#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
SPEN	23013	hgsc.bcm.edu	37	1	16263693	16263693	+	Silent	SNP	T	T	G	rs549209393	byFrequency	TCGA-2Y-A9H7-01A-11D-A38X-10	TCGA-2Y-A9H7-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e447e430-664c-4a56-9017-620aef1f0ffb	b2219bf0-50ab-4c4d-a22d-6b2a5c4bb365	g.chr1:16263693T>G	ENST00000375759.3	+	12	10266	c.10062T>G	c.(10060-10062)ccT>ccG	p.P3354P		NM_015001.2	NP_055816.2	Q96T58	MINT_HUMAN	spen family transcriptional repressor	3354	Pro-rich.				negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|positive regulation of neurogenesis (GO:0050769)|positive regulation of transcription, DNA-templated (GO:0045893)|viral process (GO:0016032)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)|single-stranded DNA binding (GO:0003697)|transcription corepressor activity (GO:0003714)			NS(1)|breast(13)|central_nervous_system(3)|cervix(5)|endometrium(16)|kidney(18)|large_intestine(27)|liver(2)|lung(37)|ovary(7)|prostate(7)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	149		Colorectal(325;0.000258)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|Colorectal(212;5.96e-07)|COAD - Colon adenocarcinoma(227;3.11e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000115)|Kidney(64;0.000212)|KIRC - Kidney renal clear cell carcinoma(64;0.003)|STAD - Stomach adenocarcinoma(313;0.013)|READ - Rectum adenocarcinoma(331;0.0681)		TGCAGCCTCCTCAGCCTGTGC	0.647																																					p.P3354P		Atlas-SNP	.											.	SPEN	374	.	0			c.T10062G						.						46.0	52.0	50.0					1																	16263693		2203	4298	6501	SO:0001819	synonymous_variant	23013	exon12			GCCTCCTCAGCCT		CCDS164.1	1p36	2013-10-17	2013-10-17		ENSG00000065526	ENSG00000065526		"""RNA binding motif (RRM) containing"""	17575	protein-coding gene	gene with protein product		613484	"""SPEN homolog, transcriptional regulator (Drosophila)"", ""spen homolog, transcriptional regulator (Drosophila)"""			10451362, 11331609	Standard	NM_015001		Approved	KIAA0929, MINT, SHARP, RBM15C	uc001axk.1	Q96T58	OTTHUMG00000009376	ENST00000375759.3:c.10062T>G	chr1.hg19:g.16263693T>G		79.0	0.0		40.0	19.0	NM_015001	Q9H9A8|Q9NWH5|Q9UQ01|Q9Y556	Silent	SNP	ENST00000375759.3	hg19	CCDS164.1																																																																																			.	.		0.647	SPEN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025993.1	NM_015001	
MAST2	23139	hgsc.bcm.edu	37	1	46499912	46499912	+	Missense_Mutation	SNP	G	G	A	rs368958391		TCGA-2Y-A9H7-01A-11D-A38X-10	TCGA-2Y-A9H7-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e447e430-664c-4a56-9017-620aef1f0ffb	b2219bf0-50ab-4c4d-a22d-6b2a5c4bb365	g.chr1:46499912G>A	ENST00000361297.2	+	28	4125	c.3842G>A	c.(3841-3843)cGg>cAg	p.R1281Q	MAST2_ENST00000372009.2_Missense_Mutation_p.R1188Q	NM_015112.2	NP_055927.2			microtubule associated serine/threonine kinase 2											breast(1)|lung(3)|ovary(5)|stomach(2)	11	Acute lymphoblastic leukemia(166;0.155)|Lung SC(450;0.184)					CAAGGCTACCGGGTGACCCCC	0.582																																					p.R1281Q		Atlas-SNP	.											.	MAST2	136	.	0			c.G3842A						.		GLN/ARG	0,3910		0,0,1955	58.0	62.0	60.0		3842	4.8	1.0	1		60	1,8309		0,1,4154	no	missense	MAST2	NM_015112.2	43	0,1,6109	AA,AG,GG		0.012,0.0,0.0082	probably-damaging	1281/1799	46499912	1,12219	1955	4155	6110	SO:0001583	missense	23139	exon28			GCTACCGGGTGAC	AB047005	CCDS41326.1	1p34.1	2008-02-05			ENSG00000086015	ENSG00000086015			19035	protein-coding gene	gene with protein product		612257					Standard	NM_015112		Approved	MAST205, KIAA0807	uc001cov.3	Q6P0Q8	OTTHUMG00000008007	ENST00000361297.2:c.3842G>A	chr1.hg19:g.46499912G>A	ENSP00000354671:p.Arg1281Gln	66.0	0.0		46.0	31.0	NM_015112		Missense_Mutation	SNP	ENST00000361297.2	hg19	CCDS41326.1	.	.	.	.	.	.	.	.	.	.	g	28.7	4.945700	0.92593	0.0	1.2E-4	ENSG00000086015	ENST00000361297;ENST00000372009	T;T	0.39056	1.1;1.1	4.84	4.84	0.62591	.	0.170176	0.48767	D	0.000168	T	0.68128	0.2967	M	0.83118	2.625	0.42403	D	0.992574	D;D	0.89917	1.0;1.0	D;D	0.87578	0.92;0.998	T	0.72388	-0.4309	10	0.46703	T	0.11	-1.3506	17.9868	0.89158	0.0:0.0:1.0:0.0	.	1188;1281	E7ERL6;Q6P0Q8	.;MAST2_HUMAN	Q	1281;1188	ENSP00000354671:R1281Q;ENSP00000361079:R1188Q	ENSP00000354671:R1281Q	R	+	2	0	MAST2	46272499	1.000000	0.71417	0.979000	0.43373	0.870000	0.49936	7.883000	0.87264	2.221000	0.72209	0.552000	0.68991	CGG	.	.		0.582	MAST2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021977.1	NM_015112	
SELENBP1	8991	hgsc.bcm.edu	37	1	151337513	151337513	+	Missense_Mutation	SNP	C	C	T	rs544356174		TCGA-2Y-A9H7-01A-11D-A38X-10	TCGA-2Y-A9H7-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e447e430-664c-4a56-9017-620aef1f0ffb	b2219bf0-50ab-4c4d-a22d-6b2a5c4bb365	g.chr1:151337513C>T	ENST00000368868.5	-	11	1236	c.1145G>A	c.(1144-1146)cGg>cAg	p.R382Q	SELENBP1_ENST00000435071.1_Missense_Mutation_p.R318Q|SELENBP1_ENST00000426705.2_Missense_Mutation_p.R424Q|SELENBP1_ENST00000473693.1_5'Flank|SELENBP1_ENST00000447402.3_Missense_Mutation_p.R320Q	NM_003944.3	NP_003935.2	Q13228	SBP1_HUMAN	selenium binding protein 1	382					protein transport (GO:0015031)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	selenium binding (GO:0008430)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(11)|prostate(1)|urinary_tract(1)	20	Lung SC(34;0.00471)|Ovarian(49;0.00871)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.112)|LUSC - Lung squamous cell carcinoma(543;0.181)			TCCAGCCACCCGTTTTCCCTT	0.577													C|||	1	0.000199681	0.0	0.0	5008	,	,		19581	0.001		0.0	False		,,,				2504	0.0				p.R424Q		Atlas-SNP	.											.	SELENBP1	44	.	0			c.G1271A						.						39.0	34.0	36.0					1																	151337513		2203	4300	6503	SO:0001583	missense	8991	exon11			GCCACCCGTTTTC	U29091	CCDS995.1, CCDS58027.1, CCDS60266.1	1q21.3	2014-05-19			ENSG00000143416	ENSG00000143416			10719	protein-coding gene	gene with protein product		604188				9027582	Standard	NM_003944		Approved	hSP56, hSBP, LPSB	uc010pcy.3	Q13228	OTTHUMG00000012498	ENST00000368868.5:c.1145G>A	chr1.hg19:g.151337513C>T	ENSP00000357861:p.Arg382Gln	73.0	0.0		99.0	25.0	NM_001258289	A6NML9|A6PVW9|B2RDR3|B4DKP6|B4E1F3|Q49AQ8|Q96GX7	Missense_Mutation	SNP	ENST00000368868.5	hg19	CCDS995.1	.	.	.	.	.	.	.	.	.	.	C	15.98	2.992901	0.54041	.	.	ENSG00000143416	ENST00000368868;ENST00000447402;ENST00000435071	.	.	.	4.52	1.55	0.23275	WD40/YVTN repeat-like-containing domain (1);	0.340561	0.26742	N	0.022731	T	0.46386	0.1390	M	0.85630	2.765	0.47441	D	0.999424	B;B;B;B	0.22276	0.016;0.067;0.007;0.014	B;B;B;B	0.24541	0.003;0.054;0.015;0.015	T	0.49504	-0.8933	9	0.45353	T	0.12	-9.4969	7.0869	0.25261	0.0:0.6317:0.0:0.3683	.	320;235;318;382	B4E1F3;B4DPI7;Q13228-2;Q13228	.;.;.;SBP1_HUMAN	Q	382;320;318	.	ENSP00000357861:R382Q	R	-	2	0	SELENBP1	149604137	0.000000	0.05858	0.872000	0.34217	0.984000	0.73092	-0.181000	0.09740	0.534000	0.28695	0.655000	0.94253	CGG	.	.		0.577	SELENBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034904.4		
PRR9	574414	hgsc.bcm.edu	37	1	153190633	153190633	+	Nonsense_Mutation	SNP	G	G	T			TCGA-2Y-A9H7-01A-11D-A38X-10	TCGA-2Y-A9H7-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e447e430-664c-4a56-9017-620aef1f0ffb	b2219bf0-50ab-4c4d-a22d-6b2a5c4bb365	g.chr1:153190633G>T	ENST00000368744.3	+	2	69	c.13G>T	c.(13-15)Gag>Tag	p.E5*		NM_001195571.1	NP_001182500.1	Q5T870	PRR9_HUMAN	proline rich 9	5										prostate(1)	1						GTCCTTCAGTGAGCAGCAGTG	0.507																																					p.E5X		Atlas-SNP	.											.	PRR9	1	.	0			c.G13T						.																																			SO:0001587	stop_gained	574414	exon2			TTCAGTGAGCAGC	AL161636	CCDS55639.1	1q21.3	2008-07-02			ENSG00000203783	ENSG00000203783			32057	protein-coding gene	gene with protein product							Standard	NM_001195571		Approved		uc021ozw.1	Q5T870	OTTHUMG00000013936	ENST00000368744.3:c.13G>T	chr1.hg19:g.153190633G>T	ENSP00000357733:p.Glu5*	93.0	0.0		162.0	101.0	NM_001195571		Nonsense_Mutation	SNP	ENST00000368744.3	hg19	CCDS55639.1	.	.	.	.	.	.	.	.	.	.	G	25.7	4.662644	0.88251	.	.	ENSG00000203783	ENST00000368744	.	.	.	5.5	4.59	0.56863	.	0.106595	0.40144	N	0.001172	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.59425	D	0.04	-11.3748	10.5555	0.45114	0.0892:0.0:0.9108:0.0	.	.	.	.	X	5	.	ENSP00000357733:E5X	E	+	1	0	PRR9	151457257	0.807000	0.29009	0.892000	0.35008	0.714000	0.41099	2.992000	0.49417	1.323000	0.45263	0.467000	0.42956	GAG	.	.		0.507	PRR9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039105.1		
SPTA1	6708	hgsc.bcm.edu	37	1	158648224	158648224	+	Missense_Mutation	SNP	A	A	G	rs121918634		TCGA-2Y-A9H7-01A-11D-A38X-10	TCGA-2Y-A9H7-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e447e430-664c-4a56-9017-620aef1f0ffb	b2219bf0-50ab-4c4d-a22d-6b2a5c4bb365	g.chr1:158648224A>G	ENST00000368147.4	-	6	959	c.779T>C	c.(778-780)cTg>cCg	p.L260P		NM_003126.2	NP_003117.2	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	260			L -> P (in EL2; Nigerian). {ECO:0000269|PubMed:2794061}.		actin filament capping (GO:0051693)|actin filament organization (GO:0007015)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|lymphocyte homeostasis (GO:0002260)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of protein binding (GO:0032092)|positive regulation of T cell proliferation (GO:0042102)|regulation of cell shape (GO:0008360)	actin cytoskeleton (GO:0015629)|cuticular plate (GO:0032437)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)			NS(3)|breast(7)|cervix(1)|endometrium(22)|kidney(9)|large_intestine(29)|liver(2)|lung(183)|ovary(5)|prostate(18)|skin(11)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(6)	307	all_hematologic(112;0.0378)					AGCATTGGACAGAGCTTTCTG	0.428																																					p.L260P		Atlas-SNP	.											.	SPTA1	720	.	0			c.T779C	GRCh37	CM890108	SPTA1	M	rs121918634	.						120.0	111.0	114.0					1																	158648224		1870	4115	5985	SO:0001583	missense	6708	exon6			TTGGACAGAGCTT	M61877	CCDS41423.1	1q21	2014-06-23	2014-06-23		ENSG00000163554	ENSG00000163554		"""EF-hand domain containing"""	11272	protein-coding gene	gene with protein product	"""elliptocytosis 2"""	182860	"""spectrin, alpha, erythrocytic 1 (elliptocytosis 2)"""				Standard	NM_003126		Approved	EL2	uc001fst.1	P02549	OTTHUMG00000019636	ENST00000368147.4:c.779T>C	chr1.hg19:g.158648224A>G	ENSP00000357129:p.Leu260Pro	55.0	0.0		109.0	36.0	NM_003126	Q15514|Q5VYL1|Q5VYL2|Q6LDY5	Missense_Mutation	SNP	ENST00000368147.4	hg19	CCDS41423.1	.	.	.	.	.	.	.	.	.	.	A	15.52	2.859325	0.51376	.	.	ENSG00000163554	ENST00000368148;ENST00000368147	T;T	0.80909	-1.43;-1.43	4.66	4.66	0.58398	.	0.000000	0.26439	N	0.024363	D	0.90421	0.7001	M	0.93462	3.42	0.80722	A	1	D	0.89917	1.0	D	0.97110	1.0	D	0.93002	0.6424	9	0.87932	D	0	.	13.3542	0.60619	1.0:0.0:0.0:0.0	.	260	P02549	SPTA1_HUMAN	P	260	ENSP00000357130:L260P;ENSP00000357129:L260P	ENSP00000357129:L260P	L	-	2	0	SPTA1	156914848	1.000000	0.71417	0.203000	0.23512	0.130000	0.20726	8.035000	0.88872	2.080000	0.62538	0.528000	0.53228	CTG	.	.		0.428	SPTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051851.3	NM_003126	
DNM3	26052	hgsc.bcm.edu	37	1	172356496	172356496	+	Missense_Mutation	SNP	G	G	T			TCGA-2Y-A9H7-01A-11D-A38X-10	TCGA-2Y-A9H7-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e447e430-664c-4a56-9017-620aef1f0ffb	b2219bf0-50ab-4c4d-a22d-6b2a5c4bb365	g.chr1:172356496G>T	ENST00000355305.5	+	19	2457	c.2300G>T	c.(2299-2301)cGc>cTc	p.R767L	DNM3_ENST00000358155.4_Missense_Mutation_p.R761L|DNM3_ENST00000367731.1_Missense_Mutation_p.R757L			Q9UQ16	DYN3_HUMAN	dynamin 3	767					endocytosis (GO:0006897)|filopodium assembly (GO:0046847)|GTP catabolic process (GO:0006184)|synapse assembly (GO:0007416)	dendritic spine (GO:0043197)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|mitochondrion (GO:0005739)|perinuclear region of cytoplasm (GO:0048471)|postsynaptic density (GO:0014069)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			NS(1)|breast(3)|endometrium(1)|kidney(1)|large_intestine(9)|lung(16)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	37						CAGCACTCTCGCAGGTAAGAA	0.617																																					p.R761L		Atlas-SNP	.											.	DNM3	85	.	0			c.G2282T						.						21.0	22.0	22.0					1																	172356496		2006	4160	6166	SO:0001583	missense	26052	exon19			ACTCTCGCAGGTA	AL136712	CCDS44276.1, CCDS60356.1	1q24.1	2013-01-10			ENSG00000197959	ENSG00000197959		"""Pleckstrin homology (PH) domain containing"""	29125	protein-coding gene	gene with protein product	"""Dyna III"""	611445				10048485	Standard	NM_015569		Approved	KIAA0820	uc001gie.4	Q9UQ16	OTTHUMG00000034913	ENST00000355305.5:c.2300G>T	chr1.hg19:g.172356496G>T	ENSP00000347457:p.Arg767Leu	80.0	0.0		148.0	45.0	NM_015569	A9Z1Y1|O14982|O95555|Q1MTM8|Q5W129|Q6P2G1|Q9H0P3|Q9H548|Q9NQ68|Q9NQN6	Missense_Mutation	SNP	ENST00000355305.5	hg19		.	.	.	.	.	.	.	.	.	.	G	14.13	2.442639	0.43326	.	.	ENSG00000197959	ENST00000359070;ENST00000358155;ENST00000355305;ENST00000367731;ENST00000485254	D;D;D;T	0.92595	-3.07;-3.07;-3.07;-0.66	5.04	5.04	0.67666	.	0.227351	0.31949	N	0.006809	D	0.83050	0.5170	L	0.61218	1.895	0.80722	D	1	P;B;B	0.38110	0.618;0.235;0.235	B;B;B	0.32864	0.145;0.067;0.154	T	0.81504	-0.0903	10	0.19590	T	0.45	.	10.9111	0.47110	0.0881:0.0:0.9119:0.0	.	767;757;761	Q9UQ16;Q9UQ16-2;Q9UQ16-3	DYN3_HUMAN;.;.	L	771;761;767;757;130	ENSP00000350876:R761L;ENSP00000347457:R767L;ENSP00000356705:R757L;ENSP00000429165:R130L	ENSP00000347457:R767L	R	+	2	0	DNM3	170623119	0.997000	0.39634	1.000000	0.80357	0.886000	0.51366	-0.229000	0.09098	2.507000	0.84556	0.585000	0.79938	CGC	.	.		0.617	DNM3-003	NOVEL	not_organism_supported|basic	protein_coding	protein_coding	OTTHUMT00000084531.1	NM_015569	
NFASC	23114	hgsc.bcm.edu	37	1	204913476	204913476	+	Missense_Mutation	SNP	T	T	G			TCGA-2Y-A9H7-01A-11D-A38X-10	TCGA-2Y-A9H7-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e447e430-664c-4a56-9017-620aef1f0ffb	b2219bf0-50ab-4c4d-a22d-6b2a5c4bb365	g.chr1:204913476T>G	ENST00000401399.1	+	2	232	c.33T>G	c.(31-33)caT>caG	p.H11Q	NFASC_ENST00000367170.4_Missense_Mutation_p.H11Q|NFASC_ENST00000338515.6_Missense_Mutation_p.H11Q|NFASC_ENST00000338586.6_Missense_Mutation_p.H11Q|NFASC_ENST00000403080.1_Missense_Mutation_p.H11Q|NFASC_ENST00000367169.4_Missense_Mutation_p.H11Q|NFASC_ENST00000367171.4_Missense_Mutation_p.H11Q|NFASC_ENST00000404907.1_Missense_Mutation_p.H11Q|NFASC_ENST00000360049.4_Missense_Mutation_p.H11Q|NFASC_ENST00000404076.1_Missense_Mutation_p.H11Q|NFASC_ENST00000339876.6_Missense_Mutation_p.H11Q|NFASC_ENST00000367172.4_Missense_Mutation_p.H11Q|NFASC_ENST00000539706.1_Missense_Mutation_p.H11Q|NFASC_ENST00000513543.1_Missense_Mutation_p.H11Q			O94856	NFASC_HUMAN	neurofascin	11					axon guidance (GO:0007411)|clustering of voltage-gated sodium channels (GO:0045162)|heterotypic cell-cell adhesion (GO:0034113)|myelination (GO:0042552)|paranodal junction assembly (GO:0030913)|peripheral nervous system development (GO:0007422)|protein localization to juxtaparanode region of axon (GO:0071205)|protein localization to paranode region of axon (GO:0002175)|synapse organization (GO:0050808)|transmission of nerve impulse (GO:0019226)	axon initial segment (GO:0043194)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|node of Ranvier (GO:0033268)|paranodal junction (GO:0033010)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)				NS(1)|breast(4)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|liver(1)|lung(24)|ovary(3)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)	81	all_cancers(21;0.0375)|Breast(84;0.0437)|all_epithelial(62;0.171)|Prostate(682;0.19)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.158)			CCTGGGTCCATGCAGCCTTCC	0.592																																					p.H11Q		Atlas-SNP	.											.	NFASC	396	.	0			c.T33G						.						47.0	43.0	44.0					1																	204913476		2203	4300	6503	SO:0001583	missense	23114	exon3			GGTCCATGCAGCC	AK027553	CCDS30982.1, CCDS53460.1, CCDS53461.1, CCDS53462.1	1q32.1	2013-02-11	2010-06-24		ENSG00000163531	ENSG00000163531		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	29866	protein-coding gene	gene with protein product		609145	"""neurofascin homolog (chicken)"""			1377696, 8672144	Standard	NM_015090		Approved	NRCAML, KIAA0756, FLJ46866, NF	uc001hbj.3	O94856	OTTHUMG00000151697	ENST00000401399.1:c.33T>G	chr1.hg19:g.204913476T>G	ENSP00000385637:p.His11Gln	63.0	0.0		83.0	49.0	NM_015090	B2RNN8|B3KQZ1|B5MDP6|B5MDR6|B7ZMD8|Q149P5|Q5T2F0|Q5T2F1|Q5T2F2|Q5T2F3|Q5T2F4|Q5T2F5|Q5T2F6|Q5T2F7|Q5T2F9|Q5T2G0|Q5W9F8|Q68DH3|Q6ZQV6|Q7Z3K1|Q96HT1|Q96K50	Missense_Mutation	SNP	ENST00000401399.1	hg19	CCDS53460.1	.	.	.	.	.	.	.	.	.	.	T	9.470	1.095264	0.20471	.	.	ENSG00000163531	ENST00000367172;ENST00000367171;ENST00000367170;ENST00000338515;ENST00000339876;ENST00000338586;ENST00000295776;ENST00000539706;ENST00000360049;ENST00000367169;ENST00000446412;ENST00000403080;ENST00000404076;ENST00000401399;ENST00000505079;ENST00000404907;ENST00000513543	T;T;T;T;T;T;T;T;T;T;T;T;T;D;T;T	0.84660	0.0;-0.06;0.0;0.01;-0.0;-0.0;0.06;0.08;0.03;-0.48;-0.47;-0.04;-0.0;-1.88;0.06;0.08	5.33	-4.8	0.03190	.	0.393107	0.18882	N	0.128542	T	0.69984	0.3172	N	0.08118	0	0.09310	N	1	B;B;B;P;B;B	0.37573	0.002;0.0;0.003;0.6;0.0;0.068	B;B;B;B;B;B	0.43728	0.006;0.001;0.001;0.429;0.0;0.017	T	0.65837	-0.6071	10	0.21540	T	0.41	.	12.4975	0.55937	0.0:0.3576:0.0:0.6424	.	11;11;113;11;11;11	O94856-11;O94856-8;B4DRH7;O94856-9;O94856-3;O94856-2	.;.;.;.;.;.	Q	11	ENSP00000356140:H11Q;ENSP00000356139:H11Q;ENSP00000356138:H11Q;ENSP00000342128:H11Q;ENSP00000344786:H11Q;ENSP00000343509:H11Q;ENSP00000438614:H11Q;ENSP00000353154:H11Q;ENSP00000356137:H11Q;ENSP00000412161:H11Q;ENSP00000384875:H11Q;ENSP00000385676:H11Q;ENSP00000385637:H11Q;ENSP00000427586:H11Q;ENSP00000384061:H11Q;ENSP00000425908:H11Q	ENSP00000295776:H11Q	H	+	3	2	NFASC	203180099	0.000000	0.05858	0.023000	0.16930	0.769000	0.43574	-2.069000	0.01381	-0.788000	0.04504	-0.337000	0.08149	CAT	.	.		0.592	NFASC-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000131237.1	NM_001005388	
CNIH4	29097	hgsc.bcm.edu	37	1	224559054	224559054	+	Silent	SNP	G	G	A	rs143487399		TCGA-2Y-A9H7-01A-11D-A38X-10	TCGA-2Y-A9H7-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e447e430-664c-4a56-9017-620aef1f0ffb	b2219bf0-50ab-4c4d-a22d-6b2a5c4bb365	g.chr1:224559054G>A	ENST00000465271.1	+	4	396	c.321G>A	c.(319-321)ctG>ctA	p.L107L	CNIH4_ENST00000366858.3_Intron|CNIH4_ENST00000366857.5_Intron|CNIH4_ENST00000468318.1_3'UTR|CNIH4_ENST00000366856.3_Silent_p.L107L	NM_014184.3	NP_054903.1	Q9P003	CNIH4_HUMAN	cornichon family AMPA receptor auxiliary protein 4	107					intracellular signal transduction (GO:0035556)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				kidney(3)|lung(2)|ovary(2)	7				GBM - Glioblastoma multiforme(131;0.00341)		GAGGGCAGCTGAAGTCACACA	0.398																																					p.L107L		Atlas-SNP	.											.	CNIH4	17	.	0			c.G321A						.						209.0	187.0	195.0					1																	224559054		2203	4300	6503	SO:0001819	synonymous_variant	29097	exon4			GCAGCTGAAGTCA		CCDS1543.1, CCDS60429.1, CCDS60430.1	1q42.12	2013-08-28	2013-08-28		ENSG00000143771	ENSG00000143771			25013	protein-coding gene	gene with protein product			"""cornichon homolog 4 (Drosophila)"""			11042152	Standard	NM_014184		Approved	HSPC163	uc001hom.2	Q9P003	OTTHUMG00000037635	ENST00000465271.1:c.321G>A	chr1.hg19:g.224559054G>A		107.0	0.0		171.0	46.0	NM_014184	A8K1Q8|B2R553|Q9H0X8	Silent	SNP	ENST00000465271.1	hg19	CCDS1543.1																																																																																			.	G|1.000;C|0.000		0.398	CNIH4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000091754.1	NM_014184	
RYR2	6262	hgsc.bcm.edu	37	1	237947690	237947690	+	Silent	SNP	G	G	A			TCGA-2Y-A9H7-01A-11D-A38X-10	TCGA-2Y-A9H7-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e447e430-664c-4a56-9017-620aef1f0ffb	b2219bf0-50ab-4c4d-a22d-6b2a5c4bb365	g.chr1:237947690G>A	ENST00000366574.2	+	90	12995	c.12678G>A	c.(12676-12678)ccG>ccA	p.P4226P	RYR2_ENST00000609119.1_3'UTR|RYR2_ENST00000542537.1_Silent_p.P4210P|RYR2_ENST00000360064.6_Silent_p.P4232P	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	4226					BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)	p.P4224P(1)		NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			AGGAGAGGCCGGAAGAGCAGG	0.547																																					p.P4226P		Atlas-SNP	.											RYR2,NS,carcinoma,+1,1	RYR2	1273	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G12678A						.						59.0	66.0	64.0					1																	237947690		1978	4163	6141	SO:0001819	synonymous_variant	6262	exon90			GAGGCCGGAAGAG	X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.12678G>A	chr1.hg19:g.237947690G>A		100.0	0.0		181.0	98.0	NM_001035	Q15411|Q546N8|Q5T3P2	Silent	SNP	ENST00000366574.2	hg19	CCDS55691.1																																																																																			.	.		0.547	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095402.2	NM_001035	
EIF2B4	8890	hgsc.bcm.edu	37	2	27587708	27587708	+	Missense_Mutation	SNP	G	G	A			TCGA-2Y-A9H7-01A-11D-A38X-10	TCGA-2Y-A9H7-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e447e430-664c-4a56-9017-620aef1f0ffb	b2219bf0-50ab-4c4d-a22d-6b2a5c4bb365	g.chr2:27587708G>A	ENST00000347454.4	-	12	1420	c.1249C>T	c.(1249-1251)Cgg>Tgg	p.R417W	EIF2B4_ENST00000451130.2_Missense_Mutation_p.R437W|EIF2B4_ENST00000493344.2_Missense_Mutation_p.R438W|AC074117.10_ENST00000412749.1_RNA|EIF2B4_ENST00000445933.2_Missense_Mutation_p.R416W	NM_001034116.1|NM_015636.3	NP_001029288.1|NP_056451.3	Q9UI10	EI2BD_HUMAN	eukaryotic translation initiation factor 2B, subunit 4 delta, 67kDa	417					cellular protein metabolic process (GO:0044267)|cellular response to stimulus (GO:0051716)|gene expression (GO:0010467)|myelination (GO:0042552)|negative regulation of translational initiation (GO:0045947)|negative regulation of translational initiation in response to stress (GO:0032057)|oligodendrocyte development (GO:0014003)|ovarian follicle development (GO:0001541)|positive regulation of GTPase activity (GO:0043547)|regulation of translation (GO:0006417)|regulation of translational initiation (GO:0006446)|response to glucose (GO:0009749)|response to heat (GO:0009408)|response to peptide hormone (GO:0043434)|translation (GO:0006412)|translational initiation (GO:0006413)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|eukaryotic translation initiation factor 2B complex (GO:0005851)	translation initiation factor activity (GO:0003743)|translation initiation factor binding (GO:0031369)			breast(1)|cervix(1)|endometrium(1)|kidney(1)|lung(5)|skin(1)	10	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GTCCCTACCCGTGACATCACA	0.493																																					p.R437W		Atlas-SNP	.											.	EIF2B4	48	.	0			c.C1309T						.						76.0	68.0	70.0					2																	27587708		2203	4300	6503	SO:0001583	missense	8890	exon11			CTACCCGTGACAT	AJ011306	CCDS33164.1, CCDS46244.1, CCDS46245.1	2p23.3	2008-02-05	2002-08-29		ENSG00000115211	ENSG00000115211			3260	protein-coding gene	gene with protein product		606687	"""eukaryotic translation initiation factor 2B, subunit 4 (delta, 67kD)"""			8929216, 7982969	Standard	NM_172195		Approved	EIF2Bdelta, EIF-2B, DKFZP586J0119, EIF2B	uc002rjz.3	Q9UI10	OTTHUMG00000151927	ENST00000347454.4:c.1249C>T	chr2.hg19:g.27587708G>A	ENSP00000233552:p.Arg417Trp	107.0	0.0		145.0	8.0	NM_172195	Q53RY7|Q5BJF4|Q9BUV9|Q9UBG4|Q9UIQ9|Q9UJ95	Missense_Mutation	SNP	ENST00000347454.4	hg19	CCDS33164.1	.	.	.	.	.	.	.	.	.	.	G	19.29	3.798255	0.70567	.	.	ENSG00000115211	ENST00000347454;ENST00000414437;ENST00000445933;ENST00000451130;ENST00000493344	D;D;D;D	0.93488	-3.23;-3.23;-3.23;-3.23	4.9	1.9	0.25705	.	0.052587	0.85682	D	0.000000	D	0.97139	0.9065	M	0.94021	3.485	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.999;0.998;0.998	D	0.97373	0.9977	10	0.87932	D	0	-9.7662	13.0216	0.58791	0.0:0.0:0.5844:0.4156	.	414;416;417;437	F5H6W1;Q9UI10-3;Q9UI10;Q9UI10-2	.;.;EI2BD_HUMAN;.	W	417;414;416;437;438	ENSP00000233552:R417W;ENSP00000394397:R416W;ENSP00000394869:R437W;ENSP00000429323:R438W	ENSP00000233552:R417W	R	-	1	2	EIF2B4	27441212	1.000000	0.71417	0.921000	0.36526	0.988000	0.76386	5.486000	0.66856	0.625000	0.30304	-0.182000	0.12963	CGG	.	.		0.493	EIF2B4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000324448.1		
SLC8A1	6546	hgsc.bcm.edu	37	2	40387905	40387905	+	Splice_Site	SNP	C	C	A			TCGA-2Y-A9H7-01A-11D-A38X-10	TCGA-2Y-A9H7-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e447e430-664c-4a56-9017-620aef1f0ffb	b2219bf0-50ab-4c4d-a22d-6b2a5c4bb365	g.chr2:40387905C>A	ENST00000403092.1	-	9	2302	c.2269G>T	c.(2269-2271)Ggg>Tgg	p.G757W	SLC8A1-AS1_ENST00000444629.1_RNA|SLC8A1-AS1_ENST00000599268.1_RNA|SLC8A1-AS1_ENST00000597385.1_RNA|SLC8A1_ENST00000542756.1_Splice_Site_p.G752W|SLC8A1_ENST00000405901.3_Splice_Site_p.G752W|SLC8A1-AS1_ENST00000599740.1_RNA|SLC8A1-AS1_ENST00000593878.1_RNA|SLC8A1-AS1_ENST00000593848.1_RNA|SLC8A1_ENST00000402441.1_Splice_Site_p.G721W|SLC8A1_ENST00000542024.1_Splice_Site_p.G721W|SLC8A1_ENST00000406391.2_Splice_Site_p.G721W|SLC8A1-AS1_ENST00000596532.1_RNA|SLC8A1-AS1_ENST00000435515.1_RNA|SLC8A1_ENST00000405269.1_Splice_Site_p.G721W|SLC8A1_ENST00000332839.4_Splice_Site_p.G757W|SLC8A1-AS1_ENST00000599956.1_RNA|SLC8A1_ENST00000406785.2_Splice_Site_p.G721W|SLC8A1_ENST00000408028.2_Splice_Site_p.G749W|SLC8A1-AS1_ENST00000598247.1_RNA|SLC8A1-AS1_ENST00000597170.1_RNA|SLC8A1-AS1_ENST00000601679.1_RNA			P32418	NAC1_HUMAN	solute carrier family 8 (sodium/calcium exchanger), member 1	757					blood coagulation (GO:0007596)|calcium ion export (GO:1901660)|calcium ion homeostasis (GO:0055074)|calcium ion import (GO:0070509)|calcium ion transport into cytosol (GO:0060402)|cardiac muscle cell development (GO:0055013)|cardiac muscle contraction (GO:0060048)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular response to caffeine (GO:0071313)|cellular response to reactive oxygen species (GO:0034614)|cellular sodium ion homeostasis (GO:0006883)|cytosolic calcium ion transport (GO:0060401)|embryonic heart tube development (GO:0035050)|embryonic placenta development (GO:0001892)|heart morphogenesis (GO:0003007)|ion transport (GO:0006811)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|muscle contraction (GO:0006936)|muscle fiber development (GO:0048747)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|post-embryonic development (GO:0009791)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of the force of heart contraction (GO:0002026)|relaxation of cardiac muscle (GO:0055119)|relaxation of smooth muscle (GO:0044557)|sodium ion export (GO:0071436)|sodium ion import (GO:0097369)|transmembrane transport (GO:0055085)|vascular smooth muscle contraction (GO:0014829)	basolateral plasma membrane (GO:0016323)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|calcium:sodium antiporter activity (GO:0005432)|cytoskeletal protein binding (GO:0008092)|ion channel binding (GO:0044325)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(1)|endometrium(7)|kidney(5)|large_intestine(14)|liver(1)|lung(57)|ovary(2)|pancreas(1)|skin(7)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(2)	100					Alpha-Linolenic Acid(DB00132)|Icosapent(DB00159)	AGGCACTCACCAGCACTGACA	0.443																																					p.G757W		Atlas-SNP	.											.	SLC8A1	221	.	0			c.G2269T						.						136.0	127.0	130.0					2																	40387905		2203	4300	6503	SO:0001630	splice_region_variant	6546	exon8			ACTCACCAGCACT		CCDS1806.1, CCDS46264.1, CCDS46265.1, CCDS59430.1	2p22.1	2013-07-15			ENSG00000183023	ENSG00000183023		"""Solute carriers"""	11068	protein-coding gene	gene with protein product	"""Na+/Ca++ exchanger"""	182305		NCX1		1559714	Standard	NM_021097		Approved		uc002rrx.3	P32418	OTTHUMG00000102183	ENST00000403092.1:c.2269+1G>T	chr2.hg19:g.40387905C>A		49.0	0.0		74.0	25.0	NM_021097	A8K6N1|D6W595|O95849|Q4QQG6|Q587I6|Q59GN4|Q9UBL8|Q9UD55|Q9UDN1|Q9UDN2|Q9UKX6	Missense_Mutation	SNP	ENST00000403092.1	hg19	CCDS1806.1	.	.	.	.	.	.	.	.	.	.	C	24.2	4.507187	0.85282	.	.	ENSG00000183023	ENST00000406785;ENST00000378715;ENST00000542756;ENST00000403092;ENST00000405901;ENST00000402441;ENST00000405269;ENST00000332839;ENST00000408028;ENST00000535962;ENST00000406391;ENST00000542024	T;T;T;T;T;T;T;T;T;T	0.34472	1.39;1.4;1.4;1.4;1.39;1.39;1.4;1.36;1.39;1.39	5.6	5.6	0.85130	.	0.000000	0.85682	D	0.000000	T	0.62588	0.2440	M	0.78637	2.42	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;0.999;1.0	D;D;D;D	0.97110	0.997;1.0;0.97;1.0	T	0.61978	-0.6951	9	.	.	.	.	17.4714	0.87647	0.0:1.0:0.0:0.0	.	721;744;752;757	P32418-2;P32418-3;F6VPY9;P32418	.;.;.;NAC1_HUMAN	W	721;757;752;757;752;721;721;757;749;744;721;721	ENSP00000383886:G721W;ENSP00000440727:G752W;ENSP00000384763:G757W;ENSP00000385678:G752W;ENSP00000385188:G721W;ENSP00000385535:G721W;ENSP00000332931:G757W;ENSP00000384908:G749W;ENSP00000385811:G721W;ENSP00000443515:G721W	.	G	-	1	0	SLC8A1	40241409	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	7.534000	0.82004	2.788000	0.95919	0.650000	0.86243	GGG	.	.		0.443	SLC8A1-010	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326065.1	NM_021097	Missense_Mutation
