#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
PLCH2	9651	hgsc.bcm.edu	37	1	2436408	2436408	+	Missense_Mutation	SNP	G	G	A	rs374511532		TCGA-3K-AAZ8-01A-12D-A38X-10	TCGA-3K-AAZ8-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ca7f5e36-bbb3-44aa-b0c7-3f170a2bbc0f	c70e868a-ba0a-4b90-ad4d-d61ed7b34ecf	g.chr1:2436408G>A	ENST00000419816.2	+	22	4281	c.4007G>A	c.(4006-4008)cGg>cAg	p.R1336Q	PLCH2_ENST00000378486.3_Missense_Mutation_p.R1336Q|PLCH2_ENST00000449969.1_3'UTR|PLCH2_ENST00000378488.3_Missense_Mutation_p.R1300Q			O75038	PLCH2_HUMAN	phospholipase C, eta 2	1336					inositol phosphate metabolic process (GO:0043647)|intracellular signal transduction (GO:0035556)|lipid catabolic process (GO:0016042)|phosphatidylinositol metabolic process (GO:0046488)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|phosphatidylinositol phospholipase C activity (GO:0004435)|signal transducer activity (GO:0004871)			central_nervous_system(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(8)|ovary(1)|prostate(3)|skin(1)	20	all_cancers(77;0.000161)|all_epithelial(69;5.98e-05)|all_lung(157;0.016)|Lung NSC(156;0.0376)|Ovarian(185;0.0634)	all_epithelial(116;7.32e-16)|all_lung(118;1.15e-06)|Lung NSC(185;6.26e-05)|Renal(390;0.00571)|Breast(487;0.00832)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Medulloblastoma(700;0.151)|Lung SC(97;0.217)		Epithelial(90;1.44e-37)|OV - Ovarian serous cystadenocarcinoma(86;6.78e-23)|GBM - Glioblastoma multiforme(42;2.8e-08)|Colorectal(212;4.19e-05)|COAD - Colon adenocarcinoma(227;0.000195)|Kidney(185;0.00034)|BRCA - Breast invasive adenocarcinoma(365;0.00443)|KIRC - Kidney renal clear cell carcinoma(229;0.00548)|STAD - Stomach adenocarcinoma(132;0.00644)|Lung(427;0.2)		GGTTTTGTGCGGCGCTCCTCC	0.731																																					p.R1336Q		Atlas-SNP	.											.	PLCH2	131	.	0			c.G4007A						.	G	GLN/ARG	0,3172		0,0,1586	3.0	4.0	4.0		4007	2.5	0.8	1		4	5,7217		0,5,3606	no	missense	PLCH2	NM_014638.2	43	0,5,5192	AA,AG,GG		0.0692,0.0,0.0481	possibly-damaging	1336/1417	2436408	5,10389	1586	3611	5197	SO:0001583	missense	9651	exon22			TTGTGCGGCGCTC	AB007919	CCDS59959.1	1p36.32	2013-01-10	2006-03-16	2006-03-16	ENSG00000149527	ENSG00000149527	3.1.4.11	"""EF-hand domain containing"""	29037	protein-coding gene	gene with protein product		612836	"""phospholipase C-like 4"""	PLCL4		15899900	Standard	XM_006711054		Approved	KIAA0450, PLCeta2, RP3-395M20.1, PLC-eta2	uc001aji.1	O75038	OTTHUMG00000000719	ENST00000419816.2:c.4007G>A	chr1.hg19:g.2436408G>A	ENSP00000389803:p.Arg1336Gln	62.0	0.0		56.0	23.0	NM_014638	A2VCM3|B9DI80|Q3LUA8|Q86XJ2|Q86XU1|Q86YU7|Q8TEH5|Q8WUS6	Missense_Mutation	SNP	ENST00000419816.2	hg19		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	16.82|16.82	3.229367|3.229367	0.58777|0.58777	0.0|0.0	6.92E-4|6.92E-4	ENSG00000149527|ENSG00000149527	ENST00000419816|ENST00000378486;ENST00000378488;ENST00000278878	.|T;T	.|0.64618	.|0.17;-0.11	4.41|4.41	2.52|2.52	0.30459|0.30459	.|.	.|1.454070	.|0.04326	.|N	.|0.351512	T|T	0.57359|0.57359	0.2048|0.2048	M|M	0.73217|0.73217	2.22|2.22	0.80722|0.80722	D|D	1|1	.|D;P	.|0.53745	.|0.962;0.584	.|B;B	.|0.32677	.|0.15;0.058	T|T	0.55522|0.55522	-0.8128|-0.8128	5|9	.|.	.|.	.|.	.|.	9.0964|9.0964	0.36642|0.36642	0.1805:0.0:0.8195:0.0|0.1805:0.0:0.8195:0.0	.|.	.|1088;1336	.|B9DI82;O75038	.|.;PLCH2_HUMAN	S|Q	631|1336;1300;1088	.|ENSP00000367747:R1336Q;ENSP00000367749:R1300Q	.|.	G|R	+|+	1|2	0|0	PLCH2|PLCH2	2426268|2426268	1.000000|1.000000	0.71417|0.71417	0.832000|0.832000	0.32986|0.32986	0.251000|0.251000	0.25915|0.25915	7.139000|7.139000	0.77314|0.77314	0.320000|0.320000	0.23234|0.23234	0.491000|0.491000	0.48974|0.48974	GGC|CGG	.	.		0.731	PLCH2-009	KNOWN	non_canonical_conserved|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000467514.1	NM_014638	
PRDM16	63976	hgsc.bcm.edu	37	1	3329297	3329297	+	Missense_Mutation	SNP	C	C	T			TCGA-3K-AAZ8-01A-12D-A38X-10	TCGA-3K-AAZ8-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ca7f5e36-bbb3-44aa-b0c7-3f170a2bbc0f	c70e868a-ba0a-4b90-ad4d-d61ed7b34ecf	g.chr1:3329297C>T	ENST00000270722.5	+	9	2585	c.2536C>T	c.(2536-2538)Cgg>Tgg	p.R846W	PRDM16_ENST00000378398.3_Missense_Mutation_p.R847W|PRDM16_ENST00000378391.2_Missense_Mutation_p.R846W|PRDM16_ENST00000511072.1_Missense_Mutation_p.R847W|PRDM16_ENST00000514189.1_Missense_Mutation_p.R847W|PRDM16_ENST00000512462.1_3'UTR|PRDM16_ENST00000441472.2_Missense_Mutation_p.R846W|PRDM16_ENST00000442529.2_Missense_Mutation_p.R846W			Q9HAZ2	PRD16_HUMAN	PR domain containing 16	846	Interaction with CTBP1 and CTBP2. {ECO:0000250}.|Mediates interaction with SKI and regulation of TGF-beta signaling.				brown fat cell differentiation (GO:0050873)|negative regulation of granulocyte differentiation (GO:0030853)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neurogenesis (GO:0022008)|palate development (GO:0060021)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cellular respiration (GO:0043457)|somatic stem cell maintenance (GO:0035019)|tongue development (GO:0043586)|transcription, DNA-templated (GO:0006351)|white fat cell differentiation (GO:0050872)	nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|transcription coactivator activity (GO:0003713)			breast(4)|central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(7)|lung(22)|ovary(2)|pancreas(1)|prostate(2)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(3)	59	all_cancers(77;0.00208)|all_epithelial(69;0.000732)|Ovarian(185;0.0634)|Lung NSC(156;0.109)|all_lung(157;0.111)	all_epithelial(116;2.03e-21)|all_lung(118;7.55e-09)|Lung NSC(185;1.28e-06)|Breast(487;0.000792)|Renal(390;0.00137)|Hepatocellular(190;0.00515)|Myeloproliferative disorder(586;0.0267)|Ovarian(437;0.0365)|Lung SC(97;0.114)|Medulloblastoma(700;0.134)		Epithelial(90;5.59e-35)|OV - Ovarian serous cystadenocarcinoma(86;1.99e-20)|GBM - Glioblastoma multiforme(42;3.72e-11)|Colorectal(212;0.000425)|BRCA - Breast invasive adenocarcinoma(365;0.000946)|COAD - Colon adenocarcinoma(227;0.000968)|Kidney(185;0.00155)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0175)|Lung(427;0.137)		GTGCCCGGCGCGGATGCCCCA	0.692			T	EVI1	"""MDS, AML"""																																p.R846W		Atlas-SNP	.		Dom	yes		1	1p36.23-p33	63976	PR domain containing 16		L	.	PRDM16	147	.	0			c.C2536T						.						7.0	8.0	8.0					1																	3329297		1795	3908	5703	SO:0001583	missense	63976	exon9			CCGGCGCGGATGC	AF294278	CCDS41236.1, CCDS44048.1, CCDS41236.2, CCDS44048.2	1p36.23-p33	2013-01-08			ENSG00000142611	ENSG00000142611		"""Zinc fingers, C2H2-type"""	14000	protein-coding gene	gene with protein product	"""MDS1/EVI1-like"", ""PR-domain zinc finger protein 16"", ""transcription factor MEL1"""	605557				11050005	Standard	NM_199454		Approved	MEL1, PFM13, KIAA1675, MGC166915	uc001akf.3	Q9HAZ2	OTTHUMG00000000581	ENST00000270722.5:c.2536C>T	chr1.hg19:g.3329297C>T	ENSP00000270722:p.Arg846Trp	88.0	0.0		65.0	34.0	NM_022114	A6NHQ8|B1AJP7|B1AJP8|B1AJP9|B1WB48|Q8WYJ9|Q9C0I8	Missense_Mutation	SNP	ENST00000270722.5	hg19	CCDS41236.2	.	.	.	.	.	.	.	.	.	.	C	8.280	0.815354	0.16607	.	.	ENSG00000142611	ENST00000511072;ENST00000378398;ENST00000441472;ENST00000442529;ENST00000378391;ENST00000514189;ENST00000270722;ENST00000512462;ENST00000408992;ENST00000509860	T;T;T;T;T;T;T;T;T	0.06608	3.3;3.32;3.33;3.34;3.32;3.31;3.33;3.28;3.29	4.05	3.11	0.35812	.	0.268828	0.25628	U	0.029366	T	0.10208	0.0250	L	0.43152	1.355	0.26118	N	0.980596	B;B;D;B	0.55385	0.001;0.001;0.971;0.001	B;B;P;B	0.49047	0.0;0.002;0.599;0.001	T	0.05084	-1.0907	10	0.56958	D	0.05	.	13.1324	0.59391	0.1617:0.8382:0.0:0.0	.	846;846;846;846	Q9HAZ2;Q9HAZ2-2;F8WEV3;D3YTA5	PRD16_HUMAN;.;.;.	W	847;847;846;846;846;847;846;662;662;655	ENSP00000426975:R847W;ENSP00000367651:R847W;ENSP00000407968:R846W;ENSP00000405253:R846W;ENSP00000367643:R846W;ENSP00000421400:R847W;ENSP00000270722:R846W;ENSP00000422504:R662W;ENSP00000425796:R655W	ENSP00000270722:R846W	R	+	1	2	PRDM16	3319157	1.000000	0.71417	0.117000	0.21633	0.033000	0.12548	5.440000	0.66563	0.803000	0.34113	-0.332000	0.08345	CGG	.	.		0.692	PRDM16-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000001382.3	NM_022114	
NMNAT1	64802	hgsc.bcm.edu	37	1	10042386	10042386	+	Missense_Mutation	SNP	G	G	T			TCGA-3K-AAZ8-01A-12D-A38X-10	TCGA-3K-AAZ8-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ca7f5e36-bbb3-44aa-b0c7-3f170a2bbc0f	c70e868a-ba0a-4b90-ad4d-d61ed7b34ecf	g.chr1:10042386G>T	ENST00000377205.1	+	5	611	c.467G>T	c.(466-468)gGg>gTg	p.G156V	RP11-807G9.2_ENST00000413148.1_RNA	NM_022787.3	NP_073624.2	Q9HAN9	NMNA1_HUMAN	nicotinamide nucleotide adenylyltransferase 1	156			G -> R (in LCA9). {ECO:0000269|PubMed:22842227}.		NAD biosynthetic process (GO:0009435)|NAD metabolic process (GO:0019674)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|nicotinamide-nucleotide adenylyltransferase activity (GO:0000309)|nicotinate-nucleotide adenylyltransferase activity (GO:0004515)			large_intestine(2)|lung(2)|stomach(1)	5		all_lung(284;0.000407)|Renal(390;0.000469)|Lung NSC(185;0.000577)|Colorectal(325;0.0062)|Breast(348;0.00686)|Hepatocellular(190;0.0305)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.104)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.31e-08)|COAD - Colon adenocarcinoma(227;1.54e-05)|Kidney(185;0.00028)|BRCA - Breast invasive adenocarcinoma(304;0.00032)|KIRC - Kidney renal clear cell carcinoma(229;0.00101)|STAD - Stomach adenocarcinoma(132;0.00908)|READ - Rectum adenocarcinoma(331;0.0419)		CTGCTGTGTGGGGCAGATTTA	0.483																																					p.G156V		Atlas-SNP	.											.	NMNAT1	18	.	0			c.G467T						.						104.0	101.0	102.0					1																	10042386		2203	4300	6503	SO:0001583	missense	64802	exon5			TGTGTGGGGCAGA	AF312734	CCDS108.1, CCDS72698.1	1p36.22	2014-01-28	2003-04-30	2003-05-02	ENSG00000173614	ENSG00000173614	2.7.7.1		17877	protein-coding gene	gene with protein product		608700	"""nicotinamide nucleotide adenylyltransferase"", ""Leber congenital amaurosis 9"", ""Leber's congenital amaurosis 9"""	LCA9		11248244, 11027696, 22842227	Standard	XR_244792		Approved	NMNAT, PNAT1	uc001aqp.3	Q9HAN9	OTTHUMG00000001799	ENST00000377205.1:c.467G>T	chr1.hg19:g.10042386G>T	ENSP00000366410:p.Gly156Val	92.0	0.0		84.0	27.0	NM_022787	B1AN63|Q8TAE9|Q9H247|Q9H6B6	Missense_Mutation	SNP	ENST00000377205.1	hg19	CCDS108.1	.	.	.	.	.	.	.	.	.	.	G	26.2	4.712659	0.89112	.	.	ENSG00000173614	ENST00000377205	D	0.99915	-7.99	5.12	5.12	0.69794	Cytidylyltransferase (1);Rossmann-like alpha/beta/alpha sandwich fold (1);	0.000000	0.85682	D	0.000000	D	0.99945	0.9976	H	0.95982	3.75	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.95988	0.8983	10	0.87932	D	0	-1.8287	18.9958	0.92812	0.0:0.0:1.0:0.0	.	156	Q9HAN9	NMNA1_HUMAN	V	156	ENSP00000366410:G156V	ENSP00000366410:G156V	G	+	2	0	NMNAT1	9964973	1.000000	0.71417	1.000000	0.80357	0.942000	0.58702	9.449000	0.97603	2.549000	0.85964	0.456000	0.33151	GGG	.	.		0.483	NMNAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005029.1		
EMC1	23065	hgsc.bcm.edu	37	1	19568962	19568962	+	Missense_Mutation	SNP	T	T	A			TCGA-3K-AAZ8-01A-12D-A38X-10	TCGA-3K-AAZ8-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ca7f5e36-bbb3-44aa-b0c7-3f170a2bbc0f	c70e868a-ba0a-4b90-ad4d-d61ed7b34ecf	g.chr1:19568962T>A	ENST00000477853.1	-	5	428	c.386A>T	c.(385-387)cAg>cTg	p.Q129L	RP1-43E13.2_ENST00000437898.1_RNA|EMC1_ENST00000375208.3_Missense_Mutation_p.Q107L|EMC1_ENST00000375199.3_Missense_Mutation_p.Q129L	NM_001271427.1|NM_001271428.1|NM_015047.2	NP_001258356.1|NP_001258357.1|NP_055862.1	Q8N766	EMC1_HUMAN	ER membrane protein complex subunit 1	129						ER membrane protein complex (GO:0072546)|integral component of membrane (GO:0016021)											CCCAAGTGCCTGGAAACTGAA	0.552																																					p.Q129L		Atlas-SNP	.											.	.	.	.	0			c.A386T						.						94.0	83.0	86.0					1																	19568962		2203	4300	6503	SO:0001583	missense	23065	exon5			AGTGCCTGGAAAC		CCDS190.1, CCDS59190.1, CCDS59191.1	1p36.13	2012-05-23	2012-05-23	2012-05-23	ENSG00000127463	ENSG00000127463			28957	protein-coding gene	gene with protein product			"""KIAA0090"""	KIAA0090		22119785	Standard	NM_015047		Approved		uc001bbo.4	Q8N766	OTTHUMG00000002497	ENST00000477853.1:c.386A>T	chr1.hg19:g.19568962T>A	ENSP00000420608:p.Gln129Leu	72.0	0.0		53.0	31.0	NM_001271427	A8K6F3|Q14700|Q5TG62|Q63HL0|Q63HL3|Q8NBH8	Missense_Mutation	SNP	ENST00000477853.1	hg19	CCDS190.1	.	.	.	.	.	.	.	.	.	.	T	33	5.268798	0.95429	.	.	ENSG00000127463	ENST00000477853;ENST00000375199;ENST00000375208	T;T;T	0.41400	1.0;1.0;1.91	6.08	6.08	0.98989	Quinonprotein alcohol dehydrogenase-like (2);	0.000000	0.85682	D	0.000000	T	0.58221	0.2107	L	0.56769	1.78	0.80722	D	1	D;D;D;D	0.69078	0.991;0.991;0.996;0.997	P;P;D;D	0.66602	0.852;0.889;0.909;0.945	T	0.52866	-0.8518	10	0.25751	T	0.34	.	15.4678	0.75416	0.0:0.0:0.0:1.0	.	107;129;129;129	Q8N766-4;Q8N766-2;Q8N766-3;Q8N766	.;.;.;K0090_HUMAN	L	129;129;107	ENSP00000420608:Q129L;ENSP00000364345:Q129L;ENSP00000364354:Q107L	ENSP00000364345:Q129L	Q	-	2	0	KIAA0090	19441549	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.883000	0.69721	2.333000	0.79357	0.533000	0.62120	CAG	.	.		0.552	EMC1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000007076.2	NM_015047	
PTPRU	10076	hgsc.bcm.edu	37	1	29602163	29602163	+	Missense_Mutation	SNP	A	A	T			TCGA-3K-AAZ8-01A-12D-A38X-10	TCGA-3K-AAZ8-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ca7f5e36-bbb3-44aa-b0c7-3f170a2bbc0f	c70e868a-ba0a-4b90-ad4d-d61ed7b34ecf	g.chr1:29602163A>T	ENST00000345512.3	+	8	1477	c.1348A>T	c.(1348-1350)Atc>Ttc	p.I450F	PTPRU_ENST00000323874.8_Missense_Mutation_p.I450F|PTPRU_ENST00000428026.2_Missense_Mutation_p.I450F|PTPRU_ENST00000356870.3_Missense_Mutation_p.I450F|PTPRU_ENST00000460170.2_Missense_Mutation_p.I450F|PTPRU_ENST00000373779.3_Missense_Mutation_p.I450F	NM_005704.4	NP_005695.3	Q92729	PTPRU_HUMAN	protein tyrosine phosphatase, receptor type, U	450	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				canonical Wnt signaling pathway (GO:0060070)|cell adhesion (GO:0007155)|cell differentiation (GO:0030154)|homotypic cell-cell adhesion (GO:0034109)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|organ regeneration (GO:0031100)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|protein localization to cell surface (GO:0034394)|response to glucocorticoid (GO:0051384)|single organismal cell-cell adhesion (GO:0016337)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	cell-cell junction (GO:0005911)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(4)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(18)|lung(26)|ovary(1)|prostate(3)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	79		Colorectal(325;0.000399)|Lung NSC(340;0.00953)|all_lung(284;0.0112)|Breast(348;0.0126)|all_neural(195;0.0199)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0563)|Medulloblastoma(700;0.123)		Colorectal(126;6.99e-07)|COAD - Colon adenocarcinoma(152;3.18e-05)|STAD - Stomach adenocarcinoma(196;0.0234)|READ - Rectum adenocarcinoma(331;0.0686)|BRCA - Breast invasive adenocarcinoma(304;0.0871)		CCGCTACACCATCAAGAACCT	0.557																																					p.I450F		Atlas-SNP	.											.	PTPRU	374	.	0			c.A1348T						.						185.0	144.0	158.0					1																	29602163		2203	4300	6503	SO:0001583	missense	10076	exon8			TACACCATCAAGA	U71075	CCDS334.1, CCDS335.1, CCDS44098.1, CCDS44098.2, CCDS53290.1	1p35.3	2013-02-11			ENSG00000060656	ENSG00000060656		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9683	protein-coding gene	gene with protein product	"""pi R-PTP-Psi"""	602454				8700514, 9434160	Standard	NM_133178		Approved	PTPRO, hPTP-J, PCP-2, FMI, PTP	uc001bru.3	Q92729	OTTHUMG00000003699	ENST00000345512.3:c.1348A>T	chr1.hg19:g.29602163A>T	ENSP00000334941:p.Ile450Phe	422.0	0.0		306.0	146.0	NM_001195001	A6H8L1|O00197|P78399|Q59HA4|Q5SYU4|Q5SYU5|Q92735|Q92850	Missense_Mutation	SNP	ENST00000345512.3	hg19	CCDS334.1	.	.	.	.	.	.	.	.	.	.	A	16.74	3.206762	0.58343	.	.	ENSG00000060656	ENST00000345512;ENST00000373779;ENST00000356870;ENST00000323874;ENST00000428026;ENST00000460170	T;T;T;T;T;T	0.57436	0.4;0.4;0.4;0.4;0.4;0.4	5.4	5.4	0.78164	Fibronectin, type III (3);Immunoglobulin-like fold (1);	0.150917	0.45126	D	0.000398	T	0.40040	0.1101	L	0.52573	1.65	0.44762	D	0.997762	P;B;P;P;P	0.42409	0.705;0.233;0.705;0.779;0.581	B;B;B;B;B	0.30029	0.11;0.069;0.11;0.051;0.051	T	0.37430	-0.9706	9	.	.	.	.	10.9844	0.47514	0.8439:0.1561:0.0:0.0	.	450;450;450;450;450	Q92729-3;Q92729-4;Q92729-2;E9PH42;Q92729	.;.;.;.;PTPRU_HUMAN	F	450	ENSP00000334941:I450F;ENSP00000362884:I450F;ENSP00000349333:I450F;ENSP00000314987:I450F;ENSP00000392332:I450F;ENSP00000432906:I450F	.	I	+	1	0	PTPRU	29474750	1.000000	0.71417	1.000000	0.80357	0.907000	0.53573	3.775000	0.55349	2.177000	0.69029	0.523000	0.50628	ATC	.	.		0.557	PTPRU-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000010447.1		
CSMD2	114784	hgsc.bcm.edu	37	1	34035031	34035031	+	Missense_Mutation	SNP	T	T	A			TCGA-3K-AAZ8-01A-12D-A38X-10	TCGA-3K-AAZ8-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ca7f5e36-bbb3-44aa-b0c7-3f170a2bbc0f	c70e868a-ba0a-4b90-ad4d-d61ed7b34ecf	g.chr1:34035031T>A	ENST00000373381.4	-	52	8250	c.8074A>T	c.(8074-8076)Agg>Tgg	p.R2692W		NM_001281956.1|NM_052896.3	NP_001268885.1|NP_443128.2	Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2	2694	Sushi 17. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(5)|breast(5)|central_nervous_system(3)|cervix(2)|endometrium(20)|haematopoietic_and_lymphoid_tissue(4)|kidney(9)|large_intestine(43)|lung(114)|ovary(8)|pancreas(1)|prostate(6)|skin(20)|upper_aerodigestive_tract(5)|urinary_tract(1)	246		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)				TCACGCACCCTGGAGCCCACC	0.587																																					p.R2694W		Atlas-SNP	.											.	CSMD2	946	.	0			c.A8080T						.						92.0	82.0	85.0					1																	34035031		2203	4300	6503	SO:0001583	missense	114784	exon53			GCACCCTGGAGCC	AY210418	CCDS380.1, CCDS60082.1	1p34.3	2014-01-28			ENSG00000121904	ENSG00000121904			19290	protein-coding gene	gene with protein product		608398				11472063, 11572484	Standard	NM_001281956		Approved	KIAA1884	uc001bxn.1	Q7Z408	OTTHUMG00000011135	ENST00000373381.4:c.8074A>T	chr1.hg19:g.34035031T>A	ENSP00000362479:p.Arg2692Trp	101.0	0.0		67.0	21.0	NM_052896	B1AM50|E7EUA6|Q53TY4|Q5VT59|Q8N963|Q96Q03|Q9H4V7|Q9H4V8|Q9H4V9|Q9H4W0|Q9H4W1|Q9H4W2|Q9H4W3|Q9H4W4|Q9HCY5|Q9HCY6|Q9HCY7	Missense_Mutation	SNP	ENST00000373381.4	hg19		.	.	.	.	.	.	.	.	.	.	T	14.76	2.630863	0.46944	.	.	ENSG00000121904	ENST00000373381	T	0.66099	-0.19	5.47	-3.92	0.04155	Complement control module (2);Sushi/SCR/CCP (3);	0.000000	0.85682	D	0.000000	T	0.80132	0.4567	M	0.86343	2.81	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.78314	0.991;0.949	D	0.83907	0.0293	10	0.72032	D	0.01	.	21.0284	0.99944	0.0:0.0:0.8124:0.1876	.	2694;2692	Q7Z408;E7EUA6	CSMD2_HUMAN;.	W	2692	ENSP00000362479:R2692W	ENSP00000241312:R2694W	R	-	1	2	CSMD2	33807618	1.000000	0.71417	0.985000	0.45067	0.009000	0.06853	1.213000	0.32407	-0.590000	0.05866	-1.444000	0.01066	AGG	.	.		0.587	CSMD2-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_052896	
OMA1	115209	hgsc.bcm.edu	37	1	58971782	58971782	+	Missense_Mutation	SNP	G	G	A			TCGA-3K-AAZ8-01A-12D-A38X-10	TCGA-3K-AAZ8-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ca7f5e36-bbb3-44aa-b0c7-3f170a2bbc0f	c70e868a-ba0a-4b90-ad4d-d61ed7b34ecf	g.chr1:58971782G>A	ENST00000371226.3	-	8	1428	c.1315C>T	c.(1315-1317)Cac>Tac	p.H439Y	OMA1_ENST00000358603.2_Missense_Mutation_p.H439Y|DAB1_ENST00000485760.1_5'UTR	NM_145243.3	NP_660286.1	Q96E52	OMA1_HUMAN	OMA1 zinc metallopeptidase	439					cristae formation (GO:0042407)|diet induced thermogenesis (GO:0002024)|energy homeostasis (GO:0097009)|glucose metabolic process (GO:0006006)|lipid metabolic process (GO:0006629)|misfolded or incompletely synthesized protein catabolic process (GO:0006515)|mitochondrial protein processing (GO:0034982)|negative regulation of mitochondrial fusion (GO:0010637)|response to stress (GO:0006950)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial membrane (GO:0031966)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)			NS(1)|breast(1)|large_intestine(6)|liver(2)|lung(6)|prostate(1)|skin(1)	18	all_cancers(7;6.54e-05)					TGAGAAGGGTGTGTAGATAAC	0.453																																					p.H439Y		Atlas-SNP	.											.	OMA1	50	.	0			c.C1315T						.						144.0	127.0	133.0					1																	58971782		2203	4300	6503	SO:0001583	missense	115209	exon8			AAGGGTGTGTAGA	AK091101	CCDS608.1	1p32.2-p32.1	2013-05-03	2013-05-03		ENSG00000162600	ENSG00000162600			29661	protein-coding gene	gene with protein product	"""overlapping activity with M-AAA protease"", ""zinc metallopeptidase OMA1"""		"""OMA1 zinc metallopeptidase homolog (S. cerevisiae)"""			12477932	Standard	NM_145243		Approved	MPRP-1, YKR087C, ZMPOMA1, FLJ33782	uc001cyy.3	Q96E52	OTTHUMG00000010068	ENST00000371226.3:c.1315C>T	chr1.hg19:g.58971782G>A	ENSP00000360270:p.His439Tyr	96.0	0.0		78.0	18.0	NM_145243	D3DQ54|Q5T3G6|Q5T3G7|Q5T3G8|Q5T3G9|Q5T3H0|Q8NBB3	Missense_Mutation	SNP	ENST00000371226.3	hg19	CCDS608.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	26.2|26.2	4.716958|4.716958	0.89205|0.89205	.|.	.|.	ENSG00000162600|ENSG00000162600	ENST00000358603;ENST00000371226|ENST00000421528	D;D|D	0.91407|0.84516	-2.84;-2.84|-1.86	5.34|5.34	5.34|5.34	0.76211|0.76211	.|.	0.049804|.	0.85682|.	D|.	0.000000|.	D|D	0.95433|0.95433	0.8517|0.8517	H|H	0.97390|0.97390	3.995|3.995	0.54753|0.54753	D|D	0.999981|0.999981	D;D|.	0.89917|.	1.0;1.0|.	D;D|.	0.97110|.	1.0;1.0|.	D|D	0.96709|0.96709	0.9524|0.9524	10|7	0.87932|0.87932	D|D	0|0	-7.6031|-7.6031	17.9783|17.9783	0.89133|0.89133	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	439;439|.	Q96E52;Q96E52-2|.	OMA1_HUMAN;.|.	Y|I	439|280	ENSP00000351417:H439Y;ENSP00000360270:H439Y|ENSP00000391941:T280I	ENSP00000351417:H439Y|ENSP00000391941:T280I	H|T	-|-	1|2	0|0	OMA1|OMA1	58744370|58744370	1.000000|1.000000	0.71417|0.71417	0.975000|0.975000	0.42487|0.42487	0.918000|0.918000	0.54935|0.54935	8.712000|8.712000	0.91403|0.91403	2.785000|2.785000	0.95823|0.95823	0.650000|0.650000	0.86243|0.86243	CAC|ACA	.	.		0.453	OMA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027819.1	NM_145243	
IL23R	149233	hgsc.bcm.edu	37	1	67648612	67648612	+	Missense_Mutation	SNP	T	T	A			TCGA-3K-AAZ8-01A-12D-A38X-10	TCGA-3K-AAZ8-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ca7f5e36-bbb3-44aa-b0c7-3f170a2bbc0f	c70e868a-ba0a-4b90-ad4d-d61ed7b34ecf	g.chr1:67648612T>A	ENST00000347310.5	+	4	632	c.461T>A	c.(460-462)aTa>aAa	p.I154K	C1orf141_ENST00000371007.2_Intron|IL23R_ENST00000371002.1_Missense_Mutation_p.I154K	NM_144701.2	NP_653302.2	Q5VWK5	IL23R_HUMAN	interleukin 23 receptor	154	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				defense response to Gram-negative bacterium (GO:0050829)|inflammatory response (GO:0006954)|interleukin-23-mediated signaling pathway (GO:0038155)|negative regulation of interleukin-10 production (GO:0032693)|positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of activation of JAK2 kinase activity (GO:0010535)|positive regulation of defense response to virus by host (GO:0002230)|positive regulation of granulocyte macrophage colony-stimulating factor production (GO:0032725)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-17 production (GO:0032740)|positive regulation of memory T cell differentiation (GO:0043382)|positive regulation of natural killer cell proliferation (GO:0032819)|positive regulation of NK T cell activation (GO:0051135)|positive regulation of osteoclast differentiation (GO:0045672)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of T-helper 1 type immune response (GO:0002827)|positive regulation of T-helper 17 cell lineage commitment (GO:2000330)|positive regulation of T-helper 17 type immune response (GO:2000318)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation of tyrosine phosphorylation of Stat4 protein (GO:0042520)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|regulation of tyrosine phosphorylation of Stat1 protein (GO:0042510)|response to interferon-gamma (GO:0034341)|response to lipopolysaccharide (GO:0032496)	interleukin-23 receptor complex (GO:0072536)|receptor complex (GO:0043235)				breast(2)|endometrium(2)|kidney(2)|large_intestine(3)|liver(2)|lung(7)|ovary(1)|skin(1)|urinary_tract(1)	21						CTCACCTACATAGACACAAAA	0.478																																					p.I154K		Atlas-SNP	.											.	IL23R	52	.	0			c.T461A						.						127.0	116.0	120.0					1																	67648612		2203	4300	6503	SO:0001583	missense	149233	exon4			CCTACATAGACAC	AF461422	CCDS637.1	1p31.2	2008-02-05			ENSG00000162594	ENSG00000162594			19100	protein-coding gene	gene with protein product		607562				12023369	Standard	NM_144701		Approved	IL-23R	uc001ddo.3	Q5VWK5	OTTHUMG00000009092	ENST00000347310.5:c.461T>A	chr1.hg19:g.67648612T>A	ENSP00000321345:p.Ile154Lys	128.0	0.0		112.0	22.0	NM_144701	C9JGX4|Q4VGP1|Q4VGP2|Q4VGP3|Q4VGP4|Q4VGP5|Q4VGP6|Q5VWK7|Q8IW84|Q8NFQ9|Q96AS1	Missense_Mutation	SNP	ENST00000347310.5	hg19	CCDS637.1	.	.	.	.	.	.	.	.	.	.	T	14.22	2.469966	0.43839	.	.	ENSG00000162594	ENST00000347310;ENST00000431791;ENST00000441823;ENST00000416525;ENST00000540911;ENST00000371002;ENST00000540775;ENST00000543799	T;T	0.23552	1.9;1.9	5.24	5.24	0.73138	Fibronectin, type III (3);Immunoglobulin-like fold (1);	0.621107	0.16267	N	0.221996	T	0.23965	0.0580	L	0.53249	1.67	0.80722	D	1	P;P;P;P;P;D	0.53151	0.925;0.95;0.925;0.874;0.925;0.958	B;P;P;P;P;P	0.50708	0.387;0.648;0.466;0.571;0.466;0.466	T	0.03394	-1.1041	10	0.87932	D	0	-31.2694	11.5495	0.50713	0.0:0.0:0.0:1.0	.	8;13;13;8;154;154	B6HY71;E9PHX4;E9PG12;B6HY79;Q5VWK5-3;Q5VWK5	.;.;.;.;.;IL23R_HUMAN	K	154;13;13;13;13;154;109;109	ENSP00000321345:I154K;ENSP00000360041:I154K	ENSP00000321345:I154K	I	+	2	0	IL23R	67421200	0.332000	0.24722	0.969000	0.41365	0.505000	0.33919	4.204000	0.58460	1.987000	0.57996	0.460000	0.39030	ATA	.	.		0.478	IL23R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025199.2	NM_144701	
CHIA	27159	hgsc.bcm.edu	37	1	111861228	111861228	+	Silent	SNP	T	T	A			TCGA-3K-AAZ8-01A-12D-A38X-10	TCGA-3K-AAZ8-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ca7f5e36-bbb3-44aa-b0c7-3f170a2bbc0f	c70e868a-ba0a-4b90-ad4d-d61ed7b34ecf	g.chr1:111861228T>A	ENST00000369740.1	+	9	946	c.843T>A	c.(841-843)atT>atA	p.I281I	RP5-1125M8.2_ENST00000426321.1_RNA|CHIA_ENST00000483391.1_Silent_p.I120I|CHIA_ENST00000430615.1_Silent_p.I173I|CHIA_ENST00000353665.6_Silent_p.I120I|CHIA_ENST00000343320.6_Silent_p.I281I|CHIA_ENST00000451398.2_Silent_p.I120I	NM_001258001.1|NM_201653.3	NP_001244930.1|NP_970615.2	Q9BZP6	CHIA_HUMAN	chitinase, acidic	281					apoptotic process (GO:0006915)|cell wall chitin metabolic process (GO:0006037)|chitin catabolic process (GO:0006032)|chitin metabolic process (GO:0006030)|digestion (GO:0007586)|immune response (GO:0006955)|polysaccharide catabolic process (GO:0000272)|positive regulation of chemokine secretion (GO:0090197)|production of molecular mediator involved in inflammatory response (GO:0002532)|response to fungus (GO:0009620)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	carbohydrate binding (GO:0030246)|chitin binding (GO:0008061)|chitinase activity (GO:0004568)|kinase binding (GO:0019900)|lysozyme activity (GO:0003796)			central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(3)|lung(9)|ovary(1)|skin(1)	23		all_cancers(81;3.23e-05)|all_epithelial(167;1.2e-05)|all_lung(203;0.000154)|Lung NSC(277;0.000304)		Colorectal(144;0.0115)|Lung(183;0.0292)|COAD - Colon adenocarcinoma(174;0.0314)|all cancers(265;0.0477)|Epithelial(280;0.0918)|LUSC - Lung squamous cell carcinoma(189;0.154)		ACACTGGAATTGGTGCCCCCA	0.532																																					p.I281I		Atlas-SNP	.											.	CHIA	115	.	0			c.T843A						.						153.0	147.0	149.0					1																	111861228		2203	4300	6503	SO:0001819	synonymous_variant	27159	exon9			TGGAATTGGTGCC	AF290004	CCDS832.1, CCDS41368.1, CCDS58017.1	1p13.2	2008-05-14			ENSG00000134216	ENSG00000134216			17432	protein-coding gene	gene with protein product		606080				11085997	Standard	NM_021797		Approved	AMCase, TSA1902, CHIT2	uc001eas.4	Q9BZP6	OTTHUMG00000011165	ENST00000369740.1:c.843T>A	chr1.hg19:g.111861228T>A		146.0	0.0		89.0	30.0	NM_201653	Q32W79|Q32W80|Q3B866|Q5U5Z5|Q5VUV4|Q86UD8|Q9ULY3|Q9ULY4	Silent	SNP	ENST00000369740.1	hg19	CCDS41368.1																																																																																			.	.		0.532	CHIA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030710.1		
HAX1	10456	hgsc.bcm.edu	37	1	154245239	154245239	+	Missense_Mutation	SNP	C	C	A			TCGA-3K-AAZ8-01A-12D-A38X-10	TCGA-3K-AAZ8-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ca7f5e36-bbb3-44aa-b0c7-3f170a2bbc0f	c70e868a-ba0a-4b90-ad4d-d61ed7b34ecf	g.chr1:154245239C>A	ENST00000328703.7	+	1	253	c.40C>A	c.(40-42)Cct>Act	p.P14T	HAX1_ENST00000483970.2_Missense_Mutation_p.P14T|HAX1_ENST00000457918.2_Missense_Mutation_p.P14T|HAX1_ENST00000532105.1_De_novo_Start_InFrame	NM_006118.3	NP_006109.2	O00165	HAX1_HUMAN	HCLS1 associated protein X-1	14	Required for localization in mitochondria. {ECO:0000250}.				cellular response to cytokine stimulus (GO:0071345)|positive regulation of actin cytoskeleton reorganization (GO:2000251)|positive regulation of granulocyte differentiation (GO:0030854)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of actin filament polymerization (GO:0030833)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrion degradation (GO:1903146)|regulation of protein targeting to mitochondrion (GO:1903214)	actin cytoskeleton (GO:0015629)|cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|lamellipodium (GO:0030027)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|sarcoplasmic reticulum (GO:0016529)|transcription factor complex (GO:0005667)	interleukin-1 binding (GO:0019966)|protein N-terminus binding (GO:0047485)			cervix(1)|endometrium(2)|large_intestine(2)|lung(8)|prostate(1)|upper_aerodigestive_tract(1)	15	all_lung(78;2.62e-30)|Lung NSC(65;3.94e-28)|Hepatocellular(266;0.0877)		LUSC - Lung squamous cell carcinoma(543;0.185)			TTTCGGCTTTCCTGGACCTCG	0.567									Kostmann syndrome																												p.P14T		Atlas-SNP	.											.	HAX1	25	.	0			c.C40A						.						55.0	54.0	54.0					1																	154245239		2203	4300	6503	SO:0001583	missense	10456	exon1	Familial Cancer Database	Kostmann Infantile Agranulocytosis, Severe Congenital Neutropenia, Congenital Agranulocytosis	GGCTTTCCTGGAC	U68566	CCDS1064.1, CCDS44230.1	1q21.3	2014-09-17			ENSG00000143575	ENSG00000143575			16915	protein-coding gene	gene with protein product	"""HCLS1 (and PKD2) associated protein"""	605998				9058808, 10760273	Standard	NM_006118		Approved	HS1BP1, HCLSBP1	uc001fes.3	O00165	OTTHUMG00000035978	ENST00000328703.7:c.40C>A	chr1.hg19:g.154245239C>A	ENSP00000329002:p.Pro14Thr	115.0	0.0		131.0	28.0	NM_006118	A8W4W9|A8W4X0|B4DUJ7|Q5VYD5|Q5VYD7|Q96AU4|Q9BS80	Missense_Mutation	SNP	ENST00000328703.7	hg19	CCDS1064.1	.	.	.	.	.	.	.	.	.	.	C	20.4	3.976550	0.74360	.	.	ENSG00000143575	ENST00000328703;ENST00000457918;ENST00000483970;ENST00000435087	T;T;T;T	0.66280	0.97;-0.2;0.97;0.97	4.53	-0.145	0.13436	.	0.199329	0.42964	D	0.000623	T	0.39200	0.1069	M	0.71581	2.175	0.80722	D	1	B;B;P	0.35575	0.167;0.03;0.51	B;B;B	0.32864	0.085;0.055;0.154	T	0.38478	-0.9659	10	0.72032	D	0.01	-6.9549	7.363	0.26758	0.0:0.5613:0.0:0.4387	.	14;14;14	O00165-2;O00165-5;O00165	.;.;HAX1_HUMAN	T	14	ENSP00000329002:P14T;ENSP00000411448:P14T;ENSP00000435088:P14T;ENSP00000394920:P14T	ENSP00000329002:P14T	P	+	1	0	HAX1	152511863	0.999000	0.42202	0.999000	0.59377	0.986000	0.74619	0.922000	0.28734	0.080000	0.16959	0.655000	0.94253	CCT	.	.		0.567	HAX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087650.1	NM_006118	
PYGO2	90780	hgsc.bcm.edu	37	1	154931785	154931785	+	Missense_Mutation	SNP	C	C	T			TCGA-3K-AAZ8-01A-12D-A38X-10	TCGA-3K-AAZ8-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ca7f5e36-bbb3-44aa-b0c7-3f170a2bbc0f	c70e868a-ba0a-4b90-ad4d-d61ed7b34ecf	g.chr1:154931785C>T	ENST00000368457.2	-	3	862	c.691G>A	c.(691-693)Ggt>Agt	p.G231S	RP11-307C12.12_ENST00000605085.1_RNA|PYGO2_ENST00000368456.1_Missense_Mutation_p.G194S|PYGO2_ENST00000483463.1_5'Flank	NM_138300.3	NP_612157.1	Q9BRQ0	PYGO2_HUMAN	pygopus family PHD finger 2	231	Pro-rich.				brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|developmental growth (GO:0048589)|in utero embryonic development (GO:0001701)|kidney development (GO:0001822)|lens development in camera-type eye (GO:0002088)|mammary gland development (GO:0030879)|palate development (GO:0060021)|positive regulation of chromatin binding (GO:0035563)|post-embryonic development (GO:0009791)|regulation of histone H3-K4 methylation (GO:0051569)|regulation of mammary gland epithelial cell proliferation (GO:0033599)|spermatid nucleus differentiation (GO:0007289)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|histone acetyltransferase regulator activity (GO:0035034)|zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(2)|lung(3)|skin(2)|urinary_tract(1)	10	all_epithelial(22;4.9e-30)|all_lung(78;4.1e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)|all_neural(408;0.245)		BRCA - Breast invasive adenocarcinoma(34;0.00034)			AGCCCCTGACCAGGTCTCTGG	0.632																																					p.G231S	NSCLC(87;357 1460 1955 21029 23522)	Atlas-SNP	.											.	PYGO2	32	.	0			c.G691A						.						27.0	32.0	30.0					1																	154931785		2203	4300	6503	SO:0001583	missense	90780	exon3			CCTGACCAGGTCT	BC006132	CCDS1075.1	1q22	2013-10-09	2013-10-09		ENSG00000163348	ENSG00000163348		"""Zinc fingers, PHD-type"""	30257	protein-coding gene	gene with protein product		606903	"""pygopus homolog 2 (Drosophila)"""			11988739	Standard	NM_138300		Approved		uc001fft.3	Q9BRQ0	OTTHUMG00000037370	ENST00000368457.2:c.691G>A	chr1.hg19:g.154931785C>T	ENSP00000357442:p.Gly231Ser	144.0	0.0		157.0	14.0	NM_138300	Q8WYZ4|Q96CY2	Missense_Mutation	SNP	ENST00000368457.2	hg19	CCDS1075.1	.	.	.	.	.	.	.	.	.	.	C	11.94	1.788679	0.31685	.	.	ENSG00000163348	ENST00000368457;ENST00000368456	T;T	0.42513	0.97;0.98	4.72	4.72	0.59763	.	0.153445	0.41396	D	0.000881	T	0.06462	0.0166	N	0.08118	0	0.31468	N	0.66873	B	0.23058	0.079	B	0.15870	0.014	T	0.19943	-1.0290	10	0.05525	T	0.97	-5.8889	8.7651	0.34698	0.0:0.9001:0.0:0.0999	.	231	Q9BRQ0	PYGO2_HUMAN	S	231;194	ENSP00000357442:G231S;ENSP00000357441:G194S	ENSP00000357441:G194S	G	-	1	0	PYGO2	153198409	0.124000	0.22315	1.000000	0.80357	0.989000	0.77384	0.232000	0.17891	2.454000	0.82982	0.462000	0.41574	GGT	.	.		0.632	PYGO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090949.1	NM_138300	
OR10K2	391107	hgsc.bcm.edu	37	1	158390373	158390373	+	Missense_Mutation	SNP	A	A	T			TCGA-3K-AAZ8-01A-12D-A38X-10	TCGA-3K-AAZ8-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ca7f5e36-bbb3-44aa-b0c7-3f170a2bbc0f	c70e868a-ba0a-4b90-ad4d-d61ed7b34ecf	g.chr1:158390373A>T	ENST00000314902.2	-	1	283	c.284T>A	c.(283-285)cTg>cAg	p.L95Q		NM_001004476.1	NP_001004476.1	Q6IF99	O10K2_HUMAN	olfactory receptor, family 10, subfamily K, member 2	95						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(1)|cervix(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(19)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	36	all_hematologic(112;0.0378)					GGCACAGCCCAGGAAAGAAAT	0.478																																					p.L95Q		Atlas-SNP	.											.	OR10K2	69	.	0			c.T284A						.						178.0	174.0	175.0					1																	158390373		2203	4300	6503	SO:0001583	missense	391107	exon1			CAGCCCAGGAAAG	AB065642	CCDS30896.1	1q23.1	2012-08-09			ENSG00000180708	ENSG00000180708		"""GPCR / Class A : Olfactory receptors"""	14826	protein-coding gene	gene with protein product							Standard	NM_001004476		Approved		uc010pii.2	Q6IF99	OTTHUMG00000019638	ENST00000314902.2:c.284T>A	chr1.hg19:g.158390373A>T	ENSP00000324251:p.Leu95Gln	112.0	0.0		139.0	41.0	NM_001004476		Missense_Mutation	SNP	ENST00000314902.2	hg19	CCDS30896.1	.	.	.	.	.	.	.	.	.	.	A	1.710	-0.499247	0.04291	.	.	ENSG00000180708	ENST00000314902	T	0.00397	7.57	4.1	1.66	0.24008	GPCR, rhodopsin-like superfamily (1);	0.798993	0.10278	N	0.693841	T	0.00039	0.0001	N	0.25031	0.7	0.09310	N	1	P	0.39717	0.684	B	0.29267	0.1	T	0.00001	-1.2757	10	0.19147	T	0.46	.	3.7156	0.08437	0.6486:0.0:0.1881:0.1633	.	95	Q6IF99	O10K2_HUMAN	Q	95	ENSP00000324251:L95Q	ENSP00000324251:L95Q	L	-	2	0	OR10K2	156656997	0.000000	0.05858	0.482000	0.27366	0.398000	0.30690	-0.297000	0.08276	0.214000	0.20742	0.383000	0.25322	CTG	.	.		0.478	OR10K2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051854.1	NM_001004476	
TNFSF18	8995	hgsc.bcm.edu	37	1	173010529	173010529	+	Missense_Mutation	SNP	G	G	A			TCGA-3K-AAZ8-01A-12D-A38X-10	TCGA-3K-AAZ8-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ca7f5e36-bbb3-44aa-b0c7-3f170a2bbc0f	c70e868a-ba0a-4b90-ad4d-d61ed7b34ecf	g.chr1:173010529G>A	ENST00000404377.3	-	3	578	c.578C>T	c.(577-579)gCa>gTa	p.A193V	RP1-15D23.2_ENST00000432694.2_lincRNA|TNFSF18_ENST00000239468.2_Missense_Mutation_p.A171V	NM_005092.3	NP_005083.2	Q9UNG2	TNF18_HUMAN	tumor necrosis factor (ligand) superfamily, member 18	193					cell-cell signaling (GO:0007267)|negative regulation of apoptotic process (GO:0043066)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|regulation of T cell proliferation (GO:0042129)|signal transduction (GO:0007165)|T cell proliferation involved in immune response (GO:0002309)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	cell surface (GO:0009986)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor binding (GO:0005102)|tumor necrosis factor receptor superfamily binding (GO:0032813)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(3)|skin(1)	9						TTGGGGATTTGCTAGTAAAAT	0.413																																					p.A193V		Atlas-SNP	.											.	TNFSF18	24	.	0			c.C578T						.						86.0	83.0	84.0					1																	173010529		2203	4300	6503	SO:0001583	missense	8995	exon3			GGATTTGCTAGTA	AF117713	CCDS1305.2	1q23	2008-02-05			ENSG00000120337	ENSG00000120337		"""Tumor necrosis factor (ligand) superfamily"""	11932	protein-coding gene	gene with protein product		603898				10037686, 10074428	Standard	NM_005092		Approved	AITRL, TL6, hGITRL	uc001giu.2	Q9UNG2	OTTHUMG00000034835	ENST00000404377.3:c.578C>T	chr1.hg19:g.173010529G>A	ENSP00000385470:p.Ala193Val	121.0	0.0		148.0	91.0	NM_005092	A9IQG8|O95852|Q6ISV1	Missense_Mutation	SNP	ENST00000404377.3	hg19	CCDS1305.2	.	.	.	.	.	.	.	.	.	.	G	15.92	2.976194	0.53720	.	.	ENSG00000120337	ENST00000404377;ENST00000239468	.	.	.	5.66	1.98	0.26296	Tumour necrosis factor-like (2);	0.734354	0.12572	N	0.457166	T	0.10337	0.0253	L	0.27053	0.805	0.09310	N	1	B	0.15719	0.014	B	0.10450	0.005	T	0.22452	-1.0216	9	0.41790	T	0.15	-2.1274	3.2248	0.06728	0.2377:0.0:0.5088:0.2535	.	193	Q9UNG2	TNF18_HUMAN	V	193;171	.	ENSP00000239468:A171V	A	-	2	0	TNFSF18	171277152	0.009000	0.17119	0.001000	0.08648	0.759000	0.43091	0.990000	0.29642	0.698000	0.31739	0.655000	0.94253	GCA	.	.		0.413	TNFSF18-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000084268.2	NM_005092	
RGSL1	353299	hgsc.bcm.edu	37	1	182458311	182458311	+	Missense_Mutation	SNP	A	A	C			TCGA-3K-AAZ8-01A-12D-A38X-10	TCGA-3K-AAZ8-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ca7f5e36-bbb3-44aa-b0c7-3f170a2bbc0f	c70e868a-ba0a-4b90-ad4d-d61ed7b34ecf	g.chr1:182458311A>C	ENST00000294854.8	+	8	1711	c.1691A>C	c.(1690-1692)gAg>gCg	p.E564A	RGSL1_ENST00000542961.1_Missense_Mutation_p.E599A	NM_001137669.1	NP_001131141.1	A5PLK6	RGSL_HUMAN	regulator of G-protein signaling like 1	564					termination of G-protein coupled receptor signaling pathway (GO:0038032)	integral component of membrane (GO:0016021)				central_nervous_system(2)|skin(4)	6						CTCCAGGTAGAGCTGACATCT	0.423																																					p.E564A	Ovarian(71;11 616 11292 12944 18021 32289 33994 41738 46526)	Atlas-SNP	.											.	RGSL1	111	.	0			c.A1691C						.						82.0	73.0	75.0					1																	182458311		692	1591	2283	SO:0001583	missense	353299	exon8			AGGTAGAGCTGAC	AF510428	CCDS58049.1	1q25	2013-04-02	2007-08-14		ENSG00000121446	ENSG00000121446			18636	protein-coding gene	gene with protein product		611012	"""regulator of G-protein signalling like 1"", ""regulator of G-protein signaling like 2"", ""regulator of G-protein signalling like 2"""	RGSL2		12801632	Standard	NM_001137669		Approved		uc009wxw.3	A5PLK6	OTTHUMG00000035217	ENST00000294854.8:c.1691A>C	chr1.hg19:g.182458311A>C	ENSP00000457748:p.Glu564Ala	119.0	0.0		165.0	31.0	NM_001137669	A2A2Z0|A6PVM2|A6PVM3|Q0VAJ4|Q0VAJ5|Q6ZRL0|Q86UV0|Q9H084	Missense_Mutation	SNP	ENST00000294854.8	hg19	CCDS58049.1																																																																																			.	.		0.423	RGSL1-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320710.3	NM_181572	
TRIM11	81559	hgsc.bcm.edu	37	1	228588704	228588704	+	Silent	SNP	G	G	A			TCGA-3K-AAZ8-01A-12D-A38X-10	TCGA-3K-AAZ8-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ca7f5e36-bbb3-44aa-b0c7-3f170a2bbc0f	c70e868a-ba0a-4b90-ad4d-d61ed7b34ecf	g.chr1:228588704G>A	ENST00000284551.6	-	3	974	c.696C>T	c.(694-696)ctC>ctT	p.L232L	TRIM11_ENST00000460651.1_5'UTR|TRIM11_ENST00000366699.3_Silent_p.L232L|TRIM11_ENST00000493030.2_Silent_p.L107L	NM_145214.2	NP_660215.1	Q96F44	TRI11_HUMAN	tripartite motif containing 11	232					defense response to virus (GO:0051607)|innate immune response (GO:0045087)|negative regulation of neurogenesis (GO:0050768)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of viral entry into host cell (GO:0046597)|negative regulation of viral release from host cell (GO:1902187)|negative regulation of viral transcription (GO:0032897)|positive regulation of viral entry into host cell (GO:0046598)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(12)|ovary(1)|skin(1)	18		Prostate(94;0.0724)				AGCGGCCCTCGAGCTCGGCGA	0.726																																					p.L232L		Atlas-SNP	.											.	TRIM11	38	.	0			c.C696T						.						8.0	10.0	9.0					1																	228588704		2161	4243	6404	SO:0001819	synonymous_variant	81559	exon3			GCCCTCGAGCTCG	AF220125	CCDS31048.1	1q42.13	2013-01-09	2011-01-25		ENSG00000154370	ENSG00000154370		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	16281	protein-coding gene	gene with protein product		607868	"""tripartite motif-containing 11"""			11331580	Standard	NM_145214		Approved	RNF92, BIA1	uc001hss.3	Q96F44	OTTHUMG00000039773	ENST00000284551.6:c.696C>T	chr1.hg19:g.228588704G>A		80.0	0.0		82.0	45.0	NM_145214	A6NKE2|B2RB82|B3KUS3|B4DX88|Q5VSU1|Q8NCA6|Q9C022	Silent	SNP	ENST00000284551.6	hg19	CCDS31048.1																																																																																			.	.		0.726	TRIM11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095995.3	NM_145214	
