#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
EPHA8	2046	hgsc.bcm.edu	37	1	22902961	22902961	+	Silent	SNP	A	A	T			TCGA-2Y-A9H9-01A-21D-A38X-10	TCGA-2Y-A9H9-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5586a43-bdc1-4030-93f8-cfb7bfa6a4b1	5ab2f233-e5fe-41df-9cef-56c0fdd900d3	g.chr1:22902961A>T	ENST00000166244.3	+	3	483	c.411A>T	c.(409-411)acA>acT	p.T137T	EPHA8_ENST00000538803.1_Silent_p.T137T|EPHA8_ENST00000374644.4_Silent_p.T137T	NM_020526.3	NP_065387.1	P29322	EPHA8_HUMAN	EPH receptor A8	137	Eph LBD. {ECO:0000255|PROSITE- ProRule:PRU00883}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|ephrin receptor signaling pathway (GO:0048013)|neuron projection development (GO:0031175)|neuron remodeling (GO:0016322)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|protein autophosphorylation (GO:0046777)|regulation of cell adhesion (GO:0030155)|regulation of cell adhesion mediated by integrin (GO:0033628)|substrate-dependent cell migration (GO:0006929)	endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)	ATP binding (GO:0005524)|GPI-linked ephrin receptor activity (GO:0005004)			breast(3)|central_nervous_system(5)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(9)|large_intestine(6)|lung(22)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	61		Colorectal(325;3.46e-05)|Lung NSC(340;6.55e-05)|all_lung(284;9.87e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0227)|OV - Ovarian serous cystadenocarcinoma(117;7.29e-27)|Colorectal(126;1.61e-07)|COAD - Colon adenocarcinoma(152;1.14e-05)|GBM - Glioblastoma multiforme(114;1.74e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000554)|KIRC - Kidney renal clear cell carcinoma(1967;0.00272)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.199)		GGGCCAGCACACAAGAAAGCC	0.612																																					p.T137T		Atlas-SNP	.											.	EPHA8	221	.	0			c.A411T						.						79.0	70.0	73.0					1																	22902961		2203	4300	6503	SO:0001819	synonymous_variant	2046	exon3			CAGCACACAAGAA	BC038796	CCDS225.1, CCDS30626.1	1p36.12	2013-02-11	2004-10-28		ENSG00000070886	ENSG00000070886	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3391	protein-coding gene	gene with protein product		176945	"""EphA8"""	EEK		1648701	Standard	NM_001006943		Approved	Hek3	uc001bfx.1	P29322	OTTHUMG00000002892	ENST00000166244.3:c.411A>T	chr1.hg19:g.22902961A>T		212.0	0.0		219.0	98.0	NM_020526	Q6IN80|Q8IUX6|Q9NUA9|Q9P269	Silent	SNP	ENST00000166244.3	hg19	CCDS225.1																																																																																			.	.		0.612	EPHA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008085.1	NM_020526	
RNPC3	55599	hgsc.bcm.edu	37	1	104068797	104068797	+	Silent	SNP	G	G	T			TCGA-2Y-A9H9-01A-21D-A38X-10	TCGA-2Y-A9H9-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5586a43-bdc1-4030-93f8-cfb7bfa6a4b1	5ab2f233-e5fe-41df-9cef-56c0fdd900d3	g.chr1:104068797G>T	ENST00000533099.1	+	2	341	c.105G>T	c.(103-105)ccG>ccT	p.P35P	RP11-153F1.1_ENST00000444810.1_RNA|RP11-153F1.1_ENST00000447322.2_RNA|RNPC3_ENST00000524631.1_Silent_p.P35P|RNPC3_ENST00000423855.2_Silent_p.P35P|RN7SKP285_ENST00000410137.1_RNA			Q96LT9	RBM40_HUMAN	RNA-binding region (RNP1, RRM) containing 3	35	Necessary for interaction with PDCD7.|RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.				mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)|U12-type spliceosomal complex (GO:0005689)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|skin(1)	4		all_epithelial(167;3.05e-05)|all_lung(203;0.000199)|Lung NSC(277;0.000451)		Lung(183;0.111)|Epithelial(280;0.122)|all cancers(265;0.125)|Colorectal(144;0.163)		GGCACCTGCCGGCTGAGCTTA	0.632																																					p.P35P		Atlas-SNP	.											.	RNPC3	20	.	0			c.G105T						.						43.0	41.0	42.0					1																	104068797		692	1591	2283	SO:0001819	synonymous_variant	55599	exon1			CCTGCCGGCTGAG	AB058742, AY099329	CCDS781.1	1p21.1	2013-07-16			ENSG00000185946	ENSG00000185946		"""RNA binding motif (RRM) containing"""	18666	protein-coding gene	gene with protein product	"""U11/U12 snRNP 65K"""					14974681, 15146077	Standard	NM_017619		Approved	KIAA1839, FLJ20008, RBM40, SNRNP65	uc010oun.2	Q96LT9	OTTHUMG00000166613	ENST00000533099.1:c.105G>T	chr1.hg19:g.104068797G>T		170.0	0.0		144.0	64.0	NM_017619	A8K1C9|D3DT74|Q5TZ87|Q96FK7|Q96JI8|Q9NSU7|Q9NXX2	Silent	SNP	ENST00000533099.1	hg19	CCDS781.1																																																																																			.	.		0.632	RNPC3-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000390812.1	NM_017619	
CERS2	29956	hgsc.bcm.edu	37	1	150941409	150941409	+	Missense_Mutation	SNP	C	C	T			TCGA-2Y-A9H9-01A-21D-A38X-10	TCGA-2Y-A9H9-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5586a43-bdc1-4030-93f8-cfb7bfa6a4b1	5ab2f233-e5fe-41df-9cef-56c0fdd900d3	g.chr1:150941409C>T	ENST00000271688.6	-	2	544	c.158G>A	c.(157-159)cGa>cAa	p.R53Q	CERS2_ENST00000345896.4_Intron|RP11-316M1.12_ENST00000560481.1_RNA|RP11-316M1.12_ENST00000561111.1_RNA|CERS2_ENST00000561294.1_Missense_Mutation_p.R53Q|CERS2_ENST00000368954.5_Missense_Mutation_p.R53Q	NM_181746.3	NP_859530.1	Q96G23	CERS2_HUMAN	ceramide synthase 2	53					ceramide biosynthetic process (GO:0046513)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nuclear membrane (GO:0031965)	DNA binding (GO:0003677)|sphingosine N-acyltransferase activity (GO:0050291)										AAAGAAGTATCGAACGATGAG	0.502																																					p.R53Q		Atlas-SNP	.											LASS2,colon,carcinoma,0,1	.	.	.	0			c.G158A						.						148.0	121.0	130.0					1																	150941409		2203	4300	6503	SO:0001583	missense	29956	exon2			AAGTATCGAACGA	AF189062	CCDS973.1	1q21.3	2012-09-20	2011-07-08	2011-07-08	ENSG00000143418	ENSG00000143418		"""Homeoboxes / CERS class"""	14076	protein-coding gene	gene with protein product		606920	"""longevity assurance (LAG1, S. cerevisiae) homolog 2"", ""LAG1 longevity assurance homolog 2 (S. cerevisiae)"", ""LAG1 homolog, ceramide synthase 2"""	LASS2		11543633	Standard	NM_181746		Approved	SP260, FLJ10243	uc001evz.3	Q96G23	OTTHUMG00000035064	ENST00000271688.6:c.158G>A	chr1.hg19:g.150941409C>T	ENSP00000271688:p.Arg53Gln	88.0	0.0		170.0	39.0	NM_022075	D3DV06|Q5SZE5|Q9HD96|Q9NW79	Missense_Mutation	SNP	ENST00000271688.6	hg19	CCDS973.1	.	.	.	.	.	.	.	.	.	.	C	32	5.132742	0.94517	.	.	ENSG00000143418	ENST00000368954;ENST00000271688;ENST00000368949;ENST00000361419;ENST00000421609;ENST00000457392	T;T;T;T;T;T	0.75260	-0.92;-0.92;-0.92;-0.92;-0.92;-0.92	4.82	4.82	0.62117	.	0.000000	0.85682	D	0.000000	D	0.88433	0.6435	M	0.93241	3.395	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.91206	0.4995	10	0.87932	D	0	-5.1005	16.6517	0.85218	0.0:1.0:0.0:0.0	.	53	Q96G23	CERS2_HUMAN	Q	53;53;73;53;53;53	ENSP00000357950:R53Q;ENSP00000271688:R53Q;ENSP00000357945:R73Q;ENSP00000355020:R53Q;ENSP00000393239:R53Q;ENSP00000394012:R53Q	ENSP00000271688:R53Q	R	-	2	0	CERS2	149208033	1.000000	0.71417	0.999000	0.59377	0.960000	0.62799	7.005000	0.76323	2.496000	0.84212	0.650000	0.86243	CGA	.	.		0.502	CERS2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084897.2	NM_022075	
FLG	2312	hgsc.bcm.edu	37	1	152280892	152280892	+	Missense_Mutation	SNP	G	G	A			TCGA-2Y-A9H9-01A-21D-A38X-10	TCGA-2Y-A9H9-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5586a43-bdc1-4030-93f8-cfb7bfa6a4b1	5ab2f233-e5fe-41df-9cef-56c0fdd900d3	g.chr1:152280892G>A	ENST00000368799.1	-	3	6505	c.6470C>T	c.(6469-6471)tCg>tTg	p.S2157L	FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000420707.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	2157	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CCTATCTACCGATTGCTCTTG	0.597									Ichthyosis																												p.S2157L		Atlas-SNP	.											FLG,NS,carcinoma,+1,2	FLG	900	.	0			c.C6470T						.						386.0	328.0	348.0					1																	152280892		2203	4300	6503	SO:0001583	missense	2312	exon3	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	TCTACCGATTGCT	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.6470C>T	chr1.hg19:g.152280892G>A	ENSP00000357789:p.Ser2157Leu	139.0	0.0		209.0	76.0	NM_002016	Q01720|Q5T583|Q9UC71	Missense_Mutation	SNP	ENST00000368799.1	hg19	CCDS30860.1	.	.	.	.	.	.	.	.	.	.	g	5.683	0.310525	0.10733	.	.	ENSG00000143631	ENST00000368799	T	0.03745	3.82	2.59	-1.71	0.08133	.	.	.	.	.	T	0.01061	0.0035	L	0.55103	1.725	0.09310	N	1	B	0.11235	0.004	B	0.06405	0.002	T	0.45483	-0.9258	9	0.26408	T	0.33	.	4.0063	0.09603	0.1329:0.0:0.3602:0.5069	.	2157	P20930	FILA_HUMAN	L	2157	ENSP00000357789:S2157L	ENSP00000357789:S2157L	S	-	2	0	FLG	150547516	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	0.268000	0.18571	-0.390000	0.07774	-0.663000	0.03849	TCG	.	.		0.597	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033742.1	NM_002016	
OR6N2	81442	hgsc.bcm.edu	37	1	158746473	158746473	+	Splice_Site	SNP	C	C	G			TCGA-2Y-A9H9-01A-21D-A38X-10	TCGA-2Y-A9H9-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5586a43-bdc1-4030-93f8-cfb7bfa6a4b1	5ab2f233-e5fe-41df-9cef-56c0fdd900d3	g.chr1:158746473C>G	ENST00000339258.1	-	1	952	c.953G>C	c.(952-954)tGa>tCa	p.*318S		NM_001005278.1	NP_001005278.1	Q8NGY6	OR6N2_HUMAN	olfactory receptor, family 6, subfamily N, member 2	0						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(3)|large_intestine(6)|lung(10)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	24	all_hematologic(112;0.0378)					GGAAGAAAGTCAAAGATGAGC	0.378																																					p.X318S		Atlas-SNP	.											.	OR6N2	78	.	0			c.G953C						.						128.0	124.0	125.0					1																	158746473		2203	4300	6503	SO:0001630	splice_region_variant	81442	exon1			GAAAGTCAAAGAT	BK004200	CCDS30906.1	1q23.1	2012-08-09			ENSG00000188340	ENSG00000188340		"""GPCR / Class A : Olfactory receptors"""	15035	protein-coding gene	gene with protein product							Standard	NM_001005278		Approved		uc010pir.2	Q8NGY6	OTTHUMG00000022775	ENST00000339258.1:c.951+1G>C	chr1.hg19:g.158746473C>G		35.0	0.0		87.0	29.0	NM_001005278	Q6IFR2	Missense_Mutation	SNP	ENST00000339258.1	hg19	CCDS30906.1	.	.	.	.	.	.	.	.	.	.	C	12.76	2.033822	0.35893	.	.	ENSG00000188340	ENST00000339258	.	.	.	4.24	2.12	0.27331	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	8.0105	0.30351	0.0:0.769:0.0:0.231	.	.	.	.	S	318	.	.	X	-	2	2	OR6N2	157013097	0.000000	0.05858	0.111000	0.21465	0.212000	0.24457	-0.052000	0.11865	0.955000	0.37878	0.650000	0.86243	TGA	.	.		0.378	OR6N2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059068.1		Nonstop_Mutation
HHIPL2	79802	hgsc.bcm.edu	37	1	222716922	222716922	+	Missense_Mutation	SNP	C	C	T			TCGA-2Y-A9H9-01A-21D-A38X-10	TCGA-2Y-A9H9-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5586a43-bdc1-4030-93f8-cfb7bfa6a4b1	5ab2f233-e5fe-41df-9cef-56c0fdd900d3	g.chr1:222716922C>T	ENST00000343410.6	-	2	989	c.931G>A	c.(931-933)Gtt>Att	p.V311I		NM_024746.3	NP_079022.2	Q6UWX4	HIPL2_HUMAN	HHIP-like 2	311					carbohydrate metabolic process (GO:0005975)	extracellular region (GO:0005576)	oxidoreductase activity, acting on the CH-OH group of donors, quinone or similar compound as acceptor (GO:0016901)|quinone binding (GO:0048038)			NS(2)|endometrium(8)|kidney(4)|large_intestine(7)|lung(28)|ovary(1)|prostate(3)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	59				GBM - Glioblastoma multiforme(131;0.0185)		GCCCGAGAAACCTTCATCTCA	0.443																																					p.V311I		Atlas-SNP	.											.	HHIPL2	122	.	0			c.G931A						.						281.0	308.0	299.0					1																	222716922		2203	4300	6503	SO:0001583	missense	79802	exon2			GAGAAACCTTCAT	BC007638	CCDS1530.2	1q41	2008-02-05	2008-01-16	2008-01-16	ENSG00000143512	ENSG00000143512			25842	protein-coding gene	gene with protein product			"""KIAA1822-like"""	KIAA1822L		12975309	Standard	NM_024746		Approved	FLJ13840	uc001hnh.1	Q6UWX4	OTTHUMG00000037545	ENST00000343410.6:c.931G>A	chr1.hg19:g.222716922C>T	ENSP00000342118:p.Val311Ile	110.0	0.0		100.0	44.0	NM_024746	Q6GU65|Q96BT4|Q96BU5|Q9H8A0	Missense_Mutation	SNP	ENST00000343410.6	hg19	CCDS1530.2	.	.	.	.	.	.	.	.	.	.	C	19.48	3.835620	0.71373	.	.	ENSG00000143512	ENST00000343410	T	0.10960	2.82	5.57	4.66	0.58398	Soluble quinoprotein glucose/sorbosone dehydrogenase (1);Six-bladed beta-propeller, TolB-like (1);	0.121221	0.53938	D	0.000050	T	0.21550	0.0519	L	0.55103	1.725	0.45580	D	0.998527	P	0.39551	0.678	P	0.49387	0.609	T	0.00770	-1.1573	10	0.41790	T	0.15	-11.6888	16.3171	0.82932	0.0:0.8676:0.1324:0.0	.	311	Q6UWX4	HIPL2_HUMAN	I	311	ENSP00000342118:V311I	ENSP00000342118:V311I	V	-	1	0	HHIPL2	220783545	0.967000	0.33354	0.998000	0.56505	0.991000	0.79684	2.349000	0.44054	1.325000	0.45301	0.591000	0.81541	GTT	.	.		0.443	HHIPL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091499.2	NM_024746	
HADHB	3032	hgsc.bcm.edu	37	2	26501661	26501661	+	Missense_Mutation	SNP	G	G	T			TCGA-2Y-A9H9-01A-21D-A38X-10	TCGA-2Y-A9H9-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5586a43-bdc1-4030-93f8-cfb7bfa6a4b1	5ab2f233-e5fe-41df-9cef-56c0fdd900d3	g.chr2:26501661G>T	ENST00000317799.5	+	8	726	c.622G>T	c.(622-624)Gca>Tca	p.A208S	HADHB_ENST00000405867.3_Intron|HADHB_ENST00000545822.1_Missense_Mutation_p.A186S|HADHB_ENST00000494615.1_3'UTR|HADHB_ENST00000537713.1_Missense_Mutation_p.A193S	NM_000183.2	NP_000174.1	P55084	ECHB_HUMAN	hydroxyacyl-CoA dehydrogenase/3-ketoacyl-CoA thiolase/enoyl-CoA hydratase (trifunctional protein), beta subunit	208					cardiolipin acyl-chain remodeling (GO:0035965)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|glycerophospholipid biosynthetic process (GO:0046474)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|mitochondrial envelope (GO:0005740)|mitochondrial fatty acid beta-oxidation multienzyme complex (GO:0016507)|mitochondrial inner membrane (GO:0005743)|mitochondrial nucleoid (GO:0042645)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	3-hydroxyacyl-CoA dehydrogenase activity (GO:0003857)|acetyl-CoA C-acyltransferase activity (GO:0003988)|enoyl-CoA hydratase activity (GO:0004300)|fatty-acyl-CoA binding (GO:0000062)|long-chain-3-hydroxyacyl-CoA dehydrogenase activity (GO:0016509)|long-chain-enoyl-CoA hydratase activity (GO:0016508)|NAD binding (GO:0051287)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(7)|ovary(1)|prostate(1)|skin(1)	19	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TAATTTCCTAGCACCTGAGGT	0.423																																					p.A208S		Atlas-SNP	.											.	HADHB	50	.	0			c.G622T						.						123.0	123.0	123.0					2																	26501661		2203	4300	6503	SO:0001583	missense	3032	exon8			TTCCTAGCACCTG		CCDS1722.1, CCDS62871.1, CCDS62872.1	2p23	2010-04-30	2010-04-30		ENSG00000138029	ENSG00000138029	2.3.1.16		4803	protein-coding gene	gene with protein product	"""mitochondrial trifunctional protein, beta subunit"""	143450	"""hydroxyacyl-Coenzyme A dehydrogenase/3-ketoacyl-Coenzyme A thiolase/enoyl-Coenzyme A hydratase (trifunctional protein), beta subunit"""			9605857	Standard	NM_000183		Approved	MTPB	uc002rgz.3	P55084	OTTHUMG00000096978	ENST00000317799.5:c.622G>T	chr2.hg19:g.26501661G>T	ENSP00000325136:p.Ala208Ser	94.0	0.0		108.0	55.0	NM_000183	B2RB16|B4E2W0|O14969|Q53TA6|Q96C77|Q9H3F5|Q9T2V8	Missense_Mutation	SNP	ENST00000317799.5	hg19	CCDS1722.1	.	.	.	.	.	.	.	.	.	.	G	10.30	1.312602	0.23908	.	.	ENSG00000138029	ENST00000317799;ENST00000537713;ENST00000545822	D;D;D	0.93189	-3.17;-3.18;-3.16	5.58	-8.39	0.00969	Thiolase, N-terminal (1);Thiolase-like (1);	0.497156	0.22113	N	0.064455	T	0.79747	0.4499	N	0.12831	0.26	0.09310	N	0.999996	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.15052	0.004;0.012;0.007	T	0.68292	-0.5447	9	.	.	.	-0.0618	9.8181	0.40865	0.34:0.0:0.5287:0.1314	.	193;186;208	F5GZQ3;B4E2W0;P55084	.;.;ECHB_HUMAN	S	208;193;186	ENSP00000325136:A208S;ENSP00000444295:A193S;ENSP00000442665:A186S	.	A	+	1	0	HADHB	26355165	0.327000	0.24678	0.004000	0.12327	0.965000	0.64279	0.647000	0.24812	-0.852000	0.04141	-0.271000	0.10264	GCA	.	.		0.423	HADHB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214050.2	NM_000183	
SLC8A1	6546	hgsc.bcm.edu	37	2	40655983	40655983	+	Missense_Mutation	SNP	T	T	A			TCGA-2Y-A9H9-01A-21D-A38X-10	TCGA-2Y-A9H9-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5586a43-bdc1-4030-93f8-cfb7bfa6a4b1	5ab2f233-e5fe-41df-9cef-56c0fdd900d3	g.chr2:40655983T>A	ENST00000403092.1	-	2	1471	c.1438A>T	c.(1438-1440)Ata>Tta	p.I480L	SLC8A1_ENST00000542756.1_Missense_Mutation_p.I480L|SLC8A1_ENST00000406391.2_Missense_Mutation_p.I480L|SLC8A1_ENST00000402441.1_Missense_Mutation_p.I480L|SLC8A1_ENST00000542024.1_Missense_Mutation_p.I480L|SLC8A1_ENST00000332839.4_Missense_Mutation_p.I480L|SLC8A1_ENST00000408028.2_Missense_Mutation_p.I480L|SLC8A1_ENST00000405269.1_Missense_Mutation_p.I480L|SLC8A1_ENST00000405901.3_Missense_Mutation_p.I480L|SLC8A1_ENST00000406785.2_Missense_Mutation_p.I480L			P32418	NAC1_HUMAN	solute carrier family 8 (sodium/calcium exchanger), member 1	480	Calx-beta 1.				blood coagulation (GO:0007596)|calcium ion export (GO:1901660)|calcium ion homeostasis (GO:0055074)|calcium ion import (GO:0070509)|calcium ion transport into cytosol (GO:0060402)|cardiac muscle cell development (GO:0055013)|cardiac muscle contraction (GO:0060048)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular response to caffeine (GO:0071313)|cellular response to reactive oxygen species (GO:0034614)|cellular sodium ion homeostasis (GO:0006883)|cytosolic calcium ion transport (GO:0060401)|embryonic heart tube development (GO:0035050)|embryonic placenta development (GO:0001892)|heart morphogenesis (GO:0003007)|ion transport (GO:0006811)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|muscle contraction (GO:0006936)|muscle fiber development (GO:0048747)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|post-embryonic development (GO:0009791)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of the force of heart contraction (GO:0002026)|relaxation of cardiac muscle (GO:0055119)|relaxation of smooth muscle (GO:0044557)|sodium ion export (GO:0071436)|sodium ion import (GO:0097369)|transmembrane transport (GO:0055085)|vascular smooth muscle contraction (GO:0014829)	basolateral plasma membrane (GO:0016323)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|calcium:sodium antiporter activity (GO:0005432)|cytoskeletal protein binding (GO:0008092)|ion channel binding (GO:0044325)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(1)|endometrium(7)|kidney(5)|large_intestine(14)|liver(1)|lung(57)|ovary(2)|pancreas(1)|skin(7)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(2)	100					Alpha-Linolenic Acid(DB00132)|Icosapent(DB00159)	TCATCATCTATGATACCCACT	0.418																																					p.I480L		Atlas-SNP	.											.	SLC8A1	221	.	0			c.A1438T						.						75.0	70.0	72.0					2																	40655983		2203	4300	6503	SO:0001583	missense	6546	exon1			CATCTATGATACC		CCDS1806.1, CCDS46264.1, CCDS46265.1, CCDS59430.1	2p22.1	2013-07-15			ENSG00000183023	ENSG00000183023		"""Solute carriers"""	11068	protein-coding gene	gene with protein product	"""Na+/Ca++ exchanger"""	182305		NCX1		1559714	Standard	NM_021097		Approved		uc002rrx.3	P32418	OTTHUMG00000102183	ENST00000403092.1:c.1438A>T	chr2.hg19:g.40655983T>A	ENSP00000384763:p.Ile480Leu	67.0	0.0		83.0	31.0	NM_001252624	A8K6N1|D6W595|O95849|Q4QQG6|Q587I6|Q59GN4|Q9UBL8|Q9UD55|Q9UDN1|Q9UDN2|Q9UKX6	Missense_Mutation	SNP	ENST00000403092.1	hg19	CCDS1806.1	.	.	.	.	.	.	.	.	.	.	T	16.26	3.073855	0.55646	.	.	ENSG00000183023	ENST00000406785;ENST00000378715;ENST00000542756;ENST00000403092;ENST00000405901;ENST00000402441;ENST00000405269;ENST00000332839;ENST00000408028;ENST00000535962;ENST00000406391;ENST00000542024	T;T;T;T;T;T;T;T;T;T	0.29917	1.55;1.55;1.55;1.55;1.55;1.55;1.55;1.55;1.55;1.55	6.17	6.17	0.99709	Na-Ca exchanger/integrin-beta4 (2);	0.000000	0.85682	D	0.000000	T	0.42720	0.1215	L	0.46567	1.45	0.80722	D	1	P;B;P;B;P	0.42357	0.736;0.075;0.736;0.055;0.777	P;B;P;B;P	0.51833	0.552;0.33;0.552;0.091;0.681	T	0.27673	-1.0067	10	0.87932	D	0	.	14.7743	0.69713	0.0:0.0:0.0:1.0	.	480;480;480;480;480	P32418-4;P32418-2;P32418-3;F6VPY9;P32418	.;.;.;.;NAC1_HUMAN	L	480	ENSP00000383886:I480L;ENSP00000440727:I480L;ENSP00000384763:I480L;ENSP00000385678:I480L;ENSP00000385188:I480L;ENSP00000385535:I480L;ENSP00000332931:I480L;ENSP00000384908:I480L;ENSP00000385811:I480L;ENSP00000443515:I480L	ENSP00000332931:I480L	I	-	1	0	SLC8A1	40509487	1.000000	0.71417	0.996000	0.52242	0.696000	0.40369	7.881000	0.87252	2.371000	0.80710	0.533000	0.62120	ATA	.	.		0.418	SLC8A1-010	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326065.1	NM_021097	
MSH6	2956	hgsc.bcm.edu	37	2	48018238	48018238	+	Nonsense_Mutation	SNP	A	A	T			TCGA-2Y-A9H9-01A-21D-A38X-10	TCGA-2Y-A9H9-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5586a43-bdc1-4030-93f8-cfb7bfa6a4b1	5ab2f233-e5fe-41df-9cef-56c0fdd900d3	g.chr2:48018238A>T	ENST00000234420.5	+	2	585	c.433A>T	c.(433-435)Aaa>Taa	p.K145*	MSH6_ENST00000540021.1_Intron|MSH6_ENST00000538136.1_5'UTR|FBXO11_ENST00000405808.1_Intron	NM_000179.2	NP_000170.1	P52701	MSH6_HUMAN	mutS homolog 6	145	PWWP. {ECO:0000255|PROSITE- ProRule:PRU00162}.				ATP catabolic process (GO:0006200)|determination of adult lifespan (GO:0008340)|DNA repair (GO:0006281)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|isotype switching (GO:0045190)|meiotic mismatch repair (GO:0000710)|mismatch repair (GO:0006298)|negative regulation of DNA recombination (GO:0045910)|positive regulation of helicase activity (GO:0051096)|reciprocal meiotic recombination (GO:0007131)|response to UV (GO:0009411)|somatic hypermutation of immunoglobulin genes (GO:0016446)|somatic recombination of immunoglobulin gene segments (GO:0016447)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|MutSalpha complex (GO:0032301)|nuclear chromatin (GO:0000790)|nuclear chromosome (GO:0000228)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|damaged DNA binding (GO:0003684)|DNA-dependent ATPase activity (GO:0008094)|guanine/thymine mispair binding (GO:0032137)|methylated histone binding (GO:0035064)|mismatched DNA binding (GO:0030983)	p.0?(2)		breast(8)|central_nervous_system(29)|cervix(1)|endometrium(32)|haematopoietic_and_lymphoid_tissue(12)|kidney(2)|large_intestine(75)|lung(25)|ovary(3)|prostate(3)|skin(10)|stomach(22)|thyroid(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	229		Acute lymphoblastic leukemia(82;0.0299)|all_hematologic(82;0.0358)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)			CTGGGTTAGCAAAAGGCTTTT	0.463			"""Mis, N, F, S"""		colorectal	"""colorectal, endometrial, ovarian"""		Mismatch excision repair (MMR)	Turcot syndrome;Muir-Torre syndrome;Lynch syndrome;Constitutional Mismatch Repair Deficiency Syndrome																												p.K145X		Atlas-SNP	.	yes	Rec	yes	Hereditary non-polyposis colorectal cancer	2	2p16	2956	mutS homolog 6 (E. coli)		E	.	MSH6	341	.	2	Whole gene deletion(2)	haematopoietic_and_lymphoid_tissue(2)	c.A433T						.						79.0	82.0	81.0					2																	48018238		2203	4300	6503	SO:0001587	stop_gained	2956	exon2	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome; ;Hereditary Non-Polyposis Colorectal Cancer, HNPCC, Lynch syndromes 1 and 2 (= Cancer Family Syndrome), Hereditary Mismatch Repair Deficiency syndrome, HMRDS;Mismatch Repair Cancer syndrome, MMRCS, Childhood Cancer Syndrome, CCS, Biallelic Mismatch Repair Gene Mutations Associated Early Onset Cancer, Lynch syndrome type III	GTTAGCAAAAGGC	U54777	CCDS1836.1, CCDS62906.1, CCDS62907.1	2p16	2014-09-17	2013-09-12		ENSG00000116062	ENSG00000116062			7329	protein-coding gene	gene with protein product		600678	"""mutS (E. coli) homolog 6"", ""mutS homolog 6 (E. coli)"""	GTBP		7604266	Standard	NM_000179		Approved		uc002rwd.4	P52701	OTTHUMG00000129129	ENST00000234420.5:c.433A>T	chr2.hg19:g.48018238A>T	ENSP00000234420:p.Lys145*	152.0	0.0		166.0	71.0	NM_000179	B4DF41|B4E3I4|F5H2F9|O43706|O43917|Q8TCX4|Q9BTB5	Nonsense_Mutation	SNP	ENST00000234420.5	hg19	CCDS1836.1	.	.	.	.	.	.	.	.	.	.	A	27.6	4.844280	0.91197	.	.	ENSG00000116062	ENST00000234420;ENST00000544857;ENST00000446255;ENST00000455383;ENST00000420813;ENST00000411819	.	.	.	5.63	5.63	0.86233	.	0.284105	0.38548	N	0.001652	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-13.8151	5.7735	0.18267	0.712:0.1462:0.1418:0.0	.	.	.	.	X	145;143;145;46;46;46	.	ENSP00000234420:K145X	K	+	1	0	MSH6	47871742	1.000000	0.71417	1.000000	0.80357	0.901000	0.52897	2.171000	0.42453	2.128000	0.65567	0.455000	0.32223	AAA	.	.		0.463	MSH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251180.4	NM_000179	
PDCL3	79031	hgsc.bcm.edu	37	2	101186107	101186107	+	Missense_Mutation	SNP	T	T	A			TCGA-2Y-A9H9-01A-21D-A38X-10	TCGA-2Y-A9H9-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5586a43-bdc1-4030-93f8-cfb7bfa6a4b1	5ab2f233-e5fe-41df-9cef-56c0fdd900d3	g.chr2:101186107T>A	ENST00000264254.6	+	4	670	c.292T>A	c.(292-294)Tca>Aca	p.S98T		NM_024065.4	NP_076970.1	Q9H2J4	PDCL3_HUMAN	phosducin-like 3	98	Thioredoxin fold. {ECO:0000250}.				angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|negative regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000059)|positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell proliferation (GO:0001938)|protein folding (GO:0006457)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|viral process (GO:0016032)	cytoplasm (GO:0005737)	protein binding involved in protein folding (GO:0044183)			endometrium(3)|large_intestine(2)|liver(1)|lung(6)	12						TTTGGAGATCTCAGGGAAGGA	0.458																																					p.S98T		Atlas-SNP	.											.	PDCL3	27	.	0			c.T292A						.						84.0	86.0	85.0					2																	101186107		2203	4298	6501	SO:0001583	missense	79031	exon4			GAGATCTCAGGGA	AF267853	CCDS33261.1	2q12	2008-02-05			ENSG00000115539	ENSG00000115539			28860	protein-coding gene	gene with protein product		611678					Standard	NM_024065		Approved	VIAF1	uc002tao.2	Q9H2J4	OTTHUMG00000153141	ENST00000264254.6:c.292T>A	chr2.hg19:g.101186107T>A	ENSP00000264254:p.Ser98Thr	140.0	0.0		194.0	85.0	NM_024065	B2RA00|Q53S68	Missense_Mutation	SNP	ENST00000264254.6	hg19	CCDS33261.1	.	.	.	.	.	.	.	.	.	.	.	16.15	3.040997	0.55003	.	.	ENSG00000115539	ENST00000264254;ENST00000416255	T;T	0.15952	2.38;2.38	4.59	4.59	0.56863	Phosducin, thioredoxin-like domain (1);Thioredoxin-like fold (2);	0.069308	0.64402	D	0.000012	T	0.22044	0.0531	M	0.62266	1.93	0.50632	D	0.999884	B	0.15473	0.013	B	0.28638	0.092	T	0.03354	-1.1045	10	0.30078	T	0.28	-25.0944	14.2704	0.66149	0.0:0.0:0.0:1.0	.	98	Q9H2J4	PDCL3_HUMAN	T	98;48	ENSP00000264254:S98T;ENSP00000413936:S48T	ENSP00000264254:S98T	S	+	1	0	PDCL3	100552539	1.000000	0.71417	0.999000	0.59377	0.927000	0.56198	7.680000	0.84062	1.816000	0.52996	0.454000	0.30748	TCA	.	.		0.458	PDCL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329734.1	NM_024065	
MRPS9	64965	hgsc.bcm.edu	37	2	105696507	105696507	+	Missense_Mutation	SNP	A	A	G			TCGA-2Y-A9H9-01A-21D-A38X-10	TCGA-2Y-A9H9-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5586a43-bdc1-4030-93f8-cfb7bfa6a4b1	5ab2f233-e5fe-41df-9cef-56c0fdd900d3	g.chr2:105696507A>G	ENST00000258455.3	+	5	586	c.476A>G	c.(475-477)tAt>tGt	p.Y159C		NM_182640.2	NP_872578.1	P82933	RT09_HUMAN	mitochondrial ribosomal protein S9	159					DNA damage response, detection of DNA damage (GO:0042769)|peptide biosynthetic process (GO:0043043)|translation (GO:0006412)	mitochondrial small ribosomal subunit (GO:0005763)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			breast(2)|endometrium(3)|kidney(1)|large_intestine(2)|lung(4)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	18						CAGTCATACTATTCATTAATG	0.333																																					p.Y159C		Atlas-SNP	.											.	MRPS9	32	.	0			c.A476G						.						134.0	121.0	125.0					2																	105696507		2203	4300	6503	SO:0001583	missense	64965	exon5			CATACTATTCATT		CCDS2065.1	2q12.1	2012-09-13			ENSG00000135972	ENSG00000135972		"""Mitochondrial ribosomal proteins / small subunits"""	14501	protein-coding gene	gene with protein product	"""28S ribosomal protein S9, mitochondrial"""	611975				11279123	Standard	NM_182640		Approved	RPMS9, MRP-S9, S9mt	uc002tcn.4	P82933	OTTHUMG00000130807	ENST00000258455.3:c.476A>G	chr2.hg19:g.105696507A>G	ENSP00000258455:p.Tyr159Cys	42.0	0.0		53.0	10.0	NM_182640	Q6PG40	Missense_Mutation	SNP	ENST00000258455.3	hg19	CCDS2065.1	.	.	.	.	.	.	.	.	.	.	A	19.63	3.863744	0.71949	.	.	ENSG00000135972	ENST00000258455	D	0.92199	-2.99	5.71	5.71	0.89125	.	0.000000	0.85682	D	0.000000	D	0.96367	0.8815	M	0.85462	2.755	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.96975	0.9711	10	0.87932	D	0	-16.6605	15.9892	0.80188	1.0:0.0:0.0:0.0	.	159	P82933	RT09_HUMAN	C	159	ENSP00000258455:Y159C	ENSP00000258455:Y159C	Y	+	2	0	MRPS9	105062939	1.000000	0.71417	0.634000	0.29324	0.876000	0.50452	8.165000	0.89663	2.180000	0.69256	0.533000	0.62120	TAT	.	.		0.333	MRPS9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253352.1	NM_182640	
SCN7A	6332	hgsc.bcm.edu	37	2	167262815	167262815	+	Missense_Mutation	SNP	C	C	A			TCGA-2Y-A9H9-01A-21D-A38X-10	TCGA-2Y-A9H9-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5586a43-bdc1-4030-93f8-cfb7bfa6a4b1	5ab2f233-e5fe-41df-9cef-56c0fdd900d3	g.chr2:167262815C>A	ENST00000409855.1	-	25	4450	c.4324G>T	c.(4324-4326)Gca>Tca	p.A1442S		NM_002976.3	NP_002967.2	Q01118	SCN7A_HUMAN	sodium channel, voltage-gated, type VII, alpha subunit	1442					membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|neuronal action potential (GO:0019228)|sodium ion homeostasis (GO:0055078)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	glial cell projection (GO:0097386)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(1)|lung(30)|prostate(4)|soft_tissue(1)|urinary_tract(1)	44					Valproic Acid(DB00313)	TTGAAAATTGCATCAAGCATC	0.393																																					p.A1442S		Atlas-SNP	.											.	SCN7A	410	.	0			c.G4324T						.						149.0	142.0	144.0					2																	167262815		1882	4139	6021	SO:0001583	missense	6332	exon25			AAATTGCATCAAG	M91556	CCDS46442.1	2q21-q23	2012-03-05	2012-02-28	2002-06-14	ENSG00000136546	ENSG00000136546		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10594	protein-coding gene	gene with protein product		182392	"""sodium channel, voltage-gated, type VI, alpha"", ""sodium channel, voltage-gated, type VII, alpha"""	SCN6A		10198179	Standard	NM_002976		Approved	Nav2.1, Nav2.2, NaG	uc002udu.2	Q01118	OTTHUMG00000154078	ENST00000409855.1:c.4324G>T	chr2.hg19:g.167262815C>A	ENSP00000386796:p.Ala1442Ser	202.0	0.0		389.0	162.0	NM_002976		Missense_Mutation	SNP	ENST00000409855.1	hg19	CCDS46442.1	.	.	.	.	.	.	.	.	.	.	C	16.15	3.040357	0.55003	.	.	ENSG00000136546	ENST00000409855;ENST00000259060	D	0.98455	-4.94	5.14	3.22	0.36961	Ion transport (1);	0.209915	0.33875	N	0.004474	D	0.97576	0.9206	L	0.41573	1.285	0.39571	D	0.969285	D	0.71674	0.998	D	0.67103	0.949	D	0.97456	1.0031	10	0.87932	D	0	.	8.7256	0.34467	0.0:0.7588:0.1542:0.087	.	1442	Q01118	SCN7A_HUMAN	S	1442	ENSP00000386796:A1442S	ENSP00000259060:A1442S	A	-	1	0	SCN7A	166971061	0.999000	0.42202	0.911000	0.35937	0.521000	0.34408	3.082000	0.50128	1.539000	0.49286	0.591000	0.81541	GCA	.	.		0.393	SCN7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333745.1		
TTN	7273	hgsc.bcm.edu	37	2	179424152	179424152	+	Missense_Mutation	SNP	A	A	C			TCGA-2Y-A9H9-01A-21D-A38X-10	TCGA-2Y-A9H9-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5586a43-bdc1-4030-93f8-cfb7bfa6a4b1	5ab2f233-e5fe-41df-9cef-56c0fdd900d3	g.chr2:179424152A>C	ENST00000591111.1	-	276	82008	c.81784T>G	c.(81784-81786)Tcc>Gcc	p.S27262A	TTN-AS1_ENST00000592689.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.S20030A|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.S19963A|TTN_ENST00000460472.2_Missense_Mutation_p.S19838A|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.S28903A|TTN_ENST00000342992.6_Missense_Mutation_p.S26335A|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000419746.1_RNA			Q8WZ42	TITIN_HUMAN	titin	27262	Fibronectin type-III 98. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			ACTTTGTAGGAGAGGCGGTTA	0.433																																					p.S28903A		Atlas-SNP	.											.	TTN	18412	.	0			c.T86707G						.						106.0	109.0	108.0					2																	179424152		1848	4095	5943	SO:0001583	missense	7273	exon326			TGTAGGAGAGGCG	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.81784T>G	chr2.hg19:g.179424152A>C	ENSP00000465570:p.Ser27262Ala	135.0	0.0		167.0	32.0	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	hg19		.	.	.	.	.	.	.	.	.	.	A	11.27	1.589867	0.28357	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.59638	0.25;0.25;0.25;0.25	5.31	4.07	0.47477	Fibronectin, type III (4);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.50497	0.1619	L	0.52823	1.66	0.31512	N	0.66342	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.04013	0.001;0.001;0.001;0.001	T	0.57406	-0.7817	9	0.87932	D	0	.	7.576	0.27937	0.7149:0.1455:0.0:0.1396	.	19838;19963;20030;27262	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	A	26335;19838;20030;19963;19835	ENSP00000343764:S26335A;ENSP00000434586:S19838A;ENSP00000340554:S20030A;ENSP00000352154:S19963A	ENSP00000340554:S20030A	S	-	1	0	TTN	179132398	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	4.656000	0.61483	2.129000	0.65627	0.533000	0.62120	TCC	.	.		0.433	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
DNAH7	56171	hgsc.bcm.edu	37	2	196741411	196741411	+	Missense_Mutation	SNP	T	T	C			TCGA-2Y-A9H9-01A-21D-A38X-10	TCGA-2Y-A9H9-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5586a43-bdc1-4030-93f8-cfb7bfa6a4b1	5ab2f233-e5fe-41df-9cef-56c0fdd900d3	g.chr2:196741411T>C	ENST00000312428.6	-	37	6074	c.5974A>G	c.(5974-5976)Aat>Gat	p.N1992D		NM_018897.2	NP_061720.2	Q8WXX0	DYH7_HUMAN	dynein, axonemal, heavy chain 7	1992	AAA 3. {ECO:0000250}.				cilium movement (GO:0003341)|cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)	axonemal dynein complex (GO:0005858)|cilium (GO:0005929)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|microtubule motor activity (GO:0003777)			NS(4)|breast(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(28)|liver(3)|lung(100)|ovary(4)|prostate(5)|skin(26)|upper_aerodigestive_tract(2)|urinary_tract(3)	205						TTTAGTTGATTTAAAAGAAAA	0.294																																					p.N1992D		Atlas-SNP	.											.	DNAH7	512	.	0			c.A5974G						.						77.0	68.0	71.0					2																	196741411		1792	4063	5855	SO:0001583	missense	56171	exon37			GTTGATTTAAAAG	AF327442	CCDS42794.1	2q33.1	2013-01-10	2006-09-04		ENSG00000118997	ENSG00000118997		"""Axonemal dyneins"", ""EF-hand domain containing"""	18661	protein-coding gene	gene with protein product		610061	"""dynein, axonemal, heavy polypeptide 7"""			9373155, 11877439	Standard	NM_018897		Approved	KIAA0944	uc002utj.4	Q8WXX0	OTTHUMG00000154438	ENST00000312428.6:c.5974A>G	chr2.hg19:g.196741411T>C	ENSP00000311273:p.Asn1992Asp	43.0	0.0		76.0	31.0	NM_018897	B8ZZX8|O00433|O95492|Q4G152|Q53QX7|Q53S64|Q53T02|Q68CY5|Q8N1Z2|Q9UMS3|Q9Y2F3	Missense_Mutation	SNP	ENST00000312428.6	hg19	CCDS42794.1	.	.	.	.	.	.	.	.	.	.	T	14.70	2.614965	0.46631	.	.	ENSG00000118997	ENST00000312428	T	0.39997	1.05	5.64	5.64	0.86602	ATPase, AAA+ type, core (1);	0.000000	0.85682	D	0.000000	T	0.45558	0.1348	L	0.55481	1.735	0.80722	D	1	B	0.26602	0.154	B	0.35655	0.207	T	0.34825	-0.9813	10	0.35671	T	0.21	.	15.6824	0.77381	0.0:0.0:0.0:1.0	.	1992	Q8WXX0	DYH7_HUMAN	D	1992	ENSP00000311273:N1992D	ENSP00000311273:N1992D	N	-	1	0	DNAH7	196449656	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	4.400000	0.59709	2.367000	0.80283	0.528000	0.53228	AAT	.	.		0.294	DNAH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335202.3	NM_018897	
HECW2	57520	hgsc.bcm.edu	37	2	197185161	197185161	+	Missense_Mutation	SNP	T	T	C			TCGA-2Y-A9H9-01A-21D-A38X-10	TCGA-2Y-A9H9-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5586a43-bdc1-4030-93f8-cfb7bfa6a4b1	5ab2f233-e5fe-41df-9cef-56c0fdd900d3	g.chr2:197185161T>C	ENST00000260983.3	-	8	1069	c.887A>G	c.(886-888)gAt>gGt	p.D296G	HECW2_ENST00000409111.1_Intron	NM_020760.1	NP_065811.1	Q9P2P5	HECW2_HUMAN	HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2	296					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			biliary_tract(1)|breast(3)|central_nervous_system(4)|cervix(2)|endometrium(7)|kidney(4)|large_intestine(24)|lung(45)|ovary(5)|pancreas(2)|prostate(2)|skin(10)|upper_aerodigestive_tract(2)|urinary_tract(2)	113						GAGCATTTGATCACTGCAAGA	0.502																																					p.D296G		Atlas-SNP	.											.	HECW2	239	.	0			c.A887G						.						75.0	72.0	73.0					2																	197185161		2203	4300	6503	SO:0001583	missense	57520	exon8			ATTTGATCACTGC	AL390186	CCDS33354.1	2q32.3	2004-12-13			ENSG00000138411	ENSG00000138411			29853	protein-coding gene	gene with protein product						10718198, 12890487	Standard	NM_020760		Approved	KIAA1301, NEDL2	uc002utm.1	Q9P2P5	OTTHUMG00000154435	ENST00000260983.3:c.887A>G	chr2.hg19:g.197185161T>C	ENSP00000260983:p.Asp296Gly	140.0	0.0		171.0	23.0	NM_020760	B8ZZB4|Q17RT5|Q68DF8|Q9NPS9	Missense_Mutation	SNP	ENST00000260983.3	hg19	CCDS33354.1	.	.	.	.	.	.	.	.	.	.	T	19.06	3.754737	0.69648	.	.	ENSG00000138411	ENST00000260983	T	0.36520	1.25	5.1	5.1	0.69264	C2 calcium-dependent membrane targeting (1);C2 calcium/lipid-binding domain, CaLB (1);	.	.	.	.	T	0.48466	0.1501	L	0.32530	0.975	0.54753	D	0.999981	D	0.69078	0.997	D	0.77004	0.989	T	0.50474	-0.8824	9	0.72032	D	0.01	.	13.6242	0.62155	0.0:0.0:0.0:1.0	.	296	Q9P2P5	HECW2_HUMAN	G	296	ENSP00000260983:D296G	ENSP00000260983:D296G	D	-	2	0	HECW2	196893406	1.000000	0.71417	0.531000	0.27976	0.506000	0.33950	4.625000	0.61262	2.131000	0.65755	0.459000	0.35465	GAT	.	.		0.502	HECW2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335199.3	NM_020760	
ANKRD44	91526	hgsc.bcm.edu	37	2	197878357	197878357	+	Missense_Mutation	SNP	C	C	T	rs374386037		TCGA-2Y-A9H9-01A-21D-A38X-10	TCGA-2Y-A9H9-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5586a43-bdc1-4030-93f8-cfb7bfa6a4b1	5ab2f233-e5fe-41df-9cef-56c0fdd900d3	g.chr2:197878357C>T	ENST00000328737.2	-	18	1803	c.1727G>A	c.(1726-1728)cGc>cAc	p.R576H	ANKRD44_ENST00000337207.5_Missense_Mutation_p.R576H|ANKRD44_ENST00000282272.8_Missense_Mutation_p.R593H|ANKRD44_ENST00000450567.1_Missense_Mutation_p.R576H			Q8N8A2	ANR44_HUMAN	ankyrin repeat domain 44	601										NS(1)|endometrium(3)|kidney(2)|large_intestine(9)|lung(20)|ovary(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	45			OV - Ovarian serous cystadenocarcinoma(117;0.246)			CAGAGCAGTGCGGCCTTTCTC	0.498																																					p.R601H		Atlas-SNP	.											.	ANKRD44	281	.	0			c.G1802A						.	C	HIS/ARG	0,4406		0,0,2203	226.0	215.0	219.0		1802	4.4	1.0	2		219	1,8599	1.2+/-3.3	0,1,4299	no	missense	ANKRD44	NM_001195144.1	29	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	benign	601/994	197878357	1,13005	2203	4300	6503	SO:0001583	missense	91526	exon18			GCAGTGCGGCCTT	AK097086	CCDS33355.1, CCDS33355.2, CCDS74619.1	2q33.1	2013-01-10			ENSG00000065413	ENSG00000065413		"""Serine/threonine phosphatases / Protein phosphatase 6, regulatory subunits"", ""Ankyrin repeat domain containing"""	25259	protein-coding gene	gene with protein product	"""protein phosphatase 6 ankyrin repeat subunit B"""						Standard	NM_153697		Approved	PP6-ARS-B	uc021vuj.1	Q8N8A2	OTTHUMG00000154411	ENST00000328737.2:c.1727G>A	chr2.hg19:g.197878357C>T	ENSP00000331516:p.Arg576His	113.0	0.0		135.0	63.0	NM_001195144	Q53SL9|Q6P480|Q86VL5|Q8IZ72|Q9UFA4	Missense_Mutation	SNP	ENST00000328737.2	hg19		.	.	.	.	.	.	.	.	.	.	C	19.13	3.767764	0.69878	0.0	1.16E-4	ENSG00000065413	ENST00000424317;ENST00000282272;ENST00000328737;ENST00000450567;ENST00000337207;ENST00000422886	T;T;T;T;T;T	0.66460	-0.21;-0.21;-0.21;-0.21;-0.21;-0.21	4.43	4.43	0.53597	.	0.000000	0.85682	D	0.000000	T	0.78547	0.4300	M	0.64170	1.965	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.75096	-0.3438	10	0.22109	T	0.4	.	17.2648	0.87083	0.0:1.0:0.0:0.0	.	619	Q8N8A2-2	.	H	416;593;576;576;576;276	ENSP00000403415:R416H;ENSP00000282272:R593H;ENSP00000331516:R576H;ENSP00000402420:R576H;ENSP00000338794:R576H;ENSP00000416319:R276H	ENSP00000282272:R593H	R	-	2	0	ANKRD44	197586602	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	4.795000	0.62489	2.294000	0.77228	0.655000	0.94253	CGC	.	.		0.498	ANKRD44-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000335113.1	NM_153697	
