#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
FHAD1	114827	hgsc.bcm.edu	37	1	15707915	15707915	+	Missense_Mutation	SNP	G	G	T			TCGA-2Y-A9H5-01A-11D-A382-10	TCGA-2Y-A9H5-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10106872-3169-465f-900a-b6e74debfc51	978cf657-0928-40db-9f1c-888305de2cbb	g.chr1:15707915G>T	ENST00000375998.4	+	28	3924	c.3924G>T	c.(3922-3924)ttG>ttT	p.L1308F	FHAD1_ENST00000314740.8_Missense_Mutation_p.L561F|FHAD1_ENST00000375999.3_Missense_Mutation_p.L1308F|FHAD1_ENST00000471347.1_3'UTR|FHAD1_ENST00000358897.4_Missense_Mutation_p.L1308F|FHAD1_ENST00000417793.1_Missense_Mutation_p.L1272F			B1AJZ9	FHAD1_HUMAN	forkhead-associated (FHA) phosphopeptide binding domain 1	1308										skin(1)|stomach(1)	2						AGGAGCTGTTGAGAGGATATG	0.547																																					p.L1308F		Atlas-SNP	.											.	FHAD1	78	.	0			c.G3924T						.						89.0	89.0	89.0					1																	15707915		692	1591	2283	SO:0001583	missense	114827	exon29			GCTGTTGAGAGGA	AK093300		1p36.21	2012-04-19			ENSG00000142621	ENSG00000142621			29408	protein-coding gene	gene with protein product						11572484	Standard	NM_052929		Approved	KIAA1937	uc001awb.2	B1AJZ9	OTTHUMG00000002088	ENST00000375998.4:c.3924G>T	chr1.hg19:g.15707915G>T	ENSP00000365166:p.Leu1308Phe	170.0	0.0		105.0	53.0	NM_052929	Q0P6F5|Q8N8D3|Q8N9T6|Q8NA05	Missense_Mutation	SNP	ENST00000375998.4	hg19		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	12.59|12.59	1.982308|1.982308	0.34942|0.34942	.|.	.|.	ENSG00000142621|ENSG00000142621	ENST00000358897;ENST00000417793;ENST00000375999;ENST00000375998;ENST00000529606;ENST00000314740;ENST00000314668|ENST00000444385	T;T;T;T;T;T;T|.	0.75589|.	-0.95;-0.92;-0.95;-0.95;-0.7;-0.68;-0.69|.	5.44|5.44	2.41|2.41	0.29592|0.29592	.|.	.|.	.|.	.|.	.|.	T|.	0.46288|.	0.1385|.	M|M	0.74258|0.74258	2.255|2.255	0.22446|0.22446	N|N	0.999093|0.999093	D;D|.	0.71674|.	0.996;0.998|.	P;D|.	0.64687|.	0.9;0.928|.	T|.	0.40175|.	-0.9577|.	9|.	0.66056|.	D|.	0.02|.	-6.8673|-6.8673	4.3817|4.3817	0.11297|0.11297	0.0857:0.1539:0.6012:0.1592|0.0857:0.1539:0.6012:0.1592	.|.	561;1308|.	B7WPP2;B1AJZ9|.	.;FHAD1_HUMAN|.	F|L	1308;1272;1308;1308;579;561;543|627	ENSP00000351770:L1308F;ENSP00000407615:L1272F;ENSP00000365167:L1308F;ENSP00000365166:L1308F;ENSP00000434909:L579F;ENSP00000322979:L561F;ENSP00000318812:L543F|.	ENSP00000318812:L543F|.	L|X	+|+	3|2	2|2	FHAD1|FHAD1	15580502|15580502	0.750000|0.750000	0.28316|0.28316	0.016000|0.016000	0.15963|0.15963	0.392000|0.392000	0.30506|0.30506	1.070000|1.070000	0.30653|0.30653	0.219000|0.219000	0.20840|0.20840	-0.181000|-0.181000	0.13052|0.13052	TTG|TGA	.	.		0.547	FHAD1-026	PUTATIVE	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000393400.2	NM_052929	
SPEN	23013	hgsc.bcm.edu	37	1	16257447	16257447	+	Missense_Mutation	SNP	G	G	T			TCGA-2Y-A9H5-01A-11D-A382-10	TCGA-2Y-A9H5-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10106872-3169-465f-900a-b6e74debfc51	978cf657-0928-40db-9f1c-888305de2cbb	g.chr1:16257447G>T	ENST00000375759.3	+	11	4916	c.4712G>T	c.(4711-4713)aGc>aTc	p.S1571I		NM_015001.2	NP_055816.2	Q96T58	MINT_HUMAN	spen family transcriptional repressor	1571					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|positive regulation of neurogenesis (GO:0050769)|positive regulation of transcription, DNA-templated (GO:0045893)|viral process (GO:0016032)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)|single-stranded DNA binding (GO:0003697)|transcription corepressor activity (GO:0003714)			NS(1)|breast(13)|central_nervous_system(3)|cervix(5)|endometrium(16)|kidney(18)|large_intestine(27)|liver(2)|lung(37)|ovary(7)|prostate(7)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	149		Colorectal(325;0.000258)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|Colorectal(212;5.96e-07)|COAD - Colon adenocarcinoma(227;3.11e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000115)|Kidney(64;0.000212)|KIRC - Kidney renal clear cell carcinoma(64;0.003)|STAD - Stomach adenocarcinoma(313;0.013)|READ - Rectum adenocarcinoma(331;0.0681)		GGAGCAAACAGCACAACTGAT	0.428																																					p.S1571I		Atlas-SNP	.											.	SPEN	374	.	0			c.G4712T						.						76.0	79.0	78.0					1																	16257447		2203	4300	6503	SO:0001583	missense	23013	exon11			CAAACAGCACAAC		CCDS164.1	1p36	2013-10-17	2013-10-17		ENSG00000065526	ENSG00000065526		"""RNA binding motif (RRM) containing"""	17575	protein-coding gene	gene with protein product		613484	"""SPEN homolog, transcriptional regulator (Drosophila)"", ""spen homolog, transcriptional regulator (Drosophila)"""			10451362, 11331609	Standard	NM_015001		Approved	KIAA0929, MINT, SHARP, RBM15C	uc001axk.1	Q96T58	OTTHUMG00000009376	ENST00000375759.3:c.4712G>T	chr1.hg19:g.16257447G>T	ENSP00000364912:p.Ser1571Ile	197.0	0.0		109.0	5.0	NM_015001	Q9H9A8|Q9NWH5|Q9UQ01|Q9Y556	Missense_Mutation	SNP	ENST00000375759.3	hg19	CCDS164.1	.	.	.	.	.	.	.	.	.	.	G	10.54	1.379420	0.24944	.	.	ENSG00000065526	ENST00000375759	T	0.10668	2.85	5.03	2.1	0.27182	.	.	.	.	.	T	0.06962	0.0177	L	0.27053	0.805	0.40985	D	0.9848	P	0.34780	0.468	B	0.29942	0.109	T	0.34502	-0.9826	9	0.52906	T	0.07	-4.2988	8.0954	0.30824	0.1442:0.131:0.7248:0.0	.	1571	Q96T58	MINT_HUMAN	I	1571	ENSP00000364912:S1571I	ENSP00000364912:S1571I	S	+	2	0	SPEN	16130034	1.000000	0.71417	0.106000	0.21319	0.012000	0.07955	2.845000	0.48254	0.284000	0.22305	0.563000	0.77884	AGC	.	.		0.428	SPEN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025993.1	NM_015001	
CSMD2	114784	hgsc.bcm.edu	37	1	33999415	33999415	+	Silent	SNP	T	T	C			TCGA-2Y-A9H5-01A-11D-A382-10	TCGA-2Y-A9H5-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10106872-3169-465f-900a-b6e74debfc51	978cf657-0928-40db-9f1c-888305de2cbb	g.chr1:33999415T>C	ENST00000373381.4	-	63	10148	c.9972A>G	c.(9970-9972)ggA>ggG	p.G3324G		NM_001281956.1|NM_052896.3	NP_001268885.1|NP_443128.2	Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2	3180						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(5)|breast(5)|central_nervous_system(3)|cervix(2)|endometrium(20)|haematopoietic_and_lymphoid_tissue(4)|kidney(9)|large_intestine(43)|lung(114)|ovary(8)|pancreas(1)|prostate(6)|skin(20)|upper_aerodigestive_tract(5)|urinary_tract(1)	246		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)				CAGGTGGGGTTCCACTCCAGG	0.557																																					p.G3180G		Atlas-SNP	.											.	CSMD2	946	.	0			c.A9540G						.						137.0	115.0	122.0					1																	33999415		2203	4300	6503	SO:0001819	synonymous_variant	114784	exon62			TGGGGTTCCACTC	AY210418	CCDS380.1, CCDS60082.1	1p34.3	2014-01-28			ENSG00000121904	ENSG00000121904			19290	protein-coding gene	gene with protein product		608398				11472063, 11572484	Standard	NM_001281956		Approved	KIAA1884	uc001bxn.1	Q7Z408	OTTHUMG00000011135	ENST00000373381.4:c.9972A>G	chr1.hg19:g.33999415T>C		125.0	0.0		78.0	43.0	NM_052896	B1AM50|E7EUA6|Q53TY4|Q5VT59|Q8N963|Q96Q03|Q9H4V7|Q9H4V8|Q9H4V9|Q9H4W0|Q9H4W1|Q9H4W2|Q9H4W3|Q9H4W4|Q9HCY5|Q9HCY6|Q9HCY7	Silent	SNP	ENST00000373381.4	hg19																																																																																				.	.		0.557	CSMD2-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_052896	
CYP4B1	1580	hgsc.bcm.edu	37	1	47276518	47276518	+	Missense_Mutation	SNP	G	G	T			TCGA-2Y-A9H5-01A-11D-A382-10	TCGA-2Y-A9H5-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10106872-3169-465f-900a-b6e74debfc51	978cf657-0928-40db-9f1c-888305de2cbb	g.chr1:47276518G>T	ENST00000271153.4	+	2	255	c.219G>T	c.(217-219)tgG>tgT	p.W73C	CYP4B1_ENST00000371919.4_Missense_Mutation_p.W73C|CYP4B1_ENST00000546128.1_3'UTR|CYP4B1_ENST00000371923.4_Missense_Mutation_p.W73C|CYP4B1_ENST00000452782.2_5'Flank			P13584	CP4B1_HUMAN	cytochrome P450, family 4, subfamily B, polypeptide 1	73					biphenyl metabolic process (GO:0018879)|exogenous drug catabolic process (GO:0042738)|fluorene metabolic process (GO:0018917)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	aromatase activity (GO:0070330)|drug binding (GO:0008144)|fluorene oxygenase activity (GO:0018585)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxygen binding (GO:0019825)			NS(2)|breast(1)|endometrium(2)|kidney(1)|large_intestine(12)|lung(9)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	36	Acute lymphoblastic leukemia(166;0.155)				Midazolam(DB00683)|Phenobarbital(DB01174)|Thiamine(DB00152)	TGGTGTCCTGGGCCCACCAGT	0.552																																					p.W73C		Atlas-SNP	.											.	CYP4B1	81	.	0			c.G219T						.						99.0	84.0	89.0					1																	47276518		2203	4300	6503	SO:0001583	missense	1580	exon2			GTCCTGGGCCCAC	BC017758	CCDS542.1, CCDS41328.1	1p33	2013-11-11	2003-01-14		ENSG00000142973	ENSG00000142973		"""Cytochrome P450s"""	2644	protein-coding gene	gene with protein product		124075	"""cytochrome P450, subfamily IVB, polypeptide 1"""				Standard	NM_000779		Approved		uc001cqn.4	P13584	OTTHUMG00000007984	ENST00000271153.4:c.219G>T	chr1.hg19:g.47276518G>T	ENSP00000271153:p.Trp73Cys	63.0	0.0		57.0	32.0	NM_000779	Q1HBI2|Q8TD85|Q8WWF2|Q8WWU9|Q8WWV0	Missense_Mutation	SNP	ENST00000271153.4	hg19	CCDS542.1	.	.	.	.	.	.	.	.	.	.	G	12.45	1.940218	0.34283	.	.	ENSG00000142973	ENST00000371923;ENST00000271153;ENST00000371919	T;T;T	0.79940	-1.32;-1.32;-0.36	5.35	4.44	0.53790	.	0.332477	0.34853	N	0.003624	D	0.86117	0.5856	L	0.54908	1.71	0.80722	D	1	D;B;B	0.89917	1.0;0.039;0.049	D;B;B	0.77004	0.989;0.067;0.111	D	0.85542	0.1216	10	0.44086	T	0.13	.	12.9384	0.58329	0.0796:0.0:0.9204:0.0	.	73;73;73	Q8IZB0;P13584-2;P13584	.;.;CP4B1_HUMAN	C	73	ENSP00000360991:W73C;ENSP00000271153:W73C;ENSP00000360987:W73C	ENSP00000271153:W73C	W	+	3	0	CYP4B1	47049105	1.000000	0.71417	0.850000	0.33497	0.670000	0.39368	4.439000	0.59968	1.278000	0.44430	-0.299000	0.09455	TGG	.	.		0.552	CYP4B1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000021911.1	NM_000779	
FCRL5	83416	hgsc.bcm.edu	37	1	157504613	157504613	+	Missense_Mutation	SNP	G	G	A			TCGA-2Y-A9H5-01A-11D-A382-10	TCGA-2Y-A9H5-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10106872-3169-465f-900a-b6e74debfc51	978cf657-0928-40db-9f1c-888305de2cbb	g.chr1:157504613G>A	ENST00000361835.3	-	8	1629	c.1472C>T	c.(1471-1473)aCa>aTa	p.T491I	FCRL5_ENST00000368191.3_Missense_Mutation_p.T406I|FCRL5_ENST00000356953.4_Missense_Mutation_p.T491I|FCRL5_ENST00000368189.3_Missense_Mutation_p.T491I|FCRL5_ENST00000368190.3_Missense_Mutation_p.T491I	NM_001195388.1|NM_031281.2	NP_001182317.1|NP_112571.2	Q96RD9	FCRL5_HUMAN	Fc receptor-like 5	491	Ig-like C2-type 5.				negative regulation of B cell receptor signaling pathway (GO:0050859)|negative regulation of release of sequestered calcium ion into cytosol (GO:0051280)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)				breast(5)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(45)|ovary(5)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	85	all_hematologic(112;0.0378)|Hepatocellular(266;0.178)	Prostate(1639;0.231)				ACAGTGAAGTGTCACAGTGGC	0.507																																					p.T491I		Atlas-SNP	.											.	FCRL5	177	.	0			c.C1472T						.						52.0	51.0	51.0					1																	157504613		2203	4300	6503	SO:0001583	missense	83416	exon8			TGAAGTGTCACAG	AF369794	CCDS1165.1	1q21	2013-01-11			ENSG00000143297	ENSG00000143297		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	18508	protein-coding gene	gene with protein product		605877				11027651, 11290337	Standard	NM_031281		Approved	FCRH5, IRTA2, BXMAS1, CD307e	uc009wsm.3	Q96RD9	OTTHUMG00000017481	ENST00000361835.3:c.1472C>T	chr1.hg19:g.157504613G>A	ENSP00000354691:p.Thr491Ile	93.0	0.0		223.0	125.0	NM_031281	A0N0M2|B7WNT9|B7WP94|Q495Q2|Q495Q4|Q5VYK9|Q6UY46	Missense_Mutation	SNP	ENST00000361835.3	hg19	CCDS1165.1	.	.	.	.	.	.	.	.	.	.	G	11.70	1.716459	0.30413	.	.	ENSG00000143297	ENST00000361835;ENST00000356953;ENST00000368190;ENST00000368191;ENST00000368189	T;T;T;T;T	0.16743	2.32;2.32;2.32;2.32;2.32	3.34	1.18	0.20946	Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.19967	0.0480	M	0.75777	2.31	0.09310	N	1	D;D;D;D;D;P	0.71674	0.997;0.998;0.997;0.973;0.991;0.91	D;D;D;P;P;P	0.72075	0.976;0.953;0.921;0.744;0.706;0.475	T	0.03662	-1.1015	9	0.41790	T	0.15	.	5.1908	0.15209	0.0:0.2524:0.5196:0.228	.	522;406;491;491;491;491	B4DW39;F5GXJ2;Q96RD9-3;A6NJE8;Q96RD9-4;Q96RD9	.;.;.;.;.;FCRL5_HUMAN	I	491;491;491;406;491	ENSP00000354691:T491I;ENSP00000349434:T491I;ENSP00000357173:T491I;ENSP00000357174:T406I;ENSP00000357172:T491I	ENSP00000349434:T491I	T	-	2	0	FCRL5	155771237	0.001000	0.12720	0.019000	0.16419	0.012000	0.07955	0.330000	0.19715	0.729000	0.32403	0.313000	0.20887	ACA	.	.		0.507	FCRL5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000046263.1	NM_031281	
POGK	57645	hgsc.bcm.edu	37	1	166818813	166818813	+	Missense_Mutation	SNP	G	G	A			TCGA-2Y-A9H5-01A-11D-A382-10	TCGA-2Y-A9H5-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10106872-3169-465f-900a-b6e74debfc51	978cf657-0928-40db-9f1c-888305de2cbb	g.chr1:166818813G>A	ENST00000367875.1	+	5	1357	c.997G>A	c.(997-999)Gaa>Aaa	p.E333K	POGK_ENST00000367876.4_Missense_Mutation_p.E333K|POGK_ENST00000537173.1_Missense_Mutation_p.E215K|POGK_ENST00000536514.1_Missense_Mutation_p.E248K			Q9P215	POGK_HUMAN	pogo transposable element with KRAB domain	333					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(2)|kidney(1)|large_intestine(8)|lung(4)|ovary(2)|prostate(1)|skin(3)|urinary_tract(1)	22						GCACCTGCCGGAAGACCTGAC	0.547																																					p.E333K	GBM(76;192 1530 30153 48742)	Atlas-SNP	.											.	POGK	54	.	0			c.G997A						.						77.0	80.0	79.0					1																	166818813		2203	4300	6503	SO:0001583	missense	57645	exon5			CTGCCGGAAGACC	AB040946	CCDS1254.1	1q23.2	2013-01-08			ENSG00000143157	ENSG00000143157		"""-"""	18800	protein-coding gene	gene with protein product	"""KRAB box domain containing 2"""						Standard	NM_017542		Approved	KIAA15131, LST003, BASS2, KRBOX2	uc001gdt.1	Q9P215	OTTHUMG00000034325	ENST00000367875.1:c.997G>A	chr1.hg19:g.166818813G>A	ENSP00000356849:p.Glu333Lys	95.0	0.0		111.0	55.0	NM_017542	Q5TIJ1|Q8TE07	Missense_Mutation	SNP	ENST00000367875.1	hg19	CCDS1254.1	.	.	.	.	.	.	.	.	.	.	G	14.06	2.423340	0.43020	.	.	ENSG00000143157	ENST00000537173;ENST00000536514;ENST00000367876;ENST00000367875	T;T;T;T	0.33654	1.41;1.4;4.66;4.66	5.5	4.59	0.56863	.	0.000000	0.52532	D	0.000077	T	0.08223	0.0205	N	0.14661	0.345	0.32819	D	0.502434	B;B;B	0.31837	0.175;0.342;0.068	B;B;B	0.31751	0.135;0.092;0.012	T	0.17077	-1.0381	8	.	.	.	-25.3765	7.5282	0.27668	0.0863:0.1672:0.7465:0.0	.	215;248;333	G3V1P0;B4DS22;Q9P215	.;.;POGK_HUMAN	K	215;248;333;333	ENSP00000442763:E215K;ENSP00000441187:E248K;ENSP00000356850:E333K;ENSP00000356849:E333K	.	E	+	1	0	POGK	165085437	0.041000	0.20044	0.612000	0.29024	0.909000	0.53808	0.867000	0.27968	1.551000	0.49450	0.655000	0.94253	GAA	.	.		0.547	POGK-003	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000082888.1	NM_017542	
RYR2	6262	hgsc.bcm.edu	37	1	237532889	237532889	+	Missense_Mutation	SNP	G	G	A			TCGA-2Y-A9H5-01A-11D-A382-10	TCGA-2Y-A9H5-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10106872-3169-465f-900a-b6e74debfc51	978cf657-0928-40db-9f1c-888305de2cbb	g.chr1:237532889G>A	ENST00000366574.2	+	6	682	c.365G>A	c.(364-366)cGc>cAc	p.R122H	RYR2_ENST00000542537.1_Missense_Mutation_p.R106H|RYR2_ENST00000360064.6_Missense_Mutation_p.R120H	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	122	MIR 1. {ECO:0000255|PROSITE- ProRule:PRU00131}.				BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)	p.R120H(1)		NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			ATATTGCTGCGCCATTCCTAT	0.463																																					p.R122H		Atlas-SNP	.											RYR2,colon,carcinoma,+1,1	RYR2	1273	.	1	Substitution - Missense(1)	central_nervous_system(1)	c.G365A						.						151.0	125.0	133.0					1																	237532889		1967	4162	6129	SO:0001583	missense	6262	exon6			TGCTGCGCCATTC	X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.365G>A	chr1.hg19:g.237532889G>A	ENSP00000355533:p.Arg122His	70.0	0.0		141.0	13.0	NM_001035	Q15411|Q546N8|Q5T3P2	Missense_Mutation	SNP	ENST00000366574.2	hg19	CCDS55691.1	.	.	.	.	.	.	.	.	.	.	G	34	5.316181	0.95655	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537	D;D;D	0.93659	-3.26;-3.26;-3.26	5.55	5.55	0.83447	Inositol 1,4,5-trisphosphate/ryanodine receptor (1);MIR motif (2);	0.000000	0.64402	D	0.000004	D	0.96738	0.8935	M	0.80183	2.485	0.80722	D	1	D	0.89917	1.0	D	0.71656	0.974	D	0.96962	0.9702	10	0.87932	D	0	.	18.6233	0.91328	0.0:0.0:1.0:0.0	.	122	Q92736	RYR2_HUMAN	H	122;120;106	ENSP00000355533:R122H;ENSP00000353174:R120H;ENSP00000443798:R106H	ENSP00000353174:R120H	R	+	2	0	RYR2	235599512	1.000000	0.71417	0.952000	0.39060	0.919000	0.55068	9.386000	0.97228	2.755000	0.94549	0.655000	0.94253	CGC	.	.		0.463	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095402.2	NM_001035	
AHCTF1	25909	hgsc.bcm.edu	37	1	247007207	247007207	+	Nonsense_Mutation	SNP	G	G	A	rs542305190		TCGA-2Y-A9H5-01A-11D-A382-10	TCGA-2Y-A9H5-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10106872-3169-465f-900a-b6e74debfc51	978cf657-0928-40db-9f1c-888305de2cbb	g.chr1:247007207G>A	ENST00000391829.2	-	34	6538	c.6415C>T	c.(6415-6417)Cag>Tag	p.Q2139*	AHCTF1_ENST00000326225.3_Nonsense_Mutation_p.Q2148*|AHCTF1_ENST00000470300.1_5'UTR|AHCTF1_ENST00000366508.1_Nonsense_Mutation_p.Q2174*			Q8WYP5	ELYS_HUMAN	AT hook containing transcription factor 1	2139	Disordered. {ECO:0000250}.|Necessary for nuclear localization. {ECO:0000250}.				cytokinesis (GO:0000910)|mitotic cell cycle (GO:0000278)|mRNA transport (GO:0051028)|nuclear pore complex assembly (GO:0051292)|protein transport (GO:0015031)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|kinetochore (GO:0000776)|nuclear matrix (GO:0016363)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(6)|cervix(3)|endometrium(8)|kidney(6)|large_intestine(12)|liver(2)|lung(21)|ovary(5)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	74	all_cancers(71;3.05e-05)|all_epithelial(71;6.72e-06)|Ovarian(71;0.0173)|Breast(184;0.0318)|all_lung(81;0.0458)|Lung NSC(105;0.0518)	all_cancers(173;0.0266)	OV - Ovarian serous cystadenocarcinoma(106;0.00271)			TCTTTCAGCTGTGCAGGAACC	0.318																																					p.Q2148X	Colon(145;197 1800 4745 15099 26333)	Atlas-SNP	.											.	AHCTF1	187	.	0			c.C6442T						.						61.0	60.0	60.0					1																	247007207		2202	4299	6501	SO:0001587	stop_gained	25909	exon34			TCAGCTGTGCAGG		CCDS1629.1, CCDS1629.2	1q44	2008-09-09			ENSG00000153207	ENSG00000153207			24618	protein-coding gene	gene with protein product	"""ELYS transcription factor like protein TMBS62"""	610853				11952839	Standard	NM_015446		Approved	ELYS	uc001ibv.2	Q8WYP5	OTTHUMG00000040706	ENST00000391829.2:c.6415C>T	chr1.hg19:g.247007207G>A	ENSP00000375705:p.Gln2139*	434.0	0.0		689.0	161.0	NM_015446	A6NGM0|A8MSG9|A8MZ86|Q7Z4E3|Q8IZA4|Q96EH9|Q9Y4Q6	Nonsense_Mutation	SNP	ENST00000391829.2	hg19		.	.	.	.	.	.	.	.	.	.	G	45	11.579505	0.99578	.	.	ENSG00000153207	ENST00000366508;ENST00000326225;ENST00000391829	.	.	.	4.86	3.89	0.44902	.	0.196774	0.36234	N	0.002712	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.19590	T	0.45	-4.3443	10.2343	0.43273	0.0:0.1432:0.71:0.1468	.	.	.	.	X	2174;2148;2139	.	ENSP00000355465:Q2148X	Q	-	1	0	AHCTF1	245073830	1.000000	0.71417	0.950000	0.38849	0.386000	0.30323	3.158000	0.50723	2.386000	0.81285	0.467000	0.42956	CAG	.	.		0.318	AHCTF1-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_015446	
SLC1A4	6509	hgsc.bcm.edu	37	2	65248223	65248223	+	Silent	SNP	C	C	T			TCGA-2Y-A9H5-01A-11D-A382-10	TCGA-2Y-A9H5-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10106872-3169-465f-900a-b6e74debfc51	978cf657-0928-40db-9f1c-888305de2cbb	g.chr2:65248223C>T	ENST00000234256.3	+	8	1785	c.1542C>T	c.(1540-1542)aaC>aaT	p.N514N	SLC1A4_ENST00000531327.1_Silent_p.N216N	NM_003038.4	NP_003029.2	P43007	SATT_HUMAN	solute carrier family 1 (glutamate/neutral amino acid transporter), member 4	514					amino acid transport (GO:0006865)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|cognition (GO:0050890)|glutamine transport (GO:0006868)|hydroxyproline transport (GO:0034589)|ion transport (GO:0006811)|L-alanine transport (GO:0015808)|L-cystine transport (GO:0015811)|L-serine transport (GO:0015825)|proline transmembrane transport (GO:0035524)|proline transport (GO:0015824)|synaptic transmission, glutamatergic (GO:0035249)|threonine transport (GO:0015826)|transmembrane transport (GO:0055085)	cell surface (GO:0009986)|centrosome (GO:0005813)|dendrite (GO:0030425)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intermediate filament (GO:0005882)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	chloride channel activity (GO:0005254)|L-alanine transmembrane transporter activity (GO:0015180)|L-cystine transmembrane transporter activity (GO:0015184)|L-glutamine transmembrane transporter activity (GO:0015186)|L-hydroxyproline transmembrane transporter activity (GO:0034590)|L-proline transmembrane transporter activity (GO:0015193)|L-serine transmembrane transporter activity (GO:0015194)|L-threonine transmembrane transporter activity (GO:0015195)|sodium:dicarboxylate symporter activity (GO:0017153)			breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(3)|pancreas(1)|prostate(1)|urinary_tract(1)	13					L-Alanine(DB00160)	CACACCAGAACCCCGCTGGCC	0.597																																					p.N514N		Atlas-SNP	.											.	SLC1A4	33	.	0			c.C1542T						.						77.0	75.0	75.0					2																	65248223		2203	4300	6503	SO:0001819	synonymous_variant	6509	exon8			CCAGAACCCCGCT		CCDS1879.1, CCDS54362.1	2p15-p13	2013-05-22			ENSG00000115902	ENSG00000115902		"""Solute carriers"""	10942	protein-coding gene	gene with protein product	"""alanine/serine/cysteine/threonine transporter"""	600229				7896285, 8910405	Standard	NM_003038		Approved	SATT, ASCT1	uc010yqa.2	P43007	OTTHUMG00000129537	ENST00000234256.3:c.1542C>T	chr2.hg19:g.65248223C>T		205.0	0.0		187.0	11.0	NM_003038	B7Z3C0|D6W5F0	Silent	SNP	ENST00000234256.3	hg19	CCDS1879.1																																																																																			.	.		0.597	SLC1A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251726.2	NM_003038	
LRP1B	53353	hgsc.bcm.edu	37	2	141457818	141457818	+	Splice_Site	SNP	C	C	T			TCGA-2Y-A9H5-01A-11D-A382-10	TCGA-2Y-A9H5-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10106872-3169-465f-900a-b6e74debfc51	978cf657-0928-40db-9f1c-888305de2cbb	g.chr2:141457818C>T	ENST00000389484.3	-	41	7771		c.e41+1			NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B						protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)			NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		ACTGTACTTACTTTCAACAAT	0.313										TSP Lung(27;0.18)																											.	Colon(99;50 2074 2507 20106)	Atlas-SNP	.											.	LRP1B	1315	.	0			c.6799+1G>A						.						70.0	73.0	72.0					2																	141457818		2203	4297	6500	SO:0001630	splice_region_variant	53353	exon42			TACTTACTTTCAA	AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.6799+1G>A	chr2.hg19:g.141457818C>T		46.0	0.0		73.0	37.0	NM_018557	Q8WY29|Q8WY30|Q8WY31	Splice_Site	SNP	ENST00000389484.3	hg19	CCDS2182.1	.	.	.	.	.	.	.	.	.	.	C	20.9	4.072492	0.76415	.	.	ENSG00000168702	ENST00000389484;ENST00000544579	.	.	.	3.95	3.95	0.45737	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.5232	0.84322	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	LRP1B	141174288	1.000000	0.71417	1.000000	0.80357	0.920000	0.55202	7.710000	0.84655	2.176000	0.68965	0.585000	0.79938	.	.	.		0.313	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254736.2	NM_018557	Intron
NEUROD1	4760	hgsc.bcm.edu	37	2	182543445	182543445	+	Missense_Mutation	SNP	G	G	A			TCGA-2Y-A9H5-01A-11D-A382-10	TCGA-2Y-A9H5-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10106872-3169-465f-900a-b6e74debfc51	978cf657-0928-40db-9f1c-888305de2cbb	g.chr2:182543445G>A	ENST00000295108.3	-	2	600	c.143C>T	c.(142-144)gCa>gTa	p.A48V	NEUROD1_ENST00000496876.1_Intron|CERKL_ENST00000479558.1_Intron	NM_002500.4	NP_002491.2	Q13562	NDF1_HUMAN	neuronal differentiation 1	48					amacrine cell differentiation (GO:0035881)|anterior/posterior pattern specification (GO:0009952)|cellular response to glucose stimulus (GO:0071333)|cerebellum development (GO:0021549)|dentate gyrus development (GO:0021542)|embryonic organ morphogenesis (GO:0048562)|endocrine pancreas development (GO:0031018)|enteroendocrine cell differentiation (GO:0035883)|glucose homeostasis (GO:0042593)|inner ear development (GO:0048839)|insulin secretion (GO:0030073)|negative regulation of JAK-STAT cascade (GO:0046426)|negative regulation of type B pancreatic cell apoptotic process (GO:2000675)|neurogenesis (GO:0022008)|nitric oxide mediated signal transduction (GO:0007263)|nucleocytoplasmic transport (GO:0006913)|pancreatic A cell fate commitment (GO:0003326)|pancreatic PP cell fate commitment (GO:0003329)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell differentiation (GO:0045597)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription regulatory region DNA binding (GO:2000679)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cell cycle arrest (GO:0071156)|regulation of insulin secretion (GO:0050796)|regulation of intestinal epithelial structure maintenance (GO:0060730)|response to drug (GO:0042493)|response to glucose (GO:0009749)|signal transduction involved in regulation of gene expression (GO:0023019)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|E-box binding (GO:0070888)|protein heterodimerization activity (GO:0046982)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription coactivator activity (GO:0001105)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)			endometrium(3)|kidney(1)|large_intestine(6)|lung(9)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25			OV - Ovarian serous cystadenocarcinoma(117;0.088)			GTCCTCCTCTGCGTTCATGGT	0.572																																					p.A48V		Atlas-SNP	.											.	NEUROD1	67	.	0			c.C143T						.						128.0	100.0	109.0					2																	182543445		2203	4300	6503	SO:0001583	missense	4760	exon2			TCCTCTGCGTTCA	U50823	CCDS2283.1	2q32	2013-05-21	2012-02-22		ENSG00000162992	ENSG00000162992		"""Basic helix-loop-helix proteins"""	7762	protein-coding gene	gene with protein product	"""beta-cell E-box transactivator 2"", ""neurogenic helix-loop-helix protein NEUROD"""	601724	"""neurogenic differentiation 1"""	NEUROD		7754368, 8786144	Standard	NM_002500		Approved	BETA2, BHF-1, NeuroD, bHLHa3, MODY6	uc002uof.4	Q13562	OTTHUMG00000132583	ENST00000295108.3:c.143C>T	chr2.hg19:g.182543445G>A	ENSP00000295108:p.Ala48Val	75.0	0.0		67.0	31.0	NM_002500	B2R9I8|F1T0E1|O00343|Q13340|Q5U095|Q96TH0|Q99455|Q9UEC8	Missense_Mutation	SNP	ENST00000295108.3	hg19	CCDS2283.1	.	.	.	.	.	.	.	.	.	.	G	14.41	2.527217	0.44969	.	.	ENSG00000162992	ENST00000295108	D	0.95238	-3.65	5.9	4.97	0.65823	.	0.924596	0.09179	N	0.837729	D	0.87533	0.6201	N	0.08118	0	0.09310	N	1	B	0.20671	0.047	B	0.10450	0.005	T	0.75800	-0.3190	10	0.34782	T	0.22	-0.1502	11.3896	0.49806	0.0:0.0:0.7135:0.2865	.	48	Q13562	NDF1_HUMAN	V	48	ENSP00000295108:A48V	ENSP00000295108:A48V	A	-	2	0	NEUROD1	182251690	0.055000	0.20627	0.812000	0.32479	0.927000	0.56198	1.051000	0.30417	2.788000	0.95919	0.650000	0.86243	GCA	.	.		0.572	NEUROD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255792.2	NM_002500	
