F;ENSP00000400799:V636F;ENSP00000024061:V643F	ENSP00000024061:V643F	V	-	1	0	SLC45A4	142291699	1.000000	0.71417	0.944000	0.38274	0.357000	0.29423	7.272000	0.78516	2.453000	0.82957	0.655000	0.94253	GTC	.	.		0.612	SLC45A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378571.3	XM_050325	
SVEP1	79987	hgsc.bcm.edu	37	9	113261408	113261408	+	Missense_Mutation	SNP	C	C	A			TCGA-2Y-A9GX-01A-11D-A382-10	TCGA-2Y-A9GX-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e1ab7d98-d4e4-47e9-bcbd-a616ec8e29bb	e977b5c2-99d4-4352-b892-10503efd33a7	g.chr9:113261408C>A	ENST00000401783.2	-	7	1930	c.1594G>T	c.(1594-1596)Ggg>Tgg	p.G532W	SVEP1_ENST00000467821.1_5'UTR|SVEP1_ENST00000374461.1_Missense_Mutation_p.G509W|SVEP1_ENST00000374469.1_Missense_Mutation_p.G509W|SVEP1_ENST00000302728.8_Missense_Mutation_p.G532W	NM_153366.3	NP_699197.3	Q4LDE5	SVEP1_HUMAN	sushi, von Willebrand factor type A, EGF and pentraxin domain containing 1	532	Sushi 3. {ECO:0000255|PROSITE- ProRule:PRU00302}.				cell adhesion (GO:0007155)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|chromatin binding (GO:0003682)			NS(1)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|cervix(2)|endometrium(19)|kidney(8)|large_intestine(24)|lung(58)|ovary(7)|prostate(7)|skin(1)|stomach(4)|upper_aerodigestive_tract(5)|urinary_tract(4)	147						AAAATGAACCCTTGGCGGCAA	0.468																																					p.G532W		Atlas-SNP	.											.	SVEP1	326	.	0			c.G1594T						.						66.0	63.0	64.0					9																	113261408		1965	4164	6129	SO:0001583	missense	79987	exon7			TGAACCCTTGGCG	AK027870		9q31-q32	2008-02-05	2005-03-15	2005-03-17	ENSG00000165124	ENSG00000165124			15985	protein-coding gene	gene with protein product		611691	"""chromosome 9 open reading frame 13"""	C9orf13			Standard	NM_153366		Approved	bA427L11.3, POLYDOM, FLJ13529	uc010mtz.3	Q4LDE5	OTTHUMG00000020482	ENST00000401783.2:c.1594G>T	chr9.hg19:g.113261408C>A	ENSP00000384917:p.Gly532Trp	108.0	0.0		122.0	8.0	NM_153366	Q0P675|Q5D213|Q5T938|Q5VTE4|Q5VTE5|Q7Z387|Q7Z3G3|Q8NBT9|Q96JU7|Q9H284|Q9H8J9	Missense_Mutation	SNP	ENST00000401783.2	hg19	CCDS48004.1	.	.	.	.	.	.	.	.	.	.	C	24.3	4.521262	0.85600	.	.	ENSG00000165124	ENST00000401783;ENST00000374469;ENST00000302728;ENST00000374461	T;T;T;T	0.59364	0.27;0.27;0.27;0.27	5.91	5.91	0.95273	Complement control module (2);Sushi/SCR/CCP (2);	0.000000	0.85682	D	0.000000	T	0.70020	0.3176	L	0.36672	1.1	0.48135	D	0.999594	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.998;1.0;1.0	T	0.71174	-0.4670	10	0.87932	D	0	.	19.0678	0.93119	0.0:1.0:0.0:0.0	.	532;532;532	E9PBN8;Q4LDE5;Q4LDE5-2	.;SVEP1_HUMAN;.	W	532;509;532;509	ENSP00000384917:G532W;ENSP00000363593:G509W;ENSP00000304118:G532W;ENSP00000363585:G509W	ENSP00000304118:G532W	G	-	1	0	SVEP1	112301229	1.000000	0.71417	0.994000	0.49952	0.978000	0.69477	5.599000	0.67592	2.813000	0.96785	0.655000	0.94253	GGG	.	.		0.468	SVEP1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			
CACNA1B	774	hgsc.bcm.edu	37	9	140970351	140970351	+	Missense_Mutation	SNP	G	G	A			TCGA-2Y-A9GX-01A-11D-A382-10	TCGA-2Y-A9GX-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e1ab7d98-d4e4-47e9-bcbd-a616ec8e29bb	e977b5c2-99d4-4352-b892-10503efd33a7	g.chr9:140970351G>A	ENST00000371372.1	+	35	5083	c.4938G>A	c.(4936-4938)atG>atA	p.M1646I	CACNA1B_ENST00000371365.2_Missense_Mutation_p.M10I|CACNA1B_ENST00000371357.1_Missense_Mutation_p.M1645I|CACNA1B_ENST00000277549.5_Missense_Mutation_p.M840I|CACNA1B_ENST00000371363.1_Missense_Mutation_p.M1644I|CACNA1B_ENST00000277551.2_Missense_Mutation_p.M1646I|CACNA1B_ENST00000371355.4_Missense_Mutation_p.M1647I	NM_000718.3|NM_001243812.1	NP_000709.1|NP_001230741.1	Q00975	CAC1B_HUMAN	calcium channel, voltage-dependent, N type, alpha 1B subunit	1646					calcium ion import (GO:0070509)|locomotory behavior (GO:0007626)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|neurotransmitter secretion (GO:0007269)|regulation of blood pressure (GO:0008217)|regulation of calcium ion transport (GO:0051924)|regulation of heart contraction (GO:0008016)|response to pain (GO:0048265)|synaptic transmission (GO:0007268)|transport (GO:0006810)	dendrite (GO:0030425)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|high voltage-gated calcium channel activity (GO:0008331)|protein C-terminus binding (GO:0008022)|voltage-gated calcium channel activity (GO:0005245)			NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(1)|endometrium(10)|kidney(2)|large_intestine(17)|lung(31)|ovary(1)|prostate(1)|skin(2)|stomach(2)|urinary_tract(2)	80	all_cancers(76;0.166)			OV - Ovarian serous cystadenocarcinoma(145;1.16e-05)|Epithelial(140;0.000476)	Amlodipine(DB00381)|Gabapentin(DB00996)|Levetiracetam(DB01202)|Spironolactone(DB00421)|Verapamil(DB00661)	AAGCCCTGATGCTGCTGTTCA	0.537																																					p.M1646I		Atlas-SNP	.											.	CACNA1B	266	.	0			c.G4938A						.						67.0	72.0	70.0					9																	140970351		2039	4180	6219	SO:0001583	missense	774	exon34			CCTGATGCTGCTG	AB209467	CCDS59522.1, CCDS59523.1	9q34	2013-01-10	2007-02-16		ENSG00000148408	ENSG00000148408		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"", ""EF-hand domain containing"""	1389	protein-coding gene	gene with protein product		601012		CACNL1A5		8825650, 16382099	Standard	NM_000718		Approved	Cav2.2, CACNN	uc004cog.3	Q00975	OTTHUMG00000021002	ENST00000371372.1:c.4938G>A	chr9.hg19:g.140970351G>A	ENSP00000360423:p.Met1646Ile	98.0	0.0		68.0	15.0	NM_001243812	B1AQK5	Missense_Mutation	SNP	ENST00000371372.1	hg19	CCDS59522.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	16.12|16.12	3.034388|3.034388	0.54896|0.54896	.|.	.|.	ENSG00000148408|ENSG00000148408	ENST00000413253|ENST00000371372;ENST00000277551;ENST00000277549;ENST00000371363;ENST00000371357;ENST00000371355;ENST00000371365	.|D;D;D;D;D;D;D	.|0.97279	.|-4.32;-4.32;-4.32;-4.32;-4.32;-4.32;-4.32	5.23|5.23	5.23|5.23	0.72850|0.72850	.|Ion transport (1);	.|0.050300	.|0.85682	.|D	.|0.000000	D|D	0.94768|0.94768	0.8311|0.8311	N|N	0.20304|0.20304	0.555|0.555	0.80722|0.80722	D|D	1|1	.|P;P;P	.|0.45902	.|0.74;0.868;0.868	.|P;P;P	.|0.45276	.|0.475;0.475;0.475	D|D	0.95661|0.95661	0.8715|0.8715	5|10	.|0.87932	.|D	.|0	.|.	19.1693|19.1693	0.93570|0.93570	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|1646;1645;1644	.|Q00975;B1AQK7;B1AQK6	.|CAC1B_HUMAN;.;.	T|I	11|1646;1646;840;1644;1645;1647;10	.|ENSP00000360423:M1646I;ENSP00000277551:M1646I;ENSP00000277549:M840I;ENSP00000360414:M1644I;ENSP00000360408:M1645I;ENSP00000360406:M1647I;ENSP00000360416:M10I	.|ENSP00000277549:M840I	A|M	+|+	1|3	0|0	CACNA1B|CACNA1B	140090172|140090172	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.934000|0.934000	0.57294|0.57294	3.847000|3.847000	0.55895|0.55895	2.607000|2.607000	0.88179|0.88179	0.655000|0.655000	0.94253|0.94253	GCT|ATG	.	.		0.537	CACNA1B-001	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000055380.1	NM_000718	
