#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
SPTA1	6708	hgsc.bcm.edu	37	1	158651408	158651408	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-A110-01A-11D-A12Z-10	TCGA-BC-A110-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7df1cd46-d00e-474c-9815-b41edb5ccf20	10045d1f-6bbd-4855-878e-90705d76e6f8	g.chr1:158651408G>A	ENST00000368147.4	-	4	620	c.440C>T	c.(439-441)aCc>aTc	p.T147I		NM_003126.2	NP_003117.2	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	147					actin filament capping (GO:0051693)|actin filament organization (GO:0007015)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|lymphocyte homeostasis (GO:0002260)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of protein binding (GO:0032092)|positive regulation of T cell proliferation (GO:0042102)|regulation of cell shape (GO:0008360)	actin cytoskeleton (GO:0015629)|cuticular plate (GO:0032437)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)			NS(3)|breast(7)|cervix(1)|endometrium(22)|kidney(9)|large_intestine(29)|liver(2)|lung(183)|ovary(5)|prostate(18)|skin(11)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(6)	307	all_hematologic(112;0.0378)					CTTCTCCAGGGTCAGCTCTAA	0.547																																					p.T147I		Atlas-SNP	.											.	SPTA1	720	.	0			c.C440T						.						132.0	135.0	134.0					1																	158651408		2011	4166	6177	SO:0001583	missense	6708	exon4			TCCAGGGTCAGCT	M61877	CCDS41423.1	1q21	2014-06-23	2014-06-23		ENSG00000163554	ENSG00000163554		"""EF-hand domain containing"""	11272	protein-coding gene	gene with protein product	"""elliptocytosis 2"""	182860	"""spectrin, alpha, erythrocytic 1 (elliptocytosis 2)"""				Standard	NM_003126		Approved	EL2	uc001fst.1	P02549	OTTHUMG00000019636	ENST00000368147.4:c.440C>T	chr1.hg19:g.158651408G>A	ENSP00000357129:p.Thr147Ile	281.0	0.0		224.0	16.0	NM_003126	Q15514|Q5VYL1|Q5VYL2|Q6LDY5	Missense_Mutation	SNP	ENST00000368147.4	hg19	CCDS41423.1	.	.	.	.	.	.	.	.	.	.	G	9.380	1.072843	0.20147	.	.	ENSG00000163554	ENST00000368148;ENST00000368147	T;T	0.48836	0.8;0.8	5.15	3.25	0.37280	.	.	.	.	.	T	0.24470	0.0593	M	0.65677	2.01	0.35854	D	0.826973	B	0.10296	0.003	B	0.18561	0.022	T	0.06881	-1.0802	9	0.23302	T	0.38	.	6.9641	0.24613	0.3221:0.0:0.6779:0.0	.	147	P02549	SPTA1_HUMAN	I	147	ENSP00000357130:T147I;ENSP00000357129:T147I	ENSP00000357129:T147I	T	-	2	0	SPTA1	156918032	0.999000	0.42202	0.960000	0.40013	0.347000	0.29111	3.240000	0.51368	1.401000	0.46761	0.563000	0.77884	ACC	.	.		0.547	SPTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051851.3	NM_003126	
PTPN14	5784	hgsc.bcm.edu	37	1	214557735	214557735	+	Missense_Mutation	SNP	G	G	T	rs144475962		TCGA-BC-A110-01A-11D-A12Z-10	TCGA-BC-A110-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7df1cd46-d00e-474c-9815-b41edb5ccf20	10045d1f-6bbd-4855-878e-90705d76e6f8	g.chr1:214557735G>T	ENST00000366956.5	-	13	1657	c.1463C>A	c.(1462-1464)cCg>cAg	p.P488Q	PTPN14_ENST00000543945.1_3'UTR	NM_005401.4	NP_005392.2	Q15678	PTN14_HUMAN	protein tyrosine phosphatase, non-receptor type 14	488					lymphangiogenesis (GO:0001946)|negative regulation of cell proliferation (GO:0008285)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of protein export from nucleus (GO:0046825)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	protein tyrosine phosphatase activity (GO:0004725)|receptor tyrosine kinase binding (GO:0030971)|transcription cofactor activity (GO:0003712)			NS(2)|breast(3)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(9)|liver(3)|lung(21)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	58				OV - Ovarian serous cystadenocarcinoma(81;0.00181)|all cancers(67;0.00194)|Epithelial(68;0.0157)|GBM - Glioblastoma multiforme(131;0.155)		CCGCATCTCCGGTTGGCTGTA	0.537																																					p.P488Q	Colon(92;557 1424 24372 34121 40073)	Atlas-SNP	.											PTPN14,NS,malignant_melanoma,0,1	PTPN14	168	.	0			c.C1463A						.						149.0	158.0	155.0					1																	214557735		2203	4300	6503	SO:0001583	missense	5784	exon13			ATCTCCGGTTGGC	X82676	CCDS1514.1	1q32.2	2011-06-09			ENSG00000152104	ENSG00000152104		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9647	protein-coding gene	gene with protein product		603155				7733990	Standard	NM_005401		Approved	PEZ	uc001hkk.2	Q15678	OTTHUMG00000037039	ENST00000366956.5:c.1463C>A	chr1.hg19:g.214557735G>T	ENSP00000355923:p.Pro488Gln	392.0	1.0		329.0	23.0	NM_005401	Q5VSI0	Missense_Mutation	SNP	ENST00000366956.5	hg19	CCDS1514.1	.	.	.	.	.	.	.	.	.	.	G	22.4	4.290951	0.80914	.	.	ENSG00000152104	ENST00000366956	T	0.75704	-0.96	5.49	5.49	0.81192	.	0.000000	0.85682	D	0.000000	D	0.86234	0.5884	M	0.72118	2.19	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.86783	0.1980	10	0.62326	D	0.03	.	19.3634	0.94451	0.0:0.0:1.0:0.0	.	488	Q15678	PTN14_HUMAN	Q	488	ENSP00000355923:P488Q	ENSP00000355923:P488Q	P	-	2	0	PTPN14	212624358	1.000000	0.71417	0.962000	0.40283	0.912000	0.54170	9.666000	0.98612	2.583000	0.87209	0.650000	0.86243	CCG	.	G|0.999;A|0.001		0.537	PTPN14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089918.2	NM_005401	
CCDC185	164127	hgsc.bcm.edu	37	1	223568584	223568584	+	Silent	SNP	C	C	T			TCGA-BC-A110-01A-11D-A12Z-10	TCGA-BC-A110-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7df1cd46-d00e-474c-9815-b41edb5ccf20	10045d1f-6bbd-4855-878e-90705d76e6f8	g.chr1:223568584C>T	ENST00000366875.3	+	1	1870	c.1767C>T	c.(1765-1767)ctC>ctT	p.L589L		NM_152610.2	NP_689823.2	Q8N715	CC185_HUMAN		589										breast(4)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(4)|lung(12)|skin(3)	29				GBM - Glioblastoma multiforme(131;0.0704)		TCCAGAAGCTCCCTCAGGCCT	0.557																																					p.L589L		Atlas-SNP	.											.	C1orf65	71	.	0			c.C1767T						.						65.0	64.0	64.0					1																	223568584		2203	4300	6503	SO:0001819	synonymous_variant	164127	exon1			GAAGCTCCCTCAG																												ENST00000366875.3:c.1767C>T	chr1.hg19:g.223568584C>T		138.0	0.0		115.0	9.0	NM_152610	Q8N746|Q8NA93	Silent	SNP	ENST00000366875.3	hg19	CCDS1537.1																																																																																			.	.		0.557	C1orf65-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092718.1		
OBSCN	84033	hgsc.bcm.edu	37	1	228495849	228495849	+	Silent	SNP	G	G	T	rs562134549		TCGA-BC-A110-01A-11D-A12Z-10	TCGA-BC-A110-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7df1cd46-d00e-474c-9815-b41edb5ccf20	10045d1f-6bbd-4855-878e-90705d76e6f8	g.chr1:228495849G>T	ENST00000422127.1	+	47	12548	c.12504G>T	c.(12502-12504)gcG>gcT	p.A4168A	OBSCN_ENST00000366707.4_Silent_p.A1802A|OBSCN_ENST00000284548.11_Silent_p.A4168A|OBSCN_ENST00000570156.2_Silent_p.A5125A|OBSCN_ENST00000366709.4_Silent_p.A1287A	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	4168					apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				TGGTTGATGCGGAGGTGACGG	0.602																																					p.A5125A		Atlas-SNP	.											.	OBSCN	2142	.	0			c.G15375T						.						88.0	101.0	97.0					1																	228495849		2160	4257	6417	SO:0001819	synonymous_variant	84033	exon58			TGATGCGGAGGTG	AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.12504G>T	chr1.hg19:g.228495849G>T		168.0	0.0		129.0	9.0	NM_001271223	Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Silent	SNP	ENST00000422127.1	hg19	CCDS58065.1																																																																																			.	.		0.602	OBSCN-204	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_052843	
ZNF638	27332	hgsc.bcm.edu	37	2	71658550	71658550	+	Missense_Mutation	SNP	T	T	G	rs201989581		TCGA-BC-A110-01A-11D-A12Z-10	TCGA-BC-A110-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7df1cd46-d00e-474c-9815-b41edb5ccf20	10045d1f-6bbd-4855-878e-90705d76e6f8	g.chr2:71658550T>G	ENST00000409544.1	+	26	6374	c.5744T>G	c.(5743-5745)gTc>gGc	p.V1915G	ZNF638_ENST00000264447.4_Missense_Mutation_p.V1915G|ZNF638_ENST00000355812.3_3'UTR|ZNF638_ENST00000409407.1_Missense_Mutation_p.V855G	NM_001252612.1	NP_001239541.1	Q14966	ZN638_HUMAN	zinc finger protein 638	1915					regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(16)|lung(28)|ovary(2)|pancreas(2)|prostate(1)|skin(2)|urinary_tract(1)	63						GCGTCTGATGTCCCTGAGGGT	0.443																																					p.V1915G		Atlas-SNP	.											.	ZNF638	179	.	0			c.T5744G						.						48.0	47.0	47.0					2																	71658550		2203	4300	6503	SO:0001583	missense	27332	exon26			CTGATGTCCCTGA	D83032	CCDS1917.1	2p13.1	2013-02-12	2004-07-29	2004-07-30	ENSG00000075292	ENSG00000075292		"""RNA binding motif (RRM) containing"""	17894	protein-coding gene	gene with protein product		614349	"""zinc finger, matrin-like"""	ZFML		8647861	Standard	NM_014497		Approved	NP220, MGC26130, Zfp638	uc002shy.3	Q14966	OTTHUMG00000129735	ENST00000409544.1:c.5744T>G	chr2.hg19:g.71658550T>G	ENSP00000386433:p.Val1915Gly	404.0	0.0		292.0	12.0	NM_014497	B5MDV1|B7ZLD1|Q53R34|Q5XJ05|Q68DP3|Q6P2H2|Q7Z3T7|Q8NF92|Q8TCA1|Q9H2G1|Q9NP37	Missense_Mutation	SNP	ENST00000409544.1	hg19	CCDS1917.1	.	.	.	.	.	.	.	.	.	.	T	15.04	2.714121	0.48622	.	.	ENSG00000075292	ENST00000264447;ENST00000409544;ENST00000409407	T;T;T	0.34072	1.38;1.38;1.78	4.87	2.38	0.29361	.	0.747498	0.11444	N	0.563489	T	0.34395	0.0896	L	0.29908	0.895	0.33958	D	0.645225	P;P	0.49783	0.928;0.546	P;B	0.50659	0.647;0.205	T	0.45131	-0.9282	10	0.66056	D	0.02	0.1063	7.1578	0.25647	0.0:0.189:0.0:0.811	.	1915;1915	Q14966-3;Q14966	.;ZN638_HUMAN	G	1915;1915;855	ENSP00000264447:V1915G;ENSP00000386433:V1915G;ENSP00000386813:V855G	ENSP00000264447:V1915G	V	+	2	0	ZNF638	71512058	0.550000	0.26489	0.722000	0.30670	0.991000	0.79684	0.518000	0.22847	0.390000	0.25115	0.392000	0.25879	GTC	.	T|0.999;C|0.001		0.443	ZNF638-002	NOVEL	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000327431.1	NM_014497	