WDR64	128025	hgsc.bcm.edu	37	1	241920625	241920625	+	Missense_Mutation	SNP	T	T	C			TCGA-3K-AAZ8-01A-12D-A38X-10	TCGA-3K-AAZ8-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ca7f5e36-bbb3-44aa-b0c7-3f170a2bbc0f	c70e868a-ba0a-4b90-ad4d-d61ed7b34ecf	g.chr1:241920625T>C	ENST00000366552.2	+	14	1988	c.1781T>C	c.(1780-1782)cTg>cCg	p.L594P	WDR64_ENST00000437684.2_Missense_Mutation_p.L594P	NM_144625.4	NP_653226.4	B1ANS9	WDR64_HUMAN	WD repeat domain 64	594										breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(17)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	44	Ovarian(103;0.103)	all_cancers(173;0.0121)	OV - Ovarian serous cystadenocarcinoma(106;0.0116)			ATCTGGGAGCTGCCTGATGTT	0.408																																					p.L594P		Atlas-SNP	.											.	WDR64	234	.	0			c.T1781C						.						127.0	107.0	114.0					1																	241920625		2203	4300	6503	SO:0001583	missense	128025	exon14			GGGAGCTGCCTGA	AK057540		1q43	2013-01-09			ENSG00000162843	ENSG00000162843		"""WD repeat domain containing"""	26570	protein-coding gene	gene with protein product							Standard	NM_144625		Approved	FLJ32978	uc001hzg.2	B1ANS9	OTTHUMG00000039705	ENST00000366552.2:c.1781T>C	chr1.hg19:g.241920625T>C	ENSP00000355510:p.Leu594Pro	93.0	0.0		107.0	71.0	NM_144625	B1ANT0|Q7Z573|Q96LY9	Missense_Mutation	SNP	ENST00000366552.2	hg19		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	12.52|12.52	1.963589|1.963589	0.34659|0.34659	.|.	.|.	ENSG00000162843|ENSG00000162843	ENST00000425826|ENST00000366552;ENST00000437684;ENST00000414635	.|T;T;T	.|0.61627	.|0.09;0.09;0.09	5.54|5.54	5.54|5.54	0.83059|0.83059	.|WD40 repeat-like-containing domain (1);	.|0.000000	.|0.43579	.|D	.|0.000554	T|T	0.72374|0.72374	0.3452|0.3452	M|M	0.68952|0.68952	2.095|2.095	0.80722|0.80722	D|D	1|1	.|D;D	.|0.89917	.|1.0;0.999	.|D;D	.|0.85130	.|0.991;0.997	T|T	0.71255|0.71255	-0.4647|-0.4647	5|10	.|0.33940	.|T	.|0.23	-8.8387|-8.8387	13.205|13.205	0.59790|0.59790	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|594;314	.|B1ANS9;D1MPS4	.|WDR64_HUMAN;.	R|P	73|594;594;365	.|ENSP00000355510:L594P;ENSP00000402446:L594P;ENSP00000406656:L365P	.|ENSP00000355510:L594P	C|L	+|+	1|2	0|0	WDR64|WDR64	239987248|239987248	1.000000|1.000000	0.71417|0.71417	0.999000|0.999000	0.59377|0.59377	0.030000|0.030000	0.12068|0.12068	4.049000|4.049000	0.57397|0.57397	2.099000|2.099000	0.63709|0.63709	0.528000|0.528000	0.53228|0.53228	TGC|CTG	.	.		0.408	WDR64-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_144625	
NLRP3	114548	hgsc.bcm.edu	37	1	247593020	247593020	+	Missense_Mutation	SNP	A	A	G			TCGA-3K-AAZ8-01A-12D-A38X-10	TCGA-3K-AAZ8-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ca7f5e36-bbb3-44aa-b0c7-3f170a2bbc0f	c70e868a-ba0a-4b90-ad4d-d61ed7b34ecf	g.chr1:247593020A>G	ENST00000336119.3	+	4	3036	c.2290A>G	c.(2290-2292)Acg>Gcg	p.T764A	NLRP3_ENST00000366496.2_Missense_Mutation_p.T764A|NLRP3_ENST00000348069.2_Intron|NLRP3_ENST00000391827.2_Intron|NLRP3_ENST00000366497.2_Missense_Mutation_p.T764A|NLRP3_ENST00000391828.3_Missense_Mutation_p.T764A	NM_001127462.2|NM_001243133.1|NM_004895.4	NP_001120934.1|NP_001230062.1|NP_004886.3	Q96P20	NALP3_HUMAN	NLR family, pyrin domain containing 3	764					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|cellular response to lipopolysaccharide (GO:0071222)|defense response (GO:0006952)|defense response to virus (GO:0051607)|detection of biotic stimulus (GO:0009595)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|interleukin-1 beta production (GO:0032611)|interleukin-1 secretion (GO:0050701)|interleukin-18 production (GO:0032621)|negative regulation of acute inflammatory response (GO:0002674)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-1 beta secretion (GO:0050713)|negative regulation of NF-kappaB import into nucleus (GO:0042347)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|NLRP3 inflammasome complex assembly (GO:0044546)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of interleukin-1 beta secretion (GO:0050718)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein oligomerization (GO:0051259)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|NLRP3 inflammasome complex (GO:0072559)	ATP binding (GO:0005524)|peptidoglycan binding (GO:0042834)			NS(1)|breast(3)|endometrium(6)|kidney(1)|large_intestine(19)|lung(85)|ovary(9)|pancreas(2)|prostate(4)|skin(8)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	142	all_cancers(71;9.66e-05)|all_epithelial(71;1.85e-05)|Breast(184;0.0226)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.0172)	OV - Ovarian serous cystadenocarcinoma(106;0.0141)			GTTGTGTGAAACGCTCCAGCA	0.512																																					p.T764A		Atlas-SNP	.											.	NLRP3	286	.	0			c.A2290G						.						99.0	92.0	94.0					1																	247593020		2203	4300	6503	SO:0001583	missense	114548	exon4			TGTGAAACGCTCC	AF054176	CCDS1632.1, CCDS1633.1, CCDS44346.1, CCDS44347.1	1q44	2014-09-17	2006-12-08	2006-12-08	ENSG00000162711	ENSG00000162711		"""Nucleotide-binding domain and leucine rich repeat containing"""	16400	protein-coding gene	gene with protein product	"""Cryopyrin"", ""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 3"""	606416	"""cold autoinflammatory syndrome 1"""	C1orf7, CIAS1		10741953	Standard	NM_183395		Approved	AGTAVPRL, AII, AVP, FCAS, FCU, NALP3, PYPAF1, MWS, CLR1.1	uc001icr.3	Q96P20	OTTHUMG00000040647	ENST00000336119.3:c.2290A>G	chr1.hg19:g.247593020A>G	ENSP00000337383:p.Thr764Ala	96.0	0.0		146.0	56.0	NM_004895	B2RC97|B7ZKS9|B7ZKT2|B7ZKT3|O75434|Q17RS2|Q59H68|Q5JQS8|Q5JQS9|Q6TG35|Q8TCW0|Q8TEU9|Q8WXH9	Missense_Mutation	SNP	ENST00000336119.3	hg19	CCDS1632.1	.	.	.	.	.	.	.	.	.	.	A	0.018	-1.470333	0.01044	.	.	ENSG00000162711	ENST00000391828;ENST00000366497;ENST00000336119;ENST00000366496	D;D;D;D	0.87887	-2.31;-2.31;-2.31;-2.31	4.21	-2.3	0.06785	.	0.886354	0.09463	N	0.798745	T	0.65407	0.2688	N	0.02765	-0.5	0.09310	N	1	B;B;B	0.15473	0.0;0.013;0.0	B;B;B	0.23018	0.0;0.043;0.002	T	0.56715	-0.7933	10	0.02654	T	1	.	9.6047	0.39626	0.3475:0.0:0.6525:0.0	.	764;764;764	B7ZKS9;Q96P20-5;Q96P20	.;.;NALP3_HUMAN	A	764	ENSP00000375704:T764A;ENSP00000355453:T764A;ENSP00000337383:T764A;ENSP00000355452:T764A	ENSP00000337383:T764A	T	+	1	0	NLRP3	245659643	0.008000	0.16893	0.000000	0.03702	0.074000	0.17049	1.550000	0.36223	-0.277000	0.09193	-0.403000	0.06358	ACG	.	.		0.512	NLRP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097740.1	NM_004895	
REG1A	5967	hgsc.bcm.edu	37	2	79349980	79349980	+	Missense_Mutation	SNP	A	A	G			TCGA-3K-AAZ8-01A-12D-A38X-10	TCGA-3K-AAZ8-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ca7f5e36-bbb3-44aa-b0c7-3f170a2bbc0f	c70e868a-ba0a-4b90-ad4d-d61ed7b34ecf	g.chr2:79349980A>G	ENST00000233735.1	+	5	438	c.335A>G	c.(334-336)cAc>cGc	p.H112R		NM_002909.4	NP_002900.2	P05451	REG1A_HUMAN	regenerating islet-derived 1 alpha	112	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				positive regulation of cell proliferation (GO:0008284)	extracellular vesicular exosome (GO:0070062)	carbohydrate binding (GO:0030246)|growth factor activity (GO:0008083)			NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(5)|lung(26)|prostate(1)|upper_aerodigestive_tract(1)	39						CGCCGCTGGCACTGGAGCAGT	0.557																																					p.H112R		Atlas-SNP	.											.	REG1A	74	.	0			c.A335G						.						112.0	111.0	111.0					2																	79349980		2203	4300	6503	SO:0001583	missense	5967	exon5			GCTGGCACTGGAG		CCDS1964.1	2p12	2008-09-04	2008-06-04		ENSG00000115386	ENSG00000115386			9951	protein-coding gene	gene with protein product	"""pancreatic stone protein"", ""pancreatic thread protein"""	167770	"""regenerating islet-derived 1 alpha (pancreatic stone protein, pancreatic thread protein)"""	REG		2332435, 8333731	Standard	NM_002909		Approved	PSP, PTP, PSPS, PSPS1	uc002snz.3	P05451	OTTHUMG00000130016	ENST00000233735.1:c.335A>G	chr2.hg19:g.79349980A>G	ENSP00000233735:p.His112Arg	133.0	0.0		98.0	19.0	NM_002909	P11379|Q4ZG28	Missense_Mutation	SNP	ENST00000233735.1	hg19	CCDS1964.1	.	.	.	.	.	.	.	.	.	.	a	9.271	1.045592	0.19748	.	.	ENSG00000115386	ENST00000233735	T	0.07114	3.22	2.92	0.459	0.16678	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (3);	0.580363	0.14402	N	0.321842	T	0.07548	0.0190	N	0.13235	0.315	0.23309	N	0.997936	D	0.71674	0.998	P	0.61477	0.889	T	0.21895	-1.0232	10	0.08179	T	0.78	.	4.3454	0.11131	0.596:0.0:0.404:0.0	.	112	P05451	REG1A_HUMAN	R	112	ENSP00000233735:H112R	ENSP00000233735:H112R	H	+	2	0	REG1A	79203488	0.159000	0.22864	0.988000	0.46212	0.900000	0.52787	0.088000	0.14979	0.325000	0.23359	0.455000	0.32223	CAC	.	.		0.557	REG1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252289.1	NM_002909	
SFTPB	6439	hgsc.bcm.edu	37	2	85888601	85888602	+	Missense_Mutation	DNP	GG	GG	AT			TCGA-3K-AAZ8-01A-12D-A38X-10	TCGA-3K-AAZ8-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ca7f5e36-bbb3-44aa-b0c7-3f170a2bbc0f	c70e868a-ba0a-4b90-ad4d-d61ed7b34ecf	g.chr2:85888601_85888602GG>AT	ENST00000519937.2	-	10	1159_1160	c.1140_1141CC>AT	c.(1138-1143)gaCCtt>gaATtt	p.380_381DL>EF	SFTPB_ENST00000342375.3_Missense_Mutation_p.380_381DL>EF|SFTPB_ENST00000393822.3_Missense_Mutation_p.392_393DL>EF|SFTPB_ENST00000409383.1_Missense_Mutation_p.392_393DL>EF			P07988	PSPB_HUMAN	surfactant protein B	380					organ morphogenesis (GO:0009887)|respiratory gaseous exchange (GO:0007585)|sphingolipid metabolic process (GO:0006665)	extracellular region (GO:0005576)|lysosome (GO:0005764)				central_nervous_system(1)|endometrium(1)|large_intestine(6)|lung(3)|ovary(1)|prostate(1)|skin(3)	16						TCTCATCAAAGGTCGGGGCTGT	0.653																																					p.L393F|p.D392E		Atlas-SNP	.											.	SFTPB	49	.	0			c.C1177T|c.C1176A						.																																			SO:0001583	missense	6439	exon11			ATCAAAGGTCGGG|TCAAAGGTCGGGG	J02761	CCDS1983.1, CCDS1983.2	2p12-p11.2	2008-08-26	2008-08-26		ENSG00000168878	ENSG00000168878			10801	protein-coding gene	gene with protein product		178640	"""surfactant, pulmonary-associated protein B"""	SFTP3		2924687, 1346779	Standard	NM_198843		Approved	SP-B	uc002sqh.3	P07988	OTTHUMG00000130181	ENST00000519937.2:c.1140_1141delinsAT	chr2.hg19:g.85888601_85888602delinsAT	ENSP00000428719:p.D380_L381delinsEF	46.0	0.0		38.0	7.0	NM_198843	Q96R04	Missense_Mutation	SNP	ENST00000519937.2	hg19																																																																																				.	.		0.653	SFTPB-001	KNOWN	alternative_3_UTR|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000252499.3	NM_198843	
ZAP70	7535	hgsc.bcm.edu	37	2	98349640	98349640	+	Missense_Mutation	SNP	A	A	T			TCGA-3K-AAZ8-01A-12D-A38X-10	TCGA-3K-AAZ8-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ca7f5e36-bbb3-44aa-b0c7-3f170a2bbc0f	c70e868a-ba0a-4b90-ad4d-d61ed7b34ecf	g.chr2:98349640A>T	ENST00000264972.5	+	6	970	c.755A>T	c.(754-756)gAg>gTg	p.E252V	ZAP70_ENST00000451498.2_5'Flank|ZAP70_ENST00000463643.1_3'UTR|ZAP70_ENST00000442208.1_Missense_Mutation_p.E126V	NM_001079.3	NP_001070.2	P43403	ZAP70_HUMAN	zeta-chain (TCR) associated protein kinase 70kDa	252	SH2 2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				adaptive immune response (GO:0002250)|B cell activation (GO:0042113)|beta selection (GO:0043366)|immune response (GO:0006955)|intracellular signal transduction (GO:0035556)|negative thymic T cell selection (GO:0045060)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of alpha-beta T cell differentiation (GO:0046638)|positive regulation of alpha-beta T cell proliferation (GO:0046641)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of T cell differentiation (GO:0045582)|positive thymic T cell selection (GO:0045059)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|T cell activation (GO:0042110)|T cell aggregation (GO:0070489)|T cell differentiation (GO:0030217)|T cell migration (GO:0072678)|T cell receptor signaling pathway (GO:0050852)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|immunological synapse (GO:0001772)|plasma membrane (GO:0005886)|T cell receptor complex (GO:0042101)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(15)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	29						TGCCTGAAGGAGGCCTGCCCC	0.687																																					p.E252V		Atlas-SNP	.											.	ZAP70	77	.	0			c.A755T						.						36.0	37.0	37.0					2																	98349640		2203	4299	6502	SO:0001583	missense	7535	exon6			TGAAGGAGGCCTG	L05148	CCDS33254.1, CCDS33255.1	2q11-q13	2014-09-17	2002-08-29		ENSG00000115085	ENSG00000115085		"""SH2 domain containing"""	12858	protein-coding gene	gene with protein product		176947	"""zeta-chain (TCR) associated protein kinase (70 kD)"""	SRK		1423621	Standard	NM_001079		Approved	ZAP-70, STD	uc002syd.1	P43403	OTTHUMG00000153060	ENST00000264972.5:c.755A>T	chr2.hg19:g.98349640A>T	ENSP00000264972:p.Glu252Val	165.0	0.0		133.0	65.0	NM_001079	A6NFP4|Q6PIA4|Q8IXD6|Q9UBS6	Missense_Mutation	SNP	ENST00000264972.5	hg19	CCDS33254.1	.	.	.	.	.	.	.	.	.	.	A	18.40	3.615729	0.66672	.	.	ENSG00000115085	ENST00000264972;ENST00000442208	D;D	0.92299	-3.01;-3.01	5.41	4.24	0.50183	SH2 motif (2);	0.123452	0.35646	N	0.003079	D	0.91264	0.7246	L	0.39020	1.185	0.58432	D	0.999999	D;P	0.56287	0.975;0.913	P;P	0.61328	0.887;0.592	D	0.87103	0.2180	10	0.13853	T	0.58	.	10.3545	0.43956	0.8531:0.0:0.0:0.1469	.	126;252	P43403-3;P43403	.;ZAP70_HUMAN	V	252;126	ENSP00000264972:E252V;ENSP00000411141:E126V	ENSP00000264972:E252V	E	+	2	0	ZAP70	97716072	1.000000	0.71417	0.996000	0.52242	0.701000	0.40568	8.605000	0.90883	0.970000	0.38263	0.533000	0.62120	GAG	.	.		0.687	ZAP70-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329278.1		
TSN	7247	hgsc.bcm.edu	37	2	122522838	122522838	+	Silent	SNP	C	C	T			TCGA-3K-AAZ8-01A-12D-A38X-10	TCGA-3K-AAZ8-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ca7f5e36-bbb3-44aa-b0c7-3f170a2bbc0f	c70e868a-ba0a-4b90-ad4d-d61ed7b34ecf	g.chr2:122522838C>T	ENST00000389682.3	+	6	829	c.582C>T	c.(580-582)cgC>cgT	p.R194R	TSN_ENST00000536142.1_3'UTR|TSN_ENST00000498545.1_3'UTR|TSN_ENST00000409193.1_Silent_p.R189R	NM_001261401.1|NM_004622.2	NP_001248330.1|NP_004613.1	Q15631	TSN_HUMAN	translin	194	Leucine-zipper. {ECO:0000255}.				DNA recombination (GO:0006310)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|endonuclease activity (GO:0004519)|mRNA binding (GO:0003729)|sequence-specific DNA binding (GO:0043565)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(2)|large_intestine(1)|liver(1)|lung(3)|skin(1)	12		Ovarian(717;0.0563)|Prostate(154;0.116)				TGAGGAAGCGCTACGACGGAT	0.493																																					p.R194R		Atlas-SNP	.											.	TSN	31	.	0			c.C582T						.						173.0	174.0	174.0					2																	122522838		2203	4300	6503	SO:0001819	synonymous_variant	7247	exon6			GAAGCGCTACGAC	X78627	CCDS33284.1, CCDS58723.1	2q21.1	2008-05-23			ENSG00000211460	ENSG00000211460			12379	protein-coding gene	gene with protein product	"""recombination hotspot associated factor"""	600575				7947454, 9244443	Standard	NM_004622		Approved	TRSLN, BCLF-1, REHF-1	uc002tnl.3	Q15631	OTTHUMG00000153334	ENST00000389682.3:c.582C>T	chr2.hg19:g.122522838C>T		108.0	0.0		82.0	38.0	NM_004622	B7Z3X8|Q5U0K7	Silent	SNP	ENST00000389682.3	hg19	CCDS33284.1																																																																																			.	.		0.493	TSN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330767.1	NM_004622	
METTL5	29081	hgsc.bcm.edu	37	2	170672031	170672031	+	Missense_Mutation	SNP	T	T	C			TCGA-3K-AAZ8-01A-12D-A38X-10	TCGA-3K-AAZ8-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ca7f5e36-bbb3-44aa-b0c7-3f170a2bbc0f	c70e868a-ba0a-4b90-ad4d-d61ed7b34ecf	g.chr2:170672031T>C	ENST00000260953.5	-	5	813	c.497A>G	c.(496-498)cAa>cGa	p.Q166R	METTL5_ENST00000409965.1_Missense_Mutation_p.Q166R|METTL5_ENST00000409837.1_Missense_Mutation_p.Q166R|METTL5_ENST00000308099.3_Intron|METTL5_ENST00000392640.2_Missense_Mutation_p.Q166R|METTL5_ENST00000409340.1_Missense_Mutation_p.Q67R|U3_ENST00000517172.1_RNA|METTL5_ENST00000410097.1_Missense_Mutation_p.Q166R	NM_014168.2	NP_054887.2	Q9NRN9	METL5_HUMAN	methyltransferase like 5	166							methyltransferase activity (GO:0008168)|nucleic acid binding (GO:0003676)			breast(2)|central_nervous_system(1)|large_intestine(5)|lung(1)|prostate(1)	10						AGCTTTCTTTTGAACATGCTG	0.299																																					p.Q166R		Atlas-SNP	.											.	METTL5	24	.	0			c.A497G						.						95.0	89.0	91.0					2																	170672031		2202	4300	6502	SO:0001583	missense	29081	exon5			TTCTTTTGAACAT	AF201938	CCDS33320.1	2q31.1	2011-01-28			ENSG00000138382	ENSG00000138382			25006	protein-coding gene	gene with protein product						11042152	Standard	XM_005246478		Approved	HSPC133	uc002ufn.3	Q9NRN9	OTTHUMG00000154117	ENST00000260953.5:c.497A>G	chr2.hg19:g.170672031T>C	ENSP00000260953:p.Gln166Arg	101.0	0.0		67.0	12.0	NM_014168	D3DPC9|Q9NVX1	Missense_Mutation	SNP	ENST00000260953.5	hg19	CCDS33320.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	7.862|7.862	0.726351|0.726351	0.15439|0.15439	.|.	.|.	ENSG00000138382|ENSG00000138382	ENST00000442181|ENST00000409837;ENST00000409340;ENST00000260953;ENST00000409965;ENST00000392640;ENST00000410097	.|T;T;T;T	.|0.41400	.|1.01;1.0;1.0;1.0	5.42|5.42	4.24|4.24	0.50183|0.50183	.|.	.|0.226290	.|0.46442	.|D	.|0.000291	T|T	0.28101|0.28101	0.0693|0.0693	N|N	0.26130|0.26130	0.795|0.795	0.52501|0.52501	D|D	0.999959|0.999959	.|B;B	.|0.09022	.|0.002;0.001	.|B;B	.|0.15052	.|0.012;0.005	T|T	0.05338|0.05338	-1.0891|-1.0891	5|10	.|0.15499	.|T	.|0.54	-15.4463|-15.4463	11.4073|11.4073	0.49904|0.49904	0.1448:0.0:0.0:0.8552|0.1448:0.0:0.0:0.8552	.|.	.|166;166	.|B8ZZC8;Q9NRN9	.|.;METL5_HUMAN	E|R	77|166;67;166;166;166;166	.|ENSP00000387106:Q67R;ENSP00000260953:Q166R;ENSP00000386582:Q166R;ENSP00000376415:Q166R	.|ENSP00000260953:Q166R	K|Q	-|-	1|2	0|0	METTL5|METTL5	170380277|170380277	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.753000|0.753000	0.42808|0.42808	2.987000|2.987000	0.49378|0.49378	0.957000|0.957000	0.37930|0.37930	-0.527000|-0.527000	0.04329|0.04329	AAA|CAA	.	.		0.299	METTL5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000333957.1	NM_014168	
MYO3B	140469	hgsc.bcm.edu	37	2	171239700	171239700	+	Splice_Site	SNP	G	G	A			TCGA-3K-AAZ8-01A-12D-A38X-10	TCGA-3K-AAZ8-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ca7f5e36-bbb3-44aa-b0c7-3f170a2bbc0f	c70e868a-ba0a-4b90-ad4d-d61ed7b34ecf	g.chr2:171239700G>A	ENST00000408978.4	+	11	1328		c.e11+1		MYO3B_ENST00000602629.1_Splice_Site|MYO3B_ENST00000409044.3_Splice_Site|MYO3B_ENST00000334231.6_Splice_Site	NM_138995.4	NP_620482.3	Q8WXR4	MYO3B_HUMAN	myosin IIIB						peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of filopodium assembly (GO:0051491)|protein autophosphorylation (GO:0046777)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|filopodium tip (GO:0032433)|myosin complex (GO:0016459)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|stereocilium bundle tip (GO:0032426)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(25)|ovary(6)|pancreas(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	59						CTCTCCACAGGTAAGGGATGT	0.358																																					.		Atlas-SNP	.											.	MYO3B	320	.	0			c.1185+1G>A						.						117.0	109.0	112.0					2																	171239700		1813	4082	5895	SO:0001630	splice_region_variant	140469	exon11			CCACAGGTAAGGG		CCDS42773.1, CCDS46446.1	2q31.1-q31.2	2011-09-27			ENSG00000071909	ENSG00000071909		"""Myosins / Myosin superfamily : Class III"""	15576	protein-coding gene	gene with protein product		610040					Standard	NM_001083615		Approved		uc002ufy.3	Q8WXR4	OTTHUMG00000154002	ENST00000408978.4:c.1185+1G>A	chr2.hg19:g.171239700G>A		95.0	0.0		81.0	7.0	NM_138995	B8ZZR2|Q53QE1|Q53T08|Q8IX64|Q8IX65|Q8IX66|Q8IX67|Q8IX68|Q96N94	Splice_Site	SNP	ENST00000408978.4	hg19	CCDS42773.1	.	.	.	.	.	.	.	.	.	.	G	31	5.078752	0.94050	.	.	ENSG00000071909	ENST00000409044;ENST00000408978;ENST00000317915;ENST00000484338;ENST00000334231	.	.	.	5.87	5.87	0.94306	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.2191	0.98319	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	MYO3B	170947946	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	9.585000	0.98223	2.780000	0.95670	0.655000	0.94253	.	.	.		0.358	MYO3B-004	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000333410.1		Intron
TTN	7273	hgsc.bcm.edu	37	2	179424990	179424990	+	Silent	SNP	A	A	G			TCGA-3K-AAZ8-01A-12D-A38X-10	TCGA-3K-AAZ8-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ca7f5e36-bbb3-44aa-b0c7-3f170a2bbc0f	c70e868a-ba0a-4b90-ad4d-d61ed7b34ecf	g.chr2:179424990A>G	ENST00000591111.1	-	276	81170	c.80946T>C	c.(80944-80946)taT>taC	p.Y26982Y	TTN-AS1_ENST00000456053.1_RNA|TTN_ENST00000589042.1_Silent_p.Y28623Y|TTN_ENST00000342992.6_Silent_p.Y26055Y|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN_ENST00000342175.6_Silent_p.Y19750Y|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN_ENST00000359218.5_Silent_p.Y19683Y|TTN_ENST00000460472.2_Silent_p.Y19558Y|TTN-AS1_ENST00000592600.1_RNA			Q8WZ42	TITIN_HUMAN	titin	26982	Fibronectin type-III 96. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CATAAACACGATATTCATATT	0.418																																					p.Y28623Y		Atlas-SNP	.											.	TTN	18412	.	0			c.T85869C						.						105.0	104.0	104.0					2																	179424990		1920	4129	6049	SO:0001819	synonymous_variant	7273	exon326			AACACGATATTCA	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.80946T>C	chr2.hg19:g.179424990A>G		157.0	0.0		103.0	53.0	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Silent	SNP	ENST00000591111.1	hg19																																																																																				.	.		0.418	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
TTN	7273	hgsc.bcm.edu	37	2	179489281	179489281	+	Missense_Mutation	SNP	A	A	T			TCGA-3K-AAZ8-01A-12D-A38X-10	TCGA-3K-AAZ8-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ca7f5e36-bbb3-44aa-b0c7-3f170a2bbc0f	c70e868a-ba0a-4b90-ad4d-d61ed7b34ecf	g.chr2:179489281A>T	ENST00000591111.1	-	192	40027	c.39803T>A	c.(39802-39804)cTt>cAt	p.L13268H	TTN-AS1_ENST00000589830.1_RNA|TTN-AS1_ENST00000589487.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.L14909H|TTN_ENST00000342992.6_Missense_Mutation_p.L12341H|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000589907.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.L6036H|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.L5969H|TTN_ENST00000460472.2_Missense_Mutation_p.L5844H			Q8WZ42	TITIN_HUMAN	titin	13268	Ig-like 88.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			ATGTATAACAAGTTTTCTGAC	0.383																																					p.L14909H		Atlas-SNP	.											.	TTN	18412	.	0			c.T44726A						.						122.0	120.0	121.0					2																	179489281		1891	4095	5986	SO:0001583	missense	7273	exon242			ATAACAAGTTTTC	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.39803T>A	chr2.hg19:g.179489281A>T	ENSP00000465570:p.Leu13268His	209.0	0.0		167.0	16.0	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	hg19		.	.	.	.	.	.	.	.	.	.	A	15.51	2.854982	0.51376	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.25250	1.81;1.81;1.81;1.81	6.06	6.06	0.98353	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.70824	0.3268	H	0.99325	4.515	0.58432	D	0.999997	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	D	0.84217	0.0459	9	0.87932	D	0	.	16.6245	0.84952	1.0:0.0:0.0:0.0	.	5844;5969;6036;13268	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	H	12341;5844;6036;5969;5844	ENSP00000343764:L12341H;ENSP00000434586:L5844H;ENSP00000340554:L6036H;ENSP00000352154:L5969H	ENSP00000340554:L6036H	L	-	2	0	TTN	179197526	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	9.281000	0.95811	2.323000	0.78572	0.528000	0.53228	CTT	.	.		0.383	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
SF3B1	23451	hgsc.bcm.edu	37	2	198267481	198267481	+	Missense_Mutation	SNP	T	T	G			TCGA-3K-AAZ8-01A-12D-A38X-10	TCGA-3K-AAZ8-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ca7f5e36-bbb3-44aa-b0c7-3f170a2bbc0f	c70e868a-ba0a-4b90-ad4d-d61ed7b34ecf	g.chr2:198267481T>G	ENST00000335508.6	-	14	1967	c.1876A>C	c.(1876-1878)Aac>Cac	p.N626H	SNORA4_ENST00000365564.1_RNA|SF3B1_ENST00000462613.1_5'Flank	NM_012433.2	NP_036565.2	O75533	SF3B1_HUMAN	splicing factor 3b, subunit 1, 155kDa	626					anterior/posterior pattern specification (GO:0009952)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	catalytic step 2 spliceosome (GO:0071013)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)|U12-type spliceosomal complex (GO:0005689)	chromatin binding (GO:0003682)|poly(A) RNA binding (GO:0044822)	p.N626Y(2)|p.N626D(1)		NS(35)|breast(10)|central_nervous_system(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(524)|kidney(4)|large_intestine(10)|lung(19)|ovary(1)|pancreas(4)|prostate(6)|salivary_gland(1)|skin(4)|testis(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	633			OV - Ovarian serous cystadenocarcinoma(117;0.246)			GCTGTTGTGTTACGGACATAC	0.438			Mis		myelodysplastic syndrome																																p.N626H		Atlas-SNP	.		Dom	yes		2	2q33.1	23451	"""splicing factor 3b, subunit 1, 155kDa"""		L	SF3B1,NS,carcinoma,0,10	SF3B1	1038	.	3	Substitution - Missense(3)	haematopoietic_and_lymphoid_tissue(3)	c.A1876C						.						96.0	93.0	94.0					2																	198267481		2203	4300	6503	SO:0001583	missense	23451	exon14			TTGTGTTACGGAC	AF054284	CCDS33356.1, CCDS46479.1	2q33.1	2014-09-17	2002-08-29		ENSG00000115524	ENSG00000115524			10768	protein-coding gene	gene with protein product		605590	"""splicing factor 3b, subunit 1, 155kD"""			9585501	Standard	XM_005246428		Approved	SAP155, SF3b155, PRPF10, Prp10, Hsh155	uc002uue.3	O75533	OTTHUMG00000154447	ENST00000335508.6:c.1876A>C	chr2.hg19:g.198267481T>G	ENSP00000335321:p.Asn626His	102.0	0.0		118.0	13.0	NM_012433	E9PCH3	Missense_Mutation	SNP	ENST00000335508.6	hg19	CCDS33356.1	.	.	.	.	.	.	.	.	.	.	T	26.2	4.711895	0.89112	.	.	ENSG00000115524	ENST00000335508	T	0.65732	-0.17	5.82	5.82	0.92795	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	D	0.85894	0.5803	H	0.96015	3.755	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.90396	0.4399	10	0.87932	D	0	.	16.1839	0.81934	0.0:0.0:0.0:1.0	.	626	O75533	SF3B1_HUMAN	H	626	ENSP00000335321:N626H	ENSP00000335321:N626H	N	-	1	0	SF3B1	197975726	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.948000	0.87774	2.222000	0.72286	0.533000	0.62120	AAC	.	.		0.438	SF3B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335245.2		
UNC80	285175	hgsc.bcm.edu	37	2	210683912	210683912	+	Missense_Mutation	SNP	G	G	T			TCGA-3K-AAZ8-01A-12D-A38X-10	TCGA-3K-AAZ8-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ca7f5e36-bbb3-44aa-b0c7-3f170a2bbc0f	c70e868a-ba0a-4b90-ad4d-d61ed7b34ecf	g.chr2:210683912G>T	ENST00000439458.1	+	12	1969	c.1889G>T	c.(1888-1890)aGc>aTc	p.S630I	UNC80_ENST00000272845.6_Missense_Mutation_p.S630I	NM_032504.1	NP_115893.1	Q8N2C7	UNC80_HUMAN	unc-80 homolog (C. elegans)	630					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(9)|ovary(1)|prostate(1)	20						ATAAACTACAGCTACCTAGAG	0.453																																					p.S630I		Atlas-SNP	.											.	UNC80	280	.	0			c.G1889T						.						90.0	74.0	79.0					2																	210683912		692	1591	2283	SO:0001583	missense	285175	exon12			ACTACAGCTACCT	AK090815	CCDS2387.1, CCDS46504.1, CCDS2387.2	2q35	2009-08-17	2009-08-17	2009-08-17	ENSG00000144406	ENSG00000144406			26582	protein-coding gene	gene with protein product		612636	"""chromosome 2 open reading frame 21"""	C2orf21		19092807	Standard	NM_032504		Approved	FLJ33496, KIAA1843, UNC-80	uc010zjc.1	Q8N2C7	OTTHUMG00000132963	ENST00000439458.1:c.1889G>T	chr2.hg19:g.210683912G>T	ENSP00000391088:p.Ser630Ile	142.0	0.0		146.0	33.0	NM_182587	B2RN50|B4DQY9|B4DZB3|C4IXS8|C9J1U3|Q96JI4|Q96SS0	Missense_Mutation	SNP	ENST00000439458.1	hg19	CCDS46504.1	.	.	.	.	.	.	.	.	.	.	G	18.53	3.643306	0.67244	.	.	ENSG00000144406	ENST00000439458;ENST00000272845	T;T	0.33438	1.41;1.41	5.76	5.76	0.90799	.	.	.	.	.	T	0.31167	0.0788	N	0.19112	0.55	0.80722	D	1	P	0.43701	0.815	P	0.45829	0.494	T	0.07693	-1.0759	9	0.72032	D	0.01	-5.9991	19.9731	0.97292	0.0:0.0:1.0:0.0	.	630	Q8N2C7	UNC80_HUMAN	I	630	ENSP00000391088:S630I;ENSP00000272845:S630I	ENSP00000272845:S630I	S	+	2	0	UNC80	210392157	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	6.092000	0.71414	2.715000	0.92844	0.563000	0.77884	AGC	.	.		0.453	UNC80-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_182587	
CCDC108	255101	hgsc.bcm.edu	37	2	219875570	219875570	+	Missense_Mutation	SNP	C	C	T	rs564721573		TCGA-3K-AAZ8-01A-12D-A38X-10	TCGA-3K-AAZ8-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ca7f5e36-bbb3-44aa-b0c7-3f170a2bbc0f	c70e868a-ba0a-4b90-ad4d-d61ed7b34ecf	g.chr2:219875570C>T	ENST00000341552.5	-	25	4189	c.4106G>A	c.(4105-4107)cGg>cAg	p.R1369Q	AC097468.4_ENST00000441450.1_RNA|CCDC108_ENST00000441968.1_Missense_Mutation_p.R1369Q|CCDC108_ENST00000453220.1_Missense_Mutation_p.R1369Q	NM_194302.2	NP_919278.2	Q6ZU64	CC108_HUMAN	coiled-coil domain containing 108	1369						integral component of membrane (GO:0016021)	poly(A) RNA binding (GO:0044822)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(18)|liver(1)|lung(34)|ovary(2)|pancreas(1)|prostate(6)|skin(5)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	80		Renal(207;0.0915)		Epithelial(149;1.12e-06)|all cancers(144;0.000196)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		CCACAAGACCCGGGCAGTGCT	0.567													C|||	1	0.000199681	0.0	0.0	5008	,	,		21069	0.0		0.0	False		,,,				2504	0.001				p.R1369Q		Atlas-SNP	.											.	CCDC108	208	.	0			c.G4106A						.						56.0	50.0	52.0					2																	219875570		2203	4300	6503	SO:0001583	missense	255101	exon25			AAGACCCGGGCAG	NM_194302, AL833882, AK127189	CCDS2430.2, CCDS2431.2, CCDS63125.1, CCDS63126.1	2q35	2008-02-05			ENSG00000181378	ENSG00000181378			25325	protein-coding gene	gene with protein product		614270				12477932	Standard	NM_194302		Approved	DKFZp434O0527, MGC35338	uc002vjl.2	Q6ZU64	OTTHUMG00000133013	ENST00000341552.5:c.4106G>A	chr2.hg19:g.219875570C>T	ENSP00000340776:p.Arg1369Gln	150.0	0.0		86.0	44.0	NM_194302	A2BDD8|E9PCR1|E9PG25|E9PG72|Q6ZSR8|Q8N0T4|Q8NDJ3	Missense_Mutation	SNP	ENST00000341552.5	hg19	CCDS2430.2	.	.	.	.	.	.	.	.	.	.	C	5.170	0.216994	0.09810	.	.	ENSG00000181378	ENST00000341552;ENST00000441968;ENST00000453220	T;T;T	0.04502	3.61;3.61;3.61	5.44	-5.48	0.02592	.	1.050440	0.07548	N	0.914865	T	0.01800	0.0057	N	0.05124	-0.11	0.09310	N	1	B	0.14805	0.011	B	0.11329	0.006	T	0.47837	-0.9086	10	0.09843	T	0.71	-3.1705	4.0874	0.09953	0.0975:0.307:0.0976:0.498	.	1369	Q6ZU64	CC108_HUMAN	Q	1369	ENSP00000340776:R1369Q;ENSP00000413377:R1369Q;ENSP00000409117:R1369Q	ENSP00000340776:R1369Q	R	-	2	0	CCDC108	219583814	0.000000	0.05858	0.000000	0.03702	0.259000	0.26198	-1.017000	0.03630	-1.139000	0.02881	0.650000	0.86243	CGG	.	.		0.567	CCDC108-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256598.4	NM_194302	
SCG2	7857	hgsc.bcm.edu	37	2	224462660	224462660	+	Silent	SNP	A	A	G			TCGA-3K-AAZ8-01A-12D-A38X-10	TCGA-3K-AAZ8-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ca7f5e36-bbb3-44aa-b0c7-3f170a2bbc0f	c70e868a-ba0a-4b90-ad4d-d61ed7b34ecf	g.chr2:224462660A>G	ENST00000305409.2	-	2	1573	c.1341T>C	c.(1339-1341)aaT>aaC	p.N447N		NM_003469.4	NP_003460.2	O00255	MEN1_HUMAN	secretogranin II	0					brain development (GO:0007420)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|chromatin remodeling (GO:0006338)|DNA repair (GO:0006281)|embryonic skeletal system morphogenesis (GO:0048704)|gene expression (GO:0010467)|hemopoiesis (GO:0030097)|histone lysine methylation (GO:0034968)|leukocyte homeostasis (GO:0001776)|MAPK cascade (GO:0000165)|maternal process involved in female pregnancy (GO:0060135)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of JNK cascade (GO:0046329)|negative regulation of organ growth (GO:0046621)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of telomerase activity (GO:0051974)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|osteoblast development (GO:0002076)|osteoblast fate commitment (GO:0002051)|palate development (GO:0060021)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell division (GO:0051781)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of histone methylation (GO:0031062)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of protein binding (GO:0032092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|regulation of activin receptor signaling pathway (GO:0032925)|response to gamma radiation (GO:0010332)|response to UV (GO:0009411)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	chromatin (GO:0000785)|cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|histone methyltransferase complex (GO:0035097)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|four-way junction DNA binding (GO:0000400)|protein binding, bridging (GO:0030674)|protein N-terminus binding (GO:0047485)|R-SMAD binding (GO:0070412)|sequence-specific DNA binding (GO:0043565)|transcription regulatory region DNA binding (GO:0044212)|Y-form DNA binding (GO:0000403)			NS(1)|breast(1)|endometrium(1)|kidney(6)|large_intestine(10)|liver(1)|lung(16)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(4)	44		Renal(207;0.0112)|Lung NSC(271;0.0185)|all_lung(227;0.0271)		Epithelial(121;8.16e-11)|all cancers(144;4.66e-08)|Lung(261;0.00714)|LUSC - Lung squamous cell carcinoma(224;0.008)		ACGTTTTCTGATTTGCTGCAC	0.478																																					p.N447N		Atlas-SNP	.											.	SCG2	99	.	0			c.T1341C						.						102.0	103.0	102.0					2																	224462660		2203	4300	6503	SO:0001819	synonymous_variant	7857	exon2			TTTCTGATTTGCT	M25756	CCDS2457.1	2q35-q36	2010-04-27	2010-04-27		ENSG00000171951	ENSG00000171951			10575	protein-coding gene	gene with protein product	"""secretoneurin"", ""chromogranin C"""	118930				8617499, 16101435	Standard	NM_003469		Approved	CHGC, SgII, SN	uc002vnm.3	P13521	OTTHUMG00000133166	ENST00000305409.2:c.1341T>C	chr2.hg19:g.224462660A>G		55.0	0.0		45.0	23.0	NM_003469	A5HBC6|A5HBC7|A5HBC8|A5HBC9|A5HBD0|A5HBD1|A5HBD2|O00632|Q9BUF0|Q9BUK2	Silent	SNP	ENST00000305409.2	hg19	CCDS2457.1																																																																																			.	.		0.478	SCG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256870.2	NM_003469	
KCNH8	131096	hgsc.bcm.edu	37	3	19384192	19384192	+	Silent	SNP	T	T	C	rs150723210		TCGA-3K-AAZ8-01A-12D-A38X-10	TCGA-3K-AAZ8-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ca7f5e36-bbb3-44aa-b0c7-3f170a2bbc0f	c70e868a-ba0a-4b90-ad4d-d61ed7b34ecf	g.chr3:19384192T>C	ENST00000328405.2	+	4	822	c.556T>C	c.(556-558)Ttg>Ctg	p.L186L		NM_144633.2	NP_653234.2	Q96L42	KCNH8_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 8	186					potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	phosphorelay sensor kinase activity (GO:0000155)|voltage-gated potassium channel activity (GO:0005249)			NS(1)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|liver(3)|lung(37)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	77						AAAGAACAAATTGAAAATAAA	0.458																																					p.L186L	NSCLC(124;1625 1765 8018 24930 42026)	Atlas-SNP	.											.	KCNH8	189	.	0			c.T556C						.	T		1,4405	2.1+/-5.4	0,1,2202	78.0	81.0	80.0		556	-0.7	1.0	3	dbSNP_134	80	0,8600		0,0,4300	no	coding-synonymous	KCNH8	NM_144633.2		0,1,6502	CC,CT,TT		0.0,0.0227,0.0077		186/1108	19384192	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	131096	exon4			AACAAATTGAAAA	AY053503	CCDS2632.1	3p24.3	2012-07-05			ENSG00000183960	ENSG00000183960		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	18864	protein-coding gene	gene with protein product		608260				16382104	Standard	NM_144633		Approved	Kv12.1, elk3	uc003cbk.1	Q96L42	OTTHUMG00000129891	ENST00000328405.2:c.556T>C	chr3.hg19:g.19384192T>C		178.0	0.0		146.0	39.0	NM_144633	B7Z2I7|Q59GQ6	Silent	SNP	ENST00000328405.2	hg19	CCDS2632.1																																																																																			.	T|1.000;C|0.000		0.458	KCNH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252139.2	NM_144633	
CTNNB1	1499	hgsc.bcm.edu	37	3	41266137	41266137	+	Missense_Mutation	SNP	C	C	T	rs121913409		TCGA-3K-AAZ8-01A-12D-A38X-10	TCGA-3K-AAZ8-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ca7f5e36-bbb3-44aa-b0c7-3f170a2bbc0f	c70e868a-ba0a-4b90-ad4d-d61ed7b34ecf	g.chr3:41266137C>T	ENST00000349496.5	+	3	414	c.134C>T	c.(133-135)tCt>tTt	p.S45F	CTNNB1_ENST00000396185.3_Missense_Mutation_p.S45F|CTNNB1_ENST00000453024.1_Missense_Mutation_p.S38F|CTNNB1_ENST00000396183.3_Missense_Mutation_p.S45F|CTNNB1_ENST00000405570.1_Missense_Mutation_p.S45F	NM_001904.3	NP_001895.1	P35222	CTNB1_HUMAN	catenin (cadherin-associated protein), beta 1, 88kDa	45			Missing (in colorectal cancer). {ECO:0000269|PubMed:9065402}.|S -> F (in hepatocellular carcinoma). {ECO:0000269|PubMed:10435629}.|S -> P (in hepatocellular carcinoma). {ECO:0000269|PubMed:10435629}.		adherens junction assembly (GO:0034333)|androgen receptor signaling pathway (GO:0030521)|anterior/posterior axis specification (GO:0009948)|apoptotic process (GO:0006915)|bone resorption (GO:0045453)|branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of cardiac outflow tract cell proliferation (GO:0061324)|canonical Wnt signaling pathway involved in positive regulation of epithelial to mesenchymal transition (GO:0044334)|cell adhesion (GO:0007155)|cell fate specification (GO:0001708)|cell maturation (GO:0048469)|cell-matrix adhesion (GO:0007160)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to growth factor stimulus (GO:0071363)|cellular response to indole-3-methanol (GO:0071681)|cellular response to mechanical stimulus (GO:0071260)|central nervous system vasculogenesis (GO:0022009)|cytoskeletal anchoring at plasma membrane (GO:0007016)|determination of dorsal/ventral asymmetry (GO:0048262)|dorsal/ventral axis specification (GO:0009950)|ectoderm development (GO:0007398)|embryonic axis specification (GO:0000578)|embryonic digit morphogenesis (GO:0042733)|embryonic foregut morphogenesis (GO:0048617)|embryonic forelimb morphogenesis (GO:0035115)|embryonic heart tube development (GO:0035050)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal limb joint morphogenesis (GO:0036023)|endodermal cell fate commitment (GO:0001711)|endothelial tube morphogenesis (GO:0061154)|epithelial cell differentiation involved in prostate gland development (GO:0060742)|epithelial to mesenchymal transition (GO:0001837)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|fungiform papilla formation (GO:0061198)|gastrulation with mouth forming second (GO:0001702)|genitalia morphogenesis (GO:0035112)|glial cell fate determination (GO:0007403)|hair cell differentiation (GO:0035315)|hair follicle morphogenesis (GO:0031069)|hair follicle placode formation (GO:0060789)|hindbrain development (GO:0030902)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|layer formation in cerebral cortex (GO:0021819)|lens morphogenesis in camera-type eye (GO:0002089)|liver development (GO:0001889)|lung cell differentiation (GO:0060479)|lung induction (GO:0060492)|lung-associated mesenchyme development (GO:0060484)|male genitalia development (GO:0030539)|mesenchymal cell proliferation involved in lung development (GO:0060916)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|midgut development (GO:0007494)|muscle cell differentiation (GO:0042692)|myoblast differentiation (GO:0045445)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of heart induction by canonical Wnt signaling pathway (GO:0003136)|negative regulation of neuron death (GO:1901215)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein sumoylation (GO:0033234)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephron tubule formation (GO:0072079)|neural plate development (GO:0001840)|neuron migration (GO:0001764)|odontogenesis of dentin-containing tooth (GO:0042475)|oocyte development (GO:0048599)|osteoclast differentiation (GO:0030316)|oviduct development (GO:0060066)|pancreas development (GO:0031016)|patterning of blood vessels (GO:0001569)|positive regulation of apoptotic process (GO:0043065)|positive regulation of branching involved in lung morphogenesis (GO:0061047)|positive regulation of determination of dorsal identity (GO:2000017)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of epithelial cell proliferation involved in prostate gland development (GO:0060769)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of heparan sulfate proteoglycan biosynthetic process (GO:0010909)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein heterooligomerization (GO:0051291)|protein localization to cell surface (GO:0034394)|proximal/distal pattern formation (GO:0009954)|regulation of angiogenesis (GO:0045765)|regulation of calcium ion import (GO:0090279)|regulation of centriole-centriole cohesion (GO:0030997)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of fibroblast proliferation (GO:0048145)|regulation of myelination (GO:0031641)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of protein localization to cell surface (GO:2000008)|regulation of secondary heart field cardioblast proliferation (GO:0003266)|regulation of smooth muscle cell proliferation (GO:0048660)|regulation of T cell proliferation (GO:0042129)|renal inner medulla development (GO:0072053)|renal outer medulla development (GO:0072054)|renal vesicle formation (GO:0072033)|response to cadmium ion (GO:0046686)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|Schwann cell proliferation (GO:0014010)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle cell differentiation (GO:0051145)|synapse organization (GO:0050808)|synaptic vesicle transport (GO:0048489)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tongue morphogenesis (GO:0043587)|trachea formation (GO:0060440)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	adherens junction (GO:0005912)|apical part of cell (GO:0045177)|basolateral plasma membrane (GO:0016323)|beta-catenin destruction complex (GO:0030877)|beta-catenin-TCF7L2 complex (GO:0070369)|catenin complex (GO:0016342)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell periphery (GO:0071944)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microvillus membrane (GO:0031528)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein-DNA complex (GO:0032993)|Scrib-APC-beta-catenin complex (GO:0034750)|synapse (GO:0045202)|tight junction (GO:0005923)|transcription factor complex (GO:0005667)|Z disc (GO:0030018)|zonula adherens (GO:0005915)	alpha-catenin binding (GO:0045294)|androgen receptor binding (GO:0050681)|cadherin binding (GO:0045296)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|I-SMAD binding (GO:0070411)|ion channel binding (GO:0044325)|kinase binding (GO:0019900)|nuclear hormone receptor binding (GO:0035257)|protein C-terminus binding (GO:0008022)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|R-SMAD binding (GO:0070412)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|structural molecule activity (GO:0005198)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.S45F(384)|p.S45del(53)|p.A5_A80del(53)|p.S45C(19)|p.S45Y(17)|p.A5_Q143del(7)|p.A5_A80>D(7)|p.Q28_H134del(5)|p.?(4)|p.W25_I140del(3)|p.T3_A126del(2)|p.S45_S47>C(2)|p.D32_S47del(2)|p.P44_S45del(2)|p.M5_N141>D(2)|p.L10_N141del(2)|p.A5_Y142>D(2)|p.A5_Q143>E(1)|p.S37_G48>C(1)|p.A13_R151del(1)|p.H36_E53>L(1)|p.M14_S45del(1)|p.S45_G48del(1)|p.Q28_Q61del(1)|p.T41_N51del(1)|p.M1_A87del(1)|p.S45_L46del(1)|p.A20_N141del(1)|p.D11_Y142>H(1)|p.P44_N51del(1)|p.I35_K170del(1)|p.Y30_A97del(1)|p.T42_G48del(1)|p.S45_D58del(1)|p.V22_T102del(1)|p.A20_A80del(1)|p.V22_S71>A(1)|p.S45fs*2(1)|p.T40_L46del(1)|p.A5_T59del(1)|p.M1_V173del(1)|p.E15_I140>V(1)|p.H24_M131del(1)|p.S45E(1)|p.M8_A80del(1)|p.A5_E54del(1)|p.A21_A80del(1)|p.P16_K133del(1)|p.V22_Y64del(1)|p.A20_S111del(1)|p.T42_K49>Q(1)|p.Y30_A80del(1)	CTNNB1/PLAG1(60)	NS(4)|adrenal_gland(103)|biliary_tract(43)|bone(21)|breast(7)|central_nervous_system(260)|cervix(9)|endometrium(293)|eye(1)|haematopoietic_and_lymphoid_tissue(60)|kidney(202)|large_intestine(269)|liver(1010)|lung(63)|oesophagus(6)|ovary(106)|pancreas(126)|parathyroid(11)|pituitary(111)|pleura(2)|prostate(31)|salivary_gland(13)|skin(103)|small_intestine(17)|soft_tissue(792)|stomach(165)|thyroid(55)|upper_aerodigestive_tract(2)|urinary_tract(8)	3893				KIRC - Kidney renal clear cell carcinoma(284;0.0028)|Kidney(284;0.00294)		ACAGCTCCTTCTCTGAGTGGT	0.498	S45F(HCC15_LUNG)|S45F(LS180_LARGE_INTESTINE)	15	"""H, Mis, T"""	PLAG1	"""colorectal, cvarian,  hepatoblastoma, others, pleomorphic salivary adenoma"""				Pilomatrixoma, Familial Clustering of																												p.S45F	Colon(6;3 56 14213 18255)	Atlas-SNP	.		Dom	yes		3	3p22-p21.3	1499	"""catenin (cadherin-associated protein), beta 1"""		"""E, M, O"""	CTNNB1,NS,carcinoma,+1,2	CTNNB1	4904	.	601	Substitution - Missense(421)|Deletion - In frame(152)|Complex - deletion inframe(20)|Unknown(7)|Deletion - Frameshift(1)	soft_tissue(233)|liver(141)|large_intestine(85)|kidney(74)|endometrium(16)|skin(11)|adrenal_gland(9)|stomach(7)|biliary_tract(5)|ovary(4)|lung(3)|central_nervous_system(2)|cervix(2)|small_intestine(2)|haematopoietic_and_lymphoid_tissue(2)|urinary_tract(1)|pituitary(1)|prostate(1)|bone(1)|pancreas(1)	c.C134T						.						84.0	74.0	77.0					3																	41266137		2203	4300	6503	SO:0001583	missense	1499	exon3	Familial Cancer Database	Pilomatricoma, Familial Clustering of, Epithelioma Calcificans of Malherbe	CTCCTTCTCTGAG	X87838	CCDS2694.1	3p21	2013-02-15	2002-08-29		ENSG00000168036	ENSG00000168036		"""Armadillo repeat containing"""	2514	protein-coding gene	gene with protein product		116806	"""catenin (cadherin-associated protein), beta 1 (88kD)"""	CTNNB		7829088	Standard	NM_001098210		Approved	beta-catenin, armadillo	uc003ckr.2	P35222	OTTHUMG00000131393	ENST00000349496.5:c.134C>T	chr3.hg19:g.41266137C>T	ENSP00000344456:p.Ser45Phe	135.0	0.0		121.0	60.0	NM_001098209	A8K1L7|Q8NEW9|Q8NI94|Q9H391	Missense_Mutation	SNP	ENST00000349496.5	hg19	CCDS2694.1	.	.	.	.	.	.	.	.	.	.	C	24.8	4.569754	0.86439	.	.	ENSG00000168036	ENST00000426215;ENST00000405570;ENST00000431914;ENST00000396183;ENST00000349496;ENST00000453024;ENST00000396185;ENST00000450969;ENST00000441708	T;T;T;T;T;T;T;T;T	0.52057	0.68;0.68;0.68;0.68;0.68;0.68;0.68;0.68;0.68	5.91	5.91	0.95273	.	0.000000	0.85682	D	0.000000	T	0.68165	0.2971	M	0.65677	2.01	0.80722	D	1	D	0.67145	0.996	D	0.64687	0.928	T	0.68895	-0.5288	10	0.87932	D	0	-13.6823	20.2983	0.98569	0.0:1.0:0.0:0.0	.	45	P35222	CTNB1_HUMAN	F	38;45;45;45;45;38;45;45;45	ENSP00000400508:S38F;ENSP00000385604:S45F;ENSP00000412219:S45F;ENSP00000379486:S45F;ENSP00000344456:S45F;ENSP00000411226:S38F;ENSP00000379488:S45F;ENSP00000409302:S45F;ENSP00000401599:S45F	ENSP00000344456:S45F	S	+	2	0	CTNNB1	41241141	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.818000	0.86416	2.802000	0.96397	0.655000	0.94253	TCT	.	.		0.498	CTNNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254182.2	NM_001098210	
