#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
HENMT1	113802	hgsc.bcm.edu	37	1	109191371	109191371	+	Silent	SNP	G	G	A			TCGA-5C-A9VH-01A-11D-A36X-10	TCGA-5C-A9VH-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	44e358dc-cbf5-4177-89a4-3d0d0fe2ff38	b56ae97e-c498-4223-a583-2b86e313f4bb	g.chr1:109191371G>A	ENST00000370032.5	-	8	1419	c.999C>T	c.(997-999)ttC>ttT	p.F333F	HENMT1_ENST00000370031.1_Silent_p.F364F|HENMT1_ENST00000402983.1_Silent_p.F333F|HENMT1_ENST00000493676.1_5'Flank	NM_144584.2	NP_653185.2	Q5T8I9	HENMT_HUMAN	HEN1 methyltransferase homolog 1 (Arabidopsis)	333					gene silencing by RNA (GO:0031047)|piRNA metabolic process (GO:0034587)|RNA methylation (GO:0001510)	P granule (GO:0043186)	metal ion binding (GO:0046872)|O-methyltransferase activity (GO:0008171)|RNA binding (GO:0003723)|RNA methyltransferase activity (GO:0008173)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|ovary(2)|prostate(1)|skin(2)|stomach(1)	16						CTCCAACACAGAAGGGTGTGG	0.478																																					p.F333F		Atlas-SNP	.											.	HENMT1	38	.	0			c.C999T						.						115.0	108.0	110.0					1																	109191371		2203	4300	6503	SO:0001819	synonymous_variant	113802	exon8			AACACAGAAGGGT		CCDS787.1	1p13.3	2011-01-28	2011-01-28	2011-01-28	ENSG00000162639	ENSG00000162639			26400	protein-coding gene	gene with protein product	"""HEN1 methyltransferase homolog (Arabidopsis)"""	612178	"""chromosome 1 open reading frame 59"""	C1orf59			Standard	NM_144584		Approved	FLJ30525, HEN1	uc001dvt.4	Q5T8I9	OTTHUMG00000011123	ENST00000370032.5:c.999C>T	chr1.hg19:g.109191371G>A		180.0	1.0		77.0	51.0	NM_144584	A8MRR6|B1AM16|B1AM17|Q96EJ7|Q96NN0	Silent	SNP	ENST00000370032.5	hg19	CCDS787.1																																																																																			.	.		0.478	HENMT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030592.1	NM_144584	
VPS45	11311	hgsc.bcm.edu	37	1	150053492	150053492	+	Silent	SNP	G	G	T	rs375831361		TCGA-5C-A9VH-01A-11D-A36X-10	TCGA-5C-A9VH-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	44e358dc-cbf5-4177-89a4-3d0d0fe2ff38	b56ae97e-c498-4223-a583-2b86e313f4bb	g.chr1:150053492G>T	ENST00000369130.3	+	8	1302	c.756G>T	c.(754-756)gtG>gtT	p.V252V	VPS45_ENST00000369128.5_Silent_p.V147V|VPS45_ENST00000535106.1_Silent_p.V183V	NM_001279354.1|NM_007259.3	NP_001266283.1|NP_009190.2	Q9NRW7	VPS45_HUMAN	vacuolar protein sorting 45 homolog (S. cerevisiae)	252					blood coagulation (GO:0007596)|intracellular protein transport (GO:0006886)|vesicle docking involved in exocytosis (GO:0006904)	endosome membrane (GO:0010008)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(7)|prostate(1)|skin(1)|urinary_tract(1)	21	Breast(34;0.00211)|Ovarian(49;0.0265)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.171)			TTTCCAGAGTGCCGGGAATCA	0.348																																					p.V252V		Atlas-SNP	.											.	VPS45	47	.	0			c.G756T						.	G		0,4406		0,0,2203	90.0	92.0	92.0		756	2.1	1.0	1		92	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	VPS45	NM_007259.3		0,1,6502	TT,TG,GG		0.0116,0.0,0.0077		252/571	150053492	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	11311	exon8			CAGAGTGCCGGGA	U35246	CCDS944.1, CCDS60244.1, CCDS72904.1	1q21.2	2008-02-05	2006-12-19	2006-12-19	ENSG00000136631	ENSG00000136631			14579	protein-coding gene	gene with protein product		610035	"""vacuolar protein sorting 45A (yeast homolog)"", ""vacuolar protein sorting 45A (yeast)"""	VPS45B, VPS45A		8996080	Standard	NM_007259		Approved	h-vps45, H1	uc001etp.3	Q9NRW7	OTTHUMG00000012511	ENST00000369130.3:c.756G>T	chr1.hg19:g.150053492G>T		144.0	0.0		194.0	47.0	NM_007259	D3DUZ9|F5H8K1|Q15715|Q53FR8|Q5T4P6|Q9Y4Z6	Silent	SNP	ENST00000369130.3	hg19	CCDS944.1																																																																																			.	.		0.348	VPS45-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034964.1	NM_007259	
UBAP2L	9898	hgsc.bcm.edu	37	1	154201144	154201144	+	Silent	SNP	C	C	T			TCGA-5C-A9VH-01A-11D-A36X-10	TCGA-5C-A9VH-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	44e358dc-cbf5-4177-89a4-3d0d0fe2ff38	b56ae97e-c498-4223-a583-2b86e313f4bb	g.chr1:154201144C>T	ENST00000361546.2	+	3	264	c.222C>T	c.(220-222)gaC>gaT	p.D74D	UBAP2L_ENST00000428931.1_Silent_p.D74D|UBAP2L_ENST00000343815.6_Silent_p.D74D|UBAP2L_ENST00000271877.7_Silent_p.D74D			Q14157	UBP2L_HUMAN	ubiquitin associated protein 2-like	74	UBA. {ECO:0000255|PROSITE- ProRule:PRU00212}.				binding of sperm to zona pellucida (GO:0007339)		poly(A) RNA binding (GO:0044822)			NS(2)|breast(7)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(8)|lung(20)|ovary(1)|prostate(1)|urinary_tract(2)	50	all_lung(78;1.09e-30)|Lung NSC(65;1.66e-28)|Hepatocellular(266;0.0877)		LUSC - Lung squamous cell carcinoma(543;0.185)			CTTTGCATGACTGCAATGGAG	0.423																																					p.D74D		Atlas-SNP	.											.	UBAP2L	197	.	0			c.C222T						.						215.0	189.0	198.0					1																	154201144		2203	4300	6503	SO:0001819	synonymous_variant	9898	exon4			GCATGACTGCAAT	BC003170	CCDS1063.1, CCDS44229.1, CCDS72925.1	1q21.3	2008-02-05			ENSG00000143569	ENSG00000143569			29877	protein-coding gene	gene with protein product						8590280, 11230159	Standard	NM_014847		Approved	NICE-4, KIAA0144	uc001fep.4	Q14157	OTTHUMG00000035983	ENST00000361546.2:c.222C>T	chr1.hg19:g.154201144C>T		44.0	0.0		62.0	12.0	NM_001127320	B4E0U8|Q5VU75|Q5VU76|Q9BTU3|Q9UGL2|Q9UGL3|Q9UGL4|Q9UGL5	Silent	SNP	ENST00000361546.2	hg19	CCDS1063.1																																																																																			.	.		0.423	UBAP2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087673.1	NM_014847	
FLAD1	80308	hgsc.bcm.edu	37	1	154962718	154962718	+	Missense_Mutation	SNP	A	A	T			TCGA-5C-A9VH-01A-11D-A36X-10	TCGA-5C-A9VH-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	44e358dc-cbf5-4177-89a4-3d0d0fe2ff38	b56ae97e-c498-4223-a583-2b86e313f4bb	g.chr1:154962718A>T	ENST00000292180.3	+	4	1671	c.1349A>T	c.(1348-1350)cAg>cTg	p.Q450L	FLAD1_ENST00000405236.2_Missense_Mutation_p.R302W|FLAD1_ENST00000295530.2_Missense_Mutation_p.R134W|FLAD1_ENST00000315144.10_Missense_Mutation_p.Q353L|FLAD1_ENST00000368433.1_Missense_Mutation_p.Q450L|FLAD1_ENST00000368428.1_De_novo_Start_OutOfFrame|FLAD1_ENST00000368432.1_Missense_Mutation_p.Q353L	NM_025207.4	NP_079483.3	Q8NFF5	FAD1_HUMAN	flavin adenine dinucleotide synthetase 1	450	FAD synthase.				FAD biosynthetic process (GO:0006747)|Mo-molybdopterin cofactor biosynthetic process (GO:0006777)|riboflavin metabolic process (GO:0006771)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|FMN adenylyltransferase activity (GO:0003919)			endometrium(3)|kidney(4)|large_intestine(2)|lung(7)|ovary(3)|skin(3)	22	all_epithelial(22;2.77e-30)|all_lung(78;4.1e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		BRCA - Breast invasive adenocarcinoma(34;0.00034)			CAGTTTCTACAGGACACTATC	0.522																																					p.Q450L		Atlas-SNP	.											.	FLAD1	52	.	0			c.A1349T						.						138.0	143.0	141.0					1																	154962718		2203	4300	6503	SO:0001583	missense	80308	exon4			TTCTACAGGACAC		CCDS1078.1, CCDS1079.1, CCDS53371.1, CCDS53372.1	1q22	2013-03-05	2013-03-05		ENSG00000160688	ENSG00000160688	2.7.7.2		24671	protein-coding gene	gene with protein product		610595	"""Fad1, flavin adenine dinucleotide synthetase, homolog (yeast)"", ""FAD1 flavin adenine dinucleotide synthetase homolog (S. cerevisiae)"", ""flavin adenine dinucleotide synthetase"""				Standard	NM_001184891		Approved	PP591, FAD1	uc001fgf.2	Q8NFF5	OTTHUMG00000037416	ENST00000292180.3:c.1349A>T	chr1.hg19:g.154962718A>T	ENSP00000292180:p.Gln450Leu	134.0	0.0		215.0	94.0	NM_025207	Q8N5J1|Q8N686|Q8WU93|Q8WUJ4|Q96CR8|Q99764|Q9HBN6	Missense_Mutation	SNP	ENST00000292180.3	hg19	CCDS1078.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	16.51|16.51	3.144692|3.144692	0.57044|0.57044	.|.	.|.	ENSG00000160688|ENSG00000160688	ENST00000368433;ENST00000315144;ENST00000368432;ENST00000292180|ENST00000405236;ENST00000295530	.|.	.|.	.|.	5.37|5.37	5.37|5.37	0.77165|0.77165	Phosphoadenosine phosphosulphate reductase (1);Rossmann-like alpha/beta/alpha sandwich fold (1);|.	0.057589|.	0.64402|.	D|.	0.000001|.	T|T	0.51719|0.51719	0.1691|0.1691	M|M	0.64404|0.64404	1.975|1.975	0.25793|0.25793	N|N	0.984597|0.984597	B|D	0.28584|0.69078	0.216|0.997	B|D	0.31390|0.71870	0.129|0.975	T|T	0.51803|0.51803	-0.8659|-0.8659	9|8	0.32370|0.87932	T|D	0.25|0	-25.5623|-25.5623	9.4334|9.4334	0.38624|0.38624	0.918:0.0:0.082:0.0|0.918:0.0:0.082:0.0	.|.	450|134	Q8NFF5|Q5T191	FAD1_HUMAN|.	L|W	450;353;353;450|302;134	.|.	ENSP00000292180:Q450L|ENSP00000295530:R134W	Q|R	+|+	2|1	0|2	FLAD1|FLAD1	153229342|153229342	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.980000|0.980000	0.70556|0.70556	5.316000|5.316000	0.65815|0.65815	2.254000|2.254000	0.74563|0.74563	0.533000|0.533000	0.62120|0.62120	CAG|AGG	.	.		0.522	FLAD1-001	NOVEL	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000091089.1	NM_025207	
TBX19	9095	hgsc.bcm.edu	37	1	168250458	168250458	+	Missense_Mutation	SNP	A	A	G			TCGA-5C-A9VH-01A-11D-A36X-10	TCGA-5C-A9VH-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	44e358dc-cbf5-4177-89a4-3d0d0fe2ff38	b56ae97e-c498-4223-a583-2b86e313f4bb	g.chr1:168250458A>G	ENST00000367821.3	+	1	181	c.130A>G	c.(130-132)Atc>Gtc	p.I44V		NM_005149.2	NP_005140.1	O60806	TBX19_HUMAN	T-box 19	44					anatomical structure morphogenesis (GO:0009653)|cell fate commitment (GO:0045165)|pituitary gland development (GO:0021983)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell differentiation (GO:0045595)|regulation of cell proliferation (GO:0042127)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	enhancer sequence-specific DNA binding (GO:0001158)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|liver(1)|lung(11)|prostate(2)|skin(2)|urinary_tract(1)	34	all_hematologic(923;0.215)					ACTTCAGATCATCCTGGAGGA	0.537																																					p.I44V		Atlas-SNP	.											.	TBX19	68	.	0			c.A130G						.						126.0	114.0	118.0					1																	168250458		2203	4300	6503	SO:0001583	missense	9095	exon1			CAGATCATCCTGG	AJ010277	CCDS1272.1	1q23-q24	2008-02-05			ENSG00000143178	ENSG00000143178		"""T-boxes"""	11596	protein-coding gene	gene with protein product	"""TBS 19"""	604614				9888994	Standard	NM_005149		Approved	dj747L4.1, TPIT	uc001gfl.3	O60806	OTTHUMG00000034648	ENST00000367821.3:c.130A>G	chr1.hg19:g.168250458A>G	ENSP00000356795:p.Ile44Val	174.0	0.0		232.0	53.0	NM_005149	Q52M53	Missense_Mutation	SNP	ENST00000367821.3	hg19	CCDS1272.1	.	.	.	.	.	.	.	.	.	.	A	8.387	0.838766	0.16891	.	.	ENSG00000143178	ENST00000367821	D	0.87256	-2.23	5.72	0.901	0.19284	p53-like transcription factor, DNA-binding (1);	0.654011	0.16384	N	0.216785	T	0.47507	0.1449	N	0.04018	-0.295	0.26629	N	0.972502	B	0.09022	0.002	B	0.08055	0.003	T	0.07271	-1.0781	9	0.23891	T	0.37	.	5.159	0.15050	0.5262:0.1496:0.3243:0.0	.	44	O60806	TBX19_HUMAN	V	44	ENSP00000356795:I44V	ENSP00000356795:I44V	I	+	1	0	TBX19	166517082	0.995000	0.38212	0.997000	0.53966	0.994000	0.84299	0.664000	0.25068	0.111000	0.17947	0.533000	0.62120	ATC	.	.		0.537	TBX19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083825.1	NM_005149	
FMO2	2327	hgsc.bcm.edu	37	1	171176859	171176859	+	Silent	SNP	T	T	C			TCGA-5C-A9VH-01A-11D-A36X-10	TCGA-5C-A9VH-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	44e358dc-cbf5-4177-89a4-3d0d0fe2ff38	b56ae97e-c498-4223-a583-2b86e313f4bb	g.chr1:171176859T>C	ENST00000209929.7	+	8	1344	c.1186T>C	c.(1186-1188)Ttg>Ctg	p.L396L	RP1-127D3.4_ENST00000445909.1_RNA|RP1-127D3.4_ENST00000445290.1_RNA|RP1-127D3.4_ENST00000422841.1_RNA|FMO2_ENST00000529935.1_3'UTR|FMO2_ENST00000441535.1_Silent_p.L396L			P31512	FMO4_HUMAN	flavin containing monooxygenase 2 (non-functional)	395					drug catabolic process (GO:0042737)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	flavin adenine dinucleotide binding (GO:0050660)|N,N-dimethylaniline monooxygenase activity (GO:0004499)|NADP binding (GO:0050661)			endometrium(2)|kidney(1)|large_intestine(5)|lung(7)|prostate(1)|skin(2)|stomach(3)|urinary_tract(1)	22	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)					TTCCTTAGGCTTGTGTAGCCT	0.313																																					p.L396L		Atlas-SNP	.											.	FMO2	66	.	0			c.T1186C						.						98.0	103.0	101.0					1																	171176859		2203	4300	6503	SO:0001819	synonymous_variant	2327	exon8			TTAGGCTTGTGTA	BC005894	CCDS1293.1	1q24.3	2011-08-04	2006-07-17		ENSG00000094963	ENSG00000094963			3770	protein-coding gene	gene with protein product		603955	"""flavin containing monooxygenase 2"""			1417778, 9804831	Standard	XR_426768		Approved		uc001ghk.1	Q99518	OTTHUMG00000035504	ENST00000209929.7:c.1186T>C	chr1.hg19:g.171176859T>C		283.0	0.0		423.0	98.0	NM_001460	Q53XR0	Silent	SNP	ENST00000209929.7	hg19	CCDS1293.1																																																																																			.	.		0.313	FMO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086216.2	NM_001460	
PAPPA2	60676	hgsc.bcm.edu	37	1	176564000	176564000	+	Silent	SNP	T	T	C			TCGA-5C-A9VH-01A-11D-A36X-10	TCGA-5C-A9VH-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	44e358dc-cbf5-4177-89a4-3d0d0fe2ff38	b56ae97e-c498-4223-a583-2b86e313f4bb	g.chr1:176564000T>C	ENST00000367662.3	+	3	2424	c.1260T>C	c.(1258-1260)cgT>cgC	p.R420R	PAPPA2_ENST00000367661.3_Silent_p.R420R	NM_020318.2	NP_064714.2	Q9BXP8	PAPP2_HUMAN	pappalysin 2	420					bone morphogenesis (GO:0060349)|cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|proteolysis (GO:0006508)|regulation of cell growth (GO:0001558)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|membrane (GO:0016020)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(3)|breast(3)|central_nervous_system(7)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(19)|lung(136)|ovary(7)|pancreas(1)|prostate(4)|skin(10)|upper_aerodigestive_tract(8)|urinary_tract(1)	226						ACTATTTCCGTGGACACCTGG	0.572																																					p.R420R		Atlas-SNP	.											.	PAPPA2	665	.	0			c.T1260C						.						109.0	112.0	111.0					1																	176564000		2097	4215	6312	SO:0001819	synonymous_variant	60676	exon3			TTTCCGTGGACAC	BG354569	CCDS41438.1, CCDS41439.1	1q23-q25	2008-05-23	2004-07-07	2004-07-09	ENSG00000116183	ENSG00000116183			14615	protein-coding gene	gene with protein product			"""placenta-specific 3"""	PLAC3		11018262, 11264294	Standard	NM_021936		Approved	PAPPE, PAPP-A2	uc001gkz.3	Q9BXP8	OTTHUMG00000035025	ENST00000367662.3:c.1260T>C	chr1.hg19:g.176564000T>C		104.0	0.0		161.0	39.0	NM_021936	A9Z1Y8|Q96PH7|Q96PH8|Q9H4C9	Silent	SNP	ENST00000367662.3	hg19	CCDS41438.1																																																																																			.	.		0.572	PAPPA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084763.1		
TGFB2	7042	hgsc.bcm.edu	37	1	218578606	218578606	+	Missense_Mutation	SNP	G	G	C			TCGA-5C-A9VH-01A-11D-A36X-10	TCGA-5C-A9VH-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	44e358dc-cbf5-4177-89a4-3d0d0fe2ff38	b56ae97e-c498-4223-a583-2b86e313f4bb	g.chr1:218578606G>C	ENST00000366930.4	+	2	909	c.442G>C	c.(442-444)Gag>Cag	p.E148Q	TGFB2_ENST00000366929.4_Missense_Mutation_p.E176Q	NM_003238.3	NP_003229.1	P61812	TGFB2_HUMAN	transforming growth factor, beta 2	148					activation of protein kinase activity (GO:0032147)|angiogenesis (GO:0001525)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|blood vessel remodeling (GO:0001974)|cardiac epithelial to mesenchymal transition (GO:0060317)|cardiac muscle cell proliferation (GO:0060038)|cardioblast differentiation (GO:0010002)|cartilage condensation (GO:0001502)|catagen (GO:0042637)|cell cycle arrest (GO:0007050)|cell death (GO:0008219)|cell growth (GO:0016049)|cell migration (GO:0016477)|cell morphogenesis (GO:0000902)|cell proliferation (GO:0008283)|cell-cell junction organization (GO:0045216)|cell-cell signaling (GO:0007267)|collagen fibril organization (GO:0030199)|dopamine biosynthetic process (GO:0042416)|embryo development (GO:0009790)|embryonic digestive tract development (GO:0048566)|epithelial to mesenchymal transition (GO:0001837)|extracellular matrix organization (GO:0030198)|extrinsic apoptotic signaling pathway (GO:0097191)|eye development (GO:0001654)|face morphogenesis (GO:0060325)|generation of neurons (GO:0048699)|glial cell migration (GO:0008347)|hair follicle development (GO:0001942)|hair follicle morphogenesis (GO:0031069)|heart development (GO:0007507)|heart morphogenesis (GO:0003007)|hemopoiesis (GO:0030097)|menstrual cycle phase (GO:0022601)|negative regulation of alkaline phosphatase activity (GO:0010693)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of immune response (GO:0050777)|negative regulation of macrophage cytokine production (GO:0010936)|neuron development (GO:0048666)|neuron fate commitment (GO:0048663)|neutrophil chemotaxis (GO:0030593)|odontogenesis (GO:0042476)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of activation-induced cell death of T cells (GO:0070237)|positive regulation of cardioblast differentiation (GO:0051891)|positive regulation of catagen (GO:0051795)|positive regulation of cell adhesion mediated by integrin (GO:0033630)|positive regulation of cell cycle (GO:0045787)|positive regulation of cell division (GO:0051781)|positive regulation of cell growth (GO:0030307)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of gene expression (GO:0010628)|positive regulation of heart contraction (GO:0045823)|positive regulation of immune response (GO:0050778)|positive regulation of integrin biosynthetic process (GO:0045726)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of ossification (GO:0045778)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein secretion (GO:0050714)|positive regulation of stress-activated MAPK cascade (GO:0032874)|protein phosphorylation (GO:0006468)|regulation of transforming growth factor beta2 production (GO:0032909)|response to drug (GO:0042493)|response to hypoxia (GO:0001666)|response to progesterone (GO:0032570)|response to wounding (GO:0009611)|salivary gland morphogenesis (GO:0007435)|signal transduction by phosphorylation (GO:0023014)|SMAD protein import into nucleus (GO:0007184)|somatic stem cell division (GO:0048103)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing (GO:0042060)	axon (GO:0030424)|endosome (GO:0005768)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|neuronal cell body (GO:0043025)|platelet alpha granule lumen (GO:0031093)	beta-amyloid binding (GO:0001540)|cytokine activity (GO:0005125)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|transforming growth factor beta receptor binding (GO:0005160)|type II transforming growth factor beta receptor binding (GO:0005114)			breast(1)|endometrium(1)|large_intestine(11)|lung(15)|upper_aerodigestive_tract(2)|urinary_tract(1)	31				all cancers(67;0.0459)|OV - Ovarian serous cystadenocarcinoma(81;0.049)|GBM - Glioblastoma multiforme(131;0.0776)		GGTGAAAGCAGAGTTCAGAGT	0.433																																					p.E176Q		Atlas-SNP	.											.	TGFB2	102	.	0			c.G526C						.						216.0	208.0	211.0					1																	218578606		2203	4300	6503	SO:0001583	missense	7042	exon3			AAAGCAGAGTTCA	M19154	CCDS1521.1, CCDS44318.1	1q41	2014-01-30			ENSG00000092969	ENSG00000092969		"""Endogenous ligands"""	11768	protein-coding gene	gene with protein product	"""prepro-transforming growth factor beta-2"""	190220					Standard	NM_003238		Approved		uc001hln.3	P61812	OTTHUMG00000039521	ENST00000366930.4:c.442G>C	chr1.hg19:g.218578606G>C	ENSP00000355897:p.Glu148Gln	135.0	0.0		160.0	30.0	NM_001135599	B4DKC5|P08112|Q15579|Q15581|Q4VAV9	Missense_Mutation	SNP	ENST00000366930.4	hg19	CCDS1521.1	.	.	.	.	.	.	.	.	.	.	G	19.80	3.895590	0.72639	.	.	ENSG00000092969	ENST00000366930;ENST00000366929	T;T	0.72051	-0.62;-0.62	5.09	5.09	0.68999	Transforming growth factor-beta, N-terminal (1);	0.000000	0.85682	D	0.000000	D	0.84763	0.5544	M	0.88377	2.95	0.80722	D	1	P;D;D	0.63880	0.95;0.983;0.993	P;P;P	0.59761	0.652;0.831;0.863	D	0.85736	0.1334	10	0.37606	T	0.19	.	18.5292	0.90984	0.0:0.0:1.0:0.0	.	176;148;177	P61812-2;P61812;Q59EG9	.;TGFB2_HUMAN;.	Q	148;176	ENSP00000355897:E148Q;ENSP00000355896:E176Q	ENSP00000355896:E176Q	E	+	1	0	TGFB2	216645229	1.000000	0.71417	0.991000	0.47740	0.997000	0.91878	9.675000	0.98638	2.363000	0.80096	0.650000	0.86243	GAG	.	.		0.433	TGFB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095359.2	NM_003238	
KIF26B	55083	hgsc.bcm.edu	37	1	245862336	245862336	+	Missense_Mutation	SNP	G	G	C	rs367835473		TCGA-5C-A9VH-01A-11D-A36X-10	TCGA-5C-A9VH-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	44e358dc-cbf5-4177-89a4-3d0d0fe2ff38	b56ae97e-c498-4223-a583-2b86e313f4bb	g.chr1:245862336G>C	ENST00000407071.2	+	14	6615	c.6175G>C	c.(6175-6177)Gaa>Caa	p.E2059Q	KIF26B_ENST00000366518.4_Missense_Mutation_p.E1678Q	NM_018012.3	NP_060482.2	Q2KJY2	KI26B_HUMAN	kinesin family member 26B	2059					establishment of cell polarity (GO:0030010)|metabolic process (GO:0008152)|positive regulation of cell-cell adhesion (GO:0022409)|ureteric bud invasion (GO:0072092)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(21)|ovary(4)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	51	all_cancers(71;3.86e-05)|all_epithelial(71;0.000121)|Ovarian(71;0.0412)|all_lung(81;0.0498)|Lung NSC(105;0.0708)|Breast(184;0.127)		OV - Ovarian serous cystadenocarcinoma(106;0.022)			GTGGCTCAGTGAATGTAAGGC	0.597																																					p.E2059Q		Atlas-SNP	.											.	KIF26B	343	.	0			c.G6175C						.						76.0	83.0	80.0					1																	245862336		2107	4219	6326	SO:0001583	missense	55083	exon14			CTCAGTGAATGTA	AK001019	CCDS44342.1	1q44	2008-02-05			ENSG00000162849	ENSG00000162849		"""Kinesins"""	25484	protein-coding gene	gene with protein product		614026					Standard	NM_018012		Approved	FLJ10157	uc001ibf.1	Q2KJY2	OTTHUMG00000040079	ENST00000407071.2:c.6175G>C	chr1.hg19:g.245862336G>C	ENSP00000385545:p.Glu2059Gln	102.0	0.0		148.0	67.0	NM_018012	Q6ZQR9|Q6ZUZ0|Q8IUN3|Q8IVR1|Q9NWB4	Missense_Mutation	SNP	ENST00000407071.2	hg19	CCDS44342.1	.	.	.	.	.	.	.	.	.	.	G	15.70	2.910478	0.52439	.	.	ENSG00000162849	ENST00000407071;ENST00000366518;ENST00000413001	D;D	0.82526	-1.62;-1.61	5.73	5.73	0.89815	.	.	.	.	.	D	0.87188	0.6115	L	0.38175	1.15	0.58432	D	0.999999	D	0.89917	1.0	D	0.83275	0.996	T	0.82839	-0.0259	9	0.19147	T	0.46	.	19.9017	0.96988	0.0:0.0:1.0:0.0	.	2059	Q2KJY2	KI26B_HUMAN	Q	2059;1678;1675	ENSP00000385545:E2059Q;ENSP00000355475:E1678Q	ENSP00000355475:E1678Q	E	+	1	0	KIF26B	243928959	1.000000	0.71417	0.993000	0.49108	0.843000	0.47879	9.838000	0.99474	2.707000	0.92482	0.561000	0.74099	GAA	.	.		0.597	KIF26B-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381037.1	XM_371354	
PQLC3	130814	hgsc.bcm.edu	37	2	11300609	11300609	+	Missense_Mutation	SNP	G	G	T			TCGA-5C-A9VH-01A-11D-A36X-10	TCGA-5C-A9VH-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	44e358dc-cbf5-4177-89a4-3d0d0fe2ff38	b56ae97e-c498-4223-a583-2b86e313f4bb	g.chr2:11300609G>T	ENST00000295083.3	+	2	336	c.161G>T	c.(160-162)cGg>cTg	p.R54L	PQLC3_ENST00000402361.1_Missense_Mutation_p.R54L|PQLC3_ENST00000476787.1_3'UTR|PQLC3_ENST00000441908.2_Missense_Mutation_p.R54L	NM_152391.3	NP_689604.1	Q8N755	PQLC3_HUMAN	PQ loop repeat containing 3	54						integral component of membrane (GO:0016021)				kidney(2)|large_intestine(2)|lung(1)|upper_aerodigestive_tract(1)	6	all_hematologic(175;0.0797)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.0978)|OV - Ovarian serous cystadenocarcinoma(76;0.132)		GTGTTTCTGCGGTACCAGTGT	0.602																																					p.R54L		Atlas-SNP	.											.	PQLC3	8	.	0			c.G161T						.						145.0	123.0	130.0					2																	11300609		2203	4300	6503	SO:0001583	missense	130814	exon2			TTCTGCGGTACCA	BC027625	CCDS1679.1, CCDS62856.1, CCDS62857.1	2p25.1	2004-02-05	2005-07-19	2005-07-19	ENSG00000162976	ENSG00000162976			28503	protein-coding gene	gene with protein product			"""chromosome 2 open reading frame 22"""	C2orf22		12477932	Standard	NM_001282711		Approved	MGC33602	uc002rbc.3	Q8N755	OTTHUMG00000119055	ENST00000295083.3:c.161G>T	chr2.hg19:g.11300609G>T	ENSP00000295083:p.Arg54Leu	73.0	0.0		52.0	16.0	NM_152391	B2R8K1|B4DWA4	Missense_Mutation	SNP	ENST00000295083.3	hg19	CCDS1679.1	.	.	.	.	.	.	.	.	.	.	G	13.63	2.295929	0.40594	.	.	ENSG00000162976	ENST00000445402;ENST00000295083;ENST00000441908;ENST00000402361	D;D;D;D	0.97352	-4.35;-4.35;-4.35;-4.35	5.01	5.01	0.66863	.	0.139116	0.47455	D	0.000238	D	0.96225	0.8769	L	0.36672	1.1	0.40465	D	0.980283	D;D	0.60575	0.974;0.988	P;P	0.57846	0.776;0.828	D	0.94737	0.7915	10	0.15499	T	0.54	-25.082	15.2439	0.73490	0.0:0.0:1.0:0.0	.	54;54	B4DWA4;Q8N755	.;PQLC3_HUMAN	L	77;54;54;54	ENSP00000410430:R77L;ENSP00000295083:R54L;ENSP00000406148:R54L;ENSP00000384129:R54L	ENSP00000295083:R54L	R	+	2	0	PQLC3	11218060	1.000000	0.71417	0.996000	0.52242	0.701000	0.40568	2.641000	0.46587	2.307000	0.77673	0.561000	0.74099	CGG	.	.		0.602	PQLC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239266.4	NM_152391	
SEMA4F	10505	hgsc.bcm.edu	37	2	74900921	74900921	+	Missense_Mutation	SNP	G	G	A			TCGA-5C-A9VH-01A-11D-A36X-10	TCGA-5C-A9VH-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	44e358dc-cbf5-4177-89a4-3d0d0fe2ff38	b56ae97e-c498-4223-a583-2b86e313f4bb	g.chr2:74900921G>A	ENST00000357877.2	+	7	937	c.788G>A	c.(787-789)cGc>cAc	p.R263H	SEMA4F_ENST00000339773.5_Intron	NM_004263.3	NP_004254.2	O95754	SEM4F_HUMAN	sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4F	263	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon guidance (GO:0007411)|cell-cell signaling (GO:0007267)|negative regulation of axon extension (GO:0030517)|nervous system development (GO:0007399)|retinal ganglion cell axon guidance (GO:0031290)	endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	receptor activity (GO:0004872)			biliary_tract(1)|breast(2)|endometrium(8)|kidney(3)|large_intestine(9)|lung(14)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(2)	45						TCATACGAGCGCATTAAAGTC	0.557																																					p.R263H		Atlas-SNP	.											SEMA4F,NS,carcinoma,0,1	SEMA4F	89	.	0			c.G788A						.						109.0	117.0	114.0					2																	74900921		2203	4300	6503	SO:0001583	missense	10505	exon7			ACGAGCGCATTAA	AF038652	CCDS1955.1, CCDS62942.1, CCDS74529.1	2p13.1	2008-05-21			ENSG00000135622	ENSG00000135622		"""Semaphorins"""	10734	protein-coding gene	gene with protein product	"""m-Sema M"""	603706		SEMAM		10051670	Standard	NM_004263		Approved	SEMAW	uc002sna.2	O95754	OTTHUMG00000129952	ENST00000357877.2:c.788G>A	chr2.hg19:g.74900921G>A	ENSP00000350547:p.Arg263His	71.0	0.0		58.0	24.0	NM_004263	Q542Y7|Q9NS35	Missense_Mutation	SNP	ENST00000357877.2	hg19	CCDS1955.1	.	.	.	.	.	.	.	.	.	.	G	13.68	2.309276	0.40895	.	.	ENSG00000135622	ENST00000357877	T	0.10860	2.83	5.03	-4.74	0.03249	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	0.796333	0.11605	N	0.547387	T	0.04227	0.0117	N	0.13272	0.32	0.09310	N	0.999996	B	0.11235	0.004	B	0.10450	0.005	T	0.37454	-0.9705	10	0.31617	T	0.26	.	2.1447	0.03784	0.4596:0.2354:0.1855:0.1195	.	263	O95754	SEM4F_HUMAN	H	263	ENSP00000350547:R263H	ENSP00000350547:R263H	R	+	2	0	SEMA4F	74754429	0.000000	0.05858	0.035000	0.18076	0.962000	0.63368	0.222000	0.17699	-0.592000	0.05851	0.462000	0.41574	CGC	.	.		0.557	SEMA4F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252214.2	NM_004263	
