#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
FPGT-TNNI3K	100526835	hgsc.bcm.edu	37	1	74819702	74819702	+	Missense_Mutation	SNP	G	G	A			TCGA-2Y-A9H6-01A-11D-A38X-10	TCGA-2Y-A9H6-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ee12965-26aa-443a-b8de-f4a79dc3e857	b27b338e-86e5-4131-83cf-206c52b809b7	g.chr1:74819702G>A	ENST00000370899.3	+	13	1406	c.1369G>A	c.(1369-1371)Gtt>Att	p.V457I	FPGT-TNNI3K_ENST00000370895.1_Missense_Mutation_p.V457I|TNNI3K_ENST00000370891.2_Missense_Mutation_p.V457I|RP11-439H8.4_ENST00000415549.2_RNA|FPGT-TNNI3K_ENST00000557284.2_Missense_Mutation_p.V470I|TNNI3K_ENST00000326637.3_Missense_Mutation_p.V356I	NM_001199327.1	NP_001186256			FPGT-TNNI3K readthrough																		CATTCGCCTGGTTCAGTTCTT	0.418																																					p.V457I		Atlas-SNP	.											.	.	.	.	0			c.G1369A						.						161.0	141.0	148.0					1																	74819702		2203	4300	6503	SO:0001583	missense	100526835	exon13			CGCCTGGTTCAGT			1p31.3	2014-03-14			ENSG00000259030	ENSG00000259030			42952	other	readthrough							Standard	NM_001112808		Approved		uc001dge.2		OTTHUMG00000166281	ENST00000370899.3:c.1369G>A	chr1.hg19:g.74819702G>A	ENSP00000359936:p.Val457Ile	79.0	0.0		68.0	33.0	NM_001112808		Missense_Mutation	SNP	ENST00000370899.3	hg19		.	.	.	.	.	.	.	.	.	.	G	21.8	4.205257	0.79127	.	.	ENSG00000259030;ENSG00000259030;ENSG00000259030;ENSG00000116783;ENSG00000116783	ENST00000370899;ENST00000370895;ENST00000557284;ENST00000370891;ENST00000326637	T;T;T;T;T	0.69685	-0.42;-0.42;-0.42;-0.42;-0.42	5.22	2.33	0.28932	Ankyrin repeat-containing domain (4);	0.122893	0.53938	N	0.000042	T	0.69115	0.3075	M	0.73430	2.235	0.44454	D	0.997387	P;D;D;D	0.67145	0.831;0.983;0.983;0.996	P;P;P;D	0.76071	0.596;0.876;0.826;0.987	T	0.68017	-0.5520	10	0.39692	T	0.17	.	8.4223	0.32707	0.1393:0.1279:0.7328:0.0	.	356;457;457;457	Q59H18;Q59H18-1;Q59H18-4;Q59H18-3	TNI3K_HUMAN;.;.;.	I	457;457;457;457;356	ENSP00000359936:V457I;ENSP00000359932:V457I;ENSP00000450895:V457I;ENSP00000359928:V457I;ENSP00000322251:V356I	ENSP00000322251:V356I	V	+	1	0	RP11-653A5.2;AC093158.1	74592290	1.000000	0.71417	0.999000	0.59377	0.963000	0.63663	6.180000	0.71981	0.356000	0.24157	-0.175000	0.13238	GTT	.	.		0.418	FPGT-TNNI3K-003	NOVEL	basic|appris_candidate|readthrough_transcript|exp_conf	protein_coding	protein_coding	OTTHUMT00000026438.3		
IVL	3713	hgsc.bcm.edu	37	1	152883099	152883099	+	Missense_Mutation	SNP	C	C	T	rs541702541	byFrequency	TCGA-2Y-A9H6-01A-11D-A38X-10	TCGA-2Y-A9H6-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ee12965-26aa-443a-b8de-f4a79dc3e857	b27b338e-86e5-4131-83cf-206c52b809b7	g.chr1:152883099C>T	ENST00000368764.3	+	2	890	c.826C>T	c.(826-828)Cca>Tca	p.P276S	IVL_ENST00000392667.2_Missense_Mutation_p.P130S			P07476	INVO_HUMAN	involucrin	276	39 X 10 AA approximate tandem repeats of [LP]-[EKG]-[LHVYQEK]-[PLSQE]-[EQDV]- [QHEKRGA]-Q-[EMVQLP]-[GKLE]-[QHVNLD].				isopeptide cross-linking via N6-(L-isoglutamyl)-L-lysine (GO:0018153)|keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)|response to UV-B (GO:0010224)	cornified envelope (GO:0001533)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	protein binding, bridging (GO:0030674)|structural molecule activity (GO:0005198)			breast(1)|endometrium(6)|kidney(1)|large_intestine(5)|lung(11)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	29	Lung NSC(65;3.97e-29)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			gcTGGAGGTCCCAGAGGAGCA	0.637													C|||	2	0.000399361	0.0	0.0029	5008	,	,		19342	0.0		0.0	False		,,,				2504	0.0				p.P276S		Atlas-SNP	.											.	IVL	100	.	0			c.C826T						.						16.0	15.0	15.0					1																	152883099		2039	3988	6027	SO:0001583	missense	3713	exon2			GAGGTCCCAGAGG	BC046391	CCDS1030.1	1q21	2008-02-05			ENSG00000163207	ENSG00000163207			6187	protein-coding gene	gene with protein product		147360				2873896	Standard	NM_005547		Approved		uc001fau.3	P07476	OTTHUMG00000012451	ENST00000368764.3:c.826C>T	chr1.hg19:g.152883099C>T	ENSP00000357753:p.Pro276Ser	184.0	0.0		287.0	63.0	NM_005547	Q5T7P4	Missense_Mutation	SNP	ENST00000368764.3	hg19	CCDS1030.1	.	.	.	.	.	.	.	.	.	.	C	8.482	0.859906	0.17178	.	.	ENSG00000163207	ENST00000368764;ENST00000392667	T;T	0.09445	3.19;2.98	3.62	-1.67	0.08238	.	.	.	.	.	T	0.02494	0.0076	L	0.58101	1.795	0.09310	N	1	P	0.42123	0.771	B	0.42282	0.382	T	0.31586	-0.9938	9	0.09590	T	0.72	.	0.4282	0.00467	0.334:0.2865:0.1642:0.2153	.	276	P07476	INVO_HUMAN	S	276;130	ENSP00000357753:P276S;ENSP00000376435:P130S	ENSP00000357753:P276S	P	+	1	0	IVL	151149723	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-0.090000	0.11163	-0.154000	0.11118	0.194000	0.17425	CCA	.	.		0.637	IVL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034664.1	NM_005547	
BRINP3	339479	hgsc.bcm.edu	37	1	190067855	190067855	+	Silent	SNP	G	G	T			TCGA-2Y-A9H6-01A-11D-A38X-10	TCGA-2Y-A9H6-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ee12965-26aa-443a-b8de-f4a79dc3e857	b27b338e-86e5-4131-83cf-206c52b809b7	g.chr1:190067855G>T	ENST00000367462.3	-	8	1825	c.1594C>A	c.(1594-1596)Cgg>Agg	p.R532R	BRINP3_ENST00000534846.1_Silent_p.R430R	NM_199051.1	NP_950252.1	Q76B58	BRNP3_HUMAN	bone morphogenetic protein/retinoic acid inducible neural-specific 3	532					cell cycle arrest (GO:0007050)|cellular response to retinoic acid (GO:0071300)|negative regulation of mitotic cell cycle (GO:0045930)|positive regulation of neuron differentiation (GO:0045666)	dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)											AGGAGCATCCGCTTACGCCAG	0.433																																					p.R532R		Atlas-SNP	.											.	FAM5C	343	.	0			c.C1594A						.						119.0	116.0	117.0					1																	190067855		2203	4300	6503	SO:0001819	synonymous_variant	339479	exon8			GCATCCGCTTACG	AB111893	CCDS1373.1	1q31.1	2013-09-18	2013-09-18	2013-09-18	ENSG00000162670	ENSG00000162670			22393	protein-coding gene	gene with protein product			"""family with sequence similarity 5, member C"""	FAM5C		16018821, 15193423	Standard	NM_199051		Approved	DBCCR1L, DBCCR1L1	uc001gse.1	Q76B58	OTTHUMG00000035533	ENST00000367462.3:c.1594C>A	chr1.hg19:g.190067855G>T		82.0	0.0		151.0	37.0	NM_199051	B3KVP1|B7Z260|O95726|Q2M330	Silent	SNP	ENST00000367462.3	hg19	CCDS1373.1																																																																																			.	.		0.433	BRINP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086278.1	NM_199051	
CR2	1380	hgsc.bcm.edu	37	1	207649630	207649630	+	Missense_Mutation	SNP	G	G	A			TCGA-2Y-A9H6-01A-11D-A38X-10	TCGA-2Y-A9H6-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ee12965-26aa-443a-b8de-f4a79dc3e857	b27b338e-86e5-4131-83cf-206c52b809b7	g.chr1:207649630G>A	ENST00000367058.3	+	14	2780	c.2591G>A	c.(2590-2592)gGt>gAt	p.G864D	CR2_ENST00000367057.3_Missense_Mutation_p.G923D|CR2_ENST00000367059.3_Intron|CR2_ENST00000458541.2_Missense_Mutation_p.G837D	NM_001877.4	NP_001868.2	P20023	CR2_HUMAN	complement component (3d/Epstein Barr virus) receptor 2	864	Sushi 14. {ECO:0000255|PROSITE- ProRule:PRU00302}.				B cell differentiation (GO:0030183)|B cell proliferation (GO:0042100)|complement activation, classical pathway (GO:0006958)|immune response (GO:0006955)|innate immune response (GO:0045087)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	complement binding (GO:0001848)|complement receptor activity (GO:0004875)|DNA binding (GO:0003677)|protein homodimerization activity (GO:0042803)|transmembrane signaling receptor activity (GO:0004888)			NS(2)|breast(3)|endometrium(4)|kidney(3)|large_intestine(12)|lung(26)|ovary(1)|pancreas(1)|prostate(1)|skin(12)|upper_aerodigestive_tract(3)|urinary_tract(1)	69						AACCATACTGGTGGAAACATA	0.498																																					p.G923D		Atlas-SNP	.											.	CR2	164	.	0			c.G2768A						.						153.0	139.0	144.0					1																	207649630		2203	4300	6503	SO:0001583	missense	1380	exon15			ATACTGGTGGAAA	M26004	CCDS1478.1, CCDS31007.1	1q32	2014-09-17			ENSG00000117322	ENSG00000117322		"""CD molecules"", ""Complement system"""	2336	protein-coding gene	gene with protein product		120650					Standard	NM_001006658		Approved	CD21	uc001hfv.3	P20023	OTTHUMG00000036307	ENST00000367058.3:c.2591G>A	chr1.hg19:g.207649630G>A	ENSP00000356025:p.Gly864Asp	46.0	0.0		195.0	47.0	NM_001006658	C9JHD2|Q13866|Q14212|Q53EL2|Q5BKT9|Q5SR46|Q5SR48	Missense_Mutation	SNP	ENST00000367058.3	hg19	CCDS1478.1	.	.	.	.	.	.	.	.	.	.	G	14.57	2.573726	0.45902	.	.	ENSG00000117322	ENST00000367058;ENST00000367057;ENST00000458541	T;T;T	0.50277	0.75;0.75;0.75	4.87	3.95	0.45737	Complement control module (2);Sushi/SCR/CCP (3);	.	.	.	.	T	0.54775	0.1879	L	0.35723	1.085	0.43084	D	0.994749	D;D	0.71674	0.998;0.997	D;D	0.71414	0.961;0.973	T	0.52434	-0.8576	9	0.35671	T	0.21	.	11.8047	0.52147	0.0:0.1781:0.8219:0.0	.	864;923	P20023;P20023-3	CR2_HUMAN;.	D	864;923;837	ENSP00000356025:G864D;ENSP00000356024:G923D;ENSP00000404222:G837D	ENSP00000356024:G923D	G	+	2	0	CR2	205716253	0.284000	0.24287	0.688000	0.30117	0.319000	0.28217	1.238000	0.32707	1.360000	0.45960	0.655000	0.94253	GGT	.	.		0.498	CR2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000088274.1	NM_001877	
CDC42BPA	8476	hgsc.bcm.edu	37	1	227223280	227223280	+	Silent	SNP	A	A	G	rs371390192		TCGA-2Y-A9H6-01A-11D-A38X-10	TCGA-2Y-A9H6-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ee12965-26aa-443a-b8de-f4a79dc3e857	b27b338e-86e5-4131-83cf-206c52b809b7	g.chr1:227223280A>G	ENST00000366769.3	-	24	4414	c.3123T>C	c.(3121-3123)tgT>tgC	p.C1041C	CDC42BPA_ENST00000366764.2_Silent_p.C1013C|CDC42BPA_ENST00000366767.3_Silent_p.C960C|CDC42BPA_ENST00000535525.1_Silent_p.C1021C|CDC42BPA_ENST00000334218.5_Silent_p.C1041C|CDC42BPA_ENST00000366765.3_Silent_p.C1054C|CDC42BPA_ENST00000366766.2_Silent_p.C1076C	NM_003607.3	NP_003598.2			CDC42 binding protein kinase alpha (DMPK-like)											NS(1)|breast(4)|cervix(1)|endometrium(8)|kidney(8)|large_intestine(12)|lung(32)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(3)|urinary_tract(2)	77		all_cancers(173;0.156)|Prostate(94;0.0792)				CTTTGTTTACACAAGTTATAT	0.383																																					p.C1041C		Atlas-SNP	.											.	CDC42BPA	528	.	0			c.T3123C						.	A	,	0,4406		0,0,2203	89.0	90.0	90.0		3123,2880	4.7	1.0	1		90	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous	CDC42BPA	NM_003607.3,NM_014826.4	,	0,1,6502	GG,GA,AA		0.0116,0.0,0.0077	,	1041/1720,960/1639	227223280	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	8476	exon24			GTTTACACAAGTT	U59305	CCDS1558.1, CCDS1559.1	1q42.11	2011-11-23	2001-11-28		ENSG00000143776	ENSG00000143776			1737	protein-coding gene	gene with protein product	"""myotonic dystrophy kinase-related Cdc42-binding kinase"""	603412	"""CDC42-binding protein kinase alpha (DMPK-like)"""				Standard	NM_003607		Approved	MRCKA, PK428, FLJ23347, KIAA0451, MRCK	uc001hqr.3	Q5VT25	OTTHUMG00000037618	ENST00000366769.3:c.3123T>C	chr1.hg19:g.227223280A>G		67.0	0.0		136.0	33.0	NM_003607		Silent	SNP	ENST00000366769.3	hg19	CCDS1558.1	.	.	.	.	.	.	.	.	.	.	A	10.57	1.388599	0.25118	0.0	1.16E-4	ENSG00000143776	ENST00000448940;ENST00000442054;ENST00000441725	D;D;D	0.99898	-7.61;-7.61;-7.61	5.8	4.67	0.58626	.	0.000000	0.85682	D	0.000000	D	0.99802	0.9915	.	.	.	0.80722	D	1	.	.	.	.	.	.	D	0.96290	0.9213	7	0.87932	D	0	.	11.7355	0.51763	0.9313:0.0:0.0687:0.0	.	.	.	.	R	244;370;266	ENSP00000415388:C244R;ENSP00000401051:C370R;ENSP00000408165:C266R	ENSP00000408165:C266R	C	-	1	0	CDC42BPA	225289903	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.058000	0.49939	1.024000	0.39682	0.528000	0.53228	TGT	.	.		0.383	CDC42BPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091696.1	NM_014826	
KIF26B	55083	hgsc.bcm.edu	37	1	245809435	245809435	+	Missense_Mutation	SNP	G	G	A			TCGA-2Y-A9H6-01A-11D-A38X-10	TCGA-2Y-A9H6-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ee12965-26aa-443a-b8de-f4a79dc3e857	b27b338e-86e5-4131-83cf-206c52b809b7	g.chr1:245809435G>A	ENST00000407071.2	+	10	2551	c.2111G>A	c.(2110-2112)cGc>cAc	p.R704H	KIF26B_ENST00000366518.4_Missense_Mutation_p.R323H	NM_018012.3	NP_060482.2	Q2KJY2	KI26B_HUMAN	kinesin family member 26B	704	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				establishment of cell polarity (GO:0030010)|metabolic process (GO:0008152)|positive regulation of cell-cell adhesion (GO:0022409)|ureteric bud invasion (GO:0072092)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(21)|ovary(4)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	51	all_cancers(71;3.86e-05)|all_epithelial(71;0.000121)|Ovarian(71;0.0412)|all_lung(81;0.0498)|Lung NSC(105;0.0708)|Breast(184;0.127)		OV - Ovarian serous cystadenocarcinoma(106;0.022)			TCTGGAGGTCGCAGCCGCCTG	0.502																																					p.R704H		Atlas-SNP	.											KIF26B_ENST00000407071,colon,carcinoma,0,2	KIF26B	343	.	0			c.G2111A						.						55.0	56.0	55.0					1																	245809435		1936	4140	6076	SO:0001583	missense	55083	exon10			GAGGTCGCAGCCG	AK001019	CCDS44342.1	1q44	2008-02-05			ENSG00000162849	ENSG00000162849		"""Kinesins"""	25484	protein-coding gene	gene with protein product		614026					Standard	NM_018012		Approved	FLJ10157	uc001ibf.1	Q2KJY2	OTTHUMG00000040079	ENST00000407071.2:c.2111G>A	chr1.hg19:g.245809435G>A	ENSP00000385545:p.Arg704His	31.0	0.0		96.0	43.0	NM_018012	Q6ZQR9|Q6ZUZ0|Q8IUN3|Q8IVR1|Q9NWB4	Missense_Mutation	SNP	ENST00000407071.2	hg19	CCDS44342.1	.	.	.	.	.	.	.	.	.	.	G	23.5	4.423362	0.83559	.	.	ENSG00000162849	ENST00000407071;ENST00000366518;ENST00000413001	T;T	0.17528	2.27;2.27	5.78	5.78	0.91487	Kinesin, motor domain (4);	.	.	.	.	T	0.42314	0.1197	L	0.56396	1.775	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	T	0.13098	-1.0522	9	0.87932	D	0	.	20.0114	0.97452	0.0:0.0:1.0:0.0	.	323;704	B7WPD9;Q2KJY2	.;KI26B_HUMAN	H	704;323;320	ENSP00000385545:R704H;ENSP00000355475:R323H	ENSP00000355475:R323H	R	+	2	0	KIF26B	243876058	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	9.476000	0.97823	2.724000	0.93272	0.555000	0.69702	CGC	.	.		0.502	KIF26B-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381037.1	XM_371354	
CMPK2	129607	hgsc.bcm.edu	37	2	6991720	6991720	+	Missense_Mutation	SNP	G	G	A	rs372816766		TCGA-2Y-A9H6-01A-11D-A38X-10	TCGA-2Y-A9H6-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ee12965-26aa-443a-b8de-f4a79dc3e857	b27b338e-86e5-4131-83cf-206c52b809b7	g.chr2:6991720G>A	ENST00000256722.5	-	4	1086	c.1087C>T	c.(1087-1089)Cca>Tca	p.P363S	CMPK2_ENST00000458098.1_Intron|CMPK2_ENST00000478738.1_5'UTR|CMPK2_ENST00000404168.1_Missense_Mutation_p.P363S	NM_207315.3	NP_997198.2	Q5EBM0	CMPK2_HUMAN	cytidine monophosphate (UMP-CMP) kinase 2, mitochondrial	363					cellular response to lipopolysaccharide (GO:0071222)|dTDP biosynthetic process (GO:0006233)|dUDP biosynthetic process (GO:0006227)|nucleoside diphosphate phosphorylation (GO:0006165)|nucleoside triphosphate biosynthetic process (GO:0009142)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	ATP binding (GO:0005524)|cytidylate kinase activity (GO:0004127)|nucleoside diphosphate kinase activity (GO:0004550)|thymidylate kinase activity (GO:0004798)|UMP kinase activity (GO:0033862)			large_intestine(1)|lung(13)|prostate(1)|upper_aerodigestive_tract(1)	16	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)					AGGTCCTCTGGCCACTGGTAC	0.617																																					p.P363S		Atlas-SNP	.											.	CMPK2	30	.	0			c.C1087T						.	G	SER/PRO	0,4104		0,0,2052	96.0	101.0	100.0		1087	5.2	1.0	2		100	1,8423		0,1,4211	no	missense	CMPK2	NM_207315.2	74	0,1,6263	AA,AG,GG		0.0119,0.0,0.0080	probably-damaging	363/450	6991720	1,12527	2052	4212	6264	SO:0001583	missense	129607	exon4			CCTCTGGCCACTG		CCDS42648.1, CCDS58695.1, CCDS58696.1	2p25.2	2008-01-25			ENSG00000134326	ENSG00000134326	2.7.4.14		27015	protein-coding gene	gene with protein product	"""cytidylate kinase 2"""	611787				17999954	Standard	NM_207315		Approved	TYKi, UMP-CMPK2	uc002qyo.4	Q5EBM0	OTTHUMG00000151629	ENST00000256722.5:c.1087C>T	chr2.hg19:g.6991720G>A	ENSP00000256722:p.Pro363Ser	80.0	0.0		137.0	44.0	NM_001256477	A2RUB0|A5D8T2|B7ZM18|Q6ZRU2|Q96AL8	Missense_Mutation	SNP	ENST00000256722.5	hg19	CCDS42648.1	.	.	.	.	.	.	.	.	.	.	G	17.87	3.494398	0.64186	0.0	1.19E-4	ENSG00000134326	ENST00000256722;ENST00000404168	T;T	0.39787	1.06;1.06	5.23	5.23	0.72850	.	0.000000	0.85682	D	0.000000	T	0.66056	0.2751	M	0.69823	2.125	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.68739	-0.5329	10	0.72032	D	0.01	-13.7264	19.1591	0.93524	0.0:0.0:1.0:0.0	.	363	Q5EBM0	CMPK2_HUMAN	S	363	ENSP00000256722:P363S;ENSP00000384915:P363S	ENSP00000256722:P363S	P	-	1	0	CMPK2	6909171	1.000000	0.71417	0.998000	0.56505	0.038000	0.13279	9.525000	0.98039	2.596000	0.87737	0.561000	0.74099	CCA	.	.		0.617	CMPK2-002	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323339.2	NM_207315	
GPR75-ASB3	100302652	hgsc.bcm.edu	37	2	53977937	53977937	+	Missense_Mutation	SNP	G	G	A	rs540542893		TCGA-2Y-A9H6-01A-11D-A38X-10	TCGA-2Y-A9H6-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ee12965-26aa-443a-b8de-f4a79dc3e857	b27b338e-86e5-4131-83cf-206c52b809b7	g.chr2:53977937G>A	ENST00000263634.3	-	3	472	c.338C>T	c.(337-339)aCg>aTg	p.T113M	ASB3_ENST00000406625.2_Missense_Mutation_p.T148M|GPR75-ASB3_ENST00000482829.1_5'UTR|GPR75-ASB3_ENST00000406687.1_Missense_Mutation_p.T40M|GPR75-ASB3_ENST00000352846.3_Missense_Mutation_p.T151M|ASB3_ENST00000498475.2_Intron|GPR75-ASB3_ENST00000394717.2_Missense_Mutation_p.T40M	NM_016115.4	NP_057199.1			GPR75-ASB3 readthrough																		CAATGGTGTCGTTTCTTCTAA	0.353																																					p.T151M		Atlas-SNP	.											ASB3,caecum,carcinoma,0,1	.	.	.	0			c.C452T						.						115.0	116.0	116.0					2																	53977937		2203	4300	6503	SO:0001583	missense	100302652	exon3			GGTGTCGTTTCTT		CCDS54361.1	2p16	2013-01-23			ENSG00000115239	ENSG00000115239			40043	other	readthrough							Standard	NM_001164165		Approved				OTTHUMG00000129279	ENST00000263634.3:c.338C>T	chr2.hg19:g.53977937G>A	ENSP00000263634:p.Thr113Met	60.0	0.0		84.0	5.0	NM_001164165		Missense_Mutation	SNP	ENST00000263634.3	hg19	CCDS1846.1	.	.	.	.	.	.	.	.	.	.	G	17.86	3.493614	0.64186	.	.	ENSG00000115239	ENST00000263634;ENST00000406625;ENST00000406687;ENST00000394717;ENST00000352846;ENST00000446049	T;T;T;T;T	0.64991	-0.13;-0.13;-0.13;-0.13;-0.13	5.54	4.65	0.58169	Ankyrin repeat-containing domain (4);	0.174333	0.49916	D	0.000140	T	0.64294	0.2585	N	0.16478	0.41	0.28771	N	0.9003909999999999	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.78314	0.991;0.976;0.964	T	0.69128	-0.5227	9	0.31617	T	0.26	-15.9352	14.2721	0.66157	0.0:0.0:0.7299:0.2701	.	113;148;113	B4DZX6;Q2TAI4;Q9Y575	.;.;ASB3_HUMAN	M	113;148;40;40;151;113	ENSP00000263634:T113M;ENSP00000385085:T148M;ENSP00000384728:T40M;ENSP00000378206:T40M;ENSP00000313756:T151M	ENSP00000263634:T113M	T	-	2	0	ASB3	53831441	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	4.037000	0.57311	1.451000	0.47736	0.591000	0.81541	ACG	.	.		0.353	GPR75-ASB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251402.3		