DIS3L2	129563	hgsc.bcm.edu	37	2	232880381	232880381	+	Splice_Site	SNP	G	G	A			TCGA-2Y-A9H5-01A-11D-A382-10	TCGA-2Y-A9H5-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10106872-3169-465f-900a-b6e74debfc51	978cf657-0928-40db-9f1c-888305de2cbb	g.chr2:232880381G>A	ENST00000409307.1	+	2	210	c.210G>A	c.(208-210)caG>caA	p.Q70Q	DIS3L2_ENST00000325385.7_Splice_Site_p.Q70Q|DIS3L2_ENST00000409401.3_Splice_Site_p.Q70Q|AC105461.1_ENST00000413841.1_RNA|DIS3L2_ENST00000273009.6_Splice_Site_p.Q70Q|DIS3L2_ENST00000360410.4_Splice_Site_p.Q70Q					DIS3 like 3'-5' exoribonuclease 2											breast(2)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(7)|lung(18)|ovary(1)|prostate(2)|urinary_tract(1)	40		all_hematologic(139;0.00809)|Renal(207;0.0113)|Acute lymphoblastic leukemia(138;0.0195)|all_lung(227;0.0465)|Lung NSC(271;0.136)		Epithelial(121;1.6e-13)|BRCA - Breast invasive adenocarcinoma(100;0.00104)|LUSC - Lung squamous cell carcinoma(224;0.0109)|Lung(119;0.0149)		CACTCATCCAGGTGCTTAAAA	0.398																																					p.Q70Q		Atlas-SNP	.											.	DIS3L2	77	.	0			c.G210A						.						100.0	88.0	92.0					2																	232880381		1869	4109	5978	SO:0001630	splice_region_variant	129563	exon3			CATCCAGGTGCTT	BC026166	CCDS42834.1, CCDS58752.1, CCDS58753.1	2q37.1	2014-09-17	2014-03-05		ENSG00000144535	ENSG00000144535			28648	protein-coding gene	gene with protein product		614184	"""family with sequence similarity 6, member A"", ""DIS3 mitotic control homolog (S. cerevisiae)-like 2"""	FAM6A		22306653, 23503588	Standard	NM_152383		Approved	FLJ36974, MGC42174	uc010fxz.3	Q8IYB7	OTTHUMG00000153385	ENST00000409307.1:c.210+1G>A	chr2.hg19:g.232880381G>A		25.0	0.0		68.0	31.0	NM_001257282		Silent	SNP	ENST00000409307.1	hg19	CCDS42834.1																																																																																			.	.		0.398	DIS3L2-015	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330988.1	NM_152383	Silent
ROBO1	6091	hgsc.bcm.edu	37	3	78706267	78706267	+	Silent	SNP	C	C	T			TCGA-2Y-A9H5-01A-11D-A382-10	TCGA-2Y-A9H5-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10106872-3169-465f-900a-b6e74debfc51	978cf657-0928-40db-9f1c-888305de2cbb	g.chr3:78706267C>T	ENST00000464233.1	-	18	2708	c.2595G>A	c.(2593-2595)gaG>gaA	p.E865E	ROBO1_ENST00000467549.1_Silent_p.E829E|ROBO1_ENST00000495273.1_Silent_p.E829E|ROBO1_ENST00000436010.2_Silent_p.E826E	NM_002941.3	NP_002932.1	Q9Y6N7	ROBO1_HUMAN	roundabout, axon guidance receptor, homolog 1 (Drosophila)	865	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|axon guidance (GO:0007411)|axon midline choice point recognition (GO:0016199)|cell adhesion (GO:0007155)|cell migration involved in sprouting angiogenesis (GO:0002042)|chemorepulsion involved in postnatal olfactory bulb interneuron migration (GO:0021836)|homophilic cell adhesion (GO:0007156)|mammary duct terminal end bud growth (GO:0060763)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|negative regulation of negative chemotaxis (GO:0050925)|nervous system development (GO:0007399)|positive regulation of axonogenesis (GO:0050772)|Roundabout signaling pathway (GO:0035385)	axolemma (GO:0030673)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	axon guidance receptor activity (GO:0008046)|identical protein binding (GO:0042802)|LRR domain binding (GO:0030275)			breast(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(2)|lung(25)|urinary_tract(1)	44		Lung SC(41;0.0257)|Lung NSC(201;0.0439)		LUSC - Lung squamous cell carcinoma(21;0.008)|Epithelial(33;0.00999)|Lung(72;0.0177)|BRCA - Breast invasive adenocarcinoma(55;0.0274)		TGAACTGAGGCTCACTCTTTA	0.522																																					p.E865E		Atlas-SNP	.											.	ROBO1	833	.	0			c.G2595A						.						54.0	58.0	57.0					3																	78706267		2018	4182	6200	SO:0001819	synonymous_variant	6091	exon18			CTGAGGCTCACTC	AF040990	CCDS46872.1, CCDS46872.2, CCDS54610.1, CCDS54611.1	3p12.3	2013-02-11	2001-11-28		ENSG00000169855	ENSG00000169855		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	10249	protein-coding gene	gene with protein product		602430	"""roundabout (axon guidance receptor, Drosophila) homolog 1"""			9458045, 9608531	Standard	NM_002941		Approved	DUTT1, FLJ21882, SAX3	uc003dqe.2	Q9Y6N7	OTTHUMG00000158843	ENST00000464233.1:c.2595G>A	chr3.hg19:g.78706267C>T		65.0	0.0		61.0	25.0	NM_002941	B2RXI1|D3DU36|E9PD49|Q1RMC7|Q7Z300|Q9BUS7	Silent	SNP	ENST00000464233.1	hg19	CCDS54611.1																																																																																			.	.		0.522	ROBO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352610.1	NM_002941	
LRRC66	339977	hgsc.bcm.edu	37	4	52861214	52861214	+	Silent	SNP	G	G	A			TCGA-2Y-A9H5-01A-11D-A382-10	TCGA-2Y-A9H5-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10106872-3169-465f-900a-b6e74debfc51	978cf657-0928-40db-9f1c-888305de2cbb	g.chr4:52861214G>A	ENST00000343457.3	-	4	1980	c.1974C>T	c.(1972-1974)taC>taT	p.Y658Y		NM_001024611.1	NP_001019782.1	Q68CR7	LRC66_HUMAN	leucine rich repeat containing 66	658						integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(9)|kidney(1)|large_intestine(8)|lung(34)|ovary(1)|pancreas(1)|prostate(2)|skin(1)	58						TTGGGTCACCGTATGGAACCT	0.542																																					p.Y658Y		Atlas-SNP	.											.	LRRC66	128	.	0			c.C1974T						.						81.0	79.0	80.0					4																	52861214		2002	4162	6164	SO:0001819	synonymous_variant	339977	exon4			GTCACCGTATGGA	BC040414	CCDS43229.1	4q12	2008-08-08			ENSG00000188993	ENSG00000188993			34299	protein-coding gene	gene with protein product							Standard	XM_005265739		Approved		uc003gzi.3	Q68CR7	OTTHUMG00000160623	ENST00000343457.3:c.1974C>T	chr4.hg19:g.52861214G>A		35.0	0.0		44.0	21.0	NM_001024611		Silent	SNP	ENST00000343457.3	hg19	CCDS43229.1																																																																																			.	.		0.542	LRRC66-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361473.1	NM_001024611	
PAQR3	152559	hgsc.bcm.edu	37	4	79851430	79851430	+	Missense_Mutation	SNP	G	G	A			TCGA-2Y-A9H5-01A-11D-A382-10	TCGA-2Y-A9H5-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10106872-3169-465f-900a-b6e74debfc51	978cf657-0928-40db-9f1c-888305de2cbb	g.chr4:79851430G>A	ENST00000512733.1	-	3	611	c.398C>T	c.(397-399)tCa>tTa	p.S133L	PAQR3_ENST00000295462.3_Nonsense_Mutation_p.Q79*|PAQR3_ENST00000380645.4_Missense_Mutation_p.S133L	NM_001040202.1	NP_001035292.1	Q6TCH7	PAQR3_HUMAN	progestin and adipoQ receptor family member III	133					negative regulation of MAP kinase activity (GO:0043407)|negative regulation of neuron projection development (GO:0010977)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|negative regulation of protein phosphorylation (GO:0001933)|protein localization to Golgi apparatus (GO:0034067)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			breast(2)|central_nervous_system(1)|large_intestine(3)|lung(1)|upper_aerodigestive_tract(1)	8						TGTTTTTTCTGACCGATGGCA	0.363																																					p.S133L		Atlas-SNP	.											.	PAQR3	28	.	0			c.C398T						.						77.0	79.0	78.0					4																	79851430		2203	4300	6503	SO:0001583	missense	152559	exon3			TTTTCTGACCGAT	AK055774	CCDS34020.1	4q21	2008-02-05				ENSG00000163291			30130	protein-coding gene	gene with protein product		614577				16044242	Standard	XM_006714104		Approved		uc003hlp.1	Q6TCH7		ENST00000512733.1:c.398C>T	chr4.hg19:g.79851430G>A	ENSP00000421981:p.Ser133Leu	57.0	0.0		114.0	42.0	NM_001040202	A8K5B7|B3KP59|Q6PIQ1|Q86X05|Q8NCP9	Missense_Mutation	SNP	ENST00000512733.1	hg19	CCDS34020.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	38|38	6.756666|6.756666	0.97817|0.97817	.|.	.|.	ENSG00000163291|ENSG00000163291	ENST00000295462|ENST00000512733;ENST00000380645	.|T;T	.|0.29655	.|1.56;1.56	6.07|6.07	6.07|6.07	0.98685|0.98685	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	.|T	.|0.67382	.|0.2887	M|M	0.91818|0.91818	3.245|3.245	0.80722|0.80722	A|A	1|1	.|D	.|0.76494	.|0.999	.|D	.|0.83275	.|0.996	.|T	.|0.72887	.|-0.4156	.|9	0.87932|0.87932	D|D	0|0	-5.6583|-5.6583	20.6439|20.6439	0.99570|0.99570	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|133	.|Q6TCH7	.|PAQR3_HUMAN	X|L	79|133	.|ENSP00000421981:S133L;ENSP00000370019:S133L	ENSP00000295462:Q79X|ENSP00000344203:S133L	Q|S	-|-	1|2	0|0	PAQR3|PAQR3	80070454|80070454	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.985000|0.985000	0.73830|0.73830	9.835000|9.835000	0.99442|0.99442	2.884000|2.884000	0.98904|0.98904	0.655000|0.655000	0.94253|0.94253	CAG|TCA	.	.		0.363	PAQR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363442.1	NM_177453	
SEC31A	22872	hgsc.bcm.edu	37	4	83800020	83800020	+	Silent	SNP	G	G	A			TCGA-2Y-A9H5-01A-11D-A382-10	TCGA-2Y-A9H5-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10106872-3169-465f-900a-b6e74debfc51	978cf657-0928-40db-9f1c-888305de2cbb	g.chr4:83800020G>A	ENST00000395310.2	-	4	447	c.265C>T	c.(265-267)Ctg>Ttg	p.L89L	SEC31A_ENST00000513858.1_Silent_p.L89L|SEC31A_ENST00000326950.5_Silent_p.L89L|SEC31A_ENST00000508479.1_Silent_p.L89L|SEC31A_ENST00000509142.1_Silent_p.L89L|SEC31A_ENST00000436790.2_5'UTR|SEC31A_ENST00000505984.1_Silent_p.L89L|SEC31A_ENST00000348405.4_Silent_p.L89L|SEC31A_ENST00000443462.2_Silent_p.L84L|SEC31A_ENST00000505472.1_Silent_p.L89L|SEC31A_ENST00000311785.7_Silent_p.L89L|SEC31A_ENST00000500777.2_Silent_p.L89L|SEC31A_ENST00000432794.1_Silent_p.L89L|SEC31A_ENST00000448323.1_Silent_p.L89L|SEC31A_ENST00000508502.1_Silent_p.L89L|SEC31A_ENST00000355196.2_Silent_p.L89L	NM_001077207.2|NM_001077208.2|NM_014933.3	NP_001070675.1|NP_001070676.1|NP_055748.2	O94979	SC31A_HUMAN	SEC31 homolog A (S. cerevisiae)	89					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular protein metabolic process (GO:0044267)|COPII vesicle coating (GO:0048208)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER to Golgi vesicle-mediated transport (GO:0006888)|membrane organization (GO:0061024)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|protein transport (GO:0015031)|response to calcium ion (GO:0051592)	COPII vesicle coat (GO:0030127)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum exit site (GO:0070971)|endoplasmic reticulum membrane (GO:0005789)|ER to Golgi transport vesicle (GO:0030134)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)|intracellular membrane-bounded organelle (GO:0043231)|perinuclear region of cytoplasm (GO:0048471)|vesicle coat (GO:0030120)	calcium-dependent protein binding (GO:0048306)		SEC31A/ALK(3)|SEC31A/JAK2(4)	breast(1)	1		Hepatocellular(203;0.114)				CCTGCAATCAGAACTCCAGAG	0.368																																					p.L89L		Atlas-SNP	.											SEC31A_ENST00000432794,right_upper_lobe,carcinoma,0,2	SEC31A	227	.	0			c.C265T						.						69.0	68.0	68.0					4																	83800020		2203	4300	6503	SO:0001819	synonymous_variant	22872	exon4			CAATCAGAACTCC	AB018358	CCDS3596.1, CCDS3597.1, CCDS43244.1, CCDS47088.1, CCDS54773.1, CCDS75155.1, CCDS75156.1	4q21.3	2013-01-10	2006-10-05	2006-09-07	ENSG00000138674	ENSG00000138674		"""WD repeat domain containing"""	17052	protein-coding gene	gene with protein product		610257	"""SEC31-like 1 (S. cerevisiae)"", ""Sec31 homolog A (S. cerevisiae)"""	SEC31L1		10048485, 10788476	Standard	NM_001077206		Approved	KIAA0905, ABP125, ABP130	uc003hnh.3	O94979	OTTHUMG00000130297	ENST00000395310.2:c.265C>T	chr4.hg19:g.83800020G>A		285.0	1.0		341.0	127.0	NM_001077206	B4DIW6|B7ZKZ7|B7ZL00|H7C2W3|Q17RR5|Q5H9P6|Q5XG74|Q659G7|Q6ZU90|Q7LCX9|Q86TJ0|Q8IZH4|Q9P048|Q9P0A6|Q9UM05|Q9UM06	Silent	SNP	ENST00000395310.2	hg19	CCDS3596.1																																																																																			.	.		0.368	SEC31A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252640.1	NM_016211	
AGPAT9	84803	hgsc.bcm.edu	37	4	84502954	84502954	+	Missense_Mutation	SNP	A	A	T			TCGA-2Y-A9H5-01A-11D-A382-10	TCGA-2Y-A9H5-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10106872-3169-465f-900a-b6e74debfc51	978cf657-0928-40db-9f1c-888305de2cbb	g.chr4:84502954A>T	ENST00000395226.2	+	4	666	c.448A>T	c.(448-450)Ata>Tta	p.I150L	AGPAT9_ENST00000264409.4_Missense_Mutation_p.I150L	NM_001256421.1	NP_001243350.1	Q53EU6	GPAT3_HUMAN	1-acylglycerol-3-phosphate O-acyltransferase 9	150					CDP-diacylglycerol biosynthetic process (GO:0016024)|cellular lipid metabolic process (GO:0044255)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidic acid biosynthetic process (GO:0006654)|phospholipid metabolic process (GO:0006644)|regulation of TOR signaling (GO:0032006)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	1-acylglycerol-3-phosphate O-acyltransferase activity (GO:0003841)|glycerol-3-phosphate O-acyltransferase activity (GO:0004366)			endometrium(1)|kidney(1)|large_intestine(4)|lung(4)|skin(3)	13		Hepatocellular(203;0.114)				GCTGGGCGTCATAGTGCGCTA	0.448																																					p.I150L		Atlas-SNP	.											.	AGPAT9	41	.	0			c.A448T						.						239.0	225.0	230.0					4																	84502954		2203	4300	6503	SO:0001583	missense	84803	exon4			GGCGTCATAGTGC	AK055749	CCDS3606.1	4q21.23	2014-02-13	2008-01-29		ENSG00000138678	ENSG00000138678	2.3.1.15	"""1-acylglycerol-3-phosphate O-acyltransferases"""	28157	protein-coding gene	gene with protein product	"""lysophosphatidic acid acyltransferase, theta"""	610958	"""1-acylglycerol-3-phosphate O-acyltransferase 9 (lysophosphatidic acid acyltransferase, theta)"""			12975309	Standard	NM_001256421		Approved	MGC11324, LPAAT-theta, MAG1, HMFN0839	uc003how.4	Q53EU6	OTTHUMG00000130431	ENST00000395226.2:c.448A>T	chr4.hg19:g.84502954A>T	ENSP00000378651:p.Ile150Leu	89.0	0.0		118.0	42.0	NM_001256421	Q68CJ4|Q6GPI6|Q96NA3	Missense_Mutation	SNP	ENST00000395226.2	hg19	CCDS3606.1	.	.	.	.	.	.	.	.	.	.	A	2.573	-0.299238	0.05532	.	.	ENSG00000138678	ENST00000395226;ENST00000264409	T;T	0.39997	1.05;1.05	5.66	-7.66	0.01277	.	0.536654	0.21293	N	0.076927	T	0.11707	0.0285	N	0.12443	0.215	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.39035	-0.9633	10	0.02654	T	1	-0.0015	1.9387	0.03342	0.1604:0.3611:0.2368:0.2416	.	150	Q53EU6	GPAT3_HUMAN	L	150	ENSP00000378651:I150L;ENSP00000264409:I150L	ENSP00000264409:I150L	I	+	1	0	AGPAT9	84721978	0.000000	0.05858	0.034000	0.17996	0.963000	0.63663	-2.026000	0.01434	-1.373000	0.02134	-0.328000	0.08392	ATA	.	.		0.448	AGPAT9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252821.3	NM_032717	
NDST3	9348	hgsc.bcm.edu	37	4	119161760	119161760	+	Missense_Mutation	SNP	G	G	A			TCGA-2Y-A9H5-01A-11D-A382-10	TCGA-2Y-A9H5-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10106872-3169-465f-900a-b6e74debfc51	978cf657-0928-40db-9f1c-888305de2cbb	g.chr4:119161760G>A	ENST00000296499.5	+	11	2603	c.2200G>A	c.(2200-2202)Gag>Aag	p.E734K		NM_004784.2	NP_004775.1	O95803	NDST3_HUMAN	N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 3	734	Heparan sulfate N-sulfotransferase 3.				heparan sulfate proteoglycan biosynthetic process (GO:0015012)|heparin biosynthetic process (GO:0030210)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	[heparan sulfate]-glucosamine N-sulfotransferase activity (GO:0015016)|deacetylase activity (GO:0019213)			NS(1)|breast(3)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(23)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	54						TGCACCCTCGGAGCTCAGAGC	0.517																																					p.E734K		Atlas-SNP	.											.	NDST3	107	.	0			c.G2200A						.						78.0	75.0	76.0					4																	119161760		2203	4300	6503	SO:0001583	missense	9348	exon11			CCCTCGGAGCTCA	AF074924	CCDS3708.1	4q26	2008-08-04			ENSG00000164100	ENSG00000164100		"""Sulfotransferases, membrane-bound"""	7682	protein-coding gene	gene with protein product		603950				9915799	Standard	NM_004784		Approved	HSST3	uc003ibx.3	O95803	OTTHUMG00000132959	ENST00000296499.5:c.2200G>A	chr4.hg19:g.119161760G>A	ENSP00000296499:p.Glu734Lys	65.0	0.0		122.0	46.0	NM_004784	B4DI67|Q4W5C1|Q4W5D0|Q6UWC5|Q9UP21	Missense_Mutation	SNP	ENST00000296499.5	hg19	CCDS3708.1	.	.	.	.	.	.	.	.	.	.	G	0.050	-1.252808	0.01469	.	.	ENSG00000164100	ENST00000296499	T	0.54479	0.57	5.49	3.78	0.43462	Sulfotransferase domain (1);	0.331420	0.30890	N	0.008673	T	0.37348	0.1000	L	0.32530	0.975	0.80722	D	1	B	0.06786	0.001	B	0.13407	0.009	T	0.13098	-1.0522	10	0.07482	T	0.82	.	12.3309	0.55039	0.1373:0.0:0.8627:0.0	.	734	O95803	NDST3_HUMAN	K	734	ENSP00000296499:E734K	ENSP00000296499:E734K	E	+	1	0	NDST3	119381208	1.000000	0.71417	0.035000	0.18076	0.012000	0.07955	2.943000	0.49026	0.808000	0.34231	-0.150000	0.13652	GAG	.	.		0.517	NDST3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256517.4	NM_004784	
SLC10A7	84068	hgsc.bcm.edu	37	4	147431063	147431063	+	Splice_Site	SNP	A	A	T			TCGA-2Y-A9H5-01A-11D-A382-10	TCGA-2Y-A9H5-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10106872-3169-465f-900a-b6e74debfc51	978cf657-0928-40db-9f1c-888305de2cbb	g.chr4:147431063A>T	ENST00000507030.1	-	3	320		c.e3+1		SLC10A7_ENST00000264986.3_Intron|SLC10A7_ENST00000335472.7_Splice_Site|SLC10A7_ENST00000394059.4_Splice_Site|SLC10A7_ENST00000511315.1_Splice_Site|SLC10A7_ENST00000432059.2_Splice_Site|SLC10A7_ENST00000511374.1_Intron|SLC10A7_ENST00000394062.3_Splice_Site			Q0GE19	NTCP7_HUMAN	solute carrier family 10, member 7						sodium ion transport (GO:0006814)	integral component of membrane (GO:0016021)	symporter activity (GO:0015293)			endometrium(1)|kidney(3)|large_intestine(3)|lung(8)|skin(1)	16	all_hematologic(180;0.151)					ATTTAAACATACCCTTTTAAA	0.348																																					.		Atlas-SNP	.											.	SLC10A7	32	.	0			c.320+2T>A						.						61.0	64.0	63.0					4																	147431063		2203	4300	6503	SO:0001630	splice_region_variant	84068	exon4			AAACATACCCTTT	AY346324	CCDS3768.1, CCDS34073.1, CCDS75198.1	4q31.2	2013-07-18	2013-07-18	2006-12-19	ENSG00000120519	ENSG00000120519		"""Solute carriers"""	23088	protein-coding gene	gene with protein product		611459	"""chromosome 4 open reading frame 13"""	C4orf13		15932064	Standard	NM_032128		Approved	MGC25043, DKFZp566M114, DKFZp313H0531, DKFZp779O2438	uc003ikr.2	Q0GE19	OTTHUMG00000161437	ENST00000507030.1:c.320+1T>A	chr4.hg19:g.147431063A>T		113.0	0.0		128.0	51.0	NM_001029998	A7E2E6|A7MAX9|Q0VAP9|Q45NG1|Q45NG2|Q5H9S6|Q6P4E6|Q8IZ62|Q8NBP8|Q9H0M9	Splice_Site	SNP	ENST00000507030.1	hg19	CCDS34073.1	.	.	.	.	.	.	.	.	.	.	A	21.8	4.198209	0.79015	.	.	ENSG00000120519	ENST00000432059;ENST00000335472;ENST00000507030;ENST00000394062;ENST00000394059	.	.	.	5.1	5.1	0.69264	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.737	0.62824	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	SLC10A7	147650513	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.207000	0.72159	2.049000	0.60858	0.533000	0.62120	.	.	.		0.348	SLC10A7-009	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000366932.1	NM_032128	Intron
BRD9	65980	hgsc.bcm.edu	37	5	887508	887508	+	Missense_Mutation	SNP	T	T	A			TCGA-2Y-A9H5-01A-11D-A382-10	TCGA-2Y-A9H5-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10106872-3169-465f-900a-b6e74debfc51	978cf657-0928-40db-9f1c-888305de2cbb	g.chr5:887508T>A	ENST00000467963.1	-	6	851	c.685A>T	c.(685-687)Atc>Ttc	p.I229F	BRD9_ENST00000323510.4_Missense_Mutation_p.I113F|BRD9_ENST00000494422.1_5'Flank|BRD9_ENST00000388890.4_Missense_Mutation_p.I113F|BRD9_ENST00000483173.1_Missense_Mutation_p.I176F|BRD9_ENST00000435709.2_Missense_Mutation_p.I113F	NM_023924.4	NP_076413.3	Q9H8M2	BRD9_HUMAN	bromodomain containing 9	229					chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)		lysine-acetylated histone binding (GO:0070577)|nucleic acid binding (GO:0003676)			breast(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(11)|ovary(2)|pancreas(1)|prostate(3)	29			Epithelial(17;0.00202)|OV - Ovarian serous cystadenocarcinoma(19;0.00353)|all cancers(22;0.00815)|Lung(60;0.185)			GCGTGAAGGATCTTCTTCGCC	0.488																																					p.I229F		Atlas-SNP	.											.	BRD9	113	.	0			c.A685T						.						207.0	193.0	198.0					5																	887508		2203	4300	6503	SO:0001583	missense	65980	exon6			GAAGGATCTTCTT	AK023503	CCDS34127.1, CCDS34128.1, CCDS34127.2, CCDS34128.2	5p15.33	2008-02-05			ENSG00000028310	ENSG00000028310			25818	protein-coding gene	gene with protein product						12477932	Standard	NM_023924		Approved	FLJ13441	uc003jbq.3	Q9H8M2	OTTHUMG00000159258	ENST00000467963.1:c.685A>T	chr5.hg19:g.887508T>A	ENSP00000419765:p.Ile229Phe	72.0	0.0		73.0	17.0	NM_023924	A6NFY8|B4DMQ2|B4DR93|Q2XUS1|Q6UWU9|Q8IUS4|Q9H5Q5|Q9H7R9	Missense_Mutation	SNP	ENST00000467963.1	hg19	CCDS34127.2	.	.	.	.	.	.	.	.	.	.	t	12.76	2.034037	0.35893	.	.	ENSG00000028310	ENST00000323510;ENST00000388890;ENST00000483173;ENST00000467963;ENST00000435709;ENST00000489093	T;T;T;T;T;T	0.19669	2.13;2.13;2.13;2.13;2.13;2.13	5.35	4.17	0.49024	Bromodomain (3);	0.169713	0.51477	D	0.000089	T	0.15262	0.0368	N	0.08118	0	0.47374	D	0.999409	P;P;P;P	0.51791	0.948;0.723;0.724;0.942	B;B;B;P	0.48189	0.408;0.256;0.345;0.57	T	0.06427	-1.0827	10	0.87932	D	0	.	11.0832	0.48072	0.0:0.0:0.2968:0.7032	.	176;229;113;113	B4DMQ2;Q9H8M2;Q9H8M2-1;Q9H8M2-3	.;BRD9_HUMAN;.;.	F	113;113;176;229;113;113	ENSP00000323557:I113F;ENSP00000373542:I113F;ENSP00000419845:I176F;ENSP00000419765:I229F;ENSP00000402984:I113F;ENSP00000420722:I113F	ENSP00000323557:I113F	I	-	1	0	BRD9	940508	1.000000	0.71417	1.000000	0.80357	0.073000	0.16967	3.248000	0.51430	0.845000	0.35118	0.533000	0.62120	ATC	.	.		0.488	BRD9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354113.1	NM_023924	
EMB	133418	hgsc.bcm.edu	37	5	49695712	49695712	+	Missense_Mutation	SNP	A	A	G			TCGA-2Y-A9H5-01A-11D-A382-10	TCGA-2Y-A9H5-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10106872-3169-465f-900a-b6e74debfc51	978cf657-0928-40db-9f1c-888305de2cbb	g.chr5:49695712A>G	ENST00000303221.5	-	8	1162	c.947T>C	c.(946-948)gTc>gCc	p.V316A	EMB_ENST00000514111.1_Missense_Mutation_p.V266A|EMB_ENST00000508934.1_Missense_Mutation_p.V262A	NM_198449.2	NP_940851.1	Q6PCB8	EMB_HUMAN	embigin	316					cell adhesion (GO:0007155)|plasma membrane lactate transport (GO:0035879)	cell junction (GO:0030054)|integral component of plasma membrane (GO:0005887)|synapse (GO:0045202)	organic cyclic compound binding (GO:0097159)			breast(2)|endometrium(3)|large_intestine(4)|lung(4)|skin(2)	15	Lung SC(58;0.218)	Lung NSC(810;0.0795)				ATGCCTGGGGACATTATTTTC	0.269																																					p.V316A		Atlas-SNP	.											.	EMB	42	.	0			c.T947C						.						71.0	75.0	74.0					5																	49695712		2197	4284	6481	SO:0001583	missense	133418	exon8			CTGGGGACATTAT	BC059398	CCDS3953.1	5q11.1	2013-01-29	2010-06-24		ENSG00000170571	ENSG00000170571		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	30465	protein-coding gene	gene with protein product		615669	"""embigin homolog (mouse)"""			9438341	Standard	NM_198449		Approved	MGC71745	uc003jom.3	Q6PCB8	OTTHUMG00000131161	ENST00000303221.5:c.947T>C	chr5.hg19:g.49695712A>G	ENSP00000302289:p.Val316Ala	227.0	0.0		416.0	129.0	NM_198449	B7Z6S3|B7Z902	Missense_Mutation	SNP	ENST00000303221.5	hg19	CCDS3953.1	.	.	.	.	.	.	.	.	.	.	A	0.015	-1.540046	0.00934	.	.	ENSG00000170571	ENST00000303221;ENST00000510295;ENST00000508934;ENST00000514111	T;T;T	0.42513	0.97;0.99;1.0	4.33	-7.35	0.01422	.	1.418890	0.04651	N	0.407153	T	0.16085	0.0387	N	0.08118	0	0.09310	N	0.999999	B;B	0.10296	0.003;0.0	B;B	0.04013	0.001;0.001	T	0.10730	-1.0617	9	.	.	.	0.0166	1.9822	0.03429	0.4347:0.2233:0.2296:0.1125	.	262;316	D6RDX7;Q6PCB8	.;EMB_HUMAN	A	316;288;262;266	ENSP00000302289:V316A;ENSP00000425215:V262A;ENSP00000426404:V266A	.	V	-	2	0	EMB	49731469	0.017000	0.18338	0.005000	0.12908	0.588000	0.36517	-0.390000	0.07332	-1.442000	0.01955	-0.425000	0.05940	GTC	.	.		0.269	EMB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253853.1	NM_198449	
SRFBP1	153443	hgsc.bcm.edu	37	5	121355923	121355923	+	Missense_Mutation	SNP	A	A	G	rs374380607		TCGA-2Y-A9H5-01A-11D-A382-10	TCGA-2Y-A9H5-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10106872-3169-465f-900a-b6e74debfc51	978cf657-0928-40db-9f1c-888305de2cbb	g.chr5:121355923A>G	ENST00000339397.4	+	6	565	c.493A>G	c.(493-495)Atc>Gtc	p.I165V		NM_152546.2	NP_689759.2			serum response factor binding protein 1											central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(6)|skin(1)	15		all_cancers(142;0.0124)|Prostate(80;0.0322)	KIRC - Kidney renal clear cell carcinoma(527;0.206)	OV - Ovarian serous cystadenocarcinoma(64;0.000227)|Epithelial(69;0.000365)|all cancers(49;0.00517)		AGCAACTGTCATCAGTGAGCA	0.343																																					p.I165V		Atlas-SNP	.											.	SRFBP1	47	.	0			c.A493G						.	A	VAL/ILE	0,3744		0,0,1872	109.0	99.0	102.0		493	-5.1	0.0	5		102	1,8189		0,1,4094	no	missense	SRFBP1	NM_152546.2	29	0,1,5966	GG,GA,AA		0.0122,0.0,0.0084	benign	165/430	121355923	1,11933	1872	4095	5967	SO:0001583	missense	153443	exon6			ACTGTCATCAGTG	AK058015	CCDS43354.1	5q23.1	2006-12-21				ENSG00000151304			26333	protein-coding gene	gene with protein product	"""BUD22 homolog (S. cerevisiae)"""	610479				15492011	Standard	NM_152546		Approved	FLJ25286, p49, STRAP, BUD22, Rlb1	uc003kst.1	Q8NEF9		ENST00000339397.4:c.493A>G	chr5.hg19:g.121355923A>G	ENSP00000341324:p.Ile165Val	132.0	0.0		181.0	56.0	NM_152546		Missense_Mutation	SNP	ENST00000339397.4	hg19	CCDS43354.1	.	.	.	.	.	.	.	.	.	.	A	0.008	-1.895756	0.00522	0.0	1.22E-4	ENSG00000151304	ENST00000339397	.	.	.	5.2	-5.13	0.02884	.	1.855570	0.01872	N	0.037266	T	0.15478	0.0373	N	0.10664	0.02	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.14035	-1.0487	9	0.11485	T	0.65	8.3821	4.878	0.13665	0.4647:0.0:0.3207:0.2146	.	165	Q8NEF9	SRFB1_HUMAN	V	165	.	ENSP00000341324:I165V	I	+	1	0	SRFBP1	121383822	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	0.166000	0.16583	-1.012000	0.03387	-0.468000	0.05107	ATC	.	.		0.343	SRFBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371200.1	NM_152546	
