#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
RBL2	5934	hgsc.bcm.edu	37	16	53513829	53513830	+	Frame_Shift_Ins	INS	-	-	A			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr16:53513829_53513830insA	ENST00000262133.6	+	19	2944_2945	c.2807_2808insA	c.(2806-2811)agaaaafs	p.RK936fs	RBL2_ENST00000379935.4_3'UTR|RBL2_ENST00000544545.1_Intron	NM_005611.3	NP_005602.3	Q08999	RBL2_HUMAN	retinoblastoma-like 2	936	Domain B.|Pocket; binds E1A.				chromatin modification (GO:0016568)|mitotic cell cycle (GO:0000278)|regulation of cell cycle (GO:0051726)|regulation of lipid kinase activity (GO:0043550)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)			breast(3)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(8)|lung(17)|ovary(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	45						AAAGGGAAAAGAAAAAGAAGAA	0.376																																					p.R936fs		.	.											.	RBL2	.	.	0			c.2807_2808insA						.																																			SO:0001589	frameshift_variant	5934	exon19			.	X74594	CCDS10748.1	16q12.2	2014-03-11	2014-03-11		ENSG00000103479	ENSG00000103479			9894	protein-coding gene	gene with protein product		180203				8361765, 8643454	Standard	NM_005611		Approved	Rb2, p130	uc002ehi.4	Q08999	OTTHUMG00000133198	ENST00000262133.6:c.2812dupA	16.37:g.53513834_53513834dupA	ENSP00000262133:p.Arg936fs	269.0	0.0		151.0	10.0	NM_005611	B7Z913|Q15073|Q16084|Q8NE70|Q92812	Frame_Shift_Ins	INS	ENST00000262133.6	37	CCDS10748.1																																																																																			.	.		0.376	RBL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256908.3	NM_005611	
CEP85L	387119	hgsc.bcm.edu	37	6	118886846	118886847	+	Frame_Shift_Ins	INS	-	-	A			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr6:118886846_118886847insA	ENST00000368491.3	-	3	1486_1487	c.865_866insT	c.(865-867)cccfs	p.P289fs	CEP85L_ENST00000360290.3_Frame_Shift_Ins_p.P187fs|CEP85L_ENST00000368488.5_Frame_Shift_Ins_p.P292fs|CEP85L_ENST00000392500.3_Frame_Shift_Ins_p.P292fs|CEP85L_ENST00000419517.2_Frame_Shift_Ins_p.P289fs|CEP85L_ENST00000472713.1_5'UTR	NM_001042475.2	NP_001035940.1	Q5SZL2	CE85L_HUMAN	centrosomal protein 85kDa-like	289						centrosome (GO:0005813)|cytoplasm (GO:0005737)											AGGCTGAATGGGAACTCCACCT	0.446																																					p.P292fs		.	.											.	.	.	.	0			c.875_876insT						.																																			SO:0001589	frameshift_variant	387119	exon4			.	AF308284	CCDS5119.2, CCDS43498.1, CCDS55052.1	6q22.31	2011-11-25	2011-11-25	2011-11-25	ENSG00000111860	ENSG00000111860			21638	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 204"""	C6orf204			Standard	NM_206921		Approved	NY-BR-15, bA57K17.2	uc003pya.2	Q5SZL2	OTTHUMG00000015465	ENST00000368491.3:c.865_866insT	6.37:g.118886846_118886847insA	ENSP00000357477:p.Pro289fs	287.0	0.0		300.0	27.0	NM_001178035	A1A4E1|A2A3P2|A2IDE5|F8W6J2|G3V0H3|Q2TAM2|Q5T323|Q7Z5K7|Q9H289	Frame_Shift_Ins	INS	ENST00000368491.3	37	CCDS43498.1																																																																																			.	.		0.446	CEP85L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041996.2	NM_001042475	
CMTM1	113540	hgsc.bcm.edu	37	16	66600574	66600575	+	Intron	INS	-	-	C			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr16:66600574_66600575insC	ENST00000457188.2	+	1	202				CMTM1_ENST00000528324.1_Intron|CKLF-CMTM1_ENST00000527729.1_Intron|CMTM1_ENST00000535705.1_Intron|CMTM1_ENST00000533666.1_Intron|CMTM1_ENST00000529506.1_Intron|CMTM1_ENST00000332695.7_Intron|CMTM1_ENST00000328020.6_Frame_Shift_Ins_p.HP53fs|CMTM1_ENST00000531885.1_Intron|CMTM1_ENST00000336328.6_Intron|CMTM1_ENST00000379500.2_Frame_Shift_Ins_p.HP53fs|CMTM1_ENST00000533953.1_Frame_Shift_Ins_p.HP53fs	NM_181269.2	NP_851786.1	Q8IZ96	CKLF1_HUMAN	CKLF-like MARVEL transmembrane domain containing 1						chemotaxis (GO:0006935)	extracellular space (GO:0005615)|integral component of membrane (GO:0016021)				breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(2)	7		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0702)|Epithelial(162;0.222)		CCCCGGAAGCACCCCGCAGTCT	0.658																																					p.H53fs		.	.											.	CMTM1	.	.	0			c.158_159insC						.																																			SO:0001627	intron_variant	113540	exon1			.	AF278577	CCDS10810.1, CCDS10811.1, CCDS10812.2, CCDS45503.1, CCDS45504.1, CCDS54019.1, CCDS54020.1, CCDS54021.1	16q22.1	2009-10-06	2005-11-08	2005-11-08	ENSG00000089505	ENSG00000089505			19172	protein-coding gene	gene with protein product		607884	"""chemokine-like factor super family 1"", ""chemokine-like factor superfamily 1"""	CKLFSF1		12782130	Standard	NM_181268		Approved	CKLFH1a, CKLFH	uc002epr.4	Q8IZ96	OTTHUMG00000137502	ENST00000457188.2:c.81+77->C	16.37:g.66600578_66600578dupC		209.0	0.0		139.0	10.0	NM_181268	Q2PPY5|Q6PEV5|Q8IU76|Q8IU83|Q8IU86|Q8IU93|Q8IZ87|Q8IZ88|Q8IZ89|Q8IZ90|Q8IZ91|Q8IZ92|Q8IZ93|Q8IZ94|Q8IZ95|Q96JC2|Q96JC3	Frame_Shift_Ins	INS	ENST00000457188.2	37	CCDS45503.1																																																																																			.	.		0.658	CMTM1-015	NOVEL	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000390261.2	NM_052999	
KMT2D	8085	hgsc.bcm.edu	37	12	49425625	49425626	+	Frame_Shift_Ins	INS	-	-	G	rs576644174|rs542331667	byFrequency	TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr12:49425625_49425626insG	ENST00000301067.7	-	39	12861_12862	c.12862_12863insC	c.(12862-12864)cggfs	p.R4288fs		NM_003482.3	NP_003473.3	O14686	KMT2D_HUMAN	lysine (K)-specific methyltransferase 2D	4288	Pro-rich.				chromatin silencing (GO:0006342)|histone H3-K4 methylation (GO:0051568)|oocyte growth (GO:0001555)|oogenesis (GO:0048477)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to estrogen (GO:0043627)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)										GGCAGGGAGCCGGGGTGGGCCC	0.658																																					p.R4288fs		.	.											.	MLL2	.	.	0			c.12863_12864insC						.																																			SO:0001589	frameshift_variant	8085	exon39			.	AF010403	CCDS44873.1	12q13.12	2013-05-09	2013-05-09	2013-05-09	ENSG00000167548	ENSG00000167548		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7133	protein-coding gene	gene with protein product		602113	"""trinucleotide repeat containing 21"", ""myeloid/lymphoid or mixed-lineage leukemia 2"""	TNRC21, MLL2		9247308	Standard	NM_003482		Approved	ALR, MLL4, CAGL114		O14686	OTTHUMG00000166524	ENST00000301067.7:c.12863dupC	12.37:g.49425629_49425629dupG	ENSP00000301067:p.Arg4288fs	239.0	0.0		165.0	11.0	NM_003482	O14687	Frame_Shift_Ins	INS	ENST00000301067.7	37	CCDS44873.1																																																																																			.	.		0.658	KMT2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390183.2		
FAM160A2	84067	hgsc.bcm.edu	37	11	6238840	6238841	+	Frame_Shift_Ins	INS	-	-	C			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr11:6238840_6238841insC	ENST00000449352.2	-	9	2238_2239	c.1975_1976insG	c.(1975-1977)gaafs	p.E659fs	FAM160A2_ENST00000265978.4_Frame_Shift_Ins_p.E673fs|FAM160A2_ENST00000524416.1_Frame_Shift_Ins_p.E659fs|FAM160A2_ENST00000529360.1_5'Flank			Q8N612	F16A2_HUMAN	family with sequence similarity 160, member A2	659					early endosome to late endosome transport (GO:0045022)|endosome organization (GO:0007032)|endosome to lysosome transport (GO:0008333)|lysosome organization (GO:0007040)|protein transport (GO:0015031)	FHF complex (GO:0070695)				NS(1)|endometrium(3)|kidney(2)|large_intestine(7)|liver(1)|lung(14)|ovary(2)|prostate(4)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	42						CTCTAGCAGTTCCCCAGCTCCC	0.634																																					p.E673fs		.	.											.	FAM160A2	.	.	0			c.2018_2019insG						.																																			SO:0001589	frameshift_variant	84067	exon9			.		CCDS7760.1, CCDS44530.1	11p15.4	2008-06-05	2008-06-05	2008-06-05	ENSG00000051009	ENSG00000051009			25378	protein-coding gene	gene with protein product			"""chromosome 11 open reading frame 56"""	C11orf56		11230166, 11214970	Standard	NM_001098794		Approved	FLJ22665, KIAA1759, DKFZP566M1046	uc001mck.4	Q8N612	OTTHUMG00000133379	ENST00000449352.2:c.1976dupG	11.37:g.6238844_6238844dupC	ENSP00000416918:p.Glu659fs	297.0	0.0		157.0	11.0	NM_032127	Q9C0A4|Q9H0N3|Q9H624	Frame_Shift_Ins	INS	ENST00000449352.2	37	CCDS44530.1																																																																																			.	.		0.634	FAM160A2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000383759.1	NM_032127	
TERF1	7013	hgsc.bcm.edu	37	8	73951354	73951355	+	Frame_Shift_Ins	INS	-	-	A			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr8:73951354_73951355insA	ENST00000276603.5	+	9	1066_1067	c.1043_1044insA	c.(1042-1047)acaaaafs	p.TK348fs	TERF1_ENST00000276602.6_Frame_Shift_Ins_p.TK328fs	NM_017489.2	NP_059523.2	P54274	TERF1_HUMAN	telomeric repeat binding factor (NIMA-interacting) 1	348	Interaction with RLIM.				age-dependent telomere shortening (GO:0001309)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of DNA replication (GO:0008156)|negative regulation of telomerase activity (GO:0051974)|negative regulation of telomere maintenance via semi-conservative replication (GO:0032214)|negative regulation of telomere maintenance via telomerase (GO:0032211)|positive regulation of apoptotic process (GO:0043065)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of mitosis (GO:0045840)|positive regulation of mitotic cell cycle (GO:0045931)|protein homooligomerization (GO:0051260)|response to drug (GO:0042493)|telomere maintenance (GO:0000723)|telomere maintenance via telomerase (GO:0007004)|telomere maintenance via telomere shortening (GO:0010834)	chromosome, telomeric region (GO:0000781)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nuclear telomere cap complex (GO:0000783)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA binding, bending (GO:0008301)|double-stranded telomeric DNA binding (GO:0003691)|microtubule binding (GO:0008017)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|telomeric DNA binding (GO:0042162)			central_nervous_system(1)|large_intestine(1)|lung(5)|ovary(1)|skin(1)	9	Breast(64;0.218)		Epithelial(68;0.0984)			CTTTTAGGTACAAAAAAGAAAA	0.297																																					p.T348fs		.	.											.	TERF1	.	.	0			c.1043_1044insA						.																																			SO:0001589	frameshift_variant	7013	exon9			.	U74382	CCDS6210.1, CCDS6211.1	8q21.11	2011-05-24			ENSG00000147601	ENSG00000147601			11728	protein-coding gene	gene with protein product		600951		TRBF1		9391075	Standard	NM_003218		Approved	PIN2, TRF1, TRF	uc003xzd.2	P54274	OTTHUMG00000164522	ENST00000276603.5:c.1049dupA	8.37:g.73951360_73951360dupA	ENSP00000276603:p.Thr348fs	102.0	0.0		135.0	11.0	NM_017489	A7XP29|Q15553|Q8NHT6|Q93029	Frame_Shift_Ins	INS	ENST00000276603.5	37	CCDS6211.1																																																																																			.	.		0.297	TERF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000379093.1	NM_017489	
PRPF39	55015	hgsc.bcm.edu	37	14	45564691	45564692	+	Frame_Shift_Ins	INS	-	-	T			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr14:45564691_45564692insT	ENST00000355765.6	+	2	419_420	c.249_250insT	c.(250-252)tttfs	p.F84fs		NM_017922.3	NP_060392.3	Q86UA1	PRP39_HUMAN	pre-mRNA processing factor 39	84					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)				breast(2)|endometrium(2)|kidney(4)|lung(3)|ovary(1)	12						AATATGAAAAATTTTGGAAAAC	0.371																																					p.K83fs		.	.											.	PRPF39	.	.	0			c.249_250insT						.																																			SO:0001589	frameshift_variant	55015	exon2			.	AK000673	CCDS9682.2	14q21.1	2013-10-03	2013-10-03		ENSG00000185246	ENSG00000185246			20314	protein-coding gene	gene with protein product		614907	"""PRP39 pre-mRNA processing factor 39 homolog (yeast)"", ""PRP39 pre-mRNA processing factor 39 homolog (S. cerevisiae)"""				Standard	NM_017922		Approved	FLJ20666, FLJ11128	uc001wvz.4	Q86UA1	OTTHUMG00000140265	ENST00000355765.6:c.253dupT	14.37:g.45564695_45564695dupT	ENSP00000348010:p.Phe84fs	176.0	0.0		166.0	10.0	NM_017922	Q08AL1|Q08AL2|Q9NUU5	Frame_Shift_Ins	INS	ENST00000355765.6	37	CCDS9682.2																																																																																			.	.		0.371	PRPF39-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319683.2		
GLA	2717	hgsc.bcm.edu	37	X	100655664	100655678	+	In_Frame_Del	DEL	GGCCACATATAAAGA	GGCCACATATAAAGA	-	rs372416832		TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	GGCCACATATAAAGA	GGCCACATATAAAGA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chrX:100655664_100655678delGGCCACATATAAAGA	ENST00000218516.3	-	4	636_650	c.615_629delTCTTTATATGTGGCC	c.(613-630)cctctttatatgtggccc>ccc	p.205_210PLYMWP>P	GLA_ENST00000479445.1_5'Flank|RPL36A-HNRNPH2_ENST00000409170.3_Intron	NM_000169.2	NP_000160.1	P06280	AGAL_HUMAN	galactosidase, alpha	205	Substrate binding.		Missing (in FD). {ECO:0000269|PubMed:9100224}.|P -> T (in FD). {ECO:0000269|PubMed:8807334, ECO:0000269|PubMed:8875188}.		glycoside catabolic process (GO:0016139)|glycosphingolipid catabolic process (GO:0046479)|glycosphingolipid metabolic process (GO:0006687)|glycosylceramide catabolic process (GO:0046477)|negative regulation of nitric oxide biosynthetic process (GO:0045019)|negative regulation of nitric-oxide synthase activity (GO:0051001)|oligosaccharide metabolic process (GO:0009311)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|lysosomal lumen (GO:0043202)|lysosome (GO:0005764)	alpha-galactosidase activity (GO:0004557)|catalytic activity (GO:0003824)|galactoside binding (GO:0016936)|hydrolase activity (GO:0016787)|protein homodimerization activity (GO:0042803)|raffinose alpha-galactosidase activity (GO:0052692)|receptor binding (GO:0005102)			endometrium(1)|kidney(1)|large_intestine(4)|lung(8)	14						CTTTTGAAAGGGCCACATATAAAGAGGCCACTCAC	0.428																																					p.206_210del	Colon(193;776 2816 31189 44474)	.	.											.	GLA	.	.	0			c.616_630del	GRCh37	CD033537|CD972786|CI082255|CM023794|CX023866	GLA	D|I|M|X		.																																			SO:0001651	inframe_deletion	2717	exon4			.	X16889	CCDS14484.1	Xq21.3-q22	2014-09-17			ENSG00000102393	ENSG00000102393	3.2.1.22		4296	protein-coding gene	gene with protein product		300644					Standard	NM_000169		Approved	GALA	uc004ehl.1	P06280	OTTHUMG00000022026	ENST00000218516.3:c.615_629delTCTTTATATGTGGCC	X.37:g.100655664_100655678delGGCCACATATAAAGA	ENSP00000218516:p.Pro205_Trp209del	115.0	0.0		110.0	11.0	NM_000169	Q6LER7	In_Frame_Del	DEL	ENST00000218516.3	37	CCDS14484.1																																																																																			.	.		0.428	GLA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057540.1		
APEX1	328	hgsc.bcm.edu	37	14	20925388	20925389	+	Frame_Shift_Ins	INS	-	-	A	rs538008341		TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr14:20925388_20925389insA	ENST00000216714.3	+	5	946_947	c.678_679insA	c.(679-681)aaafs	p.K227fs	APEX1_ENST00000557365.1_3'UTR|APEX1_ENST00000398030.4_Frame_Shift_Ins_p.K227fs|APEX1_ENST00000555414.1_Frame_Shift_Ins_p.K227fs|OSGEP_ENST00000206542.4_5'Flank|OSGEP_ENST00000556252.1_5'Flank|APEX1_ENST00000557054.1_3'UTR	NM_001244249.1|NM_001641.3	NP_001231178.1|NP_001632.2	P27695	APEX1_HUMAN	APEX nuclease (multifunctional DNA repair enzyme) 1	227					aging (GO:0007568)|base-excision repair (GO:0006284)|cell redox homeostasis (GO:0045454)|cellular response to cAMP (GO:0071320)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to peptide hormone stimulus (GO:0071375)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA catabolic process, exonucleolytic (GO:0000738)|DNA demethylation (GO:0080111)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|negative regulation of smooth muscle cell migration (GO:0014912)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|oxidation-reduction process (GO:0055114)|positive regulation of DNA repair (GO:0045739)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|regulation of mRNA stability (GO:0043488)|regulation of transcription, DNA-templated (GO:0006355)|response to drug (GO:0042493)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|mitochondrion (GO:0005739)|nuclear speck (GO:0016607)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|ribosome (GO:0005840)|transcription factor complex (GO:0005667)	3'-5' exonuclease activity (GO:0008408)|chromatin DNA binding (GO:0031490)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|DNA-(apurinic or apyrimidinic site) lyase activity (GO:0003906)|double-stranded DNA 3'-5' exodeoxyribonuclease activity (GO:0008311)|endodeoxyribonuclease activity (GO:0004520)|endonuclease activity (GO:0004519)|metal ion binding (GO:0046872)|oxidoreductase activity (GO:0016491)|phosphodiesterase I activity (GO:0004528)|phosphoric diester hydrolase activity (GO:0008081)|poly(A) RNA binding (GO:0044822)|RNA-DNA hybrid ribonuclease activity (GO:0004523)|site-specific endodeoxyribonuclease activity, specific for altered base (GO:0016890)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|uracil DNA N-glycosylase activity (GO:0004844)			breast(2)|endometrium(1)|large_intestine(4)|ovary(2)	9	all_cancers(95;0.00123)	all_lung(585;0.235)	Epithelial(56;1.09e-07)|all cancers(55;1.19e-06)	GBM - Glioblastoma multiforme(265;0.0224)|READ - Rectum adenocarcinoma(17;0.193)	Lucanthone(DB04967)	CCAAGGGGAACAAAAAGAATGC	0.554								Other BER factors																													p.N226fs		.	.											.	APEX1	.	.	0			c.678_679insA						.																																			SO:0001589	frameshift_variant	328	exon5			.	X59764	CCDS9550.1	14q11.2	2008-02-05	2002-09-11	2002-09-13	ENSG00000100823	ENSG00000100823	4.2.99.18		587	protein-coding gene	gene with protein product		107748	"""APEX nuclease (multifunctional DNA repair enzyme)"""	APEX			Standard	NM_001641		Approved	APE, REF1, HAP1, APX, APEN, REF-1, APE-1	uc021rnr.1	P27695	OTTHUMG00000029544	ENST00000216714.3:c.683dupA	14.37:g.20925393_20925393dupA	ENSP00000216714:p.Lys227fs	206.0	0.0		169.0	12.0	NM_080648	Q969L5|Q99775	Frame_Shift_Ins	INS	ENST00000216714.3	37	CCDS9550.1																																																																																			.	.		0.554	APEX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000073641.3	NM_001641	
DDX3X	1654	hgsc.bcm.edu	37	X	41205635	41205636	+	Frame_Shift_Ins	INS	-	-	A			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chrX:41205635_41205636insA	ENST00000399959.2	+	13	2324_2325	c.1469_1470insA	c.(1468-1473)ggaaaafs	p.GK490fs	RN7SL15P_ENST00000582825.1_RNA|DDX3X_ENST00000542215.1_3'UTR|DDX3X_ENST00000441189.2_Intron|DDX3X_ENST00000457138.2_Frame_Shift_Ins_p.GK474fs|DDX3X_ENST00000478993.1_3'UTR	NM_001193416.1|NM_001193417.1|NM_001356.3	NP_001180345.1|NP_001180346.1|NP_001347.3	O00571	DDX3X_HUMAN	DEAD (Asp-Glu-Ala-Asp) box helicase 3, X-linked	490	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.|Interaction with GSK3B.|Necessary for interaction with XPO1.				ATP catabolic process (GO:0006200)|cellular response to arsenic-containing substance (GO:0071243)|cellular response to osmotic stress (GO:0071470)|chromosome segregation (GO:0007059)|DNA duplex unwinding (GO:0032508)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|intrinsic apoptotic signaling pathway (GO:0097193)|mature ribosome assembly (GO:0042256)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|negative regulation of protein complex assembly (GO:0031333)|negative regulation of translation (GO:0017148)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell growth (GO:0030307)|positive regulation of chemokine (C-C motif) ligand 5 production (GO:0071651)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of translation (GO:0045727)|positive regulation of translational initiation (GO:0045948)|response to virus (GO:0009615)|RNA secondary structure unwinding (GO:0010501)|stress granule assembly (GO:0034063)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|extracellular vesicular exosome (GO:0070062)|mitochondrial outer membrane (GO:0005741)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|ATP-dependent RNA helicase activity (GO:0004004)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|eukaryotic initiation factor 4E binding (GO:0008190)|mRNA 5'-UTR binding (GO:0048027)|poly(A) binding (GO:0008143)|poly(A) RNA binding (GO:0044822)|ribosomal small subunit binding (GO:0043024)|RNA binding (GO:0003723)|RNA stem-loop binding (GO:0035613)|transcription factor binding (GO:0008134)|translation initiation factor binding (GO:0031369)			NS(3)|breast(8)|central_nervous_system(36)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(3)|lung(7)|ovary(2)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(4)|urinary_tract(1)	84						TTCCGCTCAGGAAAAAGCCCAA	0.411										HNSCC(61;0.18)																											p.G490fs		.	.											.	DDX3X	.	.	0			c.1469_1470insA						.																																			SO:0001589	frameshift_variant	1654	exon13			.	U50553	CCDS43931.1, CCDS55404.1	Xp11.3-p11.23	2013-07-16	2013-07-16	2003-06-20	ENSG00000215301	ENSG00000215301		"""DEAD-boxes"""	2745	protein-coding gene	gene with protein product		300160	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 3"", ""DEAD (Asp-Glu-Ala-Asp) box polypeptide 3, X-linked"""	DDX3		9381176, 9730595	Standard	NM_001193416		Approved	DBX, HLP2, DDX14	uc004dfe.3	O00571	OTTHUMG00000021369	ENST00000399959.2:c.1474dupA	X.37:g.41205640_41205640dupA	ENSP00000382840:p.Gly490fs	153.0	0.0		177.0	11.0	NM_001193416	A8K538|B4E3E8|O15536	Frame_Shift_Ins	INS	ENST00000399959.2	37	CCDS43931.1																																																																																			.	.		0.411	DDX3X-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056253.1	NM_024005	
GP6	51206	hgsc.bcm.edu	37	19	55539031	55539040	+	Frame_Shift_Del	DEL	GCTGTGGGCG	GCTGTGGGCG	-	rs387906919|rs367907292		TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	GCTGTGGGCG	GCTGTGGGCG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr19:55539031_55539040delGCTGTGGGCG	ENST00000417454.1	-	4	543_552	c.516_525delCGCCCACAGC	c.(514-525)gccgcccacagcfs	p.AAHS172fs	CTC-550B14.7_ENST00000593060.1_RNA|GP6_ENST00000310373.3_Frame_Shift_Del_p.AAHS172fs|CTC-550B14.7_ENST00000586845.1_RNA|CTC-550B14.7_ENST00000586961.1_RNA|CTC-550B14.6_ENST00000585492.1_RNA|GP6_ENST00000333884.2_Frame_Shift_Del_p.AAHS172fs	NM_016363.4	NP_057447	Q9HCN6	GPVI_HUMAN	glycoprotein VI (platelet)	172	Ig-like C2-type 2.				blood coagulation (GO:0007596)|enzyme linked receptor protein signaling pathway (GO:0007167)|leukocyte migration (GO:0050900)|platelet activation (GO:0030168)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|tetraspanin-enriched microdomain (GO:0097197)	collagen binding (GO:0005518)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)			NS(2)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(6)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	19			BRCA - Breast invasive adenocarcinoma(297;0.156)	GBM - Glioblastoma multiforme(193;0.0515)		GGTAGGTTCCGCTGTGGGCGGCGGTCACCG	0.59																																					p.173_176del		.	.											.	GP6	.	.	0			c.517_526del						.																																			SO:0001589	frameshift_variant	51206	exon4			.	AB035073	CCDS42626.1, CCDS46184.1, CCDS58678.1	19q13.4	2013-01-29			ENSG00000088053	ENSG00000088053		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	14388	protein-coding gene	gene with protein product		605546				11027634	Standard	NM_001083899		Approved	GPVI	uc002qil.3	Q9HCN6	OTTHUMG00000159709	ENST00000417454.1:c.516_525delCGCCCACAGC	19.37:g.55539031_55539040delGCTGTGGGCG	ENSP00000394922:p.Ala172fs	108.0	0.0		82.0	11.0	NM_016363	Q9HCN7|Q9UIF2	Frame_Shift_Del	DEL	ENST00000417454.1	37	CCDS46184.1																																																																																			.	.		0.590	GP6-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000357006.1		
JAK2	3717	hgsc.bcm.edu	37	9	5069192	5069193	+	Frame_Shift_Ins	INS	-	-	C			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr9:5069192_5069193insC	ENST00000381652.3	+	11	1991_1992	c.1497_1498insC	c.(1498-1500)cccfs	p.P500fs	JAK2_ENST00000544510.1_Frame_Shift_Ins_p.P351fs|JAK2_ENST00000539801.1_Frame_Shift_Ins_p.P500fs	NM_004972.3	NP_004963.1	O60674	JAK2_HUMAN	Janus kinase 2	500					actin filament polymerization (GO:0030041)|activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of cysteine-type endopeptidase activity involved in apoptotic signaling pathway (GO:0097296)|activation of JAK2 kinase activity (GO:0042977)|activation of MAPKK activity (GO:0000186)|apoptotic process (GO:0006915)|axon regeneration (GO:0031103)|blood coagulation (GO:0007596)|cell differentiation (GO:0030154)|cellular component movement (GO:0006928)|cytokine-mediated signaling pathway (GO:0019221)|enzyme linked receptor protein signaling pathway (GO:0007167)|erythrocyte differentiation (GO:0030218)|extrinsic apoptotic signaling pathway (GO:0097191)|G-protein coupled receptor signaling pathway (GO:0007186)|growth hormone receptor signaling pathway (GO:0060396)|histone H3-Y41 phosphorylation (GO:0035409)|hormone-mediated signaling pathway (GO:0009755)|host programmed cell death induced by symbiont (GO:0034050)|interferon-gamma-mediated signaling pathway (GO:0060333)|interleukin-12-mediated signaling pathway (GO:0035722)|intracellular signal transduction (GO:0035556)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|JAK-STAT cascade (GO:0007259)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|mammary gland epithelium development (GO:0061180)|mesoderm development (GO:0007498)|mineralocorticoid receptor signaling pathway (GO:0031959)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of DNA binding (GO:0043392)|negative regulation of heart contraction (GO:0045822)|negative regulation of neuron apoptotic process (GO:0043524)|peptidyl-tyrosine phosphorylation (GO:0018108)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell activation (GO:0050867)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of DNA binding (GO:0043388)|positive regulation of growth hormone receptor signaling pathway (GO:0060399)|positive regulation of inflammatory response (GO:0050729)|positive regulation of insulin secretion (GO:0032024)|positive regulation of interleukin-1 beta production (GO:0032731)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phosphoprotein phosphatase activity (GO:0032516)|positive regulation of protein import into nucleus, translocation (GO:0033160)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of inflammatory response (GO:0050727)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|response to antibiotic (GO:0046677)|response to hydroperoxide (GO:0033194)|response to interleukin-12 (GO:0070671)|response to lipopolysaccharide (GO:0032496)|response to tumor necrosis factor (GO:0034612)|signal transduction (GO:0007165)|STAT protein import into nucleus (GO:0007262)|tumor necrosis factor-mediated signaling pathway (GO:0033209)|tyrosine phosphorylation of STAT protein (GO:0007260)|tyrosine phosphorylation of Stat1 protein (GO:0042508)|tyrosine phosphorylation of Stat3 protein (GO:0042503)|tyrosine phosphorylation of Stat5 protein (GO:0042506)	caveola (GO:0005901)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|endosome lumen (GO:0031904)|membrane raft (GO:0045121)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)	ATP binding (GO:0005524)|growth hormone receptor binding (GO:0005131)|heme binding (GO:0020037)|histone binding (GO:0042393)|histone kinase activity (H3-Y41 specific) (GO:0035401)|interleukin-12 receptor binding (GO:0005143)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|protein tyrosine kinase activity (GO:0004713)|receptor binding (GO:0005102)|SH2 domain binding (GO:0042169)		BCR/JAK2(6)|SSBP2/JAK2(4)|SEC31A/JAK2(4)|ETV6/JAK2(11)|PCM1/JAK2(30)|PAX5/JAK2(18)	breast(5)|endometrium(4)|haematopoietic_and_lymphoid_tissue(32944)|kidney(4)|large_intestine(10)|liver(1)|lung(20)|ovary(3)|prostate(4)|skin(2)|urinary_tract(1)	32998	all_hematologic(13;0.137)	Acute lymphoblastic leukemia(23;0.0198)|Breast(48;0.147)		GBM - Glioblastoma multiforme(50;0.0237)|Lung(218;0.133)	Ruxolitinib(DB08877)|Tofacitinib(DB08895)	CTAAATGCTGTCCCCCAAAGCC	0.337		1	"""T, Mis, O"""	"""ETV6, PCM1, BCR"""	"""ALL, AML, MPD,  CML"""				Polycythemia Vera, Familial																												p.C499fs		.	.		Dom	yes		9	9p24	3717	Janus kinase 2		L	.	JAK2	.	.	0			c.1497_1498insC						.																																			SO:0001589	frameshift_variant	3717	exon11	Familial Cancer Database		.		CCDS6457.1	9p24	2014-09-17	2009-04-23		ENSG00000096968	ENSG00000096968	2.7.10.1	"""SH2 domain containing"""	6192	protein-coding gene	gene with protein product		147796				1848670	Standard	NM_004972		Approved	JTK10	uc003ziw.3	O60674	OTTHUMG00000019490	ENST00000381652.3:c.1502dupC	9.37:g.5069197_5069197dupC	ENSP00000371067:p.Pro500fs	195.0	0.0		178.0	12.0	NM_004972	O14636|O75297	Frame_Shift_Ins	INS	ENST00000381652.3	37	CCDS6457.1																																																																																			.	.		0.337	JAK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051609.1		
PCNT	5116	hgsc.bcm.edu	37	21	47819683	47819684	+	Frame_Shift_Ins	INS	-	-	A			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr21:47819683_47819684insA	ENST00000359568.5	+	25	4871_4872	c.4764_4765insA	c.(4765-4767)aaafs	p.K1589fs	PCNT_ENST00000480896.1_3'UTR	NM_006031.5	NP_006022.3	O95613	PCNT_HUMAN	pericentrin	1589					brain morphogenesis (GO:0048854)|cerebellar cortex morphogenesis (GO:0021696)|cilium assembly (GO:0042384)|G2/M transition of mitotic cell cycle (GO:0000086)|in utero embryonic development (GO:0001701)|limb morphogenesis (GO:0035108)|microtubule cytoskeleton organization (GO:0000226)|mitotic cell cycle (GO:0000278)|multicellular organism growth (GO:0035264)|negative regulation of apoptotic process (GO:0043066)|neural precursor cell proliferation (GO:0061351)|neuron migration (GO:0001764)|olfactory bulb development (GO:0021772)|positive regulation of intracellular protein transport (GO:0090316)|spindle organization (GO:0007051)	centriolar satellite (GO:0034451)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intercellular bridge (GO:0045171)|membrane (GO:0016020)|microtubule (GO:0005874)|motile cilium (GO:0031514)|pericentriolar material (GO:0000242)				NS(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(15)|liver(2)|lung(41)|ovary(5)|pancreas(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	104	Breast(49;0.112)					TGGAAAAACAGAAAAACATCGT	0.49																																					p.Q1588fs		.	.											.	PCNT	.	.	0			c.4764_4765insA						.																																			SO:0001589	frameshift_variant	5116	exon25			.	AB007862	CCDS33592.1	21q22.3	2014-02-20	2008-01-30	2005-11-03	ENSG00000160299	ENSG00000160299			16068	protein-coding gene	gene with protein product	"""kendrin"", ""Seckel syndrome 4"""	605925	"""pericentrin 2 (kendrin)"""	PCNT2		8812505, 9455477	Standard	NM_006031		Approved	KEN, KIAA0402, PCN, PCNTB, SCKL4	uc002zji.4	O95613	OTTHUMG00000090665	ENST00000359568.5:c.4769dupA	21.37:g.47819688_47819688dupA	ENSP00000352572:p.Lys1589fs	237.0	0.0		207.0	13.0	NM_006031	O43152|Q7Z7C9	Frame_Shift_Ins	INS	ENST00000359568.5	37	CCDS33592.1																																																																																			.	.		0.490	PCNT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207336.1	NM_006031	
RP1	6101	hgsc.bcm.edu	37	8	55542461	55542462	+	Frame_Shift_Ins	INS	-	-	A			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr8:55542461_55542462insA	ENST00000220676.1	+	4	6167_6168	c.6019_6020insA	c.(6019-6021)caafs	p.Q2007fs		NM_006269.1	NP_006260.1	P56715	RP1_HUMAN	retinitis pigmentosa 1 (autosomal dominant)	2007					axoneme assembly (GO:0035082)|cellular response to light stimulus (GO:0071482)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|photoreceptor cell outer segment organization (GO:0035845)|phototransduction, visible light (GO:0007603)|retinal cone cell development (GO:0046549)|retinal rod cell development (GO:0046548)|visual perception (GO:0007601)	axoneme (GO:0005930)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|photoreceptor connecting cilium (GO:0032391)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)	microtubule binding (GO:0008017)			NS(4)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(29)|lung(69)|ovary(6)|pancreas(1)|prostate(9)|skin(17)|upper_aerodigestive_tract(3)|urinary_tract(2)	169		all_lung(136;0.0831)|Lung NSC(129;0.109)|all_epithelial(80;0.123)	OV - Ovarian serous cystadenocarcinoma(7;4.4e-07)|Epithelial(17;3.37e-05)|all cancers(17;0.000285)			AAGAAGAAAACAAAAAAGAATT	0.302																																					p.Q2007fs	Colon(91;1014 1389 7634 14542 40420)	.	.											.	RP1	.	.	0			c.6019_6020insA						.																																			SO:0001589	frameshift_variant	6101	exon4			.	AF146592	CCDS6160.1	8q12.1	2013-01-08				ENSG00000104237			10263	protein-coding gene	gene with protein product		603937				1783394	Standard	NM_006269		Approved	DCDC4A	uc003xsd.1	P56715		ENST00000220676.1:c.6025dupA	8.37:g.55542467_55542467dupA	ENSP00000220676:p.Gln2007fs	208.0	0.0		188.0	13.0	NM_006269		Frame_Shift_Ins	INS	ENST00000220676.1	37	CCDS6160.1																																																																																			.	.		0.302	RP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378532.2	NM_006269	
PLCH1	23007	hgsc.bcm.edu	37	3	155200477	155200478	+	Frame_Shift_Ins	INS	-	-	T			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr3:155200477_155200478insT	ENST00000340059.7	-	23	3360_3361	c.3361_3362insA	c.(3361-3363)agcfs	p.S1121fs	PLCH1_ENST00000414191.1_Frame_Shift_Ins_p.S1083fs|PLCH1_ENST00000334686.6_Frame_Shift_Ins_p.S1083fs|PLCH1_ENST00000447496.2_3'UTR|PLCH1_ENST00000494598.1_Intron|PLCH1_ENST00000460012.1_Frame_Shift_Ins_p.S1083fs	NM_001130960.1	NP_001124432.1	Q4KWH8	PLCH1_HUMAN	phospholipase C, eta 1	1121					inositol phosphate metabolic process (GO:0043647)|lipid catabolic process (GO:0016042)|phosphatidylinositol-mediated signaling (GO:0048015)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|calcium-dependent phospholipase C activity (GO:0050429)|phosphatidylinositol phospholipase C activity (GO:0004435)|signal transducer activity (GO:0004871)			NS(3)|breast(3)|endometrium(9)|kidney(4)|large_intestine(20)|lung(45)|ovary(2)|prostate(5)|skin(8)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(4)	107			Lung(72;0.11)|LUSC - Lung squamous cell carcinoma(72;0.114)			TGACAAGATGCTTTTCCCTTCC	0.46																																					p.S1121fs		.	.											.	PLCH1	.	.	0			c.3362_3363insA						.																																			SO:0001589	frameshift_variant	23007	exon23			.	AB028992	CCDS33881.1, CCDS46939.1, CCDS46940.1	3q25	2013-01-10	2006-03-16	2006-03-16	ENSG00000114805	ENSG00000114805	3.1.4.11	"""EF-hand domain containing"""	29185	protein-coding gene	gene with protein product		612835	"""phospholipase C-like 3"""	PLCL3		15702972	Standard	NM_014996		Approved	KIAA1069, MGC117152, DKFZp434C1372, PLCeta1	uc021xge.1	Q4KWH8	OTTHUMG00000158477	ENST00000340059.7:c.3362dupA	3.37:g.155200481_155200481dupT	ENSP00000345988:p.Ser1121fs	210.0	0.0		183.0	11.0	NM_001130960	Q29RV9|Q4KWH9|Q68CN0|Q86XK4|Q9H9U2|Q9UPT3	Frame_Shift_Ins	INS	ENST00000340059.7	37	CCDS46939.1																																																																																			.	.		0.460	PLCH1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000351125.1	NM_014996	
KCNN3	3782	hgsc.bcm.edu	37	1	154842187	154842188	+	Frame_Shift_Ins	INS	-	-	G	rs372000131		TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr1:154842187_154842188insG	ENST00000271915.4	-	1	568_569	c.253_254insC	c.(253-255)ctgfs	p.L85fs	KCNN3_ENST00000358505.2_5'Flank	NM_001204087.1|NM_002249.5	NP_001191016.1|NP_002240.3	Q9UGI6	KCNN3_HUMAN	potassium intermediate/small conductance calcium-activated channel, subfamily N, member 3	90	Gln-rich.		Missing.		potassium ion transmembrane transport (GO:0071805)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	calmodulin binding (GO:0005516)|small conductance calcium-activated potassium channel activity (GO:0016286)			cervix(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(11)|prostate(4)|skin(1)	28	all_lung(78;2.29e-27)|all_hematologic(923;0.088)|Hepatocellular(266;0.108)|all_neural(408;0.245)		BRCA - Breast invasive adenocarcinoma(34;0.00819)		Miconazole(DB01110)|Procaine(DB00721)	GAGCTGAGACAGGGGATGCGGT	0.693																																					p.L85fs		.	.											.	KCNN3	.	.	0			c.254_255insC						.																																			SO:0001589	frameshift_variant	3782	exon1			.	AF031815	CCDS1072.1, CCDS30880.1, CCDS72928.1	1q21.3	2012-07-05			ENSG00000143603	ENSG00000143603		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	6292	protein-coding gene	gene with protein product		602983				9491810, 16382103	Standard	NM_002249		Approved	KCa2.3, hSK3, SKCA3	uc021pah.1	Q9UGI6	OTTHUMG00000037260	ENST00000271915.4:c.254dupC	1.37:g.154842191_154842191dupG	ENSP00000271915:p.Leu85fs	66.0	0.0		149.0	10.0	NM_001204087	B1ANX0|O43517|Q86VF9|Q8WXG7	Frame_Shift_Ins	INS	ENST00000271915.4	37	CCDS30880.1																																																																																			.	.		0.693	KCNN3-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090688.3	NM_002249	
LINC00283	100874057	hgsc.bcm.edu	37	13	103396690	103396691	+	RNA	INS	-	-	T			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr13:103396690_103396691insT	ENST00000430111.1	+	0	1063_1064									long intergenic non-protein coding RNA 283																		CTGTTTGTAAGTTTTTTTGATT	0.361																																					p.N2119fs		.	.											.	.	.	.	0			c.6357_6358insA						.																																					643677	exon4			.			13q33.1	2012-10-12	2011-08-10	2011-08-10	ENSG00000231633	ENSG00000231633		"""Long non-coding RNAs"""	38809	non-coding RNA	RNA, long non-coding			"""non-protein coding RNA 283"""	NCRNA00283			Standard			Approved				OTTHUMG00000017311		13.37:g.103396697_103396697dupT		177.0	0.0		155.0	10.0	NM_001146197		Frame_Shift_Ins	INS	ENST00000430111.1	37																																																																																				.	.		0.361	LINC00283-001	KNOWN	not_organism_supported|basic	antisense	antisense	OTTHUMT00000045714.1		
PRAMEF9	343070	hgsc.bcm.edu	37	1	13427643	13427644	+	Frame_Shift_Ins	INS	-	-	A			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr1:13427643_13427644insA	ENST00000376152.1	+	4	1315_1316	c.1221_1222insA	c.(1222-1224)aaafs	p.K408fs	RP11-219C24.10_ENST00000432559.2_lincRNA	NM_001010890.1	NP_001010890.1	Q5VWM5	PRAM9_HUMAN	PRAME family member 9	408					negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)							Ovarian(185;0.249)	Lung NSC(185;3.67e-05)|all_lung(284;4.03e-05)|Renal(390;0.000147)|Breast(348;0.000278)|Colorectal(325;0.00058)|Ovarian(437;0.00965)|Hepatocellular(190;0.0245)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;4.88e-06)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|COAD - Colon adenocarcinoma(227;0.000241)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		CAATCATACTCAAAAACTTATG	0.52																																					p.L407fs		.	.											.	.	.	.	0			c.1221_1222insA						.																																			SO:0001589	frameshift_variant	343070	exon4			.	AK124292		1p36.21	2013-01-17			ENSG00000204501	ENSG00000204501		"""-"""	27996	protein-coding gene	gene with protein product							Standard	NM_001010890		Approved		uc001auw.1	Q5VWM5	OTTHUMG00000008035	ENST00000376152.1:c.1226dupA	1.37:g.13427648_13427648dupA	ENSP00000365322:p.Lys408fs	233.0	0.0		133.0	10.0	NM_001010890	B2RPE1|Q08EQ1	Frame_Shift_Ins	INS	ENST00000376152.1	37	CCDS30598.1																																																																																			.	.		0.520	PRAMEF9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022041.1	NM_001010890	
ARHGAP32	9743	hgsc.bcm.edu	37	11	128842442	128842443	+	Frame_Shift_Ins	INS	-	-	G			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr11:128842442_128842443insG	ENST00000310343.9	-	21	3915_3916	c.3916_3917insC	c.(3916-3918)cttfs	p.L1306fs	ARHGAP32_ENST00000392657.3_Frame_Shift_Ins_p.L957fs|ARHGAP32_ENST00000527272.1_Frame_Shift_Ins_p.L957fs|ARHGAP32_ENST00000524655.1_3'UTR	NM_001142685.1	NP_001136157.1	A7KAX9	RHG32_HUMAN	Rho GTPase activating protein 32	1306	Poly-Pro.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell projection (GO:0042995)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|postsynaptic membrane (GO:0045211)	GTPase activator activity (GO:0005096)|phosphatidylinositol binding (GO:0035091)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(12)|lung(28)|ovary(3)|prostate(6)|urinary_tract(3)	60						CGGAGGGGGAAGGGGACGATTA	0.53																																					p.L1306fs		.	.											.	ARHGAP32	.	.	0			c.3917_3918insC						.																																			SO:0001589	frameshift_variant	9743	exon21			.	AB018255	CCDS31718.1, CCDS44769.1	11q24.3	2011-06-29			ENSG00000134909	ENSG00000134909		"""Rho GTPase activating proteins"""	17399	protein-coding gene	gene with protein product		608541				12446789, 12819203, 17663722	Standard	NM_014715		Approved	GRIT, KIAA0712, MGC1892, RICS, GC-GAP	uc009zcp.3	A7KAX9	OTTHUMG00000165774	ENST00000310343.9:c.3917dupC	11.37:g.128842446_128842446dupG	ENSP00000310561:p.Leu1306fs	227.0	0.0		169.0	10.0	NM_001142685	I7H0B0|O94820|Q86YL6|Q8IUG4|Q9BWG3	Frame_Shift_Ins	INS	ENST00000310343.9	37	CCDS44769.1																																																																																			.	.		0.530	ARHGAP32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386151.3	NM_014715	
SLC38A10	124565	hgsc.bcm.edu	37	17	79226065	79226066	+	Frame_Shift_Ins	INS	-	-	T			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr17:79226065_79226066insT	ENST00000374759.3	-	13	2257_2258	c.1874_1875insA	c.(1873-1875)aagfs	p.K625fs	SLC38A10_ENST00000288439.5_Frame_Shift_Ins_p.K625fs	NM_001037984.1	NP_001033073.1	Q9HBR0	S38AA_HUMAN	solute carrier family 38, member 10	625					amino acid transport (GO:0006865)|bone development (GO:0060348)|sodium ion transport (GO:0006814)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)				NS(1)|breast(2)|endometrium(4)|kidney(2)|large_intestine(2)|lung(7)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	23	all_neural(118;0.0804)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0272)|OV - Ovarian serous cystadenocarcinoma(97;0.117)			CCCCCTTGGCCTTTTCCCCTCC	0.708																																					p.K625fs		.	.											.	SLC38A10	.	.	0			c.1875_1876insA						.																																			SO:0001589	frameshift_variant	124565	exon13			.	BC014642	CCDS11780.1, CCDS42397.1	17q25.3	2013-05-22			ENSG00000157637	ENSG00000157637		"""Solute carriers"""	28237	protein-coding gene	gene with protein product							Standard	XM_005257019		Approved	MGC15523, PP1744	uc002jzz.1	Q9HBR0	OTTHUMG00000168049	ENST00000374759.3:c.1875dupA	17.37:g.79226069_79226069dupT	ENSP00000363891:p.Lys625fs	114.0	0.0		132.0	11.0	NM_001037984	Q6ZRC5|Q8NA99|Q96C66	Frame_Shift_Ins	INS	ENST00000374759.3	37	CCDS42397.1																																																																																			.	.		0.708	SLC38A10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000397747.1	NM_138570	
ADH1A	124	hgsc.bcm.edu	37	4	100205756	100205757	+	Frame_Shift_Ins	INS	-	-	C			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr4:100205756_100205757insC	ENST00000209668.2	-	5	479_480	c.366_367insG	c.(364-369)gggaccfs	p.T123fs	RP11-696N14.1_ENST00000500358.2_RNA|ADH1A_ENST00000511656.1_5'Flank	NM_000667.3	NP_000658.1	P07327	ADH1A_HUMAN	alcohol dehydrogenase 1A (class I), alpha polypeptide	123					alcohol metabolic process (GO:0006066)|drug metabolic process (GO:0017144)|ethanol oxidation (GO:0006069)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	alcohol dehydrogenase (NAD) activity (GO:0004022)|alcohol dehydrogenase activity, zinc-dependent (GO:0004024)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(2)|large_intestine(3)|lung(11)|ovary(1)|prostate(1)|skin(4)|stomach(1)	25				OV - Ovarian serous cystadenocarcinoma(123;9.56e-08)	Ethanol(DB00898)|Fomepizole(DB01213)	TCCTGCAGGGTCCCCTGAGGAT	0.515																																					p.T123fs		.	.											.	ADH1A	.	.	0			c.367_368insG						.																																			SO:0001589	frameshift_variant	124	exon5			.	M12963	CCDS3648.1	4q23	2009-12-04			ENSG00000187758	ENSG00000187758	1.1.1.1	"""Alcohol dehydrogenases"""	249	protein-coding gene	gene with protein product		103700		ADH1		3006456	Standard	NM_000667		Approved		uc003hur.2	P07327	OTTHUMG00000131026	ENST00000209668.2:c.367dupG	4.37:g.100205760_100205760dupC	ENSP00000209668:p.Thr123fs	210.0	0.0		181.0	11.0	NM_000667	A8K3E3|Q17R68	Frame_Shift_Ins	INS	ENST00000209668.2	37	CCDS3648.1																																																																																			.	.		0.515	ADH1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253669.1	NM_000667	
TCP10	6953	hgsc.bcm.edu	37	6	167790069	167790070	+	Frame_Shift_Ins	INS	-	-	G	rs75579977	byFrequency	TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr6:167790069_167790070insG	ENST00000397829.4	-	5	707_708	c.540_541insC	c.(538-543)cccggtfs	p.G181fs	TCP10_ENST00000366827.2_Frame_Shift_Ins_p.G181fs	NM_004610.3	NP_004601.3	Q12799	TCP10_HUMAN	t-complex 10	208						cytosol (GO:0005829)		p.G181S(2)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(5)|large_intestine(2)|lung(6)	18		Breast(66;1.53e-05)|Ovarian(120;0.024)		OV - Ovarian serous cystadenocarcinoma(33;4.05e-20)|BRCA - Breast invasive adenocarcinoma(81;1.1e-06)|GBM - Glioblastoma multiforme(31;0.0386)		CTTTCTGCACCGGGAGTCGGCC	0.53																																					p.G181fs		.	.											.	TCP10	.	.	2	Substitution - Missense(2)	NS(1)|endometrium(1)	c.541_542insC						.																																			SO:0001589	frameshift_variant	6953	exon5			.	U03399	CCDS43527.1	6q27	2012-09-20	2012-09-20		ENSG00000203690	ENSG00000203690			11656	protein-coding gene	gene with protein product		187020	"""t-complex 10 (a murine tcp homolog)"", ""t-complex 10 (mouse)"", ""t-complex 10 homolog (mouse)"""			8111376	Standard	NM_004610		Approved		uc003qvv.1	Q12799	OTTHUMG00000016026	ENST00000397829.4:c.541dupC	6.37:g.167790072_167790072dupG	ENSP00000380929:p.Gly181fs	294.0	0.0		336.0	22.0	NM_004610	Q5JR60|Q6P4F4	Frame_Shift_Ins	INS	ENST00000397829.4	37	CCDS43527.1																																																																																			.	.		0.530	TCP10-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000365570.1	NM_004610	
IL6R	3570	hgsc.bcm.edu	37	1	154437759	154437760	+	Frame_Shift_Ins	INS	-	-	G			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr1:154437759_154437760insG	ENST00000368485.3	+	10	1747_1748	c.1310_1311insG	c.(1309-1314)ctggggfs	p.LG437fs	IL6R_ENST00000507256.1_3'UTR|IL6R_ENST00000344086.4_3'UTR	NM_000565.3	NP_000556.1	P08887	IL6RA_HUMAN	interleukin 6 receptor	437					acute-phase response (GO:0006953)|ciliary neurotrophic factor-mediated signaling pathway (GO:0070120)|cytokine-mediated signaling pathway (GO:0019221)|defense response to Gram-negative bacterium (GO:0050829)|defense response to Gram-positive bacterium (GO:0050830)|endocrine pancreas development (GO:0031018)|extrinsic apoptotic signaling pathway (GO:0097191)|hepatic immune response (GO:0002384)|interleukin-6-mediated signaling pathway (GO:0070102)|monocyte chemotaxis (GO:0002548)|negative regulation of collagen biosynthetic process (GO:0032966)|negative regulation of interleukin-8 production (GO:0032717)|neutrophil mediated immunity (GO:0002446)|positive regulation of activation of Janus kinase activity (GO:0010536)|positive regulation of cell proliferation (GO:0008284)|positive regulation of chemokine production (GO:0032722)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of leukocyte chemotaxis (GO:0002690)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|response to cytokine (GO:0034097)	apical plasma membrane (GO:0016324)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|interleukin-6 receptor complex (GO:0005896)|plasma membrane (GO:0005886)	ciliary neurotrophic factor binding (GO:0070119)|cytokine receptor activity (GO:0004896)|enzyme binding (GO:0019899)|interleukin-6 binding (GO:0019981)|protein homodimerization activity (GO:0042803)		IL6R/ATP8B2(2)	breast(2)|large_intestine(1)|ovary(3)	6	all_lung(78;1.72e-29)|Lung NSC(65;2.96e-27)|Hepatocellular(266;0.0877)		LUSC - Lung squamous cell carcinoma(543;0.185)		Tocilizumab(DB06273)	CCCAGCAGCCTGGGGTCTGACA	0.604																																					p.L437fs		.	.											.	IL6R	.	.	0			c.1310_1311insG						.																																			SO:0001589	frameshift_variant	3570	exon10			.	X12830	CCDS1067.1, CCDS1068.1, CCDS72927.1	1q21	2013-01-11			ENSG00000160712	ENSG00000160712		"""Interleukins and interleukin receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6019	protein-coding gene	gene with protein product		147880					Standard	NM_000565		Approved	CD126	uc001fez.2	P08887	OTTHUMG00000036073	ENST00000368485.3:c.1314dupG	1.37:g.154437763_154437763dupG	ENSP00000357470:p.Leu437fs	158.0	0.0		172.0	11.0	NM_000565	A8KAE8|B2R6V4|Q16202|Q53EQ7|Q5FWG2|Q5VZ23	Frame_Shift_Ins	INS	ENST00000368485.3	37	CCDS1067.1																																																																																			.	.		0.604	IL6R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087911.1	NM_000565	
PDZD2	23037	hgsc.bcm.edu	37	5	32058103	32058104	+	Frame_Shift_Ins	INS	-	-	G			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr5:32058103_32058104insG	ENST00000438447.1	+	12	2482_2483	c.2094_2095insG	c.(2095-2097)gggfs	p.G699fs	PDZD2_ENST00000282493.3_Frame_Shift_Ins_p.G699fs			O15018	PDZD2_HUMAN	PDZ domain containing 2	699					cell adhesion (GO:0007155)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|nucleus (GO:0005634)				NS(2)|breast(4)|central_nervous_system(5)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(31)|lung(58)|ovary(6)|prostate(2)|skin(8)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	148						TCAATACCAGTGGGGGAGCCTC	0.569																																					p.S698fs		.	.											.	PDZD2	.	.	0			c.2094_2095insG						.																																			SO:0001589	frameshift_variant	23037	exon11			.	AB002298	CCDS34137.1	5p14.1	2008-02-05	2006-01-24	2006-01-24		ENSG00000133401			18486	protein-coding gene	gene with protein product		610697	"""PDZ domain containing 3"""	PDZK3		9205841	Standard	XM_005248271		Approved	KIAA0300	uc003jhm.3	O15018		ENST00000438447.1:c.2099dupG	5.37:g.32058108_32058108dupG	ENSP00000402033:p.Gly699fs	223.0	0.0		201.0	13.0	NM_178140	Q9BXD4	Frame_Shift_Ins	INS	ENST00000438447.1	37	CCDS34137.1																																																																																			.	.		0.569	PDZD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366608.1		
ARID2	196528	hgsc.bcm.edu	37	12	46246025	46246026	+	Frame_Shift_Ins	INS	-	-	A			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr12:46246025_46246026insA	ENST00000334344.6	+	15	4291_4292	c.4119_4120insA	c.(4120-4122)aaafs	p.K1374fs	ARID2_ENST00000479608.1_3'UTR|ARID2_ENST00000457135.1_5'Flank|ARID2_ENST00000422737.1_Frame_Shift_Ins_p.K1225fs|ARID2_ENST00000444670.1_Frame_Shift_Ins_p.K984fs	NM_152641.2	NP_689854.2	Q68CP9	ARID2_HUMAN	AT rich interactive domain 2 (ARID, RFX-like)	1374					chromatin modification (GO:0016568)|nucleosome disassembly (GO:0006337)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(3)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(21)|liver(20)|lung(34)|ovary(7)|pancreas(1)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	116	Lung SC(27;0.192)|Renal(347;0.236)	Lung NSC(34;0.106)|all_lung(34;0.22)	OV - Ovarian serous cystadenocarcinoma(5;0.00691)	GBM - Glioblastoma multiforme(48;0.0153)		CTCATTTAAGCAAAAACATTCC	0.351			"""N, S, F"""		hepatocellular carcinoma																																p.S1373fs		.	.		Rec	yes		12	12q12	196528	AT rich interactive domain 2		E	.	ARID2	.	.	0			c.4119_4120insA						.																																			SO:0001589	frameshift_variant	196528	exon15			.		CCDS31783.1	12q13.11	2013-02-07			ENSG00000189079	ENSG00000189079		"""-"""	18037	protein-coding gene	gene with protein product		609539					Standard	NM_152641		Approved	KIAA1557, DKFZp686G052, FLJ30619, BAF200	uc001ros.1	Q68CP9	OTTHUMG00000150487	ENST00000334344.6:c.4124dupA	12.37:g.46246030_46246030dupA	ENSP00000335044:p.Lys1374fs	165.0	0.0		198.0	12.0	NM_152641	Q15KG9|Q5EB51|Q645I3|Q6ZRY5|Q7Z3I5|Q86T28|Q96SJ6|Q9HCL5	Frame_Shift_Ins	INS	ENST00000334344.6	37	CCDS31783.1																																																																																			.	.		0.351	ARID2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318380.2	XM_350875	
LINC00283	100874057	hgsc.bcm.edu	37	13	103393521	103393522	+	RNA	INS	-	-	T			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr13:103393521_103393522insT	ENST00000430111.1	+	0	0									long intergenic non-protein coding RNA 283																		TTCATCCTCAATTTTTTTGAAA	0.297																																					p.L3176fs		.	.											.	.	.	.	0			c.9526_9527insA						.																																					643677	exon4			.			13q33.1	2012-10-12	2011-08-10	2011-08-10	ENSG00000231633	ENSG00000231633		"""Long non-coding RNAs"""	38809	non-coding RNA	RNA, long non-coding			"""non-protein coding RNA 283"""	NCRNA00283			Standard			Approved				OTTHUMG00000017311		13.37:g.103393528_103393528dupT		120.0	0.0		127.0	11.0	NM_001146197		Frame_Shift_Ins	INS	ENST00000430111.1	37																																																																																				.	.		0.297	LINC00283-001	KNOWN	not_organism_supported|basic	antisense	antisense	OTTHUMT00000045714.1		
EBLN2	55096	hgsc.bcm.edu	37	3	73111508	73111509	+	Frame_Shift_Ins	INS	-	-	C			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr3:73111508_73111509insC	ENST00000533473.1	+	1	699_700	c.276_277insC	c.(277-279)cccfs	p.P93fs	PPP4R2_ENST00000394284.3_Intron|PPP4R2_ENST00000295862.9_Intron|PPP4R2_ENST00000356692.5_Intron	NM_018029.3	NP_060499.3	Q6P2I7	EBLN2_HUMAN	endogenous Bornavirus-like nucleoprotein 2	93										endometrium(1)|large_intestine(3)|lung(1)|prostate(1)	6						ATGCATTGGAACCCCAACCCAG	0.48																																					p.E92fs		.	.											.	.	.	.	0			c.276_277insC						.																																			SO:0001589	frameshift_variant	55096	exon1			.		CCDS54608.1	3p13	2011-06-03			ENSG00000255423	ENSG00000255423			25493	protein-coding gene	gene with protein product	"""endogenous Borna-like N element 2"""	613250				20054395, 20686665	Standard	NM_018029		Approved		uc003dpj.3	Q6P2I7	OTTHUMG00000165897	ENST00000533473.1:c.280dupC	3.37:g.73111512_73111512dupC	ENSP00000432104:p.Pro93fs	151.0	0.0		148.0	10.0	NM_018029	Q8WWH3|Q9NW89	Frame_Shift_Ins	INS	ENST00000533473.1	37	CCDS54608.1																																																																																			.	.		0.480	EBLN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386932.1	NM_018029	
CBX4	8535	hgsc.bcm.edu	37	17	77808830	77808831	+	Frame_Shift_Ins	INS	-	-	C			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr17:77808830_77808831insC	ENST00000269397.4	-	5	787_788	c.610_611insG	c.(610-612)gccfs	p.A204fs		NM_003655.2	NP_003646.2	O00257	CBX4_HUMAN	chromobox homolog 4	204	Interaction with BMI1.				chromatin modification (GO:0016568)|negative regulation of apoptotic process (GO:0043066)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|protein sumoylation (GO:0016925)|transcription, DNA-templated (GO:0006351)	nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)	chromatin binding (GO:0003682)|enzyme binding (GO:0019899)|ligase activity (GO:0016874)|single-stranded RNA binding (GO:0003727)|SUMO binding (GO:0032183)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|cervix(1)|endometrium(1)|large_intestine(1)|lung(7)|ovary(1)|prostate(3)|skin(2)|urinary_tract(1)	18			OV - Ovarian serous cystadenocarcinoma(97;0.0102)|BRCA - Breast invasive adenocarcinoma(99;0.0224)			GTAGCCTTTGGCCCCCGCACCT	0.738											OREG0024799	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.A204fs		.	.											.	CBX4	.	.	0			c.611_612insG						.																																			SO:0001589	frameshift_variant	8535	exon5			.	AF013956	CCDS32758.1	17q25.3	2010-07-06	2010-06-24		ENSG00000141582	ENSG00000141582			1554	protein-coding gene	gene with protein product	"""NS5ATP1-binding protein 16"", ""Pc class 2 homolog (Drosophila)"""	603079	"""chromobox homolog 4 (Drosophila Pc class)"""			9315667	Standard	NM_003655		Approved	hPC2, PC2, NBP16	uc002jxe.3	O00257	OTTHUMG00000150415	ENST00000269397.4:c.611dupG	17.37:g.77808835_77808835dupC	ENSP00000269397:p.Ala204fs	78.0	0.0	1178	206.0	12.0	NM_003655	B1PJR7|Q6TPI8|Q96C04	Frame_Shift_Ins	INS	ENST00000269397.4	37	CCDS32758.1																																																																																			.	.		0.738	CBX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318007.1	NM_003655	
POTEM	641455	hgsc.bcm.edu	37	14	20019862	20019863	+	Frame_Shift_Ins	INS	-	-	A	rs564173388		TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr14:20019862_20019863insA	ENST00000551509.1	-	1	409_410	c.358_359insT	c.(358-360)tggfs	p.W120fs		NM_001145442.1	NP_001138914.1	A6NI47	POTEM_HUMAN	POTE ankyrin domain family, member M	120										endometrium(4)|kidney(1)|lung(4)	9						GTAGTCTCCCCAGGGGCCCACT	0.609																																					p.W120fs		.	.											.	.	.	.	0			c.359_360insT						.																																			SO:0001589	frameshift_variant	641455	exon1			.		CCDS73609.1	14q11.2	2013-01-10			ENSG00000187537	ENSG00000187537		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	37096	protein-coding gene	gene with protein product	"""prostate-specific P704P"""					16364570	Standard	NM_001145442		Approved	POTE14beta, P704P, ACT	uc001vwc.3	A6NI47		ENST00000551509.1:c.359dupT	14.37:g.20019863_20019863dupA	ENSP00000452296:p.Trp120fs	138.0	0.0		119.0	22.0	NM_001145442		Frame_Shift_Ins	INS	ENST00000551509.1	37	CCDS45076.1																																																																																			.	.		0.609	POTEM-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409490.3	NM_001145442	
FSIP2	401024	hgsc.bcm.edu	37	2	186673386	186673387	+	Frame_Shift_Ins	INS	-	-	A			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr2:186673386_186673387insA	ENST00000424728.1	+	17	19353_19354	c.19353_19354insA	c.(19354-19356)aaafs	p.K6452fs	FSIP2_ENST00000343098.5_Frame_Shift_Ins_p.K6541fs			Q5CZC0	FSIP2_HUMAN	fibrous sheath interacting protein 2	6452										NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(4)|kidney(1)|large_intestine(11)|lung(46)|pancreas(1)|urinary_tract(2)	69						CAGCCTTTCCTAAAAAAGTGGC	0.317																																					p.P6540fs		.	.											.	FSIP2	.	.	0			c.19620_19621insA						.																																			SO:0001589	frameshift_variant	401024	exon17			.	AK092099	CCDS54426.1	2q32.1	2010-06-18			ENSG00000188738	ENSG00000188738			21675	protein-coding gene	gene with protein product		615796				14702039	Standard	NM_173651		Approved	FLJ34780	uc002upl.3	Q5CZC0	OTTHUMG00000153874	ENST00000424728.1:c.19359dupA	2.37:g.186673392_186673392dupA	ENSP00000401306:p.Lys6452fs	132.0	0.0		167.0	11.0	NM_173651	Q53TL3|Q53TN5|Q5HYH2|Q6ZTZ5|Q6ZU14|Q6ZU21	Frame_Shift_Ins	INS	ENST00000424728.1	37																																																																																				.	.		0.317	FSIP2-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000332778.3	NM_173651	
MIR122	406906	hgsc.bcm.edu	37	18	56118310	56118312	+	lincRNA	DEL	AGC	AGC	-			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	AGC	AGC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr18:56118310_56118312delAGC	ENST00000590797.1	+	0	758				MIR122_ENST00000385044.1_RNA																							GAGTTTCCTTAGCAGAGCTGTGG	0.438																																					.		.	.											.	.	.	.	0			.						.																																					406906	.			.																													18.37:g.56118310_56118312delAGC		130.0	0.0		69.0	39.0	.		RNA	DEL	ENST00000590797.1	37																																																																																				.	.		0.438	RP11-1151B14.3-001	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000449120.1		
TRIM13	10206	hgsc.bcm.edu	37	13	50591338	50591339	+	3'UTR	INS	-	-	A			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr13:50591338_50591339insA	ENST00000378182.3	+	0	6000_6001				TRIM13_ENST00000478111.1_Intron|KCNRG_ENST00000360473.4_Intron|KCNRG_ENST00000312942.1_Intron	NM_001007278.1|NM_005798.3|NM_052811.2|NM_213590.1	NP_001007279.1|NP_005789.2|NP_434698.1|NP_998755.1	O60858	TRI13_HUMAN	tripartite motif containing 13						anatomical structure morphogenesis (GO:0009653)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|innate immune response (GO:0045087)|negative regulation of viral release from host cell (GO:1902187)|negative regulation of viral transcription (GO:0032897)|positive regulation of cell death (GO:0010942)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of macroautophagy (GO:0016239)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein autoubiquitination (GO:0051865)|response to gamma radiation (GO:0010332)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|perinuclear endoplasmic reticulum (GO:0097038)	ligase activity (GO:0016874)|signal transducer activity (GO:0004871)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			large_intestine(5)|lung(2)|ovary(2)|upper_aerodigestive_tract(1)	10		Acute lymphoblastic leukemia(7;3.41e-06)|Lung NSC(96;3.08e-05)|Breast(56;9.7e-05)|Prostate(109;0.00174)|Hepatocellular(98;0.0207)|Myeloproliferative disorder(33;0.163)|Lung SC(185;0.187)|all_neural(104;0.19)		GBM - Glioblastoma multiforme(99;1.53e-10)|COAD - Colon adenocarcinoma(199;0.205)		TAACAAAAATGAAATTTTTTTT	0.297																																					.		.	.											.	TRIM13	.	.	0			.						.																																			SO:0001624	3_prime_UTR_variant	10206	.			.	AF220127	CCDS9423.1, CCDS41888.1	13q14	2013-01-09	2011-01-25	2006-09-26	ENSG00000204977	ENSG00000204977		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	9976	protein-coding gene	gene with protein product		605661	"""ret finger protein 2"", ""tripartite motif-containing 13"""	RFP2		9599022	Standard	NM_213590		Approved	Leu5, RNF77, DLEU5	uc001vdp.1	O60858	OTTHUMG00000016926	ENST00000378182.3:c.*4039->A	13.37:g.50591341_50591341dupA		138.0	0.0		145.0	14.0	.	B2RB49|Q5UBW0|Q5W0U8|Q5W0U9|Q9BQ47|Q9C021	RNA	INS	ENST00000378182.3	37	CCDS9423.1																																																																																			.	.		0.297	TRIM13-005	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000354875.1	NM_001007278	
PRDX2	7001	hgsc.bcm.edu	37	19	12911099	12911100	+	Frame_Shift_Ins	INS	-	-	G	rs369634820|rs541050535		TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr19:12911099_12911100insG	ENST00000301522.2	-	4	399_400	c.271_272insC	c.(271-273)cggfs	p.R91fs	CTD-2659N19.10_ENST00000585496.1_RNA|PRDX2_ENST00000334482.5_Frame_Shift_Ins_p.R91fs	NM_005809.4	NP_005800.3	P32119	PRDX2_HUMAN	peroxiredoxin 2	91	Thioredoxin. {ECO:0000255|PROSITE- ProRule:PRU00691}.				cellular response to oxidative stress (GO:0034599)|hydrogen peroxide catabolic process (GO:0042744)|negative regulation of apoptotic process (GO:0043066)|negative regulation of neuron apoptotic process (GO:0043524)|regulation of apoptotic process (GO:0042981)|removal of superoxide radicals (GO:0019430)|response to oxidative stress (GO:0006979)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	antioxidant activity (GO:0016209)|thioredoxin peroxidase activity (GO:0008379)			endometrium(1)|large_intestine(1)|lung(1)|prostate(1)	4						TCCCTCTTTCCGGGGGGTGTTG	0.599																																					p.I91fs		.	.											.	PRDX2	.	.	0			c.272_273insC						.																																			SO:0001589	frameshift_variant	7001	exon4			.		CCDS12281.1	19p13.2	2008-07-17			ENSG00000167815	ENSG00000167815			9353	protein-coding gene	gene with protein product	"""thioredoxin-dependent peroxide reductase 1"", ""thiol-specific antioxidant 1"", ""natural killer-enhancing factor B"", ""thioredoxin peroxidase 1"", ""torin"""	600538		TDPX1		7607688	Standard	NM_005809		Approved	PRP, NKEFB, TSA, PRXII, PRX2, MGC4104	uc002mvd.4	P32119	OTTHUMG00000134285	ENST00000301522.2:c.272dupC	19.37:g.12911105_12911105dupG	ENSP00000301522:p.Arg91fs	212.0	0.0		184.0	11.0	NM_005809	A8K0C0|P31945|P32118|P35701|Q6FHG4|Q92763|Q9UC23	Frame_Shift_Ins	INS	ENST00000301522.2	37	CCDS12281.1																																																																																			.	.		0.599	PRDX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258950.2	NM_005809	
UNKL	64718	hgsc.bcm.edu	37	16	1417771	1417772	+	Frame_Shift_Ins	INS	-	-	G			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr16:1417771_1417772insG	ENST00000389221.4	-	13	1663_1664	c.1664_1665insC	c.(1663-1665)ccafs	p.P555fs	UNKL_ENST00000508903.2_Frame_Shift_Ins_p.P558fs|UNKL_ENST00000391893.2_Frame_Shift_Ins_p.P54fs|UNKL_ENST00000397464.1_Frame_Shift_Ins_p.P57fs|UNKL_ENST00000248104.7_Frame_Shift_Ins_p.P54fs|UNKL_ENST00000402641.2_Frame_Shift_Ins_p.P57fs|UNKL_ENST00000403703.1_Frame_Shift_Ins_p.P57fs	NM_001193388.1	NP_001180317	Q9H9P5	UNKL_HUMAN	unkempt family zinc finger-like	555	Ser-rich.				protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|endometrium(1)|large_intestine(1)|lung(1)	4		Hepatocellular(780;0.0893)				TCGAAGAGGATGGGGGGCCGGC	0.644																																					p.P558fs		.	.											.	UNKL	.	.	0			c.1674_1675insC						.																																			SO:0001589	frameshift_variant	64718	exon13			.	BC011924	CCDS32359.1, CCDS53980.1, CCDS61787.1	16p13.3	2014-03-10	2013-10-17		ENSG00000059145	ENSG00000059145		"""Zinc fingers, CCCH-type domain containing"""	14184	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 28"", ""unkempt homolog (Drosophila)-like"""	C16orf28		20148946	Standard	NM_001193389		Approved	ZC3HDC5L, ZC3H5L, FLJ23360	uc031qup.1	Q9H9P5	OTTHUMG00000128553	ENST00000389221.4:c.1665dupC	16.37:g.1417777_1417777dupG	ENSP00000373873:p.Pro555fs	196.0	0.0		185.0	11.0	NM_001193388	B0QYN6|B1GXI8|Q96EV1|Q96RZ1|Q9BWL5|Q9H5K0|Q9UJJ8	Frame_Shift_Ins	INS	ENST00000389221.4	37	CCDS53981.1																																																																																			.	.		0.644	UNKL-201	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_001037125	
CPNE5	57699	hgsc.bcm.edu	37	6	36710124	36710124	+	Frame_Shift_Del	DEL	G	G	-			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr6:36710124delG	ENST00000244751.2	-	21	2327	c.1703delC	c.(1702-1704)ccafs	p.P569fs	CPNE5_ENST00000459703.1_5'UTR|CPNE5_ENST00000393189.2_Frame_Shift_Del_p.P277fs	NM_020939.1	NP_065990.1	Q9HCH3	CPNE5_HUMAN	copine V	569						extracellular vesicular exosome (GO:0070062)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)				central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(4)|large_intestine(4)|liver(1)|lung(9)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	25						TGCTGCGGGTGGGGGACGCGG	0.682																																					p.P568fs		.	.											.	CPNE5	.	.	0			c.1704delA						.						79.0	73.0	75.0					6																	36710124		2203	4300	6503	SO:0001589	frameshift_variant	57699	exon21			.	H09181	CCDS4825.1	6p21.2	2010-05-28			ENSG00000124772	ENSG00000124772			2318	protein-coding gene	gene with protein product		604209				9430674	Standard	NM_020939		Approved	CPN5, COPN5, KIAA1599	uc003omr.1	Q9HCH3	OTTHUMG00000014602	ENST00000244751.2:c.1703delC	6.37:g.36710124delG	ENSP00000244751:p.Pro569fs	110.0	0.0		91.0	23.0	NM_020939	Q7Z6C8	Frame_Shift_Del	DEL	ENST00000244751.2	37	CCDS4825.1																																																																																			.	.		0.682	CPNE5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040351.1	NM_020939	
NUDT17	200035	hgsc.bcm.edu	37	1	145587383	145587384	+	Frame_Shift_Ins	INS	-	-	G	rs139528449|rs139789829	byFrequency	TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr1:145587383_145587384insG	ENST00000334513.5	-	6	707_708	c.696_697insC	c.(694-699)cccggafs	p.G233fs	NUDT17_ENST00000444015.2_5'UTR	NM_001012758.2	NP_001012776.1	P0C025	NUD17_HUMAN	nudix (nucleoside diphosphate linked moiety X)-type motif 17	233	Nudix hydrolase. {ECO:0000255|PROSITE- ProRule:PRU00794}.						hydrolase activity (GO:0016787)|metal ion binding (GO:0046872)			endometrium(3)|large_intestine(1)|lung(2)|skin(1)|urinary_tract(2)	9	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					GGGAGAAGTCCGGGTGTCTCTG	0.545																																					p.G233fs		.	.											.	NUDT17	.	.	0			c.697_698insC						.																																			SO:0001589	frameshift_variant	200035	exon6			.	BC046352	CCDS72865.1	1q21.1	2008-02-05			ENSG00000186364	ENSG00000186364		"""Nudix motif containing"""	26618	protein-coding gene	gene with protein product						12477932	Standard	NM_001012758		Approved	FLJ34433	uc001eoe.3	P0C025	OTTHUMG00000013752	ENST00000334513.5:c.697dupC	1.37:g.145587386_145587386dupG	ENSP00000334437:p.Gly233fs	97.0	0.0		127.0	10.0	NM_001012758		Frame_Shift_Ins	INS	ENST00000334513.5	37	CCDS30830.1																																																																																			.	.		0.545	NUDT17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000038541.3	XM_496395	
PI4KAP2	375133	hgsc.bcm.edu	37	22	21838338	21838339	+	RNA	INS	-	-	T	rs201760046	byFrequency	TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr22:21838338_21838339insT	ENST00000450651.1	-	0	988_989							A4QPH2	PI4P2_HUMAN	phosphatidylinositol 4-kinase, catalytic, alpha pseudogene 2						phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)		kinase activity (GO:0016301)|phosphotransferase activity, alcohol group as acceptor (GO:0016773)			endometrium(3)|urinary_tract(1)	4						AGAAATCAAACCCCCGCTGGTA	0.52																																					.		.	.											.	PI4KAP2	.	.	0			.						.																																					375133	.			.			22q11.21	2014-03-20	2007-08-14		ENSG00000183506	ENSG00000183506			33577	pseudogene	pseudogene							Standard	NR_003700		Approved		uc011aie.1	A4QPH2	OTTHUMG00000150827		22.37:g.21838338_21838339insT		115.0	0.0		138.0	12.0	.	Q6ICJ0|Q6ZT68|Q8WUK7	RNA	INS	ENST00000450651.1	37																																																																																				.	.		0.520	PI4KAP2-005	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000334908.1		
KIAA1755	85449	hgsc.bcm.edu	37	20	36869926	36869927	+	Frame_Shift_Ins	INS	-	-	C			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr20:36869926_36869927insC	ENST00000279024.4	-	3	877_878	c.606_607insG	c.(604-609)gggcccfs	p.P203fs		NM_001029864.1	NP_001025035.1	Q5JYT7	K1755_HUMAN	KIAA1755	203										breast(2)|endometrium(3)|kidney(1)|large_intestine(5)|lung(31)|ovary(5)|pancreas(2)|skin(4)|stomach(1)	54		Myeloproliferative disorder(115;0.00874)				AATGGAAGGGGCCCCCAGGCTT	0.574																																					p.P203fs		.	.											.	KIAA1755	.	.	0			c.607_608insG						.																																			SO:0001589	frameshift_variant	85449	exon3			.	AB051542	CCDS33467.1	20q11.23	2007-12-07			ENSG00000149633	ENSG00000149633			29372	protein-coding gene	gene with protein product						11214970	Standard	NM_001029864		Approved	RP5-1054A22.3	uc002xhy.1	Q5JYT7	OTTHUMG00000032436	ENST00000279024.4:c.607dupG	20.37:g.36869931_36869931dupC	ENSP00000279024:p.Pro203fs	198.0	0.0		181.0	12.0	NM_001029864	Q9C0A8	Frame_Shift_Ins	INS	ENST00000279024.4	37	CCDS33467.1																																																																																			.	.		0.574	KIAA1755-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000079144.3	NM_001029864	
ABCD2	225	hgsc.bcm.edu	37	12	40013265	40013266	+	Frame_Shift_Ins	INS	-	-	T			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr12:40013265_40013266insT	ENST00000308666.3	-	1	287_288	c.152_153insA	c.(151-153)aagfs	p.K51fs		NM_005164.3	NP_005155.1	Q9UBJ2	ABCD2_HUMAN	ATP-binding cassette, sub-family D (ALD), member 2	51	Interaction with PEX19.				fatty acid beta-oxidation (GO:0006635)|positive regulation of fatty acid beta-oxidation (GO:0032000)|transmembrane transport (GO:0055085)|very long-chain fatty acid catabolic process (GO:0042760)|very long-chain fatty acid metabolic process (GO:0000038)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|mitochondrion (GO:0005739)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|protein homodimerization activity (GO:0042803)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(10)|lung(24)|ovary(2)|pancreas(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	52						CTGCTTTTTTCTTCCCGTGGCC	0.5																																					p.K51fs		.	.											.	ABCD2	.	.	0			c.153_154insA						.																																			SO:0001589	frameshift_variant	225	exon1			.	U28150	CCDS8734.1	12q12	2012-05-16			ENSG00000173208	ENSG00000173208		"""ATP binding cassette transporters / subfamily D"""	66	protein-coding gene	gene with protein product		601081		ALDL1		8577752	Standard	NM_005164		Approved	ALDR, ALDRP	uc001rmb.2	Q9UBJ2	OTTHUMG00000169337	ENST00000308666.3:c.153dupA	12.37:g.40013267_40013267dupT	ENSP00000310688:p.Lys51fs	163.0	0.0		166.0	10.0	NM_005164	B2RAM3|Q13210|Q2M3H9	Frame_Shift_Ins	INS	ENST00000308666.3	37	CCDS8734.1																																																																																			.	.		0.500	ABCD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403591.1	NM_005164	
EBLN2	55096	hgsc.bcm.edu	37	3	73111541	73111542	+	Frame_Shift_Ins	INS	-	-	A			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr3:73111541_73111542insA	ENST00000533473.1	+	1	732_733	c.309_310insA	c.(310-312)aaafs	p.K104fs	PPP4R2_ENST00000394284.3_Intron|PPP4R2_ENST00000295862.9_Intron|PPP4R2_ENST00000356692.5_Intron	NM_018029.3	NP_060499.3	Q6P2I7	EBLN2_HUMAN	endogenous Bornavirus-like nucleoprotein 2	104										endometrium(1)|large_intestine(3)|lung(1)|prostate(1)	6						TTAAGGACATTAAAAAAGCAGC	0.426																																					p.I103fs		.	.											.	.	.	.	0			c.309_310insA						.																																			SO:0001589	frameshift_variant	55096	exon1			.		CCDS54608.1	3p13	2011-06-03			ENSG00000255423	ENSG00000255423			25493	protein-coding gene	gene with protein product	"""endogenous Borna-like N element 2"""	613250				20054395, 20686665	Standard	NM_018029		Approved		uc003dpj.3	Q6P2I7	OTTHUMG00000165897	ENST00000533473.1:c.315dupA	3.37:g.73111547_73111547dupA	ENSP00000432104:p.Lys104fs	231.0	0.0		195.0	13.0	NM_018029	Q8WWH3|Q9NW89	Frame_Shift_Ins	INS	ENST00000533473.1	37	CCDS54608.1																																																																																			.	.		0.426	EBLN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386932.1	NM_018029	
CYLC2	1539	hgsc.bcm.edu	37	9	105767323	105767324	+	Frame_Shift_Ins	INS	-	-	A			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr9:105767323_105767324insA	ENST00000374798.3	+	5	480_481	c.410_411insA	c.(409-414)ggaaaafs	p.GK137fs	CYLC2_ENST00000487798.1_Frame_Shift_Ins_p.GK137fs	NM_001340.3	NP_001331.1	Q14093	CYLC2_HUMAN	cylicin, basic protein of sperm head cytoskeleton 2	137	31 X 3 AA repeats of K-K-X.				cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	structural constituent of cytoskeleton (GO:0005200)			NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(14)|ovary(1)|skin(5)|stomach(5)|upper_aerodigestive_tract(2)	41		all_hematologic(171;0.125)				TTAaaacaaggaaaaaaagatt	0.332																																					p.G137fs		.	.											.	CYLC2	.	.	0			c.410_411insA						.																																			SO:0001589	frameshift_variant	1539	exon5			.	Z46788	CCDS35085.1	9q31.2	2008-07-21			ENSG00000155833	ENSG00000155833			2583	protein-coding gene	gene with protein product		604035				7737358	Standard	NM_001340		Approved		uc004bbs.2	Q14093	OTTHUMG00000020396	ENST00000374798.3:c.417dupA	9.37:g.105767330_105767330dupA	ENSP00000420256:p.Gly137fs	244.0	0.0		208.0	13.0	NM_001340	B2R8F4|Q5VVJ9	Frame_Shift_Ins	INS	ENST00000374798.3	37	CCDS35085.1																																																																																			.	.		0.332	CYLC2-001	KNOWN	alternative_3_UTR|NMD_exception|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000053463.3	NM_001340	
CASP8AP2	9994	hgsc.bcm.edu	37	6	90577003	90577004	+	RNA	INS	-	-	A			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr6:90577003_90577004insA	ENST00000551025.1	+	0	5431_5432									caspase 8 associated protein 2											NS(1)|endometrium(7)|kidney(6)|large_intestine(12)|lung(21)|ovary(2)|urinary_tract(2)	51		all_cancers(76;3.64e-09)|Prostate(29;1.16e-10)|Acute lymphoblastic leukemia(125;1.45e-10)|all_hematologic(105;7.74e-07)|all_epithelial(107;4.69e-05)|Lung NSC(302;0.238)		BRCA - Breast invasive adenocarcinoma(108;0.0953)		TAACTGTACTGAAAAAAGTGAG	0.396																																					p.E1332fs	Colon(187;1656 2025 17045 31481 39901)	.	.											.	CASP8AP2	.	.	0			c.3994_3995insA						.																																					9994	exon8			.	AB037736		6q15	2012-04-19	2008-10-30		ENSG00000118412	ENSG00000118412			1510	protein-coding gene	gene with protein product	"""FLICE-associated huge protein"""	606880	"""CASP8 associated protein 2"""			10235259, 17245429, 17003126	Standard	NM_001137668		Approved	FLASH, CED-4, RIP25, FLJ11208, KIAA1315	uc011dzz.2	Q9UKL3	OTTHUMG00000015212		6.37:g.90577009_90577009dupA		145.0	0.0		168.0	10.0	NM_001137667		Frame_Shift_Ins	INS	ENST00000551025.1	37																																																																																				.	.		0.396	CASP8AP2-202	KNOWN	basic	processed_transcript	processed_transcript		NM_001137667	
PLEKHA5	54477	hgsc.bcm.edu	37	12	19427544	19427545	+	Frame_Shift_Ins	INS	-	-	A			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr12:19427544_19427545insA	ENST00000299275.6	+	10	928_929	c.922_923insA	c.(922-924)caafs	p.Q308fs	PLEKHA5_ENST00000309364.4_Frame_Shift_Ins_p.Q308fs|PLEKHA5_ENST00000510738.2_3'UTR|PLEKHA5_ENST00000359180.3_Frame_Shift_Ins_p.Q308fs|PLEKHA5_ENST00000355397.3_Frame_Shift_Ins_p.Q308fs|PLEKHA5_ENST00000317589.4_Frame_Shift_Ins_p.Q308fs|PLEKHA5_ENST00000543806.1_Frame_Shift_Ins_p.Q200fs|PLEKHA5_ENST00000538714.1_Frame_Shift_Ins_p.Q308fs|PLEKHA5_ENST00000539256.1_Frame_Shift_Ins_p.Q66fs|PLEKHA5_ENST00000424268.1_Frame_Shift_Ins_p.Q200fs|PLEKHA5_ENST00000429027.2_Frame_Shift_Ins_p.Q314fs	NM_019012.5	NP_061885.2	Q9HAU0	PKHA5_HUMAN	pleckstrin homology domain containing, family A member 5	308					reproductive system development (GO:0061458)	cytosol (GO:0005829)|membrane (GO:0016020)	1-phosphatidylinositol binding (GO:0005545)|phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|phosphatidylinositol-3-phosphate binding (GO:0032266)|phosphatidylinositol-4-phosphate binding (GO:0070273)|phosphatidylinositol-5-phosphate binding (GO:0010314)			autonomic_ganglia(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|lung(14)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	35	Acute lymphoblastic leukemia(4;0.000455)|all_hematologic(4;0.00804)					CCAAAACAATCAAAAAAACAAG	0.327																																					p.Q314fs	Pancreas(196;329 2193 11246 14234 19524)	.	.											.	PLEKHA5	.	.	0			c.940_941insA						.																																			SO:0001589	frameshift_variant	54477	exon11			.	AF302150	CCDS8682.1, CCDS44840.1, CCDS44840.2, CCDS55809.1, CCDS58213.1, CCDS58214.1	12p12	2013-01-10			ENSG00000052126	ENSG00000052126		"""Pleckstrin homology (PH) domain containing"""	30036	protein-coding gene	gene with protein product		607770				11214970, 11001876	Standard	NM_001143821		Approved	PEPP2, KIAA1686, FLJ10667	uc031qgo.1	Q9HAU0	OTTHUMG00000167921	ENST00000299275.6:c.929dupA	12.37:g.19427551_19427551dupA	ENSP00000299275:p.Gln308fs	133.0	0.0		145.0	10.0	NM_001256470	A0JP03|B4DGS1|E9PHQ3|F5H0I0|Q6NSF8|Q86ST7|Q8N3K6|Q96DY9|Q9BVR4|Q9C0H7|Q9H924|Q9NVK8	Frame_Shift_Ins	INS	ENST00000299275.6	37	CCDS8682.1																																																																																			.	.		0.327	PLEKHA5-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000397013.1	NM_019012	