MTHFD2	10797	hgsc.bcm.edu	37	2	74435849	74435849	+	Splice_Site	SNP	G	G	T			TCGA-2Y-A9H6-01A-11D-A38X-10	TCGA-2Y-A9H6-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ee12965-26aa-443a-b8de-f4a79dc3e857	b27b338e-86e5-4131-83cf-206c52b809b7	g.chr2:74435849G>T	ENST00000394053.2	+	4	642		c.e4+1		MTHFD2_ENST00000409804.1_Intron|MTHFD2_ENST00000264090.4_Splice_Site|MTHFD2_ENST00000394050.3_Splice_Site|MTHFD2_ENST00000409601.1_Splice_Site	NM_006636.3	NP_006627.2	P13995	MTDC_HUMAN	methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2, methenyltetrahydrofolate cyclohydrolase						folic acid-containing compound biosynthetic process (GO:0009396)|one-carbon metabolic process (GO:0006730)|tetrahydrofolate metabolic process (GO:0046653)	extracellular space (GO:0005615)|mitochondrion (GO:0005739)	magnesium ion binding (GO:0000287)|methenyltetrahydrofolate cyclohydrolase activity (GO:0004477)|methylenetetrahydrofolate dehydrogenase (NAD+) activity (GO:0004487)|methylenetetrahydrofolate dehydrogenase (NADP+) activity (GO:0004488)|phosphate ion binding (GO:0042301)			endometrium(1)|kidney(1)|large_intestine(1)|lung(3)	6					Tetrahydrofolic acid(DB00116)	AAGCGAACTGGTAGGTATATC	0.403																																					.		Atlas-SNP	.											.	MTHFD2	43	.	0			c.562+1G>T						.						205.0	184.0	191.0					2																	74435849		1874	4103	5977	SO:0001630	splice_region_variant	10797	exon4			GAACTGGTAGGTA	X16396	CCDS1935.2	2p13.1	2008-05-02			ENSG00000065911	ENSG00000065911			7434	protein-coding gene	gene with protein product		604887				2587219, 8218174	Standard	NR_027405		Approved		uc002skk.3	P13995	OTTHUMG00000129814	ENST00000394053.2:c.562+1G>T	chr2.hg19:g.74435849G>T		64.0	0.0		114.0	5.0	NM_006636	Q53G90|Q53GV5|Q53S36|Q7Z650	Splice_Site	SNP	ENST00000394053.2	hg19	CCDS1935.2	.	.	.	.	.	.	.	.	.	.	G	20.9	4.061533	0.76187	.	.	ENSG00000065911	ENST00000394053;ENST00000264090;ENST00000394050;ENST00000409601	.	.	.	4.4	4.4	0.53042	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.3381	0.74273	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	MTHFD2	74289357	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	9.010000	0.93611	2.409000	0.81822	0.650000	0.86243	.	.	.		0.403	MTHFD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252045.2		Intron
ATOH8	84913	hgsc.bcm.edu	37	2	85981810	85981810	+	Silent	SNP	A	A	G			TCGA-2Y-A9H6-01A-11D-A38X-10	TCGA-2Y-A9H6-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ee12965-26aa-443a-b8de-f4a79dc3e857	b27b338e-86e5-4131-83cf-206c52b809b7	g.chr2:85981810A>G	ENST00000306279.3	+	1	794	c.498A>G	c.(496-498)tcA>tcG	p.S166S	ATOH8_ENST00000463422.1_3'UTR	NM_032827.6	NP_116216.2	Q96SQ7	ATOH8_HUMAN	atonal homolog 8 (Drosophila)	166	Pro-rich.				cell differentiation (GO:0030154)|nervous system development (GO:0007399)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			cervix(1)|endometrium(1)|large_intestine(1)|lung(2)	5						ccgcgccgTCAGCACCCCCAG	0.706																																					p.S166S		Atlas-SNP	.											.	ATOH8	15	.	0			c.A498G						.						8.0	10.0	10.0					2																	85981810		2020	4087	6107	SO:0001819	synonymous_variant	84913	exon1			GCCGTCAGCACCC	AK074681	CCDS1985.1	2p11.2	2013-05-21			ENSG00000168874	ENSG00000168874		"""Basic helix-loop-helix proteins"""	24126	protein-coding gene	gene with protein product	"""basic helix loop helix transcription factor 6"""					12419857	Standard	NM_032827		Approved	HATH6, FLJ14708, bHLHa21	uc002sqn.3	Q96SQ7	OTTHUMG00000130178	ENST00000306279.3:c.498A>G	chr2.hg19:g.85981810A>G		143.0	0.0		124.0	38.0	NM_032827	Q504S2|Q659B0	Silent	SNP	ENST00000306279.3	hg19	CCDS1985.1																																																																																			.	.		0.706	ATOH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252496.1	NM_032827	
SPHKAP	80309	hgsc.bcm.edu	37	2	228881378	228881378	+	Missense_Mutation	SNP	G	G	T			TCGA-2Y-A9H6-01A-11D-A38X-10	TCGA-2Y-A9H6-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ee12965-26aa-443a-b8de-f4a79dc3e857	b27b338e-86e5-4131-83cf-206c52b809b7	g.chr2:228881378G>T	ENST00000392056.3	-	7	4238	c.4192C>A	c.(4192-4194)Cct>Act	p.P1398T	SPHKAP_ENST00000344657.5_Missense_Mutation_p.P1398T	NM_001142644.1	NP_001136116.1	Q2M3C7	SPKAP_HUMAN	SPHK1 interactor, AKAP domain containing	1398						extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|Z disc (GO:0030018)	protein kinase A binding (GO:0051018)			NS(5)|breast(5)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(25)|lung(86)|ovary(6)|pancreas(1)|prostate(6)|skin(17)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	185		Renal(207;0.025)|all_hematologic(139;0.15)|all_lung(227;0.204)|Acute lymphoblastic leukemia(138;0.205)|Esophageal squamous(248;0.23)		Epithelial(121;8.17e-11)|all cancers(144;7.92e-08)|Lung(261;0.0168)|LUSC - Lung squamous cell carcinoma(224;0.0232)		GAATCTAAAGGGCTGTGGTTT	0.458																																					p.P1398T		Atlas-SNP	.											.	SPHKAP	750	.	0			c.C4192A						.						90.0	96.0	94.0					2																	228881378		2203	4300	6503	SO:0001583	missense	80309	exon7			CTAAAGGGCTGTG		CCDS33389.1, CCDS46537.1	2q36.3	2010-08-20			ENSG00000153820	ENSG00000153820		"""A-kinase anchor proteins"""	30619	protein-coding gene	gene with protein product	"""sphingosine kinase type 1-interacting protein"""	611646				12080051, 11214970	Standard	NM_030623		Approved	SKIP	uc002vpq.2	Q2M3C7	OTTHUMG00000153584	ENST00000392056.3:c.4192C>A	chr2.hg19:g.228881378G>T	ENSP00000375909:p.Pro1398Thr	76.0	0.0		100.0	29.0	NM_030623	Q68DA3|Q68DR8|Q9C0I5	Missense_Mutation	SNP	ENST00000392056.3	hg19	CCDS46537.1	.	.	.	.	.	.	.	.	.	.	G	3.048	-0.196108	0.06259	.	.	ENSG00000153820	ENST00000392056;ENST00000344657	T;T	0.11385	2.78;2.78	5.52	-0.811	0.10857	.	1.268580	0.05103	N	0.487452	T	0.06142	0.0159	N	0.14661	0.345	0.09310	N	1	B;B;B	0.15473	0.003;0.013;0.013	B;B;B	0.17979	0.005;0.006;0.02	T	0.42189	-0.9466	10	0.14252	T	0.57	.	6.0883	0.19980	0.0:0.2987:0.3239:0.3773	.	429;1398;1398	B3KR30;Q2M3C7;Q2M3C7-2	.;SPKAP_HUMAN;.	T	1398	ENSP00000375909:P1398T;ENSP00000339886:P1398T	ENSP00000339886:P1398T	P	-	1	0	SPHKAP	228589622	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.393000	0.07305	-0.117000	0.11872	-0.262000	0.10625	CCT	.	.		0.458	SPHKAP-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000331750.1	NM_030623	
CCR4	1233	hgsc.bcm.edu	37	3	32995552	32995552	+	Missense_Mutation	SNP	T	T	A			TCGA-2Y-A9H6-01A-11D-A38X-10	TCGA-2Y-A9H6-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ee12965-26aa-443a-b8de-f4a79dc3e857	b27b338e-86e5-4131-83cf-206c52b809b7	g.chr3:32995552T>A	ENST00000330953.5	+	2	806	c.638T>A	c.(637-639)aTc>aAc	p.I213N		NM_005508.4	NP_005499.1	P51679	CCR4_HUMAN	chemokine (C-C motif) receptor 4	213					chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|immune response (GO:0006955)|inflammatory response (GO:0006954)|neuron migration (GO:0001764)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of positive chemotaxis (GO:0050927)|response to antibiotic (GO:0046677)|response to bacterium (GO:0009617)|response to radiation (GO:0009314)|tolerance induction (GO:0002507)	external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	C-C chemokine receptor activity (GO:0016493)|chemokine receptor activity (GO:0004950)			NS(1)|kidney(1)|large_intestine(2)|lung(7)|prostate(1)|skin(3)|stomach(1)	16						GGATTGGTGATCCCCTTAGGG	0.468																																					p.I213N		Atlas-SNP	.											.	CCR4	36	.	0			c.T638A						.						146.0	130.0	135.0					3																	32995552		2203	4300	6503	SO:0001583	missense	1233	exon2			TGGTGATCCCCTT	X85740	CCDS2656.1	3p24-p21.3	2012-08-08			ENSG00000183813	ENSG00000183813		"""GPCR / Class A : Chemokine receptors : C-C motif"", ""CD molecules"""	1605	protein-coding gene	gene with protein product		604836				7642634, 8884276	Standard	NM_005508		Approved	CC-CKR-4, CMKBR4, CKR4, k5-5, ChemR13, CD194	uc003cfg.1	P51679	OTTHUMG00000130752	ENST00000330953.5:c.638T>A	chr3.hg19:g.32995552T>A	ENSP00000332659:p.Ile213Asn	118.0	0.0		187.0	102.0	NM_005508	Q9ULY6|Q9ULY7	Missense_Mutation	SNP	ENST00000330953.5	hg19	CCDS2656.1	.	.	.	.	.	.	.	.	.	.	T	14.76	2.632813	0.47049	.	.	ENSG00000183813	ENST00000330953	T	0.44083	0.93	5.95	5.95	0.96441	GPCR, rhodopsin-like superfamily (1);	0.348334	0.24745	N	0.035948	T	0.67287	0.2877	M	0.90309	3.105	0.21416	N	0.999693	D	0.56287	0.975	P	0.57057	0.812	T	0.67753	-0.5589	10	0.87932	D	0	.	16.0852	0.81042	0.0:0.0:0.0:1.0	.	213	P51679	CCR4_HUMAN	N	213	ENSP00000332659:I213N	ENSP00000332659:I213N	I	+	2	0	CCR4	32970556	0.991000	0.36638	0.009000	0.14445	0.079000	0.17450	8.040000	0.89188	2.279000	0.76181	0.533000	0.62120	ATC	.	.		0.468	CCR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253252.2		
DNAH12	201625	hgsc.bcm.edu	37	3	57496652	57496652	+	Nonsense_Mutation	SNP	G	G	A			TCGA-2Y-A9H6-01A-11D-A38X-10	TCGA-2Y-A9H6-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ee12965-26aa-443a-b8de-f4a79dc3e857	b27b338e-86e5-4131-83cf-206c52b809b7	g.chr3:57496652G>A	ENST00000351747.2	-	5	514	c.334C>T	c.(334-336)Cag>Tag	p.Q112*	DNAH12_ENST00000311202.6_Nonsense_Mutation_p.Q112*|DNAH12_ENST00000389536.4_Nonsense_Mutation_p.Q112*|RNU6-1181P_ENST00000384191.1_RNA	NM_178504.4	NP_848599.3	Q6ZR08	DYH12_HUMAN	dynein, axonemal, heavy chain 12	112	Stem. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(3)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(4)|lung(7)|pancreas(1)|prostate(1)|skin(1)	25						CATTCCTGCTGAATAGGTACT	0.348																																					p.Q112X		Atlas-SNP	.											.	DNAH12	182	.	0			c.C334T						.						100.0	95.0	97.0					3																	57496652		2203	4300	6503	SO:0001587	stop_gained	201625	exon5			CCTGCTGAATAGG	U53532, AK126276	CCDS33771.1	3p21.1	2009-02-04	2006-09-04		ENSG00000174844	ENSG00000174844		"""Axonemal dyneins"""	2943	protein-coding gene	gene with protein product		603340	"""dynein, axonemal, heavy polypeptide 12"", ""dynein heavy chain domain 2"", ""dynein heavy domain 2"", ""dynein, axonemal, heavy chain 12-like"", ""dynein, axonemal, heavy chain 7-like"""	DNHD2, DNAH12L, DNAH7L		8812413, 8666668	Standard	NM_198564		Approved	DLP12, Dnahc3, HL-19, hdhc3, DHC3, FLJ40427, FLJ44290	uc003dit.2	Q6ZR08	OTTHUMG00000158598	ENST00000351747.2:c.334C>T	chr3.hg19:g.57496652G>A	ENSP00000295937:p.Gln112*	84.0	0.0		75.0	4.0	NM_198564	A6NGI2|Q6ZTR8|Q8N7R9|Q8WXK2|Q92816	Nonsense_Mutation	SNP	ENST00000351747.2	hg19		.	.	.	.	.	.	.	.	.	.	G	36	5.600504	0.96614	.	.	ENSG00000174844	ENST00000351747;ENST00000495027;ENST00000389536;ENST00000311202	.	.	.	4.95	4.02	0.46733	.	0.184221	0.35466	N	0.003187	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.59425	D	0.04	.	14.0533	0.64751	0.0:0.0:0.8486:0.1514	.	.	.	.	X	112	.	ENSP00000312554:Q112X	Q	-	1	0	DNAH12	57471692	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.003000	0.76310	2.293000	0.77203	0.563000	0.77884	CAG	.	.		0.348	DNAH12-202	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_178504	
YEATS2	55689	hgsc.bcm.edu	37	3	183446490	183446490	+	Silent	SNP	G	G	A			TCGA-2Y-A9H6-01A-11D-A38X-10	TCGA-2Y-A9H6-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ee12965-26aa-443a-b8de-f4a79dc3e857	b27b338e-86e5-4131-83cf-206c52b809b7	g.chr3:183446490G>A	ENST00000305135.5	+	7	858	c.663G>A	c.(661-663)ccG>ccA	p.P221P		NM_018023.4	NP_060493.3	Q9ULM3	YETS2_HUMAN	YEATS domain containing 2	221	YEATS. {ECO:0000255|PROSITE- ProRule:PRU00376}.				chromatin organization (GO:0006325)|histone H3 acetylation (GO:0043966)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)	Ada2/Gcn5/Ada3 transcription activator complex (GO:0005671)|mitotic spindle (GO:0072686)	TBP-class protein binding (GO:0017025)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(24)|ovary(3)|prostate(2)|skin(3)	49	all_cancers(143;6.55e-10)|Ovarian(172;0.0303)		all cancers(12;2.38e-42)|Epithelial(37;1.9e-36)|OV - Ovarian serous cystadenocarcinoma(80;6.48e-22)			ATATACCTCCGGATAAGAGGG	0.358																																					p.P221P		Atlas-SNP	.											.	YEATS2	111	.	0			c.G663A						.						92.0	89.0	90.0					3																	183446490		1812	4084	5896	SO:0001819	synonymous_variant	55689	exon7			ACCTCCGGATAAG	AB033023	CCDS43175.1	3q27.3	2004-08-18			ENSG00000163872	ENSG00000163872			25489	protein-coding gene	gene with protein product		613373				10574462	Standard	NM_018023		Approved	FLJ10201, FLJ12841, FLJ13308, KIAA1197	uc003fly.2	Q9ULM3	OTTHUMG00000156898	ENST00000305135.5:c.663G>A	chr3.hg19:g.183446490G>A		90.0	0.0		116.0	36.0	NM_018023	A7E2B9|D3DNS9|Q641P6|Q9NW96	Silent	SNP	ENST00000305135.5	hg19	CCDS43175.1																																																																																			.	.		0.358	YEATS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346507.2	NM_018023	
MASP1	5648	hgsc.bcm.edu	37	3	186980462	186980462	+	Missense_Mutation	SNP	G	G	A			TCGA-2Y-A9H6-01A-11D-A38X-10	TCGA-2Y-A9H6-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ee12965-26aa-443a-b8de-f4a79dc3e857	b27b338e-86e5-4131-83cf-206c52b809b7	g.chr3:186980462G>A	ENST00000337774.5	-	3	673	c.284C>T	c.(283-285)aCc>aTc	p.T95I	MASP1_ENST00000296280.6_Missense_Mutation_p.T95I|MASP1_ENST00000495249.1_Intron|MASP1_ENST00000392470.2_Missense_Mutation_p.T69I|MASP1_ENST00000392472.2_5'UTR|MASP1_ENST00000169293.6_Missense_Mutation_p.T95I	NM_001879.5	NP_001870.3	P48740	MASP1_HUMAN	mannan-binding lectin serine peptidase 1 (C4/C2 activating component of Ra-reactive factor)	95	CUB 1. {ECO:0000255|PROSITE- ProRule:PRU00059}.|Homodimerization. {ECO:0000250}.|Interaction with FCN2.|Interaction with MBL2.				complement activation (GO:0006956)|complement activation, lectin pathway (GO:0001867)|innate immune response (GO:0045087)|negative regulation of complement activation (GO:0045916)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	calcium ion binding (GO:0005509)|calcium-dependent protein binding (GO:0048306)|peptidase activity (GO:0008233)|protein homodimerization activity (GO:0042803)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|liver(2)|lung(27)|ovary(2)|pancreas(1)|prostate(3)|urinary_tract(1)	60	all_cancers(143;5.33e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;3.49e-18)	GBM - Glioblastoma multiforme(93;0.0366)		TGTGTCTGTGGTCTCCCTGCC	0.542																																					p.T95I		Atlas-SNP	.											.	MASP1	240	.	0			c.C284T						.						71.0	67.0	68.0					3																	186980462		2203	4300	6503	SO:0001583	missense	5648	exon3			TCTGTGGTCTCCC	D28593	CCDS33907.1, CCDS33908.1, CCDS33909.1	3q27-q28	2014-09-17	2005-08-17		ENSG00000127241	ENSG00000127241		"""Serine peptidases / Serine peptidases"""	6901	protein-coding gene	gene with protein product		600521	"""mannan-binding lectin serine protease 1 (C4/C2 activating component of Ra-reactive factor)"""	CRARF, PRSS5		8018603, 8240317	Standard	NR_033519		Approved	MASP	uc003fri.3	P48740	OTTHUMG00000156461	ENST00000337774.5:c.284C>T	chr3.hg19:g.186980462G>A	ENSP00000336792:p.Thr95Ile	134.0	0.0		311.0	20.0	NM_139125	A8K542|A8K6M1|B4E2L7|O95570|Q68D21|Q8IUV8|Q96RS4|Q9UF09	Missense_Mutation	SNP	ENST00000337774.5	hg19	CCDS33907.1	.	.	.	.	.	.	.	.	.	.	G	15.41	2.823962	0.50739	.	.	ENSG00000127241	ENST00000337774;ENST00000296280;ENST00000169293;ENST00000392470;ENST00000392475	T;T;T;T;T	0.27890	1.64;1.64;1.64;1.64;1.64	5.63	4.75	0.60458	CUB (5);	0.308262	0.38164	N	0.001783	T	0.17323	0.0416	N	0.12527	0.23	0.39073	D	0.960758	B;B;B;P	0.34562	0.052;0.023;0.434;0.457	B;B;B;B	0.32465	0.066;0.014;0.127;0.146	T	0.11743	-1.0575	10	0.40728	T	0.16	.	11.016	0.47689	0.0:0.1399:0.7146:0.1454	.	69;95;95;95	F8W876;P48740-3;P48740-2;P48740	.;.;.;MASP1_HUMAN	I	95;95;95;69;102	ENSP00000336792:T95I;ENSP00000296280:T95I;ENSP00000169293:T95I;ENSP00000376262:T69I;ENSP00000376267:T102I	ENSP00000169293:T95I	T	-	2	0	MASP1	188463156	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.326000	0.52037	1.497000	0.48584	0.655000	0.94253	ACC	.	.		0.542	MASP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344262.1	NM_001879	