KIF15	56992	hgsc.bcm.edu	37	3	44841897	44841897	+	Missense_Mutation	SNP	G	G	T			TCGA-3K-AAZ8-01A-12D-A38X-10	TCGA-3K-AAZ8-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ca7f5e36-bbb3-44aa-b0c7-3f170a2bbc0f	c70e868a-ba0a-4b90-ad4d-d61ed7b34ecf	g.chr3:44841897G>T	ENST00000326047.4	+	11	1339	c.1190G>T	c.(1189-1191)gGa>gTa	p.G397V	KIF15_ENST00000425755.1_Missense_Mutation_p.G32V	NM_020242.2	NP_064627.1	Q9NS87	KIF15_HUMAN	kinesin family member 15	397					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|cell proliferation (GO:0008283)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mitotic nuclear division (GO:0007067)	centrosome (GO:0005813)|cytosol (GO:0005829)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)|plus-end kinesin complex (GO:0005873)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(7)|liver(2)|lung(9)|ovary(1)|prostate(4)|urinary_tract(5)	36				BRCA - Breast invasive adenocarcinoma(193;0.0099)|KIRC - Kidney renal clear cell carcinoma(197;0.0564)|Kidney(197;0.0707)		CTTGCTTCAGGACAGACACCA	0.483																																					p.G397V		Atlas-SNP	.											.	KIF15	103	.	0			c.G1190T						.						93.0	85.0	88.0					3																	44841897		2203	4300	6503	SO:0001583	missense	56992	exon11			CTTCAGGACAGAC	AB035898	CCDS33744.1	3p21.31	2008-03-03	2005-03-15	2005-03-17	ENSG00000163808	ENSG00000163808		"""Kinesins"""	17273	protein-coding gene	gene with protein product			"""kinesin-like 7"""	KNSL7		10878014	Standard	NM_020242		Approved	HKLP2, NY-BR-62	uc003cnx.4	Q9NS87	OTTHUMG00000156307	ENST00000326047.4:c.1190G>T	chr3.hg19:g.44841897G>T	ENSP00000324020:p.Gly397Val	385.0	0.0		311.0	80.0	NM_020242	Q17RV9|Q69YL6|Q96JX7|Q9H280	Missense_Mutation	SNP	ENST00000326047.4	hg19	CCDS33744.1	.	.	.	.	.	.	.	.	.	.	G	13.48	2.250989	0.39797	.	.	ENSG00000163808	ENST00000326047;ENST00000481166;ENST00000396031;ENST00000425755	T;D;T	0.81659	-0.64;-1.52;1.83	5.35	5.35	0.76521	.	0.150342	0.31257	N	0.007968	T	0.76321	0.3971	L	0.50333	1.59	0.54753	D	0.999989	B;B	0.28880	0.226;0.039	B;B	0.26614	0.071;0.011	T	0.75651	-0.3244	10	0.56958	D	0.05	.	14.995	0.71425	0.0:0.0:0.857:0.143	.	32;397	C9JKA9;Q9NS87	.;KIF15_HUMAN	V	397;169;396;32	ENSP00000324020:G397V;ENSP00000425499:G169V;ENSP00000389982:G32V	ENSP00000324020:G397V	G	+	2	0	KIF15	44816901	1.000000	0.71417	0.368000	0.25939	0.039000	0.13416	3.137000	0.50562	2.659000	0.90383	0.655000	0.94253	GGA	.	.		0.483	KIF15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343831.2		
SEMA3F	6405	hgsc.bcm.edu	37	3	50225206	50225206	+	Silent	SNP	T	T	C			TCGA-3K-AAZ8-01A-12D-A38X-10	TCGA-3K-AAZ8-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ca7f5e36-bbb3-44aa-b0c7-3f170a2bbc0f	c70e868a-ba0a-4b90-ad4d-d61ed7b34ecf	g.chr3:50225206T>C	ENST00000002829.3	+	19	2500	c.2016T>C	c.(2014-2016)gaT>gaC	p.D672D	SEMA3F_ENST00000413852.1_Silent_p.D573D|SEMA3F_ENST00000434342.1_Silent_p.D641D	NM_004186.3	NP_004177.3	Q13275	SEM3F_HUMAN	sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3F	672	Ig-like C2-type.				axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|branchiomotor neuron axon guidance (GO:0021785)|facial nerve structural organization (GO:0021612)|negative regulation of axon extension involved in axon guidance (GO:0048843)|nerve development (GO:0021675)|neural crest cell migration (GO:0001755)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|semaphorin-plexin signaling pathway involved in neuron projection guidance (GO:1902285)|sympathetic ganglion development (GO:0061549)|sympathetic neuron projection extension (GO:0097490)|sympathetic neuron projection guidance (GO:0097491)|trigeminal nerve structural organization (GO:0021637)	extracellular space (GO:0005615)|membrane (GO:0016020)	chemorepellent activity (GO:0045499)|receptor activity (GO:0004872)			central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(9)|ovary(1)|prostate(1)|skin(2)	17				BRCA - Breast invasive adenocarcinoma(193;0.00013)|KIRC - Kidney renal clear cell carcinoma(197;0.00599)|Kidney(197;0.00688)		AGCTCAGCGATCGTGGCCTCT	0.617																																					p.D672D		Atlas-SNP	.											.	SEMA3F	62	.	0			c.T2016C						.						64.0	50.0	55.0					3																	50225206		2203	4300	6503	SO:0001819	synonymous_variant	6405	exon19			CAGCGATCGTGGC	U33920	CCDS2811.1	3p21.3	2013-01-11			ENSG00000001617	ENSG00000001617		"""Semaphorins"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10728	protein-coding gene	gene with protein product	"""sema IV"""	601124				8786119, 8649831	Standard	NM_004186		Approved	SEMAK, Sema4	uc003cyj.3	Q13275	OTTHUMG00000156806	ENST00000002829.3:c.2016T>C	chr3.hg19:g.50225206T>C		76.0	0.0		69.0	37.0	NM_004186	C9JQ85|Q13274|Q13372|Q15704|Q6GTR4	Silent	SNP	ENST00000002829.3	hg19	CCDS2811.1																																																																																			.	.		0.617	SEMA3F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345929.1	NM_004186	
GRM2	2912	hgsc.bcm.edu	37	3	51749599	51749599	+	Nonsense_Mutation	SNP	G	G	T			TCGA-3K-AAZ8-01A-12D-A38X-10	TCGA-3K-AAZ8-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ca7f5e36-bbb3-44aa-b0c7-3f170a2bbc0f	c70e868a-ba0a-4b90-ad4d-d61ed7b34ecf	g.chr3:51749599G>T	ENST00000395052.3	+	4	2044	c.1810G>T	c.(1810-1812)Gag>Tag	p.E604*	GRM2_ENST00000475478.1_3'UTR|GRM2_ENST00000442933.2_Intron	NM_000839.3	NP_000830.2	Q14416	GRM2_HUMAN	glutamate receptor, metabotropic 2	604					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|glutamate secretion (GO:0014047)|negative regulation of adenylate cyclase activity (GO:0007194)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission (GO:0007268)	axon (GO:0030424)|cell junction (GO:0030054)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	calcium channel regulator activity (GO:0005246)|G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)|group II metabotropic glutamate receptor activity (GO:0001641)			breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|liver(1)|lung(11)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	33				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.000539)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)		CTCAGGTCGGGAGCTCTGCTA	0.587																																					p.E604X		Atlas-SNP	.											.	GRM2	91	.	0			c.G1810T						.						125.0	115.0	118.0					3																	51749599		2203	4300	6503	SO:0001587	stop_gained	2912	exon4			GGTCGGGAGCTCT	L35318	CCDS2834.1	3p21.2	2013-09-20			ENSG00000164082	ENSG00000164082		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4594	protein-coding gene	gene with protein product		604099				7620613	Standard	NM_000839		Approved	GPRC1B, mGlu2, MGLUR2	uc010hlv.3	Q14416	OTTHUMG00000156902	ENST00000395052.3:c.1810G>T	chr3.hg19:g.51749599G>T	ENSP00000378492:p.Glu604*	45.0	0.0		51.0	13.0	NM_000839	B0M0K7|Q14CU5|Q52MC6|Q9H3N6	Nonsense_Mutation	SNP	ENST00000395052.3	hg19	CCDS2834.1	.	.	.	.	.	.	.	.	.	.	G	39	7.671535	0.98425	.	.	ENSG00000164082	ENST00000395052	.	.	.	5.3	5.3	0.74995	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	19.3413	0.94342	0.0:0.0:1.0:0.0	.	.	.	.	X	604	.	ENSP00000378492:E604X	E	+	1	0	GRM2	51724639	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.855000	0.99526	2.664000	0.90586	0.561000	0.74099	GAG	.	.		0.587	GRM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346542.1		
OR5H2	79310	hgsc.bcm.edu	37	3	98001887	98001887	+	Silent	SNP	T	T	C			TCGA-3K-AAZ8-01A-12D-A38X-10	TCGA-3K-AAZ8-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ca7f5e36-bbb3-44aa-b0c7-3f170a2bbc0f	c70e868a-ba0a-4b90-ad4d-d61ed7b34ecf	g.chr3:98001887T>C	ENST00000355273.2	+	1	156	c.156T>C	c.(154-156)gcT>gcC	p.A52A	RP11-325B23.2_ENST00000508616.1_lincRNA	NM_001005482.1	NP_001005482.1	Q8NGV7	OR5H2_HUMAN	olfactory receptor, family 5, subfamily H, member 2	52						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(1)|large_intestine(5)|lung(13)|ovary(3)|upper_aerodigestive_tract(1)	24						GTCTGATTGCTCTTATCTGGA	0.428																																					p.A52A		Atlas-SNP	.											.	OR5H2	63	.	0			c.T156C						.						353.0	327.0	336.0					3																	98001887		2203	4300	6503	SO:0001819	synonymous_variant	79310	exon1			GATTGCTCTTATC		CCDS33801.1	3q11.2	2013-09-23			ENSG00000197938	ENSG00000197938		"""GPCR / Class A : Olfactory receptors"""	14752	protein-coding gene	gene with protein product							Standard	NM_001005482		Approved		uc003dsj.1	Q8NGV7	OTTHUMG00000160080	ENST00000355273.2:c.156T>C	chr3.hg19:g.98001887T>C		124.0	0.0		103.0	49.0	NM_001005482	Q6IF87	Silent	SNP	ENST00000355273.2	hg19	CCDS33801.1																																																																																			.	.		0.428	OR5H2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359113.2		
OR5K4	403278	hgsc.bcm.edu	37	3	98072899	98072899	+	Silent	SNP	C	C	T			TCGA-3K-AAZ8-01A-12D-A38X-10	TCGA-3K-AAZ8-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ca7f5e36-bbb3-44aa-b0c7-3f170a2bbc0f	c70e868a-ba0a-4b90-ad4d-d61ed7b34ecf	g.chr3:98072899C>T	ENST00000354924.2	+	1	202	c.202C>T	c.(202-204)Ctg>Ttg	p.L68L	RP11-325B23.2_ENST00000508616.1_lincRNA	NM_001005517.1	NP_001005517.1	A6NMS3	OR5K4_HUMAN	olfactory receptor, family 5, subfamily K, member 4	68						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(4)|lung(13)|upper_aerodigestive_tract(1)	21						CAACCTGGCTCTGATGGATTC	0.438																																					p.L68L		Atlas-SNP	.											.	OR5K4	75	.	0			c.C202T						.						296.0	294.0	295.0					3																	98072899		2203	4300	6503	SO:0001819	synonymous_variant	403278	exon1			CTGGCTCTGATGG		CCDS33802.1	3q11.2	2013-09-23			ENSG00000196098	ENSG00000196098		"""GPCR / Class A : Olfactory receptors"""	31291	protein-coding gene	gene with protein product							Standard	NM_001005517		Approved		uc011bgv.2	A6NMS3	OTTHUMG00000160081	ENST00000354924.2:c.202C>T	chr3.hg19:g.98072899C>T		108.0	0.0		61.0	18.0	NM_001005517		Silent	SNP	ENST00000354924.2	hg19	CCDS33802.1																																																																																			.	.		0.438	OR5K4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359114.1		
GNB4	59345	hgsc.bcm.edu	37	3	179131380	179131380	+	Silent	SNP	A	A	C			TCGA-3K-AAZ8-01A-12D-A38X-10	TCGA-3K-AAZ8-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ca7f5e36-bbb3-44aa-b0c7-3f170a2bbc0f	c70e868a-ba0a-4b90-ad4d-d61ed7b34ecf	g.chr3:179131380A>C	ENST00000232564.3	-	8	805	c.519T>G	c.(517-519)acT>acG	p.T173T	GNB4_ENST00000468623.1_Silent_p.T173T|GNB4_ENST00000465153.1_5'UTR	NM_021629.3	NP_067642.1	Q9HAV0	GBB4_HUMAN	guanine nucleotide binding protein (G protein), beta polypeptide 4	173					cell death (GO:0008219)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|small molecule metabolic process (GO:0044281)|substantia nigra development (GO:0021762)	extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	protein complex binding (GO:0032403)|signal transducer activity (GO:0004871)			endometrium(1)|kidney(1)|large_intestine(4)|lung(4)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	16	all_cancers(143;2.01e-16)|Ovarian(172;0.0172)|Breast(254;0.191)		OV - Ovarian serous cystadenocarcinoma(80;5.78e-26)|GBM - Glioblastoma multiforme(14;0.0169)|BRCA - Breast invasive adenocarcinoma(182;0.237)			TCTGCTGGGCAGTTTCGATGT	0.423																																					p.T173T	Melanoma(105;1405 1491 7265 20440 33721)	Atlas-SNP	.											.	GNB4	37	.	0			c.T519G						.						122.0	119.0	120.0					3																	179131380		2203	4300	6503	SO:0001819	synonymous_variant	59345	exon8			CTGGGCAGTTTCG	AF300648	CCDS3230.1	3q27.1	2013-01-10			ENSG00000114450	ENSG00000114450		"""WD repeat domain containing"""	20731	protein-coding gene	gene with protein product		610863				10644457, 11842130	Standard	NM_021629		Approved		uc003fjv.4	Q9HAV0	OTTHUMG00000157440	ENST00000232564.3:c.519T>G	chr3.hg19:g.179131380A>C		166.0	0.0		236.0	35.0	NM_021629	B3KMH5|D3DNR8	Silent	SNP	ENST00000232564.3	hg19	CCDS3230.1	.	.	.	.	.	.	.	.	.	.	A	9.962	1.223046	0.22457	.	.	ENSG00000114450	ENST00000466899	.	.	.	5.66	-5.14	0.02875	.	.	.	.	.	T	0.49047	0.1534	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.47420	-0.9119	4	.	.	.	-18.4996	6.9939	0.24772	0.3626:0.3225:0.3149:0.0	.	.	.	.	G	96	.	.	C	-	1	0	GNB4	180614074	0.000000	0.05858	0.895000	0.35142	0.998000	0.95712	-2.069000	0.01381	-1.266000	0.02446	0.528000	0.53228	TGC	.	.		0.423	GNB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258218.1	NM_021629	
MASP1	5648	hgsc.bcm.edu	37	3	186978538	186978538	+	Missense_Mutation	SNP	T	T	C			TCGA-3K-AAZ8-01A-12D-A38X-10	TCGA-3K-AAZ8-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ca7f5e36-bbb3-44aa-b0c7-3f170a2bbc0f	c70e868a-ba0a-4b90-ad4d-d61ed7b34ecf	g.chr3:186978538T>C	ENST00000337774.5	-	4	927	c.538A>G	c.(538-540)Acc>Gcc	p.T180A	MASP1_ENST00000392472.2_Missense_Mutation_p.T67A|MASP1_ENST00000495249.1_Intron|MASP1_ENST00000169293.6_Missense_Mutation_p.T180A|MASP1_ENST00000392470.2_Missense_Mutation_p.T154A|MASP1_ENST00000296280.6_Missense_Mutation_p.T180A	NM_001879.5	NP_001870.3	P48740	MASP1_HUMAN	mannan-binding lectin serine peptidase 1 (C4/C2 activating component of Ra-reactive factor)	180	EGF-like; calcium-binding.|Homodimerization. {ECO:0000250}.|Interaction with FCN2.|Interaction with MBL2.				complement activation (GO:0006956)|complement activation, lectin pathway (GO:0001867)|innate immune response (GO:0045087)|negative regulation of complement activation (GO:0045916)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	calcium ion binding (GO:0005509)|calcium-dependent protein binding (GO:0048306)|peptidase activity (GO:0008233)|protein homodimerization activity (GO:0042803)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|liver(2)|lung(27)|ovary(2)|pancreas(1)|prostate(3)|urinary_tract(1)	60	all_cancers(143;5.33e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;3.49e-18)	GBM - Glioblastoma multiforme(93;0.0366)		CCTCGGCAGGTCCTGTTGTCT	0.507																																					p.T180A		Atlas-SNP	.											.	MASP1	240	.	0			c.A538G						.						160.0	122.0	135.0					3																	186978538		2203	4300	6503	SO:0001583	missense	5648	exon4			GGCAGGTCCTGTT	D28593	CCDS33907.1, CCDS33908.1, CCDS33909.1	3q27-q28	2014-09-17	2005-08-17		ENSG00000127241	ENSG00000127241		"""Serine peptidases / Serine peptidases"""	6901	protein-coding gene	gene with protein product		600521	"""mannan-binding lectin serine protease 1 (C4/C2 activating component of Ra-reactive factor)"""	CRARF, PRSS5		8018603, 8240317	Standard	NR_033519		Approved	MASP	uc003fri.3	P48740	OTTHUMG00000156461	ENST00000337774.5:c.538A>G	chr3.hg19:g.186978538T>C	ENSP00000336792:p.Thr180Ala	115.0	0.0		133.0	37.0	NM_139125	A8K542|A8K6M1|B4E2L7|O95570|Q68D21|Q8IUV8|Q96RS4|Q9UF09	Missense_Mutation	SNP	ENST00000337774.5	hg19	CCDS33907.1	.	.	.	.	.	.	.	.	.	.	T	30	5.050255	0.93740	.	.	ENSG00000127241	ENST00000337774;ENST00000296280;ENST00000392472;ENST00000541896;ENST00000169293;ENST00000392470;ENST00000392475	D;D;D;D;D;D	0.97378	-2.94;-2.94;-2.94;-2.94;-2.94;-4.36	5.57	5.57	0.84162	EGF-like region, conserved site (1);EGF-like calcium-binding (2);	0.047224	0.85682	D	0.000000	D	0.98012	0.9345	M	0.71206	2.165	0.80722	D	1	D;D;D;D;D	0.76494	0.995;0.996;0.999;0.998;0.998	D;P;D;D;D	0.70227	0.946;0.888;0.968;0.928;0.957	D	0.98503	1.0615	10	0.54805	T	0.06	.	15.2194	0.73299	0.0:0.0:0.0:1.0	.	154;180;67;180;180	F8W876;P48740-3;P48740-4;P48740-2;P48740	.;.;.;.;MASP1_HUMAN	A	180;180;67;67;180;154;187	ENSP00000336792:T180A;ENSP00000296280:T180A;ENSP00000376264:T67A;ENSP00000169293:T180A;ENSP00000376262:T154A;ENSP00000376267:T187A	ENSP00000169293:T180A	T	-	1	0	MASP1	188461232	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	6.062000	0.71155	2.242000	0.73789	0.528000	0.53228	ACC	.	.		0.507	MASP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344262.1	NM_001879	
BOD1L1	259282	hgsc.bcm.edu	37	4	13578590	13578590	+	Silent	SNP	G	G	A			TCGA-3K-AAZ8-01A-12D-A38X-10	TCGA-3K-AAZ8-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ca7f5e36-bbb3-44aa-b0c7-3f170a2bbc0f	c70e868a-ba0a-4b90-ad4d-d61ed7b34ecf	g.chr4:13578590G>A	ENST00000040738.5	-	25	9045	c.8910C>T	c.(8908-8910)cgC>cgT	p.R2970R		NM_148894.2	NP_683692.2	Q8NFC6	BD1L1_HUMAN	biorientation of chromosomes in cell division 1-like 1	2970						nucleus (GO:0005634)	DNA binding (GO:0003677)										CTGATTTCTGGCGTTTTCTTT	0.453																																					p.R2970R		Atlas-SNP	.											.	.	.	.	0			c.C8910T						.						116.0	113.0	114.0					4																	13578590		2203	4300	6503	SO:0001819	synonymous_variant	259282	exon25			TTTCTGGCGTTTT	AF528529	CCDS3411.2	4p16.1	2012-04-10	2012-04-10	2012-04-10	ENSG00000038219	ENSG00000038219			31792	protein-coding gene	gene with protein product			"""family with sequence similarity 44, member A"", ""biorientation of chromosomes in cell division 1-like"""	FAM44A, BOD1L			Standard	XM_005248150		Approved	FLJ33215, KIAA1327	uc003gmz.1	Q8NFC6	OTTHUMG00000090659	ENST00000040738.5:c.8910C>T	chr4.hg19:g.13578590G>A		74.0	0.0		78.0	43.0	NM_148894	Q6P0M8|Q96AL1|Q9H6G0|Q9NTD6|Q9P2L9	Silent	SNP	ENST00000040738.5	hg19	CCDS3411.2	.	.	.	.	.	.	.	.	.	.	G	9.654	1.142264	0.21205	.	.	ENSG00000038219	ENST00000507943	.	.	.	5.67	1.49	0.22878	.	.	.	.	.	T	0.51278	0.1665	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.37888	-0.9686	4	.	.	.	-3.3794	4.7732	0.13166	0.3496:0.1633:0.487:0.0	.	.	.	.	V	79	.	.	A	-	2	0	BOD1L	13187688	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	0.740000	0.26188	0.342000	0.23796	0.655000	0.94253	GCC	.	.		0.453	BOD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207321.1	NM_148894	
DSPP	1834	hgsc.bcm.edu	37	4	88536436	88536436	+	Silent	SNP	C	C	T			TCGA-3K-AAZ8-01A-12D-A38X-10	TCGA-3K-AAZ8-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ca7f5e36-bbb3-44aa-b0c7-3f170a2bbc0f	c70e868a-ba0a-4b90-ad4d-d61ed7b34ecf	g.chr4:88536436C>T	ENST00000282478.7	+	4	2655	c.2622C>T	c.(2620-2622)agC>agT	p.S874S	DSPP_ENST00000399271.1_Silent_p.S874S|RP11-742B18.1_ENST00000506480.1_RNA			Q9NZW4	DSPP_HUMAN	dentin sialophosphoprotein	874	Asp/Ser-rich.				biomineral tissue development (GO:0031214)|cellular response to cell-matrix adhesion (GO:0071460)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(8)|lung(13)|ovary(1)|skin(3)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	47		Hepatocellular(203;0.114)|all_hematologic(202;0.236)		OV - Ovarian serous cystadenocarcinoma(123;0.000508)		gtgacagcagcaacagcagtg	0.502																																					p.S874S		Atlas-SNP	.											.	DSPP	174	.	0			c.C2622T						.						70.0	85.0	79.0					4																	88536436		1641	2936	4577	SO:0001819	synonymous_variant	1834	exon5			CAGCAGCAACAGC	AF163151	CCDS43248.1	4q21.3	2008-02-05			ENSG00000152591	ENSG00000152591			3054	protein-coding gene	gene with protein product		125485		DFNA39, DGI1		8995371, 9533027	Standard	NM_014208		Approved	DMP3	uc003hqu.3	Q9NZW4	OTTHUMG00000161061	ENST00000282478.7:c.2622C>T	chr4.hg19:g.88536436C>T		293.0	0.0		245.0	19.0	NM_014208	A8MUI0|O95815	Silent	SNP	ENST00000282478.7	hg19	CCDS43248.1																																																																																			.	.		0.502	DSPP-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363616.3	NM_014208	
KIAA0922	23240	hgsc.bcm.edu	37	4	154519794	154519794	+	Missense_Mutation	SNP	G	G	A			TCGA-3K-AAZ8-01A-12D-A38X-10	TCGA-3K-AAZ8-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ca7f5e36-bbb3-44aa-b0c7-3f170a2bbc0f	c70e868a-ba0a-4b90-ad4d-d61ed7b34ecf	g.chr4:154519794G>A	ENST00000409663.3	+	21	2225	c.2173G>A	c.(2173-2175)Gag>Aag	p.E725K	KIAA0922_ENST00000409959.3_Missense_Mutation_p.E726K|KIAA0922_ENST00000440693.1_Missense_Mutation_p.E642K	NM_015196.3	NP_056011.3	A2VDJ0	T131L_HUMAN	KIAA0922	725						integral component of membrane (GO:0016021)				breast(2)|cervix(1)|endometrium(7)|kidney(4)|large_intestine(16)|lung(20)|ovary(1)|prostate(4)|skin(3)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	63	all_hematologic(180;0.093)	Renal(120;0.118)				TGGAGCAAGAGAGTTATTAAA	0.448																																					p.E726K		Atlas-SNP	.											.	KIAA0922	214	.	0			c.G2176A						.						144.0	145.0	144.0					4																	154519794		2203	4300	6503	SO:0001583	missense	23240	exon21			GCAAGAGAGTTAT	AK096538	CCDS3783.2, CCDS47148.1	4q31.3	2008-02-05			ENSG00000121210	ENSG00000121210			29146	protein-coding gene	gene with protein product						10231032, 11230166	Standard	NM_015196		Approved	DKFZp586H1322, TMEM131L	uc010ipp.3	A2VDJ0	OTTHUMG00000153244	ENST00000409663.3:c.2173G>A	chr4.hg19:g.154519794G>A	ENSP00000386574:p.Glu725Lys	144.0	0.0		125.0	64.0	NM_001131007	B3KRV3|Q7LGA7|Q86Y92|Q8WU56|Q9H065|Q9Y2D7	Missense_Mutation	SNP	ENST00000409663.3	hg19	CCDS3783.2	.	.	.	.	.	.	.	.	.	.	G	27.5	4.838923	0.91117	.	.	ENSG00000121210	ENST00000409663;ENST00000440693;ENST00000409959;ENST00000240487	T;T;T;T	0.20881	2.32;2.04;2.32;2.05	5.58	5.58	0.84498	.	0.000000	0.85682	D	0.000000	T	0.53029	0.1771	M	0.82630	2.6	0.80722	D	1	D;D;D	0.89917	0.999;1.0;0.997	D;D;D	0.91635	0.996;0.999;0.989	T	0.56637	-0.7946	10	0.62326	D	0.03	-23.5905	19.574	0.95434	0.0:0.0:1.0:0.0	.	642;726;725	A2VDJ0-3;A2VDJ0-5;A2VDJ0	.;.;T131L_HUMAN	K	725;642;726;503	ENSP00000386574:E725K;ENSP00000409663:E642K;ENSP00000386787:E726K;ENSP00000240487:E503K	ENSP00000240487:E503K	E	+	1	0	KIAA0922	154739244	1.000000	0.71417	0.116000	0.21606	0.634000	0.38068	9.276000	0.95745	2.607000	0.88179	0.655000	0.94253	GAG	.	.		0.448	KIAA0922-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000330370.1	NM_015196	
RGS7BP	401190	hgsc.bcm.edu	37	5	63802553	63802553	+	Silent	SNP	G	G	A			TCGA-3K-AAZ8-01A-12D-A38X-10	TCGA-3K-AAZ8-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ca7f5e36-bbb3-44aa-b0c7-3f170a2bbc0f	c70e868a-ba0a-4b90-ad4d-d61ed7b34ecf	g.chr5:63802553G>A	ENST00000334025.2	+	1	428	c.102G>A	c.(100-102)gaG>gaA	p.E34E	RGS7BP_ENST00000508162.1_3'UTR	NM_001029875.1|NM_001271890.1|NM_001271891.1	NP_001025046.1|NP_001258819.1|NP_001258820.1	Q6MZT1	R7BP_HUMAN	regulator of G-protein signaling 7 binding protein	34					G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of signal transduction (GO:0009968)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(1)|large_intestine(4)|lung(3)|prostate(1)|skin(1)|stomach(1)	11		Lung NSC(810;0.000518)|Prostate(74;0.0435)|Ovarian(174;0.186)		Lung(70;0.147)		GAGATTGGGAGCGCAGGGGCA	0.587																																					p.E34E		Atlas-SNP	.											.	RGS7BP	32	.	0			c.G102A						.						32.0	44.0	40.0					5																	63802553		2203	4300	6503	SO:0001819	synonymous_variant	401190	exon1			TTGGGAGCGCAGG	BX640900	CCDS34170.1	5q12.3	2008-02-05	2007-08-14		ENSG00000186479	ENSG00000186479			23271	protein-coding gene	gene with protein product		610890	"""regulator of G-protein signalling 7 binding protein"""			15632198	Standard	NM_001271890		Approved	R7BP	uc003jtj.4	Q6MZT1	OTTHUMG00000162293	ENST00000334025.2:c.102G>A	chr5.hg19:g.63802553G>A		318.0	1.0		295.0	126.0	NM_001029875	B7Z3X1	Silent	SNP	ENST00000334025.2	hg19	CCDS34170.1																																																																																			.	.		0.587	RGS7BP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368464.1	NM_001029875	
PRDM6	93166	hgsc.bcm.edu	37	5	122435525	122435525	+	Missense_Mutation	SNP	G	G	A			TCGA-3K-AAZ8-01A-12D-A38X-10	TCGA-3K-AAZ8-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ca7f5e36-bbb3-44aa-b0c7-3f170a2bbc0f	c70e868a-ba0a-4b90-ad4d-d61ed7b34ecf	g.chr5:122435525G>A	ENST00000407847.4	+	3	1183	c.769G>A	c.(769-771)Ggc>Agc	p.G257S	PRDM6_ENST00000464424.1_3'UTR	NM_001136239.1	NP_001129711.1	Q9NQX0	PRDM6_HUMAN	PR domain containing 6	257	SET. {ECO:0000255|PROSITE- ProRule:PRU00190}.				negative regulation of smooth muscle cell differentiation (GO:0051151)|negative regulation of transcription, DNA-templated (GO:0045892)|neurogenesis (GO:0022008)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	histone-lysine N-methyltransferase activity (GO:0018024)|metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			NS(1)|breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|skin(1)	7						TACTGTGCCCGGCCTGGCCTA	0.711																																					p.G257S		Atlas-SNP	.											.	PRDM6	26	.	0			c.G769A						.						18.0	20.0	19.0					5																	122435525		692	1591	2283	SO:0001583	missense	93166	exon3			GTGCCCGGCCTGG	AF272898	CCDS47259.1	5q21-q23	2013-01-08			ENSG00000061455	ENSG00000061455		"""Zinc fingers, C2H2-type"""	9350	protein-coding gene	gene with protein product							Standard	NM_001136239		Approved		uc003kti.3	Q9NQX0	OTTHUMG00000150469	ENST00000407847.4:c.769G>A	chr5.hg19:g.122435525G>A	ENSP00000384725:p.Gly257Ser	197.0	0.0		180.0	82.0	NM_001136239	B5MCJ4|Q9NQW9	Missense_Mutation	SNP	ENST00000407847.4	hg19	CCDS47259.1	.	.	.	.	.	.	.	.	.	.	G	36	5.653661	0.96724	.	.	ENSG00000061455	ENST00000407847	D	0.86769	-2.17	5.91	5.91	0.95273	SET domain (1);	0.000000	0.85682	D	0.000000	D	0.94059	0.8096	M	0.81942	2.565	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.93243	0.6628	10	0.51188	T	0.08	-28.6147	20.3052	0.98627	0.0:0.0:1.0:0.0	.	257	Q9NQX0	PRDM6_HUMAN	S	257	ENSP00000384725:G257S	ENSP00000384725:G257S	G	+	1	0	PRDM6	122463424	1.000000	0.71417	0.983000	0.44433	0.995000	0.86356	9.020000	0.93667	2.808000	0.96608	0.655000	0.94253	GGC	.	.		0.711	PRDM6-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318226.2	XM_049619	
FBN2	2201	hgsc.bcm.edu	37	5	127666336	127666336	+	Missense_Mutation	SNP	C	C	A			TCGA-3K-AAZ8-01A-12D-A38X-10	TCGA-3K-AAZ8-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ca7f5e36-bbb3-44aa-b0c7-3f170a2bbc0f	c70e868a-ba0a-4b90-ad4d-d61ed7b34ecf	g.chr5:127666336C>A	ENST00000508053.1	-	39	5248	c.4274G>T	c.(4273-4275)tGt>tTt	p.C1425F	FBN2_ENST00000507835.1_Missense_Mutation_p.C275F|FBN2_ENST00000262464.4_Missense_Mutation_p.C1425F|FBN2_ENST00000508989.1_Missense_Mutation_p.C1392F			P35556	FBN2_HUMAN	fibrillin 2	1425	EGF-like 23; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.		C -> R (in DA9). {ECO:0000269|PubMed:19006240}.		anatomical structure morphogenesis (GO:0009653)|bone trabecula formation (GO:0060346)|embryonic limb morphogenesis (GO:0030326)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|sequestering of TGFbeta in extracellular matrix (GO:0035583)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(37)|liver(1)|lung(89)|ovary(9)|pancreas(2)|prostate(6)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	197		all_cancers(142;0.0216)|Prostate(80;0.0551)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)		GGTATTTACACACTGAGCATT	0.483																																					p.C1425F		Atlas-SNP	.											.	FBN2	858	.	0			c.G4274T	GRCh37	CM090536	FBN2	M		.						148.0	132.0	138.0					5																	127666336		2203	4300	6503	SO:0001583	missense	2201	exon33			TTTACACACTGAG	U03272	CCDS34222.1	5q23-q31	2008-08-01	2008-08-01			ENSG00000138829			3604	protein-coding gene	gene with protein product	"""fibrillin 5"""	612570	"""congenital contractural arachnodactyly"""	CCA		1852206, 8120105	Standard	NM_001999		Approved	DA9	uc003kuu.3	P35556		ENST00000508053.1:c.4274G>T	chr5.hg19:g.127666336C>A	ENSP00000424571:p.Cys1425Phe	126.0	0.0		143.0	64.0	NM_001999	B4DU01|Q59ES6	Missense_Mutation	SNP	ENST00000508053.1	hg19	CCDS34222.1	.	.	.	.	.	.	.	.	.	.	C	26.6	4.753645	0.89753	.	.	ENSG00000138829	ENST00000262464;ENST00000508053;ENST00000507835;ENST00000508989	D;D;D;D	0.99445	-5.91;-5.91;-5.91;-5.91	5.14	5.14	0.70334	EGF-like calcium-binding, conserved site (1);EGF-like calcium-binding (2);Epidermal growth factor-like, type 3 (1);	0.000000	0.64402	D	0.000003	D	0.99816	0.9919	H	0.99444	4.57	0.80722	D	1	D;D	0.89917	1.0;0.997	D;D	0.91635	0.999;0.996	D	0.96664	0.9491	10	0.87932	D	0	.	19.1483	0.93477	0.0:1.0:0.0:0.0	.	1392;1425	D6RJI3;P35556	.;FBN2_HUMAN	F	1425;1425;275;1392	ENSP00000262464:C1425F;ENSP00000424571:C1425F;ENSP00000426839:C275F;ENSP00000425596:C1392F	ENSP00000262464:C1425F	C	-	2	0	FBN2	127694235	1.000000	0.71417	1.000000	0.80357	0.907000	0.53573	7.585000	0.82584	2.835000	0.97688	0.591000	0.81541	TGT	.	.		0.483	FBN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371618.2	NM_001999	
PCDHB16	57717	hgsc.bcm.edu	37	5	140563472	140563472	+	Missense_Mutation	SNP	T	T	A			TCGA-3K-AAZ8-01A-12D-A38X-10	TCGA-3K-AAZ8-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ca7f5e36-bbb3-44aa-b0c7-3f170a2bbc0f	c70e868a-ba0a-4b90-ad4d-d61ed7b34ecf	g.chr5:140563472T>A	ENST00000361016.2	+	1	2493	c.1338T>A	c.(1336-1338)gaT>gaA	p.D446E		NM_020957.1	NP_066008.1	Q9NRJ7	PCDBG_HUMAN	protocadherin beta 16	446	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|endometrium(10)|kidney(3)|large_intestine(14)|lung(29)|ovary(5)|pancreas(2)|prostate(3)|skin(1)|urinary_tract(1)	69			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			ATGTCAATGATAACGCCCCCA	0.527																																					p.D446E		Atlas-SNP	.											.	PCDHB16	159	.	0			c.T1338A						.						138.0	129.0	132.0					5																	140563472		2203	4300	6503	SO:0001583	missense	57717	exon1			CAATGATAACGCC	AF217757	CCDS4251.1	5q31	2014-04-11			ENSG00000196963			"""Cadherins / Protocadherins : Clustered"""	14546	other	protocadherin	"""cadherin ME1"", ""protocadherin-3x"", ""PCDHbeta 16"""	606345				11230163, 11322959	Standard	NM_020957		Approved	PCDHB8a, PCDH3X, KIAA1621, PCDH-BETA16, ME1	uc003liv.3	Q9NRJ7	OTTHUMG00000188325	ENST00000361016.2:c.1338T>A	chr5.hg19:g.140563472T>A	ENSP00000354293:p.Asp446Glu	128.0	0.0		108.0	43.0	NM_020957	B3KPK5|Q8IYD5|Q96SE9|Q9HCF1	Missense_Mutation	SNP	ENST00000361016.2	hg19	CCDS4251.1	.	.	.	.	.	.	.	.	.	.	T	15.77	2.932596	0.52866	.	.	ENSG00000196963	ENST00000361016	T	0.67171	-0.25	4.3	1.47	0.22746	Cadherin (3);Cadherin conserved site (1);Cadherin-like (1);	0.000000	0.36268	N	0.002684	D	0.85898	0.5804	H	0.97758	4.07	0.32255	N	0.570899	D	0.89917	1.0	D	0.91635	0.999	D	0.87110	0.2184	10	0.87932	D	0	.	10.0661	0.42303	0.0:0.8261:0.0:0.1739	.	446	Q9NRJ7	PCDBG_HUMAN	E	446	ENSP00000354293:D446E	ENSP00000354293:D446E	D	+	3	2	PCDHB16	140543656	0.995000	0.38212	0.984000	0.44739	0.057000	0.15508	0.614000	0.24314	0.230000	0.21059	-0.400000	0.06385	GAT	.	.		0.527	PCDHB16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251800.1	NM_020957	
PCDHGA4	56111	hgsc.bcm.edu	37	5	140735666	140735666	+	Missense_Mutation	SNP	A	A	G			TCGA-3K-AAZ8-01A-12D-A38X-10	TCGA-3K-AAZ8-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ca7f5e36-bbb3-44aa-b0c7-3f170a2bbc0f	c70e868a-ba0a-4b90-ad4d-d61ed7b34ecf	g.chr5:140735666A>G	ENST00000571252.1	+	1	899	c.899A>G	c.(898-900)gAt>gGt	p.D300G	PCDHGA2_ENST00000394576.2_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGB1_ENST00000523390.1_Intron	NM_018917.2	NP_061740	Q9Y5G9	PCDG4_HUMAN	protocadherin gamma subfamily A, 4	300	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(1)|kidney(1)|lung(3)	5			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CTGAGTGGGGATATAACAATA	0.438																																					p.D300G		Atlas-SNP	.											PCDHGA4_ENST00000571252,NS,carcinoma,0,2	PCDHGA4	150	.	0			c.A899G						.						49.0	49.0	49.0					5																	140735666		1851	4091	5942	SO:0001583	missense	56111	exon1			GTGGGGATATAAC	AF152511	CCDS58979.1, CCDS58979.2, CCDS75331.1	5q31	2010-01-26						"""Cadherins / Protocadherins : Clustered"""	8702	other	protocadherin		606291				10380929	Standard	NM_018917		Approved	PCDH-GAMMA-A4		Q9Y5G9		ENST00000571252.1:c.899A>G	chr5.hg19:g.140735666A>G	ENSP00000458570:p.Asp300Gly	101.0	2.0		106.0	9.0	NM_018917	Q9Y5D3	Missense_Mutation	SNP	ENST00000571252.1	hg19	CCDS58979.1																																																																																			.	.		0.438	PCDHGA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437959.1	NM_018917	
MAPK9	5601	hgsc.bcm.edu	37	5	179666988	179666988	+	Splice_Site	SNP	C	C	T			TCGA-3K-AAZ8-01A-12D-A38X-10	TCGA-3K-AAZ8-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ca7f5e36-bbb3-44aa-b0c7-3f170a2bbc0f	c70e868a-ba0a-4b90-ad4d-d61ed7b34ecf	g.chr5:179666988C>T	ENST00000452135.2	-	10	1295		c.e10-1		MAPK9_ENST00000343111.6_Splice_Site|MAPK9_ENST00000397072.3_Splice_Site|MAPK9_ENST00000393360.3_Splice_Site|MAPK9_ENST00000524170.1_5'Flank|MAPK9_ENST00000455781.1_Splice_Site|MAPK9_ENST00000347470.4_Splice_Site			P45984	MK09_HUMAN	mitogen-activated protein kinase 9						cellular response to growth factor stimulus (GO:0071363)|cellular response to interleukin-1 (GO:0071347)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to tumor necrosis factor (GO:0071356)|cellular response to UV (GO:0034644)|central nervous system development (GO:0007417)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|JNK cascade (GO:0007254)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|neuron projection development (GO:0031175)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell morphogenesis involved in differentiation (GO:0010770)|positive regulation of chemokine production (GO:0032722)|positive regulation of gene expression (GO:0010628)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of prostaglandin biosynthetic process (GO:0031394)|positive regulation of prostaglandin secretion (GO:0032308)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of transcription, DNA-templated (GO:0045893)|protein targeting to mitochondrion (GO:0006626)|regulation of JNK cascade (GO:0046328)|regulation of protein ubiquitination (GO:0031396)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|release of cytochrome c from mitochondria (GO:0001836)|response to amine (GO:0014075)|response to cadmium ion (GO:0046686)|response to drug (GO:0042493)|response to mechanical stimulus (GO:0009612)|response to stress (GO:0006950)|response to toxic substance (GO:0009636)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)|JUN kinase activity (GO:0004705)|transcription factor binding (GO:0008134)			central_nervous_system(2)|endometrium(5)|kidney(1)|large_intestine(5)|lung(10)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	26	all_cancers(89;6.54e-05)|all_epithelial(37;1.22e-05)|Renal(175;0.000269)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.137)	all_cancers(40;0.0236)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GAGGTGGTGGCTAAAAATTAA	0.333																																					.		Atlas-SNP	.											.	MAPK9	173	.	0			c.997-1G>A						.						140.0	133.0	135.0					5																	179666988		2203	4300	6503	SO:0001630	splice_region_variant	5601	exon11			TGGTGGCTAAAAA	U09759	CCDS4453.1, CCDS4454.1, CCDS43409.1, CCDS43410.1, CCDS47356.1	5q35	2011-06-09			ENSG00000050748	ENSG00000050748	2.7.11.1	"""Mitogen-activated protein kinase cascade / Kinases"""	6886	protein-coding gene	gene with protein product	"""Jun kinase"""	602896		PRKM9		8001819	Standard	NM_002752		Approved	JNK2, p54a, SAPK	uc003mls.4	P45984	OTTHUMG00000130934	ENST00000452135.2:c.997-1G>A	chr5.hg19:g.179666988C>T		35.0	0.0		29.0	9.0	NM_002752	A8K0S3|B5BU66|B5M0B4|D3DWQ8|D3DWQ9|Q15708|Q15710|Q15711|Q8N5C5	Splice_Site	SNP	ENST00000452135.2	hg19	CCDS4453.1	.	.	.	.	.	.	.	.	.	.	C	22.6	4.311057	0.81358	.	.	ENSG00000050748	ENST00000452135;ENST00000393360;ENST00000455781;ENST00000343111;ENST00000347470	.	.	.	5.15	5.15	0.70609	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.1831	0.86859	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	MAPK9	179599594	1.000000	0.71417	0.999000	0.59377	0.994000	0.84299	7.711000	0.84669	2.555000	0.86185	0.655000	0.94253	.	.	.		0.333	MAPK9-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000253530.3		Intron
DTNBP1	84062	hgsc.bcm.edu	37	6	15663083	15663083	+	Silent	SNP	G	G	A			TCGA-3K-AAZ8-01A-12D-A38X-10	TCGA-3K-AAZ8-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ca7f5e36-bbb3-44aa-b0c7-3f170a2bbc0f	c70e868a-ba0a-4b90-ad4d-d61ed7b34ecf	g.chr6:15663083G>A	ENST00000344537.5	-	1	190	c.18C>T	c.(16-18)cgC>cgT	p.R6R	DTNBP1_ENST00000338950.5_Silent_p.R6R|DTNBP1_ENST00000355917.3_Silent_p.R6R	NM_032122.4	NP_115498.2	Q96EV8	DTBP1_HUMAN	dystrobrevin binding protein 1	6					actin cytoskeleton reorganization (GO:0031532)|anterograde axon cargo transport (GO:0008089)|anterograde synaptic vesicle transport (GO:0048490)|blood coagulation (GO:0007596)|melanosome organization (GO:0032438)|membrane organization (GO:0061024)|neuron projection development (GO:0031175)|neuron projection morphogenesis (GO:0048812)|platelet dense granule organization (GO:0060155)|positive regulation of gene expression (GO:0010628)|positive regulation of neurotransmitter secretion (GO:0001956)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of dopamine receptor signaling pathway (GO:0060159)|regulation of dopamine secretion (GO:0014059)	axon (GO:0030424)|BLOC-1 complex (GO:0031083)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|endoplasmic reticulum membrane (GO:0005789)|endosome (GO:0005768)|growth cone (GO:0030426)|neuron projection (GO:0043005)|nucleus (GO:0005634)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)|synaptic vesicle membrane (GO:0030672)				cervix(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(5)|ovary(1)|skin(2)	14	Breast(50;0.0289)|Ovarian(93;0.103)	all_hematologic(90;0.0895)	Epithelial(50;0.211)			GCAGCCGCTCGCGAAGGGTCT	0.721									Hermansky-Pudlak syndrome																												p.R6R		Atlas-SNP	.											.	DTNBP1	56	.	0			c.C18T						.						30.0	43.0	39.0					6																	15663083		2071	4103	6174	SO:0001819	synonymous_variant	84062	exon1	Familial Cancer Database	HPS, HPS1-8	CCGCTCGCGAAGG	AF394226	CCDS4534.1, CCDS4535.1, CCDS75404.1, CCDS75405.1	6p22.3	2013-09-27			ENSG00000047579	ENSG00000047579		"""Biogenesis of lysosomal organelles complex-1 subunits"""	17328	protein-coding gene	gene with protein product	"""dysbindin-1"", ""biogenesis of lysosomal organelles complex-1, subunit 8"""	607145				11316798	Standard	NM_032122		Approved	Dysbindin, My031, HPS7, DBND, BLOC1S8	uc003nbm.3	Q96EV8	OTTHUMG00000014295	ENST00000344537.5:c.18C>T	chr6.hg19:g.15663083G>A		97.0	0.0		132.0	35.0	NM_183040	A8K3V3|Q5THY3|Q5THY4|Q96NV2|Q9H0U2|Q9H3J5	Silent	SNP	ENST00000344537.5	hg19	CCDS4534.1																																																																																			.	.		0.721	DTNBP1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000039933.2	NM_032122	
FAM65B	9750	hgsc.bcm.edu	37	6	24874014	24874014	+	Missense_Mutation	SNP	T	T	A			TCGA-3K-AAZ8-01A-12D-A38X-10	TCGA-3K-AAZ8-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ca7f5e36-bbb3-44aa-b0c7-3f170a2bbc0f	c70e868a-ba0a-4b90-ad4d-d61ed7b34ecf	g.chr6:24874014T>A	ENST00000259698.4	-	3	290	c.115A>T	c.(115-117)Att>Ttt	p.I39F	FAM65B_ENST00000510784.2_Missense_Mutation_p.I73F|FAM65B_ENST00000540914.1_Missense_Mutation_p.I39F|FAM65B_ENST00000538035.1_Missense_Mutation_p.I68F|FAM65B_ENST00000378023.4_Missense_Mutation_p.I39F	NM_014722.2	NP_055537.2	Q9Y4F9	FA65B_HUMAN	family with sequence similarity 65, member B	39					cell differentiation (GO:0030154)|muscle organ development (GO:0007517)	cell projection (GO:0042995)|cytoskeleton (GO:0005856)|mitochondrion (GO:0005739)				breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(10)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	25						GAATTTTCAATGAAGGAGTTA	0.398																																					p.I39F		Atlas-SNP	.											.	FAM65B	134	.	0			c.A115T						.						83.0	74.0	77.0					6																	24874014		1835	4095	5930	SO:0001583	missense	9750	exon3			TTTCAATGAAGGA	U49187	CCDS47383.1, CCDS47384.1, CCDS69057.1, CCDS69058.1, CCDS75410.1	6p22.3-p21.32	2012-11-30	2008-06-13	2008-06-13	ENSG00000111913	ENSG00000111913			13872	protein-coding gene	gene with protein product	"""myogenesis-related and NCAM-associated protein homolog (chicken)"""	611410	"""chromosome 6 open reading frame 32"""	C6orf32		9205841, 17150207, 17825087	Standard	NM_001286447		Approved	KIAA0386, DIFF48, MYONAP	uc003neo.1	Q9Y4F9	OTTHUMG00000014375	ENST00000259698.4:c.115A>T	chr6.hg19:g.24874014T>A	ENSP00000259698:p.Ile39Phe	88.0	0.0		127.0	75.0	NM_015864	A6NHP2|Q13529|Q5VV37|Q5VV38|Q9BQ28	Missense_Mutation	SNP	ENST00000259698.4	hg19	CCDS47383.1	.	.	.	.	.	.	.	.	.	.	T	14.48	2.549093	0.45383	.	.	ENSG00000111913	ENST00000259698;ENST00000538035;ENST00000378023;ENST00000540914;ENST00000510784	T;T;T;T;T	0.02369	4.32;4.32;4.32;4.32;4.32	5.53	5.53	0.82687	.	0.089331	0.85682	D	0.000000	T	0.01421	0.0046	N	0.03154	-0.405	0.50813	D	0.999894	D;D;P;D	0.69078	0.962;0.995;0.9;0.997	P;P;P;P	0.59171	0.704;0.845;0.49;0.853	T	0.71632	-0.4534	10	0.19147	T	0.46	-23.4493	11.6593	0.51337	0.0:0.0:0.148:0.852	.	73;68;39;39	B7Z6U4;F5GX51;Q9Y4F9-2;Q9Y4F9	.;.;.;FA65B_HUMAN	F	39;68;39;39;73	ENSP00000259698:I39F;ENSP00000441138:I68F;ENSP00000367262:I39F;ENSP00000438425:I39F;ENSP00000441305:I73F	ENSP00000259698:I39F	I	-	1	0	FAM65B	24981993	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	3.876000	0.56115	2.107000	0.64212	0.533000	0.62120	ATT	.	.		0.398	FAM65B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040024.2		
