#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
MST1L	11223	hgsc.bcm.edu	37	1	17085887	17085887	+	RNA	SNP	G	G	A			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr1:17085887G>A	ENST00000455405.2	-	0	0							Q2TV78	MST1L_HUMAN	macrophage stimulating 1-like							extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)										AAGTTCTCCCGAAGGTCTCTA	0.672																																					p.R312W		Atlas-SNP	.											.	.	.	.	0			c.C934T						.																																					11223	exon8			TCTCCCGAAGGTC	U28055, AF083416		1p36.33	2013-03-27	2012-11-09	2012-11-09	ENSG00000186715	ENSG00000186715			7390	other	unknown			"""macrophage stimulating, pseudogene 7"", ""macrophage stimulating, pseudogene 9"", ""macrophage stimulating 1 (hepatocyte growth factor-like) pseudogene 9"""	MSTP7, MSTP9, MST1P9		10728827	Standard	NM_001271733		Approved	D1F15S1A, MSPL7, MSPL-7	uc010ock.3	Q2TV78	OTTHUMG00000002578		chr1.hg19:g.17085887G>A		62.0	0.0		136.0	18.0	NM_001271733	B7WPB1|Q13209	Missense_Mutation	SNP	ENST00000455405.2	hg19		.	.	.	.	.	.	.	.	.	.	.	13.64	2.297515	0.40694	.	.	ENSG00000186715	ENST00000389184;ENST00000334998;ENST00000442552	.	.	.	.	.	.	.	0.000000	0.39274	N	0.001408	T	0.64148	0.2572	.	.	.	.	.	.	D	0.89917	1.0	D	0.75020	0.985	T	0.67684	-0.5607	6	0.87932	D	0	.	5.0286	0.14398	1.0E-4:0.3807:0.6192:0.0	.	312	Q2TV78-2	.	W	302;312;312	.	ENSP00000439273:R312W	R	-	1	2	MST1P9	16958474	0.999000	0.42202	0.155000	0.22561	0.000000	0.00434	0.933000	0.28897	-0.000000	0.14550	0.000000	0.15137	CGG	.	.		0.672	MST1L-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000400328.1	NM_001271733	
BAI2	576	hgsc.bcm.edu	37	1	32207068	32207068	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr1:32207068C>A	ENST00000373658.3	-	11	2041	c.1700G>T	c.(1699-1701)cGc>cTc	p.R567L	BAI2_ENST00000373655.2_Missense_Mutation_p.R567L|BAI2_ENST00000398542.1_Missense_Mutation_p.R500L|BAI2_ENST00000398556.3_Missense_Mutation_p.R515L|BAI2_ENST00000440175.2_Missense_Mutation_p.R209L|BAI2_ENST00000398547.1_Missense_Mutation_p.R500L|BAI2_ENST00000398538.1_Missense_Mutation_p.R555L|BAI2_ENST00000527361.1_Missense_Mutation_p.R567L|BAI2_ENST00000257070.4_Missense_Mutation_p.R567L	NM_001703.2	NP_001694.2	O60241	BAI2_HUMAN	brain-specific angiogenesis inhibitor 2	567					G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of angiogenesis (GO:0016525)|neuropeptide signaling pathway (GO:0007218)|peripheral nervous system development (GO:0007422)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(5)|central_nervous_system(2)|endometrium(1)|large_intestine(7)|liver(2)|lung(24)|ovary(7)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	55		Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0606)|all_neural(195;0.0837)|Breast(348;0.174)		STAD - Stomach adenocarcinoma(196;0.0557)		GAGACAGCGGCGGCTGGCAGA	0.632																																					p.R567L		Atlas-SNP	.											.	BAI2	128	.	0			c.G1700T						.						16.0	18.0	17.0					1																	32207068		2200	4295	6495	SO:0001583	missense	576	exon11			CAGCGGCGGCTGG	AB005298	CCDS72746.1, CCDS72747.1	1p35	2014-08-08			ENSG00000121753	ENSG00000121753		"""-"", ""GPCR / Class B : Orphans"""	944	protein-coding gene	gene with protein product		602683				9533023	Standard	XM_006710783		Approved		uc001btn.3	O60241	OTTHUMG00000003885	ENST00000373658.3:c.1700G>T	chr1.hg19:g.32207068C>A	ENSP00000362762:p.Arg567Leu	61.0	0.0		132.0	72.0	NM_001703	B9EGK9|Q5T6K0|Q8NGW8|Q96GZ9	Missense_Mutation	SNP	ENST00000373658.3	hg19	CCDS346.2	.	.	.	.	.	.	.	.	.	.	C	33	5.195741	0.94960	.	.	ENSG00000121753	ENST00000398556;ENST00000398547;ENST00000373658;ENST00000373655;ENST00000398542;ENST00000257070;ENST00000527361;ENST00000440175;ENST00000398538;ENST00000420125	T;T;T;T;T;T;T;T;T;T	0.69561	1.27;1.45;-0.41;-0.41;1.69;-0.41;-0.41;-0.41;-0.41;-0.41	5.38	5.38	0.77491	GPCR, family 2, extracellular hormone receptor domain (2);	0.000000	0.43579	D	0.000544	T	0.81245	0.4782	M	0.68317	2.08	0.58432	D	0.999997	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	0.999;1.0;1.0;1.0;0.999;1.0	T	0.82623	-0.0366	10	0.87932	D	0	.	18.2761	0.90084	0.0:1.0:0.0:0.0	.	567;555;209;500;567;567	O60241-4;O60241-3;B4DKC3;A2A3C1;O60241-2;O60241	.;.;.;.;.;BAI2_HUMAN	L	515;500;567;567;500;567;567;209;555;505	ENSP00000381564:R515L;ENSP00000381555:R500L;ENSP00000362762:R567L;ENSP00000362759:R567L;ENSP00000381550:R500L;ENSP00000257070:R567L;ENSP00000435397:R567L;ENSP00000391071:R209L;ENSP00000381548:R555L;ENSP00000410921:R505L	ENSP00000257070:R567L	R	-	2	0	BAI2	31979655	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.645000	0.83430	2.694000	0.91930	0.555000	0.69702	CGC	.	.		0.632	BAI2-015	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000381838.1	NM_001703	
ARTN	9048	hgsc.bcm.edu	37	1	44402421	44402421	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr1:44402421G>T	ENST00000372359.5	+	5	1429	c.647G>T	c.(646-648)tGc>tTc	p.C216F	ARTN_ENST00000438616.3_Missense_Mutation_p.C233F|ARTN_ENST00000372354.3_Missense_Mutation_p.C216F|ARTN_ENST00000498139.2_Missense_Mutation_p.C224F|ARTN_ENST00000414809.3_Missense_Mutation_p.C224F	NM_057091.2	NP_476432.2	Q5T4W7	ARTN_HUMAN	artemin	216					axon guidance (GO:0007411)|induction of positive chemotaxis (GO:0050930)|lymphocyte migration into lymphoid organs (GO:0097021)|neuroblast proliferation (GO:0007405)|peripheral nervous system development (GO:0007422)|Peyer's patch morphogenesis (GO:0061146)|signal transduction (GO:0007165)	extracellular space (GO:0005615)	receptor binding (GO:0005102)					Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0511)				GCCACCGCCTGCGGCTGCCTG	0.677																																					p.C224F		Atlas-SNP	.											.	ARTN	6	.	0			c.G671T						.						11.0	12.0	11.0					1																	44402421		2127	4174	6301	SO:0001583	missense	9048	exon4			CCGCCTGCGGCTG	AF109401	CCDS501.1, CCDS502.1	1p33-p32	2014-01-30			ENSG00000117407	ENSG00000117407		"""Endogenous ligands"""	727	protein-coding gene	gene with protein product	"""neublastin"", ""neurotrophic factor"""	603886				9883723	Standard	NM_057090		Approved	NBN, EVN, ENOVIN	uc001ckt.3	Q5T4W7	OTTHUMG00000007705	ENST00000372359.5:c.647G>T	chr1.hg19:g.44402421G>T	ENSP00000361434:p.Cys216Phe	21.0	0.0		59.0	28.0	NM_001136215	D3DPY1|D3DPY3|O95441|O96030|Q6P6A3	Missense_Mutation	SNP	ENST00000372359.5	hg19	CCDS501.1	.	.	.	.	.	.	.	.	.	.	G	18.38	3.611251	0.66558	.	.	ENSG00000117407	ENST00000372359;ENST00000414809;ENST00000498139;ENST00000372354;ENST00000438616	D;D;D;D;D	0.99582	-6.22;-6.22;-6.22;-6.22;-6.22	4.33	4.33	0.51752	Transforming growth factor-beta, C-terminal (3);	0.000000	0.85682	D	0.000000	D	0.99507	0.9824	M	0.71036	2.16	0.58432	D	0.999997	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.997;0.999	D	0.98198	1.0466	10	0.87932	D	0	-19.3201	16.4443	0.83913	0.0:0.0:1.0:0.0	.	233;224;216	Q5T4W7-2;Q5T4W7-3;Q5T4W7	.;.;ARTN_HUMAN	F	216;224;224;216;233	ENSP00000361434:C216F;ENSP00000387435:C224F;ENSP00000436727:C224F;ENSP00000361429:C216F;ENSP00000391998:C233F	ENSP00000361429:C216F	C	+	2	0	ARTN	44175008	1.000000	0.71417	1.000000	0.80357	0.373000	0.29922	9.232000	0.95325	1.980000	0.57719	0.478000	0.44815	TGC	.	.		0.677	ARTN-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000020713.2	NM_057090	
AMPD1	270	hgsc.bcm.edu	37	1	115220086	115220086	+	Missense_Mutation	SNP	C	C	A	rs121912682	byFrequency	TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr1:115220086C>A	ENST00000520113.2	-	10	1388	c.1373G>T	c.(1372-1374)cGc>cTc	p.R458L	AMPD1_ENST00000353928.6_Missense_Mutation_p.R425L|AMPD1_ENST00000369538.3_Missense_Mutation_p.R454L			P23109	AMPD1_HUMAN	adenosine monophosphate deaminase 1	458			R -> H (in MMDD; loss of activity). {ECO:0000269|PubMed:11102975}.		IMP salvage (GO:0032264)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase metabolic process (GO:0006144)|purine-containing compound salvage (GO:0043101)|response to organic substance (GO:0010033)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	AMP deaminase activity (GO:0003876)|metal ion binding (GO:0046872)			NS(1)|breast(1)|endometrium(5)|kidney(1)|large_intestine(10)|lung(17)|ovary(3)|pancreas(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	45	all_epithelial(7;7.83e-05)|all_lung(7;0.000179)|Lung NSC(6;0.00195)|Lung SC(450;0.211)	all_cancers(81;4.64e-07)|all_epithelial(167;4.2e-07)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)	Adenosine monophosphate(DB00131)	GATGGACAGGCGGGGCTCAGC	0.572																																					p.R458L		Atlas-SNP	.											.	AMPD1	223	.	0			c.G1373T	GRCh37	CM002933	AMPD1	M	rs121912682	.						98.0	84.0	89.0					1																	115220086		2203	4300	6503	SO:0001583	missense	270	exon10			GACAGGCGGGGCT	M60092	CCDS876.1, CCDS876.2, CCDS53349.1	1p13	2010-02-10	2010-02-10		ENSG00000116748	ENSG00000116748	3.5.4.6		468	protein-coding gene	gene with protein product	"""AMPD isoform M"", ""skeletal muscle AMPD"""	102770	"""adenosine monophosphate deaminase 1 (isoform M)"""			1400401	Standard	NM_001172626		Approved	MAD, MADA	uc001efe.2	P23109	OTTHUMG00000011892	ENST00000520113.2:c.1373G>T	chr1.hg19:g.115220086C>A	ENSP00000430075:p.Arg458Leu	96.0	0.0		143.0	21.0	NM_000036	A8K5N4|B2RAM1|F2Z3B3|Q5TF00|Q5TF02	Missense_Mutation	SNP	ENST00000520113.2	hg19	CCDS876.2	.	.	.	.	.	.	.	.	.	.	C	36	5.636488	0.96693	.	.	ENSG00000116748	ENST00000520113;ENST00000369538;ENST00000353928	D;D;D	0.82711	-1.64;-1.64;-1.64	5.85	5.85	0.93711	Adenosine/AMP deaminase (1);	0.000000	0.85682	D	0.000000	D	0.93996	0.8077	H	0.95365	3.66	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	D	0.94872	0.8031	10	0.87932	D	0	-15.6719	20.1775	0.98187	0.0:1.0:0.0:0.0	.	454;425	Q5TF02;P23109	.;AMPD1_HUMAN	L	458;454;425	ENSP00000430075:R458L;ENSP00000358551:R454L;ENSP00000316520:R425L	ENSP00000316520:R425L	R	-	2	0	AMPD1	115021609	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.818000	0.86416	2.771000	0.95319	0.561000	0.74099	CGC	.	C|0.999;T|0.001		0.572	AMPD1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000032860.4		
IGSF3	3321	hgsc.bcm.edu	37	1	117122413	117122413	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr1:117122413G>A	ENST00000369486.3	-	10	3700	c.2935C>T	c.(2935-2937)Cgc>Tgc	p.R979C	IGSF3_ENST00000369483.1_Missense_Mutation_p.R999C|IGSF3_ENST00000318837.6_Missense_Mutation_p.R999C	NM_001007237.1	NP_001007238.1	O75054	IGSF3_HUMAN	immunoglobulin superfamily, member 3	979	Ig-like C2-type 8.				lacrimal gland development (GO:0032808)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)				NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(1)|lung(31)|ovary(4)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	62	Lung SC(450;0.225)	all_cancers(81;1.24e-06)|all_epithelial(167;4.85e-07)|all_lung(203;1.66e-06)|Lung NSC(69;1.11e-05)		Lung(183;0.0142)|Colorectal(144;0.0929)|LUSC - Lung squamous cell carcinoma(189;0.108)|COAD - Colon adenocarcinoma(174;0.139)|all cancers(265;0.159)|Epithelial(280;0.166)		TGGCTGGAGCGGGACACGATG	0.592																																					p.R999C		Atlas-SNP	.											IGSF3_ENST00000369483,NS,carcinoma,0,2	IGSF3	294	.	0			c.C2995T						.						37.0	36.0	36.0					1																	117122413		2203	4300	6503	SO:0001583	missense	3321	exon11			TGGAGCGGGACAC	AF031174	CCDS30813.1, CCDS30814.1	1p13	2013-01-29			ENSG00000143061	ENSG00000143061		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5950	protein-coding gene	gene with protein product		603491				9790749	Standard	NM_001007237		Approved	V8, EWI-3, MGC117164	uc031pnr.1	O75054	OTTHUMG00000022751	ENST00000369486.3:c.2935C>T	chr1.hg19:g.117122413G>A	ENSP00000358498:p.Arg979Cys	71.0	0.0		121.0	56.0	NM_001542	A6NJZ6|A6NMC7	Missense_Mutation	SNP	ENST00000369486.3	hg19	CCDS30813.1	.	.	.	.	.	.	.	.	.	.	G	25.6	4.651009	0.88056	.	.	ENSG00000143061	ENST00000369486;ENST00000369483;ENST00000318837	T;T;T	0.22539	1.95;1.95;1.95	4.67	4.67	0.58626	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.218972	0.42172	D	0.000759	T	0.26484	0.0647	L	0.50333	1.59	0.58432	D	0.999999	D;D	0.89917	0.999;1.0	P;P	0.59288	0.791;0.855	T	0.01225	-1.1413	10	0.56958	D	0.05	-36.4972	15.1177	0.72416	0.0:0.0:1.0:0.0	.	979;999	O75054;A6NJZ6	IGSF3_HUMAN;.	C	979;999;999	ENSP00000358498:R979C;ENSP00000358495:R999C;ENSP00000321184:R999C	ENSP00000321184:R999C	R	-	1	0	IGSF3	116923936	1.000000	0.71417	0.991000	0.47740	0.991000	0.79684	8.151000	0.89636	2.421000	0.82119	0.462000	0.41574	CGC	.	.		0.592	IGSF3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000059040.1	NM_001542	
OTUD7B	56957	hgsc.bcm.edu	37	1	149916120	149916120	+	Missense_Mutation	SNP	C	C	A	rs376252200		TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr1:149916120C>A	ENST00000369135.4	-	12	2462	c.2168G>T	c.(2167-2169)gGc>gTc	p.G723V		NM_020205.2	NP_064590.2	Q6GQQ9	OTU7B_HUMAN	OTU deubiquitinase 7B	723					mucosal immune response (GO:0002385)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of interleukin-8 production (GO:0032717)|negative regulation of protein localization to nucleus (GO:1900181)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|protein K11-linked deubiquitination (GO:0035871)|protein K48-linked deubiquitination (GO:0071108)|protein K63-linked deubiquitination (GO:0070536)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	cysteine-type peptidase activity (GO:0008234)|DNA binding (GO:0003677)|Lys48-specific deubiquitinase activity (GO:1990380)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)			breast(1)|endometrium(6)|kidney(2)|large_intestine(5)|lung(18)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	39	Breast(34;0.0009)|Ovarian(49;0.0265)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.171)|STAD - Stomach adenocarcinoma(528;0.247)			TGGTGGTAGGCCCCCGACACA	0.652																																					p.G723V		Atlas-SNP	.											.	OTUD7B	76	.	0			c.G2168T						.	C	VAL/GLY	0,3914		0,0,1957	28.0	32.0	31.0		2168	4.4	0.9	1		31	1,8265		0,1,4132	no	missense	OTUD7B	NM_020205.2	109	0,1,6089	AA,AC,CC		0.0121,0.0,0.0082	possibly-damaging	723/844	149916120	1,12179	1957	4133	6090	SO:0001583	missense	56957	exon12			GGTAGGCCCCCGA	AJ293573	CCDS72903.1	1q21.2	2014-02-24	2014-02-24	2006-07-07	ENSG00000163113	ENSG00000264522		"""OTU domain containing"""	16683	protein-coding gene	gene with protein product		611748	"""zinc finger, A20 domain containing 1"", ""OTU domain containing 7B"""	ZA20D1		11463333, 23827681	Standard	NM_020205		Approved	CEZANNE	uc001etn.3	Q6GQQ9	OTTHUMG00000012291	ENST00000369135.4:c.2168G>T	chr1.hg19:g.149916120C>A	ENSP00000358131:p.Gly723Val	43.0	0.0		51.0	22.0	NM_020205	B7Z643|D3DUZ8|Q5SZ60|Q8WWA7|Q9NQ53|Q9UFF4	Missense_Mutation	SNP	ENST00000369135.4	hg19	CCDS41389.1	.	.	.	.	.	.	.	.	.	.	C	10.67	1.414535	0.25465	0.0	1.21E-4	ENSG00000163113	ENST00000369135;ENST00000543330	T	0.32023	1.47	4.37	4.37	0.52481	.	0.306666	0.35151	N	0.003409	T	0.09598	0.0236	L	0.34521	1.04	0.80722	D	1	B	0.09022	0.002	B	0.06405	0.002	T	0.09292	-1.0681	9	.	.	.	-31.7542	8.1151	0.30937	0.0:0.8922:0.0:0.1078	.	723	Q6GQQ9	OTU7B_HUMAN	V	723	ENSP00000358131:G723V	.	G	-	2	0	OTUD7B	148182744	0.434000	0.25570	0.918000	0.36340	0.688000	0.40055	1.197000	0.32211	2.272000	0.75746	0.455000	0.32223	GGC	.	.		0.652	OTUD7B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034146.3	NM_020205	
OR10J5	127385	hgsc.bcm.edu	37	1	159505721	159505721	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr1:159505721G>T	ENST00000334857.2	-	1	121	c.77C>A	c.(76-78)aCc>aAc	p.T26N		NM_001004469.1	NP_001004469.1	Q8NHC4	O10J5_HUMAN	olfactory receptor, family 10, subfamily J, member 5	26						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			kidney(1)|large_intestine(4)|lung(9)|ovary(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	22	all_hematologic(112;0.0429)					CACAAAGAGGGTTATCTGATG	0.388																																					p.T26N		Atlas-SNP	.											.	OR10J5	68	.	0			c.C77A						.						96.0	92.0	93.0					1																	159505721		2203	4300	6503	SO:0001583	missense	127385	exon1			AAGAGGGTTATCT		CCDS30910.1	1q23.2	2012-08-09			ENSG00000184155	ENSG00000184155		"""GPCR / Class A : Olfactory receptors"""	14993	protein-coding gene	gene with protein product							Standard	NM_001004469		Approved		uc010piw.2	Q8NHC4	OTTHUMG00000022738	ENST00000334857.2:c.77C>A	chr1.hg19:g.159505721G>T	ENSP00000334441:p.Thr26Asn	118.0	0.0		152.0	31.0	NM_001004469	B9EH35|Q6IFH2	Missense_Mutation	SNP	ENST00000334857.2	hg19	CCDS30910.1	.	.	.	.	.	.	.	.	.	.	G	12.97	2.097148	0.37048	.	.	ENSG00000184155	ENST00000334857	T	0.00438	7.42	4.43	3.52	0.40303	.	.	.	.	.	T	0.00241	0.0007	M	0.75085	2.285	0.09310	N	1	P	0.52692	0.955	P	0.50231	0.635	T	0.46830	-0.9163	9	0.30078	T	0.28	.	6.9396	0.24486	0.2056:0.0:0.7944:0.0	.	26	Q8NHC4	O10J5_HUMAN	N	26	ENSP00000334441:T26N	ENSP00000334441:T26N	T	-	2	0	OR10J5	157772345	0.000000	0.05858	0.867000	0.34043	0.504000	0.33889	0.240000	0.18042	1.208000	0.43306	0.557000	0.71058	ACC	.	.		0.388	OR10J5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059021.1	NM_001004469	
RFWD2	64326	hgsc.bcm.edu	37	1	175956209	175956209	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr1:175956209T>C	ENST00000367669.3	-	18	2517	c.2003A>G	c.(2002-2004)tAt>tGt	p.Y668C	RFWD2_ENST00000308769.8_Missense_Mutation_p.Y644C	NM_022457.5	NP_071902.2	Q8NHY2	RFWD2_HUMAN	ring finger and WD repeat domain 2, E3 ubiquitin protein ligase	668					DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|response to ionizing radiation (GO:0010212)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|Golgi membrane (GO:0000139)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin protein ligase activity (GO:0061630)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(2)|large_intestine(5)|lung(17)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	30						AAGTCCTTTATAGTACAGGTA	0.299																																					p.Y668C	Ovarian(134;1413 1765 5706 35534 51541)	Atlas-SNP	.											.	RFWD2	67	.	0			c.A2003G						.						59.0	59.0	59.0					1																	175956209		2203	4300	6503	SO:0001583	missense	64326	exon18			CCTTTATAGTACA	AK001278	CCDS30944.1, CCDS44279.1	1q25.1-q25.2	2013-01-09	2012-02-23		ENSG00000143207	ENSG00000143207		"""WD repeat domain containing"", ""RING-type (C3HC4) zinc fingers"""	17440	protein-coding gene	gene with protein product		608067	"""ring finger and WD repeat domain 2"""			10395541	Standard	XM_005245447		Approved	FLJ10416, COP1, RNF200	uc001gku.1	Q8NHY2	OTTHUMG00000034986	ENST00000367669.3:c.2003A>G	chr1.hg19:g.175956209T>C	ENSP00000356641:p.Tyr668Cys	179.0	0.0		202.0	45.0	NM_022457	E9PKI0|Q504W6|Q6H103|Q9H6L7|X5D9B4	Missense_Mutation	SNP	ENST00000367669.3	hg19	CCDS30944.1	.	.	.	.	.	.	.	.	.	.	T	15.88	2.962913	0.53507	.	.	ENSG00000143207	ENST00000367665;ENST00000367669;ENST00000367666;ENST00000308769	T;T;T	0.70399	-0.48;-0.48;-0.48	5.64	5.64	0.86602	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	D	0.85969	0.5821	M	0.87269	2.87	0.80722	D	1	B;D;B;D;D	0.76494	0.067;0.98;0.169;0.999;0.98	B;D;B;D;D	0.77557	0.114;0.941;0.091;0.99;0.941	D	0.88357	0.2985	10	0.72032	D	0.01	-15.7895	15.8017	0.78456	0.0:0.0:0.0:1.0	.	443;428;644;668;668	Q8NHY2-3;B1AMD2;Q8NHY2-2;Q8NHY2;Q504W6	.;.;.;RFWD2_HUMAN;.	C	443;668;503;644	ENSP00000356641:Y668C;ENSP00000356638:Y503C;ENSP00000310943:Y644C	ENSP00000310943:Y644C	Y	-	2	0	RFWD2	174222832	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	7.268000	0.78473	2.261000	0.74972	0.533000	0.62120	TAT	.	.		0.299	RFWD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084672.2	NM_022457	