ZDBF2	57683	hgsc.bcm.edu	37	2	207171124	207171124	+	Silent	SNP	A	A	G			TCGA-2Y-A9H9-01A-21D-A38X-10	TCGA-2Y-A9H9-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5586a43-bdc1-4030-93f8-cfb7bfa6a4b1	5ab2f233-e5fe-41df-9cef-56c0fdd900d3	g.chr2:207171124A>G	ENST00000374423.3	+	5	2258	c.1872A>G	c.(1870-1872)gcA>gcG	p.A624A		NM_020923.1	NP_065974.1	Q9HCK1	ZDBF2_HUMAN	zinc finger, DBF-type containing 2	624							nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			endometrium(4)|kidney(5)|large_intestine(28)|lung(50)|ovary(4)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	95						GTGCTAAAGCACATCTTGATT	0.428																																					p.A624A		Atlas-SNP	.											.	ZDBF2	531	.	0			c.A1872G						.						126.0	116.0	120.0					2																	207171124		1900	4136	6036	SO:0001819	synonymous_variant	57683	exon5			TAAAGCACATCTT	AB046791	CCDS46501.1, CCDS74637.1	2q33.3	2013-01-10			ENSG00000204186	ENSG00000204186		"""Zinc fingers, DBF-type"""	29313	protein-coding gene	gene with protein product						10997877	Standard	XM_005246711		Approved	FLJ45338, KIAA1571	uc002vbp.2	Q9HCK1	OTTHUMG00000154648	ENST00000374423.3:c.1872A>G	chr2.hg19:g.207171124A>G		26.0	0.0		74.0	29.0	NM_020923	Q6ZNP7|Q6ZSN8	Silent	SNP	ENST00000374423.3	hg19	CCDS46501.1																																																																																			.	.		0.428	ZDBF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336458.1	NM_020923	
KCNH8	131096	hgsc.bcm.edu	37	3	19389280	19389280	+	Missense_Mutation	SNP	T	T	C			TCGA-2Y-A9H9-01A-21D-A38X-10	TCGA-2Y-A9H9-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5586a43-bdc1-4030-93f8-cfb7bfa6a4b1	5ab2f233-e5fe-41df-9cef-56c0fdd900d3	g.chr3:19389280T>C	ENST00000328405.2	+	5	900	c.634T>C	c.(634-636)Ttc>Ctc	p.F212L	KCNH8_ENST00000475063.1_3'UTR	NM_144633.2	NP_653234.2	Q96L42	KCNH8_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 8	212					potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	phosphorelay sensor kinase activity (GO:0000155)|voltage-gated potassium channel activity (GO:0005249)			NS(1)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|liver(3)|lung(37)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	77						AAAGTCCAAATTCATACTTCT	0.373																																					p.F212L	NSCLC(124;1625 1765 8018 24930 42026)	Atlas-SNP	.											.	KCNH8	189	.	0			c.T634C						.						149.0	138.0	142.0					3																	19389280		2203	4299	6502	SO:0001583	missense	131096	exon5			TCCAAATTCATAC	AY053503	CCDS2632.1	3p24.3	2012-07-05			ENSG00000183960	ENSG00000183960		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	18864	protein-coding gene	gene with protein product		608260				16382104	Standard	NM_144633		Approved	Kv12.1, elk3	uc003cbk.1	Q96L42	OTTHUMG00000129891	ENST00000328405.2:c.634T>C	chr3.hg19:g.19389280T>C	ENSP00000328813:p.Phe212Leu	72.0	0.0		126.0	52.0	NM_144633	B7Z2I7|Q59GQ6	Missense_Mutation	SNP	ENST00000328405.2	hg19	CCDS2632.1	.	.	.	.	.	.	.	.	.	.	T	24.0	4.477707	0.84640	.	.	ENSG00000183960	ENST00000328405	D	0.98901	-5.22	5.89	5.89	0.94794	.	0.000000	0.33382	U	0.004976	D	0.97964	0.9330	L	0.55743	1.74	0.80722	D	1	B;P	0.43973	0.034;0.823	B;P	0.48089	0.049;0.566	D	0.98047	1.0385	9	.	.	.	.	16.3109	0.82869	0.0:0.0:0.0:1.0	.	212;212	B7Z398;Q96L42	.;KCNH8_HUMAN	L	212	ENSP00000328813:F212L	.	F	+	1	0	KCNH8	19364284	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.251000	0.72441	2.257000	0.74773	0.460000	0.39030	TTC	.	.		0.373	KCNH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252139.2	NM_144633	
MAP4	4134	hgsc.bcm.edu	37	3	47910778	47910778	+	Nonsense_Mutation	SNP	G	G	A			TCGA-2Y-A9H9-01A-21D-A38X-10	TCGA-2Y-A9H9-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5586a43-bdc1-4030-93f8-cfb7bfa6a4b1	5ab2f233-e5fe-41df-9cef-56c0fdd900d3	g.chr3:47910778G>A	ENST00000360240.6	-	14	3417	c.2899C>T	c.(2899-2901)Cga>Tga	p.R967*	MAP4_ENST00000420772.2_Intron|MAP4_ENST00000264724.11_Nonsense_Mutation_p.R702*|MAP4_ENST00000462206.1_5'Flank|MAP4_ENST00000426837.2_Nonsense_Mutation_p.R2112*|MAP4_ENST00000441748.2_Intron|MAP4_ENST00000395734.3_Nonsense_Mutation_p.R967*|MAP4_ENST00000383737.4_Intron	NM_002375.4	NP_002366.2	P27816	MAP4_HUMAN	microtubule-associated protein 4	967					cell division (GO:0051301)|establishment of spindle orientation (GO:0051294)|microtubule sliding (GO:0051012)|mitotic spindle organization (GO:0007052)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|microtubule cytoskeleton (GO:0015630)|mitotic spindle (GO:0072686)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)|structural molecule activity (GO:0005198)			breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(10)|ovary(2)|pancreas(1)|skin(2)	32				BRCA - Breast invasive adenocarcinoma(193;0.000721)|KIRC - Kidney renal clear cell carcinoma(197;0.00641)|Kidney(197;0.00736)	Docetaxel(DB01248)|Paclitaxel(DB01229)	TCAGGCTTTCGGGTTGTAGCA	0.463																																					p.R967X		Atlas-SNP	.											.	MAP4	176	.	0			c.C2899T						.						144.0	138.0	140.0					3																	47910778		2203	4300	6503	SO:0001587	stop_gained	4134	exon14			GCTTTCGGGTTGT		CCDS33750.1, CCDS46818.1, CCDS46821.1	3p21	2008-07-18			ENSG00000047849	ENSG00000047849			6862	protein-coding gene	gene with protein product		157132				1905296	Standard	NM_002375		Approved		uc003csb.2	P27816	OTTHUMG00000156828	ENST00000360240.6:c.2899C>T	chr3.hg19:g.47910778G>A	ENSP00000353375:p.Arg967*	106.0	0.0		129.0	58.0	NM_001134364	Q13082|Q59FT2|Q68D74|Q6ZUW9|Q86V26|Q96A76|Q96NS9	Nonsense_Mutation	SNP	ENST00000360240.6	hg19	CCDS33750.1	.	.	.	.	.	.	.	.	.	.	G	46	12.165166	0.99642	.	.	ENSG00000047849	ENST00000264724;ENST00000395734;ENST00000426837;ENST00000360240;ENST00000383736	.	.	.	5.82	4.92	0.64577	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-2.0553	10.3329	0.43833	0.0:0.1979:0.6643:0.1377	.	.	.	.	X	702;967;2112;967;687	.	ENSP00000264724:R702X	R	-	1	2	MAP4	47885782	0.999000	0.42202	1.000000	0.80357	0.993000	0.82548	2.079000	0.41577	1.330000	0.45394	0.563000	0.77884	CGA	.	.		0.463	MAP4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000346085.1	NM_002375	
MST1R	4486	hgsc.bcm.edu	37	3	49933256	49933256	+	Missense_Mutation	SNP	C	C	T			TCGA-2Y-A9H9-01A-21D-A38X-10	TCGA-2Y-A9H9-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5586a43-bdc1-4030-93f8-cfb7bfa6a4b1	5ab2f233-e5fe-41df-9cef-56c0fdd900d3	g.chr3:49933256C>T	ENST00000296474.3	-	12	2881	c.2854G>A	c.(2854-2856)Ggg>Agg	p.G952R	MST1R_ENST00000344206.4_Missense_Mutation_p.G903R	NM_002447.2	NP_002438	Q04912	RON_HUMAN	macrophage stimulating 1 receptor (c-met-related tyrosine kinase)	952					cellular component movement (GO:0006928)|defense response (GO:0006952)|innate immune response (GO:0045087)|macrophage colony-stimulating factor signaling pathway (GO:0038145)|multicellular organismal development (GO:0007275)|positive regulation of cell proliferation (GO:0008284)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein kinase B signaling (GO:0051897)|response to virus (GO:0009615)|signal transduction (GO:0007165)|single fertilization (GO:0007338)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|stress fiber (GO:0001725)	ATP binding (GO:0005524)|enzyme binding (GO:0019899)|macrophage colony-stimulating factor receptor activity (GO:0005011)			cervix(1)|endometrium(5)|large_intestine(3)|lung(17)|ovary(5)|prostate(2)|skin(1)|urinary_tract(3)	37				BRCA - Breast invasive adenocarcinoma(193;4.65e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.00553)|Kidney(197;0.00625)		TGTGGGACCCCATCTGGCCCT	0.617																																					p.G952R		Atlas-SNP	.											.	MST1R	205	.	0			c.G2854A						.						64.0	63.0	64.0					3																	49933256		2203	4300	6503	SO:0001583	missense	4486	exon12			GGACCCCATCTGG	X70040	CCDS2807.1, CCDS58833.1	3p21	2008-08-18			ENSG00000164078	ENSG00000164078		"""CD molecules"""	7381	protein-coding gene	gene with protein product		600168	"""PTK8 protein tyrosine kinase 8"""	RON, PTK8		8386824	Standard	NM_002447		Approved	CDw136, CD136	uc003cxy.4	Q04912	OTTHUMG00000156709	ENST00000296474.3:c.2854G>A	chr3.hg19:g.49933256C>T	ENSP00000296474:p.Gly952Arg	36.0	0.0		44.0	6.0	NM_002447	B5A944|B5A945|B5A946|B5A947	Missense_Mutation	SNP	ENST00000296474.3	hg19	CCDS2807.1	.	.	.	.	.	.	.	.	.	.	C	6.580	0.475439	0.12521	.	.	ENSG00000164078	ENST00000296474;ENST00000344206	T;T	0.73897	-0.79;-0.67	4.54	-0.859	0.10685	.	0.595335	0.18888	N	0.128389	T	0.41236	0.1150	N	0.04043	-0.29	0.09310	N	1	B	0.12630	0.006	B	0.06405	0.002	T	0.24764	-1.0151	10	0.10636	T	0.68	-5.8864	4.0998	0.10009	0.0:0.3536:0.338:0.3084	.	952	Q04912	RON_HUMAN	R	952;903	ENSP00000296474:G952R;ENSP00000341325:G903R	ENSP00000296474:G952R	G	-	1	0	MST1R	49908260	0.000000	0.05858	0.001000	0.08648	0.098000	0.18820	-0.538000	0.06120	-0.000000	0.14550	0.491000	0.48974	GGG	.	.		0.617	MST1R-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000345403.1		
RNF168	165918	hgsc.bcm.edu	37	3	196199175	196199175	+	Missense_Mutation	SNP	A	A	G			TCGA-2Y-A9H9-01A-21D-A38X-10	TCGA-2Y-A9H9-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5586a43-bdc1-4030-93f8-cfb7bfa6a4b1	5ab2f233-e5fe-41df-9cef-56c0fdd900d3	g.chr3:196199175A>G	ENST00000318037.3	-	6	1825	c.1231T>C	c.(1231-1233)Tcc>Ccc	p.S411P	CTD-2002J20.1_ENST00000610042.1_RNA	NM_152617.3	NP_689830.2	Q8IYW5	RN168_HUMAN	ring finger protein 168, E3 ubiquitin protein ligase	411					cellular response to DNA damage stimulus (GO:0006974)|double-strand break repair (GO:0006302)|histone H2A K63-linked ubiquitination (GO:0070535)|histone H2A monoubiquitination (GO:0035518)|histone H2A-K13 ubiquitination (GO:0036351)|histone H2A-K15 ubiquitination (GO:0036352)|interstrand cross-link repair (GO:0036297)|isotype switching (GO:0045190)|negative regulation of translational elongation (GO:0045900)|positive regulation of DNA repair (GO:0045739)|protein K63-linked ubiquitination (GO:0070534)|protein ubiquitination (GO:0016567)|response to ionizing radiation (GO:0010212)|ubiquitin-dependent protein catabolic process (GO:0006511)	mitochondrion (GO:0005739)|nucleus (GO:0005634)|site of double-strand break (GO:0035861)|ubiquitin ligase complex (GO:0000151)	chromatin binding (GO:0003682)|histone binding (GO:0042393)|K63-linked polyubiquitin binding (GO:0070530)|ligase activity (GO:0016874)|nucleosome binding (GO:0031491)|ubiquitin binding (GO:0043130)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|endometrium(2)|large_intestine(7)|lung(9)|ovary(1)	20	all_cancers(143;1e-08)|Ovarian(172;0.0634)|Breast(254;0.206)		Epithelial(36;5.25e-24)|all cancers(36;5.47e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.76e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00348)		GATTCGGGGGACACTTTTCTT	0.383																																					p.S411P		Atlas-SNP	.											.	RNF168	49	.	0			c.T1231C						.						123.0	119.0	120.0					3																	196199175		2203	4300	6503	SO:0001583	missense	165918	exon6			CGGGGGACACTTT	AK054732	CCDS3317.1	3q29	2014-09-17	2012-02-23		ENSG00000163961	ENSG00000163961		"""RING-type (C3HC4) zinc fingers"""	26661	protein-coding gene	gene with protein product		612688	"""ring finger protein 168"""			12477932	Standard	NM_152617		Approved	FLJ35794	uc003fwq.3	Q8IYW5	OTTHUMG00000155582	ENST00000318037.3:c.1231T>C	chr3.hg19:g.196199175A>G	ENSP00000320898:p.Ser411Pro	74.0	0.0		99.0	8.0	NM_152617	Q8NA67|Q96NS4	Missense_Mutation	SNP	ENST00000318037.3	hg19	CCDS3317.1	.	.	.	.	.	.	.	.	.	.	A	8.737	0.917952	0.17982	.	.	ENSG00000163961	ENST00000318037	T	0.08008	3.14	5.81	3.35	0.38373	.	0.753892	0.12445	N	0.468260	T	0.05823	0.0152	N	0.22421	0.69	0.09310	N	1	P	0.34934	0.476	B	0.28553	0.091	T	0.34030	-0.9845	10	0.59425	D	0.04	0.1595	8.7077	0.34365	0.8031:0.1292:0.0677:0.0	.	411	Q8IYW5	RN168_HUMAN	P	411	ENSP00000320898:S411P	ENSP00000320898:S411P	S	-	1	0	RNF168	197683572	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	0.995000	0.29706	0.420000	0.25954	0.482000	0.46254	TCC	.	.		0.383	RNF168-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340778.1	NM_152617	
ZNF732	654254	hgsc.bcm.edu	37	4	266039	266039	+	Missense_Mutation	SNP	C	C	A			TCGA-2Y-A9H9-01A-21D-A38X-10	TCGA-2Y-A9H9-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5586a43-bdc1-4030-93f8-cfb7bfa6a4b1	5ab2f233-e5fe-41df-9cef-56c0fdd900d3	g.chr4:266039C>A	ENST00000419098.1	-	4	617	c.607G>T	c.(607-609)Gac>Tac	p.D203Y		NM_001137608.1	NP_001131080.1	B4DXR9	ZN732_HUMAN	zinc finger protein 732	203					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|lung(2)	3						CATTTAAAGTCTTTGCCACAT	0.368																																					p.D202Y		Atlas-SNP	.											ZNF732_ENST00000419098,NS,carcinoma,0,4	ZNF732	117	.	0			c.G604T						.						77.0	64.0	68.0					4																	266039		692	1591	2283	SO:0001583	missense	654254	exon3			TAAAGTCTTTGCC	AK302099	CCDS46990.1	4p16.3	2014-02-12	2009-07-22		ENSG00000186777	ENSG00000186777		"""Zinc fingers, C2H2-type"", ""-"""	37138	protein-coding gene	gene with protein product							Standard	NM_001137608		Approved	FLJ59067	uc011buu.1	B4DXR9	OTTHUMG00000159883	ENST00000419098.1:c.607G>T	chr4.hg19:g.266039C>A	ENSP00000415774:p.Asp203Tyr	81.0	0.0		117.0	24.0	NM_001137608		Missense_Mutation	SNP	ENST00000419098.1	hg19	CCDS46990.1	.	.	.	.	.	.	.	.	.	.	C	10.95	1.495962	0.26774	.	.	ENSG00000186777	ENST00000419098	T	0.17054	2.3	0.937	0.937	0.19494	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.17109	0.0411	L	0.31578	0.945	0.09310	N	0.999998	P	0.48589	0.912	P	0.52454	0.699	T	0.13602	-1.0503	9	0.87932	D	0	.	3.3245	0.07062	0.0:0.6837:0.0:0.3163	.	203	B4DXR9	ZN732_HUMAN	Y	203	ENSP00000415774:D203Y	ENSP00000415774:D203Y	D	-	1	0	ZNF732	256039	0.000000	0.05858	0.301000	0.25044	0.279000	0.26890	-0.185000	0.09684	0.392000	0.25172	0.393000	0.25936	GAC	.	.		0.368	ZNF732-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000357937.2	NM_001137608	
NSG1	27065	hgsc.bcm.edu	37	4	4411339	4411339	+	Missense_Mutation	SNP	T	T	A			TCGA-2Y-A9H9-01A-21D-A38X-10	TCGA-2Y-A9H9-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5586a43-bdc1-4030-93f8-cfb7bfa6a4b1	5ab2f233-e5fe-41df-9cef-56c0fdd900d3	g.chr4:4411339T>A	ENST00000421177.2	+	8	2277	c.286T>A	c.(286-288)Tgc>Agc	p.C96S	NSG1_ENST00000505246.1_Missense_Mutation_p.C96S|NSG1_ENST00000513555.1_Missense_Mutation_p.C96S|NSG1_ENST00000433139.2_Missense_Mutation_p.C96S|NSG1_ENST00000504171.1_Missense_Mutation_p.C57S|NSG1_ENST00000397958.1_Missense_Mutation_p.C96S|NSG1_ENST00000506380.1_Missense_Mutation_p.C96S			P42857	NSG1_HUMAN		96					clathrin coat assembly (GO:0048268)|dopamine receptor signaling pathway (GO:0007212)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)											CTTCCTCACCTGCGTCGTCTT	0.602																																					p.C96S		Atlas-SNP	.											.	.	.	.	0			c.T286A						.						191.0	147.0	162.0					4																	4411339		2203	4300	6503	SO:0001583	missense	0	exon4			CTCACCTGCGTCG																												ENST00000421177.2:c.286T>A	chr4.hg19:g.4411339T>A	ENSP00000388823:p.Cys96Ser	88.0	0.0		82.0	34.0	NM_014392	B4DXC5|Q49AQ1	Missense_Mutation	SNP	ENST00000421177.2	hg19	CCDS3376.1	.	.	.	.	.	.	.	.	.	.	T	22.3	4.274754	0.80580	.	.	ENSG00000168824	ENST00000421177;ENST00000513555;ENST00000505246;ENST00000506380;ENST00000397958;ENST00000433139;ENST00000504171	.	.	.	4.16	4.16	0.48862	.	0.000000	0.85682	D	0.000000	T	0.77558	0.4148	M	0.73962	2.25	0.80722	D	1	D;D	0.89917	0.991;1.0	D;D	0.91635	0.987;0.999	T	0.80942	-0.1157	9	0.87932	D	0	-18.7562	13.3663	0.60687	0.0:0.0:0.0:1.0	.	57;96	B4DXC5;P42857	.;NSG1_HUMAN	S	96;96;96;96;96;96;57	.	ENSP00000381049:C96S	C	+	1	0	AC110814.1	4462240	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	7.195000	0.77798	1.728000	0.51552	0.459000	0.35465	TGC	.	.		0.602	NSG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000246799.1		
SEL1L3	23231	hgsc.bcm.edu	37	4	25767058	25767058	+	Splice_Site	SNP	C	C	T			TCGA-2Y-A9H9-01A-21D-A38X-10	TCGA-2Y-A9H9-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5586a43-bdc1-4030-93f8-cfb7bfa6a4b1	5ab2f233-e5fe-41df-9cef-56c0fdd900d3	g.chr4:25767058C>T	ENST00000399878.3	-	20	2968		c.e20-1		SEL1L3_ENST00000264868.5_Splice_Site|SEL1L3_ENST00000502949.1_Splice_Site	NM_015187.3	NP_056002.2	Q68CR1	SE1L3_HUMAN	sel-1 suppressor of lin-12-like 3 (C. elegans)							integral component of membrane (GO:0016021)				breast(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(6)|prostate(1)|urinary_tract(2)	14						TTCAAATATGCTGCAGGAAAT	0.418																																					.		Atlas-SNP	.											.	SEL1L3	62	.	0			c.2846-1G>A						.						103.0	100.0	101.0					4																	25767058		1890	4115	6005	SO:0001630	splice_region_variant	23231	exon21			AATATGCTGCAGG	BC009945	CCDS47037.1, CCDS75113.1	4p15.2	2009-09-24			ENSG00000091490	ENSG00000091490			29108	protein-coding gene	gene with protein product	"""KIAA0746 protein"""					9872452	Standard	XM_005248143		Approved	KIAA0746	uc003gru.4	Q68CR1	OTTHUMG00000160331	ENST00000399878.3:c.2846-1G>A	chr4.hg19:g.25767058C>T		81.0	0.0		72.0	28.0	NM_015187	A0PJH6|A8K0X2|O94847|Q6P999|Q96G59	Splice_Site	SNP	ENST00000399878.3	hg19	CCDS47037.1	.	.	.	.	.	.	.	.	.	.	C	21.8	4.201008	0.79015	.	.	ENSG00000091490	ENST00000399878;ENST00000264868;ENST00000502949;ENST00000507618	.	.	.	5.24	5.24	0.73138	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.8251	0.92115	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	SEL1L3	25376156	1.000000	0.71417	0.923000	0.36655	0.724000	0.41520	5.561000	0.67339	2.439000	0.82584	0.543000	0.68304	.	.	.		0.418	SEL1L3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360261.1	NM_015187	Intron
CLOCK	9575	hgsc.bcm.edu	37	4	56308736	56308736	+	Silent	SNP	A	A	C			TCGA-2Y-A9H9-01A-21D-A38X-10	TCGA-2Y-A9H9-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5586a43-bdc1-4030-93f8-cfb7bfa6a4b1	5ab2f233-e5fe-41df-9cef-56c0fdd900d3	g.chr4:56308736A>C	ENST00000309964.4	-	20	2218	c.1968T>G	c.(1966-1968)acT>acG	p.T656T	CLOCK_ENST00000381322.1_Silent_p.T656T|CLOCK_ENST00000513440.1_Silent_p.T656T	NM_004898.3	NP_004889.1	O15516	CLOCK_HUMAN	clock circadian regulator	656	Interaction with NR3C1. {ECO:0000250|UniProtKB:O08785}.				cellular response to ionizing radiation (GO:0071479)|chromatin organization (GO:0006325)|circadian regulation of gene expression (GO:0032922)|circadian rhythm (GO:0007623)|DNA damage checkpoint (GO:0000077)|histone acetylation (GO:0016573)|negative regulation of glucocorticoid receptor signaling pathway (GO:2000323)|negative regulation of transcription, DNA-templated (GO:0045892)|photoperiodism (GO:0009648)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|regulation of hair cycle (GO:0042634)|regulation of insulin secretion (GO:0050796)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|regulation of type B pancreatic cell development (GO:2000074)|response to redox state (GO:0051775)|signal transduction (GO:0007165)|spermatogenesis (GO:0007283)	chromatoid body (GO:0033391)|chromosome (GO:0005694)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|E-box binding (GO:0070888)|histone acetyltransferase activity (GO:0004402)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity (GO:0000982)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(4)|kidney(5)|large_intestine(9)|lung(8)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	38	Lung NSC(11;0.00335)|Glioma(25;0.08)|all_epithelial(27;0.0992)|all_neural(26;0.101)		LUSC - Lung squamous cell carcinoma(4;1.62e-07)|Lung(4;1.34e-06)|Epithelial(7;0.0107)			GGGCTGTAAGAGTGCTCTGTG	0.438																																					p.T656T		Atlas-SNP	.											.	CLOCK	81	.	0			c.T1968G						.						170.0	170.0	170.0					4																	56308736		2203	4300	6503	SO:0001819	synonymous_variant	9575	exon21			TGTAAGAGTGCTC	AF011568	CCDS3500.1	4q12	2012-12-07	2012-12-07		ENSG00000134852	ENSG00000134852		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Basic helix-loop-helix proteins"""	2082	protein-coding gene	gene with protein product		601851	"""clock (mouse) homolog"", ""clock homolog (mouse)"""			10198158	Standard	NM_001267843		Approved	KIAA0334, KAT13D, bHLHe8	uc003hba.2	O15516	OTTHUMG00000102141	ENST00000309964.4:c.1968T>G	chr4.hg19:g.56308736A>C		112.0	0.0		128.0	54.0	NM_004898	A0AV01|A2I2N9|O14516|Q9UIT8	Silent	SNP	ENST00000309964.4	hg19	CCDS3500.1																																																																																			.	.		0.438	CLOCK-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361993.2	NM_004898	
YTHDC1	91746	hgsc.bcm.edu	37	4	69188594	69188594	+	Missense_Mutation	SNP	A	A	G			TCGA-2Y-A9H9-01A-21D-A38X-10	TCGA-2Y-A9H9-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5586a43-bdc1-4030-93f8-cfb7bfa6a4b1	5ab2f233-e5fe-41df-9cef-56c0fdd900d3	g.chr4:69188594A>G	ENST00000344157.4	-	11	1809	c.1474T>C	c.(1474-1476)Ttt>Ctt	p.F492L	YTHDC1_ENST00000355665.3_Missense_Mutation_p.F474L|YTHDC1_ENST00000579690.1_Missense_Mutation_p.F492L	NM_001031732.2	NP_001026902.1	Q96MU7	YTDC1_HUMAN	YTH domain containing 1	492	YTH. {ECO:0000255|PROSITE- ProRule:PRU00225}.				mRNA splice site selection (GO:0006376)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(7)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)	30						TCGGGGGGAAACAGAAGACAA	0.413																																					p.F492L		Atlas-SNP	.											.	YTHDC1	81	.	0			c.T1474C						.						87.0	91.0	90.0					4																	69188594		2203	4300	6503	SO:0001583	missense	91746	exon11			GGGGAAACAGAAG	AK098515	CCDS3522.2, CCDS33992.1	4q13.3	2009-01-14			ENSG00000083896	ENSG00000083896			30626	protein-coding gene	gene with protein product						12368078, 10564280	Standard	XM_005265706		Approved	YT521, KIAA1966, YT521-B	uc003hdx.3	Q96MU7	OTTHUMG00000129306	ENST00000344157.4:c.1474T>C	chr4.hg19:g.69188594A>G	ENSP00000339245:p.Phe492Leu	180.0	0.0		257.0	119.0	NM_001031732	Q4W5Q3|Q7Z622|Q8TF35	Missense_Mutation	SNP	ENST00000344157.4	hg19	CCDS33992.1	.	.	.	.	.	.	.	.	.	.	A	15.26	2.781351	0.49891	.	.	ENSG00000083896	ENST00000344157;ENST00000355665	T;T	0.35421	1.31;1.31	6.06	6.06	0.98353	YTH domain (2);	0.093907	0.85682	D	0.000000	T	0.59101	0.2169	M	0.62266	1.93	0.80722	D	1	D;D	0.89917	0.97;1.0	D;D	0.85130	0.984;0.997	T	0.59841	-0.7378	10	0.59425	D	0.04	.	16.6245	0.84952	1.0:0.0:0.0:0.0	.	474;492	Q96MU7-2;Q96MU7	.;YTDC1_HUMAN	L	492;474	ENSP00000339245:F492L;ENSP00000347888:F474L	ENSP00000339245:F492L	F	-	1	0	YTHDC1	68871189	1.000000	0.71417	0.987000	0.45799	0.987000	0.75469	8.536000	0.90627	2.323000	0.78572	0.528000	0.53228	TTT	.	.		0.413	YTHDC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251437.1	NM_133370	
INPP4B	8821	hgsc.bcm.edu	37	4	143226623	143226623	+	Missense_Mutation	SNP	A	A	G			TCGA-2Y-A9H9-01A-21D-A38X-10	TCGA-2Y-A9H9-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5586a43-bdc1-4030-93f8-cfb7bfa6a4b1	5ab2f233-e5fe-41df-9cef-56c0fdd900d3	g.chr4:143226623A>G	ENST00000513000.1	-	10	924	c.491T>C	c.(490-492)gTc>gCc	p.V164A	INPP4B_ENST00000308502.4_Missense_Mutation_p.V164A|INPP4B_ENST00000508116.1_Missense_Mutation_p.V164A|INPP4B_ENST00000509777.1_Missense_Mutation_p.V164A|INPP4B_ENST00000262992.4_Missense_Mutation_p.V164A	NM_003866.2	NP_003857.2	O15327	INP4B_HUMAN	inositol polyphosphate-4-phosphatase, type II, 105kDa	164					cellular calcium ion homeostasis (GO:0006874)|inositol phosphate metabolic process (GO:0043647)|negative regulation of osteoclast differentiation (GO:0045671)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|regulation of bone remodeling (GO:0046850)|regulation of nucleocytoplasmic transport (GO:0046822)|regulation of protein kinase B signaling (GO:0051896)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|Golgi apparatus (GO:0005794)	lipid binding (GO:0008289)|phosphatidylinositol trisphosphate phosphatase activity (GO:0034594)|phosphatidylinositol-3,4-bisphosphate 4-phosphatase activity (GO:0016316)|phosphatidylinositol-4,5-bisphosphate 4-phosphatase activity (GO:0034597)			breast(3)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(8)|lung(29)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	58	all_hematologic(180;0.158)					CAGGCTCAGGACCAGCAATTG	0.383																																					p.V164A		Atlas-SNP	.											.	INPP4B	132	.	0			c.T491C						.						200.0	216.0	211.0					4																	143226623		2203	4300	6503	SO:0001583	missense	8821	exon10			CTCAGGACCAGCA	U96922	CCDS3757.1	4q31.1	2008-02-05	2002-08-29			ENSG00000109452			6075	protein-coding gene	gene with protein product		607494	"""inositol polyphosphate-4-phosphatase, type II, 105kD"""			9295334	Standard	NM_003866		Approved		uc003iiw.4	O15327		ENST00000513000.1:c.491T>C	chr4.hg19:g.143226623A>G	ENSP00000425487:p.Val164Ala	291.0	0.0		345.0	149.0	NM_003866	Q2TAI2|Q5XLE7|Q6IN59|Q6PJB4	Missense_Mutation	SNP	ENST00000513000.1	hg19	CCDS3757.1	.	.	.	.	.	.	.	.	.	.	A	8.262	0.811404	0.16537	.	.	ENSG00000109452	ENST00000513000;ENST00000262992;ENST00000308502;ENST00000543161;ENST00000508116;ENST00000509777;ENST00000510812;ENST00000514525	T;T;T;T;T;T;T	0.27890	1.64;1.64;1.64;1.64;1.64;1.64;1.64	5.74	4.03	0.46877	C2 calcium/lipid-binding domain, CaLB (1);	0.485095	0.21380	N	0.075494	T	0.15435	0.0372	N	0.14661	0.345	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.28427	-1.0044	10	0.08179	T	0.78	.	9.7886	0.40692	0.1612:0.0:0.8388:0.0	.	35;164	B7Z6T2;O15327	.;INP4B_HUMAN	A	164;164;164;35;164;164;164;35	ENSP00000425487:V164A;ENSP00000262992:V164A;ENSP00000308441:V164A;ENSP00000423954:V164A;ENSP00000422793:V164A;ENSP00000427250:V164A;ENSP00000421065:V35A	ENSP00000262992:V164A	V	-	2	0	INPP4B	143446073	1.000000	0.71417	0.412000	0.26496	0.957000	0.61999	2.806000	0.47947	0.787000	0.33731	-0.239000	0.12128	GTC	.	.		0.383	INPP4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364587.1	NM_003866	
DCHS2	54798	hgsc.bcm.edu	37	4	155410658	155410658	+	Missense_Mutation	SNP	G	G	A			TCGA-2Y-A9H9-01A-21D-A38X-10	TCGA-2Y-A9H9-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5586a43-bdc1-4030-93f8-cfb7bfa6a4b1	5ab2f233-e5fe-41df-9cef-56c0fdd900d3	g.chr4:155410658G>A	ENST00000339452.1	-	1	2210	c.1850C>T	c.(1849-1851)aCt>aTt	p.T617I	DCHS2_ENST00000456341.2_Missense_Mutation_p.T610I|DCHS2_ENST00000443500.1_Missense_Mutation_p.T617I	NM_001142552.1	NP_001136024.1	Q6V1P9	PCD23_HUMAN	dachsous cadherin-related 2	1742	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(1)|cervix(3)|endometrium(8)|kidney(5)|large_intestine(54)|lung(63)|ovary(4)|pancreas(1)|prostate(14)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	176	all_hematologic(180;0.208)	Renal(120;0.0854)		LUSC - Lung squamous cell carcinoma(193;0.107)		AGTCCGGATAGTGCTGATCGC	0.602																																					p.T617I		Atlas-SNP	.											.	DCHS2	594	.	0			c.C1850T						.						47.0	48.0	48.0					4																	155410658		692	1591	2283	SO:0001583	missense	54798	exon1			CGGATAGTGCTGA	BC140919	CCDS3785.1, CCDS47150.1	4q32.1	2014-06-04	2013-10-04	2004-09-03		ENSG00000197410		"""Cadherins / Cadherin-related"""	23111	protein-coding gene	gene with protein product	"""cadherin-related family member 7"""	612486	"""cadherin-like 27"", ""dachsous 2 (Drosophila)"""	CDH27, PCDH23		15003449	Standard	NM_017639		Approved	CDHJ, FLJ20047, PCDHJ, CDHR7	uc003inw.2	Q6V1P9		ENST00000339452.1:c.1850C>T	chr4.hg19:g.155410658G>A	ENSP00000345062:p.Thr617Ile	129.0	0.0		175.0	31.0	NM_001142552	B2RU14|E9PC11|Q4W5P9|Q6ZS61|Q9NXU8	Missense_Mutation	SNP	ENST00000339452.1	hg19	CCDS47150.1	.	.	.	.	.	.	.	.	.	.	G	17.11	3.305510	0.60305	.	.	ENSG00000197410	ENST00000339452;ENST00000544161;ENST00000456341;ENST00000443500	T;T;T	0.55760	0.5;0.5;0.5	5.17	5.17	0.71159	.	.	.	.	.	T	0.60818	0.2298	L	0.43701	1.375	0.39861	D	0.973372	D;D	0.71674	0.998;0.965	D;P	0.70016	0.967;0.896	T	0.57608	-0.7782	9	0.31617	T	0.26	.	10.9228	0.47174	0.0857:0.0:0.9143:0.0	.	617;617	E9PG03;E9PC11	.;.	I	617;617;610;617	ENSP00000345062:T617I;ENSP00000408543:T610I;ENSP00000395539:T617I	ENSP00000345062:T617I	T	-	2	0	DCHS2	155630108	1.000000	0.71417	0.962000	0.40283	0.608000	0.37181	6.354000	0.73036	2.692000	0.91855	0.557000	0.71058	ACT	.	.		0.602	DCHS2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000365282.1	NM_001142552	
DCHS2	54798	hgsc.bcm.edu	37	4	155412105	155412105	+	Missense_Mutation	SNP	G	G	A			TCGA-2Y-A9H9-01A-21D-A38X-10	TCGA-2Y-A9H9-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5586a43-bdc1-4030-93f8-cfb7bfa6a4b1	5ab2f233-e5fe-41df-9cef-56c0fdd900d3	g.chr4:155412105G>A	ENST00000339452.1	-	1	763	c.403C>T	c.(403-405)Cgg>Tgg	p.R135W	DCHS2_ENST00000456341.2_Missense_Mutation_p.R128W|DCHS2_ENST00000443500.1_Missense_Mutation_p.R135W	NM_001142552.1	NP_001136024.1	Q6V1P9	PCD23_HUMAN	dachsous cadherin-related 2	1336	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(1)|cervix(3)|endometrium(8)|kidney(5)|large_intestine(54)|lung(63)|ovary(4)|pancreas(1)|prostate(14)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	176	all_hematologic(180;0.208)	Renal(120;0.0854)		LUSC - Lung squamous cell carcinoma(193;0.107)		TGGTCCCGCCGCTCGCGGTCC	0.672																																					p.R135W		Atlas-SNP	.											.	DCHS2	594	.	0			c.C403T						.						8.0	13.0	11.0					4																	155412105		685	1574	2259	SO:0001583	missense	54798	exon1			CCCGCCGCTCGCG	BC140919	CCDS3785.1, CCDS47150.1	4q32.1	2014-06-04	2013-10-04	2004-09-03		ENSG00000197410		"""Cadherins / Cadherin-related"""	23111	protein-coding gene	gene with protein product	"""cadherin-related family member 7"""	612486	"""cadherin-like 27"", ""dachsous 2 (Drosophila)"""	CDH27, PCDH23		15003449	Standard	NM_017639		Approved	CDHJ, FLJ20047, PCDHJ, CDHR7	uc003inw.2	Q6V1P9		ENST00000339452.1:c.403C>T	chr4.hg19:g.155412105G>A	ENSP00000345062:p.Arg135Trp	263.0	0.0		434.0	253.0	NM_001142552	B2RU14|E9PC11|Q4W5P9|Q6ZS61|Q9NXU8	Missense_Mutation	SNP	ENST00000339452.1	hg19	CCDS47150.1	.	.	.	.	.	.	.	.	.	.	G	19.21	3.784462	0.70222	.	.	ENSG00000197410	ENST00000339452;ENST00000544161;ENST00000456341;ENST00000443500	T;T;T	0.66995	-0.24;-0.24;-0.24	4.51	4.51	0.55191	.	.	.	.	.	T	0.81123	0.4757	M	0.86805	2.84	0.21386	N	0.999707	D;D	0.89917	0.994;1.0	P;P	0.61592	0.696;0.891	T	0.72789	-0.4187	9	0.72032	D	0.01	.	11.07	0.47997	0.0:0.0:0.68:0.32	.	135;135	E9PG03;E9PC11	.;.	W	135;135;128;135	ENSP00000345062:R135W;ENSP00000408543:R128W;ENSP00000395539:R135W	ENSP00000345062:R135W	R	-	1	2	DCHS2	155631555	0.958000	0.32768	0.983000	0.44433	0.988000	0.76386	1.011000	0.29911	2.049000	0.60858	0.462000	0.41574	CGG	.	.		0.672	DCHS2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000365282.1	NM_001142552	
HCN1	348980	hgsc.bcm.edu	37	5	45695977	45695977	+	Silent	SNP	G	G	A	rs56063136|rs56060059		TCGA-2Y-A9H9-01A-21D-A38X-10	TCGA-2Y-A9H9-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5586a43-bdc1-4030-93f8-cfb7bfa6a4b1	5ab2f233-e5fe-41df-9cef-56c0fdd900d3	g.chr5:45695977G>A	ENST00000303230.4	-	1	276	c.219C>T	c.(217-219)ggC>ggT	p.G73G		NM_021072.3	NP_066550.2	O60741	HCN1_HUMAN	hyperpolarization activated cyclic nucleotide-gated potassium channel 1	73	Gly-rich.				apical protein localization (GO:0045176)|cellular response to cAMP (GO:0071320)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of membrane potential (GO:0042391)|retinal cone cell development (GO:0046549)|sodium ion transmembrane transport (GO:0035725)|synaptic transmission (GO:0007268)	axon (GO:0030424)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cAMP binding (GO:0030552)|intracellular cAMP activated cation channel activity (GO:0005222)|potassium channel activity (GO:0005267)|voltage-gated potassium channel activity (GO:0005249)|voltage-gated sodium channel activity (GO:0005248)			NS(3)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(21)|liver(1)|lung(98)|ovary(1)|prostate(7)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(5)	156						GCTCCTcgccgccgccgccgc	0.771																																					p.G73G		Atlas-SNP	.											.	HCN1	298	.	0			c.C219T						.						4.0	5.0	5.0					5																	45695977		1679	3595	5274	SO:0001819	synonymous_variant	348980	exon1			CTCGCCGCCGCCG	AF064876	CCDS3952.1	5p12	2011-07-05			ENSG00000164588	ENSG00000164588		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	4845	protein-coding gene	gene with protein product		602780		BCNG1		9405696, 9630217, 16382102	Standard	NM_021072		Approved	BCNG-1, HAC-2	uc003jok.3	O60741	OTTHUMG00000131155	ENST00000303230.4:c.219C>T	chr5.hg19:g.45695977G>A		22.0	0.0		58.0	18.0	NM_021072		Silent	SNP	ENST00000303230.4	hg19	CCDS3952.1																																																																																			.	.		0.771	HCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253847.1	NM_021072	
ITGA1	3672	hgsc.bcm.edu	37	5	52229759	52229759	+	Missense_Mutation	SNP	A	A	G	rs539547486		TCGA-2Y-A9H9-01A-21D-A38X-10	TCGA-2Y-A9H9-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5586a43-bdc1-4030-93f8-cfb7bfa6a4b1	5ab2f233-e5fe-41df-9cef-56c0fdd900d3	g.chr5:52229759A>G	ENST00000282588.6	+	23	3355	c.2897A>G	c.(2896-2898)aAt>aGt	p.N966S	CTD-2175A23.1_ENST00000505701.1_RNA|CTD-2175A23.1_ENST00000503559.1_RNA	NM_181501.1	NP_852478.1	P56199	ITA1_HUMAN	integrin, alpha 1	966					activation of MAPK activity (GO:0000187)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell-matrix adhesion (GO:0007160)|cellular extravasation (GO:0045123)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)|muscle contraction (GO:0006936)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|neutrophil chemotaxis (GO:0030593)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of phosphoprotein phosphatase activity (GO:0032516)|vasodilation (GO:0042311)	acrosomal vesicle (GO:0001669)|basal part of cell (GO:0045178)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integrin alpha1-beta1 complex (GO:0034665)|integrin complex (GO:0008305)|membrane (GO:0016020)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)	collagen binding (GO:0005518)|collagen binding involved in cell-matrix adhesion (GO:0098639)|metal ion binding (GO:0046872)|protein phosphatase binding (GO:0019903)			NS(1)|breast(3)|central_nervous_system(4)|endometrium(3)|kidney(4)|large_intestine(6)|liver(2)|lung(19)|ovary(2)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	51		Lung NSC(810;5.05e-05)|Breast(144;0.0851)				ATTGCTGCCAATGAGACAGTC	0.284																																					p.N966S		Atlas-SNP	.											.	ITGA1	112	.	0			c.A2897G						.						45.0	49.0	47.0					5																	52229759		2197	4280	6477	SO:0001583	missense	3672	exon23			CTGCCAATGAGAC	X68742	CCDS3955.1	5q11.1	2010-03-23			ENSG00000213949	ENSG00000213949		"""CD molecules"", ""Integrins"""	6134	protein-coding gene	gene with protein product		192968				8428973, 11937138	Standard	NM_181501		Approved	VLA1, CD49a	uc003jou.3	P56199	OTTHUMG00000131163	ENST00000282588.6:c.2897A>G	chr5.hg19:g.52229759A>G	ENSP00000282588:p.Asn966Ser	379.0	0.0		517.0	191.0	NM_181501	B2RNU0	Missense_Mutation	SNP	ENST00000282588.6	hg19	CCDS3955.1	.	.	.	.	.	.	.	.	.	.	A	16.16	3.043823	0.55110	.	.	ENSG00000213949	ENST00000282588	T	0.49720	0.77	5.77	5.77	0.91146	Integrin alpha-2 (1);	0.269411	0.41938	D	0.000789	T	0.35248	0.0925	L	0.34521	1.04	0.42538	D	0.993063	B	0.21821	0.061	B	0.25759	0.063	T	0.17048	-1.0382	10	0.09084	T	0.74	.	12.482	0.55850	1.0:0.0:0.0:0.0	.	966	P56199	ITA1_HUMAN	S	966	ENSP00000282588:N966S	ENSP00000282588:N966S	N	+	2	0	ITGA1	52265516	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.041000	0.57339	2.194000	0.70268	0.528000	0.53228	AAT	.	.		0.284	ITGA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253855.3	NM_181501	
ZSWIM6	57688	hgsc.bcm.edu	37	5	60817126	60817126	+	Missense_Mutation	SNP	G	G	A			TCGA-2Y-A9H9-01A-21D-A38X-10	TCGA-2Y-A9H9-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5586a43-bdc1-4030-93f8-cfb7bfa6a4b1	5ab2f233-e5fe-41df-9cef-56c0fdd900d3	g.chr5:60817126G>A	ENST00000252744.5	+	5	1370	c.1370G>A	c.(1369-1371)tGc>tAc	p.C457Y		NM_020928.1	NP_065979.1	Q9HCJ5	ZSWM6_HUMAN	zinc finger, SWIM-type containing 6	457					neuron projection morphogenesis (GO:0048812)|regulation of neuron migration (GO:2001222)		zinc ion binding (GO:0008270)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)	8						AACCCCCACTGCAAGTTGGAG	0.373																																					p.C457Y		Atlas-SNP	.											.	ZSWIM6	51	.	0			c.G1370A						.						96.0	77.0	83.0					5																	60817126		692	1591	2283	SO:0001583	missense	57688	exon5			CCCACTGCAAGTT	BC039438	CCDS47215.1	5q12.1	2011-03-17			ENSG00000130449	ENSG00000130449		"""Zinc fingers, SWIM-type"""	29316	protein-coding gene	gene with protein product		615951				10997877, 16427614	Standard	NM_020928		Approved	KIAA1577	uc003jsr.3	Q9HCJ5	OTTHUMG00000162388	ENST00000252744.5:c.1370G>A	chr5.hg19:g.60817126G>A	ENSP00000252744:p.Cys457Tyr	141.0	0.0		185.0	83.0	NM_020928		Missense_Mutation	SNP	ENST00000252744.5	hg19	CCDS47215.1	.	.	.	.	.	.	.	.	.	.	G	14.73	2.622121	0.46840	.	.	ENSG00000130449	ENST00000252744	T	0.43688	0.94	5.31	5.31	0.75309	.	.	.	.	.	T	0.47710	0.1460	M	0.71206	2.165	0.58432	D	0.999993	B	0.13145	0.007	B	0.17979	0.02	T	0.44003	-0.9356	9	0.46703	T	0.11	-4.6217	18.9908	0.92791	0.0:0.0:1.0:0.0	.	457	Q9HCJ5	ZSWM6_HUMAN	Y	457	ENSP00000252744:C457Y	ENSP00000252744:C457Y	C	+	2	0	ZSWIM6	60852883	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.495000	0.81514	2.494000	0.84150	0.655000	0.94253	TGC	.	.		0.373	ZSWIM6-001	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368710.1	NM_020928	
SLCO4C1	353189	hgsc.bcm.edu	37	5	101627074	101627074	+	Nonsense_Mutation	SNP	C	C	A			TCGA-2Y-A9H9-01A-21D-A38X-10	TCGA-2Y-A9H9-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5586a43-bdc1-4030-93f8-cfb7bfa6a4b1	5ab2f233-e5fe-41df-9cef-56c0fdd900d3	g.chr5:101627074C>A	ENST00000310954.6	-	2	878	c.592G>T	c.(592-594)Gaa>Taa	p.E198*		NM_180991.4	NP_851322.3			solute carrier organic anion transporter family, member 4C1											breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(16)|ovary(1)|pancreas(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(5)	50		all_cancers(142;1.86e-08)|all_epithelial(76;5.24e-12)|Prostate(80;0.00124)|Colorectal(57;0.00332)|Ovarian(225;0.024)|Lung NSC(167;0.0402)|all_lung(232;0.0486)		Epithelial(69;4.07e-14)|COAD - Colon adenocarcinoma(37;0.00986)		AATTTATATTCTCCACTGAAA	0.358																																					p.E198X		Atlas-SNP	.											SLCO4C1,NS,carcinoma,0,1	SLCO4C1	113	.	0			c.G592T						.						75.0	74.0	75.0					5																	101627074		2203	4300	6503	SO:0001587	stop_gained	353189	exon2			TATATTCTCCACT	AY273896	CCDS34205.1	5q21	2013-05-22	2003-11-25		ENSG00000173930	ENSG00000173930		"""Solute carriers"""	23612	protein-coding gene	gene with protein product		609013					Standard	NM_180991		Approved	SLC21A20, OATP4C1, OATPX, OATP-H	uc003knm.3	Q6ZQN7	OTTHUMG00000162757	ENST00000310954.6:c.592G>T	chr5.hg19:g.101627074C>A	ENSP00000309741:p.Glu198*	196.0	0.0		245.0	14.0	NM_180991		Nonsense_Mutation	SNP	ENST00000310954.6	hg19	CCDS34205.1	.	.	.	.	.	.	.	.	.	.	C	22.5	4.296652	0.81025	.	.	ENSG00000173930	ENST00000310954	.	.	.	5.43	-5.92	0.02261	.	2.242970	0.01637	N	0.023842	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.06625	T	0.88	.	9.8536	0.41073	0.0:0.4518:0.1658:0.3824	.	.	.	.	X	198	.	ENSP00000309741:E198X	E	-	1	0	SLCO4C1	101654973	0.000000	0.05858	0.001000	0.08648	0.280000	0.26924	-0.636000	0.05465	-2.033000	0.00925	-1.094000	0.02160	GAA	.	.		0.358	SLCO4C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370332.1	NM_180991	