TIMM23	100287932	hgsc.bcm.edu	37	10	51592507	51592507	+	Silent	SNP	G	G	C			TCGA-2Y-A9GX-01A-11D-A382-10	TCGA-2Y-A9GX-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e1ab7d98-d4e4-47e9-bcbd-a616ec8e29bb	e977b5c2-99d4-4352-b892-10503efd33a7	g.chr10:51592507G>C	ENST00000260867.4	-	7	750	c.627C>G	c.(625-627)ctC>ctG	p.L209L	TIMM23_ENST00000485812.1_5'UTR|TIMM23_ENST00000374064.3_Silent_p.L161L|TIMM23_ENST00000374065.3_Silent_p.L172L	NM_006327.3	NP_006318.1	O14925	TIM23_HUMAN	translocase of inner mitochondrial membrane 23 homolog (yeast)	209					cellular protein metabolic process (GO:0044267)|protein targeting to mitochondrion (GO:0006626)	integral component of mitochondrial inner membrane (GO:0031305)|mitochondrial inner membrane (GO:0005743)|mitochondrial inner membrane presequence translocase complex (GO:0005744)|mitochondrial intermembrane space (GO:0005758)|mitochondrion (GO:0005739)	P-P-bond-hydrolysis-driven protein transmembrane transporter activity (GO:0015450)			endometrium(1)|large_intestine(1)|pancreas(1)	3						AAAATCTTCAGAGTGACTGTT	0.423																																					p.L209L		Atlas-SNP	.											.	TIMM23	4	.	0			c.C627G						.						134.0	127.0	129.0					10																	51592507		2203	4300	6503	SO:0001819	synonymous_variant	100287932	exon7			TCTTCAGAGTGAC	AF030162	CCDS73091.1	10q11.21-q11.23	2010-03-17			ENSG00000138297				17312	protein-coding gene	gene with protein product		605034				10339406	Standard	NM_006327		Approved	TIM23	uc010qha.2	O14925	OTTHUMG00000018213	ENST00000260867.4:c.627C>G	chr10.hg19:g.51592507G>C		97.0	0.0		125.0	12.0	NM_006327	Q53FF8|Q5T1E6|Q6P5S5	Silent	SNP	ENST00000260867.4	hg19	CCDS7238.1	.	.	.	.	.	.	.	.	.	.	G	8.452	0.853212	0.17106	.	.	ENSG00000138297	ENST00000444743	.	.	.	5.55	0.247	0.15521	.	0.106294	0.33199	N	0.005174	T	0.53965	0.1829	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.52147	-0.8614	6	0.87932	D	0	-6.4792	1.7704	0.03010	0.3265:0.2213:0.3394:0.1128	.	.	.	.	V	107	.	ENSP00000408548:L107V	L	-	1	2	TIMM23	51262513	1.000000	0.71417	0.999000	0.59377	0.974000	0.67602	1.113000	0.31184	0.156000	0.19299	0.655000	0.94253	CTG	.	.		0.423	TIMM23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048040.1	NM_006327.2	
FAM21A	387680	hgsc.bcm.edu	37	10	51829449	51829449	+	Missense_Mutation	SNP	C	C	G			TCGA-2Y-A9GX-01A-11D-A382-10	TCGA-2Y-A9GX-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e1ab7d98-d4e4-47e9-bcbd-a616ec8e29bb	e977b5c2-99d4-4352-b892-10503efd33a7	g.chr10:51829449C>G	ENST00000282633.5	+	3	314	c.269C>G	c.(268-270)tCt>tGt	p.S90C	FAM21A_ENST00000492914.1_3'UTR|FAM21A_ENST00000351071.6_Missense_Mutation_p.S90C|RP11-324H6.5_ENST00000456967.1_RNA|FAM21A_ENST00000314664.7_Missense_Mutation_p.S90C	NM_001005751.1	NP_001005751.1	Q641Q2	FA21A_HUMAN	family with sequence similarity 21, member A	90					retrograde transport, endosome to Golgi (GO:0042147)	early endosome (GO:0005769)|membrane (GO:0016020)|WASH complex (GO:0071203)				breast(1)|endometrium(4)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	15						CTTATGCTCTCTAATACCCAG	0.358																																					p.S90C		Atlas-SNP	.											.	FAM21A	32	.	0			c.C269G						.						187.0	185.0	185.0					10																	51829449		1848	4098	5946	SO:0001583	missense	387680	exon3			TGCTCTCTAATAC	BC082258	CCDS41527.1	10q11.23	2014-06-19			ENSG00000099290	ENSG00000099290			23416	protein-coding gene	gene with protein product			"""family with sequence similarity 21, member B"""	FAM21B			Standard	XM_005269805		Approved	bA56A21.1, bA98I6.1, FLJ10824	uc001jjb.3	Q641Q2	OTTHUMG00000018225	ENST00000282633.5:c.269C>G	chr10.hg19:g.51829449C>G	ENSP00000282633:p.Ser90Cys	198.0	0.0		200.0	18.0	NM_001005751	A2A3S2|A2A3U6|Q6DHY0	Missense_Mutation	SNP	ENST00000282633.5	hg19	CCDS41527.1	.	.	.	.	.	.	.	.	.	.	C	18.22	3.575719	0.65878	.	.	ENSG00000099290	ENST00000351071;ENST00000314664;ENST00000434114;ENST00000282633	.	.	.	3.73	3.73	0.42828	.	0.000000	0.85682	D	0.000000	T	0.79227	0.4410	M	0.83012	2.62	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.998;0.999;0.999	T	0.82756	-0.0300	9	0.66056	D	0.02	-15.5385	13.3892	0.60813	0.0:1.0:0.0:0.0	.	90;90;90	E7ESD2;Q641Q2-2;Q641Q2	.;.;FA21A_HUMAN	C	90;90;89;90	.	ENSP00000282633:S90C	S	+	2	0	FAM21A	51499455	1.000000	0.71417	1.000000	0.80357	0.807000	0.45602	7.612000	0.82975	1.792000	0.52537	0.194000	0.17425	TCT	.	.		0.358	FAM21A-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000276917.2	NM_001005751	
KIAA1598	57698	hgsc.bcm.edu	37	10	118711419	118711419	+	Splice_Site	SNP	C	C	T			TCGA-2Y-A9GX-01A-11D-A382-10	TCGA-2Y-A9GX-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e1ab7d98-d4e4-47e9-bcbd-a616ec8e29bb	e977b5c2-99d4-4352-b892-10503efd33a7	g.chr10:118711419C>T	ENST00000355371.4	-	6	1032		c.e6+1		KIAA1598_ENST00000260777.10_Splice_Site|KIAA1598_ENST00000497044.1_Splice_Site|KIAA1598_ENST00000392901.4_Splice_Site|KIAA1598_ENST00000392903.2_Splice_Site	NM_001127211.2|NM_001258298.1|NM_001258299.1	NP_001120683.1|NP_001245227.1|NP_001245228.1	A0MZ66	SHOT1_HUMAN	KIAA1598						axon guidance (GO:0007411)|regulation of establishment of cell polarity (GO:2000114)|regulation of neuron migration (GO:2001222)	axonal growth cone (GO:0044295)				endometrium(1)|kidney(1)|large_intestine(5)|lung(3)	10				all cancers(201;0.00494)		GAGATACATACTTCTTCAATT	0.363																																					.		Atlas-SNP	.											.	KIAA1598	74	.	0			c.534+1G>A						.						82.0	74.0	77.0					10																	118711419		2202	4299	6501	SO:0001630	splice_region_variant	57698	exon7			TACATACTTCTTC	BC022348	CCDS31293.1, CCDS44482.1, CCDS58097.1, CCDS73207.1, CCDS73208.1	10q26.12	2007-01-30			ENSG00000187164	ENSG00000187164			29319	protein-coding gene	gene with protein product		611171				10997877, 17030985	Standard	NM_001127211		Approved	shootin1, shootin-1	uc009xyw.4	A0MZ66	OTTHUMG00000019114	ENST00000355371.4:c.534+1G>A	chr10.hg19:g.118711419C>T		115.0	0.0		119.0	14.0	NM_001127211	A8MYU7|B3KRD3|B3KRH2|B3KTE0|B3KTJ7|B3KTJ8|B4E3U1|B7Z7Z9|Q68DG1|Q6PIM5|Q9HCH4|Q9NUV0	Splice_Site	SNP	ENST00000355371.4	hg19	CCDS44482.1	.	.	.	.	.	.	.	.	.	.	C	21.5	4.161118	0.78226	.	.	ENSG00000187164	ENST00000392903;ENST00000260777;ENST00000355371;ENST00000392901	.	.	.	5.69	5.69	0.88448	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.9862	0.89156	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	KIAA1598	118701409	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	5.418000	0.66429	2.682000	0.91365	0.655000	0.94253	.	.	.		0.363	KIAA1598-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_018330	Intron