TRPC7	57113	hgsc.bcm.edu	37	5	135692906	135692906	+	Missense_Mutation	SNP	G	G	A			TCGA-2Y-A9H5-01A-11D-A382-10	TCGA-2Y-A9H5-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10106872-3169-465f-900a-b6e74debfc51	978cf657-0928-40db-9f1c-888305de2cbb	g.chr5:135692906G>A	ENST00000513104.1	-	2	452	c.170C>T	c.(169-171)cCg>cTg	p.P57L	TRPC7_ENST00000426057.2_Missense_Mutation_p.P57L|TRPC7_ENST00000355180.3_Missense_Mutation_p.P57L	NM_020389.2	NP_065122.1	Q9HCX4	TRPC7_HUMAN	transient receptor potential cation channel, subfamily C, member 7	57					axon guidance (GO:0007411)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|manganese ion transport (GO:0006828)|platelet activation (GO:0030168)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)			NS(1)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(18)|ovary(1)|prostate(3)	46			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			CCGGACCACCGGGATGTTGCC	0.607																																					p.P57L		Atlas-SNP	.											.	TRPC7	126	.	0			c.C170T						.						95.0	108.0	103.0					5																	135692906		2158	4275	6433	SO:0001583	missense	57113	exon2			ACCACCGGGATGT	AJ272034	CCDS47267.1, CCDS47267.2, CCDS54905.1, CCDS54906.1	5q31.2	2011-12-14			ENSG00000069018	ENSG00000069018		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	20754	protein-coding gene	gene with protein product						11805119, 16382100	Standard	NM_020389		Approved		uc003lbn.2	Q9HCX4	OTTHUMG00000162035	ENST00000513104.1:c.170C>T	chr5.hg19:g.135692906G>A	ENSP00000426070:p.Pro57Leu	67.0	0.0		79.0	24.0	NM_001167576	A1A4Z4|F5H5U9|Q70T26|Q8IWP7	Missense_Mutation	SNP	ENST00000513104.1	hg19	CCDS47267.2	.	.	.	.	.	.	.	.	.	.	G	26.2	4.713245	0.89112	.	.	ENSG00000069018	ENST00000355180;ENST00000426057;ENST00000513104;ENST00000265193	T;T;T	0.70749	-0.51;-0.51;-0.51	5.2	5.2	0.72013	Ankyrin repeat-containing domain (3);	0.000000	0.85682	D	0.000000	T	0.80507	0.4636	L	0.42744	1.35	0.58432	D	0.999999	D;D;D;D	0.89917	1.0;0.995;1.0;1.0	D;P;D;D	0.91635	0.999;0.798;0.992;0.992	T	0.81516	-0.0897	10	0.66056	D	0.02	-18.1038	18.9316	0.92568	0.0:0.0:1.0:0.0	.	57;57;57;57	Q8IWP7;F5H5U9;Q70T25;Q9HCX4	.;.;.;TRPC7_HUMAN	L	57	ENSP00000347312:P57L;ENSP00000441628:P57L;ENSP00000426070:P57L	ENSP00000265193:P57L	P	-	2	0	TRPC7	135720805	1.000000	0.71417	0.967000	0.41034	0.997000	0.91878	9.657000	0.98554	2.691000	0.91804	0.655000	0.94253	CCG	.	.		0.607	TRPC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366975.1	NM_020389	
PCDH12	51294	hgsc.bcm.edu	37	5	141324975	141324976	+	Missense_Mutation	DNP	CT	CT	TG	rs13188049|rs3833449		TCGA-2Y-A9H5-01A-11D-A382-10	TCGA-2Y-A9H5-10A-01D-A385-10	C|T	C|T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10106872-3169-465f-900a-b6e74debfc51	978cf657-0928-40db-9f1c-888305de2cbb	g.chr5:141324975_141324976CT>TG	ENST00000231484.3	-	4	4735_4736	c.3525_3526AG>CA	c.(3523-3528)agAGgc>agCAgc	p.1175_1176RG>SS		NM_016580.2	NP_057664.1	Q9NPG4	PCD12_HUMAN	protocadherin 12	1175					calcium-dependent cell-cell adhesion (GO:0016339)|glycogen metabolic process (GO:0005977)|homophilic cell adhesion (GO:0007156)|labyrinthine layer development (GO:0060711)|neuron recognition (GO:0008038)	cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(14)|ovary(3)|prostate(2)|skin(1)	38		all_hematologic(541;0.0999)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ctgctgctgcctctgctCTTGC	0.584																																					p.G1176S|p.R1175S		Atlas-SNP	.											.	PCDH12	133	.	0			c.G3526A|c.A3525C						.																																			SO:0001583	missense	51294	exon4			TGCTGCCTCTGCT|GCTGCCTCTGCTC	AF231025	CCDS4269.1	5q31.3	2010-01-26			ENSG00000113555	ENSG00000113555		"""Cadherins / Protocadherins : Non-clustered"""	8657	protein-coding gene	gene with protein product		605622				10716726, 10380929	Standard	NM_016580		Approved	VE-cadherin-2	uc003llx.3	Q9NPG4	OTTHUMG00000129658	ENST00000231484.3:c.3525_3526delinsTG	chr5.hg19:g.141324975_141324976delinsTG	ENSP00000231484:p.R1175_G1176delinsSS	95.0|100.0	0.0		72.0	10.0|9.0	NM_016580	Q6UXB6|Q96KB8|Q9H7Y6|Q9H8E0	Missense_Mutation	SNP	ENST00000231484.3	hg19	CCDS4269.1																																																																																			.	.		0.584	PCDH12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251858.1	NM_016580	
DSP	1832	hgsc.bcm.edu	37	6	7585481	7585481	+	Silent	SNP	C	C	T			TCGA-2Y-A9H5-01A-11D-A382-10	TCGA-2Y-A9H5-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10106872-3169-465f-900a-b6e74debfc51	978cf657-0928-40db-9f1c-888305de2cbb	g.chr6:7585481C>T	ENST00000379802.3	+	24	8327	c.7986C>T	c.(7984-7986)caC>caT	p.H2662H	DSP_ENST00000418664.2_Silent_p.H2063H	NM_004415.2	NP_004406.2	P15924	DESP_HUMAN	desmoplakin	2662	4.5 X 38 AA tandem repeats (Domain C).|Globular 2.				adherens junction organization (GO:0034332)|apoptotic process (GO:0006915)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|desmosome organization (GO:0002934)|epidermis development (GO:0008544)|intermediate filament organization (GO:0045109)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)|protein localization to adherens junction (GO:0071896)|regulation of heart rate by cardiac conduction (GO:0086091)|single organismal cell-cell adhesion (GO:0016337)|ventricular cardiac muscle cell action potential (GO:0086005)|ventricular compact myocardium morphogenesis (GO:0003223)|wound healing (GO:0042060)	basolateral plasma membrane (GO:0016323)|cornified envelope (GO:0001533)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|intercalated disc (GO:0014704)|intermediate filament (GO:0005882)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)|protein binding, bridging (GO:0030674)|protein kinase C binding (GO:0005080)|scaffold protein binding (GO:0097110)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			biliary_tract(1)|breast(6)|central_nervous_system(7)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(16)|liver(2)|lung(27)|ovary(4)|prostate(1)|skin(8)|stomach(3)|upper_aerodigestive_tract(7)|urinary_tract(5)	101	Ovarian(93;0.0584)	all_hematologic(90;0.236)		OV - Ovarian serous cystadenocarcinoma(45;0.000508)		GCATCATCCACCCAACCACGG	0.562																																					p.H2662H		Atlas-SNP	.											.	DSP	306	.	0			c.C7986T						.						93.0	90.0	91.0					6																	7585481		2203	4300	6503	SO:0001819	synonymous_variant	1832	exon24			CATCCACCCAACC	J05211	CCDS4501.1, CCDS47368.1	6p24.3	2014-09-17	2003-05-20		ENSG00000096696	ENSG00000096696			3052	protein-coding gene	gene with protein product		125647	"""desmoplakin (DPI, DPII)"""			1889810	Standard	NM_004415		Approved	KPPS2, PPKS2, DPI, DPII	uc003mxp.1	P15924	OTTHUMG00000014212	ENST00000379802.3:c.7986C>T	chr6.hg19:g.7585481C>T		144.0	0.0		249.0	65.0	NM_004415	B2RTT2|D7RX09|O75993|Q14189|Q9UHN4	Silent	SNP	ENST00000379802.3	hg19	CCDS4501.1																																																																																			.	.		0.562	DSP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039786.2	NM_004415	
HIST1H3F	8968	hgsc.bcm.edu	37	6	26250518	26250518	+	Missense_Mutation	SNP	C	C	T			TCGA-2Y-A9H5-01A-11D-A382-10	TCGA-2Y-A9H5-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10106872-3169-465f-900a-b6e74debfc51	978cf657-0928-40db-9f1c-888305de2cbb	g.chr6:26250518C>T	ENST00000446824.2	-	1	317	c.316G>A	c.(316-318)Gag>Aag	p.E106K	HIST1H2BH_ENST00000356350.2_5'Flank	NM_021018.2	NP_066298.1	P68431	H31_HUMAN	histone cluster 1, H3f	106					blood coagulation (GO:0007596)|chromatin organization (GO:0006325)|DNA replication-dependent nucleosome assembly (GO:0006335)|regulation of gene silencing (GO:0060968)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)			lung(6)|urinary_tract(1)	7						TTGGTGTCCTCAAAGAGCCCC	0.602											OREG0017241	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.E106K		Atlas-SNP	.											.	HIST1H3F	16	.	0			c.G316A						.						103.0	100.0	101.0					6																	26250518		2203	4300	6503	SO:0001583	missense	8968	exon1			TGTCCTCAAAGAG	Z80786	CCDS4600.1	6p22.1	2011-01-27	2006-10-11	2003-03-14	ENSG00000256316	ENSG00000277775		"""Histones / Replication-dependent"""	4773	protein-coding gene	gene with protein product		602816	"""H3 histone family, member I"", ""histone 1, H3f"""	H3FI		9119399, 12408966	Standard	NM_021018		Approved	H3/i	uc003nhg.1	P68431	OTTHUMG00000014435	ENST00000446824.2:c.316G>A	chr6.hg19:g.26250518C>T	ENSP00000444823:p.Glu106Lys	125.0	0.0	785	149.0	7.0	NM_021018	A0PJT7|A5PLR1|P02295|P02296|P16106|Q6ISV8|Q6NWP8|Q6NWP9|Q6NXU4|Q71DJ3|Q93081	Missense_Mutation	SNP	ENST00000446824.2	hg19	CCDS4600.1	.	.	.	.	.	.	.	.	.	.	.	14.31	2.497506	0.44455	.	.	ENSG00000256316	ENST00000446824	T	0.71341	-0.56	4.82	4.82	0.62117	.	.	.	.	.	T	0.79305	0.4423	.	.	.	0.46901	D	0.999242	.	.	.	.	.	.	T	0.81895	-0.0723	6	0.87932	D	0	.	17.7536	0.88442	0.0:1.0:0.0:0.0	.	.	.	.	K	106	ENSP00000444823:E106K	ENSP00000444823:E106K	E	-	1	0	HIST1H3F	26358497	1.000000	0.71417	1.000000	0.80357	0.247000	0.25773	7.666000	0.83877	2.602000	0.87976	0.561000	0.74099	GAG	.	.		0.602	HIST1H3F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040098.1	NM_021018	
OR11A1	26531	hgsc.bcm.edu	37	6	29394996	29394996	+	Silent	SNP	C	C	A			TCGA-2Y-A9H5-01A-11D-A382-10	TCGA-2Y-A9H5-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10106872-3169-465f-900a-b6e74debfc51	978cf657-0928-40db-9f1c-888305de2cbb	g.chr6:29394996C>A	ENST00000377149.1	-	5	895	c.423G>T	c.(421-423)cgG>cgT	p.R141R	OR11A1_ENST00000377148.1_Silent_p.R141R|OR11A1_ENST00000377147.2_Silent_p.R141R|OR5V1_ENST00000377154.1_Intron			Q9GZK7	O11A1_HUMAN	olfactory receptor, family 11, subfamily A, member 1	141						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			cervix(1)|large_intestine(1)|lung(12)|ovary(1)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)	19						GCCCCATGTACCGTCTGGGCC	0.577																																					p.R141R		Atlas-SNP	.											.	OR11A1	30	.	0			c.G423T						.						73.0	81.0	78.0					6																	29394996		1507	2708	4215	SO:0001819	synonymous_variant	26531	exon1			CATGTACCGTCTG		CCDS34363.1	6p22.2-p21.31	2014-02-19	2002-02-28		ENSG00000204694	ENSG00000204694		"""GPCR / Class A : Olfactory receptors"""	8176	protein-coding gene	gene with protein product			"""olfactory receptor, family 11, subfamily A, member 2"""	OR11A2			Standard	XM_005249001		Approved	hs6M1-18	uc003nmg.3	Q9GZK7	OTTHUMG00000031225	ENST00000377149.1:c.423G>T	chr6.hg19:g.29394996C>A		66.0	0.0		120.0	35.0	NM_013937	A2BF33|A6NFQ3|B0S7T2|Q5ST16|Q9GZK8	Silent	SNP	ENST00000377149.1	hg19	CCDS34363.1																																																																																			.	.		0.577	OR11A1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000193778.1		
DAAM2	23500	hgsc.bcm.edu	37	6	39824089	39824089	+	Missense_Mutation	SNP	G	G	A			TCGA-2Y-A9H5-01A-11D-A382-10	TCGA-2Y-A9H5-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10106872-3169-465f-900a-b6e74debfc51	978cf657-0928-40db-9f1c-888305de2cbb	g.chr6:39824089G>A	ENST00000398904.2	+	2	193	c.11G>A	c.(10-12)cGc>cAc	p.R4H	DAAM2_ENST00000274867.4_Missense_Mutation_p.R4H|DAAM2_ENST00000405961.3_Missense_Mutation_p.R4H|DAAM2_ENST00000494405.1_3'UTR|DAAM2_ENST00000538976.1_Missense_Mutation_p.R4H			Q86T65	DAAM2_HUMAN	dishevelled associated activator of morphogenesis 2	4					actin cytoskeleton organization (GO:0030036)|determination of left/right symmetry (GO:0007368)					NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(9)|lung(18)|ovary(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(5)	49	Ovarian(28;0.0355)|Colorectal(47;0.196)					ATGGCCCCCCGCAAGAGGAGC	0.617																																					p.R4H		Atlas-SNP	.											DAAM2,rectum,NS,0,1	DAAM2	101	.	0			c.G11A						.						20.0	23.0	22.0					6																	39824089		1992	4156	6148	SO:0001583	missense	23500	exon2			CCCCCCGCAAGAG	AB002379	CCDS54999.1, CCDS56426.1	6p21.1	2008-07-30			ENSG00000146122	ENSG00000146122			18143	protein-coding gene	gene with protein product		606627				11779461, 12632087	Standard	NM_015345		Approved	KIAA0381	uc003oow.3	Q86T65	OTTHUMG00000014653	ENST00000398904.2:c.11G>A	chr6.hg19:g.39824089G>A	ENSP00000381876:p.Arg4His	88.0	0.0		114.0	5.0	NM_015345	G5EA45|Q5T4T8|Q5T4U0|Q9NQI5|Q9Y4G0	Missense_Mutation	SNP	ENST00000398904.2	hg19	CCDS56426.1	.	.	.	.	.	.	.	.	.	.	G	25.3	4.623445	0.87460	.	.	ENSG00000146122	ENST00000274867;ENST00000398904;ENST00000538976;ENST00000405961	D;D;D	0.81499	-1.5;-1.5;-1.5	5.92	5.05	0.67936	.	0.106857	0.64402	N	0.000012	T	0.80003	0.4544	M	0.66939	2.045	0.47737	D	0.999501	B;B;D	0.69078	0.003;0.002;0.997	B;B;P	0.52481	0.005;0.002;0.7	T	0.83021	-0.0167	10	0.66056	D	0.02	.	13.9184	0.63916	0.074:0.0:0.926:0.0	.	4;4;4	G5EA45;Q86T65;F2Z2Q2	.;DAAM2_HUMAN;.	H	4	ENSP00000274867:R4H;ENSP00000381876:R4H;ENSP00000437808:R4H	ENSP00000274867:R4H	R	+	2	0	DAAM2	39932067	1.000000	0.71417	1.000000	0.80357	0.733000	0.41908	6.243000	0.72384	1.499000	0.48617	0.655000	0.94253	CGC	.	.		0.617	DAAM2-003	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000280648.1		
GFRAL	389400	hgsc.bcm.edu	37	6	55264182	55264182	+	Missense_Mutation	SNP	C	C	T			TCGA-2Y-A9H5-01A-11D-A382-10	TCGA-2Y-A9H5-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10106872-3169-465f-900a-b6e74debfc51	978cf657-0928-40db-9f1c-888305de2cbb	g.chr6:55264182C>T	ENST00000340465.2	+	8	1150	c.1064C>T	c.(1063-1065)gCt>gTt	p.A355V		NM_207410.2	NP_997293.2	Q6UXV0	GFRAL_HUMAN	GDNF family receptor alpha like	355					negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of neuron apoptotic process (GO:0043524)|stress-activated protein kinase signaling cascade (GO:0031098)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|breast(1)|endometrium(2)|kidney(5)|large_intestine(2)|liver(1)|lung(31)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)	48	Lung NSC(77;0.0875)|Renal(3;0.122)		LUSC - Lung squamous cell carcinoma(124;0.23)			GTAATCTATGCTGCCATGTGC	0.323																																					p.A355V		Atlas-SNP	.											.	GFRAL	91	.	0			c.C1064T						.						80.0	80.0	80.0					6																	55264182		2203	4300	6503	SO:0001583	missense	389400	exon8			TCTATGCTGCCAT	AY358198	CCDS4957.1	6p12.1	2007-06-22			ENSG00000187871	ENSG00000187871			32789	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 144"""	C6orf144		16086688	Standard	NM_207410		Approved	GRAL, UNQ9356, bA360D14.1	uc003pcm.1	Q6UXV0	OTTHUMG00000014900	ENST00000340465.2:c.1064C>T	chr6.hg19:g.55264182C>T	ENSP00000343636:p.Ala355Val	167.0	0.0		316.0	91.0	NM_207410	Q5VTF6	Missense_Mutation	SNP	ENST00000340465.2	hg19	CCDS4957.1	.	.	.	.	.	.	.	.	.	.	C	10.86	1.469728	0.26423	.	.	ENSG00000187871	ENST00000340465	T	0.35236	1.32	5.79	0.807	0.18714	.	0.936787	0.08873	N	0.881279	T	0.05181	0.0138	N	0.14661	0.345	0.09310	N	1	B	0.17852	0.024	B	0.12837	0.008	T	0.42137	-0.9469	10	0.10111	T	0.7	-1.0493	4.3899	0.11335	0.0:0.4131:0.3197:0.2672	.	355	Q6UXV0	GFRAL_HUMAN	V	355	ENSP00000343636:A355V	ENSP00000343636:A355V	A	+	2	0	GFRAL	55372141	0.000000	0.05858	0.000000	0.03702	0.960000	0.62799	-0.372000	0.07504	0.063000	0.16370	0.655000	0.94253	GCT	.	.		0.323	GFRAL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040995.2	NM_207410	
MALSU1	115416	hgsc.bcm.edu	37	7	23338995	23338995	+	Silent	SNP	G	G	A			TCGA-2Y-A9H5-01A-11D-A382-10	TCGA-2Y-A9H5-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10106872-3169-465f-900a-b6e74debfc51	978cf657-0928-40db-9f1c-888305de2cbb	g.chr7:23338995G>A	ENST00000466681.1	+	1	177	c.24G>A	c.(22-24)gcG>gcA	p.A8A	MALSU1_ENST00000479974.1_Intron	NM_138446.1	NP_612455.1	Q96EH3	MASU1_HUMAN	mitochondrial assembly of ribosomal large subunit 1	8					negative regulation of mitochondrial translation (GO:0070130)|ribosomal large subunit biogenesis (GO:0042273)	mitochondrion (GO:0005739)											GCCGTGTGGCGCGGCTGCTCG	0.721																																					p.A8A		Atlas-SNP	.											.	.	.	.	0			c.G24A						.						6.0	8.0	7.0					7																	23338995		1921	4002	5923	SO:0001819	synonymous_variant	115416	exon1			TGTGGCGCGGCTG	BC012331	CCDS5381.1	7p15.3	2013-05-24	2012-02-20	2012-02-20	ENSG00000156928	ENSG00000156928			21721	protein-coding gene	gene with protein product		614624	"""chromosome 7 open reading frame 30"""	C7orf30		22238376, 22238375	Standard	NM_138446		Approved	mtRsfA	uc003swd.1	Q96EH3	OTTHUMG00000128443	ENST00000466681.1:c.24G>A	chr7.hg19:g.23338995G>A		89.0	0.0		104.0	9.0	NM_138446	A4D154	Silent	SNP	ENST00000466681.1	hg19	CCDS5381.1																																																																																			.	.		0.721	MALSU1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250241.2	NM_138446	
NRCAM	4897	hgsc.bcm.edu	37	7	107875102	107875102	+	Missense_Mutation	SNP	G	G	T			TCGA-2Y-A9H5-01A-11D-A382-10	TCGA-2Y-A9H5-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10106872-3169-465f-900a-b6e74debfc51	978cf657-0928-40db-9f1c-888305de2cbb	g.chr7:107875102G>T	ENST00000425651.2	-	3	154	c.155C>A	c.(154-156)tCt>tAt	p.S52Y	NRCAM_ENST00000413765.2_Missense_Mutation_p.S52Y|NRCAM_ENST00000379028.3_Missense_Mutation_p.S52Y|NRCAM_ENST00000379024.4_Missense_Mutation_p.S52Y|NRCAM_ENST00000351718.4_Missense_Mutation_p.S46Y|NRCAM_ENST00000379022.4_Missense_Mutation_p.S52Y	NM_001037132.2	NP_001032209.1	Q92823	NRCAM_HUMAN	neuronal cell adhesion molecule	52	Ig-like 1.				angiogenesis (GO:0001525)|axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|axonogenesis (GO:0007409)|central nervous system development (GO:0007417)|clustering of voltage-gated sodium channels (GO:0045162)|heterotypic cell-cell adhesion (GO:0034113)|neuron migration (GO:0001764)|neuronal action potential propagation (GO:0019227)|positive regulation of neuron differentiation (GO:0045666)|protein localization (GO:0008104)|regulation of axon extension (GO:0030516)|retinal ganglion cell axon guidance (GO:0031290)|single organismal cell-cell adhesion (GO:0016337)|synapse assembly (GO:0007416)	axon initial segment (GO:0043194)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|synapse (GO:0045202)	ankyrin binding (GO:0030506)			breast(4)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(8)|liver(1)|lung(36)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(4)	65						ATCTTTTGGAGACTGTTGGGT	0.363																																					p.S52Y		Atlas-SNP	.											.	NRCAM	267	.	0			c.C155A						.						107.0	115.0	112.0					7																	107875102		2203	4300	6503	SO:0001583	missense	4897	exon3			TTTGGAGACTGTT		CCDS5751.1, CCDS47686.1, CCDS55153.1, CCDS75652.1	7q31	2013-02-11			ENSG00000091129	ENSG00000091129		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	7994	protein-coding gene	gene with protein product	"""NgCAM-related cell adhesion molecule"""	601581				8812479	Standard	NM_001037132		Approved	KIAA0343, Bravo	uc022aka.1	Q92823	OTTHUMG00000154973	ENST00000425651.2:c.155C>A	chr7.hg19:g.107875102G>T	ENSP00000401244:p.Ser52Tyr	62.0	0.0		97.0	25.0	NM_001037132	A4D0S3|E9PDA4|O15051|O15179|Q14BM2|Q9UHI3|Q9UHI4	Missense_Mutation	SNP	ENST00000425651.2	hg19	CCDS47686.1	.	.	.	.	.	.	.	.	.	.	G	33	5.256128	0.95336	.	.	ENSG00000091129	ENST00000379032;ENST00000379028;ENST00000413765;ENST00000537765;ENST00000351718;ENST00000379024;ENST00000425651;ENST00000379022;ENST00000445979;ENST00000417701;ENST00000442580;ENST00000419936;ENST00000456431;ENST00000418239	T;T;T;T;T;T;T;T;T;T	0.68903	2.49;2.49;2.49;2.49;2.49;2.49;2.49;-0.36;-0.36;-0.36	5.61	5.61	0.85477	Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	D	0.84741	0.5539	M	0.84433	2.695	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0	D	0.86207	0.1622	10	0.87932	D	0	.	19.9997	0.97405	0.0:0.0:1.0:0.0	.	52;52;52;46;52	Q92823-5;Q92823-3;E9PDA4;Q92823-4;Q92823	.;.;.;.;NRCAM_HUMAN	Y	52;52;52;52;46;52;52;52;46;46;52;46;46;52	ENSP00000368314:S52Y;ENSP00000407858:S52Y;ENSP00000325269:S46Y;ENSP00000368310:S52Y;ENSP00000401244:S52Y;ENSP00000368308:S52Y;ENSP00000390421:S46Y;ENSP00000390868:S52Y;ENSP00000397544:S46Y;ENSP00000408203:S46Y	ENSP00000325269:S46Y	S	-	2	0	NRCAM	107662338	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	9.813000	0.99286	2.813000	0.96785	0.655000	0.94253	TCT	.	.		0.363	NRCAM-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337942.2	NM_001037132	
AGPAT5	55326	hgsc.bcm.edu	37	8	6566226	6566226	+	Missense_Mutation	SNP	C	C	T			TCGA-2Y-A9H5-01A-11D-A382-10	TCGA-2Y-A9H5-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10106872-3169-465f-900a-b6e74debfc51	978cf657-0928-40db-9f1c-888305de2cbb	g.chr8:6566226C>T	ENST00000285518.6	+	1	349	c.37C>T	c.(37-39)Cgc>Tgc	p.R13C	CTD-2541M15.1_ENST00000522897.1_RNA|CTD-2541M15.1_ENST00000527490.1_RNA|CTD-2541M15.1_ENST00000525186.1_RNA	NM_018361.3	NP_060831.2	Q9NUQ2	PLCE_HUMAN	1-acylglycerol-3-phosphate O-acyltransferase 5	13					CDP-diacylglycerol biosynthetic process (GO:0016024)|cellular lipid metabolic process (GO:0044255)|glycerophospholipid biosynthetic process (GO:0046474)|hematopoietic progenitor cell differentiation (GO:0002244)|phosphatidic acid biosynthetic process (GO:0006654)|phospholipid biosynthetic process (GO:0008654)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	1-acylglycerol-3-phosphate O-acyltransferase activity (GO:0003841)		AGPAT5/MCPH1(2)	endometrium(2)|kidney(2)|large_intestine(4)|lung(3)	11			STAD - Stomach adenocarcinoma(24;0.0578)	READ - Rectum adenocarcinoma(644;0.156)|COAD - Colon adenocarcinoma(149;0.191)		GTACTCCATGCGCTACCTGCT	0.721																																					p.R13C		Atlas-SNP	.											.	AGPAT5	31	.	0			c.C37T						.						28.0	27.0	27.0					8																	6566226		2202	4299	6501	SO:0001583	missense	55326	exon1			TCCATGCGCTACC	AF375789	CCDS34796.1	8p23.1	2013-02-05	2013-02-05		ENSG00000155189	ENSG00000155189	2.3.1.51	"""1-acylglycerol-3-phosphate O-acyltransferases"""	20886	protein-coding gene	gene with protein product	"""lysophosphatidic acid acyltransferase, epsilon"""	614796	"""1-acylglycerol-3-phosphate O-acyltransferase 5 (lysophosphatidic acid acyltransferase, epsilon)"""				Standard	NM_018361		Approved	FLJ11210, LPAAT-e, LPAAT-epsilon	uc003wqo.3	Q9NUQ2	OTTHUMG00000163656	ENST00000285518.6:c.37C>T	chr8.hg19:g.6566226C>T	ENSP00000285518:p.Arg13Cys	39.0	0.0		22.0	7.0	NM_018361	Q8IZ47|Q9BQG4	Missense_Mutation	SNP	ENST00000285518.6	hg19	CCDS34796.1	.	.	.	.	.	.	.	.	.	.	c	13.61	2.289508	0.40494	.	.	ENSG00000155189	ENST00000285518;ENST00000518327	T	0.33865	1.39	3.86	2.96	0.34315	.	0.119093	0.64402	U	0.000017	T	0.53642	0.1809	M	0.76574	2.34	0.80722	D	1	D;D	0.89917	1.0;1.0	P;D	0.66602	0.88;0.945	T	0.50320	-0.8842	10	0.36615	T	0.2	-5.8326	10.4172	0.44329	0.197:0.803:0.0:0.0	.	13;13	E5RH21;Q9NUQ2	.;PLCE_HUMAN	C	13;5	ENSP00000285518:R13C	ENSP00000285518:R13C	R	+	1	0	AGPAT5	6553634	1.000000	0.71417	0.788000	0.31933	0.684000	0.39900	5.431000	0.66507	0.577000	0.29470	0.297000	0.19635	CGC	.	.		0.721	AGPAT5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374684.1	NM_018361	
NRG1	3084	hgsc.bcm.edu	37	8	32600258	32600258	+	Intron	SNP	C	C	A			TCGA-2Y-A9H5-01A-11D-A382-10	TCGA-2Y-A9H5-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10106872-3169-465f-900a-b6e74debfc51	978cf657-0928-40db-9f1c-888305de2cbb	g.chr8:32600258C>A	ENST00000405005.3	+	7	700				NRG1_ENST00000287845.5_Intron|NRG1_ENST00000341377.5_Intron|NRG1_ENST00000521670.1_Intron|NRG1_ENST00000519301.1_Intron|NRG1_ENST00000520502.2_Missense_Mutation_p.S288Y|NRG1_ENST00000520407.1_Missense_Mutation_p.S414Y|NRG1_ENST00000539990.1_Intron|NRG1_ENST00000338921.4_Intron|NRG1_ENST00000356819.4_Intron|NRG1_ENST00000287842.3_Intron|NRG1_ENST00000523079.1_Intron			Q02297	NRG1_HUMAN	neuregulin 1						activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|cardiac conduction system development (GO:0003161)|cardiac muscle cell differentiation (GO:0055007)|cardiac muscle cell myoblast differentiation (GO:0060379)|cell communication (GO:0007154)|cell migration (GO:0016477)|cell morphogenesis (GO:0000902)|cell proliferation (GO:0008283)|cellular protein complex disassembly (GO:0043624)|embryo development (GO:0009790)|endocardial cell differentiation (GO:0060956)|epidermal growth factor receptor signaling pathway (GO:0007173)|ERBB signaling pathway (GO:0038127)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glial cell fate commitment (GO:0021781)|innate immune response (GO:0045087)|locomotory behavior (GO:0007626)|mammary gland development (GO:0030879)|MAPK cascade (GO:0000165)|negative regulation of cardiac muscle cell apoptotic process (GO:0010667)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of secretion (GO:0051048)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|neural crest cell development (GO:0014032)|neuron fate commitment (GO:0048663)|neurotransmitter receptor metabolic process (GO:0045213)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peripheral nervous system development (GO:0007422)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell growth (GO:0030307)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of Ras protein signal transduction (GO:0046579)|positive regulation of striated muscle cell differentiation (GO:0051155)|regulation of protein heterodimerization activity (GO:0043497)|regulation of protein homodimerization activity (GO:0043496)|synapse assembly (GO:0007416)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|ventricular cardiac muscle cell differentiation (GO:0055012)|ventricular trabecula myocardium morphogenesis (GO:0003222)|wound healing (GO:0042060)	apical plasma membrane (GO:0016324)|axon (GO:0030424)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)	cytokine activity (GO:0005125)|ErbB-3 class receptor binding (GO:0043125)|growth factor activity (GO:0008083)|protein tyrosine kinase activator activity (GO:0030296)|receptor binding (GO:0005102)|receptor tyrosine kinase binding (GO:0030971)|transcription cofactor activity (GO:0003712)|transmembrane receptor protein tyrosine kinase activator activity (GO:0030297)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(18)|ovary(1)|prostate(1)|skin(1)	39		Breast(100;0.203)		KIRC - Kidney renal clear cell carcinoma(67;0.0768)|Kidney(114;0.0943)		TACAGTACGTCCACTCCCTTT	0.463																																					p.S414Y		Atlas-SNP	.											.	NRG1	260	.	0			c.C1241A						.						289.0	240.0	257.0					8																	32600258		2203	4300	6503	SO:0001627	intron_variant	3084	exon5			GTACGTCCACTCC	L12261	CCDS6084.1, CCDS6085.1, CCDS6086.1, CCDS6087.1, CCDS47836.1, CCDS55218.1, CCDS55219.1, CCDS75727.1	8p21-p12	2014-06-23			ENSG00000157168	ENSG00000157168		"""Immunoglobulin superfamily / I-set domain containing"""	7997	protein-coding gene	gene with protein product		142445	"""NRG1 intronic transcript 2 (non-protein coding)"""	HGL, NRG1-IT2		1350381, 8095334	Standard	NM_013962		Approved	HRG, NDF, GGF	uc003xiu.2	Q02297	OTTHUMG00000163918	ENST00000405005.3:c.700+665C>A	chr8.hg19:g.32600258C>A		44.0	0.0		50.0	22.0	NM_013962	A5YAK4|A5YAK5|A8K1L2|B7Z4Z3|E9PHH4|O14667|P98202|Q02298|Q02299|Q07110|Q07111|Q12779|Q12780|Q12781|Q12782|Q12783|Q12784|Q15491|Q7RTV9|Q7RTW0|Q7RTW1|Q7RTW2|Q8NFN1|Q8NFN2|Q8NFN3|Q9UPE3	Missense_Mutation	SNP	ENST00000405005.3	hg19	CCDS6085.1	.	.	.	.	.	.	.	.	.	.	C	22.5	4.304664	0.81136	.	.	ENSG00000157168	ENST00000520407;ENST00000520502	T	0.77098	-1.07	6.03	6.03	0.97812	.	.	.	.	.	T	0.78470	0.4288	N	0.08118	0	0.80722	D	1	D;D;D;D	0.89917	0.999;1.0;1.0;1.0	D;D;D;D	0.91635	0.996;0.999;0.998;0.999	T	0.77656	-0.2506	8	.	.	.	.	20.5568	0.99304	0.0:1.0:0.0:0.0	.	198;288;233;414	B0FWZ3;Q02297-10;Q02297-8;Q02297-9	.;.;.;.	Y	414;288	ENSP00000434640:S414Y	.	S	+	2	0	NRG1	32719800	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.794000	0.85869	2.861000	0.98227	0.655000	0.94253	TCC	.	.		0.463	NRG1-017	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000472504.1		
