#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
VWA5B1	127731	hgsc.bcm.edu	37	1	20657389	20657389	+	Missense_Mutation	SNP	C	C	A	rs372275354		TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr1:20657389C>A	ENST00000375079.2	+	11	1681	c.1485C>A	c.(1483-1485)aaC>aaA	p.N495K	VWA5B1_ENST00000289825.4_Missense_Mutation_p.N212K|VWA5B1_ENST00000375083.4_Missense_Mutation_p.N495K|VWA5B1_ENST00000289815.8_Missense_Mutation_p.N495K	NM_001039500.2	NP_001034589.2	Q5TIE3	VW5B1_HUMAN	von Willebrand factor A domain containing 5B1	495	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.					extracellular region (GO:0005576)				central_nervous_system(1)|endometrium(3)|kidney(1)|prostate(1)|skin(1)	7						TTGGACCCAACGTCTGCCACA	0.557																																					p.N495K		Atlas-SNP	.											.	VWA5B1	44	.	0			c.C1485A						.						76.0	71.0	73.0					1																	20657389		692	1591	2283	SO:0001583	missense	127731	exon11			ACCCAACGTCTGC	AK125833, AK057346		1p36.12	2014-02-12			ENSG00000158816	ENSG00000158816			26538	protein-coding gene	gene with protein product							Standard	NM_001039500		Approved	FLJ32784	uc009vps.2	Q5TIE3	OTTHUMG00000002835	ENST00000375079.2:c.1485C>A	chr1.hg19:g.20657389C>A	ENSP00000364220:p.Asn495Lys	204.0	0.0		145.0	81.0	NM_001039500	A4IF35|A4IF36|Q3ZCM4|Q6ZUB4|Q96M71	Missense_Mutation	SNP	ENST00000375079.2	hg19		.	.	.	.	.	.	.	.	.	.	C	3.122	-0.180229	0.06380	.	.	ENSG00000158816	ENST00000375089;ENST00000289815;ENST00000375083;ENST00000289825;ENST00000375079	T;T;T;T	0.07216	3.21;3.21;3.21;3.21	5.19	-3.76	0.04359	von Willebrand factor, type A (3);	0.693341	0.14842	N	0.295238	T	0.03477	0.0100	N	0.25144	0.715	0.21984	N	0.999432	B;B;B	0.26081	0.027;0.056;0.141	B;B;B	0.23716	0.048;0.024;0.028	T	0.43814	-0.9368	10	0.13470	T	0.59	-5.6013	2.9084	0.05728	0.1154:0.3275:0.108:0.4491	.	495;495;212	Q5TIE3;Q5TIE3-2;Q5TIE3-3	VW5B1_HUMAN;.;.	K	495;495;495;212;495	ENSP00000289815:N495K;ENSP00000364224:N495K;ENSP00000289825:N212K;ENSP00000364220:N495K	ENSP00000289815:N495K	N	+	3	2	VWA5B1	20529976	0.000000	0.05858	0.893000	0.35052	0.983000	0.72400	-2.824000	0.00747	-0.282000	0.09128	-0.152000	0.13540	AAC	.	.		0.557	VWA5B1-001	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000007945.4	XM_001722222	
DNAJC6	9829	hgsc.bcm.edu	37	1	65775451	65775451	+	Intron	SNP	G	G	A			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr1:65775451G>A	ENST00000395325.3	+	1	179				DNAJC6_ENST00000263441.7_Intron|DNAJC6_ENST00000371069.4_Missense_Mutation_p.R8Q	NM_014787.3	NP_055602.1	O75061	AUXI_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 6						cell death (GO:0008219)|clathrin coat disassembly (GO:0072318)|membrane organization (GO:0061024)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of clathrin-mediated endocytosis (GO:2000369)	cytosol (GO:0005829)|synapse (GO:0045202)	protein tyrosine phosphatase activity (GO:0004725)			NS(1)|breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(22)|ovary(1)|prostate(2)|skin(1)	39						GGGAGCTACCGGAAAAAGACC	0.542																																					p.R8Q		Atlas-SNP	.											.	DNAJC6	104	.	0			c.G23A						.																																			SO:0001627	intron_variant	9829	exon1			GCTACCGGAAAAA	AB007942	CCDS30739.1, CCDS58004.1, CCDS58005.1	1p31.3	2011-09-02			ENSG00000116675	ENSG00000116675		"""Heat shock proteins / DNAJ (HSP40)"""	15469	protein-coding gene	gene with protein product	"""auxilin"""	608375				9455484, 11147971	Standard	NM_001256864		Approved	KIAA0473	uc001dce.2	O75061	OTTHUMG00000009066	ENST00000395325.3:c.22+44836G>A	chr1.hg19:g.65775451G>A		146.0	0.0		120.0	29.0	NM_001256864	B7Z3V8|D3DQ65|D3DQ66|Q32M66|Q4G0K1|Q5T614|Q5T615	Missense_Mutation	SNP	ENST00000395325.3	hg19	CCDS30739.1	.	.	.	.	.	.	.	.	.	.	G	16.07	3.017727	0.54576	.	.	ENSG00000116675	ENST00000371069	D	0.93019	-3.15	4.12	4.12	0.48240	.	0.620378	0.13604	N	0.375676	D	0.86594	0.5970	.	.	.	0.80722	D	1	P	0.46327	0.876	B	0.35899	0.213	D	0.87541	0.2459	9	0.51188	T	0.08	.	16.2031	0.82102	0.0:0.0:1.0:0.0	.	8	O75061-2	.	Q	8	ENSP00000360108:R8Q	ENSP00000360108:R8Q	R	+	2	0	DNAJC6	65548039	1.000000	0.71417	1.000000	0.80357	0.893000	0.52053	5.635000	0.67841	2.149000	0.67028	0.555000	0.69702	CGG	.	.		0.542	DNAJC6-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000025134.1		
SLC44A5	204962	hgsc.bcm.edu	37	1	75805298	75805298	+	Missense_Mutation	SNP	C	C	A			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr1:75805298C>A	ENST00000370855.5	-	4	183	c.70G>T	c.(70-72)Gac>Tac	p.D24Y	SLC44A5_ENST00000535611.1_5'UTR|SLC44A5_ENST00000370859.3_Missense_Mutation_p.D24Y|SLC44A5_ENST00000469525.1_5'UTR	NM_152697.4	NP_689910.2	Q8NCS7	CTL5_HUMAN	solute carrier family 44, member 5	24					glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				kidney(1)|large_intestine(13)|lung(35)|ovary(2)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	61						AAATCTGGGTCATATGTCCTT	0.343																																					p.D24Y		Atlas-SNP	.											.	SLC44A5	231	.	0			c.G70T						.						198.0	218.0	211.0					1																	75805298		2203	4300	6503	SO:0001583	missense	204962	exon4			CTGGGTCATATGT	BC034580	CCDS667.1, CCDS44164.1	1p31.1	2013-05-22			ENSG00000137968	ENSG00000137968		"""Solute carriers"""	28524	protein-coding gene	gene with protein product						15715662	Standard	NM_152697		Approved	MGC34032, CTL5	uc001dgu.3	Q8NCS7	OTTHUMG00000009721	ENST00000370855.5:c.70G>T	chr1.hg19:g.75805298C>A	ENSP00000359892:p.Asp24Tyr	74.0	0.0		65.0	14.0	NM_152697	B5MCU3|Q4G0K0|Q8NA44|Q8NB86	Missense_Mutation	SNP	ENST00000370855.5	hg19	CCDS667.1	.	.	.	.	.	.	.	.	.	.	C	12.92	2.083835	0.36758	.	.	ENSG00000137968	ENST00000370859;ENST00000536707;ENST00000370855;ENST00000535790	T;T	0.44482	0.92;0.92	5.54	4.62	0.57501	.	0.221145	0.44688	D	0.000432	T	0.57548	0.2061	M	0.85197	2.74	0.54753	D	0.99998	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.85130	0.996;0.993;0.992;0.997	T	0.66031	-0.6024	10	0.87932	D	0	-4.9098	10.5386	0.45020	0.0:0.9103:0.0:0.0897	.	18;63;24;24	B7Z5Y4;B7Z470;Q8NCS7;Q8NCS7-2	.;.;CTL5_HUMAN;.	Y	24;63;24;17	ENSP00000359896:D24Y;ENSP00000359892:D24Y	ENSP00000359892:D24Y	D	-	1	0	SLC44A5	75577886	0.872000	0.30054	0.058000	0.19502	0.574000	0.36063	1.692000	0.37731	1.468000	0.48064	0.650000	0.86243	GAC	.	.		0.343	SLC44A5-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000026921.1	NM_152697	
KCNC4	3749	hgsc.bcm.edu	37	1	110775555	110775555	+	3'UTR	SNP	G	G	A	rs374236746		TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr1:110775555G>A	ENST00000369787.3	+	0	2559				KCNC4_ENST00000438661.2_Silent_p.S614S|KCNC4_ENST00000413138.3_3'UTR|KCNC4_ENST00000412512.2_Intron	NM_004978.4	NP_004969.2	Q03721	KCNC4_HUMAN	potassium voltage-gated channel, Shaw-related subfamily, member 4						potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|regulation of neurotransmitter secretion (GO:0046928)|synaptic transmission (GO:0007268)	axon terminus (GO:0043679)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|potassium channel activity (GO:0005267)|voltage-gated potassium channel activity (GO:0005249)			central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|liver(2)|lung(11)|ovary(1)|skin(2)	32		all_cancers(81;9.88e-06)|all_epithelial(167;3.23e-06)|all_lung(203;0.000116)|Lung NSC(277;0.000233)		Lung(183;0.0238)|all cancers(265;0.0693)|Epithelial(280;0.0748)|Colorectal(144;0.112)|LUSC - Lung squamous cell carcinoma(189;0.135)		ACGCCCTCTCGTCCAACTATG	0.562													G|||	1	0.000199681	0.0	0.0	5008	,	,		19127	0.0		0.0	False		,,,				2504	0.001				p.S614S		Atlas-SNP	.											KCNC4_ENST00000438661,NS,carcinoma,0,1	KCNC4	113	.	0			c.G1842A						.	G	,	0,3982		0,0,1991	60.0	63.0	62.0		1842,	2.4	1.0	1		62	1,8313		0,1,4156	no	coding-synonymous,utr-3	KCNC4	NM_001039574.2,NM_004978.4	,	0,1,6147	AA,AG,GG		0.012,0.0,0.0081	,	614/627,	110775555	1,12295	1991	4157	6148	SO:0001624	3_prime_UTR_variant	3749	exon4			CCTCTCGTCCAAC	BC101769	CCDS821.1, CCDS44193.1	1p21	2012-07-05			ENSG00000116396	ENSG00000116396		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6236	protein-coding gene	gene with protein product		176265	"""chromosome 1 open reading frame 30"""	C1orf30		1920536, 1740329, 16382104	Standard	NM_004978		Approved	Kv3.4, HKSHIIIC	uc001dzh.3	Q03721	OTTHUMG00000011037	ENST00000369787.3:c.*624G>A	chr1.hg19:g.110775555G>A		69.0	0.0		37.0	25.0	NM_001039574	Q3MIM4|Q5TBI6	Silent	SNP	ENST00000369787.3	hg19	CCDS821.1																																																																																			.	.		0.562	KCNC4-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000052146.2	NM_001039574	
PLEKHO1	51177	hgsc.bcm.edu	37	1	150131276	150131276	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr1:150131276C>T	ENST00000369124.4	+	6	1066	c.788C>T	c.(787-789)cCc>cTc	p.P263L	PLEKHO1_ENST00000025469.6_Missense_Mutation_p.P229L|PLEKHO1_ENST00000369126.1_Missense_Mutation_p.P80L	NM_016274.4	NP_057358.2	Q53GL0	PKHO1_HUMAN	pleckstrin homology domain containing, family O member 1	263	Interaction with ATM, CKIP, IFP35 and NMI.					cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(2)|endometrium(1)|kidney(1)|large_intestine(6)|lung(10)|skin(2)	22	Lung NSC(24;7.78e-28)|Breast(34;0.00211)|Ovarian(49;0.0265)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.171)			AAGTTGACGCCCACAGAGAAA	0.642																																					p.P263L		Atlas-SNP	.											.	PLEKHO1	37	.	0			c.C788T						.						32.0	38.0	36.0					1																	150131276		2203	4300	6503	SO:0001583	missense	51177	exon6			TGACGCCCACAGA	AF073836	CCDS945.1	1q21.2	2013-01-10			ENSG00000023902	ENSG00000023902		"""Pleckstrin homology (PH) domain containing"""	24310	protein-coding gene	gene with protein product		608335				10799509	Standard	NM_016274		Approved	CKIP-1, OC120	uc001ett.3	Q53GL0	OTTHUMG00000012510	ENST00000369124.4:c.788C>T	chr1.hg19:g.150131276C>T	ENSP00000358120:p.Pro263Leu	117.0	0.0		303.0	15.0	NM_016274	Q336K5|Q8IZ51|Q9NRV3|Q9UL48	Missense_Mutation	SNP	ENST00000369124.4	hg19	CCDS945.1	.	.	.	.	.	.	.	.	.	.	C	3.672	-0.067277	0.07273	.	.	ENSG00000023902	ENST00000369126;ENST00000025469;ENST00000369124;ENST00000441340	T;T	0.40476	1.03;1.04	4.97	4.04	0.47022	.	0.833567	0.11286	N	0.579801	T	0.13713	0.0332	L	0.36672	1.1	0.09310	N	0.999999	B	0.13594	0.008	B	0.14578	0.011	T	0.20140	-1.0284	10	0.24483	T	0.36	-8.0699	7.7059	0.28650	0.2855:0.5641:0.1504:0.0	.	263	Q53GL0	PKHO1_HUMAN	L	80;229;263;143	ENSP00000025469:P229L;ENSP00000358120:P263L	ENSP00000025469:P229L	P	+	2	0	PLEKHO1	148397900	0.011000	0.17503	0.074000	0.20217	0.636000	0.38137	1.493000	0.35605	1.275000	0.44379	0.655000	0.94253	CCC	.	.		0.642	PLEKHO1-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034962.1	NM_016274	
PLEKHO1	51177	hgsc.bcm.edu	37	1	150131673	150131673	+	Silent	SNP	C	C	G			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr1:150131673C>G	ENST00000369124.4	+	6	1463	c.1185C>G	c.(1183-1185)ctC>ctG	p.L395L	PLEKHO1_ENST00000025469.6_Silent_p.L361L|PLEKHO1_ENST00000369126.1_Silent_p.L212L	NM_016274.4	NP_057358.2	Q53GL0	PKHO1_HUMAN	pleckstrin homology domain containing, family O member 1	395	Negative regulator of AP-1 activity.					cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(2)|endometrium(1)|kidney(1)|large_intestine(6)|lung(10)|skin(2)	22	Lung NSC(24;7.78e-28)|Breast(34;0.00211)|Ovarian(49;0.0265)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.171)			ACTCCCACCTCAGACAGACCA	0.587																																					p.L395L		Atlas-SNP	.											PLEKHO1,bladder,carcinoma,0,1	PLEKHO1	37	.	0			c.C1185G						.						27.0	30.0	29.0					1																	150131673		2203	4300	6503	SO:0001819	synonymous_variant	51177	exon6			CCACCTCAGACAG	AF073836	CCDS945.1	1q21.2	2013-01-10			ENSG00000023902	ENSG00000023902		"""Pleckstrin homology (PH) domain containing"""	24310	protein-coding gene	gene with protein product		608335				10799509	Standard	NM_016274		Approved	CKIP-1, OC120	uc001ett.3	Q53GL0	OTTHUMG00000012510	ENST00000369124.4:c.1185C>G	chr1.hg19:g.150131673C>G		165.0	0.0		390.0	16.0	NM_016274	Q336K5|Q8IZ51|Q9NRV3|Q9UL48	Silent	SNP	ENST00000369124.4	hg19	CCDS945.1																																																																																			.	.		0.587	PLEKHO1-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034962.1	NM_016274	
DHX9	1660	hgsc.bcm.edu	37	1	182823304	182823304	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr1:182823304A>G	ENST00000367549.3	+	6	727	c.617A>G	c.(616-618)gAt>gGt	p.D206G		NM_001357.4	NP_001348.2	Q08211	DHX9_HUMAN	DEAH (Asp-Glu-Ala-His) box helicase 9	206	DRBM 2. {ECO:0000255|PROSITE- ProRule:PRU00266}.|Interaction with CREBBP.				ATP catabolic process (GO:0006200)|cellular response to heat (GO:0034605)|circadian rhythm (GO:0007623)|CRD-mediated mRNA stabilization (GO:0070934)|DNA duplex unwinding (GO:0032508)|gene expression (GO:0010467)|innate immune response (GO:0045087)|mRNA splicing, via spliceosome (GO:0000398)|osteoblast differentiation (GO:0001649)|positive regulation of type I interferon production (GO:0032481)|RNA splicing (GO:0008380)	centrosome (GO:0005813)|CRD-mediated mRNA stability complex (GO:0070937)|cytoplasm (GO:0005737)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|ATP-dependent RNA helicase activity (GO:0004004)|DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|RNA helicase activity (GO:0003724)|RNA polymerase II transcription factor binding (GO:0001085)			NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(10)|kidney(3)|large_intestine(7)|liver(1)|lung(19)|ovary(2)|prostate(1)|skin(1)|urinary_tract(2)	49						GTGGGTCCTGATCACAACAGG	0.363																																					p.D206G	Colon(69;210 1162 3697 13559 39565)	Atlas-SNP	.											.	DHX9	114	.	0			c.A617G						.						72.0	71.0	71.0					1																	182823304		1845	4085	5930	SO:0001583	missense	1660	exon6			GTCCTGATCACAA	L13848	CCDS41444.1	1q25	2013-05-13	2013-05-13	2003-06-20	ENSG00000135829	ENSG00000135829		"""DEAH-boxes"""	2750	protein-coding gene	gene with protein product	"""NDH II"", ""RNA helicase A"""	603115	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 9 (RNA helicase A, nuclear DNA helicase II; leukophysin)"", ""DEAH (Asp-Glu-Ala-His) box polypeptide 9"""	LKP, DDX9		8344961, 9111062	Standard	NM_001357		Approved	RHA	uc001gpr.3	Q08211	OTTHUMG00000035337	ENST00000367549.3:c.617A>G	chr1.hg19:g.182823304A>G	ENSP00000356520:p.Asp206Gly	223.0	0.0		166.0	100.0	NM_001357	B2RNV4|Q05CI5|Q12803|Q32Q22|Q5VY62|Q6PD69|Q99556	Missense_Mutation	SNP	ENST00000367549.3	hg19	CCDS41444.1	.	.	.	.	.	.	.	.	.	.	A	26.1	4.703563	0.88924	.	.	ENSG00000135829	ENST00000399175;ENST00000367549	T	0.77098	-1.07	5.39	5.39	0.77823	Double-stranded RNA-binding (3);Double-stranded RNA-binding-like (1);	0.000000	0.85682	D	0.000000	D	0.90215	0.6941	M	0.92219	3.285	0.80722	D	1	P	0.46952	0.887	D	0.64042	0.921	D	0.92387	0.5918	10	0.87932	D	0	.	15.0812	0.72117	1.0:0.0:0.0:0.0	.	206	Q08211	DHX9_HUMAN	G	206	ENSP00000356520:D206G	ENSP00000356520:D206G	D	+	2	0	DHX9	181089927	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.661000	0.91125	2.045000	0.60652	0.533000	0.62120	GAT	.	.		0.363	DHX9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085522.2	NM_030588	
TRIM54	57159	hgsc.bcm.edu	37	2	27528584	27528584	+	Missense_Mutation	SNP	G	G	C			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr2:27528584G>C	ENST00000380075.2	+	5	1082	c.742G>C	c.(742-744)Ggc>Cgc	p.G248R	TRIM54_ENST00000296098.4_Missense_Mutation_p.G290R	NM_187841.2	NP_912730.2	Q9BYV2	TRI54_HUMAN	tripartite motif containing 54	248					cell differentiation (GO:0030154)|microtubule-based process (GO:0007017)|multicellular organismal development (GO:0007275)|negative regulation of microtubule depolymerization (GO:0007026)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)	signal transducer activity (GO:0004871)|zinc ion binding (GO:0008270)			cervix(1)|endometrium(1)|large_intestine(3)|lung(2)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	13	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GCGCGTCCGCGGCCTCATCCG	0.632																																					p.G290R		Atlas-SNP	.											.	TRIM54	35	.	0			c.G868C						.						34.0	32.0	33.0					2																	27528584		2202	4300	6502	SO:0001583	missense	57159	exon6			GTCCGCGGCCTCA	AJ291714	CCDS1745.2, CCDS1746.2	2p23.3	2013-01-09	2011-01-25	2004-11-17	ENSG00000138100	ENSG00000138100		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	16008	protein-coding gene	gene with protein product		606474	"""ring finger protein 30"", ""tripartite motif-containing 54"""	RNF30		11243782	Standard	NM_032546		Approved	MURF, MURF-3	uc002rjn.3	Q9BYV2	OTTHUMG00000097078	ENST00000380075.2:c.742G>C	chr2.hg19:g.27528584G>C	ENSP00000369415:p.Gly248Arg	100.0	0.0		79.0	33.0	NM_032546	A5D8T7|Q53SY4|Q9BYV3	Missense_Mutation	SNP	ENST00000380075.2	hg19	CCDS1746.2	.	.	.	.	.	.	.	.	.	.	G	15.64	2.894559	0.52121	.	.	ENSG00000138100	ENST00000380075;ENST00000380073;ENST00000296098	T;T	0.40225	1.24;1.04	4.85	3.04	0.35103	.	0.386929	0.26867	N	0.022083	T	0.43478	0.1249	L	0.46157	1.445	0.18873	N	0.999989	P;P	0.41366	0.488;0.747	B;P	0.52823	0.357;0.71	T	0.20438	-1.0275	10	0.33141	T	0.24	-14.4805	4.6928	0.12788	0.1859:0.0:0.6429:0.1711	.	248;290	Q9BYV2;Q9BYV2-2	TRI54_HUMAN;.	R	248;69;290	ENSP00000369415:G248R;ENSP00000296098:G290R	ENSP00000296098:G290R	G	+	1	0	TRIM54	27382088	0.002000	0.14202	0.852000	0.33557	0.858000	0.48976	0.624000	0.24462	0.461000	0.27071	-0.291000	0.09656	GGC	.	.		0.632	TRIM54-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214199.2	NM_187841	
PLEKHH2	130271	hgsc.bcm.edu	37	2	43903342	43903342	+	Intron	SNP	G	G	A			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr2:43903342G>A	ENST00000282406.4	+	3	233					NM_172069.3	NP_742066.2	Q8IVE3	PKHH2_HUMAN	pleckstrin homology domain containing, family H (with MyTH4 domain) member 2						negative regulation of actin filament depolymerization (GO:0030835)	cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)	actin binding (GO:0003779)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(12)|lung(24)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	56		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)				GATGGTGCTCGTGGTCTTGAG	0.403																																					p.H40H		Atlas-SNP	.											.	.	.	.	0			c.C120T						.						74.0	72.0	73.0					2																	43903342		2032	4180	6212	SO:0001627	intron_variant	0	exon1			GTGCTCGTGGTCT	AB095948	CCDS1812.1	2p22	2013-01-10			ENSG00000152527	ENSG00000152527		"""Pleckstrin homology (PH) domain containing"""	30506	protein-coding gene	gene with protein product		612723					Standard	NM_172069		Approved	KIAA2028, PLEKHH1L	uc010yny.2	Q8IVE3	OTTHUMG00000128657	ENST00000282406.4:c.124-2660G>A	chr2.hg19:g.43903342G>A		448.0	0.0		377.0	173.0	NM_001101330	Q5JPJ6|Q6P4Q1|Q8N3Q3	Silent	SNP	ENST00000282406.4	hg19	CCDS1812.1																																																																																			.	.		0.403	PLEKHH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250537.1	NM_172069	
TCF7L1	83439	hgsc.bcm.edu	37	2	85361140	85361140	+	Splice_Site	SNP	C	C	A			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr2:85361140C>A	ENST00000282111.3	+	2	526	c.251C>A	c.(250-252)gCg>gAg	p.A84E		NM_031283.2	NP_112573.1	Q9HCS4	TF7L1_HUMAN	transcription factor 7-like 1 (T-cell specific, HMG-box)	84					anterior/posterior axis specification, embryo (GO:0008595)|axial mesoderm morphogenesis (GO:0048319)|brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|chromatin organization (GO:0006325)|generation of neurons (GO:0048699)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter during mitosis (GO:0046022)|regulation of stem cell maintenance (GO:2000036)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|regulation of Wnt signaling pathway (GO:0030111)|skin development (GO:0043588)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(3)|skin(4)|upper_aerodigestive_tract(1)	18						CCTCCGCAGGCGGAGAGGCGC	0.692																																					p.A84E		Atlas-SNP	.											.	TCF7L1	44	.	0			c.C251A						.						18.0	24.0	22.0					2																	85361140		2201	4299	6500	SO:0001630	splice_region_variant	83439	exon2			CGCAGGCGGAGAG	X62870	CCDS1971.1	2p11.2	2008-02-05			ENSG00000152284	ENSG00000152284			11640	protein-coding gene	gene with protein product		604652		TCF3		1741298, 11085512	Standard	NM_031283		Approved		uc002soy.3	Q9HCS4	OTTHUMG00000130026	ENST00000282111.3:c.250-1C>A	chr2.hg19:g.85361140C>A		80.0	0.0		41.0	24.0	NM_031283	Q53R97|Q6PD70|Q9NP00	Missense_Mutation	SNP	ENST00000282111.3	hg19	CCDS1971.1	.	.	.	.	.	.	.	.	.	.	C	18.66	3.671724	0.67928	.	.	ENSG00000152284	ENST00000282111	D	0.98777	-5.13	4.11	3.2	0.36748	CTNNB1 binding, N-teminal (1);	0.222293	0.37669	N	0.001996	D	0.97235	0.9096	M	0.68317	2.08	0.32570	N	0.529866	P	0.43169	0.8	P	0.45881	0.496	D	0.95871	0.8891	10	0.33141	T	0.24	.	4.9863	0.14190	0.2109:0.677:0.0:0.112	.	84	Q9HCS4	TF7L1_HUMAN	E	84	ENSP00000282111:A84E	ENSP00000282111:A84E	A	+	2	0	TCF7L1	85214651	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	4.685000	0.61693	0.665000	0.31066	0.462000	0.41574	GCG	.	.		0.692	TCF7L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252301.2	NM_031283	Missense_Mutation
RANBP2	5903	hgsc.bcm.edu	37	2	109381074	109381074	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr2:109381074G>A	ENST00000283195.6	+	20	4205	c.4079G>A	c.(4078-4080)aGc>aAc	p.S1360N		NM_006267.4	NP_006258.3	P49792	RBP2_HUMAN	RAN binding protein 2	1360					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|negative regulation of glucokinase activity (GO:0033132)|protein folding (GO:0006457)|protein import into nucleus (GO:0006606)|protein sumoylation (GO:0016925)|regulation of gluconeogenesis involved in cellular glucose homeostasis (GO:0090526)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nuclear inclusion body (GO:0042405)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nuclear pore nuclear basket (GO:0044615)	ligase activity (GO:0016874)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)|Ran GTPase binding (GO:0008536)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)		RANBP2/ALK(34)	NS(1)|biliary_tract(1)|breast(3)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(21)|large_intestine(19)|lung(51)|pancreas(1)|prostate(8)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(1)	129						CATTGTAACAGCTGCTCATTA	0.388																																					p.S1360N		Atlas-SNP	.											.	RANBP2	488	.	0			c.G4079A						.						88.0	89.0	89.0					2																	109381074		2203	4300	6503	SO:0001583	missense	5903	exon20			GTAACAGCTGCTC	D42063	CCDS2079.1	2q13	2013-11-14			ENSG00000153201	ENSG00000153201		"""Tetratricopeptide (TTC) repeat domain containing"""	9848	protein-coding gene	gene with protein product		601181	"""acute necrotizing encephalopathy 1 (autosomal dominant)"""	ANE1		7724562, 19118815	Standard	NM_006267		Approved	NUP358, ADANE	uc002tem.4	P49792	OTTHUMG00000130981	ENST00000283195.6:c.4079G>A	chr2.hg19:g.109381074G>A	ENSP00000283195:p.Ser1360Asn	157.0	0.0		112.0	53.0	NM_006267	Q13074|Q15280|Q53TE2|Q59FH7	Missense_Mutation	SNP	ENST00000283195.6	hg19	CCDS2079.1	.	.	.	.	.	.	.	.	.	.	G	5.864	0.343570	0.11126	.	.	ENSG00000153201	ENST00000283195	T	0.57595	0.39	5.48	5.48	0.80851	Zinc finger, RanBP2-type (4);	.	.	.	.	T	0.46737	0.1408	L	0.47716	1.5	0.20196	N	0.999923	B	0.32010	0.351	B	0.34038	0.174	T	0.37174	-0.9717	9	0.29301	T	0.29	-5.1313	11.2651	0.49106	0.0:0.1352:0.7251:0.1397	.	1360	P49792	RBP2_HUMAN	N	1360	ENSP00000283195:S1360N	ENSP00000283195:S1360N	S	+	2	0	RANBP2	108747506	0.890000	0.30428	0.998000	0.56505	0.992000	0.81027	1.266000	0.33039	2.554000	0.86153	0.655000	0.94253	AGC	.	.		0.388	RANBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253594.1	NM_006267	
KCNJ3	3760	hgsc.bcm.edu	37	2	155555841	155555841	+	Missense_Mutation	SNP	C	C	A			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr2:155555841C>A	ENST00000295101.2	+	1	1031	c.554C>A	c.(553-555)tCc>tAc	p.S185Y	KCNJ3_ENST00000544049.1_Missense_Mutation_p.S185Y|AC061961.2_ENST00000443901.1_RNA	NM_001260509.1|NM_002239.3	NP_001247438.1|NP_002230.1	P48549	KCNJ3_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 3	185					potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|response to electrical stimulus (GO:0051602)|synaptic transmission (GO:0007268)	external side of plasma membrane (GO:0009897)|plasma membrane (GO:0005886)|T-tubule (GO:0030315)|voltage-gated potassium channel complex (GO:0008076)	G-protein activated inward rectifier potassium channel activity (GO:0015467)			breast(2)|endometrium(2)|kidney(3)|large_intestine(9)|lung(30)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	54					Halothane(DB01159)	ATCAAGATGTCCCAGCCCAAG	0.587																																					p.S185Y		Atlas-SNP	.											.	KCNJ3	126	.	0			c.C554A						.						77.0	67.0	70.0					2																	155555841		2203	4300	6503	SO:0001583	missense	3760	exon1			AGATGTCCCAGCC	U50964	CCDS2200.1, CCDS58733.1	2q24.1	2011-07-05			ENSG00000162989	ENSG00000162989		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6264	protein-coding gene	gene with protein product		601534				8088798, 16382105	Standard	NM_002239		Approved	Kir3.1, GIRK1, KGA	uc002tyv.2	P48549	OTTHUMG00000131937	ENST00000295101.2:c.554C>A	chr2.hg19:g.155555841C>A	ENSP00000295101:p.Ser185Tyr	87.0	0.0		79.0	17.0	NM_001260509	B4DEW7|Q8TBI0	Missense_Mutation	SNP	ENST00000295101.2	hg19	CCDS2200.1	.	.	.	.	.	.	.	.	.	.	C	21.1	4.105048	0.77096	.	.	ENSG00000162989	ENST00000295101;ENST00000544049	D;D	0.94793	-3.52;-3.52	5.41	5.41	0.78517	Immunoglobulin E-set (1);Potassium channel, inwardly rectifying, Kir, conserved region 2 (1);Potassium channel, inwardly rectifying, Kir, cytoplasmic (1);	0.000000	0.85682	D	0.000000	D	0.98185	0.9400	H	0.95437	3.67	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.99391	1.0925	10	0.87932	D	0	.	17.7563	0.88450	0.0:1.0:0.0:0.0	.	185;185	B4DEW7;P48549	.;IRK3_HUMAN	Y	185	ENSP00000295101:S185Y;ENSP00000438410:S185Y	ENSP00000295101:S185Y	S	+	2	0	KCNJ3	155264087	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.035000	0.70940	2.537000	0.85549	0.561000	0.74099	TCC	.	.		0.587	KCNJ3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254890.2	NM_002239	
XIRP2	129446	hgsc.bcm.edu	37	2	168100239	168100239	+	Missense_Mutation	SNP	G	G	T			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr2:168100239G>T	ENST00000409195.1	+	9	2426	c.2337G>T	c.(2335-2337)ttG>ttT	p.L779F	XIRP2_ENST00000295237.9_Missense_Mutation_p.L779F|XIRP2_ENST00000409273.1_Missense_Mutation_p.L557F|XIRP2_ENST00000409756.2_Intron|XIRP2_ENST00000409043.1_Intron|XIRP2_ENST00000420519.1_Intron|XIRP2_ENST00000409605.1_Intron|XIRP2_ENST00000409728.1_Intron	NM_152381.5	NP_689594.4	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2	604					actin cytoskeleton organization (GO:0030036)|cardiac muscle tissue morphogenesis (GO:0055008)|cell-cell junction organization (GO:0045216)|ventricular septum development (GO:0003281)	cell junction (GO:0030054)|Z disc (GO:0030018)				NS(3)|biliary_tract(2)|breast(5)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(51)|lung(160)|ovary(7)|pancreas(3)|prostate(11)|skin(14)|stomach(5)|upper_aerodigestive_tract(8)|urinary_tract(7)	315						CACAGCCGTTGGACACAATTA	0.408																																					p.L779F		Atlas-SNP	.											.	XIRP2	914	.	0			c.G2337T						.						70.0	66.0	67.0					2																	168100239		1860	4098	5958	SO:0001583	missense	129446	exon9			GCCGTTGGACACA	AK056582	CCDS42768.1, CCDS42769.1, CCDS56143.1, CCDS56144.1, CCDS56145.1	2q31.1	2013-10-25	2007-06-27	2007-06-27	ENSG00000163092	ENSG00000163092			14303	protein-coding gene	gene with protein product	"""myomaxin"""	609778	"""cardiomyopathy associated 3"""	CMYA3		17046827, 12203715, 15454575	Standard	NM_001079810		Approved		uc002udx.3	A4UGR9	OTTHUMG00000154027	ENST00000409195.1:c.2337G>T	chr2.hg19:g.168100239G>T	ENSP00000386840:p.Leu779Phe	305.0	0.0		230.0	114.0	NM_152381	A0PJ94|B2BBS0|B2BBS1|B2BBS4|B3KVH0|J3KNB1|Q53R52|Q5MJ67|Q702N7|Q86T36|Q86T38|Q86T46|Q86T51|Q86T53|Q86T55|Q86T79|Q86TB6|Q8N1M9|Q8N3R5|Q8TBV6	Missense_Mutation	SNP	ENST00000409195.1	hg19	CCDS42769.1	.	.	.	.	.	.	.	.	.	.	G	11.71	1.718542	0.30503	.	.	ENSG00000163092	ENST00000409195;ENST00000295237;ENST00000409273	T;T;T	0.57907	0.37;0.37;0.37	5.92	-0.957	0.10350	.	0.000000	0.64402	D	0.000001	T	0.63510	0.2517	M	0.77486	2.375	0.49389	D	0.999786	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;1.0;1.0	T	0.59847	-0.7377	10	0.87932	D	0	-4.3371	2.694	0.05129	0.413:0.1095:0.366:0.1114	.	604;604;557	A4UGR9;A4UGR9-3;A4UGR9-2	XIRP2_HUMAN;.;.	F	779;779;557	ENSP00000386840:L779F;ENSP00000295237:L779F;ENSP00000387255:L557F	ENSP00000295237:L779F	L	+	3	2	XIRP2	167808485	0.566000	0.26618	0.346000	0.25655	0.605000	0.37080	-0.080000	0.11339	-0.499000	0.06623	-0.355000	0.07637	TTG	.	.		0.408	XIRP2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000333547.1	NM_152381	
OSBPL6	114880	hgsc.bcm.edu	37	2	179170928	179170928	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr2:179170928A>G	ENST00000190611.4	+	3	393	c.17A>G	c.(16-18)aAg>aGg	p.K6R	OSBPL6_ENST00000357080.4_Missense_Mutation_p.K6R|OSBPL6_ENST00000409045.3_Missense_Mutation_p.K6R|OSBPL6_ENST00000409631.1_Missense_Mutation_p.K6R|OSBPL6_ENST00000392505.2_Missense_Mutation_p.K6R|OSBPL6_ENST00000359685.3_Missense_Mutation_p.K6R	NM_032523.3	NP_115912.1	Q9BZF3	OSBL6_HUMAN	oxysterol binding protein-like 6	6					lipid transport (GO:0006869)	cytosol (GO:0005829)|nuclear membrane (GO:0031965)|perinuclear endoplasmic reticulum (GO:0097038)|plasma membrane (GO:0005886)	lipid binding (GO:0008289)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(13)|lung(18)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	46			OV - Ovarian serous cystadenocarcinoma(117;0.00578)|Epithelial(96;0.00847)|all cancers(119;0.0335)			TCAGATGAGAAGGGCATTTCC	0.438																																					p.K6R		Atlas-SNP	.											.	OSBPL6	178	.	0			c.A17G						.						155.0	132.0	140.0					2																	179170928		2203	4300	6503	SO:0001583	missense	114880	exon3			ATGAGAAGGGCAT	AF392448	CCDS2277.1, CCDS2278.1, CCDS56150.1, CCDS56151.1, CCDS56152.1	2q32.1	2008-05-27			ENSG00000079156	ENSG00000079156		"""Oxysterol binding proteins"""	16388	protein-coding gene	gene with protein product	"""OSBP-related protein 6"""	606734				11483621	Standard	NM_001201480		Approved	ORP6	uc002uly.3	Q9BZF3	OTTHUMG00000132579	ENST00000190611.4:c.17A>G	chr2.hg19:g.179170928A>G	ENSP00000190611:p.Lys6Arg	110.0	0.0		83.0	46.0	NM_001201482	B4DTW1|C4AMC0|C4AME4|D3DPF6|D3DPF7|Q4ZG68|Q53T68|Q59H61|Q7Z4Q1|Q86V84|Q8N9T0|Q96SR1	Missense_Mutation	SNP	ENST00000190611.4	hg19	CCDS2277.1	.	.	.	.	.	.	.	.	.	.	A	17.32	3.359892	0.61403	.	.	ENSG00000079156	ENST00000392505;ENST00000359685;ENST00000357080;ENST00000409045;ENST00000190611;ENST00000409631	T;T;T;T;T;T	0.53640	0.61;0.61;0.61;0.61;0.61;0.61	5.87	4.72	0.59763	.	0.176314	0.34986	U	0.003537	T	0.27933	0.0688	N	0.05510	-0.035	0.39990	D	0.975022	B;B;B;B;B	0.17667	0.008;0.004;0.021;0.005;0.023	B;B;B;B;B	0.15484	0.009;0.004;0.013;0.004;0.006	T	0.07102	-1.0790	10	0.45353	T	0.12	-15.2766	11.0392	0.47820	0.9264:0.0:0.0736:0.0	.	6;6;6;6;6	Q9BZF3-4;Q9BZF3-2;Q9BZF3-5;Q9BZF3;Q86V84	.;.;.;OSBL6_HUMAN;.	R	6	ENSP00000376293:K6R;ENSP00000352713:K6R;ENSP00000349591:K6R;ENSP00000387248:K6R;ENSP00000190611:K6R;ENSP00000386885:K6R	ENSP00000190611:K6R	K	+	2	0	OSBPL6	178879174	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	4.699000	0.61796	1.160000	0.42584	0.533000	0.62120	AAG	.	.		0.438	OSBPL6-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000334393.2	NM_032523	