C10orf90	118611	hgsc.bcm.edu	37	10	128153451	128153451	+	Missense_Mutation	SNP	G	G	A			TCGA-2Y-A9GX-01A-11D-A382-10	TCGA-2Y-A9GX-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e1ab7d98-d4e4-47e9-bcbd-a616ec8e29bb	e977b5c2-99d4-4352-b892-10503efd33a7	g.chr10:128153451G>A	ENST00000284694.7	-	4	1468	c.1348C>T	c.(1348-1350)Ccc>Tcc	p.P450S	C10orf90_ENST00000480379.1_5'Flank|C10orf90_ENST00000356858.3_Missense_Mutation_p.P403S|C10orf90_ENST00000544758.1_Missense_Mutation_p.P547S|C10orf90_ENST00000454341.1_Intron	NM_001004298.2	NP_001004298.2	Q96M02	CJ090_HUMAN	chromosome 10 open reading frame 90	450					mitotic G2 DNA damage checkpoint (GO:0007095)|negative regulation of cell growth (GO:0030308)|protein stabilization (GO:0050821)|response to ionizing radiation (GO:0010212)|response to UV (GO:0009411)	actin cytoskeleton (GO:0015629)|centrosome (GO:0005813)|cytoplasm (GO:0005737)				NS(1)|breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(19)|liver(1)|lung(29)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	65		all_epithelial(44;4.51e-05)|all_lung(145;0.0068)|Lung NSC(174;0.0105)|Colorectal(57;0.0848)|all_neural(114;0.0936)|Breast(234;0.203)		COAD - Colon adenocarcinoma(40;0.0442)|Colorectal(40;0.0479)		TCCCCAATGGGAAGGAAATGT	0.473																																					p.P450S		Atlas-SNP	.											.	C10orf90	121	.	0			c.C1348T						.						115.0	109.0	111.0					10																	128153451		2203	4300	6503	SO:0001583	missense	118611	exon4			CAATGGGAAGGAA	BC034828	CCDS31310.1	10q26.2	2012-05-31			ENSG00000154493	ENSG00000154493			26563	protein-coding gene	gene with protein product	"""fragile-site associated tumor suppressor"""					20843368, 20154723	Standard	NM_001004298		Approved	FLJ32938, bA422P15.2, FATS	uc001ljq.3	Q96M02	OTTHUMG00000019245	ENST00000284694.7:c.1348C>T	chr10.hg19:g.128153451G>A	ENSP00000284694:p.Pro450Ser	126.0	0.0		154.0	8.0	NM_001004298	B9EIQ9|Q5JRP6|Q5T023|Q8NCV5|Q8WU75	Missense_Mutation	SNP	ENST00000284694.7	hg19	CCDS31310.1	.	.	.	.	.	.	.	.	.	.	G	9.752	1.167620	0.21621	.	.	ENSG00000154493	ENST00000356858;ENST00000284694;ENST00000544758;ENST00000432642	T;T;T	0.20200	2.09;2.11;2.09	4.34	3.42	0.39159	.	0.174621	0.27782	N	0.017875	T	0.28366	0.0701	L	0.55481	1.735	0.19775	N	0.99995	D;P	0.53312	0.959;0.705	P;B	0.51615	0.675;0.439	T	0.05209	-1.0899	10	0.44086	T	0.13	-4.2843	10.0054	0.41953	0.0:0.2057:0.7943:0.0	.	547;450	F5GZL2;Q96M02	.;CJ090_HUMAN	S	403;450;547;450	ENSP00000284694:P450S;ENSP00000444369:P547S;ENSP00000405995:P450S	ENSP00000284694:P450S	P	-	1	0	C10orf90	128143441	0.004000	0.15560	0.024000	0.17045	0.131000	0.20780	0.525000	0.22956	1.017000	0.39495	0.637000	0.83480	CCC	.	.		0.473	C10orf90-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001004298	
MMP13	4322	hgsc.bcm.edu	37	11	102824960	102824960	+	Missense_Mutation	SNP	C	C	G			TCGA-2Y-A9GX-01A-11D-A382-10	TCGA-2Y-A9GX-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e1ab7d98-d4e4-47e9-bcbd-a616ec8e29bb	e977b5c2-99d4-4352-b892-10503efd33a7	g.chr11:102824960C>G	ENST00000260302.3	-	4	590	c.562G>C	c.(562-564)Gct>Cct	p.A188P	MMP13_ENST00000340273.4_Missense_Mutation_p.A188P	NM_002427.3	NP_002418.1	P45452	MMP13_HUMAN	matrix metallopeptidase 13 (collagenase 3)	188	Interaction with TIMP2.				bone mineralization (GO:0030282)|bone morphogenesis (GO:0060349)|cartilage development (GO:0051216)|cellular protein metabolic process (GO:0044267)|collagen catabolic process (GO:0030574)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|proteolysis (GO:0006508)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(15)|ovary(2)|skin(1)|stomach(1)	27		all_hematologic(158;0.00092)|Acute lymphoblastic leukemia(157;0.000967)		BRCA - Breast invasive adenocarcinoma(274;0.0144)	Marimastat(DB00786)	GGAGGAAAAGCATGAGCCAGC	0.443																																					p.A188P		Atlas-SNP	.											.	MMP13	75	.	0			c.G562C						.						50.0	51.0	51.0					11																	102824960		2202	4299	6501	SO:0001583	missense	4322	exon4			GAAAAGCATGAGC	X75308	CCDS8324.1	11q22.3	2014-01-30	2005-08-08		ENSG00000137745	ENSG00000137745		"""Endogenous ligands"""	7159	protein-coding gene	gene with protein product	"""collagenase 3"""	600108	"""matrix metalloproteinase 13 (collagenase 3)"""			8207000	Standard	NM_002427		Approved	CLG3	uc001phl.3	P45452	OTTHUMG00000165850	ENST00000260302.3:c.562G>C	chr11.hg19:g.102824960C>G	ENSP00000260302:p.Ala188Pro	245.0	0.0		289.0	36.0	NM_002427	A8K846|B2RCZ3|Q6NWN6	Missense_Mutation	SNP	ENST00000260302.3	hg19	CCDS8324.1	.	.	.	.	.	.	.	.	.	.	C	29.0	4.966339	0.92855	.	.	ENSG00000137745	ENST00000260302;ENST00000546012;ENST00000340273	T;T	0.61980	0.06;0.06	5.88	5.88	0.94601	Peptidase M10, metallopeptidase (1);Peptidase, metallopeptidase (1);Metallopeptidase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.89132	0.6628	H	0.99197	4.465	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.93066	0.6478	10	0.87932	D	0	.	20.2314	0.98350	0.0:1.0:0.0:0.0	.	188	P45452	MMP13_HUMAN	P	188	ENSP00000260302:A188P;ENSP00000339672:A188P	ENSP00000260302:A188P	A	-	1	0	MMP13	102330170	1.000000	0.71417	0.977000	0.42913	0.985000	0.73830	7.445000	0.80570	2.789000	0.95967	0.591000	0.81541	GCT	.	.		0.443	MMP13-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000386648.1	NM_002427	
NCAM1	4684	hgsc.bcm.edu	37	11	113075222	113075222	+	Silent	SNP	C	C	A			TCGA-2Y-A9GX-01A-11D-A382-10	TCGA-2Y-A9GX-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e1ab7d98-d4e4-47e9-bcbd-a616ec8e29bb	e977b5c2-99d4-4352-b892-10503efd33a7	g.chr11:113075222C>A	ENST00000316851.7	+	2	312	c.312C>A	c.(310-312)atC>atA	p.I104I	NCAM1_ENST00000533760.1_5'UTR|NCAM1_ENST00000397957.4_3'UTR|NCAM1_ENST00000401611.2_Silent_p.I113I	NM_001242607.1|NM_181351.4	NP_001229536.1|NP_851996.2	P13591	NCAM1_HUMAN	neural cell adhesion molecule 1	114	Ig-like C2-type 1.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cytokine-mediated signaling pathway (GO:0019221)|extracellular matrix organization (GO:0030198)|interferon-gamma-mediated signaling pathway (GO:0060333)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)			breast(1)|endometrium(3)|kidney(1)|large_intestine(11)|lung(27)|ovary(3)|prostate(2)|upper_aerodigestive_tract(1)	49		all_cancers(61;5.82e-19)|all_epithelial(67;6.87e-12)|Melanoma(852;1.99e-05)|all_hematologic(158;3.66e-05)|Acute lymphoblastic leukemia(157;0.00119)|Breast(348;0.0109)|all_neural(223;0.0299)|Medulloblastoma(222;0.0458)|Renal(330;0.198)|Prostate(24;0.207)		BRCA - Breast invasive adenocarcinoma(274;1.78e-05)|Epithelial(105;0.000114)|all cancers(92;0.000467)|OV - Ovarian serous cystadenocarcinoma(223;0.212)		ACGTGAAGATCTTTCGTAAGA	0.517																																					p.I114I		Atlas-SNP	.											.	NCAM1	372	.	0			c.C342A						.						71.0	75.0	73.0					11																	113075222		2126	4225	6351	SO:0001819	synonymous_variant	4684	exon4			GAAGATCTTTCGT		CCDS73384.1, CCDS73385.1, CCDS73386.1, CCDS73387.1, CCDS73388.1	11q23.2	2013-02-11			ENSG00000149294	ENSG00000149294		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7656	protein-coding gene	gene with protein product		116930					Standard	NM_000615		Approved	NCAM, CD56	uc021qqp.1	P13591	OTTHUMG00000167196	ENST00000316851.7:c.312C>A	chr11.hg19:g.113075222C>A		72.0	0.0		61.0	4.0	NM_001242608	A8K8T8|P13592|P13593|Q05C58|Q15829|Q16180|Q16209|Q59FL7|Q86X47|Q96CJ3	Silent	SNP	ENST00000316851.7	hg19																																																																																				.	.		0.517	NCAM1-201	KNOWN	basic	protein_coding	protein_coding		NM_000615	
