#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
EPB41	2035	hgsc.bcm.edu	37	1	29314060	29314060	+	Silent	SNP	A	A	G			TCGA-2Y-A9GY-01A-11D-A382-10	TCGA-2Y-A9GY-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	75a72b01-26d1-410f-a2f3-fabe09059eed	e1cd43c8-e295-4191-8754-0520f03119e1	g.chr1:29314060A>G	ENST00000343067.4	+	2	238	c.111A>G	c.(109-111)gaA>gaG	p.E37E	EPB41_ENST00000398863.2_Silent_p.E37E|EPB41_ENST00000356093.2_Silent_p.E37E|EPB41_ENST00000347529.3_Silent_p.E37E|EPB41_ENST00000349460.4_5'UTR|Y_RNA_ENST00000383977.1_RNA|EPB41_ENST00000373798.1_Silent_p.E37E|EPB41_ENST00000373797.1_Silent_p.E37E|EPB41_ENST00000373800.3_5'UTR	NM_001166005.1	NP_001159477.1	P11171	41_HUMAN	erythrocyte membrane protein band 4.1	37					actin cytoskeleton organization (GO:0030036)|blood circulation (GO:0008015)|cortical actin cytoskeleton organization (GO:0030866)|positive regulation of protein binding (GO:0032092)	cortical cytoskeleton (GO:0030863)|extrinsic component of membrane (GO:0019898)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	1-phosphatidylinositol binding (GO:0005545)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(3)|ovary(2)|urinary_tract(1)	14		Colorectal(325;3.46e-05)|Prostate(1639;0.000244)|Lung NSC(340;0.00328)|all_lung(284;0.00412)|Breast(348;0.00765)|all_neural(195;0.0199)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)|Medulloblastoma(700;0.123)		Colorectal(126;3.12e-07)|COAD - Colon adenocarcinoma(152;1.21e-05)|STAD - Stomach adenocarcinoma(196;0.00395)|KIRC - Kidney renal clear cell carcinoma(1967;0.0249)|BRCA - Breast invasive adenocarcinoma(304;0.0289)|READ - Rectum adenocarcinoma(331;0.0757)		AGCAGGAGGAATCTTGTCAAA	0.458																																					p.E37E		Atlas-SNP	.											.	EPB41	118	.	0			c.A111G						.						172.0	174.0	173.0					1																	29314060		2203	4300	6503	SO:0001819	synonymous_variant	2035	exon2			GGAGGAATCTTGT	BC039079	CCDS330.1, CCDS331.1, CCDS332.1, CCDS53288.1, CCDS53289.1	1p33-p32	2014-05-09	2014-05-09		ENSG00000159023	ENSG00000159023			3377	protein-coding gene	gene with protein product		130500	"""elliptocytosis 1, RH-linked"""	EL1			Standard	NM_001166005		Approved	4.1R	uc001brm.2	P11171	OTTHUMG00000003644	ENST00000343067.4:c.111A>G	chr1.hg19:g.29314060A>G		333.0	0.0		475.0	135.0	NM_203343	B1ALH8|B1ALH9|D3DPM9|D3DPN0|P11176|Q14245|Q5TB35|Q5VXN8|Q8IXV9|Q9Y578|Q9Y579	Silent	SNP	ENST00000343067.4	hg19	CCDS53288.1																																																																																			.	.		0.458	EPB41-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000010312.1	NM_203342	
CCDC24	149473	hgsc.bcm.edu	37	1	44457670	44457670	+	Silent	SNP	G	G	A			TCGA-2Y-A9GY-01A-11D-A382-10	TCGA-2Y-A9GY-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	75a72b01-26d1-410f-a2f3-fabe09059eed	e1cd43c8-e295-4191-8754-0520f03119e1	g.chr1:44457670G>A	ENST00000372318.3	+	2	291	c.120G>A	c.(118-120)cgG>cgA	p.R40R	SLC6A9_ENST00000372307.3_Intron|SLC6A9_ENST00000372306.3_Intron	NM_152499.1	NP_689712.1	Q8N4L8	CCD24_HUMAN	coiled-coil domain containing 24	40										endometrium(3)|large_intestine(2)|lung(3)|stomach(1)	9	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0821)				TGGAGCTGCGGGCGGAGGTGG	0.706																																					p.R40R		Atlas-SNP	.											.	CCDC24	22	.	0			c.G120A						.						12.0	12.0	12.0					1																	44457670		2050	4060	6110	SO:0001819	synonymous_variant	149473	exon2			GCTGCGGGCGGAG		CCDS507.1	1p34.1	2008-02-05			ENSG00000159214	ENSG00000159214			28688	protein-coding gene	gene with protein product						12477932	Standard	NM_152499		Approved	MGC45441	uc001clj.3	Q8N4L8	OTTHUMG00000008299	ENST00000372318.3:c.120G>A	chr1.hg19:g.44457670G>A		124.0	0.0		128.0	50.0	NM_152499	Q6RWT2	Silent	SNP	ENST00000372318.3	hg19	CCDS507.1																																																																																			.	.		0.706	CCDC24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022865.1	NM_152499	
HFM1	164045	hgsc.bcm.edu	37	1	91841093	91841093	+	Silent	SNP	G	G	T			TCGA-2Y-A9GY-01A-11D-A382-10	TCGA-2Y-A9GY-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	75a72b01-26d1-410f-a2f3-fabe09059eed	e1cd43c8-e295-4191-8754-0520f03119e1	g.chr1:91841093G>T	ENST00000370425.3	-	12	1685	c.1587C>A	c.(1585-1587)ccC>ccA	p.P529P	HFM1_ENST00000294696.5_5'UTR|HFM1_ENST00000370424.3_Silent_p.P208P	NM_001017975.3	NP_001017975.3	A2PYH4	HFM1_HUMAN	HFM1, ATP-dependent DNA helicase homolog (S. cerevisiae)	529	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				resolution of meiotic recombination intermediates (GO:0000712)		ATP binding (GO:0005524)|helicase activity (GO:0004386)|nucleic acid binding (GO:0003676)			breast(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(17)|lung(33)|ovary(1)|prostate(3)|skin(2)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	75		all_lung(203;0.00961)|Lung NSC(277;0.0351)		all cancers(265;0.000481)|Epithelial(280;0.00863)|OV - Ovarian serous cystadenocarcinoma(397;0.126)|KIRC - Kidney renal clear cell carcinoma(1967;0.171)		CCACAAGTGTGGGTTTCTGAT	0.313																																					p.P529P		Atlas-SNP	.											.	HFM1	188	.	0			c.C1587A						.						84.0	77.0	79.0					1																	91841093		1823	4077	5900	SO:0001819	synonymous_variant	164045	exon12			AAGTGTGGGTTTC	AB204867	CCDS30769.2	1p22.2	2008-03-26			ENSG00000162669	ENSG00000162669			20193	protein-coding gene	gene with protein product		615684	"""SEC63 domain containing 1"""	SEC63D1		14702039, 17286053	Standard	XM_006710395		Approved	MER3, FLJ39011, FLJ36760	uc001doa.4	A2PYH4	OTTHUMG00000010093	ENST00000370425.3:c.1587C>A	chr1.hg19:g.91841093G>T		198.0	0.0		290.0	56.0	NM_001017975	B1B0B6|Q8N9Q0	Silent	SNP	ENST00000370425.3	hg19	CCDS30769.2																																																																																			.	.		0.313	HFM1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316716.2	NM_001017975	
KCNA10	3744	hgsc.bcm.edu	37	1	111060812	111060812	+	Missense_Mutation	SNP	G	G	T	rs150505266		TCGA-2Y-A9GY-01A-11D-A382-10	TCGA-2Y-A9GY-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	75a72b01-26d1-410f-a2f3-fabe09059eed	e1cd43c8-e295-4191-8754-0520f03119e1	g.chr1:111060812G>T	ENST00000369771.2	-	1	985	c.598C>A	c.(598-600)Cgt>Agt	p.R200S		NM_005549.2	NP_005540.1	Q16322	KCA10_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 10	200			R -> H (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.		potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|intracellular cyclic nucleotide activated cation channel activity (GO:0005221)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(13)|lung(13)|ovary(3)|skin(1)|urinary_tract(1)	35		all_cancers(81;4.57e-06)|all_epithelial(167;1.52e-05)|all_lung(203;0.000152)|Lung NSC(277;0.000301)		Lung(183;0.0238)|all cancers(265;0.0874)|Colorectal(144;0.103)|Epithelial(280;0.116)|LUSC - Lung squamous cell carcinoma(189;0.134)	Dalfampridine(DB06637)	CAGAACTGACGGTGGATGTCA	0.547																																					p.R200S		Atlas-SNP	.											KCNA10,colon,carcinoma,+2,2	KCNA10	92	.	0			c.C598A						.						121.0	122.0	122.0					1																	111060812		2203	4300	6503	SO:0001583	missense	3744	exon1			ACTGACGGTGGAT	U96110	CCDS826.1	1p13.1	2012-07-05			ENSG00000143105	ENSG00000143105		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6219	protein-coding gene	gene with protein product		602420				16382104	Standard	NM_005549		Approved	Kv1.8	uc001dzt.1	Q16322	OTTHUMG00000022785	ENST00000369771.2:c.598C>A	chr1.hg19:g.111060812G>T	ENSP00000358786:p.Arg200Ser	176.0	0.0		181.0	53.0	NM_005549		Missense_Mutation	SNP	ENST00000369771.2	hg19	CCDS826.1	.	.	.	.	.	.	.	.	.	.	G	16.62	3.173284	0.57584	.	.	ENSG00000143105	ENST00000369771	T	0.65178	-0.14	5.93	3.84	0.44239	.	0.050482	0.64402	D	0.000001	T	0.57359	0.2048	M	0.87758	2.905	0.40720	D	0.982654	P	0.44521	0.837	B	0.40677	0.337	T	0.69884	-0.5024	10	0.87932	D	0	.	13.2524	0.60060	0.0:0.0:0.604:0.396	.	200	Q16322	KCA10_HUMAN	S	200	ENSP00000358786:R200S	ENSP00000358786:R200S	R	-	1	0	KCNA10	110862335	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	1.620000	0.36976	1.460000	0.47911	0.655000	0.94253	CGT	.	G|1.000;A|0.000		0.547	KCNA10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059081.1	NM_005549	
CD5L	922	hgsc.bcm.edu	37	1	157803136	157803136	+	Silent	SNP	G	G	A			TCGA-2Y-A9GY-01A-11D-A382-10	TCGA-2Y-A9GY-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	75a72b01-26d1-410f-a2f3-fabe09059eed	e1cd43c8-e295-4191-8754-0520f03119e1	g.chr1:157803136G>A	ENST00000368174.4	-	5	981	c.885C>T	c.(883-885)ttC>ttT	p.F295F	CD5L_ENST00000484609.1_5'Flank	NM_005894.2	NP_005885.1	O43866	CD5L_HUMAN	CD5 molecule-like	295	SRCR 3. {ECO:0000255|PROSITE- ProRule:PRU00196}.				apoptotic process (GO:0006915)|cellular defense response (GO:0006968)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	scavenger receptor activity (GO:0005044)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(9)|lung(25)|ovary(1)|prostate(1)|stomach(1)|urinary_tract(1)	52	all_hematologic(112;0.0378)		LUSC - Lung squamous cell carcinoma(543;0.24)			TCCGGTCTCTGAAGGAGGGAG	0.582																																					p.F295F		Atlas-SNP	.											.	CD5L	112	.	0			c.C885T						.						117.0	119.0	118.0					1																	157803136		2203	4300	6503	SO:0001819	synonymous_variant	922	exon5			GTCTCTGAAGGAG	U82812	CCDS1171.1	1q21-q23	2008-02-05	2006-03-28		ENSG00000073754	ENSG00000073754			1690	protein-coding gene	gene with protein product		602592	"""apoptosis inhibitor 6"", ""CD5 antigen-like (scavenger receptor cysteine rich family)"""	API6		9045627	Standard	NM_005894		Approved	Spalpha	uc001frk.4	O43866	OTTHUMG00000022440	ENST00000368174.4:c.885C>T	chr1.hg19:g.157803136G>A		114.0	0.0		171.0	83.0	NM_005894	A8K7M5|Q6UX63	Silent	SNP	ENST00000368174.4	hg19	CCDS1171.1																																																																																			.	.		0.582	CD5L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058346.1	NM_005894	
KIF26B	55083	hgsc.bcm.edu	37	1	245847634	245847634	+	Silent	SNP	G	G	T	rs148065443		TCGA-2Y-A9GY-01A-11D-A382-10	TCGA-2Y-A9GY-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	75a72b01-26d1-410f-a2f3-fabe09059eed	e1cd43c8-e295-4191-8754-0520f03119e1	g.chr1:245847634G>T	ENST00000407071.2	+	11	2798	c.2358G>T	c.(2356-2358)gcG>gcT	p.A786A	KIF26B_ENST00000366518.4_Silent_p.A405A	NM_018012.3	NP_060482.2	Q2KJY2	KI26B_HUMAN	kinesin family member 26B	786	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				establishment of cell polarity (GO:0030010)|metabolic process (GO:0008152)|positive regulation of cell-cell adhesion (GO:0022409)|ureteric bud invasion (GO:0072092)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(21)|ovary(4)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	51	all_cancers(71;3.86e-05)|all_epithelial(71;0.000121)|Ovarian(71;0.0412)|all_lung(81;0.0498)|Lung NSC(105;0.0708)|Breast(184;0.127)		OV - Ovarian serous cystadenocarcinoma(106;0.022)			GGAGCTACGCGGAGACCCTGT	0.597																																					p.A786A		Atlas-SNP	.											.	KIF26B	343	.	0			c.G2358T						.						48.0	52.0	51.0					1																	245847634		2032	4179	6211	SO:0001819	synonymous_variant	55083	exon11			CTACGCGGAGACC	AK001019	CCDS44342.1	1q44	2008-02-05			ENSG00000162849	ENSG00000162849		"""Kinesins"""	25484	protein-coding gene	gene with protein product		614026					Standard	NM_018012		Approved	FLJ10157	uc001ibf.1	Q2KJY2	OTTHUMG00000040079	ENST00000407071.2:c.2358G>T	chr1.hg19:g.245847634G>T		92.0	0.0		81.0	4.0	NM_018012	Q6ZQR9|Q6ZUZ0|Q8IUN3|Q8IVR1|Q9NWB4	Silent	SNP	ENST00000407071.2	hg19	CCDS44342.1																																																																																			.	G|1.000;A|0.000		0.597	KIF26B-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381037.1	XM_371354	
VPS54	51542	hgsc.bcm.edu	37	2	64189527	64189527	+	Silent	SNP	A	A	C			TCGA-2Y-A9GY-01A-11D-A382-10	TCGA-2Y-A9GY-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	75a72b01-26d1-410f-a2f3-fabe09059eed	e1cd43c8-e295-4191-8754-0520f03119e1	g.chr2:64189527A>C	ENST00000272322.4	-	7	829	c.675T>G	c.(673-675)tcT>tcG	p.S225S	VPS54_ENST00000354504.3_Silent_p.S108S|VPS54_ENST00000409558.4_Silent_p.S213S			Q9P1Q0	VPS54_HUMAN	vacuolar protein sorting 54 homolog (S. cerevisiae)	225					growth (GO:0040007)|homeostasis of number of cells within a tissue (GO:0048873)|musculoskeletal movement (GO:0050881)|neurofilament cytoskeleton organization (GO:0060052)|protein transport (GO:0015031)|retrograde transport, endosome to Golgi (GO:0042147)	GARP complex (GO:0000938)				endometrium(3)|kidney(4)|large_intestine(8)|lung(10)|ovary(1)|upper_aerodigestive_tract(1)	27						CTGAACGTAGAGAGATCTGGT	0.388																																					p.S225S		Atlas-SNP	.											.	VPS54	57	.	0			c.T675G						.						89.0	84.0	86.0					2																	64189527		2203	4300	6503	SO:0001819	synonymous_variant	51542	exon7			ACGTAGAGAGATC	AF102177	CCDS33208.1, CCDS46302.1	2p15-p14	2014-06-13	2006-12-19		ENSG00000143952	ENSG00000143952			18652	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 164"""	614633	"""vacuolar protein sorting 54 (yeast)"""			12039048	Standard	NM_016516		Approved	HCC8, PPP1R164	uc002scq.3	Q9P1Q0	OTTHUMG00000152627	ENST00000272322.4:c.675T>G	chr2.hg19:g.64189527A>C		80.0	0.0		112.0	56.0	NM_016516	Q5VIR5|Q86YF7|Q8N6G3|Q9NPV0|Q9NT07|Q9NUJ0	Silent	SNP	ENST00000272322.4	hg19	CCDS33208.1																																																																																			.	.		0.388	VPS54-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327062.2	NM_016516	
DYSF	8291	hgsc.bcm.edu	37	2	71740979	71740979	+	Nonsense_Mutation	SNP	C	C	A	rs564416027		TCGA-2Y-A9GY-01A-11D-A382-10	TCGA-2Y-A9GY-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	75a72b01-26d1-410f-a2f3-fabe09059eed	e1cd43c8-e295-4191-8754-0520f03119e1	g.chr2:71740979C>A	ENST00000258104.3	+	6	868	c.591C>A	c.(589-591)taC>taA	p.Y197*	DYSF_ENST00000410041.1_Nonsense_Mutation_p.Y229*|DYSF_ENST00000429174.2_Nonsense_Mutation_p.Y197*|DYSF_ENST00000413539.2_Nonsense_Mutation_p.Y228*|DYSF_ENST00000409366.1_Nonsense_Mutation_p.Y198*|DYSF_ENST00000409762.1_Nonsense_Mutation_p.Y228*|DYSF_ENST00000409744.1_Nonsense_Mutation_p.Y198*|DYSF_ENST00000394120.2_Nonsense_Mutation_p.Y198*|DYSF_ENST00000409582.3_Nonsense_Mutation_p.Y228*|DYSF_ENST00000409651.1_Nonsense_Mutation_p.Y229*|DYSF_ENST00000410020.3_Nonsense_Mutation_p.Y229*	NM_001130976.1|NM_003494.3	NP_001124448.1|NP_003485.1	O75923	DYSF_HUMAN	dysferlin	197					plasma membrane repair (GO:0001778)|vesicle fusion (GO:0006906)	cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|phospholipid binding (GO:0005543)	p.Y197Y(1)|p.Y229Y(1)		autonomic_ganglia(2)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(22)|lung(57)|ovary(3)|pancreas(1)|prostate(2)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(2)	111						CGCCCCACTACCCCGGGATCA	0.582																																					p.Y229X		Atlas-SNP	.											DYSF_ENST00000410020,NS,carcinoma,0,2	DYSF	536	.	2	Substitution - coding silent(2)	lung(2)	c.C687A	GRCh37	CM090599	DYSF	M		.						58.0	60.0	60.0					2																	71740979		2203	4300	6503	SO:0001587	stop_gained	8291	exon7			CCACTACCCCGGG	AF075575	CCDS1918.1, CCDS46323.1, CCDS46324.1, CCDS46325.1, CCDS46326.1, CCDS46327.1, CCDS46328.1, CCDS46329.1, CCDS46330.1, CCDS46331.1, CCDS46332.1	2p13.3	2014-09-17	2013-09-12		ENSG00000135636	ENSG00000135636			3097	protein-coding gene	gene with protein product	"""fer-1-like family member 1"""	603009	"""limb girdle muscular dystrophy 2B (autosomal recessive)"""	LGMD2B		8320700	Standard	NM_003494		Approved	FER1L1	uc010fen.3	O75923	OTTHUMG00000129757	ENST00000258104.3:c.591C>A	chr2.hg19:g.71740979C>A	ENSP00000258104:p.Tyr197*	193.0	2.0		334.0	154.0	NM_001130982	A0FK00|B1PZ70|B1PZ71|B1PZ72|B1PZ73|B1PZ74|B1PZ75|B1PZ76|B1PZ77|B1PZ78|B1PZ79|B1PZ80|B1PZ81|B3KQB9|O75696|Q09EX5|Q0H395|Q53QY3|Q53TD2|Q8TEL8|Q9UEN7	Nonsense_Mutation	SNP	ENST00000258104.3	hg19	CCDS1918.1	.	.	.	.	.	.	.	.	.	.	C	29.0	4.971787	0.92919	.	.	ENSG00000135636	ENST00000413539;ENST00000409762;ENST00000409582;ENST00000429174;ENST00000258104;ENST00000409651;ENST00000394120;ENST00000409744;ENST00000409366;ENST00000410020;ENST00000410041	.	.	.	4.79	1.92	0.25849	.	0.467753	0.22878	N	0.054551	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.11794	T	0.64	-13.1964	7.0741	0.25195	0.0:0.6012:0.0:0.3988	.	.	.	.	X	228;228;228;197;197;229;198;198;198;229;229	.	ENSP00000258104:Y197X	Y	+	3	2	DYSF	71594487	0.032000	0.19561	0.975000	0.42487	0.025000	0.11179	-0.500000	0.06405	0.545000	0.28902	0.549000	0.68633	TAC	.	.		0.582	DYSF-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000251970.3	NM_003494	
CCT7	10574	hgsc.bcm.edu	37	2	73479950	73479950	+	Silent	SNP	A	A	T			TCGA-2Y-A9GY-01A-11D-A382-10	TCGA-2Y-A9GY-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	75a72b01-26d1-410f-a2f3-fabe09059eed	e1cd43c8-e295-4191-8754-0520f03119e1	g.chr2:73479950A>T	ENST00000258091.5	+	12	1734	c.1593A>T	c.(1591-1593)acA>acT	p.T531T	CCT7_ENST00000540468.1_Silent_p.T444T|CCT7_ENST00000398422.2_Silent_p.T327T|CCT7_ENST00000537131.1_Silent_p.T431T|CCT7_ENST00000538797.1_Silent_p.T403T|CCT7_ENST00000539919.1_Silent_p.T487T	NM_006429.3	NP_006420.1	Q99832	TCPH_HUMAN	chaperonin containing TCP1, subunit 7 (eta)	531					'de novo' posttranslational protein folding (GO:0051084)|binding of sperm to zona pellucida (GO:0007339)|cellular protein metabolic process (GO:0044267)|protein folding (GO:0006457)	cell body (GO:0044297)|chaperonin-containing T-complex (GO:0005832)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|mitochondrion (GO:0005739)|zona pellucida receptor complex (GO:0002199)	ATP binding (GO:0005524)|unfolded protein binding (GO:0051082)			breast(1)|cervix(1)|endometrium(1)|lung(3)|stomach(1)	7						ATGCTCCCACAGCAGCAGGCC	0.637																																					p.T531T		Atlas-SNP	.											.	CCT7	60	.	0			c.A1593T						.						32.0	34.0	34.0					2																	73479950		1962	4133	6095	SO:0001819	synonymous_variant	10574	exon12			TCCCACAGCAGCA	AF026292	CCDS42696.1, CCDS46336.1, CCDS54366.1, CCDS54367.1	2p13.2	2011-09-02			ENSG00000135624	ENSG00000135624		"""Heat Shock Proteins / Chaperonins"""	1622	protein-coding gene	gene with protein product		605140				9819444	Standard	NM_006429		Approved	Ccth, Nip7-1	uc002siz.3	Q99832	OTTHUMG00000152765	ENST00000258091.5:c.1593A>T	chr2.hg19:g.73479950A>T		169.0	0.0		208.0	91.0	NM_006429	A8K7E6|A8MWI8|B7WNW9|B7Z4T9|B7Z4Z7|O14871|Q6FI26	Silent	SNP	ENST00000258091.5	hg19	CCDS46336.1																																																																																			.	.		0.637	CCT7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327714.2		
ALMS1	7840	hgsc.bcm.edu	37	2	73613036	73613036	+	Missense_Mutation	SNP	G	G	C	rs61156725|rs72319667|rs3074417	byFrequency	TCGA-2Y-A9GY-01A-11D-A382-10	TCGA-2Y-A9GY-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	75a72b01-26d1-410f-a2f3-fabe09059eed	e1cd43c8-e295-4191-8754-0520f03119e1	g.chr2:73613036G>C	ENST00000264448.6	+	1	151	c.40G>C	c.(40-42)Gag>Cag	p.E14Q	ALMS1_ENST00000409009.1_Missense_Mutation_p.E14Q|ALMS1_ENST00000377715.1_Missense_Mutation_p.E14Q	NM_015120.4	NP_055935	Q8TCU4	ALMS1_HUMAN	Alstrom syndrome 1	14	Glu-rich.				endosomal transport (GO:0016197)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|regulation of stress fiber assembly (GO:0051492)	centrosome (GO:0005813)|cilium (GO:0005929)|cytoplasm (GO:0005737)|cytosol (GO:0005829)		p.E27_E28delEE(1)		breast(4)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(31)|lung(68)|ovary(4)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	147						CGAGCTggaggaggaggagga	0.692																																					p.E14Q		Atlas-SNP	.											.	ALMS1	384	.	1	Deletion - In frame(1)	ovary(1)	c.G40C						.						3.0	4.0	4.0					2																	73613036		1509	3234	4743	SO:0001583	missense	7840	exon1			CTGGAGGAGGAGG	AB002326	CCDS42697.1	2p13.1	2014-09-17			ENSG00000116127	ENSG00000116127			428	protein-coding gene	gene with protein product		606844				9063741	Standard	NM_015120		Approved	KIAA0328	uc002sje.1	Q8TCU4	OTTHUMG00000152812	ENST00000264448.6:c.40G>C	chr2.hg19:g.73613036G>C	ENSP00000264448:p.Glu14Gln	139.0	0.0		231.0	13.0	NM_015120	Q53S05|Q580Q8|Q86VP9|Q9Y4G4	Missense_Mutation	SNP	ENST00000264448.6	hg19	CCDS42697.1	.	.	.	.	.	.	.	.	.	.	G	15.09	2.731519	0.48939	.	.	ENSG00000116127	ENST00000409009;ENST00000264448;ENST00000377715	T;T;T	0.26373	2.4;2.61;1.74	3.19	3.19	0.36642	.	0.259523	0.20097	U	0.099311	T	0.32436	0.0829	N	0.19112	0.55	0.22317	N	0.999202	D;D	0.89917	1.0;1.0	D;D	0.83275	0.996;0.996	T	0.03493	-1.1031	10	0.87932	D	0	.	10.1262	0.42652	0.0:0.0:1.0:0.0	.	14;14	B8ZZJ3;Q8TCU4	.;ALMS1_HUMAN	Q	14	ENSP00000386627:E14Q;ENSP00000264448:E14Q;ENSP00000366944:E14Q	ENSP00000264448:E14Q	E	+	1	0	ALMS1	73466544	1.000000	0.71417	1.000000	0.80357	0.826000	0.46750	2.034000	0.41145	2.070000	0.61991	0.484000	0.47621	GAG	.	.		0.692	ALMS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000327776.1	NM_015120	
ALMS1	7840	hgsc.bcm.edu	37	2	73613065	73613065	+	Silent	SNP	G	G	A			TCGA-2Y-A9GY-01A-11D-A382-10	TCGA-2Y-A9GY-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	75a72b01-26d1-410f-a2f3-fabe09059eed	e1cd43c8-e295-4191-8754-0520f03119e1	g.chr2:73613065G>A	ENST00000264448.6	+	1	180	c.69G>A	c.(67-69)gaG>gaA	p.E23E	ALMS1_ENST00000409009.1_Silent_p.E23E|ALMS1_ENST00000377715.1_Silent_p.E23E	NM_015120.4	NP_055935	Q8TCU4	ALMS1_HUMAN	Alstrom syndrome 1	23	Glu-rich.				endosomal transport (GO:0016197)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|regulation of stress fiber assembly (GO:0051492)	centrosome (GO:0005813)|cilium (GO:0005929)|cytoplasm (GO:0005737)|cytosol (GO:0005829)				breast(4)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(31)|lung(68)|ovary(4)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	147						aggaggaggaggaggaagagg	0.687																																					p.E23E		Atlas-SNP	.											.	ALMS1	384	.	0			c.G69A						.						6.0	9.0	8.0					2																	73613065		1849	3831	5680	SO:0001819	synonymous_variant	7840	exon1			GGAGGAGGAGGAA	AB002326	CCDS42697.1	2p13.1	2014-09-17			ENSG00000116127	ENSG00000116127			428	protein-coding gene	gene with protein product		606844				9063741	Standard	NM_015120		Approved	KIAA0328	uc002sje.1	Q8TCU4	OTTHUMG00000152812	ENST00000264448.6:c.69G>A	chr2.hg19:g.73613065G>A		389.0	0.0		595.0	41.0	NM_015120	Q53S05|Q580Q8|Q86VP9|Q9Y4G4	Silent	SNP	ENST00000264448.6	hg19	CCDS42697.1																																																																																			.	.		0.687	ALMS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000327776.1	NM_015120	
CYTIP	9595	hgsc.bcm.edu	37	2	158272222	158272222	+	Silent	SNP	A	A	G			TCGA-2Y-A9GY-01A-11D-A382-10	TCGA-2Y-A9GY-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	75a72b01-26d1-410f-a2f3-fabe09059eed	e1cd43c8-e295-4191-8754-0520f03119e1	g.chr2:158272222A>G	ENST00000264192.3	-	8	1168	c.1047T>C	c.(1045-1047)caT>caC	p.H349H	CYTIP_ENST00000540637.1_Silent_p.H243H	NM_004288.4	NP_004279.3	O60759	CYTIP_HUMAN	cytohesin 1 interacting protein	349					regulation of cell adhesion (GO:0030155)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|endosome (GO:0005768)|nucleus (GO:0005634)				breast(2)|central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|skin(2)	15						CCACAGCACGATGAAGGCCAG	0.473																																					p.H349H		Atlas-SNP	.											.	CYTIP	45	.	0			c.T1047C						.						89.0	84.0	86.0					2																	158272222		2203	4300	6503	SO:0001819	synonymous_variant	9595	exon8			AGCACGATGAAGG	L06633	CCDS2204.1	2q11.2	2011-09-08	2008-08-14	2008-08-19	ENSG00000115165	ENSG00000115165			9506	protein-coding gene	gene with protein product	"""cytohesin binding protein HE"", ""cytohesin binder and regulator"""	604448	"""pleckstrin homology, Sec7 and coiled-coil domains, binding protein"""	PSCDBP		18926288, 10343115, 11867758, 20530790, 21562043	Standard	NM_004288		Approved	B3-1, HE, CYBR, CASP, CYTHIP	uc002tzj.1	O60759	OTTHUMG00000154551	ENST00000264192.3:c.1047T>C	chr2.hg19:g.158272222A>G		348.0	0.0		489.0	233.0	NM_004288	B4DWH9|Q15630|Q8NE32	Silent	SNP	ENST00000264192.3	hg19	CCDS2204.1																																																																																			.	.		0.473	CYTIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254926.1	NM_004288	
STAT4	6775	hgsc.bcm.edu	37	2	192012877	192012877	+	Missense_Mutation	SNP	A	A	T			TCGA-2Y-A9GY-01A-11D-A382-10	TCGA-2Y-A9GY-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	75a72b01-26d1-410f-a2f3-fabe09059eed	e1cd43c8-e295-4191-8754-0520f03119e1	g.chr2:192012877A>T	ENST00000392320.2	-	2	367	c.53T>A	c.(52-54)gTg>gAg	p.V18E	STAT4_ENST00000358470.4_Missense_Mutation_p.V18E|STAT4_ENST00000409995.1_Missense_Mutation_p.V18E	NM_003151.3	NP_003142.1	Q14765	STAT4_HUMAN	signal transducer and activator of transcription 4	18					cell proliferation (GO:0008283)|cytokine-mediated signaling pathway (GO:0019221)|JAK-STAT cascade (GO:0007259)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein phosphorylation (GO:0006468)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)			breast(4)|endometrium(1)|kidney(2)|large_intestine(6)|lung(19)|ovary(1)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)	42			OV - Ovarian serous cystadenocarcinoma(117;0.00854)|Epithelial(96;0.0864)|all cancers(119;0.204)			GAATTGATCCACCTGCTCCAA	0.368																																					p.V18E		Atlas-SNP	.											.	STAT4	85	.	0			c.T53A						.						121.0	117.0	119.0					2																	192012877		2203	4300	6503	SO:0001583	missense	6775	exon2			TGATCCACCTGCT		CCDS2310.1	2q32.2-q32.3	2013-02-14			ENSG00000138378	ENSG00000138378		"""SH2 domain containing"""	11365	protein-coding gene	gene with protein product		600558				8007943, 8700208	Standard	NM_003151		Approved		uc002usn.2	Q14765	OTTHUMG00000132700	ENST00000392320.2:c.53T>A	chr2.hg19:g.192012877A>T	ENSP00000376134:p.Val18Glu	100.0	0.0		166.0	76.0	NM_001243835	Q96NZ6	Missense_Mutation	SNP	ENST00000392320.2	hg19	CCDS2310.1	.	.	.	.	.	.	.	.	.	.	A	19.00	3.741572	0.69304	.	.	ENSG00000138378	ENST00000358470;ENST00000392320;ENST00000409995;ENST00000450994;ENST00000432798	T;T;T;T;T	0.60424	0.19;0.19;0.19;0.19;0.19	5.73	5.73	0.89815	STAT transcription factor, protein interaction (4);	0.075363	0.52532	D	0.000072	T	0.76285	0.3966	M	0.74647	2.275	0.58432	D	0.999999	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.85130	0.995;0.997;0.997	T	0.79364	-0.1834	10	0.87932	D	0	-20.4535	16.0048	0.80354	1.0:0.0:0.0:0.0	.	18;18;18	B4DSY7;B4DV04;Q14765	.;.;STAT4_HUMAN	E	18	ENSP00000351255:V18E;ENSP00000376134:V18E;ENSP00000386288:V18E;ENSP00000412397:V18E;ENSP00000414322:V18E	ENSP00000351255:V18E	V	-	2	0	STAT4	191721122	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	9.288000	0.96055	2.190000	0.69967	0.533000	0.62120	GTG	.	.		0.368	STAT4-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335586.1	NM_003151	
