#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
PIAS3	10401	hgsc.bcm.edu	37	1	145578670	145578670	+	Missense_Mutation	SNP	A	A	G			TCGA-2Y-A9H4-01A-11D-A382-10	TCGA-2Y-A9H4-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a12a5c70-7c82-4f2b-972f-81a029234685	cc2a8833-5e36-487f-bcb8-1fcb198152ff	g.chr1:145578670A>G	ENST00000393045.2	+	3	566	c.476A>G	c.(475-477)cAc>cGc	p.H159R	PIAS3_ENST00000369298.1_Missense_Mutation_p.H124R|PIAS3_ENST00000369299.3_Missense_Mutation_p.H150R	NM_006099.3	NP_006090.2	Q9Y6X2	PIAS3_HUMAN	protein inhibitor of activated STAT, 3	159	PINIT. {ECO:0000255|PROSITE- ProRule:PRU00799}.				positive regulation of gene expression (GO:0010628)|positive regulation of membrane potential (GO:0045838)|positive regulation of protein sumoylation (GO:0033235)|protein sumoylation (GO:0016925)|regulation of transcription, DNA-templated (GO:0006355)|response to hormone (GO:0009725)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|nucleus (GO:0005634)|synapse (GO:0045202)	enzyme binding (GO:0019899)|nucleic acid binding (GO:0003676)|potassium channel regulator activity (GO:0015459)|protein C-terminus binding (GO:0008022)|SUMO ligase activity (GO:0019789)|zinc ion binding (GO:0008270)			cervix(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(14)|ovary(1)|prostate(2)	28	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					GAGGAAGCGCACTTTACCTTT	0.537																																					p.H159R		Atlas-SNP	.											.	PIAS3	96	.	0			c.A476G						.						217.0	189.0	199.0					1																	145578670		2203	4300	6503	SO:0001583	missense	10401	exon3			AAGCGCACTTTAC	AB021868	CCDS72866.1	1q21	2011-10-11			ENSG00000131788	ENSG00000131788		"""Zinc fingers, MIZ-type"""	16861	protein-coding gene	gene with protein product	"""zinc finger, MIZ-type containing 5"""	605987				10319586	Standard	NM_006099		Approved	FLJ14651, ZMIZ5	uc001eoc.1	Q9Y6X2	OTTHUMG00000013750	ENST00000393045.2:c.476A>G	chr1.hg19:g.145578670A>G	ENSP00000376765:p.His159Arg	142.0	0.0		123.0	13.0	NM_006099	Q9UFI3	Missense_Mutation	SNP	ENST00000393045.2	hg19	CCDS920.2	.	.	.	.	.	.	.	.	.	.	A	14.07	2.425798	0.43020	.	.	ENSG00000131788	ENST00000393046;ENST00000369299;ENST00000393045;ENST00000369298	T;T;T;T	0.38722	1.12;1.12;1.12;1.12	4.22	3.1	0.35709	PINIT domain (1);	0.000000	0.51477	D	0.000099	T	0.18551	0.0445	L	0.29908	0.895	0.37603	D	0.920659	P;D	0.53619	0.6;0.961	B;P	0.48552	0.429;0.581	T	0.02444	-1.1158	10	0.25106	T	0.35	-10.0179	7.6914	0.28569	0.898:0.0:0.102:0.0	.	150;159	F8WA94;Q9Y6X2	.;PIAS3_HUMAN	R	150;150;159;124	ENSP00000376766:H150R;ENSP00000358305:H150R;ENSP00000376765:H159R;ENSP00000358304:H124R	ENSP00000358304:H124R	H	+	2	0	PIAS3	144290027	0.307000	0.24500	0.995000	0.50966	0.996000	0.88848	1.374000	0.34283	0.668000	0.31126	0.533000	0.62120	CAC	.	.		0.537	PIAS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000038533.4	NM_006099	
OR2L3	391192	hgsc.bcm.edu	37	1	248224048	248224048	+	Missense_Mutation	SNP	T	T	C			TCGA-2Y-A9H4-01A-11D-A382-10	TCGA-2Y-A9H4-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a12a5c70-7c82-4f2b-972f-81a029234685	cc2a8833-5e36-487f-bcb8-1fcb198152ff	g.chr1:248224048T>C	ENST00000359959.3	+	1	65	c.65T>C	c.(64-66)aTt>aCt	p.I22T	OR2L13_ENST00000366478.2_Intron	NM_001004687.1	NP_001004687.1	Q8NG85	OR2L3_HUMAN	olfactory receptor, family 2, subfamily L, member 3	22						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			cervix(1)|endometrium(2)|large_intestine(7)|lung(28)|prostate(1)|skin(1)|urinary_tract(1)	41	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0278)			CCATCAAGAATTGGCCTTTTC	0.403																																					p.I22T		Atlas-SNP	.											.	OR2L3	97	.	0			c.T65C						.						246.0	243.0	244.0					1																	248224048		2203	4300	6503	SO:0001583	missense	391192	exon1			CAAGAATTGGCCT	AB065950	CCDS31104.1	1q44	2012-08-09			ENSG00000198128	ENSG00000198128		"""GPCR / Class A : Olfactory receptors"""	15009	protein-coding gene	gene with protein product							Standard	NM_001004687		Approved		uc001idx.1	Q8NG85	OTTHUMG00000040195	ENST00000359959.3:c.65T>C	chr1.hg19:g.248224048T>C	ENSP00000353044:p.Ile22Thr	145.0	0.0		124.0	50.0	NM_001004687	B9EH44	Missense_Mutation	SNP	ENST00000359959.3	hg19	CCDS31104.1	.	.	.	.	.	.	.	.	.	.	.	0	-2.674830	0.00104	.	.	ENSG00000198128	ENST00000359959	T	0.09073	3.02	2.05	2.05	0.26809	.	.	.	.	.	T	0.05090	0.0136	N	0.25789	0.76	0.09310	N	1	B	0.06786	0.001	B	0.10450	0.005	T	0.44298	-0.9337	9	0.16896	T	0.51	.	3.8172	0.08821	0.0:0.1971:0.0:0.8029	.	22	Q8NG85	OR2L3_HUMAN	T	22	ENSP00000353044:I22T	ENSP00000353044:I22T	I	+	2	0	OR2L3	246290671	0.000000	0.05858	0.160000	0.22671	0.425000	0.31504	-1.732000	0.01851	0.928000	0.37168	0.379000	0.24179	ATT	.	.		0.403	OR2L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096852.1	NM_001004687	
NTSR2	23620	hgsc.bcm.edu	37	2	11798629	11798629	+	Silent	SNP	C	C	T	rs150650740		TCGA-2Y-A9H4-01A-11D-A382-10	TCGA-2Y-A9H4-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a12a5c70-7c82-4f2b-972f-81a029234685	cc2a8833-5e36-487f-bcb8-1fcb198152ff	g.chr2:11798629C>T	ENST00000306928.5	-	4	1243	c.1209G>A	c.(1207-1209)ggG>ggA	p.G403G		NM_012344.3	NP_036476	O95665	NTR2_HUMAN	neurotensin receptor 2	403					cell surface receptor signaling pathway (GO:0007166)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|regulation of membrane potential (GO:0042391)|sensory perception (GO:0007600)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled neurotensin receptor activity (GO:0016492)|G-protein coupled receptor activity (GO:0004930)			breast(1)|large_intestine(7)|lung(7)|prostate(1)|urinary_tract(1)	17	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.129)|OV - Ovarian serous cystadenocarcinoma(76;0.24)	Levocabastine(DB01106)	CTGGGGGATCCCCAAAGCCTG	0.547																																					p.G403G		Atlas-SNP	.											.	NTSR2	36	.	0			c.G1209A						.	C		0,4406		0,0,2203	87.0	93.0	91.0		1209	4.3	1.0	2	dbSNP_134	91	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	NTSR2	NM_012344.3		0,1,6502	TT,TC,CC		0.0116,0.0,0.0077		403/411	11798629	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	23620	exon4			GGGATCCCCAAAG	Y10148	CCDS1681.1	2p25.1	2012-08-08			ENSG00000169006	ENSG00000169006		"""GPCR / Class A : Neurotensin receptors"""	8040	protein-coding gene	gene with protein product		605538				8647296, 9851594	Standard	NM_012344		Approved	NTR2	uc002rbq.4	O95665	OTTHUMG00000119083	ENST00000306928.5:c.1209G>A	chr2.hg19:g.11798629C>T		96.0	0.0		125.0	37.0	NM_012344	Q53QQ5|Q57Z87|Q8IY58|Q8TBH6	Silent	SNP	ENST00000306928.5	hg19	CCDS1681.1																																																																																			.	C|1.000;T|0.000		0.547	NTSR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239297.1		
NTSR2	23620	hgsc.bcm.edu	37	2	11810006	11810006	+	Missense_Mutation	SNP	G	G	C			TCGA-2Y-A9H4-01A-11D-A382-10	TCGA-2Y-A9H4-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a12a5c70-7c82-4f2b-972f-81a029234685	cc2a8833-5e36-487f-bcb8-1fcb198152ff	g.chr2:11810006G>C	ENST00000306928.5	-	1	284	c.250C>G	c.(250-252)Ctg>Gtg	p.L84V		NM_012344.3	NP_036476	O95665	NTR2_HUMAN	neurotensin receptor 2	84					cell surface receptor signaling pathway (GO:0007166)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|regulation of membrane potential (GO:0042391)|sensory perception (GO:0007600)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled neurotensin receptor activity (GO:0016492)|G-protein coupled receptor activity (GO:0004930)			breast(1)|large_intestine(7)|lung(7)|prostate(1)|urinary_tract(1)	17	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.129)|OV - Ovarian serous cystadenocarcinoma(76;0.24)	Levocabastine(DB01106)	ACGCCGACCAGCAGCAGCAGC	0.721																																					p.L84V		Atlas-SNP	.											.	NTSR2	36	.	0			c.C250G						.						5.0	7.0	7.0					2																	11810006		2033	4077	6110	SO:0001583	missense	23620	exon1			CGACCAGCAGCAG	Y10148	CCDS1681.1	2p25.1	2012-08-08			ENSG00000169006	ENSG00000169006		"""GPCR / Class A : Neurotensin receptors"""	8040	protein-coding gene	gene with protein product		605538				8647296, 9851594	Standard	NM_012344		Approved	NTR2	uc002rbq.4	O95665	OTTHUMG00000119083	ENST00000306928.5:c.250C>G	chr2.hg19:g.11810006G>C	ENSP00000303686:p.Leu84Val	66.0	0.0		70.0	4.0	NM_012344	Q53QQ5|Q57Z87|Q8IY58|Q8TBH6	Missense_Mutation	SNP	ENST00000306928.5	hg19	CCDS1681.1	.	.	.	.	.	.	.	.	.	.	G	0.370	-0.934435	0.02340	.	.	ENSG00000169006	ENST00000306928	T	0.41065	1.01	3.42	1.57	0.23409	GPCR, rhodopsin-like superfamily (1);	1.351940	0.05480	N	0.554731	T	0.37210	0.0995	L	0.39514	1.22	0.23095	N	0.998303	B	0.02656	0.0	B	0.10450	0.005	T	0.33445	-0.9868	10	0.16896	T	0.51	-2.428	13.7547	0.62928	0.0:0.2905:0.7095:0.0	.	84	O95665	NTR2_HUMAN	V	84	ENSP00000303686:L84V	ENSP00000303686:L84V	L	-	1	2	NTSR2	11727457	0.824000	0.29247	0.925000	0.36789	0.098000	0.18820	0.039000	0.13884	0.107000	0.17824	-2.840000	0.00105	CTG	.	.		0.721	NTSR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239297.1		
RGPD4	285190	hgsc.bcm.edu	37	2	108488174	108488174	+	Silent	SNP	C	C	A			TCGA-2Y-A9H4-01A-11D-A382-10	TCGA-2Y-A9H4-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a12a5c70-7c82-4f2b-972f-81a029234685	cc2a8833-5e36-487f-bcb8-1fcb198152ff	g.chr2:108488174C>A	ENST00000408999.3	+	20	3791	c.3714C>A	c.(3712-3714)ccC>ccA	p.P1238P	RGPD4_ENST00000354986.4_Silent_p.P1238P	NM_182588.2	NP_872394.2	Q7Z3J3	RGPD4_HUMAN	RANBP2-like and GRIP domain containing 4	1238					protein targeting to Golgi (GO:0000042)					breast(1)|endometrium(7)|kidney(4)|lung(23)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(3)	43						CAATAAAACCCAATCCTGAAA	0.418																																					p.P1238P		Atlas-SNP	.											.	RGPD4	112	.	0			c.C3714A						.						28.0	24.0	25.0					2																	108488174		691	1590	2281	SO:0001819	synonymous_variant	285190	exon20			AAAACCCAATCCT	BX537861	CCDS46381.1	2q12.3	2013-01-10			ENSG00000196862	ENSG00000196862		"""Tetratricopeptide (TTC) repeat domain containing"""	32417	protein-coding gene	gene with protein product		612707				15710750, 15815621	Standard	NM_182588		Approved	RGP4, DKFZp686P0288	uc010ywk.2	Q7Z3J3	OTTHUMG00000153208	ENST00000408999.3:c.3714C>A	chr2.hg19:g.108488174C>A		233.0	0.0		158.0	104.0	NM_182588	B9A029	Silent	SNP	ENST00000408999.3	hg19	CCDS46381.1																																																																																			.	.		0.418	RGPD4-001	NOVEL	not_best_in_genome_evidence|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000330096.2	XM_496581	
UNC80	285175	hgsc.bcm.edu	37	2	210777350	210777350	+	Missense_Mutation	SNP	G	G	A			TCGA-2Y-A9H4-01A-11D-A382-10	TCGA-2Y-A9H4-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a12a5c70-7c82-4f2b-972f-81a029234685	cc2a8833-5e36-487f-bcb8-1fcb198152ff	g.chr2:210777350G>A	ENST00000439458.1	+	29	4731	c.4651G>A	c.(4651-4653)Gga>Aga	p.G1551R	UNC80_ENST00000272845.6_Missense_Mutation_p.G1546R	NM_032504.1	NP_115893.1	Q8N2C7	UNC80_HUMAN	unc-80 homolog (C. elegans)	1551					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(9)|ovary(1)|prostate(1)	20						CAATCTGGAAGGAAAAAAAGA	0.428																																					p.G1551R		Atlas-SNP	.											.	UNC80	280	.	0			c.G4651A						.						87.0	77.0	80.0					2																	210777350		692	1591	2283	SO:0001583	missense	285175	exon29			CTGGAAGGAAAAA	AK090815	CCDS2387.1, CCDS46504.1, CCDS2387.2	2q35	2009-08-17	2009-08-17	2009-08-17	ENSG00000144406	ENSG00000144406			26582	protein-coding gene	gene with protein product		612636	"""chromosome 2 open reading frame 21"""	C2orf21		19092807	Standard	NM_032504		Approved	FLJ33496, KIAA1843, UNC-80	uc010zjc.1	Q8N2C7	OTTHUMG00000132963	ENST00000439458.1:c.4651G>A	chr2.hg19:g.210777350G>A	ENSP00000391088:p.Gly1551Arg	95.0	0.0		84.0	29.0	NM_032504	B2RN50|B4DQY9|B4DZB3|C4IXS8|C9J1U3|Q96JI4|Q96SS0	Missense_Mutation	SNP	ENST00000439458.1	hg19	CCDS46504.1	.	.	.	.	.	.	.	.	.	.	G	26.3	4.726758	0.89298	.	.	ENSG00000144406	ENST00000439458;ENST00000272845	T;T	0.30981	1.51;1.51	5.93	5.93	0.95920	.	0.120086	0.56097	D	0.000040	T	0.45397	0.1340	L	0.34521	1.04	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.08027	-1.0742	10	0.13108	T	0.6	-21.5484	20.3495	0.98807	0.0:0.0:1.0:0.0	.	1551	Q8N2C7	UNC80_HUMAN	R	1551;1546	ENSP00000391088:G1551R;ENSP00000272845:G1546R	ENSP00000272845:G1546R	G	+	1	0	UNC80	210485595	1.000000	0.71417	1.000000	0.80357	0.828000	0.46876	9.869000	0.99810	2.814000	0.96858	0.591000	0.81541	GGA	.	.		0.428	UNC80-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_182587	
KLHL40	131377	hgsc.bcm.edu	37	3	42727774	42727774	+	Missense_Mutation	SNP	G	G	A			TCGA-2Y-A9H4-01A-11D-A382-10	TCGA-2Y-A9H4-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a12a5c70-7c82-4f2b-972f-81a029234685	cc2a8833-5e36-487f-bcb8-1fcb198152ff	g.chr3:42727774G>A	ENST00000287777.4	+	1	764	c.664G>A	c.(664-666)Gag>Aag	p.E222K		NM_152393.2	NP_689606.2	Q2TBA0	KLH40_HUMAN	kelch-like family member 40	222	BACK.				multicellular organismal development (GO:0007275)	cytoplasm (GO:0005737)											CACCGTCTTCGAGAGCGTGCG	0.716																																					p.E222K		Atlas-SNP	.											KBTBD5,NS,carcinoma,0,1	.	.	.	0			c.G664A						.						12.0	12.0	12.0					3																	42727774		2171	4249	6420	SO:0001583	missense	131377	exon1			GTCTTCGAGAGCG	AK056577	CCDS2703.1	3p21.33	2013-07-30	2013-02-22	2013-01-08	ENSG00000157119	ENSG00000157119		"""Kelch-like"", ""BTB/POZ domain containing"""	30372	protein-coding gene	gene with protein product	"""sarcosynapsin"", ""nemaline myopathy type 8"""	615340	"""kelch repeat and BTB (POZ) domain containing 5"", ""kelch-like 40 (Drosophila)"""	KBTBD5		23746549	Standard	NM_152393		Approved	SRYP, NEM8	uc003clv.1	Q2TBA0	OTTHUMG00000133045	ENST00000287777.4:c.664G>A	chr3.hg19:g.42727774G>A	ENSP00000287777:p.Glu222Lys	78.0	0.0		64.0	32.0	NM_152393	Q86SI1|Q96MR2	Missense_Mutation	SNP	ENST00000287777.4	hg19	CCDS2703.1	.	.	.	.	.	.	.	.	.	.	G	16.83	3.230177	0.58777	.	.	ENSG00000157119	ENST00000287777	T	0.68479	-0.33	4.56	3.68	0.42216	BTB/Kelch-associated (2);	0.164086	0.53938	N	0.000060	T	0.59542	0.2201	L	0.41961	1.31	0.45272	D	0.998278	B	0.30021	0.265	B	0.33750	0.169	T	0.58825	-0.7568	10	0.41790	T	0.15	.	12.5689	0.56326	0.0808:0.0:0.9192:0.0	.	222	Q2TBA0	KBTB5_HUMAN	K	222	ENSP00000287777:E222K	ENSP00000287777:E222K	E	+	1	0	KBTBD5	42702778	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	4.308000	0.59129	1.154000	0.42482	0.655000	0.94253	GAG	.	.		0.716	KLHL40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256651.1	NM_152393	
CISH	1154	hgsc.bcm.edu	37	3	50649061	50649061	+	Splice_Site	SNP	C	C	T			TCGA-2Y-A9H4-01A-11D-A382-10	TCGA-2Y-A9H4-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a12a5c70-7c82-4f2b-972f-81a029234685	cc2a8833-5e36-487f-bcb8-1fcb198152ff	g.chr3:50649061C>T	ENST00000348721.3	-	1	201		c.e1+1		MAPKAPK3_ENST00000446044.1_5'Flank|CISH_ENST00000443053.2_Splice_Site	NM_145071.2	NP_659508.1	Q9NSE2	CISH_HUMAN	cytokine inducible SH2-containing protein						intracellular signal transduction (GO:0035556)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|negative regulation of signal transduction (GO:0009968)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|protein ubiquitination (GO:0016567)|regulation of cell growth (GO:0001558)	cytosol (GO:0005829)|plasma membrane (GO:0005886)				breast(2)|lung(1)|stomach(1)|upper_aerodigestive_tract(1)	5				BRCA - Breast invasive adenocarcinoma(193;0.000272)|KIRC - Kidney renal clear cell carcinoma(197;0.0171)|Kidney(197;0.0202)		GCCGCGCTTACCCCTGAACGC	0.731											OREG0015590	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									.		Atlas-SNP	.											.	CISH	27	.	0			c.20+1G>A						.						7.0	8.0	8.0					3																	50649061		2035	3978	6013	SO:0001630	splice_region_variant	1154	exon2			CGCTTACCCCTGA	Z77852	CCDS2831.1, CCDS46834.1	3p21.3	2013-02-14			ENSG00000114737	ENSG00000114737		"""Suppressors of cytokine signaling"", ""SH2 domain containing"""	1984	protein-coding gene	gene with protein product		602441				9465889, 7796808	Standard	NM_013324		Approved	CIS, G18, CIS-1, SOCS	uc003dax.3	Q9NSE2	OTTHUMG00000156853	ENST00000348721.3:c.20+1G>A	chr3.hg19:g.50649061C>T		275.0	0.0	971	190.0	60.0	NM_145071	B2R9N1|G5E9R1|Q9NS38|Q9Y5R1	Splice_Site	SNP	ENST00000348721.3	hg19	CCDS2831.1	.	.	.	.	.	.	.	.	.	.	C	25.5	4.645694	0.87958	.	.	ENSG00000114737	ENST00000348721	.	.	.	5.63	4.75	0.60458	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.7112	0.77629	0.1377:0.8623:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	CISH	50624065	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	3.257000	0.51500	1.380000	0.46344	0.561000	0.74099	.	.	.		0.731	CISH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346245.1	NM_145071	Intron
HPS3	84343	hgsc.bcm.edu	37	3	148858010	148858010	+	Missense_Mutation	SNP	G	G	A			TCGA-2Y-A9H4-01A-11D-A382-10	TCGA-2Y-A9H4-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a12a5c70-7c82-4f2b-972f-81a029234685	cc2a8833-5e36-487f-bcb8-1fcb198152ff	g.chr3:148858010G>A	ENST00000296051.2	+	2	577	c.437G>A	c.(436-438)gGa>gAa	p.G146E	HPS3_ENST00000460120.1_Intron	NM_032383.3	NP_115759.2	Q969F9	HPS3_HUMAN	Hermansky-Pudlak syndrome 3	146					organelle organization (GO:0006996)|pigmentation (GO:0043473)	BLOC-2 complex (GO:0031084)				breast(2)|endometrium(2)|kidney(1)|large_intestine(7)|lung(12)|ovary(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)	34			LUSC - Lung squamous cell carcinoma(72;0.0473)|Lung(72;0.0607)			CCTGTGAAAGGAGACCTTCTC	0.428									Hermansky-Pudlak syndrome																												p.G146E		Atlas-SNP	.											.	HPS3	104	.	0			c.G437A						.						134.0	131.0	132.0					3																	148858010		2203	4300	6503	SO:0001583	missense	84343	exon2	Familial Cancer Database	HPS, HPS1-8	TGAAAGGAGACCT	AY033141	CCDS3140.1	3q24	2014-06-18			ENSG00000163755	ENSG00000163755			15597	protein-coding gene	gene with protein product		606118				11455388	Standard	NM_032383		Approved	SUTAL	uc003ewu.1	Q969F9	OTTHUMG00000159548	ENST00000296051.2:c.437G>A	chr3.hg19:g.148858010G>A	ENSP00000296051:p.Gly146Glu	159.0	0.0		213.0	94.0	NM_032383	A8K6G6|Q8WTV6|Q96AP1|Q96MR3|Q9H608	Missense_Mutation	SNP	ENST00000296051.2	hg19	CCDS3140.1	.	.	.	.	.	.	.	.	.	.	G	28.1	4.887920	0.91814	.	.	ENSG00000163755	ENST00000296051	D	0.92099	-2.97	5.55	5.55	0.83447	.	0.000000	0.85682	D	0.000000	D	0.96093	0.8727	M	0.75264	2.295	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.96066	0.9042	10	0.87932	D	0	-24.0005	19.8692	0.96843	0.0:0.0:1.0:0.0	.	146	Q969F9	HPS3_HUMAN	E	146	ENSP00000296051:G146E	ENSP00000296051:G146E	G	+	2	0	HPS3	150340700	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.554000	0.90689	2.762000	0.94881	0.585000	0.79938	GGA	.	.		0.428	HPS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356151.1	NM_032383	
LIPH	200879	hgsc.bcm.edu	37	3	185234915	185234915	+	Missense_Mutation	SNP	C	C	A			TCGA-2Y-A9H4-01A-11D-A382-10	TCGA-2Y-A9H4-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a12a5c70-7c82-4f2b-972f-81a029234685	cc2a8833-5e36-487f-bcb8-1fcb198152ff	g.chr3:185234915C>A	ENST00000296252.4	-	7	1063	c.922G>T	c.(922-924)Ggg>Tgg	p.G308W	LIPH_ENST00000424591.2_Missense_Mutation_p.G274W	NM_139248.2	NP_640341.1	Q8WWY8	LIPH_HUMAN	lipase, member H	308					lipid catabolic process (GO:0016042)	extracellular space (GO:0005615)|plasma membrane (GO:0005886)	heparin binding (GO:0008201)|phospholipase activity (GO:0004620)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(7)|ovary(1)|pancreas(1)|skin(2)	20	all_cancers(143;8.87e-11)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(80;1.31e-21)			GGATCTTTCCCCCTTAGATGG	0.388																																					p.G308W		Atlas-SNP	.											.	LIPH	56	.	0			c.G922T						.						249.0	224.0	233.0					3																	185234915		2203	4300	6503	SO:0001583	missense	200879	exon7			CTTTCCCCCTTAG	AY093498	CCDS3272.1	3q27	2012-07-31			ENSG00000163898	ENSG00000163898			18483	protein-coding gene	gene with protein product		607365				12213196, 12063250	Standard	XM_006713529		Approved	mPA-PLA1, PLA1B, mPA-PLA1alpha, LPDLR	uc003fpm.3	Q8WWY8	OTTHUMG00000156657	ENST00000296252.4:c.922G>T	chr3.hg19:g.185234915C>A	ENSP00000296252:p.Gly308Trp	129.0	0.0		104.0	40.0	NM_139248	A2IBA7|Q8TEC7	Missense_Mutation	SNP	ENST00000296252.4	hg19	CCDS3272.1	.	.	.	.	.	.	.	.	.	.	C	12.95	2.090192	0.36855	.	.	ENSG00000163898	ENST00000296252;ENST00000424591	D;D	0.89552	-2.53;-2.39	5.7	-1.13	0.09775	Lipase, N-terminal (1);	1.193380	0.05899	N	0.629665	D	0.90676	0.7075	L	0.55990	1.75	0.09310	N	1	D;P	0.59767	0.986;0.837	P;P	0.58520	0.799;0.84	T	0.80571	-0.1323	10	0.72032	D	0.01	-3.5428	8.4521	0.32877	0.0:0.2996:0.483:0.2174	.	274;308	A2IBA6;Q8WWY8	.;LIPH_HUMAN	W	308;274	ENSP00000296252:G308W;ENSP00000396384:G274W	ENSP00000296252:G308W	G	-	1	0	LIPH	186717609	0.000000	0.05858	0.000000	0.03702	0.415000	0.31203	-0.191000	0.09601	0.055000	0.16094	0.563000	0.77884	GGG	.	.		0.388	LIPH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345153.1		