SLC6A15	55117	hgsc.bcm.edu	37	12	85267040	85267040	+	Missense_Mutation	SNP	A	A	C			TCGA-2Y-A9GX-01A-11D-A382-10	TCGA-2Y-A9GX-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e1ab7d98-d4e4-47e9-bcbd-a616ec8e29bb	e977b5c2-99d4-4352-b892-10503efd33a7	g.chr12:85267040A>C	ENST00000266682.5	-	7	1476	c.935T>G	c.(934-936)cTg>cGg	p.L312R	SLC6A15_ENST00000551388.1_5'UTR|SLC6A15_ENST00000309283.7_Missense_Mutation_p.L20R|SLC6A15_ENST00000552192.1_Missense_Mutation_p.L205R	NM_182767.5	NP_877499.1	Q9H2J7	S6A15_HUMAN	solute carrier family 6 (neutral amino acid transporter), member 15	312					amino acid transport (GO:0006865)|ion transport (GO:0006811)|leucine transport (GO:0015820)|neurotransmitter transport (GO:0006836)|neutral amino acid transport (GO:0015804)|proline transport (GO:0015824)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	neurotransmitter transporter activity (GO:0005326)|neurotransmitter:sodium symporter activity (GO:0005328)|proline:sodium symporter activity (GO:0005298)			kidney(1)|large_intestine(18)|lung(15)|ovary(1)|pancreas(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)	44						ACCAAATCCCAGACCTAAGGC	0.413																																					p.L312R		Atlas-SNP	.											.	SLC6A15	159	.	0			c.T935G						.						153.0	151.0	152.0					12																	85267040		2203	4300	6503	SO:0001583	missense	55117	exon7			AATCCCAGACCTA	AF265577	CCDS9026.1, CCDS9027.1, CCDS53816.1	12q21.31	2013-07-15	2008-09-02		ENSG00000072041	ENSG00000072041		"""Solute carriers"""	13621	protein-coding gene	gene with protein product	"""homolog of rat orphan transporter v7-3"", ""sodium/chloride dependent neurotransmitter transporter Homo sapiens orphan neurotransmitter transporter NTT7"""	607971	"""solute carrier family 6 (neurotransmitter transporter), member 15"""			10471414, 11112352, 16185194	Standard	NM_182767		Approved	hv7-3, NTT73, FLJ10316, V7-3, SBAT1	uc001szv.4	Q9H2J7	OTTHUMG00000169742	ENST00000266682.5:c.935T>G	chr12.hg19:g.85267040A>C	ENSP00000266682:p.Leu312Arg	295.0	0.0		299.0	28.0	NM_182767	A8K592|B7Z2P7|E7ESJ5|Q9H9F5	Missense_Mutation	SNP	ENST00000266682.5	hg19	CCDS9026.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	28.0|28.0	4.879646|4.879646	0.91740|0.91740	.|.	.|.	ENSG00000072041|ENSG00000072041	ENST00000309283;ENST00000266682;ENST00000318721;ENST00000552192;ENST00000551818;ENST00000551612|ENST00000551388	T;T;T;T|.	0.78707|.	-1.2;-1.2;-1.2;-1.2|.	6.17|6.17	6.17|6.17	0.99709|0.99709	.|.	0.063145|.	0.64402|.	D|.	0.000004|.	D|D	0.87589|0.87589	0.6215|0.6215	H|H	0.95260|0.95260	3.645|3.645	0.80722|0.80722	D|D	1|1	D;D|.	0.89917|.	1.0;1.0|.	D;D|.	0.97110|.	1.0;1.0|.	D|D	0.91020|0.91020	0.4856|0.4856	10|6	0.72032|0.87932	D|D	0.01|0	.|.	16.8222|16.8222	0.85835|0.85835	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	20;312|.	F8WJN6;Q9H2J7|.	.;S6A15_HUMAN|.	R|G	20;312;28;205;20;28|7	ENSP00000311645:L20R;ENSP00000266682:L312R;ENSP00000450145:L205R;ENSP00000449263:L28R|.	ENSP00000266682:L312R|ENSP00000449619:W7G	L|W	-|-	2|1	0|0	SLC6A15|SLC6A15	83791171|83791171	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.994000|0.994000	0.84299|0.84299	8.962000|8.962000	0.93254|0.93254	2.371000|2.371000	0.80710|0.80710	0.533000|0.533000	0.62120|0.62120	CTG|TGG	.	.		0.413	SLC6A15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405678.1	NM_018057, NM_182767	
WSCD2	9671	hgsc.bcm.edu	37	12	108603913	108603913	+	Silent	SNP	C	C	T			TCGA-2Y-A9GX-01A-11D-A382-10	TCGA-2Y-A9GX-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e1ab7d98-d4e4-47e9-bcbd-a616ec8e29bb	e977b5c2-99d4-4352-b892-10503efd33a7	g.chr12:108603913C>T	ENST00000332082.4	+	5	1331	c.513C>T	c.(511-513)ggC>ggT	p.G171G	WSCD2_ENST00000261400.3_Silent_p.G171G|WSCD2_ENST00000547525.1_Silent_p.G171G|WSCD2_ENST00000549903.1_Silent_p.G171G			Q2TBF2	WSCD2_HUMAN	WSC domain containing 2	171	WSC 1. {ECO:0000255|PROSITE- ProRule:PRU00558}.					integral component of membrane (GO:0016021)		p.G171G(1)		breast(4)|endometrium(3)|kidney(1)|large_intestine(16)|liver(2)|lung(23)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	57						ACCTGTATGGCGGGCTGGAGT	0.647																																					p.G171G		Atlas-SNP	.											WSCD2,colon,carcinoma,0,1	WSCD2	125	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C513T						.						28.0	32.0	31.0					12																	108603913		2144	4254	6398	SO:0001819	synonymous_variant	9671	exon4			GTATGGCGGGCTG		CCDS41828.1	12q23.3	2008-02-05				ENSG00000075035			29117	protein-coding gene	gene with protein product							Standard	NM_014653		Approved	KIAA0789	uc001tms.3	Q2TBF2		ENST00000332082.4:c.513C>T	chr12.hg19:g.108603913C>T		121.0	1.0		99.0	11.0	NM_014653	B2RN48|B4DES1|Q8IY35|Q9Y4B7	Silent	SNP	ENST00000332082.4	hg19	CCDS41828.1																																																																																			.	.		0.647	WSCD2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405554.1	NM_014653	
MESP2	145873	hgsc.bcm.edu	37	15	90320134	90320134	+	Silent	SNP	A	A	G	rs56192595|rs200021459|rs199821487	byFrequency	TCGA-2Y-A9GX-01A-11D-A382-10	TCGA-2Y-A9GX-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e1ab7d98-d4e4-47e9-bcbd-a616ec8e29bb	e977b5c2-99d4-4352-b892-10503efd33a7	g.chr15:90320134A>G	ENST00000341735.3	+	1	546	c.546A>G	c.(544-546)caA>caG	p.Q182Q	MESP2_ENST00000558723.1_Intron|MESP2_ENST00000560219.1_Intron	NM_001039958.1	NP_001035047.1	Q0VG99	MESP2_HUMAN	mesoderm posterior basic helix-loop-helix transcription factor 2	182	13 X 2 AA tandem repeats of G-Q.				mesodermal cell migration (GO:0008078)|Notch signaling pathway (GO:0007219)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|signal transduction involved in regulation of gene expression (GO:0023019)|somite rostral/caudal axis specification (GO:0032525)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.Q198_G205delQGQGQGQG(1)		kidney(1)|large_intestine(2)|lung(1)|skin(1)|upper_aerodigestive_tract(1)	6	Lung NSC(78;0.0221)|all_lung(78;0.0448)		BRCA - Breast invasive adenocarcinoma(143;0.0146)|KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)			ggcaggggcaagggcaggggc	0.786																																					p.Q182Q		Atlas-SNP	.											MESP2,NS,carcinoma,0,1	MESP2	20	.	1	Deletion - In frame(1)	upper_aerodigestive_tract(1)	c.A546G						.						3.0	3.0	3.0					15																	90320134		1211	2942	4153	SO:0001819	synonymous_variant	145873	exon1			GGGGCAAGGGCAG		CCDS42078.1	15q26.1	2014-06-30	2014-06-30			ENSG00000188095		"""Basic helix-loop-helix proteins"""	29659	protein-coding gene	gene with protein product		605195	"""mesoderm posterior 2 homolog (mouse)"""			11578861	Standard	NM_001039958		Approved	SCDO2, bHLHc6	uc002bon.3	Q0VG99		ENST00000341735.3:c.546A>G	chr15.hg19:g.90320134A>G		13.0	1.0		44.0	6.0	NM_001039958	Q7RTU2	Silent	SNP	ENST00000341735.3	hg19	CCDS42078.1																																																																																			.	.		0.786	MESP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416421.1	XM_085261	
