#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
COL16A1	1307	hgsc.bcm.edu	37	1	32162651	32162651	+	Missense_Mutation	SNP	C	C	G			TCGA-BC-A10Y-01A-11D-A12Z-10	TCGA-BC-A10Y-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	54f8357c-9dd7-4e08-bd47-a1ebedb30b62	5589b608-e6ae-4953-8a37-484d4116179b	g.chr1:32162651C>G	ENST00000373672.3	-	8	1293	c.777G>C	c.(775-777)caG>caC	p.Q259H	COL16A1_ENST00000271069.6_Missense_Mutation_p.Q259H|COL16A1_ENST00000373668.3_Missense_Mutation_p.Q259H	NM_001856.3	NP_001847.3	Q07092	COGA1_HUMAN	collagen, type XVI, alpha 1	259	Nonhelical region 10 (NC10).				cell adhesion (GO:0007155)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|female pregnancy (GO:0007565)|integrin-mediated signaling pathway (GO:0007229)	collagen type XVI trimer (GO:0005597)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	integrin binding (GO:0005178)			breast(4)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(7)|lung(15)|ovary(8)|prostate(4)	48		Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0423)|all_neural(195;0.0837)|Breast(348;0.116)		STAD - Stomach adenocarcinoma(196;0.059)		GCTCATTGCTCTGGGTGTCCC	0.602																																					p.Q259H	Colon(143;498 1786 21362 25193 36625)	Atlas-SNP	.											.	COL16A1	137	.	0			c.G777C						.						113.0	125.0	121.0					1																	32162651		1986	4145	6131	SO:0001583	missense	1307	exon8			ATTGCTCTGGGTG	M92642	CCDS41297.1	1p35-p34	2013-01-16			ENSG00000084636	ENSG00000084636		"""Collagens"""	2193	protein-coding gene	gene with protein product		120326				1631157	Standard	NM_001856		Approved		uc001btk.1	Q07092	OTTHUMG00000003883	ENST00000373672.3:c.777G>C	chr1.hg19:g.32162651C>G	ENSP00000362776:p.Gln259His	273.0	0.0		305.0	136.0	NM_001856	Q16593|Q59F89|Q71RG9	Missense_Mutation	SNP	ENST00000373672.3	hg19	CCDS41297.1	.	.	.	.	.	.	.	.	.	.	C	14.55	2.569750	0.45798	.	.	ENSG00000084636	ENST00000373672;ENST00000271069;ENST00000373668	T;T;T	0.71934	-0.61;-0.61;-0.61	4.87	2.97	0.34412	.	0.195831	0.35495	N	0.003162	T	0.74230	0.3689	L	0.40543	1.245	0.33708	D	0.615411	D;D;D	0.69078	0.993;0.995;0.997	P;P;D	0.67548	0.903;0.897;0.952	T	0.80663	-0.1282	10	0.87932	D	0	.	9.755	0.40498	0.0:0.8279:0.0:0.1721	.	259;259;259	A6NCT7;Q07092;Q07092-2	.;COGA1_HUMAN;.	H	259	ENSP00000362776:Q259H;ENSP00000271069:Q259H;ENSP00000362772:Q259H	ENSP00000271069:Q259H	Q	-	3	2	COL16A1	31935238	0.986000	0.35501	1.000000	0.80357	0.884000	0.51177	0.422000	0.21296	1.182000	0.42928	0.655000	0.94253	CAG	.	.		0.602	COL16A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011057.2	NM_001856	
BAI2	576	hgsc.bcm.edu	37	1	32196897	32196897	+	Missense_Mutation	SNP	A	A	T			TCGA-BC-A10Y-01A-11D-A12Z-10	TCGA-BC-A10Y-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	54f8357c-9dd7-4e08-bd47-a1ebedb30b62	5589b608-e6ae-4953-8a37-484d4116179b	g.chr1:32196897A>T	ENST00000373658.3	-	29	4225	c.3884T>A	c.(3883-3885)tTc>tAc	p.F1295Y	BAI2_ENST00000398538.1_Missense_Mutation_p.F1283Y|BAI2_ENST00000398556.3_Missense_Mutation_p.F1210Y|BAI2_ENST00000398547.1_Missense_Mutation_p.F1228Y|BAI2_ENST00000373655.2_Missense_Mutation_p.F1295Y|BAI2_ENST00000398542.1_Missense_Mutation_p.F1195Y|BAI2_ENST00000527361.1_Missense_Mutation_p.F1262Y|BAI2_ENST00000465256.1_5'UTR|BAI2_ENST00000440175.2_Missense_Mutation_p.F904Y|BAI2_ENST00000257070.4_Missense_Mutation_p.F1262Y	NM_001703.2	NP_001694.2	O60241	BAI2_HUMAN	brain-specific angiogenesis inhibitor 2	1295					G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of angiogenesis (GO:0016525)|neuropeptide signaling pathway (GO:0007218)|peripheral nervous system development (GO:0007422)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(5)|central_nervous_system(2)|endometrium(1)|large_intestine(7)|liver(2)|lung(24)|ovary(7)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	55		Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0606)|all_neural(195;0.0837)|Breast(348;0.174)		STAD - Stomach adenocarcinoma(196;0.0557)		CAGTGGTGAGAAGCTGAGGCT	0.647																																					p.F1295Y		Atlas-SNP	.											.	BAI2	128	.	0			c.T3884A						.						31.0	26.0	28.0					1																	32196897		2203	4300	6503	SO:0001583	missense	576	exon29			GGTGAGAAGCTGA	AB005298	CCDS72746.1, CCDS72747.1	1p35	2014-08-08			ENSG00000121753	ENSG00000121753		"""-"", ""GPCR / Class B : Orphans"""	944	protein-coding gene	gene with protein product		602683				9533023	Standard	XM_006710783		Approved		uc001btn.3	O60241	OTTHUMG00000003885	ENST00000373658.3:c.3884T>A	chr1.hg19:g.32196897A>T	ENSP00000362762:p.Phe1295Tyr	163.0	0.0		175.0	85.0	NM_001703	B9EGK9|Q5T6K0|Q8NGW8|Q96GZ9	Missense_Mutation	SNP	ENST00000373658.3	hg19	CCDS346.2	.	.	.	.	.	.	.	.	.	.	A	16.50	3.141251	0.57044	.	.	ENSG00000121753	ENST00000398556;ENST00000398547;ENST00000373658;ENST00000373655;ENST00000398542;ENST00000257070;ENST00000527361;ENST00000440175;ENST00000398538	T;T;T;T;T;T;T;T;T	0.57107	1.13;1.3;0.42;0.42;1.56;0.46;0.46;1.2;0.49	5.16	5.16	0.70880	.	0.000000	0.45126	D	0.000394	T	0.53158	0.1779	L	0.40543	1.245	0.43152	D	0.994923	B;P;P;P;B;P;P	0.49447	0.082;0.924;0.709;0.876;0.161;0.876;0.468	B;P;B;P;B;P;B	0.51266	0.219;0.664;0.217;0.463;0.279;0.463;0.348	T	0.47736	-0.9094	10	0.21540	T	0.41	.	14.9679	0.71208	1.0:0.0:0.0:0.0	.	1262;1283;904;1210;1295;1295;1283	O60241-4;O60241-3;B4DKC3;A2A3C6;O60241-2;O60241;A2A3C2	.;.;.;.;.;BAI2_HUMAN;.	Y	1210;1228;1295;1295;1195;1262;1262;904;1283	ENSP00000381564:F1210Y;ENSP00000381555:F1228Y;ENSP00000362762:F1295Y;ENSP00000362759:F1295Y;ENSP00000381550:F1195Y;ENSP00000257070:F1262Y;ENSP00000435397:F1262Y;ENSP00000391071:F904Y;ENSP00000381548:F1283Y	ENSP00000257070:F1262Y	F	-	2	0	BAI2	31969484	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	4.306000	0.59117	2.074000	0.62210	0.459000	0.35465	TTC	.	.		0.647	BAI2-015	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000381838.1	NM_001703	
LHX8	431707	hgsc.bcm.edu	37	1	75602325	75602325	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-A10Y-01A-11D-A12Z-10	TCGA-BC-A10Y-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	54f8357c-9dd7-4e08-bd47-a1ebedb30b62	5589b608-e6ae-4953-8a37-484d4116179b	g.chr1:75602325C>T	ENST00000294638.5	+	3	720	c.56C>T	c.(55-57)aCa>aTa	p.T19I	LHX8_ENST00000356261.3_Missense_Mutation_p.T9I	NM_001001933.1	NP_001001933.1	Q68G74	LHX8_HUMAN	LIM homeobox 8	19					female gonad development (GO:0008585)|forebrain neuron development (GO:0021884)|learning or memory (GO:0007611)|odontogenesis of dentin-containing tooth (GO:0042475)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	female germ cell nucleus (GO:0001674)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(18)|ovary(3)|urinary_tract(1)	30						GGGCGGACTACAGCCCTGGCG	0.667																																					p.T19I		Atlas-SNP	.											.	LHX8	73	.	0			c.C56T						.						21.0	22.0	22.0					1																	75602325		1790	3354	5144	SO:0001583	missense	431707	exon3			GGACTACAGCCCT	AB050476	CCDS30756.1, CCDS58008.1	1p31.1	2011-06-20			ENSG00000162624	ENSG00000162624		"""Homeoboxes / LIM class"""	28838	protein-coding gene	gene with protein product		604425				9598319	Standard	NM_001256114		Approved	Lhx7	uc031pmx.1	Q68G74	OTTHUMG00000009692	ENST00000294638.5:c.56C>T	chr1.hg19:g.75602325C>T	ENSP00000294638:p.Thr19Ile	74.0	0.0		73.0	34.0	NM_001001933	E9PGE3	Missense_Mutation	SNP	ENST00000294638.5	hg19	CCDS30756.1	.	.	.	.	.	.	.	.	.	.	C	16.27	3.076522	0.55753	.	.	ENSG00000162624	ENST00000294638;ENST00000356261	D;D	0.86297	-2.1;-2.09	3.58	3.58	0.41010	.	0.925878	0.08939	N	0.871821	T	0.64713	0.2623	N	0.08118	0	0.27613	N	0.948593	B	0.15473	0.013	B	0.04013	0.001	T	0.62348	-0.6873	10	0.72032	D	0.01	.	14.7861	0.69806	0.0:1.0:0.0:0.0	.	19	Q68G74	LHX8_HUMAN	I	19;9	ENSP00000294638:T19I;ENSP00000348597:T9I	ENSP00000294638:T19I	T	+	2	0	LHX8	75374913	0.992000	0.36948	0.998000	0.56505	0.955000	0.61496	2.339000	0.43965	1.533000	0.49186	0.313000	0.20887	ACA	.	.		0.667	LHX8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000026700.1	NM_001001933	
POGZ	23126	hgsc.bcm.edu	37	1	151414583	151414583	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A10Y-01A-11D-A12Z-10	TCGA-BC-A10Y-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	54f8357c-9dd7-4e08-bd47-a1ebedb30b62	5589b608-e6ae-4953-8a37-484d4116179b	g.chr1:151414583T>C	ENST00000271715.2	-	2	412	c.98A>G	c.(97-99)tAt>tGt	p.Y33C	POGZ_ENST00000368863.2_Missense_Mutation_p.Y33C|POGZ_ENST00000409503.1_Missense_Mutation_p.Y33C|POGZ_ENST00000540984.1_5'UTR|POGZ_ENST00000491586.1_Missense_Mutation_p.Y33C|POGZ_ENST00000361398.3_Missense_Mutation_p.Y33C|POGZ_ENST00000531094.1_Missense_Mutation_p.Y33C|POGZ_ENST00000392723.1_Missense_Mutation_p.Y33C	NM_001194937.1|NM_015100.3	NP_001181866.1|NP_055915.2	Q7Z3K3	POGZ_HUMAN	pogo transposable element with ZNF domain	33					kinetochore assembly (GO:0051382)|mitotic sister chromatid cohesion (GO:0007064)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|endometrium(10)|kidney(3)|large_intestine(10)|liver(2)|lung(11)|ovary(3)|prostate(2)|skin(3)|urinary_tract(1)	47	Lung SC(34;0.00471)|Ovarian(49;0.00672)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.112)|LUSC - Lung squamous cell carcinoma(543;0.181)			CACTGAATTATAATCTTCAAC	0.388																																					p.Y33C		Atlas-SNP	.											.	POGZ	211	.	0			c.A98G						.						95.0	92.0	93.0					1																	151414583		2203	4300	6503	SO:0001583	missense	23126	exon2			GAATTATAATCTT	AB007930	CCDS997.1, CCDS998.1, CCDS44222.1, CCDS44222.2, CCDS53365.1, CCDS53366.1	1q21.1	2013-07-22			ENSG00000143442	ENSG00000143442			18801	protein-coding gene	gene with protein product	"""zinc finger protein 280E"", ""putative protein product of Nbla00003"""	614787				10976766	Standard	NM_015100		Approved	KIAA0461, ZNF635m, ZNF280E	uc001eyd.2	Q7Z3K3	OTTHUMG00000012499	ENST00000271715.2:c.98A>G	chr1.hg19:g.151414583T>C	ENSP00000271715:p.Tyr33Cys	207.0	0.0		265.0	87.0	NM_145796	B4DTP8|B4DYL9|B7ZBY5|E9PM80|O75049|Q3LIC4|Q5SZS1|Q5SZS2|Q5SZS3|Q5SZS4|Q8TDZ7|Q9Y4X7	Missense_Mutation	SNP	ENST00000271715.2	hg19	CCDS997.1	.	.	.	.	.	.	.	.	.	.	T	20.2	3.954328	0.73902	.	.	ENSG00000143442	ENST00000392723;ENST00000271715;ENST00000361398;ENST00000368863;ENST00000409503;ENST00000531094;ENST00000491586;ENST00000437847;ENST00000533461;ENST00000533351;ENST00000450842	T;T;T;T;T;T;T	0.01185	5.64;5.86;5.64;5.75;5.84;5.72;5.21	6.03	6.03	0.97812	.	0.000000	0.64402	D	0.000020	T	0.01523	0.0049	N	0.14661	0.345	0.80722	D	1	D;D;D;D;D;D;D	0.89917	0.999;0.999;1.0;1.0;1.0;0.999;0.999	D;D;D;D;D;D;D	0.83275	0.945;0.962;0.996;0.964;0.983;0.975;0.924	T	0.74621	-0.3604	10	0.62326	D	0.03	-14.65	15.3964	0.74798	0.0:0.0:0.0:1.0	.	33;33;33;33;33;33;33	E9PM80;B7ZBY5;Q7Z3K3-5;Q7Z3K3-4;Q7Z3K3-3;Q7Z3K3-2;Q7Z3K3	.;.;.;.;.;.;POGZ_HUMAN	C	33	ENSP00000376484:Y33C;ENSP00000271715:Y33C;ENSP00000354467:Y33C;ENSP00000357856:Y33C;ENSP00000386836:Y33C;ENSP00000431259:Y33C;ENSP00000418408:Y33C	ENSP00000271715:Y33C	Y	-	2	0	POGZ	149681207	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.129000	0.64739	2.313000	0.78055	0.455000	0.32223	TAT	.	.		0.388	POGZ-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000034915.2	NM_207171	
USH2A	7399	hgsc.bcm.edu	37	1	216496858	216496858	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-A10Y-01A-11D-A12Z-10	TCGA-BC-A10Y-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	54f8357c-9dd7-4e08-bd47-a1ebedb30b62	5589b608-e6ae-4953-8a37-484d4116179b	g.chr1:216496858C>T	ENST00000307340.3	-	8	1894	c.1508G>A	c.(1507-1509)aGa>aAa	p.R503K	USH2A_ENST00000366943.2_Missense_Mutation_p.R503K|USH2A_ENST00000366942.3_Missense_Mutation_p.R503K	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	503	Laminin N-terminal. {ECO:0000255|PROSITE- ProRule:PRU00466}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)			NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		ATATCTGTGTCTGAGGTTAAC	0.368										HNSCC(13;0.011)																											p.R503K		Atlas-SNP	.											USH2A,NS,carcinoma,0,1	USH2A	1168	.	0			c.G1508A						.						149.0	146.0	147.0					1																	216496858		2203	4300	6503	SO:0001583	missense	7399	exon8			CTGTGTCTGAGGT	AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.1508G>A	chr1.hg19:g.216496858C>T	ENSP00000305941:p.Arg503Lys	217.0	1.0		359.0	104.0	NM_007123	Q5VVM9|Q6S362|Q9NS27	Missense_Mutation	SNP	ENST00000307340.3	hg19	CCDS31025.1	.	.	.	.	.	.	.	.	.	.	C	12.81	2.049535	0.36181	.	.	ENSG00000042781	ENST00000307340;ENST00000366943;ENST00000366942	T;T;T	0.20738	2.44;2.43;2.05	5.5	4.59	0.56863	Laminin, N-terminal (3);	0.000000	0.49305	D	0.000150	T	0.22166	0.0534	M	0.68728	2.09	0.41999	D	0.990888	B;P	0.42785	0.164;0.79	B;B	0.34242	0.098;0.178	T	0.05649	-1.0872	10	0.41790	T	0.15	.	14.2176	0.65805	0.0:0.9281:0.0:0.0719	.	503;503	O75445-2;O75445	.;USH2A_HUMAN	K	503	ENSP00000305941:R503K;ENSP00000355910:R503K;ENSP00000355909:R503K	ENSP00000305941:R503K	R	-	2	0	USH2A	214563481	0.058000	0.20735	0.759000	0.31340	0.645000	0.38454	2.330000	0.43885	1.301000	0.44836	0.655000	0.94253	AGA	.	.		0.368	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128138.1	NM_007123	
SNTG2	54221	hgsc.bcm.edu	37	2	1079315	1079315	+	Missense_Mutation	SNP	G	G	T			TCGA-BC-A10Y-01A-11D-A12Z-10	TCGA-BC-A10Y-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	54f8357c-9dd7-4e08-bd47-a1ebedb30b62	5589b608-e6ae-4953-8a37-484d4116179b	g.chr2:1079315G>T	ENST00000308624.5	+	2	313	c.184G>T	c.(184-186)Gtg>Ttg	p.V62L	SNTG2_ENST00000407292.1_Missense_Mutation_p.V62L	NM_018968.3	NP_061841.2	Q9NY99	SNTG2_HUMAN	syntrophin, gamma 2	62					central nervous system development (GO:0007417)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|syntrophin complex (GO:0016013)	PDZ domain binding (GO:0030165)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(9)|lung(20)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	52	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.00469)		all cancers(51;0.0178)|OV - Ovarian serous cystadenocarcinoma(76;0.07)|Epithelial(75;0.0864)|GBM - Glioblastoma multiforme(21;0.173)		TGTTGTCTGTGTGGGCGGAAG	0.488																																					p.V62L		Atlas-SNP	.											.	SNTG2	125	.	0			c.G184T						.						114.0	113.0	113.0					2																	1079315		1996	4168	6164	SO:0001583	missense	54221	exon2			GTCTGTGTGGGCG	AJ003029	CCDS46220.1	2p25	2008-05-23			ENSG00000172554	ENSG00000172554			13741	protein-coding gene	gene with protein product		608715				10747910	Standard	NM_018968		Approved	SYN5, G2SYN	uc002qwq.3	Q9NY99	OTTHUMG00000151370	ENST00000308624.5:c.184G>T	chr2.hg19:g.1079315G>T	ENSP00000311837:p.Val62Leu	110.0	0.0		90.0	36.0	NM_018968	Q05AH5	Missense_Mutation	SNP	ENST00000308624.5	hg19	CCDS46220.1	.	.	.	.	.	.	.	.	.	.	G	3.107	-0.183483	0.06340	.	.	ENSG00000172554	ENST00000308624;ENST00000407292	T;T	0.54071	1.15;0.59	4.23	1.06	0.20224	PDZ/DHR/GLGF (1);	0.574520	0.17993	N	0.155145	T	0.37210	0.0995	L	0.45137	1.4	0.19300	N	0.999975	B;B	0.22276	0.046;0.067	B;B	0.24541	0.054;0.035	T	0.28902	-1.0029	10	0.09843	T	0.71	.	7.5428	0.27748	0.3238:0.0:0.6762:0.0	.	62;62	Q9NY99-2;Q9NY99	.;SNTG2_HUMAN	L	62	ENSP00000311837:V62L;ENSP00000385020:V62L	ENSP00000311837:V62L	V	+	1	0	SNTG2	1069315	0.838000	0.29461	0.027000	0.17364	0.061000	0.15899	0.319000	0.19522	-0.124000	0.11724	0.591000	0.81541	GTG	.	.		0.488	SNTG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322454.1	NM_018968	
PIGF	5281	hgsc.bcm.edu	37	2	46839477	46839477	+	Silent	SNP	T	T	A	rs1824050	byFrequency	TCGA-BC-A10Y-01A-11D-A12Z-10	TCGA-BC-A10Y-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	54f8357c-9dd7-4e08-bd47-a1ebedb30b62	5589b608-e6ae-4953-8a37-484d4116179b	g.chr2:46839477T>A	ENST00000281382.6	-	4	497	c.327A>T	c.(325-327)gcA>gcT	p.A109A	PIGF_ENST00000306465.4_Silent_p.A109A|PIGF_ENST00000495933.1_5'UTR	NM_002643.3	NP_002634.1	Q07326	PIGF_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class F	109					C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|GPI anchor biosynthetic process (GO:0006506)|post-translational protein modification (GO:0043687)|preassembly of GPI anchor in ER membrane (GO:0016254)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	ethanolaminephosphotransferase activity (GO:0004307)			breast(1)|endometrium(1)|lung(1)|stomach(1)	4		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)	LUSC - Lung squamous cell carcinoma(58;0.114)			ATGTTTCCAATGCCAACCTAG	0.274																																					p.A109A		Atlas-SNP	.											.	PIGF	9	.	0			c.A327T						.						23.0	21.0	22.0					2																	46839477		2180	4280	6460	SO:0001819	synonymous_variant	5281	exon4			TTCCAATGCCAAC		CCDS1827.1, CCDS1828.1	2p21-p16	2013-02-26	2006-06-28		ENSG00000151665	ENSG00000151665		"""Phosphatidylinositol glycan anchor biosynthesis"""	8962	protein-coding gene	gene with protein product		600153	"""phosphatidylinositol glycan, class F"""			8575782, 8463218	Standard	NM_173074		Approved		uc002rvd.3	Q07326	OTTHUMG00000128816	ENST00000281382.6:c.327A>T	chr2.hg19:g.46839477T>A		502.0	2.0		323.0	152.0	NM_002643	Q8WW20	Silent	SNP	ENST00000281382.6	hg19	CCDS1827.1																																																																																			.	T|0.798;C|0.202		0.274	PIGF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250749.2	NM_173074	
VRK2	7444	hgsc.bcm.edu	37	2	58373591	58373591	+	Missense_Mutation	SNP	G	G	C			TCGA-BC-A10Y-01A-11D-A12Z-10	TCGA-BC-A10Y-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	54f8357c-9dd7-4e08-bd47-a1ebedb30b62	5589b608-e6ae-4953-8a37-484d4116179b	g.chr2:58373591G>C	ENST00000435505.2	+	15	1909	c.1164G>C	c.(1162-1164)atG>atC	p.M388I	VRK2_ENST00000340157.4_Missense_Mutation_p.M388I|VRK2_ENST00000440705.2_Missense_Mutation_p.M365I|VRK2_ENST00000412104.2_Missense_Mutation_p.M388I|VRK2_ENST00000417641.2_Missense_Mutation_p.M388I			Q86Y07	VRK2_HUMAN	vaccinia related kinase 2	388					cellular response to oxidative stress (GO:0034599)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of interleukin-1-mediated signaling pathway (GO:2000659)|regulation of MAPK cascade (GO:0043408)|viral process (GO:0016032)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|mitochondrial membrane (GO:0031966)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			endometrium(4)|kidney(2)|large_intestine(5)|lung(12)|ovary(1)	24						TTGGATTGATGAACAATGAAG	0.378																																					p.M388I		Atlas-SNP	.											.	VRK2	46	.	0			c.G1164C						.						213.0	230.0	224.0					2																	58373591		2203	4300	6503	SO:0001583	missense	7444	exon12			ATTGATGAACAAT	AK058199	CCDS1859.1, CCDS46291.1, CCDS46292.1	2p16.1	2008-05-15			ENSG00000028116	ENSG00000028116			12719	protein-coding gene	gene with protein product		602169					Standard	NM_001130480		Approved		uc002rzv.3	Q86Y07	OTTHUMG00000129348	ENST00000435505.2:c.1164G>C	chr2.hg19:g.58373591G>C	ENSP00000408002:p.Met388Ile	402.0	0.0		343.0	145.0	NM_001130480	B4DKL0|D6W5D4|D6W5D6|Q49AK9|Q53EU9|Q53S39|Q53S77|Q53TU1|Q86Y08|Q86Y09|Q86Y10|Q86Y11|Q86Y12|Q8IXI5|Q99987	Missense_Mutation	SNP	ENST00000435505.2	hg19	CCDS1859.1	.	.	.	.	.	.	.	.	.	.	G	13.55	2.269199	0.40095	.	.	ENSG00000028116	ENST00000435505;ENST00000417641;ENST00000412104;ENST00000340157;ENST00000394539;ENST00000440705	T;T;T;T;T	0.04809	3.55;3.81;3.81;3.55;3.56	5.61	-7.56	0.01322	.	1.800900	0.02598	N	0.100790	T	0.02688	0.0081	N	0.14661	0.345	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.41770	-0.9490	10	0.37606	T	0.19	7.6974	4.3483	0.11143	0.0696:0.301:0.1975:0.4319	.	388;388;388	Q86Y07-2;Q86Y07-5;Q86Y07	.;.;VRK2_HUMAN	I	388;388;388;388;388;365	ENSP00000408002:M388I;ENSP00000402375:M388I;ENSP00000404156:M388I;ENSP00000342381:M388I;ENSP00000398323:M365I	ENSP00000342381:M388I	M	+	3	0	VRK2	58227095	0.000000	0.05858	0.000000	0.03702	0.850000	0.48378	-0.280000	0.08468	-1.183000	0.02723	0.650000	0.86243	ATG	.	.		0.378	VRK2-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000325304.2	NM_006296	