TDRD5	163589	hgsc.bcm.edu	37	1	179623394	179623394	+	Intron	SNP	T	T	G			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr1:179623394T>G	ENST00000367614.1	+	13	2519				TDRD5_ENST00000294848.8_Intron|TDRD5_ENST00000444136.1_Nonsense_Mutation_p.L740*	NM_001199091.1	NP_001186020.1	Q8NAT2	TDRD5_HUMAN	tudor domain containing 5						DNA methylation involved in gamete generation (GO:0043046)|P granule organization (GO:0030719)|spermatid development (GO:0007286)	chromatoid body (GO:0033391)|pi-body (GO:0071546)				NS(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(7)|lung(44)|ovary(2)|prostate(1)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)	77						AAGGAGCCATTAAAGGATTCT	0.313																																					p.L740X		Atlas-SNP	.											.	TDRD5	149	.	0			c.T2219G						.																																			SO:0001627	intron_variant	163589	exon14			AGCCATTAAAGGA	AK092142	CCDS1332.1, CCDS55663.1	1q24.2	2013-01-23			ENSG00000162782	ENSG00000162782		"""Tudor domain containing"""	20614	protein-coding gene	gene with protein product							Standard	NM_001199085		Approved	FLJ34823, TUDOR3	uc010pnp.2	Q8NAT2	OTTHUMG00000035259	ENST00000367614.1:c.2160+2062T>G	chr1.hg19:g.179623394T>G		283.0	0.0		264.0	24.0	NM_001199085	A1L4G5|B7ZLV0|Q5EBN4|Q5VTV0|Q6ZSK2	Nonsense_Mutation	SNP	ENST00000367614.1	hg19	CCDS1332.1	.	.	.	.	.	.	.	.	.	.	T	18.82	3.704245	0.68615	.	.	ENSG00000162782	ENST00000444136;ENST00000417329	.	.	.	5.06	5.06	0.68205	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.21540	T	0.41	-21.2831	11.498	0.50419	0.0:0.0:0.0:1.0	.	.	.	.	X	740;196	.	ENSP00000410744:L196X	L	+	2	0	TDRD5	177890017	0.998000	0.40836	0.973000	0.42090	0.440000	0.31957	1.936000	0.40183	2.036000	0.60181	0.533000	0.62120	TTA	.	.		0.313	TDRD5-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000085295.1	NM_173533	
HHIPL2	79802	hgsc.bcm.edu	37	1	222705320	222705320	+	Missense_Mutation	SNP	C	C	G			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr1:222705320C>G	ENST00000343410.6	-	6	1769	c.1711G>C	c.(1711-1713)Gaa>Caa	p.E571Q		NM_024746.3	NP_079022.2	Q6UWX4	HIPL2_HUMAN	HHIP-like 2	571					carbohydrate metabolic process (GO:0005975)	extracellular region (GO:0005576)	oxidoreductase activity, acting on the CH-OH group of donors, quinone or similar compound as acceptor (GO:0016901)|quinone binding (GO:0048038)			NS(2)|endometrium(8)|kidney(4)|large_intestine(7)|lung(28)|ovary(1)|prostate(3)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	59				GBM - Glioblastoma multiforme(131;0.0185)		GCTTCATCTTCAGCAAAGGAG	0.433																																					p.E571Q		Atlas-SNP	.											.	HHIPL2	122	.	0			c.G1711C						.						84.0	81.0	82.0					1																	222705320		2203	4300	6503	SO:0001583	missense	79802	exon6			CATCTTCAGCAAA	BC007638	CCDS1530.2	1q41	2008-02-05	2008-01-16	2008-01-16	ENSG00000143512	ENSG00000143512			25842	protein-coding gene	gene with protein product			"""KIAA1822-like"""	KIAA1822L		12975309	Standard	NM_024746		Approved	FLJ13840	uc001hnh.1	Q6UWX4	OTTHUMG00000037545	ENST00000343410.6:c.1711G>C	chr1.hg19:g.222705320C>G	ENSP00000342118:p.Glu571Gln	91.0	0.0		62.0	25.0	NM_024746	Q6GU65|Q96BT4|Q96BU5|Q9H8A0	Missense_Mutation	SNP	ENST00000343410.6	hg19	CCDS1530.2	.	.	.	.	.	.	.	.	.	.	C	20.5	3.999179	0.74818	.	.	ENSG00000143512	ENST00000343410	T	0.11169	2.8	5.0	4.09	0.47781	Soluble quinoprotein glucose/sorbosone dehydrogenase (1);Six-bladed beta-propeller, TolB-like (1);	0.052062	0.64402	D	0.000001	T	0.23688	0.0573	L	0.43757	1.38	0.52099	D	0.999942	D	0.89917	1.0	D	0.97110	1.0	T	0.00581	-1.1660	10	0.39692	T	0.17	-18.8979	12.8232	0.57704	0.0:0.9204:0.0:0.0796	.	571	Q6UWX4	HIPL2_HUMAN	Q	571	ENSP00000342118:E571Q	ENSP00000342118:E571Q	E	-	1	0	HHIPL2	220771943	1.000000	0.71417	0.994000	0.49952	0.982000	0.71751	5.694000	0.68272	1.091000	0.41335	0.591000	0.81541	GAA	.	.		0.433	HHIPL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091499.2	NM_024746	
RBM34	23029	hgsc.bcm.edu	37	1	235318339	235318339	+	Missense_Mutation	SNP	C	C	A	rs200657743		TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr1:235318339C>A	ENST00000408888.3	-	4	684	c.454G>T	c.(454-456)Gta>Tta	p.V152L	RBM34_ENST00000366606.3_Missense_Mutation_p.V147L			P42696	RBM34_HUMAN	RNA binding motif protein 34	152						nucleolus (GO:0005730)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			central_nervous_system(1)	1	Ovarian(103;0.0398)	all_cancers(173;0.177)|Prostate(94;0.0166)	OV - Ovarian serous cystadenocarcinoma(106;5.43e-05)|Epithelial(3;0.000121)			CTATCTGCTACTTTAACACCA	0.368																																					p.V152L		Atlas-SNP	.											.	RBM34	41	.	0			c.G454T						.						188.0	159.0	168.0					1																	235318339		1819	4089	5908	SO:0001583	missense	23029	exon4			CTGCTACTTTAAC		CCDS41477.1, CCDS41477.2	1q42.3	2013-02-12			ENSG00000188739	ENSG00000188739		"""RNA binding motif (RRM) containing"""	28965	protein-coding gene	gene with protein product						7788527, 15134903	Standard	NM_015014		Approved	KIAA0117	uc001hwn.3	P42696	OTTHUMG00000039620	ENST00000408888.3:c.454G>T	chr1.hg19:g.235318339C>A	ENSP00000386226:p.Val152Leu	662.0	1.0		694.0	308.0	NM_001161533	A8K8J7|Q8N2Z8|Q9H5A1	Missense_Mutation	SNP	ENST00000408888.3	hg19	CCDS41477.2	.	.	.	.	.	.	.	.	.	.	C	1.089	-0.664488	0.03428	.	.	ENSG00000188739	ENST00000408888;ENST00000366606;ENST00000400947;ENST00000447801;ENST00000429912	T;T;T	0.14391	2.51;2.51;2.63	5.67	0.267	0.15622	.	1.363850	0.04381	N	0.360761	T	0.15003	0.0362	M	0.64997	1.995	0.09310	N	1	B;B	0.33171	0.4;0.01	B;B	0.26969	0.075;0.005	T	0.35201	-0.9798	10	0.27785	T	0.31	-1.4571	8.9883	0.36008	0.0:0.5752:0.0:0.4248	.	152;152	P42696-2;P42696	.;RBM34_HUMAN	L	152;147;181;150;181	ENSP00000386226:V152L;ENSP00000355565:V147L;ENSP00000400000:V150L	ENSP00000355565:V147L	V	-	1	0	RBM34	233384962	0.000000	0.05858	0.000000	0.03702	0.055000	0.15305	-0.038000	0.12144	0.091000	0.17302	0.655000	0.94253	GTA	.	.		0.368	RBM34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000100146.1	NM_015014	
KIF26B	55083	hgsc.bcm.edu	37	1	245772747	245772747	+	Missense_Mutation	SNP	C	C	G			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr1:245772747C>G	ENST00000407071.2	+	8	2271	c.1831C>G	c.(1831-1833)Ctg>Gtg	p.L611V	KIF26B_ENST00000366518.4_Missense_Mutation_p.L230V	NM_018012.3	NP_060482.2	Q2KJY2	KI26B_HUMAN	kinesin family member 26B	611	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				establishment of cell polarity (GO:0030010)|metabolic process (GO:0008152)|positive regulation of cell-cell adhesion (GO:0022409)|ureteric bud invasion (GO:0072092)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(21)|ovary(4)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	51	all_cancers(71;3.86e-05)|all_epithelial(71;0.000121)|Ovarian(71;0.0412)|all_lung(81;0.0498)|Lung NSC(105;0.0708)|Breast(184;0.127)		OV - Ovarian serous cystadenocarcinoma(106;0.022)			GCGGGACCTGCTGTCGGAGGT	0.637																																					p.L611V		Atlas-SNP	.											.	KIF26B	343	.	0			c.C1831G						.						16.0	21.0	20.0					1																	245772747		1971	4134	6105	SO:0001583	missense	55083	exon8			GACCTGCTGTCGG	AK001019	CCDS44342.1	1q44	2008-02-05			ENSG00000162849	ENSG00000162849		"""Kinesins"""	25484	protein-coding gene	gene with protein product		614026					Standard	NM_018012		Approved	FLJ10157	uc001ibf.1	Q2KJY2	OTTHUMG00000040079	ENST00000407071.2:c.1831C>G	chr1.hg19:g.245772747C>G	ENSP00000385545:p.Leu611Val	55.0	0.0		132.0	23.0	NM_018012	Q6ZQR9|Q6ZUZ0|Q8IUN3|Q8IVR1|Q9NWB4	Missense_Mutation	SNP	ENST00000407071.2	hg19	CCDS44342.1	.	.	.	.	.	.	.	.	.	.	C	15.72	2.917892	0.52546	.	.	ENSG00000162849	ENST00000407071;ENST00000366518;ENST00000413001	D;D	0.87887	-2.31;-2.31	5.4	3.51	0.40186	Kinesin, motor domain (4);	.	.	.	.	D	0.93690	0.7984	M	0.90425	3.115	0.58432	D	0.999996	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.93431	0.6785	9	0.87932	D	0	.	10.4968	0.44783	0.0:0.7695:0.0:0.2305	.	230;611	B7WPD9;Q2KJY2	.;KI26B_HUMAN	V	611;230;227	ENSP00000385545:L611V;ENSP00000355475:L230V	ENSP00000355475:L230V	L	+	1	2	KIF26B	243839370	1.000000	0.71417	0.992000	0.48379	0.993000	0.82548	2.697000	0.47060	0.746000	0.32786	0.650000	0.86243	CTG	.	.		0.637	KIF26B-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381037.1	XM_371354	
SRSF7	6432	hgsc.bcm.edu	37	2	38976737	38976737	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr2:38976737T>C	ENST00000313117.6	-	3	557	c.320A>G	c.(319-321)tAt>tGt	p.Y107C	SRSF7_ENST00000409276.1_Missense_Mutation_p.Y107C|SRSF7_ENST00000446327.2_Missense_Mutation_p.Y107C|GEMIN6_ENST00000409011.1_5'Flank	NM_001031684.2|NM_001195446.1	NP_001026854.1|NP_001182375.1	Q16629	SRSF7_HUMAN	serine/arginine-rich splicing factor 7	107					gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	12						GCCACACTCATAGCATCTATC	0.458																																					p.Y107C		Atlas-SNP	.											.	SRSF7	29	.	0			c.A320G						.						149.0	141.0	144.0					2																	38976737		2203	4300	6503	SO:0001583	missense	6432	exon3			CACTCATAGCATC	L41887	CCDS33183.1, CCDS56115.1	2p22.1	2013-02-12	2010-06-22	2010-06-22	ENSG00000115875	ENSG00000115875		"""Zinc fingers, CCHC domain containing"", ""Serine/arginine-rich splicing factors"", ""RNA binding motif (RRM) containing"""	10789	protein-coding gene	gene with protein product	"""SR splicing factor 7"""	600572	"""splicing factor, arginine/serine-rich 7 (35kD)"", ""splicing factor, arginine/serine-rich 7, 35kDa"""	SFRS7		8013463, 20516191	Standard	NM_001031684		Approved	9G8, ZCRB2, HSSG1, AAG3, RBM37, ZCCHC20	uc002rqz.3	Q16629	OTTHUMG00000102076	ENST00000313117.6:c.320A>G	chr2.hg19:g.38976737T>C	ENSP00000325905:p.Tyr107Cys	282.0	1.0		529.0	188.0	NM_001195446	B4DLU6|G5E9M3|Q564D3	Missense_Mutation	SNP	ENST00000313117.6	hg19	CCDS33183.1	.	.	.	.	.	.	.	.	.	.	T	18.42	3.621157	0.66787	.	.	ENSG00000115875	ENST00000313117;ENST00000446327;ENST00000409276	T;T;T	0.78003	-1.14;-1.14;-1.14	5.93	4.75	0.60458	Zinc finger, CCHC retroviral-type (1);Zinc finger, CCHC-type (2);	0.000000	0.64402	D	0.000004	D	0.89047	0.6604	M	0.89095	3.005	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	D	0.90120	0.4198	10	0.87932	D	0	.	12.3223	0.54991	0.1269:0.0:0.0:0.8731	.	107;107	G5E9M3;Q16629	.;SRSF7_HUMAN	C	107	ENSP00000325905:Y107C;ENSP00000402264:Y107C;ENSP00000386806:Y107C	ENSP00000325905:Y107C	Y	-	2	0	SRSF7	38830241	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.677000	0.84024	1.024000	0.39682	0.533000	0.62120	TAT	.	.		0.458	SRSF7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219889.2	NM_001031684	
CCDC88A	55704	hgsc.bcm.edu	37	2	55582881	55582881	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr2:55582881T>C	ENST00000436346.1	-	8	1475	c.634A>G	c.(634-636)Ata>Gta	p.I212V	CCDC88A_ENST00000413716.2_Missense_Mutation_p.I212V|CCDC88A_ENST00000263630.8_Missense_Mutation_p.I212V|CCDC88A_ENST00000336838.6_Missense_Mutation_p.I212V	NM_001135597.1|NM_001254943.1	NP_001129069.1|NP_001241872.1	Q3V6T2	GRDN_HUMAN	coiled-coil domain containing 88A	212					activation of protein kinase B activity (GO:0032148)|cell migration (GO:0016477)|DNA replication (GO:0006260)|lamellipodium assembly (GO:0030032)|membrane organization (GO:0061024)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cell proliferation (GO:0042127)|regulation of DNA replication (GO:0006275)|regulation of neuron projection development (GO:0010975)|regulation of protein phosphorylation (GO:0001932)|TOR signaling (GO:0031929)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|membrane (GO:0016020)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|microtubule binding (GO:0008017)|phosphatidylinositol binding (GO:0035091)|protein homodimerization activity (GO:0042803)|protein kinase B binding (GO:0043422)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(22)|lung(23)|ovary(3)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|urinary_tract(1)	69						GAGAGTTCTATGATAGTCTAG	0.423																																					p.I212V		Atlas-SNP	.											CCDC88A_ENST00000336838,NS,carcinoma,0,2	CCDC88A	336	.	0			c.A634G						.						62.0	52.0	55.0					2																	55582881		2203	4300	6503	SO:0001583	missense	55704	exon8			GTTCTATGATAGT	AB033038, AF112218	CCDS33203.1, CCDS46288.1, CCDS58710.1	2p16.3	2013-03-13	2007-05-31	2007-05-31	ENSG00000115355	ENSG00000115355			25523	protein-coding gene	gene with protein product	"""Galpha-interacting vesicle-associated protein"", ""Akt-phosphorylation enhancer"", ""girdin"", ""girders of actin filaments"""	609736	"""KIAA1212"""	KIAA1212		15749703, 15753085	Standard	NM_001135597		Approved	FLJ10392, APE, GIV, HkRP1, GRDN	uc002ryv.2	Q3V6T2	OTTHUMG00000151915	ENST00000436346.1:c.634A>G	chr2.hg19:g.55582881T>C	ENSP00000410608:p.Ile212Val	75.0	0.0		78.0	30.0	NM_018084	A1IGE7|B7ZM78|C9JG83|Q53SF1|Q581G3|Q5HYD0|Q7Z339|Q7Z3C5	Missense_Mutation	SNP	ENST00000436346.1	hg19		.	.	.	.	.	.	.	.	.	.	T	2.571	-0.299616	0.05532	.	.	ENSG00000115355	ENST00000336838;ENST00000263630;ENST00000436346;ENST00000413716;ENST00000430086	T;T;T;T;T	0.40756	1.02;1.02;1.02;1.02;2.34	5.05	-6.62	0.01813	.	0.490245	0.16762	N	0.200562	T	0.19087	0.0458	N	0.17082	0.46	0.80722	D	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.001;0.0;0.001	T	0.42344	-0.9457	10	0.02654	T	1	-1.1238	15.1743	0.72899	0.0:0.567:0.0:0.4329	.	212;212;212	B7ZM78;Q3V6T2-2;Q3V6T2-3	.;.;.	V	212;212;212;212;137	ENSP00000338728:I212V;ENSP00000263630:I212V;ENSP00000410608:I212V;ENSP00000404431:I212V;ENSP00000399237:I137V	ENSP00000263630:I212V	I	-	1	0	CCDC88A	55436385	0.000000	0.05858	0.028000	0.17463	0.985000	0.73830	-0.362000	0.07602	-1.480000	0.01865	0.482000	0.46254	ATA	.	.		0.423	CCDC88A-203	KNOWN	basic	protein_coding	protein_coding		NM_017571	
SLC5A7	60482	hgsc.bcm.edu	37	2	108622601	108622601	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr2:108622601G>A	ENST00000264047.2	+	7	1114	c.838G>A	c.(838-840)Ggg>Agg	p.G280R	SLC5A7_ENST00000540517.1_Missense_Mutation_p.G175R|SLC5A7_ENST00000409059.1_Missense_Mutation_p.G280R	NM_021815.2	NP_068587.1	Q9GZV3	SC5A7_HUMAN	solute carrier family 5 (sodium/choline cotransporter), member 7	280					acetylcholine biosynthetic process (GO:0008292)|cell death (GO:0008219)|neuromuscular synaptic transmission (GO:0007274)|neurotransmitter secretion (GO:0007269)|synaptic transmission (GO:0007268)|synaptic transmission, cholinergic (GO:0007271)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	choline binding (GO:0033265)|choline transmembrane transporter activity (GO:0015220)|choline:sodium symporter activity (GO:0005307)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(23)|ovary(2)|pancreas(1)|prostate(1)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(2)	49					Choline(DB00122)	GGCAGCTTTCGGGTGCCTGGT	0.522																																					p.G280R		Atlas-SNP	.											.	SLC5A7	109	.	0			c.G838A						.						109.0	94.0	99.0					2																	108622601		2203	4300	6503	SO:0001583	missense	60482	exon7			GCTTTCGGGTGCC	AF276871	CCDS2074.1	2q12	2013-07-19	2013-07-19		ENSG00000115665	ENSG00000115665		"""Solute carriers"""	14025	protein-coding gene	gene with protein product		608761	"""solute carrier family 5 (choline transporter), member 7"""			11027560	Standard	NM_021815		Approved	hCHT, CHT1	uc002tdv.3	Q9GZV3	OTTHUMG00000130959	ENST00000264047.2:c.838G>A	chr2.hg19:g.108622601G>A	ENSP00000264047:p.Gly280Arg	101.0	0.0		156.0	59.0	NM_021815	Q53TF2	Missense_Mutation	SNP	ENST00000264047.2	hg19	CCDS2074.1	.	.	.	.	.	.	.	.	.	.	G	33	5.207259	0.95033	.	.	ENSG00000115665	ENST00000409059;ENST00000540517;ENST00000264047	D;D;D	0.88201	-2.35;-2.35;-2.35	5.52	5.52	0.82312	.	0.000000	0.85682	D	0.000000	D	0.95934	0.8676	M	0.91872	3.25	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	D	0.96084	0.9056	10	0.66056	D	0.02	-14.1517	19.8703	0.96847	0.0:0.0:1.0:0.0	.	280	Q9GZV3	SC5A7_HUMAN	R	280;175;280	ENSP00000387346:G280R;ENSP00000445351:G175R;ENSP00000264047:G280R	ENSP00000264047:G280R	G	+	1	0	SLC5A7	107989033	1.000000	0.71417	0.993000	0.49108	0.896000	0.52359	9.810000	0.99221	2.770000	0.95276	0.650000	0.86243	GGG	.	.		0.522	SLC5A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253562.1		
KYNU	8942	hgsc.bcm.edu	37	2	143718192	143718192	+	Splice_Site	SNP	G	G	A			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr2:143718192G>A	ENST00000264170.4	+	8	840		c.e8-1		KYNU_ENST00000375773.2_Splice_Site|KYNU_ENST00000409512.1_Splice_Site	NM_003937.2	NP_003928.1			kynureninase											large_intestine(10)|liver(1)|lung(18)|prostate(3)|skin(4)	36				BRCA - Breast invasive adenocarcinoma(221;0.072)		ACTTGATTTAGGGGGAAGAAA	0.363																																					.		Atlas-SNP	.											.	KYNU	110	.	0			c.583-1G>A						.						82.0	83.0	82.0					2																	143718192		2203	4300	6503	SO:0001630	splice_region_variant	8942	exon9			GATTTAGGGGGAA	U57721	CCDS2183.1, CCDS33299.1	2q22.2	2010-11-23	2010-11-23		ENSG00000115919	ENSG00000115919	3.7.1.3		6469	protein-coding gene	gene with protein product	"""L-kynurenine hydrolase"""	605197	"""kynureninase (L-kynurenine hydrolase)"""			8706755, 9180257	Standard	NM_001199241		Approved		uc002tvl.3	Q16719	OTTHUMG00000131829	ENST00000264170.4:c.583-1G>A	chr2.hg19:g.143718192G>A		74.0	0.0		48.0	12.0	NM_001199241		Splice_Site	SNP	ENST00000264170.4	hg19	CCDS2183.1	.	.	.	.	.	.	.	.	.	.	G	18.77	3.695405	0.68386	.	.	ENSG00000115919	ENST00000264170;ENST00000375773;ENST00000409512	.	.	.	5.35	5.35	0.76521	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.0789	0.93173	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	KYNU	143434662	1.000000	0.71417	0.999000	0.59377	0.683000	0.39861	9.360000	0.97119	2.668000	0.90789	0.644000	0.83932	.	.	.		0.363	KYNU-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254772.1	NM_001032998	Intron
SCN2A	6326	hgsc.bcm.edu	37	2	166211045	166211045	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr2:166211045A>G	ENST00000375437.2	+	17	3553	c.3263A>G	c.(3262-3264)gAt>gGt	p.D1088G	SCN2A_ENST00000375427.2_Missense_Mutation_p.D1088G|SCN2A_ENST00000283256.6_Missense_Mutation_p.D1088G|SCN2A_ENST00000357398.3_Missense_Mutation_p.D1088G	NM_001040142.1	NP_001035232.1	Q99250	SCN2A_HUMAN	sodium channel, voltage-gated, type II, alpha subunit	1088					intrinsic apoptotic signaling pathway in response to osmotic stress (GO:0008627)|membrane depolarization during action potential (GO:0086010)|myelination (GO:0042552)|neuron apoptotic process (GO:0051402)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon (GO:0030424)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intrinsic component of plasma membrane (GO:0031226)|node of Ranvier (GO:0033268)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|sodium channel complex (GO:0034706)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(1)|breast(7)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(27)|liver(2)|lung(49)|ovary(6)|pancreas(1)|prostate(2)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	118					Lamotrigine(DB00555)|Propofol(DB00818)|Valproic Acid(DB00313)|Zonisamide(DB00909)	TATGTCGTGGATGAAAGTGAT	0.373																																					p.D1088G		Atlas-SNP	.											.	SCN2A	589	.	0			c.A3263G						.						113.0	111.0	112.0					2																	166211045		2203	4300	6503	SO:0001583	missense	6326	exon16			TCGTGGATGAAAG	AB208888	CCDS33313.1, CCDS33314.1	2q24.3	2012-02-26	2007-01-23	2007-01-23	ENSG00000136531	ENSG00000136531		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10588	protein-coding gene	gene with protein product		182390	"""sodium channel, voltage-gated, type II, alpha 2 polypeptide"", ""sodium channel, voltage-gated, type II, alpha 1 polypeptide"""	SCN2A1, SCN2A2		1317301, 16382098	Standard	XM_005246753		Approved	Nav1.2, HBSCII, HBSCI	uc002ude.3	Q99250	OTTHUMG00000044172	ENST00000375437.2:c.3263A>G	chr2.hg19:g.166211045A>G	ENSP00000364586:p.Asp1088Gly	309.0	0.0		305.0	95.0	NM_001040143	A6NC14|A6NIQ5|Q14472|Q53T77|Q9BZC9|Q9BZD0	Missense_Mutation	SNP	ENST00000375437.2	hg19	CCDS33314.1	.	.	.	.	.	.	.	.	.	.	A	13.29	2.193601	0.38707	.	.	ENSG00000136531	ENST00000375437;ENST00000357398;ENST00000283256;ENST00000375427	D;D;D;D	0.83992	-1.79;-1.79;-1.79;-1.79	5.26	5.26	0.73747	Sodium ion transport-associated (1);	0.172626	0.41001	D	0.000972	D	0.88239	0.6383	M	0.77616	2.38	0.34725	D	0.729149	B;P	0.47545	0.01;0.897	B;P	0.53760	0.015;0.734	D	0.91929	0.5553	10	0.40728	T	0.16	.	15.1655	0.72821	1.0:0.0:0.0:0.0	.	1088;1088	Q99250-2;Q99250	.;SCN2A_HUMAN	G	1088	ENSP00000364586:D1088G;ENSP00000349973:D1088G;ENSP00000283256:D1088G;ENSP00000364576:D1088G	ENSP00000283256:D1088G	D	+	2	0	SCN2A	165919291	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.903000	0.56318	1.981000	0.57761	0.482000	0.46254	GAT	.	.		0.373	SCN2A-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000102659.2	NM_021007	