NCL	4691	hgsc.bcm.edu	37	2	232325420	232325420	+	Missense_Mutation	SNP	A	A	T	rs527711138|rs371359723	byFrequency	TCGA-BC-A110-01A-11D-A12Z-10	TCGA-BC-A110-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7df1cd46-d00e-474c-9815-b41edb5ccf20	10045d1f-6bbd-4855-878e-90705d76e6f8	g.chr2:232325420A>T	ENST00000322723.4	-	4	1011	c.771T>A	c.(769-771)gaT>gaA	p.D257E	SNORD82_ENST00000365530.1_RNA	NM_005381.2	NP_005372.2	P19338	NUCL_HUMAN	nucleolin	257	Asp/Glu-rich (acidic).				angiogenesis (GO:0001525)|positive regulation of transcription of nuclear large rRNA transcript from RNA polymerase I promoter (GO:1901838)	cell cortex (GO:0005938)|cytoplasmic ribonucleoprotein granule (GO:0036464)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	identical protein binding (GO:0042802)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)|RNA binding (GO:0003723)|telomeric DNA binding (GO:0042162)			breast(3)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(8)|lung(7)|ovary(2)|pancreas(2)|prostate(2)|skin(3)	35		Ovarian(221;1.34e-05)|Renal(207;0.0112)|Lung NSC(271;0.0339)|all_lung(227;0.0616)|all_hematologic(139;0.0748)|Hepatocellular(293;0.137)|Acute lymphoblastic leukemia(138;0.167)		Epithelial(121;1.65e-111)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(119;0.014)|COAD - Colon adenocarcinoma(134;0.141)|STAD - Stomach adenocarcinoma(1183;0.18)		catcttcatcatcatcatctt	0.433																																					p.D257E		Atlas-SNP	.											.	NCL	80	.	0			c.T771A						.						231.0	195.0	207.0					2																	232325420		2203	4300	6503	SO:0001583	missense	4691	exon4			TTCATCATCATCA		CCDS33397.1	2q37.1	2013-09-19			ENSG00000115053	ENSG00000115053		"""RNA binding motif (RRM) containing"""	7667	protein-coding gene	gene with protein product		164035				2394707, 3409881	Standard	NM_005381		Approved	C23	uc002vru.3	P19338	OTTHUMG00000153866	ENST00000322723.4:c.771T>A	chr2.hg19:g.232325420A>T	ENSP00000318195:p.Asp257Glu	258.0	0.0		322.0	41.0	NM_005381	Q53SK1|Q8NB06|Q9UCF0|Q9UDG1	Missense_Mutation	SNP	ENST00000322723.4	hg19	CCDS33397.1	.	.	.	.	.	.	.	.	.	.	A	0.113	-1.136367	0.01742	.	.	ENSG00000115053	ENST00000322723;ENST00000392033	T	0.12147	2.71	4.93	-9.86	0.00473	.	1.236740	0.05337	N	0.529361	T	0.03651	0.0104	N	0.01800	-0.715	0.09310	N	0.999999	B	0.02656	0.0	B	0.01281	0.0	T	0.20974	-1.0259	10	0.02654	T	1	0.6458	10.0345	0.42120	0.1491:0.5688:0.1562:0.1259	.	257	P19338	NUCL_HUMAN	E	257;149	ENSP00000318195:D257E	ENSP00000318195:D257E	D	-	3	2	NCL	232033664	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-13.503000	0.00001	-5.449000	0.00014	-3.075000	0.00066	GAT	.	.		0.433	NCL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000332731.1	NM_005381	
NCL	4691	hgsc.bcm.edu	37	2	232325423	232325423	+	Missense_Mutation	SNP	A	A	T	rs375194579		TCGA-BC-A110-01A-11D-A12Z-10	TCGA-BC-A110-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7df1cd46-d00e-474c-9815-b41edb5ccf20	10045d1f-6bbd-4855-878e-90705d76e6f8	g.chr2:232325423A>T	ENST00000322723.4	-	4	1008	c.768T>A	c.(766-768)gaT>gaA	p.D256E	SNORD82_ENST00000365530.1_RNA	NM_005381.2	NP_005372.2	P19338	NUCL_HUMAN	nucleolin	256	Asp/Glu-rich (acidic).				angiogenesis (GO:0001525)|positive regulation of transcription of nuclear large rRNA transcript from RNA polymerase I promoter (GO:1901838)	cell cortex (GO:0005938)|cytoplasmic ribonucleoprotein granule (GO:0036464)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	identical protein binding (GO:0042802)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)|RNA binding (GO:0003723)|telomeric DNA binding (GO:0042162)			breast(3)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(8)|lung(7)|ovary(2)|pancreas(2)|prostate(2)|skin(3)	35		Ovarian(221;1.34e-05)|Renal(207;0.0112)|Lung NSC(271;0.0339)|all_lung(227;0.0616)|all_hematologic(139;0.0748)|Hepatocellular(293;0.137)|Acute lymphoblastic leukemia(138;0.167)		Epithelial(121;1.65e-111)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(119;0.014)|COAD - Colon adenocarcinoma(134;0.141)|STAD - Stomach adenocarcinoma(1183;0.18)		cttcatcatcatcatcttcat	0.433																																					p.D256E		Atlas-SNP	.											.	NCL	80	.	0			c.T768A						.						238.0	199.0	212.0					2																	232325423		2203	4300	6503	SO:0001583	missense	4691	exon4			ATCATCATCATCT		CCDS33397.1	2q37.1	2013-09-19			ENSG00000115053	ENSG00000115053		"""RNA binding motif (RRM) containing"""	7667	protein-coding gene	gene with protein product		164035				2394707, 3409881	Standard	NM_005381		Approved	C23	uc002vru.3	P19338	OTTHUMG00000153866	ENST00000322723.4:c.768T>A	chr2.hg19:g.232325423A>T	ENSP00000318195:p.Asp256Glu	473.0	0.0		384.0	36.0	NM_005381	Q53SK1|Q8NB06|Q9UCF0|Q9UDG1	Missense_Mutation	SNP	ENST00000322723.4	hg19	CCDS33397.1	.	.	.	.	.	.	.	.	.	.	A	0.085	-1.176650	0.01646	.	.	ENSG00000115053	ENST00000322723;ENST00000392033	T	0.41400	1.0	4.86	-9.72	0.00515	.	1.228550	0.05655	N	0.585809	T	0.09379	0.0231	N	0.01109	-1.01	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.05500	-1.0881	10	0.06365	T	0.9	0.1898	3.4755	0.07583	0.235:0.3943:0.2326:0.1382	.	256	P19338	NUCL_HUMAN	E	256;148	ENSP00000318195:D256E	ENSP00000318195:D256E	D	-	3	2	NCL	232033667	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-5.904000	0.00091	-3.318000	0.00188	-2.212000	0.00299	GAT	.	.		0.433	NCL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000332731.1	NM_005381	
USP40	55230	hgsc.bcm.edu	37	2	234394446	234394446	+	Silent	SNP	G	G	A	rs542793420		TCGA-BC-A110-01A-11D-A12Z-10	TCGA-BC-A110-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7df1cd46-d00e-474c-9815-b41edb5ccf20	10045d1f-6bbd-4855-878e-90705d76e6f8	g.chr2:234394446G>A	ENST00000427112.2	-	28	3407	c.3372C>T	c.(3370-3372)ccC>ccT	p.P1124P	USP40_ENST00000496298.1_5'UTR|USP40_ENST00000251722.6_Silent_p.P1124P|USP40_ENST00000450966.1_Silent_p.P1136P			Q9NVE5	UBP40_HUMAN	ubiquitin specific peptidase 40	1124					ubiquitin-dependent protein catabolic process (GO:0006511)		cysteine-type peptidase activity (GO:0008234)|ubiquitinyl hydrolase activity (GO:0036459)			breast(1)|endometrium(6)|kidney(5)|large_intestine(5)|lung(10)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	30		Breast(86;0.0013)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.0179)|Acute lymphoblastic leukemia(138;0.0326)|Lung NSC(271;0.0539)		Epithelial(121;1.71e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000407)|Lung(119;0.00277)|LUSC - Lung squamous cell carcinoma(224;0.00646)		CGAACTTTTCGGGAAAGTATT	0.512													G|||	1	0.000199681	0.0	0.0	5008	,	,		18876	0.001		0.0	False		,,,				2504	0.0				p.P1136P		Atlas-SNP	.											.	USP40	174	.	0			c.C3408T						.						24.0	27.0	26.0					2																	234394446		1875	4098	5973	SO:0001819	synonymous_variant	55230	exon28			CTTTTCGGGAAAG	AK001647	CCDS46547.1	2q37.1	2005-08-08	2005-08-08		ENSG00000085982	ENSG00000085982		"""Ubiquitin-specific peptidases"""	20069	protein-coding gene	gene with protein product		610570	"""ubiquitin specific protease 40"""			12838346	Standard	NM_018218		Approved	FLJ10785	uc010zmr.2	Q9NVE5	OTTHUMG00000153199	ENST00000427112.2:c.3372C>T	chr2.hg19:g.234394446G>A		438.0	0.0		335.0	21.0	NM_018218	Q6NX38|Q70EL0	Silent	SNP	ENST00000427112.2	hg19	CCDS46547.1	.	.	.	.	.	.	.	.	.	.	G	10.30	1.312564	0.23908	.	.	ENSG00000085982	ENST00000454354	T	0.34072	1.38	5.75	-2.8	0.05823	.	0.636347	0.17268	N	0.180514	T	0.36853	0.0982	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.33574	-0.9863	7	0.62326	D	0.03	.	4.7274	0.12948	0.4326:0.0:0.3385:0.2289	.	.	.	.	L	92	ENSP00000394133:P92L	ENSP00000394133:P92L	P	-	2	0	USP40	234059185	0.357000	0.24938	0.954000	0.39281	0.965000	0.64279	-0.372000	0.07504	-0.444000	0.07170	-1.000000	0.02509	CCG	.	.		0.512	USP40-017	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000397235.1	XM_114294	
IFT57	55081	hgsc.bcm.edu	37	3	107937444	107937444	+	Silent	SNP	T	T	C			TCGA-BC-A110-01A-11D-A12Z-10	TCGA-BC-A110-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7df1cd46-d00e-474c-9815-b41edb5ccf20	10045d1f-6bbd-4855-878e-90705d76e6f8	g.chr3:107937444T>C	ENST00000264538.3	-	3	679	c.432A>G	c.(430-432)gtA>gtG	p.V144V		NM_018010.3	NP_060480.1	Q9NWB7	IFT57_HUMAN	intraflagellar transport 57	144					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|cilium assembly (GO:0042384)|heart looping (GO:0001947)|intraciliary transport (GO:0042073)|left/right pattern formation (GO:0060972)|negative regulation of epithelial cell proliferation (GO:0050680)|neural tube closure (GO:0001843)|regulation of apoptotic process (GO:0042981)|regulation of transcription, DNA-templated (GO:0006355)|smoothened signaling pathway (GO:0007224)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cilium (GO:0005929)|dendrite terminus (GO:0044292)|Golgi apparatus (GO:0005794)|intraciliary transport particle B (GO:0030992)|photoreceptor connecting cilium (GO:0032391)	DNA binding (GO:0003677)			kidney(1)|large_intestine(2)|lung(4)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(2)	14			OV - Ovarian serous cystadenocarcinoma(3;0.0428)|Epithelial(53;0.246)			GAACATAGCATACATGTTCTC	0.338																																					p.V144V		Atlas-SNP	.											.	IFT57	44	.	0			c.A432G						.						69.0	70.0	69.0					3																	107937444		2203	4300	6503	SO:0001819	synonymous_variant	55081	exon3			ATAGCATACATGT	AK001009	CCDS2951.1	3q13.13	2014-07-03	2014-07-03	2005-11-02	ENSG00000114446	ENSG00000114446		"""Intraflagellar transport homologs"""	17367	protein-coding gene	gene with protein product		606621	"""estrogen-related receptor beta like 1"", ""intraflagellar transport 57 homolog (Chlamydomonas)"""	ESRRBL1			Standard	NM_018010		Approved	FLJ10147, HIPPI, MHS4R2	uc003dwx.4	Q9NWB7	OTTHUMG00000159223	ENST00000264538.3:c.432A>G	chr3.hg19:g.107937444T>C		393.0	0.0		307.0	13.0	NM_018010	Q96DA9	Silent	SNP	ENST00000264538.3	hg19	CCDS2951.1																																																																																			.	.		0.338	IFT57-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353918.1	NM_018010	
ARHGAP10	79658	hgsc.bcm.edu	37	4	148886196	148886196	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-A110-01A-11D-A12Z-10	TCGA-BC-A110-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7df1cd46-d00e-474c-9815-b41edb5ccf20	10045d1f-6bbd-4855-878e-90705d76e6f8	g.chr4:148886196G>A	ENST00000336498.3	+	17	1711	c.1472G>A	c.(1471-1473)cGt>cAt	p.R491H	ARHGAP10_ENST00000414545.2_Missense_Mutation_p.R140H	NM_024605.3	NP_078881.3	Q5T5U3	RHG21_HUMAN	Rho GTPase activating protein 10	1254					establishment of Golgi localization (GO:0051683)|Golgi organization (GO:0007030)|maintenance of Golgi location (GO:0051684)|organelle transport along microtubule (GO:0072384)|signal transduction (GO:0007165)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)			autonomic_ganglia(2)|endometrium(5)|kidney(2)|large_intestine(4)|liver(2)|lung(13)|ovary(1)|pancreas(1)|prostate(1)|skin(2)	33	all_hematologic(180;0.151)	Renal(17;0.0166)		GBM - Glioblastoma multiforme(119;0.0423)		CCAGAATCTCGTGTTAATGCG	0.308																																					p.R491H		Atlas-SNP	.											.	ARHGAP10	92	.	0			c.G1472A						.						78.0	76.0	77.0					4																	148886196		2203	4300	6503	SO:0001583	missense	79658	exon17			AATCTCGTGTTAA	BC047914	CCDS34075.1	4q31.23	2013-09-20			ENSG00000071205	ENSG00000071205		"""Rho GTPase activating proteins"""	26099	protein-coding gene	gene with protein product		609746				8288572	Standard	NM_024605		Approved	FLJ20896, FLJ41791, GRAF2	uc003ilf.3	A1A4S6	OTTHUMG00000161460	ENST00000336498.3:c.1472G>A	chr4.hg19:g.148886196G>A	ENSP00000336923:p.Arg491His	561.0	0.0		466.0	23.0	NM_024605	Q0VF98|Q7Z3P7|Q8N3A2|Q8NI19|Q8TBV5|Q9P2C3	Missense_Mutation	SNP	ENST00000336498.3	hg19	CCDS34075.1	.	.	.	.	.	.	.	.	.	.	G	18.49	3.634973	0.67130	.	.	ENSG00000071205	ENST00000336498;ENST00000414545	T;T	0.22743	1.94;1.94	5.55	5.55	0.83447	Rho GTPase-activating protein domain (4);Rho GTPase activation protein (1);	0.000000	0.85682	D	0.000000	T	0.64907	0.2641	H	0.97465	4.01	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.991;0.996	T	0.78548	-0.2162	10	0.87932	D	0	.	19.5156	0.95162	0.0:0.0:1.0:0.0	.	72;140;491	Q86T21;E7EUW5;A1A4S6	.;.;RHG10_HUMAN	H	491;140	ENSP00000336923:R491H;ENSP00000406624:R140H	ENSP00000336923:R491H	R	+	2	0	ARHGAP10	149105646	1.000000	0.71417	0.961000	0.40146	0.122000	0.20287	9.059000	0.93902	2.611000	0.88343	0.561000	0.74099	CGT	.	.		0.308	ARHGAP10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365005.1	NM_024605	