ELMOD3	84173	hgsc.bcm.edu	37	2	85590252	85590252	+	Silent	SNP	G	G	A			TCGA-2Y-A9H7-01A-11D-A38X-10	TCGA-2Y-A9H7-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e447e430-664c-4a56-9017-620aef1f0ffb	b2219bf0-50ab-4c4d-a22d-6b2a5c4bb365	g.chr2:85590252G>A	ENST00000409890.2	+	6	829	c.162G>A	c.(160-162)caG>caA	p.Q54Q	ELMOD3_ENST00000315658.7_Silent_p.Q54Q|ELMOD3_ENST00000490508.1_3'UTR|ELMOD3_ENST00000409344.3_Silent_p.Q54Q|ELMOD3_ENST00000393852.4_Silent_p.Q54Q|ELMOD3_ENST00000409013.3_Silent_p.Q54Q|ELMOD3_ENST00000428955.2_Silent_p.Q54Q			Q96FG2	ELMD3_HUMAN	ELMO/CED-12 domain containing 3	54					phagocytosis (GO:0006909)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				endometrium(1)|kidney(1)|large_intestine(3)|lung(4)|ovary(2)|prostate(1)	12						GCATTCTCCAGGCTCTGACCA	0.522																																					p.Q54Q		Atlas-SNP	.											.	ELMOD3	53	.	0			c.G162A						.						76.0	73.0	74.0					2																	85590252		2203	4300	6503	SO:0001819	synonymous_variant	84173	exon6			TCTCCAGGCTCTG	AF258573	CCDS1973.1, CCDS46352.1	2p11.2	2014-01-28	2008-08-14	2008-08-14	ENSG00000115459	ENSG00000115459		"""RNA binding motif (RRM) containing"""	26158	protein-coding gene	gene with protein product		615427	"""RNA binding motif protein 29"", ""RNA binding motif and ELMO/CED-12 domain 1"", ""deafness, autosomal recessive 88"""	RBM29, RBED1, DFNB88		24039609	Standard	NM_032213		Approved	FLJ21977	uc010ysn.2	Q96FG2	OTTHUMG00000130170	ENST00000409890.2:c.162G>A	chr2.hg19:g.85590252G>A		68.0	0.0		75.0	37.0	NM_001135022	B8ZZD6|D6W5K4|Q2M1K3|Q2XSU3|Q2XSU4|Q8NAC1|Q8TCK4|Q8WV70|Q8WY75|Q9H6Q8	Silent	SNP	ENST00000409890.2	hg19	CCDS46352.1																																																																																			.	.		0.522	ELMOD3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329124.1	NM_032213	
BAZ2B	29994	hgsc.bcm.edu	37	2	160289825	160289825	+	Missense_Mutation	SNP	G	G	C			TCGA-2Y-A9H7-01A-11D-A38X-10	TCGA-2Y-A9H7-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e447e430-664c-4a56-9017-620aef1f0ffb	b2219bf0-50ab-4c4d-a22d-6b2a5c4bb365	g.chr2:160289825G>C	ENST00000392783.2	-	9	1838	c.1343C>G	c.(1342-1344)tCg>tGg	p.S448W	BAZ2B_ENST00000355831.2_Missense_Mutation_p.S448W|BAZ2B_ENST00000343439.5_Missense_Mutation_p.S446W|BAZ2B_ENST00000392782.1_Missense_Mutation_p.S446W	NM_013450.2	NP_038478.2	Q9UIF8	BAZ2B_HUMAN	bromodomain adjacent to zinc finger domain, 2B	448					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(7)|liver(2)|lung(41)|ovary(3)|prostate(1)|skin(2)|soft_tissue(1)|urinary_tract(1)	82						CAGGCTCTTCGATGACTCTTG	0.358																																					p.S448W		Atlas-SNP	.											.	BAZ2B	196	.	0			c.C1343G						.						158.0	148.0	151.0					2																	160289825		1885	4112	5997	SO:0001583	missense	29994	exon9			CTCTTCGATGACT	AB032255	CCDS2209.2, CCDS74594.1	2q24.2	2013-01-28			ENSG00000123636	ENSG00000123636		"""Zinc fingers, PHD-type"""	963	protein-coding gene	gene with protein product		605683				10662543	Standard	XM_005246488		Approved	WALp4	uc002uao.3	Q9UIF8	OTTHUMG00000132027	ENST00000392783.2:c.1343C>G	chr2.hg19:g.160289825G>C	ENSP00000376534:p.Ser448Trp	64.0	0.0		54.0	17.0	NM_013450	D3DPA8|Q96EA1|Q96SQ8|Q9P252|Q9Y4N8	Missense_Mutation	SNP	ENST00000392783.2	hg19	CCDS2209.2	.	.	.	.	.	.	.	.	.	.	G	12.92	2.082413	0.36758	.	.	ENSG00000123636	ENST00000392782;ENST00000392783;ENST00000355831;ENST00000343439;ENST00000546335	D;D;D;D	0.88818	-2.43;-2.43;-2.43;-2.43	5.87	4.98	0.66077	.	0.482216	0.15223	U	0.273830	D	0.92990	0.7769	L	0.51422	1.61	0.53688	D	0.999978	D;D;D;D;D	0.89917	1.0;0.997;0.995;0.988;0.992	D;P;P;P;P	0.79108	0.992;0.83;0.747;0.747;0.563	D	0.92865	0.6309	10	0.87932	D	0	-2.5662	16.6818	0.85294	0.0:0.1338:0.8662:0.0	.	448;252;446;446;448	Q9UIF8-3;Q9UIF8-4;Q9UIF8-2;Q9UIF8-5;Q9UIF8	.;.;.;.;BAZ2B_HUMAN	W	446;448;448;446;385	ENSP00000376533:S446W;ENSP00000376534:S448W;ENSP00000348087:S448W;ENSP00000339670:S446W	ENSP00000339670:S446W	S	-	2	0	BAZ2B	159998071	1.000000	0.71417	0.993000	0.49108	0.995000	0.86356	3.703000	0.54808	1.452000	0.47756	0.655000	0.94253	TCG	.	.		0.358	BAZ2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255037.2		
LRP2	4036	hgsc.bcm.edu	37	2	170058284	170058284	+	Missense_Mutation	SNP	C	C	G			TCGA-2Y-A9H7-01A-11D-A38X-10	TCGA-2Y-A9H7-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e447e430-664c-4a56-9017-620aef1f0ffb	b2219bf0-50ab-4c4d-a22d-6b2a5c4bb365	g.chr2:170058284C>G	ENST00000263816.3	-	44	8591	c.8306G>C	c.(8305-8307)gGc>gCc	p.G2769A		NM_004525.2	NP_004516.2	P98164	LRP2_HUMAN	low density lipoprotein receptor-related protein 2	2769	LDL-receptor class A 17. {ECO:0000255|PROSITE-ProRule:PRU00124}.				cell proliferation (GO:0008283)|endocytosis (GO:0006897)|forebrain development (GO:0030900)|lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|protein glycosylation (GO:0006486)|receptor-mediated endocytosis (GO:0006898)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D metabolic process (GO:0042359)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)			biliary_tract(1)|breast(16)|central_nervous_system(6)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(2)|kidney(17)|large_intestine(70)|liver(1)|lung(117)|ovary(19)|pancreas(1)|prostate(2)|skin(17)|upper_aerodigestive_tract(7)|urinary_tract(13)	315				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	"""""""Insulin(DB00071)|Gentamicin(DB00798)|Insulin Regular(DB00030)|Urokinase(DB00013)"""	CTCATCACTGCCATCACCACA	0.502																																					p.G2769A		Atlas-SNP	.											.	LRP2	751	.	0			c.G8306C						.						164.0	137.0	146.0					2																	170058284		2203	4300	6503	SO:0001583	missense	4036	exon44			TCACTGCCATCAC		CCDS2232.1	2q31.1	2013-05-28	2010-01-26		ENSG00000081479	ENSG00000081479		"""Low density lipoprotein receptors"""	6694	protein-coding gene	gene with protein product	"""megalin"""	600073				7959795	Standard	NM_004525		Approved	gp330, DBS	uc002ues.3	P98164	OTTHUMG00000132179	ENST00000263816.3:c.8306G>C	chr2.hg19:g.170058284C>G	ENSP00000263816:p.Gly2769Ala	44.0	0.0		46.0	19.0	NM_004525	O00711|Q16215	Missense_Mutation	SNP	ENST00000263816.3	hg19	CCDS2232.1	.	.	.	.	.	.	.	.	.	.	C	15.38	2.815182	0.50527	.	.	ENSG00000081479	ENST00000263816	D	0.96396	-4.0	5.7	4.58	0.56647	Low-density lipoprotein (LDL) receptor class A, conserved site (1);	0.229367	0.49916	D	0.000137	D	0.94225	0.8146	L	0.54908	1.71	0.80722	D	1	B	0.22541	0.071	B	0.29353	0.101	D	0.91135	0.4941	10	0.54805	T	0.06	.	9.5885	0.39532	0.0:0.0858:0.0:0.9142	.	2769	P98164	LRP2_HUMAN	A	2769	ENSP00000263816:G2769A	ENSP00000263816:G2769A	G	-	2	0	LRP2	169766530	1.000000	0.71417	1.000000	0.80357	0.910000	0.53928	2.202000	0.42743	1.026000	0.39733	0.650000	0.86243	GGC	.	.		0.502	LRP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255231.2	NM_004525	
CCDC141	285025	hgsc.bcm.edu	37	2	179718305	179718305	+	Missense_Mutation	SNP	C	C	T			TCGA-2Y-A9H7-01A-11D-A38X-10	TCGA-2Y-A9H7-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e447e430-664c-4a56-9017-620aef1f0ffb	b2219bf0-50ab-4c4d-a22d-6b2a5c4bb365	g.chr2:179718305C>T	ENST00000420890.2	-	20	3224	c.3107G>A	c.(3106-3108)gGa>gAa	p.G1036E	CCDC141_ENST00000295723.5_Missense_Mutation_p.G461E	NM_173648.3	NP_775919.3	Q6ZP82	CC141_HUMAN	coiled-coil domain containing 141	1036										NS(2)|breast(1)|endometrium(5)|kidney(1)|large_intestine(17)|lung(37)|ovary(8)|pancreas(2)|skin(4)|upper_aerodigestive_tract(1)	78			OV - Ovarian serous cystadenocarcinoma(117;0.0274)|Epithelial(96;0.0531)|all cancers(119;0.147)			GGAATATTTTCCAACTCTTAC	0.388																																					p.G1036E		Atlas-SNP	.											CCDC141_ENST00000420890,mucosal,malignant_melanoma,0,4	CCDC141	362	.	0			c.G3107A						.						111.0	111.0	111.0					2																	179718305		2203	4300	6503	SO:0001583	missense	285025	exon20			TATTTTCCAACTC	AK096821		2q31.2	2013-01-14			ENSG00000163492	ENSG00000163492		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	26821	protein-coding gene	gene with protein product	"""coiled-coil protein associated with myosin II and DISC1"""					20956536	Standard	NM_173648		Approved	FLJ39502, CAMDI	uc002une.2	Q6ZP82	OTTHUMG00000132578	ENST00000420890.2:c.3107G>A	chr2.hg19:g.179718305C>T	ENSP00000395995:p.Gly1036Glu	55.0	0.0		104.0	37.0	NM_173648	H7C0P1|J3KNW6|Q8N8H3	Missense_Mutation	SNP	ENST00000420890.2	hg19		.	.	.	.	.	.	.	.	.	.	C	17.39	3.377901	0.61735	.	.	ENSG00000163492	ENST00000420890;ENST00000343876;ENST00000295723	T;T;T	0.31247	1.5;1.5;1.5	5.85	5.85	0.93711	.	0.000000	0.51477	D	0.000090	T	0.29976	0.0750	L	0.34521	1.04	0.37079	D	0.898886	P	0.49358	0.923	P	0.47470	0.548	T	0.06972	-1.0797	10	0.22109	T	0.4	-12.8104	14.34	0.66619	0.0:0.9295:0.0:0.0704	.	461	Q6ZP82	CC141_HUMAN	E	1036;480;461	ENSP00000395995:G1036E;ENSP00000344627:G480E;ENSP00000295723:G461E	ENSP00000295723:G461E	G	-	2	0	CCDC141	179426550	0.998000	0.40836	0.998000	0.56505	0.960000	0.62799	3.951000	0.56684	2.768000	0.95171	0.655000	0.94253	GGA	.	.		0.388	CCDC141-202	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_173648	
UNC80	285175	hgsc.bcm.edu	37	2	210778536	210778536	+	Missense_Mutation	SNP	T	T	C			TCGA-2Y-A9H7-01A-11D-A38X-10	TCGA-2Y-A9H7-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e447e430-664c-4a56-9017-620aef1f0ffb	b2219bf0-50ab-4c4d-a22d-6b2a5c4bb365	g.chr2:210778536T>C	ENST00000439458.1	+	30	4783	c.4703T>C	c.(4702-4704)tTg>tCg	p.L1568S	UNC80_ENST00000272845.6_Missense_Mutation_p.L1563S	NM_032504.1	NP_115893.1	Q8N2C7	UNC80_HUMAN	unc-80 homolog (C. elegans)	1568					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(9)|ovary(1)|prostate(1)	20						GTGATGAGCTTGTCGCCTGCT	0.473																																					p.L1568S		Atlas-SNP	.											.	UNC80	280	.	0			c.T4703C						.						189.0	142.0	156.0					2																	210778536		692	1591	2283	SO:0001583	missense	285175	exon30			TGAGCTTGTCGCC	AK090815	CCDS2387.1, CCDS46504.1, CCDS2387.2	2q35	2009-08-17	2009-08-17	2009-08-17	ENSG00000144406	ENSG00000144406			26582	protein-coding gene	gene with protein product		612636	"""chromosome 2 open reading frame 21"""	C2orf21		19092807	Standard	NM_032504		Approved	FLJ33496, KIAA1843, UNC-80	uc010zjc.1	Q8N2C7	OTTHUMG00000132963	ENST00000439458.1:c.4703T>C	chr2.hg19:g.210778536T>C	ENSP00000391088:p.Leu1568Ser	126.0	0.0		146.0	59.0	NM_032504	B2RN50|B4DQY9|B4DZB3|C4IXS8|C9J1U3|Q96JI4|Q96SS0	Missense_Mutation	SNP	ENST00000439458.1	hg19	CCDS46504.1	.	.	.	.	.	.	.	.	.	.	T	22.9	4.351277	0.82132	.	.	ENSG00000144406	ENST00000439458;ENST00000272845	T;T	0.37752	1.18;1.18	5.68	5.68	0.88126	.	0.000000	0.64402	D	0.000005	T	0.55081	0.1898	L	0.50333	1.59	0.80722	D	1	D	0.69078	0.997	D	0.78314	0.991	T	0.55872	-0.8072	10	0.59425	D	0.04	-10.3133	15.9266	0.79621	0.0:0.0:0.0:1.0	.	1568	Q8N2C7	UNC80_HUMAN	S	1568;1563	ENSP00000391088:L1568S;ENSP00000272845:L1563S	ENSP00000272845:L1563S	L	+	2	0	UNC80	210486781	1.000000	0.71417	0.999000	0.59377	0.996000	0.88848	7.825000	0.86693	2.179000	0.69175	0.477000	0.44152	TTG	.	.		0.473	UNC80-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_182587	
THUMPD3	25917	hgsc.bcm.edu	37	3	9412987	9412987	+	Missense_Mutation	SNP	G	G	A			TCGA-2Y-A9H7-01A-11D-A38X-10	TCGA-2Y-A9H7-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e447e430-664c-4a56-9017-620aef1f0ffb	b2219bf0-50ab-4c4d-a22d-6b2a5c4bb365	g.chr3:9412987G>A	ENST00000345094.3	+	4	908	c.574G>A	c.(574-576)Gcc>Acc	p.A192T	THUMPD3_ENST00000515662.2_Missense_Mutation_p.A192T|THUMPD3_ENST00000452837.2_Missense_Mutation_p.A192T|SETD5-AS1_ENST00000468186.1_RNA	NM_001114092.1|NM_015453.2	NP_001107564.1|NP_056268.2	Q9BV44	THUM3_HUMAN	THUMP domain containing 3	192	THUMP. {ECO:0000255|PROSITE- ProRule:PRU00529}.					cytoplasm (GO:0005737)|nucleolus (GO:0005730)	methyltransferase activity (GO:0008168)|RNA binding (GO:0003723)			NS(1)|central_nervous_system(1)|large_intestine(4)|lung(9)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	19	Medulloblastoma(99;0.227)			OV - Ovarian serous cystadenocarcinoma(96;0.101)		TGAAAATCCAGCCATCAAAGA	0.343																																					p.A192T		Atlas-SNP	.											.	THUMPD3	46	.	0			c.G574A						.						72.0	77.0	75.0					3																	9412987		2203	4300	6503	SO:0001583	missense	25917	exon4			AATCCAGCCATCA	AL117483	CCDS2573.1	3p25.3	2004-06-04			ENSG00000134077	ENSG00000134077			24493	protein-coding gene	gene with protein product						12477932	Standard	NM_015453		Approved	DKFZP434F091	uc003brn.4	Q9BV44	OTTHUMG00000097031	ENST00000345094.3:c.574G>A	chr3.hg19:g.9412987G>A	ENSP00000339532:p.Ala192Thr	186.0	0.0		222.0	75.0	NM_001114092	Q9H8V6|Q9NVC1|Q9UFS3	Missense_Mutation	SNP	ENST00000345094.3	hg19	CCDS2573.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.01|15.01	2.707154|2.707154	0.48412|0.48412	.|.	.|.	ENSG00000134077|ENSG00000134077	ENST00000452837;ENST00000345094;ENST00000515662|ENST00000416603	T;T;T|.	0.43294|.	0.95;0.95;0.95|.	5.94|5.94	5.06|5.06	0.68205|0.68205	THUMP (2);|.	0.480071|.	0.23766|.	N|.	0.044768|.	T|T	0.62036|0.62036	0.2395|0.2395	L|L	0.57536|0.57536	1.79|1.79	0.41436|0.41436	D|D	0.98789|0.98789	B|.	0.14012|.	0.009|.	B|.	0.15484|.	0.013|.	T|T	0.59456|0.59456	-0.7451|-0.7451	10|5	0.24483|.	T|.	0.36|.	-10.5002|-10.5002	9.6357|9.6357	0.39806|0.39806	0.0771:0.1447:0.7782:0.0|0.0771:0.1447:0.7782:0.0	.|.	192|.	Q9BV44|.	THUM3_HUMAN|.	T|N	192|24	ENSP00000395893:A192T;ENSP00000339532:A192T;ENSP00000424064:A192T|.	ENSP00000339532:A192T|.	A|S	+|+	1|2	0|0	THUMPD3|THUMPD3	9387987|9387987	0.481000|0.481000	0.25941|0.25941	1.000000|1.000000	0.80357|0.80357	0.923000|0.923000	0.55619|0.55619	1.687000|1.687000	0.37680|0.37680	2.826000|2.826000	0.97356|0.97356	0.561000|0.561000	0.74099|0.74099	GCC|AGC	.	.		0.343	THUMPD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214127.1	NM_015453	
CAMK1	8536	hgsc.bcm.edu	37	3	9807539	9807539	+	Missense_Mutation	SNP	T	T	A			TCGA-2Y-A9H7-01A-11D-A38X-10	TCGA-2Y-A9H7-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e447e430-664c-4a56-9017-620aef1f0ffb	b2219bf0-50ab-4c4d-a22d-6b2a5c4bb365	g.chr3:9807539T>A	ENST00000256460.3	-	3	296	c.119A>T	c.(118-120)aAg>aTg	p.K40M	OGG1_ENST00000302036.7_Missense_Mutation_p.L332H|OGG1_ENST00000349503.5_Missense_Mutation_p.L265H|OGG1_ENST00000449570.2_3'UTR|OGG1_ENST00000302008.8_3'UTR|OGG1_ENST00000383826.5_3'UTR	NM_003656.4	NP_003647.1	Q14012	KCC1A_HUMAN	calcium/calmodulin-dependent protein kinase I	40	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell cycle (GO:0007049)|nucleocytoplasmic transport (GO:0006913)|positive regulation of dendritic spine development (GO:0060999)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neuron projection development (GO:0010976)|positive regulation of protein export from nucleus (GO:0046827)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of synapse structural plasticity (GO:0051835)|protein phosphorylation (GO:0006468)|regulation of muscle cell differentiation (GO:0051147)|regulation of protein binding (GO:0043393)|regulation of protein localization (GO:0032880)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)			endometrium(1)|large_intestine(3)|lung(6)|ovary(1)|skin(1)	12	Medulloblastoma(99;0.227)			OV - Ovarian serous cystadenocarcinoma(96;0.0475)		CTGCGTCCTCTTATCTTCTGC	0.577																																					p.L332H		Atlas-SNP	.											.	OGG1	57	.	0			c.T995A						.						81.0	75.0	77.0					3																	9807539		2203	4300	6503	SO:0001583	missense	4968	exon7			GTCCTCTTATCTT	L41816	CCDS2582.1	3p25.3	2004-02-27			ENSG00000134072	ENSG00000134072			1459	protein-coding gene	gene with protein product		604998				7641687	Standard	NM_003656		Approved	CaMKI	uc003bst.3	Q14012	OTTHUMG00000128419	ENST00000256460.3:c.119A>T	chr3.hg19:g.9807539T>A	ENSP00000256460:p.Lys40Met	63.0	0.0		78.0	34.0	NM_016821	Q3KPF6	Missense_Mutation	SNP	ENST00000256460.3	hg19	CCDS2582.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	19.50|19.50	3.838995|3.838995	0.71373|0.71373	.|.	.|.	ENSG00000134072|ENSG00000114026	ENST00000256460|ENST00000302036;ENST00000349503	T|T;T	0.68025|0.62941	-0.3|-0.01;0.79	4.87|4.87	4.87|4.87	0.63330|0.63330	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);|.	0.051090|.	0.85682|.	D|.	0.000000|.	T|T	0.75391|0.75391	0.3843|0.3843	M|M	0.75264|0.75264	2.295|2.295	0.80722|0.80722	D|D	1|1	P|D;D	0.41978|0.76494	0.767|0.999;0.998	P|D;P	0.50490|0.69479	0.642|0.964;0.819	T|T	0.76299|0.76299	-0.3010|-0.3010	10|9	0.72032|0.45353	D|T	0.01|0.12	0.356|0.356	10.8818|10.8818	0.46944|0.46944	0.0:0.0775:0.0:0.9225|0.0:0.0775:0.0:0.9225	.|.	40|265;332	Q14012|E5KPM6;E5KPM5	KCC1A_HUMAN|.;.	M|H	40|332;265	ENSP00000256460:K40M|ENSP00000306561:L332H;ENSP00000303132:L265H	ENSP00000256460:K40M|ENSP00000306561:L332H	K|L	-|+	2|2	0|0	CAMK1|OGG1	9782539|9782539	1.000000|1.000000	0.71417|0.71417	0.967000|0.967000	0.41034|0.41034	0.706000|0.706000	0.40770|0.40770	3.427000|3.427000	0.52785|0.52785	1.952000|1.952000	0.56665|0.56665	0.374000|0.374000	0.22700|0.22700	AAG|CTT	.	.		0.577	CAMK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250206.1	NM_003656	
HDAC11	79885	hgsc.bcm.edu	37	3	13546008	13546008	+	Missense_Mutation	SNP	G	G	A			TCGA-2Y-A9H7-01A-11D-A38X-10	TCGA-2Y-A9H7-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e447e430-664c-4a56-9017-620aef1f0ffb	b2219bf0-50ab-4c4d-a22d-6b2a5c4bb365	g.chr3:13546008G>A	ENST00000295757.3	+	10	1052	c.869G>A	c.(868-870)cGt>cAt	p.R290H	HDAC11_ENST00000402271.1_Missense_Mutation_p.R211H|HDAC11_ENST00000402259.1_Missense_Mutation_p.R124H|HDAC11_ENST00000522202.1_Missense_Mutation_p.R239H|HDAC11_ENST00000405025.1_3'UTR|HDAC11_ENST00000404040.1_Missense_Mutation_p.R190H|HDAC11_ENST00000446613.2_Missense_Mutation_p.R98H|HDAC11_ENST00000433119.1_3'UTR|HDAC11_ENST00000404548.1_3'UTR|HDAC11_ENST00000437379.2_Missense_Mutation_p.R262H	NM_024827.3	NP_079103.2	Q96DB2	HDA11_HUMAN	histone deacetylase 11	290	Histone deacetylase.				chromatin modification (GO:0016568)|histone deacetylation (GO:0016575)|oligodendrocyte development (GO:0014003)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|histone deacetylase complex (GO:0000118)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	histone deacetylase activity (GO:0004407)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|NAD-dependent histone deacetylase activity (H3-K18 specific) (GO:0097372)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|NAD-dependent histone deacetylase activity (H4-K16 specific) (GO:0046970)|transcription factor binding (GO:0008134)			breast(1)|endometrium(2)|large_intestine(1)|lung(2)|ovary(4)|prostate(3)	13						CGGATGGTCCGTGGCCGCCGG	0.612																																					p.R290H		Atlas-SNP	.											.	HDAC11	39	.	0			c.G869A						.						86.0	72.0	77.0					3																	13546008		2203	4300	6503	SO:0001583	missense	79885	exon10			TGGTCCGTGGCCG	AK025426	CCDS2615.1, CCDS46760.1	3p25.1	2008-07-18			ENSG00000163517	ENSG00000163517	3.5.1.98		19086	protein-coding gene	gene with protein product		607226				11948178	Standard	NM_001136041		Approved		uc003bxy.3	Q96DB2	OTTHUMG00000129800	ENST00000295757.3:c.869G>A	chr3.hg19:g.13546008G>A	ENSP00000295757:p.Arg290His	71.0	0.0		51.0	22.0	NM_024827	B4DDK1|Q9H6I7|Q9H6X3|Q9NTC9	Missense_Mutation	SNP	ENST00000295757.3	hg19	CCDS2615.1	.	.	.	.	.	.	.	.	.	.	G	21.5	4.157660	0.78114	.	.	ENSG00000163517	ENST00000295757;ENST00000402259;ENST00000402271;ENST00000446613;ENST00000404040;ENST00000522202;ENST00000437379	T;T;T;T;T;T;T	0.70516	-0.49;-0.49;-0.49;-0.49;-0.49;-0.49;-0.49	5.38	5.38	0.77491	Histone deacetylase domain (2);	0.179190	0.45867	D	0.000325	D	0.83640	0.5298	M	0.75447	2.3	0.51767	D	0.999934	D;D	0.89917	1.0;1.0	D;D	0.72338	0.967;0.977	D	0.85555	0.1224	10	0.87932	D	0	-13.9604	16.6271	0.84974	0.0:0.0:1.0:0.0	.	239;290	B4DDK1;Q96DB2	.;HDA11_HUMAN	H	290;124;211;98;190;239;262	ENSP00000295757:R290H;ENSP00000384706:R124H;ENSP00000384123:R211H;ENSP00000401487:R98H;ENSP00000385475:R190H;ENSP00000429794:R239H;ENSP00000395188:R262H	ENSP00000295757:R290H	R	+	2	0	HDAC11	13521008	1.000000	0.71417	0.918000	0.36340	0.436000	0.31835	5.150000	0.64869	2.516000	0.84829	0.561000	0.74099	CGT	.	.		0.612	HDAC11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252028.5	NM_024827	
DOCK3	1795	hgsc.bcm.edu	37	3	51297607	51297607	+	Silent	SNP	G	G	A			TCGA-2Y-A9H7-01A-11D-A38X-10	TCGA-2Y-A9H7-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e447e430-664c-4a56-9017-620aef1f0ffb	b2219bf0-50ab-4c4d-a22d-6b2a5c4bb365	g.chr3:51297607G>A	ENST00000266037.9	+	23	2228	c.2205G>A	c.(2203-2205)aaG>aaA	p.K735K		NM_004947.4	NP_004938.1	Q8IZD9	DOCK3_HUMAN	dedicator of cytokinesis 3	735					small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)	guanyl-nucleotide exchange factor activity (GO:0005085)			breast(2)|cervix(1)|endometrium(10)|kidney(4)|lung(22)|prostate(5)|urinary_tract(1)	45				BRCA - Breast invasive adenocarcinoma(193;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00449)|Kidney(197;0.00518)		ACCTTTTCAAGTTCATTGTAC	0.458																																					p.K735K		Atlas-SNP	.											.	DOCK3	397	.	0			c.G2205A						.						89.0	87.0	88.0					3																	51297607		1937	4148	6085	SO:0001819	synonymous_variant	1795	exon23			TTTCAAGTTCATT	AB002297	CCDS46835.1	3p21	2008-02-01			ENSG00000088538	ENSG00000088538			2989	protein-coding gene	gene with protein product		603123	"""dedicator of cyto-kinesis 3"""			9205841	Standard	NM_004947		Approved	KIAA0299, MOCA, PBP	uc011bds.2	Q8IZD9	OTTHUMG00000156892	ENST00000266037.9:c.2205G>A	chr3.hg19:g.51297607G>A		68.0	0.0		87.0	36.0	NM_004947	O15017	Silent	SNP	ENST00000266037.9	hg19	CCDS46835.1																																																																																			.	.		0.458	DOCK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346478.5	NM_004947	
ZDHHC23	254887	hgsc.bcm.edu	37	3	113672983	113672983	+	Missense_Mutation	SNP	A	A	T	rs370935137		TCGA-2Y-A9H7-01A-11D-A38X-10	TCGA-2Y-A9H7-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e447e430-664c-4a56-9017-620aef1f0ffb	b2219bf0-50ab-4c4d-a22d-6b2a5c4bb365	g.chr3:113672983A>T	ENST00000330212.3	+	3	897	c.598A>T	c.(598-600)Agc>Tgc	p.S200C	ZDHHC23_ENST00000498275.1_Missense_Mutation_p.S194C	NM_173570.3	NP_775841.2	Q8IYP9	ZDH23_HUMAN	zinc finger, DHHC-type containing 23	200					protein localization to plasma membrane (GO:0072659)|protein palmitoylation (GO:0018345)	integral component of membrane (GO:0016021)	protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(3)|ovary(2)|urinary_tract(2)	16						CAATCCAGCAAGCGGTGACAG	0.557																																					p.S200C		Atlas-SNP	.											.	ZDHHC23	38	.	0			c.A598T						.						110.0	116.0	114.0					3																	113672983		2203	4300	6503	SO:0001583	missense	254887	exon3			CCAGCAAGCGGTG	AK127025	CCDS33827.1	3q13.31	2008-05-02			ENSG00000184307	ENSG00000184307		"""Zinc fingers, DHHC-type"""	28654	protein-coding gene	gene with protein product						12477932	Standard	NM_173570		Approved	MGC42530	uc003eau.3	Q8IYP9	OTTHUMG00000159335	ENST00000330212.3:c.598A>T	chr3.hg19:g.113672983A>T	ENSP00000330485:p.Ser200Cys	145.0	0.0		164.0	56.0	NM_173570	D3DN76	Missense_Mutation	SNP	ENST00000330212.3	hg19	CCDS33827.1	.	.	.	.	.	.	.	.	.	.	A	7.063	0.566726	0.13560	.	.	ENSG00000184307	ENST00000330212;ENST00000498275	T;T	0.47177	0.85;0.85	5.7	-7.1	0.01547	.	1.044020	0.07344	N	0.881239	T	0.26085	0.0636	N	0.24115	0.695	0.09310	N	1	B	0.10296	0.003	B	0.14023	0.01	T	0.29761	-1.0001	10	0.49607	T	0.09	-1.1867	4.2589	0.10732	0.3561:0.1858:0.3739:0.0843	.	200	Q8IYP9	ZDH23_HUMAN	C	200;194	ENSP00000330485:S200C;ENSP00000417840:S194C	ENSP00000330485:S200C	S	+	1	0	ZDHHC23	115155673	0.000000	0.05858	0.001000	0.08648	0.195000	0.23768	0.013000	0.13310	-0.777000	0.04572	0.459000	0.35465	AGC	.	.		0.557	ZDHHC23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354702.1	NM_173570	