CTNNA2	1496	hgsc.bcm.edu	37	2	80085161	80085161	+	Silent	SNP	C	C	T			TCGA-BC-A10Y-01A-11D-A12Z-10	TCGA-BC-A10Y-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	54f8357c-9dd7-4e08-bd47-a1ebedb30b62	5589b608-e6ae-4953-8a37-484d4116179b	g.chr2:80085161C>T	ENST00000402739.4	+	3	326	c.321C>T	c.(319-321)tcC>tcT	p.S107S	CTNNA2_ENST00000541047.1_Silent_p.S107S|CTNNA2_ENST00000466387.1_Silent_p.S107S|CTNNA2_ENST00000361291.4_Silent_p.S141S|CTNNA2_ENST00000496558.1_Silent_p.S107S|CTNNA2_ENST00000540488.1_Silent_p.S107S	NM_001282597.1	NP_001269526.1	P26232	CTNA2_HUMAN	catenin (cadherin-associated protein), alpha 2	107					axonogenesis (GO:0007409)|brain morphogenesis (GO:0048854)|dendrite morphogenesis (GO:0048813)|muscle cell differentiation (GO:0042692)|positive regulation of muscle cell differentiation (GO:0051149)|prepulse inhibition (GO:0060134)|radial glia guided migration of Purkinje cell (GO:0021942)|regulation of synapse structural plasticity (GO:0051823)|single organismal cell-cell adhesion (GO:0016337)	actin cytoskeleton (GO:0015629)|adherens junction (GO:0005912)|axon (GO:0030424)|basolateral plasma membrane (GO:0016323)|cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|lamellipodium (GO:0030027)	structural constituent of cytoskeleton (GO:0005200)			breast(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(49)|pancreas(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	78						GGATCGCCTCCTCCGAGTTTG	0.582																																					p.S107S		Atlas-SNP	.											.	CTNNA2	462	.	0			c.C321T						.						97.0	94.0	95.0					2																	80085161		2054	4194	6248	SO:0001819	synonymous_variant	1496	exon4			CGCCTCCTCCGAG		CCDS42703.2, CCDS62944.1, CCDS62945.1, CCDS74531.1	2p12-p11.1	2010-05-04			ENSG00000066032	ENSG00000066032			2510	protein-coding gene	gene with protein product	"""cadherin-associated protein, related"", ""cancer/testis antigen 114"""	114025				8432524	Standard	NM_004389		Approved	CAP-R, CT114	uc010ysf.2	P26232	OTTHUMG00000152903	ENST00000402739.4:c.321C>T	chr2.hg19:g.80085161C>T		136.0	0.0		128.0	52.0	NM_001164883	B3KXE5|B7Z2W7|B7Z352|B7Z898|Q4ZFW1|Q53R26|Q53R33|Q53T67|Q53T71|Q53TM8|Q7Z3L1|Q7Z3Y0	Silent	SNP	ENST00000402739.4	hg19																																																																																				.	.		0.582	CTNNA2-003	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000328511.4	NM_004389	
DPP10	57628	hgsc.bcm.edu	37	2	116510776	116510776	+	Missense_Mutation	SNP	G	G	T			TCGA-BC-A10Y-01A-11D-A12Z-10	TCGA-BC-A10Y-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	54f8357c-9dd7-4e08-bd47-a1ebedb30b62	5589b608-e6ae-4953-8a37-484d4116179b	g.chr2:116510776G>T	ENST00000410059.1	+	11	1457	c.977G>T	c.(976-978)tGg>tTg	p.W326L	DPP10_ENST00000393147.2_Missense_Mutation_p.W330L|DPP10_ENST00000310323.8_Missense_Mutation_p.W319L|DPP10_ENST00000409163.1_Missense_Mutation_p.W276L	NM_001178037.1|NM_020868.3	NP_001171508.1|NP_065919	Q8N608	DPP10_HUMAN	dipeptidyl-peptidase 10 (non-functional)	326						integral component of membrane (GO:0016021)|membrane (GO:0016020)	serine-type peptidase activity (GO:0008236)			breast(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(24)|liver(2)|lung(48)|ovary(6)|prostate(1)|skin(5)|soft_tissue(1)	101						ATGGTTAAATGGGTAAGCAAT	0.378																																					p.W330L		Atlas-SNP	.											.	DPP10	415	.	0			c.G989T						.						104.0	92.0	96.0					2																	116510776		2203	4300	6503	SO:0001583	missense	57628	exon11			TTAAATGGGTAAG	AY172661	CCDS33278.1, CCDS46400.1, CCDS54388.1, CCDS54389.1	2q14.1	2010-05-04	2010-05-04		ENSG00000175497	ENSG00000175497			20823	protein-coding gene	gene with protein product		608209	"""dipeptidylpeptidase 10"", ""dipeptidyl-peptidase 10"""			10819331, 12662155	Standard	NM_020868		Approved	DPRP3	uc002tle.3	Q8N608	OTTHUMG00000153294	ENST00000410059.1:c.977G>T	chr2.hg19:g.116510776G>T	ENSP00000386565:p.Trp326Leu	299.0	0.0		196.0	73.0	NM_001178034	A8K1Q2|J3KPP2|J3KQ46|Q0GLB8|Q53QT3|Q53S86|Q53SL8|Q53SS4|Q6TTV4|Q86YR9|Q9P236	Missense_Mutation	SNP	ENST00000410059.1	hg19	CCDS46400.1	.	.	.	.	.	.	.	.	.	.	G	26.4	4.730807	0.89390	.	.	ENSG00000175497	ENST00000410059;ENST00000409163;ENST00000393147;ENST00000310323;ENST00000476155	T;T;T;T	0.56941	0.43;0.43;0.43;0.43	5.1	5.1	0.69264	Peptidase S9B, dipeptidylpeptidase IV N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.81763	0.4891	H	0.96142	3.775	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.999;1.0;1.0;1.0	D	0.87568	0.2476	10	0.87932	D	0	-28.5782	17.6852	0.88255	0.0:0.0:1.0:0.0	.	319;330;322;326	Q8N608-2;Q0GLB8;Q0GLB9;Q8N608	.;.;.;DPP10_HUMAN	L	326;276;330;319;276	ENSP00000386565:W326L;ENSP00000387038:W276L;ENSP00000376855:W330L;ENSP00000309066:W319L	ENSP00000309066:W319L	W	+	2	0	DPP10	116227246	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.236000	0.95360	2.660000	0.90430	0.650000	0.86243	TGG	.	.		0.378	DPP10-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000330580.4	NM_020868	
ZNF445	353274	hgsc.bcm.edu	37	3	44489484	44489484	+	Missense_Mutation	SNP	C	C	A			TCGA-BC-A10Y-01A-11D-A12Z-10	TCGA-BC-A10Y-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	54f8357c-9dd7-4e08-bd47-a1ebedb30b62	5589b608-e6ae-4953-8a37-484d4116179b	g.chr3:44489484C>A	ENST00000396077.2	-	8	2026	c.1679G>T	c.(1678-1680)cGa>cTa	p.R560L	ZNF445_ENST00000425708.2_Missense_Mutation_p.R560L	NM_181489.5	NP_852466.1	P59923	ZN445_HUMAN	zinc finger protein 445	560					transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(5)|kidney(3)|large_intestine(8)|lung(8)|ovary(2)|pancreas(1)|skin(3)	31				KIRC - Kidney renal clear cell carcinoma(197;0.0514)|Kidney(197;0.0646)		ATGGGTTTCTCGGTGCAGACG	0.463																																					p.R560L		Atlas-SNP	.											.	ZNF445	91	.	0			c.G1679T						.						111.0	113.0	112.0					3																	44489484		2203	4300	6503	SO:0001583	missense	353274	exon8			GTTTCTCGGTGCA	AY262260	CCDS2713.1	3p21.32	2013-01-09	2003-10-07		ENSG00000185219	ENSG00000185219		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	21018	protein-coding gene	gene with protein product			"""zinc finger protein 168"""	ZNF168		7814019	Standard	NM_181489		Approved	ZKSCAN15, ZSCAN47	uc003cnf.2	P59923	OTTHUMG00000133042	ENST00000396077.2:c.1679G>T	chr3.hg19:g.44489484C>A	ENSP00000379387:p.Arg560Leu	114.0	0.0		92.0	12.0	NM_181489	Q3MJD1	Missense_Mutation	SNP	ENST00000396077.2	hg19	CCDS2713.1	.	.	.	.	.	.	.	.	.	.	C	11.52	1.662061	0.29515	.	.	ENSG00000185219	ENST00000425708;ENST00000396077	T;T	0.59083	0.29;0.29	3.61	0.854	0.19007	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.499968	0.17093	N	0.187319	T	0.33527	0.0866	N	0.16567	0.415	0.22511	N	0.999038	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.17992	-1.0351	10	0.59425	D	0.04	.	2.4045	0.04409	0.2079:0.2355:0.0:0.5566	.	548;560	B7ZKX2;P59923	.;ZN445_HUMAN	L	560	ENSP00000413073:R560L;ENSP00000379387:R560L	ENSP00000379387:R560L	R	-	2	0	ZNF445	44464488	0.004000	0.15560	0.986000	0.45419	0.910000	0.53928	0.614000	0.24314	0.220000	0.20860	-0.423000	0.05987	CGA	.	.		0.463	ZNF445-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256647.2	NM_181489	
UPK1B	7348	hgsc.bcm.edu	37	3	118909118	118909118	+	Nonsense_Mutation	SNP	T	T	A	rs113148509		TCGA-BC-A10Y-01A-11D-A12Z-10	TCGA-BC-A10Y-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	54f8357c-9dd7-4e08-bd47-a1ebedb30b62	5589b608-e6ae-4953-8a37-484d4116179b	g.chr3:118909118T>A	ENST00000264234.3	+	4	446	c.297T>A	c.(295-297)taT>taA	p.Y99*	UPK1B_ENST00000497685.1_Nonsense_Mutation_p.Y19*|UPK1B_ENST00000460625.1_Nonsense_Mutation_p.Y99*	NM_006952.3	NP_008883.2	O75841	UPK1B_HUMAN	uroplakin 1B	99					epithelial cell differentiation (GO:0030855)	apical plasma membrane (GO:0016324)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	structural molecule activity (GO:0005198)			breast(1)|endometrium(3)|large_intestine(2)|lung(6)|pancreas(1)|skin(1)	14				GBM - Glioblastoma multiforme(114;0.222)		TTATAGTATATGCCTTTGAAG	0.313																																					p.Y99X		Atlas-SNP	.											.	UPK1B	27	.	0			c.T297A						.						148.0	149.0	149.0					3																	118909118		2203	4300	6503	SO:0001587	stop_gained	7348	exon4			AGTATATGCCTTT	AF082888	CCDS2985.1	3q13.32	2013-02-14			ENSG00000114638	ENSG00000114638		"""Tetraspanins"""	12578	protein-coding gene	gene with protein product		602380		UPK1		9935153, 9846985	Standard	NM_006952		Approved	TSPAN20	uc003ecc.3	O75841	OTTHUMG00000159354	ENST00000264234.3:c.297T>A	chr3.hg19:g.118909118T>A	ENSP00000264234:p.Tyr99*	523.0	0.0		443.0	178.0	NM_006952	O60753|Q9UIM2|Q9UNX6	Nonsense_Mutation	SNP	ENST00000264234.3	hg19	CCDS2985.1	.	.	.	.	.	.	.	.	.	.	T	35	5.447698	0.96205	.	.	ENSG00000114638	ENST00000497685;ENST00000264234;ENST00000479520;ENST00000494855;ENST00000460625	.	.	.	4.57	-0.897	0.10553	.	0.079382	0.52532	D	0.000062	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.29301	T	0.29	-10.4254	8.7815	0.34794	0.0:0.3214:0.0:0.6786	.	.	.	.	X	19;99;99;99;99	.	ENSP00000264234:Y99X	Y	+	3	2	UPK1B	120391808	0.864000	0.29904	0.942000	0.38095	0.995000	0.86356	-0.303000	0.08210	-0.309000	0.08779	0.460000	0.39030	TAT	.	T|0.500;C|0.500		0.313	UPK1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354883.2		
RHO	6010	hgsc.bcm.edu	37	3	129252455	129252455	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-A10Y-01A-11D-A12Z-10	TCGA-BC-A10Y-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	54f8357c-9dd7-4e08-bd47-a1ebedb30b62	5589b608-e6ae-4953-8a37-484d4116179b	g.chr3:129252455G>A	ENST00000296271.3	+	5	1035	c.941G>A	c.(940-942)cGg>cAg	p.R314Q		NM_000539.3	NP_000530.1	P08100	OPSD_HUMAN	rhodopsin	314					G-protein coupled receptor signaling pathway (GO:0007186)|phototransduction, visible light (GO:0007603)|protein phosphorylation (GO:0006468)|protein-chromophore linkage (GO:0018298)|red, far-red light phototransduction (GO:0009585)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|retina development in camera-type eye (GO:0060041)|retinoid metabolic process (GO:0001523)|rhodopsin mediated signaling pathway (GO:0016056)|visual perception (GO:0007601)	cell-cell junction (GO:0005911)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|photoreceptor disc membrane (GO:0097381)|photoreceptor inner segment (GO:0001917)|photoreceptor inner segment membrane (GO:0060342)|photoreceptor outer segment (GO:0001750)|photoreceptor outer segment membrane (GO:0042622)|plasma membrane (GO:0005886)|rough endoplasmic reticulum membrane (GO:0030867)	G-protein coupled receptor activity (GO:0004930)|metal ion binding (GO:0046872)|photoreceptor activity (GO:0009881)|retinal binding (GO:0016918)			breast(1)|endometrium(1)|large_intestine(10)|lung(6)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	22		all_neural(597;0.0227)|Myeloproliferative disorder(1037;0.0255)|Prostate(884;0.183)		GBM - Glioblastoma multiforme(114;2.58e-05)|Lung(219;0.0234)	Halothane(DB01159)	TTCCAGTTCCGGAACTGCATG	0.622																																					p.R314Q	Esophageal Squamous(118;214 1623 30842 43234 46940)	Atlas-SNP	.											.	RHO	57	.	0			c.G941A						.						153.0	134.0	140.0					3																	129252455		2203	4300	6503	SO:0001583	missense	6010	exon5			AGTTCCGGAACTG	AB065668	CCDS3063.1	3q21-q24	2014-01-28	2008-04-16		ENSG00000163914	ENSG00000163914		"""GPCR / Class A : Opsin receptors"""	10012	protein-coding gene	gene with protein product	"""opsin 2, rod pigment"""	180380	"""retinitis pigmentosa 4, autosomal dominant"""	RP4		2016091	Standard	NM_000539		Approved	OPN2, CSNBAD1	uc003emt.3	P08100	OTTHUMG00000159542	ENST00000296271.3:c.941G>A	chr3.hg19:g.129252455G>A	ENSP00000296271:p.Arg314Gln	33.0	0.0		68.0	33.0	NM_000539	Q16414|Q2M249	Missense_Mutation	SNP	ENST00000296271.3	hg19	CCDS3063.1	.	.	.	.	.	.	.	.	.	.	G	35	5.479852	0.96307	.	.	ENSG00000163914	ENST00000296271	T	0.57273	0.41	5.21	5.21	0.72293	.	0.000000	0.85682	D	0.000000	T	0.72439	0.3460	M	0.70275	2.135	0.80722	D	1	D	0.76494	0.999	D	0.71870	0.975	T	0.75909	-0.3151	10	0.87932	D	0	.	18.7559	0.91832	0.0:0.0:1.0:0.0	.	314	P08100	OPSD_HUMAN	Q	314	ENSP00000296271:R314Q	ENSP00000296271:R314Q	R	+	2	0	RHO	130735145	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	9.383000	0.97214	2.428000	0.82296	0.655000	0.94253	CGG	.	.		0.622	RHO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356101.1	NM_000539	
UGT2B15	7366	hgsc.bcm.edu	37	4	69535667	69535667	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A10Y-01A-11D-A12Z-10	TCGA-BC-A10Y-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	54f8357c-9dd7-4e08-bd47-a1ebedb30b62	5589b608-e6ae-4953-8a37-484d4116179b	g.chr4:69535667A>G	ENST00000338206.5	-	1	679	c.670T>C	c.(670-672)Tgg>Cgg	p.W224R		NM_001076.3	NP_001067.2	P54855	UDB15_HUMAN	UDP glucuronosyltransferase 2 family, polypeptide B15	224					cellular glucuronidation (GO:0052695)|steroid metabolic process (GO:0008202)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	glucuronosyltransferase activity (GO:0015020)									Acetaminophen(DB00316)|Dabigatran etexilate(DB06695)|Ezetimibe(DB00973)|Lorazepam(DB00186)|Morphine(DB00295)|Oxazepam(DB00842)|Valproic Acid(DB00313)	ATTTGAAACCAAAAGTCAAAA	0.328																																					p.W224R		Atlas-SNP	.											.	UGT2B15	48	.	0			c.T670C						.						100.0	111.0	107.0					4																	69535667		2203	4296	6499	SO:0001583	missense	7366	exon1			GAAACCAAAAGTC	AF180322	CCDS3524.1	4q13	2008-02-05	2005-07-20		ENSG00000196620	ENSG00000196620		"""UDP glucuronosyltransferases"""	12546	protein-coding gene	gene with protein product		600069	"""UDP glycosyltransferase 2 family, polypeptide B15"""			7835904	Standard	NM_001076		Approved	UGT2B8	uc021xow.1	P54855	OTTHUMG00000161507	ENST00000338206.5:c.670T>C	chr4.hg19:g.69535667A>G	ENSP00000341045:p.Trp224Arg	429.0	2.0		184.0	147.0	NM_001076	A6NDX0|A6NNJ4|A8K054|P23765|Q9UK63	Missense_Mutation	SNP	ENST00000338206.5	hg19	CCDS3524.1	.	.	.	.	.	.	.	.	.	.	a	6.602	0.479446	0.12581	.	.	ENSG00000196620	ENST00000338206	T	0.60424	0.19	2.79	2.79	0.32731	.	0.376195	0.20935	U	0.083027	T	0.50956	0.1646	M	0.64567	1.98	0.23192	N	0.998149	B	0.15473	0.013	B	0.23852	0.049	T	0.50363	-0.8837	10	0.59425	D	0.04	.	5.9768	0.19385	0.7309:0.2691:0.0:0.0	.	224	P54855	UDB15_HUMAN	R	224	ENSP00000341045:W224R	ENSP00000341045:W224R	W	-	1	0	UGT2B15	69218262	0.010000	0.17322	1.000000	0.80357	0.578000	0.36192	1.985000	0.40668	1.259000	0.44117	0.363000	0.22086	TGG	.	.		0.328	UGT2B15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365172.1	NM_001076	
NIPAL4	348938	hgsc.bcm.edu	37	5	156899886	156899886	+	Missense_Mutation	SNP	A	A	G	rs536139990		TCGA-BC-A10Y-01A-11D-A12Z-10	TCGA-BC-A10Y-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	54f8357c-9dd7-4e08-bd47-a1ebedb30b62	5589b608-e6ae-4953-8a37-484d4116179b	g.chr5:156899886A>G	ENST00000311946.7	+	6	1435	c.1319A>G	c.(1318-1320)aAg>aGg	p.K440R	NIPAL4_ENST00000435489.2_Missense_Mutation_p.K421R|ADAM19_ENST00000430702.2_Intron	NM_001099287.1	NP_001092757.1	Q0D2K0	NIPA4_HUMAN	NIPA-like domain containing 4	440						integral component of membrane (GO:0016021)	magnesium ion transmembrane transporter activity (GO:0015095)			breast(3)|endometrium(3)|kidney(1)|large_intestine(1)|lung(12)|prostate(1)|skin(1)	22						CTGGAAGACAAGAACGTCCTT	0.483																																					p.K440R		Atlas-SNP	.											.	NIPAL4	48	.	0			c.A1319G						.						45.0	44.0	45.0					5																	156899886		1897	4129	6026	SO:0001583	missense	348938	exon6			AAGACAAGAACGT	AK026158	CCDS47328.1, CCDS54944.1	5q33.3	2009-03-24	2009-03-24		ENSG00000172548	ENSG00000172548			28018	protein-coding gene	gene with protein product	"""ichthyin"""	609383	"""NIPA-like 4"""			8619474, 9110174, 15317751	Standard	NM_001099287		Approved	ICHYN	uc003lwx.4	Q0D2K0	OTTHUMG00000163497	ENST00000311946.7:c.1319A>G	chr5.hg19:g.156899886A>G	ENSP00000311687:p.Lys440Arg	80.0	0.0		82.0	34.0	NM_001099287	A8S6F1|A8S6F5|A8S6F8|B4DLF3|Q0D2J8|Q0D2J9	Missense_Mutation	SNP	ENST00000311946.7	hg19	CCDS47328.1	.	.	.	.	.	.	.	.	.	.	A	17.97	3.518720	0.64634	.	.	ENSG00000172548	ENST00000435489;ENST00000311946	D;D	0.91521	-2.73;-2.86	5.93	5.93	0.95920	.	0.000000	0.85682	D	0.000000	D	0.91630	0.7355	N	0.24115	0.695	0.58432	D	0.999991	D;D	0.89917	1.0;0.999	D;D	0.85130	0.997;0.994	D	0.91331	0.5090	10	0.35671	T	0.21	-30.6807	16.3829	0.83481	1.0:0.0:0.0:0.0	.	421;440	Q0D2K0-2;Q0D2K0	.;NIPA4_HUMAN	R	421;440	ENSP00000406456:K421R;ENSP00000311687:K440R	ENSP00000311687:K440R	K	+	2	0	NIPAL4	156832464	1.000000	0.71417	1.000000	0.80357	0.409000	0.31022	5.975000	0.70475	2.271000	0.75665	0.459000	0.35465	AAG	.	.		0.483	NIPAL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373789.1	NM_001099287	
SLIT3	6586	hgsc.bcm.edu	37	5	168119629	168119629	+	Silent	SNP	G	G	A			TCGA-BC-A10Y-01A-11D-A12Z-10	TCGA-BC-A10Y-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	54f8357c-9dd7-4e08-bd47-a1ebedb30b62	5589b608-e6ae-4953-8a37-484d4116179b	g.chr5:168119629G>A	ENST00000519560.1	-	29	3578	c.3159C>T	c.(3157-3159)ccC>ccT	p.P1053P	SLIT3_ENST00000332966.8_Silent_p.P1060P|SLIT3_ENST00000404867.3_Silent_p.P1053P	NM_001271946.1|NM_003062.2	NP_001258875.1|NP_003053	O75094	SLIT3_HUMAN	slit homolog 3 (Drosophila)	1053	EGF-like 4. {ECO:0000255|PROSITE- ProRule:PRU00076}.				apoptotic process involved in luteolysis (GO:0061364)|axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|cellular response to hormone stimulus (GO:0032870)|negative chemotaxis (GO:0050919)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of gene expression (GO:0010629)|organ morphogenesis (GO:0009887)|response to cortisol (GO:0051414)|Roundabout signaling pathway (GO:0035385)	extracellular space (GO:0005615)|mitochondrion (GO:0005739)	calcium ion binding (GO:0005509)|Roundabout binding (GO:0048495)			endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(15)|liver(2)|lung(48)|ovary(4)|prostate(7)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	100	Renal(175;0.000159)|Lung NSC(126;0.0174)|all_lung(126;0.0392)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			CTTTGTCCAGGGGGATGCACT	0.542																																					p.P1060P	Ovarian(29;311 847 10864 17279 24903)	Atlas-SNP	.											.	SLIT3	224	.	0			c.C3180T						.						112.0	85.0	94.0					5																	168119629		2203	4300	6503	SO:0001819	synonymous_variant	6586	exon29			GTCCAGGGGGATG	AB011538	CCDS4369.1, CCDS64311.1	5q35	2008-07-18	2001-11-28		ENSG00000184347	ENSG00000184347			11087	protein-coding gene	gene with protein product		603745	"""slit (Drosophila) homolog 3"""	SLIL2		9693030, 9813312	Standard	NM_001271946		Approved	slit2, MEGF5, SLIT1, Slit-3	uc010jjg.4	O75094	OTTHUMG00000130409	ENST00000519560.1:c.3159C>T	chr5.hg19:g.168119629G>A		73.0	0.0		90.0	9.0	NM_001271946	A6H8U9|J3KNP3|O95804|Q9UFH5	Silent	SNP	ENST00000519560.1	hg19	CCDS4369.1																																																																																			.	.		0.542	SLIT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252792.4	NM_003062	
SERPINB6	5269	hgsc.bcm.edu	37	6	2959566	2959566	+	Start_Codon_SNP	SNP	T	T	C			TCGA-BC-A10Y-01A-11D-A12Z-10	TCGA-BC-A10Y-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	54f8357c-9dd7-4e08-bd47-a1ebedb30b62	5589b608-e6ae-4953-8a37-484d4116179b	g.chr6:2959566T>C	ENST00000380520.1	-	1	1995	c.1A>G	c.(1-3)Atg>Gtg	p.M1V	SERPINB6_ENST00000380539.1_Start_Codon_SNP_p.M1V|SERPINB6_ENST00000380546.3_Start_Codon_SNP_p.M1V|SERPINB6_ENST00000380524.1_Start_Codon_SNP_p.M1V|SERPINB6_ENST00000335686.5_Start_Codon_SNP_p.M1V|SERPINB6_ENST00000380529.1_Start_Codon_SNP_p.M1V			P35237	SPB6_HUMAN	serpin peptidase inhibitor, clade B (ovalbumin), member 6	1					negative regulation of endopeptidase activity (GO:0010951)|regulation of proteolysis (GO:0030162)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|protein complex (GO:0043234)	protease binding (GO:0002020)|serine-type endopeptidase inhibitor activity (GO:0004867)			breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(8)|stomach(1)|upper_aerodigestive_tract(2)	17	Ovarian(93;0.0412)	all_hematologic(90;0.0895)			Drotrecogin alfa(DB00055)	AGAACATCCATGATGGCAGAC	0.473																																					p.M20V		Atlas-SNP	.											.	SERPINB6	31	.	0			c.A58G						.						122.0	113.0	116.0					6																	2959566		2203	4300	6503	SO:0001582	initiator_codon_variant	5269	exon2			CATCCATGATGGC	Z22658	CCDS4479.1, CCDS75386.1, CCDS75387.1	6p25.2	2014-02-18	2005-08-18		ENSG00000124570	ENSG00000124570		"""Serine (or cysteine) peptidase inhibitors"""	8950	protein-coding gene	gene with protein product	"""cytoplasmic antiproteinase"""	173321	"""serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 6"", ""deafness, autosomal recessive 91"""	PI6, DFNB91		8415716, 9858835, 20451170, 24172014	Standard	NM_004568		Approved	PTI, CAP	uc031smo.1	P35237	OTTHUMG00000016170	ENST00000380520.1:c.1A>G	chr6.hg19:g.2959566T>C	ENSP00000369891:p.Met1Val	130.0	0.0		155.0	65.0	NM_001271823	B2RBA8|Q59F97|Q5TD06|Q7Z2Y7|Q96J44|Q9UDI7	Missense_Mutation	SNP	ENST00000380520.1	hg19	CCDS4479.1	.	.	.	.	.	.	.	.	.	.	T	14.20	2.463937	0.43736	.	.	ENSG00000124570	ENST00000380524;ENST00000380520;ENST00000335686;ENST00000380529;ENST00000380539;ENST00000380546;ENST00000440670	D;D;D;D;D;D	0.82255	-1.59;-1.59;-1.59;-1.59;-1.59;-1.59	4.74	4.74	0.60224	Serpin domain (1);	0.181994	0.56097	D	0.000025	D	0.89220	0.6653	.	.	.	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.90937	0.4794	9	0.87932	D	0	.	13.7526	0.62917	0.0:0.0:0.0:1.0	.	1	P35237	SPB6_HUMAN	V	1	ENSP00000369896:M1V;ENSP00000369891:M1V;ENSP00000338358:M1V;ENSP00000369901:M1V;ENSP00000369912:M1V;ENSP00000369919:M1V	ENSP00000338358:M1V	M	-	1	0	SERPINB6	2904565	1.000000	0.71417	0.992000	0.48379	0.223000	0.24884	6.287000	0.72671	2.055000	0.61198	0.482000	0.46254	ATG	.	.		0.473	SERPINB6-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043422.1		Missense_Mutation