SGTB	54557	hgsc.bcm.edu	37	5	64976616	64976616	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-A110-01A-11D-A12Z-10	TCGA-BC-A110-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7df1cd46-d00e-474c-9815-b41edb5ccf20	10045d1f-6bbd-4855-878e-90705d76e6f8	g.chr5:64976616G>A	ENST00000381007.4	-	7	720	c.485C>T	c.(484-486)gCc>gTc	p.A162V		NM_019072.2	NP_061945.1	Q96EQ0	SGTB_HUMAN	small glutamine-rich tetratricopeptide repeat (TPR)-containing, beta	162										large_intestine(3)|lung(3)|skin(3)	9		Lung NSC(167;3.24e-06)|Prostate(74;0.0138)|Ovarian(174;0.0545)|Breast(144;0.174)|Colorectal(97;0.234)		UCEC - Uterine corpus endometrioid carcinoma (4;0.0657)|Lung(70;0.00487)		GGCAGTGAGGGCCAGCCTGAA	0.353																																					p.A162V		Atlas-SNP	.											.	SGTB	22	.	0			c.C485T						.						71.0	69.0	70.0					5																	64976616		2203	4300	6503	SO:0001583	missense	54557	exon7			GTGAGGGCCAGCC	AK096321	CCDS3988.1	5q12.3	2013-01-10			ENSG00000197860	ENSG00000197860		"""Tetratricopeptide (TTC) repeat domain containing"""	23567	protein-coding gene	gene with protein product						12477932	Standard	XM_005248548		Approved	Sgt2, FLJ39002	uc003jud.3	Q96EQ0	OTTHUMG00000097801	ENST00000381007.4:c.485C>T	chr5.hg19:g.64976616G>A	ENSP00000370395:p.Ala162Val	182.0	0.0		136.0	9.0	NM_019072		Missense_Mutation	SNP	ENST00000381007.4	hg19	CCDS3988.1	.	.	.	.	.	.	.	.	.	.	G	34	5.356958	0.95854	.	.	ENSG00000197860	ENST00000381007;ENST00000506816	T;T	0.67171	-0.25;-0.25	5.31	5.31	0.75309	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.114435	0.64402	D	0.000014	D	0.82504	0.5051	M	0.78456	2.415	0.80722	D	1	D	0.89917	1.0	D	0.73380	0.98	D	0.83842	0.0258	10	0.56958	D	0.05	-26.1574	18.9824	0.92760	0.0:0.0:1.0:0.0	.	162	Q96EQ0	SGTB_HUMAN	V	162	ENSP00000370395:A162V;ENSP00000421447:A162V	ENSP00000370395:A162V	A	-	2	0	SGTB	65012372	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.444000	0.97578	2.496000	0.84212	0.557000	0.71058	GCC	.	.		0.353	SGTB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215057.2	NM_019072	
C6orf106	64771	hgsc.bcm.edu	37	6	34574641	34574641	+	Silent	SNP	A	A	C			TCGA-BC-A110-01A-11D-A12Z-10	TCGA-BC-A110-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7df1cd46-d00e-474c-9815-b41edb5ccf20	10045d1f-6bbd-4855-878e-90705d76e6f8	g.chr6:34574641A>C	ENST00000374023.3	-	4	795	c.552T>G	c.(550-552)ctT>ctG	p.L184L	C6orf106_ENST00000374026.3_Silent_p.L118L|C6orf106_ENST00000374021.1_Silent_p.L110L	NM_024294.2	NP_077270.1	Q9H6K1	CF106_HUMAN	chromosome 6 open reading frame 106	184										endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)|skin(2)	10						TTACTCCTAAAAGTCCACCCA	0.468																																					p.L184L		Atlas-SNP	.											.	C6orf106	29	.	0			c.T552G						.						73.0	65.0	68.0					6																	34574641		2203	4300	6503	SO:0001819	synonymous_variant	64771	exon4			TCCTAAAAGTCCA	AF052106	CCDS4795.1, CCDS4796.1	6p21.31	2012-01-27			ENSG00000196821	ENSG00000196821			21215	protein-coding gene	gene with protein product		612217					Standard	XM_005249298		Approved	FLJ22195, dJ391O22.4	uc003ojr.2	Q9H6K1	OTTHUMG00000014553	ENST00000374023.3:c.552T>G	chr6.hg19:g.34574641A>C		91.0	0.0		67.0	8.0	NM_024294	B2R8K7|Q5VV77|Q96MG5|Q9BUR9	Silent	SNP	ENST00000374023.3	hg19	CCDS4796.1																																																																																			.	.		0.468	C6orf106-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040251.1	NM_022758	
GJB7	375519	hgsc.bcm.edu	37	6	87994213	87994213	+	Missense_Mutation	SNP	C	C	T	rs568580095|rs373942790	byFrequency	TCGA-BC-A110-01A-11D-A12Z-10	TCGA-BC-A110-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7df1cd46-d00e-474c-9815-b41edb5ccf20	10045d1f-6bbd-4855-878e-90705d76e6f8	g.chr6:87994213C>T	ENST00000525899.1	-	3	763	c.418G>A	c.(418-420)Gtt>Att	p.V140I	GJB7_ENST00000296882.3_Missense_Mutation_p.V140I	NM_198568.2	NP_940970.1	Q6PEY0	CXB7_HUMAN	gap junction protein, beta 7, 25kDa	140					cell communication (GO:0007154)	connexon complex (GO:0005922)|integral component of membrane (GO:0016021)				endometrium(2)|large_intestine(3)	5		all_cancers(76;1.93e-06)|Acute lymphoblastic leukemia(125;3.55e-10)|Prostate(29;7.38e-10)|all_hematologic(105;3.29e-06)|all_epithelial(107;0.00323)		BRCA - Breast invasive adenocarcinoma(108;0.0167)		TAAAATAAAACAAGGAAGCCA	0.403																																					p.V140I		Atlas-SNP	.											.	GJB7	28	.	0			c.G418A						.																																			SO:0001583	missense	375519	exon3			ATAAAACAAGGAA	AJ414563	CCDS5008.1	6q15	2008-02-05	2007-11-06			ENSG00000164411		"""Ion channels / Gap junction proteins (connexins)"""	16690	protein-coding gene	gene with protein product	"""connexin 25"""	611921	"""gap junction protein, beta 7"""				Standard	NM_198568		Approved	CX25, bA136M9.1	uc003plo.2	Q6PEY0		ENST00000525899.1:c.418G>A	chr6.hg19:g.87994213C>T	ENSP00000435355:p.Val140Ile	99.0	0.0		79.0	16.0	NM_198568	B3KXL0|Q96KP0	Missense_Mutation	SNP	ENST00000525899.1	hg19	CCDS5008.1	.	.	.	.	.	.	.	.	.	.	C	3.485	-0.105081	0.06967	.	.	ENSG00000164411	ENST00000525899;ENST00000296882;ENST00000369576	D;D;D	0.95788	-3.81;-3.81;-3.81	4.98	1.07	0.20283	Gap junction protein, cysteine-rich domain (1);	0.205176	0.31199	U	0.008077	D	0.83133	0.5188	L	0.41124	1.26	0.09310	N	1	B	0.20368	0.044	B	0.25987	0.065	T	0.74025	-0.3797	10	0.22706	T	0.39	.	5.8059	0.18440	0.1334:0.6349:0.0:0.2317	.	140	Q6PEY0	CXB7_HUMAN	I	140	ENSP00000435355:V140I;ENSP00000296882:V140I;ENSP00000358589:V140I	ENSP00000296882:V140I	V	-	1	0	GJB7	88050932	0.009000	0.17119	0.983000	0.44433	0.056000	0.15407	0.695000	0.25527	0.145000	0.18977	-0.314000	0.08810	GTT	.	.		0.403	GJB7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394780.1		
GUSB	2990	hgsc.bcm.edu	37	7	65440043	65440043	+	Nonsense_Mutation	SNP	G	G	A			TCGA-BC-A110-01A-11D-A12Z-10	TCGA-BC-A110-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7df1cd46-d00e-474c-9815-b41edb5ccf20	10045d1f-6bbd-4855-878e-90705d76e6f8	g.chr7:65440043G>A	ENST00000304895.4	-	6	1058	c.928C>T	c.(928-930)Cag>Tag	p.Q310*	GUSB_ENST00000421103.1_Nonsense_Mutation_p.Q164*|GUSB_ENST00000345660.6_Intron|GUSB_ENST00000476486.1_5'UTR	NM_000181.3	NP_000172.2	P08236	BGLR_HUMAN	glucuronidase, beta	310					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|hyaluronan catabolic process (GO:0030214)|hyaluronan metabolic process (GO:0030212)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)	beta-glucuronidase activity (GO:0004566)			breast(1)|cervix(2)|kidney(2)|large_intestine(4)|lung(10)|skin(1)	20						AGTGACGTCTGTGCAGTCAGC	0.607																																					p.Q310X		Atlas-SNP	.											.	GUSB	52	.	0			c.C928T						.						70.0	64.0	66.0					7																	65440043		2203	4300	6503	SO:0001587	stop_gained	2990	exon6			ACGTCTGTGCAGT	M15182	CCDS5530.1, CCDS64665.1	7q11.21	2012-10-02			ENSG00000169919	ENSG00000169919	3.2.1.31		4696	protein-coding gene	gene with protein product		611499				3468507	Standard	NM_000181		Approved		uc003tun.3	P08236	OTTHUMG00000023735	ENST00000304895.4:c.928C>T	chr7.hg19:g.65440043G>A	ENSP00000302728:p.Gln310*	80.0	0.0		68.0	9.0	NM_000181	B4E1F6|E9PCV0|Q549U0|Q96CL9	Nonsense_Mutation	SNP	ENST00000304895.4	hg19	CCDS5530.1	.	.	.	.	.	.	.	.	.	.	G	23.1	4.376815	0.82682	.	.	ENSG00000169919	ENST00000304895;ENST00000421103	.	.	.	4.99	1.04	0.20106	.	0.888310	0.09996	N	0.729024	.	.	.	.	.	.	0.38947	D	0.958264	.	.	.	.	.	.	.	.	.	.	0.07030	T	0.85	.	9.8986	0.41334	0.0:0.3697:0.3767:0.2536	.	.	.	.	X	310;164	.	ENSP00000302728:Q310X	Q	-	1	0	GUSB	65077478	0.937000	0.31787	0.003000	0.11579	0.219000	0.24729	1.931000	0.40134	0.005000	0.14708	0.511000	0.50034	CAG	.	.		0.607	GUSB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251637.3	NM_000181	
LRRCC1	85444	hgsc.bcm.edu	37	8	86057622	86057622	+	Splice_Site	SNP	A	A	T			TCGA-BC-A110-01A-11D-A12Z-10	TCGA-BC-A110-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7df1cd46-d00e-474c-9815-b41edb5ccf20	10045d1f-6bbd-4855-878e-90705d76e6f8	g.chr8:86057622A>T	ENST00000360375.3	+	19	3125		c.e19-1		LRRCC1_ENST00000414626.2_Splice_Site	NM_033402.4	NP_208325.3	Q9C099	LRCC1_HUMAN	leucine rich repeat and coiled-coil centrosomal protein 1						mitotic nuclear division (GO:0007067)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.?(2)		breast(3)|central_nervous_system(1)|endometrium(4)|kidney(9)|large_intestine(7)|lung(16)|skin(1)|upper_aerodigestive_tract(2)	43						ATGTCGATTTAGGTCCATCAA	0.264																																					.		Atlas-SNP	.											LRRCC1_ENST00000414626,NS,carcinoma,0,2	LRRCC1	212	.	2	Unknown(2)	lung(2)	c.2977-2A>T						.						37.0	34.0	35.0					8																	86057622		1785	4056	5841	SO:0001630	splice_region_variant	85444	exon19			CGATTTAGGTCCA	BC030701	CCDS43750.1	8q21.2	2012-04-10	2012-04-10		ENSG00000133739	ENSG00000133739			29373	protein-coding gene	gene with protein product	"""centrosomal leucine-rich repeat and coiled-coil containing protein"", ""variable number of flagella 1 homolog (Chlamydomonas)"""		"""leucine rich repeat and coiled-coil domain containing 1"""			11214970, 18728398	Standard	NM_033402		Approved	KIAA1764, CLERC, VFL1	uc003ycw.3	Q9C099	OTTHUMG00000164784	ENST00000360375.3:c.2977-1A>T	chr8.hg19:g.86057622A>T		463.0	2.0		438.0	27.0	NM_033402	B4DYX6|B5RI11|Q8N768|Q96DK7|Q96N01	Splice_Site	SNP	ENST00000360375.3	hg19	CCDS43750.1	.	.	.	.	.	.	.	.	.	.	A	10.56	1.384971	0.25031	.	.	ENSG00000133739	ENST00000360375;ENST00000414626	.	.	.	5.06	5.06	0.68205	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.9715	0.71238	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	LRRCC1	86244874	1.000000	0.71417	0.972000	0.41901	0.023000	0.10783	7.483000	0.81158	2.112000	0.64535	0.459000	0.35465	.	.	.		0.264	LRRCC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380267.1	NM_033402	Intron