FXR1	8087	hgsc.bcm.edu	37	3	180666144	180666144	+	Missense_Mutation	SNP	A	A	G			TCGA-2Y-A9H7-01A-11D-A38X-10	TCGA-2Y-A9H7-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e447e430-664c-4a56-9017-620aef1f0ffb	b2219bf0-50ab-4c4d-a22d-6b2a5c4bb365	g.chr3:180666144A>G	ENST00000357559.4	+	5	664	c.280A>G	c.(280-282)Att>Gtt	p.I94V	FXR1_ENST00000480918.1_Missense_Mutation_p.I81V|FXR1_ENST00000445140.2_Missense_Mutation_p.I94V|FXR1_ENST00000491062.1_Missense_Mutation_p.I45V|FXR1_ENST00000305586.7_Missense_Mutation_p.I9V|FXR1_ENST00000468861.1_Missense_Mutation_p.I9V	NM_001013438.2|NM_005087.3	NP_001013456.1|NP_005078.2	P51114	FXR1_HUMAN	fragile X mental retardation, autosomal homolog 1	94	Agenet-like 2.				apoptotic process (GO:0006915)|cell differentiation (GO:0030154)|muscle organ development (GO:0007517)|negative regulation of translation (GO:0017148)	costamere (GO:0043034)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|polysome (GO:0005844)	G-quadruplex RNA binding (GO:0002151)|mRNA 3'-UTR binding (GO:0003730)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(3)|endometrium(4)|large_intestine(5)|lung(12)|skin(2)	26	all_cancers(143;6.07e-14)|Ovarian(172;0.0212)		Epithelial(37;3.05e-35)|OV - Ovarian serous cystadenocarcinoma(80;2.4e-22)			GTTTTATGTCATTGAATATGC	0.303																																					p.I94V		Atlas-SNP	.											.	FXR1	75	.	0			c.A280G						.						37.0	38.0	38.0					3																	180666144		2201	4300	6501	SO:0001583	missense	8087	exon5			TATGTCATTGAAT	M67468	CCDS3238.1, CCDS33894.1, CCDS46965.1	3q28	2014-01-28			ENSG00000114416	ENSG00000114416			4023	protein-coding gene	gene with protein product		600819				7781595, 9642279	Standard	NM_005087		Approved		uc003fkq.3	P51114	OTTHUMG00000158138	ENST00000357559.4:c.280A>G	chr3.hg19:g.180666144A>G	ENSP00000350170:p.Ile94Val	80.0	0.0		99.0	40.0	NM_001013438	A8K9B8|Q7Z450|Q8N6R8	Missense_Mutation	SNP	ENST00000357559.4	hg19	CCDS3238.1	.	.	.	.	.	.	.	.	.	.	A	17.93	3.508970	0.64410	.	.	ENSG00000114416	ENST00000469882;ENST00000484790;ENST00000465551;ENST00000357559;ENST00000305586;ENST00000491062;ENST00000468861;ENST00000445140;ENST00000484958;ENST00000480918;ENST00000484042	T;T;T;T;T;T;T;T;T;T;T	0.44881	0.96;0.93;0.91;2.09;1.76;1.18;1.27;1.4;1.01;1.96;0.97	5.83	5.83	0.93111	Agenet (1);	0.000000	0.85682	D	0.000000	T	0.54415	0.1857	L	0.33189	0.99	0.80722	D	1	P;D;D;D;B;B	0.63046	0.894;0.992;0.983;0.967;0.022;0.288	D;D;D;D;B;P	0.83275	0.979;0.996;0.977;0.946;0.158;0.848	T	0.51942	-0.8641	10	0.39692	T	0.17	-21.9532	16.2005	0.82071	1.0:0.0:0.0:0.0	.	81;45;9;9;94;94	B4DXZ6;E9PFF5;E7EU85;E7ERF5;P51114-2;P51114	.;.;.;.;.;FXR1_HUMAN	V	9;9;9;94;9;45;9;94;9;81;98	ENSP00000419793:I9V;ENSP00000417125:I9V;ENSP00000418724:I9V;ENSP00000350170:I94V;ENSP00000307633:I9V;ENSP00000420643:I45V;ENSP00000420515:I9V;ENSP00000388828:I94V;ENSP00000419933:I9V;ENSP00000418097:I81V;ENSP00000417513:I98V	ENSP00000307633:I9V	I	+	1	0	FXR1	182148838	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.339000	0.96797	2.227000	0.72691	0.528000	0.53228	ATT	.	.		0.303	FXR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350265.5		
NPFFR2	10886	hgsc.bcm.edu	37	4	72994622	72994622	+	Missense_Mutation	SNP	A	A	G			TCGA-2Y-A9H7-01A-11D-A38X-10	TCGA-2Y-A9H7-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e447e430-664c-4a56-9017-620aef1f0ffb	b2219bf0-50ab-4c4d-a22d-6b2a5c4bb365	g.chr4:72994622A>G	ENST00000308744.6	+	2	718	c.620A>G	c.(619-621)gAc>gGc	p.D207G	NPFFR2_ENST00000358749.3_Missense_Mutation_p.D105G|NPFFR2_ENST00000344413.5_Intron|NPFFR2_ENST00000395999.1_Missense_Mutation_p.D108G	NM_004885.2	NP_004876.2	Q9Y5X5	NPFF2_HUMAN	neuropeptide FF receptor 2	207					detection of abiotic stimulus (GO:0009582)|G-protein coupled receptor signaling pathway (GO:0007186)|regulation of adenylate cyclase activity (GO:0045761)|regulation of cAMP-dependent protein kinase activity (GO:2000479)|regulation of MAPK cascade (GO:0043408)	actin cytoskeleton (GO:0015629)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|neuropeptide receptor activity (GO:0008188)			NS(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(24)|ovary(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	43			Lung(101;0.0935)|LUSC - Lung squamous cell carcinoma(112;0.138)			ACACTGCTGGACAATATTATA	0.383																																					p.D207G		Atlas-SNP	.											.	NPFFR2	98	.	0			c.A620G						.						106.0	102.0	104.0					4																	72994622		2203	4300	6503	SO:0001583	missense	10886	exon2			TGCTGGACAATAT	AF236083	CCDS3551.1, CCDS3552.1, CCDS47072.1	4q21	2012-08-10	2006-02-15	2006-02-15	ENSG00000056291	ENSG00000056291		"""GPCR / Class A :  Neuropeptide receptors : FF/AF"", ""GPCR / Class A : RF amide peptide receptors"""	4525	protein-coding gene	gene with protein product	"""neuropeptide FF 2"""	607449	"""G protein-coupled receptor 74"""	GPR74		10079187, 10851242	Standard	NM_001144756		Approved	NPFF2, NPGPR	uc003hgg.2	Q9Y5X5	OTTHUMG00000129918	ENST00000308744.6:c.620A>G	chr4.hg19:g.72994622A>G	ENSP00000307822:p.Asp207Gly	70.0	0.0		70.0	27.0	NM_004885	Q96RV1|Q9NR49	Missense_Mutation	SNP	ENST00000308744.6	hg19	CCDS3551.1	.	.	.	.	.	.	.	.	.	.	A	20.4	3.979105	0.74360	.	.	ENSG00000056291	ENST00000308744;ENST00000395999;ENST00000358749	T;T;T	0.38240	1.15;1.15;1.15	5.75	5.75	0.90469	GPCR, rhodopsin-like superfamily (1);	0.000000	0.53938	D	0.000057	T	0.55016	0.1894	M	0.66297	2.02	0.80722	D	1	P;P	0.48407	0.819;0.91	P;P	0.61132	0.616;0.884	T	0.49542	-0.8929	10	0.27082	T	0.32	.	15.7296	0.77790	1.0:0.0:0.0:0.0	.	108;207	Q9Y5X5-3;Q9Y5X5	.;NPFF2_HUMAN	G	207;108;105	ENSP00000307822:D207G;ENSP00000379321:D108G;ENSP00000351599:D105G	ENSP00000307822:D207G	D	+	2	0	NPFFR2	73213486	1.000000	0.71417	1.000000	0.80357	0.904000	0.53231	9.136000	0.94489	2.188000	0.69820	0.528000	0.53228	GAC	.	.		0.383	NPFFR2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000252170.2	NM_004885	
COQ2	27235	hgsc.bcm.edu	37	4	84205844	84205844	+	Missense_Mutation	SNP	C	C	T			TCGA-2Y-A9H7-01A-11D-A38X-10	TCGA-2Y-A9H7-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e447e430-664c-4a56-9017-620aef1f0ffb	b2219bf0-50ab-4c4d-a22d-6b2a5c4bb365	g.chr4:84205844C>T	ENST00000311469.4	-	1	223	c.224G>A	c.(223-225)cGg>cAg	p.R75Q	COQ2_ENST00000439031.2_Missense_Mutation_p.R38Q|COQ2_ENST00000311461.7_Missense_Mutation_p.R25Q	NM_015697.7	NP_056512.5	Q96H96	COQ2_HUMAN	coenzyme Q2 4-hydroxybenzoate polyprenyltransferase	25					cell death (GO:0008219)|glycerol metabolic process (GO:0006071)|isoprenoid biosynthetic process (GO:0008299)|small molecule metabolic process (GO:0044281)|ubiquinone biosynthetic process (GO:0006744)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)	4-hydroxybenzoate decaprenyltransferase activity (GO:0002083)|4-hydroxybenzoate nonaprenyltransferase activity (GO:0047293)			central_nervous_system(1)|endometrium(1)|large_intestine(3)|ovary(1)|skin(1)|stomach(1)	8		Hepatocellular(203;0.114)				GGAGCGGCCCCGCCAGCCCGG	0.786																																					p.R75Q		Atlas-SNP	.											.	COQ2	22	.	0			c.G224A						.						2.0	2.0	2.0					4																	84205844		878	2038	2916	SO:0001583	missense	27235	exon1			CGGCCCCGCCAGC		CCDS47090.1, CCDS47090.2	4q21.23	2013-05-23	2013-05-23				2.5.1.39		25223	protein-coding gene	gene with protein product	"""4-hydroxybenzoate polyprenyltransferase"""	609825	"""coenzyme Q2 homolog, prenyltransferase (yeast)"""			15153069, 17332895	Standard	NM_015697		Approved	CL640, FLJ26072	uc003hog.3	Q96H96		ENST00000311469.4:c.224G>A	chr4.hg19:g.84205844C>T	ENSP00000310873:p.Arg75Gln	502.0	0.0		550.0	249.0	NM_015697	O95331|Q1JQ78|Q684R2	Missense_Mutation	SNP	ENST00000311469.4	hg19	CCDS47090.2	.	.	.	.	.	.	.	.	.	.	C	13.43	2.234729	0.39498	.	.	ENSG00000173085	ENST00000311469;ENST00000439031;ENST00000311461	T;T;T	0.79554	-1.26;-1.21;-1.28	3.33	0.579	0.17397	.	1.239200	0.05804	N	0.612818	T	0.68604	0.3019	L	0.40543	1.245	0.09310	N	1	B;B	0.19583	0.037;0.037	B;B	0.04013	0.001;0.001	T	0.45818	-0.9235	10	0.19590	T	0.45	-20.464	3.4231	0.07401	0.0:0.5306:0.2181:0.2513	.	25;25	E2QRG7;Q96H96	.;COQ2_HUMAN	Q	75;38;25	ENSP00000310873:R75Q;ENSP00000409275:R38Q;ENSP00000311835:R25Q	ENSP00000311835:R25Q	R	-	2	0	COQ2	84424868	0.000000	0.05858	0.000000	0.03702	0.152000	0.21847	-0.315000	0.08081	0.072000	0.16694	-0.499000	0.04595	CGG	.	.		0.786	COQ2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363027.3	NM_015697	
TET2	54790	hgsc.bcm.edu	37	4	106164733	106164733	+	Missense_Mutation	SNP	C	C	T			TCGA-2Y-A9H7-01A-11D-A38X-10	TCGA-2Y-A9H7-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e447e430-664c-4a56-9017-620aef1f0ffb	b2219bf0-50ab-4c4d-a22d-6b2a5c4bb365	g.chr4:106164733C>T	ENST00000540549.1	+	6	4461	c.3601C>T	c.(3601-3603)Cgc>Tgc	p.R1201C	TET2_ENST00000380013.4_Missense_Mutation_p.R1201C|TET2_ENST00000513237.1_Missense_Mutation_p.R1222C|TET2_ENST00000545826.1_Silent_p.F1170F			Q6N021	TET2_HUMAN	tet methylcytosine dioxygenase 2	1201					5-methylcytosine catabolic process (GO:0006211)|cell cycle (GO:0007049)|DNA demethylation (GO:0080111)|histone H3-K4 trimethylation (GO:0080182)|kidney development (GO:0001822)|myeloid cell differentiation (GO:0030099)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|post-embryonic development (GO:0009791)|protein O-linked glycosylation (GO:0006493)		DNA binding (GO:0003677)|ferrous iron binding (GO:0008198)|methylcytosine dioxygenase activity (GO:0070579)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1272)|kidney(3)|large_intestine(11)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	1314		Myeloproliferative disorder(5;0.0393)		OV - Ovarian serous cystadenocarcinoma(123;7.18e-08)		GCAGGTGGTTCGCAGAAGCAG	0.527			"""Mis N, F"""		MDS																																p.R1201C		Atlas-SNP	.		Rec	yes		4	4q24	54790	tet oncogene family member 2		L	.	TET2	1762	.	0			c.C3601T						.						186.0	175.0	178.0					4																	106164733		692	1591	2283	SO:0001583	missense	54790	exon6			GTGGTTCGCAGAA	AB046766	CCDS3666.1, CCDS47120.1	4q24	2014-09-17	2011-09-30	2008-03-12	ENSG00000168769	ENSG00000168769			25941	protein-coding gene	gene with protein product		612839	"""KIAA1546"", ""tet oncogene family member 2"""	KIAA1546		10997877, 12646957	Standard	NM_017628		Approved	FLJ20032	uc003hxk.3	Q6N021	OTTHUMG00000131213	ENST00000540549.1:c.3601C>T	chr4.hg19:g.106164733C>T	ENSP00000442788:p.Arg1201Cys	73.0	0.0		64.0	20.0	NM_001127208	B5MDU0|Q2TB88|Q3LIB8|Q96JX5|Q9HCM6|Q9NXW0	Missense_Mutation	SNP	ENST00000540549.1	hg19	CCDS47120.1	.	.	.	.	.	.	.	.	.	.	C	23.5	4.423447	0.83559	.	.	ENSG00000168769	ENST00000540549;ENST00000513237;ENST00000380013	T;T;T	0.42513	0.97;0.97;0.97	5.64	4.77	0.60923	TET cysteine-rich domain (1);	.	.	.	.	T	0.69106	0.3074	M	0.87180	2.865	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.75178	-0.3409	9	0.87932	D	0	.	16.0104	0.80399	0.1348:0.8651:0.0:0.0	.	1222;1201	E7EQS8;Q6N021	.;TET2_HUMAN	C	1201;1222;1201	ENSP00000442788:R1201C;ENSP00000425443:R1222C;ENSP00000369351:R1201C	ENSP00000369351:R1201C	R	+	1	0	TET2	106384182	1.000000	0.71417	0.884000	0.34674	0.514000	0.34195	7.684000	0.84104	2.664000	0.90586	0.655000	0.94253	CGC	.	.		0.527	TET2-202	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000253952.2	NM_017628	
FAT1	2195	hgsc.bcm.edu	37	4	187630712	187630712	+	Silent	SNP	G	G	A	rs373265178		TCGA-2Y-A9H7-01A-11D-A38X-10	TCGA-2Y-A9H7-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e447e430-664c-4a56-9017-620aef1f0ffb	b2219bf0-50ab-4c4d-a22d-6b2a5c4bb365	g.chr4:187630712G>A	ENST00000441802.2	-	2	479	c.270C>T	c.(268-270)ctC>ctT	p.L90L		NM_005245.3	NP_005236.2	Q14517	FAT1_HUMAN	FAT atypical cadherin 1	90	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				actin filament organization (GO:0007015)|anatomical structure morphogenesis (GO:0009653)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|cell-cell signaling (GO:0007267)|establishment or maintenance of cell polarity (GO:0007163)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.L90L(1)		NS(1)|breast(3)|central_nervous_system(3)|endometrium(38)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(33)|lung(88)|ovary(13)|pancreas(2)|prostate(16)|skin(2)|upper_aerodigestive_tract(11)|urinary_tract(4)	228						AAAAGTCTCCGAGAATGTACT	0.393										HNSCC(5;0.00058)																											p.L90L	Colon(197;1040 2055 4143 4984 49344)	Atlas-SNP	.											FAT1,colon,carcinoma,0,1	FAT1	500	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C270T						.	G		1,3767		0,1,1883	90.0	83.0	85.0		270	-4.1	0.7	4		85	0,8226		0,0,4113	no	coding-synonymous	FAT1	NM_005245.3		0,1,5996	AA,AG,GG		0.0,0.0265,0.0083		90/4589	187630712	1,11993	1884	4113	5997	SO:0001819	synonymous_variant	2195	exon2			GTCTCCGAGAATG	X87241	CCDS47177.1	4q35.2	2013-05-31	2013-05-31	2008-10-30	ENSG00000083857	ENSG00000083857		"""Cadherins / Cadherin-related"""	3595	protein-coding gene	gene with protein product	"""cadherin-related family member 8"""	600976	"""FAT tumor suppressor (Drosophila) homolog"", ""FAT tumor suppressor homolog 1 (Drosophila)"""	FAT		8586420	Standard	XM_005262834		Approved	CDHF7, CDHR8	uc003izf.3	Q14517	OTTHUMG00000160320	ENST00000441802.2:c.270C>T	chr4.hg19:g.187630712G>A		81.0	0.0		96.0	38.0	NM_005245		Silent	SNP	ENST00000441802.2	hg19	CCDS47177.1																																																																																			.	.		0.393	FAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360209.3	NM_005245	
SNCB	6620	hgsc.bcm.edu	37	5	176056620	176056620	+	Silent	SNP	C	C	T			TCGA-2Y-A9H7-01A-11D-A38X-10	TCGA-2Y-A9H7-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e447e430-664c-4a56-9017-620aef1f0ffb	b2219bf0-50ab-4c4d-a22d-6b2a5c4bb365	g.chr5:176056620C>T	ENST00000310112.3	-	3	286	c.36G>A	c.(34-36)aaG>aaA	p.K12K	SNCB_ENST00000393693.2_Silent_p.K12K|MIR4281_ENST00000580852.1_RNA|SNCB_ENST00000506696.1_Silent_p.K12K|EIF4E1B_ENST00000318682.6_5'Flank|SNCB_ENST00000510387.1_Silent_p.K12K	NM_001001502.1	NP_001001502.1	Q16143	SYUB_HUMAN	synuclein, beta	12					dopamine metabolic process (GO:0042417)|negative regulation of catalytic activity (GO:0043086)|negative regulation of neuron apoptotic process (GO:0043524)|synapse organization (GO:0050808)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|inclusion body (GO:0016234)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|terminal bouton (GO:0043195)	calcium ion binding (GO:0005509)|phospholipase inhibitor activity (GO:0004859)			breast(1)|large_intestine(1)|lung(6)|ovary(1)|upper_aerodigestive_tract(1)	10	all_cancers(89;0.00222)|Renal(175;0.000269)|Lung NSC(126;0.00902)|all_lung(126;0.0142)	Medulloblastoma(196;0.00498)|all_neural(177;0.0212)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			CAACGCCCTCCTTGGCCATGG	0.682																																					p.K12K		Atlas-SNP	.											.	SNCB	20	.	0			c.G36A						.						47.0	37.0	40.0					5																	176056620		2203	4300	6503	SO:0001819	synonymous_variant	6620	exon3			GCCCTCCTTGGCC	AF053134	CCDS4406.1	5q35	2008-07-18			ENSG00000074317	ENSG00000074317			11140	protein-coding gene	gene with protein product		602569				7558013, 9806846	Standard	NM_003085		Approved		uc003meq.3	Q16143	OTTHUMG00000130661	ENST00000310112.3:c.36G>A	chr5.hg19:g.176056620C>T		147.0	0.0		147.0	63.0	NM_001001502	Q6IAX7	Silent	SNP	ENST00000310112.3	hg19	CCDS4406.1																																																																																			.	.		0.682	SNCB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253152.2	NM_001001502	
ZFP2	80108	hgsc.bcm.edu	37	5	178358992	178358992	+	Silent	SNP	C	C	T			TCGA-2Y-A9H7-01A-11D-A38X-10	TCGA-2Y-A9H7-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e447e430-664c-4a56-9017-620aef1f0ffb	b2219bf0-50ab-4c4d-a22d-6b2a5c4bb365	g.chr5:178358992C>T	ENST00000361362.2	+	5	1208	c.678C>T	c.(676-678)agC>agT	p.S226S	ZFP2_ENST00000520301.1_Silent_p.S226S|ZFP2_ENST00000503510.2_Silent_p.S226S|ZFP2_ENST00000523286.1_Silent_p.S226S	NM_030613.2	NP_085116.2	Q6ZN57	ZFP2_HUMAN	ZFP2 zinc finger protein	226					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|endometrium(2)|kidney(1)|large_intestine(7)|liver(1)|lung(2)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|stomach(1)	20	all_cancers(89;0.000639)|all_epithelial(37;0.000109)|Renal(175;0.000159)|Lung NSC(126;0.00199)|all_lung(126;0.00351)	all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.00655)|GBM - Glioblastoma multiforme(465;0.0302)|OV - Ovarian serous cystadenocarcinoma(192;0.0615)|Epithelial(171;0.111)		TTACCCAAAGCATGAATTTGA	0.363																																					p.S226S		Atlas-SNP	.											.	ZFP2	70	.	0			c.C678T						.						48.0	51.0	50.0					5																	178358992		2203	4300	6503	SO:0001819	synonymous_variant	80108	exon5			CCAAAGCATGAAT	AK025281	CCDS4440.1	5q35.3	2013-01-08	2012-11-27		ENSG00000198939	ENSG00000198939		"""Zinc fingers, C2H2-type"""	26138	protein-coding gene	gene with protein product			"""zinc finger protein 2 homolog (mouse)"""				Standard	NM_030613		Approved	FLJ21628, ZNF751	uc003mjn.1	Q6ZN57	OTTHUMG00000130885	ENST00000361362.2:c.678C>T	chr5.hg19:g.178358992C>T		70.0	0.0		98.0	42.0	NM_030613	A5PLN5|B7ZM23|Q9H6Z6	Silent	SNP	ENST00000361362.2	hg19	CCDS4440.1																																																																																			.	.		0.363	ZFP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253470.2	NM_030613	
SRSF3	6428	hgsc.bcm.edu	37	6	36564715	36564715	+	Missense_Mutation	SNP	C	C	A			TCGA-2Y-A9H7-01A-11D-A38X-10	TCGA-2Y-A9H7-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e447e430-664c-4a56-9017-620aef1f0ffb	b2219bf0-50ab-4c4d-a22d-6b2a5c4bb365	g.chr6:36564715C>A	ENST00000373715.6	+	2	292	c.176C>A	c.(175-177)gCa>gAa	p.A59E	SRSF3_ENST00000339436.7_Missense_Mutation_p.A59E	NM_003017.4	NP_003008.1	P84103	SRSF3_HUMAN	serine/arginine-rich splicing factor 3	59	RRM. {ECO:0000255|PROSITE- ProRule:PRU00176}.|Sufficiernt for interaction with NXF1.				gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(3)|skin(2)	7						CCCCGAGATGCAGCTGATGCA	0.428																																					p.A59E		Atlas-SNP	.											.	SRSF3	28	.	0			c.C176A						.						62.0	65.0	64.0					6																	36564715		2203	4300	6503	SO:0001583	missense	6428	exon2			GAGATGCAGCTGA	L10838	CCDS4823.1	6p21	2013-02-12	2010-06-22	2010-06-22	ENSG00000112081	ENSG00000112081		"""Serine/arginine-rich splicing factors"", ""RNA binding motif (RRM) containing"""	10785	protein-coding gene	gene with protein product		603364	"""splicing factor, arginine/serine-rich 3"""	SFRS3		1577277, 20516191	Standard	NM_003017		Approved	SRp20	uc003omj.3	P84103	OTTHUMG00000014599	ENST00000373715.6:c.176C>A	chr6.hg19:g.36564715C>A	ENSP00000362820:p.Ala59Glu	87.0	0.0		96.0	35.0	NM_003017	B4E241|O08831|P23152|Q5R3K0	Missense_Mutation	SNP	ENST00000373715.6	hg19	CCDS4823.1	.	.	.	.	.	.	.	.	.	.	C	36	5.632616	0.96682	.	.	ENSG00000112081	ENST00000373715;ENST00000339436	T;D	0.84660	1.47;-1.88	5.47	5.47	0.80525	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.000000	0.85682	D	0.000000	D	0.94837	0.8332	H	0.95402	3.665	0.80722	D	1	D;D	0.76494	0.999;0.998	D;D	0.87578	0.997;0.998	D	0.95687	0.8737	10	0.87932	D	0	.	19.7017	0.96057	0.0:1.0:0.0:0.0	.	59;59	B4E241;P84103	.;SRSF3_HUMAN	E	59	ENSP00000362820:A59E;ENSP00000344762:A59E	ENSP00000344762:A59E	A	+	2	0	SRSF3	36672693	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	7.776000	0.85560	2.724000	0.93272	0.561000	0.74099	GCA	.	.		0.428	SRSF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040347.2	NM_003017	
TREML1	340205	hgsc.bcm.edu	37	6	41121748	41121748	+	Missense_Mutation	SNP	G	G	C			TCGA-2Y-A9H7-01A-11D-A38X-10	TCGA-2Y-A9H7-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e447e430-664c-4a56-9017-620aef1f0ffb	b2219bf0-50ab-4c4d-a22d-6b2a5c4bb365	g.chr6:41121748G>C	ENST00000426005.2	-	2	167	c.124C>G	c.(124-126)Ctc>Gtc	p.L42V	TREML1_ENST00000437044.2_Intron|TREML1_ENST00000373127.4_Missense_Mutation_p.L42V	NM_178174.2	NP_835468.1	Q86YW5	TRML1_HUMAN	triggering receptor expressed on myeloid cells-like 1	42	Ig-like V-type.				calcium-mediated signaling (GO:0019722)|innate immune response (GO:0045087)|platelet activation (GO:0030168)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|platelet alpha granule (GO:0031091)				breast(2)|endometrium(2)|kidney(1)|large_intestine(2)|lung(5)|ovary(1)	13	Ovarian(28;0.0418)|Colorectal(47;0.196)					ACATCCTGGAGCCTGTAGTGG	0.632																																					p.L42V		Atlas-SNP	.											.	TREML1	20	.	0			c.C124G						.						36.0	38.0	37.0					6																	41121748		2203	4300	6503	SO:0001583	missense	340205	exon2			CCTGGAGCCTGTA	AF534822	CCDS4851.1, CCDS64420.1, CCDS64421.1	6p21.1	2013-01-11			ENSG00000161911	ENSG00000161911		"""Immunoglobulin superfamily / V-set domain containing"""	20434	protein-coding gene	gene with protein product	"""TREM-like transcript 1"""	609714				12393607, 12645956	Standard	NM_178174		Approved	TLT1, dJ238O23.3	uc011duc.3	Q86YW5	OTTHUMG00000016231	ENST00000426005.2:c.124C>G	chr6.hg19:g.41121748G>C	ENSP00000402855:p.Leu42Val	81.0	0.0		93.0	41.0	NM_178174	Q496B3|Q8IWY1|Q8IWY2	Missense_Mutation	SNP	ENST00000426005.2	hg19	CCDS4851.1	.	.	.	.	.	.	.	.	.	.	G	7.986	0.752245	0.15778	.	.	ENSG00000161911	ENST00000373127;ENST00000426005	T;T	0.21734	1.99;1.99	5.97	5.97	0.96955	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like fold (1);	0.514439	0.18110	N	0.151384	T	0.13157	0.0319	L	0.58669	1.825	0.80722	D	1	B;B	0.34161	0.397;0.439	B;B	0.31442	0.13;0.066	T	0.02417	-1.1162	10	0.29301	T	0.29	.	15.9281	0.79635	0.0:0.0:1.0:0.0	.	42;42	Q86YW5;Q86YW5-2	TRML1_HUMAN;.	V	42	ENSP00000362219:L42V;ENSP00000402855:L42V	ENSP00000362219:L42V	L	-	1	0	TREML1	41229726	0.462000	0.25791	0.207000	0.23584	0.032000	0.12392	4.697000	0.61782	2.837000	0.97791	0.655000	0.94253	CTC	.	.		0.632	TREML1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000043538.2	NM_178174	
FOXP4	116113	hgsc.bcm.edu	37	6	41558024	41558024	+	Missense_Mutation	SNP	A	A	G			TCGA-2Y-A9H7-01A-11D-A38X-10	TCGA-2Y-A9H7-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e447e430-664c-4a56-9017-620aef1f0ffb	b2219bf0-50ab-4c4d-a22d-6b2a5c4bb365	g.chr6:41558024A>G	ENST00000307972.4	+	11	1385	c.1373A>G	c.(1372-1374)cAt>cGt	p.H458R	FOXP4_ENST00000373063.3_Missense_Mutation_p.H445R|FOXP4_ENST00000373057.3_Missense_Mutation_p.H456R|FOXP4_ENST00000409208.1_Missense_Mutation_p.H446R|FOXP4_ENST00000373060.1_Missense_Mutation_p.H458R			Q8IVH2	FOXP4_HUMAN	forkhead box P4	458					embryonic foregut morphogenesis (GO:0048617)|heart development (GO:0007507)|lung secretory cell differentiation (GO:0061140)|negative regulation of lung goblet cell differentiation (GO:1901250)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(6)|upper_aerodigestive_tract(1)	16	Ovarian(28;0.0327)|Colorectal(47;0.196)					GCCCAGAATCATGAGTTCTAC	0.622																																					p.H458R		Atlas-SNP	.											.	FOXP4	83	.	0			c.A1373G						.						108.0	116.0	113.0					6																	41558024		2203	4300	6503	SO:0001583	missense	116113	exon12			AGAATCATGAGTT	AB080747	CCDS4856.1, CCDS34447.1, CCDS34448.1	6p21.1	2008-02-05			ENSG00000137166	ENSG00000137166		"""Forkhead boxes"""	20842	protein-coding gene	gene with protein product		608924					Standard	XM_006714991		Approved	FLJ40908	uc003oql.3	Q8IVH2	OTTHUMG00000014679	ENST00000307972.4:c.1373A>G	chr6.hg19:g.41558024A>G	ENSP00000309823:p.His458Arg	102.0	0.0		108.0	36.0	NM_001012426	Q5W098|Q7Z7F8|Q8IW55|Q96E19	Missense_Mutation	SNP	ENST00000307972.4	hg19	CCDS34447.1	.	.	.	.	.	.	.	.	.	.	A	12.89	2.074509	0.36566	.	.	ENSG00000137166	ENST00000373060;ENST00000373063;ENST00000409208;ENST00000373057;ENST00000307972	D;D;D;D;D	0.89617	-2.5;-2.54;-2.53;-2.5;-2.5	3.95	3.95	0.45737	Winged helix-turn-helix transcription repressor DNA-binding (1);	0.128751	0.53938	D	0.000058	T	0.73536	0.3599	L	0.36672	1.1	0.41306	D	0.987076	B;B;B	0.17465	0.022;0.012;0.011	B;B;B	0.14578	0.009;0.011;0.002	T	0.69986	-0.4996	10	0.20519	T	0.43	.	13.147	0.59467	1.0:0.0:0.0:0.0	.	445;456;458	Q8IW55;Q7Z7F8;Q8IVH2	.;.;FOXP4_HUMAN	R	458;445;446;456;458	ENSP00000362151:H458R;ENSP00000362154:H445R;ENSP00000386958:H446R;ENSP00000362148:H456R;ENSP00000309823:H458R	ENSP00000309823:H458R	H	+	2	0	FOXP4	41666002	1.000000	0.71417	0.987000	0.45799	0.958000	0.62258	6.296000	0.72751	1.576000	0.49790	0.374000	0.22700	CAT	.	.		0.622	FOXP4-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000106767.1	NM_138457	
TBP	6908	hgsc.bcm.edu	37	6	170871004	170871004	+	Silent	SNP	G	G	A			TCGA-2Y-A9H7-01A-11D-A38X-10	TCGA-2Y-A9H7-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e447e430-664c-4a56-9017-620aef1f0ffb	b2219bf0-50ab-4c4d-a22d-6b2a5c4bb365	g.chr6:170871004G>A	ENST00000392092.2	+	3	459	c.180G>A	c.(178-180)caG>caA	p.Q60Q	TBP_ENST00000230354.6_Silent_p.Q60Q|TBP_ENST00000540980.1_Silent_p.Q40Q	NM_003194.4	NP_003185.1	P20226	TBP_HUMAN	TATA box binding protein	60	Poly-Gln.				cell death (GO:0008219)|gene expression (GO:0010467)|positive regulation of transcription, DNA-templated (GO:0045893)|spermatogenesis (GO:0007283)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription from RNA polymerase III promoter (GO:0006383)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	cytoplasm (GO:0005737)|female pronucleus (GO:0001939)|male pronucleus (GO:0001940)|nuclear euchromatin (GO:0005719)|nucleoplasm (GO:0005654)|transcription factor TFIIA complex (GO:0005672)|transcription factor TFIID complex (GO:0005669)	repressing transcription factor binding (GO:0070491)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(9)|ovary(1)|prostate(4)|urinary_tract(1)	26		Breast(66;5.08e-05)|Ovarian(120;0.125)|Esophageal squamous(34;0.246)		OV - Ovarian serous cystadenocarcinoma(33;1.07e-22)|BRCA - Breast invasive adenocarcinoma(81;5.01e-06)|GBM - Glioblastoma multiforme(31;0.00591)		Ggcagcagcagcaacaacaac	0.542																																					p.Q60Q		Atlas-SNP	.											.	TBP	58	.	0			c.G180A						.						43.0	45.0	44.0					6																	170871004		2203	4300	6503	SO:0001819	synonymous_variant	6908	exon3			GCAGCAGCAACAA	M55654	CCDS5315.1, CCDS55077.1	6q27	2014-04-02			ENSG00000112592	ENSG00000112592		"""General transcription factors"""	11588	protein-coding gene	gene with protein product		600075		GTF2D1, SCA17		2194289, 11448935	Standard	NM_003194		Approved	TFIID	uc003qxu.3	P20226	OTTHUMG00000016084	ENST00000392092.2:c.180G>A	chr6.hg19:g.170871004G>A		54.0	0.0		30.0	5.0	NM_003194	B4E3B3|F5H869|Q16845|Q6IBM6|Q9UC02	Silent	SNP	ENST00000392092.2	hg19	CCDS5315.1																																																																																			.	.		0.542	TBP-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000043271.2	NM_003194	
AMPH	273	hgsc.bcm.edu	37	7	38543259	38543259	+	Missense_Mutation	SNP	C	C	A			TCGA-2Y-A9H7-01A-11D-A38X-10	TCGA-2Y-A9H7-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e447e430-664c-4a56-9017-620aef1f0ffb	b2219bf0-50ab-4c4d-a22d-6b2a5c4bb365	g.chr7:38543259C>A	ENST00000356264.2	-	3	411	c.196G>T	c.(196-198)Gca>Tca	p.A66S	AMPH_ENST00000428293.2_Missense_Mutation_p.A66S|AMPH_ENST00000325590.5_Missense_Mutation_p.A66S	NM_001635.3	NP_001626.1	P49418	AMPH_HUMAN	amphiphysin	66	BAR. {ECO:0000255|PROSITE- ProRule:PRU00361}.				endocytosis (GO:0006897)|learning (GO:0007612)|synaptic transmission (GO:0007268)|synaptic vesicle endocytosis (GO:0048488)	actin cytoskeleton (GO:0015629)|cell junction (GO:0030054)|leading edge membrane (GO:0031256)|synaptic vesicle (GO:0008021)	phospholipid binding (GO:0005543)			breast(1)|endometrium(3)|kidney(3)|large_intestine(12)|liver(3)|lung(27)|ovary(3)|prostate(1)|skin(7)|upper_aerodigestive_tract(2)	62						CCTTTGATTGCTGCTAAATAT	0.388																																					p.A66S		Atlas-SNP	.											.	AMPH	157	.	0			c.G196T						.						232.0	193.0	206.0					7																	38543259		2203	4300	6503	SO:0001583	missense	273	exon3			TGATTGCTGCTAA		CCDS5456.1, CCDS47574.1	7p14-p13	2007-06-19	2007-06-19		ENSG00000078053	ENSG00000078053			471	protein-coding gene	gene with protein product		600418	"""amphiphysin (Stiff-Mann syndrome with breast cancer 128kD autoantigen)"", ""amphiphysin (Stiff-Man syndrome with breast cancer 128kDa autoantigen)"""			8245793	Standard	NM_139316		Approved		uc003tgu.3	P49418	OTTHUMG00000023725	ENST00000356264.2:c.196G>T	chr7.hg19:g.38543259C>A	ENSP00000348602:p.Ala66Ser	53.0	0.0		89.0	35.0	NM_139316	A4D1X8|A4D1X9|O43538|Q75MJ8|Q75MK5|Q75MM3|Q8N4G0	Missense_Mutation	SNP	ENST00000356264.2	hg19	CCDS5456.1	.	.	.	.	.	.	.	.	.	.	C	16.28	3.077713	0.55753	.	.	ENSG00000078053	ENST00000325590;ENST00000356264;ENST00000428293;ENST00000544070	T;T;T	0.60548	0.18;0.18;0.18	5.92	5.92	0.95590	BAR (3);	0.000000	0.85682	D	0.000000	T	0.67078	0.2855	L	0.39633	1.23	0.58432	D	0.999997	D;D	0.76494	0.991;0.999	D;D	0.80764	0.962;0.994	T	0.58205	-0.7677	10	0.15952	T	0.53	-20.0998	17.2374	0.87002	0.0:1.0:0.0:0.0	.	66;66	P49418-2;P49418	.;AMPH_HUMAN	S	66	ENSP00000317441:A66S;ENSP00000348602:A66S;ENSP00000390734:A66S	ENSP00000317441:A66S	A	-	1	0	AMPH	38509784	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.642000	0.61383	2.809000	0.96659	0.655000	0.94253	GCA	.	.		0.388	AMPH-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000226953.2	NM_001635	