CORIN	10699	hgsc.bcm.edu	37	4	47685816	47685816	+	Missense_Mutation	SNP	C	C	A			TCGA-2Y-A9H6-01A-11D-A38X-10	TCGA-2Y-A9H6-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ee12965-26aa-443a-b8de-f4a79dc3e857	b27b338e-86e5-4131-83cf-206c52b809b7	g.chr4:47685816C>A	ENST00000273857.4	-	7	952	c.953G>T	c.(952-954)tGc>tTc	p.C318F	CORIN_ENST00000505909.1_Missense_Mutation_p.C318F|CORIN_ENST00000502252.1_Missense_Mutation_p.C251F|CORIN_ENST00000504584.1_Missense_Mutation_p.C318F|CORIN_ENST00000508498.1_Missense_Mutation_p.C179F	NM_006587.2	NP_006578.2	Q9Y5Q5	CORIN_HUMAN	corin, serine peptidase	318	LDL-receptor class A 2. {ECO:0000255|PROSITE-ProRule:PRU00124}.				female pregnancy (GO:0007565)|peptide hormone processing (GO:0016486)|proteolysis (GO:0006508)|regulation of blood pressure (GO:0008217)|regulation of renal sodium excretion (GO:0035813)|regulation of systemic arterial blood pressure by atrial natriuretic peptide (GO:0003050)	cell surface (GO:0009986)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	serine-type endopeptidase activity (GO:0004252)|serine-type exopeptidase activity (GO:0070008)			NS(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(18)|lung(39)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)	79						GTAATTAAGGCACTTGCCTGT	0.428																																					p.C318F		Atlas-SNP	.											.	CORIN	154	.	0			c.G953T						.						126.0	117.0	120.0					4																	47685816		2203	4300	6503	SO:0001583	missense	10699	exon7			TTAAGGCACTTGC	AF133845	CCDS3477.1, CCDS63958.1, CCDS75122.1	4p13-p12	2011-08-31	2005-08-17		ENSG00000145244	ENSG00000145244		"""Serine peptidases / Transmembrane"""	19012	protein-coding gene	gene with protein product		605236	"""corin, serine protease"""			10329693	Standard	NM_006587		Approved	PRSC, CRN, ATC2, Lrp4, TMPRSS10	uc003gxm.3	Q9Y5Q5	OTTHUMG00000099441	ENST00000273857.4:c.953G>T	chr4.hg19:g.47685816C>A	ENSP00000273857:p.Cys318Phe	31.0	0.0		49.0	21.0	NM_006587	B0ZBE3|Q2TBD2|Q4W5E5|Q4W5G6|Q9UHY2	Missense_Mutation	SNP	ENST00000273857.4	hg19	CCDS3477.1	.	.	.	.	.	.	.	.	.	.	C	26.0	4.692392	0.88735	.	.	ENSG00000145244	ENST00000273857;ENST00000508498;ENST00000502252;ENST00000505909;ENST00000504584	D;D;D;D;D	0.99919	-8.0;-8.0;-8.0;-8.0;-8.0	5.83	5.83	0.93111	Low-density lipoprotein (LDL) receptor class A, conserved site (1);	0.000000	0.85682	D	0.000000	D	0.99947	0.9977	H	0.96048	3.76	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	0.999;0.999;0.999;1.0;1.0	D	0.96309	0.9227	10	0.87932	D	0	.	20.1133	0.97917	0.0:1.0:0.0:0.0	.	318;318;251;179;318	B7Z4R1;B4E2W9;B4E1Y7;B4DZA3;Q9Y5Q5	.;.;.;.;CORIN_HUMAN	F	318;179;251;318;318	ENSP00000273857:C318F;ENSP00000425597:C179F;ENSP00000424212:C251F;ENSP00000425401:C318F;ENSP00000423216:C318F	ENSP00000273857:C318F	C	-	2	0	CORIN	47380573	1.000000	0.71417	1.000000	0.80357	0.949000	0.60115	7.163000	0.77524	2.762000	0.94881	0.591000	0.81541	TGC	.	.		0.428	CORIN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216906.2		
TIFA	92610	hgsc.bcm.edu	37	4	113199372	113199372	+	Silent	SNP	T	T	A			TCGA-2Y-A9H6-01A-11D-A38X-10	TCGA-2Y-A9H6-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ee12965-26aa-443a-b8de-f4a79dc3e857	b27b338e-86e5-4131-83cf-206c52b809b7	g.chr4:113199372T>A	ENST00000361717.3	-	2	482	c.201A>T	c.(199-201)cgA>cgT	p.R67R	TIFA_ENST00000500655.2_Silent_p.R67R	NM_052864.2	NP_443096.1	Q96CG3	TIFA_HUMAN	TRAF-interacting protein with forkhead-associated domain	67	FHA. {ECO:0000255|PROSITE- ProRule:PRU00086}.				I-kappaB kinase/NF-kappaB signaling (GO:0007249)					breast(2)|endometrium(1)|large_intestine(1)|lung(1)|skin(1)	6		Ovarian(17;0.0443)|Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.00172)		AAAACTGAACTCGGGAAACCT	0.378																																					p.R67R		Atlas-SNP	.											.	TIFA	15	.	0			c.A201T						.						66.0	76.0	73.0					4																	113199372		2190	4296	6486	SO:0001819	synonymous_variant	92610	exon2			CTGAACTCGGGAA	BC008294	CCDS34051.1	4q25	2008-03-17				ENSG00000145365			19075	protein-coding gene	gene with protein product	"""TRAF2 binding protein"", ""TRAF6 binding protein"""	609028				1179819	Standard	NM_052864		Approved	MGC20791, T2BP, T6BP, TIFAA	uc003ial.3	Q96CG3		ENST00000361717.3:c.201A>T	chr4.hg19:g.113199372T>A		47.0	0.0		90.0	40.0	NM_052864		Silent	SNP	ENST00000361717.3	hg19	CCDS34051.1																																																																																			.	.		0.378	TIFA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363647.2	NM_052864	
DCHS2	54798	hgsc.bcm.edu	37	4	155156796	155156796	+	Missense_Mutation	SNP	A	A	G			TCGA-2Y-A9H6-01A-11D-A38X-10	TCGA-2Y-A9H6-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ee12965-26aa-443a-b8de-f4a79dc3e857	b27b338e-86e5-4131-83cf-206c52b809b7	g.chr4:155156796A>G	ENST00000357232.4	-	25	7642	c.7643T>C	c.(7642-7644)tTa>tCa	p.L2548S		NM_017639.3	NP_060109.2	Q6V1P9	PCD23_HUMAN	dachsous cadherin-related 2	2548					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(1)|cervix(3)|endometrium(8)|kidney(5)|large_intestine(54)|lung(63)|ovary(4)|pancreas(1)|prostate(14)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	176	all_hematologic(180;0.208)	Renal(120;0.0854)		LUSC - Lung squamous cell carcinoma(193;0.107)		CAGAAACACTAAAAAGGAGAC	0.378																																					p.L2548S		Atlas-SNP	.											.	DCHS2	594	.	0			c.T7643C						.						58.0	60.0	60.0					4																	155156796		2202	4300	6502	SO:0001583	missense	54798	exon25			AACACTAAAAAGG	BC140919	CCDS3785.1, CCDS47150.1	4q32.1	2014-06-04	2013-10-04	2004-09-03		ENSG00000197410		"""Cadherins / Cadherin-related"""	23111	protein-coding gene	gene with protein product	"""cadherin-related family member 7"""	612486	"""cadherin-like 27"", ""dachsous 2 (Drosophila)"""	CDH27, PCDH23		15003449	Standard	NM_017639		Approved	CDHJ, FLJ20047, PCDHJ, CDHR7	uc003inw.2	Q6V1P9		ENST00000357232.4:c.7643T>C	chr4.hg19:g.155156796A>G	ENSP00000349768:p.Leu2548Ser	67.0	0.0		186.0	64.0	NM_017639	B2RU14|E9PC11|Q4W5P9|Q6ZS61|Q9NXU8	Missense_Mutation	SNP	ENST00000357232.4	hg19	CCDS3785.1	.	.	.	.	.	.	.	.	.	.	A	9.614	1.132078	0.21041	.	.	ENSG00000197410	ENST00000357232	T	0.58797	0.31	5.53	5.53	0.82687	.	0.652243	0.12944	N	0.426388	T	0.54532	0.1864	L	0.51422	1.61	0.80722	D	1	P	0.38922	0.651	B	0.35240	0.198	T	0.58989	-0.7538	10	0.72032	D	0.01	.	15.6563	0.77136	1.0:0.0:0.0:0.0	.	2548	Q6V1P9	PCD23_HUMAN	S	2548	ENSP00000349768:L2548S	ENSP00000349768:L2548S	L	-	2	0	DCHS2	155376246	0.013000	0.17824	0.144000	0.22314	0.325000	0.28411	2.114000	0.41911	2.096000	0.63516	0.383000	0.25322	TTA	.	.		0.378	DCHS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365281.2	NM_001142552	
PDCD6	10016	hgsc.bcm.edu	37	5	311465	311465	+	Missense_Mutation	SNP	G	G	A			TCGA-2Y-A9H6-01A-11D-A38X-10	TCGA-2Y-A9H6-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ee12965-26aa-443a-b8de-f4a79dc3e857	b27b338e-86e5-4131-83cf-206c52b809b7	g.chr5:311465G>A	ENST00000264933.4	+	5	525	c.425G>A	c.(424-426)gGa>gAa	p.G142E	PDCD6_ENST00000507528.1_Missense_Mutation_p.G140E|AHRR_ENST00000512529.1_Intron|PDCD6_ENST00000505221.1_Intron|AHRR_ENST00000316418.5_Intron|PDCD6_ENST00000511482.1_3'UTR|AHRR_ENST00000505113.1_Intron	NM_001267556.1|NM_001267558.1|NM_013232.3	NP_001254485.1|NP_001254487.1|NP_037364.1	O75340	PDCD6_HUMAN	programmed cell death 6	142	EF-hand 4. {ECO:0000255|PROSITE- ProRule:PRU00448}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|angiogenesis (GO:0001525)|apoptotic signaling pathway (GO:0097190)|cellular response to heat (GO:0034605)|intracellular protein transport (GO:0006886)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of TOR signaling (GO:0032007)|negative regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030948)|positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|proteolysis (GO:0006508)|response to calcium ion (GO:0051592)|vascular endothelial growth factor receptor-2 signaling pathway (GO:0036324)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	binding, bridging (GO:0060090)|calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|calcium-dependent protein binding (GO:0048306)|protein dimerization activity (GO:0046983)			breast(2)|endometrium(1)|large_intestine(4)|lung(1)	8			Epithelial(17;0.00193)|OV - Ovarian serous cystadenocarcinoma(19;0.00489)|all cancers(22;0.00511)|Lung(60;0.113)			GACAGGCAGGGACGGGGGCAG	0.577																																					p.G142E		Atlas-SNP	.											.	PDCD6	24	.	0			c.G425A						.						104.0	86.0	92.0					5																	311465		2203	4299	6502	SO:0001583	missense	10016	exon5			GGCAGGGACGGGG	AF035606	CCDS3854.1, CCDS58940.1, CCDS58941.1, CCDS75222.1, CCDS75223.1	5p15.33	2013-01-10			ENSG00000249915	ENSG00000249915		"""EF-hand domain containing"""	8765	protein-coding gene	gene with protein product	"""apoptosis-linked gene-2"""	601057				8560270	Standard	NM_013232		Approved	ALG-2, PEF1B	uc003jat.1	O75340	OTTHUMG00000090283	ENST00000264933.4:c.425G>A	chr5.hg19:g.311465G>A	ENSP00000264933:p.Gly142Glu	125.0	0.0		102.0	32.0	NM_013232	B2RD16|E7ESR3|Q2YDC2|Q5TZS0	Missense_Mutation	SNP	ENST00000264933.4	hg19	CCDS3854.1	.	.	.	.	.	.	.	.	.	.	g	14.07	2.426116	0.43020	.	.	ENSG00000249915	ENST00000264933;ENST00000507528;ENST00000507473	T;T;T	0.80909	-0.85;-0.85;-1.43	5.83	5.83	0.93111	EF-hand-like domain (1);	.	.	.	.	D	0.85885	0.5801	M	0.89904	3.07	0.80722	D	1	B;B	0.31040	0.305;0.176	B;B	0.35510	0.145;0.204	D	0.84821	0.0796	9	0.42905	T	0.14	.	17.6162	0.88068	0.0:0.0:1.0:0.0	.	140;142	Q2YDC2;O75340	.;PDCD6_HUMAN	E	142;140;55	ENSP00000264933:G142E;ENSP00000423815:G140E;ENSP00000425370:G55E	ENSP00000264933:G142E	G	+	2	0	PDCD6	364465	1.000000	0.71417	0.980000	0.43619	0.255000	0.26057	7.489000	0.81451	2.763000	0.94921	0.655000	0.94253	GGA	.	.		0.577	PDCD6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000206609.2	NM_013232	
FBXL7	23194	hgsc.bcm.edu	37	5	15936876	15936876	+	Silent	SNP	C	C	A			TCGA-2Y-A9H6-01A-11D-A38X-10	TCGA-2Y-A9H6-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ee12965-26aa-443a-b8de-f4a79dc3e857	b27b338e-86e5-4131-83cf-206c52b809b7	g.chr5:15936876C>A	ENST00000504595.1	+	4	1538	c.1057C>A	c.(1057-1059)Cgg>Agg	p.R353R	FBXL7_ENST00000329673.7_Silent_p.R341R|MIR887_ENST00000401258.1_RNA|FBXL7_ENST00000510662.1_Silent_p.R306R	NM_001278317.1|NM_012304.3	NP_001265246.1|NP_036436.1	Q9UJT9	FBXL7_HUMAN	F-box and leucine-rich repeat protein 7	353					cell proliferation (GO:0008283)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic nuclear division (GO:0007067)|protein ubiquitination (GO:0016567)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)|ubiquitin-dependent protein catabolic process (GO:0006511)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|SCF ubiquitin ligase complex (GO:0019005)|ubiquitin ligase complex (GO:0000151)	ubiquitin-protein transferase activity (GO:0004842)			cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(13)|lung(33)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	60						GTCCCGCCTGCGGTACCTGAG	0.662																																					p.R353R		Atlas-SNP	.											FBXL7,colon,carcinoma,0,1	FBXL7	138	.	0			c.C1057A						.						26.0	29.0	28.0					5																	15936876		2179	4269	6448	SO:0001819	synonymous_variant	23194	exon4			CGCCTGCGGTACC	AB020647	CCDS54833.1, CCDS64129.1	5p15.1	2011-06-09				ENSG00000183580		"""F-boxes / Leucine-rich repeats"""	13604	protein-coding gene	gene with protein product		605656				10048485, 10531035	Standard	NM_012304		Approved	KIAA0840, FBL7, FBL6	uc003jfn.1	Q9UJT9		ENST00000504595.1:c.1057C>A	chr5.hg19:g.15936876C>A		79.0	0.0		77.0	18.0	NM_012304	B9EGF1|D6RDY7|O94926	Silent	SNP	ENST00000504595.1	hg19	CCDS54833.1																																																																																			.	.		0.662	FBXL7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366117.1	NM_012304	
CFB	629	hgsc.bcm.edu	37	6	31914168	31914168	+	Missense_Mutation	SNP	G	G	T			TCGA-2Y-A9H6-01A-11D-A38X-10	TCGA-2Y-A9H6-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ee12965-26aa-443a-b8de-f4a79dc3e857	b27b338e-86e5-4131-83cf-206c52b809b7	g.chr6:31914168G>T	ENST00000425368.2	+	2	596	c.83G>T	c.(82-84)tGg>tTg	p.W28L	CFB_ENST00000556679.1_Missense_Mutation_p.W530L|CFB_ENST00000456570.1_Missense_Mutation_p.W530L|CFB_ENST00000477310.1_Intron	NM_001710.5	NP_001701.2	P00751	CFAB_HUMAN	complement factor B	28			W -> Q (in allele FA; requires 2 nucleotide substitutions). {ECO:0000269|PubMed:2249879}.|W -> R (in allele S). {ECO:0000269|PubMed:2249879, ECO:0000269|PubMed:8181962, ECO:0000269|PubMed:8225386, ECO:0000269|PubMed:8247029}.		complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	complement binding (GO:0001848)|serine-type endopeptidase activity (GO:0004252)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(10)|pancreas(1)|skin(1)|urinary_tract(1)	21						ACCACTCCATGGTCTTTGGCC	0.602																																					p.W28L		Atlas-SNP	.											.	CFB	33	.	0			c.G83T						.						76.0	77.0	77.0					6																	31914168		1511	2709	4220	SO:0001583	missense	629	exon2			CTCCATGGTCTTT	L15702	CCDS4729.1	6p21.33	2014-09-17	2006-02-10	2006-02-10	ENSG00000243649	ENSG00000243649	3.4.21.47	"""Complement system"""	1037	protein-coding gene	gene with protein product		138470	"""B-factor, properdin"""	BFD, BF			Standard	NM_001710		Approved	H2-Bf	uc011dor.2	P00751	OTTHUMG00000031198	ENST00000425368.2:c.83G>T	chr6.hg19:g.31914168G>T	ENSP00000416561:p.Trp28Leu	115.0	0.0		148.0	56.0	NM_001710	B0QZQ6|O15006|Q29944|Q53F89|Q5JP67|Q5ST50|Q96HX6|Q9BTF5|Q9BX92	Missense_Mutation	SNP	ENST00000425368.2	hg19	CCDS4729.1	.	.	.	.	.	.	.	.	.	.	G	0.384	-0.927020	0.02377	.	.	ENSG00000243649;ENSG00000243649;ENSG00000243649;ENSG00000244255	ENST00000556679;ENST00000475617;ENST00000425368;ENST00000456570	T;T;T;T	0.79749	-1.3;2.62;-1.21;-1.3	5.31	-1.91	0.07641	.	2.179520	0.02368	N	0.077582	T	0.31857	0.0810	N	0.08118	0	0.09310	N	1	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.04013	0.001;0.0;0.0;0.0	T	0.18429	-1.0337	10	0.16420	T	0.52	-0.0381	0.0697	0.00021	0.3185:0.1961:0.1662:0.3192	.	28;530;28;28	B4E1Z1;B4E1Z4;P00751;P00751-2	.;.;CFAB_HUMAN;.	L	530;28;28;530	ENSP00000451848:W530L;ENSP00000420090:W28L;ENSP00000416561:W28L;ENSP00000410815:W530L	ENSP00000416561:W28L	W	+	2	0	CFB;XXbac-BPG116M5.17	32022147	0.055000	0.20627	0.000000	0.03702	0.085000	0.17905	0.782000	0.26788	0.018000	0.15052	-0.541000	0.04245	TGG	.	.		0.602	CFB-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000076395.3	NM_001710	
KIAA0895	23366	hgsc.bcm.edu	37	7	36373513	36373513	+	Missense_Mutation	SNP	C	C	T			TCGA-2Y-A9H6-01A-11D-A38X-10	TCGA-2Y-A9H6-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ee12965-26aa-443a-b8de-f4a79dc3e857	b27b338e-86e5-4131-83cf-206c52b809b7	g.chr7:36373513C>T	ENST00000297063.6	-	5	1308	c.1258G>A	c.(1258-1260)Gat>Aat	p.D420N	KIAA0895_ENST00000440378.1_Missense_Mutation_p.D417N|KIAA0895_ENST00000317020.6_Missense_Mutation_p.D369N|KIAA0895_ENST00000338533.5_Missense_Mutation_p.D407N|KIAA0895_ENST00000453212.1_Missense_Mutation_p.D175N|KIAA0895_ENST00000436884.1_Missense_Mutation_p.D317N|KIAA0895_ENST00000480192.1_5'UTR	NM_001100425.1	NP_001093895.1	Q8NCT3	K0895_HUMAN	KIAA0895	420										breast(2)|endometrium(1)|kidney(1)|large_intestine(6)|liver(1)|lung(11)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	26						ACACAATAATCCCATCTTGTA	0.448																																					p.D420N		Atlas-SNP	.											.	KIAA0895	89	.	0			c.G1258A						.						94.0	93.0	93.0					7																	36373513		1865	4088	5953	SO:0001583	missense	23366	exon5			AATAATCCCATCT	BC028678	CCDS43570.1, CCDS47573.1, CCDS56482.1, CCDS56483.1, CCDS56484.1, CCDS75583.1	7p14.2	2008-11-27			ENSG00000164542	ENSG00000164542			22206	protein-coding gene	gene with protein product							Standard	NM_015314		Approved		uc003tfd.2	Q8NCT3	OTTHUMG00000154939	ENST00000297063.6:c.1258G>A	chr7.hg19:g.36373513C>T	ENSP00000297063:p.Asp420Asn	101.0	0.0		162.0	54.0	NM_001100425	B4DF35|B7ZLT4|B9EGB9|O94969|Q0VGC1|Q7Z4L2	Missense_Mutation	SNP	ENST00000297063.6	hg19	CCDS43570.1	.	.	.	.	.	.	.	.	.	.	C	35	5.435945	0.96168	.	.	ENSG00000164542	ENST00000297063;ENST00000338533;ENST00000317020;ENST00000440378;ENST00000436884;ENST00000453212	.	.	.	5.06	5.06	0.68205	.	0.000000	0.85682	D	0.000000	T	0.77458	0.4133	M	0.62723	1.935	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;1.0;0.999;0.998;0.998	T	0.76421	-0.2965	9	0.41790	T	0.15	-18.4965	18.7786	0.91922	0.0:1.0:0.0:0.0	.	417;317;420;407;369	B7ZLT4;B4DF35;Q8NCT3;Q8NCT3-2;Q8NCT3-3	.;.;K0895_HUMAN;.;.	N	420;407;369;417;317;175	.	ENSP00000297063:D420N	D	-	1	0	KIAA0895	36340038	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.357000	0.79456	2.515000	0.84797	0.655000	0.94253	GAT	.	.		0.448	KIAA0895-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000337717.1	NM_015314	
LRGUK	136332	hgsc.bcm.edu	37	7	133821880	133821880	+	Silent	SNP	A	A	G			TCGA-2Y-A9H6-01A-11D-A38X-10	TCGA-2Y-A9H6-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ee12965-26aa-443a-b8de-f4a79dc3e857	b27b338e-86e5-4131-83cf-206c52b809b7	g.chr7:133821880A>G	ENST00000285928.2	+	2	471	c.402A>G	c.(400-402)ttA>ttG	p.L134L	LRGUK_ENST00000473068.1_3'UTR	NM_144648.1	NP_653249.1	Q96M69	LRGUK_HUMAN	leucine-rich repeats and guanylate kinase domain containing	134						cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|kinase activity (GO:0016301)			breast(1)|endometrium(2)|kidney(2)|large_intestine(12)|lung(23)|ovary(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	49						ATCTAACTTTATCAGTGAGTA	0.473																																					p.L134L		Atlas-SNP	.											.	LRGUK	113	.	0			c.A402G						.						69.0	63.0	65.0					7																	133821880		2203	4300	6503	SO:0001819	synonymous_variant	136332	exon2			AACTTTATCAGTG	AK057348	CCDS5830.1	7q33	2006-10-27			ENSG00000155530	ENSG00000155530			21964	protein-coding gene	gene with protein product							Standard	NM_144648		Approved	FLJ32786	uc003vrm.1	Q96M69	OTTHUMG00000155320	ENST00000285928.2:c.402A>G	chr7.hg19:g.133821880A>G		42.0	0.0		74.0	21.0	NM_144648	Q2M3I1	Silent	SNP	ENST00000285928.2	hg19	CCDS5830.1																																																																																			.	.		0.473	LRGUK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339442.1	NM_144648	