ZCCHC14	23174	hgsc.bcm.edu	37	16	87445309	87445309	+	Silent	SNP	C	C	A			TCGA-2Y-A9GX-01A-11D-A382-10	TCGA-2Y-A9GX-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e1ab7d98-d4e4-47e9-bcbd-a616ec8e29bb	e977b5c2-99d4-4352-b892-10503efd33a7	g.chr16:87445309C>A	ENST00000268616.4	-	12	2824	c.2607G>T	c.(2605-2607)acG>acT	p.T869T		NM_015144.2	NP_055959.1	Q8WYQ9	ZCH14_HUMAN	zinc finger, CCHC domain containing 14	869							nucleic acid binding (GO:0003676)|phosphatidylinositol binding (GO:0035091)|zinc ion binding (GO:0008270)			breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(5)|lung(10)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	36				BRCA - Breast invasive adenocarcinoma(80;0.0285)		GCACGGCAAACGTGGACTGCC	0.627																																					p.T869T		Atlas-SNP	.											.	ZCCHC14	87	.	0			c.G2607T						.						56.0	47.0	50.0					16																	87445309		2198	4300	6498	SO:0001819	synonymous_variant	23174	exon12			GGCAAACGTGGAC	AB011151	CCDS10961.1	16q24.2	2013-01-10			ENSG00000140948	ENSG00000140948		"""Zinc fingers, CCHC domain containing"", ""Sterile alpha motif (SAM) domain containing"""	24134	protein-coding gene	gene with protein product						9628581	Standard	XM_005255858		Approved	BDG29, MGC14139	uc002fjz.1	Q8WYQ9	OTTHUMG00000137655	ENST00000268616.4:c.2607G>T	chr16.hg19:g.87445309C>A		50.0	0.0		68.0	9.0	NM_015144	D3DUN1|O60324|Q3MJD8|Q9UFP0	Silent	SNP	ENST00000268616.4	hg19	CCDS10961.1																																																																																			.	.		0.627	ZCCHC14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269107.1	NM_015144	
RNF135	84282	hgsc.bcm.edu	37	17	29325716	29325716	+	Missense_Mutation	SNP	C	C	T			TCGA-2Y-A9GX-01A-11D-A382-10	TCGA-2Y-A9GX-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e1ab7d98-d4e4-47e9-bcbd-a616ec8e29bb	e977b5c2-99d4-4352-b892-10503efd33a7	g.chr17:29325716C>T	ENST00000328381.5	+	5	1679	c.806C>T	c.(805-807)tCc>tTc	p.S269F	RNF135_ENST00000443677.2_3'UTR|RNF135_ENST00000535306.2_3'UTR|RNF135_ENST00000324689.4_3'UTR	NM_032322.3	NP_115698.3	Q8IUD6	RN135_HUMAN	ring finger protein 135	269	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				innate immune response (GO:0045087)|negative regulation of type I interferon production (GO:0032480)|positive regulation of interferon-beta production (GO:0032728)|protein ubiquitination (GO:0016567)|regulation of innate immune response (GO:0045088)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	ligase activity (GO:0016874)|ribonucleoprotein complex binding (GO:0043021)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.?(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(2)|lung(1)|skin(2)|urinary_tract(1)	10		all_cancers(10;8.65e-08)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Myeloproliferative disorder(56;0.0255)				AAGAGCCTTTCCTGCAGCCTG	0.493																																					p.S269F		Atlas-SNP	.											.	RNF135	19	.	1	Unknown(1)	central_nervous_system(1)	c.C806T						.						98.0	101.0	100.0					17																	29325716		2203	4300	6503	SO:0001583	missense	84282	exon5			GCCTTTCCTGCAG	AJ496729	CCDS11262.1, CCDS11263.1, CCDS54104.1	17q11.2	2013-01-09			ENSG00000181481	ENSG00000181481		"""RING-type (C3HC4) zinc fingers"""	21158	protein-coding gene	gene with protein product	"""riplet"""	611358				11468690, 19017631	Standard	NM_001184992		Approved	MGC13061	uc002hfz.3	Q8IUD6	OTTHUMG00000132867	ENST00000328381.5:c.806C>T	chr17.hg19:g.29325716C>T	ENSP00000328340:p.Ser269Phe	108.0	0.0		128.0	14.0	NM_032322	A0AVM5|B2R7G9|B6ZLM5|F5GX60|Q9BSE9	Missense_Mutation	SNP	ENST00000328381.5	hg19	CCDS11262.1	.	.	.	.	.	.	.	.	.	.	C	16.72	3.202202	0.58234	.	.	ENSG00000181481	ENST00000328381;ENST00000535605	T	0.62941	-0.01	4.93	2.84	0.33178	Concanavalin A-like lectin/glucanase (1);SPRY-associated (1);B30.2/SPRY domain (1);	0.194775	0.25686	N	0.028975	T	0.75095	0.3803	M	0.70595	2.14	0.27650	N	0.94742	D	0.76494	0.999	D	0.67231	0.95	T	0.69760	-0.5058	10	0.62326	D	0.03	-8.2189	13.1279	0.59366	0.0:0.5276:0.4724:0.0	.	269	Q8IUD6	RN135_HUMAN	F	269;88	ENSP00000328340:S269F	ENSP00000328340:S269F	S	+	2	0	RNF135	26349842	0.001000	0.12720	0.037000	0.18230	0.174000	0.22865	0.918000	0.28678	0.546000	0.28920	0.563000	0.77884	TCC	.	.		0.493	RNF135-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256342.3	NM_032322	
CDC27	996	hgsc.bcm.edu	37	17	45216246	45216246	+	Missense_Mutation	SNP	T	T	C	rs199551316		TCGA-2Y-A9GX-01A-11D-A382-10	TCGA-2Y-A9GX-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e1ab7d98-d4e4-47e9-bcbd-a616ec8e29bb	e977b5c2-99d4-4352-b892-10503efd33a7	g.chr17:45216246T>C	ENST00000066544.3	-	13	1656	c.1563A>G	c.(1561-1563)atA>atG	p.I521M	CDC27_ENST00000446365.2_Missense_Mutation_p.I460M|CDC27_ENST00000531206.1_Missense_Mutation_p.I527M|CDC27_ENST00000527547.1_Missense_Mutation_p.I520M	NM_001114091.1|NM_001256.3	NP_001107563.1|NP_001247.3	P30260	CDC27_HUMAN	cell division cycle 27	521					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cell proliferation (GO:0008283)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cell cycle (GO:0000278)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	protein phosphatase binding (GO:0019903)			NS(1)|breast(5)|central_nervous_system(3)|cervix(1)|endometrium(2)|kidney(17)|large_intestine(18)|lung(11)|ovary(5)|pancreas(1)|prostate(19)|skin(5)|upper_aerodigestive_tract(2)	90						CCTCTGAGAATATTCTTTCAG	0.343																																					p.I527M		Atlas-SNP	.											.	CDC27	337	.	0			c.A1581G						.						26.0	30.0	29.0					17																	45216246		2179	4283	6462	SO:0001583	missense	996	exon13			TGAGAATATTCTT	U00001	CCDS11509.1, CCDS45720.1, CCDS74090.1	17q21.32	2013-01-17	2013-01-17		ENSG00000004897	ENSG00000004897		"""Anaphase promoting complex subunits"", ""Tetratricopeptide (TTC) repeat domain containing"""	1728	protein-coding gene	gene with protein product	"""anaphase promoting complex subunit 3"""	116946	"""cell division cycle 27"", ""cell division cycle 27 homolog (S. cerevisiae)"""	D0S1430E, D17S978E		8234252	Standard	XM_005257892		Approved	APC3, ANAPC3, NUC2	uc002ile.4	P30260	OTTHUMG00000166429	ENST00000066544.3:c.1563A>G	chr17.hg19:g.45216246T>C	ENSP00000066544:p.Ile521Met	46.0	0.0		54.0	12.0	NM_001114091	G3V1C4|Q16349|Q96F35	Missense_Mutation	SNP	ENST00000066544.3	hg19	CCDS11509.1	.	.	.	.	.	.	.	.	.	.	T	14.67	2.603451	0.46423	.	.	ENSG00000004897	ENST00000066544;ENST00000531206;ENST00000446365;ENST00000527547	T;T;T;T	0.74315	-0.83;-0.83;-0.83;-0.83	5.22	2.78	0.32641	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.176402	0.53938	D	0.000051	T	0.67822	0.2934	L	0.57536	1.79	0.50313	D	0.999864	P;P;P;B	0.40266	0.71;0.624;0.624;0.306	B;B;B;B	0.42112	0.284;0.376;0.376;0.22	T	0.67987	-0.5528	10	0.48119	T	0.1	-1.4205	5.5829	0.17260	0.0:0.0929:0.2737:0.6334	.	460;520;527;521	B4DL80;G5EA36;G3V1C4;P30260	.;.;.;CDC27_HUMAN	M	521;527;460;520	ENSP00000066544:I521M;ENSP00000434614:I527M;ENSP00000392802:I460M;ENSP00000437339:I520M	ENSP00000066544:I521M	I	-	3	3	CDC27	42571245	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.459000	0.35234	1.972000	0.57404	0.528000	0.53228	ATA	.	.		0.343	CDC27-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000389742.2		