KAT6B	23522	hgsc.bcm.edu	37	10	76735587	76735588	+	Frame_Shift_Ins	INS	-	-	C			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr10:76735587_76735588insC	ENST00000287239.4	+	8	1981_1982	c.1492_1493insC	c.(1492-1494)accfs	p.T498fs	KAT6B_ENST00000372711.1_Intron|KAT6B_ENST00000372714.1_Intron|KAT6B_ENST00000372724.1_Intron|KAT6B_ENST00000372725.1_Intron	NM_001256468.1|NM_012330.3	NP_001243397.1|NP_036462.2	Q8WYB5	KAT6B_HUMAN	K(lysine) acetyltransferase 6B	498	Negatively regulates HAT activity.|Ser-rich.				chromatin organization (GO:0006325)|histone acetylation (GO:0016573)|histone H3 acetylation (GO:0043966)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome assembly (GO:0006334)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	MOZ/MORF histone acetyltransferase complex (GO:0070776)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	acetyltransferase activity (GO:0016407)|DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)										TCCACCCCCAACCCCCATCTCC	0.535																																					p.T498fs		.	.											.	.	.	.	0			c.1492_1493insC						.																																			SO:0001589	frameshift_variant	23522	exon8			.	AF113514	CCDS7345.1, CCDS58084.1, CCDS58085.1	10q22.2	2013-01-28	2011-07-21	2011-07-21	ENSG00000156650	ENSG00000156650		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Zinc fingers, C2HC-type containing"", ""Zinc fingers, PHD-type"""	17582	protein-coding gene	gene with protein product	"""MOZ-related factor"""	605880	"""MYST histone acetyltransferase (monocytic leukemia) 4"""	MYST4		9205841, 10497217	Standard	NM_012330		Approved	querkopf, qkf, Morf, MOZ2, ZC2HC6B	uc001jwn.2	Q8WYB5	OTTHUMG00000018509	ENST00000287239.4:c.1497dupC	10.37:g.76735592_76735592dupC	ENSP00000287239:p.Thr498fs	130.0	0.0		118.0	10.0	NM_012330	O15087|Q86Y05|Q8WU81|Q9UKW2|Q9UKW3|Q9UKX0	Frame_Shift_Ins	INS	ENST00000287239.4	37	CCDS7345.1																																																																																			.	.		0.535	KAT6B-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048771.1	NM_012330	
B4GALT3	8703	hgsc.bcm.edu	37	1	161143503	161143504	+	Frame_Shift_Ins	INS	-	-	G			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr1:161143503_161143504insG	ENST00000319769.5	-	6	916_917	c.694_695insC	c.(694-696)cagfs	p.Q232fs	PPOX_ENST00000535223.1_Intron|B4GALT3_ENST00000470882.1_5'UTR|PPOX_ENST00000432542.2_Intron|B4GALT3_ENST00000367998.1_Frame_Shift_Ins_p.Q232fs|PPOX_ENST00000495483.1_Intron	NM_001199873.1|NM_003779.3	NP_001186802.1|NP_003770.1	O60512	B4GT3_HUMAN	UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 3	232					carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	beta-N-acetylglucosaminylglycopeptide beta-1,4-galactosyltransferase activity (GO:0003831)|galactosyltransferase activity (GO:0008378)|metal ion binding (GO:0046872)|N-acetyllactosamine synthase activity (GO:0003945)			cervix(1)|endometrium(5)|large_intestine(6)|lung(6)	18	all_cancers(52;3.73e-19)|Breast(13;0.000577)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00275)		N-Acetyl-D-glucosamine(DB00141)	TCCGAAGTACTGGGGGTACGGG	0.554																																					p.Q232fs		.	.											.	B4GALT3	.	.	0			c.695_696insC						.																																			SO:0001589	frameshift_variant	8703	exon6			.	BC006099	CCDS1222.1	1q21-q23	2013-02-19			ENSG00000158850	ENSG00000158850		"""Beta 4-glycosyltransferases"""	926	protein-coding gene	gene with protein product		604014				9405390, 9597550	Standard	NM_001199873		Approved	beta4Gal-T3	uc001fys.2	O60512	OTTHUMG00000034348	ENST00000319769.5:c.695dupC	1.37:g.161143508_161143508dupG	ENSP00000320965:p.Gln232fs	130.0	0.0		147.0	11.0	NM_003779	D3DVG3|O60910|Q9BPZ4|Q9H8T2	Frame_Shift_Ins	INS	ENST00000319769.5	37	CCDS1222.1																																																																																			.	.		0.554	B4GALT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083054.1	NM_003779	
OR6X1	390260	hgsc.bcm.edu	37	11	123624382	123624383	+	Frame_Shift_Ins	INS	-	-	G	rs187417785		TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr11:123624382_123624383insG	ENST00000327930.2	-	1	870_871	c.844_845insC	c.(844-846)cttfs	p.L282fs		NM_001005188.1	NP_001005188.1	Q8NH79	OR6X1_HUMAN	olfactory receptor, family 6, subfamily X, member 1	282						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(3)|endometrium(3)|large_intestine(4)|lung(8)|ovary(2)|prostate(1)|skin(2)	23		Breast(109;0.0109)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0279)		GGGATTCAGAAGGGGGGTGAGG	0.436																																					p.L282fs		.	.											.	OR6X1	.	.	0			c.845_846insC						.																																			SO:0001589	frameshift_variant	390260	exon1			.	AB065510	CCDS31695.1	11q24.1	2012-08-09			ENSG00000221931	ENSG00000221931		"""GPCR / Class A : Olfactory receptors"""	14737	protein-coding gene	gene with protein product							Standard	NM_001005188		Approved		uc010rzy.2	Q8NH79	OTTHUMG00000166011	ENST00000327930.2:c.845dupC	11.37:g.123624388_123624388dupG	ENSP00000333724:p.Leu282fs	168.0	0.0		144.0	10.0	NM_001005188	B9EGW9|Q6IFA0	Frame_Shift_Ins	INS	ENST00000327930.2	37	CCDS31695.1																																																																																			.	.		0.436	OR6X1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387436.1	NM_001005188	
CFAP46	54777	hgsc.bcm.edu	37	10	134726617	134726618	+	Frame_Shift_Ins	INS	-	-	C			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr10:134726617_134726618insC	ENST00000368586.5	-	18	2365_2366	c.2265_2266insG	c.(2263-2268)gggcggfs	p.R756fs	TTC40_ENST00000368582.2_Frame_Shift_Ins_p.R756fs	NM_001200049.2	NP_001186978.2														breast(1)|endometrium(5)|lung(19)|urinary_tract(3)	28						TCCTTCTGCCGCCCGGCCAGGA	0.634																																					p.R756fs		.	.											.	.	.	.	0			c.2266_2267insG						.																																			SO:0001589	frameshift_variant	54777	exon18			.																												ENST00000368586.5:c.2266dupG	10.37:g.134726620_134726620dupC	ENSP00000357575:p.Arg756fs	166.0	0.0		126.0	10.0	NM_001200049		Frame_Shift_Ins	INS	ENST00000368586.5	37	CCDS58101.1																																																																																			.	.		0.634	TTC40-001	PUTATIVE	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000051095.3		
CELSR1	9620	hgsc.bcm.edu	37	22	46930690	46930691	+	Frame_Shift_Ins	INS	-	-	G			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr22:46930690_46930691insG	ENST00000262738.3	-	1	2376_2377	c.2377_2378insC	c.(2377-2379)catfs	p.H793fs	CELSR1_ENST00000395964.1_Frame_Shift_Ins_p.H793fs|CELSR1_ENST00000497509.1_5'Flank	NM_014246.1	NP_055061.1	Q9NYQ6	CELR1_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 1	793	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				anterior/posterior pattern specification (GO:0009952)|apical protein localization (GO:0045176)|central nervous system development (GO:0007417)|establishment of body hair planar orientation (GO:0048105)|establishment of planar polarity (GO:0001736)|establishment of planar polarity of embryonic epithelium (GO:0042249)|G-protein coupled receptor signaling pathway (GO:0007186)|hair follicle development (GO:0001942)|homophilic cell adhesion (GO:0007156)|inner ear morphogenesis (GO:0042472)|lateral sprouting involved in lung morphogenesis (GO:0060490)|locomotory behavior (GO:0007626)|neural tube closure (GO:0001843)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|orthogonal dichotomous subdivision of terminal units involved in lung branching morphogenesis (GO:0060488)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|planar dichotomous subdivision of terminal units involved in lung branching morphogenesis (GO:0060489)|protein localization involved in establishment of planar polarity (GO:0090251)|regulation of actin cytoskeleton organization (GO:0032956)|Rho protein signal transduction (GO:0007266)|wound healing (GO:0042060)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)|protein dimerization activity (GO:0046983)|transmembrane signaling receptor activity (GO:0004888)			breast(8)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(5)|kidney(4)|large_intestine(13)|lung(27)|ovary(2)|pancreas(2)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(3)	95		Ovarian(80;0.00142)|Breast(42;0.00296)|all_neural(38;0.0416)|Colorectal(5;0.0766)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00643)|BRCA - Breast invasive adenocarcinoma(115;0.171)		CACTGTGTAATGGGAGCTCTGA	0.579																																					p.H793fs		.	.											.	CELSR1	.	.	0			c.2378_2379insC						.																																			SO:0001589	frameshift_variant	9620	exon1			.	AF231024	CCDS14076.1	22q13.31	2014-08-08	2013-02-18		ENSG00000075275	ENSG00000075275		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	1850	protein-coding gene	gene with protein product	"""flamingo homolog 2 (Drosophila)"""	604523	"""cadherin, EGF LAG seven-pass G-type receptor 1, flamingo (Drosophila) homolog"""			9339365	Standard	XM_006724383		Approved	ME2, HFMI2, FMI2, CDHF9	uc003bhw.1	Q9NYQ6	OTTHUMG00000150423	ENST00000262738.3:c.2378dupC	22.37:g.46930693_46930693dupG	ENSP00000262738:p.His793fs	139.0	0.0		167.0	10.0	NM_014246	O95722|Q5TH47|Q9BWQ5|Q9Y506|Q9Y526	Frame_Shift_Ins	INS	ENST00000262738.3	37	CCDS14076.1																																																																																			.	.		0.579	CELSR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318037.1	NM_014246	
HIVEP2	3097	hgsc.bcm.edu	37	6	143094744	143094745	+	Frame_Shift_Ins	INS	-	-	T			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr6:143094744_143094745insT	ENST00000367604.1	-	4	1770_1771	c.1131_1132insA	c.(1129-1134)aaaggafs	p.G378fs	HIVEP2_ENST00000367603.2_Frame_Shift_Ins_p.G378fs|HIVEP2_ENST00000012134.2_Frame_Shift_Ins_p.G378fs			P31629	ZEP2_HUMAN	human immunodeficiency virus type I enhancer binding protein 2	378					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|breast(4)|central_nervous_system(6)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(19)|lung(35)|ovary(4)|prostate(6)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	100				OV - Ovarian serous cystadenocarcinoma(155;1.61e-05)|GBM - Glioblastoma multiforme(68;0.0102)		GAATCTTGTCCTTTTTTCTCTG	0.431																																					p.G378fs	Esophageal Squamous(107;843 1510 13293 16805 42198)	.	.											.	HIVEP2	.	.	0			c.1132_1133insA						.																																			SO:0001589	frameshift_variant	3097	exon5			.	M60119	CCDS43510.1	6q23-q24	2013-01-08	2001-11-28		ENSG00000010818	ENSG00000010818		"""Zinc fingers, C2H2-type"""	4921	protein-coding gene	gene with protein product	"""c-myc intron binding protein 1"""	143054	"""human immunodeficiency virus type I enhancer-binding protein 2"""			1733857, 2022670	Standard	NM_006734		Approved	MBP-2, HIV-EP2, MIBP1, ZAS2, Schnurri-2, ZNF40B	uc003qjd.3	P31629	OTTHUMG00000015713	ENST00000367604.1:c.1132dupA	6.37:g.143094750_143094750dupT	ENSP00000356576:p.Gly378fs	284.0	0.0		299.0	18.0	NM_006734	Q02646|Q5THT5|Q9NS05	Frame_Shift_Ins	INS	ENST00000367604.1	37	CCDS43510.1																																																																																			.	.		0.431	HIVEP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042495.1		
SAMD15	161394	hgsc.bcm.edu	37	14	77844867	77844868	+	Frame_Shift_Ins	INS	-	-	G	rs111283439		TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr14:77844867_77844868insG	ENST00000216471.4	+	1	1392_1393	c.1106_1107insG	c.(1105-1110)gagaaafs	p.K370fs	TMED8_ENST00000216468.7_5'Flank|SAMD15_ENST00000533095.2_Intron	NM_001010860.1	NP_001010860.1	Q9P1V8	SAM15_HUMAN	sterile alpha motif domain containing 15	370			K -> E (in dbSNP:rs4903576).							breast(2)|endometrium(3)|kidney(2)|large_intestine(4)|lung(10)|pancreas(1)|skin(1)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	28						AAGTCAAATGAGAAAAAAAATC	0.386																																					p.E369fs		.	.											.	SAMD15	.	.	0			c.1106_1107insG						.																																			SO:0001589	frameshift_variant	161394	exon1			.	AK093282	CCDS32126.1	14q24.3	2013-01-10	2010-10-20	2010-10-20	ENSG00000100583	ENSG00000100583		"""Sterile alpha motif (SAM) domain containing"""	18631	protein-coding gene	gene with protein product			"""family with sequence similarity 15, member A"", ""chromosome 14 open reading frame 174"""	FAM15A, C14orf174			Standard	XM_006720069		Approved	FLJ35963	uc001xtq.1	Q9P1V8		ENST00000216471.4:c.1107dupG	14.37:g.77844868_77844868dupG	ENSP00000216471:p.Lys370fs	222.0	0.0		215.0	17.0	NM_001010860	Q2M3P3	Frame_Shift_Ins	INS	ENST00000216471.4	37	CCDS32126.1																																																																																			.	.		0.386	SAMD15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394587.2	NM_001010860	
ERI2	112479	hgsc.bcm.edu	37	16	20809480	20809481	+	Frame_Shift_Ins	INS	-	-	T			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr16:20809480_20809481insT	ENST00000357967.4	-	9	1683_1684	c.1641_1642insA	c.(1639-1644)aaacaafs	p.Q548fs	ERI2_ENST00000389345.5_Frame_Shift_Ins_p.Q283fs|ERI2_ENST00000300005.3_Intron|ERI2_ENST00000569729.1_Frame_Shift_Ins_p.N262fs|ERI2_ENST00000564349.1_Frame_Shift_Ins_p.Q455fs|ERI2_ENST00000563117.1_Frame_Shift_Ins_p.Q455fs	NM_001142725.1	NP_001136197.1	A8K979	ERI2_HUMAN	ERI1 exoribonuclease family member 2	548							exonuclease activity (GO:0004527)|nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(1)|large_intestine(5)|lung(2)|prostate(2)	11						GTGAAGGGTTGTTTTTTTGCTG	0.431																																					p.Q548fs		.	.											.	ERI2	.	.	0			c.1642_1643insA						.																																			SO:0001589	frameshift_variant	112479	exon9			.	BC010503	CCDS10590.1, CCDS45436.1	16p12.3	2014-02-18	2009-10-07	2008-12-16	ENSG00000196678	ENSG00000196678		"""Enhanced RNAi three prime mRNA exonucleases"""	30541	protein-coding gene	gene with protein product	"""enhanced RNAi three prime mRNA exonuclease homolog 2 (C.elegans)"", ""exoribonuclease 2"", ""zinc finger, GRF-type containing 5"""		"""exonuclease domain containing 1"""	EXOD1		10819331	Standard	NM_080663		Approved	KIAA1504, MGC16943, ZGRF5	uc010vbb.1	A8K979	OTTHUMG00000131557	ENST00000357967.4:c.1642dupA	16.37:g.20809487_20809487dupT	ENSP00000350651:p.Gln548fs	114.0	0.0		155.0	10.0	NM_001142725	Q6ZSJ2|Q96FR9|Q9P224|Q9Y6V3	Frame_Shift_Ins	INS	ENST00000357967.4	37	CCDS45436.1																																																																																			.	.		0.431	ERI2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_080663	
THBS3	7059	hgsc.bcm.edu	37	1	155165011	155165012	+	IGR	INS	-	-	T			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr1:155165011_155165012insT	ENST00000368378.3	-	0	3145				MUC1_ENST00000368393.3_5'Flank|MUC1_ENST00000438413.1_5'Flank|MIR92B_ENST00000607575.1_RNA|MUC1_ENST00000368396.4_5'Flank|MUC1_ENST00000337604.5_5'Flank|RP11-263K19.4_ENST00000447623.1_RNA|MUC1_ENST00000462215.1_5'Flank|RP11-263K19.4_ENST00000454348.1_RNA|MUC1_ENST00000457295.2_5'Flank|MUC1_ENST00000343256.5_5'Flank|MUC1_ENST00000368395.1_5'Flank|MUC1_ENST00000342482.4_5'Flank|MUC1_ENST00000368392.3_5'Flank|MUC1_ENST00000368398.3_5'Flank|MUC1_ENST00000368389.2_5'Flank|MUC1_ENST00000368390.3_5'Flank|MUC1_ENST00000338684.5_5'Flank	NM_001252607.1|NM_007112.4	NP_001239536.1|NP_009043.1	P49746	TSP3_HUMAN	thrombospondin 3						bone trabecula formation (GO:0060346)|cell-matrix adhesion (GO:0007160)|growth plate cartilage development (GO:0003417)|ossification involved in bone maturation (GO:0043931)	extracellular region (GO:0005576)|perinuclear region of cytoplasm (GO:0048471)	calcium ion binding (GO:0005509)|heparin binding (GO:0008201)			breast(6)|endometrium(4)|kidney(4)|large_intestine(6)|lung(14)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(4)|urinary_tract(3)	48	all_epithelial(22;5.72e-28)|all_lung(78;2.07e-24)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		Epithelial(20;3.72e-10)|all cancers(21;1.19e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)			GTGCAGTGTTGTTTTTTCCCCC	0.782																																					.		.	.											.	.	.	.	0			.						.																																			SO:0001628	intergenic_variant	693235	.			.	L38969	CCDS1099.1, CCDS58034.1, CCDS72937.1	1q21	2008-02-05			ENSG00000169231	ENSG00000169231			11787	protein-coding gene	gene with protein product		188062				1601886	Standard	NM_007112		Approved		uc001fix.3	P49746	OTTHUMG00000035710		1.37:g.155165017_155165017dupT		46.0	0.0		263.0	16.0	.	B1AVR8|B4DQ20|Q8WV34	RNA	INS	ENST00000368378.3	37	CCDS1099.1																																																																																			.	.		0.782	THBS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086856.1	NM_007112	
NANOGNB	360030	hgsc.bcm.edu	37	12	7922711	7922712	+	Frame_Shift_Ins	INS	-	-	A			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr12:7922711_7922712insA	ENST00000382119.1	+	2	305_306	c.235_236insA	c.(235-237)gaafs	p.E79fs		NM_001145465.1	NP_001138937.1	Q7Z5D8	NANGN_HUMAN	NANOG neighbor homeobox	79						nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)	1						agaaaaagaagaaaaaaacgaa	0.376																																					p.E79fs		.	.											.	.	.	.	0			c.235_236insA						.																																			SO:0001589	frameshift_variant	360030	exon2			.		CCDS44826.1	12p13.31	2011-06-02	2010-07-08		ENSG00000205857	ENSG00000205857			24958	protein-coding gene	gene with protein product	"""homeobox C14"""					12477932	Standard	NM_001145465		Approved		uc009zfx.2	Q7Z5D8	OTTHUMG00000165107	ENST00000382119.1:c.242dupA	12.37:g.7922718_7922718dupA	ENSP00000371553:p.Glu79fs	156.0	0.0		163.0	10.0	NM_001145465		Frame_Shift_Ins	INS	ENST00000382119.1	37	CCDS44826.1																																																																																			.	.		0.376	NANOGNB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381846.1		
ETV3L	440695	hgsc.bcm.edu	37	1	157067713	157067714	+	Frame_Shift_Ins	INS	-	-	G			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr1:157067713_157067714insG	ENST00000454449.2	-	4	837_838	c.553_554insC	c.(553-555)cgafs	p.R185fs		NM_001004341.2	NP_001004341.1	Q6ZN32	ETV3L_HUMAN	ets variant 3-like	185					cell differentiation (GO:0030154)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(9)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	24	Hepatocellular(266;0.158)	Prostate(1639;0.184)				TGGTGGCCCTCGGGGGGTCTGC	0.619																																					p.R185fs		.	.											.	ETV3L	.	.	0			c.554_555insC						.																																			SO:0001589	frameshift_variant	440695	exon4			.	AK131392	CCDS30893.1	1q23.1	2013-09-24	2008-09-12		ENSG00000253831	ENSG00000253831			33834	protein-coding gene	gene with protein product			"""ets variant gene 3-like"""				Standard	NM_001004341		Approved	FLJ16478	uc001fqq.2	Q6ZN32	OTTHUMG00000041325	ENST00000454449.2:c.554dupC	1.37:g.157067719_157067719dupG	ENSP00000430271:p.Arg185fs	169.0	0.0		184.0	12.0	NM_001004341		Frame_Shift_Ins	INS	ENST00000454449.2	37	CCDS30893.1																																																																																			.	.		0.619	ETV3L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000099024.2	NM_001004341	
RAD51	5888	hgsc.bcm.edu	37	15	41022163	41022164	+	Frame_Shift_Ins	INS	-	-	A			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr15:41022163_41022164insA	ENST00000267868.3	+	9	1155_1156	c.887_888insA	c.(886-891)tcaacafs	p.T297fs	RAD51_ENST00000557850.1_Frame_Shift_Ins_p.T200fs|RAD51_ENST00000530766.1_Intron|RAD51_ENST00000382643.3_Frame_Shift_Ins_p.T298fs|RAD51_ENST00000532743.1_Frame_Shift_Ins_p.T298fs|RAD51_ENST00000423169.2_Intron	NM_002875.4	NP_002866.2	Q06609	RAD51_HUMAN	RAD51 recombinase	297					ATP catabolic process (GO:0006200)|cellular response to camptothecin (GO:0072757)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to ionizing radiation (GO:0071479)|DNA recombinase assembly (GO:0000730)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA unwinding involved in DNA replication (GO:0006268)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|meiotic nuclear division (GO:0007126)|mitotic recombination (GO:0006312)|positive regulation of DNA ligation (GO:0051106)|protein homooligomerization (GO:0051260)|reciprocal meiotic recombination (GO:0007131)|regulation of double-strand break repair via homologous recombination (GO:0010569)	condensed chromosome (GO:0000793)|condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|lateral element (GO:0000800)|mitochondrion (GO:0005739)|nuclear chromosome (GO:0000228)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|PML body (GO:0016605)	ATP binding (GO:0005524)|damaged DNA binding (GO:0003684)|DNA polymerase binding (GO:0070182)|double-stranded DNA binding (GO:0003690)|identical protein binding (GO:0042802)|protein C-terminus binding (GO:0008022)|single-stranded DNA binding (GO:0003697)|single-stranded DNA-dependent ATPase activity (GO:0043142)			breast(2)|endometrium(1)|kidney(3)|large_intestine(1)|lung(1)|ovary(1)	9		all_cancers(109;1.19e-18)|all_epithelial(112;2.33e-15)|Lung NSC(122;5.34e-11)|all_lung(180;1.33e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.0946)		GBM - Glioblastoma multiforme(113;1.45e-05)|BRCA - Breast invasive adenocarcinoma(123;0.000421)|COAD - Colon adenocarcinoma(120;0.163)		GCCCATGCATCAACAACCAGGT	0.406								Homologous recombination																													p.S297fs		.	.											.	RAD51	.	.	0			c.890_891insA						.																																			SO:0001589	frameshift_variant	5888	exon9			.	D13804	CCDS10062.1, CCDS53931.1, CCDS53932.1	15q15.1	2014-06-12	2013-07-02		ENSG00000051180	ENSG00000051180			9817	protein-coding gene	gene with protein product	"""BRCA1/BRCA2-containing complex, subunit 5"""	179617	"""RAD51 (S. cerevisiae) homolog (E coli RecA homolog)"", ""RAD51 homolog (RecA homolog, E. coli) (S. cerevisiae)"", ""RAD51 homolog (S. cerevisiae)"""	RAD51A, RECA		8358431, 8479919	Standard	NM_002875		Approved	HsRad51, HsT16930, BRCC5	uc010bbx.3	Q06609	OTTHUMG00000130067	ENST00000267868.3:c.889dupA	15.37:g.41022165_41022165dupA	ENSP00000267868:p.Thr297fs	185.0	0.0		164.0	10.0	NM_133487	B0FXP0|B2R8T6|Q6FHX9|Q6ZNA8|Q9BV60	Frame_Shift_Ins	INS	ENST00000267868.3	37	CCDS10062.1																																																																																			.	.		0.406	RAD51-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000252358.1	NM_002875, NM_133487	
RRP12	23223	hgsc.bcm.edu	37	10	99116875	99116876	+	Frame_Shift_Ins	INS	-	-	T			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr10:99116875_99116876insT	ENST00000370992.4	-	34	3980_3981	c.3869_3870insA	c.(3868-3870)aacfs	p.N1290fs	RRP12_ENST00000536831.1_Frame_Shift_Ins_p.N1008fs|RRP12_ENST00000414986.1_Frame_Shift_Ins_p.N1229fs|RRP12_ENST00000315563.6_Frame_Shift_Ins_p.N1190fs|RRP12_ENST00000479481.1_5'UTR	NM_015179.3	NP_055994.2	Q5JTH9	RRP12_HUMAN	ribosomal RNA processing 12 homolog (S. cerevisiae)	1290						integral component of membrane (GO:0016021)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)	p.N1290S(1)		NS(1)|breast(2)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(5)|large_intestine(2)|lung(13)|ovary(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	37		Colorectal(252;0.162)		Epithelial(162;2.72e-09)|all cancers(201;1.76e-07)		CCTTTCTGCGGTTTTTGTGTCC	0.639																																					p.N1290fs		.	.											.	RRP12	.	.	1	Substitution - Missense(1)	kidney(1)	c.3870_3871insA						.																																			SO:0001589	frameshift_variant	23223	exon34			.		CCDS7457.1, CCDS44467.1, CCDS60605.1	10q24.2	2006-11-06	2006-11-06	2006-11-06	ENSG00000052749	ENSG00000052749			29100	protein-coding gene	gene with protein product			"""KIAA0690"""	KIAA0690		9734811	Standard	NM_015179		Approved		uc001knf.3	Q5JTH9	OTTHUMG00000018855	ENST00000370992.4:c.3870dupA	10.37:g.99116880_99116880dupT	ENSP00000360031:p.Asn1290fs	104.0	0.0		118.0	10.0	NM_015179	B4DK00|E9PCK7|Q5JTH8|Q69YK4|Q96E87|Q9BUH3|Q9Y4C7	Frame_Shift_Ins	INS	ENST00000370992.4	37	CCDS7457.1																																																																																			.	.		0.639	RRP12-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000049699.4	NM_015179	
FCGBP	8857	hgsc.bcm.edu	37	19	40400622	40400623	+	Frame_Shift_Ins	INS	-	-	G			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr19:40400622_40400623insG	ENST00000221347.6	-	12	5473_5474	c.5466_5467insC	c.(5464-5469)cccaacfs	p.N1823fs		NM_003890.2	NP_003881.2	Q9Y6R7	FCGBP_HUMAN	Fc fragment of IgG binding protein	1823	VWFD 4. {ECO:0000255|PROSITE- ProRule:PRU00580}.					extracellular vesicular exosome (GO:0070062)				NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(5)|endometrium(13)|kidney(9)|large_intestine(27)|lung(49)|ovary(8)|pancreas(3)|prostate(13)|skin(9)|stomach(9)|upper_aerodigestive_tract(6)|urinary_tract(3)	165	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)			TGGTCATTGTTGGGGTTGCGGT	0.619																																					p.N1823fs		.	.											.	FCGBP	.	.	0			c.5467_5468insC						.																																			SO:0001589	frameshift_variant	8857	exon12			.	D84239		19q13.2	2013-09-20			ENSG00000090920	ENSG00000275395			13572	protein-coding gene	gene with protein product	"""IgG Fc binding protein"", ""Human Fc gamma BP"""					9182547	Standard	NM_003890		Approved	FC(GAMMA)BP	uc002omp.4	Q9Y6R7	OTTHUMG00000182580	ENST00000221347.6:c.5467dupC	19.37:g.40400626_40400626dupG	ENSP00000221347:p.Asn1823fs	256.0	0.0		226.0	14.0	NM_003890	O95784	Frame_Shift_Ins	INS	ENST00000221347.6	37	CCDS12546.1																																																																																			.	.		0.619	FCGBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462507.1	NM_003890	
ATP6V1D	51382	hgsc.bcm.edu	37	14	67819690	67819691	+	Frame_Shift_Ins	INS	-	-	T			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr14:67819690_67819691insT	ENST00000216442.7	-	2	658_659	c.108_109insA	c.(106-111)aaatctfs	p.S37fs	ATP6V1D_ENST00000555431.1_Intron|ATP6V1D_ENST00000554236.1_Frame_Shift_Ins_p.S37fs|ATP6V1D_ENST00000555474.1_Frame_Shift_Ins_p.S37fs	NM_015994.3	NP_057078.1	Q9Y5K8	VATD_HUMAN	ATPase, H+ transporting, lysosomal 34kDa, V1 subunit D	37					cellular iron ion homeostasis (GO:0006879)|cilium assembly (GO:0042384)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|protein localization to cilium (GO:0061512)|proton transport (GO:0015992)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|vacuolar proton-transporting V-type ATPase complex (GO:0016471)	ATPase activity, coupled to transmembrane movement of substances (GO:0042626)			lung(3)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	7				all cancers(60;0.000739)|OV - Ovarian serous cystadenocarcinoma(108;0.00597)|BRCA - Breast invasive adenocarcinoma(234;0.00957)		AAGGCATCAGATTTTTTCTTCA	0.347																																					p.S37fs		.	.											.	ATP6V1D	.	.	0			c.109_110insA						.																																			SO:0001589	frameshift_variant	51382	exon2			.	AF145316	CCDS9780.1	14q23-q24.2	2010-04-21	2002-08-29	2002-05-10	ENSG00000100554	ENSG00000100554		"""ATPases / V-type"""	13527	protein-coding gene	gene with protein product		609398	"""ATPase, H+ transporting, lysosomal (vacuolar proton pump)"""	ATP6M		9442887	Standard	NM_015994		Approved	VATD, VMA8	uc001xjf.3	Q9Y5K8		ENST00000216442.7:c.109dupA	14.37:g.67819696_67819696dupT	ENSP00000216442:p.Ser37fs	202.0	0.0		184.0	11.0	NM_015994	B2RE33|Q9Y688	Frame_Shift_Ins	INS	ENST00000216442.7	37	CCDS9780.1																																																																																			.	.		0.347	ATP6V1D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412511.1	NM_015994	
FILIP1L	11259	hgsc.bcm.edu	37	3	99568989	99568990	+	Frame_Shift_Ins	INS	-	-	T			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr3:99568989_99568990insT	ENST00000354552.3	-	5	2000_2001	c.1530_1531insA	c.(1528-1533)aaattafs	p.L511fs	FILIP1L_ENST00000383694.2_Frame_Shift_Ins_p.L271fs|FILIP1L_ENST00000471562.1_Frame_Shift_Ins_p.L271fs|FILIP1L_ENST00000476723.1_Intron|CMSS1_ENST00000496116.1_Intron|CMSS1_ENST00000421999.2_Intron|FILIP1L_ENST00000331335.5_Frame_Shift_Ins_p.L511fs|FILIP1L_ENST00000487087.1_Frame_Shift_Ins_p.L87fs	NM_182909.2	NP_878913.2	Q4L180	FIL1L_HUMAN	filamin A interacting protein 1-like	511						cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)				breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(11)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	35						GTTTTCTTTAATTTTTCACTCA	0.322																																					p.L511fs		.	.											.	FILIP1L	.	.	0			c.1531_1532insA						.																																			SO:0001589	frameshift_variant	11259	exon5			.		CCDS43117.1, CCDS43118.1, CCDS43119.1, CCDS63700.1, CCDS74969.1	3q12.1	2011-10-21			ENSG00000168386	ENSG00000168386			24589	protein-coding gene	gene with protein product	"""downregulated in ovarian cancer 1"", ""GPBP-interacting protein of 130 kDa"""	612993				8314147, 15935955, 21832087	Standard	NM_001282793		Approved	DOC-1, GIP130	uc003dtm.3	Q4L180	OTTHUMG00000159055	ENST00000354552.3:c.1531dupA	3.37:g.99568994_99568994dupT	ENSP00000346560:p.Leu511fs	276.0	0.0		232.0	15.0	NM_182909	B2CNV7|B2CNV8|Q13597|Q2YDY5|Q6KFX5|Q6KFX6|Q6KFX7|Q8IUM3|Q8N6Z0	Frame_Shift_Ins	INS	ENST00000354552.3	37	CCDS43117.1																																																																																			.	.		0.322	FILIP1L-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000353069.1	NM_014890	
WDTC1	23038	hgsc.bcm.edu	37	1	27622887	27622888	+	Frame_Shift_Ins	INS	-	-	G	rs267598533		TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr1:27622887_27622888insG	ENST00000319394.3	+	10	1479_1480	c.944_945insG	c.(943-948)tcggggfs	p.SG315fs	WDTC1_ENST00000361771.3_Frame_Shift_Ins_p.SG315fs	NM_001276252.1|NM_015023.3	NP_001263181.1|NP_055838.2	Q8N5D0	WDTC1_HUMAN	WD and tetratricopeptide repeats 1	315					cellular chemical homeostasis (GO:0055082)|cellular response to insulin stimulus (GO:0032869)|glucose metabolic process (GO:0006006)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|negative regulation of fatty acid biosynthetic process (GO:0045717)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|protein ubiquitination (GO:0016567)|regulation of cell size (GO:0008361)	cytosol (GO:0005829)|nucleus (GO:0005634)	enzyme inhibitor activity (GO:0004857)			central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(7)|lung(5)|ovary(1)|skin(1)	21		all_cancers(24;3.12e-19)|all_epithelial(13;4.18e-18)|Colorectal(325;0.000147)|all_lung(284;0.000366)|Lung NSC(340;0.000548)|Renal(390;0.00211)|Breast(348;0.00257)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0707)|all_neural(195;0.0966)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0443)|OV - Ovarian serous cystadenocarcinoma(117;1.09e-27)|Colorectal(126;8.83e-09)|COAD - Colon adenocarcinoma(152;1.02e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000544)|KIRC - Kidney renal clear cell carcinoma(1967;0.00201)|STAD - Stomach adenocarcinoma(196;0.00321)|READ - Rectum adenocarcinoma(331;0.0476)		TGCCACTCCTCGGGGGGTAAGT	0.52																																					p.S315fs		.	.											.	WDTC1	.	.	0			c.944_945insG						.																																			SO:0001589	frameshift_variant	23038	exon10			.	AK023778	CCDS296.1, CCDS60044.1	1p35.3	2013-01-11			ENSG00000142784	ENSG00000142784		"""DDB1 and CUL4 associated factors"", ""WD repeat domain containing"", ""Tetratricopeptide (TTC) repeat domain containing"""	29175	protein-coding gene	gene with protein product	"""adipose homolog (Drosophila)"", ""DDB1 and CUL4 associated factor 9"""					12717455, 19238144	Standard	NM_015023		Approved	KIAA1037, ADP, DCAF9	uc009vst.3	Q8N5D0	OTTHUMG00000004273	ENST00000319394.3:c.949dupG	1.37:g.27622893_27622893dupG	ENSP00000317971:p.Ser315fs	415.0	0.0		237.0	17.0	NM_015023	D3DPL5|Q5SSC5|Q9NV87|Q9UPW4	Frame_Shift_Ins	INS	ENST00000319394.3	37																																																																																				.	.		0.520	WDTC1-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_015023	
DST	667	hgsc.bcm.edu	37	6	56472828	56472829	+	Frame_Shift_Ins	INS	-	-	T			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr6:56472828_56472829insT	ENST00000361203.3	-	36	5971_5972	c.5964_5965insA	c.(5962-5967)aaattafs	p.L1989fs	DST_ENST00000370754.5_Frame_Shift_Ins_p.L2167fs|DST_ENST00000370769.4_Frame_Shift_Ins_p.L1989fs|DST_ENST00000244364.6_Intron|DST_ENST00000446842.2_Frame_Shift_Ins_p.L1663fs|DST_ENST00000370788.2_Intron|DST_ENST00000312431.6_Frame_Shift_Ins_p.L1989fs|DST_ENST00000421834.2_Intron			Q03001	DYST_HUMAN	dystonin	1989					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cytoplasmic microtubule organization (GO:0031122)|cytoskeleton organization (GO:0007010)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|maintenance of cell polarity (GO:0030011)|microtubule cytoskeleton organization (GO:0000226)|regulation of microtubule polymerization or depolymerization (GO:0031110)|response to wounding (GO:0009611)|retrograde axon cargo transport (GO:0008090)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integral component of membrane (GO:0016021)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|neurofilament cytoskeleton (GO:0060053)|nucleus (GO:0005634)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|microtubule plus-end binding (GO:0051010)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)			NS(1)|breast(5)|central_nervous_system(8)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(43)|ovary(7)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	105	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			GATAGAAATAATTTTTTAGTTT	0.381																																					.		.	.											.	.	.	.	0			.						.																																			SO:0001589	frameshift_variant	100873774	.			.	M22942, M69225	CCDS4959.1, CCDS47443.1, CCDS75474.1	6p12.1	2013-01-10	2004-06-25	2004-07-01	ENSG00000151914	ENSG00000151914		"""EF-hand domain containing"""	1090	protein-coding gene	gene with protein product		113810	"""bullous pemphigoid antigen 1, 230/240kDa"""	BPAG1		2461961, 2276744	Standard	NM_001144770		Approved	BP240, KIAA0728, FLJ21489, FLJ13425, FLJ32235, FLJ30627, CATX-15, BPA, MACF2	uc021zba.2	Q03001	OTTHUMG00000014913	ENST00000361203.3:c.5965dupA	6.37:g.56472834_56472834dupT	ENSP00000354508:p.Leu1989fs	153.0	0.0		191.0	13.0	.	B7Z3H1|O94833|Q12825|Q13266|Q13267|Q13775|Q5TBT0|Q5TBT2|Q5TF23|Q5TF24|Q8N1T8|Q8N8J3|Q8WXK8|Q8WXK9|Q96AK9|Q96DQ5|Q96J76|Q96QT5|Q9H555|Q9UGD7|Q9UGD8|Q9UN10	RNA	INS	ENST00000361203.3	37																																																																																				.	.		0.381	DST-004	NOVEL	not_organism_supported|basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000041021.3	NM_001723	
OR2A12	346525	hgsc.bcm.edu	37	7	143792820	143792821	+	Frame_Shift_Ins	INS	-	-	G			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr7:143792820_143792821insG	ENST00000408949.2	+	1	680_681	c.620_621insG	c.(619-624)gtggggfs	p.VG207fs		NM_001004135.1	NP_001004135.1	Q8NGT7	O2A12_HUMAN	olfactory receptor, family 2, subfamily A, member 12	207						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(4)|lung(14)|ovary(2)	25	Melanoma(164;0.0783)					TTCATCTTAGTGGGGCCGCTCT	0.54																																					p.V207fs		.	.											.	OR2A12	.	.	0			c.620_621insG						.																																			SO:0001589	frameshift_variant	346525	exon1			.		CCDS43670.1	7q35	2013-09-20	2002-11-13	2002-11-13	ENSG00000221858	ENSG00000221858		"""GPCR / Class A : Olfactory receptors"""	15082	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily A, member 12 pseudogene"""	OR2A12P			Standard	NM_001004135		Approved		uc011kty.2	Q8NGT7	OTTHUMG00000157996	ENST00000408949.2:c.624dupG	7.37:g.143792824_143792824dupG	ENSP00000386174:p.Val207fs	133.0	0.0		143.0	10.0	NM_001004135	Q6IF43	Frame_Shift_Ins	INS	ENST00000408949.2	37	CCDS43670.1																																																																																			.	.		0.540	OR2A12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349969.1		
BMPR2	659	hgsc.bcm.edu	37	2	203420129	203420130	+	Frame_Shift_Ins	INS	-	-	A			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr2:203420129_203420130insA	ENST00000374580.4	+	12	2280_2281	c.1741_1742insA	c.(1741-1743)gaafs	p.E581fs	BMPR2_ENST00000374574.2_Intron	NM_001204.6	NP_001195.2	Q13873	BMPR2_HUMAN	bone morphogenetic protein receptor, type II (serine/threonine kinase)	581					activin receptor signaling pathway (GO:0032924)|anterior/posterior pattern specification (GO:0009952)|artery development (GO:0060840)|blood vessel remodeling (GO:0001974)|BMP signaling pathway (GO:0030509)|brain development (GO:0007420)|cellular response to starvation (GO:0009267)|chondrocyte development (GO:0002063)|limb development (GO:0060173)|lung alveolus development (GO:0048286)|lymphangiogenesis (GO:0001946)|lymphatic endothelial cell differentiation (GO:0060836)|mesoderm formation (GO:0001707)|negative regulation of cell growth (GO:0030308)|negative regulation of chondrocyte proliferation (GO:1902731)|negative regulation of DNA biosynthetic process (GO:2000279)|negative regulation of systemic arterial blood pressure (GO:0003085)|negative regulation of vasoconstriction (GO:0045906)|positive regulation of axon extension involved in axon guidance (GO:0048842)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of bone mineralization (GO:0030501)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|regulation of cell proliferation (GO:0042127)|regulation of lung blood pressure (GO:0014916)|retina vasculature development in camera-type eye (GO:0061298)|transcription from RNA polymerase II promoter (GO:0006366)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|venous blood vessel development (GO:0060841)	apical plasma membrane (GO:0016324)|basal plasma membrane (GO:0009925)|caveola (GO:0005901)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular space (GO:0005615)|fully spanning plasma membrane (GO:0044214)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	activin receptor activity, type II (GO:0016362)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|transforming growth factor beta-activated receptor activity (GO:0005024)			autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(6)|large_intestine(11)|lung(7)|ovary(4)|pancreas(1)|skin(1)|stomach(1)|urinary_tract(2)	42						GACTATAGGGGAAAAAAACCGA	0.441																																					p.E581fs		.	.											.	BMPR2	.	.	0			c.1741_1742insA						.																																			SO:0001589	frameshift_variant	659	exon12			.	Z48923	CCDS33361.1	2q33-q34	2014-09-17			ENSG00000204217	ENSG00000204217			1078	protein-coding gene	gene with protein product		600799	"""primary pulmonary hypertension 1"""	PPH1		7791754	Standard	NM_001204		Approved	BRK-3, T-ALK, BMPR3, BMPR-II	uc002uzf.4	Q13873	OTTHUMG00000133617	ENST00000374580.4:c.1748dupA	2.37:g.203420136_203420136dupA	ENSP00000363708:p.Glu581fs	178.0	0.0		184.0	12.0	NM_001204	Q13161|Q16569|Q4ZG08|Q53SA5|Q585T8	Frame_Shift_Ins	INS	ENST00000374580.4	37	CCDS33361.1																																																																																			.	.		0.441	BMPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257743.1	NM_001204	
THRAP3	9967	hgsc.bcm.edu	37	1	36755000	36755001	+	Frame_Shift_Ins	INS	-	-	A	rs374538181		TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr1:36755000_36755001insA	ENST00000354618.5	+	5	1604_1605	c.1380_1381insA	c.(1381-1383)aaafs	p.K461fs	THRAP3_ENST00000469141.2_Frame_Shift_Ins_p.K461fs	NM_005119.3	NP_005110.2	Q9Y2W1	TR150_HUMAN	thyroid hormone receptor associated protein 3	461	Required for mRNA decay activity.				androgen receptor signaling pathway (GO:0030521)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|mRNA processing (GO:0006397)|mRNA stabilization (GO:0048255)|nuclear-transcribed mRNA catabolic process (GO:0000956)|positive regulation of mRNA splicing, via spliceosome (GO:0048026)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|RNA splicing (GO:0008380)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|phosphoprotein binding (GO:0051219)|poly(A) RNA binding (GO:0044822)|receptor activity (GO:0004872)|RNA polymerase II transcription cofactor activity (GO:0001104)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)			breast(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(9)|lung(12)|ovary(5)|stomach(1)	37		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)				TAGGTGCAAACAAAAACCAGGA	0.455			T	USP6	aneurysmal bone cysts																																p.N460fs	Pancreas(129;785 1795 20938 23278 32581)	.	.		Dom	yes		1	1p34.3	9967	thyroid hormone receptor associated protein 3 (TRAP150)		M	.	THRAP3	.	.	0			c.1380_1381insA						.																																			SO:0001589	frameshift_variant	9967	exon5			.	AF117756	CCDS405.1	1p34.3	2008-02-05			ENSG00000054118	ENSG00000054118			22964	protein-coding gene	gene with protein product		603809					Standard	NM_005119		Approved	TRAP150	uc001cae.4	Q9Y2W1	OTTHUMG00000007866	ENST00000354618.5:c.1385dupA	1.37:g.36755005_36755005dupA	ENSP00000346634:p.Lys461fs	126.0	0.0		128.0	10.0	NM_005119	D3DPS5|Q5VTK6	Frame_Shift_Ins	INS	ENST00000354618.5	37	CCDS405.1																																																																																			.	.		0.455	THRAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021688.2	NM_005119	
SLCO1A2	6579	hgsc.bcm.edu	37	12	21453394	21453395	+	Frame_Shift_Ins	INS	-	-	A			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr12:21453394_21453395insA	ENST00000307378.6	-	9	1517_1518	c.797_798insT	c.(796-798)ttgfs	p.L266fs	SLCO1A2_ENST00000458504.1_Frame_Shift_Ins_p.L134fs|SLCO1A2_ENST00000537524.1_Frame_Shift_Ins_p.L134fs|SLCO1A2_ENST00000390670.3_Frame_Shift_Ins_p.L264fs|SLCO1A2_ENST00000452078.1_Frame_Shift_Ins_p.L266fs	NM_134431.3	NP_602307.1	P46721	SO1A2_HUMAN	solute carrier organic anion transporter family, member 1A2	266					bile acid and bile salt transport (GO:0015721)|bile acid metabolic process (GO:0008206)|organic anion transport (GO:0015711)|small molecule metabolic process (GO:0044281)|sodium-independent organic anion transport (GO:0043252)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	organic anion transmembrane transporter activity (GO:0008514)			breast(2)|endometrium(2)|kidney(4)|large_intestine(8)|lung(23)|ovary(1)|pancreas(1)|skin(6)|upper_aerodigestive_tract(1)	48					Aminohippurate(DB00345)|Atorvastatin(DB01076)|Bumetanide(DB00887)|Chlorambucil(DB00291)|Conjugated Estrogens(DB00286)|Cyclosporine(DB00091)|Dexamethasone(DB01234)|Digitoxin(DB01396)|Digoxin(DB00390)|Dinoprostone(DB00917)|Enalapril(DB00584)|Erythromycin(DB00199)|Estradiol(DB00783)|Estriol(DB04573)|Estrone(DB00655)|Fexofenadine(DB00950)|Glyburide(DB01016)|Hydrocortisone(DB00741)|Ibuprofen(DB01050)|Indinavir(DB00224)|Indomethacin(DB00328)|Ketoconazole(DB01026)|Ketoprofen(DB01009)|Levothyroxine(DB00451)|Liothyronine(DB00279)|Liotrix(DB01583)|Lovastatin(DB00227)|Methotrexate(DB00563)|Methyltestosterone(DB06710)|Mirabegron(DB08893)|Naloxone(DB01183)|Naproxen(DB00788)|Nelfinavir(DB00220)|Ouabain(DB01092)|Pravastatin(DB00175)|Prednisolone(DB00860)|Prednisone(DB00635)|Probenecid(DB01032)|Quinidine(DB00908)|Quinine(DB00468)|Rifampicin(DB01045)|Ritonavir(DB00503)|Rocuronium(DB00728)|Rosuvastatin(DB01098)|Saquinavir(DB01232)|Simvastatin(DB00641)|Spironolactone(DB00421)|Sumatriptan(DB00669)|Tauroursodeoxycholic acid(DB08834)|Testosterone(DB00624)|Tolbutamide(DB01124)|Ursodeoxycholic acid(DB01586)|Verapamil(DB00661)	GTGTGTTGGGCAAAAAGAAAAA	0.406																																					p.L266fs		.	.											.	SLCO1A2	.	.	0			c.798_799insT						.																																			SO:0001589	frameshift_variant	6579	exon9			.		CCDS8686.1	12p12	2013-05-22	2003-11-25	2003-11-26	ENSG00000084453	ENSG00000084453		"""Solute carriers"""	10956	protein-coding gene	gene with protein product		602883	"""solute carrier family 21 (organic anion transporter), member 3"""	SLC21A3		9007731	Standard	NM_134431		Approved	OATP, OATP1A2, OATP-A	uc001rer.3	P46721	OTTHUMG00000156259	ENST00000307378.6:c.798dupT	12.37:g.21453399_21453399dupA	ENSP00000305974:p.Leu266fs	188.0	0.0		214.0	13.0	NM_134431	Q9UGP7|Q9UL38	Frame_Shift_Ins	INS	ENST00000307378.6	37	CCDS8686.1																																																																																			.	.		0.406	SLCO1A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343648.3	NM_021094	
ANKRD12	23253	hgsc.bcm.edu	37	18	9255075	9255076	+	Frame_Shift_Ins	INS	-	-	A			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr18:9255075_9255076insA	ENST00000262126.4	+	9	2050_2051	c.1810_1811insA	c.(1810-1812)gaafs	p.E604fs	ANKRD12_ENST00000400020.3_Frame_Shift_Ins_p.E581fs|ANKRD12_ENST00000383440.2_Frame_Shift_Ins_p.E581fs	NM_015208.4	NP_056023.3	Q6UB98	ANR12_HUMAN	ankyrin repeat domain 12	604				E -> K (in Ref. 5; CAH56382). {ECO:0000305}.		cytoplasm (GO:0005737)|nucleus (GO:0005634)				NS(1)|breast(3)|central_nervous_system(2)|endometrium(8)|kidney(2)|large_intestine(20)|lung(18)|ovary(3)|pancreas(1)|prostate(4)|skin(1)|urinary_tract(2)	65						TAAGCATAAGGAAAAAAGCAAA	0.317																																					p.E604fs		.	.											.	ANKRD12	.	.	0			c.1810_1811insA						.																																			SO:0001589	frameshift_variant	23253	exon9			.	AY373757	CCDS11843.1, CCDS42411.1	18p11.22	2013-01-10			ENSG00000101745	ENSG00000101745		"""Ankyrin repeat domain containing"""	29135	protein-coding gene	gene with protein product		610616				10048485	Standard	NM_001204056		Approved	KIAA0874, FLJ20053, GAC-1	uc002knv.3	Q6UB98	OTTHUMG00000131595	ENST00000262126.4:c.1816dupA	18.37:g.9255081_9255081dupA	ENSP00000262126:p.Glu604fs	280.0	0.0		198.0	14.0	NM_015208	O94951|Q658K1|Q6QMF7|Q9H231|Q9H784	Frame_Shift_Ins	INS	ENST00000262126.4	37	CCDS11843.1																																																																																			.	.		0.317	ANKRD12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254478.2	NM_015208	
CYLC1	1538	hgsc.bcm.edu	37	X	83128980	83128981	+	Frame_Shift_Ins	INS	-	-	A			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chrX:83128980_83128981insA	ENST00000329312.4	+	4	1301_1302	c.1264_1265insA	c.(1264-1266)gaafs	p.E422fs		NM_021118.1	NP_066941.1	P35663	CYLC1_HUMAN	cylicin, basic protein of sperm head cytoskeleton 1	422					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	acrosomal matrix (GO:0043159)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)	p.E421K(1)|p.K423fs*69(1)		NS(2)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(11)|liver(1)|lung(22)|ovary(4)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	58						TCAGAAAGATGAAAAAAAGGAT	0.342																																					p.E422fs		.	.											CYLC1,NS,malignant_melanoma,0	CYLC1	.	.	2	Substitution - Missense(1)|Deletion - Frameshift(1)	lung(1)|skin(1)	c.1264_1265insA						.																																			SO:0001589	frameshift_variant	1538	exon4			.	Z22780	CCDS35341.1, CCDS75998.1	Xq21.1	2008-07-31			ENSG00000183035	ENSG00000183035			2582	protein-coding gene	gene with protein product	"""cylicin 1"""	300768				7737358, 8354692	Standard	NM_021118		Approved		uc004eei.2	P35663	OTTHUMG00000021922	ENST00000329312.4:c.1271dupA	X.37:g.83128987_83128987dupA	ENSP00000331556:p.Glu422fs	136.0	0.0		149.0	10.0	NM_021118	A0AVQ8|Q5JQQ9	Frame_Shift_Ins	INS	ENST00000329312.4	37	CCDS35341.1																																																																																			.	.		0.342	CYLC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057371.1	NM_021118	
DOPEY1	23033	hgsc.bcm.edu	37	6	83847672	83847673	+	Frame_Shift_Ins	INS	-	-	A			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr6:83847672_83847673insA	ENST00000349129.2	+	21	4171_4172	c.3911_3912insA	c.(3910-3915)agaaaafs	p.RK1304fs	DOPEY1_ENST00000484282.1_3'UTR|DOPEY1_ENST00000237163.5_Frame_Shift_Ins_p.RK1285fs|DOPEY1_ENST00000369739.3_Frame_Shift_Ins_p.RK1295fs	NM_015018.3	NP_055833.2	Q5JWR5	DOP1_HUMAN	dopey family member 1	1304					protein transport (GO:0015031)					breast(4)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(16)|ovary(5)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)	67		all_cancers(76;2.29e-06)|Acute lymphoblastic leukemia(125;3.41e-06)|all_hematologic(105;0.000865)|all_epithelial(107;0.00203)		BRCA - Breast invasive adenocarcinoma(397;0.053)		AAACTTGCCAGAAAAAAGGATG	0.347																																					p.R1304fs		.	.											.	DOPEY1	.	.	0			c.3911_3912insA						.																																			SO:0001589	frameshift_variant	23033	exon21			.	AK027030	CCDS4996.1, CCDS64467.1	6q15	2013-03-05	2006-02-02	2006-02-02	ENSG00000083097	ENSG00000083097			21194	protein-coding gene	gene with protein product			"""KIAA1117"""	KIAA1117		16301316, 16303751, 10931277	Standard	NM_015018		Approved	dJ202D23.2	uc011dyy.2	Q5JWR5	OTTHUMG00000016365	ENST00000349129.2:c.3917dupA	6.37:g.83847678_83847678dupA	ENSP00000195654:p.Arg1304fs	132.0	0.0		144.0	11.0	NM_015018	Q86XV1|Q9H5J5|Q9NSL4|Q9UPN5|Q9Y414	Frame_Shift_Ins	INS	ENST00000349129.2	37	CCDS4996.1																																																																																			.	.		0.347	DOPEY1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043785.2	NM_015018	
DLK2	65989	hgsc.bcm.edu	37	6	43418412	43418413	+	Frame_Shift_Ins	INS	-	-	G	rs200290716		TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr6:43418412_43418413insG	ENST00000357338.3	-	6	1716_1717	c.1016_1017insC	c.(1015-1017)cctfs	p.P339fs	DLK2_ENST00000414245.1_Frame_Shift_Ins_p.P333fs|DLK2_ENST00000372488.3_Frame_Shift_Ins_p.P339fs|DLK2_ENST00000372485.1_Frame_Shift_Ins_p.P333fs	NM_206539.1	NP_996262.1	Q6UY11	DLK2_HUMAN	delta-like 2 homolog (Drosophila)	339					negative regulation of Notch signaling pathway (GO:0045746)|regulation of fat cell differentiation (GO:0045598)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)			breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(1)|upper_aerodigestive_tract(1)	7	all_lung(25;0.00536)		Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0152)|OV - Ovarian serous cystadenocarcinoma(102;0.0804)			AACAGGGTCCAGGGGGGCAGAC	0.658																																					p.P339fs		.	.											.	DLK2	.	.	0			c.1017_1018insC						.																																			SO:0001589	frameshift_variant	65989	exon6			.	AK055380	CCDS4897.1, CCDS75461.1	6p21.1	2008-02-05	2007-07-05	2007-07-05	ENSG00000171462	ENSG00000171462			21113	protein-coding gene	gene with protein product			"""EGF-like-domain, multiple 9"""	EGFL9			Standard	NM_001286656		Approved	MGC2487	uc003ovb.3	Q6UY11	OTTHUMG00000014735	ENST00000357338.3:c.1017dupC	6.37:g.43418418_43418418dupG	ENSP00000349893:p.Pro339fs	182.0	0.0		143.0	12.0	NM_023932	B3KNZ7|Q5T3T8|Q9BQ54	Frame_Shift_Ins	INS	ENST00000357338.3	37	CCDS4897.1																																																																																			.	.		0.658	DLK2-003	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040618.1	NM_023932	
PSMD13	5719	hgsc.bcm.edu	37	11	244104	244105	+	Intron	INS	-	-	G	rs373900649		TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr11:244104_244105insG	ENST00000532097.1	+	3	713				PSMD13_ENST00000431206.2_Frame_Shift_Ins_p.E54fs|PSMD13_ENST00000352303.5_Intron	NM_002817.3	NP_002808.3	Q9UNM6	PSD13_HUMAN	proteasome (prosome, macropain) 26S subunit, non-ATPase, 13						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|meiosis I (GO:0007127)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)|proteasome regulatory particle (GO:0005838)				NS(1)|large_intestine(2)|lung(5)|ovary(1)|skin(1)	10		all_cancers(49;1.58e-09)|all_epithelial(84;2.71e-06)|Breast(177;0.000162)|Ovarian(85;0.000626)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.0538)|all_lung(207;0.0713)		all cancers(45;7.79e-27)|Epithelial(43;4e-26)|OV - Ovarian serous cystadenocarcinoma(40;6.02e-21)|BRCA - Breast invasive adenocarcinoma(625;3.93e-05)|Lung(200;0.112)|LUSC - Lung squamous cell carcinoma(625;0.129)		TTTTTCACTTTGAAAATGAGTG	0.401																																					p.F53fs		.	.											.	PSMD13	.	.	0			c.159_160insG						.																																			SO:0001627	intron_variant	5719	exon2			.	AB009398	CCDS7692.1, CCDS44504.1	11p15.5	2008-05-22			ENSG00000185627	ENSG00000185627		"""Proteasome (prosome, macropain) subunits"""	9558	protein-coding gene	gene with protein product		603481				9714768, 8811196	Standard	NM_002817		Approved	p40.5, Rpn9	uc001loo.2	Q9UNM6	OTTHUMG00000119072	ENST00000532097.1:c.209+29->G	11.37:g.244105_244105dupG		180.0	0.0		154.0	10.0	NM_175932	B3KT15|O75831|Q53XU2|Q9UNV3	Frame_Shift_Ins	INS	ENST00000532097.1	37	CCDS7692.1																																																																																			.	.		0.401	PSMD13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239286.2	NM_002817	
C11orf86	254439	hgsc.bcm.edu	37	11	66742903	66742904	+	Frame_Shift_Ins	INS	-	-	G			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr11:66742903_66742904insG	ENST00000308963.4	+	1	156_157	c.70_71insG	c.(70-72)tggfs	p.W24fs		NM_001136485.1	NP_001129957.1	A6NJI1	CK086_HUMAN	chromosome 11 open reading frame 86	24										NS(1)|skin(1)	2						GCAGGAGCCCTGGGGGAGGCCC	0.663																																					p.W24fs		.	.											.	C11orf86	.	.	0			c.70_71insG						.																																			SO:0001589	frameshift_variant	254439	exon1			.	AK026328, AP003176	CCDS44656.1	11q13.1	2012-08-10			ENSG00000173237	ENSG00000173237			34442	protein-coding gene	gene with protein product							Standard	NM_001136485		Approved	FLJ22675	uc010rpm.2	A6NJI1	OTTHUMG00000153671	ENST00000308963.4:c.75dupG	11.37:g.66742908_66742908dupG	ENSP00000311479:p.Trp24fs	125.0	0.0		178.0	11.0	NM_001136485		Frame_Shift_Ins	INS	ENST00000308963.4	37	CCDS44656.1																																																																																			.	.		0.663	C11orf86-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000332022.2	NM_001136485	
TMED9	54732	hgsc.bcm.edu	37	5	177019352	177019354	+	In_Frame_Del	DEL	AGA	AGA	-			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	AGA	AGA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr5:177019352_177019354delAGA	ENST00000332598.6	+	1	194_196	c.137_139delAGA	c.(136-141)gagaag>gag	p.K48del		NM_017510.4	NP_059980.2	Q9BVK6	TMED9_HUMAN	transmembrane emp24 protein transport domain containing 9	48	GOLD. {ECO:0000255|PROSITE- ProRule:PRU00096}.				COPI coating of Golgi vesicle (GO:0048205)|Golgi organization (GO:0007030)|positive regulation of organelle organization (GO:0010638)|protein transport (GO:0015031)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|trans-Golgi network transport vesicle (GO:0030140)	syntaxin binding (GO:0019905)			endometrium(1)|large_intestine(1)|lung(5)|prostate(1)|upper_aerodigestive_tract(2)	10	all_cancers(89;0.00033)|Renal(175;0.000269)|Lung NSC(126;0.00161)|all_lung(126;0.00286)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GGAGAGACGGAGAAGAAGTGCTT	0.64																																					p.46_46del		.	.											.	TMED9	.	.	0			c.136_138del						.																																			SO:0001651	inframe_deletion	54732	exon1			.	AF441399	CCDS4428.1	5q35.3	2008-02-05			ENSG00000184840	ENSG00000184840			24878	protein-coding gene	gene with protein product						12477932	Standard	NM_017510		Approved	HSGP25L2G	uc003mhx.3	Q9BVK6	OTTHUMG00000130859	ENST00000332598.6:c.137_139delAGA	5.37:g.177019355_177019357delAGA	ENSP00000330945:p.Lys48del	280.0	0.0		246.0	34.0	NM_017510	Q14437|Q8WZ61	In_Frame_Del	DEL	ENST00000332598.6	37	CCDS4428.1																																																																																			.	.		0.640	TMED9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253433.1	NM_017510	
LCE1C	353133	hgsc.bcm.edu	37	1	152777757	152777758	+	Frame_Shift_Ins	INS	-	-	C	rs565723067|rs534849272	byFrequency	TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr1:152777757_152777758insC	ENST00000607093.1	-	1	196_197	c.197_198insG	c.(196-198)ggafs	p.G66fs	LCE1C_ENST00000368768.1_Frame_Shift_Ins_p.G66fs			Q5T751	LCE1C_HUMAN	late cornified envelope 1C	66	Gly-rich.				keratinization (GO:0031424)			p.G66E(1)		NS(1)|lung(4)|prostate(1)|skin(2)|urinary_tract(1)	9	Lung NSC(65;9.06e-30)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			AACTGCAGCATCCCCCAGAGCT	0.668																																					p.G66fs		.	.											.	LCE1C	.	.	1	Substitution - Missense(1)	lung(1)	c.198_199insG						.																																			SO:0001589	frameshift_variant	353133	exon2			.		CCDS1026.1	1q21.3	2008-02-05			ENSG00000197084	ENSG00000197084		"""Late cornified envelopes"""	29464	protein-coding gene	gene with protein product		612605				11698679	Standard	NM_001276331		Approved	LEP3	uc001fap.1	Q5T751	OTTHUMG00000012445	ENST00000607093.1:c.198dupG	1.37:g.152777762_152777762dupC	ENSP00000475270:p.Gly66fs	150.0	0.0		161.0	10.0	NM_178351		Frame_Shift_Ins	INS	ENST00000607093.1	37	CCDS1026.1																																																																																			.	.		0.668	LCE1C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034658.2	NM_178351	
TTF1	7270	hgsc.bcm.edu	37	9	135277201	135277202	+	Frame_Shift_Ins	INS	-	-	T			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr9:135277201_135277202insT	ENST00000334270.2	-	2	1046_1047	c.1007_1008insA	c.(1006-1008)aagfs	p.K336fs		NM_001205296.1|NM_007344.3	NP_001192225.1|NP_031370.2	Q15361	TTF1_HUMAN	transcription termination factor, RNA polymerase I	336	Poly-Lys.				chromatin remodeling (GO:0006338)|DNA-templated transcription, termination (GO:0006353)|gene expression (GO:0010467)|negative regulation of DNA replication (GO:0008156)|regulation of transcription, DNA-templated (GO:0006355)|termination of RNA polymerase I transcription (GO:0006363)|transcription from RNA polymerase I promoter (GO:0006360)|transcription initiation from RNA polymerase I promoter (GO:0006361)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			endometrium(3)|kidney(1)|large_intestine(5)|lung(13)|ovary(2)|pancreas(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	30		Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;4.25e-06)|Epithelial(140;9.09e-05)		TGGACTTTTTCTTTTTTTTCTT	0.51																																					p.K336fs		.	.											.	TTF1	.	.	0			c.1008_1009insA						.																																			SO:0001589	frameshift_variant	7270	exon2			.	BC050734	CCDS6948.1, CCDS75925.1	9q34.3	2008-02-05			ENSG00000125482	ENSG00000125482			12397	protein-coding gene	gene with protein product		600777				7597036	Standard	NM_007344		Approved		uc004cbl.3	Q15361	OTTHUMG00000020836	ENST00000334270.2:c.1008dupA	9.37:g.135277209_135277209dupT	ENSP00000333920:p.Lys336fs	164.0	0.0		151.0	10.0	NM_007344	A1L160|Q4VXF3|Q58EY2|Q6P5T5	Frame_Shift_Ins	INS	ENST00000334270.2	37	CCDS6948.1																																																																																			.	.		0.510	TTF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054784.2	NM_007344	
AUTS2	26053	hgsc.bcm.edu	37	7	70255627	70255627	+	Frame_Shift_Del	DEL	A	A	-			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr7:70255627delA	ENST00000342771.4	+	19	3746	c.3425delA	c.(3424-3426)gagfs	p.E1142fs	AUTS2_ENST00000406775.2_Frame_Shift_Del_p.E1118fs	NM_015570.2	NP_056385.1	Q8WXX7	AUTS2_HUMAN	autism susceptibility candidate 2	1142	His-rich.									breast(2)|central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(4)|urinary_tract(1)	50		all_cancers(73;0.0264)|all_epithelial(88;0.0198)|Lung NSC(55;0.0599)|all_lung(88;0.093)		LUSC - Lung squamous cell carcinoma(90;0.082)|Lung(90;0.186)		CCTCGGCGGGAGCACGAGCGG	0.682																																					p.E1142fs		.	.											.	AUTS2	.	.	0			c.3424delG						.						18.0	19.0	19.0					7																	70255627		2197	4290	6487	SO:0001589	frameshift_variant	26053	exon19			.	AF326917	CCDS5539.1, CCDS47601.1, CCDS47602.1	7q11.22	2014-01-06			ENSG00000158321	ENSG00000158321			14262	protein-coding gene	gene with protein product		607270				12160723	Standard	XM_005250257		Approved	KIAA0442, FBRSL2	uc003tvw.4	Q8WXX7	OTTHUMG00000023865	ENST00000342771.4:c.3425delA	7.37:g.70255627delA	ENSP00000344087:p.Glu1142fs	64.0	0.0		58.0	13.0	NM_015570	A4D1Y9|L7QET3|L7QF75|Q5D049|Q6PJU5|Q9Y4F2	Frame_Shift_Del	DEL	ENST00000342771.4	37	CCDS5539.1																																																																																			.	.		0.682	AUTS2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251971.2		
NAPA	8775	hgsc.bcm.edu	37	19	47995348	47995349	+	Frame_Shift_Ins	INS	-	-	G			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr19:47995348_47995349insG	ENST00000263354.3	-	8	888_889	c.589_590insC	c.(589-591)ctcfs	p.L197fs	NAPA_ENST00000595227.1_Frame_Shift_Ins_p.L158fs|NAPA-AS1_ENST00000593284.1_RNA|NAPA-AS1_ENST00000594367.1_RNA	NM_003827.3	NP_003818.2	P54920	SNAA_HUMAN	N-ethylmaleimide-sensitive factor attachment protein, alpha	197					apical protein localization (GO:0045176)|brain development (GO:0007420)|intra-Golgi vesicle-mediated transport (GO:0006891)|intracellular protein transport (GO:0006886)|membrane fusion (GO:0061025)|membrane organization (GO:0061024)|neuron differentiation (GO:0030182)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of synaptic vesicle priming (GO:0010807)|SNARE complex disassembly (GO:0035494)|synaptic transmission, glutamatergic (GO:0035249)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|synaptobrevin 2-SNAP-25-syntaxin-1a complex (GO:0070044)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(3)	11		all_cancers(25;1.55e-10)|all_epithelial(76;3.4e-08)|all_lung(116;1.73e-07)|Lung NSC(112;3.95e-07)|Ovarian(192;0.0139)|all_neural(266;0.026)|Breast(70;0.0503)		OV - Ovarian serous cystadenocarcinoma(262;0.000466)|all cancers(93;0.000739)|Epithelial(262;0.0168)|GBM - Glioblastoma multiforme(486;0.049)		GTACTTGAGGAGGGGGCTGTCC	0.614																																					p.L197fs	Ovarian(185;1135 2042 27703 31345 42493)	.	.											.	NAPA	.	.	0			c.590_591insC						.																																			SO:0001589	frameshift_variant	8775	exon8			.	U39412	CCDS12702.1	19q13.33	2012-08-16			ENSG00000105402	ENSG00000105402			7641	protein-coding gene	gene with protein product	"""alpha SNAP"""	603215				9269766	Standard	NM_003827		Approved		uc002pha.2	P54920		ENST00000263354.3:c.590dupC	19.37:g.47995353_47995353dupG	ENSP00000263354:p.Leu197fs	145.0	0.0		158.0	13.0	NM_003827	A8K879|Q96IK3|Q9BVJ3	Frame_Shift_Ins	INS	ENST00000263354.3	37	CCDS12702.1																																																																																			.	.		0.614	NAPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466048.2	NM_003827	
RXFP4	339403	hgsc.bcm.edu	37	1	155912224	155912225	+	Frame_Shift_Ins	INS	-	-	G			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr1:155912224_155912225insG	ENST00000368318.3	+	1	745_746	c.724_725insG	c.(724-726)aggfs	p.R242fs		NM_181885.2	NP_871001.1	Q8TDU9	RL3R2_HUMAN	relaxin/insulin-like family peptide receptor 4	242						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	angiotensin type II receptor activity (GO:0004945)			endometrium(1)|large_intestine(4)|lung(6)|ovary(1)|skin(1)	13	Hepatocellular(266;0.133)|all_hematologic(923;0.145)|all_neural(408;0.195)					GCAGGACAGCAGGGTCGTGGCC	0.634																																					p.R242fs		.	.											.	RXFP4	.	.	0			c.724_725insG						.																																			SO:0001589	frameshift_variant	339403	exon1			.	AB065617	CCDS1124.1	1q22	2012-08-08	2006-05-09	2006-03-15	ENSG00000173080	ENSG00000173080		"""GPCR / Class A : Relaxin family peptide receptors"""	14666	protein-coding gene	gene with protein product		609043	"""G protein-coupled receptor 100"", ""relaxin 3 receptor 2"", ""relaxin family peptide receptor 4"""	GPR100, RLN3R2		15956688, 16507880	Standard	NM_181885		Approved	GPCR142, RXFPR4	uc010pgs.2	Q8TDU9	OTTHUMG00000017463	ENST00000368318.3:c.727dupG	1.37:g.155912227_155912227dupG	ENSP00000357301:p.Arg242fs	149.0	0.0		158.0	10.0	NM_181885	B0M0L4|Q3MJB1|Q8NGZ8	Frame_Shift_Ins	INS	ENST00000368318.3	37	CCDS1124.1																																																																																			.	.		0.634	RXFP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046203.1	NM_181885	
ANKRD26	22852	hgsc.bcm.edu	37	10	27324037	27324038	+	Frame_Shift_Ins	INS	-	-	T			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr10:27324037_27324038insT	ENST00000376087.4	-	24	3506_3507	c.3341_3342insA	c.(3340-3342)aagfs	p.K1114fs	ANKRD26_ENST00000436985.2_Frame_Shift_Ins_p.K1130fs|ANKRD26_ENST00000376070.3_Frame_Shift_Ins_p.K671fs	NM_001256053.1|NM_014915.2	NP_001242982.1|NP_055730.2	Q9UPS8	ANR26_HUMAN	ankyrin repeat domain 26	1113					glucose homeostasis (GO:0042593)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of multicellular organism growth (GO:0040015)|negative regulation of organ growth (GO:0046621)|regulation of fatty acid metabolic process (GO:0019217)|regulation of feeding behavior (GO:0060259)	actin filament (GO:0005884)|centrosome (GO:0005813)				breast(4)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(14)|lung(30)|ovary(1)|pancreas(1)|prostate(3)|skin(2)|urinary_tract(2)	70						CATTTTGATACTTTTGTTCCAT	0.391																																					p.K1114fs		.	.											.	ANKRD26	.	.	0			c.3342_3343insA						.																																			SO:0001589	frameshift_variant	22852	exon24			.	AB028997	CCDS41499.1	10p12.1	2014-09-17			ENSG00000107890	ENSG00000107890		"""Ankyrin repeat domain containing"""	29186	protein-coding gene	gene with protein product		610855	"""thrombocytopenia 2 (autosomal dominant)"""	THC2		10470851, 21211618	Standard	NM_014915		Approved	KIAA1074	uc009xku.1	Q9UPS8	OTTHUMG00000017851	ENST00000376087.4:c.3342dupA	10.37:g.27324041_27324041dupT	ENSP00000365255:p.Lys1114fs	159.0	0.0		178.0	12.0	NM_014915	A6NH29|Q2TAZ3|Q6ZR14|Q9H1Q1|Q9NSK9|Q9NTD5|Q9NW69	Frame_Shift_Ins	INS	ENST00000376087.4	37	CCDS41499.1																																																																																			.	.		0.391	ANKRD26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047296.1		
XIRP2	129446	hgsc.bcm.edu	37	2	168104502	168104503	+	Frame_Shift_Ins	INS	-	-	A			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr2:168104502_168104503insA	ENST00000409195.1	+	9	6689_6690	c.6600_6601insA	c.(6601-6603)aaafs	p.K2201fs	XIRP2_ENST00000409043.1_Intron|XIRP2_ENST00000409605.1_Intron|XIRP2_ENST00000409273.1_Frame_Shift_Ins_p.K1979fs|XIRP2_ENST00000409756.2_Intron|XIRP2_ENST00000295237.9_Frame_Shift_Ins_p.K2201fs|XIRP2_ENST00000409728.1_Intron|XIRP2_ENST00000420519.1_Intron	NM_152381.5	NP_689594.4	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2	2026	Pro-rich.				actin cytoskeleton organization (GO:0030036)|cardiac muscle tissue morphogenesis (GO:0055008)|cell-cell junction organization (GO:0045216)|ventricular septum development (GO:0003281)	cell junction (GO:0030054)|Z disc (GO:0030018)				NS(3)|biliary_tract(2)|breast(5)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(51)|lung(160)|ovary(7)|pancreas(3)|prostate(11)|skin(14)|stomach(5)|upper_aerodigestive_tract(8)|urinary_tract(7)	315						AGGATATAAAGAAAAAGAATAT	0.366																																					p.K2200fs		.	.											.	XIRP2	.	.	0			c.6600_6601insA						.																																			SO:0001589	frameshift_variant	129446	exon9			.	AK056582	CCDS42768.1, CCDS42769.1, CCDS56143.1, CCDS56144.1, CCDS56145.1	2q31.1	2013-10-25	2007-06-27	2007-06-27	ENSG00000163092	ENSG00000163092			14303	protein-coding gene	gene with protein product	"""myomaxin"""	609778	"""cardiomyopathy associated 3"""	CMYA3		17046827, 12203715, 15454575	Standard	NM_001079810		Approved		uc002udx.3	A4UGR9	OTTHUMG00000154027	ENST00000409195.1:c.6605dupA	2.37:g.168104507_168104507dupA	ENSP00000386840:p.Lys2201fs	153.0	0.0		172.0	11.0	NM_152381	A0PJ94|B2BBS0|B2BBS1|B2BBS4|B3KVH0|J3KNB1|Q53R52|Q5MJ67|Q702N7|Q86T36|Q86T38|Q86T46|Q86T51|Q86T53|Q86T55|Q86T79|Q86TB6|Q8N1M9|Q8N3R5|Q8TBV6	Frame_Shift_Ins	INS	ENST00000409195.1	37	CCDS42769.1																																																																																			.	.		0.366	XIRP2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000333547.1	NM_152381	
KCTD4	386618	hgsc.bcm.edu	37	13	45768382	45768383	+	Frame_Shift_Ins	INS	-	-	T			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr13:45768382_45768383insT	ENST00000379108.1	-	1	469_470	c.320_321insA	c.(319-321)aatfs	p.N107fs	KCTD4_ENST00000405872.1_Frame_Shift_Ins_p.N107fs|GTF2F2_ENST00000340473.6_Intron			Q8WVF5	KCTD4_HUMAN	potassium channel tetramerization domain containing 4	107	BTB.				protein homooligomerization (GO:0051260)					breast(1)|endometrium(1)|large_intestine(2)|lung(4)	8		Lung NSC(96;6.55e-05)|Breast(139;0.00378)|Prostate(109;0.00438)|Lung SC(185;0.0262)|Hepatocellular(98;0.0524)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;0.000249)|BRCA - Breast invasive adenocarcinoma(63;0.207)		CAAGAAGTTGATTTTCTCGAAA	0.45																																					p.N107fs		.	.											.	KCTD4	.	.	0			c.321_322insA						.																																			SO:0001589	frameshift_variant	386618	exon2			.	BC018063	CCDS9396.1	13q14.12-q14.13	2013-06-20	2013-06-20		ENSG00000180332	ENSG00000180332			23227	protein-coding gene	gene with protein product			"""potassium channel tetramerisation domain containing 4"""				Standard	NM_198404		Approved	bA321C24.3	uc001uzx.4	Q8WVF5	OTTHUMG00000016844	ENST00000379108.1:c.321dupA	13.37:g.45768386_45768386dupT	ENSP00000368402:p.Asn107fs	241.0	0.0		175.0	11.0	NM_198404	Q5W0P9	Frame_Shift_Ins	INS	ENST00000379108.1	37	CCDS9396.1																																																																																			.	.		0.450	KCTD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044757.1		
ERMAP	114625	hgsc.bcm.edu	37	1	43304572	43304573	+	Splice_Site	INS	-	-	A			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr1:43304572_43304573insA	ENST00000372517.2	+	8	861_862	c.617_618insA	c.(616-621)ggaaaa>ggAaaaa	p.GK206fs	ERMAP_ENST00000328249.3_Splice_Site_p.GK116fs|RP11-342M1.3_ENST00000416809.2_RNA|RP11-342M1.3_ENST00000425076.1_RNA|RP11-342M1.3_ENST00000444563.1_RNA|RP11-342M1.3_ENST00000414798.1_RNA|ERMAP_ENST00000487556.1_3'UTR|ERMAP_ENST00000372514.3_Splice_Site_p.GK206fs	NM_001017922.1	NP_001017922.1	Q96PL5	ERMAP_HUMAN	erythroblast membrane-associated protein (Scianna blood group)	206			Missing (in Sc-3 allele).			cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(1)|large_intestine(3)|lung(4)|ovary(1)|prostate(1)	11	Ovarian(52;0.00769)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)				TGGTTTTTAGGAAAACTCCATA	0.45																																					p.G206fs		.	.											.	ERMAP	.	.	0			c.617_618insA						.																																			SO:0001630	splice_region_variant	114625	exon7			.	AF311284	CCDS475.1	1p34	2014-07-19	2006-02-23		ENSG00000164010	ENSG00000164010		"""Blood group antigens"", ""Immunoglobulin superfamily / V-set domain containing"", ""Butyrophilins"""	15743	protein-coding gene	gene with protein product		609017	"""Radin blood group"", ""Scianna blood group"", ""erythroblast membrane-associated protein"", ""erythroblast membrane-associated protein (RD and SC blood groups)"""	RD, SC		11549310	Standard	XM_005270415		Approved	BTN5	uc001cie.1	Q96PL5	OTTHUMG00000007619	ENST00000372517.2:c.617-1->A	1.37:g.43304576_43304576dupA		186.0	0.0		182.0	11.0	NM_018538	D3DPW8|Q5VV53|Q6DUE0|Q7Z3X0|Q8NCV8|Q8NCW2|Q8NCW3|Q96PL6	Frame_Shift_Ins	INS	ENST00000372517.2	37	CCDS475.1																																																																																			.	.		0.450	ERMAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000020180.1	NM_018538	Frame_Shift_Ins
C11orf57	55216	hgsc.bcm.edu	37	11	111953315	111953316	+	Frame_Shift_Ins	INS	-	-	A			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr11:111953315_111953316insA	ENST00000280352.9	+	6	1134_1135	c.498_499insA	c.(499-501)aaafs	p.K167fs	C11orf57_ENST00000532163.1_Frame_Shift_Ins_p.K139fs|TIMM8B_ENST00000507614.1_5'Flank|C11orf57_ENST00000420986.2_Frame_Shift_Ins_p.K167fs|C11orf57_ENST00000393047.3_Frame_Shift_Ins_p.K168fs	NM_001082970.1|NM_018195.3	NP_001076439.1|NP_060665.3	Q6ZUT1	CK057_HUMAN	chromosome 11 open reading frame 57	167	Lys-rich.									autonomic_ganglia(1)|breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(1)|ovary(1)|prostate(1)	12		all_cancers(61;9.8e-15)|all_epithelial(67;6.57e-09)|Melanoma(852;1.91e-06)|all_hematologic(158;0.000405)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0112)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)		Epithelial(105;3.6e-07)|BRCA - Breast invasive adenocarcinoma(274;6.17e-07)|all cancers(92;7.01e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.0521)		AAAGGTCACACAAAAAACAGAA	0.411																																					p.H167fs		.	.											.	C11orf57	.	.	0			c.501_502insA						.																																			SO:0001589	frameshift_variant	55216	exon6			.	BX538107	CCDS8356.2, CCDS41715.1, CCDS73383.1	11q23.1	2006-03-09			ENSG00000150776	ENSG00000150776			25569	protein-coding gene	gene with protein product						12477932	Standard	NM_001082970		Approved	FLJ10726	uc001pmw.4	Q6ZUT1	OTTHUMG00000150213	ENST00000280352.9:c.504dupA	11.37:g.111953321_111953321dupA	ENSP00000339076:p.Lys167fs	305.0	0.0		242.0	15.0	NM_001082969	Q5RL41|Q6IN53|Q7Z357|Q8N2T3	Frame_Shift_Ins	INS	ENST00000280352.9	37	CCDS41715.1																																																																																			.	.		0.411	C11orf57-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000316852.1	NM_018195	
PLEKHA8P1	51054	hgsc.bcm.edu	37	12	45567240	45567241	+	RNA	INS	-	-	A			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr12:45567240_45567241insA	ENST00000256692.5	-	0	1444_1445					NR_037144.1		O95397	PKHA9_HUMAN	pleckstrin homology domain containing, family A member 8 pseudogene 1							cytoplasm (GO:0005737)	glycolipid binding (GO:0051861)|glycolipid transporter activity (GO:0017089)			breast(1)|endometrium(2)|kidney(2)|large_intestine(8)|lung(10)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	26						TCACTTCTGTCAAAAATCCCTT	0.485																																					.		.	.											.	PLEKHA8P1	.	.	0			.						.																																					51054	.			.	AF103731		12q12	2010-11-24	2010-11-24	2010-11-24	ENSG00000134297	ENSG00000134297			30222	pseudogene	pseudogene	"""putative glycolipid transfer protein"""		"""pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 9"""	PLEKHA9		12477932	Standard	NR_037144		Approved	FLJ14156	uc001rom.2	O95397			12.37:g.45567245_45567245dupA		180.0	0.0		163.0	10.0	.		RNA	INS	ENST00000256692.5	37																																																																																				.	.		0.485	PLEKHA8P1-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000404814.1	NR_037144	
NBR1	4077	hgsc.bcm.edu	37	17	41352494	41352495	+	Frame_Shift_Ins	INS	-	-	G			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr17:41352494_41352495insG	ENST00000422280.1	+	17	2796_2797	c.2337_2338insG	c.(2338-2340)gggfs	p.G780fs	NBR1_ENST00000589872.1_Frame_Shift_Ins_p.G780fs|NBR1_ENST00000590996.1_Frame_Shift_Ins_p.G780fs|NBR1_ENST00000542611.1_Frame_Shift_Ins_p.G759fs|NBR1_ENST00000389312.4_Frame_Shift_Ins_p.G780fs|NBR1_ENST00000341165.6_Frame_Shift_Ins_p.G780fs	NM_031858.2	NP_114064.1	Q14596	NBR1_HUMAN	neighbor of BRCA1 gene 1	780					macroautophagy (GO:0016236)|negative regulation of osteoblast differentiation (GO:0045668)|protein oligomerization (GO:0051259)|regulation of bone mineralization (GO:0030500)|regulation of stress-activated MAPK cascade (GO:0032872)	autophagic vacuole (GO:0005776)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|late endosome (GO:0005770)|lysosome (GO:0005764)|membrane (GO:0016020)|pre-autophagosomal structure (GO:0000407)	mitogen-activated protein kinase binding (GO:0051019)|ubiquitin binding (GO:0043130)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|cervix(1)|kidney(4)|large_intestine(1)|lung(7)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	24		Breast(137;0.00086)		BRCA - Breast invasive adenocarcinoma(366;0.0934)		CAGCTGAGGCTGGGGAAAGACT	0.594																																					p.A779fs		.	.											.	NBR1	.	.	0			c.2337_2338insG						.																																			SO:0001589	frameshift_variant	4077	exon17			.	X76952	CCDS45694.1	17q21.31	2008-02-01	2005-02-15	2005-02-16		ENSG00000188554			6746	protein-coding gene	gene with protein product		166945	"""membrane component, chromosome 17, surface marker 2 (ovarian carcinoma antigen CA125)"""	M17S2		8069304	Standard	XM_006721903		Approved	CA125, KIAA0049, 1A1-3B	uc010whv.2	Q14596		ENST00000422280.1:c.2341dupG	17.37:g.41352498_41352498dupG	ENSP00000411250:p.Gly780fs	76.0	0.0		93.0	10.0	NM_031862	Q13173|Q15026|Q5J7Q8|Q96GB6|Q9NRF7	Frame_Shift_Ins	INS	ENST00000422280.1	37	CCDS45694.1																																																																																			.	.		0.594	NBR1-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000453461.1	NM_005899	
POP1	10940	hgsc.bcm.edu	37	8	99148886	99148887	+	Frame_Shift_Ins	INS	-	-	A			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr8:99148886_99148887insA	ENST00000401707.2	+	8	1269_1270	c.1188_1189insA	c.(1189-1191)aaafs	p.K397fs	POP1_ENST00000349693.3_Frame_Shift_Ins_p.K397fs	NM_001145860.1|NM_001145861.1	NP_001139332.1|NP_001139333.1	Q99575	POP1_HUMAN	processing of precursor 1, ribonuclease P/MRP subunit (S. cerevisiae)	397					RNA phosphodiester bond hydrolysis (GO:0090501)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|tRNA 5'-leader removal (GO:0001682)|tRNA catabolic process (GO:0016078)	extracellular space (GO:0005615)|nucleolar ribonuclease P complex (GO:0005655)|ribonuclease MRP complex (GO:0000172)	poly(A) RNA binding (GO:0044822)|ribonuclease MRP activity (GO:0000171)|ribonuclease P activity (GO:0004526)			autonomic_ganglia(1)|breast(3)|endometrium(4)|large_intestine(9)|lung(15)|ovary(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	36	Breast(36;1.78e-06)		OV - Ovarian serous cystadenocarcinoma(57;0.145)			CTAAACCAATTAAAAAAATTAT	0.371																																					p.I396fs		.	.											.	POP1	.	.	0			c.1188_1189insA						.																																			SO:0001589	frameshift_variant	10940	exon8			.	D31765	CCDS6277.1	8q22.2	2012-05-21			ENSG00000104356	ENSG00000104356			30129	protein-coding gene	gene with protein product	"""processing of precursors 1"""	602486				10199568, 8918471	Standard	NM_015029		Approved		uc011lgv.2	Q99575	OTTHUMG00000164635	ENST00000401707.2:c.1195dupA	8.37:g.99148893_99148893dupA	ENSP00000385787:p.Lys397fs	139.0	0.0		149.0	12.0	NM_001145860	A8K5W9|Q15037	Frame_Shift_Ins	INS	ENST00000401707.2	37	CCDS6277.1																																																																																			.	.		0.371	POP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379470.1	NM_015029	