CNTN6	27255	hgsc.bcm.edu	37	3	1371531	1371532	+	Missense_Mutation	DNP	GA	GA	AT			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	G|A	G|A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr3:1371531_1371532GA>AT	ENST00000446702.2	+	11	1903_1904	c.1276_1277GA>AT	c.(1276-1278)GAt>ATt	p.D426I	CNTN6_ENST00000350110.2_Missense_Mutation_p.D426I|CNTN6_ENST00000539053.1_Missense_Mutation_p.D354I			Q9UQ52	CNTN6_HUMAN	contactin 6	426	Ig-like C2-type 5.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|central nervous system development (GO:0007417)|Notch signaling pathway (GO:0007219)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)		p.D426N(1)		breast(6)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(25)|lung(34)|ovary(1)|pancreas(1)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	90		all_cancers(2;0.000164)|all_epithelial(2;0.107)		Epithelial(13;0.000233)|all cancers(10;0.0013)|OV - Ovarian serous cystadenocarcinoma(96;0.0139)		AGTTGGTGGGGATATTGTTATC	0.371																																					p.D426N|p.D426V		Atlas-SNP	.											CNTN6,colon,carcinoma,0,1|.	CNTN6	245	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1276A|c.A1277T						.																																			SO:0001583	missense	27255	exon11			GGTGGGGATATTG|GTGGGGATATTGT	AB003592	CCDS2557.1	3p26-p25	2013-02-11			ENSG00000134115	ENSG00000134115		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	2176	protein-coding gene	gene with protein product	"""neural adhesion molecule"""	607220				9486763	Standard	NM_014461		Approved	NB-3	uc003bpa.3	Q9UQ52	OTTHUMG00000119030	Exception_encountered	chr3.hg19:g.1371531_1371532delinsAT	ENSP00000407822:p.Asp426Ile	519.0|516.0	1.0		177.0|175.0	63.0|60.0	NM_014461	Q2KHM2	Missense_Mutation	SNP	ENST00000446702.2	hg19	CCDS2557.1																																																																																			.	.		0.371	CNTN6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239235.2	NM_014461	
PDCD6IP	10015	hgsc.bcm.edu	37	3	33840383	33840383	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr3:33840383G>A	ENST00000307296.3	+	1	540	c.163G>A	c.(163-165)Ggt>Agt	p.G55S	RP11-10C24.3_ENST00000604982.1_lincRNA|RP11-10C24.1_ENST00000605513.1_lincRNA|PDCD6IP_ENST00000457054.2_Missense_Mutation_p.G55S			Q8WUM4	PDC6I_HUMAN	programmed cell death 6 interacting protein	55	BRO1. {ECO:0000255|PROSITE- ProRule:PRU00526}.				apoptotic process (GO:0006915)|cell cycle (GO:0007049)|cell division (GO:0051301)|protein transport (GO:0015031)|viral life cycle (GO:0019058)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|immunological synapse (GO:0001772)|membrane (GO:0016020)|vesicle (GO:0031982)	calcium-dependent protein binding (GO:0048306)|protein homodimerization activity (GO:0042803)			central_nervous_system(3)|endometrium(1)|kidney(2)|large_intestine(7)|lung(6)|ovary(2)|skin(1)|stomach(1)	23						CGCCGCAGTCGGTCGTCCGCT	0.701																																					p.G55S		Atlas-SNP	.											.	PDCD6IP	62	.	0			c.G163A						.						6.0	8.0	8.0					3																	33840383		2064	4021	6085	SO:0001583	missense	10015	exon1			GCAGTCGGTCGTC	BC020066	CCDS2660.1, CCDS54561.1	3p22.3	2012-08-30	2001-11-29		ENSG00000170248	ENSG00000170248			8766	protein-coding gene	gene with protein product	"""ALG-2 interacting protein X"""	608074	"""programmed cell death 6-interacting protein"""			9880530	Standard	NM_001162429		Approved	Alix, AIP1, Hp95	uc003cfy.4	Q8WUM4	OTTHUMG00000130751	ENST00000307296.3:c.163G>A	chr3.hg19:g.33840383G>A	ENSP00000307387:p.Gly55Ser	14.0	0.0		41.0	26.0	NM_013374	C5MQH7|E9PFU1|Q6NUS1|Q9BX86|Q9NUN0|Q9P2H2|Q9UKL5	Missense_Mutation	SNP	ENST00000307296.3	hg19	CCDS2660.1	.	.	.	.	.	.	.	.	.	.	G	16.46	3.128482	0.56721	.	.	ENSG00000170248	ENST00000307296;ENST00000457054;ENST00000413073	T;T;T	0.17213	2.29;2.29;2.29	5.65	4.78	0.61160	BRO1 domain (3);	0.000000	0.85682	D	0.000000	T	0.23886	0.0578	M	0.73372	2.23	0.80722	D	1	B;B;P	0.37997	0.004;0.0;0.614	B;B;B	0.41202	0.006;0.002;0.35	T	0.03335	-1.1047	10	0.17832	T	0.49	-2.2186	14.4391	0.67303	0.0718:0.0:0.9282:0.0	.	55;55;55	C5MQH7;E9PFU1;Q8WUM4	.;.;PDC6I_HUMAN	S	55	ENSP00000307387:G55S;ENSP00000411825:G55S;ENSP00000406693:G55S	ENSP00000307387:G55S	G	+	1	0	PDCD6IP	33815387	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.893000	0.75649	1.383000	0.46405	0.591000	0.81541	GGT	.	.		0.701	PDCD6IP-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000253251.2		
TLR9	54106	hgsc.bcm.edu	37	3	52255499	52255499	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr3:52255499C>T	ENST00000360658.2	-	2	3466	c.2833G>A	c.(2833-2835)Ggt>Agt	p.G945S	TLR9_ENST00000494383.1_Nonsense_Mutation_p.W1098*|TLR9_ENST00000597542.1_Missense_Mutation_p.G969S	NM_017442.3	NP_059138.1	Q9NR96	TLR9_HUMAN	toll-like receptor 9	945	TIR. {ECO:0000255|PROSITE- ProRule:PRU00204}.				defense response to bacterium (GO:0042742)|defense response to Gram-negative bacterium (GO:0050829)|I-kappaB phosphorylation (GO:0007252)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|maintenance of gastrointestinal epithelium (GO:0030277)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of interleukin-8 production (GO:0032717)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of toll-like receptor signaling pathway (GO:0034122)|positive regulation of chemokine production (GO:0032722)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-alpha biosynthetic process (GO:0045356)|positive regulation of interferon-beta biosynthetic process (GO:0045359)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-18 production (GO:0032741)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of JNK cascade (GO:0046330)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of toll-like receptor signaling pathway (GO:0034123)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|regulation of cytokine secretion (GO:0050707)|response to molecule of bacterial origin (GO:0002237)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|early phagosome (GO:0032009)|endolysosome membrane (GO:0036020)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|endosome (GO:0005768)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|plasma membrane (GO:0005886)	interleukin-1 receptor binding (GO:0005149)|siRNA binding (GO:0035197)|transmembrane signaling receptor activity (GO:0004888)			endometrium(4)|large_intestine(11)|lung(9)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	30				BRCA - Breast invasive adenocarcinoma(193;2.41e-05)|Kidney(197;0.000537)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)	Chloroquine(DB00608)|Hydroxychloroquine(DB01611)	CGCAAGAGACCACTGACCCGG	0.662																																					p.G945S		Atlas-SNP	.											.	TLR9	72	.	0			c.G2833A						.						38.0	42.0	40.0					3																	52255499		2201	4298	6499	SO:0001583	missense	54106	exon2			AGAGACCACTGAC	AF259262	CCDS2848.1	3p21.3	2006-02-23			ENSG00000239732	ENSG00000239732		"""CD molecules"""	15633	protein-coding gene	gene with protein product		605474				11022119	Standard	NM_017442		Approved	CD289	uc003ddb.3	Q9NR96	OTTHUMG00000158106	ENST00000360658.2:c.2833G>A	chr3.hg19:g.52255499C>T	ENSP00000353874:p.Gly945Ser	20.0	0.0		54.0	15.0	NM_017442	B3Y661|D1CS56|Q6UVZ2|Q9HD68|Q9HD69|Q9HD70|Q9NYC2|Q9NYC3	Missense_Mutation	SNP	ENST00000360658.2	hg19	CCDS2848.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	22.1|22.1	4.248815|4.248815	0.80024|0.80024	.|.	.|.	ENSG00000239732|ENSG00000173366	ENST00000360658|ENST00000494383	T|.	0.07216|.	3.21|.	5.81|5.81	4.0|4.0	0.46444|0.46444	Toll/interleukin-1 receptor homology (TIR) domain (3);|.	0.000000|.	0.42172|.	D|.	0.000750|.	T|.	0.62011|.	0.2393|.	L|L	0.61036|0.61036	1.89|1.89	0.52099|0.52099	D|D	0.999945|0.999945	P;D|.	0.89917|.	0.889;1.0|.	B;D|.	0.97110|.	0.435;1.0|.	T|.	0.58329|.	-0.7655|.	10|.	0.66056|.	D|.	0.02|.	.|.	9.2959|9.2959	0.37815|0.37815	0.1441:0.7797:0.0:0.0763|0.1441:0.7797:0.0:0.0763	.|.	1042;945|.	B4E0A1;Q9NR96|.	.;TLR9_HUMAN|.	S|X	945|1098	ENSP00000353874:G945S|.	ENSP00000353874:G945S|.	G|W	-|-	1|2	0|0	TLR9|RP11-330H6.5	52230539|52230539	0.994000|0.994000	0.37717|0.37717	0.241000|0.241000	0.24154|0.24154	0.835000|0.835000	0.47333|0.47333	3.218000|3.218000	0.51192|0.51192	0.783000|0.783000	0.33636|0.33636	0.591000|0.591000	0.81541|0.81541	GGT|TGG	.	.		0.662	TLR9-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000350203.1		
FGFRL1	53834	hgsc.bcm.edu	37	4	1015991	1015991	+	Splice_Site	SNP	G	G	T			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr4:1015991G>T	ENST00000398484.2	+	4	660	c.80G>T	c.(79-81)gGc>gTc	p.G27V	FGFRL1_ENST00000510644.1_Splice_Site_p.G27V|FGFRL1_ENST00000264748.6_Splice_Site_p.G27V|FGFRL1_ENST00000504138.1_Splice_Site_p.G27V			Q8N441	FGRL1_HUMAN	fibroblast growth factor receptor-like 1	27					diaphragm development (GO:0060539)|heart valve morphogenesis (GO:0003179)|negative regulation of cell proliferation (GO:0008285)|skeletal system development (GO:0001501)|ventricular septum morphogenesis (GO:0060412)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	fibroblast growth factor-activated receptor activity (GO:0005007)|heparin binding (GO:0008201)			endometrium(1)|lung(9)|ovary(1)|prostate(1)|skin(1)	13			OV - Ovarian serous cystadenocarcinoma(23;0.0158)			CCACCCGCAGGCCCCCCAAAG	0.741																																					p.G27V		Atlas-SNP	.											.	FGFRL1	77	.	0			c.G80T						.						5.0	6.0	5.0					4																	1015991		1971	3964	5935	SO:0001630	splice_region_variant	53834	exon3			CCGCAGGCCCCCC		CCDS3344.1	4p16	2013-01-11			ENSG00000127418	ENSG00000127418		"""Immunoglobulin superfamily / I-set domain containing"""	3693	protein-coding gene	gene with protein product		605830					Standard	NM_021923		Approved		uc003gcg.3	Q8N441	OTTHUMG00000118998	ENST00000398484.2:c.80-1G>T	chr4.hg19:g.1015991G>T		39.0	0.0		78.0	20.0	NM_001004356	B2RAU9|Q6PJN1|Q9BXN7|Q9H4D7	Missense_Mutation	SNP	ENST00000398484.2	hg19	CCDS3344.1	.	.	.	.	.	.	.	.	.	.	g	12.76	2.033972	0.35893	.	.	ENSG00000127418	ENST00000398484;ENST00000510644;ENST00000504138;ENST00000512174;ENST00000507339;ENST00000264748	T;T;T;T;T;T	0.72615	-0.67;-0.67;-0.67;-0.4;0.03;-0.67	4.62	3.71	0.42584	Immunoglobulin-like fold (1);	0.000000	0.85682	U	0.000000	T	0.62097	0.2400	L	0.49778	1.585	0.80722	D	1	B	0.27732	0.187	B	0.26969	0.075	T	0.59830	-0.7380	9	.	.	.	.	12.1552	0.54072	0.0:0.0:0.828:0.1719	.	27	Q8N441	FGRL1_HUMAN	V	27	ENSP00000381498:G27V;ENSP00000425025:G27V;ENSP00000423091:G27V;ENSP00000426740:G27V;ENSP00000424037:G27V;ENSP00000264748:G27V	.	G	+	2	0	FGFRL1	1005991	1.000000	0.71417	0.999000	0.59377	0.145000	0.21501	6.390000	0.73204	2.109000	0.64355	0.457000	0.33378	GGC	.	.		0.741	FGFRL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239195.2	NM_021923	Missense_Mutation
LPHN3	23284	hgsc.bcm.edu	37	4	62849309	62849309	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr4:62849309G>T	ENST00000514591.1	+	18	3349	c.3020G>T	c.(3019-3021)gGa>gTa	p.G1007V	LPHN3_ENST00000509896.1_Missense_Mutation_p.G1075V|LPHN3_ENST00000545650.1_Missense_Mutation_p.G1007V|LPHN3_ENST00000514157.1_Missense_Mutation_p.G1007V|LPHN3_ENST00000508946.1_Missense_Mutation_p.G1007V|LPHN3_ENST00000508693.1_Missense_Mutation_p.G1075V|LPHN3_ENST00000507625.1_Missense_Mutation_p.G1075V|LPHN3_ENST00000506720.1_Missense_Mutation_p.G1075V|LPHN3_ENST00000507164.1_Missense_Mutation_p.G1075V|LPHN3_ENST00000511324.1_Missense_Mutation_p.G1075V|LPHN3_ENST00000506746.1_Missense_Mutation_p.G1075V|LPHN3_ENST00000506700.1_Missense_Mutation_p.G1007V|LPHN3_ENST00000504896.1_Missense_Mutation_p.G1007V|LPHN3_ENST00000514996.1_Missense_Mutation_p.G1007V|LPHN3_ENST00000512091.2_Missense_Mutation_p.G1007V			Q9HAR2	LPHN3_HUMAN	latrophilin 3	994					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|G-protein coupled receptor activity (GO:0004930)			breast(5)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(5)|kidney(4)|large_intestine(21)|lung(73)|ovary(1)|pancreas(1)|prostate(6)|upper_aerodigestive_tract(1)	125						AGGAGTTATGGAACAGATAAA	0.383																																					p.G1007V		Atlas-SNP	.											.	LPHN3	800	.	0			c.G3020T						.						179.0	172.0	174.0					4																	62849309		1865	4120	5985	SO:0001583	missense	23284	exon16			GTTATGGAACAGA	AB018311	CCDS54768.1	4q13.1	2014-08-08				ENSG00000150471		"""-"", ""GPCR / Class B : Orphans"""	20974	protein-coding gene	gene with protein product						10994649	Standard	NM_015236		Approved	KIAA0768, LEC3	uc010ihh.3	Q9HAR2		ENST00000514591.1:c.3020G>T	chr4.hg19:g.62849309G>T	ENSP00000422533:p.Gly1007Val	260.0	0.0		192.0	100.0	NM_015236	E9PE04|O94867|Q9NWK5	Missense_Mutation	SNP	ENST00000514591.1	hg19	CCDS54768.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	25.5|25.5	4.645391|4.645391	0.87859|0.87859	.|.	.|.	ENSG00000150471|ENSG00000150471	ENST00000512091;ENST00000514591;ENST00000509896;ENST00000511324;ENST00000506700;ENST00000545650;ENST00000295349;ENST00000280009;ENST00000507164;ENST00000508693;ENST00000507625;ENST00000514157;ENST00000504896;ENST00000508946;ENST00000506720;ENST00000506746;ENST00000514996|ENST00000502815	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T|.	0.47869|.	0.83;0.83;0.83;0.83;0.83;0.83;0.83;0.83;0.83;0.83;0.83;0.83;0.83;0.83;0.83|.	5.82|5.82	5.82|5.82	0.92795|0.92795	GPCR, family 2-like (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.84270|0.84270	0.5435|0.5435	M|M	0.86502|0.86502	2.82|2.82	0.80722|0.80722	D|D	1|1	D;D;D|.	0.89917|.	1.0;1.0;1.0|.	D;D;D|.	0.97110|.	1.0;1.0;1.0|.	D|D	0.85057|0.85057	0.0932|0.0932	10|5	0.87932|.	D|.	0|.	.|.	20.099|20.099	0.97865|0.97865	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	1007;994;1007|.	E9PE04;Q9HAR2;Q9HAR2-2|.	.;LPHN3_HUMAN;.|.	V|C	1007;1007;1075;1075;1007;1007;994;1007;1075;1075;1075;1007;1007;1007;1075;1075;1007|464	ENSP00000423388:G1007V;ENSP00000422533:G1007V;ENSP00000423787:G1075V;ENSP00000425033:G1075V;ENSP00000424120:G1007V;ENSP00000439831:G1007V;ENSP00000421476:G1075V;ENSP00000424030:G1075V;ENSP00000421372:G1075V;ENSP00000425201:G1007V;ENSP00000423434:G1007V;ENSP00000421627:G1007V;ENSP00000420931:G1075V;ENSP00000425884:G1075V;ENSP00000424258:G1007V|.	ENSP00000280009:G1007V|.	G|W	+|+	2|3	0|0	LPHN3|LPHN3	62531904|62531904	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.988000|0.988000	0.76386|0.76386	9.869000|9.869000	0.99810|0.99810	2.752000|2.752000	0.94435|0.94435	0.655000|0.655000	0.94253|0.94253	GGA|TGG	.	.		0.383	LPHN3-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000361765.1		
UGT2A1	10941	hgsc.bcm.edu	37	4	70455333	70455333	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr4:70455333G>T	ENST00000503640.1	-	6	1396	c.1341C>A	c.(1339-1341)caC>caA	p.H447Q	UGT2A2_ENST00000457664.2_Missense_Mutation_p.H456Q|UGT2A1_ENST00000512704.1_Missense_Mutation_p.H403Q|UGT2A1_ENST00000502343.1_5'UTR|UGT2A1_ENST00000514019.1_Missense_Mutation_p.H613Q|UGT2A1_ENST00000286604.4_Missense_Mutation_p.H447Q	NM_006798.3	NP_006789.2	Q9Y4X1	UD2A1_HUMAN	UDP glucuronosyltransferase 2 family, polypeptide A1, complex locus	447					cellular glucuronidation (GO:0052695)|detection of chemical stimulus (GO:0009593)|metabolic process (GO:0008152)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)	glucuronosyltransferase activity (GO:0015020)			NS(1)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(8)|lung(11)|ovary(2)|prostate(1)|skin(2)	30						GTTGATCATGGTGAATTCTTG	0.398																																					p.H613Q		Atlas-SNP	.											.	UGT2A1	131	.	0			c.C1839A						.						99.0	104.0	103.0					4																	70455333		2203	4300	6503	SO:0001583	missense	10941	exon7			ATCATGGTGAATT	AJ006054	CCDS3529.1, CCDS58901.1, CCDS58902.1	4q13	2013-03-28	2010-12-02					"""UDP glucuronosyltransferases"""	12542	protein-coding gene	gene with protein product		604716	"""UDP glycosyltransferase 2 family, polypeptide A1"", ""UDP glucuronosyltransferase 2 family, polypeptide A1"""			10359671	Standard	NM_001252274		Approved		uc011caq.2	Q9Y4X1	OTTHUMG00000184942	ENST00000503640.1:c.1341C>A	chr4.hg19:g.70455333G>T	ENSP00000424478:p.His447Gln	328.0	1.0		289.0	139.0	NM_001252274	B4E2F4|D3GER1|D3GER2|E9PDM7|J3KNA3	Missense_Mutation	SNP	ENST00000503640.1	hg19	CCDS3529.1	.	.	.	.	.	.	.	.	.	.	G	16.04	3.009498	0.54361	.	.	ENSG00000173610	ENST00000457664;ENST00000503640;ENST00000512704;ENST00000514019;ENST00000286604	T;T;T;T;T	0.71461	-0.57;-0.57;-0.57;-0.57;-0.57	4.65	-2.05	0.07321	.	0.050572	0.85682	N	0.000000	T	0.75953	0.3920	M	0.69358	2.11	.	.	.	P;D;D;D;B	0.89917	0.476;0.988;1.0;0.999;0.134	B;P;D;D;B	0.87578	0.159;0.863;0.998;0.994;0.112	T	0.74645	-0.3596	9	0.49607	T	0.09	.	5.8441	0.18652	0.5368:0.0:0.3295:0.1337	.	613;613;403;456;447	E9PDM7;B4E2F4;D6RFW5;Q9Y4X1-2;Q9Y4X1	.;.;.;.;UD2A1_HUMAN	Q	456;447;403;613;447	ENSP00000387888:H456Q;ENSP00000424478:H447Q;ENSP00000421432:H403Q;ENSP00000425497:H613Q;ENSP00000286604:H447Q	ENSP00000286604:H447Q	H	-	3	2	UGT2A1	70489922	0.999000	0.42202	0.946000	0.38457	0.956000	0.61745	0.520000	0.22878	-0.616000	0.05671	0.579000	0.79373	CAC	.	.		0.398	UGT2A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251554.3	NM_006798	
PLK4	10733	hgsc.bcm.edu	37	4	128806961	128806961	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr4:128806961C>T	ENST00000270861.5	+	5	710	c.436C>T	c.(436-438)Cgt>Tgt	p.R146C	PLK4_ENST00000515069.1_Missense_Mutation_p.R146C|PLK4_ENST00000507249.1_Missense_Mutation_p.R146C|PLK4_ENST00000513090.1_Missense_Mutation_p.R114C|PLK4_ENST00000514379.1_Missense_Mutation_p.R105C	NM_014264.4	NP_055079.3	O00444	PLK4_HUMAN	polo-like kinase 4	146	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.		R -> H (in dbSNP:rs35232579). {ECO:0000269|PubMed:17344846}.		centriole replication (GO:0007099)|de novo centriole assembly (GO:0098535)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|positive regulation of centriole replication (GO:0046601)|protein phosphorylation (GO:0006468)|trophoblast giant cell differentiation (GO:0060707)	centriole (GO:0005814)|centrosome (GO:0005813)|cytosol (GO:0005829)|deuterosome (GO:0098536)|nucleolus (GO:0005730)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(10)|lung(12)|prostate(1)|upper_aerodigestive_tract(1)	31						CCTACTGACTCGTAATATGAA	0.418																																					p.R146C	Colon(135;508 1718 19061 31832 42879)	Atlas-SNP	.											PLK4,NS,carcinoma,0,1	PLK4	65	.	0			c.C436T						.						186.0	172.0	177.0					4																	128806961		2203	4300	6503	SO:0001583	missense	10733	exon5			CTGACTCGTAATA	Y13115	CCDS3735.1, CCDS54803.1, CCDS54804.1	4q27-q28	2013-01-18	2010-06-24	2004-01-28	ENSG00000142731	ENSG00000142731			11397	protein-coding gene	gene with protein product		605031	"""serine/threonine kinase 18"", ""polo-like kinase 4 (Drosophila)"""	STK18			Standard	NM_014264		Approved	Sak	uc003ifo.3	O00444	OTTHUMG00000133301	ENST00000270861.5:c.436C>T	chr4.hg19:g.128806961C>T	ENSP00000270861:p.Arg146Cys	223.0	0.0		327.0	114.0	NM_014264	B2RAL0|B7Z837|B7Z8G7|Q8IYF0|Q96Q95|Q9UD84|Q9UDE2	Missense_Mutation	SNP	ENST00000270861.5	hg19	CCDS3735.1	.	.	.	.	.	.	.	.	.	.	C	17.25	3.342200	0.61073	.	.	ENSG00000142731	ENST00000270861;ENST00000515069;ENST00000513090;ENST00000507249;ENST00000514379	T;T;T;T;T	0.66815	-0.23;-0.23;-0.23;-0.23;-0.23	6.03	3.23	0.37069	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.197045	0.51477	D	0.000093	T	0.67850	0.2937	L	0.51853	1.615	0.23440	N	0.997677	D;D	0.76494	0.999;0.999	P;P	0.58970	0.827;0.849	T	0.59241	-0.7491	10	0.72032	D	0.01	-7.3389	3.6812	0.08310	0.2627:0.437:0.2236:0.0768	.	114;146	O00444-2;O00444	.;PLK4_HUMAN	C	146;146;114;146;105	ENSP00000270861:R146C;ENSP00000421774:R146C;ENSP00000427554:R114C;ENSP00000423412:R146C;ENSP00000423582:R105C	ENSP00000270861:R146C	R	+	1	0	PLK4	129026411	1.000000	0.71417	0.023000	0.16930	0.988000	0.76386	4.517000	0.60503	0.865000	0.35603	0.655000	0.94253	CGT	.	.		0.418	PLK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257095.3		