CTHRC1	115908	hgsc.bcm.edu	37	8	104388131	104388131	+	Missense_Mutation	SNP	T	T	A			TCGA-BC-A110-01A-11D-A12Z-10	TCGA-BC-A110-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7df1cd46-d00e-474c-9815-b41edb5ccf20	10045d1f-6bbd-4855-878e-90705d76e6f8	g.chr8:104388131T>A	ENST00000330295.5	+	2	458	c.316T>A	c.(316-318)Tac>Aac	p.Y106N	CTHRC1_ENST00000520880.1_5'Flank|CTHRC1_ENST00000520337.1_Missense_Mutation_p.Y92N|CTHRC1_ENST00000415886.2_Missense_Mutation_p.Y106N	NM_138455.3	NP_612464.1	Q96CG8	CTHR1_HUMAN	collagen triple helix repeat containing 1	106					cell migration (GO:0016477)|cochlea morphogenesis (GO:0090103)|establishment of planar polarity involved in neural tube closure (GO:0090177)|inner ear receptor stereocilium organization (GO:0060122)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|ossification involved in bone remodeling (GO:0043932)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of osteoblast proliferation (GO:0033690)|positive regulation of protein binding (GO:0032092)|Wnt signaling pathway, planar cell polarity pathway (GO:0060071)	collagen trimer (GO:0005581)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)				endometrium(1)|large_intestine(5)|lung(4)|ovary(1)|urinary_tract(1)	12			OV - Ovarian serous cystadenocarcinoma(57;2.79e-06)|STAD - Stomach adenocarcinoma(118;0.197)			GACACCCAACTACAAGCAGTG	0.433																																					p.Y106N		Atlas-SNP	.											.	CTHRC1	29	.	0			c.T316A						.						65.0	62.0	63.0					8																	104388131		2203	4300	6503	SO:0001583	missense	115908	exon2			CCCAACTACAAGC	BC014245	CCDS6299.1, CCDS59110.1	8q22.3	2008-08-07			ENSG00000164932	ENSG00000164932			18831	protein-coding gene	gene with protein product		610635				15618538	Standard	NM_138455		Approved		uc003ylk.4	Q96CG8	OTTHUMG00000164887	ENST00000330295.5:c.316T>A	chr8.hg19:g.104388131T>A	ENSP00000330523:p.Tyr106Asn	147.0	0.0		143.0	8.0	NM_138455	G3V141|Q6UW91|Q8IX63	Missense_Mutation	SNP	ENST00000330295.5	hg19	CCDS6299.1	.	.	.	.	.	.	.	.	.	.	T	18.88	3.717135	0.68844	.	.	ENSG00000164932	ENST00000330295;ENST00000415886;ENST00000520337;ENST00000297577	T;D;T	0.97066	-0.09;-4.23;0.93	5.69	5.69	0.88448	.	0.113131	0.64402	D	0.000007	D	0.96996	0.9019	L	0.36672	1.1	0.80722	D	1	D;P	0.76494	0.999;0.734	P;B	0.62014	0.897;0.133	D	0.97670	1.0166	10	0.59425	D	0.04	-13.2529	15.9482	0.79809	0.0:0.0:0.0:1.0	.	106;106	E7EVQ5;Q96CG8	.;CTHR1_HUMAN	N	106;106;92;92	ENSP00000330523:Y106N;ENSP00000416045:Y106N;ENSP00000430550:Y92N	ENSP00000297577:Y92N	Y	+	1	0	CTHRC1	104457307	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.698000	0.84413	2.166000	0.68216	0.477000	0.44152	TAC	.	.		0.433	CTHRC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380792.1	NM_138455	
ABRA	137735	hgsc.bcm.edu	37	8	107782232	107782232	+	Missense_Mutation	SNP	G	G	C			TCGA-BC-A110-01A-11D-A12Z-10	TCGA-BC-A110-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7df1cd46-d00e-474c-9815-b41edb5ccf20	10045d1f-6bbd-4855-878e-90705d76e6f8	g.chr8:107782232G>C	ENST00000311955.3	-	1	241	c.187C>G	c.(187-189)Cct>Gct	p.P63A		NM_139166.4	NP_631905.1			actin-binding Rho activating protein									p.P63T(1)		breast(1)|kidney(4)|large_intestine(7)|lung(11)|ovary(2)|prostate(2)	27			OV - Ovarian serous cystadenocarcinoma(57;3.83e-09)			ATTGGTTTAGGAGCTTGAGGT	0.607																																					p.P63A		Atlas-SNP	.											ABRA,NS,carcinoma,0,1	ABRA	57	.	1	Substitution - Missense(1)	ovary(1)	c.C187G						.						89.0	90.0	90.0					8																	107782232		2203	4300	6503	SO:0001583	missense	137735	exon1			GTTTAGGAGCTTG	AF503617	CCDS6305.1	8q23.1	2012-02-06			ENSG00000174429	ENSG00000174429			30655	protein-coding gene	gene with protein product	"""striated muscle activator of Rho-dependent signaling"""	609747				11983702	Standard	NM_139166		Approved	STARS	uc003ymm.4	Q8N0Z2	OTTHUMG00000164809	ENST00000311955.3:c.187C>G	chr8.hg19:g.107782232G>C	ENSP00000311436:p.Pro63Ala	573.0	0.0		354.0	32.0	NM_139166		Missense_Mutation	SNP	ENST00000311955.3	hg19	CCDS6305.1	.	.	.	.	.	.	.	.	.	.	G	1.608	-0.524884	0.04141	.	.	ENSG00000174429	ENST00000311955	D	0.92446	-3.04	5.66	0.368	0.16146	.	0.804396	0.11835	N	0.524850	D	0.85124	0.5625	L	0.50333	1.59	0.09310	N	1	B	0.27068	0.167	B	0.24269	0.052	T	0.71269	-0.4643	10	0.31617	T	0.26	0.172	0.8137	0.01098	0.3794:0.1161:0.2683:0.2362	.	63	Q8N0Z2	ABRA_HUMAN	A	63	ENSP00000311436:P63A	ENSP00000311436:P63A	P	-	1	0	ABRA	107851408	0.000000	0.05858	0.008000	0.14137	0.330000	0.28571	0.103000	0.15292	0.030000	0.15379	-0.150000	0.13652	CCT	.	.		0.607	ABRA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380416.1	NM_139166	
OLFML2A	169611	hgsc.bcm.edu	37	9	127561615	127561615	+	Missense_Mutation	SNP	C	C	A	rs533587628	byFrequency	TCGA-BC-A110-01A-11D-A12Z-10	TCGA-BC-A110-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7df1cd46-d00e-474c-9815-b41edb5ccf20	10045d1f-6bbd-4855-878e-90705d76e6f8	g.chr9:127561615C>A	ENST00000373580.3	+	4	514	c.514C>A	c.(514-516)Cgc>Agc	p.R172S	OLFML2A_ENST00000288815.5_5'Flank	NM_182487.2	NP_872293.2	Q68BL7	OLM2A_HUMAN	olfactomedin-like 2A	172					extracellular matrix organization (GO:0030198)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)	extracellular matrix binding (GO:0050840)			endometrium(5)|kidney(1)|large_intestine(8)|lung(8)|ovary(2)|upper_aerodigestive_tract(1)	25						GGACAGCGTGCGCCACCTCAG	0.597																																					p.R172S		Atlas-SNP	.											.	OLFML2A	61	.	0			c.C514A						.						45.0	51.0	49.0					9																	127561615		2157	4275	6432	SO:0001583	missense	169611	exon4			AGCGTGCGCCACC	AK092255	CCDS6857.2, CCDS65129.1	9q34.11	2008-02-05			ENSG00000185585	ENSG00000185585			27270	protein-coding gene	gene with protein product		615899				12477932	Standard	NM_001282715		Approved	FLJ00237	uc004bov.3	Q68BL7	OTTHUMG00000020663	ENST00000373580.3:c.514C>A	chr9.hg19:g.127561615C>A	ENSP00000362682:p.Arg172Ser	159.0	0.0		125.0	10.0	NM_182487	Q5JTM5|Q5JTM6|Q6UXW1|Q7Z5V3	Missense_Mutation	SNP	ENST00000373580.3	hg19	CCDS6857.2	.	.	.	.	.	.	.	.	.	.	C	12.18	1.861208	0.32884	.	.	ENSG00000185585	ENST00000331715;ENST00000425732;ENST00000373580	T;T	0.44083	0.93;0.93	5.67	3.76	0.43208	.	0.489979	0.22803	N	0.055449	T	0.31009	0.0783	L	0.44542	1.39	0.80722	D	1	P;B	0.36392	0.551;0.395	B;B	0.34489	0.184;0.062	T	0.03202	-1.1061	10	0.19147	T	0.46	.	10.8651	0.46851	0.1204:0.661:0.2186:0.0	.	136;172	Q5JTM7;Q68BL7	.;OLM2A_HUMAN	S	136;136;172	ENSP00000336425:R136S;ENSP00000362682:R172S	ENSP00000336425:R136S	R	+	1	0	OLFML2A	126601436	0.683000	0.27633	1.000000	0.80357	0.691000	0.40173	1.032000	0.30178	2.681000	0.91329	0.655000	0.94253	CGC	.	.		0.597	OLFML2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054046.2	NM_182487	
HIF1A	3091	hgsc.bcm.edu	37	14	62207716	62207716	+	Missense_Mutation	SNP	A	A	T			TCGA-BC-A110-01A-11D-A12Z-10	TCGA-BC-A110-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7df1cd46-d00e-474c-9815-b41edb5ccf20	10045d1f-6bbd-4855-878e-90705d76e6f8	g.chr14:62207716A>T	ENST00000337138.4	+	12	2168	c.1903A>T	c.(1903-1905)Att>Ttt	p.I635F	HIF1A_ENST00000323441.6_Missense_Mutation_p.I635F|RP11-618G20.1_ENST00000555937.1_RNA|HIF1A_ENST00000557538.1_Missense_Mutation_p.I576F|HIF1A_ENST00000394997.1_Missense_Mutation_p.I636F|HIF1A_ENST00000539097.1_Missense_Mutation_p.I659F|HIF1A-AS2_ENST00000554254.1_lincRNA	NM_001530.3	NP_001521.1	Q16665	HIF1A_HUMAN	hypoxia inducible factor 1, alpha subunit (basic helix-loop-helix transcription factor)	635	ID.				angiogenesis (GO:0001525)|axon transport of mitochondrion (GO:0019896)|B-1 B cell homeostasis (GO:0001922)|cardiac ventricle morphogenesis (GO:0003208)|cartilage development (GO:0051216)|cellular iron ion homeostasis (GO:0006879)|cellular response to hypoxia (GO:0071456)|cellular response to interleukin-1 (GO:0071347)|cerebral cortex development (GO:0021987)|collagen metabolic process (GO:0032963)|connective tissue replacement involved in inflammatory response wound healing (GO:0002248)|digestive tract morphogenesis (GO:0048546)|dopaminergic neuron differentiation (GO:0071542)|elastin metabolic process (GO:0051541)|embryonic hemopoiesis (GO:0035162)|embryonic placenta development (GO:0001892)|epithelial cell differentiation involved in mammary gland alveolus development (GO:0061030)|epithelial to mesenchymal transition (GO:0001837)|glucose homeostasis (GO:0042593)|heart looping (GO:0001947)|hemoglobin biosynthetic process (GO:0042541)|intestinal epithelial cell maturation (GO:0060574)|lactate metabolic process (GO:0006089)|lactation (GO:0007595)|mRNA transcription from RNA polymerase II promoter (GO:0042789)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of bone mineralization (GO:0030502)|negative regulation of growth (GO:0045926)|negative regulation of mesenchymal cell apoptotic process (GO:2001054)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of oxidative stress-induced neuron intrinsic apoptotic signaling pathway (GO:1903377)|negative regulation of thymocyte apoptotic process (GO:0070244)|negative regulation of TOR signaling (GO:0032007)|neural crest cell migration (GO:0001755)|neural fold elevation formation (GO:0021502)|Notch signaling pathway (GO:0007219)|outflow tract morphogenesis (GO:0003151)|oxygen homeostasis (GO:0032364)|positive regulation of angiogenesis (GO:0045766)|positive regulation of chemokine production (GO:0032722)|positive regulation of chemokine-mediated signaling pathway (GO:0070101)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of glycolytic process (GO:0045821)|positive regulation of hormone biosynthetic process (GO:0046886)|positive regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0035774)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of receptor biosynthetic process (GO:0010870)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061419)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of gene expression (GO:0010468)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription from RNA polymerase II promoter in response to oxidative stress (GO:0043619)|regulation of transcription, DNA-templated (GO:0006355)|regulation of transforming growth factor beta2 production (GO:0032909)|response to hypoxia (GO:0001666)|response to muscle activity (GO:0014850)|retina vasculature development in camera-type eye (GO:0061298)|signal transduction (GO:0007165)|vascular endothelial growth factor production (GO:0010573)|visual learning (GO:0008542)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|motile cilium (GO:0031514)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|Hsp90 protein binding (GO:0051879)|nuclear hormone receptor binding (GO:0035257)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II transcription factor binding transcription factor activity (GO:0001076)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|transcription factor binding (GO:0008134)|transcription factor binding transcription factor activity (GO:0000989)|ubiquitin protein ligase binding (GO:0031625)			breast(2)|endometrium(8)|kidney(6)|large_intestine(3)|lung(4)	23				OV - Ovarian serous cystadenocarcinoma(108;1.62e-09)|BRCA - Breast invasive adenocarcinoma(234;0.189)	Carvedilol(DB01136)	TATGGAAGACATTAAAATATT	0.408																																					p.I659F		Atlas-SNP	.											