HIBCH	26275	hgsc.bcm.edu	37	2	191155206	191155206	+	Missense_Mutation	SNP	A	A	C			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr2:191155206A>C	ENST00000359678.5	-	5	604	c.310T>G	c.(310-312)Tcg>Gcg	p.S104A	HIBCH_ENST00000392332.3_Missense_Mutation_p.S104A	NM_014362.3|NM_198047.2	NP_055177.2|NP_932164.1	Q6NVY1	HIBCH_HUMAN	3-hydroxyisobutyryl-CoA hydrolase	104					branched-chain amino acid catabolic process (GO:0009083)|cellular nitrogen compound metabolic process (GO:0034641)|small molecule metabolic process (GO:0044281)|valine catabolic process (GO:0006574)	extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)	3-hydroxyisobutyryl-CoA hydrolase activity (GO:0003860)			NS(1)|breast(2)|endometrium(1)|large_intestine(1)|lung(5)|skin(1)|soft_tissue(1)|upper_aerodigestive_tract(1)	13			OV - Ovarian serous cystadenocarcinoma(117;0.000586)|Epithelial(96;0.0286)|all cancers(119;0.0814)			TCAGCTTCCGAGATCACTAGG	0.323																																					p.S104A		Atlas-SNP	.											.	HIBCH	28	.	0			c.T310G						.						72.0	68.0	70.0					2																	191155206		2203	4300	6503	SO:0001583	missense	26275	exon5			CTTCCGAGATCAC	U66669	CCDS2304.1, CCDS46475.1	2q32.3	2010-04-29	2010-04-29		ENSG00000198130	ENSG00000198130	3.1.2.4		4908	protein-coding gene	gene with protein product		610690	"""3-hydroxyisobutyryl-Coenzyme A hydrolase"""			8824301	Standard	NM_014362		Approved		uc002uru.3	Q6NVY1	OTTHUMG00000132673	ENST00000359678.5:c.310T>G	chr2.hg19:g.191155206A>C	ENSP00000352706:p.Ser104Ala	136.0	0.0		135.0	58.0	NM_014362	D3DPI4|Q53GA8|Q53GF2|Q53RF7|Q53TC6|Q92931|Q9BS94	Missense_Mutation	SNP	ENST00000359678.5	hg19	CCDS2304.1	.	.	.	.	.	.	.	.	.	.	A	0.017	-1.494319	0.01009	.	.	ENSG00000198130	ENST00000392332;ENST00000359678;ENST00000409934	T;T;T	0.70282	-0.14;-0.47;-0.14	5.42	-0.0735	0.13735	Crotonase, core (1);	.	.	.	.	T	0.33381	0.0861	N	0.01289	-0.905	0.80722	D	1	B;B	0.02656	0.0;0.0	B;B	0.09377	0.004;0.002	T	0.38564	-0.9655	9	0.05620	T	0.96	0.7649	9.0984	0.36653	0.3045:0.5681:0.0:0.1274	.	104;104	Q6NVY1-2;Q6NVY1	.;HIBCH_HUMAN	A	104;104;158	ENSP00000376144:S104A;ENSP00000352706:S104A;ENSP00000387247:S158A	ENSP00000352706:S104A	S	-	1	0	HIBCH	190863451	0.985000	0.35326	0.903000	0.35520	0.007000	0.05969	0.560000	0.23500	0.111000	0.17947	-0.461000	0.05368	TCG	.	.		0.323	HIBCH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255933.1		
DNAH7	56171	hgsc.bcm.edu	37	2	196825086	196825086	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr2:196825086A>G	ENST00000312428.6	-	18	2889	c.2789T>C	c.(2788-2790)tTg>tCg	p.L930S		NM_018897.2	NP_061720.2	Q8WXX0	DYH7_HUMAN	dynein, axonemal, heavy chain 7	930	Stem. {ECO:0000250}.				cilium movement (GO:0003341)|cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)	axonemal dynein complex (GO:0005858)|cilium (GO:0005929)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|microtubule motor activity (GO:0003777)			NS(4)|breast(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(28)|liver(3)|lung(100)|ovary(4)|prostate(5)|skin(26)|upper_aerodigestive_tract(2)|urinary_tract(3)	205						AACTGATGCCAAAATAAATGT	0.348																																					p.L930S		Atlas-SNP	.											.	DNAH7	512	.	0			c.T2789C						.						117.0	116.0	116.0					2																	196825086		1856	4101	5957	SO:0001583	missense	56171	exon18			GATGCCAAAATAA	AF327442	CCDS42794.1	2q33.1	2013-01-10	2006-09-04		ENSG00000118997	ENSG00000118997		"""Axonemal dyneins"", ""EF-hand domain containing"""	18661	protein-coding gene	gene with protein product		610061	"""dynein, axonemal, heavy polypeptide 7"""			9373155, 11877439	Standard	NM_018897		Approved	KIAA0944	uc002utj.4	Q8WXX0	OTTHUMG00000154438	ENST00000312428.6:c.2789T>C	chr2.hg19:g.196825086A>G	ENSP00000311273:p.Leu930Ser	108.0	0.0		98.0	44.0	NM_018897	B8ZZX8|O00433|O95492|Q4G152|Q53QX7|Q53S64|Q53T02|Q68CY5|Q8N1Z2|Q9UMS3|Q9Y2F3	Missense_Mutation	SNP	ENST00000312428.6	hg19	CCDS42794.1	.	.	.	.	.	.	.	.	.	.	A	20.6	4.018893	0.75275	.	.	ENSG00000118997	ENST00000312428	T	0.69561	-0.41	5.64	5.64	0.86602	Dynein heavy chain, domain-2 (1);	0.000000	0.35151	U	0.003404	D	0.89441	0.6716	H	0.99090	4.425	0.80722	D	1	D	0.56287	0.975	D	0.68483	0.958	D	0.93764	0.7069	10	0.87932	D	0	.	15.8646	0.79055	1.0:0.0:0.0:0.0	.	930	Q8WXX0	DYH7_HUMAN	S	930	ENSP00000311273:L930S	ENSP00000311273:L930S	L	-	2	0	DNAH7	196533331	1.000000	0.71417	0.805000	0.32314	0.845000	0.48019	7.403000	0.79983	2.149000	0.67028	0.477000	0.44152	TTG	.	.		0.348	DNAH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335202.3	NM_018897	
SGOL2	151246	hgsc.bcm.edu	37	2	201400832	201400832	+	Missense_Mutation	SNP	G	G	C			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr2:201400832G>C	ENST00000357799.4	+	4	452	c.354G>C	c.(352-354)ttG>ttC	p.L118F	SGOL2_ENST00000409203.3_Missense_Mutation_p.L118F|SGOL2_ENST00000469840.1_3'UTR	NM_001160033.1|NM_001160046.1|NM_152524.5	NP_001153505.1|NP_001153518.1|NP_689737.4	Q562F6	SGOL2_HUMAN	shugoshin-like 2 (S. pombe)	118					meiotic sister chromatid cohesion, centromeric (GO:0051754)|mitotic cell cycle (GO:0000278)	chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|kinetochore (GO:0000776)|mitotic cohesin complex (GO:0030892)|nucleus (GO:0005634)				NS(2)|breast(2)|cervix(3)|endometrium(1)|kidney(2)|large_intestine(7)|lung(20)|ovary(2)|prostate(2)|skin(2)|stomach(1)|urinary_tract(2)	46						ACAATAACTTGATAACTGCAA	0.294																																					p.L118F		Atlas-SNP	.											SGOL2,bladder,carcinoma,0,1	SGOL2	126	.	0			c.G354C						.						131.0	131.0	131.0					2																	201400832		1813	4058	5871	SO:0001583	missense	151246	exon4			TAACTTGATAACT	AY094614	CCDS42796.1	2q33.2	2008-02-05			ENSG00000163535	ENSG00000163535			30812	protein-coding gene	gene with protein product		612425					Standard	NM_001160046		Approved	TRIPIN, FLJ25211	uc002uvw.2	Q562F6	OTTHUMG00000154535	ENST00000357799.4:c.354G>C	chr2.hg19:g.201400832G>C	ENSP00000350447:p.Leu118Phe	101.0	0.0		97.0	40.0	NM_001160046	Q53RR9|Q53T20|Q86XY4|Q8IWK2|Q8IZK1|Q8N1Q5|Q96LQ3	Missense_Mutation	SNP	ENST00000357799.4	hg19	CCDS42796.1	.	.	.	.	.	.	.	.	.	.	G	16.77	3.216060	0.58452	.	.	ENSG00000163535	ENST00000357799;ENST00000409203	T;T	0.65178	-0.14;-0.14	5.34	3.48	0.39840	.	0.000000	0.43110	D	0.000604	T	0.70037	0.3178	M	0.66939	2.045	0.31308	N	0.687501	D;D;D;D	0.76494	0.999;0.999;0.999;0.999	D;D;D;D	0.73380	0.98;0.98;0.98;0.974	T	0.70547	-0.4842	10	0.72032	D	0.01	-1.3662	2.0135	0.03493	0.172:0.1518:0.52:0.1561	.	118;118;118;118	B7Z7S9;Q562F6-2;Q562F6;Q562F6-3	.;.;SGOL2_HUMAN;.	F	118	ENSP00000350447:L118F;ENSP00000386249:L118F	ENSP00000350447:L118F	L	+	3	2	SGOL2	201109077	1.000000	0.71417	0.999000	0.59377	0.960000	0.62799	0.877000	0.28106	0.766000	0.33244	0.655000	0.94253	TTG	.	.		0.294	SGOL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335834.1	NM_152524	
ABI2	10152	hgsc.bcm.edu	37	2	204193320	204193320	+	Missense_Mutation	SNP	G	G	T			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr2:204193320G>T	ENST00000422511.2	+	1	114	c.83G>T	c.(82-84)cGg>cTg	p.R28L	ABI2_ENST00000261017.5_Missense_Mutation_p.R28L|ABI2_ENST00000295851.5_Missense_Mutation_p.R28L|RP11-363J17.1_ENST00000469747.2_RNA|ABI2_ENST00000430418.1_Missense_Mutation_p.R28L|ABI2_ENST00000261016.6_5'UTR|ABI2_ENST00000424558.1_Missense_Mutation_p.R28L			Q9NYB9	ABI2_HUMAN	abl-interactor 2	28					actin polymerization or depolymerization (GO:0008154)|cell migration (GO:0016477)|cellular component movement (GO:0006928)|cytoskeleton organization (GO:0007010)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of Arp2/3 complex-mediated actin nucleation (GO:2000601)|Rac protein signal transduction (GO:0016601)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|filopodium (GO:0030175)|lamellipodium (GO:0030027)|SCAR complex (GO:0031209)	cytoskeletal adaptor activity (GO:0008093)|DNA binding (GO:0003677)|kinase binding (GO:0019900)|proline-rich region binding (GO:0070064)|protein complex binding (GO:0032403)|SH3 domain binding (GO:0017124)|ubiquitin protein ligase binding (GO:0031625)			breast(1)|kidney(3)|large_intestine(1)|liver(2)|lung(4)|prostate(2)|skin(1)|urinary_tract(1)	15						AATCTGGAACGGGTGGCCGAT	0.672																																					p.R28L		Atlas-SNP	.											.	ABI2	44	.	0			c.G83T						.						39.0	46.0	44.0					2																	204193320		2203	4300	6503	SO:0001583	missense	10152	exon1			TGGAACGGGTGGC	AF260261	CCDS2358.1, CCDS63093.1, CCDS63094.1, CCDS74634.1	2q33	2010-09-20	2009-07-23		ENSG00000138443	ENSG00000138443			24011	protein-coding gene	gene with protein product		606442				7590236, 10964520	Standard	XM_005246217		Approved	ABI-2, AIP-1, ABI2B, AblBP3, argBPIA, SSH3BP2	uc002uzz.3	Q9NYB9	OTTHUMG00000132879	ENST00000422511.2:c.83G>T	chr2.hg19:g.204193320G>T	ENSP00000396249:p.Arg28Leu	104.0	0.0		80.0	34.0	NM_005759	B4DSN1|Q13147|Q13249|Q13801|Q9BV70	Missense_Mutation	SNP	ENST00000422511.2	hg19		.	.	.	.	.	.	.	.	.	.	G	32	5.121756	0.94385	.	.	ENSG00000138443	ENST00000295851;ENST00000261017;ENST00000430418;ENST00000424558;ENST00000417864;ENST00000422511	D;D;D;D;D;D	0.81579	-1.51;-1.51;-1.51;-1.51;-1.51;-1.51	3.77	3.77	0.43336	.	0.132117	0.47093	D	0.000245	T	0.81049	0.4742	M	0.76838	2.35	0.80722	D	1	B;B;B	0.17268	0.021;0.002;0.0	B;B;B	0.14578	0.011;0.001;0.005	T	0.81992	-0.0678	10	0.87932	D	0	-0.6104	15.7751	0.78207	0.0:0.0:1.0:0.0	.	28;28;28	Q9NYB9-4;Q9NYB9;Q9NYB9-2	.;ABI2_HUMAN;.	L	28	ENSP00000295851:R28L;ENSP00000261017:R28L;ENSP00000408898:R28L;ENSP00000391433:R28L;ENSP00000414703:R28L;ENSP00000396249:R28L	ENSP00000261017:R28L	R	+	2	0	ABI2	203901565	1.000000	0.71417	0.997000	0.53966	0.965000	0.64279	8.342000	0.90049	1.923000	0.55706	0.305000	0.20034	CGG	.	.		0.672	ABI2-007	NOVEL	not_organism_supported|basic|appris_candidate|exp_conf	protein_coding	protein_coding	OTTHUMT00000336179.2	NM_005759	
DYTN	391475	hgsc.bcm.edu	37	2	207530732	207530732	+	Missense_Mutation	SNP	G	G	T			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr2:207530732G>T	ENST00000452335.2	-	10	1118	c.1002C>A	c.(1000-1002)aaC>aaA	p.N334K		NM_001093730.1	NP_001087199.1	A2CJ06	DYTN_HUMAN	dystrotelin	334						plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(6)|lung(24)|ovary(1)|upper_aerodigestive_tract(1)	36				LUSC - Lung squamous cell carcinoma(261;0.082)|Epithelial(149;0.129)|Lung(261;0.153)		CTTTGTATTGGTTTAACTGTT	0.403																																					p.N334K		Atlas-SNP	.											.	DYTN	168	.	0			c.C1002A						.						174.0	154.0	161.0					2																	207530732		1826	4080	5906	SO:0001583	missense	391475	exon10			GTATTGGTTTAAC	ABF55377	CCDS46502.1	2q33.3	2007-01-22			ENSG00000232125	ENSG00000232125			23279	protein-coding gene	gene with protein product						17233888	Standard	NM_001093730		Approved		uc002vbr.1	A2CJ06	OTTHUMG00000154729	ENST00000452335.2:c.1002C>A	chr2.hg19:g.207530732G>T	ENSP00000396593:p.Asn334Lys	364.0	1.0		283.0	131.0	NM_001093730		Missense_Mutation	SNP	ENST00000452335.2	hg19	CCDS46502.1	.	.	.	.	.	.	.	.	.	.	G	8.469	0.857115	0.17106	.	.	ENSG00000232125	ENST00000452335	T	0.15718	2.4	4.89	0.962	0.19643	.	.	.	.	.	T	0.07548	0.0190	N	0.24115	0.695	0.09310	N	1	P	0.39282	0.666	B	0.33339	0.162	T	0.24119	-1.0169	9	0.22109	T	0.4	-1.6294	1.7438	0.02958	0.1824:0.162:0.4882:0.1675	.	334	A2CJ06	DYTN_HUMAN	K	334	ENSP00000396593:N334K	ENSP00000396593:N334K	N	-	3	2	DYTN	207238977	0.026000	0.19158	0.013000	0.15412	0.517000	0.34286	-0.050000	0.11904	0.061000	0.16311	0.561000	0.74099	AAC	.	.		0.403	DYTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336799.1		
NBEAL2	23218	hgsc.bcm.edu	37	3	47030821	47030821	+	Silent	SNP	C	C	G			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr3:47030821C>G	ENST00000450053.3	+	5	602	c.423C>G	c.(421-423)ctC>ctG	p.L141L	NBEAL2_ENST00000292309.5_Silent_p.L141L|NBEAL2_ENST00000383740.2_5'UTR	NM_015175.2	NP_055990.1	Q6ZNJ1	NBEL2_HUMAN	neurobeachin-like 2	141					blood coagulation (GO:0007596)|megakaryocyte development (GO:0035855)|platelet alpha granule organization (GO:0070889)|platelet formation (GO:0030220)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)				NS(1)|breast(1)|central_nervous_system(3)|cervix(2)|endometrium(8)|kidney(5)|large_intestine(9)|lung(9)|ovary(4)|pancreas(1)|prostate(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	51		Acute lymphoblastic leukemia(5;0.0534)		BRCA - Breast invasive adenocarcinoma(193;0.0012)|KIRC - Kidney renal clear cell carcinoma(197;0.00575)|Kidney(197;0.00656)		CTCTGCTTCTCTGCGAGGGCC	0.632																																					p.L141L		Atlas-SNP	.											.	NBEAL2	267	.	0			c.C423G						.						32.0	38.0	36.0					3																	47030821		2066	4181	6247	SO:0001819	synonymous_variant	23218	exon5			GCTTCTCTGCGAG	AB011112	CCDS46817.1	3p21.31	2014-09-17			ENSG00000160796	ENSG00000160796		"""WD repeat domain containing"""	31928	protein-coding gene	gene with protein product		614169					Standard	NM_015175		Approved	KIAA0540	uc003cqp.3	Q6ZNJ1	OTTHUMG00000156497	ENST00000450053.3:c.423C>G	chr3.hg19:g.47030821C>G		91.0	0.0		74.0	29.0	NM_015175	O60288|Q6P994|Q6UX91|Q8NAC9	Silent	SNP	ENST00000450053.3	hg19	CCDS46817.1																																																																																			.	.		0.632	NBEAL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344363.3	XM_291064	
ROBO2	6092	hgsc.bcm.edu	37	3	77629195	77629195	+	Missense_Mutation	SNP	A	A	C			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr3:77629195A>C	ENST00000461745.1	+	16	3326	c.2426A>C	c.(2425-2427)cAa>cCa	p.Q809P	ROBO2_ENST00000332191.8_Missense_Mutation_p.Q809P|ROBO2_ENST00000487694.3_Missense_Mutation_p.Q825P	NM_002942.4	NP_002933.1	Q9HCK4	ROBO2_HUMAN	roundabout, axon guidance receptor, homolog 2 (Drosophila)	809	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				apoptotic process involved in luteolysis (GO:0061364)|axon guidance (GO:0007411)|axon midline choice point recognition (GO:0016199)|brain development (GO:0007420)|cellular response to hormone stimulus (GO:0032870)|central nervous system development (GO:0007417)|homophilic cell adhesion (GO:0007156)|metanephros development (GO:0001656)|negative regulation of negative chemotaxis (GO:0050925)|negative regulation of synapse assembly (GO:0051964)|olfactory bulb interneuron development (GO:0021891)|positive regulation of axonogenesis (GO:0050772)|retinal ganglion cell axon guidance (GO:0031290)|ureteric bud development (GO:0001657)	axolemma (GO:0030673)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	axon guidance receptor activity (GO:0008046)|identical protein binding (GO:0042802)			NS(1)|biliary_tract(5)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(23)|liver(1)|lung(52)|ovary(2)|pancreas(2)|prostate(5)|skin(8)|upper_aerodigestive_tract(1)	117				Epithelial(33;0.00199)|LUSC - Lung squamous cell carcinoma(21;0.008)|BRCA - Breast invasive adenocarcinoma(55;0.00884)|Lung(72;0.0183)|KIRC - Kidney renal clear cell carcinoma(39;0.0832)|Kidney(39;0.103)		CCAGGTATTCAATACCGGGTA	0.448																																					p.Q809P		Atlas-SNP	.											.	ROBO2	527	.	0			c.A2426C						.						124.0	122.0	122.0					3																	77629195		1888	4118	6006	SO:0001583	missense	6092	exon16			GTATTCAATACCG	AF040991	CCDS43109.1, CCDS54609.1	3p12.3	2013-02-11	2001-11-28		ENSG00000185008	ENSG00000185008		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	10250	protein-coding gene	gene with protein product		602431	"""roundabout (axon guidance receptor, Drosophila) homolog 2"""			9458045	Standard	NM_002942		Approved	KIAA1568	uc003dpy.4	Q9HCK4	OTTHUMG00000158935	ENST00000461745.1:c.2426A>C	chr3.hg19:g.77629195A>C	ENSP00000417164:p.Gln809Pro	206.0	0.0		98.0	86.0	NM_002942	O43608|Q19AB4|Q19AB5	Missense_Mutation	SNP	ENST00000461745.1	hg19	CCDS43109.1	.	.	.	.	.	.	.	.	.	.	A	11.95	1.790591	0.31685	.	.	ENSG00000185008	ENST00000487694;ENST00000403211;ENST00000343019;ENST00000461745;ENST00000332191;ENST00000398467	T;T;T	0.57436	0.4;0.4;0.4	5.53	5.53	0.82687	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.38492	U	0.001662	T	0.43500	0.1250	L	0.35414	1.06	0.42344	D	0.992343	B;B;B	0.11235	0.002;0.004;0.002	B;B;B	0.16289	0.007;0.015;0.007	T	0.48115	-0.9063	9	0.30078	T	0.28	.	15.3169	0.74089	1.0:0.0:0.0:0.0	.	825;809;809	Q19AB5;F8W703;Q9HCK4	.;.;ROBO2_HUMAN	P	825;825;829;809;809;530	ENSP00000417335:Q825P;ENSP00000417164:Q809P;ENSP00000327536:Q809P	ENSP00000327536:Q809P	Q	+	2	0	ROBO2	77711885	1.000000	0.71417	0.996000	0.52242	0.989000	0.77384	3.750000	0.55157	2.095000	0.63458	0.460000	0.39030	CAA	.	.		0.448	ROBO2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000352600.2	XM_031246	
KIAA1407	57577	hgsc.bcm.edu	37	3	113737618	113737618	+	Missense_Mutation	SNP	A	A	T			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr3:113737618A>T	ENST00000295878.3	-	8	1216	c.1070T>A	c.(1069-1071)cTg>cAg	p.L357Q	KIAA1407_ENST00000545063.1_Missense_Mutation_p.L188Q	NM_020817.1	NP_065868.1	Q8NCU4	K1407_HUMAN	KIAA1407	357										endometrium(9)|large_intestine(7)|lung(19)|ovary(2)|pancreas(1)|prostate(1)|urinary_tract(1)	40						CAGGACCTTCAGCTGAATCTT	0.488																																					p.L357Q		Atlas-SNP	.											.	KIAA1407	80	.	0			c.T1070A						.						209.0	218.0	215.0					3																	113737618		2203	4300	6503	SO:0001583	missense	57577	exon8			ACCTTCAGCTGAA	AF509494	CCDS2977.1	3q13.31	2005-01-10			ENSG00000163617	ENSG00000163617			29272	protein-coding gene	gene with protein product						10718198	Standard	NM_020817		Approved		uc003eax.3	Q8NCU4	OTTHUMG00000159337	ENST00000295878.3:c.1070T>A	chr3.hg19:g.113737618A>T	ENSP00000295878:p.Leu357Gln	86.0	0.0		74.0	16.0	NM_020817	B4DYL1|Q9P2E0	Missense_Mutation	SNP	ENST00000295878.3	hg19	CCDS2977.1	.	.	.	.	.	.	.	.	.	.	A	18.28	3.588477	0.66105	.	.	ENSG00000163617	ENST00000295878;ENST00000545063;ENST00000491000	T;T;T	0.68181	0.82;-0.31;0.26	5.76	5.76	0.90799	.	0.160773	0.42964	D	0.000623	T	0.73393	0.3581	L	0.58810	1.83	0.80722	D	1	P;D;D	0.60575	0.952;0.988;0.988	P;P;P	0.56398	0.678;0.797;0.797	T	0.74572	-0.3621	10	0.48119	T	0.1	.	12.3312	0.55041	0.8737:0.0:0.0:0.1263	.	344;233;357	C9JA89;B4DIZ9;Q8NCU4	.;.;K1407_HUMAN	Q	357;188;344	ENSP00000295878:L357Q;ENSP00000446381:L188Q;ENSP00000418099:L344Q	ENSP00000295878:L357Q	L	-	2	0	KIAA1407	115220308	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	3.828000	0.55753	2.201000	0.70794	0.533000	0.62120	CTG	.	.		0.488	KIAA1407-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354724.2	NM_020817	
HGD	3081	hgsc.bcm.edu	37	3	120365198	120365198	+	Missense_Mutation	SNP	T	T	A			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr3:120365198T>A	ENST00000283871.5	-	9	1024	c.565A>T	c.(565-567)Agc>Tgc	p.S189C		NM_000187.3	NP_000178.2	Q93099	HGD_HUMAN	homogentisate 1,2-dioxygenase	189			S -> I (in AKU). {ECO:0000269|PubMed:9529363}.		cellular nitrogen compound metabolic process (GO:0034641)|L-phenylalanine catabolic process (GO:0006559)|small molecule metabolic process (GO:0044281)|tyrosine catabolic process (GO:0006572)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	homogentisate 1,2-dioxygenase activity (GO:0004411)|metal ion binding (GO:0046872)			cervix(1)|endometrium(4)|kidney(2)|large_intestine(3)|lung(11)|ovary(1)|prostate(1)|skin(2)	25				GBM - Glioblastoma multiforme(114;0.158)		ACATCTATGCTGAACCGCATT	0.478																																					p.S189C		Atlas-SNP	.											.	HGD	65	.	0			c.A565T						.						109.0	101.0	104.0					3																	120365198		2203	4300	6503	SO:0001583	missense	3081	exon9			CTATGCTGAACCG		CCDS3000.1	3q	2010-04-27	2010-04-27		ENSG00000113924	ENSG00000113924	1.13.11.5		4892	protein-coding gene	gene with protein product	"""homogentisate oxidase"""	607474	"""homogentisate 1,2-dioxygenase (homogentisate oxidase)"""	AKU		8188241	Standard	NM_000187		Approved	HGO	uc003edw.3	Q93099	OTTHUMG00000159441	ENST00000283871.5:c.565A>T	chr3.hg19:g.120365198T>A	ENSP00000283871:p.Ser189Cys	45.0	0.0		41.0	20.0	NM_000187	A8K417|B2R8Z0	Missense_Mutation	SNP	ENST00000283871.5	hg19	CCDS3000.1	.	.	.	.	.	.	.	.	.	.	T	17.82	3.483529	0.63962	.	.	ENSG00000113924	ENST00000283871	D	0.99042	-5.36	5.91	5.91	0.95273	Cupin, RmlC-type (1);	0.078065	0.85682	D	0.000000	D	0.98359	0.9455	L	0.61036	1.89	0.80722	D	1	P	0.38800	0.648	P	0.45138	0.471	D	0.99019	1.0817	10	0.66056	D	0.02	-20.7815	14.2973	0.66321	0.0:0.0:0.0:1.0	.	189	Q93099	HGD_HUMAN	C	189	ENSP00000283871:S189C	ENSP00000283871:S189C	S	-	1	0	HGD	121847888	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.173000	0.77612	2.261000	0.74972	0.533000	0.62120	AGC	.	.		0.478	HGD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355410.1		
MYLK	4638	hgsc.bcm.edu	37	3	123411616	123411616	+	Silent	SNP	G	G	A			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr3:123411616G>A	ENST00000475616.1	-	16	3530	c.3531C>T	c.(3529-3531)ggC>ggT	p.G1177G	MYLK_ENST00000360304.3_Silent_p.G1177G|MYLK_ENST00000346322.5_Silent_p.G1108G|MYLK_ENST00000360772.3_Silent_p.G1177G|MYLK_ENST00000354792.5_5'Flank|MYLK_ENST00000359169.1_Silent_p.G1177G|MYLK_ENST00000510775.1_5'UTR|MYLK-AS2_ENST00000510827.1_RNA|MYLK-AS2_ENST00000515464.1_RNA			Q15746	MYLK_HUMAN	myosin light chain kinase	1177	Actin-binding (calcium/calmodulin- insensitive). {ECO:0000250}.|Ig-like C2-type 7.				actin filament organization (GO:0007015)|aorta smooth muscle tissue morphogenesis (GO:0060414)|bleb assembly (GO:0032060)|cellular hypotonic response (GO:0071476)|muscle contraction (GO:0006936)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cell migration (GO:0030335)|positive regulation of wound healing (GO:0090303)|protein phosphorylation (GO:0006468)|smooth muscle contraction (GO:0006939)|tonic smooth muscle contraction (GO:0014820)	cell-cell junction (GO:0005911)|cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|lamellipodium (GO:0030027)|stress fiber (GO:0001725)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)|metal ion binding (GO:0046872)|myosin light chain kinase activity (GO:0004687)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(24)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(37)|ovary(7)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	113		Lung NSC(201;0.0496)		GBM - Glioblastoma multiforme(114;0.0736)		ACTCCGCCTGGCCAGCGTCAT	0.597																																					p.G1177G		Atlas-SNP	.											.	MYLK	224	.	0			c.C3531T						.						91.0	70.0	77.0					3																	123411616		2203	4300	6503	SO:0001819	synonymous_variant	4638	exon19			CGCCTGGCCAGCG	X85337	CCDS3023.1, CCDS43141.1, CCDS46896.1, CCDS46897.1, CCDS58849.1	3q21	2013-02-11	2008-01-23		ENSG00000065534	ENSG00000065534	2.7.11.18	"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7590	protein-coding gene	gene with protein product	"""smooth muscle myosin light chain kinase"""	600922	"""myosin, light polypeptide kinase"""			8575746	Standard	NM_053026		Approved	MLCK, smMLCK, MYLK1, MLCK1	uc003ego.3	Q15746	OTTHUMG00000141304	ENST00000475616.1:c.3531C>T	chr3.hg19:g.123411616G>A		81.0	0.0		48.0	24.0	NM_053025	B4DUE3|D3DN97|O95796|O95797|O95798|O95799|Q14844|Q16794|Q17S15|Q3ZCP9|Q5MY99|Q5MYA0|Q6P2N0|Q7Z4J0|Q9C0L5|Q9UBG5|Q9UBY6|Q9UIT9	Silent	SNP	ENST00000475616.1	hg19	CCDS46896.1																																																																																			.	.		0.597	MYLK-004	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356464.1	NM_053025	
SHOX2	6474	hgsc.bcm.edu	37	3	157820591	157820591	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr3:157820591C>T	ENST00000425436.3	-	2	456	c.431G>A	c.(430-432)cGg>cAg	p.R144Q	SHOX2_ENST00000490689.2_Missense_Mutation_p.R15Q|SHOX2_ENST00000483851.2_Missense_Mutation_p.R144Q|SHOX2_ENST00000389589.4_Missense_Mutation_p.R168Q|SHOX2_ENST00000441443.2_Missense_Mutation_p.R15Q|SHOX2_ENST00000554685.1_5'UTR	NM_001163678.1|NM_006884.3	NP_001157150.1|NP_006875.2	O60902	SHOX2_HUMAN	short stature homeobox 2	144					cardiac atrium morphogenesis (GO:0003209)|cartilage development involved in endochondral bone morphogenesis (GO:0060351)|chondrocyte development (GO:0002063)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic forelimb morphogenesis (GO:0035115)|embryonic skeletal joint morphogenesis (GO:0060272)|heart development (GO:0007507)|heart valve development (GO:0003170)|muscle tissue morphogenesis (GO:0060415)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|osteoblast differentiation (GO:0001649)|positive regulation of axonogenesis (GO:0050772)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of skeletal muscle fiber development (GO:0048743)|positive regulation of smoothened signaling pathway (GO:0045880)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of branching morphogenesis of a nerve (GO:2000172)|regulation of chondrocyte differentiation (GO:0032330)|skeletal system development (GO:0001501)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			NS(1)|breast(1)|endometrium(1)|large_intestine(1)|liver(2)|lung(10)|skin(3)|upper_aerodigestive_tract(1)	20			Lung(72;0.00318)|LUSC - Lung squamous cell carcinoma(72;0.0043)			GAAATTGGTCCGACTTCGCCT	0.567																																					p.R168Q		Atlas-SNP	.											.	SHOX2	84	.	0			c.G503A						.						185.0	150.0	162.0					3																	157820591		2203	4300	6503	SO:0001583	missense	6474	exon3			TTGGTCCGACTTC	AJ002368	CCDS33884.1, CCDS43164.1, CCDS33884.2, CCDS54664.1	3q25.32	2011-06-20			ENSG00000168779	ENSG00000168779		"""Homeoboxes / PRD class"""	10854	protein-coding gene	gene with protein product		602504				9482898, 9466998	Standard	NM_006884		Approved	SHOT, OG12X, OG12	uc003fbs.3	O60902	OTTHUMG00000158755	ENST00000425436.3:c.431G>A	chr3.hg19:g.157820591C>T	ENSP00000398704:p.Arg144Gln	264.0	1.0		202.0	95.0	NM_003030	O60465|O60467|O60903	Missense_Mutation	SNP	ENST00000425436.3	hg19	CCDS43164.1	.	.	.	.	.	.	.	.	.	.	C	36	5.790320	0.96945	.	.	ENSG00000168779;ENSG00000168779;ENSG00000168779;ENSG00000168779;ENSG00000168779;ENSG00000258518	ENST00000425436;ENST00000490689;ENST00000389589;ENST00000313019;ENST00000441443;ENST00000483851	D;D;D;D;D	0.99150	-5.49;-5.49;-5.49;-5.49;-5.49	5.49	5.49	0.81192	Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);	0.000000	0.64402	D	0.000001	D	0.99664	0.9875	H	0.98833	4.345	0.80722	D	1	D;D;D	0.89917	0.998;1.0;1.0	D;D;D	0.97110	0.986;0.999;1.0	D	0.97355	0.9966	10	0.87932	D	0	.	19.3594	0.94431	0.0:1.0:0.0:0.0	.	144;168;144	O60902-2;O60902-3;O60902	.;.;SHOX2_HUMAN	Q	168;15;144;15;15;144	ENSP00000398704:R168Q;ENSP00000451888:R15Q;ENSP00000374240:R144Q;ENSP00000397099:R15Q;ENSP00000419362:R144Q	ENSP00000327294:R15Q	R	-	2	0	SHOX2;AC112502.1	159303285	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	7.818000	0.86416	2.576000	0.86940	0.655000	0.94253	CGG	.	.		0.567	SHOX2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000352057.2		
TMEM175	84286	hgsc.bcm.edu	37	4	944240	944240	+	Missense_Mutation	SNP	C	C	A			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr4:944240C>A	ENST00000264771.4	+	4	409	c.224C>A	c.(223-225)gCa>gAa	p.A75E	TMEM175_ENST00000508204.1_5'UTR|TMEM175_ENST00000515740.1_5'UTR|TMEM175_ENST00000504180.1_3'UTR	NM_032326.2	NP_115702.1	Q9BSA9	TM175_HUMAN	transmembrane protein 175	75						integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)				NS(1)|endometrium(1)|large_intestine(2)|lung(6)|pancreas(1)|upper_aerodigestive_tract(3)	14			OV - Ovarian serous cystadenocarcinoma(23;0.0158)			AGGCTTCTGGCAACACGGATT	0.577																																					p.A75E		Atlas-SNP	.											.	TMEM175	44	.	0			c.C224A						.						130.0	113.0	119.0					4																	944240		2203	4300	6503	SO:0001583	missense	84286	exon4			TTCTGGCAACACG	BC005158	CCDS3341.1, CCDS75087.1, CCDS75088.1	4p16.3	2008-02-05			ENSG00000127419	ENSG00000127419			28709	protein-coding gene	gene with protein product						12477932	Standard	XM_005272301		Approved	MGC4618	uc003gbq.3	Q9BSA9	OTTHUMG00000118996	ENST00000264771.4:c.224C>A	chr4.hg19:g.944240C>A	ENSP00000264771:p.Ala75Glu	182.0	0.0		111.0	44.0	NM_032326	D3DVN4|Q8ND13	Missense_Mutation	SNP	ENST00000264771.4	hg19	CCDS3341.1	.	.	.	.	.	.	.	.	.	.	C	14.05	2.418695	0.42918	.	.	ENSG00000127419	ENST00000507319;ENST00000264771;ENST00000514453;ENST00000514546	T;T;T;T	0.43294	0.95;0.95;0.95;0.95	4.9	4.9	0.64082	.	0.331079	0.28252	N	0.016034	T	0.50548	0.1622	L	0.46157	1.445	0.80722	D	1	D	0.64830	0.994	P	0.61658	0.892	T	0.35051	-0.9804	10	0.15066	T	0.55	-22.9253	13.6304	0.62191	0.0:1.0:0.0:0.0	.	75	Q9BSA9	TM175_HUMAN	E	74;75;62;75	ENSP00000424746:A74E;ENSP00000264771:A75E;ENSP00000425181:A62E;ENSP00000425763:A75E	ENSP00000264771:A75E	A	+	2	0	TMEM175	934240	0.998000	0.40836	0.929000	0.37066	0.014000	0.08584	3.836000	0.55813	2.290000	0.77057	0.549000	0.68633	GCA	.	.		0.577	TMEM175-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239193.2	NM_032326	
TBC1D14	57533	hgsc.bcm.edu	37	4	7026792	7026792	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr4:7026792T>C	ENST00000409757.4	+	13	1943	c.1819T>C	c.(1819-1821)Ttc>Ctc	p.F607L	TBC1D14_ENST00000410031.1_Missense_Mutation_p.F379L|TBC1D14_ENST00000446947.2_Missense_Mutation_p.F254L|TBC1D14_ENST00000448507.1_Missense_Mutation_p.F607L|TBC1D14_ENST00000451522.2_Missense_Mutation_p.F327L	NM_020773.2	NP_065824.2	Q9P2M4	TBC14_HUMAN	TBC1 domain family, member 14	607	Rab-GAP TBC. {ECO:0000255|PROSITE- ProRule:PRU00163}.				negative regulation of autophagy (GO:0010507)|recycling endosome to Golgi transport (GO:0071955)|regulation of autophagic vacuole assembly (GO:2000785)	autophagic vacuole (GO:0005776)|Golgi apparatus (GO:0005794)|recycling endosome (GO:0055037)	protein kinase binding (GO:0019901)|Rab GTPase activator activity (GO:0005097)			breast(1)|endometrium(5)|large_intestine(4)|lung(9)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	22						CTGGGACGTGTTCTGTCGCGA	0.498																																					p.F607L		Atlas-SNP	.											TBC1D14_ENST00000409757,colon,carcinoma,0,2	TBC1D14	110	.	0			c.T1819C						.						174.0	159.0	164.0					4																	7026792		2203	4300	6503	SO:0001583	missense	57533	exon13			GACGTGTTCTGTC	AL833868	CCDS3394.2, CCDS47006.1, CCDS75104.1	4p16.1	2008-01-22			ENSG00000132405	ENSG00000132405			29246	protein-coding gene	gene with protein product		614855				10718198	Standard	NM_020773		Approved	KIAA1322	uc003gjs.4	Q9P2M4	OTTHUMG00000090493	ENST00000409757.4:c.1819T>C	chr4.hg19:g.7026792T>C	ENSP00000386921:p.Phe607Leu	276.0	1.0		203.0	47.0	NM_001113361	B9A6L5|D3DVT4|E9PAZ6|Q8IW15|Q8NDK3	Missense_Mutation	SNP	ENST00000409757.4	hg19	CCDS3394.2	.	.	.	.	.	.	.	.	.	.	T	22.4	4.280978	0.80692	.	.	ENSG00000132405	ENST00000448507;ENST00000409757;ENST00000410031;ENST00000451522;ENST00000446947	T;T;T;T;T	0.20598	2.06;2.06;2.06;2.06;2.06	5.15	5.15	0.70609	Rab-GAP/TBC domain (4);	0.049635	0.85682	D	0.000000	T	0.27278	0.0669	L	0.42632	1.34	0.80722	D	1	P;B;B	0.42375	0.778;0.357;0.226	B;B;P	0.47528	0.399;0.219;0.549	T	0.01496	-1.1340	10	0.45353	T	0.12	-24.8858	14.1839	0.65592	0.0:0.0:0.0:1.0	.	254;327;607	F5GXK4;Q9P2M4-2;Q9P2M4	.;.;TBC14_HUMAN	L	607;607;379;327;254	ENSP00000404041:F607L;ENSP00000386921:F607L;ENSP00000386343:F379L;ENSP00000388886:F327L;ENSP00000405875:F254L	ENSP00000386921:F607L	F	+	1	0	TBC1D14	7077693	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.658000	0.83755	1.953000	0.56701	0.459000	0.35465	TTC	.	.		0.498	TBC1D14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206981.3	NM_020773	