ADNP2	22850	hgsc.bcm.edu	37	18	77895930	77895930	+	Silent	SNP	C	C	T			TCGA-2Y-A9GX-01A-11D-A382-10	TCGA-2Y-A9GX-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e1ab7d98-d4e4-47e9-bcbd-a616ec8e29bb	e977b5c2-99d4-4352-b892-10503efd33a7	g.chr18:77895930C>T	ENST00000262198.4	+	4	3089	c.2634C>T	c.(2632-2634)ccC>ccT	p.P878P		NM_014913.3	NP_055728.1	Q6IQ32	ADNP2_HUMAN	ADNP homeobox 2	878					cellular response to oxidative stress (GO:0034599)|cellular response to retinoic acid (GO:0071300)|negative regulation of cell death (GO:0060548)|neuron differentiation (GO:0030182)|positive regulation of cell growth (GO:0030307)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(9)|liver(1)|lung(15)|ovary(5)|prostate(2)	42		all_cancers(4;1.06e-15)|all_epithelial(4;2.36e-10)|all_lung(4;0.000302)|Lung NSC(4;0.000518)|Esophageal squamous(42;0.0212)|Ovarian(4;0.0256)|all_hematologic(56;0.15)|Melanoma(33;0.2)		Epithelial(2;1.1e-11)|OV - Ovarian serous cystadenocarcinoma(15;7.54e-09)|BRCA - Breast invasive adenocarcinoma(31;0.00247)|STAD - Stomach adenocarcinoma(84;0.164)		CCACCTGCCCCTTTTGCTTTG	0.592																																					p.P878P		Atlas-SNP	.											.	ADNP2	102	.	0			c.C2634T						.						67.0	68.0	68.0					18																	77895930		2203	4300	6503	SO:0001819	synonymous_variant	22850	exon4			CTGCCCCTTTTGC	AB020670	CCDS32853.1	18q23	2013-01-07	2007-07-17	2007-07-17	ENSG00000101544	ENSG00000101544		"""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	23803	protein-coding gene	gene with protein product			"""zinc finger protein 508"""	ZNF508			Standard	NM_014913		Approved	KIAA0863	uc002lnw.3	Q6IQ32	OTTHUMG00000172535	ENST00000262198.4:c.2634C>T	chr18.hg19:g.77895930C>T		52.0	0.0		46.0	4.0	NM_014913	A8K951|O94943|Q9H9P3	Silent	SNP	ENST00000262198.4	hg19	CCDS32853.1																																																																																			.	.		0.592	ADNP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418979.1	NM_014913	
SYT3	84258	hgsc.bcm.edu	37	19	51129192	51129192	+	Missense_Mutation	SNP	G	G	T			TCGA-2Y-A9GX-01A-11D-A382-10	TCGA-2Y-A9GX-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e1ab7d98-d4e4-47e9-bcbd-a616ec8e29bb	e977b5c2-99d4-4352-b892-10503efd33a7	g.chr19:51129192G>T	ENST00000338916.4	-	5	1997	c.1364C>A	c.(1363-1365)gCc>gAc	p.A455D	SYT3_ENST00000544769.1_Missense_Mutation_p.A455D|SYT3_ENST00000600079.1_Missense_Mutation_p.A455D|SYT3_ENST00000593901.1_Missense_Mutation_p.A455D	NM_032298.2	NP_115674.1	Q9BQG1	SYT3_HUMAN	synaptotagmin III	455	C2 2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				calcium ion-dependent exocytosis (GO:0017156)|positive regulation of vesicle fusion (GO:0031340)|response to calcium ion (GO:0051592)	cell junction (GO:0030054)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|synaptic vesicle (GO:0008021)	calcium-dependent phospholipid binding (GO:0005544)|metal ion binding (GO:0046872)|phosphatidylserine binding (GO:0001786)|transporter activity (GO:0005215)			breast(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(16)|ovary(2)|prostate(2)|skin(3)|urinary_tract(2)	35		all_neural(266;0.131)		OV - Ovarian serous cystadenocarcinoma(262;0.00462)|GBM - Glioblastoma multiforme(134;0.0188)		GAGGTTAGAGGCTTTGATGAT	0.602																																					p.A455D		Atlas-SNP	.											.	SYT3	85	.	0			c.C1364A						.						87.0	75.0	79.0					19																	51129192		2203	4300	6503	SO:0001583	missense	84258	exon5			TTAGAGGCTTTGA	AL136594	CCDS12798.1	19q13.33	2014-07-02			ENSG00000213023	ENSG00000213023		"""Synaptotagmins"""	11511	protein-coding gene	gene with protein product		600327				7749232	Standard	NM_032298		Approved		uc002psv.3	Q9BQG1	OTTHUMG00000183064	ENST00000338916.4:c.1364C>A	chr19.hg19:g.51129192G>T	ENSP00000340914:p.Ala455Asp	94.0	0.0		113.0	5.0	NM_032298	Q8N5Z1|Q8N640	Missense_Mutation	SNP	ENST00000338916.4	hg19	CCDS12798.1	.	.	.	.	.	.	.	.	.	.	G	22.7	4.328003	0.81690	.	.	ENSG00000213023	ENST00000338916;ENST00000544769	D;D	0.82984	-1.67;-1.67	4.13	4.13	0.48395	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.089261	0.42964	U	0.000638	D	0.94739	0.8302	H	0.99026	4.405	0.58432	D	0.999995	D	0.65815	0.995	D	0.76071	0.987	D	0.97015	0.9739	10	0.87932	D	0	.	15.5391	0.76027	0.0:0.0:1.0:0.0	.	455	Q9BQG1	SYT3_HUMAN	D	455	ENSP00000340914:A455D;ENSP00000438883:A455D	ENSP00000340914:A455D	A	-	2	0	SYT3	55821004	0.505000	0.26131	1.000000	0.80357	0.997000	0.91878	1.991000	0.40727	2.044000	0.60594	0.555000	0.69702	GCC	.	.		0.602	SYT3-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464910.1	NM_032298	
KRTAP27-1	643812	hgsc.bcm.edu	37	21	31709461	31709461	+	Missense_Mutation	SNP	G	G	T			TCGA-2Y-A9GX-01A-11D-A382-10	TCGA-2Y-A9GX-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e1ab7d98-d4e4-47e9-bcbd-a616ec8e29bb	e977b5c2-99d4-4352-b892-10503efd33a7	g.chr21:31709461G>T	ENST00000382835.2	-	1	551	c.526C>A	c.(526-528)Ctg>Atg	p.L176M		NM_001077711.1	NP_001071179.1	Q3LI81	KR271_HUMAN	keratin associated protein 27-1	176						intermediate filament (GO:0005882)				endometrium(2)|large_intestine(3)|lung(9)|ovary(2)|prostate(1)|skin(1)	18						ACATTGACCAGAGGTCTACAG	0.458																																					p.L176M		Atlas-SNP	.											KRTAP27-1,NS,carcinoma,0,1	KRTAP27-1	53	.	0			c.C526A						.						106.0	102.0	103.0					21																	31709461		2203	4300	6503	SO:0001583	missense	643812	exon1			TGACCAGAGGTCT	AB096937	CCDS33532.1	21q22.11	2007-11-23			ENSG00000206107	ENSG00000206107		"""Keratin associated proteins"""	33864	protein-coding gene	gene with protein product							Standard	NM_001077711		Approved		uc002ynx.1	Q3LI81	OTTHUMG00000059577	ENST00000382835.2:c.526C>A	chr21.hg19:g.31709461G>T	ENSP00000372286:p.Leu176Met	127.0	0.0		109.0	6.0	NM_001077711		Missense_Mutation	SNP	ENST00000382835.2	hg19	CCDS33532.1	.	.	.	.	.	.	.	.	.	.	G	9.967	1.224474	0.22457	.	.	ENSG00000206107	ENST00000382835	T	0.03272	3.99	4.17	-4.38	0.03622	.	1.199530	0.06361	N	0.711660	T	0.03783	0.0107	L	0.50333	1.59	0.09310	N	1	P	0.47409	0.895	B	0.42771	0.397	T	0.29761	-1.0001	10	0.34782	T	0.22	0.1228	1.841	0.03150	0.3244:0.1436:0.3894:0.1426	.	176	Q3LI81	KR271_HUMAN	M	176	ENSP00000372286:L176M	ENSP00000372286:L176M	L	-	1	2	KRTAP27-1	30631332	0.000000	0.05858	0.000000	0.03702	0.332000	0.28634	-0.923000	0.04000	-0.736000	0.04831	-0.482000	0.04802	CTG	.	.		0.458	KRTAP27-1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000132470.3	NM_001077711	