ZNF394	84124	hgsc.bcm.edu	37	7	99097503	99097503	+	Missense_Mutation	SNP	A	A	C			TCGA-2Y-A9H7-01A-11D-A38X-10	TCGA-2Y-A9H7-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e447e430-664c-4a56-9017-620aef1f0ffb	b2219bf0-50ab-4c4d-a22d-6b2a5c4bb365	g.chr7:99097503A>C	ENST00000337673.6	-	1	417	c.214T>G	c.(214-216)Tac>Gac	p.Y72D	ZNF394_ENST00000394177.3_Intron|ZNF394_ENST00000426306.2_Missense_Mutation_p.Y72D|ZNF789_ENST00000494186.1_Intron|ZNF789_ENST00000493485.1_Intron	NM_032164.2	NP_115540.2	Q53GI3	ZN394_HUMAN	zinc finger protein 394	72	SCAN box. {ECO:0000255|PROSITE- ProRule:PRU00187}.				transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|liver(1)|lung(5)|stomach(1)|urinary_tract(1)	16	all_cancers(62;2.54e-08)|all_epithelial(64;2.55e-09)|Lung NSC(181;0.0053)|all_lung(186;0.00895)|Esophageal squamous(72;0.0166)					ACCTCCTGGTAACGCAGCTGC	0.622																																					p.Y72D	Ovarian(24;589 697 9939 12704 40742)	Atlas-SNP	.											.	ZNF394	48	.	0			c.T214G						.						49.0	50.0	50.0					7																	99097503		2203	4300	6503	SO:0001583	missense	84124	exon1			CCTGGTAACGCAG	BC025241	CCDS5666.1	7q22.1	2014-01-28			ENSG00000160908	ENSG00000160908		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	18832	protein-coding gene	gene with protein product							Standard	NM_032164		Approved	ZKSCAN14, FLJ12298, ZSCAN46	uc003uqs.3	Q53GI3	OTTHUMG00000154660	ENST00000337673.6:c.214T>G	chr7.hg19:g.99097503A>C	ENSP00000337363:p.Tyr72Asp	57.0	0.0		37.0	13.0	NM_032164	A4D281|Q05DA6|Q6P5X9|Q8TB27|Q9HA37|Q9UD51	Missense_Mutation	SNP	ENST00000337673.6	hg19	CCDS5666.1	.	.	.	.	.	.	.	.	.	.	A	20.5	3.993101	0.74703	.	.	ENSG00000160908	ENST00000337673;ENST00000426306	T;T	0.07114	3.22;3.22	3.98	3.98	0.46160	Retrovirus capsid, C-terminal (1);Transcription regulator SCAN (3);	0.000000	0.43260	D	0.000588	T	0.35711	0.0941	H	0.94503	3.545	0.34367	D	0.691645	D;D	0.89917	1.0;1.0	D;D	0.81914	0.995;0.993	T	0.59590	-0.7426	10	0.87932	D	0	.	9.5527	0.39319	1.0:0.0:0.0:0.0	.	72;72	Q05DA6;Q53GI3	.;ZN394_HUMAN	D	72	ENSP00000337363:Y72D;ENSP00000409565:Y72D	ENSP00000337363:Y72D	Y	-	1	0	ZNF394	98935439	0.965000	0.33210	0.986000	0.45419	0.731000	0.41821	3.287000	0.51732	2.035000	0.60131	0.459000	0.35465	TAC	.	.		0.622	ZNF394-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336498.1	NM_032164	
ALKBH4	54784	hgsc.bcm.edu	37	7	102105175	102105175	+	Missense_Mutation	SNP	C	C	T			TCGA-2Y-A9H7-01A-11D-A38X-10	TCGA-2Y-A9H7-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e447e430-664c-4a56-9017-620aef1f0ffb	b2219bf0-50ab-4c4d-a22d-6b2a5c4bb365	g.chr7:102105175C>T	ENST00000292566.3	-	1	148	c.109G>A	c.(109-111)Gag>Aag	p.E37K	MIR5090_ENST00000582533.1_RNA|LRWD1_ENST00000292616.5_5'Flank	NM_017621.3	NP_060091.1	Q9NXW9	ALKB4_HUMAN	alkB, alkylation repair homolog 4 (E. coli)	37					actomyosin structure organization (GO:0031032)|cleavage furrow ingression (GO:0036090)|protein demethylation (GO:0006482)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	contractile ring (GO:0070938)|cytoplasm (GO:0005737)|midbody (GO:0030496)|nucleus (GO:0005634)	actin binding (GO:0003779)|demethylase activity (GO:0032451)|metal ion binding (GO:0046872)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)			kidney(1)|lung(5)|skin(2)	8						GGGGGCAGCTCCCAGGGCGGG	0.687																																					p.E37K		Atlas-SNP	.											.	ALKBH4	21	.	0			c.G109A						.						14.0	19.0	17.0					7																	102105175		2149	4237	6386	SO:0001583	missense	54784	exon1			GCAGCTCCCAGGG	BC017096	CCDS5723.1	7q22.1	2006-02-09			ENSG00000160993	ENSG00000160993		"""Alkylation repair homologs"""	21900	protein-coding gene	gene with protein product		613302					Standard	NM_017621		Approved	FLJ20013	uc003uzl.3	Q9NXW9	OTTHUMG00000157720	ENST00000292566.3:c.109G>A	chr7.hg19:g.102105175C>T	ENSP00000292566:p.Glu37Lys	125.0	0.0		144.0	58.0	NM_017621	Q53H92|Q9H6A4	Missense_Mutation	SNP	ENST00000292566.3	hg19	CCDS5723.1	.	.	.	.	.	.	.	.	.	.	C	0.296	-0.976719	0.02215	.	.	ENSG00000160993	ENST00000292566	T	0.49139	0.79	5.18	-2.04	0.07343	.	1.188620	0.05847	N	0.620516	T	0.25044	0.0608	N	0.10972	0.075	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.22277	-1.0221	10	0.09590	T	0.72	-1.8695	9.5419	0.39257	0.0:0.3959:0.3103:0.2937	.	37	Q9NXW9	ALKB4_HUMAN	K	37	ENSP00000292566:E37K	ENSP00000292566:E37K	E	-	1	0	ALKBH4	101892180	0.677000	0.27577	0.719000	0.30619	0.049000	0.14656	-0.095000	0.11077	-0.059000	0.13154	-0.657000	0.03884	GAG	.	.		0.687	ALKBH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349503.1	NM_017621	
TRPV5	56302	hgsc.bcm.edu	37	7	142626585	142626585	+	Missense_Mutation	SNP	C	C	T			TCGA-2Y-A9H7-01A-11D-A38X-10	TCGA-2Y-A9H7-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e447e430-664c-4a56-9017-620aef1f0ffb	b2219bf0-50ab-4c4d-a22d-6b2a5c4bb365	g.chr7:142626585C>T	ENST00000265310.1	-	4	773	c.425G>A	c.(424-426)aGt>aAt	p.S142N	TRPV5_ENST00000442623.1_Missense_Mutation_p.S142N	NM_019841.4	NP_062815.2	Q9NQA5	TRPV5_HUMAN	transient receptor potential cation channel, subfamily V, member 5	142					calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|ion transmembrane transport (GO:0034220)|protein tetramerization (GO:0051262)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)			NS(1)|breast(2)|central_nervous_system(3)|endometrium(2)|kidney(1)|large_intestine(14)|lung(32)|ovary(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	67	Melanoma(164;0.059)					GGCAGAGACACTGGCCCTGCG	0.597																																					p.S142N		Atlas-SNP	.											.	TRPV5	164	.	0			c.G425A						.						87.0	78.0	81.0					7																	142626585		2203	4300	6503	SO:0001583	missense	56302	exon4			GAGACACTGGCCC	AJ271207	CCDS5875.1	7q34	2013-01-10	2002-01-29	2002-02-01	ENSG00000127412	ENSG00000127412		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	3145	protein-coding gene	gene with protein product		606679	"""epithelial calcium channel 1"""	ECAC1		10944439, 10945469, 16382100	Standard	NM_019841		Approved	CaT2	uc003wby.1	Q9NQA5	OTTHUMG00000157157	ENST00000265310.1:c.425G>A	chr7.hg19:g.142626585C>T	ENSP00000265310:p.Ser142Asn	88.0	0.0		85.0	36.0	NM_019841	A4D2H7|E9PBZ6|Q8N4C1|Q8NDW5|Q8NDX7|Q8NDX8|Q96PM6	Missense_Mutation	SNP	ENST00000265310.1	hg19	CCDS5875.1	.	.	.	.	.	.	.	.	.	.	C	11.33	1.606211	0.28623	.	.	ENSG00000127412	ENST00000265310;ENST00000439304;ENST00000442623	T;T;T	0.49720	0.77;0.77;0.77	4.85	3.95	0.45737	Ankyrin repeat-containing domain (4);	0.209114	0.51477	D	0.000099	T	0.19327	0.0464	N	0.02865	-0.47	0.25441	N	0.98809	B;B	0.11235	0.0;0.004	B;B	0.09377	0.004;0.004	T	0.06285	-1.0835	10	0.27785	T	0.31	-0.0019	5.4082	0.16332	0.0:0.7323:0.0:0.2677	.	142;142	E9PBZ6;Q9NQA5	.;TRPV5_HUMAN	N	142;136;142	ENSP00000265310:S142N;ENSP00000406361:S136N;ENSP00000406572:S142N	ENSP00000265310:S142N	S	-	2	0	TRPV5	142336707	0.987000	0.35691	0.977000	0.42913	0.929000	0.56500	2.442000	0.44873	2.396000	0.81511	0.563000	0.77884	AGT	.	.		0.597	TRPV5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347660.1	NM_019841	
SLC35G5	83650	hgsc.bcm.edu	37	8	11189172	11189172	+	Missense_Mutation	SNP	G	G	T			TCGA-2Y-A9H7-01A-11D-A38X-10	TCGA-2Y-A9H7-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e447e430-664c-4a56-9017-620aef1f0ffb	b2219bf0-50ab-4c4d-a22d-6b2a5c4bb365	g.chr8:11189172G>T	ENST00000382435.4	+	1	776	c.557G>T	c.(556-558)gGt>gTt	p.G186V		NM_001282300.1|NM_054028.1	NP_001269229.1|NP_473369.1	Q96KT7	S35G5_HUMAN	solute carrier family 35, member G5	186						integral component of membrane (GO:0016021)											GGGACCACAGGTGTCTACACC	0.592																																					p.G186V		Atlas-SNP	.											.	.	.	.	0			c.G557T						.						159.0	155.0	156.0					8																	11189172		2203	4300	6503	SO:0001583	missense	83650	exon1			CCACAGGTGTCTA	AJ291677	CCDS5980.1	8p23.1	2013-05-22	2011-08-03	2011-08-03	ENSG00000177710	ENSG00000177710		"""Solute carriers"""	15546	protein-coding gene	gene with protein product		615199	"""acyl-malonyl condensing enzyme 1-like 2"""	AMAC, AMAC1L2			Standard	NM_054028		Approved		uc003wtp.1	Q96KT7	OTTHUMG00000090653	ENST00000382435.4:c.557G>T	chr8.hg19:g.11189172G>T	ENSP00000371872:p.Gly186Val	50.0	0.0		30.0	19.0	NM_054028	A2RRL6	Missense_Mutation	SNP	ENST00000382435.4	hg19	CCDS5980.1	.	.	.	.	.	.	.	.	.	.	G	9.298	1.052472	0.19907	.	.	ENSG00000177710	ENST00000382435	T	0.28895	1.59	.	.	.	.	0.000000	0.48767	D	0.000169	T	0.32971	0.0847	L	0.29908	0.895	0.34262	D	0.68	D	0.69078	0.997	D	0.63597	0.916	T	0.37056	-0.9722	8	0.27082	T	0.32	-5.8052	.	.	.	.	186	Q96KT7	S35G5_HUMAN	V	186	ENSP00000371872:G186V	ENSP00000371872:G186V	G	+	2	0	SLC35G5	11226582	0.001000	0.12720	0.053000	0.19242	0.042000	0.13812	0.240000	0.18042	0.088000	0.17205	0.089000	0.15464	GGT	.	.		0.592	SLC35G5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207313.2	NM_054028	
NKX3-1	4824	hgsc.bcm.edu	37	8	23538754	23538754	+	Missense_Mutation	SNP	A	A	T			TCGA-2Y-A9H7-01A-11D-A38X-10	TCGA-2Y-A9H7-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e447e430-664c-4a56-9017-620aef1f0ffb	b2219bf0-50ab-4c4d-a22d-6b2a5c4bb365	g.chr8:23538754A>T	ENST00000380871.4	-	2	722	c.685T>A	c.(685-687)Tgg>Agg	p.W229R	NKX3-1_ENST00000523261.1_Missense_Mutation_p.W154R	NM_006167.3	NP_006158.2	Q99801	NKX31_HUMAN	NK3 homeobox 1	229					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|androgen receptor signaling pathway (GO:0030521)|branching involved in prostate gland morphogenesis (GO:0060442)|branching morphogenesis of an epithelial tube (GO:0048754)|cellular response to drug (GO:0035690)|cellular response to hypoxia (GO:0071456)|cellular response to interleukin-1 (GO:0071347)|cellular response to steroid hormone stimulus (GO:0071383)|cellular response to tumor necrosis factor (GO:0071356)|dorsal aorta development (GO:0035907)|epithelial cell proliferation involved in salivary gland morphogenesis (GO:0060664)|heart development (GO:0007507)|male gonad development (GO:0008584)|metanephros development (GO:0001656)|mitotic cell cycle arrest (GO:0071850)|multicellular organismal development (GO:0007275)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of estrogen receptor binding (GO:0071899)|negative regulation of gene expression (GO:0010629)|negative regulation of insulin-like growth factor receptor signaling pathway (GO:0043569)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of transcription, DNA-templated (GO:0045892)|pharyngeal system development (GO:0060037)|positive regulation of androgen secretion (GO:2000836)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell death (GO:0010942)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of gene expression (GO:0010628)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of response to DNA damage stimulus (GO:2001022)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein kinase B signaling (GO:0043491)|regulation of transcription, DNA-templated (GO:0006355)|response to testosterone (GO:0033574)|salivary gland development (GO:0007431)|somitogenesis (GO:0001756)|steroid hormone mediated signaling pathway (GO:0043401)	intracellular (GO:0005622)|nucleus (GO:0005634)	androgen receptor activity (GO:0004882)|core promoter binding (GO:0001047)|estrogen receptor activity (GO:0030284)|estrogen receptor binding (GO:0030331)|histone deacetylase binding (GO:0042826)|protein kinase activator activity (GO:0030295)|protein self-association (GO:0043621)|RNA polymerase II core promoter sequence-specific DNA binding transcription factor activity (GO:0000983)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|transcription regulatory region sequence-specific DNA binding (GO:0000976)			large_intestine(3)|lung(4)|prostate(5)|skin(2)	14		Prostate(55;0.114)		Colorectal(74;0.0146)|COAD - Colon adenocarcinoma(73;0.061)|BRCA - Breast invasive adenocarcinoma(99;0.0708)		GCTGGGCTCCAGCTGCCCACG	0.542																																					p.W229R		Atlas-SNP	.											.	NKX3-1	25	.	0			c.T685A						.						52.0	53.0	53.0					8																	23538754		2203	4300	6503	SO:0001583	missense	4824	exon2			GGCTCCAGCTGCC		CCDS6042.1, CCDS59095.1	8p21.2	2012-03-09	2007-07-09	2002-10-04	ENSG00000167034	ENSG00000167034		"""Homeoboxes / ANTP class : NKL subclass"""	7838	protein-coding gene	gene with protein product		602041	"""NK homeobox (Drosophila), family 3, A"", ""NK3 transcription factor related, locus 1 (Drosophila)"""	NKX3A		9226374	Standard	NM_006167		Approved	NKX3.1, BAPX2	uc011kzx.2	Q99801	OTTHUMG00000097851	ENST00000380871.4:c.685T>A	chr8.hg19:g.23538754A>T	ENSP00000370253:p.Trp229Arg	94.0	0.0		41.0	29.0	NM_006167	O15465|Q9H2P4|Q9H2P5|Q9H2P6|Q9H2P7|Q9HBG0	Missense_Mutation	SNP	ENST00000380871.4	hg19	CCDS6042.1	.	.	.	.	.	.	.	.	.	.	A	20.6	4.024483	0.75390	.	.	ENSG00000167034	ENST00000380871;ENST00000300332;ENST00000523261	D;D	0.94758	-3.51;-3.33	5.97	5.97	0.96955	.	0.228552	0.31734	N	0.007150	D	0.96901	0.8988	M	0.79475	2.455	0.58432	D	0.999999	D	0.76494	0.999	D	0.71184	0.972	D	0.97350	0.9963	10	0.87932	D	0	.	14.4129	0.67128	1.0:0.0:0.0:0.0	.	229	Q99801	NKX31_HUMAN	R	229;185;154	ENSP00000370253:W229R;ENSP00000429729:W154R	ENSP00000300332:W185R	W	-	1	0	NKX3-1	23594699	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	8.809000	0.91944	2.288000	0.76882	0.533000	0.62120	TGG	.	.		0.542	NKX3-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215141.2		
WDYHV1	55093	hgsc.bcm.edu	37	8	124449502	124449502	+	Silent	SNP	C	C	A			TCGA-2Y-A9H7-01A-11D-A38X-10	TCGA-2Y-A9H7-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e447e430-664c-4a56-9017-620aef1f0ffb	b2219bf0-50ab-4c4d-a22d-6b2a5c4bb365	g.chr8:124449502C>A	ENST00000287387.2	+	5	561	c.436C>A	c.(436-438)Cga>Aga	p.R146R	WDYHV1_ENST00000518125.1_5'UTR|WDYHV1_ENST00000517609.1_3'UTR|WDYHV1_ENST00000523356.1_Silent_p.R146R|WDYHV1_ENST00000523984.1_Silent_p.R86R	NM_018024.1	NP_060494.1	Q96HA8	NTAQ1_HUMAN	WDYHV motif containing 1	146					cellular protein modification process (GO:0006464)	cytosol (GO:0005829)|nucleus (GO:0005634)	protein-N-terminal glutamine amidohydrolase activity (GO:0070773)			endometrium(2)|kidney(1)|large_intestine(1)|lung(7)|ovary(1)|prostate(1)|skin(1)|stomach(3)	17						TGCTTCTGACCGATCTCACAT	0.458																																					p.R146R		Atlas-SNP	.											.	WDYHV1	30	.	0			c.C436A						.						76.0	75.0	75.0					8																	124449502		2203	4300	6503	SO:0001819	synonymous_variant	55093	exon5			TCTGACCGATCTC	AK001066	CCDS6344.1, CCDS64965.1	8q24.13	2008-10-01	2008-10-01	2008-10-01		ENSG00000156795			25490	protein-coding gene	gene with protein product			"""chromosome 8 open reading frame 32"""	C8orf32		12477932	Standard	NM_018024		Approved	FLJ10204	uc003yqn.1	Q96HA8		ENST00000287387.2:c.436C>A	chr8.hg19:g.124449502C>A		57.0	0.0		73.0	31.0	NM_018024	B4DE68|Q9NW95	Silent	SNP	ENST00000287387.2	hg19	CCDS6344.1																																																																																			.	.		0.458	WDYHV1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381772.1	NM_018024	
HSDL2	84263	hgsc.bcm.edu	37	9	115179158	115179158	+	Missense_Mutation	SNP	G	G	T			TCGA-2Y-A9H7-01A-11D-A38X-10	TCGA-2Y-A9H7-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e447e430-664c-4a56-9017-620aef1f0ffb	b2219bf0-50ab-4c4d-a22d-6b2a5c4bb365	g.chr9:115179158G>T	ENST00000398805.3	+	5	660	c.433G>T	c.(433-435)Gtt>Ttt	p.V145F	HSDL2_ENST00000262542.7_Missense_Mutation_p.V25F|HSDL2_ENST00000398803.1_Intron|HSDL2_ENST00000539114.1_Intron|HSDL2_ENST00000488101.1_3'UTR	NM_032303.4	NP_115679.2	Q6YN16	HSDL2_HUMAN	hydroxysteroid dehydrogenase like 2	145						membrane (GO:0016020)|mitochondrion (GO:0005739)|peroxisome (GO:0005777)	oxidoreductase activity (GO:0016491)			NS(1)|breast(2)|cervix(2)|endometrium(1)|large_intestine(2)|lung(2)|prostate(1)|upper_aerodigestive_tract(2)	13						AAAGAGCAAAGTTGCTCATAT	0.373																																					p.V145F		Atlas-SNP	.											.	HSDL2	24	.	0			c.G433T						.						97.0	91.0	93.0					9																	115179158		1836	4093	5929	SO:0001583	missense	84263	exon5			AGCAAAGTTGCTC	AY093428	CCDS43864.1, CCDS56582.1	9q32	2011-09-14			ENSG00000119471	ENSG00000119471		"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 1"""	18572	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 13C, member 1"""		"""chromosome 9 open reading frame 99"""	C9orf99		12834046, 19027726	Standard	NM_032303		Approved	SDR13C1	uc004bga.2	Q6YN16	OTTHUMG00000020504	ENST00000398805.3:c.433G>T	chr9.hg19:g.115179158G>T	ENSP00000381785:p.Val145Phe	44.0	0.0		83.0	39.0	NM_032303	A8K1L4|A8K8X1|A8MSV3|Q658M8|Q9BT58	Missense_Mutation	SNP	ENST00000398805.3	hg19	CCDS43864.1	.	.	.	.	.	.	.	.	.	.	G	13.63	2.293201	0.40594	.	.	ENSG00000119471	ENST00000398805;ENST00000262542	D;T	0.87887	-2.31;1.98	6.17	-4.94	0.03057	NAD(P)-binding domain (1);	0.652152	0.16698	N	0.203256	T	0.68778	0.3038	N	0.03154	-0.405	0.58432	D	0.999999	P	0.38677	0.642	B	0.35688	0.208	T	0.59043	-0.7528	10	0.39692	T	0.17	.	16.1353	0.81481	0.4063:0.0:0.5937:0.0	.	145	Q6YN16	HSDL2_HUMAN	F	145;25	ENSP00000381785:V145F;ENSP00000262542:V25F	ENSP00000262542:V25F	V	+	1	0	HSDL2	114218979	1.000000	0.71417	0.711000	0.30485	0.750000	0.42670	1.418000	0.34782	-1.258000	0.02471	-0.768000	0.03414	GTT	.	.		0.373	HSDL2-002	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053681.1	NM_032303	
CIZ1	25792	hgsc.bcm.edu	37	9	130943066	130943066	+	Nonsense_Mutation	SNP	C	C	A			TCGA-2Y-A9H7-01A-11D-A38X-10	TCGA-2Y-A9H7-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e447e430-664c-4a56-9017-620aef1f0ffb	b2219bf0-50ab-4c4d-a22d-6b2a5c4bb365	g.chr9:130943066C>A	ENST00000393608.1	-	6	818	c.616G>T	c.(616-618)Gaa>Taa	p.E206*	CIZ1_ENST00000357558.5_Nonsense_Mutation_p.E206*|CIZ1_ENST00000538431.1_Nonsense_Mutation_p.E206*|CIZ1_ENST00000372948.3_Nonsense_Mutation_p.E206*|CIZ1_ENST00000277465.4_Nonsense_Mutation_p.E206*|CIZ1_ENST00000325721.8_Nonsense_Mutation_p.E177*|CIZ1_ENST00000372954.1_Nonsense_Mutation_p.E182*|CIZ1_ENST00000541172.1_Nonsense_Mutation_p.E105*|CIZ1_ENST00000372938.5_Nonsense_Mutation_p.E206*|CIZ1_ENST00000476727.2_5'UTR	NM_012127.2	NP_036259.2	Q9ULV3	CIZ1_HUMAN	CDKN1A interacting zinc finger protein 1	206					maintenance of protein location in nucleus (GO:0051457)|positive regulation of DNA-dependent DNA replication initiation (GO:0032298)	nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(8)|liver(1)|lung(9)|ovary(3)|prostate(2)|urinary_tract(2)	35						GACTTGTCTTCCACAGGCATT	0.567																																					p.E236X		Atlas-SNP	.											.	CIZ1	75	.	0			c.G706T						.						48.0	52.0	51.0					9																	130943066		2203	4300	6503	SO:0001587	stop_gained	25792	exon6			TGTCTTCCACAGG	AB030835	CCDS6894.1, CCDS48033.1, CCDS48034.1, CCDS75910.1	9q34.1	2012-10-05			ENSG00000148337	ENSG00000148337			16744	protein-coding gene	gene with protein product		611420				10529385	Standard	NM_001131015		Approved	LSFR1, ZNF356	uc011mas.2	Q9ULV3	OTTHUMG00000020735	ENST00000393608.1:c.616G>T	chr9.hg19:g.130943066C>A	ENSP00000377232:p.Glu206*	35.0	0.0		25.0	10.0	NM_001257975	A8K9J8|B4E131|B7ZAS8|Q5SYW3|Q5SYW5|Q8WU72|Q9H868|Q9NYM8|Q9UHK4|Q9Y3F9|Q9Y3G0	Nonsense_Mutation	SNP	ENST00000393608.1	hg19	CCDS6894.1	.	.	.	.	.	.	.	.	.	.	C	36	5.950745	0.97139	.	.	ENSG00000148337	ENST00000372954;ENST00000393608;ENST00000538431;ENST00000357558;ENST00000325721;ENST00000537314;ENST00000541172;ENST00000277465;ENST00000372941;ENST00000372948;ENST00000372938;ENST00000415526;ENST00000324544	.	.	.	4.52	4.52	0.55395	.	0.313408	0.23079	N	0.052173	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.27785	T	0.31	-3.5089	12.938	0.58327	0.0:1.0:0.0:0.0	.	.	.	.	X	182;206;206;206;177;173;105;206;182;206;206;128;206	.	ENSP00000277465:E206X	E	-	1	0	CIZ1	129982887	0.553000	0.26513	0.985000	0.45067	0.962000	0.63368	3.303000	0.51858	2.497000	0.84241	0.655000	0.94253	GAA	.	.		0.567	CIZ1-203	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000054399.1	NM_012127	
SLC39A12	221074	hgsc.bcm.edu	37	10	18270325	18270325	+	Missense_Mutation	SNP	A	A	T			TCGA-2Y-A9H7-01A-11D-A38X-10	TCGA-2Y-A9H7-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e447e430-664c-4a56-9017-620aef1f0ffb	b2219bf0-50ab-4c4d-a22d-6b2a5c4bb365	g.chr10:18270325A>T	ENST00000377369.2	+	6	1282	c.1009A>T	c.(1009-1011)Agt>Tgt	p.S337C	SLC39A12_ENST00000377371.3_Missense_Mutation_p.S337C|SLC39A12_ENST00000539911.1_Missense_Mutation_p.S203C|SLC39A12_ENST00000377374.4_Missense_Mutation_p.S337C	NM_001145195.1|NM_001282733.1|NM_001282734.1	NP_001138667.1|NP_001269662.1|NP_001269663.1	Q504Y0	S39AC_HUMAN	solute carrier family 39 (zinc transporter), member 12	337					regulation of microtubule polymerization (GO:0031113)|regulation of neuron projection development (GO:0010975)|signal transduction (GO:0007165)|zinc ion transmembrane import (GO:0071578)	integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	zinc ion transmembrane transporter activity (GO:0005385)			NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|kidney(3)|large_intestine(5)|lung(38)|ovary(3)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	60						TAAGCAAATGAGTCCAGGGAT	0.502																																					p.S337C		Atlas-SNP	.											.	SLC39A12	181	.	0			c.A1009T						.						77.0	71.0	73.0					10																	18270325		2203	4300	6503	SO:0001583	missense	221074	exon6			CAAATGAGTCCAG		CCDS7124.1, CCDS44362.1, CCDS60493.1, CCDS60494.1	10p12.33	2013-05-22			ENSG00000148482	ENSG00000148482		"""Solute carriers"""	20860	protein-coding gene	gene with protein product		608734	"""solute carrier family 39 (metal ion transporter), member 12"""			12659941	Standard	NM_152725		Approved	FLJ30499	uc001ipo.2	Q504Y0	OTTHUMG00000017759	ENST00000377369.2:c.1009A>T	chr10.hg19:g.18270325A>T	ENSP00000366586:p.Ser337Cys	130.0	0.0		135.0	44.0	NM_152725	B7ZL35|C9JJL4|Q49AN8|Q4G0L3|Q5VWV8|Q5VWV9|Q6NZY5|Q96NN4	Missense_Mutation	SNP	ENST00000377369.2	hg19	CCDS44362.1	.	.	.	.	.	.	.	.	.	.	A	15.85	2.954772	0.53293	.	.	ENSG00000148482	ENST00000377369;ENST00000377374;ENST00000377371;ENST00000539911;ENST00000425219	T;T;T;T	0.55588	0.73;0.51;0.69;0.59	5.8	5.8	0.92144	.	0.119688	0.85682	D	0.000000	T	0.44685	0.1305	L	0.49699	1.58	0.54753	D	0.999982	B;B;P	0.37233	0.445;0.317;0.588	B;B;B	0.36418	0.224;0.159;0.224	T	0.43065	-0.9414	10	0.05620	T	0.96	-16.1981	16.1499	0.81605	1.0:0.0:0.0:0.0	.	337;337;337	Q504Y0-4;Q504Y0;Q504Y0-3	.;S39AC_HUMAN;.	C	337;337;337;203;257	ENSP00000366586:S337C;ENSP00000366591:S337C;ENSP00000366588:S337C;ENSP00000440445:S203C	ENSP00000366586:S337C	S	+	1	0	SLC39A12	18310331	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	5.162000	0.64942	2.220000	0.72140	0.533000	0.62120	AGT	.	.		0.502	SLC39A12-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_152725	
ARHGAP22	58504	hgsc.bcm.edu	37	10	49658574	49658574	+	Missense_Mutation	SNP	C	C	T			TCGA-2Y-A9H7-01A-11D-A38X-10	TCGA-2Y-A9H7-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e447e430-664c-4a56-9017-620aef1f0ffb	b2219bf0-50ab-4c4d-a22d-6b2a5c4bb365	g.chr10:49658574C>T	ENST00000249601.4	-	9	1894	c.1598G>A	c.(1597-1599)cGc>cAc	p.R533H	ARHGAP22_ENST00000417912.2_Missense_Mutation_p.R549H|ARHGAP22_ENST00000374170.1_Missense_Mutation_p.R374H|ARHGAP22_ENST00000374172.1_Missense_Mutation_p.R424H|ARHGAP22_ENST00000477708.2_Missense_Mutation_p.R366H|ARHGAP22_ENST00000417247.2_Missense_Mutation_p.R443H|ARHGAP22_ENST00000435790.2_Missense_Mutation_p.R539H	NM_001256024.1|NM_021226.3	NP_001242953.1|NP_067049.2	Q7Z5H3	RHG22_HUMAN	Rho GTPase activating protein 22	533	Ser-rich.				angiogenesis (GO:0001525)|cell differentiation (GO:0030154)|regulation of small GTPase mediated signal transduction (GO:0051056)|regulation of transcription, DNA-templated (GO:0006355)|small GTPase mediated signal transduction (GO:0007264)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	GTPase activator activity (GO:0005096)			endometrium(3)|large_intestine(3)|lung(7)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	18						GTCGCTGGCGCGGCAGGCCGT	0.721																																					p.R549H		Atlas-SNP	.											.	ARHGAP22	94	.	0			c.G1646A						.						9.0	10.0	10.0					10																	49658574		2099	4140	6239	SO:0001583	missense	58504	exon9			CTGGCGCGGCAGG	AY324801	CCDS7227.1, CCDS58079.1, CCDS58080.1, CCDS58081.1	10q11.23	2013-01-10			ENSG00000128805	ENSG00000128805		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	30320	protein-coding gene	gene with protein product		610585				8619474	Standard	NM_021226		Approved	RhoGAP2	uc010qgm.3	Q7Z5H3	OTTHUMG00000018176	ENST00000249601.4:c.1598G>A	chr10.hg19:g.49658574C>T	ENSP00000249601:p.Arg533His	53.0	0.0		47.0	21.0	NM_001256024	A0AVP7|A5YM75|B4DED8|B9EGA0|C9JDM2|O00152|Q6ZSB0	Missense_Mutation	SNP	ENST00000249601.4	hg19	CCDS7227.1	.	.	.	.	.	.	.	.	.	.	C	13.42	2.232279	0.39498	.	.	ENSG00000128805	ENST00000249601;ENST00000374172;ENST00000374170;ENST00000477708;ENST00000417247;ENST00000435790;ENST00000417912	T;T;T;T;T;T;T	0.28255	2.73;2.41;1.62;2.05;2.39;2.69;2.74	5.24	3.03	0.35002	.	0.722220	0.14384	N	0.322976	T	0.22589	0.0545	L	0.50333	1.59	0.21627	N	0.999613	B;B;B;B;B;P	0.46656	0.033;0.033;0.055;0.033;0.055;0.882	B;B;B;B;B;B	0.31614	0.007;0.007;0.016;0.007;0.016;0.133	T	0.09207	-1.0685	10	0.34782	T	0.22	.	11.9395	0.52892	0.0:0.8314:0.0:0.1686	.	539;533;549;533;443;366	B4DED8;A6NDI7;Q7Z5H3-2;Q7Z5H3;Q7Z5H3-3;D6R9V6	.;.;.;RHG22_HUMAN;.;.	H	533;424;374;366;443;539;549	ENSP00000249601:R533H;ENSP00000363287:R424H;ENSP00000363285:R374H;ENSP00000422868:R366H;ENSP00000410054:R443H;ENSP00000416701:R539H;ENSP00000412461:R549H	ENSP00000249601:R533H	R	-	2	0	ARHGAP22	49328580	0.997000	0.39634	0.989000	0.46669	0.905000	0.53344	2.376000	0.44292	1.211000	0.43351	0.591000	0.81541	CGC	.	.		0.721	ARHGAP22-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000358767.1	NM_021226	