TNFRSF21	27242	hgsc.bcm.edu	37	6	47253741	47253741	+	Silent	SNP	G	G	A			TCGA-3K-AAZ8-01A-12D-A38X-10	TCGA-3K-AAZ8-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ca7f5e36-bbb3-44aa-b0c7-3f170a2bbc0f	c70e868a-ba0a-4b90-ad4d-d61ed7b34ecf	g.chr6:47253741G>A	ENST00000296861.2	-	2	1080	c.687C>T	c.(685-687)atC>atT	p.I229I		NM_014452.3	NP_055267.1	O75509	TNR21_HUMAN	tumor necrosis factor receptor superfamily, member 21	229					adaptive immune response (GO:0002250)|apoptotic process (GO:0006915)|B cell apoptotic process (GO:0001783)|cellular lipid metabolic process (GO:0044255)|cellular response to tumor necrosis factor (GO:0071356)|humoral immune response (GO:0006959)|myelination (GO:0042552)|negative regulation of B cell proliferation (GO:0030889)|negative regulation of interleukin-10 secretion (GO:2001180)|negative regulation of interleukin-13 secretion (GO:2000666)|negative regulation of interleukin-5 secretion (GO:2000663)|negative regulation of myelination (GO:0031642)|negative regulation of T cell proliferation (GO:0042130)|neuron apoptotic process (GO:0051402)|oligodendrocyte apoptotic process (GO:0097252)|regulation of oligodendrocyte differentiation (GO:0048713)|small molecule metabolic process (GO:0044281)|T cell receptor signaling pathway (GO:0050852)	axon (GO:0030424)|integral component of plasma membrane (GO:0005887)|intrinsic component of plasma membrane (GO:0031226)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(6)|lung(7)|pancreas(1)|skin(2)	21			Lung(136;0.189)			GGCGTGGAAAGATGGCTGTGC	0.522																																					p.I229I		Atlas-SNP	.											.	TNFRSF21	61	.	0			c.C687T						.						121.0	93.0	102.0					6																	47253741		2203	4300	6503	SO:0001819	synonymous_variant	27242	exon2			TGGAAAGATGGCT	AF068868	CCDS4921.1	6p21.1	2011-08-11			ENSG00000146072	ENSG00000146072		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	13469	protein-coding gene	gene with protein product	"""death receptor 6"""	605732				9714541	Standard	NM_014452		Approved	DR6, CD358	uc003oyv.3	O75509	OTTHUMG00000014796	ENST00000296861.2:c.687C>T	chr6.hg19:g.47253741G>A		114.0	0.0		157.0	43.0	NM_014452	B2RDI9|Q0D2P5|Q96D86	Silent	SNP	ENST00000296861.2	hg19	CCDS4921.1																																																																																			.	.		0.522	TNFRSF21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040814.1	NM_014452	
ELOVL5	60481	hgsc.bcm.edu	37	6	53159142	53159142	+	Intron	SNP	G	G	A			TCGA-3K-AAZ8-01A-12D-A38X-10	TCGA-3K-AAZ8-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ca7f5e36-bbb3-44aa-b0c7-3f170a2bbc0f	c70e868a-ba0a-4b90-ad4d-d61ed7b34ecf	g.chr6:53159142G>A	ENST00000542638.1	-	2	506				ELOVL5_ENST00000370913.5_Missense_Mutation_p.S69F|ELOVL5_ENST00000541407.1_Intron|ELOVL5_ENST00000486973.1_Intron|ELOVL5_ENST00000370918.4_Intron|ELOVL5_ENST00000304434.6_Intron			Q9NYP7	ELOV5_HUMAN	ELOVL fatty acid elongase 5						alpha-linolenic acid metabolic process (GO:0036109)|cellular lipid metabolic process (GO:0044255)|fatty acid elongation, monounsaturated fatty acid (GO:0034625)|fatty acid elongation, polyunsaturated fatty acid (GO:0034626)|linoleic acid metabolic process (GO:0043651)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|unsaturated fatty acid biosynthetic process (GO:0006636)|unsaturated fatty acid metabolic process (GO:0033559)|very long-chain fatty acid biosynthetic process (GO:0042761)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	fatty acid elongase activity (GO:0009922)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)	7	Lung NSC(77;0.116)					agctggcaaagagctctggga	0.483																																					p.S69F		Atlas-SNP	.											.	ELOVL5	25	.	0			c.C206T						.						12.0	10.0	11.0					6																	53159142		872	1984	2856	SO:0001627	intron_variant	60481	exon3			GGCAAAGAGCTCT	AF052129	CCDS4951.1, CCDS56433.1, CCDS56434.1, CCDS75470.1	6p21.1-p12.1	2014-07-30	2011-05-25		ENSG00000012660	ENSG00000012660			21308	protein-coding gene	gene with protein product		611805	"""ELOVL family member 5, elongation of long chain fatty acids (FEN1/Elo2, SUR4/Elo3-like, yeast)"", ""spinocerebellar ataxia 38"""	SCA38		10970790, 25065913	Standard	NM_021814		Approved	HELO1, dJ483K16.1	uc011dwx.2	Q9NYP7	OTTHUMG00000016249	ENST00000542638.1:c.58+1297C>T	chr6.hg19:g.53159142G>A		191.0	0.0		260.0	66.0	NM_001242831	B4DZJ2|F6SH78|Q59EL3|Q5TGH5|Q6NXE7|Q7L2S5|Q8NCG4|Q9UI22	Missense_Mutation	SNP	ENST00000542638.1	hg19	CCDS4951.1	.	.	.	.	.	.	.	.	.	.	G	9.180	1.023343	0.19433	.	.	ENSG00000012660	ENST00000370913	.	.	.	3.15	1.29	0.21616	.	.	.	.	.	T	0.12433	0.0302	.	.	.	0.09310	N	0.999999	B	0.02656	0.0	B	0.04013	0.001	T	0.30208	-0.9986	7	0.87932	D	0	.	4.791	0.13248	0.3088:0.0:0.6912:0.0	.	69	Q5TGH5	.	F	69	.	ENSP00000359951:S69F	S	-	2	0	ELOVL5	53267101	0.001000	0.12720	0.000000	0.03702	0.102000	0.19082	0.319000	0.19522	0.336000	0.23639	0.555000	0.69702	TCT	.	.		0.483	ELOVL5-203	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043566.1	NM_021814	
DST	667	hgsc.bcm.edu	37	6	56484410	56484410	+	Missense_Mutation	SNP	T	T	G			TCGA-3K-AAZ8-01A-12D-A38X-10	TCGA-3K-AAZ8-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ca7f5e36-bbb3-44aa-b0c7-3f170a2bbc0f	c70e868a-ba0a-4b90-ad4d-d61ed7b34ecf	g.chr6:56484410T>G	ENST00000370765.6	-	23	4529	c.4422A>C	c.(4420-4422)gaA>gaC	p.E1474D	DST_ENST00000361203.3_Intron|DST_ENST00000244364.6_Intron|DST_ENST00000370754.5_Intron|DST_ENST00000370788.2_Intron|DST_ENST00000312431.6_Intron|DST_ENST00000446842.2_Intron|DST_ENST00000421834.2_Intron|DST_ENST00000370769.4_Intron	NM_001723.5	NP_001714.1	Q03001	DYST_HUMAN	dystonin	6325					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cytoplasmic microtubule organization (GO:0031122)|cytoskeleton organization (GO:0007010)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|maintenance of cell polarity (GO:0030011)|microtubule cytoskeleton organization (GO:0000226)|regulation of microtubule polymerization or depolymerization (GO:0031110)|response to wounding (GO:0009611)|retrograde axon cargo transport (GO:0008090)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integral component of membrane (GO:0016021)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|neurofilament cytoskeleton (GO:0060053)|nucleus (GO:0005634)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|microtubule plus-end binding (GO:0051010)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)			NS(1)|breast(5)|central_nervous_system(8)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(43)|ovary(7)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	105	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			GATTAAGAGATTCTAATTCTA	0.358																																					p.E1474D		Atlas-SNP	.											.	DST	1427	.	0			c.A4422C						.						99.0	100.0	100.0					6																	56484410		2203	4300	6503	SO:0001583	missense	667	exon23			AAGAGATTCTAAT	M22942, M69225	CCDS4959.1, CCDS47443.1, CCDS75474.1	6p12.1	2013-01-10	2004-06-25	2004-07-01	ENSG00000151914	ENSG00000151914		"""EF-hand domain containing"""	1090	protein-coding gene	gene with protein product		113810	"""bullous pemphigoid antigen 1, 230/240kDa"""	BPAG1		2461961, 2276744	Standard	NM_001144770		Approved	BP240, KIAA0728, FLJ21489, FLJ13425, FLJ32235, FLJ30627, CATX-15, BPA, MACF2	uc021zba.2	Q03001	OTTHUMG00000014913	ENST00000370765.6:c.4422A>C	chr6.hg19:g.56484410T>G	ENSP00000359801:p.Glu1474Asp	74.0	0.0		110.0	27.0	NM_001723	B7Z3H1|O94833|Q12825|Q13266|Q13267|Q13775|Q5TBT0|Q5TBT2|Q5TF23|Q5TF24|Q8N1T8|Q8N8J3|Q8WXK8|Q8WXK9|Q96AK9|Q96DQ5|Q96J76|Q96QT5|Q9H555|Q9UGD7|Q9UGD8|Q9UN10	Missense_Mutation	SNP	ENST00000370765.6	hg19	CCDS4959.1	.	.	.	.	.	.	.	.	.	.	T	14.47	2.544264	0.45280	.	.	ENSG00000151914	ENST00000370765	T	0.31510	1.49	5.23	-2.51	0.06365	.	.	.	.	.	T	0.11024	0.0269	.	.	.	0.19575	N	0.999969	P	0.37276	0.589	B	0.35770	0.21	T	0.05386	-1.0888	7	0.44086	T	0.13	.	13.77	0.63019	0.0:0.5186:0.0:0.4814	.	1474	Q03001-3	.	D	1474	ENSP00000359801:E1474D	ENSP00000359801:E1474D	E	-	3	2	DST	56592369	0.977000	0.34250	0.965000	0.40720	0.952000	0.60782	0.092000	0.15066	-0.733000	0.04850	-0.280000	0.10049	GAA	.	.		0.358	DST-010	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000041027.2	NM_001723	
LGSN	51557	hgsc.bcm.edu	37	6	63995538	63995538	+	Missense_Mutation	SNP	A	A	C			TCGA-3K-AAZ8-01A-12D-A38X-10	TCGA-3K-AAZ8-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ca7f5e36-bbb3-44aa-b0c7-3f170a2bbc0f	c70e868a-ba0a-4b90-ad4d-d61ed7b34ecf	g.chr6:63995538A>C	ENST00000370657.4	-	3	317	c.284T>G	c.(283-285)cTc>cGc	p.L95R	LGSN_ENST00000370658.5_Missense_Mutation_p.L95R			Q5TDP6	LGSN_HUMAN	lengsin, lens protein with glutamine synthetase domain	95					glutamine biosynthetic process (GO:0006542)	plasma membrane (GO:0005886)	glutamate-ammonia ligase activity (GO:0004356)			NS(1)|endometrium(2)|large_intestine(5)|lung(16)|prostate(4)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	34						CACGCCGTGGAGGTCTGTTGC	0.418																																					p.L95R		Atlas-SNP	.											.	LGSN	82	.	0			c.T284G						.						117.0	98.0	104.0					6																	63995538		2203	4300	6503	SO:0001583	missense	51557	exon3			CCGTGGAGGTCTG	AF242388	CCDS4964.1, CCDS55027.1	6q12	2013-09-19	2008-09-19	2008-09-19	ENSG00000146166	ENSG00000146166			21016	protein-coding gene	gene with protein product		611470	"""glutamate-ammonia ligase (glutamine synthetase) domain containing 1"""	GLULD1		12107412	Standard	NM_016571		Approved	LGS	uc003peh.3	Q5TDP6	OTTHUMG00000014946	ENST00000370657.4:c.284T>G	chr6.hg19:g.63995538A>C	ENSP00000359691:p.Leu95Arg	122.0	0.0		143.0	45.0	NM_016571	A1L421|Q0PVN9|Q0PVP0|Q9NYJ0	Missense_Mutation	SNP	ENST00000370657.4	hg19	CCDS4964.1	.	.	.	.	.	.	.	.	.	.	A	21.3	4.134947	0.77662	.	.	ENSG00000146166	ENST00000370658;ENST00000370657	T;T	0.48836	0.8;0.8	5.61	5.61	0.85477	Glutamine synthetase, beta-Grasp (3);	0.057207	0.64402	D	0.000001	T	0.67739	0.2925	M	0.86502	2.82	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.97110	1.0;0.996	T	0.74925	-0.3498	10	0.87932	D	0	-12.0797	15.2783	0.73760	1.0:0.0:0.0:0.0	.	95;95	Q5TDP6-2;Q5TDP6	.;LGSN_HUMAN	R	95	ENSP00000359692:L95R;ENSP00000359691:L95R	ENSP00000359691:L95R	L	-	2	0	LGSN	64053497	1.000000	0.71417	0.366000	0.25914	0.918000	0.54935	8.252000	0.89840	2.269000	0.75478	0.533000	0.62120	CTC	.	.		0.418	LGSN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041076.2	NM_016571	
LCA5	167691	hgsc.bcm.edu	37	6	80223048	80223048	+	Missense_Mutation	SNP	A	A	G			TCGA-3K-AAZ8-01A-12D-A38X-10	TCGA-3K-AAZ8-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ca7f5e36-bbb3-44aa-b0c7-3f170a2bbc0f	c70e868a-ba0a-4b90-ad4d-d61ed7b34ecf	g.chr6:80223048A>G	ENST00000392959.1	-	4	1212	c.601T>C	c.(601-603)Ttt>Ctt	p.F201L	LCA5_ENST00000369846.4_Missense_Mutation_p.F201L|LCA5_ENST00000467898.3_Missense_Mutation_p.F201L	NM_181714.3	NP_859065.2	Q86VQ0	LCA5_HUMAN	Leber congenital amaurosis 5	201					intraciliary transport (GO:0042073)|photoreceptor cell maintenance (GO:0045494)|protein transport (GO:0015031)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	protein complex binding (GO:0032403)			haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(11)|lung(15)|prostate(2)|skin(1)	32		all_cancers(76;3.32e-05)|Acute lymphoblastic leukemia(125;1.1e-05)|all_hematologic(105;0.00117)|all_epithelial(107;0.0176)		BRCA - Breast invasive adenocarcinoma(397;0.0657)		TGTAAGGAAAATTTTGTCCTA	0.368																																					p.F201L		Atlas-SNP	.											.	LCA5	71	.	0			c.T601C						.						163.0	158.0	160.0					6																	80223048		2203	4300	6503	SO:0001583	missense	167691	exon3			AGGAAAATTTTGT		CCDS4990.1	6q14	2014-01-28			ENSG00000135338	ENSG00000135338			31923	protein-coding gene	gene with protein product	"""lebercilin"""	611408	"""chromosome 6 open reading frame 152"""	C6orf152		10631161, 17546029	Standard	NM_181714		Approved		uc003pix.3	Q86VQ0	OTTHUMG00000015080	ENST00000392959.1:c.601T>C	chr6.hg19:g.80223048A>G	ENSP00000376686:p.Phe201Leu	133.0	0.0		121.0	50.0	NM_001122769	E1P542|Q9BWX7	Missense_Mutation	SNP	ENST00000392959.1	hg19	CCDS4990.1	.	.	.	.	.	.	.	.	.	.	A	8.893	0.954434	0.18431	.	.	ENSG00000135338	ENST00000369846;ENST00000392959	T;T	0.76316	-1.01;-1.01	6.07	2.41	0.29592	.	0.474766	0.22705	N	0.056656	T	0.42108	0.1188	L	0.51422	1.61	0.24980	N	0.991608	B;B	0.22480	0.01;0.07	B;B	0.17098	0.017;0.013	T	0.23440	-1.0188	10	0.10902	T	0.67	-4.303	3.8199	0.08832	0.465:0.0:0.1498:0.3853	.	201;201	B4DRL2;Q86VQ0	.;LCA5_HUMAN	L	201	ENSP00000358861:F201L;ENSP00000376686:F201L	ENSP00000358861:F201L	F	-	1	0	LCA5	80279767	0.991000	0.36638	0.999000	0.59377	0.996000	0.88848	0.753000	0.26376	0.516000	0.28340	0.533000	0.62120	TTT	.	.		0.368	LCA5-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259269.1	NM_181714	
FRMD1	79981	hgsc.bcm.edu	37	6	168462619	168462619	+	Missense_Mutation	SNP	G	G	T			TCGA-3K-AAZ8-01A-12D-A38X-10	TCGA-3K-AAZ8-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ca7f5e36-bbb3-44aa-b0c7-3f170a2bbc0f	c70e868a-ba0a-4b90-ad4d-d61ed7b34ecf	g.chr6:168462619G>T	ENST00000283309.6	-	8	977	c.913C>A	c.(913-915)Cag>Aag	p.Q305K	FRMD1_ENST00000432403.1_5'UTR|FRMD1_ENST00000440994.2_Missense_Mutation_p.Q237K|FRMD1_ENST00000537786.1_Missense_Mutation_p.Q76K	NM_024919.3	NP_079195.3	Q8N878	FRMD1_HUMAN	FERM domain containing 1	305	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.					cytoskeleton (GO:0005856)				endometrium(3)|kidney(2)|large_intestine(5)|lung(6)|ovary(1)|prostate(1)|urinary_tract(1)	19		Breast(66;1.07e-05)|Ovarian(120;0.0728)		Epithelial(4;7.7e-30)|OV - Ovarian serous cystadenocarcinoma(33;5.82e-22)|BRCA - Breast invasive adenocarcinoma(4;1.38e-10)|GBM - Glioblastoma multiforme(31;0.000756)		ACCAGCTTCTGTGCTGCGGGC	0.632																																					p.Q305K	GBM(50;8 1094 9538 34399)|Ovarian(80;676 1857 8675 49015)	Atlas-SNP	.											.	FRMD1	52	.	0			c.C913A						.						27.0	28.0	28.0					6																	168462619		2202	4300	6502	SO:0001583	missense	79981	exon8			GCTTCTGTGCTGC		CCDS5306.1, CCDS47518.1	6q27	2008-10-23			ENSG00000153303	ENSG00000153303			21240	protein-coding gene	gene with protein product							Standard	NM_001122841		Approved	FLJ00181, DKFZp434O0117, FLJ40260, FLJ22615, bA164L23.1	uc003qwo.4	Q8N878	OTTHUMG00000016037	ENST00000283309.6:c.913C>A	chr6.hg19:g.168462619G>T	ENSP00000283309:p.Gln305Lys	132.0	0.0		150.0	56.0	NM_024919	B2RNV8|B3KUM6|Q5SZU7|Q9UFB0	Missense_Mutation	SNP	ENST00000283309.6	hg19	CCDS5306.1	.	.	.	.	.	.	.	.	.	.	G	4.442	0.081857	0.08533	.	.	ENSG00000153303	ENST00000283309;ENST00000440994;ENST00000537786	T;T;T	0.81247	-1.47;-1.47;-1.47	2.37	1.46	0.22682	FERM domain (1);	0.219292	0.27491	N	0.019123	T	0.38480	0.1042	N	0.08118	0	0.23665	N	0.997162	B;B;B;B	0.14012	0.009;0.004;0.004;0.009	B;B;B;B	0.20384	0.012;0.003;0.007;0.029	T	0.38351	-0.9665	10	0.25751	T	0.34	.	8.6375	0.33957	0.0:0.0:0.7704:0.2296	.	240;305;237;200	B7Z8G9;Q8N878;Q8N878-2;Q5SZU5	.;FRMD1_HUMAN;.;.	K	305;237;76	ENSP00000283309:Q305K;ENSP00000414115:Q237K;ENSP00000440078:Q76K	ENSP00000283309:Q305K	Q	-	1	0	FRMD1	168205468	0.993000	0.37304	0.007000	0.13788	0.031000	0.12232	1.398000	0.34554	0.328000	0.23435	0.313000	0.20887	CAG	.	.		0.632	FRMD1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362513.2	NM_024919	
CDK13	8621	hgsc.bcm.edu	37	7	40133764	40133764	+	Missense_Mutation	SNP	A	A	C			TCGA-3K-AAZ8-01A-12D-A38X-10	TCGA-3K-AAZ8-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ca7f5e36-bbb3-44aa-b0c7-3f170a2bbc0f	c70e868a-ba0a-4b90-ad4d-d61ed7b34ecf	g.chr7:40133764A>C	ENST00000181839.4	+	14	4329	c.3724A>C	c.(3724-3726)Atc>Ctc	p.I1242L	CDK13_ENST00000340829.5_Missense_Mutation_p.I1182L	NM_003718.4|NM_031267.3	NP_003709.3|NP_112557.2	Q14004	CDK13_HUMAN	cyclin-dependent kinase 13	1242					alternative mRNA splicing, via spliceosome (GO:0000380)|hemopoiesis (GO:0030097)|multicellular organismal development (GO:0007275)|phosphorylation of RNA polymerase II C-terminal domain (GO:0070816)|positive regulation of cell proliferation (GO:0008284)|regulation of mitosis (GO:0007088)|viral process (GO:0016032)	cyclin K-CDK13 complex (GO:0002945)|extracellular space (GO:0005615)|nuclear cyclin-dependent protein kinase holoenzyme complex (GO:0019908)|nuclear speck (GO:0016607)	ATP binding (GO:0005524)|cyclin binding (GO:0030332)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|RNA polymerase II carboxy-terminal domain kinase activity (GO:0008353)			cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(19)|ovary(1)|pancreas(2)|prostate(2)|skin(5)|stomach(2)|urinary_tract(1)	49						AGATATGAGGATCTTGGAGCT	0.468																																					p.I1242L		Atlas-SNP	.											.	CDK13	114	.	0			c.A3724C						.						102.0	94.0	97.0					7																	40133764		2203	4300	6503	SO:0001583	missense	8621	exon14			ATGAGGATCTTGG	M80629	CCDS5461.1, CCDS5462.1	7p14.1	2011-11-08	2009-12-16	2009-12-16	ENSG00000065883	ENSG00000065883		"""Cyclin-dependent kinases"""	1733	protein-coding gene	gene with protein product	"""cholinesterase-related cell division controller"""	603309	"""cell division cycle 2-like 5 (cholinesterase-related cell division controller)"""	CDC2L5		1731328, 19884882	Standard	NM_003718		Approved	CHED, CDC2L, KIAA1791	uc003thh.4	Q14004	OTTHUMG00000023726	ENST00000181839.4:c.3724A>C	chr7.hg19:g.40133764A>C	ENSP00000181839:p.Ile1242Leu	150.0	0.0		117.0	44.0	NM_003718	Q53G78|Q6DKQ9|Q75MH4|Q75MH5|Q96JN4|Q9H4A0|Q9H4A1|Q9UDR4	Missense_Mutation	SNP	ENST00000181839.4	hg19	CCDS5461.1	.	.	.	.	.	.	.	.	.	.	A	1.084	-0.666159	0.03428	.	.	ENSG00000065883	ENST00000181839;ENST00000340829	T;T	0.46819	0.86;0.86	5.26	2.88	0.33553	.	.	.	.	.	T	0.19366	0.0465	N	0.03608	-0.345	0.18873	N	0.999981	B;B	0.10296	0.003;0.0	B;B	0.09377	0.004;0.0	T	0.19224	-1.0312	8	.	.	.	0.7849	2.8832	0.05654	0.415:0.3731:0.0833:0.1287	.	1182;1242	Q14004-2;Q14004	.;CDK13_HUMAN	L	1242;1182	ENSP00000181839:I1242L;ENSP00000340557:I1182L	.	I	+	1	0	CDK13	40100289	0.924000	0.31332	0.839000	0.33178	0.957000	0.61999	1.196000	0.32198	0.816000	0.34421	0.459000	0.35465	ATC	.	.		0.468	CDK13-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000250726.2	NM_003718	
ZC3HAV1	56829	hgsc.bcm.edu	37	7	138794071	138794071	+	Missense_Mutation	SNP	C	C	A			TCGA-3K-AAZ8-01A-12D-A38X-10	TCGA-3K-AAZ8-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ca7f5e36-bbb3-44aa-b0c7-3f170a2bbc0f	c70e868a-ba0a-4b90-ad4d-d61ed7b34ecf	g.chr7:138794071C>A	ENST00000242351.5	-	1	323	c.7G>T	c.(7-9)Gac>Tac	p.D3Y	ZC3HAV1_ENST00000471652.1_Missense_Mutation_p.D3Y|ZC3HAV1_ENST00000464606.1_Missense_Mutation_p.D3Y	NM_020119.3	NP_064504.2	Q7Z2W4	ZCCHV_HUMAN	zinc finger CCCH-type, antiviral 1	3	N-terminal domain.				defense response to virus (GO:0051607)|innate immune response (GO:0045087)|negative regulation of viral genome replication (GO:0045071)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of mRNA catabolic process (GO:0061014)|positive regulation of RIG-I signaling pathway (GO:1900246)|response to virus (GO:0009615)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|NAD+ ADP-ribosyltransferase activity (GO:0003950)|poly(A) RNA binding (GO:0044822)			cervix(2)|endometrium(4)|kidney(3)|large_intestine(7)|lung(14)|ovary(2)|prostate(4)|skin(1)	37						ACCTCCGGGTCCGCCATGGCG	0.682																																					p.D3Y		Atlas-SNP	.											.	ZC3HAV1	75	.	0			c.G7T						.						9.0	11.0	11.0					7																	138794071		2036	4192	6228	SO:0001583	missense	56829	exon1			CCGGGTCCGCCAT	BX571742	CCDS5851.1, CCDS55171.1	7q34	2012-07-05			ENSG00000105939	ENSG00000105939		"""Zinc fingers, CCCH-type domain containing"", ""Poly (ADP-ribose) polymerases"""	23721	protein-coding gene	gene with protein product	"""zinc finger antiviral protein"", "" CCCH-type zinc finger antiviral protein"""	607312				12215647, 12851707	Standard	NM_024625		Approved	ZAP, FLB6421, FLJ13288, MGC48898, ZC3HDC2, ZC3H2, PARP13	uc003vun.3	Q7Z2W4	OTTHUMG00000157471	ENST00000242351.5:c.7G>T	chr7.hg19:g.138794071C>A	ENSP00000242351:p.Asp3Tyr	73.0	0.0		67.0	6.0	NM_024625	A4D1R2|A4D1S4|Q8IW57|Q8TAJ3|Q96N79|Q9H8R9|Q9P0Y7	Missense_Mutation	SNP	ENST00000242351.5	hg19	CCDS5851.1	.	.	.	.	.	.	.	.	.	.	C	24.0	4.482207	0.84747	.	.	ENSG00000105939	ENST00000242351;ENST00000464606;ENST00000471652	T;T;T	0.37235	1.21;1.21;1.21	4.74	4.74	0.60224	.	0.133103	0.35124	N	0.003425	T	0.59059	0.2166	M	0.74881	2.28	0.52099	D	0.999941	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.982	T	0.63198	-0.6691	10	0.87932	D	0	.	13.0949	0.59187	0.0:1.0:0.0:0.0	.	3;3	Q7Z2W4-2;Q7Z2W4	.;ZCCHV_HUMAN	Y	3	ENSP00000242351:D3Y;ENSP00000418385:D3Y;ENSP00000419855:D3Y	ENSP00000242351:D3Y	D	-	1	0	ZC3HAV1	138444611	0.996000	0.38824	0.992000	0.48379	0.956000	0.61745	4.205000	0.58466	2.461000	0.83175	0.491000	0.48974	GAC	.	.		0.682	ZC3HAV1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348915.1	NM_020119	
FASTK	10922	hgsc.bcm.edu	37	7	150776949	150776949	+	Missense_Mutation	SNP	C	C	T			TCGA-3K-AAZ8-01A-12D-A38X-10	TCGA-3K-AAZ8-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ca7f5e36-bbb3-44aa-b0c7-3f170a2bbc0f	c70e868a-ba0a-4b90-ad4d-d61ed7b34ecf	g.chr7:150776949C>T	ENST00000297532.6	-	2	220	c.143G>A	c.(142-144)cGg>cAg	p.R48Q	FASTK_ENST00000540185.1_Missense_Mutation_p.R14Q|FASTK_ENST00000353841.2_Intron|FASTK_ENST00000482571.1_Missense_Mutation_p.R48Q|FASTK_ENST00000489884.1_Intron	NM_006712.4	NP_006703.1	Q14296	FASTK_HUMAN	Fas-activated serine/threonine kinase	48					apoptotic signaling pathway (GO:0097190)|protein phosphorylation (GO:0006468)|regulation of RNA splicing (GO:0043484)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|Fas-activated serine/threonine kinase activity (GO:0033867)|protein serine/threonine kinase activity (GO:0004674)			lung(4)|stomach(2)	6			OV - Ovarian serous cystadenocarcinoma(82;0.00989)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)|LUSC - Lung squamous cell carcinoma(290;0.0718)|Lung(243;0.138)		GCCAGACAGCCGAGCAGGGGA	0.622																																					p.R48Q		Atlas-SNP	.											FASTK,NS,carcinoma,0,1	FASTK	29	.	0			c.G143A						.						33.0	21.0	25.0					7																	150776949		2196	4298	6494	SO:0001583	missense	10922	exon2			GACAGCCGAGCAG		CCDS5918.1, CCDS5919.1, CCDS59088.1	7q35	2006-07-06			ENSG00000164896	ENSG00000164896			24676	protein-coding gene	gene with protein product		606965				7544399, 15572676	Standard	NM_006712		Approved	FAST	uc003wix.2	Q14296	OTTHUMG00000158694	ENST00000297532.6:c.143G>A	chr7.hg19:g.150776949C>T	ENSP00000297532:p.Arg48Gln	225.0	0.0		222.0	22.0	NM_006712	A8K867|F8VTW9|Q59EM8|Q8IVA0	Missense_Mutation	SNP	ENST00000297532.6	hg19	CCDS5918.1	.	.	.	.	.	.	.	.	.	.	C	12.66	2.003204	0.35320	.	.	ENSG00000164896	ENST00000483105;ENST00000297530;ENST00000297532;ENST00000482571;ENST00000540185	T;T;T	0.52057	0.68;0.68;0.68	4.64	2.77	0.32553	.	0.221198	0.29537	N	0.011861	T	0.34250	0.0891	N	0.24115	0.695	0.29591	N	0.848441	B;B;D	0.54601	0.098;0.032;0.967	B;B;B	0.42282	0.011;0.005;0.382	T	0.32824	-0.9892	10	0.87932	D	0	-35.999	12.6106	0.56547	0.0:0.6799:0.3201:0.0	.	14;48;48	G3V1R6;F8VTW9;Q14296	.;.;FASTK_HUMAN	Q	48;48;48;48;14	ENSP00000297532:R48Q;ENSP00000418516:R48Q;ENSP00000444498:R14Q	ENSP00000297530:R48Q	R	-	2	0	FASTK	150407882	1.000000	0.71417	0.988000	0.46212	0.897000	0.52465	0.905000	0.28504	0.608000	0.30000	0.655000	0.94253	CGG	.	.		0.622	FASTK-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351832.2	NM_006712	
STAR	6770	hgsc.bcm.edu	37	8	38006210	38006210	+	Missense_Mutation	SNP	G	G	A			TCGA-3K-AAZ8-01A-12D-A38X-10	TCGA-3K-AAZ8-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ca7f5e36-bbb3-44aa-b0c7-3f170a2bbc0f	c70e868a-ba0a-4b90-ad4d-d61ed7b34ecf	g.chr8:38006210G>A	ENST00000276449.4	-	2	573	c.127C>T	c.(127-129)Ccc>Tcc	p.P43S	RP11-90P5.2_ENST00000520598.1_RNA	NM_000349.2	NP_000340.2	P49675	STAR_HUMAN	steroidogenic acute regulatory protein	43					bile acid biosynthetic process (GO:0006699)|biphenyl metabolic process (GO:0018879)|brain development (GO:0007420)|C21-steroid hormone biosynthetic process (GO:0006700)|cellular response to alkaloid (GO:0071312)|cellular response to antibiotic (GO:0071236)|cellular response to cadmium ion (GO:0071276)|cellular response to cAMP (GO:0071320)|cellular response to dexamethasone stimulus (GO:0071549)|cellular response to epinephrine stimulus (GO:0071872)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cellular response to follicle-stimulating hormone stimulus (GO:0071372)|cellular response to glucose stimulus (GO:0071333)|cellular response to growth hormone stimulus (GO:0071378)|cellular response to insulin stimulus (GO:0032869)|cellular response to interferon-alpha (GO:0035457)|cellular response to interferon-gamma (GO:0071346)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to luteinizing hormone stimulus (GO:0071373)|cellular response to transforming growth factor beta stimulus (GO:0071560)|cholesterol metabolic process (GO:0008203)|circadian sleep/wake cycle, REM sleep (GO:0042747)|dibenzo-p-dioxin metabolic process (GO:0018894)|diterpenoid metabolic process (GO:0016101)|estrogen biosynthetic process (GO:0006703)|fractalkine metabolic process (GO:0050756)|glucocorticoid metabolic process (GO:0008211)|insecticide metabolic process (GO:0017143)|intracellular cholesterol transport (GO:0032367)|male gonad development (GO:0008584)|negative regulation of neuron apoptotic process (GO:0043524)|phenol-containing compound metabolic process (GO:0018958)|phthalate metabolic process (GO:0018963)|positive regulation of gene expression (GO:0010628)|positive regulation of neurogenesis (GO:0050769)|progesterone biosynthetic process (GO:0006701)|regulation of neuronal synaptic plasticity (GO:0048168)|regulation of steroid biosynthetic process (GO:0050810)|response to activity (GO:0014823)|response to corticosterone (GO:0051412)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to ethanol (GO:0045471)|response to fungicide (GO:0060992)|response to herbicide (GO:0009635)|response to hydrogen peroxide (GO:0042542)|response to ionizing radiation (GO:0010212)|response to lead ion (GO:0010288)|response to leptin (GO:0044321)|response to nicotine (GO:0035094)|response to nutrient (GO:0007584)|small molecule metabolic process (GO:0044281)|steroid biosynthetic process (GO:0006694)|steroid metabolic process (GO:0008202)|testosterone biosynthetic process (GO:0061370)	cytosol (GO:0005829)|mitochondrial crista (GO:0030061)|mitochondrial intermembrane space (GO:0005758)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)	cholesterol binding (GO:0015485)			breast(1)|kidney(1)|large_intestine(3)|lung(4)|ovary(1)|skin(1)	11	Colorectal(12;0.000442)	all_lung(54;0.0151)|Lung NSC(58;0.0295)		READ - Rectum adenocarcinoma(644;0.188)		CTAGGGGTGGGGCCCCCCAGG	0.627																																					p.P43S		Atlas-SNP	.											.	STAR	29	.	0			c.C127T						.						41.0	46.0	44.0					8																	38006210		2203	4300	6503	SO:0001583	missense	6770	exon2			GGGTGGGGCCCCC	BC010550	CCDS6102.1	8p11.2	2011-09-13	2007-05-15		ENSG00000147465	ENSG00000147465		"""StAR-related lipid transfer (START) domain containing"""	11359	protein-coding gene	gene with protein product	"""StAR-related lipid transfer (START) domain containing 1"""	600617	"""steroidogenic acute regulator"""			7761400	Standard	NM_000349		Approved	StAR, STARD1	uc003xkv.1	P49675	OTTHUMG00000164058	ENST00000276449.4:c.127C>T	chr8.hg19:g.38006210G>A	ENSP00000276449:p.Pro43Ser	46.0	0.0		19.0	8.0	NM_000349	Q16396	Missense_Mutation	SNP	ENST00000276449.4	hg19	CCDS6102.1	.	.	.	.	.	.	.	.	.	.	G	13.10	2.135866	0.37728	.	.	ENSG00000147465	ENST00000276449	D	0.86030	-2.06	5.28	4.39	0.52855	.	0.148333	0.64402	N	0.000008	T	0.79094	0.4388	L	0.45285	1.41	0.80722	D	1	B	0.10296	0.003	B	0.11329	0.006	T	0.74219	-0.3736	10	0.44086	T	0.13	-18.5292	10.2032	0.43097	0.0738:0.0:0.7913:0.1349	.	43	P49675	STAR_HUMAN	S	43	ENSP00000276449:P43S	ENSP00000276449:P43S	P	-	1	0	STAR	38125367	0.984000	0.35163	0.866000	0.34008	0.312000	0.27988	1.280000	0.33202	1.329000	0.45376	0.462000	0.41574	CCC	.	.		0.627	STAR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376990.2	NM_000349	
POLB	5423	hgsc.bcm.edu	37	8	42218856	42218856	+	Silent	SNP	C	C	A			TCGA-3K-AAZ8-01A-12D-A38X-10	TCGA-3K-AAZ8-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ca7f5e36-bbb3-44aa-b0c7-3f170a2bbc0f	c70e868a-ba0a-4b90-ad4d-d61ed7b34ecf	g.chr8:42218856C>A	ENST00000265421.4	+	10	764	c.594C>A	c.(592-594)ccC>ccA	p.P198P	POLB_ENST00000538005.1_Silent_p.P44P	NM_002690.2	NP_002681.1	P06746	DPOLB_HUMAN	polymerase (DNA directed), beta	198					base-excision repair (GO:0006284)|base-excision repair, gap-filling (GO:0006287)|cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|DNA-dependent DNA replication (GO:0006261)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|neuron apoptotic process (GO:0051402)|pyrimidine dimer repair (GO:0006290)|response to ethanol (GO:0045471)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle microtubule (GO:0005876)	damaged DNA binding (GO:0003684)|DNA-directed DNA polymerase activity (GO:0003887)|enzyme binding (GO:0019899)|lyase activity (GO:0016829)|metal ion binding (GO:0046872)|microtubule binding (GO:0008017)			breast(1)|endometrium(3)|kidney(2)|large_intestine(3)|liver(1)|lung(5)|ovary(1)	16	all_cancers(6;1.42e-24)|all_epithelial(6;1.02e-25)|all_lung(13;2.58e-12)|Lung NSC(13;4.24e-11)|Ovarian(28;0.00769)|Prostate(17;0.0119)|Colorectal(14;0.1)|Lung SC(25;0.211)	all_lung(54;0.00671)|Lung NSC(58;0.0184)|Esophageal squamous(32;0.131)|Hepatocellular(245;0.133)|Renal(179;0.151)	BRCA - Breast invasive adenocarcinoma(8;3.18e-11)|Lung(22;0.00467)|OV - Ovarian serous cystadenocarcinoma(14;0.00523)|LUSC - Lung squamous cell carcinoma(45;0.024)		Cytarabine(DB00987)	TGACCCATCCCAGCTTCACTT	0.413								DNA polymerases (catalytic subunits)																													p.P198P		Atlas-SNP	.											.	POLB	60	.	0			c.C594A						.						153.0	130.0	138.0					8																	42218856		2203	4300	6503	SO:0001819	synonymous_variant	5423	exon10			CCATCCCAGCTTC		CCDS6129.1	8p12-p11	2012-10-02			ENSG00000070501	ENSG00000070501	2.7.7.7	"""DNA polymerases"""	9174	protein-coding gene	gene with protein product		174760					Standard	NM_002690		Approved		uc003xoz.2	P06746	OTTHUMG00000164093	ENST00000265421.4:c.594C>A	chr8.hg19:g.42218856C>A		76.0	0.0		40.0	20.0	NM_002690	B2RC78|Q3KP48|Q6FI34	Silent	SNP	ENST00000265421.4	hg19	CCDS6129.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	1.119|1.119	-0.655987|-0.655987	0.03480|0.03480	.|.	.|.	ENSG00000070501|ENSG00000070501	ENST00000518579;ENST00000517393|ENST00000521290	T;T|.	0.49432|.	0.78;0.78|.	5.58|5.58	0.27|0.27	0.15635|0.15635	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.43122|0.43122	0.1233|0.1233	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.27226|0.27226	-1.0080|-1.0080	7|4	0.87932|.	D|.	0|.	-1.8742|-1.8742	2.7484|2.7484	0.05273|0.05273	0.5288:0.2554:0.0826:0.1332|0.5288:0.2554:0.0826:0.1332	.|.	.|.	.|.	.|.	Q|K	56;14|129	ENSP00000430478:P56Q;ENSP00000428144:P14Q|.	ENSP00000428144:P14Q|.	P|Q	+|+	2|1	0|0	POLB|POLB	42338013|42338013	0.100000|0.100000	0.21855|0.21855	1.000000|1.000000	0.80357|0.80357	0.005000|0.005000	0.04900|0.04900	-0.194000|-0.194000	0.09559|0.09559	0.408000|0.408000	0.25621|0.25621	-0.388000|-0.388000	0.06559|0.06559	CCA|CAG	.	.		0.413	POLB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377242.1	NM_002690	
CRISPLD1	83690	hgsc.bcm.edu	37	8	75929313	75929313	+	Missense_Mutation	SNP	A	A	G			TCGA-3K-AAZ8-01A-12D-A38X-10	TCGA-3K-AAZ8-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ca7f5e36-bbb3-44aa-b0c7-3f170a2bbc0f	c70e868a-ba0a-4b90-ad4d-d61ed7b34ecf	g.chr8:75929313A>G	ENST00000262207.4	+	9	1429	c.961A>G	c.(961-963)Aaa>Gaa	p.K321E	CRISPLD1_ENST00000517786.1_Missense_Mutation_p.K135E|CRISPLD1_ENST00000523524.1_Missense_Mutation_p.K133E	NM_031461.5	NP_113649.1	Q9H336	CRLD1_HUMAN	cysteine-rich secretory protein LCCL domain containing 1	321	LCCL 1. {ECO:0000255|PROSITE- ProRule:PRU00123}.				face morphogenesis (GO:0060325)	extracellular vesicular exosome (GO:0070062)				biliary_tract(1)|central_nervous_system(1)|endometrium(3)|kidney(7)|large_intestine(10)|lung(16)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	43	Breast(64;0.0799)		Epithelial(68;0.155)|BRCA - Breast invasive adenocarcinoma(89;0.161)			TTTGGATAGTAAAGCTAAAGT	0.279																																					p.K321E		Atlas-SNP	.											.	CRISPLD1	94	.	0			c.A961G						.						88.0	92.0	91.0					8																	75929313		2203	4294	6497	SO:0001583	missense	83690	exon9			GATAGTAAAGCTA	AL834301	CCDS6219.1, CCDS69497.1, CCDS75754.1	8q21.13	2005-09-23	2005-02-16	2005-02-16	ENSG00000121005	ENSG00000121005			18206	protein-coding gene	gene with protein product			"""LCCL domain containing cysteine-rich secretory protein 1"""	LCRISP1			Standard	NM_031461		Approved	Cocoacrisp, DKFZp762F133	uc003yan.3	Q9H336	OTTHUMG00000164529	ENST00000262207.4:c.961A>G	chr8.hg19:g.75929313A>G	ENSP00000262207:p.Lys321Glu	211.0	0.0		301.0	48.0	NM_031461	B2RA60|B7Z929	Missense_Mutation	SNP	ENST00000262207.4	hg19	CCDS6219.1	.	.	.	.	.	.	.	.	.	.	A	16.40	3.113744	0.56398	.	.	ENSG00000121005	ENST00000262207;ENST00000523524;ENST00000517786	D;D;D	0.89552	-2.53;-2.53;-2.53	5.12	5.12	0.69794	LCCL (5);	0.215343	0.48286	D	0.000186	D	0.86719	0.6000	L	0.58101	1.795	0.33246	D	0.55793	B;B	0.23185	0.081;0.067	B;B	0.25506	0.061;0.049	D	0.88675	0.3198	10	0.66056	D	0.02	.	11.982	0.53125	0.8555:0.1445:0.0:0.0	.	135;321	B7Z929;Q9H336	.;CRLD1_HUMAN	E	321;133;135	ENSP00000262207:K321E;ENSP00000430105:K133E;ENSP00000429746:K135E	ENSP00000262207:K321E	K	+	1	0	CRISPLD1	76091868	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	4.565000	0.60836	2.276000	0.75962	0.528000	0.53228	AAA	.	.		0.279	CRISPLD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379117.1	NM_031461	
CDH17	1015	hgsc.bcm.edu	37	8	95164135	95164135	+	Missense_Mutation	SNP	C	C	T	rs189236130		TCGA-3K-AAZ8-01A-12D-A38X-10	TCGA-3K-AAZ8-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ca7f5e36-bbb3-44aa-b0c7-3f170a2bbc0f	c70e868a-ba0a-4b90-ad4d-d61ed7b34ecf	g.chr8:95164135C>T	ENST00000027335.3	-	13	1881	c.1757G>A	c.(1756-1758)gGc>gAc	p.G586D	CDH17_ENST00000441892.2_Missense_Mutation_p.G372D|CDH17_ENST00000450165.2_Missense_Mutation_p.G586D	NM_004063.3	NP_004054.3	Q12864	CAD17_HUMAN	cadherin 17, LI cadherin (liver-intestine)	586	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|oligopeptide transmembrane transport (GO:0035672)|oligopeptide transport (GO:0006857)|transport (GO:0006810)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|proton-dependent oligopeptide secondary active transmembrane transporter activity (GO:0005427)|transporter activity (GO:0005215)			NS(1)|endometrium(5)|kidney(3)|large_intestine(10)|lung(18)|ovary(6)|prostate(3)|skin(4)|stomach(2)	52	Breast(36;4.65e-06)		BRCA - Breast invasive adenocarcinoma(8;0.00691)			AGTCACATTGCCCACTTTAGT	0.502																																					p.G586D		Atlas-SNP	.											.	CDH17	119	.	0			c.G1757A						.						175.0	128.0	144.0					8																	95164135		2203	4300	6503	SO:0001583	missense	1015	exon13			ACATTGCCCACTT	X83228	CCDS6260.1	8q22.1	2010-01-26			ENSG00000079112	ENSG00000079112		"""Cadherins / Major cadherins"""	1756	protein-coding gene	gene with protein product		603017				9615235, 10191097	Standard	NM_004063		Approved	HPT-1, cadherin	uc003ygh.2	Q12864	OTTHUMG00000164391	ENST00000027335.3:c.1757G>A	chr8.hg19:g.95164135C>T	ENSP00000027335:p.Gly586Asp	89.0	0.0		109.0	79.0	NM_004063	Q15336|Q2M2E0	Missense_Mutation	SNP	ENST00000027335.3	hg19	CCDS6260.1	.	.	.	.	.	.	.	.	.	.	C	18.63	3.665485	0.67700	.	.	ENSG00000079112	ENST00000027335;ENST00000441892;ENST00000450165	T;T;T	0.54071	0.59;0.59;0.59	5.72	0.351	0.16042	Cadherin (3);Cadherin-like (1);	0.345734	0.25280	N	0.031801	T	0.55657	0.1934	M	0.83774	2.66	0.09310	N	0.999996	P;P	0.43662	0.814;0.728	P;B	0.48334	0.574;0.328	T	0.51490	-0.8699	10	0.66056	D	0.02	-1.3322	3.0135	0.06052	0.3679:0.3077:0.2426:0.0817	.	372;586	E7EN24;Q12864	.;CAD17_HUMAN	D	586;372;586	ENSP00000027335:G586D;ENSP00000392811:G372D;ENSP00000401468:G586D	ENSP00000027335:G586D	G	-	2	0	CDH17	95233311	0.997000	0.39634	0.267000	0.24556	0.572000	0.35998	1.189000	0.32114	0.389000	0.25086	0.655000	0.94253	GGC	.	C|1.000;A|0.000		0.502	CDH17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378560.1	NM_004063	
DOCK8	81704	hgsc.bcm.edu	37	9	376287	376287	+	Silent	SNP	T	T	C			TCGA-3K-AAZ8-01A-12D-A38X-10	TCGA-3K-AAZ8-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ca7f5e36-bbb3-44aa-b0c7-3f170a2bbc0f	c70e868a-ba0a-4b90-ad4d-d61ed7b34ecf	g.chr9:376287T>C	ENST00000453981.1	+	19	2299	c.2187T>C	c.(2185-2187)gtT>gtC	p.V729V	DOCK8_ENST00000469391.1_Silent_p.V661V|DOCK8_ENST00000432829.2_Silent_p.V661V|DOCK8_ENST00000382331.1_Silent_p.V31V|DOCK8_ENST00000382329.1_Silent_p.V196V			Q8NF50	DOCK8_HUMAN	dedicator of cytokinesis 8	729	DHR-1.				blood coagulation (GO:0007596)|dendritic cell migration (GO:0036336)|immunological synapse formation (GO:0001771)|memory T cell proliferation (GO:0061485)|negative regulation of T cell apoptotic process (GO:0070233)|small GTPase mediated signal transduction (GO:0007264)	cell leading edge (GO:0031252)|cytosol (GO:0005829)|membrane (GO:0016020)	guanyl-nucleotide exchange factor activity (GO:0005085)			breast(1)|central_nervous_system(5)|endometrium(2)|kidney(6)|large_intestine(13)|lung(22)|ovary(3)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	65		all_cancers(5;2.13e-17)|all_epithelial(5;2.15e-12)|all_lung(10;6.69e-11)|Lung NSC(10;1.08e-10)|Acute lymphoblastic leukemia(5;0.000242)|all_hematologic(5;0.00317)|Breast(48;0.0151)|Prostate(43;0.128)		all cancers(5;9.3e-07)|GBM - Glioblastoma multiforme(5;2.41e-06)|Epithelial(6;0.00557)|Lung(218;0.00942)		TGCAAGCTGTTTCTTCTGTAC	0.403																																					p.V729V		Atlas-SNP	.											.	DOCK8	401	.	0			c.T2187C						.						131.0	127.0	128.0					9																	376287		2203	4300	6503	SO:0001819	synonymous_variant	81704	exon19			AGCTGTTTCTTCT	AK090429	CCDS6440.1, CCDS6440.2, CCDS55283.1, CCDS55284.1	9p24.3	2014-09-17			ENSG00000107099	ENSG00000107099			19191	protein-coding gene	gene with protein product		611432				11214971	Standard	NM_203447		Approved	FLJ00026, FLJ00152, ZIR8, FLJ00346	uc003zgf.2	Q8NF50	OTTHUMG00000078789	ENST00000453981.1:c.2187T>C	chr9.hg19:g.376287T>C		106.0	0.0		91.0	45.0	NM_203447	A2A350|A2BDF2|A4FU78|B7ZLP0|E9PH09|Q3MV16|Q5JPJ1|Q8TEP1|Q8WUY2|Q9BYJ5|Q9H1Q2|Q9H1Q3|Q9H308|Q9H7P2	Silent	SNP	ENST00000453981.1	hg19	CCDS6440.2																																																																																			.	.		0.403	DOCK8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000171792.5	XM_036307	
KIAA2026	158358	hgsc.bcm.edu	37	9	5921657	5921657	+	Missense_Mutation	SNP	T	T	C			TCGA-3K-AAZ8-01A-12D-A38X-10	TCGA-3K-AAZ8-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ca7f5e36-bbb3-44aa-b0c7-3f170a2bbc0f	c70e868a-ba0a-4b90-ad4d-d61ed7b34ecf	g.chr9:5921657T>C	ENST00000399933.3	-	8	4338	c.4339A>G	c.(4339-4341)Aaa>Gaa	p.K1447E	KIAA2026_ENST00000381461.2_Missense_Mutation_p.K1417E	NM_001017969.2	NP_001017969.2	Q5HYC2	K2026_HUMAN	KIAA2026	1447										breast(6)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(11)|lung(15)|ovary(2)|prostate(2)|skin(1)	46		Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.00155)|Lung(218;0.124)		GGGTAACTTTTTGTGATATAA	0.373																																					p.K1447E		Atlas-SNP	.											.	KIAA2026	231	.	0			c.A4339G						.						171.0	160.0	163.0					9																	5921657		1923	4146	6069	SO:0001583	missense	158358	exon8			AACTTTTTGTGAT	AB095946		9p24.1	2014-01-10			ENSG00000183354	ENSG00000183354			23378	protein-coding gene	gene with protein product							Standard	NM_001017969		Approved	FLJ20375	uc003zjq.4	Q5HYC2	OTTHUMG00000019507	ENST00000399933.3:c.4339A>G	chr9.hg19:g.5921657T>C	ENSP00000382815:p.Lys1447Glu	122.0	0.0		91.0	19.0	NM_001017969	A8MTP2|B9EGW7|Q4VXA2|Q8IVE5	Missense_Mutation	SNP	ENST00000399933.3	hg19		.	.	.	.	.	.	.	.	.	.	T	12.82	2.051833	0.36181	.	.	ENSG00000183354	ENST00000399933;ENST00000381461	.	.	.	4.53	4.53	0.55603	.	0.000000	0.64402	D	0.000006	T	0.25975	0.0633	L	0.27053	0.805	0.22873	N	0.998623	B	0.28998	0.23	B	0.23574	0.047	T	0.11518	-1.0584	9	0.24483	T	0.36	-8.6695	8.7102	0.34378	0.0:0.0857:0.0:0.9143	.	1447	Q5HYC2	K2026_HUMAN	E	1447;1417	.	ENSP00000370870:K1417E	K	-	1	0	KIAA2026	5911657	0.998000	0.40836	0.998000	0.56505	0.954000	0.61252	3.468000	0.53086	1.919000	0.55581	0.392000	0.25879	AAA	.	.		0.373	KIAA2026-002	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000051652.2	NM_001017969	
AQP7	364	hgsc.bcm.edu	37	9	33385103	33385103	+	3'UTR	SNP	G	G	A	rs541770524		TCGA-3K-AAZ8-01A-12D-A38X-10	TCGA-3K-AAZ8-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ca7f5e36-bbb3-44aa-b0c7-3f170a2bbc0f	c70e868a-ba0a-4b90-ad4d-d61ed7b34ecf	g.chr9:33385103G>A	ENST00000537089.1	-	0	1329				AQP7_ENST00000377425.4_3'UTR			O14520	AQP7_HUMAN	aquaporin 7						excretion (GO:0007588)|generation of precursor metabolites and energy (GO:0006091)|glycerol transport (GO:0015793)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	glycerol channel activity (GO:0015254)|water channel activity (GO:0015250)	p.T310M(1)		NS(1)|large_intestine(1)|lung(7)|ovary(1)|prostate(4)|skin(2)|stomach(1)	17			LUSC - Lung squamous cell carcinoma(29;0.00788)	GBM - Glioblastoma multiforme(74;0.191)		GGGAGAGATCGTGGGTTCATG	0.562													g|||	1	0.000199681	0.0	0.0	5008	,	,		18465	0.0		0.0	False		,,,				2504	0.001				p.T310M		Atlas-SNP	.											AQP7,colon,carcinoma,0,1	AQP7	58	.	1	Substitution - Missense(1)	large_intestine(1)	c.C929T						.						146.0	147.0	147.0					9																	33385103		2203	4300	6503	SO:0001624	3_prime_UTR_variant	364	exon8			GAGATCGTGGGTT	AB006190	CCDS6541.1	9p13	2008-02-05			ENSG00000165269	ENSG00000165269		"""Ion channels / Aquaporins"""	640	protein-coding gene	gene with protein product		602974		AQP7L		9252401	Standard	NM_001170		Approved	AQP9, AQPap	uc003zst.3	O14520	OTTHUMG00000019773	ENST00000537089.1:c.*513C>T	chr9.hg19:g.33385103G>A		52.0	0.0		49.0	3.0	NM_001170	Q08E94|Q5T5L9|Q8NHM3	Missense_Mutation	SNP	ENST00000537089.1	hg19		.	.	.	.	.	.	.	.	.	.	g	5.533	0.283273	0.10458	.	.	ENSG00000165269	ENST00000379507;ENST00000297988	D;D	0.85013	-1.93;-1.93	3.7	-7.4	0.01397	.	.	.	.	.	T	0.66896	0.2836	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.51188	-0.8737	8	0.23302	T	0.38	5.6088	3.6616	0.08241	0.1358:0.1181:0.4916:0.2545	.	310	O14520	AQP7_HUMAN	M	309;310	ENSP00000368821:T309M;ENSP00000297988:T310M	ENSP00000297988:T310M	T	-	2	0	AQP7	33375103	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-2.499000	0.00968	-2.266000	0.00687	-0.487000	0.04747	ACG	.	.		0.562	AQP7-202	KNOWN	basic	protein_coding	protein_coding		NM_001170	