PDGFA	5154	hgsc.bcm.edu	37	7	550578	550578	+	Silent	SNP	C	C	T			TCGA-BC-A10Y-01A-11D-A12Z-10	TCGA-BC-A10Y-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	54f8357c-9dd7-4e08-bd47-a1ebedb30b62	5589b608-e6ae-4953-8a37-484d4116179b	g.chr7:550578C>T	ENST00000354513.5	-	4	713	c.321G>A	c.(319-321)cgG>cgA	p.R107R	PDGFA_ENST00000402802.3_Silent_p.R107R|PDGFA_ENST00000426681.2_5'Flank	NM_002607.5	NP_002598.4	P04085	PDGFA_HUMAN	platelet-derived growth factor alpha polypeptide	107					actin cytoskeleton organization (GO:0030036)|angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cell activation (GO:0001775)|cell projection assembly (GO:0030031)|cell-cell signaling (GO:0007267)|embryo development (GO:0009790)|epidermal growth factor receptor signaling pathway (GO:0007173)|extracellular matrix organization (GO:0030198)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|hair follicle development (GO:0001942)|innate immune response (GO:0045087)|inner ear development (GO:0048839)|lung alveolus development (GO:0048286)|negative chemotaxis (GO:0050919)|negative regulation of phosphatidylinositol biosynthetic process (GO:0010512)|negative regulation of platelet activation (GO:0010544)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ morphogenesis (GO:0009887)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA replication (GO:0045740)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of metanephric mesenchymal cell migration by platelet-derived growth factor receptor-beta signaling pathway (GO:0035793)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein autophosphorylation (GO:0031954)|positive regulation of protein kinase B signaling (GO:0051897)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of branching involved in salivary gland morphogenesis by epithelial-mesenchymal signaling (GO:0060683)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|regulation of smooth muscle cell migration (GO:0014910)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to hypoxia (GO:0001666)|response to inorganic substance (GO:0010035)|response to retinoic acid (GO:0032526)|response to wounding (GO:0009611)|skin development (GO:0043588)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing (GO:0042060)	cell surface (GO:0009986)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi membrane (GO:0000139)|microvillus (GO:0005902)|platelet alpha granule lumen (GO:0031093)	collagen binding (GO:0005518)|growth factor activity (GO:0008083)|platelet-derived growth factor binding (GO:0048407)|platelet-derived growth factor receptor binding (GO:0005161)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(8)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	16		Ovarian(82;0.0112)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0178)|Epithelial(4;1.1e-17)|OV - Ovarian serous cystadenocarcinoma(56;1.7e-17)|all cancers(6;4.89e-15)		CGACCTGACTCCGAGGAATCT	0.647																																					p.R107R		Atlas-SNP	.											.	PDGFA	34	.	0			c.G321A						.						72.0	57.0	62.0					7																	550578		2202	4300	6502	SO:0001819	synonymous_variant	5154	exon4			CTGACTCCGAGGA		CCDS34578.1, CCDS47524.1	7p22	2008-07-18			ENSG00000197461	ENSG00000197461			8799	protein-coding gene	gene with protein product	"""PDGF A-chain"", ""platelet-derived growth factor alpha chain"""	173430				1505216, 2536956	Standard	NM_002607		Approved	PDGF1, PDGF-A	uc003sir.3	P04085	OTTHUMG00000151412	ENST00000354513.5:c.321G>A	chr7.hg19:g.550578C>T		93.0	0.0		137.0	63.0	NM_002607	B5BU73	Silent	SNP	ENST00000354513.5	hg19	CCDS34578.1	.	.	.	.	.	.	.	.	.	.	c	3.113	-0.182242	0.06340	.	.	ENSG00000197461	ENST00000400761	.	.	.	4.69	1.76	0.24704	.	.	.	.	.	T	0.45538	0.1347	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.27739	-1.0065	4	.	.	.	-15.6095	3.0708	0.06230	0.143:0.5642:0.1386:0.1542	.	.	.	.	K	114	.	.	E	-	1	0	PDGFA	517104	0.985000	0.35326	1.000000	0.80357	0.113000	0.19764	0.340000	0.19892	0.420000	0.25954	-0.251000	0.11542	GAG	.	.		0.647	PDGFA-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000322534.1		
PCLO	27445	hgsc.bcm.edu	37	7	82464992	82464992	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A10Y-01A-11D-A12Z-10	TCGA-BC-A10Y-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	54f8357c-9dd7-4e08-bd47-a1ebedb30b62	5589b608-e6ae-4953-8a37-484d4116179b	g.chr7:82464992T>C	ENST00000333891.9	-	16	14577	c.14240A>G	c.(14239-14241)cAg>cGg	p.Q4747R	PCLO_ENST00000426442.2_Intron|PCLO_ENST00000423517.2_Missense_Mutation_p.Q4747R	NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein											breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						CCTTGCATTCTGGACAACCAT	0.388																																					p.Q4747R		Atlas-SNP	.											.	PCLO	1506	.	0			c.A14240G						.						59.0	58.0	58.0					7																	82464992		1889	4129	6018	SO:0001583	missense	27445	exon16			GCATTCTGGACAA	AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.14240A>G	chr7.hg19:g.82464992T>C	ENSP00000334319:p.Gln4747Arg	162.0	0.0		180.0	84.0	NM_014510		Missense_Mutation	SNP	ENST00000333891.9	hg19	CCDS47630.1	.	.	.	.	.	.	.	.	.	.	T	15.84	2.952682	0.53293	.	.	ENSG00000186472	ENST00000333891;ENST00000423517	T;T	0.40756	1.02;1.02	5.88	5.88	0.94601	.	.	.	.	.	T	0.53302	0.1788	N	0.25890	0.77	0.80722	D	1	D;D	0.65815	0.995;0.995	D;D	0.85130	0.997;0.997	T	0.57619	-0.7780	9	0.87932	D	0	.	15.958	0.79902	0.0:0.0:0.0:1.0	.	4747;4747	Q9Y6V0-5;Q9Y6V0-6	.;.	R	4747	ENSP00000334319:Q4747R;ENSP00000388393:Q4747R	ENSP00000334319:Q4747R	Q	-	2	0	PCLO	82302928	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.816000	0.86201	2.243000	0.73865	0.528000	0.53228	CAG	.	.		0.388	PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337368.5	NM_014510	
LAMB4	22798	hgsc.bcm.edu	37	7	107688358	107688358	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A10Y-01A-11D-A12Z-10	TCGA-BC-A10Y-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	54f8357c-9dd7-4e08-bd47-a1ebedb30b62	5589b608-e6ae-4953-8a37-484d4116179b	g.chr7:107688358T>C	ENST00000388781.3	-	28	4404	c.4321A>G	c.(4321-4323)Aat>Gat	p.N1441D	LAMB4_ENST00000205386.4_Missense_Mutation_p.N1441D|LAMB4_ENST00000388780.3_Missense_Mutation_p.N1441D	NM_007356.2	NP_031382.2	A4D0S4	LAMB4_HUMAN	laminin, beta 4	1441	Domain I.				cell adhesion (GO:0007155)	basement membrane (GO:0005604)				NS(1)|breast(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(22)|lung(40)|ovary(4)|prostate(5)|skin(4)	97						TTTACCTGATTTTTCAACCCA	0.383																																					p.N1441D		Atlas-SNP	.											.	LAMB4	253	.	0			c.A4321G						.						62.0	66.0	65.0					7																	107688358		2203	4300	6503	SO:0001583	missense	22798	exon28			CCTGATTTTTCAA	AF028816	CCDS34732.1	7q31	2013-03-01			ENSG00000091128	ENSG00000091128		"""Laminins"""	6491	protein-coding gene	gene with protein product							Standard	NM_007356		Approved		uc010ljo.1	A4D0S4	OTTHUMG00000154874	ENST00000388781.3:c.4321A>G	chr7.hg19:g.107688358T>C	ENSP00000373433:p.Asn1441Asp	374.0	0.0		354.0	168.0	NM_007356	A5PKU6|B2RTT3|B5MEB9|Q86TP7|Q86XN2|Q8NBX5	Missense_Mutation	SNP	ENST00000388781.3	hg19	CCDS34732.1	.	.	.	.	.	.	.	.	.	.	T	11.60	1.687673	0.29962	.	.	ENSG00000091128	ENST00000205386;ENST00000388781;ENST00000422975;ENST00000388780	T;T;T;T	0.31510	1.49;1.49;1.9;1.51	4.69	4.69	0.59074	.	0.114976	0.38436	N	0.001692	T	0.26593	0.0650	L	0.27053	0.805	0.80722	D	1	B;P	0.46784	0.03;0.884	B;P	0.46419	0.012;0.516	T	0.02294	-1.1181	10	0.18710	T	0.47	.	13.9803	0.64301	0.0:0.0:0.0:1.0	.	1441;1441	A4D0S4-3;A4D0S4	.;LAMB4_HUMAN	D	1441;1441;467;1441	ENSP00000205386:N1441D;ENSP00000373433:N1441D;ENSP00000416562:N467D;ENSP00000373432:N1441D	ENSP00000205386:N1441D	N	-	1	0	LAMB4	107475594	1.000000	0.71417	0.769000	0.31535	0.189000	0.23516	2.397000	0.44477	1.972000	0.57404	0.482000	0.46254	AAT	.	.		0.383	LAMB4-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337442.1	XM_209857	
NRCAM	4897	hgsc.bcm.edu	37	7	107866734	107866734	+	Silent	SNP	G	G	A			TCGA-BC-A10Y-01A-11D-A12Z-10	TCGA-BC-A10Y-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	54f8357c-9dd7-4e08-bd47-a1ebedb30b62	5589b608-e6ae-4953-8a37-484d4116179b	g.chr7:107866734G>A	ENST00000425651.2	-	6	638	c.639C>T	c.(637-639)cgC>cgT	p.R213R	NRCAM_ENST00000351718.4_Silent_p.R207R|NRCAM_ENST00000413765.2_Silent_p.R213R|NRCAM_ENST00000379028.3_Silent_p.R213R|NRCAM_ENST00000379024.4_Silent_p.R213R|NRCAM_ENST00000379022.4_Silent_p.R213R	NM_001037132.2	NP_001032209.1	Q92823	NRCAM_HUMAN	neuronal cell adhesion molecule	213	Ig-like 2.				angiogenesis (GO:0001525)|axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|axonogenesis (GO:0007409)|central nervous system development (GO:0007417)|clustering of voltage-gated sodium channels (GO:0045162)|heterotypic cell-cell adhesion (GO:0034113)|neuron migration (GO:0001764)|neuronal action potential propagation (GO:0019227)|positive regulation of neuron differentiation (GO:0045666)|protein localization (GO:0008104)|regulation of axon extension (GO:0030516)|retinal ganglion cell axon guidance (GO:0031290)|single organismal cell-cell adhesion (GO:0016337)|synapse assembly (GO:0007416)	axon initial segment (GO:0043194)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|synapse (GO:0045202)	ankyrin binding (GO:0030506)			breast(4)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(8)|liver(1)|lung(36)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(4)	65						TATAGTCTTCGCGGGTGTCCT	0.428																																					p.R213R		Atlas-SNP	.											.	NRCAM	267	.	0			c.C639T						.						127.0	134.0	132.0					7																	107866734		2203	4300	6503	SO:0001819	synonymous_variant	4897	exon6			GTCTTCGCGGGTG		CCDS5751.1, CCDS47686.1, CCDS55153.1, CCDS75652.1	7q31	2013-02-11			ENSG00000091129	ENSG00000091129		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	7994	protein-coding gene	gene with protein product	"""NgCAM-related cell adhesion molecule"""	601581				8812479	Standard	NM_001037132		Approved	KIAA0343, Bravo	uc022aka.1	Q92823	OTTHUMG00000154973	ENST00000425651.2:c.639C>T	chr7.hg19:g.107866734G>A		62.0	0.0		47.0	21.0	NM_001037132	A4D0S3|E9PDA4|O15051|O15179|Q14BM2|Q9UHI3|Q9UHI4	Silent	SNP	ENST00000425651.2	hg19	CCDS47686.1																																																																																			.	.		0.428	NRCAM-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337942.2	NM_001037132	
KMT2C	58508	hgsc.bcm.edu	37	7	151873592	151873592	+	Silent	SNP	A	A	C			TCGA-BC-A10Y-01A-11D-A12Z-10	TCGA-BC-A10Y-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	54f8357c-9dd7-4e08-bd47-a1ebedb30b62	5589b608-e6ae-4953-8a37-484d4116179b	g.chr7:151873592A>C	ENST00000262189.6	-	38	9164	c.8946T>G	c.(8944-8946)gtT>gtG	p.V2982V	KMT2C_ENST00000355193.2_Silent_p.V2982V	NM_170606.2	NP_733751.2	Q8NEZ4	KMT2C_HUMAN	lysine (K)-specific methyltransferase 2C	2982					histone H3-K4 methylation (GO:0051568)|intracellular signal transduction (GO:0035556)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)										CCTGAGAAAAAACATGGTTTA	0.473																																					p.V2982V		Atlas-SNP	.											.	MLL3	1564	.	0			c.T8946G						.						55.0	53.0	54.0					7																	151873592		2203	4300	6503	SO:0001819	synonymous_variant	58508	exon38			AGAAAAAACATGG	AF264750	CCDS5931.1	7q36	2013-05-09	2013-05-09	2013-05-09	ENSG00000055609	ENSG00000055609		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	13726	protein-coding gene	gene with protein product		606833	"""myeloid/lymphoid or mixed-lineage leukemia 3"""	MLL3		10819331	Standard	XM_005250026		Approved	KIAA1506, HALR		Q8NEZ4	OTTHUMG00000150553	ENST00000262189.6:c.8946T>G	chr7.hg19:g.151873592A>C		191.0	0.0		187.0	76.0	NM_170606	Q8NC02|Q8NDF6|Q9H9P4|Q9NR13|Q9P222|Q9UDR7	Silent	SNP	ENST00000262189.6	hg19	CCDS5931.1	.	.	.	.	.	.	.	.	.	.	A	5.855	0.341872	0.11069	.	.	ENSG00000055609	ENST00000360104	.	.	.	5.47	0.266	0.15617	.	.	.	.	.	T	0.44973	0.1319	.	.	.	0.52099	D	0.999947	.	.	.	.	.	.	T	0.22452	-1.0216	4	.	.	.	.	3.6374	0.08154	0.4698:0.0:0.2762:0.254	.	.	.	.	V	488	.	.	F	-	1	0	MLL3	151504525	0.682000	0.27624	0.829000	0.32907	0.966000	0.64601	0.648000	0.24828	-0.182000	0.10602	-0.256000	0.11100	TTT	.	.		0.473	KMT2C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318887.3		
ZHX2	22882	hgsc.bcm.edu	37	8	123965265	123965265	+	Silent	SNP	C	C	A			TCGA-BC-A10Y-01A-11D-A12Z-10	TCGA-BC-A10Y-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	54f8357c-9dd7-4e08-bd47-a1ebedb30b62	5589b608-e6ae-4953-8a37-484d4116179b	g.chr8:123965265C>A	ENST00000314393.4	+	3	2350	c.1515C>A	c.(1513-1515)tcC>tcA	p.S505S		NM_014943.3	NP_055758.1	Q9Y6X8	ZHX2_HUMAN	zinc fingers and homeoboxes 2	505					mRNA catabolic process (GO:0006402)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(10)|lung(15)|ovary(1)|prostate(1)|skin(4)|stomach(3)|urinary_tract(1)	45	Lung NSC(37;2e-09)|Ovarian(258;0.0205)|Hepatocellular(40;0.105)		STAD - Stomach adenocarcinoma(47;0.00527)			CCAGCGAATCCCTTGCCAAAG	0.562																																					p.S505S	Esophageal Squamous(94;1056 1388 11767 13799 49639)	Atlas-SNP	.											.	ZHX2	106	.	0			c.C1515A						.						83.0	67.0	72.0					8																	123965265		2203	4300	6503	SO:0001819	synonymous_variant	22882	exon3			CGAATCCCTTGCC	AB020661	CCDS6336.1	8q24.13	2012-03-09	2004-01-23		ENSG00000178764	ENSG00000178764		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	18513	protein-coding gene	gene with protein product		609185	"""zinc-fingers and homeoboxes 2"""			10048485, 12741956	Standard	XM_005250837		Approved	KIAA0854	uc003ypk.1	Q9Y6X8	OTTHUMG00000165077	ENST00000314393.4:c.1515C>A	chr8.hg19:g.123965265C>A		31.0	0.0		40.0	17.0	NM_014943		Silent	SNP	ENST00000314393.4	hg19	CCDS6336.1																																																																																			.	.		0.562	ZHX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381709.1	NM_014943	
TRPM6	140803	hgsc.bcm.edu	37	9	77416900	77416900	+	Silent	SNP	C	C	T	rs372508531		TCGA-BC-A10Y-01A-11D-A12Z-10	TCGA-BC-A10Y-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	54f8357c-9dd7-4e08-bd47-a1ebedb30b62	5589b608-e6ae-4953-8a37-484d4116179b	g.chr9:77416900C>T	ENST00000360774.1	-	16	2160	c.1923G>A	c.(1921-1923)gcG>gcA	p.A641A	TRPM6_ENST00000451710.3_Silent_p.A641A|TRPM6_ENST00000361255.3_Silent_p.A636A|TRPM6_ENST00000376864.4_Silent_p.A641A|TRPM6_ENST00000376872.3_Intron|TRPM6_ENST00000376871.3_Intron|RN7SKP47_ENST00000365347.1_RNA|TRPM6_ENST00000449912.2_Silent_p.A636A	NM_017662.4	NP_060132.3	Q9BX84	TRPM6_HUMAN	transient receptor potential cation channel, subfamily M, member 6	641					calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|response to toxic substance (GO:0009636)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium channel activity (GO:0005262)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(22)|liver(1)|lung(53)|ovary(1)|prostate(7)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	126						AGAGGATACACGCAATCACGG	0.493																																					p.A641A		Atlas-SNP	.											.	TRPM6	377	.	0			c.G1923A						.	C	,,	0,4406		0,0,2203	146.0	122.0	130.0		1908,1908,1923	-6.3	0.1	9		130	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous,coding-synonymous	TRPM6	NM_001177310.1,NM_001177311.1,NM_017662.4	,,	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	,,	636/2018,636/2018,641/2023	77416900	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	140803	exon16			GATACACGCAATC	AK026281	CCDS6647.1, CCDS55318.1, CCDS55319.1	9q21.13	2011-12-14	2003-12-02		ENSG00000119121	ENSG00000119121		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17995	protein-coding gene	gene with protein product		607009	"""hypomagnesemia, secondary hypocalcemia"""	HOMG, HSH		10021370, 12032570, 16382100	Standard	NM_017662		Approved	CHAK2, FLJ22628	uc004ajk.1	Q9BX84	OTTHUMG00000020027	ENST00000360774.1:c.1923G>A	chr9.hg19:g.77416900C>T		168.0	0.0		192.0	84.0	NM_017662	Q6VPR8|Q6VPR9|Q6VPS0|Q6VPS1|Q6VPS2	Silent	SNP	ENST00000360774.1	hg19	CCDS6647.1																																																																																			.	.		0.493	TRPM6-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000052693.1	NM_017662	
PTCH1	5727	hgsc.bcm.edu	37	9	98268744	98268744	+	Silent	SNP	C	C	A			TCGA-BC-A10Y-01A-11D-A12Z-10	TCGA-BC-A10Y-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	54f8357c-9dd7-4e08-bd47-a1ebedb30b62	5589b608-e6ae-4953-8a37-484d4116179b	g.chr9:98268744C>A	ENST00000331920.6	-	2	638	c.339G>T	c.(337-339)gcG>gcT	p.A113A	PTCH1_ENST00000437951.1_Silent_p.A47A|PTCH1_ENST00000418258.1_5'UTR|PTCH1_ENST00000421141.1_5'UTR|PTCH1_ENST00000430669.2_Silent_p.A47A|RP11-435O5.5_ENST00000604104.1_RNA|PTCH1_ENST00000429896.2_5'UTR|PTCH1_ENST00000468211.2_Silent_p.A47A|PTCH1_ENST00000375274.2_Silent_p.A112A	NM_000264.3	NP_000255.2	Q13635	PTC1_HUMAN	patched 1	113					brain development (GO:0007420)|branching involved in ureteric bud morphogenesis (GO:0001658)|cell differentiation involved in kidney development (GO:0061005)|cell proliferation involved in metanephros development (GO:0072203)|cellular response to cholesterol (GO:0071397)|dorsal/ventral pattern formation (GO:0009953)|embryonic limb morphogenesis (GO:0030326)|embryonic organ development (GO:0048568)|epidermis development (GO:0008544)|glucose homeostasis (GO:0042593)|heart morphogenesis (GO:0003007)|hindlimb morphogenesis (GO:0035137)|in utero embryonic development (GO:0001701)|keratinocyte proliferation (GO:0043616)|limb morphogenesis (GO:0035108)|mammary gland duct morphogenesis (GO:0060603)|mammary gland epithelial cell differentiation (GO:0060644)|negative regulation of cell division (GO:0051782)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of multicellular organism growth (GO:0040015)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural plate axis specification (GO:0021997)|neural tube closure (GO:0001843)|neural tube patterning (GO:0021532)|organ morphogenesis (GO:0009887)|pharyngeal system development (GO:0060037)|positive regulation of cholesterol efflux (GO:0010875)|protein processing (GO:0016485)|protein targeting to plasma membrane (GO:0072661)|regulation of mitotic cell cycle (GO:0007346)|regulation of protein localization (GO:0032880)|regulation of smoothened signaling pathway (GO:0008589)|renal system development (GO:0072001)|response to chlorate (GO:0010157)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to mechanical stimulus (GO:0009612)|response to retinoic acid (GO:0032526)|smoothened signaling pathway (GO:0007224)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)|somite development (GO:0061053)|spinal cord motor neuron differentiation (GO:0021522)	axonal growth cone (GO:0044295)|caveola (GO:0005901)|dendritic growth cone (GO:0044294)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|midbody (GO:0030496)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|primary cilium (GO:0072372)	cholesterol binding (GO:0015485)|cyclin binding (GO:0030332)|hedgehog family protein binding (GO:0097108)|hedgehog receptor activity (GO:0008158)|heparin binding (GO:0008201)|smoothened binding (GO:0005119)			NS(8)|bone(33)|breast(10)|central_nervous_system(95)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(8)|kidney(2)|large_intestine(18)|lung(22)|meninges(1)|oesophagus(3)|ovary(6)|prostate(2)|skin(262)|upper_aerodigestive_tract(11)|urinary_tract(2)|vulva(1)	490		Medulloblastoma(1;7.87e-06)|all_neural(1;0.000555)|Acute lymphoblastic leukemia(62;0.136)				TTAATCCCACCGCGAAGGCCC	0.577																																					p.A113A		Atlas-SNP	.											.	PTCH1	1850	.	0			c.G339T						.						61.0	60.0	60.0					9																	98268744		2203	4300	6503	SO:0001819	synonymous_variant	5727	exon2			TCCCACCGCGAAG	AI494442	CCDS6714.1, CCDS43851.1, CCDS47995.1, CCDS47996.1	9q22.1-q31	2014-09-17	2010-06-24	2006-09-26	ENSG00000185920	ENSG00000185920			9585	protein-coding gene	gene with protein product		601309	"""patched (Drosophila) homolog"", ""patched homolog (Drosophila)"", ""patched homolog 1 (Drosophila)"""	NBCCS, PTCH		8658145	Standard	NM_001083603		Approved	BCNS	uc004avk.4	Q13635	OTTHUMG00000020280	ENST00000331920.6:c.339G>T	chr9.hg19:g.98268744C>A		181.0	0.0		200.0	90.0	NM_000264	A3KBI9|E9PEJ8|Q13463|Q5R1U7|Q5R1U9|Q5R1V0|Q5VZC0|Q5VZC2|Q86XG7	Silent	SNP	ENST00000331920.6	hg19	CCDS6714.1																																																																																			.	.		0.577	PTCH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053229.2	NM_000264	