PROC	5624	hgsc.bcm.edu	37	2	128184696	128184696	+	Missense_Mutation	SNP	T	T	A			TCGA-5C-A9VH-01A-11D-A36X-10	TCGA-5C-A9VH-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	44e358dc-cbf5-4177-89a4-3d0d0fe2ff38	b56ae97e-c498-4223-a583-2b86e313f4bb	g.chr2:128184696T>A	ENST00000234071.3	+	8	781	c.694T>A	c.(694-696)Tca>Aca	p.S232T	PROC_ENST00000422777.3_Missense_Mutation_p.S232T|PROC_ENST00000409048.1_Missense_Mutation_p.S266T|PROC_ENST00000453608.2_Missense_Mutation_p.S287T	NM_000312.3	NP_000303.1	P04070	PROC_HUMAN	protein C (inactivator of coagulation factors Va and VIIIa)	232	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				blood coagulation (GO:0007596)|cellular protein metabolic process (GO:0044267)|leukocyte migration (GO:0050900)|negative regulation of apoptotic process (GO:0043066)|negative regulation of blood coagulation (GO:0030195)|peptidyl-glutamic acid carboxylation (GO:0017187)|post-translational protein modification (GO:0043687)|proteolysis (GO:0006508)	endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|serine-type endopeptidase activity (GO:0004252)			endometrium(2)|kidney(2)|large_intestine(1)|lung(9)|ovary(1)	15	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0673)	Antihemophilic Factor(DB00025)|Menadione(DB00170)|Sodium Tetradecyl Sulfate(DB00464)	CCTGCTGGACTCAAAGAAGAA	0.597																																					p.S232T		Atlas-SNP	.											.	PROC	31	.	0			c.T694A						.						117.0	118.0	118.0					2																	128184696		2203	4300	6503	SO:0001583	missense	5624	exon8			CTGGACTCAAAGA	X02750	CCDS2145.1	2q13-q14	2014-01-30			ENSG00000115718	ENSG00000115718		"""Endogenous ligands"""	9451	protein-coding gene	gene with protein product	"""prepro-protein C"""	612283				2991887, 2437584	Standard	NM_000312		Approved		uc002tok.3	P04070	OTTHUMG00000131528	ENST00000234071.3:c.694T>A	chr2.hg19:g.128184696T>A	ENSP00000234071:p.Ser232Thr	56.0	0.0		53.0	22.0	NM_000312	B4DPQ7|Q15189|Q15190|Q16001|Q53S74|Q9UC55	Missense_Mutation	SNP	ENST00000234071.3	hg19	CCDS2145.1	.	.	.	.	.	.	.	.	.	.	T	5.450	0.268052	0.10349	.	.	ENSG00000115718	ENST00000234071;ENST00000537436;ENST00000453608;ENST00000409048;ENST00000422777	D;D;D;D	0.93366	-3.21;-3.21;-3.21;-3.21	5.48	5.48	0.80851	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.000000	0.40064	N	0.001199	D	0.86037	0.5837	L	0.35593	1.075	0.23361	N	0.997836	B;B;B;B	0.18610	0.015;0.026;0.009;0.029	B;B;B;B	0.21360	0.034;0.014;0.011;0.018	T	0.69420	-0.5150	10	0.09338	T	0.73	.	6.0256	0.19652	0.208:0.0751:0.0:0.7169	.	287;288;266;232	B4DPQ7;B4DPQ3;E7END6;P04070	.;.;.;PROC_HUMAN	T	232;191;287;266;232	ENSP00000234071:S232T;ENSP00000404030:S287T;ENSP00000386679:S266T;ENSP00000409543:S232T	ENSP00000234071:S232T	S	+	1	0	PROC	127901166	0.051000	0.20477	0.996000	0.52242	0.314000	0.28054	0.295000	0.19065	2.074000	0.62210	0.533000	0.62120	TCA	.	.		0.597	PROC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254385.2	NM_000312	
TTN	7273	hgsc.bcm.edu	37	2	179596477	179596477	+	Missense_Mutation	SNP	A	A	G			TCGA-5C-A9VH-01A-11D-A36X-10	TCGA-5C-A9VH-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	44e358dc-cbf5-4177-89a4-3d0d0fe2ff38	b56ae97e-c498-4223-a583-2b86e313f4bb	g.chr2:179596477A>G	ENST00000591111.1	-	56	16398	c.16174T>C	c.(16174-16176)Tgt>Cgt	p.C5392R	TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000342175.6_Intron|TTN_ENST00000342992.6_Missense_Mutation_p.C4465R|TTN-AS1_ENST00000582847.1_RNA|TTN_ENST00000359218.5_Intron|TTN_ENST00000460472.2_Intron|TTN_ENST00000589042.1_Missense_Mutation_p.C5709R			Q8WZ42	TITIN_HUMAN	titin	12211	Ig-like 34.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GTCACCCGACACTGGTATTCG	0.493																																					p.C5709R		Atlas-SNP	.											.	TTN	18412	.	0			c.T17125C						.						101.0	102.0	102.0					2																	179596477		1951	4147	6098	SO:0001583	missense	7273	exon58			CCCGACACTGGTA	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.16174T>C	chr2.hg19:g.179596477A>G	ENSP00000465570:p.Cys5392Arg	93.0	0.0		73.0	26.0	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	hg19		.	.	.	.	.	.	.	.	.	.	A	11.86	1.763649	0.31228	.	.	ENSG00000155657	ENST00000342992	T	0.64803	-0.12	5.93	5.93	0.95920	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	D	0.87237	0.6127	H	0.98218	4.175	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.91917	0.5544	9	0.87932	D	0	.	16.3943	0.83563	1.0:0.0:0.0:0.0	.	5392	Q8WZ42	TITIN_HUMAN	R	4465	ENSP00000343764:C4465R	ENSP00000343764:C4465R	C	-	1	0	TTN	179304722	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.339000	0.96797	2.281000	0.76405	0.533000	0.62120	TGT	.	.		0.493	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
NBEAL1	65065	hgsc.bcm.edu	37	2	204031020	204031020	+	Splice_Site	SNP	G	G	A			TCGA-5C-A9VH-01A-11D-A36X-10	TCGA-5C-A9VH-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	44e358dc-cbf5-4177-89a4-3d0d0fe2ff38	b56ae97e-c498-4223-a583-2b86e313f4bb	g.chr2:204031020G>A	ENST00000449802.1	+	36	6109	c.5776G>A	c.(5776-5778)Gga>Aga	p.G1926R		NM_001114132.1	NP_001107604.1	Q6ZS30	NBEL1_HUMAN	neurobeachin-like 1	1926										NS(1)|breast(3)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(8)|liver(1)|lung(8)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	37						AAAAGAAGATGGTGAGGAGTT	0.303																																					p.G1926R		Atlas-SNP	.											.	NBEAL1	266	.	0			c.G5776A						.						70.0	63.0	65.0					2																	204031020		1821	4071	5892	SO:0001630	splice_region_variant	65065	exon36			GAAGATGGTGAGG	AY172970	CCDS46495.1	2q33	2013-01-10			ENSG00000144426	ENSG00000144426		"""WD repeat domain containing"""	20681	protein-coding gene	gene with protein product		609816	"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 17"", ""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 16"""	ALS2CR17, ALS2CR16		15193433	Standard	NM_001114132		Approved	MGC164581	uc002uzt.3	Q6ZS30	OTTHUMG00000154129	ENST00000449802.1:c.5776+1G>A	chr2.hg19:g.204031020G>A		218.0	0.0		216.0	55.0	NM_001114132	A6NHD5|Q6Y876|Q6ZP36|Q6ZQY5|Q8N8R4|Q96Q30|Q96Q31	Missense_Mutation	SNP	ENST00000449802.1	hg19	CCDS46495.1	.	.	.	.	.	.	.	.	.	.	G	16.82	3.228276	0.58777	.	.	ENSG00000144426	ENST00000449802;ENST00000340268	T	0.56941	0.43	5.12	5.12	0.69794	PH-BEACH domain (1);	0.119705	0.56097	D	0.000036	T	0.50565	0.1623	L	0.60067	1.865	0.58432	D	0.999995	P;P	0.35050	0.482;0.482	B;B	0.30029	0.11;0.11	T	0.55347	-0.8155	10	0.51188	T	0.08	.	18.5162	0.90936	0.0:0.0:1.0:0.0	.	1926;1915	Q6ZS30;C9JGK5	NBEL1_HUMAN;.	R	1926	ENSP00000399903:G1926R	ENSP00000344985:G1926R	G	+	1	0	NBEAL1	203739265	1.000000	0.71417	1.000000	0.80357	0.833000	0.47200	6.664000	0.74437	2.549000	0.85964	0.467000	0.42956	GGA	.	.		0.303	NBEAL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333982.4		Missense_Mutation
COL6A3	1293	hgsc.bcm.edu	37	2	238253721	238253721	+	Missense_Mutation	SNP	T	T	C			TCGA-5C-A9VH-01A-11D-A36X-10	TCGA-5C-A9VH-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	44e358dc-cbf5-4177-89a4-3d0d0fe2ff38	b56ae97e-c498-4223-a583-2b86e313f4bb	g.chr2:238253721T>C	ENST00000295550.4	-	34	7594	c.7142A>G	c.(7141-7143)cAa>cGa	p.Q2381R	COL6A3_ENST00000472056.1_Missense_Mutation_p.Q1774R|COL6A3_ENST00000346358.4_Missense_Mutation_p.Q2181R|COL6A3_ENST00000347401.3_Missense_Mutation_p.Q2180R|COL6A3_ENST00000353578.4_Missense_Mutation_p.Q2175R|COL6A3_ENST00000409809.1_Missense_Mutation_p.Q2175R	NM_004369.3	NP_004360.2	P12111	CO6A3_HUMAN	collagen, type VI, alpha 3	2381	Nonhelical region.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|muscle organ development (GO:0007517)|response to glucose (GO:0009749)	collagen type VI trimer (GO:0005589)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)|vesicle (GO:0031982)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(6)|central_nervous_system(7)|cervix(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(64)|lung(62)|ovary(14)|pancreas(2)|prostate(11)|skin(14)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	217		Breast(86;0.000301)|Renal(207;0.000966)|all_hematologic(139;0.067)|Ovarian(221;0.0694)|all_lung(227;0.0943)|Melanoma(123;0.203)		Epithelial(121;1.23e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.34e-10)|Kidney(56;5.71e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.51e-07)|BRCA - Breast invasive adenocarcinoma(100;0.00025)|Lung(119;0.0142)|LUSC - Lung squamous cell carcinoma(224;0.034)		TTTGATGCTTTGGATGAGGGC	0.358																																					p.Q2381R		Atlas-SNP	.											.	COL6A3	608	.	0			c.A7142G						.						93.0	90.0	91.0					2																	238253721		2203	4300	6503	SO:0001583	missense	1293	exon34			ATGCTTTGGATGA	X52022	CCDS33409.1, CCDS33410.1, CCDS33411.1, CCDS33412.1, CCDS33410.2, CCDS33411.2, CCDS54439.1	2q37	2014-09-17			ENSG00000163359	ENSG00000163359		"""Collagens"""	2213	protein-coding gene	gene with protein product		120250				1339440, 11992252	Standard	NM_004369		Approved		uc002vwl.2	P12111	OTTHUMG00000150020	ENST00000295550.4:c.7142A>G	chr2.hg19:g.238253721T>C	ENSP00000295550:p.Gln2381Arg	223.0	0.0		183.0	89.0	NM_004369	A8MT30|B4E3U5|B7ZMJ7|E9PFQ6|E9PGQ9|Q16501|Q53QF4|Q53QF6	Missense_Mutation	SNP	ENST00000295550.4	hg19	CCDS33412.1	.	.	.	.	.	.	.	.	.	.	T	9.243	1.038787	0.19669	.	.	ENSG00000163359	ENST00000295550;ENST00000347401;ENST00000353578;ENST00000472056;ENST00000409809;ENST00000346358	D;D;D;D;D;D	0.95690	-3.78;-3.78;-3.78;-3.78;-3.78;-3.78	5.31	4.13	0.48395	.	0.000000	0.51477	D	0.000082	D	0.92453	0.7604	M	0.64567	1.98	0.32379	N	0.55485	B;B;B;B	0.31413	0.001;0.001;0.002;0.322	B;B;B;B	0.33454	0.002;0.002;0.004;0.164	D	0.88835	0.3308	10	0.21014	T	0.42	.	6.8527	0.24024	0.0:0.1183:0.1374:0.7443	.	1774;1774;2175;2381	E9PFQ6;B7ZMJ7;P12111-2;P12111	.;.;.;CO6A3_HUMAN	R	2381;2180;2175;1774;2175;2181	ENSP00000295550:Q2381R;ENSP00000315609:Q2180R;ENSP00000315873:Q2175R;ENSP00000418285:Q1774R;ENSP00000386844:Q2175R;ENSP00000295546:Q2181R	ENSP00000295550:Q2381R	Q	-	2	0	COL6A3	237918460	0.903000	0.30736	0.087000	0.20705	0.828000	0.46876	1.153000	0.31676	0.824000	0.34613	0.533000	0.62120	CAA	.	.		0.358	COL6A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000315790.2	NM_004369	
SHISA5	51246	hgsc.bcm.edu	37	3	48520585	48520585	+	Splice_Site	SNP	C	C	T			TCGA-5C-A9VH-01A-11D-A36X-10	TCGA-5C-A9VH-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	44e358dc-cbf5-4177-89a4-3d0d0fe2ff38	b56ae97e-c498-4223-a583-2b86e313f4bb	g.chr3:48520585C>T	ENST00000296444.2	-	3	651		c.e3+1		SHISA5_ENST00000443308.2_Splice_Site|SHISA5_ENST00000442747.1_Splice_Site|SHISA5_ENST00000444115.1_Splice_Site	NM_001272065.1|NM_016479.3	NP_001258994.1|NP_057563.3	Q8N114	SHSA5_HUMAN	shisa family member 5						intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)	signal transducer activity (GO:0004871)|WW domain binding (GO:0050699)			large_intestine(1)|lung(1)	2						GCTTTACTTACCCTGACATGG	0.602																																					.		Atlas-SNP	.											.	SHISA5	10	.	0			c.314+1G>A						.						41.0	35.0	37.0					3																	48520585		2202	4299	6501	SO:0001630	splice_region_variant	51246	exon4			TACTTACCCTGAC	AF520698	CCDS2770.1, CCDS63621.1, CCDS63622.1, CCDS63623.1	3p21.31	2013-07-31	2013-07-31		ENSG00000164054	ENSG00000164054		"""Shisa homologs"""	30376	protein-coding gene	gene with protein product		607290	"""shisa homolog 5 (Xenopus laevis)"""			11042152, 12135983	Standard	NM_016479		Approved	SCOTIN, hShisa5	uc011bbk.1	Q8N114	OTTHUMG00000133529	ENST00000296444.2:c.314+1G>A	chr3.hg19:g.48520585C>T		59.0	0.0		55.0	19.0	NM_016479	B3KW99|F8W9N8|Q69YY9|Q7Z433|Q8NHL9|Q96MW8|Q9BV58	Splice_Site	SNP	ENST00000296444.2	hg19	CCDS2770.1	.	.	.	.	.	.	.	.	.	.	C	12.42	1.933405	0.34096	.	.	ENSG00000164054	ENST00000296444;ENST00000444115;ENST00000442747;ENST00000443308;ENST00000417841	.	.	.	3.39	2.49	0.30216	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	7.9827	0.30194	0.2437:0.7563:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	SHISA5	48495589	1.000000	0.71417	0.997000	0.53966	0.153000	0.21895	2.991000	0.49409	0.982000	0.38575	0.484000	0.47621	.	.	.		0.602	SHISA5-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000257504.3	NM_016479	Intron
ROBO2	6092	hgsc.bcm.edu	37	3	77147199	77147199	+	Silent	SNP	G	G	A			TCGA-5C-A9VH-01A-11D-A36X-10	TCGA-5C-A9VH-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	44e358dc-cbf5-4177-89a4-3d0d0fe2ff38	b56ae97e-c498-4223-a583-2b86e313f4bb	g.chr3:77147199G>A	ENST00000461745.1	+	2	996	c.96G>A	c.(94-96)cgG>cgA	p.R32R	ROBO2_ENST00000332191.8_Silent_p.R32R|ROBO2_ENST00000487694.3_Silent_p.R48R	NM_002942.4	NP_002933.1	Q9HCK4	ROBO2_HUMAN	roundabout, axon guidance receptor, homolog 2 (Drosophila)	32	Ig-like C2-type 1.				apoptotic process involved in luteolysis (GO:0061364)|axon guidance (GO:0007411)|axon midline choice point recognition (GO:0016199)|brain development (GO:0007420)|cellular response to hormone stimulus (GO:0032870)|central nervous system development (GO:0007417)|homophilic cell adhesion (GO:0007156)|metanephros development (GO:0001656)|negative regulation of negative chemotaxis (GO:0050925)|negative regulation of synapse assembly (GO:0051964)|olfactory bulb interneuron development (GO:0021891)|positive regulation of axonogenesis (GO:0050772)|retinal ganglion cell axon guidance (GO:0031290)|ureteric bud development (GO:0001657)	axolemma (GO:0030673)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	axon guidance receptor activity (GO:0008046)|identical protein binding (GO:0042802)			NS(1)|biliary_tract(5)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(23)|liver(1)|lung(52)|ovary(2)|pancreas(2)|prostate(5)|skin(8)|upper_aerodigestive_tract(1)	117				Epithelial(33;0.00199)|LUSC - Lung squamous cell carcinoma(21;0.008)|BRCA - Breast invasive adenocarcinoma(55;0.00884)|Lung(72;0.0183)|KIRC - Kidney renal clear cell carcinoma(39;0.0832)|Kidney(39;0.103)		TTCCCCCGCGGATTGTGGAGC	0.532																																					p.R32R		Atlas-SNP	.											.	ROBO2	527	.	0			c.G96A						.						47.0	49.0	48.0					3																	77147199		1945	4135	6080	SO:0001819	synonymous_variant	6092	exon2			CCCGCGGATTGTG	AF040991	CCDS43109.1, CCDS54609.1	3p12.3	2013-02-11	2001-11-28		ENSG00000185008	ENSG00000185008		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	10250	protein-coding gene	gene with protein product		602431	"""roundabout (axon guidance receptor, Drosophila) homolog 2"""			9458045	Standard	NM_002942		Approved	KIAA1568	uc003dpy.4	Q9HCK4	OTTHUMG00000158935	ENST00000461745.1:c.96G>A	chr3.hg19:g.77147199G>A		116.0	0.0		86.0	34.0	NM_002942	O43608|Q19AB4|Q19AB5	Silent	SNP	ENST00000461745.1	hg19	CCDS43109.1																																																																																			.	.		0.532	ROBO2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000352600.2	XM_031246	
TRAT1	50852	hgsc.bcm.edu	37	3	108572654	108572654	+	Missense_Mutation	SNP	A	A	G			TCGA-5C-A9VH-01A-11D-A36X-10	TCGA-5C-A9VH-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	44e358dc-cbf5-4177-89a4-3d0d0fe2ff38	b56ae97e-c498-4223-a583-2b86e313f4bb	g.chr3:108572654A>G	ENST00000295756.6	+	6	721	c.491A>G	c.(490-492)gAg>gGg	p.E164G	TRAT1_ENST00000426646.1_Missense_Mutation_p.E127G	NM_016388.2	NP_057472.2	Q6PIZ9	TRAT1_HUMAN	T cell receptor associated transmembrane adaptor 1	164					cellular defense response (GO:0006968)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|negative regulation of receptor recycling (GO:0001920)|negative regulation of transport (GO:0051051)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of T cell receptor signaling pathway (GO:0050862)|signal transduction (GO:0007165)|T cell receptor signaling pathway (GO:0050852)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|T cell receptor complex (GO:0042101)	transmembrane receptor protein tyrosine kinase adaptor activity (GO:0005068)			endometrium(2)|kidney(2)|large_intestine(2)|lung(18)|prostate(1)|skin(3)	28						CAGGCAGTAGAGGAAAACATT	0.438																																					p.E164G		Atlas-SNP	.											.	TRAT1	48	.	0			c.A491G						.						93.0	95.0	94.0					3																	108572654		2203	4300	6503	SO:0001583	missense	50852	exon6			CAGTAGAGGAAAA	AJ240084	CCDS33813.1	3q13	2005-05-04	2005-05-04	2005-05-04	ENSG00000163519	ENSG00000163519			30698	protein-coding gene	gene with protein product		604962	"""T cell receptor interacting molecule"""	TCRIM		10663578, 9687533	Standard	NM_016388		Approved	HSPC062, TRIM	uc003dxi.1	Q6PIZ9	OTTHUMG00000159198	ENST00000295756.6:c.491A>G	chr3.hg19:g.108572654A>G	ENSP00000295756:p.Glu164Gly	393.0	0.0		280.0	107.0	NM_016388	Q9NZX5	Missense_Mutation	SNP	ENST00000295756.6	hg19	CCDS33813.1	.	.	.	.	.	.	.	.	.	.	A	17.30	3.354682	0.61293	.	.	ENSG00000163519	ENST00000295756;ENST00000426646	T;T	0.34667	1.36;1.35	5.85	5.85	0.93711	.	0.092833	0.47093	D	0.000242	T	0.57519	0.2059	M	0.65975	2.015	0.36196	D	0.850405	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.67734	-0.5594	10	0.62326	D	0.03	-17.3146	12.6339	0.56673	1.0:0.0:0.0:0.0	.	127;164	C9JF66;Q6PIZ9	.;TRAT1_HUMAN	G	164;127	ENSP00000295756:E164G;ENSP00000410097:E127G	ENSP00000295756:E164G	E	+	2	0	TRAT1	110055344	1.000000	0.71417	0.996000	0.52242	0.330000	0.28571	2.435000	0.44811	2.234000	0.73211	0.533000	0.62120	GAG	.	.		0.438	TRAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353794.1	NM_016388	
STK32B	55351	hgsc.bcm.edu	37	4	5399957	5399957	+	Missense_Mutation	SNP	T	T	C			TCGA-5C-A9VH-01A-11D-A36X-10	TCGA-5C-A9VH-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	44e358dc-cbf5-4177-89a4-3d0d0fe2ff38	b56ae97e-c498-4223-a583-2b86e313f4bb	g.chr4:5399957T>C	ENST00000282908.5	+	5	880	c.458T>C	c.(457-459)cTg>cCg	p.L153P	STK32B_ENST00000512636.1_Missense_Mutation_p.L106P|STK32B_ENST00000510398.1_Missense_Mutation_p.L106P	NM_018401.1	NP_060871.1			serine/threonine kinase 32B											breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(10)|lung(16)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)	39						GACAATATCCTGCTGGATGAA	0.493																																					p.L153P		Atlas-SNP	.											.	STK32B	87	.	0			c.T458C						.						151.0	140.0	144.0					4																	5399957		2203	4300	6503	SO:0001583	missense	55351	exon5			ATATCCTGCTGGA	AJ250839	CCDS3380.1	4p16	2009-09-30			ENSG00000152953	ENSG00000152953			14217	protein-coding gene	gene with protein product						10700184	Standard	XM_005247982		Approved	STKG6, YANK2, STK32, HSA250839	uc003gih.1	Q9NY57	OTTHUMG00000090423	ENST00000282908.5:c.458T>C	chr4.hg19:g.5399957T>C	ENSP00000282908:p.Leu153Pro	87.0	0.0		68.0	27.0	NM_018401		Missense_Mutation	SNP	ENST00000282908.5	hg19	CCDS3380.1	.	.	.	.	.	.	.	.	.	.	T	15.45	2.836187	0.50951	.	.	ENSG00000152953	ENST00000282908;ENST00000512636;ENST00000510398	T;T;T	0.58797	0.31;0.31;0.31	4.4	4.4	0.53042	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.33591	U	0.004747	D	0.82986	0.5156	H	0.98218	4.175	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.87284	0.2294	10	0.87932	D	0	.	10.1832	0.42982	0.0:0.0:0.0:1.0	.	153	Q9NY57	ST32B_HUMAN	P	153;106;106	ENSP00000282908:L153P;ENSP00000423209:L106P;ENSP00000420984:L106P	ENSP00000282908:L153P	L	+	2	0	STK32B	5450858	0.967000	0.33354	0.811000	0.32455	0.668000	0.39293	3.155000	0.50700	1.975000	0.57531	0.533000	0.62120	CTG	.	.		0.493	STK32B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206854.4	NM_018401	
WDR19	57728	hgsc.bcm.edu	37	4	39280267	39280267	+	Silent	SNP	G	G	C	rs371200402		TCGA-5C-A9VH-01A-11D-A36X-10	TCGA-5C-A9VH-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	44e358dc-cbf5-4177-89a4-3d0d0fe2ff38	b56ae97e-c498-4223-a583-2b86e313f4bb	g.chr4:39280267G>C	ENST00000399820.3	+	36	4180	c.4026G>C	c.(4024-4026)ctG>ctC	p.L1342L	WDR19_ENST00000288634.7_Silent_p.L1182L	NM_025132.3	NP_079408.3	Q8NEZ3	WDR19_HUMAN	WD repeat domain 19	1342					ciliary receptor clustering involved in smoothened signaling pathway (GO:0060830)|cilium assembly (GO:0042384)|digestive system development (GO:0055123)|ear morphogenesis (GO:0042471)|embryonic camera-type eye development (GO:0031076)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic limb morphogenesis (GO:0030326)|in utero embryonic development (GO:0001701)|intraciliary retrograde transport (GO:0035721)|myotome development (GO:0061055)|neurological system process (GO:0050877)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|intraciliary transport particle A (GO:0030991)|motile cilium (GO:0031514)|nonmotile primary cilium (GO:0031513)|photoreceptor connecting cilium (GO:0032391)				large_intestine(1)	1						AGGAGGAACTGTGATTGGCAC	0.527																																					p.L1342L		Atlas-SNP	.											.	WDR19	96	.	0			c.G4026C						.						64.0	63.0	63.0					4																	39280267		2083	4221	6304	SO:0001819	synonymous_variant	57728	exon36			GGAACTGTGATTG	AB046858, AY029257	CCDS47042.1	4p14	2014-02-21			ENSG00000157796	ENSG00000157796		"""WD repeat domain containing"", ""Intraflagellar transport homologs"""	18340	protein-coding gene	gene with protein product	"""intraflagellar transport 144 homolog (Chlamydomonas)"""	608151				12906858, 22019273	Standard	XM_005262658		Approved	Pwdmp, KIAA1638, FLJ23127, ORF26, DYF-2, Oseg6, IFT144, NPHP13	uc003gtv.3	Q8NEZ3	OTTHUMG00000160466	ENST00000399820.3:c.4026G>C	chr4.hg19:g.39280267G>C		187.0	0.0		157.0	70.0	NM_025132	B5MEF2|Q8N5B4|Q9H5S0|Q9HCD4	Silent	SNP	ENST00000399820.3	hg19	CCDS47042.1																																																																																			.	.		0.527	WDR19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360689.1		
BEND4	389206	hgsc.bcm.edu	37	4	42154069	42154069	+	Missense_Mutation	SNP	G	G	T			TCGA-5C-A9VH-01A-11D-A36X-10	TCGA-5C-A9VH-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	44e358dc-cbf5-4177-89a4-3d0d0fe2ff38	b56ae97e-c498-4223-a583-2b86e313f4bb	g.chr4:42154069G>T	ENST00000502486.1	-	2	671	c.92C>A	c.(91-93)cCc>cAc	p.P31H	BEND4_ENST00000504360.1_Missense_Mutation_p.P27H	NM_207406.3	NP_997289.2	Q6ZU67	BEND4_HUMAN	BEN domain containing 4	31										NS(2)|breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(15)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	26						TCTCTTGCTGGGGAACGTCTT	0.716																																					p.P31H		Atlas-SNP	.											BEND4,NS,carcinoma,0,1	BEND4	67	.	0			c.C92A						.						9.0	12.0	11.0					4																	42154069		1845	3930	5775	SO:0001583	missense	389206	exon2			TTGCTGGGGAACG	AK092951	CCDS47048.1	4p13	2012-11-22	2008-10-03	2008-10-03	ENSG00000188848	ENSG00000188848		"""BEN domain containing"""	23815	protein-coding gene	gene with protein product			"""coiled-coil domain containing 4"""	CCDC4			Standard	NM_207406		Approved	FLJ35632, FLJ43965	uc003gwn.3	Q6ZU67	OTTHUMG00000160531	ENST00000502486.1:c.92C>A	chr4.hg19:g.42154069G>T	ENSP00000421169:p.Pro31His	113.0	0.0		82.0	29.0	NM_001159547	A1A5D6|A1A5D7|C9JQZ5|Q58A26|Q58A27	Missense_Mutation	SNP	ENST00000502486.1	hg19	CCDS47048.1	.	.	.	.	.	.	.	.	.	.	G	17.24	3.338345	0.60963	.	.	ENSG00000188848	ENST00000411720;ENST00000502486;ENST00000504360	.	.	.	3.12	3.12	0.35913	.	0.470207	0.17105	U	0.186837	T	0.62183	0.2407	L	0.29908	0.895	0.45962	D	0.998785	D;D	0.71674	0.991;0.998	P;D	0.64237	0.779;0.923	T	0.65647	-0.6117	9	0.87932	D	0	.	12.9238	0.58247	0.0:0.0:1.0:0.0	.	31;31	Q6ZU67;Q6ZU67-2	BEND4_HUMAN;.	H	27;31;27	.	ENSP00000412495:P27H	P	-	2	0	BEND4	41848826	1.000000	0.71417	0.993000	0.49108	0.985000	0.73830	3.924000	0.56476	1.240000	0.43803	0.313000	0.20887	CCC	.	.		0.716	BEND4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360975.2	NM_207406	
GSTCD	79807	hgsc.bcm.edu	37	4	106766631	106766631	+	Missense_Mutation	SNP	G	G	T			TCGA-5C-A9VH-01A-11D-A36X-10	TCGA-5C-A9VH-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	44e358dc-cbf5-4177-89a4-3d0d0fe2ff38	b56ae97e-c498-4223-a583-2b86e313f4bb	g.chr4:106766631G>T	ENST00000515279.1	+	12	2019	c.1799G>T	c.(1798-1800)cGa>cTa	p.R600L	GSTCD_ENST00000515255.1_3'UTR|GSTCD_ENST00000394730.3_Missense_Mutation_p.R513L|GSTCD_ENST00000360505.5_Missense_Mutation_p.R600L|GSTCD_ENST00000394728.3_Missense_Mutation_p.R600L			Q8NEC7	GSTCD_HUMAN	glutathione S-transferase, C-terminal domain containing	600						extracellular vesicular exosome (GO:0070062)				breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(5)|lung(2)|ovary(1)|skin(1)	14		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;3.15e-07)|READ - Rectum adenocarcinoma(30;0.139)		GATCTGGATCGAGCAAGAGCT	0.453																																					p.R600L		Atlas-SNP	.											.	GSTCD	69	.	0			c.G1799T						.						110.0	109.0	109.0					4																	106766631		1973	4175	6148	SO:0001583	missense	79807	exon12			TGGATCGAGCAAG	BC032942	CCDS3672.2, CCDS43257.1	4q24	2008-02-05	2006-05-09		ENSG00000138780	ENSG00000138780			25806	protein-coding gene	gene with protein product		615912	"""Glutathione S-transferase, C-terminal domain containing"""			12477932	Standard	NM_001031720		Approved	FLJ13273	uc003hxz.4	Q8NEC7	OTTHUMG00000131211	ENST00000515279.1:c.1799G>T	chr4.hg19:g.106766631G>T	ENSP00000422354:p.Arg600Leu	78.0	0.0		74.0	30.0	NM_001031720	A8K8J0|A8MVD3|H9KV97|Q9H8S3	Missense_Mutation	SNP	ENST00000515279.1	hg19	CCDS43257.1	.	.	.	.	.	.	.	.	.	.	G	31	5.095948	0.94197	.	.	ENSG00000138780	ENST00000394730;ENST00000515279;ENST00000360505;ENST00000394728	.	.	.	5.33	5.33	0.75918	.	0.000000	0.85682	D	0.000000	D	0.83940	0.5363	M	0.82716	2.605	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.86281	0.1667	9	0.87932	D	0	-8.7287	19.0547	0.93058	0.0:0.0:1.0:0.0	.	600;223	Q8NEC7;B7Z8J7	GSTCD_HUMAN;.	L	513;600;600;600	.	ENSP00000353695:R600L	R	+	2	0	GSTCD	106986080	1.000000	0.71417	1.000000	0.80357	0.931000	0.56810	9.038000	0.93771	2.480000	0.83734	0.650000	0.86243	CGA	.	.		0.453	GSTCD-006	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363981.1	NM_024751	
SORBS2	8470	hgsc.bcm.edu	37	4	186544464	186544464	+	Missense_Mutation	SNP	G	G	T			TCGA-5C-A9VH-01A-11D-A36X-10	TCGA-5C-A9VH-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	44e358dc-cbf5-4177-89a4-3d0d0fe2ff38	b56ae97e-c498-4223-a583-2b86e313f4bb	g.chr4:186544464G>T	ENST00000284776.7	-	13	2616	c.2107C>A	c.(2107-2109)Cct>Act	p.P703T	SORBS2_ENST00000355634.5_Missense_Mutation_p.P803T|SORBS2_ENST00000498125.1_Intron|SORBS2_ENST00000437304.2_Intron|SORBS2_ENST00000431808.1_Missense_Mutation_p.P703T|SORBS2_ENST00000319471.9_Intron|SORBS2_ENST00000449407.2_Intron|SORBS2_ENST00000393528.3_Intron|SORBS2_ENST00000418609.1_Missense_Mutation_p.P607T|SORBS2_ENST00000448662.2_Intron	NM_021069.4	NP_066547.1	O94875	SRBS2_HUMAN	sorbin and SH3 domain containing 2	703					actin filament organization (GO:0007015)|cell adhesion (GO:0007155)|cell migration (GO:0016477)	actin cytoskeleton (GO:0015629)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|Z disc (GO:0030018)	cytoskeletal adaptor activity (GO:0008093)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)			endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(9)|lung(21)|ovary(2)|prostate(2)|skin(4)|urinary_tract(1)	53		all_cancers(14;4.27e-52)|all_epithelial(14;6.58e-39)|all_lung(41;1.42e-13)|Lung NSC(41;3.73e-13)|Melanoma(20;1.91e-06)|Colorectal(36;0.00692)|Hepatocellular(41;0.00826)|Renal(120;0.00994)|Prostate(90;0.0101)|all_hematologic(60;0.0174)|all_neural(102;0.244)		OV - Ovarian serous cystadenocarcinoma(60;1.54e-09)|BRCA - Breast invasive adenocarcinoma(30;0.000232)|GBM - Glioblastoma multiforme(59;0.000385)|STAD - Stomach adenocarcinoma(60;0.00109)|LUSC - Lung squamous cell carcinoma(40;0.0205)		AAAGGCACAGGACTGACTAGA	0.453																																					p.P803T	Esophageal Squamous(153;41 2433 9491 36028)	Atlas-SNP	.											.	SORBS2	300	.	0			c.C2407A						.						132.0	144.0	140.0					4																	186544464		2203	4300	6503	SO:0001583	missense	8470	exon16			GCACAGGACTGAC		CCDS3845.1, CCDS43289.2, CCDS47173.1, CCDS47174.1, CCDS47175.1, CCDS47176.1, CCDS54825.1, CCDS59482.1	4q35.1	2008-02-05			ENSG00000154556	ENSG00000154556			24098	protein-coding gene	gene with protein product	"""Arg/Abl interacting protein"""					9211900, 9872452	Standard	NM_021069		Approved	ARGBP2, KIAA0777	uc003iym.3	O94875	OTTHUMG00000157215	ENST00000284776.7:c.2107C>A	chr4.hg19:g.186544464G>T	ENSP00000284776:p.Pro703Thr	56.0	0.0		44.0	18.0	NM_001270771	A6NEK9|B3KPQ7|B7Z1G5|B7Z3X6|C9JKV9|D3DP62|D3DP63|E9PAS5|E9PAW4|G3XAI0|H7BXR4|J3KNZ5|O60592|O60593|Q96EX0	Missense_Mutation	SNP	ENST00000284776.7	hg19	CCDS3845.1	.	.	.	.	.	.	.	.	.	.	G	15.74	2.922135	0.52653	.	.	ENSG00000154556	ENST00000284776;ENST00000431808;ENST00000418609;ENST00000355634	T;T;T;T	0.74421	-0.71;-0.71;-0.72;-0.84	5.88	5.88	0.94601	.	0.000000	0.85682	D	0.000000	D	0.86163	0.5867	M	0.68593	2.085	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.85130	0.997;0.996;0.997	D	0.85980	0.1482	10	0.66056	D	0.02	-21.1686	20.2405	0.98372	0.0:0.0:1.0:0.0	.	607;803;703	B7Z3X6;B3KPQ7;O94875	.;.;SRBS2_HUMAN	T	703;703;607;803	ENSP00000284776:P703T;ENSP00000411764:P703T;ENSP00000397482:P607T;ENSP00000347852:P803T	ENSP00000284776:P703T	P	-	1	0	SORBS2	186781458	1.000000	0.71417	0.995000	0.50966	0.072000	0.16883	9.869000	0.99810	2.797000	0.96272	0.561000	0.74099	CCT	.	.		0.453	SORBS2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000347944.3	NM_003603	