GADD45G	10912	hgsc.bcm.edu	37	9	92220779	92220779	+	Missense_Mutation	SNP	A	A	C			TCGA-3K-AAZ8-01A-12D-A38X-10	TCGA-3K-AAZ8-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ca7f5e36-bbb3-44aa-b0c7-3f170a2bbc0f	c70e868a-ba0a-4b90-ad4d-d61ed7b34ecf	g.chr9:92220779A>C	ENST00000252506.6	+	3	462	c.353A>C	c.(352-354)cAc>cCc	p.H118P	GADD45G_ENST00000494726.1_3'UTR|GADD45G_ENST00000375769.1_Missense_Mutation_p.H100P	NM_006705.3	NP_006696.1	O95257	GA45G_HUMAN	growth arrest and DNA-damage-inducible, gamma	118					activation of MAPKK activity (GO:0000186)|activation of MAPKKK activity (GO:0000185)|apoptotic process (GO:0006915)|cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|negative regulation of protein kinase activity (GO:0006469)|positive regulation of apoptotic process (GO:0043065)|positive regulation of JNK cascade (GO:0046330)|positive regulation of p38MAPK cascade (GO:1900745)|regulation of cell cycle (GO:0051726)|response to stress (GO:0006950)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				lung(2)	2						GGCGACCTGCACTGCATCCTC	0.697																																					p.H118P	Colon(131;320 2336 18973 23919)	Atlas-SNP	.											.	GADD45G	12	.	0			c.A353C						.						30.0	27.0	28.0					9																	92220779		2202	4297	6499	SO:0001583	missense	10912	exon3			ACCTGCACTGCAT	D83023	CCDS6686.1	9q22.1-q22.2	2008-07-21			ENSG00000130222	ENSG00000130222			4097	protein-coding gene	gene with protein product	"""gadd-related protein, 17 kD"", ""growth arrest and DNA-damage-inducible gamma"""	604949				9827804, 10496071	Standard	NM_006705		Approved	DDIT2, GADD45gamma, GRP17, CR6	uc004aqq.3	O95257	OTTHUMG00000020187	ENST00000252506.6:c.353A>C	chr9.hg19:g.92220779A>C	ENSP00000252506:p.His118Pro	86.0	0.0		74.0	36.0	NM_006705	Q5VZ87|Q9C076	Missense_Mutation	SNP	ENST00000252506.6	hg19	CCDS6686.1	.	.	.	.	.	.	.	.	.	.	A	21.2	4.115465	0.77323	.	.	ENSG00000130222	ENST00000252506;ENST00000375769	T;T	0.41400	1.0;1.0	4.45	3.26	0.37387	.	0.103298	0.64402	D	0.000003	T	0.52141	0.1716	M	0.85373	2.75	0.58432	D	0.999999	P	0.52842	0.956	P	0.47786	0.557	T	0.59156	-0.7507	10	0.66056	D	0.02	-5.8375	10.1809	0.42968	0.832:0.168:0.0:0.0	.	118	O95257	GA45G_HUMAN	P	118;100	ENSP00000252506:H118P;ENSP00000364924:H100P	ENSP00000252506:H118P	H	+	2	0	GADD45G	91410599	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	8.475000	0.90417	0.814000	0.34374	0.459000	0.35465	CAC	.	.		0.697	GADD45G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053000.1	NM_006705	
ZNF483	158399	hgsc.bcm.edu	37	9	114304529	114304529	+	Silent	SNP	T	T	C			TCGA-3K-AAZ8-01A-12D-A38X-10	TCGA-3K-AAZ8-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ca7f5e36-bbb3-44aa-b0c7-3f170a2bbc0f	c70e868a-ba0a-4b90-ad4d-d61ed7b34ecf	g.chr9:114304529T>C	ENST00000309235.5	+	6	1472	c.1314T>C	c.(1312-1314)acT>acC	p.T438T	ZNF483_ENST00000358151.4_Intron	NM_133464.2	NP_597721.2	Q8TF39	ZN483_HUMAN	zinc finger protein 483	438					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(1)|kidney(1)|large_intestine(11)|lung(11)|ovary(1)|skin(5)	31						GAGAAAAAACTCATAAATGTA	0.388																																					p.T438T		Atlas-SNP	.											.	ZNF483	78	.	0			c.T1314C						.						59.0	64.0	62.0					9																	114304529		2203	4300	6503	SO:0001819	synonymous_variant	158399	exon6			AAAAACTCATAAA	AB075842	CCDS35105.1, CCDS35106.1	9q32	2013-01-09			ENSG00000173258	ENSG00000173258		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	23384	protein-coding gene	gene with protein product							Standard	NM_001007169		Approved	ZKSCAN16, KIAA1962, ZSCAN48	uc004bff.2	Q8TF39	OTTHUMG00000020490	ENST00000309235.5:c.1314T>C	chr9.hg19:g.114304529T>C		99.0	0.0		78.0	15.0	NM_133464	Q5VZN2|Q8NAE1	Silent	SNP	ENST00000309235.5	hg19	CCDS35106.1																																																																																			.	.		0.388	ZNF483-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053641.1	XM_088567	
RAB14	51552	hgsc.bcm.edu	37	9	123943729	123943729	+	Missense_Mutation	SNP	T	T	C			TCGA-3K-AAZ8-01A-12D-A38X-10	TCGA-3K-AAZ8-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ca7f5e36-bbb3-44aa-b0c7-3f170a2bbc0f	c70e868a-ba0a-4b90-ad4d-d61ed7b34ecf	g.chr9:123943729T>C	ENST00000373840.4	-	8	830	c.593A>G	c.(592-594)cAg>cGg	p.Q198R		NM_016322.3	NP_057406.2	P61106	RAB14_HUMAN	RAB14, member RAS oncogene family	198					embryo development (GO:0009790)|endocytic recycling (GO:0032456)|fibroblast growth factor receptor signaling pathway (GO:0008543)|Golgi to endosome transport (GO:0006895)|GTP catabolic process (GO:0006184)|intracellular transport (GO:0046907)|membrane organization (GO:0061024)|protein transport (GO:0015031)|regulation of protein localization (GO:0032880)|small GTPase mediated signal transduction (GO:0007264)|vesicle-mediated transport (GO:0016192)	cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|early endosome (GO:0005769)|extracellular vesicular exosome (GO:0070062)|Golgi stack (GO:0005795)|intracellular (GO:0005622)|intracellular membrane-bounded organelle (GO:0043231)|late endosome (GO:0005770)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|nuclear outer membrane-endoplasmic reticulum membrane network (GO:0042175)|perinuclear region of cytoplasm (GO:0048471)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)|rough endoplasmic reticulum (GO:0005791)|trans-Golgi network transport vesicle (GO:0030140)	GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|myosin V binding (GO:0031489)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(2)	5						CCGGCCTCCCTGCGGGGCTGA	0.527																																					p.Q198R		Atlas-SNP	.											.	RAB14	14	.	0			c.A593G						.						98.0	96.0	97.0					9																	123943729		2203	4300	6503	SO:0001583	missense	51552	exon8			CCTCCCTGCGGGG	AF152463	CCDS6827.1	9q32-q34.11	2008-07-21			ENSG00000119396	ENSG00000119396		"""RAB, member RAS oncogene"""	16524	protein-coding gene	gene with protein product	"""F protein-binding protein 1"", ""bA165P4.3 (member RAS oncogene family)"", ""small GTP binding protein RAB14"""	612673				9792283, 15004230	Standard	NM_016322		Approved	FBP, RAB-14	uc004blc.3	P61106	OTTHUMG00000020582	ENST00000373840.4:c.593A>G	chr9.hg19:g.123943729T>C	ENSP00000362946:p.Gln198Arg	177.0	0.0		134.0	51.0	NM_016322	B3KR31|P35287|Q5JVD4|Q6Q7K5|Q969L0|Q9UI11	Missense_Mutation	SNP	ENST00000373840.4	hg19	CCDS6827.1	.	.	.	.	.	.	.	.	.	.	T	0.699	-0.791664	0.02884	.	.	ENSG00000119396	ENST00000373840	T	0.61392	0.11	6.06	6.06	0.98353	.	0.000000	0.85682	D	0.000000	T	0.42131	0.1189	N	0.19112	0.55	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.33954	-0.9848	10	0.11794	T	0.64	.	15.8056	0.78506	0.0:0.0:0.0:1.0	.	198	P61106	RAB14_HUMAN	R	198	ENSP00000362946:Q198R	ENSP00000362946:Q198R	Q	-	2	0	RAB14	122983550	1.000000	0.71417	1.000000	0.80357	0.491000	0.33493	7.891000	0.87319	2.323000	0.78572	0.528000	0.53228	CAG	.	.		0.527	RAB14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053857.1	NM_016322	
ANGPTL2	23452	hgsc.bcm.edu	37	9	129854065	129854065	+	Missense_Mutation	SNP	T	T	G			TCGA-3K-AAZ8-01A-12D-A38X-10	TCGA-3K-AAZ8-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ca7f5e36-bbb3-44aa-b0c7-3f170a2bbc0f	c70e868a-ba0a-4b90-ad4d-d61ed7b34ecf	g.chr9:129854065T>G	ENST00000373425.3	-	4	1783	c.1166A>C	c.(1165-1167)gAg>gCg	p.E389A	RALGPS1_ENST00000373434.1_Intron|RALGPS1_ENST00000424082.2_Intron|RALGPS1_ENST00000259351.5_Intron|RALGPS1_ENST00000394022.3_Intron|ANGPTL2_ENST00000373417.1_Missense_Mutation_p.E87A|RALGPS1_ENST00000373436.1_Intron	NM_012098.2	NP_036230.1	Q9UKU9	ANGL2_HUMAN	angiopoietin-like 2	389	Fibrinogen C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00739}.				multicellular organismal development (GO:0007275)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	receptor binding (GO:0005102)			breast(1)|endometrium(2)|kidney(1)|large_intestine(8)|lung(4)|ovary(1)|urinary_tract(1)	18						ATACTCGCTCTCAGGTTCCAG	0.557																																					p.E389A		Atlas-SNP	.											.	ANGPTL2	46	.	0			c.A1166C						.						176.0	176.0	176.0					9																	129854065		2203	4300	6503	SO:0001583	missense	23452	exon4			TCGCTCTCAGGTT	AF125175	CCDS6868.1	9q34	2013-02-06			ENSG00000136859	ENSG00000136859		"""Fibrinogen C domain containing"""	490	protein-coding gene	gene with protein product		605001				10473614	Standard	NM_012098		Approved	ARP2, HARP	uc004bqr.1	Q9UKU9	OTTHUMG00000020695	ENST00000373425.3:c.1166A>C	chr9.hg19:g.129854065T>G	ENSP00000362524:p.Glu389Ala	114.0	0.0		97.0	7.0	NM_012098	Q5JT58|Q8NCH7	Missense_Mutation	SNP	ENST00000373425.3	hg19	CCDS6868.1	.	.	.	.	.	.	.	.	.	.	T	29.2	4.984327	0.93044	.	.	ENSG00000136859	ENST00000373425;ENST00000373417	D;D	0.84589	-1.87;-1.87	5.2	5.2	0.72013	Fibrinogen, alpha/beta/gamma chain, C-terminal globular (4);Fibrinogen, alpha/beta/gamma chain, C-terminal globular, subdomain 1 (1);	0.000000	0.85682	D	0.000000	D	0.92515	0.7623	M	0.83118	2.625	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.93155	0.6553	10	0.54805	T	0.06	.	15.3682	0.74541	0.0:0.0:0.0:1.0	.	389	Q9UKU9	ANGL2_HUMAN	A	389;87	ENSP00000362524:E389A;ENSP00000362516:E87A	ENSP00000362516:E87A	E	-	2	0	ANGPTL2	128893886	1.000000	0.71417	0.997000	0.53966	0.995000	0.86356	7.997000	0.88414	2.082000	0.62665	0.533000	0.62120	GAG	.	.		0.557	ANGPTL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054129.1	NM_012098	
C9orf163	158055	hgsc.bcm.edu	37	9	139379108	139379108	+	Missense_Mutation	SNP	G	G	C			TCGA-3K-AAZ8-01A-12D-A38X-10	TCGA-3K-AAZ8-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ca7f5e36-bbb3-44aa-b0c7-3f170a2bbc0f	c70e868a-ba0a-4b90-ad4d-d61ed7b34ecf	g.chr9:139379108G>C	ENST00000354376.1	+	1	1162	c.208G>C	c.(208-210)Ggg>Cgg	p.G70R		NM_152571.2	NP_689784.1	Q8N9P6	CI163_HUMAN	chromosome 9 open reading frame 163	70										kidney(1)|lung(1)	2		Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;4.36e-06)|Epithelial(140;5.65e-06)		GGTGAGGGAGGGGGTGATATC	0.687																																					p.G70R		Atlas-SNP	.											.	C9orf163	9	.	0			c.G208C						.						20.0	22.0	22.0					9																	139379108		2200	4297	6497	SO:0001583	missense	158055	exon1			AGGGAGGGGGTGA	AK055336	CCDS7001.1	9q34.3	2006-03-21			ENSG00000196366	ENSG00000196366			26718	protein-coding gene	gene with protein product							Standard	NM_152571		Approved	FLJ36779	uc004chy.3	Q8N9P6	OTTHUMG00000131725	ENST00000354376.1:c.208G>C	chr9.hg19:g.139379108G>C	ENSP00000346345:p.Gly70Arg	117.0	0.0		87.0	44.0	NM_152571		Missense_Mutation	SNP	ENST00000354376.1	hg19	CCDS7001.1	.	.	.	.	.	.	.	.	.	.	G	10.33	1.321036	0.23994	.	.	ENSG00000196366	ENST00000354376	T	0.58797	0.31	3.49	3.49	0.39957	.	.	.	.	.	T	0.54854	0.1884	N	0.08118	0	0.09310	N	1	D	0.71674	0.998	D	0.66979	0.948	T	0.49588	-0.8924	9	0.87932	D	0	.	11.1833	0.48642	0.0:0.0:1.0:0.0	.	70	Q8N9P6	CI163_HUMAN	R	70	ENSP00000346345:G70R	ENSP00000346345:G70R	G	+	1	0	C9orf163	138498929	1.000000	0.71417	0.006000	0.13384	0.103000	0.19146	2.215000	0.42862	1.901000	0.55032	0.511000	0.50034	GGG	.	.		0.687	C9orf163-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254644.1	NM_152571	
ARMC3	219681	hgsc.bcm.edu	37	10	23292182	23292182	+	Missense_Mutation	SNP	G	G	C			TCGA-3K-AAZ8-01A-12D-A38X-10	TCGA-3K-AAZ8-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ca7f5e36-bbb3-44aa-b0c7-3f170a2bbc0f	c70e868a-ba0a-4b90-ad4d-d61ed7b34ecf	g.chr10:23292182G>C	ENST00000298032.5	+	13	1654	c.1570G>C	c.(1570-1572)Gat>Cat	p.D524H	ARMC3_ENST00000376528.4_Missense_Mutation_p.D261H|ARMC3_ENST00000409983.3_Missense_Mutation_p.D524H|ARMC3_ENST00000409049.3_Missense_Mutation_p.D524H	NM_173081.3	NP_775104.2	Q5W041	ARMC3_HUMAN	armadillo repeat containing 3	524						extracellular vesicular exosome (GO:0070062)				breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(24)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	47						CAGGGCTTTAGATATCCTTGA	0.358																																					p.D524H		Atlas-SNP	.											.	ARMC3	102	.	0			c.G1570C						.						70.0	71.0	71.0					10																	23292182		2203	4300	6503	SO:0001583	missense	219681	exon13			GCTTTAGATATCC	AK057389	CCDS7142.1, CCDS60499.1, CCDS60500.1, CCDS73073.1	10p12.31	2013-02-14			ENSG00000165309	ENSG00000165309		"""Armadillo repeat containing"""	30964	protein-coding gene	gene with protein product	"""cancer/testis antigen 81"""	611226					Standard	XM_005252380		Approved	FLJ32827, CT81	uc001irm.4	Q5W041	OTTHUMG00000017811	ENST00000298032.5:c.1570G>C	chr10.hg19:g.23292182G>C	ENSP00000298032:p.Asp524His	163.0	0.0		144.0	56.0	NM_173081	A0PG76|A6NH64|B4DZL3|B7ZBN6|B7ZBN7|Q8IXS5|Q8N7B0|Q96M49	Missense_Mutation	SNP	ENST00000298032.5	hg19	CCDS7142.1	.	.	.	.	.	.	.	.	.	.	G	18.73	3.687452	0.68157	.	.	ENSG00000165309	ENST00000298032;ENST00000409983;ENST00000376523;ENST00000409049;ENST00000376528	T;T;T;T	0.66280	-0.2;-0.2;1.03;0.61	5.53	3.66	0.41972	Armadillo-like helical (1);	0.724237	0.14280	N	0.329594	T	0.71392	0.3334	M	0.65975	2.015	0.44454	D	0.997388	P;D	0.60160	0.842;0.987	P;P	0.55222	0.626;0.771	T	0.71185	-0.4667	10	0.66056	D	0.02	-9.1706	12.4944	0.55918	0.1385:0.0:0.8615:0.0	.	524;524	Q5W041-4;Q5W041	.;ARMC3_HUMAN	H	524;524;460;524;261	ENSP00000298032:D524H;ENSP00000386943:D524H;ENSP00000387288:D524H;ENSP00000365711:D261H	ENSP00000298032:D524H	D	+	1	0	ARMC3	23332188	1.000000	0.71417	0.978000	0.43139	0.993000	0.82548	4.386000	0.59620	0.677000	0.31305	0.563000	0.77884	GAT	.	.		0.358	ARMC3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047197.2	NM_173081	
CNNM1	26507	hgsc.bcm.edu	37	10	101120654	101120654	+	Missense_Mutation	SNP	T	T	C			TCGA-3K-AAZ8-01A-12D-A38X-10	TCGA-3K-AAZ8-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ca7f5e36-bbb3-44aa-b0c7-3f170a2bbc0f	c70e868a-ba0a-4b90-ad4d-d61ed7b34ecf	g.chr10:101120654T>C	ENST00000356713.4	+	3	2069	c.1780T>C	c.(1780-1782)Ttt>Ctt	p.F594L	CNNM1_ENST00000370528.3_Missense_Mutation_p.F523L|CNNM1_ENST00000446890.1_Missense_Mutation_p.F523L|CNNM1_ENST00000370534.4_Missense_Mutation_p.F229L	NM_020348.2	NP_065081.2	Q9NRU3	CNNM1_HUMAN	cyclin and CBS domain divalent metal cation transport mediator 1	594					ion transport (GO:0006811)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	adenyl nucleotide binding (GO:0030554)			NS(1)|breast(2)|endometrium(3)|kidney(1)|large_intestine(10)|lung(5)|ovary(1)|prostate(1)|skin(1)	25		Colorectal(252;0.234)		Epithelial(162;6.82e-10)|all cancers(201;5.62e-08)		CTTCTCCTTGTTTAAGCTTTC	0.547																																					p.F594L		Atlas-SNP	.											.	CNNM1	101	.	0			c.T1780C						.						136.0	134.0	134.0					10																	101120654		2203	4300	6503	SO:0001583	missense	26507	exon3			TCCTTGTTTAAGC	AF169226	CCDS7478.2	10q24.2	2014-08-08	2014-08-07		ENSG00000119946	ENSG00000119946			102	protein-coding gene	gene with protein product		607802	"""cyclin M1"""	ACDP1		21393841	Standard	NM_020348		Approved		uc001kpp.4	Q9NRU3	OTTHUMG00000018881	ENST00000356713.4:c.1780T>C	chr10.hg19:g.101120654T>C	ENSP00000349147:p.Phe594Leu	55.0	0.0		75.0	34.0	NM_020348	Q4QQG7|Q4QQH8|Q4QQP9|Q9NT45	Missense_Mutation	SNP	ENST00000356713.4	hg19	CCDS7478.2	.	.	.	.	.	.	.	.	.	.	T	33	5.233422	0.95207	.	.	ENSG00000119946	ENST00000356713;ENST00000446890;ENST00000370528;ENST00000370534;ENST00000545665	D;D;D;T	0.85629	-2.01;-1.97;-1.92;-0.87	5.74	4.59	0.56863	.	0.000000	0.85682	D	0.000000	D	0.92678	0.7673	M	0.87682	2.9	0.80722	D	1	P;D;D;B	0.89917	0.842;1.0;0.989;0.125	B;D;D;B	0.91635	0.265;0.999;0.956;0.168	D	0.92957	0.6385	10	0.62326	D	0.03	-19.0144	12.9964	0.58648	0.0:0.0:0.1351:0.8649	.	229;594;229;594	F5H5J0;Q9NRU3-2;B7Z5S3;Q9NRU3	.;.;.;CNNM1_HUMAN	L	594;523;523;229;47	ENSP00000349147:F594L;ENSP00000406492:F523L;ENSP00000359559:F523L;ENSP00000359565:F229L	ENSP00000349147:F594L	F	+	1	0	CNNM1	101110644	1.000000	0.71417	0.982000	0.44146	0.973000	0.67179	8.040000	0.89188	0.981000	0.38548	-0.313000	0.08912	TTT	.	.		0.547	CNNM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049792.2	NM_020348	
PCGF6	84108	hgsc.bcm.edu	37	10	105110554	105110554	+	Silent	SNP	C	C	T	rs375327410		TCGA-3K-AAZ8-01A-12D-A38X-10	TCGA-3K-AAZ8-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ca7f5e36-bbb3-44aa-b0c7-3f170a2bbc0f	c70e868a-ba0a-4b90-ad4d-d61ed7b34ecf	g.chr10:105110554C>T	ENST00000369847.3	-	1	337	c.270G>A	c.(268-270)ctG>ctA	p.L90L	PCGF6_ENST00000490296.1_5'UTR|PCGF6_ENST00000337211.4_Silent_p.L90L	NM_001011663.1	NP_001011663.1	Q9BYE7	PCGF6_HUMAN	polycomb group ring finger 6	90	Glu-rich.				negative regulation of transcription, DNA-templated (GO:0045892)	nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)	DNA binding (GO:0003677)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(3)	8		Colorectal(252;0.0747)|Breast(234;0.128)		Epithelial(162;2.57e-09)|all cancers(201;7.21e-08)|BRCA - Breast invasive adenocarcinoma(275;0.205)		cttcctcctccagctcctctt	0.642																																					p.L90L		Atlas-SNP	.											RNF134,right_lower_lobe,carcinoma,0,2	PCGF6	23	.	0			c.G270A						.	C	,	2,4382		0,2,2190	14.0	13.0	13.0		270,270	2.5	1.0	10		13	0,8596		0,0,4298	no	coding-synonymous,coding-synonymous	PCGF6	NM_001011663.1,NM_032154.3	,	0,2,6488	TT,TC,CC		0.0,0.0456,0.0154	,	90/351,90/276	105110554	2,12978	2192	4298	6490	SO:0001819	synonymous_variant	84108	exon1			CTCCTCCAGCTCC	AB047006	CCDS7546.1, CCDS31275.1	10q24.33	2013-01-09	2005-01-17	2005-01-19	ENSG00000156374	ENSG00000156374		"""RING-type (C3HC4) zinc fingers"", ""Polycomb group ring fingers"""	21156	protein-coding gene	gene with protein product		607816	"""ring finger protein 134"""	RNF134		12167161	Standard	NM_032154		Approved	MBLR	uc001kwt.3	Q9BYE7	OTTHUMG00000018982	ENST00000369847.3:c.270G>A	chr10.hg19:g.105110554C>T		76.0	0.0		74.0	8.0	NM_001011663	A8K3R4|Q5SYD1|Q5SYD6|Q96ID9|Q96SJ1	Silent	SNP	ENST00000369847.3	hg19	CCDS31275.1																																																																																			.	.		0.642	PCGF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050132.1	NM_032154	
DCHS1	8642	hgsc.bcm.edu	37	11	6643123	6643123	+	Missense_Mutation	SNP	C	C	G			TCGA-3K-AAZ8-01A-12D-A38X-10	TCGA-3K-AAZ8-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ca7f5e36-bbb3-44aa-b0c7-3f170a2bbc0f	c70e868a-ba0a-4b90-ad4d-d61ed7b34ecf	g.chr11:6643123C>G	ENST00000299441.3	-	21	10195	c.9784G>C	c.(9784-9786)Gct>Cct	p.A3262P	RP11-732A19.5_ENST00000526456.1_RNA|TPP1_ENST00000534644.1_5'Flank|TPP1_ENST00000299427.6_5'Flank|TPP1_ENST00000533371.1_5'Flank|TPP1_ENST00000528657.1_5'Flank|RP11-732A19.9_ENST00000545572.1_RNA	NM_003737.2	NP_003728.1	Q96JQ0	PCD16_HUMAN	dachsous cadherin-related 1	3262					branching involved in ureteric bud morphogenesis (GO:0001658)|calcium-dependent cell-cell adhesion (GO:0016339)|cochlea development (GO:0090102)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|neural tube development (GO:0021915)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|post-anal tail morphogenesis (GO:0036342)	apical part of cell (GO:0045177)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(16)|liver(1)|lung(41)|ovary(4)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	103		Medulloblastoma(188;0.00263)|all_neural(188;0.026)		Epithelial(150;6.35e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		GAGCGAGCAGCCAGAGGAGAC	0.627																																					p.A3262P		Atlas-SNP	.											.	DCHS1	277	.	0			c.G9784C						.						58.0	52.0	54.0					11																	6643123		2201	4296	6497	SO:0001583	missense	8642	exon21			GAGCAGCCAGAGG	AB000895	CCDS7771.1	11p15.4	2013-10-04	2013-10-04	2004-09-03	ENSG00000166341	ENSG00000166341		"""Cadherins / Cadherin-related"""	13681	protein-coding gene	gene with protein product	"""cadherin-related family member 6"""	603057	"""protocadherin 16"", ""dachsous 1 (Drosophila)"""	CDH25, PCDH16		9199196	Standard	XM_005253207		Approved	FIB1, KIAA1773, FLJ11790, CDHR6	uc001mem.1	Q96JQ0	OTTHUMG00000133398	ENST00000299441.3:c.9784G>C	chr11.hg19:g.6643123C>G	ENSP00000299441:p.Ala3262Pro	59.0	0.0		69.0	12.0	NM_003737	O15098	Missense_Mutation	SNP	ENST00000299441.3	hg19	CCDS7771.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	17.45|17.45	3.393418|3.393418	0.62066|0.62066	.|.	.|.	ENSG00000166341|ENSG00000166341	ENST00000299441|ENST00000442153	T|.	0.70282|.	-0.47|.	5.01|5.01	5.01|5.01	0.66863|0.66863	.|.	0.000000|.	0.42053|.	D|.	0.000772|.	T|T	0.79399|0.79399	0.4439|0.4439	M|M	0.83483|0.83483	2.645|2.645	0.58432|0.58432	D|D	0.999999|0.999999	P|.	0.42409|.	0.779|.	B|.	0.32149|.	0.141|.	T|T	0.82829|0.82829	-0.0264|-0.0264	10|6	0.66056|0.87932	D|D	0.02|0	.|.	17.0523|17.0523	0.86523|0.86523	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	3262|.	Q96JQ0|.	PCD16_HUMAN|.	P|C	3262|21	ENSP00000299441:A3262P|.	ENSP00000299441:A3262P|ENSP00000390601:W21C	A|W	-|-	1|3	0|0	DCHS1|DCHS1	6599699|6599699	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.992000|0.992000	0.81027|0.81027	7.611000|7.611000	0.82962|0.82962	2.595000|2.595000	0.87683|0.87683	0.462000|0.462000	0.41574|0.41574	GCT|TGG	.	.		0.627	DCHS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257258.1	NM_003737	
OR2AG1	144125	hgsc.bcm.edu	37	11	6806964	6806964	+	Silent	SNP	G	G	A			TCGA-3K-AAZ8-01A-12D-A38X-10	TCGA-3K-AAZ8-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ca7f5e36-bbb3-44aa-b0c7-3f170a2bbc0f	c70e868a-ba0a-4b90-ad4d-d61ed7b34ecf	g.chr11:6806964G>A	ENST00000307401.4	+	1	717	c.696G>A	c.(694-696)gaG>gaA	p.E232E		NM_001004489.2	NP_001004489.1	Q9H205	O2AG1_HUMAN	olfactory receptor, family 2, subfamily AG, member 1	232						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(2)|lung(13)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	26		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)		Epithelial(150;2.19e-08)|BRCA - Breast invasive adenocarcinoma(625;0.129)		CATCAAATGAGGGGAGGAAGA	0.488																																					p.E232E		Atlas-SNP	.											.	OR2AG1	57	.	0			c.G696A						.						192.0	168.0	176.0					11																	6806964		2201	4296	6497	SO:0001819	synonymous_variant	144125	exon1			AAATGAGGGGAGG	AB065823	CCDS31414.1	11p15.4	2012-08-09			ENSG00000170803	ENSG00000170803		"""GPCR / Class A : Olfactory receptors"""	15142	protein-coding gene	gene with protein product				OR2AG3			Standard	NM_001004489		Approved		uc001mer.2	Q9H205	OTTHUMG00000165735	ENST00000307401.4:c.696G>A	chr11.hg19:g.6806964G>A		84.0	0.0		67.0	31.0	NM_001004489	B9EKV7|Q6IFG7|Q96R26	Silent	SNP	ENST00000307401.4	hg19	CCDS31414.1																																																																																			.	.		0.488	OR2AG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385980.1	NM_001004489	
ROM1	6094	hgsc.bcm.edu	37	11	62381849	62381849	+	Missense_Mutation	SNP	C	C	G	rs374111556		TCGA-3K-AAZ8-01A-12D-A38X-10	TCGA-3K-AAZ8-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ca7f5e36-bbb3-44aa-b0c7-3f170a2bbc0f	c70e868a-ba0a-4b90-ad4d-d61ed7b34ecf	g.chr11:62381849C>G	ENST00000278833.3	+	2	1251	c.710C>G	c.(709-711)cCc>cGc	p.P237R	ROM1_ENST00000534093.1_Missense_Mutation_p.P28A|EML3_ENST00000394773.2_5'Flank|EML3_ENST00000278845.4_5'Flank|EML3_ENST00000494176.2_5'Flank|EML3_ENST00000529309.1_5'Flank	NM_000327.3	NP_000318	Q03395	ROM1_HUMAN	retinal outer segment membrane protein 1	237					camera-type eye photoreceptor cell differentiation (GO:0060219)|cell adhesion (GO:0007155)|regulation of gene expression (GO:0010468)|retina vasculature development in camera-type eye (GO:0061298)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|photoreceptor outer segment membrane (GO:0042622)				central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(2)|ovary(1)|skin(1)	8						TACGCCCACCCCCTGTTCGAT	0.602																																					p.P237R		Atlas-SNP	.											.	ROM1	32	.	0			c.C710G						.	C	ARG/PRO	1,4403	2.1+/-5.4	0,1,2201	102.0	99.0	100.0		710	5.1	1.0	11		100	0,8598		0,0,4299	no	missense	ROM1	NM_000327.3	103	0,1,6500	GG,GC,CC		0.0,0.0227,0.0077	probably-damaging	237/352	62381849	1,13001	2202	4299	6501	SO:0001583	missense	6094	exon2			CCCACCCCCTGTT	L07894	CCDS8024.1	11q13	2013-02-14				ENSG00000149489		"""Tetraspanins"""	10254	protein-coding gene	gene with protein product		180721				8504299	Standard	NM_000327		Approved	TSPAN23, ROM	uc001ntv.3	Q03395		ENST00000278833.3:c.710C>G	chr11.hg19:g.62381849C>G	ENSP00000278833:p.Pro237Arg	84.0	0.0		53.0	15.0	NM_000327	B2R978	Missense_Mutation	SNP	ENST00000278833.3	hg19	CCDS8024.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	16.83|16.83	3.232563|3.232563	0.58777|0.58777	2.27E-4|2.27E-4	0.0|0.0	ENSG00000149489|ENSG00000149489	ENST00000525801;ENST00000534093;ENST00000525947|ENST00000278833	.|T	.|0.78816	.|-1.21	5.05|5.05	5.05|5.05	0.67936|0.67936	.|Tetraspanin, EC2 domain (1);	0.224693|0.224693	0.39341|0.39341	N|N	0.001393|0.001393	T|T	0.81456|0.81456	0.4826|0.4826	L|L	0.44542|0.44542	1.39|1.39	0.35660|0.35660	D|D	0.812427|0.812427	.|D	.|0.65815	.|0.995	.|D	.|0.66497	.|0.944	D|D	0.84417|0.84417	0.0569|0.0569	7|10	0.87932|0.44086	D|T	0|0.13	-28.2708|-28.2708	11.3965|11.3965	0.49845|0.49845	0.1808:0.8191:0.0:0.0|0.1808:0.8191:0.0:0.0	.|.	.|237	.|Q03395	.|ROM1_HUMAN	A|R	28|237	.|ENSP00000278833:P237R	ENSP00000433566:P28A|ENSP00000278833:P237R	P|P	+|+	1|2	0|0	ROM1|ROM1	62138425|62138425	0.998000|0.998000	0.40836|0.40836	0.997000|0.997000	0.53966|0.53966	0.829000|0.829000	0.46940|0.46940	1.729000|1.729000	0.38115|0.38115	2.514000|2.514000	0.84764|0.84764	0.462000|0.462000	0.41574|0.41574	CCC|CCC	.	.		0.602	ROM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394929.1	NM_000327	
B3GAT3	26229	hgsc.bcm.edu	37	11	62389402	62389402	+	Silent	SNP	C	C	T			TCGA-3K-AAZ8-01A-12D-A38X-10	TCGA-3K-AAZ8-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ca7f5e36-bbb3-44aa-b0c7-3f170a2bbc0f	c70e868a-ba0a-4b90-ad4d-d61ed7b34ecf	g.chr11:62389402C>T	ENST00000265471.5	-	1	245	c.18G>A	c.(16-18)aaG>aaA	p.K6K	B3GAT3_ENST00000534026.1_Silent_p.K6K|B3GAT3_ENST00000531383.1_Silent_p.K6K	NM_012200.3	NP_036332.2	O94766	B3GA3_HUMAN	beta-1,3-glucuronyltransferase 3	6					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|chondroitin sulfate proteoglycan biosynthetic process (GO:0050650)|dermatan sulfate proteoglycan biosynthetic process (GO:0050651)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)|protein glycosylation (GO:0006486)|small molecule metabolic process (GO:0044281)	cis-Golgi network (GO:0005801)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	galactosylgalactosylxylosylprotein 3-beta-glucuronosyltransferase activity (GO:0015018)|glucuronosyltransferase activity (GO:0015020)|metal ion binding (GO:0046872)			endometrium(1)|kidney(1)|large_intestine(3)|lung(2)|ovary(2)|prostate(2)|urinary_tract(1)	12						GAAACACGTTCTTCAGCTTCA	0.726																																					p.K6K		Atlas-SNP	.											.	B3GAT3	24	.	0			c.G18A						.						48.0	43.0	45.0					11																	62389402		2202	4296	6498	SO:0001819	synonymous_variant	26229	exon1			CACGTTCTTCAGC	AB009598	CCDS8025.1	11q12	2014-07-08	2014-07-08		ENSG00000149541	ENSG00000149541	2.4.1.135	"""Beta-1,3-glucuronyltransferases"""	923	protein-coding gene	gene with protein product	"""glucuronosyltransferase I"", ""galactosylgalactosylxylosylprotein 3-beta-glucuronosyltransferase 3"""	606374	"""beta-1,3-glucuronyltransferase 3 (glucuronosyltransferase I)"""			9506957	Standard	NM_012200		Approved	GlcAT-I	uc001ntw.3	O94766	OTTHUMG00000167685	ENST00000265471.5:c.18G>A	chr11.hg19:g.62389402C>T		216.0	0.0		177.0	9.0	NM_012200	B7ZAB3|Q96I06|Q9UEP0	Silent	SNP	ENST00000265471.5	hg19	CCDS8025.1																																																																																			.	.		0.726	B3GAT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395588.1	NM_012200	
ACER3	55331	hgsc.bcm.edu	37	11	76727823	76727823	+	Splice_Site	SNP	G	G	C			TCGA-3K-AAZ8-01A-12D-A38X-10	TCGA-3K-AAZ8-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ca7f5e36-bbb3-44aa-b0c7-3f170a2bbc0f	c70e868a-ba0a-4b90-ad4d-d61ed7b34ecf	g.chr11:76727823G>C	ENST00000532485.1	+	9	808	c.704G>C	c.(703-705)aGt>aCt	p.S235T	ACER3_ENST00000526597.1_Splice_Site_p.S140T|ACER3_ENST00000533873.1_Splice_Site_p.S198T|ACER3_ENST00000544113.1_Splice_Site_p.S102T|ACER3_ENST00000538157.1_Splice_Site_p.S193T	NM_018367.5	NP_060837.3	Q9NUN7	ACER3_HUMAN	alkaline ceramidase 3	235					ceramide metabolic process (GO:0006672)|phytosphingosine biosynthetic process (GO:0071602)|positive regulation of cell proliferation (GO:0008284)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)|sphingosine biosynthetic process (GO:0046512)	endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of Golgi membrane (GO:0030173)	phytoceramidase activity (GO:0070774)			endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|prostate(1)	9						ATCCTTTTCAGGTAGGAAATA	0.323																																					p.S235T		Atlas-SNP	.											.	ACER3	19	.	0			c.G704C						.						134.0	113.0	120.0					11																	76727823		2200	4292	6492	SO:0001630	splice_region_variant	55331	exon9			TTTTCAGGTAGGA	AF214454	CCDS8247.1, CCDS73352.1	11q13.5	2013-01-25	2008-12-19	2008-12-19	ENSG00000078124	ENSG00000078124	3.5.1.23	"""Alkaline ceramidase"""	16066	protein-coding gene	gene with protein product	"""alkaline phytoceramidase"""		"""phytoceramidase, alkaline"""	PHCA		11356846, 18619555	Standard	XM_005274090		Approved	FLJ11238, APHC	uc009yum.1	Q9NUN7	OTTHUMG00000165225	ENST00000532485.1:c.704+1G>C	chr11.hg19:g.76727823G>C		82.0	0.0		66.0	19.0	NM_018367	B2RC99	Missense_Mutation	SNP	ENST00000532485.1	hg19	CCDS8247.1	.	.	.	.	.	.	.	.	.	.	G	15.95	2.985215	0.53934	.	.	ENSG00000078124	ENST00000534206;ENST00000532485;ENST00000526597;ENST00000533873;ENST00000538157;ENST00000544113	T;T;T;T;T;T	0.42513	0.97;0.97;0.97;0.97;0.97;0.97	5.26	5.26	0.73747	.	0.000000	0.85682	D	0.000000	T	0.41073	0.1143	L	0.55834	1.745	0.80722	D	1	B;B	0.29612	0.136;0.251	B;B	0.28709	0.054;0.093	T	0.27088	-1.0084	10	0.39692	T	0.17	-3.2967	16.3566	0.83237	0.0:0.0:1.0:0.0	.	198;235	B7Z2Q2;Q9NUN7	.;ACER3_HUMAN	T	193;235;140;198;193;102	ENSP00000435733:S193T;ENSP00000434480:S235T;ENSP00000431149:S140T;ENSP00000436252:S198T;ENSP00000440916:S193T;ENSP00000440663:S102T	ENSP00000431149:S140T	S	+	2	0	ACER3	76405471	1.000000	0.71417	1.000000	0.80357	0.954000	0.61252	7.737000	0.84957	2.446000	0.82766	0.555000	0.69702	AGT	.	.		0.323	ACER3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382770.2	NM_018367	Missense_Mutation
DSCAML1	57453	hgsc.bcm.edu	37	11	117374731	117374731	+	Missense_Mutation	SNP	C	C	T			TCGA-3K-AAZ8-01A-12D-A38X-10	TCGA-3K-AAZ8-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ca7f5e36-bbb3-44aa-b0c7-3f170a2bbc0f	c70e868a-ba0a-4b90-ad4d-d61ed7b34ecf	g.chr11:117374731C>T	ENST00000321322.6	-	11	2369	c.2368G>A	c.(2368-2370)Ggg>Agg	p.G790R	DSCAML1_ENST00000527706.1_Missense_Mutation_p.G520R	NM_020693.2	NP_065744.2	Q8TD84	DSCL1_HUMAN	Down syndrome cell adhesion molecule like 1	730	Ig-like C2-type 9.				axonogenesis (GO:0007409)|brain development (GO:0007420)|cell fate determination (GO:0001709)|central nervous system development (GO:0007417)|dendrite self-avoidance (GO:0070593)|dorsal/ventral pattern formation (GO:0009953)|embryonic skeletal system morphogenesis (GO:0048704)|homophilic cell adhesion (GO:0007156)|negative regulation of cell adhesion (GO:0007162)	cell surface (GO:0009986)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein homodimerization activity (GO:0042803)			breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(24)|lung(49)|ovary(6)|pancreas(1)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	110	all_hematologic(175;0.0487)	Breast(348;0.0424)|Medulloblastoma(222;0.0523)|all_hematologic(192;0.232)		BRCA - Breast invasive adenocarcinoma(274;9.12e-06)|Epithelial(105;0.00172)		TGGGGGTTCCCGCTCCCTGGA	0.632																																					p.G790R		Atlas-SNP	.											.	DSCAML1	286	.	0			c.G2368A						.						71.0	69.0	70.0					11																	117374731		2201	4296	6497	SO:0001583	missense	57453	exon11			GGTTCCCGCTCCC		CCDS8384.1	11q22.2-q22.3	2013-02-11			ENSG00000177103	ENSG00000177103		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	14656	protein-coding gene	gene with protein product		611782				11453658	Standard	NM_020693		Approved	KIAA1132	uc001prh.1	Q8TD84	OTTHUMG00000167071	ENST00000321322.6:c.2368G>A	chr11.hg19:g.117374731C>T	ENSP00000315465:p.Gly790Arg	72.0	0.0		56.0	13.0	NM_020693	Q76MU9|Q8IZY3|Q8IZY4|Q8WXU7|Q9ULT7	Missense_Mutation	SNP	ENST00000321322.6	hg19	CCDS8384.1	.	.	.	.	.	.	.	.	.	.	C	25.9	4.689871	0.88735	.	.	ENSG00000177103	ENST00000527706;ENST00000321322;ENST00000446508	T;T	0.66638	-0.22;-0.22	4.29	4.29	0.51040	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.65196	0.2668	N	0.05554	-0.025	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.65721	-0.6099	9	0.22109	T	0.4	.	16.9369	0.86205	0.0:1.0:0.0:0.0	.	730	Q8TD84	DSCL1_HUMAN	R	520;790;497	ENSP00000434335:G520R;ENSP00000315465:G790R	ENSP00000315465:G790R	G	-	1	0	DSCAML1	116879941	1.000000	0.71417	0.998000	0.56505	0.990000	0.78478	7.605000	0.82844	2.237000	0.73441	0.462000	0.41574	GGG	.	.		0.632	DSCAML1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392907.2	NM_020693	
OR8B4	283162	hgsc.bcm.edu	37	11	124294237	124294237	+	Silent	SNP	C	C	A			TCGA-3K-AAZ8-01A-12D-A38X-10	TCGA-3K-AAZ8-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ca7f5e36-bbb3-44aa-b0c7-3f170a2bbc0f	c70e868a-ba0a-4b90-ad4d-d61ed7b34ecf	g.chr11:124294237C>A	ENST00000356130.3	-	1	552	c.531G>T	c.(529-531)ctG>ctT	p.L177L		NM_001005196.1	NP_001005196.1	Q96RC9	OR8B4_HUMAN	olfactory receptor, family 8, subfamily B, member 4	177						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|large_intestine(7)|lung(15)|ovary(1)|skin(6)|stomach(1)|urinary_tract(1)	32		Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0279)		GAACGTCACACAGATAATGGT	0.507																																					p.L177L		Atlas-SNP	.											.	OR8B4	60	.	0			c.G531T						.						92.0	63.0	73.0					11																	124294237		2201	4299	6500	SO:0001819	synonymous_variant	283162	exon1			GTCACACAGATAA	AB065831	CCDS31710.1	11q24	2012-08-09		2001-06-29	ENSG00000198657	ENSG00000198657		"""GPCR / Class A : Olfactory receptors"""	8473	protein-coding gene	gene with protein product				OR8B4P			Standard	NM_001005196		Approved		uc010sak.2	Q96RC9	OTTHUMG00000165916	ENST00000356130.3:c.531G>T	chr11.hg19:g.124294237C>A		138.0	0.0		90.0	52.0	NM_001005196	B2RNF8|Q6IFQ7	Silent	SNP	ENST00000356130.3	hg19	CCDS31710.1																																																																																			.	.		0.507	OR8B4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387055.1	NM_001005196	
LEPREL2	10536	hgsc.bcm.edu	37	12	6946251	6946251	+	RNA	SNP	G	G	A			TCGA-3K-AAZ8-01A-12D-A38X-10	TCGA-3K-AAZ8-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ca7f5e36-bbb3-44aa-b0c7-3f170a2bbc0f	c70e868a-ba0a-4b90-ad4d-d61ed7b34ecf	g.chr12:6946251G>A	ENST00000538102.1	+	0	710				LEPREL2_ENST00000396725.2_RNA|LEPREL2_ENST00000606935.1_RNA|LEPREL2_ENST00000251761.8_RNA			Q8IVL6	P3H3_HUMAN	leprecan-like 2						extracellular matrix organization (GO:0030198)|negative regulation of cell proliferation (GO:0008285)	endoplasmic reticulum lumen (GO:0005788)	iron ion binding (GO:0005506)|L-ascorbic acid binding (GO:0031418)|procollagen-proline 3-dioxygenase activity (GO:0019797)			breast(1)|cervix(1)|endometrium(2)|lung(6)	10					L-Proline(DB00172)|Succinic acid(DB00139)|Vitamin C(DB00126)	GGCTGCGCAGGTGAGCACAGG	0.667																																					.		Atlas-SNP	.											.	LEPREL2	87	.	0			c.1559+1G>A						.						26.0	28.0	28.0					12																	6946251		1967	4153	6120			10536	exon10			GCGCAGGTGAGCA	U47926	CCDS61027.1	12p13.31	2014-03-25			ENSG00000110811	ENSG00000110811			19318	protein-coding gene	gene with protein product	"""prolyl 3-hydroxylase 3"""	610342				15063763	Standard	NM_014262		Approved	GRCB, HSU47926, P3H3		Q8IVL6	OTTHUMG00000168516		chr12.hg19:g.6946251G>A		23.0	0.0		15.0	12.0	NM_014262	Q13512|Q15740|Q66K32|Q6NX61|Q7L2T1	Splice_Site	SNP	ENST00000538102.1	hg19		.	.	.	.	.	.	.	.	.	.	G	16.82	3.229547	0.58777	.	.	ENSG00000110811	ENST00000396725;ENST00000290510	.	.	.	4.35	4.35	0.52113	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.0709	0.86573	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	LEPREL2	6816512	1.000000	0.71417	1.000000	0.80357	0.492000	0.33523	8.374000	0.90133	2.253000	0.74438	0.462000	0.41574	.	.	.		0.667	LEPREL2-006	KNOWN	basic	processed_transcript	polymorphic_pseudogene	OTTHUMT00000399998.1	NM_014262	
C12orf77	196415	hgsc.bcm.edu	37	12	25148920	25148920	+	Silent	SNP	T	T	A			TCGA-3K-AAZ8-01A-12D-A38X-10	TCGA-3K-AAZ8-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ca7f5e36-bbb3-44aa-b0c7-3f170a2bbc0f	c70e868a-ba0a-4b90-ad4d-d61ed7b34ecf	g.chr12:25148920T>A	ENST00000549828.1	-	3	432	c.228A>T	c.(226-228)cgA>cgT	p.R76R	C12orf77_ENST00000434912.3_Silent_p.R21R|C12orf77_ENST00000549262.1_Silent_p.R21R	NM_001101339.1	NP_001094809.1	C9JDV5	CL097_HUMAN	chromosome 12 open reading frame 77	76										endometrium(1)|kidney(1)|large_intestine(1)|lung(3)|prostate(1)	7						CAGGCATCCATCGTATGCTGT	0.502																																					p.R76R		Atlas-SNP	.											.	C12orf77	18	.	0			c.A228T						.						85.0	90.0	88.0					12																	25148920		1991	4157	6148	SO:0001819	synonymous_variant	196415	exon3			CATCCATCGTATG	BC046192	CCDS44846.1	12p12.1	2009-09-30			ENSG00000226397	ENSG00000226397			27282	protein-coding gene	gene with protein product						12477932	Standard	NM_001101339		Approved		uc001rgf.3	C9JDV5	OTTHUMG00000170185	ENST00000549828.1:c.228A>T	chr12.hg19:g.25148920T>A		134.0	0.0		143.0	75.0	NM_001101339		Silent	SNP	ENST00000549828.1	hg19	CCDS44846.1																																																																																			.	.		0.502	C12orf77-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407827.1	NM_001101339	
ARID2	196528	hgsc.bcm.edu	37	12	46231189	46231189	+	Nonsense_Mutation	SNP	T	T	G			TCGA-3K-AAZ8-01A-12D-A38X-10	TCGA-3K-AAZ8-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ca7f5e36-bbb3-44aa-b0c7-3f170a2bbc0f	c70e868a-ba0a-4b90-ad4d-d61ed7b34ecf	g.chr12:46231189T>G	ENST00000334344.6	+	9	1281	c.1109T>G	c.(1108-1110)tTa>tGa	p.L370*	ARID2_ENST00000444670.1_5'UTR|ARID2_ENST00000422737.1_Nonsense_Mutation_p.L221*|ARID2_ENST00000479608.1_3'UTR	NM_152641.2	NP_689854.2	Q68CP9	ARID2_HUMAN	AT rich interactive domain 2 (ARID, RFX-like)	370					chromatin modification (GO:0016568)|nucleosome disassembly (GO:0006337)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(3)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(21)|liver(20)|lung(34)|ovary(7)|pancreas(1)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	116	Lung SC(27;0.192)|Renal(347;0.236)	Lung NSC(34;0.106)|all_lung(34;0.22)	OV - Ovarian serous cystadenocarcinoma(5;0.00691)	GBM - Glioblastoma multiforme(48;0.0153)		GATAGATTTTTAAAGATGAGA	0.303			"""N, S, F"""		hepatocellular carcinoma																																p.L370X		Atlas-SNP	.		Rec	yes		12	12q12	196528	AT rich interactive domain 2		E	.	ARID2	311	.	0			c.T1109G						.						68.0	75.0	73.0					12																	46231189		2201	4297	6498	SO:0001587	stop_gained	196528	exon9			GATTTTTAAAGAT		CCDS31783.1	12q13.11	2013-02-07			ENSG00000189079	ENSG00000189079		"""-"""	18037	protein-coding gene	gene with protein product		609539					Standard	NM_152641		Approved	KIAA1557, DKFZp686G052, FLJ30619, BAF200	uc001ros.1	Q68CP9	OTTHUMG00000150487	ENST00000334344.6:c.1109T>G	chr12.hg19:g.46231189T>G	ENSP00000335044:p.Leu370*	131.0	0.0		105.0	53.0	NM_152641	Q15KG9|Q5EB51|Q645I3|Q6ZRY5|Q7Z3I5|Q86T28|Q96SJ6|Q9HCL5	Nonsense_Mutation	SNP	ENST00000334344.6	hg19	CCDS31783.1	.	.	.	.	.	.	.	.	.	.	T	39	7.866150	0.98534	.	.	ENSG00000189079	ENST00000334344;ENST00000422737	.	.	.	5.33	5.33	0.75918	.	0.072848	0.53938	D	0.000041	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.07644	T	0.81	-0.1393	15.3006	0.73949	0.0:0.0:0.0:1.0	.	.	.	.	X	370;221	.	ENSP00000335044:L370X	L	+	2	0	ARID2	44517456	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	7.698000	0.84413	2.011000	0.59026	0.260000	0.18958	TTA	.	.		0.303	ARID2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318380.2	XM_350875	
KMT2D	8085	hgsc.bcm.edu	37	12	49445845	49445845	+	Missense_Mutation	SNP	C	C	T			TCGA-3K-AAZ8-01A-12D-A38X-10	TCGA-3K-AAZ8-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ca7f5e36-bbb3-44aa-b0c7-3f170a2bbc0f	c70e868a-ba0a-4b90-ad4d-d61ed7b34ecf	g.chr12:49445845C>T	ENST00000301067.7	-	10	1620	c.1621G>A	c.(1621-1623)Gaa>Aaa	p.E541K		NM_003482.3	NP_003473.3	O14686	KMT2D_HUMAN	lysine (K)-specific methyltransferase 2D	541	15 X 5 AA repeats of S/P-P-P-E/P-E/A.|Pro-rich.				chromatin silencing (GO:0006342)|histone H3-K4 methylation (GO:0051568)|oocyte growth (GO:0001555)|oogenesis (GO:0048477)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to estrogen (GO:0043627)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)										GGCGATGCTTCAGGTGGTGGG	0.577																																					p.E541K		Atlas-SNP	.											.	MLL2	1173	.	0			c.G1621A						.						76.0	83.0	81.0					12																	49445845		2088	4209	6297	SO:0001583	missense	8085	exon10			ATGCTTCAGGTGG	AF010403	CCDS44873.1	12q13.12	2013-05-09	2013-05-09	2013-05-09	ENSG00000167548	ENSG00000167548		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7133	protein-coding gene	gene with protein product		602113	"""trinucleotide repeat containing 21"", ""myeloid/lymphoid or mixed-lineage leukemia 2"""	TNRC21, MLL2		9247308	Standard	NM_003482		Approved	ALR, MLL4, CAGL114		O14686	OTTHUMG00000166524	ENST00000301067.7:c.1621G>A	chr12.hg19:g.49445845C>T	ENSP00000301067:p.Glu541Lys	135.0	0.0		120.0	23.0	NM_003482	O14687	Missense_Mutation	SNP	ENST00000301067.7	hg19	CCDS44873.1	.	.	.	.	.	.	.	.	.	.	C	9.111	1.006505	0.19199	.	.	ENSG00000167548	ENST00000301067	T	0.80393	-1.37	3.69	2.8	0.32819	.	.	.	.	.	T	0.64000	0.2559	N	0.14661	0.345	0.21762	N	0.999559	B	0.02656	0.0	B	0.01281	0.0	T	0.56396	-0.7986	9	0.87932	D	0	.	5.8266	0.18556	0.0:0.7639:0.0:0.2361	.	541	O14686	MLL2_HUMAN	K	541	ENSP00000301067:E541K	ENSP00000301067:E541K	E	-	1	0	MLL2	47732112	0.000000	0.05858	0.986000	0.45419	0.844000	0.47949	-0.211000	0.09332	1.142000	0.42291	0.313000	0.20887	GAA	.	.		0.577	KMT2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390183.2		