HS3ST1	9957	hgsc.bcm.edu	37	4	11401383	11401383	+	Missense_Mutation	SNP	C	C	A			TCGA-2Y-A9H4-01A-11D-A382-10	TCGA-2Y-A9H4-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a12a5c70-7c82-4f2b-972f-81a029234685	cc2a8833-5e36-487f-bcb8-1fcb198152ff	g.chr4:11401383C>A	ENST00000002596.5	-	2	1421	c.247G>T	c.(247-249)Gcg>Tcg	p.A83S		NM_005114.2	NP_005105.1	O14792	HS3S1_HUMAN	heparan sulfate (glucosamine) 3-O-sulfotransferase 1	83					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	[heparan sulfate]-glucosamine 3-sulfotransferase 1 activity (GO:0008467)|sulfotransferase activity (GO:0008146)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|liver(1)|lung(6)|skin(3)	15						TCGTTCTCCGCGGCCGCCACG	0.657																																					p.A83S		Atlas-SNP	.											.	HS3ST1	41	.	0			c.G247T						.						64.0	55.0	58.0					4																	11401383		2203	4300	6503	SO:0001583	missense	9957	exon2			TCTCCGCGGCCGC	AF019386	CCDS3408.1	4p16	2008-02-05			ENSG00000002587	ENSG00000002587	2.8.2.23	"""Sulfotransferases, membrane-bound"""	5194	protein-coding gene	gene with protein product		603244				9988767	Standard	NM_005114		Approved	3OST1	uc003gmq.3	O14792	OTTHUMG00000090547	ENST00000002596.5:c.247G>T	chr4.hg19:g.11401383C>A	ENSP00000002596:p.Ala83Ser	79.0	0.0		67.0	25.0	NM_005114	B3KUA6|Q6PEY8	Missense_Mutation	SNP	ENST00000002596.5	hg19	CCDS3408.1	.	.	.	.	.	.	.	.	.	.	C	35	5.451715	0.96205	.	.	ENSG00000002587	ENST00000002596	T	0.51817	0.69	5.81	5.81	0.92471	Sulfotransferase domain (1);	0.000000	0.85682	D	0.000000	T	0.66157	0.2761	L	0.58302	1.8	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.59016	-0.7533	10	0.29301	T	0.29	.	19.0707	0.93134	0.0:1.0:0.0:0.0	.	83	O14792	HS3S1_HUMAN	S	83	ENSP00000002596:A83S	ENSP00000002596:A83S	A	-	1	0	HS3ST1	11010481	1.000000	0.71417	0.997000	0.53966	0.996000	0.88848	7.818000	0.86416	2.746000	0.94184	0.655000	0.94253	GCG	.	.		0.657	HS3ST1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207073.3	NM_005114	
NFXL1	152518	hgsc.bcm.edu	37	4	47907301	47907301	+	Missense_Mutation	SNP	C	C	G			TCGA-2Y-A9H4-01A-11D-A382-10	TCGA-2Y-A9H4-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a12a5c70-7c82-4f2b-972f-81a029234685	cc2a8833-5e36-487f-bcb8-1fcb198152ff	g.chr4:47907301C>G	ENST00000507489.1	-	4	645	c.469G>C	c.(469-471)Gct>Cct	p.A157P	NFXL1_ENST00000381538.3_Missense_Mutation_p.A157P|NFXL1_ENST00000329043.3_Missense_Mutation_p.A157P	NM_001278624.1	NP_001265553.1	Q6ZNB6	NFXL1_HUMAN	nuclear transcription factor, X-box binding-like 1	157						integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			NS(1)|endometrium(2)|kidney(2)|large_intestine(8)|lung(8)|ovary(1)|prostate(1)|skin(4)	27						CATGTCATAGCCCCTGCTTGA	0.343																																					p.A157P		Atlas-SNP	.											.	NFXL1	79	.	0			c.G469C						.						158.0	165.0	163.0					4																	47907301		2203	4300	6503	SO:0001583	missense	152518	exon4			TCATAGCCCCTGC	AY134856	CCDS3478.2	4p12	2008-02-05			ENSG00000170448	ENSG00000170448			18726	protein-coding gene	gene with protein product	"""ovarian zinc finger protein"""						Standard	NM_152995		Approved	HOZFP	uc003gxp.3	Q6ZNB6	OTTHUMG00000128621	ENST00000507489.1:c.469G>C	chr4.hg19:g.47907301C>G	ENSP00000422037:p.Ala157Pro	88.0	0.0		88.0	4.0	NM_152995	B1Q2K1|Q86VG1|Q8WVH1	Missense_Mutation	SNP	ENST00000507489.1	hg19	CCDS3478.2	.	.	.	.	.	.	.	.	.	.	C	28.3	4.911594	0.92178	.	.	ENSG00000170448	ENST00000381538;ENST00000507489;ENST00000329043	T;T;T	0.67523	-0.27;-0.27;-0.27	5.84	5.84	0.93424	.	0.072469	0.51477	D	0.000081	T	0.80592	0.4652	M	0.69248	2.105	0.58432	D	0.999998	D	0.76494	0.999	D	0.67103	0.949	T	0.77259	-0.2654	10	0.36615	T	0.2	-15.1185	20.1295	0.97995	0.0:1.0:0.0:0.0	.	157	Q6ZNB6	NFXL1_HUMAN	P	157	ENSP00000370949:A157P;ENSP00000422037:A157P;ENSP00000333113:A157P	ENSP00000333113:A157P	A	-	1	0	NFXL1	47602058	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	6.587000	0.74071	2.758000	0.94735	0.591000	0.81541	GCT	.	.		0.343	NFXL1-002	NOVEL	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361636.1	NM_152995	
INTU	27152	hgsc.bcm.edu	37	4	128625436	128625436	+	Silent	SNP	A	A	G			TCGA-2Y-A9H4-01A-11D-A382-10	TCGA-2Y-A9H4-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a12a5c70-7c82-4f2b-972f-81a029234685	cc2a8833-5e36-487f-bcb8-1fcb198152ff	g.chr4:128625436A>G	ENST00000335251.6	+	10	1660	c.1557A>G	c.(1555-1557)ctA>ctG	p.L519L	INTU_ENST00000512995.1_3'UTR	NM_015693.3	NP_056508.2	Q9ULD6	INTU_HUMAN	inturned planar cell polarity protein	519					cilium assembly (GO:0042384)|hair follicle morphogenesis (GO:0031069)|keratinocyte differentiation (GO:0030216)|limb development (GO:0060173)|negative regulation of cell division (GO:0051782)|negative regulation of keratinocyte proliferation (GO:0010839)|nervous system development (GO:0007399)|positive regulation of smoothened signaling pathway (GO:0045880)|regulation of smoothened signaling pathway (GO:0008589)|spinal cord dorsal/ventral patterning (GO:0021513)	cytoplasm (GO:0005737)				breast(3)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(8)|liver(2)|lung(17)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	43						GGTCTTCTCTATTTTACAAGG	0.318																																					p.L519L		Atlas-SNP	.											.	INTU	92	.	0			c.A1557G						.						111.0	117.0	115.0					4																	128625436		2203	4300	6503	SO:0001819	synonymous_variant	27152	exon10			TTCTCTATTTTAC	BC051698	CCDS34061.1	4q28.2	2013-03-05	2013-03-05	2006-10-24	ENSG00000164066	ENSG00000164066			29239	protein-coding gene	gene with protein product		610621	"""PDZ domain containing 6"", ""inturned planar cell polarity effector homolog (Drosophila)"""	PDZK6, PDZD6		10574462, 21761479	Standard	NM_015693		Approved	KIAA1284	uc003ifk.2	Q9ULD6	OTTHUMG00000161202	ENST00000335251.6:c.1557A>G	chr4.hg19:g.128625436A>G		89.0	0.0		128.0	8.0	NM_015693	A1L4N5|D6RAE6|D6RBT4|Q4W5I8|Q86V55	Silent	SNP	ENST00000335251.6	hg19	CCDS34061.1																																																																																			.	.		0.318	INTU-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364147.2	XM_371707	
FGA	2243	hgsc.bcm.edu	37	4	155507053	155507053	+	Missense_Mutation	SNP	G	G	A			TCGA-2Y-A9H4-01A-11D-A382-10	TCGA-2Y-A9H4-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a12a5c70-7c82-4f2b-972f-81a029234685	cc2a8833-5e36-487f-bcb8-1fcb198152ff	g.chr4:155507053G>A	ENST00000302053.3	-	5	1606	c.1528C>T	c.(1528-1530)Cgc>Tgc	p.R510C	FGA_ENST00000403106.3_Missense_Mutation_p.R510C	NM_000508.3	NP_000499.1	P02671	FIBA_HUMAN	fibrinogen alpha chain	510					blood coagulation (GO:0007596)|blood coagulation, common pathway (GO:0072377)|cell-matrix adhesion (GO:0007160)|cellular protein complex assembly (GO:0043623)|extracellular matrix organization (GO:0030198)|negative regulation of blood coagulation, common pathway (GO:2000261)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of exocytosis (GO:0045921)|positive regulation of heterotypic cell-cell adhesion (GO:0034116)|positive regulation of peptide hormone secretion (GO:0090277)|positive regulation of protein secretion (GO:0050714)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|positive regulation of vasoconstriction (GO:0045907)|protein polymerization (GO:0051258)|response to calcium ion (GO:0051592)|signal transduction (GO:0007165)	blood microparticle (GO:0072562)|cell cortex (GO:0005938)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|fibrinogen complex (GO:0005577)|plasma membrane (GO:0005886)|platelet alpha granule (GO:0031091)|platelet alpha granule lumen (GO:0031093)|vesicle (GO:0031982)	structural molecule activity (GO:0005198)			NS(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(14)|liver(2)|lung(20)|ovary(3)|pancreas(1)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(6)	73	all_hematologic(180;0.215)	Renal(120;0.0458)			Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Sucralfate(DB00364)|Tenecteplase(DB00031)	TGCCTATGGCGGAACCCATCC	0.488																																					p.R510C	NSCLC(143;340 1922 20892 22370 48145)	Atlas-SNP	.											.	FGA	179	.	0			c.C1528T						.						107.0	104.0	105.0					4																	155507053		2203	4300	6503	SO:0001583	missense	2243	exon5			TATGGCGGAACCC		CCDS3787.1, CCDS47152.1	4q28	2014-09-17			ENSG00000171560	ENSG00000171560		"""Fibrinogen C domain containing"", ""Endogenous ligands"""	3661	protein-coding gene	gene with protein product		134820	"""fibrinogen, A alpha polypeptide"""				Standard	NM_000508		Approved		uc003iod.1	P02671	OTTHUMG00000150330	ENST00000302053.3:c.1528C>T	chr4.hg19:g.155507053G>A	ENSP00000306361:p.Arg510Cys	70.0	0.0		76.0	31.0	NM_000508	A8K3E4|D3DP14|D3DP15|Q4QQH7|Q9BX62|Q9UCH2	Missense_Mutation	SNP	ENST00000302053.3	hg19	CCDS3787.1	.	.	.	.	.	.	.	.	.	.	G	14.37	2.514680	0.44763	.	.	ENSG00000171560	ENST00000302053;ENST00000403106	T;T	0.57107	0.42;0.42	5.56	-0.177	0.13307	Fibrinogen alpha C domain (1);	.	.	.	.	T	0.45316	0.1336	N	0.14661	0.345	0.09310	N	1	D;D	0.76494	0.998;0.999	P;P	0.60541	0.731;0.876	T	0.33854	-0.9852	9	0.36615	T	0.2	.	5.7513	0.18148	0.3491:0.437:0.2139:0.0	.	510;510	P02671-2;P02671	.;FIBA_HUMAN	C	510	ENSP00000306361:R510C;ENSP00000385981:R510C	ENSP00000306361:R510C	R	-	1	0	FGA	155726503	0.000000	0.05858	0.000000	0.03702	0.014000	0.08584	-0.158000	0.10070	-0.260000	0.09418	0.655000	0.94253	CGC	.	.		0.488	FGA-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317593.1	NM_000508	
PLCXD3	345557	hgsc.bcm.edu	37	5	41382054	41382054	+	Missense_Mutation	SNP	A	A	G			TCGA-2Y-A9H4-01A-11D-A382-10	TCGA-2Y-A9H4-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a12a5c70-7c82-4f2b-972f-81a029234685	cc2a8833-5e36-487f-bcb8-1fcb198152ff	g.chr5:41382054A>G	ENST00000377801.3	-	2	760	c.686T>C	c.(685-687)cTt>cCt	p.L229P	PLCXD3_ENST00000328457.3_Missense_Mutation_p.L229P			Q63HM9	PLCX3_HUMAN	phosphatidylinositol-specific phospholipase C, X domain containing 3	229					lipid catabolic process (GO:0016042)		phosphoric diester hydrolase activity (GO:0008081)|signal transducer activity (GO:0004871)			central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(4)|lung(21)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	37						GGATGCTTGAAGAAACTGGAT	0.527																																					p.L229P		Atlas-SNP	.											.	PLCXD3	86	.	0			c.T686C						.						63.0	68.0	66.0					5																	41382054		2203	4300	6503	SO:0001583	missense	345557	exon2			GCTTGAAGAAACT		CCDS34150.1	5p13.1	2004-09-09			ENSG00000182836	ENSG00000182836			31822	protein-coding gene	gene with protein product							Standard	NM_001005473		Approved		uc003jmm.1	Q63HM9	OTTHUMG00000162076	ENST00000377801.3:c.686T>C	chr5.hg19:g.41382054A>G	ENSP00000367032:p.Leu229Pro	82.0	0.0		132.0	42.0	NM_001005473	A6NL04	Missense_Mutation	SNP	ENST00000377801.3	hg19	CCDS34150.1	.	.	.	.	.	.	.	.	.	.	A	21.4	4.149324	0.78001	.	.	ENSG00000182836	ENST00000377801;ENST00000328457	.	.	.	6.07	6.07	0.98685	PLC-like phosphodiesterase, TIM beta/alpha-barrel domain (2);	0.000000	0.85682	D	0.000000	T	0.80555	0.4645	M	0.81942	2.565	0.80722	D	1	D	0.65815	0.995	D	0.72982	0.979	T	0.82993	-0.0181	9	0.87932	D	0	-13.1939	16.6406	0.85098	1.0:0.0:0.0:0.0	.	229	Q63HM9	PLCX3_HUMAN	P	229	.	ENSP00000333751:L229P	L	-	2	0	PLCXD3	41417811	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.852000	0.92215	2.326000	0.78906	0.533000	0.62120	CTT	.	.		0.527	PLCXD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367109.1	XM_293875	
CHSY3	337876	hgsc.bcm.edu	37	5	129240619	129240619	+	Missense_Mutation	SNP	G	G	A			TCGA-2Y-A9H4-01A-11D-A382-10	TCGA-2Y-A9H4-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a12a5c70-7c82-4f2b-972f-81a029234685	cc2a8833-5e36-487f-bcb8-1fcb198152ff	g.chr5:129240619G>A	ENST00000305031.4	+	1	455	c.97G>A	c.(97-99)Gag>Aag	p.E33K	CTC-575N7.1_ENST00000503616.1_RNA|CTC-575N7.1_ENST00000515569.1_RNA	NM_175856.4	NP_787052.3	Q70JA7	CHSS3_HUMAN	chondroitin sulfate synthase 3	33					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	Golgi cisterna membrane (GO:0032580)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	glucuronosyl-N-acetylgalactosaminyl-proteoglycan 4-beta-N-acetylgalactosaminyltransferase activity (GO:0047238)|metal ion binding (GO:0046872)|N-acetylgalactosaminyl-proteoglycan 3-beta-glucuronosyltransferase activity (GO:0050510)			central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(7)|lung(9)|ovary(2)|pancreas(1)|prostate(2)|stomach(1)|urinary_tract(1)	28		all_cancers(142;0.0227)|Breast(839;0.198)|Prostate(80;0.215)|Lung NSC(810;0.239)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	OV - Ovarian serous cystadenocarcinoma(64;0.136)		CAGGGTGGCGGAGCTGAGCGA	0.716																																					p.E33K		Atlas-SNP	.											.	CHSY3	92	.	0			c.G97A						.						7.0	8.0	8.0					5																	129240619		2129	4185	6314	SO:0001583	missense	337876	exon1			GTGGCGGAGCTGA	AB086062	CCDS34223.1	5q13	2013-02-19			ENSG00000198108	ENSG00000198108	2.4.1.175, 2.4.1.226	"""Beta 3-glycosyltransferases"", ""Beta 4-glycosyltransferases"""	24293	protein-coding gene	gene with protein product		609963				12907687	Standard	XM_005271982		Approved	CSS3, CHSY-2	uc003kvd.3	Q70JA7	OTTHUMG00000163043	ENST00000305031.4:c.97G>A	chr5.hg19:g.129240619G>A	ENSP00000302629:p.Glu33Lys	57.0	0.0		39.0	11.0	NM_175856	B2RP97|Q76L22|Q86Y52	Missense_Mutation	SNP	ENST00000305031.4	hg19	CCDS34223.1	.	.	.	.	.	.	.	.	.	.	G	19.85	3.903842	0.72754	.	.	ENSG00000198108	ENST00000305031	T	0.72835	-0.69	2.69	2.69	0.31865	.	.	.	.	.	T	0.65112	0.2660	L	0.32530	0.975	0.52099	D	0.999945	D	0.55172	0.97	P	0.48704	0.587	T	0.64901	-0.6298	8	.	.	.	.	14.1047	0.65080	0.0:0.0:1.0:0.0	.	33	Q70JA7	CHSS3_HUMAN	K	33	ENSP00000302629:E33K	.	E	+	1	0	CHSY3	129268518	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.411000	0.73298	1.814000	0.52955	0.460000	0.39030	GAG	.	.		0.716	CHSY3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371453.1	NM_175856	
RAPGEF6	51735	hgsc.bcm.edu	37	5	130769233	130769233	+	Silent	SNP	T	T	C	rs373104489		TCGA-2Y-A9H4-01A-11D-A382-10	TCGA-2Y-A9H4-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a12a5c70-7c82-4f2b-972f-81a029234685	cc2a8833-5e36-487f-bcb8-1fcb198152ff	g.chr5:130769233T>C	ENST00000509018.1	-	25	4069	c.3864A>G	c.(3862-3864)ctA>ctG	p.L1288L	RAPGEF6_ENST00000507093.1_Silent_p.L1296L|RAPGEF6_ENST00000307984.5_Silent_p.L1301L|CTC-432M15.3_ENST00000514667.1_Silent_p.L1338L|RAPGEF6_ENST00000296859.6_Silent_p.L1296L	NM_001164386.1|NM_016340.5	NP_001157858.1|NP_057424.3	Q8TEU7	RPGF6_HUMAN	Rap guanine nucleotide exchange factor (GEF) 6	1288	Ser-rich.				positive regulation of GTPase activity (GO:0043547)|Ras protein signal transduction (GO:0007265)|regulation of GTPase activity (GO:0043087)|regulation of small GTPase mediated signal transduction (GO:0051056)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	GTP-dependent protein binding (GO:0030742)|guanyl-nucleotide exchange factor activity (GO:0005085)|Ras GTPase binding (GO:0017016)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(7)|lung(10)|ovary(3)|skin(1)|stomach(1)	31			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	Lung(113;0.0721)		GTTCATCCTGTAGAGCTGCAG	0.502																																					p.L1301L	Melanoma(168;435 1955 13113 13877 23213)	Atlas-SNP	.											.	RAPGEF6	361	.	0			c.A3903G						.	T	,,,	1,4405	2.1+/-5.4	0,1,2202	180.0	147.0	158.0		3888,3903,3888,3864	-11.5	0.4	5		158	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	RAPGEF6	NM_001164386.1,NM_001164387.1,NM_001164388.1,NM_016340.5	,,,	0,1,6502	CC,CT,TT		0.0,0.0227,0.0077	,,,	1296/1610,1301/1510,1296/1505,1288/1602	130769233	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	51735	exon27			ATCCTGTAGAGCT	AF117947	CCDS34225.1, CCDS54897.1, CCDS54898.1, CCDS54899.1, CCDS54900.1	5q31.1	2008-02-05	2004-03-01	2004-03-02	ENSG00000158987	ENSG00000158987			20655	protein-coding gene	gene with protein product		610499	"""PDZ domain containing guanine nucleotide exchange factor (GEF) 2"""	PDZGEF2		11524421, 12095257	Standard	NM_016340		Approved	RA-GEF-2, PDZ-GEF2	uc010jdi.2	Q8TEU7	OTTHUMG00000162683	ENST00000509018.1:c.3864A>G	chr5.hg19:g.130769233T>C		134.0	0.0		137.0	69.0	NM_001164387	A3KN82|A5PLL6|B7ZML2|E9PDV7|Q8NI21|Q8TEU6|Q96PC1	Silent	SNP	ENST00000509018.1	hg19	CCDS34225.1																																																																																			.	.		0.502	RAPGEF6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000370059.1	NM_016340	
PCDHA12	56137	hgsc.bcm.edu	37	5	140257029	140257029	+	Missense_Mutation	SNP	G	G	A			TCGA-2Y-A9H4-01A-11D-A382-10	TCGA-2Y-A9H4-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a12a5c70-7c82-4f2b-972f-81a029234685	cc2a8833-5e36-487f-bcb8-1fcb198152ff	g.chr5:140257029G>A	ENST00000398631.2	+	1	1972	c.1972G>A	c.(1972-1974)Gcg>Acg	p.A658T	PCDHA5_ENST00000529859.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA9_ENST00000532602.1_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA10_ENST00000506939.2_Intron|PCDHA10_ENST00000307360.5_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA11_ENST00000398640.2_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA6_ENST00000527624.1_Intron	NM_018903.2|NM_031864.2	NP_061726.1|NP_114070.1	Q9UN75	PCDAC_HUMAN	protocadherin alpha 12	658	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(4)|breast(2)|cervix(1)|endometrium(19)|kidney(8)|large_intestine(8)|liver(2)|lung(25)|prostate(1)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(1)	78			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CGGTGAGCCCGCGCTGACGTC	0.692																																					p.A658T	Pancreas(113;759 1672 13322 24104 50104)	Atlas-SNP	.											.	PCDHA12	196	.	0			c.G1972A						.						75.0	78.0	77.0					5																	140257029		2203	4299	6502	SO:0001583	missense	56137	exon1			GAGCCCGCGCTGA	AF152477	CCDS47285.1, CCDS75327.1	5q31	2010-11-26			ENSG00000251664	ENSG00000251664		"""Cadherins / Protocadherins : Clustered"""	8666	other	complex locus constituent	"""KIAA0345-like 2"""	606318				10380929	Standard	NM_018903		Approved	PCDH-ALPHA12	uc003lic.2	Q9UN75	OTTHUMG00000163366	ENST00000398631.2:c.1972G>A	chr5.hg19:g.140257029G>A	ENSP00000381628:p.Ala658Thr	185.0	0.0		195.0	102.0	NM_018903	O75278|Q2M1N8	Missense_Mutation	SNP	ENST00000398631.2	hg19	CCDS47285.1	.	.	.	.	.	.	.	.	.	.	G	5.629	0.300800	0.10678	.	.	ENSG00000251664	ENST00000398631	T	0.52295	0.67	4.81	-0.584	0.11702	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.34454	0.0898	L	0.39147	1.195	0.09310	N	1	B;B	0.26318	0.035;0.146	B;B	0.28232	0.013;0.087	T	0.30001	-0.9993	9	0.56958	D	0.05	.	4.2249	0.10575	0.1494:0.4071:0.332:0.1115	.	658;658	Q9UN75-2;Q9UN75	.;PCDAC_HUMAN	T	658	ENSP00000381628:A658T	ENSP00000381628:A658T	A	+	1	0	PCDHA12	140237213	0.000000	0.05858	0.000000	0.03702	0.014000	0.08584	-0.325000	0.07976	-0.510000	0.06523	0.561000	0.74099	GCG	.	.		0.692	PCDHA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372882.2	NM_018903	
CLK4	57396	hgsc.bcm.edu	37	5	178040819	178040819	+	Missense_Mutation	SNP	T	T	G			TCGA-2Y-A9H4-01A-11D-A382-10	TCGA-2Y-A9H4-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a12a5c70-7c82-4f2b-972f-81a029234685	cc2a8833-5e36-487f-bcb8-1fcb198152ff	g.chr5:178040819T>G	ENST00000316308.4	-	6	736	c.568A>C	c.(568-570)Atc>Ctc	p.I190L		NM_020666.2	NP_065717.1	Q9HAZ1	CLK4_HUMAN	CDC-like kinase 4	190	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				protein autophosphorylation (GO:0046777)|regulation of RNA splicing (GO:0043484)	nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)			breast(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(10)|ovary(1)|prostate(1)|skin(2)	21	all_cancers(89;0.000969)|Renal(175;0.000159)|all_epithelial(37;0.000451)|Lung NSC(126;0.00545)|all_lung(126;0.00918)	all_cancers(40;0.0272)|all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.235)		TTTTTTACGATTTTCACTGCT	0.353																																					p.I190L		Atlas-SNP	.											CLK4_ENST00000316308,NS,carcinoma,0,2	CLK4	103	.	0			c.A568C						.						116.0	111.0	113.0					5																	178040819		2203	4299	6502	SO:0001583	missense	57396	exon6			TTACGATTTTCAC	AF294429	CCDS4437.1	5q35	2008-05-02			ENSG00000113240	ENSG00000113240		"""CDC-like kinases"""	13659	protein-coding gene	gene with protein product		607969				11170754	Standard	NM_020666		Approved		uc003mjf.1	Q9HAZ1	OTTHUMG00000130893	ENST00000316308.4:c.568A>C	chr5.hg19:g.178040819T>G	ENSP00000316948:p.Ile190Leu	129.0	0.0		129.0	81.0	NM_020666		Missense_Mutation	SNP	ENST00000316308.4	hg19	CCDS4437.1	.	.	.	.	.	.	.	.	.	.	T	26.8	4.773026	0.90108	.	.	ENSG00000113240	ENST00000316308;ENST00000536763	T	0.20738	2.05	5.17	5.17	0.71159	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.40448	0.1117	L	0.52266	1.64	0.80722	D	1	D;P;P	0.63046	0.992;0.937;0.937	D;D;D	0.85130	0.997;0.997;0.997	T	0.22626	-1.0211	10	0.87932	D	0	.	13.24	0.59992	0.0:0.0:0.0:1.0	.	190;190;190	B7ZL31;B9EG64;Q9HAZ1	.;.;CLK4_HUMAN	L	190	ENSP00000316948:I190L	ENSP00000316948:I190L	I	-	1	0	CLK4	177973425	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.930000	0.87610	2.074000	0.62210	0.482000	0.46254	ATC	.	.		0.353	CLK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253479.2		