TMEM174	134288	hgsc.bcm.edu	37	5	72469952	72469952	+	Missense_Mutation	SNP	C	C	G	rs556952520		TCGA-5C-A9VH-01A-11D-A36X-10	TCGA-5C-A9VH-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	44e358dc-cbf5-4177-89a4-3d0d0fe2ff38	b56ae97e-c498-4223-a583-2b86e313f4bb	g.chr5:72469952C>G	ENST00000296776.5	+	2	741	c.692C>G	c.(691-693)tCt>tGt	p.S231C	TMEM174_ENST00000511737.1_Intron	NM_153217.2	NP_694949.1	Q8WUU8	TM174_HUMAN	transmembrane protein 174	231						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				endometrium(1)|large_intestine(2)|lung(2)|ovary(1)|skin(1)	7		Lung NSC(167;0.0378)|Ovarian(174;0.0908)|Prostate(461;0.165)		OV - Ovarian serous cystadenocarcinoma(47;1.46e-54)		GCCTGCTTCTCTCCTCCCCCT	0.473																																					p.S231C		Atlas-SNP	.											TMEM174,NS,malignant_melanoma,0,1	TMEM174	22	.	0			c.C692G						.						117.0	114.0	115.0					5																	72469952		2203	4300	6503	SO:0001583	missense	134288	exon2			GCTTCTCTCCTCC	BC019346	CCDS4018.1	5q13.2	2008-02-05			ENSG00000164325	ENSG00000164325			28187	protein-coding gene	gene with protein product		614909				12477932	Standard	NM_153217		Approved	MGC13034, FLJ31268	uc010izc.3	Q8WUU8	OTTHUMG00000131268	ENST00000296776.5:c.692C>G	chr5.hg19:g.72469952C>G	ENSP00000296776:p.Ser231Cys	122.0	0.0		106.0	29.0	NM_153217	B2RDA0|Q96N81	Missense_Mutation	SNP	ENST00000296776.5	hg19	CCDS4018.1	.	.	.	.	.	.	.	.	.	.	C	14.59	2.580424	0.46006	.	.	ENSG00000164325	ENST00000296776	.	.	.	5.24	5.24	0.73138	.	0.210963	0.41938	D	0.000800	T	0.75664	0.3880	M	0.69823	2.125	0.43338	D	0.995389	D	0.65815	0.995	P	0.61132	0.884	T	0.77099	-0.2713	9	0.56958	D	0.05	-14.3656	16.1353	0.81481	0.0:1.0:0.0:0.0	.	231	Q8WUU8	TM174_HUMAN	C	231	.	ENSP00000296776:S231C	S	+	2	0	TMEM174	72505708	1.000000	0.71417	1.000000	0.80357	0.129000	0.20672	2.698000	0.47068	2.726000	0.93360	0.655000	0.94253	TCT	.	.		0.473	TMEM174-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254036.1	NM_153217	
PCDHB12	56124	hgsc.bcm.edu	37	5	140589288	140589288	+	Missense_Mutation	SNP	A	A	T			TCGA-5C-A9VH-01A-11D-A36X-10	TCGA-5C-A9VH-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	44e358dc-cbf5-4177-89a4-3d0d0fe2ff38	b56ae97e-c498-4223-a583-2b86e313f4bb	g.chr5:140589288A>T	ENST00000239450.2	+	1	998	c.809A>T	c.(808-810)gAc>gTc	p.D270V	PCDHB12_ENST00000541609.1_Intron	NM_018932.3	NP_061755.1	Q9Y5F1	PCDBC_HUMAN	protocadherin beta 12	270	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(3)|endometrium(10)|large_intestine(17)|lung(38)|ovary(3)|pancreas(1)|prostate(2)|skin(7)|stomach(1)	83			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TGGGATTTAGACTCTGGAACA	0.428																																					p.D270V		Atlas-SNP	.											.	PCDHB12	179	.	0			c.A809T						.						135.0	141.0	139.0					5																	140589288		2203	4300	6503	SO:0001583	missense	56124	exon1			ATTTAGACTCTGG	AF152491	CCDS4254.1	5q31	2010-01-26			ENSG00000120328	ENSG00000120328		"""Cadherins / Protocadherins : Clustered"""	8683	other	protocadherin		606338				10380929	Standard	NM_018932		Approved	PCDH-BETA12	uc003liz.3	Q9Y5F1	OTTHUMG00000129620	ENST00000239450.2:c.809A>T	chr5.hg19:g.140589288A>T	ENSP00000239450:p.Asp270Val	132.0	0.0		115.0	44.0	NM_018932	B4DDU1	Missense_Mutation	SNP	ENST00000239450.2	hg19	CCDS4254.1	.	.	.	.	.	.	.	.	.	.	A	16.10	3.027167	0.54683	.	.	ENSG00000120328	ENST00000239450	T	0.74737	-0.87	4.16	4.16	0.48862	Cadherin (5);Cadherin-like (1);	.	.	.	.	D	0.91593	0.7344	H	0.99357	4.53	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.94377	0.7601	9	0.87932	D	0	.	13.1424	0.59442	1.0:0.0:0.0:0.0	.	270	Q9Y5F1	PCDBC_HUMAN	V	270	ENSP00000239450:D270V	ENSP00000239450:D270V	D	+	2	0	PCDHB12	140569472	1.000000	0.71417	0.455000	0.27031	0.524000	0.34500	9.187000	0.94912	1.648000	0.50643	0.402000	0.26972	GAC	.	.		0.428	PCDHB12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251815.2	NM_018932	
PCDH1	5097	hgsc.bcm.edu	37	5	141248468	141248468	+	Missense_Mutation	SNP	G	G	A			TCGA-5C-A9VH-01A-11D-A36X-10	TCGA-5C-A9VH-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	44e358dc-cbf5-4177-89a4-3d0d0fe2ff38	b56ae97e-c498-4223-a583-2b86e313f4bb	g.chr5:141248468G>A	ENST00000394536.3	-	2	708	c.569C>T	c.(568-570)cCg>cTg	p.P190L	PCDH1_ENST00000456271.1_Missense_Mutation_p.P190L|PCDH1_ENST00000287008.3_Missense_Mutation_p.P190L|PCDH1_ENST00000536585.1_Missense_Mutation_p.P168L|PCDH1_ENST00000511044.1_5'Flank|PCDH1_ENST00000503492.1_Missense_Mutation_p.P190L	NM_001278613.1|NM_001278615.1	NP_001265542.1|NP_001265544.1	Q08174	PCDH1_HUMAN	protocadherin 1	190	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell-cell signaling (GO:0007267)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	cell-cell junction (GO:0005911)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(4)|lung(20)|ovary(5)|skin(3)|upper_aerodigestive_tract(1)	51		Lung NSC(810;0.027)|all_lung(500;0.0321)|all_hematologic(541;0.0433)|Prostate(461;0.0453)|Breast(839;0.128)|Lung SC(612;0.238)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)	GBM - Glioblastoma multiforme(465;1.06e-05)		TGAAGCCAGCGGGATGGGGAA	0.577																																					p.P190L	Ovarian(132;1609 1739 4190 14731 45037)	Atlas-SNP	.											.	PCDH1	119	.	0			c.C569T						.						290.0	277.0	281.0					5																	141248468		2203	4300	6503	SO:0001583	missense	5097	exon2			GCCAGCGGGATGG	AK075233	CCDS4267.1, CCDS43375.1	5q31.3	2010-01-26	2007-02-12		ENSG00000156453	ENSG00000156453		"""Cadherins / Protocadherins : Non-clustered"""	8655	protein-coding gene	gene with protein product		603626	"""protocadherin 1 (cadherin-like 1)"""			8508762	Standard	NM_032420		Approved	pc42	uc003llp.3	Q08174	OTTHUMG00000129661	ENST00000394536.3:c.569C>T	chr5.hg19:g.141248468G>A	ENSP00000378043:p.Pro190Leu	185.0	0.0		182.0	77.0	NM_032420	Q8IUP2	Missense_Mutation	SNP	ENST00000394536.3	hg19	CCDS43375.1	.	.	.	.	.	.	.	.	.	.	g	22.5	4.302915	0.81136	.	.	ENSG00000156453	ENST00000503492;ENST00000287008;ENST00000394536;ENST00000456271;ENST00000357517;ENST00000536585	T;T;T;T;T;T	0.41400	1.0;1.0;1.0;1.0;1.0;1.0	4.91	4.91	0.64330	Cadherin (4);Cadherin-like (1);	0.000000	0.51477	D	0.000093	T	0.58148	0.2102	L	0.47190	1.495	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.80764	0.989;0.994	T	0.61148	-0.7121	10	0.87932	D	0	.	15.985	0.80144	0.0:0.0:1.0:0.0	.	190;190	Q08174;Q08174-2	PCDH1_HUMAN;.	L	190;190;190;190;201;168	ENSP00000424667:P190L;ENSP00000287008:P190L;ENSP00000378043:P190L;ENSP00000403497:P190L;ENSP00000350122:P201L;ENSP00000438825:P168L	ENSP00000287008:P190L	P	-	2	0	PCDH1	141228652	1.000000	0.71417	0.989000	0.46669	0.985000	0.73830	6.535000	0.73838	2.442000	0.82660	0.550000	0.68814	CCG	.	.		0.577	PCDH1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000251862.1	NM_032420	
HIVEP1	3096	hgsc.bcm.edu	37	6	12121246	12121246	+	Silent	SNP	T	T	C			TCGA-5C-A9VH-01A-11D-A36X-10	TCGA-5C-A9VH-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	44e358dc-cbf5-4177-89a4-3d0d0fe2ff38	b56ae97e-c498-4223-a583-2b86e313f4bb	g.chr6:12121246T>C	ENST00000379388.2	+	4	1550	c.1218T>C	c.(1216-1218)taT>taC	p.Y406Y		NM_002114.2	NP_002105.2	P15822	ZEP1_HUMAN	human immunodeficiency virus type I enhancer binding protein 1	406					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(5)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(11)|liver(1)|lung(31)|ovary(4)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(3)	90	Breast(50;0.0639)|Ovarian(93;0.0816)	all_hematologic(90;0.117)				AAGGAAAATATATTTGTGAGT	0.403																																					p.Y406Y		Atlas-SNP	.											.	HIVEP1	242	.	0			c.T1218C						.						81.0	77.0	78.0					6																	12121246		1923	4131	6054	SO:0001819	synonymous_variant	3096	exon4			AAAATATATTTGT	J05011	CCDS43426.1	6p24-p22.3	2012-10-05	2001-11-28		ENSG00000095951	ENSG00000095951		"""Zinc fingers, C2H2-type"""	4920	protein-coding gene	gene with protein product		194540	"""human immunodeficiency virus type I enhancer-binding protein 1"", ""zinc finger protein 40"""	ZNF40		2037300	Standard	XR_241895		Approved	CIRIP, MBP-1, CRYBP1, PRDII-BF1, ZAS1, Schnurri-1, ZNF40A	uc003nac.3	P15822	OTTHUMG00000014265	ENST00000379388.2:c.1218T>C	chr6.hg19:g.12121246T>C		91.0	0.0		84.0	29.0	NM_002114	B2RTU3|Q14122|Q5MPB1|Q5VW60	Silent	SNP	ENST00000379388.2	hg19	CCDS43426.1																																																																																			.	.		0.403	HIVEP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039870.2	NM_002114	
SLC17A3	10786	hgsc.bcm.edu	37	6	25850803	25850803	+	Missense_Mutation	SNP	A	A	G			TCGA-5C-A9VH-01A-11D-A36X-10	TCGA-5C-A9VH-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	44e358dc-cbf5-4177-89a4-3d0d0fe2ff38	b56ae97e-c498-4223-a583-2b86e313f4bb	g.chr6:25850803A>G	ENST00000360657.3	-	7	928	c.643T>C	c.(643-645)Tct>Cct	p.S215P	SLC17A3_ENST00000361703.6_Missense_Mutation_p.S215P|SLC17A3_ENST00000397060.4_Missense_Mutation_p.S293P			O00476	NPT4_HUMAN	solute carrier family 17 (organic anion transporter), member 3	215					drug transmembrane transport (GO:0006855)|drug transport (GO:0015893)|glucose-6-phosphate transport (GO:0015760)|ion transmembrane transport (GO:0034220)|organic acid transport (GO:0015849)|organic anion transport (GO:0015711)|phosphate ion transmembrane transport (GO:0035435)|phosphate ion transport (GO:0006817)|regulation of anion transport (GO:0044070)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|toxin transport (GO:1901998)|transmembrane transport (GO:0055085)|urate metabolic process (GO:0046415)|urate transport (GO:0015747)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	drug transmembrane transporter activity (GO:0015238)|efflux transmembrane transporter activity (GO:0015562)|organic anion transmembrane transporter activity (GO:0008514)|sodium:phosphate symporter activity (GO:0005436)|toxin transporter activity (GO:0019534)|urate transmembrane transporter activity (GO:0015143)|voltage-gated anion channel activity (GO:0008308)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(10)|prostate(1)	20						ATGGGTAGAGATCTGAGCATA	0.423																																					p.S293P		Atlas-SNP	.											.	SLC17A3	95	.	0			c.T877C						.						142.0	129.0	133.0					6																	25850803		2203	4300	6503	SO:0001583	missense	10786	exon8			GTAGAGATCTGAG	U90545	CCDS4566.2, CCDS47385.1	6p22.2	2013-07-18	2013-07-18		ENSG00000124564	ENSG00000124564		"""Solute carriers"""	10931	protein-coding gene	gene with protein product		611034	"""solute carrier family 17 (sodium phosphate), member 3"""			9149941	Standard	NM_006632		Approved	NPT4	uc003nfk.4	O00476	OTTHUMG00000014412	ENST00000360657.3:c.643T>C	chr6.hg19:g.25850803A>G	ENSP00000353873:p.Ser215Pro	119.0	0.0		114.0	39.0	NM_001098486	B7WNJ5|B7Z511|Q8WWC7|Q9H533	Missense_Mutation	SNP	ENST00000360657.3	hg19	CCDS4566.2	.	.	.	.	.	.	.	.	.	.	A	12.17	1.856427	0.32791	.	.	ENSG00000124564	ENST00000397060;ENST00000360657;ENST00000361703	T;T;T	0.60672	0.17;0.17;0.17	3.53	3.53	0.40419	Major facilitator superfamily domain, general substrate transporter (1);	0.000000	0.46145	D	0.000318	T	0.72260	0.3438	M	0.93328	3.405	0.21473	N	0.999676	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;1.0;0.998	T	0.64791	-0.6324	10	0.87932	D	0	.	8.7361	0.34530	1.0:0.0:0.0:0.0	.	215;293;215	B7Z531;B7Z511;O00476	.;.;NPT4_HUMAN	P	293;215;215	ENSP00000380250:S293P;ENSP00000353873:S215P;ENSP00000355307:S215P	ENSP00000353873:S215P	S	-	1	0	SLC17A3	25958782	0.685000	0.27652	0.023000	0.16930	0.077000	0.17291	5.078000	0.64425	1.823000	0.53134	0.477000	0.44152	TCT	.	.		0.423	SLC17A3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000040070.2		
PRRT1	80863	hgsc.bcm.edu	37	6	32117406	32117406	+	Missense_Mutation	SNP	G	G	T			TCGA-5C-A9VH-01A-11D-A36X-10	TCGA-5C-A9VH-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	44e358dc-cbf5-4177-89a4-3d0d0fe2ff38	b56ae97e-c498-4223-a583-2b86e313f4bb	g.chr6:32117406G>T	ENST00000211413.5	-	3	776	c.652C>A	c.(652-654)Cgc>Agc	p.R218S	PRRT1_ENST00000375152.2_Missense_Mutation_p.R137S|PRRT1_ENST00000467780.1_5'UTR|PRRT1_ENST00000375150.2_Missense_Mutation_p.R137S	NM_030651.3	NP_085154.3	Q99946	PRRT1_HUMAN	proline-rich transmembrane protein 1	218					response to biotic stimulus (GO:0009607)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synapse (GO:0045202)				breast(2)|endometrium(1)|kidney(1)|lung(2)	6						TGTGGCGGGCGCCTCGGCTCC	0.672																																					p.R218S		Atlas-SNP	.											.	PRRT1	14	.	0			c.C652A						.						41.0	42.0	41.0					6																	32117406		1507	2708	4215	SO:0001583	missense	80863	exon3			GCGGGCGCCTCGG	AK054885	CCDS4739.1	6p21.32	2011-10-10	2005-07-24	2005-07-24		ENSG00000204314		"""Proline-rich transmembrane proteins"""	13943	protein-coding gene	gene with protein product	"""interferon induced transmembrane protein domain containing 7"""		"""chromosome 6 open reading frame 31"""	C6orf31			Standard	XM_006715221		Approved	NG5, IFITMD7	uc003nzt.3	Q99946		ENST00000211413.5:c.652C>A	chr6.hg19:g.32117406G>T	ENSP00000211413:p.Arg218Ser	89.0	0.0		61.0	30.0	NM_030651	A6ND08|A6ND40|B0S869|Q5SSW4|Q5SSX7|Q5STI1|Q96DW3|Q96NQ8	Missense_Mutation	SNP	ENST00000211413.5	hg19	CCDS4739.1	.	.	.	.	.	.	.	.	.	.	G	32	5.170636	0.94807	.	.	ENSG00000204314	ENST00000211413;ENST00000375150;ENST00000375152	D;D;D	0.85556	-2.0;-2.0;-2.0	5.03	5.03	0.67393	.	.	.	.	.	T	0.78065	0.4225	N	0.12569	0.235	0.53688	D	0.999977	D;D	0.89917	0.997;1.0	D;D	0.85130	0.993;0.997	T	0.76035	-0.3106	9	0.09338	T	0.73	-1.509	15.8661	0.79067	0.0:0.0:1.0:0.0	.	218;137	Q99946;Q99946-2	PRRT1_HUMAN;.	S	218;137;137	ENSP00000211413:R218S;ENSP00000364292:R137S;ENSP00000364294:R137S	ENSP00000211413:R218S	R	-	1	0	PRRT1	32225384	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.263000	0.65507	2.354000	0.79902	0.650000	0.86243	CGC	.	.		0.672	PRRT1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076255.2	NM_030651	
NOTCH4	4855	hgsc.bcm.edu	37	6	32190405	32190405	+	Missense_Mutation	SNP	C	C	T			TCGA-5C-A9VH-01A-11D-A36X-10	TCGA-5C-A9VH-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	44e358dc-cbf5-4177-89a4-3d0d0fe2ff38	b56ae97e-c498-4223-a583-2b86e313f4bb	g.chr6:32190405C>T	ENST00000375023.3	-	3	472	c.334G>A	c.(334-336)Gag>Aag	p.E112K		NM_004557.3	NP_004548.3	Q99466	NOTC4_HUMAN	notch 4	112	EGF-like 2. {ECO:0000255|PROSITE- ProRule:PRU00076}.				cell differentiation (GO:0030154)|cell fate determination (GO:0001709)|embryo development (GO:0009790)|endothelial cell morphogenesis (GO:0001886)|gene expression (GO:0010467)|hemopoiesis (GO:0030097)|mammary gland development (GO:0030879)|morphogenesis of a branching structure (GO:0001763)|negative regulation of cell differentiation (GO:0045596)|negative regulation of endothelial cell differentiation (GO:0045602)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|patterning of blood vessels (GO:0001569)|positive regulation of transcription of Notch receptor target (GO:0007221)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cell surface (GO:0009986)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|protein heterodimerization activity (GO:0046982)|receptor activity (GO:0004872)			NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(4)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(47)|ovary(5)|prostate(4)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(1)	100						TGGCATCTCTCACCAGTGAAG	0.632																																					p.E112K		Atlas-SNP	.											.	NOTCH4	201	.	0			c.G334A						.						72.0	75.0	74.0					6																	32190405		2203	4300	6503	SO:0001583	missense	4855	exon3			ATCTCTCACCAGT		CCDS34420.1	6p21.3	2013-01-10	2010-06-24		ENSG00000204301	ENSG00000204301		"""Ankyrin repeat domain containing"""	7884	protein-coding gene	gene with protein product		164951	"""Notch (Drosophila) homolog 4"", ""Notch homolog 4 (Drosophila)"""	INT3		7835890	Standard	NM_004557		Approved		uc003obb.3	Q99466	OTTHUMG00000031044	ENST00000375023.3:c.334G>A	chr6.hg19:g.32190405C>T	ENSP00000364163:p.Glu112Lys	172.0	0.0		153.0	51.0	NM_004557	B0V183|B0V1X5|O00306|Q5SSY7|Q99458|Q99940|Q9H3S8|Q9UII9|Q9UIJ0	Missense_Mutation	SNP	ENST00000375023.3	hg19	CCDS34420.1	.	.	.	.	.	.	.	.	.	.	C	9.454	1.091386	0.20471	.	.	ENSG00000204301	ENST00000375023	T	0.40756	1.02	4.14	0.959	0.19624	Epidermal growth factor-like (1);EGF-like region, conserved site (2);Epidermal growth factor-like, type 3 (1);	1.004830	0.08021	N	0.991897	T	0.04724	0.0128	N	0.04090	-0.28	0.09310	N	1	B;B	0.09022	0.002;0.002	B;B	0.16289	0.015;0.01	T	0.35773	-0.9775	10	0.13108	T	0.6	.	0.7382	0.00969	0.1951:0.3913:0.1868:0.2268	.	112;112	Q6P3V5;Q99466	.;NOTC4_HUMAN	K	112	ENSP00000364163:E112K	ENSP00000364163:E112K	E	-	1	0	NOTCH4	32298383	0.000000	0.05858	0.469000	0.27204	0.610000	0.37248	0.243000	0.18106	0.381000	0.24851	0.561000	0.74099	GAG	.	.		0.632	NOTCH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076045.2		
GLP1R	2740	hgsc.bcm.edu	37	6	39048499	39048500	+	Nonsense_Mutation	DNP	GC	GC	AA			TCGA-5C-A9VH-01A-11D-A36X-10	TCGA-5C-A9VH-10A-01D-A370-10	G|C	G|C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	44e358dc-cbf5-4177-89a4-3d0d0fe2ff38	b56ae97e-c498-4223-a583-2b86e313f4bb	g.chr6:39048499_39048500GC>AA	ENST00000373256.4	+	12	1251_1252	c.1208_1209GC>AA	c.(1207-1209)tGC>tAA	p.C403*		NM_002062.3	NP_002053.3	P43220	GLP1R_HUMAN	glucagon-like peptide 1 receptor	403					activation of adenylate cyclase activity (GO:0007190)|cAMP-mediated signaling (GO:0019933)|energy reserve metabolic process (GO:0006112)|learning or memory (GO:0007611)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of heart contraction (GO:0008016)|regulation of insulin secretion (GO:0050796)|response to stress (GO:0006950)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	glucagon receptor activity (GO:0004967)|transmembrane signaling receptor activity (GO:0004888)			breast(5)|endometrium(3)|kidney(1)|large_intestine(8)|lung(9)|pancreas(1)|prostate(1)|skin(1)|stomach(2)	31					Exenatide(DB01276)|Glucagon recombinant(DB00040)|Liraglutide(DB06655)	ATATTATACTGCTTTGTCAACA	0.569																																					p.C403Y|p.C403X		Atlas-SNP	.											.	GLP1R	64	.	0			c.G1208A|c.C1209A						.																																			SO:0001587	stop_gained	2740	exon12			TATACTGCTTTGT|ATACTGCTTTGTC		CCDS4839.1	6p21	2012-08-10			ENSG00000112164	ENSG00000112164		"""GPCR / Class B : Glucagon receptors"""	4324	protein-coding gene	gene with protein product		138032					Standard	NM_002062		Approved		uc003ooj.4	P43220	OTTHUMG00000014638	Exception_encountered	chr6.hg19:g.39048499_39048500delinsAA	ENSP00000362353:p.Cys403*	83.0|82.0	0.0		70.0	23.0	NM_002062	Q2M229|Q99669	Missense_Mutation|Nonsense_Mutation	SNP	ENST00000373256.4	hg19	CCDS4839.1																																																																																			.	.		0.569	GLP1R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040443.1		
FILIP1	27145	hgsc.bcm.edu	37	6	76023250	76023250	+	Silent	SNP	C	C	T	rs147346630		TCGA-5C-A9VH-01A-11D-A36X-10	TCGA-5C-A9VH-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	44e358dc-cbf5-4177-89a4-3d0d0fe2ff38	b56ae97e-c498-4223-a583-2b86e313f4bb	g.chr6:76023250C>T	ENST00000237172.7	-	5	2628	c.2298G>A	c.(2296-2298)ggG>ggA	p.G766G	FILIP1_ENST00000393004.2_Silent_p.G766G|FILIP1_ENST00000498523.1_5'UTR|FILIP1_ENST00000370020.1_Silent_p.G667G	NM_015687.2	NP_056502.1	Q7Z7B0	FLIP1_HUMAN	filamin A interacting protein 1	766										breast(3)|central_nervous_system(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|liver(1)|lung(28)|ovary(1)|pancreas(1)|prostate(5)|skin(9)|upper_aerodigestive_tract(4)	80						GAACCTCCTGCCCCATGTTTT	0.413																																					p.G766G		Atlas-SNP	.											.	FILIP1	173	.	0			c.G2298A						.						127.0	131.0	129.0					6																	76023250		2203	4300	6503	SO:0001819	synonymous_variant	27145	exon5			CTCCTGCCCCATG	AB033101	CCDS4984.1, CCDS75480.1	6q14.1	2008-02-05			ENSG00000118407	ENSG00000118407			21015	protein-coding gene	gene with protein product		607307				10574462	Standard	XM_005248713		Approved	FILIP, KIAA1275	uc003pia.3	Q7Z7B0	OTTHUMG00000015056	ENST00000237172.7:c.2298G>A	chr6.hg19:g.76023250C>T		113.0	0.0		79.0	27.0	NM_015687	B2RMU6|Q5VUL6|Q86TC3|Q8N8B9|Q96SK6|Q9NVI8|Q9ULE5	Silent	SNP	ENST00000237172.7	hg19	CCDS4984.1																																																																																			.	C|1.000;A|0.000		0.413	FILIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041263.1	XM_029179	
GRID2IP	392862	hgsc.bcm.edu	37	7	6547714	6547714	+	Silent	SNP	G	G	T			TCGA-5C-A9VH-01A-11D-A36X-10	TCGA-5C-A9VH-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	44e358dc-cbf5-4177-89a4-3d0d0fe2ff38	b56ae97e-c498-4223-a583-2b86e313f4bb	g.chr7:6547714G>T	ENST00000457091.2	-	13	2445	c.2446C>A	c.(2446-2448)Cgg>Agg	p.R816R	GRID2IP_ENST00000435185.1_Silent_p.R632R|GRID2IP_ENST00000452113.1_Silent_p.R625R	NM_001145118.1	NP_001138590.1	A4D2P6	GRD2I_HUMAN	glutamate receptor, ionotropic, delta 2 (Grid2) interacting protein	816					long term synaptic depression (GO:0060292)	cell junction (GO:0030054)|postsynaptic membrane (GO:0045211)				endometrium(4)	4						CCCAGGCCCCGGGACAGCATG	0.697																																					p.R816R		Atlas-SNP	.											.	GRID2IP	82	.	0			c.C2446A						.						2.0	3.0	3.0					7																	6547714		602	1377	1979	SO:0001819	synonymous_variant	392862	exon13			GGCCCCGGGACAG		CCDS47537.1	7p22	2007-10-05	2006-03-01		ENSG00000215045	ENSG00000215045			18464	protein-coding gene	gene with protein product		610639	"""glutamate receptor, ionotropic, delta 2 (Grid2) interacting protein 1"""			14612983	Standard	NM_001145118		Approved		uc011jwx.2	A4D2P6	OTTHUMG00000155531	ENST00000457091.2:c.2446C>A	chr7.hg19:g.6547714G>T		39.0	0.0		27.0	8.0	NM_001145118		Silent	SNP	ENST00000457091.2	hg19	CCDS47537.1																																																																																			.	.		0.697	GRID2IP-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340534.1	XM_294249	
TNS3	64759	hgsc.bcm.edu	37	7	47408695	47408695	+	Missense_Mutation	SNP	G	G	T			TCGA-5C-A9VH-01A-11D-A36X-10	TCGA-5C-A9VH-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	44e358dc-cbf5-4177-89a4-3d0d0fe2ff38	b56ae97e-c498-4223-a583-2b86e313f4bb	g.chr7:47408695G>T	ENST00000398879.1	-	17	1914	c.1548C>A	c.(1546-1548)agC>agA	p.S516R	TNS3_ENST00000355730.3_Missense_Mutation_p.S276R|TNS3_ENST00000311160.9_Missense_Mutation_p.S516R			Q68CZ2	TENS3_HUMAN	tensin 3	516					cell migration (GO:0016477)|lung alveolus development (GO:0048286)|positive regulation of cell proliferation (GO:0008284)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)				NS(1)|autonomic_ganglia(1)|breast(17)|endometrium(5)|kidney(4)|large_intestine(7)|liver(1)|lung(16)|ovary(4)|prostate(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	64						GTGAGTTCTGGCTGCTCTTGT	0.632																																					p.S516R		Atlas-SNP	.											.	TNS3	140	.	0			c.C1548A						.						42.0	47.0	46.0					7																	47408695		2003	4154	6157	SO:0001583	missense	64759	exon17			GTTCTGGCTGCTC	AF378756	CCDS5506.2	7p12.3	2013-02-14	2005-05-13	2005-05-13	ENSG00000136205	ENSG00000136205		"""SH2 domain containing"""	21616	protein-coding gene	gene with protein product	"""tumor endothelial marker 6"""	606825	"""tensin-like SH2 domain-containing 1"""	TENS1		11559528	Standard	NM_022748		Approved	TEM6, H_NH0549I23.2, FLJ13732	uc003tnw.3	Q68CZ2	OTTHUMG00000074075	ENST00000398879.1:c.1548C>A	chr7.hg19:g.47408695G>T	ENSP00000381854:p.Ser516Arg	78.0	0.0		78.0	23.0	NM_022748	B2RNV1|Q6IPQ2|Q8IZW7|Q8NAD0|Q96PE0|Q96S48	Missense_Mutation	SNP	ENST00000398879.1	hg19	CCDS5506.2	.	.	.	.	.	.	.	.	.	.	G	18.09	3.546694	0.65198	.	.	ENSG00000136205	ENST00000311160;ENST00000538633;ENST00000398879;ENST00000355730;ENST00000457718	D;D;D;D	0.94723	-3.12;-3.12;-3.5;-3.28	5.59	2.35	0.29111	.	0.920814	0.09433	N	0.802805	D	0.96355	0.8811	M	0.69823	2.125	0.80722	D	1	D	0.76494	0.999	D	0.83275	0.996	D	0.92761	0.6224	10	0.87932	D	0	-30.3011	7.8351	0.29365	0.3634:0.0:0.6366:0.0	.	516	Q68CZ2	TENS3_HUMAN	R	516;626;516;276;619	ENSP00000312143:S516R;ENSP00000381854:S516R;ENSP00000347968:S276R;ENSP00000414358:S619R	ENSP00000312143:S516R	S	-	3	2	TNS3	47375220	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	1.359000	0.34113	0.709000	0.31976	0.655000	0.94253	AGC	.	.		0.632	TNS3-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157253.1	NM_022748	
KMT2C	58508	hgsc.bcm.edu	37	7	152132847	152132847	+	Missense_Mutation	SNP	C	C	T			TCGA-5C-A9VH-01A-11D-A36X-10	TCGA-5C-A9VH-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	44e358dc-cbf5-4177-89a4-3d0d0fe2ff38	b56ae97e-c498-4223-a583-2b86e313f4bb	g.chr7:152132847C>T	ENST00000262189.6	-	1	243	c.25G>A	c.(25-27)Gtg>Atg	p.V9M	KMT2C_ENST00000355193.2_Missense_Mutation_p.V9M|FABP5P3_ENST00000477993.1_RNA	NM_170606.2	NP_733751.2	Q8NEZ4	KMT2C_HUMAN	lysine (K)-specific methyltransferase 2C	9					histone H3-K4 methylation (GO:0051568)|intracellular signal transduction (GO:0035556)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)										GGCTGCTCCACGCTCTTGTCC	0.741																																					p.V9M		Atlas-SNP	.											.	MLL3	1564	.	0			c.G25A						.						4.0	5.0	5.0					7																	152132847		2031	4061	6092	SO:0001583	missense	58508	exon1			GCTCCACGCTCTT	AF264750	CCDS5931.1	7q36	2013-05-09	2013-05-09	2013-05-09	ENSG00000055609	ENSG00000055609		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	13726	protein-coding gene	gene with protein product		606833	"""myeloid/lymphoid or mixed-lineage leukemia 3"""	MLL3		10819331	Standard	XM_005250026		Approved	KIAA1506, HALR		Q8NEZ4	OTTHUMG00000150553	ENST00000262189.6:c.25G>A	chr7.hg19:g.152132847C>T	ENSP00000262189:p.Val9Met	141.0	0.0		137.0	42.0	NM_170606	Q8NC02|Q8NDF6|Q9H9P4|Q9NR13|Q9P222|Q9UDR7	Missense_Mutation	SNP	ENST00000262189.6	hg19	CCDS5931.1	.	.	.	.	.	.	.	.	.	.	c	12.38	1.919802	0.33908	.	.	ENSG00000055609	ENST00000262189;ENST00000355193;ENST00000452749	D;D	0.84730	-1.89;-1.89	2.07	2.07	0.26955	.	.	.	.	.	T	0.65217	0.2670	N	0.08118	0	0.80722	D	1	B	0.33073	0.396	B	0.17098	0.017	T	0.62831	-0.6771	9	0.62326	D	0.03	.	7.5514	0.27800	0.0:0.7307:0.2693:0.0	.	9	Q8NEZ4	MLL3_HUMAN	M	9	ENSP00000262189:V9M;ENSP00000347325:V9M	ENSP00000262189:V9M	V	-	1	0	MLL3	151763780	0.905000	0.30787	0.978000	0.43139	0.930000	0.56654	1.020000	0.30027	0.667000	0.31107	0.282000	0.19409	GTG	.	.		0.741	KMT2C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318887.3		
PINX1	54984	hgsc.bcm.edu	37	8	10690495	10690495	+	Splice_Site	SNP	C	C	T			TCGA-5C-A9VH-01A-11D-A36X-10	TCGA-5C-A9VH-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	44e358dc-cbf5-4177-89a4-3d0d0fe2ff38	b56ae97e-c498-4223-a583-2b86e313f4bb	g.chr8:10690495C>T	ENST00000314787.3	-	3	249		c.e3-1		SOX7_ENST00000554914.1_Splice_Site|SOX7_ENST00000553390.1_Splice_Site|PINX1_ENST00000519088.1_Splice_Site|PINX1_ENST00000426190.2_Splice_Site|PINX1_ENST00000520018.2_Splice_Site	NM_017884.4	NP_060354.4	Q96BK5	PINX1_HUMAN	PIN2/TERF1 interacting, telomerase inhibitor 1						mitotic metaphase plate congression (GO:0007080)|negative regulation of cell proliferation (GO:0008285)|negative regulation of telomerase activity (GO:0051974)|regulation of telomerase activity (GO:0051972)|telomere maintenance via telomerase (GO:0007004)	chromosome, telomeric region (GO:0000781)|kinetochore (GO:0000776)|nuclear chromosome (GO:0000228)|nucleolus (GO:0005730)|spindle (GO:0005819)	telomerase inhibitor activity (GO:0010521)|telomeric RNA binding (GO:0070034)			kidney(2)|large_intestine(4)|lung(8)|ovary(1)|skin(2)	17				Kidney(29;0.0595)|COAD - Colon adenocarcinoma(149;0.105)|KIRC - Kidney renal clear cell carcinoma(542;0.201)		CCCCTAAACCCTGTGGAGATT	0.453																																					.		Atlas-SNP	.											.	PINX1	38	.	0			c.130-1G>A						.						88.0	78.0	81.0					8																	10690495		1886	4112	5998	SO:0001630	splice_region_variant	54984	exon4			TAAACCCTGTGGA	AF418553	CCDS47801.1, CCDS64825.1	8p23	2013-01-28				ENSG00000254093		"""G patch domain containing"""	30046	protein-coding gene	gene with protein product	"""PIN2 interacting protein 1"", ""liver-related putative tumor suppressor"""	606505				11003615, 11701125	Standard	NM_001284356		Approved	PinX1, LPTL, LPTS, FLJ20565, MGC8850		Q96BK5		ENST00000314787.3:c.130-1G>A	chr8.hg19:g.10690495C>T		76.0	0.0		29.0	13.0	NM_017884	B2R9B1|Q548A5|Q6QWG9|Q7Z7J8|Q96QD7|Q9HBU7|Q9NWW2	Splice_Site	SNP	ENST00000314787.3	hg19	CCDS47801.1	.	.	.	.	.	.	.	.	.	.	C	18.02	3.529315	0.64860	.	.	ENSG00000171056;ENSG00000258724;ENSG00000254093;ENSG00000254093;ENSG00000254093;ENSG00000254093	ENST00000553390;ENST00000554914;ENST00000314787;ENST00000426190;ENST00000519088;ENST00000524114	.	.	.	4.99	4.99	0.66335	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.8069	0.78520	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	SOX7;CTD-2135J3.4;PINX1	10727905	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.661000	0.74422	2.585000	0.87301	0.655000	0.94253	.	.	.		0.453	PINX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375683.1	NM_017884	Intron