GPSM1	26086	hgsc.bcm.edu	37	9	139234260	139234260	+	Silent	SNP	G	G	A			TCGA-BC-A10Y-01A-11D-A12Z-10	TCGA-BC-A10Y-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	54f8357c-9dd7-4e08-bd47-a1ebedb30b62	5589b608-e6ae-4953-8a37-484d4116179b	g.chr9:139234260G>A	ENST00000440944.1	+	8	1291	c.1071G>A	c.(1069-1071)caG>caA	p.Q357Q	GPSM1_ENST00000392945.3_Silent_p.Q357Q	NM_001145638.1	NP_001139110	Q86YR5	GPSM1_HUMAN	G-protein signaling modulator 1	357	Mediates association with membranes. {ECO:0000250}.				cell differentiation (GO:0030154)|nervous system development (GO:0007399)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	GDP-dissociation inhibitor activity (GO:0005092)			biliary_tract(1)|endometrium(1)|kidney(2)|lung(4)|upper_aerodigestive_tract(1)	9		Myeloproliferative disorder(178;0.0821)		OV - Ovarian serous cystadenocarcinoma(145;2.39e-06)|Epithelial(140;3.24e-06)		AGCACCTGCAGATCTCCCAGG	0.711																																					p.Q357Q		Atlas-SNP	.											.	GPSM1	50	.	0			c.G1071A						.						28.0	29.0	29.0					9																	139234260		1829	3503	5332	SO:0001819	synonymous_variant	26086	exon8			CCTGCAGATCTCC	AI272212	CCDS6996.2, CCDS48055.1, CCDS48056.1	9q34.3	2013-01-10	2010-06-24		ENSG00000160360	ENSG00000160360		"""Tetratricopeptide (TTC) repeat domain containing"""	17858	protein-coding gene	gene with protein product	"""AGS3 homolog (C. elegans)"""	609491	"""G-protein signalling modulator 1 (AGS3-like, C. elegans)"""			11278352, 10969064	Standard	NM_001145639		Approved	AGS3, DKFZP727I051	uc004chd.2	Q86YR5	OTTHUMG00000020930	ENST00000440944.1:c.1071G>A	chr9.hg19:g.139234260G>A		86.0	0.0		105.0	30.0	NM_015597	A9Z1X4|B1B0W3|Q86SR5|Q969T1|Q9UFS8	Silent	SNP	ENST00000440944.1	hg19	CCDS48055.1																																																																																			.	.		0.711	GPSM1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_015597	
RABL6	55684	hgsc.bcm.edu	37	9	139732077	139732077	+	Silent	SNP	G	G	A			TCGA-BC-A10Y-01A-11D-A12Z-10	TCGA-BC-A10Y-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	54f8357c-9dd7-4e08-bd47-a1ebedb30b62	5589b608-e6ae-4953-8a37-484d4116179b	g.chr9:139732077G>A	ENST00000311502.7	+	9	1325	c.1089G>A	c.(1087-1089)ggG>ggA	p.G363G	RABL6_ENST00000432842.2_Silent_p.G325G|RABL6_ENST00000371675.3_Silent_p.G248G|RABL6_ENST00000357466.2_Intron|RABL6_ENST00000371663.4_Silent_p.G364G			Q3YEC7	RABL6_HUMAN	RAB, member RAS oncogene family-like 6	363	Pro-rich.				small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	GTP binding (GO:0005525)										GGCTGTTTGGGACGTCACCTG	0.697																																					p.G364G		Atlas-SNP	.											.	.	.	.	0			c.G1092A						.						9.0	10.0	9.0					9																	139732077		1893	4086	5979	SO:0001819	synonymous_variant	55684	exon9			GTTTGGGACGTCA	AK094382	CCDS48058.1, CCDS55352.1, CCDS55353.1	9q34.3	2012-06-28	2012-06-28	2012-06-28	ENSG00000196642	ENSG00000196642			24703	protein-coding gene	gene with protein product	"""Rab-like protein 1"", ""partner of ARF"""	610615	"""chromosome 9 open reading frame 86"""	C9orf86		14702039, 16582619, 17962191, 19433581	Standard	NM_024718		Approved	FLJ10101, FLJ13045, pp8875, bA216L13.9, Parf, RBEL1	uc004cjj.1	Q3YEC7	OTTHUMG00000020947	ENST00000311502.7:c.1089G>A	chr9.hg19:g.139732077G>A		32.0	0.0		82.0	24.0	NM_001173988	A8QVZ7|A8QVZ8|C6K8I4|C6K8I5|Q4F968|Q5T5R7|Q8IWK1|Q8TCL4|Q8WU94|Q96SR8|Q9BU21|Q9H935	Silent	SNP	ENST00000311502.7	hg19	CCDS48058.1																																																																																			.	.		0.697	RABL6-009	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000055141.4	NM_024718	
MAN1B1	11253	hgsc.bcm.edu	37	9	140001761	140001761	+	Silent	SNP	C	C	T			TCGA-BC-A10Y-01A-11D-A12Z-10	TCGA-BC-A10Y-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	54f8357c-9dd7-4e08-bd47-a1ebedb30b62	5589b608-e6ae-4953-8a37-484d4116179b	g.chr9:140001761C>T	ENST00000371589.4	+	11	1699	c.1626C>T	c.(1624-1626)ccC>ccT	p.P542P	MAN1B1_ENST00000540391.1_3'UTR|MAN1B1_ENST00000474902.1_Silent_p.P245P	NM_016219.4	NP_057303.2	Q9UKM7	MA1B1_HUMAN	mannosidase, alpha, class 1B, member 1	542					cellular protein metabolic process (GO:0044267)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|oligosaccharide metabolic process (GO:0009311)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation (GO:0006487)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum quality control compartment (GO:0044322)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|vesicle (GO:0031982)	calcium ion binding (GO:0005509)|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity (GO:0004571)			autonomic_ganglia(1)|central_nervous_system(2)|kidney(1)|large_intestine(2)|liver(2)|lung(4)|ovary(2)	14	all_cancers(76;0.0926)	Myeloproliferative disorder(178;0.0511)	STAD - Stomach adenocarcinoma(284;0.0878)	OV - Ovarian serous cystadenocarcinoma(145;3.08e-05)|Epithelial(140;0.000513)		ACGGCCTGCCCGCCAGCCACA	0.632																																					p.P542P		Atlas-SNP	.											.	MAN1B1	40	.	0			c.C1626T						.						47.0	52.0	50.0					9																	140001761		2202	4300	6502	SO:0001819	synonymous_variant	11253	exon11			CCTGCCCGCCAGC	AF145732	CCDS7029.1	9q34.3	2014-05-27			ENSG00000177239	ENSG00000177239			6823	protein-coding gene	gene with protein product	"""endoplasmic reticulum alpha-mannosidase 1"", ""alpha 1,2-mannosidase"", ""endoplasmic reticulum mannosyl-oligosaccharide 1,2-alpha-mannosidase 1"", ""ER alpha 1,2-mannosidase"", ""Man9GlcNAc2-specific processing alpha-mannosidase"""	604346				10409699, 10521544	Standard	NM_016219		Approved	MANA-ER, MRT15	uc004cld.3	Q9UKM7	OTTHUMG00000020978	ENST00000371589.4:c.1626C>T	chr9.hg19:g.140001761C>T		162.0	0.0		264.0	89.0	NM_016219	Q5VSG3|Q9BRS9|Q9Y5K7	Silent	SNP	ENST00000371589.4	hg19	CCDS7029.1	.	.	.	.	.	.	.	.	.	.	C	0	-2.802124	0.00075	.	.	ENSG00000177239	ENST00000535144;ENST00000475449	.	.	.	4.47	-8.94	0.00768	.	.	.	.	.	T	0.14960	0.0361	.	.	.	0.26598	N	0.973067	.	.	.	.	.	.	T	0.08371	-1.0725	4	.	.	.	.	1.0599	0.01598	0.2887:0.0969:0.2715:0.343	.	.	.	.	C	516;16	.	.	R	+	1	0	MAN1B1	139121582	0.000000	0.05858	0.001000	0.08648	0.253000	0.25986	-5.232000	0.00139	-3.577000	0.00138	-1.319000	0.01295	CGC	.	.		0.632	MAN1B1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055294.2	NM_016219	
GRIN1	2902	hgsc.bcm.edu	37	9	140057425	140057425	+	Missense_Mutation	SNP	C	C	G			TCGA-BC-A10Y-01A-11D-A12Z-10	TCGA-BC-A10Y-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	54f8357c-9dd7-4e08-bd47-a1ebedb30b62	5589b608-e6ae-4953-8a37-484d4116179b	g.chr9:140057425C>G	ENST00000371561.3	+	15	3238	c.2141C>G	c.(2140-2142)gCg>gGg	p.A714G	GRIN1_ENST00000315048.3_Missense_Mutation_p.A714G|GRIN1_ENST00000371553.3_Missense_Mutation_p.A735G|GRIN1_ENST00000471122.1_3'UTR|GRIN1_ENST00000350902.5_Missense_Mutation_p.A714G|GRIN1_ENST00000371559.4_Missense_Mutation_p.A714G|GRIN1_ENST00000371560.3_Missense_Mutation_p.A735G|GRIN1_ENST00000371555.4_Missense_Mutation_p.A735G|GRIN1_ENST00000371546.4_Missense_Mutation_p.A735G|GRIN1_ENST00000371550.4_Missense_Mutation_p.A714G	NM_007327.3	NP_015566.1	Q05586	NMDZ1_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 1	714					adult locomotory behavior (GO:0008344)|calcium ion homeostasis (GO:0055074)|calcium ion transmembrane transport (GO:0070588)|cation transport (GO:0006812)|cellular calcium ion homeostasis (GO:0006874)|cellular response to manganese ion (GO:0071287)|cerebral cortex development (GO:0021987)|conditioned taste aversion (GO:0001661)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|long-term memory (GO:0007616)|male mating behavior (GO:0060179)|negative regulation of neuron apoptotic process (GO:0043524)|olfactory learning (GO:0008355)|pons maturation (GO:0021586)|positive regulation of apoptotic process (GO:0043065)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|prepulse inhibition (GO:0060134)|propylene metabolic process (GO:0018964)|protein tetramerization (GO:0051262)|regulation of axonogenesis (GO:0050770)|regulation of dendrite morphogenesis (GO:0048814)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of membrane potential (GO:0042391)|regulation of respiratory gaseous exchange (GO:0043576)|regulation of synapse assembly (GO:0051963)|respiratory gaseous exchange (GO:0007585)|response to amphetamine (GO:0001975)|response to calcium ion (GO:0051592)|response to ethanol (GO:0045471)|response to fungicide (GO:0060992)|response to morphine (GO:0043278)|rhythmic process (GO:0048511)|sensory perception of pain (GO:0019233)|social behavior (GO:0035176)|suckling behavior (GO:0001967)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|visual learning (GO:0008542)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|dendrite membrane (GO:0032590)|dendritic spine (GO:0043197)|endoplasmic reticulum (GO:0005783)|excitatory synapse (GO:0060076)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)|synaptic cleft (GO:0043083)|synaptic vesicle (GO:0008021)|terminal bouton (GO:0043195)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glutamate binding (GO:0016595)|glycine binding (GO:0016594)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|neurotransmitter binding (GO:0042165)|voltage-gated cation channel activity (GO:0022843)			NS(1)|breast(1)|endometrium(1)|kidney(1)|lung(7)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	15	all_cancers(76;0.0926)		STAD - Stomach adenocarcinoma(284;0.0878)	OV - Ovarian serous cystadenocarcinoma(145;6.87e-05)|Epithelial(140;0.00095)	Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Gabapentin(DB00996)|Ketobemidone(DB06738)|Memantine(DB01043)|Milnacipran(DB04896)|Orphenadrine(DB01173)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	TACGAGAGTGCGGCGGAGGCC	0.677																																					p.A735G	NSCLC(113;717 1653 2089 20474 37618)	Atlas-SNP	.											.	GRIN1	51	.	0			c.C2204G						.						24.0	21.0	22.0					9																	140057425		2198	4296	6494	SO:0001583	missense	2902	exon16			AGAGTGCGGCGGA		CCDS7031.1, CCDS7032.1, CCDS43910.1, CCDS55354.1, CCDS55355.1	9q34.3	2013-01-11			ENSG00000176884	ENSG00000176884		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4584	protein-coding gene	gene with protein product		138249	"""N-methyl-D-aspartate receptor subunit NR1"""	NMDAR1		1350383	Standard	NM_000832		Approved	GluN1	uc004cln.3	Q05586	OTTHUMG00000020976	ENST00000371561.3:c.2141C>G	chr9.hg19:g.140057425C>G	ENSP00000360616:p.Ala714Gly	37.0	0.0		46.0	9.0	NM_001185091	A6NLK7|A6NLR1|C9K0X1|P35437|Q12867|Q12868|Q5VSF3|Q5VSF4|Q5VSF5|Q5VSF6|Q5VSF7|Q5VSF8|Q9UPF8|Q9UPF9	Missense_Mutation	SNP	ENST00000371561.3	hg19	CCDS7031.1	.	.	.	.	.	.	.	.	.	.	c	26.8	4.771107	0.90108	.	.	ENSG00000176884	ENST00000371561;ENST00000315048;ENST00000350902;ENST00000371550;ENST00000371546;ENST00000371555;ENST00000371553;ENST00000371559;ENST00000371560	T;T;T;T;T;T;T;T;T	0.25250	1.81;1.81;1.81;1.81;1.81;1.81;1.81;1.81;1.81	4.83	4.83	0.62350	Extracellular solute-binding protein, family 3 (1);Ionotropic glutamate receptor (2);	0.000000	0.85682	D	0.000000	T	0.50616	0.1626	M	0.71581	2.175	0.80722	D	1	D;D;D;D;D;D	0.89917	0.999;1.0;0.999;0.999;1.0;0.999	D;D;D;D;D;D	0.78314	0.982;0.984;0.969;0.969;0.982;0.991	T	0.52548	-0.8561	10	0.52906	T	0.07	.	16.5012	0.84257	0.0:1.0:0.0:0.0	.	735;735;714;714;714;714	Q5VSF4;Q5VSF5;Q05586-2;Q05586-3;Q05586;A2AVK2	.;.;.;.;NMDZ1_HUMAN;.	G	714;714;714;714;735;735;735;714;735	ENSP00000360616:A714G;ENSP00000316696:A714G;ENSP00000316915:A714G;ENSP00000360605:A714G;ENSP00000360601:A735G;ENSP00000360610:A735G;ENSP00000360608:A735G;ENSP00000360614:A714G;ENSP00000360615:A735G	ENSP00000316696:A714G	A	+	2	0	GRIN1	139177246	1.000000	0.71417	0.518000	0.27811	0.964000	0.63967	5.527000	0.67123	2.247000	0.74100	0.450000	0.29827	GCG	.	.		0.677	GRIN1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000055267.3	NM_007327	
JMJD1C	221037	hgsc.bcm.edu	37	10	64952867	64952867	+	Silent	SNP	G	G	A			TCGA-BC-A10Y-01A-11D-A12Z-10	TCGA-BC-A10Y-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	54f8357c-9dd7-4e08-bd47-a1ebedb30b62	5589b608-e6ae-4953-8a37-484d4116179b	g.chr10:64952867G>A	ENST00000399262.2	-	16	6125	c.5907C>T	c.(5905-5907)tgC>tgT	p.C1969C	JMJD1C_ENST00000402544.1_Intron|JMJD1C_ENST00000399251.1_3'UTR|JMJD1C_ENST00000542921.1_Silent_p.C1787C	NM_032776.1	NP_116165.1	Q15652	JHD2C_HUMAN	jumonji domain containing 1C	1969					blood coagulation (GO:0007596)|chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	intracellular (GO:0005622)|nucleoplasm (GO:0005654)	dioxygenase activity (GO:0051213)|metal ion binding (GO:0046872)|thyroid hormone receptor binding (GO:0046966)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(8)|large_intestine(9)|lung(27)|ovary(6)|prostate(4)|skin(4)|stomach(3)|upper_aerodigestive_tract(3)	77	Prostate(12;0.0119)|all_hematologic(501;0.191)					ACTCAGGCATGCACAGAGAAA	0.368																																					p.C1969C		Atlas-SNP	.											.	JMJD1C	347	.	0			c.C5907T						.						89.0	80.0	83.0					10																	64952867		1870	4124	5994	SO:0001819	synonymous_variant	221037	exon16			AGGCATGCACAGA	L40411	CCDS41532.1, CCDS60538.1	10q22.1	2011-05-25	2004-03-31	2004-04-01	ENSG00000171988	ENSG00000171988			12313	protein-coding gene	gene with protein product		604503	"""thyroid hormone receptor interactor 8"""	TRIP8		7776974	Standard	XM_005269624		Approved	DKFZp761F0118, KIAA1380, FLJ14374	uc001jmn.3	Q15652	OTTHUMG00000018311	ENST00000399262.2:c.5907C>T	chr10.hg19:g.64952867G>A		165.0	0.0		144.0	63.0	NM_032776	A0T124|Q5SQZ8|Q5SQZ9|Q5SR00|Q7Z3E7|Q8N3U0|Q96KB9|Q9P2G7	Silent	SNP	ENST00000399262.2	hg19	CCDS41532.1	.	.	.	.	.	.	.	.	.	.	G	9.178	1.022904	0.19433	.	.	ENSG00000171988	ENST00000327520	.	.	.	5.67	4.63	0.57726	.	.	.	.	.	T	0.59404	0.2191	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.56553	-0.7960	4	.	.	.	-1.7841	8.8589	0.35245	0.1963:0.0:0.8037:0.0	.	.	.	.	V	516	.	.	A	-	2	0	JMJD1C	64622873	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.388000	0.34442	1.141000	0.42275	0.650000	0.86243	GCA	.	.		0.368	JMJD1C-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048249.2	NM_004241	
PHRF1	57661	hgsc.bcm.edu	37	11	608299	608299	+	Missense_Mutation	SNP	C	C	T	rs200183606		TCGA-BC-A10Y-01A-11D-A12Z-10	TCGA-BC-A10Y-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	54f8357c-9dd7-4e08-bd47-a1ebedb30b62	5589b608-e6ae-4953-8a37-484d4116179b	g.chr11:608299C>T	ENST00000264555.5	+	14	2971	c.2843C>T	c.(2842-2844)tCt>tTt	p.S948F	PHRF1_ENST00000413872.2_Missense_Mutation_p.S946F|PHRF1_ENST00000416188.2_Missense_Mutation_p.S947F|PHRF1_ENST00000533464.1_Missense_Mutation_p.S944F	NM_020901.2	NP_065952.2	Q9P1Y6	PHRF1_HUMAN	PHD and ring finger domains 1	948					mRNA processing (GO:0006397)|transcription from RNA polymerase II promoter (GO:0006366)	membrane (GO:0016020)	RNA polymerase binding (GO:0070063)|zinc ion binding (GO:0008270)			breast(1)|cervix(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(13)|urinary_tract(2)	28						GATGGGGCGTCTTGCAGCACC	0.687																																					p.S947F		Atlas-SNP	.											.	PHRF1	188	.	0			c.C2840T						.	C	PHE/SER	0,4022		0,0,2011	17.0	23.0	21.0		2840	2.5	0.0	11		21	2,8286		0,2,4142	yes	missense	PHRF1	NM_020901.2	155	0,2,6153	TT,TC,CC		0.0241,0.0,0.0162	benign	947/1649	608299	2,12308	2011	4144	6155	SO:0001583	missense	57661	exon14			GGGCGTCTTGCAG	BC004950	CCDS44507.1, CCDS65987.1, CCDS65988.1, CCDS65989.1	11p15.5	2014-06-13			ENSG00000070047	ENSG00000070047		"""RING-type (C3HC4) zinc fingers"", ""Zinc fingers, PHD-type"""	24351	protein-coding gene	gene with protein product	"""CTD binding SR like protein rA9"", ""protein phosphatase 1, regulatory subunit 125"""	611780		RNF221			Standard	XM_005253027		Approved	KIAA1542, PPP1R125	uc010qwc.2	Q9P1Y6	OTTHUMG00000165141	ENST00000264555.5:c.2843C>T	chr11.hg19:g.608299C>T	ENSP00000264555:p.Ser948Phe	21.0	0.0		34.0	14.0	NM_020901	A6H8W1|B7ZM64|B9EGP0|C9JS82|Q6PJP2|Q8IVY2|Q8N2Y7|Q9BSM2	Missense_Mutation	SNP	ENST00000264555.5	hg19		.	.	.	.	.	.	.	.	.	.	C	10.04	1.240978	0.22711	0.0	2.41E-4	ENSG00000070047	ENST00000264555;ENST00000413872;ENST00000416188;ENST00000533464	T;T;T;T	0.79940	-1.32;-1.32;-1.32;-1.32	4.35	2.48	0.30137	.	0.915450	0.08977	N	0.866320	T	0.65647	0.2711	N	0.19112	0.55	0.09310	N	1	P;P;P;P	0.39157	0.531;0.662;0.662;0.531	B;B;B;B	0.33196	0.076;0.159;0.159;0.076	T	0.54470	-0.8289	10	0.56958	D	0.05	-4.1525	8.2573	0.31765	0.0:0.5833:0.3026:0.1141	.	944;946;947;948	E9PJ24;F8WEF5;Q9P1Y6-3;Q9P1Y6	.;.;.;PHRF1_HUMAN	F	948;946;947;944	ENSP00000264555:S948F;ENSP00000388589:S946F;ENSP00000410626:S947F;ENSP00000431870:S944F	ENSP00000264555:S948F	S	+	2	0	PHRF1	598299	0.002000	0.14202	0.000000	0.03702	0.015000	0.08874	1.261000	0.32980	0.473000	0.27368	0.555000	0.69702	TCT	.	C|0.996;T|0.004		0.687	PHRF1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000382133.1	NM_020901	
ATP5B	506	hgsc.bcm.edu	37	12	57032145	57032145	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-A10Y-01A-11D-A12Z-10	TCGA-BC-A10Y-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	54f8357c-9dd7-4e08-bd47-a1ebedb30b62	5589b608-e6ae-4953-8a37-484d4116179b	g.chr12:57032145C>T	ENST00000262030.3	-	10	1602	c.1552G>A	c.(1552-1554)Gca>Aca	p.A518T	BAZ2A_ENST00000179765.5_5'Flank|BAZ2A_ENST00000551812.1_5'Flank|ATP5B_ENST00000550162.1_5'Flank|BAZ2A_ENST00000379441.3_5'Flank|ATP5B_ENST00000552919.1_Missense_Mutation_p.A507T	NM_001686.3	NP_001677.2	P06576	ATPB_HUMAN	ATP synthase, H+ transporting, mitochondrial F1 complex, beta polypeptide	518					angiogenesis (GO:0001525)|ATP biosynthetic process (GO:0006754)|ATP catabolic process (GO:0006200)|ATP hydrolysis coupled proton transport (GO:0015991)|cellular metabolic process (GO:0044237)|generation of precursor metabolites and energy (GO:0006091)|lipid metabolic process (GO:0006629)|mitochondrial ATP synthesis coupled proton transport (GO:0042776)|negative regulation of cell adhesion involved in substrate-bound cell migration (GO:0006933)|osteoblast differentiation (GO:0001649)|proton transport (GO:0015992)|regulation of intracellular pH (GO:0051453)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrial matrix (GO:0005759)|mitochondrial membrane (GO:0031966)|mitochondrial nucleoid (GO:0042645)|mitochondrial proton-transporting ATP synthase complex (GO:0005753)|mitochondrial proton-transporting ATP synthase, catalytic core (GO:0005754)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|MHC class I protein binding (GO:0042288)|proton-transporting ATP synthase activity, rotational mechanism (GO:0046933)|proton-transporting ATPase activity, rotational mechanism (GO:0046961)|transmembrane transporter activity (GO:0022857)|transporter activity (GO:0005215)			breast(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19						TCAGCTTTTGCCACAGCTTCT	0.453																																					p.A518T		Atlas-SNP	.											.	ATP5B	48	.	0			c.G1552A						.						180.0	170.0	174.0					12																	57032145		2203	4300	6503	SO:0001583	missense	506	exon10			CTTTTGCCACAGC	M27132	CCDS8924.1	12p13.3	2012-10-12			ENSG00000110955	ENSG00000110955	3.6.3.14	"""Mitochondrial respiratory chain complex / Complex V"", ""ATPases / F-type"""	830	protein-coding gene	gene with protein product		102910		ATPSB		2687158	Standard	NM_001686		Approved		uc001slr.3	P06576	OTTHUMG00000170291	ENST00000262030.3:c.1552G>A	chr12.hg19:g.57032145C>T	ENSP00000262030:p.Ala518Thr	147.0	0.0		146.0	55.0	NM_001686	A8K4X0|Q14283	Missense_Mutation	SNP	ENST00000262030.3	hg19	CCDS8924.1	.	.	.	.	.	.	.	.	.	.	C	15.81	2.943984	0.53079	.	.	ENSG00000110955	ENST00000262030;ENST00000552919	T;T	0.77877	-1.13;-1.13	5.37	3.19	0.36642	ATPase, F1/V1/A1 complex, alpha/beta subunit, C-terminal (2);ATPase, F1 complex beta subunit/V1 complex, C-terminal (1);	0.306615	0.35739	N	0.003014	T	0.70176	0.3194	L	0.54323	1.7	0.28680	N	0.905134	B	0.02656	0.0	B	0.04013	0.001	T	0.63892	-0.6534	10	0.42905	T	0.14	-4.2747	9.6137	0.39679	0.0:0.7446:0.0:0.2554	.	518	P06576	ATPB_HUMAN	T	518;507	ENSP00000262030:A518T;ENSP00000450297:A507T	ENSP00000262030:A518T	A	-	1	0	ATP5B	55318412	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.730000	0.47335	1.261000	0.44149	0.561000	0.74099	GCA	.	.		0.453	ATP5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408380.1	NM_001686	