TRIM7	81786	hgsc.bcm.edu	37	5	180622567	180622567	+	Missense_Mutation	SNP	G	G	A			TCGA-2Y-A9H4-01A-11D-A382-10	TCGA-2Y-A9H4-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a12a5c70-7c82-4f2b-972f-81a029234685	cc2a8833-5e36-487f-bcb8-1fcb198152ff	g.chr5:180622567G>A	ENST00000274773.7	-	7	1196	c.1135C>T	c.(1135-1137)Cgc>Tgc	p.R379C	CTC-338M12.6_ENST00000512508.1_RNA|TRIM7_ENST00000393315.1_Missense_Mutation_p.R171C|CTC-338M12.5_ENST00000508877.1_RNA|TRIM7_ENST00000504241.1_5'UTR|CTC-338M12.5_ENST00000514487.1_RNA|CTC-338M12.6_ENST00000502812.2_RNA|TRIM7_ENST00000422067.2_Missense_Mutation_p.R171C|CTC-338M12.6_ENST00000509080.1_RNA|TRIM7_ENST00000361809.3_Missense_Mutation_p.R171C|TRIM7_ENST00000393319.3_Missense_Mutation_p.R197C	NM_203293.1	NP_976038.1	Q9C029	TRIM7_HUMAN	tripartite motif containing 7	379	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.					cytoplasm (GO:0005737)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)			NS(1)|cervix(1)|endometrium(2)|large_intestine(3)|lung(6)|ovary(2)|skin(1)|stomach(1)	17	all_cancers(89;6.03e-06)|all_epithelial(37;7.1e-07)|Renal(175;0.000159)|Lung NSC(126;0.00354)|all_lung(126;0.00609)|Breast(19;0.0684)	all_cancers(40;0.000172)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_lung(500;0.0221)|all_hematologic(541;0.0433)|Lung NSC(249;0.132)|Ovarian(839;0.238)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;2e-06)|Epithelial(171;1.35e-05)|OV - Ovarian serous cystadenocarcinoma(192;0.000128)|Kidney(146;0.0674)|GBM - Glioblastoma multiforme(465;0.0802)		GTGTCGAAGCGGCAGGGGTGG	0.687																																					p.R379C	Esophageal Squamous(128;2258 2308 35507 48647)	Atlas-SNP	.											.	TRIM7	56	.	0			c.C1135T						.						36.0	38.0	37.0					5																	180622567		2196	4271	6467	SO:0001583	missense	81786	exon7			CGAAGCGGCAGGG	AF220032	CCDS4462.1, CCDS4463.1, CCDS4464.1, CCDS43414.1	5q35.3	2013-01-09	2011-01-25		ENSG00000146054	ENSG00000146054		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	16278	protein-coding gene	gene with protein product	"""glycogenin-interacting protein"", ""tripartite motif protein TRIM7"""	609315	"""tripartite motif-containing 7"""			11331580	Standard	NM_203294		Approved	RNF90, GNIP	uc003mmz.1	Q9C029	OTTHUMG00000130963	ENST00000274773.7:c.1135C>T	chr5.hg19:g.180622567G>A	ENSP00000274773:p.Arg379Cys	166.0	0.0		160.0	7.0	NM_203293	A2RUE4|D3DWR7|Q969F5|Q96F67|Q96J89|Q96J90	Missense_Mutation	SNP	ENST00000274773.7	hg19	CCDS4462.1	.	.	.	.	.	.	.	.	.	.	G	15.81	2.943644	0.53079	.	.	ENSG00000146054	ENST00000274773;ENST00000393315;ENST00000361809;ENST00000393319;ENST00000422067	T;T;T;T;T	0.59772	0.24;0.24;0.24;0.24;0.24	4.74	4.74	0.60224	Concanavalin A-like lectin/glucanase (1);SPRY-associated (1);Butyrophylin-like (1);B30.2/SPRY domain (1);	0.000000	0.51477	D	0.000084	D	0.82664	0.5086	H	0.95224	3.64	0.58432	D	0.999997	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	D	0.88272	0.2930	10	0.87932	D	0	.	15.2392	0.73455	0.0:0.0:1.0:0.0	.	379;197	Q9C029;Q9C029-4	TRIM7_HUMAN;.	C	379;171;171;197;171	ENSP00000274773:R379C;ENSP00000376991:R171C;ENSP00000355059:R171C;ENSP00000376994:R197C;ENSP00000391458:R171C	ENSP00000274773:R379C	R	-	1	0	TRIM7	180555173	0.997000	0.39634	0.664000	0.29753	0.104000	0.19210	2.598000	0.46223	2.166000	0.68216	0.549000	0.68633	CGC	.	.		0.687	TRIM7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253569.3	NM_203296	
VWA7	80737	hgsc.bcm.edu	37	6	31736935	31736935	+	Missense_Mutation	SNP	C	C	T			TCGA-2Y-A9H4-01A-11D-A382-10	TCGA-2Y-A9H4-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a12a5c70-7c82-4f2b-972f-81a029234685	cc2a8833-5e36-487f-bcb8-1fcb198152ff	g.chr6:31736935C>T	ENST00000375688.4	-	10	1563	c.1363G>A	c.(1363-1365)Gct>Act	p.A455T	VWA7_ENST00000467576.1_5'UTR|VWA7_ENST00000375686.3_Missense_Mutation_p.A455T|VWA7_ENST00000447450.1_Missense_Mutation_p.A455T			Q9Y334	VWA7_HUMAN	von Willebrand factor A domain containing 7	455	VWFA.					extracellular region (GO:0005576)											TCACGCCGAGCTCGACCCTGA	0.522																																					p.A455T		Atlas-SNP	.											.	.	.	.	0			c.G1363A						.						158.0	111.0	128.0					6																	31736935		1511	2709	4220	SO:0001583	missense	80737	exon10			GCCGAGCTCGACC		CCDS4721.2	6p21	2011-12-13	2011-12-13	2011-12-13	ENSG00000204396	ENSG00000204396			13939	protein-coding gene	gene with protein product		609693	"""chromosome 6 open reading frame 27"""	C6orf27			Standard	NM_025258		Approved	G7c, NG37	uc011dog.2	Q9Y334	OTTHUMG00000031132	ENST00000375688.4:c.1363G>A	chr6.hg19:g.31736935C>T	ENSP00000364840:p.Ala455Thr	74.0	0.0		54.0	19.0	NM_025258	A2BEX8|A6NHR6|B0V041|Q5SSR5|Q96QC8|Q9UMP9	Missense_Mutation	SNP	ENST00000375688.4	hg19	CCDS4721.2	.	.	.	.	.	.	.	.	.	.	C	7.206	0.594503	0.13875	.	.	ENSG00000204396	ENST00000375688;ENST00000375686;ENST00000447450	T;T;T	0.30182	2.75;2.54;1.54	5.65	-1.68	0.08212	von Willebrand factor, type A (1);	1.131360	0.06463	N	0.729808	T	0.03520	0.0101	N	0.03608	-0.345	0.09310	N	1	B	0.09022	0.002	B	0.10450	0.005	T	0.39761	-0.9598	10	0.23891	T	0.37	0.2041	5.7011	0.17883	0.0:0.3373:0.3064:0.3563	.	455	Q9Y334	G7C_HUMAN	T	455	ENSP00000364840:A455T;ENSP00000364838:A455T;ENSP00000390554:A455T	ENSP00000364838:A455T	A	-	1	0	C6orf27	31844914	0.000000	0.05858	0.001000	0.08648	0.135000	0.20990	-0.336000	0.07863	-0.422000	0.07405	0.462000	0.41574	GCT	.	.		0.522	VWA7-001	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076233.2	NM_025258	
TDRD6	221400	hgsc.bcm.edu	37	6	46658262	46658262	+	Missense_Mutation	SNP	A	A	C			TCGA-2Y-A9H4-01A-11D-A382-10	TCGA-2Y-A9H4-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a12a5c70-7c82-4f2b-972f-81a029234685	cc2a8833-5e36-487f-bcb8-1fcb198152ff	g.chr6:46658262A>C	ENST00000316081.6	+	1	2397	c.2397A>C	c.(2395-2397)aaA>aaC	p.K799N	RP11-446F17.3_ENST00000422284.2_RNA|TDRD6_ENST00000544460.1_Missense_Mutation_p.K799N|RP11-446F17.3_ENST00000571590.1_RNA|RP11-446F17.3_ENST00000434329.2_RNA	NM_001010870.2	NP_001010870.1	O60522	TDRD6_HUMAN	tudor domain containing 6	799					germ cell development (GO:0007281)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|P granule (GO:0043186)				NS(1)|breast(9)|central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(25)|ovary(2)|pancreas(1)|prostate(1)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	80			Lung(136;0.192)			AAGGACTTAAAACTCTAATGT	0.423																																					p.K799N		Atlas-SNP	.											.	TDRD6	205	.	0			c.A2397C						.						91.0	94.0	93.0					6																	46658262		2203	4300	6503	SO:0001583	missense	221400	exon1			ACTTAAAACTCTA	AF039442	CCDS34470.1, CCDS55017.1	6p12.3	2013-01-23			ENSG00000180113	ENSG00000180113		"""Tudor domain containing"""	21339	protein-coding gene	gene with protein product	"""cancer/testis antigen 41.2"", ""spermatogenesis associated 36"""	611200				9610721	Standard	NM_001010870		Approved	NY-CO-45, bA446F17.4, CT41.2, SPATA36	uc003oyj.3	O60522	OTTHUMG00000014788	ENST00000316081.6:c.2397A>C	chr6.hg19:g.46658262A>C	ENSP00000346065:p.Lys799Asn	149.0	0.0		140.0	65.0	NM_001168359	B3KWU2|F5H5M3|Q5HYB1|Q5VTS4|Q6ZMX5	Missense_Mutation	SNP	ENST00000316081.6	hg19	CCDS34470.1	.	.	.	.	.	.	.	.	.	.	A	11.51	1.661681	0.29515	.	.	ENSG00000180113	ENST00000544460;ENST00000316081	T;T	0.09163	3.01;3.01	5.75	3.34	0.38264	Maternal tudor protein (1);	0.578652	0.20572	N	0.089702	T	0.01870	0.0059	N	0.25890	0.77	0.09310	N	1	B;B	0.17852	0.02;0.024	B;B	0.22152	0.022;0.038	T	0.46048	-0.9219	10	0.18276	T	0.48	-17.4949	4.1992	0.10458	0.615:0.0:0.2405:0.1445	.	799;799	F5H5M3;O60522	.;TDRD6_HUMAN	N	799	ENSP00000443299:K799N;ENSP00000346065:K799N	ENSP00000346065:K799N	K	+	3	2	TDRD6	46766221	0.003000	0.15002	0.162000	0.22713	0.869000	0.49853	1.379000	0.34340	0.968000	0.38212	0.533000	0.62120	AAA	.	.		0.423	TDRD6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040800.1	XM_166443	
VWDE	221806	hgsc.bcm.edu	37	7	12410068	12410068	+	Missense_Mutation	SNP	A	A	C			TCGA-2Y-A9H4-01A-11D-A382-10	TCGA-2Y-A9H4-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a12a5c70-7c82-4f2b-972f-81a029234685	cc2a8833-5e36-487f-bcb8-1fcb198152ff	g.chr7:12410068A>C	ENST00000275358.3	-	12	2052	c.1864T>G	c.(1864-1866)Tat>Gat	p.Y622D		NM_001135924.1	NP_001129396.1	Q8N2E2	VWDE_HUMAN	von Willebrand factor D and EGF domains	622	VWFD. {ECO:0000255|PROSITE- ProRule:PRU00580}.					extracellular region (GO:0005576)				breast(4)|endometrium(2)|kidney(1)|skin(1)	8						CAGCTACAATAGGATGGCTTT	0.433																																					p.Y622D		Atlas-SNP	.											.	VWDE	123	.	0			c.T1864G						.						16.0	13.0	14.0					7																	12410068		692	1590	2282	SO:0001583	missense	221806	exon12			TACAATAGGATGG		CCDS47544.1	7p21.3	2008-09-23			ENSG00000146530	ENSG00000146530			21897	protein-coding gene	gene with protein product						14702039, 16303743	Standard	NM_001135924		Approved	FLJ14712	uc003ssj.2	Q8N2E2	OTTHUMG00000152315	ENST00000275358.3:c.1864T>G	chr7.hg19:g.12410068A>C	ENSP00000275358:p.Tyr622Asp	22.0	0.0		23.0	11.0	NM_001135924	B7ZM77|Q96SQ3	Missense_Mutation	SNP	ENST00000275358.3	hg19	CCDS47544.1	.	.	.	.	.	.	.	.	.	.	A	13.78	2.338683	0.41398	.	.	ENSG00000146530	ENST00000275358;ENST00000536307	D	0.84070	-1.8	4.79	4.79	0.61399	von Willebrand factor, type D domain (1);	.	.	.	.	D	0.86414	0.5927	L	0.53249	1.67	0.22701	N	0.998835	D	0.61080	0.989	P	0.55087	0.768	T	0.79631	-0.1723	9	0.87932	D	0	.	14.4807	0.67579	1.0:0.0:0.0:0.0	.	622	Q8N2E2	VWDE_HUMAN	D	622;76	ENSP00000275358:Y622D	ENSP00000275358:Y622D	Y	-	1	0	VWDE	12376593	0.982000	0.34865	0.056000	0.19401	0.042000	0.13812	7.474000	0.81024	2.021000	0.59480	0.459000	0.35465	TAT	.	.		0.433	VWDE-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325870.3	XM_371878	
MUC17	140453	hgsc.bcm.edu	37	7	100685401	100685401	+	Missense_Mutation	SNP	G	G	T			TCGA-2Y-A9H4-01A-11D-A382-10	TCGA-2Y-A9H4-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a12a5c70-7c82-4f2b-972f-81a029234685	cc2a8833-5e36-487f-bcb8-1fcb198152ff	g.chr7:100685401G>T	ENST00000306151.4	+	3	10768	c.10704G>T	c.(10702-10704)atG>atT	p.M3568I		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	3568	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)			NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					CTATGCGTATGTCTACTCCAA	0.468																																					p.M3568I		Atlas-SNP	.											.	MUC17	804	.	0			c.G10704T						.						208.0	207.0	208.0					7																	100685401		2203	4300	6503	SO:0001583	missense	140453	exon3			GCGTATGTCTACT	AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.10704G>T	chr7.hg19:g.100685401G>T	ENSP00000302716:p.Met3568Ile	89.0	0.0		81.0	40.0	NM_001040105	O14761|Q685J2|Q8TDH7	Missense_Mutation	SNP	ENST00000306151.4	hg19	CCDS34711.1	.	.	.	.	.	.	.	.	.	.	g	0.025	-1.380485	0.01204	.	.	ENSG00000169876	ENST00000306151	T	0.01838	4.61	1.34	-2.68	0.06041	.	.	.	.	.	T	0.01156	0.0038	N	0.08118	0	0.09310	N	1	B	0.09022	0.002	B	0.21546	0.035	T	0.46303	-0.9201	9	0.37606	T	0.19	.	0.8373	0.01142	0.1665:0.3307:0.1729:0.3299	.	3568	Q685J3	MUC17_HUMAN	I	3568	ENSP00000302716:M3568I	ENSP00000302716:M3568I	M	+	3	0	MUC17	100472121	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-3.229000	0.00549	-2.030000	0.00929	-1.038000	0.02383	ATG	.	.		0.468	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347161.1	NM_001040105	
AGBL3	340351	hgsc.bcm.edu	37	7	134719306	134719306	+	Missense_Mutation	SNP	T	T	G			TCGA-2Y-A9H4-01A-11D-A382-10	TCGA-2Y-A9H4-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a12a5c70-7c82-4f2b-972f-81a029234685	cc2a8833-5e36-487f-bcb8-1fcb198152ff	g.chr7:134719306T>G	ENST00000436302.2	+	7	1217	c.964T>G	c.(964-966)Ttt>Gtt	p.F322V	AGBL3_ENST00000435976.2_Missense_Mutation_p.F322V|AGBL3_ENST00000458078.1_Missense_Mutation_p.F296V	NM_178563.3	NP_848658.3	Q8NEM8	CBPC3_HUMAN	ATP/GTP binding protein-like 3	322						cytoplasm (GO:0005737)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(3)|lung(2)|skin(3)	10						ACGGTCAAAGTTTTGTAAAAT	0.403																																					p.F322V		Atlas-SNP	.											.	AGBL3	45	.	0			c.T964G						.						190.0	143.0	157.0					7																	134719306		692	1591	2283	SO:0001583	missense	340351	exon7			TCAAAGTTTTGTA	BC030651	CCDS47718.1	7q33	2014-06-23			ENSG00000146856	ENSG00000146856			27981	protein-coding gene	gene with protein product							Standard	NM_178563		Approved	MGC32955, CCP3	uc011kpw.2	Q8NEM8	OTTHUMG00000155406	ENST00000436302.2:c.964T>G	chr7.hg19:g.134719306T>G	ENSP00000388275:p.Phe322Val	98.0	0.0		108.0	47.0	NM_178563	B7Z827|Q9H965	Missense_Mutation	SNP	ENST00000436302.2	hg19	CCDS47718.1	.	.	.	.	.	.	.	.	.	.	T	17.47	3.396492	0.62177	.	.	ENSG00000146856	ENST00000436302;ENST00000458078;ENST00000435976	T;T;T	0.09817	2.94;2.94;2.94	5.72	4.56	0.56223	.	0.113382	0.64402	D	0.000007	T	0.13072	0.0317	L	0.47016	1.485	0.41200	D	0.98636	B	0.28026	0.198	B	0.33846	0.171	T	0.03514	-1.1029	10	0.54805	T	0.06	-12.7246	11.565	0.50800	0.0:0.0708:0.0:0.9292	.	322	Q8NEM8-4	.	V	322;296;322	ENSP00000388275:F322V;ENSP00000395969:F296V;ENSP00000401220:F322V	ENSP00000275763:F322V	F	+	1	0	AGBL3	134369846	1.000000	0.71417	0.997000	0.53966	0.995000	0.86356	3.857000	0.55972	0.985000	0.38656	0.455000	0.32223	TTT	.	.		0.403	AGBL3-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376655.1	NM_178563	
SNX16	64089	hgsc.bcm.edu	37	8	82752214	82752214	+	Missense_Mutation	SNP	G	G	T			TCGA-2Y-A9H4-01A-11D-A382-10	TCGA-2Y-A9H4-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a12a5c70-7c82-4f2b-972f-81a029234685	cc2a8833-5e36-487f-bcb8-1fcb198152ff	g.chr8:82752214G>T	ENST00000345957.4	-	2	286	c.8C>A	c.(7-9)aCt>aAt	p.T3N	SNX16_ENST00000353788.4_Missense_Mutation_p.T3N|SNX16_ENST00000396330.2_Missense_Mutation_p.T3N	NM_152836.2	NP_690049.1	P57768	SNX16_HUMAN	sorting nexin 16	3					early endosome to late endosome transport (GO:0045022)|endosome to lysosome transport (GO:0008333)|protein targeting to lysosome (GO:0006622)	early endosome (GO:0005769)|extrinsic component of endosome membrane (GO:0031313)|late endosome (GO:0005770)|lysosome (GO:0005764)	identical protein binding (GO:0042802)|phosphatidylinositol binding (GO:0035091)			large_intestine(1)|ovary(1)|pancreas(1)|skin(2)	5						GACATAAGGAGTTGCCATCTT	0.393																																					p.T3N		Atlas-SNP	.											.	SNX16	21	.	0			c.C8A						.						138.0	136.0	137.0					8																	82752214		2203	4300	6503	SO:0001583	missense	64089	exon2			TAAGGAGTTGCCA	AF305779	CCDS6234.1, CCDS6235.1	8q21.13	2011-05-03			ENSG00000104497	ENSG00000104497		"""Sorting nexins"""	14980	protein-coding gene	gene with protein product		614903				12461558, 12813048	Standard	NM_152837		Approved		uc003ycn.3	P57768	OTTHUMG00000164727	ENST00000345957.4:c.8C>A	chr8.hg19:g.82752214G>T	ENSP00000322652:p.Thr3Asn	50.0	0.0		37.0	11.0	NM_152836	A8K4D8|Q658L0|Q8N4U3	Missense_Mutation	SNP	ENST00000345957.4	hg19	CCDS6234.1	.	.	.	.	.	.	.	.	.	.	G	22.5	4.298349	0.81025	.	.	ENSG00000104497	ENST00000353788;ENST00000396330;ENST00000345957;ENST00000520618;ENST00000523757;ENST00000521810;ENST00000519119;ENST00000519817;ENST00000518183;ENST00000521773	T;T;T;T;T;T;T	0.56611	0.67;0.59;0.59;0.72;0.68;0.74;0.45	5.64	5.64	0.86602	.	0.103190	0.64402	D	0.000002	T	0.67785	0.2930	M	0.68317	2.08	0.42183	D	0.991694	D;D	0.58970	0.984;0.984	P;P	0.56612	0.802;0.802	T	0.70699	-0.4800	10	0.72032	D	0.01	-7.4989	18.7004	0.91618	0.0:0.0:1.0:0.0	.	3;3	Q658L0;P57768	.;SNX16_HUMAN	N	3	ENSP00000322631:T3N;ENSP00000379621:T3N;ENSP00000322652:T3N;ENSP00000428699:T3N;ENSP00000430038:T3N;ENSP00000428734:T3N;ENSP00000427876:T3N	ENSP00000322652:T3N	T	-	2	0	SNX16	82914769	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.891000	0.87319	2.681000	0.91329	0.561000	0.74099	ACT	.	.		0.393	SNX16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379929.1	NM_022133	
GPIHBP1	338328	hgsc.bcm.edu	37	8	144297217	144297217	+	Missense_Mutation	SNP	A	A	T	rs369222108		TCGA-2Y-A9H4-01A-11D-A382-10	TCGA-2Y-A9H4-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a12a5c70-7c82-4f2b-972f-81a029234685	cc2a8833-5e36-487f-bcb8-1fcb198152ff	g.chr8:144297217A>T	ENST00000330824.2	+	4	454	c.379A>T	c.(379-381)Acc>Tcc	p.T127S		NM_178172.3	NP_835466.1	Q8IV16	HDBP1_HUMAN	glycosylphosphatidylinositol anchored high density lipoprotein binding protein 1	127	UPAR/Ly6.				cholesterol homeostasis (GO:0042632)|intracellular protein transport (GO:0006886)|positive regulation of chylomicron remnant clearance (GO:0090321)|positive regulation of lipoprotein lipase activity (GO:0051006)|protein import (GO:0017038)|protein localization to cell surface (GO:0034394)|protein stabilization (GO:0050821)|protein transmembrane transport (GO:0071806)|response to heparin (GO:0071503)|transcytosis (GO:0045056)|triglyceride homeostasis (GO:0070328)	anchored component of external side of plasma membrane (GO:0031362)|apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|external side of plasma membrane (GO:0009897)|high-density lipoprotein particle (GO:0034364)	chylomicron binding (GO:0035478)|lipase binding (GO:0035473)|lipid binding (GO:0008289)|lipoprotein particle binding (GO:0071813)|protein transmembrane transporter activity (GO:0008320)			lung(2)	2	all_cancers(97;6.49e-11)|all_epithelial(106;2.77e-09)|Lung NSC(106;0.000167)|all_lung(105;0.000459)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)					GACCCAGGTGACCATGACCTG	0.672																																					p.T127S		Atlas-SNP	.											.	GPIHBP1	12	.	0			c.A379T						.						74.0	74.0	74.0					8																	144297217		2203	4298	6501	SO:0001583	missense	338328	exon4			CAGGTGACCATGA	AF088057	CCDS34954.1	8q24.3	2014-07-14	2008-02-07						24945	protein-coding gene	gene with protein product	"""endothelial cell LPL transporter"""	612757	"""GPI anchored high density lipoprotein binding protein 1"""			12496272, 17883852, 17620854, 17403372	Standard	NM_178172		Approved	LOC338328, GPI-HBP1	uc003yxu.2	Q8IV16		ENST00000330824.2:c.379A>T	chr8.hg19:g.144297217A>T	ENSP00000329266:p.Thr127Ser	104.0	0.0		114.0	61.0	NM_178172	Q6P3T2|Q86W15	Missense_Mutation	SNP	ENST00000330824.2	hg19	CCDS34954.1	.	.	.	.	.	.	.	.	.	.	A	11.87	1.768697	0.31320	.	.	ENSG00000182851	ENST00000330824	T	0.69306	-0.39	4.39	3.23	0.37069	Ly-6 antigen / uPA receptor -like (1);CD59 antigen (1);	0.139481	0.33572	N	0.004777	T	0.69251	0.3090	M	0.70595	2.14	0.09310	N	1	D	0.55605	0.972	P	0.51701	0.677	T	0.61178	-0.7115	10	0.49607	T	0.09	-10.3827	6.7826	0.23654	0.8892:0.0:0.1108:0.0	.	127	Q8IV16	HDBP1_HUMAN	S	127	ENSP00000329266:T127S	ENSP00000329266:T127S	T	+	1	0	GPIHBP1	144368592	0.803000	0.28956	0.015000	0.15790	0.053000	0.15095	2.561000	0.45905	0.648000	0.30732	0.374000	0.22700	ACC	.	.		0.672	GPIHBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381113.1	NM_178172	
GNA14	9630	hgsc.bcm.edu	37	9	80144021	80144021	+	Silent	SNP	G	G	A			TCGA-2Y-A9H4-01A-11D-A382-10	TCGA-2Y-A9H4-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a12a5c70-7c82-4f2b-972f-81a029234685	cc2a8833-5e36-487f-bcb8-1fcb198152ff	g.chr9:80144021G>A	ENST00000341700.6	-	2	786	c.273C>T	c.(271-273)gaC>gaT	p.D91D	RP11-466A17.1_ENST00000439145.1_RNA	NM_004297.3	NP_004288.1	O95837	GNA14_HUMAN	guanine nucleotide binding protein (G protein), alpha 14	91					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|blood coagulation (GO:0007596)|phospholipase C-activating dopamine receptor signaling pathway (GO:0060158)|platelet activation (GO:0030168)|signal transduction (GO:0007165)	extracellular vesicular exosome (GO:0070062)|heterotrimeric G-protein complex (GO:0005834)|plasma membrane (GO:0005886)	G-protein beta/gamma-subunit complex binding (GO:0031683)|G-protein coupled receptor binding (GO:0001664)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)			endometrium(3)|kidney(1)|large_intestine(7)|lung(4)|ovary(2)|prostate(1)|skin(4)|urinary_tract(2)	24						TCCTTAGCGTGTCCATCGCTC	0.483																																					p.D91D		Atlas-SNP	.											.	GNA14	50	.	0			c.C273T						.						387.0	307.0	334.0					9																	80144021		2203	4300	6503	SO:0001819	synonymous_variant	9630	exon2			TAGCGTGTCCATC	AF105201	CCDS6657.1	9q21	2008-05-23			ENSG00000156049	ENSG00000156049			4382	protein-coding gene	gene with protein product		604397				10191087, 17620339	Standard	NM_004297		Approved		uc004aku.3	O95837	OTTHUMG00000020058	ENST00000341700.6:c.273C>T	chr9.hg19:g.80144021G>A		128.0	0.0		117.0	34.0	NM_004297	B1ALW3	Silent	SNP	ENST00000341700.6	hg19	CCDS6657.1																																																																																			.	.		0.483	GNA14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052759.1		