TRMT44	152992	hgsc.bcm.edu	37	4	8469838	8469838	+	Silent	SNP	C	C	T			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr4:8469838C>T	ENST00000389737.4	+	9	1692	c.1692C>T	c.(1690-1692)gtC>gtT	p.V564V	TRMT44_ENST00000513449.2_Silent_p.V323V	NM_152544.2	NP_689757.2	Q8IYL2	TRM44_HUMAN	tRNA methyltransferase 44 homolog (S. cerevisiae)	564					tRNA processing (GO:0008033)	cytoplasm (GO:0005737)	metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)										ACGCCAGGGTCGGGTGTGTAA	0.632																																					p.V564V		Atlas-SNP	.											.	TRMT44	7	.	0			c.C1692T						.						36.0	34.0	35.0					4																	8469838		2203	4300	6503	SO:0001819	synonymous_variant	152992	exon9			CAGGGTCGGGTGT	AK093044	CCDS3402.1, CCDS3402.2	4p16.1	2012-06-12	2012-06-12	2012-06-12	ENSG00000155275	ENSG00000155275			26653	protein-coding gene	gene with protein product	"""tRNA methyltransferase 44 homolog (S. cerevisiae)"""	614309	"""chromosome 4 open reading frame 23"", ""methyltransferase like 19"""	C4orf23, METTL19		21658913	Standard	NM_152544		Approved	FLJ35725, TRM44	uc003glg.2	Q8IYL2	OTTHUMG00000160935	ENST00000389737.4:c.1692C>T	chr4.hg19:g.8469838C>T		155.0	0.0		123.0	5.0	NM_152544	Q8NA95	Silent	SNP	ENST00000389737.4	hg19	CCDS3402.2																																																																																			.	.		0.632	TRMT44-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000359197.2	NM_152544	
PCDH7	5099	hgsc.bcm.edu	37	4	30724910	30724910	+	Missense_Mutation	SNP	C	C	A			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr4:30724910C>A	ENST00000361762.2	+	1	2874	c.1866C>A	c.(1864-1866)agC>agA	p.S622R	PCDH7_ENST00000543491.1_Missense_Mutation_p.S622R	NM_002589.2	NP_002580.2	O60245	PCDH7_HUMAN	protocadherin 7	622	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(8)|liver(1)|lung(26)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	55						TGCAGGGCAGCACTACGGTGA	0.488																																					p.S622R		Atlas-SNP	.											.	PCDH7	215	.	0			c.C1866A						.						92.0	97.0	95.0					4																	30724910		2203	4300	6503	SO:0001583	missense	5099	exon1			GGGCAGCACTACG	AB006755	CCDS33971.1, CCDS75116.1	4p15	2014-06-13	2007-02-12			ENSG00000169851		"""Cadherins / Protocadherins : Non-clustered"""	8659	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 120"""	602988	"""BH-protocadherin (brain-heart)"""			9615233	Standard	NM_002589		Approved	BH-Pcdh, PPP1R120	uc021xnd.1	O60245		ENST00000361762.2:c.1866C>A	chr4.hg19:g.30724910C>A	ENSP00000355243:p.Ser622Arg	68.0	0.0		89.0	36.0	NM_032457	O60246|O60247|Q4W5C4	Missense_Mutation	SNP	ENST00000361762.2	hg19	CCDS33971.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	13.82|13.82	2.352629|2.352629	0.41700|0.41700	.|.	.|.	ENSG00000169851|ENSG00000169851	ENST00000511884|ENST00000361762;ENST00000543491;ENST00000333135	.|T;T	.|0.50813	.|0.73;0.73	5.37|5.37	3.65|3.65	0.41850|0.41850	.|Cadherin (5);Cadherin-like (1);	.|.	.|.	.|.	.|.	T|T	0.45054|0.45054	0.1323|0.1323	N|N	0.25957|0.25957	0.775|0.775	0.48975|0.48975	D|D	0.99973|0.99973	.|D;D;P	.|0.55800	.|0.973;0.973;0.872	.|P;P;P	.|0.55871	.|0.786;0.786;0.756	T|T	0.41342|0.41342	-0.9514|-0.9514	5|9	.|0.72032	.|D	.|0.01	.|.	6.8325|6.8325	0.23917|0.23917	0.1414:0.7145:0.0:0.1441|0.1414:0.7145:0.0:0.1441	.|.	.|622;575;622	.|F5GWJ1;O60245-3;O60245	.|.;.;PCDH7_HUMAN	N|R	312|622;622;575	.|ENSP00000355243:S622R;ENSP00000441802:S622R	.|ENSP00000330302:S575R	H|S	+|+	1|3	0|2	PCDH7|PCDH7	30334008|30334008	0.845000|0.845000	0.29573|0.29573	1.000000|1.000000	0.80357|0.80357	0.987000|0.987000	0.75469|0.75469	-0.058000|-0.058000	0.11750|0.11750	0.839000|0.839000	0.34971|0.34971	0.655000|0.655000	0.94253|0.94253	CAC|AGC	.	.		0.488	PCDH7-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000360366.1	NM_032457, NM_002589	
PCDH7	5099	hgsc.bcm.edu	37	4	30725405	30725405	+	Missense_Mutation	SNP	T	T	A			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr4:30725405T>A	ENST00000361762.2	+	1	3369	c.2361T>A	c.(2359-2361)aaT>aaA	p.N787K	PCDH7_ENST00000543491.1_Missense_Mutation_p.N787K	NM_002589.2	NP_002580.2	O60245	PCDH7_HUMAN	protocadherin 7	787	Cadherin 7. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(8)|liver(1)|lung(26)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	55						TGGGAGGAAATCCCTTCAAGC	0.468																																					p.N787K		Atlas-SNP	.											.	PCDH7	215	.	0			c.T2361A						.						54.0	53.0	54.0					4																	30725405		2203	4300	6503	SO:0001583	missense	5099	exon1			AGGAAATCCCTTC	AB006755	CCDS33971.1, CCDS75116.1	4p15	2014-06-13	2007-02-12			ENSG00000169851		"""Cadherins / Protocadherins : Non-clustered"""	8659	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 120"""	602988	"""BH-protocadherin (brain-heart)"""			9615233	Standard	NM_002589		Approved	BH-Pcdh, PPP1R120	uc021xnd.1	O60245		ENST00000361762.2:c.2361T>A	chr4.hg19:g.30725405T>A	ENSP00000355243:p.Asn787Lys	104.0	0.0		89.0	38.0	NM_032457	O60246|O60247|Q4W5C4	Missense_Mutation	SNP	ENST00000361762.2	hg19	CCDS33971.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	14.57|14.57	2.575956|2.575956	0.45902|0.45902	.|.	.|.	ENSG00000169851|ENSG00000169851	ENST00000361762;ENST00000543491;ENST00000333135|ENST00000511884	T;T|.	0.53857|.	0.6;0.6|.	4.96|4.96	3.79|3.79	0.43588|0.43588	Cadherin (4);Cadherin-like (1);|.	.|.	.|.	.|.	.|.	T|T	0.65217|0.65217	0.2670|0.2670	M|M	0.77616|0.77616	2.38|2.38	0.48288|0.48288	D|D	0.99962|0.99962	D;D;D|.	0.89917|.	1.0;1.0;1.0|.	D;D;D|.	0.97110|.	0.999;0.999;1.0|.	T|T	0.63677|0.63677	-0.6583|-0.6583	9|5	0.87932|.	D|.	0|.	.|.	6.7845|6.7845	0.23665|0.23665	0.0:0.2297:0.0:0.7703|0.0:0.2297:0.0:0.7703	.|.	787;740;787|.	F5GWJ1;O60245-3;O60245|.	.;.;PCDH7_HUMAN|.	K|T	787;787;740|477	ENSP00000355243:N787K;ENSP00000441802:N787K|.	ENSP00000330302:N740K|.	N|S	+|+	3|1	2|0	PCDH7|PCDH7	30334503|30334503	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.994000|0.994000	0.84299|0.84299	0.940000|0.940000	0.28992|0.28992	0.930000|0.930000	0.37217|0.37217	0.533000|0.533000	0.62120|0.62120	AAT|TCC	.	.		0.468	PCDH7-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000360366.1	NM_032457, NM_002589	
LPHN3	23284	hgsc.bcm.edu	37	4	62936605	62936605	+	Silent	SNP	T	T	C			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr4:62936605T>C	ENST00000514591.1	+	25	4718	c.4389T>C	c.(4387-4389)gcT>gcC	p.A1463A	RP11-84A1.3_ENST00000506704.1_RNA|LPHN3_ENST00000506700.1_3'UTR|LPHN3_ENST00000507164.1_3'UTR|LPHN3_ENST00000508693.1_3'UTR|LPHN3_ENST00000504896.1_3'UTR|LPHN3_ENST00000511324.1_3'UTR|RP11-84A1.3_ENST00000509461.1_RNA|LPHN3_ENST00000508946.1_Silent_p.A1506A|LPHN3_ENST00000507625.1_Silent_p.A1522A|LPHN3_ENST00000514996.1_Silent_p.A1497A|LPHN3_ENST00000506720.1_Silent_p.A1574A|LPHN3_ENST00000514157.1_3'UTR|RP11-84A1.3_ENST00000504135.1_RNA|LPHN3_ENST00000512091.2_3'UTR|LPHN3_ENST00000506746.1_Silent_p.A1565A|LPHN3_ENST00000509896.1_3'UTR|LPHN3_ENST00000545650.1_Silent_p.A1463A			Q9HAR2	LPHN3_HUMAN	latrophilin 3	1441					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|G-protein coupled receptor activity (GO:0004930)			breast(5)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(5)|kidney(4)|large_intestine(21)|lung(73)|ovary(1)|pancreas(1)|prostate(6)|upper_aerodigestive_tract(1)	125						AAGGACCGGCTCATTTGGTCA	0.443																																					p.A1463A		Atlas-SNP	.											.	LPHN3	800	.	0			c.T4389C						.						51.0	52.0	52.0					4																	62936605		692	1591	2283	SO:0001819	synonymous_variant	23284	exon23			ACCGGCTCATTTG	AB018311	CCDS54768.1	4q13.1	2014-08-08				ENSG00000150471		"""-"", ""GPCR / Class B : Orphans"""	20974	protein-coding gene	gene with protein product						10994649	Standard	NM_015236		Approved	KIAA0768, LEC3	uc010ihh.3	Q9HAR2		ENST00000514591.1:c.4389T>C	chr4.hg19:g.62936605T>C		69.0	0.0		86.0	56.0	NM_015236	E9PE04|O94867|Q9NWK5	Silent	SNP	ENST00000514591.1	hg19	CCDS54768.1	.	.	.	.	.	.	.	.	.	.	T	4.504	0.093563	0.08632	.	.	ENSG00000150471	ENST00000502815	.	.	.	5.5	1.47	0.22746	.	.	.	.	.	T	0.55752	0.1940	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.48103	-0.9064	4	.	.	.	.	8.4372	0.32795	0.122:0.0:0.4432:0.4348	.	.	.	.	P	912	.	.	S	+	1	0	LPHN3	62619200	0.950000	0.32346	0.998000	0.56505	0.994000	0.84299	-0.010000	0.12743	0.373000	0.24621	0.482000	0.46254	TCA	.	.		0.443	LPHN3-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000361765.1		
NPY5R	4889	hgsc.bcm.edu	37	4	164272591	164272591	+	Missense_Mutation	SNP	T	T	A			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr4:164272591T>A	ENST00000515560.1	+	4	2688	c.1166T>A	c.(1165-1167)gTg>gAg	p.V389E	NPY5R_ENST00000338566.3_Missense_Mutation_p.V389E|NPY5R_ENST00000506953.1_Missense_Mutation_p.V389E			Q15761	NPY5R_HUMAN	neuropeptide Y receptor Y5	389					cardiac left ventricle morphogenesis (GO:0003214)|eating behavior (GO:0042755)|G-protein coupled receptor signaling pathway (GO:0007186)|generation of ovulation cycle rhythm (GO:0060112)|negative regulation of apoptotic process (GO:0043066)|negative regulation of glutamate secretion (GO:0014050)|negative regulation of synaptic transmission, GABAergic (GO:0032229)|neuropeptide signaling pathway (GO:0007218)|outflow tract morphogenesis (GO:0003151)|positive regulation of acute inflammatory response (GO:0002675)|positive regulation of smooth muscle cell proliferation (GO:0048661)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	neuropeptide Y receptor activity (GO:0004983)|pancreatic polypeptide receptor activity (GO:0001602)|peptide YY receptor activity (GO:0001601)			NS(2)|biliary_tract(1)|breast(1)|endometrium(3)|large_intestine(4)|lung(26)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	42	all_hematologic(180;0.166)	Prostate(90;0.109)				CTTTTCCATGTGGTAACTGAT	0.348																																					p.V389E	Melanoma(139;1287 1774 9781 19750 25599)	Atlas-SNP	.											.	NPY5R	101	.	0			c.T1166A						.						160.0	152.0	155.0					4																	164272591		2203	4300	6503	SO:0001583	missense	4889	exon4			TCCATGTGGTAAC	BC042416	CCDS3804.1	4q31-q32	2012-08-08				ENSG00000164129		"""GPCR / Class A : Neuropeptide receptors : Y"""	7958	protein-coding gene	gene with protein product		602001				8700207, 9417917	Standard	NM_006174		Approved	NPYR5	uc003iqn.3	Q15761		ENST00000515560.1:c.1166T>A	chr4.hg19:g.164272591T>A	ENSP00000423917:p.Val389Glu	207.0	0.0		154.0	86.0	NM_006174	Q6GTR7|Q92916	Missense_Mutation	SNP	ENST00000515560.1	hg19	CCDS3804.1	.	.	.	.	.	.	.	.	.	.	T	17.70	3.453285	0.63290	.	.	ENSG00000164129	ENST00000338566;ENST00000515560;ENST00000506953	T;T;T	0.55930	0.49;0.49;0.49	4.9	3.7	0.42460	GPCR, rhodopsin-like superfamily (1);	0.283599	0.24294	N	0.039799	T	0.63331	0.2502	M	0.68317	2.08	0.35343	D	0.786634	D	0.61080	0.989	P	0.58172	0.834	T	0.74349	-0.3694	10	0.62326	D	0.03	.	11.1021	0.48182	0.0:0.0772:0.0:0.9228	.	389	Q15761	NPY5R_HUMAN	E	389	ENSP00000339377:V389E;ENSP00000423917:V389E;ENSP00000423474:V389E	ENSP00000339377:V389E	V	+	2	0	NPY5R	164492041	1.000000	0.71417	0.999000	0.59377	0.854000	0.48673	5.294000	0.65687	1.966000	0.57179	0.377000	0.23210	GTG	.	.		0.348	NPY5R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364633.1	NM_006174	
DDX60	55601	hgsc.bcm.edu	37	4	169201507	169201507	+	Missense_Mutation	SNP	C	C	G			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr4:169201507C>G	ENST00000393743.3	-	14	2248	c.1957G>C	c.(1957-1959)Gaa>Caa	p.E653Q		NM_017631.5	NP_060101.3	Q8IY21	DDX60_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 60	653					defense response to virus (GO:0051607)|innate immune response (GO:0045087)|positive regulation of MDA-5 signaling pathway (GO:1900245)|positive regulation of RIG-I signaling pathway (GO:1900246)|response to virus (GO:0009615)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)	ATP binding (GO:0005524)|double-stranded DNA binding (GO:0003690)|double-stranded RNA binding (GO:0003725)|helicase activity (GO:0004386)|single-stranded RNA binding (GO:0003727)			breast(1)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(15)|liver(1)|lung(21)|ovary(1)|pancreas(2)|prostate(1)|skin(4)|urinary_tract(4)	63		Prostate(90;0.00876)|Renal(120;0.0183)|all_neural(102;0.0837)|Melanoma(52;0.132)		GBM - Glioblastoma multiforme(119;0.0485)		CGGCAATGTTCTTTCCAGGCT	0.358																																					p.E653Q		Atlas-SNP	.											.	DDX60	304	.	0			c.G1957C						.						89.0	83.0	85.0					4																	169201507		2203	4300	6503	SO:0001583	missense	55601	exon14			AATGTTCTTTCCA	AK001649	CCDS34097.1	4q32.3	2010-02-17			ENSG00000137628	ENSG00000137628			25942	protein-coding gene	gene with protein product		613974				12477932	Standard	NM_017631		Approved	FLJ20035	uc003irp.3	Q8IY21	OTTHUMG00000161350	ENST00000393743.3:c.1957G>C	chr4.hg19:g.169201507C>G	ENSP00000377344:p.Glu653Gln	307.0	0.0		247.0	144.0	NM_017631	Q6PK35|Q9NVE3	Missense_Mutation	SNP	ENST00000393743.3	hg19	CCDS34097.1	.	.	.	.	.	.	.	.	.	.	C	12.22	1.873492	0.33069	.	.	ENSG00000137628	ENST00000393743	T	0.19532	2.14	5.48	4.64	0.57946	.	0.302034	0.30210	N	0.010142	T	0.35480	0.0933	M	0.75264	2.295	0.32678	N	0.515851	D	0.65815	0.995	P	0.53062	0.717	T	0.52711	-0.8539	10	0.40728	T	0.16	.	11.3079	0.49347	0.0:0.849:0.0:0.151	.	653	Q8IY21	DDX60_HUMAN	Q	653	ENSP00000377344:E653Q	ENSP00000377344:E653Q	E	-	1	0	DDX60	169438082	0.657000	0.27393	0.794000	0.32065	0.056000	0.15407	1.215000	0.32431	1.326000	0.45319	0.563000	0.77884	GAA	.	.		0.358	DDX60-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364622.1	NM_017631	
DDX60L	91351	hgsc.bcm.edu	37	4	169382958	169382958	+	Nonsense_Mutation	SNP	C	C	T			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr4:169382958C>T	ENST00000511577.1	-	5	745	c.498G>A	c.(496-498)tgG>tgA	p.W166*	DDX60L_ENST00000505890.1_Nonsense_Mutation_p.W166*|DDX60L_ENST00000260184.7_Nonsense_Mutation_p.W166*			Q5H9U9	DDX6L_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 60-like	166							ATP binding (GO:0005524)|helicase activity (GO:0004386)|RNA binding (GO:0003723)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(7)|lung(23)|ovary(2)|prostate(1)|skin(1)|stomach(1)	43		Prostate(90;0.00876)|Renal(120;0.0183)|all_neural(102;0.0837)|Melanoma(52;0.132)		GBM - Glioblastoma multiforme(119;0.175)		CTTTCATTCCCCAGGAATGTA	0.368																																					p.W166X		Atlas-SNP	.											.	DDX60L	116	.	0			c.G498A						.						56.0	50.0	52.0					4																	169382958		1838	4094	5932	SO:0001587	stop_gained	91351	exon5			CATTCCCCAGGAA	AK092461	CCDS47161.1	4q32.3	2008-01-08				ENSG00000181381			26429	protein-coding gene	gene with protein product							Standard	XM_005263341		Approved	FLJ31033	uc003irq.4	Q5H9U9		ENST00000511577.1:c.498G>A	chr4.hg19:g.169382958C>T	ENSP00000422423:p.Trp166*	114.0	0.0		89.0	30.0	NM_001012967	Q96ND6	Nonsense_Mutation	SNP	ENST00000511577.1	hg19		.	.	.	.	.	.	.	.	.	.	C	20.1	3.934346	0.73442	.	.	ENSG00000181381	ENST00000260184;ENST00000511577;ENST00000505890	.	.	.	3.43	3.43	0.39272	.	0.227351	0.22562	U	0.058453	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.12766	T	0.61	.	14.7903	0.69837	0.0:1.0:0.0:0.0	.	.	.	.	X	166	.	ENSP00000260184:W166X	W	-	3	0	DDX60L	169619533	0.228000	0.23718	0.006000	0.13384	0.063000	0.16089	3.164000	0.50770	1.604000	0.50143	0.467000	0.42956	TGG	.	.		0.368	DDX60L-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000364839.1	NM_001012967	
IRX1	79192	hgsc.bcm.edu	37	5	3599577	3599577	+	Missense_Mutation	SNP	C	C	A			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr5:3599577C>A	ENST00000302006.3	+	2	567	c.515C>A	c.(514-516)aCg>aAg	p.T172K	CTD-2012M11.3_ENST00000559410.1_RNA	NM_024337.3	NP_077313.3	P78414	IRX1_HUMAN	iroquois homeobox 1	172					proximal/distal pattern formation involved in metanephric nephron development (GO:0072272)|regulation of transcription, DNA-templated (GO:0006355)|specification of loop of Henle identity (GO:0072086)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			biliary_tract(1)|endometrium(5)|kidney(2)|large_intestine(5)|lung(18)|ovary(2)|pancreas(1)|prostate(5)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	43						ATGACCCTCACGCAGGTCTCC	0.617																																					p.T172K		Atlas-SNP	.											.	IRX1	106	.	0			c.C515A						.						154.0	119.0	131.0					5																	3599577		2203	4300	6503	SO:0001583	missense	79192	exon2			CCCTCACGCAGGT	U90307	CCDS34132.1	5p15.33	2011-12-16	2007-07-13		ENSG00000170549	ENSG00000170549		"""Homeoboxes / TALE class"""	14358	protein-coding gene	gene with protein product		606197					Standard	NM_024337		Approved	IRX-5	uc003jde.3	P78414	OTTHUMG00000161632	ENST00000302006.3:c.515C>A	chr5.hg19:g.3599577C>A	ENSP00000305244:p.Thr172Lys	236.0	0.0		227.0	116.0	NM_024337	Q7Z2F8|Q8N312	Missense_Mutation	SNP	ENST00000302006.3	hg19	CCDS34132.1	.	.	.	.	.	.	.	.	.	.	C	28.6	4.936665	0.92458	.	.	ENSG00000170549	ENST00000302006	D	0.90324	-2.65	4.81	4.81	0.61882	Homeodomain-related (1);Homeobox (2);Homeobox KN domain (1);Homeodomain-like (1);Homeobox, conserved site (1);	0.049539	0.85682	D	0.000000	D	0.92280	0.7551	L	0.36672	1.1	0.80722	D	1	D	0.54964	0.969	P	0.62560	0.904	D	0.93527	0.6866	10	0.87932	D	0	-25.1634	17.5082	0.87753	0.0:1.0:0.0:0.0	.	172	P78414	IRX1_HUMAN	K	172	ENSP00000305244:T172K	ENSP00000305244:T172K	T	+	2	0	IRX1	3652577	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.547000	0.82146	2.173000	0.68751	0.655000	0.94253	ACG	.	.		0.617	IRX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365546.1	NM_024337	
CTNND2	1501	hgsc.bcm.edu	37	5	10992757	10992757	+	Silent	SNP	C	C	A	rs531016201		TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr5:10992757C>A	ENST00000304623.8	-	19	3306	c.3117G>T	c.(3115-3117)tcG>tcT	p.S1039S	CTNND2_ENST00000495388.2_5'UTR|CTNND2_ENST00000359640.2_Silent_p.S981S|CTNND2_ENST00000458100.2_Silent_p.S606S|CTNND2_ENST00000503622.1_Silent_p.S702S|CTNND2_ENST00000511377.1_Silent_p.S948S	NM_001332.2	NP_001323.1	Q9UQB3	CTND2_HUMAN	catenin (cadherin-associated protein), delta 2	1039					cell adhesion (GO:0007155)|learning (GO:0007612)|morphogenesis of a branching structure (GO:0001763)|multicellular organismal development (GO:0007275)|regulation of synaptic plasticity (GO:0048167)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)				NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(29)|liver(1)|lung(71)|ovary(4)|pancreas(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(4)|urinary_tract(2)	136						TGGTTGAAGACGAGGCTACAA	0.542																																					p.S1039S		Atlas-SNP	.											.	CTNND2	289	.	0			c.G3117T						.						143.0	130.0	134.0					5																	10992757		2203	4300	6503	SO:0001819	synonymous_variant	1501	exon19			TGAAGACGAGGCT	U52828	CCDS3881.1, CCDS75227.1, CCDS75228.1	5p15.2	2013-02-14	2012-08-15		ENSG00000169862	ENSG00000169862		"""Armadillo repeat containing"""	2516	protein-coding gene	gene with protein product	"""neural plakophilin-related arm-repeat protein"""	604275	"""catenin (cadherin-associated protein), delta 2 (neural plakophilin-related arm-repeat protein)"""			9342840, 9223106	Standard	XM_005248251		Approved	NPRAP, GT24	uc003jfa.1	Q9UQB3	OTTHUMG00000090511	ENST00000304623.8:c.3117G>T	chr5.hg19:g.10992757C>A		159.0	0.0		123.0	60.0	NM_001332	B0FTZ7|O00379|O15390|O43206|O43840|Q13589|Q9UM66|Q9UPM3	Silent	SNP	ENST00000304623.8	hg19	CCDS3881.1																																																																																			.	.		0.542	CTNND2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206999.1	NM_001332	
FSTL4	23105	hgsc.bcm.edu	37	5	132534838	132534838	+	Missense_Mutation	SNP	C	C	G			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr5:132534838C>G	ENST00000265342.7	-	16	2727	c.2478G>C	c.(2476-2478)gaG>gaC	p.E826D	CTB-49A3.2_ENST00000509051.1_RNA	NM_015082.1	NP_055897.1	Q6MZW2	FSTL4_HUMAN	follistatin-like 4	826						extracellular region (GO:0005576)	calcium ion binding (GO:0005509)			autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(4)|lung(8)|skin(2)|upper_aerodigestive_tract(1)	23		all_cancers(142;0.244)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			TACCTGACACCTCACACCGCA	0.577																																					p.E826D		Atlas-SNP	.											.	FSTL4	74	.	0			c.G2478C						.						68.0	65.0	66.0					5																	132534838		2203	4300	6503	SO:0001583	missense	23105	exon16			TGACACCTCACAC	AB028984	CCDS34238.1	5q31.1	2013-01-29			ENSG00000053108	ENSG00000053108		"""EF-hand domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	21389	protein-coding gene	gene with protein product						10470851, 15527507	Standard	NM_015082		Approved	KIAA1061	uc003kyn.1	Q6MZW2	OTTHUMG00000162729	ENST00000265342.7:c.2478G>C	chr5.hg19:g.132534838C>G	ENSP00000265342:p.Glu826Asp	86.0	0.0		66.0	25.0	NM_015082	Q8TBU0|Q9UPU1	Missense_Mutation	SNP	ENST00000265342.7	hg19	CCDS34238.1	.	.	.	.	.	.	.	.	.	.	C	17.71	3.455853	0.63401	.	.	ENSG00000053108	ENST00000265342;ENST00000360575	T	0.62364	0.03	5.24	5.24	0.73138	Immunoglobulin-like (1);	0.000000	0.85682	D	0.000000	T	0.75867	0.3908	M	0.82323	2.585	0.80722	D	1	D;D	0.63046	0.962;0.992	P;P	0.53224	0.611;0.721	T	0.80817	-0.1213	10	0.72032	D	0.01	-33.8418	17.4006	0.87459	0.0:1.0:0.0:0.0	.	826;475	Q6MZW2;B3KPF3	FSTL4_HUMAN;.	D	826;657	ENSP00000265342:E826D	ENSP00000265342:E826D	E	-	3	2	FSTL4	132562737	1.000000	0.71417	1.000000	0.80357	0.224000	0.24922	4.688000	0.61715	2.446000	0.82766	0.650000	0.86243	GAG	.	.		0.577	FSTL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370212.1	XM_048786	
PCDHA6	56142	hgsc.bcm.edu	37	5	140209550	140209550	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr5:140209550G>A	ENST00000529310.1	+	1	1988	c.1874G>A	c.(1873-1875)gGg>gAg	p.G625E	PCDHA5_ENST00000529619.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA3_ENST00000522353.2_Intron	NM_018909.2|NM_031848.2|NM_031849.1	NP_061732.1|NP_114036.1|NP_114037.1	Q9UN73	PCDA6_HUMAN	protocadherin alpha 6	625	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(11)|lung(42)|prostate(8)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	89			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TTTCGCGTGGGGCTGTACACG	0.667																																					p.G625E		Atlas-SNP	.											.	PCDHA6	442	.	0			c.G1874A						.						72.0	77.0	75.0					5																	140209550		2203	4300	6503	SO:0001583	missense	56142	exon1			GCGTGGGGCTGTA	AF152484	CCDS47281.1, CCDS47282.1	5q31	2010-11-26			ENSG00000081842	ENSG00000081842		"""Cadherins / Protocadherins : Clustered"""	8672	other	complex locus constituent	"""KIAA0345-like 8"""	606312		CNRS2		10380929, 10662547	Standard	NM_018909		Approved	CNR2, CRNR2, PCDH-ALPHA6		Q9UN73	OTTHUMG00000163353	ENST00000529310.1:c.1874G>A	chr5.hg19:g.140209550G>A	ENSP00000433378:p.Gly625Glu	131.0	0.0		118.0	49.0	NM_018909	O75283|Q9NRT8	Missense_Mutation	SNP	ENST00000529310.1	hg19	CCDS47281.1	.	.	.	.	.	.	.	.	.	.	G	10.67	1.416124	0.25552	.	.	ENSG00000081842	ENST00000529310	T	0.37752	1.18	3.98	2.09	0.27110	Cadherin (4);Cadherin-like (1);	0.443885	0.16053	U	0.231876	T	0.54663	0.1872	M	0.61703	1.905	0.80722	D	1	D;D	0.71674	0.994;0.998	D;D	0.70716	0.924;0.97	T	0.53906	-0.8372	10	0.51188	T	0.08	.	13.7146	0.62689	0.0:0.2959:0.7041:0.0	.	625;625	Q9UN73-3;Q9UN73	.;PCDA6_HUMAN	E	625	ENSP00000433378:G625E	ENSP00000433378:G625E	G	+	2	0	PCDHA6	140189734	0.914000	0.31030	0.974000	0.42286	0.181000	0.23173	1.727000	0.38095	0.410000	0.25675	0.306000	0.20318	GGG	.	.		0.667	PCDHA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372829.3	NM_018909	
PCDHAC2	56134	hgsc.bcm.edu	37	5	140347607	140347607	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr5:140347607A>G	ENST00000289269.5	+	1	1788	c.1256A>G	c.(1255-1257)tAt>tGt	p.Y419C	PCDHA5_ENST00000529859.1_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA12_ENST00000398631.2_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA13_ENST00000289272.2_Intron|PCDHA10_ENST00000307360.5_Intron|PCDHAC1_ENST00000253807.2_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA9_ENST00000532602.1_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA11_ENST00000398640.2_Intron|PCDHA10_ENST00000506939.2_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA13_ENST00000409494.1_Intron|PCDHA3_ENST00000522353.2_Intron	NM_018899.5|NM_031883.2	NP_061722.1|NP_114089.1	Q9Y5I4	PCDC2_HUMAN	protocadherin alpha subfamily C, 2	419	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|endometrium(4)|kidney(4)|large_intestine(10)|liver(2)|lung(9)|ovary(2)|prostate(1)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(1)	45			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGAAACTCCTATACACTGGTG	0.577																																					p.Y419C	Melanoma(190;638 2083 3390 11909 52360)	Atlas-SNP	.											.	PCDHAC2	142	.	0			c.A1256G						.						90.0	89.0	89.0					5																	140347607		2203	4300	6503	SO:0001583	missense	56134	exon1			ACTCCTATACACT	AF152474	CCDS4242.1	5q31	2010-11-26			ENSG00000243232	ENSG00000243232		"""Cadherins / Protocadherins : Clustered"""	8677	other	complex locus constituent		606321				10380929	Standard	NM_031883		Approved	PCDH-ALPHA-C2		Q9Y5I4	OTTHUMG00000129607	ENST00000289269.5:c.1256A>G	chr5.hg19:g.140347607A>G	ENSP00000289269:p.Tyr419Cys	61.0	0.0		92.0	49.0	NM_031883	Q2M3V1|Q9Y5F4	Missense_Mutation	SNP	ENST00000289269.5	hg19	CCDS4242.1	.	.	.	.	.	.	.	.	.	.	A	10.47	1.358951	0.24598	.	.	ENSG00000243232	ENST00000289269	T	0.68181	-0.31	5.82	5.82	0.92795	Cadherin (4);Cadherin-like (1);	0.000000	0.38164	N	0.001799	D	0.88115	0.6350	H	0.97077	3.935	0.58432	D	0.999995	D;D	0.89917	0.999;1.0	D;D	0.97110	0.97;1.0	D	0.92032	0.5634	10	0.87932	D	0	.	16.1728	0.81831	1.0:0.0:0.0:0.0	.	419;419	Q9Y5I4-2;Q9Y5I4	.;PCDC2_HUMAN	C	419	ENSP00000289269:Y419C	ENSP00000289269:Y419C	Y	+	2	0	PCDHAC2	140327791	1.000000	0.71417	0.978000	0.43139	0.029000	0.11900	5.199000	0.65152	2.228000	0.72767	0.533000	0.62120	TAT	.	.		0.577	PCDHAC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251802.2	NM_018899	
PCDHB7	56129	hgsc.bcm.edu	37	5	140554546	140554546	+	Silent	SNP	G	G	A			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr5:140554546G>A	ENST00000231137.3	+	1	2304	c.2130G>A	c.(2128-2130)cgG>cgA	p.R710R	PCDHB8_ENST00000239444.2_5'Flank	NM_018940.2	NP_061763.1	Q9Y5E2	PCDB7_HUMAN	protocadherin beta 7	710					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(20)|lung(54)|ovary(5)|prostate(7)|skin(7)|upper_aerodigestive_tract(4)|urinary_tract(1)	119			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TGGCGGTGCGGCTGTGCAGGA	0.682																																					p.R710R		Atlas-SNP	.											.	PCDHB7	231	.	0			c.G2130A						.						72.0	122.0	105.0					5																	140554546		2197	4285	6482	SO:0001819	synonymous_variant	56129	exon1			GGTGCGGCTGTGC	AF152500	CCDS4249.1	5q31	2010-01-26			ENSG00000113212	ENSG00000113212		"""Cadherins / Protocadherins : Clustered"""	8692	other	protocadherin		606333				10380929	Standard	NM_018940		Approved	PCDH-BETA7	uc003lit.3	Q9Y5E2	OTTHUMG00000129608	ENST00000231137.3:c.2130G>A	chr5.hg19:g.140554546G>A		198.0	0.0		177.0	28.0	NM_018940	A1L3Y8	Silent	SNP	ENST00000231137.3	hg19	CCDS4249.1																																																																																			.	.		0.682	PCDHB7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251803.2	NM_018940	
GPR151	134391	hgsc.bcm.edu	37	5	145895523	145895523	+	Missense_Mutation	SNP	C	C	T	rs181265546	byFrequency	TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr5:145895523C>T	ENST00000311104.2	-	1	230	c.154G>A	c.(154-156)Gtg>Atg	p.V52M		NM_194251.2	NP_919227.2	Q8TDV0	GP151_HUMAN	G protein-coupled receptor 151	52						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			endometrium(2)|large_intestine(1)|lung(6)|ovary(1)|pancreas(1)|skin(1)|urinary_tract(2)	14			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			AGGTTTCCCACGAAGCCCACC	0.552													C|||	3	0.000599042	0.0	0.0	5008	,	,		19817	0.0		0.0	False		,,,				2504	0.0031				p.V52M	Pancreas(78;420 1386 18535 37114 49710)	Atlas-SNP	.											.	GPR151	35	.	0			c.G154A						.						105.0	104.0	104.0					5																	145895523		2203	4300	6503	SO:0001583	missense	134391	exon1			TTCCCACGAAGCC	AY255557	CCDS34266.1	5q32	2012-08-21						"""GPCR / Class A : Orphans"""	23624	protein-coding gene	gene with protein product	"""galanin receptor 4"""					12679517	Standard	NM_194251		Approved	PGR7, GALR4	uc003lod.1	Q8TDV0		ENST00000311104.2:c.154G>A	chr5.hg19:g.145895523C>T	ENSP00000308733:p.Val52Met	134.0	0.0		105.0	17.0	NM_194251	Q86SN8|Q8NGV2	Missense_Mutation	SNP	ENST00000311104.2	hg19	CCDS34266.1	.	.	.	.	.	.	.	.	.	.	C	11.11	1.542848	0.27563	.	.	ENSG00000173250	ENST00000311104	T	0.40225	1.04	5.99	0.66	0.17868	.	0.400813	0.25798	N	0.028236	T	0.31482	0.0798	L	0.54323	1.7	0.27329	N	0.956834	B	0.23806	0.091	B	0.17098	0.017	T	0.15983	-1.0418	10	0.37606	T	0.19	.	6.1039	0.20063	0.0:0.5202:0.2451:0.2347	.	52	Q8TDV0	GP151_HUMAN	M	52	ENSP00000308733:V52M	ENSP00000308733:V52M	V	-	1	0	GPR151	145875716	0.897000	0.30589	0.995000	0.50966	0.984000	0.73092	0.005000	0.13129	0.031000	0.15407	-0.345000	0.07892	GTG	.	C|1.000;G|0.000		0.552	GPR151-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373457.1	NM_194251	
CLK4	57396	hgsc.bcm.edu	37	5	178040784	178040784	+	Silent	SNP	A	A	T			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr5:178040784A>T	ENST00000316308.4	-	6	771	c.603T>A	c.(601-603)gcT>gcA	p.A201A		NM_020666.2	NP_065717.1	Q9HAZ1	CLK4_HUMAN	CDC-like kinase 4	201	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				protein autophosphorylation (GO:0046777)|regulation of RNA splicing (GO:0043484)	nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)			breast(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(10)|ovary(1)|prostate(1)|skin(2)	21	all_cancers(89;0.000969)|Renal(175;0.000159)|all_epithelial(37;0.000451)|Lung NSC(126;0.00545)|all_lung(126;0.00918)	all_cancers(40;0.0272)|all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.235)		TTTCTGAACGAGCTGCTTCAC	0.338																																					p.A201A		Atlas-SNP	.											.	CLK4	103	.	0			c.T603A						.						133.0	132.0	133.0					5																	178040784		2203	4300	6503	SO:0001819	synonymous_variant	57396	exon6			TGAACGAGCTGCT	AF294429	CCDS4437.1	5q35	2008-05-02			ENSG00000113240	ENSG00000113240		"""CDC-like kinases"""	13659	protein-coding gene	gene with protein product		607969				11170754	Standard	NM_020666		Approved		uc003mjf.1	Q9HAZ1	OTTHUMG00000130893	ENST00000316308.4:c.603T>A	chr5.hg19:g.178040784A>T		231.0	0.0		173.0	65.0	NM_020666		Silent	SNP	ENST00000316308.4	hg19	CCDS4437.1																																																																																			.	.		0.338	CLK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253479.2		