ATP8A2	51761	hgsc.bcm.edu	37	13	26153014	26153014	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A10Y-01A-11D-A12Z-10	TCGA-BC-A10Y-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	54f8357c-9dd7-4e08-bd47-a1ebedb30b62	5589b608-e6ae-4953-8a37-484d4116179b	g.chr13:26153014A>G	ENST00000381655.2	+	21	1986	c.1844A>G	c.(1843-1845)cAt>cGt	p.H615R	ATP8A2_ENST00000255283.8_Missense_Mutation_p.H575R|ATP8A2_ENST00000491840.1_3'UTR	NM_016529.4	NP_057613.4	Q9NTI2	AT8A2_HUMAN	ATPase, aminophospholipid transporter, class I, type 8A, member 2	575					aging (GO:0007568)|axonogenesis (GO:0007409)|detection of light stimulus involved in visual perception (GO:0050908)|eating behavior (GO:0042755)|inner ear morphogenesis (GO:0042472)|involuntary skeletal muscle contraction (GO:0003011)|negative regulation of cell proliferation (GO:0008285)|neurofilament cytoskeleton organization (GO:0060052)|neuromuscular process controlling posture (GO:0050884)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of neuron projection development (GO:0010976)|positive regulation of phospholipid translocation (GO:0061092)|response to auditory stimulus (GO:0010996)|retina layer formation (GO:0010842)|skin development (GO:0043588)	cell projection (GO:0042995)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(17)|lung(31)|ovary(4)|skin(3)|stomach(1)|urinary_tract(1)	72		Breast(139;0.0201)|Lung SC(185;0.0225)		all cancers(112;0.043)|OV - Ovarian serous cystadenocarcinoma(117;0.0748)|Epithelial(112;0.079)		ACATTATGCCATCTGGAATAC	0.388																																					p.H615R		Atlas-SNP	.											.	ATP8A2	181	.	0			c.A1844G						.						136.0	130.0	132.0					13																	26153014		1883	4114	5997	SO:0001583	missense	51761	exon21			TATGCCATCTGGA	AL137256	CCDS41873.1	13q12	2010-04-20	2010-03-31		ENSG00000132932	ENSG00000132932	3.6.3.1	"""ATPases / P-type"""	13533	protein-coding gene	gene with protein product		605870	"""ATPase, aminophospholipid transporter-like, Class I, type 8A, member 2"", ""ATPase, aminophospholipid transporter-like, class I, type 8A, member 2"""			11015572, 19778899	Standard	NM_016529		Approved	ATPIB, ML-1	uc001uqk.3	Q9NTI2	OTTHUMG00000016611	ENST00000381655.2:c.1844A>G	chr13.hg19:g.26153014A>G	ENSP00000371070:p.His615Arg	111.0	0.0		89.0	38.0	NM_016529	Q9H527|Q9NPU6|Q9NTL2|Q9NYM3	Missense_Mutation	SNP	ENST00000381655.2	hg19	CCDS41873.1	.	.	.	.	.	.	.	.	.	.	A	22.8	4.336979	0.81801	.	.	ENSG00000132932	ENST00000381655;ENST00000255283;ENST00000544544	T;T	0.67865	-0.29;-0.29	5.61	5.61	0.85477	ATPase, cation-transporting, domain N (1);HAD-like domain (1);ATPase, P-type, cytoplasmic domain N (1);	0.048152	0.85682	D	0.000000	D	0.84174	0.5414	M	0.88241	2.94	0.80722	D	1	D;D;D	0.58620	0.983;0.979;0.983	D;D;D	0.68483	0.958;0.947;0.958	D	0.87335	0.2327	10	0.87932	D	0	.	16.1054	0.81216	1.0:0.0:0.0:0.0	.	575;395;575	B7Z880;F5GZN5;Q9NTI2	.;.;AT8A2_HUMAN	R	615;575;395	ENSP00000371070:H615R;ENSP00000255283:H575R	ENSP00000255283:H575R	H	+	2	0	ATP8A2	25051014	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.847000	0.92166	2.266000	0.75297	0.533000	0.62120	CAT	.	.		0.388	ATP8A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044236.2	NM_016529	
BRCA2	675	hgsc.bcm.edu	37	13	32914712	32914712	+	Missense_Mutation	SNP	C	C	G	rs34309943|rs276174867	byFrequency	TCGA-BC-A10Y-01A-11D-A12Z-10	TCGA-BC-A10Y-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	54f8357c-9dd7-4e08-bd47-a1ebedb30b62	5589b608-e6ae-4953-8a37-484d4116179b	g.chr13:32914712C>G	ENST00000380152.3	+	11	6453	c.6220C>G	c.(6220-6222)Cac>Gac	p.H2074D	BRCA2_ENST00000544455.1_Missense_Mutation_p.H2074D			P51587	BRCA2_HUMAN	breast cancer 2, early onset	2074			H -> N (in dbSNP:rs34309943).		brain development (GO:0007420)|cell aging (GO:0007569)|centrosome duplication (GO:0051298)|cytokinesis (GO:0000910)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|female gonad development (GO:0008585)|hemopoiesis (GO:0030097)|histone H3 acetylation (GO:0043966)|histone H4 acetylation (GO:0043967)|inner cell mass cell proliferation (GO:0001833)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|male meiosis I (GO:0007141)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|nucleotide-excision repair (GO:0006289)|oocyte maturation (GO:0001556)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cytokinesis (GO:0032465)|replication fork protection (GO:0048478)|response to gamma radiation (GO:0010332)|response to UV-C (GO:0010225)|response to X-ray (GO:0010165)|spermatogenesis (GO:0007283)	BRCA2-MAGE-D1 complex (GO:0033593)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)|secretory granule (GO:0030141)	gamma-tubulin binding (GO:0043015)|H3 histone acetyltransferase activity (GO:0010484)|H4 histone acetyltransferase activity (GO:0010485)|protease binding (GO:0002020)|single-stranded DNA binding (GO:0003697)			NS(3)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(32)|liver(1)|lung(41)|oesophagus(5)|ovary(22)|pancreas(4)|prostate(3)|salivary_gland(1)|skin(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	183		Lung SC(185;0.0262)		all cancers(112;7.13e-07)|Epithelial(112;1.59e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.000732)|BRCA - Breast invasive adenocarcinoma(63;0.0291)|GBM - Glioblastoma multiforme(144;0.0704)		AAGTTCCTTACACAAAGTTAA	0.343			"""D, Mis, N, F, S"""		"""breast, ovarian, pancreatic"""	"""breast, ovarian, pancreatic, leukemia  (FANCB, FANCD1)"""		Homologous recombination	Pancreatic Cancer, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Prostate Cancer;Hereditary Breast-Ovarian Cancer, BRCA2 type;Fanconi Anemia type D1, bi-allelic BRCA2 mutations;Fanconi Anemia	TCGA Ovarian(8;0.087)																											p.H2074D	Esophageal Squamous(138;838 1285 7957 30353 30468 36915 49332)	Atlas-SNP	.	yes	Rec	yes	Hereditary breast/ovarian cancer	13	13q12	675	familial breast/ovarian cancer gene 2		"""L, E"""	.	BRCA2	812	.	0			c.C6220G	GRCh37	CM012589	BRCA2	M	rs34309943	.						62.0	64.0	64.0					13																	32914712		2203	4297	6500	SO:0001583	missense	675	exon11	Familial Cancer Database	incl.: Hereditary Pancreatic Adenocarcinoma, Insulin-Dependent Diabetes Mellitus - Exocrine Insufficiency - Familial Pancreatic Cancer, PNCA1;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;HPC; ;FANCD1;Pancytopenia Dysmelia, FA (several complementation groups)	TCCTTACACAAAG	U43746	CCDS9344.1	13q12-q13	2014-09-17	2003-10-14		ENSG00000139618	ENSG00000139618		"""Fanconi anemia, complementation groups"""	1101	protein-coding gene	gene with protein product	"""BRCA1/BRCA2-containing complex, subunit 2"""	600185	"""Fanconi anemia, complementation group D1"""	FANCD1, FACD, FANCD		8091231, 7581463, 15057823	Standard	NM_000059		Approved	FAD, FAD1, BRCC2	uc001uub.1	P51587	OTTHUMG00000017411	ENST00000380152.3:c.6220C>G	chr13.hg19:g.32914712C>G	ENSP00000369497:p.His2074Asp	127.0	0.0		94.0	38.0	NM_000059	O00183|O15008|Q13879|Q5TBJ7	Missense_Mutation	SNP	ENST00000380152.3	hg19	CCDS9344.1	.	.	.	.	.	.	.	.	.	.	C	9.633	1.136989	0.21123	.	.	ENSG00000139618	ENST00000380152;ENST00000544455	T;T	0.73897	-0.79;-0.79	5.77	-4.11	0.03928	.	0.987072	0.08269	N	0.971792	T	0.51058	0.1652	N	0.19112	0.55	0.09310	N	1	B	0.27416	0.178	B	0.28385	0.089	T	0.37314	-0.9711	10	0.21540	T	0.41	.	3.5294	0.07771	0.5141:0.2527:0.1001:0.1331	.	2074	P51587	BRCA2_HUMAN	D	2074	ENSP00000369497:H2074D;ENSP00000439902:H2074D	ENSP00000369497:H2074D	H	+	1	0	BRCA2	31812712	0.833000	0.29383	0.091000	0.20842	0.550000	0.35303	0.382000	0.20635	-0.334000	0.08463	0.591000	0.81541	CAC	.	C|0.998;A|0.002		0.343	BRCA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046000.2	NM_000059	
MAB21L1	4081	hgsc.bcm.edu	37	13	36049710	36049710	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A10Y-01A-11D-A12Z-10	TCGA-BC-A10Y-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	54f8357c-9dd7-4e08-bd47-a1ebedb30b62	5589b608-e6ae-4953-8a37-484d4116179b	g.chr13:36049710A>G	ENST00000379919.4	-	1	1122	c.566T>C	c.(565-567)cTt>cCt	p.L189P	NBEA_ENST00000310336.4_Intron|NBEA_ENST00000540320.1_Intron|NBEA_ENST00000379939.2_Intron|NBEA_ENST00000400445.3_Intron|NBEA_ENST00000537702.1_5'Flank	NM_005584.4	NP_005575.1	Q13394	MB211_HUMAN	mab-21-like 1 (C. elegans)	189					anatomical structure morphogenesis (GO:0009653)|camera-type eye development (GO:0043010)|positive regulation of cell proliferation (GO:0008284)	nucleus (GO:0005634)				breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(7)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	20		Breast(139;0.014)|Lung SC(185;0.051)|Prostate(109;0.202)		all cancers(112;9.63e-08)|Epithelial(112;1.37e-06)|BRCA - Breast invasive adenocarcinoma(63;0.000659)|OV - Ovarian serous cystadenocarcinoma(117;0.00372)|GBM - Glioblastoma multiforme(144;0.115)		GATGTGGGGAAGTGGCCAGTG	0.607																																					p.L189P		Atlas-SNP	.											.	MAB21L1	52	.	0			c.T566C						.						45.0	52.0	50.0					13																	36049710		2203	4300	6503	SO:0001583	missense	4081	exon1			TGGGGAAGTGGCC	BC028170	CCDS9353.1	13q13.3	2008-02-05	2001-11-28		ENSG00000180660	ENSG00000180660			6757	protein-coding gene	gene with protein product		601280	"""mab-21 (C. elegans)-like 1"""			8733127	Standard	NM_005584		Approved	CAGR1		Q13394	OTTHUMG00000016723	ENST00000379919.4:c.566T>C	chr13.hg19:g.36049710A>G	ENSP00000369251:p.Leu189Pro	96.0	0.0		55.0	23.0	NM_005584	Q6I9T5	Missense_Mutation	SNP	ENST00000379919.4	hg19	CCDS9353.1	.	.	.	.	.	.	.	.	.	.	A	14.55	2.570144	0.45798	.	.	ENSG00000180660	ENST00000379919	T	0.07908	3.15	5.66	5.66	0.87406	.	0.000000	0.85682	D	0.000000	T	0.14614	0.0353	L	0.40543	1.245	0.80722	D	1	B	0.29955	0.263	B	0.43990	0.438	T	0.17258	-1.0375	10	0.27785	T	0.31	-8.1728	15.8843	0.79232	1.0:0.0:0.0:0.0	.	189	Q13394	MB211_HUMAN	P	189	ENSP00000369251:L189P	ENSP00000369251:L189P	L	-	2	0	MAB21L1	34947710	1.000000	0.71417	0.955000	0.39395	0.987000	0.75469	9.339000	0.96797	2.164000	0.68074	0.533000	0.62120	CTT	.	.		0.607	MAB21L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044459.3	NM_005584	
DCLK1	9201	hgsc.bcm.edu	37	13	36385025	36385025	+	Nonsense_Mutation	SNP	G	G	T			TCGA-BC-A10Y-01A-11D-A12Z-10	TCGA-BC-A10Y-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	54f8357c-9dd7-4e08-bd47-a1ebedb30b62	5589b608-e6ae-4953-8a37-484d4116179b	g.chr13:36385025G>T	ENST00000360631.3	-	12	1846	c.1635C>A	c.(1633-1635)taC>taA	p.Y545*	DCLK1_ENST00000379893.1_Nonsense_Mutation_p.Y238*|DCLK1_ENST00000255448.4_Nonsense_Mutation_p.Y545*			O15075	DCLK1_HUMAN	doublecortin-like kinase 1	545	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				axon extension (GO:0048675)|central nervous system development (GO:0007417)|central nervous system projection neuron axonogenesis (GO:0021952)|dendrite morphogenesis (GO:0048813)|endosomal transport (GO:0016197)|forebrain development (GO:0030900)|nervous system development (GO:0007399)|neuron migration (GO:0001764)|protein phosphorylation (GO:0006468)|response to virus (GO:0009615)	integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein activity (GO:0005057)			breast(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(18)|lung(17)|ovary(2)|prostate(3)|skin(4)|stomach(6)|urinary_tract(1)	64		Breast(139;0.0147)|Lung SC(185;0.0685)|Prostate(109;0.122)	KIRC - Kidney renal clear cell carcinoma(5;0.119)|Kidney(79;0.169)	all cancers(112;1.72e-06)|Epithelial(112;4.24e-05)|BRCA - Breast invasive adenocarcinoma(63;0.00159)|OV - Ovarian serous cystadenocarcinoma(117;0.0158)|GBM - Glioblastoma multiforme(144;0.0638)		CACAGACTGTGTACAGGGGGC	0.463																																					p.Y545X		Atlas-SNP	.											DCLK1_ENST00000379893,NS,carcinoma,0,3	DCLK1	350	.	0			c.C1635A						.						171.0	165.0	167.0					13																	36385025		2203	4300	6503	SO:0001587	stop_gained	9201	exon12			GACTGTGTACAGG	AB002367	CCDS9354.1, CCDS55895.1, CCDS73561.1	13q13.3	2008-02-05	2007-04-02	2007-04-02	ENSG00000133083	ENSG00000133083			2700	protein-coding gene	gene with protein product		604742	"""doublecortin and CaM kinase-like 1"""	DCAMKL1		9747029, 10036192	Standard	NM_004734		Approved	KIAA0369, DCLK, DCDC3A	uc001uvf.3	O15075	OTTHUMG00000016729	ENST00000360631.3:c.1635C>A	chr13.hg19:g.36385025G>T	ENSP00000353846:p.Tyr545*	202.0	0.0		252.0	111.0	NM_004734	B7Z3E9|Q5VZY8|Q5VZZ0|Q5VZZ1	Nonsense_Mutation	SNP	ENST00000360631.3	hg19		.	.	.	.	.	.	.	.	.	.	G	39	7.667052	0.98422	.	.	ENSG00000133083	ENST00000399319;ENST00000255448;ENST00000360631;ENST00000379893;ENST00000539451	.	.	.	5.18	1.52	0.23074	.	0.059652	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	10.1631	0.42864	0.3398:0.0:0.6602:0.0	.	.	.	.	X	237;545;545;238;527	.	ENSP00000255448:Y545X	Y	-	3	2	DCLK1	35283025	1.000000	0.71417	0.998000	0.56505	0.995000	0.86356	1.537000	0.36083	0.036000	0.15547	-0.136000	0.14681	TAC	.	.		0.463	DCLK1-010	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000044487.1	NM_004734	
OR4M1	441670	hgsc.bcm.edu	37	14	20249191	20249191	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-A10Y-01A-11D-A12Z-10	TCGA-BC-A10Y-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	54f8357c-9dd7-4e08-bd47-a1ebedb30b62	5589b608-e6ae-4953-8a37-484d4116179b	g.chr14:20249191G>A	ENST00000315957.4	+	1	791	c.710G>A	c.(709-711)aGg>aAg	p.R237K		NM_001005500.1	NP_001005500.1	Q8NGD0	OR4M1_HUMAN	olfactory receptor, family 4, subfamily M, member 1	237						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(1)|endometrium(1)|large_intestine(4)|lung(32)|prostate(1)|skin(2)	42	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		AATACCAACAGGGCCATGTCC	0.463																																					p.R237K		Atlas-SNP	.											.	OR4M1	104	.	0			c.G710A						.						298.0	258.0	272.0					14																	20249191		2203	4300	6503	SO:0001583	missense	441670	exon1			CCAACAGGGCCAT		CCDS32021.1	14q11.2	2013-09-23			ENSG00000176299	ENSG00000176299		"""GPCR / Class A : Olfactory receptors"""	14735	protein-coding gene	gene with protein product							Standard	NM_001005500		Approved		uc010tku.2	Q8NGD0	OTTHUMG00000170599	ENST00000315957.4:c.710G>A	chr14.hg19:g.20249191G>A	ENSP00000319654:p.Arg237Lys	701.0	0.0		693.0	279.0	NM_001005500	B9EH18|Q6IFA3	Missense_Mutation	SNP	ENST00000315957.4	hg19	CCDS32021.1	.	.	.	.	.	.	.	.	.	.	.	4.405	0.074809	0.08485	.	.	ENSG00000176299	ENST00000315957	T	0.00007	9.64	4.42	3.52	0.40303	GPCR, rhodopsin-like superfamily (1);	0.000000	0.49916	D	0.000127	T	0.00012	0.0000	N	0.00063	-2.32	0.31973	N	0.606841	B	0.17268	0.021	B	0.15484	0.013	T	0.06232	-1.0838	10	0.02654	T	1	-9.6388	6.0147	0.19596	0.2032:0.0:0.7968:0.0	.	237	Q8NGD0	OR4M1_HUMAN	K	237	ENSP00000319654:R237K	ENSP00000319654:R237K	R	+	2	0	OR4M1	19319031	1.000000	0.71417	0.982000	0.44146	0.951000	0.60555	3.858000	0.55979	2.468000	0.83385	0.506000	0.49869	AGG	.	.		0.463	OR4M1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409770.1		
POLE2	5427	hgsc.bcm.edu	37	14	50140883	50140883	+	Silent	SNP	A	A	G			TCGA-BC-A10Y-01A-11D-A12Z-10	TCGA-BC-A10Y-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	54f8357c-9dd7-4e08-bd47-a1ebedb30b62	5589b608-e6ae-4953-8a37-484d4116179b	g.chr14:50140883A>G	ENST00000216367.5	-	5	474	c.375T>C	c.(373-375)gaT>gaC	p.D125D	POLE2_ENST00000554396.1_Silent_p.D125D|POLE2_ENST00000556584.1_5'UTR|POLE2_ENST00000539565.2_Silent_p.D99D	NM_002692.3	NP_002683.2	P56282	DPOE2_HUMAN	polymerase (DNA directed), epsilon 2, accessory subunit	125					DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA gap filling (GO:0006297)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|transcription-coupled nucleotide-excision repair (GO:0006283)	epsilon DNA polymerase complex (GO:0008622)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)			kidney(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	10	all_epithelial(31;0.0021)|Breast(41;0.0124)				Cladribine(DB00242)	TCTCTGCTTTATCTCTTGGTG	0.413																																					p.D125D		Atlas-SNP	.											.	POLE2	36	.	0			c.T375C						.						248.0	252.0	251.0					14																	50140883		2203	4300	6503	SO:0001819	synonymous_variant	5427	exon5			TGCTTTATCTCTT	AF025840	CCDS32073.1, CCDS55914.1, CCDS55915.1	14q21-q22	2012-05-18	2012-05-18		ENSG00000100479	ENSG00000100479		"""DNA polymerases"""	9178	protein-coding gene	gene with protein product	"""DNA polymerase epsilon subunit B"""	602670	"""polymerase (DNA directed), epsilon 2 (p59 subunit)"""			9405441, 9443964	Standard	NM_002692		Approved	DPE2	uc001wwu.3	P56282	OTTHUMG00000170813	ENST00000216367.5:c.375T>C	chr14.hg19:g.50140883A>G		182.0	0.0		167.0	78.0	NM_001197331	A0AV55|A4FU92|A4LBB7|A6NH58|B4DDE6|O43560	Silent	SNP	ENST00000216367.5	hg19	CCDS32073.1																																																																																			.	.		0.413	POLE2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410512.1	NM_002692	
GPHN	10243	hgsc.bcm.edu	37	14	67646366	67646366	+	Missense_Mutation	SNP	A	A	T			TCGA-BC-A10Y-01A-11D-A12Z-10	TCGA-BC-A10Y-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	54f8357c-9dd7-4e08-bd47-a1ebedb30b62	5589b608-e6ae-4953-8a37-484d4116179b	g.chr14:67646366A>T	ENST00000315266.5	+	21	3173	c.2052A>T	c.(2050-2052)gaA>gaT	p.E684D	GPHN_ENST00000305960.9_Missense_Mutation_p.E653D|GPHN_ENST00000478722.1_Missense_Mutation_p.E717D|GPHN_ENST00000543237.1_Missense_Mutation_p.E730D|GPHN_ENST00000544752.2_3'UTR	NM_001024218.1	NP_001019389.1	Q9NQX3	GEPH_HUMAN	gephyrin	684	MPT adenylyltransferase.				establishment of synaptic specificity at neuromuscular junction (GO:0007529)|glycine receptor clustering (GO:0072579)|Mo-molybdopterin cofactor biosynthetic process (GO:0006777)|molybdopterin cofactor biosynthetic process (GO:0032324)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|inhibitory synapse (GO:0060077)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|molybdopterin adenylyltransferase activity (GO:0061598)|molybdopterin molybdotransferase activity (GO:0061599)|transferase activity (GO:0016740)			large_intestine(8)|liver(1)|ovary(2)|stomach(1)	12		all_cancers(7;0.0476)|all_hematologic(31;0.0116)		Epithelial(1;1.73e-08)|all cancers(60;3.15e-07)|OV - Ovarian serous cystadenocarcinoma(108;0.000275)|BRCA - Breast invasive adenocarcinoma(234;0.00323)|Colorectal(3;0.0938)|KIRC - Kidney renal clear cell carcinoma(182;0.184)		ATCACCAAGAACCACTACCTT	0.363			T	MLL	AL																																p.E717D		Atlas-SNP	.		Dom	yes		14	14q24	10243	gephyrin (GPH)		L	.	GPHN	79	.	0			c.A2151T						.						130.0	107.0	115.0					14																	67646366		2203	4300	6503	SO:0001583	missense	10243	exon22			CCAAGAACCACTA	AB037806	CCDS9777.1, CCDS32103.1	14q23.3	2008-04-22			ENSG00000171723	ENSG00000171723			15465	protein-coding gene	gene with protein product		603930				1319186, 10325225, 18403029	Standard	XM_005267250		Approved	KIAA1385	uc001xix.3	Q9NQX3	OTTHUMG00000029785	ENST00000315266.5:c.2052A>T	chr14.hg19:g.67646366A>T	ENSP00000312771:p.Glu684Asp	329.0	0.0		300.0	139.0	NM_020806	Q9H4E9|Q9P2G2	Missense_Mutation	SNP	ENST00000315266.5	hg19	CCDS32103.1	.	.	.	.	.	.	.	.	.	.	A	8.510	0.866181	0.17250	.	.	ENSG00000171723	ENST00000315266;ENST00000478722;ENST00000543237;ENST00000305960	.	.	.	5.79	2.24	0.28232	MoeA, C-terminal, domain IV (3);	0.000000	0.85682	D	0.000000	T	0.28797	0.0714	N	0.12502	0.225	0.58432	D	0.999999	B;B;B;B	0.06786	0.0;0.001;0.001;0.0	B;B;B;B	0.10450	0.003;0.005;0.004;0.004	T	0.04333	-1.0959	9	0.16420	T	0.52	-10.9275	8.3167	0.32104	0.7147:0.0:0.2853:0.0	.	653;730;684;717	F8W7D6;F5H039;Q9NQX3;Q9NQX3-2	.;.;GEPH_HUMAN;.	D	684;717;730;653	.	ENSP00000303019:E653D	E	+	3	2	GPHN	66716119	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.607000	0.46300	0.468000	0.27243	-0.256000	0.11100	GAA	.	.		0.363	GPHN-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000074299.2	NM_020806	
CCDC88C	440193	hgsc.bcm.edu	37	14	91770248	91770248	+	Silent	SNP	C	C	T			TCGA-BC-A10Y-01A-11D-A12Z-10	TCGA-BC-A10Y-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	54f8357c-9dd7-4e08-bd47-a1ebedb30b62	5589b608-e6ae-4953-8a37-484d4116179b	g.chr14:91770248C>T	ENST00000389857.6	-	20	3518	c.3432G>A	c.(3430-3432)acG>acA	p.T1144T		NM_001080414.3	NP_001073883.2	Q9P219	DAPLE_HUMAN	coiled-coil domain containing 88C	1144					protein destabilization (GO:0031648)|protein homooligomerization (GO:0051260)|regulation of protein phosphorylation (GO:0001932)|Wnt signaling pathway (GO:0016055)		PDZ domain binding (GO:0030165)|protein self-association (GO:0043621)			central_nervous_system(3)|endometrium(2)|kidney(3)|large_intestine(2)|lung(6)|ovary(6)|pancreas(1)|urinary_tract(1)	24		all_cancers(154;0.0468)				TCTCCTTGGCCGTGTGGTGGT	0.657																																					p.T1144T		Atlas-SNP	.											.	CCDC88C	192	.	0			c.G3432A						.						75.0	82.0	80.0					14																	91770248		2150	4255	6405	SO:0001819	synonymous_variant	440193	exon20			CTTGGCCGTGTGG		CCDS45151.1	14q32.12	2014-07-30	2007-05-31	2007-05-31		ENSG00000015133			19967	protein-coding gene	gene with protein product	"""Dvl-associating protein with a high frequency of leucine residues"", ""spinocerebellar ataxia 40"""	611204	"""KIAA1509"""	KIAA1509		17185515, 25062847	Standard	NM_001080414		Approved	DAPLE, HkRP2, SCA40	uc010aty.3	Q9P219		ENST00000389857.6:c.3432G>A	chr14.hg19:g.91770248C>T		100.0	0.0		130.0	51.0	NM_001080414	Q69YK1|Q7L1M2|Q86SX7|Q8IYG8	Silent	SNP	ENST00000389857.6	hg19	CCDS45151.1																																																																																			.	.		0.657	CCDC88C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411650.1	XM_029353	