NGEF	25791	hgsc.bcm.edu	37	2	233759597	233759597	+	Silent	SNP	C	C	T	rs527494178		TCGA-2Y-A9GY-01A-11D-A382-10	TCGA-2Y-A9GY-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	75a72b01-26d1-410f-a2f3-fabe09059eed	e1cd43c8-e295-4191-8754-0520f03119e1	g.chr2:233759597C>T	ENST00000264051.3	-	6	1136	c.858G>A	c.(856-858)gcG>gcA	p.A286A	NGEF_ENST00000539537.1_Silent_p.A9A|NGEF_ENST00000373552.4_Silent_p.A194A|NGEF_ENST00000409079.1_Silent_p.A194A	NM_019850.2	NP_062824.2	Q8N5V2	NGEF_HUMAN	neuronal guanine nucleotide exchange factor	286	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				apoptotic signaling pathway (GO:0097190)|ephrin receptor signaling pathway (GO:0048013)|negative regulation of dendritic spine morphogenesis (GO:0061002)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|regulation of GTPase activity (GO:0043087)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell projection (GO:0042995)|cytosol (GO:0005829)|membrane (GO:0016020)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			central_nervous_system(4)|endometrium(8)|kidney(2)|large_intestine(3)|lung(10)|ovary(3)|pancreas(1)|skin(4)	35		Breast(86;0.00279)|Renal(207;0.00339)|all_hematologic(139;0.00793)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0271)|Lung NSC(271;0.0839)		Epithelial(121;8.65e-17)|BRCA - Breast invasive adenocarcinoma(100;0.00037)|LUSC - Lung squamous cell carcinoma(224;0.00813)|Lung(119;0.00984)|GBM - Glioblastoma multiforme(43;0.0604)		TGTAGTAGGACGCCTCGGAAG	0.582													C|||	1	0.000199681	0.0008	0.0	5008	,	,		18589	0.0		0.0	False		,,,				2504	0.0				p.A286A		Atlas-SNP	.											.	NGEF	198	.	0			c.G858A						.						121.0	106.0	111.0					2																	233759597		2203	4300	6503	SO:0001819	synonymous_variant	25791	exon6			GTAGGACGCCTCG	AJ238899	CCDS2500.1, CCDS46544.1	2q37	2012-07-24			ENSG00000066248	ENSG00000066248		"""Rho guanine nucleotide exchange factors"""	7807	protein-coding gene	gene with protein product	"""ephexin"""	605991				10777665	Standard	NM_019850		Approved	ARHGEF27	uc002vts.2	Q8N5V2	OTTHUMG00000133272	ENST00000264051.3:c.858G>A	chr2.hg19:g.233759597C>T		98.0	0.0		153.0	32.0	NM_019850	B4DMB8|B9A045|E9PC42|Q53QQ4|Q53ST7|Q6GMQ5|Q9NQD6	Silent	SNP	ENST00000264051.3	hg19	CCDS2500.1	.	.	.	.	.	.	.	.	.	.	C	5.168	0.216573	0.09810	.	.	ENSG00000066248	ENST00000420650	.	.	.	5.22	-0.627	0.11541	.	.	.	.	.	T	0.50309	0.1608	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.34477	-0.9827	4	.	.	.	-31.3689	5.3754	0.16162	0.0612:0.2032:0.3025:0.4331	.	.	.	.	I	79	.	.	V	-	1	0	NGEF	233467841	0.413000	0.25400	0.990000	0.47175	0.473000	0.32948	-0.301000	0.08232	-0.409000	0.07553	-2.275000	0.00273	GTC	.	.		0.582	NGEF-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000257051.2	XM_044799	
PER2	8864	hgsc.bcm.edu	37	2	239161961	239161961	+	Silent	SNP	C	C	T	rs575531966		TCGA-2Y-A9GY-01A-11D-A382-10	TCGA-2Y-A9GY-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	75a72b01-26d1-410f-a2f3-fabe09059eed	e1cd43c8-e295-4191-8754-0520f03119e1	g.chr2:239161961C>T	ENST00000254657.3	-	19	2982	c.2703G>A	c.(2701-2703)gcG>gcA	p.A901A	AC096574.4_ENST00000456601.1_RNA|PER2_ENST00000254658.3_3'UTR	NM_022817.2	NP_073728.1	O15055	PER2_HUMAN	period circadian clock 2	901	Interaction with PPARG. {ECO:0000250|UniProtKB:O54943}.|Pro-rich.				circadian regulation of gene expression (GO:0032922)|circadian regulation of translation (GO:0097167)|circadian rhythm (GO:0007623)|fatty acid metabolic process (GO:0006631)|gluconeogenesis (GO:0006094)|glycogen biosynthetic process (GO:0005978)|histone H3 deacetylation (GO:0070932)|lactate biosynthetic process (GO:0019249)|negative regulation of circadian rhythm (GO:0042754)|negative regulation of DNA-templated transcription, termination (GO:0060567)|negative regulation of fat cell proliferation (GO:0070345)|negative regulation of protein ubiquitination (GO:0031397)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription regulatory region DNA binding (GO:2000678)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of cell cycle (GO:0051726)|regulation of circadian rhythm (GO:0042752)|regulation of glutamate uptake involved in transmission of nerve impulse (GO:0051946)|regulation of insulin secretion (GO:0050796)|regulation of neurogenesis (GO:0050767)|regulation of vasoconstriction (GO:0019229)|response to ischemia (GO:0002931)|transcription, DNA-templated (GO:0006351)|white fat cell differentiation (GO:0050872)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	pre-mRNA binding (GO:0036002)|signal transducer activity (GO:0004871)|transcription coactivator activity (GO:0003713)|transcription factor binding transcription factor activity (GO:0000989)|transcription regulatory region sequence-specific DNA binding (GO:0000976)|ubiquitin binding (GO:0043130)			NS(1)|breast(5)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(3)|lung(16)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	37		Breast(86;7.61e-05)|Renal(207;0.00183)|Ovarian(221;0.0423)|all_lung(227;0.114)|all_hematologic(139;0.158)|Melanoma(123;0.203)|Lung NSC(271;0.223)|Hepatocellular(293;0.244)		Epithelial(121;6.84e-24)|OV - Ovarian serous cystadenocarcinoma(60;9.73e-12)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;6.5e-08)|BRCA - Breast invasive adenocarcinoma(100;6.77e-05)|Lung(119;0.00941)|LUSC - Lung squamous cell carcinoma(224;0.0161)		CCATGACAGGCGCCAAAGGGG	0.647																																					p.A901A		Atlas-SNP	.											.	PER2	85	.	0			c.G2703A						.						41.0	44.0	43.0					2																	239161961		2203	4300	6503	SO:0001819	synonymous_variant	8864	exon19			GACAGGCGCCAAA	AB002345	CCDS2528.1	2q37.3	2012-12-13	2012-12-13		ENSG00000132326	ENSG00000132326			8846	protein-coding gene	gene with protein product		603426	"""period (Drosophila) homolog 2"", ""period homolog 2 (Drosophila)"""			9427249, 17218255	Standard	NM_022817		Approved	KIAA0347	uc002vyc.3	O15055	OTTHUMG00000152884	ENST00000254657.3:c.2703G>A	chr2.hg19:g.239161961C>T		125.0	0.0		161.0	12.0	NM_022817	A2I2P7|Q4ZG49|Q6DT41|Q9UQ45	Silent	SNP	ENST00000254657.3	hg19	CCDS2528.1																																																																																			.	.		0.647	PER2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257167.1	NM_022817	
CAND2	23066	hgsc.bcm.edu	37	3	12845054	12845054	+	Nonsense_Mutation	SNP	G	G	T			TCGA-2Y-A9GY-01A-11D-A382-10	TCGA-2Y-A9GY-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	75a72b01-26d1-410f-a2f3-fabe09059eed	e1cd43c8-e295-4191-8754-0520f03119e1	g.chr3:12845054G>T	ENST00000456430.2	+	2	177	c.136G>T	c.(136-138)Gag>Tag	p.E46*	CAND2_ENST00000295989.5_Nonsense_Mutation_p.E46*	NM_001162499.1	NP_001155971.1	O75155	CAND2_HUMAN	cullin-associated and neddylation-dissociated 2 (putative)	46					positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	intracellular (GO:0005622)|nucleus (GO:0005634)				breast(3)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(8)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	37						CGAGGACAGCGAGCGCAAGGT	0.602																																					p.E46X	GBM(43;676 868 1633 6395 37496)	Atlas-SNP	.											.	CAND2	138	.	0			c.G136T						.						63.0	71.0	68.0					3																	12845054		2203	4300	6503	SO:0001587	stop_gained	23066	exon2			GACAGCGAGCGCA		CCDS43053.1, CCDS54554.1	3p25.2	2008-02-05			ENSG00000144712	ENSG00000144712			30689	protein-coding gene	gene with protein product	"""TBP interacting protein"""	610403				9734811, 10441524	Standard	NM_012298		Approved	TIP120B, KIAA0667, Tp120b	uc003bxk.2	O75155	OTTHUMG00000155397	ENST00000456430.2:c.136G>T	chr3.hg19:g.12845054G>T	ENSP00000387641:p.Glu46*	50.0	0.0		87.0	4.0	NM_012298	B9EGM9|E9KL24	Nonsense_Mutation	SNP	ENST00000456430.2	hg19	CCDS54554.1	.	.	.	.	.	.	.	.	.	.	G	36	5.634867	0.96682	.	.	ENSG00000144712	ENST00000295989;ENST00000456430	.	.	.	4.66	4.66	0.58398	.	0.149727	0.42964	D	0.000622	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.07325	T	0.83	-10.9323	15.4488	0.75257	0.0:0.0:1.0:0.0	.	.	.	.	X	46	.	ENSP00000295989:E46X	E	+	1	0	CAND2	12820054	1.000000	0.71417	0.965000	0.40720	0.933000	0.57130	9.532000	0.98057	2.572000	0.86782	0.655000	0.94253	GAG	.	.		0.602	CAND2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339856.4	XM_371617	
CD80	941	hgsc.bcm.edu	37	3	119263513	119263513	+	Missense_Mutation	SNP	A	A	G			TCGA-2Y-A9GY-01A-11D-A382-10	TCGA-2Y-A9GY-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	75a72b01-26d1-410f-a2f3-fabe09059eed	e1cd43c8-e295-4191-8754-0520f03119e1	g.chr3:119263513A>G	ENST00000264246.3	-	3	664	c.302T>C	c.(301-303)aTt>aCt	p.I101T	CD80_ENST00000478182.1_Missense_Mutation_p.I101T|CD80_ENST00000383668.3_Missense_Mutation_p.I101T|CD80_ENST00000383669.3_Missense_Mutation_p.I101T	NM_005191.3	NP_005182.1	P33681	CD80_HUMAN	CD80 molecule	101	Ig-like V-type.				cell-cell signaling (GO:0007267)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of alpha-beta T cell proliferation (GO:0046641)|positive regulation of granulocyte macrophage colony-stimulating factor biosynthetic process (GO:0045425)|positive regulation of interleukin-2 biosynthetic process (GO:0045086)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of signal transduction (GO:0009967)|positive regulation of T-helper 1 cell differentiation (GO:0045627)|positive regulation of transcription, DNA-templated (GO:0045893)|T cell activation (GO:0042110)|T cell costimulation (GO:0031295)|viral process (GO:0016032)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	coreceptor activity (GO:0015026)			breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|upper_aerodigestive_tract(2)	12					Abatacept(DB01281)|Belatacept(DB06681)	CAGGATCACAATGGAGAGGTT	0.473																																					p.I101T	Melanoma(132;135 1764 1806 5833 14593)	Atlas-SNP	.											.	CD80	35	.	0			c.T302C						.						149.0	143.0	145.0					3																	119263513		2203	4300	6503	SO:0001583	missense	941	exon3			ATCACAATGGAGA		CCDS2989.1	3q13.3-q21	2013-01-11	2006-03-31		ENSG00000121594	ENSG00000121594		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"""	1700	protein-coding gene	gene with protein product	"""B-lymphocyte activation antigen B7"""	112203	"""CD80 antigen (CD28 antigen ligand 1, B7-1 antigen)"", ""CD80 molecule """	CD28LG, CD28LG1		1370389	Standard	NM_005191		Approved	B7.1, B7-1	uc003ecq.3	P33681	OTTHUMG00000159419	ENST00000264246.3:c.302T>C	chr3.hg19:g.119263513A>G	ENSP00000264246:p.Ile101Thr	119.0	0.0		117.0	49.0	NM_005191	Q5DTA9|Q5DTB0	Missense_Mutation	SNP	ENST00000264246.3	hg19	CCDS2989.1	.	.	.	.	.	.	.	.	.	.	A	12.04	1.818243	0.32145	.	.	ENSG00000121594	ENST00000264246;ENST00000478182;ENST00000383669;ENST00000383668	T;T;T;T	0.47869	0.83;0.83;0.83;0.83	5.13	5.13	0.70059	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.680401	0.12921	N	0.428161	T	0.69531	0.3121	M	0.80847	2.515	0.09310	N	1	D;D;D;D	0.71674	0.998;0.982;0.996;0.996	D;D;D;D	0.87578	0.998;0.986;0.994;0.994	T	0.61282	-0.7094	10	0.87932	D	0	-2.6865	11.2561	0.49054	1.0:0.0:0.0:0.0	.	101;101;101;101	Q5DTA9;Q5DTB0;A0N0P2;P33681	.;.;.;CD80_HUMAN	T	101	ENSP00000264246:I101T;ENSP00000418364:I101T;ENSP00000373165:I101T;ENSP00000373164:I101T	ENSP00000264246:I101T	I	-	2	0	CD80	120746203	0.054000	0.20591	0.026000	0.17262	0.039000	0.13416	3.767000	0.55288	2.152000	0.67230	0.528000	0.53228	ATT	.	.		0.473	CD80-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355196.1	NM_005191	
GPR156	165829	hgsc.bcm.edu	37	3	119886025	119886025	+	Missense_Mutation	SNP	A	A	C			TCGA-2Y-A9GY-01A-11D-A382-10	TCGA-2Y-A9GY-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	75a72b01-26d1-410f-a2f3-fabe09059eed	e1cd43c8-e295-4191-8754-0520f03119e1	g.chr3:119886025A>C	ENST00000464295.1	-	10	2744	c.2299T>G	c.(2299-2301)Ttc>Gtc	p.F767V	GPR156_ENST00000461057.1_Missense_Mutation_p.F763V|GPR156_ENST00000315843.3_Missense_Mutation_p.F767V			Q8NFN8	GP156_HUMAN	G protein-coupled receptor 156	767						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled GABA receptor activity (GO:0004965)			breast(2)|endometrium(3)|kidney(1)|large_intestine(11)|lung(12)|ovary(1)|prostate(1)|skin(1)	32				GBM - Glioblastoma multiforme(114;0.19)		GAGCTCTGGAAGCAGATTTCA	0.557																																					p.F767V		Atlas-SNP	.											.	GPR156	85	.	0			c.T2299G						.						113.0	127.0	122.0					3																	119886025		2203	4300	6503	SO:0001583	missense	165829	exon9			TCTGGAAGCAGAT	AF488739	CCDS2997.1, CCDS54629.1	3q13.33	2012-08-21			ENSG00000175697	ENSG00000175697		"""GPCR / Class C : Orphans"""	20844	protein-coding gene	gene with protein product		610464				12591167	Standard	NM_153002		Approved	PGR28, GABABL	uc011bjf.2	Q8NFN8	OTTHUMG00000159406	ENST00000464295.1:c.2299T>G	chr3.hg19:g.119886025A>C	ENSP00000417261:p.Phe767Val	110.0	0.0		103.0	47.0	NM_153002	B7ZL66|E9PFZ4|Q14CM1|Q86SN6	Missense_Mutation	SNP	ENST00000464295.1	hg19	CCDS2997.1	.	.	.	.	.	.	.	.	.	.	A	19.57	3.851630	0.71719	.	.	ENSG00000175697	ENST00000464295;ENST00000315843;ENST00000461057	T;T;T	0.30448	1.53;1.53;1.54	5.11	5.11	0.69529	.	0.158034	0.44285	D	0.000464	T	0.29652	0.0740	L	0.27053	0.805	0.36555	D	0.872077	D;D	0.53151	0.958;0.958	P;P	0.51833	0.681;0.681	T	0.17776	-1.0358	9	.	.	.	-24.5545	10.5774	0.45235	0.9223:0.0:0.0777:0.0	.	763;767	E9PFZ4;Q8NFN8	.;GP156_HUMAN	V	767;767;763	ENSP00000417261:F767V;ENSP00000324553:F767V;ENSP00000418758:F763V	.	F	-	1	0	GPR156	121368715	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.672000	0.46850	2.281000	0.76405	0.533000	0.62120	TTC	.	.		0.557	GPR156-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000355139.1	NM_153002	
OTOL1	131149	hgsc.bcm.edu	37	3	161221396	161221396	+	Missense_Mutation	SNP	A	A	T	rs570932275		TCGA-2Y-A9GY-01A-11D-A382-10	TCGA-2Y-A9GY-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	75a72b01-26d1-410f-a2f3-fabe09059eed	e1cd43c8-e295-4191-8754-0520f03119e1	g.chr3:161221396A>T	ENST00000327928.4	+	4	1100	c.1100A>T	c.(1099-1101)tAt>tTt	p.Y367F		NM_001080440.1	NP_001073909.1	A6NHN0	OTOL1_HUMAN	otolin 1	367	C1q. {ECO:0000255|PROSITE- ProRule:PRU00368}.					collagen trimer (GO:0005581)|extracellular region (GO:0005576)				central_nervous_system(2)|kidney(2)|large_intestine(8)|lung(11)|ovary(1)|prostate(2)|skin(1)	27						AAGATTCTCTATAATGACCAA	0.468													A|||	1	0.000199681	0.0	0.0	5008	,	,		18186	0.001		0.0	False		,,,				2504	0.0				p.Y367F		Atlas-SNP	.											.	OTOL1	63	.	0			c.A1100T						.						57.0	52.0	54.0					3																	161221396		1879	4104	5983	SO:0001583	missense	131149	exon4			TTCTCTATAATGA		CCDS46948.1	3q26.1	2011-05-19	2011-05-19			ENSG00000182447			34071	protein-coding gene	gene with protein product	"""C1q and tumor necrosis factor related protein 15"""		"""otolin 1 homolog (zebrafish)"""			17544811, 15905077	Standard	NM_001080440		Approved	C1QTNF15	uc011bpb.2	A6NHN0		ENST00000327928.4:c.1100A>T	chr3.hg19:g.161221396A>T	ENSP00000330808:p.Tyr367Phe	83.0	0.0		87.0	19.0	NM_001080440		Missense_Mutation	SNP	ENST00000327928.4	hg19	CCDS46948.1	.	.	.	.	.	.	.	.	.	.	A	11.05	1.525009	0.27299	.	.	ENSG00000182447	ENST00000327928	T	0.75589	-0.95	5.23	4.06	0.47325	Tumour necrosis factor-like (2);Complement C1q protein (4);	0.057841	0.64402	D	0.000001	D	0.82742	0.5103	M	0.76002	2.32	0.26282	N	0.978266	D	0.64830	0.994	D	0.66847	0.947	T	0.73898	-0.3837	10	0.31617	T	0.26	.	10.9923	0.47557	0.837:0.163:0.0:0.0	.	367	A6NHN0	OTOL1_HUMAN	F	367	ENSP00000330808:Y367F	ENSP00000330808:Y367F	Y	+	2	0	OTOL1	162704090	1.000000	0.71417	0.707000	0.30419	0.076000	0.17211	5.918000	0.69996	0.804000	0.34136	0.455000	0.32223	TAT	.	.		0.468	OTOL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353184.1	NM_001080440	
MARCH11	441061	hgsc.bcm.edu	37	5	16067614	16067614	+	Nonsense_Mutation	SNP	G	G	T			TCGA-2Y-A9GY-01A-11D-A382-10	TCGA-2Y-A9GY-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	75a72b01-26d1-410f-a2f3-fabe09059eed	e1cd43c8-e295-4191-8754-0520f03119e1	g.chr5:16067614G>T	ENST00000332432.8	-	4	1374	c.1175C>A	c.(1174-1176)tCg>tAg	p.S392*		NM_001102562.1	NP_001096032.1	A6NNE9	MARHB_HUMAN	membrane-associated ring finger (C3HC4) 11	392					protein ubiquitination (GO:0016567)	cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			NS(1)|central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(14)|urinary_tract(1)	20						AACCTCCCCCGAGCTGTTATC	0.463																																					p.S392X		Atlas-SNP	.											MARCH11,rectum,carcinoma,0,1	MARCH11	50	.	0			c.C1175A						.						182.0	177.0	179.0					5																	16067614		1943	4147	6090	SO:0001587	stop_gained	441061	exon4			TCCCCCGAGCTGT	BC150513	CCDS47192.1	5p15.1	2013-01-09			ENSG00000183654	ENSG00000183654		"""RING-type (C3HC4) zinc fingers"", ""MARCH membrane-associated ring fingers"""	33609	protein-coding gene	gene with protein product		613338				17604280	Standard	NM_001102562		Approved	MARCH-XI	uc003jfo.2	A6NNE9	OTTHUMG00000161789	ENST00000332432.8:c.1175C>A	chr5.hg19:g.16067614G>T	ENSP00000333181:p.Ser392*	59.0	0.0		95.0	34.0	NM_001102562	A7E2S6	Nonsense_Mutation	SNP	ENST00000332432.8	hg19	CCDS47192.1	.	.	.	.	.	.	.	.	.	.	G	36	5.970353	0.97156	.	.	ENSG00000183654	ENST00000332432	.	.	.	5.12	5.12	0.69794	.	0.135742	0.50627	D	0.000113	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-14.7453	18.9417	0.92608	0.0:0.0:1.0:0.0	.	.	.	.	X	392	.	ENSP00000333181:S392X	S	-	2	0	MARCH11	16120614	1.000000	0.71417	0.996000	0.52242	0.955000	0.61496	6.707000	0.74654	2.525000	0.85131	0.655000	0.94253	TCG	.	.		0.463	MARCH11-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000366096.2	NM_001102562	
ADAMTS19	171019	hgsc.bcm.edu	37	5	128977574	128977574	+	Missense_Mutation	SNP	G	G	T			TCGA-2Y-A9GY-01A-11D-A382-10	TCGA-2Y-A9GY-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	75a72b01-26d1-410f-a2f3-fabe09059eed	e1cd43c8-e295-4191-8754-0520f03119e1	g.chr5:128977574G>T	ENST00000274487.4	+	11	1920	c.1775G>T	c.(1774-1776)tGg>tTg	p.W592L	CTC-575N7.1_ENST00000503616.1_RNA	NM_133638.3	NP_598377.3	Q8TE59	ATS19_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 19	592	Disintegrin.					proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(4)|endometrium(10)|kidney(9)|large_intestine(14)|lung(34)|ovary(6)|pancreas(1)|prostate(6)|skin(6)	91		all_cancers(142;0.0148)|Prostate(80;0.0494)|Breast(839;0.238)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	OV - Ovarian serous cystadenocarcinoma(64;0.222)		ACAGGATTATGGTGCAAGGTA	0.398																																					p.W592L		Atlas-SNP	.											.	ADAMTS19	216	.	0			c.G1775T						.						214.0	180.0	191.0					5																	128977574		2203	4300	6503	SO:0001583	missense	171019	exon11			GATTATGGTGCAA	AJ311904	CCDS4146.1	5q23.3	2009-04-27	2005-08-19		ENSG00000145808	ENSG00000145808		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17111	protein-coding gene	gene with protein product		607513	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 19"""			11867212	Standard	NM_133638		Approved		uc003kvb.1	Q8TE59	OTTHUMG00000128990	ENST00000274487.4:c.1775G>T	chr5.hg19:g.128977574G>T	ENSP00000274487:p.Trp592Leu	90.0	0.0		123.0	41.0	NM_133638		Missense_Mutation	SNP	ENST00000274487.4	hg19	CCDS4146.1	.	.	.	.	.	.	.	.	.	.	G	21.7	4.192046	0.78902	.	.	ENSG00000145808	ENST00000274487	T	0.64991	-0.13	3.85	3.85	0.44370	.	0.000000	0.64402	D	0.000018	D	0.82490	0.5048	M	0.90595	3.13	0.58432	D	0.999994	D	0.89917	1.0	D	0.87578	0.998	D	0.86680	0.1916	9	.	.	.	.	17.0821	0.86601	0.0:0.0:1.0:0.0	.	592	Q8TE59	ATS19_HUMAN	L	592	ENSP00000274487:W592L	.	W	+	2	0	ADAMTS19	129005473	1.000000	0.71417	0.994000	0.49952	0.988000	0.76386	7.207000	0.77899	2.426000	0.82243	0.591000	0.81541	TGG	.	.		0.398	ADAMTS19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250979.2	NM_133638	
ACSL6	23305	hgsc.bcm.edu	37	5	131310509	131310509	+	Intron	SNP	C	C	G			TCGA-2Y-A9GY-01A-11D-A382-10	TCGA-2Y-A9GY-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	75a72b01-26d1-410f-a2f3-fabe09059eed	e1cd43c8-e295-4191-8754-0520f03119e1	g.chr5:131310509C>G	ENST00000379240.1	-	11	1147				ACSL6_ENST00000379249.3_Missense_Mutation_p.C312S|ACSL6_ENST00000379246.1_Intron|ACSL6_ENST00000357096.1_Intron|ACSL6_ENST00000379264.2_Intron|ACSL6_ENST00000544770.1_Intron|ACSL6_ENST00000296869.4_Missense_Mutation_p.C337S|ACSL6_ENST00000431707.1_Intron|ACSL6_ENST00000379244.1_Missense_Mutation_p.C312S|ACSL6_ENST00000543479.1_Missense_Mutation_p.C312S|ACSL6_ENST00000379272.2_Intron|ACSL6_ENST00000379255.1_Intron			Q9UKU0	ACSL6_HUMAN	acyl-CoA synthetase long-chain family member 6						acyl-CoA metabolic process (GO:0006637)|cellular lipid metabolic process (GO:0044255)|cellular response to insulin stimulus (GO:0032869)|fatty acid transport (GO:0015908)|long-chain fatty acid metabolic process (GO:0001676)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|neuroblast proliferation (GO:0007405)|neuron development (GO:0048666)|phospholipid biosynthetic process (GO:0008654)|positive regulation of neuron projection development (GO:0010976)|positive regulation of plasma membrane long-chain fatty acid transport (GO:0010747)|positive regulation of triglyceride biosynthetic process (GO:0010867)|response to gravity (GO:0009629)|response to hypoxia (GO:0001666)|response to nutrient (GO:0007584)|response to steroid hormone (GO:0048545)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|nucleus (GO:0005634)|peroxisome (GO:0005777)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|enzyme binding (GO:0019899)|long-chain fatty acid-CoA ligase activity (GO:0004467)|protein homodimerization activity (GO:0042803)			NS(1)|breast(1)|endometrium(2)|kidney(4)|large_intestine(8)|lung(12)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	35		all_cancers(142;0.107)|Breast(839;0.198)|Lung NSC(810;0.216)|all_lung(232;0.248)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			CACATCCGCACAAGTGGGAGC	0.522																																					p.C337S		Atlas-SNP	.											.	ACSL6	169	.	0			c.G1010C						.						62.0	57.0	59.0					5																	131310509		2203	4300	6503	SO:0001627	intron_variant	23305	exon11			TCCGCACAAGTGG	AB020644	CCDS34228.1, CCDS34229.1, CCDS56381.1, CCDS56382.1, CCDS56383.1	5q31	2008-02-05	2004-02-19	2004-02-20	ENSG00000164398	ENSG00000164398		"""Acyl-CoA synthetase family"""	16496	protein-coding gene	gene with protein product		604443	"""fatty-acid-Coenzyme A ligase, long-chain 6"""	FACL6		10502316, 10548543	Standard	NM_015256		Approved	KIAA0837, ACS2, LACS5, LACS2	uc003kvy.2	Q9UKU0	OTTHUMG00000150692	ENST00000379240.1:c.993+76G>C	chr5.hg19:g.131310509C>G		259.0	0.0		239.0	119.0	NM_015256	J3KPG3|O94924|O95829|Q108M9|Q108N0|Q4G191|Q86TN7	Missense_Mutation	SNP	ENST00000379240.1	hg19		.	.	.	.	.	.	.	.	.	.	C	2.187	-0.386197	0.04966	.	.	ENSG00000164398	ENST00000379249;ENST00000296869;ENST00000379244;ENST00000543479;ENST00000434099	T;T;T;T;T	0.09255	3.0;3.0;3.0;3.0;3.0	5.16	4.3	0.51218	.	0.670270	0.15722	N	0.247865	T	0.03390	0.0098	N	0.00894	-1.105	0.80722	D	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.001;0.0;0.0	T	0.36962	-0.9726	10	0.11485	T	0.65	.	10.6827	0.45823	0.0:0.8461:0.0:0.1539	.	312;302;337	Q9UKU0-3;B4DFW3;Q9UKU0-8	.;.;.	S	312;337;312;312;277	ENSP00000368551:C312S;ENSP00000296869:C337S;ENSP00000368546:C312S;ENSP00000442124:C312S;ENSP00000397507:C277S	ENSP00000296869:C337S	C	-	2	0	ACSL6	131338408	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.087000	0.50167	1.194000	0.43101	0.555000	0.69702	TGT	.	.		0.522	ACSL6-004	NOVEL	basic|appris_candidate_longest|exp_conf	protein_coding	protein_coding	OTTHUMT00000132622.1	NM_015256	
H2AFY	9555	hgsc.bcm.edu	37	5	134705791	134705791	+	Missense_Mutation	SNP	T	T	C			TCGA-2Y-A9GY-01A-11D-A382-10	TCGA-2Y-A9GY-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	75a72b01-26d1-410f-a2f3-fabe09059eed	e1cd43c8-e295-4191-8754-0520f03119e1	g.chr5:134705791T>C	ENST00000511689.1	-	3	807	c.214A>G	c.(214-216)Aag>Gag	p.K72E	H2AFY_ENST00000312469.4_Missense_Mutation_p.K72E|H2AFY_ENST00000510038.1_Missense_Mutation_p.K72E|H2AFY_ENST00000304332.4_Missense_Mutation_p.K72E|H2AFY_ENST00000423969.2_Intron	NM_001040158.1|NM_138610.2	NP_001035248.1|NP_613258.2	O75367	H2AY_HUMAN	H2A histone family, member Y	72	Histone H2A.				chromatin modification (GO:0016568)|dosage compensation (GO:0007549)|establishment of protein localization to chromatin (GO:0071169)|negative regulation of cell cycle G2/M phase transition (GO:1902750)|negative regulation of gene expression, epigenetic (GO:0045814)|negative regulation of histone phosphorylation (GO:0033128)|negative regulation of protein serine/threonine kinase activity (GO:0071901)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription of nuclear large rRNA transcript from RNA polymerase I promoter (GO:1901837)|nucleosome assembly (GO:0006334)	Barr body (GO:0001740)|condensed chromosome (GO:0000793)|extracellular vesicular exosome (GO:0070062)|nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleosome (GO:0000786)|nucleus (GO:0005634)|pericentric heterochromatin (GO:0005721)|sex chromatin (GO:0001739)	chromatin DNA binding (GO:0031490)|DNA binding (GO:0003677)|double-stranded methylated DNA binding (GO:0010385)|protein kinase binding (GO:0019901)|protein serine/threonine kinase inhibitor activity (GO:0030291)|rDNA binding (GO:0000182)|transcription regulatory region DNA binding (GO:0044212)			endometrium(3)|large_intestine(3)|lung(3)|ovary(1)|urinary_tract(1)	11			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			CGTCCCTTCTTGTTGTCTCTC	0.577																																					p.K72E		Atlas-SNP	.											.	H2AFY	61	.	0			c.A214G						.						91.0	72.0	79.0					5																	134705791		2203	4300	6503	SO:0001583	missense	9555	exon3			CCTTCTTGTTGTC	AF054174	CCDS4183.1, CCDS4184.1, CCDS4185.1	5q31.1	2011-01-27			ENSG00000113648	ENSG00000113648		"""Histones / Replication-independent"""	4740	protein-coding gene	gene with protein product		610054				9653160, 9714746	Standard	NM_004893		Approved	macroH2A1.2	uc003lam.1	O75367	OTTHUMG00000129141	ENST00000511689.1:c.214A>G	chr5.hg19:g.134705791T>C	ENSP00000423563:p.Lys72Glu	53.0	0.0		42.0	19.0	NM_138610	O75377|Q503A8|Q7Z5E3|Q96D41|Q9H8P3|Q9UP96	Missense_Mutation	SNP	ENST00000511689.1	hg19	CCDS4185.1	.	.	.	.	.	.	.	.	.	.	T	35	5.487474	0.96323	.	.	ENSG00000113648	ENST00000511689;ENST00000304332;ENST00000312469;ENST00000510038	T;T;T;T	0.76316	-1.01;-1.01;-1.01;-1.01	6.06	6.06	0.98353	Histone-fold (2);Histone core (1);Histone H2A (2);	0.000000	0.85682	D	0.000000	D	0.93003	0.7773	H	0.98577	4.27	0.80722	D	1	D;D;D	0.89917	0.998;0.999;1.0	D;D;D	0.80764	0.915;0.994;0.989	D	0.95541	0.8612	10	0.87932	D	0	.	16.6093	0.84858	0.0:0.0:0.0:1.0	.	72;72;72	O75367-3;O75367-2;O75367	.;.;H2AY_HUMAN	E	72	ENSP00000423563:K72E;ENSP00000302572:K72E;ENSP00000310169:K72E;ENSP00000424971:K72E	ENSP00000302572:K72E	K	-	1	0	H2AFY	134733690	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.015000	0.88690	2.324000	0.78689	0.533000	0.62120	AAG	.	.		0.577	H2AFY-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000251196.3	NM_004893	