PREX2	80243	hgsc.bcm.edu	37	8	68965476	68965476	+	Missense_Mutation	SNP	G	G	A			TCGA-2Y-A9H5-01A-11D-A382-10	TCGA-2Y-A9H5-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10106872-3169-465f-900a-b6e74debfc51	978cf657-0928-40db-9f1c-888305de2cbb	g.chr8:68965476G>A	ENST00000288368.4	+	9	1365	c.1088G>A	c.(1087-1089)cGg>cAg	p.R363Q	PREX2_ENST00000529398.1_3'UTR	NM_024870.2|NM_025170.4	NP_079146.2|NP_079446.3	Q70Z35	PREX2_HUMAN	phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 2	363					adult locomotory behavior (GO:0008344)|dendrite morphogenesis (GO:0048813)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|positive regulation of Rac GTPase activity (GO:0032855)		Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)	p.R363Q(2)		NS(6)|biliary_tract(1)|breast(4)|endometrium(11)|kidney(16)|large_intestine(25)|liver(4)|lung(57)|ovary(2)|pancreas(4)|prostate(3)|skin(42)|upper_aerodigestive_tract(1)|urinary_tract(2)	178						AGAGAACGGCGGAAAGGTGGG	0.373																																					p.R363Q		Atlas-SNP	.											PREX2_ENST00000354677,NS,carcinoma,0,6	PREX2	614	.	2	Substitution - Missense(2)	lung(2)	c.G1088A						.						107.0	104.0	105.0					8																	68965476		2203	4300	6503	SO:0001583	missense	80243	exon9			AACGGCGGAAAGG	AK024079	CCDS6201.1	8q13.1	2014-06-13	2008-09-15	2008-09-15	ENSG00000046889	ENSG00000046889		"""Rho guanine nucleotide exchange factors"""	22950	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 129"""	612139	"""DEP domain containing 2"""	DEPDC2		15304342, 15304343	Standard	NM_024870		Approved	DEP.2, FLJ12987, P-REX2, PPP1R129	uc003xxv.1	Q70Z35	OTTHUMG00000164402	ENST00000288368.4:c.1088G>A	chr8.hg19:g.68965476G>A	ENSP00000288368:p.Arg363Gln	112.0	0.0		246.0	62.0	NM_025170	B4DFX0|Q32KL0|Q32KL1|Q6R7Q3|Q6R7Q4|Q9H805|Q9H961	Missense_Mutation	SNP	ENST00000288368.4	hg19	CCDS6201.1	.	.	.	.	.	.	.	.	.	.	G	36	5.643888	0.96704	.	.	ENSG00000046889	ENST00000288368;ENST00000396539;ENST00000354677	T	0.61040	0.14	5.74	5.74	0.90152	Pleckstrin homology domain (1);	0.000000	0.85682	D	0.000000	T	0.74114	0.3674	L	0.54323	1.7	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;0.999;1.0	T	0.74197	-0.3743	10	0.62326	D	0.03	.	19.9189	0.97077	0.0:0.0:1.0:0.0	.	363;363;363	Q70Z35-2;Q70Z35;Q70Z35-3	.;PREX2_HUMAN;.	Q	363	ENSP00000288368:R363Q	ENSP00000288368:R363Q	R	+	2	0	PREX2	69128030	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.869000	0.99810	2.707000	0.92482	0.655000	0.94253	CGG	.	.		0.373	PREX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378620.1	NM_025170	
DCSTAMP	81501	hgsc.bcm.edu	37	8	105360974	105360974	+	Missense_Mutation	SNP	G	G	T	rs149253106		TCGA-2Y-A9H5-01A-11D-A382-10	TCGA-2Y-A9H5-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10106872-3169-465f-900a-b6e74debfc51	978cf657-0928-40db-9f1c-888305de2cbb	g.chr8:105360974G>T	ENST00000297581.2	+	2	243	c.194G>T	c.(193-195)tGg>tTg	p.W65L	DPYS_ENST00000521601.1_Intron|DCSTAMP_ENST00000517991.1_Missense_Mutation_p.W65L	NM_030788.3	NP_110415.1	Q9H295	DCSTP_HUMAN	dendrocyte expressed seven transmembrane protein	65					cellular response to interleukin-4 (GO:0071353)|cellular response to macrophage colony-stimulating factor stimulus (GO:0036006)|cellular response to tumor necrosis factor (GO:0071356)|membrane fusion (GO:0061025)|myeloid dendritic cell differentiation (GO:0043011)|negative regulation of cell growth (GO:0030308)|osteoclast differentiation (GO:0030316)|osteoclast fusion (GO:0072675)|positive regulation of bone resorption (GO:0045780)|positive regulation of macrophage fusion (GO:0034241)|positive regulation of monocyte differentiation (GO:0045657)	cell surface (GO:0009986)|endoplasmic reticulum membrane (GO:0005789)|endosome membrane (GO:0010008)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)											GCTGCCTCCTGGATTATCACG	0.507																																					p.W65L		Atlas-SNP	.											.	.	.	.	0			c.G194T						.						134.0	121.0	125.0					8																	105360974		2203	4300	6503	SO:0001583	missense	81501	exon2			CCTCCTGGATTAT	AF305068	CCDS6301.1, CCDS59111.1	8q22.3	2012-08-10	2012-03-27	2012-03-27	ENSG00000164935	ENSG00000164935			18549	protein-coding gene	gene with protein product	"""Dendritic cells (DC)-specific transmembrane protein"", ""IL-Four INDuced"""	605933	"""transmembrane 7 superfamily member 4"""	TM7SF4		11169400, 11345591	Standard	NM_030788		Approved	DC-STAMP, FIND	uc003ylx.2	Q9H295	OTTHUMG00000164890	ENST00000297581.2:c.194G>T	chr8.hg19:g.105360974G>T	ENSP00000297581:p.Trp65Leu	65.0	0.0		128.0	18.0	NM_001257317	B7ZVW2|E7ESG0|Q2M2D5	Missense_Mutation	SNP	ENST00000297581.2	hg19	CCDS6301.1	.	.	.	.	.	.	.	.	.	.	G	25.0	4.587901	0.86851	.	.	ENSG00000164935	ENST00000297581;ENST00000517991	T	0.27890	1.64	5.84	4.93	0.64822	.	0.372666	0.28279	N	0.015924	T	0.50154	0.1599	M	0.69823	2.125	0.48236	D	0.999617	D	0.65815	0.995	P	0.59703	0.862	T	0.44436	-0.9328	9	.	.	.	-11.3121	15.3565	0.74431	0.0:0.1382:0.8618:0.0	.	65	Q9H295	TM7S4_HUMAN	L	65	ENSP00000297581:W65L	.	W	+	2	0	TM7SF4	105430150	1.000000	0.71417	0.931000	0.37212	0.019000	0.09904	3.852000	0.55934	2.779000	0.95612	0.655000	0.94253	TGG	.	G|1.000;A|0.000		0.507	DCSTAMP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380810.1	NM_030788	
KLHL38	340359	hgsc.bcm.edu	37	8	124659239	124659239	+	Missense_Mutation	SNP	T	T	C			TCGA-2Y-A9H5-01A-11D-A382-10	TCGA-2Y-A9H5-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10106872-3169-465f-900a-b6e74debfc51	978cf657-0928-40db-9f1c-888305de2cbb	g.chr8:124659239T>C	ENST00000325995.7	-	2	1389	c.1366A>G	c.(1366-1368)Aga>Gga	p.R456G	CTD-2552K11.2_ENST00000524355.1_RNA	NM_001081675.2	NP_001075144.2	Q2WGJ6	KLH38_HUMAN	kelch-like family member 38	456								p.R456G(1)		breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(9)|lung(16)|pancreas(1)|prostate(3)|stomach(1)	38						CACGAGTTTCTGGAAATGTGA	0.438																																					p.R456G		Atlas-SNP	.											KLHL38,NS,carcinoma,0,1	KLHL38	81	.	1	Substitution - Missense(1)	lung(1)	c.A1366G						.						173.0	166.0	169.0					8																	124659239		1946	4139	6085	SO:0001583	missense	340359	exon2			AGTTTCTGGAAAT		CCDS43766.1	8q24.13	2013-02-22	2013-02-22		ENSG00000175946	ENSG00000175946		"""Kelch-like"", ""BTB/POZ domain containing"""	34435	protein-coding gene	gene with protein product			"""kelch-like 38 (Drosophila)"""				Standard	NM_001081675		Approved	C8ORFK36	uc003yqs.1	Q2WGJ6	OTTHUMG00000164983	ENST00000325995.7:c.1366A>G	chr8.hg19:g.124659239T>C	ENSP00000321475:p.Arg456Gly	115.0	0.0		167.0	75.0	NM_001081675	A0PK12	Missense_Mutation	SNP	ENST00000325995.7	hg19	CCDS43766.1	.	.	.	.	.	.	.	.	.	.	t	13.15	2.151622	0.38021	.	.	ENSG00000175946	ENST00000325995	T	0.66280	-0.2	5.04	5.04	0.67666	Kelch-type beta propeller (1);	0.093858	0.64402	D	0.000002	T	0.55940	0.1952	L	0.47716	1.5	0.44555	D	0.997517	B	0.11235	0.004	B	0.09377	0.004	T	0.52815	-0.8525	10	0.37606	T	0.19	.	14.8202	0.70068	0.0:0.0:0.0:1.0	.	456	Q2WGJ6	KLH38_HUMAN	G	456	ENSP00000321475:R456G	ENSP00000321475:R456G	R	-	1	2	KLHL38	124728420	1.000000	0.71417	1.000000	0.80357	0.900000	0.52787	4.090000	0.57693	1.916000	0.55485	0.370000	0.22315	AGA	.	.		0.438	KLHL38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381288.1		
TMEM2	23670	hgsc.bcm.edu	37	9	74327050	74327050	+	Silent	SNP	G	G	C			TCGA-2Y-A9H5-01A-11D-A382-10	TCGA-2Y-A9H5-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10106872-3169-465f-900a-b6e74debfc51	978cf657-0928-40db-9f1c-888305de2cbb	g.chr9:74327050G>C	ENST00000377044.4	-	16	3257	c.2718C>G	c.(2716-2718)tcC>tcG	p.S906S	TMEM2_ENST00000377066.5_Silent_p.S843S	NM_001135820.1|NM_013390.2	NP_001129292.1|NP_037522.1	Q9UHN6	TMEM2_HUMAN	transmembrane protein 2	906					multicellular organismal development (GO:0007275)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(15)|liver(1)|lung(19)|ovary(2)|prostate(5)|skin(1)|stomach(1)|urinary_tract(2)	56		all_epithelial(88;4.56e-14)|Myeloproliferative disorder(762;0.0255)		GBM - Glioblastoma multiforme(74;7.45e-21)|OV - Ovarian serous cystadenocarcinoma(323;1.02e-16)		TTATCTGCCAGGAATTCTTCA	0.423																																					p.S906S		Atlas-SNP	.											.	TMEM2	112	.	0			c.C2718G						.						123.0	116.0	119.0					9																	74327050		2203	4300	6503	SO:0001819	synonymous_variant	23670	exon16			CTGCCAGGAATTC		CCDS6638.1, CCDS47979.1	9q21.13	2011-07-19			ENSG00000135048	ENSG00000135048			11869	protein-coding gene	gene with protein product		605835					Standard	NM_013390		Approved		uc011lsa.1	Q9UHN6	OTTHUMG00000020000	ENST00000377044.4:c.2718C>G	chr9.hg19:g.74327050G>C		99.0	0.0		105.0	36.0	NM_013390	A6H8W9|B2RTQ6|Q5T838|Q5T839|Q5T840|Q5T841|Q8NBP6|Q9P2D5	Silent	SNP	ENST00000377044.4	hg19	CCDS6638.1																																																																																			.	.		0.423	TMEM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052618.2	NM_013390	
TLE1	7088	hgsc.bcm.edu	37	9	84202721	84202721	+	Nonsense_Mutation	SNP	C	C	A			TCGA-2Y-A9H5-01A-11D-A382-10	TCGA-2Y-A9H5-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10106872-3169-465f-900a-b6e74debfc51	978cf657-0928-40db-9f1c-888305de2cbb	g.chr9:84202721C>A	ENST00000376499.3	-	17	2916	c.1852G>T	c.(1852-1854)Gga>Tga	p.G618*		NM_005077.3	NP_005068.2	Q04724	TLE1_HUMAN	transducin-like enhancer of split 1 (E(sp1) homolog, Drosophila)	618					multicellular organismal development (GO:0007275)|negative regulation of anoikis (GO:2000811)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of Wnt signaling pathway (GO:0030178)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|positive regulation of gene expression (GO:0010628)|signal transduction (GO:0007165)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|identical protein binding (GO:0042802)|RNA polymerase II transcription corepressor activity (GO:0001106)|transcription factor binding (GO:0008134)	p.G618R(2)|p.G618*(1)		NS(1)|endometrium(5)|kidney(2)|large_intestine(2)|lung(11)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	29						CAGCTGGCTCCGTCTGTGTGG	0.502																																					p.G618X	NSCLC(155;1437 1995 30668 39354 45875)|Melanoma(16;266 781 14000 47728 51870)	Atlas-SNP	.											TLE1,NS,carcinoma,0,2	TLE1	81	.	3	Substitution - Missense(2)|Substitution - Nonsense(1)	lung(2)|endometrium(1)	c.G1852T						.						79.0	78.0	78.0					9																	84202721		2203	4300	6503	SO:0001587	stop_gained	7088	exon17			TGGCTCCGTCTGT		CCDS6661.1	9q21.32	2013-01-10	2001-11-28		ENSG00000196781	ENSG00000196781		"""WD repeat domain containing"""	11837	protein-coding gene	gene with protein product	"""enhancer of split groucho 1"""	600189	"""transducin-like enhancer of split 1, homolog of Drosophila E(sp1)"""			8365415, 8808280	Standard	NM_005077		Approved	ESG1, GRG1, ESG	uc004aly.3	Q04724	OTTHUMG00000021008	ENST00000376499.3:c.1852G>T	chr9.hg19:g.84202721C>A	ENSP00000365682:p.Gly618*	72.0	0.0		61.0	29.0	NM_005077	A8K495|Q5T3G4|Q969V9	Nonsense_Mutation	SNP	ENST00000376499.3	hg19	CCDS6661.1	.	.	.	.	.	.	.	.	.	.	c	49	15.075900	0.99821	.	.	ENSG00000196781	ENST00000376499	.	.	.	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-12.0128	19.9738	0.97296	0.0:1.0:0.0:0.0	.	.	.	.	X	618	.	ENSP00000365682:G618X	G	-	1	0	TLE1	83392541	1.000000	0.71417	1.000000	0.80357	1.000000	0.99986	7.818000	0.86416	2.732000	0.93576	0.655000	0.94253	GGA	.	.		0.502	TLE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055407.1	NM_005077	
FGD3	89846	hgsc.bcm.edu	37	9	95797700	95797700	+	Silent	SNP	G	G	T			TCGA-2Y-A9H5-01A-11D-A382-10	TCGA-2Y-A9H5-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10106872-3169-465f-900a-b6e74debfc51	978cf657-0928-40db-9f1c-888305de2cbb	g.chr9:95797700G>T	ENST00000375482.3	+	18	2503	c.2007G>T	c.(2005-2007)ggG>ggT	p.G669G	FGD3_ENST00000337352.6_Silent_p.G669G|FGD3_ENST00000538555.1_Silent_p.G272G|FGD3_ENST00000416701.2_Silent_p.G668G	NM_001083536.1	NP_001077005.1	Q5JSP0	FGD3_HUMAN	FYVE, RhoGEF and PH domain containing 3	669	PH 2. {ECO:0000255|PROSITE- ProRule:PRU00145}.				actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|cytoskeleton organization (GO:0007010)|filopodium assembly (GO:0046847)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of Cdc42 GTPase activity (GO:0043088)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|ruffle (GO:0001726)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|small GTPase binding (GO:0031267)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(4)|ovary(2)|prostate(1)|urinary_tract(1)	17						TGGACTCGGGGCATGTGTGGA	0.657																																					p.G669G		Atlas-SNP	.											.	FGD3	116	.	0			c.G2007T						.						31.0	40.0	37.0					9																	95797700		2157	4270	6427	SO:0001819	synonymous_variant	89846	exon18			CTCGGGGCATGTG	AK000004	CCDS43849.1, CCDS69619.1	9q22	2013-01-10	2004-08-24		ENSG00000127084	ENSG00000127084		"""Zinc fingers, FYVE domain containing"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	16027	protein-coding gene	gene with protein product			"""FGD1 family, member 3"""			11214971	Standard	NM_001083536		Approved	FLJ00004, ZFYVE5	uc004asz.2	Q5JSP0	OTTHUMG00000021032	ENST00000375482.3:c.2007G>T	chr9.hg19:g.95797700G>T		168.0	0.0		81.0	37.0	NM_001083536	F8W7P2|Q4VX84|Q7Z7D9|Q8N5G1	Silent	SNP	ENST00000375482.3	hg19	CCDS43849.1																																																																																			.	.		0.657	FGD3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000055493.1	NM_033086	
NEK6	10783	hgsc.bcm.edu	37	9	127074820	127074820	+	Silent	SNP	G	G	A			TCGA-2Y-A9H5-01A-11D-A382-10	TCGA-2Y-A9H5-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10106872-3169-465f-900a-b6e74debfc51	978cf657-0928-40db-9f1c-888305de2cbb	g.chr9:127074820G>A	ENST00000320246.5	+	3	268	c.123G>A	c.(121-123)tcG>tcA	p.S41S	NEK6_ENST00000394199.2_Silent_p.S75S|NEK6_ENST00000540326.1_Silent_p.S59S|NEK6_ENST00000539416.1_Silent_p.S66S|NEK6_ENST00000546191.1_Silent_p.S41S|NEK6_ENST00000373603.1_Silent_p.S41S|NEK6_ENST00000545174.1_Silent_p.S41S|NEK6_ENST00000373600.3_Silent_p.S75S	NM_014397.5	NP_055212.2	Q9HC98	NEK6_HUMAN	NIMA-related kinase 6	41	Interaction with ARHGAP33, ANKRA2, CDC42, PRDX3, RAD26L, RBBP6, RPS7 and TRIP4.				apoptotic process (GO:0006915)|chromosome segregation (GO:0007059)|cytokinesis (GO:0000910)|G2 DNA damage checkpoint (GO:0031572)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic nuclear envelope disassembly (GO:0007077)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of cellular senescence (GO:2000772)|regulation of mitotic cell cycle (GO:0007346)|regulation of mitotic metaphase/anaphase transition (GO:0030071)|signal transduction (GO:0007165)|spindle assembly (GO:0051225)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|microtubule (GO:0005874)|nucleus (GO:0005634)	ATP binding (GO:0005524)|kinesin binding (GO:0019894)|magnesium ion binding (GO:0000287)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)|signal transducer activity (GO:0004871)			endometrium(1)|kidney(1)|large_intestine(4)|lung(4)|ovary(2)|prostate(1)|skin(1)|stomach(1)	15						TTCGCTGCTCGCTGGCGGACT	0.612																																					p.S75S	NSCLC(122;934 1785 18647 44295 45571)	Atlas-SNP	.											.	NEK6	47	.	0			c.G225A						.						53.0	49.0	50.0					9																	127074820		2203	4300	6503	SO:0001819	synonymous_variant	10783	exon4			CTGCTCGCTGGCG	AF087909	CCDS6854.1, CCDS48015.1, CCDS55338.1, CCDS55339.1	9q33.3-q34.11	2012-11-15	2012-11-15		ENSG00000119408	ENSG00000119408			7749	protein-coding gene	gene with protein product	"""putative serine-threonine protein kinase"""	604884	"""NIMA (never in mitosis gene a)-related kinase 6"""			10702691	Standard	NM_001145001		Approved	SID6-1512	uc004boh.3	Q9HC98	OTTHUMG00000020650	ENST00000320246.5:c.123G>A	chr9.hg19:g.127074820G>A		92.0	0.0		43.0	10.0	NM_001166171	B7Z2D9|Q5TBG3|Q5TBG9|Q6FG86|Q6IAR3|Q96E83|Q9ULX2	Silent	SNP	ENST00000320246.5	hg19	CCDS6854.1																																																																																			.	.		0.612	NEK6-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054016.1	NM_014397	
CACNA1B	774	hgsc.bcm.edu	37	9	141016411	141016411	+	Missense_Mutation	SNP	G	G	A			TCGA-2Y-A9H5-01A-11D-A382-10	TCGA-2Y-A9H5-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10106872-3169-465f-900a-b6e74debfc51	978cf657-0928-40db-9f1c-888305de2cbb	g.chr9:141016411G>A	ENST00000371372.1	+	47	7125	c.6980G>A	c.(6979-6981)cGg>cAg	p.R2327Q	CACNA1B_ENST00000371363.1_Missense_Mutation_p.R2325Q|CACNA1B_ENST00000371355.4_Missense_Mutation_p.R2328Q|CACNA1B_ENST00000371357.1_Missense_Mutation_p.R2326Q|CACNA1B_ENST00000277549.5_Missense_Mutation_p.R1521Q|CACNA1B_ENST00000277551.2_3'UTR	NM_000718.3|NM_001243812.1	NP_000709.1|NP_001230741.1	Q00975	CAC1B_HUMAN	calcium channel, voltage-dependent, N type, alpha 1B subunit	2327					calcium ion import (GO:0070509)|locomotory behavior (GO:0007626)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|neurotransmitter secretion (GO:0007269)|regulation of blood pressure (GO:0008217)|regulation of calcium ion transport (GO:0051924)|regulation of heart contraction (GO:0008016)|response to pain (GO:0048265)|synaptic transmission (GO:0007268)|transport (GO:0006810)	dendrite (GO:0030425)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|high voltage-gated calcium channel activity (GO:0008331)|protein C-terminus binding (GO:0008022)|voltage-gated calcium channel activity (GO:0005245)			NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(1)|endometrium(10)|kidney(2)|large_intestine(17)|lung(31)|ovary(1)|prostate(1)|skin(2)|stomach(2)|urinary_tract(2)	80	all_cancers(76;0.166)			OV - Ovarian serous cystadenocarcinoma(145;1.16e-05)|Epithelial(140;0.000476)	Amlodipine(DB00381)|Gabapentin(DB00996)|Levetiracetam(DB01202)|Spironolactone(DB00421)|Verapamil(DB00661)	GGCCGAGCACGGCACAGCTAC	0.632																																					p.R2327Q		Atlas-SNP	.											.	CACNA1B	266	.	0			c.G6980A						.						24.0	26.0	26.0					9																	141016411		2099	4214	6313	SO:0001583	missense	774	exon46			GAGCACGGCACAG	AB209467	CCDS59522.1, CCDS59523.1	9q34	2013-01-10	2007-02-16		ENSG00000148408	ENSG00000148408		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"", ""EF-hand domain containing"""	1389	protein-coding gene	gene with protein product		601012		CACNL1A5		8825650, 16382099	Standard	NM_000718		Approved	Cav2.2, CACNN	uc004cog.3	Q00975	OTTHUMG00000021002	ENST00000371372.1:c.6980G>A	chr9.hg19:g.141016411G>A	ENSP00000360423:p.Arg2327Gln	42.0	0.0		19.0	10.0	NM_000718	B1AQK5	Missense_Mutation	SNP	ENST00000371372.1	hg19	CCDS59522.1	.	.	.	.	.	.	.	.	.	.	G	17.91	3.504795	0.64410	.	.	ENSG00000148408	ENST00000371372;ENST00000277549;ENST00000371363;ENST00000371357;ENST00000371355	D;D;D;D;D	0.96913	-3.95;-4.17;-3.95;-3.94;-3.94	5.22	5.22	0.72569	.	0.575551	0.16297	N	0.220603	D	0.94076	0.8101	N	0.21373	0.66	0.49130	D	0.999753	D;D	0.63880	0.993;0.993	P;P	0.47470	0.548;0.548	D	0.93142	0.6542	10	0.30854	T	0.27	.	18.7817	0.91934	0.0:0.0:1.0:0.0	.	2326;2325	B1AQK7;B1AQK6	.;.	Q	2327;1521;2325;2326;2328	ENSP00000360423:R2327Q;ENSP00000277549:R1521Q;ENSP00000360414:R2325Q;ENSP00000360408:R2326Q;ENSP00000360406:R2328Q	ENSP00000277549:R1521Q	R	+	2	0	CACNA1B	140136232	1.000000	0.71417	0.993000	0.49108	0.827000	0.46813	2.754000	0.47532	2.443000	0.82685	0.561000	0.74099	CGG	.	.		0.632	CACNA1B-001	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000055380.1	NM_000718	
CUL2	8453	hgsc.bcm.edu	37	10	35320492	35320492	+	Missense_Mutation	SNP	T	T	C			TCGA-2Y-A9H5-01A-11D-A382-10	TCGA-2Y-A9H5-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10106872-3169-465f-900a-b6e74debfc51	978cf657-0928-40db-9f1c-888305de2cbb	g.chr10:35320492T>C	ENST00000374748.1	-	14	1539	c.1226A>G	c.(1225-1227)aAt>aGt	p.N409S	CUL2_ENST00000602371.1_Missense_Mutation_p.N352S|CUL2_ENST00000374742.1_Missense_Mutation_p.N409S|CUL2_ENST00000374749.3_Missense_Mutation_p.N409S|CUL2_ENST00000374751.3_Missense_Mutation_p.N409S|CUL2_ENST00000537177.1_Missense_Mutation_p.N428S|CUL2_ENST00000374746.1_Missense_Mutation_p.N409S			Q13617	CUL2_HUMAN	cullin 2	409					cell cycle arrest (GO:0007050)|cellular response to hypoxia (GO:0071456)|G1/S transition of mitotic cell cycle (GO:0000082)|intrinsic apoptotic signaling pathway (GO:0097193)|negative regulation of cell proliferation (GO:0008285)|protein ubiquitination (GO:0016567)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|ubiquitin-dependent protein catabolic process (GO:0006511)|viral process (GO:0016032)	Cul2-RING ubiquitin ligase complex (GO:0031462)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|VCB complex (GO:0030891)	ubiquitin protein ligase binding (GO:0031625)			breast(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(11)|ovary(3)|prostate(2)|skin(1)|urinary_tract(2)	31						TTCCACTTCATTCTCTGTCAT	0.383																																					p.N428S		Atlas-SNP	.											.	CUL2	63	.	0			c.A1283G						.						187.0	157.0	167.0					10																	35320492		2203	4300	6503	SO:0001583	missense	8453	exon13			ACTTCATTCTCTG	U83410	CCDS7179.1, CCDS73086.1	10p11.2	2011-05-24			ENSG00000108094	ENSG00000108094			2552	protein-coding gene	gene with protein product		603135				8681378	Standard	NM_003591		Approved		uc021ppa.1	Q13617	OTTHUMG00000017950	ENST00000374748.1:c.1226A>G	chr10.hg19:g.35320492T>C	ENSP00000363880:p.Asn409Ser	103.0	0.0		107.0	33.0	NM_001198778	B3KT95|B7Z6K8|D3DRY6|G3V1S2|O00200|Q5T2B6|Q9UNF9	Missense_Mutation	SNP	ENST00000374748.1	hg19	CCDS7179.1	.	.	.	.	.	.	.	.	.	.	T	7.220	0.597130	0.13875	.	.	ENSG00000108094	ENST00000374751;ENST00000374748;ENST00000374746;ENST00000374749;ENST00000374754;ENST00000374742;ENST00000537177	T;T;T;T;T;T	0.72942	-0.7;-0.7;-0.7;-0.7;-0.7;-0.7	5.87	4.71	0.59529	Cullin, N-terminal (1);Cullin homology (2);	0.040038	0.85682	N	0.000000	T	0.37517	0.1006	N	0.01188	-0.97	0.58432	D	0.999999	B;B;B	0.12013	0.005;0.004;0.005	B;B;B	0.15052	0.009;0.007;0.012	T	0.41963	-0.9479	10	0.02654	T	1	-17.8391	12.0765	0.53647	0.0:0.068:0.0:0.932	.	409;428;409	Q5T2B5;G3V1S2;Q13617	.;.;CUL2_HUMAN	S	409;409;409;409;352;409;428	ENSP00000363883:N409S;ENSP00000363880:N409S;ENSP00000363878:N409S;ENSP00000363881:N409S;ENSP00000363874:N409S;ENSP00000444856:N428S	ENSP00000363874:N409S	N	-	2	0	CUL2	35360498	1.000000	0.71417	1.000000	0.80357	0.953000	0.61014	6.267000	0.72546	1.004000	0.39156	0.482000	0.46254	AAT	.	.		0.383	CUL2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047538.1	NM_003591	
NODAL	4838	hgsc.bcm.edu	37	10	72195410	72195410	+	Missense_Mutation	SNP	T	T	C			TCGA-2Y-A9H5-01A-11D-A382-10	TCGA-2Y-A9H5-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10106872-3169-465f-900a-b6e74debfc51	978cf657-0928-40db-9f1c-888305de2cbb	g.chr10:72195410T>C	ENST00000287139.3	-	2	522	c.523A>G	c.(523-525)Agg>Ggg	p.R175G	AC022532.1_ENST00000420338.2_Silent_p.P119P	NM_018055.4	NP_060525.3	Q96S42	NODAL_HUMAN	nodal growth differentiation factor	175					axial mesodermal cell fate specification (GO:0048327)|brain development (GO:0007420)|cell migration involved in gastrulation (GO:0042074)|digestive tract morphogenesis (GO:0048546)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic pattern specification (GO:0009880)|embryonic placenta development (GO:0001892)|embryonic process involved in female pregnancy (GO:0060136)|endodermal cell differentiation (GO:0035987)|epiblast cell-extraembryonic ectoderm cell signaling involved in anterior/posterior axis specification (GO:0060802)|floor plate morphogenesis (GO:0033505)|formation of anatomical boundary (GO:0048859)|growth (GO:0040007)|heart looping (GO:0001947)|inhibition of neuroepithelial cell differentiation (GO:0002085)|left lung morphogenesis (GO:0060460)|liver development (GO:0001889)|maternal placenta development (GO:0001893)|maternal process involved in parturition (GO:0060137)|mesendoderm development (GO:0048382)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of chorionic trophoblast cell proliferation (GO:1901383)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of trophoblast cell migration (GO:1901164)|neural fold formation (GO:0001842)|nodal signaling pathway involved in determination of lateral mesoderm left/right asymmetry (GO:1900164)|placenta development (GO:0001890)|polarity specification of proximal/distal axis (GO:0010085)|positive regulation of activin receptor signaling pathway (GO:0032927)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell-cell adhesion (GO:0022409)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of nodal signaling pathway involved in determination of lateral mesoderm left/right asymmetry (GO:1900224)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of SMAD protein import into nucleus (GO:0060391)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of gastrulation (GO:0010470)|regulation of stem cell maintenance (GO:2000036)|SMAD protein signal transduction (GO:0060395)|stem cell maintenance (GO:0019827)|transforming growth factor beta receptor signaling pathway involved in primitive streak formation (GO:0090010)|trophectodermal cellular morphogenesis (GO:0001831)|vasculature development (GO:0001944)	extracellular space (GO:0005615)	morphogen activity (GO:0016015)|type I activin receptor binding (GO:0070698)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(4)|upper_aerodigestive_tract(2)	15						CCAGCTACCCTGGACATCTGC	0.627																																					p.R175G		Atlas-SNP	.											.	NODAL	32	.	0			c.A523G						.						35.0	36.0	36.0					10																	72195410		2203	4300	6503	SO:0001583	missense	4838	exon2			CTACCCTGGACAT	BC033585	CCDS7304.1	10q22.1	2012-12-07	2012-12-07		ENSG00000156574	ENSG00000156574			7865	protein-coding gene	gene with protein product		601265	"""nodal, mouse, homolog"", ""nodal homolog (mouse)"""			9354794	Standard	NM_018055		Approved		uc001jrc.2	Q96S42	OTTHUMG00000018408	ENST00000287139.3:c.523A>G	chr10.hg19:g.72195410T>C	ENSP00000287139:p.Arg175Gly	140.0	0.0		133.0	39.0	NM_018055	Q2M3A5|Q8N4V3	Missense_Mutation	SNP	ENST00000287139.3	hg19	CCDS7304.1	.	.	.	.	.	.	.	.	.	.	T	4.847	0.157546	0.09236	.	.	ENSG00000156574	ENST00000287139;ENST00000414871	D;D	0.84589	-1.87;-1.86	5.99	3.66	0.41972	.	0.534934	0.21679	N	0.070760	T	0.67581	0.2908	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.53143	-0.8480	10	0.21540	T	0.41	.	8.4465	0.32845	0.0:0.2077:0.0:0.7923	.	175	Q96S42	NODAL_HUMAN	G	175;120	ENSP00000287139:R175G;ENSP00000394468:R120G	ENSP00000287139:R175G	R	-	1	2	NODAL	71865416	0.000000	0.05858	0.816000	0.32577	0.180000	0.23129	-0.410000	0.07151	1.065000	0.40693	0.533000	0.62120	AGG	.	.		0.627	NODAL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048511.1	NM_018055	
NKX2-3	159296	hgsc.bcm.edu	37	10	101295220	101295220	+	Silent	SNP	C	C	A			TCGA-2Y-A9H5-01A-11D-A382-10	TCGA-2Y-A9H5-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10106872-3169-465f-900a-b6e74debfc51	978cf657-0928-40db-9f1c-888305de2cbb	g.chr10:101295220C>A	ENST00000344586.7	+	2	1036	c.837C>A	c.(835-837)gcC>gcA	p.A279A		NM_145285.2	NP_660328.2	Q8TAU0	NKX23_HUMAN	NK2 homeobox 3	279	Poly-Ala.				CD4-positive, alpha-beta T cell differentiation (GO:0043367)|gland morphogenesis (GO:0022612)|leukocyte homeostasis (GO:0001776)|leukocyte migration (GO:0050900)|lymph node development (GO:0048535)|macrophage differentiation (GO:0030225)|odontogenesis of dentin-containing tooth (GO:0042475)|Peyer's patch development (GO:0048541)|plasma cell differentiation (GO:0002317)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|post-embryonic digestive tract morphogenesis (GO:0048621)|regulation of cell proliferation (GO:0042127)|spleen development (GO:0048536)|transcription, DNA-templated (GO:0006351)|triglyceride metabolic process (GO:0006641)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			endometrium(1)|kidney(1)|lung(1)|ovary(1)|upper_aerodigestive_tract(1)	5		Colorectal(252;0.234)		Epithelial(162;4.72e-10)|all cancers(201;3.45e-08)		ccgccgccgccgccgccgcAG	0.781																																					p.A279A	Pancreas(173;2021 2035 19403 19989 27291)	Atlas-SNP	.											.	NKX2-3	11	.	0			c.C837A						.						1.0	1.0	1.0					10																	101295220		45	145	190	SO:0001819	synonymous_variant	159296	exon2			CGCCGCCGCCGCC		CCDS41558.1	10q24.2	2013-09-20	2011-06-01	2002-10-04	ENSG00000119919	ENSG00000119919		"""Homeoboxes / ANTP class : NKL subclass"""	7836	protein-coding gene	gene with protein product		606727	"""NK-2 (Drosophila) homolog C"", ""NK2 transcription factor related, locus 3 (Drosophila)"""	NKX2C		1346742, 9142493	Standard	NM_145285		Approved	NKX2.3, CSX3, NKX4-3	uc009xwj.3	Q8TAU0	OTTHUMG00000018887	ENST00000344586.7:c.837C>A	chr10.hg19:g.101295220C>A		32.0	0.0		34.0	5.0	NM_145285	B4DUZ4|Q9NYS6	Silent	SNP	ENST00000344586.7	hg19	CCDS41558.1																																																																																			.	.		0.781	NKX2-3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049808.2		