.	HIF1A	120	.	0			c.A1975T						.						108.0	100.0	103.0					14																	62207716		2203	4300	6503	SO:0001583	missense	3091	exon12			GAAGACATTAAAA	U22431	CCDS9753.1, CCDS9754.1, CCDS58324.1	14q23.2	2013-05-21	2008-12-02		ENSG00000100644	ENSG00000100644		"""Basic helix-loop-helix proteins"""	4910	protein-coding gene	gene with protein product		603348				8786149, 9079689	Standard	NM_001530		Approved	MOP1, HIF-1alpha, PASD8, HIF1, bHLHe78	uc001xfq.2	Q16665	OTTHUMG00000140344	ENST00000337138.4:c.1903A>T	chr14.hg19:g.62207716A>T	ENSP00000338018:p.Ile635Phe	235.0	0.0		159.0	9.0	NM_001243084	C0LZJ3|Q53XP6|Q96PT9|Q9UPB1	Missense_Mutation	SNP	ENST00000337138.4	hg19	CCDS9753.1	.	.	.	.	.	.	.	.	.	.	A	8.810	0.935036	0.18206	.	.	ENSG00000100644	ENST00000539494;ENST00000394988;ENST00000337138;ENST00000394997;ENST00000323441;ENST00000557538;ENST00000539097	T;T;T;T;T	0.52754	0.65;0.65;0.65;0.65;0.65	5.72	2.13	0.27403	.	3.176880	0.00628	N	0.000473	T	0.30916	0.0780	N	0.19112	0.55	0.30200	N	0.798702	B;B;B	0.26809	0.16;0.16;0.16	B;B;B	0.26693	0.072;0.072;0.072	T	0.21381	-1.0247	10	0.15952	T	0.53	.	2.0923	0.03660	0.4959:0.1201:0.2679:0.1161	.	636;635;635	A8MYV6;D0VY79;Q16665	.;.;HIF1A_HUMAN	F	386;576;635;636;635;576;659	ENSP00000338018:I635F;ENSP00000378446:I636F;ENSP00000323326:I635F;ENSP00000451696:I576F;ENSP00000437955:I659F	ENSP00000323326:I635F	I	+	1	0	HIF1A	61277469	0.902000	0.30710	0.996000	0.52242	0.898000	0.52572	0.814000	0.27239	0.187000	0.20147	-0.256000	0.11100	ATT	.	.		0.408	HIF1A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000276977.2	NM_001530	
AHNAK2	113146	hgsc.bcm.edu	37	14	105419292	105419292	+	Missense_Mutation	SNP	C	C	A			TCGA-BC-A110-01A-11D-A12Z-10	TCGA-BC-A110-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7df1cd46-d00e-474c-9815-b41edb5ccf20	10045d1f-6bbd-4855-878e-90705d76e6f8	g.chr14:105419292C>A	ENST00000333244.5	-	7	2615	c.2496G>T	c.(2494-2496)aaG>aaT	p.K832N	AHNAK2_ENST00000557457.1_Intron	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	832						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)				cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			GCATTTTGAACTTGCTGTCTT	0.622																																					p.K832N		Atlas-SNP	.											.	AHNAK2	719	.	0			c.G2496T						.						236.0	259.0	252.0					14																	105419292		1956	4145	6101	SO:0001583	missense	113146	exon7			TTTGAACTTGCTG	AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.2496G>T	chr14.hg19:g.105419292C>A	ENSP00000353114:p.Lys832Asn	323.0	0.0		228.0	13.0	NM_138420	Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Missense_Mutation	SNP	ENST00000333244.5	hg19	CCDS45177.1	.	.	.	.	.	.	.	.	.	.	c	8.580	0.882016	0.17467	.	.	ENSG00000185567	ENST00000333244	T	0.01871	4.59	4.02	2.13	0.27403	.	.	.	.	.	T	0.11367	0.0277	M	0.87328	2.875	0.21184	N	0.999764	D	0.76494	0.999	D	0.81914	0.995	T	0.16512	-1.0400	9	0.20519	T	0.43	.	9.0866	0.36586	0.0:0.7193:0.0:0.2807	.	832	Q8IVF2	AHNK2_HUMAN	N	832	ENSP00000353114:K832N	ENSP00000353114:K832N	K	-	3	2	AHNAK2	104490337	0.000000	0.05858	0.558000	0.28319	0.017000	0.09413	-0.608000	0.05641	0.187000	0.20147	-1.579000	0.00862	AAG	.	.		0.622	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410300.1	NM_138420	
URI1	8725	hgsc.bcm.edu	37	19	30476164	30476164	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-A110-01A-11D-A12Z-10	TCGA-BC-A110-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7df1cd46-d00e-474c-9815-b41edb5ccf20	10045d1f-6bbd-4855-878e-90705d76e6f8	g.chr19:30476164G>A	ENST00000542441.2	+	3	484	c.187G>A	c.(187-189)Gaa>Aaa	p.E63K	URI1_ENST00000392271.1_5'UTR|URI1_ENST00000312051.6_Missense_Mutation_p.E23K|URI1_ENST00000360605.4_Missense_Mutation_p.E45K			O94763	RMP_HUMAN	URI1, prefoldin-like chaperone	63					cellular response to growth factor stimulus (GO:0071363)|cellular response to steroid hormone stimulus (GO:0071383)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|negative regulation of phosphatase activity (GO:0010923)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|protein folding (GO:0006457)|regulation of cell growth (GO:0001558)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to virus (GO:0009615)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|DNA-directed RNA polymerase II, core complex (GO:0005665)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|prefoldin complex (GO:0016272)	chromatin binding (GO:0003682)|protein phosphatase inhibitor activity (GO:0004864)|RNA polymerase II transcription corepressor activity (GO:0001106)										TGCCCTTCGAGAAAGACTCAG	0.279																																					p.E63K		Atlas-SNP	.											.	.	.	.	0			c.G187A						.						188.0	196.0	193.0					19																	30476164		2203	4300	6503	SO:0001583	missense	8725	exon3			CTTCGAGAAAGAC	AF091095	CCDS12420.1, CCDS58658.1	19q12	2012-04-17	2011-11-21	2011-11-21	ENSG00000105176	ENSG00000105176		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	13236	protein-coding gene	gene with protein product	"""unconventional prefoldin RPB5 interactor"", ""RPB5-mediating protein"", ""protein phosphatase 1, regulatory subunit 19"""	603494	"""chromosome 19 open reading frame 2"""	C19orf2		9878255, 9819440	Standard	NM_003796		Approved	RMP, NNX3, FLJ10575, URI, PPP1R19	uc002nsr.3	O94763		ENST00000542441.2:c.187G>A	chr19.hg19:g.30476164G>A	ENSP00000442436:p.Glu63Lys	359.0	0.0		263.0	15.0	NM_003796	A8K805|H7BY42|Q8TC23|Q9UNU3	Missense_Mutation	SNP	ENST00000542441.2	hg19	CCDS12420.1	.	.	.	.	.	.	.	.	.	.	G	29.8	5.035399	0.93630	.	.	ENSG00000105176	ENST00000360605;ENST00000542441;ENST00000312051	T;T	0.46451	0.87;0.87	4.8	4.8	0.61643	Prefoldin (1);Prefoldin subunit (1);	0.049109	0.85682	D	0.000000	T	0.55465	0.1922	L	0.43152	1.355	0.80722	D	1	D;D;D	0.71674	0.998;0.998;0.997	D;D;D	0.69824	0.96;0.958;0.966	T	0.53041	-0.8494	10	0.38643	T	0.18	-19.7679	16.0247	0.80536	0.0:0.0:1.0:0.0	.	23;63;61	F8W9T0;O94763;Q8TC23	.;RMP_HUMAN;.	K	61;63;23	ENSP00000442436:E63K;ENSP00000312530:E23K	ENSP00000312530:E23K	E	+	1	0	C19orf2	35168004	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.082000	0.76851	2.230000	0.72887	0.563000	0.77884	GAA	.	.		0.279	URI1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000439756.1	NM_134447	
SON	6651	hgsc.bcm.edu	37	21	34925206	34925206	+	Silent	SNP	T	T	A			TCGA-BC-A110-01A-11D-A12Z-10	TCGA-BC-A110-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7df1cd46-d00e-474c-9815-b41edb5ccf20	10045d1f-6bbd-4855-878e-90705d76e6f8	g.chr21:34925206T>A	ENST00000356577.4	+	3	4144	c.3669T>A	c.(3667-3669)ccT>ccA	p.P1223P	SON_ENST00000381679.4_Silent_p.P1223P|SON_ENST00000290239.6_Silent_p.P1223P|SON_ENST00000300278.4_Silent_p.P1223P|SON_ENST00000381692.2_Intron	NM_138927.1	NP_620305	P18583	SON_HUMAN	SON DNA binding protein	1223					cytokinesis (GO:0000910)|microtubule cytoskeleton organization (GO:0000226)|mRNA processing (GO:0006397)|negative regulation of apoptotic process (GO:0043066)|regulation of cell cycle (GO:0051726)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	nuclear speck (GO:0016607)|nucleus (GO:0005634)	DNA binding (GO:0003677)|nucleic acid binding (GO:0003676)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(3)|central_nervous_system(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|lung(25)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	72						TTTCGGAGCCTTCAGCAGTGC	0.493																																					p.P1223P		Atlas-SNP	.											.	SON	343	.	0			c.T3669A						.						153.0	156.0	155.0					21																	34925206		2203	4300	6503	SO:0001819	synonymous_variant	6651	exon3			GGAGCCTTCAGCA	AF380181	CCDS13629.1, CCDS13631.1, CCDS74784.1	21q22.1-q22.2	2013-01-28			ENSG00000159140	ENSG00000159140		"""G patch domain containing"""	11183	protein-coding gene	gene with protein product	"""NRE-binding protein"", ""negative regulatory element-binding protein"", ""Bax antagonist selected in Saccharomyces 1"""	182465		C21orf50		8318737, 21551269	Standard	NM_032195		Approved	DBP-5, NREBP, KIAA1019, BASS1, FLJ21099, FLJ33914	uc002yse.1	P18583	OTTHUMG00000065806	ENST00000356577.4:c.3669T>A	chr21.hg19:g.34925206T>A		282.0	0.0		237.0	14.0	NM_032195	D3DSF5|D3DSF6|E7ETE8|E7EU67|E7EVW3|E9PFQ2|O14487|O95981|Q14120|Q6PKE0|Q9H7B1|Q9P070|Q9P072|Q9UKP9|Q9UPY0	Silent	SNP	ENST00000356577.4	hg19	CCDS13629.1	.	.	.	.	.	.	.	.	.	.	T	5.392	0.257602	0.10239	.	.	ENSG00000159140	ENST00000436227	.	.	.	5.42	4.25	0.50352	.	.	.	.	.	T	0.55016	0.1894	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.51044	-0.8755	4	.	.	.	.	5.6107	0.17404	0.0:0.0869:0.1746:0.7385	.	.	.	.	H	218	.	.	L	+	2	0	SON	33847076	0.879000	0.30193	0.882000	0.34594	0.509000	0.34042	1.139000	0.31504	0.875000	0.35847	0.460000	0.39030	CTT	.	.		0.493	SON-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000140978.2	NM_138927	