ARAP3	64411	hgsc.bcm.edu	37	5	141060026	141060026	+	Missense_Mutation	SNP	C	C	A			TCGA-2Y-A9GY-01A-11D-A382-10	TCGA-2Y-A9GY-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	75a72b01-26d1-410f-a2f3-fabe09059eed	e1cd43c8-e295-4191-8754-0520f03119e1	g.chr5:141060026C>A	ENST00000239440.4	-	2	93	c.28G>T	c.(28-30)Gct>Tct	p.A10S	ARAP3_ENST00000508305.1_5'UTR	NM_022481.5	NP_071926.4	Q8WWN8	ARAP3_HUMAN	ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 3	10	SAM. {ECO:0000255|PROSITE- ProRule:PRU00184}.				cytoskeleton organization (GO:0007010)|negative regulation of cell migration (GO:0030336)|negative regulation of Rac protein signal transduction (GO:0035021)|negative regulation of Rho protein signal transduction (GO:0035024)|regulation of ARF GTPase activity (GO:0032312)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	ARF GTPase activator activity (GO:0008060)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|Rho GTPase activator activity (GO:0005100)|zinc ion binding (GO:0008270)	p.A10T(1)		NS(1)|breast(7)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(14)|ovary(1)|prostate(2)|skin(4)|stomach(1)	53						AGCCACACAGCGATGTCCAGG	0.682																																					p.A10S		Atlas-SNP	.											ARAP3,NS,NS,0,1	ARAP3	139	.	1	Substitution - Missense(1)	NS(1)	c.G28T						.						27.0	28.0	27.0					5																	141060026		2203	4293	6496	SO:0001583	missense	64411	exon2			ACACAGCGATGTC	AJ310567	CCDS4266.1	5q31.3	2013-01-11	2008-09-22	2008-09-22	ENSG00000120318	ENSG00000120318		"""ADP-ribosylation factor GTPase activating proteins"", ""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	24097	protein-coding gene	gene with protein product		606647	"""centaurin, delta 3"""	CENTD3		11804589, 12015138	Standard	XM_005268497		Approved	FLJ21065, DRAG1	uc003llm.3	Q8WWN8	OTTHUMG00000129610	ENST00000239440.4:c.28G>T	chr5.hg19:g.141060026C>A	ENSP00000239440:p.Ala10Ser	29.0	0.0		17.0	10.0	NM_022481	B4DIT1|D3DQE3	Missense_Mutation	SNP	ENST00000239440.4	hg19	CCDS4266.1	.	.	.	.	.	.	.	.	.	.	C	12.96	2.093123	0.36952	.	.	ENSG00000120318	ENST00000239440;ENST00000504448	D;T	0.85339	-1.97;-0.01	4.39	-0.788	0.10939	Sterile alpha motif domain (2);Sterile alpha motif/pointed domain (2);Sterile alpha motif, type 2 (1);	0.581772	0.15624	N	0.252737	T	0.71634	0.3363	N	0.25890	0.77	0.80722	D	1	B	0.28055	0.199	B	0.33121	0.158	T	0.57388	-0.7820	10	0.51188	T	0.08	.	1.3608	0.02191	0.2954:0.3899:0.1437:0.171	.	10	Q8WWN8	ARAP3_HUMAN	S	10	ENSP00000239440:A10S;ENSP00000421148:A10S	ENSP00000239440:A10S	A	-	1	0	ARAP3	141040210	0.998000	0.40836	0.990000	0.47175	0.989000	0.77384	0.326000	0.19646	-0.401000	0.07644	-0.361000	0.07541	GCT	.	.		0.682	ARAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251805.1	NM_022481	
TDRD6	221400	hgsc.bcm.edu	37	6	46657236	46657236	+	Silent	SNP	A	A	G			TCGA-2Y-A9GY-01A-11D-A382-10	TCGA-2Y-A9GY-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	75a72b01-26d1-410f-a2f3-fabe09059eed	e1cd43c8-e295-4191-8754-0520f03119e1	g.chr6:46657236A>G	ENST00000316081.6	+	1	1371	c.1371A>G	c.(1369-1371)ccA>ccG	p.P457P	RP11-446F17.3_ENST00000422284.2_RNA|RP11-446F17.3_ENST00000571590.1_RNA|RP11-446F17.3_ENST00000434329.2_RNA|TDRD6_ENST00000544460.1_Silent_p.P457P	NM_001010870.2	NP_001010870.1	O60522	TDRD6_HUMAN	tudor domain containing 6	457	Poly-Glu.				germ cell development (GO:0007281)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|P granule (GO:0043186)				NS(1)|breast(9)|central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(25)|ovary(2)|pancreas(1)|prostate(1)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	80			Lung(136;0.192)			AGGAGGAACCAGAAACATCTC	0.468																																					p.P457P		Atlas-SNP	.											.	TDRD6	205	.	0			c.A1371G						.						88.0	80.0	83.0					6																	46657236		2203	4300	6503	SO:0001819	synonymous_variant	221400	exon1			GGAACCAGAAACA	AF039442	CCDS34470.1, CCDS55017.1	6p12.3	2013-01-23			ENSG00000180113	ENSG00000180113		"""Tudor domain containing"""	21339	protein-coding gene	gene with protein product	"""cancer/testis antigen 41.2"", ""spermatogenesis associated 36"""	611200				9610721	Standard	NM_001010870		Approved	NY-CO-45, bA446F17.4, CT41.2, SPATA36	uc003oyj.3	O60522	OTTHUMG00000014788	ENST00000316081.6:c.1371A>G	chr6.hg19:g.46657236A>G		32.0	0.0		59.0	29.0	NM_001168359	B3KWU2|F5H5M3|Q5HYB1|Q5VTS4|Q6ZMX5	Silent	SNP	ENST00000316081.6	hg19	CCDS34470.1																																																																																			.	.		0.468	TDRD6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040800.1	XM_166443	
TNFRSF21	27242	hgsc.bcm.edu	37	6	47200685	47200685	+	Missense_Mutation	SNP	T	T	C			TCGA-2Y-A9GY-01A-11D-A382-10	TCGA-2Y-A9GY-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	75a72b01-26d1-410f-a2f3-fabe09059eed	e1cd43c8-e295-4191-8754-0520f03119e1	g.chr6:47200685T>C	ENST00000296861.2	-	6	2177	c.1784A>G	c.(1783-1785)gAc>gGc	p.D595G		NM_014452.3	NP_055267.1	O75509	TNR21_HUMAN	tumor necrosis factor receptor superfamily, member 21	595					adaptive immune response (GO:0002250)|apoptotic process (GO:0006915)|B cell apoptotic process (GO:0001783)|cellular lipid metabolic process (GO:0044255)|cellular response to tumor necrosis factor (GO:0071356)|humoral immune response (GO:0006959)|myelination (GO:0042552)|negative regulation of B cell proliferation (GO:0030889)|negative regulation of interleukin-10 secretion (GO:2001180)|negative regulation of interleukin-13 secretion (GO:2000666)|negative regulation of interleukin-5 secretion (GO:2000663)|negative regulation of myelination (GO:0031642)|negative regulation of T cell proliferation (GO:0042130)|neuron apoptotic process (GO:0051402)|oligodendrocyte apoptotic process (GO:0097252)|regulation of oligodendrocyte differentiation (GO:0048713)|small molecule metabolic process (GO:0044281)|T cell receptor signaling pathway (GO:0050852)	axon (GO:0030424)|integral component of plasma membrane (GO:0005887)|intrinsic component of plasma membrane (GO:0031226)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(6)|lung(7)|pancreas(1)|skin(2)	21			Lung(136;0.189)			AGGCTGCAAGTCACAGGGGTC	0.522																																					p.D595G		Atlas-SNP	.											.	TNFRSF21	61	.	0			c.A1784G						.						80.0	81.0	81.0					6																	47200685		2203	4300	6503	SO:0001583	missense	27242	exon6			TGCAAGTCACAGG	AF068868	CCDS4921.1	6p21.1	2011-08-11			ENSG00000146072	ENSG00000146072		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	13469	protein-coding gene	gene with protein product	"""death receptor 6"""	605732				9714541	Standard	NM_014452		Approved	DR6, CD358	uc003oyv.3	O75509	OTTHUMG00000014796	ENST00000296861.2:c.1784A>G	chr6.hg19:g.47200685T>C	ENSP00000296861:p.Asp595Gly	80.0	0.0		120.0	26.0	NM_014452	B2RDI9|Q0D2P5|Q96D86	Missense_Mutation	SNP	ENST00000296861.2	hg19	CCDS4921.1	.	.	.	.	.	.	.	.	.	.	T	19.58	3.853495	0.71719	.	.	ENSG00000146072	ENST00000296861;ENST00000419206	T	0.70631	-0.5	5.84	5.84	0.93424	.	0.088018	0.85682	D	0.000000	T	0.69557	0.3124	L	0.27053	0.805	0.58432	D	0.999996	D	0.89917	1.0	D	0.74348	0.983	T	0.76184	-0.3052	10	0.87932	D	0	.	14.7818	0.69772	0.0:0.0:0.0:1.0	.	595	O75509	TNR21_HUMAN	G	595;284	ENSP00000296861:D595G	ENSP00000296861:D595G	D	-	2	0	TNFRSF21	47308644	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.040000	0.89188	2.232000	0.73038	0.533000	0.62120	GAC	.	.		0.522	TNFRSF21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040814.1	NM_014452	
PTP4A1	7803	hgsc.bcm.edu	37	6	64289208	64289208	+	Missense_Mutation	SNP	T	T	C			TCGA-2Y-A9GY-01A-11D-A382-10	TCGA-2Y-A9GY-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	75a72b01-26d1-410f-a2f3-fabe09059eed	e1cd43c8-e295-4191-8754-0520f03119e1	g.chr6:64289208T>C	ENST00000370651.3	+	5	1529	c.376T>C	c.(376-378)Tac>Cac	p.Y126H	PTP4A1_ENST00000370650.2_Intron	NM_003463.3	NP_003454.1	Q93096	TP4A1_HUMAN	protein tyrosine phosphatase type IVA, member 1	126	Interaction with ATF5. {ECO:0000250}.|Tyrosine-protein phosphatase.				cell cycle (GO:0007049)|multicellular organismal development (GO:0007275)|positive regulation of cell migration (GO:0030335)	cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	protein tyrosine phosphatase activity (GO:0004725)			large_intestine(3)|lung(4)|skin(1)	8	all_cancers(3;0.071)|all_epithelial(2;0.0146)|Lung NSC(77;0.175)		Epithelial(2;0.0365)|LUSC - Lung squamous cell carcinoma(74;0.0644)|all cancers(2;0.112)|Lung(124;0.13)			TGGAATGAAATACGAAGATGC	0.333																																					p.Y126H	Pancreas(91;1019 1502 28028 38110 51645)	Atlas-SNP	.											.	PTP4A1	13	.	0			c.T376C						.						123.0	114.0	117.0					6																	64289208		2203	4299	6502	SO:0001583	missense	7803	exon5			ATGAAATACGAAG	U48296	CCDS4965.1	6q12	2011-06-09			ENSG00000112245	ENSG00000112245		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PRLs"""	9634	protein-coding gene	gene with protein product		601585				9642300	Standard	NM_003463		Approved	PTPCAAX1, PRL-1	uc003pel.3	Q93096	OTTHUMG00000014949	ENST00000370651.3:c.376T>C	chr6.hg19:g.64289208T>C	ENSP00000359685:p.Tyr126His	303.0	0.0		515.0	35.0	NM_003463	B2R6C8|O00648|Q49A54	Missense_Mutation	SNP	ENST00000370651.3	hg19	CCDS4965.1	.	.	.	.	.	.	.	.	.	.	T	17.72	3.458009	0.63401	.	.	ENSG00000112245	ENST00000370651	D	0.86164	-2.08	5.96	5.96	0.96718	Protein-tyrosine phosphatase, receptor/non-receptor type (1);Protein-tyrosine/Dual-specificity phosphatase (1);	0.000000	0.85682	D	0.000000	D	0.86502	0.5948	M	0.84846	2.72	0.80722	D	1	B	0.19817	0.039	B	0.31016	0.123	D	0.84718	0.0738	10	0.46703	T	0.11	-12.6314	16.4221	0.83766	0.0:0.0:0.0:1.0	.	126	Q93096	TP4A1_HUMAN	H	126	ENSP00000359685:Y126H	ENSP00000359685:Y126H	Y	+	1	0	PTP4A1	64347167	1.000000	0.71417	0.992000	0.48379	0.846000	0.48090	8.015000	0.88690	2.283000	0.76528	0.477000	0.44152	TAC	.	.		0.333	PTP4A1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041083.2		
SIM1	6492	hgsc.bcm.edu	37	6	100896042	100896042	+	Missense_Mutation	SNP	A	A	C			TCGA-2Y-A9GY-01A-11D-A382-10	TCGA-2Y-A9GY-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	75a72b01-26d1-410f-a2f3-fabe09059eed	e1cd43c8-e295-4191-8754-0520f03119e1	g.chr6:100896042A>C	ENST00000369208.3	-	8	1612	c.830T>G	c.(829-831)cTg>cGg	p.L277R	SIM1_ENST00000262901.4_Missense_Mutation_p.L277R			P81133	SIM1_HUMAN	single-minded family bHLH transcription factor 1	277	PAS 2. {ECO:0000255|PROSITE- ProRule:PRU00140}.				cell differentiation (GO:0030154)|nervous system development (GO:0007399)|transcription, DNA-templated (GO:0006351)|ureteric bud development (GO:0001657)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)			breast(1)|central_nervous_system(4)|endometrium(5)|kidney(1)|large_intestine(15)|lung(34)|ovary(4)|prostate(1)|skin(5)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(5)	79		all_cancers(76;9.88e-06)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(107;0.0248)|Colorectal(196;0.13)		BRCA - Breast invasive adenocarcinoma(108;0.0774)		CGCGCAGCGCAGGTGGAAGGT	0.612																																					p.L277R		Atlas-SNP	.											SIM1,NS,lymphoid_neoplasm,0,1	SIM1	173	.	0			c.T830G						.						112.0	82.0	92.0					6																	100896042		2203	4300	6503	SO:0001583	missense	6492	exon7			CAGCGCAGGTGGA	U70212	CCDS5045.1	6q16.3	2013-10-17	2013-10-17		ENSG00000112246	ENSG00000112246		"""Basic helix-loop-helix proteins"""	10882	protein-coding gene	gene with protein product		603128	"""single-minded (Drosophila) homolog 1"", ""single-minded homolog 1 (Drosophila)"""			9199934, 11448938	Standard	NM_005068		Approved	bHLHe14	uc003pqj.4	P81133	OTTHUMG00000015275	ENST00000369208.3:c.830T>G	chr6.hg19:g.100896042A>C	ENSP00000358210:p.Leu277Arg	36.0	0.0		48.0	16.0	NM_005068	Q5TDP7	Missense_Mutation	SNP	ENST00000369208.3	hg19	CCDS5045.1	.	.	.	.	.	.	.	.	.	.	A	18.54	3.645429	0.67358	.	.	ENSG00000112246	ENST00000369208;ENST00000262901	T;T	0.22539	1.95;1.95	5.29	5.29	0.74685	PAS fold-3 (1);PAS (1);	0.000000	0.85682	D	0.000000	T	0.44582	0.1300	M	0.87381	2.88	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.55623	-0.8112	10	0.87932	D	0	.	15.2644	0.73649	1.0:0.0:0.0:0.0	.	277	P81133	SIM1_HUMAN	R	277	ENSP00000358210:L277R;ENSP00000262901:L277R	ENSP00000262901:L277R	L	-	2	0	SIM1	101002763	1.000000	0.71417	1.000000	0.80357	0.176000	0.22953	8.962000	0.93254	2.003000	0.58678	0.533000	0.62120	CTG	.	.		0.612	SIM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041628.3	NM_005068	
GRIK2	2898	hgsc.bcm.edu	37	6	102516350	102516350	+	Silent	SNP	C	C	T			TCGA-2Y-A9GY-01A-11D-A382-10	TCGA-2Y-A9GY-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	75a72b01-26d1-410f-a2f3-fabe09059eed	e1cd43c8-e295-4191-8754-0520f03119e1	g.chr6:102516350C>T	ENST00000421544.1	+	16	3181	c.2691C>T	c.(2689-2691)aaC>aaT	p.N897N	GRIK2_ENST00000369137.3_Silent_p.N821N|GRIK2_ENST00000413795.1_3'UTR|GRIK2_ENST00000369138.1_3'UTR|GRIK2_ENST00000369134.4_Silent_p.N848N	NM_021956.4	NP_068775.1	Q13002	GRIK2_HUMAN	glutamate receptor, ionotropic, kainate 2	897					behavioral fear response (GO:0001662)|cellular calcium ion homeostasis (GO:0006874)|glutamate receptor signaling pathway (GO:0007215)|intracellular protein transport (GO:0006886)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|neuronal action potential (GO:0019228)|positive regulation of synaptic transmission (GO:0050806)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of inhibitory postsynaptic membrane potential (GO:0060080)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of short-term neuronal synaptic plasticity (GO:0048172)|regulation of synaptic transmission (GO:0050804)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|kainate selective glutamate receptor complex (GO:0032983)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	extracellular-glutamate-gated ion channel activity (GO:0005234)|kainate selective glutamate receptor activity (GO:0015277)			NS(1)|breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(37)|ovary(2)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	83		all_cancers(76;1.19e-07)|Acute lymphoblastic leukemia(125;6.17e-11)|all_hematologic(75;6.01e-08)|all_epithelial(87;0.0121)|Colorectal(196;0.14)		all cancers(137;0.112)|BRCA - Breast invasive adenocarcinoma(108;0.124)|GBM - Glioblastoma multiforme(226;0.206)	Amobarbital(DB01351)|Aprobarbital(DB01352)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Methylphenobarbital(DB00849)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Primidone(DB00794)|Secobarbital(DB00418)|Talbutal(DB00306)|Thiopental(DB00599)	ACACATTTAACGACAGAAGGT	0.438																																					p.N897N		Atlas-SNP	.											.	GRIK2	487	.	0			c.C2691T						.						92.0	83.0	86.0					6																	102516350		2203	4300	6503	SO:0001819	synonymous_variant	2898	exon16			ATTTAACGACAGA		CCDS5048.1, CCDS5049.1, CCDS55045.1	6q16.3	2012-08-29			ENSG00000164418	ENSG00000164418		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4580	protein-coding gene	gene with protein product		138244		GLUR6		8034316	Standard	NM_021956		Approved	GluK2, MRT6	uc003pqp.4	Q13002	OTTHUMG00000016328	ENST00000421544.1:c.2691C>T	chr6.hg19:g.102516350C>T		100.0	0.0		135.0	50.0	NM_021956	A6NMY9|B5MCV0|D7RWZ3|D7RWZ4|D7RWZ5|D7RWZ6|D7RWZ7|Q8WWS1|Q96KS6|Q96KS7|Q96KS8	Silent	SNP	ENST00000421544.1	hg19	CCDS5048.1																																																																																			.	.		0.438	GRIK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043718.1		
CSMD1	64478	hgsc.bcm.edu	37	8	3046528	3046528	+	Missense_Mutation	SNP	A	A	G			TCGA-2Y-A9GY-01A-11D-A382-10	TCGA-2Y-A9GY-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	75a72b01-26d1-410f-a2f3-fabe09059eed	e1cd43c8-e295-4191-8754-0520f03119e1	g.chr8:3046528A>G	ENST00000520002.1	-	36	5962	c.5407T>C	c.(5407-5409)Tgc>Cgc	p.C1803R	CSMD1_ENST00000542608.1_Missense_Mutation_p.C1802R|CSMD1_ENST00000602557.1_Missense_Mutation_p.C1803R|CSMD1_ENST00000539096.1_Missense_Mutation_p.C1802R|CSMD1_ENST00000523387.1_5'UTR|CSMD1_ENST00000602723.1_Missense_Mutation_p.C1803R|CSMD1_ENST00000400186.3_Missense_Mutation_p.C1803R|CSMD1_ENST00000537824.1_Missense_Mutation_p.C1802R			Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1	1803	CUB 11. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		TTGCCACTGCAGGGTACTAAA	0.438																																					p.C1802R		Atlas-SNP	.											.	CSMD1	1469	.	0			c.T5404C						.						68.0	64.0	65.0					8																	3046528		1928	4138	6066	SO:0001583	missense	64478	exon35			CACTGCAGGGTAC			8p23.2	2012-04-17			ENSG00000183117	ENSG00000183117		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14026	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 24"""	608397					Standard	NM_033225		Approved	KIAA1890, PPP1R24	uc022aqr.1	Q96PZ7	OTTHUMG00000163605	ENST00000520002.1:c.5407T>C	chr8.hg19:g.3046528A>G	ENSP00000430733:p.Cys1803Arg	99.0	0.0		84.0	25.0	NM_033225	Q0H0J5|Q96QU9|Q96RM4	Missense_Mutation	SNP	ENST00000520002.1	hg19		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	17.31|17.31	3.357530|3.357530	0.61293|0.61293	.|.	.|.	ENSG00000183117|ENSG00000183117	ENST00000400186;ENST00000520002;ENST00000318252;ENST00000537824;ENST00000542608;ENST00000539096|ENST00000335551	T;T;T;T;T|.	0.66280|.	-0.2;-0.2;-0.2;-0.2;-0.2|.	5.55|5.55	5.55|5.55	0.83447|0.83447	CUB (5);|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.88676|0.88676	0.6501|0.6501	H|H	0.98199|0.98199	4.17|4.17	0.80722|0.80722	D|D	1|1	D;D;D|.	0.89917|.	0.999;0.966;1.0|.	D;D;D|.	0.97110|.	0.998;0.976;1.0|.	D|D	0.92872|0.92872	0.6315|0.6315	10|5	0.87932|.	D|.	0|.	.|.	15.7137|15.7137	0.77652|0.77652	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	1803;1803;1803|.	E5RIG2;Q96PZ7;Q96PZ7-4|.	.;CSMD1_HUMAN;.|.	R|P	1803;1803;1665;1802;1802;1802|1282	ENSP00000383047:C1803R;ENSP00000430733:C1803R;ENSP00000441462:C1802R;ENSP00000446243:C1802R;ENSP00000441675:C1802R|.	ENSP00000320445:C1665R|.	C|L	-|-	1|2	0|0	CSMD1|CSMD1	3033935|3033935	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.150000|0.150000	0.21749|0.21749	9.050000|9.050000	0.93843|0.93843	2.095000|2.095000	0.63458|0.63458	0.519000|0.519000	0.50382|0.50382	TGC|CTG	.	.		0.438	CSMD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000374500.2	NM_033225	
BHLHE22	27319	hgsc.bcm.edu	37	8	65494023	65494023	+	Missense_Mutation	SNP	A	A	G	rs62519837		TCGA-2Y-A9GY-01A-11D-A382-10	TCGA-2Y-A9GY-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	75a72b01-26d1-410f-a2f3-fabe09059eed	e1cd43c8-e295-4191-8754-0520f03119e1	g.chr8:65494023A>G	ENST00000321870.1	+	1	1210	c.676A>G	c.(676-678)Agc>Ggc	p.S226G	RP11-21C4.1_ENST00000517909.1_RNA	NM_152414.4	NP_689627.1	Q8NFJ8	BHE22_HUMAN	basic helix-loop-helix family, member e22	226	Ser-rich.				anterior commissure morphogenesis (GO:0021960)|cerebral cortex regionalization (GO:0021796)|corpus callosum morphogenesis (GO:0021540)|corticospinal tract morphogenesis (GO:0021957)|negative regulation of transcription, DNA-templated (GO:0045892)|retinal bipolar neuron differentiation (GO:0060040)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)	p.S234delS(1)|p.S226G(1)		NS(1)|central_nervous_system(1)|lung(1)|prostate(1)|skin(1)	5						cagcggcggcagcagcagcag	0.706																																					p.S226G	Colon(113;104 1586 2865 9855 18065)	Atlas-SNP	.											BHLHE22,extremity,malignant_melanoma,0,1	BHLHE22	21	.	2	Substitution - Missense(1)|Deletion - In frame(1)	central_nervous_system(1)|skin(1)	c.A676G						.						3.0	4.0	4.0					8																	65494023		1652	3428	5080	SO:0001583	missense	27319	exon1			GGCGGCAGCAGCA	U80755	CCDS6179.1	8q12.1	2009-01-12	2009-01-12	2009-01-12		ENSG00000180828		"""Basic helix-loop-helix proteins"""	11963	protein-coding gene	gene with protein product		613483	"""trinucleotide repeat containing 20"", ""basic helix-loop-helix domain containing, class B, 5"""	TNRC20, BHLHB5		9225980, 12213201, 18557763	Standard	NM_152414		Approved	CAGL85, Beta3, bHLHe22	uc003xvi.3	Q8NFJ8		ENST00000321870.1:c.676A>G	chr8.hg19:g.65494023A>G	ENSP00000318799:p.Ser226Gly	21.0	2.0		39.0	8.0	NM_152414		Missense_Mutation	SNP	ENST00000321870.1	hg19	CCDS6179.1	.	.	.	.	.	.	.	.	.	.	A	0.001	-3.714868	0.00005	.	.	ENSG00000180828	ENST00000321870	T	0.80033	-1.33	0.79	-1.26	0.09376	.	.	.	.	.	T	0.48642	0.1511	N	0.00926	-1.1	0.09310	N	1	B	0.26041	0.14	B	0.32805	0.153	T	0.47368	-0.9123	9	0.15499	T	0.54	.	3.5404	0.07809	0.3747:0.0:0.6253:0.0	rs62519837	226	Q8NFJ8	BHE22_HUMAN	G	226	ENSP00000318799:S226G	ENSP00000318799:S226G	S	+	1	0	BHLHE22	65656577	0.273000	0.24181	0.215000	0.23724	0.107000	0.19398	-0.535000	0.06142	-0.333000	0.08476	0.136000	0.15936	AGC	.	G|1.000;|0.000		0.706	BHLHE22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378549.1	NM_152414	
TIGD5	84948	hgsc.bcm.edu	37	8	144680335	144680335	+	Missense_Mutation	SNP	C	C	A			TCGA-2Y-A9GY-01A-11D-A382-10	TCGA-2Y-A9GY-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	75a72b01-26d1-410f-a2f3-fabe09059eed	e1cd43c8-e295-4191-8754-0520f03119e1	g.chr8:144680335C>A	ENST00000504548.2	+	1	262	c.262C>A	c.(262-264)Ctg>Atg	p.L88M	EEF1D_ENST00000532400.1_5'Flank|EEF1D_ENST00000526838.1_5'Flank|EEF1D_ENST00000395119.3_5'Flank|EEF1D_ENST00000529272.1_5'Flank|EEF1D_ENST00000531770.1_5'Flank|EEF1D_ENST00000317198.6_5'Flank|EEF1D_ENST00000524624.1_5'Flank|EEF1D_ENST00000423316.2_5'Flank|EEF1D_ENST00000419152.2_5'Flank|EEF1D_ENST00000442189.2_5'Flank|TIGD5_ENST00000321385.3_Missense_Mutation_p.L39M|EEF1D_ENST00000531621.1_5'Flank|EEF1D_ENST00000528610.1_5'Flank	NM_032862.4	NP_116251.4	Q53EQ6	TIGD5_HUMAN	tigger transposable element derived 5	88	HTH psq-type. {ECO:0000255|PROSITE- ProRule:PRU00320}.					nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(1)|lung(3)|ovary(1)|soft_tissue(1)|urinary_tract(1)	7	all_cancers(97;3.74e-11)|all_epithelial(106;2.62e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		Colorectal(110;0.134)|BRCA - Breast invasive adenocarcinoma(115;0.239)			GGGCGGGACGCTGCGCGGCTG	0.692																																					p.L88M		Atlas-SNP	.											.	TIGD5	22	.	0			c.C262A						.						13.0	13.0	13.0					8																	144680335		2168	4268	6436	SO:0001583	missense	84948	exon1			GGGACGCTGCGCG	AK027832	CCDS6406.1, CCDS6406.2	8q24.3	2008-02-01				ENSG00000179886			18336	protein-coding gene	gene with protein product							Standard	NM_032862		Approved	FLJ14926	uc003yyx.2	Q53EQ6		ENST00000504548.2:c.262C>A	chr8.hg19:g.144680335C>A	ENSP00000421489:p.Leu88Met	83.0	0.0		179.0	58.0	NM_032862	E7EWS2|Q6NT83|Q8N5A1|Q96JW8	Missense_Mutation	SNP	ENST00000504548.2	hg19	CCDS6406.2	.	.	.	.	.	.	.	.	.	.	c	15.64	2.891855	0.52014	.	.	ENSG00000179886	ENST00000504548;ENST00000321385	T;T	0.58060	0.36;0.36	4.31	4.31	0.51392	Homeodomain-related (1);Homeodomain-like (1);Helix-turn-helix, Psq-like (1);Centromere protein Cenp-B, DNA-binding domain 1 (1);	0.000000	0.37095	U	0.002254	T	0.67458	0.2895	L	0.52905	1.665	0.21841	N	0.999513	D	0.89917	1.0	D	0.75484	0.986	T	0.61481	-0.7054	10	0.54805	T	0.06	.	15.7972	0.78420	0.0:1.0:0.0:0.0	.	39	Q53EQ6	TIGD5_HUMAN	M	88;39	ENSP00000421489:L88M;ENSP00000315906:L39M	ENSP00000315906:L39M	L	+	1	2	TIGD5	144751478	0.961000	0.32948	1.000000	0.80357	0.522000	0.34438	1.196000	0.32198	1.934000	0.56057	0.165000	0.16767	CTG	.	.		0.692	TIGD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368269.1	NM_032862	
SLC35D2	11046	hgsc.bcm.edu	37	9	99113414	99113414	+	Silent	SNP	G	G	A			TCGA-2Y-A9GY-01A-11D-A382-10	TCGA-2Y-A9GY-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	75a72b01-26d1-410f-a2f3-fabe09059eed	e1cd43c8-e295-4191-8754-0520f03119e1	g.chr9:99113414G>A	ENST00000253270.7	-	6	521	c.459C>T	c.(457-459)gcC>gcT	p.A153A	SLC35D2_ENST00000375257.1_Silent_p.A153A|SLC35D2_ENST00000375259.4_Silent_p.A153A|SLC35D2_ENST00000482643.1_5'UTR	NM_007001.2	NP_008932.2	Q76EJ3	S35D2_HUMAN	solute carrier family 35 (UDP-GlcNAc/UDP-glucose transporter), member D2	153					carbohydrate derivative transport (GO:1901264)|carbohydrate metabolic process (GO:0005975)|carbohydrate transport (GO:0008643)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|nucleotide transmembrane transport (GO:1901679)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	nucleotide-sugar transmembrane transporter activity (GO:0005338)			endometrium(3)|large_intestine(3)|lung(4)|skin(2)	12		Acute lymphoblastic leukemia(62;0.0167)				CGAGAATAATGGCAAAGACAC	0.413																																					p.A153A		Atlas-SNP	.											.	SLC35D2	20	.	0			c.C459T						.						138.0	124.0	129.0					9																	99113414		2203	4300	6503	SO:0001819	synonymous_variant	11046	exon6			AATAATGGCAAAG	AB122077	CCDS6717.1, CCDS69625.1	9q22.33	2013-07-17	2013-07-17		ENSG00000130958	ENSG00000130958		"""Solute carriers"""	20799	protein-coding gene	gene with protein product		609182	"""solute carrier family 35, member D2"""			15607426	Standard	NM_007001		Approved	UGTrel8, SQV7L	uc004awc.3	Q76EJ3	OTTHUMG00000020293	ENST00000253270.7:c.459C>T	chr9.hg19:g.99113414G>A		124.0	0.0		164.0	54.0	NM_007001	O95454|Q498C1|Q75W21|Q7Z5X5	Silent	SNP	ENST00000253270.7	hg19	CCDS6717.1																																																																																			.	.		0.413	SLC35D2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053261.1		