TMEFF1	8577	hgsc.bcm.edu	37	9	103278965	103278965	+	Missense_Mutation	SNP	G	G	A			TCGA-2Y-A9H4-01A-11D-A382-10	TCGA-2Y-A9H4-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a12a5c70-7c82-4f2b-972f-81a029234685	cc2a8833-5e36-487f-bcb8-1fcb198152ff	g.chr9:103278965G>A	ENST00000374879.4	+	5	904	c.472G>A	c.(472-474)Ggg>Agg	p.G158R	TMEFF1_ENST00000334943.6_Missense_Mutation_p.G119R|MSANTD3-TMEFF1_ENST00000502978.1_Missense_Mutation_p.R121K	NM_003692.4	NP_003683.2	Q8IYR6	TEFF1_HUMAN	transmembrane protein with EGF-like and two follistatin-like domains 1	158					multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|kidney(1)|large_intestine(7)|lung(9)|stomach(1)	19		Acute lymphoblastic leukemia(62;0.0452)				AGAAGAGGAAGGGTCAGGGGC	0.398																																					p.G232R		Atlas-SNP	.											.	.	.	.	0			c.G694A						.						90.0	85.0	87.0					9																	103278965		2203	4300	6503	SO:0001583	missense	100526694	exon5			GAGGAAGGGTCAG	U19878	CCDS6750.1	9q31	2010-05-04			ENSG00000241697	ENSG00000241697			11866	protein-coding gene	gene with protein product	"""tomoregulin-1"", ""cancer/testis antigen family 120, member 1"""	603421		C9orf2		9730596	Standard	NM_003692		Approved	H7365, CT120.1		Q8IYR6	OTTHUMG00000020367	ENST00000374879.4:c.472G>A	chr9.hg19:g.103278965G>A	ENSP00000364013:p.Gly158Arg	133.0	0.0		101.0	32.0	NM_001198812	Q13086|Q8N3T8	Missense_Mutation	SNP	ENST00000374879.4	hg19	CCDS6750.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	26.3|26.3	4.723128|4.723128	0.89298|0.89298	.|.	.|.	ENSG00000241697|ENSG00000251349	ENST00000334943;ENST00000374879|ENST00000502978	T;T|.	0.59502|.	0.27;0.26|.	5.87|5.87	5.87|5.87	0.94306|0.94306	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.59418|0.59418	0.2192|0.2192	L|L	0.32530|0.32530	0.975|0.975	0.80722|0.80722	D|D	1|1	D;D|.	0.89917|.	0.999;1.0|.	D;D|.	0.79108|.	0.986;0.992|.	T|T	0.50725|0.50725	-0.8794|-0.8794	10|5	0.23891|.	T|.	0.37|.	-10.9338|-10.9338	18.0718|18.0718	0.89410|0.89410	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	158;119|.	Q8IYR6;Q8IYR6-2|.	TEFF1_HUMAN;.|.	R|K	119;158|121	ENSP00000334447:G119R;ENSP00000364013:G158R|.	ENSP00000334447:G119R|.	G|R	+|+	1|2	0|0	TMEFF1|C9orf30-TMEFF1	102318786|102318786	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	7.998000|7.998000	0.88491|0.88491	2.941000|2.941000	0.99782|0.99782	0.655000|0.655000	0.94253|0.94253	GGG|AGG	.	.		0.398	TMEFF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053418.1	NM_003692	
PAPPA	5069	hgsc.bcm.edu	37	9	119097256	119097256	+	Missense_Mutation	SNP	G	G	A			TCGA-2Y-A9H4-01A-11D-A382-10	TCGA-2Y-A9H4-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a12a5c70-7c82-4f2b-972f-81a029234685	cc2a8833-5e36-487f-bcb8-1fcb198152ff	g.chr9:119097256G>A	ENST00000328252.3	+	13	3883	c.3514G>A	c.(3514-3516)Gcc>Acc	p.A1172T	PAPPA_ENST00000534838.1_Missense_Mutation_p.A210T	NM_002581.3	NP_002572.2	Q13219	PAPP1_HUMAN	pregnancy-associated plasma protein A, pappalysin 1	1172					cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|female pregnancy (GO:0007565)|response to follicle-stimulating hormone (GO:0032354)|response to glucocorticoid (GO:0051384)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)	endopeptidase activity (GO:0004175)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(1)|breast(4)|endometrium(9)|kidney(2)|large_intestine(23)|lung(33)|ovary(4)|pancreas(2)|prostate(5)|skin(7)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(1)	98						GCCCCTGGTCGCCATCTCGGG	0.617																																					p.A1172T		Atlas-SNP	.											.	PAPPA	243	.	0			c.G3514A						.						113.0	95.0	101.0					9																	119097256		2203	4300	6503	SO:0001583	missense	5069	exon13			CTGGTCGCCATCT		CCDS6813.1	9q33.1	2014-03-05			ENSG00000182752	ENSG00000182752			8602	protein-coding gene	gene with protein product	"""insulin-like growth factor-dependent IGF binding protein-4 protease"", ""aspecific BCL2 ARE-binding protein 2"", ""differentially placenta 1 expressed protein"""	176385				7679961	Standard	NM_002581		Approved	PAPP-A, PAPPA1, IGFBP-4ase, PAPA, ASBABP2, DIPLA1	uc004bjn.3	Q13219	OTTHUMG00000021045	ENST00000328252.3:c.3514G>A	chr9.hg19:g.119097256G>A	ENSP00000330658:p.Ala1172Thr	98.0	0.0		72.0	24.0	NM_002581	B1AMF9|Q08371|Q68G52|Q9UDK7	Missense_Mutation	SNP	ENST00000328252.3	hg19	CCDS6813.1	.	.	.	.	.	.	.	.	.	.	G	36	5.637047	0.96693	.	.	ENSG00000182752	ENST00000328252;ENST00000534838	T;T	0.05319	4.24;3.46	5.86	5.86	0.93980	.	0.045243	0.85682	D	0.000000	T	0.29491	0.0735	M	0.79475	2.455	0.80722	D	1	D;D	0.89917	0.983;1.0	P;D	0.87578	0.45;0.998	T	0.00436	-1.1740	10	0.72032	D	0.01	-25.892	20.1865	0.98220	0.0:0.0:1.0:0.0	.	210;1172	F5GZ19;Q13219	.;PAPP1_HUMAN	T	1172;210	ENSP00000330658:A1172T;ENSP00000441461:A210T	ENSP00000330658:A1172T	A	+	1	0	PAPPA	118137077	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.434000	0.97515	2.775000	0.95449	0.655000	0.94253	GCC	.	.		0.617	PAPPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055546.1	NM_002581	
SLC22A18AS	5003	hgsc.bcm.edu	37	11	2920711	2920711	+	Missense_Mutation	SNP	C	C	G			TCGA-2Y-A9H4-01A-11D-A382-10	TCGA-2Y-A9H4-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a12a5c70-7c82-4f2b-972f-81a029234685	cc2a8833-5e36-487f-bcb8-1fcb198152ff	g.chr11:2920711C>G	ENST00000533594.1	-	3	717	c.221G>C	c.(220-222)gGa>gCa	p.G74A	SLC22A18_ENST00000312221.5_5'Flank|SLC22A18AS_ENST00000455942.2_Intron|SLC22A18_ENST00000380574.1_5'Flank|SLC22A18_ENST00000449793.2_5'Flank|SLC22A18_ENST00000347936.2_5'Flank	NM_007105.2	NP_009036.2	Q8N1D0	BWR1B_HUMAN	solute carrier family 22 (organic cation transporter), member 18 antisense	74										NS(1)|endometrium(2)	3						cttccttcctccagtcagcct	0.592																																					p.G74A		Atlas-SNP	.											.	SLC22A18AS	7	.	0			c.G221C						.						117.0	100.0	105.0					11																	2920711		692	1591	2283	SO:0001583	missense	5003	exon3			CTTCCTCCAGTCA	AF035407	CCDS7739.1	11p15.5	2011-02-10	2005-08-23	2005-08-23	ENSG00000254827	ENSG00000254827			10965	protein-coding gene	gene with protein product		603240	"""solute carrier family 22 (organic cation transporter), member 1-like antisense"""	BWSCR1B, ORCTL2S, SLC22A1LS		9570947, 9520460, 15175115	Standard	NM_007105		Approved	BWR1B, p27-BWR1B	uc001lwv.4	Q8N1D0	OTTHUMG00000010038	ENST00000533594.1:c.221G>C	chr11.hg19:g.2920711C>G	ENSP00000433282:p.Gly74Ala	89.0	0.0		101.0	18.0	NM_007105	E9PLK8|O43563	Missense_Mutation	SNP	ENST00000533594.1	hg19	CCDS7739.1	.	.	.	.	.	.	.	.	.	.	C	11.56	1.673939	0.29693	.	.	ENSG00000254827	ENST00000533594	T	0.43688	0.94	1.59	-3.17	0.05202	.	.	.	.	.	T	0.18635	0.0447	N	0.08118	0	0.09310	N	1	B	0.19817	0.039	B	0.11329	0.006	T	0.14337	-1.0476	9	0.87932	D	0	.	3.8907	0.09117	0.3066:0.2973:0.3961:0.0	.	74	E9PLK8	.	A	74	ENSP00000433282:G74A	ENSP00000433282:G74A	G	-	2	0	SLC22A18AS	2877287	0.000000	0.05858	0.000000	0.03702	0.602000	0.36980	-0.382000	0.07408	-1.097000	0.03042	0.313000	0.20887	GGA	.	.		0.592	SLC22A18AS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027771.3	NM_007105	
PRRG4	79056	hgsc.bcm.edu	37	11	32875007	32875007	+	Silent	SNP	A	A	G			TCGA-2Y-A9H4-01A-11D-A382-10	TCGA-2Y-A9H4-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a12a5c70-7c82-4f2b-972f-81a029234685	cc2a8833-5e36-487f-bcb8-1fcb198152ff	g.chr11:32875007A>G	ENST00000257836.3	+	6	868	c.615A>G	c.(613-615)ccA>ccG	p.P205P		NM_024081.5	NP_076986.1	Q9BZD6	TMG4_HUMAN	proline rich Gla (G-carboxyglutamic acid) 4 (transmembrane)	205	Poly-Pro.					extracellular region (GO:0005576)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)			large_intestine(2)|lung(2)|prostate(2)|urinary_tract(1)	7	Breast(20;0.206)					CACCACCACCACCATATCCTG	0.443																																					p.P205P		Atlas-SNP	.											.	PRRG4	15	.	0			c.A615G						.						124.0	123.0	123.0					11																	32875007		2202	4299	6501	SO:0001819	synonymous_variant	79056	exon6			ACCACCACCATAT	AF326351	CCDS7881.1	11p13	2008-02-05			ENSG00000135378	ENSG00000135378			30799	protein-coding gene	gene with protein product		611690				11171957	Standard	NM_024081		Approved	TMG4	uc001mtx.3	Q9BZD6	OTTHUMG00000166219	ENST00000257836.3:c.615A>G	chr11.hg19:g.32875007A>G		122.0	0.0		97.0	41.0	NM_024081		Silent	SNP	ENST00000257836.3	hg19	CCDS7881.1																																																																																			.	.		0.443	PRRG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388446.1	NM_024081	
OR4S2	219431	hgsc.bcm.edu	37	11	55419121	55419121	+	Missense_Mutation	SNP	T	T	C			TCGA-2Y-A9H4-01A-11D-A382-10	TCGA-2Y-A9H4-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a12a5c70-7c82-4f2b-972f-81a029234685	cc2a8833-5e36-487f-bcb8-1fcb198152ff	g.chr11:55419121T>C	ENST00000312422.2	+	1	742	c.742T>C	c.(742-744)Ttt>Ctt	p.F248L		NM_001004059.2	NP_001004059.2	Q8NH73	OR4S2_HUMAN	olfactory receptor, family 4, subfamily S, member 2	248						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|kidney(2)|large_intestine(4)|lung(28)|ovary(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	45		all_epithelial(135;0.0748)				GGTCGTTATCTTTTTCGGCCC	0.483																																					p.F248L		Atlas-SNP	.											.	OR4S2	89	.	0			c.T742C						.						169.0	138.0	149.0					11																	55419121		2179	4027	6206	SO:0001583	missense	219431	exon1			GTTATCTTTTTCG	BK004390	CCDS31505.1	11q11	2012-08-09	2002-11-13	2002-11-15	ENSG00000174982	ENSG00000174982		"""GPCR / Class A : Olfactory receptors"""	15183	protein-coding gene	gene with protein product			"""olfactory receptor, family 4, subfamily S, member 2 pseudogene"""	OR4S2P			Standard	NM_001004059		Approved	OST725	uc001nhs.1	Q8NH73	OTTHUMG00000166799	ENST00000312422.2:c.742T>C	chr11.hg19:g.55419121T>C	ENSP00000310337:p.Phe248Leu	81.0	0.0		124.0	43.0	NM_001004059	Q6IF72	Missense_Mutation	SNP	ENST00000312422.2	hg19	CCDS31505.1	.	.	.	.	.	.	.	.	.	.	T	13.92	2.380776	0.42207	.	.	ENSG00000174982	ENST00000312422	T	0.00285	8.3	5.35	5.35	0.76521	GPCR, rhodopsin-like superfamily (1);	0.000000	0.56097	D	0.000040	T	0.00300	0.0009	M	0.78223	2.4	0.32788	N	0.501534	B	0.30326	0.276	B	0.31614	0.133	T	0.18555	-1.0333	10	0.72032	D	0.01	.	9.509	0.39065	0.0:0.0842:0.0:0.9158	.	248	Q8NH73	OR4S2_HUMAN	L	248	ENSP00000310337:F248L	ENSP00000310337:F248L	F	+	1	0	OR4S2	55175697	0.002000	0.14202	1.000000	0.80357	0.591000	0.36615	1.170000	0.31883	2.028000	0.59812	0.443000	0.29094	TTT	.	.		0.483	OR4S2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391503.1	NM_001004059	
RELA	5970	hgsc.bcm.edu	37	11	65422301	65422301	+	Missense_Mutation	SNP	C	C	A			TCGA-2Y-A9H4-01A-11D-A382-10	TCGA-2Y-A9H4-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a12a5c70-7c82-4f2b-972f-81a029234685	cc2a8833-5e36-487f-bcb8-1fcb198152ff	g.chr11:65422301C>A	ENST00000406246.3	-	11	1465	c.1204G>T	c.(1204-1206)Gct>Tct	p.A402S	RELA_ENST00000308639.9_Missense_Mutation_p.A399S|RELA_ENST00000525693.1_3'UTR	NM_001243984.1|NM_001243985.1|NM_021975.3	NP_001230913.1|NP_001230914.1|NP_068810.3	Q04206	TF65_HUMAN	v-rel avian reticuloendotheliosis viral oncogene homolog A	402					acetaldehyde metabolic process (GO:0006117)|aging (GO:0007568)|cellular defense response (GO:0006968)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to interleukin-1 (GO:0071347)|cellular response to interleukin-6 (GO:0071354)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to nicotine (GO:0071316)|cellular response to peptide hormone stimulus (GO:0071375)|cellular response to tumor necrosis factor (GO:0071356)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|Fc-epsilon receptor signaling pathway (GO:0038095)|hair follicle development (GO:0001942)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|liver development (GO:0001889)|membrane protein intracellular domain proteolysis (GO:0031293)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nucleotide-binding oligomerization domain containing 2 signaling pathway (GO:0070431)|organ morphogenesis (GO:0009887)|positive regulation of cell proliferation (GO:0008284)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-12 biosynthetic process (GO:0045084)|positive regulation of miRNA metabolic process (GO:2000630)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of Schwann cell differentiation (GO:0014040)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|regulation of inflammatory response (GO:0050727)|response to amino acid (GO:0043200)|response to cAMP (GO:0051591)|response to cobalamin (GO:0033590)|response to drug (GO:0042493)|response to insulin (GO:0032868)|response to interleukin-1 (GO:0070555)|response to mechanical stimulus (GO:0009612)|response to morphine (GO:0043278)|response to muramyl dipeptide (GO:0032495)|response to organic substance (GO:0010033)|response to progesterone (GO:0032570)|response to UV-B (GO:0010224)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	activating transcription factor binding (GO:0033613)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|identical protein binding (GO:0042802)|NF-kappaB binding (GO:0051059)|phosphate ion binding (GO:0042301)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|repressing transcription factor binding (GO:0070491)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(11)|ovary(1)|urinary_tract(1)	19						tgggccagagctgataccatg	0.716																																					p.A402S		Atlas-SNP	.											.	RELA	44	.	0			c.G1204T						.						6.0	8.0	7.0					11																	65422301		2156	4233	6389	SO:0001583	missense	5970	exon11			CCAGAGCTGATAC	Z22951	CCDS31609.1, CCDS44651.1, CCDS73322.1	11q13	2013-07-09	2013-07-09		ENSG00000173039	ENSG00000173039			9955	protein-coding gene	gene with protein product		164014	"""nuclear factor of kappa light polypeptide gene enhancer in B-cells 3"""	NFKB3		2001591	Standard	NM_021975		Approved	p65	uc001ofg.3	Q04206	OTTHUMG00000166566	ENST00000406246.3:c.1204G>T	chr11.hg19:g.65422301C>A	ENSP00000384273:p.Ala402Ser	153.0	0.0		108.0	41.0	NM_021975	Q6GTV1|Q6SLK1	Missense_Mutation	SNP	ENST00000406246.3	hg19	CCDS31609.1	.	.	.	.	.	.	.	.	.	.	C	1.361	-0.588830	0.03799	.	.	ENSG00000173039	ENST00000406246;ENST00000308639;ENST00000545816;ENST00000532999	T;T;T	0.49432	0.78;0.78;0.78	3.82	0.804	0.18697	.	2.226600	0.01700	N	0.027155	T	0.27241	0.0668	N	0.14661	0.345	0.09310	N	1	B;B;B;B;B	0.02656	0.0;0.0;0.0;0.0;0.0	B;B;B;B;B	0.06405	0.002;0.002;0.002;0.001;0.0	T	0.22034	-1.0228	10	0.02654	T	1	0.4006	5.6637	0.17682	0.0:0.495:0.3917:0.1133	.	392;389;399;402;413	Q04206-3;Q04206-2;Q04206-4;Q04206;B4E082	.;.;.;TF65_HUMAN;.	S	402;399;413;413	ENSP00000384273:A402S;ENSP00000311508:A399S;ENSP00000433526:A413S	ENSP00000311508:A399S	A	-	1	0	RELA	65178877	0.008000	0.16893	0.001000	0.08648	0.771000	0.43674	-0.111000	0.10807	-0.000000	0.14550	-0.287000	0.09952	GCT	.	.		0.716	RELA-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000390457.2	NM_021975	
OAF	220323	hgsc.bcm.edu	37	11	120082155	120082155	+	Silent	SNP	C	C	T			TCGA-2Y-A9H4-01A-11D-A382-10	TCGA-2Y-A9H4-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a12a5c70-7c82-4f2b-972f-81a029234685	cc2a8833-5e36-487f-bcb8-1fcb198152ff	g.chr11:120082155C>T	ENST00000328965.4	+	1	681	c.168C>T	c.(166-168)agC>agT	p.S56S	OAF_ENST00000531220.1_5'UTR	NM_178507.2	NP_848602.1	Q86UD1	OAF_HUMAN	OAF homolog (Drosophila)	56						extracellular vesicular exosome (GO:0070062)				kidney(1)|lung(5)	6		Breast(109;0.00663)|Medulloblastoma(222;0.0523)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;5.1e-06)		ACGCGGACAGCATCAGCCTCG	0.711																																					p.S56S		Atlas-SNP	.											.	OAF	12	.	0			c.C168T						.						18.0	18.0	18.0					11																	120082155		2192	4283	6475	SO:0001819	synonymous_variant	220323	exon1			GGACAGCATCAGC	BC047726	CCDS8430.1	11q23.3	2010-11-23			ENSG00000184232	ENSG00000184232			28752	protein-coding gene	gene with protein product						12477932	Standard	NM_178507		Approved	MGC52117	uc001pxb.3	Q86UD1	OTTHUMG00000166139	ENST00000328965.4:c.168C>T	chr11.hg19:g.120082155C>T		155.0	0.0		106.0	41.0	NM_178507		Silent	SNP	ENST00000328965.4	hg19	CCDS8430.1																																																																																			.	.		0.711	OAF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388036.2	NM_178507	
OR6X1	390260	hgsc.bcm.edu	37	11	123624701	123624701	+	Missense_Mutation	SNP	A	A	G			TCGA-2Y-A9H4-01A-11D-A382-10	TCGA-2Y-A9H4-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a12a5c70-7c82-4f2b-972f-81a029234685	cc2a8833-5e36-487f-bcb8-1fcb198152ff	g.chr11:123624701A>G	ENST00000327930.2	-	1	552	c.526T>C	c.(526-528)Tac>Cac	p.Y176H		NM_001005188.1	NP_001005188.1	Q8NH79	OR6X1_HUMAN	olfactory receptor, family 6, subfamily X, member 1	176						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(3)|endometrium(3)|large_intestine(4)|lung(8)|ovary(2)|prostate(1)|skin(2)	23		Breast(109;0.0109)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0279)		ACATCACAGTAGAAATGACTG	0.512																																					p.Y176H		Atlas-SNP	.											OR6X1,NS,malignant_melanoma,0,1	OR6X1	54	.	0			c.T526C						.						89.0	91.0	90.0					11																	123624701		2202	4299	6501	SO:0001583	missense	390260	exon1			CACAGTAGAAATG	AB065510	CCDS31695.1	11q24.1	2012-08-09			ENSG00000221931	ENSG00000221931		"""GPCR / Class A : Olfactory receptors"""	14737	protein-coding gene	gene with protein product							Standard	NM_001005188		Approved		uc010rzy.2	Q8NH79	OTTHUMG00000166011	ENST00000327930.2:c.526T>C	chr11.hg19:g.123624701A>G	ENSP00000333724:p.Tyr176His	79.0	0.0		70.0	25.0	NM_001005188	B9EGW9|Q6IFA0	Missense_Mutation	SNP	ENST00000327930.2	hg19	CCDS31695.1	.	.	.	.	.	.	.	.	.	.	A	19.94	3.919282	0.73098	.	.	ENSG00000221931	ENST00000327930	T	0.00130	8.69	4.37	4.37	0.52481	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.00300	0.0009	L	0.58810	1.83	0.37683	D	0.923574	P	0.41188	0.741	P	0.52957	0.714	D	0.86616	0.1876	9	0.44086	T	0.13	-9.2246	11.6004	0.50999	1.0:0.0:0.0:0.0	.	176	Q8NH79	OR6X1_HUMAN	H	176	ENSP00000333724:Y176H	ENSP00000333724:Y176H	Y	-	1	0	OR6X1	123129911	1.000000	0.71417	0.999000	0.59377	0.961000	0.63080	8.765000	0.91724	1.845000	0.53610	0.528000	0.53228	TAC	.	.		0.512	OR6X1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387436.1	NM_001005188	
OR8D4	338662	hgsc.bcm.edu	37	11	123777184	123777184	+	Missense_Mutation	SNP	G	G	A			TCGA-2Y-A9H4-01A-11D-A382-10	TCGA-2Y-A9H4-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a12a5c70-7c82-4f2b-972f-81a029234685	cc2a8833-5e36-487f-bcb8-1fcb198152ff	g.chr11:123777184G>A	ENST00000321355.2	+	1	76	c.46G>A	c.(46-48)Gga>Aga	p.G16R		NM_001005197.1	NP_001005197.1	Q8NGM9	OR8D4_HUMAN	olfactory receptor, family 8, subfamily D, member 4	16						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			large_intestine(1)|lung(16)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	25		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.93e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0409)		TCTTCTTTCAGGATTAACTGA	0.408																																					p.G16R		Atlas-SNP	.											.	OR8D4	62	.	0			c.G46A						.						91.0	86.0	88.0					11																	123777184		2202	4299	6501	SO:0001583	missense	338662	exon1			CTTTCAGGATTAA	AB065761	CCDS31698.1	11q24.1	2012-08-09			ENSG00000181518	ENSG00000181518		"""GPCR / Class A : Olfactory receptors"""	14840	protein-coding gene	gene with protein product							Standard	NM_001005197		Approved		uc010saa.2	Q8NGM9	OTTHUMG00000165960	ENST00000321355.2:c.46G>A	chr11.hg19:g.123777184G>A	ENSP00000325381:p.Gly16Arg	55.0	0.0		56.0	22.0	NM_001005197	Q6IFE9	Missense_Mutation	SNP	ENST00000321355.2	hg19	CCDS31698.1	.	.	.	.	.	.	.	.	.	.	G	17.11	3.306476	0.60305	.	.	ENSG00000181518	ENST00000321355	T	0.00659	5.94	5.58	4.67	0.58626	.	0.000000	0.45361	D	0.000365	T	0.06325	0.0163	M	0.92122	3.275	0.32385	N	0.554106	D	0.89917	1.0	D	0.79784	0.993	T	0.03473	-1.1033	10	0.87932	D	0	.	13.3545	0.60621	0.0776:0.0:0.9224:0.0	.	16	Q8NGM9	OR8D4_HUMAN	R	16	ENSP00000325381:G16R	ENSP00000325381:G16R	G	+	1	0	OR8D4	123282394	1.000000	0.71417	0.174000	0.22961	0.948000	0.59901	5.220000	0.65267	1.344000	0.45657	-0.136000	0.14681	GGA	.	.		0.408	OR8D4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387262.1	NM_001005197	