MCM4	4173	hgsc.bcm.edu	37	8	48883923	48883923	+	Missense_Mutation	SNP	A	A	T			TCGA-5C-A9VH-01A-11D-A36X-10	TCGA-5C-A9VH-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	44e358dc-cbf5-4177-89a4-3d0d0fe2ff38	b56ae97e-c498-4223-a583-2b86e313f4bb	g.chr8:48883923A>T	ENST00000262105.2	+	12	2032	c.1823A>T	c.(1822-1824)aAt>aTt	p.N608I	MCM4_ENST00000523944.1_Missense_Mutation_p.N608I	NM_005914.3	NP_005905.2	P33991	MCM4_HUMAN	minichromosome maintenance complex component 4	608	MCM.				DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA strand elongation involved in DNA replication (GO:0006271)|DNA unwinding involved in DNA replication (GO:0006268)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)	MCM complex (GO:0042555)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA helicase activity (GO:0003678)|single-stranded DNA binding (GO:0003697)			biliary_tract(1)|breast(1)|endometrium(7)|kidney(4)|large_intestine(5)|lung(16)|ovary(2)|prostate(3)|skin(3)|urinary_tract(2)	44		all_cancers(86;0.026)|all_epithelial(80;0.000748)|Lung NSC(129;0.00327)|all_lung(136;0.00354)				TGTCAGCTCAATGCGCGCACC	0.498																																					p.N608I		Atlas-SNP	.											.	MCM4	97	.	0			c.A1823T						.						98.0	92.0	94.0					8																	48883923		2203	4300	6503	SO:0001583	missense	4173	exon13			AGCTCAATGCGCG		CCDS6143.1	8q12-q13	2008-02-05	2007-04-04		ENSG00000104738	ENSG00000104738			6947	protein-coding gene	gene with protein product		602638	"""MCM4 minichromosome maintenance deficient 4 (S. cerevisiae)"""	CDC21		7601140	Standard	NM_005914		Approved	CDC54, hCdc21, P1-Cdc21, MGC33310	uc003xql.2	P33991	OTTHUMG00000164205	ENST00000262105.2:c.1823A>T	chr8.hg19:g.48883923A>T	ENSP00000262105:p.Asn608Ile	86.0	0.0		152.0	31.0	NM_182746	Q8NEH1|Q99658	Missense_Mutation	SNP	ENST00000262105.2	hg19	CCDS6143.1	.	.	.	.	.	.	.	.	.	.	A	21.5	4.156830	0.78114	.	.	ENSG00000104738	ENST00000523944;ENST00000262105;ENST00000396826;ENST00000429229	T;T	0.08634	3.07;3.07	6.17	5.02	0.67125	ATPase, AAA+ type, core (1);	0.123647	0.85682	D	0.000000	T	0.46870	0.1415	H	0.99182	4.46	0.80722	D	1	D;D	0.71674	0.998;0.998	D;D	0.76071	0.987;0.987	T	0.67102	-0.5755	10	0.87932	D	0	-36.8898	12.3678	0.55238	0.9348:0.0:0.0652:0.0	.	608;608	B3KMX0;P33991	.;MCM4_HUMAN	I	608;608;595;568	ENSP00000430194:N608I;ENSP00000262105:N608I	ENSP00000262105:N608I	N	+	2	0	MCM4	49046476	1.000000	0.71417	0.994000	0.49952	0.589000	0.36550	9.300000	0.96151	1.159000	0.42565	0.533000	0.62120	AAT	.	.		0.498	MCM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377791.1	NM_005914	
JRK	8629	hgsc.bcm.edu	37	8	143747230	143747230	+	RNA	SNP	G	G	A			TCGA-5C-A9VH-01A-11D-A36X-10	TCGA-5C-A9VH-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	44e358dc-cbf5-4177-89a4-3d0d0fe2ff38	b56ae97e-c498-4223-a583-2b86e313f4bb	g.chr8:143747230G>A	ENST00000507178.2	-	0	580							O75564	JERKY_HUMAN	Jrk homolog (mouse)							nucleus (GO:0005634)	DNA binding (GO:0003677)					all_cancers(97;3.96e-12)|all_epithelial(106;1.19e-08)|Lung NSC(106;0.000413)|all_lung(105;0.00106)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)	Acute lymphoblastic leukemia(644;2.31e-05)				cagcttgggcgtgtgcagcgt	0.672																																					p.T83M		Atlas-SNP	.											.	.	.	.	0			c.C248T						.						29.0	36.0	34.0					8																	143747230		2130	4241	6371			8629	exon2			TTGGGCGTGTGCA	AF072467	CCDS75796.1, CCDS75797.1	8q24.3	2014-03-28	2014-03-28			ENSG00000234616			6199	protein-coding gene	gene with protein product		603210	"""jerky (mouse) homolog"", ""jerky homolog (mouse)"""			9675132	Standard	NM_003724		Approved	JH8, jerky	uc003ywo.3	O75564			chr8.hg19:g.143747230G>A		62.0	0.0		112.0	23.0	NM_003724	O75565	Missense_Mutation	SNP	ENST00000507178.2	hg19																																																																																				.	.		0.672	JRK-003	KNOWN	basic	processed_transcript	processed_transcript	OTTHUMT00000362914.1	NM_003724	
TIGD5	84948	hgsc.bcm.edu	37	8	144681433	144681433	+	Missense_Mutation	SNP	C	C	A			TCGA-5C-A9VH-01A-11D-A36X-10	TCGA-5C-A9VH-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	44e358dc-cbf5-4177-89a4-3d0d0fe2ff38	b56ae97e-c498-4223-a583-2b86e313f4bb	g.chr8:144681433C>A	ENST00000504548.2	+	1	1360	c.1360C>A	c.(1360-1362)Ctc>Atc	p.L454I	EEF1D_ENST00000531770.1_5'Flank|EEF1D_ENST00000531621.1_5'Flank|RP11-661A12.14_ENST00000606452.1_lincRNA|EEF1D_ENST00000524624.1_5'Flank|TIGD5_ENST00000321385.3_Missense_Mutation_p.L405I|EEF1D_ENST00000423316.2_5'Flank|EEF1D_ENST00000317198.6_5'Flank|EEF1D_ENST00000419152.2_5'Flank|EEF1D_ENST00000529272.1_5'Flank|EEF1D_ENST00000395119.3_5'Flank|EEF1D_ENST00000532400.1_5'Flank|EEF1D_ENST00000442189.2_5'Flank|EEF1D_ENST00000528610.1_5'Flank|EEF1D_ENST00000526838.1_5'Flank	NM_032862.4	NP_116251.4	Q53EQ6	TIGD5_HUMAN	tigger transposable element derived 5	454	DDE 2.					nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(1)|lung(3)|ovary(1)|soft_tissue(1)|urinary_tract(1)	7	all_cancers(97;3.74e-11)|all_epithelial(106;2.62e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		Colorectal(110;0.134)|BRCA - Breast invasive adenocarcinoma(115;0.239)			CAGCTTCATGCTCAAGGACAT	0.667																																					p.L454I		Atlas-SNP	.											.	TIGD5	22	.	0			c.C1360A						.						23.0	24.0	23.0					8																	144681433		2189	4290	6479	SO:0001583	missense	84948	exon1			TTCATGCTCAAGG	AK027832	CCDS6406.1, CCDS6406.2	8q24.3	2008-02-01				ENSG00000179886			18336	protein-coding gene	gene with protein product							Standard	NM_032862		Approved	FLJ14926	uc003yyx.2	Q53EQ6		ENST00000504548.2:c.1360C>A	chr8.hg19:g.144681433C>A	ENSP00000421489:p.Leu454Ile	98.0	0.0		174.0	37.0	NM_032862	E7EWS2|Q6NT83|Q8N5A1|Q96JW8	Missense_Mutation	SNP	ENST00000504548.2	hg19	CCDS6406.2	.	.	.	.	.	.	.	.	.	.	C	20.6	4.025090	0.75390	.	.	ENSG00000179886	ENST00000504548;ENST00000321385	T;T	0.46451	0.87;0.87	4.3	4.3	0.51218	.	0.000000	0.50627	U	0.000114	T	0.49609	0.1567	L	0.32530	0.975	0.27089	N	0.962908	D	0.71674	0.998	D	0.70227	0.968	T	0.42999	-0.9418	10	0.14252	T	0.57	.	15.7834	0.78281	0.0:1.0:0.0:0.0	.	405	Q53EQ6	TIGD5_HUMAN	I	454;405	ENSP00000421489:L454I;ENSP00000315906:L405I	ENSP00000315906:L405I	L	+	1	0	TIGD5	144752576	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.953000	0.49105	1.926000	0.55796	0.655000	0.94253	CTC	.	.		0.667	TIGD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368269.1	NM_032862	
IFNB1	3456	hgsc.bcm.edu	37	9	21077442	21077442	+	Missense_Mutation	SNP	G	G	T			TCGA-5C-A9VH-01A-11D-A36X-10	TCGA-5C-A9VH-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	44e358dc-cbf5-4177-89a4-3d0d0fe2ff38	b56ae97e-c498-4223-a583-2b86e313f4bb	g.chr9:21077442G>T	ENST00000380232.2	-	1	501	c.427C>A	c.(427-429)Ctg>Atg	p.L143M		NM_002176.2	NP_002167.1	P01574	IFNB_HUMAN	interferon, beta 1, fibroblast	143					adaptive immune response (GO:0002250)|B cell activation involved in immune response (GO:0002312)|B cell differentiation (GO:0030183)|B cell proliferation (GO:0042100)|blood coagulation (GO:0007596)|cell surface receptor signaling pathway (GO:0007166)|cellular response to exogenous dsRNA (GO:0071360)|cellular response to interferon-beta (GO:0035458)|cytokine-mediated signaling pathway (GO:0019221)|defense response to bacterium (GO:0042742)|defense response to virus (GO:0051607)|humoral immune response (GO:0006959)|innate immune response (GO:0045087)|natural killer cell activation (GO:0030101)|natural killer cell activation involved in immune response (GO:0002323)|negative regulation of T cell differentiation (GO:0045581)|negative regulation of T-helper 2 cell cytokine production (GO:2000552)|negative regulation of viral genome replication (GO:0045071)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of innate immune response (GO:0045089)|positive regulation of peptidyl-serine phosphorylation of STAT protein (GO:0033141)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of MHC class I biosynthetic process (GO:0045343)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|response to exogenous dsRNA (GO:0043330)|response to virus (GO:0009615)|T cell activation involved in immune response (GO:0002286)|type I interferon signaling pathway (GO:0060337)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	cytokine activity (GO:0005125)|type I interferon receptor binding (GO:0005132)			breast(3)|kidney(1)|large_intestine(1)|lung(6)|ovary(1)	12				GBM - Glioblastoma multiforme(5;7.45e-142)|Lung(24;2.42e-17)|LUSC - Lung squamous cell carcinoma(38;7.17e-11)		TATCTTTTCAGGTGCAGACTG	0.433																																					p.L143M		Atlas-SNP	.											.	IFNB1	33	.	0			c.C427A						.						180.0	183.0	182.0					9																	21077442		2203	4300	6503	SO:0001583	missense	3456	exon1			TTTTCAGGTGCAG		CCDS6495.1	9p22	2008-07-21			ENSG00000171855	ENSG00000171855		"""Interferons"""	5434	protein-coding gene	gene with protein product		147640		IFNB			Standard	NM_002176		Approved	IFB, IFF	uc003zok.3	P01574	OTTHUMG00000019652	ENST00000380232.2:c.427C>A	chr9.hg19:g.21077442G>T	ENSP00000369581:p.Leu143Met	159.0	0.0		71.0	41.0	NM_002176	Q5VWC9	Missense_Mutation	SNP	ENST00000380232.2	hg19	CCDS6495.1	.	.	.	.	.	.	.	.	.	.	G	13.80	2.346573	0.41599	.	.	ENSG00000171855	ENST00000380232	T	0.27104	1.69	5.42	2.54	0.30619	Four-helical cytokine-like, core (1);Four-helical cytokine, core (1);	0.195950	0.34484	N	0.003925	T	0.44993	0.1320	M	0.79123	2.44	0.09310	N	1	D	0.89917	1.0	D	0.87578	0.998	T	0.23547	-1.0185	10	0.52906	T	0.07	-10.0403	5.3225	0.15889	0.1767:0.3212:0.5021:0.0	.	143	P01574	IFNB_HUMAN	M	143	ENSP00000369581:L143M	ENSP00000369581:L143M	L	-	1	2	IFNB1	21067442	0.617000	0.27043	0.011000	0.14972	0.019000	0.09904	0.791000	0.26915	0.386000	0.24997	0.650000	0.86243	CTG	.	.		0.433	IFNB1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051881.1	NM_002176	
GPR144	347088	hgsc.bcm.edu	37	9	127218951	127218951	+	Silent	SNP	C	C	G			TCGA-5C-A9VH-01A-11D-A36X-10	TCGA-5C-A9VH-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	44e358dc-cbf5-4177-89a4-3d0d0fe2ff38	b56ae97e-c498-4223-a583-2b86e313f4bb	g.chr9:127218951C>G	ENST00000334810.1	+	8	1500	c.1500C>G	c.(1498-1500)ccC>ccG	p.P500P				Q7Z7M1	GP144_HUMAN	G protein-coupled receptor 144	500					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			central_nervous_system(1)|endometrium(3)	4						GCCTGGCACCCCTGCTGAGCA	0.652																																					p.P500P		Atlas-SNP	.											.	GPR144	33	.	0			c.C1500G						.						66.0	74.0	72.0					9																	127218951		692	1591	2283	SO:0001819	synonymous_variant	347088	exon8			GGCACCCCTGCTG	AY278562		9q34.11	2014-08-08			ENSG00000180264	ENSG00000180264		"""-"", ""GPCR / Class B : Orphans"""	18651	protein-coding gene	gene with protein product							Standard	XM_006710216		Approved	PGR24	uc010mwn.3	Q7Z7M1	OTTHUMG00000020652	ENST00000334810.1:c.1500C>G	chr9.hg19:g.127218951C>G		56.0	0.0		17.0	10.0	NM_001161808	Q86SL4|Q8NH12	Silent	SNP	ENST00000334810.1	hg19	CCDS48016.1																																																																																			.	.		0.652	GPR144-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054026.2	NM_182611	
ST8SIA6	338596	hgsc.bcm.edu	37	10	17363172	17363172	+	Missense_Mutation	SNP	G	G	A			TCGA-5C-A9VH-01A-11D-A36X-10	TCGA-5C-A9VH-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	44e358dc-cbf5-4177-89a4-3d0d0fe2ff38	b56ae97e-c498-4223-a583-2b86e313f4bb	g.chr10:17363172G>A	ENST00000377602.4	-	8	976	c.902C>T	c.(901-903)cCc>cTc	p.P301L		NM_001004470.1	NP_001004470.1	P61647	SIA8F_HUMAN	ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 6	301					carbohydrate biosynthetic process (GO:0016051)|cellular protein metabolic process (GO:0044267)|ganglioside biosynthetic process (GO:0001574)|glycolipid biosynthetic process (GO:0009247)|glycoprotein metabolic process (GO:0009100)|oligosaccharide metabolic process (GO:0009311)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|protein O-linked glycosylation (GO:0006493)|sialylation (GO:0097503)	Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)	sialyltransferase activity (GO:0008373)			endometrium(3)|kidney(3)|large_intestine(4)|liver(1)|lung(24)|ovary(1)|skin(1)	37						CAGGTACTTGGGATGGAAAAA	0.468																																					p.P301L		Atlas-SNP	.											.	ST8SIA6	85	.	0			c.C902T						.						185.0	188.0	187.0					10																	17363172		2203	4300	6503	SO:0001583	missense	338596	exon8			TACTTGGGATGGA		CCDS31158.1	10p13	2013-03-01	2005-02-07	2005-02-07	ENSG00000148488	ENSG00000148488		"""Sialyltransferases"""	23317	protein-coding gene	gene with protein product	"""ST8Sia VI"""	610139	"""sialyltransferase 8F (alpha-2, 8-sialyltransferase)"""	SIAT8F		11980897	Standard	XR_242697		Approved		uc001ipd.3	P61647	OTTHUMG00000017748	ENST00000377602.4:c.902C>T	chr10.hg19:g.17363172G>A	ENSP00000366827:p.Pro301Leu	195.0	0.0		128.0	54.0	NM_001004470	B0YJ97|B9EH72|Q5VZH4	Missense_Mutation	SNP	ENST00000377602.4	hg19	CCDS31158.1	.	.	.	.	.	.	.	.	.	.	G	32	5.130943	0.94473	.	.	ENSG00000148488	ENST00000377602	T	0.59906	0.23	5.18	5.18	0.71444	.	0.000000	0.85682	D	0.000000	T	0.76652	0.4017	M	0.76433	2.335	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.75147	-0.3420	10	0.42905	T	0.14	-17.476	19.2559	0.93945	0.0:0.0:1.0:0.0	.	301	P61647	SIA8F_HUMAN	L	301	ENSP00000366827:P301L	ENSP00000366827:P301L	P	-	2	0	ST8SIA6	17403178	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.601000	0.98297	2.861000	0.98227	0.650000	0.86243	CCC	.	.		0.468	ST8SIA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047036.1	NM_001004470	
PRKG1	5592	hgsc.bcm.edu	37	10	54042015	54042015	+	Missense_Mutation	SNP	C	C	T			TCGA-5C-A9VH-01A-11D-A36X-10	TCGA-5C-A9VH-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	44e358dc-cbf5-4177-89a4-3d0d0fe2ff38	b56ae97e-c498-4223-a583-2b86e313f4bb	g.chr10:54042015C>T	ENST00000401604.2	+	14	1797	c.1603C>T	c.(1603-1605)Cat>Tat	p.H535Y	PRKG1_ENST00000373985.1_Missense_Mutation_p.H523Y|PRKG1_ENST00000373980.4_Missense_Mutation_p.H550Y|PRKG1-AS1_ENST00000426785.2_RNA|PRKG1_ENST00000373975.2_Missense_Mutation_p.H253Y|PRKG1-AS1_ENST00000452247.2_RNA			Q13976	KGP1_HUMAN	protein kinase, cGMP-dependent, type I	535	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				actin cytoskeleton organization (GO:0030036)|blood coagulation (GO:0007596)|cGMP-mediated signaling (GO:0019934)|dendrite development (GO:0016358)|forebrain development (GO:0030900)|negative regulation of platelet aggregation (GO:0090331)|neuron migration (GO:0001764)|protein phosphorylation (GO:0006468)|regulation of GTPase activity (GO:0043087)|relaxation of vascular smooth muscle (GO:0060087)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium channel regulator activity (GO:0005246)|cGMP binding (GO:0030553)|cGMP-dependent protein kinase activity (GO:0004692)	p.H550Y(1)		autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(23)|ovary(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	53		all_cancers(4;2.13e-08)|all_epithelial(4;2.44e-08)|all_lung(4;0.000173)		all cancers(4;1.18e-05)|GBM - Glioblastoma multiforme(4;0.000359)|Epithelial(53;0.00532)|Lung(62;0.0606)		GAACAAAGGCCATGACATTTC	0.423																																					p.H550Y		Atlas-SNP	.											PRKG1,ear,carcinoma,0,1	PRKG1	167	.	1	Substitution - Missense(1)	skin(1)	c.C1648T						.						112.0	103.0	106.0					10																	54042015		2203	4300	6503	SO:0001583	missense	5592	exon14			AAAGGCCATGACA		CCDS7244.1	10q11.2	2009-07-10			ENSG00000185532	ENSG00000185532	2.7.11.1		9414	protein-coding gene	gene with protein product		176894		PRKGR1B, PRKG1B		2792381, 1544322	Standard	NM_001098512		Approved	PGK, PKG	uc001jjo.3	Q13976	OTTHUMG00000018248	ENST00000401604.2:c.1603C>T	chr10.hg19:g.54042015C>T	ENSP00000384200:p.His535Tyr	164.0	0.0		109.0	41.0	NM_006258	A5YM56|B3KSF3|E2PU10|P14619|Q5JP05|Q5JSJ6|Q6P5T7	Missense_Mutation	SNP	ENST00000401604.2	hg19	CCDS44399.1	.	.	.	.	.	.	.	.	.	.	C	28.2	4.897084	0.91962	.	.	ENSG00000185532	ENST00000401604;ENST00000373985;ENST00000373980;ENST00000332193;ENST00000373975	T;T;T	0.04603	3.59;3.59;3.59	5.49	5.49	0.81192	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.07098	0.0180	N	0.01515	-0.825	0.80722	D	1	D;D;D	0.89917	0.993;1.0;1.0	D;D;D	0.97110	0.979;1.0;1.0	T	0.65594	-0.6130	10	0.32370	T	0.25	-18.3413	19.3218	0.94245	0.0:1.0:0.0:0.0	.	253;550;535	B3KSF3;Q13976-2;Q13976	.;.;KGP1_HUMAN	Y	535;523;550;253;147	ENSP00000384200:H535Y;ENSP00000363097:H523Y;ENSP00000363092:H550Y	ENSP00000327642:H253Y	H	+	1	0	PRKG1	53712021	1.000000	0.71417	0.987000	0.45799	0.998000	0.95712	7.770000	0.85390	2.727000	0.93392	0.563000	0.77884	CAT	.	.		0.423	PRKG1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			
DDIT4	54541	hgsc.bcm.edu	37	10	74034129	74034129	+	Missense_Mutation	SNP	C	C	G			TCGA-5C-A9VH-01A-11D-A36X-10	TCGA-5C-A9VH-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	44e358dc-cbf5-4177-89a4-3d0d0fe2ff38	b56ae97e-c498-4223-a583-2b86e313f4bb	g.chr10:74034129C>G	ENST00000307365.3	+	2	356	c.155C>G	c.(154-156)tCg>tGg	p.S52W	RP11-442H21.2_ENST00000491934.2_RNA	NM_019058.2	NP_061931.1	Q9NX09	DDIT4_HUMAN	DNA-damage-inducible transcript 4	52					brain development (GO:0007420)|cell proliferation (GO:0008283)|defense response to virus (GO:0051607)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|negative regulation of glycolytic process (GO:0045820)|negative regulation of intracellular signal transduction (GO:1902532)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|negative regulation of peptidyl-threonine phosphorylation (GO:0010801)|negative regulation of TOR signaling (GO:0032007)|neuron differentiation (GO:0030182)|neuron migration (GO:0001764)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of neuron death (GO:1901216)|protein complex disassembly (GO:0043241)|reactive oxygen species metabolic process (GO:0072593)|response to hypoxia (GO:0001666)	cytoplasm (GO:0005737)|intracellular (GO:0005622)|mitochondrion (GO:0005739)				cervix(1)|endometrium(2)|lung(5)|pancreas(1)|prostate(2)|urinary_tract(1)	12						CTGGAGAGCTCGGACTGCGAG	0.721																																					p.S52W		Atlas-SNP	.											.	DDIT4	14	.	0			c.C155G						.						29.0	31.0	31.0					10																	74034129		2203	4298	6501	SO:0001583	missense	54541	exon2			AGAGCTCGGACTG	AK000507	CCDS7315.1	10q22.1	2008-05-14			ENSG00000168209	ENSG00000168209			24944	protein-coding gene	gene with protein product	"""HIF-1 responsive RTP801"""	607729				11884613	Standard	NM_019058		Approved	RTP801, FLJ20500, REDD-1, REDD1, Dig2	uc001jsx.1	Q9NX09	OTTHUMG00000018435	ENST00000307365.3:c.155C>G	chr10.hg19:g.74034129C>G	ENSP00000307305:p.Ser52Trp	40.0	0.0		45.0	20.0	NM_019058	Q9H0S3	Missense_Mutation	SNP	ENST00000307365.3	hg19	CCDS7315.1	.	.	.	.	.	.	.	.	.	.	C	25.8	4.670725	0.88348	.	.	ENSG00000168209	ENST00000307365	T	0.51817	0.69	5.33	5.33	0.75918	.	0.415784	0.26788	N	0.022486	T	0.58836	0.2150	L	0.27053	0.805	0.80722	D	1	D	0.76494	0.999	D	0.80764	0.994	T	0.62914	-0.6753	10	0.87932	D	0	-13.0136	19.0232	0.92922	0.0:1.0:0.0:0.0	.	52	Q9NX09	DDIT4_HUMAN	W	52	ENSP00000307305:S52W	ENSP00000307305:S52W	S	+	2	0	DDIT4	73704135	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	3.230000	0.51286	2.652000	0.90054	0.655000	0.94253	TCG	.	.		0.721	DDIT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048577.1	NM_019058	
SH3PXD2A	9644	hgsc.bcm.edu	37	10	105361743	105361743	+	Missense_Mutation	SNP	C	C	T	rs561681082		TCGA-5C-A9VH-01A-11D-A36X-10	TCGA-5C-A9VH-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	44e358dc-cbf5-4177-89a4-3d0d0fe2ff38	b56ae97e-c498-4223-a583-2b86e313f4bb	g.chr10:105361743C>T	ENST00000369774.4	-	15	3508	c.3232G>A	c.(3232-3234)Gtc>Atc	p.V1078I	SH3PXD2A_ENST00000315994.6_5'UTR|SH3PXD2A_ENST00000538130.1_Missense_Mutation_p.V913I|SH3PXD2A_ENST00000540321.1_Missense_Mutation_p.V945I|SH3PXD2A_ENST00000427662.2_Intron|SH3PXD2A_ENST00000355946.2_Missense_Mutation_p.V1050I			Q5TCZ1	SPD2A_HUMAN	SH3 and PX domains 2A	1078	SH3 5. {ECO:0000255|PROSITE- ProRule:PRU00192}.				superoxide metabolic process (GO:0006801)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|podosome (GO:0002102)	phosphatidylinositol binding (GO:0035091)			breast(1)|central_nervous_system(1)|endometrium(6)|kidney(1)|large_intestine(8)|lung(18)|ovary(1)|skin(1)|urinary_tract(1)	38		Colorectal(252;0.0815)|Breast(234;0.131)		Epithelial(162;4.09e-10)|all cancers(201;2.73e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0119)		GCGATAGAGACGTACACATCT	0.577													C|||	1	0.000199681	0.0	0.0	5008	,	,		17603	0.001		0.0	False		,,,				2504	0.0				p.V1050I		Atlas-SNP	.											.	SH3PXD2A	90	.	0			c.G3148A						.						129.0	131.0	130.0					10																	105361743		2203	4300	6503	SO:0001583	missense	9644	exon14			TAGAGACGTACAC	AB007878	CCDS31278.1	10q25.1	2006-02-13	2006-02-13	2006-02-13	ENSG00000107957	ENSG00000107957			23664	protein-coding gene	gene with protein product	"""five SH3 domains"""		"""SH3 multiple domains 1"""	SH3MD1		9687503	Standard	XM_005270297		Approved	FISH, KIAA0418	uc001kxj.1	Q5TCZ1	OTTHUMG00000018997	ENST00000369774.4:c.3232G>A	chr10.hg19:g.105361743C>T	ENSP00000358789:p.Val1078Ile	74.0	0.0		70.0	29.0	NM_014631	D3DR98|O43302|Q5TCZ2|Q5TDQ8	Missense_Mutation	SNP	ENST00000369774.4	hg19		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	5.558|5.558	0.287830|0.287830	0.10513|0.10513	.|.	.|.	ENSG00000107957|ENSG00000107957	ENST00000420222|ENST00000369774;ENST00000355946;ENST00000315994;ENST00000536035;ENST00000540321;ENST00000538130	.|T;T;T;T	.|0.31510	.|1.49;1.49;1.49;1.49	5.39|5.39	2.25|2.25	0.28309|0.28309	.|Src homology-3 domain (2);	.|0.251698	.|0.39759	.|N	.|0.001277	T|T	0.23611|0.23611	0.0571|0.0571	L|L	0.52206|0.52206	1.635|1.635	0.38176|0.38176	D|D	0.939463|0.939463	.|B;B;B;B	.|0.18013	.|0.003;0.015;0.019;0.025	.|B;B;B;B	.|0.14578	.|0.003;0.005;0.007;0.011	T|T	0.10730|0.10730	-1.0617|-1.0617	5|10	.|0.18710	.|T	.|0.47	-21.6886|-21.6886	8.487|8.487	0.33078|0.33078	0.0:0.6687:0.0:0.3313|0.0:0.6687:0.0:0.3313	.|.	.|1078;927;923;1050	.|Q5TCZ1;B7Z9L8;B7Z3B0;Q5TCZ1-3	.|SPD2A_HUMAN;.;.;.	H|I	1004|1078;1050;885;910;945;913	.|ENSP00000358789:V1078I;ENSP00000348215:V1050I;ENSP00000443663:V945I;ENSP00000441514:V913I	.|ENSP00000318135:V885I	R|V	-|-	2|1	0|0	SH3PXD2A|SH3PXD2A	105351733|105351733	0.051000|0.051000	0.20477|0.20477	0.118000|0.118000	0.21660|0.21660	0.135000|0.135000	0.20990|0.20990	0.296000|0.296000	0.19083|0.19083	0.156000|0.156000	0.19299|0.19299	-0.367000|-0.367000	0.07326|0.07326	CGT|GTC	.	.		0.577	SH3PXD2A-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000050178.1	NM_014631	
CFAP58	159686	hgsc.bcm.edu	37	10	106163548	106163548	+	Missense_Mutation	SNP	G	G	A			TCGA-5C-A9VH-01A-11D-A36X-10	TCGA-5C-A9VH-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	44e358dc-cbf5-4177-89a4-3d0d0fe2ff38	b56ae97e-c498-4223-a583-2b86e313f4bb	g.chr10:106163548G>A	ENST00000369704.3	+	14	2235	c.2101G>A	c.(2101-2103)Gag>Aag	p.E701K		NM_001008723.1	NP_001008723.1	Q5T655	CC147_HUMAN		701						extracellular space (GO:0005615)				NS(1)|breast(1)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(16)|ovary(3)|pancreas(1)|prostate(3)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(2)	52		Colorectal(252;0.103)|Breast(234;0.122)		Epithelial(162;7.55e-10)|all cancers(201;3.37e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0189)		CCGAGCCCTGGAGGAGGAGCT	0.488																																					p.E701K		Atlas-SNP	.											.	CCDC147	137	.	0			c.G2101A						.						64.0	65.0	65.0					10																	106163548		2203	4300	6503	SO:0001583	missense	159686	exon14			GCCCTGGAGGAGG																												ENST00000369704.3:c.2101G>A	chr10.hg19:g.106163548G>A	ENSP00000358718:p.Glu701Lys	88.0	0.0		78.0	35.0	NM_001008723	D3DRA6|Q8NA27	Missense_Mutation	SNP	ENST00000369704.3	hg19	CCDS31282.1	.	.	.	.	.	.	.	.	.	.	G	24.1	4.495854	0.85069	.	.	ENSG00000120051	ENST00000369704	T	0.51071	0.72	5.5	5.5	0.81552	.	0.104953	0.64402	D	0.000006	T	0.63546	0.2520	M	0.79475	2.455	0.80722	D	1	P	0.49961	0.93	P	0.56042	0.79	T	0.58370	-0.7648	10	0.15952	T	0.53	-27.5186	17.9465	0.89040	0.0:0.0:1.0:0.0	.	701	Q5T655	CC147_HUMAN	K	701	ENSP00000358718:E701K	ENSP00000358718:E701K	E	+	1	0	CCDC147	106153538	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.212000	0.65225	2.735000	0.93741	0.655000	0.94253	GAG	.	.		0.488	CCDC147-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050216.1		
MRGPRX4	117196	hgsc.bcm.edu	37	11	18195075	18195075	+	Missense_Mutation	SNP	G	G	C			TCGA-5C-A9VH-01A-11D-A36X-10	TCGA-5C-A9VH-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	44e358dc-cbf5-4177-89a4-3d0d0fe2ff38	b56ae97e-c498-4223-a583-2b86e313f4bb	g.chr11:18195075G>C	ENST00000314254.3	+	1	692	c.272G>C	c.(271-273)aGc>aCc	p.S91T	RP11-113D6.6_ENST00000527671.1_Intron	NM_054032.3	NP_473373.2	Q96LA9	MRGX4_HUMAN	MAS-related GPR, member X4	91						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(18)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	32						ATCAATATCAGCCATCTCATC	0.512																																					p.S91T		Atlas-SNP	.											.	MRGPRX4	68	.	0			c.G272C						.						124.0	96.0	106.0					11																	18195075		2199	4293	6492	SO:0001583	missense	117196	exon1			ATATCAGCCATCT	AY042216	CCDS7831.1	11p15.1	2013-10-10			ENSG00000179817	ENSG00000179817		"""GPCR / Class A : Orphans"""	17617	protein-coding gene	gene with protein product		607230				11551509	Standard	NM_054032		Approved	MRGX4	uc001mnv.1	Q96LA9	OTTHUMG00000166442	ENST00000314254.3:c.272G>C	chr11.hg19:g.18195075G>C	ENSP00000314042:p.Ser91Thr	105.0	0.0		90.0	27.0	NM_054032	Q3KNU3|Q3KNU4|Q502W0|Q8TDD6|Q8TDD7	Missense_Mutation	SNP	ENST00000314254.3	hg19	CCDS7831.1	.	.	.	.	.	.	.	.	.	.	G	0.093	-1.164358	0.01673	.	.	ENSG00000179817	ENST00000314254	T	0.42131	0.98	2.7	-1.99	0.07457	GPCR, rhodopsin-like superfamily (1);	3.243040	0.00654	N	0.000579	T	0.29817	0.0745	L	0.41824	1.3	0.09310	N	1	B	0.06786	0.001	B	0.10450	0.005	T	0.03287	-1.1052	10	0.21540	T	0.41	.	1.2322	0.01946	0.1774:0.1204:0.3655:0.3368	.	91	Q96LA9	MRGX4_HUMAN	T	91	ENSP00000314042:S91T	ENSP00000314042:S91T	S	+	2	0	MRGPRX4	18151651	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.490000	0.02304	-0.576000	0.05974	-3.271000	0.00048	AGC	.	.		0.512	MRGPRX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389788.1	NM_054032	
ARFGAP2	84364	hgsc.bcm.edu	37	11	47193261	47193261	+	Missense_Mutation	SNP	G	G	A	rs138040761	byFrequency	TCGA-5C-A9VH-01A-11D-A36X-10	TCGA-5C-A9VH-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	44e358dc-cbf5-4177-89a4-3d0d0fe2ff38	b56ae97e-c498-4223-a583-2b86e313f4bb	g.chr11:47193261G>A	ENST00000524782.1	-	9	991	c.763C>T	c.(763-765)Cgt>Tgt	p.R255C	ARFGAP2_ENST00000319543.6_5'UTR|RP11-390K5.6_ENST00000524412.1_RNA|ARFGAP2_ENST00000395449.3_5'UTR|ARFGAP2_ENST00000419701.2_Missense_Mutation_p.R148C|ARFGAP2_ENST00000426335.2_Missense_Mutation_p.R119C	NM_001242832.1|NM_032389.4	NP_001229761.1|NP_115765.2	Q8N6H7	ARFG2_HUMAN	ADP-ribosylation factor GTPase activating protein 2	255	Required for interaction with coatomer.				protein transport (GO:0015031)|regulation of ARF GTPase activity (GO:0032312)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)	ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)			breast(2)|kidney(2)|large_intestine(5)|lung(7)|ovary(3)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	23						TGCTGCTCACGGAGCTTCTCT	0.622													G|||	14	0.00279553	0.0	0.0	5008	,	,		15707	0.0		0.0	False		,,,				2504	0.0143				p.R255C		Atlas-SNP	.											.	ARFGAP2	43	.	0			c.C763T						.	G	CYS/ARG,CYS/ARG	0,4402		0,0,2201	65.0	68.0	67.0		679,763	5.9	1.0	11	dbSNP_134	67	1,8597	1.2+/-3.3	0,1,4298	no	missense,missense	ARFGAP2	NM_001242832.1,NM_032389.4	180,180	0,1,6499	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging,probably-damaging	227/494,255/522	47193261	1,12999	2201	4299	6500	SO:0001583	missense	84364	exon9			GCTCACGGAGCTT	AK027482	CCDS7926.1, CCDS73283.1	11p11.2-p11.12	2012-10-05	2008-01-09	2008-01-09	ENSG00000149182	ENSG00000149182		"""ADP-ribosylation factor GTPase activating proteins"""	13504	protein-coding gene	gene with protein product		606908	"""zinc finger protein 289, ID1 regulated"""	ZNF289		11278321, 14690497	Standard	NM_032389		Approved	IRZ, Zfp289, FLJ14576	uc001ndt.3	Q8N6H7	OTTHUMG00000166773	ENST00000524782.1:c.763C>T	chr11.hg19:g.47193261G>A	ENSP00000434442:p.Arg255Cys	46.0	0.0		54.0	5.0	NM_032389	B4DX29|B7Z9M7|D3DQQ9|Q3LIF2|Q8N3I1|Q96SX7	Missense_Mutation	SNP	ENST00000524782.1	hg19	CCDS7926.1	.	.	.	.	.	.	.	.	.	.	G	16.51	3.143951	0.57044	0.0	1.16E-4	ENSG00000149182	ENST00000426335;ENST00000524782;ENST00000419701;ENST00000527927;ENST00000525398	T;T;T;T;T	0.48522	0.81;0.81;0.81;0.81;0.81	5.95	5.95	0.96441	.	0.000000	0.85682	D	0.000000	T	0.67524	0.2902	M	0.78801	2.425	0.80722	D	1	D;B;D	0.89917	1.0;0.081;0.999	D;B;P	0.67103	0.949;0.006;0.891	T	0.70167	-0.4946	10	0.72032	D	0.01	-8.5939	13.2963	0.60298	0.0:0.0:0.7402:0.2598	.	148;119;255	B4DX29;G5E9L0;Q8N6H7	.;.;ARFG2_HUMAN	C	119;255;148;119;269	ENSP00000400226:R119C;ENSP00000434442:R255C;ENSP00000389264:R148C;ENSP00000434433:R119C;ENSP00000431939:R269C	ENSP00000389264:R148C	R	-	1	0	ARFGAP2	47149837	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.465000	0.60141	2.824000	0.97209	0.655000	0.94253	CGT	.	G|1.000;A|0.000		0.622	ARFGAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391425.1	NM_032389	