RBM20	282996	hgsc.bcm.edu	37	10	112404251	112404251	+	Silent	SNP	C	C	T			TCGA-2Y-A9H5-01A-11D-A382-10	TCGA-2Y-A9H5-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10106872-3169-465f-900a-b6e74debfc51	978cf657-0928-40db-9f1c-888305de2cbb	g.chr10:112404251C>T	ENST00000369519.3	+	1	97	c.39C>T	c.(37-39)ccC>ccT	p.P13P	Y_RNA_ENST00000411370.1_RNA	NM_001134363.1	NP_001127835.1	Q5T481	RBM20_HUMAN	RNA binding motif protein 20	13	Pro-rich.				heart development (GO:0007507)|mRNA processing (GO:0006397)|positive regulation of RNA splicing (GO:0033120)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|endometrium(4)|kidney(3)|large_intestine(1)|ovary(1)|skin(2)	12						ACGCGGACCCCAGCGGTCCGG	0.761																																					p.P13P		Atlas-SNP	.											.	RBM20	50	.	0			c.C39T						.						4.0	9.0	7.0					10																	112404251		599	1467	2066	SO:0001819	synonymous_variant	282996	exon1			GGACCCCAGCGGT	BX648563	CCDS44477.1	10q25.3	2014-09-17			ENSG00000203867	ENSG00000203867		"""RNA binding motif (RRM) containing"""	27424	protein-coding gene	gene with protein product		613171					Standard	NM_001134363		Approved		uc001kzf.2	Q5T481	OTTHUMG00000019043	ENST00000369519.3:c.39C>T	chr10.hg19:g.112404251C>T		1078.0	0.0		1138.0	379.0	NM_001134363	A6NIP5|B5A868|Q5JVI1	Silent	SNP	ENST00000369519.3	hg19	CCDS44477.1																																																																																			.	.		0.761	RBM20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050339.2	NM_001134363	
OR51F2	119694	hgsc.bcm.edu	37	11	4842843	4842843	+	Missense_Mutation	SNP	C	C	G	rs557130556		TCGA-2Y-A9H5-01A-11D-A382-10	TCGA-2Y-A9H5-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10106872-3169-465f-900a-b6e74debfc51	978cf657-0928-40db-9f1c-888305de2cbb	g.chr11:4842843C>G	ENST00000322110.5	+	1	293	c.228C>G	c.(226-228)ttC>ttG	p.F76L	MMP26_ENST00000380390.1_Intron|MMP26_ENST00000477339.1_Intron	NM_001004753.1	NP_001004753.1	Q8NH61	O51F2_HUMAN	olfactory receptor, family 51, subfamily F, member 2	76						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|endometrium(4)|large_intestine(3)|lung(16)|ovary(1)|pancreas(1)|prostate(4)|skin(2)	33		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.0778)		Epithelial(150;5.06e-12)|BRCA - Breast invasive adenocarcinoma(625;0.00438)|LUSC - Lung squamous cell carcinoma(625;0.19)		TGTACTATTTCCTCTCTATGC	0.458																																					p.F76L		Atlas-SNP	.											.	OR51F2	72	.	0			c.C228G						.						207.0	200.0	203.0					11																	4842843		2201	4298	6499	SO:0001583	missense	119694	exon1			CTATTTCCTCTCT	BK004281	CCDS31361.1	11p15.4	2012-08-09			ENSG00000176925	ENSG00000176925		"""GPCR / Class A : Olfactory receptors"""	15197	protein-coding gene	gene with protein product							Standard	NM_001004753		Approved		uc010qyn.2	Q8NH61	OTTHUMG00000066508	ENST00000322110.5:c.228C>G	chr11.hg19:g.4842843C>G	ENSP00000323952:p.Phe76Leu	58.0	0.0		129.0	41.0	NM_001004753	Q6IFI1	Missense_Mutation	SNP	ENST00000322110.5	hg19	CCDS31361.1	.	.	.	.	.	.	.	.	.	.	C	12.53	1.964784	0.34659	.	.	ENSG00000176925	ENST00000322110	T	0.13778	2.56	4.43	-0.248	0.13015	GPCR, rhodopsin-like superfamily (1);	0.000000	0.42964	U	0.000640	T	0.12944	0.0314	M	0.64997	1.995	0.29237	N	0.872899	B	0.29115	0.233	B	0.31946	0.138	T	0.10314	-1.0635	10	0.66056	D	0.02	.	4.8058	0.13319	0.0:0.3468:0.1609:0.4923	.	76	Q8NH61	O51F2_HUMAN	L	76	ENSP00000323952:F76L	ENSP00000323952:F76L	F	+	3	2	OR51F2	4799419	0.228000	0.23718	0.999000	0.59377	0.695000	0.40330	-0.421000	0.07053	0.158000	0.19367	0.561000	0.74099	TTC	.	.		0.458	OR51F2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142181.1	NM_001004753	
LDHC	3948	hgsc.bcm.edu	37	11	18467772	18467772	+	Silent	SNP	C	C	T			TCGA-2Y-A9H5-01A-11D-A382-10	TCGA-2Y-A9H5-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10106872-3169-465f-900a-b6e74debfc51	978cf657-0928-40db-9f1c-888305de2cbb	g.chr11:18467772C>T	ENST00000541669.1	+	7	837	c.726C>T	c.(724-726)atC>atT	p.I242I	LDHC_ENST00000536880.1_Silent_p.I228I|LDHC_ENST00000544105.1_Intron|LDHC_ENST00000535809.1_Intron|LDHC_ENST00000537486.1_Intron|LDHC_ENST00000280704.4_Silent_p.I242I|LDHC_ENST00000546146.1_Intron			P07864	LDHC_HUMAN	lactate dehydrogenase C	242					ATP biosynthetic process (GO:0006754)|cellular carbohydrate metabolic process (GO:0044262)|lactate biosynthetic process from pyruvate (GO:0019244)|lactate oxidation (GO:0019516)|sperm motility (GO:0030317)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|motile cilium (GO:0031514)|nucleus (GO:0005634)	L-lactate dehydrogenase activity (GO:0004459)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(12)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24						ATGAAATTATCAAGCTGAAGG	0.368																																					p.I242I		Atlas-SNP	.											.	LDHC	37	.	0			c.C726T						.						159.0	158.0	158.0					11																	18467772		2199	4293	6492	SO:0001819	synonymous_variant	3948	exon7			AATTATCAAGCTG	AY286300	CCDS7840.1	11p15.1	2012-10-02			ENSG00000166796	ENSG00000166796	1.1.1.27		6544	protein-coding gene	gene with protein product	"""cancer/testis antigen 32"""	150150					Standard	NM_002301		Approved	CT32	uc001mom.4	P07864	OTTHUMG00000167722	ENST00000541669.1:c.726C>T	chr11.hg19:g.18467772C>T		103.0	0.0		92.0	35.0	NM_002301	D3DQY4|Q6GSG8|Q7Z7J4	Silent	SNP	ENST00000541669.1	hg19	CCDS7840.1																																																																																			.	.		0.368	LDHC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395892.1	NM_017448	
PAMR1	25891	hgsc.bcm.edu	37	11	35456179	35456179	+	Missense_Mutation	SNP	C	C	T			TCGA-2Y-A9H5-01A-11D-A382-10	TCGA-2Y-A9H5-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10106872-3169-465f-900a-b6e74debfc51	978cf657-0928-40db-9f1c-888305de2cbb	g.chr11:35456179C>T	ENST00000378880.2	-	10	1952	c.1507G>A	c.(1507-1509)Gcc>Acc	p.A503T	PAMR1_ENST00000378878.3_Missense_Mutation_p.A392T|PAMR1_ENST00000532848.1_Missense_Mutation_p.A463T|PAMR1_ENST00000278360.3_Missense_Mutation_p.A520T	NM_001001991.1	NP_001001991.1	Q6UXH9	PAMR1_HUMAN	peptidase domain containing associated with muscle regeneration 1	503	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.					extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(8)|ovary(3)|upper_aerodigestive_tract(1)	26						ACACAGTGGGCAGCCACCACC	0.572																																					p.A520T		Atlas-SNP	.											.	PAMR1	85	.	0			c.G1558A						.						100.0	87.0	91.0					11																	35456179		2202	4298	6500	SO:0001583	missense	25891	exon11			AGTGGGCAGCCAC		CCDS7898.1, CCDS31460.1, CCDS60759.1, CCDS60760.1	11p13	2009-09-30			ENSG00000149090	ENSG00000149090			24554	protein-coding gene	gene with protein product	"""regeneration-associated muscle protease"""					15111323	Standard	NM_001282675		Approved	RAMP, DKFZP586H2123	uc001mwf.3	Q6UXH9	OTTHUMG00000166328	ENST00000378880.2:c.1507G>A	chr11.hg19:g.35456179C>T	ENSP00000368158:p.Ala503Thr	96.0	0.0		119.0	45.0	NM_015430	A8MQ58|B7ZA73|Q5EBL7|Q5JPI4|Q6N062|Q71RE9|Q96JW2|Q9Y432	Missense_Mutation	SNP	ENST00000378880.2	hg19	CCDS31460.1	.	.	.	.	.	.	.	.	.	.	C	35	5.534571	0.96460	.	.	ENSG00000149090	ENST00000278360;ENST00000378880;ENST00000378878;ENST00000532848;ENST00000527605	D;D;D;D;D	0.96940	-4.18;-4.18;-4.18;-4.18;-4.18	5.36	5.36	0.76844	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.000000	0.85682	D	0.000000	D	0.98378	0.9461	M	0.87900	2.915	0.80722	D	1	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.91635	0.997;0.999;0.998	D	0.99349	1.0914	10	0.87932	D	0	.	19.0909	0.93227	0.0:1.0:0.0:0.0	.	392;503;520	A8MQ58;Q6UXH9;Q6UXH9-2	.;PAMR1_HUMAN;.	T	520;503;392;463;480	ENSP00000278360:A520T;ENSP00000368158:A503T;ENSP00000368156:A392T;ENSP00000433868:A463T;ENSP00000432591:A480T	ENSP00000278360:A520T	A	-	1	0	PAMR1	35412755	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	7.818000	0.86416	2.526000	0.85167	0.555000	0.69702	GCC	.	.		0.572	PAMR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389177.1	NM_015430	
KCNA1	3736	hgsc.bcm.edu	37	12	5021467	5021467	+	Missense_Mutation	SNP	A	A	T			TCGA-2Y-A9H5-01A-11D-A382-10	TCGA-2Y-A9H5-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10106872-3169-465f-900a-b6e74debfc51	978cf657-0928-40db-9f1c-888305de2cbb	g.chr12:5021467A>T	ENST00000382545.3	+	2	2030	c.923A>T	c.(922-924)cAc>cTc	p.H308L	KCNA1_ENST00000543874.2_Intron	NM_000217.2	NP_000208.2	Q09470	KCNA1_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 1 (episodic ataxia with myokymia)	308					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	apical plasma membrane (GO:0016324)|dendrite (GO:0030425)|juxtaparanode region of axon (GO:0044224)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|potassium channel activity (GO:0005267)|potassium ion transmembrane transporter activity (GO:0015079)			NS(1)|breast(3)|cervix(2)|endometrium(5)|kidney(1)|large_intestine(14)|lung(23)|ovary(3)|pancreas(2)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	63					Amitriptyline(DB00321)|Dalfampridine(DB06637)|Desflurane(DB01189)|Enflurane(DB00228)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Nifedipine(DB01115)|Sevoflurane(DB01236)	CTCTCCCGCCACTCTAAGGGC	0.547																																					p.H308L		Atlas-SNP	.											.	KCNA1	112	.	0			c.A923T						.						65.0	72.0	70.0					12																	5021467		2203	4300	6503	SO:0001583	missense	3736	exon2			CCCGCCACTCTAA	L02750	CCDS8535.1	12p13	2012-07-05			ENSG00000111262	ENSG00000111262		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6218	protein-coding gene	gene with protein product		176260		AEMK		1349297, 8821794, 16382104	Standard	NM_000217		Approved	Kv1.1, RBK1, HUK1, MBK1	uc001qnh.3	Q09470	OTTHUMG00000044398	ENST00000382545.3:c.923A>T	chr12.hg19:g.5021467A>T	ENSP00000371985:p.His308Leu	85.0	0.0		81.0	15.0	NM_000217	A6NM83|Q3MIQ9	Missense_Mutation	SNP	ENST00000382545.3	hg19	CCDS8535.1	.	.	.	.	.	.	.	.	.	.	A	19.49	3.837405	0.71373	.	.	ENSG00000111262	ENST00000382545;ENST00000228858	D	0.97404	-4.37	5.08	5.08	0.68730	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.98391	0.9465	M	0.84433	2.695	0.80722	D	1	D	0.76494	0.999	D	0.80764	0.994	D	0.99421	1.0933	10	0.87932	D	0	.	14.4841	0.67603	1.0:0.0:0.0:0.0	.	308	Q09470	KCNA1_HUMAN	L	308	ENSP00000371985:H308L	ENSP00000228858:H308L	H	+	2	0	KCNA1	4891728	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.073000	0.93992	2.254000	0.74563	0.533000	0.62120	CAC	.	.		0.547	KCNA1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000103343.2	NM_000217	
CLEC7A	64581	hgsc.bcm.edu	37	12	10279240	10279240	+	Missense_Mutation	SNP	C	C	A			TCGA-2Y-A9H5-01A-11D-A382-10	TCGA-2Y-A9H5-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10106872-3169-465f-900a-b6e74debfc51	978cf657-0928-40db-9f1c-888305de2cbb	g.chr12:10279240C>A	ENST00000304084.8	-	3	424	c.270G>T	c.(268-270)gaG>gaT	p.E90D	CLEC7A_ENST00000533022.1_Missense_Mutation_p.E90D|CLEC7A_ENST00000298523.5_Intron|CLEC7A_ENST00000396484.2_Intron|CLEC7A_ENST00000353231.5_Intron	NM_197947.2	NP_922938.1	Q9BXN2	CLC7A_HUMAN	C-type lectin domain family 7, member A	90					carbohydrate mediated signaling (GO:0009756)|cell recognition (GO:0008037)|defense response to protozoan (GO:0042832)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|pattern recognition receptor signaling pathway (GO:0002221)|phagocytosis, recognition (GO:0006910)|T cell activation (GO:0042110)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|MHC protein binding (GO:0042287)|signaling pattern recognition receptor activity (GO:0008329)			central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(1)|upper_aerodigestive_tract(1)	7						GACTGTGGTTCTCTTTATTTC	0.398																																					p.E90D		Atlas-SNP	.											.	CLEC7A	55	.	0			c.G270T						.						177.0	161.0	166.0					12																	10279240		1864	4104	5968	SO:0001583	missense	64581	exon3			GTGGTTCTCTTTA	AY009090	CCDS8613.1, CCDS8614.1, CCDS8617.1, CCDS41753.1, CCDS41754.1, CCDS53744.1	12p13.2-p12.3	2014-09-17		2005-02-09	ENSG00000172243	ENSG00000172243		"""C-type lectin domain containing"""	14558	protein-coding gene	gene with protein product		606264	"""C-type (calcium dependent, carbohydrate-recognition domain) lectin, superfamily member 12"""	CLECSF12			Standard	XM_005253468		Approved	dectin-1, hDectin-1	uc001qxg.2	Q9BXN2	OTTHUMG00000133597	ENST00000304084.8:c.270G>T	chr12.hg19:g.10279240C>A	ENSP00000302569:p.Glu90Asp	110.0	0.0		105.0	30.0	NM_197947	B2R861|B7Z494|B7Z5A9|B7Z5B9|Q6IPS7|Q96D32|Q96DR9|Q96LD3|Q96PA4|Q96PA5|Q96PA6|Q96PA7|Q96PA8|Q9H1K3	Missense_Mutation	SNP	ENST00000304084.8	hg19	CCDS41753.1	.	.	.	.	.	.	.	.	.	.	C	16.78	3.217541	0.58560	.	.	ENSG00000172243	ENST00000304084;ENST00000533022	T;T	0.08370	3.1;3.1	3.96	2.11	0.27256	C-type lectin-like (1);	0.575853	0.15772	N	0.245370	T	0.07683	0.0193	L	0.59436	1.845	0.52501	D	0.999959	B;B;B	0.18461	0.028;0.028;0.006	B;B;B	0.18561	0.022;0.013;0.006	T	0.14783	-1.0460	10	0.12766	T	0.61	.	5.354	0.16051	0.0:0.6804:0.2079:0.1117	.	90;90;90	Q9BXN2-4;Q9BXN2-3;Q9BXN2	.;.;CLC7A_HUMAN	D	90	ENSP00000302569:E90D;ENSP00000431461:E90D	ENSP00000302569:E90D	E	-	3	2	CLEC7A	10170507	0.040000	0.19996	0.717000	0.30585	0.988000	0.76386	0.158000	0.16422	0.614000	0.30107	0.655000	0.94253	GAG	.	.		0.398	CLEC7A-013	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390772.1	NM_197954	
DERA	51071	hgsc.bcm.edu	37	12	16109926	16109926	+	Missense_Mutation	SNP	G	G	A			TCGA-2Y-A9H5-01A-11D-A382-10	TCGA-2Y-A9H5-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10106872-3169-465f-900a-b6e74debfc51	978cf657-0928-40db-9f1c-888305de2cbb	g.chr12:16109926G>A	ENST00000428559.2	+	2	300	c.88G>A	c.(88-90)Gaa>Aaa	p.E30K	DERA_ENST00000532964.1_Missense_Mutation_p.E30K|DERA_ENST00000526530.1_5'UTR	NM_015954.2	NP_057038.2	Q9Y315	DEOC_HUMAN	deoxyribose-phosphate aldolase (putative)	30					deoxyribonucleoside catabolic process (GO:0046121)|deoxyribonucleotide catabolic process (GO:0009264)|deoxyribose phosphate catabolic process (GO:0046386)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	deoxyribose-phosphate aldolase activity (GO:0004139)			endometrium(1)|large_intestine(2)|lung(3)|skin(1)	7		Hepatocellular(102;0.121)				GAGGCGTGCGGAACAAATCCA	0.448																																					p.E30K		Atlas-SNP	.											.	DERA	20	.	0			c.G88A						.						67.0	69.0	68.0					12																	16109926		1894	4101	5995	SO:0001583	missense	51071	exon2			CGTGCGGAACAAA	AF132960	CCDS44838.1, CCDS73451.1	12p12.3	2010-06-24	2010-06-24		ENSG00000023697	ENSG00000023697	4.1.2.4		24269	protein-coding gene	gene with protein product			"""2-deoxyribose-5-phosphate aldolase homolog (C. elegans)"""			12546782	Standard	XM_006719083		Approved	CGI-26, DEOC	uc001rde.3	Q9Y315	OTTHUMG00000165537	ENST00000428559.2:c.88G>A	chr12.hg19:g.16109926G>A	ENSP00000416583:p.Glu30Lys	94.0	0.0		134.0	48.0	NM_015954	Q53HN9|Q6PHW2	Missense_Mutation	SNP	ENST00000428559.2	hg19	CCDS44838.1	.	.	.	.	.	.	.	.	.	.	G	10.26	1.301793	0.23736	.	.	ENSG00000023697	ENST00000428559;ENST00000531803;ENST00000532964	.	.	.	5.14	-0.44	0.12261	.	0.537012	0.20780	N	0.085801	T	0.36138	0.0956	L	0.32530	0.975	0.23661	N	0.997176	B	0.24258	0.1	B	0.15870	0.014	T	0.12016	-1.0564	9	0.25106	T	0.35	-6.6666	19.0954	0.93248	0.0:0.6579:0.3421:0.0	.	30	Q9Y315	DEOC_HUMAN	K	30;51;30	.	ENSP00000416583:E30K	E	+	1	0	DERA	16001193	0.947000	0.32204	0.003000	0.11579	0.993000	0.82548	1.626000	0.37039	-0.279000	0.09167	0.655000	0.94253	GAA	.	.		0.448	DERA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384731.1	NM_015954	
RACGAP1	29127	hgsc.bcm.edu	37	12	50386074	50386074	+	Missense_Mutation	SNP	T	T	C			TCGA-2Y-A9H5-01A-11D-A382-10	TCGA-2Y-A9H5-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10106872-3169-465f-900a-b6e74debfc51	978cf657-0928-40db-9f1c-888305de2cbb	g.chr12:50386074T>C	ENST00000548961.1	-	1	67	c.62A>G	c.(61-63)aAt>aGt	p.N21S	RACGAP1_ENST00000454520.2_Missense_Mutation_p.N511S|RACGAP1_ENST00000434422.1_Missense_Mutation_p.N511S|RACGAP1_ENST00000547905.1_Missense_Mutation_p.N511S|RACGAP1_ENST00000427314.2_Missense_Mutation_p.N511S|RACGAP1_ENST00000312377.5_Missense_Mutation_p.N511S|RACGAP1_ENST00000551016.1_Missense_Mutation_p.N511S					Rac GTPase activating protein 1											cervix(1)|endometrium(1)|kidney(3)|large_intestine(3)|lung(6)	14						TGGGTCTGGATTGGGCACAGC	0.458																																					p.N511S		Atlas-SNP	.											.	RACGAP1	36	.	0			c.A1532G						.						135.0	123.0	127.0					12																	50386074		2203	4300	6503	SO:0001583	missense	29127	exon16			TCTGGATTGGGCA		CCDS8795.1	12q13	2004-05-17				ENSG00000161800			9804	protein-coding gene	gene with protein product		604980				9497316	Standard	NM_013277		Approved	MgcRacGAP	uc001rvs.2	Q9H0H5		ENST00000548961.1:c.62A>G	chr12.hg19:g.50386074T>C	ENSP00000446889:p.Asn21Ser	65.0	0.0		100.0	32.0	NM_013277		Missense_Mutation	SNP	ENST00000548961.1	hg19		.	.	.	.	.	.	.	.	.	.	T	18.56	3.649766	0.67358	.	.	ENSG00000161800	ENST00000548961;ENST00000427314;ENST00000312377;ENST00000434422;ENST00000454520;ENST00000551016;ENST00000547905;ENST00000549342	T;T;T;T;T;T;T	0.25749	1.78;1.78;1.78;1.78;1.78;1.78;3.0	6.06	6.06	0.98353	Rho GTPase-activating protein domain (3);Rho GTPase activation protein (1);	0.164261	0.64402	D	0.000003	T	0.26195	0.0639	L	0.54323	1.7	0.80722	D	1	B	0.28378	0.209	B	0.22601	0.04	T	0.03597	-1.1021	10	0.21014	T	0.42	-23.5346	16.6127	0.84892	0.0:0.0:0.0:1.0	.	511	Q9H0H5	RGAP1_HUMAN	S	21;511;511;511;511;511;511;247	ENSP00000404190:N511S;ENSP00000309871:N511S;ENSP00000413241:N511S;ENSP00000404808:N511S;ENSP00000449374:N511S;ENSP00000449370:N511S;ENSP00000449565:N247S	ENSP00000309871:N511S	N	-	2	0	RACGAP1	48672341	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	8.015000	0.88690	2.322000	0.78497	0.528000	0.53228	AAT	.	.		0.458	RACGAP1-017	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000406031.2	NM_013277	
LRP1	4035	hgsc.bcm.edu	37	12	57605033	57605033	+	Missense_Mutation	SNP	A	A	T			TCGA-2Y-A9H5-01A-11D-A382-10	TCGA-2Y-A9H5-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10106872-3169-465f-900a-b6e74debfc51	978cf657-0928-40db-9f1c-888305de2cbb	g.chr12:57605033A>T	ENST00000243077.3	+	84	13457	c.12991A>T	c.(12991-12993)Act>Tct	p.T4331S		NM_002332.2	NP_002323.2	Q07954	LRP1_HUMAN	low density lipoprotein receptor-related protein 1	4331	EGF-like 20. {ECO:0000255|PROSITE- ProRule:PRU00076}.				aging (GO:0007568)|aorta morphogenesis (GO:0035909)|apoptotic cell clearance (GO:0043277)|beta-amyloid clearance (GO:0097242)|cell proliferation (GO:0008283)|cholesterol metabolic process (GO:0008203)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of platelet-derived growth factor receptor-beta signaling pathway (GO:2000587)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of Wnt signaling pathway (GO:0030178)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of lipid transport (GO:0032370)|positive regulation of protein transport (GO:0051222)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|receptor-mediated endocytosis (GO:0006898)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cholesterol transport (GO:0032374)|regulation of phospholipase A2 activity (GO:0032429)|retinoid metabolic process (GO:0001523)	clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|endosome (GO:0005768)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	apolipoprotein binding (GO:0034185)|calcium ion binding (GO:0005509)|lipoprotein particle receptor binding (GO:0070325)|lipoprotein transporter activity (GO:0042954)|poly(A) RNA binding (GO:0044822)|protein complex binding (GO:0032403)|receptor activity (GO:0004872)			NS(1)|breast(9)|central_nervous_system(3)|cervix(3)|endometrium(33)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(26)|lung(58)|ovary(10)|pancreas(2)|prostate(11)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	184				BRCA - Breast invasive adenocarcinoma(357;0.0103)	Antihemophilic Factor(DB00025)|Coagulation Factor IX(DB00100)|Tenecteplase(DB00031)	ATGCCGCTGCACTGCCTACTT	0.582																																					p.T4331S		Atlas-SNP	.											.	LRP1	428	.	0			c.A12991T						.						101.0	81.0	88.0					12																	57605033		2203	4300	6503	SO:0001583	missense	4035	exon84			CGCTGCACTGCCT	X13916	CCDS8932.1	12q13.3	2013-05-28	2010-01-26		ENSG00000123384	ENSG00000123384		"""CD molecules"", ""Low density lipoprotein receptors"""	6692	protein-coding gene	gene with protein product		107770	"""alpha-2-macroglobulin receptor"""	APR, A2MR		2548950	Standard	NM_002332		Approved	LRP, CD91, LRP1A, APOER	uc001snd.3	Q07954	OTTHUMG00000044412	ENST00000243077.3:c.12991A>T	chr12.hg19:g.57605033A>T	ENSP00000243077:p.Thr4331Ser	76.0	0.0		81.0	26.0	NM_002332	Q2PP12|Q86SW0|Q8IVG8	Missense_Mutation	SNP	ENST00000243077.3	hg19	CCDS8932.1	.	.	.	.	.	.	.	.	.	.	A	8.923	0.961476	0.18583	.	.	ENSG00000123384	ENST00000243077	T	0.09723	2.95	4.39	1.92	0.25849	Epidermal growth factor-like (1);EGF-like region, conserved site (1);Epidermal growth factor-like, type 3 (1);	0.568939	0.15146	N	0.278009	T	0.04363	0.0120	N	0.04508	-0.205	0.45852	D	0.998713	B	0.02656	0.0	B	0.01281	0.0	T	0.40421	-0.9564	10	0.30854	T	0.27	.	5.5265	0.16960	0.548:0.1542:0.0:0.2978	.	4331	Q07954	LRP1_HUMAN	S	4331	ENSP00000243077:T4331S	ENSP00000243077:T4331S	T	+	1	0	LRP1	55891300	0.051000	0.20477	0.965000	0.40720	0.088000	0.18126	1.288000	0.33296	0.209000	0.20645	-0.695000	0.03696	ACT	.	.		0.582	LRP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412772.2	NM_002332	
TMEM132D	121256	hgsc.bcm.edu	37	12	130184653	130184653	+	Missense_Mutation	SNP	C	C	T			TCGA-2Y-A9H5-01A-11D-A382-10	TCGA-2Y-A9H5-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10106872-3169-465f-900a-b6e74debfc51	978cf657-0928-40db-9f1c-888305de2cbb	g.chr12:130184653C>T	ENST00000422113.2	-	2	996	c.670G>A	c.(670-672)Gtg>Atg	p.V224M	RP11-174M13.2_ENST00000544036.1_lincRNA	NM_133448.2	NP_597705.2	Q14C87	T132D_HUMAN	transmembrane protein 132D	224					negative regulation of phosphatase activity (GO:0010923)	integral component of membrane (GO:0016021)		p.V224M(1)		NS(1)|breast(6)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(33)|liver(1)|lung(69)|ovary(10)|pancreas(2)|prostate(2)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(2)	152	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0934)|Breast(359;0.133)		OV - Ovarian serous cystadenocarcinoma(86;0.000288)|Epithelial(86;0.0116)|all cancers(50;0.0246)		TAGAGCTCCACGGGGGTCCCC	0.667																																					p.V224M		Atlas-SNP	.											TMEM132D,NS,carcinoma,0,1	TMEM132D	299	.	1	Substitution - Missense(1)	breast(1)	c.G670A						.						50.0	51.0	51.0					12																	130184653		2203	4300	6503	SO:0001583	missense	121256	exon2			GCTCCACGGGGGT	AB061814	CCDS9266.1	12q24.32-q24.33	2014-06-13			ENSG00000151952	ENSG00000151952			29411	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 153"""	611257				11853319, 12966072	Standard	NM_133448		Approved	KIAA1944, MOLT, PPP1R153	uc009zyl.1	Q14C87	OTTHUMG00000168400	ENST00000422113.2:c.670G>A	chr12.hg19:g.130184653C>T	ENSP00000408581:p.Val224Met	73.0	0.0		89.0	28.0	NM_133448	Q14C96|Q76M59|Q8N1W9|Q8N3Q5|Q8TF57	Missense_Mutation	SNP	ENST00000422113.2	hg19	CCDS9266.1	.	.	.	.	.	.	.	.	.	.	C	14.97	2.693085	0.48202	.	.	ENSG00000151952	ENST00000422113	T	0.15017	2.46	5.35	5.35	0.76521	.	0.000000	0.56097	D	0.000021	T	0.39384	0.1076	L	0.55103	1.725	0.50171	D	0.999854	D	0.89917	1.0	D	0.91635	0.999	T	0.03315	-1.1049	9	.	.	.	-32.7882	19.0705	0.93134	0.0:1.0:0.0:0.0	.	224	Q14C87	T132D_HUMAN	M	224	ENSP00000408581:V224M	.	V	-	1	0	TMEM132D	128750606	1.000000	0.71417	0.946000	0.38457	0.055000	0.15305	7.590000	0.82653	2.482000	0.83794	0.650000	0.86243	GTG	.	.		0.667	TMEM132D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399592.1	NM_133448	
PROSER1	80209	hgsc.bcm.edu	37	13	39587824	39587824	+	Missense_Mutation	SNP	G	G	A	rs546645213		TCGA-2Y-A9H5-01A-11D-A382-10	TCGA-2Y-A9H5-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10106872-3169-465f-900a-b6e74debfc51	978cf657-0928-40db-9f1c-888305de2cbb	g.chr13:39587824G>A	ENST00000352251.3	-	11	2398	c.1565C>T	c.(1564-1566)tCa>tTa	p.S522L	PROSER1_ENST00000350125.3_Missense_Mutation_p.S500L|PROSER1_ENST00000484434.3_Intron	NM_025138.4	NP_079414.3	Q86XN7	PRSR1_HUMAN	proline and serine rich 1	522	Ser-rich.																AGGGATGGCTGATGGGGCATA	0.547													G|||	1	0.000199681	0.0	0.0	5008	,	,		19675	0.001		0.0	False		,,,				2504	0.0				p.S522L		Atlas-SNP	.											.	.	.	.	0			c.C1565T						.						72.0	74.0	73.0					13																	39587824		2203	4300	6503	SO:0001583	missense	80209	exon11			ATGGCTGATGGGG	AK022723	CCDS9368.2	13q13.2	2011-08-09	2011-08-09	2011-08-09	ENSG00000120685	ENSG00000120685			20291	protein-coding gene	gene with protein product			"""chromosome 13 open reading frame 23"""	C13orf23			Standard	NM_025138		Approved	bA50D16.2, FLJ12661	uc001uwy.4	Q86XN7	OTTHUMG00000016764	ENST00000352251.3:c.1565C>T	chr13.hg19:g.39587824G>A	ENSP00000332034:p.Ser522Leu	110.0	0.0		93.0	34.0	NM_025138	A6NJ97|Q6P2S2|Q7Z3X5|Q8N3D2|Q8N3P1|Q9H9M1	Missense_Mutation	SNP	ENST00000352251.3	hg19	CCDS9368.2	.	.	.	.	.	.	.	.	.	.	G	12.98	2.099943	0.37048	.	.	ENSG00000120685	ENST00000352251;ENST00000350125	T;T	0.33654	1.41;1.4	4.85	3.98	0.46160	.	.	.	.	.	T	0.28300	0.0699	L	0.29908	0.895	0.09310	N	1	B;B	0.28933	0.228;0.228	B;B	0.30855	0.121;0.085	T	0.15150	-1.0447	8	.	.	.	-0.1145	12.7869	0.57512	0.0:0.3154:0.6846:0.0	.	500;522	A6NJ97;Q86XN7	.;PRSR1_HUMAN	L	522;500	ENSP00000332034:S522L;ENSP00000339123:S500L	.	S	-	2	0	PROSER1	38485824	0.991000	0.36638	0.001000	0.08648	0.028000	0.11728	8.085000	0.89518	0.992000	0.38840	0.561000	0.74099	TCA	.	.		0.547	PROSER1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044607.5	NM_025138	