GUCY2C	2984	hgsc.bcm.edu	37	12	14839106	14839106	+	Silent	SNP	G	G	A			TCGA-2Y-A9H4-01A-11D-A382-10	TCGA-2Y-A9H4-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a12a5c70-7c82-4f2b-972f-81a029234685	cc2a8833-5e36-487f-bcb8-1fcb198152ff	g.chr12:14839106G>A	ENST00000261170.3	-	3	520	c.384C>T	c.(382-384)acC>acT	p.T128T	RP11-174G6.1_ENST00000501178.2_RNA	NM_004963.3	NP_004954.2	P25092	GUC2C_HUMAN	guanylate cyclase 2C (heat stable enterotoxin receptor)	128					intracellular signal transduction (GO:0035556)|receptor guanylyl cyclase signaling pathway (GO:0007168)|regulation of cell proliferation (GO:0042127)|response to toxic substance (GO:0009636)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|protein kinase activity (GO:0004672)|toxic substance binding (GO:0015643)			breast(3)|endometrium(7)|kidney(3)|large_intestine(9)|lung(17)|ovary(4)|skin(7)|urinary_tract(1)	51					Linaclotide(DB08890)	ACATCTGGAAGGTGGAGTATG	0.403																																					p.T128T		Atlas-SNP	.											.	GUCY2C	126	.	0			c.C384T						.						100.0	84.0	89.0					12																	14839106		2203	4300	6503	SO:0001819	synonymous_variant	2984	exon3			CTGGAAGGTGGAG		CCDS8664.1	12p12	2008-08-18			ENSG00000070019	ENSG00000070019			4688	protein-coding gene	gene with protein product		601330		GUC2C		8661067	Standard	NM_004963		Approved	STAR	uc001rcd.3	P25092	OTTHUMG00000168732	ENST00000261170.3:c.384C>T	chr12.hg19:g.14839106G>A		83.0	0.0		67.0	28.0	NM_004963	B2RMY6	Silent	SNP	ENST00000261170.3	hg19	CCDS8664.1																																																																																			.	.		0.403	GUCY2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400835.1		
ASUN	55726	hgsc.bcm.edu	37	12	27059306	27059306	+	Silent	SNP	C	C	T			TCGA-2Y-A9H4-01A-11D-A382-10	TCGA-2Y-A9H4-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a12a5c70-7c82-4f2b-972f-81a029234685	cc2a8833-5e36-487f-bcb8-1fcb198152ff	g.chr12:27059306C>T	ENST00000261191.7	-	16	2546	c.2010G>A	c.(2008-2010)caG>caA	p.Q670Q	ASUN_ENST00000539625.1_Silent_p.Q569Q	NM_018164.2	NP_060634.2	Q9NVM9	ASUN_HUMAN	asunder spermatogenesis regulator	670					centrosome localization (GO:0051642)|mitotic nuclear division (GO:0007067)|mitotic spindle organization (GO:0007052)|protein localization to nuclear envelope (GO:0090435)|regulation of fertilization (GO:0080154)|regulation of mitotic cell cycle (GO:0007346)|sperm motility (GO:0030317)	cytoplasm (GO:0005737)|nucleus (GO:0005634)											CAGCAAATTCCTGATGTTTTC	0.338																																					p.Q670Q		Atlas-SNP	.											.	.	.	.	0			c.G2010A						.						112.0	119.0	116.0					12																	27059306		2203	4298	6501	SO:0001819	synonymous_variant	55726	exon16			AAATTCCTGATGT	AK001222	CCDS8708.1	12p12.3	2013-05-08	2013-05-08	2011-12-09	ENSG00000064102	ENSG00000064102			20174	protein-coding gene	gene with protein product	"""spermatogenesis associated 30"""	615079	"""chromosome 12 open reading frame 11"", ""asunder, spermatogenesis regulator homolog (Drosphila)"""	C12orf11		12414650, 19357193, 23097494	Standard	NM_018164		Approved	FLJ10637, NET48, Mat89Bb, SPATA30	uc001rhk.4	Q9NVM9	OTTHUMG00000169193	ENST00000261191.7:c.2010G>A	chr12.hg19:g.27059306C>T		98.0	0.0		93.0	10.0	NM_018164	B4DNK1|Q86WE2|Q96HM2|Q9BTX2|Q9NTB6|Q9NVM5	Silent	SNP	ENST00000261191.7	hg19	CCDS8708.1																																																																																			.	.		0.338	ASUN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402819.1	NM_018164	
ADAMTS20	80070	hgsc.bcm.edu	37	12	43858526	43858526	+	Nonsense_Mutation	SNP	G	G	T			TCGA-2Y-A9H4-01A-11D-A382-10	TCGA-2Y-A9H4-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a12a5c70-7c82-4f2b-972f-81a029234685	cc2a8833-5e36-487f-bcb8-1fcb198152ff	g.chr12:43858526G>T	ENST00000389420.3	-	10	1376	c.1377C>A	c.(1375-1377)taC>taA	p.Y459*	ADAMTS20_ENST00000553158.1_Nonsense_Mutation_p.Y459*	NM_025003.3	NP_079279.3	P59510	ATS20_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 20	459	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.				extracellular matrix organization (GO:0030198)|negative regulation of apoptotic process (GO:0043066)|positive regulation of melanocyte differentiation (GO:0045636)|positive regulation of signal transduction (GO:0009967)	extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(6)|endometrium(3)|kidney(4)|large_intestine(11)|liver(1)|lung(43)|ovary(4)|pancreas(3)|prostate(5)|skin(12)|upper_aerodigestive_tract(1)|urinary_tract(1)	95	all_cancers(12;2.6e-05)|Lung SC(27;0.184)	Lung NSC(34;0.0569)|all_lung(34;0.129)		GBM - Glioblastoma multiforme(48;0.0473)		GACATTCCCCGTAACCAGTAC	0.358																																					p.Y459X		Atlas-SNP	.											.	ADAMTS20	635	.	0			c.C1377A						.						67.0	63.0	64.0					12																	43858526		2203	4300	6503	SO:0001587	stop_gained	80070	exon10			TTCCCCGTAACCA	AF488804	CCDS31778.2	12q12	2005-08-19	2005-08-19			ENSG00000173157		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17178	protein-coding gene	gene with protein product		611681	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 20"""			12514189, 12562771	Standard	NM_025003		Approved	GON-1	uc010skx.2	P59510		ENST00000389420.3:c.1377C>A	chr12.hg19:g.43858526G>T	ENSP00000374071:p.Tyr459*	56.0	0.0		58.0	29.0	NM_025003	A6NNC9|J3QT00	Nonsense_Mutation	SNP	ENST00000389420.3	hg19	CCDS31778.2	.	.	.	.	.	.	.	.	.	.	g	15.52	2.857468	0.51376	.	.	ENSG00000173157	ENST00000389420;ENST00000553158;ENST00000389417	.	.	.	4.74	-1.11	0.09840	.	0.445102	0.18955	N	0.126576	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	5.541	0.17038	0.5745:0.0:0.3076:0.118	.	.	.	.	X	459	.	ENSP00000374068:Y459X	Y	-	3	2	ADAMTS20	42144793	0.999000	0.42202	0.803000	0.32268	0.076000	0.17211	0.886000	0.28241	-0.209000	0.10156	-0.435000	0.05868	TAC	.	.		0.358	ADAMTS20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403643.1	NM_025003	
ADAMTS20	80070	hgsc.bcm.edu	37	12	43858528	43858528	+	Missense_Mutation	SNP	A	A	T			TCGA-2Y-A9H4-01A-11D-A382-10	TCGA-2Y-A9H4-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a12a5c70-7c82-4f2b-972f-81a029234685	cc2a8833-5e36-487f-bcb8-1fcb198152ff	g.chr12:43858528A>T	ENST00000389420.3	-	10	1374	c.1375T>A	c.(1375-1377)Tac>Aac	p.Y459N	ADAMTS20_ENST00000553158.1_Missense_Mutation_p.Y459N	NM_025003.3	NP_079279.3	P59510	ATS20_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 20	459	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.				extracellular matrix organization (GO:0030198)|negative regulation of apoptotic process (GO:0043066)|positive regulation of melanocyte differentiation (GO:0045636)|positive regulation of signal transduction (GO:0009967)	extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(6)|endometrium(3)|kidney(4)|large_intestine(11)|liver(1)|lung(43)|ovary(4)|pancreas(3)|prostate(5)|skin(12)|upper_aerodigestive_tract(1)|urinary_tract(1)	95	all_cancers(12;2.6e-05)|Lung SC(27;0.184)	Lung NSC(34;0.0569)|all_lung(34;0.129)		GBM - Glioblastoma multiforme(48;0.0473)		CATTCCCCGTAACCAGTACTG	0.358																																					p.Y459N		Atlas-SNP	.											.	ADAMTS20	635	.	0			c.T1375A						.						65.0	61.0	63.0					12																	43858528		2203	4300	6503	SO:0001583	missense	80070	exon10			CCCCGTAACCAGT	AF488804	CCDS31778.2	12q12	2005-08-19	2005-08-19			ENSG00000173157		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17178	protein-coding gene	gene with protein product		611681	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 20"""			12514189, 12562771	Standard	NM_025003		Approved	GON-1	uc010skx.2	P59510		ENST00000389420.3:c.1375T>A	chr12.hg19:g.43858528A>T	ENSP00000374071:p.Tyr459Asn	57.0	0.0		57.0	28.0	NM_025003	A6NNC9|J3QT00	Missense_Mutation	SNP	ENST00000389420.3	hg19	CCDS31778.2	.	.	.	.	.	.	.	.	.	.	A	1.119	-0.655929	0.03480	.	.	ENSG00000173157	ENST00000389420;ENST00000553158;ENST00000389417	T;T	0.03524	3.9;3.9	4.74	0.821	0.18799	Metallopeptidase, catalytic domain (1);Peptidase M12B, ADAM/reprolysin (2);	0.445102	0.18955	N	0.126576	T	0.02156	0.0067	N	0.16201	0.385	0.80722	D	1	B	0.15719	0.014	B	0.25614	0.062	T	0.51140	-0.8743	10	0.37606	T	0.19	.	2.8819	0.05649	0.4805:0.0:0.3141:0.2054	.	459	P59510	ATS20_HUMAN	N	459	ENSP00000374071:Y459N;ENSP00000448341:Y459N	ENSP00000374068:Y459N	Y	-	1	0	ADAMTS20	42144795	1.000000	0.71417	0.666000	0.29783	0.009000	0.06853	3.621000	0.54210	0.279000	0.22186	-1.335000	0.01260	TAC	.	.		0.358	ADAMTS20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403643.1	NM_025003	
SELPLG	6404	hgsc.bcm.edu	37	12	109017847	109017847	+	Silent	SNP	C	C	T			TCGA-2Y-A9H4-01A-11D-A382-10	TCGA-2Y-A9H4-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a12a5c70-7c82-4f2b-972f-81a029234685	cc2a8833-5e36-487f-bcb8-1fcb198152ff	g.chr12:109017847C>T	ENST00000550948.1	-	2	461	c.237G>A	c.(235-237)gaG>gaA	p.E79E	SELPLG_ENST00000228463.6_Silent_p.E95E|SELPLG_ENST00000388962.3_Silent_p.E79E			Q14242	SELPL_HUMAN	selectin P ligand	79					blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cellular response to interleukin-6 (GO:0071354)|leukocyte adhesive activation (GO:0050902)|leukocyte migration (GO:0050900)|leukocyte tethering or rolling (GO:0050901)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	receptor binding (GO:0005102)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(3)|prostate(3)|skin(1)	12						CAGTGGTAGACTCAGGGGTTC	0.567																																					p.E95E		Atlas-SNP	.											.	SELPLG	138	.	0			c.G285A						.						76.0	65.0	69.0					12																	109017847		2203	4300	6503	SO:0001819	synonymous_variant	6404	exon2			GGTAGACTCAGGG		CCDS31895.1, CCDS31895.2, CCDS55881.1	12q24	2014-01-30						"""CD molecules"", ""Endogenous ligands"""	10722	protein-coding gene	gene with protein product		600738				7505206	Standard	NM_003006		Approved	PSGL-1, CD162	uc010sxe.2	Q14242		ENST00000550948.1:c.237G>A	chr12.hg19:g.109017847C>T		133.0	0.0		83.0	29.0	NM_001206609	A8K2Y0|B4DQC3|B7Z5C7|J3KMX6|Q12775|Q6GTW7|Q8N7J7	Silent	SNP	ENST00000550948.1	hg19	CCDS31895.2																																																																																			.	.		0.567	SELPLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403904.1		
SACS	26278	hgsc.bcm.edu	37	13	23910913	23910913	+	Missense_Mutation	SNP	C	C	A			TCGA-2Y-A9H4-01A-11D-A382-10	TCGA-2Y-A9H4-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a12a5c70-7c82-4f2b-972f-81a029234685	cc2a8833-5e36-487f-bcb8-1fcb198152ff	g.chr13:23910913C>A	ENST00000382292.3	-	9	7375	c.7102G>T	c.(7102-7104)Gca>Tca	p.A2368S	SACS_ENST00000402364.1_Missense_Mutation_p.A1618S|SACS_ENST00000382298.3_Missense_Mutation_p.A2368S			Q9NZJ4	SACS_HUMAN	sacsin molecular chaperone	2368					cell death (GO:0008219)|negative regulation of inclusion body assembly (GO:0090084)|protein folding (GO:0006457)	axon (GO:0030424)|cell body fiber (GO:0070852)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	chaperone binding (GO:0051087)|Hsp70 protein binding (GO:0030544)|proteasome binding (GO:0070628)			NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(54)|lung(49)|ovary(7)|pancreas(1)|prostate(4)|skin(10)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(11)	189		all_cancers(29;1.51e-22)|all_epithelial(30;7.82e-19)|all_lung(29;4.71e-18)|Lung SC(185;0.0225)|Breast(139;0.128)		all cancers(112;0.00197)|Epithelial(112;0.00854)|OV - Ovarian serous cystadenocarcinoma(117;0.0298)|Lung(94;0.189)		AGGTATGGTGCCGCCTCAAAA	0.353																																					p.A2368S		Atlas-SNP	.											.	SACS	871	.	0			c.G7102T						.						48.0	50.0	49.0					13																	23910913		2202	4299	6501	SO:0001583	missense	26278	exon10			ATGGTGCCGCCTC	AF193556	CCDS9300.2	13q11	2014-06-13	2014-01-30		ENSG00000151835	ENSG00000151835		"""Heat shock proteins / DNAJ (HSP40)"""	10519	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 138"""	604490	"""spastic ataxia of Charlevoix-Saguenay (sacsin)"""			10610707, 15057823, 21726565	Standard	NM_001278055		Approved	ARSACS, KIAA0730, DKFZp686B15167, DNAJC29, SPAX6, PPP1R138	uc001uon.3	Q9NZJ4	OTTHUMG00000016562	ENST00000382292.3:c.7102G>T	chr13.hg19:g.23910913C>A	ENSP00000371729:p.Ala2368Ser	82.0	0.0		93.0	42.0	NM_014363	O94835|Q5T9J5|Q5T9J7|Q5T9J8|Q68DF5|Q6MZR4|Q8NBF9	Missense_Mutation	SNP	ENST00000382292.3	hg19	CCDS9300.2	.	.	.	.	.	.	.	.	.	.	C	7.570	0.666480	0.14710	.	.	ENSG00000151835	ENST00000382292;ENST00000402364;ENST00000382298	D;D;D	0.92048	-2.96;-2.96;-2.96	5.84	5.84	0.93424	.	0.054520	0.64402	D	0.000001	D	0.88793	0.6533	L	0.38838	1.175	0.42463	D	0.992792	B	0.14438	0.01	B	0.08055	0.003	T	0.83113	-0.0122	10	0.25106	T	0.35	.	20.1379	0.98040	0.0:1.0:0.0:0.0	.	2368	Q9NZJ4	SACS_HUMAN	S	2368;1618;2368	ENSP00000371729:A2368S;ENSP00000385844:A1618S;ENSP00000371735:A2368S	ENSP00000371729:A2368S	A	-	1	0	SACS	22808913	1.000000	0.71417	1.000000	0.80357	0.050000	0.14768	4.643000	0.61390	2.779000	0.95612	0.655000	0.94253	GCA	.	.		0.353	SACS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044148.3	NM_014363	
NBEA	26960	hgsc.bcm.edu	37	13	35632969	35632969	+	Missense_Mutation	SNP	T	T	G			TCGA-2Y-A9H4-01A-11D-A382-10	TCGA-2Y-A9H4-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a12a5c70-7c82-4f2b-972f-81a029234685	cc2a8833-5e36-487f-bcb8-1fcb198152ff	g.chr13:35632969T>G	ENST00000400445.3	+	8	1742	c.1208T>G	c.(1207-1209)tTt>tGt	p.F403C	NBEA_ENST00000540320.1_Missense_Mutation_p.F403C|NBEA_ENST00000310336.4_Missense_Mutation_p.F403C|NBEA_ENST00000379939.2_Missense_Mutation_p.F403C	NM_015678.4	NP_056493.3	Q8NFP9	NBEA_HUMAN	neurobeachin	403					protein localization (GO:0008104)	cytosol (GO:0005829)|endomembrane system (GO:0012505)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)				NS(1)|breast(1)|endometrium(14)|kidney(4)|large_intestine(29)|lung(40)|ovary(9)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	108		Breast(139;0.0141)|Lung SC(185;0.0548)|Prostate(109;0.207)		all cancers(112;1.93e-08)|Epithelial(112;1.62e-07)|BRCA - Breast invasive adenocarcinoma(63;0.00033)|OV - Ovarian serous cystadenocarcinoma(117;0.00109)|KIRC - Kidney renal clear cell carcinoma(186;0.00575)|Kidney(163;0.00656)|GBM - Glioblastoma multiforme(144;0.191)|Lung(94;0.199)		GCACAGATATTTGCAATTCAT	0.358																																					p.F403C		Atlas-SNP	.											.	NBEA	340	.	0			c.T1208G						.						38.0	34.0	35.0					13																	35632969		1814	4070	5884	SO:0001583	missense	26960	exon8			AGATATTTGCAAT	AF467288	CCDS45026.1, CCDS55894.1	13q13	2014-09-17			ENSG00000172915	ENSG00000172915		"""A-kinase anchor proteins"", ""WD repeat domain containing"""	7648	protein-coding gene	gene with protein product		604889				10501977	Standard	NM_015678		Approved	KIAA1544, BCL8B, FLJ10197	uc021ric.1	Q8NFP9	OTTHUMG00000016724	ENST00000400445.3:c.1208T>G	chr13.hg19:g.35632969T>G	ENSP00000383295:p.Phe403Cys	295.0	1.0		345.0	134.0	NM_015678	B7Z2H9|Q5T320|Q9HCM8|Q9NSU1|Q9NW98|Q9Y6J1	Missense_Mutation	SNP	ENST00000400445.3	hg19	CCDS45026.1	.	.	.	.	.	.	.	.	.	.	T	16.70	3.197130	0.58126	.	.	ENSG00000172915	ENST00000540320;ENST00000400445;ENST00000379939;ENST00000310336	T;T;T;T	0.65916	-0.18;-0.18;-0.18;-0.18	5.23	5.23	0.72850	.	0.000000	0.85682	D	0.000000	T	0.62490	0.2432	N	0.08118	0	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.68941	-0.5276	10	0.45353	T	0.12	.	15.4109	0.74917	0.0:0.0:0.0:1.0	.	403	Q5T321	.	C	403	ENSP00000440951:F403C;ENSP00000383295:F403C;ENSP00000369271:F403C;ENSP00000308534:F403C	ENSP00000308534:F403C	F	+	2	0	NBEA	34530969	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.188000	0.72045	2.111000	0.64477	0.528000	0.53228	TTT	.	.		0.358	NBEA-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_015678	
NBEA	26960	hgsc.bcm.edu	37	13	36180583	36180583	+	Silent	SNP	C	C	T			TCGA-2Y-A9H4-01A-11D-A382-10	TCGA-2Y-A9H4-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a12a5c70-7c82-4f2b-972f-81a029234685	cc2a8833-5e36-487f-bcb8-1fcb198152ff	g.chr13:36180583C>T	ENST00000400445.3	+	48	7851	c.7317C>T	c.(7315-7317)taC>taT	p.Y2439Y	NBEA_ENST00000379922.3_5'UTR|NBEA_ENST00000537702.1_Silent_p.Y232Y|NBEA_ENST00000540320.1_Silent_p.Y2439Y|NBEA_ENST00000310336.4_Silent_p.Y2439Y|NBEA_ENST00000379939.2_Silent_p.Y2436Y	NM_015678.4	NP_056493.3	Q8NFP9	NBEA_HUMAN	neurobeachin	2439	BEACH. {ECO:0000255|PROSITE- ProRule:PRU00026, ECO:0000305}.				protein localization (GO:0008104)	cytosol (GO:0005829)|endomembrane system (GO:0012505)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)				NS(1)|breast(1)|endometrium(14)|kidney(4)|large_intestine(29)|lung(40)|ovary(9)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	108		Breast(139;0.0141)|Lung SC(185;0.0548)|Prostate(109;0.207)		all cancers(112;1.93e-08)|Epithelial(112;1.62e-07)|BRCA - Breast invasive adenocarcinoma(63;0.00033)|OV - Ovarian serous cystadenocarcinoma(117;0.00109)|KIRC - Kidney renal clear cell carcinoma(186;0.00575)|Kidney(163;0.00656)|GBM - Glioblastoma multiforme(144;0.191)|Lung(94;0.199)		CAGAGTTCTACTACCTACCAG	0.313																																					p.Y2439Y		Atlas-SNP	.											.	NBEA	340	.	0			c.C7317T						.						94.0	87.0	89.0					13																	36180583		1842	4105	5947	SO:0001819	synonymous_variant	26960	exon48			GTTCTACTACCTA	AF467288	CCDS45026.1, CCDS55894.1	13q13	2014-09-17			ENSG00000172915	ENSG00000172915		"""A-kinase anchor proteins"", ""WD repeat domain containing"""	7648	protein-coding gene	gene with protein product		604889				10501977	Standard	NM_015678		Approved	KIAA1544, BCL8B, FLJ10197	uc021ric.1	Q8NFP9	OTTHUMG00000016724	ENST00000400445.3:c.7317C>T	chr13.hg19:g.36180583C>T		107.0	0.0		108.0	41.0	NM_015678	B7Z2H9|Q5T320|Q9HCM8|Q9NSU1|Q9NW98|Q9Y6J1	Silent	SNP	ENST00000400445.3	hg19	CCDS45026.1																																																																																			.	.		0.313	NBEA-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_015678	
Unknown	0	hgsc.bcm.edu	37	13	103402336	103402336	+	IGR	SNP	G	G	A			TCGA-2Y-A9H4-01A-11D-A382-10	TCGA-2Y-A9H4-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a12a5c70-7c82-4f2b-972f-81a029234685	cc2a8833-5e36-487f-bcb8-1fcb198152ff	g.chr13:103402336G>A								LINC00283 (4762 upstream) : TEX30 (16003 downstream)																							GAAATAAGTGGGCAAGAGGGC	0.363																																					p.A237A		Atlas-SNP	.											.	.	.	.	0			c.C711T						.						50.0	41.0	44.0					13																	103402336		692	1591	2283	SO:0001628	intergenic_variant	643677	exon4			TAAGTGGGCAAGA																													chr13.hg19:g.103402336G>A		60.0	0.0		69.0	11.0	NM_001146197		Silent	SNP		hg19																																																																																				.	.	0	0.363								
SAMD4A	23034	hgsc.bcm.edu	37	14	55034783	55034783	+	Missense_Mutation	SNP	C	C	G			TCGA-2Y-A9H4-01A-11D-A382-10	TCGA-2Y-A9H4-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a12a5c70-7c82-4f2b-972f-81a029234685	cc2a8833-5e36-487f-bcb8-1fcb198152ff	g.chr14:55034783C>G	ENST00000554335.1	+	2	812	c.149C>G	c.(148-150)gCc>gGc	p.A50G	SAMD4A_ENST00000251091.5_Missense_Mutation_p.A50G|SAMD4A_ENST00000357634.3_Missense_Mutation_p.A49G|SAMD4A_ENST00000392067.3_Missense_Mutation_p.A50G|SAMD4A_ENST00000555112.1_3'UTR			Q9UPU9	SMAG1_HUMAN	sterile alpha motif domain containing 4A	50					negative regulation of translation (GO:0017148)|positive regulation of translation (GO:0045727)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|neuron projection (GO:0043005)|synapse (GO:0045202)	poly(A) RNA binding (GO:0044822)|translation repressor activity (GO:0030371)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(9)|lung(10)|prostate(1)|skin(1)	29						CACTCGCTGGCCGACTGCGCC	0.711																																					p.A50G		Atlas-SNP	.											.	SAMD4A	68	.	0			c.C149G						.						21.0	21.0	21.0					14																	55034783		2199	4299	6498	SO:0001583	missense	23034	exon1			CGCTGGCCGACTG	AB028976	CCDS32084.1, CCDS55917.1, CCDS55918.1, CCDS32084.2, CCDS55917.2	14q22.2	2013-01-10	2006-01-27	2006-01-27	ENSG00000020577	ENSG00000020577		"""Sterile alpha motif (SAM) domain containing"""	23023	protein-coding gene	gene with protein product	"""smaug homolog (Drosophila)"""	610747	"""sterile alpha motif domain containing 4"""	SAMD4		16221671	Standard	NM_001161577		Approved	KIAA1053, DKFZP434H0350, Smaug, SMG, SMGA, hSmaug1	uc001xbb.4	Q9UPU9	OTTHUMG00000170999	ENST00000554335.1:c.149C>G	chr14.hg19:g.55034783C>G	ENSP00000452535:p.Ala50Gly	23.0	0.0		13.0	5.0	NM_015589	A8MPZ5|Q0VA96|Q6PEW4	Missense_Mutation	SNP	ENST00000554335.1	hg19	CCDS32084.2	.	.	.	.	.	.	.	.	.	.	C	24.3	4.517723	0.85495	.	.	ENSG00000020577	ENST00000554335;ENST00000392067;ENST00000305831;ENST00000251091;ENST00000357634	T;T;T	0.74421	-0.84;-0.84;-0.84	5.4	4.45	0.53987	.	0.072472	0.52532	D	0.000071	T	0.78923	0.4360	L	0.52759	1.655	0.27234	N	0.959326	D;P	0.62365	0.991;0.759	D;B	0.67103	0.949;0.186	T	0.69573	-0.5109	10	0.45353	T	0.12	-12.012	8.4758	0.33012	0.1543:0.7688:0.0:0.0768	.	50;50	Q9UPU9-3;Q9UPU9	.;SMAG1_HUMAN	G	50;50;50;49;49	ENSP00000452535:A50G;ENSP00000375919:A50G;ENSP00000350261:A49G	ENSP00000306381:A50G	A	+	2	0	SAMD4A	54104533	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	4.720000	0.61944	2.531000	0.85337	0.542000	0.68232	GCC	.	.		0.711	SAMD4A-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000411186.1	NM_015589	