TAS2R41	259287	hgsc.bcm.edu	37	7	143175617	143175617	+	Missense_Mutation	SNP	G	G	T			TCGA-2Y-A9H6-01A-11D-A38X-10	TCGA-2Y-A9H6-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ee12965-26aa-443a-b8de-f4a79dc3e857	b27b338e-86e5-4131-83cf-206c52b809b7	g.chr7:143175617G>T	ENST00000408916.1	+	1	652	c.652G>T	c.(652-654)Ggg>Tgg	p.G218W	EPHA1-AS1_ENST00000429289.1_RNA	NM_176883.2	NP_795364.2	P59536	T2R41_HUMAN	taste receptor, type 2, member 41	218					sensory perception of taste (GO:0050909)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.G218R(1)		endometrium(2)|large_intestine(2)|lung(10)|pancreas(1)|prostate(2)|skin(1)	18	Melanoma(164;0.15)					GCAGCACAACGGGCACAGCCT	0.478																																					p.G218W		Atlas-SNP	.											TAS2R41,caecum,carcinoma,0,1	TAS2R41	43	.	1	Substitution - Missense(1)	large_intestine(1)	c.G652T						.						70.0	77.0	75.0					7																	143175617		2047	4195	6242	SO:0001583	missense	259287	exon1			CACAACGGGCACA	AF494232	CCDS43663.1	7q34	2012-08-22			ENSG00000221855	ENSG00000221855		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	18883	protein-coding gene	gene with protein product		613965				12379855	Standard	NM_176883		Approved	T2R59	uc003wdc.1	P59536	OTTHUMG00000155892	ENST00000408916.1:c.652G>T	chr7.hg19:g.143175617G>T	ENSP00000386201:p.Gly218Trp	50.0	0.0		120.0	5.0	NM_176883	P59550|Q495I2|Q50KJ5|Q50KJ6|Q50KJ7|Q645W7	Missense_Mutation	SNP	ENST00000408916.1	hg19	CCDS43663.1	.	.	.	.	.	.	.	.	.	.	G	8.203	0.798688	0.16397	.	.	ENSG00000221855	ENST00000408916	T	0.00768	5.72	6.0	-2.08	0.07254	.	1.076560	0.07393	U	0.889477	T	0.01454	0.0047	M	0.78344	2.41	0.09310	N	1	B	0.30526	0.283	B	0.29267	0.1	T	0.29427	-1.0012	10	0.72032	D	0.01	.	8.3065	0.32045	0.3903:0.0:0.5148:0.0949	.	218	P59536	T2R41_HUMAN	W	218	ENSP00000386201:G218W	ENSP00000386201:G218W	G	+	1	0	TAS2R41	142885739	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.176000	0.09811	-1.107000	0.03004	-1.814000	0.00607	GGG	.	.		0.478	TAS2R41-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342149.1		
MCMDC2	157777	hgsc.bcm.edu	37	8	67789682	67789682	+	Silent	SNP	T	T	C			TCGA-2Y-A9H6-01A-11D-A38X-10	TCGA-2Y-A9H6-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ee12965-26aa-443a-b8de-f4a79dc3e857	b27b338e-86e5-4131-83cf-206c52b809b7	g.chr8:67789682T>C	ENST00000422365.2	+	5	555	c.384T>C	c.(382-384)taT>taC	p.Y128Y	MCMDC2_ENST00000313616.5_Silent_p.Y128Y|MCMDC2_ENST00000492775.1_Silent_p.Y128Y|MCMDC2_ENST00000541540.1_Silent_p.Y65Y|MCMDC2_ENST00000469823.1_3'UTR|MCMDC2_ENST00000396592.3_Silent_p.Y128Y	NM_173518.4	NP_775789.3	Q4G0Z9	MCMD2_HUMAN	minichromosome maintenance domain containing 2	128					DNA replication (GO:0006260)		ATP binding (GO:0005524)|DNA binding (GO:0003677)			endometrium(2)|kidney(2)|lung(5)	9						AGAGATTTTATATGATGCAAG	0.358																																					p.Y128Y		Atlas-SNP	.											.	MCMDC2	84	.	0			c.T384C						.						94.0	87.0	90.0					8																	67789682		2203	4300	6503	SO:0001819	synonymous_variant	157777	exon5			ATTTTATATGATG	BC034576	CCDS6197.2, CCDS47868.1, CCDS47869.1	8q13.1	2012-04-13	2012-04-13	2012-04-13	ENSG00000178460	ENSG00000178460			26368	protein-coding gene	gene with protein product			"""chromosome 8 open reading frame 45"""	C8orf45			Standard	NM_173518		Approved	FLJ25692	uc003xwz.4	Q4G0Z9	OTTHUMG00000157068	ENST00000422365.2:c.384T>C	chr8.hg19:g.67789682T>C		114.0	0.0		131.0	35.0	NM_173518	B4DYZ3|B4DZM4|B4E293|Q6P533|Q7Z3P4	Silent	SNP	ENST00000422365.2	hg19	CCDS6197.2																																																																																			.	.		0.358	MCMDC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347350.1	NM_173518	
UBAP2	55833	hgsc.bcm.edu	37	9	33932569	33932569	+	Silent	SNP	C	C	T			TCGA-2Y-A9H6-01A-11D-A38X-10	TCGA-2Y-A9H6-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ee12965-26aa-443a-b8de-f4a79dc3e857	b27b338e-86e5-4131-83cf-206c52b809b7	g.chr9:33932569C>T	ENST00000379238.1	-	19	2283	c.2166G>A	c.(2164-2166)acG>acA	p.T722T	UBAP2_ENST00000449054.1_Silent_p.T722T|SNORD121B_ENST00000458838.1_RNA|UBAP2_ENST00000360802.1_Silent_p.T722T|UBAP2_ENST00000418786.2_Intron|UBAP2_ENST00000379239.4_Silent_p.T455T|UBAP2_ENST00000539807.1_Silent_p.T477T					ubiquitin associated protein 2											endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(7)|lung(13)|ovary(3)|stomach(1)	32			LUSC - Lung squamous cell carcinoma(29;0.00575)	GBM - Glioblastoma multiforme(74;0.168)		CTGTGTGTGACGTGCTCGAGG	0.562																																					p.T722T		Atlas-SNP	.											.	UBAP2	82	.	0			c.G2166A						.						112.0	99.0	103.0					9																	33932569		2203	4300	6503	SO:0001819	synonymous_variant	55833	exon19			GTGTGACGTGCTC	AB040924	CCDS6547.1, CCDS75828.1	9p11.2	2008-02-05			ENSG00000137073	ENSG00000137073			14185	protein-coding gene	gene with protein product						8871400	Standard	NM_018449		Approved	KIAA1491, bA176F3.5, FLJ22435	uc003ztq.1	Q5T6F2	OTTHUMG00000000427	ENST00000379238.1:c.2166G>A	chr9.hg19:g.33932569C>T		74.0	0.0		55.0	30.0	NM_018449		Silent	SNP	ENST00000379238.1	hg19	CCDS6547.1																																																																																			.	.		0.562	UBAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000001071.1	NM_018449	
SARDH	1757	hgsc.bcm.edu	37	9	136595229	136595229	+	Silent	SNP	A	A	C			TCGA-2Y-A9H6-01A-11D-A38X-10	TCGA-2Y-A9H6-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ee12965-26aa-443a-b8de-f4a79dc3e857	b27b338e-86e5-4131-83cf-206c52b809b7	g.chr9:136595229A>C	ENST00000371872.4	-	5	1028	c.771T>G	c.(769-771)acT>acG	p.T257T	SARDH_ENST00000422262.2_Silent_p.T89T|SARDH_ENST00000298628.5_Silent_p.T257T|SARDH_ENST00000439388.1_Silent_p.T257T|SARDH_ENST00000371867.1_Silent_p.T168T	NM_007101.3	NP_009032.2	Q9UL12	SARDH_HUMAN	sarcosine dehydrogenase	257					glycine catabolic process (GO:0006546)	mitochondrion (GO:0005739)	aminomethyltransferase activity (GO:0004047)|sarcosine dehydrogenase activity (GO:0008480)			central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|lung(13)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)	44				OV - Ovarian serous cystadenocarcinoma(145;3.21e-07)|Epithelial(140;2.37e-06)|all cancers(34;2.75e-05)		AACCATGCTGAGTCTCCACAC	0.582																																					p.T257T		Atlas-SNP	.											.	SARDH	112	.	0			c.T771G						.						113.0	100.0	104.0					9																	136595229		2203	4300	6503	SO:0001819	synonymous_variant	1757	exon5			ATGCTGAGTCTCC		CCDS6978.1	9q33-q34	2008-02-05			ENSG00000123453	ENSG00000123453	1.5.99.2		10536	protein-coding gene	gene with protein product		604455		DMGDHL1		10444331	Standard	NM_007101		Approved	SDH	uc004cep.4	Q9UL12	OTTHUMG00000020879	ENST00000371872.4:c.771T>G	chr9.hg19:g.136595229A>C		102.0	0.0		76.0	6.0	NM_007101	B2RMR5|B4DPI2|B7ZLT6|Q5SYV0|Q9Y280|Q9Y2Y3	Silent	SNP	ENST00000371872.4	hg19	CCDS6978.1																																																																																			.	.		0.582	SARDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054931.1		
OPTN	10133	hgsc.bcm.edu	37	10	13154620	13154620	+	Silent	SNP	T	T	G			TCGA-2Y-A9H6-01A-11D-A38X-10	TCGA-2Y-A9H6-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ee12965-26aa-443a-b8de-f4a79dc3e857	b27b338e-86e5-4131-83cf-206c52b809b7	g.chr10:13154620T>G	ENST00000378748.3	+	6	899	c.537T>G	c.(535-537)gtT>gtG	p.V179V	OPTN_ENST00000378752.3_Silent_p.V179V|OPTN_ENST00000378764.2_Silent_p.V179V|OPTN_ENST00000482140.1_3'UTR|OPTN_ENST00000378757.2_Silent_p.V179V|OPTN_ENST00000263036.5_Silent_p.V179V|OPTN_ENST00000378747.3_Silent_p.V179V	NM_001008211.1|NM_001008213.1	NP_001008212|NP_001008214	Q96CV9	OPTN_HUMAN	optineurin	179	Interaction with Rab8.				cell death (GO:0008219)|defense response to Gram-negative bacterium (GO:0050829)|G2/M transition of mitotic cell cycle (GO:0000086)|Golgi organization (GO:0007030)|Golgi ribbon formation (GO:0090161)|Golgi to plasma membrane protein transport (GO:0043001)|macroautophagy (GO:0016236)|mitotic cell cycle (GO:0000278)|negative regulation of receptor recycling (GO:0001920)|protein targeting to Golgi (GO:0000042)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|nucleoplasm (GO:0005654)|perinuclear region of cytoplasm (GO:0048471)|trans-Golgi network (GO:0005802)	polyubiquitin binding (GO:0031593)|protein C-terminus binding (GO:0008022)|Rab GTPase binding (GO:0017137)			breast(1)|endometrium(2)|large_intestine(5)|lung(9)|ovary(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	22						ATTCCTTTGTTGAAATTAGGA	0.438																																					p.V179V		Atlas-SNP	.											.	OPTN	57	.	0			c.T537G						.						105.0	110.0	109.0					10																	13154620		2203	4300	6503	SO:0001819	synonymous_variant	10133	exon5			CTTTGTTGAAATT	AF420371	CCDS7094.1	10p14	2014-01-28	2003-09-08		ENSG00000123240	ENSG00000123240			17142	protein-coding gene	gene with protein product		602432	"""glaucoma 1, open angle, E (adult-onset)"""	GLC1E		11834836, 9488477	Standard	NM_001008211		Approved	FIP2, HYPL, FIP-2, TFIIIA-INTP, NRP, HIP7	uc001ilx.1	Q96CV9	OTTHUMG00000017690	ENST00000378748.3:c.537T>G	chr10.hg19:g.13154620T>G		115.0	0.0		103.0	10.0	NM_001008212	B3KP00|D3DRS4|D3DRS8|Q5T672|Q5T673|Q5T674|Q5T675|Q7LDL9|Q8N562|Q9UET9|Q9UEV4|Q9Y218	Silent	SNP	ENST00000378748.3	hg19	CCDS7094.1																																																																																			.	.		0.438	OPTN-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000046834.1	NM_021980	
EPS8L2	64787	hgsc.bcm.edu	37	11	720644	720644	+	Silent	SNP	G	G	C			TCGA-2Y-A9H6-01A-11D-A38X-10	TCGA-2Y-A9H6-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ee12965-26aa-443a-b8de-f4a79dc3e857	b27b338e-86e5-4131-83cf-206c52b809b7	g.chr11:720644G>C	ENST00000533256.1	+	7	750	c.375G>C	c.(373-375)acG>acC	p.T125T	EPS8L2_ENST00000530636.1_Silent_p.T125T|AP006621.9_ENST00000527021.2_RNA|EPS8L2_ENST00000318562.8_Silent_p.T125T|EPS8L2_ENST00000526198.1_Silent_p.T141T			Q9H6S3	ES8L2_HUMAN	EPS8-like 2	125	PID. {ECO:0000255|PROSITE- ProRule:PRU00148}.				positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of ruffle assembly (GO:1900029)|regulation of Rho protein signal transduction (GO:0035023)|Rho protein signal transduction (GO:0007266)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|ruffle membrane (GO:0032587)|vesicle (GO:0031982)	actin binding (GO:0003779)			NS(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(2)|pancreas(1)|prostate(2)|soft_tissue(1)|urinary_tract(1)	13		all_cancers(49;1.24e-08)|all_epithelial(84;1.87e-05)|Breast(177;0.000286)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.106)|all_lung(207;0.136)		all cancers(45;4.37e-27)|Epithelial(43;2.81e-26)|OV - Ovarian serous cystadenocarcinoma(40;1.33e-20)|BRCA - Breast invasive adenocarcinoma(625;4.29e-05)|Lung(200;0.0582)|LUSC - Lung squamous cell carcinoma(625;0.0703)		GCAGCCAGACGGTCCTCAACC	0.662																																					p.T125T		Atlas-SNP	.											.	EPS8L2	42	.	0			c.G375C						.						23.0	22.0	22.0					11																	720644		2195	4294	6489	SO:0001819	synonymous_variant	64787	exon6			CCAGACGGTCCTC	AF318331	CCDS31328.1	11p15.5	2008-02-05				ENSG00000177106			21296	protein-coding gene	gene with protein product		614988				12620401	Standard	NM_022772		Approved	FLJ21935, FLJ22171, MGC3088	uc001lqt.3	Q9H6S3		ENST00000533256.1:c.375G>C	chr11.hg19:g.720644G>C		142.0	0.0		68.0	35.0	NM_022772	B3KSX1|B7ZKL3|Q53GM8|Q8WYW7|Q96K06|Q9H6K9	Silent	SNP	ENST00000533256.1	hg19	CCDS31328.1																																																																																			.	.		0.662	EPS8L2-003	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382344.1	NM_022772	
HIPK3	10114	hgsc.bcm.edu	37	11	33308510	33308510	+	Missense_Mutation	SNP	T	T	A			TCGA-2Y-A9H6-01A-11D-A38X-10	TCGA-2Y-A9H6-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ee12965-26aa-443a-b8de-f4a79dc3e857	b27b338e-86e5-4131-83cf-206c52b809b7	g.chr11:33308510T>A	ENST00000303296.4	+	2	855	c.550T>A	c.(550-552)Tta>Ata	p.L184I	HIPK3_ENST00000379016.3_Missense_Mutation_p.L184I|HIPK3_ENST00000456517.1_Missense_Mutation_p.L184I|HIPK3_ENST00000525975.1_Missense_Mutation_p.L184I	NM_005734.3	NP_005725.3	Q9H422	HIPK3_HUMAN	homeodomain interacting protein kinase 3	184					apoptotic process (GO:0006915)|mRNA transcription (GO:0009299)|negative regulation of apoptotic process (GO:0043066)|negative regulation of JUN kinase activity (GO:0043508)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|protein phosphorylation (GO:0006468)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|PML body (GO:0016605)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			endometrium(3)|kidney(3)|large_intestine(9)|liver(4)|lung(10)|ovary(2)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	39						TGACTATCAGTTAGTACAGCA	0.428																																					p.L184I		Atlas-SNP	.											.	HIPK3	92	.	0			c.T550A						.						85.0	78.0	81.0					11																	33308510		2202	4298	6500	SO:0001583	missense	10114	exon2			TATCAGTTAGTAC	AF004849	CCDS7884.1, CCDS41634.1	11p13	2008-07-18	2001-11-29		ENSG00000110422	ENSG00000110422			4915	protein-coding gene	gene with protein product		604424	"""homeodomain-interacting protein kinase 3"""			9373137, 9748262	Standard	NM_005734		Approved	PKY, DYRK6, YAK1, FIST3	uc031pzm.1	Q9H422	OTTHUMG00000132269	ENST00000303296.4:c.550T>A	chr11.hg19:g.33308510T>A	ENSP00000304226:p.Leu184Ile	92.0	0.0		88.0	37.0	NM_001048200	O14632|Q2PBG4|Q2PBG5|Q92632|Q9HAS2	Missense_Mutation	SNP	ENST00000303296.4	hg19	CCDS7884.1	.	.	.	.	.	.	.	.	.	.	T	15.19	2.760749	0.49468	.	.	ENSG00000110422	ENST00000525975;ENST00000303296;ENST00000379016;ENST00000456517	T;T;T;T	0.27256	1.68;1.68;1.68;1.68	5.65	4.53	0.55603	Protein kinase-like domain (1);	0.000000	0.49916	D	0.000135	T	0.27313	0.0670	M	0.62723	1.935	0.50313	D	0.999861	P;P	0.38078	0.545;0.617	B;B	0.37833	0.259;0.132	T	0.04752	-1.0929	10	0.87932	D	0	.	9.2193	0.37366	0.0:0.1568:0.0:0.8432	.	184;184	Q9H422-2;Q9H422	.;HIPK3_HUMAN	I	184	ENSP00000431710:L184I;ENSP00000304226:L184I;ENSP00000368301:L184I;ENSP00000398241:L184I	ENSP00000304226:L184I	L	+	1	2	HIPK3	33265086	1.000000	0.71417	1.000000	0.80357	0.670000	0.39368	1.858000	0.39408	0.987000	0.38709	-0.361000	0.07541	TTA	.	.		0.428	HIPK3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000255358.1	NM_005734	
KDELC2	143888	hgsc.bcm.edu	37	11	108369075	108369075	+	Missense_Mutation	SNP	C	C	A			TCGA-2Y-A9H6-01A-11D-A38X-10	TCGA-2Y-A9H6-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ee12965-26aa-443a-b8de-f4a79dc3e857	b27b338e-86e5-4131-83cf-206c52b809b7	g.chr11:108369075C>A	ENST00000323468.5	-	1	84	c.19G>T	c.(19-21)Gcc>Tcc	p.A7S		NM_153705.4	NP_714916.3	Q7Z4H8	KDEL2_HUMAN	KDEL (Lys-Asp-Glu-Leu) containing 2	7						endoplasmic reticulum (GO:0005783)				breast(1)|endometrium(1)|large_intestine(3)|lung(6)|ovary(1)|prostate(1)	13		all_cancers(61;1.38e-11)|all_epithelial(67;3.16e-07)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		Epithelial(105;6.93e-06)|BRCA - Breast invasive adenocarcinoma(274;8.54e-06)|all cancers(92;0.00016)|OV - Ovarian serous cystadenocarcinoma(223;0.132)|Colorectal(284;0.14)		AGCAGCAGGGCCCGCGGGAGG	0.816																																					p.A7S		Atlas-SNP	.											.	KDELC2	37	.	0			c.G19T						.						1.0	1.0	1.0					11																	108369075		449	962	1411	SO:0001583	missense	143888	exon1			GCAGGGCCCGCGG	AF533708	CCDS41711.1	11q32	2010-11-18			ENSG00000178202	ENSG00000178202			28496	protein-coding gene	gene with protein product						12975309	Standard	NM_153705		Approved	MGC33424	uc001pkj.2	Q7Z4H8	OTTHUMG00000166535	ENST00000323468.5:c.19G>T	chr11.hg19:g.108369075C>A	ENSP00000315386:p.Ala7Ser	45.0	0.0		24.0	7.0	NM_153705	Q6UWW2|Q6ZUM9|Q8N7L8|Q8NE24	Missense_Mutation	SNP	ENST00000323468.5	hg19	CCDS41711.1	.	.	.	.	.	.	.	.	.	.	C	14.77	2.633310	0.47049	.	.	ENSG00000178202	ENST00000323468	T	0.17691	2.26	3.03	1.07	0.20283	.	3.165320	0.01740	N	0.029361	T	0.09423	0.0232	N	0.08118	0	0.44976	D	0.997998	B	0.12630	0.006	B	0.08055	0.003	T	0.28004	-1.0057	10	0.17832	T	0.49	-0.2676	6.3994	0.21630	0.1822:0.7108:0.0:0.107	.	7	Q7Z4H8	KDEL2_HUMAN	S	7	ENSP00000315386:A7S	ENSP00000315386:A7S	A	-	1	0	KDELC2	107874285	0.001000	0.12720	0.005000	0.12908	0.299000	0.27559	1.109000	0.31135	0.297000	0.22615	0.313000	0.20887	GCC	.	.		0.816	KDELC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390273.1	NM_153705	
CHD4	1108	hgsc.bcm.edu	37	12	6710863	6710863	+	Nonsense_Mutation	SNP	C	C	A			TCGA-2Y-A9H6-01A-11D-A38X-10	TCGA-2Y-A9H6-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ee12965-26aa-443a-b8de-f4a79dc3e857	b27b338e-86e5-4131-83cf-206c52b809b7	g.chr12:6710863C>A	ENST00000357008.2	-	5	671	c.508G>T	c.(508-510)Gag>Tag	p.E170*	CHD4_ENST00000544040.1_Nonsense_Mutation_p.E163*|CHD4_ENST00000544484.1_Nonsense_Mutation_p.E167*|CHD4_ENST00000309577.6_Nonsense_Mutation_p.E170*	NM_001273.2	NP_001264.2	Q14839	CHD4_HUMAN	chromodomain helicase DNA binding protein 4	170					ATP-dependent chromatin remodeling (GO:0043044)|DNA duplex unwinding (GO:0032508)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|spindle assembly (GO:0051225)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|NuRD complex (GO:0016581)|protein complex (GO:0043234)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|RNA polymerase II repressing transcription factor binding (GO:0001103)|zinc ion binding (GO:0008270)			central_nervous_system(2)	2						CGATAATCCTCCTCTGAGAAC	0.493																																					p.E170X	Colon(32;586 792 4568 16848 45314)	Atlas-SNP	.											.	CHD4	539	.	0			c.G508T						.						271.0	275.0	274.0					12																	6710863		2203	4300	6503	SO:0001587	stop_gained	1108	exon5			AATCCTCCTCTGA	X86691	CCDS8552.1	12p13	2013-01-28				ENSG00000111642		"""Zinc fingers, PHD-type"""	1919	protein-coding gene	gene with protein product		603277				7575689, 8843877	Standard	XM_006718958		Approved	Mi-2b, Mi2-BETA	uc001qpo.3	Q14839		ENST00000357008.2:c.508G>T	chr12.hg19:g.6710863C>A	ENSP00000349508:p.Glu170*	111.0	0.0		110.0	39.0	NM_001273	Q8IXZ5	Nonsense_Mutation	SNP	ENST00000357008.2	hg19	CCDS8552.1	.	.	.	.	.	.	.	.	.	.	C	37	6.262264	0.97421	.	.	ENSG00000111642	ENST00000544484;ENST00000544040;ENST00000309577;ENST00000357008;ENST00000537464;ENST00000545942	.	.	.	5.87	5.87	0.94306	.	0.060254	0.64402	D	0.000005	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	-2.4517	16.49	0.84198	0.1314:0.8686:0.0:0.0	.	.	.	.	X	167;163;170;170;144;170	.	ENSP00000312419:E170X	E	-	1	0	CHD4	6581124	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.776000	0.85560	2.774000	0.95407	0.650000	0.86243	GAG	.	.		0.493	CHD4-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001273	