SVEP1	79987	hgsc.bcm.edu	37	9	113261434	113261434	+	Missense_Mutation	SNP	G	G	A			TCGA-2Y-A9GY-01A-11D-A382-10	TCGA-2Y-A9GY-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	75a72b01-26d1-410f-a2f3-fabe09059eed	e1cd43c8-e295-4191-8754-0520f03119e1	g.chr9:113261434G>A	ENST00000401783.2	-	7	1904	c.1568C>T	c.(1567-1569)aCg>aTg	p.T523M	SVEP1_ENST00000302728.8_Missense_Mutation_p.T523M|SVEP1_ENST00000467821.1_5'UTR|SVEP1_ENST00000374469.1_Missense_Mutation_p.T500M|SVEP1_ENST00000374461.1_Missense_Mutation_p.T500M	NM_153366.3	NP_699197.3	Q4LDE5	SVEP1_HUMAN	sushi, von Willebrand factor type A, EGF and pentraxin domain containing 1	523	Sushi 3. {ECO:0000255|PROSITE- ProRule:PRU00302}.				cell adhesion (GO:0007155)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|chromatin binding (GO:0003682)			NS(1)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|cervix(2)|endometrium(19)|kidney(8)|large_intestine(24)|lung(58)|ovary(7)|prostate(7)|skin(1)|stomach(4)|upper_aerodigestive_tract(5)|urinary_tract(4)	147						ATAGCAGATCGTCCCAAATTT	0.483																																					p.T523M		Atlas-SNP	.											.	SVEP1	326	.	0			c.C1568T						.						61.0	60.0	60.0					9																	113261434		2006	4181	6187	SO:0001583	missense	79987	exon7			CAGATCGTCCCAA	AK027870		9q31-q32	2008-02-05	2005-03-15	2005-03-17	ENSG00000165124	ENSG00000165124			15985	protein-coding gene	gene with protein product		611691	"""chromosome 9 open reading frame 13"""	C9orf13			Standard	NM_153366		Approved	bA427L11.3, POLYDOM, FLJ13529	uc010mtz.3	Q4LDE5	OTTHUMG00000020482	ENST00000401783.2:c.1568C>T	chr9.hg19:g.113261434G>A	ENSP00000384917:p.Thr523Met	92.0	0.0		116.0	46.0	NM_153366	Q0P675|Q5D213|Q5T938|Q5VTE4|Q5VTE5|Q7Z387|Q7Z3G3|Q8NBT9|Q96JU7|Q9H284|Q9H8J9	Missense_Mutation	SNP	ENST00000401783.2	hg19	CCDS48004.1	.	.	.	.	.	.	.	.	.	.	G	1.137	-0.650572	0.03506	.	.	ENSG00000165124	ENST00000401783;ENST00000374469;ENST00000302728;ENST00000374461	T;T;T;T	0.47177	0.85;0.85;0.85;0.85	5.91	-1.35	0.09114	Complement control module (2);Sushi/SCR/CCP (2);	0.460626	0.25433	N	0.030719	T	0.20901	0.0503	N	0.11201	0.11	0.09310	N	1	B;B;B	0.22003	0.041;0.007;0.063	B;B;B	0.18263	0.004;0.004;0.021	T	0.15122	-1.0448	10	0.20519	T	0.43	.	6.3811	0.21536	0.485:0.0:0.3963:0.1187	.	523;523;523	E9PBN8;Q4LDE5;Q4LDE5-2	.;SVEP1_HUMAN;.	M	523;500;523;500	ENSP00000384917:T523M;ENSP00000363593:T500M;ENSP00000304118:T523M;ENSP00000363585:T500M	ENSP00000304118:T523M	T	-	2	0	SVEP1	112301255	0.001000	0.12720	0.002000	0.10522	0.013000	0.08279	0.015000	0.13355	-0.577000	0.05967	-0.794000	0.03295	ACG	.	.		0.483	SVEP1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			
MYO3A	53904	hgsc.bcm.edu	37	10	26446318	26446318	+	Missense_Mutation	SNP	G	G	C			TCGA-2Y-A9GY-01A-11D-A382-10	TCGA-2Y-A9GY-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	75a72b01-26d1-410f-a2f3-fabe09059eed	e1cd43c8-e295-4191-8754-0520f03119e1	g.chr10:26446318G>C	ENST00000265944.5	+	26	3039	c.2873G>C	c.(2872-2874)cGt>cCt	p.R958P	MYO3A_ENST00000543632.1_Intron	NM_017433.4	NP_059129.3	Q8NEV4	MYO3A_HUMAN	myosin IIIA	958	Myosin motor.				ATP catabolic process (GO:0006200)|inner ear development (GO:0048839)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of filopodium assembly (GO:0051491)|protein autophosphorylation (GO:0046777)|response to stimulus (GO:0050896)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|filamentous actin (GO:0031941)|filopodium (GO:0030175)|filopodium tip (GO:0032433)|myosin complex (GO:0016459)|photoreceptor inner segment (GO:0001917)|stereocilium bundle tip (GO:0032426)	actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|plus-end directed microfilament motor activity (GO:0060002)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.R958H(1)		NS(2)|breast(9)|central_nervous_system(3)|endometrium(9)|kidney(10)|large_intestine(28)|liver(1)|lung(46)|ovary(11)|pancreas(1)|prostate(6)|skin(11)|stomach(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	146						AATAGTGAGCGTCAGGCAAGA	0.408																																					p.R958P		Atlas-SNP	.											MYO3A,caecum,carcinoma,0,2	MYO3A	371	.	1	Substitution - Missense(1)	breast(1)	c.G2873C						.						139.0	131.0	133.0					10																	26446318		2203	4300	6503	SO:0001583	missense	53904	exon26			GTGAGCGTCAGGC	AF229172	CCDS7148.1	10p11.1	2011-09-27	2004-05-19		ENSG00000095777	ENSG00000095777		"""Myosins / Myosin superfamily : Class III"""	7601	protein-coding gene	gene with protein product		606808	"""deafness, autosomal recessive 30"""	DFNB30		10936054	Standard	NM_017433		Approved		uc001isn.2	Q8NEV4	OTTHUMG00000017837	ENST00000265944.5:c.2873G>C	chr10.hg19:g.26446318G>C	ENSP00000265944:p.Arg958Pro	118.0	0.0		136.0	17.0	NM_017433	Q4G0X2|Q5VZ28|Q8WX17|Q9NYS8	Missense_Mutation	SNP	ENST00000265944.5	hg19	CCDS7148.1	.	.	.	.	.	.	.	.	.	.	G	28.6	4.934020	0.92458	.	.	ENSG00000095777	ENST00000265944	D	0.87650	-2.28	5.31	5.31	0.75309	Myosin head, motor domain (2);	0.000000	0.85682	D	0.000000	D	0.94361	0.8187	M	0.85299	2.745	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.94745	0.7922	10	0.72032	D	0.01	.	19.3468	0.94367	0.0:0.0:1.0:0.0	.	958	Q8NEV4	MYO3A_HUMAN	P	958	ENSP00000265944:R958P	ENSP00000265944:R958P	R	+	2	0	MYO3A	26486324	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.809000	0.99208	2.640000	0.89533	0.655000	0.94253	CGT	.	.		0.408	MYO3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047259.1	NM_017433	
KIAA1462	57608	hgsc.bcm.edu	37	10	30318601	30318601	+	Missense_Mutation	SNP	C	C	T			TCGA-2Y-A9GY-01A-11D-A382-10	TCGA-2Y-A9GY-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	75a72b01-26d1-410f-a2f3-fabe09059eed	e1cd43c8-e295-4191-8754-0520f03119e1	g.chr10:30318601C>T	ENST00000375377.1	-	3	577	c.476G>A	c.(475-477)aGg>aAg	p.R159K		NM_020848.2	NP_065899.1	Q9P266	JCAD_HUMAN	KIAA1462	159					cell adhesion (GO:0007155)	cell-cell junction (GO:0005911)				breast(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|lung(23)|ovary(6)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)	75						ATGCTCTGACCTTCCTCCAAC	0.572																																					p.R159K		Atlas-SNP	.											.	KIAA1462	162	.	0			c.G476A						.						288.0	284.0	286.0					10																	30318601		2092	4224	6316	SO:0001583	missense	57608	exon3			TCTGACCTTCCTC	AB040895	CCDS41500.1	10p12.1	2013-04-23			ENSG00000165757	ENSG00000165757			29283	protein-coding gene	gene with protein product	"""junctional protein associated with coronary artery disease"""	614398				10819331, 21884682	Standard	NM_020848		Approved	JCAD	uc001iux.3	Q9P266	OTTHUMG00000017885	ENST00000375377.1:c.476G>A	chr10.hg19:g.30318601C>T	ENSP00000364526:p.Arg159Lys	82.0	0.0		104.0	15.0	NM_020848	Q5HYA7|Q5T992|Q86WZ9|Q9BYJ2	Missense_Mutation	SNP	ENST00000375377.1	hg19	CCDS41500.1	.	.	.	.	.	.	.	.	.	.	C	19.11	3.764313	0.69878	.	.	ENSG00000165757	ENST00000375377	T	0.15372	2.43	5.55	5.55	0.83447	.	0.211473	0.42964	D	0.000625	T	0.34803	0.0910	M	0.67953	2.075	0.09310	N	1	D	0.60575	0.988	P	0.57911	0.829	T	0.14144	-1.0483	10	0.41790	T	0.15	-34.187	15.0318	0.71713	0.0:0.8582:0.1418:0.0	.	159	Q9P266	K1462_HUMAN	K	159	ENSP00000364526:R159K	ENSP00000364526:R159K	R	-	2	0	KIAA1462	30358607	0.674000	0.27549	0.969000	0.41365	0.772000	0.43724	2.423000	0.44705	2.610000	0.88304	0.655000	0.94253	AGG	.	.		0.572	KIAA1462-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047409.1	NM_020848	
CYP2E1	1571	hgsc.bcm.edu	37	10	135340964	135340964	+	Missense_Mutation	SNP	T	T	C			TCGA-2Y-A9GY-01A-11D-A382-10	TCGA-2Y-A9GY-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	75a72b01-26d1-410f-a2f3-fabe09059eed	e1cd43c8-e295-4191-8754-0520f03119e1	g.chr10:135340964T>C	ENST00000463117.2	+	3	337	c.65T>C	c.(64-66)aTg>aCg	p.M22T	SPRN_ENST00000541506.1_Intron|CYP2E1_ENST00000252945.3_Missense_Mutation_p.M22T			P05181	CP2E1_HUMAN	cytochrome P450, family 2, subfamily E, polypeptide 1	22					drug metabolic process (GO:0017144)|heterocycle metabolic process (GO:0046483)|monoterpenoid metabolic process (GO:0016098)|oxidation-reduction process (GO:0055114)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to organonitrogen compound (GO:0010243)|response to ozone (GO:0010193)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|triglyceride metabolic process (GO:0006641)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|Golgi membrane (GO:0000139)|intrinsic component of endoplasmic reticulum membrane (GO:0031227)|mitochondrion (GO:0005739)	enzyme binding (GO:0019899)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxidoreductase activity (GO:0016491)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NAD(P)H as one donor, and incorporation of one atom of oxygen (GO:0016709)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen (GO:0016712)|oxygen binding (GO:0019825)			NS(1)|central_nervous_system(3)|endometrium(1)|kidney(4)|large_intestine(6)|liver(2)|lung(7)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	30		all_cancers(35;1.14e-09)|all_epithelial(44;5.79e-08)|Lung NSC(174;0.00263)|all_lung(145;0.0039)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.172)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;1.12e-06)|all cancers(32;1.43e-06)|Epithelial(32;1.71e-06)	Acetaminophen(DB00316)|Aldesleukin(DB00041)|Almotriptan(DB00918)|Alosetron(DB00969)|Aminophylline(DB01223)|Amitriptyline(DB00321)|Antipyrine(DB01435)|Azelastine(DB00972)|Benzyl alcohol(DB06770)|Bifonazole(DB04794)|Bromazepam(DB01558)|Brompheniramine(DB00835)|Bupropion(DB01156)|Caffeine(DB00201)|Carbinoxamine(DB00748)|Carvedilol(DB01136)|Chlorpromazine(DB00477)|Chlorzoxazone(DB00356)|Cimetidine(DB00501)|Citalopram(DB00215)|Clevidipine(DB04920)|Clofibrate(DB00636)|Clomifene(DB00882)|Clonazepam(DB01068)|Clotrimazole(DB00257)|Clozapine(DB00363)|Colchicine(DB01394)|Dacarbazine(DB00851)|Dalfampridine(DB06637)|Dapsone(DB00250)|Desipramine(DB01151)|Dexamethasone(DB01234)|Dexfenfluramine(DB01191)|Dexmedetomidine(DB00633)|Dextromethorphan(DB00514)|Diazepam(DB00829)|Diclofenac(DB00586)|Diethylstilbestrol(DB00255)|Disulfiram(DB00822)|Econazole(DB01127)|Enflurane(DB00228)|Enfuvirtide(DB00109)|Estrone(DB00655)|Ethanol(DB00898)|Ethanolamine Oleate(DB06689)|Ethosuximide(DB00593)|Etoposide(DB00773)|Etoricoxib(DB01628)|Felbamate(DB00949)|Fingolimod(DB08868)|Flunitrazepam(DB01544)|Fluphenazine(DB00623)|Flurazepam(DB00690)|Fluvoxamine(DB00176)|Folic Acid(DB00158)|Fomepizole(DB01213)|Glucosamine(DB01296)|Halothane(DB01159)|Hexobarbital(DB01355)|Iloperidone(DB04946)|Imipramine(DB00458)|Isoflurane(DB00753)|Isoniazid(DB00951)|Isosorbide Dinitrate(DB00883)|Itraconazole(DB01167)|Menadione(DB00170)|Meprobamate(DB00371)|Methazolamide(DB00703)|Methimazole(DB00763)|Methotrimeprazine(DB01403)|Methoxyflurane(DB01028)|Metyrapone(DB01011)|Mexiletine(DB00379)|Miconazole(DB01110)|Midazolam(DB00683)|Mitoxantrone(DB01204)|Nicardipine(DB00622)|Nicotine(DB00184)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nitrazepam(DB01595)|Nortriptyline(DB00540)|Ondansetron(DB00904)|Orphenadrine(DB01173)|Oxaliplatin(DB00526)|Paramethadione(DB00617)|Phenelzine(DB00780)|Phenobarbital(DB01174)|Pilocarpine(DB01085)|Pimozide(DB01100)|Proguanil(DB01131)|Propofol(DB00818)|Quinidine(DB00908)|Quinine(DB00468)|Rifampicin(DB01045)|Ritonavir(DB00503)|Rufinamide(DB06201)|S-Adenosylmethionine(DB00118)|Selegiline(DB01037)|Sevoflurane(DB01236)|Sildenafil(DB00203)|Streptozocin(DB00428)|Sulfadiazine(DB00359)|Sulfanilamide(DB00259)|Tamoxifen(DB00675)|Thalidomide(DB01041)|Theobromine(DB01412)|Theophylline(DB00277)|Thiopental(DB00599)|Thioridazine(DB00679)|Ticlopidine(DB00208)|Tioconazole(DB01007)|Trabectedin(DB05109)|Tranylcypromine(DB00752)|Trimethadione(DB00347)|Ursodeoxycholic acid(DB01586)|Zafirlukast(DB00549)|Zopiclone(DB01198)	CTGGTGTCCATGTGGAGGCAG	0.632									Naso-/Oropharyngeal/Laryngeal Cancer, Familial Clustering of																												p.M22T		Atlas-SNP	.											.	CYP2E1	69	.	0			c.T65C						.						57.0	57.0	57.0					10																	135340964		2203	4300	6503	SO:0001583	missense	1571	exon1	Familial Cancer Database	incl.: Familial Head and Neck Cancer	TGTCCATGTGGAG	J02843	CCDS7686.1	10q26.3	2013-05-03	2003-01-14	2002-09-13	ENSG00000130649	ENSG00000130649		"""Cytochrome P450s"""	2631	protein-coding gene	gene with protein product		124040	"""cytochrome P450, subfamily IIE (ethanol-inducible), polypeptide 1"""	CYP2E			Standard	NM_000773		Approved		uc001lnj.1	P05181	OTTHUMG00000019322	ENST00000463117.2:c.65T>C	chr10.hg19:g.135340964T>C	ENSP00000440689:p.Met22Thr	57.0	0.0		77.0	17.0	NM_000773	Q5VZD5|Q6NWT9|Q9UK47	Missense_Mutation	SNP	ENST00000463117.2	hg19	CCDS7686.1	.	.	.	.	.	.	.	.	.	.	T	11.15	1.554352	0.27739	.	.	ENSG00000130649	ENST00000463117;ENST00000541261;ENST00000252945	T;T;T	0.67345	-0.26;1.98;-0.26	4.86	3.73	0.42828	.	1.055870	0.07266	N	0.868308	T	0.43787	0.1263	N	0.08118	0	0.18873	N	0.999981	B	0.09022	0.002	B	0.09377	0.004	T	0.31138	-0.9954	10	0.25751	T	0.34	.	4.3703	0.11244	0.1734:0.093:0.0:0.7336	.	22	P05181	CP2E1_HUMAN	T	22	ENSP00000440689:M22T;ENSP00000437799:M22T;ENSP00000252945:M22T	ENSP00000252945:M22T	M	+	2	0	CYP2E1	135190954	0.278000	0.24230	0.711000	0.30485	0.843000	0.47879	1.738000	0.38207	0.990000	0.38787	0.460000	0.39030	ATG	.	.		0.632	CYP2E1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051161.2	NM_000773	
GALNT18	374378	hgsc.bcm.edu	37	11	11394087	11394087	+	Missense_Mutation	SNP	C	C	A			TCGA-2Y-A9GY-01A-11D-A382-10	TCGA-2Y-A9GY-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	75a72b01-26d1-410f-a2f3-fabe09059eed	e1cd43c8-e295-4191-8754-0520f03119e1	g.chr11:11394087C>A	ENST00000227756.4	-	6	1478	c.1067G>T	c.(1066-1068)gGc>gTc	p.G356V		NM_198516.2	NP_940918.2	Q6P9A2	GLT18_HUMAN	polypeptide N-acetylgalactosaminyltransferase 18	356	Catalytic subdomain B.				protein glycosylation (GO:0006486)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)										CACATTCTCGCCCCCGTAGAC	0.597																																					p.G356V		Atlas-SNP	.											.	.	.	.	0			c.G1067T						.						99.0	79.0	86.0					11																	11394087		2201	4294	6495	SO:0001583	missense	374378	exon6			TTCTCGCCCCCGT	AK055111	CCDS7807.1	11p15	2014-03-13	2014-03-13	2013-01-25	ENSG00000110328	ENSG00000110328	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	30488	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 18"""	615136	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 4"", ""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 18"""	GALNTL4		22186971	Standard	NM_198516		Approved	MGC71806, GALNT15, GalNAc-T18	uc001mjo.2	Q6P9A2	OTTHUMG00000165707	ENST00000227756.4:c.1067G>T	chr11.hg19:g.11394087C>A	ENSP00000227756:p.Gly356Val	57.0	0.0		81.0	11.0	NM_198516	O95903|Q8NDY9	Missense_Mutation	SNP	ENST00000227756.4	hg19	CCDS7807.1	.	.	.	.	.	.	.	.	.	.	C	25.9	4.688022	0.88639	.	.	ENSG00000110328	ENST00000227756	T	0.67865	-0.29	6.0	6.0	0.97389	.	0.063492	0.64402	N	0.000008	D	0.85919	0.5809	M	0.90369	3.11	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.87396	0.2366	10	0.66056	D	0.02	.	19.1107	0.93315	0.0:1.0:0.0:0.0	.	356	Q6P9A2	GLTL4_HUMAN	V	356	ENSP00000227756:G356V	ENSP00000227756:G356V	G	-	2	0	GALNTL4	11350663	1.000000	0.71417	0.999000	0.59377	0.944000	0.59088	7.818000	0.86416	2.850000	0.98022	0.650000	0.86243	GGC	.	.		0.597	GALNT18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385848.1	NM_198516	
OR5W2	390148	hgsc.bcm.edu	37	11	55681443	55681443	+	Missense_Mutation	SNP	T	T	C			TCGA-2Y-A9GY-01A-11D-A382-10	TCGA-2Y-A9GY-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	75a72b01-26d1-410f-a2f3-fabe09059eed	e1cd43c8-e295-4191-8754-0520f03119e1	g.chr11:55681443T>C	ENST00000344514.1	-	1	615	c.616A>G	c.(616-618)Att>Gtt	p.I206V		NM_001001960.1	NP_001001960.1	Q8NH69	OR5W2_HUMAN	olfactory receptor, family 5, subfamily W, member 2	206						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(28)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	49						CTCAGTTCAATAAAACCAAAG	0.388																																					p.I206V	Melanoma(48;171 1190 15239 43886 49348)	Atlas-SNP	.											.	OR5W2	112	.	0			c.A616G						.						58.0	61.0	60.0					11																	55681443		2201	4296	6497	SO:0001583	missense	390148	exon1			GTTCAATAAAACC	BK004398	CCDS31513.1	11q11	2012-08-09		2004-03-10	ENSG00000187612	ENSG00000187612		"""GPCR / Class A : Olfactory receptors"""	15299	protein-coding gene	gene with protein product				OR5W2P, OR5W3P			Standard	NM_001001960		Approved		uc010rir.2	Q8NH69	OTTHUMG00000166818	ENST00000344514.1:c.616A>G	chr11.hg19:g.55681443T>C	ENSP00000342448:p.Ile206Val	120.0	0.0		125.0	33.0	NM_001001960		Missense_Mutation	SNP	ENST00000344514.1	hg19	CCDS31513.1	.	.	.	.	.	.	.	.	.	.	T	8.977	0.974421	0.18736	.	.	ENSG00000187612	ENST00000344514	T	0.00044	8.83	5.0	5.0	0.66597	GPCR, rhodopsin-like superfamily (1);	0.000000	0.41097	D	0.000959	T	0.00073	0.0002	N	0.12746	0.255	0.24431	N	0.994572	B	0.12013	0.005	B	0.20577	0.03	T	0.19582	-1.0301	10	0.02654	T	1	.	12.6626	0.56822	0.0:0.0:0.0:1.0	.	206	Q8NH69	OR5W2_HUMAN	V	206	ENSP00000342448:I206V	ENSP00000342448:I206V	I	-	1	0	OR5W2	55438019	0.000000	0.05858	0.879000	0.34478	0.601000	0.36947	0.255000	0.18333	1.870000	0.54199	0.443000	0.29094	ATT	.	.		0.388	OR5W2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391523.1	NM_001001960	
OR5I1	10798	hgsc.bcm.edu	37	11	55703115	55703115	+	Missense_Mutation	SNP	T	T	A			TCGA-2Y-A9GY-01A-11D-A382-10	TCGA-2Y-A9GY-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	75a72b01-26d1-410f-a2f3-fabe09059eed	e1cd43c8-e295-4191-8754-0520f03119e1	g.chr11:55703115T>A	ENST00000301532.3	-	1	761	c.762A>T	c.(760-762)caA>caT	p.Q254H		NM_006637.1	NP_006628.1	Q13606	OR5I1_HUMAN	olfactory receptor, family 5, subfamily I, member 1	254					signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(34)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	52						GGAGAGTCCCTTGGTAGATCG	0.433																																					p.Q254H		Atlas-SNP	.											.	OR5I1	110	.	0			c.A762T						.						74.0	73.0	73.0					11																	55703115		2201	4296	6497	SO:0001583	missense	10798	exon1			AGTCCCTTGGTAG	BC069093	CCDS7949.1	11q11	2012-08-09			ENSG00000167825	ENSG00000167825		"""GPCR / Class A : Olfactory receptors"""	8347	protein-coding gene	gene with protein product		608496				9017400, 9787077	Standard	NM_006637		Approved	HSOlf1, OLF1	uc010ris.2	Q13606	OTTHUMG00000166821	ENST00000301532.3:c.762A>T	chr11.hg19:g.55703115T>A	ENSP00000301532:p.Gln254His	97.0	0.0		104.0	31.0	NM_006637	Q6IEU4	Missense_Mutation	SNP	ENST00000301532.3	hg19	CCDS7949.1	.	.	.	.	.	.	.	.	.	.	T	7.091	0.572151	0.13623	.	.	ENSG00000167825	ENST00000301532	T	0.36699	1.24	5.16	2.02	0.26589	GPCR, rhodopsin-like superfamily (1);	0.155531	0.30374	N	0.009764	T	0.20618	0.0496	N	0.00690	-1.25	0.30772	N	0.74296	D	0.71674	0.998	D	0.83275	0.996	T	0.10109	-1.0644	10	0.31617	T	0.26	.	4.2144	0.10528	0.2718:0.5533:0.0:0.1749	.	254	Q13606	OR5I1_HUMAN	H	254	ENSP00000301532:Q254H	ENSP00000301532:Q254H	Q	-	3	2	OR5I1	55459691	0.000000	0.05858	0.779000	0.31741	0.032000	0.12392	-0.356000	0.07661	0.646000	0.30693	-0.925000	0.02716	CAA	.	.		0.433	OR5I1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391528.1	NM_006637	
TCN1	6947	hgsc.bcm.edu	37	11	59623355	59623355	+	Nonsense_Mutation	SNP	G	G	T	rs146250932	byFrequency	TCGA-2Y-A9GY-01A-11D-A382-10	TCGA-2Y-A9GY-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	75a72b01-26d1-410f-a2f3-fabe09059eed	e1cd43c8-e295-4191-8754-0520f03119e1	g.chr11:59623355G>T	ENST00000257264.3	-	6	1028	c.924C>A	c.(922-924)tgC>tgA	p.C308*	TCN1_ENST00000532419.1_Intron	NM_001062.3	NP_001053.2	P20061	TCO1_HUMAN	transcobalamin I (vitamin B12 binding protein, R binder family)	308	Globular N-terminal alpha domain.				cobalamin metabolic process (GO:0009235)|cobalamin transport (GO:0015889)|cobalt ion transport (GO:0006824)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	cobalamin binding (GO:0031419)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(15)|ovary(2)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	29		all_epithelial(135;0.198)			Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	AAGCAGAGACGCAAGAAGAGT	0.443																																					p.C308X		Atlas-SNP	.											TCN1,bladder,carcinoma,0,1	TCN1	64	.	0			c.C924A						.						113.0	112.0	113.0					11																	59623355		2201	4295	6496	SO:0001587	stop_gained	6947	exon6			AGAGACGCAAGAA	J05068	CCDS7978.1	11q11-q12	2008-07-21			ENSG00000134827	ENSG00000134827			11652	protein-coding gene	gene with protein product	"""haptocorin"", ""haptocorrin"""	189905					Standard	NM_001062		Approved	TCI, TC1	uc001noj.2	P20061	OTTHUMG00000167400	ENST00000257264.3:c.924C>A	chr11.hg19:g.59623355G>T	ENSP00000257264:p.Cys308*	70.0	0.0		88.0	19.0	NM_001062	A8KAC5|Q8WV77	Nonsense_Mutation	SNP	ENST00000257264.3	hg19	CCDS7978.1	.	.	.	.	.	.	.	.	.	.	g	18.95	3.732387	0.69189	.	.	ENSG00000134827	ENST00000257264	.	.	.	4.83	2.35	0.29111	.	0.519912	0.16168	N	0.226457	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	5.7723	0.18259	0.7819:0.0:0.2181:0.0	.	.	.	.	X	308	.	ENSP00000257264:C308X	C	-	3	2	TCN1	59379931	0.005000	0.15991	0.369000	0.25952	0.289000	0.27227	-0.253000	0.08794	0.683000	0.31428	-0.451000	0.05528	TGC	.	G|0.999;A|0.001		0.443	TCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394503.1	NM_001062	
AHNAK	79026	hgsc.bcm.edu	37	11	62296756	62296756	+	Silent	SNP	T	T	C			TCGA-2Y-A9GY-01A-11D-A382-10	TCGA-2Y-A9GY-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	75a72b01-26d1-410f-a2f3-fabe09059eed	e1cd43c8-e295-4191-8754-0520f03119e1	g.chr11:62296756T>C	ENST00000378024.4	-	5	5407	c.5133A>G	c.(5131-5133)aaA>aaG	p.K1711K	AHNAK_ENST00000530124.1_Intron|AHNAK_ENST00000257247.7_Intron	NM_001620.1	NP_001611.1	Q09666	AHNK_HUMAN	AHNAK nucleoprotein	1711					protein oligomerization (GO:0051259)|regulation of RNA splicing (GO:0043484)|regulation of voltage-gated calcium channel activity (GO:1901385)	actin cytoskeleton (GO:0015629)|cell-cell contact zone (GO:0044291)|costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|vesicle (GO:0031982)	poly(A) RNA binding (GO:0044822)|S100 protein binding (GO:0044548)|structural molecule activity conferring elasticity (GO:0097493)			NS(3)|autonomic_ganglia(1)|breast(10)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(33)|large_intestine(40)|liver(1)|lung(108)|ovary(13)|pancreas(4)|prostate(5)|skin(16)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	268		Melanoma(852;0.155)				TCTTGGGCATTTTCAGGTGCC	0.483																																					p.K1711K		Atlas-SNP	.											.	AHNAK	532	.	0			c.A5133G						.						219.0	225.0	223.0					11																	62296756		2202	4299	6501	SO:0001819	synonymous_variant	79026	exon5			GGGCATTTTCAGG	M80899	CCDS31584.1, CCDS44625.1	11q12-q13	2008-02-05	2007-03-30		ENSG00000124942	ENSG00000124942			347	protein-coding gene	gene with protein product	"""desmoyokin"""	103390	"""AHNAK nucleoprotein (desmoyokin)"""			7987395, 12153988	Standard	NM_024060		Approved	MGC5395	uc001ntl.3	Q09666	OTTHUMG00000167558	ENST00000378024.4:c.5133A>G	chr11.hg19:g.62296756T>C		109.0	0.0		99.0	4.0	NM_001620	A1A586	Silent	SNP	ENST00000378024.4	hg19	CCDS31584.1																																																																																			.	.		0.483	AHNAK-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395572.1	NM_024060	
TRIM77	390231	hgsc.bcm.edu	37	11	89450720	89450720	+	Missense_Mutation	SNP	G	G	T			TCGA-2Y-A9GY-01A-11D-A382-10	TCGA-2Y-A9GY-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	75a72b01-26d1-410f-a2f3-fabe09059eed	e1cd43c8-e295-4191-8754-0520f03119e1	g.chr11:89450720G>T	ENST00000398290.3	+	6	1033	c.1033G>T	c.(1033-1035)Gtg>Ttg	p.V345L		NM_001146162.1	NP_001139634.1	I1YAP6	TRI77_HUMAN	tripartite motif containing 77	345	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.					intracellular (GO:0005622)	zinc ion binding (GO:0008270)										TTACTGGGAGGTGGATGTGAA	0.448																																					p.V345L		Atlas-SNP	.											.	.	.	.	0			c.G1033T						.						158.0	131.0	139.0					11																	89450720		692	1591	2283	SO:0001583	missense	390231	exon6			TGGGAGGTGGATG		CCDS60929.1	11q14.3	2014-02-17	2013-01-14	2013-01-14	ENSG00000214414	ENSG00000214414		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	34228	protein-coding gene	gene with protein product			"""tripartite motif-containing 77"", ""tripartite motif containing 77, pseudogene"""	TRIM77P			Standard	NM_001146162		Approved		uc010rtw.2	I1YAP6	OTTHUMG00000167624	ENST00000398290.3:c.1033G>T	chr11.hg19:g.89450720G>T	ENSP00000474003:p.Val345Leu	106.0	0.0		74.0	14.0	NM_001146162		Missense_Mutation	SNP	ENST00000398290.3	hg19																																																																																				.	.		0.448	TRIM77-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_001146162	
ZC3H12C	85463	hgsc.bcm.edu	37	11	110035069	110035069	+	Missense_Mutation	SNP	A	A	G			TCGA-2Y-A9GY-01A-11D-A382-10	TCGA-2Y-A9GY-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	75a72b01-26d1-410f-a2f3-fabe09059eed	e1cd43c8-e295-4191-8754-0520f03119e1	g.chr11:110035069A>G	ENST00000278590.3	+	6	1310	c.1259A>G	c.(1258-1260)aAg>aGg	p.K420R	ZC3H12C_ENST00000453089.2_Missense_Mutation_p.K389R|ZC3H12C_ENST00000528673.1_Missense_Mutation_p.K421R	NM_033390.1	NP_203748.1	Q9C0D7	ZC12C_HUMAN	zinc finger CCCH-type containing 12C	420							endonuclease activity (GO:0004519)|metal ion binding (GO:0046872)			endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|lung(16)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	37		all_cancers(61;3.24e-13)|all_epithelial(67;1.27e-07)|Melanoma(852;1.46e-05)|all_hematologic(158;3.66e-05)|Acute lymphoblastic leukemia(157;3.95e-05)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)|Breast(348;0.0544)		Epithelial(105;1.72e-06)|BRCA - Breast invasive adenocarcinoma(274;1.17e-05)|all cancers(92;9e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.0279)		TTCTTAGGAAAGAAGTGTACC	0.428																																					p.K420R		Atlas-SNP	.											.	ZC3H12C	83	.	0			c.A1259G						.						28.0	27.0	27.0					11																	110035069		1900	4117	6017	SO:0001583	missense	85463	exon6			TAGGAAAGAAGTG		CCDS44727.1	11q22.3	2012-07-05			ENSG00000149289	ENSG00000149289		"""Zinc fingers, CCCH-type domain containing"""	29362	protein-coding gene	gene with protein product	"""MCP induced protein 3"""	615001				11214970, 18178554	Standard	NM_033390		Approved	KIAA1726, MCPIP3	uc009yxw.3	Q9C0D7	OTTHUMG00000166572	ENST00000278590.3:c.1259A>G	chr11.hg19:g.110035069A>G	ENSP00000278590:p.Lys420Arg	50.0	0.0		55.0	13.0	NM_033390	B4DI65|B4DR47	Missense_Mutation	SNP	ENST00000278590.3	hg19	CCDS44727.1	.	.	.	.	.	.	.	.	.	.	A	16.65	3.182575	0.57800	.	.	ENSG00000149289	ENST00000278590;ENST00000528673;ENST00000453089	T;T;T	0.46819	0.86;0.86;0.86	5.76	5.76	0.90799	Zinc finger, CCCH-type (1);	0.000000	0.85682	D	0.000000	T	0.61286	0.2335	L	0.42245	1.32	0.53688	D	0.999973	P;D;P	0.76494	0.615;0.999;0.615	B;D;B	0.80764	0.219;0.994;0.219	T	0.59016	-0.7533	10	0.38643	T	0.18	-27.7098	16.0668	0.80887	1.0:0.0:0.0:0.0	.	421;420;420	B4DR47;B4DI65;Q9C0D7	.;.;ZC12C_HUMAN	R	420;421;389	ENSP00000278590:K420R;ENSP00000431821:K421R;ENSP00000413094:K389R	ENSP00000278590:K420R	K	+	2	0	ZC3H12C	109540279	1.000000	0.71417	1.000000	0.80357	0.943000	0.58893	7.576000	0.82467	2.192000	0.70111	0.459000	0.35465	AAG	.	.		0.428	ZC3H12C-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000390491.1	NM_033390	