APBA2	321	hgsc.bcm.edu	37	15	29346830	29346830	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-A10Y-01A-11D-A12Z-10	TCGA-BC-A10Y-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	54f8357c-9dd7-4e08-bd47-a1ebedb30b62	5589b608-e6ae-4953-8a37-484d4116179b	g.chr15:29346830C>T	ENST00000558402.1	+	5	1342	c.743C>T	c.(742-744)gCc>gTc	p.A248V	APBA2_ENST00000558330.1_Missense_Mutation_p.A248V|APBA2_ENST00000561069.1_Missense_Mutation_p.A248V|APBA2_ENST00000558259.1_Missense_Mutation_p.A248V|APBA2_ENST00000411764.1_Missense_Mutation_p.A248V			Q99767	APBA2_HUMAN	amyloid beta (A4) precursor protein-binding, family A, member 2	248	STXBP1-binding.				in utero embryonic development (GO:0001701)|locomotory behavior (GO:0007626)|multicellular organism growth (GO:0035264)|nervous system development (GO:0007399)|protein transport (GO:0015031)|regulation of gene expression (GO:0010468)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)	beta-amyloid binding (GO:0001540)	p.A248D(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(7)|liver(2)|lung(33)|stomach(1)|urinary_tract(1)	59		all_lung(180;1.73e-12)|Breast(32;2.89e-05)|Colorectal(260;0.234)		all cancers(64;7.44e-11)|Epithelial(43;5.74e-10)|GBM - Glioblastoma multiforme(186;0.026)|BRCA - Breast invasive adenocarcinoma(123;0.0286)|Lung(196;0.24)		GCCAGTGAGGCCAGCCCCGAG	0.652																																					p.A248V		Atlas-SNP	.											.	APBA2	132	.	1	Substitution - Missense(1)	lung(1)	c.C743T						.						50.0	43.0	45.0					15																	29346830		2203	4300	6503	SO:0001583	missense	321	exon3			GTGAGGCCAGCCC	AB014719	CCDS10022.1, CCDS45197.1	15q11-q12	2008-07-18	2008-07-18		ENSG00000034053	ENSG00000034053			579	protein-coding gene	gene with protein product		602712	"""X11-like"", ""amyloid beta (A4) precursor protein-binding, family A, member 2 (X11-like)"""	X11L, MINT2		8955346	Standard	NM_005503		Approved	D15S1518E, LIN-10, MGC:14091, HsT16821	uc001zck.3	Q99767	OTTHUMG00000129255	ENST00000558402.1:c.743C>T	chr15.hg19:g.29346830C>T	ENSP00000453293:p.Ala248Val	126.0	0.0		134.0	60.0	NM_005503	E9PGI4|O60571|Q5XKC0	Missense_Mutation	SNP	ENST00000558402.1	hg19	CCDS10022.1	.	.	.	.	.	.	.	.	.	.	C	14.17	2.455267	0.43634	.	.	ENSG00000034053	ENST00000411764;ENST00000219865	T	0.46451	0.87	4.96	3.93	0.45458	.	0.364621	0.28135	N	0.016475	T	0.32675	0.0837	L	0.51422	1.61	0.28731	N	0.902478	B;B;B	0.29481	0.245;0.129;0.062	B;B;B	0.30646	0.118;0.058;0.058	T	0.12243	-1.0555	10	0.23891	T	0.37	.	6.6082	0.22737	0.0:0.7989:0.0:0.2011	.	248;248;248	Q5XKC0;E9PGI4;Q99767	.;.;APBA2_HUMAN	V	248	ENSP00000409312:A248V	ENSP00000219865:A248V	A	+	2	0	APBA2	27134122	1.000000	0.71417	1.000000	0.80357	0.927000	0.56198	2.864000	0.48404	2.280000	0.76307	0.650000	0.86243	GCC	.	.		0.652	APBA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251362.3	NM_005503	
ST8SIA2	8128	hgsc.bcm.edu	37	15	93007604	93007604	+	Missense_Mutation	SNP	G	G	T	rs149476731		TCGA-BC-A10Y-01A-11D-A12Z-10	TCGA-BC-A10Y-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	54f8357c-9dd7-4e08-bd47-a1ebedb30b62	5589b608-e6ae-4953-8a37-484d4116179b	g.chr15:93007604G>T	ENST00000268164.3	+	6	1354	c.1117G>T	c.(1117-1119)Ggg>Tgg	p.G373W	ST8SIA2_ENST00000539113.1_Missense_Mutation_p.G352W	NM_006011.3	NP_006002.1	Q92186	SIA8B_HUMAN	ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 2	373					axon guidance (GO:0007411)|carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|cellular protein modification process (GO:0006464)|ganglioside biosynthetic process (GO:0001574)|N-glycan processing (GO:0006491)|nervous system development (GO:0007399)|oligosaccharide metabolic process (GO:0009311)|post-translational protein modification (GO:0043687)|protein glycosylation (GO:0006486)|protein N-linked glycosylation via asparagine (GO:0018279)|sialylation (GO:0097503)	early endosome (GO:0005769)|Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)|recycling endosome (GO:0055037)	alpha-N-acetylneuraminate alpha-2,8-sialyltransferase activity (GO:0003828)|sialic acid binding (GO:0033691)			endometrium(2)|large_intestine(6)|lung(9)|skin(2)|urinary_tract(1)	20	Lung NSC(78;0.0893)|all_lung(78;0.125)		BRCA - Breast invasive adenocarcinoma(143;0.0355)|OV - Ovarian serous cystadenocarcinoma(32;0.203)			CCAGTGCGATGGGGCCACGTA	0.597																																					p.G373W		Atlas-SNP	.											.	ST8SIA2	41	.	0			c.G1117T						.	G	TRP/GLY	1,4395		0,1,2197	71.0	68.0	69.0		1117	5.6	1.0	15	dbSNP_134	69	0,8596		0,0,4298	no	missense	ST8SIA2	NM_006011.3	184	0,1,6495	TT,TG,GG		0.0,0.0227,0.0077	possibly-damaging	373/376	93007604	1,12991	2198	4298	6496	SO:0001583	missense	8128	exon6			TGCGATGGGGCCA	U33551	CCDS10372.1	15q26	2013-03-01	2003-01-14	2005-02-07	ENSG00000140557	ENSG00000140557		"""Sialyltransferases"""	10870	protein-coding gene	gene with protein product		602546	"""sialyltransferase 8 (alpha-2, 8-sialytransferase) B"""	SIAT8B		7559389	Standard	NM_006011		Approved	STX, ST8SIA-II, HsT19690	uc002bra.3	Q92186	OTTHUMG00000149843	ENST00000268164.3:c.1117G>T	chr15.hg19:g.93007604G>T	ENSP00000268164:p.Gly373Trp	45.0	0.0		86.0	26.0	NM_006011	Q4VAZ0|Q92470|Q92746	Missense_Mutation	SNP	ENST00000268164.3	hg19	CCDS10372.1	.	.	.	.	.	.	.	.	.	.	G	21.0	4.078754	0.76528	2.27E-4	0.0	ENSG00000140557	ENST00000268164;ENST00000539113;ENST00000555434	T;T;T	0.23552	2.2;2.44;1.9	5.6	5.6	0.85130	.	0.241297	0.40144	N	0.001174	T	0.33904	0.0879	L	0.29908	0.895	0.50632	D	0.999883	D;D	0.60575	0.988;0.988	P;P	0.53006	0.715;0.715	T	0.05733	-1.0867	10	0.72032	D	0.01	-17.3051	19.6223	0.95663	0.0:0.0:1.0:0.0	.	352;373	C6G488;Q92186	.;SIA8B_HUMAN	W	373;352;330	ENSP00000268164:G373W;ENSP00000437382:G352W;ENSP00000450851:G330W	ENSP00000268164:G373W	G	+	1	0	ST8SIA2	90808608	1.000000	0.71417	0.980000	0.43619	0.925000	0.55904	6.156000	0.71840	2.635000	0.89317	0.650000	0.86243	GGG	.	G|1.000;T|0.000		0.597	ST8SIA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313526.1	NM_006011	
LOC81691	81691	hgsc.bcm.edu	37	16	20826252	20826252	+	Missense_Mutation	SNP	G	G	T	rs201728796		TCGA-BC-A10Y-01A-11D-A12Z-10	TCGA-BC-A10Y-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	54f8357c-9dd7-4e08-bd47-a1ebedb30b62	5589b608-e6ae-4953-8a37-484d4116179b	g.chr16:20826252G>T	ENST00000261377.6	+	4	464	c.255G>T	c.(253-255)tgG>tgT	p.W85C	AC004381.6_ENST00000348433.6_Missense_Mutation_p.W85C|AC004381.6_ENST00000564274.1_Missense_Mutation_p.W85C|AC004381.6_ENST00000567297.1_3'UTR|ERI2_ENST00000564349.1_Intron	NM_001199053.1|NM_030941.2	NP_001185982.1|NP_112203.2																					TTGGCAGCTGGTGCCAGCTTT	0.433																																					p.W85C		Atlas-SNP	.											.	LOC81691	41	.	0			c.G255T						.						101.0	89.0	93.0					16																	20826252		2201	4300	6501	SO:0001583	missense	0	exon4			CAGCTGGTGCCAG																												ENST00000261377.6:c.255G>T	chr16.hg19:g.20826252G>T	ENSP00000261377:p.Trp85Cys	211.0	0.0		184.0	76.0	NM_030941		Missense_Mutation	SNP	ENST00000261377.6	hg19	CCDS10591.1	.	.	.	.	.	.	.	.	.	.	G	18.24	3.581324	0.65992	.	.	ENSG00000005189	ENST00000348433;ENST00000261377	T;T	0.72051	-0.62;-0.4	5.46	5.46	0.80206	.	0.000000	0.85682	D	0.000000	D	0.82384	0.5025	M	0.65498	2.005	0.80722	D	1	D;P	0.89917	1.0;0.459	D;B	0.91635	0.999;0.403	D	0.83665	0.0163	10	0.66056	D	0.02	-10.6428	14.8209	0.70070	0.0:0.0:1.0:0.0	.	85;85	Q96IC2-2;Q96IC2	.;REXON_HUMAN	C	85	ENSP00000261378:W85C;ENSP00000261377:W85C	ENSP00000261377:W85C	W	+	3	0	AC004381.6	20733753	1.000000	0.71417	1.000000	0.80357	0.937000	0.57800	5.476000	0.66793	2.557000	0.86248	0.561000	0.74099	TGG	.	G|1.000;A|0.000		0.433	AC004381.6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254418.2		
METTL9	51108	hgsc.bcm.edu	37	16	21636425	21636425	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A10Y-01A-11D-A12Z-10	TCGA-BC-A10Y-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	54f8357c-9dd7-4e08-bd47-a1ebedb30b62	5589b608-e6ae-4953-8a37-484d4116179b	g.chr16:21636425A>G	ENST00000358154.3	+	4	998	c.740A>G	c.(739-741)tAt>tGt	p.Y247C	METTL9_ENST00000396014.4_Missense_Mutation_p.Y247C|CTB-31N19.3_ENST00000564271.1_RNA	NM_001077180.1|NM_016025.3	NP_001070648.1|NP_057109.3	Q9H1A3	METL9_HUMAN	methyltransferase like 9	247										endometrium(1)|kidney(3)|large_intestine(1)|lung(1)|ovary(1)	7				GBM - Glioblastoma multiforme(48;0.0759)		TTTCATCCCTATGTGGAAAAC	0.443																																					p.Y247C		Atlas-SNP	.											.	METTL9	18	.	0			c.A740G						.						102.0	91.0	95.0					16																	21636425		2199	4300	6499	SO:0001583	missense	51108	exon4			ATCCCTATGTGGA	NM_016025, AF151839	CCDS10598.2, CCDS45440.1	16p12.2	2008-11-06			ENSG00000197006	ENSG00000197006			24586	protein-coding gene	gene with protein product	"""DORA reverse strand protein 1"""	609388				10810093, 11132146	Standard	NM_001077180		Approved	DREV1	uc002dje.3	Q9H1A3	OTTHUMG00000131584	ENST00000358154.3:c.740A>G	chr16.hg19:g.21636425A>G	ENSP00000350874:p.Tyr247Cys	169.0	0.0		139.0	46.0	NM_016025	Q8NBT8|Q9BWJ7|Q9H1A2|Q9Y390	Missense_Mutation	SNP	ENST00000358154.3	hg19	CCDS10598.2	.	.	.	.	.	.	.	.	.	.	A	16.29	3.081694	0.55753	.	.	ENSG00000197006	ENST00000358154;ENST00000396014;ENST00000540294	.	.	.	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	T	0.75184	0.3815	L	0.54323	1.7	0.80722	D	1	D;B	0.89917	1.0;0.241	D;B	0.85130	0.997;0.111	T	0.75508	-0.3293	9	0.51188	T	0.08	-14.1756	14.7743	0.69713	1.0:0.0:0.0:0.0	.	247;247	Q9H1A3-2;Q9H1A3	.;METL9_HUMAN	C	247;247;211	.	ENSP00000350874:Y247C	Y	+	2	0	METTL9	21543926	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	6.148000	0.71788	2.371000	0.80710	0.533000	0.62120	TAT	.	.		0.443	METTL9-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254465.1	NM_016025	
MAZ	4150	hgsc.bcm.edu	37	16	29820038	29820038	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-A10Y-01A-11D-A12Z-10	TCGA-BC-A10Y-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	54f8357c-9dd7-4e08-bd47-a1ebedb30b62	5589b608-e6ae-4953-8a37-484d4116179b	g.chr16:29820038C>T	ENST00000322945.6	+	4	1420	c.1255C>T	c.(1255-1257)Cat>Tat	p.H419Y	AC009133.15_ENST00000566537.1_RNA|MAZ_ENST00000569978.1_Missense_Mutation_p.H20Y|MAZ_ENST00000219782.6_Missense_Mutation_p.H419Y|AC009133.14_ENST00000563806.1_RNA|AC009133.20_ENST00000569039.1_RNA|MAZ_ENST00000566906.2_Intron|AC009133.14_ENST00000569981.1_RNA|MAZ_ENST00000563402.1_Intron|MAZ_ENST00000568282.1_Missense_Mutation_p.H20Y|MAZ_ENST00000568544.1_Missense_Mutation_p.H20Y|MAZ_ENST00000545521.1_Missense_Mutation_p.H396Y|MAZ_ENST00000562337.1_Missense_Mutation_p.H114Y	NM_002383.2	NP_002374.2	P56270	MAZ_HUMAN	MYC-associated zinc finger protein (purine-binding transcription factor)	419					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|termination of RNA polymerase II transcription (GO:0006369)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			endometrium(3)|lung(4)|ovary(2)|upper_aerodigestive_tract(1)	10						GGGTCCTCACCATGTCTGTGA	0.607																																					p.H419Y	Colon(72;875 1167 15364 30899 37091)	Atlas-SNP	.											.	MAZ	48	.	0			c.C1255T						.						43.0	45.0	44.0					16																	29820038		2112	4225	6337	SO:0001583	missense	4150	exon4			CCTCACCATGTCT	M93339	CCDS42143.1, CCDS42144.1, CCDS61902.1, CCDS61903.1	16p11.2	2013-01-08			ENSG00000103495	ENSG00000103495		"""Zinc fingers, C2H2-type"""	6914	protein-coding gene	gene with protein product		600999				1567856, 1502157	Standard	NM_001276275		Approved	ZF87, Pur-1, Zif87, ZNF801	uc002dtx.4	P56270	OTTHUMG00000132119	ENST00000322945.6:c.1255C>T	chr16.hg19:g.29820038C>T	ENSP00000313362:p.His419Tyr	104.0	0.0		85.0	36.0	NM_002383	A8QJL9|C6G496|G5E927|H3BQD6|Q15703|Q8NFN7|Q99443	Missense_Mutation	SNP	ENST00000322945.6	hg19	CCDS42143.1	.	.	.	.	.	.	.	.	.	.	C	15.15	2.748142	0.49257	.	.	ENSG00000103495	ENST00000545521;ENST00000322945;ENST00000219782;ENST00000544343	T;T;T	0.11604	2.76;2.76;5.07	5.3	4.35	0.52113	.	0.058153	0.64402	D	0.000002	T	0.03783	0.0107	N	0.04508	-0.205	0.33481	D	0.587416	P;B;B;B	0.35507	0.506;0.067;0.23;0.383	B;B;B;B	0.29716	0.083;0.054;0.053;0.106	T	0.21415	-1.0246	10	0.02654	T	1	-2.0738	11.944	0.52918	0.0:0.9143:0.0:0.0857	.	396;194;419;419	C6G496;F5H7A6;P56270;G5E927	.;.;MAZ_HUMAN;.	Y	396;419;419;194	ENSP00000443956:H396Y;ENSP00000313362:H419Y;ENSP00000219782:H419Y	ENSP00000219782:H419Y	H	+	1	0	MAZ	29727539	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.434000	0.44802	1.364000	0.46038	0.655000	0.94253	CAT	.	.		0.607	MAZ-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000435536.1	NM_002383	
ATP2C2	9914	hgsc.bcm.edu	37	16	84486812	84486812	+	Nonsense_Mutation	SNP	A	A	T			TCGA-BC-A10Y-01A-11D-A12Z-10	TCGA-BC-A10Y-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	54f8357c-9dd7-4e08-bd47-a1ebedb30b62	5589b608-e6ae-4953-8a37-484d4116179b	g.chr16:84486812A>T	ENST00000262429.4	+	19	1989	c.1900A>T	c.(1900-1902)Aag>Tag	p.K634*	ATP2C2_ENST00000420010.2_3'UTR|ATP2C2_ENST00000416219.2_Nonsense_Mutation_p.K634*	NM_014861.2	NP_055676.2	O75185	AT2C2_HUMAN	ATPase, Ca++ transporting, type 2C, member 2	634					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|calcium-transporting ATPase activity (GO:0005388)|metal ion binding (GO:0046872)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(10)|ovary(1)|prostate(3)|skin(5)|urinary_tract(1)	33						CAGCGTGGAGAAGGGCGAGCT	0.617																																					p.K634X		Atlas-SNP	.											.	ATP2C2	75	.	0			c.A1900T						.						60.0	68.0	66.0					16																	84486812		2061	4190	6251	SO:0001587	stop_gained	9914	exon19			GTGGAGAAGGGCG	AK091051	CCDS42207.1, CCDS67088.1	16q24.1	2010-04-20			ENSG00000064270	ENSG00000064270	3.6.3.8	"""ATPases / P-type"""	29103	protein-coding gene	gene with protein product	"""secretory pathway calcium ATPase 2"""	613082				9734811	Standard	XM_006721355		Approved	KIAA0703, SPCA2	uc002fhx.3	O75185		ENST00000262429.4:c.1900A>T	chr16.hg19:g.84486812A>T	ENSP00000262429:p.Lys634*	111.0	0.0		115.0	49.0	NM_014861	B4DU76|E7ES94|Q5HYC3|Q5S053|Q68CQ2	Nonsense_Mutation	SNP	ENST00000262429.4	hg19	CCDS42207.1	.	.	.	.	.	.	.	.	.	.	A	39	7.849860	0.98525	.	.	ENSG00000064270	ENST00000416219;ENST00000262429;ENST00000420010	.	.	.	5.22	3.07	0.35406	.	0.586522	0.17025	N	0.189949	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.26408	T	0.33	.	6.5657	0.22511	0.2928:0.5234:0.1837:0.0	.	.	.	.	X	634;634;483	.	ENSP00000262429:K634X	K	+	1	0	ATP2C2	83044313	0.991000	0.36638	0.393000	0.26258	0.035000	0.12851	0.592000	0.23984	0.452000	0.26830	0.459000	0.35465	AAG	.	.		0.617	ATP2C2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433404.1	NM_014861	
COTL1	23406	hgsc.bcm.edu	37	16	84623756	84623756	+	Silent	SNP	G	G	A	rs376530038		TCGA-BC-A10Y-01A-11D-A12Z-10	TCGA-BC-A10Y-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	54f8357c-9dd7-4e08-bd47-a1ebedb30b62	5589b608-e6ae-4953-8a37-484d4116179b	g.chr16:84623756G>A	ENST00000262428.4	-	3	435	c.273C>T	c.(271-273)cgC>cgT	p.R91R	COTL1_ENST00000564057.1_Silent_p.R22R	NM_021149.2	NP_066972.1	Q14019	COTL1_HUMAN	coactosin-like F-actin binding protein 1	91	ADF-H. {ECO:0000255|PROSITE- ProRule:PRU00599}.				defense response to fungus (GO:0050832)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	actin binding (GO:0003779)|enzyme binding (GO:0019899)			endometrium(1)|large_intestine(1)|liver(1)|lung(2)|skin(1)	6						CGGTTTTGGCGCGCTGCAGCC	0.592																																					p.R91R		Atlas-SNP	.											.	COTL1	17	.	0			c.C273T						.						101.0	76.0	85.0					16																	84623756		2199	4300	6499	SO:0001819	synonymous_variant	23406	exon3			TTTGGCGCGCTGC	L54057	CCDS10947.1	16q24.1	2014-03-05	2014-03-05	2002-08-01	ENSG00000103187	ENSG00000103187			18304	protein-coding gene	gene with protein product		606748	"""coactosin-like 1 (Dictyostelium)"""			10051563, 9326934, 16924104	Standard	NM_021149		Approved	CLP	uc002fid.3	Q14019	OTTHUMG00000137634	ENST00000262428.4:c.273C>T	chr16.hg19:g.84623756G>A		120.0	0.0		139.0	67.0	NM_021149	B2RDU3|D3DUL9|Q86XM5	Silent	SNP	ENST00000262428.4	hg19	CCDS10947.1																																																																																			.	.		0.592	COTL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269075.1	NM_021149	
G6PC	2538	hgsc.bcm.edu	37	17	41063222	41063222	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A10Y-01A-11D-A12Z-10	TCGA-BC-A10Y-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	54f8357c-9dd7-4e08-bd47-a1ebedb30b62	5589b608-e6ae-4953-8a37-484d4116179b	g.chr17:41063222A>G	ENST00000253801.2	+	5	932	c.853A>G	c.(853-855)Aag>Gag	p.K285E	G6PC_ENST00000592383.1_3'UTR|G6PC_ENST00000585489.1_3'UTR	NM_000151.3	NP_000142.2	P35575	G6PC_HUMAN	glucose-6-phosphatase, catalytic subunit	285					carbohydrate metabolic process (GO:0005975)|cholesterol homeostasis (GO:0042632)|dephosphorylation (GO:0016311)|gluconeogenesis (GO:0006094)|glucose 6-phosphate metabolic process (GO:0051156)|glucose homeostasis (GO:0042593)|glucose transport (GO:0015758)|glucose-6-phosphate transport (GO:0015760)|glycogen catabolic process (GO:0005980)|glycogen metabolic process (GO:0005977)|hexose transport (GO:0008645)|multicellular organism growth (GO:0035264)|regulation of gene expression (GO:0010468)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|transmembrane transport (GO:0055085)|triglyceride metabolic process (GO:0006641)|urate metabolic process (GO:0046415)	endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)	glucose-6-phosphatase activity (GO:0004346)|phosphate ion binding (GO:0042301)|phosphotransferase activity, alcohol group as acceptor (GO:0016773)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(9)|ovary(1)|prostate(1)|skin(1)	23		Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.113)		GGAGAGCTGCAAGGGGAAACT	0.577																																					p.K285E		Atlas-SNP	.											.	G6PC	48	.	0			c.A853G						.						94.0	88.0	90.0					17																	41063222		2203	4300	6503	SO:0001583	missense	2538	exon5			AGCTGCAAGGGGA	U01120	CCDS11446.1, CCDS59291.1	17q21	2014-09-17	2006-06-28			ENSG00000131482	3.1.3.9		4056	protein-coding gene	gene with protein product	"""glycogen storage disease type I, von Gierke disease"""	613742	"""glucose-6-phosphatase, catalytic (glycogen storage disease type I, von Gierke disease)"""	G6PT		7774924	Standard	NM_000151		Approved	GSD1a	uc002icb.2	P35575		ENST00000253801.2:c.853A>G	chr17.hg19:g.41063222A>G	ENSP00000253801:p.Lys285Glu	155.0	0.0		177.0	74.0	NM_000151	A1L4C0|B4E1C3|K7EL82	Missense_Mutation	SNP	ENST00000253801.2	hg19	CCDS11446.1	.	.	.	.	.	.	.	.	.	.	A	11.76	1.735432	0.30774	.	.	ENSG00000131482	ENST00000253801	T	0.76968	-1.06	4.94	2.7	0.31948	.	0.500148	0.21229	N	0.078016	T	0.64940	0.2644	L	0.40543	1.245	0.80722	D	1	B	0.28713	0.22	B	0.22386	0.039	T	0.57171	-0.7857	10	0.42905	T	0.14	.	7.4228	0.27081	0.6356:0.2889:0.0755:0.0	.	285	P35575	G6PC_HUMAN	E	285	ENSP00000253801:K285E	ENSP00000253801:K285E	K	+	1	0	G6PC	38316748	0.978000	0.34361	0.669000	0.29828	0.561000	0.35649	1.281000	0.33214	0.364000	0.24374	0.445000	0.29226	AAG	.	.		0.577	G6PC-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452451.1	NM_000151	
GH1	2688	hgsc.bcm.edu	37	17	61994712	61994712	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-A10Y-01A-11D-A12Z-10	TCGA-BC-A10Y-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	54f8357c-9dd7-4e08-bd47-a1ebedb30b62	5589b608-e6ae-4953-8a37-484d4116179b	g.chr17:61994712C>T	ENST00000323322.5	-	5	653	c.611G>A	c.(610-612)cGc>cAc	p.R204H	GH1_ENST00000342364.4_Missense_Mutation_p.R109H|GH1_ENST00000351388.4_Missense_Mutation_p.R164H|CSHL1_ENST00000392824.4_Intron|GH1_ENST00000458650.2_Missense_Mutation_p.R189H	NM_000515.3	NP_000506.2	P01241	SOMA_HUMAN	growth hormone 1	204					bone maturation (GO:0070977)|glucose transport (GO:0015758)|growth hormone receptor signaling pathway (GO:0060396)|JAK-STAT cascade (GO:0007259)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|positive regulation of activation of JAK2 kinase activity (GO:0010535)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|response to estradiol (GO:0032355)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	growth factor activity (GO:0008083)|growth hormone receptor binding (GO:0005131)|metal ion binding (GO:0046872)|prolactin receptor binding (GO:0005148)			breast(3)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(10)	19						CTGCACGATGCGCAGGAATGT	0.582																																					p.R204H		Atlas-SNP	.											.	GH1	39	.	0			c.G611A						.						159.0	123.0	135.0					17																	61994712		2203	4297	6500	SO:0001583	missense	2688	exon5			ACGATGCGCAGGA	M13438	CCDS11653.1, CCDS11654.1, CCDS45760.1	17q22-q24	2014-01-30				ENSG00000259384		"""Endogenous ligands"""	4261	protein-coding gene	gene with protein product	"""pituitary growth hormone"", ""somatotropin"""	139250				6306568	Standard	XM_005257218		Approved	GH-N, GHN, GH, hGH-N	uc002jdj.3	P01241		ENST00000323322.5:c.611G>A	chr17.hg19:g.61994712C>T	ENSP00000312673:p.Arg204His	413.0	1.0		610.0	163.0	NM_000515	A6NEF6|Q14405|Q16631|Q5EB53|Q9HBZ1|Q9UMJ7|Q9UNL5	Missense_Mutation	SNP	ENST00000323322.5	hg19	CCDS11653.1	.	.	.	.	.	.	.	.	.	.	c	12.36	1.913401	0.33815	.	.	ENSG00000204414	ENST00000323322;ENST00000458650;ENST00000351388;ENST00000342364	D;T;D;D	0.91464	-2.85;0.79;-2.85;-2.85	2.62	2.62	0.31277	Somatotropin hormone, conserved site (1);Four-helical cytokine-like, core (1);Four-helical cytokine, core (1);	4.792870	0.00622	N	0.000451	D	0.88966	0.6581	M	0.79123	2.44	0.31505	N	0.664319	P;B;B;B	0.41102	0.738;0.241;0.164;0.164	B;B;B;B	0.32928	0.155;0.12;0.061;0.061	T	0.81415	-0.0943	10	0.56958	D	0.05	.	4.6175	0.12433	0.0:0.7127:0.0:0.2873	.	109;164;204;189	B1A4G9;A6NEF6;P01241;B1A4G7	.;.;SOMA_HUMAN;.	H	204;189;164;109	ENSP00000312673:R204H;ENSP00000408486:R189H;ENSP00000343791:R164H;ENSP00000339278:R109H	ENSP00000312673:R204H	R	-	2	0	GH1	59348444	1.000000	0.71417	0.994000	0.49952	0.824000	0.46624	3.326000	0.52037	1.470000	0.48102	0.298000	0.19748	CGC	.	.		0.582	GH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417708.1	NM_000515	