PKD2L2	27039	hgsc.bcm.edu	37	5	137241951	137241951	+	Missense_Mutation	SNP	C	C	A			TCGA-2Y-A9H9-01A-21D-A38X-10	TCGA-2Y-A9H9-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5586a43-bdc1-4030-93f8-cfb7bfa6a4b1	5ab2f233-e5fe-41df-9cef-56c0fdd900d3	g.chr5:137241951C>A	ENST00000508883.1	+	6	829	c.803C>A	c.(802-804)tCt>tAt	p.S268Y	PKD2L2_ENST00000508638.1_Missense_Mutation_p.S268Y|PKD2L2_ENST00000290431.5_Missense_Mutation_p.S268Y|PKD2L2_ENST00000350250.4_Missense_Mutation_p.S234Y|PKD2L2_ENST00000502810.1_Missense_Mutation_p.S268Y			Q9NZM6	PK2L2_HUMAN	polycystic kidney disease 2-like 2	268					calcium ion transmembrane transport (GO:0070588)|detection of mechanical stimulus (GO:0050982)	integral component of membrane (GO:0016021)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)			breast(1)|endometrium(7)|kidney(4)|large_intestine(6)|lung(7)|skin(1)|upper_aerodigestive_tract(2)	28			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0109)			CAGTTTTACTCTGTGAAGCTC	0.368																																					p.S268Y		Atlas-SNP	.											.	PKD2L2	68	.	0			c.C803A						.						127.0	119.0	121.0					5																	137241951		1830	4089	5919	SO:0001583	missense	27039	exon6			TTTACTCTGTGAA	AF118125	CCDS43367.1, CCDS58971.1, CCDS58972.1	5q31	2011-12-16			ENSG00000078795	ENSG00000078795		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	9012	protein-coding gene	gene with protein product		604669				10602361	Standard	NM_014386		Approved	TRPP5	uc003lbw.1	Q9NZM6	OTTHUMG00000163306	ENST00000508883.1:c.803C>A	chr5.hg19:g.137241951C>A	ENSP00000424725:p.Ser268Tyr	131.0	0.0		171.0	79.0	NM_001258448	A6NK98|B4DXD2|E9PC91|E9PDG4|Q86YB4|Q9UNJ0	Missense_Mutation	SNP	ENST00000508883.1	hg19		.	.	.	.	.	.	.	.	.	.	C	26.3	4.729213	0.89390	.	.	ENSG00000078795	ENST00000503015;ENST00000350250;ENST00000508638;ENST00000502810;ENST00000508883;ENST00000290431	T;T;T;T;T;T	0.73681	-0.77;-0.77;-0.77;-0.77;-0.77;-0.77	5.12	5.12	0.69794	Polycystin cation channel, PKD1/PKD2 (1);	0.000000	0.64402	D	0.000017	D	0.85004	0.5598	M	0.62723	1.935	0.49582	D	0.999801	D;D;D	0.89917	0.992;1.0;1.0	D;D;D	0.91635	0.958;0.999;0.999	D	0.86604	0.1868	10	0.87932	D	0	-10.9603	18.1552	0.89688	0.0:1.0:0.0:0.0	.	268;268;268	Q9NZM6;E9PC91;Q9NZM6-5	PK2L2_HUMAN;.;.	Y	178;234;268;268;268;268	ENSP00000424885:S178Y;ENSP00000344177:S234Y;ENSP00000423382:S268Y;ENSP00000425513:S268Y;ENSP00000424725:S268Y;ENSP00000290431:S268Y	ENSP00000290431:S268Y	S	+	2	0	PKD2L2	137269850	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.786000	0.85741	2.396000	0.81511	0.467000	0.42956	TCT	.	.		0.368	PKD2L2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000372521.1	NM_014386	
PCDHA9	9752	hgsc.bcm.edu	37	5	140228373	140228373	+	Missense_Mutation	SNP	G	G	A			TCGA-2Y-A9H9-01A-21D-A38X-10	TCGA-2Y-A9H9-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5586a43-bdc1-4030-93f8-cfb7bfa6a4b1	5ab2f233-e5fe-41df-9cef-56c0fdd900d3	g.chr5:140228373G>A	ENST00000532602.1	+	1	1326	c.293G>A	c.(292-294)cGg>cAg	p.R98Q	PCDHA7_ENST00000525929.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA9_ENST00000378122.3_Missense_Mutation_p.R98Q|PCDHA4_ENST00000512229.2_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA5_ENST00000529619.1_Intron	NM_031857.1	NP_114063.1	Q9Y5H5	PCDA9_HUMAN	protocadherin alpha 9	98	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(18)|ovary(4)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	59			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CTGTGCGGGCGGAGCGCGGAG	0.567																																					p.R98Q	Melanoma(55;1800 1972 14909)	Atlas-SNP	.											.	PCDHA9	373	.	0			c.G293A						.						100.0	90.0	93.0					5																	140228373		2197	4261	6458	SO:0001583	missense	9752	exon1			GCGGGCGGAGCGC	AF152487	CCDS54920.1	5q31	2010-11-26				ENSG00000204961		"""Cadherins / Protocadherins : Clustered"""	8675	other	complex locus constituent	"""KIAA0345-like 5"""	606315				10380929	Standard	NM_031857		Approved	KIAA0345, PCDH-ALPHA9		Q9Y5H5		ENST00000532602.1:c.293G>A	chr5.hg19:g.140228373G>A	ENSP00000436042:p.Arg98Gln	187.0	0.0		245.0	36.0	NM_031857	O15053|Q2M3S5	Missense_Mutation	SNP	ENST00000532602.1	hg19	CCDS54920.1	.	.	.	.	.	.	.	.	.	.	G	10.54	1.377557	0.24944	.	.	ENSG00000204961	ENST00000532602;ENST00000378122	T;T	0.26373	1.74;1.74	3.91	3.02	0.34903	Cadherin, N-terminal (1);Cadherin (3);Cadherin-like (1);	0.296211	0.17413	U	0.175101	T	0.10809	0.0264	N	0.13198	0.31	0.09310	N	1	B;P	0.49090	0.067;0.919	B;B	0.38428	0.021;0.273	T	0.12553	-1.0543	10	0.46703	T	0.11	.	2.3719	0.04332	0.2068:0.0:0.5001:0.293	.	98;98	Q9Y5H5;Q9Y5H5-2	PCDA9_HUMAN;.	Q	98	ENSP00000436042:R98Q;ENSP00000367362:R98Q	ENSP00000367362:R98Q	R	+	2	0	PCDHA9	140208557	0.000000	0.05858	0.998000	0.56505	0.685000	0.39939	0.165000	0.16564	2.155000	0.67459	0.586000	0.80456	CGG	.	.		0.567	PCDHA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372896.2	NM_031857	
PCDH12	51294	hgsc.bcm.edu	37	5	141335204	141335204	+	Missense_Mutation	SNP	G	G	T			TCGA-2Y-A9H9-01A-21D-A38X-10	TCGA-2Y-A9H9-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5586a43-bdc1-4030-93f8-cfb7bfa6a4b1	5ab2f233-e5fe-41df-9cef-56c0fdd900d3	g.chr5:141335204G>T	ENST00000231484.3	-	1	3423	c.2213C>A	c.(2212-2214)tCc>tAc	p.S738Y	AC005740.6_ENST00000607378.1_RNA|PCDH12_ENST00000512221.1_5'Flank	NM_016580.2	NP_057664.1	Q9NPG4	PCD12_HUMAN	protocadherin 12	738					calcium-dependent cell-cell adhesion (GO:0016339)|glycogen metabolic process (GO:0005977)|homophilic cell adhesion (GO:0007156)|labyrinthine layer development (GO:0060711)|neuron recognition (GO:0008038)	cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(14)|ovary(3)|prostate(2)|skin(1)	38		all_hematologic(541;0.0999)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CCGGCAGATGGACATGAACAA	0.582																																					p.S738Y		Atlas-SNP	.											.	PCDH12	133	.	0			c.C2213A						.						66.0	58.0	61.0					5																	141335204		2203	4300	6503	SO:0001583	missense	51294	exon1			CAGATGGACATGA	AF231025	CCDS4269.1	5q31.3	2010-01-26			ENSG00000113555	ENSG00000113555		"""Cadherins / Protocadherins : Non-clustered"""	8657	protein-coding gene	gene with protein product		605622				10716726, 10380929	Standard	NM_016580		Approved	VE-cadherin-2	uc003llx.3	Q9NPG4	OTTHUMG00000129658	ENST00000231484.3:c.2213C>A	chr5.hg19:g.141335204G>T	ENSP00000231484:p.Ser738Tyr	86.0	0.0		94.0	36.0	NM_016580	Q6UXB6|Q96KB8|Q9H7Y6|Q9H8E0	Missense_Mutation	SNP	ENST00000231484.3	hg19	CCDS4269.1	.	.	.	.	.	.	.	.	.	.	G	17.12	3.307565	0.60305	.	.	ENSG00000113555	ENST00000231484	T	0.53423	0.62	5.01	4.14	0.48551	.	0.062533	0.64402	D	0.000003	T	0.61009	0.2313	M	0.62723	1.935	0.43250	D	0.995179	D	0.71674	0.998	D	0.63488	0.915	T	0.63629	-0.6594	10	0.62326	D	0.03	.	11.0435	0.47844	0.0898:0.0:0.9102:0.0	.	738	Q9NPG4	PCD12_HUMAN	Y	738	ENSP00000231484:S738Y	ENSP00000231484:S738Y	S	-	2	0	PCDH12	141315388	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	6.233000	0.72320	1.360000	0.45960	0.561000	0.74099	TCC	.	.		0.582	PCDH12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251858.1	NM_016580	
FAT2	2196	hgsc.bcm.edu	37	5	150945848	150945848	+	Missense_Mutation	SNP	T	T	C			TCGA-2Y-A9H9-01A-21D-A38X-10	TCGA-2Y-A9H9-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5586a43-bdc1-4030-93f8-cfb7bfa6a4b1	5ab2f233-e5fe-41df-9cef-56c0fdd900d3	g.chr5:150945848T>C	ENST00000261800.5	-	1	2657	c.2645A>G	c.(2644-2646)gAc>gGc	p.D882G		NM_001447.2	NP_001438.1	Q9NYQ8	FAT2_HUMAN	FAT atypical cadherin 2	882	Cadherin 7. {ECO:0000255|PROSITE- ProRule:PRU00043}.				epithelial cell migration (GO:0010631)|homophilic cell adhesion (GO:0007156)	cell-cell adherens junction (GO:0005913)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(6)|breast(3)|central_nervous_system(3)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(61)|liver(1)|lung(60)|ovary(6)|prostate(5)|skin(5)|stomach(2)|upper_aerodigestive_tract(11)|urinary_tract(1)	196		Medulloblastoma(196;0.0912)|all_hematologic(541;0.104)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			TGATTCGCGGTCCAGGTGTCC	0.552																																					p.D882G		Atlas-SNP	.											.	FAT2	465	.	0			c.A2645G						.						94.0	90.0	91.0					5																	150945848		2203	4300	6503	SO:0001583	missense	2196	exon1			TCGCGGTCCAGGT	AF231022	CCDS4317.1	5q33.1	2014-07-21	2013-05-31		ENSG00000086570	ENSG00000086570		"""Cadherins / Cadherin-related"""	3596	protein-coding gene	gene with protein product	"""cadherin-related family member 9"""	604269	"""FAT tumor suppressor (Drosophila) homolog 2"", ""FAT tumor suppressor homolog 2 (Drosophila)"""			9693030	Standard	NM_001447		Approved	MEGF1, CDHF8, HFAT2, CDHR9	uc003lue.4	Q9NYQ8	OTTHUMG00000130126	ENST00000261800.5:c.2645A>G	chr5.hg19:g.150945848T>C	ENSP00000261800:p.Asp882Gly	151.0	0.0		202.0	99.0	NM_001447	O75091|Q9NSR7	Missense_Mutation	SNP	ENST00000261800.5	hg19	CCDS4317.1	.	.	.	.	.	.	.	.	.	.	T	19.07	3.756354	0.69648	.	.	ENSG00000086570	ENST00000261800	T	0.65178	-0.14	5.67	5.67	0.87782	Cadherin (4);Cadherin-like (1);	0.000000	0.64402	D	0.000001	D	0.84848	0.5563	H	0.94503	3.545	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.89114	0.3498	10	0.72032	D	0.01	.	15.924	0.79597	0.0:0.0:0.0:1.0	.	882	Q9NYQ8	FAT2_HUMAN	G	882	ENSP00000261800:D882G	ENSP00000261800:D882G	D	-	2	0	FAT2	150926041	1.000000	0.71417	0.971000	0.41717	0.782000	0.44232	7.975000	0.88055	2.163000	0.67991	0.459000	0.35465	GAC	.	.		0.552	FAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252434.1	NM_001447	
CAGE1	285782	hgsc.bcm.edu	37	6	7378874	7378874	+	Silent	SNP	G	G	A			TCGA-2Y-A9H9-01A-21D-A38X-10	TCGA-2Y-A9H9-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5586a43-bdc1-4030-93f8-cfb7bfa6a4b1	5ab2f233-e5fe-41df-9cef-56c0fdd900d3	g.chr6:7378874G>A	ENST00000512086.1	-	4	865	c.663C>T	c.(661-663)agC>agT	p.S221S	CAGE1_ENST00000338150.4_Silent_p.S221S|CAGE1_ENST00000379918.4_Silent_p.S221S|CAGE1_ENST00000509324.1_Intron|CAGE1_ENST00000502583.1_Silent_p.S221S|CAGE1_ENST00000296742.7_Silent_p.S85S			Q8TC20	CAGE1_HUMAN	cancer antigen 1	221										breast(1)|cervix(1)|endometrium(3)|kidney(2)|lung(11)|urinary_tract(1)	19	Ovarian(93;0.0418)					TTGGAGGTTGGCTAGGGTTGA	0.393																																					p.S221S		Atlas-SNP	.											.	CAGE1	165	.	0			c.C663T						.						175.0	170.0	172.0					6																	7378874		1840	4089	5929	SO:0001819	synonymous_variant	285782	exon4			AGGTTGGCTAGGG	BC026194	CCDS47367.1, CCDS54964.1, CCDS54965.1	6p24.3	2009-08-06	2005-01-26	2005-01-27	ENSG00000164304	ENSG00000164304			21622	protein-coding gene	gene with protein product	"""cancer/testis antigen 95"""	608304	"""cancer/testis antigen 3"""	CTAG3		12531476	Standard	NM_205864		Approved	bA69L16.7, CT95	uc003mxl.2	Q8TC20	OTTHUMG00000014200	ENST00000512086.1:c.663C>T	chr6.hg19:g.7378874G>A		189.0	0.0		212.0	96.0	NM_001170693	D6RCT9|Q5TAM0|Q86TM4|Q8N7R5	Silent	SNP	ENST00000512086.1	hg19																																																																																				.	.		0.393	CAGE1-008	PUTATIVE	non_canonical_conserved|basic	protein_coding	protein_coding	OTTHUMT00000367136.1	NM_175745	
MRS2	57380	hgsc.bcm.edu	37	6	24403393	24403393	+	Missense_Mutation	SNP	G	G	T			TCGA-2Y-A9H9-01A-21D-A38X-10	TCGA-2Y-A9H9-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5586a43-bdc1-4030-93f8-cfb7bfa6a4b1	5ab2f233-e5fe-41df-9cef-56c0fdd900d3	g.chr6:24403393G>T	ENST00000378386.3	+	1	212	c.119G>T	c.(118-120)gGc>gTc	p.G40V	MRS2_ENST00000378353.1_Missense_Mutation_p.G40V|MRS2_ENST00000483634.1_3'UTR|MRS2_ENST00000535061.1_Missense_Mutation_p.G40V|MRS2_ENST00000543597.1_5'UTR|MRS2_ENST00000443868.2_Missense_Mutation_p.G40V|MRS2_ENST00000274747.7_Missense_Mutation_p.G40V	NM_020662.2	NP_065713.1	Q9HD23	MRS2_HUMAN	MRS2 magnesium transporter	40						integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)	magnesium ion transmembrane transporter activity (GO:0015095)			breast(1)|endometrium(2)|large_intestine(2)|lung(5)|skin(1)|stomach(1)	12						GCTGCCTGCGGCCGCCGAGCC	0.701																																					p.G40V		Atlas-SNP	.											.	MRS2	31	.	0			c.G119T						.						26.0	27.0	27.0					6																	24403393		2202	4295	6497	SO:0001583	missense	57380	exon1			CCTGCGGCCGCCG	AF288288	CCDS4552.1, CCDS69055.1, CCDS69056.1, CCDS75408.1	6p22.3-p22.1	2013-05-03	2013-05-03	2008-01-18	ENSG00000124532	ENSG00000124532			13785	protein-coding gene	gene with protein product			"""MRS2-like, magnesium homeostasis factor (S. cerevisiae)"", ""MRS2 magnesium homeostasis factor homolog (S. cerevisiae)"""	MRS2L			Standard	XM_005249242		Approved		uc003neb.3	Q9HD23	OTTHUMG00000014355	ENST00000378386.3:c.119G>T	chr6.hg19:g.24403393G>T	ENSP00000367637:p.Gly40Val	41.0	0.0		44.0	12.0	NM_020662	A8K4U3|B3KNN2|B4DQL2|Q5T3Y1|Q6NTG4|Q96KF8|Q9BVP1	Missense_Mutation	SNP	ENST00000378386.3	hg19	CCDS4552.1	.	.	.	.	.	.	.	.	.	.	G	15.78	2.935352	0.52866	.	.	ENSG00000124532	ENST00000274747;ENST00000535061;ENST00000378386;ENST00000378353;ENST00000443868	T;T;T;T;T	0.53857	0.6;0.99;1.3;0.73;1.29	5.01	5.01	0.66863	.	0.973329	0.08365	N	0.957109	T	0.36082	0.0954	N	0.24115	0.695	0.80722	D	1	B;B;B;B	0.28552	0.215;0.032;0.215;0.078	B;B;B;B	0.38755	0.24;0.055;0.281;0.037	T	0.16100	-1.0414	10	0.66056	D	0.02	-7.0205	13.6908	0.62544	0.0:0.0:1.0:0.0	.	40;40;40;40	F5GWH3;B4DQL2;Q9HD23;Q9HD23-2	.;.;MRS2_HUMAN;.	V	40	ENSP00000274747:G40V;ENSP00000441839:G40V;ENSP00000367637:G40V;ENSP00000367604:G40V;ENSP00000399585:G40V	ENSP00000274747:G40V	G	+	2	0	MRS2	24511372	0.006000	0.16342	0.916000	0.36221	0.014000	0.08584	0.513000	0.22770	2.585000	0.87301	0.655000	0.94253	GGC	.	.		0.701	MRS2-009	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040002.1		
TDP2	51567	hgsc.bcm.edu	37	6	24651152	24651152	+	Missense_Mutation	SNP	A	A	T			TCGA-2Y-A9H9-01A-21D-A38X-10	TCGA-2Y-A9H9-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5586a43-bdc1-4030-93f8-cfb7bfa6a4b1	5ab2f233-e5fe-41df-9cef-56c0fdd900d3	g.chr6:24651152A>T	ENST00000378198.4	-	7	1123	c.953T>A	c.(952-954)aTa>aAa	p.I318K	TDP2_ENST00000545995.1_Missense_Mutation_p.I348K|TDP2_ENST00000341060.3_Missense_Mutation_p.I260K			O95551	TYDP2_HUMAN	tyrosyl-DNA phosphodiesterase 2	318					cell surface receptor signaling pathway (GO:0007166)|double-strand break repair (GO:0006302)|regulation of RNA biosynthetic process (GO:2001141)	cytoplasm (GO:0005737)|intercellular bridge (GO:0045171)|nucleus (GO:0005634)|PML body (GO:0016605)	5'-tyrosyl-DNA phosphodiesterase activity (GO:0070260)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|nuclease activity (GO:0004518)|single-stranded DNA binding (GO:0003697)|transcription corepressor activity (GO:0003714)|tyrosyl-RNA phosphodiesterase activity (GO:0036317)			kidney(2)|large_intestine(1)|lung(5)|ovary(1)	9						TCTGAAAAATATTCGATCAAA	0.398								Direct reversal of damage																													p.I318K		Atlas-SNP	.											.	TDP2	29	.	0			c.T953A						.						98.0	96.0	97.0					6																	24651152		2203	4300	6503	SO:0001583	missense	51567	exon7			AAAAATATTCGAT	AJ269473	CCDS4557.1	6p22.3-p22.1	2010-05-07	2010-05-07	2010-05-07	ENSG00000111802	ENSG00000111802	3.1.4.-		17768	protein-coding gene	gene with protein product		605764	"""TRAF and TNF receptor associated protein"""	TTRAP		11478795	Standard	NM_016614		Approved		uc003nej.3	O95551	OTTHUMG00000014360	ENST00000378198.4:c.953T>A	chr6.hg19:g.24651152A>T	ENSP00000367440:p.Ile318Lys	127.0	0.0		226.0	146.0	NM_016614	B4DKL8|B4DQ95|Q2TBE2|Q5JYM0|Q7Z6U5|Q9NUK5|Q9NYY9	Missense_Mutation	SNP	ENST00000378198.4	hg19	CCDS4557.1	.	.	.	.	.	.	.	.	.	.	A	34	5.378913	0.95945	.	.	ENSG00000111802	ENST00000378198;ENST00000545995;ENST00000545780;ENST00000341060	D;D;D	0.85861	-2.04;-2.04;-2.04	6.07	6.07	0.98685	Endonuclease/exonuclease/phosphatase (2);	0.182021	0.56097	D	0.000040	D	0.90031	0.6887	M	0.70275	2.135	0.80722	D	1	D	0.59767	0.986	D	0.66497	0.944	D	0.91230	0.5013	10	0.87932	D	0	-18.1364	16.6288	0.85011	1.0:0.0:0.0:0.0	.	318	O95551	TYDP2_HUMAN	K	318;348;240;260	ENSP00000367440:I318K;ENSP00000437637:I348K;ENSP00000345345:I260K	ENSP00000345345:I260K	I	-	2	0	TDP2	24759131	1.000000	0.71417	0.998000	0.56505	0.994000	0.84299	8.809000	0.91944	2.326000	0.78906	0.533000	0.62120	ATA	.	.		0.398	TDP2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000040012.1		
SLC17A2	10246	hgsc.bcm.edu	37	6	25917052	25917052	+	Missense_Mutation	SNP	A	A	T			TCGA-2Y-A9H9-01A-21D-A38X-10	TCGA-2Y-A9H9-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5586a43-bdc1-4030-93f8-cfb7bfa6a4b1	5ab2f233-e5fe-41df-9cef-56c0fdd900d3	g.chr6:25917052A>T	ENST00000265425.3	-	7	811	c.791T>A	c.(790-792)gTc>gAc	p.V264D	SLC17A2_ENST00000377850.3_Missense_Mutation_p.V264D|SLC17A2_ENST00000360488.3_Missense_Mutation_p.V264D			O00624	NPT3_HUMAN	solute carrier family 17, member 2	264					phosphate ion transmembrane transport (GO:0035435)|phosphate-containing compound metabolic process (GO:0006796)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	sodium:phosphate symporter activity (GO:0005436)			endometrium(3)|kidney(1)|large_intestine(9)|lung(12)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	31						CTTTATGGGGACAGCTCGTCC	0.498																																					p.V264D		Atlas-SNP	.											.	SLC17A2	70	.	0			c.T791A						.						92.0	85.0	88.0					6																	25917052		2203	4300	6503	SO:0001583	missense	10246	exon8			ATGGGGACAGCTC	U90544	CCDS4567.1, CCDS69060.1	6p22.2	2013-07-18	2013-07-18		ENSG00000112337	ENSG00000112337		"""Solute carriers"""	10930	protein-coding gene	gene with protein product		611049	"""solute carrier family 17 (sodium phosphate), member 2"""			9149941	Standard	NM_001286123		Approved	NPT3	uc003nfl.3	O00624	OTTHUMG00000014413	ENST00000265425.3:c.791T>A	chr6.hg19:g.25917052A>T	ENSP00000265425:p.Val264Asp	95.0	0.0		121.0	53.0	NM_005835	A6NK81|A6NLD6|Q5TB84|Q76P85	Missense_Mutation	SNP	ENST00000265425.3	hg19		.	.	.	.	.	.	.	.	.	.	A	18.86	3.712393	0.68730	.	.	ENSG00000112337	ENST00000360488;ENST00000377850;ENST00000265425	T;T;T	0.60299	0.2;0.2;0.2	4.65	4.65	0.58169	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.311671	0.23569	N	0.046769	T	0.56934	0.2019	L	0.49126	1.545	0.58432	D	0.999999	P;P;D	0.57571	0.949;0.949;0.98	P;P;P	0.59948	0.866;0.633;0.844	T	0.63157	-0.6700	10	0.87932	D	0	.	10.6641	0.45719	1.0:0.0:0.0:0.0	.	264;264;264	O00624;A6NK81;O00624-2	NPT3_HUMAN;.;.	D	264	ENSP00000353677:V264D;ENSP00000367081:V264D;ENSP00000265425:V264D	ENSP00000265425:V264D	V	-	2	0	SLC17A2	26025031	0.994000	0.37717	1.000000	0.80357	0.620000	0.37586	6.228000	0.72288	2.067000	0.61834	0.460000	0.39030	GTC	.	.		0.498	SLC17A2-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000040075.1		
HIST1H4G	8369	hgsc.bcm.edu	37	6	26247145	26247145	+	Missense_Mutation	SNP	T	T	C			TCGA-2Y-A9H9-01A-21D-A38X-10	TCGA-2Y-A9H9-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5586a43-bdc1-4030-93f8-cfb7bfa6a4b1	5ab2f233-e5fe-41df-9cef-56c0fdd900d3	g.chr6:26247145T>C	ENST00000244537.4	-	1	114	c.61A>G	c.(61-63)Aag>Gag	p.K21E		NM_003547.2	NP_003538.1	Q99525	H4G_HUMAN	histone cluster 1, H4g	21						nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|endometrium(1)|large_intestine(1)|lung(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	7		all_hematologic(11;0.0945)|Acute lymphoblastic leukemia(11;0.167)				CTCAGTACCTTGCGATGGCAC	0.512																																					p.K21E		Atlas-SNP	.											.	HIST1H4G	18	.	0			c.A61G						.						54.0	50.0	51.0					6																	26247145		2203	4300	6503	SO:0001583	missense	8369	exon1			GTACCTTGCGATG	Z80788	CCDS4599.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000124578	ENSG00000275663		"""Histones / Replication-dependent"""	4792	protein-coding gene	gene with protein product		602832	"""H4 histone family, member L"", ""histone 1, H4g"""	H4FL		9119399, 12408966	Standard	NM_003547		Approved	H4/l	uc003nhf.3	Q99525	OTTHUMG00000014444	ENST00000244537.4:c.61A>G	chr6.hg19:g.26247145T>C	ENSP00000244537:p.Lys21Glu	60.0	0.0		75.0	34.0	NM_003547		Missense_Mutation	SNP	ENST00000244537.4	hg19	CCDS4599.1	.	.	.	.	.	.	.	.	.	.	.	12.19	1.864828	0.32977	.	.	ENSG00000124578	ENST00000244537	.	.	.	3.34	3.34	0.38264	Histone-fold (2);	.	.	.	.	T	0.47691	0.1459	.	.	.	0.41624	D	0.988984	P	0.41748	0.761	P	0.45660	0.489	T	0.56926	-0.7898	7	0.87932	D	0	.	11.7312	0.51737	0.0:0.0:0.0:1.0	.	21	Q99525	H4G_HUMAN	E	21	.	ENSP00000244537:K21E	K	-	1	0	HIST1H4G	26355124	1.000000	0.71417	0.316000	0.25252	0.003000	0.03518	5.573000	0.67417	1.502000	0.48669	0.410000	0.27636	AAG	.	.		0.512	HIST1H4G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040107.1	NM_003547	
MRPS18B	28973	hgsc.bcm.edu	37	6	30587275	30587275	+	Silent	SNP	C	C	T			TCGA-2Y-A9H9-01A-21D-A38X-10	TCGA-2Y-A9H9-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5586a43-bdc1-4030-93f8-cfb7bfa6a4b1	5ab2f233-e5fe-41df-9cef-56c0fdd900d3	g.chr6:30587275C>T	ENST00000259873.4	+	2	241	c.84C>T	c.(82-84)ccC>ccT	p.P28P	PPP1R10_ENST00000484449.1_5'Flank|PPP1R10_ENST00000376511.2_5'Flank|MRPS18B_ENST00000472229.1_3'UTR|MRPS18B_ENST00000506373.2_Silent_p.P28P	NM_014046.3	NP_054765.1	Q9Y676	RT18B_HUMAN	mitochondrial ribosomal protein S18B	28					translation (GO:0006412)	cell junction (GO:0030054)|mitochondrial small ribosomal subunit (GO:0005763)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	structural constituent of ribosome (GO:0003735)			endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(2)|prostate(1)|skin(2)	13						TGTAGGTTCCCCTCCAGACTC	0.403																																					p.P28P		Atlas-SNP	.											.	MRPS18B	22	.	0			c.C84T						.						71.0	87.0	82.0					6																	30587275		1507	2707	4214	SO:0001819	synonymous_variant	28973	exon2			GGTTCCCCTCCAG	AF100761	CCDS4682.1	6p21	2012-09-13			ENSG00000204568	ENSG00000204568		"""Mitochondrial ribosomal proteins / small subunits"""	14516	protein-coding gene	gene with protein product		611982				11279123	Standard	NM_014046		Approved	MRPS18-2, PTD017, C6orf14, HSPC183	uc003nqo.2	Q9Y676	OTTHUMG00000031268	ENST00000259873.4:c.84C>T	chr6.hg19:g.30587275C>T		64.0	0.0		79.0	33.0	NM_014046	A6NDQ0|Q659G4|Q9BS27	Silent	SNP	ENST00000259873.4	hg19	CCDS4682.1																																																																																			.	.		0.403	MRPS18B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076584.2		
MDN1	23195	hgsc.bcm.edu	37	6	90377748	90377748	+	Silent	SNP	G	G	T			TCGA-2Y-A9H9-01A-21D-A38X-10	TCGA-2Y-A9H9-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5586a43-bdc1-4030-93f8-cfb7bfa6a4b1	5ab2f233-e5fe-41df-9cef-56c0fdd900d3	g.chr6:90377748G>T	ENST00000369393.3	-	84	14194	c.14079C>A	c.(14077-14079)atC>atA	p.I4693I	MDN1_ENST00000468568.1_5'Flank|MDN1_ENST00000428876.1_Silent_p.I4693I			Q9NU22	MDN1_HUMAN	MDN1, midasin homolog (yeast)	4693					ATP catabolic process (GO:0006200)|protein complex assembly (GO:0006461)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|unfolded protein binding (GO:0051082)			NS(1)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(22)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(52)|liver(1)|lung(83)|ovary(10)|pancreas(1)|prostate(10)|skin(6)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	218		all_cancers(76;1.47e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00246)		BRCA - Breast invasive adenocarcinoma(108;0.0193)		CTTCATTTCCGATCTGGTCAC	0.418																																					p.I4693I		Atlas-SNP	.											.	MDN1	478	.	0			c.C14079A						.						260.0	199.0	220.0					6																	90377748		2203	4300	6503	SO:0001819	synonymous_variant	23195	exon84			ATTTCCGATCTGG	AF503925	CCDS5024.1	6q15	2014-01-28			ENSG00000112159	ENSG00000112159			18302	protein-coding gene	gene with protein product						9205841, 12102729	Standard	XM_005248699		Approved	KIAA0301	uc003pnn.1	Q9NU22	OTTHUMG00000015213	ENST00000369393.3:c.14079C>A	chr6.hg19:g.90377748G>T		81.0	0.0		107.0	5.0	NM_014611	O15019|Q5T794	Silent	SNP	ENST00000369393.3	hg19	CCDS5024.1																																																																																			.	.		0.418	MDN1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041514.2		
MDN1	23195	hgsc.bcm.edu	37	6	90410473	90410473	+	Missense_Mutation	SNP	C	C	G			TCGA-2Y-A9H9-01A-21D-A38X-10	TCGA-2Y-A9H9-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5586a43-bdc1-4030-93f8-cfb7bfa6a4b1	5ab2f233-e5fe-41df-9cef-56c0fdd900d3	g.chr6:90410473C>G	ENST00000369393.3	-	56	8645	c.8530G>C	c.(8530-8532)Gac>Cac	p.D2844H	MDN1_ENST00000428876.1_Missense_Mutation_p.D2844H			Q9NU22	MDN1_HUMAN	MDN1, midasin homolog (yeast)	2844					ATP catabolic process (GO:0006200)|protein complex assembly (GO:0006461)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|unfolded protein binding (GO:0051082)			NS(1)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(22)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(52)|liver(1)|lung(83)|ovary(10)|pancreas(1)|prostate(10)|skin(6)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	218		all_cancers(76;1.47e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00246)		BRCA - Breast invasive adenocarcinoma(108;0.0193)		CGGTTAATGTCTTCCTGCCAT	0.483																																					p.D2844H		Atlas-SNP	.											.	MDN1	478	.	0			c.G8530C						.						96.0	91.0	93.0					6																	90410473		2203	4300	6503	SO:0001583	missense	23195	exon56			TAATGTCTTCCTG	AF503925	CCDS5024.1	6q15	2014-01-28			ENSG00000112159	ENSG00000112159			18302	protein-coding gene	gene with protein product						9205841, 12102729	Standard	XM_005248699		Approved	KIAA0301	uc003pnn.1	Q9NU22	OTTHUMG00000015213	ENST00000369393.3:c.8530G>C	chr6.hg19:g.90410473C>G	ENSP00000358400:p.Asp2844His	123.0	0.0		175.0	69.0	NM_014611	O15019|Q5T794	Missense_Mutation	SNP	ENST00000369393.3	hg19	CCDS5024.1	.	.	.	.	.	.	.	.	.	.	C	12.42	1.931679	0.34096	.	.	ENSG00000112159	ENST00000369393;ENST00000428876	T;T	0.03689	3.84;3.84	5.64	5.64	0.86602	.	0.118700	0.56097	D	0.000036	T	0.01835	0.0058	N	0.24115	0.695	0.32743	N	0.507442	P	0.51351	0.944	P	0.45881	0.496	T	0.46091	-0.9216	10	0.62326	D	0.03	.	9.8913	0.41292	0.0:0.8435:0.0:0.1565	.	2844	Q9NU22	MDN1_HUMAN	H	2844	ENSP00000358400:D2844H;ENSP00000413970:D2844H	ENSP00000358400:D2844H	D	-	1	0	MDN1	90467194	1.000000	0.71417	0.996000	0.52242	0.560000	0.35617	1.907000	0.39897	2.660000	0.90430	0.655000	0.94253	GAC	.	.		0.483	MDN1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041514.2		
GPRC6A	222545	hgsc.bcm.edu	37	6	117116996	117116996	+	Silent	SNP	T	T	C			TCGA-2Y-A9H9-01A-21D-A38X-10	TCGA-2Y-A9H9-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5586a43-bdc1-4030-93f8-cfb7bfa6a4b1	5ab2f233-e5fe-41df-9cef-56c0fdd900d3	g.chr6:117116996T>C	ENST00000310357.3	-	5	1572	c.1551A>G	c.(1549-1551)caA>caG	p.Q517Q	GPRC6A_ENST00000368549.3_Silent_p.Q446Q|GPRC6A_ENST00000530250.1_Silent_p.Q342Q	NM_148963.2	NP_683766.2	Q5T6X5	GPC6A_HUMAN	G protein-coupled receptor, class C, group 6, member A	517					calcium-mediated signaling (GO:0019722)|response to amino acid (GO:0043200)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			autonomic_ganglia(1)|breast(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(8)|liver(1)|lung(24)|ovary(5)|pancreas(1)|skin(5)|stomach(3)|upper_aerodigestive_tract(3)	65		all_cancers(87;0.0314)|all_epithelial(87;0.0216)|Colorectal(196;0.234)		GBM - Glioblastoma multiforme(226;0.0265)|all cancers(137;0.0554)|OV - Ovarian serous cystadenocarcinoma(136;0.07)		TAGATTGAATTTGCTATATTA	0.299																																					p.Q517Q		Atlas-SNP	.											.	GPRC6A	152	.	0			c.A1551G						.						68.0	65.0	66.0					6																	117116996		2203	4300	6503	SO:0001819	synonymous_variant	222545	exon5			TTGAATTTGCTAT	AF502962	CCDS5112.1, CCDS69184.1, CCDS69185.1	6q22.31	2014-01-30	2014-01-30		ENSG00000173612	ENSG00000173612		"""GPCR / Class C : Calcium-sensing receptors"""	18510	protein-coding gene	gene with protein product			"""G protein-coupled receptor, family C, group 6, member A"""				Standard	NM_001286354		Approved	bA86F4.3	uc003pxj.1	Q5T6X5	OTTHUMG00000015447	ENST00000310357.3:c.1551A>G	chr6.hg19:g.117116996T>C		69.0	0.0		63.0	34.0	NM_148963	Q6JK43|Q6JK44|Q8NGU8|Q8NHZ9|Q8TDT6	Silent	SNP	ENST00000310357.3	hg19	CCDS5112.1																																																																																			.	.		0.299	GPRC6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041966.2		
NCOA7	135112	hgsc.bcm.edu	37	6	126210902	126210902	+	Missense_Mutation	SNP	G	G	T			TCGA-2Y-A9H9-01A-21D-A38X-10	TCGA-2Y-A9H9-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5586a43-bdc1-4030-93f8-cfb7bfa6a4b1	5ab2f233-e5fe-41df-9cef-56c0fdd900d3	g.chr6:126210902G>T	ENST00000368357.3	+	10	2054	c.1702G>T	c.(1702-1704)Ggt>Tgt	p.G568C	NCOA7_ENST00000229634.9_Missense_Mutation_p.G453C|NCOA7_ENST00000392477.2_Missense_Mutation_p.G568C	NM_001199619.1|NM_001199620.1	NP_001186548.1|NP_001186549.1	Q8NI08	NCOA7_HUMAN	nuclear receptor coactivator 7	568					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	intracellular (GO:0005622)|nucleus (GO:0005634)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nuclear hormone receptor binding (GO:0035257)			NS(1)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|large_intestine(6)|lung(16)|ovary(1)|skin(1)|soft_tissue(1)|urinary_tract(2)	39				UCEC - Uterine corpus endometrioid carcinoma (4;0.0803)|GBM - Glioblastoma multiforme(226;0.0193)|all cancers(137;0.237)		TTCCCAGGCGGGTGATCCCAT	0.433																																					p.G568C		Atlas-SNP	.											.	NCOA7	92	.	0			c.G1702T						.						52.0	56.0	54.0					6																	126210902		2203	4299	6502	SO:0001583	missense	135112	exon10			CAGGCGGGTGATC	AJ420542	CCDS5132.1, CCDS56448.1	6q22.33	2013-03-14			ENSG00000111912	ENSG00000111912			21081	protein-coding gene	gene with protein product	"""TBC/LysM-associated domain containing 4"""	609752				11971969	Standard	NM_001199619		Approved	ERAP140, dJ187J11.3, TLDC4	uc003qai.3	Q8NI08	OTTHUMG00000015513	ENST00000368357.3:c.1702G>T	chr6.hg19:g.126210902G>T	ENSP00000357341:p.Gly568Cys	102.0	0.0		128.0	34.0	NM_001199619	B2RNS2|B7Z2C4|B9EH71|G8JL91|Q3LID6|Q4G0V1|Q5TF95|Q6IPQ4|Q6NE83|Q86T89|Q8N1W4	Missense_Mutation	SNP	ENST00000368357.3	hg19	CCDS5132.1	.	.	.	.	.	.	.	.	.	.	G	2.055	-0.416693	0.04766	.	.	ENSG00000111912	ENST00000368357;ENST00000392477;ENST00000229634;ENST00000413085	T;T;T;T	0.32753	1.44;1.44;1.44;1.44	5.8	-1.88	0.07713	.	0.679402	0.15062	N	0.282709	T	0.05547	0.0146	L	0.27053	0.805	0.09310	N	1	B;B;B	0.11235	0.004;0.001;0.001	B;B;B	0.10450	0.005;0.004;0.002	T	0.29882	-0.9997	10	0.52906	T	0.07	-1.3197	1.3744	0.02217	0.3571:0.103:0.3301:0.2098	.	557;557;568	B3KXK4;Q8NI08-2;Q8NI08	.;.;NCOA7_HUMAN	C	568;568;453;366	ENSP00000357341:G568C;ENSP00000376269:G568C;ENSP00000229634:G453C;ENSP00000389186:G366C	ENSP00000229634:G453C	G	+	1	0	NCOA7	126252595	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.287000	0.08388	-0.101000	0.12219	0.655000	0.94253	GGT	.	.		0.433	NCOA7-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000042083.4	XM_059748	
DACT2	168002	hgsc.bcm.edu	37	6	168708969	168708969	+	Missense_Mutation	SNP	C	C	A			TCGA-2Y-A9H9-01A-21D-A38X-10	TCGA-2Y-A9H9-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5586a43-bdc1-4030-93f8-cfb7bfa6a4b1	5ab2f233-e5fe-41df-9cef-56c0fdd900d3	g.chr6:168708969C>A	ENST00000366795.3	-	4	1556	c.1468G>T	c.(1468-1470)Ggt>Tgt	p.G490C	DACT2_ENST00000366796.3_Intron|DACT2_ENST00000610183.1_Missense_Mutation_p.G320C|DACT2_ENST00000607983.1_Missense_Mutation_p.G82C	NM_214462.3	NP_999627.2	Q5SW24	DACT2_HUMAN	dishevelled-binding antagonist of beta-catenin 2	490					epithelial cell morphogenesis (GO:0003382)|hematopoietic progenitor cell differentiation (GO:0002244)|inner medullary collecting duct development (GO:0072061)|negative regulation of cell adhesion (GO:0007162)|negative regulation of nodal signaling pathway (GO:1900108)|skin development (GO:0043588)	mitochondrion (GO:0005739)	beta-catenin binding (GO:0008013)|delta-catenin binding (GO:0070097)|protein kinase A binding (GO:0051018)|protein kinase C binding (GO:0005080)|transcription factor binding (GO:0008134)			endometrium(1)	1		Breast(66;1.46e-05)|Ovarian(120;0.0728)		OV - Ovarian serous cystadenocarcinoma(33;5.33e-21)|BRCA - Breast invasive adenocarcinoma(81;1.18e-06)|GBM - Glioblastoma multiforme(31;0.000957)		TTGGGGGGACCCATTTTCAGG	0.572																																					p.G490C		Atlas-SNP	.											.	DACT2	46	.	0			c.G1468T						.						49.0	49.0	49.0					6																	168708969		692	1591	2283	SO:0001583	missense	168002	exon4			GGGGACCCATTTT	AF318336	CCDS47519.1, CCDS69241.1, CCDS75554.1	6q27	2013-05-15	2013-05-15	2003-09-17	ENSG00000164488	ENSG00000164488			21231	protein-coding gene	gene with protein product		608966	"""chromosome 6 open reading frame 116"", ""dapper homolog 2, antagonist of beta-catenin (xenopus)"", ""dapper, antagonist of beta-catenin, homolog 2 (Xenopus laevis)"""	C6orf116			Standard	NM_001286351		Approved	bA503C24.7, DAPPER2	uc003qwq.3	Q5SW24	OTTHUMG00000016046	ENST00000366795.3:c.1468G>T	chr6.hg19:g.168708969C>A	ENSP00000355760:p.Gly490Cys	69.0	0.0		80.0	9.0	NM_214462	Q2NKJ2|Q569G0|Q8WYW2	Missense_Mutation	SNP	ENST00000366795.3	hg19	CCDS47519.1	.	.	.	.	.	.	.	.	.	.	C	13.06	2.123106	0.37436	.	.	ENSG00000164488	ENST00000366795	T	0.54866	0.55	3.46	-0.88	0.10610	.	0.686023	0.12899	N	0.429967	T	0.48624	0.1510	L	0.56769	1.78	0.09310	N	1	D	0.89917	1.0	D	0.73380	0.98	T	0.37407	-0.9707	10	0.72032	D	0.01	-16.2559	7.6316	0.28243	0.0:0.5324:0.0:0.4676	.	490	Q5SW24	DACT2_HUMAN	C	490	ENSP00000355760:G490C	ENSP00000355760:G490C	G	-	1	0	DACT2	168451818	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.155000	0.16362	-0.080000	0.12685	0.650000	0.86243	GGT	.	.		0.572	DACT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043193.1		
C7orf25	79020	hgsc.bcm.edu	37	7	42949271	42949271	+	Missense_Mutation	SNP	G	G	C			TCGA-2Y-A9H9-01A-21D-A38X-10	TCGA-2Y-A9H9-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5586a43-bdc1-4030-93f8-cfb7bfa6a4b1	5ab2f233-e5fe-41df-9cef-56c0fdd900d3	g.chr7:42949271G>C	ENST00000350427.4	-	2	1504	c.1229C>G	c.(1228-1230)cCc>cGc	p.P410R	C7orf25_ENST00000431882.2_Missense_Mutation_p.P468R|C7orf25_ENST00000438029.1_Missense_Mutation_p.P410R|PSMA2_ENST00000442788.1_3'UTR|C7orf25_ENST00000447342.1_Missense_Mutation_p.P410R			Q9BPX7	CG025_HUMAN	chromosome 7 open reading frame 25	410										endometrium(6)|kidney(1)|large_intestine(7)|lung(2)|skin(1)	17						TTTTGGTAAGGGGGTGGCTAG	0.413																																					p.P468R		Atlas-SNP	.											.	C7orf25	36	.	0			c.C1403G						.						99.0	100.0	100.0					7																	42949271		2203	4300	6503	SO:0001583	missense	79020	exon2			GGTAAGGGGGTGG	BC001845	CCDS5466.1, CCDS47576.1	7p14.1	2011-11-24			ENSG00000136197	ENSG00000136197			21703	protein-coding gene	gene with protein product							Standard	NM_024054		Approved	MGC2821	uc003thx.4	Q9BPX7	OTTHUMG00000128869	ENST00000350427.4:c.1229C>G	chr7.hg19:g.42949271G>C	ENSP00000343364:p.Pro410Arg	137.0	0.0		198.0	71.0	NM_001099858	A4D1V2|J3KR36|Q9H779	Missense_Mutation	SNP	ENST00000350427.4	hg19	CCDS5466.1	.	.	.	.	.	.	.	.	.	.	G	18.91	3.722966	0.68959	.	.	ENSG00000136197	ENST00000350427;ENST00000447342;ENST00000431882;ENST00000438029	T;T;T;T	0.48522	0.86;0.86;0.81;0.86	6.06	6.06	0.98353	.	0.000000	0.85682	D	0.000000	T	0.69984	0.3172	M	0.65498	2.005	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.997	T	0.68784	-0.5317	10	0.62326	D	0.03	-0.8237	20.6282	0.99521	0.0:0.0:1.0:0.0	.	468;410	B4DQM3;Q9BPX7	.;CG025_HUMAN	R	410;410;468;410	ENSP00000343364:P410R;ENSP00000413029:P410R;ENSP00000416290:P468R;ENSP00000396597:P410R	ENSP00000343364:P410R	P	-	2	0	C7orf25	42915796	1.000000	0.71417	1.000000	0.80357	0.896000	0.52359	9.224000	0.95209	2.871000	0.98454	0.655000	0.94253	CCC	.	.		0.413	C7orf25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250814.2	NM_024054	
SEMA3C	10512	hgsc.bcm.edu	37	7	80378240	80378240	+	Nonsense_Mutation	SNP	G	G	A	rs557931063		TCGA-2Y-A9H9-01A-21D-A38X-10	TCGA-2Y-A9H9-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5586a43-bdc1-4030-93f8-cfb7bfa6a4b1	5ab2f233-e5fe-41df-9cef-56c0fdd900d3	g.chr7:80378240G>A	ENST00000265361.3	-	17	2377	c.1816C>T	c.(1816-1818)Cag>Tag	p.Q606*	SEMA3C_ENST00000544525.1_Nonsense_Mutation_p.Q624*|SEMA3C_ENST00000419255.2_Nonsense_Mutation_p.Q606*	NM_006379.3	NP_006370.1	Q99985	SEM3C_HUMAN	sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3C	606	Ig-like C2-type.				axon guidance (GO:0007411)|blood vessel remodeling (GO:0001974)|cardiac right ventricle morphogenesis (GO:0003215)|dichotomous subdivision of terminal units involved in salivary gland branching (GO:0060666)|immune response (GO:0006955)|limb bud formation (GO:0060174)|neural crest cell migration (GO:0001755)|neural tube development (GO:0021915)|outflow tract morphogenesis (GO:0003151)|post-embryonic development (GO:0009791)|pulmonary myocardium development (GO:0003350)|response to drug (GO:0042493)|somitogenesis (GO:0001756)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	receptor activity (GO:0004872)			NS(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(17)|ovary(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	34						TTGTCTTTCTGTAACAGCCAC	0.468													G|||	1	0.000199681	0.0008	0.0	5008	,	,		17269	0.0		0.0	False		,,,				2504	0.0				p.Q606X		Atlas-SNP	.											.	SEMA3C	106	.	0			c.C1816T						.						148.0	134.0	139.0					7																	80378240		2203	4300	6503	SO:0001587	stop_gained	10512	exon17			CTTTCTGTAACAG	AB000220	CCDS5596.1	7q21-q31	2013-01-11			ENSG00000075223	ENSG00000075223		"""Semaphorins"", ""Immunoglobulin superfamily / I-set domain containing"""	10725	protein-coding gene	gene with protein product		602645		SEMAE		7748561, 9168980	Standard	NM_006379		Approved	SemE	uc003uhj.3	Q99985	OTTHUMG00000023447	ENST00000265361.3:c.1816C>T	chr7.hg19:g.80378240G>A	ENSP00000265361:p.Gln606*	36.0	0.0		75.0	37.0	NM_006379	B4DRL8	Nonsense_Mutation	SNP	ENST00000265361.3	hg19	CCDS5596.1	.	.	.	.	.	.	.	.	.	.	G	44	10.795397	0.99469	.	.	ENSG00000075223	ENST00000265361;ENST00000419255;ENST00000544525	.	.	.	5.38	5.38	0.77491	.	0.051716	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	19.1326	0.93413	0.0:0.0:1.0:0.0	.	.	.	.	X	606;606;624	.	ENSP00000265361:Q606X	Q	-	1	0	SEMA3C	80216176	1.000000	0.71417	1.000000	0.80357	0.944000	0.59088	9.837000	0.99465	2.511000	0.84671	0.563000	0.77884	CAG	.	.		0.468	SEMA3C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253279.1	NM_006379	
RNF148	378925	hgsc.bcm.edu	37	7	122342140	122342140	+	Missense_Mutation	SNP	G	G	T			TCGA-2Y-A9H9-01A-21D-A38X-10	TCGA-2Y-A9H9-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5586a43-bdc1-4030-93f8-cfb7bfa6a4b1	5ab2f233-e5fe-41df-9cef-56c0fdd900d3	g.chr7:122342140G>T	ENST00000434824.1	-	1	881	c.665C>A	c.(664-666)aCc>aAc	p.T222N	CADPS2_ENST00000334010.7_Intron|RNF148_ENST00000447240.1_Intron|CADPS2_ENST00000313070.7_Intron|CADPS2_ENST00000449022.2_Intron|RNF133_ENST00000340112.2_5'Flank|CADPS2_ENST00000412584.2_Intron	NM_198085.1	NP_932351.1	Q8N7C7	RN148_HUMAN	ring finger protein 148	222						integral component of membrane (GO:0016021)	zinc ion binding (GO:0008270)			endometrium(2)|kidney(1)|large_intestine(6)|lung(7)	16						TCGCCTCCTGGTGAAAGAATT	0.418																																					p.T222N		Atlas-SNP	.											.	RNF148	71	.	0			c.C665A						.						83.0	77.0	79.0					7																	122342140		1921	4138	6059	SO:0001583	missense	378925	exon1			CTCCTGGTGAAAG	BC029264	CCDS47692.1	7q31.33	2013-01-09			ENSG00000235631	ENSG00000235631		"""RING-type (C3HC4) zinc fingers"""	22411	protein-coding gene	gene with protein product						8744354	Standard	NM_198085		Approved	MGC35222	uc003vkk.1	Q8N7C7	OTTHUMG00000157099	ENST00000434824.1:c.665C>A	chr7.hg19:g.122342140G>T	ENSP00000388207:p.Thr222Asn	34.0	0.0		107.0	26.0	NM_198085	A4D0X4|Q8N308	Missense_Mutation	SNP	ENST00000434824.1	hg19	CCDS47692.1	.	.	.	.	.	.	.	.	.	.	G	5.564	0.288948	0.10513	.	.	ENSG00000235631	ENST00000434824	T	0.04275	3.66	5.37	-0.286	0.12862	.	.	.	.	.	T	0.02230	0.0069	N	0.10874	0.06	0.28891	N	0.893848	B	0.02656	0.0	B	0.06405	0.002	T	0.46748	-0.9169	9	0.19147	T	0.46	.	3.7165	0.08439	0.0799:0.3417:0.3305:0.2479	.	222	Q8N7C7	RN148_HUMAN	N	222	ENSP00000388207:T222N	ENSP00000388207:T222N	T	-	2	0	RNF148	122129376	0.000000	0.05858	0.945000	0.38365	0.683000	0.39861	0.073000	0.14640	0.245000	0.21373	-0.310000	0.09108	ACC	.	.		0.418	RNF148-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347424.1	NM_198085	