LRP1	4035	hgsc.bcm.edu	37	12	57562953	57562953	+	Missense_Mutation	SNP	C	C	A			TCGA-3K-AAZ8-01A-12D-A38X-10	TCGA-3K-AAZ8-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ca7f5e36-bbb3-44aa-b0c7-3f170a2bbc0f	c70e868a-ba0a-4b90-ad4d-d61ed7b34ecf	g.chr12:57562953C>A	ENST00000243077.3	+	20	3492	c.3026C>A	c.(3025-3027)gCc>gAc	p.A1009D	LRP1_ENST00000553446.1_3'UTR	NM_002332.2	NP_002323.2	Q07954	LRP1_HUMAN	low density lipoprotein receptor-related protein 1	1009	LDL-receptor class A 6. {ECO:0000255|PROSITE-ProRule:PRU00124}.				aging (GO:0007568)|aorta morphogenesis (GO:0035909)|apoptotic cell clearance (GO:0043277)|beta-amyloid clearance (GO:0097242)|cell proliferation (GO:0008283)|cholesterol metabolic process (GO:0008203)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of platelet-derived growth factor receptor-beta signaling pathway (GO:2000587)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of Wnt signaling pathway (GO:0030178)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of lipid transport (GO:0032370)|positive regulation of protein transport (GO:0051222)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|receptor-mediated endocytosis (GO:0006898)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cholesterol transport (GO:0032374)|regulation of phospholipase A2 activity (GO:0032429)|retinoid metabolic process (GO:0001523)	clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|endosome (GO:0005768)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	apolipoprotein binding (GO:0034185)|calcium ion binding (GO:0005509)|lipoprotein particle receptor binding (GO:0070325)|lipoprotein transporter activity (GO:0042954)|poly(A) RNA binding (GO:0044822)|protein complex binding (GO:0032403)|receptor activity (GO:0004872)			NS(1)|breast(9)|central_nervous_system(3)|cervix(3)|endometrium(33)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(26)|lung(58)|ovary(10)|pancreas(2)|prostate(11)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	184				BRCA - Breast invasive adenocarcinoma(357;0.0103)	Antihemophilic Factor(DB00025)|Coagulation Factor IX(DB00100)|Tenecteplase(DB00031)	AGTGACGAAGCCGGCTGCAGC	0.607																																					p.A1009D		Atlas-SNP	.											.	LRP1	428	.	0			c.C3026A						.						71.0	66.0	68.0					12																	57562953		2203	4300	6503	SO:0001583	missense	4035	exon20			ACGAAGCCGGCTG	X13916	CCDS8932.1	12q13.3	2013-05-28	2010-01-26		ENSG00000123384	ENSG00000123384		"""CD molecules"", ""Low density lipoprotein receptors"""	6692	protein-coding gene	gene with protein product		107770	"""alpha-2-macroglobulin receptor"""	APR, A2MR		2548950	Standard	NM_002332		Approved	LRP, CD91, LRP1A, APOER	uc001snd.3	Q07954	OTTHUMG00000044412	ENST00000243077.3:c.3026C>A	chr12.hg19:g.57562953C>A	ENSP00000243077:p.Ala1009Asp	57.0	0.0		65.0	41.0	NM_002332	Q2PP12|Q86SW0|Q8IVG8	Missense_Mutation	SNP	ENST00000243077.3	hg19	CCDS8932.1	.	.	.	.	.	.	.	.	.	.	C	20.1	3.936664	0.73442	.	.	ENSG00000123384	ENST00000243077	D	0.95482	-3.72	4.97	4.08	0.47627	Low-density lipoprotein (LDL) receptor class A, conserved site (1);	0.161263	0.39544	N	0.001332	D	0.88908	0.6565	N	0.25789	0.76	0.80722	D	1	B	0.15719	0.014	B	0.16289	0.015	T	0.81477	-0.0915	10	0.12103	T	0.63	.	7.4899	0.27456	0.1647:0.7496:0.0:0.0857	.	1009	Q07954	LRP1_HUMAN	D	1009	ENSP00000243077:A1009D	ENSP00000243077:A1009D	A	+	2	0	LRP1	55849220	0.670000	0.27512	0.950000	0.38849	0.991000	0.79684	1.145000	0.31577	1.336000	0.45506	0.561000	0.74099	GCC	.	.		0.607	LRP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412772.2	NM_002332	
P2RX7	5027	hgsc.bcm.edu	37	12	121622253	121622253	+	Missense_Mutation	SNP	G	G	A			TCGA-3K-AAZ8-01A-12D-A38X-10	TCGA-3K-AAZ8-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ca7f5e36-bbb3-44aa-b0c7-3f170a2bbc0f	c70e868a-ba0a-4b90-ad4d-d61ed7b34ecf	g.chr12:121622253G>A	ENST00000546057.1	+	13	1579	c.1436G>A	c.(1435-1437)tGt>tAt	p.C479Y	P2RX7_ENST00000328963.5_Missense_Mutation_p.C309Y|P2RX7_ENST00000541446.1_Missense_Mutation_p.C190Y|P2RX7_ENST00000443520.3_3'UTR|P2RX7_ENST00000535250.1_Missense_Mutation_p.C389Y	NM_002562.5	NP_002553	Q99572	P2RX7_HUMAN	purinergic receptor P2X, ligand-gated ion channel, 7	479					apoptotic signaling pathway (GO:0097190)|bleb assembly (GO:0032060)|cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|cell surface receptor signaling pathway (GO:0007166)|innate immune response (GO:0045087)|membrane depolarization (GO:0051899)|negative regulation of bone resorption (GO:0045779)|negative regulation of MAPK cascade (GO:0043409)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|pore complex assembly (GO:0046931)|positive regulation of bone mineralization (GO:0030501)|positive regulation of calcium ion transport into cytosol (GO:0010524)|positive regulation of cytolysis (GO:0045919)|positive regulation of cytoskeleton organization (GO:0051495)|positive regulation of interleukin-1 beta secretion (GO:0050718)|purinergic nucleotide receptor signaling pathway (GO:0035590)|regulation of killing of cells of other organism (GO:0051709)|regulation of sodium ion transport (GO:0002028)|response to ATP (GO:0033198)|sensory perception of pain (GO:0019233)	bleb (GO:0032059)|cytoplasm (GO:0005737)|integral component of nuclear inner membrane (GO:0005639)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|extracellular ATP-gated cation channel activity (GO:0004931)|lipopolysaccharide binding (GO:0001530)|protein homodimerization activity (GO:0042803)|purinergic nucleotide receptor activity (GO:0001614)|receptor binding (GO:0005102)			NS(1)|breast(1)|endometrium(1)|large_intestine(5)|lung(9)|skin(1)|stomach(1)	19	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)					TGGTGCCAGTGTGGAAGCTGC	0.602																																					p.C479Y		Atlas-SNP	.											.	P2RX7	53	.	0			c.G1436A						.						60.0	56.0	57.0					12																	121622253		2203	4300	6503	SO:0001583	missense	5027	exon13			GCCAGTGTGGAAG	Y09561	CCDS9213.1	12q24	2012-01-17			ENSG00000089041	ENSG00000089041		"""Purinergic receptors"", ""Ligand-gated ion channels / Purinergic receptors, ionotropic"""	8537	protein-coding gene	gene with protein product		602566				9038151, 9826911	Standard	NM_002562		Approved	P2X7, MGC20089	uc001tzm.3	Q99572	OTTHUMG00000169153	ENST00000546057.1:c.1436G>A	chr12.hg19:g.121622253G>A	ENSP00000442349:p.Cys479Tyr	52.0	0.0		70.0	11.0	NM_002562	A8K2Z0|E7EMK6|F5H6P2|F5H7E8|F8W951|O14991|Q4VKH8|Q4VKH9|Q4VKI0|Q4VKI1|Q4VKI2|Q4VKI3|Q4VKI4|Q7Z771|Q96EV7	Missense_Mutation	SNP	ENST00000546057.1	hg19	CCDS9213.1	.	.	.	.	.	.	.	.	.	.	G	17.80	3.478629	0.63849	.	.	ENSG00000089041	ENST00000546057;ENST00000328963;ENST00000535250;ENST00000541446	T;T;T;T	0.37411	2.48;1.84;2.21;1.2	5.21	5.21	0.72293	.	0.000000	0.49305	D	0.000151	T	0.64616	0.2614	M	0.85197	2.74	0.50171	D	0.999858	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.998;0.999;0.999	T	0.70813	-0.4770	10	0.87932	D	0	.	15.4642	0.75387	0.0:0.0:1.0:0.0	.	309;190;389;479	F8W951;F5H6P2;F5H7E8;Q99572	.;.;.;P2RX7_HUMAN	Y	479;309;389;190	ENSP00000442349:C479Y;ENSP00000330696:C309Y;ENSP00000442572:C389Y;ENSP00000437471:C190Y	ENSP00000330696:C309Y	C	+	2	0	P2RX7	120106636	1.000000	0.71417	0.976000	0.42696	0.539000	0.34962	6.856000	0.75450	2.429000	0.82318	0.591000	0.81541	TGT	.	.		0.602	P2RX7-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402532.1	NM_002562	
KNTC1	9735	hgsc.bcm.edu	37	12	123057714	123057714	+	Missense_Mutation	SNP	G	G	C			TCGA-3K-AAZ8-01A-12D-A38X-10	TCGA-3K-AAZ8-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ca7f5e36-bbb3-44aa-b0c7-3f170a2bbc0f	c70e868a-ba0a-4b90-ad4d-d61ed7b34ecf	g.chr12:123057714G>C	ENST00000333479.7	+	26	2342	c.2165G>C	c.(2164-2166)cGa>cCa	p.R722P	KNTC1_ENST00000450485.2_Missense_Mutation_p.R685P	NM_014708.4	NP_055523.1	P50748	KNTC1_HUMAN	kinetochore associated 1	722					mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|mitotic nuclear division (GO:0007067)|protein complex assembly (GO:0006461)|regulation of exit from mitosis (GO:0007096)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|kinetochore microtubule (GO:0005828)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|spindle pole (GO:0000922)				breast(1)|central_nervous_system(1)|cervix(2)|endometrium(12)|kidney(8)|large_intestine(12)|lung(20)|ovary(7)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(4)	72	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;7.21e-05)|Epithelial(86;0.000178)|BRCA - Breast invasive adenocarcinoma(302;0.217)		ATAGTGTTCCGAATGTTTGAT	0.378																																					p.R722P		Atlas-SNP	.											KNTC1,NS,carcinoma,0,1	KNTC1	182	.	0			c.G2165C						.						122.0	119.0	120.0					12																	123057714		1844	4085	5929	SO:0001583	missense	9735	exon26			TGTTCCGAATGTT		CCDS45002.1	12q24.31	2013-01-17			ENSG00000184445	ENSG00000184445			17255	protein-coding gene	gene with protein product	"""rough deal homolog (Drosophila)"""	607363				11146660, 11590237	Standard	NM_014708		Approved	KIAA0166, ROD	uc001ucv.3	P50748	OTTHUMG00000168861	ENST00000333479.7:c.2165G>C	chr12.hg19:g.123057714G>C	ENSP00000328236:p.Arg722Pro	155.0	0.0		143.0	34.0	NM_014708	A7E2C4|B3KSG2	Missense_Mutation	SNP	ENST00000333479.7	hg19	CCDS45002.1	.	.	.	.	.	.	.	.	.	.	G	15.75	2.925374	0.52759	.	.	ENSG00000184445	ENST00000450485;ENST00000333479	T;T	0.25749	1.78;2.3	5.45	5.45	0.79879	.	0.132610	0.53938	D	0.000056	T	0.48943	0.1528	L	0.60455	1.87	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.77557	0.99;0.957	T	0.27331	-1.0077	10	0.35671	T	0.21	-9.528	19.2801	0.94050	0.0:0.0:1.0:0.0	.	685;722	E7ES84;P50748	.;KNTC1_HUMAN	P	685;722	ENSP00000397992:R685P;ENSP00000328236:R722P	ENSP00000328236:R722P	R	+	2	0	KNTC1	121623667	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.320000	0.65841	2.570000	0.86706	0.655000	0.94253	CGA	.	.		0.378	KNTC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396110.2		
FOXO1	2308	hgsc.bcm.edu	37	13	41134803	41134803	+	Silent	SNP	T	T	C			TCGA-3K-AAZ8-01A-12D-A38X-10	TCGA-3K-AAZ8-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ca7f5e36-bbb3-44aa-b0c7-3f170a2bbc0f	c70e868a-ba0a-4b90-ad4d-d61ed7b34ecf	g.chr13:41134803T>C	ENST00000379561.5	-	2	1209	c.825A>G	c.(823-825)gcA>gcG	p.A275A	FOXO1_ENST00000473775.1_5'Flank	NM_002015.3	NP_002006.2	Q12778	FOXO1_HUMAN	forkhead box O1	275					apoptotic process (GO:0006915)|autophagy (GO:0006914)|blood vessel development (GO:0001568)|cellular glucose homeostasis (GO:0001678)|cellular response to cold (GO:0070417)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to hyperoxia (GO:0071455)|cellular response to insulin stimulus (GO:0032869)|cellular response to nitric oxide (GO:0071732)|cellular response to oxidative stress (GO:0034599)|cellular response to starvation (GO:0009267)|endocrine pancreas development (GO:0031018)|epidermal growth factor receptor signaling pathway (GO:0007173)|fat cell differentiation (GO:0045444)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|negative regulation of apoptotic process (GO:0043066)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of stress-activated MAPK cascade (GO:0032873)|negative regulation of transcription, DNA-templated (GO:0045892)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of apoptotic process (GO:0043065)|positive regulation of autophagy (GO:0010508)|positive regulation of gluconeogenesis (GO:0045722)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein acetylation (GO:0006473)|regulation of cell proliferation (GO:0042127)|regulation of energy homeostasis (GO:2000505)|regulation of gluconeogenesis by regulation of transcription from RNA polymerase II promoter (GO:0035947)|temperature homeostasis (GO:0001659)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|protein phosphatase 2A binding (GO:0051721)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|sequence-specific DNA binding (GO:0043565)|transcription factor binding transcription factor activity (GO:0000989)|ubiquitin protein ligase binding (GO:0031625)		PAX7/FOXO1(197)|PAX3/FOXO1(749)	central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(7)|kidney(1)|large_intestine(2)|lung(2)|upper_aerodigestive_tract(1)	20		Lung NSC(96;1.18e-05)|Breast(139;0.00394)|Prostate(109;0.0181)|Lung SC(185;0.0262)|Hepatocellular(188;0.194)		all cancers(112;7.32e-09)|Epithelial(112;2.87e-06)|OV - Ovarian serous cystadenocarcinoma(117;6.98e-05)|GBM - Glioblastoma multiforme(144;0.00394)|BRCA - Breast invasive adenocarcinoma(63;0.0815)		ACTGGAGAGATGCTTTCTTCT	0.527																																					p.A275A		Atlas-SNP	.											.	FOXO1	110	.	0			c.A825G						.						88.0	81.0	84.0					13																	41134803		2203	4300	6503	SO:0001819	synonymous_variant	2308	exon2			GAGAGATGCTTTC		CCDS9371.1	13q14.1	2011-08-01	2007-05-02	2007-05-02	ENSG00000150907	ENSG00000150907		"""Forkhead boxes"""	3819	protein-coding gene	gene with protein product		136533	"""forkhead homolog in rhabdomyosarcoma"""	FKHR, FOXO1A		8275086, 15057823	Standard	NM_002015		Approved	FKH1	uc001uxl.4	Q12778	OTTHUMG00000016775	ENST00000379561.5:c.825A>G	chr13.hg19:g.41134803T>C		129.0	0.0		101.0	25.0	NM_002015	O43523|Q5VYC7|Q6NSK6	Silent	SNP	ENST00000379561.5	hg19	CCDS9371.1																																																																																			.	.		0.527	FOXO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044634.3	NM_002015	
PCDH20	64881	hgsc.bcm.edu	37	13	61985776	61985776	+	Missense_Mutation	SNP	C	C	T			TCGA-3K-AAZ8-01A-12D-A38X-10	TCGA-3K-AAZ8-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ca7f5e36-bbb3-44aa-b0c7-3f170a2bbc0f	c70e868a-ba0a-4b90-ad4d-d61ed7b34ecf	g.chr13:61985776C>T	ENST00000409186.1	-	5	4561	c.2456G>A	c.(2455-2457)cGc>cAc	p.R819H	PCDH20_ENST00000409204.4_Missense_Mutation_p.R819H			Q8N6Y1	PCD20_HUMAN	protocadherin 20	819	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)			breast(3)|central_nervous_system(2)|endometrium(3)|kidney(4)|large_intestine(14)|liver(1)|lung(23)|ovary(5)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	58		Breast(118;0.195)|Prostate(109;0.229)		GBM - Glioblastoma multiforme(99;0.000118)		CACCAGTAAGCGATGGAGCCC	0.478																																					p.R819H		Atlas-SNP	.											.	PCDH20	265	.	0			c.G2456A						.						132.0	123.0	126.0					13																	61985776		2203	4300	6503	SO:0001583	missense	64881	exon2			AGTAAGCGATGGA	AF169693	CCDS9442.2	13q21	2010-01-26			ENSG00000197991	ENSG00000197991		"""Cadherins / Protocadherins : Non-clustered"""	14257	protein-coding gene	gene with protein product		614449					Standard	NM_022843		Approved	PCDH13, FLJ22218	uc001vid.4	Q8N6Y1	OTTHUMG00000017012	ENST00000409186.1:c.2456G>A	chr13.hg19:g.61985776C>T	ENSP00000386653:p.Arg819His	98.0	0.0		85.0	14.0	NM_022843	A8K1K9|B1AQU2|Q8NDN4|Q9NRT9	Missense_Mutation	SNP	ENST00000409186.1	hg19	CCDS9442.2	.	.	.	.	.	.	.	.	.	.	C	20.9	4.067874	0.76301	.	.	ENSG00000197991	ENST00000409204;ENST00000409186;ENST00000358674	T;T	0.51817	0.69;0.69	5.83	5.83	0.93111	.	0.000000	0.64402	D	0.000006	T	0.48466	0.1501	L	0.58101	1.795	0.58432	D	0.999998	B	0.31383	0.321	B	0.25405	0.06	T	0.50065	-0.8871	10	0.87932	D	0	.	20.1338	0.98010	0.0:1.0:0.0:0.0	.	819	A8K1K9	.	H	819;819;565	ENSP00000387250:R819H;ENSP00000386653:R819H	ENSP00000351500:R565H	R	-	2	0	PCDH20	60883777	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.745000	0.85046	2.770000	0.95276	0.655000	0.94253	CGC	.	.		0.478	PCDH20-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333054.2	NM_022843	
PRKCH	5583	hgsc.bcm.edu	37	14	61924300	61924300	+	Missense_Mutation	SNP	A	A	T			TCGA-3K-AAZ8-01A-12D-A38X-10	TCGA-3K-AAZ8-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ca7f5e36-bbb3-44aa-b0c7-3f170a2bbc0f	c70e868a-ba0a-4b90-ad4d-d61ed7b34ecf	g.chr14:61924300A>T	ENST00000332981.5	+	9	1566	c.1181A>T	c.(1180-1182)gAt>gTt	p.D394V	PRKCH_ENST00000555082.1_Missense_Mutation_p.D233V	NM_006255.3	NP_006246.2	P24723	KPCL_HUMAN	protein kinase C, eta	394	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				blood coagulation (GO:0007596)|negative regulation of glial cell apoptotic process (GO:0034351)|platelet activation (GO:0030168)|positive regulation of B cell receptor signaling pathway (GO:0050861)|positive regulation of glial cell proliferation (GO:0060252)|positive regulation of keratinocyte differentiation (GO:0045618)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein kinase C signaling (GO:0070528)|protein phosphorylation (GO:0006468)|regulation of tight junction assembly (GO:2000810)|signal transduction (GO:0007165)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium-independent protein kinase C activity (GO:0004699)|enzyme binding (GO:0019899)|metal ion binding (GO:0046872)|protein kinase C activity (GO:0004697)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|lung(4)|ovary(2)|pancreas(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	25				OV - Ovarian serous cystadenocarcinoma(108;0.045)|BRCA - Breast invasive adenocarcinoma(234;0.0906)|KIRC - Kidney renal clear cell carcinoma(182;0.182)		ATTCTGCAGGATGATGATGTG	0.502																																					p.D394V	Melanoma(135;863 1779 8064 14443 26348)	Atlas-SNP	.											.	PRKCH	89	.	0			c.A1181T						.						266.0	247.0	253.0					14																	61924300		2203	4300	6503	SO:0001583	missense	5583	exon9			TGCAGGATGATGA	M55284	CCDS9752.1	14q23.1	2009-07-10			ENSG00000027075	ENSG00000027075	2.7.11.1		9403	protein-coding gene	gene with protein product		605437		PRKCL		1986216, 1545821	Standard	NM_006255		Approved	PKC-L, PKCL	uc001xfn.3	P24723	OTTHUMG00000152341	ENST00000332981.5:c.1181A>T	chr14.hg19:g.61924300A>T	ENSP00000329127:p.Asp394Val	98.0	0.0		109.0	44.0	NM_006255	B4DJN5|Q16246|Q8NE03	Missense_Mutation	SNP	ENST00000332981.5	hg19	CCDS9752.1	.	.	.	.	.	.	.	.	.	.	A	26.1	4.701013	0.88924	.	.	ENSG00000027075	ENST00000332981;ENST00000555082	T;T	0.65549	-0.16;-0.16	5.74	5.74	0.90152	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.64402	D	0.000002	T	0.70334	0.3212	L	0.31526	0.94	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	T	0.74112	-0.3770	10	0.87932	D	0	.	16.0499	0.80749	1.0:0.0:0.0:0.0	.	394	P24723	KPCL_HUMAN	V	394;233	ENSP00000329127:D394V;ENSP00000450981:D233V	ENSP00000329127:D394V	D	+	2	0	PRKCH	60994053	1.000000	0.71417	0.942000	0.38095	0.890000	0.51754	9.339000	0.96797	2.193000	0.70182	0.533000	0.62120	GAT	.	.		0.502	PRKCH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276974.2	NM_006255	
KCNH5	27133	hgsc.bcm.edu	37	14	63246590	63246590	+	Silent	SNP	A	A	G			TCGA-3K-AAZ8-01A-12D-A38X-10	TCGA-3K-AAZ8-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ca7f5e36-bbb3-44aa-b0c7-3f170a2bbc0f	c70e868a-ba0a-4b90-ad4d-d61ed7b34ecf	g.chr14:63246590A>G	ENST00000322893.7	-	10	2143	c.1875T>C	c.(1873-1875)caT>caC	p.H625H	KCNH5_ENST00000394968.1_Silent_p.H567H|KCNH5_ENST00000420622.2_Intron	NM_139318.3	NP_647479.2	Q8NCM2	KCNH5_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 5	625					potassium ion transmembrane transport (GO:0071805)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	phosphorelay sensor kinase activity (GO:0000155)|voltage-gated potassium channel activity (GO:0005249)			NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(33)|ovary(5)|prostate(2)|skin(17)|upper_aerodigestive_tract(4)|urinary_tract(2)	99				OV - Ovarian serous cystadenocarcinoma(108;0.00958)|BRCA - Breast invasive adenocarcinoma(234;0.168)		TCGCACATGCATGGGCAAGGG	0.443																																					p.H625H		Atlas-SNP	.											.	KCNH5	320	.	0			c.T1875C						.						102.0	89.0	94.0					14																	63246590		2203	4300	6503	SO:0001819	synonymous_variant	27133	exon10			ACATGCATGGGCA	U69185	CCDS9756.1, CCDS45122.1	14q23.1	2012-07-05			ENSG00000140015	ENSG00000140015		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6254	protein-coding gene	gene with protein product		605716				9738473, 16382104	Standard	NM_139318		Approved	Kv10.2, H-EAG2, eag2	uc001xfx.3	Q8NCM2	OTTHUMG00000029041	ENST00000322893.7:c.1875T>C	chr14.hg19:g.63246590A>G		155.0	0.0		152.0	74.0	NM_139318	C9JP98	Silent	SNP	ENST00000322893.7	hg19	CCDS9756.1																																																																																			.	.		0.443	KCNH5-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411747.1	NM_139318	
MLH3	27030	hgsc.bcm.edu	37	14	75514207	75514207	+	Missense_Mutation	SNP	G	G	C			TCGA-3K-AAZ8-01A-12D-A38X-10	TCGA-3K-AAZ8-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ca7f5e36-bbb3-44aa-b0c7-3f170a2bbc0f	c70e868a-ba0a-4b90-ad4d-d61ed7b34ecf	g.chr14:75514207G>C	ENST00000556740.1	-	1	2187	c.2152C>G	c.(2152-2154)Ccc>Gcc	p.P718A	MLH3_ENST00000355774.2_Missense_Mutation_p.P718A|MLH3_ENST00000556257.1_Missense_Mutation_p.P718A|MLH3_ENST00000544985.1_5'Flank|MLH3_ENST00000555671.1_5'Flank|MLH3_ENST00000238662.7_Missense_Mutation_p.P718A|MLH3_ENST00000380968.2_5'UTR			Q9UHC1	MLH3_HUMAN	mutL homolog 3	718					ATP catabolic process (GO:0006200)|female meiosis I (GO:0007144)|male meiosis (GO:0007140)|mismatch repair (GO:0006298)|protein localization (GO:0008104)|reciprocal meiotic recombination (GO:0007131)|synaptonemal complex assembly (GO:0007130)	chiasma (GO:0005712)|male germ cell nucleus (GO:0001673)|mismatch repair complex (GO:0032300)|nucleus (GO:0005634)|synaptonemal complex (GO:0000795)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|centromeric DNA binding (GO:0019237)|chromatin binding (GO:0003682)|mismatched DNA binding (GO:0030983)|satellite DNA binding (GO:0003696)|single-stranded DNA binding (GO:0003697)			breast(5)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(1)|lung(16)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	44				BRCA - Breast invasive adenocarcinoma(234;0.00688)		CTATACCAGGGGAAAGAGGGG	0.378								Mismatch excision repair (MMR)																													p.P718A		Atlas-SNP	.											.	MLH3	200	.	0			c.C2152G						.						84.0	86.0	85.0					14																	75514207		2203	4300	6503	SO:0001583	missense	27030	exon2			ACCAGGGGAAAGA	AF195657	CCDS9837.1, CCDS32123.1	14q24.3	2014-09-17	2013-09-12			ENSG00000119684			7128	protein-coding gene	gene with protein product		604395	"""mutL (E. coli) homolog 3"", ""mutL homolog 3 (E. coli)"""			10615123	Standard	XR_245681		Approved		uc001xrd.1	Q9UHC1		ENST00000556740.1:c.2152C>G	chr14.hg19:g.75514207G>C	ENSP00000452316:p.Pro718Ala	108.0	0.0		119.0	31.0	NM_014381	P49751|Q56DK9|Q9P292|Q9UHC0	Missense_Mutation	SNP	ENST00000556740.1	hg19	CCDS32123.1	.	.	.	.	.	.	.	.	.	.	G	6.981	0.551106	0.13374	.	.	ENSG00000119684	ENST00000355774;ENST00000238662;ENST00000556257;ENST00000556740	T;T;T;T	0.32753	1.44;1.44;1.44;1.44	3.56	2.62	0.31277	.	0.403671	0.24145	N	0.041125	T	0.30103	0.0754	L	0.59436	1.845	0.09310	N	1	P;P	0.47841	0.901;0.657	B;B	0.42030	0.373;0.197	T	0.12734	-1.0536	10	0.56958	D	0.05	-0.4652	10.7352	0.46120	0.0:0.3741:0.6259:0.0	.	718;718	Q9UHC1-2;Q9UHC1	.;MLH3_HUMAN	A	718	ENSP00000348020:P718A;ENSP00000238662:P718A;ENSP00000451540:P718A;ENSP00000452316:P718A	ENSP00000238662:P718A	P	-	1	0	MLH3	74583960	0.523000	0.26274	0.018000	0.16275	0.122000	0.20287	0.848000	0.27710	0.419000	0.25927	0.655000	0.94253	CCC	.	.		0.378	MLH3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415006.1	NM_014381	
AHNAK2	113146	hgsc.bcm.edu	37	14	105416987	105416987	+	Missense_Mutation	SNP	G	G	C	rs547264247	byFrequency	TCGA-3K-AAZ8-01A-12D-A38X-10	TCGA-3K-AAZ8-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ca7f5e36-bbb3-44aa-b0c7-3f170a2bbc0f	c70e868a-ba0a-4b90-ad4d-d61ed7b34ecf	g.chr14:105416987G>C	ENST00000333244.5	-	7	4920	c.4801C>G	c.(4801-4803)Ccc>Gcc	p.P1601A	AHNAK2_ENST00000557457.1_Intron	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	1601						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)				cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			TCCAGCTTGGGGCCCTTAACA	0.597													.|||	9	0.00179712	0.0045	0.0	5008	,	,		15394	0.0		0.0	False		,,,				2504	0.0031				p.P1601A		Atlas-SNP	.											AHNAK2_ENST00000333244,NS,carcinoma,0,1	AHNAK2	719	.	0			c.C4801G						.						102.0	114.0	110.0					14																	105416987		1802	4024	5826	SO:0001583	missense	113146	exon7			GCTTGGGGCCCTT	AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.4801C>G	chr14.hg19:g.105416987G>C	ENSP00000353114:p.Pro1601Ala	102.0	2.0		103.0	7.0	NM_138420	Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Missense_Mutation	SNP	ENST00000333244.5	hg19	CCDS45177.1	.	.	.	.	.	.	.	.	.	.	g	10.98	1.503413	0.26949	.	.	ENSG00000185567	ENST00000333244	T	0.02812	4.15	3.41	2.49	0.30216	.	.	.	.	.	T	0.14830	0.0358	M	0.90082	3.085	0.24426	N	0.994593	D	0.63880	0.993	P	0.62491	0.903	T	0.06162	-1.0842	9	0.33141	T	0.24	-8.4935	10.9913	0.47551	0.095:0.0:0.905:0.0	.	1601	Q8IVF2	AHNK2_HUMAN	A	1601	ENSP00000353114:P1601A	ENSP00000353114:P1601A	P	-	1	0	AHNAK2	104488032	0.008000	0.16893	0.124000	0.21820	0.109000	0.19521	0.698000	0.25571	0.622000	0.30249	0.485000	0.47835	CCC	.	.		0.597	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410300.1	NM_138420	
ZNF106	64397	hgsc.bcm.edu	37	15	42743691	42743691	+	Missense_Mutation	SNP	T	T	A			TCGA-3K-AAZ8-01A-12D-A38X-10	TCGA-3K-AAZ8-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ca7f5e36-bbb3-44aa-b0c7-3f170a2bbc0f	c70e868a-ba0a-4b90-ad4d-d61ed7b34ecf	g.chr15:42743691T>A	ENST00000263805.4	-	2	1036	c.710A>T	c.(709-711)tAc>tTc	p.Y237F	ZNF106_ENST00000565380.1_Intron|ZNF106_ENST00000565611.1_Intron	NM_001284306.1|NM_001284307.1|NM_022473.1	NP_001271235.1|NP_001271236.1|NP_071918.1	Q9H2Y7	ZN106_HUMAN	zinc finger protein 106	237					insulin receptor signaling pathway (GO:0008286)	cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)										AGGGCCACTGTAATTCCAATT	0.393																																					p.Y237F		Atlas-SNP	.											.	ZFP106	117	.	0			c.A710T						.						107.0	105.0	106.0					15																	42743691		2203	4299	6502	SO:0001583	missense	64397	exon2			CCACTGTAATTCC	AF205632	CCDS32208.1, CCDS61602.1, CCDS61603.1	15q15.1	2012-11-27	2012-11-27		ENSG00000103994	ENSG00000103994		"""Zinc fingers, C2H2-type"""	12886	protein-coding gene	gene with protein product	"""SH3-domain binding protein 3"""		"""zinc finger protein 106 homolog (mouse)"""	ZFP106			Standard	XM_005254591		Approved	ZNF474, SH3BP3	uc001zpw.3	Q9H2Y7	OTTHUMG00000173244	ENST00000263805.4:c.710A>T	chr15.hg19:g.42743691T>A	ENSP00000263805:p.Tyr237Phe	118.0	0.0		95.0	24.0	NM_022473	B4DZ40|E9PE29|Q6NSD9|Q6PEK1|Q86T43|Q86T45|Q86T50|Q86T58|Q86TA9|Q96M37|Q9H7B8	Missense_Mutation	SNP	ENST00000263805.4	hg19	CCDS32208.1	.	.	.	.	.	.	.	.	.	.	T	9.969	1.225074	0.22457	.	.	ENSG00000103994	ENST00000263805	T	0.55588	0.51	5.74	5.74	0.90152	.	0.265322	0.32836	N	0.005581	T	0.28797	0.0714	N	0.16743	0.435	0.80722	D	1	P;B	0.35155	0.487;0.034	B;B	0.30943	0.122;0.01	T	0.17018	-1.0383	10	0.12430	T	0.62	-13.2159	6.5	0.22164	0.2396:0.0:0.1274:0.633	.	20;237	B4DGC7;Q9H2Y7	.;ZF106_HUMAN	F	237	ENSP00000263805:Y237F	ENSP00000263805:Y237F	Y	-	2	0	ZFP106	40530983	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.297000	0.43593	2.186000	0.69663	0.524000	0.50904	TAC	.	.		0.393	ZNF106-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000422587.1	NM_022473	
ZNF609	23060	hgsc.bcm.edu	37	15	64967423	64967423	+	Silent	SNP	T	T	C	rs368660859		TCGA-3K-AAZ8-01A-12D-A38X-10	TCGA-3K-AAZ8-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ca7f5e36-bbb3-44aa-b0c7-3f170a2bbc0f	c70e868a-ba0a-4b90-ad4d-d61ed7b34ecf	g.chr15:64967423T>C	ENST00000326648.3	+	4	2498	c.2370T>C	c.(2368-2370)gcT>gcC	p.A790A		NM_015042.1	NP_055857.1	O15014	ZN609_HUMAN	zinc finger protein 609	790						nucleus (GO:0005634)	metal ion binding (GO:0046872)			breast(3)|central_nervous_system(2)|endometrium(5)|kidney(1)|large_intestine(9)|lung(11)|ovary(1)|pancreas(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						GCATCAAGGCTGAAGCCGACA	0.542																																					p.A790A		Atlas-SNP	.											.	ZNF609	106	.	0			c.T2370C						.	T		1,4403		0,1,2201	56.0	59.0	58.0		2370	-3.8	1.0	15		58	0,8582		0,0,4291	no	coding-synonymous	ZNF609	NM_015042.1		0,1,6492	CC,CT,TT		0.0,0.0227,0.0077		790/1412	64967423	1,12985	2202	4291	6493	SO:0001819	synonymous_variant	23060	exon4			CAAGGCTGAAGCC	BC014251	CCDS32270.1	15q22.1	2008-05-02				ENSG00000180357		"""Zinc fingers, C2H2-type"""	29003	protein-coding gene	gene with protein product						9205841	Standard	NM_015042		Approved	KIAA0295	uc002ann.3	O15014		ENST00000326648.3:c.2370T>C	chr15.hg19:g.64967423T>C		92.0	0.0		80.0	44.0	NM_015042	Q0D2I2	Silent	SNP	ENST00000326648.3	hg19	CCDS32270.1																																																																																			.	.		0.542	ZNF609-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418130.1	XM_042833	
CHRNA5	1138	hgsc.bcm.edu	37	15	78873234	78873234	+	Missense_Mutation	SNP	G	G	A	rs202057419		TCGA-3K-AAZ8-01A-12D-A38X-10	TCGA-3K-AAZ8-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ca7f5e36-bbb3-44aa-b0c7-3f170a2bbc0f	c70e868a-ba0a-4b90-ad4d-d61ed7b34ecf	g.chr15:78873234G>A	ENST00000299565.5	+	2	388	c.188G>A	c.(187-189)cGt>cAt	p.R63H	CHRNA5_ENST00000559554.1_Missense_Mutation_p.R63H	NM_000745.3	NP_000736.2	P30532	ACHA5_HUMAN	cholinergic receptor, nicotinic, alpha 5 (neuronal)	63					behavioral response to nicotine (GO:0035095)|cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|ion transmembrane transport (GO:0034220)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transport (GO:0006810)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine receptor activity (GO:0015464)|acetylcholine-activated cation-selective channel activity (GO:0004889)|ligand-gated ion channel activity (GO:0015276)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(1)|ovary(1)|prostate(1)|skin(3)	15					Galantamine(DB00674)|Nicotine(DB00184)	AGATGGGTTCGTCCTGTGGAA	0.328																																					p.R63H		Atlas-SNP	.											.	CHRNA5	48	.	0			c.G188A						.						92.0	94.0	93.0					15																	78873234		2196	4293	6489	SO:0001583	missense	1138	exon2			GGGTTCGTCCTGT		CCDS10304.1	15q24	2012-02-11	2012-02-07		ENSG00000169684	ENSG00000169684		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1959	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, alpha 5 (neuronal)"""	118505	"""cholinergic receptor, nicotinic, alpha polypeptide 5"""			2004777	Standard	NM_000745		Approved		uc002bdy.3	P30532	OTTHUMG00000143858	ENST00000299565.5:c.188G>A	chr15.hg19:g.78873234G>A	ENSP00000299565:p.Arg63His	100.0	0.0		65.0	25.0	NM_000745	Q15824|Q99554	Missense_Mutation	SNP	ENST00000299565.5	hg19	CCDS10304.1	.	.	.	.	.	.	.	.	.	.	G	33	5.202410	0.94997	.	.	ENSG00000169684	ENST00000299565;ENST00000394802	D	0.83250	-1.7	5.52	5.52	0.82312	Neurotransmitter-gated ion-channel ligand-binding (3);	0.000000	0.85682	D	0.000000	D	0.94228	0.8147	H	0.95043	3.615	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.95534	0.8606	10	0.87932	D	0	.	19.4388	0.94809	0.0:0.0:1.0:0.0	.	63	P30532	ACHA5_HUMAN	H	63;14	ENSP00000299565:R63H	ENSP00000299565:R63H	R	+	2	0	CHRNA5	76660289	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.848000	0.99507	2.590000	0.87494	0.655000	0.94253	CGT	.	.		0.328	CHRNA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000290106.1		
MPV17L	255027	hgsc.bcm.edu	37	16	15501839	15501839	+	Missense_Mutation	SNP	G	G	A			TCGA-3K-AAZ8-01A-12D-A38X-10	TCGA-3K-AAZ8-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ca7f5e36-bbb3-44aa-b0c7-3f170a2bbc0f	c70e868a-ba0a-4b90-ad4d-d61ed7b34ecf	g.chr16:15501839G>A	ENST00000396385.3	+	4	580	c.461G>A	c.(460-462)gGa>gAa	p.G154E	MPV17L_ENST00000287594.7_Nonsense_Mutation_p.W130*|RP11-1021N1.1_ENST00000568222.1_Intron	NM_001128423.1	NP_001121895.1	Q2QL34	MP17L_HUMAN	MPV17 mitochondrial membrane protein-like	154					negative regulation of hydrogen peroxide biosynthetic process (GO:0010730)|negative regulation of mitochondrial outer membrane permeabilization involved in apoptotic signaling pathway (GO:1901029)|reactive oxygen species metabolic process (GO:0072593)	integral component of membrane (GO:0016021)|peroxisome (GO:0005777)	receptor binding (GO:0005102)			kidney(2)|large_intestine(1)|skin(1)	4						GCTTACGCTGGAGTCTGTGGT	0.498																																					p.W130X		Atlas-SNP	.											.	MPV17L	21	.	0			c.G390A						.						66.0	59.0	61.0					16																	15501839		2197	4298	6495	SO:0001583	missense	255027	exon3			ACGCTGGAGTCTG	DQ004255	CCDS10560.1, CCDS45421.1	16p13.11	2009-04-06			ENSG00000156968	ENSG00000156968			26827	protein-coding gene	gene with protein product						16631601	Standard	NM_001128423		Approved	FLJ39599, MLPH1, MLPH2, MPV17L1	uc002ddn.2	Q2QL34	OTTHUMG00000129882	ENST00000396385.3:c.461G>A	chr16.hg19:g.15501839G>A	ENSP00000379669:p.Gly154Glu	90.0	0.0		118.0	48.0	NM_173803	B4DDY1|Q6P7T6|Q8N8E9	Nonsense_Mutation	SNP	ENST00000396385.3	hg19	CCDS45421.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	14.73|14.73	2.621863|2.621863	0.46840|0.46840	.|.	.|.	ENSG00000156968|ENSG00000156968	ENST00000396385|ENST00000287594	D|.	0.85556|.	-2.0|.	5.29|5.29	5.29|5.29	0.74685|0.74685	.|.	0.000000|.	0.64402|.	U|.	0.000005|.	T|.	0.43055|.	0.1230|.	.|.	.|.	.|.	0.46222|0.46222	D|D	0.998932|0.998932	D|.	0.89917|.	1.0|.	D|.	0.91635|.	0.999|.	T|.	0.32402|.	-0.9908|.	9|.	0.66056|0.02654	D|T	0.02|1	-3.7697|-3.7697	15.6672|15.6672	0.77238|0.77238	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	154|.	Q2QL34|.	MP17L_HUMAN|.	E|X	154|130	ENSP00000379669:G154E|.	ENSP00000379669:G154E|ENSP00000287594:W130X	G|W	+|+	2|3	0|0	MPV17L|MPV17L	15409340|15409340	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.017000|0.017000	0.09413|0.09413	6.145000|6.145000	0.71769|0.71769	2.486000|2.486000	0.83907|0.83907	0.471000|0.471000	0.43371|0.43371	GGA|TGG	.	.		0.498	MPV17L-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000422450.1	NM_173803	
ABCC1	4363	hgsc.bcm.edu	37	16	16177302	16177302	+	Missense_Mutation	SNP	T	T	A			TCGA-3K-AAZ8-01A-12D-A38X-10	TCGA-3K-AAZ8-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ca7f5e36-bbb3-44aa-b0c7-3f170a2bbc0f	c70e868a-ba0a-4b90-ad4d-d61ed7b34ecf	g.chr16:16177302T>A	ENST00000399410.3	+	17	2370	c.2195T>A	c.(2194-2196)cTg>cAg	p.L732Q	ABCC1_ENST00000399408.2_Missense_Mutation_p.L732Q|ABCC1_ENST00000351154.5_Intron|ABCC1_ENST00000345148.5_Missense_Mutation_p.L732Q|ABCC1_ENST00000349029.5_Intron|ABCC1_ENST00000346370.5_Missense_Mutation_p.L732Q	NM_004996.3	NP_004987.2	P33527	MRP1_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 1	732	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				arachidonic acid metabolic process (GO:0019369)|ATP catabolic process (GO:0006200)|cobalamin metabolic process (GO:0009235)|leukotriene metabolic process (GO:0006691)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|transporter activity (GO:0005215)			breast(3)|endometrium(9)|kidney(3)|large_intestine(12)|lung(20)|ovary(5)|prostate(1)|skin(3)	56					Abiraterone(DB05812)|Aminohippurate(DB00345)|Amprenavir(DB00701)|Atazanavir(DB01072)|Atorvastatin(DB01076)|Colchicine(DB01394)|Conjugated Estrogens(DB00286)|Cyclosporine(DB00091)|Dactinomycin(DB00970)|Daunorubicin(DB00694)|Diclofenac(DB00586)|Docetaxel(DB01248)|Doxorubicin(DB00997)|Epirubicin(DB00445)|Erythromycin(DB00199)|Etoposide(DB00773)|Fluorescein(DB00693)|Glutathione(DB00143)|Glyburide(DB01016)|Ibuprofen(DB01050)|Idarubicin(DB01177)|Indinavir(DB00224)|Indomethacin(DB00328)|Irinotecan(DB00762)|Ivermectin(DB00602)|Lamivudine(DB00709)|Methotrexate(DB00563)|Mifepristone(DB00834)|Mitoxantrone(DB01204)|Ofloxacin(DB01165)|Paclitaxel(DB01229)|Phenobarbital(DB01174)|Probenecid(DB01032)|Progesterone(DB00396)|Rifampicin(DB01045)|Ritonavir(DB00503)|Rosuvastatin(DB01098)|Saquinavir(DB01232)|Saxagliptin(DB06335)|Sulfinpyrazone(DB01138)|Vandetanib(DB05294)|Vemurafenib(DB08881)|Verapamil(DB00661)|Vinblastine(DB00570)|Vincristine(DB00541)|Zoledronate(DB00399)	GGATGTCAGCTGGAGGAACCA	0.537																																					p.L732Q		Atlas-SNP	.											.	ABCC1	156	.	0			c.T2195A						.						78.0	81.0	80.0					16																	16177302		2024	4214	6238	SO:0001583	missense	4363	exon17			GTCAGCTGGAGGA	L05628	CCDS42122.1	16p13.1	2012-03-14			ENSG00000103222	ENSG00000103222		"""ATP binding cassette transporters / subfamily C"""	51	protein-coding gene	gene with protein product		158343	"""multidrug resistance associated protein 1"""	MRP, MRP1		8098549, 1360704	Standard	NM_004996		Approved	GS-X	uc010bvi.3	P33527	OTTHUMG00000048267	ENST00000399410.3:c.2195T>A	chr16.hg19:g.16177302T>A	ENSP00000382342:p.Leu732Gln	141.0	0.0		134.0	40.0	NM_004996	A3RJX2|C9JPJ4|O14819|O43333|P78419|Q59GI9|Q9UQ97|Q9UQ99|Q9UQA0	Missense_Mutation	SNP	ENST00000399410.3	hg19	CCDS42122.1	.	.	.	.	.	.	.	.	.	.	T	6.272	0.418367	0.11870	.	.	ENSG00000103222	ENST00000399410;ENST00000399408;ENST00000346370;ENST00000345148;ENST00000536381	D;D;D;D	0.90955	-2.76;-2.76;-2.76;-2.76	5.27	4.15	0.48705	ATPase, AAA+ type, core (1);ABC transporter-like (2);	0.818608	0.11011	N	0.609513	D	0.86606	0.5973	L	0.54323	1.7	0.09310	N	1	B;P;B;B	0.34837	0.196;0.472;0.375;0.324	B;B;B;B	0.34180	0.032;0.158;0.177;0.111	T	0.79642	-0.1718	10	0.56958	D	0.05	-14.0027	5.0393	0.14451	0.0:0.121:0.1851:0.6938	.	732;732;732;732	P33527-4;P33527-3;P33527;P33527-9	.;.;MRP1_HUMAN;.	Q	732;732;732;732;406	ENSP00000382342:L732Q;ENSP00000382340:L732Q;ENSP00000263019:L732Q;ENSP00000263014:L732Q	ENSP00000263014:L732Q	L	+	2	0	ABCC1	16084803	0.000000	0.05858	0.589000	0.28718	0.124000	0.20399	-0.327000	0.07955	2.006000	0.58801	0.460000	0.39030	CTG	.	.		0.537	ABCC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109701.1	NM_004996	
GPT2	84706	hgsc.bcm.edu	37	16	46956209	46956209	+	Missense_Mutation	SNP	G	G	T			TCGA-3K-AAZ8-01A-12D-A38X-10	TCGA-3K-AAZ8-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ca7f5e36-bbb3-44aa-b0c7-3f170a2bbc0f	c70e868a-ba0a-4b90-ad4d-d61ed7b34ecf	g.chr16:46956209G>T	ENST00000340124.4	+	9	1205	c.1093G>T	c.(1093-1095)Ggc>Tgc	p.G365C	GPT2_ENST00000440783.2_Missense_Mutation_p.G265C	NM_133443.2	NP_597700.1	Q8TD30	ALAT2_HUMAN	glutamic pyruvate transaminase (alanine aminotransferase) 2	365					2-oxoglutarate metabolic process (GO:0006103)|cellular amino acid biosynthetic process (GO:0008652)|cellular nitrogen compound metabolic process (GO:0034641)|L-alanine catabolic process (GO:0042853)|L-alanine metabolic process (GO:0042851)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)	L-alanine:2-oxoglutarate aminotransferase activity (GO:0004021)|pyridoxal phosphate binding (GO:0030170)			NS(1)|breast(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(10)|ovary(1)|prostate(1)|skin(2)	23		all_cancers(37;0.0276)|all_epithelial(9;0.0498)|all_lung(18;0.0522)			L-Alanine(DB00160)|Phenelzine(DB00780)	TGAGATCAAGGGCCAGCTGGT	0.607																																					p.G365C		Atlas-SNP	.											.	GPT2	40	.	0			c.G1093T						.						97.0	81.0	86.0					16																	46956209		2203	4300	6503	SO:0001583	missense	84706	exon9			ATCAAGGGCCAGC		CCDS10725.1, CCDS45478.1	16q12.1	2008-02-05			ENSG00000166123	ENSG00000166123	2.6.1.2		18062	protein-coding gene	gene with protein product		138210					Standard	NM_133443		Approved	ALT2	uc002eel.3	Q8TD30	OTTHUMG00000132541	ENST00000340124.4:c.1093G>T	chr16.hg19:g.46956209G>T	ENSP00000345282:p.Gly365Cys	59.0	0.0		50.0	17.0	NM_133443	Q8N9E2	Missense_Mutation	SNP	ENST00000340124.4	hg19	CCDS10725.1	.	.	.	.	.	.	.	.	.	.	G	27.7	4.854771	0.91355	.	.	ENSG00000166123	ENST00000340124;ENST00000440783	D;T	0.90620	-2.7;1.92	4.84	4.84	0.62591	Aminotransferase, class I/classII (1);Pyridoxal phosphate-dependent transferase, major region, subdomain 2 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.114312	0.56097	D	0.000023	D	0.91016	0.7174	L	0.32530	0.975	0.80722	D	1	P	0.40431	0.717	P	0.51866	0.682	D	0.91817	0.5464	10	0.59425	D	0.04	.	18.3066	0.90184	0.0:0.0:1.0:0.0	.	365	Q8TD30	ALAT2_HUMAN	C	365;265	ENSP00000345282:G365C;ENSP00000413804:G265C	ENSP00000345282:G365C	G	+	1	0	GPT2	45513710	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	9.697000	0.98697	2.407000	0.81776	0.462000	0.41574	GGC	.	.		0.607	GPT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255741.2		
CYLD	1540	hgsc.bcm.edu	37	16	50816274	50816274	+	Missense_Mutation	SNP	A	A	C			TCGA-3K-AAZ8-01A-12D-A38X-10	TCGA-3K-AAZ8-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ca7f5e36-bbb3-44aa-b0c7-3f170a2bbc0f	c70e868a-ba0a-4b90-ad4d-d61ed7b34ecf	g.chr16:50816274A>C	ENST00000427738.3	+	10	1928	c.1723A>C	c.(1723-1725)Act>Cct	p.T575P	RP11-327F22.4_ENST00000564510.1_RNA|CYLD_ENST00000311559.9_Missense_Mutation_p.T575P|CYLD_ENST00000564326.1_Missense_Mutation_p.T572P|RP11-327F22.4_ENST00000575917.1_RNA|CYLD_ENST00000568704.2_Missense_Mutation_p.T390P|CYLD_ENST00000398568.2_Missense_Mutation_p.T572P|CYLD_ENST00000540145.1_Missense_Mutation_p.T575P|CYLD_ENST00000566206.1_Missense_Mutation_p.T572P|CYLD_ENST00000569418.1_Missense_Mutation_p.T572P			Q9NQC7	CYLD_HUMAN	cylindromatosis (turban tumor syndrome)	575	Interaction with TRIP.				cell cycle (GO:0007049)|innate immune response (GO:0045087)|necroptotic process (GO:0070266)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of NF-kappaB import into nucleus (GO:0042347)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of type I interferon production (GO:0032480)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|protein K63-linked deubiquitination (GO:0070536)|regulation of intrinsic apoptotic signaling pathway (GO:2001242)|regulation of microtubule cytoskeleton organization (GO:0070507)|regulation of mitotic cell cycle (GO:0007346)|ubiquitin-dependent protein catabolic process (GO:0006511)|Wnt signaling pathway (GO:0016055)	centrosome (GO:0005813)|cytosol (GO:0005829)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|microtubule (GO:0005874)|nucleus (GO:0005634)	Lys63-specific deubiquitinase activity (GO:0061578)|proline-rich region binding (GO:0070064)|protein kinase binding (GO:0019901)|ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)			central_nervous_system(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(9)|lung(17)|pancreas(1)|skin(22)|upper_aerodigestive_tract(1)	62		all_cancers(37;0.0156)				AGAAGAAAATACTCCACCAAA	0.303			"""Mis, N, F, S"""		cylindroma	cylindroma			Multiple Trichoepithelioma, Familial;Familial Cylindromatosis																												p.T575P		Atlas-SNP	.	yes	Rec	yes	Familial cylindromatosis	16	16q12-q13	1540	familial cylindromatosis gene		E	.	CYLD	150	.	0			c.A1723C						.						93.0	84.0	87.0					16																	50816274		1809	4076	5885	SO:0001583	missense	1540	exon12	Familial Cancer Database	;FADC, Turban Tumor syndrome, Epithelioma Adenoides Cysticum of Brooke, Hereditary Multiple Benign Cystic Epithelioma, Dermal Eccrine Cylindromatosis, Brooke-Spiegler s.	GAAAATACTCCAC	AB020656	CCDS42164.1, CCDS45482.1	16q12-q13	2014-09-17							2584	protein-coding gene	gene with protein product	"""ubiquitin specific peptidase like 2"""	605018		CYLD1		7493027	Standard	NM_015247		Approved	KIAA0849, USPL2	uc002egq.1	Q9NQC7		ENST00000427738.3:c.1723A>C	chr16.hg19:g.50816274A>C	ENSP00000392025:p.Thr575Pro	141.0	0.0		146.0	63.0	NM_015247	O94934|Q7L3N6|Q96EH0|Q9NZX9	Missense_Mutation	SNP	ENST00000427738.3	hg19	CCDS45482.1	.	.	.	.	.	.	.	.	.	.	A	23.9	4.473870	0.84640	.	.	ENSG00000083799	ENST00000540145;ENST00000311559;ENST00000427738;ENST00000398568	T;T;T	0.74315	-0.83;-0.83;-0.83	5.61	5.61	0.85477	Cytoskeleton-associated protein, Gly-rich domain (1);	0.044311	0.85682	D	0.000000	T	0.78685	0.4322	N	0.24115	0.695	0.80722	D	1	D;D;D;D	0.89917	0.999;1.0;1.0;0.999	D;D;D;D	0.83275	0.991;0.996;0.996;0.991	T	0.81475	-0.0916	10	0.62326	D	0.03	-21.2581	15.8025	0.78463	1.0:0.0:0.0:0.0	.	572;575;572;575	A8KAB0;F5H2R7;Q9NQC7-2;Q9NQC7	.;.;.;CYLD_HUMAN	P	575;575;572;572	ENSP00000445447:T575P;ENSP00000308928:T575P;ENSP00000381574:T572P	ENSP00000308928:T575P	T	+	1	0	CYLD	49373775	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	8.861000	0.92277	2.127000	0.65507	0.482000	0.46254	ACT	.	.		0.303	CYLD-010	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000422998.2		
CHST5	23563	hgsc.bcm.edu	37	16	75563641	75563641	+	Silent	SNP	C	C	T			TCGA-3K-AAZ8-01A-12D-A38X-10	TCGA-3K-AAZ8-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ca7f5e36-bbb3-44aa-b0c7-3f170a2bbc0f	c70e868a-ba0a-4b90-ad4d-d61ed7b34ecf	g.chr16:75563641C>T	ENST00000336257.3	-	3	2036	c.642G>A	c.(640-642)gcG>gcA	p.A214A	CHST5_ENST00000541075.1_Silent_p.A220A|RP11-77K12.7_ENST00000460606.1_3'UTR	NM_024533.4	NP_078809.2	Q9GZS9	CHST5_HUMAN	carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 5	214					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|N-acetylglucosamine metabolic process (GO:0006044)|protein sulfation (GO:0006477)|small molecule metabolic process (GO:0044281)|sulfur compound metabolic process (GO:0006790)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|intrinsic component of Golgi membrane (GO:0031228)	N-acetylglucosamine 6-O-sulfotransferase activity (GO:0001517)|sulfotransferase activity (GO:0008146)			cervix(1)|endometrium(5)|kidney(1)|large_intestine(3)|lung(11)|ovary(1)|prostate(2)	24						GCAGGTTGAGCGCGGGGTCGC	0.716																																					p.A214A		Atlas-SNP	.											.	CHST5	47	.	0			c.G642A						.						50.0	55.0	54.0					16																	75563641		2197	4299	6496	SO:0001819	synonymous_variant	23563	exon3			GTTGAGCGCGGGG	AF176839	CCDS10919.1	16q23.1	2008-02-05			ENSG00000135702	ENSG00000135702		"""Sulfotransferases, membrane-bound"""	1973	protein-coding gene	gene with protein product		604817				10491328, 11017086	Standard	NM_024533		Approved	I-GLCNAC-6-ST, FLJ22167	uc002fei.3	Q9GZS9	OTTHUMG00000137610	ENST00000336257.3:c.642G>A	chr16.hg19:g.75563641C>T		67.0	0.0		59.0	21.0	NM_024533	B2RV23|Q7LCN3|Q9UBY3	Silent	SNP	ENST00000336257.3	hg19	CCDS10919.1																																																																																			.	.		0.716	CHST5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269025.2	NM_012126	