PDE4D	5144	hgsc.bcm.edu	37	5	58882174	58882174	+	Intron	SNP	T	T	C			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr5:58882174T>C	ENST00000340635.6	-	1	631				PDE4D_ENST00000360047.5_Missense_Mutation_p.R10G|PDE4D_ENST00000546160.1_Intron|PDE4D_ENST00000502575.1_Intron|PDE4D_ENST00000507116.1_Intron|PDE4D_ENST00000502484.2_Intron	NM_001104631.1	NP_001098101.1	Q08499	PDE4D_HUMAN	phosphodiesterase 4D, cAMP-specific						adrenergic receptor signaling pathway (GO:0071875)|adrenergic receptor signaling pathway involved in positive regulation of heart rate (GO:0086024)|aging (GO:0007568)|cAMP catabolic process (GO:0006198)|cAMP-mediated signaling (GO:0019933)|cellular response to cAMP (GO:0071320)|cellular response to epinephrine stimulus (GO:0071872)|cellular response to lipopolysaccharide (GO:0071222)|establishment of endothelial barrier (GO:0061028)|multicellular organism growth (GO:0035264)|negative regulation of heart contraction (GO:0045822)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|negative regulation of relaxation of cardiac muscle (GO:1901898)|neutrophil chemotaxis (GO:0030593)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-2 production (GO:0032743)|positive regulation of interleukin-5 production (GO:0032754)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of cell communication by electrical coupling involved in cardiac conduction (GO:1901844)|regulation of heart rate (GO:0002027)|regulation of receptor activity (GO:0010469)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|smooth muscle contraction (GO:0006939)|T cell receptor signaling pathway (GO:0050852)	calcium channel complex (GO:0034704)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|membrane (GO:0016020)|plasma membrane (GO:0005886)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|ATPase binding (GO:0051117)|beta-2 adrenergic receptor binding (GO:0031698)|cAMP binding (GO:0030552)|drug binding (GO:0008144)|enzyme binding (GO:0019899)|ion channel binding (GO:0044325)|metal ion binding (GO:0046872)|scaffold protein binding (GO:0097110)|ubiquitin protein ligase binding (GO:0031625)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(8)|pancreas(1)	15		all_cancers(5;6.5e-58)|all_epithelial(5;1.75e-57)|all_lung(5;6.84e-18)|Lung NSC(5;1.29e-17)|Melanoma(5;0.00168)|Prostate(74;0.00234)|Colorectal(97;0.00629)|Ovarian(174;0.00832)|Breast(144;0.00996)|all_hematologic(6;0.0344)|Hepatocellular(6;0.0742)|Esophageal squamous(6;0.0954)		Epithelial(2;2.6e-55)|all cancers(2;2.66e-49)|OV - Ovarian serous cystadenocarcinoma(10;1.48e-39)|Colorectal(2;8.29e-08)|Lung(2;4.47e-07)|STAD - Stomach adenocarcinoma(2;1.11e-05)|COAD - Colon adenocarcinoma(2;0.00012)|LUSC - Lung squamous cell carcinoma(2;0.000775)|LUAD - Lung adenocarcinoma(3;0.0173)|READ - Rectum adenocarcinoma(2;0.0276)	Adenosine monophosphate(DB00131)|Caffeine(DB00201)|Dyphylline(DB00651)|Ibudilast(DB05266)|Iloprost(DB01088)|Ketotifen(DB00920)|Roflumilast(DB01656)	GAATGCCTTCTAAAGGGAAAA	0.353																																					p.R10G		Atlas-SNP	.											.	PDE4D	345	.	0			c.A28G						.						258.0	253.0	254.0					5																	58882174		1864	4103	5967	SO:0001627	intron_variant	5144	exon1			GCCTTCTAAAGGG		CCDS47213.1, CCDS54858.1, CCDS54859.1, CCDS56369.1, CCDS56370.1, CCDS56371.1, CCDS56372.1, CCDS56373.1	5q12	2010-06-24	2010-06-24				3.1.4.17	"""Phosphodiesterases"""	8783	protein-coding gene	gene with protein product	"""phosphodiesterase E3 dunce homolog (Drosophila)"""	600129	"""phosphodiesterase 4D, cAMP-specific (dunce (Drosophila)-homolog phosphodiesterase E3)"""	DPDE3			Standard	NM_006203		Approved		uc003jsa.2	Q08499		ENST00000340635.6:c.455+306820A>G	chr5.hg19:g.58882174T>C		221.0	0.0		166.0	78.0	NM_006203	O43433|Q13549|Q13550|Q13551|Q7Z2L8|Q8IV84|Q8IVA9|Q8IVD2|Q8IVD3|Q96HL4|Q9HCX7	Missense_Mutation	SNP	ENST00000340635.6	hg19	CCDS47213.1	.	.	.	.	.	.	.	.	.	.	T	9.961	1.222890	0.22457	.	.	ENSG00000113448	ENST00000360047	T	0.67865	-0.29	5.64	5.64	0.86602	.	.	.	.	.	T	0.73745	0.3626	.	.	.	0.80722	D	1	P	0.43662	0.814	P	0.51701	0.677	T	0.76119	-0.3076	8	0.62326	D	0.03	.	11.9443	0.52920	0.0:0.0:0.1448:0.8552	.	9	Q08499-2	.	G	10	ENSP00000353152:R10G	ENSP00000353152:R10G	R	-	1	2	PDE4D	58917931	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.288000	0.43514	2.367000	0.80283	0.528000	0.53228	AGA	.	.		0.353	PDE4D-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000367940.3		
GPR98	84059	hgsc.bcm.edu	37	5	89953983	89953983	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr5:89953983C>T	ENST00000405460.2	+	21	4736	c.4640C>T	c.(4639-4641)tCt>tTt	p.S1547F		NM_032119.3	NP_115495.3	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98	1547					detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|G-protein coupled receptor signaling pathway (GO:0007186)|inner ear receptor stereocilium organization (GO:0060122)|maintenance of organ identity (GO:0048496)|nervous system development (GO:0007399)|neurological system process (GO:0050877)|neuropeptide signaling pathway (GO:0007218)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|visual perception (GO:0007601)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|stereocilia ankle link complex (GO:0002142)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(4)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(3)|kidney(18)|large_intestine(46)|liver(2)|lung(80)|ovary(12)|pancreas(5)|prostate(1)|skin(50)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(6)	269		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		AAACTAGTTTCTGTATATGGA	0.363																																					p.S1547F		Atlas-SNP	.											.	GPR98	605	.	0			c.C4640T						.						99.0	100.0	99.0					5																	89953983		1825	4082	5907	SO:0001583	missense	84059	exon21			TAGTTTCTGTATA	AB014586	CCDS47246.1	5q13	2014-08-08	2006-05-26	2006-05-26	ENSG00000164199	ENSG00000164199		"""-"", ""GPCR / Class B : Orphans"""	17416	protein-coding gene	gene with protein product		602851	"""monogenic, audiogenic seizure susceptibility 1 homolog (mouse)"""	USH2C, MASS1		10976914, 14740321	Standard	NM_032119		Approved	DKFZp761P0710, KIAA0686, FEB4, VLGR1b	uc003kju.3	Q8WXG9	OTTHUMG00000162668	ENST00000405460.2:c.4640C>T	chr5.hg19:g.89953983C>T	ENSP00000384582:p.Ser1547Phe	214.0	0.0		223.0	30.0	NM_032119	O75171|Q8TF58|Q9H0X5|Q9UL61	Missense_Mutation	SNP	ENST00000405460.2	hg19	CCDS47246.1	.	.	.	.	.	.	.	.	.	.	C	14.81	2.646393	0.47258	.	.	ENSG00000164199	ENST00000405460;ENST00000296619;ENST00000399043	T	0.30714	1.52	5.86	5.86	0.93980	.	0.099573	0.64402	D	0.000001	T	0.43765	0.1262	L	0.27053	0.805	0.80722	D	1	D	0.71674	0.998	D	0.68943	0.961	T	0.35226	-0.9797	10	0.87932	D	0	.	17.1393	0.86748	0.0:0.874:0.126:0.0	.	1547	Q8WXG9	GPR98_HUMAN	F	1547	ENSP00000384582:S1547F	ENSP00000296619:S1547F	S	+	2	0	GPR98	89989739	1.000000	0.71417	1.000000	0.80357	0.049000	0.14656	4.622000	0.61240	2.771000	0.95319	0.650000	0.86243	TCT	.	.		0.363	GPR98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369993.2	NM_032119	
RHOBTB3	22836	hgsc.bcm.edu	37	5	95091309	95091309	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr5:95091309A>G	ENST00000379982.3	+	6	1400	c.892A>G	c.(892-894)Atc>Gtc	p.I298V	GLRX_ENST00000508780.1_Intron	NM_014899.3	NP_055714.3	O94955	RHBT3_HUMAN	Rho-related BTB domain containing 3	298	BTB 1. {ECO:0000255|PROSITE- ProRule:PRU00037}.				ATP catabolic process (GO:0006200)|retrograde transport, endosome to Golgi (GO:0042147)|small GTPase mediated signal transduction (GO:0007264)	Golgi apparatus (GO:0005794)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|GTP binding (GO:0005525)|Rab GTPase binding (GO:0017137)			breast(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(5)|skin(1)	16		all_cancers(142;2.58e-06)|all_epithelial(76;4.19e-09)|all_lung(232;0.00307)|Lung NSC(167;0.00452)|Ovarian(225;0.0164)|Colorectal(57;0.0846)|Breast(839;0.198)		all cancers(79;8.79e-16)		GGATTCCAGTATCATCCGAAC	0.448																																					p.I298V		Atlas-SNP	.											.	RHOBTB3	43	.	0			c.A892G						.						104.0	94.0	98.0					5																	95091309		2203	4300	6503	SO:0001583	missense	22836	exon6			TCCAGTATCATCC	AB020685	CCDS4077.1	5q15	2014-05-09			ENSG00000164292	ENSG00000164292		"""BTB/POZ domain containing"""	18757	protein-coding gene	gene with protein product		607353				11222756, 17035353	Standard	NM_014899		Approved	KIAA0878	uc003klm.3	O94955	OTTHUMG00000121171	ENST00000379982.3:c.892A>G	chr5.hg19:g.95091309A>G	ENSP00000369318:p.Ile298Val	271.0	0.0		167.0	28.0	NM_014899	A0PJA4|A8K1W9|Q8IW06	Missense_Mutation	SNP	ENST00000379982.3	hg19	CCDS4077.1	.	.	.	.	.	.	.	.	.	.	A	6.328	0.428644	0.11987	.	.	ENSG00000164292	ENST00000379982	T	0.62498	0.02	6.08	4.95	0.65309	BTB/POZ-like (2);BTB/POZ (1);	0.249082	0.42172	D	0.000751	T	0.35219	0.0924	N	0.08118	0	0.80722	D	1	B	0.02656	0.0	B	0.04013	0.001	T	0.25710	-1.0124	10	0.10111	T	0.7	-27.8358	7.9112	0.29791	0.8235:0.0:0.1765:0.0	.	298	O94955	RHBT3_HUMAN	V	298	ENSP00000369318:I298V	ENSP00000369318:I298V	I	+	1	0	RHOBTB3	95117065	0.085000	0.21516	0.977000	0.42913	0.886000	0.51366	0.966000	0.29331	2.333000	0.79357	0.482000	0.46254	ATC	.	.		0.448	RHOBTB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241658.1	NM_014899	
PCBD2	84105	hgsc.bcm.edu	37	5	134246024	134246024	+	Splice_Site	SNP	G	G	C			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr5:134246024G>C	ENST00000512783.1	+	2	104		c.e2-1		PCBD2_ENST00000510013.1_Splice_Site|PCBD2_ENST00000254908.6_Splice_Site			Q9H0N5	PHS2_HUMAN	pterin-4 alpha-carbinolamine dehydratase/dimerization cofactor of hepatocyte nuclear factor 1 alpha (TCF1) 2						positive regulation of transcription, DNA-templated (GO:0045893)|protein heterooligomerization (GO:0051291)|protein homotetramerization (GO:0051289)|tetrahydrobiopterin biosynthetic process (GO:0006729)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	4-alpha-hydroxytetrahydrobiopterin dehydratase activity (GO:0008124)|phenylalanine 4-monooxygenase activity (GO:0004505)			kidney(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			TCTCTTCATAGTCATCAGGTA	0.408																																					.		Atlas-SNP	.											.	PCBD2	3	.	0			c.85-1G>C						.						109.0	102.0	104.0					5																	134246024		1929	4148	6077	SO:0001630	splice_region_variant	84105	exon2			TTCATAGTCATCA	AF499009	CCDS43364.1	5q31.1	2008-02-05	2006-01-10			ENSG00000132570			24474	protein-coding gene	gene with protein product		609836	"""6-pyruvoyl-tetrahydropterin synthase/dimerization cofactor of hepatocyte nuclear factor 1 alpha (TCF1) 2"""			15182178, 11980910	Standard	NM_032151		Approved	DCOHM, DCOH2	uc010jdz.3	Q9H0N5		ENST00000512783.1:c.85-1G>C	chr5.hg19:g.134246024G>C		103.0	0.0		125.0	23.0	NM_032151	Q8TD40	Splice_Site	SNP	ENST00000512783.1	hg19	CCDS43364.1	.	.	.	.	.	.	.	.	.	.	G	9.558	1.117736	0.20877	.	.	ENSG00000132570	ENST00000254908;ENST00000512783	.	.	.	5.44	5.44	0.79542	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.8022	0.88591	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	PCBD2	134273923	1.000000	0.71417	0.175000	0.22980	0.033000	0.12548	6.318000	0.72866	2.710000	0.92621	0.563000	0.77884	.	.	.		0.408	PCBD2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371578.1	NM_032151	Intron
FOXI1	2299	hgsc.bcm.edu	37	5	169535204	169535204	+	Missense_Mutation	SNP	C	C	A	rs35678180	byFrequency	TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr5:169535204C>A	ENST00000306268.6	+	2	787	c.726C>A	c.(724-726)agC>agA	p.S242R	FOXI1_ENST00000449804.2_Intron			Q12951	FOXI1_HUMAN	forkhead box I1	242					embryo development (GO:0009790)|inner ear morphogenesis (GO:0042472)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding, bending (GO:0008301)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(3)|central_nervous_system(3)|endometrium(1)|kidney(1)|large_intestine(7)|lung(16)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	35	Renal(175;0.000159)|Lung NSC(126;0.0267)|all_lung(126;0.04)	Medulloblastoma(196;0.0109)|all_neural(177;0.0298)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			CGGTGGACAGCCCCAAGACCA	0.592									Pendred syndrome																												p.S242R		Atlas-SNP	.											.	FOXI1	70	.	0			c.C726A						.						56.0	62.0	60.0					5																	169535204		2203	4300	6503	SO:0001583	missense	2299	exon2	Familial Cancer Database	Goiter-Deafness syndrome	GGACAGCCCCAAG	BC029778	CCDS4372.1, CCDS47337.1	5q34	2008-02-05			ENSG00000168269	ENSG00000168269		"""Forkhead boxes"""	3815	protein-coding gene	gene with protein product		601093		FKHL10		7957066, 8825632	Standard	NM_144769		Approved	FREAC6	uc003mai.4	Q12951	OTTHUMG00000130436	ENST00000306268.6:c.726C>A	chr5.hg19:g.169535204C>A	ENSP00000304286:p.Ser242Arg	57.0	0.0		113.0	25.0	NM_012188	Q14518|Q66SR7|Q8N6L8	Missense_Mutation	SNP	ENST00000306268.6	hg19	CCDS4372.1	.	.	.	.	.	.	.	.	.	.	C	12.47	1.949135	0.34377	.	.	ENSG00000168269	ENST00000306268	D	0.94280	-3.39	4.91	3.01	0.34805	.	0.246213	0.41605	D	0.000858	D	0.94997	0.8381	M	0.81682	2.555	0.80722	D	1	D	0.59357	0.985	P	0.58077	0.832	D	0.93602	0.6931	10	0.41790	T	0.15	.	10.1849	0.42991	0.0:0.826:0.0:0.174	.	242	Q12951	FOXI1_HUMAN	R	242	ENSP00000304286:S242R	ENSP00000304286:S242R	S	+	3	2	FOXI1	169467782	1.000000	0.71417	0.997000	0.53966	0.015000	0.08874	1.094000	0.30951	0.987000	0.38709	0.455000	0.32223	AGC	.	C|0.995;T|0.005		0.592	FOXI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252827.2	NM_144769, NM_012188	
DBN1	1627	hgsc.bcm.edu	37	5	176895871	176895871	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr5:176895871T>A	ENST00000309007.5	-	2	335	c.116A>T	c.(115-117)gAt>gTt	p.D39V	DBN1_ENST00000292385.5_Missense_Mutation_p.D41V|DBN1_ENST00000393565.1_Missense_Mutation_p.D39V	NM_004395.3	NP_004386	Q16643	DREB_HUMAN	drebrin 1	39	ADF-H. {ECO:0000255|PROSITE- ProRule:PRU00599}.				actin filament organization (GO:0007015)|cell communication by chemical coupling (GO:0010643)|cell communication by electrical coupling (GO:0010644)|maintenance of protein location in cell (GO:0032507)|neural precursor cell proliferation (GO:0061351)|regulation of dendrite development (GO:0050773)|regulation of neuronal synaptic plasticity (GO:0048168)	actin cytoskeleton (GO:0015629)|actomyosin (GO:0042641)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|gap junction (GO:0005921)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|profilin binding (GO:0005522)			breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(1)|lung(12)|ovary(1)|skin(2)	25	all_cancers(89;2.17e-05)|Renal(175;0.000269)|Lung NSC(126;0.0014)|all_lung(126;0.0025)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			CTTGAGGTCATCGGAGCCATC	0.607																																					p.D41V		Atlas-SNP	.											.	DBN1	122	.	0			c.A122T						.						183.0	159.0	167.0					5																	176895871		2203	4300	6503	SO:0001583	missense	1627	exon3			AGGTCATCGGAGC		CCDS4420.1, CCDS4421.1	5q35.3	2008-02-05			ENSG00000113758	ENSG00000113758			2695	protein-coding gene	gene with protein product		126660		D0S117E		8216329	Standard	NM_004395		Approved		uc003mgy.2	Q16643	OTTHUMG00000130856	ENST00000309007.5:c.116A>T	chr5.hg19:g.176895871T>A	ENSP00000308532:p.Asp39Val	101.0	0.0		176.0	23.0	NM_080881	A8MV58|B2RBG0|Q9UFZ5	Missense_Mutation	SNP	ENST00000309007.5	hg19	CCDS4420.1	.	.	.	.	.	.	.	.	.	.	T	21.1	4.098996	0.76870	.	.	ENSG00000113758	ENST00000309007;ENST00000292385;ENST00000393565;ENST00000477391;ENST00000514833	T;T;T;T;T	0.38077	1.16;1.16;1.16;1.16;1.16	3.76	3.76	0.43208	Actin-binding, cofilin/tropomyosin type (3);	0.137801	0.47093	D	0.000241	T	0.56790	0.2009	M	0.69823	2.125	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.79784	0.993;0.987	T	0.62220	-0.6900	10	0.87932	D	0	-21.9146	12.4455	0.55649	0.0:0.0:0.0:1.0	.	39;41	Q16643;Q16643-2	DREB_HUMAN;.	V	39;41;39;39;39	ENSP00000308532:D39V;ENSP00000292385:D41V;ENSP00000377195:D39V;ENSP00000422854:D39V;ENSP00000421465:D39V	ENSP00000292385:D41V	D	-	2	0	DBN1	176828477	1.000000	0.71417	0.994000	0.49952	0.827000	0.46813	5.052000	0.64263	1.941000	0.56285	0.450000	0.29827	GAT	.	.		0.607	DBN1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000253429.2	NM_080881	
JARID2	3720	hgsc.bcm.edu	37	6	15507624	15507624	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr6:15507624T>A	ENST00000341776.2	+	11	2952	c.2708T>A	c.(2707-2709)cTg>cAg	p.L903Q	JARID2_ENST00000541660.1_Missense_Mutation_p.L865Q|JARID2_ENST00000474854.1_3'UTR|JARID2_ENST00000397311.3_Missense_Mutation_p.L731Q	NM_004973.3	NP_004964.2	Q92833	JARD2_HUMAN	jumonji, AT rich interactive domain 2	903	JmjC. {ECO:0000255|PROSITE- ProRule:PRU00538}.				central nervous system development (GO:0007417)|chromatin modification (GO:0016568)|liver development (GO:0001889)|negative regulation of cell proliferation (GO:0008285)|negative regulation of histone methylation (GO:0031061)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of histone H3-K9 methylation (GO:0051574)|spleen development (GO:0048536)|stem cell differentiation (GO:0048863)|thymus development (GO:0048538)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(10)|kidney(2)|large_intestine(15)|lung(19)|ovary(3)|pancreas(1)|prostate(5)|stomach(1)	59	Breast(50;0.0142)|Ovarian(93;0.103)	all_hematologic(90;0.00612)				GGGTCCATCCTGCGTCACCTC	0.587																																					p.L903Q		Atlas-SNP	.											.	JARID2	135	.	0			c.T2708A						.						154.0	127.0	136.0					6																	15507624		2203	4300	6503	SO:0001583	missense	3720	exon11			CCATCCTGCGTCA	U57592	CCDS4533.1, CCDS58996.1	6p24-p23	2008-02-05	2006-10-06	2004-01-30	ENSG00000008083	ENSG00000008083			6196	protein-coding gene	gene with protein product		601594	"""jumonji (mouse) homolog"", ""Jumonji, AT rich interactive domain 2"""	JMJ		8894700	Standard	NM_001267040		Approved		uc003nbj.4	Q92833	OTTHUMG00000014293	ENST00000341776.2:c.2708T>A	chr6.hg19:g.15507624T>A	ENSP00000341280:p.Leu903Gln	71.0	0.0		155.0	49.0	NM_004973	A8K9Z6|B7Z5S5|B7Z8L0|Q5U5L5|Q86X63	Missense_Mutation	SNP	ENST00000341776.2	hg19	CCDS4533.1	.	.	.	.	.	.	.	.	.	.	T	28.7	4.945874	0.92593	.	.	ENSG00000008083	ENST00000341776;ENST00000397311;ENST00000541660	T;T;T	0.57752	0.38;0.38;0.38	5.36	5.36	0.76844	Transcription factor jumonji/aspartyl beta-hydroxylase (2);	0.000000	0.85682	D	0.000000	T	0.69433	0.3110	M	0.83012	2.62	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	T	0.76024	-0.3110	10	0.87932	D	0	-10.9955	15.3324	0.74223	0.0:0.0:0.0:1.0	.	865;903	F5H590;Q92833	.;JARD2_HUMAN	Q	903;731;865	ENSP00000341280:L903Q;ENSP00000380478:L731Q;ENSP00000444623:L865Q	ENSP00000341280:L903Q	L	+	2	0	JARID2	15615603	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.930000	0.87610	2.028000	0.59812	0.477000	0.44152	CTG	.	.		0.587	JARID2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000039926.1	NM_004973	
OR11A1	26531	hgsc.bcm.edu	37	6	29395051	29395051	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr6:29395051C>T	ENST00000377149.1	-	5	840	c.368G>A	c.(367-369)cGc>cAc	p.R123H	OR5V1_ENST00000377154.1_Intron|OR11A1_ENST00000377148.1_Missense_Mutation_p.R123H|OR11A1_ENST00000377147.2_Missense_Mutation_p.R123H			Q9GZK7	O11A1_HUMAN	olfactory receptor, family 11, subfamily A, member 1	123						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			cervix(1)|large_intestine(1)|lung(12)|ovary(1)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)	19						TGCCAGGTAGCGGTCATATGC	0.537																																					p.R123H		Atlas-SNP	.											.	OR11A1	30	.	0			c.G368A						.						64.0	70.0	68.0					6																	29395051		1510	2709	4219	SO:0001583	missense	26531	exon1			AGGTAGCGGTCAT		CCDS34363.1	6p22.2-p21.31	2014-02-19	2002-02-28		ENSG00000204694	ENSG00000204694		"""GPCR / Class A : Olfactory receptors"""	8176	protein-coding gene	gene with protein product			"""olfactory receptor, family 11, subfamily A, member 2"""	OR11A2			Standard	XM_005249001		Approved	hs6M1-18	uc003nmg.3	Q9GZK7	OTTHUMG00000031225	ENST00000377149.1:c.368G>A	chr6.hg19:g.29395051C>T	ENSP00000366354:p.Arg123His	77.0	0.0		94.0	34.0	NM_013937	A2BF33|A6NFQ3|B0S7T2|Q5ST16|Q9GZK8	Missense_Mutation	SNP	ENST00000377149.1	hg19	CCDS34363.1	.	.	.	.	.	.	.	.	.	.	C	14.78	2.638066	0.47153	.	.	ENSG00000204694	ENST00000377148;ENST00000377149;ENST00000377147	T;T;T	0.77489	-1.1;-1.1;-1.1	3.78	2.9	0.33743	GPCR, rhodopsin-like superfamily (1);	0.000000	0.38436	N	0.001686	D	0.84969	0.5590	M	0.88906	2.99	0.35989	D	0.836566	D	0.89917	1.0	D	0.87578	0.998	D	0.86849	0.2022	10	0.87932	D	0	-20.52	10.1326	0.42687	0.0:0.8986:0.0:0.1014	.	123	Q9GZK7	O11A1_HUMAN	H	123	ENSP00000366353:R123H;ENSP00000366354:R123H;ENSP00000366352:R123H	ENSP00000366352:R123H	R	-	2	0	OR11A1	29503030	0.966000	0.33281	0.949000	0.38748	0.086000	0.17979	5.138000	0.64795	0.785000	0.33685	0.405000	0.27470	CGC	.	.		0.537	OR11A1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000193778.1		