ZNF467	168544	hgsc.bcm.edu	37	7	149463194	149463194	+	Missense_Mutation	SNP	C	C	T			TCGA-2Y-A9H9-01A-21D-A38X-10	TCGA-2Y-A9H9-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5586a43-bdc1-4030-93f8-cfb7bfa6a4b1	5ab2f233-e5fe-41df-9cef-56c0fdd900d3	g.chr7:149463194C>T	ENST00000302017.3	-	5	810	c.397G>A	c.(397-399)Gcg>Acg	p.A133T	ZNF467_ENST00000484747.1_Intron	NM_207336.1	NP_997219.1	Q7Z7K2	ZN467_HUMAN	zinc finger protein 467	133					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|kidney(1)|large_intestine(2)|liver(1)|lung(7)|urinary_tract(1)	13	Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			AGTTTGTACGCGGCAGCCAGA	0.662																																					p.A133T		Atlas-SNP	.											.	ZNF467	50	.	0			c.G397A						.						34.0	34.0	34.0					7																	149463194		2203	4300	6503	SO:0001583	missense	168544	exon5			TGTACGCGGCAGC	BC029296	CCDS5899.1	7q36.1	2013-01-08			ENSG00000181444	ENSG00000181444		"""Zinc fingers, C2H2-type"""	23154	protein-coding gene	gene with protein product		614040				12426389	Standard	NM_207336		Approved	EZI, Zfp467	uc003wgd.2	Q7Z7K2	OTTHUMG00000157883	ENST00000302017.3:c.397G>A	chr7.hg19:g.149463194C>T	ENSP00000304769:p.Ala133Thr	87.0	0.0		101.0	7.0	NM_207336		Missense_Mutation	SNP	ENST00000302017.3	hg19	CCDS5899.1	.	.	.	.	.	.	.	.	.	.	c	6.296	0.422643	0.11928	.	.	ENSG00000181444	ENST00000302017	T	0.07327	3.2	4.16	-2.73	0.05950	.	0.652197	0.11569	N	0.550983	T	0.03564	0.0102	N	0.17082	0.46	0.09310	N	1	B	0.09022	0.002	B	0.04013	0.001	T	0.46707	-0.9172	10	0.08599	T	0.76	-3.4854	5.0458	0.14483	0.1339:0.443:0.0:0.4231	.	133	Q7Z7K2	ZN467_HUMAN	T	133	ENSP00000304769:A133T	ENSP00000304769:A133T	A	-	1	0	ZNF467	149094127	0.000000	0.05858	0.000000	0.03702	0.582000	0.36321	-2.572000	0.00912	-0.816000	0.04340	0.298000	0.19748	GCG	.	.		0.662	ZNF467-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349833.1	NM_207336	
ADAM28	10863	hgsc.bcm.edu	37	8	24201031	24201031	+	Nonsense_Mutation	SNP	G	G	T			TCGA-2Y-A9H9-01A-21D-A38X-10	TCGA-2Y-A9H9-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5586a43-bdc1-4030-93f8-cfb7bfa6a4b1	5ab2f233-e5fe-41df-9cef-56c0fdd900d3	g.chr8:24201031G>T	ENST00000265769.4	+	18	2034	c.1924G>T	c.(1924-1926)Gag>Tag	p.E642*	RP11-624C23.1_ENST00000519689.1_RNA|RP11-624C23.1_ENST00000523700.1_RNA|RP11-624C23.1_ENST00000518988.1_RNA|ADAM28_ENST00000397649.3_Nonsense_Mutation_p.E389*|RP11-624C23.1_ENST00000523578.1_RNA	NM_014265.4	NP_055080.2	Q9UKQ2	ADA28_HUMAN	ADAM metallopeptidase domain 28	642	EGF-like. {ECO:0000255|PROSITE- ProRule:PRU00076}.				spermatogenesis (GO:0007283)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(10)|lung(7)|prostate(1)|skin(12)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	42		Prostate(55;0.0959)		Colorectal(74;0.0129)|COAD - Colon adenocarcinoma(73;0.0434)|BRCA - Breast invasive adenocarcinoma(99;0.175)		GTGTGACCATGAGCTCCAGTG	0.483																																					p.E642X	NSCLC(193;488 2149 22258 34798 40734)	Atlas-SNP	.											.	ADAM28	100	.	0			c.G1924T						.						189.0	147.0	161.0					8																	24201031		2203	4300	6503	SO:0001587	stop_gained	10863	exon18			GACCATGAGCTCC	AJ242015	CCDS34865.1, CCDS47830.1	8p21.2	2005-11-29	2005-08-18		ENSG00000042980	ENSG00000042980		"""ADAM metallopeptidase domain containing"""	206	protein-coding gene	gene with protein product		606188	"""a disintegrin and metalloproteinase domain 28"""				Standard	XM_005273378		Approved	eMDCII, MDC-Lm, MDC-Ls, ADAM23	uc003xdy.3	Q9UKQ2	OTTHUMG00000163780	ENST00000265769.4:c.1924G>T	chr8.hg19:g.24201031G>T	ENSP00000265769:p.Glu642*	57.0	0.0		58.0	42.0	NM_014265	B2RMV5|Q9Y339|Q9Y3S0	Nonsense_Mutation	SNP	ENST00000265769.4	hg19	CCDS34865.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	36|36	5.949562|5.949562	0.97134|0.97134	.|.	.|.	ENSG00000042980|ENSG00000042980	ENST00000265769;ENST00000397649|ENST00000521629;ENST00000518326	.|.	.|.	.|.	5.37|5.37	3.55|3.55	0.40652|0.40652	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	0.02654|.	T|.	1|.	.|.	9.3849|9.3849	0.38336|0.38336	0.1736:0.0:0.8264:0.0|0.1736:0.0:0.8264:0.0	.|.	.|.	.|.	.|.	X|L	642;389|274;67	.|.	ENSP00000265769:E642X|.	E|X	+|+	1|2	0|2	ADAM28|ADAM28	24256976|24256976	0.994000|0.994000	0.37717|0.37717	0.965000|0.965000	0.40720|0.40720	0.916000|0.916000	0.54674|0.54674	2.214000|2.214000	0.42853|0.42853	1.418000|1.418000	0.47098|0.47098	0.655000|0.655000	0.94253|0.94253	GAG|TGA	.	.		0.483	ADAM28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375441.2	NM_021778	
NRG1	3084	hgsc.bcm.edu	37	8	32616839	32616839	+	Missense_Mutation	SNP	A	A	C			TCGA-2Y-A9H9-01A-21D-A38X-10	TCGA-2Y-A9H9-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5586a43-bdc1-4030-93f8-cfb7bfa6a4b1	5ab2f233-e5fe-41df-9cef-56c0fdd900d3	g.chr8:32616839A>C	ENST00000405005.3	+	10	946	c.946A>C	c.(946-948)Aac>Cac	p.N316H	NRG1_ENST00000341377.5_3'UTR|NRG1_ENST00000521670.1_Missense_Mutation_p.N316H|NRG1_ENST00000287842.3_Missense_Mutation_p.N313H|NRG1_ENST00000539990.1_Missense_Mutation_p.N159H|NRG1_ENST00000356819.4_Missense_Mutation_p.N321H|NRG1_ENST00000519301.1_Missense_Mutation_p.N266H|NRG1_ENST00000523079.1_Missense_Mutation_p.N313H|NRG1_ENST00000287845.5_Missense_Mutation_p.N287H|NRG1_ENST00000338921.4_Missense_Mutation_p.N324H			Q02297	NRG1_HUMAN	neuregulin 1	316					activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|cardiac conduction system development (GO:0003161)|cardiac muscle cell differentiation (GO:0055007)|cardiac muscle cell myoblast differentiation (GO:0060379)|cell communication (GO:0007154)|cell migration (GO:0016477)|cell morphogenesis (GO:0000902)|cell proliferation (GO:0008283)|cellular protein complex disassembly (GO:0043624)|embryo development (GO:0009790)|endocardial cell differentiation (GO:0060956)|epidermal growth factor receptor signaling pathway (GO:0007173)|ERBB signaling pathway (GO:0038127)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glial cell fate commitment (GO:0021781)|innate immune response (GO:0045087)|locomotory behavior (GO:0007626)|mammary gland development (GO:0030879)|MAPK cascade (GO:0000165)|negative regulation of cardiac muscle cell apoptotic process (GO:0010667)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of secretion (GO:0051048)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|neural crest cell development (GO:0014032)|neuron fate commitment (GO:0048663)|neurotransmitter receptor metabolic process (GO:0045213)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peripheral nervous system development (GO:0007422)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell growth (GO:0030307)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of Ras protein signal transduction (GO:0046579)|positive regulation of striated muscle cell differentiation (GO:0051155)|regulation of protein heterodimerization activity (GO:0043497)|regulation of protein homodimerization activity (GO:0043496)|synapse assembly (GO:0007416)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|ventricular cardiac muscle cell differentiation (GO:0055012)|ventricular trabecula myocardium morphogenesis (GO:0003222)|wound healing (GO:0042060)	apical plasma membrane (GO:0016324)|axon (GO:0030424)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)	cytokine activity (GO:0005125)|ErbB-3 class receptor binding (GO:0043125)|growth factor activity (GO:0008083)|protein tyrosine kinase activator activity (GO:0030296)|receptor binding (GO:0005102)|receptor tyrosine kinase binding (GO:0030971)|transcription cofactor activity (GO:0003712)|transmembrane receptor protein tyrosine kinase activator activity (GO:0030297)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(18)|ovary(1)|prostate(1)|skin(1)	39		Breast(100;0.203)		KIRC - Kidney renal clear cell carcinoma(67;0.0768)|Kidney(114;0.0943)		CGTATCTAAAAACGTCATCTC	0.393																																					p.N321H		Atlas-SNP	.											.	NRG1	260	.	0			c.A961C						.						179.0	152.0	161.0					8																	32616839		2203	4300	6503	SO:0001583	missense	3084	exon11			TCTAAAAACGTCA	L12261	CCDS6084.1, CCDS6085.1, CCDS6086.1, CCDS6087.1, CCDS47836.1, CCDS55218.1, CCDS55219.1, CCDS75727.1	8p21-p12	2014-06-23			ENSG00000157168	ENSG00000157168		"""Immunoglobulin superfamily / I-set domain containing"""	7997	protein-coding gene	gene with protein product		142445	"""NRG1 intronic transcript 2 (non-protein coding)"""	HGL, NRG1-IT2		1350381, 8095334	Standard	NM_013962		Approved	HRG, NDF, GGF	uc003xiu.2	Q02297	OTTHUMG00000163918	ENST00000405005.3:c.946A>C	chr8.hg19:g.32616839A>C	ENSP00000384620:p.Asn316His	74.0	0.0		57.0	21.0	NM_013956	A5YAK4|A5YAK5|A8K1L2|B7Z4Z3|E9PHH4|O14667|P98202|Q02298|Q02299|Q07110|Q07111|Q12779|Q12780|Q12781|Q12782|Q12783|Q12784|Q15491|Q7RTV9|Q7RTW0|Q7RTW1|Q7RTW2|Q8NFN1|Q8NFN2|Q8NFN3|Q9UPE3	Missense_Mutation	SNP	ENST00000405005.3	hg19	CCDS6085.1	.	.	.	.	.	.	.	.	.	.	A	24.7	4.565394	0.86439	.	.	ENSG00000157168	ENST00000518104;ENST00000519301;ENST00000523534;ENST00000523079;ENST00000338921;ENST00000356819;ENST00000287840;ENST00000287845;ENST00000287842;ENST00000405005;ENST00000521670;ENST00000539990	T;T;T;T;T;T;T;T;T;T;T;T	0.61392	0.11;0.11;0.11;0.11;0.11;0.11;0.11;0.11;0.11;0.11;0.11;0.11	6.16	6.16	0.99307	Neuregulin 1-related, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.76118	0.3943	M	0.69823	2.125	0.58432	D	0.999999	D;D;D;D;D;D;D;D;D;D;D	0.89917	0.999;1.0;1.0;1.0;1.0;0.999;0.999;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D;D;D;D;D	0.97110	0.999;0.995;0.999;0.998;0.999;0.998;0.996;0.998;1.0;0.998;0.997	T	0.78303	-0.2256	10	0.87932	D	0	2.832	16.8061	0.85666	1.0:0.0:0.0:0.0	.	159;162;313;287;321;312;324;313;316;321;316	B7Z1E3;B7Z1D7;E9PHH4;F8W9E3;Q7RTW4;B0FYA9;Q02297-2;Q02297-7;Q02297;Q02297-6;Q02297-3	.;.;.;.;.;.;.;.;NRG1_HUMAN;.;.	H	283;266;389;313;324;321;316;287;313;316;316;159	ENSP00000430053:N283H;ENSP00000429582:N266H;ENSP00000429067:N389H;ENSP00000430120:N313H;ENSP00000343395:N324H;ENSP00000349275:N321H;ENSP00000287840:N316H;ENSP00000287845:N287H;ENSP00000287842:N313H;ENSP00000384620:N316H;ENSP00000428828:N316H;ENSP00000439276:N159H	ENSP00000287840:N316H	N	+	1	0	NRG1	32736381	1.000000	0.71417	1.000000	0.80357	0.866000	0.49608	8.594000	0.90836	2.367000	0.80283	0.528000	0.53228	AAC	.	.		0.393	NRG1-017	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000472504.1		
MOS	4342	hgsc.bcm.edu	37	8	57025864	57025864	+	Missense_Mutation	SNP	C	C	A			TCGA-2Y-A9H9-01A-21D-A38X-10	TCGA-2Y-A9H9-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5586a43-bdc1-4030-93f8-cfb7bfa6a4b1	5ab2f233-e5fe-41df-9cef-56c0fdd900d3	g.chr8:57025864C>A	ENST00000311923.1	-	1	677	c.678G>T	c.(676-678)ttG>ttT	p.L226F		NM_005372.1	NP_005363.1	P00540	MOS_HUMAN	v-mos Moloney murine sarcoma viral oncogene homolog	226	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|chromatin organization (GO:0006325)|establishment of meiotic spindle orientation (GO:0051296)|MAPK cascade (GO:0000165)|meiotic spindle organization (GO:0000212)|negative regulation of metaphase/anaphase transition of meiotic cell cycle (GO:1902103)|protein autophosphorylation (GO:0046777)|regulation of meiosis (GO:0040020)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|MAP kinase kinase kinase activity (GO:0004709)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(1)|large_intestine(5)|lung(12)|ovary(1)|urinary_tract(2)	22			Epithelial(17;0.00117)|all cancers(17;0.00879)			GCAGATCTTCCAACTTCTCAG	0.537																																					p.L226F	Esophageal Squamous(124;373 2870 4778)	Atlas-SNP	.											.	MOS	63	.	0			c.G678T						.						70.0	75.0	73.0					8																	57025864		2203	4300	6503	SO:0001583	missense	4342	exon1			ATCTTCCAACTTC		CCDS6164.1	8q11	2012-10-02			ENSG00000172680	ENSG00000172680			7199	protein-coding gene	gene with protein product		190060				9552420	Standard	NM_005372		Approved		uc011leb.2	P00540	OTTHUMG00000164299	ENST00000311923.1:c.678G>T	chr8.hg19:g.57025864C>A	ENSP00000310722:p.Leu226Phe	97.0	0.0		96.0	45.0	NM_005372	Q3KPG9|Q3KPH0	Missense_Mutation	SNP	ENST00000311923.1	hg19	CCDS6164.1	.	.	.	.	.	.	.	.	.	.	C	11.97	1.797781	0.31777	.	.	ENSG00000172680	ENST00000311923	T	0.66815	-0.23	5.8	-1.31	0.09230	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.086238	0.47852	D	0.000202	T	0.66925	0.2839	L	0.45285	1.41	0.32530	N	0.535079	D	0.76494	0.999	D	0.81914	0.995	T	0.67325	-0.5699	10	0.87932	D	0	.	3.1329	0.06429	0.1108:0.4293:0.1093:0.3506	.	226	P00540	MOS_HUMAN	F	226	ENSP00000310722:L226F	ENSP00000310722:L226F	L	-	3	2	MOS	57188418	0.686000	0.27661	0.006000	0.13384	0.204000	0.24138	0.205000	0.17356	-0.124000	0.11724	0.561000	0.74099	TTG	.	.		0.537	MOS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378174.1	NM_005372	
NCOA2	10499	hgsc.bcm.edu	37	8	71037078	71037078	+	Silent	SNP	T	T	C			TCGA-2Y-A9H9-01A-21D-A38X-10	TCGA-2Y-A9H9-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5586a43-bdc1-4030-93f8-cfb7bfa6a4b1	5ab2f233-e5fe-41df-9cef-56c0fdd900d3	g.chr8:71037078T>C	ENST00000452400.2	-	20	4120	c.3939A>G	c.(3937-3939)ccA>ccG	p.P1313P	NCOA2_ENST00000267974.4_Silent_p.P401P	NM_006540.2	NP_006531.1	Q15596	NCOA2_HUMAN	nuclear receptor coactivator 2	1313					cellular lipid metabolic process (GO:0044255)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of glucose metabolic process (GO:0010906)|regulation of transcription, DNA-templated (GO:0006355)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	chromatin binding (GO:0003682)|histone acetyltransferase activity (GO:0004402)|ligand-dependent nuclear receptor binding (GO:0016922)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nuclear hormone receptor binding (GO:0035257)|signal transducer activity (GO:0004871)|thyroid hormone receptor coactivator activity (GO:0030375)|transcription coactivator activity (GO:0003713)		PAX3/NCOA2(4)|HEY1/NCOA2(10)	NS(1)|breast(4)|endometrium(7)|kidney(4)|large_intestine(10)|lung(25)|ovary(1)|pancreas(2)|prostate(2)|skin(4)	60	Breast(64;0.201)		Epithelial(68;0.0147)|OV - Ovarian serous cystadenocarcinoma(28;0.0455)|all cancers(69;0.0606)			CAGTAAAGCCTGGATCAGGTT	0.468			T	"""RUNXBP2, HEY1"""	"""AML, Chondrosarcoma"""																																p.P1313P		Atlas-SNP	.		Dom	yes		8	8q13.1	10499	nuclear receptor coactivator 2 (TIF2)		L	.	NCOA2	147	.	0			c.A3939G						.						94.0	97.0	96.0					8																	71037078		1894	4145	6039	SO:0001819	synonymous_variant	10499	exon20			AAAGCCTGGATCA	X97674	CCDS47872.1	8q13.3	2011-07-01			ENSG00000140396	ENSG00000140396		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Basic helix-loop-helix proteins"""	7669	protein-coding gene	gene with protein product		601993				9111344, 8670870	Standard	XM_005251128		Approved	TIF2, GRIP1, NCoA-2, KAT13C, bHLHe75	uc003xyn.1	Q15596	OTTHUMG00000164671	ENST00000452400.2:c.3939A>G	chr8.hg19:g.71037078T>C		54.0	0.0		135.0	87.0	NM_006540	Q14CD2	Silent	SNP	ENST00000452400.2	hg19	CCDS47872.1	.	.	.	.	.	.	.	.	.	.	T	10.30	1.312159	0.23821	.	.	ENSG00000140396	ENST00000518363	.	.	.	5.82	-2.18	0.07037	.	.	.	.	.	T	0.40119	0.1104	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.30119	-0.9989	4	.	.	.	.	2.3671	0.04322	0.2834:0.0643:0.2227:0.4295	.	.	.	.	R	414	.	.	Q	-	2	0	NCOA2	71199632	1.000000	0.71417	0.996000	0.52242	0.997000	0.91878	0.559000	0.23485	-0.236000	0.09753	0.533000	0.62120	CAG	.	.		0.468	NCOA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379696.1		
DCAF4L2	138009	hgsc.bcm.edu	37	8	88885352	88885352	+	Missense_Mutation	SNP	T	T	A			TCGA-2Y-A9H9-01A-21D-A38X-10	TCGA-2Y-A9H9-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5586a43-bdc1-4030-93f8-cfb7bfa6a4b1	5ab2f233-e5fe-41df-9cef-56c0fdd900d3	g.chr8:88885352T>A	ENST00000319675.3	-	1	944	c.848A>T	c.(847-849)cAa>cTa	p.Q283L		NM_152418.3	NP_689631.1	Q8NA75	DC4L2_HUMAN	DDB1 and CUL4 associated factor 4-like 2	283										breast(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(19)|liver(2)|lung(40)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	83						CACCAGGAATTGGCCATCTTG	0.502																																					p.Q283L		Atlas-SNP	.											.	DCAF4L2	187	.	0			c.A848T						.						97.0	88.0	91.0					8																	88885352		2203	4300	6503	SO:0001583	missense	138009	exon1			AGGAATTGGCCAT	AL833507	CCDS6245.1	8q21.3	2013-01-09	2009-07-17	2009-07-17		ENSG00000176566		"""WD repeat domain containing"""	26657	protein-coding gene	gene with protein product			"""WD repeat domain 21C"""	WDR21C		14702039	Standard	NM_152418		Approved		uc003ydz.3	Q8NA75		ENST00000319675.3:c.848A>T	chr8.hg19:g.88885352T>A	ENSP00000316496:p.Gln283Leu	100.0	0.0		120.0	40.0	NM_152418		Missense_Mutation	SNP	ENST00000319675.3	hg19	CCDS6245.1	.	.	.	.	.	.	.	.	.	.	T	11.75	1.731188	0.30684	.	.	ENSG00000176566	ENST00000319675	T	0.24350	1.86	1.39	1.39	0.22231	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.352041	0.33005	N	0.005384	T	0.18173	0.0436	L	0.33710	1.025	0.33177	D	0.549095	B	0.31256	0.316	B	0.35655	0.207	T	0.16512	-1.0400	10	0.45353	T	0.12	.	6.5295	0.22320	0.0:0.0:0.0:1.0	.	283	Q8NA75	DC4L2_HUMAN	L	283	ENSP00000316496:Q283L	ENSP00000316496:Q283L	Q	-	2	0	DCAF4L2	88954468	1.000000	0.71417	0.007000	0.13788	0.007000	0.05969	3.481000	0.53179	0.627000	0.30340	0.383000	0.25322	CAA	.	.		0.502	DCAF4L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375302.1	NM_152418	
CSMD3	114788	hgsc.bcm.edu	37	8	113301671	113301671	+	Missense_Mutation	SNP	T	T	C			TCGA-2Y-A9H9-01A-21D-A38X-10	TCGA-2Y-A9H9-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5586a43-bdc1-4030-93f8-cfb7bfa6a4b1	5ab2f233-e5fe-41df-9cef-56c0fdd900d3	g.chr8:113301671T>C	ENST00000297405.5	-	57	9315	c.9071A>G	c.(9070-9072)aAg>aGg	p.K3024R	CSMD3_ENST00000455883.2_Missense_Mutation_p.K2855R|CSMD3_ENST00000352409.3_Missense_Mutation_p.K2954R|CSMD3_ENST00000343508.3_Missense_Mutation_p.K2984R	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	3024	Sushi 21. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						AAGGGAACGCTTTCCTGTGCA	0.473										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																											p.K3024R		Atlas-SNP	.											.	CSMD3	2325	.	0			c.A9071G						.						117.0	105.0	109.0					8																	113301671		2203	4300	6503	SO:0001583	missense	114788	exon57			GAACGCTTTCCTG	AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.9071A>G	chr8.hg19:g.113301671T>C	ENSP00000297405:p.Lys3024Arg	62.0	0.0		102.0	40.0	NM_198123	Q96PZ3	Missense_Mutation	SNP	ENST00000297405.5	hg19	CCDS6315.1	.	.	.	.	.	.	.	.	.	.	T	13.17	2.156250	0.38021	.	.	ENSG00000164796	ENST00000343508;ENST00000297405;ENST00000339701;ENST00000455883;ENST00000352409	T;T;T;T;T	0.64085	-0.08;-0.08;-0.08;-0.08;-0.08	6.17	3.83	0.44106	Complement control module (2);Sushi/SCR/CCP (3);	0.417853	0.24525	N	0.037775	T	0.37320	0.0999	N	0.10760	0.04	0.29226	N	0.873632	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.001;0.001;0.001	T	0.25433	-1.0132	10	0.54805	T	0.06	.	5.5656	0.17168	0.0:0.3437:0.0:0.6563	.	2855;3024;2984	Q7Z407-3;Q7Z407;Q7Z407-2	.;CSMD3_HUMAN;.	R	2984;3024;2294;2855;2954	ENSP00000345799:K2984R;ENSP00000297405:K3024R;ENSP00000341558:K2294R;ENSP00000412263:K2855R;ENSP00000343124:K2954R	ENSP00000297405:K3024R	K	-	2	0	CSMD3	113370847	0.984000	0.35163	1.000000	0.80357	0.994000	0.84299	2.589000	0.46145	1.149000	0.42402	0.533000	0.62120	AAG	.	.		0.473	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347141.1	NM_052900	
CNTLN	54875	hgsc.bcm.edu	37	9	17394651	17394651	+	Silent	SNP	A	A	G			TCGA-2Y-A9H9-01A-21D-A38X-10	TCGA-2Y-A9H9-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5586a43-bdc1-4030-93f8-cfb7bfa6a4b1	5ab2f233-e5fe-41df-9cef-56c0fdd900d3	g.chr9:17394651A>G	ENST00000380647.3	+	15	2283	c.2199A>G	c.(2197-2199)caA>caG	p.Q733Q	CNTLN_ENST00000262360.5_Silent_p.Q733Q|CNTLN_ENST00000425824.1_Silent_p.Q733Q			Q9NXG0	CNTLN_HUMAN	centlein, centrosomal protein	733					centriole-centriole cohesion (GO:0010457)|protein localization to organelle (GO:0033365)	centriole (GO:0005814)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	phosphorelay sensor kinase activity (GO:0000155)|protein binding, bridging (GO:0030674)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)			breast(6)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(5)|kidney(3)|large_intestine(10)|lung(17)|ovary(1)|pancreas(1)|prostate(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	53				GBM - Glioblastoma multiforme(50;6.14e-10)		AACAGCAACAAGAAGATACAG	0.313																																					p.Q733Q		Atlas-SNP	.											.	CNTLN	128	.	0			c.A2199G						.						66.0	61.0	63.0					9																	17394651		1798	4071	5869	SO:0001819	synonymous_variant	54875	exon15			GCAACAAGAAGAT	AK000283	CCDS43789.1, CCDS47953.1	9p22.2-p22.1	2008-11-11	2008-02-08	2008-02-08	ENSG00000044459	ENSG00000044459			23432	protein-coding gene	gene with protein product		611870	"""chromosome 9 open reading frame 101"", ""chromosome 9 open reading frame 39"""	C9orf101, C9orf39		18086554	Standard	XM_005251492		Approved	FLJ20276, bA340N12.1, OTTHUMG00000019597	uc003zmy.3	Q9NXG0	OTTHUMG00000019599	ENST00000380647.3:c.2199A>G	chr9.hg19:g.17394651A>G		244.0	0.0		392.0	163.0	NM_017738	A5Z2X6|Q5VYJ0|Q8N1G9|Q9HAJ5	Silent	SNP	ENST00000380647.3	hg19	CCDS43789.1																																																																																			.	.		0.313	CNTLN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000051793.3	NM_017738	
NPR2	4882	hgsc.bcm.edu	37	9	35811469	35811469	+	IGR	SNP	G	G	A	rs571991371		TCGA-2Y-A9H9-01A-21D-A38X-10	TCGA-2Y-A9H9-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5586a43-bdc1-4030-93f8-cfb7bfa6a4b1	5ab2f233-e5fe-41df-9cef-56c0fdd900d3	g.chr9:35811469G>A	ENST00000342694.2	+	0	3686				SPAG8_ENST00000484764.1_Missense_Mutation_p.H190Y|HINT2_ENST00000474908.1_5'Flank|SPAG8_ENST00000340291.2_Missense_Mutation_p.H192Y|TMEM8B_ENST00000377996.1_5'Flank|SPAG8_ENST00000479751.1_5'Flank|SPAG8_ENST00000396638.2_Missense_Mutation_p.H192Y|AL133410.1_ENST00000582432.1_RNA	NM_003995.3	NP_003986.2	P20594	ANPRB_HUMAN	natriuretic peptide receptor 2						bone development (GO:0060348)|cell surface receptor signaling pathway (GO:0007166)|cellular response to granulocyte macrophage colony-stimulating factor stimulus (GO:0097011)|cGMP biosynthetic process (GO:0006182)|intracellular signal transduction (GO:0035556)|negative regulation of meiotic cell cycle (GO:0051447)|negative regulation of oocyte maturation (GO:1900194)|ossification (GO:0001503)|receptor guanylyl cyclase signaling pathway (GO:0007168)|regulation of blood pressure (GO:0008217)|signal transduction (GO:0007165)|single organism reproductive process (GO:0044702)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|hormone binding (GO:0042562)|natriuretic peptide receptor activity (GO:0016941)|peptide hormone binding (GO:0017046)|protein kinase activity (GO:0004672)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(14)|ovary(2)|prostate(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	45	all_epithelial(49;0.161)		LUSC - Lung squamous cell carcinoma(32;0.00521)|Lung(28;0.00697)|STAD - Stomach adenocarcinoma(86;0.194)		Erythrityl Tetranitrate(DB01613)|Nesiritide(DB04899)	GGACCAGGATGagagccagag	0.632																																					p.H192Y		Atlas-SNP	.											.	SPAG8	67	.	0			c.C574T						.						50.0	47.0	48.0					9																	35811469		2203	4300	6503	SO:0001628	intergenic_variant	26206	exon2			CAGGATGAGAGCC	AJ005282	CCDS6590.1	9p21-p12	2014-03-03	2014-03-03		ENSG00000159899	ENSG00000159899			7944	protein-coding gene	gene with protein product	"""guanylate cyclase B"""	108961	"""acromesomelic dysplasia, Maroteaux type"", ""atrionatriuretic peptide receptor B"", ""natriuretic peptide receptor B"""	ANPRB, NPRB, AMDM		9634515, 15146390	Standard	XM_005251478		Approved	GUCY2B, ANPb	uc003zyd.3	P20594	OTTHUMG00000019871		chr9.hg19:g.35811469G>A		30.0	0.0		44.0	20.0	NM_001039592	B0ZBF2|B0ZBF3|D3DRP3|D3DRP4|O60871|Q4VAK7|Q5TCV2|Q8TA93|Q9UQ50	Missense_Mutation	SNP	ENST00000342694.2	hg19	CCDS6590.1	.	.	.	.	.	.	.	.	.	.	G	8.669	0.902302	0.17760	.	.	ENSG00000137098	ENST00000340291;ENST00000484764;ENST00000396638	T;T;T	0.41758	0.99;0.99;0.99	4.21	1.29	0.21616	.	1.201680	0.05881	N	0.626454	T	0.23806	0.0576	N	0.08118	0	0.09310	N	1	B;B	0.30455	0.28;0.28	B;B	0.31495	0.131;0.131	T	0.27088	-1.0084	10	0.51188	T	0.08	0.133	4.7488	0.13050	0.0:0.5941:0.1915:0.2144	.	192;192	E9PDV6;Q99932-2	.;.	Y	192;190;192	ENSP00000340982:H192Y;ENSP00000418072:H190Y;ENSP00000379878:H192Y	ENSP00000340982:H192Y	H	-	1	0	SPAG8	35801469	0.096000	0.21769	0.000000	0.03702	0.021000	0.10359	0.744000	0.26245	0.134000	0.18681	-0.165000	0.13383	CAT	.	.		0.632	NPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052345.1		
PRUNE2	158471	hgsc.bcm.edu	37	9	79324435	79324435	+	Missense_Mutation	SNP	A	A	G			TCGA-2Y-A9H9-01A-21D-A38X-10	TCGA-2Y-A9H9-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5586a43-bdc1-4030-93f8-cfb7bfa6a4b1	5ab2f233-e5fe-41df-9cef-56c0fdd900d3	g.chr9:79324435A>G	ENST00000376718.3	-	8	2878	c.2755T>C	c.(2755-2757)Tgg>Cgg	p.W919R	PRUNE2_ENST00000428286.1_Missense_Mutation_p.W560R	NM_015225.2	NP_056040.2	Q8WUY3	PRUN2_HUMAN	prune homolog 2 (Drosophila)	919					apoptotic process (GO:0006915)	cytoplasm (GO:0005737)	metal ion binding (GO:0046872)|pyrophosphatase activity (GO:0016462)			endometrium(1)|kidney(4)|large_intestine(3)|lung(7)|prostate(1)	16						AAAAGGTTCCAGGAATCTACC	0.398																																					p.W919R		Atlas-SNP	.											.	PRUNE2	331	.	0			c.T2755C						.						229.0	215.0	219.0					9																	79324435		1568	3582	5150	SO:0001583	missense	158471	exon8			GGTTCCAGGAATC	BC019095	CCDS47982.1	9q21.32	2013-04-29	2006-11-24	2006-11-24	ENSG00000106772	ENSG00000106772			25209	protein-coding gene	gene with protein product	"""olfaxin"""	610691	"""chromosome 9 open reading frame 65"", ""KIAA0367"""	C9orf65, KIAA0367		16288218	Standard	NM_015225		Approved	BMCC1, BNIPXL, A214N16.3, bA214N16.3	uc010mpk.3	Q8WUY3	OTTHUMG00000020047	ENST00000376718.3:c.2755T>C	chr9.hg19:g.79324435A>G	ENSP00000365908:p.Trp919Arg	117.0	0.0		80.0	20.0	NM_015225	B3KYC4|B4DQH8|O15073|Q58A63|Q5JUB6|Q5T304|Q5T476|Q6T2V6|Q6T2V7|Q8N665	Missense_Mutation	SNP	ENST00000376718.3	hg19	CCDS47982.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	14.07|14.07	2.425229|2.425229	0.43020|0.43020	.|.	.|.	ENSG00000106772|ENSG00000106772	ENST00000426088|ENST00000376718;ENST00000428286;ENST00000422033	.|T;T	.|0.74526	.|-0.82;-0.85	5.83|5.83	5.83|5.83	0.93111|0.93111	.|.	.|0.000000	.|0.47852	.|D	.|0.000204	T|T	0.80803|0.80803	0.4693|0.4693	L|L	0.34521|0.34521	1.04|1.04	0.80722|0.80722	D|D	1|1	.|D	.|0.89917	.|1.0	.|D	.|0.87578	.|0.998	T|T	0.82991|0.82991	-0.0182|-0.0182	5|10	.|0.87932	.|D	.|0	-6.1607|-6.1607	16.1922|16.1922	0.82000|0.82000	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|919	.|Q8WUY3	.|PRUN2_HUMAN	P|R	240|919;560;918	.|ENSP00000365908:W919R;ENSP00000397425:W560R	.|ENSP00000365908:W919R	L|W	-|-	2|1	0|0	PRUNE2|PRUNE2	78514255|78514255	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.526000|0.526000	0.34562|0.34562	6.414000|6.414000	0.73318|0.73318	2.226000|2.226000	0.72624|0.72624	0.459000|0.459000	0.35465|0.35465	CTG|TGG	.	.		0.398	PRUNE2-003	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052730.2	NM_138818	
TLE1	7088	hgsc.bcm.edu	37	9	84235385	84235385	+	Missense_Mutation	SNP	T	T	C			TCGA-2Y-A9H9-01A-21D-A38X-10	TCGA-2Y-A9H9-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5586a43-bdc1-4030-93f8-cfb7bfa6a4b1	5ab2f233-e5fe-41df-9cef-56c0fdd900d3	g.chr9:84235385T>C	ENST00000376499.3	-	9	1746	c.682A>G	c.(682-684)Aag>Gag	p.K228E	TLE1_ENST00000464999.1_5'UTR|TLE1_ENST00000376472.1_5'UTR	NM_005077.3	NP_005068.2	Q04724	TLE1_HUMAN	transducin-like enhancer of split 1 (E(sp1) homolog, Drosophila)	228	CCN domain.				multicellular organismal development (GO:0007275)|negative regulation of anoikis (GO:2000811)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of Wnt signaling pathway (GO:0030178)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|positive regulation of gene expression (GO:0010628)|signal transduction (GO:0007165)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|identical protein binding (GO:0042802)|RNA polymerase II transcription corepressor activity (GO:0001106)|transcription factor binding (GO:0008134)			NS(1)|endometrium(5)|kidney(2)|large_intestine(2)|lung(11)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	29						TCATCCACCTTCCTTTTCTTG	0.388																																					p.K228E	NSCLC(155;1437 1995 30668 39354 45875)|Melanoma(16;266 781 14000 47728 51870)	Atlas-SNP	.											.	TLE1	81	.	0			c.A682G						.						185.0	161.0	170.0					9																	84235385		2203	4300	6503	SO:0001583	missense	7088	exon9			CCACCTTCCTTTT		CCDS6661.1	9q21.32	2013-01-10	2001-11-28		ENSG00000196781	ENSG00000196781		"""WD repeat domain containing"""	11837	protein-coding gene	gene with protein product	"""enhancer of split groucho 1"""	600189	"""transducin-like enhancer of split 1, homolog of Drosophila E(sp1)"""			8365415, 8808280	Standard	NM_005077		Approved	ESG1, GRG1, ESG	uc004aly.3	Q04724	OTTHUMG00000021008	ENST00000376499.3:c.682A>G	chr9.hg19:g.84235385T>C	ENSP00000365682:p.Lys228Glu	105.0	0.0		97.0	5.0	NM_005077	A8K495|Q5T3G4|Q969V9	Missense_Mutation	SNP	ENST00000376499.3	hg19	CCDS6661.1	.	.	.	.	.	.	.	.	.	.	T	27.4	4.830039	0.91036	.	.	ENSG00000196781	ENST00000376499;ENST00000355002;ENST00000418319	T;T	0.59224	0.28;0.92	5.91	5.91	0.95273	.	0.000000	0.85682	D	0.000000	T	0.75466	0.3853	M	0.86420	2.815	0.80722	D	1	P;P;P;B;P	0.43885	0.713;0.745;0.82;0.39;0.745	P;P;P;B;B	0.54815	0.761;0.493;0.576;0.054;0.41	T	0.76075	-0.3092	10	0.35671	T	0.21	-20.0721	16.3514	0.83213	0.0:0.0:0.0:1.0	.	154;228;255;238;228	B4E345;B4DEF9;Q59EF7;Q5T3G3;Q04724	.;.;.;.;TLE1_HUMAN	E	228;238;238	ENSP00000365682:K228E;ENSP00000391347:K238E	ENSP00000347102:K238E	K	-	1	0	TLE1	83425205	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.004000	0.88535	2.252000	0.74401	0.533000	0.62120	AAG	.	.		0.388	TLE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055407.1	NM_005077	
CYLC2	1539	hgsc.bcm.edu	37	9	105767525	105767525	+	Silent	SNP	A	A	T			TCGA-2Y-A9H9-01A-21D-A38X-10	TCGA-2Y-A9H9-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5586a43-bdc1-4030-93f8-cfb7bfa6a4b1	5ab2f233-e5fe-41df-9cef-56c0fdd900d3	g.chr9:105767525A>T	ENST00000374798.3	+	5	682	c.612A>T	c.(610-612)acA>acT	p.T204T	CYLC2_ENST00000487798.1_Silent_p.T204T	NM_001340.3	NP_001331.1	Q14093	CYLC2_HUMAN	cylicin, basic protein of sperm head cytoskeleton 2	204	3 X approximate tandem repeats.|31 X 3 AA repeats of K-K-X.				cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	structural constituent of cytoskeleton (GO:0005200)			NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(14)|ovary(1)|skin(5)|stomach(5)|upper_aerodigestive_tract(2)	41		all_hematologic(171;0.125)				ACTCGGCAACAGAATCTGAAG	0.368																																					p.T204T		Atlas-SNP	.											.	CYLC2	109	.	0			c.A612T						.						80.0	78.0	79.0					9																	105767525		2203	4300	6503	SO:0001819	synonymous_variant	1539	exon5			GGCAACAGAATCT	Z46788	CCDS35085.1	9q31.2	2008-07-21			ENSG00000155833	ENSG00000155833			2583	protein-coding gene	gene with protein product		604035				7737358	Standard	NM_001340		Approved		uc004bbs.2	Q14093	OTTHUMG00000020396	ENST00000374798.3:c.612A>T	chr9.hg19:g.105767525A>T		298.0	0.0		190.0	141.0	NM_001340	B2R8F4|Q5VVJ9	Silent	SNP	ENST00000374798.3	hg19	CCDS35085.1																																																																																			.	.		0.368	CYLC2-001	KNOWN	alternative_3_UTR|NMD_exception|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000053463.3	NM_001340	
RBM18	92400	hgsc.bcm.edu	37	9	125007619	125007619	+	Splice_Site	SNP	C	C	A	rs149650476		TCGA-2Y-A9H9-01A-21D-A38X-10	TCGA-2Y-A9H9-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5586a43-bdc1-4030-93f8-cfb7bfa6a4b1	5ab2f233-e5fe-41df-9cef-56c0fdd900d3	g.chr9:125007619C>A	ENST00000417201.3	-	5	469	c.329G>T	c.(328-330)aGa>aTa	p.R110I	RBM18_ENST00000483428.1_5'UTR	NM_033117.3	NP_149108.1	Q96H35	RBM18_HUMAN	RNA binding motif protein 18	110							nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(3)	7						ATGATCATATCTCTGAAAATG	0.388																																					p.R110I		Atlas-SNP	.											.	RBM18	15	.	0			c.G329T						.						119.0	117.0	118.0					9																	125007619		2203	4300	6503	SO:0001630	splice_region_variant	92400	exon5			TCATATCTCTGAA	AK057676	CCDS6839.1	9q34.11	2013-02-12			ENSG00000119446	ENSG00000119446		"""RNA binding motif (RRM) containing"""	28413	protein-coding gene	gene with protein product						12477932	Standard	NM_033117		Approved	MGC2734	uc004bma.2	Q96H35	OTTHUMG00000020602	ENST00000417201.3:c.328-1G>T	chr9.hg19:g.125007619C>A		31.0	0.0		22.0	13.0	NM_033117	B3KQ89	Missense_Mutation	SNP	ENST00000417201.3	hg19	CCDS6839.1	.	.	.	.	.	.	.	.	.	.	C	20.7	4.037796	0.75617	.	.	ENSG00000119446	ENST00000417201	T	0.36878	1.23	5.57	5.57	0.84162	Nucleotide-binding, alpha-beta plait (1);	0.040141	0.85682	D	0.000000	T	0.36717	0.0977	L	0.51422	1.61	0.80722	D	1	P	0.39551	0.678	B	0.36335	0.222	T	0.26985	-1.0087	10	0.59425	D	0.04	-13.9192	18.5452	0.91043	0.0:1.0:0.0:0.0	.	110	Q96H35	RBM18_HUMAN	I	110	ENSP00000409315:R110I	ENSP00000409315:R110I	R	-	2	0	RBM18	124047440	1.000000	0.71417	0.991000	0.47740	0.961000	0.63080	6.161000	0.71868	2.630000	0.89119	0.655000	0.94253	AGA	.	C|1.000;T|0.000		0.388	RBM18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053928.2	NM_033117	Missense_Mutation
NEK6	10783	hgsc.bcm.edu	37	9	127089633	127089633	+	Silent	SNP	C	C	T	rs553709380		TCGA-2Y-A9H9-01A-21D-A38X-10	TCGA-2Y-A9H9-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5586a43-bdc1-4030-93f8-cfb7bfa6a4b1	5ab2f233-e5fe-41df-9cef-56c0fdd900d3	g.chr9:127089633C>T	ENST00000320246.5	+	7	676	c.531C>T	c.(529-531)aaC>aaT	p.N177N	NEK6_ENST00000394199.2_Silent_p.N211N|NEK6_ENST00000539416.1_Silent_p.N202N|NEK6_ENST00000373603.1_Silent_p.N177N|NEK6_ENST00000373600.3_Silent_p.N211N|NEK6_ENST00000540326.1_Silent_p.N195N|NEK6_ENST00000546191.1_Silent_p.N177N|NEK6_ENST00000545174.1_Silent_p.N177N	NM_014397.5	NP_055212.2	Q9HC98	NEK6_HUMAN	NIMA-related kinase 6	177	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic process (GO:0006915)|chromosome segregation (GO:0007059)|cytokinesis (GO:0000910)|G2 DNA damage checkpoint (GO:0031572)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic nuclear envelope disassembly (GO:0007077)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of cellular senescence (GO:2000772)|regulation of mitotic cell cycle (GO:0007346)|regulation of mitotic metaphase/anaphase transition (GO:0030071)|signal transduction (GO:0007165)|spindle assembly (GO:0051225)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|microtubule (GO:0005874)|nucleus (GO:0005634)	ATP binding (GO:0005524)|kinesin binding (GO:0019894)|magnesium ion binding (GO:0000287)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)|signal transducer activity (GO:0004871)			endometrium(1)|kidney(1)|large_intestine(4)|lung(4)|ovary(2)|prostate(1)|skin(1)|stomach(1)	15						AGCCTGCCAACGTGTTCATCA	0.627																																					p.N211N	NSCLC(122;934 1785 18647 44295 45571)	Atlas-SNP	.											.	NEK6	47	.	0			c.C633T						.						260.0	231.0	241.0					9																	127089633		2203	4300	6503	SO:0001819	synonymous_variant	10783	exon8			TGCCAACGTGTTC	AF087909	CCDS6854.1, CCDS48015.1, CCDS55338.1, CCDS55339.1	9q33.3-q34.11	2012-11-15	2012-11-15		ENSG00000119408	ENSG00000119408			7749	protein-coding gene	gene with protein product	"""putative serine-threonine protein kinase"""	604884	"""NIMA (never in mitosis gene a)-related kinase 6"""			10702691	Standard	NM_001145001		Approved	SID6-1512	uc004boh.3	Q9HC98	OTTHUMG00000020650	ENST00000320246.5:c.531C>T	chr9.hg19:g.127089633C>T		59.0	0.0		28.0	24.0	NM_001166171	B7Z2D9|Q5TBG3|Q5TBG9|Q6FG86|Q6IAR3|Q96E83|Q9ULX2	Silent	SNP	ENST00000320246.5	hg19	CCDS6854.1																																																																																			.	.		0.627	NEK6-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054016.1	NM_014397	
TYSND1	219743	hgsc.bcm.edu	37	10	71905794	71905794	+	Silent	SNP	G	G	C			TCGA-2Y-A9H9-01A-21D-A38X-10	TCGA-2Y-A9H9-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5586a43-bdc1-4030-93f8-cfb7bfa6a4b1	5ab2f233-e5fe-41df-9cef-56c0fdd900d3	g.chr10:71905794G>C	ENST00000287078.6	-	1	548	c.549C>G	c.(547-549)ggC>ggG	p.G183G	TYSND1_ENST00000335494.5_Silent_p.G183G|TYSND1_ENST00000494143.1_5'Flank	NM_173555.2	NP_775826.2	Q2T9J0	TYSD1_HUMAN	trypsin domain containing 1	183					protein homooligomerization (GO:0051260)|protein processing (GO:0016485)|proteolysis (GO:0006508)|regulation of fatty acid beta-oxidation (GO:0031998)	membrane (GO:0016020)|peroxisome (GO:0005777)	identical protein binding (GO:0042802)|protease binding (GO:0002020)|serine-type endopeptidase activity (GO:0004252)			endometrium(2)|large_intestine(2)|liver(1)|lung(3)|prostate(1)	9						GCGCAAACCAGCCCAGCGCTC	0.701																																					p.G183G		Atlas-SNP	.											.	TYSND1	20	.	0			c.C549G						.						25.0	26.0	25.0					10																	71905794		2197	4289	6486	SO:0001819	synonymous_variant	219743	exon1			AAACCAGCCCAGC	BC016840	CCDS31213.1, CCDS31214.1	10q22.1	2009-11-06		2006-09-21	ENSG00000156521	ENSG00000156521			28531	protein-coding gene	gene with protein product		611017				17255948	Standard	NM_173555		Approved	MGC34695, NET41	uc001jqr.4	Q2T9J0	OTTHUMG00000018397	ENST00000287078.6:c.549C>G	chr10.hg19:g.71905794G>C		112.0	0.0		118.0	54.0	NM_173555	Q5SQT4|Q5SQU1|Q8N6H2|Q96AR5	Silent	SNP	ENST00000287078.6	hg19	CCDS31213.1																																																																																			.	.		0.701	TYSND1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048483.1	NM_173555	