DAAM1	23002	hgsc.bcm.edu	37	14	59835462	59835462	+	Missense_Mutation	SNP	G	G	A			TCGA-2Y-A9H4-01A-11D-A382-10	TCGA-2Y-A9H4-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a12a5c70-7c82-4f2b-972f-81a029234685	cc2a8833-5e36-487f-bcb8-1fcb198152ff	g.chr14:59835462G>A	ENST00000395125.1	+	25	3145	c.3122G>A	c.(3121-3123)cGc>cAc	p.R1041H	DAAM1_ENST00000360909.3_Missense_Mutation_p.R1031H|DAAM1_ENST00000553966.1_3'UTR|DAAM1_ENST00000351081.1_Missense_Mutation_p.R1041H	NM_014992.2	NP_055807.1	Q9Y4D1	DAAM1_HUMAN	dishevelled associated activator of morphogenesis 1	1041	DAD. {ECO:0000255|PROSITE- ProRule:PRU00577}.				actin cytoskeleton organization (GO:0030036)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|plasma membrane (GO:0005886)|stress fiber (GO:0001725)	identical protein binding (GO:0042802)			breast(3)|cervix(3)|endometrium(5)|kidney(5)|large_intestine(4)|lung(7)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(4)|urinary_tract(1)	37				OV - Ovarian serous cystadenocarcinoma(108;0.165)		TCAGCTTTACGCTCAGGAGAA	0.413																																					p.R1041H		Atlas-SNP	.											.	DAAM1	95	.	0			c.G3122A						.						125.0	118.0	120.0					14																	59835462		2203	4300	6503	SO:0001583	missense	23002	exon25			CTTTACGCTCAGG	AB014566	CCDS9737.1, CCDS58323.1	14q22.3	2008-08-11			ENSG00000100592	ENSG00000100592			18142	protein-coding gene	gene with protein product		606626				11779461, 18162551	Standard	NM_014992		Approved	KIAA0666	uc031qou.1	Q9Y4D1	OTTHUMG00000140326	ENST00000395125.1:c.3122G>A	chr14.hg19:g.59835462G>A	ENSP00000378557:p.Arg1041His	146.0	0.0		166.0	65.0	NM_014992	Q86U34|Q8N1Z8|Q8TB39	Missense_Mutation	SNP	ENST00000395125.1	hg19	CCDS9737.1	.	.	.	.	.	.	.	.	.	.	G	28.0	4.882217	0.91740	.	.	ENSG00000100592	ENST00000360909;ENST00000351081;ENST00000395125	D;D;D	0.82433	-1.61;-1.61;-1.61	5.64	5.64	0.86602	Actin-binding FH2/DRF autoregulatory (1);Diaphanous autoregulatory (1);	0.050738	0.85682	N	0.000000	D	0.91382	0.7281	M	0.74258	2.255	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.995	D	0.91773	0.5429	10	0.87932	D	0	.	19.7154	0.96115	0.0:0.0:1.0:0.0	.	1031;1041	Q9Y4D1-2;Q9Y4D1	.;DAAM1_HUMAN	H	1031;1041;1041	ENSP00000354162:R1031H;ENSP00000247170:R1041H;ENSP00000378557:R1041H	ENSP00000247170:R1041H	R	+	2	0	DAAM1	58905215	1.000000	0.71417	0.999000	0.59377	0.995000	0.86356	9.807000	0.99171	2.664000	0.90586	0.655000	0.94253	CGC	.	.		0.413	DAAM1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000276942.2	NM_014992	
VRTN	55237	hgsc.bcm.edu	37	14	74823991	74823991	+	Missense_Mutation	SNP	A	A	T			TCGA-2Y-A9H4-01A-11D-A382-10	TCGA-2Y-A9H4-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a12a5c70-7c82-4f2b-972f-81a029234685	cc2a8833-5e36-487f-bcb8-1fcb198152ff	g.chr14:74823991A>T	ENST00000256362.4	+	2	746	c.505A>T	c.(505-507)Agc>Tgc	p.S169C		NM_018228.2	NP_060698.2	Q9H8Y1	VRTN_HUMAN	vertebrae development associated	169					transposition, DNA-mediated (GO:0006313)		sequence-specific DNA binding (GO:0043565)|transposase activity (GO:0004803)			NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(15)|ovary(5)|prostate(2)|skin(1)|urinary_tract(1)	41						TTTCCCCAGCAGCTTCTCCAA	0.597																																					p.S169C		Atlas-SNP	.											.	VRTN	79	.	0			c.A505T						.						117.0	110.0	113.0					14																	74823991		2203	4300	6503	SO:0001583	missense	55237	exon2			CCCAGCAGCTTCT	AK001673	CCDS9830.1	14q24.2	2012-12-07	2012-12-07	2010-10-20	ENSG00000133980	ENSG00000133980			20223	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 115"", ""vertebrae development homolog (pig)"""	C14orf115		21232157	Standard	NM_018228		Approved	FLJ10811, vertnin	uc001xpw.4	Q9H8Y1	OTTHUMG00000171208	ENST00000256362.4:c.505A>T	chr14.hg19:g.74823991A>T	ENSP00000256362:p.Ser169Cys	39.0	0.0		23.0	15.0	NM_018228	Q9NVC7	Missense_Mutation	SNP	ENST00000256362.4	hg19	CCDS9830.1	.	.	.	.	.	.	.	.	.	.	A	14.18	2.459296	0.43634	.	.	ENSG00000133980	ENST00000256362	T	0.47177	0.85	5.05	5.05	0.67936	.	0.138925	0.50627	D	0.000107	T	0.54013	0.1832	L	0.27053	0.805	0.45250	D	0.998253	D	0.89917	1.0	D	0.67231	0.95	T	0.58994	-0.7537	10	0.87932	D	0	-0.5668	13.4994	0.61445	1.0:0.0:0.0:0.0	.	169	Q9H8Y1	VRTN_HUMAN	C	169	ENSP00000256362:S169C	ENSP00000256362:S169C	S	+	1	0	VRTN	73893744	1.000000	0.71417	0.975000	0.42487	0.099000	0.18886	4.098000	0.57748	2.123000	0.65237	0.459000	0.35465	AGC	.	.		0.597	VRTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412339.1	NM_018228	
RYR3	6263	hgsc.bcm.edu	37	15	33765670	33765670	+	Missense_Mutation	SNP	G	G	T			TCGA-2Y-A9H4-01A-11D-A382-10	TCGA-2Y-A9H4-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a12a5c70-7c82-4f2b-972f-81a029234685	cc2a8833-5e36-487f-bcb8-1fcb198152ff	g.chr15:33765670G>T	ENST00000389232.4	+	2	172	c.102G>T	c.(100-102)agG>agT	p.R34S	RYR3_ENST00000415757.3_Missense_Mutation_p.R34S	NM_001036.3	NP_001027.3	Q15413	RYR3_HUMAN	ryanodine receptor 3	34					calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cellular response to ATP (GO:0071318)|cellular response to caffeine (GO:0071313)|cellular response to calcium ion (GO:0071277)|cellular response to magnesium ion (GO:0071286)|ion transmembrane transport (GO:0034220)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|protein homotetramerization (GO:0051289)|striated muscle contraction (GO:0006941)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|ryanodine-sensitive calcium-release channel activity (GO:0005219)			NS(3)|breast(9)|central_nervous_system(8)|cervix(2)|endometrium(29)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(55)|lung(148)|ovary(7)|pancreas(1)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(3)	311		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		AGGAGCAGAGGAAGTTCTGCC	0.547																																					p.R34S		Atlas-SNP	.											.	RYR3	760	.	0			c.G102T						.						102.0	106.0	104.0					15																	33765670		2091	4211	6302	SO:0001583	missense	6263	exon2			GCAGAGGAAGTTC		CCDS45210.1, CCDS58351.1	15q14-q15	2013-01-10				ENSG00000198838		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10485	protein-coding gene	gene with protein product		180903				8276408	Standard	NM_001036		Approved		uc001zhi.3	Q15413		ENST00000389232.4:c.102G>T	chr15.hg19:g.33765670G>T	ENSP00000373884:p.Arg34Ser	47.0	0.0		56.0	16.0	NM_001243996	O15175|Q15412	Missense_Mutation	SNP	ENST00000389232.4	hg19	CCDS45210.1	.	.	.	.	.	.	.	.	.	.	G	10.53	1.375900	0.24857	.	.	ENSG00000198838	ENST00000389232;ENST00000415757;ENST00000361728	D;D	0.96334	-3.98;-3.98	4.86	0.365	0.16131	Inositol 1,4,5-trisphosphate/ryanodine receptor (1);	0.000000	0.85682	D	0.000000	D	0.95478	0.8531	L	0.46157	1.445	0.45087	D	0.998101	D;D	0.63880	0.981;0.993	D;P	0.69142	0.962;0.874	D	0.91887	0.5520	10	0.46703	T	0.11	.	3.7773	0.08665	0.3096:0.3915:0.2989:0.0	.	34;34	Q15413-2;Q15413	.;RYR3_HUMAN	S	34	ENSP00000373884:R34S;ENSP00000399610:R34S	ENSP00000354735:R34S	R	+	3	2	RYR3	31552962	1.000000	0.71417	0.963000	0.40424	0.953000	0.61014	1.441000	0.35035	0.210000	0.20664	0.650000	0.86243	AGG	.	.		0.547	RYR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000417514.1		
EIF2AK4	440275	hgsc.bcm.edu	37	15	40259627	40259627	+	Missense_Mutation	SNP	A	A	G			TCGA-2Y-A9H4-01A-11D-A382-10	TCGA-2Y-A9H4-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a12a5c70-7c82-4f2b-972f-81a029234685	cc2a8833-5e36-487f-bcb8-1fcb198152ff	g.chr15:40259627A>G	ENST00000263791.5	+	9	1143	c.1100A>G	c.(1099-1101)aAa>aGa	p.K367R	EIF2AK4_ENST00000559624.1_Missense_Mutation_p.K367R|EIF2AK4_ENST00000382727.2_Missense_Mutation_p.K367R	NM_001013703.2	NP_001013725.2	Q9P2K8	E2AK4_HUMAN	eukaryotic translation initiation factor 2 alpha kinase 4	367	Protein kinase 1. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cellular response to starvation (GO:0009267)|endoplasmic reticulum unfolded protein response (GO:0030968)|negative regulation of translation (GO:0017148)|protein phosphorylation (GO:0006468)|regulation of translational initiation (GO:0006446)|regulation of translational initiation in response to stress (GO:0043558)	cytosolic ribosome (GO:0022626)	ATP binding (GO:0005524)|eukaryotic translation initiation factor 2alpha kinase activity (GO:0004694)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(2)|endometrium(1)|kidney(3)|large_intestine(8)|lung(18)|ovary(1)|prostate(3)|skin(2)|stomach(1)	40		all_cancers(109;1.05e-19)|all_epithelial(112;4.38e-17)|Lung NSC(122;1.09e-12)|all_lung(180;3.56e-11)|Melanoma(134;0.0575)|Ovarian(310;0.0826)|Colorectal(260;0.119)		GBM - Glioblastoma multiforme(113;5.31e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0616)		ATGAATCTCAAAGAGCAAGAC	0.443																																					p.K367R		Atlas-SNP	.											.	EIF2AK4	107	.	0			c.A1100G						.						84.0	82.0	83.0					15																	40259627		1951	4148	6099	SO:0001583	missense	440275	exon9			ATCTCAAAGAGCA	AB037759	CCDS42016.1	15q13.3	2008-08-18				ENSG00000128829			19687	protein-coding gene	gene with protein product		609280				10504407	Standard	XM_005254392		Approved	GCN2, KIAA1338	uc001zkm.1	Q9P2K8		ENST00000263791.5:c.1100A>G	chr15.hg19:g.40259627A>G	ENSP00000263791:p.Lys367Arg	177.0	0.0		170.0	36.0	NM_001013703	C9JEC4|Q69YL7|Q6DC97|Q96GN6|Q9H5K1|Q9NSQ3|Q9NSZ5|Q9UJ56	Missense_Mutation	SNP	ENST00000263791.5	hg19	CCDS42016.1	.	.	.	.	.	.	.	.	.	.	A	5.638	0.302373	0.10678	.	.	ENSG00000128829	ENST00000263791;ENST00000382727	T;T	0.64803	-0.12;-0.12	5.36	-2.23	0.06930	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.725269	0.13509	N	0.382622	T	0.39118	0.1066	N	0.12920	0.275	0.20563	N	0.999887	B;B	0.06786	0.0;0.001	B;B	0.11329	0.006;0.001	T	0.24548	-1.0157	10	0.17369	T	0.5	-5.5525	11.8436	0.52368	0.5416:0.0:0.4584:0.0	.	367;367	Q9P2K8;Q9P2K8-3	E2AK4_HUMAN;.	R	367	ENSP00000263791:K367R;ENSP00000372174:K367R	ENSP00000263791:K367R	K	+	2	0	EIF2AK4	38046919	0.041000	0.20044	0.872000	0.34217	0.870000	0.49936	-0.040000	0.12104	-0.230000	0.09840	-0.274000	0.10170	AAA	.	.		0.443	EIF2AK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418395.1		
SPESP1	246777	hgsc.bcm.edu	37	15	69238044	69238044	+	Silent	SNP	A	A	G			TCGA-2Y-A9H4-01A-11D-A382-10	TCGA-2Y-A9H4-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a12a5c70-7c82-4f2b-972f-81a029234685	cc2a8833-5e36-487f-bcb8-1fcb198152ff	g.chr15:69238044A>G	ENST00000310673.3	+	2	325	c.171A>G	c.(169-171)aaA>aaG	p.K57K	NOX5_ENST00000260364.5_Intron|RP11-809H16.2_ENST00000557966.1_RNA|SPESP1_ENST00000560188.1_3'UTR|NOX5_ENST00000455873.3_Intron|NOX5_ENST00000448182.3_Intron	NM_145658.3	NP_663633.1	Q6UW49	SPESP_HUMAN	sperm equatorial segment protein 1	57					acrosome reaction (GO:0007340)|fusion of sperm to egg plasma membrane (GO:0007342)|multicellular organismal development (GO:0007275)	acrosomal vesicle (GO:0001669)				breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(11)|prostate(1)|skin(1)|urinary_tract(1)	19						GTGAGAAAAAATCTAACTCTC	0.378																																					p.K57K		Atlas-SNP	.											.	SPESP1	39	.	0			c.A171G						.						105.0	108.0	107.0					15																	69238044		2200	4298	6498	SO:0001819	synonymous_variant	246777	exon2			GAAAAAATCTAAC	AF275321	CCDS10230.1	15q22.31	2011-04-15				ENSG00000258484			15570	protein-coding gene	gene with protein product		609399				12773409	Standard	NM_145658		Approved	SP-ESP	uc002arn.2	Q6UW49		ENST00000310673.3:c.171A>G	chr15.hg19:g.69238044A>G		213.0	0.0		212.0	84.0	NM_145658	Q8NG22|Q8WVH8	Silent	SNP	ENST00000310673.3	hg19	CCDS10230.1																																																																																			.	.		0.378	SPESP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257125.1	NM_145658	
RHBDL1	9028	hgsc.bcm.edu	37	16	727559	727559	+	Splice_Site	SNP	G	G	T			TCGA-2Y-A9H4-01A-11D-A382-10	TCGA-2Y-A9H4-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a12a5c70-7c82-4f2b-972f-81a029234685	cc2a8833-5e36-487f-bcb8-1fcb198152ff	g.chr16:727559G>T	ENST00000219551.2	+	5	1011	c.984G>T	c.(982-984)atG>atT	p.M328I	LA16c-313D11.9_ENST00000571933.1_RNA|STUB1_ENST00000219548.4_5'Flank|LA16c-313D11.9_ENST00000567091.1_RNA|RHBDL1_ENST00000352681.3_Splice_Site_p.M263I|STUB1_ENST00000565677.1_5'Flank			O75783	RHBL1_HUMAN	rhomboid, veinlet-like 1 (Drosophila)	328					signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|serine-type endopeptidase activity (GO:0004252)			endometrium(1)|kidney(1)|lung(4)|urinary_tract(3)	9		Hepatocellular(780;0.0218)				ACGTTGTCATGGTAACGGGCC	0.672																																					p.M328I		Atlas-SNP	.											.	RHBDL1	14	.	0			c.G984T						.						27.0	29.0	29.0					16																	727559		2190	4294	6484	SO:0001630	splice_region_variant	9028	exon5			TGTCATGGTAACG	Y17108	CCDS61779.1	16p13.3	2008-02-05	2001-11-28	2003-04-11	ENSG00000103269	ENSG00000103269			10007	protein-coding gene	gene with protein product		603264	"""rhomboid (veinlet, Drosophila)-like"""	RHBDL		9662444	Standard	NM_001278720		Approved	RRP	uc002cis.1	O75783	OTTHUMG00000121141	ENST00000219551.2:c.984+1G>T	chr16.hg19:g.727559G>T		46.0	0.0		40.0	16.0	NM_003961	A2IDC0|A2IDC1|Q0VAX4|Q9NQ85	Missense_Mutation	SNP	ENST00000219551.2	hg19	CCDS10418.1	.	.	.	.	.	.	.	.	.	.	G	16.61	3.172607	0.57584	.	.	ENSG00000103269	ENST00000352681;ENST00000450775;ENST00000219551	T;T	0.11063	2.81;2.81	4.16	4.16	0.48862	Peptidase S54, rhomboid domain (1);	0.000000	0.85682	D	0.000000	T	0.23926	0.0579	L	0.39147	1.195	0.80722	D	1	D;P;D	0.57571	0.98;0.943;0.961	D;D;P	0.75020	0.985;0.93;0.794	T	0.01252	-1.1405	10	0.51188	T	0.08	-28.0367	15.0314	0.71710	0.0:0.0:1.0:0.0	.	263;328;263	B4DFK3;O75783;O75783-2	.;RHBL1_HUMAN;.	I	263;263;328	ENSP00000344206:M263I;ENSP00000219551:M328I	ENSP00000219551:M328I	M	+	3	0	RHBDL1	667560	1.000000	0.71417	1.000000	0.80357	0.952000	0.60782	8.935000	0.92923	1.875000	0.54330	0.561000	0.74099	ATG	.	.		0.672	RHBDL1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000241619.1	NM_003961	Missense_Mutation
OTOA	146183	hgsc.bcm.edu	37	16	21739616	21739616	+	Missense_Mutation	SNP	C	C	T			TCGA-2Y-A9H4-01A-11D-A382-10	TCGA-2Y-A9H4-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a12a5c70-7c82-4f2b-972f-81a029234685	cc2a8833-5e36-487f-bcb8-1fcb198152ff	g.chr16:21739616C>T	ENST00000286149.4	+	19	2114	c.2113C>T	c.(2113-2115)Cac>Tac	p.H705Y	OTOA_ENST00000388957.3_Missense_Mutation_p.H367Y|OTOA_ENST00000388956.4_Missense_Mutation_p.H612Y|OTOA_ENST00000388958.3_Missense_Mutation_p.H691Y			Q7RTW8	OTOAN_HUMAN	otoancorin	705					cell-matrix adhesion (GO:0007160)|sensory perception of sound (GO:0007605)|transmission of nerve impulse (GO:0019226)	anchored component of membrane (GO:0031225)|apical plasma membrane (GO:0016324)|proteinaceous extracellular matrix (GO:0005578)				breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(9)|liver(2)|lung(23)|ovary(1)|prostate(1)|skin(5)|stomach(1)	46				GBM - Glioblastoma multiforme(48;0.0414)		CCTGCTGTGTCACTTGCCGGC	0.562																																					p.H691Y		Atlas-SNP	.											.	OTOA	144	.	0			c.C2071T						.						107.0	90.0	95.0					16																	21739616		2198	4300	6498	SO:0001583	missense	146183	exon19			CTGTGTCACTTGC	AK057335	CCDS10600.2, CCDS32403.1, CCDS53994.1	16p12.2	2009-08-18	2002-07-05		ENSG00000155719	ENSG00000155719			16378	protein-coding gene	gene with protein product	"""cancer/testis antigen 108"""	607038	"""deafness, autosomal recessive 22"""	DFNB22		11972037, 19088187	Standard	NM_170664		Approved	CT108	uc002djh.3	Q7RTW8	OTTHUMG00000090721	ENST00000286149.4:c.2113C>T	chr16.hg19:g.21739616C>T	ENSP00000286149:p.His705Tyr	97.0	0.0		72.0	23.0	NM_144672	A1L3A8|A2VDI0|B3KWU3|E9PF51|Q8NA86|Q96M76	Missense_Mutation	SNP	ENST00000286149.4	hg19		.	.	.	.	.	.	.	.	.	.	C	15.98	2.993706	0.54041	.	.	ENSG00000155719	ENST00000388958;ENST00000286149;ENST00000388956;ENST00000388957;ENST00000338456	T;T;T;T	0.66099	-0.19;-0.19;-0.18;-0.17	5.29	5.29	0.74685	.	0.062767	0.64402	D	0.000007	T	0.75729	0.3889	M	0.68952	2.095	0.43683	D	0.996122	D;D;D;D	0.89917	1.0;1.0;0.998;1.0	D;D;D;D	0.91635	0.999;0.999;0.978;0.999	T	0.72855	-0.4166	10	0.28530	T	0.3	-15.9596	14.4211	0.67183	0.0:1.0:0.0:0.0	.	705;612;367;691	Q7RTW8;B3KWU3;Q7RTW8-2;E9PF51	OTOAN_HUMAN;.;.;.	Y	691;705;612;367;100	ENSP00000373610:H691Y;ENSP00000286149:H705Y;ENSP00000373608:H612Y;ENSP00000373609:H367Y	ENSP00000286149:H705Y	H	+	1	0	OTOA	21647117	1.000000	0.71417	0.998000	0.56505	0.324000	0.28378	4.184000	0.58323	2.457000	0.83068	0.655000	0.94253	CAC	.	.		0.562	OTOA-003	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000430021.1		
MED24	9862	hgsc.bcm.edu	37	17	38186019	38186019	+	Silent	SNP	A	A	G			TCGA-2Y-A9H4-01A-11D-A382-10	TCGA-2Y-A9H4-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a12a5c70-7c82-4f2b-972f-81a029234685	cc2a8833-5e36-487f-bcb8-1fcb198152ff	g.chr17:38186019A>G	ENST00000394128.2	-	13	1329	c.1248T>C	c.(1246-1248)acT>acC	p.T416T	MED24_ENST00000394126.1_Silent_p.T441T|MED24_ENST00000394127.2_Silent_p.T403T|MED24_ENST00000501516.3_Silent_p.T435T|SNORD124_ENST00000459577.1_RNA|MED24_ENST00000356271.3_Silent_p.T403T	NM_014815.3	NP_055630.2	O75448	MED24_HUMAN	mediator complex subunit 24	416					androgen receptor signaling pathway (GO:0030521)|gene expression (GO:0010467)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|positive regulation of transcription, DNA-templated (GO:0045893)|protein heterooligomerization (GO:0051291)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	histone acetyltransferase activity (GO:0004402)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|receptor activity (GO:0004872)|RNA polymerase II transcription cofactor activity (GO:0001104)|thyroid hormone receptor binding (GO:0046966)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)			autonomic_ganglia(1)|breast(2)|endometrium(9)|large_intestine(10)|lung(14)|ovary(1)|prostate(2)|skin(1)|urinary_tract(1)	41	Colorectal(19;0.000442)					TGTTTGTGACAGTGGGCTCCG	0.547																																					p.T416T		Atlas-SNP	.											.	MED24	89	.	0			c.T1248C						.						203.0	161.0	175.0					17																	38186019		2203	4300	6503	SO:0001819	synonymous_variant	9862	exon13			TGTGACAGTGGGC	AF055995	CCDS11359.1, CCDS42315.1	17q21.2	2007-07-30	2007-07-30	2007-07-30	ENSG00000008838	ENSG00000008838			22963	protein-coding gene	gene with protein product		607000	"""thyroid hormone receptor associated protein 4"", ""cofactor required for Sp1 transcriptional activation, subunit 4, 100kDa"""	THRAP4, CRSP4			Standard	NM_001079518		Approved	TRAP100, KIAA0130, DRIP100, CRSP100	uc002htt.3	O75448	OTTHUMG00000133329	ENST00000394128.2:c.1248T>C	chr17.hg19:g.38186019A>G		86.0	0.0		66.0	30.0	NM_014815	A8K4S5|B3KMR9|Q14143|Q9NNY5	Silent	SNP	ENST00000394128.2	hg19	CCDS11359.1																																																																																			.	.		0.547	MED24-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257147.2	NM_014815	