HMGB3	3149	hgsc.bcm.edu	37	X	150155724	150155724	+	Missense_Mutation	SNP	A	A	T			TCGA-BC-A110-01A-11D-A12Z-10	TCGA-BC-A110-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7df1cd46-d00e-474c-9815-b41edb5ccf20	10045d1f-6bbd-4855-878e-90705d76e6f8	g.chrX:150155724A>T	ENST00000325307.7	+	4	510	c.414A>T	c.(412-414)gaA>gaT	p.E138D	HMGB3_ENST00000448905.2_Missense_Mutation_p.E138D	NM_005342.2	NP_005333.2	O15347	HMGB3_HUMAN	high mobility group box 3	138					DNA recombination (GO:0006310)|multicellular organismal development (GO:0007275)	chromosome (GO:0005694)|nucleus (GO:0005634)	DNA binding, bending (GO:0008301)|double-stranded DNA binding (GO:0003690)|poly(A) RNA binding (GO:0044822)			endometrium(3)|large_intestine(2)|lung(2)|skin(1)	8	Acute lymphoblastic leukemia(192;6.56e-05)					ATGACAGTGAAAAGCAGCCTT	0.488																																					p.E138D		Atlas-SNP	.											.	HMGB3	27	.	0			c.A414T						.						47.0	45.0	46.0					X																	150155724		2203	4297	6500	SO:0001583	missense	3149	exon4			CAGTGAAAAGCAG	AF274572	CCDS35428.1	Xq28	2011-07-01	2011-04-05	2002-08-16	ENSG00000029993	ENSG00000029993		"""High-mobility group / Canonical"""	5004	protein-coding gene	gene with protein product	"""non-histone chromosomal protein"""	300193	"""high-mobility group (nonhistone chromosomal) protein 4"", ""high-mobility group box 3"""	HMG4		9598312	Standard	XM_005274665		Approved	HMG2A, MGC90319	uc004fep.3	O15347	OTTHUMG00000024162	ENST00000325307.7:c.414A>T	chrX.hg19:g.150155724A>T	ENSP00000359393:p.Glu138Asp	219.0	0.0		158.0	11.0	NM_005342	O95556|Q6NS40	Missense_Mutation	SNP	ENST00000325307.7	hg19	CCDS35428.1	.	.	.	.	.	.	.	.	.	.	a	5.724	0.318006	0.10845	.	.	ENSG00000029993	ENST00000419110;ENST00000325307;ENST00000455596;ENST00000448905;ENST00000430118	D;D;D;D;D	0.95342	-3.68;-3.68;-3.68;-3.68;-3.68	5.05	-3.08	0.05347	High mobility group, HMG1/HMG2, subgroup (1);High mobility group, superfamily (1);High mobility group, HMG1/HMG2 (4);	0.127237	0.52532	D	0.000079	T	0.81341	0.4802	N	0.02192	-0.645	0.41426	D	0.987836	B	0.19200	0.034	B	0.24848	0.056	T	0.66763	-0.5841	10	0.02654	T	1	.	15.3324	0.74223	0.2667:0.0:0.7333:0.0	.	138	O15347	HMGB3_HUMAN	D	138	ENSP00000410354:E138D;ENSP00000359393:E138D;ENSP00000405601:E138D;ENSP00000442758:E138D;ENSP00000417027:E138D	ENSP00000359393:E138D	E	+	3	2	HMGB3	149906382	0.619000	0.27059	0.765000	0.31456	0.990000	0.78478	-0.130000	0.10498	-0.793000	0.04475	0.430000	0.28490	GAA	.	.		0.488	HMGB3-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060867.1	NM_005342	
FILIP1	27145	hgsc.bcm.edu	37	6	76018525	76018526	+	Frame_Shift_Ins	INS	-	-	C			TCGA-BC-A110-01A-11D-A12Z-10	TCGA-BC-A110-11A-11D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7df1cd46-d00e-474c-9815-b41edb5ccf20	10045d1f-6bbd-4855-878e-90705d76e6f8	g.chr6:76018525_76018526insC	ENST00000237172.7	-	6	3853_3854	c.3523_3524insG	c.(3523-3525)gccfs	p.A1175fs	FILIP1_ENST00000393004.2_Intron|FILIP1_ENST00000370020.1_Frame_Shift_Ins_p.A1076fs|FILIP1_ENST00000498523.1_5'UTR	NM_015687.2	NP_056502.1	Q7Z7B0	FLIP1_HUMAN	filamin A interacting protein 1	1175										breast(3)|central_nervous_system(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|liver(1)|lung(28)|ovary(1)|pancreas(1)|prostate(5)|skin(9)|upper_aerodigestive_tract(4)	80						TGCTCCTGGGGCTGCCACTACT	0.52																																					p.A1175fs		Atlas-INDEL	.											.	FILIP1	173	.	0			c.3524_3525insG						.																																			SO:0001589	frameshift_variant	27145	exon6			.	AB033101	CCDS4984.1, CCDS75480.1	6q14.1	2008-02-05			ENSG00000118407	ENSG00000118407			21015	protein-coding gene	gene with protein product		607307				10574462	Standard	XM_005248713		Approved	FILIP, KIAA1275	uc003pia.3	Q7Z7B0	OTTHUMG00000015056	ENST00000237172.7:c.3524dupG	chr6.hg19:g.76018526_76018526dupC	ENSP00000237172:p.Ala1175fs	455.0	0.0		214.0	17.0	NM_015687	B2RMU6|Q5VUL6|Q86TC3|Q8N8B9|Q96SK6|Q9NVI8|Q9ULE5	Frame_Shift_Ins	INS	ENST00000237172.7	hg19	CCDS4984.1																																																																																			.	.		0.520	FILIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041263.1	XM_029179	
ARFGAP2	84364	hgsc.bcm.edu	37	11	47187860	47187861	+	Frame_Shift_Ins	INS	-	-	C			TCGA-BC-A110-01A-11D-A12Z-10	TCGA-BC-A110-11A-11D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7df1cd46-d00e-474c-9815-b41edb5ccf20	10045d1f-6bbd-4855-878e-90705d76e6f8	g.chr11:47187860_47187861insC	ENST00000524782.1	-	15	1731_1732	c.1503_1504insG	c.(1501-1506)gggaaafs	p.K502fs	RP11-390K5.6_ENST00000524412.1_RNA|ARFGAP2_ENST00000419701.2_Frame_Shift_Ins_p.K395fs|ARFGAP2_ENST00000395449.3_5'UTR|ARFGAP2_ENST00000426335.2_Frame_Shift_Ins_p.K366fs|ARFGAP2_ENST00000319543.6_Frame_Shift_Ins_p.K233fs	NM_001242832.1|NM_032389.4	NP_001229761.1|NP_115765.2	Q8N6H7	ARFG2_HUMAN	ADP-ribosylation factor GTPase activating protein 2	502	Required for interaction with coatomer.				protein transport (GO:0015031)|regulation of ARF GTPase activity (GO:0032312)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)	ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)			breast(2)|kidney(2)|large_intestine(5)|lung(7)|ovary(3)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	23						ACAGCCATTTTCCCAGCCACAG	0.545																																					p.K502fs		Atlas-INDEL	.											.	ARFGAP2	43	.	0			c.1504_1505insG						.																																			SO:0001589	frameshift_variant	84364	exon15			.	AK027482	CCDS7926.1, CCDS73283.1	11p11.2-p11.12	2012-10-05	2008-01-09	2008-01-09	ENSG00000149182	ENSG00000149182		"""ADP-ribosylation factor GTPase activating proteins"""	13504	protein-coding gene	gene with protein product		606908	"""zinc finger protein 289, ID1 regulated"""	ZNF289		11278321, 14690497	Standard	NM_032389		Approved	IRZ, Zfp289, FLJ14576	uc001ndt.3	Q8N6H7	OTTHUMG00000166773	ENST00000524782.1:c.1504dupG	chr11.hg19:g.47187863_47187863dupC	ENSP00000434442:p.Lys502fs	210.0	0.0		121.0	16.0	NM_032389	B4DX29|B7Z9M7|D3DQQ9|Q3LIF2|Q8N3I1|Q96SX7	Frame_Shift_Ins	INS	ENST00000524782.1	hg19	CCDS7926.1																																																																																			.	.		0.545	ARFGAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391425.1	NM_032389	
TNKS1BP1	85456	hgsc.bcm.edu	37	11	57077359	57077360	+	Frame_Shift_Ins	INS	-	-	C			TCGA-BC-A110-01A-11D-A12Z-10	TCGA-BC-A110-11A-11D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7df1cd46-d00e-474c-9815-b41edb5ccf20	10045d1f-6bbd-4855-878e-90705d76e6f8	g.chr11:57077359_57077360insC	ENST00000532437.1	-	5	3136_3137	c.2825_2826insG	c.(2824-2826)agcfs	p.S942fs	TNKS1BP1_ENST00000530920.1_5'UTR|TNKS1BP1_ENST00000358252.3_Frame_Shift_Ins_p.S942fs			Q9C0C2	TB182_HUMAN	tankyrase 1 binding protein 1, 182kDa	942	Acidic.				gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|RNA metabolic process (GO:0016070)|telomere maintenance via telomerase (GO:0007004)	CCR4-NOT complex (GO:0030014)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|nuclear telomeric heterochromatin (GO:0005724)|nucleus (GO:0005634)	ankyrin binding (GO:0030506)|enzyme binding (GO:0019899)			breast(3)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(11)|lung(24)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	64		all_epithelial(135;0.21)				CCGCAGCCCGGCTGCCATAGGT	0.589																																					p.S942fs		Atlas-INDEL	.											.	TNKS1BP1	148	.	0			c.2826_2827insG						.																																			SO:0001589	frameshift_variant	85456	exon6			.	AB051528	CCDS7951.1	11q12.2	2008-07-21			ENSG00000149115	ENSG00000149115			19081	protein-coding gene	gene with protein product		607104				11854288	Standard	NM_033396		Approved	TAB182, KIAA1741, FLJ45975	uc001njs.3	Q9C0C2	OTTHUMG00000167022	ENST00000532437.1:c.2826dupG	chr11.hg19:g.57077360_57077360dupC	ENSP00000437271:p.Ser942fs	158.0	0.0		118.0	10.0	NM_033396	A7E2F8|Q6PJ35|Q6ZV74	Frame_Shift_Ins	INS	ENST00000532437.1	hg19	CCDS7951.1																																																																																			.	.		0.589	TNKS1BP1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392455.1	NM_033396	
SMARCC1	6599	hgsc.bcm.edu	37	3	47629720	47629721	+	Frame_Shift_Ins	INS	-	-	G	rs35867350		TCGA-BC-A110-01A-11D-A12Z-10	TCGA-BC-A110-11A-11D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7df1cd46-d00e-474c-9815-b41edb5ccf20	10045d1f-6bbd-4855-878e-90705d76e6f8	g.chr3:47629720_47629721insG	ENST00000254480.5	-	28	3415_3416	c.3296_3297insC	c.(3295-3297)ccgfs	p.P1099fs	SMARCC1_ENST00000425518.1_5'UTR	NM_003074.3	NP_003065.3	Q92922	SMRC1_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 1	1099	Pro-rich.				ATP-dependent chromatin remodeling (GO:0043044)|chromatin remodeling (GO:0006338)|insulin receptor signaling pathway (GO:0008286)|nervous system development (GO:0007399)|nucleosome disassembly (GO:0006337)|organ morphogenesis (GO:0009887)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|protein complex (GO:0043234)|SWI/SNF complex (GO:0016514)|XY body (GO:0001741)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|protein N-terminus binding (GO:0047485)|transcription coactivator activity (GO:0003713)			breast(1)|endometrium(5)|kidney(2)|large_intestine(3)|lung(15)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	33				BRCA - Breast invasive adenocarcinoma(193;7.47e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.00862)|Kidney(197;0.01)		CTGAGGCTGGCGGGCCAGGAGC	0.604																																					p.P1099fs		Atlas-INDEL	.											.	SMARCC1	85	.	0			c.3297_3298insC						.																																			SO:0001589	frameshift_variant	6599	exon28			.	U66615	CCDS2758.1	3p21.31	2008-05-15			ENSG00000173473	ENSG00000173473			11104	protein-coding gene	gene with protein product		601732				8804307	Standard	NM_003074		Approved	BAF155, SRG3, Rsc8, CRACC1	uc003crq.2	Q92922	OTTHUMG00000133519	ENST00000254480.5:c.3297dupC	chr3.hg19:g.47629723_47629723dupG	ENSP00000254480:p.Pro1099fs	151.0	0.0		116.0	11.0	NM_003074	Q17RS0|Q6P172|Q8IWH2	Frame_Shift_Ins	INS	ENST00000254480.5	hg19	CCDS2758.1																																																																																			.	.		0.604	SMARCC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257491.1		
ZNF233	353355	hgsc.bcm.edu	37	19	44778797	44778797	+	Frame_Shift_Del	DEL	T	T	-	rs386809644|rs386809645|rs2884015	byFrequency	TCGA-BC-A110-01A-11D-A12Z-10	TCGA-BC-A110-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7df1cd46-d00e-474c-9815-b41edb5ccf20	10045d1f-6bbd-4855-878e-90705d76e6f8	g.chr19:44778797delT	ENST00000391958.2	+	5	2111	c.1984delT	c.(1984-1986)ttgfs	p.L662fs	ZNF235_ENST00000589799.1_Intron|ZNF233_ENST00000334152.1_Frame_Shift_Del_p.L644fs|ZNF233_ENST00000592581.1_3'UTR	NM_181756.2	NP_861421.2	A6NK53	ZN233_HUMAN	zinc finger protein 233	662					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(4)|skin(3)|urinary_tract(1)	20		Prostate(69;0.0435)|all_neural(266;0.226)				TAAGAGTTCGTTGTCTTCAGA	0.413																																					p.S661fs		Atlas-INDEL	.											.,8	ZNF233	73	.	0			c.1983delG						.		,	2463,1797		712,1039,379	70.0	79.0	75.0		,	-8.4	0.0	19	dbSNP_129	61	1034,7216		69,896,3160	no	frameshift,frameshift	ZNF233	NM_181756.2,NM_001207005.1	,	781,1935,3539	A1A1,A1R,RR		12.5333,42.1831,27.9536	,	,	44778797	3497,9013	2201	4300	6501	SO:0001589	frameshift_variant	353355	exon5			.	AY166792	CCDS33047.1	19q13.31	2013-01-08				ENSG00000159915		"""Zinc fingers, C2H2-type"", ""-"""	30946	protein-coding gene	gene with protein product						12743021	Standard	NM_001207005		Approved	FLJ38032	uc021uvi.1	A6NK53		ENST00000391958.2:c.1984delT	chr19.hg19:g.44778797delT	ENSP00000375820:p.Leu662fs	109.0	0.0		88.0	81.0	NM_001207005	B2RN78|B2RN79|Q86WL8	Frame_Shift_Del	DEL	ENST00000391958.2	hg19	CCDS33047.1																																																																																			.	.		0.413	ZNF233-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000460737.1	NM_181756	