LHFP	10186	hgsc.bcm.edu	37	13	39952662	39952662	+	Splice_Site	SNP	G	G	C			TCGA-2Y-A9H5-01A-11D-A382-10	TCGA-2Y-A9H5-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10106872-3169-465f-900a-b6e74debfc51	978cf657-0928-40db-9f1c-888305de2cbb	g.chr13:39952662G>C	ENST00000379589.3	-	3	849	c.387C>G	c.(385-387)ggC>ggG	p.G129G		NM_005780.2	NP_005771.1	Q9Y693	LHFP_HUMAN	lipoma HMGIC fusion partner	129						integral component of membrane (GO:0016021)	DNA binding (GO:0003677)		HMGA2/LHFP(2)	breast(1)|endometrium(2)|large_intestine(1)|liver(1)|lung(6)|prostate(2)	13		Lung NSC(96;3.55e-06)|Breast(139;0.00408)|Ovarian(182;0.0107)|Prostate(109;0.0118)|Lung SC(185;0.0719)|Hepatocellular(188;0.114)		OV - Ovarian serous cystadenocarcinoma(117;6.48e-46)|Epithelial(112;8.43e-42)|all cancers(112;1.42e-36)|GBM - Glioblastoma multiforme(144;0.00187)|BRCA - Breast invasive adenocarcinoma(63;0.00886)|KIRC - Kidney renal clear cell carcinoma(186;0.048)|Kidney(163;0.0601)|LUSC - Lung squamous cell carcinoma(192;0.105)		CAATCAACAAGCCTGCAAAGA	0.498			T	HMGA2	lipoma																																p.G129G		Atlas-SNP	.		Dom	yes		13	13q12	10186	lipoma HMGIC fusion partner		M	.	LHFP	31	.	0			c.C387G						.						60.0	57.0	58.0					13																	39952662		2203	4300	6503	SO:0001630	splice_region_variant	10186	exon3			CAACAAGCCTGCA	AF098807	CCDS9369.1	13q12	2008-07-18			ENSG00000183722	ENSG00000183722			6586	protein-coding gene	gene with protein product		606710				10329012	Standard	NM_005780		Approved	MGC22429	uc001uxf.3	Q9Y693	OTTHUMG00000016767	ENST00000379589.3:c.386-1C>G	chr13.hg19:g.39952662G>C		51.0	0.0		58.0	28.0	NM_005780	B2R7M2|Q53FC0|Q96SH5	Silent	SNP	ENST00000379589.3	hg19	CCDS9369.1																																																																																			.	.		0.498	LHFP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044619.1	NM_005780	Silent
GZMB	3002	hgsc.bcm.edu	37	14	25102229	25102229	+	Missense_Mutation	SNP	C	C	T			TCGA-2Y-A9H5-01A-11D-A382-10	TCGA-2Y-A9H5-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10106872-3169-465f-900a-b6e74debfc51	978cf657-0928-40db-9f1c-888305de2cbb	g.chr14:25102229C>T	ENST00000216341.4	-	2	201	c.95G>A	c.(94-96)cGc>cAc	p.R32H	RP11-104E19.1_ENST00000555300.1_RNA|GZMB_ENST00000382542.1_Missense_Mutation_p.R66H|GZMB_ENST00000415355.3_Missense_Mutation_p.R20H|RP11-104E19.1_ENST00000557736.1_RNA|GZMB_ENST00000382540.1_Missense_Mutation_p.R32H|GZMB_ENST00000526004.1_Missense_Mutation_p.R32H			P10144	GRAB_HUMAN	granzyme B (granzyme 2, cytotoxic T-lymphocyte-associated serine esterase 1)	32	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.			RP -> PR (in Ref. 12; AA sequence). {ECO:0000305}.	apoptotic process (GO:0006915)|cytolysis (GO:0019835)|intrinsic apoptotic signaling pathway (GO:0097193)|Notch signaling pathway (GO:0007219)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|immunological synapse (GO:0001772)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			endometrium(2)|large_intestine(1)|lung(4)|stomach(4)|urinary_tract(2)	13				GBM - Glioblastoma multiforme(265;0.028)		CATGTAGGGGCGGGAGTGGGG	0.562																																					p.R32H		Atlas-SNP	.											.	GZMB	73	.	0			c.G95A						.						112.0	114.0	113.0					14																	25102229		2203	4300	6503	SO:0001583	missense	3002	exon2			TAGGGGCGGGAGT	BC030195	CCDS9633.1	14q11.2	2008-08-13			ENSG00000100453	ENSG00000100453			4709	protein-coding gene	gene with protein product	"""fragmentin 2"", ""cytotoxic serine protease B"", ""cathepsin G-like 1"", ""T-cell serine protease 1-3E"""	123910		CTLA1, CSPB		2323780	Standard	NM_004131		Approved	CCPI, CGL-1, CSP-B, CGL1, CTSGL1, HLP, SECT	uc001wps.2	P10144	OTTHUMG00000029369	ENST00000216341.4:c.95G>A	chr14.hg19:g.25102229C>T	ENSP00000216341:p.Arg32His	63.0	0.0		82.0	32.0	NM_004131	Q8N1D2|Q9UCC1	Missense_Mutation	SNP	ENST00000216341.4	hg19	CCDS9633.1	.	.	.	.	.	.	.	.	.	.	c	13.49	2.252849	0.39797	.	.	ENSG00000100453	ENST00000415355;ENST00000216341;ENST00000382542;ENST00000382540;ENST00000526004	T;D;D;T;T	0.92752	0.31;-3.1;-3.1;1.58;-1.48	5.04	1.23	0.21249	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.000000	0.33290	N	0.005070	D	0.82346	0.5017	N	0.13098	0.295	0.22911	N	0.998572	P;B	0.39535	0.677;0.371	B;B	0.39119	0.291;0.118	T	0.74630	-0.3601	10	0.49607	T	0.09	.	7.4777	0.27387	0.0:0.656:0.0:0.344	.	20;32	Q6XGZ4;P10144	.;GRAB_HUMAN	H	20;32;66;32;32	ENSP00000387385:R20H;ENSP00000216341:R32H;ENSP00000371982:R66H;ENSP00000371980:R32H;ENSP00000434213:R32H	ENSP00000216341:R32H	R	-	2	0	GZMB	24172069	0.208000	0.23494	0.159000	0.22649	0.976000	0.68499	0.541000	0.23207	0.123000	0.18342	-0.137000	0.14449	CGC	.	.		0.562	GZMB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276540.3	NM_004131	
UNC79	57578	hgsc.bcm.edu	37	14	94046579	94046579	+	Missense_Mutation	SNP	C	C	A			TCGA-2Y-A9H5-01A-11D-A382-10	TCGA-2Y-A9H5-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10106872-3169-465f-900a-b6e74debfc51	978cf657-0928-40db-9f1c-888305de2cbb	g.chr14:94046579C>A	ENST00000393151.2	+	19	2518	c.2518C>A	c.(2518-2520)Caa>Aaa	p.Q840K	UNC79_ENST00000256339.4_Missense_Mutation_p.Q663K|UNC79_ENST00000555664.1_Missense_Mutation_p.Q840K|UNC79_ENST00000553484.1_Missense_Mutation_p.Q840K			Q9P2D8	UNC79_HUMAN	unc-79 homolog (C. elegans)	840					behavioral response to ethanol (GO:0048149)|ion transmembrane transport (GO:0034220)|multicellular organism growth (GO:0035264)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.I654_H670del(1)		breast(3)|cervix(2)|endometrium(10)|kidney(7)|large_intestine(18)|liver(1)|lung(64)|ovary(1)|prostate(5)|skin(3)|urinary_tract(4)	118						CAATGTCTTCCAAGCCCCCTG	0.433																																					p.Q663K		Atlas-SNP	.											.	UNC79	366	.	1	Deletion - In frame(1)	ovary(1)	c.C1987A						.						74.0	85.0	81.0					14																	94046579		2203	4300	6503	SO:0001583	missense	57578	exon19			GTCTTCCAAGCCC	AB037830	CCDS9911.2	14q32.13	2011-08-18	2011-08-18	2011-08-18	ENSG00000133958	ENSG00000133958			19966	protein-coding gene	gene with protein product			"""KIAA1409"""	KIAA1409		20714347, 21040849	Standard	NM_020818		Approved		uc001ybs.1	Q9P2D8	OTTHUMG00000029783	ENST00000393151.2:c.2518C>A	chr14.hg19:g.94046579C>A	ENSP00000376858:p.Gln840Lys	103.0	0.0		117.0	6.0	NM_020818	B5MDL6|Q6ZUT7	Missense_Mutation	SNP	ENST00000393151.2	hg19		.	.	.	.	.	.	.	.	.	.	C	12.95	2.091445	0.36952	.	.	ENSG00000133958	ENST00000256339;ENST00000555664;ENST00000553484;ENST00000393151;ENST00000393153	T;T;T;T	0.17370	2.28;2.28;2.28;2.28	5.01	4.1	0.47936	.	0.056983	0.64402	N	0.000001	T	0.28167	0.0695	L	0.29908	0.895	0.44227	D	0.997061	P	0.48911	0.917	D	0.63488	0.915	T	0.01791	-1.1273	10	0.48119	T	0.1	-5.4024	14.4764	0.67548	0.1483:0.8517:0.0:0.0	.	840	C9JQL1	.	K	663;840;840;840;840	ENSP00000256339:Q663K;ENSP00000450868:Q840K;ENSP00000451360:Q840K;ENSP00000376858:Q840K	ENSP00000256339:Q663K	Q	+	1	0	KIAA1409	93116332	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.818000	0.86416	1.067000	0.40740	0.561000	0.74099	CAA	.	.		0.433	UNC79-006	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000412766.1	XM_028395	
CYFIP1	23191	hgsc.bcm.edu	37	15	22940832	22940832	+	Missense_Mutation	SNP	A	A	G			TCGA-2Y-A9H5-01A-11D-A382-10	TCGA-2Y-A9H5-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10106872-3169-465f-900a-b6e74debfc51	978cf657-0928-40db-9f1c-888305de2cbb	g.chr15:22940832A>G	ENST00000313077.7	+	11	1222	c.1097A>G	c.(1096-1098)tAc>tGc	p.Y366C	CYFIP1_ENST00000560848.1_Missense_Mutation_p.Y366C	NM_014608.2	NP_055423.1			cytoplasmic FMR1 interacting protein 1											endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|liver(1)|lung(14)|ovary(4)|pancreas(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	40		all_cancers(20;2.26e-25)|all_epithelial(15;2.1e-22)|Lung NSC(15;3.36e-17)|all_lung(15;1.04e-16)|Breast(32;0.000776)|Colorectal(260;0.0488)		all cancers(64;2.22e-06)|Epithelial(43;1.49e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00101)		CTGGCGCGCTACAGCAACAGC	0.582																																					p.Y366C		Atlas-SNP	.											.	CYFIP1	159	.	0			c.A1097G						.						47.0	37.0	40.0					15																	22940832		2203	4300	6503	SO:0001583	missense	23191	exon11			CGCGCTACAGCAA	D38549	CCDS73695.1, CCDS73696.1	15q11	2008-07-18			ENSG00000068793	ENSG00000273749			13759	protein-coding gene	gene with protein product	"""selective hybridizing clone"", ""cytoplasmic FMRP interacting protein 1"""	606322				11438699	Standard	XM_005272543		Approved	KIAA0068, P140SRA-1, SHYC	uc001yus.3	Q7L576	OTTHUMG00000129100	ENST00000313077.7:c.1097A>G	chr15.hg19:g.22940832A>G	ENSP00000324549:p.Tyr366Cys	210.0	0.0		192.0	56.0	NM_014608		Missense_Mutation	SNP	ENST00000313077.7	hg19	CCDS10009.1	.	.	.	.	.	.	.	.	.	.	A	25.4	4.632944	0.87660	.	.	ENSG00000068793	ENST00000313077;ENST00000412127	T	0.18960	2.18	5.63	5.63	0.86233	.	0.000000	0.64402	D	0.000006	T	0.32496	0.0831	L	0.43152	1.355	0.80722	D	1	D;D	0.64830	0.994;0.991	P;P	0.54759	0.707;0.76	T	0.02075	-1.1218	10	0.52906	T	0.07	-27.4278	15.8446	0.78876	1.0:0.0:0.0:0.0	.	394;366	E7EQ04;Q7L576	.;CYFP1_HUMAN	C	366;394	ENSP00000324549:Y366C	ENSP00000324549:Y366C	Y	+	2	0	CYFIP1	20492273	1.000000	0.71417	1.000000	0.80357	0.894000	0.52154	9.104000	0.94239	2.152000	0.67230	0.482000	0.46254	TAC	.	.		0.582	CYFIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251136.2	NM_014608	
FBN1	2200	hgsc.bcm.edu	37	15	48736756	48736756	+	Nonsense_Mutation	SNP	G	G	A			TCGA-2Y-A9H5-01A-11D-A382-10	TCGA-2Y-A9H5-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10106872-3169-465f-900a-b6e74debfc51	978cf657-0928-40db-9f1c-888305de2cbb	g.chr15:48736756G>A	ENST00000316623.5	-	49	6474	c.6019C>T	c.(6019-6021)Caa>Taa	p.Q2007*		NM_000138.4	NP_000129	P35555	FBN1_HUMAN	fibrillin 1	2007	EGF-like 34; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|heart development (GO:0007507)|kidney development (GO:0001822)|sequestering of BMP in extracellular matrix (GO:0035582)|sequestering of TGFbeta in extracellular matrix (GO:0035583)|skeletal system development (GO:0001501)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(5)|cervix(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|liver(1)|lung(49)|ovary(4)|pancreas(1)|prostate(9)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	139		all_lung(180;0.00279)		all cancers(107;4.24e-07)|GBM - Glioblastoma multiforme(94;1.41e-05)		TTCTCATTTTGAAGACTGTAT	0.428																																					p.Q2007X		Atlas-SNP	.											.	FBN1	310	.	0			c.C6019T						.						150.0	137.0	141.0					15																	48736756		2198	4296	6494	SO:0001587	stop_gained	2200	exon49			CATTTTGAAGACT	X63556	CCDS32232.1	15q21.1	2014-09-17	2006-04-25			ENSG00000166147			3603	protein-coding gene	gene with protein product	"""Marfan syndrome"""	134797	"""fibrillin 1 (Marfan syndrome)"""	FBN, MFS1, WMS		10036187, 12525539	Standard	NM_000138		Approved	MASS, OCTD, SGS	uc001zwx.2	P35555		ENST00000316623.5:c.6019C>T	chr15.hg19:g.48736756G>A	ENSP00000325527:p.Gln2007*	33.0	0.0		95.0	12.0	NM_000138	B2RUU0|D2JYH6|Q15972|Q75N87	Nonsense_Mutation	SNP	ENST00000316623.5	hg19	CCDS32232.1	.	.	.	.	.	.	.	.	.	.	G	37	6.288066	0.97444	.	.	ENSG00000166147	ENST00000316623;ENST00000389087;ENST00000544030	.	.	.	6.07	6.07	0.98685	.	0.208189	0.51477	D	0.000087	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.08599	T	0.76	.	11.5352	0.50633	0.0:0.1341:0.7269:0.1389	.	.	.	.	X	2007;575;897	.	ENSP00000325527:Q2007X	Q	-	1	0	FBN1	46524048	0.999000	0.42202	0.965000	0.40720	0.907000	0.53573	2.874000	0.48483	2.885000	0.99019	0.655000	0.94253	CAA	.	.		0.428	FBN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417355.1		
FANCI	55215	hgsc.bcm.edu	37	15	89826381	89826381	+	Missense_Mutation	SNP	G	G	A	rs368127142		TCGA-2Y-A9H5-01A-11D-A382-10	TCGA-2Y-A9H5-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10106872-3169-465f-900a-b6e74debfc51	978cf657-0928-40db-9f1c-888305de2cbb	g.chr15:89826381G>A	ENST00000310775.7	+	17	1684	c.1598G>A	c.(1597-1599)cGa>cAa	p.R533Q	FANCI_ENST00000300027.8_Missense_Mutation_p.R533Q	NM_001113378.1	NP_001106849.1	Q9NVI1	FANCI_HUMAN	Fanconi anemia, complementation group I	533					cell cycle (GO:0007049)|DNA repair (GO:0006281)|positive regulation of protein ubiquitination (GO:0031398)	membrane (GO:0016020)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|DNA polymerase binding (GO:0070182)			breast(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(7)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	31	Lung NSC(78;0.0472)|all_lung(78;0.089)					CTTGATGCCCGAAAATCTGCA	0.438								Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																												p.R533Q		Atlas-SNP	.											.	FANCI	129	.	0			c.G1598A						.	G	GLN/ARG,GLN/ARG	0,4400		0,0,2200	133.0	128.0	130.0		1598,1598	6.0	1.0	15		130	1,8597	1.2+/-3.3	0,1,4298	no	missense,missense	FANCI	NM_001113378.1,NM_018193.2	43,43	0,1,6498	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging,probably-damaging	533/1329,533/1269	89826381	1,12997	2200	4299	6499	SO:0001583	missense	55215	exon17	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	ATGCCCGAAAATC	BC004277	CCDS10349.2, CCDS45346.1	15q26.1	2014-09-17	2007-05-03	2007-05-03	ENSG00000140525	ENSG00000140525		"""Fanconi anemia, complementation groups"""	25568	protein-coding gene	gene with protein product		611360	"""KIAA1794"""	KIAA1794		14630800, 17460694, 17412408	Standard	NM_001113378		Approved	FLJ10719	uc010bnp.1	Q9NVI1	OTTHUMG00000132993	ENST00000310775.7:c.1598G>A	chr15.hg19:g.89826381G>A	ENSP00000310842:p.Arg533Gln	63.0	0.0		68.0	27.0	NM_001113378	A4ZVE4|A5YMH4|A6NJZ0|Q96JN1|Q96ST0|Q9BT96	Missense_Mutation	SNP	ENST00000310775.7	hg19	CCDS45346.1	.	.	.	.	.	.	.	.	.	.	G	36	5.670481	0.96754	0.0	1.16E-4	ENSG00000140525	ENST00000300027;ENST00000310775;ENST00000447611	D;D;D	0.94650	-3.48;-3.48;-3.48	6.03	6.03	0.97812	.	0.000000	0.85682	D	0.000000	D	0.97377	0.9142	M	0.78049	2.395	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.96998	0.9727	10	0.59425	D	0.04	-11.9968	20.5666	0.99351	0.0:0.0:1.0:0.0	.	533;533;533	Q9NVI1;Q9NVI1-2;Q9NVI1-1	FANCI_HUMAN;.;.	Q	533	ENSP00000300027:R533Q;ENSP00000310842:R533Q;ENSP00000413249:R533Q	ENSP00000300027:R533Q	R	+	2	0	FANCI	87627385	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.609000	0.98334	2.854000	0.98071	0.655000	0.94253	CGA	.	.		0.438	FANCI-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000421140.1	NM_018193	
ZNF18	7566	hgsc.bcm.edu	37	17	11881727	11881727	+	Silent	SNP	T	T	G			TCGA-2Y-A9H5-01A-11D-A382-10	TCGA-2Y-A9H5-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10106872-3169-465f-900a-b6e74debfc51	978cf657-0928-40db-9f1c-888305de2cbb	g.chr17:11881727T>G	ENST00000322748.3	-	9	1801	c.1197A>C	c.(1195-1197)ccA>ccC	p.P399P	ZNF18_ENST00000580306.2_Silent_p.P399P|ZNF18_ENST00000454073.3_Silent_p.P398P|RP11-1096G20.5_ENST00000580270.1_RNA	NM_144680.2	NP_653281.2	P17022	ZNF18_HUMAN	zinc finger protein 18	399					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(4)	14				Colorectal(4;3.33e-05)|COAD - Colon adenocarcinoma(4;0.000494)|READ - Rectum adenocarcinoma(10;0.233)		TGGGGGCTCTTGGCTGCCCCT	0.512																																					p.P399P		Atlas-SNP	.											.	ZNF18	42	.	0			c.A1197C						.						58.0	64.0	62.0					17																	11881727		2203	4300	6503	SO:0001819	synonymous_variant	7566	exon9			GGCTCTTGGCTGC	X52342	CCDS32568.1	17p12	2013-01-09	2006-05-10		ENSG00000154957	ENSG00000154957		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	12969	protein-coding gene	gene with protein product		194524	"""zinc finger protein 18 (KOX 11)"""			15702252	Standard	XM_005256786		Approved	ZKSCAN6, KOX11, HDSG1, Zfp535, ZNF535, ZSCAN38	uc002gng.1	P17022	OTTHUMG00000178307	ENST00000322748.3:c.1197A>C	chr17.hg19:g.11881727T>G		61.0	0.0		100.0	27.0	NM_144680	Q5QHQ3|Q8IYC4|Q8NAH6	Silent	SNP	ENST00000322748.3	hg19	CCDS32568.1																																																																																			.	.		0.512	ZNF18-002	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000441450.2	XM_085596	
GIT1	28964	hgsc.bcm.edu	37	17	27903137	27903137	+	Missense_Mutation	SNP	C	C	T	rs374985717		TCGA-2Y-A9H5-01A-11D-A382-10	TCGA-2Y-A9H5-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10106872-3169-465f-900a-b6e74debfc51	978cf657-0928-40db-9f1c-888305de2cbb	g.chr17:27903137C>T	ENST00000225394.3	-	15	1872	c.1624G>A	c.(1624-1626)Gac>Aac	p.D542N	GIT1_ENST00000581348.1_Missense_Mutation_p.D551N|GIT1_ENST00000579937.1_Missense_Mutation_p.D542N|RP11-68I3.2_ENST00000581474.1_RNA|GIT1_ENST00000394869.3_Missense_Mutation_p.D551N	NM_014030.3	NP_054749.2	Q9Y2X7	GIT1_HUMAN	G protein-coupled receptor kinase interacting ArfGAP 1	542					regulation of ARF GTPase activity (GO:0032312)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|membrane (GO:0016020)	ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)			large_intestine(2)|lung(3)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	9				READ - Rectum adenocarcinoma(3;0.0419)|Colorectal(3;0.069)		TAGATGGCGTCGTCCTCTAGC	0.607																																					p.D551N	Colon(81;41 1719 20078 35068)	Atlas-SNP	.											.	GIT1	84	.	0			c.G1651A						.	C	ASN/ASP,ASN/ASP	0,4406		0,0,2203	98.0	96.0	97.0		1651,1624	4.2	1.0	17		97	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	GIT1	NM_001085454.1,NM_014030.3	23,23	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	benign,benign	551/771,542/762	27903137	1,13005	2203	4300	6503	SO:0001583	missense	28964	exon16			TGGCGTCGTCCTC	AF124490	CCDS11250.1, CCDS42290.1	17p11.2	2013-01-10	2008-09-05		ENSG00000108262	ENSG00000108262		"""ADP-ribosylation factor GTPase activating proteins"", ""Ankyrin repeat domain containing"""	4272	protein-coding gene	gene with protein product		608434	"""G protein-coupled receptor kinase interactor 1"""			9826657, 10896954	Standard	NM_014030		Approved		uc002heg.2	Q9Y2X7	OTTHUMG00000132730	ENST00000225394.3:c.1624G>A	chr17.hg19:g.27903137C>T	ENSP00000225394:p.Asp542Asn	127.0	0.0		65.0	25.0	NM_001085454	B4DGU9|B4DSV3|Q86SS0|Q9BRJ4	Missense_Mutation	SNP	ENST00000225394.3	hg19	CCDS11250.1	.	.	.	.	.	.	.	.	.	.	C	16.51	3.142745	0.57044	0.0	1.16E-4	ENSG00000108262	ENST00000225394;ENST00000394869	T;T	0.69926	-0.38;-0.44	5.21	4.17	0.49024	.	0.344692	0.31484	N	0.007570	T	0.46190	0.1380	N	0.08118	0	0.33729	D	0.617985	D;P;B;D	0.61080	0.98;0.564;0.429;0.989	B;B;B;P	0.44394	0.368;0.026;0.012;0.448	T	0.54450	-0.8292	10	0.19147	T	0.46	.	13.2569	0.60083	0.1582:0.8418:0.0:0.0	.	555;551;551;542	Q59FC3;Q9Y2X7-3;B4DGU9;Q9Y2X7	.;.;.;GIT1_HUMAN	N	542;551	ENSP00000225394:D542N;ENSP00000378338:D551N	ENSP00000225394:D542N	D	-	1	0	GIT1	24927263	0.988000	0.35896	0.976000	0.42696	0.826000	0.46750	3.386000	0.52492	2.598000	0.87819	0.462000	0.41574	GAC	.	.		0.607	GIT1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256073.1	NM_014030	
CACNA1G	8913	hgsc.bcm.edu	37	17	48703836	48703836	+	Silent	SNP	C	C	T			TCGA-2Y-A9H5-01A-11D-A382-10	TCGA-2Y-A9H5-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10106872-3169-465f-900a-b6e74debfc51	978cf657-0928-40db-9f1c-888305de2cbb	g.chr17:48703836C>T	ENST00000359106.5	+	38	6858	c.6858C>T	c.(6856-6858)gaC>gaT	p.D2286D	CACNA1G_ENST00000515165.1_Silent_p.D2193D|CACNA1G_ENST00000354983.4_Silent_p.D2252D|CACNA1G_ENST00000515765.1_Silent_p.D2230D|CACNA1G_ENST00000505165.1_Silent_p.D2114D|CACNA1G_ENST00000507510.2_Silent_p.D2241D|CTB-22K21.2_ENST00000502435.1_RNA|CACNA1G_ENST00000507336.1_Silent_p.D2275D|CACNA1G_ENST00000503485.1_Silent_p.D2159D|CACNA1G_ENST00000502264.1_Silent_p.D2215D|CACNA1G_ENST00000510115.1_Silent_p.D2207D|CACNA1G_ENST00000507896.1_Silent_p.D2103D|CACNA1G_ENST00000358244.5_Silent_p.D2080D|CACNA1G_ENST00000510366.1_Silent_p.D2141D|CACNA1G_ENST00000515411.1_Silent_p.D2223D|CACNA1G_ENST00000514717.1_Silent_p.D2136D|CACNA1G_ENST00000352832.5_Silent_p.D2159D|CACNA1G_ENST00000514181.1_Silent_p.D2168D|CACNA1G_ENST00000514079.1_Silent_p.D2200D|CACNA1G_ENST00000512389.1_Silent_p.D2182D|CACNA1G_ENST00000442258.2_Silent_p.D2152D|CACNA1G_ENST00000429973.2_Silent_p.D2175D|CACNA1G_ENST00000513964.1_Silent_p.D2148D|CACNA1G_ENST00000507609.1_Silent_p.D2186D|CACNA1G_ENST00000360761.4_Silent_p.D2170D|CACNA1G_ENST00000513689.2_Silent_p.D2196D	NM_018896.4	NP_061496.2	O43497	CAC1G_HUMAN	calcium channel, voltage-dependent, T type, alpha 1G subunit	2286					axon guidance (GO:0007411)|calcium ion import (GO:0070509)|membrane depolarization during action potential (GO:0086010)|positive regulation of calcium ion-dependent exocytosis (GO:0045956)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of heart rate (GO:0002027)|regulation of membrane potential (GO:0042391)|response to nickel cation (GO:0010045)|synaptic transmission (GO:0007268)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	low voltage-gated calcium channel activity (GO:0008332)|scaffold protein binding (GO:0097110)			breast(5)|cervix(1)|endometrium(13)|kidney(5)|lung(23)	47	Breast(11;6.7e-17)		BRCA - Breast invasive adenocarcinoma(22;7.52e-09)		Cinnarizine(DB00568)|Ethosuximide(DB00593)|Flunarizine(DB04841)|Methsuximide(DB05246)|Spironolactone(DB00421)|Trimethadione(DB00347)|Verapamil(DB00661)|Zonisamide(DB00909)	TGGGCACAGACCCCTCTAACC	0.657											OREG0024569	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.D2286D		Atlas-SNP	.											.	CACNA1G	659	.	0			c.C6858T						.						10.0	14.0	13.0					17																	48703836		1888	4079	5967	SO:0001819	synonymous_variant	8913	exon38			CACAGACCCCTCT	AC004590	CCDS45730.1, CCDS45731.1, CCDS45732.1, CCDS45733.1, CCDS45734.1, CCDS45735.1, CCDS45736.1, CCDS45737.1, CCDS54142.1, CCDS54143.1, CCDS54144.1, CCDS54145.1, CCDS54146.1, CCDS58565.1, CCDS58566.1, CCDS58567.1, CCDS58568.1, CCDS58569.1, CCDS58570.1, CCDS58571.1, CCDS58572.1, CCDS58573.1, CCDS58574.1, CCDS58575.1, CCDS58576.1	17q22	2012-03-07	2007-02-16		ENSG00000006283	ENSG00000006283		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1394	protein-coding gene	gene with protein product		604065				9495342, 16382099	Standard	NM_001256334		Approved	Cav3.1, NBR13	uc002irk.2	O43497	OTTHUMG00000162180	ENST00000359106.5:c.6858C>T	chr17.hg19:g.48703836C>T		216.0	0.0	956	144.0	29.0	NM_018896	D6RA64|E7EPR0|O43498|O94770|Q19QY8|Q19QY9|Q19QZ0|Q19QZ1|Q19QZ2|Q19QZ3|Q19QZ4|Q19QZ5|Q19QZ6|Q19QZ7|Q19QZ8|Q19QZ9|Q19R00|Q19R01|Q19R02|Q19R03|Q19R04|Q19R05|Q19R06|Q19R07|Q19R08|Q19R09|Q19R10|Q19R11|Q19R12|Q19R13|Q19R15|Q19R16|Q19R17|Q19R18|Q2TAC4|Q9NYU4|Q9NYU5|Q9NYU6|Q9NYU7|Q9NYU8|Q9NYU9|Q9NYV0|Q9NYV1|Q9UHN9|Q9UHP0|Q9ULU6|Q9UNG7|Q9Y5T2|Q9Y5T3	Silent	SNP	ENST00000359106.5	hg19	CCDS45730.1																																																																																			.	.		0.657	CACNA1G-013	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000367895.1	NM_018896	
TBX2	6909	hgsc.bcm.edu	37	17	59482827	59482827	+	Missense_Mutation	SNP	C	C	T			TCGA-2Y-A9H5-01A-11D-A382-10	TCGA-2Y-A9H5-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10106872-3169-465f-900a-b6e74debfc51	978cf657-0928-40db-9f1c-888305de2cbb	g.chr17:59482827C>T	ENST00000240328.3	+	6	1597	c.1316C>T	c.(1315-1317)gCg>gTg	p.A439V	RP11-332H18.4_ENST00000592009.1_RNA	NM_005994.3	NP_005985.3	Q13207	TBX2_HUMAN	T-box 2	439					aorta morphogenesis (GO:0035909)|atrioventricular canal development (GO:0036302)|cardiac muscle tissue development (GO:0048738)|cell aging (GO:0007569)|cellular senescence (GO:0090398)|developmental growth involved in morphogenesis (GO:0060560)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic digit morphogenesis (GO:0042733)|endocardial cushion morphogenesis (GO:0003203)|mammary placode formation (GO:0060596)|muscle cell fate determination (GO:0007521)|negative regulation of cardiac chamber formation (GO:1901211)|negative regulation of heart looping (GO:1901208)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|outflow tract morphogenesis (GO:0003151)|outflow tract septum morphogenesis (GO:0003148)|palate development (GO:0060021)|pharynx development (GO:0060465)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell proliferation (GO:0008284)|regulation of transcription from RNA polymerase II promoter involved in myocardial precursor cell differentiation (GO:0003256)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(1)|lung(7)|ovary(1)	9						CGCAAGGAGGCGGCCGAGGGC	0.736																																					p.A439V	GBM(3;187 253 11467 14965 23079)	Atlas-SNP	.											.	TBX2	30	.	0			c.C1316T						.						7.0	9.0	8.0					17																	59482827		2121	4175	6296	SO:0001583	missense	6909	exon6			AGGAGGCGGCCGA	AB209378	CCDS11627.2	17q23.2	2012-01-23			ENSG00000121068	ENSG00000121068		"""T-boxes"""	11597	protein-coding gene	gene with protein product		600747				8530034	Standard	NM_005994		Approved		uc010wox.2	Q13207	OTTHUMG00000156986	ENST00000240328.3:c.1316C>T	chr17.hg19:g.59482827C>T	ENSP00000240328:p.Ala439Val	123.0	0.0		93.0	12.0	NM_005994	Q16424|Q7Z647	Missense_Mutation	SNP	ENST00000240328.3	hg19	CCDS11627.2	.	.	.	.	.	.	.	.	.	.	C	6.804	0.517355	0.13005	.	.	ENSG00000121068	ENST00000240328	D	0.86432	-2.12	4.34	-2.1	0.07210	.	1.044700	0.07574	N	0.919000	T	0.67933	0.2946	N	0.08118	0	0.09310	N	0.999996	B	0.28026	0.198	B	0.25884	0.064	T	0.56414	-0.7983	10	0.29301	T	0.29	.	1.8212	0.03111	0.1219:0.2259:0.3655:0.2867	.	439	Q13207	TBX2_HUMAN	V	439	ENSP00000240328:A439V	ENSP00000240328:A439V	A	+	2	0	TBX2	56837609	0.090000	0.21635	0.018000	0.16275	0.087000	0.18053	0.592000	0.23984	-0.141000	0.11374	0.561000	0.74099	GCG	.	.		0.736	TBX2-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346977.2	NM_005994	
ATP8B1	5205	hgsc.bcm.edu	37	18	55315840	55315840	+	Silent	SNP	C	C	T			TCGA-2Y-A9H5-01A-11D-A382-10	TCGA-2Y-A9H5-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10106872-3169-465f-900a-b6e74debfc51	978cf657-0928-40db-9f1c-888305de2cbb	g.chr18:55315840C>T	ENST00000283684.4	-	27	3635	c.3636G>A	c.(3634-3636)tcG>tcA	p.S1212S	RP11-35G9.3_ENST00000591854.1_RNA|RP11-35G9.3_ENST00000592201.1_RNA|RP11-35G9.5_ENST00000588925.1_RNA|ATP8B1_ENST00000536015.1_Silent_p.S1212S|RP11-35G9.3_ENST00000599199.1_RNA			O43520	AT8B1_HUMAN	ATPase, aminophospholipid transporter, class I, type 8B, member 1	1212					bile acid and bile salt transport (GO:0015721)|bile acid metabolic process (GO:0008206)|drug transmembrane transport (GO:0006855)|inner ear receptor cell development (GO:0060119)|ion transmembrane transport (GO:0034220)|negative regulation of transcription, DNA-templated (GO:0045892)|phospholipid translocation (GO:0045332)|regulation of microvillus assembly (GO:0032534)|sensory perception of sound (GO:0007605)|transmembrane transport (GO:0055085)|vestibulocochlear nerve formation (GO:0021650)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)	ATP binding (GO:0005524)|cardiolipin binding (GO:1901612)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			breast(6)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(11)|lung(19)|ovary(3)|prostate(1)	53		Colorectal(73;0.229)				CCCGCTGGTGCGAGAAGGCGT	0.682																																					p.S1212S		Atlas-SNP	.											.	ATP8B1	126	.	0			c.G3636A						.						21.0	22.0	21.0					18																	55315840		2202	4298	6500	SO:0001819	synonymous_variant	5205	exon28			CTGGTGCGAGAAG	AF038007	CCDS11965.1	18q21	2010-04-28	2010-04-28		ENSG00000081923	ENSG00000081923		"""ATPases / P-type"""	3706	protein-coding gene	gene with protein product		602397	"""ATPase, Class I, type 8B, member 1"", ""ATPase, class I, type 8B, member 1"""	FIC1, BRIC, PFIC1		9500542, 7655458	Standard	NM_005603		Approved	ATPIC, PFIC	uc002lgw.3	O43520	OTTHUMG00000132739	ENST00000283684.4:c.3636G>A	chr18.hg19:g.55315840C>T		144.0	0.0		93.0	4.0	NM_005603	Q9BTP8	Silent	SNP	ENST00000283684.4	hg19	CCDS11965.1																																																																																			.	.		0.682	ATP8B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256097.1	NM_005603	