IGSF9B	22997	hgsc.bcm.edu	37	11	133790637	133790637	+	Missense_Mutation	SNP	C	C	T			TCGA-2Y-A9GY-01A-11D-A382-10	TCGA-2Y-A9GY-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	75a72b01-26d1-410f-a2f3-fabe09059eed	e1cd43c8-e295-4191-8754-0520f03119e1	g.chr11:133790637C>T	ENST00000321016.8	-	18	3213	c.2983G>A	c.(2983-2985)Gtc>Atc	p.V995I	IGSF9B_ENST00000533871.2_Missense_Mutation_p.V995I			Q9UPX0	TUTLB_HUMAN	immunoglobulin superfamily, member 9B	995	Pro-rich.				homophilic cell adhesion (GO:0007156)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)	dendrite (GO:0030425)|inhibitory synapse (GO:0060077)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)				breast(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(18)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	44	all_hematologic(175;0.127)	all_cancers(12;1.58e-21)|all_epithelial(12;5.17e-16)|all_lung(97;1.6e-05)|Lung NSC(97;3.86e-05)|Breast(109;0.000126)|Medulloblastoma(222;0.0245)|all_neural(223;0.0505)|Esophageal squamous(93;0.0559)		Epithelial(10;7.19e-10)|BRCA - Breast invasive adenocarcinoma(10;9.69e-09)|all cancers(11;1.23e-08)|OV - Ovarian serous cystadenocarcinoma(99;0.00328)|Lung(977;0.221)		GACGACATGACGGAGCTCAGG	0.657																																					p.V995I		Atlas-SNP	.											.	IGSF9B	290	.	0			c.G2983A						.						28.0	32.0	30.0					11																	133790637		2028	4170	6198	SO:0001583	missense	22997	exon18			ACATGACGGAGCT	AK097578	CCDS61010.1	11q25	2013-02-11	2005-10-12	2005-11-20				"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	32326	protein-coding gene	gene with protein product		613773					Standard	NM_001277285		Approved	KIAA1030	uc031qfh.1	Q9UPX0		ENST00000321016.8:c.2983G>A	chr11.hg19:g.133790637C>T	ENSP00000317980:p.Val995Ile	79.0	0.0		61.0	15.0	NM_014987	G5EA26	Missense_Mutation	SNP	ENST00000321016.8	hg19		.	.	.	.	.	.	.	.	.	.	c	14.16	2.453566	0.43531	.	.	ENSG00000080854	ENST00000321016;ENST00000533871	T;T	0.68624	-0.02;-0.34	4.93	4.0	0.46444	.	0.184196	0.26166	N	0.025944	T	0.48447	0.1500	N	0.24115	0.695	0.26237	N	0.978926	P	0.34587	0.458	B	0.20184	0.028	T	0.39781	-0.9597	10	0.44086	T	0.13	.	14.0103	0.64493	0.1527:0.8473:0.0:0.0	.	995	Q9UPX0	TUTLB_HUMAN	I	995;837	ENSP00000317980:V995I;ENSP00000436552:V837I	ENSP00000317980:V995I	V	-	1	0	IGSF9B	133295847	1.000000	0.71417	0.367000	0.25926	0.647000	0.38526	5.682000	0.68182	1.031000	0.39867	0.550000	0.68814	GTC	.	.		0.657	IGSF9B-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		XM_290502	
CHD4	1108	hgsc.bcm.edu	37	12	6682294	6682294	+	Silent	SNP	G	G	A			TCGA-2Y-A9GY-01A-11D-A382-10	TCGA-2Y-A9GY-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	75a72b01-26d1-410f-a2f3-fabe09059eed	e1cd43c8-e295-4191-8754-0520f03119e1	g.chr12:6682294G>A	ENST00000357008.2	-	38	5666	c.5503C>T	c.(5503-5505)Ctg>Ttg	p.L1835L	CHD4_ENST00000309577.6_Silent_p.L1863L|CHD4_ENST00000544040.1_Silent_p.L1828L|CHD4_ENST00000544484.1_Silent_p.L1860L	NM_001273.2	NP_001264.2	Q14839	CHD4_HUMAN	chromodomain helicase DNA binding protein 4	1835	Required for interaction with PCNT.				ATP-dependent chromatin remodeling (GO:0043044)|DNA duplex unwinding (GO:0032508)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|spindle assembly (GO:0051225)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|NuRD complex (GO:0016581)|protein complex (GO:0043234)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|RNA polymerase II repressing transcription factor binding (GO:0001103)|zinc ion binding (GO:0008270)			central_nervous_system(2)	2						TCCTTGGACAGGTGCTGATGA	0.567																																					p.L1835L	Colon(32;586 792 4568 16848 45314)	Atlas-SNP	.											.	CHD4	539	.	0			c.C5503T						.						149.0	125.0	133.0					12																	6682294		2203	4300	6503	SO:0001819	synonymous_variant	1108	exon38			TGGACAGGTGCTG	X86691	CCDS8552.1	12p13	2013-01-28				ENSG00000111642		"""Zinc fingers, PHD-type"""	1919	protein-coding gene	gene with protein product		603277				7575689, 8843877	Standard	XM_006718958		Approved	Mi-2b, Mi2-BETA	uc001qpo.3	Q14839		ENST00000357008.2:c.5503C>T	chr12.hg19:g.6682294G>A		73.0	0.0		130.0	20.0	NM_001273	Q8IXZ5	Silent	SNP	ENST00000357008.2	hg19	CCDS8552.1																																																																																			.	.		0.567	CHD4-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001273	
NECAP1	25977	hgsc.bcm.edu	37	12	8245601	8245601	+	Missense_Mutation	SNP	A	A	G			TCGA-2Y-A9GY-01A-11D-A382-10	TCGA-2Y-A9GY-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	75a72b01-26d1-410f-a2f3-fabe09059eed	e1cd43c8-e295-4191-8754-0520f03119e1	g.chr12:8245601A>G	ENST00000339754.5	+	6	704	c.626A>G	c.(625-627)cAt>cGt	p.H209R		NM_015509.3	NP_056324.2	Q8NC96	NECP1_HUMAN	NECAP endocytosis associated 1	209					endocytosis (GO:0006897)|protein transport (GO:0015031)	clathrin vesicle coat (GO:0030125)|coated pit (GO:0005905)|plasma membrane (GO:0005886)				cervix(1)|lung(5)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	10				Kidney(36;0.0915)		ATCAGCAATCATGTCACCCCA	0.493																																					p.H209R		Atlas-SNP	.											.	NECAP1	21	.	0			c.A626G						.						194.0	178.0	183.0					12																	8245601		2203	4300	6503	SO:0001583	missense	25977	exon6			GCAATCATGTCAC	AK074923	CCDS8589.1	12p13.31	2012-05-02			ENSG00000089818	ENSG00000089818			24539	protein-coding gene	gene with protein product		611623				14555962, 15494011	Standard	NM_015509		Approved	DKFZP566B183	uc001qtx.2	Q8NC96	OTTHUMG00000168568	ENST00000339754.5:c.626A>G	chr12.hg19:g.8245601A>G	ENSP00000341737:p.His209Arg	98.0	0.0		128.0	63.0	NM_015509	Q2NL73|Q5XG95|Q6NWY6|Q8N153|Q8NCB0|Q9BU52|Q9Y407	Missense_Mutation	SNP	ENST00000339754.5	hg19	CCDS8589.1	.	.	.	.	.	.	.	.	.	.	A	10.87	1.473367	0.26423	.	.	ENSG00000089818	ENST00000545179;ENST00000339754;ENST00000540291;ENST00000540083	T;T	0.30448	1.57;1.53	4.63	4.63	0.57726	.	0.234273	0.44285	D	0.000480	T	0.19565	0.0470	L	0.36672	1.1	0.49915	D	0.999831	P	0.43701	0.815	B	0.35931	0.214	T	0.03695	-1.1012	10	0.15952	T	0.53	.	10.6245	0.45500	1.0:0.0:0.0:0.0	.	209	Q8NC96	NECP1_HUMAN	R	209;209;67;67	ENSP00000341737:H209R;ENSP00000439319:H67R	ENSP00000341737:H209R	H	+	2	0	NECAP1	8136868	1.000000	0.71417	0.995000	0.50966	0.989000	0.77384	5.504000	0.66968	2.077000	0.62373	0.533000	0.62120	CAT	.	.		0.493	NECAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400244.1	NM_015509	
OTOGL	283310	hgsc.bcm.edu	37	12	80746176	80746176	+	Missense_Mutation	SNP	G	G	C			TCGA-2Y-A9GY-01A-11D-A382-10	TCGA-2Y-A9GY-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	75a72b01-26d1-410f-a2f3-fabe09059eed	e1cd43c8-e295-4191-8754-0520f03119e1	g.chr12:80746176G>C	ENST00000547103.1	+	44	5310	c.5304G>C	c.(5302-5304)aaG>aaC	p.K1768N	OTOGL_ENST00000458043.2_Missense_Mutation_p.K1780N			Q3ZCN5	OTOGL_HUMAN	otogelin-like	1768					L-arabinose metabolic process (GO:0046373)	extracellular region (GO:0005576)	alpha-L-arabinofuranosidase activity (GO:0046556)			breast(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(14)|prostate(1)	23						TGTGCAACAAGTTTGATATCT	0.343																																					p.K1780N		Atlas-SNP	.											.	OTOGL	235	.	0			c.G5340C						.						127.0	119.0	121.0					12																	80746176		1889	4113	6002	SO:0001583	missense	283310	exon44			CAACAAGTTTGAT	AK096852		12q21.31	2011-02-11	2011-02-11	2011-02-11	ENSG00000165899	ENSG00000165899			26901	protein-coding gene	gene with protein product		614925	"""chromosome 12 open reading frame 64"""	C12orf64			Standard	NM_173591		Approved	FLJ90579	uc001szd.3	Q3ZCN5	OTTHUMG00000150509	ENST00000547103.1:c.5304G>C	chr12.hg19:g.80746176G>C	ENSP00000447211:p.Lys1768Asn	63.0	0.0		72.0	6.0	NM_173591	F8W0C3|Q495U8|Q8N8G5|Q8NC28	Missense_Mutation	SNP	ENST00000547103.1	hg19		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	12.82|12.82	2.051617|2.051617	0.36181|0.36181	.|.	.|.	ENSG00000165899|ENSG00000165899	ENST00000547103;ENST00000458043|ENST00000298820	D;D|.	0.85861|.	-2.04;-2.04|.	6.04|6.04	-1.12|-1.12	0.09808|0.09808	.|.	.|.	.|.	.|.	.|.	T|T	0.38506|0.38506	0.1043|0.1043	L|L	0.55743|0.55743	1.74|1.74	0.26376|0.26376	N|N	0.976818|0.976818	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.37776|0.37776	-0.9691|-0.9691	7|5	0.46703|.	T|.	0.11|.	.|.	5.5859|5.5859	0.17274|0.17274	0.3311:0.0:0.4557:0.2132|0.3311:0.0:0.4557:0.2132	.|.	.|.	.|.	.|.	N|T	1768;1780|223	ENSP00000447211:K1768N;ENSP00000400895:K1780N|.	ENSP00000400895:K1780N|.	K|S	+|+	3|2	2|0	OTOGL|OTOGL	79270307|79270307	0.923000|0.923000	0.31300|0.31300	0.995000|0.995000	0.50966|0.50966	0.833000|0.833000	0.47200|0.47200	0.045000|0.045000	0.14013|0.14013	-0.086000|-0.086000	0.12550|0.12550	-0.222000|-0.222000	0.12452|0.12452	AAG|AGT	.	.		0.343	OTOGL-001	NOVEL	not_organism_supported|basic	protein_coding	protein_coding	OTTHUMT00000407438.1	NM_173591	
PAH	5053	hgsc.bcm.edu	37	12	103249042	103249042	+	Missense_Mutation	SNP	G	G	A			TCGA-2Y-A9GY-01A-11D-A382-10	TCGA-2Y-A9GY-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	75a72b01-26d1-410f-a2f3-fabe09059eed	e1cd43c8-e295-4191-8754-0520f03119e1	g.chr12:103249042G>A	ENST00000553106.1	-	6	1050	c.578C>T	c.(577-579)aCt>aTt	p.T193I	PAH_ENST00000307000.2_Missense_Mutation_p.T188I|PAH_ENST00000551988.1_5'Flank	NM_000277.1	NP_000268.1	P00439	PH4H_HUMAN	phenylalanine hydroxylase	193					catecholamine biosynthetic process (GO:0042423)|cellular amino acid biosynthetic process (GO:0008652)|cellular nitrogen compound metabolic process (GO:0034641)|L-phenylalanine catabolic process (GO:0006559)|neurotransmitter biosynthetic process (GO:0042136)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	amino acid binding (GO:0016597)|iron ion binding (GO:0005506)|phenylalanine 4-monooxygenase activity (GO:0004505)			endometrium(1)|kidney(3)|large_intestine(5)|lung(10)|ovary(5)|skin(2)|urinary_tract(1)	27					Droxidopa(DB06262)|Epinephrine(DB00668)|L-Phenylalanine(DB00120)|Norepinephrine(DB00368)|Tetrahydrobiopterin(DB00360)	GGACTTCAGAGTCTTGAACAC	0.433																																					p.T193I		Atlas-SNP	.											.	PAH	77	.	0			c.C578T						.						130.0	122.0	124.0					12																	103249042		2203	4300	6503	SO:0001583	missense	5053	exon6			TTCAGAGTCTTGA	U49897	CCDS9092.1	12q22-q24.2	2010-04-27				ENSG00000171759	1.14.16.1		8582	protein-coding gene	gene with protein product	"""phenylalanine 4-monooxygenase"""	612349				2063869	Standard	NM_000277		Approved	PH	uc001tjq.1	P00439		ENST00000553106.1:c.578C>T	chr12.hg19:g.103249042G>A	ENSP00000448059:p.Thr193Ile	65.0	0.0		90.0	47.0	NM_000277	Q16717|Q8TC14	Missense_Mutation	SNP	ENST00000553106.1	hg19	CCDS9092.1	.	.	.	.	.	.	.	.	.	.	G	12.80	2.046551	0.36085	.	.	ENSG00000171759	ENST00000553106;ENST00000307000	D;D	0.99541	-6.12;-6.12	5.87	4.97	0.65823	Aromatic amino acid hydroxylase, C-terminal (3);	0.098161	0.64402	D	0.000003	D	0.98479	0.9493	N	0.25957	0.775	0.38386	D	0.945266	P;P	0.46512	0.879;0.562	P;B	0.48368	0.575;0.382	D	0.99854	1.1075	10	0.39692	T	0.17	-14.4771	13.2417	0.59999	0.0:0.0:0.5667:0.4333	.	193;193	B4DPN2;P00439	.;PH4H_HUMAN	I	193;188	ENSP00000448059:T193I;ENSP00000303500:T188I	ENSP00000303500:T188I	T	-	2	0	PAH	101773172	1.000000	0.71417	0.997000	0.53966	0.003000	0.03518	5.819000	0.69243	1.460000	0.47911	0.650000	0.86243	ACT	.	.		0.433	PAH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406692.1		
STOML3	161003	hgsc.bcm.edu	37	13	39542580	39542580	+	Missense_Mutation	SNP	G	G	C			TCGA-2Y-A9GY-01A-11D-A382-10	TCGA-2Y-A9GY-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	75a72b01-26d1-410f-a2f3-fabe09059eed	e1cd43c8-e295-4191-8754-0520f03119e1	g.chr13:39542580G>C	ENST00000379631.4	-	6	952	c.608C>G	c.(607-609)tCc>tGc	p.S203C	STOML3_ENST00000423210.1_Missense_Mutation_p.S194C	NM_145286.2	NP_660329.1	Q8TAV4	STML3_HUMAN	stomatin (EPB72)-like 3	203					signal transduction (GO:0007165)	cilium (GO:0005929)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)				breast(1)|large_intestine(2)|lung(5)|ovary(1)|prostate(1)|skin(1)	11		Lung NSC(96;1.42e-05)|Prostate(109;0.00851)|Breast(139;0.0199)|Lung SC(185;0.0743)		all cancers(112;2.93e-08)|Epithelial(112;3.64e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.00107)|BRCA - Breast invasive adenocarcinoma(63;0.00349)|GBM - Glioblastoma multiforme(144;0.0137)		GGCTGCCATGGATCTCTGCAA	0.557																																					p.S203C		Atlas-SNP	.											.	STOML3	47	.	0			c.C608G						.						105.0	99.0	101.0					13																	39542580		2203	4300	6503	SO:0001583	missense	161003	exon6			GCCATGGATCTCT	BC025760	CCDS9367.1, CCDS45040.1	13q13.2	2004-03-05			ENSG00000133115	ENSG00000133115			19420	protein-coding gene	gene with protein product		608327				12122055	Standard	NM_145286		Approved	SRO, Epb7.2l	uc001uwx.3	Q8TAV4	OTTHUMG00000016763	ENST00000379631.4:c.608C>G	chr13.hg19:g.39542580G>C	ENSP00000368952:p.Ser203Cys	52.0	0.0		50.0	24.0	NM_145286	B4E285|Q5JS35	Missense_Mutation	SNP	ENST00000379631.4	hg19	CCDS9367.1	.	.	.	.	.	.	.	.	.	.	G	17.60	3.428853	0.62844	.	.	ENSG00000133115	ENST00000379631;ENST00000423210	D;D	0.94966	-3.57;-3.57	5.92	5.92	0.95590	.	0.096682	0.64402	D	0.000001	D	0.97018	0.9026	M	0.85373	2.75	0.51012	D	0.999905	D;D	0.58970	0.984;0.984	D;D	0.64506	0.926;0.926	D	0.97115	0.9807	10	0.87932	D	0	-16.713	13.1665	0.59573	0.0767:0.0:0.9232:0.0	.	194;203	B4E285;Q8TAV4	.;STML3_HUMAN	C	203;194	ENSP00000368952:S203C;ENSP00000401989:S194C	ENSP00000368952:S203C	S	-	2	0	STOML3	38440580	1.000000	0.71417	0.999000	0.59377	0.200000	0.23975	7.634000	0.83273	2.795000	0.96236	0.655000	0.94253	TCC	.	.		0.557	STOML3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000044604.2		
SYT16	83851	hgsc.bcm.edu	37	14	62551004	62551004	+	Silent	SNP	C	C	T			TCGA-2Y-A9GY-01A-11D-A382-10	TCGA-2Y-A9GY-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	75a72b01-26d1-410f-a2f3-fabe09059eed	e1cd43c8-e295-4191-8754-0520f03119e1	g.chr14:62551004C>T	ENST00000430451.2	+	5	1722	c.1525C>T	c.(1525-1527)Ctg>Ttg	p.L509L		NM_031914.2	NP_114120.2	Q17RD7	SYT16_HUMAN	synaptotagmin XVI	509	C2 2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				exocytosis (GO:0006887)					central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(11)|lung(12)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	35				OV - Ovarian serous cystadenocarcinoma(108;0.0438)|BRCA - Breast invasive adenocarcinoma(234;0.118)		GGCGCCAGAGCTGTTGGTGGG	0.567																																					p.L509L		Atlas-SNP	.											.	SYT16	144	.	0			c.C1525T						.						90.0	90.0	90.0					14																	62551004		2002	4162	6164	SO:0001819	synonymous_variant	83851	exon5			CCAGAGCTGTTGG	BC040924	CCDS45121.1	14q23.2	2014-07-02	2005-07-15	2005-07-15	ENSG00000139973	ENSG00000139973		"""Synaptotagmins"""	23142	protein-coding gene	gene with protein product	"""synaptotagmin XIV-related"", "" chr14 synaptotagmin"""	610950	"""synaptotagmin XIV-like"""	SYT14L		11543631	Standard	NM_031914		Approved	yt14r, CHR14SYT, Strep14	uc001xfu.1	Q17RD7	OTTHUMG00000171106	ENST00000430451.2:c.1525C>T	chr14.hg19:g.62551004C>T		93.0	0.0		74.0	44.0	NM_031914	B4DZH2|B7ZL60|C9J8I3|Q707N2|Q7Z441|Q8IUU0|Q9BQR8	Silent	SNP	ENST00000430451.2	hg19	CCDS45121.1																																																																																			.	.		0.567	SYT16-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000411700.1	NM_031914	
NRXN3	9369	hgsc.bcm.edu	37	14	80158522	80158522	+	Intron	SNP	C	C	T			TCGA-2Y-A9GY-01A-11D-A382-10	TCGA-2Y-A9GY-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	75a72b01-26d1-410f-a2f3-fabe09059eed	e1cd43c8-e295-4191-8754-0520f03119e1	g.chr14:80158522C>T	ENST00000557594.1	+	4	1554				NRXN3_ENST00000335750.5_Intron|NRXN3_ENST00000428277.2_Missense_Mutation_p.T203I|RP11-242P2.1_ENST00000553322.1_RNA|NRXN3_ENST00000281127.7_Intron|NRXN3_ENST00000556003.1_Intron|NRXN3_ENST00000554719.1_Intron	NM_001272020.1	NP_001258949.1	Q9HDB5	NRX3B_HUMAN	neurexin 3						adult behavior (GO:0030534)|angiogenesis (GO:0001525)|learning (GO:0007612)|neuron cell-cell adhesion (GO:0007158)|neurotransmitter secretion (GO:0007269)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synapse maturation (GO:0090129)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|vocalization behavior (GO:0071625)	integral component of membrane (GO:0016021)	cell adhesion molecule binding (GO:0050839)|neuroligin family protein binding (GO:0097109)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(23)|lung(40)|ovary(3)|pancreas(2)|prostate(5)|skin(7)|upper_aerodigestive_tract(9)|urinary_tract(1)	104		Renal(4;0.00876)		BRCA - Breast invasive adenocarcinoma(234;0.00544)|Kidney(3;0.029)|KIRC - Kidney renal clear cell carcinoma(182;0.223)		AAAGGCAACACTGATAATGAA	0.333																																					p.T203I		Atlas-SNP	.											.	NRXN3	342	.	0			c.C608T						.						56.0	52.0	53.0					14																	80158522		1803	4072	5875	SO:0001627	intron_variant	9369	exon4			GCAACACTGATAA	AB018286	CCDS9870.1, CCDS9871.1, CCDS45145.1, CCDS61515.1	14q31	2010-01-19				ENSG00000021645			8010	protein-coding gene	gene with protein product		600567	"""chromosome 14 open reading frame 60"""	C14orf60		11944992, 12379233	Standard	NM_004796		Approved	KIAA0743	uc001xun.4	Q9HDB5		ENST00000557594.1:c.602-5451C>T	chr14.hg19:g.80158522C>T		70.0	0.0		69.0	12.0	NM_001105250	A5PKW8|A8MPU5|B3KPM7|Q6NUR0|Q8IUD8	Missense_Mutation	SNP	ENST00000557594.1	hg19		.	.	.	.	.	.	.	.	.	.	C	14.76	2.630539	0.46944	.	.	ENSG00000021645	ENST00000332068;ENST00000428277	T	0.78246	-1.16	5.72	5.72	0.89469	.	.	.	.	.	D	0.86543	0.5958	.	.	.	0.80722	D	1	D	0.60575	0.988	P	0.60789	0.879	D	0.85995	0.1491	7	.	.	.	.	18.0612	0.89378	0.0:1.0:0.0:0.0	.	203	Q9HDB5-4	.	I	1197;203	ENSP00000394426:T203I	.	T	+	2	0	NRXN3	79228275	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.831000	0.48144	2.704000	0.92352	0.650000	0.86243	ACT	.	.		0.333	NRXN3-004	NOVEL	basic	protein_coding	protein_coding	OTTHUMT00000413790.1	NM_001105250	
BAG5	9529	hgsc.bcm.edu	37	14	104026516	104026516	+	Missense_Mutation	SNP	C	C	T			TCGA-2Y-A9GY-01A-11D-A382-10	TCGA-2Y-A9GY-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	75a72b01-26d1-410f-a2f3-fabe09059eed	e1cd43c8-e295-4191-8754-0520f03119e1	g.chr14:104026516C>T	ENST00000445922.2	-	2	1232	c.986G>A	c.(985-987)cGg>cAg	p.R329Q	RP11-894P9.2_ENST00000556332.1_RNA|RP11-73M18.2_ENST00000472726.2_5'Flank|BAG5_ENST00000299204.4_Missense_Mutation_p.R329Q|APOPT1_ENST00000556253.2_5'Flank|APOPT1_ENST00000247618.4_5'Flank|APOPT1_ENST00000409074.2_5'Flank|BAG5_ENST00000337322.4_Missense_Mutation_p.R370Q	NM_004873.3	NP_004864.1	Q9UL15	BAG5_HUMAN	BCL2-associated athanogene 5	329	BAG 4. {ECO:0000255|PROSITE- ProRule:PRU00369}.				negative regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902176)|negative regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032435)|negative regulation of protein refolding (GO:0061084)|negative regulation of protein ubiquitination (GO:0031397)|negative regulation of ubiquitin-protein transferase activity (GO:0051444)|neuron death (GO:0070997)|protein folding (GO:0006457)|regulation of inclusion body assembly (GO:0090083)	inclusion body (GO:0016234)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	chaperone binding (GO:0051087)|protein kinase binding (GO:0019901)|ubiquitin protein ligase binding (GO:0031625)	p.R329L(1)		endometrium(5)|large_intestine(4)|lung(7)|ovary(2)|prostate(2)|skin(2)|urinary_tract(2)	24		Melanoma(154;0.155)	Epithelial(46;0.144)			CCTGGCTTCCCGGATGCAGGG	0.453																																					p.R370Q	NSCLC(171;1832 2055 18950 31566 41632)	Atlas-SNP	.											.	BAG5	47	.	1	Substitution - Missense(1)	lung(1)	c.G1109A						.						64.0	69.0	68.0					14																	104026516		2203	4300	6503	SO:0001583	missense	9529	exon2			GCTTCCCGGATGC	AF095195	CCDS9982.1, CCDS41995.1	14q32	2008-08-01				ENSG00000166170			941	protein-coding gene	gene with protein product		603885				9873016, 15603737	Standard	NM_001015048		Approved		uc001ynh.2	Q9UL15		ENST00000445922.2:c.986G>A	chr14.hg19:g.104026516C>T	ENSP00000391713:p.Arg329Gln	91.0	0.0		99.0	35.0	NM_001015049	O94950|Q86W59	Missense_Mutation	SNP	ENST00000445922.2	hg19	CCDS9982.1	.	.	.	.	.	.	.	.	.	.	C	17.48	3.399391	0.62177	.	.	ENSG00000166170	ENST00000299204;ENST00000445922;ENST00000337322	D;D;D	0.93366	-3.21;-3.21;-3.21	5.76	4.85	0.62838	BAG domain (3);	0.000000	0.85682	D	0.000000	D	0.94384	0.8194	L	0.32530	0.975	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.69307	0.961;0.963	D	0.95218	0.8331	10	0.87932	D	0	-17.4587	16.6082	0.84836	0.0:0.8697:0.1303:0.0	.	329;370	Q9UL15;Q9UL15-2	BAG5_HUMAN;.	Q	329;329;370	ENSP00000299204:R329Q;ENSP00000391713:R329Q;ENSP00000338814:R370Q	ENSP00000299204:R329Q	R	-	2	0	BAG5	103096269	1.000000	0.71417	0.963000	0.40424	0.240000	0.25518	7.013000	0.76373	1.403000	0.46800	0.655000	0.94253	CGG	.	.		0.453	BAG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414990.1		
BAG5	9529	hgsc.bcm.edu	37	14	104028275	104028275	+	Intron	SNP	T	T	C			TCGA-2Y-A9GY-01A-11D-A382-10	TCGA-2Y-A9GY-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	75a72b01-26d1-410f-a2f3-fabe09059eed	e1cd43c8-e295-4191-8754-0520f03119e1	g.chr14:104028275T>C	ENST00000445922.2	-	1	219				RP11-894P9.2_ENST00000556332.1_RNA|RP11-73M18.2_ENST00000472726.2_5'Flank|BAG5_ENST00000299204.4_Intron|APOPT1_ENST00000556253.2_5'Flank|APOPT1_ENST00000247618.4_5'Flank|APOPT1_ENST00000409074.2_5'Flank|BAG5_ENST00000337322.4_Missense_Mutation_p.R24G	NM_004873.3	NP_004864.1	Q9UL15	BAG5_HUMAN	BCL2-associated athanogene 5						negative regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902176)|negative regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032435)|negative regulation of protein refolding (GO:0061084)|negative regulation of protein ubiquitination (GO:0031397)|negative regulation of ubiquitin-protein transferase activity (GO:0051444)|neuron death (GO:0070997)|protein folding (GO:0006457)|regulation of inclusion body assembly (GO:0090083)	inclusion body (GO:0016234)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	chaperone binding (GO:0051087)|protein kinase binding (GO:0019901)|ubiquitin protein ligase binding (GO:0031625)			endometrium(5)|large_intestine(4)|lung(7)|ovary(2)|prostate(2)|skin(2)|urinary_tract(2)	24		Melanoma(154;0.155)	Epithelial(46;0.144)			CACAATGGCCTAATGCACGTT	0.493																																					p.R24G	NSCLC(171;1832 2055 18950 31566 41632)	Atlas-SNP	.											.	BAG5	47	.	0			c.A70G						.						107.0	108.0	108.0					14																	104028275		1917	4128	6045	SO:0001627	intron_variant	9529	exon1			ATGGCCTAATGCA	AF095195	CCDS9982.1, CCDS41995.1	14q32	2008-08-01				ENSG00000166170			941	protein-coding gene	gene with protein product		603885				9873016, 15603737	Standard	NM_001015048		Approved		uc001ynh.2	Q9UL15		ENST00000445922.2:c.27+161A>G	chr14.hg19:g.104028275T>C		78.0	0.0		99.0	4.0	NM_001015049	O94950|Q86W59	Missense_Mutation	SNP	ENST00000445922.2	hg19	CCDS9982.1	.	.	.	.	.	.	.	.	.	.	T	9.837	1.189976	0.21954	.	.	ENSG00000166170	ENST00000337322	T	0.80909	-1.43	2.78	-5.56	0.02529	.	1.637800	0.05073	U	0.481964	T	0.63224	0.2493	.	.	.	0.09310	N	0.999998	B	0.02656	0.0	B	0.01281	0.0	T	0.42699	-0.9436	9	0.35671	T	0.21	.	2.2259	0.03984	0.142:0.3842:0.2875:0.1863	.	24	Q9UL15-2	.	G	24	ENSP00000338814:R24G	ENSP00000338814:R24G	R	-	1	2	BAG5	103098028	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.742000	0.01835	-1.978000	0.00993	-1.614000	0.00798	AGG	.	.		0.493	BAG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414990.1		
RYR3	6263	hgsc.bcm.edu	37	15	34130221	34130221	+	Silent	SNP	C	C	T			TCGA-2Y-A9GY-01A-11D-A382-10	TCGA-2Y-A9GY-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	75a72b01-26d1-410f-a2f3-fabe09059eed	e1cd43c8-e295-4191-8754-0520f03119e1	g.chr15:34130221C>T	ENST00000389232.4	+	89	12110	c.12040C>T	c.(12040-12042)Ctg>Ttg	p.L4014L	RYR3_ENST00000415757.3_Silent_p.L4009L	NM_001036.3	NP_001027.3	Q15413	RYR3_HUMAN	ryanodine receptor 3	4014					calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cellular response to ATP (GO:0071318)|cellular response to caffeine (GO:0071313)|cellular response to calcium ion (GO:0071277)|cellular response to magnesium ion (GO:0071286)|ion transmembrane transport (GO:0034220)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|protein homotetramerization (GO:0051289)|striated muscle contraction (GO:0006941)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|ryanodine-sensitive calcium-release channel activity (GO:0005219)			NS(3)|breast(9)|central_nervous_system(8)|cervix(2)|endometrium(29)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(55)|lung(148)|ovary(7)|pancreas(1)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(3)	311		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		CCTGAAGTGTCTGTTGGACCC	0.473																																					p.L4014L		Atlas-SNP	.											.	RYR3	760	.	0			c.C12040T						.						121.0	120.0	120.0					15																	34130221		1942	4149	6091	SO:0001819	synonymous_variant	6263	exon89			AAGTGTCTGTTGG		CCDS45210.1, CCDS58351.1	15q14-q15	2013-01-10				ENSG00000198838		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10485	protein-coding gene	gene with protein product		180903				8276408	Standard	NM_001036		Approved		uc001zhi.3	Q15413		ENST00000389232.4:c.12040C>T	chr15.hg19:g.34130221C>T		108.0	0.0		140.0	18.0	NM_001036	O15175|Q15412	Silent	SNP	ENST00000389232.4	hg19	CCDS45210.1																																																																																			.	.		0.473	RYR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000417514.1		