PPFIA2	8499	hgsc.bcm.edu	37	12	81769684	81769684	+	Missense_Mutation	SNP	G	G	T			TCGA-2Y-A9H6-01A-11D-A38X-10	TCGA-2Y-A9H6-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ee12965-26aa-443a-b8de-f4a79dc3e857	b27b338e-86e5-4131-83cf-206c52b809b7	g.chr12:81769684G>T	ENST00000549396.1	-	10	1182	c.1022C>A	c.(1021-1023)aCa>aAa	p.T341K	PPFIA2_ENST00000548586.1_Missense_Mutation_p.T341K|PPFIA2_ENST00000333447.7_Missense_Mutation_p.T323K|RP11-315E17.1_ENST00000546936.1_RNA|PPFIA2_ENST00000550584.2_Missense_Mutation_p.T341K|PPFIA2_ENST00000443686.3_Missense_Mutation_p.T242K|PPFIA2_ENST00000552948.1_Missense_Mutation_p.T341K|PPFIA2_ENST00000545296.2_5'UTR|PPFIA2_ENST00000549325.1_Missense_Mutation_p.T323K|PPFIA2_ENST00000550359.2_Missense_Mutation_p.T188K|PPFIA2_ENST00000407050.4_Missense_Mutation_p.T267K	NM_001220476.1|NM_001282536.1|NM_003625.3	NP_001207405.1|NP_001269465.1|NP_003616.2	O75334	LIPA2_HUMAN	protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 2	341	Glu-rich.				cell-matrix adhesion (GO:0007160)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|presynaptic active zone (GO:0048786)				NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(15)|lung(37)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(5)	85						TTCAAGGGTTGTAATTCTTTC	0.328																																					p.T341K		Atlas-SNP	.											.	PPFIA2	207	.	0			c.C1022A						.						221.0	201.0	207.0					12																	81769684		1877	4139	6016	SO:0001583	missense	8499	exon9			AGGGTTGTAATTC	AF034799	CCDS55850.1, CCDS55851.1, CCDS55852.1, CCDS55853.1, CCDS55854.1, CCDS55855.1, CCDS55856.1, CCDS55857.1, CCDS59236.1, CCDS73503.1	12q21.31	2013-01-10						"""Sterile alpha motif (SAM) domain containing"""	9246	protein-coding gene	gene with protein product	"""Liprin-alpha2"""	603143				9624153	Standard	NM_003625		Approved		uc031qis.1	O75334		ENST00000549396.1:c.1022C>A	chr12.hg19:g.81769684G>T	ENSP00000450337:p.Thr341Lys	53.0	0.0		95.0	25.0	NM_001220476	B3KVT5|B3KXA0|B7Z2A6|B7Z3U9|B7Z663|B7ZKZ5|E7ERB8|E7ETG6|F8VP68|Q2M3G8	Missense_Mutation	SNP	ENST00000549396.1	hg19	CCDS55857.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	21.5|21.5	4.154820|4.154820	0.78114|0.78114	.|.	.|.	ENSG00000139220|ENSG00000139220	ENST00000548790|ENST00000549396;ENST00000549325;ENST00000407050;ENST00000541501;ENST00000333447;ENST00000548586;ENST00000443686;ENST00000552948	.|T;T;T;T;T;T;T	.|0.77750	.|1.22;1.22;1.22;-1.12;1.22;1.22;1.22	5.15|5.15	5.15|5.15	0.70609|0.70609	.|.	.|0.129904	.|0.52532	.|D	.|0.000067	D|D	0.83013|0.83013	0.5162|0.5162	M|M	0.87038|0.87038	2.855|2.855	0.80722|0.80722	D|D	1|1	.|P;P	.|0.41673	.|0.578;0.759	.|B;B	.|0.41332	.|0.354;0.248	D|D	0.86476|0.86476	0.1788|0.1788	5|10	.|0.62326	.|D	.|0.03	-13.4936|-13.4936	19.0352|19.0352	0.92974|0.92974	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|241;341	.|B7Z4H8;O75334	.|.;LIPA2_HUMAN	K|K	159|341;323;267;352;323;341;242;341	.|ENSP00000450337:T341K;ENSP00000450298:T323K;ENSP00000385093:T267K;ENSP00000327416:T323K;ENSP00000449338:T341K;ENSP00000388373:T242K;ENSP00000447868:T341K	.|ENSP00000327416:T323K	Q|T	-|-	1|2	0|0	PPFIA2|PPFIA2	80293815|80293815	1.000000|1.000000	0.71417|0.71417	0.982000|0.982000	0.44146|0.44146	0.986000|0.986000	0.74619|0.74619	4.506000|4.506000	0.60428|0.60428	2.567000|2.567000	0.86603|0.86603	0.650000|0.650000	0.86243|0.86243	CAA|ACA	.	.		0.328	PPFIA2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000408030.1		
TGM1	7051	hgsc.bcm.edu	37	14	24729790	24729790	+	Missense_Mutation	SNP	C	C	T	rs369636498		TCGA-2Y-A9H6-01A-11D-A38X-10	TCGA-2Y-A9H6-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ee12965-26aa-443a-b8de-f4a79dc3e857	b27b338e-86e5-4131-83cf-206c52b809b7	g.chr14:24729790C>T	ENST00000206765.6	-	4	746	c.623G>A	c.(622-624)cGg>cAg	p.R208Q	TGM1_ENST00000544573.1_Intron	NM_000359.2	NP_000350.1	P22735	TGM1_HUMAN	transglutaminase 1	208					cell envelope organization (GO:0043163)|cellular protein modification process (GO:0006464)|keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)|organ morphogenesis (GO:0009887)|peptide cross-linking (GO:0018149)	cell-cell adherens junction (GO:0005913)|cornified envelope (GO:0001533)|extracellular vesicular exosome (GO:0070062)|intrinsic component of membrane (GO:0031224)	metal ion binding (GO:0046872)|protein-glutamine gamma-glutamyltransferase activity (GO:0003810)			breast(1)|central_nervous_system(3)|endometrium(3)|kidney(1)|large_intestine(5)|lung(7)|ovary(2)|prostate(2)	24				GBM - Glioblastoma multiforme(265;0.0186)	L-Glutamine(DB00130)	AGTGTGGACCCGCAGGTTCAG	0.607													C|||	1	0.000199681	0.0	0.0	5008	,	,		19613	0.0		0.0	False		,,,				2504	0.001				p.R208Q		Atlas-SNP	.											.	TGM1	73	.	0			c.G623A						.	C	GLN/ARG	0,4406		0,0,2203	202.0	167.0	178.0		623	3.8	0.6	14		178	1,8599	1.2+/-3.3	0,1,4299	no	missense	TGM1	NM_000359.2	43	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	possibly-damaging	208/818	24729790	1,13005	2203	4300	6503	SO:0001583	missense	7051	exon4			TGGACCCGCAGGT	D90287	CCDS9622.1	14q11.2	2013-05-02	2013-05-02		ENSG00000092295	ENSG00000092295	2.3.2.13	"""Transglutaminases"""	11777	protein-coding gene	gene with protein product	"""K polypeptide epidermal type I, protein-glutamine-gamma-glutamyltransferase"""	190195	"""transglutaminase 1 (K polypeptide epidermal type I, protein-glutamine-gamma-glutamyltransferase)"""	ICR2		11390390	Standard	NM_000359		Approved	TGASE, TGK, LI, LI1	uc001wod.3	P22735	OTTHUMG00000029329	ENST00000206765.6:c.623G>A	chr14.hg19:g.24729790C>T	ENSP00000206765:p.Arg208Gln	161.0	0.0		126.0	6.0	NM_000359	B4DWR7|Q197M4	Missense_Mutation	SNP	ENST00000206765.6	hg19	CCDS9622.1	.	.	.	.	.	.	.	.	.	.	C	10.23	1.293991	0.23564	0.0	1.16E-4	ENSG00000092295	ENST00000206765	D	0.83992	-1.79	5.89	3.76	0.43208	Immunoglobulin E-set (1);Transglutaminase, N-terminal (1);Immunoglobulin-like fold (1);	0.195706	0.46442	D	0.000296	T	0.65668	0.2713	N	0.05487	-0.04	0.23440	N	0.997677	B	0.27316	0.175	B	0.16722	0.016	T	0.56854	-0.7910	10	0.33940	T	0.23	-17.2242	13.0381	0.58882	0.0:0.8426:0.0:0.1574	.	208	P22735	TGM1_HUMAN	Q	208	ENSP00000206765:R208Q	ENSP00000206765:R208Q	R	-	2	0	TGM1	23799630	0.187000	0.23238	0.643000	0.29450	0.572000	0.35998	2.043000	0.41231	1.507000	0.48752	0.563000	0.77884	CGG	.	.		0.607	TGM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000073160.6	NM_000359	
TRPM7	54822	hgsc.bcm.edu	37	15	50903454	50903454	+	Missense_Mutation	SNP	T	T	C			TCGA-2Y-A9H6-01A-11D-A38X-10	TCGA-2Y-A9H6-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ee12965-26aa-443a-b8de-f4a79dc3e857	b27b338e-86e5-4131-83cf-206c52b809b7	g.chr15:50903454T>C	ENST00000313478.7	-	17	2397	c.2116A>G	c.(2116-2118)Atg>Gtg	p.M706V	TRPM7_ENST00000560955.1_Missense_Mutation_p.M706V	NM_017672.4	NP_060142.3	Q96QT4	TRPM7_HUMAN	transient receptor potential cation channel, subfamily M, member 7	706					actomyosin structure organization (GO:0031032)|calcium ion transmembrane transport (GO:0070588)|calcium-dependent cell-matrix adhesion (GO:0016340)|cellular magnesium ion homeostasis (GO:0010961)|ion transmembrane transport (GO:0034220)|necroptotic process (GO:0070266)|protein autophosphorylation (GO:0046777)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	ATP binding (GO:0005524)|calcium channel activity (GO:0005262)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)			breast(3)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(17)|lung(13)|ovary(4)|pancreas(1)|skin(4)|stomach(3)	52				all cancers(107;0.000819)|GBM - Glioblastoma multiforme(94;0.0045)		AGCAATTTCATAGCCATGGTT	0.363																																					p.M706V		Atlas-SNP	.											.	TRPM7	145	.	0			c.A2116G						.						110.0	99.0	102.0					15																	50903454		1831	4087	5918	SO:0001583	missense	54822	exon17			ATTTCATAGCCAT	AF346629	CCDS42035.1, CCDS73725.1	15q21	2011-12-14				ENSG00000092439		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17994	protein-coding gene	gene with protein product		605692				11161216, 11385574, 16382100	Standard	XM_005254486		Approved	CHAK1, LTRPC7, TRP-PLIK	uc001zyt.4	Q96QT4		ENST00000313478.7:c.2116A>G	chr15.hg19:g.50903454T>C	ENSP00000320239:p.Met706Val	79.0	0.0		107.0	29.0	NM_017672	Q6ZMF5|Q86VJ4|Q8NBW2|Q9BXB2|Q9NXQ2	Missense_Mutation	SNP	ENST00000313478.7	hg19	CCDS42035.1	.	.	.	.	.	.	.	.	.	.	T	25.0	4.592645	0.86953	.	.	ENSG00000092439	ENST00000313478	D	0.81908	-1.55	5.55	5.55	0.83447	.	0.000000	0.85682	D	0.000000	D	0.88381	0.6421	M	0.84846	2.72	0.58432	D	0.999999	P	0.50943	0.94	P	0.49561	0.615	D	0.90488	0.4465	10	0.87932	D	0	-16.7725	15.6872	0.77421	0.0:0.0:0.0:1.0	.	706	Q96QT4	TRPM7_HUMAN	V	706	ENSP00000320239:M706V	ENSP00000320239:M706V	M	-	1	0	TRPM7	48690746	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.040000	0.89188	2.100000	0.63781	0.533000	0.62120	ATG	.	.		0.363	TRPM7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000418604.1	NM_017672	
LMF1	64788	hgsc.bcm.edu	37	16	1020930	1020930	+	Silent	SNP	C	C	T			TCGA-2Y-A9H6-01A-11D-A38X-10	TCGA-2Y-A9H6-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ee12965-26aa-443a-b8de-f4a79dc3e857	b27b338e-86e5-4131-83cf-206c52b809b7	g.chr16:1020930C>T	ENST00000262301.11	-	1	69	c.51G>A	c.(49-51)agG>agA	p.R17R	LMF1_ENST00000543238.1_5'UTR|LMF1_ENST00000568897.1_5'Flank|LMF1_ENST00000399843.2_Silent_p.R17R|LMF1_ENST00000539379.1_Silent_p.R10R	NM_022773.2	NP_073610.2	Q96S06	LMF1_HUMAN	lipase maturation factor 1	17					chylomicron remnant clearance (GO:0034382)|ER to Golgi vesicle-mediated transport (GO:0006888)|positive regulation of lipoprotein lipase activity (GO:0051006)|protein glycosylation in Golgi (GO:0033578)|protein maturation (GO:0051604)|protein secretion (GO:0009306)|regulation of cholesterol metabolic process (GO:0090181)|regulation of triglyceride metabolic process (GO:0090207)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)|prostate(1)|stomach(2)|urinary_tract(1)	18		Hepatocellular(780;0.00308)				CAGTCTTCCGCCTCCTCAGCG	0.746																																					p.R17R		Atlas-SNP	.											.	LMF1	42	.	0			c.G51A						.						6.0	9.0	8.0					16																	1020930		1820	4008	5828	SO:0001819	synonymous_variant	64788	exon1			CTTCCGCCTCCTC	AK022743	CCDS45373.1	16p13.3	2008-02-05	2007-11-29	2007-11-29	ENSG00000103227	ENSG00000103227			14154	protein-coding gene	gene with protein product		611761	"""chromosome 16 open reading frame 26"", ""transmembrane protein 112"""	C16orf26, TMEM112		11157797, 17994020	Standard	NM_022773		Approved	FLJ12681, JFP11, FLJ22302, TMEM112A	uc021tae.1	Q96S06	OTTHUMG00000047848	ENST00000262301.11:c.51G>A	chr16.hg19:g.1020930C>T		141.0	0.0		122.0	32.0	NM_022773	Q68CJ3|Q96FJ4|Q9H6G4|Q9H9K7	Silent	SNP	ENST00000262301.11	hg19	CCDS45373.1																																																																																			.	.		0.746	LMF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000109071.3	NM_022773	
MAPK8IP3	23162	hgsc.bcm.edu	37	16	1808157	1808157	+	Missense_Mutation	SNP	T	T	C			TCGA-2Y-A9H6-01A-11D-A38X-10	TCGA-2Y-A9H6-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ee12965-26aa-443a-b8de-f4a79dc3e857	b27b338e-86e5-4131-83cf-206c52b809b7	g.chr16:1808157T>C	ENST00000250894.4	+	9	1379	c.1222T>C	c.(1222-1224)Tca>Cca	p.S408P	MAPK8IP3_ENST00000356010.5_Missense_Mutation_p.S408P	NM_015133.3	NP_055948.2	Q9UPT6	JIP3_HUMAN	mitogen-activated protein kinase 8 interacting protein 3	408					activation of JUN kinase activity (GO:0007257)|axon guidance (GO:0007411)|forebrain development (GO:0030900)|in utero embryonic development (GO:0001701)|lung alveolus development (GO:0048286)|lung morphogenesis (GO:0060425)|positive regulation of neuron differentiation (GO:0045666)|post-embryonic development (GO:0009791)|protein localization (GO:0008104)|regulation of gene expression (GO:0010468)|regulation of JNK cascade (GO:0046328)|respiratory gaseous exchange (GO:0007585)|vesicle-mediated transport (GO:0016192)	axolemma (GO:0030673)|dendrite (GO:0030425)|Golgi membrane (GO:0000139)|smooth endoplasmic reticulum (GO:0005790)	kinesin binding (GO:0019894)|MAP-kinase scaffold activity (GO:0005078)			NS(1)|breast(3)|central_nervous_system(3)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(20)|ovary(1)|prostate(2)|skin(2)|urinary_tract(3)	42						AGGGGAGTTCTCAGGTGAGTA	0.567																																					p.S408P		Atlas-SNP	.											.	MAPK8IP3	164	.	0			c.T1222C						.						107.0	111.0	109.0					16																	1808157		2026	4170	6196	SO:0001583	missense	23162	exon9			GAGTTCTCAGGTG	AB028989	CCDS10442.2, CCDS45379.1	16p13.3	2009-11-23			ENSG00000138834	ENSG00000138834			6884	protein-coding gene	gene with protein product	"""homolog of Drosophila Sunday driver 2"""	605431				10523642, 10629060	Standard	XM_005255187		Approved	KIAA1066, JSAP1, JIP3, syd	uc002cmk.3	Q9UPT6	OTTHUMG00000128637	ENST00000250894.4:c.1222T>C	chr16.hg19:g.1808157T>C	ENSP00000250894:p.Ser408Pro	91.0	0.0		67.0	22.0	NM_015133	A2A2B3|A7E2B3|Q96RY4|Q9H4I4|Q9H7P1|Q9NUG0	Missense_Mutation	SNP	ENST00000250894.4	hg19	CCDS10442.2	.	.	.	.	.	.	.	.	.	.	T	16.35	3.097415	0.56075	.	.	ENSG00000138834	ENST00000250894;ENST00000356010	T;T	0.34472	1.38;1.36	5.21	5.21	0.72293	.	.	.	.	.	T	0.28101	0.0693	L	0.29908	0.895	0.23150	N	0.998211	P;B	0.35944	0.529;0.405	B;B	0.34180	0.158;0.177	T	0.22173	-1.0224	9	0.72032	D	0.01	0.7974	10.8577	0.46808	0.0:0.0:0.1579:0.8421	.	409;408	B7ZMF3;Q9UPT6	.;JIP3_HUMAN	P	408	ENSP00000250894:S408P;ENSP00000348290:S408P	ENSP00000250894:S408P	S	+	1	0	MAPK8IP3	1748158	1.000000	0.71417	1.000000	0.80357	0.851000	0.48451	6.213000	0.72194	1.985000	0.57927	0.459000	0.35465	TCA	.	.		0.567	MAPK8IP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250508.2	NM_001040439	
CAMKK1	84254	hgsc.bcm.edu	37	17	3788636	3788636	+	Missense_Mutation	SNP	T	T	C			TCGA-2Y-A9H6-01A-11D-A38X-10	TCGA-2Y-A9H6-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ee12965-26aa-443a-b8de-f4a79dc3e857	b27b338e-86e5-4131-83cf-206c52b809b7	g.chr17:3788636T>C	ENST00000348335.2	-	2	494	c.346A>G	c.(346-348)Atc>Gtc	p.I116V	CAMKK1_ENST00000381769.2_Missense_Mutation_p.I143V|CAMKK1_ENST00000158166.5_Missense_Mutation_p.I116V|CAMKK1_ENST00000381771.2_Missense_Mutation_p.I116V	NM_032294.2	NP_115670.1	Q8N5S9	KKCC1_HUMAN	calcium/calmodulin-dependent protein kinase kinase 1, alpha	116					synaptic transmission (GO:0007268)	cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)			NS(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(4)|ovary(1)	11				LUAD - Lung adenocarcinoma(2;2.11e-05)|Lung(3;0.0176)		GCATCTGAGATGGCCACGTGG	0.637																																					p.I116V		Atlas-SNP	.											.	CAMKK1	70	.	0			c.A346G						.						14.0	17.0	16.0					17																	3788636		2184	4263	6447	SO:0001583	missense	84254	exon2			CTGAGATGGCCAC	AL136576	CCDS11038.1, CCDS11039.1	17p13.3	2004-02-18			ENSG00000004660	ENSG00000004660			1469	protein-coding gene	gene with protein product		611411				11230166	Standard	NM_172207		Approved	DKFZp761M0423, CAMKKA, MGC34095	uc002fwt.3	Q8N5S9	OTTHUMG00000090725	ENST00000348335.2:c.346A>G	chr17.hg19:g.3788636T>C	ENSP00000323118:p.Ile116Val	68.0	0.0		75.0	7.0	NM_032294	Q9BQH3	Missense_Mutation	SNP	ENST00000348335.2	hg19	CCDS11038.1	.	.	.	.	.	.	.	.	.	.	T	16.79	3.220470	0.58560	.	.	ENSG00000004660	ENST00000381769;ENST00000348335;ENST00000381771;ENST00000158166	T;T;T;T	0.48836	0.8;0.8;0.8;0.8	5.05	5.05	0.67936	Protein kinase-like domain (1);	0.053765	0.64402	D	0.000001	T	0.49541	0.1563	L	0.50333	1.59	0.58432	D	0.999996	P;P	0.40302	0.712;0.589	P;B	0.46718	0.525;0.222	T	0.42632	-0.9440	10	0.30078	T	0.28	-21.0111	12.7728	0.57432	0.0:0.0:0.0:1.0	.	116;116	F8W9H1;Q8N5S9	.;KKCC1_HUMAN	V	143;116;116;116	ENSP00000371188:I143V;ENSP00000323118:I116V;ENSP00000371190:I116V;ENSP00000158166:I116V	ENSP00000158166:I116V	I	-	1	0	CAMKK1	3735385	1.000000	0.71417	1.000000	0.80357	0.925000	0.55904	6.926000	0.75835	2.126000	0.65437	0.402000	0.26972	ATC	.	.		0.637	CAMKK1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207456.1	NM_032294, NM_172206, NM_172207	
USP6	9098	hgsc.bcm.edu	37	17	5041019	5041019	+	Missense_Mutation	SNP	C	C	T			TCGA-2Y-A9H6-01A-11D-A38X-10	TCGA-2Y-A9H6-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ee12965-26aa-443a-b8de-f4a79dc3e857	b27b338e-86e5-4131-83cf-206c52b809b7	g.chr17:5041019C>T	ENST00000574788.1	+	20	3129	c.899C>T	c.(898-900)aCc>aTc	p.T300I	USP6_ENST00000332776.4_Missense_Mutation_p.T300I|USP6_ENST00000304328.5_5'UTR|USP6_ENST00000250066.6_Missense_Mutation_p.T300I			P35125	UBP6_HUMAN	ubiquitin specific peptidase 6	300					cellular protein modification process (GO:0006464)|protein deubiquitination (GO:0016579)|regulation of vesicle-mediated transport (GO:0060627)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)	calmodulin binding (GO:0005516)|cysteine-type endopeptidase activity (GO:0004197)|nucleic acid binding (GO:0003676)|Rab GTPase activator activity (GO:0005097)|ubiquitin-specific protease activity (GO:0004843)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(4)|lung(15)|ovary(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	34						ATGCCAATAACCAGCATTGCT	0.577			T	"""COL1A1, CDH11, ZNF9, OMD"""	aneurysmal bone cysts																																p.T300I		Atlas-SNP	.		Dom	yes		17	17p13	9098	ubiquitin specific peptidase 6 (Tre-2 oncogene)		M	.	USP6	213	.	0			c.C899T						.						249.0	218.0	228.0					17																	5041019		2203	4300	6503	SO:0001583	missense	9098	exon12			CAATAACCAGCAT	X63547	CCDS11069.2	17p13	2014-06-12	2014-06-12		ENSG00000129204	ENSG00000129204	3.4.19.12	"""Ubiquitin-specific peptidases"""	12629	protein-coding gene	gene with protein product	"""ubiquitin carboxyl-terminal hydrolase 6"", ""TBC1D3 and USP32 fusion"", ""Tre-2 oncogene"""	604334	"""ubiquitin specific protease 6 (Tre-2 oncogene)"", ""TRE oncogene, Smith Magenis syndrome chromosome region"", ""ubiquitin specific peptidase 6 (Tre-2 oncogene)"""	HRP1, TRESMCR		12838346, 1349106	Standard	NM_004505		Approved	Tre-2, TRE17, Tre2	uc002gav.1	P35125	OTTHUMG00000099449	ENST00000574788.1:c.899C>T	chr17.hg19:g.5041019C>T	ENSP00000460380:p.Thr300Ile	33.0	0.0		42.0	13.0	NM_004505	Q15634|Q86WP6|Q8IWT4	Missense_Mutation	SNP	ENST00000574788.1	hg19	CCDS11069.2	.	.	.	.	.	.	.	.	.	.	C	14.69	2.611401	0.46631	.	.	ENSG00000129204	ENST00000332776;ENST00000250066	T;T	0.21191	2.02;2.02	.	.	.	Rab-GAP/TBC domain (3);	0.392224	0.33110	N	0.005270	T	0.13543	0.0328	L	0.40543	1.245	0.80722	D	1	P	0.41008	0.735	B	0.32980	0.156	T	0.04870	-1.0921	8	0.87932	D	0	.	.	.	.	.	300	P35125	UBP6_HUMAN	I	300	ENSP00000328010:T300I;ENSP00000250066:T300I	ENSP00000250066:T300I	T	+	2	0	USP6	4981743	0.997000	0.39634	0.023000	0.16930	0.023000	0.10783	4.523000	0.60545	0.119000	0.18210	0.121000	0.15741	ACC	.	.		0.577	USP6-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438990.1	NM_004505	