OR1S1	219959	hgsc.bcm.edu	37	11	57983067	57983067	+	Missense_Mutation	SNP	A	A	T			TCGA-5C-A9VH-01A-11D-A36X-10	TCGA-5C-A9VH-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	44e358dc-cbf5-4177-89a4-3d0d0fe2ff38	b56ae97e-c498-4223-a583-2b86e313f4bb	g.chr11:57983067A>T	ENST00000309433.6	+	1	851	c.851A>T	c.(850-852)gAt>gTt	p.D284V		NM_001004458.1	NP_001004458.1	Q8NH92	OR1S1_HUMAN	olfactory receptor, family 1, subfamily S, member 1	284						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(1)|endometrium(24)|kidney(1)|large_intestine(1)|liver(1)|lung(10)|prostate(1)|skin(2)|stomach(3)|urinary_tract(3)	48		Breast(21;0.0589)				GAGGACACTGATAAGATTGGT	0.473																																					p.D284V		Atlas-SNP	.											.	OR1S1	139	.	0			c.A851T						.						136.0	123.0	127.0					11																	57983067		2201	4293	6494	SO:0001583	missense	219959	exon1			ACACTGATAAGAT	BK004299	CCDS31546.1	11q12.1	2012-08-09			ENSG00000172774	ENSG00000172774		"""GPCR / Class A : Olfactory receptors"""	8227	protein-coding gene	gene with protein product							Standard	NM_001004458		Approved	OST034	uc010rkc.2	Q8NH92	OTTHUMG00000167463	ENST00000309433.6:c.851A>T	chr11.hg19:g.57983067A>T	ENSP00000311688:p.Asp284Val	141.0	0.0		107.0	27.0	NM_001004458	Q6IFG3	Missense_Mutation	SNP	ENST00000309433.6	hg19	CCDS31546.1	.	.	.	.	.	.	.	.	.	.	A	12.41	1.930780	0.34096	.	.	ENSG00000172774	ENST00000309433	T	0.00253	8.43	3.23	3.23	0.37069	GPCR, rhodopsin-like superfamily (1);	0.409624	0.20658	N	0.088067	T	0.00552	0.0018	M	0.87971	2.92	0.09310	N	0.999995	D	0.89917	1.0	D	0.76071	0.987	T	0.36065	-0.9763	10	0.56958	D	0.05	.	7.6674	0.28439	0.8888:0.0:0.1112:0.0	.	284	Q8NH92	OR1S1_HUMAN	V	284	ENSP00000311688:D284V	ENSP00000311688:D284V	D	+	2	0	OR1S1	57739643	0.000000	0.05858	0.184000	0.23157	0.758000	0.43043	1.286000	0.33273	1.345000	0.45676	0.392000	0.25879	GAT	.	.		0.473	OR1S1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394705.1	NM_001004458	
MFRP	83552	hgsc.bcm.edu	37	11	119213689	119213689	+	Silent	SNP	G	G	T			TCGA-5C-A9VH-01A-11D-A36X-10	TCGA-5C-A9VH-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	44e358dc-cbf5-4177-89a4-3d0d0fe2ff38	b56ae97e-c498-4223-a583-2b86e313f4bb	g.chr11:119213689G>T	ENST00000530681.1	-	10	1293	c.1149C>A	c.(1147-1149)ccC>ccA	p.P383P	MFRP_ENST00000449574.2_Silent_p.P383P|C1QTNF5_ENST00000528368.1_5'Flank|C1QTNF5_ENST00000445041.2_5'UTR|C1QTNF5_ENST00000525657.1_5'Flank|MFRP_ENST00000529147.1_5'Flank|MFRP_ENST00000360167.4_Missense_Mutation_p.P308H|MFRP_ENST00000555262.1_Silent_p.P383P	NM_001278431.1	NP_001265360.1	Q9BY79	MFRP_HUMAN	membrane frizzled-related protein	383	CUB 2. {ECO:0000255|PROSITE- ProRule:PRU00059}.				embryo development (GO:0009790)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(8)|prostate(1)|urinary_tract(1)	18		Medulloblastoma(222;0.0523)|Breast(348;0.174)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;3.84e-05)		AGACGAGGTGGGGGGGTGGCT	0.622																																					p.P383P		Atlas-SNP	.											.	MFRP	63	.	0			c.C1149A						.						33.0	27.0	29.0					11																	119213689		2196	4293	6489	SO:0001819	synonymous_variant	83552	exon10			GAGGTGGGGGGGT	AB055505	CCDS8421.1	11q23.3	2014-01-28			ENSG00000235718	ENSG00000235718			18121	protein-coding gene	gene with protein product	"""membrane-type frizzled-related protein"", ""complement C1q tumor necrosis factor-related protein 5 precursor variant 1"""	606227				11263980	Standard	NM_031433		Approved	FLJ30570, rd6, NNO2, C1QTNF5	uc001pwj.2	Q9BY79		ENST00000530681.1:c.1149C>A	chr11.hg19:g.119213689G>T		74.0	0.0		50.0	21.0	NM_031433	B0YJ36|B0YJ37|B4DHN8|Q335M3|Q96DQ9	Silent	SNP	ENST00000530681.1	hg19	CCDS8421.1	.	.	.	.	.	.	.	.	.	.	G	0.213	-1.035170	0.02029	.	.	ENSG00000235718	ENST00000360167	T	0.25085	1.82	4.84	-9.68	0.00528	.	0.274308	0.34411	N	0.003982	T	0.11024	0.0269	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.05886	-1.0858	9	0.42905	T	0.14	-0.9876	3.3846	0.07266	0.1173:0.3353:0.2036:0.3438	.	308	B4DHN8	.	H	308	ENSP00000353291:P308H	ENSP00000353291:P308H	P	-	2	0	MFRP	118718899	0.000000	0.05858	0.000000	0.03702	0.106000	0.19336	-1.766000	0.01797	-3.385000	0.00174	-1.153000	0.01818	CCC	.	.		0.622	MFRP-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	nonsense_mediated_decay	protein_coding	OTTHUMT00000415179.1	NM_031433	
BLID	414899	hgsc.bcm.edu	37	11	121986326	121986326	+	Missense_Mutation	SNP	T	T	A	rs375451446		TCGA-5C-A9VH-01A-11D-A36X-10	TCGA-5C-A9VH-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	44e358dc-cbf5-4177-89a4-3d0d0fe2ff38	b56ae97e-c498-4223-a583-2b86e313f4bb	g.chr11:121986326T>A	ENST00000560104.1	-	1	597	c.305A>T	c.(304-306)aAt>aTt	p.N102I		NM_001001786.2	NP_001001786.2	Q8IZY5	BLID_HUMAN	BH3-like motif containing, cell death inducer	102					apoptotic process (GO:0006915)	mitochondrion (GO:0005739)				NS(1)|large_intestine(4)|lung(6)|pancreas(1)	12		Breast(109;0.0164)|Medulloblastoma(222;0.0523)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;2.08e-05)|OV - Ovarian serous cystadenocarcinoma(99;0.101)		AGCAGAGGAATTGCATAACAA	0.453																																					p.N102I		Atlas-SNP	.											.	BLID	20	.	0			c.A305T						.						105.0	101.0	102.0					11																	121986326		2202	4299	6501	SO:0001583	missense	414899	exon1			GAGGAATTGCATA	AF303179	CCDS31693.1	11q24.1	2007-06-22				ENSG00000259571			33495	protein-coding gene	gene with protein product	"""breast cancer cell 2"""	608853				15069058, 17220890	Standard	NM_001001786		Approved	BRCC2	uc001pyf.3	Q8IZY5		ENST00000560104.1:c.305A>T	chr11.hg19:g.121986326T>A	ENSP00000453153:p.Asn102Ile	107.0	0.0		100.0	41.0	NM_001001786	A1L416	Missense_Mutation	SNP	ENST00000560104.1	hg19	CCDS31693.1	.	.	.	.	.	.	.	.	.	.	T	15.18	2.756516	0.49362	.	.	ENSG00000258606;ENSG00000258574	ENST00000553434;ENST00000556841	.	.	.	3.76	1.44	0.22558	.	.	.	.	.	T	0.19127	0.0459	N	0.08118	0	0.09310	N	0.999999	P	0.44429	0.835	P	0.46917	0.531	T	0.10132	-1.0643	8	0.87932	D	0	.	5.3091	0.15821	0.0:0.2371:0.0:0.7629	.	102	Q8IZY5	BLID_HUMAN	I	102	.	ENSP00000448995:N102I	N	-	2	0	BLID;AP001924.1	121491536	0.123000	0.22298	0.240000	0.24138	0.719000	0.41307	0.696000	0.25541	0.296000	0.22592	0.482000	0.46254	AAT	.	.		0.453	BLID-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387656.1	NM_001001786	
ESAM	90952	hgsc.bcm.edu	37	11	124626226	124626226	+	Missense_Mutation	SNP	C	C	A			TCGA-5C-A9VH-01A-11D-A36X-10	TCGA-5C-A9VH-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	44e358dc-cbf5-4177-89a4-3d0d0fe2ff38	b56ae97e-c498-4223-a583-2b86e313f4bb	g.chr11:124626226C>A	ENST00000278927.5	-	4	613	c.484G>T	c.(484-486)Ggt>Tgt	p.G162C	RP11-677M14.3_ENST00000504932.2_RNA|ESAM_ENST00000442070.2_Intron	NM_138961.2	NP_620411.2	Q96AP7	ESAM_HUMAN	endothelial cell adhesion molecule	162	Ig-like C2-type.				blood coagulation (GO:0007596)|homophilic cell adhesion (GO:0007156)|leukocyte migration (GO:0050900)|single organismal cell-cell adhesion (GO:0016337)	adherens junction (GO:0005912)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|tight junction (GO:0005923)				endometrium(2)|kidney(1)|large_intestine(6)|lung(4)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	16	all_hematologic(175;0.215)	Breast(109;0.00109)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.022)		TGGGGCACACCCTGGAGACGG	0.607																																					p.G162C		Atlas-SNP	.											.	ESAM	31	.	0			c.G484T						.						35.0	30.0	32.0					11																	124626226		2201	4299	6500	SO:0001583	missense	90952	exon4			GCACACCCTGGAG	AK075396	CCDS8453.1	11q24.2	2013-01-29			ENSG00000149564	ENSG00000149564		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	17474	protein-coding gene	gene with protein product		614281				11279107, 11906820	Standard	NM_138961		Approved	W117m	uc001qav.4	Q96AP7	OTTHUMG00000151986	ENST00000278927.5:c.484G>T	chr11.hg19:g.124626226C>A	ENSP00000278927:p.Gly162Cys	59.0	0.0		40.0	10.0	NM_138961	B4DVN8|Q96T50	Missense_Mutation	SNP	ENST00000278927.5	hg19	CCDS8453.1	.	.	.	.	.	.	.	.	.	.	C	14.44	2.536261	0.45176	.	.	ENSG00000149564	ENST00000278927;ENST00000435477	T;T	0.16324	2.35;2.35	5.37	4.45	0.53987	Immunoglobulin-like fold (1);	0.052629	0.85682	D	0.000000	T	0.48352	0.1495	M	0.92317	3.295	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.995;0.996;0.999	T	0.57213	-0.7850	10	0.87932	D	0	.	10.4642	0.44598	0.0:0.9097:0.0:0.0903	.	162;162;35	F8WDW9;Q96AP7;C9JIE7	.;ESAM_HUMAN;.	C	162;35	ENSP00000278927:G162C;ENSP00000415893:G35C	ENSP00000278927:G162C	G	-	1	0	ESAM	124131436	0.634000	0.27190	0.276000	0.24689	0.221000	0.24807	3.014000	0.49590	2.509000	0.84616	0.655000	0.94253	GGT	.	.		0.607	ESAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324686.1	NM_138961	
ZNF384	171017	hgsc.bcm.edu	37	12	6787570	6787570	+	Missense_Mutation	SNP	C	C	A			TCGA-5C-A9VH-01A-11D-A36X-10	TCGA-5C-A9VH-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	44e358dc-cbf5-4177-89a4-3d0d0fe2ff38	b56ae97e-c498-4223-a583-2b86e313f4bb	g.chr12:6787570C>A	ENST00000396801.3	-	6	616	c.409G>T	c.(409-411)Gct>Tct	p.A137S	ZNF384_ENST00000396799.2_Missense_Mutation_p.A137S|ZNF384_ENST00000396795.1_Missense_Mutation_p.A137S|ZNF384_ENST00000319770.3_Missense_Mutation_p.A121S|ZNF384_ENST00000361959.3_Missense_Mutation_p.A137S|ZNF384_ENST00000355772.4_Intron	NM_001135734.2	NP_001129206.1	Q8TF68	ZN384_HUMAN	zinc finger protein 384	137					nucleocytoplasmic transport (GO:0006913)|positive regulation of protein secretion (GO:0050714)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	focal adhesion (GO:0005925)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)		EWSR1/ZNF384(4)	breast(3)|central_nervous_system(3)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|prostate(1)|urinary_tract(1)	18						AAGGTCTGAGCTGATGATGCT	0.547			T	"""EWSR1, TAF15 """	ALL																																p.A137S		Atlas-SNP	.		Dom	yes		12	12p13	171017	zinc finger protein 384 (CIZ/NMP4)		L	.	ZNF384	102	.	0			c.G409T						.						37.0	36.0	36.0					12																	6787570		2203	4300	6503	SO:0001583	missense	171017	exon6			TCTGAGCTGATGA	U80738	CCDS8557.1, CCDS31732.1, CCDS44817.1	12p12	2013-01-08	2002-05-23	2002-05-24		ENSG00000126746		"""Zinc fingers, C2H2-type"""	11955	protein-coding gene	gene with protein product		609951	"""trinucleotide repeat containing 1"""	TNRC1		9225980, 11149472	Standard	NM_001135734		Approved	CAGH1A, CIZ, NMP4, NP	uc010sfh.2	Q8TF68		ENST00000396801.3:c.409G>T	chr12.hg19:g.6787570C>A	ENSP00000380019:p.Ala137Ser	117.0	0.0		116.0	38.0	NM_133476	O15407|Q7Z722|Q8N938	Missense_Mutation	SNP	ENST00000396801.3	hg19	CCDS44817.1	.	.	.	.	.	.	.	.	.	.	C	9.295	1.051654	0.19827	.	.	ENSG00000126746	ENST00000319770;ENST00000396795;ENST00000396801;ENST00000361959;ENST00000396799;ENST00000417772;ENST00000436774;ENST00000542796;ENST00000540915;ENST00000535485	T;T;T;T;T;T	0.08282	3.16;3.21;3.11;3.11;3.21;3.47	5.47	5.47	0.80525	.	0.000000	0.64402	D	0.000002	T	0.04137	0.0115	N	0.03050	-0.425	0.45822	D	0.998692	B;B;B	0.28378	0.209;0.123;0.123	B;B;B	0.18871	0.021;0.015;0.023	T	0.53940	-0.8367	10	0.21014	T	0.42	-7.7809	17.4978	0.87723	0.0:1.0:0.0:0.0	.	137;121;137	Q8TF68;F8W6Q3;Q8TF68-2	ZN384_HUMAN;.;.	S	121;137;137;137;137;137;121;121;137;121	ENSP00000321650:A121S;ENSP00000380013:A137S;ENSP00000380019:A137S;ENSP00000354592:A137S;ENSP00000380017:A137S;ENSP00000412911:A121S	ENSP00000321650:A121S	A	-	1	0	ZNF384	6657831	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	2.009000	0.40903	2.560000	0.86352	0.591000	0.81541	GCT	.	.		0.547	ZNF384-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400712.1		
TAS2R20	259295	hgsc.bcm.edu	37	12	11150332	11150332	+	Missense_Mutation	SNP	A	A	G			TCGA-5C-A9VH-01A-11D-A36X-10	TCGA-5C-A9VH-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	44e358dc-cbf5-4177-89a4-3d0d0fe2ff38	b56ae97e-c498-4223-a583-2b86e313f4bb	g.chr12:11150332A>G	ENST00000538986.1	-	1	142	c.143T>C	c.(142-144)aTt>aCt	p.I48T	PRR4_ENST00000536668.1_Intron|TAS2R14_ENST00000381852.4_Intron	NM_176889.2	NP_795370.2	P59543	T2R20_HUMAN	taste receptor, type 2, member 20	48					sensory perception of taste (GO:0050909)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(1)|endometrium(1)|large_intestine(3)|lung(4)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	13						CAGAGCAGCAATAATTTGATC	0.358																																					p.I48T		Atlas-SNP	.											.	TAS2R20	17	.	0			c.T143C						.						42.0	47.0	45.0					12																	11150332		2202	4299	6501	SO:0001583	missense	259295	exon1			GCAGCAATAATTT	AX097732, AF494236	CCDS8639.1	12p13.2	2012-08-22			ENSG00000255837	ENSG00000255837		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	19109	protein-coding gene	gene with protein product		613962	"""taste receptor, type 2, member 49"""	TAS2R49			Standard	NM_176889		Approved	T2R20, T2R56	uc001qzm.2	P59543	OTTHUMG00000162695	ENST00000538986.1:c.143T>C	chr12.hg19:g.11150332A>G	ENSP00000441624:p.Ile48Thr	292.0	0.0		218.0	80.0	NM_176889	P59549|Q2HIZ4|Q496D8|Q645X9	Missense_Mutation	SNP	ENST00000538986.1	hg19	CCDS8639.1	.	.	.	.	.	.	.	.	.	.	A	12.07	1.827179	0.32329	.	.	ENSG00000255837	ENST00000538986	T	0.00840	5.63	2.77	2.77	0.32553	.	0.353536	0.21366	U	0.075710	T	0.01592	0.0051	M	0.64404	1.975	0.09310	N	1	P	0.37731	0.607	B	0.39465	0.3	T	0.38993	-0.9635	10	0.87932	D	0	.	8.9683	0.35890	1.0:0.0:0.0:0.0	.	48	P59543	T2R20_HUMAN	T	48	ENSP00000441624:I48T	ENSP00000441624:I48T	I	-	2	0	TAS2R20	11041599	0.374000	0.25081	0.004000	0.12327	0.033000	0.12548	2.971000	0.49248	1.279000	0.44446	0.482000	0.46254	ATT	.	.		0.358	TAS2R20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370130.2	NM_176889	
DAZAP2	9802	hgsc.bcm.edu	37	12	51634874	51634874	+	Missense_Mutation	SNP	G	G	T			TCGA-5C-A9VH-01A-11D-A36X-10	TCGA-5C-A9VH-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	44e358dc-cbf5-4177-89a4-3d0d0fe2ff38	b56ae97e-c498-4223-a583-2b86e313f4bb	g.chr12:51634874G>T	ENST00000412716.3	+	3	968	c.352G>T	c.(352-354)Gct>Tct	p.A118S	DAZAP2_ENST00000551534.1_3'UTR|DAZAP2_ENST00000425012.2_Missense_Mutation_p.A118S|DAZAP2_ENST00000439799.2_Intron|DAZAP2_ENST00000604900.1_Missense_Mutation_p.A118S|DAZAP2_ENST00000551313.1_Missense_Mutation_p.A58S|DAZAP2_ENST00000549555.1_Intron|DAZAP2_ENST00000449723.3_Missense_Mutation_p.A96S|DAZAP2_ENST00000549732.2_Missense_Mutation_p.A86S			Q15038	DAZP2_HUMAN	DAZ associated protein 2	118	Pro-rich.					cytoplasm (GO:0005737)|nucleus (GO:0005634)	WW domain binding (GO:0050699)			haematopoietic_and_lymphoid_tissue(3)|lung(2)|urinary_tract(1)	6						CAGATTTGGAGCTGGGGCTAC	0.473																																					p.A118S		Atlas-SNP	.											.	DAZAP2	6	.	0			c.G352T						.						88.0	80.0	83.0					12																	51634874		2203	4300	6503	SO:0001583	missense	9802	exon3			TTTGGAGCTGGGG	D31767	CCDS8809.1, CCDS44884.1, CCDS44885.1, CCDS44886.1, CCDS44887.1, CCDS44888.1	12q13.13	2012-04-04			ENSG00000183283	ENSG00000183283			2684	protein-coding gene	gene with protein product		607431				10857750, 7584044	Standard	NM_014764		Approved	KIAA0058	uc010snd.2	Q15038	OTTHUMG00000169649	ENST00000412716.3:c.352G>T	chr12.hg19:g.51634874G>T	ENSP00000394699:p.Ala118Ser	52.0	0.0		31.0	12.0	NM_001136269	A8K254|B4DDT5|B4E1G3|C9JA96|C9JP84|E9PB45|F8VU62	Missense_Mutation	SNP	ENST00000412716.3	hg19	CCDS8809.1	.	.	.	.	.	.	.	.	.	.	G	23.0	4.365959	0.82463	.	.	ENSG00000183283	ENST00000412716;ENST00000425012;ENST00000549732;ENST00000449723;ENST00000551313	T;T;T;T;T	0.42900	0.96;0.96;0.96;0.96;0.96	4.13	4.13	0.48395	.	0.118043	0.56097	D	0.000032	T	0.43010	0.1228	N	0.11927	0.2	0.35056	D	0.761059	D;D;D	0.63046	0.975;0.978;0.992	P;D;D	0.74348	0.79;0.918;0.983	T	0.40421	-0.9564	10	0.13108	T	0.6	.	16.3716	0.83364	0.0:0.0:1.0:0.0	.	118;86;118	B4DDT5;C9JP84;Q15038	.;.;DAZP2_HUMAN	S	118;118;86;96;58	ENSP00000394699:A118S;ENSP00000408251:A118S;ENSP00000446554:A86S;ENSP00000412812:A96S;ENSP00000447842:A58S	ENSP00000394699:A118S	A	+	1	0	DAZAP2	49921141	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.472000	0.60189	2.589000	0.87451	0.655000	0.94253	GCT	.	.		0.473	DAZAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405259.2	NM_014764	
CSAD	51380	hgsc.bcm.edu	37	12	53566426	53566426	+	Missense_Mutation	SNP	C	C	G			TCGA-5C-A9VH-01A-11D-A36X-10	TCGA-5C-A9VH-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	44e358dc-cbf5-4177-89a4-3d0d0fe2ff38	b56ae97e-c498-4223-a583-2b86e313f4bb	g.chr12:53566426C>G	ENST00000444623.1	-	5	400	c.133G>C	c.(133-135)Gag>Cag	p.E45Q	CSAD_ENST00000491654.1_5'UTR|CSAD_ENST00000542115.1_Missense_Mutation_p.E45Q|CSAD_ENST00000379843.3_Intron|CSAD_ENST00000453446.2_Missense_Mutation_p.E45Q|CSAD_ENST00000267085.4_Missense_Mutation_p.E72Q|CSAD_ENST00000379846.1_Intron	NM_001244705.1	NP_001231634.1	Q9Y600	CSAD_HUMAN	cysteine sulfinic acid decarboxylase	45					cellular nitrogen compound metabolic process (GO:0034641)|small molecule metabolic process (GO:0044281)|sulfur amino acid catabolic process (GO:0000098)|sulfur amino acid metabolic process (GO:0000096)|taurine biosynthetic process (GO:0042412)		pyridoxal phosphate binding (GO:0030170)|sulfinoalanine decarboxylase activity (GO:0004782)			kidney(1)|large_intestine(2)|lung(6)|ovary(1)|prostate(4)	14					L-Cysteine(DB00151)	TCCTTCCACTCACAGACCTAG	0.617																																					p.E72Q	Ovarian(109;252 1546 16882 28524 44645)	Atlas-SNP	.											.	CSAD	66	.	0			c.G214C						.						21.0	23.0	22.0					12																	53566426		2203	4300	6503	SO:0001583	missense	51380	exon5			TCCACTCACAGAC	AB044561	CCDS8848.2, CCDS58235.1	12q13.11-q14.3	2008-08-04			ENSG00000139631	ENSG00000139631			18966	protein-coding gene	gene with protein product	"""P-selectin cytoplasmic tail-associated protein"""					15489334	Standard	NM_015989		Approved	PCAP, CSD	uc001sbz.3	Q9Y600	OTTHUMG00000048076	ENST00000444623.1:c.133G>C	chr12.hg19:g.53566426C>G	ENSP00000415485:p.Glu45Gln	43.0	0.0		23.0	10.0	NM_015989	A8K0U4|Q4QQH9|Q9UNJ5|Q9Y601	Missense_Mutation	SNP	ENST00000444623.1	hg19	CCDS58235.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	17.52|17.52	3.410027|3.410027	0.62399|0.62399	.|.	.|.	ENSG00000139631|ENSG00000139631	ENST00000308926;ENST00000267085;ENST00000544139;ENST00000444623;ENST00000398047;ENST00000453446;ENST00000542115;ENST00000437073;ENST00000424990|ENST00000379850	T;T;T;T;T;T|.	0.39056|.	1.1;1.1;1.1;1.1;1.1;1.1|.	4.67|4.67	4.67|4.67	0.58626|0.58626	Pyridoxal phosphate-dependent transferase, major domain (1);|.	0.102798|.	0.64402|.	D|.	0.000003|.	T|.	0.75384|.	0.3842|.	M|M	0.74647|0.74647	2.275|2.275	0.58432|0.58432	D|D	0.999999|0.999999	D;D;D|.	0.71674|.	0.997;0.998;0.988|.	D;D;P|.	0.70016|.	0.933;0.967;0.88|.	T|.	0.75958|.	-0.3134|.	10|.	0.26408|.	T|.	0.33|.	-28.7401|-28.7401	16.888|16.888	0.86080|0.86080	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	45;72;45|.	B4DL84;Q9Y600-3;Q9Y600|.	.;.;CSAD_HUMAN|.	Q|S	134;72;45;45;45;45;45;45;45|70	ENSP00000267085:E72Q;ENSP00000415485:E45Q;ENSP00000410648:E45Q;ENSP00000439419:E45Q;ENSP00000415314:E45Q;ENSP00000401078:E45Q|.	ENSP00000267085:E72Q|.	E|X	-|-	1|2	0|2	CSAD|CSAD	51852693|51852693	1.000000|1.000000	0.71417|0.71417	0.995000|0.995000	0.50966|0.50966	0.881000|0.881000	0.50899|0.50899	6.909000|6.909000	0.75735|0.75735	2.604000|2.604000	0.88044|0.88044	0.555000|0.555000	0.69702|0.69702	GAG|TGA	.	.		0.617	CSAD-017	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343697.1	NM_015989	
SRGAP1	57522	hgsc.bcm.edu	37	12	64377754	64377754	+	Missense_Mutation	SNP	A	A	T			TCGA-5C-A9VH-01A-11D-A36X-10	TCGA-5C-A9VH-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	44e358dc-cbf5-4177-89a4-3d0d0fe2ff38	b56ae97e-c498-4223-a583-2b86e313f4bb	g.chr12:64377754A>T	ENST00000355086.3	+	2	619	c.95A>T	c.(94-96)cAa>cTa	p.Q32L	SRGAP1_ENST00000357825.3_Missense_Mutation_p.Q32L|SRGAP1_ENST00000543397.1_5'UTR	NM_020762.2	NP_065813.1	Q7Z6B7	SRGP1_HUMAN	SLIT-ROBO Rho GTPase activating protein 1	32	F-BAR domain.|FCH. {ECO:0000255|PROSITE- ProRule:PRU00083}.				axon guidance (GO:0007411)|cell migration (GO:0016477)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	Rho GTPase activator activity (GO:0005100)			breast(4)|central_nervous_system(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(26)|ovary(2)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	65			GBM - Glioblastoma multiforme(3;0.000139)|BRCA - Breast invasive adenocarcinoma(9;0.225)	GBM - Glioblastoma multiforme(28;0.0608)		GTAGAACAACAAAAATGCCTG	0.413																																					p.Q32L		Atlas-SNP	.											.	SRGAP1	146	.	0			c.A95T						.						78.0	83.0	81.0					12																	64377754		2203	4300	6503	SO:0001583	missense	57522	exon2			AACAACAAAAATG	AB037725	CCDS8967.1	12q13.13	2011-07-04			ENSG00000196935	ENSG00000196935		"""Rho GTPase activating proteins"""	17382	protein-coding gene	gene with protein product		606523				11672528	Standard	NM_020762		Approved	KIAA1304, ARHGAP13	uc010ssp.1	Q7Z6B7	OTTHUMG00000168750	ENST00000355086.3:c.95A>T	chr12.hg19:g.64377754A>T	ENSP00000347198:p.Gln32Leu	83.0	0.0		82.0	38.0	NM_020762	Q9H8A3|Q9P2P2	Missense_Mutation	SNP	ENST00000355086.3	hg19	CCDS8967.1	.	.	.	.	.	.	.	.	.	.	A	3.909	-0.020495	0.07634	.	.	ENSG00000196935	ENST00000355086;ENST00000357825	T;T	0.13778	2.56;2.56	4.89	3.71	0.42584	Fps/Fes/Fer/CIP4 homology (3);	0.000000	0.33591	U	0.004750	T	0.02267	0.0070	N	0.00065	-2.305	0.58432	D	0.999999	B;B	0.06786	0.001;0.001	B;B	0.09377	0.004;0.001	T	0.34054	-0.9844	9	.	.	.	.	11.075	0.48025	0.861:0.0:0.0:0.139	.	32;32	Q7Z6B7;Q7Z6B7-2	SRGP1_HUMAN;.	L	32	ENSP00000347198:Q32L;ENSP00000350480:Q32L	.	Q	+	2	0	SRGAP1	62664021	1.000000	0.71417	0.914000	0.36105	0.993000	0.82548	5.077000	0.64419	0.786000	0.33708	0.477000	0.44152	CAA	.	.		0.413	SRGAP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000400896.1		
RNF17	56163	hgsc.bcm.edu	37	13	25378454	25378454	+	Missense_Mutation	SNP	T	T	A			TCGA-5C-A9VH-01A-11D-A36X-10	TCGA-5C-A9VH-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	44e358dc-cbf5-4177-89a4-3d0d0fe2ff38	b56ae97e-c498-4223-a583-2b86e313f4bb	g.chr13:25378454T>A	ENST00000255324.5	+	15	2030	c.1978T>A	c.(1978-1980)Ttt>Att	p.F660I	RNF17_ENST00000381921.1_Missense_Mutation_p.F660I|RNF17_ENST00000255325.6_Intron	NM_001184993.1|NM_031277.2	NP_001171922.1|NP_112567.2	Q9BXT8	RNF17_HUMAN	ring finger protein 17	660					multicellular organismal development (GO:0007275)|spermatid development (GO:0007286)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	hydrolase activity, acting on ester bonds (GO:0016788)|nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(15)|ovary(1)|prostate(3)|skin(6)	36		Lung SC(185;0.0225)|Breast(139;0.077)		all cancers(112;0.0114)|OV - Ovarian serous cystadenocarcinoma(117;0.0311)|Epithelial(112;0.0524)		AAGAAGTCACTTTGAAAAAAA	0.378																																					p.F660I		Atlas-SNP	.											.	RNF17	259	.	0			c.T1978A						.						88.0	87.0	87.0					13																	25378454		2200	4299	6499	SO:0001583	missense	56163	exon15			AGTCACTTTGAAA	AF285602, AK001907	CCDS9308.2	13q12.13	2013-01-23			ENSG00000132972	ENSG00000132972		"""RING-type (C3HC4) zinc fingers"", ""Tudor domain containing"""	10060	protein-coding gene	gene with protein product	"""spermatogenesis associated 23"""	605793	"""tudor domain containing 4"""	TDRD4		11279525	Standard	NM_001184993		Approved	Mmip-2, SPATA23, FLJ11045	uc001upr.3	Q9BXT8	OTTHUMG00000016589	ENST00000255324.5:c.1978T>A	chr13.hg19:g.25378454T>A	ENSP00000255324:p.Phe660Ile	103.0	0.0		81.0	29.0	NM_001184993	Q5T2J9|Q6P1W3|Q9BXT7|Q9NUY9	Missense_Mutation	SNP	ENST00000255324.5	hg19	CCDS9308.2	.	.	.	.	.	.	.	.	.	.	T	9.150	1.015945	0.19355	.	.	ENSG00000132972	ENST00000255324;ENST00000381921;ENST00000429047	T;T	0.20598	2.06;2.06	5.49	-3.84	0.04256	.	1.261360	0.05418	N	0.543777	T	0.07593	0.0191	N	0.08118	0	0.09310	N	0.999999	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.30563	-0.9974	10	0.17369	T	0.5	.	0.7527	0.00993	0.1635:0.2446:0.2884:0.3035	.	660;660	B7Z7S1;Q9BXT8	.;RNF17_HUMAN	I	660;660;519	ENSP00000255324:F660I;ENSP00000371346:F660I	ENSP00000255324:F660I	F	+	1	0	RNF17	24276454	0.002000	0.14202	0.056000	0.19401	0.580000	0.36256	0.156000	0.16382	-0.307000	0.08804	0.477000	0.44152	TTT	.	.		0.378	RNF17-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044217.1	NM_031994	
OLFM4	10562	hgsc.bcm.edu	37	13	53608515	53608515	+	Silent	SNP	C	C	T			TCGA-5C-A9VH-01A-11D-A36X-10	TCGA-5C-A9VH-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	44e358dc-cbf5-4177-89a4-3d0d0fe2ff38	b56ae97e-c498-4223-a583-2b86e313f4bb	g.chr13:53608515C>T	ENST00000219022.2	+	2	315	c.237C>T	c.(235-237)gaC>gaT	p.D79D		NM_006418.4	NP_006409.3	Q6UX06	OLFM4_HUMAN	olfactomedin 4	79					cell adhesion (GO:0007155)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of immune response (GO:0050777)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|protein homooligomerization (GO:0051260)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|specific granule (GO:0042581)	cadherin binding (GO:0045296)|catalytic activity (GO:0003824)|protein homodimerization activity (GO:0042803)			breast(2)|endometrium(4)|kidney(4)|large_intestine(5)|lung(20)|skin(3)|urinary_tract(1)	39		Breast(56;0.000776)|Lung NSC(96;0.000814)|Hepatocellular(98;0.065)|Prostate(109;0.0771)|all_neural(104;0.173)		GBM - Glioblastoma multiforme(99;3.13e-08)		CCGTGGATGACCGTGGGACCT	0.478																																					p.D79D		Atlas-SNP	.											.	OLFM4	94	.	0			c.C237T						.						137.0	118.0	124.0					13																	53608515		2203	4300	6503	SO:0001819	synonymous_variant	10562	exon2			GGATGACCGTGGG	AY358567	CCDS9440.1	13q14	2004-06-25			ENSG00000102837	ENSG00000102837			17190	protein-coding gene	gene with protein product		614061					Standard	NM_006418		Approved	OlfD, GW112, GC1	uc001vhl.3	Q6UX06	OTTHUMG00000016981	ENST00000219022.2:c.237C>T	chr13.hg19:g.53608515C>T		103.0	0.0		68.0	18.0	NM_006418	O95362|Q5VWG0|Q86T22	Silent	SNP	ENST00000219022.2	hg19	CCDS9440.1																																																																																			.	.		0.478	OLFM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045112.2	NM_006418	