ICAM1	3383	hgsc.bcm.edu	37	19	10385686	10385686	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A10Y-01A-11D-A12Z-10	TCGA-BC-A10Y-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	54f8357c-9dd7-4e08-bd47-a1ebedb30b62	5589b608-e6ae-4953-8a37-484d4116179b	g.chr19:10385686A>G	ENST00000264832.3	+	2	638	c.313A>G	c.(313-315)Acc>Gcc	p.T105A	CTD-2369P2.5_ENST00000592893.1_RNA|ICAM1_ENST00000423829.2_Intron	NM_000201.2	NP_000192.2	P05362	ICAM1_HUMAN	intercellular adhesion molecule 1	105					adhesion of symbiont to host (GO:0044406)|cell adhesion (GO:0007155)|cell adhesion mediated by integrin (GO:0033627)|cell aging (GO:0007569)|cellular response to alkaloid (GO:0071312)|cellular response to glucose stimulus (GO:0071333)|cellular response to hypoxia (GO:0071456)|cellular response to interleukin-1 (GO:0071347)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to nutrient levels (GO:0031669)|cellular response to tumor necrosis factor (GO:0071356)|cytokine-mediated signaling pathway (GO:0019221)|establishment of endothelial barrier (GO:0061028)|extracellular matrix organization (GO:0030198)|heterophilic cell-cell adhesion (GO:0007157)|interferon-gamma-mediated signaling pathway (GO:0060333)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|membrane to membrane docking (GO:0022614)|negative regulation of calcium ion transport (GO:0051926)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|ovarian follicle development (GO:0001541)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of cellular extravasation (GO:0002693)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of vasoconstriction (GO:0045907)|receptor-mediated virion attachment to host cell (GO:0046813)|regulation of cell adhesion (GO:0030155)|regulation of cell shape (GO:0008360)|regulation of immune response (GO:0050776)|regulation of leukocyte mediated cytotoxicity (GO:0001910)|regulation of ruffle assembly (GO:1900027)|response to amino acid (GO:0043200)|response to amphetamine (GO:0001975)|response to copper ion (GO:0046688)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to gonadotropin (GO:0034698)|response to ionizing radiation (GO:0010212)|response to organic cyclic compound (GO:0014070)|response to sulfur dioxide (GO:0010477)|T cell activation via T cell receptor contact with antigen bound to MHC molecule on antigen presenting cell (GO:0002291)|T cell antigen processing and presentation (GO:0002457)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|immunological synapse (GO:0001772)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	integrin binding (GO:0005178)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)|virus receptor activity (GO:0001618)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(4)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	14			OV - Ovarian serous cystadenocarcinoma(20;1.39e-09)|Epithelial(33;2.81e-06)|all cancers(31;6.56e-06)		Hyaluronan(DB08818)|Natalizumab(DB00108)	AACAGCTAAAACCTTCCTCAC	0.562																																					p.T105A		Atlas-SNP	.											.	ICAM1	32	.	0			c.A313G						.						105.0	105.0	105.0					19																	10385686		2202	4299	6501	SO:0001583	missense	3383	exon2			GCTAAAACCTTCC		CCDS12231.1	19p13.3-p13.2	2014-01-30	2008-07-18			ENSG00000090339		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Endogenous ligands"""	5344	protein-coding gene	gene with protein product	"""human rhinovirus receptor"""	147840				2453850, 3871395	Standard	NM_000201		Approved	BB2, CD54	uc002mnq.2	P05362		ENST00000264832.3:c.313A>G	chr19.hg19:g.10385686A>G	ENSP00000264832:p.Thr105Ala	77.0	0.0		55.0	31.0	NM_000201	B2R6M3|Q5NKV7|Q96B50	Missense_Mutation	SNP	ENST00000264832.3	hg19	CCDS12231.1	.	.	.	.	.	.	.	.	.	.	A	2.259	-0.369764	0.05069	.	.	ENSG00000090339	ENST00000264832	T	0.26518	1.73	4.46	-7.41	0.01392	Intercellular adhesion molecule, N-terminal (1);Immunoglobulin-like fold (1);	1.154360	0.06315	N	0.703431	T	0.11965	0.0291	N	0.10760	0.04	0.09310	N	1	B	0.02656	0.0	B	0.10450	0.005	T	0.39583	-0.9607	10	0.15499	T	0.54	-0.4045	14.6977	0.69134	0.1734:0.0:0.8266:0.0	.	105	P05362	ICAM1_HUMAN	A	105	ENSP00000264832:T105A	ENSP00000264832:T105A	T	+	1	0	ICAM1	10246686	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.788000	0.04614	-1.333000	0.02247	-0.408000	0.06270	ACC	.	.		0.562	ICAM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451207.1		
ATP13A1	57130	hgsc.bcm.edu	37	19	19756558	19756558	+	Silent	SNP	C	C	T			TCGA-BC-A10Y-01A-11D-A12Z-10	TCGA-BC-A10Y-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	54f8357c-9dd7-4e08-bd47-a1ebedb30b62	5589b608-e6ae-4953-8a37-484d4116179b	g.chr19:19756558C>T	ENST00000357324.6	-	25	3428	c.3402G>A	c.(3400-3402)ctG>ctA	p.L1134L	ATP13A1_ENST00000291503.5_Silent_p.L1016L|GMIP_ENST00000445806.2_5'Flank|GMIP_ENST00000203556.4_5'Flank|GMIP_ENST00000587238.1_5'Flank	NM_020410.2	NP_065143.2	Q9HD20	AT131_HUMAN	ATPase type 13A1	1134						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|metal ion binding (GO:0046872)			central_nervous_system(3)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|liver(2)|lung(7)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	29						GACTCCACACCAGGGGCTTGT	0.627																																					p.L1134L	Esophageal Squamous(142;920 1789 9047 14684 24777)	Atlas-SNP	.											.	ATP13A1	82	.	0			c.G3402A						.						29.0	32.0	31.0					19																	19756558		2203	4297	6500	SO:0001819	synonymous_variant	57130	exon25			CCACACCAGGGGC	AK056420	CCDS32970.2	19p13.11	2010-04-20	2005-01-12	2005-01-12	ENSG00000105726	ENSG00000105726		"""ATPases / P-type"""	24215	protein-coding gene	gene with protein product	"""cation transporting ATPase"""		"""ATPase type 13A"""	ATP13A		11347906	Standard	NM_020410		Approved	KIAA1825, FLJ31858, CGI-152	uc002nnh.4	Q9HD20	OTTHUMG00000153016	ENST00000357324.6:c.3402G>A	chr19.hg19:g.19756558C>T		81.0	0.0		85.0	53.0	NM_020410	B3KPJ2|B3KTA7|Q6NT90|Q6ZMG7|Q9H6C6	Silent	SNP	ENST00000357324.6	hg19	CCDS32970.2																																																																																			.	.		0.627	ATP13A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329005.1	NM_020410	
WDR87	83889	hgsc.bcm.edu	37	19	38383656	38383656	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-A10Y-01A-11D-A12Z-10	TCGA-BC-A10Y-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	54f8357c-9dd7-4e08-bd47-a1ebedb30b62	5589b608-e6ae-4953-8a37-484d4116179b	g.chr19:38383656G>A	ENST00000303868.5	-	4	2794	c.2570C>T	c.(2569-2571)aCc>aTc	p.T857I	WDR87_ENST00000447313.2_Missense_Mutation_p.T896I	NM_031951.3	NP_114157.3	Q6ZQQ6	WDR87_HUMAN	WD repeat domain 87	857										NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|lung(2)|prostate(1)|skin(3)|stomach(1)	36						GACACTGTAGGTTACATCCTT	0.393																																					p.T857I		Atlas-SNP	.											.	WDR87	191	.	0			c.C2570T						.						121.0	96.0	104.0					19																	38383656		692	1591	2283	SO:0001583	missense	83889	exon4			CTGTAGGTTACAT	AK128826	CCDS46063.1, CCDS74356.1	19q13.13	2013-01-09			ENSG00000171804	ENSG00000171804		"""WD repeat domain containing"""	29934	protein-coding gene	gene with protein product							Standard	XM_005259304		Approved	NYD-SP11	uc010efu.2	Q6ZQQ6	OTTHUMG00000048187	ENST00000303868.5:c.2570C>T	chr19.hg19:g.38383656G>A	ENSP00000368025:p.Thr857Ile	315.0	1.0		373.0	182.0	NM_031951	Q9BWV9	Missense_Mutation	SNP	ENST00000303868.5	hg19	CCDS46063.1	.	.	.	.	.	.	.	.	.	.	G	6.512	0.462670	0.12402	.	.	ENSG00000171804	ENST00000447313;ENST00000303868	T;T	0.10668	2.85;2.85	5.4	4.35	0.52113	.	0.372260	0.22932	N	0.053885	T	0.25791	0.0628	L	0.57536	1.79	0.09310	N	1	D;D	0.69078	0.997;0.997	D;D	0.66196	0.942;0.942	T	0.03077	-1.1075	10	0.56958	D	0.05	-12.8528	11.4495	0.50145	0.0:0.0:0.8198:0.1802	.	857;896	Q6ZQQ6;E7ESW6	WDR87_HUMAN;.	I	896;857	ENSP00000405012:T896I;ENSP00000368025:T857I	ENSP00000368025:T857I	T	-	2	0	WDR87	43075496	0.788000	0.28762	0.084000	0.20598	0.051000	0.14879	3.353000	0.52247	1.242000	0.43836	0.643000	0.83706	ACC	.	.		0.393	WDR87-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000314628.2	XM_940478	
RRBP1	6238	hgsc.bcm.edu	37	20	17596122	17596122	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-A10Y-01A-11D-A12Z-10	TCGA-BC-A10Y-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	54f8357c-9dd7-4e08-bd47-a1ebedb30b62	5589b608-e6ae-4953-8a37-484d4116179b	g.chr20:17596122G>A	ENST00000377813.1	-	23	4307	c.4004C>T	c.(4003-4005)gCc>gTc	p.A1335V	RRBP1_ENST00000470422.1_5'UTR|RRBP1_ENST00000246043.4_Missense_Mutation_p.A1335V|RRBP1_ENST00000377807.2_Missense_Mutation_p.A902V|RRBP1_ENST00000360807.4_Missense_Mutation_p.A902V|RRBP1_ENST00000455029.2_Missense_Mutation_p.A676V			Q9P2E9	RRBP1_HUMAN	ribosome binding protein 1	1335					osteoblast differentiation (GO:0001649)|protein transport (GO:0015031)|translation (GO:0006412)	endoplasmic reticulum (GO:0005783)|integral component of endoplasmic reticulum membrane (GO:0030176)|membrane (GO:0016020)|ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)|receptor activity (GO:0004872)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(9)|ovary(2)|prostate(6)	28						TAGGGGGCCGGCTGTGCGGAG	0.617																																					p.A902V		Atlas-SNP	.											.	RRBP1	157	.	0			c.C2705T						.						52.0	54.0	53.0					20																	17596122		2203	4300	6503	SO:0001583	missense	6238	exon23			GGGCCGGCTGTGC	AB037819	CCDS13128.1	20p12	2012-12-07	2012-12-07		ENSG00000125844	ENSG00000125844			10448	protein-coding gene	gene with protein product		601418	"""ribosome binding protein 1 (dog 180kD homolog)"", ""ribosome binding protein 1 homolog 180kDa (dog)"""			8812507	Standard	NM_001042576		Approved	ES/130, hES	uc002wpw.1	Q9P2E9	OTTHUMG00000031945	ENST00000377813.1:c.4004C>T	chr20.hg19:g.17596122G>A	ENSP00000367044:p.Ala1335Val	97.0	0.0		100.0	44.0	NM_004587	A2A2S6|A6NCN6|O75300|O75301|Q5W165|Q96SB2|Q9BWP1|Q9H476	Missense_Mutation	SNP	ENST00000377813.1	hg19		.	.	.	.	.	.	.	.	.	.	G	13.11	2.138467	0.37728	.	.	ENSG00000125844	ENST00000360807;ENST00000377813;ENST00000377807;ENST00000246043;ENST00000455029	T;T;T;T;T	0.30981	1.51;1.51;1.51;1.51;1.51	5.13	-0.565	0.11771	.	2.631350	0.01755	N	0.030204	T	0.23611	0.0571	L	0.36672	1.1	0.09310	N	1	B;B	0.24132	0.098;0.015	B;B	0.26770	0.073;0.01	T	0.08700	-1.0709	10	0.29301	T	0.29	6.4995	2.7014	0.05149	0.1518:0.2642:0.4465:0.1375	.	902;1335	Q9P2E9-3;Q9P2E9	.;RRBP1_HUMAN	V	902;1335;902;1335;676	ENSP00000354045:A902V;ENSP00000367044:A1335V;ENSP00000367038:A902V;ENSP00000246043:A1335V;ENSP00000401206:A676V	ENSP00000246043:A1335V	A	-	2	0	RRBP1	17544122	0.001000	0.12720	0.000000	0.03702	0.003000	0.03518	0.966000	0.29331	-0.348000	0.08286	0.556000	0.70494	GCC	.	.		0.617	RRBP1-002	NOVEL	basic	protein_coding	protein_coding	OTTHUMT00000078125.1	NM_001042576	
RRP1B	23076	hgsc.bcm.edu	37	21	45092191	45092191	+	Silent	SNP	A	A	G			TCGA-BC-A10Y-01A-11D-A12Z-10	TCGA-BC-A10Y-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	54f8357c-9dd7-4e08-bd47-a1ebedb30b62	5589b608-e6ae-4953-8a37-484d4116179b	g.chr21:45092191A>G	ENST00000340648.4	+	3	333	c.216A>G	c.(214-216)gaA>gaG	p.E72E		NM_015056.2	NP_055871.1	Q14684	RRP1B_HUMAN	ribosomal RNA processing 1B	72					negative regulation of phosphatase activity (GO:0010923)|rRNA processing (GO:0006364)	cytosol (GO:0005829)|euchromatin (GO:0000791)|heterochromatin (GO:0000792)|nucleolus (GO:0005730)|nucleus (GO:0005634)|preribosome, small subunit precursor (GO:0030688)	poly(A) RNA binding (GO:0044822)			cervix(1)|endometrium(1)|kidney(3)|large_intestine(4)|lung(3)|ovary(1)|pancreas(1)|prostate(3)|skin(3)|stomach(1)	21				STAD - Stomach adenocarcinoma(101;0.178)		CTCTGCAGGAAGAGCTCGCCA	0.557																																					p.E72E		Atlas-SNP	.											.	RRP1B	51	.	0			c.A216G						.						170.0	142.0	151.0					21																	45092191		2203	4300	6503	SO:0001819	synonymous_variant	23076	exon3			GCAGGAAGAGCTC	AK124620	CCDS33577.1	21q22.3	2014-06-13	2013-07-02	2007-03-26	ENSG00000160208	ENSG00000160208			23818	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 136"""	610654	"""KIAA0179"", ""ribosomal RNA processing 1 homolog B (S. cerevisiae)"""	KIAA0179			Standard	NM_015056		Approved	Nnp1, RRP1, PPP1R136	uc002zdk.3	Q14684	OTTHUMG00000086872	ENST00000340648.4:c.216A>G	chr21.hg19:g.45092191A>G		139.0	0.0		118.0	54.0	NM_015056	Q8TBZ4	Silent	SNP	ENST00000340648.4	hg19	CCDS33577.1																																																																																			.	.		0.557	RRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195651.1	NM_015056	
MAP3K15	389840	hgsc.bcm.edu	37	X	19410152	19410152	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-A10Y-01A-11D-A12Z-10	TCGA-BC-A10Y-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	54f8357c-9dd7-4e08-bd47-a1ebedb30b62	5589b608-e6ae-4953-8a37-484d4116179b	g.chrX:19410152G>A	ENST00000338883.4	-	18	2398	c.2399C>T	c.(2398-2400)gCg>gTg	p.A800V	MAP3K15_ENST00000359173.3_Missense_Mutation_p.A235V|MAP3K15_ENST00000469203.2_Missense_Mutation_p.A632V|MAP3K15_ENST00000518578.1_5'UTR	NM_001001671.3	NP_001001671.3	Q6ZN16	M3K15_HUMAN	mitogen-activated protein kinase kinase kinase 15	800	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.						ATP binding (GO:0005524)|MAP kinase kinase kinase activity (GO:0004709)|metal ion binding (GO:0046872)			NS(2)|cervix(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(8)|lung(13)|ovary(3)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	42	Hepatocellular(33;0.183)					GTTCACACCCGCAAGACGTTT	0.502																																					p.A800V		Atlas-SNP	.											.	MAP3K15	108	.	0			c.C2399T						.						77.0	73.0	75.0					X																	19410152		2203	4300	6503	SO:0001583	missense	389840	exon18			ACACCCGCAAGAC	AK131412		Xp22.12	2011-06-09			ENSG00000180815	ENSG00000180815		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	31689	protein-coding gene	gene with protein product		300820					Standard	NM_001001671		Approved	bA723P2.3, FLJ16518	uc022btq.1	Q6ZN16	OTTHUMG00000022724	ENST00000338883.4:c.2399C>T	chrX.hg19:g.19410152G>A	ENSP00000345629:p.Ala800Val	36.0	0.0		49.0	44.0	NM_001001671	A2AI49|A2AI50|A6NJ61|Q5JPR4|Q6ZMV3	Missense_Mutation	SNP	ENST00000338883.4	hg19		.	.	.	.	.	.	.	.	.	.	G	14.46	2.543327	0.45280	.	.	ENSG00000180815	ENST00000338883;ENST00000359173;ENST00000469203	T;T;T	0.65732	-0.17;-0.17;-0.17	5.09	4.2	0.49525	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.39036	0.1063	N	0.16166	0.38	0.80722	D	1	P;P	0.51537	0.946;0.853	B;B	0.31101	0.124;0.066	T	0.46830	-0.9163	10	0.72032	D	0.01	.	14.2245	0.65850	0.0:0.0:0.8495:0.1505	.	275;800	Q6ZN16-3;Q6ZN16	.;M3K15_HUMAN	V	800;235;632	ENSP00000345629:A800V;ENSP00000352093:A235V;ENSP00000428356:A632V	ENSP00000345629:A800V	A	-	2	0	MAP3K15	19320073	1.000000	0.71417	0.862000	0.33874	0.325000	0.28411	6.300000	0.72776	1.006000	0.39211	0.513000	0.50165	GCG	.	.		0.502	MAP3K15-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_001001671	
EIF2S3	1968	hgsc.bcm.edu	37	X	24084190	24084190	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A10Y-01A-11D-A12Z-10	TCGA-BC-A10Y-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	54f8357c-9dd7-4e08-bd47-a1ebedb30b62	5589b608-e6ae-4953-8a37-484d4116179b	g.chrX:24084190T>C	ENST00000253039.4	+	8	1101	c.848T>C	c.(847-849)aTc>aCc	p.I283T		NM_001415.3	NP_001406.1	P41091	IF2G_HUMAN	eukaryotic translation initiation factor 2, subunit 3 gamma, 52kDa	283					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|GTP catabolic process (GO:0006184)|translation (GO:0006412)|translational initiation (GO:0006413)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|translation factor activity, nucleic acid binding (GO:0008135)|translation initiation factor activity (GO:0003743)			breast(1)|cervix(1)|endometrium(4)|large_intestine(1)|lung(4)|ovary(1)	12						GGTGGTAGTATCCTAAAAGGA	0.323																																					p.I283T		Atlas-SNP	.											.	EIF2S3	31	.	0			c.T848C						.						166.0	153.0	158.0					X																	24084190		2203	4299	6502	SO:0001583	missense	1968	exon8			GTAGTATCCTAAA	L19161	CCDS14210.1	Xp22.2-p22.1	2008-07-31	2002-08-29		ENSG00000130741	ENSG00000130741			3267	protein-coding gene	gene with protein product	"""eukaryotic translation initiation factor 2G"""	300161	"""eukaryotic translation initiation factor 2, subunit 3 (gamma, 52kD)"""	EIF2G		8106381, 9736774	Standard	NM_001415		Approved	EIF2gamma, EIF2	uc004dbc.3	P41091	OTTHUMG00000021262	ENST00000253039.4:c.848T>C	chrX.hg19:g.24084190T>C	ENSP00000253039:p.Ile283Thr	479.0	0.0		387.0	347.0	NM_001415	B5BTZ4	Missense_Mutation	SNP	ENST00000253039.4	hg19	CCDS14210.1	.	.	.	.	.	.	.	.	.	.	t	20.9	4.073711	0.76415	.	.	ENSG00000130741	ENST00000253039	T	0.71817	-0.6	5.49	5.49	0.81192	Translation elongation factor EFTu/EF1A, domain 2 (1);Translation elongation/initiation factor/Ribosomal, beta-barrel (1);	0.000000	0.85682	D	0.000000	D	0.89770	0.6811	H	0.98089	4.145	0.80722	D	1	D	0.71674	0.998	D	0.72625	0.978	D	0.93420	0.6776	10	0.87932	D	0	.	14.804	0.69938	0.0:0.0:0.0:1.0	.	283	P41091	IF2G_HUMAN	T	283	ENSP00000253039:I283T	ENSP00000253039:I283T	I	+	2	0	EIF2S3	23994111	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	7.553000	0.82203	1.946000	0.56461	0.438000	0.28831	ATC	.	.		0.323	EIF2S3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056079.1	NM_001415	
AFF2	2334	hgsc.bcm.edu	37	X	147744245	147744245	+	Missense_Mutation	SNP	T	T	A			TCGA-BC-A10Y-01A-11D-A12Z-10	TCGA-BC-A10Y-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	54f8357c-9dd7-4e08-bd47-a1ebedb30b62	5589b608-e6ae-4953-8a37-484d4116179b	g.chrX:147744245T>A	ENST00000370460.2	+	3	1476	c.997T>A	c.(997-999)Tca>Aca	p.S333T	AFF2_ENST00000342251.3_Missense_Mutation_p.S329T|AFF2_ENST00000370457.5_Missense_Mutation_p.S329T|AFF2_ENST00000370458.1_Missense_Mutation_p.S329T	NM_001169123.1|NM_002025.3	NP_001162594.1|NP_002016.2	P51816	AFF2_HUMAN	AF4/FMR2 family, member 2	333					brain development (GO:0007420)|learning or memory (GO:0007611)|mRNA processing (GO:0006397)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	nuclear speck (GO:0016607)	G-quadruplex RNA binding (GO:0002151)			breast(5)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(29)|liver(2)|lung(39)|ovary(4)|pancreas(5)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	109	Acute lymphoblastic leukemia(192;6.56e-05)					TGCAGCCAGTTCAAAGACTAA	0.378																																					p.S333T		Atlas-SNP	.											.	AFF2	679	.	0			c.T997A						.						44.0	41.0	42.0					X																	147744245		2203	4299	6502	SO:0001583	missense	2334	exon3			GCCAGTTCAAAGA	U48436	CCDS14684.1, CCDS55521.1, CCDS76040.1	Xq28	2008-02-05	2005-06-27	2005-06-27	ENSG00000155966	ENSG00000155966			3776	protein-coding gene	gene with protein product		300806	"""fragile X mental retardation 2"""	FMR2			Standard	NM_002025		Approved	FRAXE	uc004fcp.3	P51816	OTTHUMG00000022613	ENST00000370460.2:c.997T>A	chrX.hg19:g.147744245T>A	ENSP00000359489:p.Ser333Thr	357.0	1.0		309.0	288.0	NM_002025	A2RTY4|B4DXD5|B7WNQ1|B7ZLD6|B7ZLD9|O43786|O60215|P78407|Q13521|Q14323|Q7Z2F7|Q7Z400|Q9UNA5	Missense_Mutation	SNP	ENST00000370460.2	hg19	CCDS14684.1	.	.	.	.	.	.	.	.	.	.	T	2.028	-0.423185	0.04734	.	.	ENSG00000155966	ENST00000370460;ENST00000370457;ENST00000342251;ENST00000370458	T;T;T;T	0.66638	0.03;-0.22;-0.22;1.01	5.92	-2.34	0.06704	.	0.486350	0.21455	N	0.074274	T	0.43545	0.1252	N	0.25890	0.77	0.80722	D	1	B;B;B;B;B;B	0.06786	0.001;0.001;0.001;0.001;0.001;0.001	B;B;B;B;B;B	0.12156	0.003;0.003;0.003;0.003;0.004;0.007	T	0.08106	-1.0738	10	0.16896	T	0.51	.	7.0505	0.25071	0.4558:0.0:0.2588:0.2855	.	333;329;329;329;333;329	P51816-6;P51816-3;P51816-2;P51816-5;P51816;P51816-4	.;.;.;.;AFF2_HUMAN;.	T	333;329;329;329	ENSP00000359489:S333T;ENSP00000359486:S329T;ENSP00000345459:S329T;ENSP00000359487:S329T	ENSP00000345459:S329T	S	+	1	0	AFF2	147551937	0.994000	0.37717	0.990000	0.47175	0.995000	0.86356	0.113000	0.15499	-0.385000	0.07833	0.486000	0.48141	TCA	.	.		0.378	AFF2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058673.2	NM_002025	