HIST1H3F	8968	hgsc.bcm.edu	37	6	26250628	26250628	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr6:26250628T>C	ENST00000446824.2	-	1	207	c.206A>G	c.(205-207)cAg>cGg	p.Q69R	HIST1H2BH_ENST00000356350.2_5'Flank	NM_021018.2	NP_066298.1	P68431	H31_HUMAN	histone cluster 1, H3f	69					blood coagulation (GO:0007596)|chromatin organization (GO:0006325)|DNA replication-dependent nucleosome assembly (GO:0006335)|regulation of gene silencing (GO:0060968)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)			lung(6)|urinary_tract(1)	7						TACCAGACGCTGGAATGGTAG	0.597											OREG0017241	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.Q69R		Atlas-SNP	.											.	HIST1H3F	16	.	0			c.A206G						.						124.0	123.0	123.0					6																	26250628		2203	4300	6503	SO:0001583	missense	8968	exon1			AGACGCTGGAATG	Z80786	CCDS4600.1	6p22.1	2011-01-27	2006-10-11	2003-03-14	ENSG00000256316	ENSG00000277775		"""Histones / Replication-dependent"""	4773	protein-coding gene	gene with protein product		602816	"""H3 histone family, member I"", ""histone 1, H3f"""	H3FI		9119399, 12408966	Standard	NM_021018		Approved	H3/i	uc003nhg.1	P68431	OTTHUMG00000014435	ENST00000446824.2:c.206A>G	chr6.hg19:g.26250628T>C	ENSP00000444823:p.Gln69Arg	191.0	1.0	785	194.0	104.0	NM_021018	A0PJT7|A5PLR1|P02295|P02296|P16106|Q6ISV8|Q6NWP8|Q6NWP9|Q6NXU4|Q71DJ3|Q93081	Missense_Mutation	SNP	ENST00000446824.2	hg19	CCDS4600.1	.	.	.	.	.	.	.	.	.	.	.	15.60	2.880807	0.51801	.	.	ENSG00000256316	ENST00000446824	T	0.67171	-0.25	4.82	4.82	0.62117	.	.	.	.	.	T	0.71273	0.3320	.	.	.	0.39988	D	0.975005	.	.	.	.	.	.	T	0.76639	-0.2885	6	0.87932	D	0	.	14.2481	0.66001	0.0:0.0:0.0:1.0	.	.	.	.	R	69	ENSP00000444823:Q69R	ENSP00000444823:Q69R	Q	-	2	0	HIST1H3F	26358607	1.000000	0.71417	1.000000	0.80357	0.299000	0.27559	6.007000	0.70731	2.103000	0.63969	0.459000	0.35465	CAG	.	.		0.597	HIST1H3F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040098.1	NM_021018	
HSPA1L	3305	hgsc.bcm.edu	37	6	31777908	31777908	+	Silent	SNP	T	T	C			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr6:31777908T>C	ENST00000375654.4	-	2	2031	c.1842A>G	c.(1840-1842)caA>caG	p.Q614Q	HSPA1L_ENST00000417199.3_Silent_p.Q614Q	NM_005527.3	NP_005518.3	P34931	HS71L_HUMAN	heat shock 70kDa protein 1-like	614					binding of sperm to zona pellucida (GO:0007339)|protein refolding (GO:0042026)|response to unfolded protein (GO:0006986)	blood microparticle (GO:0072562)|cell body (GO:0044297)|cytosol (GO:0005829)|mitochondrial matrix (GO:0005759)|zona pellucida receptor complex (GO:0002199)	ATP binding (GO:0005524)|unfolded protein binding (GO:0051082)			breast(1)|endometrium(3)|kidney(2)|large_intestine(10)|lung(10)|ovary(3)|pleura(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	34						TGCATCCTCCTTGGTAGAGTT	0.473																																					p.Q614Q		Atlas-SNP	.											.	HSPA1L	185	.	0			c.A1842G						.						114.0	104.0	107.0					6																	31777908		2203	4300	6503	SO:0001819	synonymous_variant	3305	exon2			TCCTCCTTGGTAG	D85730	CCDS34413.1	6p21.3	2014-01-21	2002-08-29		ENSG00000204390	ENSG00000204390		"""Heat shock proteins / HSP70"""	5234	protein-coding gene	gene with protein product		140559	"""heat shock 70kD protein-like 1"""			9685725, 9349405	Standard	NM_005527		Approved	HSP70-HOM, hum70t	uc003nxh.3	P34931	OTTHUMG00000031208	ENST00000375654.4:c.1842A>G	chr6.hg19:g.31777908T>C		217.0	0.0		413.0	120.0	NM_005527	A6NNB0|B0UXW8|O75634|Q2HXR3|Q8NE72|Q96QC9|Q9UQM1	Silent	SNP	ENST00000375654.4	hg19	CCDS34413.1																																																																																			.	.		0.473	HSPA1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076416.2		
CPNE5	57699	hgsc.bcm.edu	37	6	36712088	36712088	+	Silent	SNP	G	G	T			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr6:36712088G>T	ENST00000244751.2	-	19	2070	c.1446C>A	c.(1444-1446)ccC>ccA	p.P482P	CPNE5_ENST00000393189.2_Silent_p.P190P|CPNE5_ENST00000459703.1_5'UTR	NM_020939.1	NP_065990.1	Q9HCH3	CPNE5_HUMAN	copine V	482	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.					extracellular vesicular exosome (GO:0070062)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)				central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(4)|large_intestine(4)|liver(1)|lung(9)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	25						TGATGGACATGGGGAGCTTGG	0.597																																					p.P482P		Atlas-SNP	.											.	CPNE5	56	.	0			c.C1446A						.						62.0	43.0	50.0					6																	36712088		2198	4296	6494	SO:0001819	synonymous_variant	57699	exon19			GGACATGGGGAGC	H09181	CCDS4825.1	6p21.2	2010-05-28			ENSG00000124772	ENSG00000124772			2318	protein-coding gene	gene with protein product		604209				9430674	Standard	NM_020939		Approved	CPN5, COPN5, KIAA1599	uc003omr.1	Q9HCH3	OTTHUMG00000014602	ENST00000244751.2:c.1446C>A	chr6.hg19:g.36712088G>T		119.0	0.0		80.0	40.0	NM_020939	Q7Z6C8	Silent	SNP	ENST00000244751.2	hg19	CCDS4825.1																																																																																			.	.		0.597	CPNE5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040351.1	NM_020939	
DST	667	hgsc.bcm.edu	37	6	56480865	56480865	+	Missense_Mutation	SNP	C	C	T	rs200851382		TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr6:56480865C>T	ENST00000370765.6	-	24	7507	c.7400G>A	c.(7399-7401)cGt>cAt	p.R2467H	DST_ENST00000446842.2_Intron|DST_ENST00000312431.6_Intron|DST_ENST00000370754.5_Intron|DST_ENST00000370769.4_Intron|DST_ENST00000421834.2_Intron|DST_ENST00000361203.3_Intron|DST_ENST00000244364.6_Intron|DST_ENST00000370788.2_Intron	NM_001723.5	NP_001714.1	Q03001	DYST_HUMAN	dystonin	1763					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cytoplasmic microtubule organization (GO:0031122)|cytoskeleton organization (GO:0007010)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|maintenance of cell polarity (GO:0030011)|microtubule cytoskeleton organization (GO:0000226)|regulation of microtubule polymerization or depolymerization (GO:0031110)|response to wounding (GO:0009611)|retrograde axon cargo transport (GO:0008090)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integral component of membrane (GO:0016021)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|neurofilament cytoskeleton (GO:0060053)|nucleus (GO:0005634)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|microtubule plus-end binding (GO:0051010)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)			NS(1)|breast(5)|central_nervous_system(8)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(43)|ovary(7)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	105	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			CAAATTTCTACGGGAGGCTTT	0.498																																					p.R2467H		Atlas-SNP	.											.	DST	1427	.	0			c.G7400A						.						61.0	66.0	64.0					6																	56480865		2203	4300	6503	SO:0001583	missense	667	exon24			TTTCTACGGGAGG	M22942, M69225	CCDS4959.1, CCDS47443.1, CCDS75474.1	6p12.1	2013-01-10	2004-06-25	2004-07-01	ENSG00000151914	ENSG00000151914		"""EF-hand domain containing"""	1090	protein-coding gene	gene with protein product		113810	"""bullous pemphigoid antigen 1, 230/240kDa"""	BPAG1		2461961, 2276744	Standard	NM_001144770		Approved	BP240, KIAA0728, FLJ21489, FLJ13425, FLJ32235, FLJ30627, CATX-15, BPA, MACF2	uc021zba.2	Q03001	OTTHUMG00000014913	ENST00000370765.6:c.7400G>A	chr6.hg19:g.56480865C>T	ENSP00000359801:p.Arg2467His	112.0	0.0		122.0	30.0	NM_001723	B7Z3H1|O94833|Q12825|Q13266|Q13267|Q13775|Q5TBT0|Q5TBT2|Q5TF23|Q5TF24|Q8N1T8|Q8N8J3|Q8WXK8|Q8WXK9|Q96AK9|Q96DQ5|Q96J76|Q96QT5|Q9H555|Q9UGD7|Q9UGD8|Q9UN10	Missense_Mutation	SNP	ENST00000370765.6	hg19	CCDS4959.1	.	.	.	.	.	.	.	.	.	.	C	9.092	1.001920	0.19121	.	.	ENSG00000151914	ENST00000370765	T	0.69685	-0.42	5.94	5.94	0.96194	.	.	.	.	.	T	0.30665	0.0772	.	.	.	0.18873	N	0.999989	P	0.41929	0.765	B	0.35727	0.209	T	0.50320	-0.8842	7	0.02654	T	1	.	20.3593	0.98849	0.0:1.0:0.0:0.0	.	2467	Q03001-3	.	H	2467	ENSP00000359801:R2467H	ENSP00000359801:R2467H	R	-	2	0	DST	56588824	1.000000	0.71417	0.967000	0.41034	0.948000	0.59901	5.745000	0.68672	2.822000	0.97130	0.557000	0.71058	CGT	.	C|0.999;T|0.001		0.498	DST-010	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000041027.2	NM_001723	
RIMS1	22999	hgsc.bcm.edu	37	6	72968729	72968729	+	Missense_Mutation	SNP	C	C	A			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr6:72968729C>A	ENST00000521978.1	+	18	2968	c.2968C>A	c.(2968-2970)Cca>Aca	p.P990T	RIMS1_ENST00000401910.3_Missense_Mutation_p.P463T|RIMS1_ENST00000522291.1_Missense_Mutation_p.P989T|RIMS1_ENST00000264839.7_Missense_Mutation_p.P990T|RIMS1_ENST00000425662.2_Missense_Mutation_p.P383T|RIMS1_ENST00000523963.1_Missense_Mutation_p.P464T|RIMS1_ENST00000538414.1_5'UTR|RIMS1_ENST00000348717.5_Missense_Mutation_p.P989T|RIMS1_ENST00000517960.1_Missense_Mutation_p.P989T|RIMS1_ENST00000520567.1_Missense_Mutation_p.P989T|RIMS1_ENST00000518273.1_Missense_Mutation_p.P990T|RIMS1_ENST00000491071.2_Missense_Mutation_p.P990T|RIMS1_ENST00000517827.1_Missense_Mutation_p.P449T	NM_014989.5	NP_055804.2	Q86UR5	RIMS1_HUMAN	regulating synaptic membrane exocytosis 1	990					calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|glutamate secretion (GO:0014047)|intracellular protein transport (GO:0006886)|membrane fusion (GO:0061025)|neurotransmitter secretion (GO:0007269)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of gene expression (GO:0010628)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|protein complex assembly (GO:0006461)|regulated secretory pathway (GO:0045055)|regulation of catalytic activity (GO:0050790)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of neurotransmitter secretion (GO:0046928)|response to stimulus (GO:0050896)|secretion (GO:0046903)|synaptic transmission (GO:0007268)|synaptic vesicle exocytosis (GO:0016079)|visual perception (GO:0007601)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|Rab GTPase binding (GO:0017137)|small GTPase regulator activity (GO:0005083)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(25)|liver(4)|lung(35)|ovary(9)|pancreas(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	102		all_epithelial(107;0.179)|all_hematologic(105;0.212)				GTCACGTTCTCCAACCAGACA	0.378																																					p.P990T		Atlas-SNP	.											.	RIMS1	278	.	0			c.C2968A						.						137.0	137.0	137.0					6																	72968729		1944	4129	6073	SO:0001583	missense	22999	exon18			CGTTCTCCAACCA	AB002338	CCDS47449.1, CCDS55029.1, CCDS55030.1, CCDS55031.1, CCDS55032.1, CCDS55033.1	6q12-q13	2008-10-16	2002-06-12	2002-06-14	ENSG00000079841	ENSG00000079841			17282	protein-coding gene	gene with protein product	"""Rab3-interacting molecule"""	606629	"""RAB3 interacting protein 2"""	RAB3IP2, CORD7		9205841, 11438518	Standard	NM_001168407		Approved	RIM, KIAA0340, RIM1	uc003pga.4	Q86UR5	OTTHUMG00000015009	ENST00000521978.1:c.2968C>A	chr6.hg19:g.72968729C>A	ENSP00000428417:p.Pro990Thr	98.0	0.0		104.0	41.0	NM_014989	A7MBN6|B7Z2M0|B7Z2Q9|B7Z3S3|B7Z6S2|E7EX08|E9PCB7|E9PCZ1|E9PF48|E9PHF5|E9PHR1|O15048|Q5JY21|Q5JY25|Q5SZK1|Q8TDY9|Q8TDZ5|Q9HBA1|Q9HBA2|Q9HBA3|Q9HBA4|Q9HBA5|Q9HBA6	Missense_Mutation	SNP	ENST00000521978.1	hg19	CCDS47449.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	14.53|14.53	2.561642|2.561642	0.45590|0.45590	.|.	.|.	ENSG00000079841|ENSG00000079841	ENST00000491071;ENST00000350827;ENST00000352008;ENST00000348717;ENST00000349908;ENST00000346609;ENST00000264839;ENST00000517960;ENST00000518273;ENST00000520567;ENST00000522291;ENST00000521978;ENST00000401910;ENST00000523963;ENST00000425662;ENST00000453976;ENST00000517827;ENST00000370420|ENST00000517433	T;T;T;T;T;T;T;T;T;T;T;T;T;T|T	0.17370|0.15952	2.56;2.7;2.57;2.7;2.7;2.72;2.65;2.54;2.7;2.74;2.68;2.49;2.68;2.28|2.38	5.41|5.41	5.41|5.41	0.78517|0.78517	.|.	0.000000|.	0.64402|.	D|.	0.000005|.	T|T	0.27169|0.27169	0.0666|0.0666	L|L	0.54323|0.54323	1.7|1.7	0.80722|0.80722	D|D	1|1	B;D;D;P;B;B;B;B;D;B;D;D|.	0.89917|.	0.012;0.998;1.0;0.584;0.021;0.434;0.001;0.069;0.999;0.063;1.0;0.999|.	B;D;D;B;B;B;B;B;D;B;D;D|.	0.87578|.	0.005;0.981;0.998;0.113;0.015;0.417;0.001;0.032;0.991;0.05;0.998;0.993|.	T|T	0.00837|0.00837	-1.1546|-1.1546	10|7	0.15066|0.87932	T|D	0.55|0	-15.6514|-15.6514	19.5526|19.5526	0.95328|0.95328	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	449;464;990;449;463;989;242;990;989;243;990;990|.	B7Z3S3;E9PHF5;E9PHR1;B7Z9Z3;E9PF48;E7EX08;Q5JY22;E7ERQ1;E7ENC2;Q5JY21;C9JNW6;Q86UR5|.	.;.;.;.;.;.;.;.;.;.;.;RIMS1_HUMAN|.	T|Y	990;990;990;989;990;989;990;989;990;989;989;990;463;464;383;383;449;215|563	ENSP00000430101:P990T;ENSP00000275037:P989T;ENSP00000264839:P990T;ENSP00000429959:P989T;ENSP00000430408:P990T;ENSP00000430502:P989T;ENSP00000430932:P989T;ENSP00000428417:P990T;ENSP00000385649:P463T;ENSP00000428328:P464T;ENSP00000411235:P383T;ENSP00000389503:P383T;ENSP00000428367:P449T;ENSP00000359448:P215T|ENSP00000430359:S563Y	ENSP00000264839:P990T|ENSP00000430359:S563Y	P|S	+|+	1|2	0|0	RIMS1|RIMS1	73025450|73025450	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	5.610000|5.610000	0.67668|0.67668	2.701000|2.701000	0.92244|0.92244	0.563000|0.563000	0.77884|0.77884	CCA|TCC	.	.		0.378	RIMS1-011	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374968.1		
SYNE1	23345	hgsc.bcm.edu	37	6	152583243	152583243	+	Missense_Mutation	SNP	C	C	A			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr6:152583243C>A	ENST00000367255.5	-	101	19497	c.18896G>T	c.(18895-18897)tGg>tTg	p.W6299L	SYNE1_ENST00000448038.1_Missense_Mutation_p.W6228L|SYNE1_ENST00000341594.5_Missense_Mutation_p.W5911L|SYNE1_ENST00000265368.4_Missense_Mutation_p.W6299L|SYNE1_ENST00000423061.1_Missense_Mutation_p.W6228L|SYNE1_ENST00000356820.4_Missense_Mutation_p.W823L	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	6299					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		TAGGCTTTCCCATTTCATTCT	0.373										HNSCC(10;0.0054)																											p.W6299L		Atlas-SNP	.											.	SYNE1	3227	.	0			c.G18896T						.						157.0	144.0	148.0					6																	152583243		2203	4300	6503	SO:0001583	missense	23345	exon101			CTTTCCCATTTCA	AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.18896G>T	chr6.hg19:g.152583243C>A	ENSP00000356224:p.Trp6299Leu	238.0	0.0		212.0	49.0	NM_182961	E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Missense_Mutation	SNP	ENST00000367255.5	hg19	CCDS5236.2	.	.	.	.	.	.	.	.	.	.	C	29.2	4.982397	0.93044	.	.	ENSG00000131018	ENST00000367255;ENST00000423061;ENST00000265368;ENST00000448038;ENST00000341594;ENST00000356820	D;D;D;D;D;T	0.86865	-2.09;-2.12;-2.18;-2.1;-1.56;0.05	5.96	5.96	0.96718	.	0.000000	0.56097	D	0.000035	D	0.92198	0.7526	M	0.72894	2.215	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.999	D	0.89072	0.3470	10	0.32370	T	0.25	.	20.4192	0.99033	0.0:1.0:0.0:0.0	.	6299;6299;6228	Q8NF91;E7EQI5;Q8NF91-4	SYNE1_HUMAN;.;.	L	6299;6228;6299;6228;5911;823	ENSP00000356224:W6299L;ENSP00000396024:W6228L;ENSP00000265368:W6299L;ENSP00000390975:W6228L;ENSP00000341887:W5911L;ENSP00000349276:W823L	ENSP00000265368:W6299L	W	-	2	0	SYNE1	152624936	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.439000	0.73430	2.831000	0.97527	0.650000	0.86243	TGG	.	.		0.373	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000334755.2	NM_182961	
HGF	3082	hgsc.bcm.edu	37	7	81339555	81339556	+	Missense_Mutation	DNP	GG	GG	TT	rs375872396		TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr7:81339555_81339556GG>TT	ENST00000222390.5	-	13	1674_1675	c.1448_1449CC>AA	c.(1447-1449)cCC>cAA	p.P483Q	HGF_ENST00000457544.2_Missense_Mutation_p.P478Q	NM_000601.4	NP_000592.3	P14210	HGF_HUMAN	hepatocyte growth factor (hepapoietin A; scatter factor)	483					activation of MAPK activity (GO:0000187)|blood coagulation (GO:0007596)|cell chemotaxis (GO:0060326)|cellular response to hepatocyte growth factor stimulus (GO:0035729)|epithelial to mesenchymal transition (GO:0001837)|hepatocyte growth factor receptor signaling pathway (GO:0048012)|hyaluronan metabolic process (GO:0030212)|liver development (GO:0001889)|mitotic nuclear division (GO:0007067)|myoblast proliferation (GO:0051450)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of hydrogen peroxide-mediated programmed cell death (GO:1901299)|negative regulation of release of cytochrome c from mitochondria (GO:0090201)|organ regeneration (GO:0031100)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive chemotaxis (GO:0050918)|positive regulation of cell migration (GO:0030335)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of branching involved in salivary gland morphogenesis by mesenchymal-epithelial signaling (GO:0060665)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)|platelet alpha granule lumen (GO:0031093)	catalytic activity (GO:0003824)|chemoattractant activity (GO:0042056)|growth factor activity (GO:0008083)|identical protein binding (GO:0042802)			NS(2)|breast(1)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|liver(2)|lung(41)|ovary(2)|prostate(2)|skin(6)|urinary_tract(1)	75						AAGATATTACGGGATCTGAAAC	0.317																																					p.P483P|p.P483H		Atlas-SNP	.											.	HGF	171	.	0			c.C1449A|c.C1448A						.																																			SO:0001583	missense	3082	exon13			TATTACGGGATCT|ATTACGGGATCTG		CCDS5597.1, CCDS47626.1, CCDS47627.1, CCDS47628.1, CCDS47629.1	7q21.1	2009-09-11			ENSG00000019991	ENSG00000019991			4893	protein-coding gene	gene with protein product	"""hepatopoietin A"", ""fibroblast-derived tumor cytotoxic factor"", ""scatter factor"", ""lung fibroblast-derived mitogen"""	142409	"""deafness, autosomal recessive 39"""	DFNB39		1837206, 19576567	Standard	XM_006715956		Approved	SF, F-TCF, HGFB, HPTA	uc003uhl.3	P14210	OTTHUMG00000023804	ENST00000222390.5:c.1448_1449delinsTT	chr7.hg19:g.81339555_81339556delinsTT	ENSP00000222390:p.Pro483Gln	197.0|194.0	0.0		126.0|124.0	58.0|59.0	NM_000601	A1L3U6|Q02935|Q13494|Q14519|Q3KRB2|Q8TCE2|Q9BYL9|Q9BYM0|Q9UDU6	Silent|Missense_Mutation	SNP	ENST00000222390.5	hg19	CCDS5597.1																																																																																			.	.		0.317	HGF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253315.2	NM_000601	
PLXNA4	91584	hgsc.bcm.edu	37	7	131912231	131912231	+	Missense_Mutation	SNP	G	G	A	rs533775501		TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr7:131912231G>A	ENST00000359827.3	-	7	2823	c.1861C>T	c.(1861-1863)Ccc>Tcc	p.P621S	PLXNA4_ENST00000321063.4_Missense_Mutation_p.P621S			Q9HCM2	PLXA4_HUMAN	plexin A4	621					anterior commissure morphogenesis (GO:0021960)|axon guidance (GO:0007411)|chemorepulsion of branchiomotor axon (GO:0021793)|facial nerve structural organization (GO:0021612)|glossopharyngeal nerve morphogenesis (GO:0021615)|postganglionic parasympathetic nervous system development (GO:0021784)|regulation of axon extension involved in axon guidance (GO:0048841)|regulation of negative chemotaxis (GO:0050923)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|sympathetic nervous system development (GO:0048485)|trigeminal nerve structural organization (GO:0021637)|vagus nerve morphogenesis (GO:0021644)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	semaphorin receptor activity (GO:0017154)			NS(1)|breast(1)|endometrium(3)|kidney(4)|large_intestine(14)|lung(17)|ovary(1)|prostate(2)|skin(1)|stomach(1)	45						ATGATCCGGGGCACCTCCTTG	0.582																																					p.P621S		Atlas-SNP	.											.	PLXNA4	873	.	0			c.C1861T						.						64.0	68.0	66.0					7																	131912231		2078	4217	6295	SO:0001583	missense	91584	exon7			TCCGGGGCACCTC	AB046770, AK123428	CCDS5826.1, CCDS43646.1, CCDS43647.1	7q32.3	2007-09-26	2007-09-26	2007-09-26	ENSG00000221866	ENSG00000221866		"""Plexins"""	9102	protein-coding gene	gene with protein product		604280	"""plexin A4, A"", ""plexin A4, B"""	PLXNA4A, PLXNA4B			Standard	NM_181775		Approved	KIAA1550, DKFZp434G0625PRO34003, FAYV2820	uc003vra.4	Q9HCM2	OTTHUMG00000155108	ENST00000359827.3:c.1861C>T	chr7.hg19:g.131912231G>A	ENSP00000352882:p.Pro621Ser	115.0	0.0		46.0	21.0	NM_020911	A4D1N6|E9PAM2|Q6UWC6|Q6ZW89|Q8N969|Q8ND00|Q8NEN3|Q9NTD4	Missense_Mutation	SNP	ENST00000359827.3	hg19	CCDS43646.1	.	.	.	.	.	.	.	.	.	.	G	21.9	4.211224	0.79240	.	.	ENSG00000221866	ENST00000321063;ENST00000359827	T;T	0.01192	5.2;5.2	5.73	5.73	0.89815	.	0.000000	0.85682	D	0.000000	T	0.02571	0.0078	L	0.56340	1.77	0.80722	D	1	B	0.29212	0.237	B	0.32149	0.141	T	0.55927	-0.8063	10	0.66056	D	0.02	.	19.9025	0.96993	0.0:0.0:1.0:0.0	.	621	Q9HCM2	PLXA4_HUMAN	S	621	ENSP00000323194:P621S;ENSP00000352882:P621S	ENSP00000323194:P621S	P	-	1	0	PLXNA4	131562771	1.000000	0.71417	1.000000	0.80357	0.709000	0.40893	6.351000	0.73022	2.722000	0.93159	0.655000	0.94253	CCC	.	.		0.582	PLXNA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338422.2	NM_181775	
RP1L1	94137	hgsc.bcm.edu	37	8	10467732	10467732	+	Missense_Mutation	SNP	T	T	A			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr8:10467732T>A	ENST00000382483.3	-	4	4099	c.3876A>T	c.(3874-3876)ttA>ttT	p.L1292F		NM_178857.5	NP_849188.4	Q8IWN7	RP1L1_HUMAN	retinitis pigmentosa 1-like 1	1292	8 X 16 AA approximate tandem repeats of T-E-E-G-L-Q-E-E-G-V-Q-L-E-E-T-K.				cell projection organization (GO:0030030)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|visual perception (GO:0007601)	axoneme (GO:0005930)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|photoreceptor connecting cilium (GO:0032391)|photoreceptor outer segment (GO:0001750)				breast(5)|central_nervous_system(2)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(16)|lung(82)|ovary(8)|prostate(5)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(3)	148				COAD - Colon adenocarcinoma(149;0.0811)		TGTTTTCAGCTAACTGCTCCA	0.512																																					p.L1292F		Atlas-SNP	.											.	RP1L1	453	.	0			c.A3876T						.						174.0	170.0	171.0					8																	10467732		2043	4197	6240	SO:0001583	missense	94137	exon4			TTCAGCTAACTGC	AY168346	CCDS43708.1	8p23.1	2011-12-06			ENSG00000183638	ENSG00000183638			15946	protein-coding gene	gene with protein product		608581				12634863	Standard	NM_178857		Approved	DCDC4B	uc003wtc.3	Q8IWN7	OTTHUMG00000163806	ENST00000382483.3:c.3876A>T	chr8.hg19:g.10467732T>A	ENSP00000371923:p.Leu1292Phe	132.0	0.0		49.0	26.0	NM_178857	Q86SQ1|Q8IWN8|Q8IWN9|Q8IWP0|Q8IWP1|Q8IWP2	Missense_Mutation	SNP	ENST00000382483.3	hg19	CCDS43708.1	.	.	.	.	.	.	.	.	.	.	T	5.704	0.314484	0.10789	.	.	ENSG00000183638	ENST00000382483	T	0.04406	3.63	4.08	-8.17	0.01057	.	1.971510	0.03439	N	0.209094	T	0.02230	0.0069	N	0.08118	0	0.09310	N	1	B	0.18461	0.028	B	0.14023	0.01	T	0.42766	-0.9432	10	0.52906	T	0.07	6.4955	2.7625	0.05311	0.1113:0.3826:0.2254:0.2808	.	1292	A6NKC6	.	F	1292	ENSP00000371923:L1292F	ENSP00000371923:L1292F	L	-	3	2	RP1L1	10505142	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.375000	0.02563	-1.498000	0.01824	-1.144000	0.01866	TTA	.	.		0.512	RP1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375673.1		
ZFHX4	79776	hgsc.bcm.edu	37	8	77618337	77618337	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr8:77618337G>A	ENST00000521891.2	+	2	2462	c.2014G>A	c.(2014-2016)Ggc>Agc	p.G672S	ZFHX4_ENST00000517683.1_Intron|ZFHX4_ENST00000518282.1_Missense_Mutation_p.G672S|ZFHX4_ENST00000050961.6_Missense_Mutation_p.G672S|ZFHX4_ENST00000455469.2_Missense_Mutation_p.G672S	NM_024721.4	NP_078997.4	Q86UP3	ZFHX4_HUMAN	zinc finger homeobox 4	672					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)	p.G672C(1)		NS(3)|breast(11)|central_nervous_system(1)|endometrium(36)|haematopoietic_and_lymphoid_tissue(2)|kidney(15)|large_intestine(66)|liver(2)|lung(245)|ovary(11)|pancreas(3)|prostate(11)|skin(7)|upper_aerodigestive_tract(13)|urinary_tract(6)	432			BRCA - Breast invasive adenocarcinoma(89;0.0895)			TGAGCCGGGTGGCTCTTGTGT	0.498										HNSCC(33;0.089)																											p.G672S		Atlas-SNP	.											ZFHX4,NS,carcinoma,0,1	ZFHX4	878	.	1	Substitution - Missense(1)	lung(1)	c.G2014A						.						49.0	54.0	52.0					8																	77618337		1998	4193	6191	SO:0001583	missense	79776	exon2			CCGGGTGGCTCTT		CCDS47878.1, CCDS47878.2	8q21.11	2012-07-02	2007-07-16		ENSG00000091656	ENSG00000091656		"""Homeoboxes / ZF class"""	30939	protein-coding gene	gene with protein product		606940	"""zinc finger homeodomain 4"""			10873665, 11935336	Standard	NM_024721		Approved	ZFH4, FLJ20980	uc003yau.2	Q86UP3	OTTHUMG00000164557	ENST00000521891.2:c.2014G>A	chr8.hg19:g.77618337G>A	ENSP00000430497:p.Gly672Ser	96.0	0.0		52.0	8.0	NM_024721	G3V138|Q18PS0|Q6ZN20	Missense_Mutation	SNP	ENST00000521891.2	hg19	CCDS47878.2	.	.	.	.	.	.	.	.	.	.	G	18.19	3.570096	0.65765	.	.	ENSG00000091656	ENST00000521891;ENST00000399468;ENST00000455469;ENST00000050961;ENST00000518282	T;T;T;T	0.50813	0.73;0.8;0.77;0.76	5.3	5.3	0.74995	.	0.000000	0.45361	U	0.000367	T	0.58133	0.2101	L	0.41236	1.265	0.80722	D	1	D;D;D;B	0.69078	0.996;0.997;0.997;0.328	P;D;D;B	0.68353	0.907;0.957;0.957;0.413	T	0.45175	-0.9279	10	0.12430	T	0.62	.	19.15	0.93483	0.0:0.0:1.0:0.0	.	672;672;672;672	Q86UP3;Q86UP3-4;G3V138;Q86UP3-3	ZFHX4_HUMAN;.;.;.	S	672	ENSP00000430497:G672S;ENSP00000399605:G672S;ENSP00000050961:G672S;ENSP00000430848:G672S	ENSP00000050961:G672S	G	+	1	0	ZFHX4	77780892	1.000000	0.71417	0.968000	0.41197	0.996000	0.88848	9.657000	0.98554	2.750000	0.94351	0.655000	0.94253	GGC	.	.		0.498	ZFHX4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000379197.2	NM_024721	
GSDMC	56169	hgsc.bcm.edu	37	8	130777987	130777987	+	Missense_Mutation	SNP	C	C	G			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr8:130777987C>G	ENST00000276708.4	-	4	1338	c.457G>C	c.(457-459)Gac>Cac	p.D153H		NM_031415.2	NP_113603.1	Q9BYG8	GSDMC_HUMAN	gasdermin C	153						cytoplasm (GO:0005737)|microtubule organizing center (GO:0005815)|mitochondrion (GO:0005739)				autonomic_ganglia(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(5)|ovary(2)|pancreas(1)|skin(5)|stomach(2)|upper_aerodigestive_tract(1)	26						TACAGGTTGTCCCCTCTCCTC	0.468																																					p.D153H		Atlas-SNP	.											.	GSDMC	71	.	0			c.G457C						.						96.0	88.0	91.0					8																	130777987		2203	4300	6503	SO:0001583	missense	56169	exon4			GGTTGTCCCCTCT	AB042405	CCDS6360.1	8q24.21	2014-05-14	2008-07-31	2008-07-31	ENSG00000147697	ENSG00000147697			7151	protein-coding gene	gene with protein product		608384	"""melanoma-derived leucine zipper, extra-nuclear factor"""	MLZE		17350798	Standard	NM_031415		Approved		uc003ysr.3	Q9BYG8	OTTHUMG00000164851	ENST00000276708.4:c.457G>C	chr8.hg19:g.130777987C>G	ENSP00000276708:p.Asp153His	110.0	0.0		53.0	18.0	NM_031415	Q5XKF3|Q6P494	Missense_Mutation	SNP	ENST00000276708.4	hg19	CCDS6360.1	.	.	.	.	.	.	.	.	.	.	C	9.544	1.114025	0.20795	.	.	ENSG00000147697	ENST00000276708	T	0.26660	1.72	4.51	0.607	0.17564	.	1.441670	0.04076	N	0.308803	T	0.22936	0.0554	L	0.39147	1.195	0.09310	N	1	B	0.30068	0.267	B	0.30646	0.118	T	0.27938	-1.0059	10	0.46703	T	0.11	.	6.3838	0.21550	0.0:0.5506:0.0:0.4494	.	153	Q9BYG8	GSDMC_HUMAN	H	153	ENSP00000276708:D153H	ENSP00000276708:D153H	D	-	1	0	GSDMC	130847169	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.393000	0.07305	-0.071000	0.12886	0.591000	0.81541	GAC	.	.		0.468	GSDMC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380586.1		
VPS13A	23230	hgsc.bcm.edu	37	9	79824389	79824389	+	Nonsense_Mutation	SNP	C	C	T			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr9:79824389C>T	ENST00000360280.3	+	6	696	c.436C>T	c.(436-438)Cag>Tag	p.Q146*	VPS13A_ENST00000357409.5_Nonsense_Mutation_p.Q146*|VPS13A_ENST00000376634.4_Nonsense_Mutation_p.Q146*|VPS13A_ENST00000376636.3_Nonsense_Mutation_p.Q146*	NM_033305.2	NP_150648.2	Q96RL7	VP13A_HUMAN	vacuolar protein sorting 13 homolog A (S. cerevisiae)	146					cell death (GO:0008219)|Golgi to endosome transport (GO:0006895)|locomotory behavior (GO:0007626)|nervous system development (GO:0007399)|protein localization (GO:0008104)|protein transport (GO:0015031)|social behavior (GO:0035176)	dense core granule (GO:0031045)|intracellular (GO:0005622)				breast(4)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(28)|liver(1)|lung(42)|ovary(3)|pancreas(3)|prostate(3)|skin(9)|upper_aerodigestive_tract(1)|urinary_tract(1)	104						ATTAGTTACACAGATCATAAA	0.254																																					p.Q146X		Atlas-SNP	.											.	VPS13A	735	.	0			c.C436T						.						38.0	40.0	39.0					9																	79824389		2203	4290	6493	SO:0001587	stop_gained	23230	exon6			GTTACACAGATCA	AB023203	CCDS6655.1, CCDS6656.1, CCDS47983.1, CCDS55321.1	9q21	2014-01-30	2006-04-04	2004-02-11	ENSG00000197969	ENSG00000197969			1908	protein-coding gene	gene with protein product	"""chorein"""	605978	"""chorea acanthocytosis"", ""vacuolar protein sorting 13A (yeast)"""	CHAC		9382101, 11381253	Standard	NM_001018038		Approved	KIAA0986	uc004akr.3	Q96RL7	OTTHUMG00000020055	ENST00000360280.3:c.436C>T	chr9.hg19:g.79824389C>T	ENSP00000353422:p.Gln146*	332.0	0.0		233.0	127.0	NM_001018038	Q5JSX9|Q5JSY0|Q5VYR5|Q702P4|Q709D0|Q86YF8|Q96S61|Q9H995|Q9Y2J1	Nonsense_Mutation	SNP	ENST00000360280.3	hg19	CCDS6655.1	.	.	.	.	.	.	.	.	.	.	C	38	6.912853	0.97928	.	.	ENSG00000197969	ENST00000376634;ENST00000376636;ENST00000360280;ENST00000357409	.	.	.	5.71	5.71	0.89125	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	19.4521	0.94872	0.0:1.0:0.0:0.0	.	.	.	.	X	146	.	ENSP00000349985:Q146X	Q	+	1	0	VPS13A	79014209	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.182000	0.77689	2.703000	0.92315	0.655000	0.94253	CAG	.	.		0.254	VPS13A-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000052753.2	NM_015186	