LINC00283	100874057	hgsc.bcm.edu	37	13	103397069	103397070	+	RNA	INS	-	-	T			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr13:103397069_103397070insT	ENST00000430111.1	+	0	1442_1443									long intergenic non-protein coding RNA 283																		TTCTGTTAACATTTTTTGAATA	0.386																																					p.M1993fs		.	.											.	.	.	.	0			c.5978_5979insA						.																																					643677	exon4			.			13q33.1	2012-10-12	2011-08-10	2011-08-10	ENSG00000231633	ENSG00000231633		"""Long non-coding RNAs"""	38809	non-coding RNA	RNA, long non-coding			"""non-protein coding RNA 283"""	NCRNA00283			Standard			Approved				OTTHUMG00000017311		13.37:g.103397075_103397075dupT		220.0	0.0		188.0	15.0	NM_001146197		Frame_Shift_Ins	INS	ENST00000430111.1	37																																																																																				.	.		0.386	LINC00283-001	KNOWN	not_organism_supported|basic	antisense	antisense	OTTHUMT00000045714.1		
ZNF217	7764	hgsc.bcm.edu	37	20	52199201	52199202	+	Frame_Shift_Ins	INS	-	-	T			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr20:52199201_52199202insT	ENST00000371471.2	-	2	589_590	c.164_165insA	c.(163-165)aatfs	p.N55fs	ZNF217_ENST00000540425.1_5'Flank|ZNF217_ENST00000302342.3_Frame_Shift_Ins_p.N55fs			O75362	ZN217_HUMAN	zinc finger protein 217	55					negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone deacetylase complex (GO:0000118)|nucleoplasm (GO:0005654)	metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(13)|lung(17)|ovary(1)|prostate(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	50	all_cancers(1;6.75e-17)|all_epithelial(1;1.76e-18)|Breast(2;3.83e-14)|Lung NSC(4;9.04e-07)|all_lung(4;2.5e-06)|Ovarian(1;0.0398)		BRCA - Breast invasive adenocarcinoma(1;9.88e-17)|Epithelial(1;1.56e-14)|all cancers(1;9.44e-13)|STAD - Stomach adenocarcinoma(23;0.0474)|Colorectal(105;0.198)			TTTGGATGACATTTTTTTCTTG	0.46																																					p.N55fs		.	.											.	ZNF217	.	.	0			c.165_166insA						.																																			SO:0001589	frameshift_variant	7764	exon1			.	AF041259	CCDS13443.1	20q13.2	2013-01-08			ENSG00000171940	ENSG00000171940		"""Zinc fingers, C2H2-type"""	13009	protein-coding gene	gene with protein product		602967				9671742	Standard	NM_006526		Approved	ZABC1	uc002xwq.4	O75362	OTTHUMG00000032764	ENST00000371471.2:c.165dupA	20.37:g.52199208_52199208dupT	ENSP00000360526:p.Asn55fs	151.0	0.0		155.0	10.0	NM_006526	E1P5Y6|Q14DB8	Frame_Shift_Ins	INS	ENST00000371471.2	37	CCDS13443.1																																																																																			.	.		0.460	ZNF217-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079757.2	NM_006526	
KRTAP5-1	387264	hgsc.bcm.edu	37	11	1605983	1605984	+	Frame_Shift_Ins	INS	-	-	C	rs59007122		TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr11:1605983_1605984insC	ENST00000382171.2	-	1	529_530	c.496_497insG	c.(496-498)gccfs	p.A166fs	KRTAP5-AS1_ENST00000424148.1_RNA|KRTAP5-AS1_ENST00000532922.1_RNA|KRTAP5-AS1_ENST00000534077.1_RNA|KRTAP5-AS1_ENST00000524947.1_RNA	NM_001005922.1	NP_001005922.1	Q6L8H4	KRA51_HUMAN	keratin associated protein 5-1	166	8 X 4 AA repeats of C-C-X-P.					keratin filament (GO:0045095)				endometrium(3)|kidney(1)|lung(9)|skin(2)|upper_aerodigestive_tract(1)	16		all_epithelial(84;0.00018)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.000614)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		AGAACCACAGGCCCCCTTGGAG	0.658																																					p.A166fs		.	.											.	KRTAP5-1	.	.	0			c.497_498insG						.																																			SO:0001589	frameshift_variant	387264	exon1			.	AB126070	CCDS31330.1	11p15.5	2008-02-05			ENSG00000205869	ENSG00000205869		"""Keratin associated proteins"""	23596	protein-coding gene	gene with protein product		148022	"""keratin, cuticle, ultrahigh sulphur 1-like"""	KRN1L		15144888	Standard	NM_001005922		Approved	KRTAP5.1	uc001ltu.1	Q6L8H4	OTTHUMG00000057557	ENST00000382171.2:c.497dupG	11.37:g.1605988_1605988dupC	ENSP00000371606:p.Ala166fs	248.0	0.0		135.0	10.0	NM_001005922		Frame_Shift_Ins	INS	ENST00000382171.2	37	CCDS31330.1																																																																																			.	.		0.658	KRTAP5-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000127922.1	NM_001005922	
LRP12	29967	hgsc.bcm.edu	37	8	105509428	105509429	+	Frame_Shift_Ins	INS	-	-	A	rs35928649		TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr8:105509428_105509429insA	ENST00000276654.5	-	5	1459_1460	c.1351_1352insT	c.(1351-1353)tgcfs	p.C451fs	LRP12_ENST00000424843.2_Frame_Shift_Ins_p.C432fs|LRP12_ENST00000518375.1_5'Flank	NM_013437.4	NP_038465.1	Q9Y561	LRP12_HUMAN	low density lipoprotein receptor-related protein 12	451	LDL-receptor class A 5. {ECO:0000255|PROSITE-ProRule:PRU00124}.				endocytosis (GO:0006897)|receptor-mediated endocytosis (GO:0006898)|regulation of growth (GO:0040008)|signal transduction (GO:0007165)	coated pit (GO:0005905)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	low-density lipoprotein receptor activity (GO:0005041)			NS(1)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(10)|lung(18)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	48			OV - Ovarian serous cystadenocarcinoma(57;1.21e-06)|STAD - Stomach adenocarcinoma(118;0.229)			TCCTGGTTGGCAAAAAAAGCAG	0.406																																					p.C451fs		.	.											.	LRP12	.	.	0			c.1352_1353insT						.																																			SO:0001589	frameshift_variant	29967	exon5			.	AF166350	CCDS6303.1, CCDS47907.1	8q22.2	2013-02-27	2010-01-26		ENSG00000147650	ENSG00000147650		"""Low density lipoprotein receptors"""	31708	protein-coding gene	gene with protein product						12809483, 14676824	Standard	NM_013437		Approved	ST7, FLJ12929	uc003yma.3	Q9Y561	OTTHUMG00000164892	ENST00000276654.5:c.1352dupT	8.37:g.105509435_105509435dupA	ENSP00000276654:p.Cys451fs	208.0	0.0		156.0	12.0	NM_013437	A8K137|B4DRQ2	Frame_Shift_Ins	INS	ENST00000276654.5	37	CCDS6303.1																																																																																			.	.		0.406	LRP12-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380821.1	NM_013437	
TPRX1	284355	hgsc.bcm.edu	37	19	48305271	48305272	+	Frame_Shift_Ins	INS	-	-	G	rs149923413|rs139632837	byFrequency	TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr19:48305271_48305272insG	ENST00000322175.3	-	2	1151_1152	c.996_997insC	c.(994-999)cccttafs	p.PL332fs	TPRX1_ENST00000535759.1_Frame_Shift_Ins_p.PL429fs|TPRX1_ENST00000543508.1_Frame_Shift_Ins_p.PL322fs	NM_198479.2	NP_940881.2	Q8N7U7	TPRX1_HUMAN	tetra-peptide repeat homeobox 1	332						nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(5)|kidney(1)|large_intestine(4)|lung(4)|ovary(1)|prostate(2)|skin(1)	18		all_cancers(25;3.02e-09)|all_epithelial(76;7e-07)|all_lung(116;2.48e-06)|Lung NSC(112;5.15e-06)|Ovarian(192;0.0139)|all_neural(266;0.0146)|Breast(70;0.133)		OV - Ovarian serous cystadenocarcinoma(262;0.000241)|all cancers(93;0.00036)|Epithelial(262;0.0127)|GBM - Glioblastoma multiforme(486;0.048)		TGAGGCCATAAGggggctgggg	0.624																																					p.L333fs	Esophageal Squamous(123;175 2281 3051 32395)	.	.											.	TPRX1	.	.	0			c.997_998insC						.																																			SO:0001589	frameshift_variant	284355	exon2			.		CCDS33066.1	19q13.33	2011-07-08			ENSG00000178928	ENSG00000178928		"""Homeoboxes / PRD class"""	32174	protein-coding gene	gene with protein product		611166					Standard	XM_005258788		Approved	FLJ40321	uc002php.2	Q8N7U7		ENST00000322175.3:c.997dupC	19.37:g.48305276_48305276dupG	ENSP00000323455:p.Pro332fs	122.0	0.0		160.0	10.0	NM_198479	A5D8Y3|B2RPL5	Frame_Shift_Ins	INS	ENST00000322175.3	37	CCDS33066.1																																																																																			.	.		0.624	TPRX1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000409868.1	NM_198479	
HELLS	3070	hgsc.bcm.edu	37	10	96322576	96322577	+	Frame_Shift_Ins	INS	-	-	A			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr10:96322576_96322577insA	ENST00000348459.5	+	6	483_484	c.378_379insA	c.(379-381)aaafs	p.K127fs	HELLS_ENST00000371332.4_Frame_Shift_Ins_p.K127fs|HELLS_ENST00000462057.1_3'UTR|HELLS_ENST00000394036.1_Intron|HELLS_ENST00000394045.1_Frame_Shift_Ins_p.K127fs|HELLS_ENST00000239026.6_3'UTR|HELLS_ENST00000394044.1_Frame_Shift_Ins_p.K127fs	NM_018063.3	NP_060533.2			helicase, lymphoid-specific											endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(7)|lung(4)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	22		Colorectal(252;0.0429)		all cancers(201;2.13e-05)		taGTTATGAGGAAAAAAAGAGG	0.282																																					p.R126fs		.	.											.	HELLS	.	.	0			c.378_379insA						.																																			SO:0001589	frameshift_variant	3070	exon6			.	AF155827	CCDS7434.1, CCDS73162.1, CCDS73163.1, CCDS73164.1, CCDS73165.1	10q24.2	2008-08-01			ENSG00000119969	ENSG00000119969			4861	protein-coding gene	gene with protein product	"""SWI/SNF2-related, matrix-associated, actin-dependent regulator of chromatin, subfamily A, member 6"", ""proliferation-associated SNF2-like protein"""	603946				9878251, 10910076	Standard	NM_018063		Approved	PASG, SMARCA6, LSH, Nbla10143	uc001kjt.3	Q9NRZ9	OTTHUMG00000018793	ENST00000348459.5:c.385dupA	10.37:g.96322583_96322583dupA	ENSP00000239027:p.Lys127fs	240.0	0.0		271.0	19.0	NM_018063		Frame_Shift_Ins	INS	ENST00000348459.5	37	CCDS7434.1																																																																																			.	.		0.282	HELLS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049475.1	NM_018063	
C6orf62	81688	hgsc.bcm.edu	37	6	24706479	24706480	+	Frame_Shift_Ins	INS	-	-	T			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr6:24706479_24706480insT	ENST00000378119.4	-	5	2742_2743	c.575_576insA	c.(574-576)aacfs	p.N192fs	RP1-30M3.6_ENST00000606921.1_RNA|C6orf62_ENST00000540769.1_Frame_Shift_Ins_p.N134fs|C6orf62_ENST00000378102.3_Frame_Shift_Ins_p.N163fs	NM_030939.4	NP_112201.1	Q9GZU0	CF062_HUMAN	chromosome 6 open reading frame 62	192						intracellular (GO:0005622)				endometrium(2)|kidney(3)|large_intestine(2)|lung(3)	10						TTGTAGCTTTGTTTTTTGGAGT	0.406																																					p.N192fs		.	.											.	C6orf62	.	.	0			c.576_577insA						.																																			SO:0001589	frameshift_variant	81688	exon5			.	AL136632	CCDS4559.1	6p22.1	2011-12-13			ENSG00000112308	ENSG00000112308			20998	protein-coding gene	gene with protein product	"""HBV X-transactivated protein 12"""					11230166	Standard	NM_030939		Approved	FLJ12619, DKFZP564G182, XTP12	uc003nel.3	Q9GZU0	OTTHUMG00000014361	ENST00000378119.4:c.576dupA	6.37:g.24706485_24706485dupT	ENSP00000367359:p.Asn192fs	129.0	0.0		179.0	11.0	NM_030939	Q3LIB6|Q5JVZ2|Q5JVZ3|Q6IA63|Q9H1Z2	Frame_Shift_Ins	INS	ENST00000378119.4	37	CCDS4559.1																																																																																			.	.		0.406	C6orf62-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040017.1	NM_030939	
TSHR	7253	hgsc.bcm.edu	37	14	81609512	81609513	+	Frame_Shift_Ins	INS	-	-	A			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr14:81609512_81609513insA	ENST00000541158.2	+	11	1432_1433	c.1110_1111insA	c.(1111-1113)aaafs	p.K371fs	TSHR_ENST00000298171.2_Frame_Shift_Ins_p.K371fs|RP11-114N19.3_ENST00000557775.1_RNA			P16473	TSHR_HUMAN	thyroid stimulating hormone receptor	371					adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adult locomotory behavior (GO:0008344)|B cell differentiation (GO:0030183)|cell-cell signaling (GO:0007267)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|positive regulation of cell proliferation (GO:0008284)|positive regulation of multicellular organism growth (GO:0040018)|regulation of locomotion (GO:0040012)|thyroid-stimulating hormone signaling pathway (GO:0038194)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	thyroid-stimulating hormone receptor activity (GO:0004996)			breast(2)|endometrium(2)|kidney(1)|large_intestine(10)|lung(18)|ovary(6)|prostate(3)|skin(2)|stomach(1)|thyroid(291)|upper_aerodigestive_tract(1)	337				BRCA - Breast invasive adenocarcinoma(234;0.0402)	Thyrotropin Alfa(DB00024)	GCCAGGAGCTCAAAAACCCCCA	0.446			Mis		toxic thyroid adenoma	thyroid  adenoma	Hereditary nonautoimmune hyperthyroidism; subclinical hypothyroidism																														p.L370fs		.	.	yes	Dom	yes		14	14q31	7253	thyroid stimulating hormone receptor	yes	E	.	TSHR	.	.	0			c.1110_1111insA						.																																			SO:0001589	frameshift_variant	7253	exon10			.	AY429111	CCDS9872.1, CCDS32131.1, CCDS55935.1	14q24-q31	2014-09-17			ENSG00000165409	ENSG00000165409		"""GPCR / Class A : Gonadotropin and TSH receptors"""	12373	protein-coding gene	gene with protein product		603372				2558651, 2610690	Standard	NM_001018036		Approved	LGR3	uc001xvd.1	P16473		ENST00000541158.2:c.1115dupA	14.37:g.81609517_81609517dupA	ENSP00000441235:p.Lys371fs	213.0	0.0		188.0	12.0	NM_000369	A0PJU7|F5GYU5|G3V2A9|Q16503|Q8TB90|Q96GT6|Q9P1V4|Q9ULA3|Q9UPH3	Frame_Shift_Ins	INS	ENST00000541158.2	37	CCDS9872.1																																																																																			.	.		0.446	TSHR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413364.1	NM_000369	
WARS	7453	hgsc.bcm.edu	37	14	100808872	100808873	+	Frame_Shift_Ins	INS	-	-	G			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr14:100808872_100808873insG	ENST00000355338.2	-	9	1593_1594	c.975_976insC	c.(973-978)cccaggfs	p.R326fs	WARS_ENST00000556645.1_Frame_Shift_Ins_p.R285fs|WARS_ENST00000358655.4_Frame_Shift_Ins_p.R285fs|WARS_ENST00000557135.1_Frame_Shift_Ins_p.R326fs|RP11-638I2.9_ENST00000556212.1_RNA|WARS_ENST00000392882.2_Frame_Shift_Ins_p.R326fs|RP11-638I2.8_ENST00000557226.1_RNA|WARS_ENST00000344102.5_Frame_Shift_Ins_p.R285fs	NM_173701.1	NP_776049.1	P23381	SYWC_HUMAN	tryptophanyl-tRNA synthetase	326					angiogenesis (GO:0001525)|gene expression (GO:0010467)|negative regulation of cell proliferation (GO:0008285)|regulation of angiogenesis (GO:0045765)|translation (GO:0006412)|tRNA aminoacylation for protein translation (GO:0006418)|tryptophanyl-tRNA aminoacylation (GO:0006436)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ATP binding (GO:0005524)|tryptophan-tRNA ligase activity (GO:0004830)			breast(2)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(9)|ovary(1)|upper_aerodigestive_tract(1)	20		all_cancers(154;0.00223)|all_lung(585;2.48e-06)|all_epithelial(191;0.000564)|Melanoma(154;0.152)			L-Tryptophan(DB00150)	TAGCCGATCCTGGGGGCGACGT	0.579																																					p.R326fs		.	.											.	WARS	.	.	0			c.976_977insC						.																																			SO:0001589	frameshift_variant	7453	exon9			.	M61715	CCDS9960.1, CCDS9961.1	14q32.2	2014-03-19			ENSG00000140105	ENSG00000140105	6.1.1.2	"""Aminoacyl tRNA synthetases / Class I"""	12729	protein-coding gene	gene with protein product	"""tryptophan tRNA ligase 1, cytoplasmic"""	191050		IFI53		1537332, 1763065	Standard	NM_004184		Approved	IFP53	uc001yhl.1	P23381	OTTHUMG00000171572	ENST00000355338.2:c.976dupC	14.37:g.100808877_100808877dupG	ENSP00000347495:p.Arg326fs	249.0	0.0		208.0	15.0	NM_004184	A6NGN1|A6NID3|P78535|Q502Y0|Q53XB6|Q9UDI5|Q9UDL3	Frame_Shift_Ins	INS	ENST00000355338.2	37	CCDS9960.1																																																																																			.	.		0.579	WARS-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414236.1	NM_004184	
IPO7	10527	hgsc.bcm.edu	37	11	9463685	9463693	+	In_Frame_Del	DEL	AACAAAGAA	AACAAAGAA	-			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	AACAAAGAA	AACAAAGAA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr11:9463685_9463693delAACAAAGAA	ENST00000379719.3	+	24	3102_3110	c.2960_2968delAACAAAGAA	c.(2959-2970)gaacaaagaaaa>gaa	p.QRK988del		NM_006391.2	NP_006382.1	O95373	IPO7_HUMAN	importin 7	988					innate immune response (GO:0045087)|protein import into nucleus (GO:0006606)|regulation of catalytic activity (GO:0050790)|signal transduction (GO:0007165)|viral process (GO:0016032)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear pore (GO:0005643)	Ran GTPase binding (GO:0008536)|small GTPase regulator activity (GO:0005083)|transporter activity (GO:0005215)			NS(1)|breast(1)|endometrium(3)|kidney(3)|large_intestine(6)|lung(12)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29				all cancers(16;8.29e-09)|Epithelial(150;4.76e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0217)		CTTAATGAAGAACAAAGAAAACAGTTACA	0.354																																					p.987_989del		.	.											.	IPO7	.	.	0			c.2959_2967del						.																																			SO:0001651	inframe_deletion	10527	exon24			.	AF098799	CCDS31425.1	11p15.3	2010-12-02	2003-03-11	2003-03-14	ENSG00000205339	ENSG00000205339		"""Importins"""	9852	protein-coding gene	gene with protein product		605586	"""RAN binding protein 7"""	RANBP7		9214382	Standard	NM_006391		Approved	Imp7	uc001mho.3	O95373	OTTHUMG00000165753	ENST00000379719.3:c.2960_2968delAACAAAGAA	11.37:g.9463685_9463693delAACAAAGAA	ENSP00000369042:p.Gln988_Lys990del	361.0	0.0		311.0	21.0	NM_006391	A6NNM5|B2R786|Q1RMF7|Q9H177|Q9NTE3	In_Frame_Del	DEL	ENST00000379719.3	37	CCDS31425.1																																																																																			.	.		0.354	IPO7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386022.1	NM_006391	
HFM1	164045	hgsc.bcm.edu	37	1	91742600	91742600	+	Frame_Shift_Del	DEL	T	T	-			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr1:91742600delT	ENST00000370425.3	-	31	3509	c.3411delA	c.(3409-3411)aaafs	p.K1137fs	HFM1_ENST00000462405.1_5'UTR|HFM1_ENST00000370424.3_Frame_Shift_Del_p.K816fs|HFM1_ENST00000294696.5_Frame_Shift_Del_p.K369fs	NM_001017975.3	NP_001017975.3	A2PYH4	HFM1_HUMAN	HFM1, ATP-dependent DNA helicase homolog (S. cerevisiae)	1137					resolution of meiotic recombination intermediates (GO:0000712)		ATP binding (GO:0005524)|helicase activity (GO:0004386)|nucleic acid binding (GO:0003676)			breast(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(17)|lung(33)|ovary(1)|prostate(3)|skin(2)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	75		all_lung(203;0.00961)|Lung NSC(277;0.0351)		all cancers(265;0.000481)|Epithelial(280;0.00863)|OV - Ovarian serous cystadenocarcinoma(397;0.126)|KIRC - Kidney renal clear cell carcinoma(1967;0.171)		GGTTCCCAGGTTTTTTGCTGG	0.284																																					p.P1138fs		.	.											.	HFM1	.	.	0			c.3412delC						.						114.0	113.0	113.0					1																	91742600		2203	4299	6502	SO:0001589	frameshift_variant	164045	exon31			.	AB204867	CCDS30769.2	1p22.2	2008-03-26			ENSG00000162669	ENSG00000162669			20193	protein-coding gene	gene with protein product		615684	"""SEC63 domain containing 1"""	SEC63D1		14702039, 17286053	Standard	XM_006710395		Approved	MER3, FLJ39011, FLJ36760	uc001doa.4	A2PYH4	OTTHUMG00000010093	ENST00000370425.3:c.3411delA	1.37:g.91742600delT	ENSP00000359454:p.Lys1137fs	313.0	0.0		310.0	77.0	NM_001017975	B1B0B6|Q8N9Q0	Frame_Shift_Del	DEL	ENST00000370425.3	37	CCDS30769.2																																																																																			.	.		0.284	HFM1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316716.2	NM_001017975	
OR6C4	341418	hgsc.bcm.edu	37	12	55945306	55945307	+	Frame_Shift_Ins	INS	-	-	T			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr12:55945306_55945307insT	ENST00000394256.2	+	1	324_325	c.296_297insT	c.(295-300)tattttfs	p.YF99fs	RP11-110A12.2_ENST00000556750.1_RNA|RP11-110A12.2_ENST00000555138.1_RNA	NM_001005494.1	NP_001005494.1	Q8NGE1	OR6C4_HUMAN	olfactory receptor, family 6, subfamily C, member 4	99						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|skin(1)	11						TTGACTCAGTATTTTTTTGCTA	0.401																																					p.Y99fs		.	.											.	OR6C4	.	.	0			c.296_297insT						.																																			SO:0001589	frameshift_variant	341418	exon1			.	BK004261	CCDS31827.1	12q14.2	2012-08-09				ENSG00000179626		"""GPCR / Class A : Olfactory receptors"""	19632	protein-coding gene	gene with protein product							Standard	NM_001005494		Approved		uc010spp.2	Q8NGE1	OTTHUMG00000169959	ENST00000394256.2:c.303dupT	12.37:g.55945313_55945313dupT	ENSP00000377799:p.Tyr99fs	206.0	0.0		218.0	18.0	NM_001005494	A8MZG7|B2RNN2|Q6IFK1	Frame_Shift_Ins	INS	ENST00000394256.2	37	CCDS31827.1																																																																																			.	.		0.401	OR6C4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406678.1		
PTEN	5728	hgsc.bcm.edu	37	10	89720665	89720666	+	Frame_Shift_Ins	INS	-	-	T			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr10:89720665_89720666insT	ENST00000371953.3	+	8	2173_2174	c.816_817insT	c.(817-819)tttfs	p.F273fs	PTEN_ENST00000472832.1_3'UTR	NM_000314.4	NP_000305.3	P60484	PTEN_HUMAN	phosphatase and tensin homolog	273	C2 tensin-type. {ECO:0000255|PROSITE- ProRule:PRU00589}.				activation of mitotic anaphase-promoting complex activity (GO:0007092)|aging (GO:0007568)|angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|brain morphogenesis (GO:0048854)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle tissue development (GO:0048738)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|central nervous system development (GO:0007417)|central nervous system myelin maintenance (GO:0032286)|central nervous system neuron axonogenesis (GO:0021955)|dendritic spine morphogenesis (GO:0060997)|dentate gyrus development (GO:0021542)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|forebrain morphogenesis (GO:0048853)|heart development (GO:0007507)|innate immune response (GO:0045087)|inositol phosphate dephosphorylation (GO:0046855)|inositol phosphate metabolic process (GO:0043647)|learning or memory (GO:0007611)|locomotor rhythm (GO:0045475)|locomotory behavior (GO:0007626)|long term synaptic depression (GO:0060292)|long-term synaptic potentiation (GO:0060291)|male mating behavior (GO:0060179)|maternal behavior (GO:0042711)|memory (GO:0007613)|multicellular organismal response to stress (GO:0033555)|negative regulation of apoptotic process (GO:0043066)|negative regulation of axonogenesis (GO:0050771)|negative regulation of cell aging (GO:0090344)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell size (GO:0045792)|negative regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031658)|negative regulation of dendritic spine morphogenesis (GO:0061002)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of excitatory postsynaptic membrane potential (GO:0090394)|negative regulation of focal adhesion assembly (GO:0051895)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of myelination (GO:0031642)|negative regulation of organ growth (GO:0046621)|negative regulation of phagocytosis (GO:0050765)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of ribosome biogenesis (GO:0090071)|negative regulation of synaptic vesicle clustering (GO:2000808)|neuron-neuron synaptic transmission (GO:0007270)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell proliferation (GO:0008284)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|postsynaptic density assembly (GO:0097107)|prepulse inhibition (GO:0060134)|presynaptic membrane assembly (GO:0097105)|prostate gland growth (GO:0060736)|protein dephosphorylation (GO:0006470)|protein kinase B signaling (GO:0043491)|protein stabilization (GO:0050821)|regulation of B cell apoptotic process (GO:0002902)|regulation of cellular component size (GO:0032535)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of myeloid cell apoptotic process (GO:0033032)|regulation of neuron projection development (GO:0010975)|regulation of protein stability (GO:0031647)|response to arsenic-containing substance (GO:0046685)|response to ATP (GO:0033198)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|response to glucose (GO:0009749)|response to nutrient (GO:0007584)|response to zinc ion (GO:0010043)|rhythmic synaptic transmission (GO:0060024)|small molecule metabolic process (GO:0044281)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synapse maturation (GO:0060074)|T cell receptor signaling pathway (GO:0050852)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)|myelin sheath adaxonal region (GO:0035749)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|Schmidt-Lanterman incisure (GO:0043220)	anaphase-promoting complex binding (GO:0010997)|enzyme binding (GO:0019899)|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity (GO:0051717)|lipid binding (GO:0008289)|magnesium ion binding (GO:0000287)|PDZ domain binding (GO:0030165)|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity (GO:0016314)|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity (GO:0051800)|phosphatidylinositol-3-phosphatase activity (GO:0004438)|phosphoprotein phosphatase activity (GO:0004721)|protein serine/threonine phosphatase activity (GO:0004722)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)	p.0?(37)|p.R55fs*1(5)|p.?(2)|p.N212fs*1(2)|p.Y27fs*1(2)|p.G165_*404del(1)		NS(28)|autonomic_ganglia(2)|biliary_tract(6)|bone(5)|breast(92)|central_nervous_system(676)|cervix(26)|endometrium(1068)|eye(8)|haematopoietic_and_lymphoid_tissue(137)|kidney(24)|large_intestine(98)|liver(20)|lung(91)|meninges(2)|oesophagus(2)|ovary(82)|pancreas(6)|prostate(129)|salivary_gland(5)|skin(127)|soft_tissue(19)|stomach(30)|testis(1)|thyroid(29)|upper_aerodigestive_tract(29)|urinary_tract(12)|vulva(17)	2771		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)		AAATGTTTCACTTTTGGGTAAA	0.262		31	"""D, Mis, N, F, S"""		"""glioma,  prostate, endometrial"""	"""harmartoma, glioma,  prostate, endometrial"""			Proteus syndrome;Juvenile Polyposis;Hereditary Mixed Polyposis Syndrome type 1;Cowden syndrome;Bannayan-Riley-Ruvalcaba syndrome	HNSCC(9;0.0022)|TCGA GBM(2;<1E-08)|TSP Lung(26;0.18)																											p.H272fs		.	.	yes	Rec	yes	"""Cowden Syndrome, Bannayan-Riley-Ruvalcaba syndrome"""	10	10q23.3	5728	phosphatase and tensin homolog gene		"""L, E, M, O"""	PTEN,NS,carcinoma,+2	PTEN	.	.	49	Whole gene deletion(37)|Deletion - Frameshift(9)|Unknown(2)|Deletion - In frame(1)	prostate(16)|central_nervous_system(11)|skin(6)|lung(4)|haematopoietic_and_lymphoid_tissue(3)|breast(3)|ovary(3)|urinary_tract(2)|soft_tissue(1)	c.816_817insT						.																																			SO:0001589	frameshift_variant	5728	exon8	Familial Cancer Database	Incl.: Encephalocraniocutaneous Lipomatosis, ECCL, Proteus-like s.;incl.: Juvenile Polyposis of the Stomach;HMPS1, Colorectal Adenoma Carcinoma syndrome, CRAC, CRAC1;CS, Cowden disease, Multiple Hamartoma Syndrome, incl.: Lhermitte-Duclos; part of PTEN hamartoma tumour syndrome (PHTS) / PTEN-MATCHS, Cowden-like syndrome;subset of PTEN-Hamartoma Tumor Syndrome; incl.: Ruvalcaba-Myhre-Smith s.	.	U92436	CCDS31238.1	10q23	2014-09-17	2008-07-31		ENSG00000171862	ENSG00000171862		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"""	9588	protein-coding gene	gene with protein product	"""mutated in multiple advanced cancers 1"""	601728		BZS, MHAM		9090379	Standard	NM_000314		Approved	MMAC1, TEP1, PTEN1	uc001kfb.3	P60484	OTTHUMG00000018688	ENST00000371953.3:c.820dupT	10.37:g.89720669_89720669dupT	ENSP00000361021:p.Phe273fs	139.0	0.0		218.0	15.0	NM_000314	B2R904|F2YHV0|O00633|O02679|Q6ICT7	Frame_Shift_Ins	INS	ENST00000371953.3	37	CCDS31238.1																																																																																			.	.		0.262	PTEN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049241.1	NM_000314	
NLRP1	22861	hgsc.bcm.edu	37	17	5462267	5462268	+	Frame_Shift_Ins	INS	-	-	T			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr17:5462267_5462268insT	ENST00000572272.1	-	4	1747_1748	c.1748_1749insA	c.(1747-1749)aagfs	p.K583fs	NLRP1_ENST00000269280.4_Frame_Shift_Ins_p.K583fs|NLRP1_ENST00000345221.3_Frame_Shift_Ins_p.K583fs|NLRP1_ENST00000262467.5_Frame_Shift_Ins_p.K583fs|NLRP1_ENST00000577119.1_Frame_Shift_Ins_p.K583fs|NLRP1_ENST00000354411.3_Frame_Shift_Ins_p.K583fs|NLRP1_ENST00000571307.1_5'UTR			Q9C000	NALP1_HUMAN	NLR family, pyrin domain containing 1	583	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|defense response to bacterium (GO:0042742)|innate immune response (GO:0045087)|neuron apoptotic process (GO:0051402)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of interleukin-1 beta secretion (GO:0050718)|regulation of inflammatory response (GO:0050727)|response to muramyl dipeptide (GO:0032495)	cytosol (GO:0005829)|intracellular (GO:0005622)|NLRP1 inflammasome complex (GO:0072558)|nucleus (GO:0005634)	ATP binding (GO:0005524)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)|enzyme binding (GO:0019899)|protein domain specific binding (GO:0019904)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(17)|liver(5)|lung(17)|ovary(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	65		Colorectal(1115;3.48e-05)				TGAAAAGGGTCTTTTTTTGCCA	0.535																																					p.K583fs		.	.											.	NLRP1	.	.	0			c.1749_1750insA						.																																			SO:0001589	frameshift_variant	22861	exon4			.	AB023143	CCDS32537.1, CCDS42244.1, CCDS42245.1, CCDS42246.1, CCDS58508.1	17p13	2014-01-29	2006-12-08	2006-12-08	ENSG00000091592	ENSG00000091592		"""Nucleotide-binding domain and leucine rich repeat containing"""	14374	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 1"""	606636	"""NACHT, leucine rich repeat and PYD (pyrin domain) containing 1"", ""systemic lupus erythematosus, vitiligo-related 1"""	NALP1, SLEV1		8781126, 12563287, 17377159	Standard	NM_033006		Approved	KIAA0926, DKFZp586O1822, CARD7, NAC, CLR17.1, DEFCAP, VAMAS1	uc002gci.3	Q9C000		ENST00000572272.1:c.1749dupA	17.37:g.5462274_5462274dupT	ENSP00000460475:p.Lys583fs	219.0	0.0		158.0	10.0	NM_033007	E9PE50|I6L9D9|Q9BZZ8|Q9BZZ9|Q9H5Z7|Q9H5Z8|Q9HAV8|Q9UFT4|Q9Y2E0	Frame_Shift_Ins	INS	ENST00000572272.1	37	CCDS42246.1																																																																																			.	.		0.535	NLRP1-011	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000439517.1	NM_033004	
SVOPL	136306	hgsc.bcm.edu	37	7	138312995	138312996	+	Frame_Shift_Ins	INS	-	-	C	rs562489887|rs79662895		TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr7:138312995_138312996insC	ENST00000419765.3	-	10	1009_1010	c.976_977insG	c.(976-978)gacfs	p.D326fs	SVOPL_ENST00000288513.5_Frame_Shift_Ins_p.D174fs|SVOPL_ENST00000436657.1_Frame_Shift_Ins_p.D174fs|SVOPL_ENST00000421622.1_Frame_Shift_Ins_p.D206fs|SVOPL_ENST00000463557.1_5'Flank	NM_001139456.1	NP_001132928.1	Q8N434	SVOPL_HUMAN	SVOP-like	326						integral component of membrane (GO:0016021)	transmembrane transporter activity (GO:0022857)			NS(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(4)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)	19						CTCCCCTGAGTCCCCCCCAGTC	0.554																																					p.D326fs		.	.											.	SVOPL	.	.	0			c.977_978insG						.																																			SO:0001589	frameshift_variant	136306	exon10			.	BC036796	CCDS5848.1, CCDS47721.1	7q34	2011-07-12	2007-04-04		ENSG00000157703	ENSG00000157703			27034	protein-coding gene	gene with protein product		611700	"""SV2 related protein homolog (rat)-like"""				Standard	NM_001139456		Approved	MGC46715	uc011kqh.2	Q8N434	OTTHUMG00000155870	ENST00000419765.3:c.977dupG	7.37:g.138313002_138313002dupC	ENSP00000405482:p.Asp326fs	139.0	0.0		131.0	12.0	NM_001139456		Frame_Shift_Ins	INS	ENST00000419765.3	37	CCDS47721.1																																																																																			.	.		0.554	SVOPL-005	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342092.4	NM_174959	
AXDND1	126859	hgsc.bcm.edu	37	1	179437688	179437689	+	Frame_Shift_Ins	INS	-	-	A			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr1:179437688_179437689insA	ENST00000367618.3	+	17	2296_2297	c.1909_1910insA	c.(1909-1911)gaafs	p.E637fs	AXDND1_ENST00000457238.2_3'UTR|AXDND1_ENST00000461179.2_3'UTR	NM_144696.4	NP_653297.3	Q5T1B0	AXDN1_HUMAN	axonemal dynein light chain domain containing 1	637										NS(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(27)|ovary(1)|pancreas(1)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)	59						GGAAATAGATGAAAAAATTAAT	0.351																																					p.E637fs		.	.											.	AXDND1	.	.	0			c.1909_1910insA						.																																			SO:0001589	frameshift_variant	126859	exon17			.	BX647935	CCDS30948.1	1q25.2	2011-02-18	2011-02-18	2011-02-18	ENSG00000162779	ENSG00000162779			26564	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 125"""	C1orf125		14702039	Standard	NM_144696		Approved	FLJ32940	uc001gmo.3	Q5T1B0	OTTHUMG00000035266	ENST00000367618.3:c.1915dupA	1.37:g.179437694_179437694dupA	ENSP00000356590:p.Glu637fs	149.0	0.0		221.0	15.0	NM_144696	Q6AWB2|Q96LJ3|Q96M01	Frame_Shift_Ins	INS	ENST00000367618.3	37	CCDS30948.1																																																																																			.	.		0.351	AXDND1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085312.1	NM_144696	
PHYKPL	85007	hgsc.bcm.edu	37	5	177642304	177642305	+	Frame_Shift_Ins	INS	-	-	T			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr5:177642304_177642305insT	ENST00000308158.5	-	9	1288_1289	c.1054_1055insA	c.(1054-1056)atcfs	p.I352fs	PHYKPL_ENST00000481811.1_5'UTR	NM_153373.2	NP_699204.1	Q8IUZ5	AT2L2_HUMAN	5-phosphohydroxy-L-lysine phospho-lyase	352						mitochondrion (GO:0005739)	lyase activity (GO:0016829)|pyridoxal phosphate binding (GO:0030170)|transaminase activity (GO:0008483)									L-Alanine(DB00160)	GGGATGTTTGATTTTTTGCTGC	0.574																																					p.I352fs		.	.											.	AGXT2L2	.	.	0			c.1055_1056insA						.																																			SO:0001589	frameshift_variant	85007	exon9			.	BC037567	CCDS4434.1	5q35.3	2013-06-12	2013-06-12	2013-06-12	ENSG00000175309	ENSG00000175309	4.2.3.134		28249	protein-coding gene	gene with protein product	"""5-phosphonooxy-L-lysine phospho-lyase"""	614683	"""alanine-glyoxylate aminotransferase 2-like 2"""	AGXT2L2		22241472	Standard	NM_153373		Approved	MGC15875	uc003miz.3	Q8IUZ5	OTTHUMG00000130892	ENST00000308158.5:c.1055dupA	5.37:g.177642310_177642310dupT	ENSP00000310978:p.Ile352fs	215.0	0.0		246.0	16.0	NM_153373	A8K7P6|B3KN36|D3DWP9|Q8WYS6|Q96HW8	Frame_Shift_Ins	INS	ENST00000308158.5	37	CCDS4434.1																																																																																			.	.		0.574	PHYKPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253477.1	NM_032921	
ELF1	1997	hgsc.bcm.edu	37	13	41507921	41507922	+	Frame_Shift_Ins	INS	-	-	C			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr13:41507921_41507922insC	ENST00000239882.3	-	9	1813_1814	c.1499_1500insG	c.(1498-1500)ggcfs	p.G500fs	ELF1_ENST00000498824.1_5'UTR|ELF1_ENST00000442101.1_Frame_Shift_Ins_p.G476fs	NM_172373.3	NP_758961.1	P32519	ELF1_HUMAN	E74-like factor 1 (ets domain transcription factor)	500					cell differentiation (GO:0030154)|negative regulation of T cell receptor signaling pathway (GO:0050860)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cytokine production (GO:0001817)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(8)|lung(12)|ovary(1)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	37		Lung NSC(96;8.3e-05)|Prostate(109;0.0233)|Breast(139;0.0296)|Lung SC(185;0.0367)		all cancers(112;1.87e-08)|Epithelial(112;8.45e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000202)|GBM - Glioblastoma multiforme(144;0.00266)|BRCA - Breast invasive adenocarcinoma(63;0.072)		CCTGGGCAGGGCCCAAGACAAT	0.495																																					p.G500fs		.	.											.	ELF1	.	.	0			c.1500_1501insG						.																																			SO:0001589	frameshift_variant	1997	exon9			.	M82882	CCDS9374.1	13q13	2008-07-18			ENSG00000120690	ENSG00000120690			3316	protein-coding gene	gene with protein product		189973				1545787	Standard	NM_001145353		Approved		uc001uxs.3	P32519	OTTHUMG00000016783	ENST00000239882.3:c.1500dupG	13.37:g.41507924_41507924dupC	ENSP00000239882:p.Gly500fs	207.0	0.0		179.0	11.0	NM_172373	B4E2I5|E9PDQ9|Q8N6F6|Q9UDE1	Frame_Shift_Ins	INS	ENST00000239882.3	37	CCDS9374.1																																																																																			.	.		0.495	ELF1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044654.3	NM_172373	
AGTPBP1	23287	hgsc.bcm.edu	37	9	88247814	88247815	+	Frame_Shift_Ins	INS	-	-	A			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr9:88247814_88247815insA	ENST00000357081.3	-	14	1921_1922	c.1777_1778insT	c.(1777-1779)tgcfs	p.C593fs	AGTPBP1_ENST00000376109.3_Frame_Shift_Ins_p.C605fs|AGTPBP1_ENST00000376083.3_Frame_Shift_Ins_p.C553fs|AGTPBP1_ENST00000432218.1_Frame_Shift_Ins_p.C431fs|AGTPBP1_ENST00000337006.4_3'UTR			Q9UPW5	CBPC1_HUMAN	ATP/GTP binding protein 1	593					adult walking behavior (GO:0007628)|C-terminal protein deglutamylation (GO:0035609)|cerebellar Purkinje cell differentiation (GO:0021702)|eye photoreceptor cell differentiation (GO:0001754)|mitochondrion organization (GO:0007005)|neuromuscular process (GO:0050905)|neurotransmitter metabolic process (GO:0042133)|olfactory bulb development (GO:0021772)|protein side chain deglutamylation (GO:0035610)|retina development in camera-type eye (GO:0060041)	cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	metallocarboxypeptidase activity (GO:0004181)|tubulin binding (GO:0015631)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(12)|lung(12)|ovary(5)|skin(2)|urinary_tract(3)	44						TCCAGTGCAGCAAAGCTTCCCT	0.446																																					p.C553fs		.	.											.	AGTPBP1	.	.	0			c.1658_1659insT						.																																			SO:0001589	frameshift_variant	23287	exon14			.	AB028958	CCDS6672.1, CCDS75854.1	9q21.33	2014-06-23			ENSG00000135049	ENSG00000135049			17258	protein-coding gene	gene with protein product	"""cytosolic carboxypeptidase 1"", ""tubulinyl-Tyr carboxypeptidase"", ""carboxypeptidase-tubulin"", ""tyrosine carboxypeptidase"", ""soluble carboxypeptidase"""	606830				11083920	Standard	NM_015239		Approved	KIAA1035, Nna1, CCP1	uc010mqc.3	Q9UPW5	OTTHUMG00000020124	ENST00000357081.3:c.1778dupT	9.37:g.88247817_88247817dupA	ENSP00000349592:p.Cys593fs	199.0	0.0		163.0	12.0	NM_015239	B4DIT6|B4DRZ8|Q5VV80|Q63HM7|Q658P5|Q6P9D6|Q9H8U6|Q9H9W8|Q9NVK1	Frame_Shift_Ins	INS	ENST00000357081.3	37																																																																																				.	.		0.446	AGTPBP1-004	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000052893.1	NM_015239	
ERAP1	51752	hgsc.bcm.edu	37	5	96132948	96132949	+	In_Frame_Ins	INS	-	-	TCATCTTCA			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr5:96132948_96132949insTCATCTTCA	ENST00000443439.2	-	4	793_794	c.727_728insTGAAGATGA	c.(727-729)agc>aTGAAGATGAgc	p.242_243insMKM	ERAP1_ENST00000296754.3_In_Frame_Ins_p.242_243insMKM	NM_001040458.1|NM_001198541.1	NP_001035548.1|NP_001185470.1	Q9NZ08	ERAP1_HUMAN	endoplasmic reticulum aminopeptidase 1	242					angiogenesis (GO:0001525)|antigen processing and presentation of endogenous peptide antigen via MHC class I (GO:0019885)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|fat cell differentiation (GO:0045444)|membrane protein ectodomain proteolysis (GO:0006509)|positive regulation of angiogenesis (GO:0045766)|regulation of blood pressure (GO:0008217)|regulation of innate immune response (GO:0045088)|response to bacterium (GO:0009617)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	aminopeptidase activity (GO:0004177)|interleukin-1, Type II receptor binding (GO:0005151)|interleukin-6 receptor binding (GO:0005138)|metalloexopeptidase activity (GO:0008235)|zinc ion binding (GO:0008270)			endometrium(7)|large_intestine(5)|lung(3)|ovary(1)|pancreas(1)|stomach(2)	19		all_cancers(142;1.75e-06)|all_epithelial(76;3.08e-09)|all_lung(232;0.000435)|Lung NSC(167;0.000601)|Ovarian(225;0.024)|Colorectal(57;0.0432)|Breast(839;0.244)		all cancers(79;7.26e-15)|COAD - Colon adenocarcinoma(37;0.071)		CAGATAGGTGCTCATCTTCACA	0.401																																					p.S243delinsMKMS		.	.											.	ERAP1	.	.	0			c.728_729insTGAAGATGA						.																																			SO:0001652	inframe_insertion	51752	exon4			.	AB011097	CCDS4085.1, CCDS47250.1	5q15	2014-04-07			ENSG00000164307	ENSG00000164307			18173	protein-coding gene	gene with protein product	"""aminopeptidase regulator of TNFR1 shedding"", ""adipocyte-derived leucine aminopeptidase"", ""puromycin-insensitive leucyl-specific aminopeptidase"""	606832				10220586, 12189246, 16286653	Standard	NM_001198541		Approved	ARTS-1, A-LAP, PILS-AP, KIAA0525, ERAAP1	uc003kml.3	Q9NZ08	OTTHUMG00000128721	ENST00000443439.2:c.719_727dupTGAAGATGA	5.37:g.96132949_96132957dupTCATCTTCA	ENSP00000406304:p.Met242_Ser243insMetLysMet	281.0	0.0		239.0	20.0	NM_001198541	O60278|Q6UWY6|Q8NEL4|Q8TAD0|Q9UHF8|Q9UKY2	In_Frame_Ins	INS	ENST00000443439.2	37	CCDS47250.1																																																																																			.	.		0.401	ERAP1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370699.1	NM_016442	
PJA1	64219	hgsc.bcm.edu	37	X	68382256	68382257	+	Frame_Shift_Ins	INS	-	-	A			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chrX:68382256_68382257insA	ENST00000361478.1	-	2	1202_1203	c.825_826insT	c.(823-828)tttgatfs	p.D276fs	PJA1_ENST00000374584.3_Intron|PJA1_ENST00000477231.1_5'UTR|PJA1_ENST00000374583.1_Frame_Shift_Ins_p.D276fs|PJA1_ENST00000374571.4_Frame_Shift_Ins_p.D221fs	NM_001032396.2|NM_022368.4|NM_145119.3	NP_001027568.1|NP_071763.2|NP_660095.1	Q8NG27	PJA1_HUMAN	praja ring finger 1, E3 ubiquitin protein ligase	276	Poly-Asp.				protein catabolic process (GO:0030163)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(3)|large_intestine(5)|lung(12)|ovary(1)	21						TCATCAGTATCAAAAAAAATTT	0.495																																					p.D276_T277delinsX		.	.											.	PJA1	.	.	0			c.826_827insT						.																																			SO:0001589	frameshift_variant	64219	exon2			.	AK021892	CCDS14392.1, CCDS14393.1, CCDS35316.1	Xq13.1	2013-01-09	2012-02-23		ENSG00000181191	ENSG00000181191		"""RING-type (C3HC4) zinc fingers"""	16648	protein-coding gene	gene with protein product		300420	"""praja 1"", ""praja ring finger 1"""			12036302	Standard	NM_001032396		Approved	FLJ11830, RNF70	uc004dxh.3	Q8NG27	OTTHUMG00000021753	ENST00000361478.1:c.826dupT	X.37:g.68382264_68382264dupA	ENSP00000355014:p.Asp276fs	127.0	0.0		152.0	10.0	NM_145119	A2A322|Q5JUT8|Q5JUT9|Q8NG28|Q9HAC1	Frame_Shift_Ins	INS	ENST00000361478.1	37	CCDS14393.1																																																																																			.	.		0.495	PJA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000057031.2	NM_145119	
RAPGEF1	2889	hgsc.bcm.edu	37	9	134501450	134501451	+	Frame_Shift_Ins	INS	-	-	G			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr9:134501450_134501451insG	ENST00000372189.3	-	10	1632_1633	c.1509_1510insC	c.(1507-1512)ccctacfs	p.Y504fs	RAPGEF1_ENST00000372195.1_Frame_Shift_Ins_p.Y521fs|RAPGEF1_ENST00000481260.1_5'Flank|RAPGEF1_ENST00000372190.3_Frame_Shift_Ins_p.Y522fs	NM_005312.2	NP_005303.2	Q13905	RPGF1_HUMAN	Rap guanine nucleotide exchange factor (GEF) 1	504					activation of MAPKK activity (GO:0000186)|blood vessel development (GO:0001568)|cellular response to cAMP (GO:0071320)|cellular response to nerve growth factor stimulus (GO:1990090)|establishment of endothelial barrier (GO:0061028)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of neural precursor cell proliferation (GO:2000178)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of Ras protein signal transduction (GO:0046580)|nerve growth factor signaling pathway (GO:0038180)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of neuron projection development (GO:0010976)|positive regulation of Rap GTPase activity (GO:0032854)|Rap protein signal transduction (GO:0032486)|regulation of cell junction assembly (GO:1901888)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytosol (GO:0005829)|early endosome (GO:0005769)|endosome (GO:0005768)	Rap guanyl-nucleotide exchange factor activity (GO:0017034)			NS(2)|breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|large_intestine(8)|lung(9)|ovary(2)|prostate(4)|skin(1)|urinary_tract(1)	39		Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;2.19e-05)|Epithelial(140;0.000364)		AAGGGCGCGTAGGGGACGGATG	0.594																																					p.Y522fs		.	.											.	RAPGEF1	.	.	0			c.1564_1565insC						.																																			SO:0001589	frameshift_variant	2889	exon10			.	BC041710	CCDS48047.1	9q34.3	2008-02-05	2004-03-01	2004-03-02	ENSG00000107263	ENSG00000107263			4568	protein-coding gene	gene with protein product		600303	"""guanine nucleotide-releasing factor 2 (specific for crk proto-oncogene)"""	GRF2		7959692, 7512734	Standard	NM_005312		Approved	C3G	uc022bos.1	Q13905	OTTHUMG00000020829	ENST00000372189.3:c.1510dupC	9.37:g.134501454_134501454dupG	ENSP00000361263:p.Tyr504fs	199.0	0.0		157.0	10.0	NM_198679	Q5JUE4|Q8IV73	Frame_Shift_Ins	INS	ENST00000372189.3	37	CCDS48047.1																																																																																			.	.		0.594	RAPGEF1-001	KNOWN	non_canonical_U12|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000054759.2	NM_005312	
LCE1D	353134	hgsc.bcm.edu	37	1	152770450	152770451	+	Frame_Shift_Ins	INS	-	-	G			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr1:152770450_152770451insG	ENST00000326233.6	+	2	223_224	c.180_181insG	c.(181-183)gggfs	p.G61fs		NM_178352.2	NP_848129.1	Q5T752	LCE1D_HUMAN	late cornified envelope 1D	61	Cys-rich.				cellular response to calcium ion (GO:0071277)|cognition (GO:0050890)|keratinization (GO:0031424)	cornified envelope (GO:0001533)|cytoplasm (GO:0005737)|perinuclear region of cytoplasm (GO:0048471)				large_intestine(1)	1	Lung NSC(65;3.97e-29)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)			GCTCCAACTCTGGGGGCTGCTG	0.663																																					p.S60fs		.	.											.	LCE1D	.	.	0			c.180_181insG						.																																			SO:0001589	frameshift_variant	353134	exon2			.		CCDS1025.1	1q21.3	2008-02-05			ENSG00000172155	ENSG00000172155		"""Late cornified envelopes"""	29465	protein-coding gene	gene with protein product		612606				11698679	Standard	NM_178352		Approved	LEP4	uc009wnp.3	Q5T752	OTTHUMG00000012444	ENST00000326233.6:c.185dupG	1.37:g.152770455_152770455dupG	ENSP00000316737:p.Gly61fs	131.0	0.0		128.0	11.0	NM_178352		Frame_Shift_Ins	INS	ENST00000326233.6	37	CCDS1025.1																																																																																			.	.		0.663	LCE1D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034657.2	NM_178352	
THRB	7068	hgsc.bcm.edu	37	3	24164402	24164403	+	Frame_Shift_Ins	INS	-	-	G	rs121918687		TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr3:24164402_24164403insG	ENST00000356447.4	-	10	1642_1643	c.1358_1359insC	c.(1357-1359)cctfs	p.P453fs	THRB_ENST00000396671.2_Frame_Shift_Ins_p.P453fs|THRB_ENST00000416420.1_Frame_Shift_Ins_p.P453fs|THRB_ENST00000280696.5_Frame_Shift_Ins_p.P468fs	NM_000461.4|NM_001128177.1	NP_000452.2|NP_001121649.1	P10828	THB_HUMAN	thyroid hormone receptor, beta	453	Interaction with NR2F6.|Ligand-binding.		P -> H (in GTHR). {ECO:0000269|PubMed:2153155}.|P -> L (in GTHR). {ECO:0000269|PubMed:19268523}.|P -> S (in GTHR). {ECO:0000269|PubMed:7833659}.|P -> T (in GTHR; dbSNP:rs28933408). {ECO:0000269|PubMed:1619012, ECO:0000269|PubMed:1661299, ECO:0000269|PubMed:19268523, ECO:0000269|PubMed:8514853}.		female courtship behavior (GO:0008050)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of female receptivity (GO:0007621)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|organ morphogenesis (GO:0009887)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of heart contraction (GO:0008016)|sensory perception of sound (GO:0007605)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|Type I pneumocyte differentiation (GO:0060509)	extracellular vesicular exosome (GO:0070062)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|thyroid hormone binding (GO:0070324)|thyroid hormone receptor activity (GO:0004887)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(2)|large_intestine(4)|lung(6)|pancreas(2)|prostate(1)|skin(3)	19					Dextrothyroxine(DB00509)|Levothyroxine(DB00451)|Liothyronine(DB00279)|Liotrix(DB01583)	CCAAGAACAAAGGGGGGAAGAG	0.48																																					p.P453fs	Melanoma(21;896 1043 15021 37958)	.	.											.	THRB	.	.	0			c.1359_1360insC	GRCh37	CI062290|CM900208|CP015819	THRB	I|M|X	rs121918687	.																																			SO:0001589	frameshift_variant	7068	exon10			.		CCDS2641.1	3p24.2	2013-01-16	2011-05-19		ENSG00000151090	ENSG00000151090		"""Nuclear hormone receptors"""	11799	protein-coding gene	gene with protein product	"""avian erythroblastic leukemia viral (v-erb-a) oncogene homolog 2"", ""oncogene ERBA2"", ""generalized resistance to thyroid hormone"", ""thyroid hormone receptor beta 1"""	190160	"""thyroid hormone receptor, beta (avian erythroblastic leukemia viral (v-erb-a) oncogene homolog 2)"", ""pituitary resistance to thyroid hormone"", ""thyroid hormone receptor, beta (erythroblastic leukemia viral (v-erb-a) oncogene homolog 2, avian)"""	ERBA2, PRTH		1973914, 8040303	Standard	NM_000461		Approved	THRB1, THRB2, NR1A2, THR1, ERBA-BETA, GRTH	uc003ccy.4	P10828	OTTHUMG00000130478	ENST00000356447.4:c.1359dupC	3.37:g.24164408_24164408dupG	ENSP00000348827:p.Pro453fs	162.0	0.0		119.0	10.0	NM_000461	B3KU79|P37243|Q13986|Q3KP35|Q6WGL2|Q9UD41	Frame_Shift_Ins	INS	ENST00000356447.4	37	CCDS2641.1																																																																																			.	.		0.480	THRB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000252877.3	NM_000461	
ADAM15	8751	hgsc.bcm.edu	37	1	155029712	155029713	+	Frame_Shift_Ins	INS	-	-	A			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr1:155029712_155029713insA	ENST00000356955.2	+	12	1298_1299	c.1197_1198insA	c.(1198-1200)aaafs	p.K400fs	ADAM15_ENST00000447332.3_Frame_Shift_Ins_p.K384fs|ADAM15_ENST00000271836.6_Frame_Shift_Ins_p.K400fs|ADAM15_ENST00000360674.4_Frame_Shift_Ins_p.K400fs|ADAM15_ENST00000368413.1_Frame_Shift_Ins_p.K106fs|ADAM15_ENST00000368412.3_Frame_Shift_Ins_p.K400fs|ADAM15_ENST00000531455.1_Frame_Shift_Ins_p.K410fs|ADAM15_ENST00000355956.2_Frame_Shift_Ins_p.K400fs|ADAM15_ENST00000472434.1_3'UTR|ADAM15_ENST00000368410.2_Frame_Shift_Ins_p.K106fs|ADAM15_ENST00000359280.4_Frame_Shift_Ins_p.K400fs|ADAM15_ENST00000449910.2_Frame_Shift_Ins_p.K400fs	NM_207197.2	NP_997080.1	Q13444	ADA15_HUMAN	ADAM metallopeptidase domain 15	400	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.				angiogenesis (GO:0001525)|cardiac epithelial to mesenchymal transition (GO:0060317)|cell-matrix adhesion (GO:0007160)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of receptor binding (GO:1900121)|protein kinase C signaling (GO:0070528)|tissue regeneration (GO:0042246)	cell junction (GO:0030054)|cell projection (GO:0042995)|cell surface (GO:0009986)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|SH3 domain binding (GO:0017124)|zinc ion binding (GO:0008270)			NS(1)|central_nervous_system(3)|cervix(1)|endometrium(9)|kidney(1)|large_intestine(7)|lung(8)|ovary(1)|prostate(2)|skin(5)|urinary_tract(1)	39	all_epithelial(22;1.43e-30)|all_lung(78;6.64e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		BRCA - Breast invasive adenocarcinoma(34;0.000434)			GGGCCCTGGAGAAAGCCCTCCT	0.634																																					p.E409fs		.	.											.	ADAM15	.	.	0			c.1227_1228insA						.																																			SO:0001589	frameshift_variant	8751	exon12			.	U46005	CCDS1084.1, CCDS1085.1, CCDS1086.1, CCDS1087.1, CCDS1088.1, CCDS44236.1, CCDS58031.1, CCDS58032.1, CCDS60282.1	1q21.3	2008-02-05	2007-06-04		ENSG00000143537	ENSG00000143537		"""ADAM metallopeptidase domain containing"""	193	protein-coding gene	gene with protein product	"""metargidin"""	605548	"""a disintegrin and metalloproteinase domain 15 (metargidin)"""			9516430	Standard	NM_003815		Approved	MDC15	uc001fgr.2	Q13444	OTTHUMG00000013898	ENST00000356955.2:c.1200dupA	1.37:g.155029715_155029715dupA	ENSP00000349436:p.Lys400fs	76.0	0.0		157.0	11.0	NM_001261464	B3KQU5|B4DLB5|B4DMH8|E9PN65|Q13493|Q53XQ0|Q5SR68|Q5SR69|Q6R267|Q71S61|Q71S62|Q71S63|Q71S64|Q71S65|Q71S66|Q71S67|Q71S68|Q71S69|Q96C78|U3KQL5	Frame_Shift_Ins	INS	ENST00000356955.2	37	CCDS1087.1																																																																																			.	.		0.634	ADAM15-019	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000387168.1	NM_003815	
SPTY2D1	144108	hgsc.bcm.edu	37	11	18637172	18637173	+	Frame_Shift_Ins	INS	-	-	T			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr11:18637172_18637173insT	ENST00000336349.5	-	3	883_884	c.648_649insA	c.(646-651)aaacttfs	p.L217fs	SPTY2D1_ENST00000543776.1_5'Flank	NM_194285.2	NP_919261.2	Q68D10	SPT2_HUMAN	SPT2, Suppressor of Ty, domain containing 1 (S. cerevisiae)	217								p.K216fs*254(1)		breast(4)|cervix(3)|endometrium(2)|kidney(3)|large_intestine(7)|lung(9)|skin(1)|stomach(1)	30						TCTGTCTCAAGTTTTTTTCTCC	0.446																																					p.L217fs		.	.											.	SPTY2D1	.	.	1	Deletion - Frameshift(1)	lung(1)	c.649_650insA						.																																			SO:0001589	frameshift_variant	144108	exon3			.	BX647798	CCDS31441.1	11p15.1	2005-10-28			ENSG00000179119	ENSG00000179119			26818	protein-coding gene	gene with protein product							Standard	NM_194285		Approved	FLJ39441, DKFZp686I068	uc001moy.3	Q68D10	OTTHUMG00000167733	ENST00000336349.5:c.649dupA	11.37:g.18637179_18637179dupT	ENSP00000337991:p.Leu217fs	294.0	0.0		253.0	16.0	NM_194285	Q6AWA5|Q6MZI5|Q7Z390|Q7Z470|Q86VG8|Q8N3E7|Q8N417|Q8N8I3	Frame_Shift_Ins	INS	ENST00000336349.5	37	CCDS31441.1																																																																																			.	.		0.446	SPTY2D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395941.1	NM_194285	
DCHS2	54798	hgsc.bcm.edu	37	4	155157446	155157447	+	Frame_Shift_Del	DEL	AG	AG	-			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	AG	AG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr4:155157446_155157447delAG	ENST00000357232.4	-	25	6991_6992	c.6992_6993delCT	c.(6991-6993)tctfs	p.S2331fs		NM_017639.3	NP_060109.2	Q6V1P9	PCD23_HUMAN	dachsous cadherin-related 2	2331	Cadherin 21. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(1)|cervix(3)|endometrium(8)|kidney(5)|large_intestine(54)|lung(63)|ovary(4)|pancreas(1)|prostate(14)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	176	all_hematologic(180;0.208)	Renal(120;0.0854)		LUSC - Lung squamous cell carcinoma(193;0.107)		AGCATATGGTAGAGGAAATAGG	0.411																																					p.2331_2332del		.	.											.	DCHS2	.	.	0			c.6993_6994del						.																																			SO:0001589	frameshift_variant	54798	exon25			.	BC140919	CCDS3785.1, CCDS47150.1	4q32.1	2014-06-04	2013-10-04	2004-09-03		ENSG00000197410		"""Cadherins / Cadherin-related"""	23111	protein-coding gene	gene with protein product	"""cadherin-related family member 7"""	612486	"""cadherin-like 27"", ""dachsous 2 (Drosophila)"""	CDH27, PCDH23		15003449	Standard	NM_017639		Approved	CDHJ, FLJ20047, PCDHJ, CDHR7	uc003inw.2	Q6V1P9		ENST00000357232.4:c.6992_6993delCT	4.37:g.155157448_155157449delAG	ENSP00000349768:p.Ser2331fs	191.0	0.0		225.0	74.0	NM_017639	B2RU14|E9PC11|Q4W5P9|Q6ZS61|Q9NXU8	Frame_Shift_Del	DEL	ENST00000357232.4	37	CCDS3785.1																																																																																			.	.		0.411	DCHS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365281.2	NM_001142552	
APBB1	322	hgsc.bcm.edu	37	11	6423899	6423900	+	Frame_Shift_Ins	INS	-	-	G			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr11:6423899_6423900insG	ENST00000609360.1	-	7	1259_1260	c.1160_1161insC	c.(1159-1161)cctfs	p.P387fs	APBB1_ENST00000389906.2_Frame_Shift_Ins_p.P387fs|APBB1_ENST00000311051.3_Frame_Shift_Ins_p.P387fs|APBB1_ENST00000608645.1_Frame_Shift_Ins_p.P128fs|APBB1_ENST00000609331.1_Frame_Shift_Ins_p.P152fs|APBB1_ENST00000608655.1_Frame_Shift_Ins_p.P167fs|APBB1_ENST00000608704.1_Frame_Shift_Ins_p.P128fs|APBB1_ENST00000529519.1_Intron|APBB1_ENST00000299402.6_Frame_Shift_Ins_p.P387fs|APBB1_ENST00000530885.1_Frame_Shift_Ins_p.P167fs|APBB1_ENST00000608394.1_Frame_Shift_Ins_p.P128fs	NM_001164.3	NP_001155.1	O00213	APBB1_HUMAN	amyloid beta (A4) precursor protein-binding, family B, member 1 (Fe65)	387	PID 1. {ECO:0000255|PROSITE- ProRule:PRU00148}.				apoptotic process (GO:0006915)|axonogenesis (GO:0007409)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|histone H4 acetylation (GO:0043967)|negative regulation of cell growth (GO:0030308)|negative regulation of thymidylate synthase biosynthetic process (GO:0050760)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|growth cone (GO:0030426)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|synapse (GO:0045202)	beta-amyloid binding (GO:0001540)|chromatin binding (GO:0003682)|histone binding (GO:0042393)|proline-rich region binding (GO:0070064)|transcription factor binding (GO:0008134)			breast(4)|endometrium(3)|kidney(1)|large_intestine(7)|lung(5)|prostate(2)|skin(1)|urinary_tract(1)	24		Medulloblastoma(188;0.00263)|all_neural(188;0.026)|Breast(177;0.029)		Epithelial(150;6.49e-08)|BRCA - Breast invasive adenocarcinoma(625;0.194)		TGCTGCGTCCAGGGGCCAGCTC	0.579																																					p.P387fs	GBM(147;1810 2556 5672 39622)	.	.											.	APBB1	.	.	0			c.1161_1162insC						.																																			SO:0001589	frameshift_variant	322	exon7			.	L77864	CCDS31410.1, CCDS58114.1, CCDS66015.1, CCDS66016.1, CCDS66017.1, CCDS66018.1	11p15	2008-02-01				ENSG00000166313			581	protein-coding gene	gene with protein product		602709		RIR		8955346, 8894693	Standard	NM_001164		Approved	Fe65	uc001mcy.1	O00213		ENST00000609360.1:c.1161dupC	11.37:g.6423903_6423903dupG	ENSP00000477213:p.Pro387fs	275.0	0.0		185.0	11.0	NM_001164	A1E379|A6NH82|A6NL69|B7Z1J5|B7Z1J6|B7Z2Y0|D3DQT2|Q7Z324|Q96A93|V9GYK0|V9GYT4	Frame_Shift_Ins	INS	ENST00000609360.1	37																																																																																				.	.		0.579	APBB1-023	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000471831.1	NM_001164	
RPL36A	6173	hgsc.bcm.edu	37	X	100646804	100646805	+	Frame_Shift_Ins	INS	-	-	A			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chrX:100646804_100646805insA	ENST00000553110.3	+	3	255_256	c.171_172insA	c.(172-174)aaafs	p.K58fs	RPL36A_ENST00000471855.1_5'UTR|RPL36A_ENST00000427805.2_Frame_Shift_Ins_p.K94fs|RPL36A-HNRNPH2_ENST00000409170.3_Frame_Shift_Ins_p.GK68fs			P83881	RL36A_HUMAN	ribosomal protein L36a	58					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			liver(4)|lung(1)|prostate(1)	6						CGATTTTCCGGAAAAAGGTGAG	0.421																																					p.R93fs		.	.											.	.	.	.	0			c.279_280insA						.																																			SO:0001589	frameshift_variant	0	exon3			.	BC001781	CCDS14483.1, CCDS14483.2	Xq22.1	2011-04-06	2002-01-15	2002-01-18	ENSG00000241343	ENSG00000241343		"""L ribosomal proteins"""	10359	protein-coding gene	gene with protein product		300902	"""ribosomal protein L44"""	RPL44		3461443	Standard	NM_021029		Approved	L36A		P83881	OTTHUMG00000022027	ENST00000553110.3:c.176dupA	X.37:g.100646809_100646809dupA	ENSP00000446503:p.Lys58fs	196.0	0.0		153.0	10.0	NM_001199973	P09896|P10661|Q08ES5|Q5J9I6	Frame_Shift_Ins	INS	ENST00000553110.3	37																																																																																				.	.		0.421	RPL36A-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_021029	
STON1	11037	hgsc.bcm.edu	37	2	48809580	48809581	+	Frame_Shift_Ins	INS	-	-	G	rs199917756		TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr2:48809580_48809581insG	ENST00000406226.1	+	3	2003_2004	c.1808_1809insG	c.(1807-1812)ctggggfs	p.LG603fs	STON1_ENST00000404752.1_Frame_Shift_Ins_p.LG603fs|STON1-GTF2A1L_ENST00000394754.1_Frame_Shift_Ins_p.LG603fs|STON1-GTF2A1L_ENST00000309827.2_Frame_Shift_Ins_p.LG603fs|STON1-GTF2A1L_ENST00000402114.2_Frame_Shift_Ins_p.LG603fs|STON1-GTF2A1L_ENST00000394751.3_Frame_Shift_Ins_p.LG603fs|STON1-GTF2A1L_ENST00000405008.1_Frame_Shift_Ins_p.LG603fs|STON1_ENST00000309835.3_Frame_Shift_Ins_p.LG603fs	NM_001198595.1	NP_001185524.1	Q9Y6Q2	STON1_HUMAN	stonin 1	603	MHD. {ECO:0000255|PROSITE- ProRule:PRU00404}.				endocytosis (GO:0006897)|intracellular protein transport (GO:0006886)|regulation of endocytosis (GO:0030100)	clathrin adaptor complex (GO:0030131)				NS(1)|endometrium(1)|kidney(2)|large_intestine(9)|lung(19)|prostate(3)|skin(2)	37		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)			CGAGCATGTCTGGGGAGTTTAC	0.485																																					p.L603fs		.	.											.	STON1	.	.	0			c.1808_1809insG						.																																			SO:0001589	frameshift_variant	11037	exon3			.	AF026169	CCDS1841.1	2p16.3	2008-02-05			ENSG00000243244	ENSG00000243244			17003	protein-coding gene	gene with protein product	"""stoned B homolog 1 (Drosophila)"""	605357				14504226, 10364255	Standard	NM_001198595		Approved	SBLF, stoned-b1		Q9Y6Q2	OTTHUMG00000129169	ENST00000406226.1:c.1812dupG	2.37:g.48809584_48809584dupG	ENSP00000384615:p.Leu603fs	151.0	0.0		164.0	11.0	NM_001198595	A8MXJ1|B5MCF5|B7ZL16|Q96JE3|Q9BYX3	Frame_Shift_Ins	INS	ENST00000406226.1	37	CCDS1841.1																																																																																			.	.		0.485	STON1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323848.2	NM_006873	
SYNE4	163183	hgsc.bcm.edu	37	19	36496296	36496296	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr19:36496296C>T	ENST00000324444.3	-	6	1022	c.911G>A	c.(910-912)gGc>gAc	p.G304D	SYNE4_ENST00000340477.5_Missense_Mutation_p.G191D	NM_001039876.1	NP_001034965.1	Q8N205	SYNE4_HUMAN	spectrin repeat containing, nuclear envelope family member 4	304					establishment of epithelial cell apical/basal polarity (GO:0045198)	integral component of nuclear outer membrane (GO:0031309)											GTGGCCGAGGCCAGACTCCAG	0.567																																					p.G304D		.	.											.	.	.	.	0			c.G911A						.						85.0	90.0	88.0					19																	36496296		2076	4218	6294	SO:0001583	missense	163183	exon6			CCGAGGCCAGACT	BC038360	CCDS42553.1	19q13.12	2014-01-28	2012-05-31	2012-05-31	ENSG00000181392	ENSG00000181392			26703	protein-coding gene	gene with protein product		615535	"""chromosome 19 open reading frame 46"", ""deafness, autosomal recessive 76"""	C19orf46, DFNB76		23348741	Standard	XM_005258597		Approved	FLJ36445, Nesprin-4, Nesp4	uc002ocq.1	Q8N205	OTTHUMG00000048135	ENST00000324444.3:c.911G>A	19.37:g.36496296C>T	ENSP00000316130:p.Gly304Asp	172.0	0.0		197.0	33.0	NM_001039876	A8MRS0|A8MYE3|Q7Z7L3	Missense_Mutation	SNP	ENST00000324444.3	37	CCDS42553.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	13.30|13.30	2.197423|2.197423	0.38806|0.38806	.|.	.|.	ENSG00000181392|ENSG00000181392	ENST00000397428;ENST00000340477;ENST00000324444|ENST00000490730	T;T|.	0.58210|.	0.48;0.35|.	3.99|3.99	2.94|2.94	0.34122|0.34122	.|.	.|.	.|.	.|.	.|.	T|.	0.33789|.	0.0875|.	L|L	0.32530|0.32530	0.975|0.975	0.26468|0.26468	N|N	0.975332|0.975332	B;B|.	0.29531|.	0.247;0.037|.	B;B|.	0.32583|.	0.148;0.029|.	T|.	0.18681|.	-1.0329|.	9|.	0.87932|.	D|.	0|.	-4.2898|-4.2898	8.0888|8.0888	0.30788|0.30788	0.0:0.8888:0.0:0.1112|0.0:0.8888:0.0:0.1112	.|.	191;304|.	Q8N205-2;Q8N205|.	.;SYNE4_HUMAN|.	D|X	28;191;304|244	ENSP00000343152:G191D;ENSP00000316130:G304D|.	ENSP00000316130:G304D|.	G|W	-|-	2|3	0|0	C19orf46|C19orf46	41188136|41188136	0.587000|0.587000	0.26791|0.26791	0.639000|0.639000	0.29394|0.29394	0.023000|0.023000	0.10783|0.10783	1.023000|1.023000	0.30065|0.30065	1.264000|1.264000	0.44198|0.44198	0.591000|0.591000	0.81541|0.81541	GGC|TGG	.	.		0.567	SYNE4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109525.3	NM_001039876	
ORC1	4998	hgsc.bcm.edu	37	1	52859445	52859445	+	Missense_Mutation	SNP	G	G	T			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr1:52859445G>T	ENST00000371568.3	-	6	970	c.752C>A	c.(751-753)aCt>aAt	p.T251N	ORC1_ENST00000371566.1_Missense_Mutation_p.T251N	NM_001190818.1|NM_001190819.1|NM_004153.3	NP_001177747.1|NP_001177748.1|NP_004144.2	Q13415	ORC1_HUMAN	origin recognition complex, subunit 1	251					DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear origin of replication recognition complex (GO:0005664)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|origin recognition complex (GO:0000808)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)			breast(1)|cervix(2)|endometrium(4)|kidney(4)|large_intestine(9)|lung(9)|ovary(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	37						GGCACATGAAGTCTGCTGGGA	0.418																																					p.T251N		.	.											.	ORC1	.	.	0			c.C752A						.						52.0	49.0	50.0					1																	52859445		2203	4300	6503	SO:0001583	missense	4998	exon6			CATGAAGTCTGCT		CCDS566.1	1p32	2010-10-12	2010-10-12	2010-10-12	ENSG00000085840	ENSG00000085840		"""ATPases / AAA-type"""	8487	protein-coding gene	gene with protein product	"""origin recognition complex, subunit 1, S. cerevisiae, homolog-like"", ""origin recognition complex 1"", ""replication control protein 1"""	601902	"""origin recognition complex, subunit 1 (yeast homolog)-like"", ""origin recognition complex, subunit 1-like (yeast)"", ""origin recognition complex, subunit 1 homolog (S. cerevisiae)"""	ORC1L		8884289	Standard	NM_004153		Approved	HSORC1, PARC1	uc001ctu.3	Q13415	OTTHUMG00000008104	ENST00000371568.3:c.752C>A	1.37:g.52859445G>T	ENSP00000360623:p.Thr251Asn	70.0	0.0		104.0	39.0	NM_004153	D3DQ34|Q13471|Q5T0F5	Missense_Mutation	SNP	ENST00000371568.3	37	CCDS566.1	.	.	.	.	.	.	.	.	.	.	G	0.143	-1.100376	0.01843	.	.	ENSG00000085840	ENST00000371568;ENST00000371566	T;T	0.40225	1.04;1.04	4.94	-4.95	0.03048	.	1.308390	0.04413	N	0.366392	T	0.16171	0.0389	N	0.08118	0	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.10730	-1.0617	10	0.12766	T	0.61	0.0307	0.8723	0.01217	0.322:0.1064:0.1711:0.4005	.	251;251	B7Z8H0;Q13415	.;ORC1_HUMAN	N	251	ENSP00000360623:T251N;ENSP00000360621:T251N	ENSP00000360621:T251N	T	-	2	0	ORC1	52632033	0.004000	0.15560	0.000000	0.03702	0.005000	0.04900	-0.259000	0.08721	-0.837000	0.04223	-0.181000	0.13052	ACT	.	.		0.418	ORC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022202.1	NM_004153	
NPSR1	387129	hgsc.bcm.edu	37	7	34888202	34888202	+	Missense_Mutation	SNP	C	C	A			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr7:34888202C>A	ENST00000360581.1	+	8	1080	c.952C>A	c.(952-954)Ctg>Atg	p.L318M	NPSR1_ENST00000359791.1_Missense_Mutation_p.L318M|NPSR1_ENST00000381542.1_Missense_Mutation_p.L252M|NPSR1_ENST00000531252.1_Missense_Mutation_p.L307M|NPSR1_ENST00000381539.3_Missense_Mutation_p.L318M	NM_207172.1	NP_997055.1	Q6W5P4	NPSR1_HUMAN	neuropeptide S receptor 1	318						cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	neuropeptide receptor activity (GO:0008188)|vasopressin receptor activity (GO:0005000)			endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(5)|lung(14)|pancreas(1)|skin(7)	31					Halothane(DB01159)	CATTCAGAACCTGCCAGCATT	0.498																																					p.L318M		.	.											.	NPSR1	.	.	0			c.C952A						.						230.0	218.0	222.0					7																	34888202		2203	4300	6503	SO:0001583	missense	387129	exon8			CAGAACCTGCCAG	AY255536	CCDS5443.1, CCDS5444.1, CCDS75579.1, CCDS75580.1, CCDS75581.1	7p14.3	2012-08-08	2006-05-10	2006-05-10	ENSG00000187258	ENSG00000187258		"""GPCR / Class A : Neuropeptide receptors : S"""	23631	protein-coding gene	gene with protein product		608595	"""G protein-coupled receptor 154"""	GPR154		12679517, 15073379	Standard	NM_207173		Approved	PGR14, GPRA	uc003tei.1	Q6W5P4	OTTHUMG00000099383	ENST00000360581.1:c.952C>A	7.37:g.34888202C>A	ENSP00000353788:p.Leu318Met	263.0	0.0		223.0	81.0	NM_207172	A2RTZ4|Q2XP58|Q56H76|Q56H77|Q56H78|Q6JSL4|Q6JSL5|Q6JSL6|Q6JSL7|Q6JSL8|Q6W5P3|Q6ZMB8	Missense_Mutation	SNP	ENST00000360581.1	37	CCDS5444.1	.	.	.	.	.	.	.	.	.	.	C	18.03	3.533024	0.64972	.	.	ENSG00000187258	ENST00000360581;ENST00000381542;ENST00000359791;ENST00000531252;ENST00000381539;ENST00000334481	T;T;T;T;T	0.51071	0.72;0.72;0.72;0.72;0.72	5.37	4.49	0.54785	GPCR, rhodopsin-like superfamily (1);	0.000000	0.47455	D	0.000240	T	0.67906	0.2943	M	0.83603	2.65	0.47659	D	0.999486	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;0.997;1.0;0.998	D;D;D;D;D;D	0.91635	0.999;0.999;0.998;0.966;0.999;0.974	T	0.71397	-0.4605	10	0.66056	D	0.02	-12.4707	9.491	0.38960	0.0:0.8415:0.0:0.1585	.	252;307;252;318;318;318	B7ZMA2;Q6W5P4-5;Q6W5P4-2;Q6W5P4-4;Q6W5P4-3;Q6W5P4	.;.;.;.;.;NPSR1_HUMAN	M	318;252;318;307;318;121	ENSP00000353788:L318M;ENSP00000370953:L252M;ENSP00000352839:L318M;ENSP00000433258:L307M;ENSP00000370950:L318M	ENSP00000334093:L121M	L	+	1	2	NPSR1	34854727	1.000000	0.71417	1.000000	0.80357	0.953000	0.61014	2.780000	0.47742	1.493000	0.48517	0.655000	0.94253	CTG	.	.		0.498	NPSR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216837.1	NM_207173	
USP31	57478	hgsc.bcm.edu	37	16	23093878	23093878	+	Splice_Site	SNP	G	G	C			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr16:23093878G>C	ENST00000219689.7	-	12	1830	c.1831C>G	c.(1831-1833)Ctt>Gtt	p.L611V		NM_020718.3	NP_065769.3	Q86UV5	UBP48_HUMAN	ubiquitin specific peptidase 31	262	DUSP 2. {ECO:0000255|PROSITE- ProRule:PRU00613}.				ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	ubiquitin-specific protease activity (GO:0004843)			breast(4)|central_nervous_system(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(17)|ovary(4)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|urinary_tract(2)	57				GBM - Glioblastoma multiforme(48;0.0187)		TCGGGGGCAAGCTGAAAACAG	0.498																																					p.L611V		.	.											.	USP31	.	.	0			c.C1831G						.						74.0	63.0	67.0					16																	23093878		2197	4300	6497	SO:0001630	splice_region_variant	57478	exon12			GGGCAAGCTGAAA	AB033029	CCDS10607.1	16p12.3	2008-02-05	2005-08-08		ENSG00000103404	ENSG00000103404		"""Ubiquitin-specific peptidases"""	20060	protein-coding gene	gene with protein product			"""ubiquitin specific protease 31"""			12838346	Standard	NM_020718		Approved	KIAA1203	uc002dll.3	Q70CQ4	OTTHUMG00000094793	ENST00000219689.7:c.1831-1C>G	16.37:g.23093878G>C		133.0	0.0		168.0	30.0	NM_020718	B7ZKS7|Q2M3I4|Q5SZI4|Q5T3T5|Q6NX53|Q8N3F6|Q96F64|Q96IQ3|Q9H5N3|Q9H5T7|Q9NUJ6|Q9NXR0	Missense_Mutation	SNP	ENST00000219689.7	37	CCDS10607.1	.	.	.	.	.	.	.	.	.	.	G	21.6	4.171238	0.78452	.	.	ENSG00000103404	ENST00000219689	T	0.03745	3.82	4.9	4.9	0.64082	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.081669	0.49916	D	0.000121	T	0.18257	0.0438	M	0.84846	2.72	0.80722	D	1	P	0.49447	0.924	P	0.56823	0.807	T	0.00593	-1.1654	10	0.87932	D	0	-11.7004	17.4507	0.87591	0.0:0.0:1.0:0.0	.	611	Q70CQ4	UBP31_HUMAN	V	611	ENSP00000219689:L611V	ENSP00000219689:L611V	L	-	1	0	USP31	23001379	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.203000	0.77864	2.410000	0.81850	0.650000	0.86243	CTT	.	.		0.498	USP31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211607.1	NM_020718	Missense_Mutation
FAM107B	83641	hgsc.bcm.edu	37	10	14563197	14563197	+	Nonsense_Mutation	SNP	C	C	A			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr10:14563197C>A	ENST00000378470.1	-	4	674	c.388G>T	c.(388-390)Gag>Tag	p.E130*	FAM107B_ENST00000378467.4_Nonsense_Mutation_p.E130*|FAM107B_ENST00000496330.1_Nonsense_Mutation_p.E130*|FAM107B_ENST00000479731.1_Nonsense_Mutation_p.E130*|FAM107B_ENST00000378458.2_Nonsense_Mutation_p.E130*|FAM107B_ENST00000478076.1_Nonsense_Mutation_p.E130*|FAM107B_ENST00000378465.3_Nonsense_Mutation_p.E130*|FAM107B_ENST00000181796.2_Nonsense_Mutation_p.E305*|FAM107B_ENST00000378462.1_Nonsense_Mutation_p.E130*|FAM107B_ENST00000468747.1_Nonsense_Mutation_p.E130*	NM_001282695.1|NM_001282696.1|NM_001282697.1|NM_001282698.1|NM_001282700.1|NM_001282701.1|NM_001282702.1|NM_001282703.1	NP_001269624.1|NP_001269625.1|NP_001269626.1|NP_001269627.1|NP_001269629.1|NP_001269630.1|NP_001269631.1|NP_001269632.1	Q9H098	F107B_HUMAN	family with sequence similarity 107, member B	130					sensory perception of sound (GO:0007605)					breast(7)|kidney(1)|large_intestine(4)|lung(7)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	25						GCCTAGGACTCCTGGGCTTGG	0.527																																					p.E305X		.	.											.	FAM107B	.	.	0			c.G913T						.						157.0	142.0	147.0					10																	14563197		2203	4300	6503	SO:0001587	stop_gained	83641	exon5			AGGACTCCTGGGC	AK127413	CCDS7102.1, CCDS60486.1	10p14	2006-01-17	2006-01-17	2005-11-20	ENSG00000065809	ENSG00000065809			23726	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 45"""	C10orf45		11230166	Standard	XM_005252616		Approved	FLJ45505, MGC11034	uc001ina.1	Q9H098	OTTHUMG00000017709	ENST00000378470.1:c.388G>T	10.37:g.14563197C>A	ENSP00000367731:p.Glu130*	200.0	0.0		140.0	30.0	NM_031453	A8K1P4|D3DRT2|Q5T9K7|Q5T9K8|Q6ZSI4	Nonsense_Mutation	SNP	ENST00000378470.1	37		.	.	.	.	.	.	.	.	.	.	C	36	5.790557	0.96945	.	.	ENSG00000065809	ENST00000378470;ENST00000181796;ENST00000468747;ENST00000378467;ENST00000378465;ENST00000378458;ENST00000478076;ENST00000378462;ENST00000378461;ENST00000496330;ENST00000479731;ENST00000468492	.	.	.	5.62	5.62	0.85841	.	0.280557	0.39909	N	0.001232	.	.	.	.	.	.	0.43522	D	0.995794	.	.	.	.	.	.	.	.	.	.	0.62326	D	0.03	-12.8842	11.6661	0.51374	0.0:0.9184:0.0:0.0816	.	.	.	.	X	130;305;130;130;130;130;130;130;130;130;130;130	.	ENSP00000181796:E305X	E	-	1	0	FAM107B	14603203	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	1.803000	0.38863	2.642000	0.89623	0.563000	0.77884	GAG	.	.		0.527	FAM107B-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000046899.1	NM_031453	
KDR	3791	hgsc.bcm.edu	37	4	55976873	55976873	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr4:55976873G>A	ENST00000263923.4	-	8	1334	c.1039C>T	c.(1039-1041)Cgt>Tgt	p.R347C		NM_002253.2	NP_002244.1	P35968	VGFR2_HUMAN	kinase insert domain receptor (a type III receptor tyrosine kinase)	347	Ig-like C2-type 4.				angiogenesis (GO:0001525)|branching morphogenesis of an epithelial tube (GO:0048754)|calcium ion homeostasis (GO:0055074)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|cell fate commitment (GO:0045165)|cell maturation (GO:0048469)|cell migration involved in sprouting angiogenesis (GO:0002042)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|embryonic hemopoiesis (GO:0035162)|endothelial cell differentiation (GO:0045446)|endothelium development (GO:0003158)|extracellular matrix organization (GO:0030198)|lung alveolus development (GO:0048286)|lymph vessel development (GO:0001945)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endothelial cell apoptotic process (GO:2000352)|ovarian follicle development (GO:0001541)|peptidyl-tyrosine autophosphorylation (GO:0038083)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of positive chemotaxis (GO:0050927)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of vasculogenesis (GO:2001214)|protein autophosphorylation (GO:0046777)|regulation of cell shape (GO:0008360)|signal transduction by phosphorylation (GO:0023014)|surfactant homeostasis (GO:0043129)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|vascular endothelial growth factor signaling pathway (GO:0038084)|vasculogenesis (GO:0001570)|viral process (GO:0016032)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sorting endosome (GO:0097443)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|Hsp90 protein binding (GO:0051879)|integrin binding (GO:0005178)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor binding (GO:0038085)|vascular endothelial growth factor-activated receptor activity (GO:0005021)			NS(1)|breast(3)|central_nervous_system(4)|endometrium(2)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(16)|lung(71)|ovary(2)|prostate(2)|skin(10)|soft_tissue(4)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	135	all_cancers(7;0.0255)|all_lung(4;0.00175)|Lung NSC(11;0.00384)|all_epithelial(27;0.034)|Glioma(25;0.08)|all_neural(26;0.101)		Epithelial(7;0.189)		Axitinib(DB06626)|Cabozantinib(DB08875)|Pazopanib(DB06589)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	ATTCTGACACGCTCCCCCACC	0.418			Mis		"""NSCLC, angiosarcoma"""					TSP Lung(20;0.16)																											p.R347C		.	.		Dom	yes		4	4q11-q12	3791	vascular endothelial growth factor receptor 2		E	.	KDR	.	.	0			c.C1039T						.						75.0	83.0	81.0					4																	55976873		2203	4300	6503	SO:0001583	missense	3791	exon8			TGACACGCTCCCC	AF035121	CCDS3497.1	4q11-q12	2013-01-29			ENSG00000128052	ENSG00000128052	2.7.10.1	"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6307	protein-coding gene	gene with protein product		191306				1417831	Standard	NM_002253		Approved	FLK1, VEGFR, VEGFR2, CD309	uc003has.3	P35968	OTTHUMG00000128734	ENST00000263923.4:c.1039C>T	4.37:g.55976873G>A	ENSP00000263923:p.Arg347Cys	333.0	0.0		267.0	116.0	NM_002253	A2RRS0|B5A925|C5IFA0|O60723|Q14178	Missense_Mutation	SNP	ENST00000263923.4	37	CCDS3497.1	.	.	.	.	.	.	.	.	.	.	G	12.52	1.962291	0.34659	.	.	ENSG00000128052	ENST00000263923	T	0.68181	-0.31	5.65	3.92	0.45320	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.765736	0.13043	N	0.418394	T	0.65801	0.2726	M	0.83483	2.645	0.09310	N	1	B;B	0.11235	0.004;0.003	B;B	0.06405	0.002;0.002	T	0.60732	-0.7205	10	0.54805	T	0.06	.	5.0904	0.14706	0.0715:0.1265:0.5409:0.261	.	347;347	P35968-2;P35968	.;VGFR2_HUMAN	C	347	ENSP00000263923:R347C	ENSP00000263923:R347C	R	-	1	0	KDR	55671630	0.004000	0.15560	0.001000	0.08648	0.968000	0.65278	1.439000	0.35013	0.732000	0.32470	0.563000	0.77884	CGT	.	.		0.418	KDR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250645.1		
ARHGEF28	64283	hgsc.bcm.edu	37	5	73153515	73153515	+	Missense_Mutation	SNP	C	C	A			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr5:73153515C>A	ENST00000426542.2	+	14	1845	c.1825C>A	c.(1825-1827)Cct>Act	p.P609T	ARHGEF28_ENST00000287898.5_Missense_Mutation_p.P609T|ARHGEF28_ENST00000545377.1_Missense_Mutation_p.P609T|ARHGEF28_ENST00000296799.4_Missense_Mutation_p.P296T|ARHGEF28_ENST00000437974.1_Missense_Mutation_p.P609T|ARHGEF28_ENST00000296794.6_Missense_Mutation_p.P609T|ARHGEF28_ENST00000513042.2_Missense_Mutation_p.P609T			Q8N1W1	ARG28_HUMAN	Rho guanine nucleotide exchange factor (GEF) 28	609					central nervous system neuron axonogenesis (GO:0021955)|intracellular signal transduction (GO:0035556)|neurofilament cytoskeleton organization (GO:0060052)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|RNA binding (GO:0003723)										ATACATCATACCTGCCAAATC	0.353																																					p.P609T		.	.											.	.	.	.	0			c.C1825A						.						65.0	66.0	66.0					5																	73153515		1872	4094	5966	SO:0001583	missense	64283	exon15			ATCATACCTGCCA		CCDS47231.1, CCDS47231.2, CCDS54870.1, CCDS58957.1	5q13.2	2012-08-08			ENSG00000214944	ENSG00000214944			30322	protein-coding gene	gene with protein product		612790				9199174, 11058585	Standard	NM_001177693		Approved	RGNEF, p190RhoGEF, RIP2	uc010izf.3	Q8N1W1	OTTHUMG00000162454	ENST00000426542.2:c.1825C>A	5.37:g.73153515C>A	ENSP00000412175:p.Pro609Thr	300.0	0.0		340.0	113.0	NM_001080479	B2RXG7|B4E3K4|B5MDA3|B7ZW32|E9PC75|Q8NCM7|Q96E37|Q9H6L3|Q9H6W0	Missense_Mutation	SNP	ENST00000426542.2	37	CCDS54870.1	.	.	.	.	.	.	.	.	.	.	C	24.3	4.519472	0.85495	.	.	ENSG00000214944	ENST00000296794;ENST00000545377;ENST00000513042;ENST00000287898;ENST00000437974;ENST00000426542;ENST00000296799	T;T;T;T;T;T;T	0.17691	2.46;2.43;2.44;2.3;2.43;2.44;2.26	5.51	5.51	0.81932	.	.	.	.	.	T	0.34193	0.0889	L	0.32530	0.975	0.53005	D	0.999963	D;D;D;D	0.89917	1.0;1.0;0.999;1.0	D;D;D;D	0.97110	1.0;1.0;0.972;0.987	T	0.04551	-1.0943	9	0.72032	D	0.01	.	19.0039	0.92843	0.0:1.0:0.0:0.0	.	296;609;609;609	B5MDA3;Q8N1W1;E9PC75;Q8N1W1-4	.;RGNEF_HUMAN;.;.	T	609;609;609;609;609;609;296	ENSP00000296794:P609T;ENSP00000441913:P609T;ENSP00000441436:P609T;ENSP00000287898:P609T;ENSP00000411459:P609T;ENSP00000412175:P609T;ENSP00000296799:P296T	ENSP00000287898:P609T	P	+	1	0	RP11-428C6.1	73189271	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.199000	0.77831	2.615000	0.88500	0.650000	0.86243	CCT	.	.		0.353	ARHGEF28-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000368975.1		