CHAT	1103	hgsc.bcm.edu	37	10	50872913	50872913	+	Missense_Mutation	SNP	C	C	A			TCGA-2Y-A9H7-01A-11D-A38X-10	TCGA-2Y-A9H7-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e447e430-664c-4a56-9017-620aef1f0ffb	b2219bf0-50ab-4c4d-a22d-6b2a5c4bb365	g.chr10:50872913C>A	ENST00000337653.2	+	15	2221	c.2068C>A	c.(2068-2070)Ctt>Att	p.L690I	CHAT_ENST00000395562.2_Missense_Mutation_p.L608I|CHAT_ENST00000455728.2_Intron|CHAT_ENST00000395559.2_Missense_Mutation_p.L572I|CHAT_ENST00000339797.1_Missense_Mutation_p.L572I|CHAT_ENST00000351556.3_Missense_Mutation_p.L572I	NM_001142929.1|NM_020549.4	NP_001136401.1|NP_065574	P28329	CLAT_HUMAN	choline O-acetyltransferase	690					adult walking behavior (GO:0007628)|dendrite development (GO:0016358)|establishment of synaptic specificity at neuromuscular junction (GO:0007529)|glycerophospholipid biosynthetic process (GO:0046474)|muscle organ development (GO:0007517)|neuromuscular synaptic transmission (GO:0007274)|neurotransmitter biosynthetic process (GO:0042136)|neurotransmitter secretion (GO:0007269)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|rhythmic behavior (GO:0007622)|rhythmic excitation (GO:0043179)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)	choline O-acetyltransferase activity (GO:0004102)			central_nervous_system(3)|endometrium(2)|kidney(2)|large_intestine(11)|lung(34)|prostate(3)|urinary_tract(1)	56		all_neural(218;0.107)		GBM - Glioblastoma multiforme(2;0.000585)	Choline(DB00122)|Nicotine(DB00184)	AGAGACCATCCTTTTCTGCAT	0.512																																					p.L690I		Atlas-SNP	.											.	CHAT	162	.	0			c.C2068A						.						224.0	207.0	212.0					10																	50872913		2203	4300	6503	SO:0001583	missense	1103	exon15			ACCATCCTTTTCT	AF305907	CCDS7232.1, CCDS7233.1, CCDS44389.1	10q11.2	2010-05-11	2010-05-11		ENSG00000070748	ENSG00000070748	2.3.1.6		1912	protein-coding gene	gene with protein product		118490	"""choline acetyltransferase"""			1840566	Standard	NM_020984		Approved		uc001jhz.2	P28329	OTTHUMG00000018198	ENST00000337653.2:c.2068C>A	chr10.hg19:g.50872913C>A	ENSP00000337103:p.Leu690Ile	99.0	0.0		95.0	31.0	NM_020549	A2BDF4|A2BDF5|Q16488|Q9BQ23|Q9BQ35|Q9BQE1	Missense_Mutation	SNP	ENST00000337653.2	hg19	CCDS7232.1	.	.	.	.	.	.	.	.	.	.	C	4.855	0.158863	0.09236	.	.	ENSG00000070748	ENST00000339797;ENST00000351556;ENST00000395559;ENST00000337653;ENST00000395562	D;D;D;D;D	0.88818	-2.43;-2.43;-2.43;-2.43;-2.43	5.76	3.51	0.40186	.	0.187520	0.45606	D	0.000356	T	0.76069	0.3936	N	0.11651	0.15	0.35028	D	0.758538	B	0.18741	0.03	B	0.28849	0.095	T	0.70992	-0.4721	10	0.19147	T	0.46	-11.6538	6.9467	0.24522	0.1865:0.6799:0.0:0.1337	.	690	P28329	CLAT_HUMAN	I	572;572;572;690;608	ENSP00000343486:L572I;ENSP00000345878:L572I;ENSP00000378926:L572I;ENSP00000337103:L690I;ENSP00000378929:L608I	ENSP00000337103:L690I	L	+	1	0	CHAT	50542919	0.994000	0.37717	1.000000	0.80357	0.997000	0.91878	0.483000	0.22292	1.388000	0.46506	0.655000	0.94253	CTT	.	.		0.512	CHAT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047997.1	NM_020549	
PLEKHA1	59338	hgsc.bcm.edu	37	10	124189324	124189324	+	Missense_Mutation	SNP	C	C	T			TCGA-2Y-A9H7-01A-11D-A38X-10	TCGA-2Y-A9H7-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e447e430-664c-4a56-9017-620aef1f0ffb	b2219bf0-50ab-4c4d-a22d-6b2a5c4bb365	g.chr10:124189324C>T	ENST00000368990.3	+	12	1216	c.1085C>T	c.(1084-1086)tCt>tTt	p.S362F	PLEKHA1_ENST00000368988.1_Missense_Mutation_p.L376F|PLEKHA1_ENST00000368989.2_Missense_Mutation_p.L376F|PLEKHA1_ENST00000433307.1_Missense_Mutation_p.S362F|PLEKHA1_ENST00000538022.1_3'UTR	NM_001001974.2	NP_001001974.1	Q9HB21	PKHA1_HUMAN	pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 1	362					androgen metabolic process (GO:0008209)|B cell receptor signaling pathway (GO:0050853)|cellular response to hydrogen peroxide (GO:0070301)|establishment of protein localization (GO:0045184)|estrogen metabolic process (GO:0008210)|face morphogenesis (GO:0060325)|Leydig cell differentiation (GO:0033327)|luteinization (GO:0001553)|multicellular organism growth (GO:0035264)|negative regulation of protein kinase B signaling (GO:0051898)|palate development (GO:0060021)|phosphatidylinositol 3-kinase signaling (GO:0014065)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|post-embryonic development (GO:0009791)|ruffle organization (GO:0031529)|skeletal system morphogenesis (GO:0048705)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	PDZ domain binding (GO:0030165)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(5)|urinary_tract(1)	13		all_neural(114;0.0765)|Lung NSC(174;0.132)|all_lung(145;0.163)|Breast(234;0.238)				CAGACTGTCTCTCCAAGAGAA	0.468																																					p.S362F		Atlas-SNP	.											.	PLEKHA1	33	.	0			c.C1085T						.						97.0	91.0	93.0					10																	124189324		2203	4300	6503	SO:0001583	missense	59338	exon12			CTGTCTCTCCAAG	AF286160	CCDS7629.1, CCDS55730.1	10q26.3	2013-01-10	2002-01-14		ENSG00000107679	ENSG00000107679		"""Pleckstrin homology (PH) domain containing"""	14335	protein-coding gene	gene with protein product	"""tandem PH domain containing protein-1"""	607772	"""pleckstrin homology domain-containing, family A (phosphoinositide binding specific) member 1"""			11001876, 15485858	Standard	NM_001001974		Approved	TAPP1	uc001lge.2	Q9HB21	OTTHUMG00000019184	ENST00000368990.3:c.1085C>T	chr10.hg19:g.124189324C>T	ENSP00000357986:p.Ser362Phe	67.0	0.0		104.0	40.0	NM_021622	B3KQ55|D3DRE2|Q9BVK0	Missense_Mutation	SNP	ENST00000368990.3	hg19	CCDS7629.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	20.3|20.3	3.967131|3.967131	0.74131|0.74131	.|.	.|.	ENSG00000107679|ENSG00000107679	ENST00000368989;ENST00000368988|ENST00000368990;ENST00000409427;ENST00000433307	T;T|T;T	0.11277|0.06218	2.79;2.79|3.33;3.33	5.65|5.65	5.65|5.65	0.86999|0.86999	.|.	.|1.118330	.|0.06320	.|N	.|0.704226	T|T	0.09113|0.09113	0.0225|0.0225	N|N	0.19112|0.19112	0.55|0.55	0.80722|0.80722	D|D	1|1	.|B	.|0.29805	.|0.257	.|B	.|0.35353	.|0.201	T|T	0.51795|0.51795	-0.8660|-0.8660	7|9	0.29301|.	T|.	0.29|.	-4.4286|-4.4286	20.0793|20.0793	0.97766|0.97766	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|362	.|Q9HB21	.|PKHA1_HUMAN	F|F	376|362	ENSP00000357985:L376F;ENSP00000357984:L376F|ENSP00000357986:S362F;ENSP00000394416:S362F	ENSP00000357984:L376F|.	L|S	+|+	1|2	0|0	PLEKHA1|PLEKHA1	124179314|124179314	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	3.585000|3.585000	0.53943|0.53943	2.826000|2.826000	0.97356|0.97356	0.650000|0.650000	0.86243|0.86243	CTC|TCT	.	.		0.468	PLEKHA1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050783.1	NM_001001974	
ZNF214	7761	hgsc.bcm.edu	37	11	7022371	7022371	+	Silent	SNP	T	T	C			TCGA-2Y-A9H7-01A-11D-A38X-10	TCGA-2Y-A9H7-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e447e430-664c-4a56-9017-620aef1f0ffb	b2219bf0-50ab-4c4d-a22d-6b2a5c4bb365	g.chr11:7022371T>C	ENST00000278314.4	-	3	858	c.543A>G	c.(541-543)gaA>gaG	p.E181E	ZNF214_ENST00000536068.1_Silent_p.E181E|ZNF214_ENST00000531083.1_5'Flank	NM_013249.2	NP_037381.2	Q9UL59	ZN214_HUMAN	zinc finger protein 214	181					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(10)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	29				Epithelial(150;3.87e-08)|BRCA - Breast invasive adenocarcinoma(625;0.081)		TGAGCTTCTGTTCTTTTTCCA	0.438																																					p.E181E	Ovarian(22;251 657 736 21522 46864)	Atlas-SNP	.											.	ZNF214	65	.	0			c.A543G						.						110.0	111.0	110.0					11																	7022371		2200	4294	6494	SO:0001819	synonymous_variant	7761	exon3			CTTCTGTTCTTTT	AF056617	CCDS31418.1	11p15.4	2013-01-08				ENSG00000149050		"""Zinc fingers, C2H2-type"", ""-"""	13006	protein-coding gene	gene with protein product		605015					Standard	NM_013249		Approved		uc001mfa.2	Q9UL59		ENST00000278314.4:c.543A>G	chr11.hg19:g.7022371T>C		53.0	0.0		80.0	29.0	NM_013249	B2R8Q1	Silent	SNP	ENST00000278314.4	hg19	CCDS31418.1																																																																																			.	.		0.438	ZNF214-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385349.1		
UEVLD	55293	hgsc.bcm.edu	37	11	18553955	18553955	+	Missense_Mutation	SNP	T	T	C			TCGA-2Y-A9H7-01A-11D-A38X-10	TCGA-2Y-A9H7-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e447e430-664c-4a56-9017-620aef1f0ffb	b2219bf0-50ab-4c4d-a22d-6b2a5c4bb365	g.chr11:18553955T>C	ENST00000396197.3	-	12	1356	c.1328A>G	c.(1327-1329)aAa>aGa	p.K443R	UEVLD_ENST00000379387.4_Missense_Mutation_p.K421R|UEVLD_ENST00000535484.1_3'UTR|UEVLD_ENST00000540666.1_5'UTR|UEVLD_ENST00000541984.1_3'UTR|UEVLD_ENST00000320750.6_3'UTR|UEVLD_ENST00000543987.1_3'UTR	NM_001040697.2|NM_001261384.1	NP_001035787.1|NP_001248313.1			UEV and lactate/malate dehyrogenase domains											endometrium(1)|kidney(1)|large_intestine(1)|lung(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	8						CAGTGTGGTTTTGATAACTTC	0.358																																					p.K443R		Atlas-SNP	.											.	UEVLD	58	.	0			c.A1328G						.						143.0	135.0	138.0					11																	18553955		2199	4293	6492	SO:0001583	missense	55293	exon12			GTGGTTTTGATAA	AF503350	CCDS7843.1, CCDS41624.1, CCDS58122.1, CCDS58123.1, CCDS58124.1, CCDS58125.1, CCDS73266.1	11p15.1	2006-07-14			ENSG00000151116	ENSG00000151116			30866	protein-coding gene	gene with protein product		610985				12427560	Standard	NM_001040697		Approved	Attp, UEV3	uc001mot.4	Q8IX04	OTTHUMG00000167729	ENST00000396197.3:c.1328A>G	chr11.hg19:g.18553955T>C	ENSP00000379500:p.Lys443Arg	71.0	0.0		108.0	40.0	NM_001040697		Missense_Mutation	SNP	ENST00000396197.3	hg19	CCDS41624.1	.	.	.	.	.	.	.	.	.	.	T	11.48	1.652799	0.29336	.	.	ENSG00000151116	ENST00000396197;ENST00000379387;ENST00000540110	T;T	0.67523	-0.27;-0.27	5.31	4.17	0.49024	Lactate/malate dehydrogenase, C-terminal (1);Lactate dehydrogenase/glycoside hydrolase, family 4, C-terminal (2);	0.254323	0.32640	U	0.005822	T	0.53417	0.1795	L	0.39566	1.225	0.23107	N	0.998289	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.46978	-0.9152	10	0.46703	T	0.11	-1.3138	6.7105	0.23274	0.0:0.0807:0.1519:0.7674	.	421;443	B4DL43;Q8IX04	.;UEVLD_HUMAN	R	443;421;220	ENSP00000379500:K443R;ENSP00000368697:K421R	ENSP00000368697:K421R	K	-	2	0	UEVLD	18510531	0.021000	0.18746	0.896000	0.35187	0.635000	0.38103	0.030000	0.13688	0.854000	0.35336	0.459000	0.35465	AAA	.	.		0.358	UEVLD-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395923.2	NM_018314	
LGR4	55366	hgsc.bcm.edu	37	11	27389741	27389741	+	Silent	SNP	G	G	A	rs145204350|rs375970924		TCGA-2Y-A9H7-01A-11D-A38X-10	TCGA-2Y-A9H7-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e447e430-664c-4a56-9017-620aef1f0ffb	b2219bf0-50ab-4c4d-a22d-6b2a5c4bb365	g.chr11:27389741G>A	ENST00000379214.4	-	18	2972	c.2529C>T	c.(2527-2529)taC>taT	p.Y843Y	LGR4_ENST00000389858.4_Silent_p.Y819Y	NM_018490.2	NP_060960.2	Q9BXB1	LGR4_HUMAN	leucine-rich repeat containing G protein-coupled receptor 4	843					bone mineralization (GO:0030282)|bone remodeling (GO:0046849)|canonical Wnt signaling pathway involved in metanephric kidney development (GO:0061290)|cell differentiation involved in metanephros development (GO:0072202)|epithelial cell proliferation (GO:0050673)|innate immune response (GO:0045087)|male genitalia development (GO:0030539)|metanephric glomerulus development (GO:0072224)|metanephric nephron tubule morphogenesis (GO:0072282)|negative regulation of cytokine secretion (GO:0050710)|negative regulation of toll-like receptor signaling pathway (GO:0034122)|negative regulation of transcription, DNA-templated (GO:0045892)|osteoblast differentiation (GO:0001649)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of transcription, DNA-templated (GO:0045893)|spermatogenesis (GO:0007283)	integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)|transmembrane signaling receptor activity (GO:0004888)			NS(3)|breast(2)|endometrium(3)|kidney(2)|large_intestine(11)|lung(10)|ovary(1)	32						TGCCACAGTCGTAGTAGAAAT	0.438																																					p.Y843Y		Atlas-SNP	.											.	LGR4	87	.	0			c.C2529T						.	G		1,4403	2.1+/-5.4	0,1,2201	163.0	156.0	159.0		2529	-10.8	0.2	11	dbSNP_134	159	0,8598		0,0,4299	no	coding-synonymous	LGR4	NM_018490.2		0,1,6500	AA,AG,GG		0.0,0.0227,0.0077		843/952	27389741	1,13001	2202	4299	6501	SO:0001819	synonymous_variant	55366	exon18			ACAGTCGTAGTAG	AF257182	CCDS31449.1	11p14-p13	2012-08-21	2011-01-25	2004-11-12	ENSG00000205213	ENSG00000205213		"""GPCR / Class A : Orphans"""	13299	protein-coding gene	gene with protein product		606666	"""G protein-coupled receptor 48"", ""leucine-rich repeat-containing G protein-coupled receptor 4"""	GPR48		10894923	Standard	NM_018490		Approved		uc001mrj.4	Q9BXB1	OTTHUMG00000133508	ENST00000379214.4:c.2529C>T	chr11.hg19:g.27389741G>A		58.0	0.0		76.0	30.0	NM_018490	A6NCH3|G5E9B3|Q8N537|Q9NYD1	Silent	SNP	ENST00000379214.4	hg19	CCDS31449.1																																																																																			.	G|1.000;A|0.000		0.438	LGR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257467.1	NM_018490	
KRAS	3845	hgsc.bcm.edu	37	12	25398285	25398285	+	Missense_Mutation	SNP	C	C	A	rs121913530		TCGA-2Y-A9H7-01A-11D-A38X-10	TCGA-2Y-A9H7-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e447e430-664c-4a56-9017-620aef1f0ffb	b2219bf0-50ab-4c4d-a22d-6b2a5c4bb365	g.chr12:25398285C>A	ENST00000256078.4	-	2	97	c.34G>T	c.(34-36)Ggt>Tgt	p.G12C	KRAS_ENST00000557334.1_Missense_Mutation_p.G12C|KRAS_ENST00000556131.1_Missense_Mutation_p.G12C|KRAS_ENST00000311936.3_Missense_Mutation_p.G12C	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	12			G -> A (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.|G -> C (in lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:6320174}.|G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929, ECO:0000269|PubMed:8439212}.|G -> R (in lung cancer and bladder cancer; somatic mutation). {ECO:0000269|PubMed:6695174}.|G -> S (in lung carcinoma and GASC; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929}.|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation, constitutively activated). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:22711838, ECO:0000269|PubMed:3034404, ECO:0000269|PubMed:6092920, ECO:0000269|PubMed:8439212}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12C(3001)|p.G12S(1288)|p.G12R(789)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12W(3)|p.A11_G12insGA(2)|p.G12Y(2)|p.G12N(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			CCTACGCCACCAGCTCCAACT	0.348	G12C(CALU1_LUNG)|G12C(HCC44_LUNG)|G12C(IALM_LUNG)|G12C(KHM1B_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12C(KYSE410_OESOPHAGUS)|G12C(LU65_LUNG)|G12C(LU99_LUNG)|G12C(MIAPACA2_PANCREAS)|G12C(NCIH1373_LUNG)|G12C(NCIH1792_LUNG)|G12C(NCIH2030_LUNG)|G12C(NCIH2122_LUNG)|G12C(NCIH23_LUNG)|G12C(NCIH358_LUNG)|G12C(OV56_OVARY)|G12C(SW1463_LARGE_INTESTINE)|G12C(SW1573_LUNG)|G12C(SW837_LARGE_INTESTINE)|G12C(UMUC3_URINARY_TRACT)|G12R(CAL62_THYROID)|G12R(HS274T_BREAST)|G12R(HUPT3_PANCREAS)|G12R(KP2_PANCREAS)|G12R(PSN1_PANCREAS)|G12R(TCCPAN2_PANCREAS)|G12S(A549_LUNG)|G12S(KMS20_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12S(LS123_LARGE_INTESTINE)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											p.G12C	Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	Atlas-SNP	.		Dom	yes		12	12p12.1	3845	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog		"""L, E, M, O"""	KRAS_ENST00000256078,NS,adenocarcinoma,+1,3	KRAS	30930	.	5144	Substitution - Missense(5142)|Insertion - In frame(2)	large_intestine(2360)|lung(1649)|pancreas(656)|biliary_tract(125)|ovary(56)|endometrium(54)|haematopoietic_and_lymphoid_tissue(49)|thyroid(42)|stomach(21)|cervix(19)|upper_aerodigestive_tract(17)|urinary_tract(17)|soft_tissue(15)|small_intestine(13)|prostate(11)|breast(9)|skin(8)|testis(7)|liver(6)|oesophagus(3)|peritoneum(1)|autonomic_ganglia(1)|kidney(1)|central_nervous_system(1)|NS(1)|penis(1)|adrenal_gland(1)	c.G34T	GRCh37	CM076251	KRAS	M	rs121913530	.						93.0	83.0	86.0					12																	25398285		2203	4300	6503	SO:0001583	missense	3845	exon2	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	CGCCACCAGCTCC	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.34G>T	chr12.hg19:g.25398285C>A	ENSP00000256078:p.Gly12Cys	137.0	0.0		150.0	53.0	NM_004985	A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	hg19	CCDS8703.1	.	.	.	.	.	.	.	.	.	.	C	25.8	4.676185	0.88445	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	T;T;T;T	0.79141	-1.24;-1.24;-1.24;-1.24	5.68	5.68	0.88126	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.90466	0.7014	M	0.90650	3.135	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.79784	0.993;0.993	D	0.91833	0.5477	10	0.72032	D	0.01	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	12;12	P01116-2;P01116	.;RASK_HUMAN	C	12	ENSP00000308495:G12C;ENSP00000452512:G12C;ENSP00000256078:G12C;ENSP00000451856:G12C	ENSP00000256078:G12C	G	-	1	0	KRAS	25289552	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGT	.	.		0.348	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	NM_033360	
ATP2A2	488	hgsc.bcm.edu	37	12	110719613	110719613	+	Missense_Mutation	SNP	A	A	C			TCGA-2Y-A9H7-01A-11D-A38X-10	TCGA-2Y-A9H7-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e447e430-664c-4a56-9017-620aef1f0ffb	b2219bf0-50ab-4c4d-a22d-6b2a5c4bb365	g.chr12:110719613A>C	ENST00000539276.2	+	1	128	c.19A>C	c.(19-21)Aag>Cag	p.K7Q	ATP2A2_ENST00000308664.6_Missense_Mutation_p.K7Q|ATP2A2_ENST00000395494.2_Missense_Mutation_p.K7Q|ATP2A2_ENST00000552636.1_Intron			P16615	AT2A2_HUMAN	ATPase, Ca++ transporting, cardiac muscle, slow twitch 2	7					blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|cell adhesion (GO:0007155)|cellular calcium ion homeostasis (GO:0006874)|epidermis development (GO:0008544)|ER-nucleus signaling pathway (GO:0006984)|ion transmembrane transport (GO:0034220)|negative regulation of heart contraction (GO:0045822)|positive regulation of heart rate (GO:0010460)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of the force of heart contraction (GO:0002026)|relaxation of cardiac muscle (GO:0055119)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|transport (GO:0006810)	endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|platelet dense tubular network membrane (GO:0031095)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)	ATP binding (GO:0005524)|calcium-transporting ATPase activity (GO:0005388)|calcium-transporting ATPase activity involved in regulation of cardiac muscle cell membrane potential (GO:0086039)|enzyme binding (GO:0019899)|metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)|S100 protein binding (GO:0044548)			NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(10)|ovary(3)|pancreas(1)|prostate(2)|skin(4)|urinary_tract(1)	38						CGCGCACACCAAGACGGTGGA	0.701																																					p.K7Q		Atlas-SNP	.											.	ATP2A2	78	.	0			c.A19C						.						60.0	48.0	52.0					12																	110719613		2167	4279	6446	SO:0001583	missense	488	exon1			CACACCAAGACGG		CCDS9143.1, CCDS9144.1	12q24.11	2012-10-22			ENSG00000174437	ENSG00000174437	3.6.3.8	"""ATPases / P-type"""	812	protein-coding gene	gene with protein product	"""sarcoplasmic/endoplasmic reticulum calcium ATPase 2"", ""calcium pump 2"""	108740		ATP2B, DAR		10080178	Standard	NM_170665		Approved	SERCA2	uc001tqk.4	P16615	OTTHUMG00000169327	ENST00000539276.2:c.19A>C	chr12.hg19:g.110719613A>C	ENSP00000440045:p.Lys7Gln	50.0	0.0		30.0	12.0	NM_001681	A6NDN7|B4DF05|P16614|Q86VJ2	Missense_Mutation	SNP	ENST00000539276.2	hg19	CCDS9144.1	.	.	.	.	.	.	.	.	.	.	A	21.9	4.214457	0.79352	.	.	ENSG00000174437	ENST00000308664;ENST00000395494;ENST00000539276	T;T;T	0.78246	-1.16;-1.16;-1.16	5.21	5.21	0.72293	ATPase, P-type cation-transporter, N-terminal (2);	0.101923	0.64402	D	0.000003	T	0.73745	0.3626	L	0.55834	1.745	0.80722	D	1	B;B;B	0.18610	0.029;0.005;0.012	B;B;B	0.21151	0.033;0.004;0.011	T	0.69355	-0.5167	10	0.30854	T	0.27	.	15.0866	0.72158	1.0:0.0:0.0:0.0	.	7;7;7	P16615-4;P16615-2;P16615	.;.;AT2A2_HUMAN	Q	7	ENSP00000311186:K7Q;ENSP00000378872:K7Q;ENSP00000440045:K7Q	ENSP00000311186:K7Q	K	+	1	0	ATP2A2	109203996	1.000000	0.71417	1.000000	0.80357	0.900000	0.52787	6.972000	0.76110	1.970000	0.57323	0.454000	0.30748	AAG	.	.		0.701	ATP2A2-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000403539.1	NM_001681	
BRAP	8315	hgsc.bcm.edu	37	12	112119568	112119568	+	Missense_Mutation	SNP	G	G	A			TCGA-2Y-A9H7-01A-11D-A38X-10	TCGA-2Y-A9H7-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e447e430-664c-4a56-9017-620aef1f0ffb	b2219bf0-50ab-4c4d-a22d-6b2a5c4bb365	g.chr12:112119568G>A	ENST00000327551.6	-	3	366	c.226C>T	c.(226-228)Cac>Tac	p.H76Y	BRAP_ENST00000539060.1_5'Flank|BRAP_ENST00000419234.4_Missense_Mutation_p.H106Y			Q6UWU4	CF089_HUMAN	BRCA1 associated protein	0					epithelial cell proliferation (GO:0050673)|positive regulation of cell cycle (GO:0045787)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				cervix(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(5)|prostate(2)|skin(1)|stomach(1)|urinary_tract(1)	20						TCCTTACTGTGATCTTTACTT	0.408																																					p.H106Y	Pancreas(146;846 1904 7830 25130 26065)	Atlas-SNP	.											.	BRAP	42	.	0			c.C316T						.						174.0	159.0	164.0					12																	112119568		2203	4300	6503	SO:0001583	missense	8315	exon3			TACTGTGATCTTT	AF035620	CCDS9154.1	12q24.12	2014-09-11			ENSG00000089234	ENSG00000089234		"""RING-type (C3HC4) zinc fingers"""	1099	protein-coding gene	gene with protein product	"""impedes mitogenic signal propagation"", ""galectin-2-binding protein"""	604986				9497340, 19198608	Standard	XM_005253944		Approved	BRAP2, RNF52, IMP	uc001tsn.4	Q7Z569	OTTHUMG00000169600	ENST00000327551.6:c.226C>T	chr12.hg19:g.112119568G>A	ENSP00000330813:p.His76Tyr	173.0	0.0		211.0	91.0	NM_006768	B4DTT1|F4NAR0|F4NAR1|Q6ZMG5|Q7Z356|Q8IZ35	Missense_Mutation	SNP	ENST00000327551.6	hg19		.	.	.	.	.	.	.	.	.	.	G	9.876	1.200176	0.22121	.	.	ENSG00000089234	ENST00000419234;ENST00000327551	T;T	0.42131	0.98;0.98	6.08	4.23	0.50019	.	1.161590	0.05993	N	0.646308	T	0.31544	0.0800	N	0.22421	0.69	0.09310	N	0.999999	B	0.14012	0.009	B	0.14578	0.011	T	0.27191	-1.0081	10	0.62326	D	0.03	-0.7492	5.8425	0.18641	0.0654:0.1208:0.5643:0.2496	.	106	Q7Z569	BRAP_HUMAN	Y	106;76	ENSP00000403524:H106Y;ENSP00000330813:H76Y	ENSP00000330813:H76Y	H	-	1	0	BRAP	110603951	0.510000	0.26171	0.869000	0.34112	0.427000	0.31564	1.597000	0.36729	0.871000	0.35750	0.655000	0.94253	CAC	.	.		0.408	BRAP-002	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000404994.2		
CCDC122	160857	hgsc.bcm.edu	37	13	44411471	44411471	+	Missense_Mutation	SNP	T	T	A			TCGA-2Y-A9H7-01A-11D-A38X-10	TCGA-2Y-A9H7-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e447e430-664c-4a56-9017-620aef1f0ffb	b2219bf0-50ab-4c4d-a22d-6b2a5c4bb365	g.chr13:44411471T>A	ENST00000444614.3	-	7	1025	c.767A>T	c.(766-768)cAa>cTa	p.Q256L		NM_144974.3	NP_659411.2	Q5T0U0	CC122_HUMAN	coiled-coil domain containing 122	256										endometrium(1)|large_intestine(2)|lung(5)|stomach(1)	9		Lung NSC(96;7.5e-06)|Breast(139;0.00765)|Hepatocellular(98;0.00826)|Prostate(109;0.0143)|Lung SC(185;0.0262)		GBM - Glioblastoma multiforme(144;0.000767)|BRCA - Breast invasive adenocarcinoma(63;0.128)		TTCCAATTGTTGAATGTTCCA	0.388																																					p.Q256L		Atlas-SNP	.											.	CCDC122	21	.	0			c.A767T						.						158.0	141.0	146.0					13																	44411471		1877	4103	5980	SO:0001583	missense	160857	exon7			AATTGTTGAATGT	AK056408	CCDS9390.2	13q14.11	2008-10-30			ENSG00000151773	ENSG00000151773			26478	protein-coding gene	gene with protein product		613408					Standard	NM_144974		Approved	FLJ31846	uc010acf.3	Q5T0U0	OTTHUMG00000017413	ENST00000444614.3:c.767A>T	chr13.hg19:g.44411471T>A	ENSP00000407763:p.Gln256Leu	50.0	0.0		67.0	27.0	NM_144974	B2RP70|B7ZMI9|Q96MV0	Missense_Mutation	SNP	ENST00000444614.3	hg19	CCDS9390.2	.	.	.	.	.	.	.	.	.	.	T	15.48	2.845539	0.51164	.	.	ENSG00000151773	ENST00000444614	T	0.41758	0.99	5.2	4.02	0.46733	.	.	.	.	.	T	0.40347	0.1113	L	0.53249	1.67	0.80722	D	1	B	0.25609	0.13	B	0.32624	0.149	T	0.34502	-0.9826	9	0.87932	D	0	.	8.6548	0.34058	0.0:0.0881:0.0:0.9119	.	256	Q5T0U0	CC122_HUMAN	L	256	ENSP00000407763:Q256L	ENSP00000407763:Q256L	Q	-	2	0	CCDC122	43309471	1.000000	0.71417	0.982000	0.44146	0.952000	0.60782	1.835000	0.39181	0.926000	0.37118	0.477000	0.44152	CAA	.	.		0.388	CCDC122-004	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276172.4	NM_144974	
VPS36	51028	hgsc.bcm.edu	37	13	53010479	53010479	+	Missense_Mutation	SNP	C	C	A			TCGA-2Y-A9H7-01A-11D-A38X-10	TCGA-2Y-A9H7-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e447e430-664c-4a56-9017-620aef1f0ffb	b2219bf0-50ab-4c4d-a22d-6b2a5c4bb365	g.chr13:53010479C>A	ENST00000378060.4	-	4	324	c.297G>T	c.(295-297)caG>caT	p.Q99H	VPS36_ENST00000480923.1_5'UTR	NM_001282168.1|NM_001282169.1|NM_016075.2	NP_001269097.1|NP_001269098.1|NP_057159.2	Q86VN1	VPS36_HUMAN	vacuolar protein sorting 36 homolog (S. cerevisiae)	99					endosomal transport (GO:0016197)|membrane organization (GO:0061024)|protein transport (GO:0015031)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|late endosome (GO:0005770)|lysosome (GO:0005764)|membrane (GO:0016020)|nucleus (GO:0005634)	phosphatidylinositol-3-phosphate binding (GO:0032266)			breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(7)|skin(1)|upper_aerodigestive_tract(2)	17		Breast(56;0.000207)|Lung NSC(96;0.00212)|Hepatocellular(98;0.065)|Prostate(109;0.0771)|all_neural(104;0.173)		GBM - Glioblastoma multiforme(99;3.14e-08)		TCTTACTACTCTGGAATGGGC	0.388																																					p.Q99H		Atlas-SNP	.											.	VPS36	38	.	0			c.G297T						.						106.0	100.0	102.0					13																	53010479		2203	4300	6503	SO:0001583	missense	51028	exon4			ACTACTCTGGAAT	AF151903	CCDS9434.1, CCDS73577.1	13q14.13	2008-02-05	2007-01-12	2005-08-02	ENSG00000136100	ENSG00000136100			20312	protein-coding gene	gene with protein product		610903	"""chromosome 13 open reading frame 9"", ""vacuolar protein sorting 36 homolog (yeast)"""	C13orf9		11278625, 15755741	Standard	NM_016075		Approved	CGI-145, Eap45	uc001vgs.3	Q86VN1	OTTHUMG00000016964	ENST00000378060.4:c.297G>T	chr13.hg19:g.53010479C>A	ENSP00000367299:p.Gln99His	154.0	0.0		161.0	67.0	NM_016075	A8K125|Q3ZCV7|Q5H9S1|Q5VXB6|Q9H8Z5|Q9Y3E3	Missense_Mutation	SNP	ENST00000378060.4	hg19	CCDS9434.1	.	.	.	.	.	.	.	.	.	.	.	16.61	3.172212	0.57584	.	.	ENSG00000136100	ENST00000378060	.	.	.	5.93	3.82	0.43975	.	0.000000	0.85682	D	0.000000	T	0.44244	0.1284	L	0.57536	1.79	0.58432	D	0.999997	D	0.61080	0.989	B	0.43838	0.433	T	0.35943	-0.9768	9	0.16896	T	0.51	.	7.0428	0.25029	0.0:0.6681:0.0:0.3319	.	99	Q86VN1	VPS36_HUMAN	H	99	.	ENSP00000367299:Q99H	Q	-	3	2	VPS36	51908480	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	0.986000	0.29590	1.438000	0.47492	0.655000	0.94253	CAG	.	.		0.388	VPS36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045059.3		