PDCD7	10081	hgsc.bcm.edu	37	15	65421369	65421369	+	Splice_Site	SNP	C	C	A	rs543198741		TCGA-2Y-A9GY-01A-11D-A382-10	TCGA-2Y-A9GY-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	75a72b01-26d1-410f-a2f3-fabe09059eed	e1cd43c8-e295-4191-8754-0520f03119e1	g.chr15:65421369C>A	ENST00000204549.4	-	2	1064		c.e2+1			NM_005707.1	NP_005698.1	Q8N8D1	PDCD7_HUMAN	programmed cell death 7						apoptotic process (GO:0006915)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of T cell apoptotic process (GO:0070234)|response to glucocorticoid (GO:0051384)|RNA splicing (GO:0008380)	U12-type spliceosomal complex (GO:0005689)				endometrium(4)|large_intestine(1)|lung(1)|upper_aerodigestive_tract(1)	7						GCCACAGTTACCTTTCCTCGC	0.428																																					.		Atlas-SNP	.											.	PDCD7	22	.	0			c.1009+1G>T						.						291.0	265.0	273.0					15																	65421369		2202	4299	6501	SO:0001630	splice_region_variant	10081	exon3			CAGTTACCTTTCC	AF083930	CCDS10201.1	15q22.2	2012-06-07			ENSG00000090470	ENSG00000090470			8767	protein-coding gene	gene with protein product	"""U11/U12 snRNP 59K"""	608138				10037816	Standard	NM_005707		Approved	HES18, ES18	uc002aol.3	Q8N8D1	OTTHUMG00000133117	ENST00000204549.4:c.1009+1G>T	chr15.hg19:g.65421369C>A		52.0	0.0		79.0	28.0	NM_005707	Q96AK8|Q9Y6D7	Splice_Site	SNP	ENST00000204549.4	hg19	CCDS10201.1	.	.	.	.	.	.	.	.	.	.	C	20.4	3.977925	0.74360	.	.	ENSG00000090470	ENST00000204549;ENST00000431964;ENST00000380204	.	.	.	5.83	5.83	0.93111	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.1162	0.97934	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	PDCD7	63208422	1.000000	0.71417	1.000000	0.80357	0.789000	0.44602	7.487000	0.81328	2.757000	0.94681	0.563000	0.77884	.	.	.		0.428	PDCD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256784.2	NM_005707	Intron
DENND4A	10260	hgsc.bcm.edu	37	15	66021923	66021923	+	Silent	SNP	G	G	A			TCGA-2Y-A9GY-01A-11D-A382-10	TCGA-2Y-A9GY-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	75a72b01-26d1-410f-a2f3-fabe09059eed	e1cd43c8-e295-4191-8754-0520f03119e1	g.chr15:66021923G>A	ENST00000431932.2	-	10	1468	c.1260C>T	c.(1258-1260)atC>atT	p.I420I	DENND4A_ENST00000443035.3_Silent_p.I420I	NM_005848.3	NP_005839.3	Q7Z401	MYCPP_HUMAN	DENN/MADD domain containing 4A	420	DENN. {ECO:0000255|PROSITE- ProRule:PRU00304}.				positive regulation of Rab GTPase activity (GO:0032851)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|Rab guanyl-nucleotide exchange factor activity (GO:0017112)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(17)|lung(11)|ovary(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	51						GTAGGGAATGGATAAGAATTT	0.398																																					p.I420I		Atlas-SNP	.											.	DENND4A	217	.	0			c.C1260T						.						64.0	60.0	61.0					15																	66021923		1882	4100	5982	SO:0001819	synonymous_variant	10260	exon10			GGAATGGATAAGA	AF534403	CCDS45285.1, CCDS53949.1	15q22.31	2012-10-03	2006-01-27	2006-01-27				"""DENN/MADD domain containing"""	24321	protein-coding gene	gene with protein product		600382	"""c-myc promoter binding protein"""	MYCPBP		8056341, 12906859	Standard	NM_005848		Approved	IRLB	uc002api.3	Q7Z401		ENST00000431932.2:c.1260C>T	chr15.hg19:g.66021923G>A		69.0	0.0		82.0	28.0	NM_001144823	E7EPL3|Q14655|Q86T77|Q8IVX2|Q8NB93	Silent	SNP	ENST00000431932.2	hg19	CCDS45285.1																																																																																			.	.		0.398	DENND4A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419611.1	NM_005848	
NTRK3	4916	hgsc.bcm.edu	37	15	88679766	88679766	+	Missense_Mutation	SNP	C	C	T			TCGA-2Y-A9GY-01A-11D-A382-10	TCGA-2Y-A9GY-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	75a72b01-26d1-410f-a2f3-fabe09059eed	e1cd43c8-e295-4191-8754-0520f03119e1	g.chr15:88679766C>T	ENST00000360948.2	-	7	858	c.697G>A	c.(697-699)Ggc>Agc	p.G233S	NTRK3_ENST00000542733.2_Missense_Mutation_p.G135S|NTRK3_ENST00000558676.1_Missense_Mutation_p.G233S|NTRK3_ENST00000357724.2_Missense_Mutation_p.G233S|NTRK3_ENST00000394480.2_Missense_Mutation_p.G233S|NTRK3_ENST00000540489.2_Missense_Mutation_p.G233S|NTRK3_ENST00000355254.2_Missense_Mutation_p.G233S|NTRK3_ENST00000317501.3_Missense_Mutation_p.G233S|NTRK3_ENST00000557856.1_Missense_Mutation_p.G233S	NM_001012338.2	NP_001012338.1	Q16288	NTRK3_HUMAN	neurotrophic tyrosine kinase, receptor, type 3	233	Ig-like C2-type 1.				activation of MAPK activity (GO:0000187)|activation of protein kinase B activity (GO:0032148)|activation of Ras GTPase activity (GO:0032856)|cellular response to retinoic acid (GO:0071300)|circadian rhythm (GO:0007623)|cochlea development (GO:0090102)|lens fiber cell differentiation (GO:0070306)|mechanoreceptor differentiation (GO:0042490)|modulation by virus of host transcription (GO:0019056)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of cell death (GO:0060548)|negative regulation of protein phosphorylation (GO:0001933)|neuron fate specification (GO:0048665)|neuron migration (GO:0001764)|neurotrophin signaling pathway (GO:0038179)|positive regulation of actin cytoskeleton reorganization (GO:2000251)|positive regulation of axon extension involved in regeneration (GO:0048691)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of positive chemotaxis (GO:0050927)|protein autophosphorylation (GO:0046777)|response to axon injury (GO:0048678)|response to corticosterone (GO:0051412)|response to ethanol (GO:0045471)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|neurotrophin binding (GO:0043121)|neurotrophin receptor activity (GO:0005030)|p53 binding (GO:0002039)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)		ETV6/NTRK3(238)	breast(3)|central_nervous_system(3)|endometrium(6)|kidney(1)|large_intestine(22)|lung(63)|ovary(6)|pancreas(3)|prostate(1)|skin(4)|stomach(5)|upper_aerodigestive_tract(2)	119			BRCA - Breast invasive adenocarcinoma(143;0.211)			GATCCAGAGCCATTGCAAGTG	0.557			T	ETV6	"""congenital fibrosarcoma, Secretory breast """					TSP Lung(13;0.10)																											p.G233S		Atlas-SNP	.		Dom	yes		15	15q25	4916	"""neurotrophic tyrosine kinase, receptor, type 3"""		"""E, M"""	.	NTRK3	587	.	0			c.G697A						.						171.0	104.0	126.0					15																	88679766		2201	4299	6500	SO:0001583	missense	4916	exon8			CAGAGCCATTGCA	U05012	CCDS10340.1, CCDS32322.1, CCDS32323.1, CCDS58399.1	15q24-q25	2013-01-11			ENSG00000140538	ENSG00000140538	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"""	8033	protein-coding gene	gene with protein product		191316				7806211	Standard	NM_001012338		Approved	TRKC	uc002bme.2	Q16288	OTTHUMG00000148677	ENST00000360948.2:c.697G>A	chr15.hg19:g.88679766C>T	ENSP00000354207:p.Gly233Ser	51.0	0.0		97.0	38.0	NM_001243101	B7Z4C5|E9PG56|H0YND1|O75682|Q12827|Q16289	Missense_Mutation	SNP	ENST00000360948.2	hg19	CCDS32322.1	.	.	.	.	.	.	.	.	.	.	C	24.5	4.541047	0.85917	.	.	ENSG00000140538	ENST00000394480;ENST00000360948;ENST00000357724;ENST00000355254;ENST00000542733;ENST00000540489;ENST00000317501	T;T;T;T;T;T;T	0.66460	-0.21;-0.21;-0.21;-0.21;-0.21;-0.21;-0.21	5.64	5.64	0.86602	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.75034	0.3795	L	0.40543	1.245	0.80722	D	1	D;D;P;D;D;P	0.89917	1.0;1.0;0.621;1.0;1.0;0.621	D;D;P;D;D;P	0.97110	1.0;1.0;0.593;1.0;0.998;0.593	T	0.68014	-0.5521	10	0.16896	T	0.51	.	18.6884	0.91574	0.0:1.0:0.0:0.0	.	135;233;233;233;233;233	B7Z7U4;E9PG56;B7Z4C5;Q96CY4;Q16288-3;Q16288	.;.;.;.;.;NTRK3_HUMAN	S	233;233;233;233;135;233;233	ENSP00000377990:G233S;ENSP00000354207:G233S;ENSP00000350356:G233S;ENSP00000347397:G233S;ENSP00000437773:G135S;ENSP00000444673:G233S;ENSP00000318328:G233S	ENSP00000318328:G233S	G	-	1	0	NTRK3	86480770	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.359000	0.79477	2.657000	0.90304	0.655000	0.94253	GGC	.	.		0.557	NTRK3-204	KNOWN	basic|CCDS	protein_coding	protein_coding			
SRRM2	23524	hgsc.bcm.edu	37	16	2814152	2814152	+	Missense_Mutation	SNP	C	C	G			TCGA-2Y-A9GY-01A-11D-A382-10	TCGA-2Y-A9GY-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	75a72b01-26d1-410f-a2f3-fabe09059eed	e1cd43c8-e295-4191-8754-0520f03119e1	g.chr16:2814152C>G	ENST00000301740.8	+	11	4172	c.3623C>G	c.(3622-3624)aCc>aGc	p.T1208S		NM_016333.3	NP_057417.3	Q9UQ35	SRRM2_HUMAN	serine/arginine repetitive matrix 2	1208	Ser-rich.				mRNA splicing, via spliceosome (GO:0000398)	Cajal body (GO:0015030)|catalytic step 2 spliceosome (GO:0071013)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	C2H2 zinc finger domain binding (GO:0070742)|poly(A) RNA binding (GO:0044822)|protein N-terminus binding (GO:0047485)			breast(3)|central_nervous_system(1)|cervix(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(20)|lung(34)|ovary(6)|pancreas(3)|prostate(2)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(7)	105						ACACTTAGAACCCCGCCAAGG	0.458																																					p.T1208S		Atlas-SNP	.											.	SRRM2	263	.	0			c.C3623G						.						105.0	110.0	108.0					16																	2814152		2198	4300	6498	SO:0001583	missense	23524	exon11			TTAGAACCCCGCC	AF201422	CCDS32373.1	16p13.3	2012-07-02			ENSG00000167978	ENSG00000167978			16639	protein-coding gene	gene with protein product		606032				10668804, 11004489	Standard	NM_016333		Approved	SRm300, SRL300, KIAA0324, Cwc21	uc002crk.3	Q9UQ35	OTTHUMG00000177358	ENST00000301740.8:c.3623C>G	chr16.hg19:g.2814152C>G	ENSP00000301740:p.Thr1208Ser	104.0	0.0		196.0	28.0	NM_016333	A6NKB9|D3DU97|O15038|O94803|Q6NSL3|Q6PIM3|Q6PK40|Q8IW17|Q96GY7|Q9P0G1|Q9UHA8|Q9UQ36|Q9UQ37|Q9UQ38|Q9UQ40	Missense_Mutation	SNP	ENST00000301740.8	hg19	CCDS32373.1	.	.	.	.	.	.	.	.	.	.	C	3.012	-0.203734	0.06180	.	.	ENSG00000167978	ENST00000301740;ENST00000382301;ENST00000544933	D	0.92595	-3.07	5.97	2.73	0.32206	.	0.476475	0.21288	N	0.077040	T	0.75598	0.3871	N	0.02539	-0.55	0.09310	N	1	B	0.10296	0.003	B	0.04013	0.001	T	0.62854	-0.6766	10	0.13853	T	0.58	-0.0106	6.9403	0.24488	0.0:0.6721:0.1601:0.1678	.	1208	Q9UQ35	SRRM2_HUMAN	S	1208;1208;460	ENSP00000301740:T1208S	ENSP00000301740:T1208S	T	+	2	0	SRRM2	2754153	0.001000	0.12720	0.012000	0.15200	0.016000	0.09150	0.907000	0.28531	0.846000	0.35142	0.655000	0.94253	ACC	.	.		0.458	SRRM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000436411.1		
DNAAF1	123872	hgsc.bcm.edu	37	16	84203706	84203706	+	Silent	SNP	G	G	A			TCGA-2Y-A9GY-01A-11D-A382-10	TCGA-2Y-A9GY-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	75a72b01-26d1-410f-a2f3-fabe09059eed	e1cd43c8-e295-4191-8754-0520f03119e1	g.chr16:84203706G>A	ENST00000378553.5	+	8	1396	c.1272G>A	c.(1270-1272)tcG>tcA	p.S424S	DNAAF1_ENST00000563818.1_3'UTR|DNAAF1_ENST00000334315.5_Intron	NM_178452.4	NP_848547.4	Q8NEP3	DAAF1_HUMAN	dynein, axonemal, assembly factor 1	424	Pro-rich.				axonemal dynein complex assembly (GO:0070286)|cilium morphogenesis (GO:0060271)|cilium movement (GO:0003341)|determination of digestive tract left/right asymmetry (GO:0071907)|determination of liver left/right asymmetry (GO:0071910)|determination of pancreatic left/right asymmetry (GO:0035469)|epithelial cilium movement involved in determination of left/right asymmetry (GO:0060287)|heart looping (GO:0001947)|inner dynein arm assembly (GO:0036159)|left/right pattern formation (GO:0060972)|lung development (GO:0030324)|motile cilium assembly (GO:0044458)|outer dynein arm assembly (GO:0036158)|regulation of cilium beat frequency (GO:0003356)	axoneme (GO:0005930)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	dynein binding (GO:0045502)			NS(1)|endometrium(7)|kidney(1)|large_intestine(6)|lung(15)|ovary(4)|pancreas(1)|prostate(1)|stomach(4)|urinary_tract(1)	41						TGCTACTGTCGTCACCTGTGG	0.622																																					p.S424S		Atlas-SNP	.											DNAAF1,NS,carcinoma,0,3	DNAAF1	81	.	0			c.G1272A						.						61.0	64.0	63.0					16																	84203706		2200	4300	6500	SO:0001819	synonymous_variant	123872	exon8			ACTGTCGTCACCT	BC024009	CCDS10943.2	16q24.1	2012-05-03	2011-06-09	2011-06-09	ENSG00000154099	ENSG00000154099			30539	protein-coding gene	gene with protein product	"""outer row dynein assembly 7 homolog (Chlamydomonas)"""	613190	"""leucine rich repeat containing 50"""	LRRC50		19944405	Standard	NM_178452		Approved	FLJ25330, ODA7, CILD13	uc002fhl.4	Q8NEP3	OTTHUMG00000128517	ENST00000378553.5:c.1272G>A	chr16.hg19:g.84203706G>A		110.0	0.0		105.0	50.0	NM_178452	B4DJA3|Q69YI8|Q69YJ0|Q69YW5|Q96LP3|Q96MB6	Silent	SNP	ENST00000378553.5	hg19	CCDS10943.2																																																																																			.	.		0.622	DNAAF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250328.3	NM_178452	
TP53	7157	hgsc.bcm.edu	37	17	7578211	7578211	+	Missense_Mutation	SNP	C	C	A	rs587778720		TCGA-2Y-A9GY-01A-11D-A382-10	TCGA-2Y-A9GY-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	75a72b01-26d1-410f-a2f3-fabe09059eed	e1cd43c8-e295-4191-8754-0520f03119e1	g.chr17:7578211C>A	ENST00000269305.4	-	6	827	c.638G>T	c.(637-639)cGa>cTa	p.R213L	TP53_ENST00000359597.4_Missense_Mutation_p.R213L|TP53_ENST00000413465.2_Missense_Mutation_p.R213L|TP53_ENST00000420246.2_Missense_Mutation_p.R213L|TP53_ENST00000455263.2_Missense_Mutation_p.R213L|TP53_ENST00000445888.2_Missense_Mutation_p.R213L|TP53_ENST00000574684.1_Intron	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	213	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		R -> G (in sporadic cancers; somatic mutation).|R -> L (in sporadic cancers; somatic mutation).|R -> P (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974}.|R -> Q (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> W (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R213L(38)|p.R213Q(29)|p.0?(8)|p.R213P(5)|p.?(5)|p.R120L(4)|p.R81L(4)|p.R120Q(2)|p.R81Q(2)|p.D208_V216delDRNTFRHSV(1)|p.D207_R213delDDRNTFR(1)|p.T211_S215delTFRHS(1)|p.D208fs*1(1)|p.R213>L(1)|p.R209_R213delRNTFR(1)|p.R213fs*2(1)|p.T211fs*28(1)|p.R213_S215>X(1)|p.D207_V216del10(1)|p.R213fs*32(1)|p.R209fs*6(1)|p.R213W(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CACACTATGTCGAAAAGTGTT	0.532		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.R213L	Pancreas(47;798 1329 9957 10801)	Atlas-SNP	.	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53_ENST00000545858,NS,adenocarcinoma,-1,1	TP53	33396	.	110	Substitution - Missense(85)|Whole gene deletion(8)|Deletion - In frame(5)|Deletion - Frameshift(5)|Unknown(5)|Complex - deletion inframe(1)|Complex - compound substitution(1)	prostate(15)|large_intestine(14)|urinary_tract(9)|liver(9)|haematopoietic_and_lymphoid_tissue(8)|biliary_tract(6)|stomach(6)|oesophagus(6)|kidney(5)|lung(5)|central_nervous_system(4)|ovary(4)|pancreas(4)|bone(4)|upper_aerodigestive_tract(3)|soft_tissue(2)|eye(2)|vulva(1)|endometrium(1)|skin(1)|breast(1)	c.G638T	GRCh37	CM004906|CM022474	TP53	M		.						132.0	118.0	122.0					17																	7578211		2203	4300	6503	SO:0001583	missense	7157	exon6	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	CTATGTCGAAAAG	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.638G>T	chr17.hg19:g.7578211C>A	ENSP00000269305:p.Arg213Leu	149.0	0.0		97.0	46.0	NM_000546	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	hg19	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	C	36	5.890676	0.97074	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	D;D;D;D;D;D;D;D	0.99866	-7.3;-7.3;-7.3;-7.3;-7.3;-7.3;-7.3;-7.3	5.28	4.32	0.51571	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.057335	0.64402	D	0.000003	D	0.99871	0.9939	M	0.92507	3.315	0.53688	D	0.999978	D;D;D;D;D;D;D	0.89917	1.0;0.999;1.0;1.0;1.0;0.999;1.0	D;D;D;D;D;D;D	0.97110	1.0;0.988;0.996;0.999;0.989;0.986;0.999	D	0.96662	0.9490	10	0.87932	D	0	-7.5444	11.7807	0.52013	0.0:0.9141:0.0:0.0859	.	174;213;213;120;213;213;213	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	L	213;213;213;213;213;213;202;120;81;120;81	ENSP00000410739:R213L;ENSP00000352610:R213L;ENSP00000269305:R213L;ENSP00000398846:R213L;ENSP00000391127:R213L;ENSP00000391478:R213L;ENSP00000425104:R81L;ENSP00000423862:R120L	ENSP00000269305:R213L	R	-	2	0	TP53	7518936	0.996000	0.38824	0.185000	0.23176	0.961000	0.63080	7.775000	0.85489	1.367000	0.46095	0.563000	0.77884	CGA	.	.		0.532	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
KCNJ12	3768	hgsc.bcm.edu	37	17	21319642	21319642	+	Missense_Mutation	SNP	G	G	A	rs368741477		TCGA-2Y-A9GY-01A-11D-A382-10	TCGA-2Y-A9GY-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	75a72b01-26d1-410f-a2f3-fabe09059eed	e1cd43c8-e295-4191-8754-0520f03119e1	g.chr17:21319642G>A	ENST00000583088.1	+	3	1883	c.988G>A	c.(988-990)Gtg>Atg	p.V330M	KCNJ12_ENST00000331718.5_Missense_Mutation_p.V330M	NM_021012.4	NP_066292.2	Q14500	KCJ12_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 12	330					muscle contraction (GO:0006936)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|protein homotetramerization (GO:0051289)|regulation of heart contraction (GO:0008016)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|intrinsic component of membrane (GO:0031224)|plasma membrane (GO:0005886)	inward rectifier potassium channel activity (GO:0005242)			NS(1)|breast(4)|endometrium(4)|kidney(1)|large_intestine(5)|lung(39)|ovary(5)|skin(8)|stomach(3)	70				Colorectal(15;0.0183)|COAD - Colon adenocarcinoma(3;0.0732)	Dofetilide(DB00204)|Yohimbine(DB01392)	CTTTGAGCCCGTGCTCTTCGA	0.592										Prostate(3;0.18)																											p.V330M		Atlas-SNP	.											KCNJ12,NS,carcinoma,0,1	.	.	.	0			c.G988A						.	G	MET/VAL	0,4406		0,0,2203	148.0	150.0	149.0		988	5.8	0.9	17		149	1,8599	1.2+/-3.3	0,1,4299	no	missense	KCNJ12	NM_021012.4	21	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	330/434	21319642	1,13005	2203	4300	6503	SO:0001583	missense	100134444	exon3			GAGCCCGTGCTCT	L36069	CCDS11219.1	17p11.1	2011-07-05	2004-01-13		ENSG00000184185	ENSG00000184185		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6258	protein-coding gene	gene with protein product		602323	"""potassium inwardly-rectifying channel, subfamily J, inhibitor 1"""	KCNJN1		7859381, 12417321, 16382105	Standard	NM_021012		Approved	Kir2.2, Kir2.2v, IRK2, hIRK1	uc021tss.1	Q14500	OTTHUMG00000132039	ENST00000583088.1:c.988G>A	chr17.hg19:g.21319642G>A	ENSP00000463778:p.Val330Met	118.0	0.0		94.0	15.0	NM_001194958	O43401|Q15756|Q8NG63	Missense_Mutation	SNP	ENST00000583088.1	hg19	CCDS11219.1	.	.	.	.	.	.	.	.	.	.	G	20.4	3.989628	0.74589	0.0	1.16E-4	ENSG00000184185	ENST00000331718	D	0.95588	-3.75	5.76	5.76	0.90799	Immunoglobulin E-set (1);Potassium channel, inwardly rectifying, Kir, conserved region 2 (2);Potassium channel, inwardly rectifying, Kir, cytoplasmic (1);	0.000000	0.85682	D	0.000000	D	0.97120	0.9059	L	0.58669	1.825	0.80722	D	1	D	0.89917	1.0	D	0.68353	0.957	D	0.96931	0.9681	10	0.54805	T	0.06	.	19.9738	0.97296	0.0:0.0:1.0:0.0	.	330	Q14500	IRK12_HUMAN	M	330	ENSP00000328150:V330M	ENSP00000328150:V330M	V	+	1	0	KCNJ12	21260235	1.000000	0.71417	0.938000	0.37757	0.900000	0.52787	9.698000	0.98700	2.732000	0.93576	0.655000	0.94253	GTG	.	.		0.592	KCNJ12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255060.2	NM_021012	
SUPT6H	6830	hgsc.bcm.edu	37	17	27014460	27014460	+	Nonsense_Mutation	SNP	G	G	T			TCGA-2Y-A9GY-01A-11D-A382-10	TCGA-2Y-A9GY-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	75a72b01-26d1-410f-a2f3-fabe09059eed	e1cd43c8-e295-4191-8754-0520f03119e1	g.chr17:27014460G>T	ENST00000314616.6	+	23	3260	c.2977G>T	c.(2977-2979)Gga>Tga	p.G993*	SUPT6H_ENST00000347486.4_Nonsense_Mutation_p.G993*	NM_003170.3	NP_003161.2	Q7KZ85	SPT6H_HUMAN	suppressor of Ty 6 homolog (S. cerevisiae)	993	Interaction with KDM6A. {ECO:0000250}.			YVCGLGP -> VCLWPGT (in Ref. 1; AAB18949). {ECO:0000305}.	chromatin remodeling (GO:0006338)|mRNA processing (GO:0006397)|mRNA transport (GO:0051028)|negative regulation of histone H3-K27 methylation (GO:0061086)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|regulation of isotype switching (GO:0045191)|regulation of mRNA export from nucleus (GO:0010793)|regulation of mRNA processing (GO:0050684)|regulation of muscle cell differentiation (GO:0051147)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone binding (GO:0042393)|hydrolase activity, acting on ester bonds (GO:0016788)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(4)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(15)|lung(21)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	64	Lung NSC(42;0.00431)					TTGTGGCCTGGGACCTCGGAA	0.458																																					p.G993X		Atlas-SNP	.											.	SUPT6H	165	.	0			c.G2977T						.						64.0	54.0	58.0					17																	27014460		2203	4300	6503	SO:0001587	stop_gained	6830	exon23			GGCCTGGGACCTC	U38658	CCDS32596.1	17q11.2	2013-02-14	2001-11-28			ENSG00000109111		"""SH2 domain containing"""	11470	protein-coding gene	gene with protein product		601333	"""suppressor of Ty (S.cerevisiae) 6 homolog"""			8786132	Standard	XM_005258026		Approved	KIAA0162, SPT6H	uc002hby.3	Q7KZ85		ENST00000314616.6:c.2977G>T	chr17.hg19:g.27014460G>T	ENSP00000319104:p.Gly993*	49.0	0.0		75.0	25.0	NM_003170	A7E2B4|Q15737|Q6GMQ4|Q7KYW9|Q7LDK4|Q8N526|Q92775|Q96AH3|Q9BTH9|Q9BTI2	Nonsense_Mutation	SNP	ENST00000314616.6	hg19	CCDS32596.1	.	.	.	.	.	.	.	.	.	.	G	44	10.989530	0.99499	.	.	ENSG00000109111	ENST00000314616	.	.	.	5.29	5.29	0.74685	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-16.3759	19.3016	0.94146	0.0:0.0:1.0:0.0	.	.	.	.	X	993	.	ENSP00000319104:G993X	G	+	1	0	SUPT6H	24038587	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.160000	0.94734	2.649000	0.89929	0.557000	0.71058	GGA	.	.		0.458	SUPT6H-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446422.2	NM_003170	
NAGLU	4669	hgsc.bcm.edu	37	17	40689495	40689495	+	Missense_Mutation	SNP	G	G	C			TCGA-2Y-A9GY-01A-11D-A382-10	TCGA-2Y-A9GY-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	75a72b01-26d1-410f-a2f3-fabe09059eed	e1cd43c8-e295-4191-8754-0520f03119e1	g.chr17:40689495G>C	ENST00000225927.2	+	2	564	c.463G>C	c.(463-465)Gac>Cac	p.D155H	RP11-400F19.8_ENST00000585572.1_RNA	NM_000263.3	NP_000254.2	P54802	ANAG_HUMAN	N-acetylglucosaminidase, alpha	155					carbohydrate metabolic process (GO:0005975)|cerebellar Purkinje cell layer development (GO:0021680)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|inner ear receptor cell development (GO:0060119)|locomotor rhythm (GO:0045475)|lysosome organization (GO:0007040)|middle ear morphogenesis (GO:0042474)|nervous system development (GO:0007399)|retinal rod cell development (GO:0046548)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)|lysosome (GO:0005764)	alpha-N-acetylglucosaminidase activity (GO:0004561)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(1)|ovary(2)|skin(1)	12		all_cancers(22;1.58e-05)|Breast(137;0.000153)|all_epithelial(22;0.000344)		BRCA - Breast invasive adenocarcinoma(366;0.13)	N-Acetyl-D-glucosamine(DB00141)	GCGAGAGATAGACTGGATGGC	0.622																																					p.D155H		Atlas-SNP	.											.	NAGLU	36	.	0			c.G463C						.						130.0	112.0	118.0					17																	40689495		2203	4300	6503	SO:0001583	missense	4669	exon2			GAGATAGACTGGA		CCDS11427.1	17q21.2	2010-07-27	2010-07-27		ENSG00000108784	ENSG00000108784	3.2.1.50		7632	protein-coding gene	gene with protein product	"""Sanfilippo disease IIIB"""	609701					Standard	XM_006721920		Approved	NAG	uc002hzv.3	P54802		ENST00000225927.2:c.463G>C	chr17.hg19:g.40689495G>C	ENSP00000225927:p.Asp155His	66.0	0.0		109.0	46.0	NM_000263		Missense_Mutation	SNP	ENST00000225927.2	hg19	CCDS11427.1	.	.	.	.	.	.	.	.	.	.	G	29.1	4.979917	0.92982	.	.	ENSG00000108784	ENST00000225927	D	0.99479	-5.98	4.3	4.3	0.51218	Alpha-N-acetylglucosaminidase, tim-barrel domain (1);	0.000000	0.85682	D	0.000000	D	0.99661	0.9874	H	0.95611	3.695	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.97379	0.9981	10	0.87932	D	0	-42.4756	15.8626	0.79038	0.0:0.0:1.0:0.0	.	155	P54802	ANAG_HUMAN	H	155	ENSP00000225927:D155H	ENSP00000225927:D155H	D	+	1	0	NAGLU	37943021	1.000000	0.71417	0.953000	0.39169	0.977000	0.68977	9.428000	0.97476	2.363000	0.80096	0.561000	0.74099	GAC	.	.		0.622	NAGLU-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450385.1	NM_000263	
HOXB5	3215	hgsc.bcm.edu	37	17	46670974	46670974	+	Missense_Mutation	SNP	T	T	G	rs199857901		TCGA-2Y-A9GY-01A-11D-A382-10	TCGA-2Y-A9GY-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	75a72b01-26d1-410f-a2f3-fabe09059eed	e1cd43c8-e295-4191-8754-0520f03119e1	g.chr17:46670974T>G	ENST00000239151.5	-	1	349	c.71A>C	c.(70-72)tAt>tCt	p.Y24S	HOXB-AS3_ENST00000480872.1_RNA|HOXB3_ENST00000552000.2_Intron|HOXB-AS3_ENST00000467155.2_RNA|HOXB-AS3_ENST00000476204.1_RNA|HOXB-AS3_ENST00000474324.1_RNA|HOXB-AS3_ENST00000460041.1_RNA|HOXB-AS3_ENST00000481995.1_RNA|HOXB-AS3_ENST00000466037.2_RNA|HOXB-AS3_ENST00000487849.3_RNA|HOXB-AS3_ENST00000474040.1_RNA|HOXB-AS3_ENST00000477144.1_RNA|HOXB-AS3_ENST00000429755.4_RNA|HOXB-AS3_ENST00000465846.2_RNA|HOXB-AS3_ENST00000492897.3_RNA	NM_002147.3	NP_002138.1	P09067	HXB5_HUMAN	homeobox B5	24					anatomical structure morphogenesis (GO:0009653)|anterior/posterior pattern specification (GO:0009952)|embryonic skeletal system morphogenesis (GO:0048704)|endothelial cell differentiation (GO:0045446)	nucleus (GO:0005634)	RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)			large_intestine(1)|lung(2)	3						GCCACTGCCATAATTTAGCAA	0.517																																					p.Y24S		Atlas-SNP	.											.	HOXB5	20	.	0			c.A71C						.						46.0	47.0	47.0					17																	46670974		1908	3830	5738	SO:0001583	missense	3215	exon1			CTGCCATAATTTA		CCDS11530.1	17q21.32	2011-06-20	2005-12-22		ENSG00000120075	ENSG00000120075		"""Homeoboxes / ANTP class : HOXL subclass"""	5116	protein-coding gene	gene with protein product		142960	"""homeo box B5"""	HOX2, HOX2A		1973146, 1358459	Standard	NM_002147		Approved		uc002inr.3	P09067	OTTHUMG00000159913	ENST00000239151.5:c.71A>C	chr17.hg19:g.46670974T>G	ENSP00000239151:p.Tyr24Ser	151.0	0.0		212.0	27.0	NM_002147	B2RC69|P09069|Q17RP4	Missense_Mutation	SNP	ENST00000239151.5	hg19	CCDS11530.1	.	.	.	.	.	.	.	.	.	.	T	19.86	3.904827	0.72868	.	.	ENSG00000120075	ENST00000239151	D	0.93604	-3.25	5.44	5.44	0.79542	.	0.000000	0.64402	D	0.000001	D	0.97259	0.9104	M	0.91612	3.225	0.80722	D	1	D	0.71674	0.998	D	0.73708	0.981	D	0.98200	1.0467	10	0.87932	D	0	.	15.4969	0.75662	0.0:0.0:0.0:1.0	.	24	P09067	HXB5_HUMAN	S	24	ENSP00000239151:Y24S	ENSP00000239151:Y24S	Y	-	2	0	HOXB5	44025973	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.698000	0.84413	2.062000	0.61559	0.454000	0.30748	TAT	.	T|0.999;C|0.001		0.517	HOXB5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358148.2		