PKHD1	5314	hgsc.bcm.edu	37	6	51732778	51732778	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr6:51732778A>G	ENST00000371117.3	-	48	7891	c.7616T>C	c.(7615-7617)aTt>aCt	p.I2539T	PKHD1_ENST00000340994.4_Missense_Mutation_p.I2539T	NM_138694.3	NP_619639.3	P08F94	PKHD1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)	2539					cellular calcium ion homeostasis (GO:0006874)|cilium assembly (GO:0042384)|homeostatic process (GO:0042592)|kidney development (GO:0001822)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cellular component movement (GO:0051271)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein kinase B signaling (GO:0051898)|positive regulation of cell proliferation (GO:0008284)|regulation of centrosome duplication (GO:0010824)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of TOR signaling (GO:0032006)|single organismal cell-cell adhesion (GO:0016337)	anchored component of external side of plasma membrane (GO:0031362)|apical plasma membrane (GO:0016324)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitotic spindle (GO:0072686)|perinuclear region of cytoplasm (GO:0048471)|primary cilium (GO:0072372)	receptor activity (GO:0004872)			NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(5)|cervix(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(59)|lung(139)|ovary(16)|prostate(8)|skin(20)|soft_tissue(1)|stomach(2)|upper_aerodigestive_tract(7)|urinary_tract(5)	304	Lung NSC(77;0.0605)					AGAAGCAAGAATGTGACTTCT	0.428																																					p.I2539T		Atlas-SNP	.											.	PKHD1	927	.	0			c.T7616C						.						91.0	84.0	86.0					6																	51732778		2203	4299	6502	SO:0001583	missense	5314	exon48			GCAAGAATGTGAC	AF480064	CCDS4935.1, CCDS4936.1	6p21.2-p12	2012-11-26	2003-04-16		ENSG00000170927	ENSG00000170927			9016	protein-coding gene	gene with protein product	"""tigmin"", ""polyductin"", ""fibrocystin"""	606702	"""TIG multiple domains 1"""	TIGM1		9503014	Standard	NM_138694		Approved	ARPKD, FCYT	uc003pah.1	P08F94	OTTHUMG00000014841	ENST00000371117.3:c.7616T>C	chr6.hg19:g.51732778A>G	ENSP00000360158:p.Ile2539Thr	155.0	0.0		126.0	39.0	NM_170724	Q5VUA2|Q5VUA3|Q5VWV1|Q86Z26|Q8TCZ9	Missense_Mutation	SNP	ENST00000371117.3	hg19	CCDS4935.1	.	.	.	.	.	.	.	.	.	.	A	16.52	3.145150	0.57044	.	.	ENSG00000170927	ENST00000371117;ENST00000340994;ENST00000393616	D;D	0.87334	-2.04;-2.24	5.67	5.67	0.87782	.	0.329660	0.29253	N	0.012689	D	0.83059	0.5172	L	0.54323	1.7	0.23620	N	0.997277	P;P;P	0.47545	0.799;0.897;0.651	B;P;B	0.47470	0.276;0.548;0.115	T	0.79914	-0.1602	10	0.72032	D	0.01	.	15.0934	0.72215	1.0:0.0:0.0:0.0	.	2539;2539;2539	A8MVM9;P08F94-2;P08F94	.;.;PKHD1_HUMAN	T	2539	ENSP00000360158:I2539T;ENSP00000341097:I2539T	ENSP00000341097:I2539T	I	-	2	0	PKHD1	51840737	0.980000	0.34600	0.928000	0.36995	0.811000	0.45836	6.060000	0.71141	2.165000	0.68154	0.482000	0.46254	ATT	.	.		0.428	PKHD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040893.1	NM_138694	
GFRAL	389400	hgsc.bcm.edu	37	6	55263983	55263983	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr6:55263983C>A	ENST00000340465.2	+	7	1044	c.958C>A	c.(958-960)Cca>Aca	p.P320T		NM_207410.2	NP_997293.2	Q6UXV0	GFRAL_HUMAN	GDNF family receptor alpha like	320					negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of neuron apoptotic process (GO:0043524)|stress-activated protein kinase signaling cascade (GO:0031098)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|breast(1)|endometrium(2)|kidney(5)|large_intestine(2)|liver(1)|lung(31)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)	48	Lung NSC(77;0.0875)|Renal(3;0.122)		LUSC - Lung squamous cell carcinoma(124;0.23)			TTCAGATTATCCAACCCTGTC	0.294																																					p.P320T		Atlas-SNP	.											.	GFRAL	91	.	0			c.C958A						.						36.0	35.0	36.0					6																	55263983		2203	4289	6492	SO:0001583	missense	389400	exon7			GATTATCCAACCC	AY358198	CCDS4957.1	6p12.1	2007-06-22			ENSG00000187871	ENSG00000187871			32789	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 144"""	C6orf144		16086688	Standard	NM_207410		Approved	GRAL, UNQ9356, bA360D14.1	uc003pcm.1	Q6UXV0	OTTHUMG00000014900	ENST00000340465.2:c.958C>A	chr6.hg19:g.55263983C>A	ENSP00000343636:p.Pro320Thr	648.0	1.0		489.0	149.0	NM_207410	Q5VTF6	Missense_Mutation	SNP	ENST00000340465.2	hg19	CCDS4957.1	.	.	.	.	.	.	.	.	.	.	C	3.374	-0.127832	0.06753	.	.	ENSG00000187871	ENST00000340465	T	0.30981	1.51	5.79	1.61	0.23674	.	1.656770	0.03636	N	0.238747	T	0.07279	0.0184	L	0.27053	0.805	0.09310	N	1	B	0.27625	0.183	B	0.22386	0.039	T	0.23154	-1.0196	10	0.25751	T	0.34	-0.8127	5.5127	0.16890	0.1501:0.5985:0.0:0.2513	.	320	Q6UXV0	GFRAL_HUMAN	T	320	ENSP00000343636:P320T	ENSP00000343636:P320T	P	+	1	0	GFRAL	55371942	0.112000	0.22096	0.208000	0.23602	0.032000	0.12392	0.767000	0.26575	0.378000	0.24764	-0.150000	0.13652	CCA	.	.		0.294	GFRAL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040995.2	NM_207410	
REV3L	5980	hgsc.bcm.edu	37	6	111678241	111678241	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr6:111678241T>A	ENST00000358835.3	-	19	7614	c.7160A>T	c.(7159-7161)cAt>cTt	p.H2387L	REV3L_ENST00000435970.1_Missense_Mutation_p.H2309L|REV3L_ENST00000368802.3_Missense_Mutation_p.H2387L|REV3L_ENST00000368805.1_Missense_Mutation_p.H2387L			O60673	DPOLZ_HUMAN	REV3-like, polymerase (DNA directed), zeta, catalytic subunit	2387					DNA-dependent DNA replication (GO:0006261)|translesion synthesis (GO:0019985)	chromosome (GO:0005694)|nucleus (GO:0005634)|zeta DNA polymerase complex (GO:0016035)	4 iron, 4 sulfur cluster binding (GO:0051539)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)			NS(2)|breast(1)|endometrium(6)|kidney(7)|large_intestine(30)|lung(25)|ovary(3)|prostate(5)|skin(8)|upper_aerodigestive_tract(1)	88		all_cancers(87;7.57e-06)|Acute lymphoblastic leukemia(125;2.46e-08)|all_hematologic(75;1.08e-06)|all_epithelial(87;0.00138)|Colorectal(196;0.021)		OV - Ovarian serous cystadenocarcinoma(136;0.0314)|Epithelial(106;0.057)|all cancers(137;0.0663)		TGCAATTTCATGAAAAAGTGC	0.323								DNA polymerases (catalytic subunits)																													p.H2387L		Atlas-SNP	.											.	REV3L	386	.	0			c.A7160T						.						90.0	99.0	96.0					6																	111678241		2203	4300	6503	SO:0001583	missense	5980	exon18			ATTTCATGAAAAA	AF058701	CCDS5091.2, CCDS69177.1	6q22	2012-05-18	2012-05-18		ENSG00000009413	ENSG00000009413		"""DNA polymerases"""	9968	protein-coding gene	gene with protein product	"""polymerase, DNA, zeta"""	602776	"""REV3 (yeast homolog)-like, catalytic subunit of DNA polymerase zeta"", ""REV3-like, catalytic subunit of DNA polymerase zeta (yeast)"""			9618506, 9925914	Standard	NM_001286431		Approved	POLZ, REV3	uc003puy.4	O60673	OTTHUMG00000016318	ENST00000358835.3:c.7160A>T	chr6.hg19:g.111678241T>A	ENSP00000351697:p.His2387Leu	260.0	0.0		182.0	52.0	NM_002912	O43214|Q5TC33	Missense_Mutation	SNP	ENST00000358835.3	hg19	CCDS5091.2	.	.	.	.	.	.	.	.	.	.	T	16.23	3.065852	0.55539	.	.	ENSG00000009413	ENST00000368802;ENST00000368805;ENST00000358835;ENST00000435970;ENST00000543871	T;T;T;T	0.08720	3.06;3.06;3.06;3.06	5.93	5.93	0.95920	DNA-directed DNA polymerase, family B, exonuclease domain (1);Ribonuclease H-like (1);	0.188610	0.47455	D	0.000229	T	0.01800	0.0057	N	0.02247	-0.625	0.39361	D	0.965926	B	0.06786	0.001	B	0.01281	0.0	T	0.49312	-0.8953	10	0.44086	T	0.13	-0.8613	16.3766	0.83401	0.0:0.0:0.0:1.0	.	2387	O60673	DPOLZ_HUMAN	L	2387;2387;2387;2309;460	ENSP00000357792:H2387L;ENSP00000357795:H2387L;ENSP00000351697:H2387L;ENSP00000402003:H2309L	ENSP00000351697:H2387L	H	-	2	0	REV3L	111784934	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.213000	0.77950	2.263000	0.75096	0.533000	0.62120	CAT	.	.		0.323	REV3L-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043695.1	NM_002912	
UTRN	7402	hgsc.bcm.edu	37	6	144758707	144758707	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr6:144758707A>G	ENST00000367545.3	+	10	1066	c.1066A>G	c.(1066-1068)Atg>Gtg	p.M356V		NM_007124.2	NP_009055.2	P46939	UTRO_HUMAN	utrophin	356	Interaction with SYNM.				aging (GO:0007568)|muscle cell differentiation (GO:0042692)|muscle contraction (GO:0006936)|muscle organ development (GO:0007517)|neuron projection morphogenesis (GO:0048812)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of sodium ion transmembrane transporter activity (GO:2000649)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dystrophin-associated glycoprotein complex (GO:0016010)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane (GO:0016020)|membrane raft (GO:0045121)|myofibril (GO:0030016)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|protein kinase binding (GO:0019901)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(1)|cervix(2)|endometrium(21)|kidney(10)|large_intestine(29)|lung(56)|ovary(5)|pancreas(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	148		Ovarian(120;0.218)		OV - Ovarian serous cystadenocarcinoma(155;5.72e-07)|GBM - Glioblastoma multiforme(68;4.9e-05)|Colorectal(48;0.213)		CTAGGCTTTTATGATGGAACT	0.423																																					p.M356V		Atlas-SNP	.											.	UTRN	327	.	0			c.A1066G						.						60.0	59.0	60.0					6																	144758707		2203	4300	6503	SO:0001583	missense	7402	exon10			GCTTTTATGATGG	AK023675	CCDS34547.1	6q24	2008-02-05	2006-12-13		ENSG00000152818	ENSG00000152818			12635	protein-coding gene	gene with protein product		128240	"""utrophin (homologous to dystrophin)"""	DMDL		1426262	Standard	NM_007124		Approved	DRP, DRP1	uc003qkt.3	P46939	OTTHUMG00000015746	ENST00000367545.3:c.1066A>G	chr6.hg19:g.144758707A>G	ENSP00000356515:p.Met356Val	64.0	0.0		56.0	22.0	NM_007124	Q5SYY1|Q5SZ57|Q9UJ40	Missense_Mutation	SNP	ENST00000367545.3	hg19	CCDS34547.1	.	.	.	.	.	.	.	.	.	.	A	21.7	4.188889	0.78789	.	.	ENSG00000152818	ENST00000367529;ENST00000367545	T	0.48522	0.81	5.45	5.45	0.79879	.	0.000000	0.64402	D	0.000010	T	0.64438	0.2598	M	0.80508	2.5	0.80722	D	1	D	0.65815	0.995	D	0.77004	0.989	T	0.70846	-0.4761	10	0.72032	D	0.01	.	15.5234	0.75881	1.0:0.0:0.0:0.0	.	356	P46939	UTRO_HUMAN	V	356	ENSP00000356515:M356V	ENSP00000356499:M356V	M	+	1	0	UTRN	144800400	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	9.339000	0.96797	2.072000	0.62099	0.533000	0.62120	ATG	.	.		0.423	UTRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042551.1		
KCND2	3751	hgsc.bcm.edu	37	7	119914945	119914945	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr7:119914945C>A	ENST00000331113.4	+	1	1224	c.259C>A	c.(259-261)Cgt>Agt	p.R87S		NM_012281.2	NP_036413.1	Q9NZV8	KCND2_HUMAN	potassium voltage-gated channel, Shal-related subfamily, member 2	87	Interaction with KCNIP1. {ECO:0000250}.				action potential (GO:0001508)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	dendritic spine (GO:0043197)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	A-type (transient outward) potassium channel activity (GO:0005250)|metal ion binding (GO:0046872)|voltage-gated potassium channel activity (GO:0005249)			NS(2)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(11)|lung(35)|ovary(3)|pancreas(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	75	all_neural(327;0.117)				Amitriptyline(DB00321)|Dalfampridine(DB06637)|Disopyramide(DB00280)|Imipramine(DB00458)	TTTCTTTGACCGTGACCCAGA	0.527																																					p.R87S		Atlas-SNP	.											.	KCND2	194	.	0			c.C259A						.						134.0	137.0	136.0					7																	119914945		2203	4300	6503	SO:0001583	missense	3751	exon1			TTTGACCGTGACC	AJ010969	CCDS5776.1	7q31	2012-07-05			ENSG00000184408	ENSG00000184408		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6238	protein-coding gene	gene with protein product		605410				10551270, 16382104	Standard	NM_012281		Approved	Kv4.2, RK5, KIAA1044	uc003vjj.1	Q9NZV8	OTTHUMG00000156989	ENST00000331113.4:c.259C>A	chr7.hg19:g.119914945C>A	ENSP00000333496:p.Arg87Ser	82.0	0.0		144.0	65.0	NM_012281	O95012|O95021|Q2TBD3|Q9UBY7|Q9UN98|Q9UNH9	Missense_Mutation	SNP	ENST00000331113.4	hg19	CCDS5776.1	.	.	.	.	.	.	.	.	.	.	C	20.8	4.049908	0.75846	.	.	ENSG00000184408	ENST00000331113	D	0.90133	-2.62	5.51	5.51	0.81932	BTB/POZ-like (1);BTB/POZ fold (2);Potassium channel, voltage dependent, Kv, tetramerisation (1);	0.000000	0.85682	D	0.000000	D	0.97235	0.9096	H	0.98646	4.29	0.58432	D	0.999999	D	0.89917	1.0	D	0.97110	1.0	D	0.98281	1.0508	9	.	.	.	.	14.2875	0.66256	0.1486:0.8514:0.0:0.0	.	87	Q9NZV8	KCND2_HUMAN	S	87	ENSP00000333496:R87S	.	R	+	1	0	KCND2	119702181	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	5.930000	0.70104	2.603000	0.88011	0.655000	0.94253	CGT	.	.		0.527	KCND2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346996.1	NM_012281	
ASB15	142685	hgsc.bcm.edu	37	7	123270025	123270025	+	Silent	SNP	T	T	C			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr7:123270025T>C	ENST00000451558.1	+	13	1967	c.1446T>C	c.(1444-1446)tgT>tgC	p.C482C	ASB15_ENST00000275699.3_Silent_p.C482C|ASB15_ENST00000434204.1_Silent_p.C482C|ASB15_ENST00000540573.1_Silent_p.C482C|ASB15_ENST00000451215.1_Silent_p.C482C			Q8WXK1	ASB15_HUMAN	ankyrin repeat and SOCS box containing 15	482					intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)					breast(1)|kidney(1)|large_intestine(1)|lung(6)|skin(3)	12						CTCAGTTCTGTGAGTTTATTA	0.308																																					p.C482C		Atlas-SNP	.											.	ASB15	94	.	0			c.T1446C						.						115.0	116.0	116.0					7																	123270025		2203	4300	6503	SO:0001819	synonymous_variant	142685	exon9			GTTCTGTGAGTTT	AF403033	CCDS34742.1	7q31.31	2013-01-10	2011-01-25		ENSG00000146809	ENSG00000146809		"""Ankyrin repeat domain containing"""	19767	protein-coding gene	gene with protein product			"""ankyrin repeat and SOCS box-containing 15"""			12076535	Standard	XM_005250149		Approved	FLJ43370	uc003vkw.1	Q8WXK1	OTTHUMG00000157114	ENST00000451558.1:c.1446T>C	chr7.hg19:g.123270025T>C		143.0	0.0		133.0	52.0	NM_080928	Q3ZCP3|Q3ZCP5|Q68D37	Silent	SNP	ENST00000451558.1	hg19	CCDS34742.1																																																																																			.	.		0.308	ASB15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347493.1		
TTPA	7274	hgsc.bcm.edu	37	8	63973866	63973866	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr8:63973866T>C	ENST00000260116.4	-	5	813	c.782A>G	c.(781-783)aAt>aGt	p.N261S	TTPA_ENST00000521138.1_Intron	NM_000370.3	NP_000361.1	P49638	TTPA_HUMAN	tocopherol (alpha) transfer protein	261					embryonic placenta development (GO:0001892)|intermembrane transport (GO:0046909)|intracellular pH reduction (GO:0051452)|lipid metabolic process (GO:0006629)|negative regulation of cell death (GO:0060548)|negative regulation of establishment of blood-brain barrier (GO:0090212)|response to nutrient (GO:0007584)|response to pH (GO:0009268)|response to toxic substance (GO:0009636)|transport (GO:0006810)|vitamin E metabolic process (GO:0042360)|vitamin transport (GO:0051180)	cytosol (GO:0005829)|late endosome (GO:0005770)	phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|transporter activity (GO:0005215)|vitamin E binding (GO:0008431)			breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(8)	15	Breast(64;0.0716)	all_cancers(86;0.145)|Lung NSC(129;0.0324)|all_lung(136;0.0593)|all_epithelial(80;0.123)			Vitamin E(DB00163)	CATTATAAAATTTGTCCATTC	0.373																																					p.N261S		Atlas-SNP	.											.	TTPA	29	.	0			c.A782G						.						79.0	79.0	79.0					8																	63973866		2203	4300	6503	SO:0001583	missense	7274	exon5			ATAAAATTTGTCC	BC058000	CCDS6178.1	8q12.3	2007-07-18	2007-07-16			ENSG00000137561			12404	protein-coding gene	gene with protein product		600415	"""ataxia (Friedreich-like) with vitamin E deficiency"""	AVED		7719340, 7887897	Standard	NM_000370		Approved		uc003xux.2	P49638		ENST00000260116.4:c.782A>G	chr8.hg19:g.63973866T>C	ENSP00000260116:p.Asn261Ser	186.0	0.0		357.0	69.0	NM_000370	Q71V64	Missense_Mutation	SNP	ENST00000260116.4	hg19	CCDS6178.1	.	.	.	.	.	.	.	.	.	.	T	9.479	1.097706	0.20552	.	.	ENSG00000137561	ENST00000260116	D	0.84070	-1.8	5.86	5.86	0.93980	Cellular retinaldehyde-binding/triple function, C-terminal (2);	0.361985	0.34223	N	0.004144	T	0.70945	0.3282	N	0.25647	0.755	0.30101	N	0.807391	B	0.10296	0.003	B	0.04013	0.001	T	0.59789	-0.7388	10	0.10111	T	0.7	.	12.4132	0.55480	0.0:0.0:0.1399:0.8601	.	261	P49638	TTPA_HUMAN	S	261	ENSP00000260116:N261S	ENSP00000260116:N261S	N	-	2	0	TTPA	64136420	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.218000	0.58554	2.367000	0.80283	0.528000	0.53228	AAT	.	.		0.373	TTPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378460.1	NM_000370	
PKHD1L1	93035	hgsc.bcm.edu	37	8	110460575	110460575	+	Missense_Mutation	SNP	G	G	C			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr8:110460575G>C	ENST00000378402.5	+	39	6084	c.5980G>C	c.(5980-5982)Gta>Cta	p.V1994L		NM_177531.4	NP_803875.2	Q86WI1	PKHL1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)-like 1	1994	IPT/TIG 12.				immune response (GO:0006955)	cytosol (GO:0005829)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			NS(4)|breast(13)|central_nervous_system(6)|cervix(1)|endometrium(19)|kidney(17)|large_intestine(34)|lung(122)|ovary(11)|pancreas(3)|prostate(9)|skin(3)|stomach(4)|upper_aerodigestive_tract(13)|urinary_tract(4)	263			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			GTCCACAGTTGTATTTGAGTA	0.398										HNSCC(38;0.096)																											p.V1994L		Atlas-SNP	.											.	PKHD1L1	522	.	0			c.G5980C						.						77.0	76.0	76.0					8																	110460575		1930	4153	6083	SO:0001583	missense	93035	exon39			ACAGTTGTATTTG	AY219181	CCDS47911.1	8q23	2003-03-28			ENSG00000205038	ENSG00000205038			20313	protein-coding gene	gene with protein product		607843				12620974	Standard	NM_177531		Approved		uc003yne.3	Q86WI1	OTTHUMG00000164934	ENST00000378402.5:c.5980G>C	chr8.hg19:g.110460575G>C	ENSP00000367655:p.Val1994Leu	103.0	0.0		232.0	13.0	NM_177531	Q567P2|Q9UF27	Missense_Mutation	SNP	ENST00000378402.5	hg19	CCDS47911.1	.	.	.	.	.	.	.	.	.	.	G	7.036	0.561583	0.13498	.	.	ENSG00000205038	ENST00000378402	T	0.75938	-0.98	5.63	2.85	0.33270	Cell surface receptor IPT/TIG (2);Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.694656	0.13897	N	0.355149	T	0.66015	0.2747	M	0.68317	2.08	0.09310	N	1	B	0.18863	0.031	B	0.22880	0.042	T	0.50725	-0.8794	10	0.13108	T	0.6	.	4.6974	0.12811	0.2566:0.1591:0.5843:0.0	.	1994	Q86WI1	PKHL1_HUMAN	L	1994	ENSP00000367655:V1994L	ENSP00000367655:V1994L	V	+	1	0	PKHD1L1	110529751	0.000000	0.05858	0.012000	0.15200	0.290000	0.27261	0.347000	0.20014	0.734000	0.32515	0.585000	0.79938	GTA	.	.		0.398	PKHD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381017.1	NM_177531	