RNMT	8731	hgsc.bcm.edu	37	18	13741655	13741655	+	Nonsense_Mutation	SNP	T	T	A			TCGA-2Y-A9H4-01A-11D-A382-10	TCGA-2Y-A9H4-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a12a5c70-7c82-4f2b-972f-81a029234685	cc2a8833-5e36-487f-bcb8-1fcb198152ff	g.chr18:13741655T>A	ENST00000383314.2	+	7	1179	c.939T>A	c.(937-939)taT>taA	p.Y313*	RNMT_ENST00000535051.1_Nonsense_Mutation_p.Y71*|RNMT_ENST00000592764.1_Nonsense_Mutation_p.Y313*|RNMT_ENST00000589866.1_Nonsense_Mutation_p.Y313*|RNMT_ENST00000543302.2_Nonsense_Mutation_p.Y313*|RNMT_ENST00000262173.3_Nonsense_Mutation_p.Y313*			O43148	MCES_HUMAN	RNA (guanine-7-) methyltransferase	313	mRNA cap 0 methyltransferase. {ECO:0000255|PROSITE-ProRule:PRU00895}.				7-methylguanosine mRNA capping (GO:0006370)|gene expression (GO:0010467)|RNA (guanine-N7)-methylation (GO:0036265)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	mRNA cap binding complex (GO:0005845)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|receptor complex (GO:0043235)	mRNA (guanine-N7-)-methyltransferase activity (GO:0004482)|RNA binding (GO:0003723)			central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(7)|skin(2)	18						CTGGGGGCTATTTTATTGGTA	0.363																																					p.Y313X	GBM(29;474 594 19092 36647 41529)	Atlas-SNP	.											.	RNMT	42	.	0			c.T939A						.						97.0	98.0	98.0					18																	13741655		2203	4300	6503	SO:0001587	stop_gained	8731	exon7			GGGCTATTTTATT	AF067791	CCDS11867.1	18p11.21	2008-05-14			ENSG00000101654	ENSG00000101654	2.1.1.56		10075	protein-coding gene	gene with protein product		603514				9828141, 9705270	Standard	NM_003799		Approved	RG7MT1	uc002ksl.1	O43148	OTTHUMG00000131718	ENST00000383314.2:c.939T>A	chr18.hg19:g.13741655T>A	ENSP00000372804:p.Tyr313*	104.0	0.0		82.0	30.0	NM_003799	B0YJ90|D3DUJ5|O94996|Q9UIJ9	Nonsense_Mutation	SNP	ENST00000383314.2	hg19	CCDS11867.1	.	.	.	.	.	.	.	.	.	.	T	39	7.882852	0.98542	.	.	ENSG00000101654	ENST00000383314;ENST00000535051;ENST00000543302;ENST00000262173	.	.	.	5.61	4.46	0.54185	.	0.050900	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-7.8991	11.2654	0.49108	0.0:0.0714:0.0:0.9286	.	.	.	.	X	313;71;313;313	.	ENSP00000262173:Y313X	Y	+	3	2	RNMT	13731655	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.516000	0.60496	0.972000	0.38314	0.482000	0.46254	TAT	.	.		0.363	RNMT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254636.1	NM_003799	
NETO1	81832	hgsc.bcm.edu	37	18	70461395	70461395	+	Missense_Mutation	SNP	G	G	T			TCGA-2Y-A9H4-01A-11D-A382-10	TCGA-2Y-A9H4-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a12a5c70-7c82-4f2b-972f-81a029234685	cc2a8833-5e36-487f-bcb8-1fcb198152ff	g.chr18:70461395G>T	ENST00000327305.6	-	6	1253	c.596C>A	c.(595-597)gCt>gAt	p.A199D	NETO1_ENST00000299430.2_Missense_Mutation_p.A198D|NETO1_ENST00000583169.1_Missense_Mutation_p.A199D	NM_138966.3	NP_620416	Q8TDF5	NETO1_HUMAN	neuropilin (NRP) and tolloid (TLL)-like 1	199	CUB 2. {ECO:0000255|PROSITE- ProRule:PRU00059}.				memory (GO:0007613)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|receptor localization to synapse (GO:0097120)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|visual learning (GO:0008542)	cell junction (GO:0030054)|excitatory synapse (GO:0060076)|extracellular region (GO:0005576)|kainate selective glutamate receptor complex (GO:0032983)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)				NS(3)|breast(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(36)|ovary(2)|prostate(3)|skin(3)|stomach(1)	63		Esophageal squamous(42;0.129)		READ - Rectum adenocarcinoma(1;0.0487)		GCAATCAACAGCCTCGCTAGC	0.458																																					p.A199D		Atlas-SNP	.											.	NETO1	178	.	0			c.C596A						.						202.0	173.0	183.0					18																	70461395		2203	4300	6503	SO:0001583	missense	81832	exon6			TCAACAGCCTCGC	AF448838	CCDS12000.1, CCDS42444.1	18q22.2	2008-08-01			ENSG00000166342	ENSG00000166342			13823	protein-coding gene	gene with protein product		607973				11943477, 12810072	Standard	NM_138999		Approved	BTCL1, BCTL1	uc002lkw.3	Q8TDF5	OTTHUMG00000132834	ENST00000327305.6:c.596C>A	chr18.hg19:g.70461395G>T	ENSP00000313088:p.Ala199Asp	158.0	0.0		200.0	38.0	NM_001201465	Q86W85|Q8ND78|Q8TDF4	Missense_Mutation	SNP	ENST00000327305.6	hg19	CCDS12000.1	.	.	.	.	.	.	.	.	.	.	G	17.22	3.335085	0.60853	.	.	ENSG00000166342	ENST00000327305;ENST00000299430	T;T	0.17691	2.26;2.26	5.29	5.29	0.74685	CUB (5);	0.000000	0.64402	D	0.000014	T	0.45994	0.1370	M	0.78916	2.43	0.80722	D	1	D;D	0.76494	0.999;0.987	D;D	0.85130	0.997;0.95	T	0.43621	-0.9380	10	0.54805	T	0.06	-18.7142	18.9328	0.92572	0.0:0.0:1.0:0.0	.	198;199	Q8TDF5-2;Q8TDF5	.;NETO1_HUMAN	D	199;198	ENSP00000313088:A199D;ENSP00000299430:A198D	ENSP00000299430:A198D	A	-	2	0	NETO1	68612375	1.000000	0.71417	0.996000	0.52242	0.396000	0.30629	9.476000	0.97823	2.462000	0.83206	0.655000	0.94253	GCT	.	.		0.458	NETO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256301.2	NM_138999	
TJP3	27134	hgsc.bcm.edu	37	19	3728689	3728689	+	Missense_Mutation	SNP	G	G	A			TCGA-2Y-A9H4-01A-11D-A382-10	TCGA-2Y-A9H4-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a12a5c70-7c82-4f2b-972f-81a029234685	cc2a8833-5e36-487f-bcb8-1fcb198152ff	g.chr19:3728689G>A	ENST00000541714.2	+	3	598	c.136G>A	c.(136-138)Ggg>Agg	p.G46R	TJP3_ENST00000539908.2_Missense_Mutation_p.G10R|TJP3_ENST00000382008.3_Missense_Mutation_p.G46R|TJP3_ENST00000589378.1_Missense_Mutation_p.G55R|TJP3_ENST00000262968.9_Missense_Mutation_p.G65R|TJP3_ENST00000587686.1_Missense_Mutation_p.G65R	NM_001267560.1	NP_001254489.1	O95049	ZO3_HUMAN	tight junction protein 3	46	PDZ 1. {ECO:0000255|PROSITE- ProRule:PRU00143}.				regulation of G1/S transition of mitotic cell cycle (GO:2000045)	apical plasma membrane (GO:0016324)|nucleus (GO:0005634)|tight junction (GO:0005923)				breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(10)|ovary(1)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	26				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0118)|STAD - Stomach adenocarcinoma(1328;0.18)		GGTACCTGGAGGGCCGGCGGA	0.647																																					p.G55R		Atlas-SNP	.											.	TJP3	79	.	0			c.G163A						.						35.0	38.0	37.0					19																	3728689		2203	4300	6503	SO:0001583	missense	27134	exon3			CCTGGAGGGCCGG	AC005954	CCDS32873.1, CCDS32873.2, CCDS59332.1	19p13.3	2012-07-12	2012-07-12			ENSG00000105289			11829	protein-coding gene	gene with protein product	"""zona occludens 3"""	612689					Standard	NM_001267560		Approved	ZO-3	uc010xhu.3	O95049		ENST00000541714.2:c.136G>A	chr19.hg19:g.3728689G>A	ENSP00000439278:p.Gly46Arg	93.0	0.0		81.0	34.0	NM_001267561	A6NFP3|B3KR73|B3KXZ0|B4E2W6|F5H2X0|F5H4S9|K7EK22|Q32N01	Missense_Mutation	SNP	ENST00000541714.2	hg19	CCDS32873.2	.	.	.	.	.	.	.	.	.	.	G	16.22	3.060555	0.55432	.	.	ENSG00000105289	ENST00000541714;ENST00000539908;ENST00000382008;ENST00000262968	T;T;T;T	0.56275	1.02;0.47;1.02;1.72	4.02	4.02	0.46733	PDZ/DHR/GLGF (4);	0.000000	0.85682	D	0.000000	D	0.82637	0.5080	H	0.98577	4.27	0.80722	D	1	D;D;D;D	0.76494	0.999;0.981;0.998;0.998	D;D;D;D	0.77557	0.99;0.916;0.987;0.986	D	0.89944	0.4075	10	0.87932	D	0	.	15.7177	0.77681	0.0:0.0:1.0:0.0	.	65;65;46;46	O95049-3;O95049-2;O95049;F5H2X0	.;.;ZO3_HUMAN;.	R	46;10;46;65	ENSP00000439278:G46R;ENSP00000439991:G10R;ENSP00000371438:G46R;ENSP00000262968:G65R	ENSP00000262968:G65R	G	+	1	0	TJP3	3679689	1.000000	0.71417	0.237000	0.24090	0.015000	0.08874	8.821000	0.92009	2.253000	0.74438	0.456000	0.33151	GGG	.	.		0.647	TJP3-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000453434.1		
OR7A5	26659	hgsc.bcm.edu	37	19	14938215	14938215	+	Missense_Mutation	SNP	A	A	T			TCGA-2Y-A9H4-01A-11D-A382-10	TCGA-2Y-A9H4-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a12a5c70-7c82-4f2b-972f-81a029234685	cc2a8833-5e36-487f-bcb8-1fcb198152ff	g.chr19:14938215A>T	ENST00000322301.3	-	2	926	c.839T>A	c.(838-840)gTg>gAg	p.V280E	OR7A5_ENST00000594432.1_Missense_Mutation_p.V280E|OR7A5_ENST00000601611.1_Intron			Q15622	OR7A5_HUMAN	olfactory receptor, family 7, subfamily A, member 5	280					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(4)|endometrium(2)|kidney(4)|large_intestine(3)|lung(6)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	26						GGGGGTGACCACAGTGTACAT	0.468																																					p.V280E		Atlas-SNP	.											.	OR7A5	43	.	0			c.T839A						.						85.0	78.0	80.0					19																	14938215		2203	4300	6503	SO:0001583	missense	26659	exon1			GTGACCACAGTGT	X64976	CCDS12318.1	19p13.1	2012-08-09	2003-12-09			ENSG00000188269		"""GPCR / Class A : Olfactory receptors"""	8368	protein-coding gene	gene with protein product			"""olfactory receptor, family 7, subfamily A, member 5 pseudogene"""				Standard	XM_006722722		Approved	HTPCR2	uc002mzw.3	Q15622		ENST00000322301.3:c.839T>A	chr19.hg19:g.14938215A>T	ENSP00000316955:p.Val280Glu	91.0	0.0		58.0	29.0	NM_017506	B2R682|Q6IFP1|Q96R96	Missense_Mutation	SNP	ENST00000322301.3	hg19	CCDS12318.1	.	.	.	.	.	.	.	.	.	.	a	12.24	1.879670	0.33162	.	.	ENSG00000188269	ENST00000322301	T	0.00316	8.13	3.12	0.873	0.19118	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.00998	0.0033	H	0.98701	4.305	0.09310	N	1	D	0.76494	0.999	D	0.79784	0.993	T	0.45977	-0.9224	9	0.87932	D	0	.	3.212	0.06686	0.5407:0.2157:0.2436:0.0	.	280	Q15622	OR7A5_HUMAN	E	280	ENSP00000316955:V280E	ENSP00000316955:V280E	V	-	2	0	OR7A5	14799215	0.007000	0.16637	0.172000	0.22920	0.556000	0.35491	2.383000	0.44354	0.013000	0.14918	0.102000	0.15555	GTG	.	.		0.468	OR7A5-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466518.1	NM_017506	
SIRPG	55423	hgsc.bcm.edu	37	20	1616060	1616060	+	Missense_Mutation	SNP	T	T	A			TCGA-2Y-A9H4-01A-11D-A382-10	TCGA-2Y-A9H4-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a12a5c70-7c82-4f2b-972f-81a029234685	cc2a8833-5e36-487f-bcb8-1fcb198152ff	g.chr20:1616060T>A	ENST00000303415.3	-	4	998	c.934A>T	c.(934-936)Agc>Tgc	p.S312C	RP11-77C3.3_ENST00000456177.1_RNA|RP11-77C3.3_ENST00000437384.1_RNA|SIRPG_ENST00000381583.2_Intron|SIRPG_ENST00000216927.4_Intron|SIRPG_ENST00000344103.4_Intron|SIRPG_ENST00000381580.1_Missense_Mutation_p.S279C	NM_018556.3	NP_061026.2	Q9P1W8	SIRPG_HUMAN	signal-regulatory protein gamma	312	Ig-like C1-type 2.				blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|intracellular signal transduction (GO:0035556)|leukocyte migration (GO:0050900)|negative regulation of cell proliferation (GO:0008285)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-cell adhesion (GO:0022409)|positive regulation of T cell activation (GO:0050870)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(14)|ovary(1)|prostate(2)|stomach(1)	27						AGGAACCAGCTTGTCCAGTTG	0.547																																					p.S312C		Atlas-SNP	.											.	SIRPG	61	.	0			c.A934T						.						227.0	178.0	194.0					20																	1616060		2203	4300	6503	SO:0001583	missense	55423	exon4			ACCAGCTTGTCCA	AB042624	CCDS13020.2, CCDS13021.2, CCDS33434.1	20p13	2013-01-11	2006-02-03	2006-02-03	ENSG00000089012	ENSG00000089012		"""Signal-regulatory proteins"", ""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C1-set domain containing"""	15757	protein-coding gene	gene with protein product		605466	"""signal-regulatory protein beta 2"""	SIRPB2		11185750, 16339511	Standard	XM_005260749		Approved	bA77C3.1, SIRP-B2, SIRPgamma, CD172g	uc002wfm.1	Q9P1W8	OTTHUMG00000031680	ENST00000303415.3:c.934A>T	chr20.hg19:g.1616060T>A	ENSP00000305529:p.Ser312Cys	206.0	0.0		155.0	54.0	NM_018556	B1AKP6|Q5D051|Q5JV25|Q5MKL4|Q8WWA5|Q9NQK8	Missense_Mutation	SNP	ENST00000303415.3	hg19	CCDS13020.2	.	.	.	.	.	.	.	.	.	.	.	14.29	2.491278	0.44249	.	.	ENSG00000089012	ENST00000381580;ENST00000303415	T;T	0.00892	5.57;5.57	1.6	1.6	0.23607	Immunoglobulin-like (1);Immunoglobulin C1-set (2);Immunoglobulin-like fold (1);	0.342187	0.28566	N	0.014892	T	0.06234	0.0161	H	0.95151	3.63	0.44067	D	0.996818	D	0.61080	0.989	D	0.71870	0.975	T	0.01004	-1.1484	10	0.59425	D	0.04	.	5.2806	0.15673	0.0:0.0:0.0:1.0	.	312	Q9P1W8	SIRPG_HUMAN	C	279;312	ENSP00000370992:S279C;ENSP00000305529:S312C	ENSP00000305529:S312C	S	-	1	0	SIRPG	1564060	0.926000	0.31397	0.512000	0.27736	0.260000	0.26232	3.102000	0.50291	0.977000	0.38444	0.164000	0.16699	AGC	.	.		0.547	SIRPG-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077566.2	NM_018556	
TAF4	6874	hgsc.bcm.edu	37	20	60639513	60639513	+	Missense_Mutation	SNP	G	G	A			TCGA-2Y-A9H4-01A-11D-A382-10	TCGA-2Y-A9H4-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a12a5c70-7c82-4f2b-972f-81a029234685	cc2a8833-5e36-487f-bcb8-1fcb198152ff	g.chr20:60639513G>A	ENST00000252996.4	-	1	1353	c.1354C>T	c.(1354-1356)Ccc>Tcc	p.P452S	hsa-mir-3195_ENST00000585001.1_RNA	NM_003185.3	NP_003176.2	O00268	TAF4_HUMAN	TAF4 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 135kDa	452					DNA-templated transcription, initiation (GO:0006352)|gene expression (GO:0010467)|ovarian follicle development (GO:0001541)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	cytoplasm (GO:0005737)|MLL1 complex (GO:0071339)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor TFIID complex (GO:0005669)|transcription factor TFTC complex (GO:0033276)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(15)|ovary(2)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	37	Breast(26;1e-08)		BRCA - Breast invasive adenocarcinoma(19;3.1e-07)			TCACCTGGGGGCAGCTGGAAG	0.687																																					p.P452S		Atlas-SNP	.											.	TAF4	84	.	0			c.C1354T						.						6.0	8.0	7.0					20																	60639513		2115	4196	6311	SO:0001583	missense	6874	exon1			CTGGGGGCAGCTG	Y11354	CCDS33500.1	20q13.33	2010-02-26	2002-08-29	2002-01-18	ENSG00000130699	ENSG00000130699			11537	protein-coding gene	gene with protein product		601796	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, C1, 130kD"""	TAF4A, TAF2C1, TAF2C		8942982, 9192867	Standard	NM_003185		Approved	TAFII130, TAFII135	uc002ybs.3	O00268	OTTHUMG00000032893	ENST00000252996.4:c.1354C>T	chr20.hg19:g.60639513G>A	ENSP00000252996:p.Pro452Ser	71.0	0.0		68.0	16.0	NM_003185	A6NGD9|Q5TBP6|Q99721|Q9BR40|Q9BX42	Missense_Mutation	SNP	ENST00000252996.4	hg19	CCDS33500.1	.	.	.	.	.	.	.	.	.	.	g	21.2	4.112596	0.77210	.	.	ENSG00000130699	ENST00000252996;ENST00000436129	T;T	0.30182	1.54;1.54	2.75	2.75	0.32379	.	0.233720	0.36167	N	0.002744	T	0.30039	0.0752	L	0.49455	1.56	0.58432	D	0.999999	B	0.32781	0.384	B	0.37144	0.242	T	0.08617	-1.0713	10	0.27785	T	0.31	.	13.4609	0.61227	0.0:0.0:1.0:0.0	.	452	O00268	TAF4_HUMAN	S	452;316	ENSP00000252996:P452S;ENSP00000399091:P316S	ENSP00000252996:P452S	P	-	1	0	TAF4	60072908	1.000000	0.71417	1.000000	0.80357	0.860000	0.49131	6.497000	0.73674	1.104000	0.41587	0.177000	0.17058	CCC	.	.		0.687	TAF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079968.2	NM_003185	
TTC3	7267	hgsc.bcm.edu	37	21	38538061	38538061	+	Missense_Mutation	SNP	G	G	A			TCGA-2Y-A9H4-01A-11D-A382-10	TCGA-2Y-A9H4-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a12a5c70-7c82-4f2b-972f-81a029234685	cc2a8833-5e36-487f-bcb8-1fcb198152ff	g.chr21:38538061G>A	ENST00000399017.2	+	33	6292	c.3545G>A	c.(3544-3546)aGg>aAg	p.R1182K	TTC3_ENST00000479930.1_3'UTR|TTC3_ENST00000354749.2_Missense_Mutation_p.R1182K|TTC3_ENST00000355666.1_Missense_Mutation_p.R1182K	NM_003316.3	NP_003307.3	P53804	TTC3_HUMAN	tetratricopeptide repeat domain 3	1182	Arg/Lys-rich (basic).				negative regulation of cell morphogenesis involved in differentiation (GO:0010771)|negative regulation of neuron differentiation (GO:0045665)|protein K48-linked ubiquitination (GO:0070936)|ubiquitin-dependent protein catabolic process (GO:0006511)	mitochondrion (GO:0005739)|nucleus (GO:0005634)|vacuole (GO:0005773)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(5)|endometrium(7)|kidney(5)|large_intestine(17)|liver(1)|lung(18)|ovary(4)|prostate(2)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(5)	75		Myeloproliferative disorder(46;0.0412)				AAGAAAAAAAGGAAGAAGAAA	0.378																																					p.R1182K	Ovarian(38;194 1649 35661)	Atlas-SNP	.											.	TTC3	182	.	0			c.G3545A						.						111.0	122.0	118.0					21																	38538061		2196	4298	6494	SO:0001583	missense	7267	exon33			AAAAAAGGAAGAA	D84296	CCDS13651.1	21q22.2	2013-01-11			ENSG00000182670	ENSG00000182670		"""RING-type (C3HC4) zinc fingers"", ""Tetratricopeptide (TTC) repeat domain containing"""	12393	protein-coding gene	gene with protein product		602259				8947847	Standard	NM_003316		Approved	TPRD, TPRDI, DCRR1, TPRDII, TPRDIII, RNF105	uc002yvz.3	P53804	OTTHUMG00000086654	ENST00000399017.2:c.3545G>A	chr21.hg19:g.38538061G>A	ENSP00000381981:p.Arg1182Lys	62.0	0.0		70.0	31.0	NM_001001894	A8K7H7|B2RPA7|D3DSG9|D3DSH2|D3DSH3|O60767|P78476|P78477|Q569I2|Q6P578|Q9UEK4	Missense_Mutation	SNP	ENST00000399017.2	hg19	CCDS13651.1	.	.	.	.	.	.	.	.	.	.	G	7.270	0.606887	0.14002	.	.	ENSG00000182670	ENST00000438055;ENST00000355666;ENST00000399017;ENST00000354749	T;T;T;T	0.14022	2.54;3.1;3.1;3.1	4.69	3.78	0.43462	.	0.314194	0.27866	N	0.017534	T	0.24044	0.0582	L	0.46157	1.445	0.37162	D	0.902635	D;D	0.67145	0.996;0.994	D;D	0.76071	0.987;0.97	T	0.04017	-1.0984	9	.	.	.	-15.7093	6.1288	0.20194	0.1643:0.263:0.5727:0.0	.	240;1182	Q5GIT6;P53804	.;TTC3_HUMAN	K	1164;1182;1182;1182	ENSP00000391891:R1164K;ENSP00000347889:R1182K;ENSP00000381981:R1182K;ENSP00000346791:R1182K	.	R	+	2	0	TTC3	37459931	1.000000	0.71417	0.998000	0.56505	0.845000	0.48019	1.521000	0.35910	2.318000	0.78349	0.655000	0.94253	AGG	.	.		0.378	TTC3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000194776.1		
TNMD	64102	hgsc.bcm.edu	37	X	99854661	99854661	+	Missense_Mutation	SNP	C	C	T			TCGA-2Y-A9H4-01A-11D-A382-10	TCGA-2Y-A9H4-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a12a5c70-7c82-4f2b-972f-81a029234685	cc2a8833-5e36-487f-bcb8-1fcb198152ff	g.chrX:99854661C>T	ENST00000373031.4	+	7	1118	c.901C>T	c.(901-903)Cgt>Tgt	p.R301C		NM_022144.2	NP_071427.2	Q9H2S6	TNMD_HUMAN	tenomodulin	301					cellular response to BMP stimulus (GO:0071773)|endothelial cell morphogenesis (GO:0001886)|negative regulation of angiogenesis (GO:0016525)|negative regulation of endothelial cell proliferation (GO:0001937)|tendon cell differentiation (GO:0035990)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(7)|skin(1)	16						AGTCATCTGTCGTGTCATCAT	0.507																																					p.R301C		Atlas-SNP	.											.	TNMD	40	.	0			c.C901T						.						98.0	60.0	73.0					X																	99854661		2203	4300	6503	SO:0001583	missense	64102	exon7			ATCTGTCGTGTCA	AF191770	CCDS14469.1	Xq21.33-q23	2012-10-10			ENSG00000000005	ENSG00000000005		"""BRICHOS domain containing"""	17757	protein-coding gene	gene with protein product	"""BRICHOS domain containing 4"""	300459					Standard	NM_022144		Approved	myodulin, ChM1L, tendin, TEM, BRICD4	uc004efy.4	Q9H2S6	OTTHUMG00000022001	ENST00000373031.4:c.901C>T	chrX.hg19:g.99854661C>T	ENSP00000362122:p.Arg301Cys	72.0	0.0		99.0	87.0	NM_022144	Q9HBX0|Q9UJG0	Missense_Mutation	SNP	ENST00000373031.4	hg19	CCDS14469.1	.	.	.	.	.	.	.	.	.	.	C	23.5	4.428152	0.83667	.	.	ENSG00000000005	ENST00000373031	T	0.37584	1.19	5.87	5.87	0.94306	.	0.064498	0.64402	D	0.000004	T	0.34193	0.0889	L	0.39898	1.24	0.58432	D	0.999999	D	0.61697	0.99	B	0.43809	0.432	T	0.17745	-1.0359	10	0.87932	D	0	-30.575	14.0258	0.64584	0.1508:0.8492:0.0:0.0	.	301	Q9H2S6	TNMD_HUMAN	C	301	ENSP00000362122:R301C	ENSP00000362122:R301C	R	+	1	0	TNMD	99741317	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.920000	0.48844	2.469000	0.83416	0.594000	0.82650	CGT	.	.		0.507	TNMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057481.1	NM_022144	
GPRASP1	9737	hgsc.bcm.edu	37	X	101909785	101909785	+	Missense_Mutation	SNP	C	C	T	rs17339512	byFrequency	TCGA-2Y-A9H4-01A-11D-A382-10	TCGA-2Y-A9H4-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a12a5c70-7c82-4f2b-972f-81a029234685	cc2a8833-5e36-487f-bcb8-1fcb198152ff	g.chrX:101909785C>T	ENST00000361600.5	+	5	1745	c.944C>T	c.(943-945)gCc>gTc	p.A315V	GPRASP1_ENST00000415986.1_Missense_Mutation_p.A315V|RP4-769N13.7_ENST00000602441.1_RNA|GPRASP1_ENST00000537097.1_Missense_Mutation_p.A315V|GPRASP1_ENST00000444152.1_Missense_Mutation_p.A315V	NM_014710.4	NP_055525.3	Q5JY77	GASP1_HUMAN	G protein-coupled receptor associated sorting protein 1	315			A -> G (in dbSNP:rs17339512). {ECO:0000269|PubMed:9455477}.		endosome to lysosome transport (GO:0008333)|G-protein coupled receptor catabolic process (GO:1990172)	cytoplasm (GO:0005737)				NS(1)|breast(3)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(10)|lung(29)|ovary(2)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	60						GGAAAGGAGGCCAAATTCAGG	0.488																																					p.A315V		Atlas-SNP	.											.	GPRASP1	140	.	0			c.C944T						.						94.0	93.0	93.0					X																	101909785		2203	4300	6503	SO:0001583	missense	9737	exon3			AGGAGGCCAAATT	AB007903	CCDS35352.1	Xq22.1	2014-03-21			ENSG00000198932	ENSG00000198932		"""Armadillo repeat containing"""	24834	protein-coding gene	gene with protein product		300417				9455477, 15086532, 16221301	Standard	NM_014710		Approved	GASP, GASP1	uc010nod.3	Q5JY77	OTTHUMG00000022061	ENST00000361600.5:c.944C>T	chrX.hg19:g.101909785C>T	ENSP00000355146:p.Ala315Val	57.0	0.0		86.0	4.0	NM_001099411	O43168|Q96LA1	Missense_Mutation	SNP	ENST00000361600.5	hg19	CCDS35352.1	.	.	.	.	.	.	.	.	.	.	C	7.503	0.653137	0.14580	.	.	ENSG00000198932	ENST00000415986;ENST00000444152;ENST00000361600;ENST00000537097	T;T;T;T	0.11712	2.75;2.75;2.75;2.75	1.94	-0.0574	0.13801	.	.	.	.	.	T	0.08403	0.0209	L	0.46614	1.455	0.20196	N	0.999927	B	0.24132	0.098	B	0.12837	0.008	T	0.34179	-0.9839	9	0.34782	T	0.22	-0.001	4.2854	0.10853	0.0:0.5984:0.2349:0.1667	.	315	Q5JY77	GASP1_HUMAN	V	315	ENSP00000393691:A315V;ENSP00000409420:A315V;ENSP00000355146:A315V;ENSP00000445683:A315V	ENSP00000355146:A315V	A	+	2	0	GPRASP1	101796441	0.000000	0.05858	0.023000	0.16930	0.103000	0.19146	-0.198000	0.09505	-0.107000	0.12088	0.279000	0.19357	GCC	.	C|0.962;G|0.038		0.488	GPRASP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057634.2	NM_014710	