ATXN3	4287	hgsc.bcm.edu	37	14	92548653	92548653	+	Missense_Mutation	SNP	T	T	G			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr14:92548653T>G	ENST00000532032.1	-	8	775	c.766A>C	c.(766-768)Agt>Cgt	p.S256R	ATXN3_ENST00000502250.1_Missense_Mutation_p.S77R|ATXN3_ENST00000503767.1_Missense_Mutation_p.S241R|ATXN3_ENST00000393287.5_Missense_Mutation_p.S256R|ATXN3_ENST00000554491.1_5'UTR|ATXN3_ENST00000545170.1_Missense_Mutation_p.S256R|ATXN3_ENST00000429774.2_Missense_Mutation_p.S241R|ATXN3_ENST00000340660.6_Missense_Mutation_p.S201R			P54252	ATX3_HUMAN	ataxin 3	256					actin cytoskeleton organization (GO:0030036)|cell death (GO:0008219)|cellular response to misfolded protein (GO:0071218)|intermediate filament cytoskeleton organization (GO:0045104)|microtubule cytoskeleton organization (GO:0000226)|misfolded or incompletely synthesized protein catabolic process (GO:0006515)|monoubiquitinated protein deubiquitination (GO:0035520)|nervous system development (GO:0007399)|nucleotide-excision repair (GO:0006289)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein K48-linked deubiquitination (GO:0071108)|protein K63-linked deubiquitination (GO:0070536)|regulation of cell-substrate adhesion (GO:0010810)|regulation of transcription, DNA-templated (GO:0006355)|synaptic transmission (GO:0007268)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATPase binding (GO:0051117)|identical protein binding (GO:0042802)|Lys48-specific deubiquitinase activity (GO:1990380)|Lys63-specific deubiquitinase activity (GO:0061578)|omega peptidase activity (GO:0008242)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			endometrium(2)|large_intestine(1)|lung(7)|prostate(1)|stomach(1)	12		all_cancers(154;0.0768)		COAD - Colon adenocarcinoma(157;0.224)		CCTTGCATACTTAGCTGAATA	0.413																																					p.S256R	Esophageal Squamous(190;752 2094 29897 44875 49530)	.	.											.	ATXN3	.	.	0			c.A766C						.						163.0	140.0	148.0					14																	92548653		2203	4300	6503	SO:0001583	missense	4287	exon8			GCATACTTAGCTG	U64820	CCDS9900.1, CCDS32143.1, CCDS45154.1, CCDS53908.1, CCDS73680.1	14q21	2014-09-17	2004-08-12	2004-08-13	ENSG00000066427	ENSG00000066427		"""Ataxins"""	7106	protein-coding gene	gene with protein product		607047	"""Machado-Joseph disease (spinocerebellar ataxia 3, olivopontocerebellar ataxia 3, autosomal dominant, ataxin 3)"""	SCA3, MJD		8358439	Standard	NM_004993		Approved	ATX3, JOS	uc001yac.4	P54252	OTTHUMG00000162212	ENST00000532032.1:c.766A>C	14.37:g.92548653T>G	ENSP00000437157:p.Ser256Arg	169.0	0.0		149.0	28.0	NM_004993	A7LFZ5|D6RDL9|E9PB63|O15284|O15285|O15286|Q8N189|Q96TC3|Q96TC4|Q9H3N0	Missense_Mutation	SNP	ENST00000532032.1	37		.	.	.	.	.	.	.	.	.	.	T	26.9	4.777368	0.90195	.	.	ENSG00000066427	ENST00000545278;ENST00000539555;ENST00000537884;ENST00000545170;ENST00000447800;ENST00000359819;ENST00000393289;ENST00000429774;ENST00000539454;ENST00000393287;ENST00000502250;ENST00000503767;ENST00000340660;ENST00000532032;ENST00000555381;ENST00000557311;ENST00000554592;ENST00000554672;ENST00000553491;ENST00000556220;ENST00000506466	T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.56103	1.67;1.59;1.82;0.82;1.72;1.37;1.49;0.96;0.6;1.4;0.95;0.69;0.78;0.48	5.29	5.29	0.74685	Ubiquitin interacting motif (3);	0.000000	0.85682	D	0.000000	T	0.71626	0.3362	M	0.72894	2.215	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	0.999;1.0;1.0;1.0;0.991	T	0.75566	-0.3273	10	0.87932	D	0	.	15.2672	0.73672	0.0:0.0:0.0:1.0	.	256;241;256;201;256	P54252;E9PB63;F5H096;P54252-3;P54252-2	ATX3_HUMAN;.;.;.;.	R	256;256;256;256;256;256;256;241;255;256;77;241;201;256;186;77;255;158;205;150;190	ENSP00000445618:S256R;ENSP00000389376:S241R;ENSP00000376965:S256R;ENSP00000425322:S77R;ENSP00000426697:S241R;ENSP00000339110:S201R;ENSP00000437157:S256R;ENSP00000451001:S186R;ENSP00000450642:S77R;ENSP00000451385:S255R;ENSP00000451417:S158R;ENSP00000451996:S205R;ENSP00000450641:S150R;ENSP00000435571:S190R	ENSP00000339110:S201R	S	-	1	0	ATXN3	91618406	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.528000	0.81941	2.014000	0.59158	0.397000	0.26171	AGT	.	.		0.413	ATXN3-015	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000388065.1	NM_004993	
COL7A1	1294	hgsc.bcm.edu	37	3	48608550	48608550	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr3:48608550C>T	ENST00000328333.8	-	93	7255	c.7148G>A	c.(7147-7149)gGc>gAc	p.G2383D	COL7A1_ENST00000454817.1_Missense_Mutation_p.G2351D	NM_000094.3	NP_000085.1	Q02388	CO7A1_HUMAN	collagen, type VII, alpha 1	2383	Triple-helical region.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|endodermal cell differentiation (GO:0035987)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	basement membrane (GO:0005604)|collagen type VII trimer (GO:0005590)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	serine-type endopeptidase inhibitor activity (GO:0004867)			NS(3)|breast(8)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(57)|ovary(7)|prostate(5)|skin(9)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(5)	137				BRCA - Breast invasive adenocarcinoma(193;0.000293)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)		ACCTGGAGGGCCAGGAGGCCC	0.632																																					p.G2383D		.	.											.	COL7A1	.	.	0			c.G7148A						.						33.0	42.0	39.0					3																	48608550		2203	4299	6502	SO:0001583	missense	1294	exon93			GGAGGGCCAGGAG	L02870	CCDS2773.1	3p21.1	2014-09-17	2008-08-01		ENSG00000114270	ENSG00000114270		"""Collagens"", ""Fibronectin type III domain containing"""	2214	protein-coding gene	gene with protein product	"""collagen VII, alpha-1 polypeptide"", ""LC collagen"""	120120	"""epidermolysis bullosa, dystrophic, dominant and recessive"""	EBDCT, EBD1, EBR1		1871109	Standard	NM_000094		Approved		uc003ctz.2	Q02388	OTTHUMG00000133541	ENST00000328333.8:c.7148G>A	3.37:g.48608550C>T	ENSP00000332371:p.Gly2383Asp	125.0	0.0		99.0	25.0	NM_000094	Q14054|Q16507	Missense_Mutation	SNP	ENST00000328333.8	37	CCDS2773.1	.	.	.	.	.	.	.	.	.	.	C	9.446	1.089401	0.20390	.	.	ENSG00000114270	ENST00000328333;ENST00000454817;ENST00000422991	D;D;D	0.99353	-5.77;-5.77;-5.14	4.91	3.99	0.46301	.	0.000000	0.46442	D	0.000297	D	0.99588	0.9851	H	0.97214	3.96	0.41532	D	0.988466	D	0.89917	1.0	D	0.83275	0.996	D	0.97707	1.0188	10	0.72032	D	0.01	.	12.3656	0.55226	0.167:0.833:0.0:0.0	.	2383	Q02388	CO7A1_HUMAN	D	2383;2351;48	ENSP00000332371:G2383D;ENSP00000412569:G2351D;ENSP00000391608:G48D	ENSP00000332371:G2383D	G	-	2	0	COL7A1	48583554	1.000000	0.71417	0.997000	0.53966	0.213000	0.24496	2.719000	0.47244	2.439000	0.82584	0.655000	0.94253	GGC	.	.		0.632	COL7A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257519.1	NM_000094	
OR10A2	341276	hgsc.bcm.edu	37	11	6891840	6891840	+	Missense_Mutation	SNP	G	G	T			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr11:6891840G>T	ENST00000307322.4	+	1	917	c.855G>T	c.(853-855)aaG>aaT	p.K285N		NM_001004460.1	NP_001004460.1	Q9H208	O10A2_HUMAN	olfactory receptor, family 10, subfamily A, member 2	285						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.K285N(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|large_intestine(4)|lung(12)|urinary_tract(1)	24		Medulloblastoma(188;0.0523)|all_neural(188;0.236)		Epithelial(150;4.89e-08)|BRCA - Breast invasive adenocarcinoma(625;0.13)		ACGAGGTGAAGAATGCCCTCA	0.453																																					p.K285N		.	.											.	OR10A2	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G855T						.						103.0	100.0	101.0					11																	6891840		2201	4296	6497	SO:0001583	missense	341276	exon1			GGTGAAGAATGCC	BK004293	CCDS31415.1	11p15.4	2012-08-09		2004-03-10	ENSG00000170790	ENSG00000170790		"""GPCR / Class A : Olfactory receptors"""	8161	protein-coding gene	gene with protein product				OR10A2P			Standard	NM_001004460		Approved	OST363	uc001meu.1	Q9H208	OTTHUMG00000165739	ENST00000307322.4:c.855G>T	11.37:g.6891840G>T	ENSP00000303862:p.Lys285Asn	202.0	0.0		127.0	49.0	NM_001004460	B2RNL9|Q6IFG9	Missense_Mutation	SNP	ENST00000307322.4	37	CCDS31415.1	.	.	.	.	.	.	.	.	.	.	g	12.29	1.893894	0.33442	.	.	ENSG00000170790	ENST00000307322	T	0.40756	1.02	4.18	-1.12	0.09808	.	0.000000	0.64402	D	0.000008	T	0.55257	0.1909	M	0.70787	2.145	0.30214	N	0.797439	D	0.89917	1.0	D	0.77557	0.99	T	0.54860	-0.8230	10	0.62326	D	0.03	.	8.0966	0.30833	0.5882:0.0:0.4118:0.0	.	285	Q9H208	O10A2_HUMAN	N	285	ENSP00000303862:K285N	ENSP00000303862:K285N	K	+	3	2	OR10A2	6848416	0.001000	0.12720	0.997000	0.53966	0.347000	0.29111	0.159000	0.16442	-0.063000	0.13065	-0.141000	0.14075	AAG	.	.		0.453	OR10A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385984.1	NM_001004460	
ST8SIA6	338596	hgsc.bcm.edu	37	10	17365101	17365101	+	Missense_Mutation	SNP	T	T	A			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr10:17365101T>A	ENST00000377602.4	-	7	765	c.691A>T	c.(691-693)Aat>Tat	p.N231Y		NM_001004470.1	NP_001004470.1	P61647	SIA8F_HUMAN	ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 6	231					carbohydrate biosynthetic process (GO:0016051)|cellular protein metabolic process (GO:0044267)|ganglioside biosynthetic process (GO:0001574)|glycolipid biosynthetic process (GO:0009247)|glycoprotein metabolic process (GO:0009100)|oligosaccharide metabolic process (GO:0009311)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|protein O-linked glycosylation (GO:0006493)|sialylation (GO:0097503)	Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)	sialyltransferase activity (GO:0008373)			endometrium(3)|kidney(3)|large_intestine(4)|liver(1)|lung(24)|ovary(1)|skin(1)	37						GTCACAAGATTTGTTTTACTG	0.338																																					p.N231Y		.	.											.	ST8SIA6	.	.	0			c.A691T						.						201.0	181.0	188.0					10																	17365101		2203	4300	6503	SO:0001583	missense	338596	exon7			CAAGATTTGTTTT		CCDS31158.1	10p13	2013-03-01	2005-02-07	2005-02-07	ENSG00000148488	ENSG00000148488		"""Sialyltransferases"""	23317	protein-coding gene	gene with protein product	"""ST8Sia VI"""	610139	"""sialyltransferase 8F (alpha-2, 8-sialyltransferase)"""	SIAT8F		11980897	Standard	XR_242697		Approved		uc001ipd.3	P61647	OTTHUMG00000017748	ENST00000377602.4:c.691A>T	10.37:g.17365101T>A	ENSP00000366827:p.Asn231Tyr	354.0	0.0		266.0	62.0	NM_001004470	B0YJ97|B9EH72|Q5VZH4	Missense_Mutation	SNP	ENST00000377602.4	37	CCDS31158.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	16.61|16.61	3.169972|3.169972	0.57584|0.57584	.|.	.|.	ENSG00000148488|ENSG00000148488	ENST00000440449|ENST00000377610;ENST00000377602	.|T	.|0.32023	.|1.47	5.12|5.12	3.99|3.99	0.46301|0.46301	.|.	.|0.132733	.|0.64402	.|D	.|0.000002	T|T	0.59128|0.59128	0.2171|0.2171	M|M	0.91354|0.91354	3.2|3.2	0.46376|0.46376	D|D	0.999017|0.999017	.|D	.|0.67145	.|0.996	.|D	.|0.64877	.|0.93	T|T	0.67233|0.67233	-0.5722|-0.5722	5|10	.|0.87932	.|D	.|0	-9.9539|-9.9539	11.0133|11.0133	0.47675|0.47675	0.0:0.073:0.0:0.927|0.0:0.073:0.0:0.927	.|.	.|231	.|P61647	.|SIA8F_HUMAN	I|Y	51|61;231	.|ENSP00000366827:N231Y	.|ENSP00000366827:N231Y	K|N	-|-	2|1	0|0	ST8SIA6|ST8SIA6	17405107|17405107	0.900000|0.900000	0.30661|0.30661	0.950000|0.950000	0.38849|0.38849	0.947000|0.947000	0.59692|0.59692	1.385000|1.385000	0.34408|0.34408	1.086000|1.086000	0.41228|0.41228	0.460000|0.460000	0.39030|0.39030	AAA|AAT	.	.		0.338	ST8SIA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047036.1	NM_001004470	
F8	2157	hgsc.bcm.edu	37	X	154158684	154158684	+	Missense_Mutation	SNP	C	C	G			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chrX:154158684C>G	ENST00000360256.4	-	14	3581	c.3381G>C	c.(3379-3381)tgG>tgC	p.W1127C		NM_000132.3	NP_000123.1	P00451	FA8_HUMAN	coagulation factor VIII, procoagulant component	1127	B.				acute-phase response (GO:0006953)|blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|cell adhesion (GO:0007155)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)	copper ion binding (GO:0005507)|oxidoreductase activity (GO:0016491)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(27)|liver(1)|lung(47)|ovary(5)|pancreas(3)|prostate(1)|skin(5)|upper_aerodigestive_tract(5)|urinary_tract(2)	120	all_cancers(53;7.19e-17)|all_epithelial(53;9.83e-11)|all_lung(58;6.63e-07)|Lung NSC(58;2.08e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)				Coagulation Factor IX(DB00100)|Drotrecogin alfa(DB00055)	TCCTTTGTATCCACCTTGCTG	0.443																																					p.W1127C		.	.											.	F8	.	.	0			c.G3381C	GRCh37	CM012943	F8	M		.						65.0	64.0	64.0					X																	154158684		2203	4298	6501	SO:0001583	missense	2157	exon14			TTGTATCCACCTT	M90707	CCDS35457.1, CCDS44026.1	Xq28	2014-09-17	2008-07-29		ENSG00000185010	ENSG00000185010			3546	protein-coding gene	gene with protein product	"""Factor VIIIF8B"", ""hemophilia A"""	300841		F8C		6438528, 3935400	Standard	NM_000132		Approved	FVIII, DXS1253E, HEMA	uc004fmt.3	P00451	OTTHUMG00000022688	ENST00000360256.4:c.3381G>C	X.37:g.154158684C>G	ENSP00000353393:p.Trp1127Cys	149.0	0.0		165.0	28.0	NM_000132	Q14286|Q5HY69	Missense_Mutation	SNP	ENST00000360256.4	37	CCDS35457.1	.	.	.	.	.	.	.	.	.	.	c	5.085	0.201423	0.09652	.	.	ENSG00000185010	ENST00000360256	D	0.99282	-5.68	4.94	3.0	0.34707	.	1.026450	0.07723	N	0.943986	D	0.98223	0.9412	M	0.64997	1.995	0.18873	N	0.999982	D	0.60575	0.988	P	0.46975	0.533	D	0.95268	0.8375	10	0.52906	T	0.07	0.3189	4.3522	0.11160	0.2434:0.637:0.0:0.1196	.	1127	P00451	FA8_HUMAN	C	1127	ENSP00000353393:W1127C	ENSP00000353393:W1127C	W	-	3	0	F8	153811878	0.000000	0.05858	0.001000	0.08648	0.050000	0.14768	0.732000	0.26072	1.084000	0.41184	0.597000	0.82753	TGG	.	.		0.443	F8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058869.4		
PLEKHA4	57664	hgsc.bcm.edu	37	19	49364948	49364948	+	Splice_Site	SNP	T	T	C			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr19:49364948T>C	ENST00000263265.6	-	4	749	c.194A>G	c.(193-195)gAc>gGc	p.D65G	PLEKHA4_ENST00000596713.1_5'Flank|PLEKHA4_ENST00000355496.5_Splice_Site_p.D65G	NM_020904.2	NP_065955.2	Q9H4M7	PKHA4_HUMAN	pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 4	65	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.					cytoplasm (GO:0005737)|membrane (GO:0016020)	1-phosphatidylinositol binding (GO:0005545)			NS(1)|breast(5)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(5)|ovary(1)|prostate(3)|skin(2)|urinary_tract(2)	30		all_lung(116;4.89e-05)|Lung NSC(112;8.3e-05)|all_epithelial(76;0.000108)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.00027)|all cancers(93;0.00084)|GBM - Glioblastoma multiforme(486;0.0244)|Epithelial(262;0.0364)		CCCCGAGCTGTCCTGGGGAGA	0.577																																					p.D65G		.	.											.	PLEKHA4	.	.	0			c.A194G						.						23.0	25.0	24.0					19																	49364948		2203	4298	6501	SO:0001630	splice_region_variant	57664	exon4			GAGCTGTCCTGGG	AY007233	CCDS12737.1, CCDS54291.1	19q13.33	2013-01-10	2002-01-14			ENSG00000105559		"""Pleckstrin homology (PH) domain containing"""	14339	protein-coding gene	gene with protein product		607769	"""pleckstrin homology domain-containing, family A (phosphoinositide binding specific) member 4"""			11001876	Standard	NM_020904		Approved	PEPP1	uc002pkx.3	Q9H4M7		ENST00000263265.6:c.193-1A>G	19.37:g.49364948T>C		68.0	0.0		77.0	29.0	NM_001161354	Q8N4M8|Q8N658	Missense_Mutation	SNP	ENST00000263265.6	37	CCDS12737.1	.	.	.	.	.	.	.	.	.	.	t	21.5	4.154062	0.78114	.	.	ENSG00000105559	ENST00000263265;ENST00000355496	T;T	0.08458	3.09;3.09	4.38	4.38	0.52667	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.067384	0.56097	D	0.000038	T	0.10208	0.0250	N	0.12961	0.28	0.48762	D	0.999708	P;B	0.45957	0.869;0.01	P;B	0.53450	0.726;0.059	T	0.21999	-1.0229	10	0.48119	T	0.1	.	11.8829	0.52586	0.0:0.0:0.0:1.0	.	65;65	Q9H4M7-2;Q9H4M7	.;PKHA4_HUMAN	G	65	ENSP00000263265:D65G;ENSP00000347683:D65G	ENSP00000263265:D65G	D	-	2	0	PLEKHA4	54056760	1.000000	0.71417	1.000000	0.80357	0.943000	0.58893	5.592000	0.67543	1.986000	0.57962	0.375000	0.23000	GAC	.	.		0.577	PLEKHA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466216.1		Missense_Mutation
IL17C	27189	hgsc.bcm.edu	37	16	88705412	88705412	+	Silent	SNP	G	G	A			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr16:88705412G>A	ENST00000244241.4	+	2	79	c.30G>A	c.(28-30)ctG>ctA	p.L10L		NM_013278.3	NP_037410.1	Q9P0M4	IL17C_HUMAN	interleukin 17C	10					cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|inflammatory response (GO:0006954)|neutrophil differentiation (GO:0030223)|positive regulation of cytokine production involved in inflammatory response (GO:1900017)	extracellular space (GO:0005615)	cytokine activity (GO:0005125)			large_intestine(1)|lung(1)	2				BRCA - Breast invasive adenocarcinoma(80;0.0477)		TCCTGTTTCTGACCTGGCTGC	0.647																																					p.L10L		.	.											.	IL17C	.	.	0			c.G30A						.						87.0	99.0	95.0					16																	88705412		1993	4161	6154	SO:0001819	synonymous_variant	27189	exon2			GTTTCTGACCTGG	AF152099	CCDS42217.1	16q24	2011-07-14			ENSG00000124391	ENSG00000124391		"""Interleukins and interleukin receptors"""	5983	protein-coding gene	gene with protein product		604628				10639155	Standard	NM_013278		Approved	IL-17C, CX2, IL-21, MGC126884, MGC138401	uc002fla.3	Q9P0M4		ENST00000244241.4:c.30G>A	16.37:g.88705412G>A		185.0	0.0		142.0	23.0	NM_013278	Q3MIG8|Q9HC75	Silent	SNP	ENST00000244241.4	37	CCDS42217.1																																																																																			.	.		0.647	IL17C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000422575.1	NM_013278	
HIST1H4D	8360	hgsc.bcm.edu	37	6	26189253	26189253	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr6:26189253G>A	ENST00000340756.2	-	1	51	c.52C>T	c.(52-54)Cgt>Tgt	p.R18C		NM_003539.3	NP_003530.1	P62805	H4_HUMAN	histone cluster 1, H4d	18					CENP-A containing nucleosome assembly (GO:0034080)|chromatin organization (GO:0006325)|DNA replication-dependent nucleosome assembly (GO:0006335)|DNA replication-independent nucleosome assembly (GO:0006336)|histone H4-K20 demethylation (GO:0035574)|mitotic cell cycle (GO:0000278)|negative regulation of megakaryocyte differentiation (GO:0045653)|nucleosome assembly (GO:0006334)|telomere maintenance (GO:0000723)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|histone demethylase activity (H4-K20 specific) (GO:0035575)|poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(2)|large_intestine(2)|lung(1)|prostate(1)	8		all_hematologic(11;0.196)				TTACGGTGACGCTTGGCGCCA	0.572																																					p.R18C		.	.											.	HIST1H4D	.	.	0			c.C52T						.						55.0	60.0	58.0					6																	26189253		2203	4300	6503	SO:0001583	missense	8360	exon1			GGTGACGCTTGGC	X60482	CCDS4589.1	6p22.1	2011-01-27	2006-10-11	2003-02-21	ENSG00000188987	ENSG00000277157		"""Histones / Replication-dependent"""	4782	protein-coding gene	gene with protein product		602823	"""H4 histone family, member B"", ""histone 1, H4d"""	H4FB		9119399, 12408966	Standard	NM_003539		Approved	H4/b	uc003ngu.3	P62805	OTTHUMG00000014423	ENST00000340756.2:c.52C>T	6.37:g.26189253G>A	ENSP00000343282:p.Arg18Cys	64.0	0.0		75.0	32.0	NM_003539	A2VCL0|P02304|P02305|Q6DRA9|Q6FGB8|Q6NWP7	Missense_Mutation	SNP	ENST00000340756.2	37	CCDS4589.1	.	.	.	.	.	.	.	.	.	.	.	16.34	3.094365	0.56075	.	.	ENSG00000188987	ENST00000340756	.	.	.	5.32	5.32	0.75619	.	0.000000	0.85682	D	0.000000	T	0.72431	0.3459	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.75297	-0.3367	6	0.62326	D	0.03	.	17.9848	0.89153	0.0:0.0:1.0:0.0	.	.	.	.	C	18	.	ENSP00000343282:R18C	R	-	1	0	HIST1H4D	26297232	1.000000	0.71417	1.000000	0.80357	0.014000	0.08584	9.370000	0.97159	2.494000	0.84150	0.650000	0.86243	CGT	.	.		0.572	HIST1H4D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040085.1	NM_003539	
HFM1	164045	hgsc.bcm.edu	37	1	91742605	91742605	+	Missense_Mutation	SNP	T	T	G			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr1:91742605T>G	ENST00000370425.3	-	31	3504	c.3406A>C	c.(3406-3408)Aaa>Caa	p.K1136Q	HFM1_ENST00000462405.1_5'UTR|HFM1_ENST00000370424.3_Missense_Mutation_p.K815Q|HFM1_ENST00000294696.5_Missense_Mutation_p.K368Q	NM_001017975.3	NP_001017975.3	A2PYH4	HFM1_HUMAN	HFM1, ATP-dependent DNA helicase homolog (S. cerevisiae)	1136					resolution of meiotic recombination intermediates (GO:0000712)		ATP binding (GO:0005524)|helicase activity (GO:0004386)|nucleic acid binding (GO:0003676)			breast(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(17)|lung(33)|ovary(1)|prostate(3)|skin(2)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	75		all_lung(203;0.00961)|Lung NSC(277;0.0351)		all cancers(265;0.000481)|Epithelial(280;0.00863)|OV - Ovarian serous cystadenocarcinoma(397;0.126)|KIRC - Kidney renal clear cell carcinoma(1967;0.171)		CCAGGTTTTTTGCTGGCAGTC	0.289																																					p.K1136Q		.	.											.	HFM1	.	.	0			c.A3406C						.						110.0	109.0	109.0					1																	91742605		2203	4299	6502	SO:0001583	missense	164045	exon31			GTTTTTTGCTGGC	AB204867	CCDS30769.2	1p22.2	2008-03-26			ENSG00000162669	ENSG00000162669			20193	protein-coding gene	gene with protein product		615684	"""SEC63 domain containing 1"""	SEC63D1		14702039, 17286053	Standard	XM_006710395		Approved	MER3, FLJ39011, FLJ36760	uc001doa.4	A2PYH4	OTTHUMG00000010093	ENST00000370425.3:c.3406A>C	1.37:g.91742605T>G	ENSP00000359454:p.Lys1136Gln	300.0	0.0		296.0	13.0	NM_001017975	B1B0B6|Q8N9Q0	Missense_Mutation	SNP	ENST00000370425.3	37	CCDS30769.2	.	.	.	.	.	.	.	.	.	.	T	11.88	1.769468	0.31320	.	.	ENSG00000162669	ENST00000370425;ENST00000294696;ENST00000370424;ENST00000370421	T;T;T	0.64438	0.27;0.64;-0.1	5.71	5.71	0.89125	.	0.217537	0.31772	N	0.007085	T	0.41282	0.1152	L	0.53249	1.67	0.34985	D	0.754507	B;B;B	0.32010	0.351;0.242;0.201	B;B;B	0.28465	0.09;0.074;0.05	T	0.46582	-0.9181	10	0.31617	T	0.26	.	13.4861	0.61366	0.0:0.0:0.0:1.0	.	815;347;1136	A6NGI5;B1B0B5;A2PYH4	.;.;HFM1_HUMAN	Q	1136;368;815;820	ENSP00000359454:K1136Q;ENSP00000294696:K368Q;ENSP00000359453:K815Q	ENSP00000294696:K368Q	K	-	1	0	HFM1	91515193	1.000000	0.71417	0.983000	0.44433	0.577000	0.36160	5.255000	0.65462	2.178000	0.69098	0.477000	0.44152	AAA	.	.		0.289	HFM1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316716.2	NM_001017975	
PLCG1	5335	hgsc.bcm.edu	37	20	39794969	39794969	+	Silent	SNP	C	C	T			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr20:39794969C>T	ENST00000373271.1	+	17	2340	c.1935C>T	c.(1933-1935)cgC>cgT	p.R645R	PLCG1_ENST00000244007.3_Silent_p.R645R|PLCG1_ENST00000373272.2_Silent_p.R645R	NM_182811.1	NP_877963.1	P19174	PLCG1_HUMAN	phospholipase C, gamma 1	645	SH2 1. {ECO:0000255|PROSITE- ProRule:PRU00191}.				activation of MAPKK activity (GO:0000186)|activation of phospholipase C activity (GO:0007202)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|calcium-mediated signaling (GO:0019722)|cell migration (GO:0016477)|cellular response to epidermal growth factor stimulus (GO:0071364)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|inositol phosphate metabolic process (GO:0043647)|leukocyte migration (GO:0050900)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phospholipid catabolic process (GO:0009395)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|T cell receptor signaling pathway (GO:0050852)|viral process (GO:0016032)	cell projection (GO:0042995)|cell-cell junction (GO:0005911)|COP9 signalosome (GO:0008180)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	calcium ion binding (GO:0005509)|neurotrophin TRKA receptor binding (GO:0005168)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|protein kinase binding (GO:0019901)|receptor signaling protein activity (GO:0005057)			breast(5)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(16)|skin(6)|urinary_tract(2)	46		Myeloproliferative disorder(115;0.00878)				TGCCCCTGCGCTGTAATGAGT	0.587																																					p.R645R		.	.											.	PLCG1	.	.	0			c.C1935T						.						89.0	83.0	85.0					20																	39794969		2203	4300	6503	SO:0001819	synonymous_variant	5335	exon17			CCTGCGCTGTAAT	M34667	CCDS13313.1, CCDS13314.1	20q12-q13.1	2013-02-14	2004-01-29		ENSG00000124181	ENSG00000124181	3.1.4.11	"""Pleckstrin homology (PH) domain containing"", ""EF-hand domain containing"", ""SH2 domain containing"""	9065	protein-coding gene	gene with protein product		172420	"""phospholipase C, gamma 1 (formerly subtype 148)"""	PLC1		2167438, 3254788	Standard	NM_182811		Approved	PLC148, PLC-II, PLCgamma1, NCKAP3	uc002xjo.1	P19174	OTTHUMG00000033082	ENST00000373271.1:c.1935C>T	20.37:g.39794969C>T		119.0	0.0		95.0	18.0	NM_182811	B7ZLY7|B9EGH4|E1P5W4|Q2V575	Silent	SNP	ENST00000373271.1	37	CCDS13314.1																																																																																			.	.		0.587	PLCG1-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000080514.3	NM_182811	
WDR44	54521	hgsc.bcm.edu	37	X	117528110	117528110	+	Missense_Mutation	SNP	G	G	T			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chrX:117528110G>T	ENST00000254029.3	+	5	1314	c.919G>T	c.(919-921)Gca>Tca	p.A307S	WDR44_ENST00000371825.3_Missense_Mutation_p.A307S|WDR44_ENST00000371822.5_Missense_Mutation_p.A282S	NM_019045.4	NP_061918.3	Q5JSH3	WDR44_HUMAN	WD repeat domain 44	307						endosome (GO:0005768)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)				breast(4)|endometrium(2)|kidney(1)|large_intestine(4)|lung(16)|ovary(1)|pancreas(1)|prostate(1)|stomach(2)|upper_aerodigestive_tract(1)	33						TCTTGATTTGGCAAGTGCTAC	0.438																																					p.A307S		.	.											.	WDR44	.	.	0			c.G919T						.						132.0	128.0	130.0					X																	117528110		2203	4300	6503	SO:0001583	missense	54521	exon5			GATTTGGCAAGTG	AK001978	CCDS14572.1, CCDS55482.1, CCDS55483.1	Xq24	2013-01-09			ENSG00000131725	ENSG00000131725		"""WD repeat domain containing"""	30512	protein-coding gene	gene with protein product						12477932	Standard	NM_019045		Approved	DKFZp686L20145, RPH11, RAB11BP	uc004eqn.3	Q5JSH3	OTTHUMG00000022254	ENST00000254029.3:c.919G>T	X.37:g.117528110G>T	ENSP00000254029:p.Ala307Ser	190.0	0.0		148.0	108.0	NM_001184965	B4DSE9|F8W913|Q0JS52|Q0JTF3|Q5JSH2|Q6ZSC1|Q7Z365|Q7Z3P6|Q8NAU8|Q8NHU5|Q9NUV4	Missense_Mutation	SNP	ENST00000254029.3	37	CCDS14572.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	33|33	5.254332|5.254332	0.95336|0.95336	.|.	.|.	ENSG00000131725|ENSG00000131725	ENST00000371822;ENST00000254029;ENST00000371825|ENST00000371848	T;T;T|.	0.76448|.	-1.02;-0.4;-0.27|.	5.51|5.51	5.51|5.51	0.81932|0.81932	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.59542|0.59542	0.2201|0.2201	L|L	0.32530|0.32530	0.975|0.975	0.58432|0.58432	D|D	0.999996|0.999996	D;D;D;D|.	0.76494|.	0.992;0.996;0.999;0.986|.	P;P;D;P|.	0.69142|.	0.845;0.831;0.962;0.784|.	T|T	0.54860|0.54860	-0.8230|-0.8230	10|5	0.17369|.	T|.	0.5|.	-11.7317|-11.7317	18.4537|18.4537	0.90713|0.90713	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	282;307;307;307|.	F8W913;E9PCI7;Q5JSH3-2;Q5JSH3|.	.;.;.;WDR44_HUMAN|.	S|V	282;307;307|206	ENSP00000360887:A282S;ENSP00000254029:A307S;ENSP00000360890:A307S|.	ENSP00000254029:A307S|.	A|G	+|+	1|2	0|0	WDR44|WDR44	117412138|117412138	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.990000|0.990000	0.78478|0.78478	9.230000|9.230000	0.95299|0.95299	2.300000|2.300000	0.77407|0.77407	0.600000|0.600000	0.82982|0.82982	GCA|GGC	.	.		0.438	WDR44-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058001.1	NM_019045	
CAPN3	825	hgsc.bcm.edu	37	15	42703132	42703132	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr15:42703132G>A	ENST00000397163.3	+	22	2533	c.2314G>A	c.(2314-2316)Gac>Aac	p.D772N	CAPN3_ENST00000349748.3_Missense_Mutation_p.D680N|CAPN3_ENST00000562199.1_3'UTR|CAPN3_ENST00000569136.1_Missense_Mutation_p.D107N|CAPN3_ENST00000561817.1_Missense_Mutation_p.D107N|CAPN3_ENST00000357568.3_Missense_Mutation_p.D766N|CAPN3_ENST00000397204.4_Missense_Mutation_p.D107N|RP11-164J13.1_ENST00000495723.1_RNA|CAPN3_ENST00000337571.4_Missense_Mutation_p.D107N|CAPN3_ENST00000356316.3_Missense_Mutation_p.D679N|CAPN3_ENST00000397200.4_Missense_Mutation_p.D260N|CAPN3_ENST00000318023.7_Missense_Mutation_p.D766N	NM_000070.2	NP_000061.1	P20807	CAN3_HUMAN	calpain 3, (p94)	772	Domain IV.				apoptotic process (GO:0006915)|autolysis (GO:0001896)|cellular response to calcium ion (GO:0071277)|cellular response to salt stress (GO:0071472)|G1 to G0 transition involved in cell differentiation (GO:0070315)|muscle cell cellular homeostasis (GO:0046716)|muscle organ development (GO:0007517)|muscle structure development (GO:0061061)|myofibril assembly (GO:0030239)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein sumoylation (GO:0033234)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of proteolysis (GO:0045862)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|positive regulation of satellite cell activation involved in skeletal muscle regeneration (GO:0014718)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein localization to membrane (GO:0072657)|proteolysis (GO:0006508)|regulation of catalytic activity (GO:0050790)|regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043122)|regulation of myoblast differentiation (GO:0045661)|response to calcium ion (GO:0051592)|response to muscle activity (GO:0014850)|sarcomere organization (GO:0045214)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular (GO:0005622)|myofibril (GO:0030016)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|T-tubule (GO:0030315)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|catalytic activity (GO:0003824)|cysteine-type peptidase activity (GO:0008234)|ligase regulator activity (GO:0055103)|peptidase activity (GO:0008233)|protein complex scaffold (GO:0032947)|signal transducer activity (GO:0004871)|sodium ion binding (GO:0031402)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(21)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	47		all_cancers(109;1.65e-16)|all_epithelial(112;8.34e-15)|Lung NSC(122;3.56e-09)|all_lung(180;1.68e-08)|Melanoma(134;0.0574)|Colorectal(260;0.152)		GBM - Glioblastoma multiforme(94;7.36e-07)		GCGGTACGCAGACAAACACAT	0.542																																					p.D772N		.	.											.	CAPN3	.	.	0			c.G2314A	GRCh37	CD951643	CAPN3	D		.						234.0	186.0	203.0					15																	42703132		2203	4299	6502	SO:0001583	missense	825	exon22			TACGCAGACAAAC	X85030	CCDS10085.1, CCDS10086.1, CCDS32207.1, CCDS45245.1, CCDS45246.1	15q15.1	2014-09-17			ENSG00000092529	ENSG00000092529	3.4.22.52	"""EF-hand domain containing"""	1480	protein-coding gene	gene with protein product		114240		LGMD2, LGMD2A		2555341, 7720071	Standard	NM_024344		Approved	CANP3, p94, nCL-1	uc001zpn.1	P20807	OTTHUMG00000130619	ENST00000397163.3:c.2314G>A	15.37:g.42703132G>A	ENSP00000380349:p.Asp772Asn	240.0	0.0		204.0	51.0	NM_000070	A6H8K6|Q7L4R0|Q9BQC8|Q9BTU4|Q9Y5S6|Q9Y5S7	Missense_Mutation	SNP	ENST00000397163.3	37	CCDS45245.1	.	.	.	.	.	.	.	.	.	.	G	17.33	3.362995	0.61403	.	.	ENSG00000092529	ENST00000356316;ENST00000337522;ENST00000397163;ENST00000357568;ENST00000349748;ENST00000318023;ENST00000397200;ENST00000337571;ENST00000397204	D;D;D;D;D;D;D;D	0.94966	-3.57;-3.57;-3.57;-3.57;-3.57;-3.57;-3.57;-3.57	5.4	5.4	0.78164	EF-hand-like domain (1);	0.065340	0.64402	U	0.000007	D	0.90827	0.7119	L	0.28344	0.845	0.46521	D	0.99908	B;B;B;B;B;B;B	0.31519	0.09;0.09;0.004;0.03;0.327;0.219;0.098	B;B;B;B;B;B;B	0.38020	0.047;0.101;0.008;0.035;0.263;0.255;0.144	D	0.88741	0.3243	10	0.44086	T	0.13	.	12.6478	0.56744	0.0749:0.0:0.9251:0.0	.	637;685;107;680;766;772;679	C6EVS4;C6EVS3;A4FTZ9;P20807-2;P20807-3;P20807;Q762C8	.;.;.;.;.;CAN3_HUMAN;.	N	679;260;772;766;680;766;260;107;107	ENSP00000348667:D679N;ENSP00000380349:D772N;ENSP00000350181:D766N;ENSP00000183936:D680N;ENSP00000326281:D766N;ENSP00000380384:D260N;ENSP00000336840:D107N;ENSP00000380387:D107N	ENSP00000326281:D766N	D	+	1	0	CAPN3	40490424	1.000000	0.71417	0.996000	0.52242	0.986000	0.74619	5.011000	0.64011	2.818000	0.97014	0.655000	0.94253	GAC	.	.		0.542	CAPN3-009	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000421075.1		
JAG2	3714	hgsc.bcm.edu	37	14	105609430	105609430	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr14:105609430G>A	ENST00000331782.3	-	26	3722	c.3319C>T	c.(3319-3321)Cgc>Tgc	p.R1107C	JAG2_ENST00000347004.2_Missense_Mutation_p.R1069C	NM_002226.4	NP_002217.3	Q9Y219	JAG2_HUMAN	jagged 2	1107					auditory receptor cell fate commitment (GO:0009912)|cell cycle (GO:0007049)|cell differentiation (GO:0030154)|epithelial cell apoptotic process involved in palatal shelf morphogenesis (GO:1990134)|gamma-delta T cell differentiation (GO:0042492)|in utero embryonic development (GO:0001701)|morphogenesis of embryonic epithelium (GO:0016331)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|odontogenesis of dentin-containing tooth (GO:0042475)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of cell proliferation (GO:0042127)|respiratory system process (GO:0003016)|skeletal system development (GO:0001501)|spermatogenesis (GO:0007283)|T cell differentiation (GO:0030217)|thymic T cell selection (GO:0045061)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|growth factor activity (GO:0008083)|Notch binding (GO:0005112)			breast(2)|endometrium(2)|kidney(3)|large_intestine(1)|lung(7)|prostate(2)|skin(5)	22		all_cancers(154;0.0336)|all_epithelial(191;0.0729)|Melanoma(154;0.155)	OV - Ovarian serous cystadenocarcinoma(23;0.00989)|all cancers(16;0.0114)|Epithelial(46;0.0272)	Epithelial(152;0.047)|OV - Ovarian serous cystadenocarcinoma(161;0.148)|all cancers(159;0.208)		CTGCGCTTGCGTGTCCACCAC	0.682																																					p.R1107C		.	.											.	JAG2	.	.	0			c.C3319T						.						20.0	27.0	24.0					14																	105609430		2194	4292	6486	SO:0001583	missense	3714	exon26			GCTTGCGTGTCCA	AF020201	CCDS9998.1, CCDS9999.1	14q32	2008-08-01			ENSG00000184916	ENSG00000184916			6189	protein-coding gene	gene with protein product		602570				9315665, 10662552	Standard	NM_002226		Approved		uc001yqg.4	Q9Y219	OTTHUMG00000140172	ENST00000331782.3:c.3319C>T	14.37:g.105609430G>A	ENSP00000328169:p.Arg1107Cys	27.0	0.0		14.0	7.0	NM_002226	Q9UE17|Q9UE99|Q9UNK8|Q9Y6P9|Q9Y6Q0	Missense_Mutation	SNP	ENST00000331782.3	37	CCDS9998.1	.	.	.	.	.	.	.	.	.	.	G	23.6	4.440212	0.83993	.	.	ENSG00000184916	ENST00000331782;ENST00000347004	D;D	0.88046	-2.32;-2.33	4.09	4.09	0.47781	.	0.070739	0.64402	D	0.000016	D	0.92260	0.7545	M	0.67397	2.05	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	D	0.93322	0.6693	10	0.87932	D	0	.	15.4312	0.75102	0.0:0.0:1.0:0.0	.	1069;1107	Q9Y219-2;Q9Y219	.;JAG2_HUMAN	C	1107;1069	ENSP00000328169:R1107C;ENSP00000328566:R1069C	ENSP00000328169:R1107C	R	-	1	0	JAG2	104680475	1.000000	0.71417	0.535000	0.28026	0.909000	0.53808	4.675000	0.61619	2.111000	0.64477	0.491000	0.48974	CGC	.	.		0.682	JAG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276506.2		
ACPT	93650	hgsc.bcm.edu	37	19	51298214	51298214	+	Silent	SNP	C	C	T			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr19:51298214C>T	ENST00000270593.1	+	10	1158	c.1158C>T	c.(1156-1158)atC>atT	p.I386I	CTD-2568A17.8_ENST00000594114.1_RNA|ACPT_ENST00000270594.3_Silent_p.I293I	NM_033068.2	NP_149059.1	Q9BZG2	PPAT_HUMAN	acid phosphatase, testicular	386						integral component of membrane (GO:0016021)	acid phosphatase activity (GO:0003993)			central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|lung(6)|skin(3)	11		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.00641)|GBM - Glioblastoma multiforme(134;0.028)		AGGCTGCCATCCCCCCAGGTG	0.697																																					p.I386I		.	.											.	ACPT	.	.	0			c.C1158T						.						33.0	41.0	38.0					19																	51298214		2201	4299	6500	SO:0001819	synonymous_variant	93650	exon10			TGCCATCCCCCCA	AF321918	CCDS12802.1	19q13.33	2012-10-02			ENSG00000142513	ENSG00000142513			14376	protein-coding gene	gene with protein product		606362				11414767	Standard	NM_033068		Approved		uc002pta.1	Q9BZG2		ENST00000270593.1:c.1158C>T	19.37:g.51298214C>T		178.0	0.0		163.0	18.0	NM_033068	C0H3P7|Q9BZG3|Q9BZG4	Silent	SNP	ENST00000270593.1	37	CCDS12802.1																																																																																			.	.		0.697	ACPT-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464434.1	NM_033068	
AP1B1	162	hgsc.bcm.edu	37	22	29736737	29736737	+	Missense_Mutation	SNP	C	C	G			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr22:29736737C>G	ENST00000405198.1	-	13	1937	c.1906G>C	c.(1906-1908)Gac>Cac	p.D636H	AP1B1_ENST00000415447.1_Missense_Mutation_p.D636H|AP1B1_ENST00000432560.2_Missense_Mutation_p.D636H|AP1B1_ENST00000357586.2_Missense_Mutation_p.D636H|AP1B1_ENST00000472057.1_5'UTR|AP1B1_ENST00000356015.2_Missense_Mutation_p.D636H|AP1B1_ENST00000317368.7_Missense_Mutation_p.D636H|AP1B1_ENST00000402502.1_Missense_Mutation_p.D636H			Q10567	AP1B1_HUMAN	adaptor-related protein complex 1, beta 1 subunit	636	Pro-rich (stalk region).				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of defense response to virus by virus (GO:0050690)|viral process (GO:0016032)	clathrin adaptor complex (GO:0030131)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|Golgi membrane (GO:0000139)|lysosomal membrane (GO:0005765)|trans-Golgi network membrane (GO:0032588)	protein kinase binding (GO:0019901)|protein transporter activity (GO:0008565)|transporter activity (GO:0005215)			endometrium(3)|large_intestine(4)|lung(8)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	22						GGGCCGAGGTCCAGGTTGAGG	0.672																																					p.D636H		.	.											.	AP1B1	.	.	0			c.G1906C						.						20.0	21.0	21.0					22																	29736737		2198	4296	6494	SO:0001583	missense	162	exon14			CGAGGTCCAGGTT	L13939	CCDS13855.1, CCDS13856.1, CCDS13856.2, CCDS54515.1	22q12.2	2010-06-18			ENSG00000100280	ENSG00000100280			554	protein-coding gene	gene with protein product		600157		ADTB1, CLAPB2		7987321, 8812422	Standard	NM_145730		Approved	BAM22, AP105A	uc003afj.3	Q10567	OTTHUMG00000151109	ENST00000405198.1:c.1906G>C	22.37:g.29736737C>G	ENSP00000384194:p.Asp636His	92.0	0.0		97.0	11.0	NM_001127	C9JRD1|F8WDL0|P78436|Q20WL3|Q86X54	Missense_Mutation	SNP	ENST00000405198.1	37	CCDS13855.1	.	.	.	.	.	.	.	.	.	.	C	32	5.126483	0.94429	.	.	ENSG00000100280	ENST00000357586;ENST00000356015;ENST00000432560;ENST00000405198;ENST00000317368;ENST00000402502;ENST00000415447	T;T;T;T;T;T;T	0.37915	1.25;1.22;1.17;1.25;1.24;1.17;1.17	5.58	5.58	0.84498	.	0.000000	0.85682	D	0.000000	T	0.65471	0.2694	M	0.83774	2.66	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;0.999;0.996;0.997;0.997	T	0.66988	-0.5784	10	0.49607	T	0.09	-37.5738	19.1697	0.93572	0.0:1.0:0.0:0.0	.	189;636;636;636;636	B4DS79;F8WDL0;Q10567-2;Q10567;Q10567-3	.;.;.;AP1B1_HUMAN;.	H	636	ENSP00000350199:D636H;ENSP00000348297:D636H;ENSP00000400065:D636H;ENSP00000384194:D636H;ENSP00000319361:D636H;ENSP00000386071:D636H;ENSP00000387612:D636H	ENSP00000319361:D636H	D	-	1	0	AP1B1	28066737	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.768000	0.85345	2.638000	0.89438	0.655000	0.94253	GAC	.	.		0.672	AP1B1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000321374.1	NM_001127	
FGD3	89846	hgsc.bcm.edu	37	9	95796931	95796931	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr9:95796931C>T	ENST00000375482.3	+	17	2390	c.1894C>T	c.(1894-1896)Ccc>Tcc	p.P632S	FGD3_ENST00000416701.2_Missense_Mutation_p.P631S|FGD3_ENST00000337352.6_Missense_Mutation_p.P632S|FGD3_ENST00000538555.1_Missense_Mutation_p.P235S	NM_001083536.1	NP_001077005.1	Q5JSP0	FGD3_HUMAN	FYVE, RhoGEF and PH domain containing 3	632	PH 2. {ECO:0000255|PROSITE- ProRule:PRU00145}.				actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|cytoskeleton organization (GO:0007010)|filopodium assembly (GO:0046847)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of Cdc42 GTPase activity (GO:0043088)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|ruffle (GO:0001726)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|small GTPase binding (GO:0031267)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(4)|ovary(2)|prostate(1)|urinary_tract(1)	17						CATGTCAGATCCCCAGGTGCT	0.701																																					p.P632S		.	.											.	FGD3	.	.	0			c.C1894T						.						32.0	40.0	38.0					9																	95796931		2057	4196	6253	SO:0001583	missense	89846	exon17			TCAGATCCCCAGG	AK000004	CCDS43849.1, CCDS69619.1	9q22	2013-01-10	2004-08-24		ENSG00000127084	ENSG00000127084		"""Zinc fingers, FYVE domain containing"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	16027	protein-coding gene	gene with protein product			"""FGD1 family, member 3"""			11214971	Standard	NM_001083536		Approved	FLJ00004, ZFYVE5	uc004asz.2	Q5JSP0	OTTHUMG00000021032	ENST00000375482.3:c.1894C>T	9.37:g.95796931C>T	ENSP00000364631:p.Pro632Ser	112.0	0.0		73.0	22.0	NM_001083536	F8W7P2|Q4VX84|Q7Z7D9|Q8N5G1	Missense_Mutation	SNP	ENST00000375482.3	37	CCDS43849.1	.	.	.	.	.	.	.	.	.	.	C	9.537	1.112404	0.20795	.	.	ENSG00000127084	ENST00000375482;ENST00000416701;ENST00000337352;ENST00000538555	T;T;T;T	0.73363	-0.68;-0.69;-0.68;-0.74	4.43	0.192	0.15134	Pleckstrin homology-type (1);Pleckstrin homology domain (2);	0.423808	0.17658	N	0.166421	T	0.63034	0.2477	L	0.48877	1.53	0.35437	D	0.7945	B;B	0.19200	0.034;0.013	B;B	0.25987	0.056;0.065	T	0.58364	-0.7649	10	0.66056	D	0.02	.	4.2856	0.10853	0.3105:0.5031:0.0:0.1864	.	631;632	F8W7P2;Q5JSP0	.;FGD3_HUMAN	S	632;631;632;235	ENSP00000364631:P632S;ENSP00000413833:P631S;ENSP00000336914:P632S;ENSP00000442560:P235S	ENSP00000336914:P632S	P	+	1	0	FGD3	94836752	0.160000	0.22878	0.066000	0.19879	0.229000	0.25112	0.961000	0.29267	-0.052000	0.13311	0.561000	0.74099	CCC	.	.		0.701	FGD3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000055493.1	NM_033086	
UTP20	27340	hgsc.bcm.edu	37	12	101711355	101711355	+	Silent	SNP	C	C	T			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr12:101711355C>T	ENST00000261637.4	+	22	2826	c.2652C>T	c.(2650-2652)gcC>gcT	p.A884A		NM_014503.2	NP_055318.2	O75691	UTP20_HUMAN	UTP20, small subunit (SSU) processome component, homolog (yeast)	884					endonucleolytic cleavage in 5'-ETS of tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000480)|endonucleolytic cleavage in ITS1 to separate SSU-rRNA from 5.8S rRNA and LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000447)|endonucleolytic cleavage to generate mature 5'-end of SSU-rRNA from (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000472)|negative regulation of cell proliferation (GO:0008285)|rRNA processing (GO:0006364)	90S preribosome (GO:0030686)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|preribosome, small subunit precursor (GO:0030688)|small-subunit processome (GO:0032040)	poly(A) RNA binding (GO:0044822)			NS(3)|biliary_tract(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(26)|lung(30)|ovary(2)|prostate(3)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	88						AGGAACCTGCCGCAGGAGATG	0.498																																					p.A884A		.	.											.	UTP20	.	.	0			c.C2652T						.						89.0	86.0	87.0					12																	101711355		2203	4300	6503	SO:0001819	synonymous_variant	27340	exon22			ACCTGCCGCAGGA	AJ006778	CCDS9081.1	12q23	2006-02-11				ENSG00000120800			17897	protein-coding gene	gene with protein product	"""down regulated in metastasis"""	612822				9673349, 15590835, 12837249	Standard	NM_014503		Approved	DRIM	uc001tia.1	O75691	OTTHUMG00000170270	ENST00000261637.4:c.2652C>T	12.37:g.101711355C>T		138.0	0.0		141.0	34.0	NM_014503	Q9H3H4	Silent	SNP	ENST00000261637.4	37	CCDS9081.1																																																																																			.	.		0.498	UTP20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408242.1	NM_014503	
RABGGTA	5875	hgsc.bcm.edu	37	14	24738189	24738189	+	Silent	SNP	C	C	T			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr14:24738189C>T	ENST00000399409.3	-	7	1209	c.726G>A	c.(724-726)caG>caA	p.Q242Q	RABGGTA_ENST00000559586.1_5'Flank|RABGGTA_ENST00000560777.1_5'UTR|RABGGTA_ENST00000216840.6_Silent_p.Q242Q	NM_004581.5	NP_004572.3	Q92696	PGTA_HUMAN	Rab geranylgeranyltransferase, alpha subunit	242					cellular protein modification process (GO:0006464)|protein geranylgeranylation (GO:0018344)|visual perception (GO:0007601)	Rab-protein geranylgeranyltransferase complex (GO:0005968)	Rab geranylgeranyltransferase activity (GO:0004663)|Rab GTPase binding (GO:0017137)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(6)	12				GBM - Glioblastoma multiforme(265;0.0184)		GCAGTGCATCCTGGGGGTCAG	0.562																																					p.Q242Q		.	.											.	.	.	.	0			c.G726A						.						44.0	55.0	51.0					14																	24738189		2122	4251	6373	SO:0001819	synonymous_variant	5875	exon7			TGCATCCTGGGGG		CCDS45088.1	14q11.2	2011-06-27				ENSG00000100949		"""Prenyltransferase alpha subunit repeat containing"""	9795	protein-coding gene	gene with protein product	"""protein prenyltransferase alpha subunit repeat containing 3"""	601905				8954794	Standard	NM_182836		Approved	PTAR3	uc001wog.4	Q92696		ENST00000399409.3:c.726G>A	14.37:g.24738189C>T		150.0	0.0		128.0	29.0	NM_004581	A8K5N2|D3DS69	Silent	SNP	ENST00000399409.3	37	CCDS45088.1																																																																																			.	.		0.562	RABGGTA-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415308.5	NM_182836	
TMEM186	25880	hgsc.bcm.edu	37	16	8890210	8890210	+	Missense_Mutation	SNP	G	G	C			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr16:8890210G>C	ENST00000333050.6	-	2	274	c.241C>G	c.(241-243)Ctg>Gtg	p.L81V	PMM2_ENST00000569958.1_5'Flank|TMEM186_ENST00000564869.1_Intron|PMM2_ENST00000566983.1_Intron|PMM2_ENST00000268261.4_5'Flank|PMM2_ENST00000539622.1_5'Flank|PMM2_ENST00000537352.1_5'Flank	NM_015421.3	NP_056236.2	Q96B77	TM186_HUMAN	transmembrane protein 186	81						integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)				NS(1)|endometrium(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	9						ACCACTGTCAGGGCAGTCTGT	0.517																																					p.L81V		.	.											.	TMEM186	.	.	0			c.C241G						.						118.0	104.0	109.0					16																	8890210		2197	4300	6497	SO:0001583	missense	25880	exon2			CTGTCAGGGCAGT	BC015912	CCDS10535.1	16p13.2	2008-02-05	2007-02-08	2007-02-08	ENSG00000184857	ENSG00000184857			24530	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 51"""	C16orf51		11230166	Standard	NM_015421		Approved	DKFZP564K2062	uc002cze.3	Q96B77	OTTHUMG00000129696	ENST00000333050.6:c.241C>G	16.37:g.8890210G>C	ENSP00000331640:p.Leu81Val	129.0	0.0		123.0	8.0	NM_015421	B2RAY0|Q9Y4T4	Missense_Mutation	SNP	ENST00000333050.6	37	CCDS10535.1	.	.	.	.	.	.	.	.	.	.	G	9.564	1.119318	0.20877	.	.	ENSG00000184857	ENST00000333050	.	.	.	5.36	1.76	0.24704	.	0.848519	0.09714	N	0.765361	T	0.44603	0.1301	L	0.31578	0.945	0.58432	D	0.999993	B	0.23249	0.082	B	0.28916	0.096	T	0.13710	-1.0499	9	0.15066	T	0.55	-8.0658	10.2021	0.43089	0.0:0.1133:0.5867:0.2999	.	81	Q96B77	TM186_HUMAN	V	81	.	ENSP00000331640:L81V	L	-	1	2	TMEM186	8797711	0.002000	0.14202	0.988000	0.46212	0.859000	0.49053	-0.365000	0.07573	0.579000	0.29504	0.561000	0.74099	CTG	.	.		0.517	TMEM186-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251903.1	NM_015421	
CUBN	8029	hgsc.bcm.edu	37	10	17169924	17169924	+	Splice_Site	SNP	C	C	G			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr10:17169924C>G	ENST00000377833.4	-	3	318		c.e3-1		CUBN_ENST00000377823.1_Splice_Site	NM_001081.3	NP_001072.2	O60494	CUBN_HUMAN	cubilin (intrinsic factor-cobalamin receptor)						cholesterol metabolic process (GO:0008203)|cobalamin metabolic process (GO:0009235)|cobalamin transport (GO:0015889)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|tissue homeostasis (GO:0001894)|vitamin D metabolic process (GO:0042359)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|extrinsic component of external side of plasma membrane (GO:0031232)|Golgi apparatus (GO:0005794)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|cobalamin binding (GO:0031419)|protein homodimerization activity (GO:0042803)|receptor activity (GO:0004872)|transporter activity (GO:0005215)			breast(8)|central_nervous_system(4)|cervix(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(42)|liver(1)|lung(107)|ovary(9)|pancreas(2)|prostate(3)|skin(9)|stomach(3)|upper_aerodigestive_tract(11)|urinary_tract(8)	241					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	TTTTCTGGATCTAATTTTAGA	0.274																																					.		.	.											.	CUBN	.	.	0			c.253-1G>C						.						114.0	115.0	115.0					10																	17169924		2202	4300	6502	SO:0001630	splice_region_variant	8029	exon4			CTGGATCTAATTT	AF034611	CCDS7113.1	10p12	2014-09-17			ENSG00000107611	ENSG00000107611			2548	protein-coding gene	gene with protein product		602997		MGA1		9572993, 9478979	Standard	NM_001081		Approved	IFCR, gp280	uc001ioo.3	O60494	OTTHUMG00000017741	ENST00000377833.4:c.253-1G>C	10.37:g.17169924C>G		104.0	0.0		104.0	23.0	NM_001081	B0YIZ4|Q5VTA6|Q96RU9	Splice_Site	SNP	ENST00000377833.4	37	CCDS7113.1	.	.	.	.	.	.	.	.	.	.	C	17.55	3.416664	0.62511	.	.	ENSG00000107611	ENST00000377833;ENST00000377823	.	.	.	5.39	5.39	0.77823	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.293	0.90136	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	CUBN	17209930	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	5.321000	0.65846	2.699000	0.92147	0.650000	0.86243	.	.	.		0.274	CUBN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047009.1	NM_001081	Intron
HCN3	57657	hgsc.bcm.edu	37	1	155255629	155255629	+	Missense_Mutation	SNP	C	C	A			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr1:155255629C>A	ENST00000368358.3	+	6	1359	c.1351C>A	c.(1351-1353)Ccg>Acg	p.P451T	HCN3_ENST00000496230.1_3'UTR	NM_020897.2	NP_065948.1	Q9P1Z3	HCN3_HUMAN	hyperpolarization activated cyclic nucleotide-gated potassium channel 3	451					potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|sodium ion transmembrane transport (GO:0035725)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cAMP binding (GO:0030552)|voltage-gated potassium channel activity (GO:0005249)|voltage-gated sodium channel activity (GO:0005248)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(10)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	27	all_lung(78;2.32e-23)|Hepatocellular(266;0.0877)|all_hematologic(923;0.088)		Epithelial(20;3.72e-10)|all cancers(21;1.19e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)			GGTCTTCCAGCCGGGGGATCT	0.657																																					p.P451T		.	.											.	HCN3	.	.	0			c.C1351A						.						74.0	70.0	71.0					1																	155255629		2203	4300	6503	SO:0001583	missense	57657	exon6			TTCCAGCCGGGGG	AB040968	CCDS1108.1	1q21.2	2011-07-05			ENSG00000143630	ENSG00000143630		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	19183	protein-coding gene	gene with protein product		609973				16382102	Standard	NM_020897		Approved	KIAA1535	uc001fjz.2	Q9P1Z3	OTTHUMG00000035872	ENST00000368358.3:c.1351C>A	1.37:g.155255629C>A	ENSP00000357342:p.Pro451Thr	184.0	0.0		401.0	36.0	NM_020897	D3DV90|Q4VX12|Q8N6W6|Q9BWQ2	Missense_Mutation	SNP	ENST00000368358.3	37	CCDS1108.1	.	.	.	.	.	.	.	.	.	.	C	29.1	4.973201	0.92919	.	.	ENSG00000143630	ENST00000368358	D	0.97505	-4.41	5.46	5.46	0.80206	Cyclic nucleotide-binding-like (1);RmlC-like jelly roll fold (1);Cyclic nucleotide-binding domain (3);	0.000000	0.51477	D	0.000099	D	0.98448	0.9483	M	0.84846	2.72	0.80722	D	1	D;P	0.62365	0.991;0.685	D;P	0.74674	0.984;0.709	D	0.99360	1.0917	10	0.87932	D	0	.	17.154	0.86785	0.0:1.0:0.0:0.0	.	146;451	B7Z5R8;Q9P1Z3	.;HCN3_HUMAN	T	451	ENSP00000357342:P451T	ENSP00000357342:P451T	P	+	1	0	HCN3	153522253	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.776000	0.85560	2.724000	0.93272	0.561000	0.74099	CCG	.	.		0.657	HCN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087388.1	NM_020897	
GUCY1A2	2977	hgsc.bcm.edu	37	11	106810544	106810544	+	Missense_Mutation	SNP	G	G	T			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr11:106810544G>T	ENST00000526355.2	-	4	1316	c.848C>A	c.(847-849)cCa>cAa	p.P283Q	GUCY1A2_ENST00000347596.2_Missense_Mutation_p.P283Q|GUCY1A2_ENST00000282249.2_Missense_Mutation_p.P283Q	NM_000855.2	NP_000846.1	P33402	GCYA2_HUMAN	guanylate cyclase 1, soluble, alpha 2	283					blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|positive regulation of cGMP biosynthetic process (GO:0030828)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)	GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|heme binding (GO:0020037)			breast(5)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(18)|liver(1)|lung(32)|ovary(1)|pancreas(2)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	74		all_epithelial(67;3.66e-05)|Melanoma(852;0.000382)|Acute lymphoblastic leukemia(157;0.001)|all_hematologic(158;0.0017)|Breast(348;0.026)|all_neural(303;0.068)		BRCA - Breast invasive adenocarcinoma(274;8.04e-05)|Epithelial(105;0.0036)|all cancers(92;0.0476)	Isosorbide Mononitrate(DB01020)|Nitric Oxide(DB00435)	ACAATTGCCTGGGTTTGAAAC	0.443																																					p.P283Q		.	.											.	GUCY1A2	.	.	0			c.C848A						.						112.0	110.0	111.0					11																	106810544		2201	4298	6499	SO:0001583	missense	2977	exon4			TTGCCTGGGTTTG	X63282	CCDS8335.1, CCDS58170.1	11q21-q22	2008-03-18			ENSG00000152402	ENSG00000152402	4.6.1.2		4684	protein-coding gene	gene with protein product		601244		GUC1A2		1683630	Standard	NM_000855		Approved	GC-SA2	uc001pjg.2	P33402	OTTHUMG00000166296	ENST00000526355.2:c.848C>A	11.37:g.106810544G>T	ENSP00000431245:p.Pro283Gln	118.0	0.0		94.0	22.0	NM_000855	A1L4C4|B7ZLT5	Missense_Mutation	SNP	ENST00000526355.2	37	CCDS8335.1	.	.	.	.	.	.	.	.	.	.	G	11.57	1.677897	0.29783	.	.	ENSG00000152402	ENST00000526355;ENST00000282249;ENST00000347596	D;D;D	0.86627	-1.81;-2.15;-1.8	5.45	5.45	0.79879	NO signalling/Golgi transport  ligand-binding domain (1);	0.000000	0.44902	U	0.000408	D	0.87034	0.6077	L	0.27053	0.805	0.49483	D	0.999799	D;D;D	0.71674	0.998;0.987;0.974	P;P;P	0.59761	0.855;0.863;0.497	T	0.83134	-0.0112	10	0.12766	T	0.61	.	18.2758	0.90083	0.0:0.0:1.0:0.0	.	283;283;283	B7ZLT5;P33402-2;P33402	.;.;GCYA2_HUMAN	Q	283	ENSP00000431245:P283Q;ENSP00000282249:P283Q;ENSP00000344874:P283Q	ENSP00000282249:P283Q	P	-	2	0	GUCY1A2	106315754	1.000000	0.71417	1.000000	0.80357	0.370000	0.29829	5.565000	0.67365	2.553000	0.86117	0.591000	0.81541	CCA	.	.		0.443	GUCY1A2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000389003.2		
ZNF20	7568	hgsc.bcm.edu	37	19	12243428	12243428	+	Missense_Mutation	SNP	C	C	G			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr19:12243428C>G	ENST00000334213.5	-	4	1797	c.1573G>C	c.(1573-1575)Gaa>Caa	p.E525Q	ZNF20_ENST00000600335.1_Intron|ZNF625-ZNF20_ENST00000430024.1_3'UTR|ZNF20_ENST00000485451.1_5'Flank	NM_001203250.1|NM_021143.3	NP_001190179.1|NP_066966.2	P17024	ZNF20_HUMAN	zinc finger protein 20	525					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|kidney(1)|lung(6)	8						TGAGTTCTTTCATGTTCTCGA	0.403																																					p.E525Q		.	.											.	ZNF20	.	.	0			c.G1573C						.						146.0	156.0	153.0					19																	12243428		2160	4285	6445	SO:0001583	missense	7568	exon4			TTCTTTCATGTTC	X52344	CCDS45986.1	19p13.2	2013-01-08	2006-05-10		ENSG00000132010	ENSG00000132010		"""Zinc fingers, C2H2-type"", ""-"""	12992	protein-coding gene	gene with protein product		194557	"""zinc finger protein 20 (KOX 13)"""				Standard	NM_021143		Approved	KOX13	uc002mtf.2	P17024	OTTHUMG00000156409	ENST00000334213.5:c.1573G>C	19.37:g.12243428C>G	ENSP00000335437:p.Glu525Gln	145.0	0.0		192.0	67.0	NM_021143	Q8N457|Q9UG41	Missense_Mutation	SNP	ENST00000334213.5	37	CCDS45986.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	9.039|9.039	0.989099|0.989099	0.18966|0.18966	.|.	.|.	ENSG00000132010|ENSG00000132010	ENST00000334213|ENST00000292241	T|.	0.01484|.	4.84|.	0.94|0.94	-0.173|-0.173	0.13322|0.13322	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);|.	.|.	.|.	.|.	.|.	T|T	0.21347|0.21347	0.0514|0.0514	N|N	0.17345|0.17345	0.48|0.48	0.19775|0.19775	N|N	0.99996|0.99996	P|.	0.43477|.	0.808|.	B|.	0.39027|.	0.288|.	T|T	0.25779|0.25779	-1.0122|-1.0122	9|6	0.02654|0.87932	T|D	1|0	.|.	3.1081|3.1081	0.06348|0.06348	0.0:0.6655:0.0:0.3345|0.0:0.6655:0.0:0.3345	.|.	525|.	P17024|.	ZNF20_HUMAN|.	Q|I	525|524	ENSP00000335437:E525Q|.	ENSP00000335437:E525Q|ENSP00000292241:M524I	E|M	-|-	1|3	0|0	ZNF20|ZNF20	12104428|12104428	0.000000|0.000000	0.05858|0.05858	0.040000|0.040000	0.18447|0.18447	0.791000|0.791000	0.44710|0.44710	-1.527000|-1.527000	0.02227|0.02227	-0.041000|-0.041000	0.13558|0.13558	0.313000|0.313000	0.20887|0.20887	GAA|ATG	.	.		0.403	ZNF20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344101.1	NM_021143	
PIK3CA	5290	hgsc.bcm.edu	37	3	178936091	178936091	+	Missense_Mutation	SNP	G	G	A	rs104886003		TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr3:178936091G>A	ENST00000263967.3	+	10	1790	c.1633G>A	c.(1633-1635)Gag>Aag	p.E545K		NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	545	PIK helical. {ECO:0000255|PROSITE- ProRule:PRU00878}.		E -> A (in CWS5 and HCC; also found in a glioblastoma multiforme sample). {ECO:0000269|PubMed:15608678, ECO:0000269|PubMed:15924253, ECO:0000269|PubMed:23246288}.|E -> G (in KERSEB; also found in an endometrial carcinoma sample). {ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:17673550}.|E -> K (in MCAP, KERSEB, CRC and BC; shows an increase in lipid kinase activity; oncogenic in vivo; occurs in the interface between the PI3K helical domain and the nSH2 (N-terminal SH2) region of the p85 regulatory subunit and may reduce the inhibitory effect of p85; requires interaction with RAS to induce cellular transformation; enhances invadopodia-mediated extracellular matrix degradation and invasion in breast cancer cells). {ECO:0000269|PubMed:15289301, ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15712344, ECO:0000269|PubMed:15784156, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:16353168, ECO:0000269|PubMed:16533766, ECO:0000269|PubMed:17673550, ECO:0000269|PubMed:22729224}.		angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.E545K(881)|p.E545Q(18)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	TGAAATCACTGAGCAGGAGAA	0.353	E545K(BC3C_URINARY_TRACT)|E545K(BFTC909_KIDNEY)|E545K(DLD1_LARGE_INTESTINE)|E545K(ESS1_ENDOMETRIUM)|E545K(HCC202_BREAST)|E545K(HCT15_LARGE_INTESTINE)|E545K(HSC4_UPPER_AERODIGESTIVE_TRACT)|E545K(HT1197_URINARY_TRACT)|E545K(HUH28_BILIARY_TRACT)|E545K(KYSE510_OESOPHAGUS)|E545K(L363_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|E545K(MCF7_BREAST)|E545K(MDAMB361_BREAST)|E545K(MKN1_STOMACH)|E545K(NCIH460_LUNG)|E545K(NCIH508_LARGE_INTESTINE)|E545K(NCIH596_LUNG)|E545K(RERFLCSQ1_LUNG)|E545K(TCCSUP_URINARY_TRACT)|E545K(TE5_OESOPHAGUS)	57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											p.E545K	Colon(199;1504 1750 3362 26421 31210 32040)	.	.		Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	PIK3CA,bladder,carcinoma,0	PIK3CA	.	.	899	Substitution - Missense(899)	breast(308)|large_intestine(286)|urinary_tract(97)|lung(44)|endometrium(37)|ovary(25)|stomach(17)|upper_aerodigestive_tract(16)|skin(14)|central_nervous_system(13)|cervix(13)|thyroid(7)|oesophagus(7)|penis(4)|kidney(3)|soft_tissue(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(1)|biliary_tract(1)|NS(1)|pituitary(1)	c.G1633A						.						61.0	60.0	60.0					3																	178936091		1813	4072	5885	SO:0001583	missense	5290	exon10			ATCACTGAGCAGG		CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.1633G>A	3.37:g.178936091G>A	ENSP00000263967:p.Glu545Lys	497.0	1.0		460.0	90.0	NM_006218	Q14CW1|Q99762	Missense_Mutation	SNP	ENST00000263967.3	37	CCDS43171.1	.	.	.	.	.	.	.	.	.	.	G	36	5.703347	0.96812	.	.	ENSG00000121879	ENST00000263967	T	0.63255	-0.03	5.78	5.78	0.91487	Phosphoinositide 3-kinase, accessory (PIK) domain (3);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.73822	0.3636	L	0.51914	1.62	0.80722	D	1	D	0.62365	0.991	D	0.62955	0.909	T	0.68872	-0.5294	10	0.32370	T	0.25	-25.7963	20.0024	0.97423	0.0:0.0:1.0:0.0	.	545	P42336	PK3CA_HUMAN	K	545	ENSP00000263967:E545K	ENSP00000263967:E545K	E	+	1	0	PIK3CA	180418785	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	9.476000	0.97823	2.722000	0.93159	0.467000	0.42956	GAG	.	.		0.353	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000348409.2		
MTOR	2475	hgsc.bcm.edu	37	1	11303173	11303173	+	Silent	SNP	A	A	G			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr1:11303173A>G	ENST00000361445.4	-	9	1486	c.1410T>C	c.(1408-1410)caT>caC	p.H470H		NM_004958.3	NP_004949.1	P42345	MTOR_HUMAN	mechanistic target of rapamycin (serine/threonine kinase)	470	Interaction with NBN.				cell growth (GO:0016049)|cellular response to hypoxia (GO:0071456)|cellular response to nutrient levels (GO:0031669)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|germ cell development (GO:0007281)|growth (GO:0040007)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|negative regulation of autophagy (GO:0010507)|negative regulation of cell size (GO:0045792)|negative regulation of macroautophagy (GO:0016242)|negative regulation of NFAT protein import into nucleus (GO:0051534)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|phosphatidylinositol-mediated signaling (GO:0048015)|phosphorylation (GO:0016310)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of gene expression (GO:0010628)|positive regulation of lamellipodium assembly (GO:0010592)|positive regulation of lipid biosynthetic process (GO:0046889)|positive regulation of myotube differentiation (GO:0010831)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of translation (GO:0045727)|protein autophosphorylation (GO:0046777)|protein catabolic process (GO:0030163)|protein phosphorylation (GO:0006468)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of carbohydrate utilization (GO:0043610)|regulation of fatty acid beta-oxidation (GO:0031998)|regulation of glycogen biosynthetic process (GO:0005979)|regulation of protein kinase activity (GO:0045859)|regulation of Rac GTPase activity (GO:0032314)|regulation of response to food (GO:0032095)|response to amino acid (GO:0043200)|response to nutrient (GO:0007584)|response to stress (GO:0006950)|ruffle organization (GO:0031529)|signal transduction (GO:0007165)|T cell costimulation (GO:0031295)|TOR signaling (GO:0031929)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endomembrane system (GO:0012505)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|phosphatidylinositol 3-kinase complex (GO:0005942)|PML body (GO:0016605)|TORC1 complex (GO:0031931)|TORC2 complex (GO:0031932)	ATP binding (GO:0005524)|drug binding (GO:0008144)|kinase activity (GO:0016301)|phosphoprotein binding (GO:0051219)|protein serine/threonine kinase activity (GO:0004674)|ribosome binding (GO:0043022)|RNA polymerase III type 1 promoter DNA binding (GO:0001030)|RNA polymerase III type 2 promoter DNA binding (GO:0001031)|RNA polymerase III type 3 promoter DNA binding (GO:0001032)|TFIIIC-class transcription factor binding (GO:0001156)			breast(5)|central_nervous_system(7)|endometrium(20)|kidney(34)|large_intestine(21)|lung(43)|ovary(9)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	149					Everolimus(DB01590)|Pimecrolimus(DB00337)|Sirolimus(DB00877)|Temsirolimus(DB06287)	GTGCTTACTTATGGGCGAAGT	0.512																																					p.H470H		.	.											.	MTOR	.	.	0			c.T1410C						.						63.0	67.0	66.0					1																	11303173		2203	4300	6503	SO:0001819	synonymous_variant	2475	exon9			TTACTTATGGGCG	L34075	CCDS127.1	1p36	2014-09-17	2009-05-29	2009-05-29	ENSG00000198793	ENSG00000198793			3942	protein-coding gene	gene with protein product	"""FK506 binding protein 12-rapamycin associated protein 2"", ""rapamycin target protein"", ""FKBP12-rapamycin complex-associated protein 1"", ""FKBP-rapamycin associated protein"", ""rapamycin associated protein FRAP2"", ""dJ576K7.1 (FK506 binding protein 12-rapamycin associated protein 1)"", ""rapamycin and FKBP12 target 1"", ""mammalian target of rapamycin"""	601231	"""FK506 binding protein 12-rapamycin associated protein 1"""	FRAP, FRAP2, FRAP1		8008069, 8660990	Standard	NM_004958		Approved	RAFT1, RAPT1, FLJ44809	uc001asd.3	P42345	OTTHUMG00000002001	ENST00000361445.4:c.1410T>C	1.37:g.11303173A>G		67.0	0.0		40.0	24.0	NM_004958	Q4LE76|Q5TER1|Q6LE87|Q96QG3|Q9Y4I3	Silent	SNP	ENST00000361445.4	37	CCDS127.1																																																																																			.	.		0.512	MTOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005558.1	NM_004958	
HFM1	164045	hgsc.bcm.edu	37	1	91742607	91742607	+	Missense_Mutation	SNP	C	C	G			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr1:91742607C>G	ENST00000370425.3	-	31	3502	c.3404G>C	c.(3403-3405)aGc>aCc	p.S1135T	HFM1_ENST00000462405.1_5'UTR|HFM1_ENST00000370424.3_Missense_Mutation_p.S814T|HFM1_ENST00000294696.5_Missense_Mutation_p.S367T	NM_001017975.3	NP_001017975.3	A2PYH4	HFM1_HUMAN	HFM1, ATP-dependent DNA helicase homolog (S. cerevisiae)	1135					resolution of meiotic recombination intermediates (GO:0000712)		ATP binding (GO:0005524)|helicase activity (GO:0004386)|nucleic acid binding (GO:0003676)			breast(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(17)|lung(33)|ovary(1)|prostate(3)|skin(2)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	75		all_lung(203;0.00961)|Lung NSC(277;0.0351)		all cancers(265;0.000481)|Epithelial(280;0.00863)|OV - Ovarian serous cystadenocarcinoma(397;0.126)|KIRC - Kidney renal clear cell carcinoma(1967;0.171)		AGGTTTTTTGCTGGCAGTCGT	0.299																																					p.S1135T		.	.											.	HFM1	.	.	0			c.G3404C						.						109.0	107.0	108.0					1																	91742607		2203	4299	6502	SO:0001583	missense	164045	exon31			TTTTTGCTGGCAG	AB204867	CCDS30769.2	1p22.2	2008-03-26			ENSG00000162669	ENSG00000162669			20193	protein-coding gene	gene with protein product		615684	"""SEC63 domain containing 1"""	SEC63D1		14702039, 17286053	Standard	XM_006710395		Approved	MER3, FLJ39011, FLJ36760	uc001doa.4	A2PYH4	OTTHUMG00000010093	ENST00000370425.3:c.3404G>C	1.37:g.91742607C>G	ENSP00000359454:p.Ser1135Thr	294.0	0.0		292.0	91.0	NM_001017975	B1B0B6|Q8N9Q0	Missense_Mutation	SNP	ENST00000370425.3	37	CCDS30769.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	0.104|0.104	-1.148444|-1.148444	0.01714|0.01714	.|.	.|.	ENSG00000162669|ENSG00000162669	ENST00000430465|ENST00000370425;ENST00000294696;ENST00000370424;ENST00000370421	.|T;T;T	.|0.63096	.|0.35;0.71;-0.02	5.71|5.71	2.75|2.75	0.32379|0.32379	.|.	.|0.325149	.|0.26911	.|N	.|0.021877	T|T	0.15652|0.15652	0.0377|0.0377	N|N	0.14661|0.14661	0.345|0.345	0.20764|0.20764	N|N	0.999856|0.999856	.|B;B;B	.|0.09022	.|0.002;0.001;0.002	.|B;B;B	.|0.09377	.|0.004;0.003;0.001	T|T	0.28964|0.28964	-1.0027|-1.0027	5|10	.|0.13470	.|T	.|0.59	.|.	5.4308|5.4308	0.16452|0.16452	0.0:0.6141:0.1458:0.2401|0.0:0.6141:0.1458:0.2401	.|.	.|814;346;1135	.|A6NGI5;B1B0B5;A2PYH4	.|.;.;HFM1_HUMAN	P|T	347|1135;367;814;819	.|ENSP00000359454:S1135T;ENSP00000294696:S367T;ENSP00000359453:S814T	.|ENSP00000294696:S367T	A|S	-|-	1|2	0|0	HFM1|HFM1	91515195|91515195	0.171000|0.171000	0.23029|0.23029	0.595000|0.595000	0.28798|0.28798	0.539000|0.539000	0.34962|0.34962	0.179000|0.179000	0.16840|0.16840	0.315000|0.315000	0.23110|0.23110	0.585000|0.585000	0.79938|0.79938	GCA|AGC	.	.		0.299	HFM1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316716.2	NM_001017975	
F13A1	2162	hgsc.bcm.edu	37	6	6145912	6145912	+	Silent	SNP	G	G	A	rs200672690		TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr6:6145912G>A	ENST00000264870.3	-	15	2404	c.2139C>T	c.(2137-2139)gaC>gaT	p.D713D		NM_000129.3	NP_000120.2	P00488	F13A_HUMAN	coagulation factor XIII, A1 polypeptide	713					blood coagulation (GO:0007596)|peptide cross-linking (GO:0018149)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|platelet alpha granule lumen (GO:0031093)	metal ion binding (GO:0046872)|protein-glutamine gamma-glutamyltransferase activity (GO:0003810)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(37)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	62	Ovarian(93;0.0816)	all_hematologic(90;0.152)			L-Glutamine(DB00130)	GTCTCAGGGAGTCACTGCTCA	0.557																																					p.D713D		.	.											.	F13A1	.	.	0			c.C2139T						.						144.0	126.0	132.0					6																	6145912		2203	4300	6503	SO:0001819	synonymous_variant	2162	exon15			CAGGGAGTCACTG	M14539	CCDS4496.1	6p24.2-p23	2014-01-24			ENSG00000124491	ENSG00000124491		"""Transglutaminases"""	3531	protein-coding gene	gene with protein product		134570		F13A			Standard	NM_000129		Approved		uc003mwv.3	P00488	OTTHUMG00000014186	ENST00000264870.3:c.2139C>T	6.37:g.6145912G>A		171.0	0.0		144.0	61.0	NM_000129	Q59HA7|Q8N6X2|Q96P24|Q9BX29	Silent	SNP	ENST00000264870.3	37	CCDS4496.1																																																																																			G|0.999;A|0.001	.		0.557	F13A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039756.3	NM_000129	
DNAH5	1767	hgsc.bcm.edu	37	5	13727745	13727745	+	Missense_Mutation	SNP	C	C	T	rs377633103		TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr5:13727745C>T	ENST00000265104.4	-	70	12008	c.11904G>A	c.(11902-11904)atG>atA	p.M3968I		NM_001369.2	NP_001360.1	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	3968					cilium movement (GO:0003341)|lateral ventricle development (GO:0021670)|left/right axis specification (GO:0070986)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(6)|breast(14)|central_nervous_system(4)|cervix(2)|endometrium(23)|haematopoietic_and_lymphoid_tissue(8)|kidney(11)|large_intestine(85)|liver(1)|lung(129)|ovary(16)|pancreas(2)|prostate(5)|skin(48)|stomach(5)|upper_aerodigestive_tract(11)|urinary_tract(8)	378	Lung NSC(4;0.00476)					AAATTTTCCACATTTTCTCAT	0.373									Kartagener syndrome																												p.M3968I		.	.											.	DNAH5	.	.	0			c.G11904A						.	C	ILE/MET	0,4406		0,0,2203	95.0	96.0	96.0		11904	4.6	1.0	5		96	1,8599	1.2+/-3.3	0,1,4299	no	missense	DNAH5	NM_001369.2	10	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	benign	3968/4625	13727745	1,13005	2203	4300	6503	SO:0001583	missense	1767	exon70	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	TTTCCACATTTTC	AJ132090	CCDS3882.1	5p15.2	2008-07-18	2006-09-04		ENSG00000039139	ENSG00000039139		"""Axonemal dyneins"""	2950	protein-coding gene	gene with protein product	"""dynein heavy chain 5"""	603335	"""dynein, axonemal, heavy polypeptide 5"""			9256245, 11788826	Standard	NM_001369		Approved	Dnahc5, HL1, PCD, CILD3, KTGNR	uc003jfd.2	Q8TE73	OTTHUMG00000090533	ENST00000265104.4:c.11904G>A	5.37:g.13727745C>T	ENSP00000265104:p.Met3968Ile	320.0	0.0		354.0	119.0	NM_001369	Q92860|Q96L74|Q9H5S7|Q9HCG9	Missense_Mutation	SNP	ENST00000265104.4	37	CCDS3882.1	.	.	.	.	.	.	.	.	.	.	C	13.52	2.262348	0.39995	0.0	1.16E-4	ENSG00000039139	ENST00000265104	T	0.08193	3.12	5.49	4.62	0.57501	Dynein heavy chain (1);	0.558290	0.20333	N	0.094397	T	0.04724	0.0128	N	0.04880	-0.145	0.33289	D	0.563269	B	0.06786	0.001	B	0.16722	0.016	T	0.14504	-1.0470	10	0.38643	T	0.18	.	10.3593	0.43982	0.0:0.8504:0.0:0.1496	.	3968	Q8TE73	DYH5_HUMAN	I	3968	ENSP00000265104:M3968I	ENSP00000265104:M3968I	M	-	3	0	DNAH5	13780745	0.998000	0.40836	1.000000	0.80357	0.998000	0.95712	0.671000	0.25172	1.320000	0.45209	0.650000	0.86243	ATG	.	.		0.373	DNAH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207057.2	NM_001369	
ZFYVE20	64145	hgsc.bcm.edu	37	3	15126258	15126258	+	Silent	SNP	G	G	A			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr3:15126258G>A	ENST00000253699.3	-	8	1195	c.582C>T	c.(580-582)atC>atT	p.I194I	ZFYVE20_ENST00000435849.3_Silent_p.I194I|ZFYVE20_ENST00000449964.2_5'UTR|ZFYVE20_ENST00000476527.2_Silent_p.I194I	NM_022340.2	NP_071735.2	Q9H1K0	RBNS5_HUMAN	zinc finger, FYVE domain containing 20	194	Necessary for the correct targeting to endosomes.				blood coagulation (GO:0007596)|endosomal transport (GO:0016197)|protein transport (GO:0015031)	endosome (GO:0005768)|endosome membrane (GO:0010008)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)	zinc ion binding (GO:0008270)			NS(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(10)|skin(3)|stomach(1)|urinary_tract(2)	26						AGGGAAGGCTGATGAGCTCCA	0.537																																					p.I194I		.	.											.	ZFYVE20	.	.	0			c.C582T						.						81.0	87.0	85.0					3																	15126258		2203	4300	6503	SO:0001819	synonymous_variant	64145	exon8			AAGGCTGATGAGC	AY009133	CCDS2623.1	3p25.1	2014-01-15			ENSG00000131381	ENSG00000131381		"""Zinc fingers, FYVE domain containing"""	20759	protein-coding gene	gene with protein product		609511				11062261	Standard	XR_427283		Approved	Rabenosyn-5	uc003bzm.1	Q9H1K0	OTTHUMG00000129860	ENST00000253699.3:c.582C>T	3.37:g.15126258G>A		142.0	0.0		125.0	66.0	NM_022340	B4DWY8|C9J4P5|Q3KP30|Q59EY8|Q8NAQ1	Silent	SNP	ENST00000253699.3	37	CCDS2623.1																																																																																			.	.		0.537	ZFYVE20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252102.2	NM_022340	
RXFP3	51289	hgsc.bcm.edu	37	5	33937720	33937720	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr5:33937720G>A	ENST00000330120.3	+	1	1230	c.875G>A	c.(874-876)cGc>cAc	p.R292H		NM_016568.3	NP_057652.1	Q9NSD7	RL3R1_HUMAN	relaxin/insulin-like family peptide receptor 3	292					G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of cytokinesis (GO:0032467)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled peptide receptor activity (GO:0008528)|G-protein coupled receptor activity (GO:0004930)			endometrium(4)|large_intestine(9)|lung(24)|ovary(1)|skin(1)|upper_aerodigestive_tract(3)	42						CTGCTGGTGCGCTTCATCGCC	0.682																																					p.R292H		.	.											.	RXFP3	.	.	0			c.G875A						.						36.0	27.0	30.0					5																	33937720		2190	4274	6464	SO:0001583	missense	51289	exon1			TGGTGCGCTTCAT	D88437	CCDS3900.1	5p15.1-p14	2012-08-08	2006-05-09	2006-03-15	ENSG00000182631	ENSG00000182631		"""GPCR / Class A : Relaxin family peptide receptors"""	24883	protein-coding gene	gene with protein product		609445	"""relaxin 3 receptor 1"", ""relaxin family peptide receptor 3"""	RLN3R1		15956688, 16507880	Standard	NM_016568		Approved	SALPR, GPCR135, RXFPR3	uc003jic.2	Q9NSD7	OTTHUMG00000090685	ENST00000330120.3:c.875G>A	5.37:g.33937720G>A	ENSP00000328708:p.Arg292His	117.0	0.0		151.0	67.0	NM_016568	Q14DA5	Missense_Mutation	SNP	ENST00000330120.3	37	CCDS3900.1	.	.	.	.	.	.	.	.	.	.	G	34	5.360728	0.95877	.	.	ENSG00000182631	ENST00000330120	T	0.39592	1.07	5.74	5.74	0.90152	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.72078	0.3416	M	0.88450	2.955	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	T	0.76152	-0.3064	10	0.62326	D	0.03	-36.9412	19.9295	0.97114	0.0:0.0:1.0:0.0	.	292	Q9NSD7	RL3R1_HUMAN	H	292	ENSP00000328708:R292H	ENSP00000328708:R292H	R	+	2	0	RXFP3	33973477	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.801000	0.99128	2.695000	0.91970	0.655000	0.94253	CGC	.	.		0.682	RXFP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207369.1	NM_016568	
DPY19L1	23333	hgsc.bcm.edu	37	7	35050986	35050986	+	Missense_Mutation	SNP	G	G	A	rs569347879		TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr7:35050986G>A	ENST00000310974.4	-	5	551	c.407C>T	c.(406-408)aCg>aTg	p.T136M		NM_015283.1	NP_056098.1	Q2PZI1	D19L1_HUMAN	dpy-19-like 1 (C. elegans)	136						integral component of membrane (GO:0016021)|membrane (GO:0016020)	transferase activity, transferring glycosyl groups (GO:0016757)			endometrium(3)|kidney(5)|large_intestine(8)|lung(8)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(4)	31						TCTGGTAACCGTCCAACATAT	0.348													G|||	1	0.000199681	0.0008	0.0	5008	,	,		18556	0.0		0.0	False		,,,				2504	0.0				p.T136M		.	.											.	DPY19L1	.	.	0			c.C407T						.						95.0	87.0	89.0					7																	35050986		1831	4084	5915	SO:0001583	missense	23333	exon5			GTAACCGTCCAAC	AB020684	CCDS43567.1	7p14.3-p14.2	2006-04-26			ENSG00000173852	ENSG00000173852			22205	protein-coding gene	gene with protein product		613892					Standard	NM_015283		Approved	KIAA0877	uc003tem.4	Q2PZI1	OTTHUMG00000154888	ENST00000310974.4:c.407C>T	7.37:g.35050986G>A	ENSP00000308695:p.Thr136Met	364.0	0.0		368.0	69.0	NM_015283	O94954|Q4G151	Missense_Mutation	SNP	ENST00000310974.4	37	CCDS43567.1	.	.	.	.	.	.	.	.	.	.	G	20.4	3.982340	0.74474	.	.	ENSG00000173852	ENST00000310974	T	0.60040	0.22	5.21	4.33	0.51752	.	0.053328	0.64402	D	0.000001	T	0.70868	0.3273	L	0.56769	1.78	0.48571	D	0.999673	D	0.89917	1.0	D	0.77004	0.989	T	0.72516	-0.4269	10	0.56958	D	0.05	-19.4131	13.0619	0.59012	0.0775:0.0:0.9225:0.0	.	136	Q2PZI1	D19L1_HUMAN	M	136	ENSP00000308695:T136M	ENSP00000308695:T136M	T	-	2	0	DPY19L1	35017511	1.000000	0.71417	0.999000	0.59377	0.987000	0.75469	7.712000	0.84684	1.200000	0.43188	-0.143000	0.13931	ACG	.	.		0.348	DPY19L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337506.1		
NBAS	51594	hgsc.bcm.edu	37	2	15519748	15519748	+	Missense_Mutation	SNP	C	C	A			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr2:15519748C>A	ENST00000281513.5	-	30	3593	c.3568G>T	c.(3568-3570)Gat>Tat	p.D1190Y	NBAS_ENST00000441750.1_Missense_Mutation_p.D1070Y	NM_015909.3	NP_056993.2	A2RRP1	NBAS_HUMAN	neuroblastoma amplified sequence	1190					negative regulation of nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:2000623)|nuclear-transcribed mRNA catabolic process (GO:0000956)	cytoplasm (GO:0005737)|membrane (GO:0016020)				NS(4)|breast(4)|central_nervous_system(3)|endometrium(6)|kidney(5)|large_intestine(12)|liver(1)|lung(54)|ovary(2)|pancreas(3)|prostate(9)|skin(6)|stomach(3)	112						ATGCAGCTATCAGTGAGGTTG	0.423																																					p.D1190Y		.	.											.	NBAS	.	.	0			c.G3568T						.						98.0	96.0	97.0					2																	15519748		2203	4300	6503	SO:0001583	missense	51594	exon30			AGCTATCAGTGAG	BC051792	CCDS1685.1	2p24.3	2009-02-23			ENSG00000151779	ENSG00000151779			15625	protein-coding gene	gene with protein product		608025				9926938, 12706883	Standard	NM_015909		Approved	NAG	uc002rcc.2	A2RRP1	OTTHUMG00000121153	ENST00000281513.5:c.3568G>T	2.37:g.15519748C>A	ENSP00000281513:p.Asp1190Tyr	337.0	0.0		334.0	45.0	NM_015909	O95790|Q2VPJ7|Q53TK6|Q86V39|Q8NFY8|Q9Y3W5	Missense_Mutation	SNP	ENST00000281513.5	37	CCDS1685.1	.	.	.	.	.	.	.	.	.	.	C	25.4	4.631951	0.87660	.	.	ENSG00000151779	ENST00000441750;ENST00000281513;ENST00000441755	T;T;T	0.19105	2.17;2.17;2.17	5.79	5.79	0.91817	Secretory pathway Sec39 (1);	0.000000	0.85682	D	0.000000	T	0.51635	0.1686	M	0.77820	2.39	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	T	0.52351	-0.8587	10	0.87932	D	0	.	20.0361	0.97558	0.0:1.0:0.0:0.0	.	1070;1190	A2RRP1-2;A2RRP1	.;NBAS_HUMAN	Y	1070;1190;237	ENSP00000413201:D1070Y;ENSP00000281513:D1190Y;ENSP00000396501:D237Y	ENSP00000281513:D1190Y	D	-	1	0	NBAS	15437199	1.000000	0.71417	0.946000	0.38457	0.941000	0.58515	6.917000	0.75782	2.740000	0.93945	0.563000	0.77884	GAT	.	.		0.423	NBAS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241638.1	NM_015909	