SEC23A	10484	hgsc.bcm.edu	37	14	39560758	39560758	+	Missense_Mutation	SNP	G	G	A			TCGA-2Y-A9H7-01A-11D-A38X-10	TCGA-2Y-A9H7-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e447e430-664c-4a56-9017-620aef1f0ffb	b2219bf0-50ab-4c4d-a22d-6b2a5c4bb365	g.chr14:39560758G>A	ENST00000307712.6	-	5	1043	c.526C>T	c.(526-528)Cat>Tat	p.H176Y	SEC23A_ENST00000536508.1_Missense_Mutation_p.H50Y|SEC23A_ENST00000537403.1_5'Flank|SEC23A_ENST00000545328.2_Missense_Mutation_p.H147Y	NM_006364.2	NP_006355.2	Q15436	SC23A_HUMAN	Sec23 homolog A (S. cerevisiae)	176					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular protein metabolic process (GO:0044267)|COPII vesicle coating (GO:0048208)|ER to Golgi vesicle-mediated transport (GO:0006888)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|small molecule metabolic process (GO:0044281)|vesicle-mediated transport (GO:0016192)	COPII vesicle coat (GO:0030127)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)|perinuclear region of cytoplasm (GO:0048471)	zinc ion binding (GO:0008270)			kidney(2)|large_intestine(3)|liver(1)|lung(11)|ovary(4)|pancreas(1)|upper_aerodigestive_tract(1)	23	Hepatocellular(127;0.213)		Lung(238;0.00047)|LUAD - Lung adenocarcinoma(48;0.000565)	GBM - Glioblastoma multiforme(112;0.0151)		CCAAGTTCATGAACCTGAACC	0.383																																					p.H176Y		Atlas-SNP	.											.	SEC23A	73	.	0			c.C526T						.						119.0	109.0	112.0					14																	39560758		2203	4300	6503	SO:0001583	missense	10484	exon5			GTTCATGAACCTG	X97064	CCDS9668.1	14q21.1	2008-05-14	2001-11-28		ENSG00000100934	ENSG00000100934			10701	protein-coding gene	gene with protein product		610511	"""Sec23 (S. cerevisiae) homolog A"""			8898360, 10329445	Standard	NM_006364		Approved		uc001wup.1	Q15436	OTTHUMG00000028812	ENST00000307712.6:c.526C>T	chr14.hg19:g.39560758G>A	ENSP00000306881:p.His176Tyr	83.0	0.0		102.0	44.0	NM_006364	B2R5P4|B3KXI2|Q8NE16	Missense_Mutation	SNP	ENST00000307712.6	hg19	CCDS9668.1	.	.	.	.	.	.	.	.	.	.	G	25.6	4.659353	0.88154	.	.	ENSG00000100934	ENST00000307712;ENST00000536508;ENST00000545328;ENST00000554645	T;T;T	0.71579	-0.58;-0.58;-0.58	5.46	5.46	0.80206	Sec23/Sec24, trunk domain (1);	0.000000	0.85682	D	0.000000	T	0.81517	0.4839	M	0.80746	2.51	0.80722	D	1	P;P;P;B	0.46457	0.878;0.603;0.603;0.173	P;B;B;B	0.52309	0.695;0.399;0.283;0.105	T	0.82202	-0.0574	10	0.46703	T	0.11	-25.565	19.2992	0.94136	0.0:0.0:1.0:0.0	.	64;147;50;176	G3V531;F5H365;F5H6C4;Q15436	.;.;.;SC23A_HUMAN	Y	176;50;147;64	ENSP00000306881:H176Y;ENSP00000437715:H50Y;ENSP00000445393:H147Y	ENSP00000306881:H176Y	H	-	1	0	SEC23A	38630509	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	9.772000	0.98984	2.544000	0.85801	0.563000	0.77884	CAT	.	.		0.383	SEC23A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276728.2		
PPP1R36	145376	hgsc.bcm.edu	37	14	65054887	65054887	+	Missense_Mutation	SNP	C	C	T			TCGA-2Y-A9H7-01A-11D-A38X-10	TCGA-2Y-A9H7-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e447e430-664c-4a56-9017-620aef1f0ffb	b2219bf0-50ab-4c4d-a22d-6b2a5c4bb365	g.chr14:65054887C>T	ENST00000298705.1	+	11	1052	c.956C>T	c.(955-957)aCt>aTt	p.T319I	RP11-973N13.3_ENST00000556634.1_RNA|RP11-973N13.3_ENST00000554454.1_RNA	NM_172365.1	NP_758953.1	Q96LQ0	PPR36_HUMAN	protein phosphatase 1, regulatory subunit 36	319					negative regulation of phosphatase activity (GO:0010923)		phosphatase binding (GO:0019902)|protein phosphatase inhibitor activity (GO:0004864)										GTCATGTCTACTCTGCTGCCA	0.443																																					p.T319I		Atlas-SNP	.											.	.	.	.	0			c.C956T						.						111.0	109.0	110.0					14																	65054887		2203	4300	6503	SO:0001583	missense	145376	exon11			TGTCTACTCTGCT		CCDS9767.1	14q23.2	2012-04-17	2011-10-11	2011-10-11	ENSG00000165807	ENSG00000165807		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	20097	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 50"""	C14orf50			Standard	NM_172365		Approved		uc001xhl.1	Q96LQ0	OTTHUMG00000141316	ENST00000298705.1:c.956C>T	chr14.hg19:g.65054887C>T	ENSP00000298705:p.Thr319Ile	65.0	0.0		78.0	41.0	NM_172365	Q6NTH6	Missense_Mutation	SNP	ENST00000298705.1	hg19	CCDS9767.1	.	.	.	.	.	.	.	.	.	.	C	20.2	3.954092	0.73902	.	.	ENSG00000165807	ENST00000298705	T	0.32515	1.45	5.55	5.55	0.83447	.	0.092039	0.47455	D	0.000224	T	0.52025	0.1709	M	0.63428	1.95	0.38144	D	0.938536	D	0.76494	0.999	D	0.68943	0.961	T	0.57201	-0.7852	10	0.72032	D	0.01	-17.6391	15.0284	0.71687	0.0:1.0:0.0:0.0	.	319	Q96LQ0	PPR36_HUMAN	I	319	ENSP00000298705:T319I	ENSP00000298705:T319I	T	+	2	0	C14orf50	64124640	1.000000	0.71417	0.995000	0.50966	0.994000	0.84299	3.737000	0.55060	2.596000	0.87737	0.655000	0.94253	ACT	.	.		0.443	PPP1R36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000280667.1	NM_172365	
ZFYVE26	23503	hgsc.bcm.edu	37	14	68265207	68265207	+	Missense_Mutation	SNP	G	G	C			TCGA-2Y-A9H7-01A-11D-A38X-10	TCGA-2Y-A9H7-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e447e430-664c-4a56-9017-620aef1f0ffb	b2219bf0-50ab-4c4d-a22d-6b2a5c4bb365	g.chr14:68265207G>C	ENST00000347230.4	-	11	1910	c.1772C>G	c.(1771-1773)cCa>cGa	p.P591R	ZFYVE26_ENST00000555452.1_Missense_Mutation_p.P591R	NM_015346.3	NP_056161.2	Q68DK2	ZFY26_HUMAN	zinc finger, FYVE domain containing 26	591					cell death (GO:0008219)|cytokinesis (GO:0000910)|double-strand break repair via homologous recombination (GO:0000724)	centrosome (GO:0005813)|lysosomal membrane (GO:0005765)|midbody (GO:0030496)	metal ion binding (GO:0046872)|phosphatidylinositol-3-phosphate binding (GO:0032266)			NS(1)|breast(3)|cervix(1)|endometrium(6)|kidney(8)|large_intestine(8)|lung(39)|ovary(12)|pancreas(1)|prostate(7)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)	94				all cancers(60;0.000763)|OV - Ovarian serous cystadenocarcinoma(108;0.0011)|BRCA - Breast invasive adenocarcinoma(234;0.0115)		GTGAGGCTCTGGGTGAAGATC	0.512																																					p.P591R		Atlas-SNP	.											.	ZFYVE26	223	.	0			c.C1772G						.						84.0	75.0	78.0					14																	68265207		2203	4300	6503	SO:0001583	missense	23503	exon11			GGCTCTGGGTGAA	AB002319	CCDS9788.1	14q23.3	2012-11-23				ENSG00000072121		"""Zinc fingers, FYVE domain containing"""	20761	protein-coding gene	gene with protein product	"""spastizin"", ""FYVE-CENT"""	612012	"""spastic paraplegia 15 (complicated, autosomal recessive)"""	SPG15		9205841, 18394578	Standard	NM_015346		Approved	KIAA0321	uc001xka.2	Q68DK2		ENST00000347230.4:c.1772C>G	chr14.hg19:g.68265207G>C	ENSP00000251119:p.Pro591Arg	81.0	0.0		107.0	42.0	NM_015346	B1B5Y3|B4E2U3|O15035|Q68DT9|Q6AW90|Q6ZR50|Q7Z3A4|Q7Z3I1|Q8N4W7	Missense_Mutation	SNP	ENST00000347230.4	hg19	CCDS9788.1	.	.	.	.	.	.	.	.	.	.	G	13.36	2.213479	0.39102	.	.	ENSG00000072121	ENST00000347230;ENST00000411699;ENST00000555452	T;T	0.25912	1.91;1.77	5.56	4.67	0.58626	.	0.598474	0.17249	N	0.181242	T	0.30008	0.0751	L	0.44542	1.39	0.29869	N	0.826968	D;P;B	0.59357	0.985;0.631;0.294	P;B;B	0.49708	0.62;0.246;0.057	T	0.15607	-1.0431	10	0.59425	D	0.04	-12.4627	10.4876	0.44731	0.0:0.1175:0.5253:0.3572	.	591;591;591	Q68DK2-4;G3V2D8;Q68DK2	.;.;ZFY26_HUMAN	R	591;570;591	ENSP00000251119:P591R;ENSP00000450603:P591R	ENSP00000251119:P591R	P	-	2	0	ZFYVE26	67334960	0.995000	0.38212	1.000000	0.80357	0.993000	0.82548	1.143000	0.31553	1.344000	0.45657	0.655000	0.94253	CCA	.	.		0.512	ZFYVE26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412736.2	NM_015346	
ZC3H14	79882	hgsc.bcm.edu	37	14	89038562	89038562	+	Missense_Mutation	SNP	A	A	G			TCGA-2Y-A9H7-01A-11D-A38X-10	TCGA-2Y-A9H7-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e447e430-664c-4a56-9017-620aef1f0ffb	b2219bf0-50ab-4c4d-a22d-6b2a5c4bb365	g.chr14:89038562A>G	ENST00000251038.5	+	5	649	c.424A>G	c.(424-426)Aat>Gat	p.N142D	ZC3H14_ENST00000557607.1_5'UTR|ZC3H14_ENST00000302216.8_Missense_Mutation_p.N142D|ZC3H14_ENST00000336693.4_Missense_Mutation_p.N108D|ZC3H14_ENST00000359301.3_Missense_Mutation_p.N108D|ZC3H14_ENST00000555755.1_Missense_Mutation_p.N142D|ZC3H14_ENST00000393514.5_Missense_Mutation_p.N142D|ZC3H14_ENST00000556945.1_Missense_Mutation_p.N142D	NM_001160103.1|NM_001160104.1|NM_024824.4	NP_001153575.1|NP_001153576.1|NP_079100.2	Q6PJT7	ZC3HE_HUMAN	zinc finger CCCH-type containing 14	142						cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			cervix(2)|endometrium(3)|kidney(2)|large_intestine(3)|lung(6)|ovary(2)|prostate(1)|skin(2)	21						AAAAACCACAAATGTCAGGTA	0.453																																					p.N142D		Atlas-SNP	.											.	ZC3H14	71	.	0			c.A424G						.						58.0	58.0	58.0					14																	89038562		2203	4300	6503	SO:0001583	missense	79882	exon5			ACCACAAATGTCA	AF155107	CCDS32133.1, CCDS32134.1, CCDS32135.1, CCDS32136.1, CCDS55938.1	14q31.3	2014-08-12			ENSG00000100722	ENSG00000100722		"""Zinc fingers, CCCH-type domain containing"""	20509	protein-coding gene	gene with protein product		613279				10508479	Standard	NM_024824		Approved	FLJ11806, UKp68, NY-REN-37	uc001xww.3	Q6PJT7	OTTHUMG00000170803	ENST00000251038.5:c.424A>G	chr14.hg19:g.89038562A>G	ENSP00000251038:p.Asn142Asp	186.0	0.0		231.0	95.0	NM_001160104	A8MY46|B4DXU8|B4DZW7|B4E2H4|G3V5R4|Q6MZU4|Q6PJ32|Q6PUI6|Q6PUI8|Q86TQ5|Q86TW0|Q86TW1|Q8NCT6|Q8NCZ3|Q8TDE2|Q9HAC9|Q9Y5A0	Missense_Mutation	SNP	ENST00000251038.5	hg19	CCDS32133.1	.	.	.	.	.	.	.	.	.	.	A	8.085	0.773296	0.16051	.	.	ENSG00000100722	ENST00000251038;ENST00000393530;ENST00000353091;ENST00000359301;ENST00000302216;ENST00000380684;ENST00000556945;ENST00000556158;ENST00000555799;ENST00000555755;ENST00000393514;ENST00000336693;ENST00000557693	.	.	.	5.43	1.59	0.23543	.	0.702444	0.14348	N	0.325255	T	0.25232	0.0613	L	0.40543	1.245	0.09310	N	1	B;B;B;B	0.28128	0.066;0.066;0.201;0.066	B;B;B;B	0.23275	0.022;0.022;0.045;0.022	T	0.14337	-1.0476	9	0.12103	T	0.63	-3.146	4.5407	0.12056	0.5825:0.0:0.2753:0.1422	.	142;142;142;142	G3V5R4;Q6PJT7-2;Q6PJT7-3;Q6PJT7	.;.;.;ZC3HE_HUMAN	D	142;142;142;108;142;123;142;129;108;142;142;108;108	.	ENSP00000251038:N142D	N	+	1	0	ZC3H14	88108315	0.002000	0.14202	0.004000	0.12327	0.072000	0.16883	0.619000	0.24388	0.903000	0.36546	0.455000	0.32223	AAT	.	.		0.453	ZC3H14-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000410387.1	NM_024824	
FAN1	22909	hgsc.bcm.edu	37	15	31197246	31197246	+	Missense_Mutation	SNP	C	C	A			TCGA-2Y-A9H7-01A-11D-A38X-10	TCGA-2Y-A9H7-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e447e430-664c-4a56-9017-620aef1f0ffb	b2219bf0-50ab-4c4d-a22d-6b2a5c4bb365	g.chr15:31197246C>A	ENST00000362065.4	+	2	671	c.380C>A	c.(379-381)cCc>cAc	p.P127H	FAN1_ENST00000561607.1_Missense_Mutation_p.P127H|FAN1_ENST00000565466.1_Missense_Mutation_p.P127H|FAN1_ENST00000561594.1_Missense_Mutation_p.P127H	NM_014967.4	NP_055782.3	Q9Y2M0	FAN1_HUMAN	FANCD2/FANCI-associated nuclease 1	127					DNA catabolic process, endonucleolytic (GO:0000737)|DNA repair (GO:0006281)|double-strand break repair via homologous recombination (GO:0000724)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA incision (GO:0033683)	nucleus (GO:0005634)	5'-3' exonuclease activity (GO:0008409)|5'-flap endonuclease activity (GO:0017108)|DNA binding (GO:0003677)|magnesium ion binding (GO:0000287)|phosphodiesterase I activity (GO:0004528)|ubiquitin binding (GO:0043130)			autonomic_ganglia(2)|breast(2)|cervix(2)|endometrium(7)|kidney(1)|large_intestine(6)|lung(8)|skin(1)	29						AAGATCAGTCCCTACTTTAAA	0.393								Direct reversal of damage																													p.P127H		Atlas-SNP	.											.	FAN1	77	.	0			c.C380A						.						78.0	71.0	74.0					15																	31197246		2202	4300	6502	SO:0001583	missense	22909	exon2			TCAGTCCCTACTT		CCDS32186.1, CCDS58344.1	15q13.2-q13.3	2010-08-04	2010-08-04	2010-08-04		ENSG00000198690			29170	protein-coding gene	gene with protein product		613534	"""KIAA1018"", ""myotubularin related protein 15"""	KIAA1018, MTMR15		20603015, 20603016, 20603073	Standard	NM_014967		Approved		uc001zff.3	Q9Y2M0		ENST00000362065.4:c.380C>A	chr15.hg19:g.31197246C>A	ENSP00000354497:p.Pro127His	110.0	0.0		124.0	49.0	NM_001146095	A8K4M2|Q86WU8	Missense_Mutation	SNP	ENST00000362065.4	hg19	CCDS32186.1	.	.	.	.	.	.	.	.	.	.	C	19.11	3.764185	0.69878	.	.	ENSG00000198690	ENST00000362065	D	0.90133	-2.62	5.33	5.33	0.75918	.	0.104769	0.64402	D	0.000003	D	0.94394	0.8197	L	0.57536	1.79	0.54753	D	0.999989	D;D	0.89917	1.0;1.0	D;D	0.74348	0.962;0.983	D	0.94674	0.7859	10	0.87932	D	0	-15.5681	18.9753	0.92733	0.0:1.0:0.0:0.0	.	127;127	Q9Y2M0;Q9Y2M0-2	FAN1_HUMAN;.	H	127	ENSP00000354497:P127H	ENSP00000354497:P127H	P	+	2	0	FAN1	28984538	1.000000	0.71417	1.000000	0.80357	0.375000	0.29983	4.170000	0.58229	2.655000	0.90218	0.462000	0.41574	CCC	.	.		0.393	FAN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000430740.1	NM_014967	
C15orf39	56905	hgsc.bcm.edu	37	15	75501057	75501057	+	Missense_Mutation	SNP	C	C	T			TCGA-2Y-A9H7-01A-11D-A38X-10	TCGA-2Y-A9H7-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e447e430-664c-4a56-9017-620aef1f0ffb	b2219bf0-50ab-4c4d-a22d-6b2a5c4bb365	g.chr15:75501057C>T	ENST00000360639.2	+	2	2988	c.2668C>T	c.(2668-2670)Cca>Tca	p.P890S	RP11-69H7.3_ENST00000563568.1_RNA|C15orf39_ENST00000567617.1_Missense_Mutation_p.P890S|C15orf39_ENST00000394987.4_Missense_Mutation_p.P890S			Q6ZRI6	CO039_HUMAN	chromosome 15 open reading frame 39	890						cytoplasm (GO:0005737)				autonomic_ganglia(1)|breast(2)|endometrium(3)|large_intestine(4)|lung(4)|skin(1)|upper_aerodigestive_tract(1)	16						GCTCGCCCTGCCAGGCTGCAC	0.677																																					p.P890S		Atlas-SNP	.											.	C15orf39	64	.	0			c.C2668T						.						24.0	21.0	22.0					15																	75501057		2197	4292	6489	SO:0001583	missense	56905	exon2			GCCCTGCCAGGCT	AK128205	CCDS10276.1	15q23	2013-03-14	2005-10-24		ENSG00000167173	ENSG00000167173			24497	protein-coding gene	gene with protein product			"""chromosome 15 open reading frame 38~Name Same As HGNC:28782"""				Standard	NM_015492		Approved	DKFZP434H132, FLJ46337	uc002azq.4	Q6ZRI6	OTTHUMG00000142820	ENST00000360639.2:c.2668C>T	chr15.hg19:g.75501057C>T	ENSP00000353854:p.Pro890Ser	23.0	0.0		40.0	20.0	NM_015492	B3KWI3|C9J888|Q71JB1|Q7L3S0|Q8N3F2|Q96FB6|Q9NTU5	Missense_Mutation	SNP	ENST00000360639.2	hg19	CCDS10276.1	.	.	.	.	.	.	.	.	.	.	C	4.258	0.046891	0.08243	.	.	ENSG00000167173	ENST00000360639;ENST00000394987;ENST00000446981	T;T	0.16073	2.37;2.37	5.44	4.47	0.54385	.	0.568298	0.19135	N	0.121827	T	0.08537	0.0212	N	0.08118	0	0.09310	N	1	B;B	0.25719	0.021;0.132	B;B	0.18561	0.022;0.008	T	0.16247	-1.0409	10	0.46703	T	0.11	-6.7891	9.2834	0.37742	0.2247:0.6384:0.1369:0.0	.	452;890	Q2VPA3;Q6ZRI6	.;CO039_HUMAN	S	890;890;288	ENSP00000353854:P890S;ENSP00000378438:P890S	ENSP00000353854:P890S	P	+	1	0	C15orf39	73288110	0.954000	0.32549	0.463000	0.27130	0.012000	0.07955	2.068000	0.41471	2.556000	0.86216	0.561000	0.74099	CCA	.	.		0.677	C15orf39-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286410.1	NM_015492	
ZNF592	9640	hgsc.bcm.edu	37	15	85326095	85326095	+	Silent	SNP	G	G	T			TCGA-2Y-A9H7-01A-11D-A38X-10	TCGA-2Y-A9H7-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e447e430-664c-4a56-9017-620aef1f0ffb	b2219bf0-50ab-4c4d-a22d-6b2a5c4bb365	g.chr15:85326095G>T	ENST00000560079.2	+	4	477	c.189G>T	c.(187-189)gtG>gtT	p.V63V	ZNF592_ENST00000299927.3_Silent_p.V63V	NM_014630.2	NP_055445.2	Q92610	ZN592_HUMAN	zinc finger protein 592	63					cell death (GO:0008219)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(2)|kidney(1)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(2)|urinary_tract(1)	40			BRCA - Breast invasive adenocarcinoma(143;0.0587)			CCCCCGATGTGCCGGCCGTGA	0.532																																					p.V63V		Atlas-SNP	.											.	ZNF592	95	.	0			c.G189T						.						100.0	90.0	93.0					15																	85326095		2203	4299	6502	SO:0001819	synonymous_variant	9640	exon4			CGATGTGCCGGCC	D86966	CCDS32317.1	15q25.2	2011-03-15				ENSG00000166716		"""Zinc fingers, C2H2-type"""	28986	protein-coding gene	gene with protein product		613624	"""spinocerebellar ataxia, autosomal recessive 5"""	SCAR5		9039502, 12030328, 20531441	Standard	NM_014630		Approved	KIAA0211, CAMOS	uc002bld.3	Q92610		ENST00000560079.2:c.189G>T	chr15.hg19:g.85326095G>T		77.0	0.0		86.0	31.0	NM_014630	Q2M1T2|Q504Y9	Silent	SNP	ENST00000560079.2	hg19	CCDS32317.1																																																																																			.	.		0.532	ZNF592-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418779.2	NM_014630	
AXIN1	8312	hgsc.bcm.edu	37	16	396147	396147	+	Splice_Site	SNP	C	C	G			TCGA-2Y-A9H7-01A-11D-A38X-10	TCGA-2Y-A9H7-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e447e430-664c-4a56-9017-620aef1f0ffb	b2219bf0-50ab-4c4d-a22d-6b2a5c4bb365	g.chr16:396147C>G	ENST00000262320.3	-	2	1250		c.e2+1		AXIN1_ENST00000354866.3_Splice_Site|AXIN1_ENST00000481769.1_Intron	NM_003502.3	NP_003493.1	O15169	AXIN1_HUMAN	axin 1						activation of JUN kinase activity (GO:0007257)|activation of protein kinase activity (GO:0032147)|apoptotic process (GO:0006915)|axial mesoderm formation (GO:0048320)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in neural plate anterior/posterior pattern formation (GO:0060823)|cell death (GO:0008219)|cellular protein complex assembly (GO:0043623)|cellular response to organic cyclic compound (GO:0071407)|cytoplasmic microtubule organization (GO:0031122)|determination of left/right symmetry (GO:0007368)|dorsal/ventral axis specification (GO:0009950)|embryonic eye morphogenesis (GO:0048048)|embryonic skeletal joint morphogenesis (GO:0060272)|forebrain anterior/posterior pattern specification (GO:0021797)|genetic imprinting (GO:0071514)|in utero embryonic development (GO:0001701)|muscle cell development (GO:0055001)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of protein metabolic process (GO:0051248)|negative regulation of transcription elongation from RNA polymerase II promoter (GO:0034244)|negative regulation of Wnt signaling pathway (GO:0030178)|nucleocytoplasmic transport (GO:0006913)|olfactory placode formation (GO:0030910)|optic placode formation (GO:0001743)|positive regulation of GTPase activity (GO:0043547)|positive regulation of JNK cascade (GO:0046330)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|post-anal tail morphogenesis (GO:0036342)|protein catabolic process (GO:0030163)|protein homooligomerization (GO:0051260)|protein polyubiquitination (GO:0000209)|regulation of catenin import into nucleus (GO:0035412)|sensory perception of sound (GO:0007605)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|Wnt signaling pathway involved in somitogenesis (GO:0090244)|Wnt-activated signaling pathway involved in forebrain neuron fate commitment (GO:0021881)	beta-catenin destruction complex (GO:0030877)|cell cortex (GO:0005938)|cell periphery (GO:0071944)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytoplasmic microtubule (GO:0005881)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|lateral plasma membrane (GO:0016328)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|postsynaptic density (GO:0014069)	armadillo repeat domain binding (GO:0070016)|beta-catenin binding (GO:0008013)|enzyme binding (GO:0019899)|GTPase activator activity (GO:0005096)|I-SMAD binding (GO:0070411)|identical protein binding (GO:0042802)|protein complex scaffold (GO:0032947)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|ubiquitin protein ligase binding (GO:0031625)			biliary_tract(27)|breast(4)|central_nervous_system(6)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(20)|liver(81)|lung(5)|ovary(2)|prostate(3)|salivary_gland(7)|skin(5)|stomach(4)|thyroid(41)|upper_aerodigestive_tract(4)|urinary_tract(2)	221		all_cancers(16;2.75e-07)|all_epithelial(16;1.6e-06)|Hepatocellular(16;0.000105)|Lung NSC(18;0.00774)|all_lung(18;0.0187)				GTCGGACTCACCTGAACTCTC	0.617																																					.		Atlas-SNP	.											.	AXIN1	290	.	0			c.878+1G>C						.						30.0	32.0	31.0					16																	396147		2203	4299	6502	SO:0001630	splice_region_variant	8312	exon3			GACTCACCTGAAC	AF009674	CCDS10405.1, CCDS10406.1	16p13.3	2012-04-17			ENSG00000103126	ENSG00000103126		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	903	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 49"""	603816				9230313	Standard	NM_003502		Approved	PPP1R49	uc002cgp.2	O15169	OTTHUMG00000064930	ENST00000262320.3:c.878+1G>C	chr16.hg19:g.396147C>G		49.0	0.0		18.0	17.0	NM_181050	Q4TT26|Q4TT27|Q86YA7|Q8WVW6|Q96S28	Splice_Site	SNP	ENST00000262320.3	hg19	CCDS10405.1	.	.	.	.	.	.	.	.	.	.	C	15.08	2.727611	0.48833	.	.	ENSG00000103126	ENST00000262320;ENST00000354866	.	.	.	5.4	5.4	0.78164	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.173	0.93588	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	AXIN1	336148	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	7.710000	0.84655	2.516000	0.84829	0.655000	0.94253	.	.	.		0.617	AXIN1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000139441.3		Intron
JMJD8	339123	hgsc.bcm.edu	37	16	731813	731813	+	3'UTR	SNP	G	G	A	rs145094142		TCGA-2Y-A9H7-01A-11D-A38X-10	TCGA-2Y-A9H7-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e447e430-664c-4a56-9017-620aef1f0ffb	b2219bf0-50ab-4c4d-a22d-6b2a5c4bb365	g.chr16:731813G>A	ENST00000293882.4	-	0	1985				STUB1_ENST00000564370.1_Missense_Mutation_p.R110Q|STUB1_ENST00000566181.2_3'UTR|JMJD8_ENST00000454700.1_3'UTR|STUB1_ENST00000219548.4_Missense_Mutation_p.R182Q|LA16c-313D11.9_ENST00000567091.1_RNA|STUB1_ENST00000565677.1_Missense_Mutation_p.R110Q|LA16c-313D11.9_ENST00000571933.1_RNA|JMJD8_ENST00000412368.2_3'UTR|JMJD8_ENST00000609261.1_3'UTR			Q96S16	JMJD8_HUMAN	jumonji domain containing 8							extracellular vesicular exosome (GO:0070062)				breast(1)	1						GAGTGCCAGCGAAACCACGAG	0.627																																					p.R182Q		Atlas-SNP	.											.	STUB1	26	.	0			c.G545A						.	G	,GLN/ARG	0,4398		0,0,2199	38.0	39.0	39.0		,545	3.2	1.0	16	dbSNP_134	39	1,8599	1.2+/-3.3	0,1,4299	no	utr-3,missense	STUB1,JMJD8	NM_001005920.2,NM_005861.2	,43	0,1,6498	AA,AG,GG		0.0116,0.0,0.0077	,benign	,182/304	731813	1,12997	2199	4300	6499	SO:0001624	3_prime_UTR_variant	10273	exon4			GCCAGCGAAACCA		CCDS45369.1	16p13.3	2008-07-28	2008-07-28	2008-07-28		ENSG00000161999			14148	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 20"""	C16orf20			Standard	NM_001005920		Approved		uc002ciw.1	Q96S16		ENST00000293882.4:c.*981C>T	chr16.hg19:g.731813G>A		155.0	0.0		91.0	69.0	NM_005861	B2RNS7|D3DU58|Q4PKE3|Q4VBY1|Q6GMW5|Q71RB8	Missense_Mutation	SNP	ENST00000293882.4	hg19		.	.	.	.	.	.	.	.	.	.	G	5.715	0.316461	0.10789	0.0	1.16E-4	ENSG00000103266	ENST00000219548	T	0.14516	2.5	4.15	3.19	0.36642	.	0.157867	0.44688	D	0.000427	T	0.06188	0.0160	N	0.11427	0.14	0.80722	D	1	B	0.06786	0.001	B	0.01281	0.0	T	0.29458	-1.0011	10	0.12766	T	0.61	-28.6077	8.7441	0.34575	0.1906:0.0:0.8094:0.0	.	182	Q9UNE7	CHIP_HUMAN	Q	182	ENSP00000219548:R182Q	ENSP00000219548:R182Q	R	+	2	0	STUB1	671814	1.000000	0.71417	0.996000	0.52242	0.710000	0.40934	1.768000	0.38511	1.092000	0.41356	-0.273000	0.10243	CGA	.	G|1.000;A|0.000		0.627	JMJD8-201	KNOWN	basic	protein_coding	protein_coding		NM_001005920	
PKD1	5310	hgsc.bcm.edu	37	16	2141435	2141435	+	Silent	SNP	G	G	A			TCGA-2Y-A9H7-01A-11D-A38X-10	TCGA-2Y-A9H7-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e447e430-664c-4a56-9017-620aef1f0ffb	b2219bf0-50ab-4c4d-a22d-6b2a5c4bb365	g.chr16:2141435G>A	ENST00000262304.4	-	42	11909	c.11701C>T	c.(11701-11703)Ctg>Ttg	p.L3901L	MIR1225_ENST00000408729.1_RNA|RP11-304L19.1_ENST00000570072.1_RNA|PKD1_ENST00000423118.1_Silent_p.L3900L	NM_001009944.2	NP_001009944	P98161	PKD1_HUMAN	polycystic kidney disease 1 (autosomal dominant)	3901					anatomical structure morphogenesis (GO:0009653)|branching morphogenesis of an epithelial tube (GO:0048754)|calcium ion transmembrane transport (GO:0070588)|calcium-independent cell-matrix adhesion (GO:0007161)|cartilage condensation (GO:0001502)|cartilage development (GO:0051216)|cation transmembrane transport (GO:0098655)|cell cycle arrest (GO:0007050)|cell-matrix adhesion (GO:0007160)|cytoplasmic sequestering of transcription factor (GO:0042994)|detection of mechanical stimulus (GO:0050982)|digestive tract development (GO:0048565)|embryonic placenta development (GO:0001892)|genitalia development (GO:0048806)|heart development (GO:0007507)|homophilic cell adhesion (GO:0007156)|in utero embryonic development (GO:0001701)|JAK-STAT cascade (GO:0007259)|kidney development (GO:0001822)|liver development (GO:0001889)|lung epithelium development (GO:0060428)|mesonephric duct development (GO:0072177)|mesonephric tubule development (GO:0072164)|metanephric ascending thin limb development (GO:0072218)|metanephric collecting duct development (GO:0072205)|metanephric distal tubule morphogenesis (GO:0072287)|metanephric proximal tubule development (GO:0072237)|neural tube development (GO:0021915)|neuropeptide signaling pathway (GO:0007218)|nitrogen compound metabolic process (GO:0006807)|peptidyl-serine phosphorylation (GO:0018105)|placenta blood vessel development (GO:0060674)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of protein binding (GO:0032092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein export from nucleus (GO:0006611)|regulation of mitotic spindle organization (GO:0060236)|regulation of proteasomal protein catabolic process (GO:0061136)|response to fluid shear stress (GO:0034405)|skin development (GO:0043588)|spinal cord development (GO:0021510)	basolateral plasma membrane (GO:0016323)|cilium (GO:0005929)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lateral plasma membrane (GO:0016328)|motile primary cilium (GO:0031512)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|polycystin complex (GO:0002133)	calcium channel activity (GO:0005262)|carbohydrate binding (GO:0030246)|cation channel activity (GO:0005261)|ion channel binding (GO:0044325)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(7)|kidney(6)|lung(34)|prostate(4)|skin(10)|upper_aerodigestive_tract(3)|urinary_tract(3)	72						GAGGTGAGCAGAGGCAGCGAG	0.806																																					p.L3901L		Atlas-SNP	.											.	PKD1	184	.	0			c.C11701T	GRCh37	CI062279	PKD1	I		.						1.0	1.0	1.0					16																	2141435		417	744	1161	SO:0001819	synonymous_variant	5310	exon42			TGAGCAGAGGCAG	L33243	CCDS32369.1, CCDS45385.1	16p13.3	2014-01-28			ENSG00000008710	ENSG00000008710		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	9008	protein-coding gene	gene with protein product	"""polycystin 1"", ""transient receptor potential cation channel, subfamily P, member 1"""	601313					Standard	NM_001009944		Approved	PBP, Pc-1, TRPP1	uc002cos.1	P98161	OTTHUMG00000155795	ENST00000262304.4:c.11701C>T	chr16.hg19:g.2141435G>A		55.0	0.0		21.0	13.0	NM_001009944	Q15140|Q15141	Silent	SNP	ENST00000262304.4	hg19	CCDS32369.1																																																																																			.	.		0.806	PKD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000341688.1		