GRIN3A	116443	hgsc.bcm.edu	37	9	104449365	104449365	+	Missense_Mutation	SNP	C	C	A			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr9:104449365C>A	ENST00000361820.3	-	2	1417	c.817G>T	c.(817-819)Gac>Tac	p.D273Y		NM_133445.2	NP_597702.2	Q8TCU5	NMD3A_HUMAN	glutamate receptor, ionotropic, N-methyl-D-aspartate 3A	273					calcium ion transport (GO:0006816)|dendrite development (GO:0016358)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|prepulse inhibition (GO:0060134)|response to ethanol (GO:0045471)|rhythmic process (GO:0048511)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glycine binding (GO:0016594)|identical protein binding (GO:0042802)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|neurotransmitter binding (GO:0042165)|protein phosphatase 2A binding (GO:0051721)			breast(2)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(12)|lung(44)|ovary(4)|pancreas(1)|skin(7)|upper_aerodigestive_tract(1)	80		Acute lymphoblastic leukemia(62;0.0568)			Acamprosate(DB00659)|Acetylcysteine(DB06151)|Amantadine(DB00915)|Atomoxetine(DB00289)|Chloroprocaine(DB01161)|Dextromethorphan(DB00514)|Ethanol(DB00898)|Ethopropazine(DB00392)|Felbamate(DB00949)|Gabapentin(DB00996)|Halothane(DB01159)|Ketamine(DB01221)|Ketobemidone(DB06738)|Memantine(DB01043)|Methadone(DB00333)|Milnacipran(DB04896)|Orphenadrine(DB01173)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Procaine(DB00721)|Secobarbital(DB00418)|Tramadol(DB00193)	ATGTTCCAGTCTTCCTGGCAC	0.448																																					p.D273Y		Atlas-SNP	.											.	GRIN3A	186	.	0			c.G817T						.						134.0	122.0	126.0					9																	104449365		2203	4300	6503	SO:0001583	missense	116443	exon2			TCCAGTCTTCCTG		CCDS6758.1	9q31.1	2012-08-29			ENSG00000198785	ENSG00000198785		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	16767	protein-coding gene	gene with protein product		606650					Standard	NM_133445		Approved	GluN3A	uc004bbp.2	Q8TCU5	OTTHUMG00000020387	ENST00000361820.3:c.817G>T	chr9.hg19:g.104449365C>A	ENSP00000355155:p.Asp273Tyr	258.0	0.0		212.0	77.0	NM_133445	B3DLF9|Q5VTR3|Q8TF29|Q8WXI6	Missense_Mutation	SNP	ENST00000361820.3	hg19	CCDS6758.1	.	.	.	.	.	.	.	.	.	.	C	18.65	3.670461	0.67814	.	.	ENSG00000198785	ENST00000361820	D	0.88896	-2.44	5.82	5.82	0.92795	.	0.350421	0.31821	N	0.007002	D	0.84897	0.5574	L	0.44542	1.39	0.58432	D	0.999999	P	0.34780	0.468	B	0.32864	0.154	T	0.81693	-0.0817	10	0.11182	T	0.66	.	20.1178	0.97943	0.0:1.0:0.0:0.0	.	273	Q8TCU5	NMD3A_HUMAN	Y	273	ENSP00000355155:D273Y	ENSP00000355155:D273Y	D	-	1	0	GRIN3A	103489186	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.495000	0.66912	2.759000	0.94783	0.557000	0.71058	GAC	.	.		0.448	GRIN3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053453.1		
ADAMTSL2	9719	hgsc.bcm.edu	37	9	136402628	136402628	+	Silent	SNP	G	G	A			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr9:136402628G>A	ENST00000354484.4	+	3	749	c.192G>A	c.(190-192)ggG>ggA	p.G64G	ADAMTSL2_ENST00000393060.1_Silent_p.G64G|ADAMTSL2_ENST00000393061.3_Silent_p.G173G	NM_001145320.1	NP_001138792.1	Q86TH1	ATL2_HUMAN	ADAMTS-like 2	64	TSP type-1 1. {ECO:0000255|PROSITE- ProRule:PRU00210}.				negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)	proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			kidney(2)|large_intestine(2)|lung(7)|ovary(2)|urinary_tract(1)	14				OV - Ovarian serous cystadenocarcinoma(145;9.31e-08)|Epithelial(140;6.62e-07)|all cancers(34;7.74e-06)		GCAGTTGCGGGGGTGGGGTGA	0.677																																					p.G64G		Atlas-SNP	.											.	ADAMTSL2	40	.	0			c.G192A						.						33.0	38.0	37.0					9																	136402628		2201	4298	6499	SO:0001819	synonymous_variant	9719	exon3			TTGCGGGGGTGGG	AB011177	CCDS6976.1	9q34.3	2005-01-12			ENSG00000197859	ENSG00000197859			14631	protein-coding gene	gene with protein product		612277				9628581, 14667842	Standard	NM_014694		Approved	KIAA0605	uc004cei.3	Q86TH1	OTTHUMG00000131706	ENST00000354484.4:c.192G>A	chr9.hg19:g.136402628G>A		115.0	0.0		60.0	25.0	NM_014694	B1B0D5|O60345	Silent	SNP	ENST00000354484.4	hg19	CCDS6976.1																																																																																			.	.		0.677	ADAMTSL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254619.1	NM_014694	
AKR1C1	1645	hgsc.bcm.edu	37	10	5009199	5009199	+	Silent	SNP	T	T	C			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr10:5009199T>C	ENST00000380872.4	+	3	525	c.333T>C	c.(331-333)gtT>gtC	p.V111V	AKR1C1_ENST00000380859.1_Silent_p.V113V|AKR1C1_ENST00000434459.2_Silent_p.V111V|AKR1C1_ENST00000477661.1_3'UTR	NM_001353.5	NP_001344.2	Q04828	AK1C1_HUMAN	aldo-keto reductase family 1, member C1	111					bile acid and bile salt transport (GO:0015721)|bile acid metabolic process (GO:0008206)|cellular response to jasmonic acid stimulus (GO:0071395)|cholesterol homeostasis (GO:0042632)|daunorubicin metabolic process (GO:0044597)|digestion (GO:0007586)|doxorubicin metabolic process (GO:0044598)|epithelial cell differentiation (GO:0030855)|intestinal cholesterol absorption (GO:0030299)|oxidation-reduction process (GO:0055114)|phototransduction, visible light (GO:0007603)|progesterone metabolic process (GO:0042448)|protein homooligomerization (GO:0051260)|response to organophosphorus (GO:0046683)|retinal metabolic process (GO:0042574)|retinoid metabolic process (GO:0001523)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	17-alpha,20-alpha-dihydroxypregn-4-en-3-one dehydrogenase activity (GO:0047006)|alditol:NADP+ 1-oxidoreductase activity (GO:0004032)|aldo-keto reductase (NADP) activity (GO:0004033)|androsterone dehydrogenase (B-specific) activity (GO:0047042)|bile acid binding (GO:0032052)|carboxylic acid binding (GO:0031406)|indanol dehydrogenase activity (GO:0047718)|ketosteroid monooxygenase activity (GO:0047086)|oxidoreductase activity, acting on NAD(P)H, quinone or similar compound as acceptor (GO:0016655)|phenanthrene 9,10-monooxygenase activity (GO:0018636)|trans-1,2-dihydrobenzene-1,2-diol dehydrogenase activity (GO:0047115)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|lung(2)|ovary(3)|prostate(1)	13					Acetylsalicylic acid(DB00945)|Salicylic acid(DB00936)	TGGATTATGTTGACCTCTACC	0.398																																					p.V111V	Colon(130;2054 2316 13360 15380)	Atlas-SNP	.											.	AKR1C1	39	.	0			c.T333C						.						125.0	115.0	118.0					10																	5009199		2203	4300	6503	SO:0001819	synonymous_variant	1645	exon3			TTATGTTGACCTC	D26124	CCDS7061.1	10p15-p14	2012-12-04	2012-12-04		ENSG00000187134	ENSG00000187134	1.3.1.20, 1.1.1.149, 1.1.1.112	"""Aldo-keto reductases"""	384	protein-coding gene	gene with protein product	"""dihydrodiol dehydrogenase 1; 20-alpha (3-alpha)-hydroxysteroid dehydrogenase"""	600449	"""aldo-keto reductase family 1, member C1 (dihydrodiol dehydrogenase 1; 20-alpha (3-alpha)-hydroxysteroid dehydrogenase)"""	DDH1		8011662	Standard	NM_001353		Approved	DDH, MBAB, DD1, HAKRC		Q04828	OTTHUMG00000017580	ENST00000380872.4:c.333T>C	chr10.hg19:g.5009199T>C		347.0	0.0		311.0	137.0	NM_001353	P52896|Q5SR15|Q7M4N2|Q9UCX2	Silent	SNP	ENST00000380872.4	hg19	CCDS7061.1	.	.	.	.	.	.	.	.	.	.	T	3.685	-0.064794	0.07273	.	.	ENSG00000187134	ENST00000442997	.	.	.	2.95	-5.91	0.02269	.	.	.	.	.	T	0.37019	0.0988	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.37502	-0.9703	4	.	.	.	.	2.0885	0.03651	0.3674:0.0969:0.3694:0.1663	.	.	.	.	S	78	.	.	L	+	2	0	AKR1C1	4999199	0.349000	0.24870	0.022000	0.16811	0.029000	0.11900	-0.852000	0.04308	-2.566000	0.00470	0.254000	0.18369	TTG	.	.		0.398	AKR1C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046523.2	NM_001353	
ARMC3	219681	hgsc.bcm.edu	37	10	23297251	23297251	+	Silent	SNP	C	C	A			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr10:23297251C>A	ENST00000298032.5	+	15	1960	c.1876C>A	c.(1876-1878)Cga>Aga	p.R626R	ARMC3_ENST00000376528.4_Silent_p.R363R|ARMC3_ENST00000409049.3_Silent_p.R626R|ARMC3_ENST00000409983.3_Silent_p.R626R	NM_173081.3	NP_775104.2	Q5W041	ARMC3_HUMAN	armadillo repeat containing 3	626			R -> Q (in dbSNP:rs10828395). {ECO:0000269|PubMed:15489334}.			extracellular vesicular exosome (GO:0070062)				breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(24)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	47						TGGTTATGGACGAAGTATTTC	0.279																																					p.R626R		Atlas-SNP	.											.	ARMC3	102	.	0			c.C1876A						.						35.0	32.0	33.0					10																	23297251		2191	4269	6460	SO:0001819	synonymous_variant	219681	exon15			TATGGACGAAGTA	AK057389	CCDS7142.1, CCDS60499.1, CCDS60500.1, CCDS73073.1	10p12.31	2013-02-14			ENSG00000165309	ENSG00000165309		"""Armadillo repeat containing"""	30964	protein-coding gene	gene with protein product	"""cancer/testis antigen 81"""	611226					Standard	XM_005252380		Approved	FLJ32827, CT81	uc001irm.4	Q5W041	OTTHUMG00000017811	ENST00000298032.5:c.1876C>A	chr10.hg19:g.23297251C>A		151.0	0.0		138.0	21.0	NM_173081	A0PG76|A6NH64|B4DZL3|B7ZBN6|B7ZBN7|Q8IXS5|Q8N7B0|Q96M49	Silent	SNP	ENST00000298032.5	hg19	CCDS7142.1																																																																																			.	.		0.279	ARMC3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047197.2	NM_173081	
MYO3A	53904	hgsc.bcm.edu	37	10	26462898	26462898	+	Silent	SNP	T	T	C			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr10:26462898T>C	ENST00000265944.5	+	30	3871	c.3705T>C	c.(3703-3705)gcT>gcC	p.A1235A	MYO3A_ENST00000543632.1_Intron	NM_017433.4	NP_059129.3	Q8NEV4	MYO3A_HUMAN	myosin IIIA	1235					ATP catabolic process (GO:0006200)|inner ear development (GO:0048839)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of filopodium assembly (GO:0051491)|protein autophosphorylation (GO:0046777)|response to stimulus (GO:0050896)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|filamentous actin (GO:0031941)|filopodium (GO:0030175)|filopodium tip (GO:0032433)|myosin complex (GO:0016459)|photoreceptor inner segment (GO:0001917)|stereocilium bundle tip (GO:0032426)	actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|plus-end directed microfilament motor activity (GO:0060002)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(9)|central_nervous_system(3)|endometrium(9)|kidney(10)|large_intestine(28)|liver(1)|lung(46)|ovary(11)|pancreas(1)|prostate(6)|skin(11)|stomach(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	146						AAGAGGAAGCTATGATCCAGA	0.438																																					p.A1235A		Atlas-SNP	.											.	MYO3A	371	.	0			c.T3705C						.						110.0	112.0	111.0					10																	26462898		2203	4300	6503	SO:0001819	synonymous_variant	53904	exon30			GGAAGCTATGATC	AF229172	CCDS7148.1	10p11.1	2011-09-27	2004-05-19		ENSG00000095777	ENSG00000095777		"""Myosins / Myosin superfamily : Class III"""	7601	protein-coding gene	gene with protein product		606808	"""deafness, autosomal recessive 30"""	DFNB30		10936054	Standard	NM_017433		Approved		uc001isn.2	Q8NEV4	OTTHUMG00000017837	ENST00000265944.5:c.3705T>C	chr10.hg19:g.26462898T>C		156.0	0.0		136.0	61.0	NM_017433	Q4G0X2|Q5VZ28|Q8WX17|Q9NYS8	Silent	SNP	ENST00000265944.5	hg19	CCDS7148.1																																																																																			.	.		0.438	MYO3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047259.1	NM_017433	
WAPAL	23063	hgsc.bcm.edu	37	10	88206050	88206050	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr10:88206050C>T	ENST00000298767.5	-	16	3743	c.3271G>A	c.(3271-3273)Gaa>Aaa	p.E1091K	WAPAL_ENST00000372075.1_Missense_Mutation_p.E303K|WAPAL_ENST00000263070.7_Missense_Mutation_p.E303K|WAPAL_ENST00000484070.1_5'Flank	NM_015045.2	NP_055860.1	Q7Z5K2	WAPL_HUMAN	wings apart-like homolog (Drosophila)	1091	WAPL. {ECO:0000255|PROSITE- ProRule:PRU00603}.				mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of chromatin binding (GO:0035562)|negative regulation of DNA replication (GO:0008156)|negative regulation of sister chromatid cohesion (GO:0045875)|positive regulation of fibroblast proliferation (GO:0048146)|protein localization to chromatin (GO:0071168)|regulation of chromosome condensation (GO:0060623)|regulation of cohesin localization to chromatin (GO:0071922)|response to toxic substance (GO:0009636)|viral process (GO:0016032)	chromatin (GO:0000785)|chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cohesin complex (GO:0008278)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|microtubule cytoskeleton (GO:0015630)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|synaptonemal complex (GO:0000795)				breast(2)|endometrium(2)|kidney(5)|large_intestine(6)|lung(13)|ovary(2)|stomach(1)	31						TGTTTCTCTTCTGTACCATCA	0.388																																					p.E1091K		Atlas-SNP	.											.	WAPAL	81	.	0			c.G3271A						.						186.0	185.0	186.0					10																	88206050		2203	4300	6503	SO:0001583	missense	23063	exon16			TCTCTTCTGTACC	AB065003	CCDS7375.1	10q23.31	2006-12-08	2006-03-16	2006-03-16	ENSG00000062650	ENSG00000062650			23293	protein-coding gene	gene with protein product	"""friend of EBNA2"""	610754	"""KIAA0261"""	KIAA0261		9039502, 17112726	Standard	XM_006717726		Approved	FOE, WAPL	uc001kdo.3	Q7Z5K2	OTTHUMG00000018651	ENST00000298767.5:c.3271G>A	chr10.hg19:g.88206050C>T	ENSP00000298767:p.Glu1091Lys	261.0	0.0		180.0	104.0	NM_015045	A7E2B5|Q5VSK5|Q8IX10|Q92549	Missense_Mutation	SNP	ENST00000298767.5	hg19	CCDS7375.1	.	.	.	.	.	.	.	.	.	.	C	17.09	3.300015	0.60195	.	.	ENSG00000062650	ENST00000342368;ENST00000298767;ENST00000372076;ENST00000372075;ENST00000263070	T;T;T	0.36520	1.25;1.25;1.25	5.51	5.51	0.81932	Armadillo-type fold (1);	0.269247	0.36628	N	0.002493	T	0.37489	0.1005	L	0.48642	1.525	0.54753	D	0.999989	P;B;P;B	0.37864	0.61;0.06;0.61;0.447	B;B;B;B	0.40982	0.345;0.018;0.345;0.168	T	0.06899	-1.0801	10	0.13853	T	0.58	.	19.4394	0.94811	0.0:1.0:0.0:0.0	.	1085;1129;1091;1128	B2RTX8;E9PH12;Q7Z5K2;Q7Z5K2-2	.;.;WAPL_HUMAN;.	K	1176;1091;1176;303;303	ENSP00000298767:E1091K;ENSP00000361145:E303K;ENSP00000263070:E303K	ENSP00000263070:E303K	E	-	1	0	WAPAL	88196030	1.000000	0.71417	0.984000	0.44739	0.994000	0.84299	3.385000	0.52485	2.581000	0.87130	0.655000	0.94253	GAA	.	.		0.388	WAPAL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049151.2	NM_015045	
IDE	3416	hgsc.bcm.edu	37	10	94225544	94225544	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr10:94225544T>C	ENST00000265986.6	-	20	2433	c.2377A>G	c.(2377-2379)Ata>Gta	p.I793V	IDE_ENST00000496903.1_5'UTR|IDE_ENST00000371581.5_Missense_Mutation_p.I238V	NM_004969.3	NP_004960.2	P14735	IDE_HUMAN	insulin-degrading enzyme	793					beta-amyloid metabolic process (GO:0050435)|bradykinin catabolic process (GO:0010815)|determination of adult lifespan (GO:0008340)|hormone catabolic process (GO:0042447)|insulin catabolic process (GO:1901143)|insulin metabolic process (GO:1901142)|insulin receptor signaling pathway (GO:0008286)|negative regulation of proteolysis (GO:0045861)|positive regulation of protein oligomerization (GO:0032461)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|protein homotetramerization (GO:0051289)|proteolysis (GO:0006508)|proteolysis involved in cellular protein catabolic process (GO:0051603)|ubiquitin homeostasis (GO:0010992)|viral process (GO:0016032)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic proteasome complex (GO:0031597)|extracellular space (GO:0005615)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|beta-amyloid binding (GO:0001540)|beta-endorphin binding (GO:0031626)|glycoprotein binding (GO:0001948)|insulin binding (GO:0043559)|metalloendopeptidase activity (GO:0004222)|peptide binding (GO:0042277)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)|ubiquitin binding (GO:0043130)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(10)|liver(1)|lung(10)|ovary(2)|urinary_tract(2)	33					"""""""Insulin(DB00071)|Bacitracin(DB00626)|Insulin Regular(DB00030)"""	TGGTAGTATATCTCGATGCCA	0.408																																					p.I793V		Atlas-SNP	.											.	IDE	77	.	0			c.A2377G						.						184.0	168.0	174.0					10																	94225544		2203	4300	6503	SO:0001583	missense	3416	exon20			AGTATATCTCGAT	M21188	CCDS7421.1, CCDS53554.1	10q23-q25	2007-03-27			ENSG00000119912	ENSG00000119912			5381	protein-coding gene	gene with protein product	"""insulysin"""	146680				2293021	Standard	NM_004969		Approved		uc001kia.3	P14735	OTTHUMG00000018759	ENST00000265986.6:c.2377A>G	chr10.hg19:g.94225544T>C	ENSP00000265986:p.Ile793Val	282.0	0.0		186.0	53.0	NM_004969	B2R721|B7ZAU2|D3DR35|Q5T5N2	Missense_Mutation	SNP	ENST00000265986.6	hg19	CCDS7421.1	.	.	.	.	.	.	.	.	.	.	T	2.951	-0.216720	0.06101	.	.	ENSG00000119912	ENST00000265986;ENST00000371581	T;T	0.08193	3.12;3.12	6.02	6.02	0.97574	Peptidase M16, C-terminal (1);Metalloenzyme, LuxS/M16 peptidase-like, metal-binding (1);	0.000000	0.85682	D	0.000000	T	0.03959	0.0111	N	0.02247	-0.625	0.80722	D	1	B;B	0.18013	0.008;0.025	B;B	0.25987	0.015;0.065	T	0.29088	-1.0023	10	0.02654	T	1	-16.6034	16.5494	0.84464	0.0:0.0:0.0:1.0	.	793;238	P14735;B3KSB8	IDE_HUMAN;.	V	793;238	ENSP00000265986:I793V;ENSP00000360637:I238V	ENSP00000265986:I793V	I	-	1	0	IDE	94215524	1.000000	0.71417	0.985000	0.45067	0.187000	0.23431	7.803000	0.85983	2.299000	0.77371	0.528000	0.53228	ATA	.	.		0.408	IDE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049393.1	NM_004969	
SLC39A13	91252	hgsc.bcm.edu	37	11	47436693	47436693	+	Missense_Mutation	SNP	G	G	T			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr11:47436693G>T	ENST00000362021.4	+	9	1065	c.1023G>T	c.(1021-1023)ttG>ttT	p.L341F	SLC39A13_ENST00000524928.1_3'UTR|SLC39A13_ENST00000354884.4_Missense_Mutation_p.L334F|SLC39A13_ENST00000533076.1_3'UTR	NM_001128225.2	NP_001121697	Q96H72	S39AD_HUMAN	solute carrier family 39 (zinc transporter), member 13	341					cellular zinc ion homeostasis (GO:0006882)|connective tissue development (GO:0061448)|zinc ion transmembrane transport (GO:0071577)	Golgi apparatus (GO:0005794)|integral component of Golgi membrane (GO:0030173)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)	protein homodimerization activity (GO:0042803)|zinc ion transmembrane transporter activity (GO:0005385)			breast(1)|kidney(1)|lung(1)|prostate(1)	4				Lung(87;0.0936)		CTGACCTCTTGGAAGAAGAGG	0.632																																					p.L341F		Atlas-SNP	.											.	SLC39A13	18	.	0			c.G1023T						.						43.0	40.0	41.0					11																	47436693		2201	4297	6498	SO:0001583	missense	91252	exon9			CCTCTTGGAAGAA		CCDS7934.1, CCDS44592.1	11p11.2	2013-05-22			ENSG00000165915	ENSG00000165915		"""Solute carriers"""	20859	protein-coding gene	gene with protein product		608735	"""solute carrier family 39 (metal ion transporter), member 13"""			12659941	Standard	NM_001128225		Approved	FLJ25785	uc009ylq.3	Q96H72	OTTHUMG00000166890	ENST00000362021.4:c.1023G>T	chr11.hg19:g.47436693G>T	ENSP00000354689:p.Leu341Phe	136.0	0.0		127.0	48.0	NM_001128225	D3DQR6|D3DQR7|E9PLY1|E9PQV3|Q659D9|Q8N7C9|Q8WV10	Missense_Mutation	SNP	ENST00000362021.4	hg19	CCDS44592.1	.	.	.	.	.	.	.	.	.	.	G	18.76	3.691759	0.68271	.	.	ENSG00000165915	ENST00000362021;ENST00000354884	T;T	0.51574	0.7;0.7	5.46	4.55	0.56014	.	0.072955	0.56097	D	0.000022	T	0.69296	0.3095	M	0.89478	3.035	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.77004	0.989;0.981	T	0.71341	-0.4622	10	0.45353	T	0.12	-16.5436	8.6848	0.34232	0.2285:0.0:0.7715:0.0	.	341;334	Q96H72;Q96H72-2	S39AD_HUMAN;.	F	341;334	ENSP00000354689:L341F;ENSP00000346956:L334F	ENSP00000346956:L334F	L	+	3	2	SLC39A13	47393269	0.998000	0.40836	1.000000	0.80357	0.968000	0.65278	0.471000	0.22100	1.303000	0.44873	0.462000	0.41574	TTG	.	.		0.632	SLC39A13-012	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000395652.1	NM_152264	
ARHGEF12	23365	hgsc.bcm.edu	37	11	120317715	120317715	+	Missense_Mutation	SNP	G	G	C			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr11:120317715G>C	ENST00000397843.2	+	18	1676	c.1510G>C	c.(1510-1512)Gag>Cag	p.E504Q	ARHGEF12_ENST00000532993.1_Missense_Mutation_p.E401Q|ARHGEF12_ENST00000356641.3_Missense_Mutation_p.E485Q	NM_015313.2	NP_056128.1	Q9NZN5	ARHGC_HUMAN	Rho guanine nucleotide exchange factor (GEF) 12	504	RGSL.				apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|G-protein coupled receptor signaling pathway (GO:0007186)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	G-protein coupled receptor binding (GO:0001664)|GTPase activator activity (GO:0005096)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(5)|endometrium(6)|kidney(5)|large_intestine(13)|lung(23)|ovary(4)|pancreas(1)|prostate(1)|skin(2)	61		Breast(109;0.000813)|Medulloblastoma(222;0.0425)|Hepatocellular(160;0.0831)|all_hematologic(192;0.107)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.231)		ACTTGATGCAGAGCGAGACAA	0.428			T	MLL	AML																																p.E504Q		Atlas-SNP	.		Dom	yes		11	11q23.3	23365	RHO guanine nucleotide exchange factor (GEF) 12 (LARG)		L	.	ARHGEF12	133	.	0			c.G1510C						.						127.0	119.0	121.0					11																	120317715		1976	4177	6153	SO:0001583	missense	23365	exon18			GATGCAGAGCGAG	AF180681	CCDS41727.1, CCDS55794.1	11q23.3	2011-11-16			ENSG00000196914	ENSG00000196914		"""Rho guanine nucleotide exchange factors"""	14193	protein-coding gene	gene with protein product		604763				10681437, 9205841	Standard	NM_001198665		Approved	KIAA0382, LARG	uc001pxl.2	Q9NZN5	OTTHUMG00000166143	ENST00000397843.2:c.1510G>C	chr11.hg19:g.120317715G>C	ENSP00000380942:p.Glu504Gln	217.0	0.0		143.0	42.0	NM_015313	O15086|Q6P526	Missense_Mutation	SNP	ENST00000397843.2	hg19	CCDS41727.1	.	.	.	.	.	.	.	.	.	.	G	33	5.252150	0.95336	.	.	ENSG00000196914	ENST00000397843;ENST00000356641;ENST00000532993	D;D;D	0.85013	-1.93;-1.93;-1.93	5.3	5.3	0.74995	Regulator of G protein signalling superfamily (1);Regulator of G protein signalling-like fold (1);	0.000000	0.46758	D	0.000263	D	0.92011	0.7469	M	0.70595	2.14	0.58432	D	0.999995	D;D;D	0.89917	0.994;0.999;1.0	D;D;D	0.79108	0.95;0.979;0.992	D	0.91908	0.5537	10	0.54805	T	0.06	-19.1516	19.3235	0.94252	0.0:0.0:1.0:0.0	.	401;485;504	B4DGW2;Q9NZN5-2;Q9NZN5	.;.;ARHGC_HUMAN	Q	504;485;401	ENSP00000380942:E504Q;ENSP00000349056:E485Q;ENSP00000432984:E401Q	ENSP00000349056:E485Q	E	+	1	0	ARHGEF12	119822925	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.314000	0.96306	2.627000	0.88993	0.650000	0.86243	GAG	.	.		0.428	ARHGEF12-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388052.1	NM_015313	
RECQL	5965	hgsc.bcm.edu	37	12	21643210	21643210	+	Missense_Mutation	SNP	C	C	G			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr12:21643210C>G	ENST00000444129.2	-	4	785	c.317G>C	c.(316-318)gGa>gCa	p.G106A	RECQL_ENST00000421138.2_Missense_Mutation_p.G106A	NM_002907.3|NM_032941.2	NP_002898.2|NP_116559.1	P46063	RECQ1_HUMAN	RecQ helicase-like	106	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				DNA duplex unwinding (GO:0032508)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA strand renaturation (GO:0000733)	membrane (GO:0016020)|nucleus (GO:0005634)	annealing helicase activity (GO:0036310)|ATP binding (GO:0005524)|ATP-dependent 3'-5' DNA helicase activity (GO:0043140)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)			endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	17						TACCTCCTTTCCAGCCATTGT	0.348								Other identified genes with known or suspected DNA repair function																													p.G106A		Atlas-SNP	.											.	RECQL	45	.	0			c.G317C						.						120.0	121.0	120.0					12																	21643210		2203	4300	6503	SO:0001583	missense	5965	exon5			TCCTTTCCAGCCA	D37984	CCDS31756.1	12p12.1	2014-03-07	2014-03-07	2014-03-07	ENSG00000004700	ENSG00000004700			9948	protein-coding gene	gene with protein product	"""DNA helicase Q1-like"""	600537	"""RecQ protein-like (DNA helicase Q1-like)"""			7527136, 7961977	Standard	NM_002907		Approved	RecQ1, RecQL1	uc001rex.3	P46063	OTTHUMG00000169131	ENST00000444129.2:c.317G>C	chr12.hg19:g.21643210C>G	ENSP00000416739:p.Gly106Ala	175.0	0.0		94.0	88.0	NM_032941	A8K6G2	Missense_Mutation	SNP	ENST00000444129.2	hg19	CCDS31756.1	.	.	.	.	.	.	.	.	.	.	C	26.1	4.708568	0.89018	.	.	ENSG00000004700	ENST00000444129;ENST00000421138;ENST00000396093;ENST00000314748;ENST00000542432;ENST00000536240	T;T;T;T;T;T	0.76968	-0.97;-0.97;-0.53;-0.53;-0.53;-1.06	5.29	5.29	0.74685	DEAD-like helicase (2);DNA/RNA helicase, DEAD/DEAH box type, N-terminal (1);	0.117022	0.64402	D	0.000017	D	0.84790	0.5550	M	0.91038	3.17	0.58432	D	0.999992	P	0.48407	0.91	B	0.43575	0.424	D	0.88762	0.3258	10	0.66056	D	0.02	-1.1318	19.2899	0.94095	0.0:1.0:0.0:0.0	.	106	P46063	RECQ1_HUMAN	A	106	ENSP00000416739:G106A;ENSP00000395449:G106A;ENSP00000379400:G106A;ENSP00000318727:G106A;ENSP00000445555:G106A;ENSP00000439069:G106A	ENSP00000318727:G106A	G	-	2	0	RECQL	21534477	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.570000	0.82390	2.615000	0.88500	0.650000	0.86243	GGA	.	.		0.348	RECQL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402371.1	NM_002907	
PDZRN4	29951	hgsc.bcm.edu	37	12	41967431	41967431	+	Silent	SNP	G	G	T			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr12:41967431G>T	ENST00000402685.2	+	10	2858	c.2850G>T	c.(2848-2850)ctG>ctT	p.L950L	PDZRN4_ENST00000539469.2_Silent_p.L692L|PDZRN4_ENST00000298919.7_Silent_p.L690L	NM_001164595.1	NP_001158067.1	Q6ZMN7	PZRN4_HUMAN	PDZ domain containing ring finger 4	950							ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(23)|lung(29)|ovary(3)|pancreas(1)|prostate(2)|skin(4)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	77	all_cancers(12;0.000673)	Lung NSC(34;0.0205)|all_lung(34;0.0264)				AGCAGCACCTGGTTAGGGCCA	0.562																																					p.L950L		Atlas-SNP	.											.	PDZRN4	346	.	0			c.G2850T						.						94.0	87.0	89.0					12																	41967431		2203	4300	6503	SO:0001819	synonymous_variant	29951	exon10			GCACCTGGTTAGG	AK094690	CCDS8739.1, CCDS53777.1	12q12	2008-08-14	2008-08-14			ENSG00000165966		"""RING-type (C3HC4) zinc fingers"""	30552	protein-coding gene	gene with protein product	"""similar to semaF cytoplasmic domain associated protein 3"""	609730				11230166, 15010864	Standard	NM_013377		Approved	DKFZp434B0417, LNX4, FLJ33777, IMAGE5767589	uc010skn.2	Q6ZMN7		ENST00000402685.2:c.2850G>T	chr12.hg19:g.41967431G>T		91.0	0.0		60.0	14.0	NM_001164595	Q52LY3|Q52LY4|Q6N052|Q8IUU1|Q9NTP7	Silent	SNP	ENST00000402685.2	hg19	CCDS53777.1																																																																																			.	.		0.562	PDZRN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403701.1	NM_013377	
HOXC4	3221	hgsc.bcm.edu	37	12	54447739	54447739	+	Missense_Mutation	SNP	C	C	A	rs377491433		TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr12:54447739C>A	ENST00000430889.2	+	1	79	c.33C>A	c.(31-33)aaC>aaA	p.N11K	HOXC4_ENST00000609810.1_Missense_Mutation_p.N11K|HOXC4_ENST00000303406.4_Missense_Mutation_p.N11K	NM_153633.2	NP_705897.1	P09017	HXC4_HUMAN	homeobox C4	11					multicellular organismal development (GO:0007275)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			cervix(1)|kidney(2)|large_intestine(4)|lung(3)|ovary(1)|prostate(1)|urinary_tract(1)	13						TGGACTCTAACTACATCGATC	0.423																																					p.N11K		Atlas-SNP	.											.	HOXC4	29	.	0			c.C33A						.						97.0	96.0	96.0					12																	54447739		2203	4300	6503	SO:0001583	missense	3221	exon3			CTCTAACTACATC		CCDS8873.1	12q13.13	2011-06-20	2005-12-22		ENSG00000198353	ENSG00000198353		"""Homeoboxes / ANTP class : HOXL subclass"""	5126	protein-coding gene	gene with protein product		142974	"""homeo box C4"""	HOX3, HOX3E		1973146, 1358459	Standard	NM_014620		Approved		uc001sex.3	P09017	OTTHUMG00000160036	ENST00000430889.2:c.33C>A	chr12.hg19:g.54447739C>A	ENSP00000399808:p.Asn11Lys	112.0	0.0		87.0	20.0	NM_014620		Missense_Mutation	SNP	ENST00000430889.2	hg19	CCDS8873.1	.	.	.	.	.	.	.	.	.	.	C	12.51	1.960162	0.34565	.	.	ENSG00000198353	ENST00000303406;ENST00000430889	T;T	0.55234	0.53;0.53	3.41	3.41	0.39046	.	0.055508	0.64402	D	0.000002	T	0.62368	0.2422	L	0.46819	1.47	0.80722	D	1	D	0.63880	0.993	D	0.70227	0.968	T	0.57929	-0.7726	10	0.23302	T	0.38	.	14.7795	0.69754	0.0:1.0:0.0:0.0	.	11	P09017	HXC4_HUMAN	K	11	ENSP00000305973:N11K;ENSP00000399808:N11K	ENSP00000305973:N11K	N	+	3	2	HOXC4	52734006	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.319000	0.43788	2.187000	0.69744	0.462000	0.41574	AAC	.	.		0.423	HOXC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358963.1		
WIF1	11197	hgsc.bcm.edu	37	12	65448938	65448938	+	Missense_Mutation	SNP	G	G	C			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr12:65448938G>C	ENST00000286574.4	-	9	1352	c.978C>G	c.(976-978)tgC>tgG	p.C326W		NM_007191.4	NP_009122.2	Q9Y5W5	WIF1_HUMAN	WNT inhibitory factor 1	326	EGF-like 5. {ECO:0000255|PROSITE- ProRule:PRU00076}.				multicellular organismal development (GO:0007275)|positive regulation of fat cell differentiation (GO:0045600)|signal transduction (GO:0007165)|Wnt signaling pathway (GO:0016055)	extracellular region (GO:0005576)				cervix(1)|large_intestine(4)|lung(10)|ovary(3)|skin(1)|stomach(1)|urinary_tract(1)	21			LUAD - Lung adenocarcinoma(6;0.0234)|LUSC - Lung squamous cell carcinoma(43;0.0975)	GBM - Glioblastoma multiforme(28;0.0231)		CTTGACATTGGCATTTGTTGG	0.393			T	HMGA2	pleomorphic salivary gland adenoma																																p.C326W	Esophageal Squamous(148;1595 1816 48559 49439 49664)	Atlas-SNP	.		Dom	yes		12	12q14.3	11197	WNT inhibitory factor 1		E	.	WIF1	96	.	0			c.C978G						.						92.0	87.0	89.0					12																	65448938		2203	4300	6503	SO:0001583	missense	11197	exon9			ACATTGGCATTTG	AF122922	CCDS8971.1	12q14.2	2008-04-11			ENSG00000156076	ENSG00000156076			18081	protein-coding gene	gene with protein product		605186				10201374	Standard	NM_007191		Approved		uc001ssk.3	Q9Y5W5	OTTHUMG00000168832	ENST00000286574.4:c.978C>G	chr12.hg19:g.65448938G>C	ENSP00000286574:p.Cys326Trp	149.0	0.0		95.0	24.0	NM_007191	Q6UXI1|Q8WVG4	Missense_Mutation	SNP	ENST00000286574.4	hg19	CCDS8971.1	.	.	.	.	.	.	.	.	.	.	G	15.50	2.851565	0.51270	.	.	ENSG00000156076	ENST00000286574;ENST00000543094	D;D	0.99984	-11.36;-6.54	5.71	3.89	0.44902	EGF, extracellular (1);Epidermal growth factor-like (1);EGF-like region, conserved site (2);Epidermal growth factor-like, type 3 (1);	0.000000	0.85682	D	0.000000	D	0.99986	0.9997	H	0.95611	3.695	0.80722	D	1	D	0.76494	0.999	D	0.85130	0.997	D	0.96261	0.9191	9	.	.	.	.	9.9417	0.41585	0.2071:0.0:0.7929:0.0	.	326	Q9Y5W5	WIF1_HUMAN	W	326;75	ENSP00000286574:C326W;ENSP00000439024:C75W	.	C	-	3	2	WIF1	63735205	1.000000	0.71417	0.998000	0.56505	0.601000	0.36947	3.540000	0.53611	0.887000	0.36136	0.655000	0.94253	TGC	.	.		0.393	WIF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401258.2		
FREM2	341640	hgsc.bcm.edu	37	13	39357273	39357273	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr13:39357273C>T	ENST00000280481.7	+	5	5924	c.5708C>T	c.(5707-5709)cCc>cTc	p.P1903L		NM_207361.4	NP_997244.3	Q5SZK8	FREM2_HUMAN	FRAS1 related extracellular matrix protein 2	1903	Calx-beta 2.				cell communication (GO:0007154)|homophilic cell adhesion (GO:0007156)|inner ear development (GO:0048839)|morphogenesis of an epithelium (GO:0002009)	basement membrane (GO:0005604)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(35)|lung(39)|ovary(9)|pancreas(2)|prostate(12)|skin(11)|upper_aerodigestive_tract(7)|urinary_tract(2)	148		Lung NSC(96;1.04e-07)|Prostate(109;0.00384)|Breast(139;0.00396)|Lung SC(185;0.0565)|Hepatocellular(188;0.114)		all cancers(112;3.32e-07)|Epithelial(112;1.66e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00154)|BRCA - Breast invasive adenocarcinoma(63;0.00631)|GBM - Glioblastoma multiforme(144;0.0312)		CTGTTCATTCCCATCAGGAGG	0.438																																					p.P1903L		Atlas-SNP	.											.	FREM2	385	.	0			c.C5708T						.						208.0	192.0	198.0					13																	39357273		2203	4300	6503	SO:0001583	missense	341640	exon5			TCATTCCCATCAG	BX538150	CCDS31960.1	13q13.3	2004-12-15			ENSG00000150893	ENSG00000150893			25396	protein-coding gene	gene with protein product		608945				15345741	Standard	NM_207361		Approved	DKFZp686J0811	uc001uwv.3	Q5SZK8	OTTHUMG00000016759	ENST00000280481.7:c.5708C>T	chr13.hg19:g.39357273C>T	ENSP00000280481:p.Pro1903Leu	189.0	0.0		182.0	120.0	NM_207361	Q4QQG1|Q5H9N8|Q5T6Q1|Q6N057|Q6ZSB4|Q7Z305|Q7Z341	Missense_Mutation	SNP	ENST00000280481.7	hg19	CCDS31960.1	.	.	.	.	.	.	.	.	.	.	C	20.2	3.954021	0.73902	.	.	ENSG00000150893	ENST00000280481	T	0.27557	1.66	5.84	5.84	0.93424	Na-Ca exchanger/integrin-beta4 (2);	0.000000	0.85682	D	0.000000	T	0.60676	0.2287	M	0.78916	2.43	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.62539	-0.6833	10	0.87932	D	0	.	20.1336	0.98010	0.0:1.0:0.0:0.0	.	1903	Q5SZK8	FREM2_HUMAN	L	1903	ENSP00000280481:P1903L	ENSP00000280481:P1903L	P	+	2	0	FREM2	38255273	1.000000	0.71417	1.000000	0.80357	0.043000	0.13939	7.811000	0.86092	2.751000	0.94390	0.514000	0.50259	CCC	.	.		0.438	FREM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044599.2	NM_207361	