ACAP1	9744	hgsc.bcm.edu	37	17	7247901	7247901	+	Missense_Mutation	SNP	C	C	A			TCGA-2Y-A9H6-01A-11D-A38X-10	TCGA-2Y-A9H6-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ee12965-26aa-443a-b8de-f4a79dc3e857	b27b338e-86e5-4131-83cf-206c52b809b7	g.chr17:7247901C>A	ENST00000158762.3	+	10	994	c.788C>A	c.(787-789)cCt>cAt	p.P263H		NM_014716.3	NP_055531.1	Q15027	ACAP1_HUMAN	ArfGAP with coiled-coil, ankyrin repeat and PH domains 1	263	Required for formation of endosomal tubules when overexpressed with PIP5K1C.				protein transport (GO:0015031)|regulation of ARF GTPase activity (GO:0032312)	endosome (GO:0005768)|membrane (GO:0016020)	ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)			NS(1)|breast(5)|cervix(3)|endometrium(4)|kidney(1)|large_intestine(7)|liver(1)|lung(6)|prostate(3)|skin(1)|urinary_tract(1)	33						AGAGAGGGGCCTGGTGGCCTG	0.592																																					p.P263H		Atlas-SNP	.											.	ACAP1	66	.	0			c.C788A						.						56.0	46.0	49.0					17																	7247901		2011	3869	5880	SO:0001583	missense	9744	exon10			AGGGGCCTGGTGG	D30758	CCDS11101.1	17p13.1	2013-01-11	2008-09-22	2008-09-22	ENSG00000072818	ENSG00000072818		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	16467	protein-coding gene	gene with protein product		607763	"""centaurin, beta 1"""	CENTB1		11050434, 11062263	Standard	NM_014716		Approved	KIAA0050	uc002ggd.2	Q15027	OTTHUMG00000102199	ENST00000158762.3:c.788C>A	chr17.hg19:g.7247901C>A	ENSP00000158762:p.Pro263His	71.0	0.0		85.0	32.0	NM_014716	Q53XN9	Missense_Mutation	SNP	ENST00000158762.3	hg19	CCDS11101.1	.	.	.	.	.	.	.	.	.	.	C	11.77	1.738068	0.30774	.	.	ENSG00000072818	ENST00000158762	T	0.04551	3.6	5.24	4.27	0.50696	.	0.328645	0.32106	N	0.006564	T	0.06234	0.0161	L	0.57536	1.79	0.80722	D	1	P	0.45348	0.856	B	0.36186	0.219	T	0.23119	-1.0197	10	0.62326	D	0.03	.	11.8561	0.52437	0.0:0.9139:0.0:0.0861	.	263	Q15027	ACAP1_HUMAN	H	263	ENSP00000158762:P263H	ENSP00000158762:P263H	P	+	2	0	ACAP1	7188625	0.995000	0.38212	0.111000	0.21465	0.180000	0.23129	3.855000	0.55957	1.354000	0.45846	0.563000	0.77884	CCT	.	.		0.592	ACAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000220049.4	NM_014716	
FXR2	9513	hgsc.bcm.edu	37	17	7504837	7504837	+	Missense_Mutation	SNP	T	T	C			TCGA-2Y-A9H6-01A-11D-A38X-10	TCGA-2Y-A9H6-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ee12965-26aa-443a-b8de-f4a79dc3e857	b27b338e-86e5-4131-83cf-206c52b809b7	g.chr17:7504837T>C	ENST00000250113.7	-	7	884	c.550A>G	c.(550-552)Aca>Gca	p.T184A		NM_004860.3	NP_004851.2	P51116	FXR2_HUMAN	fragile X mental retardation, autosomal homolog 2	184						cytoplasm (GO:0005737)|cytosolic large ribosomal subunit (GO:0022625)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)	p.?(1)		NS(1)|breast(2)|endometrium(6)|kidney(1)|large_intestine(7)|lung(8)|prostate(1)	26				READ - Rectum adenocarcinoma(115;0.17)		GGGGCTTCTGTGGTTGACTGG	0.502																																					p.T184A		Atlas-SNP	.											.	FXR2	44	.	1	Unknown(1)	haematopoietic_and_lymphoid_tissue(1)	c.A550G						.						141.0	138.0	139.0					17																	7504837		1910	4122	6032	SO:0001583	missense	9513	exon7			CTTCTGTGGTTGA	U31501	CCDS45604.1	17p13.3	2014-09-17				ENSG00000129245			4024	protein-coding gene	gene with protein product		605339		FMR1L2		7489725, 9259278	Standard	NM_004860		Approved		uc002gia.2	P51116		ENST00000250113.7:c.550A>G	chr17.hg19:g.7504837T>C	ENSP00000250113:p.Thr184Ala	104.0	0.0		87.0	32.0	NM_004860	B2R9M2|D3DTQ1|Q86V09|Q8WUM2	Missense_Mutation	SNP	ENST00000250113.7	hg19	CCDS45604.1	.	.	.	.	.	.	.	.	.	.	T	15.01	2.706631	0.48412	.	.	ENSG00000129245	ENST00000250113	T	0.35605	1.3	5.44	4.34	0.51931	.	0.107908	0.64402	D	0.000006	T	0.22781	0.0550	N	0.19112	0.55	0.31668	N	0.644681	B;B	0.22851	0.076;0.076	B;B	0.23716	0.048;0.048	T	0.15925	-1.0420	10	0.39692	T	0.17	0.0495	8.2772	0.31879	0.3181:0.0:0.0:0.6818	.	184;184	Q86V09;P51116	.;FXR2_HUMAN	A	184	ENSP00000250113:T184A	ENSP00000250113:T184A	T	-	1	0	FXR2	7445562	0.997000	0.39634	1.000000	0.80357	0.991000	0.79684	3.947000	0.56652	0.865000	0.35603	0.523000	0.50628	ACA	.	.		0.502	FXR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441084.1		
CACNA1G	8913	hgsc.bcm.edu	37	17	48684344	48684344	+	Silent	SNP	C	C	T			TCGA-2Y-A9H6-01A-11D-A38X-10	TCGA-2Y-A9H6-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ee12965-26aa-443a-b8de-f4a79dc3e857	b27b338e-86e5-4131-83cf-206c52b809b7	g.chr17:48684344C>T	ENST00000359106.5	+	24	4506	c.4506C>T	c.(4504-4506)gaC>gaT	p.D1502D	CACNA1G_ENST00000507336.1_Silent_p.D1502D|CACNA1G_ENST00000514717.1_Silent_p.D1479D|CACNA1G_ENST00000507609.1_Silent_p.D1502D|CACNA1G_ENST00000514079.1_Silent_p.D1502D|CACNA1G_ENST00000512389.1_Silent_p.D1502D|CACNA1G_ENST00000515411.1_Silent_p.D1502D|CACNA1G_ENST00000515165.1_Silent_p.D1502D|CACNA1G_ENST00000429973.2_Silent_p.D1502D|CACNA1G_ENST00000513689.2_Silent_p.D1502D|CACNA1G_ENST00000503485.1_Silent_p.D1502D|CACNA1G_ENST00000502264.1_Silent_p.D1479D|CACNA1G_ENST00000513964.1_Silent_p.D1502D|CACNA1G_ENST00000515765.1_Silent_p.D1502D|CACNA1G_ENST00000354983.4_Silent_p.D1479D|CACNA1G_ENST00000505165.1_Silent_p.D1502D|CACNA1G_ENST00000360761.4_Silent_p.D1479D|CACNA1G_ENST00000510115.1_Silent_p.D1479D|CACNA1G_ENST00000352832.5_Silent_p.D1479D|CACNA1G_ENST00000358244.5_Silent_p.D1479D|CACNA1G_ENST00000507896.1_Silent_p.D1502D|CACNA1G_ENST00000442258.2_Silent_p.D1479D|CACNA1G_ENST00000507510.2_Silent_p.D1502D|CACNA1G_ENST00000510366.1_Silent_p.D1502D|CACNA1G_ENST00000514181.1_Silent_p.D1502D	NM_018896.4	NP_061496.2	O43497	CAC1G_HUMAN	calcium channel, voltage-dependent, T type, alpha 1G subunit	1502					axon guidance (GO:0007411)|calcium ion import (GO:0070509)|membrane depolarization during action potential (GO:0086010)|positive regulation of calcium ion-dependent exocytosis (GO:0045956)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of heart rate (GO:0002027)|regulation of membrane potential (GO:0042391)|response to nickel cation (GO:0010045)|synaptic transmission (GO:0007268)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	low voltage-gated calcium channel activity (GO:0008332)|scaffold protein binding (GO:0097110)			breast(5)|cervix(1)|endometrium(13)|kidney(5)|lung(23)	47	Breast(11;6.7e-17)		BRCA - Breast invasive adenocarcinoma(22;7.52e-09)		Cinnarizine(DB00568)|Ethosuximide(DB00593)|Flunarizine(DB04841)|Methsuximide(DB05246)|Spironolactone(DB00421)|Trimethadione(DB00347)|Verapamil(DB00661)|Zonisamide(DB00909)	TGGGCGTGGACCAGCAGGTAG	0.587																																					p.D1502D		Atlas-SNP	.											.	CACNA1G	659	.	0			c.C4506T						.						102.0	97.0	99.0					17																	48684344		2130	4228	6358	SO:0001819	synonymous_variant	8913	exon24			CGTGGACCAGCAG	AC004590	CCDS45730.1, CCDS45731.1, CCDS45732.1, CCDS45733.1, CCDS45734.1, CCDS45735.1, CCDS45736.1, CCDS45737.1, CCDS54142.1, CCDS54143.1, CCDS54144.1, CCDS54145.1, CCDS54146.1, CCDS58565.1, CCDS58566.1, CCDS58567.1, CCDS58568.1, CCDS58569.1, CCDS58570.1, CCDS58571.1, CCDS58572.1, CCDS58573.1, CCDS58574.1, CCDS58575.1, CCDS58576.1	17q22	2012-03-07	2007-02-16		ENSG00000006283	ENSG00000006283		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1394	protein-coding gene	gene with protein product		604065				9495342, 16382099	Standard	NM_001256334		Approved	Cav3.1, NBR13	uc002irk.2	O43497	OTTHUMG00000162180	ENST00000359106.5:c.4506C>T	chr17.hg19:g.48684344C>T		76.0	0.0		65.0	16.0	NM_001256360	D6RA64|E7EPR0|O43498|O94770|Q19QY8|Q19QY9|Q19QZ0|Q19QZ1|Q19QZ2|Q19QZ3|Q19QZ4|Q19QZ5|Q19QZ6|Q19QZ7|Q19QZ8|Q19QZ9|Q19R00|Q19R01|Q19R02|Q19R03|Q19R04|Q19R05|Q19R06|Q19R07|Q19R08|Q19R09|Q19R10|Q19R11|Q19R12|Q19R13|Q19R15|Q19R16|Q19R17|Q19R18|Q2TAC4|Q9NYU4|Q9NYU5|Q9NYU6|Q9NYU7|Q9NYU8|Q9NYU9|Q9NYV0|Q9NYV1|Q9UHN9|Q9UHP0|Q9ULU6|Q9UNG7|Q9Y5T2|Q9Y5T3	Silent	SNP	ENST00000359106.5	hg19	CCDS45730.1																																																																																			.	.		0.587	CACNA1G-013	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000367895.1	NM_018896	
CACNG4	27092	hgsc.bcm.edu	37	17	65026622	65026622	+	Silent	SNP	C	C	T			TCGA-2Y-A9H6-01A-11D-A38X-10	TCGA-2Y-A9H6-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ee12965-26aa-443a-b8de-f4a79dc3e857	b27b338e-86e5-4131-83cf-206c52b809b7	g.chr17:65026622C>T	ENST00000262138.3	+	4	488	c.486C>T	c.(484-486)agC>agT	p.S162S	AC005544.1_ENST00000375684.1_5'Flank|RP11-74H8.1_ENST00000579138.1_RNA	NM_014405.3	NP_055220.1	Q9UBN1	CCG4_HUMAN	calcium channel, voltage-dependent, gamma subunit 4	162					membrane depolarization (GO:0051899)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|synaptic transmission (GO:0007268)|transmission of nerve impulse (GO:0019226)|transport (GO:0006810)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|endocytic vesicle membrane (GO:0030666)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	voltage-gated calcium channel activity (GO:0005245)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|prostate(3)	19	all_cancers(12;9.86e-11)		BRCA - Breast invasive adenocarcinoma(6;1.35e-07)			ACATTTCCAGCAACACAGGTG	0.532																																					p.S162S		Atlas-SNP	.											.	CACNG4	44	.	0			c.C486T						.						138.0	136.0	136.0					17																	65026622		2203	4300	6503	SO:0001819	synonymous_variant	27092	exon4			TTCCAGCAACACA	AH008289	CCDS11667.1	17q24	2006-01-23				ENSG00000075461		"""Calcium channel subunits"""	1408	protein-coding gene	gene with protein product		606404				10613843	Standard	NM_014405		Approved	MGC11138, MGC24983	uc002jft.2	Q9UBN1		ENST00000262138.3:c.486C>T	chr17.hg19:g.65026622C>T		230.0	0.0		188.0	15.0	NM_014405	B2RCK0	Silent	SNP	ENST00000262138.3	hg19	CCDS11667.1																																																																																			.	.		0.532	CACNG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000447036.1	NM_014405	
BPTF	2186	hgsc.bcm.edu	37	17	65920661	65920661	+	Splice_Site	SNP	A	A	G			TCGA-2Y-A9H6-01A-11D-A38X-10	TCGA-2Y-A9H6-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ee12965-26aa-443a-b8de-f4a79dc3e857	b27b338e-86e5-4131-83cf-206c52b809b7	g.chr17:65920661A>G	ENST00000321892.4	+	17	6147		c.e17-1		BPTF_ENST00000424123.3_Splice_Site|BPTF_ENST00000335221.5_Splice_Site|BPTF_ENST00000306378.6_Splice_Site			Q12830	BPTF_HUMAN	bromodomain PHD finger transcription factor						anterior/posterior pattern specification (GO:0009952)|ATP catabolic process (GO:0006200)|brain development (GO:0007420)|chromatin remodeling (GO:0006338)|embryonic placenta development (GO:0001892)|endoderm development (GO:0007492)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)|nucleus (GO:0005634)|NURF complex (GO:0016589)	sequence-specific DNA binding (GO:0043565)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(16)|lung(23)|ovary(3)|pancreas(2)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	78	all_cancers(12;6e-11)		BRCA - Breast invasive adenocarcinoma(8;7.48e-08)|Colorectal(3;0.0984)|LUSC - Lung squamous cell carcinoma(166;0.24)			TTTTTCCTGCAGAGTGGAGAA	0.418																																					.		Atlas-SNP	.											.	BPTF	415	.	0			c.6087-2A>G						.						77.0	74.0	75.0					17																	65920661		2203	4300	6503	SO:0001630	splice_region_variant	2186	exon17			TCCTGCAGAGTGG	AY282495	CCDS11673.1	17q24	2013-01-28	2006-12-01	2006-12-01	ENSG00000171634	ENSG00000171634		"""Zinc fingers, PHD-type"""	3581	protein-coding gene	gene with protein product		601819	"""fetal Alzheimer antigen"""	FALZ		8975731, 10662542, 16728976	Standard	NM_182641		Approved	FAC1, NURF301	uc002jgf.3	Q12830	OTTHUMG00000132254	ENST00000321892.4:c.6087-1A>G	chr17.hg19:g.65920661A>G		195.0	0.0		274.0	82.0	NM_004459	Q6NX67|Q7Z7D6|Q9UIG2	Splice_Site	SNP	ENST00000321892.4	hg19		.	.	.	.	.	.	.	.	.	.	A	22.2	4.259431	0.80246	.	.	ENSG00000171634	ENST00000306378;ENST00000335221;ENST00000321892	.	.	.	5.12	5.12	0.69794	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.2325	0.73401	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	BPTF	63351123	1.000000	0.71417	0.998000	0.56505	0.966000	0.64601	8.867000	0.92314	2.054000	0.61138	0.528000	0.53228	.	.	.		0.418	BPTF-201	KNOWN	basic	protein_coding	protein_coding		NM_182641, NM_004459	Intron
FASN	2194	hgsc.bcm.edu	37	17	80045255	80045255	+	Missense_Mutation	SNP	T	T	C	rs141517558		TCGA-2Y-A9H6-01A-11D-A38X-10	TCGA-2Y-A9H6-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ee12965-26aa-443a-b8de-f4a79dc3e857	b27b338e-86e5-4131-83cf-206c52b809b7	g.chr17:80045255T>C	ENST00000306749.2	-	20	3387	c.3169A>G	c.(3169-3171)Atc>Gtc	p.I1057V		NM_004104.4	NP_004095.4	P49327	FAS_HUMAN	fatty acid synthase	1057					acetyl-CoA metabolic process (GO:0006084)|cellular lipid metabolic process (GO:0044255)|cellular response to interleukin-4 (GO:0071353)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|fatty acid metabolic process (GO:0006631)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|osteoblast differentiation (GO:0001649)|pantothenate metabolic process (GO:0015939)|positive regulation of cellular metabolic process (GO:0031325)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|glycogen granule (GO:0042587)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	3-hydroxyoctanoyl-[acyl-carrier-protein] dehydratase activity (GO:0047451)|3-hydroxypalmitoyl-[acyl-carrier-protein] dehydratase activity (GO:0004317)|3-oxoacyl-[acyl-carrier-protein] reductase (NADPH) activity (GO:0004316)|3-oxoacyl-[acyl-carrier-protein] synthase activity (GO:0004315)|[acyl-carrier-protein] S-acetyltransferase activity (GO:0004313)|[acyl-carrier-protein] S-malonyltransferase activity (GO:0004314)|drug binding (GO:0008144)|enoyl-[acyl-carrier-protein] reductase (NADPH, A-specific) activity (GO:0047117)|enoyl-[acyl-carrier-protein] reductase (NADPH, B-specific) activity (GO:0004319)|fatty acid synthase activity (GO:0004312)|myristoyl-[acyl-carrier-protein] hydrolase activity (GO:0016295)|NADPH binding (GO:0070402)|oleoyl-[acyl-carrier-protein] hydrolase activity (GO:0004320)|palmitoyl-[acyl-carrier-protein] hydrolase activity (GO:0016296)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			central_nervous_system(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(12)|prostate(3)|skin(2)|urinary_tract(1)	34	all_neural(118;0.0878)|Ovarian(332;0.227)|all_lung(278;0.246)		OV - Ovarian serous cystadenocarcinoma(97;0.0211)|BRCA - Breast invasive adenocarcinoma(99;0.0237)		Cerulenin(DB01034)|Orlistat(DB01083)	GCAGGGTCGATGTGGATGGCG	0.642																																					p.I1057V	Colon(59;314 1043 11189 28578 32273)	Atlas-SNP	.											.	FASN	154	.	0			c.A3169G						.	T	VAL/ILE	0,4406		0,0,2203	117.0	88.0	97.0		3169	3.8	0.9	17	dbSNP_134	97	1,8595	1.2+/-3.3	0,1,4297	no	missense	FASN	NM_004104.4	29	0,1,6500	CC,CT,TT		0.0116,0.0,0.0077	benign	1057/2512	80045255	1,13001	2203	4298	6501	SO:0001583	missense	2194	exon20			GGTCGATGTGGAT	U26644	CCDS11801.1	17q25	2012-01-31			ENSG00000169710	ENSG00000169710	2.3.1.85	"""Short chain dehydrogenase/reductase superfamily / Atypical members"""	3594	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 27X, member 1"""	600212				7835891, 7567999, 19027726	Standard	NM_004104		Approved	FAS, SDR27X1	uc002kdu.3	P49327		ENST00000306749.2:c.3169A>G	chr17.hg19:g.80045255T>C	ENSP00000304592:p.Ile1057Val	57.0	0.0		63.0	18.0	NM_004104	Q13479|Q16702|Q4LE83|Q6P4U5|Q6SS02|Q969R1|Q96C68|Q96IT0	Missense_Mutation	SNP	ENST00000306749.2	hg19	CCDS11801.1	.	.	.	.	.	.	.	.	.	.	T	10.26	1.301515	0.23736	0.0	1.16E-4	ENSG00000169710	ENST00000306749;ENST00000545909	T	0.34667	1.35	3.85	3.85	0.44370	.	0.136306	0.49305	D	0.000143	T	0.37892	0.1020	M	0.77406	2.37	0.44006	D	0.996719	B	0.32829	0.386	B	0.27170	0.077	T	0.40979	-0.9534	10	0.46703	T	0.11	-36.3329	12.7742	0.57437	0.0:0.0:0.0:1.0	.	1057	P49327	FAS_HUMAN	V	1057;22	ENSP00000304592:I1057V	ENSP00000304592:I1057V	I	-	1	0	FASN	77638544	0.992000	0.36948	0.903000	0.35520	0.628000	0.37860	2.072000	0.41510	1.617000	0.50277	0.402000	0.26972	ATC	.	T|1.000;C|0.000		0.642	FASN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442369.1	NM_004104	