TOB1	10140	hgsc.bcm.edu	37	17	48941376	48941376	+	Start_Codon_SNP	SNP	C	C	A			TCGA-2Y-A9GY-01A-11D-A382-10	TCGA-2Y-A9GY-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	75a72b01-26d1-410f-a2f3-fabe09059eed	e1cd43c8-e295-4191-8754-0520f03119e1	g.chr17:48941376C>A	ENST00000268957.3	-	3	431	c.3G>T	c.(1-3)atG>atT	p.M1I	TOB1_ENST00000509385.1_Intron|TOB1_ENST00000499247.2_Start_Codon_SNP_p.M1I|TOB1-AS1_ENST00000523470.1_RNA|TOB1-AS1_ENST00000416263.3_RNA	NM_001243877.1	NP_001230806.1	P50616	TOB1_HUMAN	transducer of ERBB2, 1	1					negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of cell proliferation (GO:0008285)|negative regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060212)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of translation (GO:0017148)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|positive regulation of signal transduction (GO:0009967)|SMAD protein import into nucleus (GO:0007184)	CCR4-NOT complex (GO:0030014)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	receptor tyrosine kinase binding (GO:0030971)|SH3/SH2 adaptor activity (GO:0005070)|transcription corepressor activity (GO:0003714)			breast(1)|kidney(2)|large_intestine(3)|liver(1)|lung(2)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	13			BRCA - Breast invasive adenocarcinoma(22;1.09e-08)			TTTCAAGCTGCATAGCTGCTA	0.343																																					p.M1I	NSCLC(144;643 1919 24513 29423 40686)	Atlas-SNP	.											.	TOB1	40	.	0			c.G3T						.						31.0	32.0	32.0					17																	48941376		2184	4293	6477	SO:0001582	initiator_codon_variant	10140	exon2			AAGCTGCATAGCT	D38305	CCDS11576.1	17q21.33	2012-08-14			ENSG00000141232	ENSG00000141232			11979	protein-coding gene	gene with protein product		605523		TROB1		8632892, 17785442	Standard	NM_005749		Approved	TOB, TROB	uc002isw.3	P50616	OTTHUMG00000162277	ENST00000268957.3:c.3G>T	chr17.hg19:g.48941376C>A	ENSP00000268957:p.Met1Ile	40.0	0.0		68.0	41.0	NM_005749	B2R9T0|D3DTY3|Q4KMQ0	Missense_Mutation	SNP	ENST00000268957.3	hg19	CCDS11576.1	.	.	.	.	.	.	.	.	.	.	C	17.76	3.469410	0.63625	.	.	ENSG00000141232	ENST00000499247;ENST00000268957	T;T	0.69435	-0.4;-0.4	5.76	5.76	0.90799	Anti-proliferative protein (2);	0.000000	0.85682	D	0.000000	D	0.83677	0.5306	.	.	.	0.80722	D	1	D	0.56521	0.976	D	0.72982	0.979	D	0.84911	0.0848	9	0.87932	D	0	.	19.9857	0.97347	0.0:1.0:0.0:0.0	.	1	P50616	TOB1_HUMAN	I	1	ENSP00000427695:M1I;ENSP00000268957:M1I	ENSP00000268957:M1I	M	-	3	0	TOB1	46296375	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.487000	0.81328	2.706000	0.92434	0.655000	0.94253	ATG	.	.		0.343	TOB1-002	KNOWN	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000368364.1		Missense_Mutation
TEX14	56155	hgsc.bcm.edu	37	17	56665261	56665261	+	Missense_Mutation	SNP	T	T	C	rs369322235		TCGA-2Y-A9GY-01A-11D-A382-10	TCGA-2Y-A9GY-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	75a72b01-26d1-410f-a2f3-fabe09059eed	e1cd43c8-e295-4191-8754-0520f03119e1	g.chr17:56665261T>C	ENST00000240361.8	-	16	2801	c.2716A>G	c.(2716-2718)Acc>Gcc	p.T906A	TEX14_ENST00000349033.5_Missense_Mutation_p.T900A|TEX14_ENST00000389934.3_Missense_Mutation_p.T900A			Q8IWB6	TEX14_HUMAN	testis expressed 14	906					attachment of spindle microtubules to kinetochore (GO:0008608)|intercellular bridge organization (GO:0043063)|male meiosis (GO:0007140)|mitotic sister chromatid separation (GO:0051306)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of cytokinesis (GO:0032466)|negative regulation of protein binding (GO:0032091)	cell (GO:0005623)|cytoplasm (GO:0005737)|intercellular bridge (GO:0045171)|kinetochore (GO:0000776)|midbody (GO:0030496)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)			breast(6)|endometrium(5)|kidney(3)|large_intestine(22)|liver(1)|lung(24)|ovary(4)|pancreas(1)|prostate(1)|skin(5)|stomach(5)|upper_aerodigestive_tract(1)|urinary_tract(3)	81	Medulloblastoma(34;0.127)|all_neural(34;0.237)					CCTTACCTGGTAGAGTCCCAG	0.582											OREG0024616	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.T906A		Atlas-SNP	.											.	TEX14	343	.	0			c.A2716G						.						132.0	126.0	128.0					17																	56665261		2203	4300	6503	SO:0001583	missense	56155	exon16			ACCTGGTAGAGTC	AF285601	CCDS32692.1, CCDS32693.1, CCDS56042.1	17q22	2013-09-20	2007-03-13		ENSG00000121101	ENSG00000121101			11737	protein-coding gene	gene with protein product	"""cancer/testis antigen 113"""	605792	"""testis expressed sequence 14"""			11279525, 12711554	Standard	NM_031272		Approved	CT113	uc010dcz.2	Q8IWB6	OTTHUMG00000179245	ENST00000240361.8:c.2716A>G	chr17.hg19:g.56665261T>C	ENSP00000240361:p.Thr906Ala	63.0	0.0	1017	123.0	20.0	NM_001201457	A6NH19|Q7RTP3|Q8ND97|Q9BXT9	Missense_Mutation	SNP	ENST00000240361.8	hg19	CCDS56042.1	.	.	.	.	.	.	.	.	.	.	T	2.338	-0.351856	0.05173	.	.	ENSG00000121101	ENST00000240361;ENST00000389934;ENST00000349033	T;T;T	0.78246	-1.16;-1.16;-1.11	5.0	-10.0	0.00425	.	1.931450	0.01822	N	0.034142	T	0.60457	0.2270	L	0.36672	1.1	0.09310	N	1	B;B;B	0.06786	0.0;0.0;0.001	B;B;B	0.08055	0.001;0.001;0.003	T	0.48375	-0.9041	10	0.15952	T	0.53	.	5.1361	0.14935	0.1897:0.5002:0.14:0.1701	.	906;900;900	Q8IWB6;Q8IWB6-3;Q8IWB6-2	TEX14_HUMAN;.;.	A	906;900;900	ENSP00000240361:T906A;ENSP00000374584:T900A;ENSP00000268910:T900A	ENSP00000240361:T906A	T	-	1	0	TEX14	54020260	0.000000	0.05858	0.000000	0.03702	0.032000	0.12392	-2.048000	0.01406	-3.012000	0.00272	0.455000	0.32223	ACC	.	.		0.582	TEX14-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000445446.1		
GPRC5C	55890	hgsc.bcm.edu	37	17	72436225	72436225	+	Missense_Mutation	SNP	G	G	A			TCGA-2Y-A9GY-01A-11D-A382-10	TCGA-2Y-A9GY-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	75a72b01-26d1-410f-a2f3-fabe09059eed	e1cd43c8-e295-4191-8754-0520f03119e1	g.chr17:72436225G>A	ENST00000392627.1	+	2	1571	c.445G>A	c.(445-447)Gtg>Atg	p.V149M	GPRC5C_ENST00000342648.5_Intron|GPRC5C_ENST00000392629.2_Missense_Mutation_p.V116M|GPRC5C_ENST00000481232.1_Intron	NM_022036.2	NP_071319.2	Q9NQ84	GPC5C_HUMAN	G protein-coupled receptor, class C, group 5, member C	104					G-protein coupled receptor signaling pathway (GO:0007186)	cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|mitochondrion (GO:0005739)|receptor complex (GO:0043235)|vesicle (GO:0031982)	G-protein coupled receptor activity (GO:0004930)			central_nervous_system(1)|large_intestine(3)|lung(9)|ovary(2)|pancreas(1)|prostate(1)	17						CTTCTGCCTCGTGTTTGCCTG	0.607																																					p.V149M		Atlas-SNP	.											.	GPRC5C	92	.	0			c.G445A						.						93.0	95.0	94.0					17																	72436225		2203	4300	6503	SO:0001583	missense	55890	exon2			TGCCTCGTGTTTG	AF207989	CCDS11699.1, CCDS42378.1	17q25	2014-01-30	2014-01-30		ENSG00000170412	ENSG00000170412		"""GPCR / Class C : Orphans"""	13309	protein-coding gene	gene with protein product		605949	"""G protein-coupled receptor, family C, group 5, member C"""			10945465	Standard	NM_022036		Approved	RAIG-3	uc002jkr.3	Q9NQ84	OTTHUMG00000067613	ENST00000392627.1:c.445G>A	chr17.hg19:g.72436225G>A	ENSP00000376403:p.Val149Met	35.0	0.0		67.0	36.0	NM_022036	B5BUN4|Q2NL85|Q9NZG5	Missense_Mutation	SNP	ENST00000392627.1	hg19	CCDS11699.1	.	.	.	.	.	.	.	.	.	.	G	10.81	1.456136	0.26161	.	.	ENSG00000170412	ENST00000392627;ENST00000342648;ENST00000392629;ENST00000392628	D	0.88975	-2.45	5.67	5.67	0.87782	GPCR, family 3, C-terminal (2);	0.233636	0.44483	D	0.000452	D	0.92476	0.7611	M	0.62723	1.935	0.41042	D	0.985232	D;D;D	0.76494	0.999;0.997;0.999	D;D;D	0.67548	0.952;0.919;0.92	D	0.92825	0.6275	10	0.87932	D	0	-7.1666	12.0466	0.53483	0.0867:0.0:0.9133:0.0	.	104;104;116	A8MXZ4;Q9NQ84;Q9NQ84-2	.;GPC5C_HUMAN;.	M	104;149;116;104	ENSP00000376405:V116M	ENSP00000340595:V149M	V	+	1	0	GPRC5C	69947820	1.000000	0.71417	0.997000	0.53966	0.870000	0.49936	4.859000	0.62954	2.676000	0.91093	0.561000	0.74099	GTG	.	.		0.607	GPRC5C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000145094.2		
ME2	4200	hgsc.bcm.edu	37	18	48452204	48452204	+	Missense_Mutation	SNP	T	T	C			TCGA-2Y-A9GY-01A-11D-A382-10	TCGA-2Y-A9GY-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	75a72b01-26d1-410f-a2f3-fabe09059eed	e1cd43c8-e295-4191-8754-0520f03119e1	g.chr18:48452204T>C	ENST00000321341.5	+	12	1522	c.1250T>C	c.(1249-1251)tTt>tCt	p.F417S	ME2_ENST00000382927.3_Missense_Mutation_p.F417S	NM_002396.4	NP_002387.1	P23368	MAOM_HUMAN	malic enzyme 2, NAD(+)-dependent, mitochondrial	417					malate metabolic process (GO:0006108)	intracellular membrane-bounded organelle (GO:0043231)|mitochondrion (GO:0005739)	electron carrier activity (GO:0009055)|malate dehydrogenase (decarboxylating) (NAD+) activity (GO:0004471)|metal ion binding (GO:0046872)|NAD binding (GO:0051287)|oxaloacetate decarboxylase activity (GO:0008948)			breast(2)|endometrium(1)|kidney(2)|large_intestine(4)|lung(11)|upper_aerodigestive_tract(3)	23		Colorectal(6;0.0273)|all_epithelial(6;0.118)		Colorectal(21;0.0313)|READ - Rectum adenocarcinoma(32;0.105)|STAD - Stomach adenocarcinoma(97;0.184)		CCTGTAATATTTGCATTAAGT	0.398																																					p.F417S		Atlas-SNP	.											.	ME2	49	.	0			c.T1250C						.						67.0	62.0	64.0					18																	48452204		2203	4300	6503	SO:0001583	missense	4200	exon12			TAATATTTGCATT	M55905	CCDS11948.1, CCDS54187.1	18q21	2012-10-02			ENSG00000082212	ENSG00000082212	1.1.1.40		6984	protein-coding gene	gene with protein product		154270				1993674	Standard	NM_002396		Approved		uc002ley.3	P23368	OTTHUMG00000132694	ENST00000321341.5:c.1250T>C	chr18.hg19:g.48452204T>C	ENSP00000321070:p.Phe417Ser	192.0	0.0		282.0	115.0	NM_001168335	B2R8J2|Q9BWL6|Q9BYG1|Q9H4B2	Missense_Mutation	SNP	ENST00000321341.5	hg19	CCDS11948.1	.	.	.	.	.	.	.	.	.	.	T	23.6	4.432115	0.83776	.	.	ENSG00000082212	ENST00000321341;ENST00000382927	T;T	0.60040	0.22;0.22	5.59	5.59	0.84812	Malic enzyme, NAD-binding (2);NAD(P)-binding domain (1);	0.047369	0.85682	D	0.000000	D	0.84293	0.5440	H	0.97564	4.03	0.58432	D	0.999996	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.89821	0.3989	10	0.87932	D	0	-23.0014	14.7442	0.69477	0.0:0.0:0.0:1.0	.	417;417	Q9BWL6;P23368	.;MAOM_HUMAN	S	417	ENSP00000321070:F417S;ENSP00000372384:F417S	ENSP00000321070:F417S	F	+	2	0	ME2	46706202	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	5.989000	0.70587	2.118000	0.64928	0.533000	0.62120	TTT	.	.		0.398	ME2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255991.1	NM_002396	
KEAP1	9817	hgsc.bcm.edu	37	19	10610255	10610255	+	Missense_Mutation	SNP	A	A	C			TCGA-2Y-A9GY-01A-11D-A382-10	TCGA-2Y-A9GY-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	75a72b01-26d1-410f-a2f3-fabe09059eed	e1cd43c8-e295-4191-8754-0520f03119e1	g.chr19:10610255A>C	ENST00000171111.5	-	2	1002	c.455T>G	c.(454-456)gTc>gGc	p.V152G	KEAP1_ENST00000393623.2_Missense_Mutation_p.V152G|KEAP1_ENST00000588024.1_5'Flank	NM_203500.1	NP_987096.1	Q14145	KEAP1_HUMAN	kelch-like ECH-associated protein 1	152					cellular response to interleukin-4 (GO:0071353)|in utero embryonic development (GO:0001701)|proteasomal ubiquitin-independent protein catabolic process (GO:0010499)|protein ubiquitination (GO:0016567)|regulation of epidermal cell differentiation (GO:0045604)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|microtubule organizing center (GO:0005815)|midbody (GO:0030496)|nucleus (GO:0005634)				breast(3)|endometrium(2)|kidney(4)|large_intestine(4)|liver(2)|lung(69)|ovary(2)|pancreas(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	92			OV - Ovarian serous cystadenocarcinoma(20;2.71e-09)|Epithelial(33;2.32e-06)|all cancers(31;1.42e-05)		Dimethyl fumarate(DB08908)	GACGTGGAGGACACACTTCTC	0.582																																					p.V152G		Atlas-SNP	.											.	KEAP1	182	.	0			c.T455G						.						182.0	143.0	156.0					19																	10610255		2203	4300	6503	SO:0001583	missense	9817	exon2			TGGAGGACACACT	AF361886	CCDS12239.1	19p13.2	2013-01-30				ENSG00000079999		"""Kelch-like"", ""BTB/POZ domain containing"""	23177	protein-coding gene	gene with protein product	"""kelch-like family member 19"""	606016					Standard	NM_012289		Approved	KIAA0132, MGC10630, MGC1114, MGC20887, MGC4407, MGC9454, INrf2, KLHL19	uc002mor.1	Q14145		ENST00000171111.5:c.455T>G	chr19.hg19:g.10610255A>C	ENSP00000171111:p.Val152Gly	107.0	0.0		67.0	27.0	NM_012289	B3KPD5|Q6LEP0|Q8WTX1|Q9BPY9	Missense_Mutation	SNP	ENST00000171111.5	hg19	CCDS12239.1	.	.	.	.	.	.	.	.	.	.	A	15.53	2.859886	0.51482	.	.	ENSG00000079999	ENST00000171111;ENST00000393623	T;T	0.70986	-0.53;-0.53	4.81	3.8	0.43715	BTB/POZ-like (1);BTB/POZ (1);BTB/POZ fold (2);	0.128186	0.52532	D	0.000074	D	0.87249	0.6130	H	0.96333	3.805	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.87316	0.2315	10	0.87932	D	0	.	8.5797	0.33621	0.9066:0.0:0.0934:0.0	.	152	Q14145	KEAP1_HUMAN	G	152	ENSP00000171111:V152G;ENSP00000377245:V152G	ENSP00000171111:V152G	V	-	2	0	KEAP1	10471255	1.000000	0.71417	0.989000	0.46669	0.401000	0.30781	9.093000	0.94163	0.703000	0.31848	-0.379000	0.06801	GTC	.	.		0.582	KEAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452000.1	NM_012289	
TMED1	11018	hgsc.bcm.edu	37	19	10943770	10943770	+	Missense_Mutation	SNP	G	G	T			TCGA-2Y-A9GY-01A-11D-A382-10	TCGA-2Y-A9GY-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	75a72b01-26d1-410f-a2f3-fabe09059eed	e1cd43c8-e295-4191-8754-0520f03119e1	g.chr19:10943770G>T	ENST00000214869.2	-	4	683	c.585C>A	c.(583-585)ttC>ttA	p.F195L	TMED1_ENST00000591695.1_Missense_Mutation_p.S134Y|TMED1_ENST00000588289.1_Missense_Mutation_p.F50L	NM_006858.2	NP_006849.1	Q13445	TMED1_HUMAN	transmembrane emp24 protein transport domain containing 1	195					cell-cell signaling (GO:0007267)|protein transport (GO:0015031)|signal transduction (GO:0007165)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor binding (GO:0005102)			breast(1)|central_nervous_system(2)|lung(2)|ovary(3)|prostate(1)|skin(1)	10						CAGCTGACCAGAAGTTGACCC	0.647																																					p.F195L		Atlas-SNP	.											.	TMED1	22	.	0			c.C585A						.						76.0	73.0	74.0					19																	10943770		2203	4300	6503	SO:0001583	missense	11018	exon4			TGACCAGAAGTTG	U41804	CCDS12249.1	19p13.2	2008-02-05	2005-08-26			ENSG00000099203			17291	protein-coding gene	gene with protein product		605395	"""transmembrane emp24 domain containing 1"""			11466339, 8621446	Standard	NM_006858		Approved	ST2L, MGC1270, IL1RL1LG, Il1rl1l	uc002mpy.3	Q13445		ENST00000214869.2:c.585C>A	chr19.hg19:g.10943770G>T	ENSP00000214869:p.Phe195Leu	102.0	0.0		68.0	33.0	NM_006858		Missense_Mutation	SNP	ENST00000214869.2	hg19	CCDS12249.1	.	.	.	.	.	.	.	.	.	.	G	14.97	2.693921	0.48202	.	.	ENSG00000099203	ENST00000214869	T	0.16196	2.36	5.24	4.2	0.49525	GOLD (1);	0.000000	0.85682	D	0.000000	T	0.21801	0.0525	M	0.71296	2.17	0.80722	D	1	P	0.36086	0.536	B	0.39531	0.302	T	0.03095	-1.1073	10	0.15952	T	0.53	-20.8576	12.7717	0.57426	0.0807:0.0:0.9193:0.0	.	195	Q13445	TMED1_HUMAN	L	195	ENSP00000214869:F195L	ENSP00000214869:F195L	F	-	3	2	TMED1	10804770	1.000000	0.71417	1.000000	0.80357	0.318000	0.28184	3.171000	0.50824	1.215000	0.43411	-0.140000	0.14226	TTC	.	.		0.647	TMED1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452614.1	NM_006858	
NXNL1	115861	hgsc.bcm.edu	37	19	17571528	17571528	+	Missense_Mutation	SNP	C	C	A	rs374915427		TCGA-2Y-A9GY-01A-11D-A382-10	TCGA-2Y-A9GY-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	75a72b01-26d1-410f-a2f3-fabe09059eed	e1cd43c8-e295-4191-8754-0520f03119e1	g.chr19:17571528C>A	ENST00000301944.2	-	1	235	c.151G>T	c.(151-153)Gtg>Ttg	p.V51L	CTD-2521M24.10_ENST00000594663.1_5'UTR	NM_138454.1	NP_612463.1	Q96CM4	NXNL1_HUMAN	nucleoredoxin-like 1	51	Thioredoxin. {ECO:0000255|PROSITE- ProRule:PRU00691}.				photoreceptor cell maintenance (GO:0045494)	membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)				central_nervous_system(1)|cervix(1)|large_intestine(1)|lung(1)|prostate(1)|upper_aerodigestive_tract(1)	6						AGGATGGGCACGAAGGCCTGG	0.617																																					p.V51L		Atlas-SNP	.											.	NXNL1	13	.	0			c.G151T						.						82.0	79.0	80.0					19																	17571528		2203	4300	6503	SO:0001583	missense	115861	exon1			TGGGCACGAAGGC	BC014127	CCDS12360.1	19p13.11	2014-05-21	2007-08-16	2007-08-16	ENSG00000171773	ENSG00000171773			25179	protein-coding gene	gene with protein product		608791	"""thioredoxin-like 6"""	TXNL6		12477932	Standard	NM_138454		Approved	RDCVF	uc002ngs.3	Q96CM4	OTTHUMG00000182798	ENST00000301944.2:c.151G>T	chr19.hg19:g.17571528C>A	ENSP00000305631:p.Val51Leu	57.0	0.0		49.0	26.0	NM_138454	Q0QD37	Missense_Mutation	SNP	ENST00000301944.2	hg19	CCDS12360.1	.	.	.	.	.	.	.	.	.	.	c	7.195	0.592355	0.13812	.	.	ENSG00000171773	ENST00000301944	T	0.79033	-1.23	3.92	3.92	0.45320	Thioredoxin-like fold (3);	0.241819	0.41001	D	0.000969	T	0.51024	0.1650	N	0.01228	-0.945	0.09310	N	1	B	0.13594	0.008	B	0.12156	0.007	T	0.47611	-0.9104	10	0.36615	T	0.2	-8.9194	13.4448	0.61134	0.0:1.0:0.0:0.0	.	51	Q96CM4	NXNL1_HUMAN	L	51	ENSP00000305631:V51L	ENSP00000305631:V51L	V	-	1	0	NXNL1	17432528	0.006000	0.16342	0.209000	0.23619	0.092000	0.18411	0.983000	0.29552	2.018000	0.59344	0.467000	0.42956	GTG	.	.		0.617	NXNL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463803.1	NM_138454	
WDR87	83889	hgsc.bcm.edu	37	19	38377966	38377966	+	Missense_Mutation	SNP	G	G	C			TCGA-2Y-A9GY-01A-11D-A382-10	TCGA-2Y-A9GY-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	75a72b01-26d1-410f-a2f3-fabe09059eed	e1cd43c8-e295-4191-8754-0520f03119e1	g.chr19:38377966G>C	ENST00000303868.5	-	6	6452	c.6228C>G	c.(6226-6228)atC>atG	p.I2076M	WDR87_ENST00000447313.2_Missense_Mutation_p.I2115M	NM_031951.3	NP_114157.3	Q6ZQQ6	WDR87_HUMAN	WD repeat domain 87	2076	Glu-rich.									NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|lung(2)|prostate(1)|skin(3)|stomach(1)	36						GTGCCTTTAAGATTTTGTTCA	0.393																																					p.I2076M		Atlas-SNP	.											.	WDR87	191	.	0			c.C6228G						.						38.0	28.0	31.0					19																	38377966		692	1591	2283	SO:0001583	missense	83889	exon6			CTTTAAGATTTTG	AK128826	CCDS46063.1, CCDS74356.1	19q13.13	2013-01-09			ENSG00000171804	ENSG00000171804		"""WD repeat domain containing"""	29934	protein-coding gene	gene with protein product							Standard	XM_005259304		Approved	NYD-SP11	uc010efu.2	Q6ZQQ6	OTTHUMG00000048187	ENST00000303868.5:c.6228C>G	chr19.hg19:g.38377966G>C	ENSP00000368025:p.Ile2076Met	165.0	0.0		237.0	38.0	NM_031951	Q9BWV9	Missense_Mutation	SNP	ENST00000303868.5	hg19	CCDS46063.1	.	.	.	.	.	.	.	.	.	.	G	5.006	0.186729	0.09547	.	.	ENSG00000171804	ENST00000447313;ENST00000303868	T;T	0.64803	-0.12;-0.12	3.8	-1.29	0.09288	.	.	.	.	.	T	0.37544	0.1007	N	0.14661	0.345	0.09310	N	1	B;B	0.18461	0.028;0.028	B;B	0.11329	0.006;0.006	T	0.16928	-1.0386	9	0.33141	T	0.24	.	4.5155	0.11934	0.2139:0.3533:0.4329:0.0	.	2076;2115	Q6ZQQ6;E7ESW6	WDR87_HUMAN;.	M	2115;2076	ENSP00000405012:I2115M;ENSP00000368025:I2076M	ENSP00000368025:I2076M	I	-	3	3	WDR87	43069806	0.000000	0.05858	0.000000	0.03702	0.080000	0.17528	-1.580000	0.02121	-0.081000	0.12662	0.542000	0.68232	ATC	.	.		0.393	WDR87-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000314628.2	XM_940478	
SHISA7	729956	hgsc.bcm.edu	37	19	55944926	55944926	+	Missense_Mutation	SNP	G	G	T			TCGA-2Y-A9GY-01A-11D-A382-10	TCGA-2Y-A9GY-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	75a72b01-26d1-410f-a2f3-fabe09059eed	e1cd43c8-e295-4191-8754-0520f03119e1	g.chr19:55944926G>T	ENST00000376325.4	-	4	1213	c.1214C>A	c.(1213-1215)gCg>gAg	p.A405E		NM_001145176.1	NP_001138648.1	A6NL88	SHSA7_HUMAN	shisa family member 7	405						integral component of membrane (GO:0016021)				skin(1)	1						CACCAGGCGCGCGCGCGGCAG	0.761																																					p.A405E		Atlas-SNP	.											.	SHISA7	14	.	0			c.C1214A						.						4.0	8.0	7.0					19																	55944926		588	1392	1980	SO:0001583	missense	729956	exon4			AGGCGCGCGCGCG		CCDS46193.1	19q13.42	2013-07-31	2013-07-31					"""Shisa homologs"""	35409	protein-coding gene	gene with protein product			"""shisa homolog 7 (Xenopus laevis)"""				Standard	NM_001145176		Approved		uc002qkz.3	A6NL88		ENST00000376325.4:c.1214C>A	chr19.hg19:g.55944926G>T	ENSP00000365503:p.Ala405Glu	51.0	0.0		51.0	17.0	NM_001145176		Missense_Mutation	SNP	ENST00000376325.4	hg19	CCDS46193.1	.	.	.	.	.	.	.	.	.	.	G	0.164	-1.078723	0.01903	.	.	ENSG00000187902	ENST00000376325;ENST00000432840	.	.	.	2.51	2.51	0.30379	.	0.370667	0.18731	U	0.132730	T	0.07954	0.0199	N	0.14661	0.345	0.25348	N	0.988893	P	0.48694	0.914	B	0.32149	0.141	T	0.20874	-1.0262	9	0.02654	T	1	.	6.6852	0.23142	0.0:0.0:0.718:0.2819	.	405	A6NL88	SHSA7_HUMAN	E	405;252	.	ENSP00000365503:A405E	A	-	2	0	SHISA7	60636738	0.012000	0.17670	0.997000	0.53966	0.549000	0.35272	1.103000	0.31062	1.715000	0.51383	0.394000	0.25966	GCG	.	.		0.761	SHISA7-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334533.2	NM_001145176	
R3HDML	140902	hgsc.bcm.edu	37	20	42979420	42979420	+	Missense_Mutation	SNP	C	C	G			TCGA-2Y-A9GY-01A-11D-A382-10	TCGA-2Y-A9GY-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	75a72b01-26d1-410f-a2f3-fabe09059eed	e1cd43c8-e295-4191-8754-0520f03119e1	g.chr20:42979420C>G	ENST00000217043.2	+	5	922	c.750C>G	c.(748-750)ttC>ttG	p.F250L	RP5-881L22.5_ENST00000438702.1_RNA|RP5-881L22.5_ENST00000430481.2_RNA	NM_178491.2	NP_848586.1	Q9H3Y0	CRSPL_HUMAN	R3H domain containing-like	250						extracellular region (GO:0005576)	peptidase inhibitor activity (GO:0030414)			NS(1)|breast(2)|endometrium(1)|kidney(1)|large_intestine(2)|lung(14)	21		Myeloproliferative disorder(115;0.028)	COAD - Colon adenocarcinoma(18;0.00189)			CCAACAAGTTCACGTGGTTCT	0.522																																					p.F250L		Atlas-SNP	.											.	R3HDML	33	.	0			c.C750G						.						162.0	142.0	149.0					20																	42979420		2203	4300	6503	SO:0001583	missense	140902	exon5			CAAGTTCACGTGG	BC107048	CCDS13329.1	20q13.12	2007-04-26	2005-09-02		ENSG00000101074	ENSG00000101074			16249	protein-coding gene	gene with protein product			"""R3H domain (binds single-stranded nucleic acids) containing-like"""				Standard	NM_178491		Approved	dJ881L22.3	uc002xls.2	Q9H3Y0	OTTHUMG00000032524	ENST00000217043.2:c.750C>G	chr20.hg19:g.42979420C>G	ENSP00000217043:p.Phe250Leu	121.0	0.0		183.0	45.0	NM_178491		Missense_Mutation	SNP	ENST00000217043.2	hg19	CCDS13329.1	.	.	.	.	.	.	.	.	.	.	C	2.487	-0.318397	0.05386	.	.	ENSG00000101074	ENST00000217043	T	0.04156	3.69	4.64	2.2	0.27929	.	0.486384	0.19009	N	0.125123	T	0.00936	0.0031	N	0.00205	-1.85	0.20307	N	0.999914	B	0.02656	0.0	B	0.01281	0.0	T	0.46721	-0.9171	10	0.02654	T	1	.	5.9616	0.19303	0.0:0.4921:0.2832:0.2247	.	250	Q9H3Y0	CRSPL_HUMAN	L	250	ENSP00000217043:F250L	ENSP00000217043:F250L	F	+	3	2	R3HDML	42412834	0.001000	0.12720	0.167000	0.22817	0.005000	0.04900	-0.407000	0.07178	0.887000	0.36136	0.561000	0.74099	TTC	.	.		0.522	R3HDML-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079344.1	NM_178491	
WDR4	10785	hgsc.bcm.edu	37	21	44272435	44272435	+	Splice_Site	SNP	C	C	A			TCGA-2Y-A9GY-01A-11D-A382-10	TCGA-2Y-A9GY-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	75a72b01-26d1-410f-a2f3-fabe09059eed	e1cd43c8-e295-4191-8754-0520f03119e1	g.chr21:44272435C>A	ENST00000398208.2	-	10	1035		c.e10-1		WDR4_ENST00000492742.1_Splice_Site|WDR4_ENST00000330317.2_Splice_Site	NM_001260474.1|NM_001260475.1|NM_001260476.1|NM_018669.5	NP_001247403.1|NP_001247404.1|NP_001247405.1|NP_061139.2			WD repeat domain 4											haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(3)|ovary(2)	11				Colorectal(79;0.0165)|Lung(125;0.0484)|STAD - Stomach adenocarcinoma(101;0.0624)|COAD - Colon adenocarcinoma(84;0.128)|LUSC - Lung squamous cell carcinoma(216;0.244)		CAGGAACAGACTGCAGGCGAC	0.572																																					.		Atlas-SNP	.											.	WDR4	35	.	0			c.976-1G>T						.						77.0	62.0	67.0					21																	44272435		2203	4300	6503	SO:0001630	splice_region_variant	10785	exon11			AACAGACTGCAGG	AJ243912	CCDS13691.1	21q22.3	2013-01-09			ENSG00000160193	ENSG00000160193		"""WD repeat domain containing"""	12756	protein-coding gene	gene with protein product	"""TRM82 tRNA methyltransferase 82 homolog (S. cerevisiae)"""	605924				12403464	Standard	NM_018669		Approved	TRM82, TRMT82	uc002zci.4	P57081	OTTHUMG00000086826	ENST00000398208.2:c.976-1G>T	chr21.hg19:g.44272435C>A		76.0	0.0		89.0	14.0	NM_033661		Splice_Site	SNP	ENST00000398208.2	hg19	CCDS13691.1	.	.	.	.	.	.	.	.	.	.	C	12.54	1.967697	0.34754	.	.	ENSG00000160193	ENST00000330317;ENST00000398208	.	.	.	4.12	4.12	0.48240	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.065	0.53583	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	WDR4	43145504	0.937000	0.31787	0.308000	0.25141	0.022000	0.10575	3.344000	0.52174	2.303000	0.77524	0.655000	0.94253	.	.	.		0.572	WDR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195479.1		Intron
ANKRD54	129138	hgsc.bcm.edu	37	22	38228664	38228664	+	Missense_Mutation	SNP	T	T	C			TCGA-2Y-A9GY-01A-11D-A382-10	TCGA-2Y-A9GY-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	75a72b01-26d1-410f-a2f3-fabe09059eed	e1cd43c8-e295-4191-8754-0520f03119e1	g.chr22:38228664T>C	ENST00000215941.4	-	7	1000	c.808A>G	c.(808-810)Atg>Gtg	p.M270V	ANKRD54_ENST00000406423.1_Missense_Mutation_p.M150V|ANKRD54_ENST00000609454.1_Missense_Mutation_p.M77V|ANKRD54_ENST00000411961.2_Missense_Mutation_p.M254V|ANKRD54_ENST00000498417.1_5'UTR	NM_138797.2	NP_620152.1	Q6NXT1	ANR54_HUMAN	ankyrin repeat domain 54	270					nucleocytoplasmic transport (GO:0006913)|positive regulation of erythrocyte differentiation (GO:0045648)|regulation of intracellular signal transduction (GO:1902531)	cytoplasm (GO:0005737)|midbody (GO:0030496)|nucleus (GO:0005634)	protein kinase regulator activity (GO:0019887)			lung(1)	1	Melanoma(58;0.045)					GTACTGGTCATCTGCAGGCGG	0.617																																					p.M270V		Atlas-SNP	.											.	ANKRD54	7	.	0			c.A808G						.						76.0	70.0	72.0					22																	38228664		2203	4300	6503	SO:0001583	missense	129138	exon7			TGGTCATCTGCAG	BC014641	CCDS13959.1	22q13.1	2013-01-10			ENSG00000100124	ENSG00000100124		"""Ankyrin repeat domain containing"""	25185	protein-coding gene	gene with protein product		613383				15461802	Standard	NM_138797		Approved	LIAR	uc003auc.3	Q6NXT1	OTTHUMG00000150663	ENST00000215941.4:c.808A>G	chr22.hg19:g.38228664T>C	ENSP00000215941:p.Met270Val	37.0	0.0		55.0	21.0	NM_138797	Q6ZSB1|Q9UGV1	Missense_Mutation	SNP	ENST00000215941.4	hg19	CCDS13959.1	.	.	.	.	.	.	.	.	.	.	T	1.606	-0.525197	0.04141	.	.	ENSG00000100124	ENST00000215941;ENST00000406423;ENST00000411961	T;T;T	0.66638	-0.11;-0.03;-0.22	5.59	5.59	0.84812	.	0.238444	0.49916	D	0.000134	T	0.49745	0.1575	N	0.19112	0.55	0.36218	D	0.851827	B;B	0.19445	0.036;0.005	B;B	0.13407	0.009;0.002	T	0.54180	-0.8332	10	0.25751	T	0.34	-3.6261	11.7302	0.51732	0.0:0.0:0.1473:0.8527	.	150;270	B5MCX7;Q6NXT1	.;ANR54_HUMAN	V	270;150;254	ENSP00000215941:M270V;ENSP00000384392:M150V;ENSP00000405782:M254V	ENSP00000215941:M270V	M	-	1	0	ANKRD54	36558610	1.000000	0.71417	1.000000	0.80357	0.189000	0.23516	2.500000	0.45381	2.129000	0.65627	0.528000	0.53228	ATG	.	.		0.617	ANKRD54-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319490.1	NM_138797	