MYCBP2	23077	hgsc.bcm.edu	37	13	77836229	77836229	+	Missense_Mutation	SNP	C	C	T			TCGA-5C-A9VH-01A-11D-A36X-10	TCGA-5C-A9VH-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	44e358dc-cbf5-4177-89a4-3d0d0fe2ff38	b56ae97e-c498-4223-a583-2b86e313f4bb	g.chr13:77836229C>T	ENST00000544440.2	-	11	1509	c.1492G>A	c.(1492-1494)Gca>Aca	p.A498T	MYCBP2_ENST00000360084.5_5'UTR|MYCBP2_ENST00000357337.6_Missense_Mutation_p.A498T|MYCBP2_ENST00000407578.2_Missense_Mutation_p.A536T					MYC binding protein 2, E3 ubiquitin protein ligase											NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(51)|ovary(5)|pancreas(2)|prostate(5)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	118		Breast(118;0.212)|Acute lymphoblastic leukemia(28;0.22)		GBM - Glioblastoma multiforme(99;0.109)		TCTCGTCCTGCACCAAGAATT	0.323																																					p.A536T		Atlas-SNP	.											.	MYCBP2	1029	.	0			c.G1606A						.						87.0	84.0	85.0					13																	77836229		2203	4299	6502	SO:0001583	missense	23077	exon11			GTCCTGCACCAAG	AB020723		13q22	2012-02-23	2012-02-23		ENSG00000005810	ENSG00000005810			23386	protein-coding gene	gene with protein product		610392	"""MYC binding protein 2"""			9689053, 15057823	Standard	NM_015057		Approved	PAM, KIAA0916, FLJ10106	uc021rks.1	O75592	OTTHUMG00000017105	ENST00000544440.2:c.1492G>A	chr13.hg19:g.77836229C>T	ENSP00000444596:p.Ala498Thr	44.0	0.0		44.0	13.0	NM_015057		Missense_Mutation	SNP	ENST00000544440.2	hg19		.	.	.	.	.	.	.	.	.	.	C	27.0	4.791602	0.90367	.	.	ENSG00000005810	ENST00000357337;ENST00000407578;ENST00000544440	D;D;D	0.81739	-1.53;-1.53;-1.53	5.29	5.29	0.74685	Regulator of chromosome condensation/beta-lactamase-inhibitor protein II (2);	0.000000	0.64402	D	0.000001	D	0.84061	0.5389	L	0.38175	1.15	0.58432	D	0.999998	D	0.63880	0.993	D	0.70935	0.971	D	0.83786	0.0228	10	0.44086	T	0.13	.	14.2069	0.65739	0.0:0.9263:0.0:0.0737	.	498	O75592	MYCB2_HUMAN	T	498;536;498	ENSP00000349892:A498T;ENSP00000384288:A536T;ENSP00000444596:A498T	ENSP00000349892:A498T	A	-	1	0	MYCBP2	76734230	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.341000	0.52151	2.468000	0.83385	0.591000	0.81541	GCA	.	.		0.323	MYCBP2-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000045326.1	NM_015057	
SPATA7	55812	hgsc.bcm.edu	37	14	88857749	88857749	+	Missense_Mutation	SNP	G	G	T	rs200551653		TCGA-5C-A9VH-01A-11D-A36X-10	TCGA-5C-A9VH-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	44e358dc-cbf5-4177-89a4-3d0d0fe2ff38	b56ae97e-c498-4223-a583-2b86e313f4bb	g.chr14:88857749G>T	ENST00000393545.4	+	2	333	c.44G>T	c.(43-45)aGa>aTa	p.R15I	SPATA7_ENST00000045347.7_Missense_Mutation_p.R15I|SPATA7_ENST00000554102.1_3'UTR|SPATA7_ENST00000356583.5_Missense_Mutation_p.R15I|SPATA7_ENST00000556553.1_Missense_Mutation_p.R15I	NM_018418.4	NP_060888.2	Q9P0W8	SPAT7_HUMAN	spermatogenesis associated 7	15					response to stimulus (GO:0050896)|visual perception (GO:0007601)					cervix(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(9)|ovary(1)	18						GTCCTTCCCAGATATGGTCCA	0.348																																					p.R15I		Atlas-SNP	.											.	SPATA7	58	.	0			c.G44T						.						82.0	76.0	78.0					14																	88857749		2203	4300	6503	SO:0001583	missense	55812	exon2			TTCCCAGATATGG	AF144487	CCDS9883.1, CCDS32132.1	14q31.3	2011-02-17				ENSG00000042317			20423	protein-coding gene	gene with protein product		609868	"""Leber congenital amaurosis 3"""	LCA3		9799089, 19268277	Standard	NM_018418		Approved	HSD3	uc001xwq.3	Q9P0W8		ENST00000393545.4:c.44G>T	chr14.hg19:g.88857749G>T	ENSP00000377176:p.Arg15Ile	93.0	0.0		69.0	25.0	NM_018418	Q5BKY5|Q8WX30|Q96HF3|Q9H0X0|Q9P0W7	Missense_Mutation	SNP	ENST00000393545.4	hg19	CCDS9883.1	.	.	.	.	.	.	.	.	.	.	G	14.33	2.504020	0.44558	.	.	ENSG00000042317	ENST00000556553;ENST00000393545;ENST00000356583;ENST00000553885;ENST00000045347	T;T;T;T;T	0.26067	1.76;1.76;1.76;1.76;1.76	4.97	-0.167	0.13347	.	0.806182	0.11408	N	0.567045	T	0.27933	0.0688	M	0.62723	1.935	0.45390	D	0.998374	B;P	0.37276	0.358;0.589	B;B	0.42422	0.299;0.387	T	0.21484	-1.0244	10	0.87932	D	0	-0.9809	5.1818	0.15163	0.2442:0.2811:0.4748:0.0	.	15;15	Q9P0W8-2;Q9P0W8	.;SPAT7_HUMAN	I	15	ENSP00000451128:R15I;ENSP00000377176:R15I;ENSP00000348991:R15I;ENSP00000450606:R15I;ENSP00000045347:R15I	ENSP00000045347:R15I	R	+	2	0	SPATA7	87927502	1.000000	0.71417	0.639000	0.29394	0.984000	0.73092	1.596000	0.36718	-0.014000	0.14175	-0.234000	0.12200	AGA	.	G|0.999;C|0.001		0.348	SPATA7-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410172.1		
DUOXA2	405753	hgsc.bcm.edu	37	15	45410034	45410034	+	Missense_Mutation	SNP	C	C	T			TCGA-5C-A9VH-01A-11D-A36X-10	TCGA-5C-A9VH-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	44e358dc-cbf5-4177-89a4-3d0d0fe2ff38	b56ae97e-c498-4223-a583-2b86e313f4bb	g.chr15:45410034C>T	ENST00000323030.5	+	6	1175	c.890C>T	c.(889-891)cCt>cTt	p.P297L	DUOXA1_ENST00000267803.4_Intron|DUOXA1_ENST00000430224.2_Intron|DUOXA1_ENST00000559014.1_Intron|DUOXA1_ENST00000558996.1_3'UTR	NM_207581.3	NP_997464.2	Q1HG44	DOXA2_HUMAN	dual oxidase maturation factor 2	297					hydrogen peroxide metabolic process (GO:0042743)|protein transport (GO:0015031)|regulation of inflammatory response (GO:0050727)|regulation of thyroid hormone generation (GO:2000609)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)							all_cancers(109;5.7e-11)|all_epithelial(112;4.65e-09)|Lung NSC(122;3.55e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)		all cancers(107;2.88e-18)|GBM - Glioblastoma multiforme(94;3.95e-07)|COAD - Colon adenocarcinoma(120;0.0652)|Colorectal(133;0.0659)		GGGGGCTCACCTCTTATCCTC	0.607											OREG0023102	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.P297L		Atlas-SNP	.											.	DUOXA2	38	.	0			c.C890T						.						63.0	71.0	68.0					15																	45410034		2198	4298	6496	SO:0001583	missense	405753	exon6			GCTCACCTCTTAT	BX537581	CCDS10118.2	15q21.1	2008-10-30		2006-07-25	ENSG00000140274	ENSG00000140274			32698	protein-coding gene	gene with protein product		612772				16651268	Standard	NM_207581		Approved		uc001zuo.3	Q1HG44	OTTHUMG00000131354	ENST00000323030.5:c.890C>T	chr15.hg19:g.45410034C>T	ENSP00000319705:p.Pro297Leu	106.0	0.0	931	77.0	39.0	NM_207581	B2RPI9|H0YNQ6	Missense_Mutation	SNP	ENST00000323030.5	hg19	CCDS10118.2	.	.	.	.	.	.	.	.	.	.	C	14.47	2.546483	0.45383	.	.	ENSG00000140274	ENST00000323030	T	0.55760	0.5	5.26	4.34	0.51931	.	0.408629	0.27558	N	0.018821	T	0.28034	0.0691	N	0.08118	0	0.29538	N	0.852329	P	0.40875	0.731	B	0.33750	0.169	T	0.11792	-1.0573	10	0.28530	T	0.3	-5.4342	11.7399	0.51786	0.1756:0.8244:0.0:0.0	.	297	Q1HG44	DOXA2_HUMAN	L	297	ENSP00000319705:P297L	ENSP00000319705:P297L	P	+	2	0	DUOXA2	43197326	0.000000	0.05858	0.039000	0.18376	0.036000	0.12997	0.381000	0.20619	1.336000	0.45506	0.561000	0.74099	CCT	.	.		0.607	DUOXA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254142.1	NM_207581	
CSPG4	1464	hgsc.bcm.edu	37	15	75968199	75968199	+	Missense_Mutation	SNP	T	T	C			TCGA-5C-A9VH-01A-11D-A36X-10	TCGA-5C-A9VH-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	44e358dc-cbf5-4177-89a4-3d0d0fe2ff38	b56ae97e-c498-4223-a583-2b86e313f4bb	g.chr15:75968199T>C	ENST00000308508.5	-	10	6753	c.6661A>G	c.(6661-6663)Aac>Gac	p.N2221D	CTD-2026K11.1_ENST00000569467.1_RNA|AC105020.1_ENST00000435356.1_5'Flank	NM_001897.4	NP_001888.2	Q6UVK1	CSPG4_HUMAN	chondroitin sulfate proteoglycan 4	2221	Cysteine-containing.|Neurite growth inhibition. {ECO:0000250}.				activation of MAPK activity (GO:0000187)|angiogenesis (GO:0001525)|carbohydrate metabolic process (GO:0005975)|cell proliferation (GO:0008283)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|glial cell migration (GO:0008347)|glycosaminoglycan metabolic process (GO:0030203)|intracellular signal transduction (GO:0035556)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|small molecule metabolic process (GO:0044281)|tissue remodeling (GO:0048771)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell projection (GO:0042995)|cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|lysosomal lumen (GO:0043202)	protein kinase binding (GO:0019901)|signal transducer activity (GO:0004871)			breast(1)|cervix(2)|endometrium(5)|kidney(5)|large_intestine(3)|liver(2)|lung(18)|ovary(2)|pancreas(2)|prostate(4)|skin(4)	48						CTGAACATGTTGGCCTCAAGG	0.617																																					p.N2221D		Atlas-SNP	.											.	CSPG4	175	.	0			c.A6661G						.						92.0	89.0	90.0					15																	75968199		2197	4294	6491	SO:0001583	missense	1464	exon10			ACATGTTGGCCTC	X96753, AY359468	CCDS10284.1	15q24.2	2010-04-19	2007-02-16		ENSG00000173546	ENSG00000173546		"""Proteoglycans / Cell surface : Other"""	2466	protein-coding gene	gene with protein product	"""melanoma-associated chondroitin sulfate proteoglycan"""	601172	"""chondroitin sulfate proteoglycan 4 (melanoma-associated)"""			8790396, 16407841	Standard	NM_001897		Approved	MCSPG, MEL-CSPG, MSK16, NG2, MCSP, HMW-MAA	uc002baw.3	Q6UVK1	OTTHUMG00000142836	ENST00000308508.5:c.6661A>G	chr15.hg19:g.75968199T>C	ENSP00000312506:p.Asn2221Asp	38.0	0.0		30.0	9.0	NM_001897	D3DW77|Q92675	Missense_Mutation	SNP	ENST00000308508.5	hg19	CCDS10284.1	.	.	.	.	.	.	.	.	.	.	T	17.30	3.355422	0.61293	.	.	ENSG00000173546	ENST00000308508;ENST00000537176	T	0.20738	2.05	5.33	4.18	0.49190	.	0.077653	0.52532	D	0.000062	T	0.31389	0.0795	L	0.49126	1.545	0.38925	D	0.957817	D	0.67145	0.996	P	0.57204	0.815	T	0.04635	-1.0937	10	0.38643	T	0.18	.	10.6126	0.45432	0.0:0.0:0.3099:0.6901	.	2221	Q6UVK1	CSPG4_HUMAN	D	2221;253	ENSP00000312506:N2221D	ENSP00000312506:N2221D	N	-	1	0	CSPG4	73755254	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	1.418000	0.34782	0.842000	0.35045	0.459000	0.35465	AAC	.	.		0.617	CSPG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286472.1	NM_001897	
GP2	2813	hgsc.bcm.edu	37	16	20335564	20335564	+	Missense_Mutation	SNP	T	T	C			TCGA-5C-A9VH-01A-11D-A36X-10	TCGA-5C-A9VH-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	44e358dc-cbf5-4177-89a4-3d0d0fe2ff38	b56ae97e-c498-4223-a583-2b86e313f4bb	g.chr16:20335564T>C	ENST00000381362.4	-	3	185	c.109A>G	c.(109-111)Att>Gtt	p.I37V	GP2_ENST00000381360.5_Intron|GP2_ENST00000341642.5_Intron|GP2_ENST00000302555.5_Missense_Mutation_p.I37V|GP2_ENST00000573897.1_5'Flank	NM_001007240.1|NM_001502.2	NP_001007241.2|NP_001493.2	P55259	GP2_HUMAN	glycoprotein 2 (zymogen granule membrane)	37					antigen transcytosis by M cells in mucosal-associated lymphoid tissue (GO:0002412)	anchored component of membrane (GO:0031225)|apical plasma membrane (GO:0016324)|extracellular vesicular exosome (GO:0070062)	antigen binding (GO:0003823)			breast(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(25)|ovary(3)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	48						CTGGCTTCAATGGGGTTTCCA	0.522																																					p.I37V		Atlas-SNP	.											.	GP2	122	.	0			c.A109G						.						40.0	38.0	39.0					16																	20335564		2203	4300	6503	SO:0001583	missense	2813	exon3			CTTCAATGGGGTT	U36221	CCDS10582.2, CCDS42128.1, CCDS45432.1, CCDS45433.1	16p12.3	2008-02-05			ENSG00000169347	ENSG00000169347			4441	protein-coding gene	gene with protein product		602977				9605860	Standard	XM_005255259		Approved		uc002dgw.3	P55259	OTTHUMG00000131489	ENST00000381362.4:c.109A>G	chr16.hg19:g.20335564T>C	ENSP00000370767:p.Ile37Val	199.0	0.0		143.0	65.0	NM_001502	A6NFM9|A6NJA8|Q13338|Q9UIF1	Missense_Mutation	SNP	ENST00000381362.4	hg19	CCDS42128.1	.	.	.	.	.	.	.	.	.	.	t	5.609	0.297047	0.10622	.	.	ENSG00000169347	ENST00000302555;ENST00000381362	D;D	0.99226	-5.59;-5.59	4.78	-9.56	0.00566	.	.	.	.	.	D	0.93572	0.7948	N	0.08118	0	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.09377	0.004;0.0	D	0.90471	0.4453	9	0.18710	T	0.47	9.8097	2.3862	0.04366	0.2586:0.212:0.399:0.1304	.	37;37	P55259-3;P55259	.;GP2_HUMAN	V	37	ENSP00000304044:I37V;ENSP00000370767:I37V	ENSP00000304044:I37V	I	-	1	0	GP2	20243065	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-2.459000	0.01000	-2.245000	0.00705	-1.325000	0.01285	ATT	.	.		0.522	GP2-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000436920.1	NM_016295	
ITFG1	81533	hgsc.bcm.edu	37	16	47292650	47292650	+	Splice_Site	SNP	C	C	A			TCGA-5C-A9VH-01A-11D-A36X-10	TCGA-5C-A9VH-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	44e358dc-cbf5-4177-89a4-3d0d0fe2ff38	b56ae97e-c498-4223-a583-2b86e313f4bb	g.chr16:47292650C>A	ENST00000320640.6	-	12	1451	c.1223G>T	c.(1222-1224)gGa>gTa	p.G408V	ITFG1_ENST00000568047.1_5'UTR|ITFG1_ENST00000544001.2_Splice_Site_p.G295V	NM_030790.3	NP_110417.2	Q8TB96	TIP_HUMAN	integrin alpha FG-GAP repeat containing 1	408						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(2)|kidney(1)|large_intestine(2)|lung(7)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(1)	19		all_cancers(37;0.0613)|all_lung(18;0.0543)|Lung NSC(13;0.227)				GTCCAAGATTCCCTGGAAAAA	0.274																																					p.G408V		Atlas-SNP	.											.	ITFG1	49	.	0			c.G1223T						.						63.0	64.0	63.0					16																	47292650		2200	4296	6496	SO:0001630	splice_region_variant	81533	exon12			AAGATTCCCTGGA	AF503339	CCDS10728.1	16q12.1	2008-02-05			ENSG00000129636	ENSG00000129636			30697	protein-coding gene	gene with protein product	"""T cell immunomodulatory protein"""	611803				12598909	Standard	NM_030790		Approved	CDA08, TIP	uc002eet.3	Q8TB96	OTTHUMG00000133103	ENST00000320640.6:c.1222-1G>T	chr16.hg19:g.47292650C>A		40.0	0.0		42.0	8.0	NM_030790	Q96SR4|Q9BRE2|Q9H2V9	Missense_Mutation	SNP	ENST00000320640.6	hg19	CCDS10728.1	.	.	.	.	.	.	.	.	.	.	C	23.7	4.451052	0.84209	.	.	ENSG00000129636	ENST00000320640;ENST00000537184;ENST00000542691;ENST00000544001	T;T	0.80824	-1.42;0.6	5.44	5.44	0.79542	.	0.000000	0.85682	D	0.000000	D	0.91670	0.7367	M	0.88704	2.975	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.998;1.0	D	0.92720	0.6190	10	0.87932	D	0	-0.4478	19.2105	0.93753	0.0:1.0:0.0:0.0	.	295;408	F5GXC5;Q8TB96	.;TIP_HUMAN	V	408;68;153;295	ENSP00000319918:G408V;ENSP00000441062:G295V	ENSP00000319918:G408V	G	-	2	0	ITFG1	45850151	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	7.330000	0.79181	2.712000	0.92718	0.585000	0.79938	GGA	.	.		0.274	ITFG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256768.3	NM_030790	Missense_Mutation
VPS4A	27183	hgsc.bcm.edu	37	16	69356497	69356497	+	Missense_Mutation	SNP	T	T	C			TCGA-5C-A9VH-01A-11D-A36X-10	TCGA-5C-A9VH-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	44e358dc-cbf5-4177-89a4-3d0d0fe2ff38	b56ae97e-c498-4223-a583-2b86e313f4bb	g.chr16:69356497T>C	ENST00000254950.11	+	10	1262	c.1106T>C	c.(1105-1107)aTg>aCg	p.M369T	COG8_ENST00000564419.1_Intron	NM_013245.2	NP_037377.1			vacuolar protein sorting 4 homolog A (S. cerevisiae)											NS(1)|central_nervous_system(1)|large_intestine(2)|lung(3)	7		Ovarian(137;0.101)				CCCAGCATGATGATTGATGAC	0.587																																					p.M369T		Atlas-SNP	.											.	VPS4A	18	.	0			c.T1106C						.						85.0	88.0	87.0					16																	69356497		2058	4222	6280	SO:0001583	missense	27183	exon10			GCATGATGATTGA	AF112215	CCDS45517.1	16q23.1	2010-04-21	2006-04-04		ENSG00000132612	ENSG00000132612		"""ATPases / AAA-type"""	13488	protein-coding gene	gene with protein product		609982	"""vacuolar protein sorting 4A (yeast homolog)"", ""vacuolar protein sorting 4A (yeast)"""			10637304, 11563910	Standard	NM_013245		Approved	VPS4, VPS4-1, FLJ22197, SKD2, SKD1, SKD1A	uc002eww.3	Q9UN37		ENST00000254950.11:c.1106T>C	chr16.hg19:g.69356497T>C	ENSP00000254950:p.Met369Thr	85.0	0.0		64.0	5.0	NM_013245		Missense_Mutation	SNP	ENST00000254950.11	hg19	CCDS45517.1	.	.	.	.	.	.	.	.	.	.	T	0.217	-1.031696	0.02029	.	.	ENSG00000132612	ENST00000254950	D	0.94687	-3.49	5.62	4.52	0.55395	.	0.202829	0.64402	N	0.000016	D	0.83732	0.5318	N	0.05199	-0.095	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.74842	-0.3527	10	0.08179	T	0.78	-13.6267	8.6393	0.33968	0.0:0.1558:0.0:0.8442	.	369	Q9UN37	VPS4A_HUMAN	T	369	ENSP00000254950:M369T	ENSP00000254950:M369T	M	+	2	0	VPS4A	67913998	0.956000	0.32656	0.975000	0.42487	0.022000	0.10575	2.605000	0.46283	0.949000	0.37715	-0.290000	0.09829	ATG	.	.		0.587	VPS4A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000430563.3	NM_013245	
PKD1L2	114780	hgsc.bcm.edu	37	16	81232485	81232485	+	RNA	SNP	A	A	G			TCGA-5C-A9VH-01A-11D-A36X-10	TCGA-5C-A9VH-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	44e358dc-cbf5-4177-89a4-3d0d0fe2ff38	b56ae97e-c498-4223-a583-2b86e313f4bb	g.chr16:81232485A>G	ENST00000525539.1	-	0	1324				PKD1L2_ENST00000337114.4_RNA	NM_052892.3	NP_443124.3	Q7Z442	PK1L2_HUMAN	polycystic kidney disease 1-like 2						ion transport (GO:0006811)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)			breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(20)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	44						GTGGACTGTAATGTTTCTGGA	0.557																																					p.I442T		Atlas-SNP	.											.	PKD1L2	361	.	0			c.T1325C						.						176.0	181.0	179.0					16																	81232485		1991	4143	6134			114780	exon7			ACTGTAATGTTTC	AY164483	CCDS61998.1, CCDS61999.1	16q23.2	2014-09-11			ENSG00000166473	ENSG00000166473			21715	protein-coding gene	gene with protein product		607894				12782129	Standard	NM_052892		Approved	KIAA1879	uc002fgf.1	Q7Z442	OTTHUMG00000166126		chr16.hg19:g.81232485A>G		191.0	0.0		145.0	43.0	NM_001076780	Q6UEE1|Q6ZN46|Q6ZSP2|Q8N1H9|Q96CL2|Q96Q08	Missense_Mutation	SNP	ENST00000525539.1	hg19		.	.	.	.	.	.	.	.	.	.	A	10.32	1.316534	0.23908	.	.	ENSG00000166473	ENST00000337114	T	0.01455	4.87	4.98	4.98	0.66077	Egg jelly receptor, REJ-like (1);	0.573831	0.17233	N	0.181845	T	0.03263	0.0095	.	.	.	0.21740	N	0.999564	P;B	0.35272	0.493;0.361	B;B	0.39258	0.295;0.036	T	0.33137	-0.9880	9	0.87932	D	0	-5.6646	14.6886	0.69068	1.0:0.0:0.0:0.0	.	442;442	Q7Z442-3;Q7Z442	.;PK1L2_HUMAN	T	442	ENSP00000337397:I442T	ENSP00000337397:I442T	I	-	2	0	PKD1L2	79789986	0.979000	0.34478	0.032000	0.17829	0.010000	0.07245	6.830000	0.75319	1.884000	0.54569	0.448000	0.29417	ATT	.	.		0.557	PKD1L2-001	KNOWN	non_canonical_polymorphism|basic	polymorphic_pseudogene	polymorphic_pseudogene	OTTHUMT00000387972.2		
ATAD5	79915	hgsc.bcm.edu	37	17	29162604	29162604	+	Missense_Mutation	SNP	A	A	G			TCGA-5C-A9VH-01A-11D-A36X-10	TCGA-5C-A9VH-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	44e358dc-cbf5-4177-89a4-3d0d0fe2ff38	b56ae97e-c498-4223-a583-2b86e313f4bb	g.chr17:29162604A>G	ENST00000321990.4	+	2	1883	c.1505A>G	c.(1504-1506)aAg>aGg	p.K502R	CTD-2349P21.11_ENST00000580873.1_RNA	NM_024857.3	NP_079133.3	Q96QE3	ATAD5_HUMAN	ATPase family, AAA domain containing 5	502					cellular response to DNA damage stimulus (GO:0006974)	nucleus (GO:0005634)	ATP binding (GO:0005524)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(8)|kidney(3)|large_intestine(18)|lung(13)|ovary(3)|pancreas(1)	51		all_hematologic(16;0.0202)|Acute lymphoblastic leukemia(14;0.0238)|Myeloproliferative disorder(56;0.0393)				AACACTCAAAAGAAAGAAACA	0.303																																					p.K502R		Atlas-SNP	.											.	ATAD5	150	.	0			c.A1505G						.						52.0	60.0	57.0					17																	29162604		2202	4295	6497	SO:0001583	missense	79915	exon2			CTCAAAAGAAAGA		CCDS11260.1	17q11.2	2010-04-21	2007-02-08	2007-02-08	ENSG00000176208	ENSG00000176208		"""ATPases / AAA-type"""	25752	protein-coding gene	gene with protein product	"""enhanced level of genomic instability 1 homolog (S. cerevisiae)"""	609534	"""chromosome 17 open reading frame 41"""	C17orf41		15983387, 11468690, 19755857	Standard	NM_024857		Approved	FLJ12735, FRAG1, ELG1	uc002hfs.1	Q96QE3	OTTHUMG00000132794	ENST00000321990.4:c.1505A>G	chr17.hg19:g.29162604A>G	ENSP00000313171:p.Lys502Arg	240.0	0.0		205.0	87.0	NM_024857	Q05DH0|Q69YR6|Q9H9I1	Missense_Mutation	SNP	ENST00000321990.4	hg19	CCDS11260.1	.	.	.	.	.	.	.	.	.	.	A	7.096	0.573139	0.13623	.	.	ENSG00000176208	ENST00000321990	T	0.09723	2.95	5.85	0.743	0.18347	.	0.649731	0.14873	N	0.293452	T	0.08492	0.0211	L	0.53249	1.67	0.09310	N	1	B;P	0.36222	0.418;0.544	B;B	0.33521	0.165;0.079	T	0.25779	-1.0122	10	0.51188	T	0.08	.	1.6687	0.02807	0.333:0.1141:0.1114:0.4415	.	502;502	Q96QE3-2;Q96QE3	.;ATAD5_HUMAN	R	502	ENSP00000313171:K502R	ENSP00000313171:K502R	K	+	2	0	ATAD5	26186730	0.087000	0.21565	0.845000	0.33349	0.852000	0.48524	0.711000	0.25764	0.410000	0.25675	0.533000	0.62120	AAG	.	.		0.303	ATAD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256206.2	NM_024857	
PIGW	284098	hgsc.bcm.edu	37	17	34893442	34893442	+	Silent	SNP	A	A	G			TCGA-5C-A9VH-01A-11D-A36X-10	TCGA-5C-A9VH-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	44e358dc-cbf5-4177-89a4-3d0d0fe2ff38	b56ae97e-c498-4223-a583-2b86e313f4bb	g.chr17:34893442A>G	ENST00000592983.1	+	2	1072	c.492A>G	c.(490-492)acA>acG	p.T164T	MYO19_ENST00000590081.1_Intron|MYO19_ENST00000544606.1_5'Flank|MYO19_ENST00000268852.9_5'Flank|MYO19_ENST00000431794.3_5'Flank|PIGW_ENST00000328396.2_Silent_p.T164T|MYO19_ENST00000586007.1_5'Flank			Q7Z7B1	PIGW_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class W	164					C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|preassembly of GPI anchor in ER membrane (GO:0016254)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	transferase activity, transferring acyl groups (GO:0016746)			breast(2)|endometrium(3)|kidney(1)|large_intestine(1)|lung(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	13		Breast(25;0.00957)|Ovarian(249;0.17)	Kidney(155;0.104)	UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		TCTATGGGACAGGAGCAATGG	0.433																																					p.T164T		Atlas-SNP	.											.	PIGW	50	.	0			c.A492G						.						207.0	216.0	213.0					17																	34893442		2203	4300	6503	SO:0001819	synonymous_variant	284098	exon2			TGGGACAGGAGCA	AB097818	CCDS11313.1	17q21.1	2014-05-06	2006-06-28		ENSG00000184886	ENSG00000277161		"""Phosphatidylinositol glycan anchor biosynthesis"""	23213	protein-coding gene	gene with protein product		610275	"""phosphatidylinositol glycan, class W"""			14517336, 12714589	Standard	XM_005257238		Approved	Gwt1, FLJ37433	uc002hmz.1	Q7Z7B1	OTTHUMG00000188438	ENST00000592983.1:c.492A>G	chr17.hg19:g.34893442A>G		135.0	0.0		102.0	32.0	NM_178517	Q8N9G3	Silent	SNP	ENST00000592983.1	hg19	CCDS11313.1																																																																																			.	.		0.433	PIGW-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451318.1	NM_178517	
SOCS7	30837	hgsc.bcm.edu	37	17	36508540	36508541	+	Missense_Mutation	DNP	GC	GC	AG			TCGA-5C-A9VH-01A-11D-A36X-10	TCGA-5C-A9VH-10A-01D-A370-10	G|C	G|C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	44e358dc-cbf5-4177-89a4-3d0d0fe2ff38	b56ae97e-c498-4223-a583-2b86e313f4bb	g.chr17:36508540_36508541GC>AG	ENST00000577233.1	+	1	413_414	c.413_414GC>AG	c.(412-414)aGC>aAG	p.S138K	SOCS7_ENST00000331159.5_Missense_Mutation_p.S138K	NM_014598.2	NP_055413.1	O14512	SOCS7_HUMAN	suppressor of cytokine signaling 7	138	Mediates interaction with SORBS3.				fat cell differentiation (GO:0045444)|insulin receptor signaling pathway (GO:0008286)|intracellular signal transduction (GO:0035556)|negative regulation of signal transduction (GO:0009968)|protein ubiquitination (GO:0016567)|regulation of growth (GO:0040008)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	SH3 domain binding (GO:0017124)			central_nervous_system(1)|endometrium(1)|kidney(1)|prostate(1)|skin(5)	9	Breast(7;3.47e-17)					GAGGAGCTCAGCAGCCCGGGTC	0.683																																					p.S138N|p.S138R		Atlas-SNP	.											.	SOCS7	22	.	0			c.G413A|c.C414G						.																																			SO:0001583	missense	30837	exon1			AGCTCAGCAGCCC|GCTCAGCAGCCCG	AB005216	CCDS32637.1	17q12	2014-08-12			ENSG00000274211	ENSG00000274211		"""Suppressors of cytokine signaling"", ""SH2 domain containing"""	29846	protein-coding gene	gene with protein product	"""Nck, Ash and phospholipase C binding protein"", ""NCK-associated protein 4"""	608788				9344857, 12076535	Standard	XM_005257264		Approved	NAP4, NCKAP4	uc002hqa.3	O14512	OTTHUMG00000188546	Exception_encountered	chr17.hg19:g.36508540_36508541delinsAG	ENSP00000464034:p.Ser138Lys	217.0|220.0	0.0		194.0|189.0	81.0|80.0	NM_014598	A2VCU2|Q0IJ63	Missense_Mutation	SNP	ENST00000577233.1	hg19	CCDS32637.1																																																																																			.	.		0.683	SOCS7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440486.4	XM_371052	
BRCA1	672	hgsc.bcm.edu	37	17	41246777	41246777	+	Silent	SNP	A	A	G			TCGA-5C-A9VH-01A-11D-A36X-10	TCGA-5C-A9VH-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	44e358dc-cbf5-4177-89a4-3d0d0fe2ff38	b56ae97e-c498-4223-a583-2b86e313f4bb	g.chr17:41246777A>G	ENST00000357654.3	-	10	889	c.771T>C	c.(769-771)caT>caC	p.H257H	BRCA1_ENST00000346315.3_Silent_p.H257H|BRCA1_ENST00000493795.1_Silent_p.H210H|BRCA1_ENST00000586385.1_Intron|BRCA1_ENST00000491747.2_Silent_p.H257H|BRCA1_ENST00000352993.3_Intron|BRCA1_ENST00000591534.1_Intron|BRCA1_ENST00000471181.2_Silent_p.H257H|BRCA1_ENST00000309486.4_5'UTR|BRCA1_ENST00000468300.1_Silent_p.H257H|BRCA1_ENST00000354071.3_Silent_p.H257H|BRCA1_ENST00000351666.3_Intron|BRCA1_ENST00000591849.1_Intron	NM_007294.3	NP_009225.1	P38398	BRCA1_HUMAN	breast cancer 1, early onset	257					androgen receptor signaling pathway (GO:0030521)|apoptotic process (GO:0006915)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to indole-3-methanol (GO:0071681)|cellular response to tumor necrosis factor (GO:0071356)|chromosome segregation (GO:0007059)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|fatty acid biosynthetic process (GO:0006633)|G2 DNA damage checkpoint (GO:0031572)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of centriole replication (GO:0046600)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of fatty acid biosynthetic process (GO:0045717)|negative regulation of histone H3-K9 methylation (GO:0051573)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of DNA repair (GO:0045739)|positive regulation of gene expression (GO:0010628)|positive regulation of histone acetylation (GO:0035066)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of histone H3-K9 acetylation (GO:2000617)|positive regulation of histone H4-K16 acetylation (GO:2000620)|positive regulation of histone H4-K20 methylation (GO:0070512)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation vascular endothelial growth factor production (GO:0010575)|postreplication repair (GO:0006301)|protein autoubiquitination (GO:0051865)|protein K6-linked ubiquitination (GO:0085020)|protein ubiquitination (GO:0016567)|regulation of apoptotic process (GO:0042981)|regulation of cell proliferation (GO:0042127)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|response to estrogen (GO:0043627)|response to ionizing radiation (GO:0010212)	BRCA1-A complex (GO:0070531)|BRCA1-BARD1 complex (GO:0031436)|chromosome (GO:0005694)|cytoplasm (GO:0005737)|gamma-tubulin ring complex (GO:0008274)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|ribonucleoprotein complex (GO:0030529)|ubiquitin ligase complex (GO:0000151)	androgen receptor binding (GO:0050681)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|ligase activity (GO:0016874)|RNA binding (GO:0003723)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)|tubulin binding (GO:0015631)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(30)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(7)|lung(28)|ovary(36)|skin(2)|stomach(4)|urinary_tract(2)	120		Breast(137;0.000717)		BRCA - Breast invasive adenocarcinoma(366;0.126)		ACTTTTCTGGATGCCTCTCAG	0.423			"""D, Mis, N, F, S"""		ovarian	"""breast, ovarian"""		Homologous recombination	Hereditary Breast-Ovarian Cancer, BRCA1 type	TCGA Ovarian(2;0.000030)																											p.H257H		Atlas-SNP	.	yes	Rec	yes	Hereditary breast/ovarian cancer	17	17q21	672	familial breast/ovarian cancer gene 1		E	.	BRCA1	304	.	0			c.T771C						.						97.0	89.0	92.0					17																	41246777		2203	4300	6503	SO:0001819	synonymous_variant	672	exon9	Familial Cancer Database		TTCTGGATGCCTC	U14680	CCDS11453.1, CCDS11454.1, CCDS11455.1, CCDS11456.1, CCDS11459.1, CCDS11455.2, CCDS11456.2, CCDS11459.2, CCDS11454.2	17q21.31	2014-09-17			ENSG00000012048	ENSG00000012048		"""RING-type (C3HC4) zinc fingers"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	1100	protein-coding gene	gene with protein product	"""BRCA1/BRCA2-containing complex, subunit 1"", ""protein phosphatase 1, regulatory subunit 53"""	113705				1676470	Standard	NM_007300		Approved	RNF53, BRCC1, PPP1R53	uc002ict.3	P38398	OTTHUMG00000157426	ENST00000357654.3:c.771T>C	chr17.hg19:g.41246777A>G		71.0	0.0		53.0	25.0	NM_007298	O15129|Q1RMC1|Q3LRJ0|Q3LRJ6|Q6IN79|Q7KYU9	Silent	SNP	ENST00000357654.3	hg19	CCDS11453.1	.	.	.	.	.	.	.	.	.	.	A	6.620	0.482881	0.12581	.	.	ENSG00000012048	ENST00000473961	.	.	.	4.73	4.73	0.59995	.	.	.	.	.	T	0.61035	0.2315	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.59511	-0.7441	4	.	.	.	.	10.1432	0.42747	0.8328:0.1672:0.0:0.0	.	.	.	.	T	123	.	.	I	-	2	0	BRCA1	38500303	0.998000	0.40836	1.000000	0.80357	0.992000	0.81027	2.912000	0.48782	2.116000	0.64780	0.533000	0.62120	ATC	.	.		0.423	BRCA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348798.2	NM_007294	