EPG5	57724	hgsc.bcm.edu	37	18	43458391	43458391	+	Silent	SNP	T	T	C			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr18:43458391T>C	ENST00000282041.5	-	34	5926	c.5892A>G	c.(5890-5892)gtA>gtG	p.V1964V	EPG5_ENST00000585906.1_5'UTR	NM_020964.2	NP_066015.2	Q9HCE0	EPG5_HUMAN	ectopic P-granules autophagy protein 5 homolog (C. elegans)	1964					autophagic vacuole maturation (GO:0097352)|autophagy (GO:0006914)|endocytic recycling (GO:0032456)					NS(1)|breast(9)|central_nervous_system(3)|cervix(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(22)|lung(35)|ovary(2)|pancreas(1)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	95						GCTGAATGATTACTGAATGTA	0.323																																					p.V1964V		.	.											.	EPG5	.	.	0			c.A5892G						.						78.0	71.0	73.0					18																	43458391		1815	4068	5883	SO:0001819	synonymous_variant	57724	exon34			AATGATTACTGAA	AK023817	CCDS11926.2	18q12.3	2011-03-02	2011-03-02	2011-03-02	ENSG00000152223	ENSG00000152223			29331	protein-coding gene	gene with protein product		615068	"""KIAA1632"""	KIAA1632		10997877, 20550938	Standard	XM_005258323		Approved	hEPG5	uc002lbm.3	Q9HCE0	OTTHUMG00000132626	ENST00000282041.5:c.5892A>G	18.37:g.43458391T>C		80.0	0.0		113.0	12.0	NM_020964	A2BDF3|Q9H8C8	Silent	SNP	ENST00000282041.5	37	CCDS11926.2																																																																																			.	.		0.323	EPG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445081.1	NM_020964	
PARD3	56288	hgsc.bcm.edu	37	10	34400172	34400172	+	Silent	SNP	C	C	T			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr10:34400172C>T	ENST00000374789.3	-	25	4321	c.3996G>A	c.(3994-3996)gtG>gtA	p.V1332V	PARD3_ENST00000545260.1_Silent_p.V1242V|PARD3_ENST00000374794.3_Silent_p.V1220V|PARD3_ENST00000374788.3_Silent_p.V1329V|PARD3_ENST00000350537.4_Silent_p.V1286V|PARD3_ENST00000346874.4_Silent_p.V1295V|PARD3_ENST00000545693.1_Silent_p.V1316V|PARD3_ENST00000374790.3_Silent_p.V1272V	NM_019619.3	NP_062565.2	Q8TEW0	PARD3_HUMAN	par-3 family cell polarity regulator	1332					apical constriction (GO:0003383)|asymmetric cell division (GO:0008356)|axonogenesis (GO:0007409)|cell cycle (GO:0007049)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|centrosome localization (GO:0051642)|establishment of epithelial cell polarity (GO:0090162)|establishment or maintenance of cell polarity (GO:0007163)|microtubule cytoskeleton organization (GO:0000226)|myelination in peripheral nervous system (GO:0022011)|negative regulation of peptidyl-threonine phosphorylation (GO:0010801)|positive regulation of myelination (GO:0031643)|protein complex assembly (GO:0006461)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|protein targeting to membrane (GO:0006612)|regulation of actin filament-based process (GO:0032970)|regulation of cellular localization (GO:0060341)|tight junction assembly (GO:0070830)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing, spreading of cells (GO:0044319)	apical part of cell (GO:0045177)|axonal growth cone (GO:0044295)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|internode region of axon (GO:0033269)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|spindle (GO:0005819)|tight junction (GO:0005923)	phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3-phosphate binding (GO:0032266)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(11)|lung(21)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	63		Breast(68;0.0707)				GGGAGGGGGGCACATCTTGCC	0.572																																					p.V1332V		.	.											.	PARD3	.	.	0			c.G3996A						.						47.0	50.0	49.0					10																	34400172		2203	4300	6503	SO:0001819	synonymous_variant	56288	exon25			GGGGGGCACATCT	AF252293	CCDS7178.1, CCDS53509.1, CCDS53510.1, CCDS53511.1, CCDS53512.1, CCDS53513.1, CCDS53514.1, CCDS53515.1, CCDS53516.1	10p11.22	2014-06-13	2013-08-28		ENSG00000148498	ENSG00000148498			16051	protein-coding gene	gene with protein product	"""atypical PKC isotype-specific interacting protein"", ""par-3 family cell polarity regulator alpha"", ""protein phosphatase 1, regulatory subunit 118"""	606745	"""par-3 (partitioning defective 3, C.elegans) homolog"", ""par-3 partitioning defective 3 homolog (C. elegans)"""			10934474	Standard	NM_001184790		Approved	PAR3, PARD3A, Bazooka, Baz, ASIP, PPP1R118	uc010qej.2	Q8TEW0	OTTHUMG00000017948	ENST00000374789.3:c.3996G>A	10.37:g.34400172C>T		150.0	0.0		101.0	53.0	NM_019619	F5H5T0|Q5T2U1|Q5VUA2|Q5VUA3|Q5VWV0|Q5VWV1|Q5VWV3|Q5VWV4|Q5VWV5|Q6IQ47|Q8TCZ9|Q8TEW1|Q8TEW2|Q8TEW3|Q96K28|Q96RM6|Q96RM7|Q9BY57|Q9BY58|Q9HC48|Q9NWL4|Q9NYE6	Silent	SNP	ENST00000374789.3	37	CCDS7178.1																																																																																			.	.		0.572	PARD3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047527.1	NM_019619	
KNTC1	9735	hgsc.bcm.edu	37	12	123097712	123097712	+	Missense_Mutation	SNP	T	T	G			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr12:123097712T>G	ENST00000333479.7	+	54	5853	c.5676T>G	c.(5674-5676)tgT>tgG	p.C1892W	KNTC1_ENST00000537348.1_Missense_Mutation_p.C317W|KNTC1_ENST00000436959.3_5'UTR|KNTC1_ENST00000450485.2_Missense_Mutation_p.C817W	NM_014708.4	NP_055523.1	P50748	KNTC1_HUMAN	kinetochore associated 1	1892					mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|mitotic nuclear division (GO:0007067)|protein complex assembly (GO:0006461)|regulation of exit from mitosis (GO:0007096)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|kinetochore microtubule (GO:0005828)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|spindle pole (GO:0000922)				breast(1)|central_nervous_system(1)|cervix(2)|endometrium(12)|kidney(8)|large_intestine(12)|lung(20)|ovary(7)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(4)	72	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;7.21e-05)|Epithelial(86;0.000178)|BRCA - Breast invasive adenocarcinoma(302;0.217)		CTCTTCAGTGTCTCTTCTATT	0.348																																					p.C1892W		.	.											.	KNTC1	.	.	0			c.T5676G						.						177.0	170.0	172.0					12																	123097712		1831	4085	5916	SO:0001583	missense	9735	exon54			TCAGTGTCTCTTC		CCDS45002.1	12q24.31	2013-01-17			ENSG00000184445	ENSG00000184445			17255	protein-coding gene	gene with protein product	"""rough deal homolog (Drosophila)"""	607363				11146660, 11590237	Standard	NM_014708		Approved	KIAA0166, ROD	uc001ucv.3	P50748	OTTHUMG00000168861	ENST00000333479.7:c.5676T>G	12.37:g.123097712T>G	ENSP00000328236:p.Cys1892Trp	158.0	0.0		177.0	63.0	NM_014708	A7E2C4|B3KSG2	Missense_Mutation	SNP	ENST00000333479.7	37	CCDS45002.1	.	.	.	.	.	.	.	.	.	.	T	18.04	3.533662	0.64972	.	.	ENSG00000184445	ENST00000450485;ENST00000333479;ENST00000537348;ENST00000546125	T;T;T;T	0.30981	1.51;1.51;1.51;1.51	5.46	-0.867	0.10655	RZZ complex, subunit KNTC1/ROD, C-terminal (1);	0.039449	0.85682	D	0.000000	T	0.47838	0.1467	M	0.67953	2.075	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.45877	-0.9231	10	0.87932	D	0	-16.1272	10.7332	0.46109	0.0:0.3956:0.0:0.6044	.	817;1892	E7ES84;P50748	.;KNTC1_HUMAN	W	817;1892;317;79	ENSP00000397992:C817W;ENSP00000328236:C1892W;ENSP00000443622:C317W;ENSP00000439119:C79W	ENSP00000328236:C1892W	C	+	3	2	KNTC1	121663665	0.999000	0.42202	0.997000	0.53966	0.989000	0.77384	0.380000	0.20602	-0.149000	0.11215	0.533000	0.62120	TGT	.	.		0.348	KNTC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396110.2		
ACTN2	88	hgsc.bcm.edu	37	1	236891012	236891012	+	Missense_Mutation	SNP	C	C	A			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr1:236891012C>A	ENST00000366578.4	+	6	737	c.571C>A	c.(571-573)Cac>Aac	p.H191N	ACTN2_ENST00000492634.1_3'UTR|ACTN2_ENST00000542672.1_Missense_Mutation_p.H191N	NM_001103.2|NM_001278343.1	NP_001094.1|NP_001265272.1	P35609	ACTN2_HUMAN	actinin, alpha 2	191	Actin-binding.|CH 2. {ECO:0000255|PROSITE- ProRule:PRU00044}.				blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|focal adhesion assembly (GO:0048041)|microspike assembly (GO:0030035)|muscle filament sliding (GO:0030049)|negative regulation of potassium ion transmembrane transporter activity (GO:1901017)|negative regulation of potassium ion transport (GO:0043267)|negative regulation of protein localization to cell surface (GO:2000009)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of potassium ion transport (GO:0043268)|protein homotetramerization (GO:0051289)|regulation of apoptotic process (GO:0042981)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	actin filament (GO:0005884)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|platelet alpha granule lumen (GO:0031093)|pseudopodium (GO:0031143)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|cytoskeletal protein binding (GO:0008092)|FATZ binding (GO:0051373)|identical protein binding (GO:0042802)|integrin binding (GO:0005178)|ion channel binding (GO:0044325)|protein dimerization activity (GO:0046983)|structural constituent of muscle (GO:0008307)|thyroid hormone receptor coactivator activity (GO:0030375)|titin binding (GO:0031432)|titin Z domain binding (GO:0070080)			endometrium(4)|kidney(2)|large_intestine(15)|lung(55)|ovary(4)|prostate(3)|skin(3)	86	Ovarian(103;0.0634)|Breast(184;0.221)	all_cancers(173;0.00661)|Acute lymphoblastic leukemia(190;0.109)|Prostate(94;0.174)	OV - Ovarian serous cystadenocarcinoma(106;0.00168)			TGCCCTCATCCACCGACACCG	0.547																																					p.H191N		.	.											.	ACTN2	.	.	0			c.C571A						.						179.0	145.0	156.0					1																	236891012		2203	4300	6503	SO:0001583	missense	88	exon6			CTCATCCACCGAC	BC047901	CCDS1613.1, CCDS60455.1, CCDS73053.1	1q42-q43	2014-09-17			ENSG00000077522	ENSG00000077522		"""EF-hand domain containing"""	164	protein-coding gene	gene with protein product		102573				1339456	Standard	NM_001103		Approved		uc001hyf.2	P35609	OTTHUMG00000040059	ENST00000366578.4:c.571C>A	1.37:g.236891012C>A	ENSP00000355537:p.His191Asn	111.0	0.0		163.0	27.0	NM_001103	B1ANE4|B2RCS5|Q86TF4|Q86TI8	Missense_Mutation	SNP	ENST00000366578.4	37	CCDS1613.1	.	.	.	.	.	.	.	.	.	.	C	29.4	5.005920	0.93287	.	.	ENSG00000077522	ENST00000542672;ENST00000366578	D;D	0.95035	-3.59;-3.59	5.2	5.2	0.72013	Calponin homology domain (5);	0.000000	0.85682	D	0.000000	D	0.97729	0.9255	M	0.89214	3.015	0.80722	D	1	D;P	0.89917	1.0;0.884	D;D	0.87578	0.998;0.981	D	0.98588	1.0653	10	0.87932	D	0	.	18.7382	0.91764	0.0:1.0:0.0:0.0	.	191;191	B2RCS5;P35609	.;ACTN2_HUMAN	N	191	ENSP00000443495:H191N;ENSP00000355537:H191N	ENSP00000355537:H191N	H	+	1	0	ACTN2	234957635	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.818000	0.86416	2.411000	0.81874	0.462000	0.41574	CAC	.	.		0.547	ACTN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000096628.1	NM_001103	
TMPRSS4	56649	hgsc.bcm.edu	37	11	117979580	117979580	+	Silent	SNP	C	C	T			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr11:117979580C>T	ENST00000437212.3	+	7	766	c.552C>T	c.(550-552)ctC>ctT	p.L184L	TMPRSS4_ENST00000523251.1_Silent_p.L144L|TMPRSS4_ENST00000534111.1_Silent_p.L182L|TMPRSS4_ENST00000522824.1_Silent_p.L179L|TMPRSS4_ENST00000522307.1_Silent_p.L37L			Q9NRS4	TMPS4_HUMAN	transmembrane protease, serine 4	184	SRCR. {ECO:0000255|PROSITE- ProRule:PRU00196}.				proteolysis (GO:0006508)	integral component of membrane (GO:0016021)	scavenger receptor activity (GO:0005044)|serine-type endopeptidase activity (GO:0004252)			breast(2)|central_nervous_system(2)|large_intestine(3)|lung(8)|ovary(1)|prostate(2)|skin(1)	19	all_hematologic(175;0.0487)	Medulloblastoma(222;0.0431)|all_hematologic(192;0.164)|Breast(348;0.183)|all_neural(223;0.238)		BRCA - Breast invasive adenocarcinoma(274;4.16e-05)|Epithelial(105;0.00204)		GGCCCTGTCTCTCAGGCTCCC	0.577																																					p.L184L		.	.											.	TMPRSS4	.	.	0			c.C552T						.						117.0	97.0	103.0					11																	117979580		2200	4296	6496	SO:0001819	synonymous_variant	56649	exon7			CTGTCTCTCAGGC	AF179224	CCDS31684.1, CCDS44743.1, CCDS53716.1, CCDS53717.1	11q23.3	2010-04-13			ENSG00000137648	ENSG00000137648		"""Serine peptidases / Transmembrane"""	11878	protein-coding gene	gene with protein product	"""transmembrane serine protease 3"", ""membrane-type serine protease 2"", ""type II membrane serine protease"""	606565				10825129	Standard	NM_001083947		Approved	TMPRSS3, MT-SP2	uc021qrd.1	Q9NRS4	OTTHUMG00000164122	ENST00000437212.3:c.552C>T	11.37:g.117979580C>T		107.0	0.0		76.0	40.0	NM_019894	A8MU84|B0YJB0|B7Z8C5|E7ERX8|Q5XKQ6|Q6UX37|Q9NZA5	Silent	SNP	ENST00000437212.3	37	CCDS31684.1																																																																																			.	.		0.577	TMPRSS4-004	KNOWN	non_canonical_polymorphism|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000377328.2	NM_019894	
DNAJC28	54943	hgsc.bcm.edu	37	21	34860757	34860757	+	Missense_Mutation	SNP	T	T	A			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr21:34860757T>A	ENST00000314399.3	-	2	1382	c.944A>T	c.(943-945)aAt>aTt	p.N315I	DNAJC28_ENST00000402202.1_Missense_Mutation_p.N315I|DNAJC28_ENST00000381947.3_Missense_Mutation_p.N315I	NM_017833.3	NP_060303.2	Q9NX36	DJC28_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 28	315										endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(5)|skin(1)|urinary_tract(1)	18						AACAATTAAATTAAAATCATT	0.348																																					p.N315I		.	.											.	DNAJC28	.	.	0			c.A944T						.						83.0	79.0	80.0					21																	34860757		2203	4300	6503	SO:0001583	missense	54943	exon2			ATTAAATTAAAAT	AK000468	CCDS13626.1	21q22.11	2011-09-02	2008-06-17	2008-06-17	ENSG00000177692	ENSG00000177692		"""Heat shock proteins / DNAJ (HSP40)"""	1297	protein-coding gene	gene with protein product	"""Orf28"""		"""chromosome 21 open reading frame 55"""	C21orf55			Standard	NM_017833		Approved	C21orf78	uc002yrw.3	Q9NX36	OTTHUMG00000065531	ENST00000314399.3:c.944A>T	21.37:g.34860757T>A	ENSP00000320303:p.Asn315Ile	470.0	0.0		347.0	32.0	NM_001040192	D3DSF2	Missense_Mutation	SNP	ENST00000314399.3	37	CCDS13626.1	.	.	.	.	.	.	.	.	.	.	T	19.95	3.921477	0.73213	.	.	ENSG00000177692	ENST00000381947;ENST00000314399;ENST00000402202	.	.	.	5.09	5.09	0.68999	.	0.000000	0.85682	D	0.000000	T	0.79816	0.4511	M	0.80183	2.485	0.53688	D	0.999979	D	0.89917	1.0	D	0.87578	0.998	T	0.83136	-0.0111	9	0.87932	D	0	-25.7443	14.8401	0.70217	0.0:0.0:0.0:1.0	.	315	Q9NX36	DJC28_HUMAN	I	315	.	ENSP00000320303:N315I	N	-	2	0	DNAJC28	33782627	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.094000	0.76944	2.050000	0.60909	0.528000	0.53228	AAT	.	.		0.348	DNAJC28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000140454.3		
PYGM	5837	hgsc.bcm.edu	37	11	64517976	64517976	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr11:64517976C>T	ENST00000164139.3	-	17	2447	c.2049G>A	c.(2047-2049)atG>atA	p.M683I	PYGM_ENST00000377432.3_Missense_Mutation_p.M595I|PYGM_ENST00000462303.1_5'Flank	NM_005609.2	NP_005600.1	P11217	PYGM_HUMAN	phosphorylase, glycogen, muscle	683					carbohydrate metabolic process (GO:0005975)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|glycogen metabolic process (GO:0005977)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	glycogen phosphorylase activity (GO:0008184)|nucleotide binding (GO:0000166)|pyridoxal phosphate binding (GO:0030170)			cervix(1)|endometrium(2)|kidney(3)|large_intestine(4)|lung(21)|ovary(3)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	38						CCCCGTTGAGCATGAACTTCA	0.597																																					p.M683I		.	.											.	PYGM	.	.	0			c.G2049A						.						140.0	125.0	130.0					11																	64517976		2201	4297	6498	SO:0001583	missense	5837	exon17			GTTGAGCATGAAC		CCDS8079.1, CCDS53659.1	11q12-q13.2	2013-03-01	2008-07-31		ENSG00000068976	ENSG00000068976	2.4.1.1	"""Glycogen phosphorylases"""	9726	protein-coding gene	gene with protein product	"""McArdle syndrome"", ""glycogen storage disease type V"", ""glycogen phosphorylase, muscle form"""	608455	"""phosphorylase, glycogen; muscle"""				Standard	NM_005609		Approved		uc001oax.4	P11217	OTTHUMG00000066835	ENST00000164139.3:c.2049G>A	11.37:g.64517976C>T	ENSP00000164139:p.Met683Ile	177.0	0.0		138.0	24.0	NM_005609	A0AVK1|A6NDY6	Missense_Mutation	SNP	ENST00000164139.3	37	CCDS8079.1	.	.	.	.	.	.	.	.	.	.	C	20.5	3.996298	0.74818	.	.	ENSG00000068976	ENST00000377432;ENST00000164139;ENST00000540450	D;D	0.94232	-3.11;-3.38	4.91	4.91	0.64330	.	0.000000	0.64402	D	0.000007	D	0.95683	0.8596	M	0.93375	3.41	0.80722	D	1	B;B	0.28971	0.229;0.137	B;B	0.37780	0.228;0.258	D	0.95288	0.8392	10	0.49607	T	0.09	-42.4242	15.638	0.76970	0.0:1.0:0.0:0.0	.	595;683	A6NDY6;P11217	.;PYGM_HUMAN	I	595;683;664	ENSP00000366650:M595I;ENSP00000164139:M683I	ENSP00000164139:M683I	M	-	3	0	PYGM	64274552	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.616000	0.83018	2.564000	0.86499	0.555000	0.69702	ATG	.	.		0.597	PYGM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000143254.2	NM_005609	
CYP2A7	1549	hgsc.bcm.edu	37	19	41387943	41387943	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr19:41387943A>G	ENST00000301146.4	-	1	714	c.173T>C	c.(172-174)aTc>aCc	p.I58T	CYP2A7_ENST00000291764.3_Missense_Mutation_p.I58T|CTC-490E21.12_ENST00000601627.1_Intron	NM_000764.2	NP_000755.2	P20853	CP2A7_HUMAN	cytochrome P450, family 2, subfamily A, polypeptide 7	58						endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)	aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxygen binding (GO:0019825)			endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(6)|lung(7)|ovary(4)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	27			LUSC - Lung squamous cell carcinoma(20;0.000219)|Lung(22;0.000959)			CACCTTCATGATGGAGTCACA	0.592																																					p.I58T		.	.											.	CYP2A7	.	.	0			c.T173C						.						84.0	63.0	70.0					19																	41387943		2203	4300	6503	SO:0001583	missense	1549	exon1			TTCATGATGGAGT	NM_000764	CCDS12569.1, CCDS42570.1	19q13.2	2013-07-25	2003-01-14		ENSG00000198077	ENSG00000198077		"""Cytochrome P450s"""	2611	protein-coding gene	gene with protein product		608054	"""cytochrome P450, subfamily IIA (phenobarbital-inducible), polypeptide 7"""			7668294, 15128046	Standard	NM_030589		Approved	CYP2A	uc002opm.3	P20853	OTTHUMG00000182715	ENST00000301146.4:c.173T>C	19.37:g.41387943A>G	ENSP00000301146:p.Ile58Thr	409.0	1.0		375.0	180.0	NM_000764	Q13121	Missense_Mutation	SNP	ENST00000301146.4	37	CCDS12569.1	.	.	.	.	.	.	.	.	.	.	A	11.61	1.688721	0.29962	.	.	ENSG00000198077	ENST00000301146;ENST00000291764	T;T	0.69040	-0.37;2.62	2.33	2.33	0.28932	.	0.210173	0.30473	U	0.009552	T	0.66015	0.2747	L	0.42245	1.32	0.20489	N	0.999895	B;B	0.28512	0.214;0.154	B;P	0.44447	0.239;0.45	T	0.63959	-0.6519	10	0.87932	D	0	.	9.3499	0.38131	1.0:0.0:0.0:0.0	.	58;58	F8W816;P20853	.;CP2A7_HUMAN	T	58	ENSP00000301146:I58T;ENSP00000291764:I58T	ENSP00000291764:I58T	I	-	2	0	CYP2A7	46079783	0.631000	0.27164	0.018000	0.16275	0.051000	0.14879	4.464000	0.60134	1.072000	0.40860	0.155000	0.16302	ATC	.	.		0.592	CYP2A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463269.2	NM_030589	
SWAP70	23075	hgsc.bcm.edu	37	11	9769515	9769515	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr11:9769515G>A	ENST00000318950.6	+	10	1569	c.1466G>A	c.(1465-1467)cGt>cAt	p.R489H	SWAP70_ENST00000447399.2_Missense_Mutation_p.R431H	NM_015055.2	NP_055870.2	Q9UH65	SWP70_HUMAN	SWAP switching B-cell complex 70kDa subunit	489					isotype switching (GO:0045190)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|DNA binding (GO:0003677)			NS(1)|breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(2)|ovary(2)|pancreas(1)	11				all cancers(16;1.21e-10)|Epithelial(150;2.81e-09)|BRCA - Breast invasive adenocarcinoma(625;0.00649)		GAGAATCAGCGTGTCCTGAAG	0.542																																					p.R489H		.	.											.	SWAP70	.	.	0			c.G1466A						.						105.0	95.0	98.0					11																	9769515		2201	4294	6495	SO:0001583	missense	23075	exon10			ATCAGCGTGTCCT	AB014540	CCDS31426.1, CCDS73257.1	11p15	2013-01-10			ENSG00000133789	ENSG00000133789		"""Pleckstrin homology (PH) domain containing"", ""EF-hand domain containing"""	17070	protein-coding gene	gene with protein product		604762				9734811, 10681448	Standard	XM_005252829		Approved	KIAA0640, SWAP-70	uc001mhw.3	Q9UH65	OTTHUMG00000165865	ENST00000318950.6:c.1466G>A	11.37:g.9769515G>A	ENSP00000315630:p.Arg489His	125.0	0.0		96.0	17.0	NM_015055	D3DQV1|O75135|Q7LCY6|Q9P061|Q9P0Z8	Missense_Mutation	SNP	ENST00000318950.6	37	CCDS31426.1	.	.	.	.	.	.	.	.	.	.	G	20.5	3.996842	0.74818	.	.	ENSG00000133789	ENST00000447399;ENST00000318950	T;T	0.24538	1.85;1.85	5.84	4.93	0.64822	.	0.048575	0.85682	D	0.000000	T	0.42517	0.1206	L	0.53249	1.67	0.54753	D	0.999982	D;D	0.64830	0.994;0.987	P;P	0.59012	0.85;0.719	T	0.36744	-0.9735	10	0.66056	D	0.02	-9.208	15.2006	0.73132	0.0673:0.0:0.9327:0.0	.	431;489	E7EMB1;Q9UH65	.;SWP70_HUMAN	H	431;489	ENSP00000399056:R431H;ENSP00000315630:R489H	ENSP00000315630:R489H	R	+	2	0	SWAP70	9726091	1.000000	0.71417	0.845000	0.33349	0.613000	0.37349	5.120000	0.64685	1.493000	0.48517	-0.119000	0.15052	CGT	.	.		0.542	SWAP70-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386766.2	NM_015055	
LVRN	206338	hgsc.bcm.edu	37	5	115298764	115298764	+	Missense_Mutation	SNP	C	C	G			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr5:115298764C>G	ENST00000357872.4	+	1	574	c.450C>G	c.(448-450)ttC>ttG	p.F150L	AQPEP_ENST00000395528.2_5'UTR	NM_173800.4	NP_776161.3	Q6Q4G3	AMPQ_HUMAN		150						integral component of membrane (GO:0016021)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)										ATAGCCTCTTCCAGGACTGCG	0.697																																					p.F150L		.	.											.	.	.	.	0			c.C450G						.						40.0	43.0	42.0					5																	115298764		2202	4299	6501	SO:0001583	missense	0	exon1			CCTCTTCCAGGAC																												ENST00000357872.4:c.450C>G	5.37:g.115298764C>G	ENSP00000350541:p.Phe150Leu	53.0	0.0		71.0	16.0	NM_173800	A8K6J0|C9JGD2|Q32MR1|Q4G0I9|Q4G0V2|Q86XA3|Q8NBZ2	Missense_Mutation	SNP	ENST00000357872.4	37	CCDS4124.1	.	.	.	.	.	.	.	.	.	.	C	1.095	-0.662916	0.03454	.	.	ENSG00000172901	ENST00000357872;ENST00000379578	T	0.04119	3.7	4.64	-0.977	0.10282	Peptidase M1, membrane alanine aminopeptidase, N-terminal (1);	1.099670	0.06968	N	0.817619	T	0.02727	0.0082	N	0.17082	0.46	0.26840	N	0.96841	B	0.06786	0.001	B	0.06405	0.002	T	0.47761	-0.9092	10	0.30078	T	0.28	.	0.6167	0.00771	0.172:0.3271:0.1685:0.3325	.	150	Q6Q4G3	AMPQ_HUMAN	L	150	ENSP00000350541:F150L	ENSP00000350541:F150L	F	+	3	2	AC010282.1	115326663	0.000000	0.05858	0.488000	0.27440	0.140000	0.21249	-0.627000	0.05521	-0.203000	0.10251	-0.225000	0.12378	TTC	.	.		0.697	AQPEP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250852.1		
RGS4	5999	hgsc.bcm.edu	37	1	163039295	163039295	+	Silent	SNP	T	T	A			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr1:163039295T>A	ENST00000367909.6	+	1	361	c.21T>A	c.(19-21)ggT>ggA	p.G7G	RGS4_ENST00000531057.1_Silent_p.G7G|RGS4_ENST00000527809.1_Intron|RGS4_ENST00000491263.1_3'UTR|RGS4_ENST00000367906.3_5'Flank|RGS4_ENST00000367908.4_Silent_p.G7G|RGS4_ENST00000421743.2_Silent_p.G104G	NM_001113380.1|NM_005613.5	NP_001106851.1|NP_005604.1	P49798	RGS4_HUMAN	regulator of G-protein signaling 4	7					inactivation of MAPK activity (GO:0000188)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	calmodulin binding (GO:0005516)|GTPase activator activity (GO:0005096)			breast(3)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(7)|ovary(2)|upper_aerodigestive_tract(2)	21						GGCTTGCAGGTCTGCCGGCTT	0.438											OREG0013952	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.G104G	Ovarian(76;1257 1738 3039 6086)	.	.											.	RGS4	.	.	0			c.T312A						.						67.0	63.0	65.0					1																	163039295		2203	4300	6503	SO:0001819	synonymous_variant	5999	exon2			TGCAGGTCTGCCG	BC051869	CCDS1243.1, CCDS44270.1, CCDS44271.1, CCDS44272.1	1q23.3	2008-05-14	2007-08-14		ENSG00000117152	ENSG00000117152		"""Regulators of G-protein signaling"""	10000	protein-coding gene	gene with protein product		602516	"""regulator of G-protein signalling 4"", ""schizophrenia disorder 9"""	SCZD9		8602223, 8756726	Standard	NM_001102445		Approved		uc001gcl.4	P49798	OTTHUMG00000034417	ENST00000367909.6:c.21T>A	1.37:g.163039295T>A		140.0	0.0	1828	146.0	23.0	NM_001102445	A7XA56|A7XA58|A7XA59|A7YVV7|B1APZ3	Silent	SNP	ENST00000367909.6	37	CCDS1243.1																																																																																			.	.		0.438	RGS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083197.2	NM_005613	
TTC1	7265	hgsc.bcm.edu	37	5	159437629	159437629	+	Missense_Mutation	SNP	C	C	G			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr5:159437629C>G	ENST00000231238.5	+	2	204	c.94C>G	c.(94-96)Cca>Gca	p.P32A	TTC1_ENST00000522793.1_Missense_Mutation_p.P32A|Y_RNA_ENST00000362528.1_RNA	NM_001282500.1|NM_003314.1	NP_001269429.1|NP_003305.1	Q99614	TTC1_HUMAN	tetratricopeptide repeat domain 1	32					protein folding (GO:0006457)	peroxisomal membrane (GO:0005778)	unfolded protein binding (GO:0051082)			breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|liver(2)|lung(1)|prostate(1)|skin(1)	12	Renal(175;0.00196)	all_hematologic(541;0.00014)|Breast(839;0.0101)|all_neural(177;0.0281)|Medulloblastoma(196;0.0425)|Lung NSC(249;0.119)|all_lung(500;0.163)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	Epithelial(171;8.37e-05)|all cancers(165;0.000694)|OV - Ovarian serous cystadenocarcinoma(192;0.0402)		TGCTGGCCCTCCAGTTCCTGA	0.522																																					p.P32A		.	.											.	TTC1	.	.	0			c.C94G						.						57.0	59.0	59.0					5																	159437629		2203	4300	6503	SO:0001583	missense	7265	exon2			GGCCCTCCAGTTC	U46570	CCDS4348.1	5q32-q33.2	2013-01-10			ENSG00000113312	ENSG00000113312		"""Tetratricopeptide (TTC) repeat domain containing"""	12391	protein-coding gene	gene with protein product		601963				8836031	Standard	NM_003314		Approved	TPR1	uc003lxu.3	Q99614	OTTHUMG00000130326	ENST00000231238.5:c.94C>G	5.37:g.159437629C>G	ENSP00000231238:p.Pro32Ala	87.0	0.0		97.0	38.0	NM_003314	B2RCT2|D3DQJ8|Q9BVT3	Missense_Mutation	SNP	ENST00000231238.5	37	CCDS4348.1	.	.	.	.	.	.	.	.	.	.	C	0.003	-2.426001	0.00186	.	.	ENSG00000113312	ENST00000231238;ENST00000522793	T;T	0.16324	2.35;2.35	5.09	-2.61	0.06171	.	1.602510	0.03083	N	0.158727	T	0.10981	0.0268	L	0.44542	1.39	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.19063	-1.0317	10	0.06625	T	0.88	-14.1256	1.3757	0.02220	0.1235:0.3545:0.1941:0.328	.	32	Q99614	TTC1_HUMAN	A	32	ENSP00000231238:P32A;ENSP00000429225:P32A	ENSP00000231238:P32A	P	+	1	0	TTC1	159370207	0.000000	0.05858	0.000000	0.03702	0.029000	0.11900	-1.185000	0.03073	-0.696000	0.05098	-0.300000	0.09419	CCA	.	.		0.522	TTC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252675.3	NM_003314	
RPL10A	4736	hgsc.bcm.edu	37	6	35437288	35437288	+	Missense_Mutation	SNP	A	A	C			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr6:35437288A>C	ENST00000322203.6	+	4	319	c.292A>C	c.(292-294)Aaa>Caa	p.K98Q	RPL10A_ENST00000467020.1_3'UTR	NM_007104.4	NP_009035.3	P62906	RL10A_HUMAN	ribosomal protein L10a	98					anatomical structure morphogenesis (GO:0009653)|cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			breast(1)|large_intestine(2)|ovary(1)	4						CAAGAATAAAAAACTGGTCAA	0.512																																					p.K98Q		.	.											.	RPL10A	.	.	0			c.A292C						.						41.0	42.0	42.0					6																	35437288		2203	4300	6503	SO:0001583	missense	4736	exon4			AATAAAAAACTGG	U12404	CCDS4806.1	6p21.31	2011-04-06			ENSG00000198755	ENSG00000198755		"""L ribosomal proteins"""	10299	protein-coding gene	gene with protein product		615660		NEDD6		7609734, 9647638	Standard	NM_007104		Approved	Csa-19, L10A	uc003okp.1	P62906	OTTHUMG00000014566	ENST00000322203.6:c.292A>C	6.37:g.35437288A>C	ENSP00000363018:p.Lys98Gln	71.0	0.0		72.0	26.0	NM_007104	B2R801|P52859|P53025|Q5TZT6|Q8J013	Missense_Mutation	SNP	ENST00000322203.6	37	CCDS4806.1	.	.	.	.	.	.	.	.	.	.	A	19.91	3.913719	0.72983	.	.	ENSG00000198755	ENST00000322203	T	0.50001	0.76	4.61	4.61	0.57282	Ribosomal protein L1, 3-layer alpha/beta-sandwich (1);Ribosomal protein L1, superfamily (1);	0.000000	0.85682	D	0.000000	T	0.70971	0.3285	H	0.95402	3.665	0.80722	D	1	D	0.57899	0.981	D	0.71414	0.973	T	0.80643	-0.1291	10	0.87932	D	0	.	12.8579	0.57897	1.0:0.0:0.0:0.0	.	98	P62906	RL10A_HUMAN	Q	98	ENSP00000363018:K98Q	ENSP00000363018:K98Q	K	+	1	0	RPL10A	35545266	1.000000	0.71417	0.994000	0.49952	0.653000	0.38743	9.266000	0.95659	1.717000	0.51406	0.374000	0.22700	AAA	.	.		0.512	RPL10A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040283.1	NM_007104	
SPEF2	79925	hgsc.bcm.edu	37	5	35807028	35807028	+	Missense_Mutation	SNP	C	C	A			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr5:35807028C>A	ENST00000356031.3	+	35	5384	c.5230C>A	c.(5230-5232)Cta>Ata	p.L1744I	CTD-2113L7.1_ENST00000510433.1_RNA|SPEF2_ENST00000440995.2_Missense_Mutation_p.L1739I|SPEF2_ENST00000303129.4_Missense_Mutation_p.L541I	NM_024867.3	NP_079143.3	Q9C093	SPEF2_HUMAN	sperm flagellar 2	1744					axoneme assembly (GO:0035082)|brain morphogenesis (GO:0048854)|embryonic neurocranium morphogenesis (GO:0048702)|fertilization (GO:0009566)|immune system development (GO:0002520)|multicellular organismal aging (GO:0010259)|respiratory system development (GO:0060541)|spermatogenesis (GO:0007283)	Golgi apparatus (GO:0005794)|manchette (GO:0002177)|sperm midpiece (GO:0097225)				breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(15)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	37	all_lung(31;7.56e-05)		Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			TGCCAGCCACCTAAAGATAGA	0.363																																					p.L1744I		.	.											.	SPEF2	.	.	0			c.C5230A						.						64.0	61.0	62.0					5																	35807028		1845	4079	5924	SO:0001583	missense	79925	exon35			AGCCACCTAAAGA	AB051557	CCDS3910.1, CCDS43309.1	5p13.2	2010-05-04			ENSG00000152582	ENSG00000152582			26293	protein-coding gene	gene with protein product	"""cancer/testis antigen 122"""	610172				11214970, 16549801, 17610085	Standard	NM_024867		Approved	KPL2, FLJ23577, CT122	uc003jjo.3	Q9C093	OTTHUMG00000131111	ENST00000356031.3:c.5230C>A	5.37:g.35807028C>A	ENSP00000348314:p.Leu1744Ile	369.0	0.0		325.0	119.0	NM_024867	Q2TAC9|Q96LL6|Q9H5C7|Q9H5Q7	Missense_Mutation	SNP	ENST00000356031.3	37	CCDS43309.1	.	.	.	.	.	.	.	.	.	.	C	4.718	0.133489	0.09032	.	.	ENSG00000152582	ENST00000356031;ENST00000440995;ENST00000303129	T;T;T	0.46819	3.32;3.31;0.86	5.85	3.95	0.45737	HAT dimerisation (1);	0.302945	0.23043	N	0.052584	T	0.31606	0.0802	L	0.51422	1.61	0.09310	N	1	P;B;B	0.43352	0.804;0.176;0.211	B;B;B	0.28465	0.09;0.054;0.09	T	0.27971	-1.0058	10	0.36615	T	0.2	.	7.0868	0.25261	0.1239:0.6647:0.1361:0.0753	.	541;1739;1744	Q9C093-4;Q9C093-2;Q9C093	.;.;SPEF2_HUMAN	I	1744;1739;541	ENSP00000348314:L1744I;ENSP00000412125:L1739I;ENSP00000303843:L541I	ENSP00000303843:L541I	L	+	1	2	SPEF2	35842785	0.007000	0.16637	0.009000	0.14445	0.042000	0.13812	2.127000	0.42035	1.454000	0.47793	0.655000	0.94253	CTA	.	.		0.363	SPEF2-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367199.1	NM_144722	
CMIP	80790	hgsc.bcm.edu	37	16	81736275	81736275	+	Splice_Site	SNP	G	G	A			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr16:81736275G>A	ENST00000537098.3	+	17	2016		c.e17+1		CMIP_ENST00000539778.2_Splice_Site|CMIP_ENST00000398040.4_Splice_Site|CMIP_ENST00000566513.1_Splice_Site	NM_198390.2	NP_938204.2	Q8IY22	CMIP_HUMAN	c-Maf inducing protein							cytoplasm (GO:0005737)|nucleus (GO:0005634)				endometrium(5)|kidney(1)|lung(7)	13						CAAGTCCACAGTGAGTTGGTT	0.542																																					.		.	.											.	.	.	.	0			c.1944+1G>A						.						156.0	154.0	155.0					16																	81736275		1992	4167	6159	SO:0001630	splice_region_variant	80790	exon17			TCCACAGTGAGTT	AB051481	CCDS54044.1, CCDS54045.1	16q23	2011-08-04			ENSG00000153815	ENSG00000153815			24319	protein-coding gene	gene with protein product		610112				11214970, 12939343	Standard	NM_030629		Approved		uc002fgp.3	Q8IY22		ENST00000537098.3:c.1944+1G>A	16.37:g.81736275G>A		934.0	2.0		724.0	376.0	NM_198390	Q9C0G9	Splice_Site	SNP	ENST00000537098.3	37	CCDS54044.1	.	.	.	.	.	.	.	.	.	.	G	21.5	4.165130	0.78339	.	.	ENSG00000153815	ENST00000537098;ENST00000539778;ENST00000398040;ENST00000542097	.	.	.	5.43	5.43	0.79202	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.258	0.93955	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	CMIP	80293776	1.000000	0.71417	1.000000	0.80357	0.696000	0.40369	9.096000	0.94182	2.554000	0.86153	0.655000	0.94253	.	.	.		0.542	CMIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000432399.2	NM_030629	Intron
OR5D13	390142	hgsc.bcm.edu	37	11	55541187	55541187	+	Nonsense_Mutation	SNP	A	A	T			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr11:55541187A>T	ENST00000361760.1	+	1	274	c.274A>T	c.(274-276)Aga>Tga	p.R92*		NM_001001967.1	NP_001001967.1	Q8NGL4	OR5DD_HUMAN	olfactory receptor, family 5, subfamily D, member 13	92						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|liver(1)|lung(20)|ovary(1)|pancreas(2)|skin(2)|stomach(1)|urinary_tract(1)	40		all_epithelial(135;0.196)				TGTGGAATACAGAACCATCTC	0.393																																					p.R92X		.	.											.	OR5D13	.	.	0			c.A274T						.						188.0	179.0	182.0					11																	55541187		2200	4296	6496	SO:0001587	stop_gained	390142	exon1			GAATACAGAACCA	BK004394	CCDS31507.1	11q11	2012-08-09			ENSG00000198877	ENSG00000198877		"""GPCR / Class A : Olfactory receptors"""	15280	protein-coding gene	gene with protein product							Standard	NM_001001967		Approved		uc010ril.2	Q8NGL4	OTTHUMG00000166807	ENST00000361760.1:c.274A>T	11.37:g.55541187A>T	ENSP00000354800:p.Arg92*	637.0	0.0		525.0	111.0	NM_001001967	Q6IF68|Q6IFC9	Nonsense_Mutation	SNP	ENST00000361760.1	37	CCDS31507.1	.	.	.	.	.	.	.	.	.	.	A	8.603	0.887303	0.17540	.	.	ENSG00000198877	ENST00000361760	.	.	.	3.52	3.52	0.40303	.	0.000000	0.37178	U	0.002220	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.32370	T	0.25	-9.0487	6.57	0.22533	0.8857:0.0:0.1143:0.0	.	.	.	.	X	92	.	ENSP00000354800:R92X	R	+	1	2	OR5D13	55297763	0.000000	0.05858	0.357000	0.25798	0.015000	0.08874	1.189000	0.32114	1.626000	0.50381	0.398000	0.26397	AGA	.	.		0.393	OR5D13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391511.1	NM_001001967	
ELN	2006	hgsc.bcm.edu	37	7	73459566	73459566	+	Missense_Mutation	SNP	G	G	T	rs139718810		TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr7:73459566G>T	ENST00000252034.7	+	10	883	c.484G>T	c.(484-486)Ggt>Tgt	p.G162C	ELN_ENST00000380576.5_Missense_Mutation_p.G162C|ELN_ENST00000320492.7_Missense_Mutation_p.G150C|ELN_ENST00000458204.1_Missense_Mutation_p.G152C|ELN_ENST00000357036.5_Missense_Mutation_p.G167C|ELN_ENST00000320399.6_Missense_Mutation_p.G162C|ELN_ENST00000380584.4_Missense_Mutation_p.G162C|ELN_ENST00000429192.1_Missense_Mutation_p.G167C|ELN_ENST00000414324.1_Missense_Mutation_p.G157C|ELN_ENST00000445912.1_Missense_Mutation_p.G162C|ELN_ENST00000358929.4_Missense_Mutation_p.G162C|ELN_ENST00000380553.4_Intron|ELN_ENST00000380575.4_Missense_Mutation_p.G152C|ELN_ENST00000380562.4_Missense_Mutation_p.G162C	NM_000501.2|NM_001278915.1	NP_000492.2|NP_001265844.1	P15502	ELN_HUMAN	elastin	162					blood circulation (GO:0008015)|blood vessel remodeling (GO:0001974)|cell proliferation (GO:0008283)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|organ morphogenesis (GO:0009887)|regulation of actin filament polymerization (GO:0030833)|respiratory gaseous exchange (GO:0007585)|skeletal muscle tissue development (GO:0007519)|stress fiber assembly (GO:0043149)	elastic fiber (GO:0071953)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix binding (GO:0050840)|extracellular matrix constituent conferring elasticity (GO:0030023)|extracellular matrix structural constituent (GO:0005201)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(10)|ovary(4)|pancreas(2)|prostate(1)|skin(2)|stomach(1)	32		Lung NSC(55;0.159)				TCGGTTCCCCGGTGTGGGGGT	0.657			T	PAX5	B-ALL		"""Supravalvular Aortic Stenosis, Cutis laxa , Williams-Beuren Syndrome"""																														p.G167C		.	.		Dom	yes		7	7q11.23	2006	elastin	yes	L	.	ELN	.	.	0			c.G499T						.						48.0	51.0	50.0					7																	73459566		2203	4300	6503	SO:0001583	missense	2006	exon10			TTCCCCGGTGTGG		CCDS5562.2, CCDS43598.1, CCDS43599.1, CCDS47611.1, CCDS47612.1, CCDS64673.1, CCDS64674.1, CCDS64675.1, CCDS64676.1, CCDS64677.1, CCDS64678.1, CCDS75616.1, CCDS75617.1	7q11.1-q21.1	2008-08-01	2008-08-01		ENSG00000049540	ENSG00000049540			3327	protein-coding gene	gene with protein product	"""tropoelastin"", ""supravalvular aortic stenosis"", ""Williams-Beuren syndrome"""	130160				8096434	Standard	NM_001278939		Approved	WBS, WS, SVAS	uc003tzn.3	P15502	OTTHUMG00000150229	ENST00000252034.7:c.484G>T	7.37:g.73459566G>T	ENSP00000252034:p.Gly162Cys	48.0	0.0		59.0	23.0	NM_001081753	B3KTS6|O15336|O15337|Q14233|Q14234|Q14235|Q14238|Q6P0L4|Q6ZWJ6|Q75MU5|Q7Z316|Q7Z3F5|Q9UMF5	Missense_Mutation	SNP	ENST00000252034.7	37	CCDS5562.2	.	.	.	.	.	.	.	.	.	.	G	14.38	2.517070	0.44763	.	.	ENSG00000049540	ENST00000445912;ENST00000252034;ENST00000358929;ENST00000431562;ENST00000320492;ENST00000438906;ENST00000414324;ENST00000380562;ENST00000380575;ENST00000380584;ENST00000458204;ENST00000357036;ENST00000429192;ENST00000442462;ENST00000380576;ENST00000320399	D;D;D;T;T;T;D;D;D;D;D;D;D;D;D	0.96232	-3.95;-3.95;-3.95;0.91;0.91;0.91;-3.95;-3.95;-3.95;-3.95;-3.95;-3.95;-3.95;-3.95;-3.95	3.75	3.75	0.43078	.	.	.	.	.	D	0.97473	0.9173	M	0.74881	2.28	0.47009	D	0.999284	D;D;D;D;D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D;D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0	D	0.97392	0.9990	9	0.66056	D	0.02	-3.2704	11.2593	0.49074	0.0:0.0:1.0:0.0	.	162;131;150;157;152;162;152;167;167;162;162;162	E7ENM0;E9PBM4;G5E950;G3V0G6;E7EN65;P15502-1;P15502-7;P15502-12;P15502-5;P15502-13;P15502-8;P15502-2	.;.;.;.;.;.;.;.;.;.;.;.	C	162;162;162;140;150;150;157;162;152;162;152;167;167;131;162;162	ENSP00000389857:G162C;ENSP00000252034:G162C;ENSP00000351807:G162C;ENSP00000394549:G140C;ENSP00000315607:G150C;ENSP00000406949:G150C;ENSP00000392575:G157C;ENSP00000369936:G162C;ENSP00000369949:G152C;ENSP00000369958:G162C;ENSP00000403162:G152C;ENSP00000349540:G167C;ENSP00000391129:G167C;ENSP00000369950:G162C;ENSP00000313565:G162C	ENSP00000252034:G162C	G	+	1	0	ELN	73097502	0.999000	0.42202	0.984000	0.44739	0.877000	0.50540	4.954000	0.63631	2.103000	0.63969	0.467000	0.42956	GGT	G|1.000;A|0.000	.		0.657	ELN-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000316913.1	NM_000501	
ZBTB39	9880	hgsc.bcm.edu	37	12	57397205	57397205	+	Silent	SNP	C	C	T			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr12:57397205C>T	ENST00000300101.2	-	2	1582	c.1497G>A	c.(1495-1497)acG>acA	p.T499T		NM_014830.2	NP_055645.1	O15060	ZBT39_HUMAN	zinc finger and BTB domain containing 39	499					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(3)|liver(1)|lung(3)|prostate(1)	16						GATGGGACAGCGTGTGCCACA	0.557																																					p.T499T		.	.											.	ZBTB39	.	.	0			c.G1497A						.						62.0	52.0	56.0					12																	57397205		2203	4300	6503	SO:0001819	synonymous_variant	9880	exon2			GGACAGCGTGTGC	AB002350	CCDS31839.1	12q13.3	2013-01-09				ENSG00000166860		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	29014	protein-coding gene	gene with protein product						9205841	Standard	NM_014830		Approved	KIAA0352, ZNF922	uc001sml.2	O15060		ENST00000300101.2:c.1497G>A	12.37:g.57397205C>T		63.0	0.0		63.0	14.0	NM_014830	A7MD38|Q9UD98	Silent	SNP	ENST00000300101.2	37	CCDS31839.1																																																																																			.	.		0.557	ZBTB39-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411214.1	NM_014830	
COL14A1	7373	hgsc.bcm.edu	37	8	121326235	121326235	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr8:121326235G>A	ENST00000297848.3	+	38	4790	c.4520G>A	c.(4519-4521)gGa>gAa	p.G1507E	COL14A1_ENST00000309791.4_Missense_Mutation_p.G1507E|COL14A1_ENST00000247781.3_Missense_Mutation_p.G1412E	NM_021110.1	NP_066933.1			collagen, type XIV, alpha 1											NS(1)|autonomic_ganglia(1)|breast(11)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(9)|large_intestine(31)|lung(42)|ovary(5)|pancreas(1)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)	119	Lung NSC(37;6.52e-07)|Ovarian(258;0.00769)|Hepatocellular(40;0.161)		OV - Ovarian serous cystadenocarcinoma(1;6.47e-38)|STAD - Stomach adenocarcinoma(47;0.00503)			GGACCTCAAGGACCAAGTGGT	0.473																																					p.G1507E		.	.											.	COL14A1	.	.	0			c.G4520A						.						139.0	131.0	133.0					8																	121326235		2203	4300	6503	SO:0001583	missense	7373	exon38			CTCAAGGACCAAG		CCDS34938.1	8q23	2013-02-11	2008-02-04		ENSG00000187955	ENSG00000187955		"""Collagens"", ""Fibronectin type III domain containing"""	2191	protein-coding gene	gene with protein product		120324	"""undulin"""	UND		1716629, 9427527	Standard	NM_021110		Approved		uc003yox.4	Q05707	OTTHUMG00000149877	ENST00000297848.3:c.4520G>A	8.37:g.121326235G>A	ENSP00000297848:p.Gly1507Glu	263.0	1.0		204.0	86.0	NM_021110		Missense_Mutation	SNP	ENST00000297848.3	37	CCDS34938.1	.	.	.	.	.	.	.	.	.	.	G	28.4	4.920711	0.92249	.	.	ENSG00000187955	ENST00000309791;ENST00000297848;ENST00000247781	D;D;D	0.99353	-5.77;-5.77;-5.77	5.97	5.97	0.96955	.	0.000000	0.85682	D	0.000000	D	0.99616	0.9860	H	0.94542	3.55	0.80722	D	1	D	0.76494	0.999	D	0.79784	0.993	D	0.98147	1.0439	10	0.87932	D	0	.	19.1953	0.93686	0.0:0.0:1.0:0.0	.	1507	Q05707	COEA1_HUMAN	E	1507;1507;1412	ENSP00000311809:G1507E;ENSP00000297848:G1507E;ENSP00000247781:G1412E	ENSP00000247781:G1412E	G	+	2	0	COL14A1	121395416	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.536000	0.82023	2.834000	0.97654	0.650000	0.86243	GGA	.	.		0.473	COL14A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313657.2	NM_021110	
CDK12	51755	hgsc.bcm.edu	37	17	37687306	37687306	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr17:37687306C>T	ENST00000447079.4	+	14	4243	c.4210C>T	c.(4210-4212)Cgt>Tgt	p.R1404C	CDK12_ENST00000430627.2_Missense_Mutation_p.R1395C	NM_015083.1|NM_016507.2	NP_055898.1|NP_057591.2	Q9NYV4	CDK12_HUMAN	cyclin-dependent kinase 12	1404					mRNA processing (GO:0006397)|phosphorylation of RNA polymerase II C-terminal domain (GO:0070816)|protein autophosphorylation (GO:0046777)|regulation of MAP kinase activity (GO:0043405)|RNA splicing (GO:0008380)	cyclin K-CDK12 complex (GO:0002944)|nuclear cyclin-dependent protein kinase holoenzyme complex (GO:0019908)|nuclear speck (GO:0016607)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|cyclin binding (GO:0030332)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|protein kinase activity (GO:0004672)|RNA polymerase II carboxy-terminal domain kinase activity (GO:0008353)			NS(4)|breast(3)|endometrium(5)|kidney(4)|large_intestine(11)|lung(23)|ovary(11)|prostate(4)|skin(2)|urinary_tract(3)	70						CCAGGACCTCCGTTTTGCCAG	0.572			"""Mis, N, F"""		serous ovarian					TCGA Ovarian(9;0.13)																											p.R1404C		.	.		Rec	yes		17	17q12	51755	cyclin-dependent kinase 12		E	.	CDK12	.	.	0			c.C4210T						.						73.0	76.0	75.0					17																	37687306		2203	4300	6503	SO:0001583	missense	51755	exon14			GACCTCCGTTTTG	AF227198	CCDS11337.1, CCDS45666.1	17q12	2011-10-25	2009-12-16	2009-12-16	ENSG00000167258	ENSG00000167258		"""Cyclin-dependent kinases"""	24224	protein-coding gene	gene with protein product	"""CDC2 related protein kinase 7"""	615514	"""Cdc2-related kinase, arginine/serine-rich"""	CRKRS		10048485, 11683387, 19884882	Standard	XM_005257456		Approved	CRK7, CRKR, KIAA0904	uc010cvv.3	Q9NYV4	OTTHUMG00000133214	ENST00000447079.4:c.4210C>T	17.37:g.37687306C>T	ENSP00000398880:p.Arg1404Cys	138.0	0.0		112.0	14.0	NM_016507	A7E2B2|B4DYX4|B9EIQ6|O94978	Missense_Mutation	SNP	ENST00000447079.4	37	CCDS11337.1	.	.	.	.	.	.	.	.	.	.	C	13.60	2.286037	0.40394	.	.	ENSG00000167258	ENST00000430627;ENST00000447079	D;D	0.84298	-1.62;-1.83	5.34	5.34	0.76211	.	0.000000	0.49305	D	0.000145	D	0.88373	0.6419	L	0.38175	1.15	0.58432	D	0.999995	D;D	0.89917	1.0;1.0	D;D	0.85130	0.994;0.997	D	0.88897	0.3350	10	0.87932	D	0	-8.5279	13.7736	0.63039	0.1535:0.8465:0.0:0.0	.	1404;1395	Q9NYV4;Q9NYV4-2	CDK12_HUMAN;.	C	1395;1404	ENSP00000407720:R1395C;ENSP00000398880:R1404C	ENSP00000407720:R1395C	R	+	1	0	CDK12	34940832	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.412000	0.52679	2.775000	0.95449	0.650000	0.86243	CGT	.	.		0.572	CDK12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256941.4	NM_016507	
HSP90B1	7184	hgsc.bcm.edu	37	12	104341190	104341190	+	Missense_Mutation	SNP	A	A	T	rs5800607|rs201427769	byFrequency	TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr12:104341190A>T	ENST00000299767.5	+	17	2546	c.2364A>T	c.(2362-2364)gaA>gaT	p.E788D	C12orf73_ENST00000543740.2_5'Flank	NM_003299.2	NP_003290.1	P14625	ENPL_HUMAN	heat shock protein 90kDa beta (Grp94), member 1	788					actin rod assembly (GO:0031247)|activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|cellular response to ATP (GO:0071318)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|innate immune response (GO:0045087)|negative regulation of apoptotic process (GO:0043066)|protein folding (GO:0006457)|protein transport (GO:0015031)|regulation of phosphoprotein phosphatase activity (GO:0043666)|response to hypoxia (GO:0001666)|sequestering of calcium ion (GO:0051208)|toll-like receptor signaling pathway (GO:0002224)	cytosol (GO:0005829)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|midbody (GO:0030496)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|low-density lipoprotein particle receptor binding (GO:0050750)|protein phosphatase binding (GO:0019903)|RNA binding (GO:0003723)|virion binding (GO:0046790)			central_nervous_system(1)|kidney(5)|large_intestine(7)|lung(8)|ovary(2)|prostate(1)|skin(1)|urinary_tract(4)	29					Rifabutin(DB00615)	gaacagatgaagaagaagaaA	0.418																																					p.E788D		.	.											.	HSP90B1	.	.	0			c.A2364T						.						217.0	207.0	210.0					12																	104341190		2203	4300	6503	SO:0001583	missense	7184	exon17			AGATGAAGAAGAA	AY040226	CCDS9094.1	12q24.2-q24.3	2011-09-02	2006-02-24	2006-02-24		ENSG00000166598		"""Heat shock proteins / HSPC"""	12028	protein-coding gene	gene with protein product		191175	"""tumor rejection antigen (gp96) 1"""	TRA1		16269234	Standard	NM_003299		Approved	GP96, GRP94	uc001tkb.2	P14625	OTTHUMG00000170118	ENST00000299767.5:c.2364A>T	12.37:g.104341190A>T	ENSP00000299767:p.Glu788Asp	186.0	0.0		264.0	13.0	NM_003299	Q96A97	Missense_Mutation	SNP	ENST00000299767.5	37	CCDS9094.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	11.29|11.29	1.595812|1.595812	0.28445|0.28445	.|.	.|.	ENSG00000166598|ENSG00000166598	ENST00000299767;ENST00000421266|ENST00000550595	T|.	0.10099|.	2.91|.	4.76|4.76	-7.53|-7.53	0.01336|0.01336	.|.	1.243000|.	0.05329|.	N|.	0.527908|.	T|T	0.30727|0.30727	0.0774|0.0774	L|L	0.27053|0.27053	0.805|0.805	0.38952|0.38952	D|D	0.958377|0.958377	B|.	0.02656|.	0.0|.	B|.	0.01281|.	0.0|.	T|T	0.31998|0.31998	-0.9923|-0.9923	10|5	0.22109|.	T|.	0.4|.	.|.	2.0253|2.0253	0.03517|0.03517	0.2288:0.2713:0.0769:0.423|0.2288:0.2713:0.0769:0.423	.|.	788|.	P14625|.	ENPL_HUMAN|.	D|M	788;538|139	ENSP00000299767:E788D|.	ENSP00000299767:E788D|.	E|K	+|+	3|2	2|0	HSP90B1|HSP90B1	102865320|102865320	0.067000|0.067000	0.21026|0.21026	0.613000|0.613000	0.29037|0.29037	0.540000|0.540000	0.34992|0.34992	-1.814000|-1.814000	0.01723|0.01723	-1.394000|-1.394000	0.02077|0.02077	-0.336000|-0.336000	0.08194|0.08194	GAA|AAG	.	.		0.418	HSP90B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407349.1	NM_003299	
ADORA3	140	hgsc.bcm.edu	37	1	112042806	112042806	+	Silent	SNP	C	C	T			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr1:112042806C>T	ENST00000241356.4	-	2	1128	c.723G>A	c.(721-723)ctG>ctA	p.L241L	ADORA3_ENST00000369717.4_Intron|ADORA3_ENST00000486342.1_5'Flank|ADORA3_ENST00000369716.4_Intron	NM_000677.3	NP_000668.1	P33765	AA3R_HUMAN	adenosine A3 receptor	241					activation of adenylate cyclase activity (GO:0007190)|histamine secretion by mast cell (GO:0002553)|inflammatory response (GO:0006954)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of inflammatory response (GO:0050729)|positive regulation of leukocyte migration (GO:0002687)|positive regulation of mast cell degranulation (GO:0043306)|positive regulation of mucus secretion (GO:0070257)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|regulation of heart contraction (GO:0008016)|response to wounding (GO:0009611)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|mast cell granule (GO:0042629)|plasma membrane (GO:0005886)	G-protein coupled adenosine receptor activity (GO:0001609)			NS(1)|breast(2)|endometrium(1)|large_intestine(2)|lung(3)|ovary(2)|skin(1)	12		all_cancers(81;1.63e-06)|all_epithelial(167;5.01e-06)|all_lung(203;8.02e-05)|Lung NSC(277;0.000156)		all cancers(265;0.0185)|Colorectal(144;0.0186)|Lung(183;0.0238)|COAD - Colon adenocarcinoma(174;0.0644)|Epithelial(280;0.0872)|LUSC - Lung squamous cell carcinoma(189;0.134)	Adenosine(DB00640)|Aminophylline(DB01223)|Enprofylline(DB00824)	GCAGCCATGACAGAGCAAACA	0.448																																					p.L241L		.	.											.	ADORA3	.	.	0			c.G723A						.						120.0	116.0	118.0					1																	112042806		2203	4300	6503	SO:0001819	synonymous_variant	140	exon2			CCATGACAGAGCA	BC029831	CCDS838.1, CCDS839.1, CCDS41369.1	1p13.2	2014-09-17			ENSG00000121933	ENSG00000121933		"""GPCR / Class A : Adenosine receptors"", ""Immunoglobulin superfamily / V-set domain containing"""	268	protein-coding gene	gene with protein product		600445				7607699	Standard	NM_020683		Approved	AD026	uc001ebf.3	P33765	OTTHUMG00000011957	ENST00000241356.4:c.723G>A	1.37:g.112042806C>T		223.0	0.0		212.0	58.0	NM_000677	A2A3P4|Q6UWU0|Q9BYZ1	Silent	SNP	ENST00000241356.4	37	CCDS839.1																																																																																			.	.		0.448	ADORA3-010	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033065.1	NM_000677, NM_020683	
CCDC37	348807	hgsc.bcm.edu	37	3	126142435	126142435	+	Missense_Mutation	SNP	G	G	A	rs140223152|rs398102320|rs35657615|rs200815085	byFrequency	TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr3:126142435G>A	ENST00000352312.1	+	13	1333	c.1234G>A	c.(1234-1236)Gag>Aag	p.E412K	CCDC37_ENST00000505024.1_Missense_Mutation_p.E413K|CCDC37_ENST00000393425.1_Missense_Mutation_p.E413K	NM_182628.2	NP_872434.2	Q494V2	CCD37_HUMAN	coiled-coil domain containing 37	412				Missing (in Ref. 3; AAI01370/AAI01368). {ECO:0000305}.						NS(1)|autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(5)|ovary(1)|skin(3)	23				GBM - Glioblastoma multiforme(114;0.166)		CCAGGAGACGGAGAAGACCCT	0.612													G|||	1	0.000199681	0.0	0.0014	5008	,	,		17029	0.0		0.0	False		,,,				2504	0.0				p.E412K		.	.											.	CCDC37	.	.	0			c.G1234A						.						109.0	83.0	92.0					3																	126142435		2200	4257	6457	SO:0001583	missense	348807	exon13			GAGACGGAGAAGA	AK097402	CCDS3037.1	3q21.2	2014-07-31			ENSG00000163885	ENSG00000163885			26842	protein-coding gene	gene with protein product						23569216	Standard	NM_182628		Approved	FLJ40083, MIA1	uc003eiu.1	Q494V2	OTTHUMG00000162691	ENST00000352312.1:c.1234G>A	3.37:g.126142435G>A	ENSP00000344749:p.Glu412Lys	0.0	0.0		9.0	8.0	NM_182628	D3DNA8|Q494V1|Q494V4|Q8N838	Missense_Mutation	SNP	ENST00000352312.1	37	CCDS3037.1	.	.	.	.	.	.	.	.	.	.	G	22.5	4.295376	0.81025	.	.	ENSG00000163885	ENST00000352312;ENST00000393425;ENST00000505024	T;T;T	0.41400	1.0;1.0;1.0	4.93	4.93	0.64822	.	0.159668	0.53938	D	0.000054	T	0.66015	0.2747	M	0.83384	2.64	0.58432	D	0.999999	D;D	0.69078	0.997;0.996	D;P	0.66716	0.946;0.884	T	0.71137	-0.4680	10	0.56958	D	0.05	-35.5644	15.657	0.77144	0.0:0.0:1.0:0.0	.	413;412	Q494V2-2;Q494V2	.;CCD37_HUMAN	K	412;413;413	ENSP00000344749:E412K;ENSP00000377076:E413K;ENSP00000423046:E413K	ENSP00000344749:E412K	E	+	1	0	CCDC37	127625125	1.000000	0.71417	1.000000	0.80357	0.523000	0.34469	6.860000	0.75473	2.284000	0.76573	0.491000	0.48974	GAG	.	.		0.612	CCDC37-001	KNOWN	basic|appris_candidate|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000370099.4	NM_182628	
LAMB4	22798	hgsc.bcm.edu	37	7	107763585	107763585	+	Silent	SNP	A	A	G			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr7:107763585A>G	ENST00000388781.3	-	2	108	c.25T>C	c.(25-27)Ttg>Ctg	p.L9L	LAMB4_ENST00000388780.3_Silent_p.L9L|LAMB4_ENST00000418464.1_Silent_p.L9L|LAMB4_ENST00000414450.2_Silent_p.L9L|LAMB4_ENST00000205386.4_Silent_p.L9L	NM_007356.2	NP_031382.2	A4D0S4	LAMB4_HUMAN	laminin, beta 4	9					cell adhesion (GO:0007155)	basement membrane (GO:0005604)				NS(1)|breast(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(22)|lung(40)|ovary(4)|prostate(5)|skin(4)	97						CCAAGGTGCAAAAAAAGGGTC	0.308																																					p.L9L		.	.											.	LAMB4	.	.	0			c.T25C						.						100.0	103.0	102.0					7																	107763585		2203	4300	6503	SO:0001819	synonymous_variant	22798	exon2			GGTGCAAAAAAAG	AF028816	CCDS34732.1	7q31	2013-03-01			ENSG00000091128	ENSG00000091128		"""Laminins"""	6491	protein-coding gene	gene with protein product							Standard	NM_007356		Approved		uc010ljo.1	A4D0S4	OTTHUMG00000154874	ENST00000388781.3:c.25T>C	7.37:g.107763585A>G		146.0	0.0		146.0	60.0	NM_007356	A5PKU6|B2RTT3|B5MEB9|Q86TP7|Q86XN2|Q8NBX5	Silent	SNP	ENST00000388781.3	37	CCDS34732.1																																																																																			.	.		0.308	LAMB4-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337442.1	XM_209857	
CDK12	51755	hgsc.bcm.edu	37	17	37627327	37627327	+	Missense_Mutation	SNP	G	G	C			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr17:37627327G>C	ENST00000447079.4	+	2	1275	c.1242G>C	c.(1240-1242)aaG>aaC	p.K414N	CDK12_ENST00000430627.2_Missense_Mutation_p.K414N	NM_015083.1|NM_016507.2	NP_055898.1|NP_057591.2	Q9NYV4	CDK12_HUMAN	cyclin-dependent kinase 12	414					mRNA processing (GO:0006397)|phosphorylation of RNA polymerase II C-terminal domain (GO:0070816)|protein autophosphorylation (GO:0046777)|regulation of MAP kinase activity (GO:0043405)|RNA splicing (GO:0008380)	cyclin K-CDK12 complex (GO:0002944)|nuclear cyclin-dependent protein kinase holoenzyme complex (GO:0019908)|nuclear speck (GO:0016607)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|cyclin binding (GO:0030332)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|protein kinase activity (GO:0004672)|RNA polymerase II carboxy-terminal domain kinase activity (GO:0008353)			NS(4)|breast(3)|endometrium(5)|kidney(4)|large_intestine(11)|lung(23)|ovary(11)|prostate(4)|skin(2)|urinary_tract(3)	70						CTGCAGCAAAGATGGATGGAA	0.448			"""Mis, N, F"""		serous ovarian					TCGA Ovarian(9;0.13)																											p.K414N		.	.		Rec	yes		17	17q12	51755	cyclin-dependent kinase 12		E	.	CDK12	.	.	0			c.G1242C						.						55.0	55.0	55.0					17																	37627327		2203	4300	6503	SO:0001583	missense	51755	exon2			AGCAAAGATGGAT	AF227198	CCDS11337.1, CCDS45666.1	17q12	2011-10-25	2009-12-16	2009-12-16	ENSG00000167258	ENSG00000167258		"""Cyclin-dependent kinases"""	24224	protein-coding gene	gene with protein product	"""CDC2 related protein kinase 7"""	615514	"""Cdc2-related kinase, arginine/serine-rich"""	CRKRS		10048485, 11683387, 19884882	Standard	XM_005257456		Approved	CRK7, CRKR, KIAA0904	uc010cvv.3	Q9NYV4	OTTHUMG00000133214	ENST00000447079.4:c.1242G>C	17.37:g.37627327G>C	ENSP00000398880:p.Lys414Asn	119.0	0.0		174.0	26.0	NM_016507	A7E2B2|B4DYX4|B9EIQ6|O94978	Missense_Mutation	SNP	ENST00000447079.4	37	CCDS11337.1	.	.	.	.	.	.	.	.	.	.	G	12.67	2.009093	0.35415	.	.	ENSG00000167258	ENST00000430627;ENST00000447079	T;T	0.44083	0.93;0.93	6.16	3.97	0.46021	.	0.000000	0.52532	D	0.000068	T	0.45617	0.1351	L	0.27053	0.805	0.33757	D	0.621339	D;D;D	0.76494	0.999;0.999;0.999	P;D;D	0.68943	0.879;0.915;0.961	T	0.58020	-0.7710	10	0.56958	D	0.05	-14.1497	7.6919	0.28573	0.7771:0.0:0.2229:0.0	.	413;414;414	E7EUM9;Q9NYV4;Q9NYV4-2	.;CDK12_HUMAN;.	N	414	ENSP00000407720:K414N;ENSP00000398880:K414N	ENSP00000407720:K414N	K	+	3	2	CDK12	34880853	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	1.519000	0.35888	1.159000	0.42565	-0.247000	0.11927	AAG	.	.		0.448	CDK12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256941.4	NM_016507	
KLHL10	317719	hgsc.bcm.edu	37	17	40004434	40004434	+	Missense_Mutation	SNP	A	A	C			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr17:40004434A>C	ENST00000293303.4	+	5	1855	c.1702A>C	c.(1702-1704)Agc>Cgc	p.S568R	RP11-156E6.1_ENST00000560400.1_RNA	NM_152467.3	NP_689680.2	Q6JEL2	KLH10_HUMAN	kelch-like family member 10	568					cell morphogenesis (GO:0000902)|fertilization (GO:0009566)|homeostasis of number of cells within a tissue (GO:0048873)|male genitalia morphogenesis (GO:0048808)|male gonad development (GO:0008584)|protein ubiquitination (GO:0016567)|spermatid development (GO:0007286)	cytoplasm (GO:0005737)				breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(7)|ovary(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	26		Breast(137;0.000162)				CAGTGCTCTGAGCTGCTGTGT	0.448																																					p.S568R		.	.											.	KLHL10	.	.	0			c.A1702C						.						122.0	121.0	121.0					17																	40004434		2007	4186	6193	SO:0001583	missense	317719	exon5			GCTCTGAGCTGCT	AK057224	CCDS42340.1	17q21.2	2013-01-30	2013-01-30		ENSG00000161594	ENSG00000161594		"""Kelch-like"", ""BTB/POZ domain containing"""	18829	protein-coding gene	gene with protein product		608778	"""kelch-like 10 (Drosophila)"""				Standard	NM_152467		Approved	FLJ32662	uc010cxr.3	Q6JEL2	OTTHUMG00000152510	ENST00000293303.4:c.1702A>C	17.37:g.40004434A>C	ENSP00000293303:p.Ser568Arg	270.0	0.0		387.0	201.0	NM_152467	Q6NW28|Q96MC0	Missense_Mutation	SNP	ENST00000293303.4	37	CCDS42340.1	.	.	.	.	.	.	.	.	.	.	A	23.1	4.376683	0.82682	.	.	ENSG00000161594	ENST00000293303	T	0.68765	-0.35	6.17	6.17	0.99709	Galactose oxidase, beta-propeller (1);	0.037755	0.85682	N	0.000000	T	0.73768	0.3629	L	0.32530	0.975	0.58432	D	0.999999	D	0.89917	1.0	D	0.87578	0.998	T	0.71955	-0.4436	9	.	.	.	.	15.6462	0.77055	1.0:0.0:0.0:0.0	.	568	Q6JEL2	KLH10_HUMAN	R	568	ENSP00000293303:S568R	.	S	+	1	0	KLHL10	37257960	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.020000	0.76419	2.371000	0.80710	0.533000	0.62120	AGC	.	.		0.448	KLHL10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326535.1	NM_152467	
ANKRD6	22881	hgsc.bcm.edu	37	6	90333665	90333665	+	Missense_Mutation	SNP	T	T	G			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr6:90333665T>G	ENST00000522441.1	+	12	1748	c.1107T>G	c.(1105-1107)aaT>aaG	p.N369K	ANKRD6_ENST00000339746.4_Missense_Mutation_p.N369K|ANKRD6_ENST00000369408.5_Missense_Mutation_p.N334K|ANKRD6_ENST00000520793.1_Missense_Mutation_p.N310K|ANKRD6_ENST00000447838.2_Missense_Mutation_p.N369K|LYRM2_ENST00000520441.1_Intron	NM_001242811.1	NP_001229740.1	Q9Y2G4	ANKR6_HUMAN	ankyrin repeat domain 6	369					negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of JNK cascade (GO:0046330)|positive regulation of Wnt signaling pathway, planar cell polarity pathway (GO:2000096)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				NS(1)|endometrium(3)|large_intestine(7)|lung(3)|ovary(3)|pancreas(1)|prostate(1)|stomach(2)	21		all_cancers(76;1.22e-09)|Prostate(29;1.16e-10)|Acute lymphoblastic leukemia(125;1.49e-10)|all_hematologic(105;7.79e-07)|all_epithelial(107;1.83e-05)|Lung NSC(302;0.239)		BRCA - Breast invasive adenocarcinoma(108;0.0209)		ATGCTCATAATCACCCTAAAA	0.547																																					p.N369K		.	.											.	ANKRD6	.	.	0			c.T1107G						.						105.0	111.0	109.0					6																	90333665		2088	4227	6315	SO:0001583	missense	22881	exon12			TCATAATCACCCT	AB023174	CCDS47460.1, CCDS56441.1, CCDS56442.1, CCDS56443.1	6q14.2-q16.1	2013-03-20			ENSG00000135299	ENSG00000135299		"""Ankyrin repeat domain containing"""	17280	protein-coding gene	gene with protein product		610583					Standard	NM_001242809		Approved	KIAA0957	uc003pni.4	Q9Y2G4	OTTHUMG00000015202	ENST00000522441.1:c.1107T>G	6.37:g.90333665T>G	ENSP00000430985:p.Asn369Lys	226.0	0.0		175.0	19.0	NM_001242809	B3KUC3|Q5JUJ4|Q5JUJ5|Q8IUQ8|Q9NU24|Q9UFQ9	Missense_Mutation	SNP	ENST00000522441.1	37	CCDS56441.1	.	.	.	.	.	.	.	.	.	.	T	10.01	1.233653	0.22626	.	.	ENSG00000135299	ENST00000369408;ENST00000339746;ENST00000447838;ENST00000522441;ENST00000518150;ENST00000520793	T;T;T;T;T	0.68025	1.18;1.22;1.21;1.22;-0.3	6.02	-2.04	0.07343	.	0.919996	0.09193	N	0.835739	T	0.31263	0.0791	N	0.24115	0.695	0.34961	D	0.7522	B;B;B;B	0.26845	0.1;0.025;0.161;0.032	B;B;B;B	0.24394	0.024;0.02;0.053;0.013	T	0.07829	-1.0752	10	0.44086	T	0.13	0.5272	11.0166	0.47693	0.0:0.5636:0.0:0.4364	.	310;369;334;369	B3KUC3;Q9Y2G4;Q9Y2G4-1;C9JJE8	.;ANKR6_HUMAN;.;.	K	334;369;369;369;110;310	ENSP00000358416:N334K;ENSP00000345767:N369K;ENSP00000396771:N369K;ENSP00000430985:N369K;ENSP00000429782:N310K	ENSP00000345767:N369K	N	+	3	2	ANKRD6	90390386	0.005000	0.15991	0.028000	0.17463	0.778000	0.44026	-0.070000	0.11523	-0.320000	0.08640	-0.250000	0.11733	AAT	.	.		0.547	ANKRD6-006	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000376594.1		
MYPN	84665	hgsc.bcm.edu	37	10	69881741	69881741	+	Missense_Mutation	SNP	G	G	T			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr10:69881741G>T	ENST00000358913.5	+	2	1034	c.546G>T	c.(544-546)aaG>aaT	p.K182N	MYPN_ENST00000354393.2_Intron|MYPN_ENST00000373675.3_Missense_Mutation_p.K182N|MYPN_ENST00000540630.1_Missense_Mutation_p.K182N	NM_001256267.1|NM_032578.3	NP_001243196.1|NP_115967.2	Q86TC9	MYPN_HUMAN	myopalladin	182	Interaction with CARP.				sarcomere organization (GO:0045214)	I band (GO:0031674)|nucleus (GO:0005634)|Z disc (GO:0030018)	cytoskeletal protein binding (GO:0008092)|muscle alpha-actinin binding (GO:0051371)|SH3 domain binding (GO:0017124)			breast(2)|central_nervous_system(1)|endometrium(13)|kidney(6)|large_intestine(13)|liver(1)|lung(43)|ovary(3)|prostate(1)|skin(6)|upper_aerodigestive_tract(5)	94						AAAACCACAAGAGTAAACTGG	0.418																																					p.K182N		.	.											.	MYPN	.	.	0			c.G546T						.						47.0	48.0	48.0					10																	69881741		2203	4300	6503	SO:0001583	missense	84665	exon2			CCACAAGAGTAAA	AL834247	CCDS7275.1, CCDS73142.1	10q22.1	2014-09-17			ENSG00000138347	ENSG00000138347		"""Immunoglobulin superfamily / I-set domain containing"""	23246	protein-coding gene	gene with protein product	"""sarcomeric protein myopalladin, 145 kDa"""	608517				11309420, 12482578	Standard	NM_032578		Approved	MYOP	uc001jnm.5	Q86TC9	OTTHUMG00000018344	ENST00000358913.5:c.546G>T	10.37:g.69881741G>T	ENSP00000351790:p.Lys182Asn	111.0	0.0		85.0	22.0	NM_032578	Q5VV35|Q5VV36|Q86T37|Q8N3L4|Q96K90|Q96KF5	Missense_Mutation	SNP	ENST00000358913.5	37	CCDS7275.1	.	.	.	.	.	.	.	.	.	.	G	14.91	2.675451	0.47781	.	.	ENSG00000138347	ENST00000358913;ENST00000540630;ENST00000373675	T;T;T	0.63417	-0.04;-0.04;-0.04	5.91	5.0	0.66597	.	0.099314	0.64402	D	0.000002	T	0.57533	0.2060	L	0.51422	1.61	0.37573	D	0.919524	P;P	0.41848	0.763;0.501	B;B	0.41894	0.369;0.203	T	0.61412	-0.7068	9	.	.	.	.	12.7089	0.57078	0.1294:0.0:0.8706:0.0	.	182;182	Q86TC9-3;Q86TC9	.;MYPN_HUMAN	N	182	ENSP00000351790:K182N;ENSP00000441668:K182N;ENSP00000362779:K182N	.	K	+	3	2	MYPN	69551747	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.702000	0.47102	2.791000	0.96007	0.655000	0.94253	AAG	.	.		0.418	MYPN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048307.1	NM_032578	
NXPH1	30010	hgsc.bcm.edu	37	7	8791057	8791057	+	Silent	SNP	T	T	A			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr7:8791057T>A	ENST00000405863.1	+	3	1385	c.474T>A	c.(472-474)acT>acA	p.T158T	NXPH1_ENST00000497400.1_3'UTR|NXPH1_ENST00000602349.1_Silent_p.T41T	NM_152745.2	NP_689958.1	P58417	NXPH1_HUMAN	neurexophilin 1	158	III.					extracellular region (GO:0005576)				breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(4)|lung(7)|ovary(1)	17		Ovarian(82;0.0628)		UCEC - Uterine corpus endometrioid carcinoma (126;0.101)		ATAATTCAACTGGTCAAGGGA	0.398																																					p.T158T		.	.											.	NXPH1	.	.	0			c.T474A						.						83.0	83.0	83.0					7																	8791057		1877	4116	5993	SO:0001819	synonymous_variant	30010	exon3			TTCAACTGGTCAA	AB047362	CCDS47540.1	7p22	2003-03-20			ENSG00000122584	ENSG00000122584			20693	protein-coding gene	gene with protein product		604639				9570794	Standard	NM_152745		Approved		uc003srv.3	P58417	OTTHUMG00000151941	ENST00000405863.1:c.474T>A	7.37:g.8791057T>A		128.0	0.0		144.0	42.0	NM_152745	Q8NB31	Silent	SNP	ENST00000405863.1	37	CCDS47540.1																																																																																			.	.		0.398	NXPH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324591.1	NM_152745	
PANK4	55229	hgsc.bcm.edu	37	1	2452651	2452651	+	Missense_Mutation	SNP	C	C	G			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr1:2452651C>G	ENST00000378466.3	-	3	323	c.311G>C	c.(310-312)tGc>tCc	p.C104S	PANK4_ENST00000435556.3_Missense_Mutation_p.C104S|PANK4_ENST00000491212.1_5'Flank	NM_018216.1	NP_060686.1	Q9NVE7	PANK4_HUMAN	pantothenate kinase 4	104					coenzyme A biosynthetic process (GO:0015937)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|pantothenate kinase activity (GO:0004594)			breast(2)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(4)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(4)	23	all_cancers(77;0.000158)|all_epithelial(69;8.01e-05)|all_lung(157;0.0212)|Lung NSC(156;0.0376)|Ovarian(185;0.0634)	all_epithelial(116;3.18e-20)|all_lung(118;1.67e-08)|Lung NSC(185;2.69e-06)|Breast(487;0.00147)|Renal(390;0.00183)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.0847)|Medulloblastoma(700;0.123)		Epithelial(90;1.54e-37)|OV - Ovarian serous cystadenocarcinoma(86;6.95e-23)|GBM - Glioblastoma multiforme(42;2.81e-08)|Colorectal(212;4.25e-05)|COAD - Colon adenocarcinoma(227;0.000196)|Kidney(185;0.000342)|BRCA - Breast invasive adenocarcinoma(365;0.00445)|KIRC - Kidney renal clear cell carcinoma(229;0.00549)|STAD - Stomach adenocarcinoma(132;0.00644)|Lung(427;0.201)		GAAGTCCAGGCAGGCTTCGAT	0.498																																					p.C104S		.	.											.	PANK4	.	.	0			c.G311C						.						149.0	148.0	148.0					1																	2452651		2203	4300	6503	SO:0001583	missense	55229	exon3			TCCAGGCAGGCTT	AK001644	CCDS42.1	1p36.32	2008-02-05			ENSG00000157881	ENSG00000157881			19366	protein-coding gene	gene with protein product		606162				11479594	Standard	XR_241034		Approved	FLJ10782	uc001ajm.1	Q9NVE7	OTTHUMG00000000791	ENST00000378466.3:c.311G>C	1.37:g.2452651C>G	ENSP00000367727:p.Cys104Ser	299.0	0.0		312.0	54.0	NM_018216	B9DI84|Q53EU3|Q5TA84|Q7RTX3|Q9H3X5	Missense_Mutation	SNP	ENST00000378466.3	37	CCDS42.1	.	.	.	.	.	.	.	.	.	.	C	26.6	4.755702	0.89843	.	.	ENSG00000157881	ENST00000378466;ENST00000435556	D;D	0.99541	-6.12;-4.21	4.74	4.74	0.60224	.	0.057435	0.64402	D	0.000001	D	0.99351	0.9772	M	0.76838	2.35	0.80722	D	1	P;P	0.46277	0.875;0.875	P;P	0.51895	0.683;0.683	D	0.98829	1.0750	10	0.54805	T	0.06	-35.3018	16.6921	0.85324	0.0:1.0:0.0:0.0	.	104;104	E9PHT6;Q9NVE7	.;PANK4_HUMAN	S	104	ENSP00000367727:C104S;ENSP00000421433:C104S	ENSP00000367727:C104S	C	-	2	0	PANK4	2442511	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.132000	0.77251	2.177000	0.69029	0.462000	0.41574	TGC	.	.		0.498	PANK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000002082.1		
ESCO1	114799	hgsc.bcm.edu	37	18	19112484	19112484	+	Silent	SNP	G	G	A			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr18:19112484G>A	ENST00000269214.5	-	11	3262	c.2325C>T	c.(2323-2325)ttC>ttT	p.F775F		NM_052911.2	NP_443143.2	Q5FWF5	ESCO1_HUMAN	establishment of sister chromatid cohesion N-acetyltransferase 1	775					mitotic cell cycle (GO:0000278)|post-translational protein acetylation (GO:0034421)|regulation of DNA replication (GO:0006275)|sister chromatid cohesion (GO:0007062)	chromatin (GO:0000785)|nucleoplasm (GO:0005654)	metal ion binding (GO:0046872)|transferase activity, transferring acyl groups (GO:0016746)			breast(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(11)|lung(10)|prostate(3)|upper_aerodigestive_tract(1)	35						GCATCATGCTGAATACCCATA	0.413																																					p.F775F		.	.											.	ESCO1	.	.	0			c.C2325T						.						154.0	144.0	148.0					18																	19112484		2203	4300	6503	SO:0001819	synonymous_variant	114799	exon11			CATGCTGAATACC	AL832041	CCDS32800.1	18q11.2	2013-05-02	2013-05-02		ENSG00000141446	ENSG00000141446			24645	protein-coding gene	gene with protein product		609674	"""establishment of cohesion 1 homolog 1 (S. cerevisiae)"""			11572484, 14576321, 15958495	Standard	NM_052911		Approved	ESO1, EFO1, KIAA1911	uc002kth.1	Q5FWF5		ENST00000269214.5:c.2325C>T	18.37:g.19112484G>A		285.0	0.0		229.0	155.0	NM_052911	B0YJ11|B0YJ12|Q69YG4|Q69YS3|Q6IMD7|Q8N3Z5|Q8NBG2|Q96PX7	Silent	SNP	ENST00000269214.5	37	CCDS32800.1																																																																																			.	.		0.413	ESCO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443942.1	NM_052911	
GPSM2	29899	hgsc.bcm.edu	37	1	109465168	109465168	+	Missense_Mutation	SNP	T	T	A	rs374875864|rs35029887|rs201481482	byFrequency	TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr1:109465168T>A	ENST00000406462.2	+	14	2343	c.1570T>A	c.(1570-1572)Tct>Act	p.S524T	AKNAD1_ENST00000357393.4_Intron|GPSM2_ENST00000264126.3_Missense_Mutation_p.S524T			P81274	GPSM2_HUMAN	G-protein signaling modulator 2	524					establishment of mitotic spindle orientation (GO:0000132)|G-protein coupled receptor signaling pathway (GO:0007186)|lung epithelial cell differentiation (GO:0060487)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	GTPase regulator activity (GO:0030695)|identical protein binding (GO:0042802)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|liver(2)|lung(3)	14		all_epithelial(167;7.64e-05)|all_lung(203;0.000321)|Lung NSC(277;0.000626)		Colorectal(144;0.0353)|Lung(183;0.0984)|COAD - Colon adenocarcinoma(174;0.129)|Epithelial(280;0.175)|all cancers(265;0.209)		AACAACAACTTCTTCCACTCC	0.373																																					p.S524T		.	.											.	GPSM2	.	.	0			c.T1570A						.						79.0	117.0	104.0					1																	109465168		2190	4293	6483	SO:0001583	missense	29899	exon13			ACAACTTCTTCCA	AY136740	CCDS792.2	1p13.3	2013-10-11	2010-06-24		ENSG00000121957	ENSG00000121957		"""Tetratricopeptide (TTC) repeat domain containing"""	29501	protein-coding gene	gene with protein product		609245	"""G-protein signalling modulator 2 (AGS3-like, C. elegans)"", ""deafness, autosomal recessive 82"""	DFNB82		11832491, 8973305, 19888295, 20602914, 21348867	Standard	NM_013296		Approved	LGN, Pins	uc010ovc.2	P81274	OTTHUMG00000011730	ENST00000406462.2:c.1570T>A	1.37:g.109465168T>A	ENSP00000385510:p.Ser524Thr	5.0	0.0		62.0	20.0	NM_013296	Q5T1N8|Q6IBL7|Q8N0Z5	Missense_Mutation	SNP	ENST00000406462.2	37	CCDS792.2	.	.	.	.	.	.	.	.	.	.	T	7.387	0.629929	0.14257	.	.	ENSG00000121957	ENST00000406462;ENST00000264126	D;D	0.93712	-3.27;-3.27	6.17	-6.6	0.01824	.	0.546439	0.21807	N	0.068824	T	0.62563	0.2438	N	0.08118	0	0.09310	N	0.999996	B	0.11235	0.004	B	0.06405	0.002	T	0.64601	-0.6369	10	0.15499	T	0.54	-3.6969	9.2309	0.37437	0.0:0.2789:0.4599:0.2613	.	524	P81274	GPSM2_HUMAN	T	524	ENSP00000385510:S524T;ENSP00000264126:S524T	ENSP00000264126:S524T	S	+	1	0	GPSM2	109266691	0.001000	0.12720	0.000000	0.03702	0.001000	0.01503	-0.350000	0.07721	-1.555000	0.01697	-0.250000	0.11733	TCT	.	.		0.373	GPSM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032400.3	NM_013296	
DNAH2	146754	hgsc.bcm.edu	37	17	7701533	7701533	+	Silent	SNP	C	C	T			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr17:7701533C>T	ENST00000572933.1	+	54	9749	c.8289C>T	c.(8287-8289)atC>atT	p.I2763I	DNAH2_ENST00000389173.2_Silent_p.I2763I			Q9P225	DYH2_HUMAN	dynein, axonemal, heavy chain 2	2763	AAA 4. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(3)|breast(11)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(16)|large_intestine(53)|liver(2)|lung(49)|ovary(7)|prostate(7)|skin(15)|upper_aerodigestive_tract(1)|urinary_tract(1)	189		all_cancers(10;4.66e-07)|Prostate(122;0.081)				TGGTGGGTATCGGGGGCAGCG	0.607																																					p.I2763I		.	.											.	DNAH2	.	.	0			c.C8289T						.						64.0	64.0	64.0					17																	7701533		2203	4300	6503	SO:0001819	synonymous_variant	146754	exon53			GGGTATCGGGGGC	U83570, AK128517	CCDS32551.1	17p13.1	2007-10-05	2006-09-04			ENSG00000183914		"""Axonemal dyneins"""	2948	protein-coding gene	gene with protein product		603333	"""dynein, axonemal, heavy polypeptide 2"", ""dynein heavy chain domain 3"""	DNHD3		9256245	Standard	XM_005256470		Approved	KIAA1503, FLJ46675	uc002giu.1	Q9P225		ENST00000572933.1:c.8289C>T	17.37:g.7701533C>T		86.0	0.0		46.0	30.0	NM_020877	A8K992|B5MDX5|O15434|Q6PIH3|Q6ZR42	Silent	SNP	ENST00000572933.1	37	CCDS32551.1																																																																																			.	.		0.607	DNAH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440241.1	NM_020877	
GLI2	2736	hgsc.bcm.edu	37	2	121726367	121726367	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr2:121726367G>A	ENST00000452319.1	+	6	781	c.721G>A	c.(721-723)Gcc>Acc	p.A241T	GLI2_ENST00000435313.2_3'UTR|GLI2_ENST00000314490.11_5'UTR|GLI2_ENST00000361492.4_Missense_Mutation_p.A241T					GLI family zinc finger 2											NS(1)|breast(3)|central_nervous_system(4)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(7)|lung(24)|ovary(8)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	64	Renal(3;0.0496)	Prostate(154;0.0623)				ACTCTCAGACGCCAGCCTGGA	0.647																																					p.A241T		.	.											.	GLI2	.	.	0			c.G721A						.						80.0	73.0	76.0					2																	121726367		2203	4300	6503	SO:0001583	missense	2736	exon5			TCAGACGCCAGCC		CCDS33283.1	2q14	2013-01-25	2009-03-05		ENSG00000074047	ENSG00000074047		"""Zinc fingers, C2H2-type"""	4318	protein-coding gene	gene with protein product	"""tax-responsive element-2 holding protein"", ""tax helper protein 1"", ""tax helper protein 2"""	165230	"""GLI-Kruppel family member GLI2"", ""glioma-associated oncogene family zinc finger 2"""			2850480, 9557682	Standard	NM_005270		Approved	THP2, HPE9, THP1	uc010flp.3	P10070	OTTHUMG00000153741	ENST00000452319.1:c.721G>A	2.37:g.121726367G>A	ENSP00000390436:p.Ala241Thr	132.0	0.0		94.0	14.0	NM_005270		Missense_Mutation	SNP	ENST00000452319.1	37	CCDS33283.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	34|34	5.404358|5.404358	0.96051|0.96051	.|.	.|.	ENSG00000074047|ENSG00000074047	ENST00000452319;ENST00000361492|ENST00000440937;ENST00000360874	T;T|.	0.71579|.	-0.58;-0.58|.	4.91|4.91	4.91|4.91	0.64330|0.64330	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.72724|0.72724	0.3496|0.3496	M|M	0.65975|0.65975	2.015|2.015	0.80722|0.80722	D|D	1|1	D;D|D	0.89917|0.69078	1.0;1.0|0.997	D;D|P	0.70935|0.53861	0.971;0.949|0.736	T|T	0.77172|0.77172	-0.2685|-0.2685	10|8	0.15066|0.87932	T|D	0.55|0	.|.	18.2868|18.2868	0.90117|0.90117	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	241;241|111	P10070;Q0VGA0|F5H4D9	GLI2_HUMAN;.|.	T|H	241|111;103	ENSP00000390436:A241T;ENSP00000354586:A241T|.	ENSP00000354586:A241T|ENSP00000441454:R103H	A|R	+|+	1|2	0|0	GLI2|GLI2	121442837|121442837	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.982000|0.982000	0.71751|0.71751	7.807000|7.807000	0.86032|0.86032	2.557000|2.557000	0.86248|0.86248	0.655000|0.655000	0.94253|0.94253	GCC|CGC	.	.		0.647	GLI2-009	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000332293.3	NM_005270	
BRD2	6046	hgsc.bcm.edu	37	6	32948467	32948467	+	Nonsense_Mutation	SNP	C	C	A			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr6:32948467C>A	ENST00000374825.4	+	13	4079	c.2378C>A	c.(2377-2379)tCa>tAa	p.S793*	BRD2_ENST00000443797.2_Nonsense_Mutation_p.S673*|BRD2_ENST00000395287.1_Nonsense_Mutation_p.S828*|BRD2_ENST00000395289.2_Nonsense_Mutation_p.S828*|BRD2_ENST00000374831.4_Nonsense_Mutation_p.S793*|BRD2_ENST00000449085.2_Nonsense_Mutation_p.S746*	NM_005104.3	NP_005095.1	P25440	BRD2_HUMAN	bromodomain containing 2	793	Poly-Ser.|Ser-rich.				chromatin modification (GO:0016568)|nucleosome assembly (GO:0006334)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|lysine-acetylated histone binding (GO:0070577)			central_nervous_system(3)|stomach(2)	5						TCGTCGTCTTCAGACACCAGT	0.597																																					p.S828X		.	.											.	BRD2	.	.	0			c.C2483A						.						102.0	88.0	93.0					6																	32948467		1510	2708	4218	SO:0001587	stop_gained	6046	exon13			CGTCTTCAGACAC	X96670	CCDS4762.1, CCDS56420.1, CCDS56421.1	6p21.3	2010-12-23	2002-01-14		ENSG00000204256	ENSG00000204256			1103	protein-coding gene	gene with protein product		601540	"""bromodomain-containing 2"""			1352711, 8781126	Standard	NM_005104		Approved	KIAA9001, RING3, D6S113E, NAT, FSRG1	uc021ywf.1	P25440	OTTHUMG00000031241	ENST00000374825.4:c.2378C>A	6.37:g.32948467C>A	ENSP00000363958:p.Ser793*	136.0	0.0		93.0	27.0	NM_001199455	A2AAU0|B0S7P0|B1AZT1|O00699|O00700|Q15310|Q5STC9|Q63HQ9|Q658Y7|Q6P3U2|Q969U4	Nonsense_Mutation	SNP	ENST00000374825.4	37	CCDS4762.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	52|52	19.282057|19.282057	0.99917|0.99917	.|.	.|.	ENSG00000204256|ENSG00000204256	ENST00000449025|ENST00000374825;ENST00000374831;ENST00000395289;ENST00000443797;ENST00000395287;ENST00000449085	.|.	.|.	.|.	6.15|6.15	6.15|6.15	0.99193|0.99193	.|.	.|0.000000	.|0.37012	.|N	.|0.002289	T|.	0.31734|.	0.0806|.	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.17198|.	-1.0377|.	4|.	.|0.06099	.|T	.|0.92	-13.3034|-13.3034	16.3388|16.3388	0.83075|0.83075	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|.	.|.	.|.	K|X	799|793;793;828;673;828;746	.|.	.|ENSP00000363958:S793X	Q|S	+|+	1|2	0|0	BRD2|BRD2	33056445|33056445	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.856000|0.856000	0.48823|0.48823	4.969000|4.969000	0.63735|0.63735	2.932000|2.932000	0.99384|0.99384	0.643000|0.643000	0.83706|0.83706	CAG|TCA	.	.		0.597	BRD2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000076503.2		
SENP6	26054	hgsc.bcm.edu	37	6	76386875	76386875	+	Missense_Mutation	SNP	C	C	G			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr6:76386875C>G	ENST00000447266.2	+	14	2229	c.1751C>G	c.(1750-1752)cCc>cGc	p.P584R	SENP6_ENST00000370014.3_Missense_Mutation_p.P584R|SENP6_ENST00000327284.8_Missense_Mutation_p.P577R|SENP6_ENST00000370010.2_Missense_Mutation_p.P577R|SENP6_ENST00000541192.1_Missense_Mutation_p.P180R	NM_015571.2	NP_056386.2	Q9GZR1	SENP6_HUMAN	SUMO1/sentrin specific peptidase 6	584					protein desumoylation (GO:0016926)|protein modification by small protein removal (GO:0070646)|protein sumoylation (GO:0016925)|regulation of kinetochore assembly (GO:0090234)|regulation of spindle assembly (GO:0090169)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	SUMO-specific protease activity (GO:0016929)			breast(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(2)|lung(12)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	27		all_hematologic(105;0.189)				GCGAAAATTCCCTTTGAAGAA	0.343																																					p.P584R		.	.											.	SENP6	.	.	0			c.C1751G						.						37.0	36.0	36.0					6																	76386875		1811	4070	5881	SO:0001583	missense	26054	exon14			AAATTCCCTTTGA		CCDS43483.1, CCDS47454.1	6q13-q14.3	2008-02-05	2005-08-17		ENSG00000112701	ENSG00000112701			20944	protein-coding gene	gene with protein product		605003	"""SUMO1/sentrin specific protease 6"""				Standard	NM_015571		Approved	SUSP1, KIAA0797	uc003pid.4	Q9GZR1	OTTHUMG00000015060	ENST00000447266.2:c.1751C>G	6.37:g.76386875C>G	ENSP00000402527:p.Pro584Arg	399.0	1.0		514.0	165.0	NM_015571	A6NNY9|O94891|Q5VUL3|Q5VUL4|Q8TBY4|Q9UJV5	Missense_Mutation	SNP	ENST00000447266.2	37	CCDS47454.1	.	.	.	.	.	.	.	.	.	.	C	10.14	1.267921	0.23136	.	.	ENSG00000112701	ENST00000370010;ENST00000370014;ENST00000327284;ENST00000447266;ENST00000424947;ENST00000541192	T;T;T;T;T;T	0.32515	2.71;2.71;1.45;2.71;1.45;1.48	5.26	1.46	0.22682	.	0.751883	0.13601	N	0.375823	T	0.14485	0.0350	L	0.46157	1.445	0.20764	N	0.999852	B;B;P	0.43633	0.355;0.242;0.813	B;B;P	0.45071	0.279;0.144;0.468	T	0.11470	-1.0586	10	0.33141	T	0.24	0.3653	10.3264	0.43796	0.0:0.7303:0.0:0.2697	.	577;584;577	Q9GZR1-2;Q9GZR1;F8W6D9	.;SENP6_HUMAN;.	R	577;584;577;584;474;180	ENSP00000359027:P577R;ENSP00000359031:P584R;ENSP00000321820:P577R;ENSP00000402527:P584R;ENSP00000391426:P474R;ENSP00000441715:P180R	ENSP00000321820:P577R	P	+	2	0	SENP6	76443595	0.995000	0.38212	0.993000	0.49108	0.310000	0.27922	1.710000	0.37920	-0.015000	0.14150	-0.459000	0.05422	CCC	.	.		0.343	SENP6-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000041272.2	NM_015571	