CTC1	80169	hgsc.bcm.edu	37	17	8141726	8141726	+	Missense_Mutation	SNP	C	C	A			TCGA-3K-AAZ8-01A-12D-A38X-10	TCGA-3K-AAZ8-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ca7f5e36-bbb3-44aa-b0c7-3f170a2bbc0f	c70e868a-ba0a-4b90-ad4d-d61ed7b34ecf	g.chr17:8141726C>A	ENST00000315684.8	-	3	426	c.419G>T	c.(418-420)gGc>gTc	p.G140V	CTC1_ENST00000581671.1_5'UTR	NM_025099.5	NP_079375.3	Q2NKJ3	CTC1_HUMAN	CTS telomere maintenance complex component 1	140					bone marrow development (GO:0048539)|cellular response to DNA damage stimulus (GO:0006974)|hematopoietic stem cell proliferation (GO:0071425)|multicellular organism growth (GO:0035264)|positive regulation of DNA replication (GO:0045740)|positive regulation of fibroblast proliferation (GO:0048146)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)|replicative senescence (GO:0090399)|spleen development (GO:0048536)|telomere maintenance (GO:0000723)|telomere maintenance via telomere lengthening (GO:0010833)|thymus development (GO:0048538)	nuclear chromosome, telomeric region (GO:0000784)|nucleus (GO:0005634)|Stn1-Ten1 complex (GO:0070188)	single-stranded DNA binding (GO:0003697)			NS(1)|endometrium(6)|kidney(3)|large_intestine(6)|lung(8)|ovary(1)|skin(4)	29						GCTCAGGACGCCAGTGTTATC	0.498																																					p.G140V		Atlas-SNP	.											.	CTC1	75	.	0			c.G419T						.						146.0	145.0	146.0					17																	8141726		2033	4199	6232	SO:0001583	missense	80169	exon3			AGGACGCCAGTGT	AL831955	CCDS42259.1	17p13.1	2011-02-21	2011-02-21	2011-02-21	ENSG00000178971	ENSG00000178971			26169	protein-coding gene	gene with protein product	"""conserved telomere maintenance component 1"", ""alpha accessory factor 132"", ""conserved telomere capping protein 1"""	613129	"""tmp494178"", ""chromosome 17 open reading frame 68"""	C17orf68		19854130, 19854131	Standard	NM_025099		Approved	FLJ22170, AAF132	uc002gkq.4	Q2NKJ3		ENST00000315684.8:c.419G>T	chr17.hg19:g.8141726C>A	ENSP00000313759:p.Gly140Val	111.0	0.0		104.0	50.0	NM_025099	B3KR66|C9JEX5|Q1PCD1|Q2TBE3|Q8N3S6|Q9H6L0	Missense_Mutation	SNP	ENST00000315684.8	hg19	CCDS42259.1	.	.	.	.	.	.	.	.	.	.	C	18.06	3.539257	0.65085	.	.	ENSG00000178971	ENST00000315684;ENST00000449476	D;D	0.94613	-3.47;-3.47	5.94	5.94	0.96194	.	0.065120	0.64402	D	0.000014	D	0.96852	0.8972	M	0.72118	2.19	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.96924	0.9676	10	0.87932	D	0	-13.3161	15.8634	0.79043	0.0:1.0:0.0:0.0	.	140	Q2NKJ3	CTC1_HUMAN	V	140	ENSP00000313759:G140V;ENSP00000396018:G140V	ENSP00000313759:G140V	G	-	2	0	CTC1	8082451	0.998000	0.40836	0.966000	0.40874	0.532000	0.34746	4.899000	0.63245	2.826000	0.97356	0.561000	0.74099	GGC	.	.		0.498	CTC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000442012.1	NM_025099	
STX8	9482	hgsc.bcm.edu	37	17	9460750	9460750	+	Splice_Site	SNP	C	C	T			TCGA-3K-AAZ8-01A-12D-A38X-10	TCGA-3K-AAZ8-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ca7f5e36-bbb3-44aa-b0c7-3f170a2bbc0f	c70e868a-ba0a-4b90-ad4d-d61ed7b34ecf	g.chr17:9460750C>T	ENST00000306357.4	-	3	640		c.e3+1		STX8_ENST00000574431.1_Splice_Site|STX8_ENST00000573373.1_Splice_Site|RP11-565F19.2_ENST00000607496.1_RNA	NM_004853.2	NP_004844.1	Q9UNK0	STX8_HUMAN	syntaxin 8						endosome to lysosome transport (GO:0008333)|intracellular protein transport (GO:0006886)|transport (GO:0006810)|vesicle fusion (GO:0006906)	endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|late endosome membrane (GO:0031902)|lysosomal membrane (GO:0005765)|SNARE complex (GO:0031201)	SNAP receptor activity (GO:0005484)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(3)|skin(1)|urinary_tract(1)	12						TACATGGATACATCTGATGTG	0.433																																					.		Atlas-SNP	.											.	STX8	28	.	0			c.212+1G>A						.						102.0	87.0	92.0					17																	9460750		2203	4300	6503	SO:0001630	splice_region_variant	9482	exon4			TGGATACATCTGA	AF115323	CCDS32565.1	17p13.1	2012-05-25			ENSG00000170310	ENSG00000170310			11443	protein-coding gene	gene with protein product		604203				9852078, 10198254	Standard	NM_004853		Approved	CARB	uc002glx.3	Q9UNK0	OTTHUMG00000177844	ENST00000306357.4:c.212+1G>A	chr17.hg19:g.9460750C>T		92.0	0.0		72.0	32.0	NM_004853	O60712|Q53XT8	Splice_Site	SNP	ENST00000306357.4	hg19	CCDS32565.1	.	.	.	.	.	.	.	.	.	.	C	16.45	3.125926	0.56721	.	.	ENSG00000170310	ENST00000306357	.	.	.	5.84	4.86	0.63082	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.267	0.54684	0.1699:0.8301:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	STX8	9401475	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.420000	0.59841	1.448000	0.47680	0.557000	0.71058	.	.	.		0.433	STX8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000439206.3	NM_004853	Intron
ULK2	9706	hgsc.bcm.edu	37	17	19699421	19699421	+	Missense_Mutation	SNP	C	C	T			TCGA-3K-AAZ8-01A-12D-A38X-10	TCGA-3K-AAZ8-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ca7f5e36-bbb3-44aa-b0c7-3f170a2bbc0f	c70e868a-ba0a-4b90-ad4d-d61ed7b34ecf	g.chr17:19699421C>T	ENST00000395544.4	-	19	2483	c.1984G>A	c.(1984-1986)Gca>Aca	p.A662T	ULK2_ENST00000580130.1_5'Flank|ULK2_ENST00000361658.2_Missense_Mutation_p.A662T	NM_014683.3	NP_055498.3	Q8IYT8	ULK2_HUMAN	unc-51 like autophagy activating kinase 2	662			A -> V (in a metastatic melanoma sample; somatic mutation). {ECO:0000269|PubMed:17344846}.		autophagic vacuole assembly (GO:0000045)|axon extension (GO:0048675)|negative regulation of collateral sprouting (GO:0048671)|protein autophosphorylation (GO:0046777)|regulation of autophagy (GO:0010506)|response to starvation (GO:0042594)|signal transduction (GO:0007165)	ATG1/UKL1 signaling complex (GO:0034273)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|pre-autophagosomal structure membrane (GO:0034045)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			large_intestine(1)|skin(4)|stomach(1)	6	all_cancers(12;4.97e-05)|all_epithelial(12;0.00362)|Breast(13;0.186)					CCAAACACTGCCTTGCTCTGC	0.443																																					p.A662T		Atlas-SNP	.											.	ULK2	142	.	0			c.G1984A						.						104.0	99.0	100.0					17																	19699421		2203	4300	6503	SO:0001583	missense	9706	exon19			ACACTGCCTTGCT	AB014523	CCDS11213.1	17p11.2	2014-02-12	2013-07-02		ENSG00000083290	ENSG00000083290	2.7.11.1		13480	protein-coding gene	gene with protein product		608650	"""unc-51 (C. elegans)-like kinase 2"", ""unc-51-like kinase 2 (C. elegans)"""			10557072	Standard	NM_014683		Approved	KIAA0623, Unc51.2, ATG1B	uc002gwn.3	Q8IYT8	OTTHUMG00000059511	ENST00000395544.4:c.1984G>A	chr17.hg19:g.19699421C>T	ENSP00000378914:p.Ala662Thr	100.0	0.0		104.0	15.0	NM_001142610	A8MY69|O75119	Missense_Mutation	SNP	ENST00000395544.4	hg19	CCDS11213.1	.	.	.	.	.	.	.	.	.	.	C	12.84	2.058505	0.36277	.	.	ENSG00000083290	ENST00000361658;ENST00000395544	T;T	0.43688	0.94;0.94	6.02	2.82	0.32997	.	0.145914	0.64402	N	0.000006	T	0.35278	0.0926	L	0.57536	1.79	0.38186	D	0.939757	B	0.06786	0.001	B	0.04013	0.001	T	0.20538	-1.0272	10	0.23891	T	0.37	-5.0641	9.4888	0.38946	0.0:0.6895:0.0:0.3105	.	662	Q8IYT8	ULK2_HUMAN	T	662	ENSP00000354877:A662T;ENSP00000378914:A662T	ENSP00000354877:A662T	A	-	1	0	ULK2	19640013	0.998000	0.40836	0.918000	0.36340	0.862000	0.49288	1.036000	0.30228	0.778000	0.33520	-0.136000	0.14681	GCA	.	.		0.443	ULK2-001	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132375.2	NM_014683	
AKAP1	8165	hgsc.bcm.edu	37	17	55183730	55183730	+	Missense_Mutation	SNP	G	G	A	rs538528140		TCGA-3K-AAZ8-01A-12D-A38X-10	TCGA-3K-AAZ8-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ca7f5e36-bbb3-44aa-b0c7-3f170a2bbc0f	c70e868a-ba0a-4b90-ad4d-d61ed7b34ecf	g.chr17:55183730G>A	ENST00000337714.3	+	2	1138	c.905G>A	c.(904-906)gGa>gAa	p.G302E	AKAP1_ENST00000571629.1_Missense_Mutation_p.G302E|AKAP1_ENST00000314126.3_Missense_Mutation_p.G302E|AKAP1_ENST00000539273.1_Missense_Mutation_p.G302E|AKAP1_ENST00000572557.1_Missense_Mutation_p.G302E	NM_003488.3	NP_003479.1	Q92667	AKAP1_HUMAN	A kinase (PRKA) anchor protein 1	302					blood coagulation (GO:0007596)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			endometrium(2)|liver(1)|lung(7)|ovary(2)|pancreas(1)|skin(1)	14	Breast(9;5.46e-08)					GGTGTCGAGGGAGAACTGGGC	0.542																																					p.G302E		Atlas-SNP	.											.	AKAP1	73	.	0			c.G905A						.						81.0	88.0	86.0					17																	55183730		2203	4300	6503	SO:0001583	missense	8165	exon3			TCGAGGGAGAACT	X97335	CCDS11594.1	17q22	2013-01-23			ENSG00000121057	ENSG00000121057		"""A-kinase anchor proteins"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Tudor domain containing"""	367	protein-coding gene	gene with protein product	"""protein kinase anchoring protein 1"", ""dual specificity A-kinase-anchoring protein 1"", ""protein phosphatase 1, regulatory subunit 43"", ""tudor domain containing 17"""	602449		PRKA1		8769136, 7499250	Standard	NM_003488		Approved	AKAP121, AKAP149, SAKAP84, S-AKAP84, AKAP84, D-AKAP1, PPP1R43, TDRD17	uc002iux.3	Q92667	OTTHUMG00000140369	ENST00000337714.3:c.905G>A	chr17.hg19:g.55183730G>A	ENSP00000337736:p.Gly302Glu	102.0	0.0		98.0	41.0	NM_001242902	A8K8Q1|D3DTZ0|Q13320|Q9BW14	Missense_Mutation	SNP	ENST00000337714.3	hg19	CCDS11594.1	.	.	.	.	.	.	.	.	.	.	G	15.24	2.774798	0.49786	.	.	ENSG00000121057	ENST00000337714;ENST00000314126;ENST00000427138;ENST00000539273	T;T;T	0.19806	2.44;2.12;2.44	4.74	2.71	0.32032	.	0.777035	0.13077	N	0.415602	T	0.15825	0.0381	L	0.45581	1.43	0.09310	N	1	P	0.35077	0.483	B	0.30943	0.122	T	0.15983	-1.0418	10	0.30854	T	0.27	-0.9566	6.4953	0.22138	0.0984:0.1823:0.7193:0.0	.	302	Q92667	AKAP1_HUMAN	E	302;302;344;302	ENSP00000337736:G302E;ENSP00000314075:G302E;ENSP00000443139:G302E	ENSP00000314075:G302E	G	+	2	0	AKAP1	52538729	0.036000	0.19791	0.010000	0.14722	0.337000	0.28794	0.293000	0.19029	0.569000	0.29329	0.561000	0.74099	GGA	.	.		0.542	AKAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000277069.1		
MARCH10	162333	hgsc.bcm.edu	37	17	60821843	60821843	+	Silent	SNP	C	C	A	rs199898215		TCGA-3K-AAZ8-01A-12D-A38X-10	TCGA-3K-AAZ8-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ca7f5e36-bbb3-44aa-b0c7-3f170a2bbc0f	c70e868a-ba0a-4b90-ad4d-d61ed7b34ecf	g.chr17:60821843C>A	ENST00000311269.5	-	5	703	c.429G>T	c.(427-429)ctG>ctT	p.L143L	MARCH10_ENST00000583600.1_Silent_p.L181L|MARCH10_ENST00000544856.2_Silent_p.L142L|MARCH10_ENST00000456609.2_Silent_p.L143L	NM_152598.2	NP_689811.2	Q8NA82	MARHA_HUMAN	membrane-associated ring finger (C3HC4) 10, E3 ubiquitin protein ligase	143					protein ubiquitination (GO:0016567)		ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(11)|liver(1)|lung(15)	38						TAAATCTCCTCAGGTTTGGCT	0.463																																					p.L143L		Atlas-SNP	.											MARCH10,NS,carcinoma,0,1	MARCH10	102	.	0			c.G429T						.						119.0	109.0	112.0					17																	60821843		2203	4300	6503	SO:0001819	synonymous_variant	162333	exon5			TCTCCTCAGGTTT	AK093076	CCDS11635.1, CCDS74122.1, CCDS74123.1	17q23.3	2013-01-09	2012-02-23	2007-08-20		ENSG00000173838		"""RING-type (C3HC4) zinc fingers"", ""MARCH membrane-associated ring fingers"""	26655	protein-coding gene	gene with protein product		613337	"""ring finger protein 190"", ""membrane-associated ring finger (C3HC4) 10"""	RNF190		17604280	Standard	XM_005257103		Approved	FLJ35757, MARCH-X	uc002jag.4	Q8NA82		ENST00000311269.5:c.429G>T	chr17.hg19:g.60821843C>A		83.0	0.0		73.0	25.0	NM_001100875	D3DU09|Q8IYS7|Q8N7Z7	Silent	SNP	ENST00000311269.5	hg19	CCDS11635.1																																																																																			.	C|1.000;G|0.000		0.463	MARCH10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000445252.1	NM_152598	
MFSD11	79157	hgsc.bcm.edu	37	17	74737074	74737074	+	Missense_Mutation	SNP	A	A	G			TCGA-3K-AAZ8-01A-12D-A38X-10	TCGA-3K-AAZ8-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ca7f5e36-bbb3-44aa-b0c7-3f170a2bbc0f	c70e868a-ba0a-4b90-ad4d-d61ed7b34ecf	g.chr17:74737074A>G	ENST00000588460.1	+	3	2230	c.188A>G	c.(187-189)aAt>aGt	p.N63S	MFSD11_ENST00000355954.3_Missense_Mutation_p.N63S|MFSD11_ENST00000590514.1_Missense_Mutation_p.N63S|MFSD11_ENST00000593181.1_Missense_Mutation_p.N63S|MFSD11_ENST00000586622.1_Missense_Mutation_p.N63S|MFSD11_ENST00000336509.4_Missense_Mutation_p.N63S	NM_001242534.1	NP_001229463.1	O43934	MFS11_HUMAN	major facilitator superfamily domain containing 11	63						integral component of membrane (GO:0016021)				endometrium(1)|kidney(2)|large_intestine(3)|lung(7)|ovary(2)|prostate(1)|skin(1)	17						TCTGCTTCAAATTTGATTACA	0.363																																					p.N63S		Atlas-SNP	.											.	MFSD11	47	.	0			c.A188G						.						247.0	229.0	235.0					17																	74737074		2203	4300	6503	SO:0001583	missense	79157	exon4			CTTCAAATTTGAT	BC002753	CCDS11750.1, CCDS56045.1	17q25.1	2012-03-09			ENSG00000092931	ENSG00000092931			25458	protein-coding gene	gene with protein product						9358160	Standard	NM_001242532		Approved	FLJ22196, FLJ20226	uc002jte.3	O43934		ENST00000588460.1:c.188A>G	chr17.hg19:g.74737074A>G	ENSP00000464932:p.Asn63Ser	73.0	0.0		77.0	27.0	NM_001242536	O43442|Q9NXI5	Missense_Mutation	SNP	ENST00000588460.1	hg19	CCDS11750.1	.	.	.	.	.	.	.	.	.	.	A	24.0	4.480426	0.84747	.	.	ENSG00000092931	ENST00000336509;ENST00000355954	T;T	0.43294	0.95;0.95	5.8	5.8	0.92144	Major facilitator superfamily domain, general substrate transporter (1);	0.039732	0.85682	D	0.000000	T	0.58409	0.2120	M	0.66560	2.04	0.80722	D	1	D;P	0.67145	0.996;0.88	P;P	0.59546	0.821;0.859	T	0.55604	-0.8115	10	0.30078	T	0.28	-24.0367	16.1429	0.81539	1.0:0.0:0.0:0.0	.	63;63	O43934-2;O43934	.;MFS11_HUMAN	S	63	ENSP00000337240:N63S;ENSP00000348225:N63S	ENSP00000337240:N63S	N	+	2	0	MFSD11	72248669	1.000000	0.71417	0.966000	0.40874	0.960000	0.62799	5.908000	0.69916	2.209000	0.71365	0.460000	0.39030	AAT	.	.		0.363	MFSD11-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451516.1	NM_024311	
ZNF521	25925	hgsc.bcm.edu	37	18	22805711	22805711	+	Missense_Mutation	SNP	C	C	A			TCGA-3K-AAZ8-01A-12D-A38X-10	TCGA-3K-AAZ8-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ca7f5e36-bbb3-44aa-b0c7-3f170a2bbc0f	c70e868a-ba0a-4b90-ad4d-d61ed7b34ecf	g.chr18:22805711C>A	ENST00000361524.3	-	4	2319	c.2171G>T	c.(2170-2172)tGc>tTc	p.C724F	ZNF521_ENST00000579111.1_5'Flank|ZNF521_ENST00000538137.2_Missense_Mutation_p.C724F|ZNF521_ENST00000584787.1_Missense_Mutation_p.C504F	NM_015461.2	NP_056276.1	Q96K83	ZN521_HUMAN	zinc finger protein 521	724					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein domain specific binding (GO:0019904)			NS(1)|breast(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(21)|lung(97)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	149	all_cancers(21;0.0025)|all_epithelial(16;3.62e-05)|Ovarian(20;0.0991)					GCAGAGGGTGCAGCGAAAGAA	0.453			T	PAX5	ALL																																p.C724F		Atlas-SNP	.		Dom	yes		18	18q11.2	25925	zinc finger protein 521		L	.	ZNF521	269	.	0			c.G2171T						.						83.0	84.0	84.0					18																	22805711		2203	4300	6503	SO:0001583	missense	25925	exon4			AGGGTGCAGCGAA	AK027354	CCDS32806.1	18q11.2	2013-01-08				ENSG00000198795		"""Zinc fingers, C2H2-type"""	24605	protein-coding gene	gene with protein product	"""early hematopoietic zinc finger"""	610974				11984006, 14630787	Standard	NM_015461		Approved	EHZF, Evi3	uc002kvk.2	Q96K83		ENST00000361524.3:c.2171G>T	chr18.hg19:g.22805711C>A	ENSP00000354794:p.Cys724Phe	136.0	0.0		156.0	61.0	NM_015461	A3QVP7|B0YJB7|Q8IXI0|Q8TES6|Q9C065|Q9HAL5|Q9UFK4	Missense_Mutation	SNP	ENST00000361524.3	hg19	CCDS32806.1	.	.	.	.	.	.	.	.	.	.	C	10.19	1.281195	0.23392	.	.	ENSG00000198795	ENST00000361524;ENST00000538137;ENST00000399425	T;T	0.58940	0.3;0.3	6.17	6.17	0.99709	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);	0.000000	0.85682	D	0.000000	D	0.85204	0.5643	H	0.96430	3.82	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.88351	0.2981	10	0.87932	D	0	-23.4339	20.8794	0.99867	0.0:1.0:0.0:0.0	.	724	Q96K83	ZN521_HUMAN	F	724;758;724	ENSP00000354794:C724F;ENSP00000382352:C724F	ENSP00000354794:C724F	C	-	2	0	ZNF521	21059709	1.000000	0.71417	1.000000	0.80357	0.936000	0.57629	7.487000	0.81328	2.941000	0.99782	0.655000	0.94253	TGC	.	.		0.453	ZNF521-001	KNOWN	overlapping_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446781.2	NM_015461	
BOD1L2	284257	hgsc.bcm.edu	37	18	54814759	54814759	+	Silent	SNP	G	G	T			TCGA-3K-AAZ8-01A-12D-A38X-10	TCGA-3K-AAZ8-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ca7f5e36-bbb3-44aa-b0c7-3f170a2bbc0f	c70e868a-ba0a-4b90-ad4d-d61ed7b34ecf	g.chr18:54814759G>T	ENST00000585477.1	+	1	467	c.216G>T	c.(214-216)ctG>ctT	p.L72L	CTD-2526M8.3_ENST00000590942.1_lincRNA	NM_001257964.1	NP_001244893.1	Q8IYS8	BD1L2_HUMAN	biorientation of chromosomes in cell division 1-like 2	72																	ACCAAAACCTGAGCCAGAAAG	0.542																																					p.L72L		Atlas-SNP	.											.	BOD1L2	1	.	0			c.G216T						.																																			SO:0001819	synonymous_variant	284257	exon1			AAACCTGAGCCAG	AK127964	CCDS59322.1	18q21.31	2013-10-11	2012-04-10	2012-04-10	ENSG00000228075	ENSG00000228075			28505	protein-coding gene	gene with protein product			"""family with sequence similarity 44, member C"", ""biorientation of chromosomes in cell division 1 pseudogene"""	FAM44C, BOD1P		17938248	Standard	NM_001257964		Approved	MGC33608	uc002lgm.3	Q8IYS8	OTTHUMG00000180124	ENST00000585477.1:c.216G>T	chr18.hg19:g.54814759G>T		25.0	0.0		31.0	8.0	NM_001257964	B3KXU4|Q8WW13	Silent	SNP	ENST00000585477.1	hg19	CCDS59322.1																																																																																			.	.		0.542	BOD1L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449763.1	NM_001257964	
NEDD4L	23327	hgsc.bcm.edu	37	18	55833084	55833084	+	Missense_Mutation	SNP	T	T	A			TCGA-3K-AAZ8-01A-12D-A38X-10	TCGA-3K-AAZ8-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ca7f5e36-bbb3-44aa-b0c7-3f170a2bbc0f	c70e868a-ba0a-4b90-ad4d-d61ed7b34ecf	g.chr18:55833084T>A	ENST00000400345.3	+	2	396	c.113T>A	c.(112-114)tTt>tAt	p.F38Y	NEDD4L_ENST00000256830.9_Missense_Mutation_p.F38Y|NEDD4L_ENST00000435432.2_5'UTR|NEDD4L_ENST00000589054.1_Intron|NEDD4L_ENST00000357895.5_Missense_Mutation_p.F30Y|NEDD4L_ENST00000588516.1_3'UTR|NEDD4L_ENST00000356462.6_Missense_Mutation_p.F38Y|NEDD4L_ENST00000382850.4_Missense_Mutation_p.F38Y|NEDD4L_ENST00000586263.1_Missense_Mutation_p.F30Y|NEDD4L_ENST00000256832.7_5'UTR|NEDD4L_ENST00000456986.1_5'UTR	NM_001144967.2	NP_001138439.1	Q96PU5	NED4L_HUMAN	neural precursor cell expressed, developmentally down-regulated 4-like, E3 ubiquitin protein ligase	38	C2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				cellular sodium ion homeostasis (GO:0006883)|excretion (GO:0007588)|gene expression (GO:0010467)|ion transmembrane transport (GO:0034220)|negative regulation of potassium ion transmembrane transport (GO:1901380)|negative regulation of potassium ion transmembrane transporter activity (GO:1901017)|negative regulation of protein localization to cell surface (GO:2000009)|negative regulation of sodium ion transmembrane transport (GO:1902306)|negative regulation of sodium ion transmembrane transporter activity (GO:2000650)|negative regulation of systemic arterial blood pressure (GO:0003085)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|positive regulation of cation channel activity (GO:2001259)|positive regulation of caveolin-mediated endocytosis (GO:2001288)|positive regulation of endocytosis (GO:0045807)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of sodium ion transport (GO:0010765)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein K48-linked ubiquitination (GO:0070936)|protein monoubiquitination (GO:0006513)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|regulation of ion transmembrane transport (GO:0034765)|regulation of membrane depolarization (GO:0003254)|regulation of membrane potential (GO:0042391)|regulation of membrane repolarization (GO:0060306)|regulation of potassium ion transmembrane transporter activity (GO:1901016)|regulation of protein catabolic process (GO:0042176)|regulation of tight junction assembly (GO:2000810)|response to metal ion (GO:0010038)|response to salt stress (GO:0009651)|sodium ion transport (GO:0006814)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|transmembrane transport (GO:0055085)|ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway (GO:0043162)|ventricular cardiac muscle cell action potential (GO:0086005)|viral life cycle (GO:0019058)|viral process (GO:0016032)|water homeostasis (GO:0030104)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ion channel binding (GO:0044325)|ligase activity (GO:0016874)|potassium channel inhibitor activity (GO:0019870)|potassium channel regulator activity (GO:0015459)|sodium channel inhibitor activity (GO:0019871)|sodium channel regulator activity (GO:0017080)|ubiquitin-protein transferase activity (GO:0004842)			breast(1)|endometrium(7)|kidney(3)|large_intestine(10)|lung(11)|ovary(1)|prostate(4)	37						AAGGACATCTTTGGAGCCAGG	0.408																																					p.F38Y		Atlas-SNP	.											.	NEDD4L	126	.	0			c.T113A						.						156.0	141.0	146.0					18																	55833084		1832	4087	5919	SO:0001583	missense	23327	exon2			ACATCTTTGGAGC	AF210730	CCDS45872.1, CCDS45873.1, CCDS45874.1, CCDS45875.1, CCDS45876.1, CCDS58632.1, CCDS59323.1	18q21.31	2014-08-12	2012-02-23		ENSG00000049759				7728	protein-coding gene	gene with protein product		606384	"""neural precursor cell expressed, developmentally down-regulated 4-like"""			10594025, 11244092, 18322022	Standard	NM_001144965		Approved	KIAA0439, RSP5, NEDD4-2	uc002lgy.3	Q96PU5	OTTHUMG00000179875	ENST00000400345.3:c.113T>A	chr18.hg19:g.55833084T>A	ENSP00000383199:p.Phe38Tyr	116.0	0.0		88.0	11.0	NM_015277	O43165|Q3LSM7|Q7Z5F1|Q7Z5F2|Q7Z5N3|Q8N5A7|Q8WUU9|Q9BW58|Q9H2W4|Q9NT88	Missense_Mutation	SNP	ENST00000400345.3	hg19	CCDS45872.1	.	.	.	.	.	.	.	.	.	.	T	20.3	3.960136	0.74016	.	.	ENSG00000049759	ENST00000400345;ENST00000382850;ENST00000356462;ENST00000256830;ENST00000357895	T;T;T;T;T	0.69306	-0.39;-0.39;-0.39;-0.39;-0.39	5.92	5.92	0.95590	C2 membrane targeting protein (1);C2 region (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	.	.	.	.	T	0.75110	0.3805	M	0.73217	2.22	0.80722	D	1	P;P;P;P;P	0.44946	0.628;0.846;0.578;0.845;0.755	P;P;B;P;P	0.50231	0.533;0.45;0.146;0.483;0.635	T	0.78132	-0.2323	9	0.72032	D	0.01	.	15.3488	0.74368	0.0:0.0:0.0:1.0	.	30;30;38;38;38	Q96PU5-6;Q96PU5-7;Q96PU5-2;Q96PU5;Q96PU5-5	.;.;.;NED4L_HUMAN;.	Y	38;38;38;38;30	ENSP00000383199:F38Y;ENSP00000372301:F38Y;ENSP00000348847:F38Y;ENSP00000256830:F38Y;ENSP00000350569:F30Y	ENSP00000256830:F38Y	F	+	2	0	NEDD4L	53984082	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.686000	0.68211	2.269000	0.75478	0.460000	0.39030	TTT	.	.		0.408	NEDD4L-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000448749.1		
SERPINB13	5275	hgsc.bcm.edu	37	18	61260116	61260116	+	Missense_Mutation	SNP	A	A	G			TCGA-3K-AAZ8-01A-12D-A38X-10	TCGA-3K-AAZ8-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ca7f5e36-bbb3-44aa-b0c7-3f170a2bbc0f	c70e868a-ba0a-4b90-ad4d-d61ed7b34ecf	g.chr18:61260116A>G	ENST00000344731.5	+	5	485	c.383A>G	c.(382-384)tAt>tGt	p.Y128C	SERPINB13_ENST00000269489.5_Missense_Mutation_p.Y128C	NM_012397.3	NP_036529.1	Q9UIV8	SPB13_HUMAN	serpin peptidase inhibitor, clade B (ovalbumin), member 13	128					negative regulation of endopeptidase activity (GO:0010951)|regulation of proteolysis (GO:0030162)|response to UV (GO:0009411)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(15)|ovary(1)|prostate(2)|urinary_tract(1)	25						GAAAAATATTATCATGCATCT	0.318																																					p.Y128C		Atlas-SNP	.											.	SERPINB13	51	.	0			c.A383G						.						85.0	93.0	90.0					18																	61260116		2203	4300	6503	SO:0001583	missense	5275	exon5			AATATTATCATGC	AF169949, BC101821	CCDS11985.1	18q21.33	2014-02-18	2005-08-18		ENSG00000197641	ENSG00000197641		"""Serine (or cysteine) peptidase inhibitors"""	8944	protein-coding gene	gene with protein product		604445	"""serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 13"""	PI13		9297979, 10512713, 24172014	Standard	NM_012397		Approved	HUR7, hurpin, headpin	uc002ljc.3	Q9UIV8	OTTHUMG00000060406	ENST00000344731.5:c.383A>G	chr18.hg19:g.61260116A>G	ENSP00000341584:p.Tyr128Cys	88.0	0.0		97.0	37.0	NM_012397	A8K2Q8|Q3MII2|Q9HCX1|Q9UBW1|Q9UKG0	Missense_Mutation	SNP	ENST00000344731.5	hg19	CCDS11985.1	.	.	.	.	.	.	.	.	.	.	A	19.57	3.853167	0.71719	.	.	ENSG00000197641	ENST00000431153;ENST00000269489;ENST00000344731	D;D;D	0.87334	-2.24;-2.24;-2.24	5.63	4.43	0.53597	Serpin domain (3);	0.133198	0.34879	N	0.003612	D	0.94771	0.8312	H	0.94503	3.545	0.58432	D	0.999997	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	D	0.94978	0.8123	10	0.87932	D	0	.	11.3852	0.49780	0.8644:0.0:0.0:0.1356	.	137;128	B7ZKV6;Q9UIV8	.;SPB13_HUMAN	C	158;128;128	ENSP00000388300:Y158C;ENSP00000269489:Y128C;ENSP00000341584:Y128C	ENSP00000269489:Y128C	Y	+	2	0	SERPINB13	59411096	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	6.376000	0.73141	1.012000	0.39366	0.454000	0.30748	TAT	.	.		0.318	SERPINB13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000133798.1	NM_012397	
CDC37	11140	hgsc.bcm.edu	37	19	10514108	10514108	+	Missense_Mutation	SNP	T	T	G			TCGA-3K-AAZ8-01A-12D-A38X-10	TCGA-3K-AAZ8-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ca7f5e36-bbb3-44aa-b0c7-3f170a2bbc0f	c70e868a-ba0a-4b90-ad4d-d61ed7b34ecf	g.chr19:10514108T>G	ENST00000222005.2	-	1	101	c.48A>C	c.(46-48)gaA>gaC	p.E16D	MIR1181_ENST00000408639.1_RNA	NM_007065.3	NP_008996.1	Q16543	CDC37_HUMAN	cell division cycle 37	16					protein targeting (GO:0006605)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|regulation of type I interferon-mediated signaling pathway (GO:0060338)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|protein complex (GO:0043234)|ruffle membrane (GO:0032587)	heat shock protein binding (GO:0031072)|unfolded protein binding (GO:0051082)			breast(2)|endometrium(4)|kidney(2)|large_intestine(2)|lung(4)|ovary(1)|skin(1)	16			OV - Ovarian serous cystadenocarcinoma(20;4.65e-10)|Epithelial(33;6.48e-07)|all cancers(31;2.31e-06)	GBM - Glioblastoma multiforme(1328;0.0318)		GCGTCTCGTCTTCATCATCAG	0.672																																					p.E16D		Atlas-SNP	.											.	CDC37	32	.	0			c.A48C						.						87.0	68.0	75.0					19																	10514108		2203	4300	6503	SO:0001583	missense	11140	exon1			CTCGTCTTCATCA	U63131	CCDS12237.1	19p13.2	2013-01-17	2013-01-17		ENSG00000105401	ENSG00000105401			1735	protein-coding gene	gene with protein product	"""CDC37 cell division cycle 37 homolog"", ""Hsp90 co-chaperone Cdc37"", ""CDC37 (cell division cycle 37, S. cerevisiae, homolog)"""	605065	"""CDC37 (cell division cycle 37, S. cerevisiae, homolog)"", ""CDC37 cell division cycle 37 homolog (S. cerevisiae)"", ""cell division cycle 37 homolog (S. cerevisiae)"""			8703009, 8666233	Standard	NM_007065		Approved	P50CDC37	uc002mof.1	Q16543		ENST00000222005.2:c.48A>C	chr19.hg19:g.10514108T>G	ENSP00000222005:p.Glu16Asp	46.0	0.0		43.0	19.0	NM_007065	Q53YA2	Missense_Mutation	SNP	ENST00000222005.2	hg19	CCDS12237.1	.	.	.	.	.	.	.	.	.	.	T	27.1	4.801104	0.90538	.	.	ENSG00000105401	ENST00000222005	T	0.59083	0.29	4.76	-0.551	0.11822	Cdc37, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.71221	0.3314	M	0.80616	2.505	0.58432	D	0.999997	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	T	0.69525	-0.5122	10	0.87932	D	0	.	8.3422	0.32249	0.0:0.471:0.0:0.529	.	16;16	Q6FG59;Q16543	.;CDC37_HUMAN	D	16	ENSP00000222005:E16D	ENSP00000222005:E16D	E	-	3	2	CDC37	10375108	0.980000	0.34600	0.994000	0.49952	0.990000	0.78478	0.135000	0.15952	-0.218000	0.10018	-0.366000	0.07423	GAA	.	.		0.672	CDC37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451987.1	NM_007065	
F2RL3	9002	hgsc.bcm.edu	37	19	17004084	17004084	+	IGR	SNP	G	G	A			TCGA-3K-AAZ8-01A-12D-A38X-10	TCGA-3K-AAZ8-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ca7f5e36-bbb3-44aa-b0c7-3f170a2bbc0f	c70e868a-ba0a-4b90-ad4d-d61ed7b34ecf	g.chr19:17004084G>A	ENST00000248076.3	+	0	3473				CPAMD8_ENST00000443236.1_Silent_p.S1878S|CPAMD8_ENST00000597335.1_5'Flank	NM_003950.2	NP_003941.2	Q96RI0	PAR4_HUMAN	coagulation factor II (thrombin) receptor-like 3						blood coagulation (GO:0007596)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|platelet activation (GO:0030168)|platelet dense granule organization (GO:0060155)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|response to wounding (GO:0009611)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	thrombin receptor activity (GO:0015057)			cervix(1)|lung(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	7						TGTGGAACGGGCTGGCGCTCT	0.627																																					p.S1878S		Atlas-SNP	.											.	CPAMD8	192	.	0			c.C5634T						.						16.0	17.0	17.0					19																	17004084		1918	4102	6020	SO:0001628	intergenic_variant	27151	exon42			GAACGGGCTGGCG	AF055917	CCDS12350.1	19p12	2012-08-08						"""GPCR / Class A : Protease activated receptors"""	3540	protein-coding gene	gene with protein product	"""proteinase-activated receptor-4"""	602779				9618465	Standard	XM_005260139		Approved	PAR4	uc002nfa.3	Q96RI0			chr19.hg19:g.17004084G>A		64.0	0.0		57.0	11.0	NM_015692	O76067|Q6DK42	Silent	SNP	ENST00000248076.3	hg19	CCDS12350.1	.	.	.	.	.	.	.	.	.	.	G	3.087	-0.187828	0.06299	.	.	ENSG00000160111	ENST00000443236	.	.	.	1.81	-1.89	0.07689	.	.	.	.	.	T	0.21761	0.0524	.	.	.	0.09310	N	0.999999	.	.	.	.	.	.	T	0.28554	-1.0040	4	.	.	.	.	4.1779	0.10360	0.0:0.2223:0.327:0.4507	.	.	.	.	V	1889	.	.	A	-	2	0	CPAMD8	16865084	0.118000	0.22208	0.001000	0.08648	0.077000	0.17291	0.346000	0.19997	-0.411000	0.07530	-0.489000	0.04712	GCC	.	.		0.627	F2RL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462875.1		
GATAD2A	54815	hgsc.bcm.edu	37	19	19612126	19612126	+	Silent	SNP	G	G	A			TCGA-3K-AAZ8-01A-12D-A38X-10	TCGA-3K-AAZ8-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ca7f5e36-bbb3-44aa-b0c7-3f170a2bbc0f	c70e868a-ba0a-4b90-ad4d-d61ed7b34ecf	g.chr19:19612126G>A	ENST00000360315.3	+	9	1713	c.1401G>A	c.(1399-1401)caG>caA	p.Q467Q	GATAD2A_ENST00000537887.1_Silent_p.Q96Q|GATAD2A_ENST00000404158.1_Silent_p.Q468Q|GATAD2A_ENST00000358713.3_Silent_p.Q467Q|GATAD2A_ENST00000429563.2_Silent_p.Q295Q|GATAD2A_ENST00000252577.5_Silent_p.Q467Q	NM_017660.3	NP_060130.3	Q86YP4	P66A_HUMAN	GATA zinc finger domain containing 2A	467	CR2; histone tail-binding.				anterior neuropore closure (GO:0021506)|blood vessel development (GO:0001568)|DNA methylation (GO:0006306)|embryonic body morphogenesis (GO:0010172)|in utero embryonic development (GO:0001701)|negative regulation of transcription, DNA-templated (GO:0045892)|neural fold formation (GO:0001842)|programmed cell death (GO:0012501)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|NuRD complex (GO:0016581)	protein binding, bridging (GO:0030674)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|urinary_tract(1)	13						AGGCGCTGCAGCAGGAACAGG	0.647																																					p.Q467Q		Atlas-SNP	.											.	GATAD2A	81	.	0			c.G1401A						.						27.0	23.0	24.0					19																	19612126		2203	4299	6502	SO:0001819	synonymous_variant	54815	exon9			GCTGCAGCAGGAA	AL390164	CCDS12402.2	19p13.11	2013-01-25			ENSG00000167491	ENSG00000167491		"""GATA zinc finger domain containing"""	29989	protein-coding gene	gene with protein product	"""p66 alpha"""	614997				12183469	Standard	NM_017660		Approved	p66alpha	uc010xqt.2	Q86YP4	OTTHUMG00000152541	ENST00000360315.3:c.1401G>A	chr19.hg19:g.19612126G>A		159.0	0.0		146.0	58.0	NM_017660	B5MC40|Q7L3J2|Q96F28|Q9NPU2|Q9NXS1	Silent	SNP	ENST00000360315.3	hg19	CCDS12402.2	.	.	.	.	.	.	.	.	.	.	G	9.661	1.144026	0.21205	.	.	ENSG00000167491	ENST00000418032	.	.	.	5.18	0.532	0.17114	.	.	.	.	.	T	0.58119	0.2100	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.53479	-0.8433	4	.	.	.	-22.6318	10.2073	0.43120	0.299:0.0:0.701:0.0	.	.	.	.	T	94	.	.	A	+	1	0	GATAD2A	19473126	1.000000	0.71417	1.000000	0.80357	0.938000	0.57974	2.591000	0.46163	0.286000	0.22352	0.645000	0.84053	GCA	.	.		0.647	GATAD2A-202	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000326671.4	NM_017660	
TSHZ3	57616	hgsc.bcm.edu	37	19	31767550	31767550	+	Missense_Mutation	SNP	A	A	G			TCGA-3K-AAZ8-01A-12D-A38X-10	TCGA-3K-AAZ8-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ca7f5e36-bbb3-44aa-b0c7-3f170a2bbc0f	c70e868a-ba0a-4b90-ad4d-d61ed7b34ecf	g.chr19:31767550A>G	ENST00000240587.4	-	2	3476	c.3149T>C	c.(3148-3150)tTt>tCt	p.F1050S		NM_020856.2	NP_065907.2	Q63HK5	TSH3_HUMAN	teashirt zinc finger homeobox 3	1050					in utero embryonic development (GO:0001701)|kidney morphogenesis (GO:0060993)|kidney smooth muscle cell differentiation (GO:0072195)|lung development (GO:0030324)|metanephros development (GO:0001656)|musculoskeletal movement (GO:0050881)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of smooth muscle cell differentiation (GO:0051152)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|sensory perception of touch (GO:0050975)|transcription, DNA-templated (GO:0006351)|ureter smooth muscle cell differentiation (GO:0072193)|ureteric bud development (GO:0001657)|ureteric peristalsis (GO:0072105)	growth cone (GO:0030426)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|endometrium(15)|kidney(9)|large_intestine(20)|lung(60)|ovary(4)|pancreas(2)|prostate(4)|skin(5)	123	Esophageal squamous(110;0.226)					CTTGCTGGCAAAGGTCCGATT	0.488																																					p.F1050S		Atlas-SNP	.											TSHZ3_ENST00000240587,right_upper_lobe,carcinoma,0,2	TSHZ3	549	.	0			c.T3149C						.						155.0	139.0	145.0					19																	31767550		2203	4300	6503	SO:0001583	missense	57616	exon2			CTGGCAAAGGTCC	AL136805	CCDS12421.2	19q13.11	2013-11-20	2007-07-16	2006-03-14	ENSG00000121297	ENSG00000121297		"""Teashirt zinc fingers"", ""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	30700	protein-coding gene	gene with protein product	"""teashirt 3"""	614119	"""zinc finger protein 537"", ""teashirt family zinc finger 3"""	ZNF537			Standard	NM_020856		Approved	KIAA1474, TSH3	uc002nsy.4	Q63HK5	OTTHUMG00000150184	ENST00000240587.4:c.3149T>C	chr19.hg19:g.31767550A>G	ENSP00000240587:p.Phe1050Ser	228.0	0.0		185.0	78.0	NM_020856	Q9H0G6|Q9P254	Missense_Mutation	SNP	ENST00000240587.4	hg19	CCDS12421.2	.	.	.	.	.	.	.	.	.	.	A	17.65	3.442907	0.63067	.	.	ENSG00000121297	ENST00000240587	T	0.20598	2.06	5.93	5.93	0.95920	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);	0.000000	0.85682	D	0.000000	T	0.49695	0.1572	M	0.78049	2.395	0.80722	D	1	D	0.76494	0.999	D	0.87578	0.998	T	0.53063	-0.8491	10	0.87932	D	0	-8.4156	16.3871	0.83514	1.0:0.0:0.0:0.0	.	1050	Q63HK5	TSH3_HUMAN	S	1050	ENSP00000240587:F1050S	ENSP00000240587:F1050S	F	-	2	0	TSHZ3	36459390	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	8.930000	0.92872	2.265000	0.75225	0.533000	0.62120	TTT	.	.		0.488	TSHZ3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316743.2	NM_020856	
SUPT5H	6829	hgsc.bcm.edu	37	19	39961060	39961060	+	Missense_Mutation	SNP	C	C	T			TCGA-3K-AAZ8-01A-12D-A38X-10	TCGA-3K-AAZ8-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ca7f5e36-bbb3-44aa-b0c7-3f170a2bbc0f	c70e868a-ba0a-4b90-ad4d-d61ed7b34ecf	g.chr19:39961060C>T	ENST00000599117.1	+	19	1941	c.1574C>T	c.(1573-1575)gCa>gTa	p.A525V	SUPT5H_ENST00000402194.2_Missense_Mutation_p.A521V|SUPT5H_ENST00000359191.6_Missense_Mutation_p.A521V|SUPT5H_ENST00000598725.1_Missense_Mutation_p.A525V|SUPT5H_ENST00000432763.2_Missense_Mutation_p.A525V			O00267	SPT5H_HUMAN	suppressor of Ty 5 homolog (S. cerevisiae)	525					7-methylguanosine mRNA capping (GO:0006370)|cell cycle (GO:0007049)|chromatin remodeling (GO:0006338)|DNA-templated transcription, elongation (GO:0006354)|gene expression (GO:0010467)|negative regulation of DNA-templated transcription, elongation (GO:0032785)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of DNA-templated transcription, elongation (GO:0032786)|positive regulation of macroautophagy (GO:0016239)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of viral transcription (GO:0050434)|response to organic substance (GO:0010033)|single stranded viral RNA replication via double stranded DNA intermediate (GO:0039692)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	DSIF complex (GO:0032044)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|enzyme binding (GO:0019899)|poly(A) RNA binding (GO:0044822)|protein heterodimerization activity (GO:0046982)			breast(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(13)|lung(12)|ovary(3)|pancreas(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(1)	51	all_cancers(60;6.69e-07)|all_lung(34;2.66e-08)|Lung NSC(34;3e-08)|all_epithelial(25;1.57e-06)|Ovarian(47;0.159)		Epithelial(26;3.9e-26)|all cancers(26;1.35e-23)|LUSC - Lung squamous cell carcinoma(53;0.000657)			TCAGAGACAGCATCAGGTGTG	0.632																																					p.A525V		Atlas-SNP	.											.	SUPT5H	119	.	0			c.C1574T						.						118.0	113.0	115.0					19																	39961060		2203	4300	6503	SO:0001583	missense	6829	exon17			AGACAGCATCAGG	U56402	CCDS12536.1, CCDS46072.1	19q13	2008-07-22	2001-11-28			ENSG00000196235			11469	protein-coding gene	gene with protein product		602102	"""suppressor of Ty (S.cerevisiae) 5 homolog"""			8975720	Standard	NM_003169		Approved	SPT5H, SPT5, FLJ34157	uc002olp.4	O00267		ENST00000599117.1:c.1574C>T	chr19.hg19:g.39961060C>T	ENSP00000470252:p.Ala525Val	119.0	0.0		105.0	38.0	NM_003169	O43279|Q59G52|Q99639	Missense_Mutation	SNP	ENST00000599117.1	hg19	CCDS12536.1	.	.	.	.	.	.	.	.	.	.	C	36	5.866255	0.97043	.	.	ENSG00000196235	ENST00000432763;ENST00000402194;ENST00000378524;ENST00000359191	.	.	.	5.89	5.89	0.94794	.	0.000000	0.85682	D	0.000000	D	0.84197	0.5419	M	0.86651	2.83	0.80722	D	1	P;D;D	0.62365	0.955;0.991;0.984	P;D;P	0.66979	0.776;0.948;0.889	D	0.85149	0.0985	8	.	.	.	-19.2641	19.0242	0.92926	0.0:1.0:0.0:0.0	.	317;521;525	B4DJK4;O00267-2;O00267	.;.;SPT5H_HUMAN	V	525;521;503;525	.	.	A	+	2	0	SUPT5H	44652900	1.000000	0.71417	0.891000	0.34965	0.992000	0.81027	7.585000	0.82584	2.788000	0.95919	0.557000	0.71058	GCA	.	.		0.632	SUPT5H-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000464918.1	NM_003169	
LENG8	114823	hgsc.bcm.edu	37	19	54964820	54964820	+	Silent	SNP	A	A	G			TCGA-3K-AAZ8-01A-12D-A38X-10	TCGA-3K-AAZ8-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ca7f5e36-bbb3-44aa-b0c7-3f170a2bbc0f	c70e868a-ba0a-4b90-ad4d-d61ed7b34ecf	g.chr19:54964820A>G	ENST00000326764.5	+	5	890	c.411A>G	c.(409-411)caA>caG	p.Q137Q	LENG8_ENST00000376514.2_Intron	NM_052925.2	NP_443157.1	Q96PV6	LENG8_HUMAN	leukocyte receptor cluster (LRC) member 8	0										breast(1)|central_nervous_system(3)|endometrium(3)|kidney(1)|large_intestine(6)|lung(9)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	30	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.139)		CCCAACACCAAGGGACTCTGA	0.552																																					p.Q137Q		Atlas-SNP	.											.	LENG8	73	.	0			c.A411G						.						96.0	79.0	85.0					19																	54964820		2203	4300	6503	SO:0001819	synonymous_variant	114823	exon5			ACACCAAGGGACT	AF211975	CCDS12894.1	19q13.4	2008-02-05			ENSG00000167615	ENSG00000167615			15500	protein-coding gene	gene with protein product						10941842	Standard	XM_005278248		Approved	KIAA1932, MGC40108, pp13842	uc002qfw.2	Q96PV6	OTTHUMG00000065548	ENST00000326764.5:c.411A>G	chr19.hg19:g.54964820A>G		21.0	0.0		23.0	4.0	NM_052925	B0VJY9|Q8IZ27|Q8NCX6	Silent	SNP	ENST00000326764.5	hg19	CCDS12894.1																																																																																			.	.		0.552	LENG8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000140523.2	NM_052925	
BTBD3	22903	hgsc.bcm.edu	37	20	11899220	11899220	+	Nonsense_Mutation	SNP	G	G	A			TCGA-3K-AAZ8-01A-12D-A38X-10	TCGA-3K-AAZ8-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ca7f5e36-bbb3-44aa-b0c7-3f170a2bbc0f	c70e868a-ba0a-4b90-ad4d-d61ed7b34ecf	g.chr20:11899220G>A	ENST00000405977.1	+	2	922	c.297G>A	c.(295-297)tgG>tgA	p.W99*	BTBD3_ENST00000378226.2_Nonsense_Mutation_p.W99*|RP4-742J24.2_ENST00000439529.1_RNA|BTBD3_ENST00000254977.3_Nonsense_Mutation_p.W38*|BTBD3_ENST00000399006.2_Nonsense_Mutation_p.W38*	NM_001282550.1|NM_001282552.1|NM_001282554.1	NP_001269479.1|NP_001269481.1|NP_001269483.1	Q9Y2F9	BTBD3_HUMAN	BTB (POZ) domain containing 3	99					cerebral cortex development (GO:0021987)|dendrite morphogenesis (GO:0048813)	cytosol (GO:0005829)|nucleus (GO:0005634)				breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(18)|ovary(3)|skin(2)	34						CCCCAAACTGGCAGGGTCTTT	0.478																																					p.W99X		Atlas-SNP	.											.	BTBD3	92	.	0			c.G297A						.						83.0	96.0	91.0					20																	11899220		2203	4300	6503	SO:0001587	stop_gained	22903	exon1			AAACTGGCAGGGT	AB023169	CCDS13113.1, CCDS13114.1	20p12.2	2013-01-08			ENSG00000132640	ENSG00000132640		"""BTB/POZ domain containing"""	15854	protein-coding gene	gene with protein product		615566					Standard	NM_001282551		Approved	KIAA0952, dJ742J24.1	uc002wnz.3	Q9Y2F9	OTTHUMG00000031889	ENST00000405977.1:c.297G>A	chr20.hg19:g.11899220G>A	ENSP00000384545:p.Trp99*	213.0	0.0		182.0	88.0	NM_014962	D3DW19|Q5JY73	Nonsense_Mutation	SNP	ENST00000405977.1	hg19	CCDS13113.1	.	.	.	.	.	.	.	.	.	.	G	38	6.904433	0.97924	.	.	ENSG00000132640	ENST00000254977;ENST00000399006;ENST00000405977;ENST00000422390;ENST00000378226	.	.	.	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	19.8676	0.96824	0.0:0.0:1.0:0.0	.	.	.	.	X	38;38;99;38;99	.	ENSP00000254977:W38X	W	+	3	0	BTBD3	11847220	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.476000	0.97823	2.941000	0.99782	0.655000	0.94253	TGG	.	.		0.478	BTBD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078021.3		