TCF20	6942	hgsc.bcm.edu	37	22	42607813	42607813	+	Missense_Mutation	SNP	T	T	C			TCGA-2Y-A9GX-01A-11D-A382-10	TCGA-2Y-A9GX-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e1ab7d98-d4e4-47e9-bcbd-a616ec8e29bb	e977b5c2-99d4-4352-b892-10503efd33a7	g.chr22:42607813T>C	ENST00000359486.3	-	1	3635	c.3499A>G	c.(3499-3501)Agt>Ggt	p.S1167G	TCF20_ENST00000335626.4_Missense_Mutation_p.S1167G|TCF20_ENST00000404876.1_5'Flank	NM_005650.1	NP_005641.1	Q9UGU0	TCF20_HUMAN	transcription factor 20 (AR1)	1167					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(7)|large_intestine(13)|lung(22)|ovary(5)|prostate(1)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(5)	66						AGACCATCACTAGACATTAGG	0.507																																					p.S1167G		Atlas-SNP	.											.	TCF20	164	.	0			c.A3499G						.						73.0	70.0	71.0					22																	42607813		2203	4300	6503	SO:0001583	missense	6942	exon1			CATCACTAGACAT	U19345	CCDS14032.1, CCDS14033.1	22q13.3	2011-02-08			ENSG00000100207	ENSG00000100207			11631	protein-coding gene	gene with protein product	"""stromelysin-1 platelet-derived growth factor-responsive element binding protein"""	603107				9730594, 10995766	Standard	NM_005650		Approved	AR1, SPBP	uc003bcj.1	Q9UGU0	OTTHUMG00000150920	ENST00000359486.3:c.3499A>G	chr22.hg19:g.42607813T>C	ENSP00000352463:p.Ser1167Gly	83.0	0.0		104.0	13.0	NM_181492	A9JX12|O14528|Q13078|Q4V353|Q9H4M0	Missense_Mutation	SNP	ENST00000359486.3	hg19	CCDS14033.1	.	.	.	.	.	.	.	.	.	.	T	6.392	0.440410	0.12104	.	.	ENSG00000100207	ENST00000359486;ENST00000335626	T;T	0.59083	0.29;0.29	5.53	0.912	0.19349	.	0.270733	0.37437	N	0.002100	T	0.28499	0.0705	N	0.08118	0	0.25551	N	0.987084	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.12941	-1.0528	10	0.18276	T	0.48	-3.3979	5.425	0.16421	0.0:0.3002:0.1384:0.5614	.	1167;1167	Q9UGU0-2;Q9UGU0	.;TCF20_HUMAN	G	1167	ENSP00000352463:S1167G;ENSP00000335561:S1167G	ENSP00000335561:S1167G	S	-	1	0	TCF20	40937757	0.001000	0.12720	0.513000	0.27749	0.861000	0.49209	0.086000	0.14935	-0.064000	0.13043	0.533000	0.62120	AGT	.	.		0.507	TCF20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320531.1	NM_181492	
KCNE1L	23630	hgsc.bcm.edu	37	X	108868238	108868238	+	Silent	SNP	G	G	A			TCGA-2Y-A9GX-01A-11D-A382-10	TCGA-2Y-A9GX-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e1ab7d98-d4e4-47e9-bcbd-a616ec8e29bb	e977b5c2-99d4-4352-b892-10503efd33a7	g.chrX:108868238G>A	ENST00000372101.2	-	1	155	c.12C>T	c.(10-12)agC>agT	p.S4S		NM_012282.2	NP_036414.1	Q9UJ90	KCE1L_HUMAN	KCNE1-like	4					atrial cardiac muscle cell action potential (GO:0086014)|cardiac muscle contraction (GO:0060048)|membrane repolarization during cardiac muscle cell action potential (GO:0086013)|negative regulation of potassium ion transmembrane transport (GO:1901380)|positive regulation of potassium ion transmembrane transport (GO:1901381)|potassium ion export (GO:0071435)|potassium ion transmembrane transport (GO:0071805)|regulation of atrial cardiac muscle cell membrane repolarization (GO:0060372)|regulation of cation channel activity (GO:2001257)|regulation of heart contraction (GO:0008016)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of membrane repolarization (GO:0060306)|regulation of potassium ion transmembrane transport (GO:1901379)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|ventricular cardiac muscle cell action potential (GO:0086005)	voltage-gated potassium channel complex (GO:0008076)	ion channel binding (GO:0044325)|potassium channel regulator activity (GO:0015459)			endometrium(1)|kidney(1)|large_intestine(2)|lung(2)	6						GCTGGCTCTCGCTGCAGTTCA	0.697																																					p.S4S		Atlas-SNP	.											.	KCNE1L	8	.	0			c.C12T						.						7.0	8.0	8.0					X																	108868238		2135	4173	6308	SO:0001819	synonymous_variant	23630	exon1			GCTCTCGCTGCAG	AJ012743	CCDS14547.1	Xq22.3	2008-02-05	2004-06-09		ENSG00000176076	ENSG00000176076		"""Potassium channels"""	6241	protein-coding gene	gene with protein product		300328	"""potassium voltage-gated channel, Isk-related family, member 1-like"""			10493825	Standard	NM_012282		Approved		uc004eoh.3	Q9UJ90	OTTHUMG00000022189	ENST00000372101.2:c.12C>T	chrX.hg19:g.108868238G>A		58.0	0.0		68.0	19.0	NM_012282		Silent	SNP	ENST00000372101.2	hg19	CCDS14547.1																																																																																			.	.		0.697	KCNE1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057892.1	NM_012282	
ELMSAN1	91748	hgsc.bcm.edu	37	14	74196641	74196641	+	Frame_Shift_Del	DEL	T	T	-			TCGA-2Y-A9GX-01A-11D-A382-10	TCGA-2Y-A9GX-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e1ab7d98-d4e4-47e9-bcbd-a616ec8e29bb	e977b5c2-99d4-4352-b892-10503efd33a7	g.chr14:74196641delT	ENST00000286523.5	-	4	2579	c.1797delA	c.(1795-1797)aaafs	p.K599fs	ELMSAN1_ENST00000394071.2_Frame_Shift_Del_p.K599fs	NM_194278.3	NP_919254.2	Q6PJG2	EMSA1_HUMAN	ELM2 and Myb/SANT-like domain containing 1	599					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)										GCTGCTTTGGTTTCCGCACGG	0.607																																					p.P600fs		Atlas-INDEL	.											.	.	.	.	0			c.1798delC						.						46.0	45.0	45.0					14																	74196641		2203	4300	6503	SO:0001589	frameshift_variant	91748	exon4			.	BF971739	CCDS9819.1	14q24.3	2012-09-25	2012-09-25	2012-09-25	ENSG00000156030	ENSG00000156030			19853	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 117"", ""chromosome 14 open reading frame 43"""	C14orf117, C14orf43			Standard	NM_194278		Approved	LSR68	uc001xou.3	Q6PJG2	OTTHUMG00000150359	ENST00000286523.5:c.1797delA	chr14.hg19:g.74196641delT	ENSP00000286523:p.Lys599fs	61.0	0.0		59.0	10.0	NM_194278	Q6PK13|Q6PK59|Q6ZS23	Frame_Shift_Del	DEL	ENST00000286523.5	hg19	CCDS9819.1																																																																																			.	.		0.607	ELMSAN1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317793.1	NM_194278	