PDLIM2	64236	hgsc.bcm.edu	37	8	22438952	22438952	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr8:22438952A>G	ENST00000397760.4	+	3	554	c.154A>G	c.(154-156)Atc>Gtc	p.I52V	PDLIM2_ENST00000397761.2_Missense_Mutation_p.I52V|PDLIM2_ENST00000409417.1_Missense_Mutation_p.I52V|PDLIM2_ENST00000409141.1_Missense_Mutation_p.I52V|PDLIM2_ENST00000339162.7_Missense_Mutation_p.I52V|PDLIM2_ENST00000308354.7_Missense_Mutation_p.I302V|PDLIM2_ENST00000265810.4_Missense_Mutation_p.I52V			Q96JY6	PDLI2_HUMAN	PDZ and LIM domain 2 (mystique)	52	PDZ. {ECO:0000255|PROSITE- ProRule:PRU00143}.					actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)			endometrium(2)|kidney(1)|large_intestine(2)|lung(3)|urinary_tract(1)	9		Prostate(55;0.0421)|Breast(100;0.102)|all_epithelial(46;0.142)		BRCA - Breast invasive adenocarcinoma(99;0.00579)|Colorectal(74;0.0152)|COAD - Colon adenocarcinoma(73;0.0626)		AATCGTGGCCATCAACGGGGA	0.672																																					p.I302V		.	.											.	PDLIM2	.	.	0			c.A904G						.						99.0	84.0	89.0					8																	22438952		2203	4300	6503	SO:0001583	missense	64236	exon3			GTGGCCATCAACG	AY007729	CCDS34860.1, CCDS6032.1, CCDS34861.1, CCDS6032.2	8p21.3	2012-06-27			ENSG00000120913	ENSG00000120913			13992	protein-coding gene	gene with protein product		609722					Standard	NM_021630		Approved		uc003xby.4	Q96JY6	OTTHUMG00000164270	ENST00000397760.4:c.154A>G	8.37:g.22438952A>G	ENSP00000380867:p.Ile52Val	261.0	0.0		82.0	25.0	NM_021630	D3DSR5|J3KNH4|Q7Z584|Q86WM8|Q8WZ29|Q9H4L9|Q9H7I2	Missense_Mutation	SNP	ENST00000397760.4	37		.	.	.	.	.	.	.	.	.	.	A	18.80	3.700131	0.68501	.	.	ENSG00000120913	ENST00000456545;ENST00000308354;ENST00000452226;ENST00000397760;ENST00000339162;ENST00000381194;ENST00000397761;ENST00000436754;ENST00000426493;ENST00000429812;ENST00000409141;ENST00000265810;ENST00000409417	T;T;T;T;T;T;T;T;T;T;T;T	0.26373	1.74;1.74;1.74;1.74;1.74;1.74;1.74;1.74;1.74;1.74;1.74;1.74	4.99	4.99	0.66335	PDZ/DHR/GLGF (4);	0.133176	0.48286	D	0.000191	T	0.37758	0.1015	L	0.31207	0.915	0.46478	D	0.999061	D;D;D;D	0.63046	0.967;0.967;0.992;0.973	P;P;D;P	0.79108	0.718;0.718;0.992;0.815	T	0.23154	-1.0196	10	0.87932	D	0	-24.5238	12.2156	0.54404	1.0:0.0:0.0:0.0	.	52;52;52;52	Q96JY6-3;Q96JY6-4;Q96JY6;C9JS55	.;.;PDLI2_HUMAN;.	V	52;302;52;52;52;52;52;52;52;52;52;52;52	ENSP00000401992:I52V;ENSP00000312634:I302V;ENSP00000394376:I52V;ENSP00000380867:I52V;ENSP00000342035:I52V;ENSP00000380868:I52V;ENSP00000397738:I52V;ENSP00000392920:I52V;ENSP00000407643:I52V;ENSP00000386868:I52V;ENSP00000265810:I52V;ENSP00000387084:I52V	ENSP00000265810:I52V	I	+	1	0	PDLIM2	22494897	1.000000	0.71417	1.000000	0.80357	0.707000	0.40811	4.472000	0.60189	1.868000	0.54150	0.533000	0.62120	ATC	.	.		0.672	PDLIM2-202	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000334167.1		
KLHL11	55175	hgsc.bcm.edu	37	17	40010740	40010740	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr17:40010740C>T	ENST00000319121.3	-	2	1439	c.1379G>A	c.(1378-1380)gGa>gAa	p.G460E		NM_018143.1	NP_060613.1	Q9NVR0	KLH11_HUMAN	kelch-like family member 11	460										NS(2)|breast(2)|endometrium(1)|large_intestine(2)|lung(5)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	17		Breast(137;0.00156)				GTTGCCATGTCCTCCAATGCT	0.388																																					p.G460E		.	.											.	KLHL11	.	.	0			c.G1379A						.						123.0	126.0	125.0					17																	40010740		2203	4300	6503	SO:0001583	missense	55175	exon2			CCATGTCCTCCAA		CCDS11411.1	17q21	2013-01-30	2013-01-30		ENSG00000178502	ENSG00000178502		"""Kelch-like"", ""BTB/POZ domain containing"""	19008	protein-coding gene	gene with protein product			"""kelch-like 11 (Drosophila)"""				Standard	NM_018143		Approved	FLJ10572	uc002hyf.1	Q9NVR0	OTTHUMG00000133506	ENST00000319121.3:c.1379G>A	17.37:g.40010740C>T	ENSP00000314608:p.Gly460Glu	350.0	0.0		498.0	45.0	NM_018143		Missense_Mutation	SNP	ENST00000319121.3	37	CCDS11411.1	.	.	.	.	.	.	.	.	.	.	C	18.76	3.692021	0.68271	.	.	ENSG00000178502	ENST00000319121;ENST00000540254	D	0.99494	-6.01	4.73	4.73	0.59995	Galactose oxidase, beta-propeller (1);	0.000000	0.85682	D	0.000000	D	0.99739	0.9897	H	0.97214	3.96	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.97090	0.9790	10	0.87932	D	0	9.2103	18.2506	0.90002	0.0:1.0:0.0:0.0	.	460	Q9NVR0	KLH11_HUMAN	E	460;323	ENSP00000314608:G460E	ENSP00000314608:G460E	G	-	2	0	KLHL11	37264266	1.000000	0.71417	0.995000	0.50966	0.991000	0.79684	7.185000	0.77714	2.606000	0.88127	0.585000	0.79938	GGA	.	.		0.388	KLHL11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257464.2	NM_018143	
BICD1	636	hgsc.bcm.edu	37	12	32490708	32490708	+	Missense_Mutation	SNP	A	A	T			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr12:32490708A>T	ENST00000281474.5	+	7	2631	c.2528A>T	c.(2527-2529)cAg>cTg	p.Q843L	BICD1_ENST00000548411.1_Intron	NM_001714.2	NP_001705.2	Q96G01	BICD1_HUMAN	bicaudal D homolog 1 (Drosophila)	843					anatomical structure morphogenesis (GO:0009653)|intracellular mRNA localization (GO:0008298)|microtubule anchoring at microtubule organizing center (GO:0072393)|minus-end-directed organelle transport along microtubule (GO:0072385)|negative regulation of phospholipase C activity (GO:1900275)|negative regulation of phospholipase C-activating G-protein coupled receptor signaling pathway (GO:1900737)|positive regulation of receptor-mediated endocytosis (GO:0048260)|protein localization to organelle (GO:0033365)|regulation of proteinase activated receptor activity (GO:1900276)|RNA processing (GO:0006396)|stress granule assembly (GO:0034063)|viral process (GO:0016032)	cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|host cell viral assembly compartment (GO:0072517)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|trans-Golgi network (GO:0005802)	cytoskeletal adaptor activity (GO:0008093)|dynactin binding (GO:0034452)|dynein binding (GO:0045502)|proteinase activated receptor binding (GO:0031871)|Rab GTPase binding (GO:0017137)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|breast(2)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(9)|lung(14)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	46	all_cancers(9;5.13e-11)|all_epithelial(9;2.71e-11)|all_lung(12;6.66e-10)|Acute lymphoblastic leukemia(23;0.0122)|Lung SC(12;0.0213)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.204)		OV - Ovarian serous cystadenocarcinoma(6;0.0201)			CAGGGCCCACAGACACCCAAC	0.512																																					p.Q843L		.	.											.	BICD1	.	.	0			c.A2528T						.						113.0	105.0	108.0					12																	32490708		2203	4300	6503	SO:0001583	missense	636	exon7			GCCCACAGACACC	U90028	CCDS8726.1, CCDS44859.1	12p11.2-p11.1	2005-01-13	2001-11-28			ENSG00000151746			1049	protein-coding gene	gene with protein product		602204	"""Bicaudal D (Drosophila) homolog 1"""			9367685	Standard	NM_001714		Approved		uc001rku.3	Q96G01	OTTHUMG00000169307	ENST00000281474.5:c.2528A>T	12.37:g.32490708A>T	ENSP00000281474:p.Gln843Leu	98.0	0.0		105.0	18.0	NM_001714	A8K2C3|F8W113|O43892|O43893	Missense_Mutation	SNP	ENST00000281474.5	37	CCDS8726.1	.	.	.	.	.	.	.	.	.	.	A	12.58	1.981936	0.34942	.	.	ENSG00000151746	ENST00000281474	T	0.46063	0.88	4.9	4.9	0.64082	.	0.454037	0.21742	N	0.069815	T	0.21631	0.0521	N	0.08118	0	0.80722	D	1	P	0.43477	0.808	B	0.36464	0.225	T	0.06570	-1.0819	9	.	.	.	.	13.2645	0.60125	1.0:0.0:0.0:0.0	.	843	Q96G01	BICD1_HUMAN	L	843	ENSP00000281474:Q843L	.	Q	+	2	0	BICD1	32381975	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	4.136000	0.58004	2.060000	0.61445	0.482000	0.46254	CAG	.	.		0.512	BICD1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403380.1	NM_001714	
ZEB2	9839	hgsc.bcm.edu	37	2	145187479	145187479	+	Missense_Mutation	SNP	G	G	C			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr2:145187479G>C	ENST00000558170.2	-	3	1372	c.188C>G	c.(187-189)gCt>gGt	p.A63G	ZEB2_ENST00000303660.4_Missense_Mutation_p.A63G|ZEB2_ENST00000409487.3_Missense_Mutation_p.A63G|ZEB2_ENST00000539609.3_Missense_Mutation_p.A63G	NM_014795.3	NP_055610.1	O60315	ZEB2_HUMAN	zinc finger E-box binding homeobox 2	63					cell proliferation in forebrain (GO:0021846)|developmental pigmentation (GO:0048066)|hippocampus development (GO:0021766)|melanocyte migration (GO:0097324)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|neural crest cell migration (GO:0001755)|neural tube closure (GO:0001843)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of melanin biosynthetic process (GO:0048023)|positive regulation of melanocyte differentiation (GO:0045636)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of melanosome organization (GO:1903056)|somitogenesis (GO:0001756)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|phosphatase regulator activity (GO:0019208)			breast(3)|central_nervous_system(1)|cervix(2)|endometrium(7)|kidney(6)|large_intestine(23)|lung(45)|ovary(5)|pancreas(2)|prostate(6)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	107				BRCA - Breast invasive adenocarcinoma(221;0.112)		GGGCACACTAGCTGGACTCGT	0.522																																					p.A63G	Melanoma(33;1235 1264 5755 16332)	.	.											.	ZEB2	.	.	0			c.C188G						.						142.0	116.0	125.0					2																	145187479		2203	4300	6503	SO:0001583	missense	9839	exon3			ACACTAGCTGGAC	AB011141	CCDS2186.1, CCDS54403.1	2q22.3	2013-01-08	2007-02-15	2007-02-15	ENSG00000169554	ENSG00000169554		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	14881	protein-coding gene	gene with protein product	"""SMAD interacting protein 1"""	605802	"""zinc finger homeobox 1b"""	ZFHX1B			Standard	NM_014795		Approved	KIAA0569, SIP-1, SIP1	uc002tvu.3	O60315	OTTHUMG00000131834	ENST00000558170.2:c.188C>G	2.37:g.145187479G>C	ENSP00000454157:p.Ala63Gly	282.0	0.0		252.0	97.0	NM_001171653	A0JP09|B7Z2P2|F5H814|Q9UED1	Missense_Mutation	SNP	ENST00000558170.2	37	CCDS2186.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	12.42|12.42	1.933168|1.933168	0.34096|0.34096	.|.	.|.	ENSG00000169554|ENSG00000169554	ENST00000392860;ENST00000539609;ENST00000303660;ENST00000409487;ENST00000427902;ENST00000392861;ENST00000409211;ENST00000435831;ENST00000444559|ENST00000419938;ENST00000431672;ENST00000440875	D;D;D;D;D;D;D;D|.	0.89270|.	-2.49;-2.49;-2.49;-2.49;-2.49;-2.49;-2.49;-2.49|.	5.7|5.7	1.98|1.98	0.26296|0.26296	.|.	0.053490|.	0.85682|.	D|.	0.000000|.	T|T	0.35335|0.35335	0.0928|0.0928	N|N	0.12746|0.12746	0.255|0.255	0.52501|0.52501	D|D	0.999953|0.999953	D;P;P;B;B|.	0.71674|.	0.998;0.489;0.923;0.093;0.093|.	D;B;P;B;B|.	0.65684|.	0.937;0.149;0.514;0.033;0.033|.	T|T	0.04281|0.04281	-1.0963|-1.0963	10|5	0.62326|.	D|.	0.03|.	-0.0034|-0.0034	10.1847|10.1847	0.42991|0.42991	0.2644:0.0:0.7356:0.0|0.2644:0.0:0.7356:0.0	.|.	63;63;63;63;63|.	F5H814;B7Z2P2;E7ESP8;A0JP08;O60315|.	.;.;.;.;ZEB2_HUMAN|.	G|V	58;63;63;63;63;63;63;63;63|39;53;50	ENSP00000443792:A63G;ENSP00000302501:A63G;ENSP00000386854:A63G;ENSP00000395496:A63G;ENSP00000376601:A63G;ENSP00000387256:A63G;ENSP00000400993:A63G;ENSP00000399451:A63G|.	ENSP00000302501:A63G|.	A|L	-|-	2|1	0|2	ZEB2|ZEB2	144903949|144903949	1.000000|1.000000	0.71417|0.71417	0.744000|0.744000	0.31058|0.31058	0.321000|0.321000	0.28281|0.28281	3.555000|3.555000	0.53727|0.53727	0.092000|0.092000	0.17331|0.17331	-0.781000|-0.781000	0.03364|0.03364	GCT|CTA	.	.		0.522	ZEB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254778.5	NM_014795	
MFF	56947	hgsc.bcm.edu	37	2	228220420	228220420	+	Silent	SNP	C	C	T			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr2:228220420C>T	ENST00000353339.3	+	10	1281	c.840C>T	c.(838-840)acC>acT	p.T280T	MFF_ENST00000349901.7_Silent_p.T176T|MFF_ENST00000524634.1_Silent_p.T27T|MFF_ENST00000476924.1_3'UTR|MFF_ENST00000409616.1_Silent_p.T176T|MFF_ENST00000354503.6_Silent_p.T156T|MFF_ENST00000304593.9_Silent_p.T229T|MFF_ENST00000392059.1_Silent_p.T280T|MFF_ENST00000409565.1_Silent_p.T156T|MFF_ENST00000337110.7_Silent_p.T181T	NM_001277061.1	NP_001263990.1	Q9GZY8	MFF_HUMAN	mitochondrial fission factor	280					mitochondrial fission (GO:0000266)|mitochondrial fragmentation involved in apoptotic process (GO:0043653)|mitochondrial fusion (GO:0008053)|mitochondrion morphogenesis (GO:0070584)|peroxisome fission (GO:0016559)|positive regulation of mitochondrial fission (GO:0090141)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|protein homooligomerization (GO:0051260)|protein targeting to mitochondrion (GO:0006626)|regulation of mitochondrion organization (GO:0010821)|regulation of peroxisome organization (GO:1900063)|release of cytochrome c from mitochondria (GO:0001836)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|integral component of mitochondrial membrane (GO:0032592)|mitochondrial outer membrane (GO:0005741)|peroxisome (GO:0005777)|synapse (GO:0045202)	protein homodimerization activity (GO:0042803)			breast(3)|endometrium(2)|kidney(3)|large_intestine(7)|lung(4)|stomach(2)	21						TAGATACAACCATTGAAGGAA	0.358																																					p.T280T		.	.											.	MFF	.	.	0			c.C840T						.						157.0	158.0	158.0					2																	228220420		2203	4300	6503	SO:0001819	synonymous_variant	56947	exon10			TACAACCATTGAA	AF258660	CCDS2465.1, CCDS63139.1, CCDS63140.1, CCDS63141.1, CCDS63142.1, CCDS74662.1	2q36	2008-05-29	2008-05-29	2008-05-29	ENSG00000168958	ENSG00000168958			24858	protein-coding gene	gene with protein product		614785	"""chromosome 2 open reading frame 33"""	C2orf33		18353969	Standard	NM_001277061		Approved	GL004	uc002voy.4	Q9GZY8	OTTHUMG00000133180	ENST00000353339.3:c.840C>T	2.37:g.228220420C>T		350.0	0.0		372.0	127.0	NM_020194	Q567U1|Q658R6|Q9BVZ1|Q9H690|Q9NRG8	Silent	SNP	ENST00000353339.3	37	CCDS2465.1																																																																																			.	.		0.358	MFF-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256887.2	NM_020194	
SHOX2	6474	hgsc.bcm.edu	37	3	157823590	157823590	+	Missense_Mutation	SNP	C	C	A			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr3:157823590C>A	ENST00000425436.3	-	1	249	c.224G>T	c.(223-225)gGa>gTa	p.G75V	SHOX2_ENST00000554685.1_5'UTR|SHOX2_ENST00000389589.4_Missense_Mutation_p.G75V|SHOX2_ENST00000441443.2_5'UTR|RSRC1_ENST00000480820.1_5'Flank|SHOX2_ENST00000490689.2_5'Flank|SHOX2_ENST00000483851.2_Missense_Mutation_p.G75V	NM_001163678.1|NM_006884.3	NP_001157150.1|NP_006875.2	O60902	SHOX2_HUMAN	short stature homeobox 2	75	Poly-Gly.				cardiac atrium morphogenesis (GO:0003209)|cartilage development involved in endochondral bone morphogenesis (GO:0060351)|chondrocyte development (GO:0002063)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic forelimb morphogenesis (GO:0035115)|embryonic skeletal joint morphogenesis (GO:0060272)|heart development (GO:0007507)|heart valve development (GO:0003170)|muscle tissue morphogenesis (GO:0060415)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|osteoblast differentiation (GO:0001649)|positive regulation of axonogenesis (GO:0050772)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of skeletal muscle fiber development (GO:0048743)|positive regulation of smoothened signaling pathway (GO:0045880)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of branching morphogenesis of a nerve (GO:2000172)|regulation of chondrocyte differentiation (GO:0032330)|skeletal system development (GO:0001501)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			NS(1)|breast(1)|endometrium(1)|large_intestine(1)|liver(2)|lung(10)|skin(3)|upper_aerodigestive_tract(1)	20			Lung(72;0.00318)|LUSC - Lung squamous cell carcinoma(72;0.0043)			tacacctcctccgcctcctcc	0.781																																					p.G75V		.	.											.	SHOX2	.	.	0			c.G224T						.						4.0	7.0	6.0					3																	157823590		1502	3313	4815	SO:0001583	missense	6474	exon1			CCTCCTCCGCCTC	AJ002368	CCDS33884.1, CCDS43164.1, CCDS33884.2, CCDS54664.1	3q25.32	2011-06-20			ENSG00000168779	ENSG00000168779		"""Homeoboxes / PRD class"""	10854	protein-coding gene	gene with protein product		602504				9482898, 9466998	Standard	NM_006884		Approved	SHOT, OG12X, OG12	uc003fbs.3	O60902	OTTHUMG00000158755	ENST00000425436.3:c.224G>T	3.37:g.157823590C>A	ENSP00000398704:p.Gly75Val	21.0	0.0		19.0	13.0	NM_003030	O60465|O60467|O60903	Missense_Mutation	SNP	ENST00000425436.3	37	CCDS43164.1	.	.	.	.	.	.	.	.	.	.	C	10.23	1.291661	0.23564	.	.	ENSG00000168779;ENSG00000168779;ENSG00000258518	ENST00000425436;ENST00000389589;ENST00000483851	D;D;D	0.95622	-3.76;-3.76;-3.76	2.23	1.32	0.21799	.	0.241563	0.26601	N	0.023468	D	0.93239	0.7846	N	0.14661	0.345	0.80722	D	1	B;D;D	0.89917	0.186;1.0;0.999	B;D;D	0.87578	0.033;0.998;0.972	D	0.89183	0.3545	10	0.29301	T	0.29	.	8.0787	0.30731	0.0:0.4998:0.5002:0.0	.	75;75;75	O60902-2;O60902-3;O60902	.;.;SHOX2_HUMAN	V	75	ENSP00000398704:G75V;ENSP00000374240:G75V;ENSP00000419362:G75V	ENSP00000374240:G75V	G	-	2	0	SHOX2;AC112502.1	159306284	0.595000	0.26857	1.000000	0.80357	0.995000	0.86356	-0.336000	0.07863	0.475000	0.27415	0.462000	0.41574	GGA	.	.		0.781	SHOX2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000352057.2		
SRL	6345	hgsc.bcm.edu	37	16	4242512	4242512	+	Missense_Mutation	SNP	T	T	A			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr16:4242512T>A	ENST00000399609.3	-	6	1076	c.1064A>T	c.(1063-1065)aAg>aTg	p.K355M	SRL_ENST00000537996.1_Missense_Mutation_p.K313M	NM_001098814.1	NP_001092284.1	Q86TD4	SRCA_HUMAN	sarcalumenin	814	Acidic domain, probably binds calcium. {ECO:0000250}.					sarcoplasmic reticulum (GO:0016529)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(8)|ovary(3)|skin(3)	21						CATTTTGTCCTTGTAAGTCTG	0.502																																					p.K355M		.	.											.	SRL	.	.	0			c.A1064T						.						113.0	118.0	116.0					16																	4242512		2086	4223	6309	SO:0001583	missense	6345	exon6			TTGTCCTTGTAAG	AK056588	CCDS42113.1	16p13.3	2008-02-05				ENSG00000185739			11295	protein-coding gene	gene with protein product		604992				2762314	Standard	NM_001098814		Approved		uc002cvz.4	Q86TD4		ENST00000399609.3:c.1064A>T	16.37:g.4242512T>A	ENSP00000382518:p.Lys355Met	233.0	0.0		263.0	44.0	NM_001098814		Missense_Mutation	SNP	ENST00000399609.3	37	CCDS42113.1	.	.	.	.	.	.	.	.	.	.	T	16.72	3.202141	0.58234	.	.	ENSG00000185739	ENST00000399609;ENST00000330063;ENST00000537996	T;T	0.33654	1.4;1.4	5.83	2.4	0.29515	.	0.000000	0.85682	U	0.000000	T	0.45975	0.1369	M	0.71581	2.175	0.53688	D	0.999979	P	0.52692	0.955	P	0.52758	0.708	T	0.31194	-0.9952	10	0.45353	T	0.12	-16.3634	9.35	0.38131	0.0:0.2682:0.0:0.7318	.	355	Q86TD4-2	.	M	355;813;313	ENSP00000382518:K355M;ENSP00000440350:K313M	ENSP00000333285:K813M	K	-	2	0	SRL	4182513	1.000000	0.71417	0.999000	0.59377	0.982000	0.71751	3.959000	0.56744	0.130000	0.18549	-0.274000	0.10170	AAG	.	.		0.502	SRL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438087.1	XM_064152	
ACACB	32	hgsc.bcm.edu	37	12	109617830	109617830	+	Nonsense_Mutation	SNP	C	C	T			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr12:109617830C>T	ENST00000338432.7	+	11	1875	c.1756C>T	c.(1756-1758)Cag>Tag	p.Q586*	ACACB_ENST00000377854.5_Nonsense_Mutation_p.Q586*|ACACB_ENST00000377848.3_Nonsense_Mutation_p.Q586*|ACACB_ENST00000543080.1_3'UTR			O00763	ACACB_HUMAN	acetyl-CoA carboxylase beta	586	ATP-grasp. {ECO:0000255|PROSITE- ProRule:PRU00409}.|Biotin carboxylation.				acetyl-CoA metabolic process (GO:0006084)|biotin metabolic process (GO:0006768)|carnitine shuttle (GO:0006853)|cellular lipid metabolic process (GO:0044255)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|malonyl-CoA biosynthetic process (GO:2001295)|positive regulation of cellular metabolic process (GO:0031325)|protein homotetramerization (GO:0051289)|response to drug (GO:0042493)|response to organic cyclic compound (GO:0014070)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	acetyl-CoA carboxylase activity (GO:0003989)|ATP binding (GO:0005524)|biotin binding (GO:0009374)|biotin carboxylase activity (GO:0004075)|metal ion binding (GO:0046872)			NS(1)|breast(2)|endometrium(9)|kidney(5)|large_intestine(20)|lung(40)|ovary(6)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95					Adenine(DB00173)|Biotin(DB00121)	TCCTCGCTTGCAGGTGGAACA	0.562																																					p.Q586X		.	.											.	ACACB	.	.	0			c.C1756T						.						105.0	91.0	96.0					12																	109617830		2203	4300	6503	SO:0001587	stop_gained	32	exon10			CGCTTGCAGGTGG	U89344	CCDS31898.1	12q24.1	2010-05-07	2010-04-30		ENSG00000076555	ENSG00000076555	6.4.1.2		85	protein-coding gene	gene with protein product	"""acetyl-CoA carboxylase 2"""	601557	"""acetyl-Coenzyme A carboxylase beta"""			8670171	Standard	NM_001093		Approved	HACC275, ACC2, ACCB	uc001toc.3	O00763	OTTHUMG00000169250	ENST00000338432.7:c.1756C>T	12.37:g.109617830C>T	ENSP00000341044:p.Gln586*	152.0	0.0		157.0	54.0	NM_001093	A6NK36|Q16852|Q1HEC1|Q6KE87|Q6KE89|Q6TY48	Nonsense_Mutation	SNP	ENST00000338432.7	37	CCDS31898.1	.	.	.	.	.	.	.	.	.	.	C	37	6.111445	0.97291	.	.	ENSG00000076555	ENST00000338432;ENST00000377848;ENST00000377854	.	.	.	4.89	3.98	0.46160	.	0.053750	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	14.3778	0.66889	0.1492:0.8508:0.0:0.0	.	.	.	.	X	586	.	ENSP00000341044:Q586X	Q	+	1	0	ACACB	108102213	1.000000	0.71417	0.998000	0.56505	0.969000	0.65631	7.710000	0.84655	1.026000	0.39733	0.655000	0.94253	CAG	.	.		0.562	ACACB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403077.1	NM_001093	
AHCYL1	10768	hgsc.bcm.edu	37	1	110561690	110561690	+	Missense_Mutation	SNP	G	G	C			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr1:110561690G>C	ENST00000369799.5	+	14	1702	c.1335G>C	c.(1333-1335)ttG>ttC	p.L445F	AHCYL1_ENST00000393614.4_Missense_Mutation_p.L398F|AHCYL1_ENST00000359172.3_Missense_Mutation_p.L398F	NM_001242673.1|NM_001242674.1|NM_006621.5	NP_001229602.1|NP_001229603.1|NP_006612.2	O43865	SAHH2_HUMAN	adenosylhomocysteinase-like 1	445	NAD binding. {ECO:0000250}.				mRNA polyadenylation (GO:0006378)|one-carbon metabolic process (GO:0006730)|positive regulation of sodium ion transport (GO:0010765)|protein export from nucleus (GO:0006611)|regulation of anion transport (GO:0044070)|regulation of ion transmembrane transporter activity (GO:0032412)|regulation of mRNA 3'-end processing (GO:0031440)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)	adenosylhomocysteinase activity (GO:0004013)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(6)|ovary(1)|prostate(2)	18		all_epithelial(167;3.58e-05)|all_lung(203;0.000116)|Lung NSC(277;0.000233)		Lung(183;0.0259)|Colorectal(144;0.123)|all cancers(265;0.134)|Epithelial(280;0.141)|LUSC - Lung squamous cell carcinoma(189;0.143)		TACTCAATTTGAGCTGCTCCA	0.502																																					p.L445F		.	.											.	AHCYL1	.	.	0			c.G1335C						.						150.0	129.0	136.0					1																	110561690		2203	4300	6503	SO:0001583	missense	10768	exon14			CAATTTGAGCTGC	U82761	CCDS818.1, CCDS55620.1	1p13	2014-06-12	2009-06-12		ENSG00000168710	ENSG00000168710			344	protein-coding gene	gene with protein product	"""inositol 1,4,5-trisphosphate receptor-binding protein"", ""protein phosphatase 1, regulatory subunit 78"""	607826	"""S-adenosylhomocysteine hydrolase-like 1"""			11904675, 16754674, 12525476	Standard	NM_006621		Approved	XPVKONA, IRBIT, PPP1R78	uc001dyx.3	O43865	OTTHUMG00000011652	ENST00000369799.5:c.1335G>C	1.37:g.110561690G>C	ENSP00000358814:p.Leu445Phe	176.0	0.0		154.0	71.0	NM_006621	B4E168|Q2TAJ6|Q502W8|Q5VSM0|Q6P171|Q96PK4|Q9UG84	Missense_Mutation	SNP	ENST00000369799.5	37	CCDS818.1	.	.	.	.	.	.	.	.	.	.	G	21.6	4.169422	0.78452	.	.	ENSG00000168710	ENST00000369799;ENST00000359172;ENST00000393614	D;D;D	0.82803	-1.65;-1.62;-1.62	5.95	5.95	0.96441	S-adenosyl-L-homocysteine hydrolase, NAD binding (1);	0.000000	0.85682	D	0.000000	D	0.90532	0.7033	H	0.96970	3.915	0.80722	D	1	P	0.44260	0.83	P	0.52710	0.707	D	0.92447	0.5967	10	0.87932	D	0	-27.4656	10.6537	0.45663	0.0691:0.1329:0.798:0.0	.	445	O43865	SAHH2_HUMAN	F	445;398;398	ENSP00000358814:L445F;ENSP00000352092:L398F;ENSP00000377238:L398F	ENSP00000352092:L398F	L	+	3	2	AHCYL1	110363213	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.098000	0.50259	2.824000	0.97209	0.655000	0.94253	TTG	.	.		0.502	AHCYL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032243.1		
TTC27	55622	hgsc.bcm.edu	37	2	33012108	33012108	+	Missense_Mutation	SNP	G	G	T			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr2:33012108G>T	ENST00000317907.4	+	16	2121	c.1890G>T	c.(1888-1890)caG>caT	p.Q630H		NM_001193509.1|NM_017735.4	NP_001180438.1|NP_060205.3	Q6P3X3	TTC27_HUMAN	tetratricopeptide repeat domain 27	630										breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(9)|lung(14)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	38						AACACTGGCAGATTTGGGAAA	0.378																																					p.Q630H		.	.											.	TTC27	.	.	0			c.G1890T						.						86.0	83.0	84.0					2																	33012108		2203	4300	6503	SO:0001583	missense	55622	exon16			CTGGCAGATTTGG	BC063791, AK000279	CCDS33176.1	2p22.3	2013-01-10			ENSG00000018699	ENSG00000018699		"""Tetratricopeptide (TTC) repeat domain containing"""	25986	protein-coding gene	gene with protein product							Standard	NM_001193509		Approved	FLJ20272	uc002rom.3	Q6P3X3	OTTHUMG00000152134	ENST00000317907.4:c.1890G>T	2.37:g.33012108G>T	ENSP00000313953:p.Gln630His	187.0	0.0		153.0	24.0	NM_017735	A6NKJ0|Q96SS5|Q9BVF1|Q9NWR4|Q9NXG4	Missense_Mutation	SNP	ENST00000317907.4	37	CCDS33176.1	.	.	.	.	.	.	.	.	.	.	G	13.65	2.301712	0.40694	.	.	ENSG00000018699	ENST00000317907	T	0.38077	1.16	4.94	-2.28	0.06826	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.000000	0.85682	D	0.000000	T	0.45498	0.1345	L	0.39898	1.24	0.47276	D	0.999376	D	0.89917	1.0	D	0.73380	0.98	T	0.36138	-0.9760	10	0.52906	T	0.07	-10.2774	14.2328	0.65906	0.3619:0.0:0.6381:0.0	.	630	Q6P3X3	TTC27_HUMAN	H	630	ENSP00000313953:Q630H	ENSP00000313953:Q630H	Q	+	3	2	TTC27	32865612	1.000000	0.71417	0.991000	0.47740	0.966000	0.64601	1.556000	0.36288	-0.364000	0.08088	-0.946000	0.02672	CAG	.	.		0.378	TTC27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325395.1	NM_017735	
PCDHGC3	5098	hgsc.bcm.edu	37	5	140855947	140855947	+	Silent	SNP	G	G	C			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr5:140855947G>C	ENST00000308177.3	+	1	368	c.264G>C	c.(262-264)gtG>gtC	p.V88V	PCDHGB2_ENST00000522605.1_Intron|PCDHGA10_ENST00000398610.2_Intron|PCDHGB7_ENST00000398594.2_Intron|PCDHGA11_ENST00000518882.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA9_ENST00000573521.1_Intron|PCDHGB6_ENST00000520790.1_Intron|PCDHGA12_ENST00000252085.3_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA11_ENST00000398587.2_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGB1_ENST00000523390.1_Intron|RN7SL68P_ENST00000488078.2_RNA	NM_002588.2|NM_032402.1	NP_002579.2|NP_115778.1	Q9UN70	PCDGK_HUMAN	protocadherin gamma subfamily C, 3	88	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(8)|lung(8)|ovary(2)|skin(2)|urinary_tract(1)	29			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AGATGTTTGTGAACGACCGTC	0.577																																					p.V88V		.	.											.	PCDHGC3	.	.	0			c.G264C						.						135.0	139.0	138.0					5																	140855947		2203	4300	6503	SO:0001819	synonymous_variant	5098	exon1			GTTTGTGAACGAC	AF152337	CCDS4261.1, CCDS75347.1, CCDS75348.1	5q31	2010-01-26			ENSG00000240184	ENSG00000240184		"""Cadherins / Protocadherins : Clustered"""	8716	other	protocadherin	"""cadherin-like 2"", ""protocadherin 2"", ""protocadherin 43"""	603627		PCDH2		9360932, 8508762	Standard	NM_032402		Approved	PC-43, PC43, PCDH-GAMMA-C3		Q9UN70	OTTHUMG00000129613	ENST00000308177.3:c.264G>C	5.37:g.140855947G>C		168.0	0.0		175.0	27.0	NM_032402	O60622|Q08192|Q9Y5C4	Silent	SNP	ENST00000308177.3	37	CCDS4261.1																																																																																			.	.		0.577	PCDHGC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251808.2	NM_002588	
KCNH2	3757	hgsc.bcm.edu	37	7	150671893	150671893	+	Silent	SNP	C	C	A	rs529607739		TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr7:150671893C>A	ENST00000262186.5	-	2	614	c.213G>T	c.(211-213)ggG>ggT	p.G71G	KCNH2_ENST00000430723.3_Silent_p.G71G	NM_000238.3	NP_000229.1	Q12809	KCNH2_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 2	71					cardiac muscle contraction (GO:0060048)|cellular response to drug (GO:0035690)|membrane depolarization during action potential (GO:0086010)|membrane repolarization during action potential (GO:0086011)|membrane repolarization during cardiac muscle cell action potential (GO:0086013)|negative regulation of potassium ion export (GO:1902303)|negative regulation of potassium ion transmembrane transport (GO:1901380)|positive regulation of potassium ion transmembrane transport (GO:1901381)|potassium ion export (GO:0071435)|potassium ion homeostasis (GO:0055075)|potassium ion transmembrane transport (GO:0071805)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of heart rate by hormone (GO:0003064)|regulation of membrane potential (GO:0042391)|regulation of membrane repolarization (GO:0060306)|regulation of potassium ion transmembrane transport (GO:1901379)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|synaptic transmission (GO:0007268)|ventricular cardiac muscle cell action potential (GO:0086005)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|nuclear envelope (GO:0005635)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|identical protein binding (GO:0042802)|inward rectifier potassium channel activity (GO:0005242)|phosphorelay sensor kinase activity (GO:0000155)|protein homodimerization activity (GO:0042803)|ubiquitin protein ligase binding (GO:0031625)|voltage-gated potassium channel activity (GO:0005249)|voltage-gated potassium channel activity involved in ventricular cardiac muscle cell action potential repolarization (GO:1902282)			NS(1)|cervix(1)|endometrium(10)|kidney(1)|large_intestine(5)|lung(14)|ovary(1)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)	42	all_neural(206;0.219)		OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)	Alfuzosin(DB00346)|Amiodarone(DB01118)|Amsacrine(DB00276)|Astemizole(DB00637)|Carvedilol(DB01136)|Chlorpromazine(DB00477)|Cisapride(DB00604)|Dofetilide(DB00204)|Doxazosin(DB00590)|Doxepin(DB01142)|Dronedarone(DB04855)|Halofantrine(DB01218)|Ibutilide(DB00308)|Imipramine(DB00458)|Miconazole(DB01110)|Pimozide(DB01100)|Prazosin(DB00457)|Propafenone(DB01182)|Quinidine(DB00908)|Sertindole(DB06144)|Sotalol(DB00489)|Terazosin(DB01162)|Thioridazine(DB00679)|Verapamil(DB00661)	GCGTGCGCGGCCCGTGCAGGA	0.672													C|||	1	0.000199681	0.0008	0.0	5008	,	,		8692	0.0		0.0	False		,,,				2504	0.0				p.G71G	GBM(137;110 1844 13671 20123 45161)	.	.											.	KCNH2	.	.	0			c.G213T						.						16.0	15.0	15.0					7																	150671893		2195	4289	6484	SO:0001819	synonymous_variant	3757	exon2			GCGCGGCCCGTGC	U04270	CCDS5910.1, CCDS5911.1	7q36.1	2014-09-17			ENSG00000055118	ENSG00000055118		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6251	protein-coding gene	gene with protein product		152427		LQT2		18616963, 7842012, 8159766, 16382104	Standard	NM_000238		Approved	Kv11.1, HERG, erg1	uc003wic.3	Q12809	OTTHUMG00000158341	ENST00000262186.5:c.213G>T	7.37:g.150671893C>A		21.0	0.0		61.0	17.0	NM_000238	A5H1P7|C4PFH9|D3DX04|O75418|O75680|Q708S9|Q9BT72|Q9BUT7|Q9H3P0	Silent	SNP	ENST00000262186.5	37	CCDS5910.1																																																																																			.	.		0.672	KCNH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350741.2	NM_000238	
PCDH15	65217	hgsc.bcm.edu	37	10	56128943	56128943	+	Silent	SNP	C	C	T			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr10:56128943C>T	ENST00000320301.6	-	5	805	c.411G>A	c.(409-411)gtG>gtA	p.V137V	PCDH15_ENST00000395445.1_Silent_p.V137V|PCDH15_ENST00000437009.1_Silent_p.V137V|PCDH15_ENST00000395438.1_Silent_p.V137V|PCDH15_ENST00000395433.1_Silent_p.V115V|PCDH15_ENST00000373957.3_Silent_p.V115V|PCDH15_ENST00000414778.1_Silent_p.V142V|PCDH15_ENST00000409834.1_Intron|PCDH15_ENST00000361849.3_Silent_p.V137V|PCDH15_ENST00000395446.1_Silent_p.V137V|PCDH15_ENST00000395430.1_Silent_p.V137V|PCDH15_ENST00000373965.2_Silent_p.V137V|PCDH15_ENST00000395432.2_Silent_p.V137V|PCDH15_ENST00000395440.1_Silent_p.V137V|PCDH15_ENST00000373955.1_Silent_p.V137V|PCDH15_ENST00000395442.1_Silent_p.V137V	NM_033056.3	NP_149045.3	Q96QU1	PCD15_HUMAN	protocadherin-related 15	137	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				equilibrioception (GO:0050957)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)|synapse (GO:0045202)	calcium ion binding (GO:0005509)			NS(3)|breast(6)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(39)|lung(108)|ovary(5)|pancreas(6)|prostate(6)|skin(12)|upper_aerodigestive_tract(12)|urinary_tract(1)	237		Melanoma(3;0.117)|Lung SC(717;0.238)				TCCTGTCTCTCACCACTATTC	0.443										HNSCC(58;0.16)																											p.V142V		.	.											.	PCDH15	.	.	0			c.G426A						.						170.0	128.0	142.0					10																	56128943		2203	4300	6503	SO:0001819	synonymous_variant	65217	exon6			GTCTCTCACCACT	AY029205	CCDS7248.1, CCDS44400.1, CCDS44401.1, CCDS44403.1, CCDS44404.1, CCDS73134.1, CCDS73135.1, CCDS73136.1, CCDS73137.1, CCDS73138.1	10q21.1	2013-01-08	2010-01-25		ENSG00000150275	ENSG00000150275		"""Cadherins / Cadherin-related"""	14674	protein-coding gene	gene with protein product	"""cadherin-related family member 15"""	605514	"""deafness, autosomal recessive 23"", ""protocadherin 15"""	USH1F, DFNB23		11398101, 14570705	Standard	NM_033056		Approved	CDHR15	uc010qhy.1	Q96QU1	OTTHUMG00000018259	ENST00000320301.6:c.411G>A	10.37:g.56128943C>T		162.0	0.0		136.0	24.0	NM_001142763	A6NL19|C6ZEF5|C6ZEF6|C6ZEF7|Q5VY38|Q5VY39|Q6TRH8|Q8NDB9|Q96QT8	Silent	SNP	ENST00000320301.6	37	CCDS7248.1																																																																																			.	.		0.443	PCDH15-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000048121.2	NM_033056	
RIMS3	9783	hgsc.bcm.edu	37	1	41092203	41092203	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr1:41092203G>A	ENST00000372684.3	-	8	1382	c.913C>T	c.(913-915)Ccc>Tcc	p.P305S	RIMS3_ENST00000372683.1_Missense_Mutation_p.P305S	NM_014747.2	NP_055562.2	Q9UJD0	RIMS3_HUMAN	regulating synaptic membrane exocytosis 3	305					calcium ion-dependent exocytosis (GO:0017156)|neurotransmitter transport (GO:0006836)|regulation of membrane potential (GO:0042391)	cell junction (GO:0030054)|presynaptic active zone (GO:0048786)				NS(2)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	23	Ovarian(52;0.00769)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;1.47e-17)			GAGCATGAGGGGCTGGTGGCA	0.607																																					p.P305S		.	.											.	RIMS3	.	.	0			c.C913T						.						36.0	35.0	35.0					1																	41092203		2202	4300	6502	SO:0001583	missense	9783	exon8			ATGAGGGGCTGGT	BC003103	CCDS30687.1	1p34.2	2013-09-19			ENSG00000117016	ENSG00000117016			21292	protein-coding gene	gene with protein product		611600				12620390, 10748113	Standard	NM_014747		Approved	RIM3, NIM3	uc001cfu.1	Q9UJD0	OTTHUMG00000007453	ENST00000372684.3:c.913C>T	1.37:g.41092203G>A	ENSP00000361769:p.Pro305Ser	82.0	0.0		51.0	9.0	NM_014747	D3DPV8|Q92511|X5D7U7	Missense_Mutation	SNP	ENST00000372684.3	37	CCDS30687.1	.	.	.	.	.	.	.	.	.	.	G	24.2	4.507400	0.85282	.	.	ENSG00000117016	ENST00000372684;ENST00000372683	T;T	0.51574	0.7;0.7	4.59	4.59	0.56863	.	0.000000	0.85682	D	0.000000	T	0.67515	0.2901	M	0.74881	2.28	0.80722	D	1	D	0.89917	1.0	D	0.74023	0.982	T	0.71672	-0.4522	10	0.66056	D	0.02	-23.1161	14.9393	0.70980	0.0:0.0:1.0:0.0	.	305	Q9UJD0	RIMS3_HUMAN	S	305	ENSP00000361769:P305S;ENSP00000361768:P305S	ENSP00000361768:P305S	P	-	1	0	RIMS3	40864790	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	7.737000	0.84957	2.381000	0.81170	0.561000	0.74099	CCC	.	.		0.607	RIMS3-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019585.1	NM_014747	
RDH14	57665	hgsc.bcm.edu	37	2	18736770	18736770	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr2:18736770C>T	ENST00000381249.3	-	2	805	c.698G>A	c.(697-699)cGc>cAc	p.R233H	RDH14_ENST00000468071.1_5'UTR	NM_020905.3	NP_065956.1	Q9HBH5	RDH14_HUMAN	retinol dehydrogenase 14 (all-trans/9-cis/11-cis)	233					osteoblast differentiation (GO:0001649)	endoplasmic reticulum (GO:0005783)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	oxidoreductase activity (GO:0016491)			breast(2)|endometrium(1)|large_intestine(2)|lung(1)	6	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.177)				Vitamin A(DB00162)	TTCTAAGCGGCGGGCTAGTTC	0.428																																					p.R547H		.	.											.	.	.	.	0			c.G1640A						.						119.0	116.0	117.0					2																	18736770		2203	4300	6503	SO:0001583	missense	100526794	exon9			AAGCGGCGGGCTA	AF237952	CCDS1693.1	2p24.2	2011-09-14	2006-05-09		ENSG00000240857	ENSG00000240857	1.1.1.-	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 2"""	19979	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 7C, member 4"""		"""retinol dehydrogenase 14 (all-trans and 9-cis)"""			12226107, 19027726	Standard	NM_020905		Approved	PAN2, SDR7C4		Q9HBH5	OTTHUMG00000090705	ENST00000381249.3:c.698G>A	2.37:g.18736770C>T	ENSP00000370648:p.Arg233His	146.0	0.0		187.0	33.0	NM_001199103		Missense_Mutation	SNP	ENST00000381249.3	37	CCDS1693.1	.	.	.	.	.	.	.	.	.	.	C	14.89	2.669703	0.47677	.	.	ENSG00000240857	ENST00000381249	D	0.96041	-3.89	5.67	2.86	0.33363	NAD(P)-binding domain (1);	.	.	.	.	D	0.94542	0.8242	M	0.85945	2.785	0.39580	D	0.969427	B	0.21753	0.06	B	0.14023	0.01	D	0.92443	0.5963	9	0.49607	T	0.09	.	10.6185	0.45465	0.0:0.7369:0.0:0.2631	.	233	Q9HBH5	RDH14_HUMAN	H	233	ENSP00000370648:R233H	ENSP00000370648:R233H	R	-	2	0	RDH14	18600251	0.924000	0.31332	1.000000	0.80357	1.000000	0.99986	0.978000	0.29488	0.746000	0.32786	0.655000	0.94253	CGC	.	.		0.428	RDH14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207394.1		
SMNDC1	10285	hgsc.bcm.edu	37	10	112053908	112053908	+	Silent	SNP	T	T	C			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr10:112053908T>C	ENST00000369603.5	-	6	920	c.717A>G	c.(715-717)taA>taG	p.*239*	SMNDC1_ENST00000369592.1_Silent_p.*239*	NM_005871.3	NP_005862.1	O75940	SPF30_HUMAN	survival motor neuron domain containing 1	0					apoptotic process (GO:0006915)|mRNA processing (GO:0006397)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	poly(A) RNA binding (GO:0044822)			haematopoietic_and_lymphoid_tissue(1)|lung(2)|skin(1)	4		Breast(234;0.174)		Epithelial(162;6.86e-05)|all cancers(201;0.00149)|BRCA - Breast invasive adenocarcinoma(275;0.119)		GTTTTTCTGATTATTGAGGCA	0.338																																					p.X239X		.	.											.	SMNDC1	.	.	0			c.A717G						.						116.0	117.0	117.0					10																	112053908		2203	4300	6503	SO:0001819	synonymous_variant	10285	exon6			TTCTGATTATTGA	AF083385	CCDS7565.1	10q23	2013-01-23			ENSG00000119953	ENSG00000119953		"""Tudor domain containing"""	16900	protein-coding gene	gene with protein product	"""splicing factor 30, survival of motor neuron-related"", ""tudor domain containing 16C"""	603519				9731529, 9817934	Standard	NM_005871		Approved	SPF30, SMNR, TDRD16C	uc001kzc.4	O75940	OTTHUMG00000019036	ENST00000369603.5:c.717A>G	10.37:g.112053908T>C		159.0	0.0		132.0	54.0	NM_005871	B2RA27|D3DRB1|Q5T3K6	Silent	SNP	ENST00000369603.5	37	CCDS7565.1																																																																																			.	.		0.338	SMNDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050325.2	NM_005871	
PIAS4	51588	hgsc.bcm.edu	37	19	4037690	4037690	+	Silent	SNP	C	C	T			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr19:4037690C>T	ENST00000262971.2	+	11	1465	c.1350C>T	c.(1348-1350)ggC>ggT	p.G450G		NM_015897.2	NP_056981.2	Q8N2W9	PIAS4_HUMAN	protein inhibitor of activated STAT, 4	450					negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902231)|positive regulation of keratinocyte apoptotic process (GO:1902174)|positive regulation of protein sumoylation (GO:0033235)|protein sumoylation (GO:0016925)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)	DNA binding (GO:0003677)|SUMO ligase activity (GO:0019789)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(1)|lung(3)|pancreas(1)|skin(3)	17				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00461)|STAD - Stomach adenocarcinoma(1328;0.18)		CGGGTGGCGGCGGCCCGGTGG	0.706																																					p.G450G		.	.											.	PIAS4	.	.	0			c.C1350T						.																																			SO:0001819	synonymous_variant	51588	exon11			TGGCGGCGGCCCG	AF077952	CCDS12118.1	19p13.3	2011-10-11						"""Zinc fingers, MIZ-type"""	17002	protein-coding gene	gene with protein product	"""zinc finger, MIZ-type containing 6"""	605989				9724754	Standard	NM_015897		Approved	Piasg, PIASY, FLJ12419, ZMIZ6	uc002lzg.3	Q8N2W9		ENST00000262971.2:c.1350C>T	19.37:g.4037690C>T		33.0	0.0		68.0	37.0	NM_015897	O75926|Q96G19|Q9UN16	Silent	SNP	ENST00000262971.2	37	CCDS12118.1																																																																																			.	.		0.706	PIAS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457496.1	NM_015897	
ZBTB49	166793	hgsc.bcm.edu	37	4	4303971	4303971	+	Silent	SNP	A	A	G			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr4:4303971A>G	ENST00000337872.4	+	3	529	c.408A>G	c.(406-408)ctA>ctG	p.L136L	ZBTB49_ENST00000538529.1_5'UTR|ZBTB49_ENST00000355834.3_Silent_p.L136L	NM_145291.3	NP_660334.3	Q6ZSB9	ZBT49_HUMAN	zinc finger and BTB domain containing 49	136					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(3)|kidney(3)|large_intestine(5)|lung(9)|ovary(1)|prostate(1)|skin(2)|stomach(1)|urinary_tract(1)	28						CATTGTCTCTACAAAGCACCC	0.438																																					p.L136L		.	.											.	ZBTB49	.	.	0			c.A408G						.						129.0	122.0	125.0					4																	4303971		2203	4300	6503	SO:0001819	synonymous_variant	166793	exon3			GTCTCTACAAAGC	AK095878	CCDS3375.1	4p16.2	2013-01-08	2010-01-26	2010-01-26	ENSG00000168826	ENSG00000168826		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	19883	protein-coding gene	gene with protein product			"""zinc finger protein 509"""	ZNF509		12477932	Standard	NM_145291		Approved	FLJ38559	uc003ghu.3	Q6ZSB9	OTTHUMG00000090325	ENST00000337872.4:c.408A>G	4.37:g.4303971A>G		114.0	0.0		98.0	48.0	NM_145291	Q59FJ4|Q5EBN0|Q8TB80	Silent	SNP	ENST00000337872.4	37	CCDS3375.1																																																																																			.	.		0.438	ZBTB49-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206688.3	NM_145291	
NCOA1	8648	hgsc.bcm.edu	37	2	24991260	24991260	+	Nonstop_Mutation	SNP	A	A	T			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr2:24991260A>T	ENST00000406961.1	+	23	4978	c.4326A>T	c.(4324-4326)taA>taT	p.*1442Y	NCOA1_ENST00000395856.3_Nonstop_Mutation_p.*1441Y|NCOA1_ENST00000405141.1_3'UTR|NCOA1_ENST00000348332.3_Nonstop_Mutation_p.*1442Y|NCOA1_ENST00000288599.5_3'UTR|NCOA1_ENST00000407230.1_3'UTR			Q15788	NCOA1_HUMAN	nuclear receptor coactivator 1	0					androgen receptor signaling pathway (GO:0030521)|cellular lipid metabolic process (GO:0044255)|cellular response to hormone stimulus (GO:0032870)|cerebellum development (GO:0021549)|cerebral cortex development (GO:0021987)|estrous cycle phase (GO:0060206)|hippocampus development (GO:0021766)|histone H4 acetylation (GO:0043967)|hypothalamus development (GO:0021854)|labyrinthine layer morphogenesis (GO:0060713)|lactation (GO:0007595)|male gonad development (GO:0008584)|male mating behavior (GO:0060179)|ovulation cycle (GO:0042698)|positive regulation of apoptotic process (GO:0043065)|positive regulation of female receptivity (GO:0045925)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter by galactose (GO:0000435)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cellular response to drug (GO:2001038)|response to estradiol (GO:0032355)|response to progesterone (GO:0032570)|response to retinoic acid (GO:0032526)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|neuron projection (GO:0043005)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)	androgen receptor binding (GO:0050681)|chromatin binding (GO:0003682)|enzyme binding (GO:0019899)|histone acetyltransferase activity (GO:0004402)|ligand-dependent nuclear receptor binding (GO:0016922)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nuclear hormone receptor binding (GO:0035257)|protein N-terminus binding (GO:0047485)|RNA polymerase II regulatory region DNA binding (GO:0001012)|RNA polymerase II transcription coactivator activity (GO:0001105)|signal transducer activity (GO:0004871)|transcription coactivator activity (GO:0003713)		PAX3/NCOA1(8)	breast(3)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(26)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	53	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TGACTGAATAACCACTTTTAA	0.413			T	PAX3	alveolar rhadomyosarcoma																																p.X1442Y		.	.		Dom	yes		2	2p23	8648	nuclear receptor coactivator 1		M	.	NCOA1	.	.	0			c.A4326T						.						42.0	48.0	46.0					2																	24991260		2203	4300	6503	SO:0001578	stop_lost	8648	exon21			TGAATAACCACTT	U40396	CCDS1712.1, CCDS1713.1, CCDS42660.1	2p23	2011-07-01			ENSG00000084676	ENSG00000084676		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Basic helix-loop-helix proteins"""	7668	protein-coding gene	gene with protein product		602691				7481822, 9575154	Standard	XM_005264625		Approved	SRC1, F-SRC-1, NCoA-1, KAT13A, RIP160, bHLHe74	uc002rfk.3	Q15788	OTTHUMG00000125523	ENST00000406961.1:c.4326A>T	2.37:g.24991260A>T	ENSP00000385216:p.*1442Tyrext*9	102.0	0.0		81.0	18.0	NM_003743	O00150|O43792|O43793|Q13071|Q13420|Q2T9G5|Q53SX3|Q6GVI5|Q7KYV3	Missense_Mutation	SNP	ENST00000406961.1	37	CCDS1712.1	.	.	.	.	.	.	.	.	.	.	A	16.51	3.143497	0.57044	.	.	ENSG00000084676	ENST00000406961;ENST00000348332;ENST00000395856	.	.	.	5.27	5.27	0.74061	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	7.6128	0.28139	0.8423:0.0:0.1577:0.0	.	.	.	.	Y	1442;1442;1441	.	.	X	+	3	2	NCOA1	24844764	1.000000	0.71417	0.999000	0.59377	0.967000	0.64934	4.331000	0.59273	2.219000	0.72066	0.460000	0.39030	TAA	.	.		0.413	NCOA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000246852.3	NM_147223	
SCAP	22937	hgsc.bcm.edu	37	3	47476584	47476584	+	Nonsense_Mutation	SNP	C	C	A			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr3:47476584C>A	ENST00000265565.5	-	3	578	c.166G>T	c.(166-168)Gaa>Taa	p.E56*	SCAP_ENST00000441517.2_5'UTR|SCAP_ENST00000545718.1_5'UTR	NM_012235.2	NP_036367.2	Q12770	SCAP_HUMAN	SREBF chaperone	56					aging (GO:0007568)|cholesterol metabolic process (GO:0008203)|negative regulation of cholesterol biosynthetic process (GO:0045541)|positive regulation of low-density lipoprotein particle receptor biosynthetic process (GO:0045716)|regulation of fatty acid biosynthetic process (GO:0042304)|response to hypoxia (GO:0001666)|response to insulin (GO:0032868)|small molecule metabolic process (GO:0044281)|SREBP signaling pathway (GO:0032933)	cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|protein complex (GO:0043234)	unfolded protein binding (GO:0051082)			endometrium(4)|kidney(1)|large_intestine(4)|liver(1)|lung(11)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)	26				BRCA - Breast invasive adenocarcinoma(193;0.000278)|KIRC - Kidney renal clear cell carcinoma(197;0.00592)|Kidney(197;0.00679)		GTGGTGAATTCCACAGGTCCT	0.532																																					p.E56X	Pancreas(149;978 1908 29304 37806 46700)	.	.											.	SCAP	.	.	0			c.G166T						.						99.0	94.0	96.0					3																	47476584		2203	4300	6503	SO:0001587	stop_gained	22937	exon3			TGAATTCCACAGG	BC020987	CCDS2755.2	3p21.31	2013-01-10			ENSG00000114650	ENSG00000114650		"""WD repeat domain containing"""	30634	protein-coding gene	gene with protein product	"""SREBP cleavage activating protein"""	601510				8898195, 8724849, 10570913	Standard	XM_005264967		Approved	KIAA0199	uc003crh.1	Q12770	OTTHUMG00000125539	ENST00000265565.5:c.166G>T	3.37:g.47476584C>A	ENSP00000265565:p.Glu56*	167.0	0.0		108.0	25.0	NM_012235	Q8N2E0|Q8WUA1	Nonsense_Mutation	SNP	ENST00000265565.5	37	CCDS2755.2	.	.	.	.	.	.	.	.	.	.	C	34	5.345937	0.95807	.	.	ENSG00000114650	ENST00000339815;ENST00000265565;ENST00000416847;ENST00000495603;ENST00000448217	.	.	.	5.13	5.13	0.70059	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.37606	T	0.19	-15.2104	18.3633	0.90382	0.0:1.0:0.0:0.0	.	.	.	.	X	56	.	ENSP00000265565:E56X	E	-	1	0	SCAP	47451588	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	7.281000	0.78621	2.672000	0.90937	0.462000	0.41574	GAA	.	.		0.532	SCAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000246872.2	NM_012235	
AP3B1	8546	hgsc.bcm.edu	37	5	77412060	77412060	+	Splice_Site	SNP	T	T	C			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr5:77412060T>C	ENST00000255194.6	-	18	2144		c.e18-2		AP3B1_ENST00000519295.1_Splice_Site	NM_001271769.1	NP_001258698.1	O00203	AP3B1_HUMAN	adaptor-related protein complex 3, beta 1 subunit						anterograde axon cargo transport (GO:0008089)|anterograde synaptic vesicle transport (GO:0048490)|antigen processing and presentation, exogenous lipid antigen via MHC class Ib (GO:0048007)|blood coagulation (GO:0007596)|intracellular protein transport (GO:0006886)|melanosome organization (GO:0032438)|positive regulation of NK T cell differentiation (GO:0051138)|protein targeting to lysosome (GO:0006622)	AP-3 adaptor complex (GO:0030123)|cytoplasmic vesicle (GO:0031410)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)	GTP-dependent protein binding (GO:0030742)|protein phosphatase binding (GO:0019903)			breast(5)|central_nervous_system(2)|cervix(1)|endometrium(3)|large_intestine(12)|lung(12)|prostate(1)|skin(2)|urinary_tract(1)	39		all_lung(232;0.000397)|Lung NSC(167;0.00106)|Ovarian(174;0.0105)|Prostate(461;0.215)		OV - Ovarian serous cystadenocarcinoma(54;8.23e-47)|Epithelial(54;2.74e-41)|all cancers(79;4.8e-36)		TTCTTTTGCCTGTTTAAACAA	0.343									Hermansky-Pudlak syndrome																												.		.	.											.	AP3B1	.	.	0			c.1969-2A>G						.						64.0	66.0	65.0					5																	77412060		2203	4300	6503	SO:0001630	splice_region_variant	8546	exon19	Familial Cancer Database	HPS, HPS1-8	TTTGCCTGTTTAA	U81504	CCDS4041.1, CCDS64186.1	5q14.1	2014-09-17			ENSG00000132842	ENSG00000132842			566	protein-coding gene	gene with protein product		603401				9182526, 9151686	Standard	NM_003664		Approved	ADTB3A, HPS2	uc003kfj.4	O00203	OTTHUMG00000106919	ENST00000255194.6:c.1969-2A>G	5.37:g.77412060T>C		155.0	0.0		208.0	22.0	NM_003664	E5RJ68|O00580|Q7Z393|Q9HD66	Splice_Site	SNP	ENST00000255194.6	37	CCDS4041.1	.	.	.	.	.	.	.	.	.	.	T	17.27	3.347203	0.61183	.	.	ENSG00000132842	ENST00000255194;ENST00000519295;ENST00000535760	.	.	.	5.99	5.99	0.97316	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.4413	0.67321	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	AP3B1	77447816	1.000000	0.71417	0.978000	0.43139	0.896000	0.52359	4.721000	0.61951	2.296000	0.77279	0.533000	0.62120	.	.	.		0.343	AP3B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000225548.2		Intron
BZRAP1	9256	hgsc.bcm.edu	37	17	56389687	56389687	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr17:56389687C>T	ENST00000343736.4	-	17	2658	c.2495G>A	c.(2494-2496)cGa>cAa	p.R832Q	BZRAP1_ENST00000355701.3_Missense_Mutation_p.R832Q|BZRAP1_ENST00000268893.6_Missense_Mutation_p.R772Q			O95153	RIMB1_HUMAN	benzodiazepine receptor (peripheral) associated protein 1	832	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.					cytoplasm (GO:0005737)|mitochondrion (GO:0005739)	benzodiazepine receptor binding (GO:0030156)			cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|liver(2)|lung(16)|ovary(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	54	Medulloblastoma(34;0.127)|all_neural(34;0.237)					CAGGGCCTGTCGCAGCTCCCC	0.667																																					p.R832Q		.	.											.	BZRAP1	.	.	0			c.G2495A						.						20.0	22.0	21.0					17																	56389687		2202	4298	6500	SO:0001583	missense	9256	exon17			GCCTGTCGCAGCT	AB014512	CCDS11605.1, CCDS45742.1	17q22-q23	2014-01-09	2014-01-09						16831	protein-coding gene	gene with protein product		610764				9734811, 9915832	Standard	NM_004758		Approved	PRAX-1, KIAA0612, RIM-BP1, RIMBP1	uc002ivx.5	O95153		ENST00000343736.4:c.2495G>A	17.37:g.56389687C>T	ENSP00000345824:p.Arg832Gln	92.0	0.0		85.0	15.0	NM_004758	O75111|Q8N5W3	Missense_Mutation	SNP	ENST00000343736.4	37	CCDS11605.1	.	.	.	.	.	.	.	.	.	.	C	14.66	2.603024	0.46423	.	.	ENSG00000005379	ENST00000355701;ENST00000343736;ENST00000268893	T;T;T	0.10960	2.84;2.84;2.82	4.86	-0.621	0.11564	Fibronectin, type III (2);	0.181808	0.50627	N	0.000115	T	0.22244	0.0536	M	0.80183	2.485	0.45194	D	0.9982	B;D;D	0.69078	0.272;0.997;0.985	B;P;P	0.56865	0.022;0.808;0.784	T	0.05131	-1.0904	10	0.29301	T	0.29	.	9.6507	0.39895	0.0:0.6227:0.0:0.3773	.	832;772;832	B7ZVZ7;O95153-2;O95153	.;.;RIMB1_HUMAN	Q	832;832;772	ENSP00000347929:R832Q;ENSP00000345824:R832Q;ENSP00000268893:R772Q	ENSP00000268893:R772Q	R	-	2	0	BZRAP1	53744686	0.130000	0.22417	0.230000	0.23976	0.133000	0.20885	0.749000	0.26320	-0.011000	0.14247	-0.368000	0.07277	CGA	.	.		0.667	BZRAP1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000443980.1	NM_004758	
RANBP9	10048	hgsc.bcm.edu	37	6	13657454	13657454	+	Missense_Mutation	SNP	G	G	C			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr6:13657454G>C	ENST00000011619.3	-	4	849	c.791C>G	c.(790-792)tCt>tGt	p.S264C	RANBP9_ENST00000539980.1_Missense_Mutation_p.S35C	NM_005493.2	NP_005484.2	Q96S59	RANB9_HUMAN	RAN binding protein 9	264	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				axon guidance (GO:0007411)|microtubule nucleation (GO:0007020)|protein complex assembly (GO:0006461)	cytosol (GO:0005829)|microtubule associated complex (GO:0005875)|nucleus (GO:0005634)	enzyme binding (GO:0019899)|Ran GTPase binding (GO:0008536)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(8)|skin(1)	16	Breast(50;0.00669)|Ovarian(93;0.0634)	all_hematologic(90;0.117)	Epithelial(50;0.223)			AGTTCCAGAAGAACAAAACGA	0.393																																					p.S264C		.	.											.	RANBP9	.	.	0			c.C791G						.						170.0	132.0	145.0					6																	13657454		2203	4300	6503	SO:0001583	missense	10048	exon4			CCAGAAGAACAAA	AB008515	CCDS4529.1	6p23	2010-05-25			ENSG00000010017	ENSG00000010017			13727	protein-coding gene	gene with protein product	"""Ran Binding Protein in the Microtubule organizing center"""	603854				9817760	Standard	NM_005493		Approved	RanBPM	uc003nbb.3	Q96S59	OTTHUMG00000015642	ENST00000011619.3:c.791C>G	6.37:g.13657454G>C	ENSP00000011619:p.Ser264Cys	223.0	0.0		211.0	23.0	NM_005493	A0PJA2|B2R8E1|O94764|Q6P3T7|Q7LBR2|Q7Z7F9	Missense_Mutation	SNP	ENST00000011619.3	37	CCDS4529.1	.	.	.	.	.	.	.	.	.	.	G	31	5.077381	0.94000	.	.	ENSG00000010017	ENST00000011619;ENST00000539980;ENST00000283152	T;T	0.69926	-0.44;-0.44	5.86	5.86	0.93980	Concanavalin A-like lectin/glucanase (1);SPla/RYanodine receptor subgroup (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);	0.000000	0.85682	D	0.000000	T	0.72614	0.3482	L	0.36672	1.1	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.73360	-0.4007	10	0.59425	D	0.04	-16.2831	20.1823	0.98208	0.0:0.0:1.0:0.0	.	264	Q96S59	RANB9_HUMAN	C	264;35;264	ENSP00000011619:S264C;ENSP00000438162:S35C	ENSP00000011619:S264C	S	-	2	0	RANBP9	13765433	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	9.869000	0.99810	2.771000	0.95319	0.650000	0.86243	TCT	.	.		0.393	RANBP9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042373.1		
AFAP1L2	84632	hgsc.bcm.edu	37	10	116060312	116060312	+	Silent	SNP	C	C	A	rs367606214		TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr10:116060312C>A	ENST00000304129.4	-	14	1709	c.1680G>T	c.(1678-1680)ccG>ccT	p.P560P	AFAP1L2_ENST00000369271.3_Silent_p.P560P|AFAP1L2_ENST00000491814.1_5'UTR|AFAP1L2_ENST00000545353.1_Silent_p.P613P			Q8N4X5	AF1L2_HUMAN	actin filament associated protein 1-like 2	560					inflammatory response (GO:0006954)|positive regulation of epidermal growth factor receptor signaling pathway (GO:0045742)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of interleukin-6 production (GO:0032675)|regulation of mitotic cell cycle (GO:0007346)	cytoplasm (GO:0005737)	protein tyrosine kinase activator activity (GO:0030296)|SH2 domain binding (GO:0042169)|SH3 domain binding (GO:0017124)			breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|liver(1)|lung(11)|ovary(1)|prostate(2)	21		Colorectal(252;0.175)|Breast(234;0.231)		Epithelial(162;0.0219)|all cancers(201;0.0561)		AGGACAACGTCGGGGAGGAGG	0.602																																					p.P560P		.	.											.	AFAP1L2	.	.	0			c.G1680T						.						79.0	76.0	77.0					10																	116060312		2203	4300	6503	SO:0001819	synonymous_variant	84632	exon14			CAACGTCGGGGAG	BC024314	CCDS31286.1, CCDS31287.1	10q26.11	2013-01-10	2007-02-07	2007-02-07	ENSG00000169129	ENSG00000169129		"""Pleckstrin homology (PH) domain containing"""	25901	protein-coding gene	gene with protein product		612420	"""KIAA1914"""	KIAA1914		11572484, 17412687	Standard	XM_005270239		Approved	FLJ14564, Em:AC005383.4, XB130	uc001lbn.3	Q8N4X5	OTTHUMG00000019086	ENST00000304129.4:c.1680G>T	10.37:g.116060312C>A		126.0	0.0		88.0	43.0	NM_032550	A8K6P7|B3KVQ8|Q2UZW3|Q8TB54|Q96PX4|Q96SY5	Silent	SNP	ENST00000304129.4	37	CCDS31286.1																																																																																			.	.		0.602	AFAP1L2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000050462.1	NM_032550	
ST18	9705	hgsc.bcm.edu	37	8	53092714	53092714	+	Missense_Mutation	SNP	C	C	A			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr8:53092714C>A	ENST00000276480.7	-	9	928	c.245G>T	c.(244-246)gGc>gTc	p.G82V		NM_014682.2	NP_055497.1	O60284	ST18_HUMAN	suppression of tumorigenicity 18, zinc finger	82					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(14)|lung(38)|ovary(4)|prostate(2)|skin(11)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	85		Lung NSC(129;0.131)|all_epithelial(80;0.217)|all_lung(136;0.229)				TTCCAAGGGGCCATCGTCCTC	0.527																																					p.G82V		.	.											.	ST18	.	.	0			c.G245T						.						312.0	250.0	271.0					8																	53092714		2203	4300	6503	SO:0001583	missense	9705	exon9			AAGGGGCCATCGT	AB011107	CCDS6149.1	8q11.23	2014-03-24	2014-03-24	2002-12-13	ENSG00000147488	ENSG00000147488		"""Zinc fingers, C2HC-type containing"""	18695	protein-coding gene	gene with protein product	"""neural zinc finger transcription factor 3"""		"""zinc finger protein 387"", ""suppression of tumorigenicity 18 (breast carcinoma) (zinc finger protein)"""	ZNF387		15489893	Standard	NM_014682		Approved	KIAA0535, ZC2HC10, NZF3	uc003xra.2	O60284	OTTHUMG00000164233	ENST00000276480.7:c.245G>T	8.37:g.53092714C>A	ENSP00000276480:p.Gly82Val	355.0	0.0		260.0	47.0	NM_014682	Q17RY1	Missense_Mutation	SNP	ENST00000276480.7	37	CCDS6149.1	.	.	.	.	.	.	.	.	.	.	C	12.00	1.806814	0.31961	.	.	ENSG00000147488	ENST00000276480;ENST00000517580	T;T	0.43688	0.95;0.94	5.53	4.65	0.58169	.	0.492703	0.23789	N	0.044546	T	0.31358	0.0794	L	0.47716	1.5	0.20489	N	0.999897	B	0.20671	0.047	B	0.16289	0.015	T	0.17167	-1.0378	10	0.22706	T	0.39	-0.7385	6.5156	0.22246	0.1466:0.7057:0.0:0.1477	.	82	O60284	ST18_HUMAN	V	82	ENSP00000276480:G82V;ENSP00000428521:G82V	ENSP00000276480:G82V	G	-	2	0	ST18	53255267	0.000000	0.05858	0.002000	0.10522	0.006000	0.05464	0.110000	0.15437	1.346000	0.45694	0.655000	0.94253	GGC	.	.		0.527	ST18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377867.1		
HEPHL1	341208	hgsc.bcm.edu	37	11	93822053	93822053	+	Missense_Mutation	SNP	C	C	A			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr11:93822053C>A	ENST00000315765.9	+	12	2221	c.2213C>A	c.(2212-2214)gCc>gAc	p.A738D		NM_001098672.1	NP_001092142.1	Q6MZM0	HPHL1_HUMAN	hephaestin-like 1	738	Plastocyanin-like 5.				copper ion transport (GO:0006825)|oxidation-reduction process (GO:0055114)	integral component of membrane (GO:0016021)	copper ion binding (GO:0005507)|ferroxidase activity (GO:0004322)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(11)|lung(25)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	61		Acute lymphoblastic leukemia(157;2.34e-05)|all_hematologic(158;0.00824)				TTTTACATCGCCGCTGAAGAA	0.537																																					p.A738D		.	.											.	HEPHL1	.	.	0			c.C2213A						.						95.0	97.0	97.0					11																	93822053		1945	4152	6097	SO:0001583	missense	341208	exon12			ACATCGCCGCTGA	BX641008	CCDS44710.1	11q21	2008-02-05			ENSG00000181333	ENSG00000181333			30477	protein-coding gene	gene with protein product							Standard	NM_001098672		Approved	DKFZp686F22190	uc001pep.2	Q6MZM0	OTTHUMG00000167751	ENST00000315765.9:c.2213C>A	11.37:g.93822053C>A	ENSP00000313699:p.Ala738Asp	106.0	0.0		83.0	17.0	NM_001098672	Q3C1W7	Missense_Mutation	SNP	ENST00000315765.9	37	CCDS44710.1	.	.	.	.	.	.	.	.	.	.	C	22.1	4.240220	0.79912	.	.	ENSG00000181333	ENST00000315765	D	0.99080	-5.4	5.66	5.66	0.87406	Cupredoxin (2);	0.147481	0.64402	D	0.000010	D	0.99468	0.9811	M	0.92784	3.345	0.37580	D	0.91978	D	0.76494	0.999	D	0.71414	0.973	D	0.99895	1.1146	10	0.56958	D	0.05	.	19.7508	0.96268	0.0:1.0:0.0:0.0	.	738	Q6MZM0	HPHL1_HUMAN	D	738	ENSP00000313699:A738D	ENSP00000313699:A738D	A	+	2	0	HEPHL1	93461701	0.983000	0.35010	0.994000	0.49952	0.969000	0.65631	2.039000	0.41193	2.671000	0.90904	0.555000	0.69702	GCC	.	.		0.537	HEPHL1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396103.2	XM_291947	
CCDC141	285025	hgsc.bcm.edu	37	2	179702272	179702272	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr2:179702272G>A	ENST00000420890.2	-	23	3791	c.3674C>T	c.(3673-3675)tCc>tTc	p.S1225F	CCDC141_ENST00000295723.5_Missense_Mutation_p.S650F|CCDC141_ENST00000480419.1_5'UTR	NM_173648.3	NP_775919.3	Q6ZP82	CC141_HUMAN	coiled-coil domain containing 141	1225										NS(2)|breast(1)|endometrium(5)|kidney(1)|large_intestine(17)|lung(37)|ovary(8)|pancreas(2)|skin(4)|upper_aerodigestive_tract(1)	78			OV - Ovarian serous cystadenocarcinoma(117;0.0274)|Epithelial(96;0.0531)|all cancers(119;0.147)			TGCAAGAGGGGACTCAGGGCT	0.577																																					p.S1225F		.	.											.	CCDC141	.	.	0			c.C3674T						.						68.0	67.0	67.0					2																	179702272		2203	4300	6503	SO:0001583	missense	285025	exon23			AGAGGGGACTCAG	AK096821		2q31.2	2013-01-14			ENSG00000163492	ENSG00000163492		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	26821	protein-coding gene	gene with protein product	"""coiled-coil protein associated with myosin II and DISC1"""					20956536	Standard	NM_173648		Approved	FLJ39502, CAMDI	uc002une.2	Q6ZP82	OTTHUMG00000132578	ENST00000420890.2:c.3674C>T	2.37:g.179702272G>A	ENSP00000395995:p.Ser1225Phe	111.0	0.0		103.0	14.0	NM_173648	H7C0P1|J3KNW6|Q8N8H3	Missense_Mutation	SNP	ENST00000420890.2	37		.	.	.	.	.	.	.	.	.	.	G	15.59	2.879578	0.51801	.	.	ENSG00000163492	ENST00000420890;ENST00000343876;ENST00000295723	T;T;T	0.61040	0.14;0.7;0.71	5.81	4.93	0.64822	.	0.000000	0.53938	D	0.000041	T	0.72170	0.3427	L	0.59436	1.845	0.39513	D	0.968384	D;D	0.71674	0.991;0.998	P;D	0.66084	0.904;0.941	T	0.77199	-0.2675	10	0.87932	D	0	-9.1397	17.0548	0.86530	0.0:0.1271:0.8729:0.0	.	650;650	Q6ZP82;Q6ZP82-2	CC141_HUMAN;.	F	1225;669;650	ENSP00000395995:S1225F;ENSP00000344627:S669F;ENSP00000295723:S650F	ENSP00000295723:S650F	S	-	2	0	CCDC141	179410517	1.000000	0.71417	0.455000	0.27031	0.367000	0.29736	4.901000	0.63259	1.444000	0.47605	-0.156000	0.13503	TCC	.	.		0.577	CCDC141-202	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_173648	
ZP4	57829	hgsc.bcm.edu	37	1	238053180	238053180	+	Silent	SNP	A	A	G			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr1:238053180A>G	ENST00000366570.4	-	3	545	c.387T>C	c.(385-387)ccT>ccC	p.P129P	RP11-193H5.1_ENST00000450451.1_RNA	NM_021186.3	NP_067009.1	Q12836	ZP4_HUMAN	zona pellucida glycoprotein 4	129					acrosomal vesicle exocytosis (GO:0060478)|binding of sperm to zona pellucida (GO:0007339)|intracellular signal transduction (GO:0035556)|multicellular organism reproduction (GO:0032504)|negative regulation of binding of sperm to zona pellucida (GO:2000360)|positive regulation of acrosome reaction (GO:2000344)|positive regulation of humoral immune response (GO:0002922)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of T cell proliferation (GO:0042102)|protein kinase A signaling (GO:0010737)|protein kinase C signaling (GO:0070528)|single fertilization (GO:0007338)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	acrosin binding (GO:0032190)|signal transducer activity (GO:0004871)			breast(6)|cervix(2)|endometrium(5)|kidney(2)|large_intestine(8)|lung(42)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	73	Ovarian(103;0.103)	all_cancers(173;0.00175)|all_epithelial(177;0.162)|all_neural(198;0.164)|Melanoma(53;0.211)|Prostate(94;0.214)	OV - Ovarian serous cystadenocarcinoma(106;0.00989)			GAAGATCCATAGGACACTTGA	0.552																																					p.P129P	NSCLC(166;160 2029 11600 18754 19936)	.	.											.	ZP4	.	.	0			c.T387C						.						225.0	228.0	227.0					1																	238053180		2203	4300	6503	SO:0001819	synonymous_variant	57829	exon3			ATCCATAGGACAC	U05781	CCDS1615.1	1q43	2013-01-17			ENSG00000116996	ENSG00000116996		"""Zona pellucida glycoproteins"""	15770	protein-coding gene	gene with protein product		613514				7841460	Standard	NM_021186		Approved	ZPB	uc001hym.3	Q12836	OTTHUMG00000039586	ENST00000366570.4:c.387T>C	1.37:g.238053180A>G		141.0	0.0		174.0	40.0	NM_021186	B2RAE1	Silent	SNP	ENST00000366570.4	37	CCDS1615.1																																																																																			.	.		0.552	ZP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095476.1		
DRD5	1816	hgsc.bcm.edu	37	4	9784569	9784569	+	Missense_Mutation	SNP	G	G	A	rs572964780		TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr4:9784569G>A	ENST00000304374.2	+	1	1312	c.916G>A	c.(916-918)Gtg>Atg	p.V306M		NM_000798.4	NP_000789.1	P21918	DRD5_HUMAN	dopamine receptor D5	306					activation of adenylate cyclase activity (GO:0007190)|adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|associative learning (GO:0008306)|cellular calcium ion homeostasis (GO:0006874)|cellular response to catecholamine stimulus (GO:0071870)|long term synaptic depression (GO:0060292)|negative regulation of blood pressure (GO:0045776)|negative regulation of NAD(P)H oxidase activity (GO:0033861)|norepinephrine-epinephrine vasoconstriction involved in regulation of systemic arterial blood pressure (GO:0001994)|phospholipase C-activating dopamine receptor signaling pathway (GO:0060158)|positive regulation of adenylate cyclase activity (GO:0045762)|positive regulation of adenylate cyclase activity involved in G-protein coupled receptor signaling pathway (GO:0010579)|reactive oxygen species metabolic process (GO:0072593)|regulation of female receptivity (GO:0045924)|regulation of systemic arterial blood pressure by vasopressin (GO:0001992)|response to amphetamine (GO:0001975)|response to cocaine (GO:0042220)|sensitization (GO:0046960)|synaptic transmission (GO:0007268)|synaptic transmission, dopaminergic (GO:0001963)|transmission of nerve impulse (GO:0019226)|wound healing (GO:0042060)	brush border membrane (GO:0031526)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	dopamine binding (GO:0035240)|dopamine neurotransmitter receptor activity (GO:0004952)|dopamine neurotransmitter receptor activity, coupled via Gs (GO:0001588)			NS(2)|endometrium(8)|kidney(4)|large_intestine(8)|lung(22)|prostate(7)|skin(3)|stomach(2)|urinary_tract(1)	57					Apomorphine(DB00714)|Aripiprazole(DB01238)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Chlorpromazine(DB00477)|Cinnarizine(DB00568)|Dopamine(DB00988)|Ergotamine(DB00696)|Fenoldopam(DB00800)|Imipramine(DB00458)|L-DOPA(DB01235)|Lisuride(DB00589)|Loxapine(DB00408)|Methotrimeprazine(DB01403)|Mianserin(DB06148)|Mirtazapine(DB00370)|Olanzapine(DB00334)|Pergolide(DB01186)|Pramipexole(DB00413)|Quetiapine(DB01224)|Ropinirole(DB00268)|Rotigotine(DB05271)|Trimipramine(DB00726)|Ziprasidone(DB00246)	GGGGGTCTTCGTGTGTTGCTG	0.627																																					p.V306M		.	.											.	DRD5	.	.	0			c.G916A						.						62.0	60.0	61.0					4																	9784569		2203	4299	6502	SO:0001583	missense	1816	exon1			GTCTTCGTGTGTT	X58454	CCDS3405.1	4p16.1	2012-08-08			ENSG00000169676	ENSG00000169676		"""GPCR / Class A : Dopamine receptors"""	3026	protein-coding gene	gene with protein product		126453		DRD1L2		1774076	Standard	NM_000798		Approved	DRD1B	uc003gmb.4	P21918	OTTHUMG00000128489	ENST00000304374.2:c.916G>A	4.37:g.9784569G>A	ENSP00000306129:p.Val306Met	66.0	0.0		49.0	8.0	NM_000798	B2R9S3|Q8NEQ8	Missense_Mutation	SNP	ENST00000304374.2	37	CCDS3405.1	.	.	.	.	.	.	.	.	.	.	g	21.4	4.141049	0.77775	.	.	ENSG00000169676	ENST00000304374	T	0.74526	-0.85	4.73	4.73	0.59995	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	D	0.87120	0.6098	M	0.83118	2.625	0.58432	D	0.999999	D	0.89917	1.0	D	0.97110	1.0	D	0.89208	0.3562	10	0.87932	D	0	.	16.9019	0.86116	0.0:0.0:1.0:0.0	.	306	P21918	DRD5_HUMAN	M	306	ENSP00000306129:V306M	ENSP00000306129:V306M	V	+	1	0	DRD5	9393667	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	9.202000	0.95026	2.457000	0.83068	0.460000	0.39030	GTG	.	.		0.627	DRD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250293.1		
BRCA1	672	hgsc.bcm.edu	37	17	41223109	41223109	+	Missense_Mutation	SNP	C	C	T	rs80359888|rs397507238		TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr17:41223109C>T	ENST00000357654.3	-	15	4940	c.4822G>A	c.(4822-4824)Gca>Aca	p.A1608T	BRCA1_ENST00000309486.4_Missense_Mutation_p.A1312T|BRCA1_ENST00000471181.2_Missense_Mutation_p.A1629T|BRCA1_ENST00000346315.3_Intron|BRCA1_ENST00000493795.1_Missense_Mutation_p.A1561T|BRCA1_ENST00000591534.1_Missense_Mutation_p.A99T|BRCA1_ENST00000491747.2_Missense_Mutation_p.A504T|BRCA1_ENST00000351666.3_Missense_Mutation_p.A425T|BRCA1_ENST00000468300.1_Missense_Mutation_p.A504T|BRCA1_ENST00000352993.3_Missense_Mutation_p.A466T|BRCA1_ENST00000354071.3_Intron|BRCA1_ENST00000591849.1_Intron|BRCA1_ENST00000586385.1_Intron	NM_007294.3	NP_009225.1	P38398	BRCA1_HUMAN	breast cancer 1, early onset	1608					androgen receptor signaling pathway (GO:0030521)|apoptotic process (GO:0006915)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to indole-3-methanol (GO:0071681)|cellular response to tumor necrosis factor (GO:0071356)|chromosome segregation (GO:0007059)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|fatty acid biosynthetic process (GO:0006633)|G2 DNA damage checkpoint (GO:0031572)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of centriole replication (GO:0046600)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of fatty acid biosynthetic process (GO:0045717)|negative regulation of histone H3-K9 methylation (GO:0051573)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of DNA repair (GO:0045739)|positive regulation of gene expression (GO:0010628)|positive regulation of histone acetylation (GO:0035066)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of histone H3-K9 acetylation (GO:2000617)|positive regulation of histone H4-K16 acetylation (GO:2000620)|positive regulation of histone H4-K20 methylation (GO:0070512)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation vascular endothelial growth factor production (GO:0010575)|postreplication repair (GO:0006301)|protein autoubiquitination (GO:0051865)|protein K6-linked ubiquitination (GO:0085020)|protein ubiquitination (GO:0016567)|regulation of apoptotic process (GO:0042981)|regulation of cell proliferation (GO:0042127)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|response to estrogen (GO:0043627)|response to ionizing radiation (GO:0010212)	BRCA1-A complex (GO:0070531)|BRCA1-BARD1 complex (GO:0031436)|chromosome (GO:0005694)|cytoplasm (GO:0005737)|gamma-tubulin ring complex (GO:0008274)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|ribonucleoprotein complex (GO:0030529)|ubiquitin ligase complex (GO:0000151)	androgen receptor binding (GO:0050681)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|ligase activity (GO:0016874)|RNA binding (GO:0003723)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)|tubulin binding (GO:0015631)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(30)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(7)|lung(28)|ovary(36)|skin(2)|stomach(4)|urinary_tract(2)	120		Breast(137;0.000717)		BRCA - Breast invasive adenocarcinoma(366;0.126)		GCAGATTCTGCAACTTTCAAT	0.483			"""D, Mis, N, F, S"""		ovarian	"""breast, ovarian"""		Homologous recombination	Hereditary Breast-Ovarian Cancer, BRCA1 type	TCGA Ovarian(2;0.000030)																											p.A1629T		.	.	yes	Rec	yes	Hereditary breast/ovarian cancer	17	17q21	672	familial breast/ovarian cancer gene 1		E	.	BRCA1	.	.	0			c.G4885A						.						142.0	136.0	138.0					17																	41223109		2203	4300	6503	SO:0001583	missense	672	exon16	Familial Cancer Database		ATTCTGCAACTTT	U14680	CCDS11453.1, CCDS11454.1, CCDS11455.1, CCDS11456.1, CCDS11459.1, CCDS11455.2, CCDS11456.2, CCDS11459.2, CCDS11454.2	17q21.31	2014-09-17			ENSG00000012048	ENSG00000012048		"""RING-type (C3HC4) zinc fingers"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	1100	protein-coding gene	gene with protein product	"""BRCA1/BRCA2-containing complex, subunit 1"", ""protein phosphatase 1, regulatory subunit 53"""	113705				1676470	Standard	NM_007300		Approved	RNF53, BRCC1, PPP1R53	uc002ict.3	P38398	OTTHUMG00000157426	ENST00000357654.3:c.4822G>A	17.37:g.41223109C>T	ENSP00000350283:p.Ala1608Thr	195.0	0.0		262.0	41.0	NM_007300	O15129|Q1RMC1|Q3LRJ0|Q3LRJ6|Q6IN79|Q7KYU9	Missense_Mutation	SNP	ENST00000357654.3	37	CCDS11453.1	.	.	.	.	.	.	.	.	.	.	C	11.71	1.719755	0.30503	.	.	ENSG00000012048	ENST00000357654;ENST00000412061;ENST00000352993;ENST00000351666;ENST00000309486;ENST00000468300;ENST00000393691;ENST00000471181;ENST00000493795;ENST00000491747;ENST00000478531;ENST00000484087;ENST00000493919	D;D;D;D;D;D;D;D;D;D	0.86694	-2.16;-2.16;-2.16;-2.16;-2.16;-2.16;-2.16;-2.16;-2.16;-2.16	4.65	2.62	0.31277	BRCT (1);	0.726285	0.12356	N	0.476100	T	0.80025	0.4548	N	0.24115	0.695	0.09310	N	1	P;P;B;P;B;P;B;P	0.40731	0.608;0.501;0.281;0.688;0.281;0.608;0.031;0.728	B;B;B;B;B;B;B;P	0.44359	0.193;0.081;0.112;0.218;0.112;0.261;0.006;0.447	T	0.70375	-0.4889	10	0.56958	D	0.05	.	5.7699	0.18247	0.0:0.6954:0.2002:0.1044	.	504;457;503;505;504;1630;1608;1608	E7EUM2;B4DES0;E7ETR2;P38398-3;Q6IN79;E9PFC7;P38398;P38398-2	.;.;.;.;.;.;BRCA1_HUMAN;.	T	1608;1629;466;425;1312;504;457;1630;1561;503;504;379;458	ENSP00000350283:A1608T;ENSP00000312236:A466T;ENSP00000338007:A425T;ENSP00000310938:A1312T;ENSP00000417148:A504T;ENSP00000377294:A457T;ENSP00000418775:A1561T;ENSP00000420412:A504T;ENSP00000419481:A379T;ENSP00000418819:A458T	ENSP00000310938:A1312T	A	-	1	0	BRCA1	38476635	0.001000	0.12720	0.176000	0.23000	0.096000	0.18686	0.191000	0.17076	1.272000	0.44329	0.563000	0.77884	GCA	.	.		0.483	BRCA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348798.2	NM_007294	
GUF1	60558	hgsc.bcm.edu	37	4	44692732	44692732	+	Splice_Site	SNP	A	A	T			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr4:44692732A>T	ENST00000281543.5	+	12	1529		c.e12-1		GUF1_ENST00000506793.1_Splice_Site	NM_021927.2	NP_068746.2			GUF1 GTPase homolog (S. cerevisiae)											breast(1)|cervix(1)|endometrium(1)|large_intestine(3)|lung(8)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	19						TCTAATTTTTAGGAACATAGA	0.279																																					.		.	.											.	GUF1	.	.	0			c.1336-2A>T						.						30.0	31.0	31.0					4																	44692732		2197	4291	6488	SO:0001630	splice_region_variant	60558	exon12			ATTTTTAGGAACA		CCDS3468.1	4p13	2006-02-16			ENSG00000151806	ENSG00000151806			25799	protein-coding gene	gene with protein product						8553703	Standard	NM_021927		Approved	FLJ13220	uc003gww.4	Q8N442	OTTHUMG00000128608	ENST00000281543.5:c.1336-1A>T	4.37:g.44692732A>T		248.0	0.0		239.0	104.0	NM_021927		Splice_Site	SNP	ENST00000281543.5	37	CCDS3468.1	.	.	.	.	.	.	.	.	.	.	A	19.22	3.785991	0.70337	.	.	ENSG00000151806	ENST00000281543	.	.	.	5.51	5.51	0.81932	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.0983	0.72253	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	GUF1	44387489	1.000000	0.71417	1.000000	0.80357	0.816000	0.46133	8.854000	0.92228	2.216000	0.71823	0.533000	0.62120	.	.	.		0.279	GUF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250469.3	NM_021927	Intron
RAD52	5893	hgsc.bcm.edu	37	12	1023279	1023279	+	Missense_Mutation	SNP	C	C	G			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr12:1023279C>G	ENST00000358495.3	-	11	1114	c.976G>C	c.(976-978)Gaa>Caa	p.E326Q	RAD52_ENST00000539046.1_Missense_Mutation_p.E249Q|RAD52_ENST00000430095.2_Missense_Mutation_p.E326Q|RAD52_ENST00000535376.1_5'UTR	NM_134424.2	NP_602296.2	P43351	RAD52_HUMAN	RAD52 homolog (S. cerevisiae)	326					DNA recombinase assembly (GO:0000730)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)			central_nervous_system(1)|endometrium(2)|large_intestine(5)|liver(1)|lung(7)|upper_aerodigestive_tract(1)|urinary_tract(2)	19	all_cancers(10;0.0119)|all_epithelial(11;0.0171)|all_lung(10;0.0521)|Ovarian(42;0.0816)|Lung NSC(10;0.0987)		OV - Ovarian serous cystadenocarcinoma(31;0.00123)|BRCA - Breast invasive adenocarcinoma(9;0.0323)			GAGTTGTCTTCAAGAGTCTCT	0.493								Homologous recombination																													p.E326Q		.	.											.	RAD52	.	.	0			c.G976C						.						67.0	62.0	63.0					12																	1023279		1885	4122	6007	SO:0001583	missense	5893	exon11			TGTCTTCAAGAGT		CCDS8507.2	12p13-p12.2	2008-08-05	2001-11-28		ENSG00000002016	ENSG00000002016			9824	protein-coding gene	gene with protein product		600392	"""RAD52 (S. cerevisiae) homolog"""			7774919, 18313388	Standard	XM_005253721		Approved		uc001qis.1	P43351	OTTHUMG00000090361	ENST00000358495.3:c.976G>C	12.37:g.1023279C>G	ENSP00000351284:p.Glu326Gln	144.0	0.0		125.0	19.0	NM_134424	Q13205|Q9Y5T7|Q9Y5T8|Q9Y5T9	Missense_Mutation	SNP	ENST00000358495.3	37	CCDS8507.2	.	.	.	.	.	.	.	.	.	.	C	9.081	0.999376	0.19121	.	.	ENSG00000002016	ENST00000358495;ENST00000430095;ENST00000539046	T;T;T	0.35048	1.75;1.75;1.33	4.87	1.67	0.24075	.	0.611865	0.15390	N	0.264861	T	0.24509	0.0594	L	0.46157	1.445	0.18873	N	0.999987	P	0.40144	0.704	B	0.35353	0.201	T	0.10497	-1.0627	10	0.17369	T	0.5	-8.9029	7.4817	0.27408	0.0:0.663:0.0:0.337	.	326	P43351	RAD52_HUMAN	Q	326;326;249	ENSP00000351284:E326Q;ENSP00000387901:E326Q;ENSP00000445245:E249Q	ENSP00000351284:E326Q	E	-	1	0	RAD52	893540	0.004000	0.15560	0.728000	0.30774	0.531000	0.34715	-0.092000	0.11129	0.582000	0.29556	0.561000	0.74099	GAA	.	.		0.493	RAD52-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206733.2	NM_134424	