CSMD3	114788	hgsc.bcm.edu	37	8	113662479	113662479	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr8:113662479C>A	ENST00000297405.5	-	19	3348	c.3104G>T	c.(3103-3105)aGt>aTt	p.S1035I	CSMD3_ENST00000455883.2_Missense_Mutation_p.S931I|CSMD3_ENST00000352409.3_Missense_Mutation_p.S1035I|CSMD3_ENST00000343508.3_Missense_Mutation_p.S995I	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	1035	Sushi 5. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						TGAATCACAACTAAATGAAAC	0.448										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																											p.S1035I		Atlas-SNP	.											.	CSMD3	2325	.	0			c.G3104T						.						145.0	142.0	143.0					8																	113662479		2203	4300	6503	SO:0001583	missense	114788	exon19			TCACAACTAAATG	AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.3104G>T	chr8.hg19:g.113662479C>A	ENSP00000297405:p.Ser1035Ile	287.0	0.0		567.0	50.0	NM_198123	Q96PZ3	Missense_Mutation	SNP	ENST00000297405.5	hg19	CCDS6315.1	.	.	.	.	.	.	.	.	.	.	C	24.9	4.585164	0.86748	.	.	ENSG00000164796	ENST00000343508;ENST00000297405;ENST00000339701;ENST00000455883;ENST00000352409	T;T;T;T;T	0.66638	-0.22;-0.22;-0.22;-0.22;-0.22	5.88	5.88	0.94601	Complement control module (2);Sushi/SCR/CCP (3);	0.293249	0.33938	N	0.004411	T	0.80768	0.4686	M	0.73753	2.245	0.43798	D	0.99634	B;B;P	0.49090	0.257;0.146;0.919	B;B;P	0.57846	0.271;0.148;0.828	T	0.80665	-0.1281	10	0.59425	D	0.04	.	20.2228	0.98330	0.0:1.0:0.0:0.0	.	931;1035;995	Q7Z407-3;Q7Z407;Q7Z407-2	.;CSMD3_HUMAN;.	I	995;1035;375;931;1035	ENSP00000345799:S995I;ENSP00000297405:S1035I;ENSP00000341558:S375I;ENSP00000412263:S931I;ENSP00000343124:S1035I	ENSP00000297405:S1035I	S	-	2	0	CSMD3	113731655	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.854000	0.62918	2.789000	0.95967	0.655000	0.94253	AGT	.	.		0.448	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347141.1	NM_052900	
ASAP1	50807	hgsc.bcm.edu	37	8	131164981	131164981	+	Splice_Site	SNP	C	C	T			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr8:131164981C>T	ENST00000518721.1	-	13	1308		c.e13+1		ASAP1_ENST00000357668.1_Splice_Site	NM_001247996.1|NM_018482.3	NP_001234925.1|NP_060952.2	Q9ULH1	ASAP1_HUMAN	ArfGAP with SH3 domain, ankyrin repeat and PH domain 1						cilium morphogenesis (GO:0060271)|regulation of ARF GTPase activity (GO:0032312)	cytoplasm (GO:0005737)|membrane (GO:0016020)	ARF GTPase activator activity (GO:0008060)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|zinc ion binding (GO:0008270)			breast(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(13)|lung(22)|ovary(6)|pancreas(1)|prostate(1)|skin(3)|stomach(1)	68						AACATACTTACTGTGGCATGT	0.413																																					.		Atlas-SNP	.											.	ASAP1	133	.	0			c.1059+1G>A						.						226.0	198.0	207.0					8																	131164981		2203	4300	6503	SO:0001630	splice_region_variant	50807	exon15			TACTTACTGTGGC	AB033075	CCDS6362.1, CCDS75788.1	8q24.1-q24.2	2013-01-11	2008-09-22	2008-09-22	ENSG00000153317	ENSG00000153317		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	2720	protein-coding gene	gene with protein product	"""centaurin, beta 4"""	605953	"""development and differentiation enhancing factor 1"""	DDEF1		9819391	Standard	NM_018482		Approved	PAP, KIAA1249, ZG14P, CENTB4	uc003yta.2	Q9ULH1	OTTHUMG00000164772	ENST00000518721.1:c.1080+1G>A	chr8.hg19:g.131164981C>T		175.0	0.0		364.0	61.0	NM_001247996	B2RNV3	Splice_Site	SNP	ENST00000518721.1	hg19	CCDS6362.1	.	.	.	.	.	.	.	.	.	.	C	15.53	2.861874	0.51482	.	.	ENSG00000153317	ENST00000343135;ENST00000357668;ENST00000524124;ENST00000518721	.	.	.	5.18	5.18	0.71444	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.5795	0.84711	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	ASAP1	131234163	1.000000	0.71417	0.991000	0.47740	0.361000	0.29550	7.047000	0.76599	2.572000	0.86782	0.655000	0.94253	.	.	.		0.413	ASAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380170.1	NM_018482	Intron
OLFM1	10439	hgsc.bcm.edu	37	9	138011770	138011770	+	Missense_Mutation	SNP	G	G	A	rs1130517		TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr9:138011770G>A	ENST00000371793.3	+	6	1455	c.1204G>A	c.(1204-1206)Gcc>Acc	p.A402T	OLFM1_ENST00000252854.4_Missense_Mutation_p.A384T|OLFM1_ENST00000371796.3_Missense_Mutation_p.A375T	NM_001282611.1	NP_001269540.1	Q99784	NOE1_HUMAN	olfactomedin 1	402	Olfactomedin-like. {ECO:0000255|PROSITE- ProRule:PRU00446}.				negative regulation of beta-amyloid formation (GO:1902430)|negative regulation of neuron migration (GO:2001223)|nervous system development (GO:0007399)|protein oligomerization (GO:0051259)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|extracellular space (GO:0005615)|synapse (GO:0045202)	beta-amyloid binding (GO:0001540)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(6)|ovary(1)|prostate(1)|skin(2)	21		Myeloproliferative disorder(178;0.0333)		Epithelial(140;5.49e-08)|OV - Ovarian serous cystadenocarcinoma(145;9.68e-08)|all cancers(34;1.88e-07)		CAAGCGCAGCGCCGGGGAGGC	0.617																																					p.A384T		Atlas-SNP	.											.	OLFM1	57	.	0			c.G1150A						.						73.0	63.0	66.0					9																	138011770		2203	4300	6503	SO:0001583	missense	10439	exon6			CGCAGCGCCGGGG	AF035301	CCDS6986.1, CCDS6987.1, CCDS65183.1, CCDS65184.1	9q34.3	2014-01-20			ENSG00000130558	ENSG00000130558			17187	protein-coding gene	gene with protein product	"""pancortin"""	605366				9039501	Standard	NM_006334		Approved	NOE1, OlfA, AMY, NOELIN	uc004cfl.4	Q99784	OTTHUMG00000020897	ENST00000371793.3:c.1204G>A	chr9.hg19:g.138011770G>A	ENSP00000360858:p.Ala402Thr	35.0	0.0		55.0	32.0	NM_014279	Q53XZ8|Q6IMJ4|Q6IMJ5|Q8N8R0|Q969S7|Q99452	Missense_Mutation	SNP	ENST00000371793.3	hg19		.	.	.	.	.	.	.	.	.	.	G	31	5.084437	0.94100	.	.	ENSG00000130558	ENST00000252854;ENST00000371796;ENST00000371793	D;D;D	0.90385	-2.66;-2.66;-2.66	4.7	4.7	0.59300	Olfactomedin-like (3);Quinonprotein alcohol dehydrogenase-like (1);	0.000000	0.85682	D	0.000000	D	0.96043	0.8711	M	0.88640	2.97	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.997;1.0	D	0.96926	0.9677	10	0.72032	D	0.01	.	17.6361	0.88122	0.0:0.0:1.0:0.0	.	402;384	Q99784;Q6IMJ8	NOE1_HUMAN;.	T	384;375;402	ENSP00000252854:A384T;ENSP00000360861:A375T;ENSP00000360858:A402T	ENSP00000252854:A384T	A	+	1	0	OLFM1	137151591	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	9.571000	0.98176	2.166000	0.68216	0.491000	0.48974	GCC	.	.		0.617	OLFM1-004	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000054974.1	NM_014279	
GPRIN2	9721	hgsc.bcm.edu	37	10	47000008	47000008	+	Silent	SNP	G	G	T	rs111800394		TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr10:47000008G>T	ENST00000374317.1	+	3	1401	c.1128G>T	c.(1126-1128)ccG>ccT	p.P376P	GPRIN2_ENST00000374314.4_Silent_p.P376P	NM_014696.3	NP_055511.2	O60269	GRIN2_HUMAN	G protein regulated inducer of neurite outgrowth 2	376										breast(2)|central_nervous_system(1)|endometrium(6)|kidney(1)|large_intestine(1)|lung(6)|prostate(1)	18						AGGAGGTGCCGTCCCCTGTGC	0.657																																					p.P376P		Atlas-SNP	.											.	GPRIN2	94	.	0			c.G1128T						.						164.0	140.0	148.0					10																	47000008		2203	4300	6503	SO:0001819	synonymous_variant	9721	exon3			GGTGCCGTCCCCT	BC011672	CCDS73101.1	10q11.22	2006-08-24	2006-08-24	2006-08-24	ENSG00000204175	ENSG00000204175			23730	protein-coding gene	gene with protein product		611240	"""KIAA0514"""	KIAA0514		9628581	Standard	NM_014696		Approved	MGC15171	uc001jec.3	O60269	OTTHUMG00000018107	ENST00000374317.1:c.1128G>T	chr10.hg19:g.47000008G>T		78.0	0.0		221.0	23.0	NM_014696	Q5SVF0	Silent	SNP	ENST00000374317.1	hg19	CCDS31192.1																																																																																			.	G|0.500;A|0.500		0.657	GPRIN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047836.1	NM_014696	
CHST15	51363	hgsc.bcm.edu	37	10	125769678	125769678	+	Nonsense_Mutation	SNP	C	C	T			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr10:125769678C>T	ENST00000346248.5	-	8	2315	c.1673G>A	c.(1672-1674)tGg>tAg	p.W558*	CHST15_ENST00000435907.1_Nonsense_Mutation_p.W558*	NM_015892.4	NP_056976.2	Q7LFX5	CHSTF_HUMAN	carbohydrate (N-acetylgalactosamine 4-sulfate 6-O) sulfotransferase 15	558					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|hexose biosynthetic process (GO:0019319)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	3'-phosphoadenosine 5'-phosphosulfate binding (GO:0050656)|N-acetylgalactosamine 4-sulfate 6-O-sulfotransferase activity (GO:0050659)			endometrium(4)|kidney(1)|large_intestine(11)|lung(6)|ovary(3)|stomach(1)	26						CGTCGTCTTCCACGCAAACGC	0.562																																					p.W558X		Atlas-SNP	.											.	CHST15	134	.	0			c.G1673A						.						65.0	65.0	65.0					10																	125769678		2203	4300	6503	SO:0001587	stop_gained	51363	exon8			GTCTTCCACGCAA	AB011170	CCDS7638.1	10q26	2009-07-09			ENSG00000182022	ENSG00000182022	2.8.2.33	"""Sulfotransferases, membrane-bound"""	18137	protein-coding gene	gene with protein product	"""B cell RAG associated protein"", ""N-acetylgalactosamine 4-sulfate 6-O-sulfotransferase"""	608277				9628581, 9754571, 11572857	Standard	NM_014863		Approved	GALNAC4S-6ST, BRAG, KIAA0598	uc001lhm.4	Q7LFX5	OTTHUMG00000019208	ENST00000346248.5:c.1673G>A	chr10.hg19:g.125769678C>T	ENSP00000333947:p.Trp558*	37.0	0.0		94.0	34.0	NM_015892	O60338|O60474|Q86VM4	Nonsense_Mutation	SNP	ENST00000346248.5	hg19	CCDS7638.1	.	.	.	.	.	.	.	.	.	.	C	43	10.455762	0.99408	.	.	ENSG00000182022	ENST00000346248;ENST00000435907	.	.	.	5.42	5.42	0.78866	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-20.112	19.2238	0.93810	0.0:1.0:0.0:0.0	.	.	.	.	X	558	.	ENSP00000333947:W558X	W	-	2	0	CHST15	125759668	1.000000	0.71417	0.997000	0.53966	0.875000	0.50365	6.984000	0.76186	2.543000	0.85770	0.563000	0.77884	TGG	.	.		0.562	CHST15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050856.1	NM_015892	
OR10A3	26496	hgsc.bcm.edu	37	11	7960259	7960259	+	Missense_Mutation	SNP	G	G	C			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr11:7960259G>C	ENST00000360759.3	-	1	882	c.809C>G	c.(808-810)aCc>aGc	p.T270S		NM_001003745.1	NP_001003745.1	P58181	O10A3_HUMAN	olfactory receptor, family 10, subfamily A, member 3	270					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|large_intestine(5)|lung(12)|pancreas(1)|skin(2)	21				Epithelial(150;1.38e-07)|BRCA - Breast invasive adenocarcinoma(625;0.189)		CAGTTTCTTGGTTTCGGGTGA	0.453																																					p.T270S		Atlas-SNP	.											.	OR10A3	54	.	0			c.C809G						.						197.0	179.0	185.0					11																	7960259		2201	4296	6497	SO:0001583	missense	26496	exon1			TTCTTGGTTTCGG	BK004404	CCDS31421.1	11p15.4	2012-08-09			ENSG00000170683	ENSG00000170683		"""GPCR / Class A : Olfactory receptors"""	8162	protein-coding gene	gene with protein product						1370859	Standard	NM_001003745		Approved	HTPCRX12, HSHTPCRX12	uc010rbi.2	P58181	OTTHUMG00000165672	ENST00000360759.3:c.809C>G	chr11.hg19:g.7960259G>C	ENSP00000353988:p.Thr270Ser	335.0	0.0		210.0	72.0	NM_001003745	B9EH39|Q6IF58|Q96R11	Missense_Mutation	SNP	ENST00000360759.3	hg19	CCDS31421.1	.	.	.	.	.	.	.	.	.	.	G	0.429	-0.904393	0.02453	.	.	ENSG00000170683	ENST00000360759	T	0.00054	8.8	4.65	1.46	0.22682	GPCR, rhodopsin-like superfamily (1);	0.370076	0.19214	N	0.119853	T	0.00073	0.0002	N	0.04018	-0.295	0.09310	N	1	B	0.09022	0.002	B	0.21708	0.036	T	0.02437	-1.1159	10	0.09084	T	0.74	.	8.9595	0.35838	0.0:0.4598:0.3828:0.1574	.	270	P58181	O10A3_HUMAN	S	270	ENSP00000353988:T270S	ENSP00000353988:T270S	T	-	2	0	OR10A3	7916835	0.000000	0.05858	0.998000	0.56505	0.501000	0.33797	0.019000	0.13444	0.671000	0.31185	-0.234000	0.12200	ACC	.	.		0.453	OR10A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385704.1	NM_001003745	
NAT10	55226	hgsc.bcm.edu	37	11	34137375	34137375	+	Silent	SNP	G	G	A			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr11:34137375G>A	ENST00000257829.3	+	6	707	c.501G>A	c.(499-501)gtG>gtA	p.V167V	NAT10_ENST00000527971.1_Silent_p.V167V|NAT10_ENST00000531159.2_Silent_p.V95V	NM_024662.2	NP_078938	Q9H0A0	NAT10_HUMAN	N-acetyltransferase 10 (GCN5-related)	167						membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|N-acetyltransferase activity (GO:0008080)|poly(A) RNA binding (GO:0044822)			endometrium(4)|large_intestine(8)|lung(8)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	23		Acute lymphoblastic leukemia(5;0.0119)|all_hematologic(20;0.0231)				GTTAGGATGTGCATTCCAGGT	0.463																																					p.V167V		Atlas-SNP	.											.	NAT10	78	.	0			c.G501A						.						191.0	191.0	191.0					11																	34137375		2202	4298	6500	SO:0001819	synonymous_variant	55226	exon6			GGATGTGCATTCC	AF489535	CCDS7889.1, CCDS44568.1	11p13	2011-11-16	2008-09-24		ENSG00000135372	ENSG00000135372	2.3.1.-		29830	protein-coding gene	gene with protein product		609221	"""N-acetyltransferase 10"""			14592445, 21177859	Standard	NM_024662		Approved	hALP, FLJ10774, FLJ12179, NET43, KIAA1709	uc001mvk.3	Q9H0A0	OTTHUMG00000166249	ENST00000257829.3:c.501G>A	chr11.hg19:g.34137375G>A		311.0	0.0		215.0	63.0	NM_024662	B4DFD5|E7ESU4|E9PMN9|Q86WK5|Q9C0F4|Q9HA61|Q9NVF2	Silent	SNP	ENST00000257829.3	hg19	CCDS7889.1																																																																																			.	.		0.463	NAT10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388693.1	NM_024662	
C1QTNF4	114900	hgsc.bcm.edu	37	11	47611682	47611682	+	Silent	SNP	G	G	A			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr11:47611682G>A	ENST00000302514.3	-	2	1197	c.681C>T	c.(679-681)ggC>ggT	p.G227G		NM_031909.2	NP_114115.2	Q9BXJ3	C1QT4_HUMAN	C1q and tumor necrosis factor related protein 4	227	C1q 2. {ECO:0000255|PROSITE- ProRule:PRU00368}.					extracellular space (GO:0005615)				breast(2)|endometrium(1)|kidney(1)|lung(2)	6						AGAAGTAGGCGCCGGGCAGAC	0.647																																					p.G227G		Atlas-SNP	.											.	C1QTNF4	19	.	0			c.C681T						.						11.0	15.0	13.0					11																	47611682		2161	4273	6434	SO:0001819	synonymous_variant	114900	exon2			GTAGGCGCCGGGC	AF329838	CCDS7942.1	11q11	2008-07-18				ENSG00000172247			14346	protein-coding gene	gene with protein product	"""complement-c1q tumor necrosis factor-related protein 4"""	614911				16094384	Standard	NM_031909		Approved	CTRP4, ZACRP4	uc001ngc.2	Q9BXJ3		ENST00000302514.3:c.681C>T	chr11.hg19:g.47611682G>A		14.0	0.0		42.0	13.0	NM_031909	Q8IV25	Silent	SNP	ENST00000302514.3	hg19	CCDS7942.1																																																																																			.	.		0.647	C1QTNF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391772.1	NM_031909	
OR8K5	219453	hgsc.bcm.edu	37	11	55927260	55927260	+	Nonsense_Mutation	SNP	G	G	T			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr11:55927260G>T	ENST00000313447.1	-	1	533	c.534C>A	c.(532-534)taC>taA	p.Y178*		NM_001004058.2	NP_001004058.2	Q8NH50	OR8K5_HUMAN	olfactory receptor, family 8, subfamily K, member 5	178						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			large_intestine(3)|lung(24)|ovary(2)|pancreas(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	34	Esophageal squamous(21;0.00693)	Lung NSC(402;0.197)|all_epithelial(135;0.236)				CATCATCACAGTAAAAATGAC	0.358																																					p.Y178X		Atlas-SNP	.											.	OR8K5	82	.	0			c.C534A						.						93.0	94.0	94.0					11																	55927260		2201	4296	6497	SO:0001587	stop_gained	219453	exon1			ATCACAGTAAAAA	BK004347	CCDS31521.1	11q11	2012-08-09			ENSG00000181752	ENSG00000181752		"""GPCR / Class A : Olfactory receptors"""	15315	protein-coding gene	gene with protein product							Standard	NM_001004058		Approved		uc010rja.2	Q8NH50	OTTHUMG00000166820	ENST00000313447.1:c.534C>A	chr11.hg19:g.55927260G>T	ENSP00000323853:p.Tyr178*	141.0	0.0		107.0	28.0	NM_001004058	Q6IFB5	Nonsense_Mutation	SNP	ENST00000313447.1	hg19	CCDS31521.1	.	.	.	.	.	.	.	.	.	.	G	15.19	2.759194	0.49468	.	.	ENSG00000181752	ENST00000313447	.	.	.	4.18	1.08	0.20341	.	0.000000	0.51477	D	0.000095	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.07325	T	0.83	.	8.6385	0.33964	0.2774:0.0:0.7226:0.0	.	.	.	.	X	178	.	ENSP00000323853:Y178X	Y	-	3	2	OR8K5	55683836	0.002000	0.14202	0.990000	0.47175	0.832000	0.47134	0.090000	0.15025	0.120000	0.18254	-0.254000	0.11334	TAC	.	.		0.358	OR8K5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391543.1	NM_001004058	
SYVN1	84447	hgsc.bcm.edu	37	11	64900941	64900941	+	Splice_Site	SNP	T	T	C			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr11:64900941T>C	ENST00000377190.3	-	2	226	c.132A>G	c.(130-132)gcA>gcG	p.A44A	SYVN1_ENST00000526060.1_Splice_Site_p.A44A|SYVN1_ENST00000307289.6_Splice_Site_p.A44A|SYVN1_ENST00000526121.1_5'Flank|SYVN1_ENST00000294256.8_Splice_Site_p.A44A	NM_172230.2	NP_757385.1	Q86TM6	SYVN1_HUMAN	synovial apoptosis inhibitor 1, synoviolin	44					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|in utero embryonic development (GO:0001701)|negative regulation of endoplasmic reticulum stress-induced intrinsic apoptotic signaling pathway (GO:1902236)|protein N-linked glycosylation via asparagine (GO:0018279)|protein ubiquitination (GO:0016567)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	acid-amino acid ligase activity (GO:0016881)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(10)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	22						CTGAACTCACTGCCATGCTGG	0.627																																					p.A44A		Atlas-SNP	.											.	SYVN1	55	.	0			c.A132G						.						73.0	70.0	71.0					11																	64900941		2201	4297	6498	SO:0001630	splice_region_variant	84447	exon2			ACTCACTGCCATG	AB085847	CCDS8097.1, CCDS31605.1	11q13	2013-01-09			ENSG00000162298	ENSG00000162298		"""RING-type (C3HC4) zinc fingers"""	20738	protein-coding gene	gene with protein product	"""HMG-coA reductase degradation 1 homolog (S. cerevisiae)"""	608046				12975321	Standard	NM_032431		Approved	HRD1, DER3	uc001odb.3	Q86TM6		ENST00000377190.3:c.132+1A>G	chr11.hg19:g.64900941T>C		44.0	0.0		82.0	28.0	NM_172230	Q8N3K3|Q8N6E8|Q96JL5|Q96PK3	Silent	SNP	ENST00000377190.3	hg19	CCDS31605.1																																																																																			.	.		0.627	SYVN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000385274.1	NM_032431	Silent
CADM1	23705	hgsc.bcm.edu	37	11	115085443	115085443	+	Silent	SNP	C	C	G			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr11:115085443C>G	ENST00000452722.3	-	7	899	c.879G>C	c.(877-879)ctG>ctC	p.L293L	CADM1_ENST00000331581.6_Silent_p.L293L|CADM1_ENST00000537058.1_Silent_p.L293L|CADM1_ENST00000537140.1_5'UTR|CADM1_ENST00000536727.1_Silent_p.L293L|CADM1_ENST00000542447.2_Silent_p.L293L	NM_014333.3	NP_055148.3			cell adhesion molecule 1											cervix(1)|endometrium(4)|kidney(4)|large_intestine(11)|lung(9)|ovary(2)|skin(1)	32	all_hematologic(175;0.0628)	all_cancers(61;2.98e-14)|all_epithelial(67;2.64e-08)|all_hematologic(158;0.000154)|Melanoma(852;0.000952)|Acute lymphoblastic leukemia(157;0.00101)|Breast(348;0.0102)|Medulloblastoma(222;0.0429)|Prostate(24;0.145)|all_neural(223;0.237)		BRCA - Breast invasive adenocarcinoma(274;5.01e-06)|Epithelial(105;0.000305)|all cancers(92;0.00303)		TGGGCCCAGACAGTACGGCGT	0.473																																					p.L293L		Atlas-SNP	.											.	CADM1	74	.	0			c.G879C						.						259.0	222.0	234.0					11																	115085443		2201	4296	6497	SO:0001819	synonymous_variant	23705	exon7			CCCAGACAGTACG	AB017563	CCDS8373.1, CCDS53711.1, CCDS73397.1, CCDS73398.1, CCDS73399.1	11q23.2	2013-01-29	2007-02-07	2007-02-07	ENSG00000182985	ENSG00000182985		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5951	protein-coding gene	gene with protein product	"""nectin-like 2"""	605686	"""tumor suppressor in lung cancer 1"", ""immunoglobulin superfamily, member 4"""	TSLC1, IGSF4		10610705	Standard	NM_014333		Approved	NECL2, ST17, BL2, SYNCAM, IGSF4A, Necl-2, SYNCAM1, RA175	uc001ppi.4	Q9BY67	OTTHUMG00000168202	ENST00000452722.3:c.879G>C	chr11.hg19:g.115085443C>G		389.0	0.0		171.0	25.0	NM_014333		Silent	SNP	ENST00000452722.3	hg19	CCDS8373.1	.	.	.	.	.	.	.	.	.	.	C	7.913	0.736960	0.15574	.	.	ENSG00000182985	ENST00000545380	.	.	.	5.62	5.62	0.85841	.	.	.	.	.	T	0.71333	0.3327	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.69468	-0.5137	4	.	.	.	.	15.1897	0.73035	0.0:0.8597:0.1403:0.0	.	.	.	.	L	292	.	.	V	-	1	0	CADM1	114590653	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	1.578000	0.36525	2.660000	0.90430	0.655000	0.94253	GTC	.	.		0.473	CADM1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000398753.2	NM_014333	