COL17A1	1308	hgsc.bcm.edu	37	10	105837253	105837254	+	Frame_Shift_Ins	INS	-	-	G	rs374753420		TCGA-BC-A110-01A-11D-A12Z-10	TCGA-BC-A110-11A-11D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7df1cd46-d00e-474c-9815-b41edb5ccf20	10045d1f-6bbd-4855-878e-90705d76e6f8	g.chr10:105837253_105837254insG	ENST00000353479.5	-	4	418_419	c.128_129insC	c.(127-129)acafs	p.T43fs	COL17A1_ENST00000393211.3_Frame_Shift_Ins_p.T43fs|COL17A1_ENST00000369733.3_Frame_Shift_Ins_p.T43fs	NM_000494.3	NP_000485.3	Q9UMD9	COHA1_HUMAN	collagen, type XVII, alpha 1	43	Nonhelical region (NC16).				cell junction assembly (GO:0034329)|cell-matrix adhesion (GO:0007160)|collagen catabolic process (GO:0030574)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	basement membrane (GO:0005604)|cell-cell junction (GO:0005911)|collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|hemidesmosome (GO:0030056)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)				NS(1)|breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(9)|liver(1)|lung(22)|ovary(5)|pancreas(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)	62		Colorectal(252;0.103)|Breast(234;0.122)		Epithelial(162;2.5e-09)|all cancers(201;7.94e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0165)		CAAGAGAGGCTGTTTTAGCATA	0.559																																					p.T43fs		Atlas-INDEL	.											.	COL17A1	149	.	0			c.129_130insC						.																																			SO:0001589	frameshift_variant	1308	exon4			.	M91669	CCDS7554.1	10q24.3	2013-01-16			ENSG00000065618	ENSG00000065618		"""Collagens"""	2194	protein-coding gene	gene with protein product		113811		BPAG2		7916703	Standard	NM_000494		Approved	BP180	uc001kxr.3	Q9UMD9	OTTHUMG00000018998	ENST00000353479.5:c.129dupC	chr10.hg19:g.105837254_105837254dupG	ENSP00000340937:p.Thr43fs	144.0	0.0		101.0	10.0	NM_000494	Q02802|Q5JV36|Q99018|Q9NQK9|Q9UC14	Frame_Shift_Ins	INS	ENST00000353479.5	hg19	CCDS7554.1																																																																																			.	.		0.559	COL17A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050181.1	NM_130778, NM_000494	
TENM2	57451	hgsc.bcm.edu	37	5	167645298	167645299	+	Frame_Shift_Ins	INS	-	-	T			TCGA-BC-A110-01A-11D-A12Z-10	TCGA-BC-A110-11A-11D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7df1cd46-d00e-474c-9815-b41edb5ccf20	10045d1f-6bbd-4855-878e-90705d76e6f8	g.chr5:167645298_167645299insT	ENST00000518659.1	+	23	4441_4442	c.4402_4403insT	c.(4402-4404)ctafs	p.L1468fs	TENM2_ENST00000520394.1_Frame_Shift_Ins_p.L1229fs|TENM2_ENST00000545108.1_Frame_Shift_Ins_p.L1467fs|TENM2_ENST00000519204.1_Frame_Shift_Ins_p.L1347fs|TENM2_ENST00000403607.2_Frame_Shift_Ins_p.L1292fs	NM_001122679.1	NP_001116151.1	Q9NT68	TEN2_HUMAN	teneurin transmembrane protein 2	1468					axon guidance (GO:0007411)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|heterophilic cell-cell adhesion (GO:0007157)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of filopodium assembly (GO:0051491)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cell-cell junction (GO:0005911)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|endoplasmic reticulum (GO:0005783)|filopodium (GO:0030175)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|PML body (GO:0016605)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)										ACTCAGCAAACTAGCCATTCAC	0.51																																					p.L1459fs		Atlas-INDEL	.											.	.	.	.	0			c.4375_4376insT						.																																			SO:0001589	frameshift_variant	57451	exon23			.	AB032953		5q35	2012-10-02	2012-10-02	2012-10-02	ENSG00000145934	ENSG00000145934			29943	protein-coding gene	gene with protein product		610119	"""odz, odd Oz/ten-m homolog 2 (Drosophila)"""	ODZ2		10625539	Standard	NM_001122679		Approved	KIAA1127, Ten-M2	uc010jjd.3	Q9NT68	OTTHUMG00000162928	ENST00000518659.1:c.4403dupT	chr5.hg19:g.167645299_167645299dupT	ENSP00000429430:p.Leu1468fs	174.0	0.0		115.0	12.0	NM_001122679	Q9ULU2	Frame_Shift_Ins	INS	ENST00000518659.1	hg19																																																																																				.	.		0.510	TENM2-001	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000376096.1	NM_001122679	
SUMF2	25870	hgsc.bcm.edu	37	7	56144554	56144555	+	Frame_Shift_Ins	INS	-	-	C	rs541718189		TCGA-BC-A110-01A-11D-A12Z-10	TCGA-BC-A110-11A-11D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7df1cd46-d00e-474c-9815-b41edb5ccf20	10045d1f-6bbd-4855-878e-90705d76e6f8	g.chr7:56144554_56144555insC	ENST00000413756.1	+	6	586_587	c.563_564insC	c.(562-567)ttccagfs	p.Q189fs	SUMF2_ENST00000395435.2_Intron|SUMF2_ENST00000395436.2_Frame_Shift_Ins_p.Q193fs|SUMF2_ENST00000434526.2_Frame_Shift_Ins_p.Q208fs|SUMF2_ENST00000275607.9_Frame_Shift_Ins_p.Q101fs|SUMF2_ENST00000342190.6_Frame_Shift_Ins_p.Q208fs|SUMF2_ENST00000437307.2_Intron			Q8NBJ7	SUMF2_HUMAN	sulfatase modifying factor 2	189					cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)	endoplasmic reticulum lumen (GO:0005788)	metal ion binding (GO:0046872)			breast(2)|endometrium(2)|large_intestine(1)|lung(6)|ovary(2)|skin(1)	14	Breast(14;0.214)		Lung(13;0.00024)|LUSC - Lung squamous cell carcinoma(13;0.00099)			GGGAACTGGTTCCAGCCAAACC	0.54																																					p.F207fs		Atlas-INDEL	.											.	SUMF2	56	.	0			c.620_621insC						.																																			SO:0001589	frameshift_variant	25870	exon6			.	AK075477	CCDS5524.2, CCDS43588.2, CCDS43589.2, CCDS47589.1, CCDS55111.1	7q11.1	2004-04-30			ENSG00000129103	ENSG00000129103			20415	protein-coding gene	gene with protein product		607940				12757706	Standard	NM_015411		Approved	DKFZp566I1024	uc003trv.3	Q8NBJ7	OTTHUMG00000129373	ENST00000413756.1:c.565dupC	chr7.hg19:g.56144556_56144556dupC	ENSP00000406445:p.Gln189fs	207.0	0.0		140.0	10.0	NM_015411	B4DU41|B4DWQ0|Q14DW5|Q53ZE3|Q96BH2|Q9BRN3|Q9BWI1|Q9Y405	Frame_Shift_Ins	INS	ENST00000413756.1	hg19																																																																																				.	.		0.540	SUMF2-013	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000341457.2	NM_015411	
IFT88	8100	hgsc.bcm.edu	37	13	21219024	21219025	+	Frame_Shift_Ins	INS	-	-	T			TCGA-BC-A110-01A-11D-A12Z-10	TCGA-BC-A110-11A-11D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7df1cd46-d00e-474c-9815-b41edb5ccf20	10045d1f-6bbd-4855-878e-90705d76e6f8	g.chr13:21219024_21219025insT	ENST00000319980.6	+	22	2230_2231	c.1903_1904insT	c.(1903-1905)cttfs	p.L635fs	IFT88_ENST00000351808.5_Frame_Shift_Ins_p.L626fs|IFT88_ENST00000382778.4_Frame_Shift_Ins_p.L635fs|IFT88_ENST00000537103.1_Frame_Shift_Ins_p.L607fs	NM_175605.3	NP_783195.2	Q13099	IFT88_HUMAN	intraflagellar transport 88	635					anterior/posterior pattern specification (GO:0009952)|cardiac muscle cell differentiation (GO:0055007)|cardiac septum morphogenesis (GO:0060411)|cilium morphogenesis (GO:0060271)|cochlea development (GO:0090102)|cytoplasmic microtubule organization (GO:0031122)|determination of left/right symmetry (GO:0007368)|embryonic digit morphogenesis (GO:0042733)|epidermal stem cell homeostasis (GO:0036334)|epidermis development (GO:0008544)|epithelial cell morphogenesis (GO:0003382)|eye development (GO:0001654)|forebrain morphogenesis (GO:0048853)|heart formation (GO:0060914)|inner ear receptor stereocilium organization (GO:0060122)|kidney development (GO:0001822)|liver development (GO:0001889)|lung vasculature development (GO:0060426)|negative regulation of epithelial cell proliferation (GO:0050680)|Notch signaling pathway (GO:0007219)|palate development (GO:0060021)|pancreas development (GO:0031016)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|protein localization (GO:0008104)|regulation of autophagic vacuole assembly (GO:2000785)|regulation of cilium assembly (GO:1902017)|regulation of fat cell differentiation (GO:0045598)|regulation of odontogenesis of dentin-containing tooth (GO:0042487)|regulation of protein processing (GO:0070613)|regulation of smoothened signaling pathway (GO:0008589)|response to fluid shear stress (GO:0034405)|smoothened signaling pathway (GO:0007224)|sperm axoneme assembly (GO:0007288)|spermatid nucleus elongation (GO:0007290)|spinal cord dorsal/ventral patterning (GO:0021513)|telencephalon development (GO:0021537)	acrosomal membrane (GO:0002080)|apical part of cell (GO:0045177)|axonemal basal plate (GO:0097541)|centriole (GO:0005814)|ciliary basal body (GO:0036064)|ciliary base (GO:0097546)|ciliary tip (GO:0097542)|cilium (GO:0005929)|intraciliary transport particle B (GO:0030992)|kinocilium (GO:0060091)|motile cilium (GO:0031514)|motile primary cilium (GO:0031512)|photoreceptor connecting cilium (GO:0032391)				breast(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(13)|ovary(1)|prostate(2)|skin(2)|urinary_tract(1)	27		all_cancers(29;5.79e-25)|all_epithelial(30;2.57e-20)|all_lung(29;3.13e-16)|Lung SC(185;0.0262)|Ovarian(182;0.0825)|Hepatocellular(188;0.244)		all cancers(112;0.000667)|Epithelial(112;0.00119)|OV - Ovarian serous cystadenocarcinoma(117;0.0141)|Lung(94;0.0183)|LUSC - Lung squamous cell carcinoma(192;0.0528)		CATTGAGTGGCTTGGAGCCTAT	0.302																																					p.L635fs		Atlas-INDEL	.											.	IFT88	83	.	0			c.1903_1904insT						.																																			SO:0001589	frameshift_variant	8100	exon22			.	AK058172	CCDS31944.1, CCDS31945.1	13q12.1	2014-07-03	2014-07-03	2005-11-02	ENSG00000032742	ENSG00000032742		"""Intraflagellar transport homologs"", ""Tetratricopeptide (TTC) repeat domain containing"""	20606	protein-coding gene	gene with protein product	"""polaris homolog"""	600595	"""tetratricopeptide repeat domain 10"", ""intraflagellar transport 88 homolog (Chlamydomonas)"""	TTC10		7633404	Standard	XM_005266546		Approved	hTg737, Tg737, D13S1056E, MGC26259	uc001uni.3	Q13099	OTTHUMG00000016517	ENST00000319980.6:c.1905dupT	chr13.hg19:g.21219026_21219026dupT	ENSP00000323580:p.Leu635fs	300.0	0.0		279.0	17.0	NM_175605	A2A491|B4DUS2|Q5SZJ6|Q8N719	Frame_Shift_Ins	INS	ENST00000319980.6	hg19	CCDS31944.1																																																																																			.	.		0.302	IFT88-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000044075.3	NM_006531	