HSPB2	3316	hgsc.bcm.edu	37	11	111784239	111784239	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr11:111784239G>A	ENST00000304298.3	+	2	757	c.169G>A	c.(169-171)Ggg>Agg	p.G57R	CRYAB_ENST00000533280.1_5'Flank|CRYAB_ENST00000527950.1_Intron|CRYAB_ENST00000227251.3_5'Flank|CRYAB_ENST00000531198.1_5'Flank|CRYAB_ENST00000533475.1_Intron|CRYAB_ENST00000526180.1_5'Flank|CRYAB_ENST00000533971.1_5'Flank|HSPB2_ENST00000537382.1_Missense_Mutation_p.G57R|HSPB2-C11orf52_ENST00000534100.1_Intron|CRYAB_ENST00000525823.1_5'Flank	NM_001541.3	NP_001532.1	Q16082	HSPB2_HUMAN	heat shock 27kDa protein 2	57					positive regulation of catalytic activity (GO:0043085)|response to unfolded protein (GO:0006986)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	enzyme activator activity (GO:0008047)			large_intestine(2)|lung(3)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	10		all_cancers(61;3.75e-11)|all_epithelial(67;2.33e-06)|Melanoma(852;9.42e-06)|all_hematologic(158;0.000885)|Acute lymphoblastic leukemia(157;0.000966)|Breast(348;0.0512)|Medulloblastoma(222;0.0523)|all_neural(223;0.0663)		Epithelial(105;3.57e-07)|BRCA - Breast invasive adenocarcinoma(274;1.1e-06)|all cancers(92;6.57e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.051)		CGCCCCAGCTGGGGAGGGCAG	0.617																																					p.G57R		.	.											.	HSPB2	.	.	0			c.G169A						.						104.0	114.0	110.0					11																	111784239		2201	4297	6498	SO:0001583	missense	3316	exon2			CCAGCTGGGGAGG	U75898	CCDS8352.1	11q22-q23	2011-09-02	2002-08-29			ENSG00000170276		"""Heat shock proteins / HSPB"""	5247	protein-coding gene	gene with protein product		602179	"""heat shock 27kD protein 2"""			9344664, 9490724	Standard	NM_001541		Approved	Hs.78846, MKBP	uc001pmg.2	Q16082		ENST00000304298.3:c.169G>A	11.37:g.111784239G>A	ENSP00000302476:p.Gly57Arg	54.0	0.0		50.0	10.0	NM_001541	Q6I9U7	Missense_Mutation	SNP	ENST00000304298.3	37	CCDS8352.1	.	.	.	.	.	.	.	.	.	.	G	9.050	0.991858	0.18966	.	.	ENSG00000170276	ENST00000304298;ENST00000537382	D;D	0.89552	-2.53;-2.53	4.99	3.1	0.35709	HSP20-like chaperone (1);	0.750468	0.12883	N	0.431238	T	0.79902	0.4526	N	0.08118	0	0.30018	N	0.81462	P	0.50156	0.932	P	0.50590	0.645	T	0.71656	-0.4527	10	0.14252	T	0.57	-17.9801	6.1967	0.20553	0.0937:0.0:0.7223:0.1839	.	57	Q16082	HSPB2_HUMAN	R	57	ENSP00000302476:G57R;ENSP00000445585:G57R	ENSP00000302476:G57R	G	+	1	0	HSPB2	111289449	0.999000	0.42202	0.903000	0.35520	0.993000	0.82548	2.715000	0.47210	0.797000	0.33971	0.650000	0.86243	GGG	.	.		0.617	HSPB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391669.1		
OR2C1	4993	hgsc.bcm.edu	37	16	3406154	3406154	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr16:3406154G>A	ENST00000304936.2	+	1	266	c.214G>A	c.(214-216)Gct>Act	p.A72T		NM_012368.2	NP_036500.2	O95371	OR2C1_HUMAN	olfactory receptor, family 2, subfamily C, member 1	72					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)	cell cortex (GO:0005938)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			kidney(1)|large_intestine(2)|liver(1)|lung(2)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	12						CTTGGACCTTGCTTTCGCTAC	0.522																																					p.A72T		.	.											.	OR2C1	.	.	0			c.G214A						.						147.0	126.0	133.0					16																	3406154		2197	4300	6497	SO:0001583	missense	4993	exon1			GACCTTGCTTTCG	AF098664	CCDS10502.1	16p13.3	2012-08-09			ENSG00000168158	ENSG00000168158		"""GPCR / Class A : Olfactory receptors"""	8242	protein-coding gene	gene with protein product				OR2C2P		9847080	Standard	NM_012368		Approved	OLFmf3	uc002cuw.1	O95371	OTTHUMG00000090505	ENST00000304936.2:c.214G>A	16.37:g.3406154G>A	ENSP00000307726:p.Ala72Thr	292.0	0.0		520.0	34.0	NM_012368	A0AVA4|Q6IF34|Q6IF55	Missense_Mutation	SNP	ENST00000304936.2	37	CCDS10502.1	.	.	.	.	.	.	.	.	.	.	g	9.692	1.152102	0.21371	.	.	ENSG00000168158	ENST00000304936	T	0.01347	4.99	4.35	3.4	0.38934	GPCR, rhodopsin-like superfamily (1);	0.181464	0.26605	N	0.023454	T	0.01189	0.0039	N	0.14661	0.345	0.09310	N	1	B	0.10296	0.003	B	0.08055	0.003	T	0.47275	-0.9130	10	0.72032	D	0.01	.	10.0324	0.42109	0.0996:0.0:0.9004:0.0	.	72	O95371	OR2C1_HUMAN	T	72	ENSP00000307726:A72T	ENSP00000307726:A72T	A	+	1	0	OR2C1	3346155	0.000000	0.05858	0.712000	0.30502	0.580000	0.36256	0.088000	0.14979	1.046000	0.40249	0.401000	0.26515	GCT	.	.		0.522	OR2C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206993.3		
ZNF521	25925	hgsc.bcm.edu	37	18	22804595	22804595	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr18:22804595C>T	ENST00000361524.3	-	4	3435	c.3287G>A	c.(3286-3288)tGc>tAc	p.C1096Y	ZNF521_ENST00000584787.1_Missense_Mutation_p.C876Y|ZNF521_ENST00000579111.1_5'Flank|ZNF521_ENST00000538137.2_Missense_Mutation_p.C1096Y	NM_015461.2	NP_056276.1	Q96K83	ZN521_HUMAN	zinc finger protein 521	1096					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein domain specific binding (GO:0019904)			NS(1)|breast(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(21)|lung(97)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	149	all_cancers(21;0.0025)|all_epithelial(16;3.62e-05)|Ovarian(20;0.0991)					GAGATTCACGCAGCCGGCACA	0.517			T	PAX5	ALL																																p.C1096Y		.	.		Dom	yes		18	18q11.2	25925	zinc finger protein 521		L	.	ZNF521	.	.	0			c.G3287A						.						88.0	81.0	83.0					18																	22804595		2203	4300	6503	SO:0001583	missense	25925	exon4			TTCACGCAGCCGG	AK027354	CCDS32806.1	18q11.2	2013-01-08				ENSG00000198795		"""Zinc fingers, C2H2-type"""	24605	protein-coding gene	gene with protein product	"""early hematopoietic zinc finger"""	610974				11984006, 14630787	Standard	NM_015461		Approved	EHZF, Evi3	uc002kvk.2	Q96K83		ENST00000361524.3:c.3287G>A	18.37:g.22804595C>T	ENSP00000354794:p.Cys1096Tyr	135.0	0.0		104.0	75.0	NM_015461	A3QVP7|B0YJB7|Q8IXI0|Q8TES6|Q9C065|Q9HAL5|Q9UFK4	Missense_Mutation	SNP	ENST00000361524.3	37	CCDS32806.1	.	.	.	.	.	.	.	.	.	.	C	11.90	1.775366	0.31411	.	.	ENSG00000198795	ENST00000361524;ENST00000538137;ENST00000399425	T;T	0.28895	2.37;1.59	5.86	5.86	0.93980	.	0.000000	0.85682	D	0.000000	T	0.47911	0.1471	L	0.32530	0.975	0.58432	D	0.999996	D	0.76494	0.999	D	0.70487	0.969	T	0.42965	-0.9420	10	0.87932	D	0	-20.51	20.1996	0.98256	0.0:1.0:0.0:0.0	.	1096	Q96K83	ZN521_HUMAN	Y	1096;1130;1096	ENSP00000354794:C1096Y;ENSP00000382352:C1096Y	ENSP00000354794:C1096Y	C	-	2	0	ZNF521	21058593	1.000000	0.71417	0.999000	0.59377	0.990000	0.78478	7.482000	0.81143	2.776000	0.95493	0.650000	0.86243	TGC	.	.		0.517	ZNF521-001	KNOWN	overlapping_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446781.2	NM_015461	
ZNF714	148206	hgsc.bcm.edu	37	19	21299774	21299774	+	Missense_Mutation	SNP	T	T	A	rs36125838|rs57999210	byFrequency	TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr19:21299774T>A	ENST00000596143.1	+	5	629	c.304T>A	c.(304-306)Tat>Aat	p.Y102N	ZNF714_ENST00000601416.1_3'UTR|ZNF714_ENST00000596053.1_Intron|ZNF714_ENST00000291770.7_3'UTR	NM_182515.3	NP_872321	Q96N38	ZN714_HUMAN	zinc finger protein 714	102				Y -> YN (in Ref. 1; BAB71072, 2; CAD39077 and 4; AAH50468). {ECO:0000305}.	regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(2)|kidney(3)|lung(11)|urinary_tract(2)	18						CAAAAAAGGTTATGAACTAAA	0.323																																					p.Y102N		.	.											.	ZNF714	.	.	0			c.T304A						.						42.0	41.0	41.0					19																	21299774		2187	4289	6476	SO:0001583	missense	148206	exon5			AAAGGTTATGAAC	AK056006	CCDS54239.1	19p12	2013-01-08				ENSG00000160352		"""Zinc fingers, C2H2-type"""	27124	protein-coding gene	gene with protein product						12477932	Standard	NM_182515		Approved		uc002npo.4	Q96N38		ENST00000596143.1:c.304T>A	19.37:g.21299774T>A	ENSP00000472368:p.Tyr102Asn	286.0	0.0		278.0	14.0	NM_182515	Q49AI1|Q86W65|Q8ND40	Missense_Mutation	SNP	ENST00000596143.1	37	CCDS54239.1	.	.	.	.	.	.	.	.	.	.	.	8.069	0.769843	0.15983	.	.	ENSG00000160352	ENST00000343332;ENST00000291770	.	.	.	0.601	0.601	0.17529	.	.	.	.	.	T	0.53562	0.1804	M	0.67517	2.055	0.09310	N	1	P;D	0.71674	0.923;0.998	P;D	0.80764	0.504;0.994	T	0.36962	-0.9726	8	0.51188	T	0.08	.	2.6817	0.05095	0.0:0.3485:0.0:0.6515	.	102;102	Q96N38-2;A6NEM4	.;.	N	102	.	ENSP00000291770:Y102N	Y	+	1	0	ZNF714	21091614	0.002000	0.14202	0.002000	0.10522	0.005000	0.04900	-0.137000	0.10389	0.506000	0.28125	0.374000	0.22700	TAT	.	.		0.323	ZNF714-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463930.1	NM_182515	
DGKG	1608	hgsc.bcm.edu	37	3	185969660	185969660	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr3:185969660C>T	ENST00000265022.3	-	19	2188	c.1649G>A	c.(1648-1650)aGc>aAc	p.S550N	DGKG_ENST00000382164.4_Missense_Mutation_p.S511N|DGKG_ENST00000544847.1_Missense_Mutation_p.S491N|DGKG_ENST00000344484.4_Missense_Mutation_p.S525N	NM_001080744.1|NM_001080745.1|NM_001346.2	NP_001074213.1|NP_001074214.1|NP_001337.2	P49619	DGKG_HUMAN	diacylglycerol kinase, gamma 90kDa	550	DAGKc. {ECO:0000255|PROSITE- ProRule:PRU00783}.				blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|neuron development (GO:0048666)|platelet activation (GO:0030168)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|diacylglycerol kinase activity (GO:0004143)|NAD+ kinase activity (GO:0003951)			breast(3)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(17)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)	42	all_cancers(143;3.26e-12)|Ovarian(172;0.0315)|Breast(254;0.247)		OV - Ovarian serous cystadenocarcinoma(80;1.93e-20)	GBM - Glioblastoma multiforme(93;0.0657)	Phosphatidylserine(DB00144)	CACCAAGGGGCTCTGCTCAAT	0.512																																					p.S550N		.	.											.	DGKG	.	.	0			c.G1649A						.						157.0	150.0	152.0					3																	185969660		2203	4300	6503	SO:0001583	missense	1608	exon19			AAGGGGCTCTGCT	AF020945	CCDS3274.1, CCDS43181.1, CCDS43182.1	3q27-q28	2013-01-10	2002-08-29		ENSG00000058866	ENSG00000058866	2.7.1.107	"""EF-hand domain containing"""	2853	protein-coding gene	gene with protein product		601854	"""diacylglycerol kinase, gamma (90kD)"""	DAGK3		8034597	Standard	NM_001080744		Approved		uc003fqa.3	P49619	OTTHUMG00000156617	ENST00000265022.3:c.1649G>A	3.37:g.185969660C>T	ENSP00000265022:p.Ser550Asn	220.0	0.0		145.0	28.0	NM_001346	B2RAH4|Q2M1H4|Q5FWG1	Missense_Mutation	SNP	ENST00000265022.3	37	CCDS3274.1	.	.	.	.	.	.	.	.	.	.	C	22.6	4.305227	0.81247	.	.	ENSG00000058866	ENST00000265022;ENST00000344484;ENST00000382164;ENST00000544847;ENST00000538691	T;T;T;T	0.42513	0.97;0.97;0.97;0.97	5.06	5.06	0.68205	Diacylglycerol kinase, catalytic domain (3);	0.000000	0.85682	D	0.000000	T	0.63236	0.2494	M	0.75615	2.305	0.58432	D	0.999999	D;D;D;D	0.89917	0.998;0.998;1.0;0.999	D;D;D;D	0.76575	0.988;0.988;0.976;0.986	T	0.66432	-0.5925	10	0.87932	D	0	.	13.1306	0.59380	0.0:0.8388:0.1612:0.0	.	491;525;511;550	F5GX27;P49619-2;P49619-3;P49619	.;.;.;DGKG_HUMAN	N	550;525;511;491;514	ENSP00000265022:S550N;ENSP00000339777:S525N;ENSP00000371599:S511N;ENSP00000440507:S491N	ENSP00000265022:S550N	S	-	2	0	DGKG	187452354	1.000000	0.71417	1.000000	0.80357	0.944000	0.59088	7.579000	0.82511	2.645000	0.89757	0.467000	0.42956	AGC	.	.		0.512	DGKG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344800.3		
DOT1L	84444	hgsc.bcm.edu	37	19	2202716	2202716	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr19:2202716A>G	ENST00000398665.3	+	9	761	c.725A>G	c.(724-726)aAt>aGt	p.N242S		NM_032482.2	NP_115871.1	Q8TEK3	DOT1L_HUMAN	DOT1-like histone H3K79 methyltransferase	242	DOT1. {ECO:0000255|PROSITE- ProRule:PRU00902}.				histone lysine methylation (GO:0034968)|regulation of JAK-STAT cascade (GO:0046425)|regulation of transcription regulatory region DNA binding (GO:2000677)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription factor binding (GO:0008134)			NS(1)|breast(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(3)|lung(14)|ovary(2)|pancreas(2)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(9)	42		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TTTGTGAATAATTTTGCCTTT	0.537																																					p.N242S		.	.											.	DOT1L	.	.	0			c.A725G						.						184.0	191.0	189.0					19																	2202716		1996	4163	6159	SO:0001583	missense	84444	exon9			TGAATAATTTTGC	AF509504	CCDS42460.1	19p13.3	2013-05-21	2013-05-21		ENSG00000104885	ENSG00000104885	2.1.1.43	"""Chromatin-modifying enzymes / K-methyltransferases"""	24948	protein-coding gene	gene with protein product	"""histone methyltransferase DOT1L"""	607375	"""DOT1-like, histone H3 methyltransferase (S. cerevisiae)"""			11347906, 12123582	Standard	NM_032482		Approved	KIAA1814, DOT1, KMT4	uc002lvb.4	Q8TEK3	OTTHUMG00000150431	ENST00000398665.3:c.725A>G	19.37:g.2202716A>G	ENSP00000381657:p.Asn242Ser	346.0	0.0		287.0	203.0	NM_032482	O60379|Q96JL1	Missense_Mutation	SNP	ENST00000398665.3	37	CCDS42460.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	23.3|23.3	4.401898|4.401898	0.83120|0.83120	.|.	.|.	ENSG00000104885|ENSG00000104885	ENST00000440640|ENST00000398665;ENST00000221482	.|T	.|0.23754	.|1.89	4.49|4.49	4.49|4.49	0.54785|0.54785	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.59865|0.59865	0.2225|0.2225	M|M	0.93978|0.93978	3.48|3.48	0.58432|0.58432	D|D	0.999995|0.999995	.|D	.|0.76494	.|0.999	.|D	.|0.79108	.|0.992	T|T	0.71424|0.71424	-0.4597|-0.4597	5|10	.|0.87932	.|D	.|0	-37.1699|-37.1699	12.9757|12.9757	0.58537|0.58537	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|242	.|Q8TEK3-2	.|.	V|S	29|242	.|ENSP00000381657:N242S	.|ENSP00000221482:N242S	I|N	+|+	1|2	0|0	DOT1L|DOT1L	2153716|2153716	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.985000|0.985000	0.73830|0.73830	8.830000|8.830000	0.92063|0.92063	1.662000|1.662000	0.50781|0.50781	0.379000|0.379000	0.24179|0.24179	ATT|AAT	.	.		0.537	DOT1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318066.1	NM_032482	
MYL4	4635	hgsc.bcm.edu	37	17	45299202	45299202	+	Silent	SNP	G	G	C			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr17:45299202G>C	ENST00000354968.1	+	5	596	c.468G>C	c.(466-468)cgG>cgC	p.R156R	MYL4_ENST00000572316.1_Silent_p.R156R|MYL4_ENST00000393450.1_Silent_p.R156R|snoU13_ENST00000516279.1_RNA	NM_001002841.1	NP_001002841.1	P12829	MYL4_HUMAN	myosin, light chain 4, alkali; atrial, embryonic	156	EF-hand 2. {ECO:0000255|PROSITE- ProRule:PRU00448}.				cardiac muscle contraction (GO:0060048)|muscle filament sliding (GO:0030049)|positive regulation of ATPase activity (GO:0032781)|regulation of the force of heart contraction (GO:0002026)	A band (GO:0031672)|cytosol (GO:0005829)|myosin complex (GO:0016459)	actin filament binding (GO:0051015)|actin monomer binding (GO:0003785)|calcium ion binding (GO:0005509)|myosin II heavy chain binding (GO:0032038)			endometrium(2)|large_intestine(1)|lung(4)|ovary(3)|prostate(1)	11						CTGAGCTTCGGCACGTCCTTG	0.592																																					p.R156R		.	.											.	MYL4	.	.	0			c.G468C						.						97.0	73.0	81.0					17																	45299202		2203	4300	6503	SO:0001819	synonymous_variant	4635	exon5			GCTTCGGCACGTC		CCDS11510.1	17q21.32	2013-09-19	2006-09-29		ENSG00000198336	ENSG00000198336		"""Myosins / Light chain"", ""EF-hand domain containing"""	7585	protein-coding gene	gene with protein product	"""myosin, atrial/fetal muscle, light chain"""	160770	"""myosin, light polypeptide 4, alkali; atrial, embryonic"""			3417683	Standard	NM_002476		Approved	ALC1, AMLC, GT1, PRO1957	uc002ilg.3	P12829	OTTHUMG00000178232	ENST00000354968.1:c.468G>C	17.37:g.45299202G>C		144.0	0.0		167.0	83.0	NM_001002841	D3DXJ7|P11783	Silent	SNP	ENST00000354968.1	37	CCDS11510.1																																																																																			.	.		0.592	MYL4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441059.1	NM_001002841	
OR2W5	441932	hgsc.bcm.edu	37	1	247655276	247655276	+	RNA	SNP	T	T	C			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr1:247655276T>C	ENST00000522351.1	+	0	907							A6NFC9	OR2W5_HUMAN	olfactory receptor, family 2, subfamily W, member 5							integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(5)|kidney(2)|large_intestine(2)|lung(24)|ovary(1)|skin(4)	39	all_cancers(71;4.51e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.222)	OV - Ovarian serous cystadenocarcinoma(106;0.0188)			CCATCGTCATTCCCAGCATCA	0.527																																					p.S283P		.	.											.	OR2W5	.	.	0			c.T847C						.						113.0	103.0	106.0					1																	247655276		2203	4300	6503			441932	exon1			CGTCATTCCCAGC			1q44	2013-03-27		2004-03-10	ENSG00000203664	ENSG00000203664		"""GPCR / Class A : Olfactory receptors"""	15424	other	unknown				OR2W5P		12213199	Standard	NM_001004698		Approved	OST722	uc001icz.2	A6NFC9	OTTHUMG00000040573		1.37:g.247655276T>C		224.0	0.0		291.0	12.0	NM_001004698	B9EH85	Missense_Mutation	SNP	ENST00000522351.1	37																																																																																				.	.		0.527	OR2W5-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000375789.1	NM_001004698	
POT1	25913	hgsc.bcm.edu	37	7	124464094	124464094	+	Silent	SNP	T	T	C			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr7:124464094T>C	ENST00000357628.3	-	19	2425	c.1827A>G	c.(1825-1827)tcA>tcG	p.S609S	POT1_ENST00000393329.1_Silent_p.S478S	NM_015450.2	NP_056265.2	Q9NUX5	POTE1_HUMAN	protection of telomeres 1	609					DNA duplex unwinding (GO:0032508)|negative regulation of telomerase activity (GO:0051974)|negative regulation of telomere maintenance via telomerase (GO:0032211)|positive regulation of DNA strand elongation (GO:0060383)|positive regulation of helicase activity (GO:0051096)|positive regulation of telomerase activity (GO:0051973)|positive regulation of telomere maintenance via telomerase (GO:0032212)|telomere capping (GO:0016233)|telomere formation via telomerase (GO:0032203)|telomere maintenance (GO:0000723)|telomere maintenance via telomerase (GO:0007004)	chromosome, telomeric region (GO:0000781)|cytoplasm (GO:0005737)|nuclear telomere cap complex (GO:0000783)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DEAD/H-box RNA helicase binding (GO:0017151)|single-stranded telomeric DNA binding (GO:0043047)|telomerase inhibitor activity (GO:0010521)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(4)|liver(1)|lung(23)|ovary(1)|prostate(1)|skin(3)|stomach(1)|urinary_tract(1)	47						TGACATTGTATGACTTGATGA	0.308																																					p.S609S	Esophageal Squamous(149;1032 1141 16047 36610 40540 42429 44687 51642)	.	.											.	POT1	.	.	0			c.A1827G						.						168.0	144.0	152.0					7																	124464094		2202	4300	6502	SO:0001819	synonymous_variant	25913	exon19			ATTGTATGACTTG	AK022580	CCDS5793.1	7q31.33	2013-01-21	2013-01-21		ENSG00000128513	ENSG00000128513			17284	protein-coding gene	gene with protein product		606478	"""protection of telomeres 1 homolog (S. pombe)"""			11349150, 12391173	Standard	NR_003102		Approved	hPot1, DKFZp586D211	uc003vlm.3	Q9NUX5	OTTHUMG00000157194	ENST00000357628.3:c.1827A>G	7.37:g.124464094T>C		262.0	0.0		304.0	115.0	NM_015450	O95018|Q5MJ36|Q9H662|Q9NW19|Q9UG95	Silent	SNP	ENST00000357628.3	37	CCDS5793.1	.	.	.	.	.	.	.	.	.	.	T	10.89	1.479418	0.26511	.	.	ENSG00000128513	ENST00000436534	.	.	.	5.95	-5.93	0.02254	.	.	.	.	.	T	0.35508	0.0934	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.41556	-0.9502	4	.	.	.	-15.3249	1.4427	0.02357	0.2143:0.0863:0.1816:0.5178	.	.	.	.	V	108	.	.	I	-	1	0	POT1	124251330	0.342000	0.24809	0.954000	0.39281	0.984000	0.73092	-0.808000	0.04515	-0.717000	0.04955	0.533000	0.62120	ATA	.	.		0.308	POT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347861.1		
CPEB3	22849	hgsc.bcm.edu	37	10	93999727	93999727	+	Silent	SNP	G	G	A			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr10:93999727G>A	ENST00000265997.4	-	2	553	c.381C>T	c.(379-381)atC>atT	p.I127I	CPEB3_ENST00000412050.4_Silent_p.I127I	NM_014912.4	NP_055727.3	Q8NE35	CPEB3_HUMAN	cytoplasmic polyadenylation element binding protein 3	127	Pro-rich.				3'-UTR-mediated mRNA destabilization (GO:0061158)|cellular response to amino acid stimulus (GO:0071230)|long-term memory (GO:0007616)|negative regulation of cytoplasmic translational elongation (GO:1900248)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of translation (GO:0017148)|positive regulation of dendritic spine development (GO:0060999)|positive regulation of mRNA polyadenylation (GO:1900365)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|positive regulation of translation (GO:0045727)|regulation of dendritic spine development (GO:0060998)|regulation of synaptic plasticity (GO:0048167)|translation (GO:0006412)	apical dendrite (GO:0097440)|CCR4-NOT complex (GO:0030014)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|neuron projection (GO:0043005)|nucleus (GO:0005634)|synapse (GO:0045202)	mRNA 3'-UTR AU-rich region binding (GO:0035925)|mRNA 3'-UTR binding (GO:0003730)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|RNA stem-loop binding (GO:0035613)|translation factor activity, nucleic acid binding (GO:0008135)|translation repressor activity, nucleic acid binding (GO:0000900)			breast(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(5)|lung(5)|skin(2)|upper_aerodigestive_tract(2)	18		Colorectal(252;0.0869)				TGACTGGGGTGATCCCCTGGA	0.662																																					p.I127I		.	.											.	CPEB3	.	.	0			c.C381T						.						54.0	48.0	50.0					10																	93999727		2203	4300	6503	SO:0001819	synonymous_variant	22849	exon2			TGGGGTGATCCCC	AB023157	CCDS31246.1, CCDS53553.1	10q23.33	2013-02-12			ENSG00000107864	ENSG00000107864		"""RNA binding motif (RRM) containing"""	21746	protein-coding gene	gene with protein product		610606				10231032, 12672660	Standard	NM_014912		Approved	KIAA0940	uc001khw.2	Q8NE35	OTTHUMG00000018756	ENST00000265997.4:c.381C>T	10.37:g.93999727G>A		76.0	0.0		71.0	18.0	NM_014912	Q5T389|Q9NQJ7|Q9Y2E9	Silent	SNP	ENST00000265997.4	37	CCDS31246.1																																																																																			.	.		0.662	CPEB3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000049387.2	NM_014912	
EZH1	2145	hgsc.bcm.edu	37	17	40871173	40871173	+	Silent	SNP	T	T	C			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr17:40871173T>C	ENST00000428826.2	-	8	838	c.717A>G	c.(715-717)gcA>gcG	p.A239A	EZH1_ENST00000585893.1_Silent_p.A199A|EZH1_ENST00000435174.1_Silent_p.A100A|EZH1_ENST00000415827.2_Silent_p.A230A|EZH1_ENST00000590078.1_Silent_p.A169A|EZH1_ENST00000592743.1_Silent_p.A239A			Q92800	EZH1_HUMAN	enhancer of zeste 1 polycomb repressive complex 2 subunit	239					anatomical structure morphogenesis (GO:0009653)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	ESC/E(Z) complex (GO:0035098)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|histone methyltransferase activity (H3-K27 specific) (GO:0046976)			breast(1)|endometrium(4)|large_intestine(6)|lung(9)|ovary(3)|prostate(1)|skin(1)|urinary_tract(2)	27		Breast(137;0.00104)		BRCA - Breast invasive adenocarcinoma(366;0.0784)		TTGAGGCAATTGCACTGAAGA	0.443																																					p.A239A		.	.											.	EZH1	.	.	0			c.A717G						.						318.0	277.0	291.0					17																	40871173		2203	4300	6503	SO:0001819	synonymous_variant	2145	exon8			GGCAATTGCACTG		CCDS32659.1	17q21.1-q21.3	2014-05-28	2014-05-28			ENSG00000108799		"""Chromatin-modifying enzymes / K-methyltransferases"""	3526	protein-coding gene	gene with protein product		601674	"""enhancer of zeste (Drosophila) homolog 1"", ""enhancer of zeste homolog 1 (Drosophila)"""			8921387	Standard	NM_001991		Approved	KIAA0388, KMT6B	uc002iaz.3	Q92800		ENST00000428826.2:c.717A>G	17.37:g.40871173T>C		266.0	0.0		325.0	45.0	NM_001991	A6NCH6|B4DIJ1|B4DIZ7|B4DSS2|B4E3R7|O43287|Q14459|Q53XP3	Silent	SNP	ENST00000428826.2	37	CCDS32659.1																																																																																			.	.		0.443	EZH1-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452347.1	NM_001991	
NFATC3	4775	hgsc.bcm.edu	37	16	68224766	68224766	+	Missense_Mutation	SNP	G	G	C			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr16:68224766G>C	ENST00000346183.3	+	9	2218	c.2194G>C	c.(2194-2196)Gat>Cat	p.D732H	SNORA48_ENST00000391143.1_RNA|NFATC3_ENST00000575270.1_Missense_Mutation_p.D732H|NFATC3_ENST00000535127.2_3'UTR|NFATC3_ENST00000329524.4_Missense_Mutation_p.D732H|NFATC3_ENST00000349223.5_Missense_Mutation_p.D732H	NM_173165.2	NP_775188.1	Q12968	NFAC3_HUMAN	nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 3	732					cellular respiration (GO:0045333)|cellular response to calcium ion (GO:0071277)|cellular response to lithium ion (GO:0071285)|Fc-epsilon receptor signaling pathway (GO:0038095)|heart development (GO:0007507)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|muscle cell development (GO:0055001)|patterning of blood vessels (GO:0001569)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|smooth muscle cell differentiation (GO:0051145)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(7)|liver(1)|lung(19)|pancreas(1)|skin(3)|upper_aerodigestive_tract(2)	44		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0119)|Epithelial(162;0.0452)|all cancers(182;0.24)		GCCTTCCTCTGATTCAGGGTG	0.468																																					p.D732H		.	.											.	NFATC3	.	.	0			c.G2194C						.						100.0	87.0	91.0					16																	68224766		2198	4300	6498	SO:0001583	missense	4775	exon9			TCCTCTGATTCAG	L41067	CCDS10860.1, CCDS10861.1, CCDS10862.1	16q22	2009-11-24			ENSG00000072736	ENSG00000072736		"""Nuclear factor of activated T-cells"""	7777	protein-coding gene	gene with protein product		602698				7749981	Standard	NM_004555		Approved	NFAT4, NFATX	uc002evo.2	Q12968	OTTHUMG00000137555	ENST00000346183.3:c.2194G>C	16.37:g.68224766G>C	ENSP00000300659:p.Asp732His	217.0	0.0		185.0	15.0	NM_173163	O75211|Q14516|Q99840|Q99841|Q99842	Missense_Mutation	SNP	ENST00000346183.3	37	CCDS10860.1	.	.	.	.	.	.	.	.	.	.	G	13.00	2.107591	0.37145	.	.	ENSG00000072736	ENST00000349223;ENST00000346183;ENST00000329524;ENST00000535127	T;T;T	0.09350	2.99;3.0;2.99	5.55	5.55	0.83447	.	1.042500	0.07468	N	0.901830	T	0.16896	0.0406	L	0.29908	0.895	0.39968	D	0.974755	P;P;P;P	0.42337	0.612;0.776;0.612;0.612	B;P;B;B	0.47528	0.417;0.549;0.417;0.417	T	0.03017	-1.1082	10	0.59425	D	0.04	-4.9679	14.359	0.66757	0.0:0.0:0.852:0.148	.	732;732;732;732	Q12968;Q12968-3;B5B2S0;B5B2S2	NFAC3_HUMAN;.;.;.	H	732;732;732;253	ENSP00000264008:D732H;ENSP00000300659:D732H;ENSP00000331324:D732H	ENSP00000331324:D732H	D	+	1	0	NFATC3	66782267	1.000000	0.71417	1.000000	0.80357	0.378000	0.30076	7.026000	0.76455	2.617000	0.88574	0.557000	0.71058	GAT	.	.		0.468	NFATC3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268890.2	NM_004555	
SCIN	85477	hgsc.bcm.edu	37	7	12666376	12666376	+	Missense_Mutation	SNP	G	G	T			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr7:12666376G>T	ENST00000297029.5	+	8	1250	c.1149G>T	c.(1147-1149)caG>caT	p.Q383H	SCIN_ENST00000519209.1_Missense_Mutation_p.Q136H|SCIN_ENST00000445618.2_Missense_Mutation_p.Q136H|SCIN_ENST00000473722.1_3'UTR	NM_001112706.2	NP_001106177.1	Q9Y6U3	ADSV_HUMAN	scinderin	383	Ca(2+)-dependent actin binding.				actin filament capping (GO:0051693)|actin filament severing (GO:0051014)|actin nucleation (GO:0045010)|calcium ion-dependent exocytosis (GO:0017156)|negative regulation of cell proliferation (GO:0008285)|positive regulation of apoptotic process (GO:0043065)|positive regulation of megakaryocyte differentiation (GO:0045654)|positive regulation of secretion (GO:0051047)|regulation of chondrocyte differentiation (GO:0032330)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|protein complex (GO:0043234)	1-phosphatidylinositol binding (GO:0005545)|actin binding (GO:0003779)|actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|phosphatidylserine binding (GO:0001786)			endometrium(3)|kidney(1)|large_intestine(2)|lung(9)|ovary(2)	17				UCEC - Uterine corpus endometrioid carcinoma (126;0.195)		GTTCTCCGCAGATGGCAGCCC	0.418																																					p.Q383H		.	.											.	SCIN	.	.	0			c.G1149T						.						61.0	62.0	62.0					7																	12666376		1945	4135	6080	SO:0001583	missense	85477	exon8			TCCGCAGATGGCA	AF276507	CCDS47545.1, CCDS47546.1	7p21.3	2006-04-25			ENSG00000006747	ENSG00000006747			21695	protein-coding gene	gene with protein product		613416					Standard	NM_033128		Approved	adseverin, KIAA1905	uc003ssn.4	Q9Y6U3	OTTHUMG00000152385	ENST00000297029.5:c.1149G>T	7.37:g.12666376G>T	ENSP00000297029:p.Gln383His	269.0	0.0		296.0	105.0	NM_001112706	A8K2U8|Q8NBZ6|Q8WU97|Q96JC7|Q96PY2	Missense_Mutation	SNP	ENST00000297029.5	37	CCDS47545.1	.	.	.	.	.	.	.	.	.	.	G	9.425	1.084134	0.20309	.	.	ENSG00000006747	ENST00000297029;ENST00000519209;ENST00000445618	T;T;T	0.29917	1.55;1.55;1.55	5.78	3.72	0.42706	.	0.114869	0.64402	D	0.000012	T	0.26882	0.0658	L	0.50333	1.59	0.47341	D	0.999392	B	0.02656	0.0	B	0.08055	0.003	T	0.05500	-1.0881	10	0.62326	D	0.03	-6.8698	8.3504	0.32299	0.3363:0.0:0.6637:0.0	.	383	Q9Y6U3	ADSV_HUMAN	H	383;136;136	ENSP00000297029:Q383H;ENSP00000430997:Q136H;ENSP00000390189:Q136H	ENSP00000297029:Q383H	Q	+	3	2	SCIN	12632901	1.000000	0.71417	0.981000	0.43875	0.266000	0.26442	2.089000	0.41672	0.539000	0.28788	0.557000	0.71058	CAG	.	.		0.418	SCIN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326041.1	NM_033128	
SOX14	8403	hgsc.bcm.edu	37	3	137483875	137483875	+	Silent	SNP	C	C	G			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr3:137483875C>G	ENST00000306087.1	+	1	297	c.249C>G	c.(247-249)ccC>ccG	p.P83P		NM_004189.3	NP_004180.1	O95416	SOX14_HUMAN	SRY (sex determining region Y)-box 14	83					entrainment of circadian clock (GO:0009649)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|regulation of neuron migration (GO:2001222)|visual perception (GO:0007601)	nuclear transcription factor complex (GO:0044798)	chromatin binding (GO:0003682)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			large_intestine(2)|lung(12)	14						GGCGCAAGCCCAAGAACCTGC	0.642																																					p.P83P		.	.											.	SOX14	.	.	0			c.C249G						.						140.0	151.0	148.0					3																	137483875		2203	4300	6503	SO:0001819	synonymous_variant	8403	exon1			CAAGCCCAAGAAC	AJ006230	CCDS3094.1	3q22-q23	2008-07-18			ENSG00000168875	ENSG00000168875		"""SRY (sex determining region Y)-boxes"""	11193	protein-coding gene	gene with protein product	"""HMG box transcription factor SOX-14"", ""SRY-box 14"""	604747				9925951	Standard	NM_004189		Approved	SOX28	uc003erm.2	O95416	OTTHUMG00000159757	ENST00000306087.1:c.249C>G	3.37:g.137483875C>G		159.0	0.0		131.0	9.0	NM_004189	B2RAC0|Q3KPH7	Silent	SNP	ENST00000306087.1	37	CCDS3094.1																																																																																			.	.		0.642	SOX14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357182.1	NM_004189	
DNAH6	1768	hgsc.bcm.edu	37	2	84774640	84774640	+	Nonsense_Mutation	SNP	C	C	T			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr2:84774640C>T	ENST00000237449.6	+	6	1098	c.1090C>T	c.(1090-1092)Cga>Tga	p.R364*	DNAH6_ENST00000389394.3_Nonsense_Mutation_p.R364*|DNAH6_ENST00000398278.2_Nonsense_Mutation_p.R364*			Q9C0G6	DYH6_HUMAN	dynein, axonemal, heavy chain 6	364	Stem. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.R364G(1)		NS(2)|breast(9)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(3)|lung(14)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	57						AGGAGAATTTCGAAATGAGGC	0.388																																					p.R364X		.	.											.	DNAH6	.	.	1	Substitution - Missense(1)	breast(1)	c.C1090T						.						239.0	205.0	215.0					2																	84774640		692	1591	2283	SO:0001587	stop_gained	1768	exon7			GAATTTCGAAATG	U61736	CCDS46348.1	2p11.2	2011-05-24	2006-09-04		ENSG00000115423	ENSG00000115423		"""Axonemal dyneins"""	2951	protein-coding gene	gene with protein product		603336	"""dynein, axonemal, heavy polypeptide 6"", ""dynein heavy chain-like 1"""	DNHL1		8812413	Standard	NM_001370		Approved	Dnahc6, HL-2, FLJ37357	uc010fgb.3	Q9C0G6	OTTHUMG00000128957	ENST00000237449.6:c.1090C>T	2.37:g.84774640C>T	ENSP00000237449:p.Arg364*	353.0	1.0		359.0	149.0	NM_001370	A0PJN9|B5MEE0|B7ZL99|O95493|Q53QZ1|Q53TE5|Q8N1W6|Q92861|Q96BL6|Q9H030|Q9H5E1	Nonsense_Mutation	SNP	ENST00000237449.6	37	CCDS46348.1	.	.	.	.	.	.	.	.	.	.	C	33	5.247637	0.95305	.	.	ENSG00000115423	ENST00000389394;ENST00000398278;ENST00000237449	.	.	.	5.35	0.848	0.18966	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	14.0192	0.64543	0.5216:0.4783:0.0:0.0	.	.	.	.	X	364	.	ENSP00000237449:R364X	R	+	1	2	DNAH6	84628151	1.000000	0.71417	0.346000	0.25655	0.764000	0.43329	0.979000	0.29500	0.568000	0.29311	0.591000	0.81541	CGA	.	.		0.388	DNAH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328537.2	NM_001370	
ERI2	112479	hgsc.bcm.edu	37	16	20810230	20810230	+	Missense_Mutation	SNP	T	T	C	rs557835094		TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr16:20810230T>C	ENST00000357967.4	-	9	934	c.892A>G	c.(892-894)Att>Gtt	p.I298V	ERI2_ENST00000389345.5_Missense_Mutation_p.I33V|ERI2_ENST00000300005.3_Intron|ERI2_ENST00000569729.1_Intron|ERI2_ENST00000564349.1_Missense_Mutation_p.I205V|ERI2_ENST00000563117.1_Missense_Mutation_p.I205V	NM_001142725.1	NP_001136197.1	A8K979	ERI2_HUMAN	ERI1 exoribonuclease family member 2	298							exonuclease activity (GO:0004527)|nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(1)|large_intestine(5)|lung(2)|prostate(2)	11						TTTGCACAAATTGACTTCATT	0.323																																					p.I298V		.	.											.	ERI2	.	.	0			c.A892G						.						82.0	67.0	72.0					16																	20810230		692	1591	2283	SO:0001583	missense	112479	exon9			CACAAATTGACTT	BC010503	CCDS10590.1, CCDS45436.1	16p12.3	2014-02-18	2009-10-07	2008-12-16	ENSG00000196678	ENSG00000196678		"""Enhanced RNAi three prime mRNA exonucleases"""	30541	protein-coding gene	gene with protein product	"""enhanced RNAi three prime mRNA exonuclease homolog 2 (C.elegans)"", ""exoribonuclease 2"", ""zinc finger, GRF-type containing 5"""		"""exonuclease domain containing 1"""	EXOD1		10819331	Standard	NM_080663		Approved	KIAA1504, MGC16943, ZGRF5	uc010vbb.1	A8K979	OTTHUMG00000131557	ENST00000357967.4:c.892A>G	16.37:g.20810230T>C	ENSP00000350651:p.Ile298Val	427.0	0.0		605.0	190.0	NM_001142725	Q6ZSJ2|Q96FR9|Q9P224|Q9Y6V3	Missense_Mutation	SNP	ENST00000357967.4	37	CCDS45436.1	.	.	.	.	.	.	.	.	.	.	T	0.001	-2.974842	0.00047	.	.	ENSG00000196678	ENST00000357967;ENST00000389345	T;T	0.15952	2.38;2.39	6.17	1.14	0.20703	.	1.346770	0.04751	N	0.424586	T	0.03651	0.0104	N	0.00170	-1.935	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.35895	-0.9770	10	0.02654	T	1	-0.1205	9.9626	0.41706	0.0:0.5853:0.0:0.4147	.	298	A8K979	ERI2_HUMAN	V	298;33	ENSP00000350651:I298V;ENSP00000373996:I33V	ENSP00000350651:I298V	I	-	1	0	ERI2	20717731	0.000000	0.05858	0.001000	0.08648	0.107000	0.19398	0.187000	0.16998	0.425000	0.26087	-0.993000	0.02533	ATT	.	.		0.323	ERI2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_080663	
OR5D16	390144	hgsc.bcm.edu	37	11	55606431	55606431	+	Silent	SNP	C	C	A			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr11:55606431C>A	ENST00000378396.1	+	1	204	c.204C>A	c.(202-204)ctC>ctA	p.L68L		NM_001005496.1	NP_001005496.1	Q8NGK9	OR5DG_HUMAN	olfactory receptor, family 5, subfamily D, member 16	68						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			cervix(1)|endometrium(2)|large_intestine(4)|lung(26)|ovary(5)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	44		all_epithelial(135;0.208)				TCAACCACCTCTCCTTTGTGG	0.433																																					p.L68L		.	.											.	OR5D16	.	.	0			c.C204A						.						193.0	189.0	190.0					11																	55606431		2201	4296	6497	SO:0001819	synonymous_variant	390144	exon1			CCACCTCTCCTTT	AB065783	CCDS31512.1	11q11	2012-08-09			ENSG00000205029	ENSG00000205029		"""GPCR / Class A : Olfactory receptors"""	15283	protein-coding gene	gene with protein product							Standard	NM_001005496		Approved		uc010rio.2	Q8NGK9	OTTHUMG00000154233	ENST00000378396.1:c.204C>A	11.37:g.55606431C>A		511.0	0.0		407.0	90.0	NM_001005496	Q6IF65|Q96RB4	Silent	SNP	ENST00000378396.1	37	CCDS31512.1																																																																																			.	.		0.433	OR5D16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334506.1	NM_001005496	
SSC4D	136853	hgsc.bcm.edu	37	7	76029631	76029631	+	Missense_Mutation	SNP	G	G	C			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr7:76029631G>C	ENST00000275560.3	-	4	794	c.447C>G	c.(445-447)caC>caG	p.H149Q	ZP3_ENST00000336517.4_Intron	NM_080744.1	NP_542782.1														autonomic_ganglia(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(2)|lung(9)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(1)	21						CATCCTCGTAGTGAAAGCAAT	0.637																																					p.H149Q		.	.											.	SRCRB4D	.	.	0			c.C447G						.						39.0	41.0	40.0					7																	76029631		2203	4299	6502	SO:0001583	missense	136853	exon4			CTCGTAGTGAAAG																												ENST00000275560.3:c.447C>G	7.37:g.76029631G>C	ENSP00000275560:p.His149Gln	184.0	0.0		147.0	51.0	NM_080744		Missense_Mutation	SNP	ENST00000275560.3	37	CCDS5585.1	.	.	.	.	.	.	.	.	.	.	G	25.4	4.634900	0.87760	.	.	ENSG00000146700	ENST00000275560	T	0.52526	0.66	5.45	5.45	0.79879	Speract/scavenger receptor (2);Speract/scavenger receptor-related (2);	0.102960	0.64402	D	0.000003	T	0.77698	0.4169	M	0.93763	3.455	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.82497	-0.0428	10	0.56958	D	0.05	.	18.644	0.91405	0.0:0.0:1.0:0.0	.	149	Q8WTU2	SRB4D_HUMAN	Q	149	ENSP00000275560:H149Q	ENSP00000275560:H149Q	H	-	3	2	SRCRB4D	75867567	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.800000	0.62524	2.722000	0.93159	0.563000	0.77884	CAC	.	.		0.637	SRCRB4D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253001.3		
HECW2	57520	hgsc.bcm.edu	37	2	197183465	197183465	+	Missense_Mutation	SNP	C	C	G			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr2:197183465C>G	ENST00000260983.3	-	9	2331	c.2149G>C	c.(2149-2151)Gat>Cat	p.D717H	HECW2_ENST00000409111.1_Missense_Mutation_p.D361H	NM_020760.1	NP_065811.1	Q9P2P5	HECW2_HUMAN	HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2	717					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			biliary_tract(1)|breast(3)|central_nervous_system(4)|cervix(2)|endometrium(7)|kidney(4)|large_intestine(24)|lung(45)|ovary(5)|pancreas(2)|prostate(2)|skin(10)|upper_aerodigestive_tract(2)|urinary_tract(2)	113						GGCCCTTCATCCTCCCCACTG	0.657																																					p.D717H		.	.											.	HECW2	.	.	0			c.G2149C						.						30.0	32.0	31.0					2																	197183465		2203	4300	6503	SO:0001583	missense	57520	exon9			CTTCATCCTCCCC	AL390186	CCDS33354.1	2q32.3	2004-12-13			ENSG00000138411	ENSG00000138411			29853	protein-coding gene	gene with protein product						10718198, 12890487	Standard	NM_020760		Approved	KIAA1301, NEDL2	uc002utm.1	Q9P2P5	OTTHUMG00000154435	ENST00000260983.3:c.2149G>C	2.37:g.197183465C>G	ENSP00000260983:p.Asp717His	163.0	0.0		127.0	9.0	NM_020760	B8ZZB4|Q17RT5|Q68DF8|Q9NPS9	Missense_Mutation	SNP	ENST00000260983.3	37	CCDS33354.1	.	.	.	.	.	.	.	.	.	.	C	13.61	2.287536	0.40494	.	.	ENSG00000138411	ENST00000409111;ENST00000260983	T;T	0.32023	1.47;1.47	4.91	4.91	0.64330	.	2.075770	0.01897	N	0.038942	T	0.26810	0.0656	N	0.08118	0	0.22479	N	0.999065	B	0.22480	0.07	B	0.23018	0.043	T	0.44832	-0.9302	10	0.51188	T	0.08	.	18.2942	0.90139	0.0:1.0:0.0:0.0	.	717	Q9P2P5	HECW2_HUMAN	H	361;717	ENSP00000386775:D361H;ENSP00000260983:D717H	ENSP00000260983:D717H	D	-	1	0	HECW2	196891710	0.976000	0.34144	0.982000	0.44146	0.982000	0.71751	3.304000	0.51866	2.558000	0.86282	0.462000	0.41574	GAT	.	.		0.657	HECW2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335199.3	NM_020760	
KIAA1147	57189	hgsc.bcm.edu	37	7	141362636	141362636	+	Missense_Mutation	SNP	T	T	G			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr7:141362636T>G	ENST00000536163.1	-	9	1187	c.1188A>C	c.(1186-1188)caA>caC	p.Q396H	RP5-894A10.6_ENST00000602609.1_RNA|KIAA1147_ENST00000482493.1_Missense_Mutation_p.Q292H	NM_001080392.1	NP_001073861.1	A4D1U4	LCHN_HUMAN	KIAA1147	396										breast(3)|endometrium(4)|kidney(2)|large_intestine(1)|ovary(1)|skin(1)	12	Melanoma(164;0.0171)					TCCGGTTGTTTTGTTCTAGGA	0.488																																					p.Q396H		.	.											.	KIAA1147	.	.	0			c.A1188C						.						29.0	29.0	29.0					7																	141362636		1846	4086	5932	SO:0001583	missense	57189	exon9			GTTGTTTTGTTCT	AB032973	CCDS47726.1	7q34	2012-10-04			ENSG00000257093	ENSG00000257093			29472	protein-coding gene	gene with protein product							Standard	NM_001080392		Approved	LCHN	uc003vwk.3	A4D1U4	OTTHUMG00000157539	ENST00000536163.1:c.1188A>C	7.37:g.141362636T>G	ENSP00000445768:p.Gln396His	99.0	0.0		118.0	39.0	NM_001080392	Q9ULS3	Missense_Mutation	SNP	ENST00000536163.1	37	CCDS47726.1	.	.	.	.	.	.	.	.	.	.	T	14.03	2.414595	0.42817	.	.	ENSG00000257093	ENST00000536163;ENST00000482493	.	.	.	5.3	-7.49	0.01355	.	0.063133	0.64402	D	0.000005	T	0.58235	0.2108	L	0.59436	1.845	0.41751	D	0.989669	B	0.09022	0.002	B	0.08055	0.003	T	0.19257	-1.0311	9	0.51188	T	0.08	-7.8517	18.9371	0.92590	0.0:0.7327:0.0:0.2673	.	396	A4D1U4	LCHN_HUMAN	H	396;292	.	ENSP00000297761:Q396H	Q	-	3	2	KIAA1147	141009105	0.170000	0.23016	0.858000	0.33744	0.970000	0.65996	-0.471000	0.06631	-1.425000	0.01997	-0.326000	0.08463	CAA	.	.		0.488	KIAA1147-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349104.1		
NGF	4803	hgsc.bcm.edu	37	1	115829018	115829018	+	Silent	SNP	G	G	A			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr1:115829018G>A	ENST00000369512.2	-	3	567	c.399C>T	c.(397-399)ttC>ttT	p.F133F	RP4-663N10.1_ENST00000425449.1_RNA	NM_002506.2	NP_002497.2	P01138	NGF_HUMAN	nerve growth factor (beta polypeptide)	133					activation of MAPKK activity (GO:0000186)|activation of phospholipase C activity (GO:0007202)|adult locomotory behavior (GO:0008344)|apoptotic signaling pathway (GO:0097190)|circadian rhythm (GO:0007623)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|inflammatory response (GO:0006954)|memory (GO:0007613)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell cycle (GO:0045786)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of type B pancreatic cell apoptotic process (GO:2000675)|nerve growth factor processing (GO:0032455)|neuron apoptotic process (GO:0051402)|neuron projection morphogenesis (GO:0048812)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peripheral nervous system development (GO:0007422)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of apoptotic process (GO:0043065)|positive regulation of axon extension (GO:0045773)|positive regulation of axonogenesis (GO:0050772)|positive regulation of gene expression (GO:0010628)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron maturation (GO:0014042)|positive regulation of neuron projection development (GO:0010976)|positive regulation of neurotrophin TRK receptor signaling pathway (GO:0051388)|positive regulation of protein autophosphorylation (GO:0031954)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of stem cell proliferation (GO:2000648)|Ras protein signal transduction (GO:0007265)|regulation of axonogenesis (GO:0050770)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of neurotransmitter secretion (GO:0046928)|response to drug (GO:0042493)|response to electrical stimulus (GO:0051602)|response to glucocorticoid (GO:0051384)|response to lipopolysaccharide (GO:0032496)|response to mechanical stimulus (GO:0009612)|response to nicotine (GO:0035094)|response to ozone (GO:0010193)|response to peptide hormone (GO:0043434)|response to radiation (GO:0009314)|sensory perception of pain (GO:0019233)|small GTPase mediated signal transduction (GO:0007264)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	endosome (GO:0005768)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)	nerve growth factor receptor binding (GO:0005163)|receptor signaling protein activity (GO:0005057)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(2)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)	13	Lung SC(450;0.211)	all_cancers(81;1.07e-06)|all_epithelial(167;4.43e-06)|all_lung(203;2.86e-05)|Lung NSC(69;4.99e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)|all cancers(265;0.159)|Epithelial(280;0.179)	Clenbuterol(DB01407)	CACACACCGAGAATTCGCCCC	0.562																																					p.F133F		.	.											.	NGF	.	.	0			c.C399T						.						92.0	78.0	83.0					1																	115829018		2203	4300	6503	SO:0001819	synonymous_variant	4803	exon3			CACCGAGAATTCG		CCDS882.1	1p13.1	2014-09-17	2008-02-07	2008-02-07	ENSG00000134259	ENSG00000134259		"""Endogenous ligands"""	7808	protein-coding gene	gene with protein product		162030		NGFB			Standard	XM_006710663		Approved		uc001efu.1	P01138	OTTHUMG00000011880	ENST00000369512.2:c.399C>T	1.37:g.115829018G>A		158.0	0.0		143.0	60.0	NM_002506	A1A4E5|Q6FHA0|Q96P60|Q9P2Q8|Q9UKL8	Silent	SNP	ENST00000369512.2	37	CCDS882.1																																																																																			.	.		0.562	NGF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032832.1	NM_002506	
C4BPA	722	hgsc.bcm.edu	37	1	207318042	207318042	+	Missense_Mutation	SNP	A	A	T			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr1:207318042A>T	ENST00000367070.3	+	12	1968	c.1774A>T	c.(1774-1776)Act>Tct	p.T592S		NM_000715.3	NP_000706.1	P04003	C4BPA_HUMAN	complement component 4 binding protein, alpha	592					complement activation, classical pathway (GO:0006958)|innate immune response (GO:0045087)|negative regulation of complement activation, classical pathway (GO:0045959)|positive regulation of protein catabolic process (GO:0045732)|regulation of complement activation (GO:0030449)|regulation of opsonization (GO:1903027)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|other organism cell (GO:0044216)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(10)|lung(7)|ovary(2)|skin(1)|urinary_tract(2)	28						AAGACAATCCACTTTGGATAA	0.413																																					p.T592S		.	.											.	C4BPA	.	.	0			c.A1774T						.						39.0	39.0	39.0					1																	207318042		2203	4300	6503	SO:0001583	missense	722	exon12			CAATCCACTTTGG	M31452	CCDS1477.1	1q32	2010-09-24	2001-11-28		ENSG00000123838	ENSG00000123838			1325	protein-coding gene	gene with protein product		120830	"""complement component 4-binding protein, alpha"""	C4BP			Standard	XM_005273251		Approved		uc001hfo.3	P04003	OTTHUMG00000036173	ENST00000367070.3:c.1774A>T	1.37:g.207318042A>T	ENSP00000356037:p.Thr592Ser	84.0	0.0		150.0	17.0	NM_000715	Q5VVQ8	Missense_Mutation	SNP	ENST00000367070.3	37	CCDS1477.1	.	.	.	.	.	.	.	.	.	.	A	3.375	-0.127570	0.06753	.	.	ENSG00000123838	ENST00000367070	T	0.29917	1.55	4.07	-4.11	0.03928	.	2.128780	0.01768	N	0.030972	T	0.13329	0.0323	N	0.12182	0.205	0.09310	N	1	B	0.11235	0.004	B	0.10450	0.005	T	0.10109	-1.0644	10	0.11485	T	0.65	.	1.5392	0.02551	0.3172:0.1575:0.3709:0.1544	.	592	P04003	C4BPA_HUMAN	S	592	ENSP00000356037:T592S	ENSP00000356037:T592S	T	+	1	0	C4BPA	205384665	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.214000	0.09292	-0.932000	0.03742	-0.250000	0.11733	ACT	.	.		0.413	C4BPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088089.3		
C2orf42	54980	hgsc.bcm.edu	37	2	70408519	70408519	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr2:70408519C>T	ENST00000264434.2	-	3	978	c.599G>A	c.(598-600)aGt>aAt	p.S200N	C2orf42_ENST00000420306.1_Missense_Mutation_p.S200N|C2orf42_ENST00000470096.1_5'Flank	NM_017880.1	NP_060350.1	Q9NWW7	CB042_HUMAN	chromosome 2 open reading frame 42	200										endometrium(2)|large_intestine(4)|lung(4)|prostate(1)|urinary_tract(1)	12						ATACCCCAAACTGTGCTTCTG	0.498																																					p.S200N		.	.											.	C2orf42	.	.	0			c.G599A						.						119.0	117.0	118.0					2																	70408519		2203	4300	6503	SO:0001583	missense	54980	exon3			CCCAAACTGTGCT	AK000565	CCDS1899.1	2p14	2011-03-08			ENSG00000115998	ENSG00000115998			26056	protein-coding gene	gene with protein product						12477932	Standard	XM_005264389		Approved	FLJ20558	uc002sgh.3	Q9NWW7	OTTHUMG00000129642	ENST00000264434.2:c.599G>A	2.37:g.70408519C>T	ENSP00000264434:p.Ser200Asn	150.0	0.0		123.0	20.0	NM_017880	D6W5G3|Q9H629	Missense_Mutation	SNP	ENST00000264434.2	37	CCDS1899.1	.	.	.	.	.	.	.	.	.	.	C	11.88	1.772148	0.31411	.	.	ENSG00000115998	ENST00000264434;ENST00000420306	T;T	0.44482	0.92;0.92	4.96	4.07	0.47477	.	0.138843	0.64402	N	0.000003	T	0.26810	0.0656	N	0.19112	0.55	0.34079	D	0.659377	B	0.02656	0.0	B	0.04013	0.001	T	0.27739	-1.0065	10	0.26408	T	0.33	-18.7241	11.3326	0.49485	0.0:0.9096:0.0:0.0904	.	200	Q9NWW7	CB042_HUMAN	N	200	ENSP00000264434:S200N;ENSP00000404515:S200N	ENSP00000264434:S200N	S	-	2	0	C2orf42	70262023	1.000000	0.71417	0.989000	0.46669	0.984000	0.73092	4.717000	0.61923	1.286000	0.44565	0.485000	0.47835	AGT	.	.		0.498	C2orf42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251840.1	NM_017880	
NPSR1	387129	hgsc.bcm.edu	37	7	34888201	34888201	+	Missense_Mutation	SNP	C	C	A			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr7:34888201C>A	ENST00000360581.1	+	8	1079	c.951C>A	c.(949-951)aaC>aaA	p.N317K	NPSR1_ENST00000359791.1_Missense_Mutation_p.N317K|NPSR1_ENST00000381542.1_Missense_Mutation_p.N251K|NPSR1_ENST00000531252.1_Missense_Mutation_p.N306K|NPSR1_ENST00000381539.3_Missense_Mutation_p.N317K	NM_207172.1	NP_997055.1	Q6W5P4	NPSR1_HUMAN	neuropeptide S receptor 1	317						cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	neuropeptide receptor activity (GO:0008188)|vasopressin receptor activity (GO:0005000)			endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(5)|lung(14)|pancreas(1)|skin(7)	31					Halothane(DB01159)	TCATTCAGAACCTGCCAGCAT	0.498																																					p.N317K		.	.											.	NPSR1	.	.	0			c.C951A						.						231.0	219.0	223.0					7																	34888201		2203	4300	6503	SO:0001583	missense	387129	exon8			TCAGAACCTGCCA	AY255536	CCDS5443.1, CCDS5444.1, CCDS75579.1, CCDS75580.1, CCDS75581.1	7p14.3	2012-08-08	2006-05-10	2006-05-10	ENSG00000187258	ENSG00000187258		"""GPCR / Class A : Neuropeptide receptors : S"""	23631	protein-coding gene	gene with protein product		608595	"""G protein-coupled receptor 154"""	GPR154		12679517, 15073379	Standard	NM_207173		Approved	PGR14, GPRA	uc003tei.1	Q6W5P4	OTTHUMG00000099383	ENST00000360581.1:c.951C>A	7.37:g.34888201C>A	ENSP00000353788:p.Asn317Lys	265.0	0.0		225.0	86.0	NM_207172	A2RTZ4|Q2XP58|Q56H76|Q56H77|Q56H78|Q6JSL4|Q6JSL5|Q6JSL6|Q6JSL7|Q6JSL8|Q6W5P3|Q6ZMB8	Missense_Mutation	SNP	ENST00000360581.1	37	CCDS5444.1	.	.	.	.	.	.	.	.	.	.	C	19.13	3.767081	0.69878	.	.	ENSG00000187258	ENST00000360581;ENST00000381542;ENST00000359791;ENST00000531252;ENST00000381539;ENST00000334481	T;T;T;T;T	0.71698	-0.59;-0.59;-0.59;-0.59;-0.59	5.37	4.49	0.54785	GPCR, rhodopsin-like superfamily (1);	0.000000	0.64402	D	0.000003	T	0.72590	0.3479	L	0.34521	1.04	0.44098	D	0.996867	D;D;D;P;D;P	0.64830	0.994;0.99;0.993;0.887;0.99;0.775	D;P;P;P;P;P	0.64506	0.926;0.797;0.879;0.669;0.797;0.697	T	0.72161	-0.4374	10	0.44086	T	0.13	-41.3813	9.8026	0.40773	0.0:0.8456:0.0:0.1544	.	251;306;251;317;317;317	B7ZMA2;Q6W5P4-5;Q6W5P4-2;Q6W5P4-4;Q6W5P4-3;Q6W5P4	.;.;.;.;.;NPSR1_HUMAN	K	317;251;317;306;317;120	ENSP00000353788:N317K;ENSP00000370953:N251K;ENSP00000352839:N317K;ENSP00000433258:N306K;ENSP00000370950:N317K	ENSP00000334093:N120K	N	+	3	2	NPSR1	34854726	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	1.086000	0.30853	1.513000	0.48852	-0.126000	0.14955	AAC	.	.		0.498	NPSR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216837.1	NM_207173	
RING1	6015	hgsc.bcm.edu	37	6	33177781	33177781	+	Missense_Mutation	SNP	T	T	G			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr6:33177781T>G	ENST00000374656.4	+	4	537	c.329T>G	c.(328-330)aTc>aGc	p.I110S	MIR219-1_ENST00000362166.1_RNA|RING1_ENST00000478431.1_3'UTR	NM_002931.3	NP_002922.2	Q06587	RING1_HUMAN	ring finger protein 1	110	Necessary for transcriptional repression. {ECO:0000250}.				anterior/posterior pattern specification (GO:0009952)|camera-type eye morphogenesis (GO:0048593)|histone H2A monoubiquitination (GO:0035518)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)|sex chromatin (GO:0001739)	chromatin binding (GO:0003682)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.I110S(1)		endometrium(5)|large_intestine(1)|lung(3)|ovary(2)|prostate(2)|skin(4)	17						ATCTCTAAGATCTATCCTAGC	0.567																																					p.I110S		.	.											RING1,NS,carcinoma,0	RING1	.	.	1	Substitution - Missense(1)	ovary(1)	c.T329G						.						70.0	63.0	66.0					6																	33177781		2203	4300	6503	SO:0001583	missense	6015	exon4			CTAAGATCTATCC		CCDS34424.1	6p21.3	2013-01-09			ENSG00000204227	ENSG00000204227		"""RING-type (C3HC4) zinc fingers"""	10018	protein-coding gene	gene with protein product		602045				1906426	Standard	NM_002931		Approved	RNF1	uc003odk.3	Q06587	OTTHUMG00000031278	ENST00000374656.4:c.329T>G	6.37:g.33177781T>G	ENSP00000363787:p.Ile110Ser	102.0	0.0		132.0	39.0	NM_002931	A8JZZ0|Q5JP96|Q5SQW2|Q86V19	Missense_Mutation	SNP	ENST00000374656.4	37	CCDS34424.1	.	.	.	.	.	.	.	.	.	.	T	19.25	3.791731	0.70452	.	.	ENSG00000204227	ENST00000374656	D	0.85702	-2.02	4.23	4.23	0.50019	Zinc finger, RING/FYVE/PHD-type (1);	0.000000	0.64402	D	0.000001	D	0.89206	0.6649	M	0.73598	2.24	0.58432	D	0.999997	D	0.71674	0.998	D	0.83275	0.996	D	0.90554	0.4511	10	0.87932	D	0	-27.3229	11.3179	0.49403	0.0:0.0:0.0:1.0	.	110	Q06587	RING1_HUMAN	S	110	ENSP00000363787:I110S	ENSP00000363787:I110S	I	+	2	0	RING1	33285759	1.000000	0.71417	0.997000	0.53966	0.918000	0.54935	7.463000	0.80869	1.767000	0.52121	0.443000	0.29094	ATC	.	.		0.567	RING1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076609.2		
OR2B11	127623	hgsc.bcm.edu	37	1	247614658	247614658	+	Missense_Mutation	SNP	G	G	T			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr1:247614658G>T	ENST00000318749.6	-	1	650	c.627C>A	c.(625-627)ttC>ttA	p.F209L		NM_001004492.1	NP_001004492.1	Q5JQS5	OR2BB_HUMAN	olfactory receptor, family 2, subfamily B, member 11	209						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(3)|kidney(13)|large_intestine(7)|lung(31)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)	60	all_cancers(71;4.51e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.241)	OV - Ovarian serous cystadenocarcinoma(106;0.0188)			CCAACACGAAGAAGGCCACCA	0.562																																					p.F209L		.	.											.	OR2B11	.	.	0			c.C627A						.						65.0	68.0	67.0					1																	247614658		2203	4300	6503	SO:0001583	missense	127623	exon1			CACGAAGAAGGCC		CCDS31090.1	1q44	2012-08-09			ENSG00000177535	ENSG00000177535		"""GPCR / Class A : Olfactory receptors"""	31249	protein-coding gene	gene with protein product							Standard	NM_001004492		Approved		uc010pyx.2	Q5JQS5	OTTHUMG00000040572	ENST00000318749.6:c.627C>A	1.37:g.247614658G>T	ENSP00000325682:p.Phe209Leu	93.0	0.0		111.0	34.0	NM_001004492	B2RP03	Missense_Mutation	SNP	ENST00000318749.6	37	CCDS31090.1	.	.	.	.	.	.	.	.	.	.	G	1.854	-0.464310	0.04476	.	.	ENSG00000177535	ENST00000318749	T	0.34667	1.35	5.09	4.18	0.49190	GPCR, rhodopsin-like superfamily (1);	0.460023	0.20562	N	0.089897	T	0.14657	0.0354	N	0.02708	-0.52	0.30174	N	0.800983	B	0.26775	0.159	B	0.27887	0.084	T	0.15549	-1.0433	10	0.07813	T	0.8	.	11.4177	0.49962	0.0873:0.0:0.9127:0.0	.	209	Q5JQS5	OR2BB_HUMAN	L	209	ENSP00000325682:F209L	ENSP00000325682:F209L	F	-	3	2	OR2B11	245681281	0.000000	0.05858	1.000000	0.80357	0.554000	0.35429	0.216000	0.17585	1.524000	0.49035	0.643000	0.83706	TTC	.	.		0.562	OR2B11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097620.1	NM_001004492	
PCDHGA10	56106	hgsc.bcm.edu	37	5	140793274	140793274	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr5:140793274C>T	ENST00000398610.2	+	1	532	c.532C>T	c.(532-534)Ccc>Tcc	p.P178S	PCDHGB2_ENST00000522605.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA9_ENST00000573521.1_Intron|PCDHGB6_ENST00000520790.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGB1_ENST00000523390.1_Intron	NM_018913.2|NM_032090.1	NP_061736.1|NP_114479.1	Q9Y5H3	PCDGA_HUMAN	protocadherin gamma subfamily A, 10	178	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(15)|ovary(1)|prostate(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	43			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TCAGCTCAGCCCCAATAAGCA	0.532																																					p.P178S		.	.											.	.	.	.	0			c.C532T						.						33.0	35.0	34.0					5																	140793274		1950	4141	6091	SO:0001583	missense	56106	exon1			CTCAGCCCCAATA		CCDS47292.1, CCDS75343.1	5q31	2010-01-26			ENSG00000253846	ENSG00000253846		"""Cadherins / Protocadherins : Clustered"""	8697	other	protocadherin		606297				10380929	Standard	NM_018913		Approved	PCDH-GAMMA-A10		Q9Y5H3	OTTHUMG00000163688	ENST00000398610.2:c.532C>T	5.37:g.140793274C>T	ENSP00000381611:p.Pro178Ser	72.0	0.0		72.0	13.0	NM_032090	Q9Y5E0	Missense_Mutation	SNP	ENST00000398610.2	37	CCDS47292.1	.	.	.	.	.	.	.	.	.	.	c	3.205	-0.162954	0.06502	.	.	ENSG00000253846	ENST00000398610	T	0.18174	2.23	5.49	2.57	0.30868	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.09598	0.0236	N	0.25890	0.77	0.09310	N	1	B;B	0.12013	0.004;0.005	B;B	0.21360	0.02;0.034	T	0.41734	-0.9492	9	0.16420	T	0.52	.	2.3261	0.04223	0.1124:0.4548:0.2091:0.2238	.	178;178	Q9Y5H3-2;Q9Y5H3	.;PCDGA_HUMAN	S	178	ENSP00000381611:P178S	ENSP00000381611:P178S	P	+	1	0	PCDHGA10	140773458	0.000000	0.05858	0.951000	0.38953	0.657000	0.38888	-0.837000	0.04377	0.214000	0.20742	0.557000	0.71058	CCC	.	.		0.532	PCDHGA10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374747.1	NM_018913	
TUBA3C	7278	hgsc.bcm.edu	37	13	19751669	19751669	+	Missense_Mutation	SNP	G	G	C			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr13:19751669G>C	ENST00000400113.3	-	4	558	c.454C>G	c.(454-456)Ctg>Gtg	p.L152V		NM_006001.2	NP_005992.1	Q13748	TBA3C_HUMAN	tubulin, alpha 3c	152					'de novo' posttranslational protein folding (GO:0051084)|cellular protein metabolic process (GO:0044267)|microtubule-based process (GO:0007017)|protein folding (GO:0006457)|protein polymerization (GO:0051258)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|biliary_tract(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(33)|ovary(4)|prostate(7)|skin(7)|urinary_tract(1)	72		all_cancers(29;1.31e-20)|all_epithelial(30;1.59e-20)|all_lung(29;6.91e-20)|Lung NSC(5;9.25e-17)|Hepatocellular(1;0.0207)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;6.78e-06)|Epithelial(112;3.79e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00172)|Lung(94;0.0186)|LUSC - Lung squamous cell carcinoma(192;0.108)		TCCATGAGCAGAGATGCGAAC	0.582																																					p.L152V		.	.											.	TUBA3C	.	.	0			c.C454G						.						74.0	77.0	76.0					13																	19751669		2203	4300	6503	SO:0001583	missense	7278	exon4			TGAGCAGAGATGC	AF005392	CCDS9284.1	13q12.11	2007-06-20	2007-02-12	2007-02-12	ENSG00000198033	ENSG00000198033		"""Tubulins"""	12408	protein-coding gene	gene with protein product		602528	"""tubulin, alpha 2"""	TUBA2		9465305	Standard	NM_006001		Approved	bA408E5.3	uc009zzj.3	Q13748	OTTHUMG00000016481	ENST00000400113.3:c.454C>G	13.37:g.19751669G>C	ENSP00000382982:p.Leu152Val	570.0	0.0		358.0	78.0	NM_006001	A6NJQ0|Q5W099|Q6PEY3|Q96F18	Missense_Mutation	SNP	ENST00000400113.3	37	CCDS9284.1	.	.	.	.	.	.	.	.	.	.	g	5.266	0.234455	0.09969	.	.	ENSG00000198033	ENST00000400113;ENST00000360801	T	0.68903	-0.36	1.19	0.282	0.15692	.	0.000000	0.38548	U	0.001649	T	0.66167	0.2762	.	.	.	0.35405	D	0.791932	.	.	.	.	.	.	T	0.68769	-0.5321	7	0.87932	D	0	.	5.2966	0.15756	0.2219:0.0:0.7781:0.0	.	.	.	.	V	152	ENSP00000382982:L152V	ENSP00000354037:L152V	L	-	1	2	TUBA3C	18649669	1.000000	0.71417	0.996000	0.52242	0.189000	0.23516	4.940000	0.63533	0.075000	0.16796	0.162000	0.16502	CTG	.	.		0.582	TUBA3C-002	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044007.2	NM_006001	
SUPT6H	6830	hgsc.bcm.edu	37	17	27001353	27001353	+	Missense_Mutation	SNP	G	G	T			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr17:27001353G>T	ENST00000314616.6	+	3	445	c.162G>T	c.(160-162)ttG>ttT	p.L54F	SUPT6H_ENST00000347486.4_Missense_Mutation_p.L54F|AC010761.13_ENST00000578819.1_RNA	NM_003170.3	NP_003161.2	Q7KZ85	SPT6H_HUMAN	suppressor of Ty 6 homolog (S. cerevisiae)	54	Asp/Glu-rich.|Interaction with IWS1. {ECO:0000250}.|Interaction with PAAF1.				chromatin remodeling (GO:0006338)|mRNA processing (GO:0006397)|mRNA transport (GO:0051028)|negative regulation of histone H3-K27 methylation (GO:0061086)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|regulation of isotype switching (GO:0045191)|regulation of mRNA export from nucleus (GO:0010793)|regulation of mRNA processing (GO:0050684)|regulation of muscle cell differentiation (GO:0051147)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone binding (GO:0042393)|hydrolase activity, acting on ester bonds (GO:0016788)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(4)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(15)|lung(21)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	64	Lung NSC(42;0.00431)					AAGGCAACTTGAAAGGCTTTA	0.468																																					p.L54F		.	.											.	SUPT6H	.	.	0			c.G162T						.						160.0	122.0	135.0					17																	27001353		2203	4300	6503	SO:0001583	missense	6830	exon3			CAACTTGAAAGGC	U38658	CCDS32596.1	17q11.2	2013-02-14	2001-11-28			ENSG00000109111		"""SH2 domain containing"""	11470	protein-coding gene	gene with protein product		601333	"""suppressor of Ty (S.cerevisiae) 6 homolog"""			8786132	Standard	XM_005258026		Approved	KIAA0162, SPT6H	uc002hby.3	Q7KZ85		ENST00000314616.6:c.162G>T	17.37:g.27001353G>T	ENSP00000319104:p.Leu54Phe	192.0	0.0		284.0	31.0	NM_003170	A7E2B4|Q15737|Q6GMQ4|Q7KYW9|Q7LDK4|Q8N526|Q92775|Q96AH3|Q9BTH9|Q9BTI2	Missense_Mutation	SNP	ENST00000314616.6	37	CCDS32596.1	.	.	.	.	.	.	.	.	.	.	G	14.22	2.469003	0.43839	.	.	ENSG00000109111	ENST00000314616;ENST00000347486	.	.	.	5.92	-0.0841	0.13691	.	0.000000	0.64402	D	0.000001	T	0.36138	0.0956	N	0.08118	0	0.58432	D	0.999991	D	0.65815	0.995	D	0.70487	0.969	T	0.29941	-0.9995	9	0.10377	T	0.69	-11.5806	6.4959	0.22142	0.222:0.2314:0.5466:0.0	.	54	Q7KZ85	SPT6H_HUMAN	F	54	.	ENSP00000319104:L54F	L	+	3	2	SUPT6H	24025480	0.985000	0.35326	0.990000	0.47175	0.988000	0.76386	0.138000	0.16016	-0.202000	0.10268	-0.176000	0.13171	TTG	.	.		0.468	SUPT6H-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446422.2	NM_003170	
LRP11	84918	hgsc.bcm.edu	37	6	150174142	150174142	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr6:150174142C>T	ENST00000239367.2	-	2	773	c.768G>A	c.(766-768)atG>atA	p.M256I	LRP11_ENST00000546019.1_Start_Codon_SNP_p.M1I|LRP11_ENST00000367368.2_Missense_Mutation_p.M256I|RP11-350J20.12_ENST00000472053.2_RNA	NM_032832.5	NP_116221.3	Q86VZ4	LRP11_HUMAN	low density lipoprotein receptor-related protein 11	256	PKD. {ECO:0000255|PROSITE- ProRule:PRU00151}.					integral component of membrane (GO:0016021)		p.M256I(1)		cervix(1)|kidney(5)|large_intestine(1)|lung(1)	8		Ovarian(120;0.0907)	BRCA - Breast invasive adenocarcinoma(37;0.193)	OV - Ovarian serous cystadenocarcinoma(155;4.56e-12)|GBM - Glioblastoma multiforme(68;0.225)		GCGTTACCTTCATGTCCACTG	0.527																																					p.M256I		.	.											.	LRP11	.	.	1	Substitution - Missense(1)	kidney(1)	c.G768A						.						88.0	79.0	82.0					6																	150174142		2203	4300	6503	SO:0001583	missense	84918	exon2			TACCTTCATGTCC	AK027641	CCDS5220.1	6q24.3	2013-02-27			ENSG00000120256	ENSG00000120256		"""Low density lipoprotein receptors"""	16936	protein-coding gene	gene with protein product							Standard	NM_032832		Approved	bA350J20.3, MANSC3	uc003qng.2	Q86VZ4	OTTHUMG00000015801	ENST00000239367.2:c.768G>A	6.37:g.150174142C>T	ENSP00000239367:p.Met256Ile	199.0	0.0		146.0	57.0	NM_032832	Q5VYC0|Q96SN6	Missense_Mutation	SNP	ENST00000239367.2	37	CCDS5220.1	.	.	.	.	.	.	.	.	.	.	C	35	5.536507	0.96460	.	.	ENSG00000120256	ENST00000239367;ENST00000546019;ENST00000367368	T;D;T	0.97066	3.57;-4.23;2.86	5.45	5.45	0.79879	PKD/Chitinase domain (1);PKD domain (3);	0.077012	0.85682	D	0.000000	D	0.96056	0.8715	L	0.35644	1.08	0.80722	D	1	D;D	0.65815	0.995;0.984	P;P	0.59115	0.852;0.724	D	0.95362	0.8456	10	0.36615	T	0.2	-14.4133	16.2004	0.82067	0.0:1.0:0.0:0.0	.	256;256	Q5VYB9;Q86VZ4	.;LRP11_HUMAN	I	256;1;256	ENSP00000239367:M256I;ENSP00000440196:M1I;ENSP00000356338:M256I	ENSP00000239367:M256I	M	-	3	0	LRP11	150215835	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	4.146000	0.58072	2.562000	0.86427	0.591000	0.81541	ATG	.	.		0.527	LRP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042664.1	NM_032832	
LAMA3	3909	hgsc.bcm.edu	37	18	21331052	21331052	+	Splice_Site	SNP	G	G	T			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr18:21331052G>T	ENST00000313654.9	+	5	1096	c.855G>T	c.(853-855)cgG>cgT	p.R285R	LAMA3_ENST00000399516.3_Splice_Site_p.R285R	NM_198129.1	NP_937762.1	Q16787	LAMA3_HUMAN	laminin, alpha 3	285	Laminin N-terminal. {ECO:0000255|PROSITE- ProRule:PRU00466}.				cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|endodermal cell differentiation (GO:0035987)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-5 complex (GO:0005610)	structural molecule activity (GO:0005198)			NS(2)|breast(4)|central_nervous_system(3)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(24)|lung(54)|ovary(8)|prostate(6)|skin(7)|urinary_tract(4)	128	all_cancers(21;7.81e-05)|all_epithelial(16;4.45e-07)|Lung NSC(20;0.00156)|all_lung(20;0.00508)|Colorectal(14;0.0202)|Ovarian(20;0.17)					TCACTCGGCGGGTGAGTAGTC	0.403																																					p.R285R		.	.											.	LAMA3	.	.	0			c.G855T						.						84.0	83.0	83.0					18																	21331052		1861	4108	5969	SO:0001630	splice_region_variant	3909	exon5			TCGGCGGGTGAGT	L34155	CCDS11880.1, CCDS42419.1, CCDS45838.1, CCDS59307.1	18q11.2	2013-03-01	2002-08-29		ENSG00000053747	ENSG00000053747		"""Laminins"""	6483	protein-coding gene	gene with protein product		600805	"""laminin, alpha 3 (nicein (150kD), kalinin (165kD), BM600 (150kD), epilegrin)"""	LAMNA		8077230	Standard	NM_000227		Approved	nicein-150kDa, kalinin-165kDa, BM600-150kDa, epiligrin	uc002kuq.3	Q16787	OTTHUMG00000131874	ENST00000313654.9:c.855+1G>T	18.37:g.21331052G>T		161.0	0.0		111.0	28.0	NM_001127717	B0YJ33|Q13679|Q13680|Q6VU67|Q6VU68|Q6VU69|Q76E14|Q96TG0	Silent	SNP	ENST00000313654.9	37	CCDS42419.1																																																																																			.	.		0.403	LAMA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254824.3	NM_000227, NM_198129	Silent
FGD4	121512	hgsc.bcm.edu	37	12	32760995	32760995	+	Silent	SNP	G	G	A			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr12:32760995G>A	ENST00000427716.2	+	8	1522	c.1098G>A	c.(1096-1098)ttG>ttA	p.L366L	FGD4_ENST00000534526.2_Silent_p.L503L|FGD4_ENST00000381025.3_Silent_p.L118L|FGD4_ENST00000266482.3_Silent_p.L118L|FGD4_ENST00000525053.1_Silent_p.L478L|FGD4_ENST00000531134.1_Silent_p.L451L|FGD4_ENST00000546442.1_Silent_p.L273L	NM_139241.2	NP_640334.2	Q96M96	FGD4_HUMAN	FYVE, RhoGEF and PH domain containing 4	366	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|cytoskeleton organization (GO:0007010)|filopodium assembly (GO:0046847)|lamellipodium assembly (GO:0030032)|microspike assembly (GO:0030035)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of Cdc42 GTPase activity (GO:0043088)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|filopodium (GO:0030175)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|ruffle (GO:0001726)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|small GTPase binding (GO:0031267)			breast(1)|central_nervous_system(1)|cervix(1)|kidney(2)|large_intestine(5)|lung(7)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	27	Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.204)					TAAGGAAATTGCCTCCTGATT	0.418																																					p.L366L		.	.											.	FGD4	.	.	0			c.G1098A						.						165.0	163.0	164.0					12																	32760995		2203	4300	6503	SO:0001819	synonymous_variant	121512	exon8			GAAATTGCCTCCT	AK057294	CCDS8727.1	12p11.1	2014-09-17	2004-08-24		ENSG00000139132	ENSG00000139132		"""Zinc fingers, FYVE domain containing"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	19125	protein-coding gene	gene with protein product		611104	"""FGD1 family, member 4"""			11527409	Standard	NM_139241		Approved	FRABP, frabin, ZFYVE6, CMT4H	uc001rkz.3	Q96M96	OTTHUMG00000137374	ENST00000427716.2:c.1098G>A	12.37:g.32760995G>A		344.0	0.0		328.0	109.0	NM_139241	Q6ULS2|Q8TCP6	Silent	SNP	ENST00000427716.2	37	CCDS8727.1																																																																																			.	.		0.418	FGD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268017.1	NM_139241	
RTTN	25914	hgsc.bcm.edu	37	18	67794864	67794864	+	Missense_Mutation	SNP	C	C	A	rs199762299		TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr18:67794864C>A	ENST00000255674.6	-	25	3543	c.3257G>T	c.(3256-3258)aGg>aTg	p.R1086M	RTTN_ENST00000454359.1_3'UTR|RTTN_ENST00000437017.1_Missense_Mutation_p.R1086M	NM_173630.3	NP_775901.3	Q86VV8	RTTN_HUMAN	rotatin	1086					determination of left/right symmetry (GO:0007368)	ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)				NS(1)|breast(3)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(9)|lung(35)|ovary(4)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	80		Esophageal squamous(42;0.129)				CCTAACTTCCCTGTGGGTTGC	0.483																																					p.R1086M		.	.											.	RTTN	.	.	0			c.G3257T						.						66.0	65.0	65.0					18																	67794864		1930	4135	6065	SO:0001583	missense	25914	exon25			ACTTCCCTGTGGG	AL117635	CCDS42443.1	18q22.1	2008-08-01				ENSG00000176225			18654	protein-coding gene	gene with protein product		610436				11900971	Standard	NM_173630		Approved	DKFZP434G145	uc002lkp.2	Q86VV8		ENST00000255674.6:c.3257G>T	18.37:g.67794864C>A	ENSP00000255674:p.Arg1086Met	94.0	0.0		71.0	55.0	NM_173630	Q68CS9|Q6ZRL8|Q6ZTK3|Q86TG4|Q8N8N8|Q8TBQ4|Q96IN9|Q9UFJ4	Missense_Mutation	SNP	ENST00000255674.6	37	CCDS42443.1	.	.	.	.	.	.	.	.	.	.	C	21.1	4.097593	0.76870	.	.	ENSG00000176225	ENST00000255674;ENST00000437017	T;T	0.21734	1.99;1.99	5.37	4.3	0.51218	.	0.326303	0.35235	N	0.003348	T	0.36331	0.0963	L	0.56769	1.78	0.80722	D	1	D	0.65815	0.995	P	0.56823	0.807	T	0.09707	-1.0662	10	0.54805	T	0.06	.	14.9358	0.70954	0.0:0.919:0.0:0.081	.	1086	Q86VV8	RTTN_HUMAN	M	1086	ENSP00000255674:R1086M;ENSP00000399520:R1086M	ENSP00000255674:R1086M	R	-	2	0	RTTN	65945844	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	3.412000	0.52679	2.511000	0.84671	0.650000	0.86243	AGG	C|0.999;G|0.000	.		0.483	RTTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442988.1	NM_173630	
RBMXL3	139804	hgsc.bcm.edu	37	X	114426299	114426299	+	Silent	SNP	C	C	T			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chrX:114426299C>T	ENST00000424776.3	+	1	2337	c.2295C>T	c.(2293-2295)gaC>gaT	p.D765D	LRCH2_ENST00000317135.8_Intron|LRCH2_ENST00000538422.1_Intron	NM_001145346.1	NP_001138818.1	Q8N7X1	RMXL3_HUMAN	RNA binding motif protein, X-linked-like 3	765	Gly-rich.						nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			endometrium(13)|kidney(2)|skin(1)	16						GGGGCCATGACAGTTCCAGCC	0.652																																					p.D765D		.	.											.	.	.	.	0			c.C2295T						.						34.0	38.0	37.0					X																	114426299		692	1590	2282	SO:0001819	synonymous_variant	139804	exon1			CCATGACAGTTCC	AK097568	CCDS55478.1	Xq23	2013-02-12	2009-03-24	2009-03-24	ENSG00000175718	ENSG00000175718		"""RNA binding motif (RRM) containing"""	26859	protein-coding gene	gene with protein product			"""chromosome X open reading frame 55"""	CXorf55			Standard	NM_001145346		Approved	FLJ40249	uc011mte.1	Q8N7X1	OTTHUMG00000022230	ENST00000424776.3:c.2295C>T	X.37:g.114426299C>T		113.0	0.0		50.0	37.0	NM_001145346	B4DXC0	Silent	SNP	ENST00000424776.3	37	CCDS55478.1																																																																																			.	.		0.652	RBMXL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057968.3	NM_001145346	
RTTN	25914	hgsc.bcm.edu	37	18	67794863	67794863	+	Missense_Mutation	SNP	C	C	A			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr18:67794863C>A	ENST00000255674.6	-	25	3544	c.3258G>T	c.(3256-3258)agG>agT	p.R1086S	RTTN_ENST00000454359.1_3'UTR|RTTN_ENST00000437017.1_Missense_Mutation_p.R1086S	NM_173630.3	NP_775901.3	Q86VV8	RTTN_HUMAN	rotatin	1086					determination of left/right symmetry (GO:0007368)	ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)				NS(1)|breast(3)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(9)|lung(35)|ovary(4)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	80		Esophageal squamous(42;0.129)				CCCTAACTTCCCTGTGGGTTG	0.483																																					p.R1086S		.	.											.	RTTN	.	.	0			c.G3258T						.						66.0	65.0	65.0					18																	67794863		1931	4135	6066	SO:0001583	missense	25914	exon25			AACTTCCCTGTGG	AL117635	CCDS42443.1	18q22.1	2008-08-01				ENSG00000176225			18654	protein-coding gene	gene with protein product		610436				11900971	Standard	NM_173630		Approved	DKFZP434G145	uc002lkp.2	Q86VV8		ENST00000255674.6:c.3258G>T	18.37:g.67794863C>A	ENSP00000255674:p.Arg1086Ser	93.0	0.0		71.0	55.0	NM_173630	Q68CS9|Q6ZRL8|Q6ZTK3|Q86TG4|Q8N8N8|Q8TBQ4|Q96IN9|Q9UFJ4	Missense_Mutation	SNP	ENST00000255674.6	37	CCDS42443.1	.	.	.	.	.	.	.	.	.	.	C	10.90	1.481072	0.26598	.	.	ENSG00000176225	ENST00000255674;ENST00000437017	T;T	0.19806	2.12;2.12	5.37	3.48	0.39840	.	0.326303	0.35235	N	0.003348	T	0.14270	0.0345	L	0.39633	1.23	0.80722	D	1	B	0.30824	0.296	B	0.22753	0.041	T	0.07501	-1.0769	10	0.16896	T	0.51	.	10.6687	0.45745	0.0:0.7959:0.132:0.0721	.	1086	Q86VV8	RTTN_HUMAN	S	1086	ENSP00000255674:R1086S;ENSP00000399520:R1086S	ENSP00000255674:R1086S	R	-	3	2	RTTN	65945843	0.993000	0.37304	1.000000	0.80357	0.977000	0.68977	0.196000	0.17176	1.266000	0.44231	-0.143000	0.13931	AGG	.	.		0.483	RTTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442988.1	NM_173630	
FUBP1	8880	hgsc.bcm.edu	37	1	78429797	78429797	+	Nonsense_Mutation	SNP	G	G	A			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr1:78429797G>A	ENST00000370768.2	-	12	1072	c.991C>T	c.(991-993)Cga>Tga	p.R331*	FUBP1_ENST00000436586.2_Nonsense_Mutation_p.R352*|FUBP1_ENST00000370767.1_Nonsense_Mutation_p.R331*	NM_003902.3	NP_003893.2	Q96AE4	FUBP1_HUMAN	far upstream element (FUSE) binding protein 1	331	KH 3. {ECO:0000255|PROSITE- ProRule:PRU00117}.				positive regulation of gene expression (GO:0010628)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|sequence-specific DNA binding transcription factor activity (GO:0003700)|single-stranded DNA binding (GO:0003697)			central_nervous_system(7)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(4)|lung(1)|upper_aerodigestive_tract(3)	17						TGTTGACATCGGTCTGGAGGT	0.323			"""F, N"""		oligodendroglioma																																p.R331X		.	.		Rec	yes		1	1p13.1	8880	far upstream element (FUSE) binding protein 1		O	.	FUBP1	.	.	0			c.C991T						.						234.0	227.0	229.0					1																	78429797		2203	4300	6503	SO:0001587	stop_gained	8880	exon12			GACATCGGTCTGG	U05040	CCDS683.1	1p31.1	2008-02-05			ENSG00000162613	ENSG00000162613			4004	protein-coding gene	gene with protein product		603444		FUBP		8125259	Standard	XM_005271309		Approved	FBP	uc001dii.3	Q96AE4	OTTHUMG00000040799	ENST00000370768.2:c.991C>T	1.37:g.78429797G>A	ENSP00000359804:p.Arg331*	645.0	0.0		602.0	221.0	NM_003902	Q12828	Nonsense_Mutation	SNP	ENST00000370768.2	37	CCDS683.1	.	.	.	.	.	.	.	.	.	.	G	32	5.135069	0.94517	.	.	ENSG00000162613	ENST00000370773;ENST00000370767;ENST00000370768;ENST00000394922;ENST00000436586	.	.	.	5.81	0.557	0.17260	.	0.052464	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.05959	T	0.93	-14.5785	16.917	0.86154	0.0:0.0:0.1913:0.8087	.	.	.	.	X	330;331;331;330;352	.	ENSP00000294623:R330X	R	-	1	2	FUBP1	78202385	1.000000	0.71417	0.997000	0.53966	0.966000	0.64601	0.942000	0.29017	0.025000	0.15241	0.650000	0.86243	CGA	.	.		0.323	FUBP1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098030.3	NM_003902	
CYFIP2	26999	hgsc.bcm.edu	37	5	156714055	156714055	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr5:156714055A>G	ENST00000521420.1	+	3	236	c.145A>G	c.(145-147)Agg>Ggg	p.R49G	CYFIP2_ENST00000318218.6_Missense_Mutation_p.R49G|CYFIP2_ENST00000541131.1_Intron|CYFIP2_ENST00000442283.2_5'UTR|CYFIP2_ENST00000347377.6_Missense_Mutation_p.R49G|CYFIP2_ENST00000522463.1_Missense_Mutation_p.R49G|CYFIP2_ENST00000377576.3_Missense_Mutation_p.R49G					cytoplasmic FMR1 interacting protein 2											breast(1)|endometrium(12)|kidney(2)|lung(23)	38	Renal(175;0.00212)	Medulloblastoma(196;0.0306)|all_neural(177;0.0897)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			CTTTGAGGACAGGAATGCATT	0.488																																					p.R49G		.	.											.	CYFIP2	.	.	0			c.A145G						.						83.0	81.0	82.0					5																	156714055		2040	4207	6247	SO:0001583	missense	26999	exon3			GAGGACAGGAATG	AF160973	CCDS75364.1	5q34	2008-07-18				ENSG00000055163			13760	protein-coding gene	gene with protein product	"""p53 inducible protein"""	606323				11438699	Standard	NM_001037333		Approved	PIR121	uc021ygm.1	Q96F07		ENST00000521420.1:c.145A>G	5.37:g.156714055A>G	ENSP00000430904:p.Arg49Gly	102.0	0.0		183.0	108.0	NM_001037332		Missense_Mutation	SNP	ENST00000521420.1	37		.	.	.	.	.	.	.	.	.	.	A	17.56	3.420124	0.62622	.	.	ENSG00000055163	ENST00000318218;ENST00000522463;ENST00000521420;ENST00000347377;ENST00000377576	T;T;T;T;T	0.42900	0.96;1.69;1.84;0.96;0.96	5.49	2.89	0.33648	.	0.000000	0.85682	D	0.000000	T	0.62441	0.2428	M	0.85945	2.785	0.80722	D	1	P;D;D;D;P	0.59357	0.462;0.985;0.976;0.969;0.717	P;P;P;P;P	0.59357	0.478;0.633;0.7;0.856;0.478	T	0.69150	-0.5221	10	0.56958	D	0.05	-27.8786	13.3997	0.60876	0.6366:0.3634:0.0:0.0	.	49;49;49;49;49	E7EW33;E7EVJ5;E7EVF4;Q96F07-2;Q96F07	.;.;.;.;CYFP2_HUMAN	G	49	ENSP00000325817:R49G;ENSP00000428009:R49G;ENSP00000430904:R49G;ENSP00000313567:R49G;ENSP00000366799:R49G	ENSP00000325817:R49G	R	+	1	2	CYFIP2	156646633	1.000000	0.71417	1.000000	0.80357	0.863000	0.49368	2.419000	0.44671	0.891000	0.36235	0.459000	0.35465	AGG	.	.		0.488	CYFIP2-001	NOVEL	basic	protein_coding	protein_coding	OTTHUMT00000373710.1	NM_001037332	
SLC25A3	5250	hgsc.bcm.edu	37	12	98991699	98991699	+	Silent	SNP	T	T	C			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr12:98991699T>C	ENST00000228318.3	+	4	468	c.348T>C	c.(346-348)gtT>gtC	p.V116V	SLC25A3_ENST00000551917.1_Silent_p.V116V|SLC25A3_ENST00000547534.1_Silent_p.V115V|SLC25A3_ENST00000548847.1_Silent_p.V115V|SLC25A3_ENST00000552981.1_Silent_p.V115V|SNORA53_ENST00000391141.1_RNA|SLC25A3_ENST00000188376.5_Silent_p.V115V|SLC25A3_ENST00000549338.1_Silent_p.V115V|SLC25A3_ENST00000401722.3_Silent_p.V115V	NM_005888.3	NP_005879.1	Q00325	MPCP_HUMAN	solute carrier family 25 (mitochondrial carrier; phosphate carrier), member 3	116					generation of precursor metabolites and energy (GO:0006091)|phosphate ion transmembrane transport (GO:0035435)|transport (GO:0006810)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	phosphate ion carrier activity (GO:0015320)|protein complex binding (GO:0032403)|symporter activity (GO:0015293)			breast(1)|endometrium(2)|large_intestine(4)|lung(8)|prostate(1)	16		Lung NSC(355;4.08e-05)|Breast(359;0.00191)|Colorectal(145;0.00205)|Myeloproliferative disorder(1001;0.0255)		GBM - Glioblastoma multiforme(134;1.36e-23)|BRCA - Breast invasive adenocarcinoma(302;0.000115)		AGGATGGTGTTCGTGGTTTGG	0.393																																					p.V116V		.	.											.	SLC25A3	.	.	0			c.T348C						.						163.0	148.0	153.0					12																	98991699		2203	4300	6503	SO:0001819	synonymous_variant	5250	exon4			TGGTGTTCGTGGT		CCDS9065.1, CCDS9066.1	12q23.1	2013-05-22			ENSG00000075415	ENSG00000075415		"""Solute carriers"""	10989	protein-coding gene	gene with protein product		600370		PHC		8168843	Standard	NM_213611		Approved		uc001tfo.3	Q00325	OTTHUMG00000170212	ENST00000228318.3:c.348T>C	12.37:g.98991699T>C		410.0	0.0		459.0	173.0	NM_005888	B3KS34|Q7Z7N7|Q96A03	Silent	SNP	ENST00000228318.3	37	CCDS9066.1																																																																																			.	.		0.393	SLC25A3-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000407989.1	NM_005888	