CCDC79	283847	hgsc.bcm.edu	37	16	66811151	66811151	+	Missense_Mutation	SNP	T	T	G			TCGA-2Y-A9H7-01A-11D-A38X-10	TCGA-2Y-A9H7-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e447e430-664c-4a56-9017-620aef1f0ffb	b2219bf0-50ab-4c4d-a22d-6b2a5c4bb365	g.chr16:66811151T>G	ENST00000558713.2	-	10	1012	c.940A>C	c.(940-942)Aaa>Caa	p.K314Q	CCDC79_ENST00000415744.1_Missense_Mutation_p.K314Q|CCDC79_ENST00000561333.1_5'UTR|CCDC79_ENST00000433574.1_Missense_Mutation_p.K314Q|CCDC79_ENST00000433154.1_Missense_Mutation_p.K314Q|CCDC79_ENST00000432602.1_Missense_Mutation_p.K314Q			Q8NA31	TERB1_HUMAN	coiled-coil domain containing 79	314					meiotic telomere clustering (GO:0045141)|synapsis (GO:0007129)	chromosome, telomeric region (GO:0000781)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			NS(1)|endometrium(2)|kidney(1)|large_intestine(1)|skin(2)	7						ATGCTAAATTTTTCTCCTGAA	0.343																																					p.K314Q		Atlas-SNP	.											.	CCDC79	32	.	0			c.A940C						.						169.0	139.0	148.0					16																	66811151		692	1591	2283	SO:0001583	missense	283847	exon11			TAAATTTTTCTCC	AK093213		16q22.1	2012-10-03			ENSG00000249961	ENSG00000249961			26675	protein-coding gene	gene with protein product							Standard	NM_001136505		Approved	FLJ35894	uc010viv.2	Q8NA31	OTTHUMG00000133562	ENST00000558713.2:c.940A>C	chr16.hg19:g.66811151T>G	ENSP00000462883:p.Lys314Gln	67.0	0.0		29.0	15.0	NM_001136505	A0AUW1	Missense_Mutation	SNP	ENST00000558713.2	hg19		.	.	.	.	.	.	.	.	.	.	T	12.82	2.051097	0.36181	.	.	ENSG00000177461	ENST00000433154;ENST00000432602;ENST00000433574;ENST00000415744	T;T;T;T	0.49432	0.78;0.78;0.78;0.78	5.33	5.33	0.75918	Armadillo-like helical (1);Armadillo-type fold (1);	0.073236	0.56097	D	0.000038	T	0.48223	0.1488	L	0.46157	1.445	0.27664	N	0.946973	P;D	0.56521	0.925;0.976	B;P	0.50049	0.406;0.629	T	0.45396	-0.9264	10	0.33141	T	0.24	-20.0197	11.6295	0.51166	0.0:0.0:0.1485:0.8515	.	314;314	Q8NA31;Q8NA31-2	CCD79_HUMAN;.	Q	314	ENSP00000463762:K314Q;ENSP00000462977:K314Q;ENSP00000462037:K314Q;ENSP00000462236:K314Q	ENSP00000440822:K314Q	K	-	1	0	CCDC79	65368652	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	3.086000	0.50159	2.025000	0.59659	0.533000	0.62120	AAA	.	.		0.343	CCDC79-003	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000418864.2		
C16orf86	388284	hgsc.bcm.edu	37	16	67702330	67702330	+	Missense_Mutation	SNP	C	C	T			TCGA-2Y-A9H7-01A-11D-A38X-10	TCGA-2Y-A9H7-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e447e430-664c-4a56-9017-620aef1f0ffb	b2219bf0-50ab-4c4d-a22d-6b2a5c4bb365	g.chr16:67702330C>T	ENST00000403458.4	+	4	936	c.781C>T	c.(781-783)Cat>Tat	p.H261Y	ENKD1_ENST00000602409.1_5'Flank|ENKD1_ENST00000243878.4_5'Flank|ENKD1_ENST00000602644.1_5'Flank	NM_001012984.2	NP_001013002.2	Q6ZW13	CP086_HUMAN	chromosome 16 open reading frame 86	261										endometrium(2)|lung(4)	6		Acute lymphoblastic leukemia(13;3.76e-06)|all_hematologic(13;0.000303)|Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0143)|Epithelial(162;0.047)|all cancers(182;0.228)		GACCCCCACCCATGCCCTGGC	0.662											OREG0023886	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.H261Y		Atlas-SNP	.											.	C16orf86	20	.	0			c.C781T						.						22.0	27.0	25.0					16																	67702330		1987	4156	6143	SO:0001583	missense	388284	exon4			CCCACCCATGCCC		CCDS32468.2	16q22.1	2008-10-30			ENSG00000159761	ENSG00000159761			33755	protein-coding gene	gene with protein product							Standard	NM_001012984		Approved	FLJ41802	uc002ety.3	Q6ZW13	OTTHUMG00000150527	ENST00000403458.4:c.781C>T	chr16.hg19:g.67702330C>T	ENSP00000384117:p.His261Tyr	53.0	0.0	1101	35.0	23.0	NM_001012984	B5MCW6	Missense_Mutation	SNP	ENST00000403458.4	hg19	CCDS32468.2	.	.	.	.	.	.	.	.	.	.	C	11.46	1.644261	0.29246	.	.	ENSG00000159761	ENST00000403458	.	.	.	5.95	3.99	0.46301	.	.	.	.	.	T	0.31071	0.0785	L	0.32530	0.975	0.09310	N	1	B	0.20261	0.043	B	0.17433	0.018	T	0.14448	-1.0472	8	0.27785	T	0.31	-0.6268	9.6959	0.40156	0.0:0.8363:0.0:0.1637	.	261	Q6ZW13	CP086_HUMAN	Y	261	.	ENSP00000384117:H261Y	H	+	1	0	C16orf86	66259831	0.001000	0.12720	0.042000	0.18584	0.013000	0.08279	1.133000	0.31430	1.532000	0.49169	0.563000	0.77884	CAT	.	.		0.662	C16orf86-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318767.2	NM_001012984	
DNAH2	146754	hgsc.bcm.edu	37	17	7722313	7722313	+	Missense_Mutation	SNP	G	G	A			TCGA-2Y-A9H7-01A-11D-A38X-10	TCGA-2Y-A9H7-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e447e430-664c-4a56-9017-620aef1f0ffb	b2219bf0-50ab-4c4d-a22d-6b2a5c4bb365	g.chr17:7722313G>A	ENST00000572933.1	+	71	12207	c.10747G>A	c.(10747-10749)Gcc>Acc	p.A3583T	DNAH2_ENST00000389173.2_Missense_Mutation_p.A3583T			Q9P225	DYH2_HUMAN	dynein, axonemal, heavy chain 2	3583	AAA 5. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(3)|breast(11)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(16)|large_intestine(53)|liver(2)|lung(49)|ovary(7)|prostate(7)|skin(15)|upper_aerodigestive_tract(1)|urinary_tract(1)	189		all_cancers(10;4.66e-07)|Prostate(122;0.081)				CAAGATCACAGCCACAGAGGT	0.612																																					p.A3583T		Atlas-SNP	.											.	DNAH2	498	.	0			c.G10747A						.						66.0	58.0	60.0					17																	7722313		2203	4300	6503	SO:0001583	missense	146754	exon70			ATCACAGCCACAG	U83570, AK128517	CCDS32551.1	17p13.1	2007-10-05	2006-09-04			ENSG00000183914		"""Axonemal dyneins"""	2948	protein-coding gene	gene with protein product		603333	"""dynein, axonemal, heavy polypeptide 2"", ""dynein heavy chain domain 3"""	DNHD3		9256245	Standard	XM_005256470		Approved	KIAA1503, FLJ46675	uc002giu.1	Q9P225		ENST00000572933.1:c.10747G>A	chr17.hg19:g.7722313G>A	ENSP00000458355:p.Ala3583Thr	47.0	0.0		52.0	24.0	NM_020877	A8K992|B5MDX5|O15434|Q6PIH3|Q6ZR42	Missense_Mutation	SNP	ENST00000572933.1	hg19	CCDS32551.1	.	.	.	.	.	.	.	.	.	.	G	14.49	2.549886	0.45383	.	.	ENSG00000183914	ENST00000360606;ENST00000389173	T	0.68624	-0.34	4.31	4.31	0.51392	.	0.223986	0.36854	N	0.002370	T	0.74230	0.3689	M	0.69823	2.125	0.80722	D	1	P;P	0.47910	0.881;0.902	P;P	0.51945	0.614;0.685	T	0.78773	-0.2073	10	0.87932	D	0	.	13.8355	0.63406	0.0:0.0:1.0:0.0	.	3544;3583	Q9P225-2;Q9P225	.;DYH2_HUMAN	T	3544;3583	ENSP00000373825:A3583T	ENSP00000353818:A3544T	A	+	1	0	DNAH2	7663038	0.998000	0.40836	0.107000	0.21349	0.112000	0.19704	5.291000	0.65667	2.228000	0.72767	0.462000	0.41574	GCC	.	.		0.612	DNAH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440241.1	NM_020877	
TAOK1	57551	hgsc.bcm.edu	37	17	27778638	27778638	+	Silent	SNP	A	A	C			TCGA-2Y-A9H7-01A-11D-A38X-10	TCGA-2Y-A9H7-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e447e430-664c-4a56-9017-620aef1f0ffb	b2219bf0-50ab-4c4d-a22d-6b2a5c4bb365	g.chr17:27778638A>C	ENST00000261716.3	+	2	591	c.72A>C	c.(70-72)ccA>ccC	p.P24P	TAOK1_ENST00000536202.1_Silent_p.P24P	NM_020791.2	NP_065842.1	Q7L7X3	TAOK1_HUMAN	TAO kinase 1	24					cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|execution phase of apoptosis (GO:0097194)|G2 DNA damage checkpoint (GO:0031572)|mitotic cell cycle (GO:0000278)|positive regulation of JNK cascade (GO:0046330)|positive regulation of stress-activated MAPK cascade (GO:0032874)|protein phosphorylation (GO:0006468)|regulation of cytoskeleton organization (GO:0051493)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|kinase activity (GO:0016301)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|transferase activity (GO:0016740)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(4)|lung(14)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	28			Colorectal(6;0.198)			AAGAAGATCCAGAGAAGCTCT	0.443																																					p.P24P		Atlas-SNP	.											.	TAOK1	151	.	0			c.A72C						.						111.0	108.0	109.0					17																	27778638		2203	4300	6503	SO:0001819	synonymous_variant	57551	exon2			AGATCCAGAGAAG	AB037782	CCDS32601.1, CCDS56024.1	17q11.2	2014-01-28				ENSG00000160551			29259	protein-coding gene	gene with protein product		610266				10718198, 14517247	Standard	NM_020791		Approved	KIAA1361, MARKK, PSK2, MAP3K16, FLJ14314, TAO1	uc002hdz.2	Q7L7X3		ENST00000261716.3:c.72A>C	chr17.hg19:g.27778638A>C		32.0	0.0		50.0	22.0	NM_025142	A2RUT8|B7ZLV6|Q96L75|Q9H2K7|Q9H7S5|Q9P2I6	Silent	SNP	ENST00000261716.3	hg19	CCDS32601.1																																																																																			.	.		0.443	TAOK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000447790.1	NM_020791	
EFCAB5	374786	hgsc.bcm.edu	37	17	28380584	28380584	+	Missense_Mutation	SNP	C	C	G			TCGA-2Y-A9H7-01A-11D-A38X-10	TCGA-2Y-A9H7-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e447e430-664c-4a56-9017-620aef1f0ffb	b2219bf0-50ab-4c4d-a22d-6b2a5c4bb365	g.chr17:28380584C>G	ENST00000394835.3	+	10	1804	c.1612C>G	c.(1612-1614)Ctg>Gtg	p.L538V	EFCAB5_ENST00000394832.2_Missense_Mutation_p.L538V|EFCAB5_ENST00000320856.5_Missense_Mutation_p.L538V|EFCAB5_ENST00000536908.2_Missense_Mutation_p.L482V|EFCAB5_ENST00000541045.1_Missense_Mutation_p.L195V|EFCAB5_ENST00000378738.3_Missense_Mutation_p.L538V	NM_198529.3	NP_940931	A4FU69	EFCB5_HUMAN	EF-hand calcium binding domain 5	538							calcium ion binding (GO:0005509)			breast(7)|endometrium(2)|kidney(4)|large_intestine(11)|lung(14)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	43						AGAGCAAGAACTGTACATAGA	0.428																																					p.L538V		Atlas-SNP	.											.	EFCAB5	122	.	0			c.C1612G						.						86.0	80.0	82.0					17																	28380584		1965	4154	6119	SO:0001583	missense	374786	exon10			CAAGAACTGTACA	AL833911	CCDS11254.2, CCDS54103.1	17q11.2	2013-01-10			ENSG00000176927	ENSG00000176927		"""EF-hand domain containing"""	24801	protein-coding gene	gene with protein product							Standard	NM_198529		Approved	FLJ46247	uc002het.3	A4FU69	OTTHUMG00000132753	ENST00000394835.3:c.1612C>G	chr17.hg19:g.28380584C>G	ENSP00000378312:p.Leu538Val	98.0	0.0		148.0	58.0	NM_198529	B2RPN0|B4DS75|B4DZR5|F5GYL2|Q0VD68|Q6ZRM6|Q8NDG9	Missense_Mutation	SNP	ENST00000394835.3	hg19	CCDS11254.2	.	.	.	.	.	.	.	.	.	.	C	7.000	0.554665	0.13436	.	.	ENSG00000176927	ENST00000536908;ENST00000534836;ENST00000541045;ENST00000394835;ENST00000320856;ENST00000394832;ENST00000378738;ENST00000423598;ENST00000419434	T;T;T;T;T;T;T	0.41758	0.99;0.99;0.99;0.99;0.99;0.99;0.99	5.71	0.635	0.17723	.	3.096610	0.01357	N	0.012083	T	0.38188	0.1031	L	0.50333	1.59	0.09310	N	1	P;P;P;P;B;B	0.51933	0.728;0.822;0.949;0.655;0.228;0.228	B;B;B;B;B;B	0.42593	0.095;0.121;0.392;0.194;0.083;0.121	T	0.24154	-1.0168	10	0.30078	T	0.28	5.7694	5.1239	0.14875	0.133:0.6436:0.1299:0.0935	.	482;482;538;538;538;538	B4DS75;F5GYL2;A8MSY9;B5MEA3;E7EVS9;A4FU69	.;.;.;.;.;EFCB5_HUMAN	V	482;281;195;538;538;538;538;482;344	ENSP00000440619:L482V;ENSP00000445575:L195V;ENSP00000378312:L538V;ENSP00000322003:L538V;ENSP00000378309:L538V;ENSP00000368012:L538V;ENSP00000417009:L344V	ENSP00000322003:L538V	L	+	1	2	EFCAB5	25404710	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	0.005000	0.13129	0.163000	0.19507	-0.176000	0.13171	CTG	.	.		0.428	EFCAB5-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256120.4	NM_198529	
ATP6V0A1	535	hgsc.bcm.edu	37	17	40620078	40620078	+	Missense_Mutation	SNP	G	G	C			TCGA-2Y-A9H7-01A-11D-A38X-10	TCGA-2Y-A9H7-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e447e430-664c-4a56-9017-620aef1f0ffb	b2219bf0-50ab-4c4d-a22d-6b2a5c4bb365	g.chr17:40620078G>C	ENST00000343619.4	+	4	370	c.247G>C	c.(247-249)Ggt>Cgt	p.G83R	ATP6V0A1_ENST00000393829.2_Missense_Mutation_p.G83R|ATP6V0A1_ENST00000546249.1_Missense_Mutation_p.G83R|ATP6V0A1_ENST00000544137.1_Intron|ATP6V0A1_ENST00000585525.1_Missense_Mutation_p.G83R|ATP6V0A1_ENST00000537728.1_Missense_Mutation_p.G83R|ATP6V0A1_ENST00000264649.6_Missense_Mutation_p.G83R	NM_001130021.1	NP_001123493.1	Q93050	VPP1_HUMAN	ATPase, H+ transporting, lysosomal V0 subunit a1	83					ATP hydrolysis coupled proton transport (GO:0015991)|cellular iron ion homeostasis (GO:0006879)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	cytoplasm (GO:0005737)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)|vacuolar proton-transporting V-type ATPase, V0 domain (GO:0000220)	ATPase binding (GO:0051117)|hydrogen ion transmembrane transporter activity (GO:0015078)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(8)|pancreas(1)|prostate(1)|urinary_tract(3)	26		all_cancers(22;1.18e-05)|Breast(137;0.000105)|all_epithelial(22;0.000254)		BRCA - Breast invasive adenocarcinoma(366;0.137)		TATGGACACCGGTGAAAACCC	0.398																																					p.G83R		Atlas-SNP	.											.	ATP6V0A1	67	.	0			c.G247C						.						89.0	88.0	88.0					17																	40620078		2203	4300	6503	SO:0001583	missense	535	exon4			GACACCGGTGAAA	U73006	CCDS11426.1, CCDS45683.1, CCDS45684.1	17q21	2010-04-21	2006-01-20	2002-05-10	ENSG00000033627	ENSG00000033627		"""ATPases / V-type"""	865	protein-coding gene	gene with protein product		192130	"""ATPase, H+ transporting, lysosomal (vacuolar proton pump) non-catalytic accessory protein 1A (110/116kD)"", ""ATPase, H+ transporting, lysosomal V0 subunit a isoform 1"", ""ATPase, H+ transporting, lysosomal V0 subunit A1"""	VPP1, ATP6N1, ATP6N1A		7774924	Standard	NM_001130020		Approved	a1, Vph1, Stv1	uc002hzs.3	Q93050		ENST00000343619.4:c.247G>C	chr17.hg19:g.40620078G>C	ENSP00000342951:p.Gly83Arg	277.0	0.0		331.0	120.0	NM_001130020	B7Z3B7|Q8N5G7|Q9NSX0	Missense_Mutation	SNP	ENST00000343619.4	hg19	CCDS45684.1	.	.	.	.	.	.	.	.	.	.	G	25.6	4.650195	0.87958	.	.	ENSG00000033627	ENST00000343619;ENST00000546249;ENST00000393829;ENST00000264649;ENST00000537728	D;D;D;D;D	0.85955	-2.05;-2.05;-2.05;-2.05;-2.05	5.99	5.99	0.97316	.	0.000000	0.85682	D	0.000000	D	0.89431	0.6713	L	0.38733	1.17	0.80722	D	1	D;D;P;D;D;D	0.89917	1.0;1.0;0.946;1.0;0.993;0.985	D;D;P;D;P;D	0.97110	0.999;1.0;0.836;1.0;0.904;0.95	D	0.86699	0.1928	10	0.31617	T	0.26	-13.9006	20.4777	0.99188	0.0:0.0:1.0:0.0	.	83;83;83;83;83;83	B7Z641;B7Z2A9;B7Z3B7;Q93050;Q93050-1;F5H569	.;.;.;VPP1_HUMAN;.;.	R	83	ENSP00000342951:G83R;ENSP00000444676:G83R;ENSP00000377415:G83R;ENSP00000264649:G83R;ENSP00000443991:G83R	ENSP00000264649:G83R	G	+	1	0	ATP6V0A1	37873604	1.000000	0.71417	0.973000	0.42090	0.902000	0.53008	9.837000	0.99465	2.840000	0.97914	0.655000	0.94253	GGT	.	.		0.398	ATP6V0A1-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000450364.1	NM_001130020	
KCNH6	81033	hgsc.bcm.edu	37	17	61615955	61615955	+	Missense_Mutation	SNP	C	C	T	rs560791257		TCGA-2Y-A9H7-01A-11D-A38X-10	TCGA-2Y-A9H7-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e447e430-664c-4a56-9017-620aef1f0ffb	b2219bf0-50ab-4c4d-a22d-6b2a5c4bb365	g.chr17:61615955C>T	ENST00000583023.1	+	8	1897	c.1886C>T	c.(1885-1887)tCc>tTc	p.S629F	KCNH6_ENST00000314672.5_Missense_Mutation_p.S629F|KCNH6_ENST00000456941.2_Missense_Mutation_p.S576F|KCNH6_ENST00000581784.1_Missense_Mutation_p.S576F	NM_030779.2	NP_110406.1	Q9H252	KCNH6_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 6	629					potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	signal transducer activity (GO:0004871)|voltage-gated potassium channel activity (GO:0005249)			breast(2)|central_nervous_system(2)|endometrium(9)|kidney(4)|large_intestine(6)|lung(20)|ovary(2)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	54					Doxazosin(DB00590)|Ibutilide(DB00308)|Miconazole(DB01110)|Prazosin(DB00457)|Terazosin(DB01162)	GACGTGCTCTCCACCCTCTAC	0.682													C|||	1	0.000199681	0.0	0.0	5008	,	,		15390	0.0		0.0	False		,,,				2504	0.001				p.S629F		Atlas-SNP	.											.	KCNH6	122	.	0			c.C1886T						.						43.0	37.0	39.0					17																	61615955		2203	4300	6503	SO:0001583	missense	81033	exon8			TGCTCTCCACCCT	AF311913	CCDS11638.1, CCDS11639.1, CCDS62290.1	17q23.3	2012-07-05				ENSG00000173826		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	18862	protein-coding gene	gene with protein product		608168				16382104	Standard	NM_030779		Approved	Kv11.2, erg2, HERG2	uc002jay.3	Q9H252		ENST00000583023.1:c.1886C>T	chr17.hg19:g.61615955C>T	ENSP00000463533:p.Ser629Phe	134.0	0.0		140.0	59.0	NM_030779	Q9BRD7	Missense_Mutation	SNP	ENST00000583023.1	hg19	CCDS11638.1	.	.	.	.	.	.	.	.	.	.	C	25.2	4.617776	0.87359	.	.	ENSG00000173826	ENST00000314672;ENST00000456941	D;D	0.96940	-4.18;-4.18	3.97	3.97	0.46021	Cyclic nucleotide-binding-like (1);RmlC-like jelly roll fold (1);Cyclic nucleotide-binding domain (3);	0.340703	0.29486	N	0.012004	D	0.97272	0.9108	M	0.84846	2.72	0.50467	D	0.999874	B;P;P;P	0.50272	0.182;0.755;0.933;0.755	B;P;P;P	0.51415	0.264;0.637;0.669;0.637	D	0.98233	1.0484	10	0.72032	D	0.01	.	16.2244	0.82284	0.0:1.0:0.0:0.0	.	506;629;576;629	B4DPJ3;B4DKC0;Q9H252-2;Q9H252	.;.;.;KCNH6_HUMAN	F	629;576	ENSP00000318212:S629F;ENSP00000396900:S576F	ENSP00000318212:S629F	S	+	2	0	KCNH6	58969687	1.000000	0.71417	1.000000	0.80357	0.887000	0.51463	5.807000	0.69157	2.040000	0.60383	0.491000	0.48974	TCC	.	.		0.682	KCNH6-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443853.1	NM_030779	
NETO1	81832	hgsc.bcm.edu	37	18	70417298	70417298	+	Splice_Site	SNP	G	G	A			TCGA-2Y-A9H7-01A-11D-A38X-10	TCGA-2Y-A9H7-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e447e430-664c-4a56-9017-620aef1f0ffb	b2219bf0-50ab-4c4d-a22d-6b2a5c4bb365	g.chr18:70417298G>A	ENST00000327305.6	-	9	2197	c.1540C>T	c.(1540-1542)Cgg>Tgg	p.R514W	NETO1_ENST00000583169.1_Splice_Site_p.R514W|NETO1_ENST00000299430.2_Splice_Site_p.R513W|RNA5SP460_ENST00000516789.1_RNA	NM_138966.3	NP_620416	Q8TDF5	NETO1_HUMAN	neuropilin (NRP) and tolloid (TLL)-like 1	514					memory (GO:0007613)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|receptor localization to synapse (GO:0097120)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|visual learning (GO:0008542)	cell junction (GO:0030054)|excitatory synapse (GO:0060076)|extracellular region (GO:0005576)|kainate selective glutamate receptor complex (GO:0032983)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)				NS(3)|breast(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(36)|ovary(2)|prostate(3)|skin(3)|stomach(1)	63		Esophageal squamous(42;0.129)		READ - Rectum adenocarcinoma(1;0.0487)		GATACTGACCGCTGGACGGCT	0.433																																					p.R514W		Atlas-SNP	.											.	NETO1	178	.	0			c.C1540T						.						79.0	69.0	72.0					18																	70417298		2203	4300	6503	SO:0001630	splice_region_variant	81832	exon9			CTGACCGCTGGAC	AF448838	CCDS12000.1, CCDS42444.1	18q22.2	2008-08-01			ENSG00000166342	ENSG00000166342			13823	protein-coding gene	gene with protein product		607973				11943477, 12810072	Standard	NM_138999		Approved	BTCL1, BCTL1	uc002lkw.3	Q8TDF5	OTTHUMG00000132834	ENST00000327305.6:c.1541+1C>T	chr18.hg19:g.70417298G>A		25.0	0.0		26.0	11.0	NM_001201465	Q86W85|Q8ND78|Q8TDF4	Missense_Mutation	SNP	ENST00000327305.6	hg19	CCDS12000.1	.	.	.	.	.	.	.	.	.	.	G	30	5.049745	0.93740	.	.	ENSG00000166342	ENST00000327305;ENST00000299430	T;T	0.33438	1.41;1.41	5.76	5.76	0.90799	.	0.000000	0.52532	D	0.000079	T	0.54498	0.1862	L	0.54323	1.7	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.83275	0.996;0.99	T	0.53187	-0.8474	10	0.87932	D	0	-8.9025	19.973	0.97292	0.0:0.0:1.0:0.0	.	513;514	Q8TDF5-2;Q8TDF5	.;NETO1_HUMAN	W	514;513	ENSP00000313088:R514W;ENSP00000299430:R513W	ENSP00000299430:R513W	R	-	1	2	NETO1	68568278	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	9.429000	0.97481	2.725000	0.93324	0.460000	0.39030	CGG	.	.		0.433	NETO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256301.2	NM_138999	Missense_Mutation
CTDP1	9150	hgsc.bcm.edu	37	18	77474841	77474841	+	Missense_Mutation	SNP	A	A	T			TCGA-2Y-A9H7-01A-11D-A38X-10	TCGA-2Y-A9H7-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e447e430-664c-4a56-9017-620aef1f0ffb	b2219bf0-50ab-4c4d-a22d-6b2a5c4bb365	g.chr18:77474841A>T	ENST00000299543.7	+	8	1528	c.1381A>T	c.(1381-1383)Agc>Tgc	p.S461C	CTDP1_ENST00000075430.7_Missense_Mutation_p.S461C	NM_001202504.1|NM_004715.4	NP_001189433.1|NP_004706.3	Q9Y5B0	CTDP1_HUMAN	CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) phosphatase, subunit 1	461	Ser-rich.				exit from mitosis (GO:0010458)|gene expression (GO:0010467)|positive regulation of viral transcription (GO:0050434)|protein dephosphorylation (GO:0006470)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	actin cytoskeleton (GO:0015629)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|midbody (GO:0030496)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)|spindle midzone (GO:0051233)|spindle pole (GO:0000922)	CTD phosphatase activity (GO:0008420)|DNA-directed RNA polymerase activity (GO:0003899)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(14)|ovary(2)|prostate(2)|urinary_tract(1)	35		Esophageal squamous(42;0.0157)|Melanoma(33;0.144)		OV - Ovarian serous cystadenocarcinoma(15;5.2e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0277)		CAGCGAGAGCAGCAGTGAGTC	0.667																																					p.S461C		Atlas-SNP	.											.	CTDP1	67	.	0			c.A1381T						.						13.0	14.0	13.0					18																	77474841		2189	4276	6465	SO:0001583	missense	9150	exon8			GAGAGCAGCAGTG	AF081287	CCDS12017.1, CCDS12018.1, CCDS74239.1	18q23	2014-09-17			ENSG00000060069	ENSG00000060069		"""Serine/threonine phosphatases / CTD aspartate-based phosphatases"""	2498	protein-coding gene	gene with protein product		604927				9405607, 9765293	Standard	NM_004715		Approved	FCP1	uc002lnh.2	Q9Y5B0	OTTHUMG00000132920	ENST00000299543.7:c.1381A>T	chr18.hg19:g.77474841A>T	ENSP00000299543:p.Ser461Cys	119.0	0.0		127.0	44.0	NM_004715	A8MY97|Q7Z644|Q96BZ1|Q9Y6F5	Missense_Mutation	SNP	ENST00000299543.7	hg19	CCDS12017.1	.	.	.	.	.	.	.	.	.	.	A	13.63	2.295974	0.40594	.	.	ENSG00000060069	ENST00000299543;ENST00000075430	T;T	0.11385	2.81;2.78	3.64	2.47	0.30058	.	0.579692	0.19134	N	0.121860	T	0.15869	0.0382	L	0.46157	1.445	0.32894	D	0.512227	D;D;D	0.67145	0.996;0.992;0.985	P;P;P	0.56216	0.794;0.794;0.628	T	0.17228	-1.0376	10	0.56958	D	0.05	-15.7834	5.1306	0.14907	0.583:0.0:0.417:0.0	.	342;461;461	Q9Y5B0-3;Q9Y5B0-4;Q9Y5B0	.;.;CTDP1_HUMAN	C	461	ENSP00000299543:S461C;ENSP00000075430:S461C	ENSP00000075430:S461C	S	+	1	0	CTDP1	75575829	0.998000	0.40836	0.997000	0.53966	0.212000	0.24457	3.484000	0.53201	0.580000	0.29522	-0.376000	0.06991	AGC	.	.		0.667	CTDP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256432.1	NM_004715	
FBN3	84467	hgsc.bcm.edu	37	19	8160952	8160952	+	Missense_Mutation	SNP	C	C	G			TCGA-2Y-A9H7-01A-11D-A38X-10	TCGA-2Y-A9H7-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e447e430-664c-4a56-9017-620aef1f0ffb	b2219bf0-50ab-4c4d-a22d-6b2a5c4bb365	g.chr19:8160952C>G	ENST00000600128.1	-	45	5966	c.5552G>C	c.(5551-5553)tGt>tCt	p.C1851S	FBN3_ENST00000270509.2_Missense_Mutation_p.C1851S|FBN3_ENST00000601739.1_Missense_Mutation_p.C1851S			Q75N90	FBN3_HUMAN	fibrillin 3	1851	EGF-like 29; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.					proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(9)|central_nervous_system(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(15)|lung(53)|ovary(7)|pancreas(2)|prostate(3)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	132						CTGCCGGTCACACTCGTCAAT	0.567																																					p.C1851S		Atlas-SNP	.											.	FBN3	300	.	0			c.G5552C						.						117.0	91.0	100.0					19																	8160952		2203	4300	6503	SO:0001583	missense	84467	exon44			CGGTCACACTCGT		CCDS12196.1	19p13	2008-02-05							18794	protein-coding gene	gene with protein product		608529					Standard	NM_032447		Approved		uc002mjf.3	Q75N90		ENST00000600128.1:c.5552G>C	chr19.hg19:g.8160952C>G	ENSP00000470498:p.Cys1851Ser	72.0	0.0		104.0	40.0	NM_032447	Q75N91|Q75N92|Q75N93|Q86SJ5|Q96JP8	Missense_Mutation	SNP	ENST00000600128.1	hg19	CCDS12196.1	.	.	.	.	.	.	.	.	.	.	C	14.16	2.452401	0.43531	.	.	ENSG00000142449	ENST00000270509	D	0.99429	-5.89	3.91	3.91	0.45181	EGF-like calcium-binding, conserved site (1);EGF-like calcium-binding (2);Epidermal growth factor-like, type 3 (1);	0.000000	0.85682	U	0.000000	D	0.99510	0.9825	M	0.91090	3.175	0.80722	D	1	D	0.57257	0.979	P	0.60173	0.87	D	0.98113	1.0421	10	0.56958	D	0.05	.	16.2735	0.82632	0.0:1.0:0.0:0.0	.	1851	Q75N90	FBN3_HUMAN	S	1851	ENSP00000270509:C1851S	ENSP00000270509:C1851S	C	-	2	0	FBN3	8066952	1.000000	0.71417	0.126000	0.21872	0.007000	0.05969	7.075000	0.76798	1.859000	0.53934	0.655000	0.94253	TGT	.	.		0.567	FBN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461428.2	NM_032447	
EPOR	2057	hgsc.bcm.edu	37	19	11491864	11491864	+	Missense_Mutation	SNP	T	T	A			TCGA-2Y-A9H7-01A-11D-A38X-10	TCGA-2Y-A9H7-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e447e430-664c-4a56-9017-620aef1f0ffb	b2219bf0-50ab-4c4d-a22d-6b2a5c4bb365	g.chr19:11491864T>A	ENST00000222139.6	-	5	711	c.607A>T	c.(607-609)Acc>Tcc	p.T203S	EPOR_ENST00000592375.2_Missense_Mutation_p.T203S	NM_000121.3	NP_000112.1	P19235	EPOR_HUMAN	erythropoietin receptor	203	Fibronectin type-III. {ECO:0000255|PROSITE-ProRule:PRU00316}.				brain development (GO:0007420)|decidualization (GO:0046697)|erythropoietin-mediated signaling pathway (GO:0038162)|heart development (GO:0007507)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	erythropoietin receptor activity (GO:0004900)|identical protein binding (GO:0042802)			endometrium(1)|lung(2)|ovary(1)|urinary_tract(1)	5					Darbepoetin alfa(DB00012)|Epoetin alfa(DB00016)|Epoetin Zeta(DB08923)|Peginesatide(DB08894)	ACACACTCGGTGCGGCCCTCC	0.682											OREG0025255	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.T203S		Atlas-SNP	.											.	EPOR	26	.	0			c.A607T						.						3.0	4.0	4.0					19																	11491864		1941	3850	5791	SO:0001583	missense	2057	exon5			ACTCGGTGCGGCC	M34986	CCDS12260.1	19p13.3-p13.2	2013-02-11				ENSG00000187266		"""Fibronectin type III domain containing"""	3416	protein-coding gene	gene with protein product		133171					Standard	NM_000121		Approved		uc002mrj.2	P19235		ENST00000222139.6:c.607A>T	chr19.hg19:g.11491864T>A	ENSP00000222139:p.Thr203Ser	101.0	0.0	672	109.0	44.0	NM_000121	B2RCG4|Q15443|Q2M205	Missense_Mutation	SNP	ENST00000222139.6	hg19	CCDS12260.1	.	.	.	.	.	.	.	.	.	.	t	13.58	2.279033	0.40294	.	.	ENSG00000187266	ENST00000222139	D	0.86956	-2.19	5.64	5.64	0.86602	Fibronectin, type III (4);Long hematopoietin receptor, single chain, conserved site (1);Immunoglobulin-like fold (1);	0.222215	0.46758	D	0.000265	T	0.80221	0.4583	L	0.29908	0.895	0.34350	D	0.689792	B	0.32968	0.392	B	0.32677	0.15	T	0.83324	-0.0016	10	0.29301	T	0.29	-26.5643	13.3961	0.60853	0.0:0.0:0.0:1.0	.	203	P19235	EPOR_HUMAN	S	203	ENSP00000222139:T203S	ENSP00000222139:T203S	T	-	1	0	EPOR	11352864	1.000000	0.71417	0.997000	0.53966	0.301000	0.27625	2.305000	0.43664	2.164000	0.68074	0.449000	0.29647	ACC	.	.		0.682	EPOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458791.1		