DLGAP1	9229	hgsc.bcm.edu	37	18	3729263	3729263	+	Missense_Mutation	SNP	C	C	T			TCGA-2Y-A9H6-01A-11D-A38X-10	TCGA-2Y-A9H6-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ee12965-26aa-443a-b8de-f4a79dc3e857	b27b338e-86e5-4131-83cf-206c52b809b7	g.chr18:3729263C>T	ENST00000315677.3	-	7	2058	c.1463G>A	c.(1462-1464)cGc>cAc	p.R488H	DLGAP1_ENST00000400149.3_Missense_Mutation_p.R196H|DLGAP1_ENST00000581527.1_Missense_Mutation_p.R488H|DLGAP1_ENST00000515196.2_Missense_Mutation_p.R488H|DLGAP1_ENST00000400150.3_Missense_Mutation_p.R194H|DLGAP1_ENST00000581699.1_Missense_Mutation_p.R194H|DLGAP1_ENST00000534970.1_Missense_Mutation_p.R200H|DLGAP1_ENST00000478161.1_5'UTR|DLGAP1_ENST00000400155.1_Missense_Mutation_p.R194H|DLGAP1_ENST00000400145.2_Missense_Mutation_p.R186H|DLGAP1_ENST00000539435.1_Missense_Mutation_p.R186H|DLGAP1_ENST00000584874.1_Missense_Mutation_p.R488H|DLGAP1_ENST00000400147.2_Missense_Mutation_p.R186H	NM_004746.3	NP_004737.2	O14490	DLGP1_HUMAN	discs, large (Drosophila) homolog-associated protein 1	488					synaptic transmission (GO:0007268)	cell junction (GO:0030054)|neuronal postsynaptic density (GO:0097481)|postsynaptic membrane (GO:0045211)				breast(2)|endometrium(3)|kidney(1)|large_intestine(5)|lung(31)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(6)|urinary_tract(1)	56		Colorectal(8;0.0257)				GCTCCGCATGCGGAAGCAGCC	0.667																																					p.R488H		Atlas-SNP	.											.	DLGAP1	201	.	0			c.G1463A						.						45.0	37.0	39.0					18																	3729263		2203	4299	6502	SO:0001583	missense	9229	exon7			CGCATGCGGAAGC	AB000277	CCDS11836.1, CCDS42406.1, CCDS56049.1, CCDS56050.1, CCDS56051.1, CCDS56052.1, CCDS56053.1, CCDS74191.1	18p11.3	2008-07-28	2001-11-28		ENSG00000170579	ENSG00000170579			2905	protein-coding gene	gene with protein product		605445	"""discs, large (Drosophila) homolog-associated protein 1"""			9024696, 9286858	Standard	NM_004746		Approved	GKAP, SAPAP1, DAP-1	uc002kmf.3	O14490	OTTHUMG00000131537	ENST00000315677.3:c.1463G>A	chr18.hg19:g.3729263C>T	ENSP00000316377:p.Arg488His	158.0	0.0		177.0	46.0	NM_001242761	A8MWN8|B2RMU8|B7WPA1|B7Z2H2|B7Z2I2|B7Z9Y4|O14489|P78335	Missense_Mutation	SNP	ENST00000315677.3	hg19	CCDS11836.1	.	.	.	.	.	.	.	.	.	.	C	36	5.719610	0.96839	.	.	ENSG00000170579	ENST00000315677;ENST00000400147;ENST00000400150;ENST00000400149;ENST00000400155;ENST00000534970;ENST00000539435;ENST00000400145;ENST00000515196	D;D;D;D;D;D;D;D;D	0.92099	-2.97;-2.97;-2.97;-2.97;-2.97;-2.97;-2.97;-2.97;-2.97	5.9	5.9	0.94986	.	0.000000	0.85682	D	0.000000	D	0.96827	0.8964	M	0.87269	2.87	0.80722	D	1	D;D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D;D;D	0.97110	0.996;0.996;0.999;0.996;0.999;0.999;0.998;0.999;1.0	D	0.96809	0.9595	10	0.87932	D	0	-23.9211	20.2821	0.98520	0.0:1.0:0.0:0.0	.	488;200;174;194;186;488;186;488;186	B7Z9Y4;B7Z2H2;B7Z2J5;A8MWN8;B7Z2I2;Q6IS01;O14490-3;O14490;O14490-2	.;.;.;.;.;.;.;DLGP1_HUMAN;.	H	488;186;194;196;194;200;186;186;488	ENSP00000316377:R488H;ENSP00000383011:R186H;ENSP00000383014:R194H;ENSP00000383013:R196H;ENSP00000383019:R194H;ENSP00000437817:R200H;ENSP00000446312:R186H;ENSP00000383010:R186H;ENSP00000445973:R488H	ENSP00000316377:R488H	R	-	2	0	DLGAP1	3719263	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.811000	0.86092	2.786000	0.95864	0.563000	0.77884	CGC	.	.		0.667	DLGAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254394.4		
DSEL	92126	hgsc.bcm.edu	37	18	65181841	65181841	+	Missense_Mutation	SNP	G	G	A			TCGA-2Y-A9H6-01A-11D-A38X-10	TCGA-2Y-A9H6-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ee12965-26aa-443a-b8de-f4a79dc3e857	b27b338e-86e5-4131-83cf-206c52b809b7	g.chr18:65181841G>A	ENST00000310045.7	-	2	1508	c.35C>T	c.(34-36)gCg>gTg	p.A12V	RP11-638L3.1_ENST00000583687.1_lincRNA|CTD-2541J13.2_ENST00000583493.1_RNA	NM_032160.2	NP_115536.1	Q8IZU8	DSEL_HUMAN	dermatan sulfate epimerase-like	2					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	isomerase activity (GO:0016853)|sulfotransferase activity (GO:0008146)			NS(3)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(25)|lung(23)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	74		Esophageal squamous(42;0.129)				AAACATTAACGCCATGATCCA	0.393																																					p.A12V		Atlas-SNP	.											.	DSEL	196	.	0			c.C35T						.						70.0	66.0	67.0					18																	65181841		2203	4299	6502	SO:0001583	missense	92126	exon2			ATTAACGCCATGA	AF480435	CCDS11995.1	18q22.1	2007-01-29	2007-01-29	2007-01-29	ENSG00000171451	ENSG00000171451			18144	protein-coding gene	gene with protein product		611125	"""chromosome 18 open reading frame 4"""	C18orf4		16505484	Standard	NM_032160		Approved	NCAG1, FLJ11477	uc002lke.1	Q8IZU8	OTTHUMG00000132804	ENST00000310045.7:c.35C>T	chr18.hg19:g.65181841G>A	ENSP00000310565:p.Ala12Val	168.0	0.0		160.0	9.0	NM_032160	Q17RH1|Q6P5Z3	Missense_Mutation	SNP	ENST00000310045.7	hg19	CCDS11995.1	.	.	.	.	.	.	.	.	.	.	G	29.7	5.030696	0.93575	.	.	ENSG00000171451	ENST00000310045;ENST00000397964	T	0.24538	1.85	5.01	5.01	0.66863	.	0.305004	0.30320	U	0.009881	T	0.44456	0.1294	L	0.41236	1.265	0.51012	D	0.999906	D	0.89917	1.0	D	0.78314	0.991	T	0.42548	-0.9445	10	0.87932	D	0	-0.1329	18.3235	0.90246	0.0:0.0:1.0:0.0	.	2	Q8IZU8	DSEL_HUMAN	V	12;2	ENSP00000310565:A12V	ENSP00000310565:A12V	A	-	2	0	DSEL	63332821	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	8.134000	0.89606	2.332000	0.79248	0.561000	0.74099	GCG	.	.		0.393	DSEL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256221.1	NM_032160	
TMEM259	91304	hgsc.bcm.edu	37	19	1011186	1011186	+	Missense_Mutation	SNP	T	T	C	rs369432576		TCGA-2Y-A9H6-01A-11D-A38X-10	TCGA-2Y-A9H6-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ee12965-26aa-443a-b8de-f4a79dc3e857	b27b338e-86e5-4131-83cf-206c52b809b7	g.chr19:1011186T>C	ENST00000356663.3	-	10	1347	c.1226A>G	c.(1225-1227)tAt>tGt	p.Y409C	TMEM259_ENST00000333175.5_Intron	NM_001033026.1	NP_001028198.1	Q4ZIN3	MBRL_HUMAN	transmembrane protein 259	409						cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)											GTGGTAGAGATAGAAGAACCT	0.662																																					p.Y409C		Atlas-SNP	.											.	.	.	.	0			c.A1226G						.		CYS/TYR,	2,4388		0,2,2193	35.0	32.0	33.0		1226,	4.2	1.0	19		33	0,8592		0,0,4296	no	missense,intron	C19orf6	NM_001033026.1,NM_033420.3	194,	0,2,6489	CC,CT,TT		0.0,0.0456,0.0154	probably-damaging,	409/621,	1011186	2,12980	2195	4296	6491	SO:0001583	missense	91304	exon10			TAGAGATAGAAGA	BC008957	CCDS12052.1, CCDS32862.1	19p13.3	2013-02-06	2013-02-06	2013-02-06	ENSG00000182087	ENSG00000182087			17039	protein-coding gene	gene with protein product	"""membralin"", ""aspecific BCL2 ARE-binding protein 1"""	611011	"""chromosome 19 open reading frame 6"""	C19orf6		12638133, 16084606	Standard	XM_005259675		Approved	MGC4022, ASBABP1, MBRL	uc002lqr.1	Q4ZIN3		ENST00000356663.3:c.1226A>G	chr19.hg19:g.1011186T>C	ENSP00000349087:p.Tyr409Cys	102.0	0.0		58.0	11.0	NM_001033026	O60392|Q8NF79|Q96H30	Missense_Mutation	SNP	ENST00000356663.3	hg19	CCDS32862.1	.	.	.	.	.	.	.	.	.	.	t	17.50	3.404275	0.62288	4.56E-4	0.0	ENSG00000182087	ENST00000356663	.	.	.	4.17	4.17	0.49024	.	0.000000	0.85682	U	0.000000	T	0.74997	0.3790	L	0.61036	1.89	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.77593	-0.2530	9	0.72032	D	0.01	-12.1875	12.4368	0.55604	0.0:0.0:0.0:1.0	.	409	Q4ZIN3	MBRL_HUMAN	C	409	.	ENSP00000349087:Y409C	Y	-	2	0	C19orf6	962186	1.000000	0.71417	1.000000	0.80357	0.669000	0.39330	3.650000	0.54424	1.531000	0.49152	0.319000	0.21371	TAT	.	.		0.662	TMEM259-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000458236.1	NM_033420	
PRR19	284338	hgsc.bcm.edu	37	19	42814219	42814219	+	Missense_Mutation	SNP	C	C	G			TCGA-2Y-A9H6-01A-11D-A38X-10	TCGA-2Y-A9H6-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ee12965-26aa-443a-b8de-f4a79dc3e857	b27b338e-86e5-4131-83cf-206c52b809b7	g.chr19:42814219C>G	ENST00000499536.2	+	1	1294	c.483C>G	c.(481-483)ttC>ttG	p.F161L	PRR19_ENST00000598490.1_Missense_Mutation_p.F161L|PRR19_ENST00000341747.3_Missense_Mutation_p.F161L			A6NJB7	PRR19_HUMAN	proline rich 19	161										NS(1)|kidney(1)|large_intestine(2)|lung(2)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	10		Prostate(69;0.00682)				CACAGGCCTTCCCCCGGAGGA	0.637																																					p.F161L		Atlas-SNP	.											.	PRR19	30	.	0			c.C483G						.						50.0	50.0	50.0					19																	42814219		2203	4300	6503	SO:0001583	missense	284338	exon2			GGCCTTCCCCCGG	AK124116	CCDS33036.1	19q13.2	2007-12-17				ENSG00000188368			33728	protein-coding gene	gene with protein product							Standard	NM_199285		Approved	MGC70924	uc002oti.3	A6NJB7		ENST00000499536.2:c.483C>G	chr19.hg19:g.42814219C>G	ENSP00000445247:p.Phe161Leu	67.0	0.0		61.0	14.0	NM_199285	A8K663|B3KW48|Q6P584	Missense_Mutation	SNP	ENST00000499536.2	hg19	CCDS33036.1	.	.	.	.	.	.	.	.	.	.	C	16.97	3.269207	0.59540	.	.	ENSG00000188368	ENST00000341747;ENST00000499536	.	.	.	4.86	1.47	0.22746	.	0.000000	0.48767	D	0.000179	T	0.47192	0.1432	L	0.34521	1.04	0.30497	N	0.770786	D;D	0.76494	0.996;0.999	D;D	0.83275	0.99;0.996	T	0.46925	-0.9156	9	0.87932	D	0	-14.1294	7.2696	0.26250	0.0:0.7177:0.0:0.2823	.	161;161	A6NJB7;A6NJB7-2	PRR19_HUMAN;.	L	161	.	ENSP00000342709:F161L	F	+	3	2	PRR19	47506059	0.996000	0.38824	1.000000	0.80357	0.756000	0.42949	0.048000	0.14078	0.325000	0.23359	-0.150000	0.13652	TTC	.	.		0.637	PRR19-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463735.1	NM_199285	
PPFIA3	8541	hgsc.bcm.edu	37	19	49651354	49651354	+	Silent	SNP	C	C	T			TCGA-2Y-A9H6-01A-11D-A38X-10	TCGA-2Y-A9H6-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ee12965-26aa-443a-b8de-f4a79dc3e857	b27b338e-86e5-4131-83cf-206c52b809b7	g.chr19:49651354C>T	ENST00000334186.4	+	24	3199	c.2850C>T	c.(2848-2850)ggC>ggT	p.G950G	PPFIA3_ENST00000602351.1_Silent_p.G941G	NM_003660.2	NP_003651.1	O75145	LIPA3_HUMAN	protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 3	950					cell-matrix adhesion (GO:0007160)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|presynaptic active zone (GO:0048786)				NS(1)|breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(4)|liver(2)|lung(16)|pancreas(1)|prostate(1)|skin(4)|urinary_tract(1)	35		all_lung(116;3.16e-06)|Lung NSC(112;6.25e-06)|all_neural(266;0.0189)|Ovarian(192;0.0392)		all cancers(93;2.36e-05)|OV - Ovarian serous cystadenocarcinoma(262;0.000203)|GBM - Glioblastoma multiforme(486;0.00307)|Epithelial(262;0.00677)		TGGCATATGGCGACATGAACC	0.617																																					p.G950G		Atlas-SNP	.											.	PPFIA3	71	.	0			c.C2850T						.						63.0	63.0	63.0					19																	49651354		2203	4300	6503	SO:0001819	synonymous_variant	8541	exon24			ATATGGCGACATG	AF034800	CCDS12758.1	19q13.33	2013-09-23			ENSG00000177380	ENSG00000177380		"""Sterile alpha motif (SAM) domain containing"""	9247	protein-coding gene	gene with protein product	"""protein tyrosine phosphatase, receptor type, f polypeptide, alpha 3"", ""liprin-alpha 3"", ""liprin"""	603144				9624153, 9734811	Standard	NM_003660		Approved	KIAA0654, LPNA3, MGC126567, MGC126569	uc002pmr.3	O75145	OTTHUMG00000183213	ENST00000334186.4:c.2850C>T	chr19.hg19:g.49651354C>T		149.0	0.0		165.0	43.0	NM_003660	A8K142|Q3MJA0|Q9H8B5|Q9UEW4	Silent	SNP	ENST00000334186.4	hg19	CCDS12758.1																																																																																			.	.		0.617	PPFIA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465688.1	NM_003660	
NLRP12	91662	hgsc.bcm.edu	37	19	54313990	54313990	+	Missense_Mutation	SNP	C	C	T			TCGA-2Y-A9H6-01A-11D-A38X-10	TCGA-2Y-A9H6-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ee12965-26aa-443a-b8de-f4a79dc3e857	b27b338e-86e5-4131-83cf-206c52b809b7	g.chr19:54313990C>T	ENST00000324134.6	-	3	1091	c.923G>A	c.(922-924)gGa>gAa	p.G308E	NLRP12_ENST00000351894.4_Missense_Mutation_p.G308E|NLRP12_ENST00000391773.1_Missense_Mutation_p.G308E|NLRP12_ENST00000391775.3_Missense_Mutation_p.G308E|NLRP12_ENST00000345770.5_Missense_Mutation_p.G308E|NLRP12_ENST00000391772.1_Missense_Mutation_p.G308E|NLRP12_ENST00000354278.3_Missense_Mutation_p.G308E|NLRP12_ENST00000535162.1_Missense_Mutation_p.G308E	NM_001277126.1|NM_144687.2	NP_001264055.1|NP_653288.1	P59046	NAL12_HUMAN	NLR family, pyrin domain containing 12	308	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|cellular response to cytokine stimulus (GO:0071345)|dendritic cell migration (GO:0036336)|negative regulation of cytokine secretion (GO:0050710)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-1 secretion (GO:0050711)|negative regulation of interleukin-6 biosynthetic process (GO:0045409)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of NIK/NF-kappaB signaling (GO:1901223)|negative regulation of protein autophosphorylation (GO:0031953)|negative regulation of signal transduction (GO:0009968)|negative regulation of Toll signaling pathway (GO:0045751)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interleukin-1 beta secretion (GO:0050718)|positive regulation of MHC class I biosynthetic process (GO:0045345)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043122)|regulation of interleukin-18 biosynthetic process (GO:0045381)|release of cytoplasmic sequestered NF-kappaB (GO:0008588)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)	p.G308V(1)		NS(1)|breast(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|liver(1)|lung(36)|ovary(5)|pancreas(2)|skin(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	80	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(134;0.026)		GCACCAGGGTCCCTGAGGATC	0.577																																					p.C308Y		Atlas-SNP	.											NLRP12_ENST00000345770,NS,carcinoma,0,2	NLRP12	236	.	1	Substitution - Missense(1)	lung(1)	c.G923A						.						46.0	48.0	47.0					19																	54313990		2203	4300	6503	SO:0001583	missense	91662	exon3			CAGGGTCCCTGAG	AY095146	CCDS12864.1, CCDS62784.1, CCDS62785.1	19q13.42	2014-09-17	2006-12-08	2006-12-08	ENSG00000142405	ENSG00000142405		"""Nucleotide-binding domain and leucine rich repeat containing"""	22938	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 12"""	609648	"""NACHT, leucine rich repeat and PYD containing 12"""	NALP12		12563287, 12019269	Standard	NM_001277129		Approved	RNO2, PYPAF7, Monarch1, PAN6, CLR19.3	uc002qcj.5	P59046	OTTHUMG00000060776	ENST00000324134.6:c.923G>A	chr19.hg19:g.54313990C>T	ENSP00000319377:p.Gly308Glu	100.0	0.0		99.0	14.0	NM_144687	A8MTQ2|B3KTE7|Q8NEU4|Q9BY26	Missense_Mutation	SNP	ENST00000324134.6	hg19	CCDS12864.1	.	.	.	.	.	.	.	.	.	.	C	6.165	0.398558	0.11696	.	.	ENSG00000142405	ENST00000324134;ENST00000535162;ENST00000351894;ENST00000354278;ENST00000391775;ENST00000391773;ENST00000345770;ENST00000391772	T;T;T;T;T;T;T	0.74106	-0.75;-0.78;-0.81;-0.81;-0.79;-0.75;-0.78	4.47	2.28	0.28536	NACHT nucleoside triphosphatase (1);	0.158996	0.29692	N	0.011453	T	0.47469	0.1447	N	0.02420	-0.555	0.09310	N	0.999999	P;P;P;P	0.49559	0.925;0.811;0.811;0.846	P;P;P;P	0.46389	0.489;0.489;0.489;0.515	T	0.46925	-0.9156	10	0.12103	T	0.63	.	7.5178	0.27610	0.0:0.7813:0.0:0.2187	.	308;308;308;308	F2Z321;A8K407;A8MTQ2;P59046	.;.;.;NAL12_HUMAN	E	308	ENSP00000319377:G308E;ENSP00000438030:G308E;ENSP00000340473:G308E;ENSP00000346231:G308E;ENSP00000375655:G308E;ENSP00000375653:G308E;ENSP00000375652:G308E	ENSP00000319377:G308E	G	-	2	0	NLRP12	59005802	0.000000	0.05858	0.452000	0.26994	0.850000	0.48378	-0.914000	0.04038	1.025000	0.39708	0.306000	0.20318	GGA	.	.		0.577	NLRP12-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000134340.1	NM_144687	
RPN2	6185	hgsc.bcm.edu	37	20	35866808	35866808	+	Intron	SNP	C	C	A			TCGA-2Y-A9H6-01A-11D-A38X-10	TCGA-2Y-A9H6-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ee12965-26aa-443a-b8de-f4a79dc3e857	b27b338e-86e5-4131-83cf-206c52b809b7	g.chr20:35866808C>A	ENST00000237530.6	+	16	2194				RPN2_ENST00000470352.1_Intron|RPN2_ENST00000373622.5_Silent_p.I597I	NM_002951.3	NP_002942.2	P04844	RPN2_HUMAN	ribophorin II						aging (GO:0007568)|cellular protein metabolic process (GO:0044267)|cellular protein modification process (GO:0006464)|gene expression (GO:0010467)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|response to drug (GO:0042493)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)	autophagic vacuole membrane (GO:0000421)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)|oligosaccharyltransferase complex (GO:0008250)|rough endoplasmic reticulum (GO:0005791)	ribosome binding (GO:0043022)|transferase activity, transferring glycosyl groups (GO:0016757)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(7)|ovary(2)|pancreas(1)|skin(2)|stomach(1)	24		Myeloproliferative disorder(115;0.00878)				TTGGCAGGATCGCTGCAGAGC	0.502																																					p.I597I		Atlas-SNP	.											.	RPN2	45	.	0			c.C1791A						.						59.0	49.0	52.0					20																	35866808		1568	3582	5150	SO:0001627	intron_variant	6185	exon16			CAGGATCGCTGCA	Y00282	CCDS13291.1, CCDS46599.1	20q12-q13.1	2013-03-06			ENSG00000118705	ENSG00000118705			10382	protein-coding gene	gene with protein product	"""oligosaccharyltransferase complex subunit (non-catalytic)"""	180490					Standard	NM_002951		Approved	SWP1, RPNII, RIBIIR, RPN-II	uc002xgp.3	P04844	OTTHUMG00000032409	ENST00000237530.6:c.1883+1696C>A	chr20.hg19:g.35866808C>A		76.0	0.0		127.0	40.0	NM_001135771	Q5JYR6|Q6IBA5|Q96E21|Q9BUQ3|Q9UBE1	Silent	SNP	ENST00000237530.6	hg19	CCDS13291.1																																																																																			.	.		0.502	RPN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079076.2	NM_002951	
MAGEC1	9947	hgsc.bcm.edu	37	X	140995873	140995873	+	Missense_Mutation	SNP	G	G	A			TCGA-2Y-A9H6-01A-11D-A38X-10	TCGA-2Y-A9H6-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ee12965-26aa-443a-b8de-f4a79dc3e857	b27b338e-86e5-4131-83cf-206c52b809b7	g.chrX:140995873G>A	ENST00000285879.4	+	4	2969	c.2683G>A	c.(2683-2685)Gag>Aag	p.E895K	MAGEC1_ENST00000406005.2_Intron	NM_005462.4	NP_005453.2	O60732	MAGC1_HUMAN	melanoma antigen family C, 1	895										breast(3)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(22)|lung(60)|ovary(1)|pancreas(1)|prostate(1)|skin(7)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(1)	127	Acute lymphoblastic leukemia(192;6.56e-05)					GACAGACAGCGAGTCCTTGAT	0.478										HNSCC(15;0.026)																											p.E895K		Atlas-SNP	.											.	MAGEC1	317	.	0			c.G2683A						.						167.0	170.0	169.0					X																	140995873		2203	4300	6503	SO:0001583	missense	9947	exon4			GACAGCGAGTCCT	AF064589	CCDS35417.1	Xq26	2009-03-18			ENSG00000155495	ENSG00000155495			6812	protein-coding gene	gene with protein product	"""cancer/testis antigen family 7, member 1"""	300223				9485030, 9618514	Standard	NM_005462		Approved	MAGE-C1, CT7, MGC39366, CT7.1	uc004fbt.3	O60732	OTTHUMG00000022569	ENST00000285879.4:c.2683G>A	chrX.hg19:g.140995873G>A	ENSP00000285879:p.Glu895Lys	99.0	0.0		206.0	70.0	NM_005462	A0PK03|O75451|Q8TCV4	Missense_Mutation	SNP	ENST00000285879.4	hg19	CCDS35417.1	.	.	.	.	.	.	.	.	.	.	g	8.301	0.819868	0.16678	.	.	ENSG00000155495	ENST00000285879	T	0.02085	4.46	0.724	-1.45	0.08828	.	.	.	.	.	T	0.01320	0.0043	N	0.19112	0.55	0.19300	N	0.999974	P	0.52463	0.953	B	0.37346	0.247	T	0.44590	-0.9318	8	0.59425	D	0.04	.	.	.	.	.	895	O60732	MAGC1_HUMAN	K	895	ENSP00000285879:E895K	ENSP00000285879:E895K	E	+	1	0	MAGEC1	140823539	0.003000	0.15002	0.000000	0.03702	0.011000	0.07611	-0.290000	0.08354	-0.970000	0.03569	0.279000	0.19357	GAG	.	.		0.478	MAGEC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058604.1	NM_005462	