SORL1	6653	hgsc.bcm.edu	37	11	121384869	121384869	+	Frame_Shift_Del	DEL	C	C	-			TCGA-2Y-A9GX-01A-11D-A382-10	TCGA-2Y-A9GX-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e1ab7d98-d4e4-47e9-bcbd-a616ec8e29bb	e977b5c2-99d4-4352-b892-10503efd33a7	g.chr11:121384869delC	ENST00000260197.7	+	8	1179	c.1050delC	c.(1048-1050)tacfs	p.Y350fs	SORL1_ENST00000532451.1_3'UTR	NM_003105.5	NP_003096	Q92673	SORL_HUMAN	sortilin-related receptor, L(DLR class) A repeats containing	350					cell death (GO:0008219)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cholesterol metabolic process (GO:0008203)|lipid transport (GO:0006869)|negative regulation of aspartic-type endopeptidase activity involved in amyloid precursor protein catabolic process (GO:1902960)|negative regulation of beta-amyloid formation (GO:1902430)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of metalloendopeptidase activity involved in amyloid precursor protein catabolic process (GO:1902963)|negative regulation of neurofibrillary tangle assembly (GO:1902997)|negative regulation of neurogenesis (GO:0050768)|negative regulation of neuron death (GO:1901215)|negative regulation of protein binding (GO:0032091)|negative regulation of protein oligomerization (GO:0032460)|negative regulation of tau-protein kinase activity (GO:1902948)|positive regulation of choline O-acetyltransferase activity (GO:1902771)|positive regulation of early endosome to recycling endosome transport (GO:1902955)|positive regulation of endocytic recycling (GO:2001137)|positive regulation of ER to Golgi vesicle-mediated transport (GO:1902953)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein exit from endoplasmic reticulum (GO:0070863)|positive regulation of protein localization to early endosome (GO:1902966)|post-Golgi vesicle-mediated transport (GO:0006892)|protein maturation (GO:0051604)|protein retention in Golgi apparatus (GO:0045053)|protein targeting (GO:0006605)|protein targeting to Golgi (GO:0000042)|protein targeting to lysosome (GO:0006622)|receptor-mediated endocytosis (GO:0006898)|regulation of smooth muscle cell migration (GO:0014910)|signal transduction (GO:0007165)	early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi cisterna (GO:0031985)|integral component of plasma membrane (GO:0005887)|low-density lipoprotein particle (GO:0034362)|membrane (GO:0016020)|multivesicular body (GO:0005771)|neuronal cell body (GO:0043025)|nuclear envelope lumen (GO:0005641)|recycling endosome (GO:0055037)|trans-Golgi network (GO:0005802)	ADP-ribosylation factor binding (GO:0030306)|beta-amyloid binding (GO:0001540)|low-density lipoprotein particle binding (GO:0030169)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(5)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|liver(2)|lung(34)|ovary(5)|pancreas(1)|skin(12)|stomach(2)|upper_aerodigestive_tract(2)	91		Breast(109;0.00119)|Medulloblastoma(222;0.0429)|all_neural(223;0.113)		BRCA - Breast invasive adenocarcinoma(274;3.34e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.108)		AGGAATATTACATCGCAGATG	0.438																																					p.Y350fs		Atlas-Indel,Pindel	.											.	SORL1	218	.	0			c.1049delA						.						97.0	95.0	96.0					11																	121384869		2203	4299	6502	SO:0001589	frameshift_variant	6653	exon8			.	Y08110	CCDS8436.1	11q23.2-q24.4	2014-06-05	2011-01-25		ENSG00000137642	ENSG00000137642		"""Fibronectin type III domain containing"""	11185	protein-coding gene	gene with protein product	"""LDLR relative with 11 ligand-binding repeats"""	602005	"""chromosome 11 open reading frame 32"", ""sortilin-related receptor, L(DLR class) A repeats-containing"""	C11orf32		9157966, 8940146	Standard	NM_003105		Approved	gp250, LR11, LRP9, SorLA, SorLA-1	uc001pxx.3	Q92673	OTTHUMG00000166057	ENST00000260197.7:c.1050delC	chr11.hg19:g.121384869delC	ENSP00000260197:p.Tyr350fs	91.0	0.0		103.0	16.0	NM_003105	B2RNX7|Q92856	Frame_Shift_Del	DEL	ENST00000260197.7	hg19	CCDS8436.1																																																																																			.	.		0.438	SORL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387626.2	NM_003105	
KRTAP5-4	387267	hgsc.bcm.edu	37	11	1643035	1643035	+	Frame_Shift_Del	DEL	A	A	-			TCGA-2Y-A9GX-01A-11D-A382-10	TCGA-2Y-A9GX-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e1ab7d98-d4e4-47e9-bcbd-a616ec8e29bb	e977b5c2-99d4-4352-b892-10503efd33a7	g.chr11:1643035delA	ENST00000399682.1	-	1	333	c.289delT	c.(289-291)tccfs	p.S97fs		NM_001012709.1	NP_001012727	Q6L8H1	KRA54_HUMAN	keratin associated protein 5-4	0	9 X 4 AA repeats of C-C-X-P.					keratin filament (GO:0045095)				NS(1)|endometrium(9)|kidney(2)|lung(2)|pancreas(1)|prostate(3)|skin(2)	20		all_epithelial(84;0.00819)|Breast(177;0.00832)|Ovarian(85;0.0256)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		BRCA - Breast invasive adenocarcinoma(625;0.000614)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		CCCCCCTTGGAACCCCCACAG	0.687																																					p.S97fs		Atlas-INDEL	.											.	KRTAP5-4	78	.	0			c.290delC						.						6.0	11.0	10.0					11																	1643035		647	1524	2171	SO:0001589	frameshift_variant	387267	exon1			.	AB126073		11p15.5	2012-04-19			ENSG00000241598	ENSG00000241598		"""Keratin associated proteins"""	23599	protein-coding gene	gene with protein product						15144888	Standard	NM_001012709		Approved	KRTAP5.4	uc009ycy.1	Q6L8H1	OTTHUMG00000057553	ENST00000399682.1:c.289delT	chr11.hg19:g.1643035delA	ENSP00000382590:p.Ser97fs	244.0	0.0		206.0	16.0	NM_001012709		Frame_Shift_Del	DEL	ENST00000399682.1	hg19																																																																																				.	.		0.687	KRTAP5-4-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000127918.1	NM_001012709	
PCDHGC4	56098	hgsc.bcm.edu	37	5	140867041	140867041	+	Frame_Shift_Del	DEL	C	C	-			TCGA-2Y-A9GX-01A-11D-A382-10	TCGA-2Y-A9GX-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e1ab7d98-d4e4-47e9-bcbd-a616ec8e29bb	e977b5c2-99d4-4352-b892-10503efd33a7	g.chr5:140867041delC	ENST00000306593.1	+	1	2301	c.2301delC	c.(2299-2301)ggcfs	p.G767fs	PCDHGA11_ENST00000398587.2_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB7_ENST00000398594.2_Intron|PCDHGA12_ENST00000252085.3_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGB6_ENST00000520790.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA10_ENST00000398610.2_Intron|PCDHGC3_ENST00000308177.3_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGC5_ENST00000252087.1_5'Flank|PCDHGB3_ENST00000576222.1_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA9_ENST00000573521.1_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA11_ENST00000518882.1_Intron	NM_018928.2|NM_032406.1	NP_061751.1|NP_115782.1	Q9Y5F7	PCDGL_HUMAN	protocadherin gamma subfamily C, 4	767					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(13)|lung(13)|ovary(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	42			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ATGTGGGAGGCCACTCTCATG	0.557																																					p.G767fs		Atlas-Indel,Pindel	.											.	PCDHGC4	91	.	0			c.2300delG						.						88.0	74.0	79.0					5																	140867041		2203	4300	6503	SO:0001589	frameshift_variant	56098	exon1			.	AF152525	CCDS4262.1, CCDS75349.1	5q31	2010-01-26			ENSG00000242419	ENSG00000242419		"""Cadherins / Protocadherins : Clustered"""	8717	other	protocadherin		606305				10380929	Standard	NM_018928		Approved	PCDH-GAMMA-C4		Q9Y5F7	OTTHUMG00000129625	ENST00000306593.1:c.2301delC	chr5.hg19:g.140867041delC	ENSP00000306918:p.Gly767fs	96.0	0.0		114.0	14.0	NM_018928	Q495T2|Q9Y5C3	Frame_Shift_Del	DEL	ENST00000306593.1	hg19	CCDS4262.1																																																																																			.	.		0.557	PCDHGC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251820.1	NM_018928	