RPS6KA3	6197	hgsc.bcm.edu	37	X	20211662	20211662	+	Missense_Mutation	SNP	A	A	C			TCGA-2Y-A9GY-01A-11D-A382-10	TCGA-2Y-A9GY-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	75a72b01-26d1-410f-a2f3-fabe09059eed	e1cd43c8-e295-4191-8754-0520f03119e1	g.chrX:20211662A>C	ENST00000379565.3	-	7	743	c.536T>G	c.(535-537)cTt>cGt	p.L179R	RPS6KA3_ENST00000540702.1_Missense_Mutation_p.L151R|RPS6KA3_ENST00000544447.1_Missense_Mutation_p.L151R|RPS6KA3_ENST00000379548.4_Missense_Mutation_p.L150R	NM_004586.2	NP_004577.1	P51812	KS6A3_HUMAN	ribosomal protein S6 kinase, 90kDa, polypeptide 3	179	Protein kinase 1. {ECO:0000255|PROSITE- ProRule:PRU00159}.				axon guidance (GO:0007411)|cell cycle (GO:0007049)|central nervous system development (GO:0007417)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell growth (GO:0030307)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of DNA-templated transcription in response to stress (GO:0043620)|regulation of translation in response to stress (GO:0043555)|response to lipopolysaccharide (GO:0032496)|signal transduction (GO:0007165)|skeletal system development (GO:0001501)|stress-activated MAPK cascade (GO:0051403)|synaptic transmission (GO:0007268)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|cysteine-type endopeptidase inhibitor activity involved in apoptotic process (GO:0043027)|magnesium ion binding (GO:0000287)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(4)|central_nervous_system(4)|endometrium(3)|kidney(2)|large_intestine(5)|liver(14)|lung(7)|ovary(1)|stomach(1)	41					Acetylsalicylic acid(DB00945)	GTCTAAAGCAAGTGCAAGTTC	0.294																																					p.L179R		Atlas-SNP	.											.	RPS6KA3	110	.	0			c.T536G						.						88.0	77.0	81.0					X																	20211662		2203	4299	6502	SO:0001583	missense	6197	exon7			AAAGCAAGTGCAA	U08316	CCDS14197.1	Xp22.2-p22.1	2013-06-03	2002-08-29		ENSG00000177189	ENSG00000177189			10432	protein-coding gene	gene with protein product		300075	"""ribosomal protein S6 kinase, 90kD, polypeptide 3"", ""mental retardation, X-linked 19"", ""Coffin-Lowry syndrome"""	MRX19, CLS		8141249, 11896450, 16879200	Standard	XM_005274573		Approved	RSK, RSK2, HU-3	uc004czu.3	P51812	OTTHUMG00000021231	ENST00000379565.3:c.536T>G	chrX.hg19:g.20211662A>C	ENSP00000368884:p.Leu179Arg	58.0	0.0		82.0	22.0	NM_004586	B2R9V4|Q4VAP3|Q59H26|Q5JPK8|Q7Z3Z7	Missense_Mutation	SNP	ENST00000379565.3	hg19	CCDS14197.1	.	.	.	.	.	.	.	.	.	.	a	20.2	3.944526	0.73672	.	.	ENSG00000177189	ENST00000379565;ENST00000544447;ENST00000379548;ENST00000540702;ENST00000457145	T;T;T;T;T	0.63417	-0.04;-0.04;-0.04;-0.04;-0.04	4.78	3.59	0.41128	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.074930	0.53938	D	0.000053	T	0.70011	0.3175	L	0.42008	1.315	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.997;0.999;1.0;0.999	T	0.69837	-0.5037	10	0.87932	D	0	.	10.1644	0.42871	0.8482:0.0:0.0:0.1518	.	151;150;151;179	B4DG22;F5GYC4;B7ZB17;P51812	.;.;.;KS6A3_HUMAN	R	179;151;150;151;150	ENSP00000368884:L179R;ENSP00000440220:L151R;ENSP00000368865:L150R;ENSP00000444837:L151R;ENSP00000407655:L150R	ENSP00000368865:L150R	L	-	2	0	RPS6KA3	20121583	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.280000	0.95786	0.567000	0.29293	0.483000	0.47432	CTT	.	.		0.294	RPS6KA3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000056011.3	NM_004586	
SUPT20HL1	100130302	hgsc.bcm.edu	37	X	24382426	24382426	+	IGR	SNP	G	G	C			TCGA-2Y-A9GY-01A-11D-A382-10	TCGA-2Y-A9GY-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	75a72b01-26d1-410f-a2f3-fabe09059eed	e1cd43c8-e295-4191-8754-0520f03119e1	g.chrX:24382426G>C								AC004552.1 (15403 upstream) : PDK3 (100911 downstream)																							tgctgctgctgctcctgctcc	0.627																																					p.A517P		Atlas-SNP	.											.	.	.	.	0			c.G1549C						.						2.0	2.0	2.0					X																	24382426		1073	2483	3556	SO:0001628	intergenic_variant	100130302	exon1			GCTGCTGCTCCTG																													chrX.hg19:g.24382426G>C		168.0	0.0		171.0	9.0	NM_001136234		Missense_Mutation	SNP		hg19																																																																																				.	.	0	0.627								
ABCB7	22	hgsc.bcm.edu	37	X	74295382	74295382	+	Missense_Mutation	SNP	T	T	C			TCGA-2Y-A9GY-01A-11D-A382-10	TCGA-2Y-A9GY-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	75a72b01-26d1-410f-a2f3-fabe09059eed	e1cd43c8-e295-4191-8754-0520f03119e1	g.chrX:74295382T>C	ENST00000373394.3	-	6	677	c.670A>G	c.(670-672)Aga>Gga	p.R224G	ABCB7_ENST00000253577.3_Missense_Mutation_p.R225G|ABCB7_ENST00000339447.4_Missense_Mutation_p.R184G|ABCB7_ENST00000534570.1_5'Flank			O75027	ABCB7_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 7	224	ABC transmembrane type-1. {ECO:0000255|PROSITE-ProRule:PRU00441}.				cellular iron ion homeostasis (GO:0006879)|heme transport (GO:0015886)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|heme transporter activity (GO:0015232)			breast(1)|endometrium(5)|large_intestine(5)|lung(6)|ovary(2)|prostate(1)	20						TTGGCTATTCTTCGGATTGAA	0.418																																					p.R225G		Atlas-SNP	.											.	ABCB7	69	.	0			c.A673G						.						104.0	89.0	94.0					X																	74295382		2203	4300	6503	SO:0001583	missense	22	exon6			CTATTCTTCGGAT	AF038950	CCDS14428.1, CCDS65290.1, CCDS65291.1, CCDS75994.1	Xq13.3	2012-03-14			ENSG00000131269	ENSG00000131269		"""ATP binding cassette transporters / subfamily B"""	48	protein-coding gene	gene with protein product		300135		ABC7		9143506	Standard	NM_004299		Approved	EST140535, Atm1p, ASAT	uc004ebz.4	O75027	OTTHUMG00000021862	ENST00000373394.3:c.670A>G	chrX.hg19:g.74295382T>C	ENSP00000362492:p.Arg224Gly	186.0	0.0		257.0	57.0	NM_004299	G3XAC4|O75345|Q5VWY7|Q5VWY8|Q9BRE1|Q9UND1|Q9UP01	Missense_Mutation	SNP	ENST00000373394.3	hg19		.	.	.	.	.	.	.	.	.	.	T	19.86	3.905816	0.72868	.	.	ENSG00000131269	ENST00000535115;ENST00000253577;ENST00000339447;ENST00000373394;ENST00000529949;ENST00000534524	D;D;D;D;D	0.92348	-2.66;-2.66;-2.66;-2.66;-3.02	5.58	5.58	0.84498	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);ABC transporter, transmembrane domain (1);	0.000000	0.85682	D	0.000000	D	0.93530	0.7935	L	0.60012	1.86	0.80722	D	1	B;P;P;B;P	0.47677	0.103;0.876;0.899;0.126;0.745	B;P;P;B;P	0.54664	0.093;0.712;0.758;0.151;0.62	D	0.93740	0.7049	10	0.59425	D	0.04	-16.6247	13.8666	0.63592	0.0:0.0:0.0:1.0	.	198;184;225;224;225	G3V1J3;G3XAC4;B3KM98;O75027;O75027-2	.;.;.;ABCB7_HUMAN;.	G	198;225;184;224;198;169	ENSP00000253577:R225G;ENSP00000343849:R184G;ENSP00000362492:R224G;ENSP00000436586:R198G;ENSP00000435521:R169G	ENSP00000253577:R225G	R	-	1	2	ABCB7	74212107	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	6.084000	0.71335	1.871000	0.54225	0.417000	0.27973	AGA	.	.		0.418	ABCB7-002	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000057274.1	NM_004299	
FAM199X	139231	hgsc.bcm.edu	37	X	103420443	103420443	+	Missense_Mutation	SNP	C	C	G			TCGA-2Y-A9GY-01A-11D-A382-10	TCGA-2Y-A9GY-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	75a72b01-26d1-410f-a2f3-fabe09059eed	e1cd43c8-e295-4191-8754-0520f03119e1	g.chrX:103420443C>G	ENST00000493442.1	+	2	503	c.337C>G	c.(337-339)Cct>Gct	p.P113A		NM_207318.3	NP_997201.1	Q6PEV8	F199X_HUMAN	family with sequence similarity 199, X-linked	113										breast(1)|cervix(1)|endometrium(1)|large_intestine(3)|lung(2)|ovary(1)|prostate(1)|skin(1)	11						TGATTTATTTCCTGAGGGGAG	0.413																																					p.P113A		Atlas-SNP	.											.	FAM199X	38	.	0			c.C337G						.						167.0	133.0	145.0					X																	103420443		2203	4300	6503	SO:0001583	missense	139231	exon2			TTATTTCCTGAGG	BC016683	CCDS35364.1	Xq22	2010-02-11	2010-02-11	2010-02-11	ENSG00000123575	ENSG00000123575			25195	protein-coding gene	gene with protein product			"""chromosome X open reading frame 39"""	CXorf39			Standard	NM_207318		Approved		uc004elw.3	Q6PEV8	OTTHUMG00000022126	ENST00000493442.1:c.337C>G	chrX.hg19:g.103420443C>G	ENSP00000417581:p.Pro113Ala	65.0	0.0		84.0	15.0	NM_207318	Q8WVP6|Q96AV3	Missense_Mutation	SNP	ENST00000493442.1	hg19	CCDS35364.1	.	.	.	.	.	.	.	.	.	.	C	19.19	3.778991	0.70107	.	.	ENSG00000123575	ENST00000493442	T	0.58060	0.36	4.73	4.73	0.59995	.	0.000000	0.85682	D	0.000000	T	0.51193	0.1660	L	0.60455	1.87	0.80722	D	1	P	0.45715	0.865	B	0.41135	0.348	T	0.54833	-0.8234	9	.	.	.	-8.5331	16.1766	0.81857	0.0:1.0:0.0:0.0	.	113	Q6PEV8	F199X_HUMAN	A	113	ENSP00000417581:P113A	.	P	+	1	0	FAM199X	103307099	1.000000	0.71417	0.998000	0.56505	0.990000	0.78478	5.955000	0.70306	2.102000	0.63906	0.600000	0.82982	CCT	.	.		0.413	FAM199X-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057764.1	NM_207318	
DCX	1641	hgsc.bcm.edu	37	X	110654106	110654106	+	Missense_Mutation	SNP	G	G	T			TCGA-2Y-A9GY-01A-11D-A382-10	TCGA-2Y-A9GY-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	75a72b01-26d1-410f-a2f3-fabe09059eed	e1cd43c8-e295-4191-8754-0520f03119e1	g.chrX:110654106G>T	ENST00000338081.3	-	1	268	c.97C>A	c.(97-99)Caa>Aaa	p.Q33K	DCX_ENST00000356915.2_Intron|DCX_ENST00000371993.2_Intron|DCX_ENST00000488120.1_Intron|DCX_ENST00000496551.1_Intron|DCX_ENST00000356220.3_Intron	NM_000555.3	NP_000546.2	O43602	DCX_HUMAN	doublecortin	33					axon extension (GO:0048675)|axon guidance (GO:0007411)|brain development (GO:0007420)|central nervous system development (GO:0007417)|central nervous system projection neuron axonogenesis (GO:0021952)|dendrite morphogenesis (GO:0048813)|intracellular signal transduction (GO:0035556)|nervous system development (GO:0007399)|neuron migration (GO:0001764)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|neuron projection (GO:0043005)	microtubule binding (GO:0008017)|protein kinase binding (GO:0019901)			breast(1)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(10)|lung(17)|skin(6)|upper_aerodigestive_tract(1)	41						AATTCCCCTTGAAGAGAACAG	0.413																																					p.Q33K		Atlas-SNP	.											.	DCX	158	.	0			c.C97A						.						193.0	170.0	178.0					X																	110654106		2203	4300	6503	SO:0001583	missense	1641	exon1			CCCCTTGAAGAGA	AF040254	CCDS14556.1, CCDS14557.1, CCDS14558.1	Xq22.3-q23	2008-08-01	2008-08-01		ENSG00000077279	ENSG00000077279			2714	protein-coding gene	gene with protein product	"""doublecortex"""	300121	"""doublecortex; lissencephaly, X-linked (doublecortin)"""			9489699, 9489700	Standard	NM_178151		Approved	SCLH, DC, LISX, DBCN, XLIS	uc004epd.3	O43602	OTTHUMG00000022204	ENST00000338081.3:c.97C>A	chrX.hg19:g.110654106G>T	ENSP00000337697:p.Gln33Lys	349.0	0.0		484.0	186.0	NM_000555	A6NFY6|A9Z1V8|D3DUY8|D3DUY9|D3DUZ0|O43911|Q5JYZ5	Missense_Mutation	SNP	ENST00000338081.3	hg19	CCDS14556.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	g|g	11.01|11.01	1.513531|1.513531	0.27123|0.27123	.|.	.|.	ENSG00000077279|ENSG00000077279	ENST00000358070|ENST00000338081	.|T	.|0.25250	.|1.81	4.42|4.42	0.46|0.46	0.16684|0.16684	.|.	.|0.406541	.|0.18243	.|N	.|0.147198	T|T	0.09862|0.09862	0.0242|0.0242	N|N	0.08118|0.08118	0|0	0.80722|0.80722	D|D	1|1	.|B;B	.|0.06786	.|0.001;0.0	.|B;B	.|0.04013	.|0.001;0.001	T|T	0.18304|0.18304	-1.0341|-1.0341	5|10	.|0.87932	.|D	.|0	.|.	0.7146|0.7146	0.00930|0.00930	0.3218:0.2098:0.3144:0.154|0.3218:0.2098:0.3144:0.154	.|.	.|21;33	.|B4DM53;O43602	.|.;DCX_HUMAN	L|K	24|33	.|ENSP00000337697:Q33K	.|ENSP00000337697:Q33K	F|Q	-|-	3|1	2|0	DCX|DCX	110540762|110540762	1.000000|1.000000	0.71417|0.71417	0.818000|0.818000	0.32626|0.32626	0.990000|0.990000	0.78478|0.78478	1.335000|1.335000	0.33839|0.33839	-0.044000|-0.044000	0.13491|0.13491	0.505000|0.505000	0.49811|0.49811	TTC|CAA	.	.		0.413	DCX-006	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000357058.1	NM_178153	
NADK	65220	hgsc.bcm.edu	37	1	1686824	1686825	+	Frame_Shift_Ins	INS	-	-	TTTC			TCGA-2Y-A9GY-01A-11D-A382-10	TCGA-2Y-A9GY-10A-01D-A385-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	75a72b01-26d1-410f-a2f3-fabe09059eed	e1cd43c8-e295-4191-8754-0520f03119e1	g.chr1:1686824_1686825insTTTC	ENST00000341426.5	-	7	897_898	c.676_677insGAAA	c.(676-678)cagfs	p.Q226fs	NADK_ENST00000341991.3_Frame_Shift_Ins_p.Q226fs|NADK_ENST00000492768.1_5'Flank|NADK_ENST00000344463.4_Frame_Shift_Ins_p.Q371fs|NADK_ENST00000378625.1_Frame_Shift_Ins_p.Q371fs|NADK_ENST00000342348.5_Frame_Shift_Ins_p.Q194fs	NM_023018.4	NP_075394.3	O95544	NADK_HUMAN	NAD kinase	226					ATP metabolic process (GO:0046034)|NAD metabolic process (GO:0019674)|NADP biosynthetic process (GO:0006741)|phosphorylation (GO:0016310)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)			NS(1)|autonomic_ganglia(1)|endometrium(4)|large_intestine(2)|lung(4)|ovary(1)|prostate(2)|stomach(1)|urinary_tract(1)	17	all_cancers(77;0.000708)|all_epithelial(69;0.000943)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;5.61e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Medulloblastoma(700;0.123)|Lung SC(97;0.128)		Epithelial(90;8.75e-37)|OV - Ovarian serous cystadenocarcinoma(86;2.33e-23)|GBM - Glioblastoma multiforme(42;1.35e-07)|Colorectal(212;0.000203)|COAD - Colon adenocarcinoma(227;0.000225)|Kidney(185;0.00265)|STAD - Stomach adenocarcinoma(132;0.00655)|BRCA - Breast invasive adenocarcinoma(365;0.00855)|KIRC - Kidney renal clear cell carcinoma(229;0.0382)|Lung(427;0.207)		CTCTATCACCTGAGTAACTTGG	0.554																																					p.Q371fs		Atlas-INDEL	.											.	NADK	79	.	0			c.1112_1113insGAAA						.																																			SO:0001589	frameshift_variant	65220	exon9			.	BC001709	CCDS30565.1, CCDS55561.1, CCDS55562.1	1p36.33	2013-04-29			ENSG00000008130	ENSG00000008130	2.7.1.23		29831	protein-coding gene	gene with protein product		611616				11594753	Standard	NM_023018		Approved	FLJ13052	uc001aie.3	O95544	OTTHUMG00000000942	ENST00000341426.5:c.676_677insGAAA	chr1.hg19:g.1686824_1686825insTTTC	ENSP00000341679:p.Gln226fs	48.0	0.0		100.0	36.0	NM_001198994	A6NNN3|A8K296|B7Z434|F5GXR5|Q5QPS4|Q9H2P2|Q9H931	Frame_Shift_Ins	INS	ENST00000341426.5	hg19	CCDS30565.1																																																																																			.	.		0.554	NADK-003	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000002769.1	NM_023018	
TTC27	55622	hgsc.bcm.edu	37	2	33042572	33042572	+	Frame_Shift_Del	DEL	A	A	-			TCGA-2Y-A9GY-01A-11D-A382-10	TCGA-2Y-A9GY-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	75a72b01-26d1-410f-a2f3-fabe09059eed	e1cd43c8-e295-4191-8754-0520f03119e1	g.chr2:33042572delA	ENST00000317907.4	+	19	2588	c.2357delA	c.(2356-2358)caafs	p.Q786fs		NM_001193509.1|NM_017735.4	NP_001180438.1|NP_060205.3	Q6P3X3	TTC27_HUMAN	tetratricopeptide repeat domain 27	786										breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(9)|lung(14)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	38						GAAGCTGTACAAATGCTTTCT	0.343																																					p.Q786fs		Atlas-Indel,Pindel	.											.	TTC27	71	.	0			c.2356delC						.						131.0	118.0	122.0					2																	33042572		2203	4300	6503	SO:0001589	frameshift_variant	55622	exon19			.	BC063791, AK000279	CCDS33176.1	2p22.3	2013-01-10			ENSG00000018699	ENSG00000018699		"""Tetratricopeptide (TTC) repeat domain containing"""	25986	protein-coding gene	gene with protein product							Standard	NM_001193509		Approved	FLJ20272	uc002rom.3	Q6P3X3	OTTHUMG00000152134	ENST00000317907.4:c.2357delA	chr2.hg19:g.33042572delA	ENSP00000313953:p.Gln786fs	101.0	0.0		128.0	33.0	NM_017735	A6NKJ0|Q96SS5|Q9BVF1|Q9NWR4|Q9NXG4	Frame_Shift_Del	DEL	ENST00000317907.4	hg19	CCDS33176.1																																																																																			.	.		0.343	TTC27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325395.1	NM_017735	
SP140	11262	hgsc.bcm.edu	37	2	231115716	231115716	+	Frame_Shift_Del	DEL	G	G	-			TCGA-2Y-A9GY-01A-11D-A382-10	TCGA-2Y-A9GY-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	75a72b01-26d1-410f-a2f3-fabe09059eed	e1cd43c8-e295-4191-8754-0520f03119e1	g.chr2:231115716delG	ENST00000392045.3	+	10	1111	c.997delG	c.(997-999)gaafs	p.E333fs	SP140_ENST00000486687.2_Frame_Shift_Del_p.E257fs|SP140_ENST00000343805.6_Frame_Shift_Del_p.E307fs|SP140_ENST00000350136.5_Intron|SP140_ENST00000417495.3_Intron|SP140_ENST00000420434.3_Frame_Shift_Del_p.E333fs	NM_007237.4	NP_009168.4	Q13342	SP140_HUMAN	SP140 nuclear body protein	333					defense response (GO:0006952)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|nuclear envelope (GO:0005635)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			NS(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|skin(1)	12		Renal(207;0.0112)|all_lung(227;0.0221)|Lung NSC(271;0.0977)|all_hematologic(139;0.103)|Acute lymphoblastic leukemia(138;0.167)		Epithelial(121;1.13e-12)|all cancers(144;2.71e-10)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(119;0.00942)		TGACTGTTCAGAAATGTGTGA	0.483																																					p.S332fs		Atlas-INDEL	.											.	SP140	121	.	0			c.996delA						.						90.0	84.0	86.0					2																	231115716		1862	4102	5964	SO:0001589	frameshift_variant	11262	exon10			.	U63420	CCDS33392.1, CCDS42831.1, CCDS63149.1, CCDS63150.1, CCDS63151.1	2q37.1	2013-01-28			ENSG00000079263	ENSG00000079263		"""Zinc fingers, PHD-type"""	17133	protein-coding gene	gene with protein product		608602				8695863, 8910577, 12368356	Standard	NM_001005176		Approved	LYSP100-B, LYSP100-A	uc002vql.3	Q13342	OTTHUMG00000153670	ENST00000392045.3:c.997delG	chr2.hg19:g.231115716delG	ENSP00000375899:p.Glu333fs	76.0	0.0		123.0	18.0	NM_007237	E7ESH9|E7EUR5|E9PFJ6|Q0VGE5|Q13341|Q3KR17|Q4ZG66|Q53TG1|Q6NSG4|Q92881|Q96TG3	Frame_Shift_Del	DEL	ENST00000392045.3	hg19	CCDS42831.1																																																																																			.	.		0.483	SP140-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000332015.1	NM_007237	
SP140	11262	hgsc.bcm.edu	37	2	231115713	231115714	+	Frame_Shift_Del	DEL	TC	TC	-			TCGA-2Y-A9GY-01A-11D-A382-10	TCGA-2Y-A9GY-10A-01D-A385-10	TC	TC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	75a72b01-26d1-410f-a2f3-fabe09059eed	e1cd43c8-e295-4191-8754-0520f03119e1	g.chr2:231115713_231115714delTC	ENST00000392045.3	+	10	1108_1109	c.994_995delTC	c.(994-996)tcafs	p.S332fs	SP140_ENST00000486687.2_Frame_Shift_Del_p.S256fs|SP140_ENST00000343805.6_Frame_Shift_Del_p.S306fs|SP140_ENST00000350136.5_Intron|SP140_ENST00000417495.3_Intron|SP140_ENST00000420434.3_Frame_Shift_Del_p.S332fs	NM_007237.4	NP_009168.4	Q13342	SP140_HUMAN	SP140 nuclear body protein	332					defense response (GO:0006952)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|nuclear envelope (GO:0005635)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			NS(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|skin(1)	12		Renal(207;0.0112)|all_lung(227;0.0221)|Lung NSC(271;0.0977)|all_hematologic(139;0.103)|Acute lymphoblastic leukemia(138;0.167)		Epithelial(121;1.13e-12)|all cancers(144;2.71e-10)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(119;0.00942)		TGATGACTGTTCAGAAATGTGT	0.485																																					p.331_332del		Atlas-INDEL	.											.	SP140	121	.	0			c.993_994del						.																																			SO:0001589	frameshift_variant	11262	exon10			.	U63420	CCDS33392.1, CCDS42831.1, CCDS63149.1, CCDS63150.1, CCDS63151.1	2q37.1	2013-01-28			ENSG00000079263	ENSG00000079263		"""Zinc fingers, PHD-type"""	17133	protein-coding gene	gene with protein product		608602				8695863, 8910577, 12368356	Standard	NM_001005176		Approved	LYSP100-B, LYSP100-A	uc002vql.3	Q13342	OTTHUMG00000153670	ENST00000392045.3:c.994_995delTC	chr2.hg19:g.231115713_231115714delTC	ENSP00000375899:p.Ser332fs	80.0	0.0		122.0	18.0	NM_007237	E7ESH9|E7EUR5|E9PFJ6|Q0VGE5|Q13341|Q3KR17|Q4ZG66|Q53TG1|Q6NSG4|Q92881|Q96TG3	Frame_Shift_Del	DEL	ENST00000392045.3	hg19	CCDS42831.1																																																																																			.	.		0.485	SP140-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000332015.1	NM_007237	
FAM83H	286077	hgsc.bcm.edu	37	8	144810307	144810307	+	Frame_Shift_Del	DEL	G	G	-			TCGA-2Y-A9GY-01A-11D-A382-10	TCGA-2Y-A9GY-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	75a72b01-26d1-410f-a2f3-fabe09059eed	e1cd43c8-e295-4191-8754-0520f03119e1	g.chr8:144810307delG	ENST00000388913.3	-	5	1449	c.1324delC	c.(1324-1326)cgcfs	p.R442fs		NM_198488.3	NP_940890	Q6ZRV2	FA83H_HUMAN	family with sequence similarity 83, member H	442					biomineral tissue development (GO:0031214)					central_nervous_system(2)|endometrium(1)|large_intestine(1)|lung(12)|pancreas(1)|prostate(3)|urinary_tract(1)	21	all_cancers(97;3.74e-11)|all_epithelial(106;2.62e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;3.38e-41)|Epithelial(56;6.8e-40)|all cancers(56;6.43e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.146)			GTCTGGAAGCGGAAGTCGTCG	0.701																																					p.R442fs		Atlas-Indel,Pindel	.											.	FAM83H	68	.	0			c.1325delG						.						25.0	38.0	34.0					8																	144810307		2137	4225	6362	SO:0001589	frameshift_variant	286077	exon5			.	AK127960	CCDS6410.2	8q24.3	2014-03-13			ENSG00000180921	ENSG00000180921			24797	protein-coding gene	gene with protein product		611927				18252228	Standard	NM_198488		Approved	FLJ46072	uc003yzk.3	Q6ZRV2	OTTHUMG00000133559	ENST00000388913.3:c.1324delC	chr8.hg19:g.144810307delG	ENSP00000373565:p.Arg442fs	930.0	0.0		1503.0	327.0	NM_198488	A0JLS2|Q8N4W0	Frame_Shift_Del	DEL	ENST00000388913.3	hg19	CCDS6410.2																																																																																			.	.		0.701	FAM83H-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257632.2	NM_198488	
SP140	11262	hgsc.bcm.edu	37	2	231115713	231115716	+	Frame_Shift_Del	DEL	TCAG	TCAG	-			TCGA-2Y-A9GY-01A-11D-A382-10	TCGA-2Y-A9GY-10A-01D-A385-10	TCAG	TCAG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	75a72b01-26d1-410f-a2f3-fabe09059eed	e1cd43c8-e295-4191-8754-0520f03119e1	g.chr2:231115713_231115716delTCAG	ENST00000392045.3	+	10	1108_1111	c.994_997delTCAG	c.(994-999)tcagaafs	p.SE332fs	SP140_ENST00000486687.2_Frame_Shift_Del_p.SE256fs|SP140_ENST00000343805.6_Frame_Shift_Del_p.SE306fs|SP140_ENST00000350136.5_Intron|SP140_ENST00000417495.3_Intron|SP140_ENST00000420434.3_Frame_Shift_Del_p.SE332fs	NM_007237.4	NP_009168.4	Q13342	SP140_HUMAN	SP140 nuclear body protein	332					defense response (GO:0006952)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|nuclear envelope (GO:0005635)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			NS(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|skin(1)	12		Renal(207;0.0112)|all_lung(227;0.0221)|Lung NSC(271;0.0977)|all_hematologic(139;0.103)|Acute lymphoblastic leukemia(138;0.167)		Epithelial(121;1.13e-12)|all cancers(144;2.71e-10)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(119;0.00942)		TGATGACTGTTCAGAAATGTGTGA	0.485																																					p.331_332del		Pindel	.											.	SP140	121	.	0			c.993_996del						.																																			SO:0001589	frameshift_variant	11262	exon10			.	U63420	CCDS33392.1, CCDS42831.1, CCDS63149.1, CCDS63150.1, CCDS63151.1	2q37.1	2013-01-28			ENSG00000079263	ENSG00000079263		"""Zinc fingers, PHD-type"""	17133	protein-coding gene	gene with protein product		608602				8695863, 8910577, 12368356	Standard	NM_001005176		Approved	LYSP100-B, LYSP100-A	uc002vql.3	Q13342	OTTHUMG00000153670	ENST00000392045.3:c.994_997delTCAG	chr2.hg19:g.231115713_231115716delTCAG	ENSP00000375899:p.Ser332fs	79.0	0.0		122.0	16.0	NM_007237	E7ESH9|E7EUR5|E9PFJ6|Q0VGE5|Q13341|Q3KR17|Q4ZG66|Q53TG1|Q6NSG4|Q92881|Q96TG3	Frame_Shift_Del	DEL	ENST00000392045.3	hg19	CCDS42831.1																																																																																			.	.		0.485	SP140-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000332015.1	NM_007237	
NADK	65220	hgsc.bcm.edu	37	1	1686825	1686825	+	Frame_Shift_Del	DEL	G	G	-			TCGA-2Y-A9GY-01A-11D-A382-10	TCGA-2Y-A9GY-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	75a72b01-26d1-410f-a2f3-fabe09059eed	e1cd43c8-e295-4191-8754-0520f03119e1	g.chr1:1686825delG	ENST00000341426.5	-	7	897	c.676delC	c.(676-678)cagfs	p.Q226fs	NADK_ENST00000341991.3_Frame_Shift_Del_p.Q226fs|NADK_ENST00000492768.1_5'Flank|NADK_ENST00000344463.4_Frame_Shift_Del_p.Q371fs|NADK_ENST00000378625.1_Frame_Shift_Del_p.Q371fs|NADK_ENST00000342348.5_Frame_Shift_Del_p.Q194fs	NM_023018.4	NP_075394.3	O95544	NADK_HUMAN	NAD kinase	226					ATP metabolic process (GO:0046034)|NAD metabolic process (GO:0019674)|NADP biosynthetic process (GO:0006741)|phosphorylation (GO:0016310)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)			NS(1)|autonomic_ganglia(1)|endometrium(4)|large_intestine(2)|lung(4)|ovary(1)|prostate(2)|stomach(1)|urinary_tract(1)	17	all_cancers(77;0.000708)|all_epithelial(69;0.000943)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;5.61e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Medulloblastoma(700;0.123)|Lung SC(97;0.128)		Epithelial(90;8.75e-37)|OV - Ovarian serous cystadenocarcinoma(86;2.33e-23)|GBM - Glioblastoma multiforme(42;1.35e-07)|Colorectal(212;0.000203)|COAD - Colon adenocarcinoma(227;0.000225)|Kidney(185;0.00265)|STAD - Stomach adenocarcinoma(132;0.00655)|BRCA - Breast invasive adenocarcinoma(365;0.00855)|KIRC - Kidney renal clear cell carcinoma(229;0.0382)|Lung(427;0.207)		TCTATCACCTGAGTAACTTGG	0.557																																					p.Q371fs		Pindel	.											.	NADK	79	.	0			c.1112delA						.						165.0	166.0	166.0					1																	1686825		2203	4300	6503	SO:0001589	frameshift_variant	65220	exon9			.	BC001709	CCDS30565.1, CCDS55561.1, CCDS55562.1	1p36.33	2013-04-29			ENSG00000008130	ENSG00000008130	2.7.1.23		29831	protein-coding gene	gene with protein product		611616				11594753	Standard	NM_023018		Approved	FLJ13052	uc001aie.3	O95544	OTTHUMG00000000942	ENST00000341426.5:c.676delC	chr1.hg19:g.1686825delG	ENSP00000341679:p.Gln226fs	48.0	0.0		100.0	29.0	NM_001198994	A6NNN3|A8K296|B7Z434|F5GXR5|Q5QPS4|Q9H2P2|Q9H931	Frame_Shift_Del	DEL	ENST00000341426.5	hg19	CCDS30565.1																																																																																			.	.		0.557	NADK-003	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000002769.1	NM_023018	