SYNE2	23224	hgsc.bcm.edu	37	14	64518635	64518635	+	Missense_Mutation	SNP	G	G	T			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr14:64518635G>T	ENST00000344113.4	+	48	8216	c.8004G>T	c.(8002-8004)ttG>ttT	p.L2668F	SYNE2_ENST00000357395.3_5'UTR|SYNE2_ENST00000554584.1_Missense_Mutation_p.L2701F|SYNE2_ENST00000358025.3_Missense_Mutation_p.L2668F	NM_015180.4	NP_055995.4	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2	2668					centrosome localization (GO:0051642)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment or maintenance of cell polarity (GO:0007163)|fibroblast migration (GO:0010761)|nuclear envelope organization (GO:0006998)|nuclear migration (GO:0007097)|nuclear migration along microfilament (GO:0031022)|positive regulation of cell migration (GO:0030335)|protein localization to nucleus (GO:0034504)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intermediate filament cytoskeleton (GO:0045111)|lamellipodium membrane (GO:0031258)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nuclear lumen (GO:0031981)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|sarcoplasmic reticulum (GO:0016529)|SUN-KASH complex (GO:0034993)|Z disc (GO:0030018)	actin binding (GO:0003779)			NS(5)|breast(17)|central_nervous_system(3)|cervix(8)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(21)|large_intestine(34)|lung(75)|ovary(10)|pancreas(2)|prostate(8)|skin(8)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(4)	224				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		TGATTGCCTTGACCACTGACC	0.453																																					p.L2668F		Atlas-SNP	.											.	SYNE2	577	.	0			c.G8004T						.						102.0	103.0	103.0					14																	64518635		1970	4153	6123	SO:0001583	missense	23224	exon48			TGCCTTGACCACT	AB023228	CCDS9761.2, CCDS41963.1, CCDS45124.1, CCDS45125.1	14q22.1-q22.3	2014-09-17			ENSG00000054654	ENSG00000054654			17084	protein-coding gene	gene with protein product	"""nuclear envelope spectrin repeat-2"", ""nucleus and actin connecting element"""	608442				10231032, 10878022	Standard	NM_182910		Approved	SYNE-2, DKFZP434H2235, Nesprin-2, NUANCE, NUA, KIAA1011, Nesp2	uc001xgl.3	Q8WXH0	OTTHUMG00000140349	ENST00000344113.4:c.8004G>T	chr14.hg19:g.64518635G>T	ENSP00000341781:p.Leu2668Phe	291.0	0.0		252.0	126.0	NM_182914	Q540G1|Q8N1S3|Q8NF49|Q8TER7|Q8WWW3|Q8WWW4|Q8WWW5|Q8WXH1|Q9NU50|Q9UFQ4|Q9Y2L4|Q9Y4R1	Missense_Mutation	SNP	ENST00000344113.4	hg19	CCDS41963.1	.	.	.	.	.	.	.	.	.	.	G	4.015	0.000139	0.07819	.	.	ENSG00000054654	ENST00000358025;ENST00000344113;ENST00000554584;ENST00000261678	T;T;T	0.59224	0.65;0.66;0.28	5.68	2.39	0.29439	.	0.797647	0.10644	N	0.650623	T	0.51398	0.1672	L	0.27053	0.805	0.18873	N	0.999986	P;P	0.50272	0.933;0.919	P;P	0.48704	0.462;0.587	T	0.40776	-0.9545	10	0.62326	D	0.03	.	9.9368	0.41556	0.2556:0.0:0.7444:0.0	.	2668;2668	Q8WXH0;Q8WXH0-2	SYNE2_HUMAN;.	F	2668;2668;2701;2701	ENSP00000350719:L2668F;ENSP00000341781:L2668F;ENSP00000452570:L2701F	ENSP00000261678:L2701F	L	+	3	2	SYNE2	63588388	0.058000	0.20735	0.032000	0.17829	0.036000	0.12997	1.632000	0.37102	0.730000	0.32425	0.563000	0.77884	TTG	.	.		0.453	SYNE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276994.2	NM_182914	
TYRO3	7301	hgsc.bcm.edu	37	15	41865515	41865515	+	Silent	SNP	G	G	A			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr15:41865515G>A	ENST00000263798.3	+	17	2219	c.1995G>A	c.(1993-1995)gaG>gaA	p.E665E	TYRO3_ENST00000559066.1_Silent_p.E620E	NM_006293.3	NP_006284.2	Q06418	TYRO3_HUMAN	TYRO3 protein tyrosine kinase	665	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic cell clearance (GO:0043277)|cell adhesion (GO:0007155)|forebrain cell migration (GO:0021885)|natural killer cell differentiation (GO:0001779)|negative regulation of inflammatory response (GO:0050728)|negative regulation of innate immune response (GO:0045824)|negative regulation of lymphocyte activation (GO:0051250)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of toll-like receptor signaling pathway (GO:0034122)|neuron cellular homeostasis (GO:0070050)|ovulation cycle (GO:0042698)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol 3-kinase signaling (GO:0014065)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|protein autophosphorylation (GO:0046777)|protein kinase B signaling (GO:0043491)|secretion by cell (GO:0032940)|signal transduction (GO:0007165)|signal transduction by phosphorylation (GO:0023014)|spermatogenesis (GO:0007283)|substrate adhesion-dependent cell spreading (GO:0034446)|vagina development (GO:0060068)	endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|nuclear envelope (GO:0005635)|nucleus (GO:0005634)	ATP binding (GO:0005524)|phosphatidylinositol 3-kinase binding (GO:0043548)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(26)|ovary(3)|prostate(1)	43		all_cancers(109;7.33e-15)|all_epithelial(112;2.8e-12)|Lung NSC(122;3.48e-08)|all_lung(180;1.71e-07)|Melanoma(134;0.0262)		OV - Ovarian serous cystadenocarcinoma(18;3.31e-18)|GBM - Glioblastoma multiforme(113;9.31e-07)|BRCA - Breast invasive adenocarcinoma(123;0.117)		GGCTGGCAGAGGACATGACAG	0.557																																					p.E665E		Atlas-SNP	.											.	TYRO3	169	.	0			c.G1995A						.						211.0	212.0	212.0					15																	41865515		2203	4300	6503	SO:0001819	synonymous_variant	7301	exon17			GGCAGAGGACATG	D50479	CCDS10080.1	15q15.1-q21.1	2013-02-11			ENSG00000092445	ENSG00000092445	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12446	protein-coding gene	gene with protein product		600341		RSE		7851890	Standard	NM_006293		Approved	Dtk, Brt, Tif, Sky	uc001zof.2	Q06418	OTTHUMG00000130341	ENST00000263798.3:c.1995G>A	chr15.hg19:g.41865515G>A		115.0	0.0		62.0	12.0	NM_006293	O14953|Q86VR3	Silent	SNP	ENST00000263798.3	hg19	CCDS10080.1																																																																																			.	.		0.557	TYRO3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252693.2		
SHC4	399694	hgsc.bcm.edu	37	15	49148299	49148299	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr15:49148299G>A	ENST00000332408.4	-	8	1521	c.1093C>T	c.(1093-1095)Cat>Tat	p.H365Y	SHC4_ENST00000396535.3_Missense_Mutation_p.H122Y|SHC4_ENST00000537958.1_Missense_Mutation_p.H79Y	NM_203349.3	NP_976224.3	Q6S5L8	SHC4_HUMAN	SHC (Src homology 2 domain containing) family, member 4	365	PID. {ECO:0000255|PROSITE- ProRule:PRU00148}.				apoptotic process (GO:0006915)|intracellular signal transduction (GO:0035556)|positive regulation of cell proliferation (GO:0008284)|regulation of gene expression (GO:0010468)|stem cell differentiation (GO:0048863)	cell junction (GO:0030054)|postsynaptic membrane (GO:0045211)				breast(1)|endometrium(2)|large_intestine(8)|lung(11)|ovary(3)|pancreas(2)|skin(1)|upper_aerodigestive_tract(1)	29		all_lung(180;0.00466)		all cancers(107;9.4e-08)|GBM - Glioblastoma multiforme(94;5.94e-07)		TCCTCGGCATGGCTATCAATA	0.448																																					p.H365Y		Atlas-SNP	.											.	SHC4	70	.	0			c.C1093T						.						137.0	129.0	132.0					15																	49148299		2197	4294	6491	SO:0001583	missense	399694	exon8			CGGCATGGCTATC	AY358250	CCDS10130.1	15q21.1-q21.2	2013-02-14			ENSG00000185634	ENSG00000185634		"""SH2 domain containing"""	16743	protein-coding gene	gene with protein product	"""rai-like protein"""						Standard	NM_203349		Approved	RaLP	uc001zxb.1	Q6S5L8	OTTHUMG00000131513	ENST00000332408.4:c.1093C>T	chr15.hg19:g.49148299G>A	ENSP00000329668:p.His365Tyr	163.0	0.0		123.0	37.0	NM_203349	Q6UXQ3|Q8IYW3	Missense_Mutation	SNP	ENST00000332408.4	hg19	CCDS10130.1	.	.	.	.	.	.	.	.	.	.	G	4.357	0.065842	0.08388	.	.	ENSG00000185634	ENST00000332408;ENST00000396535;ENST00000537958	T;T;T	0.30182	3.55;1.54;1.55	5.14	0.673	0.17941	.	1.508310	0.03699	N	0.248252	T	0.15089	0.0364	N	0.08118	0	0.09310	N	1	B;B	0.30709	0.291;0.035	B;B	0.25884	0.064;0.009	T	0.18366	-1.0339	10	0.62326	D	0.03	-6.9214	2.2079	0.03940	0.1485:0.1126:0.3831:0.3559	.	122;365	Q6S5L8-2;Q6S5L8	.;SHC4_HUMAN	Y	365;122;79	ENSP00000329668:H365Y;ENSP00000379786:H122Y;ENSP00000443300:H79Y	ENSP00000329668:H365Y	H	-	1	0	SHC4	46935591	0.003000	0.15002	0.002000	0.10522	0.041000	0.13682	0.523000	0.22925	0.010000	0.14839	0.655000	0.94253	CAT	.	.		0.448	SHC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254371.1	NM_203349	
MCTP2	55784	hgsc.bcm.edu	37	15	94901825	94901825	+	Missense_Mutation	SNP	G	G	C			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr15:94901825G>C	ENST00000357742.4	+	9	1285	c.1285G>C	c.(1285-1287)Gag>Cag	p.E429Q	MCTP2_ENST00000331706.4_Missense_Mutation_p.E17Q|MCTP2_ENST00000557742.1_Missense_Mutation_p.E17Q|MCTP2_ENST00000451018.3_Missense_Mutation_p.E429Q|MCTP2_ENST00000543482.1_3'UTR	NM_018349.3	NP_060819.3	Q6DN12	MCTP2_HUMAN	multiple C2 domains, transmembrane 2	429	C2 2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				calcium-mediated signaling (GO:0019722)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	calcium ion binding (GO:0005509)			autonomic_ganglia(1)|breast(4)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(12)|liver(1)|lung(12)|ovary(1)|pancreas(1)|skin(9)|stomach(2)	49	Lung NSC(78;0.0821)|all_lung(78;0.148)		BRCA - Breast invasive adenocarcinoma(143;0.0323)|OV - Ovarian serous cystadenocarcinoma(32;0.0593)			CAAAAAGCATGAGGAACGTCT	0.507																																					p.E429Q		Atlas-SNP	.											.	MCTP2	122	.	0			c.G1285C						.						114.0	99.0	104.0					15																	94901825		2197	4298	6495	SO:0001583	missense	55784	exon9			AAGCATGAGGAAC	AK002037	CCDS32338.1, CCDS53975.1, CCDS53976.1	15q26.2	2006-02-08				ENSG00000140563			25636	protein-coding gene	gene with protein product						15528213	Standard	NM_018349		Approved	FLJ11175, FLJ33303	uc002btj.3	Q6DN12		ENST00000357742.4:c.1285G>C	chr15.hg19:g.94901825G>C	ENSP00000350377:p.Glu429Gln	182.0	0.0		176.0	95.0	NM_001159643	A2RRC2|C6G483|C6G484|Q49AB0|Q8TAX2|Q9NUS2|Q9NUW7	Missense_Mutation	SNP	ENST00000357742.4	hg19	CCDS32338.1	.	.	.	.	.	.	.	.	.	.	G	18.30	3.593492	0.66219	.	.	ENSG00000140563	ENST00000451018;ENST00000331706;ENST00000357742	T;T;T	0.71579	2.97;-0.58;2.97	5.87	4.95	0.65309	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.093845	0.64402	N	0.000001	T	0.69691	0.3139	L	0.48362	1.52	0.58432	D	0.999997	B;B;B	0.32188	0.023;0.332;0.359	B;B;B	0.39503	0.073;0.135;0.301	T	0.67565	-0.5638	10	0.36615	T	0.2	.	16.6123	0.84886	0.0:0.1405:0.8595:0.0	.	429;17;429	Q6DN12-2;Q6DN12-4;Q6DN12	.;.;MCTP2_HUMAN	Q	429;17;429	ENSP00000395109:E429Q;ENSP00000329646:E17Q;ENSP00000350377:E429Q	ENSP00000329646:E17Q	E	+	1	0	MCTP2	92702829	1.000000	0.71417	0.990000	0.47175	0.914000	0.54420	6.074000	0.71253	1.454000	0.47793	0.650000	0.86243	GAG	.	.		0.507	MCTP2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415060.3	NM_018349	
CHTF18	63922	hgsc.bcm.edu	37	16	845334	845334	+	Missense_Mutation	SNP	C	C	A			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr16:845334C>A	ENST00000262315.9	+	16	2216	c.2153C>A	c.(2152-2154)aCc>aAc	p.T718N	CHTF18_ENST00000455171.2_Missense_Mutation_p.T746N|CHTF18_ENST00000317063.6_Missense_Mutation_p.T927N	NM_022092.2	NP_071375.1	Q8WVB6	CTF18_HUMAN	CTF18, chromosome transmission fidelity factor 18 homolog (S. cerevisiae)	718					cell cycle (GO:0007049)|DNA replication (GO:0006260)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)			endometrium(1)|kidney(3)|liver(2)|lung(4)|prostate(1)	11		Hepatocellular(780;0.00335)				CCCAGGATCACCTTCCCCAGC	0.697																																					p.T718N		Atlas-SNP	.											.	CHTF18	52	.	0			c.C2153A						.						32.0	40.0	37.0					16																	845334		1767	3449	5216	SO:0001583	missense	63922	exon16			GGATCACCTTCCC	BC018184	CCDS45371.1	16p13.3	2010-04-21	2003-12-09		ENSG00000127586	ENSG00000127586		"""ATPases / AAA-type"""	18435	protein-coding gene	gene with protein product		613201	"""chromosome 16 open reading frame 41"""	C16orf41		12171929	Standard	NM_022092		Approved	CHL12, C321D2.4, Ctf18	uc002cke.4	Q8WVB6	OTTHUMG00000047838	ENST00000262315.9:c.2153C>A	chr16.hg19:g.845334C>A	ENSP00000262315:p.Thr718Asn	48.0	0.0		52.0	27.0	NM_022092	B7ZBA2|D3DU68|Q7Z6Y4|Q7Z6Y6|Q9BR83|Q9BRG5|Q9H7K3	Missense_Mutation	SNP	ENST00000262315.9	hg19	CCDS45371.1	.	.	.	.	.	.	.	.	.	.	C	1.879	-0.458342	0.04508	.	.	ENSG00000127586	ENST00000317063;ENST00000455171;ENST00000262315	T;T;T	0.09817	2.94;2.98;2.98	4.61	2.61	0.31194	.	0.946639	0.08884	N	0.879632	T	0.06142	0.0159	N	0.14661	0.345	0.09310	N	0.999999	B;B	0.29988	0.264;0.083	B;B	0.23275	0.045;0.02	T	0.44050	-0.9353	10	0.19147	T	0.46	-4.3262	8.652	0.34040	0.0:0.7607:0.1531:0.0862	.	746;718	Q8WVB6-2;Q8WVB6	.;CTF18_HUMAN	N	927;746;718	ENSP00000313029:T927N;ENSP00000406252:T746N;ENSP00000262315:T718N	ENSP00000262315:T718N	T	+	2	0	CHTF18	785335	0.322000	0.24634	0.143000	0.22291	0.579000	0.36224	1.157000	0.31724	0.379000	0.24794	-0.502000	0.04539	ACC	.	.		0.697	CHTF18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109061.3	NM_022092	
TELO2	9894	hgsc.bcm.edu	37	16	1551758	1551758	+	Missense_Mutation	SNP	G	G	C			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr16:1551758G>C	ENST00000262319.6	+	11	1735	c.1456G>C	c.(1456-1458)Gac>Cac	p.D486H	TELO2_ENST00000564507.1_3'UTR	NM_016111.3	NP_057195.2	Q9Y4R8	TELO2_HUMAN	telomere maintenance 2	486					regulation of TOR signaling (GO:0032006)	chromosome, telomeric region (GO:0000781)|cytoplasm (GO:0005737)|intracellular (GO:0005622)|membrane (GO:0016020)|nucleus (GO:0005634)|TORC1 complex (GO:0031931)|TORC2 complex (GO:0031932)	protein complex binding (GO:0032403)			NS(1)|endometrium(1)|kidney(5)|lung(9)|ovary(1)|skin(1)|urinary_tract(1)	19		Hepatocellular(780;0.219)				GGCGGGCTCTGACTCGGACCT	0.697																																					p.D486H		Atlas-SNP	.											.	TELO2	44	.	0			c.G1456C						.						31.0	37.0	35.0					16																	1551758		2197	4299	6496	SO:0001583	missense	9894	exon11			GGCTCTGACTCGG	AL080126	CCDS32363.1	16p13.3	2013-08-06	2013-08-06		ENSG00000100726	ENSG00000100726			29099	protein-coding gene	gene with protein product		611140	"""TEL2, telomere maintenance 2, homolog (S. cerevisiae)"""			9734811, 11230166, 12670948	Standard	NM_016111		Approved	KIAA0683, hCLK2, TEL2	uc002cly.3	Q9Y4R8	OTTHUMG00000044471	ENST00000262319.6:c.1456G>C	chr16.hg19:g.1551758G>C	ENSP00000262319:p.Asp486His	49.0	0.0		37.0	12.0	NM_016111	D3DU73|O75168|Q7LDV4|Q9BR21	Missense_Mutation	SNP	ENST00000262319.6	hg19	CCDS32363.1	.	.	.	.	.	.	.	.	.	.	G	13.20	2.167598	0.38315	.	.	ENSG00000100726	ENST00000437914;ENST00000262319	T	0.19806	2.12	5.08	3.09	0.35607	.	0.182951	0.56097	D	0.000023	T	0.38639	0.1048	M	0.74258	2.255	0.09310	N	0.999997	D	0.76494	0.999	D	0.65443	0.935	T	0.08106	-1.0738	10	0.48119	T	0.1	-10.842	7.215	0.25955	0.1996:0.0:0.8004:0.0	.	486	Q9Y4R8	TELO2_HUMAN	H	100;486	ENSP00000262319:D486H	ENSP00000262319:D486H	D	+	1	0	TELO2	1491759	0.363000	0.24989	0.032000	0.17829	0.211000	0.24417	3.391000	0.52530	1.283000	0.44513	0.655000	0.94253	GAC	.	.		0.697	TELO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000103602.2	NM_016111	
ITGAX	3687	hgsc.bcm.edu	37	16	31372494	31372494	+	Silent	SNP	T	T	C			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr16:31372494T>C	ENST00000268296.4	+	9	1093	c.972T>C	c.(970-972)gaT>gaC	p.D324D	ITGAX_ENST00000562522.1_Silent_p.D324D	NM_000887.3	NP_000878.2	P20702	ITAX_HUMAN	integrin, alpha X (complement component 3 receptor 4 subunit)	324	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|organ morphogenesis (GO:0009887)	cell surface (GO:0009986)|integrin complex (GO:0008305)|membrane (GO:0016020)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|receptor activity (GO:0004872)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(8)|lung(42)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	77						CTCTGAAAGATATTCAAAACC	0.418																																					p.D324D		Atlas-SNP	.											.	ITGAX	198	.	0			c.T972C						.						125.0	134.0	131.0					16																	31372494		2197	4300	6497	SO:0001819	synonymous_variant	3687	exon9			GAAAGATATTCAA	BC038237	CCDS10711.1, CCDS67014.1	16p11.2	2010-03-23	2006-02-10		ENSG00000140678	ENSG00000140678		"""CD molecules"", ""Complement system"", ""Integrins"""	6152	protein-coding gene	gene with protein product		151510	"""integrin, alpha X (antigen CD11C (p150), alpha polypeptide)"""	CD11C		3284962, 2303426	Standard	NM_001286375		Approved	CD11c	uc002ebu.1	P20702	OTTHUMG00000132465	ENST00000268296.4:c.972T>C	chr16.hg19:g.31372494T>C		128.0	0.0		96.0	65.0	NM_000887	Q8IVA6	Silent	SNP	ENST00000268296.4	hg19	CCDS10711.1																																																																																			.	.		0.418	ITGAX-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000255628.2	NM_000887	
DNAH9	1770	hgsc.bcm.edu	37	17	11775087	11775087	+	Missense_Mutation	SNP	A	A	T			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr17:11775087A>T	ENST00000262442.4	+	52	10294	c.10226A>T	c.(10225-10227)tAc>tTc	p.Y3409F	DNAH9_ENST00000454412.2_Missense_Mutation_p.Y3409F	NM_001372.3	NP_001363.2	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9	3409					cell projection organization (GO:0030030)|cellular component movement (GO:0006928)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|spermatogenesis (GO:0007283)	axoneme (GO:0005930)|cytoskeleton (GO:0005856)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			NS(2)|autonomic_ganglia(1)|breast(15)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(6)|kidney(17)|large_intestine(49)|liver(2)|lung(123)|ovary(6)|pancreas(1)|prostate(6)|skin(21)|stomach(2)|upper_aerodigestive_tract(13)|urinary_tract(4)	290		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)		TGGAGGCCCTACCTGAGCCAG	0.488																																					p.Y3409F		Atlas-SNP	.											.	DNAH9	695	.	0			c.A10226T						.						95.0	104.0	101.0					17																	11775087		2203	4300	6503	SO:0001583	missense	1770	exon52			GGCCCTACCTGAG	U61740	CCDS11160.1, CCDS11161.1	17p12	2009-05-07	2006-09-04		ENSG00000007174	ENSG00000007174		"""Axonemal dyneins"""	2953	protein-coding gene	gene with protein product		603330	"""dynein, axonemal, heavy polypeptide 17-like"", ""dynein, axonemal, heavy polypeptide 9"""	DNAH17L		8812413, 11247663	Standard	NM_001372		Approved	Dnahc9, KIAA0357, HL20, HL-20, DNAL1, DYH9	uc002gne.3	Q9NYC9	OTTHUMG00000130383	ENST00000262442.4:c.10226A>T	chr17.hg19:g.11775087A>T	ENSP00000262442:p.Tyr3409Phe	154.0	0.0		77.0	66.0	NM_001372	A2VCQ8|O15064|O95494|Q9NQ28	Missense_Mutation	SNP	ENST00000262442.4	hg19	CCDS11160.1	.	.	.	.	.	.	.	.	.	.	A	4.653	0.121327	0.08881	.	.	ENSG00000007174	ENST00000262442;ENST00000454412;ENST00000413703	T;T	0.75589	-0.95;-0.95	4.82	3.72	0.42706	Dynein heavy chain, coiled coil stalk (1);	0.145258	0.48767	D	0.000178	T	0.43010	0.1228	N	0.01656	-0.775	0.80722	D	1	B	0.06786	0.001	B	0.13407	0.009	T	0.34354	-0.9832	10	0.07482	T	0.82	.	11.1169	0.48266	0.8614:0.0:0.0:0.1386	.	3409	Q9NYC9	DYH9_HUMAN	F	3409;3409;1991	ENSP00000262442:Y3409F;ENSP00000414874:Y3409F	ENSP00000262442:Y3409F	Y	+	2	0	DNAH9	11715812	1.000000	0.71417	1.000000	0.80357	0.912000	0.54170	5.868000	0.69605	0.939000	0.37446	0.523000	0.50628	TAC	.	.		0.488	DNAH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252756.2	NM_001372	
SLFN12	55106	hgsc.bcm.edu	37	17	33749277	33749277	+	Silent	SNP	G	G	T			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr17:33749277G>T	ENST00000394562.1	-	4	1294	c.771C>A	c.(769-771)ctC>ctA	p.L257L	SLFN12_ENST00000304905.5_Silent_p.L257L|SLFN12_ENST00000452764.3_Silent_p.L257L|SLFN12_ENST00000460530.1_5'Flank			Q8IYM2	SLN12_HUMAN	schlafen family member 12	257							ATP binding (GO:0005524)			breast(1)|kidney(2)|large_intestine(3)|lung(8)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	18		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		CTAAGTCATCGAGGTCACTCA	0.338																																					p.L257L		Atlas-SNP	.											.	SLFN12	56	.	0			c.C771A						.						84.0	89.0	87.0					17																	33749277		2203	4300	6503	SO:0001819	synonymous_variant	55106	exon2			GTCATCGAGGTCA	AK001122	CCDS11295.1	17q12	2006-04-05			ENSG00000172123	ENSG00000172123			25500	protein-coding gene	gene with protein product		614955				12477932	Standard	NM_018042		Approved	FLJ10260	uc002hji.4	Q8IYM2	OTTHUMG00000132952	ENST00000394562.1:c.771C>A	chr17.hg19:g.33749277G>T		122.0	0.0		167.0	60.0	NM_018042	A8K711|Q9NP47	Silent	SNP	ENST00000394562.1	hg19	CCDS11295.1																																																																																			.	.		0.338	SLFN12-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256491.1	NM_018042	
NBR1	4077	hgsc.bcm.edu	37	17	41345518	41345518	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr17:41345518C>T	ENST00000422280.1	+	12	1846	c.1387C>T	c.(1387-1389)Cac>Tac	p.H463Y	NBR1_ENST00000341165.6_Missense_Mutation_p.H463Y|NBR1_ENST00000590996.1_Missense_Mutation_p.H463Y|NBR1_ENST00000589872.1_Missense_Mutation_p.H463Y|NBR1_ENST00000542611.1_Missense_Mutation_p.H442Y|NBR1_ENST00000389312.4_Missense_Mutation_p.H463Y	NM_031858.2	NP_114064.1	Q14596	NBR1_HUMAN	neighbor of BRCA1 gene 1	463					macroautophagy (GO:0016236)|negative regulation of osteoblast differentiation (GO:0045668)|protein oligomerization (GO:0051259)|regulation of bone mineralization (GO:0030500)|regulation of stress-activated MAPK cascade (GO:0032872)	autophagic vacuole (GO:0005776)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|late endosome (GO:0005770)|lysosome (GO:0005764)|membrane (GO:0016020)|pre-autophagosomal structure (GO:0000407)	mitogen-activated protein kinase binding (GO:0051019)|ubiquitin binding (GO:0043130)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|cervix(1)|kidney(4)|large_intestine(1)|lung(7)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	24		Breast(137;0.00086)		BRCA - Breast invasive adenocarcinoma(366;0.0934)		GCGTCTTTCTCACAAAGGCCA	0.522																																					p.H463Y		Atlas-SNP	.											.	NBR1	55	.	0			c.C1387T						.						70.0	68.0	69.0					17																	41345518		1904	4120	6024	SO:0001583	missense	4077	exon12			CTTTCTCACAAAG	X76952	CCDS45694.1	17q21.31	2008-02-01	2005-02-15	2005-02-16		ENSG00000188554			6746	protein-coding gene	gene with protein product		166945	"""membrane component, chromosome 17, surface marker 2 (ovarian carcinoma antigen CA125)"""	M17S2		8069304	Standard	XM_006721903		Approved	CA125, KIAA0049, 1A1-3B	uc010whv.2	Q14596		ENST00000422280.1:c.1387C>T	chr17.hg19:g.41345518C>T	ENSP00000411250:p.His463Tyr	181.0	0.0		227.0	32.0	NM_031862	Q13173|Q15026|Q5J7Q8|Q96GB6|Q9NRF7	Missense_Mutation	SNP	ENST00000422280.1	hg19	CCDS45694.1	.	.	.	.	.	.	.	.	.	.	C	29.8	5.039340	0.93630	.	.	ENSG00000188554	ENST00000422280;ENST00000542611;ENST00000341165;ENST00000389312;ENST00000389311	T;T;T;T	0.48836	1.39;0.8;1.39;1.38	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	T	0.70245	0.3202	M	0.74881	2.28	0.80722	D	1	D;D;D;P	0.62365	0.972;0.972;0.991;0.939	P;P;D;P	0.64506	0.703;0.703;0.926;0.703	T	0.70008	-0.4990	10	0.72032	D	0.01	-4.6646	20.8794	0.99867	0.0:1.0:0.0:0.0	.	463;442;463;463	A8K1U0;B7Z5R6;Q14596-2;Q14596	.;.;.;NBR1_HUMAN	Y	463;442;463;463;463	ENSP00000411250:H463Y;ENSP00000437545:H442Y;ENSP00000343479:H463Y;ENSP00000373963:H463Y	ENSP00000343479:H463Y	H	+	1	0	NBR1	38599044	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.487000	0.81328	2.941000	0.99782	0.655000	0.94253	CAC	.	.		0.522	NBR1-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000453461.1	NM_005899	
SPATA20	64847	hgsc.bcm.edu	37	17	48629417	48629417	+	Silent	SNP	G	G	A			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr17:48629417G>A	ENST00000356488.4	+	13	1868	c.1785G>A	c.(1783-1785)gcG>gcA	p.A595A	SPATA20_ENST00000006658.6_Silent_p.A611A|SPATA20_ENST00000393244.3_Silent_p.A551A|SPATA20_ENST00000511937.1_3'UTR	NM_001258372.1	NP_001245301.1	Q8TB22	SPT20_HUMAN	spermatogenesis associated 20	595					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	extracellular region (GO:0005576)	catalytic activity (GO:0003824)			endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(5)|lung(9)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	24	Breast(11;1.23e-18)		BRCA - Breast invasive adenocarcinoma(22;9.38e-09)			AGGAGAGTGCGTGGCTCGAGT	0.657																																					p.A611A		Atlas-SNP	.											.	SPATA20	59	.	0			c.G1833A						.						31.0	35.0	33.0					17																	48629417		2202	4299	6501	SO:0001819	synonymous_variant	64847	exon14			GAGTGCGTGGCTC		CCDS11571.1, CCDS58563.1, CCDS58564.1	17q21.33	2011-03-17			ENSG00000006282	ENSG00000006282			26125	protein-coding gene	gene with protein product	"""hypothetical protein FLJ21347"""	613939				12477932	Standard	NM_022827		Approved	FLJ21347, SSP411, Tisp78	uc002ird.3	Q8TB22	OTTHUMG00000162162	ENST00000356488.4:c.1785G>A	chr17.hg19:g.48629417G>A		223.0	0.0		248.0	81.0	NM_022827	Q2TA99|Q2XUZ6|Q6P0P1|Q8WVW3|Q9H747	Silent	SNP	ENST00000356488.4	hg19	CCDS58563.1																																																																																			.	.		0.657	SPATA20-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000367651.1	NM_022827	
TIMP2	7077	hgsc.bcm.edu	37	17	76888033	76888033	+	Intron	SNP	C	C	A			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr17:76888033C>A	ENST00000262768.7	-	2	429				TIMP2_ENST00000536189.2_Intron|DDC8_ENST00000322630.2_Missense_Mutation_p.G185C	NM_003255.4	NP_003246.1	P16035	TIMP2_HUMAN	TIMP metallopeptidase inhibitor 2						aging (GO:0007568)|cellular response to organic substance (GO:0071310)|central nervous system development (GO:0007417)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of cell proliferation (GO:0008285)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of proteolysis (GO:0045861)|negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of adenylate cyclase activity (GO:0045762)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of neuron differentiation (GO:0045666)|regulation of Rap protein signal transduction (GO:0032487)|response to cytokine (GO:0034097)|response to drug (GO:0042493)	basement membrane (GO:0005604)|cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|neuronal cell body (GO:0043025)	enzyme activator activity (GO:0008047)|metal ion binding (GO:0046872)|metalloendopeptidase inhibitor activity (GO:0008191)			central_nervous_system(2)	2			BRCA - Breast invasive adenocarcinoma(99;0.0101)|OV - Ovarian serous cystadenocarcinoma(97;0.194)			TGTTGCTGGCCCAACTCTTCC	0.607																																					p.G185C		Atlas-SNP	.											.	.	.	.	0			c.G553T						.																																			SO:0001627	intron_variant	0	exon3			GCTGGCCCAACTC		CCDS11758.1	17q25	2008-07-18	2005-08-08		ENSG00000035862	ENSG00000035862			11821	protein-coding gene	gene with protein product		188825	"""tissue inhibitor of metalloproteinase 2"""			1427908	Standard	NM_003255		Approved	CSC-21K	uc002jwf.3	P16035	OTTHUMG00000154517	ENST00000262768.7:c.131-18032G>T	chr17.hg19:g.76888033C>A		179.0	0.0		238.0	144.0	NM_001243540	Q16121|Q93006|Q9UDF7	Missense_Mutation	SNP	ENST00000262768.7	hg19	CCDS11758.1	.	.	.	.	.	.	.	.	.	.	C	11.32	1.604677	0.28623	.	.	ENSG00000178404	ENST00000322630	T	0.22945	1.93	3.61	-7.22	0.01485	.	3.707100	0.01089	N	0.005145	T	0.22244	0.0536	.	.	.	0.09310	N	1	D	0.56521	0.976	P	0.50162	0.633	T	0.44050	-0.9353	9	0.35671	T	0.21	-0.0814	1.0847	0.01650	0.1917:0.1313:0.2908:0.3862	.	185	Q96MC4	.	C	185	ENSP00000312767:G185C	ENSP00000312767:G185C	G	-	1	0	AC100788.1	74399628	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-1.827000	0.01704	-1.805000	0.01239	0.462000	0.41574	GGC	.	.		0.607	TIMP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335662.1	NM_003255	
ANKRD12	23253	hgsc.bcm.edu	37	18	9182491	9182491	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr18:9182491A>G	ENST00000262126.4	+	2	301	c.61A>G	c.(61-63)Atg>Gtg	p.M21V	ANKRD12_ENST00000400020.3_Missense_Mutation_p.M21V|ANKRD12_ENST00000540578.2_3'UTR|ANKRD12_ENST00000383440.2_Missense_Mutation_p.M21V|RP11-21J18.1_ENST00000579126.1_RNA	NM_015208.4	NP_056023.3	Q6UB98	ANR12_HUMAN	ankyrin repeat domain 12	21						cytoplasm (GO:0005737)|nucleus (GO:0005634)				NS(1)|breast(3)|central_nervous_system(2)|endometrium(8)|kidney(2)|large_intestine(20)|lung(18)|ovary(3)|pancreas(1)|prostate(4)|skin(1)|urinary_tract(2)	65						TGACAGCAATATGGTAGAGAA	0.343																																					p.M21V		Atlas-SNP	.											.	ANKRD12	167	.	0			c.A61G						.						70.0	71.0	70.0					18																	9182491		2203	4299	6502	SO:0001583	missense	23253	exon2			AGCAATATGGTAG	AY373757	CCDS11843.1, CCDS42411.1	18p11.22	2013-01-10			ENSG00000101745	ENSG00000101745		"""Ankyrin repeat domain containing"""	29135	protein-coding gene	gene with protein product		610616				10048485	Standard	NM_001204056		Approved	KIAA0874, FLJ20053, GAC-1	uc002knv.3	Q6UB98	OTTHUMG00000131595	ENST00000262126.4:c.61A>G	chr18.hg19:g.9182491A>G	ENSP00000262126:p.Met21Val	81.0	0.0		53.0	35.0	NM_001083625	O94951|Q658K1|Q6QMF7|Q9H231|Q9H784	Missense_Mutation	SNP	ENST00000262126.4	hg19	CCDS11843.1	.	.	.	.	.	.	.	.	.	.	A	15.02	2.708582	0.48517	.	.	ENSG00000101745	ENST00000383440;ENST00000546007;ENST00000262126;ENST00000540578	T;T;T	0.76316	-1.01;0.87;3.49	5.47	5.47	0.80525	.	0.000000	0.85682	D	0.000000	D	0.86024	0.5834	M	0.68952	2.095	0.53688	D	0.999978	P;D;P	0.58268	0.865;0.982;0.865	P;D;P	0.68943	0.824;0.961;0.824	D	0.87480	0.2420	10	0.87932	D	0	-1.5897	14.079	0.64909	1.0:0.0:0.0:0.0	.	21;21;21	Q6PG48;Q6UB98-2;Q6UB98	.;.;ANR12_HUMAN	V	21	ENSP00000372932:M21V;ENSP00000441510:M21V;ENSP00000262126:M21V	ENSP00000262126:M21V	M	+	1	0	ANKRD12	9172491	1.000000	0.71417	1.000000	0.80357	0.929000	0.56500	5.674000	0.68117	2.203000	0.70933	0.482000	0.46254	ATG	.	.		0.343	ANKRD12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254478.2	NM_015208	