IGSF9B	22997	hgsc.bcm.edu	37	11	133814256	133814256	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr11:133814256C>A	ENST00000321016.8	-	3	498	c.268G>T	c.(268-270)Gcc>Tcc	p.A90S	IGSF9B_ENST00000533871.2_Missense_Mutation_p.A90S			Q9UPX0	TUTLB_HUMAN	immunoglobulin superfamily, member 9B	90	Ig-like 1.				homophilic cell adhesion (GO:0007156)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)	dendrite (GO:0030425)|inhibitory synapse (GO:0060077)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)				breast(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(18)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	44	all_hematologic(175;0.127)	all_cancers(12;1.58e-21)|all_epithelial(12;5.17e-16)|all_lung(97;1.6e-05)|Lung NSC(97;3.86e-05)|Breast(109;0.000126)|Medulloblastoma(222;0.0245)|all_neural(223;0.0505)|Esophageal squamous(93;0.0559)		Epithelial(10;7.19e-10)|BRCA - Breast invasive adenocarcinoma(10;9.69e-09)|all cancers(11;1.23e-08)|OV - Ovarian serous cystadenocarcinoma(99;0.00328)|Lung(977;0.221)		TGAAGACTGGCCCGGCCTGGG	0.577																																					p.A90S		Atlas-SNP	.											.	IGSF9B	290	.	0			c.G268T						.						52.0	55.0	54.0					11																	133814256		1991	4159	6150	SO:0001583	missense	22997	exon3			GACTGGCCCGGCC	AK097578	CCDS61010.1	11q25	2013-02-11	2005-10-12	2005-11-20				"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	32326	protein-coding gene	gene with protein product		613773					Standard	NM_001277285		Approved	KIAA1030	uc031qfh.1	Q9UPX0		ENST00000321016.8:c.268G>T	chr11.hg19:g.133814256C>A	ENSP00000317980:p.Ala90Ser	74.0	0.0		148.0	39.0	NM_014987	G5EA26	Missense_Mutation	SNP	ENST00000321016.8	hg19		.	.	.	.	.	.	.	.	.	.	C	23.6	4.431127	0.83776	.	.	ENSG00000080854	ENST00000321016;ENST00000527648;ENST00000533160;ENST00000526663	T;T;T;T	0.27890	1.64;1.64;1.64;1.92	5.69	5.69	0.88448	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.64402	D	0.000008	T	0.38188	0.1031	N	0.25380	0.74	0.54753	D	0.999987	B	0.33318	0.408	P	0.46144	0.505	T	0.27020	-1.0086	10	0.66056	D	0.02	.	19.8208	0.96592	0.0:1.0:0.0:0.0	.	90	Q9UPX0	TUTLB_HUMAN	S	90;90;80;137	ENSP00000317980:A90S;ENSP00000436576:A90S;ENSP00000434026:A80S;ENSP00000435989:A137S	ENSP00000317980:A90S	A	-	1	0	IGSF9B	133319466	1.000000	0.71417	1.000000	0.80357	0.788000	0.44548	4.713000	0.61895	2.688000	0.91661	0.563000	0.77884	GCC	.	.		0.577	IGSF9B-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		XM_290502	
VAMP1	6843	hgsc.bcm.edu	37	12	6575091	6575091	+	Missense_Mutation	SNP	C	C	G			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr12:6575091C>G	ENST00000396308.3	-	3	350	c.205G>C	c.(205-207)Gct>Cct	p.A69P	VAMP1_ENST00000361716.3_Missense_Mutation_p.A69P|TAPBPL_ENST00000545700.1_3'UTR|VAMP1_ENST00000400911.3_Missense_Mutation_p.A69P|VAMP1_ENST00000535180.1_Missense_Mutation_p.A69P|VAMP1_ENST00000544432.1_5'UTR	NM_014231.3|NM_199245.1	NP_055046.1|NP_954740.1	P23763	VAMP1_HUMAN	vesicle-associated membrane protein 1 (synaptobrevin 1)	69	v-SNARE coiled-coil homology. {ECO:0000255|PROSITE-ProRule:PRU00290}.				neurotransmitter secretion (GO:0007269)|SNARE complex assembly (GO:0035493)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cell surface (GO:0009986)|endocytic vesicle membrane (GO:0030666)|integral component of plasma membrane (GO:0005887)|mitochondrial outer membrane (GO:0005741)|neuron projection (GO:0043005)|synapse (GO:0045202)				endometrium(1)|large_intestine(1)|prostate(1)	3					Botulinum Toxin Type B(DB00042)	AAGGCATCAGCTCGGTCATCC	0.512											OREG0021627	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.A69P		Atlas-SNP	.											.	VAMP1	6	.	0			c.G205C						.						132.0	108.0	116.0					12																	6575091		2203	4300	6503	SO:0001583	missense	6843	exon3			CATCAGCTCGGTC		CCDS31731.1, CCDS41740.1, CCDS44809.1, CCDS73422.1	12p	2013-02-13			ENSG00000139190	ENSG00000139190		"""Vesicle-associated membrane proteins"""	12642	protein-coding gene	gene with protein product		185880		SYB1		1976629	Standard	XM_006719011		Approved	VAMP-1	uc001qok.3	P23763	OTTHUMG00000168269	ENST00000396308.3:c.205G>C	chr12.hg19:g.6575091C>G	ENSP00000379602:p.Ala69Pro	124.0	0.0	635	240.0	90.0	NM_014231	A8MVP3|D3DUR3|O75468|Q15857|Q6FG94|Q8IVC9	Missense_Mutation	SNP	ENST00000396308.3	hg19	CCDS41740.1	.	.	.	.	.	.	.	.	.	.	C	25.2	4.609022	0.87258	.	.	ENSG00000139190	ENST00000400911;ENST00000361716;ENST00000535180;ENST00000355479;ENST00000396308;ENST00000396943;ENST00000539047	T;T;T;T	0.52057	0.68;0.68;0.68;0.68	5.77	5.77	0.91146	Synaptobrevin (4);	0.000000	0.85682	D	0.000000	T	0.73513	0.3596	H	0.94771	3.58	0.80722	D	1	B;B;B	0.31100	0.2;0.238;0.308	B;B;P	0.44946	0.317;0.445;0.465	T	0.77175	-0.2684	10	0.87932	D	0	.	19.9983	0.97395	0.0:1.0:0.0:0.0	.	69;69;69	P23763-3;P23763;P23763-2	.;VAMP1_HUMAN;.	P	69	ENSP00000383702:A69P;ENSP00000355122:A69P;ENSP00000444181:A69P;ENSP00000379602:A69P	ENSP00000347664:A69P	A	-	1	0	VAMP1	6445352	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	7.747000	0.85070	2.724000	0.93272	0.561000	0.74099	GCT	.	.		0.512	VAMP1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399078.1		
LRP6	4040	hgsc.bcm.edu	37	12	12291266	12291266	+	Silent	SNP	T	T	C			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr12:12291266T>C	ENST00000261349.4	-	16	3676	c.3600A>G	c.(3598-3600)caA>caG	p.Q1200Q	BCL2L14_ENST00000396369.1_Intron|LRP6_ENST00000543091.1_Silent_p.Q1200Q	NM_002336.2	NP_002327.2	O75581	LRP6_HUMAN	low density lipoprotein receptor-related protein 6	1200	Beta-propeller 4.				anterior/posterior pattern specification (GO:0009952)|axis elongation involved in somitogenesis (GO:0090245)|bone morphogenesis (GO:0060349)|bone remodeling (GO:0046849)|branching involved in mammary gland duct morphogenesis (GO:0060444)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in cardiac neural crest cell differentiation involved in heart development (GO:0061310)|canonical Wnt signaling pathway involved in neural crest cell differentiation (GO:0044335)|canonical Wnt signaling pathway involved in positive regulation of cardiac outflow tract cell proliferation (GO:0061324)|canonical Wnt signaling pathway involved in regulation of cell proliferation (GO:0044340)|cell migration involved in gastrulation (GO:0042074)|cellular response to cholesterol (GO:0071397)|cerebellum morphogenesis (GO:0021587)|cerebral cortex cell migration (GO:0021795)|cerebral cortex development (GO:0021987)|convergent extension (GO:0060026)|dopaminergic neuron differentiation (GO:0071542)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic digit morphogenesis (GO:0042733)|embryonic forelimb morphogenesis (GO:0035115)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic limb morphogenesis (GO:0030326)|embryonic pattern specification (GO:0009880)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|external genitalia morphogenesis (GO:0035261)|face morphogenesis (GO:0060325)|forebrain radial glial cell differentiation (GO:0021861)|formation of radial glial scaffolds (GO:0021943)|gastrulation with mouth forming second (GO:0001702)|heart looping (GO:0001947)|mammary placode formation (GO:0060596)|midbrain development (GO:0030901)|midbrain-hindbrain boundary development (GO:0030917)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of planar cell polarity pathway involved in cardiac muscle tissue morphogenesis (GO:2000151)|negative regulation of planar cell polarity pathway involved in cardiac right atrium morphogenesis (GO:2000162)|negative regulation of planar cell polarity pathway involved in neural tube closure (GO:2000168)|negative regulation of planar cell polarity pathway involved in outflow tract morphogenesis (GO:2000164)|negative regulation of planar cell polarity pathway involved in pericardium morphogenesis (GO:2000166)|negative regulation of planar cell polarity pathway involved in ventricular septum morphogenesis (GO:2000149)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of protein serine/threonine kinase activity (GO:0071901)|negative regulation of smooth muscle cell apoptotic process (GO:0034392)|neural crest cell differentiation (GO:0014033)|neural crest formation (GO:0014029)|neural tube closure (GO:0001843)|odontogenesis of dentin-containing tooth (GO:0042475)|palate development (GO:0060021)|pericardium morphogenesis (GO:0003344)|positive regulation of apoptotic process (GO:0043065)|positive regulation of bone resorption (GO:0045780)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell cycle (GO:0045787)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of ossification (GO:0045778)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of Wnt signaling pathway involved in dorsal/ventral axis specification (GO:2000055)|post-anal tail morphogenesis (GO:0036342)|primitive streak formation (GO:0090009)|receptor-mediated endocytosis of low-density lipoprotein particle involved in cholesterol transport (GO:0090118)|regulation of cell development (GO:0060284)|regulation of fat cell differentiation (GO:0045598)|regulation of ossification (GO:0030278)|response to folic acid (GO:0051593)|response to peptide hormone (GO:0043434)|single organismal cell-cell adhesion (GO:0016337)|synaptic transmission (GO:0007268)|thalamus development (GO:0021794)|toxin transport (GO:1901998)|trachea cartilage morphogenesis (GO:0060535)|Wnt signaling pathway (GO:0016055)|Wnt signaling pathway involved in dorsal/ventral axis specification (GO:0044332)|Wnt signaling pathway involved in forebrain neuroblast division (GO:0021874)|Wnt signaling pathway involved in somitogenesis (GO:0090244)	cell surface (GO:0009986)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|synapse (GO:0045202)	apolipoprotein binding (GO:0034185)|coreceptor activity involved in Wnt signaling pathway (GO:0071936)|frizzled binding (GO:0005109)|identical protein binding (GO:0042802)|kinase inhibitor activity (GO:0019210)|low-density lipoprotein receptor activity (GO:0005041)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)|toxin transporter activity (GO:0019534)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(19)|lung(28)|ovary(3)|prostate(2)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	85		Prostate(47;0.0865)				TACTGTATTCTTGAAGGTTCA	0.358																																					p.Q1200Q		Atlas-SNP	.											.	LRP6	170	.	0			c.A3600G						.						177.0	162.0	167.0					12																	12291266		2203	4300	6503	SO:0001819	synonymous_variant	4040	exon16			GTATTCTTGAAGG	AF074264	CCDS8647.1	12p13.2	2013-05-29			ENSG00000070018	ENSG00000070018		"""Low density lipoprotein receptors"""	6698	protein-coding gene	gene with protein product		603507				9704021	Standard	NM_002336		Approved	ADCAD2	uc001rah.4	O75581	OTTHUMG00000168540	ENST00000261349.4:c.3600A>G	chr12.hg19:g.12291266T>C		258.0	0.0		186.0	61.0	NM_002336	Q17RZ2	Silent	SNP	ENST00000261349.4	hg19	CCDS8647.1																																																																																			.	.		0.358	LRP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400137.1		
LMNTD1	160492	hgsc.bcm.edu	37	12	25801457	25801457	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr12:25801457A>T	ENST00000445693.1	-	1	31	c.29T>A	c.(28-30)aTc>aAc	p.I10N		NM_001145727.2	NP_001139199.1	Q8N9Z9	LMTD1_HUMAN		0				R -> K (in Ref. 1; BAC04132). {ECO:0000305}.	cell proliferation (GO:0008283)	cytoplasm (GO:0005737)|intermediate filament (GO:0005882)|nuclear envelope (GO:0005635)	structural molecule activity (GO:0005198)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(6)|lung(7)|ovary(2)|skin(1)|upper_aerodigestive_tract(2)	22	all_lung(3;2.75e-22)|Lung NSC(3;1.77e-21)|all_hematologic(7;0.00656)|Colorectal(261;0.0847)					GGAAACACCGATGTCTCCTGC	0.488																																					p.I10N		Atlas-SNP	.											.	IFLTD1	121	.	0			c.T29A						.						242.0	215.0	223.0					12																	25801457		692	1591	2283	SO:0001583	missense	160492	exon1			ACACCGATGTCTC																												ENST00000445693.1:c.29T>A	chr12.hg19:g.25801457A>T	ENSP00000407043:p.Ile10Asn	255.0	0.0		228.0	78.0	NM_001145727	B4DL27|B4DY70|Q8IY38	Missense_Mutation	SNP	ENST00000445693.1	hg19	CCDS44847.1	.	.	.	.	.	.	.	.	.	.	A	9.613	1.131801	0.21041	.	.	ENSG00000152936	ENST00000445693	T	0.14266	2.52	3.84	-3.21	0.05140	.	.	.	.	.	T	0.08179	0.0204	.	.	.	0.09310	N	0.999996	P	0.39157	0.662	B	0.34242	0.178	T	0.22243	-1.0222	8	0.66056	D	0.02	.	5.5128	0.16890	0.3756:0.1724:0.452:0.0	.	10	Q8N9Z9-3	.	N	10	ENSP00000407043:I10N	ENSP00000407043:I10N	I	-	2	0	IFLTD1	25692724	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-0.532000	0.06164	-0.529000	0.06358	-0.323000	0.08544	ATC	.	.		0.488	IFLTD1-003	PUTATIVE	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000402280.1		
DENND5B	160518	hgsc.bcm.edu	37	12	31562239	31562239	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr12:31562239C>T	ENST00000389082.5	-	14	3025	c.2761G>A	c.(2761-2763)Gct>Act	p.A921T	DENND5B_ENST00000536562.1_Missense_Mutation_p.A956T|DENND5B_ENST00000306833.6_Missense_Mutation_p.A956T	NM_144973.3	NP_659410.3	Q6ZUT9	DEN5B_HUMAN	DENN/MADD domain containing 5B	921	RUN 1. {ECO:0000255|PROSITE- ProRule:PRU00178}.				positive regulation of Rab GTPase activity (GO:0032851)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)			NS(2)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(8)|lung(17)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	38						TAGTCCACAGCATTGAGAGAA	0.413																																					p.A921T		Atlas-SNP	.											.	DENND5B	114	.	0			c.G2761A						.						62.0	62.0	62.0					12																	31562239		1865	4101	5966	SO:0001583	missense	160518	exon14			CCACAGCATTGAG	AF086301	CCDS44857.1	12p11.21	2012-10-03			ENSG00000170456	ENSG00000170456		"""DENN/MADD domain containing"""	28338	protein-coding gene	gene with protein product						12477932	Standard	NM_144973		Approved	MGC24039	uc001rki.1	Q6ZUT9	OTTHUMG00000169034	ENST00000389082.5:c.2761G>A	chr12.hg19:g.31562239C>T	ENSP00000373734:p.Ala921Thr	155.0	0.0		116.0	41.0	NM_144973	B5ME75|Q59FW8|Q68CZ7|Q6NUJ0|Q7Z3F9|Q8N973|Q8WUC8	Missense_Mutation	SNP	ENST00000389082.5	hg19	CCDS44857.1	.	.	.	.	.	.	.	.	.	.	C	15.79	2.935931	0.52972	.	.	ENSG00000170456	ENST00000389082;ENST00000306833;ENST00000536562	T;T;T	0.35789	1.29;1.29;1.29	4.5	4.5	0.54988	RUN (3);	0.067075	0.64402	D	0.000014	T	0.36026	0.0952	L	0.52126	1.63	0.51767	D	0.999939	B;B	0.31730	0.2;0.337	B;B	0.33254	0.16;0.156	T	0.16837	-1.0389	10	0.30854	T	0.27	-21.1322	17.4537	0.87600	0.0:1.0:0.0:0.0	.	921;956	Q6ZUT9;G3V1S3	DEN5B_HUMAN;.	T	921;956;956	ENSP00000373734:A921T;ENSP00000306482:A956T;ENSP00000444889:A956T	ENSP00000306482:A956T	A	-	1	0	DENND5B	31453506	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	4.589000	0.61006	2.328000	0.79073	0.558000	0.71614	GCT	.	.		0.413	DENND5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402040.1	NM_144973	
ATP5B	506	hgsc.bcm.edu	37	12	57038650	57038650	+	Missense_Mutation	SNP	T	T	C	rs11542649		TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr12:57038650T>C	ENST00000262030.3	-	3	450	c.400A>G	c.(400-402)Att>Gtt	p.I134V	ATP5B_ENST00000550162.1_5'Flank|ATP5B_ENST00000552919.1_Missense_Mutation_p.I134V|SNORD59A_ENST00000384304.1_RNA	NM_001686.3	NP_001677.2	P06576	ATPB_HUMAN	ATP synthase, H+ transporting, mitochondrial F1 complex, beta polypeptide	134					angiogenesis (GO:0001525)|ATP biosynthetic process (GO:0006754)|ATP catabolic process (GO:0006200)|ATP hydrolysis coupled proton transport (GO:0015991)|cellular metabolic process (GO:0044237)|generation of precursor metabolites and energy (GO:0006091)|lipid metabolic process (GO:0006629)|mitochondrial ATP synthesis coupled proton transport (GO:0042776)|negative regulation of cell adhesion involved in substrate-bound cell migration (GO:0006933)|osteoblast differentiation (GO:0001649)|proton transport (GO:0015992)|regulation of intracellular pH (GO:0051453)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrial matrix (GO:0005759)|mitochondrial membrane (GO:0031966)|mitochondrial nucleoid (GO:0042645)|mitochondrial proton-transporting ATP synthase complex (GO:0005753)|mitochondrial proton-transporting ATP synthase, catalytic core (GO:0005754)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|MHC class I protein binding (GO:0042288)|proton-transporting ATP synthase activity, rotational mechanism (GO:0046933)|proton-transporting ATPase activity, rotational mechanism (GO:0046961)|transmembrane transporter activity (GO:0022857)|transporter activity (GO:0005215)			breast(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19						CCAACAGGAATTTTGATTGGT	0.428																																					p.I134V		Atlas-SNP	.											.	ATP5B	48	.	0			c.A400G						.						124.0	114.0	117.0					12																	57038650		2203	4300	6503	SO:0001583	missense	506	exon3			CAGGAATTTTGAT	M27132	CCDS8924.1	12p13.3	2012-10-12			ENSG00000110955	ENSG00000110955	3.6.3.14	"""Mitochondrial respiratory chain complex / Complex V"", ""ATPases / F-type"""	830	protein-coding gene	gene with protein product		102910		ATPSB		2687158	Standard	NM_001686		Approved		uc001slr.3	P06576	OTTHUMG00000170291	ENST00000262030.3:c.400A>G	chr12.hg19:g.57038650T>C	ENSP00000262030:p.Ile134Val	381.0	0.0		562.0	161.0	NM_001686	A8K4X0|Q14283	Missense_Mutation	SNP	ENST00000262030.3	hg19	CCDS8924.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	12.80|12.80	2.047170|2.047170	0.36085|0.36085	.|.	.|.	ENSG00000110955|ENSG00000110955	ENST00000262030;ENST00000552919;ENST00000551020|ENST00000552959	T;T;T|.	0.79247|.	-1.25;-1.25;-1.25|.	5.6|5.6	5.6|5.6	0.85130|0.85130	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.35998|0.35998	0.0951|0.0951	N|N	0.04320|0.04320	-0.23|-0.23	0.80722|0.80722	D|D	1|1	B|.	0.06786|.	0.001|.	B|.	0.08055|.	0.003|.	T|T	0.32824|0.32824	-0.9892|-0.9892	10|5	0.02654|.	T|.	1|.	-17.1497|-17.1497	15.0669|15.0669	0.72002|0.72002	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	rs11542649;rs11542649|rs11542649;rs11542649	134|.	P06576|.	ATPB_HUMAN|.	V|S	134;134;73|70	ENSP00000262030:I134V;ENSP00000450297:I134V;ENSP00000446677:I73V|.	ENSP00000262030:I134V|.	I|N	-|-	1|2	0|0	ATP5B|ATP5B	55324917|55324917	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	7.549000|7.549000	0.82163|0.82163	2.248000|2.248000	0.74166|0.74166	0.460000|0.460000	0.39030|0.39030	ATT|AAT	.	T|1.000;|0.000		0.428	ATP5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408380.1	NM_001686	
GCN1L1	10985	hgsc.bcm.edu	37	12	120580635	120580635	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr12:120580635G>A	ENST00000300648.6	-	43	5618	c.5606C>T	c.(5605-5607)tCc>tTc	p.S1869F		NM_006836.1	NP_006827	Q92616	GCN1L_HUMAN	GCN1 general control of amino-acid synthesis 1-like 1 (yeast)	1869					regulation of translation (GO:0006417)|translation (GO:0006412)	cytoplasm (GO:0005737)|membrane (GO:0016020)|ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)|translation factor activity, nucleic acid binding (GO:0008135)			NS(2)|breast(2)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(13)|liver(1)|lung(36)|ovary(4)|prostate(7)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	94	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					CACCTTGTTGGACTGGGCAGT	0.537																																					p.S1869F		Atlas-SNP	.											.	GCN1L1	207	.	0			c.C5606T						.						141.0	145.0	143.0					12																	120580635		2060	4201	6261	SO:0001583	missense	10985	exon43			TTGTTGGACTGGG	U77700	CCDS41847.1	12q24.2	2008-07-03	2001-11-28						4199	protein-coding gene	gene with protein product		605614	"""GCN1 (general control of amino-acid synthesis 1, yeast)-like 1"""			9234705	Standard	NM_006836		Approved	KIAA0219, GCN1, GCN1L	uc001txo.3	Q92616	OTTHUMG00000169338	ENST00000300648.6:c.5606C>T	chr12.hg19:g.120580635G>A	ENSP00000300648:p.Ser1869Phe	140.0	0.0		199.0	63.0	NM_006836	A8KAY1|O95001|O95651|Q6P2S3|Q86X65|Q8N5I5|Q8WU80|Q99736|Q9UE60	Missense_Mutation	SNP	ENST00000300648.6	hg19	CCDS41847.1	.	.	.	.	.	.	.	.	.	.	G	26.6	4.750913	0.89753	.	.	ENSG00000089154	ENST00000300648	T	0.50548	0.74	5.97	5.97	0.96955	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.68476	0.3005	M	0.64997	1.995	0.80722	D	1	D	0.76494	0.999	D	0.72982	0.979	T	0.67110	-0.5753	10	0.59425	D	0.04	.	20.4238	0.99064	0.0:0.0:1.0:0.0	.	1869	Q92616	GCN1L_HUMAN	F	1869	ENSP00000300648:S1869F	ENSP00000300648:S1869F	S	-	2	0	GCN1L1	119065018	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	9.209000	0.95087	2.828000	0.97474	0.655000	0.94253	TCC	.	.		0.537	GCN1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403592.1		