NLRP2	55655	hgsc.bcm.edu	37	19	55508705	55508705	+	Missense_Mutation	SNP	C	C	G			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr19:55508705C>G	ENST00000543010.1	+	12	3043	c.2900C>G	c.(2899-2901)cCt>cGt	p.P967R	NLRP2_ENST00000339757.7_Missense_Mutation_p.P945R|NLRP2_ENST00000537859.1_Missense_Mutation_p.P945R|NLRP2_ENST00000427260.2_Missense_Mutation_p.P944R|NLRP2_ENST00000538819.1_Missense_Mutation_p.P943R|NLRP2_ENST00000391721.4_Missense_Mutation_p.P943R|NLRP2_ENST00000263437.6_Missense_Mutation_p.P964R|NLRP2_ENST00000448584.2_Missense_Mutation_p.P967R	NM_001174081.1	NP_001167552.1	Q9NX02	NALP2_HUMAN	NLR family, pyrin domain containing 2	967					positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of interleukin-1 beta secretion (GO:0050718)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|Pyrin domain binding (GO:0032090)			large_intestine(4)|liver(1)|ovary(1)|skin(2)|upper_aerodigestive_tract(3)	11			BRCA - Breast invasive adenocarcinoma(297;0.163)	GBM - Glioblastoma multiforme(193;0.028)		TGTTCCATCCCTCCGTTCAGT	0.567																																					p.P967R		.	.											.	NLRP2	.	.	0			c.C2900G						.						168.0	139.0	149.0					19																	55508705		2203	4300	6503	SO:0001583	missense	55655	exon12			CCATCCCTCCGTT	AK000517	CCDS12913.1, CCDS54318.1, CCDS54319.1	19q13.42	2008-02-05	2006-12-08	2006-12-08	ENSG00000022556	ENSG00000022556		"""Nucleotide-binding domain and leucine rich repeat containing"""	22948	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 2"""	609364	"""NACHT, leucine rich repeat and PYD containing 2"""	NALP2		12563287, 11270363	Standard	NM_001174081		Approved	FLJ20510, PYPAF2, NBS1, PAN1, CLR19.9	uc021vbq.1	Q9NX02	OTTHUMG00000167763	ENST00000543010.1:c.2900C>G	19.37:g.55508705C>G	ENSP00000445135:p.Pro967Arg	313.0	0.0		320.0	96.0	NM_017852	B4DZL7|I3L0G4|Q53FL5|Q59G09|Q8IXT0|Q9BVN5|Q9H6G6|Q9HAV9|Q9NWK3	Missense_Mutation	SNP	ENST00000543010.1	37	CCDS12913.1	.	.	.	.	.	.	.	.	.	.	C	12.51	1.959608	0.34565	.	.	ENSG00000022556	ENST00000543010;ENST00000391721;ENST00000339757;ENST00000448584;ENST00000537859;ENST00000427260;ENST00000538819;ENST00000263437	T;T;T;T;T;T;T;T	0.51817	0.69;0.69;0.69;0.69;0.69;0.69;0.69;0.69	3.2	0.425	0.16473	.	.	.	.	.	T	0.29355	0.0731	N	0.02225	-0.63	0.09310	N	1	P;P;P;P;P	0.46859	0.885;0.877;0.883;0.877;0.804	B;P;P;P;P	0.53224	0.333;0.721;0.46;0.721;0.53	T	0.11916	-1.0568	9	0.87932	D	0	.	3.2623	0.06853	0.2393:0.5711:0.0:0.1896	.	944;945;964;943;967	B4DZL7;Q9NX02-2;A8K9G6;Q9NX02-4;Q9NX02	.;.;.;.;NALP2_HUMAN	R	967;943;945;967;945;944;943;964	ENSP00000445135:P967R;ENSP00000375601:P943R;ENSP00000344074:P945R;ENSP00000409370:P967R;ENSP00000440601:P945R;ENSP00000402474:P944R;ENSP00000441133:P943R;ENSP00000263437:P964R	ENSP00000263437:P964R	P	+	2	0	NLRP2	60200517	0.001000	0.12720	0.002000	0.10522	0.083000	0.17756	1.070000	0.30653	0.052000	0.16007	0.561000	0.74099	CCT	.	.		0.567	NLRP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000396152.1	NM_017852	
HOXC10	3226	hgsc.bcm.edu	37	12	54382990	54382990	+	Silent	SNP	G	G	A			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr12:54382990G>A	ENST00000303460.4	+	2	863	c.789G>A	c.(787-789)ctG>ctA	p.L263L	RP11-834C11.12_ENST00000513209.1_Intron|HOXC10_ENST00000511575.1_3'UTR|MIR196A2_ENST00000385189.1_RNA	NM_017409.3	NP_059105.2	Q9NYD6	HXC10_HUMAN	homeobox C10	263					anterior/posterior pattern specification (GO:0009952)|embryonic limb morphogenesis (GO:0030326)|neuromuscular process (GO:0050905)|positive regulation of cell proliferation (GO:0008284)|proximal/distal pattern formation (GO:0009954)|regulation of transcription, DNA-templated (GO:0006355)|skeletal system development (GO:0001501)|spinal cord motor neuron cell fate specification (GO:0021520)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			endometrium(2)|large_intestine(3)|lung(14)|pancreas(1)	20						GAAATTGGCTGACAGCAAAGA	0.428											OREG0021882	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.L263L		.	.											.	HOXC10	.	.	0			c.G789A						.						65.0	63.0	63.0					12																	54382990		2203	4300	6503	SO:0001819	synonymous_variant	3226	exon2			TTGGCTGACAGCA		CCDS8868.1	12q13.13	2011-06-20	2005-12-22		ENSG00000180818	ENSG00000180818		"""Homeoboxes / ANTP class : HOXL subclass"""	5122	protein-coding gene	gene with protein product		605560	"""homeo box C10"""	HOX3I		1358459	Standard	NM_017409		Approved		uc001sen.3	Q9NYD6	OTTHUMG00000160031	ENST00000303460.4:c.789G>A	12.37:g.54382990G>A		220.0	0.0	999	200.0	25.0	NM_017409	O15219|O15220|Q9BVD5	Silent	SNP	ENST00000303460.4	37	CCDS8868.1																																																																																			.	.		0.428	HOXC10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358952.2		
HRC	3270	hgsc.bcm.edu	37	19	49657886	49657886	+	Silent	SNP	C	C	T			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr19:49657886C>T	ENST00000252825.4	-	1	795	c.609G>A	c.(607-609)gaG>gaA	p.E203E	HRC_ENST00000595625.1_Silent_p.E203E	NM_002152.2	NP_002143.1	P23327	SRCH_HUMAN	histidine rich calcium binding protein	203	4 X tandem repeats, acidic.|6 X approximate tandem repeats.|Glu-rich (acidic).				cytosolic calcium ion homeostasis (GO:0051480)|muscle contraction (GO:0006936)|positive regulation of heart contraction (GO:0045823)|positive regulation of heart rate (GO:0010460)|positive regulation of relaxation of cardiac muscle (GO:1901899)|regulation of calcium ion transmembrane transport (GO:1903169)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cell communication by electrical coupling involved in cardiac conduction (GO:1901844)|regulation of heart rate (GO:0002027)|regulation of peptidyl-serine phosphorylation (GO:0033135)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)	sarcoplasmic reticulum lumen (GO:0033018)|sarcoplasmic reticulum membrane (GO:0033017)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|calcium ion binding (GO:0005509)|ion channel binding (GO:0044325)			endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(10)|lung(10)|ovary(1)|prostate(3)|urinary_tract(2)	34		all_lung(116;3.16e-06)|Lung NSC(112;6.25e-06)|all_neural(266;0.0189)|Ovarian(192;0.0392)		all cancers(93;2.01e-05)|OV - Ovarian serous cystadenocarcinoma(262;0.00019)|GBM - Glioblastoma multiforme(486;0.00279)|Epithelial(262;0.00622)		TGGAGGcctcctcttcctcct	0.572																																					p.E203E	Melanoma(37;75 1097 24567 25669 30645)	.	.											.	HRC	.	.	0			c.G609A						.						123.0	91.0	102.0					19																	49657886		2203	4300	6503	SO:0001819	synonymous_variant	3270	exon1			GGCCTCCTCTTCC		CCDS12759.1	19q13.3	2008-07-16	2001-11-28			ENSG00000130528			5178	protein-coding gene	gene with protein product		142705	"""histidine-rich calcium-binding protein"""			2037293	Standard	XR_243928		Approved	MGC133236	uc002pmv.3	P23327		ENST00000252825.4:c.609G>A	19.37:g.49657886C>T		258.0	0.0		234.0	10.0	NM_002152	Q504Y6	Silent	SNP	ENST00000252825.4	37	CCDS12759.1																																																																																			.	.		0.572	HRC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465649.1	NM_002152	
SLCO1B1	10599	hgsc.bcm.edu	37	12	21329794	21329794	+	Silent	SNP	A	A	G			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr12:21329794A>G	ENST00000256958.2	+	5	540	c.444A>G	c.(442-444)ttA>ttG	p.L148L		NM_006446.4	NP_006437.3	Q9Y6L6	SO1B1_HUMAN	solute carrier organic anion transporter family, member 1B1	148					bile acid and bile salt transport (GO:0015721)|bile acid metabolic process (GO:0008206)|organic anion transport (GO:0015711)|small molecule metabolic process (GO:0044281)|sodium-independent organic anion transport (GO:0043252)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	sodium-independent organic anion transmembrane transporter activity (GO:0015347)			breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(14)|lung(33)|ovary(3)|pancreas(1)|prostate(1)|skin(8)|upper_aerodigestive_tract(1)	70					Acetylcysteine(DB06151)|Aminohippurate(DB00345)|Atorvastatin(DB01076)|Axitinib(DB06626)|Benzylpenicillin(DB01053)|Bezafibrate(DB01393)|Cabazitaxel(DB06772)|Caspofungin(DB00520)|Conjugated Estrogens(DB00286)|Cyclosporine(DB00091)|Dabrafenib(DB08912)|Dextrothyroxine(DB00509)|Digoxin(DB00390)|Dinoprostone(DB00917)|Eltrombopag(DB06210)|Estradiol(DB00783)|Estrone(DB00655)|Ezetimibe(DB00973)|Fexofenadine(DB00950)|Fluvastatin(DB01095)|Gadoxetate(DB08884)|Gemfibrozil(DB01241)|Indinavir(DB00224)|Irinotecan(DB00762)|L-Carnitine(DB00583)|Levothyroxine(DB00451)|Liothyronine(DB00279)|Liotrix(DB01583)|Lovastatin(DB00227)|Methotrexate(DB00563)|Mycophenolate mofetil(DB00688)|Nelfinavir(DB00220)|Olmesartan(DB00275)|Ouabain(DB01092)|Pantoprazole(DB00213)|Pazopanib(DB06589)|Penicillamine(DB00859)|Pioglitazone(DB01132)|Pitavastatin(DB08860)|Pravastatin(DB00175)|Quinidine(DB00908)|Repaglinide(DB00912)|Rifampicin(DB01045)|Rilpivirine(DB08864)|Ritonavir(DB00503)|Rosiglitazone(DB00412)|Rosuvastatin(DB01098)|Saquinavir(DB01232)|SIMEPREVIR(DB06290)|Simvastatin(DB00641)|Sirolimus(DB00877)|Sumatriptan(DB00669)|Valsartan(DB00177)|Verapamil(DB00661)	ATCAAATTTTATCACTCAATA	0.279																																					p.L148L		.	.											.	SLCO1B1	.	.	0			c.A444G						.						76.0	77.0	76.0					12																	21329794		2203	4288	6491	SO:0001819	synonymous_variant	10599	exon5			AATTTTATCACTC		CCDS8685.1	12p12	2013-05-22	2003-11-25	2003-11-26	ENSG00000134538	ENSG00000134538		"""Solute carriers"""	10959	protein-coding gene	gene with protein product		604843	"""solute carrier family 21 (organic anion transporter), member 6"""	SLC21A6		10358072	Standard	NM_006446		Approved	OATP-C, LST-1, OATP1B1	uc001req.4	Q9Y6L6	OTTHUMG00000169047	ENST00000256958.2:c.444A>G	12.37:g.21329794A>G		274.0	0.0		266.0	80.0	NM_006446	B2R7G2|Q29R64|Q9NQ37|Q9UBF3|Q9UH89	Silent	SNP	ENST00000256958.2	37	CCDS8685.1																																																																																			.	.		0.279	SLCO1B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402070.1	NM_006446	
ADRA1B	147	hgsc.bcm.edu	37	5	159398905	159398905	+	Silent	SNP	G	G	A			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr5:159398905G>A	ENST00000306675.3	+	2	1092	c.969G>A	c.(967-969)ctG>ctA	p.L323L		NM_000679.3	NP_000670.1	P35368	ADA1B_HUMAN	adrenoceptor alpha 1B	323					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|adrenergic receptor signaling pathway (GO:0071875)|adult heart development (GO:0007512)|behavioral response to cocaine (GO:0048148)|blood vessel remodeling (GO:0001974)|cell growth (GO:0016049)|cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|G-protein coupled receptor signaling pathway (GO:0007186)|glucose homeostasis (GO:0042593)|intracellular signal transduction (GO:0035556)|locomotory behavior (GO:0007626)|multicellular organismal development (GO:0007275)|negative regulation of glycogen catabolic process (GO:0045818)|organ growth (GO:0035265)|positive regulation of glycogen catabolic process (GO:0045819)|positive regulation of heart rate by epinephrine-norepinephrine (GO:0001996)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of the force of heart contraction by epinephrine-norepinephrine (GO:0001997)|regulation of cardiac muscle contraction (GO:0055117)|regulation of vasoconstriction (GO:0019229)|response to amphetamine (GO:0001975)|response to morphine (GO:0043278)|vasoconstriction of artery involved in baroreceptor response to lowering of systemic arterial blood pressure (GO:0001987)|visual learning (GO:0008542)	integral component of plasma membrane (GO:0005887)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	alpha1-adrenergic receptor activity (GO:0004937)|protein heterodimerization activity (GO:0046982)			endometrium(3)|large_intestine(6)|lung(7)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19	Renal(175;0.00196)	Medulloblastoma(196;0.0354)|all_neural(177;0.138)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)		Acepromazine(DB01614)|Alfuzosin(DB00346)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Amphetamine(DB00182)|Aripiprazole(DB01238)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Carvedilol(DB01136)|Chlorpromazine(DB00477)|Clonidine(DB00575)|Clozapine(DB00363)|Dapiprazole(DB00298)|Desipramine(DB01151)|Dextroamphetamine(DB01576)|Doxazosin(DB00590)|Doxepin(DB01142)|Dronedarone(DB04855)|Droxidopa(DB06262)|Epinephrine(DB00668)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Fenoldopam(DB00800)|Imipramine(DB00458)|Labetalol(DB00598)|Lisdexamfetamine(DB01255)|Loxapine(DB00408)|Maprotiline(DB00934)|Mephentermine(DB01365)|Methotrimeprazine(DB01403)|Methoxamine(DB00723)|Mianserin(DB06148)|Midodrine(DB00211)|Mirtazapine(DB00370)|Modafinil(DB00745)|Nefazodone(DB01149)|Nicardipine(DB00622)|Norepinephrine(DB00368)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Oxymetazoline(DB00935)|Paliperidone(DB01267)|Pergolide(DB01186)|Phendimetrazine(DB01579)|Phenoxybenzamine(DB00925)|Phenylephrine(DB00388)|Prazosin(DB00457)|Promazine(DB00420)|Propericiazine(DB01608)|Propiomazine(DB00777)|Quetiapine(DB01224)|Risperidone(DB00734)|Sertindole(DB06144)|Silodosin(DB06207)|Tamsulosin(DB00706)|Terazosin(DB01162)|Thioproperazine(DB01622)|Thioridazine(DB00679)|Trimipramine(DB00726)|Xylometazoline(DB06694)|Ziprasidone(DB00246)	TCTCCACCCTGAAGCCCCCCG	0.582																																					p.L323L		.	.											.	ADRA1B	.	.	0			c.G969A						.						30.0	34.0	33.0					5																	159398905		2187	4261	6448	SO:0001819	synonymous_variant	147	exon2			CACCCTGAAGCCC	L31773	CCDS4347.1	5q33.3	2012-08-08	2012-05-09		ENSG00000170214	ENSG00000170214		"""GPCR / Class A : Adrenoceptors : alpha"""	278	protein-coding gene	gene with protein product		104220	"""adrenergic, alpha-1B-, receptor"""				Standard	XM_005265818		Approved		uc003lxt.1	P35368	OTTHUMG00000130327	ENST00000306675.3:c.969G>A	5.37:g.159398905G>A		238.0	1.0		249.0	131.0	NM_000679	B0LPE1	Silent	SNP	ENST00000306675.3	37	CCDS4347.1																																																																																			.	.		0.582	ADRA1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252676.1		
RNF44	22838	hgsc.bcm.edu	37	5	175957958	175957958	+	Missense_Mutation	SNP	G	G	T			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr5:175957958G>T	ENST00000274811.4	-	5	1054	c.530C>A	c.(529-531)tCc>tAc	p.S177Y	RNF44_ENST00000509404.1_5'Flank|RNF44_ENST00000537487.1_Missense_Mutation_p.S96Y	NM_014901.4	NP_055716.1	Q7L0R7	RNF44_HUMAN	ring finger protein 44	177	Pro-rich.						zinc ion binding (GO:0008270)			endometrium(2)|lung(3)|prostate(1)|skin(1)|stomach(1)	8	all_cancers(89;0.0029)|Renal(175;0.000269)|Lung NSC(126;0.00902)|all_lung(126;0.0142)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GTGGTCACTGGAGATGAGGTG	0.657																																					p.S177Y		.	.											.	RNF44	.	.	0			c.C530A						.						18.0	20.0	19.0					5																	175957958		2180	4269	6449	SO:0001583	missense	22838	exon5			TCACTGGAGATGA	AB029023	CCDS4404.1	5q35.3	2013-01-09			ENSG00000146083	ENSG00000146083		"""RING-type (C3HC4) zinc fingers"""	19180	protein-coding gene	gene with protein product						10470851	Standard	NM_014901		Approved	KIAA1100	uc003mek.1	Q7L0R7	OTTHUMG00000130664	ENST00000274811.4:c.530C>A	5.37:g.175957958G>T	ENSP00000274811:p.Ser177Tyr	70.0	0.0		76.0	20.0	NM_014901	B4DYE0|Q8ND05|Q9UPQ2	Missense_Mutation	SNP	ENST00000274811.4	37	CCDS4404.1	.	.	.	.	.	.	.	.	.	.	G	29.6	5.020586	0.93462	.	.	ENSG00000146083	ENST00000274811;ENST00000537487	T;T	0.47177	0.85;0.85	5.36	5.36	0.76844	.	0.000000	0.85682	D	0.000000	T	0.68467	0.3004	M	0.65498	2.005	0.53688	D	0.999971	D	0.89917	1.0	D	0.74023	0.982	T	0.71031	-0.4710	10	0.72032	D	0.01	-40.9803	19.0753	0.93159	0.0:0.0:1.0:0.0	.	177	Q7L0R7	RNF44_HUMAN	Y	177;96	ENSP00000274811:S177Y;ENSP00000440352:S96Y	ENSP00000274811:S177Y	S	-	2	0	RNF44	175890564	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	9.324000	0.96373	2.526000	0.85167	0.549000	0.68633	TCC	.	.		0.657	RNF44-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253156.2		
SPAG9	9043	hgsc.bcm.edu	37	17	49075937	49075937	+	Missense_Mutation	SNP	T	T	G			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr17:49075937T>G	ENST00000262013.7	-	15	1914	c.1706A>C	c.(1705-1707)aAg>aCg	p.K569T	SPAG9_ENST00000357122.4_Missense_Mutation_p.K555T|SPAG9_ENST00000505279.1_Missense_Mutation_p.K559T|SPAG9_ENST00000510283.1_Missense_Mutation_p.K412T	NM_001130528.2	NP_001124000.1	O60271	JIP4_HUMAN	sperm associated antigen 9	569					activation of JUN kinase activity (GO:0007257)|muscle cell differentiation (GO:0042692)|negative regulation of protein homodimerization activity (GO:0090074)|positive regulation of cell migration (GO:0030335)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neuron differentiation (GO:0045666)|protein homooligomerization (GO:0051260)|retrograde transport, endosome to Golgi (GO:0042147)|spermatogenesis (GO:0007283)|striated muscle cell differentiation (GO:0051146)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)				NS(1)|breast(3)|endometrium(3)|kidney(4)|large_intestine(8)|lung(14)|ovary(1)|prostate(1)|skin(1)|stomach(1)	37			BRCA - Breast invasive adenocarcinoma(22;4.24e-07)			TGGTTCAGGCTTCTTAGTCGT	0.438																																					p.K569T		.	.											.	SPAG9	.	.	0			c.A1706C						.						164.0	138.0	147.0					17																	49075937		2203	4300	6503	SO:0001583	missense	9043	exon15			TCAGGCTTCTTAG	AB011088	CCDS11577.1, CCDS45740.1, CCDS58577.1, CCDS58578.1	17q21.33	2013-09-23			ENSG00000008294	ENSG00000008294			14524	protein-coding gene	gene with protein product	"""sperm surface protein"", ""JNK/SAPK-associated protein"", ""JNK interacting protein"", ""sperm specific protein"", ""c-Jun NH2-terminal kinase-associated leucine zipper protein"", ""Max-binding protein"", ""JNK-associated leucine-zipper protein"", ""HLC-4 protein"", ""lung cancer oncogene 4"", ""proliferation-inducing gene 6"", ""cancer/testis antigen 89"""	605430				9480848, 11106729	Standard	NM_003971		Approved	HSS, SYD1, KIAA0516, MGC14967, MGC74461, MGC117291, JLP, PHET, HLC4, PIG6, FLJ13450, FLJ14006, FLJ26141, FLJ34602, CT89	uc002itc.3	O60271	OTTHUMG00000162316	ENST00000262013.7:c.1706A>C	17.37:g.49075937T>G	ENSP00000262013:p.Lys569Thr	288.0	0.0		386.0	47.0	NM_001130528	A6H8U5|A8MSX0|B4DHH2|O60905|Q3KQU8|Q3MKM7|Q86WC7|Q86WC8|Q8IZX7|Q96II0|Q9H811	Missense_Mutation	SNP	ENST00000262013.7	37	CCDS45740.1	.	.	.	.	.	.	.	.	.	.	T	24.3	4.515151	0.85389	.	.	ENSG00000008294	ENST00000262013;ENST00000376407;ENST00000357804;ENST00000510283;ENST00000505279;ENST00000357122;ENST00000535445	T;T;D;T	0.89810	2.14;2.14;-2.57;2.14	5.71	5.71	0.89125	.	0.000000	0.85682	D	0.000000	D	0.89567	0.6752	L	0.47716	1.5	0.51233	D	0.999919	D;P;B;B;P;P	0.54207	0.965;0.766;0.067;0.04;0.878;0.575	P;B;B;B;B;B	0.52481	0.7;0.406;0.103;0.029;0.441;0.219	D	0.88074	0.2802	10	0.30078	T	0.28	-18.587	15.9886	0.80183	0.0:0.0:0.0:1.0	.	555;569;559;569;555;412	O60271-5;O60271-3;O60271-2;O60271;O60271-4;E7ENU2	.;.;.;JIP4_HUMAN;.;.	T	569;325;315;412;559;555;167	ENSP00000262013:K569T;ENSP00000423165:K412T;ENSP00000426900:K559T;ENSP00000349636:K555T	ENSP00000262013:K569T	K	-	2	0	SPAG9	46430936	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	6.243000	0.72384	2.178000	0.69098	0.482000	0.46254	AAG	.	.		0.438	SPAG9-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000368543.2	NM_003971	
CDC37L1	55664	hgsc.bcm.edu	37	9	4706065	4706065	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr9:4706065G>A	ENST00000381854.3	+	7	1169	c.967G>A	c.(967-969)Gtg>Atg	p.V323M		NM_017913.2	NP_060383.2	Q7L3B6	CD37L_HUMAN	cell division cycle 37-like 1	323	Interaction with Hsp70.|Required for interaction with STIP1.					cytoplasm (GO:0005737)				breast(1)|kidney(1)|lung(2)	4	all_hematologic(13;0.137)	Breast(48;0.238)		GBM - Glioblastoma multiforme(50;0.0318)		CTTAAACTCGGTGGTACATAA	0.393																																					p.V323M		.	.											.	CDC37L1	.	.	0			c.G967A						.						128.0	112.0	117.0					9																	4706065		2203	4300	6503	SO:0001583	missense	55664	exon7			AACTCGGTGGTAC	AK000497	CCDS6454.1	9p24.1	2013-01-17	2013-01-17		ENSG00000106993	ENSG00000106993			17179	protein-coding gene	gene with protein product		610346	"""CDC37 cell division cycle 37 homolog (S. cerevisiae)-like 1"", ""cell division cycle 37 homolog (S. cerevisiae)-like 1"""				Standard	NM_017913		Approved	HARC, FLJ20639, CDC37B	uc003zio.3	Q7L3B6	OTTHUMG00000019465	ENST00000381854.3:c.967G>A	9.37:g.4706065G>A	ENSP00000371278:p.Val323Met	291.0	0.0		269.0	58.0	NM_017913	B1AL70|Q9NWS3|Q9NX16	Missense_Mutation	SNP	ENST00000381854.3	37	CCDS6454.1	.	.	.	.	.	.	.	.	.	.	G	7.721	0.697169	0.15106	.	.	ENSG00000106993	ENST00000381854	T	0.53857	0.6	5.47	4.57	0.56435	.	0.272398	0.35436	N	0.003214	T	0.25382	0.0617	N	0.03608	-0.345	0.26256	N	0.978657	B	0.12013	0.005	B	0.11329	0.006	T	0.09509	-1.0671	10	0.21540	T	0.41	-18.2187	8.0743	0.30708	0.2277:0.0:0.7723:0.0	.	323	Q7L3B6	CD37L_HUMAN	M	323	ENSP00000371278:V323M	ENSP00000371278:V323M	V	+	1	0	CDC37L1	4696065	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.791000	0.38744	2.558000	0.86282	0.655000	0.94253	GTG	.	.		0.393	CDC37L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051564.1	NM_017913	
CLECL1	160365	hgsc.bcm.edu	37	12	9885713	9885713	+	Missense_Mutation	SNP	A	A	T	rs200639830		TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr12:9885713A>T	ENST00000327839.3	-	1	182	c.148T>A	c.(148-150)Tac>Aac	p.Y50N		NM_172004.3	NP_742001.1	Q8IZS7	CLCL1_HUMAN	C-type lectin-like 1	50						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)			breast(1)|kidney(1)|large_intestine(4)|lung(3)	9						TCTGATAAGTAAATTGAGATG	0.403																																					p.Y50N		.	.											.	CLECL1	.	.	0			c.T148A						.						77.0	80.0	79.0					12																	9885713		2203	4300	6503	SO:0001583	missense	160365	exon1			ATAAGTAAATTGA	AF518873	CCDS8603.1, CCDS73441.1	12p13.31	2007-06-21				ENSG00000184293			24462	protein-coding gene	gene with protein product	"""dendritic cell associated lectin 1"""	607467				12421943	Standard	NM_172004		Approved	DCAL1	uc001qwi.3	Q8IZS7		ENST00000327839.3:c.148T>A	12.37:g.9885713A>T	ENSP00000331766:p.Tyr50Asn	145.0	0.0		144.0	7.0	NM_001267701		Missense_Mutation	SNP	ENST00000327839.3	37	CCDS8603.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	6.915|6.915	0.538458|0.538458	0.13250|0.13250	.|.	.|.	ENSG00000184293|ENSG00000184293	ENST00000542530|ENST00000327839	.|T	.|0.56275	.|0.47	1.86|1.86	0.666|0.666	0.17901|0.17901	.|.	.|.	.|.	.|.	.|.	T|T	0.21590|0.21590	0.0520|0.0520	N|N	0.03608|0.03608	-0.345|-0.345	0.09310|0.09310	N|N	1|1	.|P	.|0.51147	.|0.942	.|B	.|0.39217	.|0.294	T|T	0.08027|0.08027	-1.0742|-1.0742	5|8	.|.	.|.	.|.	.|.	3.7406|3.7406	0.08528|0.08528	0.7983:0.0:0.2017:0.0|0.7983:0.0:0.2017:0.0	.|.	.|50	.|Q8IZS7	.|CLCL1_HUMAN	L|N	1|50	.|ENSP00000331766:Y50N	.|.	F|Y	-|-	3|1	2|0	CLECL1|CLECL1	9776980|9776980	0.002000|0.002000	0.14202|0.14202	0.001000|0.001000	0.08648|0.08648	0.004000|0.004000	0.04260|0.04260	1.812000|1.812000	0.38952|0.38952	0.170000|0.170000	0.19704|0.19704	-0.463000|-0.463000	0.05309|0.05309	TTT|TAC	.	.		0.403	CLECL1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399815.1	NM_172004	
RGS7	6000	hgsc.bcm.edu	37	1	240976967	240976967	+	Missense_Mutation	SNP	A	A	C			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr1:240976967A>C	ENST00000407727.1	-	12	906	c.907T>G	c.(907-909)Tct>Gct	p.S303A	RGS7_ENST00000366562.4_Missense_Mutation_p.S303A|RGS7_ENST00000401882.1_Missense_Mutation_p.S250A|RGS7_ENST00000446183.2_Missense_Mutation_p.S219A|RGS7_ENST00000366563.1_Missense_Mutation_p.S303A|RGS7_ENST00000348120.2_Missense_Mutation_p.S250A|RGS7_ENST00000366564.1_Missense_Mutation_p.S303A|RGS7_ENST00000331110.7_Missense_Mutation_p.S277A|RGS7_ENST00000366565.1_Missense_Mutation_p.S303A			P49802	RGS7_HUMAN	regulator of G-protein signaling 7	303	G protein gamma.				G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|positive regulation of GTPase activity (GO:0043547)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite terminus (GO:0044292)|heterotrimeric G-protein complex (GO:0005834)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	G-protein beta-subunit binding (GO:0031681)|GTPase activator activity (GO:0005096)|signal transducer activity (GO:0004871)			breast(1)|endometrium(2)|kidney(4)|large_intestine(6)|lung(51)|ovary(4)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	76		all_cancers(173;0.0131)	OV - Ovarian serous cystadenocarcinoma(106;0.027)			CATGGGTTAGAAGGGTCAGGT	0.423																																					p.S303A		.	.											.	RGS7	.	.	0			c.T907G						.						114.0	107.0	110.0					1																	240976967		2203	4300	6503	SO:0001583	missense	6000	exon13			GGTTAGAAGGGTC	BC022009	CCDS31071.1, CCDS60457.1, CCDS60458.1, CCDS60459.1	1q43	2008-02-05	2007-08-14		ENSG00000182901	ENSG00000182901		"""Regulators of G-protein signaling"""	10003	protein-coding gene	gene with protein product		602517	"""regulator of G-protein signalling 7"""			8548815	Standard	XM_005273218		Approved		uc001hyv.2	P49802	OTTHUMG00000040107	ENST00000407727.1:c.907T>G	1.37:g.240976967A>C	ENSP00000384428:p.Ser303Ala	105.0	0.0		148.0	72.0	NM_002924	Q5T3H4|Q8TD66|Q8TD67|Q8WW09|Q9UNU7|Q9Y6B9	Missense_Mutation	SNP	ENST00000407727.1	37		.	.	.	.	.	.	.	.	.	.	A	17.02	3.281245	0.59758	.	.	ENSG00000182901	ENST00000331110;ENST00000366565;ENST00000366564;ENST00000366563;ENST00000440928;ENST00000348120;ENST00000446183;ENST00000366562;ENST00000407727;ENST00000401882	T;T;T;T;T;T;T;T;T;T	0.24538	1.85;1.85;1.85;1.85;1.85;1.85;1.85;1.85;1.85;1.85	5.5	4.34	0.51931	G-protein gamma domain (4);	0.059407	0.64402	N	0.000001	T	0.42314	0.1197	M	0.90425	3.115	0.44110	D	0.99688	B;B;B;B;B;P;B	0.34800	0.091;0.041;0.296;0.064;0.033;0.469;0.041	B;B;B;B;B;B;B	0.40506	0.097;0.074;0.124;0.149;0.075;0.331;0.122	T	0.44112	-0.9349	10	0.62326	D	0.03	-11.572	11.7489	0.51837	0.8523:0.1477:0.0:0.0	.	219;277;250;303;303;303;303	B7Z223;B7Z257;P49802-4;P49802-2;P49802-5;P49802-3;P49802	.;.;.;.;.;.;RGS7_HUMAN	A	277;303;303;303;134;250;219;303;303;250	ENSP00000331485:S277A;ENSP00000355523:S303A;ENSP00000355522:S303A;ENSP00000355521:S303A;ENSP00000404399:S134A;ENSP00000341242:S250A;ENSP00000390138:S219A;ENSP00000355520:S303A;ENSP00000384428:S303A;ENSP00000385508:S250A	ENSP00000331485:S277A	S	-	1	0	RGS7	239043590	1.000000	0.71417	1.000000	0.80357	0.926000	0.56050	7.453000	0.80700	0.871000	0.35750	0.533000	0.62120	TCT	.	.		0.423	RGS7-204	KNOWN	basic	protein_coding	protein_coding		NM_002924	
HIST1H2BM	8342	hgsc.bcm.edu	37	6	27782957	27782957	+	Missense_Mutation	SNP	C	C	G			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr6:27782957C>G	ENST00000359465.4	+	1	136	c.136C>G	c.(136-138)Ctg>Gtg	p.L46V	HIST1H2AJ_ENST00000333151.3_5'Flank	NM_003521.2	NP_003512.1	Q99879	H2B1M_HUMAN	histone cluster 1, H2bm	46					chromatin organization (GO:0006325)|nucleosome assembly (GO:0006334)	extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(2)	12						GTACAAGGTGCTGAAGCAGGT	0.522																																					p.L46V		.	.											.	HIST1H2BM	.	.	0			c.C136G						.						199.0	189.0	192.0					6																	27782957		2203	4300	6503	SO:0001583	missense	8342	exon1			AAGGTGCTGAAGC	Z83738	CCDS4629.1	6p22.1	2011-01-27	2006-10-11	2003-02-28	ENSG00000196374	ENSG00000273703		"""Histones / Replication-dependent"""	4750	protein-coding gene	gene with protein product		602802	"""H2B histone family, member E"", ""histone 1, H2bm"""	H2BFE		9439656, 12408966	Standard	NM_003521		Approved	H2B/e, dJ160A22.3	uc003njo.3	Q99879	OTTHUMG00000014489	ENST00000359465.4:c.136C>G	6.37:g.27782957C>G	ENSP00000352442:p.Leu46Val	266.0	0.0		192.0	76.0	NM_003521	Q6NWQ3	Missense_Mutation	SNP	ENST00000359465.4	37	CCDS4629.1	.	.	.	.	.	.	.	.	.	.	.	8.916	0.959835	0.18507	.	.	ENSG00000196374	ENST00000359465	T	0.65916	-0.18	4.29	4.29	0.51040	Histone-fold (2);Histone core (1);	0.000000	0.45867	U	0.000324	D	0.85932	0.5812	H	0.99689	4.705	0.48762	D	0.999708	P	0.49447	0.924	P	0.60068	0.868	D	0.91878	0.5513	10	0.87932	D	0	.	16.2598	0.82535	0.0:1.0:0.0:0.0	.	46	Q99879	H2B1M_HUMAN	V	46	ENSP00000352442:L46V	ENSP00000352442:L46V	L	+	1	2	HIST1H2BM	27890936	1.000000	0.71417	1.000000	0.80357	0.033000	0.12548	1.624000	0.37018	2.373000	0.80994	0.563000	0.77884	CTG	.	.		0.522	HIST1H2BM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040157.1	NM_003521	
CAND2	23066	hgsc.bcm.edu	37	3	12854821	12854821	+	Missense_Mutation	SNP	T	T	G			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr3:12854821T>G	ENST00000456430.2	+	7	981	c.940T>G	c.(940-942)Tac>Gac	p.Y314D	CAND2_ENST00000295989.5_Missense_Mutation_p.Y221D	NM_001162499.1	NP_001155971.1	O75155	CAND2_HUMAN	cullin-associated and neddylation-dissociated 2 (putative)	314					positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	intracellular (GO:0005622)|nucleus (GO:0005634)				breast(3)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(8)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	37						CGACCCCAACTACAACTACGA	0.537																																					p.Y314D	GBM(43;676 868 1633 6395 37496)	.	.											.	CAND2	.	.	0			c.T940G						.						113.0	118.0	116.0					3																	12854821		2072	4216	6288	SO:0001583	missense	23066	exon7			CCCAACTACAACT		CCDS43053.1, CCDS54554.1	3p25.2	2008-02-05			ENSG00000144712	ENSG00000144712			30689	protein-coding gene	gene with protein product	"""TBP interacting protein"""	610403				9734811, 10441524	Standard	NM_012298		Approved	TIP120B, KIAA0667, Tp120b	uc003bxk.2	O75155	OTTHUMG00000155397	ENST00000456430.2:c.940T>G	3.37:g.12854821T>G	ENSP00000387641:p.Tyr314Asp	250.0	0.0		171.0	66.0	NM_001162499	B9EGM9|E9KL24	Missense_Mutation	SNP	ENST00000456430.2	37	CCDS54554.1	.	.	.	.	.	.	.	.	.	.	T	15.53	2.862040	0.51482	.	.	ENSG00000144712	ENST00000295989;ENST00000456430	T;T	0.63255	-0.03;-0.03	4.55	4.55	0.56014	Armadillo-type fold (1);	0.000000	0.64402	D	0.000003	D	0.83170	0.5196	H	0.94264	3.515	0.80722	D	1	D;D	0.76494	0.999;0.997	D;D	0.80764	0.963;0.994	D	0.87125	0.2193	10	0.72032	D	0.01	-38.8703	11.8714	0.52523	0.0:0.0:0.0:1.0	.	314;221	O75155;O75155-2	CAND2_HUMAN;.	D	221;314	ENSP00000295989:Y221D;ENSP00000387641:Y314D	ENSP00000295989:Y221D	Y	+	1	0	CAND2	12829821	1.000000	0.71417	0.952000	0.39060	0.133000	0.20885	7.902000	0.87389	1.682000	0.51000	0.379000	0.24179	TAC	.	.		0.537	CAND2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339856.4	XM_371617	
NELFE	7936	hgsc.bcm.edu	37	6	31921602	31921602	+	Missense_Mutation	SNP	C	C	G			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr6:31921602C>G	ENST00000375429.3	-	10	1175	c.949G>C	c.(949-951)Ggg>Cgg	p.G317R	NELFE_ENST00000444811.2_Missense_Mutation_p.G287R|NELFE_ENST00000375425.5_Missense_Mutation_p.G324R	NM_002904.5	NP_002895.3	P18615	NELFE_HUMAN	negative elongation factor complex member E	317	RRM. {ECO:0000255|PROSITE- ProRule:PRU00176}.				gene expression (GO:0010467)|negative regulation of transcription elongation from RNA polymerase II promoter (GO:0034244)|positive regulation of viral transcription (GO:0050434)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	NELF complex (GO:0032021)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)										ACCTGGGTCCCGTTGAGCTGA	0.522																																					p.G317R		.	.											.	.	.	.	0			c.G949C						.						81.0	81.0	81.0					6																	31921602		1511	2708	4219	SO:0001583	missense	7936	exon10			GGGTCCCGTTGAG	M33230	CCDS4730.1	6p21.3	2013-02-12	2013-01-31	2013-01-31	ENSG00000204356	ENSG00000204356		"""RNA binding motif (RRM) containing"""	13974	protein-coding gene	gene with protein product		154040	"""RD RNA-binding protein"", ""RD RNA binding protein"""	RDBP			Standard	XM_006715205		Approved	RD, D6S45, NELF-E, RDP	uc003nyk.3	P18615	OTTHUMG00000031046	ENST00000375429.3:c.949G>C	6.37:g.31921602C>G	ENSP00000364578:p.Gly317Arg	251.0	0.0		327.0	65.0	NM_002904	A2BE08|B4DUN1|B4DYX9|Q5JP74|Q5JP75|Q96F56|Q9NPK2	Missense_Mutation	SNP	ENST00000375429.3	37	CCDS4730.1	.	.	.	.	.	.	.	.	.	.	C	14.67	2.603820	0.46423	.	.	ENSG00000204356	ENST00000375429;ENST00000375425;ENST00000444811;ENST00000441998	T;T;T;T	0.57595	0.39;0.39;0.39;0.39	6.07	6.07	0.98685	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.172834	0.50627	D	0.000119	T	0.49115	0.1538	M	0.87758	2.905	0.58432	D	0.999995	P;P;P	0.39964	0.697;0.697;0.697	B;B;B	0.37833	0.259;0.259;0.259	T	0.62115	-0.6922	10	0.87932	D	0	-25.8007	12.7035	0.57046	0.0:0.9243:0.0:0.0757	.	287;312;317	B4DUN1;E9PCL7;P18615	.;.;NELFE_HUMAN	R	317;324;287;312	ENSP00000364578:G317R;ENSP00000364574:G324R;ENSP00000388400:G287R;ENSP00000397914:G312R	ENSP00000364574:G324R	G	-	1	0	RDBP	32029581	1.000000	0.71417	0.992000	0.48379	0.758000	0.43043	4.402000	0.59722	2.884000	0.98904	0.655000	0.94253	GGG	.	.		0.522	NELFE-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000076047.4		
RNF166	115992	hgsc.bcm.edu	37	16	88766049	88766049	+	Missense_Mutation	SNP	G	G	T			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr16:88766049G>T	ENST00000312838.4	-	3	499	c.404C>A	c.(403-405)cCc>cAc	p.P135H	RNF166_ENST00000562499.1_5'Flank|RNF166_ENST00000567844.1_Missense_Mutation_p.P54H|RNF166_ENST00000568683.1_Missense_Mutation_p.P26H|RNF166_ENST00000537718.2_Missense_Mutation_p.P26H|RNF166_ENST00000541206.2_Missense_Mutation_p.P26H|RP5-1142A6.5_ENST00000561699.1_RNA	NM_178841.3	NP_849163.1	Q96A37	RN166_HUMAN	ring finger protein 166	135							zinc ion binding (GO:0008270)			endometrium(1)	1				BRCA - Breast invasive adenocarcinoma(80;0.0476)		CTGTGATGTGGGCACCACGGG	0.617																																					p.P135H		.	.											.	RNF166	.	.	0			c.C404A						.						117.0	92.0	100.0					16																	88766049		2196	4299	6495	SO:0001583	missense	115992	exon3			GATGTGGGCACCA	AK057106	CCDS10969.1, CCDS54056.1, CCDS54057.1	16q24.3	2013-01-09			ENSG00000158717	ENSG00000158717		"""RING-type (C3HC4) zinc fingers"""	28856	protein-coding gene	gene with protein product						12477932	Standard	NM_178841		Approved	MGC2647, MGC14381	uc002flk.3	Q96A37	OTTHUMG00000137863	ENST00000312838.4:c.404C>A	16.37:g.88766049G>T	ENSP00000326095:p.Pro135His	135.0	0.0		94.0	53.0	NM_178841	B3KQ03|D3DX75|H3BTU8|Q96DM0	Missense_Mutation	SNP	ENST00000312838.4	37	CCDS10969.1	.	.	.	.	.	.	.	.	.	.	G	20.9	4.061536	0.76187	.	.	ENSG00000158717	ENST00000312838;ENST00000537718;ENST00000541206	T	0.15834	2.39	4.57	3.61	0.41365	.	0.115488	0.64402	D	0.000014	T	0.24470	0.0593	L	0.36672	1.1	0.58432	D	0.999999	D	0.76494	0.999	P	0.59703	0.862	T	0.01848	-1.1261	10	0.13853	T	0.58	-14.3429	14.3952	0.67005	0.0:0.1488:0.8512:0.0	.	135	Q96A37	RN166_HUMAN	H	135;54;26	ENSP00000326095:P135H	ENSP00000326095:P135H	P	-	2	0	RNF166	87293550	1.000000	0.71417	1.000000	0.80357	0.890000	0.51754	8.580000	0.90784	0.924000	0.37069	0.313000	0.20887	CCC	.	.		0.617	RNF166-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269544.1	NM_178841	
SSTR3	6753	hgsc.bcm.edu	37	22	37602710	37602710	+	Missense_Mutation	SNP	G	G	A	rs371635196		TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr22:37602710G>A	ENST00000328544.3	-	2	1666	c.1133C>T	c.(1132-1134)aCg>aTg	p.T378M	SSTR3_ENST00000402501.1_Missense_Mutation_p.T378M	NM_001051.3	NP_001042.1	P32745	SSR3_HUMAN	somatostatin receptor 3	378					cell-cell signaling (GO:0007267)|cellular response to estradiol stimulus (GO:0071392)|cellular response to glucocorticoid stimulus (GO:0071385)|cerebellum development (GO:0021549)|forebrain development (GO:0030900)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|hormone-mediated apoptotic signaling pathway (GO:0008628)|negative regulation of cell proliferation (GO:0008285)|response to starvation (GO:0042594)|somatostatin signaling pathway (GO:0038170)|spermatogenesis (GO:0007283)	ciliary membrane (GO:0060170)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|nonmotile primary cilium (GO:0031513)|plasma membrane (GO:0005886)	somatostatin receptor activity (GO:0004994)			NS(1)|breast(1)|kidney(1)|large_intestine(1)|lung(9)|ovary(1)	14					Pasireotide(DB06663)	GCCAGGCTGCGTGATCTGGCT	0.667																																					p.T378M		.	.											.	SSTR3	.	.	0			c.C1133T						.	G	MET/THR	0,4406		0,0,2203	47.0	44.0	45.0		1133	3.2	0.3	22		45	2,8598	2.2+/-6.3	0,2,4298	no	missense	SSTR3	NM_001051.2	81	0,2,6501	AA,AG,GG		0.0233,0.0,0.0154	benign	378/419	37602710	2,13004	2203	4300	6503	SO:0001583	missense	6753	exon2			GGCTGCGTGATCT		CCDS13944.1	22q13.1	2012-08-08			ENSG00000183473	ENSG00000278195		"""GPCR / Class A : Somatostatin receptors"""	11332	protein-coding gene	gene with protein product		182453				8449518	Standard	XM_006724311		Approved		uc003arb.3	P32745	OTTHUMG00000150537	ENST00000328544.3:c.1133C>T	22.37:g.37602710G>A	ENSP00000330138:p.Thr378Met	104.0	0.0		82.0	5.0	NM_001051	A8K550|Q53ZR7	Missense_Mutation	SNP	ENST00000328544.3	37	CCDS13944.1	.	.	.	.	.	.	.	.	.	.	G	8.607	0.888145	0.17540	0.0	2.33E-4	ENSG00000183473	ENST00000328544;ENST00000402501	T;T	0.72394	-0.65;-0.65	5.51	3.24	0.37175	.	0.793886	0.11124	N	0.597147	T	0.60586	0.2280	L	0.54323	1.7	0.09310	N	1	P	0.43662	0.814	B	0.33454	0.164	T	0.53464	-0.8435	10	0.49607	T	0.09	.	9.2651	0.37636	0.1449:0.1324:0.7227:0.0	.	378	P32745	SSR3_HUMAN	M	378	ENSP00000330138:T378M;ENSP00000384904:T378M	ENSP00000330138:T378M	T	-	2	0	SSTR3	35932656	0.870000	0.30015	0.299000	0.25016	0.384000	0.30261	3.543000	0.53633	1.325000	0.45301	0.591000	0.81541	ACG	.	.		0.667	SSTR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318802.1		
RNF26	79102	hgsc.bcm.edu	37	11	119206969	119206969	+	Missense_Mutation	SNP	G	G	C			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr11:119206969G>C	ENST00000311413.4	+	1	1733	c.1137G>C	c.(1135-1137)aaG>aaC	p.K379N	C1QTNF5_ENST00000525657.1_5'Flank|RP11-334E6.10_ENST00000501918.2_RNA	NM_032015.4	NP_114404.1	Q9BY78	RNF26_HUMAN	ring finger protein 26	379						integral component of membrane (GO:0016021)	zinc ion binding (GO:0008270)			cervix(1)|endometrium(1)|kidney(1)|lung(7)|ovary(1)|prostate(1)	12		Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;3.8e-05)		AGCGGAAGAAGTGTGTCATCT	0.602																																					p.K379N		.	.											.	RNF26	.	.	0			c.G1137C						.						116.0	98.0	104.0					11																	119206969		2199	4295	6494	SO:0001583	missense	79102	exon1			GAAGAAGTGTGTC	AB055622	CCDS8419.1	11q23	2008-07-21				ENSG00000173456		"""RING-type (C3HC4) zinc fingers"""	14646	protein-coding gene	gene with protein product	"""ring finger protein with leucine zipper"""	606130				11352657	Standard	NM_032015		Approved	MGC2642	uc001pwh.3	Q9BY78		ENST00000311413.4:c.1137G>C	11.37:g.119206969G>C	ENSP00000312439:p.Lys379Asn	82.0	0.0		61.0	9.0	NM_032015	Q542Y8	Missense_Mutation	SNP	ENST00000311413.4	37	CCDS8419.1	.	.	.	.	.	.	.	.	.	.	G	14.04	2.417352	0.42918	.	.	ENSG00000173456	ENST00000311413	T	0.78595	-1.19	5.05	4.06	0.47325	Zinc finger, RING/FYVE/PHD-type (1);	0.071335	0.53938	D	0.000053	T	0.71550	0.3353	N	0.24115	0.695	0.50313	D	0.999866	P	0.51537	0.946	P	0.56127	0.792	T	0.71755	-0.4497	10	0.56958	D	0.05	-12.6746	4.6837	0.12747	0.2563:0.0:0.7437:0.0	.	379	Q9BY78	RNF26_HUMAN	N	379	ENSP00000312439:K379N	ENSP00000312439:K379N	K	+	3	2	RNF26	118712179	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	1.774000	0.38573	2.619000	0.88677	0.491000	0.48974	AAG	.	.		0.602	RNF26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388220.1	NM_032015	
HOXC8	3224	hgsc.bcm.edu	37	12	54404963	54404963	+	Missense_Mutation	SNP	G	G	C			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr12:54404963G>C	ENST00000040584.4	+	2	764	c.527G>C	c.(526-528)cGa>cCa	p.R176P	RP11-834C11.12_ENST00000513209.1_Intron	NM_022658.3	NP_073149.1	P31273	HXC8_HUMAN	homeobox C8	176					anterior/posterior pattern specification (GO:0009952)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron differentiation (GO:0030182)|skeletal system morphogenesis (GO:0048705)|transcription, DNA-templated (GO:0006351)	microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(1)|kidney(1)|large_intestine(1)|lung(1)|ovary(1)|skin(3)	8						TATTTGACACGAAAACGTCGG	0.488																																					p.R176P	GBM(197;701 2226 7002 18822 41696)	.	.											.	HOXC8	.	.	0			c.G527C						.						101.0	96.0	98.0					12																	54404963		2203	4300	6503	SO:0001583	missense	3224	exon2			TGACACGAAAACG	X99680	CCDS8870.1	12q13.13	2011-06-20	2005-12-22			ENSG00000037965		"""Homeoboxes / ANTP class : HOXL subclass"""	5129	protein-coding gene	gene with protein product		142970	"""homeo box C8"""	HOX3, HOX3A		1973146, 1358459	Standard	NM_022658		Approved		uc001ser.3	P31273		ENST00000040584.4:c.527G>C	12.37:g.54404963G>C	ENSP00000040584:p.Arg176Pro	105.0	0.0		116.0	20.0	NM_022658	A8K4J4|O15221|O15362	Missense_Mutation	SNP	ENST00000040584.4	37	CCDS8870.1	.	.	.	.	.	.	.	.	.	.	G	18.03	3.531925	0.64972	.	.	ENSG00000037965	ENST00000040584	D	0.96334	-3.98	5.31	3.49	0.39957	Homeobox, eukaryotic (1);Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);	0.000000	0.64402	D	0.000002	D	0.97173	0.9076	M	0.63428	1.95	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.96782	0.9576	10	0.87932	D	0	.	11.0126	0.47671	0.1547:0.0:0.8453:0.0	.	176	P31273	HXC8_HUMAN	P	176	ENSP00000040584:R176P	ENSP00000040584:R176P	R	+	2	0	HOXC8	52691230	1.000000	0.71417	0.999000	0.59377	0.998000	0.95712	8.030000	0.88816	0.750000	0.32877	0.655000	0.94253	CGA	.	.		0.488	HOXC8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358957.2		
SENP3	26168	hgsc.bcm.edu	37	17	7470288	7470288	+	Splice_Site	SNP	A	A	G	rs76586164		TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr17:7470288A>G	ENST00000429205.2	+	8	1356	c.1307A>G	c.(1306-1308)aAg>aGg	p.K436R	SENP3-EIF4A1_ENST00000579777.1_RNA|SENP3_ENST00000321337.7_Splice_Site|SENP3_ENST00000578868.1_3'UTR			Q9H4L4	SENP3_HUMAN	SUMO1/sentrin/SMT3 specific peptidase 3	436	Protease.					cytoplasm (GO:0005737)|MLL1 complex (GO:0071339)|nucleolus (GO:0005730)	cysteine-type peptidase activity (GO:0008234)			central_nervous_system(1)|ovary(1)	2		Prostate(122;0.157)				TCCGTACCAAAGGGTTATGAT	0.398																																					p.K436R		.	.											.	SENP3	.	.	0			c.A1307G						.						193.0	199.0	197.0					17																	7470288		989	2111	3100	SO:0001630	splice_region_variant	26168	exon8			TACCAAAGGGTTA	AK000923	CCDS73958.1	17p13	2012-05-02	2005-08-17			ENSG00000161956			17862	protein-coding gene	gene with protein product		612844	"""SUMO1/sentrin/SMT3 specific protease 3"""			10806345, 11230166	Standard	NM_015670		Approved	DKFZP586K0919, SSP3, DKFZp762A152, SMT3IP1, Ulp1	uc002ghm.3	Q9H4L4		ENST00000429205.2:c.1306-1A>G	17.37:g.7470288A>G		405.0	0.0		209.0	23.0	NM_015670	Q66K15|Q86VS7|Q96PS4|Q9Y3W9	Missense_Mutation	SNP	ENST00000429205.2	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	20.4|20.4	3.977344|3.977344	0.74360|0.74360	.|.	.|.	ENSG00000161956|ENSG00000161956	ENST00000321337|ENST00000429205	.|T	.|0.28895	.|1.59	5.71|5.71	5.71|5.71	0.89125|0.89125	.|.	.|.	.|.	.|.	.|.	.|T	.|0.54902	.|0.1887	.|.	.|.	.|.	0.58432|0.58432	D|D	0.999999|0.999999	.|D	.|0.69078	.|0.997	.|D	.|0.77004	.|0.989	.|T	.|0.55755	.|-0.8091	.|8	.|0.45353	.|T	.|0.12	.|-15.252	13.941|13.941	0.64054|0.64054	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|436	.|Q9H4L4	.|SENP3_HUMAN	.|R	-1|436	.|ENSP00000403712:K436R	.|ENSP00000403712:K436R	.|K	+|+	.|2	.|0	SENP3|SENP3	7411012|7411012	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.993000|0.993000	0.82548|0.82548	0.000000|0.000000	0.12993|0.12993	2.179000|2.179000	0.69175|0.69175	0.421000|0.421000	0.28195|0.28195	.|AAG	A|0.500;G|0.500	.		0.398	SENP3-202	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_015670	Missense_Mutation
NLGN1	22871	hgsc.bcm.edu	37	3	173998709	173998709	+	Silent	SNP	C	C	T			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr3:173998709C>T	ENST00000457714.1	+	7	2517	c.2088C>T	c.(2086-2088)gcC>gcT	p.A696A	NLGN1_ENST00000401917.3_Silent_p.A736A|NLGN1_ENST00000545397.1_Silent_p.A696A|NLGN1_ENST00000361589.4_Silent_p.A696A	NM_014932.2	NP_055747.1	Q8N2Q7	NLGN1_HUMAN	neuroligin 1	713					alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor clustering (GO:0097113)|calcium-dependent cell-cell adhesion (GO:0016339)|cytoskeletal matrix organization at active zone (GO:0048789)|establishment of protein localization (GO:0045184)|heterophilic cell-cell adhesion (GO:0007157)|N-methyl-D-aspartate receptor clustering (GO:0097114)|nervous system development (GO:0007399)|neurexin clustering (GO:0097115)|neuron cell-cell adhesion (GO:0007158)|neuronal signal transduction (GO:0023041)|positive regulation of dendritic spine development (GO:0060999)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of intracellular signal transduction (GO:1902533)|positive regulation of ruffle assembly (GO:1900029)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synaptic transmission, GABAergic (GO:0032230)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of synaptic vesicle endocytosis (GO:1900244)|positive regulation of synaptic vesicle exocytosis (GO:2000302)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|protein heterotetramerization (GO:0051290)|protein homooligomerization (GO:0051260)|protein localization to synapse (GO:0035418)|protein targeting (GO:0006605)|receptor localization to synapse (GO:0097120)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of neuron differentiation (GO:0045664)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|synapse assembly (GO:0007416)|synaptic vesicle clustering (GO:0097091)|synaptic vesicle targeting (GO:0016080)|terminal button organization (GO:0072553)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|external side of plasma membrane (GO:0009897)|filopodium tip (GO:0032433)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuronal postsynaptic density (GO:0097481)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|neurexin family protein binding (GO:0042043)|PDZ domain binding (GO:0030165)|protein dimerization activity (GO:0046983)|receptor activity (GO:0004872)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(9)|liver(2)|lung(54)|ovary(1)|pancreas(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	83	Ovarian(172;0.0025)		LUSC - Lung squamous cell carcinoma(14;5.36e-13)|Lung(28;9.49e-13)			CCTTTGCAGCCCTGTACTACA	0.463																																					p.A696A		.	.											.	NLGN1	.	.	0			c.C2088T						.						89.0	89.0	89.0					3																	173998709		2203	4300	6503	SO:0001819	synonymous_variant	22871	exon7			TGCAGCCCTGTAC	AB028993	CCDS3222.1	3q26.32	2008-07-18			ENSG00000169760	ENSG00000169760			14291	protein-coding gene	gene with protein product		600568				10767552, 10819331	Standard	NM_014932		Approved	KIAA1070	uc003fio.1	Q8N2Q7	OTTHUMG00000157005	ENST00000457714.1:c.2088C>T	3.37:g.173998709C>T		142.0	0.0		121.0	56.0	NM_014932	Q9UPT2	Silent	SNP	ENST00000457714.1	37	CCDS3222.1																																																																																			.	.		0.463	NLGN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000347054.3	NM_014932	
SFSWAP	6433	hgsc.bcm.edu	37	12	132204080	132204080	+	Missense_Mutation	SNP	A	A	T			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr12:132204080A>T	ENST00000261674.4	+	4	743	c.602A>T	c.(601-603)gAg>gTg	p.E201V	SFSWAP_ENST00000541286.1_Missense_Mutation_p.E201V	NM_004592.3	NP_004583.2	Q12872	SFSWA_HUMAN	splicing factor, suppressor of white-apricot family	201					mRNA processing (GO:0006397)|mRNA splice site selection (GO:0006376)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	RNA binding (GO:0003723)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(8)|ovary(1)|skin(2)	25						TCTGACGTGGAGTTGGTATGT	0.398																																					p.E201V		.	.											.	SFSWAP	.	.	0			c.A602T						.						128.0	118.0	121.0					12																	132204080		2203	4300	6503	SO:0001583	missense	6433	exon4			ACGTGGAGTTGGT	U08377	CCDS9273.1, CCDS58290.1	12q24.33	2014-04-14	2014-04-14	2010-09-15	ENSG00000061936	ENSG00000061936			10790	protein-coding gene	gene with protein product		601945	"""splicing factor, arginine/serine-rich 8 (suppressor-of-white-apricot, Drosophila homolog)"", ""splicing factor, arginine/serine-rich 8 (suppressor-of-white-apricot homolog, Drosophila)"", ""splicing factor, suppressor of white-apricot homolog (Drosophila)"""	SFRS8		8940107	Standard	NM_004592		Approved	SWAP	uc010tbn.2	Q12872	OTTHUMG00000168319	ENST00000261674.4:c.602A>T	12.37:g.132204080A>T	ENSP00000261674:p.Glu201Val	215.0	0.0		362.0	81.0	NM_001261411	B2RN45|B7ZM97|F5H6B8|Q6PJF7	Missense_Mutation	SNP	ENST00000261674.4	37	CCDS9273.1	.	.	.	.	.	.	.	.	.	.	A	20.4	3.989197	0.74589	.	.	ENSG00000061936	ENST00000261674;ENST00000544623;ENST00000541286	T;T	0.11712	2.75;2.75	5.54	5.54	0.83059	.	0.000000	0.85682	D	0.000000	T	0.23451	0.0567	L	0.34521	1.04	0.80722	D	1	P;B;D	0.89917	0.508;0.374;1.0	P;B;D	0.87578	0.463;0.273;0.998	T	0.00984	-1.1491	10	0.41790	T	0.15	-39.0219	15.9586	0.79910	1.0:0.0:0.0:0.0	.	201;201;138	F5H6B8;Q12872;F5H525	.;SFSWA_HUMAN;.	V	201;138;201	ENSP00000261674:E201V;ENSP00000437738:E201V	ENSP00000261674:E201V	E	+	2	0	SFSWAP	130770033	1.000000	0.71417	1.000000	0.80357	0.480000	0.33159	8.502000	0.90505	2.234000	0.73211	0.459000	0.35465	GAG	.	.		0.398	SFSWAP-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000399276.1	NM_004592	
MSLN	10232	hgsc.bcm.edu	37	16	812697	812697	+	Missense_Mutation	SNP	C	C	G			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr16:812697C>G	ENST00000382862.3	+	2	112	c.17C>G	c.(16-18)gCt>gGt	p.A6G	MSLN_ENST00000563941.1_Missense_Mutation_p.A6G|MSLN_ENST00000545450.2_Missense_Mutation_p.A6G|MSLN_ENST00000566549.1_Missense_Mutation_p.A6G	NM_013404.4	NP_037536.2	Q13421	MSLN_HUMAN	mesothelin	6				PTARPLLG -> QRLDPCW (in Ref. 2; AAC50348). {ECO:0000305}.	cell adhesion (GO:0007155)|pancreas development (GO:0031016)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(2)|kidney(2)|lung(11)|pancreas(1)|prostate(1)|skin(3)	20		Hepatocellular(780;0.00335)				TTGCCAACGGCTCGACCCCTG	0.677																																					p.A6G		.	.											.	MSLN	.	.	0			c.C17G						.						105.0	111.0	109.0					16																	812697		2200	4296	6496	SO:0001583	missense	10232	exon3			CAACGGCTCGACC	U40434	CCDS32356.1, CCDS45370.1	16p13.3	2008-04-16			ENSG00000102854	ENSG00000102854			7371	protein-coding gene	gene with protein product		601051				7665620, 8552591	Standard	NM_005823		Approved	CAK1, MPF	uc002cjw.2	Q13421	OTTHUMG00000047992	ENST00000382862.3:c.17C>G	16.37:g.812697C>G	ENSP00000372313:p.Ala6Gly	131.0	0.0		159.0	29.0	NM_005823	D3DU65|Q14859|Q4VQD5|Q96GR6|Q96KJ5|Q9BR17|Q9BTR2|Q9UCB2|Q9UK57	Missense_Mutation	SNP	ENST00000382862.3	37	CCDS32356.1	.	.	.	.	.	.	.	.	.	.	C	13.83	2.354659	0.41700	.	.	ENSG00000102854	ENST00000446427;ENST00000445361;ENST00000545450;ENST00000382862	T;T	0.18016	2.24;2.24	2.75	2.75	0.32379	.	154.510000	0.00567	U	0.000283	T	0.35740	0.0942	L	0.51422	1.61	0.09310	N	1	D;D;D;D	0.65815	0.994;0.995;0.994;0.994	P;P;P;P	0.61722	0.828;0.893;0.828;0.828	T	0.21518	-1.0243	10	0.87932	D	0	.	9.1818	0.37146	0.0:1.0:0.0:0.0	.	6;6;6;6	Q13421-4;Q13421;Q13421-2;Q13421-3	.;MSLN_HUMAN;.;.	G	6	ENSP00000442965:A6G;ENSP00000372313:A6G	ENSP00000372313:A6G	A	+	2	0	MSLN	752698	0.012000	0.17670	0.033000	0.17914	0.001000	0.01503	2.173000	0.42472	1.886000	0.54624	0.561000	0.74099	GCT	.	.		0.677	MSLN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000109253.2		
PRPF40A	55660	hgsc.bcm.edu	37	2	153529052	153529052	+	Missense_Mutation	SNP	A	A	T			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr2:153529052A>T	ENST00000410080.1	-	13	1832	c.1291T>A	c.(1291-1293)Tca>Aca	p.S431T		NM_017892.3	NP_060362.3	O75400	PR40A_HUMAN	PRP40 pre-mRNA processing factor 40 homolog A (S. cerevisiae)	458	FF 1.				cell cycle (GO:0007049)|cell division (GO:0051301)|cell migration (GO:0016477)|cytoskeleton organization (GO:0007010)|mRNA processing (GO:0006397)|regulation of cell shape (GO:0008360)|regulation of cytokinesis (GO:0032465)|RNA splicing (GO:0008380)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(9)|prostate(1)|urinary_tract(1)	21						TTGTACTTTGATCTTGCTTCT	0.323																																					p.S431T		.	.											.	PRPF40A	.	.	0			c.T1291A						.						117.0	112.0	114.0					2																	153529052		1828	4079	5907	SO:0001583	missense	55660	exon13			ACTTTGATCTTGC	AF049523	CCDS46430.1	2q23.3	2010-01-25	2007-01-12	2006-01-13	ENSG00000196504	ENSG00000196504			16463	protein-coding gene	gene with protein product		612941	"""formin-binding protein 3"", ""formin binding protein 3"", ""PRP40 pre-mRNA processing factor 40 homolog A (yeast)"""	FNBP3		9724750, 12460579	Standard	NM_017892		Approved	FLJ20585, FBP11, HYPA, NY-REN-6, HIP10, FBP-11, FLAF1, Prp40	uc002tyh.4	O75400	OTTHUMG00000154031	ENST00000410080.1:c.1291T>A	2.37:g.153529052A>T	ENSP00000386458:p.Ser431Thr	247.0	0.0		259.0	90.0	NM_017892	O43856|O75404|Q8TBQ1|Q9H782|Q9NWU9|Q9P0Q2|Q9Y5A8	Missense_Mutation	SNP	ENST00000410080.1	37	CCDS46430.1	.	.	.	.	.	.	.	.	.	.	A	16.29	3.082583	0.55861	.	.	ENSG00000196504	ENST00000410080;ENST00000356402;ENST00000440252;ENST00000359961	T	0.30981	1.51	5.48	5.48	0.80851	FF domain (1);	0.130731	0.51477	D	0.000090	T	0.22003	0.0530	L	0.35854	1.095	0.34891	D	0.745513	B;B	0.32620	0.378;0.132	B;B	0.27500	0.073;0.08	T	0.31308	-0.9948	10	0.31617	T	0.26	-9.5398	10.2647	0.43447	0.9262:0.0:0.0738:0.0	.	458;431	O75400;E9PFS0	PR40A_HUMAN;.	T	431;440;327;378	ENSP00000386458:S431T	ENSP00000348770:S440T	S	-	1	0	PRPF40A	153237298	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.891000	0.63185	2.206000	0.71126	0.533000	0.62120	TCA	.	.		0.323	PRPF40A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333559.2	XM_371575	
ITGAV	3685	hgsc.bcm.edu	37	2	187540361	187540361	+	Missense_Mutation	SNP	G	G	T			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr2:187540361G>T	ENST00000261023.3	+	27	3011	c.2737G>T	c.(2737-2739)Gtc>Ttc	p.V913F	AC017101.10_ENST00000453665.1_RNA|ITGAV_ENST00000374907.3_Missense_Mutation_p.V877F|ITGAV_ENST00000433736.2_Missense_Mutation_p.V867F	NM_002210.3	NP_002201	P06756	ITAV_HUMAN	integrin, alpha V	913					angiogenesis (GO:0001525)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apolipoprotein A-I-mediated signaling pathway (GO:0038027)|apoptotic cell clearance (GO:0043277)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|cell adhesion (GO:0007155)|cell growth (GO:0016049)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|cell-substrate adhesion (GO:0031589)|endodermal cell differentiation (GO:0035987)|entry of symbiont into host cell by promotion of host phagocytosis (GO:0052066)|ERK1 and ERK2 cascade (GO:0070371)|extracellular matrix organization (GO:0030198)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|negative chemotaxis (GO:0050919)|negative regulation of entry of bacterium into host cell (GO:2000536)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of lipid storage (GO:0010888)|negative regulation of lipid transport (GO:0032369)|negative regulation of lipoprotein metabolic process (GO:0050748)|negative regulation of low-density lipoprotein particle receptor biosynthetic process (GO:0045715)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of osteoblast proliferation (GO:0033690)|regulation of apoptotic cell clearance (GO:2000425)|regulation of phagocytosis (GO:0050764)|substrate adhesion-dependent cell spreading (GO:0034446)|viral entry into host cell (GO:0046718)	alphav-beta3 integrin-IGF-1-IGF1R complex (GO:0035867)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|integrin alphav-beta3 complex (GO:0034683)|integrin alphav-beta5 complex (GO:0034684)|integrin alphav-beta8 complex (GO:0034686)|integrin complex (GO:0008305)|lamellipodium membrane (GO:0031258)|membrane (GO:0016020)|microvillus membrane (GO:0031528)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	extracellular matrix binding (GO:0050840)|extracellular matrix protein binding (GO:1990430)|fibronectin binding (GO:0001968)|metal ion binding (GO:0046872)|protease binding (GO:0002020)|transforming growth factor beta binding (GO:0050431)|virus receptor activity (GO:0001618)|voltage-gated calcium channel activity (GO:0005245)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(6)|lung(19)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	47			OV - Ovarian serous cystadenocarcinoma(117;0.0185)|Epithelial(96;0.072)|all cancers(119;0.189)	STAD - Stomach adenocarcinoma(3;0.106)|COAD - Colon adenocarcinoma(31;0.108)	Antithymocyte globulin(DB00098)	CTTGAAGATTGTCTGCCAAGT	0.388																																					p.V913F	Melanoma(58;108 1995 6081)	.	.											.	ITGAV	.	.	0			c.G2737T						.						125.0	117.0	120.0					2																	187540361		2203	4300	6503	SO:0001583	missense	3685	exon27			AAGATTGTCTGCC		CCDS2292.1, CCDS46470.1, CCDS46471.1	2q31-q32	2012-04-20	2012-04-20		ENSG00000138448	ENSG00000138448		"""CD molecules"", ""Integrins"""	6150	protein-coding gene	gene with protein product		193210	"""antigen identified by monoclonal antibody L230"", ""vitronectin receptor"", ""integrin, alpha V (vitronectin receptor, alpha polypeptide, antigen CD51)"""	VNRA, MSK8, VTNR		2454952	Standard	NM_001144999		Approved	CD51	uc002upq.4	P06756	OTTHUMG00000132635	ENST00000261023.3:c.2737G>T	2.37:g.187540361G>T	ENSP00000261023:p.Val913Phe	253.0	0.0		291.0	88.0	NM_002210	A0AV67|B0LPF4|B7Z883|B7ZLX0|D3DPG8|E7EWZ6|Q53SK4|Q59EB7|Q6LD15	Missense_Mutation	SNP	ENST00000261023.3	37	CCDS2292.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.75|15.75	2.926836|2.926836	0.52759|0.52759	.|.	.|.	ENSG00000138448|ENSG00000138448	ENST00000430709|ENST00000261023;ENST00000374907;ENST00000433736	.|T;T;T	.|0.46819	.|0.86;0.86;0.86	5.4|5.4	3.24|3.24	0.37175|0.37175	.|Integrin alpha-2 (1);	.|0.474754	.|0.22860	.|N	.|0.054758	T|T	0.31606|0.31606	0.0802|0.0802	N|N	0.22421|0.22421	0.69|0.69	0.27546|0.27546	N|N	0.950647|0.950647	.|P;B;P	.|0.35155	.|0.487;0.069;0.487	.|B;B;B	.|0.33392	.|0.104;0.091;0.163	T|T	0.16188|0.16188	-1.0411|-1.0411	5|10	.|0.56958	.|D	.|0.05	.|.	9.6868|9.6868	0.40103|0.40103	0.1986:0.0:0.8014:0.0|0.1986:0.0:0.8014:0.0	.|.	.|867;877;913	.|E7EWZ6;P06756-2;P06756	.|.;.;ITAV_HUMAN	F|F	63|913;877;867	.|ENSP00000261023:V913F;ENSP00000364042:V877F;ENSP00000404291:V867F	.|ENSP00000261023:V913F	L|V	+|+	3|1	2|0	ITGAV|ITGAV	187248606|187248606	0.948000|0.948000	0.32251|0.32251	0.992000|0.992000	0.48379|0.48379	0.921000|0.921000	0.55340|0.55340	1.442000|1.442000	0.35046|0.35046	0.560000|0.560000	0.29169|0.29169	-0.244000|-0.244000	0.11960|0.11960	TTG|GTC	.	.		0.388	ITGAV-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255882.2	NM_002210	
LARP7	51574	hgsc.bcm.edu	37	4	113568542	113568542	+	Missense_Mutation	SNP	A	A	T			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr4:113568542A>T	ENST00000344442.5	+	7	1112	c.834A>T	c.(832-834)aaA>aaT	p.K278N	MIR302C_ENST00000362232.1_RNA|MIR302B_ENST00000362188.1_RNA|LARP7_ENST00000324052.6_Missense_Mutation_p.K278N|LARP7_ENST00000509061.1_Missense_Mutation_p.K285N|MIR302D_ENST00000362275.1_RNA|MIR302B_ENST00000509938.1_RNA|MIR302B_ENST00000505215.1_RNA|MIR302A_ENST00000385192.1_RNA|MIR302B_ENST00000510655.1_RNA|MIR367_ENST00000362299.1_RNA	NM_016648.3	NP_057732.2	Q4G0J3	LARP7_HUMAN	La ribonucleoprotein domain family, member 7	278	Lys-rich.				RNA processing (GO:0006396)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			endometrium(2)|large_intestine(2)|lung(8)|ovary(4)|skin(1)	17		Ovarian(17;0.0443)|Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.000603)		AAAAGAAAAAACGGGACAGAG	0.463																																					p.K285N		.	.											.	LARP7	.	.	0			c.A855T						.						102.0	101.0	101.0					4																	113568542		1854	4106	5960	SO:0001583	missense	51574	exon9			GAAAAAACGGGAC	AF068284	CCDS3701.2, CCDS58924.1	4q25	2013-02-12			ENSG00000174720	ENSG00000174720		"""La ribonucleoprotein domain containing"", ""RNA binding motif (RRM) containing"""	24912	protein-coding gene	gene with protein product	"""P-TEFb-interaction protein for 7SK stability"""	612026				18191186, 18249148, 18281698, 22865833, 22488152	Standard	NM_016648		Approved	HDCMA18P, PIP7S, DKFZP564K112	uc003ibb.4	Q4G0J3	OTTHUMG00000132909	ENST00000344442.5:c.834A>T	4.37:g.113568542A>T	ENSP00000344950:p.Lys278Asn	273.0	0.0		248.0	121.0	NM_001267039	B2ZHN6|Q3B7A9|Q9P1S7|Q9Y3Z8	Missense_Mutation	SNP	ENST00000344442.5	37	CCDS3701.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	14.18|14.18	2.457685|2.457685	0.43634|0.43634	.|.	.|.	ENSG00000174720|ENSG00000174720	ENST00000344442;ENST00000509061;ENST00000505034;ENST00000324052|ENST00000511529	T;T;T;T|.	0.41400|.	1.0;1.0;2.14;1.0|.	5.86|5.86	-5.36|-5.36	0.02689|0.02689	.|.	0.142951|.	0.64402|.	N|.	0.000011|.	T|T	0.51770|0.51770	0.1694|0.1694	M|M	0.76002|0.76002	2.32|2.32	0.20307|0.20307	N|N	0.999914|0.999914	D;D|.	0.89917|.	0.999;1.0|.	D;D|.	0.87578|.	0.994;0.998|.	T|T	0.54918|0.54918	-0.8221|-0.8221	10|5	0.35671|.	T|.	0.21|.	-25.4983|-25.4983	10.7858|10.7858	0.46405|0.46405	0.4306:0.0:0.4769:0.0926|0.4306:0.0:0.4769:0.0926	.|.	278;278|.	D6RFF0;Q4G0J3|.	.;LARP7_HUMAN|.	N|I	278;285;278;278|59	ENSP00000344950:K278N;ENSP00000422626:K285N;ENSP00000421541:K278N;ENSP00000314311:K278N|.	ENSP00000314311:K278N|.	K|N	+|+	3|2	2|0	LARP7|LARP7	113787991|113787991	0.045000|0.045000	0.20229|0.20229	0.042000|0.042000	0.18584|0.18584	0.155000|0.155000	0.21991|0.21991	0.331000|0.331000	0.19733|0.19733	-1.441000|-1.441000	0.01958|0.01958	-1.450000|-1.450000	0.01041|0.01041	AAA|AAC	.	.		0.463	LARP7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256417.2	NM_016648	
PTPN21	11099	hgsc.bcm.edu	37	14	88938677	88938677	+	Nonsense_Mutation	SNP	G	G	A			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr14:88938677G>A	ENST00000556564.1	-	15	3066	c.2782C>T	c.(2782-2784)Caa>Taa	p.Q928*	PTPN21_ENST00000328736.3_Nonsense_Mutation_p.Q928*	NM_007039.3	NP_008970.2	Q16825	PTN21_HUMAN	protein tyrosine phosphatase, non-receptor type 21	928	Tyrosine-protein phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00160}.				peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	protein tyrosine phosphatase activity (GO:0004725)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(13)|liver(1)|lung(7)|ovary(4)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	45						AGAACATCTTGGAATCGATTT	0.403																																					p.Q928X		.	.											.	PTPN21	.	.	0			c.C2782T						.						196.0	171.0	180.0					14																	88938677		2203	4300	6503	SO:0001587	stop_gained	11099	exon15			CATCTTGGAATCG	X79510	CCDS9884.1	14q31	2011-06-09				ENSG00000070778		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9651	protein-coding gene	gene with protein product		603271				7519780	Standard	NM_007039		Approved	PTPD1, PTPRL10	uc001xwv.4	Q16825		ENST00000556564.1:c.2782C>T	14.37:g.88938677G>A	ENSP00000452414:p.Gln928*	358.0	0.0		284.0	51.0	NM_007039		Nonsense_Mutation	SNP	ENST00000556564.1	37	CCDS9884.1	.	.	.	.	.	.	.	.	.	.	G	43	10.348499	0.99388	.	.	ENSG00000070778	ENST00000328736;ENST00000556564	.	.	.	5.86	5.86	0.93980	.	0.119510	0.64402	D	0.000019	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.05620	T	0.96	.	20.2019	0.98263	0.0:0.0:1.0:0.0	.	.	.	.	X	928	.	ENSP00000330276:Q928X	Q	-	1	0	PTPN21	88008430	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	5.567000	0.67378	2.776000	0.95493	0.655000	0.94253	CAA	.	.		0.403	PTPN21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410303.1		
VCX	26609	hgsc.bcm.edu	37	X	7811709	7811709	+	Silent	SNP	G	G	C	rs139507263	byFrequency	TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chrX:7811709G>C	ENST00000381059.3	+	3	492	c.273G>C	c.(271-273)ccG>ccC	p.P91P	VCX_ENST00000341408.4_Silent_p.P91P	NM_013452.2	NP_038480.2	Q9H320	VCX1_HUMAN	variable charge, X-linked	91	Glu-rich.				chromatin organization (GO:0006325)|ribosome assembly (GO:0042255)|spermatogenesis (GO:0007283)	nucleolus (GO:0005730)|nucleus (GO:0005634)	chromatin binding (GO:0003682)	p.P91P(1)		NS(1)|endometrium(4)|large_intestine(2)|lung(1)|skin(1)|upper_aerodigestive_tract(1)	10		Colorectal(8;0.0136)|Medulloblastoma(8;0.184)				AGCTGCCGCCGGAGGAGCCAG	0.701																																					p.P91P		.	.											.	VCX	.	.	1	Substitution - coding silent(1)	endometrium(1)	c.G273C						.						23.0	31.0	28.0					X																	7811709		2089	4025	6114	SO:0001819	synonymous_variant	26609	exon3			GCCGCCGGAGGAG	AF167081	CCDS14128.1	Xp22.31	2008-02-05	2003-09-12		ENSG00000182583	ENSG00000182583			12667	protein-coding gene	gene with protein product		300229	"""variable charge, X chromosome"""			10607842, 10903929	Standard	NM_013452		Approved	VCX1, VCX10R, VCX-10r, VCX-B1	uc004crz.3	Q9H320	OTTHUMG00000028608	ENST00000381059.3:c.273G>C	X.37:g.7811709G>C		81.0	0.0		83.0	28.0	NM_013452	A0JNS5|Q4V774|Q9P0H3	Silent	SNP	ENST00000381059.3	37	CCDS14128.1																																																																																			G|0.999;A|0.001	.		0.701	VCX-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000071474.1	NM_013452	
SPATA2L	124044	hgsc.bcm.edu	37	16	89764069	89764069	+	Silent	SNP	C	C	G			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr16:89764069C>G	ENST00000289805.5	-	3	1016	c.948G>C	c.(946-948)ctG>ctC	p.L316L	SPATA2L_ENST00000335360.7_Intron	NM_152339.3	NP_689552.2	Q8IUW3	SPA2L_HUMAN	spermatogenesis associated 2-like	316										breast(1)|cervix(1)|endometrium(1)|lung(2)|skin(1)	6		Lung NSC(15;0.00043)|all_lung(18;0.000665)|all_hematologic(23;0.0355)		BRCA - Breast invasive adenocarcinoma(80;0.0272)		CAGGCCTACTCAGCTCACGGC	0.652																																					p.L316L		.	.											.	SPATA2L	.	.	0			c.G948C						.						30.0	33.0	32.0					16																	89764069		2197	4300	6497	SO:0001819	synonymous_variant	124044	exon3			CCTACTCAGCTCA	AF070574	CCDS10985.1	16q24.3	2007-01-30	2007-01-30	2007-01-30	ENSG00000158792	ENSG00000158792			28393	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 76"""	C16orf76		8619474	Standard	NM_152339		Approved	MGC26885, tamo	uc002foj.3	Q8IUW3	OTTHUMG00000138047	ENST00000289805.5:c.948G>C	16.37:g.89764069C>G		65.0	0.0		91.0	18.0	NM_152339	D3DX85|Q8NHV3	Silent	SNP	ENST00000289805.5	37	CCDS10985.1																																																																																			.	.		0.652	SPATA2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269923.1	NM_152339	
MYO10	4651	hgsc.bcm.edu	37	5	16701663	16701663	+	Silent	SNP	G	G	A			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr5:16701663G>A	ENST00000513610.1	-	25	3295	c.2841C>T	c.(2839-2841)ttC>ttT	p.F947F	MYO10_ENST00000505695.1_Silent_p.F286F|MYO10_ENST00000512061.1_5'Flank|MYO10_ENST00000515803.1_Silent_p.F286F|MYO10_ENST00000427430.2_Silent_p.F304F|MYO10_ENST00000274203.9_Silent_p.F304F	NM_012334.2	NP_036466.2	Q9HD67	MYO10_HUMAN	myosin X	947					ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|cytoskeleton-dependent intracellular transport (GO:0030705)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|metabolic process (GO:0008152)|positive regulation of cell-cell adhesion (GO:0022409)|regulation of cell shape (GO:0008360)|regulation of filopodium assembly (GO:0051489)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|filopodium tip (GO:0032433)|myosin complex (GO:0016459)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)	actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|plus-end directed microfilament motor activity (GO:0060002)|spectrin binding (GO:0030507)	p.F947F(1)		NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(19)|lung(28)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	86						CGATCTCGTCGAAATTGAGGG	0.632																																					p.F947F		.	.											.	MYO10	.	.	1	Substitution - coding silent(1)	kidney(1)	c.C2841T						.						38.0	44.0	42.0					5																	16701663		2150	4273	6423	SO:0001819	synonymous_variant	4651	exon25			CTCGTCGAAATTG	AF247457	CCDS54834.1	5p15.1-p14.3	2013-01-10				ENSG00000145555		"""Myosins / Myosin superfamily : Class X"", ""Pleckstrin homology (PH) domain containing"""	7593	protein-coding gene	gene with protein product		601481				8884266	Standard	NM_012334		Approved	KIAA0799	uc003jft.4	Q9HD67		ENST00000513610.1:c.2841C>T	5.37:g.16701663G>A		114.0	0.0		83.0	33.0	NM_012334	A7E2D1|O94893|Q8IVX5|Q9NYM7|Q9P110|Q9P111|Q9UHF6	Silent	SNP	ENST00000513610.1	37	CCDS54834.1																																																																																			.	.		0.632	MYO10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366167.1	NM_012334	
RAD50	10111	hgsc.bcm.edu	37	5	131924503	131924503	+	Missense_Mutation	SNP	G	G	T			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr5:131924503G>T	ENST00000265335.6	+	8	1563	c.1176G>T	c.(1174-1176)caG>caT	p.Q392H	RAD50_ENST00000378823.3_Missense_Mutation_p.Q253H			Q92878	RAD50_HUMAN	RAD50 homolog (S. cerevisiae)	392					cellular response to DNA damage stimulus (GO:0006974)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA duplex unwinding (GO:0032508)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|positive regulation of kinase activity (GO:0033674)|positive regulation of protein autophosphorylation (GO:0031954)|reciprocal meiotic recombination (GO:0007131)|regulation of mitotic recombination (GO:0000019)|telomere maintenance (GO:0000723)|telomere maintenance via telomerase (GO:0007004)	membrane (GO:0016020)|Mre11 complex (GO:0030870)|nuclear chromosome, telomeric region (GO:0000784)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|pronucleus (GO:0045120)|site of double-strand break (GO:0035861)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|nuclease activity (GO:0004518)|protein binding, bridging (GO:0030674)|zinc ion binding (GO:0008270)			breast(3)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(10)|liver(1)|lung(8)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	36		all_cancers(142;0.0368)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			GTGAAAGACAGATTAAAAATT	0.383								Homologous recombination																													p.Q392H		.	.											.	RAD50	.	.	0			c.G1176T						.						89.0	88.0	88.0					5																	131924503		2203	4300	6503	SO:0001583	missense	10111	exon8			AAGACAGATTAAA	Z75311	CCDS34233.1	5q23-q31	2008-05-30	2001-11-28		ENSG00000113522	ENSG00000113522			9816	protein-coding gene	gene with protein product		604040	"""RAD50 (S. cerevisiae) homolog"""			8756642, 9705271	Standard	NM_005732		Approved	hRad50, RAD50-2	uc003kxi.3	Q92878	OTTHUMG00000059613	ENST00000265335.6:c.1176G>T	5.37:g.131924503G>T	ENSP00000265335:p.Gln392His	400.0	0.0		524.0	47.0	NM_005732	B9EGF5|O43254|Q6GMT7|Q6P5X3|Q9UP86	Missense_Mutation	SNP	ENST00000265335.6	37	CCDS34233.1	.	.	.	.	.	.	.	.	.	.	G	13.37	2.215788	0.39102	.	.	ENSG00000113522	ENST00000378823;ENST00000265335;ENST00000453394	T;T;T	0.08458	3.4;3.09;3.09	5.97	2.61	0.31194	.	0.106596	0.64402	N	0.000003	T	0.09335	0.0230	M	0.69823	2.125	0.48975	D	0.99973	B	0.12013	0.005	B	0.11329	0.006	T	0.12708	-1.0537	10	0.52906	T	0.07	-5.6091	3.1478	0.06478	0.2277:0.1203:0.519:0.1331	.	392	Q92878	RAD50_HUMAN	H	253;392;392	ENSP00000368100:Q253H;ENSP00000265335:Q392H;ENSP00000400049:Q392H	ENSP00000265335:Q392H	Q	+	3	2	RAD50	131952402	0.996000	0.38824	1.000000	0.80357	0.993000	0.82548	0.385000	0.20685	0.757000	0.33036	-0.345000	0.07892	CAG	.	.		0.383	RAD50-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132566.5	NM_005732	
DCAF5	8816	hgsc.bcm.edu	37	14	69584924	69584924	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr14:69584924T>C	ENST00000341516.5	-	4	614	c.467A>G	c.(466-468)aAc>aGc	p.N156S	DCAF5_ENST00000553293.1_5'Flank|DCAF5_ENST00000556847.1_Missense_Mutation_p.N74S|DCAF5_ENST00000557386.1_Missense_Mutation_p.N155S|DCAF5_ENST00000389997.6_Missense_Mutation_p.N156S|DCAF5_ENST00000554215.1_Missense_Mutation_p.N74S	NM_001284206.1|NM_001284207.1|NM_003861.2	NP_001271135.1|NP_001271136.1|NP_003852.1	Q96JK2	DCAF5_HUMAN	DDB1 and CUL4 associated factor 5	156					protein ubiquitination (GO:0016567)	Cul4-RING E3 ubiquitin ligase complex (GO:0080008)|mitochondrion (GO:0005739)				breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(15)|ovary(2)|upper_aerodigestive_tract(2)	29						GGCAAAAATGTTGTCATTCAC	0.498																																					p.N156S		.	.											.	DCAF5	.	.	0			c.A467G						.						124.0	101.0	109.0					14																	69584924		2203	4300	6503	SO:0001583	missense	8816	exon4			AAAATGTTGTCAT	AB058727	CCDS32106.1, CCDS61480.1, CCDS61481.1, CCDS73646.1	14q23-q24.1	2013-01-09	2009-07-17	2009-07-17				"""WD repeat domain containing"", ""DDB1 and CUL4 associated factors"""	20224	protein-coding gene	gene with protein product		603812	"""WD repeat domain 22"""	WDR22		9740667, 9521877	Standard	NM_003861		Approved	BCRP2, D14S1461E, BCRG2, KIAA1824	uc001xkp.3	Q96JK2		ENST00000341516.5:c.467A>G	14.37:g.69584924T>C	ENSP00000341351:p.Asn156Ser	125.0	0.0		90.0	16.0	NM_003861	B2RN31|G3V4J7|O60559|Q8N3V3|Q8N3V5	Missense_Mutation	SNP	ENST00000341516.5	37	CCDS32106.1	.	.	.	.	.	.	.	.	.	.	T	19.50	3.840109	0.71488	.	.	ENSG00000139990	ENST00000341516;ENST00000554215;ENST00000556847;ENST00000557386;ENST00000389997;ENST00000554681	T;T;T;T;T;T	0.60171	0.21;0.21;0.21;0.21;0.21;0.21	5.68	5.68	0.88126	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.63379	0.2506	N	0.20304	0.555	0.58432	D	0.999999	D;P;P	0.76494	0.999;0.48;0.716	D;B;B	0.79108	0.992;0.184;0.376	T	0.66139	-0.5998	10	0.46703	T	0.11	-22.5015	15.9389	0.79739	0.0:0.0:0.0:1.0	.	156;155;156	Q8TBB7;G3V4J7;Q96JK2	.;.;DCAF5_HUMAN	S	156;74;74;155;156;73	ENSP00000341351:N156S;ENSP00000451551:N74S;ENSP00000452052:N74S;ENSP00000451845:N155S;ENSP00000374647:N156S;ENSP00000451394:N73S	ENSP00000341351:N156S	N	-	2	0	DCAF5	68654677	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.959000	0.70339	2.160000	0.67779	0.533000	0.62120	AAC	.	.		0.498	DCAF5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000414806.2	NM_003861	
ZNF675	171392	hgsc.bcm.edu	37	19	23836432	23836432	+	Nonsense_Mutation	SNP	G	G	A	rs199957959		TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr19:23836432G>A	ENST00000359788.4	-	4	1471	c.1303C>T	c.(1303-1305)Cga>Tga	p.R435*	ZNF675_ENST00000600313.1_Intron|ZNF675_ENST00000601935.1_Intron|ZNF675_ENST00000596211.1_Intron	NM_138330.2	NP_612203.2	Q8TD23	ZN675_HUMAN	zinc finger protein 675	435					bone resorption (GO:0045453)|cytokine-mediated signaling pathway (GO:0019221)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|negative regulation of interleukin-1-mediated signaling pathway (GO:2000660)|negative regulation of JNK cascade (GO:0046329)|negative regulation of JUN kinase activity (GO:0043508)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription regulatory region DNA binding (GO:2000678)|negative regulation of tumor necrosis factor-mediated signaling pathway (GO:0010804)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	DNA binding (GO:0003677)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)			endometrium(3)|kidney(2)|large_intestine(8)|lung(11)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	27		all_lung(12;0.11)|Lung NSC(12;0.163)|all_epithelial(12;0.206)				TTTGAGGATCGGTTAAAAGCT	0.378																																					p.R435X		.	.											.	ZNF675	.	.	0			c.C1303T						.						52.0	55.0	54.0					19																	23836432		2202	4300	6502	SO:0001587	stop_gained	171392	exon4			AGGATCGGTTAAA		CCDS32981.1	19p12	2013-01-08						"""Zinc fingers, C2H2-type"", ""-"""	30768	protein-coding gene	gene with protein product	"""TRAF6 inhibitory zinc finger"""					11751921	Standard	NM_138330		Approved	TIZ, TBZF	uc002nri.3	Q8TD23		ENST00000359788.4:c.1303C>T	19.37:g.23836432G>A	ENSP00000352836:p.Arg435*	82.0	0.0		70.0	6.0	NM_138330	Q8N211	Nonsense_Mutation	SNP	ENST00000359788.4	37	CCDS32981.1	.	.	.	.	.	.	.	.	.	.	.	14.11	2.436250	0.43224	.	.	ENSG00000197372	ENST00000359788	.	.	.	0.876	-1.75	0.08031	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.11794	T	0.64	.	3.7084	0.08410	0.0:0.2017:0.47:0.3283	.	.	.	.	X	435	.	ENSP00000352836:R435X	R	-	1	2	ZNF675	23628272	0.000000	0.05858	0.008000	0.14137	0.008000	0.06430	-0.308000	0.08156	-0.892000	0.03935	-0.901000	0.02856	CGA	G|0.999;A|0.001	.		0.378	ZNF675-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466433.1	NM_138330	
AK5	26289	hgsc.bcm.edu	37	1	77763544	77763544	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A112-01A-11D-A12Z-10	TCGA-BC-A112-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b3d19f75-db62-42cc-8a6f-7685ab1f3b9b	bb1973b9-7ab8-4bbc-beb1-9448f91ad7ef	g.chr1:77763544A>G	ENST00000354567.2	+	5	874	c.611A>G	c.(610-612)cAa>cGa	p.Q204R	AK5_ENST00000317704.4_3'UTR|AK5_ENST00000344720.5_Missense_Mutation_p.Q178R	NM_174858.2	NP_777283.1	Q9Y6K8	KAD5_HUMAN	adenylate kinase 5	204	Adenylate kinase 1.				ADP biosynthetic process (GO:0006172)|ATP metabolic process (GO:0046034)|dADP biosynthetic process (GO:0006173)|nucleobase-containing small molecule interconversion (GO:0015949)|nucleobase-containing small molecule metabolic process (GO:0055086)|nucleoside diphosphate phosphorylation (GO:0006165)|nucleoside triphosphate biosynthetic process (GO:0009142)|pyrimidine ribonucleotide biosynthetic process (GO:0009220)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|microtubule organizing center (GO:0005815)	adenylate kinase activity (GO:0004017)|ATP binding (GO:0005524)|nucleoside diphosphate kinase activity (GO:0004550)|nucleoside kinase activity (GO:0019206)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(27)|prostate(1)|skin(2)|stomach(1)	40						GAGATAAAGCAAAAATTGATG	0.338																																					p.Q204R		.	.											.	AK5	.	.	0			c.A611G						.						91.0	92.0	92.0					1																	77763544		2203	4300	6503	SO:0001583	missense	26289	exon5			TAAAGCAAAAATT	AF062595	CCDS675.1, CCDS676.1	1p31	2008-02-05			ENSG00000154027	ENSG00000154027		"""Adenylate kinases"""	365	protein-coding gene	gene with protein product		608009				10215863	Standard	NM_012093		Approved		uc001dhn.3	Q9Y6K8	OTTHUMG00000009796	ENST00000354567.2:c.611A>G	1.37:g.77763544A>G	ENSP00000346577:p.Gln204Arg	156.0	0.0		154.0	51.0	NM_174858	Q5U622|Q6FH66|Q7Z4T5|Q86YS0|Q8N464|Q96EC9	Missense_Mutation	SNP	ENST00000354567.2	37	CCDS675.1	.	.	.	.	.	.	.	.	.	.	A	26.3	4.720961	0.89205	.	.	ENSG00000154027	ENST00000354567;ENST00000344720	T;T	0.76839	-1.05;-1.05	5.51	5.51	0.81932	.	0.061471	0.64402	D	0.000002	T	0.77538	0.4145	L	0.33245	0.995	0.80722	D	1	P;D	0.64830	0.858;0.994	P;D	0.76575	0.462;0.988	T	0.77362	-0.2616	10	0.34782	T	0.22	-7.6916	15.9245	0.79606	1.0:0.0:0.0:0.0	.	204;180	Q9Y6K8;Q8N291	KAD5_HUMAN;.	R	204;178	ENSP00000346577:Q204R;ENSP00000341430:Q178R	ENSP00000341430:Q178R	Q	+	2	0	AK5	77536132	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.664000	0.91139	2.236000	0.73375	0.528000	0.53228	CAA	.	.		0.338	AK5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026993.4	NM_174858	