IRS4	8471	hgsc.bcm.edu	37	X	107978096	107978096	+	Missense_Mutation	SNP	C	C	A			TCGA-2Y-A9H4-01A-11D-A382-10	TCGA-2Y-A9H4-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a12a5c70-7c82-4f2b-972f-81a029234685	cc2a8833-5e36-487f-bcb8-1fcb198152ff	g.chrX:107978096C>A	ENST00000372129.2	-	1	1555	c.1479G>T	c.(1477-1479)tgG>tgT	p.W493C	RP6-24A23.6_ENST00000563887.1_5'Flank|RP6-24A23.3_ENST00000608811.1_RNA|RP6-24A23.3_ENST00000436013.1_RNA	NM_003604.2	NP_003595.1	O14654	IRS4_HUMAN	insulin receptor substrate 4	493					positive regulation of signal transduction (GO:0009967)|signal transduction (GO:0007165)	plasma membrane (GO:0005886)	SH3/SH2 adaptor activity (GO:0005070)|signal transducer activity (GO:0004871)			NS(1)|breast(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|lung(30)|ovary(5)|pancreas(2)|prostate(1)|skin(1)	78						TTCCTGAGCCCCAATTGTTCA	0.577																																					p.W493C		Atlas-SNP	.											.	IRS4	253	.	0			c.G1479T						.						129.0	121.0	124.0					X																	107978096		2203	4300	6503	SO:0001583	missense	8471	exon1			TGAGCCCCAATTG	AF007567	CCDS14544.1	Xq22.3	2008-08-01			ENSG00000133124	ENSG00000133124			6128	protein-coding gene	gene with protein product		300904				9261155, 9553137	Standard	NM_003604		Approved	PY160, IRS-4	uc004eoc.2	O14654	OTTHUMG00000022181	ENST00000372129.2:c.1479G>T	chrX.hg19:g.107978096C>A	ENSP00000361202:p.Trp493Cys	70.0	0.0		116.0	55.0	NM_003604		Missense_Mutation	SNP	ENST00000372129.2	hg19	CCDS14544.1	.	.	.	.	.	.	.	.	.	.	C	10.56	1.383719	0.25031	.	.	ENSG00000133124	ENST00000372129	T	0.35605	1.3	4.2	4.2	0.49525	.	0.549745	0.18258	N	0.146724	T	0.30198	0.0757	L	0.27053	0.805	0.45899	D	0.998741	D	0.54047	0.964	P	0.46975	0.533	T	0.02581	-1.1138	10	0.44086	T	0.13	-2.7108	10.7654	0.46291	0.0:0.9026:0.0:0.0974	.	493	O14654	IRS4_HUMAN	C	493	ENSP00000361202:W493C	ENSP00000361202:W493C	W	-	3	0	IRS4	107864752	0.999000	0.42202	1.000000	0.80357	0.915000	0.54546	1.780000	0.38634	2.355000	0.79922	0.596000	0.82720	TGG	.	.		0.577	IRS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057879.1	NM_003604	
PTPRK	5796	hgsc.bcm.edu	37	6	128320011	128320012	+	Frame_Shift_Ins	INS	-	-	A			TCGA-2Y-A9H4-01A-11D-A382-10	TCGA-2Y-A9H4-10A-01D-A385-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a12a5c70-7c82-4f2b-972f-81a029234685	cc2a8833-5e36-487f-bcb8-1fcb198152ff	g.chr6:128320011_128320012insA	ENST00000368215.3	-	16	2528_2529	c.2529_2530insT	c.(2527-2532)cttctafs	p.L844fs	PTPRK_ENST00000368210.3_Frame_Shift_Ins_p.L857fs|PTPRK_ENST00000524481.1_5'Flank|PTPRK_ENST00000368207.3_Frame_Shift_Ins_p.L871fs|PTPRK_ENST00000368226.4_Frame_Shift_Ins_p.L845fs|PTPRK_ENST00000532331.1_Frame_Shift_Ins_p.L861fs|PTPRK_ENST00000368213.5_Frame_Shift_Ins_p.L845fs|PTPRK_ENST00000368227.3_Frame_Shift_Ins_p.L857fs			Q15262	PTPRK_HUMAN	protein tyrosine phosphatase, receptor type, K	844					cell adhesion (GO:0007155)|cell migration (GO:0016477)|cellular response to reactive oxygen species (GO:0034614)|cellular response to UV (GO:0034644)|focal adhesion assembly (GO:0048041)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of keratinocyte proliferation (GO:0010839)|negative regulation of transcription, DNA-templated (GO:0045892)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|protein localization to cell surface (GO:0034394)|signal transduction (GO:0007165)|transforming growth factor beta receptor signaling pathway (GO:0007179)	axon (GO:0030424)|cell surface (GO:0009986)|cell-cell junction (GO:0005911)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|leading edge membrane (GO:0031256)|neuronal cell body (GO:0043025)|photoreceptor outer segment (GO:0001750)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)		PTPRK/RSPO3(10)	autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(14)|lung(24)|ovary(3)|pancreas(1)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	72				all cancers(137;0.0118)|GBM - Glioblastoma multiforme(226;0.0372)|OV - Ovarian serous cystadenocarcinoma(136;0.24)		GGTACGTCTAGAAGGCGACTGG	0.446																																					p.L845fs		Atlas-Indel,Pindel	.											.	PTPRK	330	.	0			c.2533_2534insT						.																																			SO:0001589	frameshift_variant	5796	exon16			.	L77886	CCDS5137.1, CCDS47473.1, CCDS75517.1	6q22.2-q22.3	2013-02-11			ENSG00000152894	ENSG00000152894		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	9674	protein-coding gene	gene with protein product		602545				9047348, 8663237	Standard	NM_002844		Approved	R-PTP-kappa	uc010kfc.3	Q15262	OTTHUMG00000015536	ENST00000368215.3:c.2530dupT	chr6.hg19:g.128320013_128320013dupA	ENSP00000357198:p.Leu844fs	65.0	0.0		106.0	36.0	NM_001135648	B2RTQ8|B7ZMG0|Q14763|Q5TG10|Q5TG11	Frame_Shift_Ins	INS	ENST00000368215.3	hg19																																																																																				.	.		0.446	PTPRK-005	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000042163.1		
ST8SIA6	338596	hgsc.bcm.edu	37	10	17363249	17363249	+	Frame_Shift_Del	DEL	G	G	-			TCGA-2Y-A9H4-01A-11D-A382-10	TCGA-2Y-A9H4-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a12a5c70-7c82-4f2b-972f-81a029234685	cc2a8833-5e36-487f-bcb8-1fcb198152ff	g.chr10:17363249delG	ENST00000377602.4	-	8	899	c.825delC	c.(823-825)gccfs	p.A275fs		NM_001004470.1	NP_001004470.1	P61647	SIA8F_HUMAN	ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 6	275					carbohydrate biosynthetic process (GO:0016051)|cellular protein metabolic process (GO:0044267)|ganglioside biosynthetic process (GO:0001574)|glycolipid biosynthetic process (GO:0009247)|glycoprotein metabolic process (GO:0009100)|oligosaccharide metabolic process (GO:0009311)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|protein O-linked glycosylation (GO:0006493)|sialylation (GO:0097503)	Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)	sialyltransferase activity (GO:0008373)			endometrium(3)|kidney(3)|large_intestine(4)|liver(1)|lung(24)|ovary(1)|skin(1)	37						TACCCGTGTTGGCCCTGAAGG	0.428																																					p.N276fs		Atlas-Indel,Pindel	.											.	ST8SIA6	85	.	0			c.826delA						.						94.0	103.0	100.0					10																	17363249		2203	4300	6503	SO:0001589	frameshift_variant	338596	exon8			.		CCDS31158.1	10p13	2013-03-01	2005-02-07	2005-02-07	ENSG00000148488	ENSG00000148488		"""Sialyltransferases"""	23317	protein-coding gene	gene with protein product	"""ST8Sia VI"""	610139	"""sialyltransferase 8F (alpha-2, 8-sialyltransferase)"""	SIAT8F		11980897	Standard	XR_242697		Approved		uc001ipd.3	P61647	OTTHUMG00000017748	ENST00000377602.4:c.825delC	chr10.hg19:g.17363249delG	ENSP00000366827:p.Ala275fs	220.0	0.0		206.0	30.0	NM_001004470	B0YJ97|B9EH72|Q5VZH4	Frame_Shift_Del	DEL	ENST00000377602.4	hg19	CCDS31158.1																																																																																			.	.		0.428	ST8SIA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047036.1	NM_001004470	
UPF3B	65109	hgsc.bcm.edu	37	X	118975219	118975222	+	Splice_Site	DEL	TCTC	TCTC	-			TCGA-2Y-A9H4-01A-11D-A382-10	TCGA-2Y-A9H4-10A-01D-A385-10	TCTC	TCTC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a12a5c70-7c82-4f2b-972f-81a029234685	cc2a8833-5e36-487f-bcb8-1fcb198152ff	g.chrX:118975219_118975222delTCTC	ENST00000276201.2	-	7	694_696	c.625_627delGAGA	c.(625-627)gagdel	p.E209fs	UPF3B_ENST00000345865.2_Splice_Site_p.E209fs|UPF3B_ENST00000478840.1_5'UTR	NM_080632.2	NP_542199.1	Q9BZI7	REN3B_HUMAN	UPF3 regulator of nonsense transcripts homolog B (yeast)	209	Necessary for interaction with UPF2.|Sufficient for association with EJC core.				gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|mRNA splicing, via spliceosome (GO:0000398)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|positive regulation of translation (GO:0045727)|RNA metabolic process (GO:0016070)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|exon-exon junction complex (GO:0035145)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	mRNA binding (GO:0003729)|nucleocytoplasmic transporter activity (GO:0005487)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(3)|endometrium(4)|kidney(1)|large_intestine(7)|lung(12)|ovary(2)|prostate(1)	30						cttctCTCATTCTCTAGAAAGAAA	0.363																																					p.209_210del		Atlas-Indel,Pindel	.											.	UPF3B	74	.	0			c.625_628del						.																																			SO:0001630	splice_region_variant	65109	exon7			.	AF318576	CCDS14587.1, CCDS14588.1	Xq25-q26	2014-01-31			ENSG00000125351	ENSG00000125351			20439	protein-coding gene	gene with protein product		300298	"""mental retardation, X-linked 62"""	MRX62		11113196, 11163187, 19238151	Standard	NM_023010		Approved	RENT3B, UPF3X, HUPF3B	uc004erz.2	Q9BZI7	OTTHUMG00000022282	ENST00000276201.2:c.625-1GAGA>-	chrX.hg19:g.118975219_118975222delTCTC		26.0	0.0		38.0	30.0	NM_023010	D3DWI3|D3DWI4|Q0VAK8|Q9H1J0	Frame_Shift_Del	DEL	ENST00000276201.2	hg19	CCDS14588.1																																																																																			.	.		0.363	UPF3B-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000058068.1		Frame_Shift_Del
TP53	7157	hgsc.bcm.edu	37	17	7579420	7579420	+	Frame_Shift_Del	DEL	G	G	-	rs587783062		TCGA-2Y-A9H4-01A-11D-A382-10	TCGA-2Y-A9H4-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a12a5c70-7c82-4f2b-972f-81a029234685	cc2a8833-5e36-487f-bcb8-1fcb198152ff	g.chr17:7579420delG	ENST00000269305.4	-	4	456	c.267delC	c.(265-267)cccfs	p.P89fs	TP53_ENST00000359597.4_Frame_Shift_Del_p.P89fs|TP53_ENST00000420246.2_Frame_Shift_Del_p.P89fs|TP53_ENST00000413465.2_Frame_Shift_Del_p.P89fs|TP53_ENST00000445888.2_Frame_Shift_Del_p.P89fs|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000455263.2_Frame_Shift_Del_p.P89fs	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	89	Interaction with WWOX.		P -> L (in sporadic cancers; somatic mutation).|P -> S (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.0?(8)|p.S90fs*59(6)|p.A76_S90del15(3)|p.A88fs*32(3)|p.G59fs*23(3)|p.V73fs*9(1)|p.D48fs*55(1)|p.P85fs*58(1)|p.S33fs*23(1)|p.A86fs*33(1)|p.A86fs*32(1)|p.P87fs*54(1)|p.P13fs*18(1)|p.A88fs*52(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GGGGCCAGGAGGGGGCTGGTG	0.627		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.S90fs	Pancreas(47;798 1329 9957 10801)	Atlas-Indel,Pindel	.	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53_ENST00000455263,NS,carcinoma,0,1	TP53	33396	.	32	Deletion - Frameshift(15)|Whole gene deletion(8)|Insertion - Frameshift(6)|Deletion - In frame(3)	liver(6)|upper_aerodigestive_tract(4)|haematopoietic_and_lymphoid_tissue(4)|lung(4)|prostate(4)|bone(4)|central_nervous_system(2)|breast(2)|stomach(1)|urinary_tract(1)	c.268delT						.						45.0	52.0	50.0					17																	7579420		2202	4299	6501	SO:0001589	frameshift_variant	7157	exon4	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	.	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.267delC	chr17.hg19:g.7579420delG	ENSP00000269305:p.Pro89fs	168.0	0.0		105.0	62.0	NM_001126112	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Frame_Shift_Del	DEL	ENST00000269305.4	hg19	CCDS11118.1																																																																																			.	.		0.627	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
USP34	9736	hgsc.bcm.edu	37	2	61597513	61597514	+	Frame_Shift_Ins	INS	-	-	A			TCGA-2Y-A9H4-01A-11D-A382-10	TCGA-2Y-A9H4-10A-01D-A385-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a12a5c70-7c82-4f2b-972f-81a029234685	cc2a8833-5e36-487f-bcb8-1fcb198152ff	g.chr2:61597513_61597514insA	ENST00000398571.2	-	10	1269_1270	c.1193_1194insT	c.(1192-1194)ttgfs	p.L398fs		NM_014709.3	NP_055524.3	Q70CQ2	UBP34_HUMAN	ubiquitin specific peptidase 34	398					positive regulation of canonical Wnt signaling pathway (GO:0090263)|protein deubiquitination (GO:0016579)|protein K48-linked deubiquitination (GO:0071108)|ubiquitin-dependent protein catabolic process (GO:0006511)|Wnt signaling pathway (GO:0016055)		cysteine-type endopeptidase activity (GO:0004197)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			autonomic_ganglia(1)|breast(14)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(24)|lung(52)|ovary(8)|prostate(10)|skin(6)|urinary_tract(2)	138			Epithelial(17;0.229)			CTTCTGCTGCCAAAAAATTCAA	0.332																																					p.L398fs		Atlas-Indel,Pindel	.											.	USP34	334	.	0			c.1194_1195insT						.																																			SO:0001589	frameshift_variant	9736	exon10			.	AB011142	CCDS42686.1	2p16.1-p15	2005-08-08	2005-08-08		ENSG00000115464	ENSG00000115464		"""Ubiquitin-specific peptidases"""	20066	protein-coding gene	gene with protein product		615295	"""ubiquitin specific protease 34"""			12838346	Standard	NM_014709		Approved	KIAA0570, KIAA0729	uc002sbe.3	Q70CQ2	OTTHUMG00000152265	ENST00000398571.2:c.1194dupT	chr2.hg19:g.61597519_61597519dupA	ENSP00000381577:p.Leu398fs	333.0	0.0		354.0	118.0	NM_014709	A8MWD0|B3KWU9|O60316|O94834|Q3B777|Q6P6C9|Q7L8P6|Q8N3T9|Q8TBW2|Q9UGA1	Frame_Shift_Ins	INS	ENST00000398571.2	hg19	CCDS42686.1																																																																																			.	.		0.332	USP34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325650.4		
DNAJC14	85406	hgsc.bcm.edu	37	12	56222310	56222310	+	Frame_Shift_Del	DEL	T	T	-			TCGA-2Y-A9H4-01A-11D-A382-10	TCGA-2Y-A9H4-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a12a5c70-7c82-4f2b-972f-81a029234685	cc2a8833-5e36-487f-bcb8-1fcb198152ff	g.chr12:56222310delT	ENST00000357606.3	-	3	422	c.133delA	c.(133-135)actfs	p.T45fs	DNAJC14_ENST00000317269.3_Frame_Shift_Del_p.T45fs|DNAJC14_ENST00000317287.5_Frame_Shift_Del_p.T45fs|RP11-762I7.5_ENST00000546837.1_5'Flank|TMEM198B_ENST00000478241.1_RNA			Q6Y2X3	DJC14_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 14	45					protein transport (GO:0015031)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)				breast(2)|kidney(1)|large_intestine(8)|lung(7)|ovary(3)|prostate(1)|skin(1)	23						TTAGGAGCAGTCCCTGCTGAG	0.592																																					p.T45fs		Atlas-Indel,Pindel	.											.	DNAJC14	52	.	0			c.134delC						.						152.0	132.0	139.0					12																	56222310		2203	4300	6503	SO:0001589	frameshift_variant	85406	exon2			.	AF141342	CCDS8894.1	12q12	2011-09-02				ENSG00000135392		"""Heat shock proteins / DNAJ (HSP40)"""	24581	protein-coding gene	gene with protein product		606092				11331877, 11984006	Standard	NM_032364		Approved	DNAJ, DRIP78, HDJ3, LIP6, FLJ32792	uc001shu.2	Q6Y2X3		ENST00000357606.3:c.133delA	chr12.hg19:g.56222310delT	ENSP00000350223:p.Thr45fs	163.0	0.0		142.0	51.0	NM_032364	A5YM67|Q17RY2|Q66K17|Q96N59|Q96T63	Frame_Shift_Del	DEL	ENST00000357606.3	hg19	CCDS8894.1																																																																																			.	.		0.592	DNAJC14-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409095.1	NM_032364	
HNRNPA1	3178	hgsc.bcm.edu	37	12	54675175	54675176	+	Frame_Shift_Ins	INS	-	-	A			TCGA-2Y-A9H4-01A-11D-A382-10	TCGA-2Y-A9H4-10A-01D-A385-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a12a5c70-7c82-4f2b-972f-81a029234685	cc2a8833-5e36-487f-bcb8-1fcb198152ff	g.chr12:54675175_54675176insA	ENST00000340913.6	+	2	74_75	c.21_22insA	c.(22-24)aaafs	p.K8fs	HNRNPA1_ENST00000330752.8_Frame_Shift_Ins_p.K8fs|HNRNPA1_ENST00000546500.1_Frame_Shift_Ins_p.K8fs|CBX5_ENST00000209875.4_5'Flank|RP11-968A15.8_ENST00000553061.1_RNA|HNRNPA1_ENST00000547276.1_Frame_Shift_Ins_p.K8fs|RP11-968A15.2_ENST00000547177.1_RNA	NM_002136.2|NM_031157.2	NP_002127.1|NP_112420.1	P09651	ROA1_HUMAN	heterogeneous nuclear ribonucleoprotein A1	8	Globular A domain.				cell death (GO:0008219)|gene expression (GO:0010467)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|mRNA transport (GO:0051028)|nuclear export (GO:0051168)|nuclear import (GO:0051170)|RNA export from nucleus (GO:0006405)|RNA splicing (GO:0008380)|viral process (GO:0016032)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|spliceosomal complex (GO:0005681)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|single-stranded DNA binding (GO:0003697)|single-stranded RNA binding (GO:0003727)			endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(4)|lung(6)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	20						TCTAGTCTCCTAAAGAGCCCGA	0.485																																					p.P7fs	Colon(83;502 1289 8436 16406 24870)	Pindel	.											.	HNRNPA1	72	.	0			c.21_22insA						.																																			SO:0001589	frameshift_variant	3178	exon2			.	BC009600	CCDS41793.1, CCDS44909.1	12q13.1	2013-10-11		2007-08-16	ENSG00000135486	ENSG00000135486		"""RNA binding motif (RRM) containing"""	5031	protein-coding gene	gene with protein product		164017		HNRPA1		1733858	Standard	XR_245923		Approved	hnRNPA1, hnRNP-A1	uc001sfl.3	P09651		ENST00000340913.6:c.24dupA	chr12.hg19:g.54675178_54675178dupA	ENSP00000341826:p.Lys8fs	94.0	0.0		77.0	21.0	NM_002136	A8K4Z8|Q3MIB7|Q6PJZ7	Frame_Shift_Ins	INS	ENST00000340913.6	hg19	CCDS44909.1																																																																																			.	.		0.485	HNRNPA1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000405480.1	NM_031157	
FLT4	2324	hgsc.bcm.edu	37	5	180041181	180041214	+	Splice_Site	DEL	TGGGGAGACAGAGGGAAGCTTGTCCCGTGGTGGA	TGGGGAGACAGAGGGAAGCTTGTCCCGTGGTGGA	-	rs659268|rs2934602|rs373004354|rs2934601|rs369575233|rs368887610|rs201584222	byFrequency	TCGA-2Y-A9H4-01A-11D-A382-10	TCGA-2Y-A9H4-10A-01D-A385-10	TGGGGAGACAGAGGGAAGCTTGTCCCGTGGTGGA	TGGGGAGACAGAGGGAAGCTTGTCCCGTGGTGGA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a12a5c70-7c82-4f2b-972f-81a029234685	cc2a8833-5e36-487f-bcb8-1fcb198152ff	g.chr5:180041181_180041214delTGGGGAGACAGAGGGAAGCTTGTCCCGTGGTGGA	ENST00000261937.6	-	24	3298		c.e24-2		FLT4_ENST00000393347.3_Splice_Site|FLT4_ENST00000502649.1_Splice_Site	NM_182925.4	NP_891555.2	P35916	VGFR3_HUMAN	fms-related tyrosine kinase 4						blood vessel morphogenesis (GO:0048514)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|lymph vessel development (GO:0001945)|lymphangiogenesis (GO:0001946)|negative regulation of apoptotic process (GO:0043066)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of JNK cascade (GO:0046330)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of protein kinase C signaling (GO:0090037)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation vascular endothelial growth factor production (GO:0010575)|protein autophosphorylation (GO:0046777)|regulation of blood vessel remodeling (GO:0060312)|sprouting angiogenesis (GO:0002040)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|vascular endothelial growth factor signaling pathway (GO:0038084)|vasculature development (GO:0001944)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|protein phosphatase binding (GO:0019903)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor-activated receptor activity (GO:0005021)			NS(1)|breast(3)|central_nervous_system(2)|endometrium(1)|kidney(6)|large_intestine(5)|liver(2)|lung(37)|ovary(6)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	71	all_cancers(89;2.21e-05)|all_epithelial(37;5.29e-06)|Renal(175;0.000159)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.114)	all_cancers(40;0.00245)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_hematologic(541;0.163)|Ovarian(839;0.238)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.134)	Axitinib(DB06626)|Pazopanib(DB06589)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	CAGCCGGGCCTGGGGAGACAGAGGGAAGCTTGTCCCGTGGTGGATGGGGAGACG	0.641																																					.	Colon(97;1075 1466 27033 27547 35871)	Pindel	.											.	FLT4	356	.	0			.						.																																			SO:0001630	splice_region_variant	2324	.			.	X68203	CCDS4457.1, CCDS43412.1	5q34-q35	2013-01-29			ENSG00000037280	ENSG00000037280	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3767	protein-coding gene	gene with protein product		136352				1319394	Standard	NM_002020		Approved	VEGFR3, PCL	uc003mlz.4	P35916	OTTHUMG00000130931	ENST00000261937.6:c.3220-2TCCACCACGGGACAAGCTTCCCTCTGTCTCCCCA>-	chr5.hg19:g.180041181_180041214delTGGGGAGACAGAGGGAAGCTTGTCCCGTGGTGGA		93.0	0.0		96.0	14.0	.	A8K6L4|B5A926|Q16067|Q86W07|Q86W08	Splice_Site	DEL	ENST00000261937.6	hg19	CCDS4457.1																																																																																			.	.		0.641	FLT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253527.4		Intron