PCDH11Y	83259	hgsc.bcm.edu	37	Y	4925278	4925278	+	Silent	SNP	C	C	T			TCGA-BC-A10Y-01A-11D-A12Z-10	TCGA-BC-A10Y-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	54f8357c-9dd7-4e08-bd47-a1ebedb30b62	5589b608-e6ae-4953-8a37-484d4116179b	g.chrY:4925278C>T	ENST00000333703.4	+	4	894	c.381C>T	c.(379-381)tgC>tgT	p.C127C	PCDH11Y_ENST00000362095.5_Silent_p.C138C|PCDH11Y_ENST00000215473.6_Silent_p.C138C	NM_001278619.1|NM_032971.2	NP_001265548.1|NP_116753.1	Q9BZA8	PC11Y_HUMAN	protocadherin 11 Y-linked	138	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			autonomic_ganglia(1)|kidney(2)|large_intestine(7)|lung(14)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	27						ATGAGCATTGCTTTTATGAAG	0.408																																					p.C138C		Atlas-SNP	.											.	PCDH11Y	163	.	0			c.C414T						.																																			SO:0001819	synonymous_variant	83259	exon1			GCATTGCTTTTAT	AF332217	CCDS14776.1, CCDS14777.1, CCDS76066.1	Yp11.2	2010-01-26	2002-05-22	2002-05-24	ENSG00000099715	ENSG00000099715		"""Cadherins / Protocadherins : Non-clustered"""	15813	protein-coding gene	gene with protein product		400022	"""protocadherin 22"""	PCDH22		10644456, 11003707	Standard	NM_032971		Approved	PCDHY	uc004fqo.3	Q9BZA8	OTTHUMG00000035105	ENST00000333703.4:c.381C>T	chrY.hg19:g.4925278C>T		736.0	1.0		684.0	496.0	NM_032972	Q70LR6|Q70LR8|Q70LS0|Q70LS1|Q70LS2|Q70LS3|Q70LS4|Q70LS5|Q8WY34|Q9BZA9|Q9H4E1	Silent	SNP	ENST00000333703.4	hg19	CCDS14776.1																																																																																			.	.		0.408	PCDH11Y-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084979.2	NM_032973	
MT-CO1	4512	hgsc.bcm.edu	37	M	6478	6478	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-A10Y-01A-11D-A12Z-10	TCGA-BC-A10Y-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	54f8357c-9dd7-4e08-bd47-a1ebedb30b62	5589b608-e6ae-4953-8a37-484d4116179b	g.chrM:6478C>T	ENST00000361624.2	+	1	575	c.575C>T	c.(574-576)gCa>gTa	p.A192V	MT-ATP6_ENST00000361899.2_5'Flank|MT-TA_ENST00000387392.1_RNA|MT-TW_ENST00000387382.1_RNA|MT-TC_ENST00000387405.1_RNA|MT-CO2_ENST00000361739.1_5'Flank|MT-TN_ENST00000387400.1_RNA|MT-TY_ENST00000387409.1_RNA|MT-ATP8_ENST00000361851.1_5'Flank|MT-TQ_ENST00000387372.1_RNA|MT-CO3_ENST00000362079.2_5'Flank|MT-TS1_ENST00000387416.2_RNA|MT-TM_ENST00000387377.1_RNA|MT-TD_ENST00000387419.1_RNA|MT-TK_ENST00000387421.1_RNA|MT-TI_ENST00000387365.1_RNA			P00395	COX1_HUMAN	mitochondrially encoded cytochrome c oxidase I	192					aerobic respiration (GO:0009060)|cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|oxidative phosphorylation (GO:0006119)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex IV (GO:0005751)|respiratory chain complex IV (GO:0045277)	cytochrome-c oxidase activity (GO:0004129)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			breast(4)|endometrium(25)|kidney(19)|lung(3)|prostate(3)	54						CCTAATCACAGCAGTCCTACT	0.498																																					p.A192V		Atlas-SNP	.											.	.	.	.	0			c.C575T						.																																			SO:0001583	missense	5742	exon1			TCACAGCAGTCCT			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198804	ENSG00000198804		"""Mitochondrial respiratory chain complex / Complex IV"""	7419	protein-coding gene	gene with protein product		516030	"""cytochrome c oxidase I"""	MTCO1		7219534	Standard			Approved	COX1, COI		P00395		ENST00000361624.2:c.575C>T	chrM.hg19:g.6478C>T	ENSP00000354499:p.Ala192Val	332.0	0.0		179.0	168.0	ENST00000361624	Q34770	Missense_Mutation	SNP	ENST00000361624.2	hg19																																																																																				.	.		0.498	MT-CO1-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024028	
CSPG5	10675	hgsc.bcm.edu	37	3	47618408	47618409	+	Frame_Shift_Ins	INS	-	-	G			TCGA-BC-A10Y-01A-11D-A12Z-10	TCGA-BC-A10Y-11A-11D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	54f8357c-9dd7-4e08-bd47-a1ebedb30b62	5589b608-e6ae-4953-8a37-484d4116179b	g.chr3:47618408_47618409insG	ENST00000383738.2	-	2	3205_3206	c.1107_1108insC	c.(1105-1110)tcctgcfs	p.C370fs	CSPG5_ENST00000465441.1_5'Flank|CSPG5_ENST00000264723.4_Frame_Shift_Ins_p.C370fs|CSPG5_ENST00000456150.1_Frame_Shift_Ins_p.C232fs	NM_001206943.1|NM_001206945.1	NP_001193872.1|NP_001193874.1	O95196	CSPG5_HUMAN	chondroitin sulfate proteoglycan 5 (neuroglycan C)	370					axon regeneration (GO:0031103)|carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|glycosaminoglycan metabolic process (GO:0030203)|intracellular transport (GO:0046907)|nervous system development (GO:0007399)|regulation of growth (GO:0040008)|regulation of synaptic transmission (GO:0050804)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|Golgi lumen (GO:0005796)|Golgi-associated vesicle membrane (GO:0030660)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)	growth factor activity (GO:0008083)	p.C370R(1)		breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(6)|ovary(2)|pancreas(1)|prostate(2)	22				BRCA - Breast invasive adenocarcinoma(193;0.000266)|KIRC - Kidney renal clear cell carcinoma(197;0.00551)|Kidney(197;0.00621)		ACTGACCGGCAGGAGCCGTTAT	0.619																																					p.C370fs		Atlas-INDEL	.											CSPG5,NS,carcinoma,0,1	CSPG5	46	.	1	Substitution - Missense(1)	prostate(1)	c.1108_1109insC						.																																			SO:0001589	frameshift_variant	10675	exon2			.	AF059274	CCDS2757.1, CCDS56252.1, CCDS56253.1, CCDS74930.1	3p21.3	2008-07-18			ENSG00000114646	ENSG00000114646			2467	protein-coding gene	gene with protein product		606775				9950058	Standard	NM_006574		Approved	NGC	uc003crp.4	O95196	OTTHUMG00000133518	ENST00000383738.2:c.1108dupC	chr3.hg19:g.47618410_47618410dupG	ENSP00000373244:p.Cys370fs	130.0	0.0		159.0	10.0	NM_001206944	Q71M39|Q71M40	Frame_Shift_Ins	INS	ENST00000383738.2	hg19	CCDS56253.1																																																																																			.	.		0.619	CSPG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257489.1	NM_006574	
NR3C2	4306	hgsc.bcm.edu	37	4	149075987	149075988	+	Frame_Shift_Ins	INS	-	-	C			TCGA-BC-A10Y-01A-11D-A12Z-10	TCGA-BC-A10Y-11A-11D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	54f8357c-9dd7-4e08-bd47-a1ebedb30b62	5589b608-e6ae-4953-8a37-484d4116179b	g.chr4:149075987_149075988insC	ENST00000358102.3	-	5	2441_2442	c.2079_2080insG	c.(2077-2082)cagcccfs	p.P694fs	NR3C2_ENST00000344721.4_Frame_Shift_Ins_p.P694fs|NR3C2_ENST00000512865.1_Intron|NR3C2_ENST00000511528.1_Frame_Shift_Ins_p.P698fs|NR3C2_ENST00000503313.1_5'UTR|NR3C2_ENST00000355292.3_Frame_Shift_Ins_p.P698fs|RP11-76G10.1_ENST00000514843.1_RNA	NM_000901.4|NM_001166104.1	NP_000892.2|NP_001159576.1	P08235	MCR_HUMAN	nuclear receptor subfamily 3, group C, member 2	694	Hinge.				gene expression (GO:0010467)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|receptor complex (GO:0043235)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid binding (GO:0005496)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(14)|liver(1)|lung(11)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	41	all_hematologic(180;0.151)			GBM - Glioblastoma multiforme(119;0.0614)	Drospirenone(DB01395)|Eplerenone(DB00700)|Felodipine(DB01023)|Fludrocortisone(DB00687)|Fluticasone Propionate(DB00588)|Nimodipine(DB00393)|Progesterone(DB00396)|Spironolactone(DB00421)	gggggtgggggCTGCTGCTGCT	0.515																																					p.P694fs	Melanoma(27;428 957 40335 51025 51111)	Atlas-INDEL	.											.	NR3C2	94	.	0			c.2080_2081insG						.																																			SO:0001589	frameshift_variant	4306	exon5			.	M16801	CCDS3772.1, CCDS54811.1	4q31	2013-01-16			ENSG00000151623	ENSG00000151623		"""Nuclear hormone receptors"""	7979	protein-coding gene	gene with protein product		600983		MLR		2558856	Standard	NM_000901		Approved	MR	uc003ilj.4	P08235	OTTHUMG00000161455	ENST00000358102.3:c.2080dupG	chr4.hg19:g.149075988_149075988dupC	ENSP00000350815:p.Pro694fs	106.0	0.0		146.0	10.0	NM_000901	B0ZBF5|B0ZBF7|Q2NKL1|Q96KQ8|Q96KQ9	Frame_Shift_Ins	INS	ENST00000358102.3	hg19	CCDS3772.1																																																																																			.	.		0.515	NR3C2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364986.1		
ACSBG1	23205	hgsc.bcm.edu	37	15	78472115	78472136	+	Splice_Site	DEL	TCAGGTCGCTGGTGGGAGAGGG	TCAGGTCGCTGGTGGGAGAGGG	-	rs199505466|rs144974698	byFrequency	TCGA-BC-A10Y-01A-11D-A12Z-10	TCGA-BC-A10Y-11A-11D-A12Z-10	TCAGGTCGCTGGTGGGAGAGGG	TCAGGTCGCTGGTGGGAGAGGG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	54f8357c-9dd7-4e08-bd47-a1ebedb30b62	5589b608-e6ae-4953-8a37-484d4116179b	g.chr15:78472115_78472136delTCAGGTCGCTGGTGGGAGAGGG	ENST00000258873.4	-	10	1459_1466	c.1254_1261delCCCTCTCCCACCAGCGACCTGA	c.(1252-1263)agccctctccca>agca	p.PLP419fs	ACSBG1_ENST00000541759.1_Splice_Site_p.PLP177fs|ACSBG1_ENST00000560817.1_Splice_Site_p.PLP177fs	NM_001199377.1|NM_015162.4	NP_001186306.1|NP_055977.3	Q96GR2	ACBG1_HUMAN	acyl-CoA synthetase bubblegum family member 1	419					long-chain fatty acid metabolic process (GO:0001676)|myelination (GO:0042552)|ovarian follicle atresia (GO:0001552)|response to glucocorticoid (GO:0051384)|very long-chain fatty acid metabolic process (GO:0000038)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)	ATP binding (GO:0005524)|long-chain fatty acid-CoA ligase activity (GO:0004467)|very long-chain fatty acid-CoA ligase activity (GO:0031957)			endometrium(2)|kidney(2)|large_intestine(11)|liver(1)|lung(15)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)	37						GTGAAGGGCTTCAGGTCGCTGGTGGGAGAGGGAGAATGGTTC	0.514																																					p.418_421del		Atlas-INDEL	.											.	ACSBG1	79	.	0			c.1254_1262del						.																																			SO:0001630	splice_region_variant	23205	exon10			.	AB014531	CCDS10298.1	15q23-q24	2006-02-09			ENSG00000103740	ENSG00000103740		"""Acyl-CoA synthetase family"""	29567	protein-coding gene	gene with protein product	"""bubblegum"", ""very long-chain acyl-CoA synthetase"", ""lipidosin"""	614362				9734811, 10954726	Standard	NM_015162		Approved	BGM, FLJ30320, MGC14352, BG1, KIAA0631, hBG1, hsBG	uc002bdh.3	Q96GR2	OTTHUMG00000143734	ENST00000258873.4:c.1254-1CCCTCTCCCACCAGCGACCTGA>-	chr15.hg19:g.78472115_78472136delTCAGGTCGCTGGTGGGAGAGGG		125.0	0.0		152.0	14.0	NM_015162	B2RB61|O75126|Q76N27|Q9HC26	In_Frame_Del	DEL	ENST00000258873.4	hg19	CCDS10298.1																																																																																			.	.		0.514	ACSBG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000289802.2	NM_015162	Frame_Shift_Del
ZNF785	146540	hgsc.bcm.edu	37	16	30594358	30594358	+	Frame_Shift_Del	DEL	C	C	-			TCGA-BC-A10Y-01A-11D-A12Z-10	TCGA-BC-A10Y-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	54f8357c-9dd7-4e08-bd47-a1ebedb30b62	5589b608-e6ae-4953-8a37-484d4116179b	g.chr16:30594358delC	ENST00000395216.2	-	3	900	c.741delG	c.(739-741)aggfs	p.R248fs	AC002310.7_ENST00000486926.1_RNA|ZNF785_ENST00000470110.1_Frame_Shift_Del_p.R233fs|AC002310.7_ENST00000492040.1_RNA|RP11-146F11.5_ENST00000563540.1_RNA	NM_152458.6	NP_689671.2	A8K8V0	ZN785_HUMAN	zinc finger protein 785	248					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|lung(2)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	9						TGTGAGCCCGCCTGTGGATAG	0.657																																					p.R248fs		Atlas-Indel,Pindel	.											.	ZNF785	30	.	0			c.742delC						.						36.0	35.0	35.0					16																	30594358		2197	4300	6497	SO:0001589	frameshift_variant	146540	exon3			.	BC040642	CCDS10685.1	16p11.2	2013-01-08			ENSG00000197162	ENSG00000197162		"""Zinc fingers, C2H2-type"", ""-"""	26496	protein-coding gene	gene with protein product						10493829	Standard	NM_152458		Approved	FLJ32130	uc002dyu.3	A8K8V0	OTTHUMG00000132398	ENST00000395216.2:c.741delG	chr16.hg19:g.30594358delC	ENSP00000378642:p.Arg248fs	68.0	0.0		68.0	31.0	NM_152458	O75701|Q8IW91|Q8WV14|Q96MN0	Frame_Shift_Del	DEL	ENST00000395216.2	hg19	CCDS10685.1																																																																																			.	.		0.657	ZNF785-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255529.2	NM_152458	
MED24	9862	hgsc.bcm.edu	37	17	38185119	38185120	+	Frame_Shift_Ins	INS	-	-	GGGG	rs142237214|rs150608790	byFrequency	TCGA-BC-A10Y-01A-11D-A12Z-10	TCGA-BC-A10Y-11A-11D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	54f8357c-9dd7-4e08-bd47-a1ebedb30b62	5589b608-e6ae-4953-8a37-484d4116179b	g.chr17:38185119_38185120insGGGG	ENST00000394128.2	-	14	1449_1450	c.1368_1369insCCCC	c.(1366-1371)gccgccfs	p.A457fs	MED24_ENST00000394127.2_Frame_Shift_Ins_p.A444fs|MED24_ENST00000394126.1_Frame_Shift_Ins_p.A482fs|MED24_ENST00000501516.3_Frame_Shift_Ins_p.A476fs|SNORD124_ENST00000459577.1_RNA|MED24_ENST00000356271.3_Frame_Shift_Ins_p.A444fs	NM_014815.3	NP_055630.2	O75448	MED24_HUMAN	mediator complex subunit 24	457					androgen receptor signaling pathway (GO:0030521)|gene expression (GO:0010467)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|positive regulation of transcription, DNA-templated (GO:0045893)|protein heterooligomerization (GO:0051291)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	histone acetyltransferase activity (GO:0004402)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|receptor activity (GO:0004872)|RNA polymerase II transcription cofactor activity (GO:0001104)|thyroid hormone receptor binding (GO:0046966)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)			autonomic_ganglia(1)|breast(2)|endometrium(9)|large_intestine(10)|lung(14)|ovary(1)|prostate(2)|skin(1)|urinary_tract(1)	41	Colorectal(19;0.000442)					TTTCCAGTGGCGGCGGCGGCAG	0.634																																					p.A457fs		Atlas-INDEL	.											MED24,colon,carcinoma,0,1	MED24	89	.	0			c.1369_1370insCCCC						.																																			SO:0001589	frameshift_variant	9862	exon14			.	AF055995	CCDS11359.1, CCDS42315.1	17q21.2	2007-07-30	2007-07-30	2007-07-30	ENSG00000008838	ENSG00000008838			22963	protein-coding gene	gene with protein product		607000	"""thyroid hormone receptor associated protein 4"", ""cofactor required for Sp1 transcriptional activation, subunit 4, 100kDa"""	THRAP4, CRSP4			Standard	NM_001079518		Approved	TRAP100, KIAA0130, DRIP100, CRSP100	uc002htt.3	O75448	OTTHUMG00000133329	ENST00000394128.2:c.1368_1369insCCCC	chr17.hg19:g.38185119_38185120insGGGG	ENSP00000377686:p.Ala457fs	102.0	0.0		72.0	12.0	NM_014815	A8K4S5|B3KMR9|Q14143|Q9NNY5	Frame_Shift_Ins	INS	ENST00000394128.2	hg19	CCDS11359.1																																																																																			.	.		0.634	MED24-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257147.2	NM_014815	
PCDHGC5	56097	hgsc.bcm.edu	37	5	140869331	140869332	+	Frame_Shift_Ins	INS	-	-	C	rs145669059		TCGA-BC-A10Y-01A-11D-A12Z-10	TCGA-BC-A10Y-11A-11D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	54f8357c-9dd7-4e08-bd47-a1ebedb30b62	5589b608-e6ae-4953-8a37-484d4116179b	g.chr5:140869331_140869332insC	ENST00000252087.1	+	1	524_525	c.524_525insC	c.(523-528)aacagcfs	p.S176fs	PCDHGA3_ENST00000253812.6_Intron|PCDHGA10_ENST00000398610.2_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGB6_ENST00000520790.1_Intron|PCDHGA12_ENST00000252085.3_Intron|PCDHGA11_ENST00000398587.2_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA11_ENST00000518882.1_Intron|PCDHGC3_ENST00000308177.3_Intron|PCDHGC4_ENST00000306593.1_Intron|PCDHGB7_ENST00000398594.2_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA9_ENST00000573521.1_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB1_ENST00000523390.1_Intron	NM_018929.2|NM_032403.2|NM_032407.1	NP_061752.1|NP_115779.1|NP_115783.1	Q9Y5F6	PCDGM_HUMAN	protocadherin gamma subfamily C, 5	176	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(2)|endometrium(6)|kidney(4)|large_intestine(4)|lung(10)|ovary(4)|prostate(1)|urinary_tract(2)	35			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CTAAGCCCCAACAGCCACTTCT	0.535																																					p.N175fs		Atlas-INDEL	.											.	PCDHGC5	199	.	0			c.524_525insC						.																																			SO:0001589	frameshift_variant	56097	exon1			.	AF152526	CCDS4263.1, CCDS75350.1	5q31	2010-01-26			ENSG00000240764	ENSG00000240764		"""Cadherins / Protocadherins : Clustered"""	8718	other	protocadherin		606306				10380929	Standard	NM_018929		Approved	PCDH-GAMMA-C5	uc003lla.2	Q9Y5F6	OTTHUMG00000129624	ENST00000252087.1:c.525dupC	chr5.hg19:g.140869332_140869332dupC	ENSP00000252087:p.Ser176fs	86.0	0.0		122.0	11.0	NM_018929	Q9Y5C2	Frame_Shift_Ins	INS	ENST00000252087.1	hg19	CCDS4263.1																																																																																			.	.		0.535	PCDHGC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251819.1	NM_018929	
PRB3	5544	hgsc.bcm.edu	37	12	11420457	11420583	+	Frame_Shift_Del	DEL	GAGGGTGGGGGACCTTGAGGTTTGTTGCCTCCTTGTGAAGGTGGTCCTTCTGGCTTTCCTGGACGAGGTGGGGGACCTTGGGACTGGTTTCCTCCTTGTGGGGGTGGTCCTTCTGGCTTTCCTGGAC	GAGGGTGGGGGACCTTGAGGTTTGTTGCCTCCTTGTGAAGGTGGTCCTTCTGGCTTTCCTGGACGAGGTGGGGGACCTTGGGACTGGTTTCCTCCTTGTGGGGGTGGTCCTTCTGGCTTTCCTGGAC	-	rs367917023|rs552923329|rs12811806|rs200902635|rs570697251|rs113884749|rs11054203|rs370173277|rs28435564|rs112526960|rs375731986|rs12368171|rs200117404|rs12811811|rs539718896|rs550913655	byFrequency	TCGA-BC-A10Y-01A-11D-A12Z-10	TCGA-BC-A10Y-11A-11D-A12Z-10	GAGGGTGGGGGACCTTGAGGTTTGTTGCCTCCTTGTGAAGGTGGTCCTTCTGGCTTTCCTGGACGAGGTGGGGGACCTTGGGACTGGTTTCCTCCTTGTGGGGGTGGTCCTTCTGGCTTTCCTGGAC	GAGGGTGGGGGACCTTGAGGTTTGTTGCCTCCTTGTGAAGGTGGTCCTTCTGGCTTTCCTGGACGAGGTGGGGGACCTTGGGACTGGTTTCCTCCTTGTGGGGGTGGTCCTTCTGGCTTTCCTGGAC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	54f8357c-9dd7-4e08-bd47-a1ebedb30b62	5589b608-e6ae-4953-8a37-484d4116179b	g.chr12:11420457_11420583delGAGGGTGGGGGACCTTGAGGTTTGTTGCCTCCTTGTGAAGGTGGTCCTTCTGGCTTTCCTGGACGAGGTGGGGGACCTTGGGACTGGTTTCCTCCTTGTGGGGGTGGTCCTTCTGGCTTTCCTGGAC	ENST00000279573.7	-	3	735_861	c.600_726delGTCCAGGAAAGCCAGAAGGACCACCCCCACAAGGAGGAAACCAGTCCCAAGGTCCCCCACCTCGTCCAGGAAAGCCAGAAGGACCACCTTCACAAGGAGGCAACAAACCTCAAGGTCCCCCACCCTC	c.(598-726)cggtccaggaaagccagaaggaccacccccacaaggaggaaaccagtcccaaggtcccccacctcgtccaggaaagccagaaggaccaccttcacaaggaggcaacaaacctcaaggtcccccaccctcfs	p.RSRKARRTTPTRRKPVPRSPTSSRKARRTTFTRRQQTSRSPTL200fs	PRB3_ENST00000538488.1_Splice_Site_p.RSRKARRTTPTRRKPVPRSPTSSR179fs|PRB3_ENST00000440870.3_Intron|PRB3_ENST00000381842.3_Splice_Site_p.RSR200fs			Q04118	PRB3_HUMAN	proline-rich protein BstNI subfamily 3	200	10 X 21 AA tandem repeats of [RH]-P-G-K- P-[EQ]-G-[PQS]-P-[PS]-Q-[GE]-G-N-[QK]- [SP]-[QR]-[GR]-P-P-P.|Pro-rich.		Missing (in allele S).		defense response to Gram-negative bacterium (GO:0050829)	extracellular region (GO:0005576)		p.Q193K(1)		breast(2)|endometrium(1)|kidney(2)|large_intestine(1)|lung(13)|ovary(1)|skin(5)	25			OV - Ovarian serous cystadenocarcinoma(49;0.201)			GCTTTCCTGGACGAGGTGGGGGACCTTGAGGTTTGTTGCCTCCTTGTGGGGGTGGTCCTTCTGGCTTTCCCGGACGAGGTGGGGGACCTTGGGACTGGTTTCCTCCTTGTGGGGGTGGTCCTTCTGGCTTTCCCGGACGAGGTGGGG	0.618																																					p.242_242del		Pindel	.											PRB3_ENST00000538488,caecum,carcinoma,0,2	PRB3	84	.	1	Substitution - Missense(1)	endometrium(1)	c.725_725del						.																																			SO:0001589	frameshift_variant	5544	exon4			.			12p13.2	2012-10-02				ENSG00000197870			9339	protein-coding gene	gene with protein product		168840				1894623	Standard	NM_006249		Approved	PRG	uc001qzs.3	Q04118		ENST00000279573.7:c.600_726delGTCCAGGAAAGCCAGAAGGACCACCCCCACAAGGAGGAAACCAGTCCCAAGGTCCCCCACCTCGTCCAGGAAAGCCAGAAGGACCACCTTCACAAGGAGGCAACAAACCTCAAGGTCCCCCACCCTC	chr12.hg19:g.11420457_11420583delGAGGGTGGGGGACCTTGAGGTTTGTTGCCTCCTTGTGAAGGTGGTCCTTCTGGCTTTCCTGGACGAGGTGGGGGACCTTGGGACTGGTTTCCTCCTTGTGGGGGTGGTCCTTCTGGCTTTCCTGGAC	ENSP00000279573:p.Arg200fs	139.0	0.0		79.0	15.0	NM_006249	Q15188|Q4VAY3|Q4VAY4|Q7M4M9|Q9UCT9	Frame_Shift_Del	DEL	ENST00000279573.7	hg19																																																																																				.	.		0.618	PRB3-001	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000402119.5	NM_006249	