INPP5F	22876	hgsc.bcm.edu	37	10	121571371	121571371	+	Missense_Mutation	SNP	A	A	C			TCGA-2Y-A9H9-01A-21D-A38X-10	TCGA-2Y-A9H9-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5586a43-bdc1-4030-93f8-cfb7bfa6a4b1	5ab2f233-e5fe-41df-9cef-56c0fdd900d3	g.chr10:121571371A>C	ENST00000361976.2	+	15	1956	c.1790A>C	c.(1789-1791)gAa>gCa	p.E597A		NM_014937.3	NP_055752.1	Q01968	OCRL_HUMAN	inositol polyphosphate-5-phosphatase F	0	ASH.				cilium assembly (GO:0042384)|in utero embryonic development (GO:0001701)|inositol phosphate metabolic process (GO:0043647)|lipid metabolic process (GO:0006629)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|positive regulation of Rac GTPase activity (GO:0032855)|regulation of Rac GTPase activity (GO:0032314)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|extracellular vesicular exosome (GO:0070062)|Golgi stack (GO:0005795)|Golgi-associated vesicle (GO:0005798)|nucleus (GO:0005634)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	inositol phosphate phosphatase activity (GO:0052745)|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity (GO:0004439)|Rac GTPase activator activity (GO:0030675)|Rac GTPase binding (GO:0048365)			breast(1)|cervix(1)|endometrium(7)|kidney(4)|large_intestine(9)|lung(5)|ovary(5)|pancreas(1)|prostate(1)|skin(1)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	42		Lung NSC(174;0.109)|all_lung(145;0.142)		all cancers(201;0.00205)|BRCA - Breast invasive adenocarcinoma(275;0.158)		AGCCACCAGGAACTAATTAGC	0.433																																					p.E597A		Atlas-SNP	.											.	INPP5F	112	.	0			c.A1790C						.						119.0	129.0	125.0					10																	121571371		2203	4300	6503	SO:0001583	missense	22876	exon15			ACCAGGAACTAAT	AB023183	CCDS7616.1, CCDS58098.1	10q26.13	2009-02-03			ENSG00000198825	ENSG00000198825			17054	protein-coding gene	gene with protein product		609389				10231032, 11274189	Standard	NM_014937		Approved	SAC2, KIAA0966, hSac2	uc001leo.3	Q9Y2H2	OTTHUMG00000019158	ENST00000361976.2:c.1790A>C	chr10.hg19:g.121571371A>C	ENSP00000354519:p.Glu597Ala	89.0	0.0		91.0	25.0	NM_014937	A6NKI1|A8KAP2|B7ZLX2|O60800|Q15684|Q15774|Q4VY09|Q4VY10|Q5JQF1|Q5JQF2|Q9UJG5|Q9UMA5	Missense_Mutation	SNP	ENST00000361976.2	hg19	CCDS7616.1	.	.	.	.	.	.	.	.	.	.	A	24.1	4.499255	0.85069	.	.	ENSG00000198825	ENST00000361976	T	0.41065	1.01	5.68	5.68	0.88126	.	0.052878	0.85682	D	0.000000	T	0.62575	0.2439	M	0.61703	1.905	0.80722	D	1	D	0.76494	0.999	D	0.85130	0.997	T	0.63659	-0.6587	10	0.52906	T	0.07	-27.6394	15.9323	0.79672	1.0:0.0:0.0:0.0	.	597	Q9Y2H2	SAC2_HUMAN	A	597	ENSP00000354519:E597A	ENSP00000354519:E597A	E	+	2	0	INPP5F	121561361	1.000000	0.71417	0.985000	0.45067	0.983000	0.72400	9.270000	0.95690	2.175000	0.68902	0.533000	0.62120	GAA	.	.		0.433	INPP5F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050679.1	NM_014937	
OR4C3	256144	hgsc.bcm.edu	37	11	48346805	48346805	+	Nonsense_Mutation	SNP	A	A	T			TCGA-2Y-A9H9-01A-21D-A38X-10	TCGA-2Y-A9H9-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5586a43-bdc1-4030-93f8-cfb7bfa6a4b1	5ab2f233-e5fe-41df-9cef-56c0fdd900d3	g.chr11:48346805A>T	ENST00000319856.4	+	1	334	c.313A>T	c.(313-315)Aaa>Taa	p.K105*		NM_001004702.1	NP_001004702.1	Q8NH37	OR4C3_HUMAN	olfactory receptor, family 4, subfamily C, member 3	78						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(18)|prostate(1)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)	32						TATGGCTCCTAAACTCATTGC	0.463																																					p.K105X		Atlas-SNP	.											.	OR4C3	75	.	0			c.A313T						.						194.0	183.0	187.0					11																	48346805		2201	4298	6499	SO:0001587	stop_gained	256144	exon1			GCTCCTAAACTCA	AB065567	CCDS31489.1	11p11.2	2012-08-09				ENSG00000176547		"""GPCR / Class A : Olfactory receptors"""	14697	protein-coding gene	gene with protein product							Standard	NM_001004702		Approved		uc010rhv.2	Q8NH37	OTTHUMG00000166579	ENST00000319856.4:c.313A>T	chr11.hg19:g.48346805A>T	ENSP00000321419:p.Lys105*	72.0	0.0		105.0	7.0	NM_001004702	B2RNF2|Q6IFB3	Nonsense_Mutation	SNP	ENST00000319856.4	hg19	CCDS31489.1	.	.	.	.	.	.	.	.	.	.	A	15.12	2.740389	0.49045	.	.	ENSG00000176547	ENST00000319856	.	.	.	5.78	5.78	0.91487	.	0.118890	0.37857	N	0.001915	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	14.2031	0.65716	1.0:0.0:0.0:0.0	.	.	.	.	X	105	.	ENSP00000321419:K105X	K	+	1	0	OR4C3	48303381	0.441000	0.25626	0.982000	0.44146	0.426000	0.31534	2.853000	0.48317	2.245000	0.73994	0.391000	0.25812	AAA	.	.		0.463	OR4C3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390557.1	NM_001004702	
DDB1	1642	hgsc.bcm.edu	37	11	61097043	61097043	+	Missense_Mutation	SNP	C	C	A			TCGA-2Y-A9H9-01A-21D-A38X-10	TCGA-2Y-A9H9-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5586a43-bdc1-4030-93f8-cfb7bfa6a4b1	5ab2f233-e5fe-41df-9cef-56c0fdd900d3	g.chr11:61097043C>A	ENST00000301764.7	-	4	738	c.341G>T	c.(340-342)cGc>cTc	p.R114L	DDB1_ENST00000545930.1_5'Flank|DDB1_ENST00000450997.2_Intron	NM_001923.4	NP_001914.3	Q16531	DDB1_HUMAN	damage-specific DNA binding protein 1, 127kDa	114	Interaction with CDT1.|WD repeat beta-propeller A.				DNA repair (GO:0006281)|histone H2A monoubiquitination (GO:0035518)|negative regulation of apoptotic process (GO:0043066)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage removal (GO:0000718)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|regulation of mitotic cell cycle phase transition (GO:1901990)|UV-damage excision repair (GO:0070914)|viral process (GO:0016032)|Wnt signaling pathway (GO:0016055)	Cul4-RING E3 ubiquitin ligase complex (GO:0080008)|Cul4A-RING E3 ubiquitin ligase complex (GO:0031464)|Cul4B-RING E3 ubiquitin ligase complex (GO:0031465)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(7)|lung(22)|ovary(2)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	48						CTCTGAGGGGCGGCCAATGCG	0.507								Nucleotide excision repair (NER)																													p.R114L		Atlas-SNP	.											.	DDB1	100	.	0			c.G341T						.						27.0	25.0	26.0					11																	61097043		2203	4299	6502	SO:0001583	missense	1642	exon4			GAGGGGCGGCCAA	AJ002955	CCDS31576.1	11q12-q13	2014-09-17	2002-08-29		ENSG00000167986	ENSG00000167986			2717	protein-coding gene	gene with protein product		600045	"""damage-specific DNA binding protein 1 (127kD)"""			8530102, 10574459	Standard	NM_001923		Approved	XPE	uc001nrc.5	Q16531	OTTHUMG00000168209	ENST00000301764.7:c.341G>T	chr11.hg19:g.61097043C>A	ENSP00000301764:p.Arg114Leu	71.0	0.0		107.0	54.0	NM_001923	A6NG77|B2R648|B4DG00|O15176|Q13289|Q58F96	Missense_Mutation	SNP	ENST00000301764.7	hg19	CCDS31576.1	.	.	.	.	.	.	.	.	.	.	C	28.2	4.900919	0.92035	.	.	ENSG00000167986	ENST00000301764;ENST00000539426;ENST00000535283;ENST00000542337	T;T;T;T	0.49720	0.77;0.77;0.77;0.77	5.09	4.17	0.49024	.	0.049992	0.85682	D	0.000000	T	0.69637	0.3133	M	0.85373	2.75	0.80722	D	1	D;D	0.57257	0.979;0.961	P;P	0.61940	0.896;0.896	T	0.76895	-0.2790	10	0.72032	D	0.01	-12.0855	15.9702	0.80008	0.0:0.8649:0.1351:0.0	.	114;114	B7Z2A1;Q16531	.;DDB1_HUMAN	L	114;58;58;114	ENSP00000301764:R114L;ENSP00000445554:R58L;ENSP00000441825:R58L;ENSP00000444105:R114L	ENSP00000301764:R114L	R	-	2	0	DDB1	60853619	1.000000	0.71417	1.000000	0.80357	0.824000	0.46624	7.474000	0.81024	1.263000	0.44181	0.563000	0.77884	CGC	.	.		0.507	DDB1-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398816.1	NM_001923	
PRSS23	11098	hgsc.bcm.edu	37	11	86519158	86519158	+	Missense_Mutation	SNP	C	C	T	rs200816081		TCGA-2Y-A9H9-01A-21D-A38X-10	TCGA-2Y-A9H9-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5586a43-bdc1-4030-93f8-cfb7bfa6a4b1	5ab2f233-e5fe-41df-9cef-56c0fdd900d3	g.chr11:86519158C>T	ENST00000280258.5	+	2	898	c.473C>T	c.(472-474)aCg>aTg	p.T158M	PRSS23_ENST00000533902.2_Intron|PRSS23_ENST00000441050.1_Missense_Mutation_p.T126M	NM_007173.4	NP_009104.1	O95084	PRS23_HUMAN	protease, serine, 23	158						extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	serine-type endopeptidase activity (GO:0004252)			central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(9)|pancreas(1)|skin(1)|stomach(1)|urinary_tract(1)	18		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)				AAGTTATCCACGGGCTGCACC	0.512																																					p.T158M		Atlas-SNP	.											.	PRSS23	49	.	0			c.C473T						.						68.0	68.0	68.0					11																	86519158		2201	4299	6500	SO:0001583	missense	11098	exon2			TATCCACGGGCTG	AF015287	CCDS8278.1	11q14.2	2010-05-12			ENSG00000150687	ENSG00000150687		"""Serine peptidases / Serine peptidases"""	14370	protein-coding gene	gene with protein product							Standard	XM_005273727		Approved	SPUVE, SIG13	uc001pcb.3	O95084		ENST00000280258.5:c.473C>T	chr11.hg19:g.86519158C>T	ENSP00000280258:p.Thr158Met	170.0	0.0		187.0	72.0	NM_007173	B2RDJ1|B4E2J3|Q6IBI0	Missense_Mutation	SNP	ENST00000280258.5	hg19	CCDS8278.1	.	.	.	.	.	.	.	.	.	.	C	23.3	4.404741	0.83230	.	.	ENSG00000150687	ENST00000280258;ENST00000441050	D;D	0.89343	-2.5;-2.5	6.17	6.17	0.99709	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (2);	0.000000	0.85682	D	0.000000	D	0.93491	0.7923	L	0.52905	1.665	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.91504	0.5221	9	.	.	.	-10.9442	20.8794	0.99867	0.0:1.0:0.0:0.0	.	126;158	B4E2J3;O95084	.;PRS23_HUMAN	M	158;126	ENSP00000280258:T158M;ENSP00000393015:T126M	.	T	+	2	0	PRSS23	86196806	1.000000	0.71417	0.478000	0.27316	0.958000	0.62258	7.395000	0.79876	2.941000	0.99782	0.655000	0.94253	ACG	.	C|0.999;T|0.001		0.512	PRSS23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393805.2	NM_007173	
FAT3	120114	hgsc.bcm.edu	37	11	92531256	92531256	+	Missense_Mutation	SNP	A	A	C	rs71473491		TCGA-2Y-A9H9-01A-21D-A38X-10	TCGA-2Y-A9H9-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5586a43-bdc1-4030-93f8-cfb7bfa6a4b1	5ab2f233-e5fe-41df-9cef-56c0fdd900d3	g.chr11:92531256A>C	ENST00000298047.6	+	9	5094	c.5077A>C	c.(5077-5079)Atc>Ctc	p.I1693L	FAT3_ENST00000409404.2_Missense_Mutation_p.I1693L|FAT3_ENST00000525166.1_Missense_Mutation_p.I1543L			Q8TDW7	FAT3_HUMAN	FAT atypical cadherin 3	1693	Cadherin 15. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(10)|kidney(4)|large_intestine(11)|liver(2)|lung(37)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	85		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				AGTCATTCTAATCTCTGCCAT	0.388										TCGA Ovarian(4;0.039)																											p.I1693L		Atlas-SNP	.											.	FAT3	1822	.	0			c.A5077C						.						114.0	114.0	114.0					11																	92531256		1951	4139	6090	SO:0001583	missense	120114	exon9			ATTCTAATCTCTG	AB076400		11q14.3	2013-05-31	2013-05-31		ENSG00000165323	ENSG00000165323		"""Cadherins / Cadherin-related"""	23112	protein-coding gene	gene with protein product	"""cadherin-related family member 10"""	612483	"""FAT tumor suppressor homolog 3 (Drosophila)"""			11811999	Standard	NM_001008781		Approved	KIAA1989, CDHF15, CDHR10	uc001pdj.4	Q8TDW7	OTTHUMG00000154468	ENST00000298047.6:c.5077A>C	chr11.hg19:g.92531256A>C	ENSP00000298047:p.Ile1693Leu	107.0	0.0		145.0	61.0	NM_001008781	B5MDB0|Q96AU6	Missense_Mutation	SNP	ENST00000298047.6	hg19		.	.	.	.	.	.	.	.	.	.	A	15.20	2.762544	0.49574	.	.	ENSG00000165323	ENST00000298047;ENST00000409404;ENST00000525166	T;T;T	0.47177	0.85;0.85;0.85	5.93	5.93	0.95920	.	.	.	.	.	T	0.20170	0.0485	N	0.03238	-0.38	0.80722	D	1	B	0.11235	0.004	B	0.06405	0.002	T	0.22906	-1.0203	9	0.13108	T	0.6	.	5.3182	0.15866	0.6863:0.1689:0.1448:0.0	.	1693	Q8TDW7-3	.	L	1693;1693;1543	ENSP00000298047:I1693L;ENSP00000387040:I1693L;ENSP00000432586:I1543L	ENSP00000298047:I1693L	I	+	1	0	FAT3	92170904	0.964000	0.33143	0.953000	0.39169	0.988000	0.76386	2.094000	0.41719	2.273000	0.75805	0.482000	0.46254	ATC	.	A|0.500;G|0.500		0.388	FAT3-201	KNOWN	basic	protein_coding	protein_coding		NM_001008781	
TAF1D	79101	hgsc.bcm.edu	37	11	93471289	93471289	+	Missense_Mutation	SNP	T	T	C			TCGA-2Y-A9H9-01A-21D-A38X-10	TCGA-2Y-A9H9-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5586a43-bdc1-4030-93f8-cfb7bfa6a4b1	5ab2f233-e5fe-41df-9cef-56c0fdd900d3	g.chr11:93471289T>C	ENST00000448108.2	-	3	1095	c.445A>G	c.(445-447)Att>Gtt	p.I149V	TAF1D_ENST00000546088.1_5'Flank|SNORA40_ENST00000388090.1_RNA	NM_024116.3	NP_077021.1	Q9H5J8	TAF1D_HUMAN	TATA box binding protein (TBP)-associated factor, RNA polymerase I, D, 41kDa	149					gene expression (GO:0010467)|regulation of transcription, DNA-templated (GO:0006355)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription from RNA polymerase I promoter (GO:0006360)|transcription initiation from RNA polymerase I promoter (GO:0006361)	microtubule organizing center (GO:0005815)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)			large_intestine(1)|lung(3)|prostate(1)|skin(2)	7						AACGTTAAAATTTTTCTCCAA	0.338																																					p.I149V		Atlas-SNP	.											.	TAF1D	18	.	0			c.A445G						.						75.0	82.0	79.0					11																	93471289		2200	4297	6497	SO:0001583	missense	79101	exon3			TTAAAATTTTTCT		CCDS8293.1	11q21	2012-05-30	2008-09-30	2008-09-30	ENSG00000166012	ENSG00000166012			28759	protein-coding gene	gene with protein product		612823	"""Josephin domain containing 3"""	JOSD3		15520167, 17318177	Standard	NM_024116		Approved	MGC5306, TAF(I)41	uc001pec.3	Q9H5J8	OTTHUMG00000167451	ENST00000448108.2:c.445A>G	chr11.hg19:g.93471289T>C	ENSP00000410409:p.Ile149Val	75.0	0.0		86.0	34.0	NM_024116	Q6I9Y6	Missense_Mutation	SNP	ENST00000448108.2	hg19	CCDS8293.1	.	.	.	.	.	.	.	.	.	.	T	11.16	1.557087	0.27827	.	.	ENSG00000166012	ENST00000448108	.	.	.	5.45	4.31	0.51392	.	0.351548	0.27636	N	0.018486	T	0.47563	0.1452	L	0.50333	1.59	0.28449	N	0.916438	D	0.58620	0.983	P	0.57720	0.826	T	0.35895	-0.9770	9	0.19147	T	0.46	-18.2288	8.985	0.35988	0.1647:0.0:0.0:0.8353	.	149	Q9H5J8	TAF1D_HUMAN	V	149	.	ENSP00000314971:I149V	I	-	1	0	TAF1D	93110937	1.000000	0.71417	0.997000	0.53966	0.061000	0.15899	2.263000	0.43293	0.989000	0.38761	-0.327000	0.08410	ATT	.	.		0.338	TAF1D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394662.2	NM_024116	
PDZD3	79849	hgsc.bcm.edu	37	11	119059807	119059807	+	Silent	SNP	C	C	T			TCGA-2Y-A9H9-01A-21D-A38X-10	TCGA-2Y-A9H9-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5586a43-bdc1-4030-93f8-cfb7bfa6a4b1	5ab2f233-e5fe-41df-9cef-56c0fdd900d3	g.chr11:119059807C>T	ENST00000531114.1	+	8	2128	c.1579C>T	c.(1579-1581)Ctg>Ttg	p.L527L	PDZD3_ENST00000392817.2_Silent_p.L527L|PDZD3_ENST00000322712.4_Silent_p.L447L|PDZD3_ENST00000525131.1_Silent_p.L448L|PDZD3_ENST00000355547.5_Silent_p.L461L			Q86UT5	NHRF4_HUMAN	PDZ domain containing 3	527	PDZ 4. {ECO:0000255|PROSITE- ProRule:PRU00143}.				cGMP-mediated signaling (GO:0019934)|ion transport (GO:0006811)|negative regulation of cGMP biosynthetic process (GO:0030827)|negative regulation of guanylate cyclase activity (GO:0031283)|receptor guanylyl cyclase signaling pathway (GO:0007168)|response to toxic substance (GO:0009636)|water transport (GO:0006833)	apical part of cell (GO:0045177)|brush border (GO:0005903)|cytosol (GO:0005829)|subapical complex (GO:0035003)	guanylate cyclase inhibitor activity (GO:0030251)|ion channel inhibitor activity (GO:0008200)|protein C-terminus binding (GO:0008022)			breast(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(1)|lung(4)|ovary(1)	14	all_hematologic(175;0.0977)	Medulloblastoma(222;0.0523)|Breast(348;0.174)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;7.52e-05)		ACAGAATGACCTGGAGAGGCT	0.637																																					p.L461L		Atlas-SNP	.											.	PDZD3	42	.	0			c.C1381T						.						46.0	46.0	46.0					11																	119059807		2200	4295	6495	SO:0001819	synonymous_variant	79849	exon10			AATGACCTGGAGA	AK091966	CCDS8417.1, CCDS53719.1	11q23.3	2008-02-05	2006-01-24	2006-01-24	ENSG00000172367	ENSG00000172367			19891	protein-coding gene	gene with protein product		607146	"""PDZ domain containing 2"""	PDZK2		11950846	Standard	NM_024791		Approved	FLJ22756, IKEPP	uc001pvz.3	Q86UT5	OTTHUMG00000166224	ENST00000531114.1:c.1579C>T	chr11.hg19:g.119059807C>T		31.0	0.0		37.0	16.0	NM_001168468	Q8N6R4|Q8NAW7|Q8NEX7|Q9H5Z3	Silent	SNP	ENST00000531114.1	hg19																																																																																				.	.		0.637	PDZD3-004	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000388471.1	NM_024791	
CLEC1B	51266	hgsc.bcm.edu	37	12	10149501	10149501	+	Missense_Mutation	SNP	G	G	C			TCGA-2Y-A9H9-01A-21D-A38X-10	TCGA-2Y-A9H9-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5586a43-bdc1-4030-93f8-cfb7bfa6a4b1	5ab2f233-e5fe-41df-9cef-56c0fdd900d3	g.chr12:10149501G>C	ENST00000298527.6	-	4	561	c.382C>G	c.(382-384)Cag>Gag	p.Q128E	CLEC1B_ENST00000428126.2_Missense_Mutation_p.Q95E|CLEC1B_ENST00000348658.4_Missense_Mutation_p.Q95E	NM_016509.3	NP_057593.3	Q9P126	CLC1B_HUMAN	C-type lectin domain family 1, member B	128	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				cell surface receptor signaling pathway (GO:0007166)|defense response (GO:0006952)|platelet formation (GO:0030220)	integral component of plasma membrane (GO:0005887)	carbohydrate binding (GO:0030246)|transmembrane signaling receptor activity (GO:0004888)	p.Q32*(1)|p.Q128*(1)		NS(1)|breast(1)|central_nervous_system(1)|large_intestine(2)|lung(12)|stomach(1)|urinary_tract(1)	19						GTGCAGTACTGCTTACTCTCT	0.423																																					p.Q128E		Atlas-SNP	.											CLEC1B_ENST00000398939,bladder,carcinoma,0,2	CLEC1B	39	.	2	Substitution - Nonsense(2)	urinary_tract(2)	c.C382G						.						186.0	165.0	172.0					12																	10149501		1893	4139	6032	SO:0001583	missense	51266	exon4			AGTACTGCTTACT	AF124841	CCDS41751.1, CCDS41752.1	12p13.31	2006-04-12				ENSG00000165682		"""C-type lectin domain containing"""	24356	protein-coding gene	gene with protein product		606783				10671229, 11745369	Standard	NM_016509		Approved	CLEC2	uc001qwu.3	Q9P126		ENST00000298527.6:c.382C>G	chr12.hg19:g.10149501G>C	ENSP00000298527:p.Gln128Glu	60.0	0.0		68.0	21.0	NM_016509	Q6UWX7|Q8NHR6	Missense_Mutation	SNP	ENST00000298527.6	hg19	CCDS41752.1	.	.	.	.	.	.	.	.	.	.	G	3.125	-0.179754	0.06380	.	.	ENSG00000165682	ENST00000398937;ENST00000428126;ENST00000298527;ENST00000348658;ENST00000398939	T;T;T;T	0.16457	2.34;2.34;2.34;2.34	4.05	-2.33	0.06724	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (3);	0.927767	0.09066	N	0.853623	T	0.07728	0.0194	L	0.27053	0.805	0.09310	N	1	B;B	0.19935	0.015;0.04	B;B	0.14023	0.004;0.01	T	0.41070	-0.9529	10	0.07030	T	0.85	.	2.6442	0.04979	0.0988:0.1443:0.2839:0.4731	.	95;128	Q9P126-2;Q9P126	.;CLC1B_HUMAN	E	35;95;128;95;32	ENSP00000381910:Q35E;ENSP00000406338:Q95E;ENSP00000298527:Q128E;ENSP00000327169:Q95E	ENSP00000298527:Q128E	Q	-	1	0	CLEC1B	10040768	0.063000	0.20901	0.014000	0.15608	0.422000	0.31414	0.205000	0.17356	-0.297000	0.08934	0.491000	0.48974	CAG	.	.		0.423	CLEC1B-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399922.1	NM_016509	
H2AFJ	55766	hgsc.bcm.edu	37	12	14927760	14927760	+	Missense_Mutation	SNP	A	A	G	rs371368734		TCGA-2Y-A9H9-01A-21D-A38X-10	TCGA-2Y-A9H9-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5586a43-bdc1-4030-93f8-cfb7bfa6a4b1	5ab2f233-e5fe-41df-9cef-56c0fdd900d3	g.chr12:14927760A>G	ENST00000544848.1	+	1	491	c.356A>G	c.(355-357)aAg>aGg	p.K119R		NM_177925.2	NP_808760.1	Q9BTM1	H2AJ_HUMAN	H2A histone family, member J	119						extracellular vesicular exosome (GO:0070062)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(1)|central_nervous_system(1)|kidney(1)|ovary(1)|skin(1)	5						CTGCTGCCCAAGAAGACGGAG	0.612																																					p.K119R		Atlas-SNP	.											.	H2AFJ	14	.	0			c.A356G						.	A	ARG/LYS	1,4405		0,1,2202	56.0	56.0	56.0		356	3.5	1.0	12		56	0,8600		0,0,4300	no	missense	H2AFJ	NM_177925.2	26	0,1,6502	GG,GA,AA		0.0,0.0227,0.0077	benign	119/130	14927760	1,13005	2203	4300	6503	SO:0001583	missense	55766	exon1			TGCCCAAGAAGAC	AK001765	CCDS31752.1	12p12.3	2012-09-11			ENSG00000246705	ENSG00000246705		"""Histones / Replication-independent"""	14456	protein-coding gene	gene with protein product							Standard	NM_177925		Approved	FLJ10903, MGC921	uc009zia.3	Q9BTM1	OTTHUMG00000168736	ENST00000544848.1:c.356A>G	chr12.hg19:g.14927760A>G	ENSP00000438553:p.Lys119Arg	159.0	0.0		160.0	76.0	NM_177925	Q9NV63	Missense_Mutation	SNP	ENST00000544848.1	hg19	CCDS31752.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	13.23|13.23	2.174360|2.174360	0.38413|0.38413	2.27E-4|2.27E-4	0.0|0.0	ENSG00000246705|ENSG00000246705	ENST00000228929|ENST00000544848	.|D	.|0.86097	.|-2.07	4.64|4.64	3.5|3.5	0.40072|0.40072	.|Histone-fold (2);Histone H2A (1);	.|.	.|.	.|.	.|.	.|D	.|0.87884	.|0.6290	M|M	0.86805|0.86805	2.84|2.84	0.40764|0.40764	D|D	0.983032|0.983032	.|B	.|0.21821	.|0.061	.|B	.|0.36418	.|0.224	.|D	.|0.86763	.|0.1968	.|9	.|0.72032	.|D	.|0.01	.|.	8.9898|8.9898	0.36017|0.36017	0.9112:0.0:0.0888:0.0|0.9112:0.0:0.0888:0.0	.|.	.|119	.|Q9BTM1	.|H2AJ_HUMAN	.|R	-1|119	.|ENSP00000438553:K119R	.|ENSP00000373730:K119R	.|K	+|+	.|2	.|0	H2AFJ|H2AFJ	14819027|14819027	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.991000|0.991000	0.79684|0.79684	7.183000|7.183000	0.77697|0.77697	1.090000|1.090000	0.41315|0.41315	-0.280000|-0.280000	0.10049|0.10049	.|AAG	.	.		0.612	H2AFJ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400845.1	NM_177925	
ADAMTS20	80070	hgsc.bcm.edu	37	12	43846185	43846185	+	Silent	SNP	A	A	G			TCGA-2Y-A9H9-01A-21D-A38X-10	TCGA-2Y-A9H9-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5586a43-bdc1-4030-93f8-cfb7bfa6a4b1	5ab2f233-e5fe-41df-9cef-56c0fdd900d3	g.chr12:43846185A>G	ENST00000389420.3	-	14	1970	c.1971T>C	c.(1969-1971)taT>taC	p.Y657Y	ADAMTS20_ENST00000553158.1_Silent_p.Y657Y	NM_025003.3	NP_079279.3	P59510	ATS20_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 20	657	Cys-rich.				extracellular matrix organization (GO:0030198)|negative regulation of apoptotic process (GO:0043066)|positive regulation of melanocyte differentiation (GO:0045636)|positive regulation of signal transduction (GO:0009967)	extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(6)|endometrium(3)|kidney(4)|large_intestine(11)|liver(1)|lung(43)|ovary(4)|pancreas(3)|prostate(5)|skin(12)|upper_aerodigestive_tract(1)|urinary_tract(1)	95	all_cancers(12;2.6e-05)|Lung SC(27;0.184)	Lung NSC(34;0.0569)|all_lung(34;0.129)		GBM - Glioblastoma multiforme(48;0.0473)		CAACCTGACAATAGAGTTTAC	0.348																																					p.Y657Y		Atlas-SNP	.											.	ADAMTS20	635	.	0			c.T1971C						.						89.0	85.0	87.0					12																	43846185		2203	4300	6503	SO:0001819	synonymous_variant	80070	exon14			CTGACAATAGAGT	AF488804	CCDS31778.2	12q12	2005-08-19	2005-08-19			ENSG00000173157		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17178	protein-coding gene	gene with protein product		611681	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 20"""			12514189, 12562771	Standard	NM_025003		Approved	GON-1	uc010skx.2	P59510		ENST00000389420.3:c.1971T>C	chr12.hg19:g.43846185A>G		68.0	0.0		125.0	47.0	NM_025003	A6NNC9|J3QT00	Silent	SNP	ENST00000389420.3	hg19	CCDS31778.2																																																																																			.	.		0.348	ADAMTS20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403643.1	NM_025003	
PUS7L	83448	hgsc.bcm.edu	37	12	44148379	44148379	+	Missense_Mutation	SNP	C	C	A			TCGA-2Y-A9H9-01A-21D-A38X-10	TCGA-2Y-A9H9-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5586a43-bdc1-4030-93f8-cfb7bfa6a4b1	5ab2f233-e5fe-41df-9cef-56c0fdd900d3	g.chr12:44148379C>A	ENST00000416848.2	-	2	1158	c.670G>T	c.(670-672)Gca>Tca	p.A224S	PUS7L_ENST00000553166.1_Missense_Mutation_p.A224S|PUS7L_ENST00000344862.5_Missense_Mutation_p.A224S|PUS7L_ENST00000431332.3_Intron|PUS7L_ENST00000551923.1_Missense_Mutation_p.A224S	NM_001098615.1|NM_001271826.1	NP_001092085.1|NP_001258755.1	Q9H0K6	PUS7L_HUMAN	pseudouridylate synthase 7 homolog (S. cerevisiae)-like	224					pseudouridine synthesis (GO:0001522)|tRNA processing (GO:0008033)		pseudouridine synthase activity (GO:0009982)|RNA binding (GO:0003723)			NS(1)|endometrium(1)|kidney(2)|large_intestine(9)|lung(15)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	32	all_cancers(12;0.00027)	Lung NSC(34;0.114)|all_lung(34;0.24)		GBM - Glioblastoma multiforme(48;0.0402)		TCTTTCTTTGCATCCAAATAT	0.299																																					p.A224S		Atlas-SNP	.											.	PUS7L	73	.	0			c.G670T						.						69.0	68.0	69.0					12																	44148379		2203	4298	6501	SO:0001583	missense	83448	exon2			TCTTTGCATCCAA	BX647494	CCDS8743.1, CCDS61104.1	12q12	2006-02-07				ENSG00000129317			25276	protein-coding gene	gene with protein product						11230166	Standard	NM_001098615		Approved	DKFZP434G1415	uc001rnr.5	Q9H0K6	OTTHUMG00000169423	ENST00000416848.2:c.670G>T	chr12.hg19:g.44148379C>A	ENSP00000415899:p.Ala224Ser	149.0	0.0		216.0	17.0	NM_001098614	B3KUJ1|Q05CU0|Q6AHZ3|Q6NUP2	Missense_Mutation	SNP	ENST00000416848.2	hg19	CCDS8743.1	.	.	.	.	.	.	.	.	.	.	C	33	5.248839	0.95305	.	.	ENSG00000129317	ENST00000416848;ENST00000344862;ENST00000551923;ENST00000553166	T;T;T;T	0.24350	1.91;1.91;1.91;1.86	5.35	5.35	0.76521	Pseudouridine synthase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.40322	0.1112	L	0.29908	0.895	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.03148	-1.1067	10	0.21540	T	0.41	-22.8576	19.9585	0.97232	0.0:1.0:0.0:0.0	.	224	Q9H0K6	PUS7L_HUMAN	S	224	ENSP00000415899:A224S;ENSP00000343081:A224S;ENSP00000447706:A224S;ENSP00000446865:A224S	ENSP00000343081:A224S	A	-	1	0	PUS7L	42434646	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	7.210000	0.77924	2.894000	0.99253	0.655000	0.94253	GCA	.	.		0.299	PUS7L-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403931.1	NM_031292	
POLR3B	55703	hgsc.bcm.edu	37	12	106903268	106903268	+	Missense_Mutation	SNP	C	C	G			TCGA-2Y-A9H9-01A-21D-A38X-10	TCGA-2Y-A9H9-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5586a43-bdc1-4030-93f8-cfb7bfa6a4b1	5ab2f233-e5fe-41df-9cef-56c0fdd900d3	g.chr12:106903268C>G	ENST00000228347.4	+	28	3565	c.3343C>G	c.(3343-3345)Cag>Gag	p.Q1115E	POLR3B_ENST00000539066.1_Missense_Mutation_p.Q1057E|RP11-144F15.1_ENST00000551505.1_Intron	NM_018082.5	NP_060552.4	Q9NW08	RPC2_HUMAN	polymerase (RNA) III (DNA directed) polypeptide B	1115					defense response to virus (GO:0051607)|gene expression (GO:0010467)|innate immune response (GO:0045087)|positive regulation of innate immune response (GO:0045089)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of type I interferon production (GO:0032481)|termination of RNA polymerase III transcription (GO:0006386)|transcription elongation from RNA polymerase III promoter (GO:0006385)|transcription from RNA polymerase III promoter (GO:0006383)	cytosol (GO:0005829)|DNA-directed RNA polymerase III complex (GO:0005666)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|metal ion binding (GO:0046872)|ribonucleoside binding (GO:0032549)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(14)|lung(22)|ovary(1)|prostate(3)|skin(3)|urinary_tract(2)	57						GCTGCTCTTCCAGGAACTACA	0.443																																					p.Q1115E		Atlas-SNP	.											.	POLR3B	123	.	0			c.C3343G						.						160.0	133.0	142.0					12																	106903268		2203	4300	6503	SO:0001583	missense	55703	exon28			CTCTTCCAGGAAC	AY092084	CCDS9105.1, CCDS53824.1	12q23.3	2014-08-12			ENSG00000013503	ENSG00000013503		"""RNA polymerase subunits"""	30348	protein-coding gene	gene with protein product		614366				12391170	Standard	NM_018082		Approved	RPC2, FLJ10388	uc001tlp.3	Q9NW08	OTTHUMG00000170077	ENST00000228347.4:c.3343C>G	chr12.hg19:g.106903268C>G	ENSP00000228347:p.Gln1115Glu	82.0	0.0		98.0	40.0	NM_018082	A8K6H0|B3KV73|F5H1E6|Q9NW59	Missense_Mutation	SNP	ENST00000228347.4	hg19	CCDS9105.1	.	.	.	.	.	.	.	.	.	.	C	28.5	4.923286	0.92319	.	.	ENSG00000013503	ENST00000228347;ENST00000539066	T;T	0.78003	-1.14;-1.14	5.57	5.57	0.84162	RNA polymerase Rpb2, domain 7 (1);	0.000000	0.85682	D	0.000000	D	0.92844	0.7724	H	0.97240	3.965	0.80722	D	1	D	0.71674	0.998	D	0.75484	0.986	D	0.94982	0.8126	10	0.87932	D	0	-16.5766	19.557	0.95354	0.0:1.0:0.0:0.0	.	1115	Q9NW08	RPC2_HUMAN	E	1115;1057	ENSP00000228347:Q1115E;ENSP00000445721:Q1057E	ENSP00000228347:Q1115E	Q	+	1	0	POLR3B	105427398	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	7.818000	0.86416	2.630000	0.89119	0.655000	0.94253	CAG	.	.		0.443	POLR3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407166.1	NM_018082	
RHOF	54509	hgsc.bcm.edu	37	12	122218862	122218862	+	Silent	SNP	G	G	A			TCGA-2Y-A9H9-01A-21D-A38X-10	TCGA-2Y-A9H9-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5586a43-bdc1-4030-93f8-cfb7bfa6a4b1	5ab2f233-e5fe-41df-9cef-56c0fdd900d3	g.chr12:122218862G>A	ENST00000267205.2	-	4	1015	c.387C>T	c.(385-387)atC>atT	p.I129I	TMEM120B_ENST00000449592.2_3'UTR|TMEM120B_ENST00000538055.1_3'UTR|RHOF_ENST00000537265.1_Silent_p.I29I|RHOF_ENST00000537171.1_Silent_p.I129I	NM_019034.2	NP_061907.2	Q9HBH0	RHOF_HUMAN	ras homolog family member F (in filopodia)	129					actin filament organization (GO:0007015)|GTP catabolic process (GO:0006184)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			large_intestine(1)|lung(1)|ovary(1)	3	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)			OV - Ovarian serous cystadenocarcinoma(86;4.38e-05)|Epithelial(86;0.000178)|BRCA - Breast invasive adenocarcinoma(302;0.223)		TCTTGCAGCCGATGAGCACCA	0.672																																					p.I129I		Atlas-SNP	.											.	RHOF	6	.	0			c.C387T						.						34.0	33.0	34.0					12																	122218862		2203	4300	6503	SO:0001819	synonymous_variant	54509	exon4			GCAGCCGATGAGC	AK000254	CCDS9222.1	12q24.31	2013-09-23	2012-02-27	2004-03-24	ENSG00000139725	ENSG00000139725			15703	protein-coding gene	gene with protein product			"""ras homolog gene family, member F (in filopodia)"""	ARHF		11084341	Standard	NM_019034		Approved	FLJ20247, RIF	uc001ubb.3	Q9HBH0	OTTHUMG00000169077	ENST00000267205.2:c.387C>T	chr12.hg19:g.122218862G>A		119.0	0.0		116.0	45.0	NM_019034	Q8WVB1|Q9NXH6	Silent	SNP	ENST00000267205.2	hg19	CCDS9222.1																																																																																			.	.		0.672	RHOF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402165.1		
AACS	65985	hgsc.bcm.edu	37	12	125621327	125621327	+	Missense_Mutation	SNP	G	G	T			TCGA-2Y-A9H9-01A-21D-A38X-10	TCGA-2Y-A9H9-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5586a43-bdc1-4030-93f8-cfb7bfa6a4b1	5ab2f233-e5fe-41df-9cef-56c0fdd900d3	g.chr12:125621327G>T	ENST00000316519.6	+	17	2004	c.1798G>T	c.(1798-1800)Gtt>Ttt	p.V600F	AACS_ENST00000261686.6_Intron|AACS_ENST00000543665.1_Intron|AACS_ENST00000316543.10_Missense_Mutation_p.V198F|AACS_ENST00000545511.1_Intron	NM_023928.3	NP_076417.2	Q86V21	AACS_HUMAN	acetoacetyl-CoA synthetase	600					adipose tissue development (GO:0060612)|cellular response to cholesterol (GO:0071397)|cellular response to glucose stimulus (GO:0071333)|cellular response to testosterone stimulus (GO:0071394)|fatty acid metabolic process (GO:0006631)|liver development (GO:0001889)|positive regulation of insulin secretion (GO:0032024)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to nutrient (GO:0007584)|response to oleic acid (GO:0034201)|response to purine-containing compound (GO:0014074)|response to starvation (GO:0042594)|white fat cell differentiation (GO:0050872)	cytoplasm (GO:0005737)	acetoacetate-CoA ligase activity (GO:0030729)|ATP binding (GO:0005524)|butyrate-CoA ligase activity (GO:0047760)			breast(1)|central_nervous_system(1)|cervix(1)|large_intestine(4)|liver(1)|lung(16)|ovary(1)|stomach(1)	26	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;9.82e-05)|Epithelial(86;0.000642)|all cancers(50;0.00843)		GCCTGACTTGGTTAAGAGGAT	0.607																																					p.V600F		Atlas-SNP	.											.	AACS	59	.	0			c.G1798T						.						126.0	106.0	113.0					12																	125621327		2203	4300	6503	SO:0001583	missense	65985	exon17			GACTTGGTTAAGA	AK022451	CCDS9263.1	12q24.31	2010-09-29			ENSG00000081760	ENSG00000081760	6.2.1.16	"""Acyl-CoA synthetase family"""	21298	protein-coding gene	gene with protein product	"""acyl-CoA synthetase family member 1"""	614364				12623130, 17762044	Standard	NM_023928		Approved	FLJ12389, SUR-5, ACSF1	uc001uhc.3	Q86V21	OTTHUMG00000168550	ENST00000316519.6:c.1798G>T	chr12.hg19:g.125621327G>T	ENSP00000324842:p.Val600Phe	76.0	0.0		97.0	43.0	NM_023928	Q49AB9|Q49AC3|Q658Q8|Q8IWD2|Q8NEW5|Q9BSJ9|Q9H829|Q9HA19	Missense_Mutation	SNP	ENST00000316519.6	hg19	CCDS9263.1	.	.	.	.	.	.	.	.	.	.	G	15.75	2.925067	0.52759	.	.	ENSG00000081760	ENST00000316519;ENST00000316543;ENST00000539251;ENST00000536118	T;T;T;T	0.11063	2.81;2.81;2.81;2.81	5.3	4.4	0.53042	.	0.058805	0.64402	D	0.000002	T	0.24586	0.0596	M	0.82517	2.595	0.80722	D	1	P	0.52842	0.956	P	0.48795	0.59	T	0.11084	-1.0602	10	0.56958	D	0.05	.	14.6054	0.68475	0.0:0.2775:0.7225:0.0	.	600	Q86V21	AACS_HUMAN	F	600;198;65;155	ENSP00000324842:V600F;ENSP00000324929:V198F;ENSP00000439151:V65F;ENSP00000441331:V155F	ENSP00000324842:V600F	V	+	1	0	AACS	124187280	1.000000	0.71417	0.952000	0.39060	0.085000	0.17905	5.888000	0.69758	1.339000	0.45563	0.561000	0.74099	GTT	.	.		0.607	AACS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400202.1	NM_023928	
ZNF10	7556	hgsc.bcm.edu	37	12	133728487	133728487	+	Missense_Mutation	SNP	C	C	T			TCGA-2Y-A9H9-01A-21D-A38X-10	TCGA-2Y-A9H9-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5586a43-bdc1-4030-93f8-cfb7bfa6a4b1	5ab2f233-e5fe-41df-9cef-56c0fdd900d3	g.chr12:133728487C>T	ENST00000248211.6	+	4	475	c.253C>T	c.(253-255)Cct>Tct	p.P85S	ZNF10_ENST00000426665.2_Missense_Mutation_p.P85S|ZNF10_ENST00000402932.2_Missense_Mutation_p.P85S|ZNF268_ENST00000416488.1_Missense_Mutation_p.P85S|CTD-2140B24.4_ENST00000540096.2_Missense_Mutation_p.P85S	NM_015394.4	NP_056209.2	P21506	ZNF10_HUMAN	zinc finger protein 10	85	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(9)|prostate(1)|skin(5)|urinary_tract(1)	26	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_cancers(7;1.28e-06)|all_epithelial(31;0.0051)|Lung NSC(355;0.00948)		OV - Ovarian serous cystadenocarcinoma(86;3.58e-08)|Epithelial(86;6.6e-07)|all cancers(50;2.28e-05)		AGAGACCCATCCTGGTGAGGA	0.542																																					p.P85S		Atlas-SNP	.											.	ZNF10	58	.	0			c.C253T						.						62.0	58.0	59.0					12																	133728487		2203	4300	6503	SO:0001583	missense	7556	exon4			ACCCATCCTGGTG	X52332, BC024182	CCDS9283.1	12q24.33	2013-01-08	2005-05-22		ENSG00000256223	ENSG00000256223		"""Zinc fingers, C2H2-type"", ""-"""	12879	protein-coding gene	gene with protein product		194538	"""zinc finger protein 10 (KOX 1)"""			7865130, 8262519	Standard	NM_015394		Approved	KOX1	uc001ulq.3	P21506	OTTHUMG00000167944	ENST00000248211.6:c.253C>T	chr12.hg19:g.133728487C>T	ENSP00000248211:p.Pro85Ser	91.0	0.0		74.0	36.0	NM_015394	B2RBS1|Q8TC91	Missense_Mutation	SNP	ENST00000248211.6	hg19	CCDS9283.1	.	.	.	.	.	.	.	.	.	.	C	11.83	1.755363	0.31046	.	.	ENSG00000256223;ENSG00000256223;ENSG00000256223;ENSG00000256223;ENSG00000090612	ENST00000248211;ENST00000426665;ENST00000402932;ENST00000537119;ENST00000416488	T;T;T;T;T	0.05717	3.4;3.4;3.57;4.62;5.69	3.82	2.87	0.33458	Krueppel-associated box (1);	0.432093	0.17278	N	0.180109	T	0.06050	0.0157	L	0.52573	1.65	0.58432	D	0.999997	B	0.29862	0.259	B	0.26614	0.071	T	0.33369	-0.9871	9	.	.	.	.	6.2098	0.20623	0.0:0.846:0.0:0.154	.	85	P21506	ZNF10_HUMAN	S	85;85;85;43;85	ENSP00000248211:P85S;ENSP00000393814:P85S;ENSP00000384893:P85S;ENSP00000437397:P43S;ENSP00000409295:P85S	.	P	+	1	0	ZNF10;ZNF268	132238560	0.003000	0.15002	0.710000	0.30468	0.019000	0.09904	-0.440000	0.06888	0.871000	0.35750	0.563000	0.77884	CCT	.	.		0.542	ZNF10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397182.1	NM_015394	
LINC00283	100874057	hgsc.bcm.edu	37	13	103398055	103398055	+	RNA	SNP	T	T	C			TCGA-2Y-A9H9-01A-21D-A38X-10	TCGA-2Y-A9H9-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5586a43-bdc1-4030-93f8-cfb7bfa6a4b1	5ab2f233-e5fe-41df-9cef-56c0fdd900d3	g.chr13:103398055T>C	ENST00000430111.1	+	0	3894									long intergenic non-protein coding RNA 283																		CACCAGCCTGTTCCTTTTGAT	0.393																																					p.E1664E		Atlas-SNP	.											.	.	.	.	0			c.A4992G						.						96.0	85.0	88.0					13																	103398055		692	1591	2283			643677	exon4			AGCCTGTTCCTTT			13q33.1	2012-10-12	2011-08-10	2011-08-10	ENSG00000231633	ENSG00000231633		"""Long non-coding RNAs"""	38809	non-coding RNA	RNA, long non-coding			"""non-protein coding RNA 283"""	NCRNA00283			Standard			Approved				OTTHUMG00000017311		chr13.hg19:g.103398055T>C		75.0	0.0		143.0	51.0	NM_001146197		Silent	SNP	ENST00000430111.1	hg19																																																																																				.	.		0.393	LINC00283-001	KNOWN	not_organism_supported|basic	antisense	antisense	OTTHUMT00000045714.1		
SOX1	6656	hgsc.bcm.edu	37	13	112723111	112723111	+	Missense_Mutation	SNP	C	C	T	rs199891204|rs137969745	byFrequency	TCGA-2Y-A9H9-01A-21D-A38X-10	TCGA-2Y-A9H9-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5586a43-bdc1-4030-93f8-cfb7bfa6a4b1	5ab2f233-e5fe-41df-9cef-56c0fdd900d3	g.chr13:112723111C>T	ENST00000330949.1	+	1	1199	c.1139C>T	c.(1138-1140)gCg>gTg	p.A380V		NM_005986.2	NP_005977.2	O00570	SOX1_HUMAN	SRY (sex determining region Y)-box 1	380					chromatin organization (GO:0006325)|forebrain neuron development (GO:0021884)|lens morphogenesis in camera-type eye (GO:0002089)|neuron migration (GO:0001764)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|ventral spinal cord interneuron specification (GO:0021521)	nucleus (GO:0005634)	core promoter sequence-specific DNA binding (GO:0001046)|DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			lung(4)	4	all_lung(23;0.000652)|Lung NSC(43;0.017)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Medulloblastoma(90;0.163)	all_cancers(25;0.000331)|Lung NSC(25;0.0496)|all_lung(25;0.0831)|all_epithelial(44;0.0868)|Breast(118;0.231)		OV - Ovarian serous cystadenocarcinoma(48;0.132)		GGCGCGGGCGCGGGCGTGAAC	0.791																																					p.A380V		Atlas-SNP	.											SOX1,spinal_cord,glioma,0,1	SOX1	14	.	0			c.C1139T						.						1.0	1.0	1.0					13																	112723111		785	1888	2673	SO:0001583	missense	6656	exon1			CGGGCGCGGGCGT		CCDS9523.1	13q34	2008-07-18			ENSG00000182968	ENSG00000182968		"""SRY (sex determining region Y)-boxes"""	11189	protein-coding gene	gene with protein product	"""SRY-related HMG-box gene 1"""	602148				9337405	Standard	NM_005986		Approved		uc001vsb.1	O00570	OTTHUMG00000017362	ENST00000330949.1:c.1139C>T	chr13.hg19:g.112723111C>T	ENSP00000330218:p.Ala380Val	21.0	0.0		10.0	4.0	NM_005986	Q5W0Q1	Missense_Mutation	SNP	ENST00000330949.1	hg19	CCDS9523.1	.	.	.	.	.	.	.	.	.	.	C	17.09	3.301562	0.60195	.	.	ENSG00000182968	ENST00000330949	D	0.83075	-1.68	3.44	3.44	0.39384	.	0.178100	0.37577	U	0.002031	T	0.65015	0.2651	N	0.04880	-0.145	0.33320	D	0.567251	B	0.27971	0.196	B	0.14578	0.011	T	0.70077	-0.4971	10	0.32370	T	0.25	.	15.1474	0.72667	0.0:1.0:0.0:0.0	.	380	O00570	SOX1_HUMAN	V	380	ENSP00000330218:A380V	ENSP00000330218:A380V	A	+	2	0	SOX1	111771112	0.987000	0.35691	1.000000	0.80357	0.983000	0.72400	4.048000	0.57390	1.754000	0.51921	0.555000	0.69702	GCG	.	.		0.791	SOX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045817.3	NM_005986	
CDKN3	1033	hgsc.bcm.edu	37	14	54866651	54866651	+	Missense_Mutation	SNP	G	G	A			TCGA-2Y-A9H9-01A-21D-A38X-10	TCGA-2Y-A9H9-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5586a43-bdc1-4030-93f8-cfb7bfa6a4b1	5ab2f233-e5fe-41df-9cef-56c0fdd900d3	g.chr14:54866651G>A	ENST00000541304.1	+	2	89	c.49G>A	c.(49-51)Gaa>Aaa	p.E17K	CDKN3_ENST00000556102.2_Missense_Mutation_p.E17K|CDKN3_ENST00000458126.2_Missense_Mutation_p.E17K|CDKN3_ENST00000543789.2_Missense_Mutation_p.E17K|CDKN3_ENST00000556305.1_3'UTR|CDKN3_ENST00000442975.2_Intron|CDKN3_ENST00000335183.6_Missense_Mutation_p.E17K			Q00526	CDK3_HUMAN	cyclin-dependent kinase inhibitor 3	0	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell proliferation (GO:0008283)|G0 to G1 transition (GO:0045023)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic nuclear division (GO:0007067)|regulation of cell cycle (GO:0051726)		ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)			breast(2)|stomach(1)	3						CTCATCAGATGAAGAGCCTAT	0.308																																					p.E17K	Pancreas(40;634 1012 9382 49950 52462)	Atlas-SNP	.											.	CDKN3	9	.	0			c.G49A						.						97.0	94.0	95.0					14																	54866651		2203	4295	6498	SO:0001583	missense	1033	exon2			TCAGATGAAGAGC	U02681	CCDS9716.1, CCDS45109.1	14q22	2011-08-25	2008-08-01		ENSG00000100526	ENSG00000100526		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : CDC14s"""	1791	protein-coding gene	gene with protein product	"""kinase associated phosphatase"", ""cyclin-dependent kinase inhibitor"", ""CDK2-associated dual specificity phosphatase"""	123832				8242750, 7698009	Standard	NM_005192		Approved	KAP, CDI1	uc001xap.3	Q16667	OTTHUMG00000140302	ENST00000541304.1:c.49G>A	chr14.hg19:g.54866651G>A	ENSP00000445572:p.Glu17Lys	356.0	1.0		370.0	157.0	NM_005192		Missense_Mutation	SNP	ENST00000541304.1	hg19		.	.	.	.	.	.	.	.	.	.	G	22.9	4.344253	0.82022	.	.	ENSG00000100526	ENST00000335183;ENST00000543789;ENST00000458126;ENST00000556102;ENST00000541304;ENST00000439312;ENST00000434252	T;T;T;T;T	0.54675	0.56;0.56;0.56;0.56;0.56	5.17	5.17	0.71159	Cyclin-dependent kinase inhibitor 3, bac/eukaryotic (1);	0.047098	0.85682	D	0.000000	T	0.60881	0.2303	M	0.73962	2.25	0.80722	D	1	P;P	0.50819	0.925;0.939	B;P	0.48368	0.439;0.575	T	0.67098	-0.5756	10	0.87932	D	0	-22.7559	14.0296	0.64606	0.0:0.0:1.0:0.0	.	17;17	F8WDR6;Q16667	.;CDKN3_HUMAN	K	17	ENSP00000335357:E17K;ENSP00000440404:E17K;ENSP00000396451:E17K;ENSP00000450711:E17K;ENSP00000445572:E17K	ENSP00000216414:E16K	E	+	1	0	CDKN3	53936401	1.000000	0.71417	0.979000	0.43373	0.896000	0.52359	4.497000	0.60367	2.687000	0.91594	0.561000	0.74099	GAA	.	.		0.308	CDKN3-004	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000411158.1		