E2F1	1869	hgsc.bcm.edu	37	20	32265105	32265105	+	Missense_Mutation	SNP	C	C	A			TCGA-3K-AAZ8-01A-12D-A38X-10	TCGA-3K-AAZ8-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ca7f5e36-bbb3-44aa-b0c7-3f170a2bbc0f	c70e868a-ba0a-4b90-ad4d-d61ed7b34ecf	g.chr20:32265105C>A	ENST00000343380.5	-	6	1011	c.872G>T	c.(871-873)gGc>gTc	p.G291V	NECAB3_ENST00000375238.4_5'Flank|RP1-63M2.5_ENST00000606866.1_RNA|NECAB3_ENST00000246190.6_5'Flank	NM_005225.2	NP_005216.1	Q01094	E2F1_HUMAN	E2F transcription factor 1	291	Required for interaction with TRIM28.				anoikis (GO:0043276)|apoptotic process (GO:0006915)|cellular response to fatty acid (GO:0071398)|cellular response to hypoxia (GO:0071456)|DNA damage checkpoint (GO:0000077)|forebrain development (GO:0030900)|G1/S transition of mitotic cell cycle (GO:0000082)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|lens fiber cell apoptotic process (GO:1990086)|mitotic cell cycle (GO:0000278)|mRNA stabilization (GO:0048255)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0071930)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of gene expression (GO:0010628)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of G1/S transition of mitotic cell cycle (GO:2000045)|regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Rb-E2F complex (GO:0035189)	core promoter binding (GO:0001047)|DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			NS(2)|breast(1)|endometrium(3)|lung(8)|prostate(1)|upper_aerodigestive_tract(1)	16						ATCGATCGGGCCTTGTTTGCT	0.602																																					p.G291V		Atlas-SNP	.											.	E2F1	41	.	0			c.G872T						.						73.0	74.0	74.0					20																	32265105		2203	4300	6503	SO:0001583	missense	1869	exon6			ATCGGGCCTTGTT		CCDS13224.1	20q11	2008-05-14			ENSG00000101412	ENSG00000101412			3113	protein-coding gene	gene with protein product		189971		RBBP3		8964493	Standard	NM_005225		Approved	RBP3	uc002wzu.4	Q01094	OTTHUMG00000032265	ENST00000343380.5:c.872G>T	chr20.hg19:g.32265105C>A	ENSP00000345571:p.Gly291Val	112.0	0.0		104.0	19.0	NM_005225	Q13143|Q92768	Missense_Mutation	SNP	ENST00000343380.5	hg19	CCDS13224.1	.	.	.	.	.	.	.	.	.	.	C	17.19	3.327054	0.60743	.	.	ENSG00000101412	ENST00000343380	D	0.99727	-6.55	4.85	4.85	0.62838	.	0.171106	0.50627	D	0.000101	D	0.99616	0.9860	M	0.81614	2.55	0.80722	D	1	D	0.89917	1.0	D	0.79108	0.992	D	0.97650	1.0154	10	0.66056	D	0.02	-31.4745	13.5067	0.61486	0.0:0.8433:0.1567:0.0	.	291	Q01094	E2F1_HUMAN	V	291	ENSP00000345571:G291V	ENSP00000345571:G291V	G	-	2	0	E2F1	31728766	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	7.590000	0.82653	2.526000	0.85167	0.462000	0.41574	GGC	.	.		0.602	E2F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078731.2		
SOGA1	140710	hgsc.bcm.edu	37	20	35422173	35422173	+	Missense_Mutation	SNP	T	T	C			TCGA-3K-AAZ8-01A-12D-A38X-10	TCGA-3K-AAZ8-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ca7f5e36-bbb3-44aa-b0c7-3f170a2bbc0f	c70e868a-ba0a-4b90-ad4d-d61ed7b34ecf	g.chr20:35422173T>C	ENST00000357779.3	-	14	3924	c.3598A>G	c.(3598-3600)Aag>Gag	p.K1200E	SOGA1_ENST00000456801.2_Missense_Mutation_p.K1041E|SOGA1_ENST00000279034.6_Intron|SOGA1_ENST00000237536.4_Missense_Mutation_p.K1438E			O94964	SOGA1_HUMAN	suppressor of glucose, autophagy associated 1	1200					insulin receptor signaling pathway (GO:0008286)|negative regulation of gluconeogenesis (GO:0045721)|regulation of autophagy (GO:0010506)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)				endometrium(5)|kidney(1)|lung(21)|urinary_tract(1)	28						GAGCCATACTTGGGGGAGCAG	0.632																																					p.K1438E		Atlas-SNP	.											.	SOGA1	136	.	0			c.A4312G						.						9.0	10.0	10.0					20																	35422173		691	1586	2277	SO:0001583	missense	140710	exon14			CATACTTGGGGGA	AK126630	CCDS46598.1, CCDS54459.1	20q11.23	2012-03-01	2012-02-27	2012-02-27	ENSG00000149639	ENSG00000149639			16111	protein-coding gene	gene with protein product	"""suppressor of glucose by autophagy"", ""suppressor of glucose from autophagy"""		"""chromosome 20 open reading frame 117"", ""KIAA0889"""	C20orf117, KIAA0889		20813965	Standard	NM_080627		Approved	dJ132F21.1, FLJ44670, SOGA	uc021wcx.1	O94964	OTTHUMG00000032395	ENST00000357779.3:c.3598A>G	chr20.hg19:g.35422173T>C	ENSP00000350424:p.Lys1200Glu	27.0	0.0		22.0	10.0	NM_080627	A6NK10|Q14DB2|Q5JW51|Q6ZTG8	Missense_Mutation	SNP	ENST00000357779.3	hg19		.	.	.	.	.	.	.	.	.	.	T	23.1	4.369192	0.82463	.	.	ENSG00000149639	ENST00000237536;ENST00000456801;ENST00000357779	T;T;T	0.33865	1.39;1.5;1.44	4.74	4.74	0.60224	.	0.000000	0.85682	D	0.000000	T	0.53318	0.1789	M	0.72894	2.215	0.58432	D	0.999996	.	.	.	.	.	.	T	0.58521	-0.7622	8	0.87932	D	0	-46.5654	13.3518	0.60605	0.0:0.0:0.0:1.0	.	.	.	.	E	1438;1041;1200	ENSP00000237536:K1438E;ENSP00000413886:K1041E;ENSP00000350424:K1200E	ENSP00000237536:K1438E	K	-	1	0	KIAA0889	34855587	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.980000	0.70516	2.000000	0.58554	0.459000	0.35465	AAG	.	.		0.632	SOGA1-201	KNOWN	basic	protein_coding	protein_coding		NM_199181	
BMP7	655	hgsc.bcm.edu	37	20	55746127	55746127	+	Missense_Mutation	SNP	C	C	A			TCGA-3K-AAZ8-01A-12D-A38X-10	TCGA-3K-AAZ8-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ca7f5e36-bbb3-44aa-b0c7-3f170a2bbc0f	c70e868a-ba0a-4b90-ad4d-d61ed7b34ecf	g.chr20:55746127C>A	ENST00000395863.3	-	7	1689	c.1184G>T	c.(1183-1185)tGc>tTc	p.C395F	BMP7_ENST00000395864.3_Missense_Mutation_p.C329F|BMP7_ENST00000460817.1_5'UTR	NM_001719.2	NP_001710.1	P18075	BMP7_HUMAN	bone morphogenetic protein 7	395					axon guidance (GO:0007411)|BMP signaling pathway (GO:0030509)|branching involved in salivary gland morphogenesis (GO:0060445)|branching morphogenesis of an epithelial tube (GO:0048754)|cartilage development (GO:0051216)|cellular response to hypoxia (GO:0071456)|dendrite development (GO:0016358)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic limb morphogenesis (GO:0030326)|embryonic pattern specification (GO:0009880)|embryonic skeletal joint morphogenesis (GO:0060272)|epithelial cell differentiation (GO:0030855)|epithelial to mesenchymal transition (GO:0001837)|extracellular matrix organization (GO:0030198)|growth (GO:0040007)|mesenchymal cell differentiation (GO:0048762)|mesenchyme development (GO:0060485)|mesoderm formation (GO:0001707)|mesonephros development (GO:0001823)|metanephric mesenchymal cell proliferation involved in metanephros development (GO:0072136)|metanephric mesenchyme morphogenesis (GO:0072133)|metanephros development (GO:0001656)|monocyte aggregation (GO:0070487)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell death (GO:0060548)|negative regulation of glomerular mesangial cell proliferation (GO:0072125)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of mesenchymal cell apoptotic process involved in nephron morphogenesis (GO:0072040)|negative regulation of mitosis (GO:0045839)|negative regulation of neurogenesis (GO:0050768)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of NF-kappaB import into nucleus (GO:0042347)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of Notch signaling pathway (GO:0045746)|negative regulation of phosphorylation (GO:0042326)|negative regulation of prostatic bud formation (GO:0060686)|negative regulation of striated muscle cell apoptotic process (GO:0010664)|negative regulation of transcription, DNA-templated (GO:0045892)|nephrogenic mesenchyme morphogenesis (GO:0072134)|neuron projection morphogenesis (GO:0048812)|odontogenesis of dentin-containing tooth (GO:0042475)|ossification (GO:0001503)|positive regulation of apoptotic process (GO:0043065)|positive regulation of bone mineralization (GO:0030501)|positive regulation of dendrite development (GO:1900006)|positive regulation of heterotypic cell-cell adhesion (GO:0034116)|positive regulation of hyaluranon cable assembly (GO:1900106)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein localization to nucleus (GO:0034504)|regulation of branching involved in prostate gland morphogenesis (GO:0060687)|regulation of pathway-restricted SMAD protein phosphorylation (GO:0060393)|regulation of removal of superoxide radicals (GO:2000121)|response to estradiol (GO:0032355)|response to peptide hormone (GO:0043434)|response to vitamin D (GO:0033280)|skeletal system development (GO:0001501)|SMAD protein signal transduction (GO:0060395)|steroid hormone mediated signaling pathway (GO:0043401)|ureteric bud development (GO:0001657)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane-bounded vesicle (GO:0031988)	heparin binding (GO:0008201)			endometrium(4)|kidney(1)|large_intestine(7)|lung(6)|prostate(1)|skin(1)	20	all_lung(29;0.0133)|Melanoma(10;0.242)		BRCA - Breast invasive adenocarcinoma(4;2.49e-13)|Epithelial(14;1.74e-08)|all cancers(14;2.05e-07)			GGGCGCACAGCAGGGCTTGGG	0.552																																					p.C395F		Atlas-SNP	.											.	BMP7	60	.	0			c.G1184T						.						110.0	90.0	97.0					20																	55746127		2203	4300	6503	SO:0001583	missense	655	exon7			GCACAGCAGGGCT		CCDS13455.1	20q13	2014-01-30	2008-05-22		ENSG00000101144	ENSG00000101144		"""Bone morphogenetic proteins"", ""Endogenous ligands"""	1074	protein-coding gene	gene with protein product	"""osteogenic protein 1"""	112267				1427904	Standard	NM_001719		Approved	OP-1	uc010gip.1	P18075	OTTHUMG00000032812	ENST00000395863.3:c.1184G>T	chr20.hg19:g.55746127C>A	ENSP00000379204:p.Cys395Phe	124.0	0.0		99.0	32.0	NM_001719	Q9H512|Q9NTQ7	Missense_Mutation	SNP	ENST00000395863.3	hg19	CCDS13455.1	.	.	.	.	.	.	.	.	.	.	C	29.5	5.009264	0.93346	.	.	ENSG00000101144	ENST00000395863;ENST00000395864	D;D	0.95069	-3.6;-3.6	5.47	5.47	0.80525	Transforming growth factor-beta, C-terminal (3);	0.084839	0.85682	D	0.000000	D	0.98704	0.9565	H	0.99143	4.445	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.99;0.999	D	0.99548	1.0965	10	0.87932	D	0	.	19.3422	0.94347	0.0:1.0:0.0:0.0	.	329;395	B1AKZ9;P18075	.;BMP7_HUMAN	F	395;329	ENSP00000379204:C395F;ENSP00000379205:C329F	ENSP00000379204:C395F	C	-	2	0	BMP7	55179534	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.711000	0.84669	2.567000	0.86603	0.655000	0.94253	TGC	.	.		0.552	BMP7-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000079831.2		
GAB4	128954	hgsc.bcm.edu	37	22	17446135	17446135	+	Silent	SNP	T	T	G			TCGA-3K-AAZ8-01A-12D-A38X-10	TCGA-3K-AAZ8-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ca7f5e36-bbb3-44aa-b0c7-3f170a2bbc0f	c70e868a-ba0a-4b90-ad4d-d61ed7b34ecf	g.chr22:17446135T>G	ENST00000400588.1	-	7	1419	c.1312A>C	c.(1312-1314)Aga>Cga	p.R438R	GAB4_ENST00000523144.1_5'Flank	NM_001037814.1	NP_001032903.1	Q2WGN9	GAB4_HUMAN	GRB2-associated binding protein family, member 4	438										breast(2)|endometrium(2)|kidney(2)|large_intestine(6)|lung(24)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	44		all_epithelial(15;0.112)|Lung NSC(13;0.248)				CTGTTGTTTCTCAGGTTGGGC	0.552																																					p.R438R		Atlas-SNP	.											.	GAB4	95	.	0			c.A1312C						.						174.0	180.0	178.0					22																	17446135		2013	4215	6228	SO:0001819	synonymous_variant	128954	exon7			TGTTTCTCAGGTT	AK057252	CCDS42976.1	22q11.2	2013-01-10			ENSG00000215568	ENSG00000215568		"""Pleckstrin homology (PH) domain containing"""	18325	protein-coding gene	gene with protein product							Standard	NM_001037814		Approved		uc002zlw.3	Q2WGN9	OTTHUMG00000149992	ENST00000400588.1:c.1312A>C	chr22.hg19:g.17446135T>G		121.0	0.0		116.0	52.0	NM_001037814		Silent	SNP	ENST00000400588.1	hg19	CCDS42976.1																																																																																			.	.		0.552	GAB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000315426.1	XM_372882	
BPIFC	254240	hgsc.bcm.edu	37	22	32833794	32833794	+	Missense_Mutation	SNP	T	T	A			TCGA-3K-AAZ8-01A-12D-A38X-10	TCGA-3K-AAZ8-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ca7f5e36-bbb3-44aa-b0c7-3f170a2bbc0f	c70e868a-ba0a-4b90-ad4d-d61ed7b34ecf	g.chr22:32833794T>A	ENST00000397452.1	-	8	810	c.700A>T	c.(700-702)Atc>Ttc	p.I234F	BPIFC_ENST00000300399.3_Missense_Mutation_p.I234F|BPIFC_ENST00000534972.1_5'UTR|BPIFC_ENST00000432451.2_Missense_Mutation_p.I48F			Q8NFQ6	BPIFC_HUMAN	BPI fold containing family C	234						extracellular region (GO:0005576)	lipopolysaccharide binding (GO:0001530)|phospholipid binding (GO:0005543)										GGAGAACTGATTAGGGAGTAA	0.348																																					p.I234F		Atlas-SNP	.											.	.	.	.	0			c.A700T						.						101.0	93.0	96.0					22																	32833794		2203	4300	6503	SO:0001583	missense	254240	exon7			AACTGATTAGGGA	AF465766	CCDS13906.1	22q12.3	2011-08-04	2011-08-01	2011-08-01	ENSG00000184459	ENSG00000184459		"""BPI fold containing"""	16503	protein-coding gene	gene with protein product		614109	"""bactericidal/permeability-increasing protein-like 2"""	BPIL2			Standard	NM_174932		Approved	dJ149A16.7	uc003amn.2	Q8NFQ6	OTTHUMG00000058273	ENST00000397452.1:c.700A>T	chr22.hg19:g.32833794T>A	ENSP00000380594:p.Ile234Phe	64.0	0.0		58.0	17.0	NM_174932	A2RRF1	Missense_Mutation	SNP	ENST00000397452.1	hg19	CCDS13906.1	.	.	.	.	.	.	.	.	.	.	T	13.77	2.335994	0.41398	.	.	ENSG00000184459	ENST00000397452;ENST00000300399;ENST00000432451	T;T;T	0.04809	3.55;3.55;3.55	5.68	-2.33	0.06724	.	0.536174	0.21330	N	0.076310	T	0.04724	0.0128	M	0.81802	2.56	0.09310	N	0.999996	P;P	0.39216	0.664;0.664	B;B	0.31191	0.08;0.125	T	0.25779	-1.0122	10	0.72032	D	0.01	-3.846	1.2887	0.02056	0.1224:0.2264:0.2513:0.3999	.	48;234	A2RRF1;Q8NFQ6	.;BPIFC_HUMAN	F	234;234;48	ENSP00000380594:I234F;ENSP00000300399:I234F;ENSP00000408920:I48F	ENSP00000300399:I234F	I	-	1	0	BPIFC	31163794	0.000000	0.05858	0.024000	0.17045	0.991000	0.79684	-0.967000	0.03821	-0.346000	0.08312	0.533000	0.62120	ATC	.	.		0.348	BPIFC-010	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000129029.2	NM_174932	
MPST	4357	hgsc.bcm.edu	37	22	37425290	37425290	+	Missense_Mutation	SNP	A	A	G			TCGA-3K-AAZ8-01A-12D-A38X-10	TCGA-3K-AAZ8-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ca7f5e36-bbb3-44aa-b0c7-3f170a2bbc0f	c70e868a-ba0a-4b90-ad4d-d61ed7b34ecf	g.chr22:37425290A>G	ENST00000397225.2	+	3	1544	c.629A>G	c.(628-630)aAc>aGc	p.N210S	MPST_ENST00000404393.1_3'UTR|MPST_ENST00000341116.3_Missense_Mutation_p.N210S|MPST_ENST00000401419.3_Missense_Mutation_p.N210S|MPST_ENST00000397129.1_Missense_Mutation_p.N230S|MPST_ENST00000404802.3_Missense_Mutation_p.N210S|MPST_ENST00000429360.2_Missense_Mutation_p.N210S			P25325	THTM_HUMAN	mercaptopyruvate sulfurtransferase	210	Rhodanese 2. {ECO:0000255|PROSITE- ProRule:PRU00173}.				cyanate catabolic process (GO:0009440)|hydrogen sulfide biosynthetic process (GO:0070814)|response to toxic substance (GO:0009636)	cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)|neuron projection (GO:0043005)|synapse (GO:0045202)	3-mercaptopyruvate sulfurtransferase activity (GO:0016784)|thiosulfate sulfurtransferase activity (GO:0004792)			central_nervous_system(2)|kidney(1)|lung(2)|prostate(1)|skin(1)	7						GGTACCGTGAACATCCCCTTC	0.547																																					p.N230S		Atlas-SNP	.											.	MPST	14	.	0			c.A689G						.						49.0	43.0	45.0					22																	37425290		2203	4300	6503	SO:0001583	missense	4357	exon3			CCGTGAACATCCC	X59434	CCDS13939.1	22q13.1	2010-04-27			ENSG00000128309	ENSG00000128309	2.8.1.2		7223	protein-coding gene	gene with protein product	"""human liver rhodanese"""	602496				1953758	Standard	NM_021126		Approved	MST, TST2	uc011amu.3	P25325	OTTHUMG00000150543	ENST00000397225.2:c.629A>G	chr22.hg19:g.37425290A>G	ENSP00000380402:p.Asn210Ser	111.0	0.0		128.0	56.0	NM_021126	A8MZ34|B3KP52|J3KPV7|O75750|Q6FHN9	Missense_Mutation	SNP	ENST00000397225.2	hg19	CCDS13939.1	.	.	.	.	.	.	.	.	.	.	A	11.79	1.744594	0.30865	.	.	ENSG00000128309	ENST00000401419;ENST00000397129;ENST00000404802;ENST00000341116;ENST00000429360;ENST00000397225;ENST00000446076	T;T;T;T;T;T	0.30182	1.54;1.54;1.54;1.54;1.54;1.54	5.35	5.35	0.76521	Rhodanese-like (5);	0.040345	0.85682	D	0.000000	T	0.29190	0.0726	L	0.56280	1.765	0.80722	D	1	P;P	0.42375	0.778;0.778	B;B	0.39258	0.295;0.295	T	0.05582	-1.0876	10	0.39692	T	0.17	-13.9949	11.3057	0.49334	0.9267:0.0:0.0733:0.0	.	210;210	Q6FHN9;P25325	.;THTM_HUMAN	S	210;230;210;210;210;210;211	ENSP00000384812:N210S;ENSP00000380318:N230S;ENSP00000383950:N210S;ENSP00000342333:N210S;ENSP00000411719:N210S;ENSP00000380402:N210S	ENSP00000342333:N210S	N	+	2	0	MPST	35755236	1.000000	0.71417	0.997000	0.53966	0.679000	0.39708	3.982000	0.56909	2.013000	0.59113	0.528000	0.53228	AAC	.	.		0.547	MPST-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318832.1	NM_001013440	
ENTHD1	150350	hgsc.bcm.edu	37	22	40140015	40140015	+	Missense_Mutation	SNP	G	G	C			TCGA-3K-AAZ8-01A-12D-A38X-10	TCGA-3K-AAZ8-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ca7f5e36-bbb3-44aa-b0c7-3f170a2bbc0f	c70e868a-ba0a-4b90-ad4d-d61ed7b34ecf	g.chr22:40140015G>C	ENST00000325157.6	-	7	1743	c.1493C>G	c.(1492-1494)tCt>tGt	p.S498C		NM_152512.3	NP_689725.2	Q8IYW4	ENTD1_HUMAN	ENTH domain containing 1	498										breast(2)|endometrium(1)|kidney(6)|large_intestine(6)|lung(11)|ovary(3)|skin(3)	32	Melanoma(58;0.0749)					AGCAGAATCAGAGTTATTTGG	0.438																																					p.S498C		Atlas-SNP	.											.	ENTHD1	83	.	0			c.C1493G						.						55.0	58.0	57.0					22																	40140015		2203	4300	6503	SO:0001583	missense	150350	exon7			GAATCAGAGTTAT	AK093154	CCDS13998.1	22q13.1	2006-06-26			ENSG00000176177	ENSG00000176177			26352	protein-coding gene	gene with protein product						12477932	Standard	NM_152512		Approved	FLJ25421	uc003ayg.3	Q8IYW4	OTTHUMG00000151098	ENST00000325157.6:c.1493C>G	chr22.hg19:g.40140015G>C	ENSP00000317431:p.Ser498Cys	134.0	0.0		118.0	52.0	NM_152512	B0QYD5|Q5H9F7|Q96LK3	Missense_Mutation	SNP	ENST00000325157.6	hg19	CCDS13998.1	.	.	.	.	.	.	.	.	.	.	G	10.74	1.436111	0.25813	.	.	ENSG00000176177	ENST00000325157	T	0.34472	1.36	5.63	4.61	0.57282	.	1.023730	0.07785	N	0.954025	T	0.55878	0.1948	M	0.66939	2.045	0.09310	N	1	D	0.71674	0.998	P	0.60173	0.87	T	0.40251	-0.9573	10	0.87932	D	0	-0.252	10.7061	0.45956	0.088:0.0:0.912:0.0	.	498	Q8IYW4	ENTD1_HUMAN	C	498	ENSP00000317431:S498C	ENSP00000317431:S498C	S	-	2	0	ENTHD1	38469961	0.959000	0.32827	0.003000	0.11579	0.051000	0.14879	4.746000	0.62133	1.363000	0.46019	0.557000	0.71058	TCT	.	.		0.438	ENTHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321302.1	NM_152512	
CXorf38	159013	hgsc.bcm.edu	37	X	40506585	40506585	+	Missense_Mutation	SNP	C	C	T			TCGA-3K-AAZ8-01A-12D-A38X-10	TCGA-3K-AAZ8-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ca7f5e36-bbb3-44aa-b0c7-3f170a2bbc0f	c70e868a-ba0a-4b90-ad4d-d61ed7b34ecf	g.chrX:40506585C>T	ENST00000327877.5	-	1	214	c.188G>A	c.(187-189)gGc>gAc	p.G63D	CXorf38_ENST00000378421.1_5'UTR|CXorf38_ENST00000378426.1_5'UTR|CXorf38_ENST00000440784.2_Missense_Mutation_p.G63D|CXorf38_ENST00000378418.2_Missense_Mutation_p.G63D	NM_144970.2	NP_659407.1	Q8TB03	CX038_HUMAN	chromosome X open reading frame 38	63										NS(1)|breast(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(3)|ovary(1)|urinary_tract(1)	12						GCACCGTGAGCCGCCGCGGCA	0.756																																					p.G63D		Atlas-SNP	.											.	CXorf38	29	.	0			c.G188A						.						2.0	3.0	3.0					X																	40506585		1413	2900	4313	SO:0001583	missense	159013	exon1			CGTGAGCCGCCGC	AL832829	CCDS14253.1	Xp11	2008-02-05			ENSG00000185753	ENSG00000185753			28589	protein-coding gene	gene with protein product							Standard	NM_144970		Approved	MGC39350	uc004dew.3	Q8TB03	OTTHUMG00000024104	ENST00000327877.5:c.188G>A	chrX.hg19:g.40506585C>T	ENSP00000330488:p.Gly63Asp	23.0	0.0		10.0	6.0	NM_144970	B3KW28|D3DWB5|Q5JPF5|Q8N941	Missense_Mutation	SNP	ENST00000327877.5	hg19	CCDS14253.1	.	.	.	.	.	.	.	.	.	.	C	14.92	2.679496	0.47886	.	.	ENSG00000185753	ENST00000327877;ENST00000440784;ENST00000378418	T;T	0.45276	0.95;0.9	4.65	3.78	0.43462	.	0.620260	0.17251	N	0.181162	T	0.31544	0.0800	L	0.40543	1.245	0.09310	N	1	P;B	0.36909	0.573;0.253	B;B	0.36244	0.22;0.128	T	0.10870	-1.0611	10	0.31617	T	0.26	-1.7911	8.1768	0.31287	0.0:0.8003:0.0:0.1997	.	63;63	E7EN46;Q8TB03	.;CX038_HUMAN	D	63	ENSP00000330488:G63D;ENSP00000400019:G63D	ENSP00000330488:G63D	G	-	2	0	CXorf38	40391529	0.006000	0.16342	0.819000	0.32651	0.698000	0.40448	0.440000	0.21592	1.075000	0.40932	0.506000	0.49869	GGC	.	.		0.756	CXorf38-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060685.3	NM_144970	
PDZD4	57595	hgsc.bcm.edu	37	X	153068845	153068845	+	Missense_Mutation	SNP	C	C	T			TCGA-3K-AAZ8-01A-12D-A38X-10	TCGA-3K-AAZ8-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ca7f5e36-bbb3-44aa-b0c7-3f170a2bbc0f	c70e868a-ba0a-4b90-ad4d-d61ed7b34ecf	g.chrX:153068845C>T	ENST00000164640.4	-	8	2464	c.2273G>A	c.(2272-2274)cGg>cAg	p.R758Q	PDZD4_ENST00000544474.1_Missense_Mutation_p.R649Q|PDZD4_ENST00000475140.1_5'Flank|PDZD4_ENST00000393758.2_Missense_Mutation_p.R683Q	NM_032512.2	NP_115901.2	Q76G19	PDZD4_HUMAN	PDZ domain containing 4	758						cytoplasm (GO:0005737)		p.R758L(1)		breast(3)|cervix(1)|endometrium(5)|lung(13)|skin(1)	23	all_lung(58;3.39e-06)|all_hematologic(71;4.25e-06)|Lung NSC(58;4.7e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					GTTGTAGACCCGCTTGCCATC	0.652																																					p.R758Q		Atlas-SNP	.											.	PDZD4	67	.	1	Substitution - Missense(1)	lung(1)	c.G2273A						.						61.0	48.0	52.0					X																	153068845		2199	4299	6498	SO:0001583	missense	57595	exon8			TAGACCCGCTTGC	AK091444	CCDS14732.1	Xq28	2008-02-05		2006-01-24	ENSG00000067840	ENSG00000067840			21167	protein-coding gene	gene with protein product		300634		PDZK4		10819331, 15077175	Standard	NM_032512		Approved	KIAA1444, LU1, FLJ34125, PDZRN4L	uc004fiz.1	Q76G19	OTTHUMG00000024209	ENST00000164640.4:c.2273G>A	chrX.hg19:g.153068845C>T	ENSP00000164640:p.Arg758Gln	32.0	0.0		21.0	15.0	NM_032512	B3KXB1|B7ZKY3|Q8NB75|Q9BUH9|Q9P284	Missense_Mutation	SNP	ENST00000164640.4	hg19	CCDS14732.1	.	.	.	.	.	.	.	.	.	.	C	16.45	3.128136	0.56721	.	.	ENSG00000067840	ENST00000164640;ENST00000393758;ENST00000537633;ENST00000544474	T;T;T	0.74842	-0.88;-0.88;-0.88	5.64	4.78	0.61160	.	0.052317	0.64402	D	0.000001	T	0.76572	0.4006	M	0.67953	2.075	0.37954	D	0.932731	P;D;D;D;P	0.60160	0.796;0.98;0.975;0.987;0.658	B;P;B;P;B	0.48114	0.124;0.567;0.314;0.566;0.071	T	0.81187	-0.1047	10	0.66056	D	0.02	-31.7173	12.6483	0.56748	0.0:0.9169:0.0:0.0831	.	649;764;758;683;662	B7ZKY3;Q17RL8;Q76G19;D3DWW0;B3KVR9	.;.;PDZD4_HUMAN;.;.	Q	758;683;662;649	ENSP00000164640:R758Q;ENSP00000377355:R683Q;ENSP00000442033:R649Q	ENSP00000164640:R758Q	R	-	2	0	PDZD4	152722039	0.190000	0.23276	0.986000	0.45419	0.374000	0.29953	3.162000	0.50755	1.153000	0.42468	-0.297000	0.09499	CGG	.	.		0.652	PDZD4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000061013.3	NM_032512	
MT-ND5	4540	hgsc.bcm.edu	37	M	13722	13722	+	Silent	SNP	A	A	G			TCGA-3K-AAZ8-01A-12D-A38X-10	TCGA-3K-AAZ8-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ca7f5e36-bbb3-44aa-b0c7-3f170a2bbc0f	c70e868a-ba0a-4b90-ad4d-d61ed7b34ecf	g.chrM:13722A>G	ENST00000361567.2	+	1	1386	c.1386A>G	c.(1384-1386)ctA>ctG	p.L462L	MT-TT_ENST00000387460.2_RNA|MT-TE_ENST00000387459.1_RNA|MT-CYB_ENST00000361789.2_5'Flank|MT-TS2_ENST00000387449.1_RNA|MT-TP_ENST00000387461.2_RNA|MT-TL2_ENST00000387456.1_RNA|MT-TH_ENST00000387441.1_RNA			P03915	NU5M_HUMAN	mitochondrially encoded NADH dehydrogenase 5	462					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(4)|endometrium(29)|kidney(33)|pancreas(1)|prostate(7)	74						GCCGGAAGCCTATTCGCAGGA	0.498																																					p.L462L		Atlas-SNP	.											.	.	.	.	0			c.A1386G						.																																			SO:0001819	synonymous_variant	0	exon1			AAGCCTATTCGCA			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198786	ENSG00000198786	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7461	protein-coding gene	gene with protein product	"""complex I ND5 subunit"", ""NADH-ubiquinone oxidoreductase chain 5"""	516005	"""NADH dehydrogenase 5"""	MTND5			Standard			Approved	ND5, NAD5		P03915		ENST00000361567.2:c.1386A>G	chrM.hg19:g.13722A>G		24.0	0.0		35.0	33.0	ENST00000361567	Q34773|Q8WCY3	Silent	SNP	ENST00000361567.2	hg19																																																																																				.	.		0.498	MT-ND5-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024036	
CHEK1	1111	hgsc.bcm.edu	37	11	125496682	125496683	+	Frame_Shift_Ins	INS	-	-	A			TCGA-3K-AAZ8-01A-12D-A38X-10	TCGA-3K-AAZ8-10A-01D-A38X-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ca7f5e36-bbb3-44aa-b0c7-3f170a2bbc0f	c70e868a-ba0a-4b90-ad4d-d61ed7b34ecf	g.chr11:125496682_125496683insA	ENST00000534070.1	+	2	274_275	c.19_20insA	c.(19-21)gaafs	p.E7fs	CHEK1_ENST00000428830.2_Frame_Shift_Ins_p.E7fs|CHEK1_ENST00000438015.1_Frame_Shift_Ins_p.E7fs|CHEK1_ENST00000532449.1_3'UTR|CHEK1_ENST00000278916.3_Frame_Shift_Ins_p.E7fs|CHEK1_ENST00000524737.1_Frame_Shift_Ins_p.E7fs|CHEK1_ENST00000544373.1_Frame_Shift_Ins_p.E7fs|CHEK1_ENST00000427383.2_Frame_Shift_Ins_p.K98fs	NM_001274.5	NP_001265.2	O14757	CHK1_HUMAN	checkpoint kinase 1	7	Interaction with CLSPN. {ECO:0000250}.				cellular response to caffeine (GO:0071313)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to mechanical stimulus (GO:0071260)|chromatin-mediated maintenance of transcription (GO:0048096)|DNA damage checkpoint (GO:0000077)|DNA damage induced protein phosphorylation (GO:0006975)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|G2 DNA damage checkpoint (GO:0031572)|G2/M transition of mitotic cell cycle (GO:0000086)|negative regulation of mitosis (GO:0045839)|peptidyl-threonine phosphorylation (GO:0018107)|regulation of cell proliferation (GO:0042127)|regulation of double-strand break repair via homologous recombination (GO:0010569)|regulation of histone H3-K9 acetylation (GO:2000615)|regulation of mitotic centrosome separation (GO:0046602)|regulation of transcription from RNA polymerase II promoter in response to UV-induced DNA damage (GO:0010767)|replicative senescence (GO:0090399)	centrosome (GO:0005813)|chromatin (GO:0000785)|condensed nuclear chromosome (GO:0000794)|cytosol (GO:0005829)|extracellular space (GO:0005615)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|replication fork (GO:0005657)	ATP binding (GO:0005524)|histone kinase activity (H3-T11 specific) (GO:0035402)|protein serine/threonine kinase activity (GO:0004674)			central_nervous_system(3)|endometrium(3)|large_intestine(2)|lung(16)|skin(1)|upper_aerodigestive_tract(1)	26	all_hematologic(175;0.228)	Breast(109;0.0021)|Lung NSC(97;0.0126)|all_lung(97;0.0132)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.13e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0748)		GCCCTTTGTGGAAGACTGGGAC	0.49								Other conserved DNA damage response genes			OREG0021478	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.E7fs		Atlas-Indel,Pindel	.											.	CHEK1	44	.	0			c.19_20insA						.																																			SO:0001589	frameshift_variant	1111	exon2			.	AF016582, BC017575	CCDS8459.1, CCDS58191.1	11q24.2	2011-11-11	2011-11-11		ENSG00000149554	ENSG00000149554			1925	protein-coding gene	gene with protein product		603078	"""CHK1 (checkpoint, S.pombe) homolog"", ""CHK1 checkpoint homolog (S. pombe)"""			9278511, 9382850	Standard	NM_001114121		Approved	CHK1	uc001qcg.4	O14757	OTTHUMG00000165853	ENST00000534070.1:c.21dupA	chr11.hg19:g.125496684_125496684dupA	ENSP00000435371:p.Glu7fs	155.0	0.0	1542	159.0	26.0	NM_001114122	A8K934|B4DDD0|B4DSK3|B5BTY6|F5H7S4|H2BI51	Frame_Shift_Ins	INS	ENST00000534070.1	hg19	CCDS8459.1																																																																																			.	.		0.490	CHEK1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386714.1	NM_001274	
DENND5B	160518	hgsc.bcm.edu	37	12	31633069	31633069	+	Frame_Shift_Del	DEL	A	A	-			TCGA-3K-AAZ8-01A-12D-A38X-10	TCGA-3K-AAZ8-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ca7f5e36-bbb3-44aa-b0c7-3f170a2bbc0f	c70e868a-ba0a-4b90-ad4d-d61ed7b34ecf	g.chr12:31633069delA	ENST00000389082.5	-	3	622	c.358delT	c.(358-360)tatfs	p.Y120fs	DENND5B_ENST00000354285.4_Frame_Shift_Del_p.Y142fs|DENND5B_ENST00000545147.1_Intron|DENND5B_ENST00000306833.6_Frame_Shift_Del_p.Y155fs|DENND5B_ENST00000536562.1_Frame_Shift_Del_p.Y155fs	NM_144973.3	NP_659410.3	Q6ZUT9	DEN5B_HUMAN	DENN/MADD domain containing 5B	120	UDENN.				positive regulation of Rab GTPase activity (GO:0032851)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)			NS(2)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(8)|lung(17)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	38						ACTTCTTCATAAAAAGTGAGA	0.413																																					p.Y120fs		Atlas-Indel,Pindel	.											.	DENND5B	114	.	0			c.359delA						.						61.0	58.0	59.0					12																	31633069		1959	4165	6124	SO:0001589	frameshift_variant	160518	exon3			.	AF086301	CCDS44857.1	12p11.21	2012-10-03			ENSG00000170456	ENSG00000170456		"""DENN/MADD domain containing"""	28338	protein-coding gene	gene with protein product						12477932	Standard	NM_144973		Approved	MGC24039	uc001rki.1	Q6ZUT9	OTTHUMG00000169034	ENST00000389082.5:c.358delT	chr12.hg19:g.31633069delA	ENSP00000373734:p.Tyr120fs	104.0	0.0		80.0	36.0	NM_144973	B5ME75|Q59FW8|Q68CZ7|Q6NUJ0|Q7Z3F9|Q8N973|Q8WUC8	Frame_Shift_Del	DEL	ENST00000389082.5	hg19	CCDS44857.1																																																																																			.	.		0.413	DENND5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402040.1	NM_144973	
AIM1L	55057	hgsc.bcm.edu	37	1	26671856	26671856	+	5'Flank	DEL	G	G	-			TCGA-3K-AAZ8-01A-12D-A38X-10	TCGA-3K-AAZ8-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ca7f5e36-bbb3-44aa-b0c7-3f170a2bbc0f	c70e868a-ba0a-4b90-ad4d-d61ed7b34ecf	g.chr1:26671856delG	ENST00000308182.5	-	0	0				AIM1L_ENST00000527815.1_5'Flank			Q8N1P7	AIM1L_HUMAN	absent in melanoma 1-like								carbohydrate binding (GO:0030246)			endometrium(2)|kidney(2)|large_intestine(1)|lung(4)|pancreas(1)|skin(2)	12		all_cancers(24;4.67e-25)|Colorectal(325;3.46e-05)|all_lung(284;5.94e-05)|Lung NSC(340;7.26e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.00637)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|OV - Ovarian serous cystadenocarcinoma(117;1.51e-27)|Colorectal(126;1.61e-08)|COAD - Colon adenocarcinoma(152;9.32e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.000792)|BRCA - Breast invasive adenocarcinoma(304;0.00104)|STAD - Stomach adenocarcinoma(196;0.00154)|GBM - Glioblastoma multiforme(114;0.00858)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.165)|LUSC - Lung squamous cell carcinoma(448;0.239)		CTCCTGGGCTGGGGACATCCT	0.567																																					p.S432fs		Atlas-Indel,Pindel	.											.	AIM1L	98	.	0			c.1294delA						.						38.0	43.0	41.0					1																	26671856		2026	4175	6201	SO:0001631	upstream_gene_variant	55057	exon2			.			1p35	2010-07-14			ENSG00000176092	ENSG00000176092			17295	protein-coding gene	gene with protein product	"""beta-gamma crystallin domain containing 2"""						Standard	NM_001039775		Approved	CRYBG2, FLJ38020	uc001bmd.4	Q8N1P7	OTTHUMG00000003490		chr1.hg19:g.26671856delG	Exception_encountered	54.0	0.0		53.0	23.0	NM_001039775	B2RNG3|Q5T137|Q5T150	Frame_Shift_Del	DEL	ENST00000308182.5	hg19																																																																																				.	.		0.567	AIM1L-201	KNOWN	basic	protein_coding	protein_coding		NM_001039775.2	
MRGPRF	116535	hgsc.bcm.edu	37	11	68772841	68772841	+	Frame_Shift_Del	DEL	C	C	-			TCGA-3K-AAZ8-01A-12D-A38X-10	TCGA-3K-AAZ8-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ca7f5e36-bbb3-44aa-b0c7-3f170a2bbc0f	c70e868a-ba0a-4b90-ad4d-d61ed7b34ecf	g.chr11:68772841delC	ENST00000309099.6	-	3	1319	c.937delG	c.(937-939)gccfs	p.A313fs	RP11-554A11.5_ENST00000562506.1_RNA|MRGPRF_ENST00000441623.1_Frame_Shift_Del_p.A313fs	NM_145015.4	NP_659452.3	Q96AM1	MRGRF_HUMAN	MAS-related GPR, member F	313						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			endometrium(3)|lung(4)	7			STAD - Stomach adenocarcinoma(18;0.0208)|LUAD - Lung adenocarcinoma(13;0.0713)			TCCCGCAGGGCCCGCTGGAAG	0.682																																					p.A313fs		Atlas-INDEL	.											.	MRGPRF	22	.	0			c.938delC						.						13.0	11.0	11.0					11																	68772841		2175	4265	6440	SO:0001589	frameshift_variant	116535	exon3			.	AK075492	CCDS8188.1	11q13.1	2014-03-13	2004-03-25		ENSG00000172935	ENSG00000172935		"""GPCR / Class A : Orphans"""	24828	protein-coding gene	gene with protein product		607233	"""G protein-coupled receptor 168"", ""G protein-coupled receptor 140"""	GPR168, GPR140		12477932	Standard	NM_001098515		Approved	MGC21621, mrgF	uc001oop.4	Q96AM1	OTTHUMG00000167897	ENST00000309099.6:c.937delG	chr11.hg19:g.68772841delC	ENSP00000309782:p.Ala313fs	48.0	0.0		28.0	13.0	NM_001098515	B3KV43|Q8NBK8	Frame_Shift_Del	DEL	ENST00000309099.6	hg19	CCDS8188.1																																																																																			.	.		0.682	MRGPRF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396875.1	NM_145015	
ALB	213	hgsc.bcm.edu	37	4	74279213	74279215	+	In_Frame_Del	DEL	TGT	TGT	-			TCGA-3K-AAZ8-01A-12D-A38X-10	TCGA-3K-AAZ8-10A-01D-A38X-10	TGT	TGT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ca7f5e36-bbb3-44aa-b0c7-3f170a2bbc0f	c70e868a-ba0a-4b90-ad4d-d61ed7b34ecf	g.chr4:74279213_74279215delTGT	ENST00000503124.1	+	6	677_679	c.470_472delTGT	c.(469-474)ctgttg>ctg	p.157_158LL>L	ALB_ENST00000415165.2_In_Frame_Del_p.115_116LL>L|ALB_ENST00000509063.1_In_Frame_Del_p.307_308LL>L|ALB_ENST00000401494.3_In_Frame_Del_p.192_193LL>L|ALB_ENST00000505649.1_3'UTR|ALB_ENST00000295897.4_In_Frame_Del_p.307_308LL>L			Q8TES7	FBF1_HUMAN	albumin	0					apical junction assembly (GO:0043297)|cilium assembly (GO:0042384)|establishment of epithelial cell polarity (GO:0090162)	cell junction (GO:0030054)|centriole (GO:0005814)|ciliary transition fiber (GO:0097539)|spindle pole (GO:0000922)				NS(1)|endometrium(4)|kidney(1)|large_intestine(6)|liver(9)|lung(16)|ovary(3)|prostate(2)|skin(4)|stomach(1)|urinary_tract(1)	48	Breast(15;0.00102)		Epithelial(6;4.8e-05)|OV - Ovarian serous cystadenocarcinoma(6;0.000263)|all cancers(17;0.000472)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			GAAAAACCTCTGTTGGAAAAATC	0.409																																					p.307_307del		Atlas-Indel,Pindel	.											.	ALB	132	.	0			c.919_921del						.																																			SO:0001651	inframe_deletion	213	exon8			.	V00494	CCDS3555.1	4q13.3	2008-02-05	2006-06-30	2006-06-30	ENSG00000163631	ENSG00000163631			399	protein-coding gene	gene with protein product		103600				6292049, 6192711	Standard	NM_000477		Approved		uc003hgs.4	P02768	OTTHUMG00000129919	ENST00000503124.1:c.470_472delTGT	chr4.hg19:g.74279213_74279215delTGT	ENSP00000421027:p.Leu158del	154.0	0.0		128.0	30.0	NM_000477	B5MEM5|Q96IF6|Q96JG4|Q96MA8	In_Frame_Del	DEL	ENST00000503124.1	hg19																																																																																				.	.		0.409	ALB-011	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000365419.1	NM_000477	
GIGYF1	64599	hgsc.bcm.edu	37	7	100284298	100284298	+	Frame_Shift_Del	DEL	C	C	-			TCGA-3K-AAZ8-01A-12D-A38X-10	TCGA-3K-AAZ8-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ca7f5e36-bbb3-44aa-b0c7-3f170a2bbc0f	c70e868a-ba0a-4b90-ad4d-d61ed7b34ecf	g.chr7:100284298delC	ENST00000275732.5	-	7	1877	c.668delG	c.(667-669)ggcfs	p.G223fs	GIGYF1_ENST00000471340.2_Intron	NM_022574.4	NP_072096.2	O75420	PERQ1_HUMAN	GRB10 interacting GYF protein 1	223					insulin-like growth factor receptor signaling pathway (GO:0048009)					central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(6)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	23	Lung NSC(181;0.035)|all_lung(186;0.0509)|Esophageal squamous(72;0.0817)					CCAGCGGTCGCCGTCTCGCCG	0.687																																					p.G223fs		Atlas-Indel,Pindel	.											.	GIGYF1	113	.	0			c.669delC						.						27.0	33.0	31.0					7																	100284298		2199	4288	6487	SO:0001589	frameshift_variant	64599	exon7			.	AF053356	CCDS34708.1	7q22	2008-02-11	2008-02-11	2008-02-11	ENSG00000146830	ENSG00000146830			9126	protein-coding gene	gene with protein product	"""GYF domain containing 1"""	612064	"""PERQ amino acid rich, with GYF domain 1"""	PERQ1		9799793, 12771153	Standard	NM_022574		Approved	GYF1	uc003uwg.1	O75420	OTTHUMG00000157036	ENST00000275732.5:c.668delG	chr7.hg19:g.100284298delC	ENSP00000275732:p.Gly223fs	57.0	0.0		63.0	34.0	NM_022574	Q6Y7W7|Q8WZ38	Frame_Shift_Del	DEL	ENST00000275732.5	hg19	CCDS34708.1																																																																																			.	.		0.687	GIGYF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347205.2	NM_022574	
ALB	213	hgsc.bcm.edu	37	4	74283862	74283863	+	Frame_Shift_Del	DEL	AG	AG	-			TCGA-3K-AAZ8-01A-12D-A38X-10	TCGA-3K-AAZ8-10A-01D-A38X-10	AG	AG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ca7f5e36-bbb3-44aa-b0c7-3f170a2bbc0f	c70e868a-ba0a-4b90-ad4d-d61ed7b34ecf	g.chr4:74283862_74283863delAG	ENST00000503124.1	+	10	1243_1244	c.1036_1037delAG	c.(1036-1038)agafs	p.R346fs	ALB_ENST00000415165.2_Frame_Shift_Del_p.R304fs|ALB_ENST00000509063.1_Frame_Shift_Del_p.R496fs|ALB_ENST00000401494.3_Frame_Shift_Del_p.R381fs|ALB_ENST00000505649.1_3'UTR|ALB_ENST00000295897.4_Frame_Shift_Del_p.R496fs			Q8TES7	FBF1_HUMAN	albumin	0					apical junction assembly (GO:0043297)|cilium assembly (GO:0042384)|establishment of epithelial cell polarity (GO:0090162)	cell junction (GO:0030054)|centriole (GO:0005814)|ciliary transition fiber (GO:0097539)|spindle pole (GO:0000922)				NS(1)|endometrium(4)|kidney(1)|large_intestine(6)|liver(9)|lung(16)|ovary(3)|prostate(2)|skin(4)|stomach(1)|urinary_tract(1)	48	Breast(15;0.00102)		Epithelial(6;4.8e-05)|OV - Ovarian serous cystadenocarcinoma(6;0.000263)|all cancers(17;0.000472)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			AGTAAGTGACAGAGTCACCAAA	0.455																																					p.495_496del		Pindel	.											.	ALB	132	.	0			c.1485_1486del						.																																			SO:0001589	frameshift_variant	213	exon12			.	V00494	CCDS3555.1	4q13.3	2008-02-05	2006-06-30	2006-06-30	ENSG00000163631	ENSG00000163631			399	protein-coding gene	gene with protein product		103600				6292049, 6192711	Standard	NM_000477		Approved		uc003hgs.4	P02768	OTTHUMG00000129919	ENST00000503124.1:c.1036_1037delAG	chr4.hg19:g.74283864_74283865delAG	ENSP00000421027:p.Arg346fs	98.0	0.0		67.0	13.0	NM_000477	B5MEM5|Q96IF6|Q96JG4|Q96MA8	Frame_Shift_Del	DEL	ENST00000503124.1	hg19																																																																																				.	.		0.455	ALB-011	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000365419.1	NM_000477	
UMODL1	89766	hgsc.bcm.edu	37	21	43531290	43531364	+	Intron	DEL	CCAGCCAGGGGAGCCCCAGCCAGGGGAGCCTCAGACAGGAGAGTACCAGCCAGGCGAGCCCCAGCCAGAGGAGCA	CCAGCCAGGGGAGCCCCAGCCAGGGGAGCCTCAGACAGGAGAGTACCAGCCAGGCGAGCCCCAGCCAGAGGAGCA	-	rs535263851|rs200737746|rs201758093|rs76618631|rs566694501|rs114358105|rs539769558	byFrequency	TCGA-3K-AAZ8-01A-12D-A38X-10	TCGA-3K-AAZ8-10A-01D-A38X-10	CCAGCCAGGGGAGCCCCAGCCAGGGGAGCCTCAGACAGGAGAGTACCAGCCAGGCGAGCCCCAGCCAGAGGAGCA	CCAGCCAGGGGAGCCCCAGCCAGGGGAGCCTCAGACAGGAGAGTACCAGCCAGGCGAGCCCCAGCCAGAGGAGCA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ca7f5e36-bbb3-44aa-b0c7-3f170a2bbc0f	c70e868a-ba0a-4b90-ad4d-d61ed7b34ecf	g.chr21:43531290_43531364delCCAGCCAGGGGAGCCCCAGCCAGGGGAGCCTCAGACAGGAGAGTACCAGCCAGGCGAGCCCCAGCCAGAGGAGCA	ENST00000408910.2	+	11	1899				UMODL1_ENST00000400424.2_Intron|UMODL1_ENST00000400427.1_In_Frame_Del_p.SQGSPSQGSLRQESTSQASPSQRST582del|UMODL1_ENST00000408989.2_In_Frame_Del_p.SQGSPSQGSLRQESTSQASPSQRST654del|C21orf128_ENST00000329015.2_5'Flank	NM_001004416.2	NP_001004416	Q5DID0	UROL1_HUMAN	uromodulin-like 1						adipose tissue development (GO:0060612)|cellular response to gonadotropin-releasing hormone (GO:0097211)|multicellular organismal reproductive process (GO:0048609)|regulation of apoptotic process (GO:0042981)|regulation of gene expression (GO:0010468)|regulation of ovarian follicle development (GO:2000354)|single fertilization (GO:0007338)	cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|peptidase inhibitor activity (GO:0030414)			breast(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(5)|lung(22)|ovary(2)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	47						CAGGTGAACCCCAGCCAGGGGAGCCCCAGCCAGGGGAGCCTCAGACAGGAGAGTACCAGCCAGGCGAGCCCCAGCCAGAGGAGCACCAGCCAGGG	0.698																																					p.653_677del	Pancreas(122;680 807 13940 14411 22888 25505 31742 36028 36332 38435)	Pindel	.											.	UMODL1	186	.	0			c.1957_2031del						.																																			SO:0001627	intron_variant	89766	exon11			.		CCDS42935.1, CCDS42936.1, CCDS56214.1, CCDS56215.1	21q22.3	2008-07-04			ENSG00000177398	ENSG00000177398			12560	protein-coding gene	gene with protein product	"""olfactorin"""	613859				16026467	Standard	NM_173568		Approved		uc002zag.1	Q5DID0	OTTHUMG00000086788	ENST00000408910.2:c.1899+59CCAGCCAGGGGAGCCCCAGCCAGGGGAGCCTCAGACAGGAGAGTACCAGCCAGGCGAGCCCCAGCCAGAGGAGCA>-	chr21.hg19:g.43531290_43531364delCCAGCCAGGGGAGCCCCAGCCAGGGGAGCCTCAGACAGGAGAGTACCAGCCAGGCGAGCCCCAGCCAGAGGAGCA		66.0	0.0		76.0	16.0	NM_173568	C9JCE6|Q5DIC9|Q6LA40|Q6LA41|Q8N216	In_Frame_Del	DEL	ENST00000408910.2	hg19	CCDS42936.1																																																																																			.	.		0.698	UMODL1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195292.2		
MUC4	4585	hgsc.bcm.edu	37	3	195506007	195506102	+	In_Frame_Del	DEL	GGTGACAGGAAGAGGCGTGGTGTCACCTGTGGATACTGAGGAAAGGCTGGTGACAGGAAGAGGGGTGGCCTGACCTGTGGATGCAGAGGAAGTGTC	GGTGACAGGAAGAGGCGTGGTGTCACCTGTGGATACTGAGGAAAGGCTGGTGACAGGAAGAGGGGTGGCCTGACCTGTGGATGCAGAGGAAGTGTC	-	rs568017375|rs199748333|rs529273490|rs191235959|rs547812110|rs559770239|rs531891299|rs574341510|rs544126797|rs564750842|rs545980189|rs553395016|rs367572598|rs566138201|rs562257952|rs555863624|rs566197584|rs376661673|rs200152370|rs74941663|rs577053797|rs538185950|rs71634712|rs533505851|rs570653011|rs2432527|rs571820970|rs535044025|rs533926243	byFrequency	TCGA-3K-AAZ8-01A-12D-A38X-10	TCGA-3K-AAZ8-10A-01D-A38X-10	GGTGACAGGAAGAGGCGTGGTGTCACCTGTGGATACTGAGGAAAGGCTGGTGACAGGAAGAGGGGTGGCCTGACCTGTGGATGCAGAGGAAGTGTC	GGTGACAGGAAGAGGCGTGGTGTCACCTGTGGATACTGAGGAAAGGCTGGTGACAGGAAGAGGGGTGGCCTGACCTGTGGATGCAGAGGAAGTGTC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ca7f5e36-bbb3-44aa-b0c7-3f170a2bbc0f	c70e868a-ba0a-4b90-ad4d-d61ed7b34ecf	g.chr3:195506007_195506102delGGTGACAGGAAGAGGCGTGGTGTCACCTGTGGATACTGAGGAAAGGCTGGTGACAGGAAGAGGGGTGGCCTGACCTGTGGATGCAGAGGAAGTGTC	ENST00000463781.3	-	2	12808_12903	c.12349_12444delGACACTTCCTCTGCATCCACAGGTCAGGCCACCCCTCTTCCTGTCACCAGCCTTTCCTCAGTATCCACAGGTGACACCACGCCTCTTCCTGTCACC	c.(12349-12444)gacacttcctctgcatccacaggtcaggccacccctcttcctgtcaccagcctttcctcagtatccacaggtgacaccacgcctcttcctgtcaccdel	p.DTSSASTGQATPLPVTSLSSVSTGDTTPLPVT4117del	MUC4_ENST00000475231.1_In_Frame_Del_p.DTSSASTGQATPLPVTSLSSVSTGDTTPLPVT4117del|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000349607.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)	p.T4148T(2)|p.T4118A(2)|p.D4117N(1)|p.D4117V(1)|p.Q4125H(1)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		AGGAAGGGATGGTGACAGGAAGAGGCGTGGTGTCACCTGTGGATACTGAGGAAAGGCTGGTGACAGGAAGAGGGGTGGCCTGACCTGTGGATGCAGAGGAAGTGTCGGTGACAGGA	0.591																																					p.4117_4149del		Pindel	.											.	MUC4	1505	.	7	Substitution - Missense(5)|Substitution - coding silent(2)	endometrium(4)|kidney(2)|central_nervous_system(1)	c.12350_12445del						.																																			SO:0001651	inframe_deletion	4585	exon2			.	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.12349_12444delGACACTTCCTCTGCATCCACAGGTCAGGCCACCCCTCTTCCTGTCACCAGCCTTTCCTCAGTATCCACAGGTGACACCACGCCTCTTCCTGTCACC	chr3.hg19:g.195506007_195506102delGGTGACAGGAAGAGGCGTGGTGTCACCTGTGGATACTGAGGAAAGGCTGGTGACAGGAAGAGGGGTGGCCTGACCTGTGGATGCAGAGGAAGTGTC	ENSP00000417498:p.Asp4117_Thr4148del	225.0	0.0		309.0	25.0	NM_018406	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	In_Frame_Del	DEL	ENST00000463781.3	hg19	CCDS54700.1																																																																																			.	.		0.591	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