ATP13A1	57130	hgsc.bcm.edu	37	19	19757110	19757110	+	Missense_Mutation	SNP	T	T	C			TCGA-2Y-A9H5-01A-11D-A382-10	TCGA-2Y-A9H5-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10106872-3169-465f-900a-b6e74debfc51	978cf657-0928-40db-9f1c-888305de2cbb	g.chr19:19757110T>C	ENST00000357324.6	-	23	3178	c.3152A>G	c.(3151-3153)aAc>aGc	p.N1051S	GMIP_ENST00000445806.2_5'Flank|GMIP_ENST00000587238.1_5'Flank|GMIP_ENST00000203556.4_5'Flank|ATP13A1_ENST00000291503.5_Missense_Mutation_p.N933S	NM_020410.2	NP_065143.2	Q9HD20	AT131_HUMAN	ATPase type 13A1	1051						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|metal ion binding (GO:0046872)			central_nervous_system(3)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|liver(2)|lung(7)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	29						GGTGTACAGGTTGAAGATGTT	0.617																																					p.N1051S	Esophageal Squamous(142;920 1789 9047 14684 24777)	Atlas-SNP	.											.	ATP13A1	82	.	0			c.A3152G						.						195.0	190.0	192.0					19																	19757110		2203	4300	6503	SO:0001583	missense	57130	exon23			TACAGGTTGAAGA	AK056420	CCDS32970.2	19p13.11	2010-04-20	2005-01-12	2005-01-12	ENSG00000105726	ENSG00000105726		"""ATPases / P-type"""	24215	protein-coding gene	gene with protein product	"""cation transporting ATPase"""		"""ATPase type 13A"""	ATP13A		11347906	Standard	NM_020410		Approved	KIAA1825, FLJ31858, CGI-152	uc002nnh.4	Q9HD20	OTTHUMG00000153016	ENST00000357324.6:c.3152A>G	chr19.hg19:g.19757110T>C	ENSP00000349877:p.Asn1051Ser	162.0	0.0		120.0	36.0	NM_020410	B3KPJ2|B3KTA7|Q6NT90|Q6ZMG7|Q9H6C6	Missense_Mutation	SNP	ENST00000357324.6	hg19	CCDS32970.2	.	.	.	.	.	.	.	.	.	.	T	18.78	3.696860	0.68386	.	.	ENSG00000105726	ENST00000291503;ENST00000357324	T;T	0.54675	0.56;0.56	4.61	4.61	0.57282	.	0.087332	0.85682	D	0.000000	T	0.34832	0.0911	N	0.25890	0.77	0.80722	D	1	B;P	0.36110	0.22;0.537	B;B	0.36378	0.223;0.219	T	0.18053	-1.0349	10	0.05959	T	0.93	-31.0281	11.9699	0.53058	0.0:0.0:0.0:1.0	.	1051;933	Q9HD20;Q9HD20-2	AT131_HUMAN;.	S	933;1051	ENSP00000291503:N933S;ENSP00000349877:N1051S	ENSP00000291503:N933S	N	-	2	0	ATP13A1	19618110	1.000000	0.71417	1.000000	0.80357	0.709000	0.40893	7.583000	0.82559	1.714000	0.51371	0.402000	0.26972	AAC	.	.		0.617	ATP13A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329005.1	NM_020410	
CLASRP	11129	hgsc.bcm.edu	37	19	45570624	45570624	+	Missense_Mutation	SNP	G	G	A			TCGA-2Y-A9H5-01A-11D-A382-10	TCGA-2Y-A9H5-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10106872-3169-465f-900a-b6e74debfc51	978cf657-0928-40db-9f1c-888305de2cbb	g.chr19:45570624G>A	ENST00000221455.3	+	14	1537	c.1439G>A	c.(1438-1440)aGg>aAg	p.R480K	CLASRP_ENST00000544944.2_Missense_Mutation_p.R480K|CLASRP_ENST00000391953.4_Missense_Mutation_p.R418K	NM_007056.2	NP_008987	Q8N2M8	CLASR_HUMAN	CLK4-associating serine/arginine rich protein	480	Arg-rich.|Ser-rich.				mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)				breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(6)|pancreas(2)|prostate(1)	16						GACCGCTACAGGCGGGGCGGC	0.736																																					p.R480K		Atlas-SNP	.											.	CLASRP	44	.	0			c.G1439A						.						2.0	2.0	2.0					19																	45570624		1062	2309	3371	SO:0001583	missense	11129	exon14			GCTACAGGCGGGG	AF042800	CCDS12652.2, CCDS62710.1	19q13.3	2010-09-21	2010-09-21	2010-09-21	ENSG00000104859	ENSG00000104859			17731	protein-coding gene	gene with protein product	"""Clk4 associating SR-related protein"""		"""splicing factor, arginine/serine-rich 16"""	SFRS16		12169693	Standard	NM_007056		Approved	SWAP2, CLASP	uc002pak.3	Q8N2M8	OTTHUMG00000150189	ENST00000221455.3:c.1439G>A	chr19.hg19:g.45570624G>A	ENSP00000221455:p.Arg480Lys	98.0	0.0		78.0	37.0	NM_007056	B4DDT8|F8WAG9|O96026|Q6UW71|Q96DX2	Missense_Mutation	SNP	ENST00000221455.3	hg19	CCDS12652.2	.	.	.	.	.	.	.	.	.	.	G	10.17	1.276405	0.23307	.	.	ENSG00000104859	ENST00000221455;ENST00000391952;ENST00000391953;ENST00000544944	T;T;T;T	0.36520	1.39;1.25;1.39;1.25	4.26	3.21	0.36854	.	0.275476	0.17624	N	0.167621	T	0.17704	0.0425	N	0.12182	0.205	0.26478	N	0.975155	B;B;B	0.28667	0.0;0.219;0.14	B;B;B	0.32090	0.0;0.14;0.067	T	0.26710	-1.0095	10	0.09084	T	0.74	-5.6513	7.0685	0.25165	0.1274:0.0:0.8726:0.0	.	418;480;480	F8WAG9;F5H0Q6;Q8N2M8	.;.;CLASR_HUMAN	K	480;480;418;480	ENSP00000221455:R480K;ENSP00000375814:R480K;ENSP00000375815:R418K;ENSP00000438702:R480K	ENSP00000221455:R480K	R	+	2	0	CLASRP	50262464	0.242000	0.23868	0.826000	0.32828	0.992000	0.81027	2.536000	0.45693	0.975000	0.38392	0.455000	0.32223	AGG	.	.		0.736	CLASRP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316749.1	NM_007056	
LRRC4B	94030	hgsc.bcm.edu	37	19	51021449	51021449	+	Silent	SNP	C	C	A			TCGA-2Y-A9H5-01A-11D-A382-10	TCGA-2Y-A9H5-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10106872-3169-465f-900a-b6e74debfc51	978cf657-0928-40db-9f1c-888305de2cbb	g.chr19:51021449C>A	ENST00000599957.1	-	3	1718	c.1521G>T	c.(1519-1521)cgG>cgT	p.R507R	LRRC4B_ENST00000389201.3_Silent_p.R507R			Q9NT99	LRC4B_HUMAN	leucine rich repeat containing 4B	507	Gly-rich.				positive regulation of synapse assembly (GO:0051965)	cell junction (GO:0030054)|cerebellar mossy fiber (GO:0044300)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synapse (GO:0045202)				breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(6)|liver(1)|lung(11)|prostate(4)|skin(1)|urinary_tract(1)	30		all_neural(266;0.131)		OV - Ovarian serous cystadenocarcinoma(262;0.00284)|GBM - Glioblastoma multiforme(134;0.0188)		TCTCCGTCCCCCGCGGCTGCA	0.716																																					p.R507R		Atlas-SNP	.											.	LRRC4B	89	.	0			c.G1521T						.						8.0	10.0	9.0					19																	51021449		1812	3927	5739	SO:0001819	synonymous_variant	94030	exon3			CGTCCCCCGCGGC	BC032460	CCDS42595.1	19q13.33	2014-01-30	2004-06-14	2004-06-16	ENSG00000131409	ENSG00000131409		"""Immunoglobulin superfamily / I-set domain containing"", ""Endogenous ligands"""	25042	protein-coding gene	gene with protein product	"""netrin-G3 ligand"""		"""leucine-rich repeats and immunoglobulin-like domains 4"""	LRIG4		11441184	Standard	NM_001080457		Approved	DKFZp761A179, HSM	uc002pss.3	Q9NT99		ENST00000599957.1:c.1521G>T	chr19.hg19:g.51021449C>A		50.0	0.0		35.0	12.0	NM_001080457	Q3ZCQ4|Q58F20	Silent	SNP	ENST00000599957.1	hg19	CCDS42595.1																																																																																			.	.		0.716	LRRC4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464907.1	NM_001080457	
NFATC2	4773	hgsc.bcm.edu	37	20	50139906	50139906	+	Missense_Mutation	SNP	C	C	A			TCGA-2Y-A9H5-01A-11D-A382-10	TCGA-2Y-A9H5-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10106872-3169-465f-900a-b6e74debfc51	978cf657-0928-40db-9f1c-888305de2cbb	g.chr20:50139906C>A	ENST00000396009.3	-	2	1093	c.874G>T	c.(874-876)Gct>Tct	p.A292S	NFATC2_ENST00000609507.1_Missense_Mutation_p.A73S|NFATC2_ENST00000414705.1_Missense_Mutation_p.A272S|NFATC2_ENST00000609943.1_Missense_Mutation_p.A272S|NFATC2_ENST00000371564.3_Missense_Mutation_p.A292S|NFATC2_ENST00000610033.1_Missense_Mutation_p.A73S	NM_001258297.1|NM_173091.3	NP_001245226.1|NP_775114.1	Q13469	NFAC2_HUMAN	nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 2	292					B cell receptor signaling pathway (GO:0050853)|cell migration (GO:0016477)|cellular response to DNA damage stimulus (GO:0006974)|cytokine production (GO:0001816)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|response to drug (GO:0042493)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear transcription factor complex (GO:0044798)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ribonucleoprotein complex (GO:0030529)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)		EWSR1/NFATC2(9)	breast(2)|endometrium(7)|kidney(1)|large_intestine(7)|lung(25)|ovary(2)|prostate(2)|skin(5)|stomach(1)|urinary_tract(1)	53	Hepatocellular(150;0.248)					GGGTACCCAGCCGGGGAGCCG	0.701																																					p.A292S		Atlas-SNP	.											.	NFATC2	112	.	0			c.G874T						.						8.0	10.0	9.0					20																	50139906		2124	4179	6303	SO:0001583	missense	4773	exon2			ACCCAGCCGGGGA	U43342, U43341	CCDS13437.1, CCDS33488.1, CCDS46614.1, CCDS68156.1, CCDS68157.1	20q13.2	2009-11-24			ENSG00000101096	ENSG00000101096		"""Nuclear factor of activated T-cells"""	7776	protein-coding gene	gene with protein product		600490				8202141	Standard	NM_012340		Approved	NF-ATP, NFATp, NFAT1	uc002xwd.4	Q13469	OTTHUMG00000032747	ENST00000396009.3:c.874G>T	chr20.hg19:g.50139906C>A	ENSP00000379330:p.Ala292Ser	141.0	0.0		114.0	39.0	NM_012340	B5B2N8|B5B2N9|B5B2P0|B5B2P2|B5B2P3|Q13468|Q5TFW7|Q5TFW8|Q9NPX6|Q9NQH3|Q9UJR2	Missense_Mutation	SNP	ENST00000396009.3	hg19	CCDS13437.1	.	.	.	.	.	.	.	.	.	.	C	0.100	-1.153650	0.01700	.	.	ENSG00000101096	ENST00000371564;ENST00000396009;ENST00000371567;ENST00000414705	T;T;T	0.78924	-1.22;-1.22;-1.22	5.24	4.29	0.51040	.	0.571341	0.18477	N	0.140058	T	0.57666	0.2069	N	0.14661	0.345	0.09310	N	0.999994	B;P;P;P	0.48640	0.085;0.828;0.913;0.828	B;B;B;B	0.38378	0.02;0.272;0.145;0.107	T	0.48364	-0.9042	10	0.29301	T	0.29	-5.8432	9.3834	0.38327	0.0:0.7792:0.1443:0.0766	.	272;272;292;292	B5B2N9;B5B2P2;Q13469;B5B2N8	.;.;NFAC2_HUMAN;.	S	292;292;73;272	ENSP00000360619:A292S;ENSP00000379330:A292S;ENSP00000396471:A272S	ENSP00000360619:A292S	A	-	1	0	NFATC2	49573313	0.001000	0.12720	0.094000	0.20943	0.106000	0.19336	0.235000	0.17948	1.189000	0.43028	0.305000	0.20034	GCT	.	.		0.701	NFATC2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000079730.2	NM_012340	
DGCR14	8220	hgsc.bcm.edu	37	22	19126717	19126717	+	Silent	SNP	G	G	C			TCGA-2Y-A9H5-01A-11D-A382-10	TCGA-2Y-A9H5-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10106872-3169-465f-900a-b6e74debfc51	978cf657-0928-40db-9f1c-888305de2cbb	g.chr22:19126717G>C	ENST00000252137.6	-	6	820	c.777C>G	c.(775-777)gcC>gcG	p.A259A		NM_022719.2	NP_073210.1	Q96DF8	DGC14_HUMAN	DiGeorge syndrome critical region gene 14	259					mRNA splicing, via spliceosome (GO:0000398)|nervous system development (GO:0007399)	catalytic step 2 spliceosome (GO:0071013)|nucleus (GO:0005634)				breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(6)|ovary(1)|prostate(2)|skin(1)	16	Colorectal(54;0.0993)					ACCTGCTCAGGGCTTGGCTGA	0.647																																					p.A259A		Atlas-SNP	.											.	DGCR14	43	.	0			c.C777G						.						45.0	44.0	44.0					22																	19126717		2203	4300	6503	SO:0001819	synonymous_variant	8220	exon6			GCTCAGGGCTTGG	L77566	CCDS13756.1	22q11.21	2007-02-20			ENSG00000100056	ENSG00000100056			16817	protein-coding gene	gene with protein product		601755	"""DiGeorge syndrome critical region gene 13"""	DGCR13		8776594, 9063747	Standard	NM_022719		Approved	DGSI, Es2el, ES2, DGS-H	uc002zou.3	Q96DF8	OTTHUMG00000150119	ENST00000252137.6:c.777C>G	chr22.hg19:g.19126717G>C		74.0	0.0		69.0	20.0	NM_022719	Q49AH7|Q9BTZ4	Silent	SNP	ENST00000252137.6	hg19	CCDS13756.1																																																																																			.	.		0.647	DGCR14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316432.2		
HCCS	3052	hgsc.bcm.edu	37	X	11132958	11132958	+	Missense_Mutation	SNP	G	G	T			TCGA-2Y-A9H5-01A-11D-A382-10	TCGA-2Y-A9H5-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10106872-3169-465f-900a-b6e74debfc51	978cf657-0928-40db-9f1c-888305de2cbb	g.chrX:11132958G>T	ENST00000321143.4	+	3	306	c.104G>T	c.(103-105)tGt>tTt	p.C35F	Y_RNA_ENST00000384422.1_RNA|HCCS_ENST00000380763.3_Missense_Mutation_p.C35F|HCCS_ENST00000380762.4_Missense_Mutation_p.C35F	NM_001122608.2|NM_001171991.2|NM_005333.4	NP_001116080.1|NP_001165462.1|NP_005324.3	P53701	CCHL_HUMAN	holocytochrome c synthase	35					organ morphogenesis (GO:0009887)|oxidation-reduction process (GO:0055114)	mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	holocytochrome-c synthase activity (GO:0004408)|metal ion binding (GO:0046872)			kidney(1)|large_intestine(3)|lung(3)	7						ATTTCAGGCTGTCCAGTGAAT	0.458																																					p.C35F	Ovarian(86;1338 1347 1462 10340 37882)	Atlas-SNP	.											.	HCCS	17	.	0			c.G104T						.						108.0	88.0	95.0					X																	11132958		2203	4300	6503	SO:0001583	missense	3052	exon3			CAGGCTGTCCAGT		CCDS14139.1	Xp22	2014-01-31	2010-05-11		ENSG00000004961	ENSG00000004961	4.4.1.17		4837	protein-coding gene	gene with protein product	"""cytochrome c heme-lyase"""	300056	"""holocytochrome c synthase (cytochrome c heme-lyase)"", ""microphthalamia with linear skin defects"""	MLS		8364577, 12444108	Standard	NM_001122608		Approved	CCHL	uc004cuj.3	P53701	OTTHUMG00000021128	ENST00000321143.4:c.104G>T	chrX.hg19:g.11132958G>T	ENSP00000326579:p.Cys35Phe	47.0	0.0		82.0	15.0	NM_001122608	B3KUS1|Q502X8	Missense_Mutation	SNP	ENST00000321143.4	hg19	CCDS14139.1	.	.	.	.	.	.	.	.	.	.	G	11.49	1.653635	0.29425	.	.	ENSG00000004961	ENST00000321143;ENST00000380763;ENST00000380762	D;D;D	0.94537	-3.45;-3.45;-3.45	5.08	4.21	0.49690	.	0.153570	0.64402	D	0.000013	D	0.96700	0.8923	M	0.80508	2.5	0.58432	D	0.999996	D	0.89917	1.0	D	0.97110	1.0	D	0.96217	0.9157	10	0.59425	D	0.04	-13.8235	10.5123	0.44868	0.0976:0.0:0.9024:0.0	.	35	P53701	CCHL_HUMAN	F	35	ENSP00000326579:C35F;ENSP00000370140:C35F;ENSP00000370139:C35F	ENSP00000326579:C35F	C	+	2	0	HCCS	11042879	1.000000	0.71417	0.966000	0.40874	0.028000	0.11728	4.214000	0.58527	1.053000	0.40415	0.600000	0.82982	TGT	.	.		0.458	HCCS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055742.1		
DMD	1756	hgsc.bcm.edu	37	X	32235037	32235037	+	Missense_Mutation	SNP	A	A	T			TCGA-2Y-A9H5-01A-11D-A382-10	TCGA-2Y-A9H5-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10106872-3169-465f-900a-b6e74debfc51	978cf657-0928-40db-9f1c-888305de2cbb	g.chrX:32235037A>T	ENST00000357033.4	-	44	6640	c.6434T>A	c.(6433-6435)cTt>cAt	p.L2145H	DMD_ENST00000378677.2_Missense_Mutation_p.L2141H	NM_000109.3|NM_004006.2|NM_004011.3|NM_004012.3|NM_004014.2	NP_000100.2|NP_003997|NP_004002.2|NP_004003.1|NP_004005.1	P11532	DMD_HUMAN	dystrophin	2145					cardiac muscle cell action potential (GO:0086001)|cardiac muscle contraction (GO:0060048)|cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|extracellular matrix organization (GO:0030198)|motile cilium assembly (GO:0044458)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|peptide biosynthetic process (GO:0043043)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of heart rate (GO:0002027)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of skeletal muscle contraction (GO:0014819)|regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion (GO:0014809)|regulation of voltage-gated calcium channel activity (GO:1901385)	cell junction (GO:0030054)|cell surface (GO:0009986)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dystrophin-associated glycoprotein complex (GO:0016010)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|syntrophin complex (GO:0016013)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|dystroglycan binding (GO:0002162)|myosin binding (GO:0017022)|nitric-oxide synthase binding (GO:0050998)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)			NS(2)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|liver(1)|lung(25)|ovary(3)|pancreas(3)|prostate(2)|skin(1)|urinary_tract(2)	77		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				ACTTACCTTAAGATACCATTT	0.333																																					p.L2145H		Atlas-SNP	.											.	DMD	2127	.	0			c.T6434A						.						65.0	53.0	57.0					X																	32235037		2202	4297	6499	SO:0001583	missense	1756	exon44			ACCTTAAGATACC	AF047505	CCDS14231.1, CCDS14232.1, CCDS14233.1, CCDS14234.1, CCDS48091.1, CCDS55394.1, CCDS55395.1, CCDS75965.1	Xp21.2	2014-09-17	2008-08-01		ENSG00000198947	ENSG00000198947			2928	protein-coding gene	gene with protein product	"""muscular dystrophy, Duchenne and Becker types"""	300377	"""dystrophin (muscular dystrophy, Duchenne and Becker types), includes DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272"", ""mental retardation, X-linked 85"""	MRX85		3282674, 3607877, 23900271	Standard	NM_004019		Approved	BMD, DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272	uc004dda.1	P11532	OTTHUMG00000021336	ENST00000357033.4:c.6434T>A	chrX.hg19:g.32235037A>T	ENSP00000354923:p.Leu2145His	227.0	0.0		427.0	37.0	NM_004006	E9PDN1|Q02295|Q14169|Q14170|Q5JYU0|Q6NSJ9|Q7KZ48|Q8N754|Q9UCW3|Q9UCW4	Missense_Mutation	SNP	ENST00000357033.4	hg19	CCDS14233.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	18.51|18.51	3.639674|3.639674	0.67244|0.67244	.|.	.|.	ENSG00000198947|ENSG00000198947	ENST00000542849;ENST00000535280|ENST00000534884;ENST00000378682;ENST00000378684;ENST00000378677;ENST00000357033	.|T;T	.|0.36699	.|1.24;1.24	5.62|5.62	5.62|5.62	0.85841|0.85841	.|.	.|0.000000	.|0.33712	.|U	.|0.004637	.|T	.|0.56001	.|0.1956	M|M	0.65498|0.65498	2.005|2.005	0.80722|0.80722	D|D	1|1	.|D;D;D;D;D;D	.|0.76494	.|0.997;0.999;0.999;0.999;0.998;0.999	.|P;D;D;D;D;D	.|0.69824	.|0.891;0.943;0.934;0.966;0.947;0.95	.|T	.|0.55560	.|-0.8122	.|10	.|0.39692	.|T	.|0.17	.|.	13.0598|13.0598	0.59000|0.59000	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|804;2137;2145;2141;804;801	.|P11532-2;P11532-4;P11532;E9PDN5;E7EQS7;E7EQS6	.|.;.;DMD_HUMAN;.;.;.	.|H	-1|2137;804;801;2141;2145	.|ENSP00000367948:L2141H;ENSP00000354923:L2145H	.|ENSP00000354923:L2145H	.|L	-|-	.|2	.|0	DMD|DMD	32144958|32144958	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.873000|0.873000	0.50193|0.50193	5.589000|5.589000	0.67523|0.67523	1.879000|1.879000	0.54435|0.54435	0.345000|0.345000	0.21793|0.21793	.|CTT	.	.		0.333	DMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056182.2	NM_004006	
HDAC6	10013	hgsc.bcm.edu	37	X	48678643	48678643	+	Missense_Mutation	SNP	G	G	T	rs186499554		TCGA-2Y-A9H5-01A-11D-A382-10	TCGA-2Y-A9H5-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10106872-3169-465f-900a-b6e74debfc51	978cf657-0928-40db-9f1c-888305de2cbb	g.chrX:48678643G>T	ENST00000334136.5	+	23	2496	c.2318G>T	c.(2317-2319)cGc>cTc	p.R773L	HDAC6_ENST00000444343.2_Missense_Mutation_p.R787L|HDAC6_ENST00000376619.2_Missense_Mutation_p.R773L			Q9UBN7	HDAC6_HUMAN	histone deacetylase 6	773	Histone deacetylase 2.				aggresome assembly (GO:0070842)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to misfolded protein (GO:0071218)|cellular response to topologically incorrect protein (GO:0035967)|histone deacetylation (GO:0016575)|Hsp90 deacetylation (GO:0070846)|intracellular protein transport (GO:0006886)|lysosome localization (GO:0032418)|macroautophagy (GO:0016236)|misfolded or incompletely synthesized protein catabolic process (GO:0006515)|negative regulation of hydrogen peroxide metabolic process (GO:0010727)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of oxidoreductase activity (GO:0051354)|negative regulation of protein complex disassembly (GO:0043242)|negative regulation of proteolysis (GO:0045861)|negative regulation of transcription, DNA-templated (GO:0045892)|peptidyl-lysine deacetylation (GO:0034983)|polyubiquitinated misfolded protein transport (GO:0070845)|positive regulation of chaperone-mediated protein complex assembly (GO:0090035)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of hydrogen peroxide-mediated programmed cell death (GO:1901300)|positive regulation of receptor biosynthetic process (GO:0010870)|positive regulation of signal transduction (GO:0009967)|protein complex disassembly (GO:0043241)|protein deacetylation (GO:0006476)|protein polyubiquitination (GO:0000209)|regulation of androgen receptor signaling pathway (GO:0060765)|regulation of establishment of protein localization (GO:0070201)|regulation of gene expression, epigenetic (GO:0040029)|regulation of microtubule-based movement (GO:0060632)|regulation of receptor activity (GO:0010469)|response to growth factor (GO:0070848)|response to misfolded protein (GO:0051788)|response to organic substance (GO:0010033)|response to toxic substance (GO:0009636)|transcription, DNA-templated (GO:0006351)|tubulin deacetylation (GO:0090042)|ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway (GO:0043162)	aggresome (GO:0016235)|axon (GO:0030424)|caveola (GO:0005901)|cell leading edge (GO:0031252)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|dendrite (GO:0030425)|histone deacetylase complex (GO:0000118)|inclusion body (GO:0016234)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|nucleus (GO:0005634)|perikaryon (GO:0043204)|perinuclear region of cytoplasm (GO:0048471)	alpha-tubulin binding (GO:0043014)|beta-catenin binding (GO:0008013)|core promoter binding (GO:0001047)|dynein complex binding (GO:0070840)|enzyme binding (GO:0019899)|histone deacetylase activity (GO:0004407)|histone deacetylase binding (GO:0042826)|Hsp90 protein binding (GO:0051879)|microtubule binding (GO:0008017)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|NAD-dependent histone deacetylase activity (H3-K18 specific) (GO:0097372)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|NAD-dependent histone deacetylase activity (H4-K16 specific) (GO:0046970)|polyubiquitin binding (GO:0031593)|tau protein binding (GO:0048156)|tubulin deacetylase activity (GO:0042903)|zinc ion binding (GO:0008270)			breast(2)|endometrium(6)|kidney(5)|large_intestine(8)|lung(9)|ovary(3)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	40					Vorinostat(DB02546)	GCCAGTGGCCGCATTATCCTT	0.572																																					p.R773L	Pancreas(112;205 1675 2305 8976 15959)	Atlas-SNP	.											.	HDAC6	111	.	0			c.G2318T						.						70.0	55.0	60.0					X																	48678643		2203	4300	6503	SO:0001583	missense	10013	exon23			GTGGCCGCATTAT	AF132609	CCDS14306.1	Xp11.23	2014-06-12			ENSG00000094631	ENSG00000094631			14064	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 90"""	300272				10220385, 10048485	Standard	NM_006044		Approved	KIAA0901, JM21, HD6, FLJ16239, PPP1R90	uc004dks.1	Q9UBN7	OTTHUMG00000034496	ENST00000334136.5:c.2318G>T	chrX.hg19:g.48678643G>T	ENSP00000334061:p.Arg773Leu	105.0	0.0		93.0	25.0	NM_006044	O94975|Q6NT75|Q7L3E5|Q96CY0	Missense_Mutation	SNP	ENST00000334136.5	hg19	CCDS14306.1	.	.	.	.	.	.	.	.	.	.	g	18.55	3.648599	0.67358	.	.	ENSG00000094631	ENST00000444343;ENST00000334136;ENST00000376619	T;T;T	0.72167	-0.63;-0.63;-0.63	5.25	0.59	0.17458	Histone deacetylase domain (2);	0.331642	0.30979	N	0.008485	D	0.82737	0.5102	M	0.88377	2.95	0.80722	D	1	D;D;D;D	0.69078	0.991;0.997;0.992;0.991	D;D;D;D	0.71870	0.945;0.975;0.971;0.945	T	0.80876	-0.1186	10	0.87932	D	0	-8.2783	8.741	0.34558	0.4142:0.0:0.5858:0.0	.	763;136;421;773	B4DZN1;B3KY98;B3KVK5;Q9UBN7	.;.;.;HDAC6_HUMAN	L	787;773;773	ENSP00000398566:R787L;ENSP00000334061:R773L;ENSP00000365804:R773L	ENSP00000334061:R773L	R	+	2	0	HDAC6	48563587	0.727000	0.28069	0.464000	0.27143	0.975000	0.68041	0.989000	0.29629	-0.218000	0.10018	-0.180000	0.13094	CGC	.	G|0.999;A|0.001		0.572	HDAC6-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000083394.2	NM_006044	
KIAA2022	340533	hgsc.bcm.edu	37	X	73963443	73963443	+	Missense_Mutation	SNP	A	A	C			TCGA-2Y-A9H5-01A-11D-A382-10	TCGA-2Y-A9H5-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10106872-3169-465f-900a-b6e74debfc51	978cf657-0928-40db-9f1c-888305de2cbb	g.chrX:73963443A>C	ENST00000055682.6	-	3	1560	c.949T>G	c.(949-951)Ttt>Gtt	p.F317V		NM_001008537.2	NP_001008537.1	Q5QGS0	K2022_HUMAN	KIAA2022	317					base-excision repair, gap-filling (GO:0006287)|DNA replication proofreading (GO:0045004)|DNA replication, removal of RNA primer (GO:0043137)|nervous system development (GO:0007399)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleotide-excision repair, DNA gap filling (GO:0006297)|regulation of mitotic cell cycle (GO:0007346)	delta DNA polymerase complex (GO:0043625)|nucleus (GO:0005634)	3'-5' exonuclease activity (GO:0008408)|DNA-directed DNA polymerase activity (GO:0003887)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(23)|liver(1)|lung(41)|ovary(7)|pancreas(2)|prostate(4)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(3)	109						TTGTCCTGAAAGGATTCATAT	0.423																																					p.F317V		Atlas-SNP	.											.	KIAA2022	262	.	0			c.T949G						.						97.0	83.0	88.0					X																	73963443		2203	4300	6503	SO:0001583	missense	340533	exon3			CCTGAAAGGATTC		CCDS35337.1	Xq13.3	2014-02-19			ENSG00000050030	ENSG00000050030			29433	protein-coding gene	gene with protein product	"""XLMR-related protein, neurite extension"""	300524				15466006, 23615299	Standard	NM_001008537		Approved	XPN, MRX98	uc004eby.3	Q5QGS0	OTTHUMG00000021860	ENST00000055682.6:c.949T>G	chrX.hg19:g.73963443A>C	ENSP00000055682:p.Phe317Val	105.0	0.0		206.0	75.0	NM_001008537	A7YY87|Q5JUX9|Q8IVE9	Missense_Mutation	SNP	ENST00000055682.6	hg19	CCDS35337.1	.	.	.	.	.	.	.	.	.	.	A	17.89	3.499667	0.64298	.	.	ENSG00000050030	ENST00000373468;ENST00000055682	T;T	0.54479	0.57;0.57	5.83	5.83	0.93111	.	0.062190	0.64402	D	0.000004	T	0.69504	0.3118	L	0.59436	1.845	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.72564	-0.4255	10	0.87932	D	0	-10.5577	15.144	0.72633	1.0:0.0:0.0:0.0	.	317	Q5QGS0	K2022_HUMAN	V	317	ENSP00000362567:F317V;ENSP00000055682:F317V	ENSP00000055682:F317V	F	-	1	0	KIAA2022	73880168	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.962000	0.93254	1.959000	0.56917	0.486000	0.48141	TTT	.	.		0.423	KIAA2022-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057270.2	NM_001008537	
TENM1	10178	hgsc.bcm.edu	37	X	123517915	123517915	+	Missense_Mutation	SNP	T	T	G			TCGA-2Y-A9H5-01A-11D-A382-10	TCGA-2Y-A9H5-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10106872-3169-465f-900a-b6e74debfc51	978cf657-0928-40db-9f1c-888305de2cbb	g.chrX:123517915T>G	ENST00000371130.3	-	29	6908	c.6845A>C	c.(6844-6846)cAt>cCt	p.H2282P	STAG2_ENST00000469481.1_Intron|TENM1_ENST00000422452.2_Missense_Mutation_p.H2289P	NM_014253.3	NP_055068.2	Q9UKZ4	TEN1_HUMAN	teneurin transmembrane protein 1	2282					immune response (GO:0006955)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neuropeptide signaling pathway (GO:0007218)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|response to stress (GO:0006950)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|nuclear matrix (GO:0016363)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	heparin binding (GO:0008201)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)										GTTGTACAAATGAGTAACTCT	0.448																																					p.H2289P		Atlas-SNP	.											.	.	.	.	0			c.A6866C						.						133.0	131.0	132.0					X																	123517915		2203	4299	6502	SO:0001583	missense	10178	exon30			TACAAATGAGTAA	AF100772	CCDS14609.1, CCDS55488.1	Xq25	2012-10-02	2012-10-02	2012-10-02	ENSG00000009694	ENSG00000009694			8117	protein-coding gene	gene with protein product		300588	"""tenascin M"", ""odz, odd Oz/ten-m homolog 1 (Drosophila)"""	ODZ3, TNM, ODZ1		10331952, 10341219	Standard	NM_001163278		Approved	TEN-M1	uc010nqy.3	Q9UKZ4	OTTHUMG00000022721	ENST00000371130.3:c.6845A>C	chrX.hg19:g.123517915T>G	ENSP00000360171:p.His2282Pro	74.0	0.0		140.0	64.0	NM_001163278	B2RTR5|Q5JZ17	Missense_Mutation	SNP	ENST00000371130.3	hg19	CCDS14609.1	.	.	.	.	.	.	.	.	.	.	T	17.57	3.422305	0.62622	.	.	ENSG00000009694	ENST00000371130;ENST00000422452	D;D	0.87256	-2.23;-2.2	5.66	5.66	0.87406	.	0.000000	0.85682	D	0.000000	D	0.94042	0.8091	M	0.87180	2.865	0.80722	D	1	D;D;D	0.89917	0.998;0.999;1.0	D;D;D	0.80764	0.991;0.994;0.981	D	0.94934	0.8085	10	0.87932	D	0	.	14.8334	0.70164	0.0:0.0:0.0:1.0	.	2288;2289;2282	B7ZMH4;B2RTR5;Q9UKZ4	.;.;TEN1_HUMAN	P	2282;2289	ENSP00000360171:H2282P;ENSP00000403954:H2289P	ENSP00000360171:H2282P	H	-	2	0	ODZ1	123345596	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.040000	0.89188	1.884000	0.54569	0.486000	0.48141	CAT	.	.		0.448	TENM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058985.1	NM_014253	