MAGEA5	4104	hgsc.bcm.edu	37	X	151283912	151283912	+	RNA	SNP	T	T	A			TCGA-2Y-A9H6-01A-11D-A38X-10	TCGA-2Y-A9H6-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ee12965-26aa-443a-b8de-f4a79dc3e857	b27b338e-86e5-4131-83cf-206c52b809b7	g.chrX:151283912T>A	ENST00000509345.2	-	0	424																											CTCCTGCTCCTCAGTAGTGGC	0.622																																					p.E34V		Atlas-SNP	.											.	.	.	.	0			c.A101T						.						45.0	47.0	46.0					X																	151283912		2203	4300	6503			0	exon4			TGCTCCTCAGTAG																													chrX.hg19:g.151283912T>A		164.0	0.0		291.0	111.0	NM_001204811		Missense_Mutation	SNP	ENST00000509345.2	hg19																																																																																				.	.		0.622	RP11-1007I13.4-001	KNOWN	basic|readthrough_transcript	processed_transcript	processed_transcript	OTTHUMT00000445981.1		
ZNF275	10838	hgsc.bcm.edu	37	X	152612617	152612617	+	Silent	SNP	C	C	T	rs370281502		TCGA-2Y-A9H6-01A-11D-A38X-10	TCGA-2Y-A9H6-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ee12965-26aa-443a-b8de-f4a79dc3e857	b27b338e-86e5-4131-83cf-206c52b809b7	g.chrX:152612617C>T	ENST00000421401.3	+	4	651	c.474C>T	c.(472-474)ccC>ccT	p.P158P	ZNF275_ENST00000370249.2_Silent_p.P105P|ZNF275_ENST00000370251.3_Silent_p.P158P|ZNF275_ENST00000440091.1_Silent_p.P188P			Q9NSD4	ZN275_HUMAN	zinc finger protein 275	158					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(5)|large_intestine(4)|lung(4)|ovary(1)|prostate(1)|urinary_tract(1)	16	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					AGCCCCAGCCCGGCCCCAGTA	0.612																																					p.P158P		Atlas-SNP	.											.	ZNF275	44	.	0			c.C474T						.	C		1,3497		0,1,1463,570	31.0	34.0	33.0		474	-9.7	0.0	X		33	0,6512		0,0,2358,1796	no	coding-synonymous	ZNF275	NM_001080485.3		0,1,3821,2366	TT,TC,CC,C		0.0,0.0286,0.01		158/330	152612617	1,10009	2034	4154	6188	SO:0001819	synonymous_variant	10838	exon4			CCAGCCCGGCCCC	BC041602		Xq28	2013-01-08			ENSG00000063587	ENSG00000063587		"""Zinc fingers, C2H2-type"", ""-"""	13069	protein-coding gene	gene with protein product							Standard	NM_001080485		Approved		uc004fhg.2	Q9NSD4	OTTHUMG00000067450	ENST00000421401.3:c.474C>T	chrX.hg19:g.152612617C>T		203.0	0.0		237.0	74.0	NM_001080485	A6NE92	Silent	SNP	ENST00000421401.3	hg19																																																																																				.	.		0.612	ZNF275-201	KNOWN	basic	protein_coding	protein_coding		NM_001080485	
MT-ND6	4541	hgsc.bcm.edu	37	M	14393	14393	+	Missense_Mutation	SNP	A	A	G			TCGA-2Y-A9H6-01A-11D-A38X-10	TCGA-2Y-A9H6-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ee12965-26aa-443a-b8de-f4a79dc3e857	b27b338e-86e5-4131-83cf-206c52b809b7	g.chrM:14393A>G	ENST00000361681.2	-	1	280	c.281T>C	c.(280-282)gTg>gCg	p.V94A	MT-CYB_ENST00000361789.2_5'Flank|MT-TS2_ENST00000387449.1_RNA|MT-TL2_ENST00000387456.1_RNA|MT-TP_ENST00000387461.2_RNA|MT-TH_ENST00000387441.1_RNA|MT-TE_ENST00000387459.1_RNA|MT-TT_ENST00000387460.2_RNA			P03923	NU6M_HUMAN	mitochondrially encoded NADH dehydrogenase 6	94					cellular metabolic process (GO:0044237)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|respiratory chain (GO:0070469)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(1)|endometrium(10)|kidney(17)|urinary_tract(1)	29						TCGCTAACCCCACTAAAACAC	0.468																																					p.V94A		Atlas-SNP	.											.	.	.	.	0			c.T281C						.																																			SO:0001583	missense	0	exon1			AACCCCACTAAAA			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198695	ENSG00000198695	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7462	protein-coding gene	gene with protein product	"""complex I ND6 subunit"", ""NADH-ubiquinone oxidoreductase chain 6"""	516006	"""NADH dehydrogenase 6"""	MTND6			Standard			Approved	NAD6, ND6		P03923		ENST00000361681.2:c.281T>C	chrM.hg19:g.14393A>G	ENSP00000354665:p.Val94Ala	25.0	0.0		65.0	6.0	ENST00000361681	Q34774|Q8HG30	Missense_Mutation	SNP	ENST00000361681.2	hg19																																																																																				.	.		0.468	MT-ND6-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024037	
KANSL3	55683	hgsc.bcm.edu	37	2	97274706	97274708	+	In_Frame_Del	DEL	CTT	CTT	-			TCGA-2Y-A9H6-01A-11D-A38X-10	TCGA-2Y-A9H6-10A-01D-A38X-10	CTT	CTT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ee12965-26aa-443a-b8de-f4a79dc3e857	b27b338e-86e5-4131-83cf-206c52b809b7	g.chr2:97274706_97274708delCTT	ENST00000431828.1	-	13	1553_1555	c.1477_1479delAAG	c.(1477-1479)aagdel	p.K493del	KANSL3_ENST00000440133.1_In_Frame_Del_p.K287del|KANSL3_ENST00000441706.2_In_Frame_Del_p.K406del|KANSL3_ENST00000599854.1_In_Frame_Del_p.K406del|KANSL3_ENST00000487070.1_5'UTR			Q9P2N6	KANL3_HUMAN	KAT8 regulatory NSL complex subunit 3	493					chromatin organization (GO:0006325)|histone H4-K16 acetylation (GO:0043984)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)	histone acetyltransferase complex (GO:0000123)|intracellular membrane-bounded organelle (GO:0043231)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)											CATCGCGGGGCTTCTTCTTCTTC	0.601																																					p.493_494del		Atlas-Indel,Pindel	.											.	.	.	.	0			c.1478_1480del						.																																			SO:0001651	inframe_deletion	55683	exon13			.	BC063792	CCDS46361.1	2q11.2	2011-10-31	2011-10-31	2011-10-31	ENSG00000114982	ENSG00000114982			25473	protein-coding gene	gene with protein product			"""KIAA1310"""	KIAA1310			Standard	NM_001115016		Approved	FLJ10081, Rcd1, NSL3	uc002swn.5	Q9P2N6	OTTHUMG00000155249	ENST00000431828.1:c.1477_1479delAAG	chr2.hg19:g.97274715_97274717delCTT	ENSP00000396749:p.Lys493del	123.0	0.0		148.0	38.0	NM_001115016	A1L184|D3DXH3|D3DXH4|Q05BU4|Q6P3X2|Q6PJH6|Q86T19|Q96L64|Q9H0C9|Q9H8C9|Q9HAP8|Q9NWE5	In_Frame_Del	DEL	ENST00000431828.1	hg19	CCDS46361.1																																																																																			.	.		0.601	KANSL3-009	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339040.2	NM_017991	
RAD51B	5890	hgsc.bcm.edu	37	14	68331792	68331802	+	Frame_Shift_Del	DEL	AACATGGGAGG	AACATGGGAGG	-			TCGA-2Y-A9H6-01A-11D-A38X-10	TCGA-2Y-A9H6-10A-01D-A38X-10	AACATGGGAGG	AACATGGGAGG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ee12965-26aa-443a-b8de-f4a79dc3e857	b27b338e-86e5-4131-83cf-206c52b809b7	g.chr14:68331792_68331802delAACATGGGAGG	ENST00000487270.1	+	5	436_446	c.388_398delAACATGGGAGG	c.(388-399)aacatgggaggafs	p.NMGG130fs	RAD51B_ENST00000390683.3_Frame_Shift_Del_p.NMGG130fs|RAD51B_ENST00000471583.1_Frame_Shift_Del_p.NMGG130fs|RAD51B_ENST00000487861.1_Frame_Shift_Del_p.NMGG130fs|RAD51B_ENST00000488612.1_Frame_Shift_Del_p.NMGG130fs	NM_133509.3	NP_598193.2	O15315	RA51B_HUMAN	RAD51 paralog B	130					ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|double-strand break repair via homologous recombination (GO:0000724)|positive regulation of G2/M transition of mitotic cell cycle (GO:0010971)|reciprocal meiotic recombination (GO:0007131)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Rad51B-Rad51C-Rad51D-XRCC2 complex (GO:0033063)|replication fork (GO:0005657)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|double-stranded DNA binding (GO:0003690)|single-stranded DNA binding (GO:0003697)		HMGA2/RAD51B(11)	breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(4)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	11						ATTACCCACCAACATGGGAGGATTAGAAGGA	0.318								Direct reversal of damage																													p.129_133del		Atlas-INDEL	.											.	RAD51B	80	.	0			c.387_397del						.																																			SO:0001589	frameshift_variant	5890	exon5			.	U84138	CCDS9789.1, CCDS9790.1	14q23-q24.2	2013-07-02	2013-07-02	2011-07-01	ENSG00000182185	ENSG00000182185			9822	protein-coding gene	gene with protein product		602948	"""RAD51 (S. cerevisiae)-like 1"", ""RAD51-like 1 (S. cerevisiae)"", ""RAD51 homolog B (S. cerevisiae)"""	RAD51L1		6261043, 9207106	Standard	NM_002877		Approved	REC2, hREC2, R51H2	uc001xkf.2	O15315	OTTHUMG00000157530	ENST00000487270.1:c.388_398delAACATGGGAGG	chr14.hg19:g.68331792_68331802delAACATGGGAGG	ENSP00000419471:p.Asn130fs	66.0	0.0		62.0	10.0	NM_002877	O60914|O75210|Q3Y4F8|Q6FHX8|Q86SY3|Q86SY4|Q86TR0|Q86U92|Q86U93|Q86U94|Q8N6H4|Q9UPL5	Frame_Shift_Del	DEL	ENST00000487270.1	hg19	CCDS9789.1																																																																																			.	.		0.318	RAD51B-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000349063.1		
PHF7	51533	hgsc.bcm.edu	37	3	52442001	52442005	+	5'Flank	DEL	CTTCA	CTTCA	-			TCGA-2Y-A9H6-01A-11D-A38X-10	TCGA-2Y-A9H6-10A-01D-A38X-10	CTTCA	CTTCA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ee12965-26aa-443a-b8de-f4a79dc3e857	b27b338e-86e5-4131-83cf-206c52b809b7	g.chr3:52442001_52442005delCTTCA	ENST00000327906.3	+	0	0				BAP1_ENST00000296288.5_Frame_Shift_Del_p.MK115fs|BAP1_ENST00000460680.1_Frame_Shift_Del_p.MK115fs	NM_016483.4	NP_057567.3	Q9BWX1	PHF7_HUMAN	PHD finger protein 7							Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	zinc ion binding (GO:0008270)			breast(2)|large_intestine(4)|lung(3)	9				BRCA - Breast invasive adenocarcinoma(193;1.71e-05)|Kidney(197;0.00178)|KIRC - Kidney renal clear cell carcinoma(197;0.00201)|OV - Ovarian serous cystadenocarcinoma(275;0.0275)		TGGTGAAGTCCTTCATGCGACTCAG	0.576																																					p.115_117del		Atlas-Indel,Pindel	.											.	BAP1	371	.	0			c.345_349del						.																																			SO:0001631	upstream_gene_variant	8314	exon5			.	AY014283	CCDS2854.1, CCDS2855.1	3p21.31	2013-01-28			ENSG00000010318	ENSG00000010318		"""Zinc fingers, PHD-type"""	18458	protein-coding gene	gene with protein product						11042152, 11829468	Standard	NM_016483		Approved	NYD-SP6, HSPC226	uc003ddy.3	Q9BWX1	OTTHUMG00000158495		chr3.hg19:g.52442001_52442005delCTTCA	Exception_encountered	271.0	0.0		151.0	67.0	NM_004656	K4DI82	Frame_Shift_Del	DEL	ENST00000327906.3	hg19	CCDS2854.1																																																																																			.	.		0.576	PHF7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351155.1	NM_016483	
RASA1	5921	hgsc.bcm.edu	37	5	86672234	86672234	+	Frame_Shift_Del	DEL	G	G	-			TCGA-2Y-A9H6-01A-11D-A38X-10	TCGA-2Y-A9H6-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ee12965-26aa-443a-b8de-f4a79dc3e857	b27b338e-86e5-4131-83cf-206c52b809b7	g.chr5:86672234delG	ENST00000274376.6	+	16	2600	c.2036delG	c.(2035-2037)cgafs	p.R679fs	CTC-428H11.2_ENST00000607486.1_RNA|RASA1_ENST00000456692.2_Frame_Shift_Del_p.R502fs|RASA1_ENST00000506290.1_Frame_Shift_Del_p.R513fs|RASA1_ENST00000512763.1_Frame_Shift_Del_p.R512fs	NM_002890.2	NP_002881.1	P20936	RASA1_HUMAN	RAS p21 protein activator (GTPase activating protein) 1	679					blood vessel morphogenesis (GO:0048514)|embryo development (GO:0009790)|intracellular signal transduction (GO:0035556)|mitotic cytokinesis (GO:0000281)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of Ras GTPase activity (GO:0032320)|regulation of actin filament polymerization (GO:0030833)|regulation of cell shape (GO:0008360)|regulation of RNA metabolic process (GO:0051252)|signal transduction (GO:0007165)|vasculogenesis (GO:0001570)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|ruffle (GO:0001726)	glycoprotein binding (GO:0001948)|GTPase binding (GO:0051020)|potassium channel inhibitor activity (GO:0019870)|Ras GTPase activator activity (GO:0005099)|receptor binding (GO:0005102)			NS(1)|cervix(1)|endometrium(7)|kidney(4)|large_intestine(12)|lung(13)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	48		all_cancers(142;8.25e-07)|Lung NSC(167;0.000185)|all_lung(232;0.000222)|Colorectal(57;0.00542)|Ovarian(174;0.0423)		OV - Ovarian serous cystadenocarcinoma(54;4.72e-41)|Epithelial(54;1.51e-36)|all cancers(79;3.76e-31)		CAGTTGAGCCGATTACAGAAA	0.418																																					p.R679fs		Atlas-Indel,Pindel	.											.	RASA1	213	.	0			c.2035delC						.						90.0	86.0	87.0					5																	86672234		2203	4300	6503	SO:0001589	frameshift_variant	5921	exon16			.		CCDS34200.1, CCDS47243.1	5q13	2013-02-14			ENSG00000145715	ENSG00000145715		"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	9871	protein-coding gene	gene with protein product	"""capillary malformation-arteriovenous malformation"""	139150		RASA		15917201	Standard	NM_022650		Approved	GAP, CM-AVM, p120GAP, p120RASGAP	uc003kiw.3	P20936	OTTHUMG00000162605	ENST00000274376.6:c.2036delG	chr5.hg19:g.86672234delG	ENSP00000274376:p.Arg679fs	59.0	0.0		148.0	52.0	NM_002890	B2R6W3|Q9UDI1	Frame_Shift_Del	DEL	ENST00000274376.6	hg19	CCDS34200.1																																																																																			.	.		0.418	RASA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000369729.1	NM_002890	
MBD1	4152	hgsc.bcm.edu	37	18	47800628	47800639	+	In_Frame_Del	DEL	GTCGCAGCAGAA	GTCGCAGCAGAA	-	rs115570375		TCGA-2Y-A9H6-01A-11D-A38X-10	TCGA-2Y-A9H6-10A-01D-A38X-10	GTCGCAGCAGAA	GTCGCAGCAGAA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ee12965-26aa-443a-b8de-f4a79dc3e857	b27b338e-86e5-4131-83cf-206c52b809b7	g.chr18:47800628_47800639delGTCGCAGCAGAA	ENST00000591416.1	-	11	1494_1505	c.1063_1074delTTCTGCTGCGAC	c.(1063-1074)ttctgctgcgacdel	p.FCCD355del	MBD1_ENST00000269468.5_In_Frame_Del_p.FCCD355del|MBD1_ENST00000587605.1_Intron|MBD1_ENST00000382948.5_In_Frame_Del_p.FCCD355del|MBD1_ENST00000588937.1_In_Frame_Del_p.FCCD332del|MBD1_ENST00000457839.2_In_Frame_Del_p.FCCD380del|MBD1_ENST00000347968.3_Intron|MBD1_ENST00000269471.5_In_Frame_Del_p.FCCD332del|MBD1_ENST00000590208.1_In_Frame_Del_p.FCCD355del|MBD1_ENST00000585672.1_In_Frame_Del_p.FCCD305del|MBD1_ENST00000339998.6_In_Frame_Del_p.FCCD355del|MBD1_ENST00000591535.1_In_Frame_Del_p.FCCD332del|MBD1_ENST00000398495.2_Intron|MBD1_ENST00000398488.1_Intron|MBD1_ENST00000424334.2_In_Frame_Del_p.FCCD406del|MBD1_ENST00000436910.1_In_Frame_Del_p.FCCD332del|MBD1_ENST00000349085.2_Intron|MBD1_ENST00000398493.1_Intron|MBD1_ENST00000585595.1_In_Frame_Del_p.FCCD380del|MBD1_ENST00000353909.3_In_Frame_Del_p.FCCD306del			Q9UIS9	MBD1_HUMAN	methyl-CpG binding domain protein 1	355					negative regulation of transcription, DNA-templated (GO:0045892)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|heterochromatin (GO:0000792)|nuclear matrix (GO:0016363)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	DNA binding (GO:0003677)|methyl-CpG binding (GO:0008327)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(5)|lung(14)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	36						ATTTGGGCTTGTCGCAGCAGAAGTCGCAGCGG	0.651																																					p.380_384del		Atlas-Indel,Pindel	.											MBD1_ENST00000457839,colon,carcinoma,0,4	MBD1	228	.	0			c.1139_1150del						.																																			SO:0001651	inframe_deletion	4152	exon12			.	Y10746	CCDS11941.1, CCDS11942.1, CCDS11943.1, CCDS11944.1, CCDS32832.1, CCDS56071.1, CCDS56072.1, CCDS56073.1, CCDS59318.1, CCDS59319.1, CCDS59320.1	18q21	2014-02-18			ENSG00000141644	ENSG00000141644			6916	protein-coding gene	gene with protein product		156535				9207790, 10441743	Standard	NM_015844		Approved	PCM1, CXXC3	uc002lem.4	Q9UIS9	OTTHUMG00000132669	ENST00000591416.1:c.1063_1074delTTCTGCTGCGAC	chr18.hg19:g.47800628_47800639delGTCGCAGCAGAA	ENSP00000467017:p.Phe355_Asp358del	169.0	0.0		108.0	15.0	NM_001204137	A4UTZ0|B4DXJ5|E9PEC5|K7ELI2|K7EQZ4|K7ESN0|O15248|O95241|Q7Z7B5|Q8N4W4|Q9UNZ6|Q9UNZ7|Q9UNZ8|Q9UNZ9	In_Frame_Del	DEL	ENST00000591416.1	hg19	CCDS11943.1																																																																																			.	.		0.651	MBD1-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000255926.3	NM_015846	
ZNF717	100131827	hgsc.bcm.edu	37	3	75790811	75790812	+	Frame_Shift_Ins	INS	-	-	T	rs199577560	byFrequency	TCGA-2Y-A9H6-01A-11D-A38X-10	TCGA-2Y-A9H6-10A-01D-A38X-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8ee12965-26aa-443a-b8de-f4a79dc3e857	b27b338e-86e5-4131-83cf-206c52b809b7	g.chr3:75790811_75790812insT	ENST00000477374.1	-	3	304_305	c.133_134insA	c.(133-135)accfs	p.T45fs	ZNF717_ENST00000422325.1_Frame_Shift_Ins_p.T45fs|ZNF717_ENST00000491507.1_5'UTR|ZNF717_ENST00000400845.3_Frame_Shift_Ins_p.T38fs|ZNF717_ENST00000478296.1_5'UTR			Q9BY31	ZN717_HUMAN	zinc finger protein 717	38	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			autonomic_ganglia(6)|endometrium(3)|lung(2)|ovary(1)|stomach(7)	19						CCTGTACAGGGTCCTCTGAGCA	0.515																																					p.T45fs		Atlas-INDEL	.											.	ZNF717	160	.	0			c.134_135insA						.			370,2012		79,212,900						-0.5	1.0			21	1420,4414		306,808,1803	no	frameshift	ZNF717	NM_001128223.1		385,1020,2703	A1A1,A1R,RR		24.3401,15.5332,21.7868				1790,6426				SO:0001589	frameshift_variant	100131827	exon3			.	AF226994		3p12.3	2013-01-08			ENSG00000227124	ENSG00000227124		"""Zinc fingers, C2H2-type"", ""-"""	29448	protein-coding gene	gene with protein product			"""zinc finger protein 838"""	ZNF838			Standard	NM_001128223		Approved	X17	uc011bgi.2	Q9BY31	OTTHUMG00000158965	ENST00000477374.1:c.134dupA	chr3.hg19:g.75790812_75790812dupT	ENSP00000417902:p.Thr45fs	28.0	0.0		80.0	12.0	NM_001128223		Frame_Shift_Ins	INS	ENST00000477374.1	hg19																																																																																				.	.		0.515	ZNF717-005	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000352767.1	NM_001128223	