HELZ	9931	hgsc.bcm.edu	37	17	65174829	65174829	+	Missense_Mutation	SNP	C	C	G			TCGA-5C-A9VH-01A-11D-A36X-10	TCGA-5C-A9VH-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	44e358dc-cbf5-4177-89a4-3d0d0fe2ff38	b56ae97e-c498-4223-a583-2b86e313f4bb	g.chr17:65174829C>G	ENST00000358691.5	-	13	1542	c.1376G>C	c.(1375-1377)cGg>cCg	p.R459P	HELZ_ENST00000580168.1_Missense_Mutation_p.R459P	NM_014877.3	NP_055692	P42694	HELZ_HUMAN	helicase with zinc finger	459						membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)	p.R459L(1)		NS(1)|breast(5)|endometrium(9)|kidney(3)|large_intestine(11)|liver(1)|lung(24)|ovary(1)|pancreas(1)|prostate(1)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(2)	69	all_cancers(12;1.24e-11)|Breast(2;1.05e-17)|all_epithelial(3;3.87e-13)					GTCATGTAACCGTGACTGATA	0.378																																					p.R459P		Atlas-SNP	.											HELZ,NS,carcinoma,0,2	HELZ	160	.	1	Substitution - Missense(1)	kidney(1)	c.G1376C						.						121.0	115.0	117.0					17																	65174829		1853	4101	5954	SO:0001583	missense	9931	exon13			TGTAACCGTGACT	D29677	CCDS42374.1	17q24.2	2013-01-18			ENSG00000198265	ENSG00000198265		"""Zinc fingers, CCCH-type domain containing"""	16878	protein-coding gene	gene with protein product	"""down-regulated in human cancers"""	606699				10471385, 12691822	Standard	NM_014877		Approved	KIAA0054, HUMORF5, DHRC	uc002jfx.4	P42694	OTTHUMG00000179555	ENST00000358691.5:c.1376G>C	chr17.hg19:g.65174829C>G	ENSP00000351524:p.Arg459Pro	126.0	0.0		78.0	21.0	NM_014877	I6L9H4	Missense_Mutation	SNP	ENST00000358691.5	hg19	CCDS42374.1	.	.	.	.	.	.	.	.	.	.	C	16.19	3.054269	0.55218	.	.	ENSG00000198265	ENST00000358691	D	0.86030	-2.06	6.07	6.07	0.98685	.	0.000000	0.85682	D	0.000000	D	0.92688	0.7676	M	0.76574	2.34	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.78314	0.991;0.983	D	0.92372	0.5906	10	0.87932	D	0	-20.6865	20.6525	0.99598	0.0:1.0:0.0:0.0	.	459;459	B7ZLW2;P42694	.;HELZ_HUMAN	P	459	ENSP00000351524:R459P	ENSP00000351524:R459P	R	-	2	0	HELZ	62605291	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.385000	0.79763	2.890000	0.99128	0.585000	0.79938	CGG	.	.		0.378	HELZ-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000447068.1	NM_014877	
CBX4	8535	hgsc.bcm.edu	37	17	77808906	77808906	+	Nonsense_Mutation	SNP	C	C	A			TCGA-5C-A9VH-01A-11D-A36X-10	TCGA-5C-A9VH-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	44e358dc-cbf5-4177-89a4-3d0d0fe2ff38	b56ae97e-c498-4223-a583-2b86e313f4bb	g.chr17:77808906C>A	ENST00000269397.4	-	5	712	c.535G>T	c.(535-537)Gag>Tag	p.E179*	CBX4_ENST00000448310.1_3'UTR	NM_003655.2	NP_003646.2	O00257	CBX4_HUMAN	chromobox homolog 4	179	Interaction with BMI1.				chromatin modification (GO:0016568)|negative regulation of apoptotic process (GO:0043066)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|protein sumoylation (GO:0016925)|transcription, DNA-templated (GO:0006351)	nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)	chromatin binding (GO:0003682)|enzyme binding (GO:0019899)|ligase activity (GO:0016874)|single-stranded RNA binding (GO:0003727)|SUMO binding (GO:0032183)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|cervix(1)|endometrium(1)|large_intestine(1)|lung(7)|ovary(1)|prostate(3)|skin(2)|urinary_tract(1)	18			OV - Ovarian serous cystadenocarcinoma(97;0.0102)|BRCA - Breast invasive adenocarcinoma(99;0.0224)			CTGGGCGCCTCCTTGTGGCCG	0.662											OREG0024799	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.E179X		Atlas-SNP	.											.	CBX4	40	.	0			c.G535T						.						56.0	58.0	57.0					17																	77808906		2203	4300	6503	SO:0001587	stop_gained	8535	exon5			GCGCCTCCTTGTG	AF013956	CCDS32758.1	17q25.3	2010-07-06	2010-06-24		ENSG00000141582	ENSG00000141582			1554	protein-coding gene	gene with protein product	"""NS5ATP1-binding protein 16"", ""Pc class 2 homolog (Drosophila)"""	603079	"""chromobox homolog 4 (Drosophila Pc class)"""			9315667	Standard	NM_003655		Approved	hPC2, PC2, NBP16	uc002jxe.3	O00257	OTTHUMG00000150415	ENST00000269397.4:c.535G>T	chr17.hg19:g.77808906C>A	ENSP00000269397:p.Glu179*	61.0	0.0	1178	49.0	17.0	NM_003655	B1PJR7|Q6TPI8|Q96C04	Nonsense_Mutation	SNP	ENST00000269397.4	hg19	CCDS32758.1	.	.	.	.	.	.	.	.	.	.	c	37	6.078027	0.97262	.	.	ENSG00000141582	ENST00000269397	.	.	.	4.16	4.16	0.48862	.	0.303964	0.25511	U	0.030180	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.22706	T	0.39	0.2304	16.4918	0.84203	0.0:1.0:0.0:0.0	.	.	.	.	X	179	.	ENSP00000269397:E179X	E	-	1	0	CBX4	75423501	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	5.437000	0.66544	1.891000	0.54761	0.298000	0.19748	GAG	.	.		0.662	CBX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318007.1	NM_003655	
SMAD4	4089	hgsc.bcm.edu	37	18	48604747	48604747	+	Missense_Mutation	SNP	C	C	G			TCGA-5C-A9VH-01A-11D-A36X-10	TCGA-5C-A9VH-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	44e358dc-cbf5-4177-89a4-3d0d0fe2ff38	b56ae97e-c498-4223-a583-2b86e313f4bb	g.chr18:48604747C>G	ENST00000342988.3	+	12	2107	c.1569C>G	c.(1567-1569)tgC>tgG	p.C523W	SMAD4_ENST00000588745.1_Missense_Mutation_p.C427W|SMAD4_ENST00000586253.1_3'UTR|SMAD4_ENST00000398417.2_Missense_Mutation_p.C523W	NM_005359.5	NP_005350.1	Q13485	SMAD4_HUMAN	SMAD family member 4	523	MH2. {ECO:0000255|PROSITE- ProRule:PRU00439}.				atrioventricular canal development (GO:0036302)|atrioventricular valve formation (GO:0003190)|axon guidance (GO:0007411)|BMP signaling pathway (GO:0030509)|brainstem development (GO:0003360)|branching involved in ureteric bud morphogenesis (GO:0001658)|cardiac septum development (GO:0003279)|cell proliferation (GO:0008283)|developmental growth (GO:0048589)|endocardial cell differentiation (GO:0060956)|endoderm development (GO:0007492)|endothelial cell activation (GO:0042118)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|formation of anatomical boundary (GO:0048859)|gastrulation with mouth forming second (GO:0001702)|gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|intracellular signal transduction (GO:0035556)|mesoderm development (GO:0007498)|metanephric mesenchyme morphogenesis (GO:0072133)|negative regulation of cell death (GO:0060548)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephrogenic mesenchyme morphogenesis (GO:0072134)|neural crest cell differentiation (GO:0014033)|neuron fate commitment (GO:0048663)|palate development (GO:0060021)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cell proliferation involved in heart valve morphogenesis (GO:0003251)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of SMAD protein import into nucleus (GO:0060391)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|regulation of binding (GO:0051098)|regulation of hair follicle development (GO:0051797)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|regulation of transforming growth factor beta2 production (GO:0032909)|response to hypoxia (GO:0001666)|response to transforming growth factor beta (GO:0071559)|sebaceous gland development (GO:0048733)|SMAD protein complex assembly (GO:0007183)|SMAD protein signal transduction (GO:0060395)|somite rostral/caudal axis specification (GO:0032525)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	activin responsive factor complex (GO:0032444)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMAD protein complex (GO:0071141)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|I-SMAD binding (GO:0070411)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|R-SMAD binding (GO:0070412)|RNA polymerase II transcription factor binding transcription factor activity (GO:0001076)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|transforming growth factor beta receptor, common-partner cytoplasmic mediator activity (GO:0030616)	p.0?(36)|p.C523W(2)|p.?(2)		NS(2)|biliary_tract(19)|breast(9)|central_nervous_system(2)|endometrium(2)|gastrointestinal_tract_(site_indeterminate)(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(142)|liver(2)|lung(27)|oesophagus(4)|ovary(7)|pancreas(180)|prostate(3)|skin(1)|small_intestine(9)|stomach(5)|testis(2)|thyroid(19)|upper_aerodigestive_tract(10)|urinary_tract(2)|vulva(1)	454		all_cancers(7;0.203)|Colorectal(6;0.003)|all_epithelial(6;0.00336)		Colorectal(16;0.0032)|COAD - Colon adenocarcinoma(17;0.0708)|READ - Rectum adenocarcinoma(32;0.155)		AAACACCTTGCTGGATTGAAA	0.478																																					p.C523W		Atlas-SNP	.											SMAD4,NS,carcinoma,0,3	SMAD4	822	.	40	Whole gene deletion(36)|Substitution - Missense(2)|Unknown(2)	pancreas(27)|large_intestine(3)|breast(3)|stomach(2)|lung(2)|upper_aerodigestive_tract(1)|biliary_tract(1)|oesophagus(1)	c.C1569G						.						93.0	90.0	91.0					18																	48604747		2203	4300	6503	SO:0001583	missense	4089	exon12			ACCTTGCTGGATT	U44378	CCDS11950.1	18q21.1	2014-09-17	2006-11-06	2004-05-26	ENSG00000141646	ENSG00000141646		"""SMADs"""	6770	protein-coding gene	gene with protein product		600993	"""MAD, mothers against decapentaplegic homolog 4 (Drosophila)"", ""SMAD, mothers against DPP homolog 4 (Drosophila)"""	MADH4		8553070, 8774881	Standard	NM_005359		Approved	DPC4	uc010xdp.2	Q13485	OTTHUMG00000132696	ENST00000342988.3:c.1569C>G	chr18.hg19:g.48604747C>G	ENSP00000341551:p.Cys523Trp	103.0	0.0		52.0	33.0	NM_005359	A8K405	Missense_Mutation	SNP	ENST00000342988.3	hg19	CCDS11950.1	.	.	.	.	.	.	.	.	.	.	C	13.63	2.295153	0.40594	.	.	ENSG00000141646	ENST00000342988;ENST00000398417	D;D	0.98264	-4.83;-4.83	6.08	3.39	0.38822	SMAD domain-like (1);SMAD/FHA domain (1);SMAD domain, Dwarfin-type (3);	0.085248	0.85682	D	0.000000	D	0.99029	0.9668	H	0.95539	3.685	0.80722	D	1	D	0.64830	0.994	D	0.64595	0.927	D	0.98837	1.0753	10	0.87932	D	0	.	9.9615	0.41699	0.0:0.7371:0.0:0.2629	.	523	Q13485	SMAD4_HUMAN	W	523	ENSP00000341551:C523W;ENSP00000381452:C523W	ENSP00000341551:C523W	C	+	3	2	SMAD4	46858745	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	1.497000	0.35649	0.475000	0.27415	0.655000	0.94253	TGC	.	.		0.478	SMAD4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255993.3	NM_005359	
CTDP1	9150	hgsc.bcm.edu	37	18	77474844	77474844	+	Missense_Mutation	SNP	A	A	T			TCGA-5C-A9VH-01A-11D-A36X-10	TCGA-5C-A9VH-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	44e358dc-cbf5-4177-89a4-3d0d0fe2ff38	b56ae97e-c498-4223-a583-2b86e313f4bb	g.chr18:77474844A>T	ENST00000299543.7	+	8	1531	c.1384A>T	c.(1384-1386)Agt>Tgt	p.S462C	CTDP1_ENST00000075430.7_Missense_Mutation_p.S462C	NM_001202504.1|NM_004715.4	NP_001189433.1|NP_004706.3	Q9Y5B0	CTDP1_HUMAN	CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) phosphatase, subunit 1	462	Ser-rich.				exit from mitosis (GO:0010458)|gene expression (GO:0010467)|positive regulation of viral transcription (GO:0050434)|protein dephosphorylation (GO:0006470)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	actin cytoskeleton (GO:0015629)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|midbody (GO:0030496)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)|spindle midzone (GO:0051233)|spindle pole (GO:0000922)	CTD phosphatase activity (GO:0008420)|DNA-directed RNA polymerase activity (GO:0003899)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(14)|ovary(2)|prostate(2)|urinary_tract(1)	35		Esophageal squamous(42;0.0157)|Melanoma(33;0.144)		OV - Ovarian serous cystadenocarcinoma(15;5.2e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0277)		CGAGAGCAGCAGTGAGTCCGA	0.677																																					p.S462C		Atlas-SNP	.											.	CTDP1	67	.	0			c.A1384T						.						13.0	14.0	13.0					18																	77474844		2186	4277	6463	SO:0001583	missense	9150	exon8			AGCAGCAGTGAGT	AF081287	CCDS12017.1, CCDS12018.1, CCDS74239.1	18q23	2014-09-17			ENSG00000060069	ENSG00000060069		"""Serine/threonine phosphatases / CTD aspartate-based phosphatases"""	2498	protein-coding gene	gene with protein product		604927				9405607, 9765293	Standard	NM_004715		Approved	FCP1	uc002lnh.2	Q9Y5B0	OTTHUMG00000132920	ENST00000299543.7:c.1384A>T	chr18.hg19:g.77474844A>T	ENSP00000299543:p.Ser462Cys	152.0	0.0		58.0	31.0	NM_004715	A8MY97|Q7Z644|Q96BZ1|Q9Y6F5	Missense_Mutation	SNP	ENST00000299543.7	hg19	CCDS12017.1	.	.	.	.	.	.	.	.	.	.	A	11.81	1.748712	0.30955	.	.	ENSG00000060069	ENST00000299543;ENST00000075430	T;T	0.11604	2.76;2.76	3.1	1.87	0.25490	.	1.094360	0.06762	N	0.781942	T	0.15219	0.0367	L	0.39898	1.24	0.21967	N	0.999445	P;D;P	0.63046	0.954;0.992;0.923	P;P;B	0.53146	0.54;0.719;0.338	T	0.18935	-1.0321	10	0.59425	D	0.04	-0.3262	3.6391	0.08160	0.5782:0.2005:0.2213:0.0	.	343;462;462	Q9Y5B0-3;Q9Y5B0-4;Q9Y5B0	.;.;CTDP1_HUMAN	C	462	ENSP00000299543:S462C;ENSP00000075430:S462C	ENSP00000075430:S462C	S	+	1	0	CTDP1	75575832	0.266000	0.24112	0.972000	0.41901	0.170000	0.22686	0.638000	0.24674	0.224000	0.20940	-0.460000	0.05396	AGT	.	.		0.677	CTDP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256432.1	NM_004715	
PLPPR3	79948	hgsc.bcm.edu	37	19	813388	813388	+	Missense_Mutation	SNP	C	C	T			TCGA-5C-A9VH-01A-11D-A36X-10	TCGA-5C-A9VH-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	44e358dc-cbf5-4177-89a4-3d0d0fe2ff38	b56ae97e-c498-4223-a583-2b86e313f4bb	g.chr19:813388C>T	ENST00000520876.3	-	8	1417	c.1339G>A	c.(1339-1341)Gag>Aag	p.E447K	MIR3187_ENST00000583431.1_RNA|LPPR3_ENST00000359894.2_Missense_Mutation_p.E475K	NM_001270366.1	NP_001257295.1	Q6T4P5	LPPR3_HUMAN		447	Glu-rich.					integral component of membrane (GO:0016021)	phosphatidate phosphatase activity (GO:0008195)										tcttcgtcctcctcctcttcc	0.756																																					p.E475K		Atlas-SNP	.											.	.	.	.	0			c.G1423A						.						2.0	2.0	2.0					19																	813388		1593	3295	4888	SO:0001583	missense	0	exon7			CGTCCTCCTCCTC																												ENST00000520876.3:c.1339G>A	chr19.hg19:g.813388C>T	ENSP00000430297:p.Glu447Lys	36.0	0.0		34.0	13.0	NM_024888	Q86XQ4|Q96EH1|Q9BQF9|Q9HAJ4	Missense_Mutation	SNP	ENST00000520876.3	hg19	CCDS58636.1	.	.	.	.	.	.	.	.	.	.	c	0.008	-1.883951	0.00532	.	.	ENSG00000129951	ENST00000300947;ENST00000359894;ENST00000520876	T;T	0.20463	2.07;2.07	.	.	.	.	0.615099	0.14392	U	0.322434	T	0.15046	0.0363	L	0.34521	1.04	0.24542	N	0.994062	B;B;B	0.30281	0.275;0.227;0.275	B;B;B	0.34301	0.109;0.179;0.087	T	0.21861	-1.0233	8	0.51188	T	0.08	-15.4211	.	.	.	.	448;447;475	Q6T4P5-2;Q6T4P5;Q6T4P5-3	.;LPPR3_HUMAN;.	K	448;475;447	ENSP00000352962:E475K;ENSP00000430297:E447K	ENSP00000300947:E448K	E	-	1	0	AC006273.1	764388	0.957000	0.32711	0.996000	0.52242	0.177000	0.22998	4.203000	0.58453	0.149000	0.19098	0.152000	0.16155	GAG	.	.		0.756	LPPR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379096.3		
NFIC	4782	hgsc.bcm.edu	37	19	3449113	3449113	+	Missense_Mutation	SNP	C	C	T			TCGA-5C-A9VH-01A-11D-A36X-10	TCGA-5C-A9VH-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	44e358dc-cbf5-4177-89a4-3d0d0fe2ff38	b56ae97e-c498-4223-a583-2b86e313f4bb	g.chr19:3449113C>T	ENST00000443272.2	+	7	1111	c.1060C>T	c.(1060-1062)Cgg>Tgg	p.R354W	NFIC_ENST00000586919.1_Missense_Mutation_p.R321W|NFIC_ENST00000589123.1_Missense_Mutation_p.R345W|NFIC_ENST00000346156.5_Missense_Mutation_p.R321W|NFIC_ENST00000395111.3_Missense_Mutation_p.R345W|NFIC_ENST00000590282.1_Missense_Mutation_p.R354W|NFIC_ENST00000341919.3_Missense_Mutation_p.R354W	NM_001245002.1	NP_001231931.1	P08651	NFIC_HUMAN	nuclear factor I/C (CCAAT-binding transcription factor)	354					DNA replication (GO:0006260)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|odontogenesis of dentin-containing tooth (GO:0042475)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription from RNA polymerase II promoter (GO:0006366)	nucleolus (GO:0005730)|nucleus (GO:0005634)	core promoter proximal region DNA binding (GO:0001159)|double-stranded DNA binding (GO:0003690)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(10)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	21		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;7.8e-05)|Epithelial(107;2.94e-108)|BRCA - Breast invasive adenocarcinoma(158;0.00154)|STAD - Stomach adenocarcinoma(1328;0.191)		CCAGCACCACCGGCCCGTCAT	0.682																																					p.R354W		Atlas-SNP	.											.	NFIC	36	.	0			c.C1060T						.						77.0	55.0	62.0					19																	3449113		2203	4300	6503	SO:0001583	missense	4782	exon7			CACCACCGGCCCG	X12492	CCDS12107.1, CCDS45914.1, CCDS58640.1, CCDS59330.1, CCDS59331.1	19p13.3	2008-02-05				ENSG00000141905			7786	protein-coding gene	gene with protein product		600729		NFI		3398920, 7590749	Standard	NM_205843		Approved	CTF, NF-I, CTF5	uc010xhi.2	P08651		ENST00000443272.2:c.1060C>T	chr19.hg19:g.3449113C>T	ENSP00000396843:p.Arg354Trp	82.0	0.0		65.0	29.0	NM_001245004	A8K1H0|B7Z4U5|B7Z9C3|K7EMU1|P08652|Q14932|Q9UPJ3|Q9UPJ9|Q9UPK0|Q9UPK1	Missense_Mutation	SNP	ENST00000443272.2	hg19	CCDS59330.1	.	.	.	.	.	.	.	.	.	.	C	18.95	3.732683	0.69189	.	.	ENSG00000141905	ENST00000443272;ENST00000395111;ENST00000346156;ENST00000341919;ENST00000343825;ENST00000269778	T;T;T;T	0.51574	0.73;0.7;0.7;0.7	3.96	2.87	0.33458	.	0.000000	0.64402	D	0.000001	T	0.60702	0.2289	M	0.63843	1.955	0.40665	D	0.982162	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.85130	0.997;0.994;0.996;0.917;0.997	T	0.57585	-0.7786	10	0.35671	T	0.21	.	9.4621	0.38792	0.3995:0.6005:0.0:0.0	.	354;354;345;354;345	B7Z4U5;P08651;P08651-3;P08651-5;P08651-2	.;NFIC_HUMAN;.;.;.	W	345;345;321;354;354;354	ENSP00000396843:R345W;ENSP00000378543:R345W;ENSP00000301935:R321W;ENSP00000342194:R354W	ENSP00000269778:R354W	R	+	1	2	NFIC	3400113	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	3.175000	0.50855	0.581000	0.29539	0.561000	0.74099	CGG	.	.		0.682	NFIC-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452834.1	NM_005597	
FCER2	2208	hgsc.bcm.edu	37	19	7763670	7763670	+	Silent	SNP	G	G	T	rs376326260		TCGA-5C-A9VH-01A-11D-A36X-10	TCGA-5C-A9VH-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	44e358dc-cbf5-4177-89a4-3d0d0fe2ff38	b56ae97e-c498-4223-a583-2b86e313f4bb	g.chr19:7763670G>T	ENST00000346664.5	-	3	305	c.93C>A	c.(91-93)acC>acA	p.T31T	FCER2_ENST00000360067.4_Silent_p.T30T|FCER2_ENST00000597921.1_Silent_p.T31T	NM_001220500.1|NM_002002.4	NP_001207429.1|NP_001993.2	P06734	FCER2_HUMAN	Fc fragment of IgE, low affinity II, receptor for (CD23)	31					Notch signaling pathway (GO:0007219)|positive regulation of humoral immune response mediated by circulating immunoglobulin (GO:0002925)|positive regulation of killing of cells of other organism (GO:0051712)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|integrin binding (GO:0005178)|metal ion binding (GO:0046872)			breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|upper_aerodigestive_tract(1)	10						ACAGAGCGGCGGTCACCAGCC	0.652																																					p.T31T		Atlas-SNP	.											.	FCER2	19	.	0			c.C93A						.						44.0	39.0	41.0					19																	7763670		2196	4296	6492	SO:0001819	synonymous_variant	2208	exon3			AGCGGCGGTCACC	M15059	CCDS12184.1	19p13.3	2011-08-30	2006-03-09			ENSG00000104921		"""C-type lectin domain containing"", ""CD molecules"""	3612	protein-coding gene	gene with protein product		151445	"""Fc fragment of IgE, low affinity II, receptor for (CD23A)"""	CD23A, FCE2			Standard	NM_002002		Approved	CLEC4J, CD23	uc002mhm.2	P06734		ENST00000346664.5:c.93C>A	chr19.hg19:g.7763670G>T		113.0	0.0		101.0	35.0	NM_002002		Silent	SNP	ENST00000346664.5	hg19	CCDS12184.1																																																																																			.	.		0.652	FCER2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000461832.1	NM_002002	
C19orf57	79173	hgsc.bcm.edu	37	19	14006250	14006250	+	Silent	SNP	C	C	T			TCGA-5C-A9VH-01A-11D-A36X-10	TCGA-5C-A9VH-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	44e358dc-cbf5-4177-89a4-3d0d0fe2ff38	b56ae97e-c498-4223-a583-2b86e313f4bb	g.chr19:14006250C>T	ENST00000586783.1	-	2	140	c.141G>A	c.(139-141)gaG>gaA	p.E47E	C19orf57_ENST00000346736.2_Silent_p.E47E|C19orf57_ENST00000454313.1_Silent_p.E47E|C19orf57_ENST00000591586.1_Silent_p.E47E			Q0VDD7	CS057_HUMAN	chromosome 19 open reading frame 57	47					multicellular organismal development (GO:0007275)					breast(2)|kidney(1)|lung(3)|ovary(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	14			OV - Ovarian serous cystadenocarcinoma(19;2e-21)			CCAATTTGCCCTCTGGCTCCT	0.567																																					p.E47E		Atlas-SNP	.											.	C19orf57	34	.	0			c.G141A						.						188.0	184.0	186.0					19																	14006250		2203	4300	6503	SO:0001819	synonymous_variant	79173	exon3			TTTGCCCTCTGGC	BC012945	CCDS12299.1	19p13.12	2012-10-26			ENSG00000132016	ENSG00000132016			28153	protein-coding gene	gene with protein product						8228263	Standard	NM_024323		Approved	MGC11271	uc002mxl.1	Q0VDD7	OTTHUMG00000181851	ENST00000586783.1:c.141G>A	chr19.hg19:g.14006250C>T		163.0	0.0		113.0	44.0	NM_024323	Q13411|Q8N825|Q96D63|Q9BU49	Silent	SNP	ENST00000586783.1	hg19																																																																																				.	.		0.567	C19orf57-003	NOVEL	basic	protein_coding	protein_coding	OTTHUMT00000457947.1	NM_024323	
PLEKHG2	64857	hgsc.bcm.edu	37	19	39915656	39915656	+	Missense_Mutation	SNP	G	G	C			TCGA-5C-A9VH-01A-11D-A36X-10	TCGA-5C-A9VH-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	44e358dc-cbf5-4177-89a4-3d0d0fe2ff38	b56ae97e-c498-4223-a583-2b86e313f4bb	g.chr19:39915656G>C	ENST00000409794.3	+	19	4733	c.3883G>C	c.(3883-3885)Ggg>Cgg	p.G1295R	CTB-60E11.4_ENST00000601124.1_lincRNA|PLEKHG2_ENST00000458508.2_Intron|PLEKHG2_ENST00000425673.1_Missense_Mutation_p.G1266R|PLEKHG2_ENST00000378550.1_Intron|PLEKHG2_ENST00000409797.2_Intron	NM_022835.2	NP_073746.2	Q9H7P9	PKHG2_HUMAN	pleckstrin homology domain containing, family G (with RhoGef domain) member 2	1295					apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(3)|central_nervous_system(1)|endometrium(8)|kidney(2)|large_intestine(2)|liver(1)|lung(13)|pancreas(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	40	all_cancers(60;3.08e-07)|all_lung(34;2.66e-08)|Lung NSC(34;3e-08)|all_epithelial(25;6.57e-07)|Ovarian(47;0.0569)		Epithelial(26;2.92e-26)|all cancers(26;2.01e-23)|Lung(45;0.000499)|LUSC - Lung squamous cell carcinoma(53;0.000657)			TCGGCGGCAGGGGCCTGGGGG	0.716																																					p.G1295R		Atlas-SNP	.											.	PLEKHG2	329	.	0			c.G3883C						.						19.0	22.0	21.0					19																	39915656		2189	4278	6467	SO:0001583	missense	64857	exon19			CGGCAGGGGCCTG	AK024429	CCDS33022.2	19q13.2	2013-01-11			ENSG00000090924	ENSG00000090924		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	29515	protein-coding gene	gene with protein product		611893				11839748, 18045877	Standard	NM_022835		Approved	CLG, FLJ00018, ARHGEF42	uc010xuz.2	Q9H7P9	OTTHUMG00000152570	ENST00000409794.3:c.3883G>C	chr19.hg19:g.39915656G>C	ENSP00000386733:p.Gly1295Arg	65.0	0.0		40.0	19.0	NM_022835	B8ZZK6|C9J0Y4|Q6DHV6|Q96BU2|Q96D18|Q9H699	Missense_Mutation	SNP	ENST00000409794.3	hg19	CCDS33022.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	19.35|19.35	3.811229|3.811229	0.70797|0.70797	.|.	.|.	ENSG00000090924|ENSG00000090924	ENST00000409794;ENST00000425673|ENST00000205135	T;T|.	0.81415|.	-1.39;-1.49|.	5.14|5.14	4.1|4.1	0.47936|0.47936	.|.	0.215507|.	0.24436|.	N|.	0.038550|.	T|T	0.63570|0.63570	0.2522|0.2522	M|M	0.65975|0.65975	2.015|2.015	0.80722|0.80722	D|D	1|1	D;D|.	0.89917|.	1.0;1.0|.	D;D|.	0.97110|.	1.0;0.999|.	T|T	0.62020|0.62020	-0.6942|-0.6942	9|5	.|.	.|.	.|.	.|.	9.3585|9.3585	0.38182|0.38182	0.0991:0.0:0.9009:0.0|0.0991:0.0:0.9009:0.0	.|.	1266;1295|.	Q9H7P9-3;Q9H7P9|.	.;PKHG2_HUMAN|.	R|S	1295;1266|1162	ENSP00000386733:G1295R;ENSP00000392906:G1266R|.	.|.	G|R	+|+	1|3	0|2	PLEKHG2|PLEKHG2	44607496|44607496	1.000000|1.000000	0.71417|0.71417	0.964000|0.964000	0.40570|0.40570	0.980000|0.980000	0.70556|0.70556	2.196000|2.196000	0.42686|0.42686	1.171000|1.171000	0.42768|0.42768	0.561000|0.561000	0.74099|0.74099	GGG|AGG	.	.		0.716	PLEKHG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326802.1	NM_022835	
BPIFA2	140683	hgsc.bcm.edu	37	20	31760750	31760750	+	Missense_Mutation	SNP	A	A	G	rs542770426		TCGA-5C-A9VH-01A-11D-A36X-10	TCGA-5C-A9VH-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	44e358dc-cbf5-4177-89a4-3d0d0fe2ff38	b56ae97e-c498-4223-a583-2b86e313f4bb	g.chr20:31760750A>G	ENST00000253362.2	+	3	316	c.170A>G	c.(169-171)aAa>aGa	p.K57R	BPIFA2_ENST00000354932.5_Missense_Mutation_p.K57R			Q96DR5	BPIA2_HUMAN	BPI fold containing family A, member 2	57						extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	lipopolysaccharide binding (GO:0001530)										ATCCTTGAGAAACTGAAGGTC	0.488													A|||	1	0.000199681	0.0	0.0	5008	,	,		19050	0.001		0.0	False		,,,				2504	0.0				p.K57R		Atlas-SNP	.											.	.	.	.	0			c.A170G						.						84.0	79.0	81.0					20																	31760750		2203	4300	6503	SO:0001583	missense	140683	exon3			TTGAGAAACTGAA	AF432917	CCDS13214.1	20q11.21	2011-08-04	2011-07-29	2011-07-29	ENSG00000131050	ENSG00000131050		"""BPI fold containing"""	16203	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 70"""	C20orf70		11971875	Standard	NM_080574		Approved	bA49G10.1, SPLUNC2, PSP	uc002wyo.1	Q96DR5	OTTHUMG00000032244	ENST00000253362.2:c.170A>G	chr20.hg19:g.31760750A>G	ENSP00000253362:p.Lys57Arg	101.0	0.0		83.0	33.0	NM_080574	Q9BQQ0	Missense_Mutation	SNP	ENST00000253362.2	hg19	CCDS13214.1	.	.	.	.	.	.	.	.	.	.	A	13.95	2.390386	0.42410	.	.	ENSG00000131050	ENST00000253362;ENST00000354932	T;T	0.13196	2.61;2.61	3.87	2.77	0.32553	.	1.606950	0.03350	N	0.196028	T	0.21590	0.0520	M	0.65975	2.015	0.09310	N	1	B	0.33280	0.405	B	0.39617	0.305	T	0.26916	-1.0089	10	0.36615	T	0.2	-23.2357	6.0224	0.19636	0.8827:0.0:0.1173:0.0	.	57	Q96DR5	BPIA2_HUMAN	R	57	ENSP00000253362:K57R;ENSP00000347012:K57R	ENSP00000253362:K57R	K	+	2	0	BPIFA2	31224411	0.003000	0.15002	0.003000	0.11579	0.015000	0.08874	2.008000	0.40893	0.835000	0.34877	0.459000	0.35465	AAA	.	.		0.488	BPIFA2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257117.1	NM_080574	
DLGAP4	22839	hgsc.bcm.edu	37	20	35060202	35060202	+	Missense_Mutation	SNP	G	G	A	rs374922768		TCGA-5C-A9VH-01A-11D-A36X-10	TCGA-5C-A9VH-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	44e358dc-cbf5-4177-89a4-3d0d0fe2ff38	b56ae97e-c498-4223-a583-2b86e313f4bb	g.chr20:35060202G>A	ENST00000373907.2	+	2	281	c.82G>A	c.(82-84)Gac>Aac	p.D28N	DLGAP4_ENST00000373913.3_Missense_Mutation_p.D28N|DLGAP4_ENST00000339266.5_Missense_Mutation_p.D28N|DLGAP4_ENST00000401952.2_Missense_Mutation_p.D28N			Q9Y2H0	DLGP4_HUMAN	discs, large (Drosophila) homolog-associated protein 4	28					cell-cell signaling (GO:0007267)	membrane (GO:0016020)|synapse (GO:0045202)				breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(3)|lung(20)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	37	Breast(12;0.0192)	Myeloproliferative disorder(115;0.00878)				TGCAGGGACCGACCGCAACCC	0.697																																					p.D28N		Atlas-SNP	.											.	DLGAP4	111	.	0			c.G82A						.						31.0	33.0	33.0					20																	35060202		2203	4296	6499	SO:0001583	missense	22839	exon2			GGGACCGACCGCA	AF088030	CCDS13274.1, CCDS13275.1	20q11.23	2010-02-05			ENSG00000080845	ENSG00000080845			24476	protein-coding gene	gene with protein product						9115257	Standard	XM_005260329		Approved	DAP4, KIAA0964, SAPAP4	uc010zvp.2	Q9Y2H0	OTTHUMG00000032390	ENST00000373907.2:c.82G>A	chr20.hg19:g.35060202G>A	ENSP00000363014:p.Asp28Asn	250.0	0.0		197.0	98.0	NM_014902	E1P5T5|Q5QPG4|Q5T2Y4|Q5T2Y5|Q9H137|Q9H138|Q9H1L7	Missense_Mutation	SNP	ENST00000373907.2	hg19		.	.	.	.	.	.	.	.	.	.	G	23.4	4.411160	0.83340	.	.	ENSG00000080845	ENST00000373913;ENST00000401952;ENST00000373907;ENST00000339266	T;T;T;T	0.53857	0.6;0.6;0.6;0.6	5.67	4.73	0.59995	.	0.332695	0.36374	N	0.002631	T	0.60301	0.2258	L	0.54323	1.7	0.35797	D	0.822827	D	0.71674	0.998	P	0.54312	0.748	T	0.71494	-0.4576	10	0.56958	D	0.05	.	13.6837	0.62502	0.0737:0.0:0.9263:0.0	.	28	Q9Y2H0-1	.	N	28	ENSP00000363023:D28N;ENSP00000384954:D28N;ENSP00000363014:D28N;ENSP00000341633:D28N	ENSP00000341633:D28N	D	+	1	0	DLGAP4	34493616	1.000000	0.71417	0.997000	0.53966	0.893000	0.52053	5.682000	0.68182	1.409000	0.46915	0.561000	0.74099	GAC	.	.		0.697	DLGAP4-007	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000079025.2	NM_014902	