SLITRK4	139065	hgsc.bcm.edu	37	X	142718857	142718857	+	Missense_Mutation	SNP	G	G	A	rs376093373		TCGA-2Y-A9H5-01A-11D-A382-10	TCGA-2Y-A9H5-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10106872-3169-465f-900a-b6e74debfc51	978cf657-0928-40db-9f1c-888305de2cbb	g.chrX:142718857G>A	ENST00000381779.4	-	2	293	c.68C>T	c.(67-69)tCg>tTg	p.S23L	SLITRK4_ENST00000356928.1_Missense_Mutation_p.S23L|SLITRK4_ENST00000338017.4_Missense_Mutation_p.S23L	NM_001184749.2|NM_001184750.1|NM_173078.4	NP_001171678.1|NP_001171679.1|NP_775101.1	Q8IW52	SLIK4_HUMAN	SLIT and NTRK-like family, member 4	23						integral component of membrane (GO:0016021)				autonomic_ganglia(1)|breast(1)|endometrium(6)|kidney(2)|large_intestine(11)|lung(27)|ovary(2)|pancreas(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(2)	60	Acute lymphoblastic leukemia(192;6.56e-05)					AATTTCCACCGATATGTCAGA	0.418																																					p.S23L		Atlas-SNP	.											.	SLITRK4	162	.	0			c.C68T						.	G	LEU/SER,LEU/SER,LEU/SER	1,3834		0,1,1631,571	65.0	59.0	61.0		68,68,68	5.6	1.0	X		61	0,6728		0,0,2428,1872	no	missense,missense,missense	SLITRK4	NM_001184749.1,NM_001184750.1,NM_173078.3	145,145,145	0,1,4059,2443	AA,AG,GG,G		0.0,0.0261,0.0095	benign,benign,benign	23/838,23/838,23/838	142718857	1,10562	2203	4300	6503	SO:0001583	missense	139065	exon2			TCCACCGATATGT	BC040986	CCDS14679.1	Xq27.3	2004-06-23			ENSG00000179542	ENSG00000179542			23502	protein-coding gene	gene with protein product		300562				14557068	Standard	NM_001184749		Approved	DKFZp547M2010	uc004fby.3	Q8IW52	OTTHUMG00000022580	ENST00000381779.4:c.68C>T	chrX.hg19:g.142718857G>A	ENSP00000371198:p.Ser23Leu	317.0	0.0		392.0	128.0	NM_001184750	Q5JXG3|Q8TCM8|Q96DL3	Missense_Mutation	SNP	ENST00000381779.4	hg19	CCDS14679.1	.	.	.	.	.	.	.	.	.	.	G	4.184	0.032694	0.08101	2.61E-4	0.0	ENSG00000179542	ENST00000381779;ENST00000356928;ENST00000338017	T;T;T	0.54866	0.55;0.55;0.55	5.6	5.6	0.85130	.	0.356473	0.29565	N	0.011797	T	0.51210	0.1661	M	0.78049	2.395	0.37739	D	0.925542	B	0.31837	0.342	B	0.24155	0.051	T	0.56372	-0.7990	10	0.10111	T	0.7	-3.2942	17.0278	0.86452	0.0:0.0:1.0:0.0	.	23	Q8IW52	SLIK4_HUMAN	L	23	ENSP00000371198:S23L;ENSP00000349400:S23L;ENSP00000336627:S23L	ENSP00000336627:S23L	S	-	2	0	SLITRK4	142546523	0.998000	0.40836	0.984000	0.44739	0.983000	0.72400	5.887000	0.69751	2.340000	0.79590	0.594000	0.82650	TCG	.	.		0.418	SLITRK4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058617.1	NM_173078	
SRPK3	26576	hgsc.bcm.edu	37	X	153049751	153049751	+	Missense_Mutation	SNP	C	C	G			TCGA-2Y-A9H5-01A-11D-A382-10	TCGA-2Y-A9H5-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10106872-3169-465f-900a-b6e74debfc51	978cf657-0928-40db-9f1c-888305de2cbb	g.chrX:153049751C>G	ENST00000370101.3	+	11	1196	c.1150C>G	c.(1150-1152)Cca>Gca	p.P384A	SRPK3_ENST00000489426.1_Missense_Mutation_p.P451A|SRPK3_ENST00000370104.1_Missense_Mutation_p.P383A|SRPK3_ENST00000370108.3_Missense_Mutation_p.P351A|SRPK3_ENST00000393786.3_Missense_Mutation_p.P350A|IDH3G_ENST00000497043.1_5'Flank|SRPK3_ENST00000370100.1_Missense_Mutation_p.P309A	NM_001170760.1|NM_014370.3	NP_001164231.1|NP_055185.2	Q9UPE1	SRPK3_HUMAN	SRSF protein kinase 3	384	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell differentiation (GO:0030154)|muscle tissue development (GO:0060537)|skeletal muscle tissue development (GO:0007519)		ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(1)|endometrium(2)|lung(4)|ovary(2)|pancreas(2)|urinary_tract(1)	13	all_hematologic(71;4.25e-06)|all_lung(58;3.83e-05)|Lung NSC(58;5.54e-05)|Acute lymphoblastic leukemia(192;6.56e-05)					TTCCCCAGCACCATTCGGTGC	0.602																																					p.P384A	Esophageal Squamous(167;766 3400 32156)	Atlas-SNP	.											.	SRPK3	63	.	0			c.C1150G						.						59.0	53.0	55.0					X																	153049751		2203	4300	6503	SO:0001583	missense	26576	exon11			CCAGCACCATTCG	AF027406	CCDS35441.1, CCDS55537.1, CCDS55538.1	Xq28	2010-06-23	2010-06-23	2006-08-17	ENSG00000184343	ENSG00000184343			11402	protein-coding gene	gene with protein product			"""serine/threonine kinase 23"", ""SFRS protein kinase 3"""	STK23		16140986	Standard	NM_014370		Approved	MSSK1	uc004fil.3	Q9UPE1	OTTHUMG00000024207	ENST00000370101.3:c.1150C>G	chrX.hg19:g.153049751C>G	ENSP00000359119:p.Pro384Ala	280.0	0.0		213.0	69.0	NM_014370	Q13583|Q4F970|Q562F5|Q9UM62	Missense_Mutation	SNP	ENST00000370101.3	hg19	CCDS35441.1	.	.	.	.	.	.	.	.	.	.	C	10.99	1.506484	0.26949	.	.	ENSG00000184343	ENST00000489426;ENST00000393786;ENST00000370104;ENST00000370108;ENST00000370101;ENST00000370100	T;T;T;T;T;T	0.54479	0.57;0.63;0.59;0.62;0.59;0.58	4.92	3.02	0.34903	Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.150969	0.30277	N	0.009987	T	0.25457	0.0619	N	0.12961	0.28	0.09310	N	0.999994	B;B;B;B;B	0.06786	0.0;0.0;0.0;0.0;0.001	B;B;B;B;B	0.04013	0.001;0.0;0.001;0.0;0.001	T	0.11155	-1.0599	10	0.09843	T	0.71	-8.2074	2.7423	0.05257	0.3255:0.4254:0.1559:0.0932	.	308;383;350;384;451	Q9UPE1-2;Q9UPE1-4;Q9UPE1-3;Q9UPE1;E7ETV6	.;.;.;SRPK3_HUMAN;.	A	451;350;383;351;384;309	ENSP00000420058:P451A;ENSP00000377376:P350A;ENSP00000359122:P383A;ENSP00000359126:P351A;ENSP00000359119:P384A;ENSP00000359118:P309A	ENSP00000359118:P309A	P	+	1	0	SRPK3	152702945	0.996000	0.38824	0.228000	0.23943	0.440000	0.31957	2.271000	0.43364	1.038000	0.40049	0.529000	0.55759	CCA	.	.		0.602	SRPK3-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000354501.1	NM_014370	
HOXB4	3214	hgsc.bcm.edu	37	17	46655285	46655285	+	Frame_Shift_Del	DEL	G	G	-			TCGA-2Y-A9H5-01A-11D-A382-10	TCGA-2Y-A9H5-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10106872-3169-465f-900a-b6e74debfc51	978cf657-0928-40db-9f1c-888305de2cbb	g.chr17:46655285delG	ENST00000332503.5	-	1	2188	c.397delC	c.(397-399)cacfs	p.H133fs	HOXB3_ENST00000460160.1_Intron|HOXB3_ENST00000476342.1_Intron|HOXB3_ENST00000472863.1_Intron|HOXB3_ENST00000489475.1_Intron|HOXB3_ENST00000498678.1_Intron|MIR10A_ENST00000385043.1_RNA|HOXB-AS3_ENST00000465846.2_RNA|HOXB3_ENST00000465120.3_Intron|HOXB3_ENST00000485909.2_5'Flank|HOXB3_ENST00000552000.2_Intron	NM_024015.4	NP_076920.1	P17483	HXB4_HUMAN	homeobox B4	133	Pro-rich (part of the transcriptional activation domain).				anterior/posterior pattern specification (GO:0009952)|bone marrow development (GO:0048539)|cell proliferation (GO:0008283)|definitive hemopoiesis (GO:0060216)|embryonic skeletal system morphogenesis (GO:0048704)|hematopoietic stem cell differentiation (GO:0060218)|morphogenesis of an epithelial sheet (GO:0002011)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of stem cell differentiation (GO:2000738)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|somatic stem cell division (GO:0048103)|spleen development (GO:0048536)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|kidney(2)|large_intestine(1)|lung(2)|ovary(1)|urinary_tract(2)	9						CACGCGGAGTGGGACGGGCTG	0.736																																					p.H133fs		Atlas-Indel,Pindel	.											.	HOXB4	16	.	0			c.398delA						.						22.0	26.0	25.0					17																	46655285		2148	4183	6331	SO:0001589	frameshift_variant	3214	exon1			.		CCDS11529.1	17q21.32	2011-06-20	2005-12-22		ENSG00000182742	ENSG00000182742		"""Homeoboxes / ANTP class : HOXL subclass"""	5115	protein-coding gene	gene with protein product		142965	"""homeo box B4"""	HOX2, HOX2F		1973146, 1358459	Standard	NM_024015		Approved		uc002inp.3	P17483	OTTHUMG00000159920	ENST00000332503.5:c.397delC	chr17.hg19:g.46655285delG	ENSP00000328928:p.His133fs	84.0	0.0		71.0	22.0	NM_024015	Q9NTA0	Frame_Shift_Del	DEL	ENST00000332503.5	hg19	CCDS11529.1																																																																																			.	.		0.736	HOXB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358259.2		
ACVR2A	92	hgsc.bcm.edu	37	2	148672850	148672853	+	Frame_Shift_Del	DEL	TGGA	TGGA	-			TCGA-2Y-A9H5-01A-11D-A382-10	TCGA-2Y-A9H5-10A-01D-A385-10	TGGA	TGGA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10106872-3169-465f-900a-b6e74debfc51	978cf657-0928-40db-9f1c-888305de2cbb	g.chr2:148672850_148672853delTGGA	ENST00000241416.7	+	5	1255_1258	c.619_622delTGGA	c.(619-624)tggaaafs	p.WK207fs	ACVR2A_ENST00000404590.1_Frame_Shift_Del_p.WK207fs|ACVR2A_ENST00000535787.1_Frame_Shift_Del_p.WK99fs	NM_001278579.1|NM_001278580.1|NM_001616.3	NP_001265508.1|NP_001265509.1|NP_001607.1	P27037	AVR2A_HUMAN	activin A receptor, type IIA	207	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activin receptor signaling pathway (GO:0032924)|anterior/posterior pattern specification (GO:0009952)|BMP signaling pathway (GO:0030509)|cellular response to BMP stimulus (GO:0071773)|determination of left/right symmetry (GO:0007368)|embryonic skeletal system development (GO:0048706)|gastrulation with mouth forming second (GO:0001702)|mesoderm development (GO:0007498)|penile erection (GO:0043084)|positive regulation of activin receptor signaling pathway (GO:0032927)|positive regulation of bone mineralization (GO:0030501)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of protein phosphorylation (GO:0001934)|regulation of BMP signaling pathway (GO:0030510)|regulation of nitric-oxide synthase activity (GO:0050999)|Sertoli cell proliferation (GO:0060011)|sperm ejaculation (GO:0042713)|spermatogenesis (GO:0007283)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|inhibin-betaglycan-ActRII complex (GO:0034673)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|coreceptor activity (GO:0015026)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|transforming growth factor beta-activated receptor activity (GO:0005024)|transmembrane receptor protein serine/threonine kinase activity (GO:0004675)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(5)|large_intestine(14)|liver(1)|lung(7)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|stomach(8)	45				BRCA - Breast invasive adenocarcinoma(221;0.0969)		TGGTTGTGTCTGGAAAGCCCAGTT	0.407																																					p.206_207del		Atlas-Indel,Pindel	.											.	ACVR2A	125	.	0			c.618_621del						.																																			SO:0001589	frameshift_variant	92	exon5			.		CCDS33301.1, CCDS63030.1	2q22.2-q23.3	2008-02-05	2005-05-10	2005-05-10	ENSG00000121989	ENSG00000121989			173	protein-coding gene	gene with protein product		102581	"""activin A receptor, type II"""	ACVR2		1314589, 10702675	Standard	NM_001278579		Approved	ACTRII	uc002twh.3	P27037	OTTHUMG00000150603	ENST00000241416.7:c.619_622delTGGA	chr2.hg19:g.148672850_148672853delTGGA	ENSP00000241416:p.Trp207fs	102.0	0.0		160.0	72.0	NM_001616	B2RAB8|B4DWQ2|D3DP85|Q53TH4|Q6NWV2|Q92474	Frame_Shift_Del	DEL	ENST00000241416.7	hg19	CCDS33301.1																																																																																			.	.		0.407	ACVR2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319051.1	NM_001616	
CDH1	999	hgsc.bcm.edu	37	16	68867249	68867250	+	Frame_Shift_Ins	INS	-	-	T			TCGA-2Y-A9H5-01A-11D-A382-10	TCGA-2Y-A9H5-10A-01D-A385-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10106872-3169-465f-900a-b6e74debfc51	978cf657-0928-40db-9f1c-888305de2cbb	g.chr16:68867249_68867250insT	ENST00000261769.5	+	16	2687_2688	c.2496_2497insT	c.(2497-2499)tttfs	p.F833fs	CDH1_ENST00000422392.2_Frame_Shift_Ins_p.F772fs|CDH1_ENST00000562836.1_3'UTR	NM_004360.3	NP_004351.1	P12830	CADH1_HUMAN	cadherin 1, type 1, E-cadherin (epithelial)	833	Required for binding alpha, beta and gamma catenins.				adherens junction organization (GO:0034332)|apoptotic process (GO:0006915)|calcium-dependent cell-cell adhesion (GO:0016339)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to amino acid stimulus (GO:0071230)|cellular response to indole-3-methanol (GO:0071681)|cellular response to lithium ion (GO:0071285)|cochlea development (GO:0090102)|epithelial cell morphogenesis (GO:0003382)|establishment of protein localization to plasma membrane (GO:0090002)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|homophilic cell adhesion (GO:0007156)|intestinal epithelial cell development (GO:0060576)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of epithelial cell proliferation (GO:0050680)|neuron projection development (GO:0031175)|pituitary gland development (GO:0021983)|positive regulation of transcription factor import into nucleus (GO:0042993)|positive regulation of transcription, DNA-templated (GO:0045893)|protein homooligomerization (GO:0051260)|protein localization to plasma membrane (GO:0072659)|protein metabolic process (GO:0019538)|regulation of branching involved in salivary gland morphogenesis (GO:0060693)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of immune response (GO:0050776)|regulation of neuron migration (GO:2001222)|regulation of protein localization to cell surface (GO:2000008)|regulation of water loss via skin (GO:0033561)|response to drug (GO:0042493)|response to toxic substance (GO:0009636)|salivary gland cavitation (GO:0060662)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|synapse assembly (GO:0007416)|tight junction assembly (GO:0070830)|trophectodermal cell differentiation (GO:0001829)	actin cytoskeleton (GO:0015629)|aggresome (GO:0016235)|apical junction complex (GO:0043296)|apical part of cell (GO:0045177)|axon terminus (GO:0043679)|basolateral plasma membrane (GO:0016323)|catenin complex (GO:0016342)|cell junction (GO:0030054)|cell surface (GO:0009986)|cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|endosome (GO:0005768)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|lateral loop (GO:0043219)|lateral plasma membrane (GO:0016328)|node of Ranvier (GO:0033268)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|Schmidt-Lanterman incisure (GO:0043220)|trans-Golgi network (GO:0005802)	ankyrin binding (GO:0030506)|beta-catenin binding (GO:0008013)|calcium ion binding (GO:0005509)|cell adhesion molecule binding (GO:0050839)|gamma-catenin binding (GO:0045295)|glycoprotein binding (GO:0001948)|GTPase activating protein binding (GO:0032794)			NS(6)|biliary_tract(8)|breast(161)|central_nervous_system(4)|endometrium(9)|kidney(4)|large_intestine(13)|lung(13)|oesophagus(3)|ovary(2)|prostate(3)|soft_tissue(2)|stomach(76)|thyroid(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	311		all_neural(199;0.0189)|Ovarian(137;0.0563)		Epithelial(162;8.44e-05)|all cancers(182;0.000404)|OV - Ovarian serous cystadenocarcinoma(108;0.000426)|BRCA - Breast invasive adenocarcinoma(181;0.0261)		CTCTGCTCGTGTTTGACTATGA	0.49			"""Mis, N, F, S"""		"""lobular breast, gastric"""	gastric			Hereditary Diffuse Gastric Cancer																												p.V832fs		Atlas-Indel,Pindel	.	yes	Rec	yes	Familial gastric carcinoma	16	16q22.1	999	"""cadherin 1, type 1, E-cadherin (epithelial) (ECAD)"""		E	.	CDH1	535	.	0			c.2496_2497insT						.																																			SO:0001589	frameshift_variant	999	exon16	Familial Cancer Database	HDGC	.	L08599	CCDS10869.1	16q22.1	2014-09-17			ENSG00000039068	ENSG00000039068		"""CD molecules"", ""Cadherins / Major cadherins"""	1748	protein-coding gene	gene with protein product	"""E-Cadherin"""	192090		UVO		9925936	Standard	NM_004360		Approved	uvomorulin, CD324	uc002ewg.1	P12830	OTTHUMG00000137561	ENST00000261769.5:c.2499dupT	chr16.hg19:g.68867252_68867252dupT	ENSP00000261769:p.Phe833fs	84.0	0.0		80.0	29.0	NM_004360	A8K1U7|Q13799|Q14216|Q15855|Q16194|Q4PJ14|Q9UII8	Frame_Shift_Ins	INS	ENST00000261769.5	hg19	CCDS10869.1																																																																																			.	.		0.490	CDH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268897.2	NM_004360	
KLHDC7A	127707	hgsc.bcm.edu	37	1	18807799	18807799	+	Frame_Shift_Del	DEL	G	G	-			TCGA-2Y-A9H5-01A-11D-A382-10	TCGA-2Y-A9H5-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10106872-3169-465f-900a-b6e74debfc51	978cf657-0928-40db-9f1c-888305de2cbb	g.chr1:18807799delG	ENST00000400664.1	+	1	376	c.324delG	c.(322-324)acgfs	p.T108fs		NM_152375.2	NP_689588.2	Q5VTJ3	KLD7A_HUMAN	kelch domain containing 7A	108						integral component of membrane (GO:0016021)				endometrium(1)|kidney(1)|large_intestine(4)|lung(11)|ovary(2)|skin(1)|upper_aerodigestive_tract(2)	22		Colorectal(325;3.46e-05)|all_lung(284;0.000152)|Lung NSC(340;0.000185)|Breast(348;0.00046)|Renal(390;0.000518)|Ovarian(437;0.0014)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00462)|BRCA - Breast invasive adenocarcinoma(304;1.41e-05)|Kidney(64;0.00017)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)		TCCTGGTCACGGGGGCCACTT	0.652																																					p.T108fs		Atlas-Indel,Pindel	.											.	KLHDC7A	60	.	0			c.323delC						.						19.0	23.0	21.0					1																	18807799		1963	4150	6113	SO:0001589	frameshift_variant	127707	exon1			.	AK096072	CCDS185.2	1p36.13	2008-02-05			ENSG00000179023	ENSG00000179023			26791	protein-coding gene	gene with protein product							Standard	NM_152375		Approved	FLJ38753	uc001bax.3	Q5VTJ3	OTTHUMG00000002431	ENST00000400664.1:c.324delG	chr1.hg19:g.18807799delG	ENSP00000383505:p.Thr108fs	308.0	0.0		155.0	16.0	NM_152375	Q8N8W6	Frame_Shift_Del	DEL	ENST00000400664.1	hg19	CCDS185.2																																																																																			.	.		0.652	KLHDC7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006923.3	NM_152375	
LARP1B	55132	hgsc.bcm.edu	37	4	128999019	128999019	+	Frame_Shift_Del	DEL	G	G	-			TCGA-2Y-A9H5-01A-11D-A382-10	TCGA-2Y-A9H5-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10106872-3169-465f-900a-b6e74debfc51	978cf657-0928-40db-9f1c-888305de2cbb	g.chr4:128999019delG	ENST00000326639.6	+	4	330	c.119delG	c.(118-120)agtfs	p.S40fs	LARP1B_ENST00000441387.1_Frame_Shift_Del_p.S40fs|LARP1B_ENST00000354456.3_5'UTR|LARP1B_ENST00000427266.1_Frame_Shift_Del_p.S40fs|LARP1B_ENST00000264584.5_Frame_Shift_Del_p.S40fs|LARP1B_ENST00000512292.1_Frame_Shift_Del_p.S40fs|LARP1B_ENST00000432347.2_Frame_Shift_Del_p.S40fs|LARP1B_ENST00000394288.3_Frame_Shift_Del_p.S40fs	NM_018078.2	NP_060548.2	Q659C4	LAR1B_HUMAN	La ribonucleoprotein domain family, member 1B	40						nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(7)|lung(11)|ovary(1)|prostate(3)	34						GAAAAGAGAAGTAACAGTGAC	0.388																																					p.S40fs		Atlas-Indel,Pindel	.											.	LARP1B	120	.	0			c.118delA						.						87.0	88.0	88.0					4																	128999019		2203	4300	6503	SO:0001589	frameshift_variant	55132	exon4			.		CCDS3738.1, CCDS47133.1, CCDS64057.1	4q28.2	2009-06-09	2009-06-09	2009-06-09	ENSG00000138709	ENSG00000138709		"""La ribonucleoprotein domain containing"""	24704	protein-coding gene	gene with protein product			"""La ribonucleoprotein domain family, member 2"""	LARP2		12045101	Standard	NM_018078		Approved	FLJ10378, DKFZp434K245, DKFZp686E0316	uc003iga.3	Q659C4	OTTHUMG00000133343	ENST00000326639.6:c.119delG	chr4.hg19:g.128999019delG	ENSP00000321997:p.Ser40fs	399.0	0.0		406.0	59.0	NM_032239	Q2YDB6|Q4W599|Q4W5B2|Q659A0|Q6P5X2|Q7Z3F7|Q86VK7|Q8N6F4|Q8N7H4|Q8NAF2|Q9H5E7|Q9NW12	Frame_Shift_Del	DEL	ENST00000326639.6	hg19	CCDS3738.1																																																																																			.	.		0.388	LARP1B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257173.2	NM_018078	
VPS37B	79720	hgsc.bcm.edu	37	12	123380577	123380585	+	In_Frame_Del	DEL	GGCGAACCG	GGCGAACCG	-	rs574348056		TCGA-2Y-A9H5-01A-11D-A382-10	TCGA-2Y-A9H5-10A-01D-A385-10	GGCGAACCG	GGCGAACCG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10106872-3169-465f-900a-b6e74debfc51	978cf657-0928-40db-9f1c-888305de2cbb	g.chr12:123380577_123380585delGGCGAACCG	ENST00000267202.2	-	1	406_414	c.25_33delCGGTTCGCC	c.(25-33)cggttcgccdel	p.RFA9del		NM_024667.2	NP_078943.1	Q9H9H4	VP37B_HUMAN	vacuolar protein sorting 37 homolog B (S. cerevisiae)	9					endosomal transport (GO:0016197)|intracellular transport of virus (GO:0075733)|membrane organization (GO:0061024)|protein transport (GO:0015031)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral protein processing (GO:0019082)|virion assembly (GO:0019068)	endosome membrane (GO:0010008)|ESCRT I complex (GO:0000813)|extracellular vesicular exosome (GO:0070062)|midbody (GO:0030496)				breast(1)|central_nervous_system(1)|large_intestine(1)|skin(1)|urinary_tract(1)	5	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;5.08e-05)|Epithelial(86;0.000197)|BRCA - Breast invasive adenocarcinoma(302;0.205)		GCGACAGCCCGGCGAACCGGGCTTCGCTC	0.718																																					p.9_12del		Atlas-Indel,Pindel	.											.	VPS37B	26	.	0			c.26_34del						.																																			SO:0001651	inframe_deletion	79720	exon1			.	AK022812	CCDS9239.1	12q24.31	2008-02-05	2006-04-04		ENSG00000139722	ENSG00000139722			25754	protein-coding gene	gene with protein product		610037	"""vacuolar protein sorting 37B (yeast)"""			15218037	Standard	NM_024667		Approved	FLJ12750	uc001udl.3	Q9H9H4	OTTHUMG00000168767	ENST00000267202.2:c.25_33delCGGTTCGCC	chr12.hg19:g.123380577_123380585delGGCGAACCG	ENSP00000267202:p.Arg9_Ala11del	67.0	0.0		60.0	16.0	NM_024667		In_Frame_Del	DEL	ENST00000267202.2	hg19	CCDS9239.1																																																																																			.	.		0.718	VPS37B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400946.1	NM_024667	
ELF3	1999	hgsc.bcm.edu	37	1	201981100	201981101	+	Frame_Shift_Ins	INS	-	-	G			TCGA-2Y-A9H5-01A-11D-A382-10	TCGA-2Y-A9H5-10A-01D-A385-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10106872-3169-465f-900a-b6e74debfc51	978cf657-0928-40db-9f1c-888305de2cbb	g.chr1:201981100_201981101insG	ENST00000359651.3	+	2	3371_3372	c.179_180insG	c.(178-183)ttggggfs	p.LG60fs	RP11-510N19.5_ENST00000504773.1_RNA|ELF3_ENST00000367283.3_Frame_Shift_Ins_p.LG60fs|ELF3_ENST00000495848.1_3'UTR|ELF3_ENST00000367284.5_Frame_Shift_Ins_p.LG60fs|RP11-465N4.4_ENST00000419190.1_RNA					E74-like factor 3 (ets domain transcription factor, epithelial-specific )											breast(2)|endometrium(2)|large_intestine(6)|lung(5)|ovary(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	20						GCCAGCTGGTTGGGGGAACAGC	0.535																																					p.L60fs		Atlas-Indel,Pindel	.											.	ELF3	92	.	0			c.179_180insG						.																																			SO:0001589	frameshift_variant	1999	exon3			.	AF016295	CCDS1419.1	1q32.2	2008-02-05			ENSG00000163435	ENSG00000163435			3318	protein-coding gene	gene with protein product		602191		ESX		9395241, 9129154	Standard	NM_001114309		Approved	EPR-1, ESE-1, ERT	uc001gxh.4	P78545	OTTHUMG00000035867	ENST00000359651.3:c.184dupG	chr1.hg19:g.201981105_201981105dupG	ENSP00000352673:p.Leu60fs	189.0	0.0		200.0	92.0	NM_004433		Frame_Shift_Ins	INS	ENST00000359651.3	hg19	CCDS1419.1																																																																																			.	.		0.535	ELF3-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087360.1	NM_004433	
ZNF800	168850	hgsc.bcm.edu	37	7	127014128	127014128	+	Frame_Shift_Del	DEL	G	G	-			TCGA-2Y-A9H5-01A-11D-A382-10	TCGA-2Y-A9H5-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10106872-3169-465f-900a-b6e74debfc51	978cf657-0928-40db-9f1c-888305de2cbb	g.chr7:127014128delG	ENST00000393313.1	-	5	1853	c.1262delC	c.(1261-1263)cctfs	p.P421fs	ZNF800_ENST00000393312.1_Frame_Shift_Del_p.P421fs|ZNF800_ENST00000265827.3_Frame_Shift_Del_p.P421fs|ZNF800_ENST00000485577.1_5'Flank			Q2TB10	ZN800_HUMAN	zinc finger protein 800	421					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(6)|lung(8)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	32						GGTAATGGAAGGGGGTGAAGA	0.358																																					p.P421fs		Pindel	.											.	ZNF800	78	.	0			c.1263delT						.						84.0	90.0	88.0					7																	127014128		2203	4298	6501	SO:0001589	frameshift_variant	168850	exon5			.	AF218032	CCDS5795.1	7q31.33	2008-05-02			ENSG00000048405	ENSG00000048405		"""Zinc fingers, C2H2-type"""	27267	protein-coding gene	gene with protein product						12477932	Standard	NM_176814		Approved		uc003vly.1	Q2TB10	OTTHUMG00000023456	ENST00000393313.1:c.1262delC	chr7.hg19:g.127014128delG	ENSP00000376989:p.Pro421fs	99.0	0.0		173.0	42.0	NM_176814	Q9HBN0	Frame_Shift_Del	DEL	ENST00000393313.1	hg19	CCDS5795.1																																																																																			.	.		0.358	ZNF800-002	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000141823.1	NM_176814	
PEG10	23089	hgsc.bcm.edu	37	7	94293724	94293727	+	Frame_Shift_Del	DEL	AAAG	AAAG	-			TCGA-2Y-A9H5-01A-11D-A382-10	TCGA-2Y-A9H5-10A-01D-A385-10	AAAG	AAAG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10106872-3169-465f-900a-b6e74debfc51	978cf657-0928-40db-9f1c-888305de2cbb	g.chr7:94293724_94293727delAAAG	ENST00000482108.1	+	2	1335_1338	c.856_859delAAAG	c.(856-861)aaagaafs	p.KE286fs	PEG10_ENST00000488574.1_Frame_Shift_Del_p.KE286fs	NM_001040152.1|NM_001172438.1|NM_001184962.1	NP_001035242.1|NP_001165909.1|NP_001171891.1	Q86TG7	PEG10_HUMAN	paternally expressed 10	286					apoptotic process (GO:0006915)|cell differentiation (GO:0030154)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|placenta development (GO:0001890)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			NS(1)|central_nervous_system(1)|endometrium(3)|large_intestine(3)|lung(9)|prostate(3)|skin(1)	21	all_cancers(62;8.26e-10)|all_epithelial(64;5.59e-09)|Lung NSC(181;0.188)|all_lung(186;0.215)		STAD - Stomach adenocarcinoma(171;0.0031)			GCAGGAAGAAAAAGAAAGACGCAG	0.593																																					p.361_362del		Pindel	.											.	PEG10	36	.	0			c.1083_1086del						.																																			SO:0001589	frameshift_variant	23089	exon2			.	AB049834	CCDS55126.1, CCDS75636.1, CCDS75637.1	7q21	2007-12-07			ENSG00000242265	ENSG00000242265			14005	protein-coding gene	gene with protein product		609810				11318613, 15716091, 16093683	Standard	NM_001172437		Approved	KIAA1051, HB-1, MEF3L, RGAG3, Mar2, Mart2	uc011kie.2	Q86TG7	OTTHUMG00000155578	ENST00000482108.1:c.856_859delAAAG	chr7.hg19:g.94293728_94293731delAAAG	ENSP00000417587:p.Lys286fs	163.0	0.0		142.0	29.0	NM_001172438	Q96A68|Q9UPV1	Frame_Shift_Del	DEL	ENST00000482108.1	hg19	CCDS55126.1																																																																																			.	.		0.593	PEG10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340751.1	NM_015068	