HRH4	59340	hgsc.bcm.edu	37	18	22057509	22057509	+	Silent	SNP	C	C	A	rs115905515	byFrequency	TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr18:22057509C>A	ENST00000256906.4	+	3	1256	c.1156C>A	c.(1156-1158)Cgg>Agg	p.R386R	HRH4_ENST00000426880.2_Silent_p.R298R	NM_001160166.1|NM_021624.3	NP_001153638.1|NP_067637.2	Q9H3N8	HRH4_HUMAN	histamine receptor H4	386					inflammatory response (GO:0006954)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of MAPK cascade (GO:0043408)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	histamine receptor activity (GO:0004969)			endometrium(2)|kidney(1)|large_intestine(4)|lung(10)|ovary(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22	all_cancers(21;0.000545)|all_epithelial(16;6.56e-06)|Lung NSC(20;0.0027)|all_lung(20;0.0085)|Colorectal(14;0.0361)|Ovarian(20;0.0991)				Amitriptyline(DB00321)|Amoxapine(DB00543)|Chlorpromazine(DB00477)|Clozapine(DB00363)|Doxepin(DB01142)|Histamine Phosphate(DB00667)|Loxapine(DB00408)|Mianserin(DB06148)|Olanzapine(DB00334)	ACAACACAGTCGGTCAGTATC	0.358																																					p.R386R		Atlas-SNP	.											.	HRH4	46	.	0			c.C1156A						.						48.0	49.0	48.0					18																	22057509		2203	4298	6501	SO:0001819	synonymous_variant	59340	exon3			CACAGTCGGTCAG	AF312230	CCDS11887.1, CCDS45841.1	18q11.2	2012-08-08			ENSG00000134489	ENSG00000134489		"""GPCR / Class A : Histamine receptors"""	17383	protein-coding gene	gene with protein product		606792				11118334, 10973974	Standard	NM_021624		Approved	H4R, HH4R, AXOR35, GPCR105, GPRv53	uc002kvi.3	Q9H3N8	OTTHUMG00000131945	ENST00000256906.4:c.1156C>A	chr18.hg19:g.22057509C>A		83.0	0.0		80.0	30.0	NM_021624	B0YJ19|B2KJ48|Q4G0I6|Q9GZQ0	Silent	SNP	ENST00000256906.4	hg19	CCDS11887.1																																																																																			.	C|0.998;T|0.002		0.358	HRH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254904.1		
DSC2	1824	hgsc.bcm.edu	37	18	28650707	28650707	+	Silent	SNP	A	A	T			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr18:28650707A>T	ENST00000280904.6	-	14	2678	c.2235T>A	c.(2233-2235)ccT>ccA	p.P745P	DSC2_ENST00000251081.6_Silent_p.P745P|snoU13_ENST00000459603.1_RNA	NM_024422.3	NP_077740.1	Q02487	DSC2_HUMAN	desmocollin 2	745					bundle of His cell to Purkinje myocyte communication (GO:0086069)|cardiac muscle cell-cardiac muscle cell adhesion (GO:0086042)|cell adhesion (GO:0007155)|cellular response to starvation (GO:0009267)|homophilic cell adhesion (GO:0007156)|regulation of heart rate by cardiac conduction (GO:0086091)|ventricular cardiac muscle cell action potential (GO:0086005)	cell-cell adherens junction (GO:0005913)|cytoplasmic vesicle (GO:0031410)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intercalated disc (GO:0014704)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(2)|kidney(1)|large_intestine(2)|lung(12)|ovary(2)|prostate(1)|skin(1)	21			OV - Ovarian serous cystadenocarcinoma(10;0.0241)			TGTCATCTCCAGGAGCTTCTG	0.383																																					p.P745P		Atlas-SNP	.											.	DSC2	168	.	0			c.T2235A						.						115.0	119.0	117.0					18																	28650707		2203	4300	6503	SO:0001819	synonymous_variant	1824	exon14			ATCTCCAGGAGCT	X56807	CCDS11892.1, CCDS11893.1	18q12.1	2014-09-17			ENSG00000134755	ENSG00000134755		"""Cadherins / Major cadherins"""	3036	protein-coding gene	gene with protein product		125645		DSC3		7774948	Standard	NM_024422		Approved	CDHF2	uc002kwl.4	Q02487	OTTHUMG00000131981	ENST00000280904.6:c.2235T>A	chr18.hg19:g.28650707A>T		166.0	0.0		114.0	73.0	NM_024422		Silent	SNP	ENST00000280904.6	hg19	CCDS11892.1																																																																																			.	.		0.383	DSC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254943.1	NM_004949	
GAREM	64762	hgsc.bcm.edu	37	18	29890226	29890226	+	Missense_Mutation	SNP	C	C	A			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr18:29890226C>A	ENST00000269209.6	-	3	326	c.323G>T	c.(322-324)aGt>aTt	p.S108I	GAREM_ENST00000578619.1_5'UTR|GAREM_ENST00000399218.4_Missense_Mutation_p.S108I			Q9H706	GAREM_HUMAN	GRB2 associated, regulator of MAPK1	108	CABIT.				cellular response to epidermal growth factor stimulus (GO:0071364)|epidermal growth factor receptor signaling pathway (GO:0007173)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)	plasma membrane (GO:0005886)	proline-rich region binding (GO:0070064)										CTCCTCCACACTGTTGAAATA	0.418																																					p.S108I		Atlas-SNP	.											FAM59A,NS,adenocarcinoma,0,1	.	.	.	0			c.G323T						.						244.0	210.0	221.0					18																	29890226		2203	4300	6503	SO:0001583	missense	64762	exon3			TCCACACTGTTGA	AK025263	CCDS11905.1, CCDS56057.1	18q12.1	2012-11-30	2012-11-30	2012-11-30	ENSG00000141441	ENSG00000141441			26136	protein-coding gene	gene with protein product	"""Grb2-associated and regulator of Erk/MAPK"""		"""chromosome 18 open reading frame 11"", ""family with sequence similarity 59, member A"""	C18orf11, FAM59A		19509291	Standard	NM_001242409		Approved	FLJ21610	uc002kxl.3	Q9H706	OTTHUMG00000132273	ENST00000269209.6:c.323G>T	chr18.hg19:g.29890226C>A	ENSP00000269209:p.Ser108Ile	275.0	0.0		179.0	50.0	NM_022751	Q0VAG3|Q0VAG4|Q8ND03|Q9BSF5	Missense_Mutation	SNP	ENST00000269209.6	hg19	CCDS56057.1	.	.	.	.	.	.	.	.	.	.	C	33	5.224369	0.95139	.	.	ENSG00000141441	ENST00000399218;ENST00000269209	T;T	0.20332	2.08;2.08	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	T	0.51568	0.1682	M	0.77616	2.38	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.91635	0.999;0.996	T	0.52480	-0.8570	10	0.87932	D	0	-16.913	19.9625	0.97256	0.0:1.0:0.0:0.0	.	108;108	Q9H706;Q9H706-3	FA59A_HUMAN;.	I	108	ENSP00000382165:S108I;ENSP00000269209:S108I	ENSP00000269209:S108I	S	-	2	0	FAM59A	28144224	1.000000	0.71417	0.982000	0.44146	0.991000	0.79684	7.420000	0.80191	2.726000	0.93360	0.655000	0.94253	AGT	.	.		0.418	GAREM-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255365.1	NM_022751	
DTNA	1837	hgsc.bcm.edu	37	18	32438291	32438291	+	Silent	SNP	A	A	G			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr18:32438291A>G	ENST00000399113.3	+	15	1494	c.1494A>G	c.(1492-1494)gaA>gaG	p.E498E	DTNA_ENST00000556414.3_Silent_p.E150E|DTNA_ENST00000591182.1_Silent_p.E146E|DTNA_ENST00000399121.5_Silent_p.E438E|DTNA_ENST00000595022.1_Silent_p.E438E|DTNA_ENST00000269191.6_Silent_p.E498E|DTNA_ENST00000597674.1_Silent_p.E120E|DTNA_ENST00000348997.5_Silent_p.E495E|DTNA_ENST00000597599.1_Silent_p.E438E|DTNA_ENST00000399097.3_Silent_p.E146E|DTNA_ENST00000596745.1_Silent_p.E248E|DTNA_ENST00000283365.9_Silent_p.E441E|DTNA_ENST00000598334.1_Silent_p.E438E|DTNA_ENST00000598774.1_Silent_p.E441E|DTNA_ENST00000269192.7_Silent_p.E207E|DTNA_ENST00000269190.7_Silent_p.E499E|DTNA_ENST00000601125.1_Silent_p.E120E|DTNA_ENST00000598142.1_Silent_p.E441E|DTNA_ENST00000599844.1_Silent_p.E120E|DTNA_ENST00000444659.1_Silent_p.E498E			Q9Y4J8	DTNA_HUMAN	dystrobrevin, alpha	498					neuromuscular synaptic transmission (GO:0007274)|signal transduction (GO:0007165)|striated muscle contraction (GO:0006941)|synaptic transmission (GO:0007268)	axon (GO:0030424)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|synapse (GO:0045202)	calcium ion binding (GO:0005509)|zinc ion binding (GO:0008270)			endometrium(1)|haematopoietic_and_lymphoid_tissue(4)|kidney(1)|large_intestine(2)|lung(19)|prostate(1)|upper_aerodigestive_tract(1)	29						TAGAGCATGAACAAGCTTCTC	0.522																																					p.E498E		Atlas-SNP	.											.	DTNA	321	.	0			c.A1494G						.						66.0	64.0	65.0					18																	32438291		2203	4300	6503	SO:0001819	synonymous_variant	1837	exon15			GCATGAACAAGCT	U84540	CCDS11908.1, CCDS11909.1, CCDS42426.1, CCDS45848.1, CCDS56060.1, CCDS56061.1, CCDS56062.1, CCDS56063.1, CCDS59309.1, CCDS59310.1, CCDS59311.1, CCDS59312.1, CCDS59313.1, CCDS59314.1	18q12	2014-09-17			ENSG00000134769	ENSG00000134769			3057	protein-coding gene	gene with protein product	"""dystrophin-related protein 3"""	601239				8081380, 15834686	Standard	NM_001390		Approved	D18S892E, DTN, DTN-1, DTN-2, DTN-3, DRP3	uc010dmn.1	Q9Y4J8	OTTHUMG00000132309	ENST00000399113.3:c.1494A>G	chr18.hg19:g.32438291A>G		113.0	0.0		74.0	42.0	NM_001390	A8K541|A8MSZ0|A8MUY4|B4DGS6|B4DIR0|B4DIU8|M0QYX6|M0R397|O15332|O15333|O75697|Q13197|Q13198|Q13199|Q13498|Q13499|Q13500|Q59GK7|Q9BS59	Silent	SNP	ENST00000399113.3	hg19	CCDS59311.1																																																																																			.	.		0.522	DTNA-005	PUTATIVE	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255422.2	NM_001390	
MALT1	10892	hgsc.bcm.edu	37	18	56401614	56401614	+	Splice_Site	SNP	G	G	A			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr18:56401614G>A	ENST00000348428.3	+	12	1733		c.e12+1		MALT1_ENST00000345724.3_Splice_Site|RP11-126O1.4_ENST00000588835.1_RNA	NM_006785.2|NM_173844.1	NP_006776.1|NP_776216.1	Q9UDY8	MALT1_HUMAN	mucosa associated lymphoid tissue lymphoma translocation gene 1						activation of NF-kappaB-inducing kinase activity (GO:0007250)|B-1 B cell differentiation (GO:0001923)|defense response (GO:0006952)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|negative regulation of apoptotic process (GO:0043066)|nuclear export (GO:0051168)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-2 production (GO:0032743)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of T cell activation (GO:0050870)|positive regulation of T cell cytokine production (GO:0002726)|protein oligomerization (GO:0051259)|protein ubiquitination (GO:0016567)|proteolysis (GO:0006508)|regulation of apoptotic process (GO:0042981)|regulation of T cell receptor signaling pathway (GO:0050856)|response to fungus (GO:0009620)|response to molecule of bacterial origin (GO:0002237)|T cell proliferation (GO:0042098)|T cell receptor signaling pathway (GO:0050852)	CBM complex (GO:0032449)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	cysteine-type endopeptidase activity (GO:0004197)|peptidase activity (GO:0008233)|protein self-association (GO:0043621)|signal transducer activity (GO:0004871)|ubiquitin-protein transferase activity (GO:0004842)			central_nervous_system(1)|large_intestine(7)|lung(1)|ovary(2)|skin(1)	12						GATATGCCACGTAAGAACATT	0.413			T	BIRC3	MALT																																.		Atlas-SNP	.		Dom	yes		18	18q21	10892	mucosa associated lymphoid tissue lymphoma translocation gene 1		L	.	MALT1	55	.	0			c.1475+1G>A						.						134.0	114.0	121.0					18																	56401614		2203	4300	6503	SO:0001630	splice_region_variant	10892	exon12			TGCCACGTAAGAA		CCDS11967.1, CCDS11968.1	18q21	2013-01-11			ENSG00000172175	ENSG00000172175		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6819	protein-coding gene	gene with protein product	"""paracaspase"""	604860		MLT		10339464, 10406266, 10523859	Standard	NM_006785		Approved		uc002lhm.1	Q9UDY8	OTTHUMG00000132761	ENST00000348428.3:c.1475+1G>A	chr18.hg19:g.56401614G>A		198.0	0.0		117.0	73.0	NM_006785	Q9NTB7|Q9ULX4	Splice_Site	SNP	ENST00000348428.3	hg19	CCDS11967.1	.	.	.	.	.	.	.	.	.	.	G	27.7	4.852421	0.91355	.	.	ENSG00000172175	ENST00000348428;ENST00000345724	.	.	.	5.88	5.88	0.94601	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.0095	0.92867	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	MALT1	54552594	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	9.476000	0.97823	2.779000	0.95612	0.650000	0.86243	.	.	.		0.413	MALT1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256132.2		Intron
PIGN	23556	hgsc.bcm.edu	37	18	59768329	59768329	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr18:59768329T>C	ENST00000357637.5	-	22	2471	c.2056A>G	c.(2056-2058)Att>Gtt	p.I686V	PIGN_ENST00000400334.3_Missense_Mutation_p.I686V	NM_176787.4	NP_789744.1	O95427	PIGN_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class N	686					C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|preassembly of GPI anchor in ER membrane (GO:0016254)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	transferase activity (GO:0016740)			breast(3)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(2)|lung(7)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	22		Colorectal(73;0.187)				CAGCTAATAATTTGATTCATG	0.398																																					p.I686V		Atlas-SNP	.											.	PIGN	62	.	0			c.A2056G						.						94.0	88.0	90.0					18																	59768329		1895	4119	6014	SO:0001583	missense	23556	exon22			TAATAATTTGATT	AF109219	CCDS45879.1	18q21.33	2013-02-26	2006-06-28		ENSG00000197563	ENSG00000197563		"""Phosphatidylinositol glycan anchor biosynthesis"""	8967	protein-coding gene	gene with protein product		606097	"""phosphatidylinositol glycan, class N"""			10069808, 10574991	Standard	NM_012327		Approved	MDC4, PIG-N	uc021ulb.1	O95427	OTTHUMG00000180098	ENST00000357637.5:c.2056A>G	chr18.hg19:g.59768329T>C	ENSP00000350263:p.Ile686Val	81.0	0.0		56.0	37.0	NM_176787	Q7L8F8|Q8TC01|Q9NT05	Missense_Mutation	SNP	ENST00000357637.5	hg19	CCDS45879.1	.	.	.	.	.	.	.	.	.	.	T	7.451	0.642660	0.14451	.	.	ENSG00000197563	ENST00000357637;ENST00000400334	T;T	0.53640	0.61;0.61	5.57	3.2	0.36748	GPI ethanolamine phosphate transferase 1, C-terminal (1);	0.407110	0.26971	N	0.021573	T	0.29716	0.0742	L	0.28504	0.86	0.38908	D	0.957467	B;B	0.15473	0.013;0.013	B;B	0.20955	0.032;0.032	T	0.10847	-1.0612	10	0.05959	T	0.93	-8.9591	9.6172	0.39698	0.0:0.1423:0.0:0.8577	.	686;686	B2RCI8;O95427	.;PIGN_HUMAN	V	686	ENSP00000350263:I686V;ENSP00000383188:I686V	ENSP00000350263:I686V	I	-	1	0	PIGN	57919309	0.993000	0.37304	0.796000	0.32109	0.887000	0.51463	0.908000	0.28545	0.928000	0.37168	0.477000	0.44152	ATT	.	.		0.398	PIGN-001	KNOWN	non_canonical_genome_sequence_error|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449757.2	NM_176787	
ZNF729	100287226	hgsc.bcm.edu	37	19	22499233	22499233	+	Nonsense_Mutation	SNP	C	C	A			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr19:22499233C>A	ENST00000601693.1	+	4	3132	c.3014C>A	c.(3013-3015)tCa>tAa	p.S1005*	ZNF729_ENST00000357491.6_Nonsense_Mutation_p.S977*			A6NN14	ZN729_HUMAN	zinc finger protein 729	1005					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(5)|central_nervous_system(1)|lung(32)|ovary(3)	41						AACAATTCCTCAACCCTTAAG	0.348																																					p.S1005X		Atlas-SNP	.											.	ZNF729	78	.	0			c.C3014A						.																																			SO:0001587	stop_gained	100287226	exon4			ATTCCTCAACCCT		CCDS59368.1	19p12	2014-02-14			ENSG00000196350	ENSG00000196350		"""Zinc fingers, C2H2-type"", ""-"""	32464	protein-coding gene	gene with protein product							Standard	NM_001242680		Approved		uc021urs.1	A6NN14	OTTHUMG00000182938	ENST00000601693.1:c.3014C>A	chr19.hg19:g.22499233C>A	ENSP00000469582:p.Ser1005*	137.0	0.0		130.0	61.0	NM_001242680	M0QY45	Nonsense_Mutation	SNP	ENST00000601693.1	hg19	CCDS59368.1	.	.	.	.	.	.	.	.	.	.	.	19.42	3.824681	0.71143	.	.	ENSG00000196350	ENST00000357491	.	.	.	0.131	0.131	0.14755	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	7.741	0.28841	0.0:0.9999:0.0:1.0E-4	.	.	.	.	X	977	.	ENSP00000350085:S977X	S	+	2	0	ZNF729	22291073	0.001000	0.12720	0.019000	0.16419	0.019000	0.09904	0.878000	0.28126	0.171000	0.19730	0.174000	0.16983	TCA	.	.		0.348	ZNF729-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464396.1	XM_496301	
ZNF229	7772	hgsc.bcm.edu	37	19	44934591	44934591	+	Missense_Mutation	SNP	C	C	G			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr19:44934591C>G	ENST00000588931.1	-	6	798	c.365G>C	c.(364-366)tGt>tCt	p.C122S	ZNF229_ENST00000591289.1_Intron|ZNF229_ENST00000291187.4_Missense_Mutation_p.C116S|CTC-512J12.4_ENST00000588655.1_RNA	NM_014518.2	NP_055333.2	Q9UJW7	ZN229_HUMAN	zinc finger protein 229	122					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(5)|central_nervous_system(2)|endometrium(6)|large_intestine(3)|lung(18)|ovary(1)|pancreas(1)|prostate(1)|skin(5)|stomach(2)|upper_aerodigestive_tract(1)	45		Prostate(69;0.0352)				ATTTACTCTACAGTCTTGGCT	0.443																																					p.C122S		Atlas-SNP	.											.	ZNF229	123	.	0			c.G365C						.						80.0	78.0	79.0					19																	44934591		1874	4089	5963	SO:0001583	missense	7772	exon6			ACTCTACAGTCTT	AF192979	CCDS42574.1, CCDS62706.1	19q13.2	2013-01-08				ENSG00000278318		"""Zinc fingers, C2H2-type"", ""-"""	13022	protein-coding gene	gene with protein product							Standard	XM_006723372		Approved		uc002oze.1	Q9UJW7		ENST00000588931.1:c.365G>C	chr19.hg19:g.44934591C>G	ENSP00000466519:p.Cys122Ser	169.0	0.0		106.0	25.0	NM_014518	B2RWN3|Q59FV2|Q86WL9	Missense_Mutation	SNP	ENST00000588931.1	hg19	CCDS42574.1	.	.	.	.	.	.	.	.	.	.	C	0.308	-0.969550	0.02232	.	.	ENSG00000167383	ENST00000291187	.	.	.	3.33	-6.65	0.01795	.	.	.	.	.	T	0.14141	0.0342	N	0.12746	0.255	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.08889	-1.0700	8	0.21014	T	0.42	.	3.3636	0.07196	0.0871:0.4048:0.2242:0.284	.	122	Q9UJW7	ZN229_HUMAN	S	122	.	ENSP00000291187:C122S	C	-	2	0	ZNF229	49626431	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-4.896000	0.00172	-3.665000	0.00124	-0.198000	0.12761	TGT	.	.		0.443	ZNF229-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000460833.1	NM_014518	
SYT3	84258	hgsc.bcm.edu	37	19	51133064	51133064	+	Missense_Mutation	SNP	G	G	T			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr19:51133064G>T	ENST00000338916.4	-	3	1672	c.1039C>A	c.(1039-1041)Cgc>Agc	p.R347S	SYT3_ENST00000600079.1_Missense_Mutation_p.R347S|SYT3_ENST00000544769.1_Missense_Mutation_p.R347S|SYT3_ENST00000593901.1_Missense_Mutation_p.R347S	NM_032298.2	NP_115674.1	Q9BQG1	SYT3_HUMAN	synaptotagmin III	347	C2 1. {ECO:0000255|PROSITE- ProRule:PRU00041}.				calcium ion-dependent exocytosis (GO:0017156)|positive regulation of vesicle fusion (GO:0031340)|response to calcium ion (GO:0051592)	cell junction (GO:0030054)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|synaptic vesicle (GO:0008021)	calcium-dependent phospholipid binding (GO:0005544)|metal ion binding (GO:0046872)|phosphatidylserine binding (GO:0001786)|transporter activity (GO:0005215)			breast(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(16)|ovary(2)|prostate(2)|skin(3)|urinary_tract(2)	35		all_neural(266;0.131)		OV - Ovarian serous cystadenocarcinoma(262;0.00462)|GBM - Glioblastoma multiforme(134;0.0188)		TTTTTCTTGCGGTCAGGCAGC	0.622																																					p.R347S		Atlas-SNP	.											.	SYT3	85	.	0			c.C1039A						.						61.0	61.0	61.0					19																	51133064		2203	4300	6503	SO:0001583	missense	84258	exon3			TCTTGCGGTCAGG	AL136594	CCDS12798.1	19q13.33	2014-07-02			ENSG00000213023	ENSG00000213023		"""Synaptotagmins"""	11511	protein-coding gene	gene with protein product		600327				7749232	Standard	NM_032298		Approved		uc002psv.3	Q9BQG1	OTTHUMG00000183064	ENST00000338916.4:c.1039C>A	chr19.hg19:g.51133064G>T	ENSP00000340914:p.Arg347Ser	91.0	0.0		35.0	7.0	NM_032298	Q8N5Z1|Q8N640	Missense_Mutation	SNP	ENST00000338916.4	hg19	CCDS12798.1	.	.	.	.	.	.	.	.	.	.	G	19.21	3.783077	0.70222	.	.	ENSG00000213023	ENST00000338916;ENST00000544769	T;T	0.08546	3.08;3.08	4.67	4.67	0.58626	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.000000	0.64402	U	0.000011	T	0.19644	0.0472	L	0.38692	1.165	0.58432	D	0.999997	D	0.76494	0.999	D	0.66602	0.945	T	0.00978	-1.1493	10	0.87932	D	0	.	16.7093	0.85381	0.0:0.0:1.0:0.0	.	347	Q9BQG1	SYT3_HUMAN	S	347	ENSP00000340914:R347S;ENSP00000438883:R347S	ENSP00000340914:R347S	R	-	1	0	SYT3	55824876	1.000000	0.71417	0.998000	0.56505	0.783000	0.44284	2.641000	0.46587	2.301000	0.77427	0.655000	0.94253	CGC	.	.		0.622	SYT3-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464910.1	NM_032298	
LILRA5	353514	hgsc.bcm.edu	37	19	54823336	54823336	+	Silent	SNP	C	C	A			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr19:54823336C>A	ENST00000301219.3	-	4	326	c.207G>T	c.(205-207)ggG>ggT	p.G69G	LILRA5_ENST00000432233.3_Silent_p.G69G|LILRA5_ENST00000346508.3_Silent_p.G57G|LILRA5_ENST00000446712.3_Silent_p.G57G|AC008984.2_ENST00000507363.1_RNA	NM_021250.2	NP_067073.1	A6NI73	LIRA5_HUMAN	leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 5	69	Ig-like C2-type 1.				innate immune response (GO:0045087)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				breast(1)|endometrium(2)|large_intestine(4)|lung(6)|ovary(1)|prostate(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	20	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		CCTCCAGGGTCCCCTGACACC	0.587																																					p.G69G		Atlas-SNP	.											.	LILRA5	49	.	0			c.G207T						.						160.0	148.0	152.0					19																	54823336		2203	4300	6503	SO:0001819	synonymous_variant	353514	exon4			CAGGGTCCCCTGA	AF212842	CCDS12888.1, CCDS12889.1	19q13.4	2013-01-11	2005-05-13	2005-05-13	ENSG00000187116	ENSG00000187116		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	16309	protein-coding gene	gene with protein product		606047		LILRB7		10941842	Standard	NM_181986		Approved	ILT11, LIR9, CD85, CD85f	uc002qfe.3	A6NI73	OTTHUMG00000065357	ENST00000301219.3:c.207G>T	chr19.hg19:g.54823336C>A		297.0	1.0		204.0	122.0	NM_181879	A6NHI3	Silent	SNP	ENST00000301219.3	hg19	CCDS12888.1																																																																																			.	.		0.587	LILRA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000140231.1	NM_181985	
LILRA1	11024	hgsc.bcm.edu	37	19	55111991	55111991	+	Missense_Mutation	SNP	C	C	A			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr19:55111991C>A	ENST00000251372.3	+	9	1509	c.1327C>A	c.(1327-1329)Ctc>Atc	p.L443I	LILRB1_ENST00000448689.1_Intron|LILRA1_ENST00000473156.1_3'UTR|LILRA1_ENST00000453777.1_Missense_Mutation_p.L243I|LILRB1_ENST00000396321.2_Intron|LILRB1_ENST00000418536.2_Intron	NM_006863.2	NP_006854.1	O75019	LIRA1_HUMAN	leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 1	443					cell surface receptor signaling pathway (GO:0007166)|defense response (GO:0006952)|immune system process (GO:0002376)|regulation of immune response (GO:0050776)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	antigen binding (GO:0003823)|transmembrane signaling receptor activity (GO:0004888)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(5)|liver(1)|lung(23)|ovary(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)	47				GBM - Glioblastoma multiforme(193;0.0348)		AGCTAACACCCTCAGCCCATC	0.537																																					p.L443I		Atlas-SNP	.											.	LILRA1	105	.	0			c.C1327A						.						96.0	96.0	96.0					19																	55111991		2203	4300	6503	SO:0001583	missense	11024	exon9			AACACCCTCAGCC	AF025530	CCDS12901.1, CCDS62802.1	19q13.4	2013-01-11			ENSG00000104974	ENSG00000104974		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6602	protein-coding gene	gene with protein product		604810				9548455	Standard	NM_006863		Approved	LIR-6, CD85i, LIR6	uc002qgh.2	O75019	OTTHUMG00000065701	ENST00000251372.3:c.1327C>A	chr19.hg19:g.55111991C>A	ENSP00000251372:p.Leu443Ile	103.0	0.0		62.0	15.0	NM_006863	O75018|Q3MJA6	Missense_Mutation	SNP	ENST00000251372.3	hg19	CCDS12901.1	.	.	.	.	.	.	.	.	.	.	C	2.191	-0.385190	0.04966	.	.	ENSG00000104974	ENST00000251372;ENST00000453777	T;T	0.00531	6.76;6.89	1.75	-3.5	0.04710	.	.	.	.	.	T	0.00356	0.0011	L	0.43152	1.355	0.09310	N	1	B	0.31519	0.327	B	0.19148	0.024	T	0.34254	-0.9836	9	0.20046	T	0.44	.	7.8519	0.29459	0.2912:0.7088:0.0:0.0	.	443	O75019	LIRA1_HUMAN	I	443;243	ENSP00000251372:L443I;ENSP00000413715:L243I	ENSP00000251372:L443I	L	+	1	0	LILRA1	59803803	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-1.580000	0.02121	-0.674000	0.05253	0.195000	0.17529	CTC	.	.		0.537	LILRA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000140807.2	NM_006863	
ERGIC3	51614	hgsc.bcm.edu	37	20	34130635	34130635	+	Missense_Mutation	SNP	C	C	A			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr20:34130635C>A	ENST00000348547.2	+	4	389	c.312C>A	c.(310-312)ttC>ttA	p.F104L	ERGIC3_ENST00000357394.4_Missense_Mutation_p.F104L|ERGIC3_ENST00000447986.1_Missense_Mutation_p.F104L|ERGIC3_ENST00000279052.6_Missense_Mutation_p.F104L	NM_015966.2	NP_057050.1	Q9Y282	ERGI3_HUMAN	ERGIC and golgi 3	104					vesicle-mediated transport (GO:0016192)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)				breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(4)|lung(4)|ovary(1)|prostate(1)	16	Lung NSC(9;0.00489)|all_lung(11;0.00729)		BRCA - Breast invasive adenocarcinoma(18;0.0127)			ACAACCTGTTCAAGCAACGAC	0.547																																					p.F104L		Atlas-SNP	.											.	ERGIC3	41	.	0			c.C312A						.						147.0	112.0	124.0					20																	34130635		2203	4300	6503	SO:0001583	missense	51614	exon4			CCTGTTCAAGCAA	AF077030	CCDS13257.1, CCDS13258.1	20q11.22	2013-09-19	2006-01-19	2006-01-19	ENSG00000125991	ENSG00000125991			15927	protein-coding gene	gene with protein product			"""serologically defined breast cancer antigen 84"", ""chromosome 20 open reading frame 47"""	SDBCAG84, C20orf47		10810093	Standard	NM_015966		Approved	CGI-54, PRO0989, NY-BR-84, Erv46	uc002xcs.3	Q9Y282	OTTHUMG00000032346	ENST00000348547.2:c.312C>A	chr20.hg19:g.34130635C>A	ENSP00000341358:p.Phe104Leu	150.0	0.0		140.0	53.0	NM_015966	Q5JWS3|Q6ZWP7|Q9H276|Q9P1L3	Missense_Mutation	SNP	ENST00000348547.2	hg19	CCDS13257.1	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	C|C|C	15.41|15.41|15.41	2.824972|2.824972|2.824972	0.50739|0.50739|0.50739	.|.|.	.|.|.	ENSG00000125991|ENSG00000125991|ENSG00000125991	ENST00000348547;ENST00000357394;ENST00000447986;ENST00000279052;ENST00000411577|ENST00000413587|ENST00000416206	T;T;T;T;T|.|.	0.42513|.|.	0.98;0.99;0.97;0.98;0.97|.|.	5.25|5.25|5.25	1.22|1.22|1.22	0.21188|0.21188|0.21188	.|.|.	0.050723|.|.	0.85682|.|.	D|.|.	0.000000|.|.	T|T|.	0.53769|0.53769|.	0.1817|0.1817|.	L|L|L	0.45422|0.45422|0.45422	1.42|1.42|1.42	0.80722|0.80722|0.80722	D|D|D	1|1|1	B;B;B;B;B;B|.|.	0.09022|.|.	0.002;0.002;0.001;0.001;0.001;0.001|.|.	B;B;B;B;B;B|.|.	0.19148|.|.	0.008;0.024;0.003;0.006;0.008;0.003|.|.	T|T|.	0.41822|0.41822|.	-0.9487|-0.9487|.	10|5|.	0.17369|.|.	T|.|.	0.5|.|.	-18.1001|-18.1001|-18.1001	9.7158|9.7158|9.7158	0.40274|0.40274|0.40274	0.0:0.6255:0.0:0.3745|0.0:0.6255:0.0:0.3745|0.0:0.6255:0.0:0.3745	.|.|.	104;104;104;104;104;104|.|.	B4DV36;E9PFA8;Q9Y282;Q9Y282-3;Q9Y282-2;A2TJK5|.|.	.;.;ERGI3_HUMAN;.;.;.|.|.	L|K|X	104;104;104;104;98|106|103	ENSP00000341358:F104L;ENSP00000349970:F104L;ENSP00000392341:F104L;ENSP00000279052:F104L;ENSP00000414490:F98L|.|.	ENSP00000279052:F104L|.|.	F|Q|S	+|+|+	3|1|2	2|0|0	ERGIC3|ERGIC3|ERGIC3	33594049|33594049|33594049	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	0.997000|0.997000|0.997000	0.53966|0.53966|0.53966	0.902000|0.902000|0.902000	0.53008|0.53008|0.53008	0.774000|0.774000|0.774000	0.26675|0.26675|0.26675	0.098000|0.098000|0.098000	0.17522|0.17522|0.17522	-0.680000|-0.680000|-0.680000	0.03767|0.03767|0.03767	TTC|CAA|TCA	.	.		0.547	ERGIC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078880.2	NM_015966	
SLC12A5	57468	hgsc.bcm.edu	37	20	44686186	44686186	+	Missense_Mutation	SNP	T	T	G			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr20:44686186T>G	ENST00000454036.2	+	26	3411	c.3362T>G	c.(3361-3363)cTg>cGg	p.L1121R	SLC12A5_ENST00000243964.3_Missense_Mutation_p.L1098R	NM_001134771.1	NP_001128243.1	Q9H2X9	S12A5_HUMAN	solute carrier family 12 (potassium/chloride transporter), member 5	1121					cellular ion homeostasis (GO:0006873)|chloride transmembrane transport (GO:1902476)|ion transport (GO:0006811)|learning (GO:0007612)|multicellular organism growth (GO:0035264)|potassium ion transport (GO:0006813)|response to drug (GO:0042493)|synaptic transmission (GO:0007268)|thermosensory behavior (GO:0040040)|transmembrane transport (GO:0055085)|transport (GO:0006810)	dendritic shaft (GO:0043198)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	potassium:chloride symporter activity (GO:0015379)|protein kinase binding (GO:0019901)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|liver(1)|lung(38)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)	80		Myeloproliferative disorder(115;0.0122)			Bumetanide(DB00887)|Potassium Chloride(DB00761)	ACAGAGCACCTGGACCGGGTG	0.677																																					p.L1121R		Atlas-SNP	.											.	SLC12A5	181	.	0			c.T3362G						.						49.0	54.0	52.0					20																	44686186		2203	4300	6503	SO:0001583	missense	57468	exon26			AGCACCTGGACCG	AB033002	CCDS13391.1, CCDS46610.1	20q13.12	2013-05-22	2010-04-20		ENSG00000124140	ENSG00000124140		"""Solute carriers"""	13818	protein-coding gene	gene with protein product		606726					Standard	NM_020708		Approved	KIAA1176, KCC2	uc010zxl.1	Q9H2X9	OTTHUMG00000032638	ENST00000454036.2:c.3362T>G	chr20.hg19:g.44686186T>G	ENSP00000387694:p.Leu1121Arg	204.0	0.0		174.0	67.0	NM_001134771	A2RTX2|Q5VZ41|Q9H4Z0|Q9ULP4	Missense_Mutation	SNP	ENST00000454036.2	hg19	CCDS46610.1	.	.	.	.	.	.	.	.	.	.	T	20.2	3.941138	0.73557	.	.	ENSG00000124140	ENST00000454036;ENST00000243964	T;T	0.60672	0.17;0.17	4.24	4.24	0.50183	.	0.175663	0.38720	N	0.001585	T	0.80199	0.4579	M	0.92507	3.315	0.80722	D	1	D;D	0.89917	0.998;1.0	D;D	0.87578	0.947;0.998	D	0.85025	0.0914	10	0.87932	D	0	.	12.6986	0.57018	0.0:0.0:0.0:1.0	.	1121;1098	Q9H2X9;Q9H2X9-2	S12A5_HUMAN;.	R	1121;1098	ENSP00000387694:L1121R;ENSP00000243964:L1098R	ENSP00000243964:L1098R	L	+	2	0	SLC12A5	44119593	1.000000	0.71417	1.000000	0.80357	0.950000	0.60333	5.637000	0.67854	1.778000	0.52293	0.454000	0.30748	CTG	.	.		0.677	SLC12A5-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000471538.1		
BACE2	25825	hgsc.bcm.edu	37	21	42622762	42622762	+	Silent	SNP	T	T	A			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr21:42622762T>A	ENST00000330333.6	+	7	1531	c.1068T>A	c.(1066-1068)ccT>ccA	p.P356P	BACE2_ENST00000466122.1_3'UTR|BACE2_ENST00000328735.6_Silent_p.P356P|BACE2_ENST00000347667.5_Intron	NM_012105.3	NP_036237.2	Q9Y5Z0	BACE2_HUMAN	beta-site APP-cleaving enzyme 2	356					membrane protein ectodomain proteolysis (GO:0006509)|negative regulation of amyloid precursor protein biosynthetic process (GO:0042985)|peptide hormone processing (GO:0016486)|proteolysis (GO:0006508)	endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	aspartic-type endopeptidase activity (GO:0004190)			endometrium(2)|large_intestine(3)|lung(4)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	14		Prostate(19;1.57e-07)|all_epithelial(19;0.0251)				CTTACTTCCCTAAAATCTCCA	0.458																																					p.P356P		Atlas-SNP	.											.	BACE2	45	.	0			c.T1068A						.						125.0	107.0	113.0					21																	42622762		2203	4300	6503	SO:0001819	synonymous_variant	25825	exon7			CTTCCCTAAAATC	AF117892	CCDS13668.1, CCDS13669.1, CCDS13670.1	21q22.3	2011-08-11			ENSG00000182240	ENSG00000182240			934	protein-coding gene	gene with protein product		605668		AEPLC		10965118, 10830953	Standard	NM_138991		Approved	CEAP1, DRAP, ALP56	uc002yyw.3	Q9Y5Z0	OTTHUMG00000086742	ENST00000330333.6:c.1068T>A	chr21.hg19:g.42622762T>A		218.0	0.0		209.0	96.0	NM_138992	A8K7P1|Q5DIH8|Q8N2D4|Q9H2V8|Q9NZL1|Q9NZL2|Q9UJT6	Silent	SNP	ENST00000330333.6	hg19	CCDS13668.1																																																																																			.	.		0.458	BACE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195056.1		