NCAM2	4685	hgsc.bcm.edu	37	21	22782741	22782741	+	Missense_Mutation	SNP	A	A	G			TCGA-5C-A9VH-01A-11D-A36X-10	TCGA-5C-A9VH-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	44e358dc-cbf5-4177-89a4-3d0d0fe2ff38	b56ae97e-c498-4223-a583-2b86e313f4bb	g.chr21:22782741A>G	ENST00000400546.1	+	10	1592	c.1343A>G	c.(1342-1344)aAt>aGt	p.N448S	NCAM2_ENST00000284894.7_Missense_Mutation_p.N306S	NM_004540.3	NP_004531.2	O15394	NCAM2_HUMAN	neural cell adhesion molecule 2	448	Ig-like C2-type 5.				axonal fasciculation (GO:0007413)|neuron cell-cell adhesion (GO:0007158)|sensory perception of smell (GO:0007608)	axon (GO:0030424)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(4)|cervix(2)|endometrium(8)|kidney(6)|large_intestine(22)|liver(4)|lung(49)|ovary(4)|prostate(4)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	108		Lung NSC(9;0.195)		all cancers(11;0.00102)|OV - Ovarian serous cystadenocarcinoma(11;0.00121)|Epithelial(23;0.00147)|Colorectal(24;0.174)		AACACGACCAATTTAAAGACT	0.313																																					p.N448S		Atlas-SNP	.											.	NCAM2	220	.	0			c.A1343G						.						75.0	76.0	76.0					21																	22782741		1822	4075	5897	SO:0001583	missense	4685	exon10			CGACCAATTTAAA		CCDS42910.1	21q21	2013-02-11			ENSG00000154654	ENSG00000154654		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7657	protein-coding gene	gene with protein product		602040				9226371	Standard	NM_004540		Approved	NCAM21, MGC51008	uc002yld.2	O15394	OTTHUMG00000078121	ENST00000400546.1:c.1343A>G	chr21.hg19:g.22782741A>G	ENSP00000383392:p.Asn448Ser	318.0	1.0		245.0	95.0	NM_004540	A8MQ06|B7Z841|Q7Z7F2	Missense_Mutation	SNP	ENST00000400546.1	hg19	CCDS42910.1	.	.	.	.	.	.	.	.	.	.	A	15.69	2.909325	0.52439	.	.	ENSG00000154654	ENST00000400546;ENST00000284894	T;T	0.66638	-0.22;-0.22	4.75	4.75	0.60458	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.203608	0.50627	D	0.000120	T	0.57242	0.2040	L	0.47016	1.485	0.80722	D	1	P;P	0.36587	0.559;0.559	B;B	0.29785	0.107;0.073	T	0.63976	-0.6515	10	0.72032	D	0.01	-17.7111	13.3568	0.60633	1.0:0.0:0.0:0.0	.	306;448	B7Z5K2;O15394	.;NCAM2_HUMAN	S	448;306	ENSP00000383392:N448S;ENSP00000284894:N306S	ENSP00000284894:N306S	N	+	2	0	NCAM2	21704612	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	7.624000	0.83124	1.893000	0.54813	0.383000	0.25322	AAT	.	.		0.313	NCAM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000170915.1	NM_004540	
UPRT	139596	hgsc.bcm.edu	37	X	74494410	74494410	+	Silent	SNP	G	G	T			TCGA-5C-A9VH-01A-11D-A36X-10	TCGA-5C-A9VH-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	44e358dc-cbf5-4177-89a4-3d0d0fe2ff38	b56ae97e-c498-4223-a583-2b86e313f4bb	g.chrX:74494410G>T	ENST00000373383.4	+	1	488	c.321G>T	c.(319-321)ggG>ggT	p.G107G	UPRT_ENST00000530743.1_5'Flank|UPRT_ENST00000373379.1_Silent_p.G107G|UPRT_ENST00000531704.1_3'UTR	NM_145052.3	NP_659489.1	Q96BW1	UPP_HUMAN	uracil phosphoribosyltransferase (FUR1) homolog (S. cerevisiae)	107					female pregnancy (GO:0007565)|lactation (GO:0007595)|response to insulin (GO:0032868)|UMP biosynthetic process (GO:0006222)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(1)|endometrium(7)|kidney(2)|large_intestine(4)|lung(4)	18						GGCAGATCGGGGCGCAGCTTA	0.552																																					p.G107G		Atlas-SNP	.											.	UPRT	46	.	0			c.G321T						.						29.0	22.0	24.0					X																	74494410		2203	4300	6503	SO:0001819	synonymous_variant	139596	exon1			GATCGGGGCGCAG	BC015116	CCDS14429.1	Xq13.3	2009-01-14			ENSG00000094841	ENSG00000094841			28334	protein-coding gene	gene with protein product		300656				12477932	Standard	NM_145052		Approved	DKFZp781E1243, MGC23937, FUR1, RP11-311P8.3	uc004ecb.2	Q96BW1	OTTHUMG00000021864	ENST00000373383.4:c.321G>T	chrX.hg19:g.74494410G>T		157.0	0.0		102.0	86.0	NM_145052	Q5JRL1|Q5JRL3|Q68DN0|Q96MW2	Silent	SNP	ENST00000373383.4	hg19	CCDS14429.1																																																																																			.	.		0.552	UPRT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057278.1	NM_145052	
GABRQ	55879	hgsc.bcm.edu	37	X	151818999	151818999	+	Nonsense_Mutation	SNP	C	C	A			TCGA-5C-A9VH-01A-11D-A36X-10	TCGA-5C-A9VH-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	44e358dc-cbf5-4177-89a4-3d0d0fe2ff38	b56ae97e-c498-4223-a583-2b86e313f4bb	g.chrX:151818999C>A	ENST00000370306.2	+	7	877	c.857C>A	c.(856-858)tCg>tAg	p.S286*		NM_018558.2	NP_061028.3	Q9UN88	GBRT_HUMAN	gamma-aminobutyric acid (GABA) A receptor, theta	286					neurotransmitter transport (GO:0006836)|signal transduction (GO:0007165)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|postsynaptic membrane (GO:0045211)|receptor complex (GO:0043235)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)|neurotransmitter transporter activity (GO:0005326)|transmembrane signaling receptor activity (GO:0004888)	p.S286L(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(9)|lung(25)|ovary(3)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	52	Acute lymphoblastic leukemia(192;6.56e-05)				Acamprosate(DB00659)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Flumazenil(DB01205)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	TCTTGGATATCGTTTTGGATG	0.453																																					p.S286X		Atlas-SNP	.											.	GABRQ	131	.	1	Substitution - Missense(1)	large_intestine(1)	c.C857A						.						359.0	303.0	322.0					X																	151818999		2203	4300	6503	SO:0001587	stop_gained	55879	exon7			GGATATCGTTTTG	U47334	CCDS14707.1	Xq28	2012-06-22	2012-02-03		ENSG00000147402	ENSG00000268089		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	14454	protein-coding gene	gene with protein product	"""GABA(A) receptor, theta"""	300349	"""gamma-aminobutyric acid (GABA) receptor, theta"""			10804200, 10449790	Standard	NM_018558		Approved	THETA	uc004ffp.1	Q9UN88	OTTHUMG00000022649	ENST00000370306.2:c.857C>A	chrX.hg19:g.151818999C>A	ENSP00000359329:p.Ser286*	118.0	0.0		115.0	83.0	NM_018558	A6NFN1|Q32MB4|Q9NZK8	Nonsense_Mutation	SNP	ENST00000370306.2	hg19	CCDS14707.1	.	.	.	.	.	.	.	.	.	.	C	28.9	4.963616	0.92791	.	.	ENSG00000147402	ENST00000370306	.	.	.	6.08	6.08	0.98989	.	0.163737	0.29572	N	0.011766	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	16.7366	0.85448	0.0:1.0:0.0:0.0	.	.	.	.	X	286	.	ENSP00000359329:S286X	S	+	2	0	GABRQ	151569655	1.000000	0.71417	0.341000	0.25589	0.302000	0.27658	7.798000	0.85924	2.562000	0.86427	0.600000	0.82982	TCG	.	.		0.453	GABRQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058763.2	NM_018558	
PCDH11Y	83259	hgsc.bcm.edu	37	Y	4967469	4967469	+	Missense_Mutation	SNP	G	G	A			TCGA-5C-A9VH-01A-11D-A36X-10	TCGA-5C-A9VH-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	44e358dc-cbf5-4177-89a4-3d0d0fe2ff38	b56ae97e-c498-4223-a583-2b86e313f4bb	g.chrY:4967469G>A	ENST00000333703.4	+	5	2330	c.1817G>A	c.(1816-1818)aGg>aAg	p.R606K	PCDH11Y_ENST00000215473.6_Missense_Mutation_p.R617K|PCDH11Y_ENST00000362095.5_Missense_Mutation_p.R617K	NM_001278619.1|NM_032971.2	NP_001265548.1|NP_116753.1	Q9BZA8	PC11Y_HUMAN	protocadherin 11 Y-linked	617	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			autonomic_ganglia(1)|kidney(2)|large_intestine(7)|lung(14)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	27						AACCTTCCAAGGCATGGTACA	0.383																																					p.R617K		Atlas-SNP	.											.	PCDH11Y	163	.	0			c.G1850A						.																																			SO:0001583	missense	83259	exon2			TTCCAAGGCATGG	AF332217	CCDS14776.1, CCDS14777.1, CCDS76066.1	Yp11.2	2010-01-26	2002-05-22	2002-05-24	ENSG00000099715	ENSG00000099715		"""Cadherins / Protocadherins : Non-clustered"""	15813	protein-coding gene	gene with protein product		400022	"""protocadherin 22"""	PCDH22		10644456, 11003707	Standard	NM_032971		Approved	PCDHY	uc004fqo.3	Q9BZA8	OTTHUMG00000035105	ENST00000333703.4:c.1817G>A	chrY.hg19:g.4967469G>A	ENSP00000330552:p.Arg606Lys	226.0	0.0		154.0	109.0	NM_032972	Q70LR6|Q70LR8|Q70LS0|Q70LS1|Q70LS2|Q70LS3|Q70LS4|Q70LS5|Q8WY34|Q9BZA9|Q9H4E1	Missense_Mutation	SNP	ENST00000333703.4	hg19	CCDS14776.1																																																																																			.	.		0.383	PCDH11Y-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084979.2	NM_032973	
MT-CO2	4513	hgsc.bcm.edu	37	M	7695	7695	+	Missense_Mutation	SNP	T	T	C			TCGA-5C-A9VH-01A-11D-A36X-10	TCGA-5C-A9VH-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	44e358dc-cbf5-4177-89a4-3d0d0fe2ff38	b56ae97e-c498-4223-a583-2b86e313f4bb	g.chrM:7695T>C	ENST00000361739.1	+	1	110	c.110T>C	c.(109-111)cTa>cCa	p.L37P	MT-TG_ENST00000387429.1_RNA|MT-TS1_ENST00000387416.2_RNA|MT-ATP8_ENST00000361851.1_5'Flank|MT-TY_ENST00000387409.1_RNA|MT-ND3_ENST00000361227.2_5'Flank|MT-TR_ENST00000387439.1_RNA|MT-ND4L_ENST00000361335.1_5'Flank|MT-TW_ENST00000387382.1_RNA|MT-TN_ENST00000387400.1_RNA|MT-TD_ENST00000387419.1_RNA|MT-TK_ENST00000387421.1_RNA|MT-TC_ENST00000387405.1_RNA|MT-TA_ENST00000387392.1_RNA|MT-CO3_ENST00000362079.2_5'Flank|MT-ATP6_ENST00000361899.2_5'Flank			P00403	COX2_HUMAN	mitochondrially encoded cytochrome c oxidase II	37					cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|mitochondrial electron transport, cytochrome c to oxygen (GO:0006123)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|respiratory chain complex IV (GO:0045277)	copper ion binding (GO:0005507)|cytochrome-c oxidase activity (GO:0004129)			endometrium(5)|kidney(8)|lung(2)|pancreas(3)|prostate(1)	19						TATCTGCTTCCTAGTCCTGTA	0.438																																					p.L37P		Atlas-SNP	.											.	.	.	.	0			c.T110C						.																																			SO:0001583	missense	5743	exon1			GCTTCCTAGTCCT			mitochondria	2012-11-16	2005-02-15	2005-02-16	ENSG00000198712	ENSG00000198712		"""Mitochondrial respiratory chain complex / Complex IV"""	7421	protein-coding gene	gene with protein product		516040	"""cytochrome c oxidase II"""	MTCO2		1712754, 1989603	Standard			Approved	COX2, CO2		P00403		ENST00000361739.1:c.110T>C	chrM.hg19:g.7695T>C	ENSP00000354876:p.Leu37Pro	20.0	0.0		26.0	22.0	ENST00000361739	Q37526	Missense_Mutation	SNP	ENST00000361739.1	hg19																																																																																				.	.		0.438	MT-CO2-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024029	
GZMH	2999	hgsc.bcm.edu	37	14	25076509	25076509	+	Frame_Shift_Del	DEL	C	C	-			TCGA-5C-A9VH-01A-11D-A36X-10	TCGA-5C-A9VH-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	44e358dc-cbf5-4177-89a4-3d0d0fe2ff38	b56ae97e-c498-4223-a583-2b86e313f4bb	g.chr14:25076509delC	ENST00000216338.4	-	4	487	c.443delG	c.(442-444)ggtfs	p.G148fs	GZMH_ENST00000382548.4_Intron|GZMH_ENST00000557220.2_Intron|RP11-104E19.1_ENST00000555300.1_RNA|RP11-104E19.1_ENST00000557736.1_RNA	NM_033423.4	NP_219491.1	P20718	GRAH_HUMAN	granzyme H (cathepsin G-like 2, protein h-CCPX)	148	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				apoptotic process (GO:0006915)|cytolysis (GO:0019835)	membrane (GO:0016020)	serine-type endopeptidase activity (GO:0004252)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(6)|ovary(1)|prostate(1)|skin(1)	12				GBM - Glioblastoma multiforme(265;0.0267)		TGAGACATAACCCCAGCCAGC	0.562																																					p.G148fs		Atlas-Indel,Pindel	.											GZMH,NS,carcinoma,0,1	GZMH	24	.	0			c.444delT						.						89.0	81.0	84.0					14																	25076509		2203	4300	6503	SO:0001589	frameshift_variant	2999	exon4			.	M72150	CCDS9632.1, CCDS59243.1	14q11.2	2003-10-20			ENSG00000100450	ENSG00000100450			4710	protein-coding gene	gene with protein product		116831		CTSGL2		2049336	Standard	NM_033423		Approved	CGL-2, CCP-X, CTLA1, CSP-C	uc001wpr.2	P20718	OTTHUMG00000140185	ENST00000216338.4:c.443delG	chr14.hg19:g.25076509delC	ENSP00000216338:p.Gly148fs	40.0	0.0		32.0	16.0	NM_033423	G3V2C5|Q6XGZ0|Q6XGZ1	Frame_Shift_Del	DEL	ENST00000216338.4	hg19	CCDS9632.1																																																																																			.	.		0.562	GZMH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276538.2	NM_033423	
ITPKB	3707	hgsc.bcm.edu	37	1	226923826	226923826	+	Frame_Shift_Del	DEL	C	C	-			TCGA-5C-A9VH-01A-11D-A36X-10	TCGA-5C-A9VH-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	44e358dc-cbf5-4177-89a4-3d0d0fe2ff38	b56ae97e-c498-4223-a583-2b86e313f4bb	g.chr1:226923826delC	ENST00000272117.3	-	1	1333	c.1334delG	c.(1333-1335)ggafs	p.G446fs	ITPKB_ENST00000429204.1_Frame_Shift_Del_p.G446fs|ITPKB_ENST00000366784.1_Frame_Shift_Del_p.G446fs			P27987	IP3KB_HUMAN	inositol-trisphosphate 3-kinase B	446					cell surface receptor signaling pathway (GO:0007166)|inositol phosphate metabolic process (GO:0043647)|MAPK cascade (GO:0000165)|positive regulation of alpha-beta T cell differentiation (GO:0046638)|positive regulation of Ras protein signal transduction (GO:0046579)|positive thymic T cell selection (GO:0045059)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	ATP binding (GO:0005524)|inositol-1,4,5-trisphosphate 3-kinase activity (GO:0008440)			central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(4)|lung(13)|ovary(4)|prostate(1)|skin(1)	30		Prostate(94;0.0773)				TGGGGACCCTCCCTCCACTCT	0.706																																					p.G445fs	Colon(84;110 1851 5306 33547)	Atlas-Indel,Pindel	.											.	ITPKB	158	.	0			c.1335delA						.						18.0	23.0	21.0					1																	226923826		2182	4282	6464	SO:0001589	frameshift_variant	3707	exon2			.	AJ242780	CCDS1555.1	1q42.12	2011-04-28	2011-04-28		ENSG00000143772	ENSG00000143772	2.7.1.127		6179	protein-coding gene	gene with protein product		147522	"""inositol 1,4,5-trisphosphate 3-kinase B"""			1654894, 1330886	Standard	NM_002221		Approved	IP3KB, IP3-3KB	uc010pvo.2	P27987	OTTHUMG00000037582	ENST00000272117.3:c.1334delG	chr1.hg19:g.226923826delC	ENSP00000272117:p.Gly446fs	84.0	0.0		87.0	13.0	NM_002221	Q5VWL9|Q5VWM0|Q96BZ2|Q96JS1|Q9UH47	Frame_Shift_Del	DEL	ENST00000272117.3	hg19	CCDS1555.1																																																																																			.	.		0.706	ITPKB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091632.1	NM_002221	
CHRM1	1128	hgsc.bcm.edu	37	11	62677923	62677927	+	Frame_Shift_Del	DEL	TTCTC	TTCTC	-			TCGA-5C-A9VH-01A-11D-A36X-10	TCGA-5C-A9VH-10A-01D-A370-10	TTCTC	TTCTC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	44e358dc-cbf5-4177-89a4-3d0d0fe2ff38	b56ae97e-c498-4223-a583-2b86e313f4bb	g.chr11:62677923_62677927delTTCTC	ENST00000306960.3	-	2	1187_1191	c.646_650delGAGAA	c.(646-651)gagaacfs	p.EN216fs	AP000438.2_ENST00000543624.1_RNA	NM_000738.2	NP_000729.2	P11229	ACM1_HUMAN	cholinergic receptor, muscarinic 1	216					cell proliferation (GO:0008283)|cellular protein modification process (GO:0006464)|cognition (GO:0050890)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|G-protein coupled receptor signaling pathway (GO:0007186)|nervous system development (GO:0007399)|neuromuscular synaptic transmission (GO:0007274)|phospholipase C-activating G-protein coupled acetylcholine receptor signaling pathway (GO:0007207)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of ion transport (GO:0043270)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of locomotion (GO:0040012)|saliva secretion (GO:0046541)|signal transduction (GO:0007165)	asymmetric synapse (GO:0032279)|axon terminus (GO:0043679)|cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	drug binding (GO:0008144)|G-protein coupled acetylcholine receptor activity (GO:0016907)|phosphatidylinositol phospholipase C activity (GO:0004435)			large_intestine(5)|lung(3)|stomach(1)	9					Aclidinium(DB08897)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Anisotropine Methylbromide(DB00517)|Aripiprazole(DB01238)|Atropine(DB00572)|Benzatropine(DB00245)|Biperiden(DB00810)|Brompheniramine(DB00835)|Buclizine(DB00354)|Carbachol(DB00411)|Cevimeline(DB00185)|Chlorpromazine(DB00477)|Chlorprothixene(DB01239)|Cinnarizine(DB00568)|Citalopram(DB00215)|Clidinium(DB00771)|Clozapine(DB00363)|Cocaine(DB00907)|Cryptenamine(DB00785)|Cyclopentolate(DB00979)|Cycrimine(DB00942)|Cyproheptadine(DB00434)|Darifenacin(DB00496)|Desipramine(DB01151)|Dicyclomine(DB00804)|Diphenidol(DB01231)|Disopyramide(DB00280)|Doxepin(DB01142)|Doxylamine(DB00366)|Escitalopram(DB01175)|Ethopropazine(DB00392)|Fesoterodine(DB06702)|Flavoxate(DB01148)|Flupentixol(DB00875)|Glycopyrrolate(DB00986)|Homatropine Methylbromide(DB00725)|Hyoscyamine(DB00424)|Imipramine(DB00458)|Ipratropium bromide(DB00332)|Ketamine(DB01221)|Loxapine(DB00408)|Maprotiline(DB00934)|Mepenzolate(DB04843)|Methantheline(DB00940)|Methotrimeprazine(DB01403)|Methylscopolamine bromide(DB00462)|Metixene(DB00340)|Metoclopramide(DB01233)|Minaprine(DB00805)|Molindone(DB01618)|Nicardipine(DB00622)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Oxybutynin(DB01062)|Oxyphencyclimine(DB00383)|Oxyphenonium(DB00219)|Paroxetine(DB00715)|Pethidine(DB00454)|Pilocarpine(DB01085)|Pirenzepine(DB00670)|Procyclidine(DB00387)|Promazine(DB00420)|Promethazine(DB01069)|Propantheline(DB00782)|Propiomazine(DB00777)|Quetiapine(DB01224)|Scopolamine(DB00747)|Solifenacin(DB01591)|Succinylcholine(DB00202)|Tiotropium(DB01409)|Tolterodine(DB01036)|Triflupromazine(DB00508)|Trihexyphenidyl(DB00376)|Trimipramine(DB00726)|Tropicamide(DB00809)|Trospium(DB00209)|Ziprasidone(DB00246)	CCGTGCTCGGTTCTCTGTCTCCCGG	0.639																																					p.216_217del		Atlas-Indel,Pindel	.											.	CHRM1	29	.	0			c.647_651del						.																																			SO:0001589	frameshift_variant	1128	exon2			.	Y00508	CCDS8040.1	11q12-q13	2012-08-08				ENSG00000168539		"""Cholinergic receptors"", ""GPCR / Class A : Cholinergic receptors, muscarinic"""	1950	protein-coding gene	gene with protein product	"""acetylcholine receptor, muscarinic 1"""	118510					Standard	NM_000738		Approved		uc001nwi.3	P11229		ENST00000306960.3:c.646_650delGAGAA	chr11.hg19:g.62677923_62677927delTTCTC	ENSP00000306490:p.Glu216fs	60.0	0.0		37.0	18.0	NM_000738	Q96RH1	Frame_Shift_Del	DEL	ENST00000306960.3	hg19	CCDS8040.1																																																																																			.	.		0.639	CHRM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396178.1	NM_000738	
TACR3	6870	hgsc.bcm.edu	37	4	104640792	104640792	+	Frame_Shift_Del	DEL	C	C	-			TCGA-5C-A9VH-01A-11D-A36X-10	TCGA-5C-A9VH-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	44e358dc-cbf5-4177-89a4-3d0d0fe2ff38	b56ae97e-c498-4223-a583-2b86e313f4bb	g.chr4:104640792delC	ENST00000304883.2	-	1	181	c.41delG	c.(40-42)ggtfs	p.G16fs		NM_001059.2	NP_001050.1	P29371	NK3R_HUMAN	tachykinin receptor 3	16					aging (GO:0007568)|hyperosmotic salinity response (GO:0042538)|positive regulation of blood pressure (GO:0045777)|positive regulation of heart rate (GO:0010460)|positive regulation of uterine smooth muscle contraction (GO:0070474)|regulation of dopamine metabolic process (GO:0042053)|regulation of feeding behavior (GO:0060259)|response to cocaine (GO:0042220)|response to estradiol (GO:0032355)|response to morphine (GO:0043278)|tachykinin receptor signaling pathway (GO:0007217)	cytoplasm (GO:0005737)|dendrite membrane (GO:0032590)|integral component of plasma membrane (GO:0005887)|neuronal cell body membrane (GO:0032809)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	tachykinin receptor activity (GO:0004995)			breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(19)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	51		Hepatocellular(203;0.217)		UCEC - Uterine corpus endometrioid carcinoma (10;0.22)|OV - Ovarian serous cystadenocarcinoma(123;3.4e-08)		CACGCCTCCACCCCCGTCTAT	0.677																																					p.G14fs		Atlas-Indel,Pindel	.											.	TACR3	102	.	0			c.42delT						.						36.0	42.0	40.0					4																	104640792		2200	4296	6496	SO:0001589	frameshift_variant	6870	exon1			.	M89473	CCDS3664.1	4q25	2012-08-08			ENSG00000169836	ENSG00000169836		"""GPCR / Class A : Tachykinin receptors"""	11528	protein-coding gene	gene with protein product	"""neurokinin beta receptor"""	162332				1374246	Standard	NM_001059		Approved	NK3R	uc003hxe.1	P29371	OTTHUMG00000131124	ENST00000304883.2:c.41delG	chr4.hg19:g.104640792delC	ENSP00000303325:p.Gly16fs	55.0	0.0		46.0	18.0	NM_001059	Q0P510	Frame_Shift_Del	DEL	ENST00000304883.2	hg19	CCDS3664.1																																																																																			.	.		0.677	TACR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253804.1	NM_001059	
ZSCAN16	80345	hgsc.bcm.edu	37	6	28093436	28093445	+	Frame_Shift_Del	DEL	CAGAATGCCA	CAGAATGCCA	-			TCGA-5C-A9VH-01A-11D-A36X-10	TCGA-5C-A9VH-10A-01D-A370-10	CAGAATGCCA	CAGAATGCCA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	44e358dc-cbf5-4177-89a4-3d0d0fe2ff38	b56ae97e-c498-4223-a583-2b86e313f4bb	g.chr6:28093436_28093445delCAGAATGCCA	ENST00000340487.4	+	2	364_373	c.215_224delCAGAATGCCA	c.(214-225)ccagaatgccacfs	p.PECH72fs	ZSCAN16-AS1_ENST00000600652.1_RNA|ZSCAN16-AS1_ENST00000602810.1_RNA	NM_025231.1	NP_079507.1	Q9H4T2	ZSC16_HUMAN	zinc finger and SCAN domain containing 16	72	SCAN box. {ECO:0000255|PROSITE- ProRule:PRU00187}.				transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			large_intestine(5)|liver(1)|lung(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	10						TGGCTGAGGCCAGAATGCCACACCAAGGAG	0.538																																					p.72_75del		Atlas-Indel,Pindel	.											.	ZSCAN16	24	.	0			c.214_223del						.																																			SO:0001589	frameshift_variant	80345	exon2			.	AK025844	CCDS4644.1	6p21.33	2013-01-08	2007-02-20	2007-02-20	ENSG00000196812	ENSG00000196812		"""-"", ""Zinc fingers, C2H2-type"""	20813	protein-coding gene	gene with protein product			"""zinc finger protein 392"", ""zinc finger protein 435"""	ZNF392, ZNF435			Standard	NM_025231		Approved	FLJ22191, dJ265C24.3	uc003nkm.3	Q9H4T2	OTTHUMG00000014509	ENST00000340487.4:c.215_224delCAGAATGCCA	chr6.hg19:g.28093436_28093445delCAGAATGCCA	ENSP00000366527:p.Pro72fs	177.0	0.0		123.0	29.0	NM_025231	Q9H6K2	Frame_Shift_Del	DEL	ENST00000340487.4	hg19	CCDS4644.1																																																																																			.	.		0.538	ZSCAN16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040177.1	NM_025231	
GDNF	2668	hgsc.bcm.edu	37	5	37834855	37834855	+	Frame_Shift_Del	DEL	T	T	-			TCGA-5C-A9VH-01A-11D-A36X-10	TCGA-5C-A9VH-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	44e358dc-cbf5-4177-89a4-3d0d0fe2ff38	b56ae97e-c498-4223-a583-2b86e313f4bb	g.chr5:37834855delT	ENST00000326524.2	-	2	243	c.44delA	c.(43-45)cacfs	p.H15fs	GDNF_ENST00000515058.1_Frame_Shift_Del_p.H15fs|GDNF_ENST00000381826.4_Frame_Shift_Del_p.H32fs|GDNF_ENST00000344622.4_Frame_Shift_Del_p.H15fs|GDNF_ENST00000427982.1_Frame_Shift_Del_p.H32fs	NM_000514.3	NP_000505.1	P39905	GDNF_HUMAN	glial cell derived neurotrophic factor	15					adult locomotory behavior (GO:0008344)|axon guidance (GO:0007411)|branching involved in ureteric bud morphogenesis (GO:0001658)|enteric nervous system development (GO:0048484)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|metanephros development (GO:0001656)|mRNA stabilization (GO:0048255)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of neuron apoptotic process (GO:0043524)|nervous system development (GO:0007399)|neural crest cell migration (GO:0001755)|neuron projection development (GO:0031175)|organ induction (GO:0001759)|peristalsis (GO:0030432)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of dopamine secretion (GO:0033603)|positive regulation of mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0072108)|positive regulation of monooxygenase activity (GO:0032770)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of ureteric bud formation (GO:0072107)|postganglionic parasympathetic nervous system development (GO:0021784)|postsynaptic membrane organization (GO:0001941)|regulation of dopamine uptake involved in synaptic transmission (GO:0051584)|regulation of morphogenesis of a branching structure (GO:0060688)|signal transduction (GO:0007165)|sympathetic nervous system development (GO:0048485)|ureteric bud formation (GO:0060676)	extracellular region (GO:0005576)	protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)			NS(1)|endometrium(1)|large_intestine(2)|liver(1)|lung(8)|skin(2)	15	all_lung(31;0.00118)					GGACGCGGTGTGGAGCAGCAC	0.726																																					p.H32fs		Atlas-Indel,Pindel	.											.	GDNF	56	.	0			c.96delC						.						26.0	28.0	27.0					5																	37834855		2202	4299	6501	SO:0001589	frameshift_variant	2668	exon2			.		CCDS3922.1, CCDS3923.1, CCDS54845.1, CCDS54846.1, CCDS75237.1	5p13.1-p12	2014-01-30			ENSG00000168621	ENSG00000168621		"""Endogenous ligands"""	4232	protein-coding gene	gene with protein product	"""astrocyte-derived trophic factor"", ""glial cell line derived neurotrophic factor"", ""glial derived neurotrophic factor"""	600837				8493557	Standard	NM_199231		Approved	ATF1, ATF2, HFB1-GDNF	uc011cpg.2	P39905	OTTHUMG00000090809	ENST00000326524.2:c.44delA	chr5.hg19:g.37834855delT	ENSP00000317145:p.His15fs	209.0	0.0		187.0	47.0	NM_001190469	B7WPK7|O95448|O95449|O95986|Q6FH33|Q96L44|Q9UD32|Q9UD33|Q9UMV2|Q9UP67|Q9UP97	Frame_Shift_Del	DEL	ENST00000326524.2	hg19	CCDS3922.1																																																																																			.	.		0.726	GDNF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207606.1	NM_000514	
RAI14	26064	hgsc.bcm.edu	37	5	34823606	34823607	+	Frame_Shift_Del	DEL	GA	GA	-			TCGA-5C-A9VH-01A-11D-A36X-10	TCGA-5C-A9VH-10A-01D-A370-10	GA	GA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	44e358dc-cbf5-4177-89a4-3d0d0fe2ff38	b56ae97e-c498-4223-a583-2b86e313f4bb	g.chr5:34823606_34823607delGA	ENST00000265109.3	+	15	1946_1947	c.1659_1660delGA	c.(1657-1662)gtgagafs	p.R554fs	RAI14_ENST00000503673.1_Frame_Shift_Del_p.R554fs|RAI14_ENST00000506376.1_Frame_Shift_Del_p.R546fs|RAI14_ENST00000512629.1_Frame_Shift_Del_p.R525fs|RAI14_ENST00000515799.1_Frame_Shift_Del_p.R557fs|RAI14_ENST00000397449.1_Frame_Shift_Del_p.R547fs|RAI14_ENST00000428746.2_Frame_Shift_Del_p.R554fs	NM_001145522.1|NM_015577.2	NP_001138994.1|NP_056392.2	Q9P0K7	RAI14_HUMAN	retinoic acid induced 14	554						actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nucleus (GO:0005634)				breast(2)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(19)|lung(22)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	56	all_lung(31;0.000191)					aagagaaagtgagagagttaga	0.406																																					p.556_556del		Atlas-Indel,Pindel	.											.	RAI14	100	.	0			c.1667_1668del						.																																			SO:0001589	frameshift_variant	26064	exon17			.	AB037755	CCDS34142.1, CCDS54837.1, CCDS54838.1, CCDS54839.1	5p13.3-p13.2	2013-01-10			ENSG00000039560	ENSG00000039560		"""Ankyrin repeat domain containing"""	14873	protein-coding gene	gene with protein product	"""novel retinal pigment epithelial"""	606586				11042181	Standard	NM_015577		Approved	NORPEG, KIAA1334, RAI13, DKFZp564G013	uc011coj.2	Q9P0K7	OTTHUMG00000162019	ENST00000265109.3:c.1659_1660delGA	chr5.hg19:g.34823610_34823611delGA	ENSP00000265109:p.Arg554fs	133.0	0.0		142.0	52.0	NM_001145525	E9PED3|Q6V1W9|Q7Z5I4|Q7Z733|Q9P2L2|Q9Y3T5	Frame_Shift_Del	DEL	ENST00000265109.3	hg19	CCDS34142.1																																																																																			.	.		0.406	RAI14-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366786.1	NM_015577	
NUAK2	81788	hgsc.bcm.edu	37	1	205290603	205290626	+	In_Frame_Del	DEL	GGTGCCGCAGGTTGTGCTTGTGGT	GGTGCCGCAGGTTGTGCTTGTGGT	-			TCGA-5C-A9VH-01A-11D-A36X-10	TCGA-5C-A9VH-10A-01D-A370-10	GGTGCCGCAGGTTGTGCTTGTGGT	GGTGCCGCAGGTTGTGCTTGTGGT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	44e358dc-cbf5-4177-89a4-3d0d0fe2ff38	b56ae97e-c498-4223-a583-2b86e313f4bb	g.chr1:205290603_205290626delGGTGCCGCAGGTTGTGCTTGTGGT	ENST00000367157.3	-	1	257_280	c.131_154delACCACAAGCACAACCTGCGGCACC	c.(130-156)caccacaagcacaacctgcggcaccgc>cgc	p.HHKHNLRH44del		NM_030952.1	NP_112214.1			NUAK family, SNF1-like kinase, 2									p.H45Y(2)		breast(3)|kidney(3)|large_intestine(4)|lung(4)|ovary(3)|prostate(3)|skin(1)|stomach(1)|urinary_tract(1)	23	Breast(84;0.186)		BRCA - Breast invasive adenocarcinoma(75;0.117)			AACTCGTAGCGGTGCCGCAGGTTGTGCTTGTGGTGGTGCCGCTT	0.679																																					p.44_52del		Pindel	.											.	NUAK2	107	.	2	Substitution - Missense(2)	kidney(2)	c.132_155del						.																																			SO:0001651	inframe_deletion	81788	exon1			.	AK074830	CCDS1453.1	1q32.1	2008-02-05			ENSG00000163545	ENSG00000163545			29558	protein-coding gene	gene with protein product	"""SNF1/AMP activated protein kinase"""	608131				11230166	Standard	NM_030952		Approved	SNARK, FLJ90349	uc001hce.3	Q9H093	OTTHUMG00000037196	ENST00000367157.3:c.131_154delACCACAAGCACAACCTGCGGCACC	chr1.hg19:g.205290603_205290626delGGTGCCGCAGGTTGTGCTTGTGGT	ENSP00000356125:p.His44_His51del	148.0	0.0		147.0	12.0	NM_030952		In_Frame_Del	DEL	ENST00000367157.3	hg19	CCDS1453.1																																																																																			.	.		0.679	NUAK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090390.1	NM_030952	