KRTAP19-8	728299	hgsc.bcm.edu	37	21	32410712	32410713	+	Frame_Shift_Ins	INS	-	-	C			TCGA-BC-A110-01A-11D-A12Z-10	TCGA-BC-A110-11A-11D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7df1cd46-d00e-474c-9815-b41edb5ccf20	10045d1f-6bbd-4855-878e-90705d76e6f8	g.chr21:32410712_32410713insC	ENST00000382822.2	-	1	82_83	c.50_51insG	c.(49-51)ggcfs	p.G17fs		NM_001099219.1	NP_001092689.1	Q3LI54	KR198_HUMAN	keratin associated protein 19-8	17						intermediate filament (GO:0005882)				endometrium(2)|upper_aerodigestive_tract(1)	3						AGCCACCAAAGCCTCCATAGCC	0.545																																					p.G17fs		Atlas-INDEL	.											.	KRTAP19-8	9	.	0			c.51_52insG						.																																			SO:0001589	frameshift_variant	728299	exon1			.	AB096964	CCDS42917.1	21q22.11	2007-11-23			ENSG00000206102	ENSG00000206102		"""Keratin associated proteins"""	33898	protein-coding gene	gene with protein product							Standard	NM_001099219		Approved		uc010glt.3	Q3LI54	OTTHUMG00000057787	ENST00000382822.2:c.51dupG	chr21.hg19:g.32410714_32410714dupC	ENSP00000372272:p.Gly17fs	216.0	0.0		134.0	10.0	NM_001099219		Frame_Shift_Ins	INS	ENST00000382822.2	hg19	CCDS42917.1																																																																																			.	.		0.545	KRTAP19-8-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000128239.3	NM_001099219	
MSH5	4439	hgsc.bcm.edu	37	6	31729664	31729665	+	Frame_Shift_Ins	INS	-	-	C			TCGA-BC-A110-01A-11D-A12Z-10	TCGA-BC-A110-11A-11D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7df1cd46-d00e-474c-9815-b41edb5ccf20	10045d1f-6bbd-4855-878e-90705d76e6f8	g.chr6:31729664_31729665insC	ENST00000375755.3	+	23	2537_2538	c.2251_2252insC	c.(2251-2253)gccfs	p.A751fs	SAPCD1_ENST00000415669.2_5'Flank|MSH5_ENST00000375750.3_Frame_Shift_Ins_p.A751fs|MSH5_ENST00000375742.3_Frame_Shift_Ins_p.A768fs|MSH5_ENST00000375740.3_Intron|MSH5-SAPCD1_ENST00000491552.1_Intron|MSH5_ENST00000375703.3_Frame_Shift_Ins_p.A752fs|SAPCD1-AS1_ENST00000419679.1_RNA|SAPCD1_ENST00000425424.1_5'Flank|MSH5_ENST00000431848.2_Frame_Shift_Ins_p.A450fs|MSH5_ENST00000534153.4_Frame_Shift_Ins_p.A768fs|MSH5-SAPCD1_ENST00000493662.2_Frame_Shift_Ins_p.A768fs|MSH5_ENST00000395853.1_Frame_Shift_Ins_p.A425fs	NM_002441.4	NP_002432.1	O43196	MSH5_HUMAN	mutS homolog 5	751					ATP catabolic process (GO:0006200)|chiasma assembly (GO:0051026)|homologous chromosome segregation (GO:0045143)|mismatch repair (GO:0006298)|reciprocal meiotic recombination (GO:0007131)	synaptonemal complex (GO:0000795)	ATP binding (GO:0005524)|DNA-dependent ATPase activity (GO:0008094)|mismatched DNA binding (GO:0030983)			breast(1)|ovary(2)|skin(2)	5						TGTTGCGAAGGCCAGCCATGCC	0.515								Direct reversal of damage;Mismatch excision repair (MMR)																													p.A752fs		Atlas-INDEL	.											.	MSH5	108	.	0			c.2254_2255insC						.																																			SO:0001589	frameshift_variant	4439	exon23			.	AF070071	CCDS4720.1, CCDS34409.1, CCDS34410.1, CCDS34409.2	6p21.3	2013-09-12	2013-09-12		ENSG00000204410	ENSG00000204410			7328	protein-coding gene	gene with protein product		603382	"""mutS (E. coli) homolog 5"", ""mutS homolog 5 (E. coli)"""			9740671, 9787078, 17977839	Standard	NM_002441		Approved		uc011hbg.2	O43196	OTTHUMG00000167551	ENST00000375755.3:c.2253dupC	chr6.hg19:g.31729666_31729666dupC	ENSP00000364908:p.Ala751fs	224.0	0.0		169.0	11.0	NM_172165	B0V033|B0V034|O60586|Q5BLU9|Q5SSR1|Q8IW44|Q9BQC7	Frame_Shift_Ins	INS	ENST00000375755.3	hg19	CCDS4720.1																																																																																			.	.		0.515	MSH5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000076243.4		
ARAP1	116985	hgsc.bcm.edu	37	11	72407643	72407644	+	Frame_Shift_Ins	INS	-	-	C	rs77227247		TCGA-BC-A110-01A-11D-A12Z-10	TCGA-BC-A110-11A-11D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7df1cd46-d00e-474c-9815-b41edb5ccf20	10045d1f-6bbd-4855-878e-90705d76e6f8	g.chr11:72407643_72407644insC	ENST00000393609.3	-	23	3424_3425	c.3222_3223insG	c.(3220-3225)ctgcccfs	p.P1075fs	ARAP1_ENST00000359373.5_Frame_Shift_Ins_p.P1075fs|ARAP1_ENST00000455638.2_Frame_Shift_Ins_p.P1075fs|ARAP1_ENST00000429686.1_Frame_Shift_Ins_p.P769fs|ARAP1_ENST00000426523.1_Frame_Shift_Ins_p.P830fs|ARAP1_ENST00000334211.8_Frame_Shift_Ins_p.P830fs|ARAP1_ENST00000393605.3_Frame_Shift_Ins_p.P835fs|ARAP1_ENST00000495878.1_5'UTR|ARAP1-AS1_ENST00000542022.1_RNA	NM_001040118.2	NP_001035207.1	Q96P48	ARAP1_HUMAN	ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 1	1075	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				actin filament reorganization involved in cell cycle (GO:0030037)|negative regulation of stress fiber assembly (GO:0051497)|positive regulation of Cdc42 GTPase activity (GO:0043089)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of receptor recycling (GO:0001921)|regulation of ARF GTPase activity (GO:0032312)|regulation of cell shape (GO:0008360)|regulation of cellular component movement (GO:0051270)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	ARF GTPase activator activity (GO:0008060)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|Rho GTPase activator activity (GO:0005100)|zinc ion binding (GO:0008270)			cervix(2)|endometrium(2)|large_intestine(10)|lung(8)|ovary(1)|skin(3)|urinary_tract(1)	27						TTGACAGGGGGCAGCCGCACCA	0.55																																					p.P1075fs	Ovarian(102;1198 1520 13195 17913 37529)	Atlas-INDEL	.											.	ARAP1	168	.	0			c.3223_3224insG						.																																			SO:0001589	frameshift_variant	116985	exon23			.	AF411983	CCDS8217.2, CCDS41687.1, CCDS44671.1	11q13.3	2013-01-11	2008-09-22	2008-09-22	ENSG00000186635	ENSG00000186635		"""ADP-ribosylation factor GTPase activating proteins"", ""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	16925	protein-coding gene	gene with protein product		606646	"""centaurin, delta 2"""	CENTD2			Standard	NM_001040118		Approved		uc001osu.3	Q96P48	OTTHUMG00000157102	ENST00000393609.3:c.3223dupG	chr11.hg19:g.72407644_72407644dupC	ENSP00000377233:p.Pro1075fs	109.0	0.0		54.0	10.0	NM_001040118	A3KLL7|B2RTS2|O94879|Q4LDD5|Q59FI7|Q6PHS3|Q8WU51|Q96HP6|Q96L71	Frame_Shift_Ins	INS	ENST00000393609.3	hg19	CCDS41687.1																																																																																			.	.		0.550	ARAP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000347428.1	NM_001040118	
PKP1	5317	hgsc.bcm.edu	37	1	201293599	201293600	+	Frame_Shift_Ins	INS	-	-	C			TCGA-BC-A110-01A-11D-A12Z-10	TCGA-BC-A110-11A-11D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7df1cd46-d00e-474c-9815-b41edb5ccf20	10045d1f-6bbd-4855-878e-90705d76e6f8	g.chr1:201293599_201293600insC	ENST00000352845.3	+	11	1787_1788	c.1787_1788insC	c.(1786-1791)ggcctgfs	p.L597fs	PKP1_ENST00000367324.3_Frame_Shift_Ins_p.L576fs|PKP1_ENST00000263946.3_Frame_Shift_Ins_p.L597fs			Q13835	PKP1_HUMAN	plakophilin 1	597					apoptotic process (GO:0006915)|cell adhesion (GO:0007155)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|intermediate filament bundle assembly (GO:0045110)|multicellular organismal development (GO:0007275)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)	desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	intermediate filament binding (GO:0019215)|lamin binding (GO:0005521)|signal transducer activity (GO:0004871)|structural constituent of epidermis (GO:0030280)			NS(2)|breast(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(3)|lung(4)|ovary(5)|prostate(1)	22						AAGGAAAAGGGCCTGCCACAAA	0.579																																					p.G596fs		Atlas-INDEL	.											.,2	PKP1	127	.	0			c.1787_1788insC						.																																			SO:0001589	frameshift_variant	5317	exon11			.	X79293	CCDS30966.1, CCDS30967.1	1q32	2014-06-18	2014-06-18		ENSG00000081277	ENSG00000081277		"""Armadillo repeat containing"""	9023	protein-coding gene	gene with protein product	"""ectodermal dysplasia/skin fragility syndrome"""	601975	"""plakophilin 1 (ectodermal dysplasia/skin fragility syndrome)"""			9272178	Standard	NM_001005337		Approved	B6P	uc001gwd.3	Q13835	OTTHUMG00000035729	ENST00000352845.3:c.1789dupC	chr1.hg19:g.201293601_201293601dupC	ENSP00000295597:p.Leu597fs	106.0	0.0		78.0	10.0	NM_000299	O00645|Q14CA0|Q15152	Frame_Shift_Ins	INS	ENST00000352845.3	hg19	CCDS30966.1																																																																																			.	.		0.579	PKP1-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000086897.1	NM_000299	
TLN1	7094	hgsc.bcm.edu	37	9	35725253	35725254	+	Frame_Shift_Ins	INS	-	-	C			TCGA-BC-A110-01A-11D-A12Z-10	TCGA-BC-A110-11A-11D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7df1cd46-d00e-474c-9815-b41edb5ccf20	10045d1f-6bbd-4855-878e-90705d76e6f8	g.chr9:35725253_35725254insC	ENST00000314888.9	-	3	548_549	c.195_196insG	c.(193-198)gggaaafs	p.K66fs	TLN1_ENST00000540444.1_Frame_Shift_Ins_p.K66fs	NM_006289.3	NP_006280.3	Q9Y490	TLN1_HUMAN	talin 1	66					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell-cell junction assembly (GO:0007043)|cell-substrate junction assembly (GO:0007044)|cellular component movement (GO:0006928)|cellular protein metabolic process (GO:0044267)|cortical actin cytoskeleton organization (GO:0030866)|cytoskeletal anchoring at plasma membrane (GO:0007016)|endoplasmic reticulum unfolded protein response (GO:0030968)|muscle contraction (GO:0006936)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)	actin cytoskeleton (GO:0015629)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|microtubule organizing center (GO:0005815)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	integrin binding (GO:0005178)|LIM domain binding (GO:0030274)|structural constituent of cytoskeleton (GO:0005200)|vinculin binding (GO:0017166)			NS(2)|breast(8)|central_nervous_system(2)|endometrium(10)|kidney(5)|large_intestine(9)|lung(32)|ovary(3)|prostate(5)|skin(3)|upper_aerodigestive_tract(6)	85	all_epithelial(49;0.167)		Lung(28;0.00276)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)			TCCAAAGCTTTCCCAGCCTCCA	0.485																																					p.K66fs		Atlas-INDEL	.											.	TLN1	185	.	0			c.196_197insG						.																																			SO:0001589	frameshift_variant	7094	exon3			.	AB028950	CCDS35009.1	9p23-p21	2008-02-05			ENSG00000137076	ENSG00000137076			11845	protein-coding gene	gene with protein product		186745		TLN		7635475, 10610730	Standard	NM_006289		Approved	ILWEQ	uc003zxt.2	Q9Y490	OTTHUMG00000019874	ENST00000314888.9:c.196dupG	chr9.hg19:g.35725256_35725256dupC	ENSP00000316029:p.Lys66fs	175.0	0.0		136.0	12.0	NM_006289	A6NMY0|Q86YD0|Q9NZQ2|Q9UHH8|Q9UPX3	Frame_Shift_Ins	INS	ENST00000314888.9	hg19	CCDS35009.1																																																																																			.	.		0.485	TLN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052353.2	NM_006289	