MKRN3	7681	hgsc.bcm.edu	37	15	23812175	23812175	+	Missense_Mutation	SNP	T	T	C			TCGA-2Y-A9H9-01A-21D-A38X-10	TCGA-2Y-A9H9-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5586a43-bdc1-4030-93f8-cfb7bfa6a4b1	5ab2f233-e5fe-41df-9cef-56c0fdd900d3	g.chr15:23812175T>C	ENST00000314520.3	+	1	1722	c.1246T>C	c.(1246-1248)Tgc>Cgc	p.C416R	MKRN3_ENST00000568252.1_Intron|MKRN3_ENST00000564592.1_Intron|RP11-73C9.1_ENST00000563044.1_RNA|MKRN3_ENST00000568945.1_Intron	NM_005664.3	NP_005655.1	Q13064	MKRN3_HUMAN	makorin ring finger protein 3	416					protein ubiquitination (GO:0016567)	ribonucleoprotein complex (GO:0030529)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(33)|ovary(2)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	61		all_cancers(20;8.44e-25)|all_epithelial(15;3.69e-22)|Lung NSC(15;2.96e-18)|all_lung(15;2.8e-17)|Breast(32;0.000353)|Colorectal(260;0.14)		all cancers(64;3.02e-06)|Epithelial(43;1.94e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0012)		TGGAGACACATGCTTTTACAA	0.517																																					p.C416R		Atlas-SNP	.											.	MKRN3	155	.	0			c.T1246C						.						96.0	94.0	95.0					15																	23812175		2203	4300	6503	SO:0001583	missense	7681	exon1			GACACATGCTTTT	U19107	CCDS10013.1	15q11-q13	2013-01-09	2008-08-13		ENSG00000179455	ENSG00000179455		"""RING-type (C3HC4) zinc fingers"""	7114	protein-coding gene	gene with protein product	"""zinc finger protein 127"""	603856		ZNF127, D15S9		10196367	Standard	NM_005664		Approved	RNF63, ZFP127, MGC88288	uc001ywh.4	Q13064	OTTHUMG00000129160	ENST00000314520.3:c.1246T>C	chr15.hg19:g.23812175T>C	ENSP00000313881:p.Cys416Arg	110.0	0.0		105.0	43.0	NM_005664		Missense_Mutation	SNP	ENST00000314520.3	hg19	CCDS10013.1	.	.	.	.	.	.	.	.	.	.	T	14.08	2.427546	0.43122	.	.	ENSG00000179455	ENST00000314520	D	0.87571	-2.27	4.01	4.01	0.46588	Zinc finger, CCCH-type (2);	0.000000	0.85682	D	0.000000	D	0.93585	0.7952	M	0.89287	3.02	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.94256	0.7498	10	0.87932	D	0	.	11.5517	0.50725	0.0:0.0:0.0:1.0	.	416	Q13064	MKRN3_HUMAN	R	416	ENSP00000313881:C416R	ENSP00000313881:C416R	C	+	1	0	MKRN3	21363268	1.000000	0.71417	0.550000	0.28217	0.160000	0.22226	4.404000	0.59735	2.049000	0.60858	0.533000	0.62120	TGC	.	.		0.517	MKRN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251225.1	NM_005664	
USP8	9101	hgsc.bcm.edu	37	15	50789394	50789394	+	Missense_Mutation	SNP	A	A	C			TCGA-2Y-A9H9-01A-21D-A38X-10	TCGA-2Y-A9H9-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5586a43-bdc1-4030-93f8-cfb7bfa6a4b1	5ab2f233-e5fe-41df-9cef-56c0fdd900d3	g.chr15:50789394A>C	ENST00000396444.3	+	18	3342	c.3004A>C	c.(3004-3006)Aag>Cag	p.K1002Q	RP11-562A8.4_ENST00000560380.1_RNA|USP8_ENST00000307179.4_Missense_Mutation_p.K1002Q|USP8_ENST00000433963.1_Missense_Mutation_p.K1002Q|USP8_ENST00000425032.3_Missense_Mutation_p.K896Q|RP11-562A8.5_ENST00000560159.1_lincRNA	NM_001128610.1|NM_005154.3	NP_001122082.1|NP_005145.3	P40818	UBP8_HUMAN	ubiquitin specific peptidase 8	1002	USP.				cell proliferation (GO:0008283)|endosome organization (GO:0007032)|mitotic cytokinesis (GO:0000281)|protein deubiquitination (GO:0016579)|protein K48-linked deubiquitination (GO:0071108)|protein K63-linked deubiquitination (GO:0070536)|Ras protein signal transduction (GO:0007265)|ubiquitin-dependent protein catabolic process (GO:0006511)	acrosomal vesicle (GO:0001669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|extrinsic component of plasma membrane (GO:0019897)|midbody (GO:0030496)|nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|ubiquitin-specific protease activity (GO:0004843)			central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(5)|lung(16)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	35				all cancers(107;0.000225)|GBM - Glioblastoma multiforme(94;0.000771)		AGAAATCTGGAAGTTACCACC	0.363																																					p.K1002Q		Atlas-SNP	.											.	USP8	90	.	0			c.A3004C						.						87.0	88.0	88.0					15																	50789394		2196	4294	6490	SO:0001583	missense	9101	exon18			ATCTGGAAGTTAC	D29956	CCDS10137.1, CCDS61632.1	15q21.1	2014-03-03	2005-08-08		ENSG00000138592	ENSG00000138592		"""Ubiquitin-specific peptidases"""	12631	protein-coding gene	gene with protein product		603158	"""ubiquitin specific protease 8"""			12838346, 9582025, 24482476	Standard	NM_005154		Approved	HumORF8, KIAA0055, UBPY, SPG59	uc001zyl.4	P40818	OTTHUMG00000131645	ENST00000396444.3:c.3004A>C	chr15.hg19:g.50789394A>C	ENSP00000379721:p.Lys1002Gln	98.0	0.0		114.0	27.0	NM_001128610	B4DKA8|Q2TB31|Q7Z3U2|Q86VA0|Q8IWI7	Missense_Mutation	SNP	ENST00000396444.3	hg19	CCDS10137.1	.	.	.	.	.	.	.	.	.	.	A	29.5	5.007400	0.93287	.	.	ENSG00000138592	ENST00000396444;ENST00000433963;ENST00000307179;ENST00000425032;ENST00000419830;ENST00000396440	T;T;T;T	0.34275	1.37;1.37;1.37;1.37	5.32	5.32	0.75619	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.000000	0.85682	D	0.000000	T	0.43743	0.1261	M	0.66939	2.045	0.80722	D	1	P;P	0.41624	0.757;0.574	B;B	0.42995	0.404;0.312	T	0.48364	-0.9042	10	0.66056	D	0.02	-19.4425	15.5747	0.76368	1.0:0.0:0.0:0.0	.	896;1002	B4DKA8;P40818	.;UBP8_HUMAN	Q	1002;1002;1002;896;220;215	ENSP00000379721:K1002Q;ENSP00000405537:K1002Q;ENSP00000302239:K1002Q;ENSP00000412682:K896Q	ENSP00000302239:K1002Q	K	+	1	0	USP8	48576686	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.870000	0.92336	2.139000	0.66308	0.528000	0.53228	AAG	.	.		0.363	USP8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254541.1	NM_005154	
MEGF11	84465	hgsc.bcm.edu	37	15	66274611	66274611	+	Missense_Mutation	SNP	A	A	T			TCGA-2Y-A9H9-01A-21D-A38X-10	TCGA-2Y-A9H9-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5586a43-bdc1-4030-93f8-cfb7bfa6a4b1	5ab2f233-e5fe-41df-9cef-56c0fdd900d3	g.chr15:66274611A>T	ENST00000409699.2	-	6	782	c.610T>A	c.(610-612)Tgc>Agc	p.C204S	MEGF11_ENST00000395625.2_Missense_Mutation_p.C129S|MEGF11_ENST00000288745.3_Missense_Mutation_p.C129S|MEGF11_ENST00000360698.4_Missense_Mutation_p.C204S|MEGF11_ENST00000395614.1_5'UTR|MEGF11_ENST00000422354.1_Missense_Mutation_p.C204S			A6BM72	MEG11_HUMAN	multiple EGF-like-domains 11	204	EGF-like 3. {ECO:0000255|PROSITE- ProRule:PRU00076}.				homotypic cell-cell adhesion (GO:0034109)|retina layer formation (GO:0010842)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(4)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	19						GCGCAGAGGCACTCGCCGGCG	0.731																																					p.C204S		Atlas-SNP	.											.	MEGF11	70	.	0			c.T610A						.						2.0	2.0	2.0					15																	66274611		1580	3107	4687	SO:0001583	missense	84465	exon6			AGAGGCACTCGCC	AB058677	CCDS10213.2	15q22.31	2006-03-31			ENSG00000157890	ENSG00000157890			29635	protein-coding gene	gene with protein product		612454				11347906	Standard	NM_032445		Approved	KIAA1781, DKFZp434L121	uc002apm.2	A6BM72	OTTHUMG00000133175	ENST00000409699.2:c.610T>A	chr15.hg19:g.66274611A>T	ENSP00000386908:p.Cys204Ser	60.0	0.0		55.0	19.0	NM_032445	Q17R86|Q6UXS5|Q8ND91|Q96KG6	Missense_Mutation	SNP	ENST00000409699.2	hg19	CCDS10213.2	.	.	.	.	.	.	.	.	.	.	A	17.51	3.406569	0.62399	.	.	ENSG00000157890	ENST00000409699;ENST00000288745;ENST00000422354;ENST00000395625;ENST00000360698	T;T;T;T;D	0.99984	-1.33;-1.33;-1.33;-1.33;-11.36	3.73	2.57	0.30868	EGF-like, laminin (2);EGF-like region, conserved site (2);Epidermal growth factor-like, type 3 (1);	0.148379	0.31188	U	0.008099	D	0.99986	0.9997	H	0.98721	4.31	0.58432	D	0.999997	D;D	0.89917	1.0;0.999	D;D	0.91635	0.999;0.999	D	0.96597	0.9442	10	0.87932	D	0	.	9.1404	0.36899	0.8153:0.1847:0.0:0.0	.	204;129	A6BM72;A6BM72-2	MEG11_HUMAN;.	S	204;129;204;129;204	ENSP00000386908:C204S;ENSP00000288745:C129S;ENSP00000414475:C204S;ENSP00000378987:C129S;ENSP00000353919:C204S	ENSP00000288745:C129S	C	-	1	0	MEGF11	64061665	1.000000	0.71417	0.971000	0.41717	0.357000	0.29423	8.879000	0.92398	0.490000	0.27771	-0.488000	0.04728	TGC	.	.		0.731	MEGF11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329307.2	NM_032445	
SMAD3	4088	hgsc.bcm.edu	37	15	67457388	67457388	+	Missense_Mutation	SNP	G	G	T			TCGA-2Y-A9H9-01A-21D-A38X-10	TCGA-2Y-A9H9-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5586a43-bdc1-4030-93f8-cfb7bfa6a4b1	5ab2f233-e5fe-41df-9cef-56c0fdd900d3	g.chr15:67457388G>T	ENST00000327367.4	+	2	672	c.362G>T	c.(361-363)tGc>tTc	p.C121F	SMAD3_ENST00000540846.2_Missense_Mutation_p.C16F|SMAD3_ENST00000537194.2_5'Flank|SMAD3_ENST00000439724.3_Missense_Mutation_p.C77F	NM_005902.3	NP_005893.1	P84022	SMAD3_HUMAN	SMAD family member 3	121	MH1. {ECO:0000255|PROSITE- ProRule:PRU00438}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of cysteine-type endopeptidase activity involved in apoptotic signaling pathway (GO:0097296)|activin receptor signaling pathway (GO:0032924)|cell cycle arrest (GO:0007050)|cell-cell junction organization (GO:0045216)|developmental growth (GO:0048589)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic foregut morphogenesis (GO:0048617)|embryonic pattern specification (GO:0009880)|endoderm development (GO:0007492)|evasion or tolerance of host defenses by virus (GO:0019049)|extrinsic apoptotic signaling pathway (GO:0097191)|gene expression (GO:0010467)|heart looping (GO:0001947)|immune response (GO:0006955)|immune system development (GO:0002520)|in utero embryonic development (GO:0001701)|intracellular signal transduction (GO:0035556)|lens fiber cell differentiation (GO:0070306)|liver development (GO:0001889)|mesoderm formation (GO:0001707)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of inflammatory response (GO:0050728)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of osteoblast proliferation (GO:0033689)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|negative regulation of wound healing (GO:0061045)|nodal signaling pathway (GO:0038092)|osteoblast development (GO:0002076)|paraxial mesoderm morphogenesis (GO:0048340)|pericardium development (GO:0060039)|positive regulation of alkaline phosphatase activity (GO:0010694)|positive regulation of bone mineralization (GO:0030501)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of cell migration (GO:0030335)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of gene expression (GO:0010628)|positive regulation of gene expression involved in extracellular matrix organization (GO:1901313)|positive regulation of interleukin-1 beta production (GO:0032731)|positive regulation of positive chemotaxis (GO:0050927)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of transcription factor import into nucleus (GO:0042993)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta3 production (GO:0032916)|primary miRNA processing (GO:0031053)|protein stabilization (GO:0050821)|regulation of binding (GO:0051098)|regulation of epithelial cell proliferation (GO:0050678)|regulation of immune response (GO:0050776)|regulation of striated muscle tissue development (GO:0016202)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|regulation of transforming growth factor beta2 production (GO:0032909)|response to hypoxia (GO:0001666)|signal transduction involved in regulation of gene expression (GO:0023019)|SMAD protein complex assembly (GO:0007183)|somitogenesis (GO:0001756)|T cell activation (GO:0042110)|thyroid gland development (GO:0030878)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transdifferentiation (GO:0060290)|transforming growth factor beta receptor signaling pathway (GO:0007179)|transport (GO:0006810)|ureteric bud development (GO:0001657)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear chromatin (GO:0000790)|nuclear inner membrane (GO:0005637)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|SMAD protein complex (GO:0071141)|SMAD2-SMAD3 protein complex (GO:0071144)|transcription factor complex (GO:0005667)	beta-catenin binding (GO:0008013)|bHLH transcription factor binding (GO:0043425)|chromatin DNA binding (GO:0031490)|co-SMAD binding (GO:0070410)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|double-stranded DNA binding (GO:0003690)|enhancer binding (GO:0035326)|phosphatase binding (GO:0019902)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|R-SMAD binding (GO:0070412)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|transforming growth factor beta receptor binding (GO:0005160)|transforming growth factor beta receptor, pathway-specific cytoplasmic mediator activity (GO:0030618)|ubiquitin binding (GO:0043130)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|central_nervous_system(1)|endometrium(4)|large_intestine(11)|lung(9)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	31				Colorectal(3;0.0129)|READ - Rectum adenocarcinoma(7;0.125)		GACGAGGTCTGCGTGAATCCC	0.607																																					p.C121F		Atlas-SNP	.											.	SMAD3	119	.	0			c.G362T						.						94.0	91.0	92.0					15																	67457388		2201	4299	6500	SO:0001583	missense	4088	exon2			AGGTCTGCGTGAA	BC050743	CCDS10222.1, CCDS45288.1, CCDS53950.1, CCDS53951.1	15q21-q22	2006-11-06	2006-11-06	2004-05-26	ENSG00000166949	ENSG00000166949		"""SMADs"""	6769	protein-coding gene	gene with protein product		603109	"""MAD, mothers against decapentaplegic homolog 3 (Drosophila)"", ""SMAD, mothers against DPP homolog 3 (Drosophila)"""	MADH3		8774881, 8673135	Standard	NM_001145102		Approved	JV15-2, HsT17436	uc002aqj.3	P84022	OTTHUMG00000133230	ENST00000327367.4:c.362G>T	chr15.hg19:g.67457388G>T	ENSP00000332973:p.Cys121Phe	57.0	0.0		53.0	18.0	NM_005902	A8K4B6|B7Z4Z5|B7Z6M9|B7Z9Q2|F5H383|O09064|O09144|O14510|O35273|Q92940|Q93002|Q9GKR4	Missense_Mutation	SNP	ENST00000327367.4	hg19	CCDS10222.1	.	.	.	.	.	.	.	.	.	.	G	23.0	4.361582	0.82353	.	.	ENSG00000166949	ENST00000327367;ENST00000535241;ENST00000540846;ENST00000439724	D;D;D	0.97994	-4.65;-4.65;-4.65	4.39	4.39	0.52855	MAD homology, MH1 (3);MAD homology 1, Dwarfin-type (2);	0.000000	0.85682	D	0.000000	D	0.99223	0.9730	H	0.97682	4.055	0.80722	D	1	D;D	0.89917	1.0;0.996	D;D	0.87578	0.998;0.968	D	0.98766	1.0726	10	0.87932	D	0	.	17.1514	0.86779	0.0:0.0:1.0:0.0	.	77;121	B7Z4Z5;P84022	.;SMAD3_HUMAN	F	121;121;16;77	ENSP00000332973:C121F;ENSP00000437757:C16F;ENSP00000401133:C77F	ENSP00000332973:C121F	C	+	2	0	SMAD3	65244442	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.428000	0.97476	2.270000	0.75569	0.561000	0.74099	TGC	.	.		0.607	SMAD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256967.2	NM_005902	
MYO9A	4649	hgsc.bcm.edu	37	15	72231259	72231259	+	Missense_Mutation	SNP	C	C	T			TCGA-2Y-A9H9-01A-21D-A38X-10	TCGA-2Y-A9H9-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5586a43-bdc1-4030-93f8-cfb7bfa6a4b1	5ab2f233-e5fe-41df-9cef-56c0fdd900d3	g.chr15:72231259C>T	ENST00000356056.5	-	16	2784	c.2312G>A	c.(2311-2313)cGg>cAg	p.R771Q	MYO9A_ENST00000424560.1_Missense_Mutation_p.R771Q|MYO9A_ENST00000563542.1_5'UTR|MYO9A_ENST00000564571.1_Missense_Mutation_p.R771Q|MYO9A_ENST00000566885.1_Missense_Mutation_p.R391Q|MYO9A_ENST00000444904.1_Missense_Mutation_p.R752Q	NM_006901.3	NP_008832.2	B2RTY4	MYO9A_HUMAN	myosin IXA	771	Myosin motor.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|visual perception (GO:0007601)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|unconventional myosin complex (GO:0016461)	ATP binding (GO:0005524)|GTPase activator activity (GO:0005096)|metal ion binding (GO:0046872)|motor activity (GO:0003774)			NS(4)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(29)|lung(27)|ovary(1)|pancreas(1)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	88						GGGATTTTTCCGGGTTATACC	0.318																																					p.R771Q		Atlas-SNP	.											.	MYO9A	203	.	0			c.G2312A						.						62.0	64.0	64.0					15																	72231259		2199	4296	6495	SO:0001583	missense	4649	exon16			TTTTTCCGGGTTA	AF117888	CCDS10239.1	15q22-q23	2011-09-27			ENSG00000066933	ENSG00000066933		"""Myosins / Myosin superfamily : Class IX"""	7608	protein-coding gene	gene with protein product		604875				10409426	Standard	NM_006901		Approved	FLJ11061, FLJ13244, MGC71859	uc002atl.5	B2RTY4	OTTHUMG00000133440	ENST00000356056.5:c.2312G>A	chr15.hg19:g.72231259C>T	ENSP00000348349:p.Arg771Gln	36.0	0.0		77.0	26.0	NM_006901	B0I1T5|C9IYB3|C9JA86|Q14787|Q3YLD7|Q3YLD8|Q6P986|Q9H8T5|Q9NTG2|Q9NUY2|Q9UEP3|Q9UNJ2	Missense_Mutation	SNP	ENST00000356056.5	hg19	CCDS10239.1	.	.	.	.	.	.	.	.	.	.	C	29.6	5.022035	0.93462	.	.	ENSG00000066933	ENST00000356056;ENST00000424560;ENST00000444904;ENST00000261864	D;D;D	0.86366	-2.11;-2.11;-2.11	5.45	5.45	0.79879	Myosin head, motor domain (1);	.	.	.	.	D	0.90786	0.7107	M	0.61703	1.905	0.52501	D	0.99995	D;P;D	0.89917	1.0;0.89;0.997	P;B;P	0.62740	0.906;0.171;0.736	D	0.88532	0.3103	9	0.25751	T	0.34	.	14.7606	0.69604	0.0:1.0:0.0:0.0	.	752;752;771	B2RTY4-2;B7WP69;B2RTY4	.;.;MYO9A_HUMAN	Q	771;771;752;752	ENSP00000348349:R771Q;ENSP00000399162:R771Q;ENSP00000398250:R752Q	ENSP00000261864:R752Q	R	-	2	0	MYO9A	70018313	1.000000	0.71417	1.000000	0.80357	0.917000	0.54804	5.609000	0.67661	2.573000	0.86826	0.585000	0.79938	CGG	.	.		0.318	MYO9A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257308.1	NM_006901	
TICRR	90381	hgsc.bcm.edu	37	15	90168109	90168109	+	Missense_Mutation	SNP	G	G	A	rs149974689		TCGA-2Y-A9H9-01A-21D-A38X-10	TCGA-2Y-A9H9-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5586a43-bdc1-4030-93f8-cfb7bfa6a4b1	5ab2f233-e5fe-41df-9cef-56c0fdd900d3	g.chr15:90168109G>A	ENST00000268138.7	+	20	4673	c.4568G>A	c.(4567-4569)cGt>cAt	p.R1523H	TICRR_ENST00000560985.1_Missense_Mutation_p.R1522H|KIF7_ENST00000558928.1_Intron			Q7Z2Z1	TICRR_HUMAN	TOPBP1-interacting checkpoint and replication regulator	1523			R -> C (in dbSNP:rs894157). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334}.		cell cycle checkpoint (GO:0000075)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|formation of translation preinitiation complex (GO:0001731)|mitotic DNA replication checkpoint (GO:0033314)|regulation of DNA-dependent DNA replication initiation (GO:0030174)|response to ionizing radiation (GO:0010212)	nucleus (GO:0005634)	chromatin binding (GO:0003682)										ATGCCTTCCCGTGACGTGCAC	0.582																																					p.R1523H		Atlas-SNP	.											.	.	.	.	0			c.G4568A						.	G	HIS/ARG	0,4400		0,0,2200	106.0	113.0	111.0		4568	-3.8	0.0	15	dbSNP_134	111	1,8597	1.2+/-3.3	0,1,4298	yes	missense	C15orf42	NM_152259.3	29	0,1,6498	AA,AG,GG		0.0116,0.0,0.0077	benign	1523/1911	90168109	1,12997	2200	4299	6499	SO:0001583	missense	90381	exon20			CTTCCCGTGACGT	AK123612	CCDS10352.2	15q26.1	2012-07-11	2012-07-11	2012-07-11	ENSG00000140534	ENSG00000140534			28704	protein-coding gene	gene with protein product	"""TOPBP1-interacting replication-stimulating protein"", ""SLD3 homolog (S. cerevisiae)"""	613298	"""chromosome 15 open reading frame 42"""	C15orf42		20116089, 20080954	Standard	NM_152259		Approved	MGC45866, FLJ41618, Treslin, SLD3	uc002boe.3	Q7Z2Z1	OTTHUMG00000149648	ENST00000268138.7:c.4568G>A	chr15.hg19:g.90168109G>A	ENSP00000268138:p.Arg1523His	85.0	0.0		111.0	54.0	NM_152259	B2RE07|B3KVV9|D3IUT4|Q8N4X8|Q8NCH6|Q9BU55	Missense_Mutation	SNP	ENST00000268138.7	hg19	CCDS10352.2	.	.	.	.	.	.	.	.	.	.	G	11.51	1.659346	0.29515	0.0	1.16E-4	ENSG00000140534	ENST00000268138	T	0.08193	3.12	5.12	-3.77	0.04346	.	0.815093	0.11014	N	0.609103	T	0.02807	0.0084	N	0.08118	0	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.44065	-0.9352	10	0.16896	T	0.51	1.6738	2.561	0.04771	0.3969:0.3531:0.1357:0.1142	.	1523	Q7Z2Z1	TICRR_HUMAN	H	1523	ENSP00000268138:R1523H	ENSP00000268138:R1523H	R	+	2	0	C15orf42	87969113	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.017000	0.12590	-0.956000	0.03631	-0.302000	0.09304	CGT	.	G|1.000;A|0.000		0.582	TICRR-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000312856.1	NM_152259	
C15orf32	145858	hgsc.bcm.edu	37	15	93015518	93015518	+	Missense_Mutation	SNP	C	C	T			TCGA-2Y-A9H9-01A-21D-A38X-10	TCGA-2Y-A9H9-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5586a43-bdc1-4030-93f8-cfb7bfa6a4b1	5ab2f233-e5fe-41df-9cef-56c0fdd900d3	g.chr15:93015518C>T	ENST00000333334.2	+	1	635	c.140C>T	c.(139-141)gCg>gTg	p.A47V	RP11-763K15.1_ENST00000554440.1_lincRNA|C15orf32_ENST00000556865.1_Missense_Mutation_p.A47V	NM_153040.2	NP_694585.1	Q32M92	CO032_HUMAN	chromosome 15 open reading frame 32	47										endometrium(1)|large_intestine(2)|lung(5)|ovary(1)|prostate(1)|skin(2)	12	Lung NSC(78;0.0893)|all_lung(78;0.125)		BRCA - Breast invasive adenocarcinoma(143;0.0493)|OV - Ovarian serous cystadenocarcinoma(32;0.125)			CCTTTCTCGGCGAGGCCATGT	0.527																																					p.A47V		Atlas-SNP	.											.	C15orf32	22	.	0			c.C140T						.						102.0	105.0	104.0					15																	93015518		2198	4298	6496	SO:0001583	missense	145858	exon1			TCTCGGCGAGGCC		CCDS10373.1, CCDS73784.1	15q26.1	2014-09-10			ENSG00000183643	ENSG00000183643			26549	protein-coding gene	gene with protein product							Standard	NM_153040		Approved	FLJ32831	uc002brc.1	Q32M92	OTTHUMG00000149844	ENST00000333334.2:c.140C>T	chr15.hg19:g.93015518C>T	ENSP00000330267:p.Ala47Val	188.0	0.0		192.0	91.0	NM_153040	C5HTZ8|Q96M45	Missense_Mutation	SNP	ENST00000333334.2	hg19	CCDS10373.1	.	.	.	.	.	.	.	.	.	.	C	2.546	-0.305101	0.05495	.	.	ENSG00000183643	ENST00000333334	T	0.54866	0.55	1.8	-1.45	0.08828	.	.	.	.	.	T	0.22975	0.0555	N	0.03608	-0.345	0.09310	N	1	B	0.14012	0.009	B	0.10450	0.005	T	0.16070	-1.0415	9	0.87932	D	0	.	1.0073	0.01489	0.2283:0.3942:0.2242:0.1533	.	47	Q32M92	CO032_HUMAN	V	47	ENSP00000330267:A47V	ENSP00000330267:A47V	A	+	2	0	C15orf32	90816522	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.193000	0.03049	-0.397000	0.07691	-1.298000	0.01336	GCG	.	.		0.527	C15orf32-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000313527.2	NM_153040	
GPR139	124274	hgsc.bcm.edu	37	16	20043728	20043728	+	Missense_Mutation	SNP	A	A	G			TCGA-2Y-A9H9-01A-21D-A38X-10	TCGA-2Y-A9H9-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5586a43-bdc1-4030-93f8-cfb7bfa6a4b1	5ab2f233-e5fe-41df-9cef-56c0fdd900d3	g.chr16:20043728A>G	ENST00000570682.1	-	2	691	c.391T>C	c.(391-393)Tgc>Cgc	p.C131R		NM_001002911.2	NP_001002911.1	Q6DWJ6	GP139_HUMAN	G protein-coupled receptor 139	131					G-protein coupled receptor signaling pathway (GO:0007186)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	neuropeptide receptor activity (GO:0008188)			autonomic_ganglia(1)|central_nervous_system(1)|kidney(1)|large_intestine(4)|lung(17)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)	30						AGCGGGTGGCAGACAGCGATA	0.498																																					p.C131R		Atlas-SNP	.											.	GPR139	75	.	0			c.T391C						.						175.0	138.0	150.0					16																	20043728		2203	4300	6503	SO:0001583	missense	124274	exon2			GGTGGCAGACAGC	AY255545	CCDS32398.1	16p13.11	2012-08-21						"""GPCR / Class A : Orphans"""	19995	protein-coding gene	gene with protein product						12679517	Standard	XM_005255114		Approved	PGR3	uc002dgu.1	Q6DWJ6		ENST00000570682.1:c.391T>C	chr16.hg19:g.20043728A>G	ENSP00000458791:p.Cys131Arg	114.0	0.0		149.0	73.0	NM_001002911	A8K5R9|Q86SP2|Q8TDU8	Missense_Mutation	SNP	ENST00000570682.1	hg19	CCDS32398.1	.	.	.	.	.	.	.	.	.	.	A	18.00	3.525661	0.64860	.	.	ENSG00000180269	ENST00000326571	.	.	.	5.73	5.73	0.89815	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.75184	0.3815	L	0.55103	1.725	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.75906	-0.3152	9	0.51188	T	0.08	-49.3405	15.1985	0.73116	1.0:0.0:0.0:0.0	.	131	Q6DWJ6	GP139_HUMAN	R	131	.	ENSP00000370779:C131R	C	-	1	0	GPR139	19951229	1.000000	0.71417	0.997000	0.53966	0.860000	0.49131	8.730000	0.91510	2.186000	0.69663	0.533000	0.62120	TGC	.	.		0.498	GPR139-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438522.1	NM_001002911	
CDH11	1009	hgsc.bcm.edu	37	16	65026819	65026819	+	Splice_Site	SNP	T	T	C			TCGA-2Y-A9H9-01A-21D-A38X-10	TCGA-2Y-A9H9-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5586a43-bdc1-4030-93f8-cfb7bfa6a4b1	5ab2f233-e5fe-41df-9cef-56c0fdd900d3	g.chr16:65026819T>C	ENST00000268603.4	-	5	1257	c.642A>G	c.(640-642)acA>acG	p.T214T	CDH11_ENST00000566827.1_Splice_Site_p.T88T|CDH11_ENST00000394156.3_Splice_Site_p.T214T	NM_001797.2	NP_001788.2	P55287	CAD11_HUMAN	cadherin 11, type 2, OB-cadherin (osteoblast)	214	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|corticospinal tract morphogenesis (GO:0021957)|homophilic cell adhesion (GO:0007156)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(5)|kidney(5)|large_intestine(19)|lung(40)|ovary(3)|prostate(3)|skin(2)|urinary_tract(2)	88		Ovarian(137;0.0973)		OV - Ovarian serous cystadenocarcinoma(108;0.205)		CCACAGTACCTGTCTGTGCTT	0.423			T	USP6	aneurysmal bone cysts					TSP Lung(24;0.17)																											p.T214T		Atlas-SNP	.		Dom	yes		16	16q22.1	1009	"""cadherin 11, type 2, OB-cadherin (osteoblast)"""		M	.	CDH11	260	.	0			c.A642G						.						145.0	112.0	123.0					16																	65026819		2203	4300	6503	SO:0001630	splice_region_variant	1009	exon5			AGTACCTGTCTGT	D21255	CCDS10803.1	16q21	2010-01-26			ENSG00000140937	ENSG00000140937		"""Cadherins / Major cadherins"""	1750	protein-coding gene	gene with protein product	"""OB-Cadherin"""	600023				9615235	Standard	NM_001797		Approved	OB, CAD11	uc002eoi.3	P55287	OTTHUMG00000137494	ENST00000268603.4:c.643+1A>G	chr16.hg19:g.65026819T>C		27.0	0.0		55.0	24.0	NM_001797	A8K5D6|A8MZC8|B7WP28|Q15065|Q15066|Q9UQ93|Q9UQ94	Silent	SNP	ENST00000268603.4	hg19	CCDS10803.1																																																																																			.	.		0.423	CDH11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268755.1	NM_033664	Silent
SLC52A1	55065	hgsc.bcm.edu	37	17	4937150	4937150	+	Missense_Mutation	SNP	G	G	A	rs370188723		TCGA-2Y-A9H9-01A-21D-A38X-10	TCGA-2Y-A9H9-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5586a43-bdc1-4030-93f8-cfb7bfa6a4b1	5ab2f233-e5fe-41df-9cef-56c0fdd900d3	g.chr17:4937150G>A	ENST00000424747.1	-	3	1346	c.634C>T	c.(634-636)Cgg>Tgg	p.R212W	SLC52A1_ENST00000254853.5_Missense_Mutation_p.R212W|SLC52A1_ENST00000512825.2_Missense_Mutation_p.R212W	NM_001104577.1	NP_001098047.1	Q9NWF4	S52A1_HUMAN	solute carrier family 52 (riboflavin transporter), member 1	212					riboflavin transport (GO:0032218)	integral component of plasma membrane (GO:0005887)	riboflavin transporter activity (GO:0032217)|virus receptor activity (GO:0001618)										AGGAGACCCCGGAAGGCGGCA	0.602																																					p.R212W		Atlas-SNP	.											.	.	.	.	0			c.C634T						.	G	TRP/ARG,TRP/ARG	0,4406		0,0,2203	66.0	68.0	68.0		634,634	1.1	0.9	17		68	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	GPR172B	NM_001104577.1,NM_017986.3	101,101	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign,benign	212/449,212/449	4937150	1,13005	2203	4300	6503	SO:0001583	missense	55065	exon3			GACCCCGGAAGGC	AY070775	CCDS11066.1	17p13.3	2013-07-17	2013-07-17	2012-02-29	ENSG00000132517	ENSG00000132517		"""Solute carriers"""	30225	protein-coding gene	gene with protein product	"""riboflavin transporter 1"""	607883	"""G protein-coupled receptor 172B"""	GPR172B		12740431, 18632736	Standard	NM_001104577		Approved	FLJ10060, GPCR42, PAR2, hRFT1, RFVT1	uc002gao.4	Q9NWF4	OTTHUMG00000099448	ENST00000424747.1:c.634C>T	chr17.hg19:g.4937150G>A	ENSP00000399979:p.Arg212Trp	126.0	0.0		77.0	55.0	NM_017986	B5MEV1|B5MEV2|Q6P9E0|Q86UT0	Missense_Mutation	SNP	ENST00000424747.1	hg19	CCDS11066.1	.	.	.	.	.	.	.	.	.	.	G	13.15	2.151509	0.38021	0.0	1.16E-4	ENSG00000132517	ENST00000254853;ENST00000512825;ENST00000424747	T;T;T	0.74315	-0.83;-0.68;-0.83	1.11	1.11	0.20524	.	0.687859	0.14531	N	0.313864	T	0.45875	0.1364	N	0.08118	0	0.20074	N	0.999938	P;B	0.34615	0.459;0.33	B;B	0.18871	0.023;0.006	T	0.31916	-0.9926	10	0.34782	T	0.22	.	8.0807	0.30744	0.0:0.0:1.0:0.0	.	212;212	F5H5Y1;Q9NWF4	.;RFT_HUMAN	W	212	ENSP00000254853:R212W;ENSP00000443026:R212W;ENSP00000399979:R212W	ENSP00000254853:R212W	R	-	1	2	GPR172B	4877874	.	.	0.908000	0.35775	0.673000	0.39480	.	.	0.910000	0.36722	0.563000	0.77884	CGG	.	.		0.602	SLC52A1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216913.1	NM_017986	
CTC1	80169	hgsc.bcm.edu	37	17	8140795	8140795	+	Silent	SNP	T	T	G			TCGA-2Y-A9H9-01A-21D-A38X-10	TCGA-2Y-A9H9-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5586a43-bdc1-4030-93f8-cfb7bfa6a4b1	5ab2f233-e5fe-41df-9cef-56c0fdd900d3	g.chr17:8140795T>G	ENST00000315684.8	-	5	697	c.690A>C	c.(688-690)ctA>ctC	p.L230L	CTC1_ENST00000581671.1_5'UTR	NM_025099.5	NP_079375.3	Q2NKJ3	CTC1_HUMAN	CTS telomere maintenance complex component 1	230					bone marrow development (GO:0048539)|cellular response to DNA damage stimulus (GO:0006974)|hematopoietic stem cell proliferation (GO:0071425)|multicellular organism growth (GO:0035264)|positive regulation of DNA replication (GO:0045740)|positive regulation of fibroblast proliferation (GO:0048146)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)|replicative senescence (GO:0090399)|spleen development (GO:0048536)|telomere maintenance (GO:0000723)|telomere maintenance via telomere lengthening (GO:0010833)|thymus development (GO:0048538)	nuclear chromosome, telomeric region (GO:0000784)|nucleus (GO:0005634)|Stn1-Ten1 complex (GO:0070188)	single-stranded DNA binding (GO:0003697)			NS(1)|endometrium(6)|kidney(3)|large_intestine(6)|lung(8)|ovary(1)|skin(4)	29						TCAATCGAACTAGACTCCCAG	0.498																																					p.L230L		Atlas-SNP	.											.	CTC1	75	.	0			c.A690C						.						98.0	97.0	97.0					17																	8140795		2009	4166	6175	SO:0001819	synonymous_variant	80169	exon5			TCGAACTAGACTC	AL831955	CCDS42259.1	17p13.1	2011-02-21	2011-02-21	2011-02-21	ENSG00000178971	ENSG00000178971			26169	protein-coding gene	gene with protein product	"""conserved telomere maintenance component 1"", ""alpha accessory factor 132"", ""conserved telomere capping protein 1"""	613129	"""tmp494178"", ""chromosome 17 open reading frame 68"""	C17orf68		19854130, 19854131	Standard	NM_025099		Approved	FLJ22170, AAF132	uc002gkq.4	Q2NKJ3		ENST00000315684.8:c.690A>C	chr17.hg19:g.8140795T>G		100.0	0.0		53.0	36.0	NM_025099	B3KR66|C9JEX5|Q1PCD1|Q2TBE3|Q8N3S6|Q9H6L0	Silent	SNP	ENST00000315684.8	hg19	CCDS42259.1																																																																																			.	.		0.498	CTC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000442012.1	NM_025099	
TLK2	11011	hgsc.bcm.edu	37	17	60685417	60685417	+	Nonsense_Mutation	SNP	C	C	T			TCGA-2Y-A9H9-01A-21D-A38X-10	TCGA-2Y-A9H9-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5586a43-bdc1-4030-93f8-cfb7bfa6a4b1	5ab2f233-e5fe-41df-9cef-56c0fdd900d3	g.chr17:60685417C>T	ENST00000326270.9	+	22	2321	c.2053C>T	c.(2053-2055)Cag>Tag	p.Q685*	TLK2_ENST00000582809.1_Nonsense_Mutation_p.Q514*|TLK2_ENST00000343388.7_Nonsense_Mutation_p.Q631*|TLK2_ENST00000346027.5_Nonsense_Mutation_p.Q663*|TLK2_ENST00000542523.1_Nonsense_Mutation_p.Q631*	NM_001284333.1	NP_001271262.1	Q86UE8	TLK2_HUMAN	tousled-like kinase 2	685	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell cycle (GO:0007049)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|chromatin modification (GO:0016568)|chromosome segregation (GO:0007059)|intracellular signal transduction (GO:0035556)|negative regulation of autophagy (GO:0010507)|negative regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032435)|peptidyl-serine phosphorylation (GO:0018105)|protein phosphorylation (GO:0006468)|regulation of chromatin assembly or disassembly (GO:0001672)	intermediate filament (GO:0005882)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(10)|kidney(4)|large_intestine(6)|liver(2)|lung(10)|prostate(1)|stomach(1)|urinary_tract(1)	39						TGGCCATAACCAGTCTCAGCA	0.398																																					p.Q663X		Atlas-SNP	.											.	TLK2	223	.	0			c.C1987T						.						64.0	66.0	66.0					17																	60685417		2203	4300	6503	SO:0001587	stop_gained	11011	exon21			CATAACCAGTCTC	AB004884	CCDS11633.1, CCDS45753.1, CCDS62283.1	17q23	2008-07-18							11842	protein-coding gene	gene with protein product		608439				9427565, 10523312	Standard	NM_006852		Approved	PKU-ALPHA, MGC44450	uc002izz.4	Q86UE8		ENST00000326270.9:c.2053C>T	chr17.hg19:g.60685417C>T	ENSP00000316512:p.Gln685*	229.0	0.0		338.0	95.0	NM_006852	D3DU07|Q9UKI7|Q9Y4F7	Nonsense_Mutation	SNP	ENST00000326270.9	hg19		.	.	.	.	.	.	.	.	.	.	C	41	8.548131	0.98859	.	.	ENSG00000146872	ENST00000346027;ENST00000343388;ENST00000326270;ENST00000542523	.	.	.	5.78	5.78	0.91487	.	0.052921	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	19.0021	0.92838	0.0:1.0:0.0:0.0	.	.	.	.	X	663;631;685;631	.	ENSP00000316512:Q685X	Q	+	1	0	TLK2	58039149	1.000000	0.71417	1.000000	0.80357	0.937000	0.57800	7.794000	0.85869	2.724000	0.93272	0.563000	0.77884	CAG	.	.		0.398	TLK2-004	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000445140.1	NM_006852	
MARCH10	162333	hgsc.bcm.edu	37	17	60814012	60814012	+	Missense_Mutation	SNP	T	T	A			TCGA-2Y-A9H9-01A-21D-A38X-10	TCGA-2Y-A9H9-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5586a43-bdc1-4030-93f8-cfb7bfa6a4b1	5ab2f233-e5fe-41df-9cef-56c0fdd900d3	g.chr17:60814012T>A	ENST00000311269.5	-	6	1491	c.1217A>T	c.(1216-1218)aAa>aTa	p.K406I	RP11-156L14.1_ENST00000579201.1_RNA|RP11-156L14.1_ENST00000584597.1_RNA|MARCH10_ENST00000583600.1_Missense_Mutation_p.K444I|RP11-156L14.1_ENST00000577270.1_RNA|RP11-156L14.1_ENST00000582564.1_RNA|MARCH10_ENST00000544856.2_Missense_Mutation_p.K405I|MARCH10_ENST00000456609.2_Missense_Mutation_p.K406I	NM_152598.2	NP_689811.2	Q8NA82	MARHA_HUMAN	membrane-associated ring finger (C3HC4) 10, E3 ubiquitin protein ligase	406					protein ubiquitination (GO:0016567)		ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(11)|liver(1)|lung(15)	38						GGGCTCGGATTTGGTGTCCCA	0.498																																					p.K406I		Atlas-SNP	.											.	MARCH10	102	.	0			c.A1217T						.						85.0	72.0	76.0					17																	60814012		2203	4300	6503	SO:0001583	missense	162333	exon6			TCGGATTTGGTGT	AK093076	CCDS11635.1, CCDS74122.1, CCDS74123.1	17q23.3	2013-01-09	2012-02-23	2007-08-20		ENSG00000173838		"""RING-type (C3HC4) zinc fingers"", ""MARCH membrane-associated ring fingers"""	26655	protein-coding gene	gene with protein product		613337	"""ring finger protein 190"", ""membrane-associated ring finger (C3HC4) 10"""	RNF190		17604280	Standard	XM_005257103		Approved	FLJ35757, MARCH-X	uc002jag.4	Q8NA82		ENST00000311269.5:c.1217A>T	chr17.hg19:g.60814012T>A	ENSP00000311496:p.Lys406Ile	80.0	0.0		130.0	76.0	NM_001100875	D3DU09|Q8IYS7|Q8N7Z7	Missense_Mutation	SNP	ENST00000311269.5	hg19	CCDS11635.1	.	.	.	.	.	.	.	.	.	.	T	8.240	0.806576	0.16467	.	.	ENSG00000173838	ENST00000456609;ENST00000311269;ENST00000544856	T;T;T	0.36878	1.23;1.23;1.23	5.49	0.604	0.17547	.	0.722811	0.13001	N	0.421669	T	0.39384	0.1076	M	0.66939	2.045	0.09310	N	1	P;P;P	0.49783	0.883;0.928;0.883	B;P;B	0.50708	0.445;0.648;0.445	T	0.32241	-0.9914	10	0.72032	D	0.01	-3.7253	1.5562	0.02585	0.2938:0.0824:0.1528:0.4711	.	405;405;406	B3KVK0;G3V1Q5;Q8NA82	.;.;MARHA_HUMAN	I	406;406;405	ENSP00000416177:K406I;ENSP00000311496:K406I;ENSP00000443746:K405I	ENSP00000311496:K406I	K	-	2	0	MARCH10	58167744	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.254000	0.08781	-0.192000	0.10432	-1.969000	0.00466	AAA	.	.		0.498	MARCH10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000445252.1	NM_152598	
MFSD11	79157	hgsc.bcm.edu	37	17	74772613	74772613	+	Missense_Mutation	SNP	A	A	T			TCGA-2Y-A9H9-01A-21D-A38X-10	TCGA-2Y-A9H9-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5586a43-bdc1-4030-93f8-cfb7bfa6a4b1	5ab2f233-e5fe-41df-9cef-56c0fdd900d3	g.chr17:74772613A>T	ENST00000588460.1	+	12	3217	c.1175A>T	c.(1174-1176)aAg>aTg	p.K392M	MFSD11_ENST00000355954.3_Missense_Mutation_p.K340M|MFSD11_ENST00000586622.1_Missense_Mutation_p.K392M|MFSD11_ENST00000590514.1_Missense_Mutation_p.K392M|MFSD11_ENST00000336509.4_Missense_Mutation_p.K392M|MFSD11_ENST00000593181.1_Missense_Mutation_p.K340M|MFSD11_ENST00000590070.1_3'UTR	NM_001242534.1	NP_001229463.1	O43934	MFS11_HUMAN	major facilitator superfamily domain containing 11	392						integral component of membrane (GO:0016021)				endometrium(1)|kidney(2)|large_intestine(3)|lung(7)|ovary(2)|prostate(1)|skin(1)	17						GCCATCTTCAAGTTTGTTCAG	0.433																																					p.K392M		Atlas-SNP	.											MFSD11,NS,lymphoid_neoplasm,0,1	MFSD11	47	.	0			c.A1175T						.						167.0	160.0	162.0					17																	74772613		2203	4300	6503	SO:0001583	missense	79157	exon12			TCTTCAAGTTTGT	BC002753	CCDS11750.1, CCDS56045.1	17q25.1	2012-03-09			ENSG00000092931	ENSG00000092931			25458	protein-coding gene	gene with protein product						9358160	Standard	NM_001242532		Approved	FLJ22196, FLJ20226	uc002jte.3	O43934		ENST00000588460.1:c.1175A>T	chr17.hg19:g.74772613A>T	ENSP00000464932:p.Lys392Met	46.0	0.0		60.0	36.0	NM_001242532	O43442|Q9NXI5	Missense_Mutation	SNP	ENST00000588460.1	hg19	CCDS11750.1	.	.	.	.	.	.	.	.	.	.	A	19.90	3.912704	0.72983	.	.	ENSG00000092931	ENST00000336509;ENST00000355954	T;T	0.80393	-1.37;-1.37	5.43	5.43	0.79202	Major facilitator superfamily domain, general substrate transporter (1);	0.044496	0.85682	D	0.000000	D	0.90926	0.7148	M	0.89478	3.035	0.80722	D	1	D;D	0.89917	1.0;0.96	D;P	0.77004	0.989;0.802	D	0.92324	0.5868	10	0.59425	D	0.04	-15.4372	15.4756	0.75478	1.0:0.0:0.0:0.0	.	340;392	O43934-2;O43934	.;MFS11_HUMAN	M	392;340	ENSP00000337240:K392M;ENSP00000348225:K340M	ENSP00000337240:K392M	K	+	2	0	MFSD11	72284208	1.000000	0.71417	1.000000	0.80357	0.851000	0.48451	6.088000	0.71371	2.046000	0.60703	0.460000	0.39030	AAG	.	.		0.433	MFSD11-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451516.1	NM_024311	