TIMM50	92609	hgsc.bcm.edu	37	19	39972548	39972548	+	Missense_Mutation	SNP	G	G	A			TCGA-2Y-A9H7-01A-11D-A38X-10	TCGA-2Y-A9H7-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e447e430-664c-4a56-9017-620aef1f0ffb	b2219bf0-50ab-4c4d-a22d-6b2a5c4bb365	g.chr19:39972548G>A	ENST00000607714.1	+	2	156	c.134G>A	c.(133-135)aGc>aAc	p.S45N	TIMM50_ENST00000314349.4_Missense_Mutation_p.S148N|TIMM50_ENST00000599794.1_Intron|TIMM50_ENST00000544017.1_5'UTR			Q3ZCQ8	TIM50_HUMAN	translocase of inner mitochondrial membrane 50 homolog (S. cerevisiae)	45					cellular protein metabolic process (GO:0044267)|mitochondrial membrane organization (GO:0007006)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|protein targeting to mitochondrion (GO:0006626)|release of cytochrome c from mitochondria (GO:0001836)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial inner membrane presequence translocase complex (GO:0005744)|mitochondrion (GO:0005739)|nuclear speck (GO:0016607)	interleukin-2 receptor binding (GO:0005134)|phosphoprotein phosphatase activity (GO:0004721)|protein serine/threonine phosphatase activity (GO:0004722)|protein tyrosine phosphatase activity (GO:0004725)|ribonucleoprotein complex binding (GO:0043021)|RNA binding (GO:0003723)			NS(1)|endometrium(3)|large_intestine(5)|lung(3)|ovary(1)|prostate(1)	14	all_cancers(60;4.04e-06)|all_lung(34;1.77e-07)|Lung NSC(34;2.09e-07)|all_epithelial(25;1.13e-05)|Ovarian(47;0.159)		Epithelial(26;5.89e-26)|all cancers(26;1.96e-23)|LUSC - Lung squamous cell carcinoma(53;0.000657)			AGCCGCGGGAGCACTAAGGCG	0.627																																					p.S148N		Atlas-SNP	.											.	TIMM50	37	.	0			c.G443A						.						72.0	82.0	79.0					19																	39972548		2203	4300	6503	SO:0001583	missense	92609	exon2			GCGGGAGCACTAA	BC009072	CCDS33023.1	19q13.2	2010-06-21	2006-04-04		ENSG00000105197	ENSG00000105197		"""Serine/threonine phosphatases / CTD aspartate-based phosphatases"""	23656	protein-coding gene	gene with protein product		607381	"""translocase of inner mitochondrial membrane 50 homolog (yeast)"""			12437925	Standard	NM_001001563		Approved	TIM50L	uc002olu.1	Q3ZCQ8		ENST00000607714.1:c.134G>A	chr19.hg19:g.39972548G>A	ENSP00000475531:p.Ser45Asn	55.0	0.0		49.0	17.0	NM_001001563	Q330K1|Q6QA00|Q96FJ5|Q96GY2|Q9H370	Missense_Mutation	SNP	ENST00000607714.1	hg19		.	.	.	.	.	.	.	.	.	.	G	14.83	2.653638	0.47362	.	.	ENSG00000105197	ENST00000314349	.	.	.	4.24	3.2	0.36748	.	0.664310	0.14279	N	0.329649	T	0.21145	0.0509	N	0.08118	0	0.21933	N	0.999462	B	0.02656	0.0	B	0.09377	0.004	T	0.17745	-1.0359	8	.	.	.	-8.512	9.5116	0.39080	0.1016:0.0:0.8984:0.0	.	148	Q3ZCQ8-2	.	N	148	.	.	S	+	2	0	TIMM50	44664388	0.039000	0.19947	0.005000	0.12908	0.548000	0.35241	1.854000	0.39368	1.120000	0.41904	0.561000	0.74099	AGC	.	.		0.627	TIMM50-021	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000470728.1	NM_001001563	
PSG1	5669	hgsc.bcm.edu	37	19	43382260	43382260	+	Missense_Mutation	SNP	T	T	A			TCGA-2Y-A9H7-01A-11D-A38X-10	TCGA-2Y-A9H7-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e447e430-664c-4a56-9017-620aef1f0ffb	b2219bf0-50ab-4c4d-a22d-6b2a5c4bb365	g.chr19:43382260T>A	ENST00000436291.2	-	2	351	c.235A>T	c.(235-237)Att>Ttt	p.I79F	PSG1_ENST00000312439.6_Missense_Mutation_p.I79F|PSG1_ENST00000595356.1_Missense_Mutation_p.I79F|PSG1_ENST00000244296.2_Missense_Mutation_p.I79F|PSG1_ENST00000595124.1_Missense_Mutation_p.I79F|PSG1_ENST00000403380.3_Missense_Mutation_p.I79F|PSG1_ENST00000601073.1_5'UTR	NM_001184825.1|NM_001184826.1	NP_001171754.1|NP_001171755.1	P11464	PSG1_HUMAN	pregnancy specific beta-1-glycoprotein 1	79	Ig-like V-type.				female pregnancy (GO:0007565)	extracellular region (GO:0005576)				breast(2)|endometrium(4)|kidney(2)|large_intestine(5)|lung(9)|ovary(3)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	30		Prostate(69;0.00682)				TATGATGTAATGTAATGGTAG	0.433																																					p.I79F		Atlas-SNP	.											.	PSG1	196	.	0			c.A235T						.						234.0	228.0	230.0					19																	43382260		2202	4299	6501	SO:0001583	missense	5669	exon2			ATGTAATGTAATG		CCDS12612.1, CCDS54275.1, CCDS59392.1, CCDS74380.1	19q13.2	2013-01-29			ENSG00000231924	ENSG00000231924		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9514	protein-coding gene	gene with protein product		176390		PSBG1			Standard	NM_006905		Approved	PSGGA, CD66f, PBG1		P11464	OTTHUMG00000151123	ENST00000436291.2:c.235A>T	chr19.hg19:g.43382260T>A	ENSP00000413041:p.Ile79Phe	69.0	0.0		83.0	40.0	NM_001184826	O75236|P11462|P11463|Q15231|Q15241|Q15243|Q16660|Q6ICR4|Q9P1W5|Q9UQ79	Missense_Mutation	SNP	ENST00000436291.2	hg19	CCDS54275.1	.	.	.	.	.	.	.	.	.	.	N	12.25	1.881571	0.33255	.	.	ENSG00000231924	ENST00000270059;ENST00000436291;ENST00000403380;ENST00000312439;ENST00000244296	T;T;T;T	0.71341	-0.56;-0.56;-0.56;-0.56	1.64	1.64	0.23874	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like fold (1);	.	.	.	.	D	0.87148	0.6105	H	0.97340	3.985	0.09310	N	1	D;P;D;P;D;P;D;D;P	0.89917	0.973;0.907;0.99;0.729;0.999;0.914;1.0;0.997;0.907	D;P;D;P;D;D;D;D;P	0.85130	0.94;0.873;0.92;0.755;0.987;0.938;0.994;0.997;0.873	T	0.73733	-0.3890	9	0.87932	D	0	.	5.4006	0.16293	0.0:0.0:0.0:1.0	.	79;79;79;79;79;79;79;79;79	O75238;P11464-4;G5E9F7;P11464;Q8NBY8;P11464-3;Q9UPK8;O75237;P11464-2	.;.;.;PSG1_HUMAN;.;.;.;.;.	F	79	ENSP00000413041:I79F;ENSP00000385386:I79F;ENSP00000308970:I79F;ENSP00000244296:I79F	ENSP00000244296:I79F	I	-	1	0	PSG1	48074100	0.027000	0.19231	0.003000	0.11579	0.015000	0.08874	1.883000	0.39658	1.029000	0.39812	0.155000	0.16302	ATT	.	.		0.433	PSG1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000321426.1		
ASXL1	171023	hgsc.bcm.edu	37	20	31021697	31021697	+	Nonsense_Mutation	SNP	G	G	T			TCGA-2Y-A9H7-01A-11D-A38X-10	TCGA-2Y-A9H7-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e447e430-664c-4a56-9017-620aef1f0ffb	b2219bf0-50ab-4c4d-a22d-6b2a5c4bb365	g.chr20:31021697G>T	ENST00000375687.4	+	12	2120	c.1696G>T	c.(1696-1698)Gag>Tag	p.E566*	ASXL1_ENST00000306058.5_Nonsense_Mutation_p.E561*	NM_015338.5	NP_056153	Q8IXJ9	ASXL1_HUMAN	additional sex combs like transcriptional regulator 1	566	Interaction with NCOA1. {ECO:0000250}.				bone development (GO:0060348)|monoubiquitinated histone H2A deubiquitination (GO:0035522)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of peroxisome proliferator activated receptor signaling pathway (GO:0035359)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of retinoic acid receptor signaling pathway (GO:0048386)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to retinoic acid (GO:0032526)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nuclear chromatin (GO:0000790)|PR-DUB complex (GO:0035517)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|peroxisome proliferator activated receptor binding (GO:0042975)|retinoic acid receptor binding (GO:0042974)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)			NS(1)|breast(2)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(655)|kidney(5)|large_intestine(18)|liver(1)|lung(27)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	722						CACTAAAGAGGAGCCCAAAGT	0.507			"""F, N, Mis"""		"""MDS, CMML"""																																p.E566X		Atlas-SNP	.		Rec	yes		20	20q11.1	171023	additional sex combs like 1		L	.	ASXL1	1114	.	0			c.G1696T						.						54.0	60.0	58.0					20																	31021697		2203	4300	6503	SO:0001587	stop_gained	171023	exon11			AAAGAGGAGCCCA	AJ438952	CCDS13201.1	20q11	2014-09-17	2014-06-17		ENSG00000171456	ENSG00000171456			18318	protein-coding gene	gene with protein product		612990	"""additional sex combs like 1 (Drosophila)"""			12657473	Standard	NM_015338		Approved	KIAA0978	uc002wxs.3	Q8IXJ9	OTTHUMG00000032218	ENST00000375687.4:c.1696G>T	chr20.hg19:g.31021697G>T	ENSP00000364839:p.Glu566*	94.0	0.0		89.0	33.0	NM_015338	B2RP59|Q5JWS9|Q8IYY7|Q9H466|Q9NQF8|Q9UFJ0|Q9UFP8|Q9Y2I4	Nonsense_Mutation	SNP	ENST00000375687.4	hg19	CCDS13201.1	.	.	.	.	.	.	.	.	.	.	G	41	8.691263	0.98916	.	.	ENSG00000171456	ENST00000358956;ENST00000375687;ENST00000421155;ENST00000412498;ENST00000306058	.	.	.	5.02	5.02	0.67125	.	0.050239	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.37606	T	0.19	-10.7937	18.905	0.92456	0.0:0.0:1.0:0.0	.	.	.	.	X	566;566;566;505;561	.	ENSP00000305119:E561X	E	+	1	0	ASXL1	30485358	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.350000	0.79385	2.780000	0.95670	0.655000	0.94253	GAG	.	.		0.507	ASXL1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000078624.2	NM_015338	
FAM65C	140876	hgsc.bcm.edu	37	20	49232571	49232571	+	Missense_Mutation	SNP	G	G	A	rs147229572	byFrequency	TCGA-2Y-A9H7-01A-11D-A38X-10	TCGA-2Y-A9H7-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e447e430-664c-4a56-9017-620aef1f0ffb	b2219bf0-50ab-4c4d-a22d-6b2a5c4bb365	g.chr20:49232571G>A	ENST00000327979.2	-	4	715	c.304C>T	c.(304-306)Cgc>Tgc	p.R102C	MIR1302-5_ENST00000408164.1_RNA|FAM65C_ENST00000535356.1_Missense_Mutation_p.R106C|FAM65C_ENST00000045083.2_Missense_Mutation_p.R102C			Q96MK2	FA65C_HUMAN	family with sequence similarity 65, member C	102								p.R102C(2)		endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|liver(1)|lung(12)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						TCTTTGTGGCGTCCAGACAGG	0.542													G|||	2	0.000399361	0.0	0.0	5008	,	,		19561	0.0		0.0	False		,,,				2504	0.002				p.R102C		Atlas-SNP	.											FAM65C,NS,carcinoma,0,3	FAM65C	87	.	2	Substitution - Missense(2)	large_intestine(1)|prostate(1)	c.C304T						.	G	CYS/ARG	4,4402	8.1+/-20.4	0,4,2199	105.0	91.0	96.0		304	-0.7	0.1	20	dbSNP_134	96	0,8600		0,0,4300	no	missense	FAM65C	NM_080829.2	180	0,4,6499	AA,AG,GG		0.0,0.0908,0.0308	benign	102/947	49232571	4,13002	2203	4300	6503	SO:0001583	missense	140876	exon4			TGTGGCGTCCAGA	AL133230	CCDS13431.2	20q13.13	2011-11-24	2008-06-13	2008-06-13	ENSG00000042062	ENSG00000042062			16168	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 175"", ""chromosome 20 open reading frame 176"""	C20orf175, C20orf176			Standard	XM_005260294		Approved	dJ530I15.2, dJ530I15.3	uc002xvm.3	Q96MK2	OTTHUMG00000032724	ENST00000327979.2:c.304C>T	chr20.hg19:g.49232571G>A	ENSP00000332663:p.Arg102Cys	61.0	0.0		51.0	23.0	NM_080829	Q5QPB6|Q9NQQ2	Missense_Mutation	SNP	ENST00000327979.2	hg19	CCDS13431.2	.	.	.	.	.	.	.	.	.	.	G	10.88	1.474409	0.26423	9.08E-4	0.0	ENSG00000042062	ENST00000327979;ENST00000045083;ENST00000535356	T;T;T	0.02216	4.39;4.39;4.39	5.07	-0.7	0.11273	.	0.321942	0.34700	N	0.003757	T	0.01627	0.0052	L	0.27053	0.805	0.22693	N	0.998845	B;B	0.09022	0.002;0.001	B;B	0.06405	0.002;0.002	T	0.43310	-0.9399	10	0.49607	T	0.09	-14.0537	5.2312	0.15422	0.3895:0.0:0.4795:0.131	.	106;102	F5H0X2;Q96MK2	.;FA65C_HUMAN	C	102;102;106	ENSP00000332663:R102C;ENSP00000045083:R102C;ENSP00000439802:R106C	ENSP00000045083:R102C	R	-	1	0	FAM65C	48665978	0.983000	0.35010	0.123000	0.21794	0.734000	0.41952	2.692000	0.47018	-0.057000	0.13199	-0.263000	0.10527	CGC	.	G|1.000;A|0.000		0.542	FAM65C-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257962.1		
TPTE	7179	hgsc.bcm.edu	37	21	10906915	10906915	+	Missense_Mutation	SNP	C	C	G	rs169758	byFrequency	TCGA-2Y-A9H7-01A-11D-A38X-10	TCGA-2Y-A9H7-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e447e430-664c-4a56-9017-620aef1f0ffb	b2219bf0-50ab-4c4d-a22d-6b2a5c4bb365	g.chr21:10906915C>G	ENST00000361285.4	-	24	1975	c.1646G>C	c.(1645-1647)gGa>gCa	p.G549A	TPTE_ENST00000342420.5_Missense_Mutation_p.G511A|TPTE_ENST00000415664.2_5'UTR|TPTE_ENST00000298232.7_Missense_Mutation_p.G531A	NM_199261.2	NP_954870	P56180	TPTE_HUMAN	transmembrane phosphatase with tensin homology	549			G -> E (in dbSNP:rs169758).		peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)	ion channel activity (GO:0005216)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			NS(1)|breast(1)|central_nervous_system(2)|cervix(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(19)|lung(76)|ovary(2)|prostate(2)|skin(8)|urinary_tract(1)	130			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		TTAATCGGATCCAGCTACAAC	0.393																																					p.G549A		Atlas-SNP	.											.	TPTE	513	.	0			c.G1646C						.						135.0	119.0	124.0					21																	10906915		2203	4300	6503	SO:0001583	missense	7179	exon24			TCGGATCCAGCTA	AF007118	CCDS74771.1, CCDS74772.1, CCDS74773.1	21p11	2011-06-09			ENSG00000166157	ENSG00000274391		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"""	12023	protein-coding gene	gene with protein product	"""PTEN-related tyrosine phosphatase"", ""cancer/testis antigen 44"""	604336				10830953, 14659893	Standard	NM_001290224		Approved	PTEN2, CT44	uc002yip.1	P56180	OTTHUMG00000074127	ENST00000361285.4:c.1646G>C	chr21.hg19:g.10906915C>G	ENSP00000355208:p.Gly549Ala	124.0	0.0		168.0	38.0	NM_199261	B2RAP7|C9J6D6|C9JKK8|Q6XPS4|Q6XPS5|Q71JA8|Q8NCS8	Missense_Mutation	SNP	ENST00000361285.4	hg19	CCDS13560.2	.	.	.	.	.	.	.	.	.	.	.	11.87	1.768066	0.31320	.	.	ENSG00000166157	ENST00000298232;ENST00000361285;ENST00000342420	D;D;D	0.95103	-3.35;-3.61;-3.43	1.79	-3.58	0.04597	.	.	.	.	.	D	0.82834	0.5123	N	0.14661	0.345	0.80722	P	0.0	B;B;B	0.31655	0.334;0.334;0.225	B;B;B	0.20767	0.031;0.031;0.014	T	0.73522	-0.3956	8	0.29301	T	0.29	.	3.6687	0.08265	0.3648:0.4609:0.1743:0.0	.	511;531;549	P56180-3;P56180-2;P56180	.;.;TPTE_HUMAN	A	531;549;511	ENSP00000298232:G531A;ENSP00000355208:G549A;ENSP00000344441:G511A	ENSP00000298232:G531A	G	-	2	0	TPTE	9928786	0.003000	0.15002	0.000000	0.03702	0.030000	0.12068	0.139000	0.16036	-0.821000	0.04312	0.184000	0.17185	GGA	.	C|0.947;T|0.053		0.393	TPTE-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000157413.1		
MT-CO2	4513	hgsc.bcm.edu	37	M	7588	7588	+	Start_Codon_SNP	SNP	G	G	A			TCGA-2Y-A9H7-01A-11D-A38X-10	TCGA-2Y-A9H7-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e447e430-664c-4a56-9017-620aef1f0ffb	b2219bf0-50ab-4c4d-a22d-6b2a5c4bb365	g.chrM:7588G>A	ENST00000361739.1	+	1	3	c.3G>A	c.(1-3)atG>atA	p.M1I	MT-ND3_ENST00000361227.2_5'Flank|MT-TC_ENST00000387405.1_RNA|MT-ND4L_ENST00000361335.1_5'Flank|MT-ATP6_ENST00000361899.2_5'Flank|MT-CO3_ENST00000362079.2_5'Flank|MT-TD_ENST00000387419.1_RNA|MT-TW_ENST00000387382.1_RNA|MT-TK_ENST00000387421.1_RNA|MT-TS1_ENST00000387416.2_RNA|MT-TG_ENST00000387429.1_RNA|MT-TN_ENST00000387400.1_RNA|MT-TA_ENST00000387392.1_RNA|MT-ATP8_ENST00000361851.1_5'Flank|MT-TR_ENST00000387439.1_RNA|MT-TY_ENST00000387409.1_RNA			P00403	COX2_HUMAN	mitochondrially encoded cytochrome c oxidase II	1					cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|mitochondrial electron transport, cytochrome c to oxygen (GO:0006123)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|respiratory chain complex IV (GO:0045277)	copper ion binding (GO:0005507)|cytochrome-c oxidase activity (GO:0004129)			endometrium(5)|kidney(8)|lung(2)|pancreas(3)|prostate(1)	19						TATATCTTAATGGCACATGCA	0.378																																					p.M1M		Atlas-SNP	.											.	.	.	.	0			c.G3A						.																																			SO:0001582	initiator_codon_variant	5743	exon1			CTTAATGGCACAT			mitochondria	2012-11-16	2005-02-15	2005-02-16	ENSG00000198712	ENSG00000198712		"""Mitochondrial respiratory chain complex / Complex IV"""	7421	protein-coding gene	gene with protein product		516040	"""cytochrome c oxidase II"""	MTCO2		1712754, 1989603	Standard			Approved	COX2, CO2		P00403		ENST00000361739.1:c.3G>A	chrM.hg19:g.7588G>A	ENSP00000354876:p.Met1Ile	7.0	0.0		37.0	23.0	ENST00000361739	Q37526	Silent	SNP	ENST00000361739.1	hg19																																																																																				.	.		0.378	MT-CO2-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024029	Missense_Mutation
MT-ND5	4540	hgsc.bcm.edu	37	M	12991	12991	+	Missense_Mutation	SNP	G	G	A			TCGA-2Y-A9H7-01A-11D-A38X-10	TCGA-2Y-A9H7-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e447e430-664c-4a56-9017-620aef1f0ffb	b2219bf0-50ab-4c4d-a22d-6b2a5c4bb365	g.chrM:12991G>A	ENST00000361567.2	+	1	655	c.655G>A	c.(655-657)Gca>Aca	p.A219T	MT-CYB_ENST00000361789.2_5'Flank|MT-TL2_ENST00000387456.1_RNA|MT-TT_ENST00000387460.2_RNA|MT-TG_ENST00000387429.1_RNA|MT-TH_ENST00000387441.1_RNA|MT-TE_ENST00000387459.1_RNA|MT-TS2_ENST00000387449.1_RNA|MT-TP_ENST00000387461.2_RNA|MT-TR_ENST00000387439.1_RNA			P03915	NU5M_HUMAN	mitochondrially encoded NADH dehydrogenase 5	219					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(4)|endometrium(29)|kidney(33)|pancreas(1)|prostate(7)	74						GCCTCCTCCTAGCAGCAGCAG	0.532																																					p.A219T		Atlas-SNP	.											.	.	.	.	0			c.G655A						.																																			SO:0001583	missense	0	exon1			CTCCTAGCAGCAG			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198786	ENSG00000198786	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7461	protein-coding gene	gene with protein product	"""complex I ND5 subunit"", ""NADH-ubiquinone oxidoreductase chain 5"""	516005	"""NADH dehydrogenase 5"""	MTND5			Standard			Approved	ND5, NAD5		P03915		ENST00000361567.2:c.655G>A	chrM.hg19:g.12991G>A	ENSP00000354813:p.Ala219Thr	6.0	0.0		41.0	12.0	ENST00000361567	Q34773|Q8WCY3	Missense_Mutation	SNP	ENST00000361567.2	hg19																																																																																				.	.		0.532	MT-ND5-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024036	
ISYNA1	51477	hgsc.bcm.edu	37	19	18547823	18547824	+	Frame_Shift_Del	DEL	CG	CG	-			TCGA-2Y-A9H7-01A-11D-A38X-10	TCGA-2Y-A9H7-10A-01D-A38X-10	CG	CG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e447e430-664c-4a56-9017-620aef1f0ffb	b2219bf0-50ab-4c4d-a22d-6b2a5c4bb365	g.chr19:18547823_18547824delCG	ENST00000338128.8	-	4	591_592	c.374_375delCG	c.(373-375)gcgfs	p.A125fs	ISYNA1_ENST00000578963.1_5'UTR|ISYNA1_ENST00000457269.4_Frame_Shift_Del_p.A71fs|ISYNA1_ENST00000317018.6_5'UTR|ISYNA1_ENST00000545187.1_Intron	NM_001170938.1|NM_016368.4	NP_001164409.1|NP_057452.1	Q9NPH2	INO1_HUMAN	inositol-3-phosphate synthase 1	125					inositol biosynthetic process (GO:0006021)|inositol phosphate metabolic process (GO:0043647)|phospholipid biosynthetic process (GO:0008654)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	inositol-3-phosphate synthase activity (GO:0004512)			breast(1)|endometrium(1)|kidney(2)|lung(4)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(2)	12						TGGGCAGCACCGCGCTGAAGGG	0.713																																					p.125_126del		Atlas-Indel,Pindel	.											.	ISYNA1	31	.	0			c.375_376del						.																																			SO:0001589	frameshift_variant	51477	exon4			.		CCDS12379.1, CCDS54234.1, CCDS62603.1	19p13.11	2014-09-04			ENSG00000105655	ENSG00000105655	5.5.1.4		29821	protein-coding gene	gene with protein product	"""myo-inositol 1-phosphate synthase"""	611670				15024000, 12941308	Standard	NM_016368		Approved	Ino1, INOS, IPS	uc002njd.2	Q9NPH2	OTTHUMG00000179027	ENST00000338128.8:c.374_375delCG	chr19.hg19:g.18547825_18547826delCG	ENSP00000337746:p.Ala125fs	106.0	0.0		128.0	54.0	NM_016368	B3KRT1|G5E9U0|Q6NXT5|Q7Z525|Q9BT65|Q9H2Y2|Q9NSU0|Q9NVW7	Frame_Shift_Del	DEL	ENST00000338128.8	hg19	CCDS12379.1																																																																																			.	.		0.713	ISYNA1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444469.2	NM_016368	
ASCL1	429	hgsc.bcm.edu	37	12	103352142	103352170	+	Frame_Shift_Del	DEL	CGCAGCCGCCGCAGCGGCAGCGCAGAGCG	CGCAGCCGCCGCAGCGGCAGCGCAGAGCG	-	rs558732328|rs552552603|rs554829144|rs545982257|rs139008516|rs568951072	byFrequency	TCGA-2Y-A9H7-01A-11D-A38X-10	TCGA-2Y-A9H7-10A-01D-A38X-10	CGCAGCCGCCGCAGCGGCAGCGCAGAGCG	CGCAGCCGCCGCAGCGGCAGCGCAGAGCG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e447e430-664c-4a56-9017-620aef1f0ffb	b2219bf0-50ab-4c4d-a22d-6b2a5c4bb365	g.chr12:103352142_103352170delCGCAGCCGCCGCAGCGGCAGCGCAGAGCG	ENST00000266744.3	+	1	679_707	c.120_148delCGCAGCCGCCGCAGCGGCAGCGCAGAGCG	c.(118-150)gccgcagccgccgcagcggcagcgcagagcgcgfs	p.AAAAAAAAQSA40fs		NM_004316.3	NP_004307.2	P50553	ASCL1_HUMAN	achaete-scute family bHLH transcription factor 1	40	Poly-Ala.				adrenal chromaffin cell differentiation (GO:0061104)|carotid body glomus cell differentiation (GO:0061103)|cell maturation (GO:0048469)|cellular response to magnetism (GO:0071259)|central nervous system neuron development (GO:0021954)|cerebral cortex development (GO:0021987)|cerebral cortex GABAergic interneuron differentiation (GO:0021892)|commitment of neuronal cell to specific neuron type in forebrain (GO:0021902)|lung epithelial cell differentiation (GO:0060487)|lung neuroendocrine cell differentiation (GO:0061100)|musculoskeletal movement, spinal reflex action (GO:0050883)|negative regulation of apoptotic process (GO:0043066)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of transcription, DNA-templated (GO:0045892)|neuroblast fate determination (GO:0007400)|neuroblast proliferation (GO:0007405)|neurogenesis (GO:0022008)|neuron fate specification (GO:0048665)|neuron migration (GO:0001764)|noradrenergic neuron development (GO:0003358)|noradrenergic neuron fate commitment (GO:0003359)|Notch signaling pathway (GO:0007219)|olfactory pit development (GO:0060166)|oligodendrocyte development (GO:0014003)|positive regulation of cell cycle (GO:0045787)|positive regulation of neural precursor cell proliferation (GO:2000179)|positive regulation of neurogenesis (GO:0050769)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of epithelial cell differentiation (GO:0030856)|regulation of gene expression (GO:0010468)|regulation of mitotic cell cycle (GO:0007346)|regulation of timing of subpallium neuron differentiation (GO:0060165)|response to epidermal growth factor (GO:0070849)|response to folic acid (GO:0051593)|response to lithium ion (GO:0010226)|response to retinoic acid (GO:0032526)|spinal cord association neuron differentiation (GO:0021527)|spinal cord oligodendrocyte cell fate specification (GO:0021530)|stomach neuroendocrine cell differentiation (GO:0061102)|subpallium neuron fate commitment (GO:0060163)|sympathetic ganglion development (GO:0061549)|sympathetic nervous system development (GO:0048485)|transcription, DNA-templated (GO:0006351)|ventral spinal cord interneuron fate commitment (GO:0060579)|vestibular nucleus development (GO:0021750)	neuronal cell body (GO:0043025)|nucleus (GO:0005634)	bHLH transcription factor binding (GO:0043425)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|E-box binding (GO:0070888)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding transcription factor activity (GO:0000989)			NS(3)|large_intestine(1)|lung(1)	5						ccgcggcggccgcagccgccgcagcggcagcgcagagcgcgcagcagca	0.769																																					p.40_49del		Atlas-INDEL	.											.	ASCL1	16	.	0			c.119_147del						.																																			SO:0001589	frameshift_variant	429	exon1			.	L08424	CCDS31886.1	12q22-q23	2013-10-17	2013-10-17			ENSG00000139352		"""Basic helix-loop-helix proteins"""	738	protein-coding gene	gene with protein product		100790	"""achaete-scute complex (Drosophila) homolog-like 1"", ""achaete-scute complex-like 1 (Drosophila)"", ""achaete-scute complex homolog 1 (Drosophila)"""			8390674	Standard	NM_004316		Approved	ASH1, HASH1, bHLHa46	uc001tjr.4	P50553		ENST00000266744.3:c.120_148delCGCAGCCGCCGCAGCGGCAGCGCAGAGCG	chr12.hg19:g.103352142_103352170delCGCAGCCGCCGCAGCGGCAGCGCAGAGCG	ENSP00000266744:p.Ala40fs	46.0	0.0		40.0	18.0	NM_004316	A8K3C4|Q9BQ30	Frame_Shift_Del	DEL	ENST00000266744.3	hg19	CCDS31886.1																																																																																			.	.		0.769	ASCL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406707.1		
CCDC152	100129792	hgsc.bcm.edu	37	5	42799777	42799779	+	In_Frame_Del	DEL	AAG	AAG	-			TCGA-2Y-A9H7-01A-11D-A38X-10	TCGA-2Y-A9H7-10A-01D-A38X-10	AAG	AAG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e447e430-664c-4a56-9017-620aef1f0ffb	b2219bf0-50ab-4c4d-a22d-6b2a5c4bb365	g.chr5:42799777_42799779delAAG	ENST00000361970.5	+	9	746_748	c.659_661delAAG	c.(658-663)caagaa>caa	p.E222del	CCDC152_ENST00000388827.4_In_Frame_Del_p.E166del|SEPP1_ENST00000509276.1_5'Flank	NM_001134848.1	NP_001128320.1	Q4G0S7	CC152_HUMAN	coiled-coil domain containing 152	222										endometrium(1)	1						CAGCATTTTCAAGAAGAAAAAAA	0.325																																					p.220_220del		Atlas-Indel,Pindel	.											.	CCDC152	10	.	0			c.658_660del						.																																			SO:0001651	inframe_deletion	100129792	exon9			.		CCDS47203.1	5p12	2008-07-14			ENSG00000198865	ENSG00000198865			34438	protein-coding gene	gene with protein product							Standard	NM_001134848		Approved	LOC100129792	uc003jmx.3	Q4G0S7	OTTHUMG00000162141	ENST00000361970.5:c.659_661delAAG	chr5.hg19:g.42799780_42799782delAAG	ENSP00000354888:p.Glu222del	146.0	0.0		193.0	72.0	NM_001134848	B3KXI4|B4E0P7|Q5BLP6	In_Frame_Del	DEL	ENST00000361970.5	hg19	CCDS47203.1																																																																																			.	.		0.325	CCDC152-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367497.1	XM_001717416	
IRF7	3665	hgsc.bcm.edu	37	11	613275	613275	+	Frame_Shift_Del	DEL	A	A	-			TCGA-2Y-A9H7-01A-11D-A38X-10	TCGA-2Y-A9H7-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e447e430-664c-4a56-9017-620aef1f0ffb	b2219bf0-50ab-4c4d-a22d-6b2a5c4bb365	g.chr11:613275delA	ENST00000397574.2	-	9	1537	c.1168delT	c.(1168-1170)tccfs	p.S390fs	IRF7_ENST00000525445.1_Frame_Shift_Del_p.S284fs|IRF7_ENST00000397562.3_Frame_Shift_Del_p.S97fs|IRF7_ENST00000397570.1_Frame_Shift_Del_p.S361fs|IRF7_ENST00000330243.5_Frame_Shift_Del_p.S403fs|IRF7_ENST00000397566.1_Frame_Shift_Del_p.S403fs|IRF7_ENST00000348655.6_Frame_Shift_Del_p.S361fs	NM_001572.3	NP_001563.2	Q92985	IRF7_HUMAN	interferon regulatory factor 7	390					cellular response to DNA damage stimulus (GO:0006974)|cytokine-mediated signaling pathway (GO:0019221)|establishment of viral latency (GO:0019043)|immunoglobulin mediated immune response (GO:0016064)|innate immune response (GO:0045087)|interferon-alpha production (GO:0032607)|interferon-beta production (GO:0032608)|interferon-gamma-mediated signaling pathway (GO:0060333)|MDA-5 signaling pathway (GO:0039530)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of macrophage apoptotic process (GO:2000110)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|positive regulation of type I interferon-mediated signaling pathway (GO:0060340)|regulation of adaptive immune response (GO:0002819)|regulation of immune response (GO:0050776)|regulation of monocyte differentiation (GO:0045655)|regulation of MyD88-dependent toll-like receptor signaling pathway (GO:0034124)|regulation of MyD88-independent toll-like receptor signaling pathway (GO:0034127)|regulation of type I interferon production (GO:0032479)|response to virus (GO:0009615)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|transcription from RNA polymerase II promoter (GO:0006366)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|type I interferon biosynthetic process (GO:0045351)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome membrane (GO:0010008)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity (GO:0000982)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)			endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	8		all_cancers(49;1.69e-08)|all_epithelial(84;1.65e-05)|Breast(177;0.000231)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.106)|all_lung(207;0.136)		all cancers(45;7.68e-28)|Epithelial(43;7.44e-27)|OV - Ovarian serous cystadenocarcinoma(40;3.53e-21)|BRCA - Breast invasive adenocarcinoma(625;6.96e-05)|Lung(200;0.0375)|LUSC - Lung squamous cell carcinoma(625;0.0703)		GCTGGGGTGGAGGGGCTGGCG	0.667																																					p.S403fs		Atlas-Indel,Pindel	.											.	IRF7	23	.	0			c.1208delC						.						13.0	19.0	17.0					11																	613275		2181	4291	6472	SO:0001589	frameshift_variant	3665	exon7			.	U53830	CCDS7703.1, CCDS7704.1, CCDS7705.1	11p15.5	2005-10-10			ENSG00000185507	ENSG00000185507			6122	protein-coding gene	gene with protein product		605047					Standard	XM_005252906		Approved		uc001lqh.3	Q92985	OTTHUMG00000132019	ENST00000397574.2:c.1168delT	chr11.hg19:g.613275delA	ENSP00000380704:p.Ser390fs	95.0	0.0		97.0	31.0	NM_004031	B9EGL3|O00331|O00332|O00333|O75924|Q9UE79	Frame_Shift_Del	DEL	ENST00000397574.2	hg19	CCDS7703.1																																																																																			.	.		0.667	IRF7-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000255026.1	NM_001572	