CECR1	51816	hgsc.bcm.edu	37	22	17662466	17662466	+	Splice_Site	SNP	C	C	A			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr22:17662466C>A	ENST00000399839.1	-	10	1713	c.1443G>T	c.(1441-1443)aaG>aaT	p.K481N	CECR1_ENST00000330232.4_Splice_Site_p.K240N|CECR1_ENST00000449907.2_Splice_Site_p.K439N|CECR1_ENST00000262607.3_Splice_Site_p.K481N|CECR1_ENST00000399837.2_Splice_Site_p.K481N	NM_001282227.1|NM_001282228.1	NP_001269156.1|NP_001269157.1	Q9NZK5	CECR1_HUMAN	cat eye syndrome chromosome region, candidate 1	481					adenosine catabolic process (GO:0006154)|hypoxanthine salvage (GO:0043103)|inosine biosynthetic process (GO:0046103)|multicellular organismal development (GO:0007275)	extracellular space (GO:0005615)	adenosine deaminase activity (GO:0004000)|adenosine receptor binding (GO:0031685)|growth factor activity (GO:0008083)|heparin binding (GO:0008201)|protein homodimerization activity (GO:0042803)|proteoglycan binding (GO:0043394)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(2)|large_intestine(6)|liver(1)|lung(10)|ovary(2)|prostate(2)|stomach(1)	25		all_epithelial(15;0.0152)|Lung NSC(13;0.0875)|all_lung(157;0.106)				GGGTACTGTACCTGCAGGAAG	0.532																																					p.K481N		Atlas-SNP	.											.	CECR1	77	.	0			c.G1443T						.						129.0	131.0	130.0					22																	17662466		2203	4300	6503	SO:0001630	splice_region_variant	51816	exon9			ACTGTACCTGCAG	AF190746	CCDS13742.1, CCDS13743.1, CCDS63395.1, CCDS74809.1	22q11.2	2008-02-22			ENSG00000093072	ENSG00000093072			1839	protein-coding gene	gene with protein product		607575		IDGFL		10756095	Standard	NM_001282225		Approved	ADGF	uc002zmk.1	Q9NZK5	OTTHUMG00000030726	ENST00000399839.1:c.1443-1G>T	chr22.hg19:g.17662466C>A		164.0	0.0		121.0	62.0	NM_017424	A8K9H4|Q6ICF1|Q86UB6|Q8NCJ2|Q96K41	Missense_Mutation	SNP	ENST00000399839.1	hg19	CCDS13742.1	.	.	.	.	.	.	.	.	.	.	C	6.453	0.451754	0.12223	.	.	ENSG00000093072	ENST00000399839;ENST00000330232;ENST00000262607;ENST00000449907;ENST00000399837	D;D;D;D;D	0.95622	-3.76;-3.76;-3.76;-3.76;-3.76	3.62	0.0265	0.14150	Adenosine/AMP deaminase (1);	0.338897	0.33670	N	0.004670	D	0.92051	0.7481	L	0.61387	1.9	0.25253	N	0.989652	B;B	0.30605	0.287;0.01	B;B	0.28991	0.097;0.026	D	0.84961	0.0877	10	0.48119	T	0.1	.	8.2936	0.31971	0.0:0.5987:0.0:0.4013	.	481;240	Q9NZK5;Q9NZK5-2	CECR1_HUMAN;.	N	481;240;481;439;481	ENSP00000382733:K481N;ENSP00000332871:K240N;ENSP00000262607:K481N;ENSP00000406443:K439N;ENSP00000382731:K481N	ENSP00000262607:K481N	K	-	3	2	CECR1	16042466	1.000000	0.71417	0.194000	0.23346	0.038000	0.13279	1.327000	0.33746	0.061000	0.16311	0.655000	0.94253	AAG	.	.		0.532	CECR1-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316079.1		Missense_Mutation
PLA2G3	50487	hgsc.bcm.edu	37	22	31533849	31533849	+	Nonsense_Mutation	SNP	T	T	A			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr22:31533849T>A	ENST00000215885.3	-	4	1165	c.913A>T	c.(913-915)Aag>Tag	p.K305*		NM_015715.3	NP_056530.2	Q9NZ20	PA2G3_HUMAN	phospholipase A2, group III	305					acrosome assembly (GO:0001675)|cilium morphogenesis (GO:0060271)|glycerophospholipid biosynthetic process (GO:0046474)|lipid catabolic process (GO:0016042)|lipoxygenase pathway (GO:0019372)|mast cell degranulation (GO:0043303)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylglycerol acyl-chain remodeling (GO:0036148)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|sperm axoneme assembly (GO:0007288)	centriole (GO:0005814)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|mast cell granule (GO:0042629)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|calcium-dependent phospholipase A2 activity (GO:0047498)			large_intestine(1)|lung(10)|ovary(1)|prostate(2)|skin(3)|urinary_tract(1)	18						AGGTGCTGCTTCTGTCGAGGC	0.652																																					p.K305X		Atlas-SNP	.											.	PLA2G3	85	.	0			c.A913T						.						82.0	94.0	90.0					22																	31533849		2203	4300	6503	SO:0001587	stop_gained	50487	exon4			GCTGCTTCTGTCG	AF220490	CCDS13889.1	22q12.2	2008-09-19			ENSG00000100078	ENSG00000100078	3.1.1.4		17934	protein-coding gene	gene with protein product		611651				10713052	Standard	NM_015715		Approved	GIII-SPLA2	uc003aka.3	Q9NZ20	OTTHUMG00000151255	ENST00000215885.3:c.913A>T	chr22.hg19:g.31533849T>A	ENSP00000215885:p.Lys305*	304.0	0.0		189.0	101.0	NM_015715	O95768	Nonsense_Mutation	SNP	ENST00000215885.3	hg19	CCDS13889.1	.	.	.	.	.	.	.	.	.	.	T	25.2	4.612473	0.87258	.	.	ENSG00000100078	ENST00000215885	.	.	.	3.68	1.48	0.22813	.	0.904173	0.09678	N	0.770218	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	0.9249	4.5179	0.11945	0.0:0.1107:0.3999:0.4894	.	.	.	.	X	305	.	ENSP00000215885:K305X	K	-	1	0	PLA2G3	29863849	0.001000	0.12720	0.006000	0.13384	0.023000	0.10783	0.169000	0.16641	0.257000	0.21650	0.533000	0.62120	AAG	.	.		0.652	PLA2G3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321938.1	NM_015715	
TOM1	10043	hgsc.bcm.edu	37	22	35717981	35717981	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr22:35717981A>G	ENST00000449058.2	+	3	292	c.167A>G	c.(166-168)aAg>aGg	p.K56R	TOM1_ENST00000447733.1_Missense_Mutation_p.K23R|TOM1_ENST00000425375.1_Missense_Mutation_p.K56R|TOM1_ENST00000436462.2_Intron|TOM1_ENST00000382034.5_5'UTR|TOM1_ENST00000411850.1_Missense_Mutation_p.K56R	NM_005488.2	NP_005479.1	O60784	TOM1_HUMAN	target of myb1 (chicken)	56	VHS. {ECO:0000255|PROSITE- ProRule:PRU00218}.				endocytosis (GO:0006897)|endosomal transport (GO:0016197)|intracellular protein transport (GO:0006886)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	clathrin binding (GO:0030276)			NS(1)|breast(2)|kidney(2)|large_intestine(2)|lung(7)|ovary(3)|prostate(2)	19						GCAGTAAAGAAGAGAATCGTG	0.527																																					p.K56R		Atlas-SNP	.											.	TOM1	43	.	0			c.A167G						.						128.0	113.0	118.0					22																	35717981		2203	4300	6503	SO:0001583	missense	10043	exon3			TAAAGAAGAGAAT	AJ006973	CCDS13913.1, CCDS46696.1, CCDS46697.1, CCDS46698.1	22q13.1	2011-01-31	2001-11-28		ENSG00000100284	ENSG00000100284			11982	protein-coding gene	gene with protein product		604700	"""target of myb1 (chicken) homolog"""			10329004, 15047686	Standard	NM_005488		Approved		uc003anp.3	O60784	OTTHUMG00000150958	ENST00000449058.2:c.167A>G	chr22.hg19:g.35717981A>G	ENSP00000394466:p.Lys56Arg	104.0	0.0		71.0	24.0	NM_001135732	B4DEL9|B4DNA1|Q5TIJ6|Q86X74	Missense_Mutation	SNP	ENST00000449058.2	hg19	CCDS13913.1	.	.	.	.	.	.	.	.	.	.	A	26.8	4.772105	0.90108	.	.	ENSG00000100284	ENST00000447733;ENST00000456128;ENST00000449058;ENST00000411850;ENST00000425375;ENST00000450839;ENST00000451197;ENST00000443206	T;T;T;T;T;T	0.28666	1.6;1.6;1.6;1.6;1.6;1.6	5.03	5.03	0.67393	VHS subgroup (1);ENTH/VHS (2);VHS (2);	0.046850	0.85682	D	0.000000	T	0.34424	0.0897	L	0.35341	1.055	0.80722	D	1	P;P;P;D	0.56035	0.834;0.888;0.823;0.974	B;P;B;P	0.51516	0.188;0.624;0.298;0.672	T	0.06162	-1.0842	10	0.42905	T	0.14	-30.0149	14.7793	0.69754	1.0:0.0:0.0:0.0	.	56;56;56;56	O60784-3;B4DKQ5;O60784-2;O60784	.;.;.;TOM1_HUMAN	R	23;56;56;56;56;56;56;23	ENSP00000398876:K23R;ENSP00000393714:K56R;ENSP00000394466:K56R;ENSP00000413697:K56R;ENSP00000394924:K56R;ENSP00000389789:K23R	ENSP00000338422:K56R	K	+	2	0	TOM1	34047981	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	7.389000	0.79806	1.895000	0.54865	0.459000	0.35465	AAG	.	.		0.527	TOM1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000320641.1	NM_005488	
ARMCX4	100131755	hgsc.bcm.edu	37	X	100747169	100747169	+	Missense_Mutation	SNP	G	G	T			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chrX:100747169G>T	ENST00000423738.3	+	2	3795	c.3593G>T	c.(3592-3594)aGt>aTt	p.S1198I		NM_001256155.1	NP_001243084.1	Q5H9R4	ARMX4_HUMAN	armadillo repeat containing, X-linked 4	0						integral component of membrane (GO:0016021)				lung(1)	1						GGTCAGACTAGTGAGGGGACC	0.662																																					p.S1198I		Atlas-SNP	.											.	ARMCX4	2	.	0			c.G3593T						.																																			SO:0001583	missense	100131755	exon2			AGACTAGTGAGGG	AK096955	CCDS59170.1	Xq22	2014-03-21	2009-11-26		ENSG00000196440	ENSG00000196440		"""Armadillo repeat containing"""	28615	protein-coding gene	gene with protein product			"""chromosome X open reading frame 35"", ""armadillo repeat containing, X-linked 4 pseudogene"""	CXorf35		16221301, 22569362	Standard	NR_028407		Approved	MGC40053, GASP4	uc031tkc.1	Q5H9R4	OTTHUMG00000022030	ENST00000423738.3:c.3593G>T	chrX.hg19:g.100747169G>T	ENSP00000404304:p.Ser1198Ile	3.0	0.0		9.0	7.0	NM_001256155	A8K928|B3KXA4|Q5H9K8|Q8N8D6	Missense_Mutation	SNP	ENST00000423738.3	hg19	CCDS59170.1	.	.	.	.	.	.	.	.	.	.	.	0.332	-0.955739	0.02267	.	.	ENSG00000196440	ENST00000423738	.	.	.	3.98	0.999	0.19862	.	.	.	.	.	T	0.31765	0.0807	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.25950	-1.0117	4	.	.	.	.	6.7921	0.23705	0.0:0.3059:0.378:0.3161	.	.	.	.	I	1302	.	.	S	+	2	0	ARMCX4	100633825	0.000000	0.05858	0.004000	0.12327	0.034000	0.12701	-0.178000	0.09782	-0.034000	0.13713	0.490000	0.48405	AGT	.	.		0.662	ARMCX4-010	PUTATIVE	upstream_ATG|upstream_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370455.2	NM_001256155	
IL1RAPL2	26280	hgsc.bcm.edu	37	X	105011223	105011223	+	Silent	SNP	T	T	C			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chrX:105011223T>C	ENST00000372582.1	+	11	2386	c.1630T>C	c.(1630-1632)Tta>Cta	p.L544L	IL1RAPL2_ENST00000344799.4_Silent_p.L544L	NM_017416.1	NP_059112.1	Q9NP60	IRPL2_HUMAN	interleukin 1 receptor accessory protein-like 2	544	TIR. {ECO:0000255|PROSITE- ProRule:PRU00204}.				central nervous system development (GO:0007417)|cytokine-mediated signaling pathway (GO:0019221)	integral component of membrane (GO:0016021)	interleukin-1 receptor activity (GO:0004908)|interleukin-1, Type II, blocking receptor activity (GO:0004910)			breast(3)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(14)|lung(23)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	49						AAGCAGCAAATTAAATTCTAA	0.408																																					p.L544L		Atlas-SNP	.											.	IL1RAPL2	105	.	0			c.T1630C						.						102.0	110.0	107.0					X																	105011223		2203	4300	6503	SO:0001819	synonymous_variant	26280	exon11			AGCAAATTAAATT	AF181285	CCDS14517.1	Xq22	2013-01-11			ENSG00000189108	ENSG00000189108		"""Interleukins and interleukin receptors"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5997	protein-coding gene	gene with protein product		300277				10757639	Standard	NM_017416		Approved	IL-1R9, TIGIRR-1, IL1RAPL-2, IL1R9	uc004elz.1	Q9NP60	OTTHUMG00000022141	ENST00000372582.1:c.1630T>C	chrX.hg19:g.105011223T>C		246.0	0.0		210.0	109.0	NM_017416	Q2M3U3|Q9NZN0	Silent	SNP	ENST00000372582.1	hg19	CCDS14517.1																																																																																			.	.		0.408	IL1RAPL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057785.1	NM_017416	
CUL4B	8450	hgsc.bcm.edu	37	X	119669737	119669737	+	Missense_Mutation	SNP	A	A	C			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chrX:119669737A>C	ENST00000404115.3	-	18	2563	c.2162T>G	c.(2161-2163)cTt>cGt	p.L721R	CUL4B_ENST00000371322.5_Missense_Mutation_p.L703R|CUL4B_ENST00000336592.6_Missense_Mutation_p.L708R	NM_003588.3	NP_003579.3	Q13620	CUL4B_HUMAN	cullin 4B	721					cell cycle (GO:0007049)|histone H2A monoubiquitination (GO:0035518)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|positive regulation of protein catabolic process (GO:0045732)|ubiquitin-dependent protein catabolic process (GO:0006511)|UV-damage excision repair (GO:0070914)	Cul4B-RING E3 ubiquitin ligase complex (GO:0031465)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(7)|lung(14)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	36						CTGCCACTGAAGTTTCCTGCC	0.338																																					p.L721R		Atlas-SNP	.											.	CUL4B	181	.	0			c.T2162G						.						136.0	139.0	138.0					X																	119669737		2203	4300	6503	SO:0001583	missense	8450	exon18			CACTGAAGTTTCC	U58091	CCDS35379.1, CCDS43987.1	Xq23	2011-05-24			ENSG00000158290	ENSG00000158290			2555	protein-coding gene	gene with protein product		300304				8681378	Standard	NM_003588		Approved		uc004esw.3	Q13620	OTTHUMG00000022302	ENST00000404115.3:c.2162T>G	chrX.hg19:g.119669737A>C	ENSP00000384109:p.Leu721Arg	574.0	0.0		573.0	136.0	NM_003588	B1APK5|B3KVX4|B7Z5K8|Q6PIE4|Q6UP07|Q7Z673|Q9BY37|Q9UEB7|Q9UED7	Missense_Mutation	SNP	ENST00000404115.3	hg19	CCDS35379.1	.	.	.	.	.	.	.	.	.	.	A	20.5	4.003165	0.74932	.	.	ENSG00000158290	ENST00000371322;ENST00000336592;ENST00000404115	D;D;D	0.90197	-2.63;-2.63;-2.63	5.79	4.61	0.57282	Cullin, N-terminal (1);Cullin homology (3);	0.000000	0.85682	D	0.000000	D	0.97040	0.9033	H	0.98466	4.24	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;1.0;1.0	D	0.96750	0.9553	9	.	.	.	-5.702	11.4747	0.50291	0.8516:0.1484:0.0:0.0	.	525;721;703	Q13620-3;Q13620;Q13620-1	.;CUL4B_HUMAN;.	R	703;708;721	ENSP00000360373:L703R;ENSP00000338919:L708R;ENSP00000384109:L721R	.	L	-	2	0	CUL4B	119553765	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	9.168000	0.94781	0.795000	0.33922	0.472000	0.43445	CTT	.	.		0.338	CUL4B-001	KNOWN	non_canonical_conserved|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000058103.1	NM_003588	
IDH3G	3421	hgsc.bcm.edu	37	X	153055245	153055245	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chrX:153055245G>A	ENST00000217901.5	-	5	464	c.268C>T	c.(268-270)Cac>Tac	p.H90Y	IDH3G_ENST00000497043.1_5'UTR|IDH3G_ENST00000427365.2_Missense_Mutation_p.H32Y|IDH3G_ENST00000370092.3_Missense_Mutation_p.H90Y|IDH3G_ENST00000370093.1_Missense_Mutation_p.H90Y	NM_004135.3	NP_004126.1	P51553	IDH3G_HUMAN	isocitrate dehydrogenase 3 (NAD+) gamma	90					carbohydrate metabolic process (GO:0005975)|cellular metabolic process (GO:0044237)|isocitrate metabolic process (GO:0006102)|small molecule metabolic process (GO:0044281)|tricarboxylic acid cycle (GO:0006099)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|isocitrate dehydrogenase (NAD+) activity (GO:0004449)|magnesium ion binding (GO:0000287)|NAD binding (GO:0051287)			breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(5)|prostate(1)	17	all_hematologic(71;4.25e-06)|all_lung(58;3.83e-05)|Lung NSC(58;5.54e-05)|Acute lymphoblastic leukemia(192;6.56e-05)					GAACTCACGTGCACCTCTTCA	0.647																																					p.H90Y		Atlas-SNP	.											.	IDH3G	36	.	0			c.C268T						.						86.0	59.0	68.0					X																	153055245		2202	4298	6500	SO:0001583	missense	3421	exon5			TCACGTGCACCTC		CCDS14730.1, CCDS44019.1	Xq28	2008-02-05			ENSG00000067829	ENSG00000067829	1.1.1.41		5386	protein-coding gene	gene with protein product		300089				9286695	Standard	NM_004135		Approved		uc004fip.4	P51553	OTTHUMG00000024219	ENST00000217901.5:c.268C>T	chrX.hg19:g.153055245G>A	ENSP00000217901:p.His90Tyr	66.0	0.0		38.0	12.0	NM_004135	E9PDD5|Q9BUU5	Missense_Mutation	SNP	ENST00000217901.5	hg19	CCDS14730.1	.	.	.	.	.	.	.	.	.	.	G	17.42	3.384208	0.61845	.	.	ENSG00000067829	ENST00000370092;ENST00000217901;ENST00000370093;ENST00000427365;ENST00000444450;ENST00000444338	T;T;T;T;T;T	0.66280	0.64;0.64;0.64;0.64;0.64;-0.2	5.34	5.34	0.76211	Isopropylmalate dehydrogenase-like domain (2);	0.281987	0.39020	N	0.001489	T	0.38825	0.1055	N	0.12569	0.235	0.26986	N	0.965255	P;B	0.34800	0.469;0.137	B;B	0.27380	0.079;0.035	T	0.25882	-1.0119	10	0.21014	T	0.42	.	12.0109	0.53286	0.0:0.0:0.8271:0.1729	.	90;90	E9PDD5;P51553	.;IDH3G_HUMAN	Y	90;90;90;32;67;1	ENSP00000359110:H90Y;ENSP00000217901:H90Y;ENSP00000359111:H90Y;ENSP00000408529:H32Y;ENSP00000401862:H67Y;ENSP00000402747:H1Y	ENSP00000217901:H90Y	H	-	1	0	IDH3G	152708439	0.965000	0.33210	1.000000	0.80357	0.955000	0.61496	3.048000	0.49862	2.238000	0.73509	0.529000	0.55759	CAC	.	.		0.647	IDH3G-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000061084.27		
MT-CO1	4512	hgsc.bcm.edu	37	M	6718	6718	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chrM:6718G>A	ENST00000361624.2	+	1	815	c.815G>A	c.(814-816)gGt>gAt	p.G272D	MT-TM_ENST00000387377.1_RNA|MT-CO2_ENST00000361739.1_5'Flank|MT-ATP8_ENST00000361851.1_5'Flank|MT-TD_ENST00000387419.1_RNA|MT-TA_ENST00000387392.1_RNA|MT-TI_ENST00000387365.1_RNA|MT-ATP6_ENST00000361899.2_5'Flank|MT-TW_ENST00000387382.1_RNA|MT-TN_ENST00000387400.1_RNA|MT-TY_ENST00000387409.1_RNA|MT-TS1_ENST00000387416.2_RNA|MT-CO3_ENST00000362079.2_5'Flank|MT-TC_ENST00000387405.1_RNA|MT-TQ_ENST00000387372.1_RNA|MT-TK_ENST00000387421.1_RNA			P00395	COX1_HUMAN	mitochondrially encoded cytochrome c oxidase I	272					aerobic respiration (GO:0009060)|cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|oxidative phosphorylation (GO:0006119)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex IV (GO:0005751)|respiratory chain complex IV (GO:0045277)	cytochrome-c oxidase activity (GO:0004129)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			breast(4)|endometrium(25)|kidney(19)|lung(3)|prostate(3)	54						TGGATACATAGGTATGGTCTG	0.393																																					p.G272D		Atlas-SNP	.											.	.	.	.	0			c.G815A						.																																			SO:0001583	missense	5742	exon1			ACATAGGTATGGT			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198804	ENSG00000198804		"""Mitochondrial respiratory chain complex / Complex IV"""	7419	protein-coding gene	gene with protein product		516030	"""cytochrome c oxidase I"""	MTCO1		7219534	Standard			Approved	COX1, COI		P00395		ENST00000361624.2:c.815G>A	chrM.hg19:g.6718G>A	ENSP00000354499:p.Gly272Asp	575.0	0.0		151.0	9.0	ENST00000361624	Q34770	Missense_Mutation	SNP	ENST00000361624.2	hg19																																																																																				.	.		0.393	MT-CO1-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024028	
MT-CO1	4512	hgsc.bcm.edu	37	M	7074	7074	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chrM:7074G>A	ENST00000361624.2	+	1	1171	c.1171G>A	c.(1171-1173)Gga>Aga	p.G391R	MT-TM_ENST00000387377.1_RNA|MT-CO2_ENST00000361739.1_5'Flank|MT-ATP8_ENST00000361851.1_5'Flank|MT-TD_ENST00000387419.1_RNA|MT-ND3_ENST00000361227.2_5'Flank|MT-TA_ENST00000387392.1_RNA|MT-TI_ENST00000387365.1_RNA|MT-ATP6_ENST00000361899.2_5'Flank|MT-TG_ENST00000387429.1_RNA|MT-TW_ENST00000387382.1_RNA|MT-TN_ENST00000387400.1_RNA|MT-TY_ENST00000387409.1_RNA|MT-TS1_ENST00000387416.2_RNA|MT-CO3_ENST00000362079.2_5'Flank|MT-TC_ENST00000387405.1_RNA|MT-TQ_ENST00000387372.1_RNA|MT-TK_ENST00000387421.1_RNA			P00395	COX1_HUMAN	mitochondrially encoded cytochrome c oxidase I	391					aerobic respiration (GO:0009060)|cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|oxidative phosphorylation (GO:0006119)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex IV (GO:0005751)|respiratory chain complex IV (GO:0045277)	cytochrome-c oxidase activity (GO:0004129)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			breast(4)|endometrium(25)|kidney(19)|lung(3)|prostate(3)	54						TTGCCATCATAGGAGGCTTCA	0.418																																					p.G391X		Atlas-SNP	.											.	.	.	.	0			c.G1171A						.																																			SO:0001583	missense	5742	exon1			ATCATAGGAGGCT			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198804	ENSG00000198804		"""Mitochondrial respiratory chain complex / Complex IV"""	7419	protein-coding gene	gene with protein product		516030	"""cytochrome c oxidase I"""	MTCO1		7219534	Standard			Approved	COX1, COI		P00395		ENST00000361624.2:c.1171G>A	chrM.hg19:g.7074G>A	ENSP00000354499:p.Gly391Arg	472.0	0.0		159.0	90.0	ENST00000361624	Q34770	Nonsense_Mutation	SNP	ENST00000361624.2	hg19																																																																																				.	.		0.418	MT-CO1-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024028	
MT-ND3	4537	hgsc.bcm.edu	37	M	10401	10401	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chrM:10401G>A	ENST00000361227.2	+	1	343	c.343G>A	c.(343-345)Gaa>Aaa	p.E115K	MT-TL2_ENST00000387456.1_RNA|MT-TD_ENST00000387419.1_RNA|MT-ND5_ENST00000361567.2_5'Flank|MT-TH_ENST00000387441.1_RNA|MT-TG_ENST00000387429.1_RNA|MT-ND4L_ENST00000361335.1_5'Flank|MT-TS1_ENST00000387416.2_RNA|MT-ND4_ENST00000361381.2_5'Flank|MT-TR_ENST00000387439.1_RNA|MT-TS2_ENST00000387449.1_RNA|MT-TK_ENST00000387421.1_RNA			P03897	NU3M_HUMAN	mitochondrially encoded NADH dehydrogenase 3	115					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)										TAGACTGAGCCGAATTGGTAT	0.333																																					p.E115K		Atlas-SNP	.											.	.	.	.	0			c.G343A						.																																			SO:0001583	missense	0	exon1			TGAACCGAATTGG			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198840	ENSG00000198840	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7458	protein-coding gene	gene with protein product	"""complex I ND3 subunit"", ""NADH-ubiquinone oxidoreductase chain 3"""	516002	"""NADH dehydrogenase 3"""	MTND3			Standard			Approved	ND3, NAD3		P03897		ENST00000361227.2:c.343G>A	chrM.hg19:g.10401G>A	ENSP00000355206:p.Glu115Lys	623.0	0.0		167.0	7.0	ENST00000361227		Missense_Mutation	SNP	ENST00000361227.2	hg19																																																																																				.	C|0.839;T|0.161		0.333	MT-ND3-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024033	
FOXD4L2	100036519	hgsc.bcm.edu	37	9	42718188	42718189	+	In_Frame_Ins	INS	-	-	GAG			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr9:42718188_42718189insGAG	ENST00000377590.1	+	1	955_956	c.123_124insGAG	c.(124-126)gag>GAGgag	p.42_42E>EE		NM_001099279.1	NP_001092749.1	Q6VB85	FX4L2_HUMAN	forkhead box D4-like 2	42					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			haematopoietic_and_lymphoid_tissue(1)	1				all cancers(8;0.00136)|Epithelial(8;0.0288)|GBM - Glioblastoma multiforme(74;0.0402)|OV - Ovarian serous cystadenocarcinoma(323;0.18)		aggtggaagacgaggaggagga	0.653																																					p.D41delinsDE		Atlas-INDEL	.											.	FOXD4L2	4	.	0			c.123_124insGAG						.																																			SO:0001652	inframe_insertion	100036519	exon1			.			9p12	2008-07-21			ENSG00000204828				24813	protein-coding gene	gene with protein product						12421752	Standard			Approved	OTTHUMG00000066752	uc004acn.3	Q6VB85	OTTHUMG00000066752	ENST00000377590.1:c.133_135dupGAG	chr9.hg19:g.42718195_42718197dupGAG	ENSP00000366814:p.Glu45dup	566.0	0.0		390.0	46.0	NM_001099279		In_Frame_Ins	INS	ENST00000377590.1	hg19	CCDS43817.1																																																																																			.	.		0.653	FOXD4L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000143077.1	NM_001099279	
SAA1	6288	hgsc.bcm.edu	37	11	18290820	18290820	+	Frame_Shift_Del	DEL	G	G	-			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr11:18290820delG	ENST00000405158.2	+	3	354	c.170delG	c.(169-171)cggfs	p.R57fs	SAA1_ENST00000356524.4_Frame_Shift_Del_p.R57fs|RNA5SP334_ENST00000364825.1_RNA|SAA1_ENST00000532858.1_Frame_Shift_Del_p.R57fs	NM_000331.4	NP_000322	P0DJI8	SAA1_HUMAN	serum amyloid A1	57					acute-phase response (GO:0006953)|innate immune response (GO:0045087)|lymphocyte chemotaxis (GO:0048247)|macrophage chemotaxis (GO:0048246)|negative regulation of inflammatory response (GO:0050728)|neutrophil chemotaxis (GO:0030593)|platelet activation (GO:0030168)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cytokine secretion (GO:0050715)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of interleukin-1 secretion (GO:0050716)|regulation of protein secretion (GO:0050708)	endocytic vesicle lumen (GO:0071682)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|high-density lipoprotein particle (GO:0034364)	G-protein coupled receptor binding (GO:0001664)|heparin binding (GO:0008201)			endometrium(1)|large_intestine(3)|lung(2)|stomach(3)	9					Human Serum Albumin(DB00062)|Serum albumin iodonated(DB00064)	TTCCATGCTCGGGGGAACTAT	0.557																																					p.R57fs		Atlas-Indel,Pindel	.											.	SAA1	14	.	0			c.169delC						.						25.0	26.0	26.0					11																	18290820		2196	4270	6466	SO:0001589	frameshift_variant	6288	exon3			.	M10906	CCDS7835.1	11p15.1	2014-01-30			ENSG00000173432	ENSG00000173432		"""Endogenous ligands"""	10513	protein-coding gene	gene with protein product		104750		SAA		2595451, 9305847	Standard	NM_199161		Approved	PIG4, TP53I4	uc021qeo.1	P0DJI8	OTTHUMG00000166147	ENST00000405158.2:c.170delG	chr11.hg19:g.18290820delG	ENSP00000384906:p.Arg57fs	217.0	0.0		208.0	60.0	NM_199161	P02735|P02736|P02737|Q16730|Q16834|Q16835|Q16879|Q3KRB3|Q6FG67|Q96QN0|Q9UCK9|Q9UCL0	Frame_Shift_Del	DEL	ENST00000405158.2	hg19	CCDS7835.1																																																																																			.	.		0.557	SAA1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395864.1	NM_199161	
FOXD4L4	349334	hgsc.bcm.edu	37	9	70428763	70428764	+	In_Frame_Ins	INS	-	-	CCT			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr9:70428763_70428764insCCT	ENST00000377413.1	-	1	967_968	c.136_137insAGG	c.(136-138)gcg>gAGGcg	p.45_46insE		NM_199244.2	NP_954714.2	Q8WXT5	FX4L4_HUMAN	forkhead box D4-like 4	45					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)								GBM - Glioblastoma multiforme(29;0.0402)|OV - Ovarian serous cystadenocarcinoma(323;0.18)		CTGCTGTCTCGcctcctcctcc	0.668																																					p.A46delinsEA		Atlas-INDEL	.											.	FOXD4L2	4	.	0			c.137_138insAGG						.																																			SO:0001652	inframe_insertion	100036519	exon1			.		CCDS75845.1	9q13	2007-03-19			ENSG00000184659	ENSG00000184659			23762	protein-coding gene	gene with protein product		611085					Standard	NM_199244		Approved	bA460E7.2, OTTHUMG00000013337		Q8WXT5	OTTHUMG00000013337	ENST00000377413.1:c.134_136dupAGG	chr9.hg19:g.70428770_70428772dupCCT	ENSP00000366630:p.Glu45_Glu45dup	585.0	0.0		380.0	38.0	NM_001099279	Q5RIB4	In_Frame_Ins	INS	ENST00000377413.1	hg19	CCDS6621.1																																																																																			.	.		0.668	FOXD4L4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000037143.2		
ANXA13	312	hgsc.bcm.edu	37	8	124701110	124701112	+	Splice_Site	DEL	CCG	CCG	-	rs367655009		TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	CCG	CCG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr8:124701110_124701112delCCG	ENST00000419625.1	-	9	789_791	c.717_719delCGG	c.(715-720)ctcggg>ctg	p.G240del	ANXA13_ENST00000262219.6_Splice_Site_p.G281del	NM_004306.2	NP_004297.2	P27216	ANX13_HUMAN	annexin A13	240					cell differentiation (GO:0030154)|negative regulation of Golgi to plasma membrane protein transport (GO:0042997)|positive regulation of Golgi to plasma membrane protein transport (GO:0042998)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|exocytic vesicle (GO:0070382)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|phosphatidylglycerol binding (GO:1901611)|phosphatidylserine binding (GO:0001786)			breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|liver(1)|lung(11)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(2)	25	Lung NSC(37;2.06e-11)|Ovarian(258;0.00579)|all_neural(195;0.0741)		STAD - Stomach adenocarcinoma(47;0.00288)			CTTTACTTTACCGAGAGTTAAAT	0.448																																					p.281_281del		Atlas-INDEL	.											.	ANXA13	38	.	0			c.841_841del						.																																			SO:0001630	splice_region_variant	312	exon10			.	Z11502	CCDS34939.1, CCDS47917.1	8q24.13	2005-11-09			ENSG00000104537	ENSG00000104537		"""Annexins"""	536	protein-coding gene	gene with protein product		602573		ANX13		9503022	Standard	NM_004306		Approved		uc003yqt.3	P27216	OTTHUMG00000164987	ENST00000419625.1:c.718+1CGG>-	chr8.hg19:g.124701110_124701112delCCG		184.0	0.0		114.0	16.0	NM_001003954	Q9BQR5	Frame_Shift_Del	DEL	ENST00000419625.1	hg19	CCDS47917.1																																																																																			.	.		0.448	ANXA13-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381308.1	NM_004306	In_Frame_Del
SAA2	6289	hgsc.bcm.edu	37	11	18267513	18267513	+	Frame_Shift_Del	DEL	C	C	-			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr11:18267513delC	ENST00000526900.1	-	3	357	c.174delG	c.(172-174)gggfs	p.G58fs	SAA2-SAA4_ENST00000524555.1_RNA|SAA2_ENST00000256733.4_Frame_Shift_Del_p.G58fs|SAA2_ENST00000528349.1_Frame_Shift_Del_p.G58fs|SAA2_ENST00000414546.2_Frame_Shift_Del_p.G58fs|SAA2_ENST00000529528.1_Frame_Shift_Del_p.G58fs|SAA2_ENST00000530400.1_Frame_Shift_Del_p.G58fs|RNA5SP333_ENST00000363466.1_RNA			P0DJI9	SAA2_HUMAN	serum amyloid A2	58					acute-phase response (GO:0006953)	extracellular vesicular exosome (GO:0070062)|high-density lipoprotein particle (GO:0034364)				central_nervous_system(1)|large_intestine(2)|lung(2)|prostate(1)	6						CATCATAGTTCCCCCGAGCAT	0.552																																					p.N59fs		Atlas-Indel,Pindel	.											.	SAA2	22	.	0			c.175delA						.						76.0	72.0	74.0					11																	18267513		2199	4290	6489	SO:0001589	frameshift_variant	6289	exon3			.	M26152	CCDS7833.1, CCDS44548.1	11p15.1-p14	2008-07-21			ENSG00000134339	ENSG00000134339			10514	protein-coding gene	gene with protein product		104751				7686132	Standard	NM_030754		Approved			P0DJI9	OTTHUMG00000166484	ENST00000526900.1:c.174delG	chr11.hg19:g.18267513delC	ENSP00000436126:p.Gly58fs	428.0	0.0		366.0	60.0	NM_030754	G3XAK9|P02735|P02736|P02737|Q16730|Q16834|Q16835|Q16879|Q3KRB3|Q6FG67|Q96QN0|Q9UCK9|Q9UCL0	Frame_Shift_Del	DEL	ENST00000526900.1	hg19	CCDS7833.1																																																																																			.	.		0.552	SAA2-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389983.1	NM_030754	
CDH22	64405	hgsc.bcm.edu	37	20	44856179	44856179	+	Frame_Shift_Del	DEL	C	C	-			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr20:44856179delC	ENST00000372262.3	-	3	1038	c.638delG	c.(637-639)ggcfs	p.G213fs	CDH22_ENST00000537909.1_Frame_Shift_Del_p.G213fs	NM_021248.1	NP_067071.1	Q9UJ99	CAD22_HUMAN	cadherin 22, type 2	213	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				brain development (GO:0007420)|calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(3)|kidney(1)|large_intestine(9)|lung(16)|ovary(4)|pancreas(1)|prostate(3)|skin(4)|urinary_tract(3)	44		Myeloproliferative disorder(115;0.0122)				GTGGTGCTCGCCGTCCAGCAC	0.741																																					p.G213fs		Atlas-Indel,Pindel	.											.	CDH22	112	.	0			c.639delC						.						27.0	23.0	24.0					20																	44856179		2203	4299	6502	SO:0001589	frameshift_variant	64405	exon4			.	AF035300	CCDS13395.1	20q13.1	2010-01-26	2009-11-20		ENSG00000149654	ENSG00000149654		"""Cadherins / Major cadherins"""	13251	protein-coding gene	gene with protein product		609920	"""cadherin-like 22"""	C20orf25		8626716	Standard	NM_021248		Approved	dJ998H6.1	uc010ghk.2	Q9UJ99	OTTHUMG00000033073	ENST00000372262.3:c.638delG	chr20.hg19:g.44856179delC	ENSP00000361336:p.Gly213fs	62.0	0.0		54.0	30.0	NM_021248	B9EGK7|O43205	Frame_Shift_Del	DEL	ENST00000372262.3	hg19	CCDS13395.1																																																																																			.	.		0.741	CDH22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080491.1	NM_021248	