FASN	2194	hgsc.bcm.edu	37	17	80044945	80044945	+	Missense_Mutation	SNP	C	C	A			TCGA-2Y-A9H9-01A-21D-A38X-10	TCGA-2Y-A9H9-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5586a43-bdc1-4030-93f8-cfb7bfa6a4b1	5ab2f233-e5fe-41df-9cef-56c0fdd900d3	g.chr17:80044945C>A	ENST00000306749.2	-	21	3626	c.3408G>T	c.(3406-3408)gaG>gaT	p.E1136D		NM_004104.4	NP_004095.4	P49327	FAS_HUMAN	fatty acid synthase	1136					acetyl-CoA metabolic process (GO:0006084)|cellular lipid metabolic process (GO:0044255)|cellular response to interleukin-4 (GO:0071353)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|fatty acid metabolic process (GO:0006631)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|osteoblast differentiation (GO:0001649)|pantothenate metabolic process (GO:0015939)|positive regulation of cellular metabolic process (GO:0031325)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|glycogen granule (GO:0042587)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	3-hydroxyoctanoyl-[acyl-carrier-protein] dehydratase activity (GO:0047451)|3-hydroxypalmitoyl-[acyl-carrier-protein] dehydratase activity (GO:0004317)|3-oxoacyl-[acyl-carrier-protein] reductase (NADPH) activity (GO:0004316)|3-oxoacyl-[acyl-carrier-protein] synthase activity (GO:0004315)|[acyl-carrier-protein] S-acetyltransferase activity (GO:0004313)|[acyl-carrier-protein] S-malonyltransferase activity (GO:0004314)|drug binding (GO:0008144)|enoyl-[acyl-carrier-protein] reductase (NADPH, A-specific) activity (GO:0047117)|enoyl-[acyl-carrier-protein] reductase (NADPH, B-specific) activity (GO:0004319)|fatty acid synthase activity (GO:0004312)|myristoyl-[acyl-carrier-protein] hydrolase activity (GO:0016295)|NADPH binding (GO:0070402)|oleoyl-[acyl-carrier-protein] hydrolase activity (GO:0004320)|palmitoyl-[acyl-carrier-protein] hydrolase activity (GO:0016296)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			central_nervous_system(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(12)|prostate(3)|skin(2)|urinary_tract(1)	34	all_neural(118;0.0878)|Ovarian(332;0.227)|all_lung(278;0.246)		OV - Ovarian serous cystadenocarcinoma(97;0.0211)|BRCA - Breast invasive adenocarcinoma(99;0.0237)		Cerulenin(DB01034)|Orlistat(DB01083)	GTTGCAGCTCCTCCTGCAGGG	0.657																																					p.E1136D	Colon(59;314 1043 11189 28578 32273)	Atlas-SNP	.											.	FASN	154	.	0			c.G3408T						.						31.0	33.0	32.0					17																	80044945		2198	4293	6491	SO:0001583	missense	2194	exon21			CAGCTCCTCCTGC	U26644	CCDS11801.1	17q25	2012-01-31			ENSG00000169710	ENSG00000169710	2.3.1.85	"""Short chain dehydrogenase/reductase superfamily / Atypical members"""	3594	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 27X, member 1"""	600212				7835891, 7567999, 19027726	Standard	NM_004104		Approved	FAS, SDR27X1	uc002kdu.3	P49327		ENST00000306749.2:c.3408G>T	chr17.hg19:g.80044945C>A	ENSP00000304592:p.Glu1136Asp	115.0	0.0		176.0	51.0	NM_004104	Q13479|Q16702|Q4LE83|Q6P4U5|Q6SS02|Q969R1|Q96C68|Q96IT0	Missense_Mutation	SNP	ENST00000306749.2	hg19	CCDS11801.1	.	.	.	.	.	.	.	.	.	.	C	3.109	-0.183054	0.06340	.	.	ENSG00000169710	ENST00000306749;ENST00000545909	T	0.47177	0.85	4.08	2.94	0.34122	.	0.787182	0.11807	N	0.527514	T	0.25644	0.0624	N	0.24115	0.695	0.09310	N	0.999994	B	0.02656	0.0	B	0.06405	0.002	T	0.20405	-1.0276	10	0.14252	T	0.57	-10.6052	0.8161	0.01103	0.1832:0.3361:0.2757:0.205	.	1136	P49327	FAS_HUMAN	D	1136;101	ENSP00000304592:E1136D	ENSP00000304592:E1136D	E	-	3	2	FASN	77638234	0.000000	0.05858	0.995000	0.50966	0.114000	0.19823	-0.596000	0.05720	0.814000	0.34374	0.478000	0.44815	GAG	.	.		0.657	FASN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442369.1	NM_004104	
MTCL1	23255	hgsc.bcm.edu	37	18	8777845	8777845	+	Silent	SNP	A	A	G			TCGA-2Y-A9H9-01A-21D-A38X-10	TCGA-2Y-A9H9-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5586a43-bdc1-4030-93f8-cfb7bfa6a4b1	5ab2f233-e5fe-41df-9cef-56c0fdd900d3	g.chr18:8777845A>G	ENST00000306329.11	+	4	1452	c.1452A>G	c.(1450-1452)agA>agG	p.R484R	SOGA2_ENST00000517570.1_Silent_p.R124R|SOGA2_ENST00000359865.3_Silent_p.R124R|SOGA2_ENST00000306285.7_5'UTR|SOGA2_ENST00000400050.3_Silent_p.R124R																							CCCTAAAAAGAAGAAGCACTC	0.433																																					p.R124R		Atlas-SNP	.											.	.	.	.	0			c.A372G						.						130.0	123.0	125.0					18																	8777845		2203	4300	6503	SO:0001819	synonymous_variant	23255	exon5			AAAAAGAAGAAGC																												ENST00000306329.11:c.1452A>G	chr18.hg19:g.8777845A>G		99.0	0.0		100.0	34.0	NM_015210		Silent	SNP	ENST00000306329.11	hg19																																																																																				.	.		0.433	SOGA2-015	PUTATIVE	basic|appris_candidate_longest|exp_conf	protein_coding	protein_coding	OTTHUMT00000444141.1		
NOL4	8715	hgsc.bcm.edu	37	18	31599308	31599308	+	Nonsense_Mutation	SNP	G	G	A			TCGA-2Y-A9H9-01A-21D-A38X-10	TCGA-2Y-A9H9-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5586a43-bdc1-4030-93f8-cfb7bfa6a4b1	5ab2f233-e5fe-41df-9cef-56c0fdd900d3	g.chr18:31599308G>A	ENST00000261592.5	-	6	1327	c.1030C>T	c.(1030-1032)Cga>Tga	p.R344*	NOL4_ENST00000589544.1_Nonsense_Mutation_p.R344*|NOL4_ENST00000535475.1_Nonsense_Mutation_p.R189*|NOL4_ENST00000535384.1_Nonsense_Mutation_p.R59*|NOL4_ENST00000538587.1_Nonsense_Mutation_p.R270*|NOL4_ENST00000269185.4_Nonsense_Mutation_p.R230*	NM_001198546.1|NM_003787.4	NP_001185475.1|NP_003778.2	O94818	NOL4_HUMAN	nucleolar protein 4	344						nucleolus (GO:0005730)	RNA binding (GO:0003723)			NS(1)|breast(2)|endometrium(6)|kidney(1)|large_intestine(7)|lung(20)|ovary(4)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	51						CTCGCCTCTCGTTCCATCTTG	0.378																																					p.R344X		Atlas-SNP	.											NOL4,colon,carcinoma,0,1	NOL4	139	.	0			c.C1030T						.						128.0	112.0	117.0					18																	31599308		2203	4300	6503	SO:0001587	stop_gained	8715	exon6			CCTCTCGTTCCAT	AB017800	CCDS11907.2, CCDS56058.1, CCDS56059.1, CCDS59308.1	18q12	2010-05-04			ENSG00000101746	ENSG00000101746			7870	protein-coding gene	gene with protein product	"""cancer/testis antigen 125"""	603577				9813152	Standard	NM_003787		Approved	NOLP, HRIHFB2255, CT125	uc010dmi.3	O94818	OTTHUMG00000132291	ENST00000261592.5:c.1030C>T	chr18.hg19:g.31599308G>A	ENSP00000261592:p.Arg344*	42.0	0.0		69.0	27.0	NM_003787	B4DSQ0|B7Z3Z7|F5H1E3|Q6IBS2|Q9BWF1	Nonsense_Mutation	SNP	ENST00000261592.5	hg19	CCDS11907.2	.	.	.	.	.	.	.	.	.	.	G	42	9.537866	0.99199	.	.	ENSG00000101746	ENST00000261592;ENST00000269185;ENST00000399171;ENST00000535384;ENST00000535475;ENST00000538587	.	.	.	5.75	3.9	0.45041	.	0.189837	0.35349	N	0.003278	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-1.5001	13.8409	0.63437	0.0:0.0:0.601:0.399	.	.	.	.	X	344;230;93;59;189;270	.	ENSP00000261592:R344X	R	-	1	2	NOL4	29853306	1.000000	0.71417	0.983000	0.44433	0.995000	0.86356	1.503000	0.35715	0.718000	0.32166	0.542000	0.68232	CGA	.	.		0.378	NOL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255386.1	NM_003787	
ABCA7	10347	hgsc.bcm.edu	37	19	1046943	1046943	+	Missense_Mutation	SNP	G	G	A	rs142076058|rs375206158	byFrequency	TCGA-2Y-A9H9-01A-21D-A38X-10	TCGA-2Y-A9H9-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5586a43-bdc1-4030-93f8-cfb7bfa6a4b1	5ab2f233-e5fe-41df-9cef-56c0fdd900d3	g.chr19:1046943G>A	ENST00000263094.6	+	14	1996	c.1765G>A	c.(1765-1767)Gcg>Acg	p.A589T	ABCA7_ENST00000435683.2_Missense_Mutation_p.A451T|ABCA7_ENST00000533574.1_Intron|ABCA7_ENST00000433129.1_Missense_Mutation_p.A589T	NM_019112.3	NP_061985.2	Q8IZY2	ABCA7_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 7	589					apolipoprotein A-I-mediated signaling pathway (GO:0038027)|ATP catabolic process (GO:0006200)|cholesterol efflux (GO:0033344)|high-density lipoprotein particle assembly (GO:0034380)|memory (GO:0007613)|negative regulation of amyloid precursor protein biosynthetic process (GO:0042985)|negative regulation of ATPase activity (GO:0032780)|negative regulation of beta-amyloid formation (GO:1902430)|peptide cross-linking (GO:0018149)|phagocytosis (GO:0006909)|phospholipid efflux (GO:0033700)|phospholipid scrambling (GO:0017121)|positive regulation of ATPase activity (GO:0032781)|positive regulation of beta-amyloid clearance (GO:1900223)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of engulfment of apoptotic cell (GO:1901076)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of phagocytosis (GO:0050766)|positive regulation of phospholipid efflux (GO:1902995)|protein localization to nucleus (GO:0034504)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|ATP-binding cassette (ABC) transporter complex (GO:0043190)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|phagocytic cup (GO:0001891)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	apolipoprotein A-I receptor activity (GO:0034188)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|phospholipid transporter activity (GO:0005548)|transporter activity (GO:0005215)			NS(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(7)|lung(22)|ovary(1)|pancreas(7)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	65		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GCTCAGCCGCGCGGTGCTCTG	0.692																																					p.A589T		Atlas-SNP	.											.	ABCA7	174	.	0			c.G1765A						.						17.0	17.0	17.0					19																	1046943		2168	4264	6432	SO:0001583	missense	10347	exon14			AGCCGCGCGGTGC	AF328787	CCDS12055.1	19p13.3	2012-03-14			ENSG00000064687	ENSG00000064687		"""ATP binding cassette transporters / subfamily A"""	37	protein-coding gene	gene with protein product		605414					Standard	NM_019112		Approved	ABCX	uc002lqw.4	Q8IZY2	OTTHUMG00000167547	ENST00000263094.6:c.1765G>A	chr19.hg19:g.1046943G>A	ENSP00000263094:p.Ala589Thr	66.0	0.0		89.0	44.0	NM_019112	Q96S58|Q9BZC4|Q9NR73|Q9UKP8	Missense_Mutation	SNP	ENST00000263094.6	hg19	CCDS12055.1	.	.	.	.	.	.	.	.	.	.	g	9.217	1.032304	0.19590	.	.	ENSG00000064687	ENST00000263094;ENST00000433129	D;D	0.82984	-1.67;-1.67	4.68	1.23	0.21249	.	.	.	.	.	T	0.75774	0.3895	L	0.41961	1.31	0.09310	N	1	B;B	0.25351	0.102;0.124	B;B	0.26693	0.031;0.072	T	0.65030	-0.6267	9	0.49607	T	0.09	.	8.8132	0.34981	0.2683:0.0:0.7317:0.0	.	451;589	Q8IZY2-2;Q8IZY2	.;ABCA7_HUMAN	T	589	ENSP00000263094:A589T;ENSP00000414062:A589T	ENSP00000263094:A589T	A	+	1	0	ABCA7	997943	0.884000	0.30299	0.000000	0.03702	0.024000	0.10985	3.405000	0.52630	0.419000	0.25927	-0.299000	0.09455	GCG	.	.		0.692	ABCA7-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000394993.1	NM_019112	
SBNO2	22904	hgsc.bcm.edu	37	19	1116910	1116910	+	Silent	SNP	G	G	A			TCGA-2Y-A9H9-01A-21D-A38X-10	TCGA-2Y-A9H9-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5586a43-bdc1-4030-93f8-cfb7bfa6a4b1	5ab2f233-e5fe-41df-9cef-56c0fdd900d3	g.chr19:1116910G>A	ENST00000361757.3	-	16	1957	c.1720C>T	c.(1720-1722)Ctg>Ttg	p.L574L	SBNO2_ENST00000438103.2_Silent_p.L517L|SBNO2_ENST00000587024.1_Silent_p.L564L	NM_014963.2	NP_055778.2	Q9Y2G9	SBNO2_HUMAN	strawberry notch homolog 2 (Drosophila)	574					bone mineralization (GO:0030282)|bone trabecula morphogenesis (GO:0061430)|macrophage activation involved in immune response (GO:0002281)|negative regulation of transcription, DNA-templated (GO:0045892)|osteoclast fusion (GO:0072675)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of inflammatory response (GO:0050727)|transcription, DNA-templated (GO:0006351)					NS(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(2)|lung(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	14		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;7.93e-06)|all_lung(49;1.25e-05)|Breast(49;0.000172)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GTGGACTGCAGCCCGATGACC	0.687																																					p.L574L		Atlas-SNP	.											.	SBNO2	112	.	0			c.C1720T						.						23.0	28.0	26.0					19																	1116910		2137	4211	6348	SO:0001819	synonymous_variant	22904	exon16			ACTGCAGCCCGAT	AK074102	CCDS45894.1, CCDS45895.1	19p13.3	2008-02-05	2006-10-06	2006-10-06		ENSG00000064932			29158	protein-coding gene	gene with protein product		615729	"""KIAA0963"""	KIAA0963		10231032	Standard	NM_014963		Approved	FLJ00173, Stno, Sno	uc002lrk.4	Q9Y2G9		ENST00000361757.3:c.1720C>T	chr19.hg19:g.1116910G>A		19.0	0.0		26.0	7.0	NM_014963	A8K8P2|B3KWJ1|O75257|Q3KQX0|Q8TEM0	Silent	SNP	ENST00000361757.3	hg19	CCDS45894.1																																																																																			.	.		0.687	SBNO2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000458065.2	NM_014963	
ZNF799	90576	hgsc.bcm.edu	37	19	12502454	12502454	+	Missense_Mutation	SNP	T	T	C			TCGA-2Y-A9H9-01A-21D-A38X-10	TCGA-2Y-A9H9-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5586a43-bdc1-4030-93f8-cfb7bfa6a4b1	5ab2f233-e5fe-41df-9cef-56c0fdd900d3	g.chr19:12502454T>C	ENST00000430385.3	-	4	958	c.758A>G	c.(757-759)tAt>tGt	p.Y253C	ZNF799_ENST00000419318.1_Missense_Mutation_p.Y221C|CTD-3105H18.14_ENST00000435033.1_Intron	NM_001080821.2	NP_001074290.1	Q96GE5	ZN799_HUMAN	zinc finger protein 799	253					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(3)|kidney(2)|large_intestine(4)|lung(4)|ovary(2)|prostate(2)|skin(2)	19						TTTACATTCATACAGTTTCTC	0.363																																					p.Y253C		Atlas-SNP	.											.	ZNF799	111	.	0			c.A758G						.						82.0	93.0	89.0					19																	12502454		2203	4298	6501	SO:0001583	missense	90576	exon4			CATTCATACAGTT	BC009517	CCDS45989.1	19p13.2	2013-01-08			ENSG00000196466	ENSG00000196466		"""Zinc fingers, C2H2-type"", ""-"""	28071	protein-coding gene	gene with protein product			"""zinc finger protein 842"""	ZNF842			Standard	NM_001080821		Approved	HIT-40, MGC71805	uc002mts.4	Q96GE5	OTTHUMG00000156408	ENST00000430385.3:c.758A>G	chr19.hg19:g.12502454T>C	ENSP00000411084:p.Tyr253Cys	54.0	0.0		113.0	50.0	NM_001080821		Missense_Mutation	SNP	ENST00000430385.3	hg19	CCDS45989.1	.	.	.	.	.	.	.	.	.	.	T	10.60	1.396845	0.25205	.	.	ENSG00000196466	ENST00000419318;ENST00000430385	T;T	0.25414	1.8;1.8	1.31	1.31	0.21738	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.51702	0.1690	M	0.91406	3.205	0.09310	N	1	D	0.89917	1.0	D	0.97110	1.0	T	0.34279	-0.9835	9	0.87932	D	0	.	3.4352	0.07442	0.3607:0.0:0.0:0.6393	.	253	Q96GE5	ZN799_HUMAN	C	221;253	ENSP00000415278:Y221C;ENSP00000411084:Y253C	ENSP00000415278:Y221C	Y	-	2	0	ZNF799	12363454	0.000000	0.05858	0.009000	0.14445	0.146000	0.21551	-0.618000	0.05578	0.846000	0.35142	0.352000	0.21897	TAT	.	.		0.363	ZNF799-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344099.2	NM_001080821	
ZNF91	7644	hgsc.bcm.edu	37	19	23543878	23543878	+	Missense_Mutation	SNP	A	A	G			TCGA-2Y-A9H9-01A-21D-A38X-10	TCGA-2Y-A9H9-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5586a43-bdc1-4030-93f8-cfb7bfa6a4b1	5ab2f233-e5fe-41df-9cef-56c0fdd900d3	g.chr19:23543878A>G	ENST00000300619.7	-	4	2108	c.1903T>C	c.(1903-1905)Tgt>Cgt	p.C635R	ZNF91_ENST00000599743.1_Intron|ZNF91_ENST00000397082.2_Missense_Mutation_p.C603R|ZNF91_ENST00000596528.1_5'Flank	NM_003430.2	NP_003421.2	Q05481	ZNF91_HUMAN	zinc finger protein 91	635					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)						all_lung(12;0.0349)|Lung NSC(12;0.0538)|all_epithelial(12;0.0611)				GCTTTGCCACATTCTTCACAT	0.393																																					p.C635R		Atlas-SNP	.											.	ZNF91	349	.	0			c.T1903C						.						63.0	67.0	66.0					19																	23543878		2165	4277	6442	SO:0001583	missense	7644	exon4			TGCCACATTCTTC	M61871	CCDS42541.1, CCDS74322.1	19p12	2014-02-04	2006-05-12		ENSG00000167232	ENSG00000167232		"""Zinc fingers, C2H2-type"", ""-"""	13166	protein-coding gene	gene with protein product		603971	"""zinc finger protein 91 (HPF7, HTF10)"""			2023909, 2505992	Standard	XR_430154		Approved	HPF7, HTF10	uc002nre.3	Q05481	OTTHUMG00000183268	ENST00000300619.7:c.1903T>C	chr19.hg19:g.23543878A>G	ENSP00000300619:p.Cys635Arg	112.0	0.0		164.0	77.0	NM_003430	A8K5E1|B7Z6G6	Missense_Mutation	SNP	ENST00000300619.7	hg19	CCDS42541.1	.	.	.	.	.	.	.	.	.	.	A	13.70	2.314341	0.40996	.	.	ENSG00000167232	ENST00000300619;ENST00000397082	D;D	0.85955	-2.05;-2.05	1.71	1.71	0.24356	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	D	0.93910	0.8051	H	0.97635	4.045	0.58432	D	0.999996	D;D	0.89917	1.0;1.0	D;D	0.97110	0.997;1.0	D	0.92717	0.6188	9	0.87932	D	0	.	8.2031	0.31436	1.0:0.0:0.0:0.0	.	603;635	Q05481-2;Q05481	.;ZNF91_HUMAN	R	635;603	ENSP00000300619:C635R;ENSP00000380272:C603R	ENSP00000300619:C635R	C	-	1	0	ZNF91	23335718	0.996000	0.38824	0.036000	0.18154	0.022000	0.10575	4.518000	0.60510	0.765000	0.33221	0.172000	0.16884	TGT	.	.		0.393	ZNF91-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000465891.1	NM_003430	
LSR	51599	hgsc.bcm.edu	37	19	35758051	35758051	+	Missense_Mutation	SNP	G	G	T			TCGA-2Y-A9H9-01A-21D-A38X-10	TCGA-2Y-A9H9-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5586a43-bdc1-4030-93f8-cfb7bfa6a4b1	5ab2f233-e5fe-41df-9cef-56c0fdd900d3	g.chr19:35758051G>T	ENST00000361790.3	+	9	1487	c.1328G>T	c.(1327-1329)cGa>cTa	p.R443L	USF2_ENST00000222305.3_5'Flank|LSR_ENST00000360798.3_Missense_Mutation_p.R375L|LSR_ENST00000347609.4_Missense_Mutation_p.R385L|LSR_ENST00000602122.1_Missense_Mutation_p.R423L|USF2_ENST00000594064.1_5'Flank|LSR_ENST00000354900.3_Missense_Mutation_p.R424L|USF2_ENST00000379134.3_5'Flank|USF2_ENST00000343550.5_5'Flank|LSR_ENST00000427250.1_Missense_Mutation_p.R287L|USF2_ENST00000595068.1_5'Flank|AD000684.2_ENST00000602262.1_RNA	NM_205834.3	NP_991403.1	Q86X29	LSR_HUMAN	lipolysis stimulated lipoprotein receptor	443					embryo development (GO:0009790)|liver development (GO:0001889)	chylomicron (GO:0042627)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|low-density lipoprotein particle (GO:0034362)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)				breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	13	all_lung(56;3.91e-09)|Lung NSC(56;5.64e-09)|Esophageal squamous(110;0.162)		Epithelial(14;1.33e-19)|OV - Ovarian serous cystadenocarcinoma(14;1.29e-18)|all cancers(14;7.11e-17)|LUSC - Lung squamous cell carcinoma(66;0.0417)			GACGACTGGCGATCTCGGCCT	0.692																																					p.R443L		Atlas-SNP	.											.	LSR	60	.	0			c.G1328T						.						29.0	37.0	34.0					19																	35758051		2106	4230	6336	SO:0001583	missense	51599	exon9			ACTGGCGATCTCG	AF130366	CCDS12449.1, CCDS12450.1, CCDS12451.1, CCDS59376.1	19q13.12	2013-01-11			ENSG00000105699	ENSG00000105699		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	29572	protein-coding gene	gene with protein product	"""lipolysis-stimulated remnant"", ""immunoglobulin-like domain containing receptor 3"""					10224102	Standard	NM_015925		Approved	LISCH7, ILDR3	uc002nyl.3	Q86X29		ENST00000361790.3:c.1328G>T	chr19.hg19:g.35758051G>T	ENSP00000354575:p.Arg443Leu	178.0	0.0		147.0	67.0	NM_205834	A6NDW3|B4DKL4|E9PHD4|O00112|O00426|Q6ZT80|Q8NBM0|Q9BT33|Q9UQL3	Missense_Mutation	SNP	ENST00000361790.3	hg19	CCDS12450.1	.	.	.	.	.	.	.	.	.	.	G	22.6	4.309538	0.81247	.	.	ENSG00000105699	ENST00000361790;ENST00000354900;ENST00000360798;ENST00000347609;ENST00000427250	T;T;T;T;T	0.71103	0.28;0.46;-0.07;0.19;-0.54	4.88	3.84	0.44239	.	0.399200	0.24111	N	0.041452	T	0.77778	0.4181	L	0.53249	1.67	0.09310	N	0.999995	B;D;B;B;P;D	0.71674	0.289;0.998;0.412;0.412;0.569;0.975	B;D;B;B;B;P	0.69654	0.09;0.965;0.205;0.251;0.101;0.762	T	0.67352	-0.5692	10	0.72032	D	0.01	-7.1397	10.2419	0.43316	0.0972:0.0:0.9028:0.0	.	381;385;423;375;424;443	Q9BT33;Q86X29-2;Q86X29-3;A6NDW3;E9PHD4;Q86X29	.;.;.;.;.;LSR_HUMAN	L	443;424;375;385;287	ENSP00000354575:R443L;ENSP00000346976:R424L;ENSP00000354034:R375L;ENSP00000262627:R385L;ENSP00000394479:R287L	ENSP00000262627:R385L	R	+	2	0	LSR	40449891	0.896000	0.30565	0.983000	0.44433	0.757000	0.42996	2.338000	0.43957	2.245000	0.73994	0.555000	0.69702	CGA	.	.		0.692	LSR-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465513.2	NM_015925	
ZNF780B	163131	hgsc.bcm.edu	37	19	40540678	40540678	+	Silent	SNP	G	G	C			TCGA-2Y-A9H9-01A-21D-A38X-10	TCGA-2Y-A9H9-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5586a43-bdc1-4030-93f8-cfb7bfa6a4b1	5ab2f233-e5fe-41df-9cef-56c0fdd900d3	g.chr19:40540678G>C	ENST00000434248.1	-	5	2153	c.2088C>G	c.(2086-2088)ccC>ccG	p.P696P	ZNF780B_ENST00000221355.6_Silent_p.P548P	NM_001005851.2	NP_001005851.1	Q9Y6R6	Z780B_HUMAN	zinc finger protein 780B	696					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|kidney(2)|large_intestine(3)|lung(12)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	23	all_cancers(60;9.55e-06)|all_lung(34;1.17e-07)|Lung NSC(34;1.41e-07)|Ovarian(47;0.0925)					TACATACAAAGGGTTTCGCAC	0.383																																					p.P696P		Atlas-SNP	.											.	ZNF780B	143	.	0			c.C2088G						.						75.0	82.0	80.0					19																	40540678		2186	4294	6480	SO:0001819	synonymous_variant	163131	exon5			TACAAAGGGTTTC	AK127063	CCDS46077.1	19q13.2	2013-01-08	2006-08-15	2006-08-15	ENSG00000128000	ENSG00000128000		"""Zinc fingers, C2H2-type"", ""-"""	33109	protein-coding gene	gene with protein product			"""zinc finger protein 779"""	ZNF779			Standard	NM_001005851		Approved		uc002omu.3	Q9Y6R6	OTTHUMG00000155118	ENST00000434248.1:c.2088C>G	chr19.hg19:g.40540678G>C		84.0	0.0		124.0	52.0	NM_001005851	B9EH00	Silent	SNP	ENST00000434248.1	hg19	CCDS46077.1																																																																																			.	.		0.383	ZNF780B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338466.1	NM_001005851	
ZNF808	388558	hgsc.bcm.edu	37	19	53057402	53057402	+	Silent	SNP	A	A	G	rs375755660		TCGA-2Y-A9H9-01A-21D-A38X-10	TCGA-2Y-A9H9-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5586a43-bdc1-4030-93f8-cfb7bfa6a4b1	5ab2f233-e5fe-41df-9cef-56c0fdd900d3	g.chr19:53057402A>G	ENST00000359798.4	+	5	1413	c.1233A>G	c.(1231-1233)caA>caG	p.Q411Q		NM_001039886.3	NP_001034975.2	Q8N4W9	ZN808_HUMAN	zinc finger protein 808	411					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(8)|kidney(3)|lung(12)|urinary_tract(1)	24				OV - Ovarian serous cystadenocarcinoma(262;0.00501)|GBM - Glioblastoma multiforme(134;0.0213)		TTAATCATCAATCAAGCCTTG	0.383													A|||	1	0.000199681	0.0	0.0	5008	,	,		22364	0.0		0.001	False		,,,				2504	0.0				p.Q411Q		Atlas-SNP	.											.	ZNF808	81	.	0			c.A1233G						.	A		1,4395		0,1,2197	72.0	77.0	75.0		1233	0.4	0.0	19		75	4,8586		0,4,4291	no	coding-synonymous	ZNF808	NM_001039886.3		0,5,6488	GG,GA,AA		0.0466,0.0227,0.0385		411/904	53057402	5,12981	2198	4295	6493	SO:0001819	synonymous_variant	388558	exon5			TCATCAATCAAGC	CR749856	CCDS46167.1	19q13.41	2013-01-08			ENSG00000198482	ENSG00000198482		"""Zinc fingers, C2H2-type"", ""-"""	33230	protein-coding gene	gene with protein product							Standard	NM_001039886		Approved		uc010epq.1	Q8N4W9	OTTHUMG00000158230	ENST00000359798.4:c.1233A>G	chr19.hg19:g.53057402A>G		115.0	0.0		122.0	61.0	NM_001039886	Q68CN7	Silent	SNP	ENST00000359798.4	hg19	CCDS46167.1																																																																																			.	.		0.383	ZNF808-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350447.3	NM_001039886	
DPRX	503834	hgsc.bcm.edu	37	19	54140215	54140215	+	Silent	SNP	T	T	C			TCGA-2Y-A9H9-01A-21D-A38X-10	TCGA-2Y-A9H9-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5586a43-bdc1-4030-93f8-cfb7bfa6a4b1	5ab2f233-e5fe-41df-9cef-56c0fdd900d3	g.chr19:54140215T>C	ENST00000376650.1	+	3	600	c.549T>C	c.(547-549)tgT>tgC	p.C183C		NM_001012728.1	NP_001012746.1	A6NFQ7	DPRX_HUMAN	divergent-paired related homeobox	183					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			endometrium(4)|large_intestine(1)|lung(7)	12	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(134;0.013)		CTCCTGCCTGTTCATCTAACC	0.448																																					p.C183C		Atlas-SNP	.											.	DPRX	34	.	0			c.T549C						.						109.0	106.0	107.0					19																	54140215		2203	4300	6503	SO:0001819	synonymous_variant	503834	exon3			TGCCTGTTCATCT		CCDS33103.1	19q13.42	2011-06-20			ENSG00000204595	ENSG00000204595		"""Homeoboxes / PRD class"""	32166	protein-coding gene	gene with protein product		611165					Standard	NM_001012728		Approved		uc002qcf.1	A6NFQ7		ENST00000376650.1:c.549T>C	chr19.hg19:g.54140215T>C		95.0	0.0		107.0	44.0	NM_001012728		Silent	SNP	ENST00000376650.1	hg19	CCDS33103.1																																																																																			.	.		0.448	DPRX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409880.1	NM_001012728	
NLRP12	91662	hgsc.bcm.edu	37	19	54314219	54314219	+	Silent	SNP	G	G	A			TCGA-2Y-A9H9-01A-21D-A38X-10	TCGA-2Y-A9H9-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5586a43-bdc1-4030-93f8-cfb7bfa6a4b1	5ab2f233-e5fe-41df-9cef-56c0fdd900d3	g.chr19:54314219G>A	ENST00000324134.6	-	3	862	c.694C>T	c.(694-696)Ctg>Ttg	p.L232L	NLRP12_ENST00000351894.4_Silent_p.L232L|NLRP12_ENST00000391773.1_Silent_p.L232L|NLRP12_ENST00000391775.3_Silent_p.L232L|NLRP12_ENST00000535162.1_Silent_p.L232L|NLRP12_ENST00000354278.3_Silent_p.L232L|NLRP12_ENST00000345770.5_Silent_p.L232L|NLRP12_ENST00000391772.1_Silent_p.L232L	NM_001277126.1|NM_144687.2	NP_001264055.1|NP_653288.1	P59046	NAL12_HUMAN	NLR family, pyrin domain containing 12	232	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|cellular response to cytokine stimulus (GO:0071345)|dendritic cell migration (GO:0036336)|negative regulation of cytokine secretion (GO:0050710)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-1 secretion (GO:0050711)|negative regulation of interleukin-6 biosynthetic process (GO:0045409)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of NIK/NF-kappaB signaling (GO:1901223)|negative regulation of protein autophosphorylation (GO:0031953)|negative regulation of signal transduction (GO:0009968)|negative regulation of Toll signaling pathway (GO:0045751)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interleukin-1 beta secretion (GO:0050718)|positive regulation of MHC class I biosynthetic process (GO:0045345)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043122)|regulation of interleukin-18 biosynthetic process (GO:0045381)|release of cytoplasmic sequestered NF-kappaB (GO:0008588)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)			NS(1)|breast(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|liver(1)|lung(36)|ovary(5)|pancreas(2)|skin(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	80	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(134;0.026)		GCCCAGTCCAGCATCACCTTG	0.587																																					p.A232S		Atlas-SNP	.											.	NLRP12	236	.	0			c.G694T						.						86.0	64.0	71.0					19																	54314219		2203	4300	6503	SO:0001819	synonymous_variant	91662	exon3			AGTCCAGCATCAC	AY095146	CCDS12864.1, CCDS62784.1, CCDS62785.1	19q13.42	2014-09-17	2006-12-08	2006-12-08	ENSG00000142405	ENSG00000142405		"""Nucleotide-binding domain and leucine rich repeat containing"""	22938	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 12"""	609648	"""NACHT, leucine rich repeat and PYD containing 12"""	NALP12		12563287, 12019269	Standard	NM_001277129		Approved	RNO2, PYPAF7, Monarch1, PAN6, CLR19.3	uc002qcj.5	P59046	OTTHUMG00000060776	ENST00000324134.6:c.694C>T	chr19.hg19:g.54314219G>A		79.0	0.0		76.0	18.0	NM_144687	A8MTQ2|B3KTE7|Q8NEU4|Q9BY26	Missense_Mutation	SNP	ENST00000324134.6	hg19	CCDS12864.1																																																																																			.	.		0.587	NLRP12-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000134340.1	NM_144687	
SIRPD	128646	hgsc.bcm.edu	37	20	1515074	1515074	+	Missense_Mutation	SNP	T	T	G			TCGA-2Y-A9H9-01A-21D-A38X-10	TCGA-2Y-A9H9-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5586a43-bdc1-4030-93f8-cfb7bfa6a4b1	5ab2f233-e5fe-41df-9cef-56c0fdd900d3	g.chr20:1515074T>G	ENST00000381623.3	-	4	1780	c.591A>C	c.(589-591)aaA>aaC	p.K197N	SIRPD_ENST00000381621.1_Missense_Mutation_p.K198N			Q9H106	SIRPD_HUMAN	signal-regulatory protein delta	197						extracellular region (GO:0005576)				breast(1)|kidney(2)|large_intestine(3)|lung(6)|ovary(2)|skin(1)	15						GTTTGGATTATTTTGACAGCA	0.358																																					p.K197N		Atlas-SNP	.											.	SIRPD	34	.	0			c.A591C						.						148.0	141.0	143.0					20																	1515074		2203	4300	6503	SO:0001583	missense	128646	exon4			GGATTATTTTGAC	AL049634	CCDS13018.1	20p13	2013-01-11	2006-02-03	2006-02-03	ENSG00000125900	ENSG00000125900		"""Signal-regulatory proteins"", ""Immunoglobulin superfamily / V-set domain containing"""	16248	protein-coding gene	gene with protein product			"""protein tyrosine phosphatase, non-receptor type substrate 1-like 2"""	PTPNS1L2		16339511	Standard	NM_178460		Approved	dJ576H24.4	uc002wfi.3	Q9H106	OTTHUMG00000031674	ENST00000381623.3:c.591A>C	chr20.hg19:g.1515074T>G	ENSP00000371036:p.Lys197Asn	47.0	0.0		62.0	27.0	NM_178460	B3KS88|Q5TFQ6	Missense_Mutation	SNP	ENST00000381623.3	hg19	CCDS13018.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	6.839|6.839	0.524001|0.524001	0.13066|0.13066	.|.	.|.	ENSG00000125900|ENSG00000125900	ENST00000381623;ENST00000381621|ENST00000429387	T;T|.	0.02258|.	4.37;4.42|.	1.52|1.52	1.52|1.52	0.23074|0.23074	.|.	.|.	.|.	.|.	.|.	T|T	0.16041|0.16041	0.0386|0.0386	N|N	0.08118|0.08118	0|0	0.09310|0.09310	N|N	1|1	D|.	0.56287|.	0.975|.	B|.	0.42522|.	0.39|.	T|T	0.23048|0.23048	-1.0199|-1.0199	9|5	0.87932|.	D|.	0|.	.|.	5.1562|5.1562	0.15036|0.15036	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	197|.	Q9H106|.	SIRPD_HUMAN|.	N|T	197;198|80	ENSP00000371036:K197N;ENSP00000371034:K198N|.	ENSP00000371034:K198N|.	K|N	-|-	3|2	2|0	SIRPD|SIRPD	1463074|1463074	0.004000|0.004000	0.15560|0.15560	0.015000|0.015000	0.15790|0.15790	0.483000|0.483000	0.33249|0.33249	0.353000|0.353000	0.20130|0.20130	0.943000|0.943000	0.37553|0.37553	0.459000|0.459000	0.35465|0.35465	AAA|AAT	.	.		0.358	SIRPD-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000077552.1	NM_178460	
NAA20	51126	hgsc.bcm.edu	37	20	20013187	20013187	+	Missense_Mutation	SNP	T	T	C			TCGA-2Y-A9H9-01A-21D-A38X-10	TCGA-2Y-A9H9-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5586a43-bdc1-4030-93f8-cfb7bfa6a4b1	5ab2f233-e5fe-41df-9cef-56c0fdd900d3	g.chr20:20013187T>C	ENST00000334982.4	+	5	622	c.341T>C	c.(340-342)gTa>gCa	p.V114A	NAA20_ENST00000484480.1_3'UTR|NAA20_ENST00000398602.2_Missense_Mutation_p.V102A|NAA20_ENST00000310450.4_Intron	NM_016100.4	NP_057184.1	P61599	NAA20_HUMAN	N(alpha)-acetyltransferase 20, NatB catalytic subunit	114	N-acetyltransferase. {ECO:0000255|PROSITE-ProRule:PRU00532}.					cytoplasm (GO:0005737)|intracellular (GO:0005622)|nucleus (GO:0005634)	peptide alpha-N-acetyltransferase activity (GO:0004596)			endometrium(3)|lung(2)|prostate(1)	6						TTTGTAAGAGTATCTAACCAA	0.383																																					p.V114A		Atlas-SNP	.											.	NAA20	15	.	0			c.T341C						.						81.0	78.0	79.0					20																	20013187		2203	4300	6503	SO:0001583	missense	51126	exon5			TAAGAGTATCTAA	AF085355	CCDS13141.1, CCDS13142.1, CCDS42854.1	20p11.23	2010-05-07	2010-01-14	2010-01-14	ENSG00000173418	ENSG00000173418	2.3.1.88	"""N(alpha)-acetyltransferase subunits"""	15908	protein-coding gene	gene with protein product	"""N-acetyltransferase 3 homolog (S. cerevisiae)"""	610833	"""N-acetyltransferase 5, ARD1 subunit (arrest-defective 1, S. cerevisiae, homolog)"", ""N-acetyltransferase 5 (ARD1 homolog, S. cerevisiae)"", ""N-acetyltransferase 5"", ""N-acetyltransferase 5 (GCN5-related, putative)"""	NAT5		12888564, 19660095	Standard	NM_016100		Approved	dJ1002M8.1, NAT3	uc002wrp.3	P61599	OTTHUMG00000031998	ENST00000334982.4:c.341T>C	chr20.hg19:g.20013187T>C	ENSP00000335636:p.Val114Ala	94.0	0.0		154.0	7.0	NM_016100	A6NHA3|B2R4G4|Q5TFT7|Q9D7H8|Q9H0Y4|Q9NQH6|Q9Y6D2	Missense_Mutation	SNP	ENST00000334982.4	hg19	CCDS13141.1	.	.	.	.	.	.	.	.	.	.	T	11.49	1.653013	0.29336	.	.	ENSG00000173418	ENST00000334982;ENST00000398602	T;T	0.22336	1.96;1.96	5.72	5.72	0.89469	GCN5-related N-acetyltransferase (GNAT) domain (2);Acyl-CoA N-acyltransferase (2);	0.126159	0.53938	D	0.000054	T	0.15478	0.0373	N	0.20357	0.565	0.80722	D	1	B;B	0.16166	0.016;0.008	B;B	0.24006	0.01;0.05	T	0.10917	-1.0609	9	.	.	.	-40.4821	14.9842	0.71332	0.0:0.0:0.0:1.0	.	102;114	A8MZB2;P61599	.;NAA20_HUMAN	A	114;102	ENSP00000335636:V114A;ENSP00000381603:V102A	.	V	+	2	0	NAA20	19961187	1.000000	0.71417	0.978000	0.43139	0.997000	0.91878	7.907000	0.87430	2.183000	0.69458	0.533000	0.62120	GTA	.	.		0.383	NAA20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078217.2	NM_016100	
EPPIN	57119	hgsc.bcm.edu	37	20	44168001	44168001	+	IGR	SNP	A	A	G			TCGA-2Y-A9H9-01A-21D-A38X-10	TCGA-2Y-A9H9-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5586a43-bdc1-4030-93f8-cfb7bfa6a4b1	5ab2f233-e5fe-41df-9cef-56c0fdd900d3	g.chr20:44168001A>G	ENST00000354280.4	-	0	1987				WFDC6_ENST00000600168.1_Silent_p.L16L|EPPIN-WFDC6_ENST00000504988.1_Intron|WFDC6_ENST00000372670.3_Silent_p.L16L|EPPIN_ENST00000555685.1_Intron	NM_020398.3	NP_065131.1	O95925	EPPI_HUMAN	epididymal peptidase inhibitor						defense response to bacterium (GO:0042742)|negative regulation of peptidase activity (GO:0010466)	extracellular region (GO:0005576)	serine-type endopeptidase inhibitor activity (GO:0004867)										ATGTCCCCCAAAAGGATGAAT	0.517																																					p.L16L		Atlas-SNP	.											.	WFDC6	13	.	0			c.T46C						.						126.0	112.0	116.0					20																	44168001		2203	4300	6503	SO:0001628	intergenic_variant	140870	exon1			CCCCCAAAAGGAT	AF286370	CCDS13359.1	20q13.12	2014-01-21	2012-08-22	2012-08-22	ENSG00000101448	ENSG00000101448		"""WAP four-disulfide core domain containing"""	15932	protein-coding gene	gene with protein product	"""epididymal protease inhibitor"", ""cancer/testis antigen 72"""	609031	"""serine protease inhibitor-like, with Kunitz and WAP domains 1 (eppin)"", ""serine peptidase inhibitor-like, with Kunitz and WAP domains 1 (eppin)"""	SPINLW1		11404006, 12206714	Standard	NM_020398		Approved	EPPIN1, EPPIN2, EPPIN3, dJ461P17.2, WAP7, WFDC7, CT71		O95925	OTTHUMG00000032588		chr20.hg19:g.44168001A>G		87.0	0.0		139.0	53.0	NM_080827	A6PVD6|Q86TP9|Q96SD7|Q9HD30	Silent	SNP	ENST00000354280.4	hg19	CCDS13359.1																																																																																			.	.		0.517	EPPIN-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000079467.4		
EPPIN	57119	hgsc.bcm.edu	37	20	44168025	44168025	+	IGR	SNP	G	G	A			TCGA-2Y-A9H9-01A-21D-A38X-10	TCGA-2Y-A9H9-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5586a43-bdc1-4030-93f8-cfb7bfa6a4b1	5ab2f233-e5fe-41df-9cef-56c0fdd900d3	g.chr20:44168025G>A	ENST00000354280.4	-	0	1987				WFDC6_ENST00000600168.1_Missense_Mutation_p.P8S|EPPIN-WFDC6_ENST00000504988.1_Intron|WFDC6_ENST00000372670.3_Missense_Mutation_p.P8S|EPPIN_ENST00000555685.1_Intron	NM_020398.3	NP_065131.1	O95925	EPPI_HUMAN	epididymal peptidase inhibitor						defense response to bacterium (GO:0042742)|negative regulation of peptidase activity (GO:0010466)	extracellular region (GO:0005576)	serine-type endopeptidase inhibitor activity (GO:0004867)										ACCAGGATTGGCAGAAGTCCT	0.517																																					p.P8S		Atlas-SNP	.											.	WFDC6	13	.	0			c.C22T						.						124.0	110.0	115.0					20																	44168025		2203	4300	6503	SO:0001628	intergenic_variant	140870	exon1			GGATTGGCAGAAG	AF286370	CCDS13359.1	20q13.12	2014-01-21	2012-08-22	2012-08-22	ENSG00000101448	ENSG00000101448		"""WAP four-disulfide core domain containing"""	15932	protein-coding gene	gene with protein product	"""epididymal protease inhibitor"", ""cancer/testis antigen 72"""	609031	"""serine protease inhibitor-like, with Kunitz and WAP domains 1 (eppin)"", ""serine peptidase inhibitor-like, with Kunitz and WAP domains 1 (eppin)"""	SPINLW1		11404006, 12206714	Standard	NM_020398		Approved	EPPIN1, EPPIN2, EPPIN3, dJ461P17.2, WAP7, WFDC7, CT71		O95925	OTTHUMG00000032588		chr20.hg19:g.44168025G>A		92.0	0.0		142.0	54.0	NM_080827	A6PVD6|Q86TP9|Q96SD7|Q9HD30	Missense_Mutation	SNP	ENST00000354280.4	hg19	CCDS13359.1	.	.	.	.	.	.	.	.	.	.	G	12.00	1.805465	0.31961	.	.	ENSG00000243543	ENST00000372670;ENST00000372665	T	0.33654	1.4	3.42	1.45	0.22620	.	.	.	.	.	T	0.20292	0.0488	.	.	.	0.46499	D	0.999073	P	0.42203	0.773	B	0.35312	0.2	T	0.03695	-1.1012	8	0.30078	T	0.28	.	5.6084	0.17392	0.2556:0.0:0.7444:0.0	.	8	Q9BQY6-2	.	S	8	ENSP00000361750:P8S	ENSP00000361750:P8S	P	-	1	0	WFDC6	43601439	0.974000	0.33945	0.648000	0.29521	0.221000	0.24807	0.513000	0.22770	0.447000	0.26695	0.455000	0.32223	CCA	.	.		0.517	EPPIN-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000079467.4		
ZNF334	55713	hgsc.bcm.edu	37	20	45131451	45131451	+	Missense_Mutation	SNP	A	A	C			TCGA-2Y-A9H9-01A-21D-A38X-10	TCGA-2Y-A9H9-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5586a43-bdc1-4030-93f8-cfb7bfa6a4b1	5ab2f233-e5fe-41df-9cef-56c0fdd900d3	g.chr20:45131451A>C	ENST00000347606.4	-	5	709	c.527T>G	c.(526-528)tTg>tGg	p.L176W	ZNF334_ENST00000593880.1_Missense_Mutation_p.L199W|ZNF334_ENST00000457685.2_Missense_Mutation_p.L138W	NM_018102.4	NP_060572.3	Q9HCZ1	ZN334_HUMAN	zinc finger protein 334	176					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(2)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(8)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	32		Myeloproliferative disorder(115;0.0122)				TTTCATTCCCAAATGACTTTT	0.338																																					p.L176W		Atlas-SNP	.											.	ZNF334	101	.	0			c.T527G						.						94.0	90.0	91.0					20																	45131451		2203	4300	6503	SO:0001583	missense	55713	exon5			ATTCCCAAATGAC	AK001331	CCDS33480.1, CCDS74736.1	20q13.12	2013-09-20			ENSG00000198185	ENSG00000198185		"""Zinc fingers, C2H2-type"", ""-"""	15806	protein-coding gene	gene with protein product							Standard	NM_018102		Approved	bA179N14.1	uc002xsc.4	Q9HCZ1	OTTHUMG00000032654	ENST00000347606.4:c.527T>G	chr20.hg19:g.45131451A>C	ENSP00000255129:p.Leu176Trp	63.0	0.0		97.0	40.0	NM_018102	Q5T6U2|Q9NVW4	Missense_Mutation	SNP	ENST00000347606.4	hg19	CCDS33480.1	.	.	.	.	.	.	.	.	.	.	A	7.988	0.752741	0.15778	.	.	ENSG00000198185	ENST00000457685;ENST00000347606	T;T	0.16196	2.36;2.36	3.3	0.21	0.15231	.	.	.	.	.	T	0.11537	0.0281	N	0.19112	0.55	0.09310	N	1	P;P;P	0.50369	0.934;0.934;0.934	B;B;B	0.43680	0.427;0.427;0.427	T	0.21143	-1.0254	9	0.72032	D	0.01	.	7.2764	0.26288	0.3397:0.0:0.6603:0.0	.	138;176;199	B3KQ93;Q9HCZ1;Q8N3P8	.;ZN334_HUMAN;.	W	138;176	ENSP00000402582:L138W;ENSP00000255129:L176W	ENSP00000255129:L176W	L	-	2	0	ZNF334	44564858	0.030000	0.19436	0.001000	0.08648	0.099000	0.18886	1.311000	0.33562	0.225000	0.20959	-1.055000	0.02315	TTG	.	.		0.338	ZNF334-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079575.1		
ZNF831	128611	hgsc.bcm.edu	37	20	57766716	57766716	+	Silent	SNP	G	G	T			TCGA-2Y-A9H9-01A-21D-A38X-10	TCGA-2Y-A9H9-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5586a43-bdc1-4030-93f8-cfb7bfa6a4b1	5ab2f233-e5fe-41df-9cef-56c0fdd900d3	g.chr20:57766716G>T	ENST00000371030.2	+	1	642	c.642G>T	c.(640-642)ctG>ctT	p.L214L		NM_178457.1	NP_848552.1	Q5JPB2	ZN831_HUMAN	zinc finger protein 831	214							metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(15)|lung(71)|ovary(2)|pancreas(1)|prostate(4)|skin(16)|upper_aerodigestive_tract(2)|urinary_tract(3)	125	all_lung(29;0.0085)					GCGGCCTCCTGGAGGAAGGGG	0.667																																					p.L214L		Atlas-SNP	.											.	ZNF831	287	.	0			c.G642T						.						26.0	32.0	30.0					20																	57766716		1874	4094	5968	SO:0001819	synonymous_variant	128611	exon1			CCTCCTGGAGGAA	AL121919	CCDS42894.1	20q13.32	2008-10-20	2008-03-25	2008-03-25	ENSG00000124203	ENSG00000124203			16167	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 174"""	C20orf174			Standard	NM_178457		Approved	dJ492J12.1	uc002yan.3	Q5JPB2	OTTHUMG00000032864	ENST00000371030.2:c.642G>T	chr20.hg19:g.57766716G>T		69.0	0.0		100.0	41.0	NM_178457	Q5TDR4|Q8TCP0	Silent	SNP	ENST00000371030.2	hg19	CCDS42894.1																																																																																			.	.		0.667	ZNF831-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000079916.2	NM_178457	
MCM3AP	8888	hgsc.bcm.edu	37	21	47656824	47656824	+	Silent	SNP	G	G	C			TCGA-2Y-A9H9-01A-21D-A38X-10	TCGA-2Y-A9H9-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5586a43-bdc1-4030-93f8-cfb7bfa6a4b1	5ab2f233-e5fe-41df-9cef-56c0fdd900d3	g.chr21:47656824G>C	ENST00000397708.1	-	28	5957	c.5703C>G	c.(5701-5703)ccC>ccG	p.P1901P	MCM3AP-AS1_ENST00000590829.1_RNA|MCM3AP-AS1_ENST00000420074.1_RNA|MCM3AP-AS1_ENST00000421927.1_RNA|MCM3AP_ENST00000291688.1_Silent_p.P1901P|MCM3AP-AS1_ENST00000444998.1_RNA|MCM3AP-AS1_ENST00000588753.1_RNA|MCM3AP-AS1_ENST00000432735.1_RNA|MCM3AP-AS1_ENST00000414659.1_RNA|MCM3AP-AS1_ENST00000591223.1_RNA|MCM3AP-AS1_ENST00000455567.1_RNA|MCM3AP_ENST00000467026.1_5'UTR			O60318	GANP_HUMAN	minichromosome maintenance complex component 3 associated protein	1901					DNA replication (GO:0006260)|immune system process (GO:0002376)|mRNA transport (GO:0051028)|protein import into nucleus (GO:0006606)	cytosol (GO:0005829)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	DNA binding (GO:0003677)|transferase activity, transferring acyl groups (GO:0016746)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(10)|kidney(5)|large_intestine(17)|lung(24)|ovary(4)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	72	Breast(49;0.112)					GAAGATAGAGGGGAAGGGAAG	0.383																																					p.P1901P		Atlas-SNP	.											.	MCM3AP	146	.	0			c.C5703G						.						119.0	115.0	117.0					21																	47656824		2203	4300	6503	SO:0001819	synonymous_variant	8888	exon27			ATAGAGGGGAAGG	AB005543	CCDS13734.1	21q22.3	2012-12-19	2007-04-04		ENSG00000160294	ENSG00000160294			6946	protein-coding gene	gene with protein product	"""germinal-centre associated nuclear protein"""	603294	"""minichromosome maintenance deficient (S. cerevisiae) 3-associated protein"", ""MCM3 minichromosome maintenance deficient 3 (S. cerevisiae) associated protein"""			9712829, 16914116, 21195085	Standard	XM_005261205		Approved	Map80, KIAA0572, GANP, SAC3	uc002zir.1	O60318	OTTHUMG00000090630	ENST00000397708.1:c.5703C>G	chr21.hg19:g.47656824G>C		69.0	0.0		66.0	30.0	NM_003906	C9JL56|Q2M3C1|Q6PJP6|Q9BSY5|Q9UMT4	Silent	SNP	ENST00000397708.1	hg19	CCDS13734.1																																																																																			.	.		0.383	MCM3AP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207254.1	NM_003906	
MYO18B	84700	hgsc.bcm.edu	37	22	26243585	26243585	+	Silent	SNP	C	C	T			TCGA-2Y-A9H9-01A-21D-A38X-10	TCGA-2Y-A9H9-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5586a43-bdc1-4030-93f8-cfb7bfa6a4b1	5ab2f233-e5fe-41df-9cef-56c0fdd900d3	g.chr22:26243585C>T	ENST00000407587.2	+	20	3913	c.3744C>T	c.(3742-3744)ttC>ttT	p.F1248F	MYO18B_ENST00000536101.1_Silent_p.F1247F|MYO18B_ENST00000335473.7_Silent_p.F1247F			Q8IUG5	MY18B_HUMAN	myosin XVIIIB	1247	Myosin motor.					cytoplasm (GO:0005737)|nucleus (GO:0005634)|unconventional myosin complex (GO:0016461)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(2)|breast(6)|central_nervous_system(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(27)|liver(2)|lung(60)|ovary(7)|prostate(8)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(2)	146						TTGCTGGGTTCCACATCCTGG	0.597																																					p.F1247F		Atlas-SNP	.											.	MYO18B	322	.	0			c.C3741T						.						22.0	27.0	25.0					22																	26243585		2102	4220	6322	SO:0001819	synonymous_variant	84700	exon20			TGGGTTCCACATC	AJ310931	CCDS54507.1	22q12.1	2011-09-27			ENSG00000133454	ENSG00000133454		"""Myosins / Myosin superfamily : Class XVIII"""	18150	protein-coding gene	gene with protein product		607295				12209013, 12547197	Standard	NM_032608		Approved	BK125H2.1	uc003abz.1	Q8IUG5	OTTHUMG00000151129	ENST00000407587.2:c.3744C>T	chr22.hg19:g.26243585C>T		56.0	0.0		59.0	24.0	NM_032608	B2RWP3|F5GYU7|Q8NDI8|Q8TE65|Q8WWS0|Q96KH2|Q96KR8|Q96KR9	Silent	SNP	ENST00000407587.2	hg19																																																																																				.	.		0.597	MYO18B-006	NOVEL	non_canonical_conserved|basic|appris_candidate_longest|exp_conf	protein_coding	protein_coding	OTTHUMT00000400691.1	NM_032608	
OSM	5008	hgsc.bcm.edu	37	22	30659920	30659920	+	Silent	SNP	G	G	A			TCGA-2Y-A9H9-01A-21D-A38X-10	TCGA-2Y-A9H9-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5586a43-bdc1-4030-93f8-cfb7bfa6a4b1	5ab2f233-e5fe-41df-9cef-56c0fdd900d3	g.chr22:30659920G>A	ENST00000215781.2	-	3	751	c.711C>T	c.(709-711)ccC>ccT	p.P237P	OSM_ENST00000403389.1_Silent_p.P216P	NM_020530.4	NP_065391.1	P13725	ONCM_HUMAN	oncostatin M	237					behavioral response to pain (GO:0048266)|cell proliferation (GO:0008283)|immune response (GO:0006955)|multicellular organismal development (GO:0007275)|negative regulation of cell proliferation (GO:0008285)|negative regulation of hormone secretion (GO:0046888)|negative regulation of meiosis (GO:0045835)|peripheral nervous system development (GO:0007422)|positive regulation of acute inflammatory response (GO:0002675)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of growth (GO:0040008)|response to heat (GO:0009408)|tyrosine phosphorylation of Stat1 protein (GO:0042508)|tyrosine phosphorylation of Stat3 protein (GO:0042503)|tyrosine phosphorylation of Stat5 protein (GO:0042506)	extracellular space (GO:0005615)|oncostatin-M receptor complex (GO:0005900)	cytokine activity (GO:0005125)|growth factor activity (GO:0008083)|oncostatin-M receptor binding (GO:0005147)			breast(1)|endometrium(2)|large_intestine(2)|lung(3)|skin(3)	11			Epithelial(10;0.206)			CTTTCCTGGAGGGTCTGGTCC	0.667																																					p.P237P		Atlas-SNP	.											.	OSM	23	.	0			c.C711T						.						93.0	93.0	93.0					22																	30659920		2203	4300	6503	SO:0001819	synonymous_variant	5008	exon3			CCTGGAGGGTCTG	AF129855	CCDS13873.1	22q12.2	2011-07-21			ENSG00000099985	ENSG00000099985			8506	protein-coding gene	gene with protein product		165095				1717982	Standard	NM_020530		Approved	MGC20461	uc003ahb.3	P13725	OTTHUMG00000150913	ENST00000215781.2:c.711C>T	chr22.hg19:g.30659920G>A		46.0	0.0		41.0	20.0	NM_020530	Q6FHP8|Q9UCP6	Silent	SNP	ENST00000215781.2	hg19	CCDS13873.1																																																																																			.	.		0.667	OSM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320512.1	NM_020530	
FAM47A	158724	hgsc.bcm.edu	37	X	34148402	34148402	+	Missense_Mutation	SNP	T	T	A			TCGA-2Y-A9H9-01A-21D-A38X-10	TCGA-2Y-A9H9-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5586a43-bdc1-4030-93f8-cfb7bfa6a4b1	5ab2f233-e5fe-41df-9cef-56c0fdd900d3	g.chrX:34148402T>A	ENST00000346193.3	-	1	2045	c.1994A>T	c.(1993-1995)gAg>gTg	p.E665V		NM_203408.3	NP_981953.2	Q5JRC9	FA47A_HUMAN	family with sequence similarity 47, member A	665										NS(1)|biliary_tract(1)|breast(2)|central_nervous_system(1)|endometrium(9)|kidney(5)|large_intestine(17)|lung(44)|ovary(5)|prostate(2)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(2)	97						GAATTTGTCCTCATCCTTTTC	0.453																																					p.E665V		Atlas-SNP	.											.	FAM47A	249	.	0			c.A1994T						.						90.0	91.0	91.0					X																	34148402		2196	4294	6490	SO:0001583	missense	158724	exon1			TTGTCCTCATCCT	BC026171	CCDS43926.1	Xp21.1	2004-08-09			ENSG00000185448	ENSG00000185448			29962	protein-coding gene	gene with protein product	"""similar to hypothetical protein FLJ35782"""					12477932	Standard	NM_203408		Approved	MGC27003	uc004ddg.3	Q5JRC9	OTTHUMG00000021339	ENST00000346193.3:c.1994A>T	chrX.hg19:g.34148402T>A	ENSP00000345029:p.Glu665Val	73.0	0.0		79.0	68.0	NM_203408	A8K8I9|Q8TAA0	Missense_Mutation	SNP	ENST00000346193.3	hg19	CCDS43926.1	.	.	.	.	.	.	.	.	.	.	T	11.60	1.686588	0.29962	.	.	ENSG00000185448	ENST00000346193	T	0.63580	-0.05	1.49	1.49	0.22878	.	.	.	.	.	T	0.72795	0.3505	M	0.81497	2.545	0.09310	N	1	D	0.69078	0.997	P	0.62089	0.898	T	0.59573	-0.7429	9	0.87932	D	0	.	4.6966	0.12806	0.0:0.0:0.0:1.0	.	665	Q5JRC9	FA47A_HUMAN	V	665	ENSP00000345029:E665V	ENSP00000345029:E665V	E	-	2	0	FAM47A	34058323	0.001000	0.12720	0.002000	0.10522	0.003000	0.03518	0.853000	0.27777	0.859000	0.35456	0.441000	0.28932	GAG	.	.		0.453	FAM47A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056205.1	NM_203408	
COL4A5	1287	hgsc.bcm.edu	37	X	107869539	107869539	+	Missense_Mutation	SNP	G	G	T	rs281874712		TCGA-2Y-A9H9-01A-21D-A38X-10	TCGA-2Y-A9H9-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5586a43-bdc1-4030-93f8-cfb7bfa6a4b1	5ab2f233-e5fe-41df-9cef-56c0fdd900d3	g.chrX:107869539G>T	ENST00000361603.2	+	36	3450	c.3206G>T	c.(3205-3207)gGt>gTt	p.G1069V	COL4A5_ENST00000328300.6_Missense_Mutation_p.G1069V	NM_000495.4	NP_000486.1	P29400	CO4A5_HUMAN	collagen, type IV, alpha 5	1069	Triple-helical region.				axon guidance (GO:0007411)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|neuromuscular junction development (GO:0007528)	basal lamina (GO:0005605)|collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|neuromuscular junction (GO:0031594)	extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(25)|lung(32)|ovary(4)|prostate(2)|skin(8)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	99						GGTGATCCTGGTATTTCAAGC	0.478									Alport syndrome with Diffuse Leiomyomatosis																												p.G1069V		Atlas-SNP	.											.	COL4A5	262	.	0			c.G3206T						.						128.0	111.0	117.0					X																	107869539		2203	4300	6503	SO:0001583	missense	1287	exon36	Familial Cancer Database		ATCCTGGTATTTC	M90464	CCDS14543.1, CCDS35366.1	Xq22	2014-09-17	2008-07-28		ENSG00000188153	ENSG00000188153		"""Collagens"""	2207	protein-coding gene	gene with protein product		303630	"""Alport syndrome"""	ASLN, ATS			Standard	NM_000495		Approved		uc004enz.2	P29400	OTTHUMG00000022182	ENST00000361603.2:c.3206G>T	chrX.hg19:g.107869539G>T	ENSP00000354505:p.Gly1069Val	42.0	0.0		71.0	16.0	NM_000495	Q16006|Q16126|Q6LD84|Q7Z700|Q9NUB7	Missense_Mutation	SNP	ENST00000361603.2	hg19	CCDS14543.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	19.45|19.45	3.829467|3.829467	0.71258|0.71258	.|.	.|.	ENSG00000188153|ENSG00000188153	ENST00000328300;ENST00000361603;ENST00000508186|ENST00000505728	D;D|.	0.99429|.	-5.89;-5.89|.	5.76|5.76	5.76|5.76	0.90799|0.90799	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.87962|0.87962	0.6310|0.6310	H|H	0.95151|0.95151	3.63|3.63	0.80722|0.80722	D|D	1|1	D;D;D|.	0.89917|.	1.0;1.0;1.0|.	D;D;D|.	0.83275|.	0.996;0.996;0.996|.	D|D	0.91351|0.91351	0.5104|0.5104	10|5	0.87932|.	D|.	0|.	.|.	18.9086|18.9086	0.92474|0.92474	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	1069;677;1069|.	E7EVY4;Q49AM6;P29400|.	.;.;CO4A5_HUMAN|.	V|L	1069|147	ENSP00000331902:G1069V;ENSP00000354505:G1069V|.	ENSP00000331902:G1069V|.	G|V	+|+	2|1	0|0	COL4A5|COL4A5	107756195|107756195	1.000000|1.000000	0.71417|0.71417	0.988000|0.988000	0.46212|0.46212	0.760000|0.760000	0.43138|0.43138	6.896000|6.896000	0.75665|0.75665	2.412000|2.412000	0.81896|0.81896	0.600000|0.600000	0.82982|0.82982	GGT|GTA	.	.		0.478	COL4A5-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000057880.2		
DCAF12L2	340578	hgsc.bcm.edu	37	X	125299403	125299403	+	Missense_Mutation	SNP	C	C	T			TCGA-2Y-A9H9-01A-21D-A38X-10	TCGA-2Y-A9H9-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5586a43-bdc1-4030-93f8-cfb7bfa6a4b1	5ab2f233-e5fe-41df-9cef-56c0fdd900d3	g.chrX:125299403C>T	ENST00000360028.2	-	1	531	c.505G>A	c.(505-507)Gaa>Aaa	p.E169K	DCAF12L2_ENST00000538699.1_Missense_Mutation_p.E169K			Q5VW00	DC122_HUMAN	DDB1 and CUL4 associated factor 12-like 2	169										NS(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|lung(36)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(3)	64						TTGGGGTTTTCGCCGCCGGTG	0.677																																					p.E169K		Atlas-SNP	.											.	DCAF12L2	157	.	0			c.G505A						.						60.0	67.0	65.0					X																	125299403		2203	4300	6503	SO:0001583	missense	340578	exon1			GGTTTTCGCCGCC	AL445072	CCDS43991.1	Xq25	2013-01-09	2009-07-17	2009-07-17	ENSG00000198354	ENSG00000198354		"""WD repeat domain containing"""	32950	protein-coding gene	gene with protein product			"""WD repeat domain 40C"""	WDR40C			Standard	NM_001013628		Approved		uc004euk.2	Q5VW00	OTTHUMG00000022348	ENST00000360028.2:c.505G>A	chrX.hg19:g.125299403C>T	ENSP00000353128:p.Glu169Lys	99.0	0.0		101.0	81.0	NM_001013628	B2RN42	Missense_Mutation	SNP	ENST00000360028.2	hg19	CCDS43991.1	.	.	.	.	.	.	.	.	.	.	C	12.47	1.947202	0.34377	.	.	ENSG00000198354	ENST00000538699;ENST00000360028	T;T	0.35048	1.33;1.33	4.09	2.24	0.28232	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.000000	0.34178	N	0.004186	T	0.30885	0.0779	M	0.64997	1.995	0.33674	D	0.611292	D	0.58620	0.983	P	0.44597	0.454	T	0.41963	-0.9479	10	0.23891	T	0.37	.	4.6519	0.12599	0.0:0.6534:0.2207:0.1259	.	169	Q5VW00	DC122_HUMAN	K	169	ENSP00000441489:E169K;ENSP00000353128:E169K	ENSP00000353128:E169K	E	-	1	0	DCAF12L2	125127084	1.000000	0.71417	0.047000	0.18901	0.005000	0.04900	6.736000	0.74811	0.461000	0.27071	0.544000	0.68410	GAA	.	.		0.677	DCAF12L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058181.1	NM_001013628	
VGLL1	51442	hgsc.bcm.edu	37	X	135631014	135631014	+	Missense_Mutation	SNP	C	C	G			TCGA-2Y-A9H9-01A-21D-A38X-10	TCGA-2Y-A9H9-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5586a43-bdc1-4030-93f8-cfb7bfa6a4b1	5ab2f233-e5fe-41df-9cef-56c0fdd900d3	g.chrX:135631014C>G	ENST00000370634.3	+	3	651	c.481C>G	c.(481-483)Cct>Gct	p.P161A	MIR934_ENST00000401241.1_RNA	NM_016267.3	NP_057351.1	Q99990	VGLL1_HUMAN	vestigial-like family member 1	161					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)			breast(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(7)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	20	Acute lymphoblastic leukemia(192;0.000127)					AGAGCCCCAGCCTGATGGGAA	0.622																																					p.P161A		Atlas-SNP	.											.	VGLL1	41	.	0			c.C481G						.						94.0	88.0	90.0					X																	135631014		2203	4300	6503	SO:0001583	missense	51442	exon3			CCCCAGCCTGATG	AF137387	CCDS14658.1	Xq26.3	2014-03-03	2014-03-03		ENSG00000102243	ENSG00000102243			20985	protein-coding gene	gene with protein product		300583	"""vestigial like 1 (Drosophila)"""			10518497	Standard	NM_016267		Approved	TONDU, TDU	uc004ezy.3	Q99990	OTTHUMG00000022509	ENST00000370634.3:c.481C>G	chrX.hg19:g.135631014C>G	ENSP00000359668:p.Pro161Ala	59.0	0.0		84.0	7.0	NM_016267	Q5H915	Missense_Mutation	SNP	ENST00000370634.3	hg19	CCDS14658.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	14.38|14.38	2.518971|2.518971	0.44866|0.44866	.|.	.|.	ENSG00000102243|ENSG00000102243	ENST00000440515|ENST00000370634	.|T	.|0.47528	.|0.84	5.81|5.81	4.04|4.04	0.47022|0.47022	.|.	.|0.423027	.|0.28388	.|N	.|0.015522	T|T	0.29190|0.29190	0.0726|0.0726	L|L	0.32530|0.32530	0.975|0.975	0.09310|0.09310	N|N	1|1	.|P	.|0.47762	.|0.9	.|B	.|0.39419	.|0.299	T|T	0.10567|0.10567	-1.0624|-1.0624	5|10	.|0.11182	.|T	.|0.66	-3.6397|-3.6397	7.0765|7.0765	0.25207|0.25207	0.0:0.7991:0.0:0.2009|0.0:0.7991:0.0:0.2009	.|.	.|161	.|Q99990	.|VGLL1_HUMAN	G|A	125|161	.|ENSP00000359668:P161A	.|ENSP00000359668:P161A	A|P	+|+	2|1	0|0	VGLL1|VGLL1	135458680|135458680	0.001000|0.001000	0.12720|0.12720	0.003000|0.003000	0.11579|0.11579	0.911000|0.911000	0.54048|0.54048	0.905000|0.905000	0.28504|0.28504	1.214000|1.214000	0.43395|0.43395	0.600000|0.600000	0.82982|0.82982	GCC|CCT	.	.		0.622	VGLL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058493.1	NM_016267	
MAGEC2	51438	hgsc.bcm.edu	37	X	141290940	141290940	+	Missense_Mutation	SNP	C	C	A			TCGA-2Y-A9H9-01A-21D-A38X-10	TCGA-2Y-A9H9-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5586a43-bdc1-4030-93f8-cfb7bfa6a4b1	5ab2f233-e5fe-41df-9cef-56c0fdd900d3	g.chrX:141290940C>A	ENST00000247452.3	-	3	1181	c.834G>T	c.(832-834)tgG>tgT	p.W278C		NM_016249.3	NP_057333.1	Q9UBF1	MAGC2_HUMAN	melanoma antigen family C, 2	278	Interaction with TRIM28.|MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.				cellular protein catabolic process (GO:0044257)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ubiquitin protein ligase binding (GO:0031625)			NS(2)|breast(3)|endometrium(3)|kidney(2)|large_intestine(8)|lung(18)|ovary(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(3)	47	Acute lymphoblastic leukemia(192;6.56e-05)					GTCCCTGCACCCAAACTTTAG	0.532										HNSCC(46;0.14)																											p.W278C		Atlas-SNP	.											.	MAGEC2	102	.	0			c.G834T						.						91.0	92.0	91.0					X																	141290940		2203	4300	6503	SO:0001583	missense	51438	exon3			CTGCACCCAAACT	AF116195	CCDS14678.1	Xq27	2009-03-25	2004-06-08	2004-06-09	ENSG00000046774	ENSG00000046774			13574	protein-coding gene	gene with protein product	"""cancer/testis antigen 10"""	300468	"""melanoma antigen, family E, 1, cancer/testis specific"""	MAGEE1		10699956	Standard	NM_016249		Approved	CT10, MAGE-C2	uc004fbu.2	Q9UBF1	OTTHUMG00000022574	ENST00000247452.3:c.834G>T	chrX.hg19:g.141290940C>A	ENSP00000354660:p.Trp278Cys	47.0	0.0		50.0	25.0	NM_016249	Q5JZ00|Q96D45|Q9P1M6|Q9P1M7	Missense_Mutation	SNP	ENST00000247452.3	hg19	CCDS14678.1	.	.	.	.	.	.	.	.	.	.	-	11.35	1.612412	0.28712	.	.	ENSG00000046774	ENST00000247452	T	0.04809	3.55	0.988	0.988	0.19796	.	0.216956	0.39020	U	0.001481	T	0.08223	0.0205	M	0.74881	2.28	0.09310	N	0.999998	P	0.41784	0.762	P	0.44897	0.463	T	0.10636	-1.0621	10	0.87932	D	0	.	4.9988	0.14253	0.0:1.0:0.0:0.0	.	278	Q9UBF1	MAGC2_HUMAN	C	278	ENSP00000354660:W278C	ENSP00000354660:W278C	W	-	3	0	MAGEC2	141118606	0.029000	0.19370	0.031000	0.17742	0.423000	0.31445	-0.397000	0.07269	0.770000	0.33336	0.284000	0.19432	TGG	.	.		0.532	MAGEC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058611.1	NM_016249	
F8	2157	hgsc.bcm.edu	37	X	154194337	154194337	+	Missense_Mutation	SNP	T	T	C			TCGA-2Y-A9H9-01A-21D-A38X-10	TCGA-2Y-A9H9-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5586a43-bdc1-4030-93f8-cfb7bfa6a4b1	5ab2f233-e5fe-41df-9cef-56c0fdd900d3	g.chrX:154194337T>C	ENST00000360256.4	-	9	1551	c.1351A>G	c.(1351-1353)Aca>Gca	p.T451A	F8_ENST00000483822.1_5'UTR	NM_000132.3	NP_000123.1	P00451	FA8_HUMAN	coagulation factor VIII, procoagulant component	451	F5/8 type A 2.|Plastocyanin-like 3.				acute-phase response (GO:0006953)|blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|cell adhesion (GO:0007155)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)	copper ion binding (GO:0005507)|oxidoreductase activity (GO:0016491)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(27)|liver(1)|lung(47)|ovary(5)|pancreas(3)|prostate(1)|skin(5)|upper_aerodigestive_tract(5)|urinary_tract(2)	120	all_cancers(53;7.19e-17)|all_epithelial(53;9.83e-11)|all_lung(58;6.63e-07)|Lung NSC(58;2.08e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)				Coagulation Factor IX(DB00100)|Drotrecogin alfa(DB00055)	GTTTCATCTGTGTATGCCATA	0.378																																					p.T451A		Atlas-SNP	.											.	F8	646	.	0			c.A1351G						.						150.0	131.0	137.0					X																	154194337		2203	4300	6503	SO:0001583	missense	2157	exon9			CATCTGTGTATGC	M90707	CCDS35457.1, CCDS44026.1	Xq28	2014-09-17	2008-07-29		ENSG00000185010	ENSG00000185010			3546	protein-coding gene	gene with protein product	"""Factor VIIIF8B"", ""hemophilia A"""	300841		F8C		6438528, 3935400	Standard	NM_000132		Approved	FVIII, DXS1253E, HEMA	uc004fmt.3	P00451	OTTHUMG00000022688	ENST00000360256.4:c.1351A>G	chrX.hg19:g.154194337T>C	ENSP00000353393:p.Thr451Ala	50.0	0.0		76.0	66.0	NM_000132	Q14286|Q5HY69	Missense_Mutation	SNP	ENST00000360256.4	hg19	CCDS35457.1	.	.	.	.	.	.	.	.	.	.	T	18.12	3.552954	0.65425	.	.	ENSG00000185010	ENST00000360256	D	0.99150	-5.49	5.24	4.03	0.46877	Cupredoxin (2);	0.155438	0.56097	D	0.000034	D	0.99080	0.9684	M	0.89095	3.005	0.28399	N	0.918741	D	0.89917	1.0	D	0.87578	0.998	D	0.96480	0.9355	10	0.54805	T	0.06	-15.3364	3.9807	0.09493	0.1875:0.1:0.0:0.7124	.	451	P00451	FA8_HUMAN	A	451	ENSP00000353393:T451A	ENSP00000353393:T451A	T	-	1	0	F8	153847531	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	2.689000	0.46993	0.607000	0.29982	0.381000	0.24937	ACA	.	.		0.378	F8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058869.4		
MT-CO1	4512	hgsc.bcm.edu	37	M	6037	6037	+	Missense_Mutation	SNP	G	G	A			TCGA-2Y-A9H9-01A-21D-A38X-10	TCGA-2Y-A9H9-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5586a43-bdc1-4030-93f8-cfb7bfa6a4b1	5ab2f233-e5fe-41df-9cef-56c0fdd900d3	g.chrM:6037G>A	ENST00000361624.2	+	1	134	c.134G>A	c.(133-135)gGc>gAc	p.G45D	MT-TI_ENST00000387365.1_RNA|MT-ATP6_ENST00000361899.2_5'Flank|MT-TA_ENST00000387392.1_RNA|MT-TY_ENST00000387409.1_RNA|MT-CO2_ENST00000361739.1_5'Flank|MT-TQ_ENST00000387372.1_RNA|MT-RNR2_ENST00000387347.2_RNA|MT-TN_ENST00000387400.1_RNA|MT-TL1_ENST00000386347.1_RNA|MT-TS1_ENST00000387416.2_RNA|MT-TK_ENST00000387421.1_RNA|MT-TD_ENST00000387419.1_RNA|MT-TC_ENST00000387405.1_RNA|MT-ATP8_ENST00000361851.1_5'Flank|MT-TW_ENST00000387382.1_RNA|MT-TM_ENST00000387377.1_RNA			P00395	COX1_HUMAN	mitochondrially encoded cytochrome c oxidase I	45					aerobic respiration (GO:0009060)|cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|oxidative phosphorylation (GO:0006119)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex IV (GO:0005751)|respiratory chain complex IV (GO:0045277)	cytochrome-c oxidase activity (GO:0004129)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			breast(4)|endometrium(25)|kidney(19)|lung(3)|prostate(3)	54						GGGCCAGCCAGGCAACCTTCT	0.473																																					p.G45D		Atlas-SNP	.											.	.	.	.	0			c.G134A						.																																			SO:0001583	missense	5742	exon1			AGCCAGGCAACCT			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198804	ENSG00000198804		"""Mitochondrial respiratory chain complex / Complex IV"""	7419	protein-coding gene	gene with protein product		516030	"""cytochrome c oxidase I"""	MTCO1		7219534	Standard			Approved	COX1, COI		P00395		ENST00000361624.2:c.134G>A	chrM.hg19:g.6037G>A	ENSP00000354499:p.Gly45Asp	26.0	0.0		75.0	7.0	ENST00000361624	Q34770	Missense_Mutation	SNP	ENST00000361624.2	hg19																																																																																				.	.		0.473	MT-CO1-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024028	
MT-CO2	4513	hgsc.bcm.edu	37	M	7896	7896	+	Nonsense_Mutation	SNP	G	G	A			TCGA-2Y-A9H9-01A-21D-A38X-10	TCGA-2Y-A9H9-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5586a43-bdc1-4030-93f8-cfb7bfa6a4b1	5ab2f233-e5fe-41df-9cef-56c0fdd900d3	g.chrM:7896G>A	ENST00000361739.1	+	1	311	c.311G>A	c.(310-312)tGg>tAg	p.W104*	MT-TG_ENST00000387429.1_RNA|MT-CO3_ENST00000362079.2_5'Flank|MT-ND4L_ENST00000361335.1_5'Flank|MT-ATP6_ENST00000361899.2_5'Flank|MT-ND4_ENST00000361381.2_5'Flank|MT-TA_ENST00000387392.1_RNA|MT-TY_ENST00000387409.1_RNA|MT-TN_ENST00000387400.1_RNA|MT-TR_ENST00000387439.1_RNA|MT-TS1_ENST00000387416.2_RNA|MT-TK_ENST00000387421.1_RNA|MT-TD_ENST00000387419.1_RNA|MT-TC_ENST00000387405.1_RNA|MT-ATP8_ENST00000361851.1_5'Flank|MT-TW_ENST00000387382.1_RNA|MT-ND3_ENST00000361227.2_5'Flank			P00403	COX2_HUMAN	mitochondrially encoded cytochrome c oxidase II	104					cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|mitochondrial electron transport, cytochrome c to oxygen (GO:0006123)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|respiratory chain complex IV (GO:0045277)	copper ion binding (GO:0005507)|cytochrome-c oxidase activity (GO:0004129)			endometrium(5)|kidney(8)|lung(2)|pancreas(3)|prostate(1)	19						TGGCCACCAATGGTACTGAAC	0.502																																					p.W104X		Atlas-SNP	.											.	.	.	.	0			c.G311A						.																																			SO:0001587	stop_gained	5743	exon1			ACCAATGGTACTG			mitochondria	2012-11-16	2005-02-15	2005-02-16	ENSG00000198712	ENSG00000198712		"""Mitochondrial respiratory chain complex / Complex IV"""	7421	protein-coding gene	gene with protein product		516040	"""cytochrome c oxidase II"""	MTCO2		1712754, 1989603	Standard			Approved	COX2, CO2		P00403		ENST00000361739.1:c.311G>A	chrM.hg19:g.7896G>A	ENSP00000354876:p.Trp104*	20.0	0.0		45.0	14.0	ENST00000361739	Q37526	Nonsense_Mutation	SNP	ENST00000361739.1	hg19																																																																																				.	.		0.502	MT-CO2-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024029	
MT-ND5	4540	hgsc.bcm.edu	37	M	13633	13633	+	Missense_Mutation	SNP	G	G	A			TCGA-2Y-A9H9-01A-21D-A38X-10	TCGA-2Y-A9H9-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5586a43-bdc1-4030-93f8-cfb7bfa6a4b1	5ab2f233-e5fe-41df-9cef-56c0fdd900d3	g.chrM:13633G>A	ENST00000361567.2	+	1	1297	c.1297G>A	c.(1297-1299)Ggt>Agt	p.G433S	MT-CYB_ENST00000361789.2_5'Flank|MT-TS2_ENST00000387449.1_RNA|MT-TT_ENST00000387460.2_RNA|MT-TE_ENST00000387459.1_RNA|MT-TH_ENST00000387441.1_RNA|MT-TP_ENST00000387461.2_RNA|MT-TL2_ENST00000387456.1_RNA			P03915	NU5M_HUMAN	mitochondrially encoded NADH dehydrogenase 5	433					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(4)|endometrium(29)|kidney(33)|pancreas(1)|prostate(7)	74						TCACCCTAACAGGTCAACCTC	0.478																																					p.G433S		Atlas-SNP	.											.	.	.	.	0			c.G1297A						.																																			SO:0001583	missense	0	exon1			CTAACAGGTCAAC			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198786	ENSG00000198786	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7461	protein-coding gene	gene with protein product	"""complex I ND5 subunit"", ""NADH-ubiquinone oxidoreductase chain 5"""	516005	"""NADH dehydrogenase 5"""	MTND5			Standard			Approved	ND5, NAD5		P03915		ENST00000361567.2:c.1297G>A	chrM.hg19:g.13633G>A	ENSP00000354813:p.Gly433Ser	16.0	0.0		38.0	10.0	ENST00000361567	Q34773|Q8WCY3	Missense_Mutation	SNP	ENST00000361567.2	hg19																																																																																				.	.		0.478	MT-ND5-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024036	
USP8	9101	hgsc.bcm.edu	37	15	50789399	50789401	+	In_Frame_Del	DEL	ACC	ACC	-			TCGA-2Y-A9H9-01A-21D-A38X-10	TCGA-2Y-A9H9-10A-01D-A38X-10	ACC	ACC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5586a43-bdc1-4030-93f8-cfb7bfa6a4b1	5ab2f233-e5fe-41df-9cef-56c0fdd900d3	g.chr15:50789399_50789401delACC	ENST00000396444.3	+	18	3347_3349	c.3009_3011delACC	c.(3007-3012)ttacca>tta	p.P1005del	RP11-562A8.4_ENST00000560380.1_RNA|USP8_ENST00000307179.4_In_Frame_Del_p.P1005del|USP8_ENST00000433963.1_In_Frame_Del_p.P1005del|USP8_ENST00000425032.3_In_Frame_Del_p.P899del|RP11-562A8.5_ENST00000560159.1_lincRNA	NM_001128610.1|NM_005154.3	NP_001122082.1|NP_005145.3	P40818	UBP8_HUMAN	ubiquitin specific peptidase 8	1005	USP.				cell proliferation (GO:0008283)|endosome organization (GO:0007032)|mitotic cytokinesis (GO:0000281)|protein deubiquitination (GO:0016579)|protein K48-linked deubiquitination (GO:0071108)|protein K63-linked deubiquitination (GO:0070536)|Ras protein signal transduction (GO:0007265)|ubiquitin-dependent protein catabolic process (GO:0006511)	acrosomal vesicle (GO:0001669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|extrinsic component of plasma membrane (GO:0019897)|midbody (GO:0030496)|nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|ubiquitin-specific protease activity (GO:0004843)			central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(5)|lung(16)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	35				all cancers(107;0.000225)|GBM - Glioblastoma multiforme(94;0.000771)		TCTGGAAGTTACCACCTGTGCTT	0.36																																					p.1003_1004del		Atlas-Indel,Pindel	.											.	USP8	90	.	0			c.3008_3010del						.																																			SO:0001651	inframe_deletion	9101	exon18			.	D29956	CCDS10137.1, CCDS61632.1	15q21.1	2014-03-03	2005-08-08		ENSG00000138592	ENSG00000138592		"""Ubiquitin-specific peptidases"""	12631	protein-coding gene	gene with protein product		603158	"""ubiquitin specific protease 8"""			12838346, 9582025, 24482476	Standard	NM_005154		Approved	HumORF8, KIAA0055, UBPY, SPG59	uc001zyl.4	P40818	OTTHUMG00000131645	ENST00000396444.3:c.3009_3011delACC	chr15.hg19:g.50789402_50789404delACC	ENSP00000379721:p.Pro1005del	95.0	0.0		110.0	29.0	NM_001128610	B4DKA8|Q2TB31|Q7Z3U2|Q86VA0|Q8IWI7	In_Frame_Del	DEL	ENST00000396444.3	hg19	CCDS10137.1																																																																																			.	.		0.360	USP8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254541.1	NM_005154	
EFNB2	1948	hgsc.bcm.edu	37	13	107187266	107187266	+	Frame_Shift_Del	DEL	A	A	-			TCGA-2Y-A9H9-01A-21D-A38X-10	TCGA-2Y-A9H9-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5586a43-bdc1-4030-93f8-cfb7bfa6a4b1	5ab2f233-e5fe-41df-9cef-56c0fdd900d3	g.chr13:107187266delA	ENST00000245323.4	-	1	196	c.47delT	c.(46-48)ttgfs	p.L16fs		NM_004093.3	NP_004084.1	P52799	EFNB2_HUMAN	ephrin-B2	16					anatomical structure morphogenesis (GO:0009653)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cell migration involved in sprouting angiogenesis (GO:0002042)|cell-cell signaling (GO:0007267)|ephrin receptor signaling pathway (GO:0048013)|lymph vessel development (GO:0001945)|negative regulation of keratinocyte proliferation (GO:0010839)|organ morphogenesis (GO:0009887)|positive regulation of cardiac muscle cell differentiation (GO:2000727)|regulation of chemotaxis (GO:0050920)|viral process (GO:0016032)	focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ephrin receptor binding (GO:0046875)			haematopoietic_and_lymphoid_tissue(2)|large_intestine(2)|lung(7)|ovary(1)|skin(1)	13	Lung NSC(43;0.015)|all_neural(89;0.0741)|Lung SC(71;0.14)|Medulloblastoma(90;0.169)					TAAAACCATCAAAACACCCCA	0.537																																					p.L16fs		Atlas-Indel,Pindel	.											.	EFNB2	39	.	0			c.48delG						.						95.0	102.0	99.0					13																	107187266		2202	4300	6502	SO:0001589	frameshift_variant	1948	exon1			.	L38734	CCDS9507.1	13q33	2011-03-09			ENSG00000125266	ENSG00000125266		"""Ephrins"""	3227	protein-coding gene	gene with protein product	"""HTK ligand"", ""ligand of eph-related kinase 5"", ""eph-related receptor tyrosine kinase ligand 5"""	600527		EPLG5		7833926	Standard	NM_004093		Approved	LERK5, Htk-L, HTKL, MGC126226, MGC126227, MGC126228	uc001vqi.3	P52799	OTTHUMG00000017324	ENST00000245323.4:c.47delT	chr13.hg19:g.107187266delA	ENSP00000245323:p.Leu16fs	97.0	0.0		111.0	51.0	NM_004093	Q5JV56	Frame_Shift_Del	DEL	ENST00000245323.4	hg19	CCDS9507.1																																																																																			.	.		0.537	EFNB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045733.4	NM_004093	
ZBTB9	221504	hgsc.bcm.edu	37	6	33424037	33424038	+	Frame_Shift_Del	DEL	TG	TG	-			TCGA-2Y-A9H9-01A-21D-A38X-10	TCGA-2Y-A9H9-10A-01D-A38X-10	TG	TG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5586a43-bdc1-4030-93f8-cfb7bfa6a4b1	5ab2f233-e5fe-41df-9cef-56c0fdd900d3	g.chr6:33424037_33424038delTG	ENST00000395064.2	+	2	1428_1429	c.1160_1161delTG	c.(1159-1161)ctgfs	p.L387fs		NM_152735.3	NP_689948.1	Q96C00	ZBTB9_HUMAN	zinc finger and BTB domain containing 9	387	Gly-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|lung(6)|skin(1)|upper_aerodigestive_tract(2)	11						TTTGGTTGCCTGTGTGGGAAGC	0.609																																					p.387_387del		Atlas-Indel,Pindel	.											.	ZBTB9	23	.	0			c.1159_1160del						.																																			SO:0001589	frameshift_variant	221504	exon2			.	AK122644	CCDS4780.1	6p21.31	2013-01-09			ENSG00000213588	ENSG00000213588		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	28323	protein-coding gene	gene with protein product						12477932	Standard	NM_152735		Approved	MGC23166, ZNF919	uc003oeq.3	Q96C00	OTTHUMG00000140180	ENST00000395064.2:c.1160_1161delTG	chr6.hg19:g.33424041_33424042delTG	ENSP00000378503:p.Leu387fs	106.0	0.0		104.0	37.0	NM_152735	A2AB19	Frame_Shift_Del	DEL	ENST00000395064.2	hg19	CCDS4780.1																																																																																			.	.		0.609	ZBTB9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276533.1	NM_152735	
BAI1	575	hgsc.bcm.edu	37	8	143546087	143546087	+	Frame_Shift_Del	DEL	G	G	-			TCGA-2Y-A9H9-01A-21D-A38X-10	TCGA-2Y-A9H9-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5586a43-bdc1-4030-93f8-cfb7bfa6a4b1	5ab2f233-e5fe-41df-9cef-56c0fdd900d3	g.chr8:143546087delG	ENST00000517894.1	+	2	1422	c.528delG	c.(526-528)gtgfs	p.V176fs	BAI1_ENST00000323289.5_Frame_Shift_Del_p.V176fs			O14514	BAI1_HUMAN	brain-specific angiogenesis inhibitor 1	176					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell proliferation (GO:0008285)|neuropeptide signaling pathway (GO:0007218)|peripheral nervous system development (GO:0007422)|signal transduction (GO:0007165)	cell-cell junction (GO:0005911)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(2)|lung(28)|ovary(4)|pancreas(1)|prostate(7)	57	all_cancers(97;2.84e-12)|all_epithelial(106;5.91e-09)|Lung NSC(106;0.000322)|all_lung(105;0.000616)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0315)|Acute lymphoblastic leukemia(118;0.155)					ACCTGGTGGTGGGGAACCGCA	0.741																																					p.V176fs		Atlas-Indel,Pindel	.											.	BAI1	146	.	0			c.527delT						.						10.0	16.0	14.0					8																	143546087		1321	2618	3939	SO:0001589	frameshift_variant	575	exon1			.	AB005297	CCDS64985.1	8q24.3	2014-08-08			ENSG00000181790	ENSG00000181790		"""-"", ""GPCR / Class B : Orphans"""	943	protein-coding gene	gene with protein product		602682				9533023	Standard	NM_001702		Approved		uc003ywm.3	O14514	OTTHUMG00000164732	ENST00000517894.1:c.528delG	chr8.hg19:g.143546087delG	ENSP00000430945:p.Val176fs	47.0	0.0		62.0	23.0	NM_001702		Frame_Shift_Del	DEL	ENST00000517894.1	hg19																																																																																				.	.		0.741	BAI1-001	KNOWN	non_canonical_conserved|not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000379963.3	NM_001702	
KRTAP21-2	337978	hgsc.bcm.edu	37	21	32119370	32119393	+	In_Frame_Del	DEL	AGCCATAGCCACAGCCAGTTCCAT	AGCCATAGCCACAGCCAGTTCCAT	-	rs561745493|rs141027580		TCGA-2Y-A9H9-01A-21D-A38X-10	TCGA-2Y-A9H9-10A-01D-A38X-10	AGCCATAGCCACAGCCAGTTCCAT	AGCCATAGCCACAGCCAGTTCCAT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5586a43-bdc1-4030-93f8-cfb7bfa6a4b1	5ab2f233-e5fe-41df-9cef-56c0fdd900d3	g.chr21:32119370_32119393delAGCCATAGCCACAGCCAGTTCCAT	ENST00000333892.2	-	1	158_181	c.128_151delATGGAACTGGCTGTGGCTATGGCT	c.(127-153)tatggaactggctgtggctatggctgt>tgt	p.YGTGCGYG43del		NM_181617.1	NP_853648.1	Q3LI59	KR212_HUMAN	keratin associated protein 21-2	43						intermediate filament (GO:0005882)	structural constituent of cutaneous appendage (GO:0030281)	p.G46V(1)		lung(4)|skin(2)|upper_aerodigestive_tract(1)	7						ccgtatccacagccatagccacagccagttccatagccagagcc	0.54																																					p.43_51del		Atlas-INDEL	.											.	KRTAP21-2	16	.	1	Substitution - Missense(1)	lung(1)	c.129_152del						.																																			SO:0001651	inframe_deletion	337978	exon1			.	AP001709	CCDS13605.1	21q22.1	2006-03-13			ENSG00000187026	ENSG00000187026		"""Keratin associated proteins"""	18946	protein-coding gene	gene with protein product						12359730	Standard	NM_181617		Approved	KAP21.2	uc011adh.2	Q3LI59	OTTHUMG00000057769	ENST00000333892.2:c.128_151delATGGAACTGGCTGTGGCTATGGCT	chr21.hg19:g.32119370_32119393delAGCCATAGCCACAGCCAGTTCCAT	ENSP00000334287:p.Tyr43_Gly50del	62.0	0.0		67.0	26.0	NM_181617		In_Frame_Del	DEL	ENST00000333892.2	hg19	CCDS13605.1																																																																																			.	.		0.540	KRTAP21-2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128221.2		
GSPT1	2935	hgsc.bcm.edu	37	16	11991733	11991750	+	5'UTR	DEL	TTGAACCTAGACAAGAGA	TTGAACCTAGACAAGAGA	-			TCGA-2Y-A9H9-01A-21D-A38X-10	TCGA-2Y-A9H9-10A-01D-A38X-10	TTGAACCTAGACAAGAGA	TTGAACCTAGACAAGAGA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5586a43-bdc1-4030-93f8-cfb7bfa6a4b1	5ab2f233-e5fe-41df-9cef-56c0fdd900d3	g.chr16:11991733_11991750delTTGAACCTAGACAAGAGA	ENST00000563468.1	-	0	0_12				GSPT1_ENST00000420576.2_5'UTR|GSPT1_ENST00000439887.2_Splice_Site_p.132_134VSC>G|RP11-166B2.8_ENST00000574364.1_RNA|GSPT1_ENST00000434724.2_Splice_Site_p.132_134VSC>G			P15170	ERF3A_HUMAN	G1 to S phase transition 1						G1/S transition of mitotic cell cycle (GO:0000082)|GTP catabolic process (GO:0006184)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|protein methylation (GO:0006479)|translational termination (GO:0006415)	intracellular (GO:0005622)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)|translation release factor activity (GO:0003747)			breast(1)|central_nervous_system(1)|kidney(4)|lung(4)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	14						ACAGCTGAATTTGAACCTAGACAAGAGATTGAAATATA	0.307																																					p.132_134del		Atlas-Indel,Pindel	.											.	GSPT1	71	.	0			c.395_401del						.																																			SO:0001623	5_prime_UTR_variant	2935	exon3			.	BC008391	CCDS45412.1, CCDS45413.1, CCDS45414.1	16p13.1	2008-08-01							4621	protein-coding gene	gene with protein product		139259				2511002, 17700517	Standard	NM_002094		Approved	GST1, ETF3A, eRF3a	uc002dbt.3	P15170		ENST00000563468.1:c.-27TCTCTTGTCTAGGTTCAA>-	chr16.hg19:g.11991733_11991750delTTGAACCTAGACAAGAGA		180.0	0.0		195.0	41.0	NM_001130006	J3KQG6|Q96GF2	Frame_Shift_Del	DEL	ENST00000563468.1	hg19	CCDS45414.1																																																																																			.	.		0.307	GSPT1-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000421513.1	NM_002094	
OR11H6	122748	hgsc.bcm.edu	37	14	20692318	20692318	+	Frame_Shift_Del	DEL	C	C	-			TCGA-2Y-A9H9-01A-21D-A38X-10	TCGA-2Y-A9H9-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5586a43-bdc1-4030-93f8-cfb7bfa6a4b1	5ab2f233-e5fe-41df-9cef-56c0fdd900d3	g.chr14:20692318delC	ENST00000315519.2	+	1	528	c.450delC	c.(448-450)tacfs	p.Y150fs		NM_001004480.1	NP_001004480.1	Q8NGC7	O11H6_HUMAN	olfactory receptor, family 11, subfamily H, member 6	150						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			cervix(1)|endometrium(2)|kidney(1)|large_intestine(6)|liver(1)|lung(13)|ovary(2)|prostate(1)|skin(2)	29	all_cancers(95;0.00108)		Epithelial(56;1.75e-06)|all cancers(55;1.22e-05)	GBM - Glioblastoma multiforme(265;0.0143)		CATTACACTACCCCTCCATCA	0.428																																					p.Y150fs		Atlas-Indel,Pindel	.											.	OR11H6	60	.	0			c.449delA						.						134.0	132.0	133.0					14																	20692318		2203	4300	6503	SO:0001589	frameshift_variant	122748	exon1			.		CCDS32033.1	14q11.2	2013-09-24			ENSG00000176219	ENSG00000176219		"""GPCR / Class A : Olfactory receptors"""	15349	protein-coding gene	gene with protein product							Standard	NM_001004480		Approved		uc010tlc.2	Q8NGC7	OTTHUMG00000170850	ENST00000315519.2:c.450delC	chr14.hg19:g.20692318delC	ENSP00000319071:p.Tyr150fs	48.0	0.0		80.0	35.0	NM_001004480	Q6IF08	Frame_Shift_Del	DEL	ENST00000315519.2	hg19	CCDS32033.1																																																																																			.	.		0.428	OR11H6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410676.1		
UPF3B	65109	hgsc.bcm.edu	37	X	118975169	118975172	+	Frame_Shift_Del	DEL	TTTC	TTTC	-			TCGA-2Y-A9H9-01A-21D-A38X-10	TCGA-2Y-A9H9-10A-01D-A38X-10	TTTC	TTTC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5586a43-bdc1-4030-93f8-cfb7bfa6a4b1	5ab2f233-e5fe-41df-9cef-56c0fdd900d3	g.chrX:118975169_118975172delTTTC	ENST00000276201.2	-	7	743_746	c.674_677delGAAA	c.(673-678)agaaaafs	p.RK225fs	UPF3B_ENST00000345865.2_Frame_Shift_Del_p.RK225fs|UPF3B_ENST00000478840.1_5'UTR	NM_080632.2	NP_542199.1	Q9BZI7	REN3B_HUMAN	UPF3 regulator of nonsense transcripts homolog B (yeast)	225	Necessary for interaction with UPF2.|Sufficient for association with EJC core.				gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|mRNA splicing, via spliceosome (GO:0000398)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|positive regulation of translation (GO:0045727)|RNA metabolic process (GO:0016070)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|exon-exon junction complex (GO:0035145)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	mRNA binding (GO:0003729)|nucleocytoplasmic transporter activity (GO:0005487)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(3)|endometrium(4)|kidney(1)|large_intestine(7)|lung(12)|ovary(2)|prostate(1)	30						tctttgtctttttctttctatttc	0.338																																					p.225_226del		Atlas-Indel,Pindel	.											.	UPF3B	74	.	0			c.675_678del	GRCh37	CD075577	UPF3B	D		.																																			SO:0001589	frameshift_variant	65109	exon7			.	AF318576	CCDS14587.1, CCDS14588.1	Xq25-q26	2014-01-31			ENSG00000125351	ENSG00000125351			20439	protein-coding gene	gene with protein product		300298	"""mental retardation, X-linked 62"""	MRX62		11113196, 11163187, 19238151	Standard	NM_023010		Approved	RENT3B, UPF3X, HUPF3B	uc004erz.2	Q9BZI7	OTTHUMG00000022282	ENST00000276201.2:c.674_677delGAAA	chrX.hg19:g.118975173_118975176delTTTC	ENSP00000276201:p.Arg225fs	39.0	0.0		80.0	64.0	NM_023010	D3DWI3|D3DWI4|Q0VAK8|Q9H1J0	Frame_Shift_Del	DEL	ENST00000276201.2	hg19	CCDS14588.1																																																																																			.	.		0.338	UPF3B-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000058068.1		