RIMBP2	23504	hgsc.bcm.edu	37	12	130927134	130927134	+	Silent	SNP	G	G	T	rs549158714		TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr12:130927134G>T	ENST00000261655.4	-	8	875	c.712C>A	c.(712-714)Cgg>Agg	p.R238R	RIMBP2_ENST00000536002.1_Silent_p.R146R|RIMBP2_ENST00000535703.1_Silent_p.R146R	NM_015347.4	NP_056162.4	O15034	RIMB2_HUMAN	RIMS binding protein 2	238					negative regulation of phosphatase activity (GO:0010923)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|synapse (GO:0045202)				NS(2)|breast(1)|central_nervous_system(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(33)|ovary(3)|pancreas(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(5)|urinary_tract(1)	96	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.213)		OV - Ovarian serous cystadenocarcinoma(86;4.29e-06)|all cancers(50;4.56e-05)|Epithelial(86;5.41e-05)		CTTGCCAACCGCGACTCGTTG	0.587																																					p.R238R		Atlas-SNP	.											RIMBP2,rectum,carcinoma,0,3	RIMBP2	220	.	0			c.C712A						.						130.0	129.0	129.0					12																	130927134		2203	4300	6503	SO:0001819	synonymous_variant	23504	exon8			CCAACCGCGACTC	AB002316	CCDS31925.1	12q24.33	2014-06-13				ENSG00000060709			30339	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 133"""	611602				10748113	Standard	NM_015347		Approved	KIAA0318, RBP2, MGC15831, RIM-BP2, PPP1R133	uc001uil.2	O15034		ENST00000261655.4:c.712C>A	chr12.hg19:g.130927134G>T		217.0	0.0		428.0	152.0	NM_015347	Q96ID2	Silent	SNP	ENST00000261655.4	hg19	CCDS31925.1																																																																																			.	.		0.587	RIMBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399520.1	NM_015347	
LNX2	222484	hgsc.bcm.edu	37	13	28143356	28143356	+	Silent	SNP	A	A	C			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr13:28143356A>C	ENST00000316334.3	-	3	594	c.465T>G	c.(463-465)acT>acG	p.T155T		NM_153371.3	NP_699202.1	Q8N448	LNX2_HUMAN	ligand of numb-protein X 2	155					protein homooligomerization (GO:0051260)		zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(8)|lung(7)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	31		Lung SC(185;0.0156)	Colorectal(13;0.000157)|READ - Rectum adenocarcinoma(15;0.105)	OV - Ovarian serous cystadenocarcinoma(117;0.113)|all cancers(112;0.127)|Epithelial(112;0.248)		TCTCTGCTTGAGTTCTACTAG	0.463																																					p.T155T		Atlas-SNP	.											.	LNX2	70	.	0			c.T465G						.						208.0	212.0	211.0					13																	28143356		2203	4300	6503	SO:0001819	synonymous_variant	222484	exon3			TGCTTGAGTTCTA	AL138699	CCDS9323.1	13q12.2	2013-01-09	2004-01-22	2004-01-23	ENSG00000139517	ENSG00000139517		"""RING-type (C3HC4) zinc fingers"""	20421	protein-coding gene	gene with protein product		609733	"""PDZ domain containing ring finger 1"""	PDZRN1			Standard	NM_153371		Approved	MGC46315	uc001url.4	Q8N448	OTTHUMG00000016634	ENST00000316334.3:c.465T>G	chr13.hg19:g.28143356A>C		290.0	0.0		136.0	68.0	NM_153371	Q5W0P0|Q6ZMH2|Q96SH4	Silent	SNP	ENST00000316334.3	hg19	CCDS9323.1																																																																																			.	.		0.463	LNX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044302.2		
POSTN	10631	hgsc.bcm.edu	37	13	38158220	38158220	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr13:38158220C>T	ENST00000379747.4	-	9	1246	c.1129G>A	c.(1129-1131)Gct>Act	p.A377T	POSTN_ENST00000379743.4_Missense_Mutation_p.A377T|POSTN_ENST00000541481.1_Missense_Mutation_p.A377T|POSTN_ENST00000379742.4_Missense_Mutation_p.A377T|POSTN_ENST00000379749.4_Missense_Mutation_p.A377T|POSTN_ENST00000541179.1_Missense_Mutation_p.A377T	NM_006475.2	NP_006466.2	Q15063	POSTN_HUMAN	periostin, osteoblast specific factor	377	FAS1 3. {ECO:0000255|PROSITE- ProRule:PRU00082, ECO:0000305}.				cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|regulation of Notch signaling pathway (GO:0008593)|skeletal system development (GO:0001501)|tissue development (GO:0009888)	proteinaceous extracellular matrix (GO:0005578)|trans-Golgi network (GO:0005802)	heparin binding (GO:0008201)			cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(16)|lung(22)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	59		Lung NSC(96;2.09e-05)|Prostate(109;0.0513)|Breast(139;0.0538)|Lung SC(185;0.0743)		all cancers(112;2.48e-08)|Epithelial(112;2.78e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000853)|BRCA - Breast invasive adenocarcinoma(63;0.013)|GBM - Glioblastoma multiforme(144;0.0154)		TGTTTTCCAGCCAGCTCAATA	0.428																																					p.A377T		Atlas-SNP	.											.	POSTN	161	.	0			c.G1129A						.						109.0	86.0	94.0					13																	38158220		2203	4300	6503	SO:0001583	missense	10631	exon9			TTCCAGCCAGCTC	D13665	CCDS9364.1, CCDS45034.1, CCDS53864.1, CCDS66530.1, CCDS66531.1	13q13.3	2008-02-05			ENSG00000133110	ENSG00000133110			16953	protein-coding gene	gene with protein product		608777				8363580, 12235007	Standard	NM_006475		Approved	OSF-2, PN, periostin	uc001uwo.4	Q15063	OTTHUMG00000016751	ENST00000379747.4:c.1129G>A	chr13.hg19:g.38158220C>T	ENSP00000369071:p.Ala377Thr	100.0	0.0		86.0	18.0	NM_006475	B1ALD8|C0IMJ1|C0IMJ2|C0IMJ4|D2KRH7|F5H628|Q15064|Q29XZ0|Q3KPJ5|Q5VSY5|Q8IZF9	Missense_Mutation	SNP	ENST00000379747.4	hg19	CCDS9364.1	.	.	.	.	.	.	.	.	.	.	C	24.2	4.504838	0.85176	.	.	ENSG00000133110	ENST00000541179;ENST00000379749;ENST00000379747;ENST00000379743;ENST00000379742;ENST00000541481	D;D;D;D;D;D	0.91631	-2.86;-2.88;-2.88;-2.88;-2.88;-2.88	5.81	5.81	0.92471	FAS1 domain (2);	0.326694	0.36167	N	0.002744	D	0.93324	0.7872	L	0.52905	1.665	0.32023	N	0.600508	B;B;B;P;P;B;B	0.39920	0.425;0.411;0.136;0.695;0.51;0.38;0.136	B;B;B;P;B;B;B	0.51297	0.248;0.431;0.171;0.665;0.349;0.322;0.171	D	0.90345	0.4362	10	0.13853	T	0.58	-4.8705	20.0912	0.97820	0.0:1.0:0.0:0.0	.	377;377;377;377;377;377;377	C0IMJ4;F5H628;B1ALD8;Q15063-3;Q15063-4;Q15063-2;Q15063	.;.;.;.;.;.;POSTN_HUMAN	T	377	ENSP00000437959:A377T;ENSP00000369073:A377T;ENSP00000369071:A377T;ENSP00000369067:A377T;ENSP00000369066:A377T;ENSP00000437953:A377T	ENSP00000369066:A377T	A	-	1	0	POSTN	37056220	0.999000	0.42202	1.000000	0.80357	0.970000	0.65996	1.325000	0.33724	2.746000	0.94184	0.591000	0.81541	GCT	.	.		0.428	POSTN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000044566.2	NM_006475	
FNDC3A	22862	hgsc.bcm.edu	37	13	49710511	49710511	+	Silent	SNP	A	A	G			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr13:49710511A>G	ENST00000492622.2	+	6	839	c.534A>G	c.(532-534)cgA>cgG	p.R178R	FNDC3A_ENST00000398316.3_Silent_p.R122R|FNDC3A_ENST00000541916.1_Silent_p.R178R	NM_001079673.1	NP_001073141.1	Q9Y2H6	FND3A_HUMAN	fibronectin type III domain containing 3A	178					fertilization (GO:0009566)|Sertoli cell development (GO:0060009)|single organismal cell-cell adhesion (GO:0016337)|spermatid development (GO:0007286)	acrosomal vesicle (GO:0001669)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|vesicle membrane (GO:0012506)	poly(A) RNA binding (GO:0044822)			endometrium(5)|kidney(3)|large_intestine(10)|lung(15)|prostate(5)|skin(2)|urinary_tract(1)	41		all_lung(13;7.44e-08)|Lung NSC(96;4.08e-06)|Breast(56;0.000111)|Prostate(109;0.00174)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|Lung SC(185;0.187)|all_neural(104;0.19)	KIRC - Kidney renal clear cell carcinoma(9;0.206)	GBM - Glioblastoma multiforme(99;2.94e-09)		GAGATGAACGATCTAGTAAAA	0.378																																					p.R178R		Atlas-SNP	.											.	FNDC3A	93	.	0			c.A534G						.						69.0	66.0	67.0					13																	49710511		2203	4300	6503	SO:0001819	synonymous_variant	22862	exon6			TGAACGATCTAGT	AB023187	CCDS9413.2, CCDS41886.1	13q14.12	2013-02-11	2005-01-20	2005-01-22	ENSG00000102531	ENSG00000102531		"""Fibronectin type III domain containing"""	20296	protein-coding gene	gene with protein product		615794	"""fibronectin type III domain containing 3"""	FNDC3			Standard	NM_001079673		Approved	bA203I16.5, KIAA0970	uc001vcm.3	Q9Y2H6	OTTHUMG00000016911	ENST00000492622.2:c.534A>G	chr13.hg19:g.49710511A>G		241.0	1.0		133.0	59.0	NM_001079673	B4DYG1|Q5HYC9|Q5JVF8|Q5JVF9|Q6EVH3|Q6EVH4|Q6N020|Q6P9D5|Q6ZME4|Q9H1W1	Silent	SNP	ENST00000492622.2	hg19	CCDS41886.1																																																																																			.	.		0.378	FNDC3A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354845.2	NM_014923	
SPRY2	10253	hgsc.bcm.edu	37	13	80911451	80911451	+	Silent	SNP	G	G	C			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr13:80911451G>C	ENST00000377102.1	-	2	1367	c.390C>G	c.(388-390)tcC>tcG	p.S130S	SPRY2_ENST00000377104.3_Silent_p.S130S|SPRY2_ENST00000540649.1_Silent_p.S130S			O43597	SPY2_HUMAN	sprouty homolog 2 (Drosophila)	130	Poly-Ser.				bud elongation involved in lung branching (GO:0060449)|cell fate commitment (GO:0045165)|epidermal growth factor receptor signaling pathway (GO:0007173)|establishment of mitotic spindle orientation (GO:0000132)|fibroblast growth factor receptor signaling pathway (GO:0008543)|inner ear morphogenesis (GO:0042472)|lung growth (GO:0060437)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of neurotrophin TRK receptor signaling pathway (GO:0051387)|negative regulation of peptidyl-threonine phosphorylation (GO:0010801)|negative regulation of Ras GTPase activity (GO:0034261)|negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of gene expression (GO:0010628)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|sensory perception of sound (GO:0007605)	cell projection (GO:0042995)|cytosol (GO:0005829)|microtubule (GO:0005874)|plasma membrane (GO:0005886)	protein kinase binding (GO:0019901)|protein serine/threonine kinase activator activity (GO:0043539)|protein serine/threonine kinase inhibitor activity (GO:0030291)			central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(5)|ovary(1)|prostate(1)	12	Medulloblastoma(90;0.18)	Acute lymphoblastic leukemia(28;0.218)|Breast(118;0.244)		GBM - Glioblastoma multiforme(99;0.0318)		TCTGTTCAGAGGAGCTGCTGC	0.567																																					p.S130S		Atlas-SNP	.											.	SPRY2	28	.	0			c.C390G						.						109.0	99.0	102.0					13																	80911451		2203	4300	6503	SO:0001819	synonymous_variant	10253	exon2			TTCAGAGGAGCTG	AF039843	CCDS9463.1	13q31.1	2008-05-14	2001-11-28		ENSG00000136158	ENSG00000136158			11270	protein-coding gene	gene with protein product		602466	"""sprouty (Drosophila) homolog 2"""			9458049	Standard	NM_005842		Approved	hSPRY2	uc001vlj.3	O43597	OTTHUMG00000017140	ENST00000377102.1:c.390C>G	chr13.hg19:g.80911451G>C		87.0	0.0		183.0	26.0	NM_005842	B2R9J9|Q5T6Z7	Silent	SNP	ENST00000377102.1	hg19	CCDS9463.1																																																																																			.	.		0.567	SPRY2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045387.1		
OR4K14	122740	hgsc.bcm.edu	37	14	20483095	20483095	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr14:20483095G>T	ENST00000305045.2	-	1	257	c.258C>A	c.(256-258)ttC>ttA	p.F86L		NM_001004712.1	NP_001004712.1	Q8NGD5	OR4KE_HUMAN	olfactory receptor, family 4, subfamily K, member 14	86						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(3)|endometrium(3)|kidney(1)|large_intestine(4)|lung(20)|skin(6)	37	all_cancers(95;0.00108)		Epithelial(56;4.65e-07)|all cancers(55;2e-06)	GBM - Glioblastoma multiforme(265;0.00124)		GATCACTAAGGAAATCCCTGA	0.507																																					p.F86L		Atlas-SNP	.											.	OR4K14	86	.	0			c.C258A						.						97.0	88.0	91.0					14																	20483095		2203	4300	6503	SO:0001583	missense	122740	exon1			ACTAAGGAAATCC		CCDS32027.1	14q11.2	2013-09-23			ENSG00000169484	ENSG00000169484		"""GPCR / Class A : Olfactory receptors"""	15352	protein-coding gene	gene with protein product							Standard	NM_001004712		Approved		uc010tky.2	Q8NGD5	OTTHUMG00000170780	ENST00000305045.2:c.258C>A	chr14.hg19:g.20483095G>T	ENSP00000305011:p.Phe86Leu	102.0	0.0		116.0	29.0	NM_001004712	Q6IEU1|Q96R71	Missense_Mutation	SNP	ENST00000305045.2	hg19	CCDS32027.1	.	.	.	.	.	.	.	.	.	.	.	9.728	1.161402	0.21538	.	.	ENSG00000169484	ENST00000305045	T	0.00912	5.55	4.04	-3.11	0.05299	GPCR, rhodopsin-like superfamily (1);	0.326573	0.22055	N	0.065245	T	0.00524	0.0017	N	0.10782	0.045	0.24601	N	0.993775	B	0.16802	0.019	B	0.17979	0.02	T	0.44817	-0.9303	10	0.02654	T	1	.	10.7225	0.46048	0.6162:0.0:0.3838:0.0	.	86	Q8NGD5	OR4KE_HUMAN	L	86	ENSP00000305011:F86L	ENSP00000305011:F86L	F	-	3	2	OR4K14	19552935	0.000000	0.05858	0.518000	0.27811	0.852000	0.48524	-2.379000	0.01067	-1.033000	0.03299	-0.438000	0.05819	TTC	.	.		0.507	OR4K14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410343.1		
PARP2	10038	hgsc.bcm.edu	37	14	20820469	20820469	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr14:20820469A>G	ENST00000250416.5	+	7	629	c.602A>G	c.(601-603)tAt>tGt	p.Y201C	PARP2_ENST00000429687.3_Missense_Mutation_p.Y188C|PARP2_ENST00000527915.1_Missense_Mutation_p.Y201C	NM_001042618.1|NM_005484.3	NP_001036083.1|NP_005475.2	Q9UGN5	PARP2_HUMAN	poly (ADP-ribose) polymerase 2	201					base-excision repair (GO:0006284)|DNA repair (GO:0006281)|extrinsic apoptotic signaling pathway (GO:0097191)|protein ADP-ribosylation (GO:0006471)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|NAD+ ADP-ribosyltransferase activity (GO:0003950)			central_nervous_system(2)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(4)|ovary(1)|pancreas(1)	15	all_cancers(95;0.00092)	all_lung(585;0.235)	Epithelial(56;5.34e-07)|all cancers(55;3.7e-06)	GBM - Glioblastoma multiforme(265;0.00888)|READ - Rectum adenocarcinoma(17;0.0649)		CCTGGAAAATATGATATGCTA	0.343								Poly(ADP-ribose) polymerase (PARP) enzymes that bind to DNA																													p.Y201C		Atlas-SNP	.											PARP2_ENST00000250416,NS,carcinoma,0,2	PARP2	92	.	0			c.A602G						.						107.0	97.0	100.0					14																	20820469		1842	4097	5939	SO:0001583	missense	10038	exon7			GAAAATATGATAT	AF085734	CCDS41910.1, CCDS45077.1	14q11.2-q12	2010-02-16	2008-07-28	2004-08-26	ENSG00000129484	ENSG00000129484		"""Poly (ADP-ribose) polymerases"""	272	protein-coding gene	gene with protein product		607725	"""ADP-ribosyltransferase (NAD+; poly(ADP-ribose) polymerase)-like 2"", ""poly (ADP-ribose) polymerase family, member 2"""	ADPRTL2		10329013, 18353725	Standard	NM_005484		Approved		uc001vxc.3	Q9UGN5	OTTHUMG00000166106	ENST00000250416.5:c.602A>G	chr14.hg19:g.20820469A>G	ENSP00000250416:p.Tyr201Cys	72.0	0.0		99.0	27.0	NM_005484	Q8TEU4|Q9NUV2|Q9UMR4|Q9Y6C8	Missense_Mutation	SNP	ENST00000250416.5	hg19	CCDS41910.1	.	.	.	.	.	.	.	.	.	.	A	21.9	4.223462	0.79464	.	.	ENSG00000129484	ENST00000429687;ENST00000250416;ENST00000527915	T;T;T	0.33654	1.4;1.4;1.4	5.53	5.53	0.82687	WGR domain (1);	0.000000	0.85682	D	0.000000	T	0.59756	0.2217	M	0.72894	2.215	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.998;1.0	T	0.63937	-0.6524	10	0.87932	D	0	-13.683	14.635	0.68682	1.0:0.0:0.0:0.0	.	188;201	Q9UGN5-2;Q9UGN5	.;PARP2_HUMAN	C	188;201;201	ENSP00000392972:Y188C;ENSP00000250416:Y201C;ENSP00000432283:Y201C	ENSP00000250416:Y201C	Y	+	2	0	PARP2	19890309	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.600000	0.82769	2.106000	0.64143	0.460000	0.39030	TAT	.	.		0.343	PARP2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000387847.2		
PRKCH	5583	hgsc.bcm.edu	37	14	61997206	61997206	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr14:61997206G>T	ENST00000332981.5	+	12	2039	c.1654G>T	c.(1654-1656)Gcg>Tcg	p.A552S	PRKCH_ENST00000555082.1_Missense_Mutation_p.A391S|RP11-47I22.4_ENST00000556347.1_Silent_p.T56T	NM_006255.3	NP_006246.2	P24723	KPCL_HUMAN	protein kinase C, eta	552	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				blood coagulation (GO:0007596)|negative regulation of glial cell apoptotic process (GO:0034351)|platelet activation (GO:0030168)|positive regulation of B cell receptor signaling pathway (GO:0050861)|positive regulation of glial cell proliferation (GO:0060252)|positive regulation of keratinocyte differentiation (GO:0045618)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein kinase C signaling (GO:0070528)|protein phosphorylation (GO:0006468)|regulation of tight junction assembly (GO:2000810)|signal transduction (GO:0007165)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium-independent protein kinase C activity (GO:0004699)|enzyme binding (GO:0019899)|metal ion binding (GO:0046872)|protein kinase C activity (GO:0004697)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|lung(4)|ovary(2)|pancreas(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	25				OV - Ovarian serous cystadenocarcinoma(108;0.045)|BRCA - Breast invasive adenocarcinoma(234;0.0906)|KIRC - Kidney renal clear cell carcinoma(182;0.182)		CTGTGGTCACGCGCCTTTTGA	0.552																																					p.A552S	Melanoma(135;863 1779 8064 14443 26348)	Atlas-SNP	.											PRKCH,colon,carcinoma,-1,1	PRKCH	89	.	0			c.G1654T						.						225.0	180.0	195.0					14																	61997206		2203	4300	6503	SO:0001583	missense	5583	exon12			GGTCACGCGCCTT	M55284	CCDS9752.1	14q23.1	2009-07-10			ENSG00000027075	ENSG00000027075	2.7.11.1		9403	protein-coding gene	gene with protein product		605437		PRKCL		1986216, 1545821	Standard	NM_006255		Approved	PKC-L, PKCL	uc001xfn.3	P24723	OTTHUMG00000152341	ENST00000332981.5:c.1654G>T	chr14.hg19:g.61997206G>T	ENSP00000329127:p.Ala552Ser	155.0	0.0		163.0	26.0	NM_006255	B4DJN5|Q16246|Q8NE03	Missense_Mutation	SNP	ENST00000332981.5	hg19	CCDS9752.1	.	.	.	.	.	.	.	.	.	.	G	11.27	1.588420	0.28357	.	.	ENSG00000027075	ENST00000555185;ENST00000332981;ENST00000555082	T;T;T	0.65549	-0.16;1.88;1.88	5.63	5.63	0.86233	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.64402	D	0.000011	T	0.62877	0.2464	N	0.17345	0.48	0.80722	D	1	D	0.53312	0.959	D	0.67548	0.952	T	0.54364	-0.8305	10	0.02654	T	1	.	19.6972	0.96030	0.0:0.0:1.0:0.0	.	552	P24723	KPCL_HUMAN	S	120;552;391	ENSP00000451871:A120S;ENSP00000329127:A552S;ENSP00000450981:A391S	ENSP00000329127:A552S	A	+	1	0	PRKCH	61066959	1.000000	0.71417	0.268000	0.24571	0.241000	0.25554	4.418000	0.59828	2.663000	0.90544	0.650000	0.86243	GCG	.	.		0.552	PRKCH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276974.2	NM_006255	
LTBP2	4053	hgsc.bcm.edu	37	14	74995708	74995708	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr14:74995708C>A	ENST00000261978.4	-	11	2491	c.2105G>T	c.(2104-2106)gGc>gTc	p.G702V	LTBP2_ENST00000556690.1_Missense_Mutation_p.G702V	NM_000428.2	NP_000419.1	Q14767	LTBP2_HUMAN	latent transforming growth factor beta binding protein 2	702	TB 2.				protein secretion (GO:0009306)|protein targeting (GO:0006605)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|heparin binding (GO:0008201)			breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(9)|liver(1)|lung(29)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	58				BRCA - Breast invasive adenocarcinoma(234;0.00219)|READ - Rectum adenocarcinoma(1;0.0649)		CCATGCTTTGCCCACGCGGCT	0.637																																					p.G702V		Atlas-SNP	.											LTBP2,NS,carcinoma,0,1	LTBP2	158	.	0			c.G2105T						.						32.0	26.0	28.0					14																	74995708		2201	4299	6500	SO:0001583	missense	4053	exon11			GCTTTGCCCACGC		CCDS9831.1	14q24.3	2011-10-20	2001-12-04			ENSG00000119681		"""Latent transforming growth factor, beta binding proteins"""	6715	protein-coding gene	gene with protein product		602091	"""chromosome 14 open reading frame 141"""	LTBP3, C14orf141		7798248	Standard	NM_000428		Approved		uc001xqa.3	Q14767		ENST00000261978.4:c.2105G>T	chr14.hg19:g.74995708C>A	ENSP00000261978:p.Gly702Val	97.0	1.0		190.0	80.0	NM_000428	Q99907|Q9NS51	Missense_Mutation	SNP	ENST00000261978.4	hg19	CCDS9831.1	.	.	.	.	.	.	.	.	.	.	C	27.2	4.809856	0.90707	.	.	ENSG00000119681	ENST00000261978;ENST00000556690	D;D	0.96104	-3.91;-3.91	5.35	5.35	0.76521	Matrix fibril-associated (3);TGF-beta binding (1);	0.000000	0.42964	D	0.000637	D	0.98030	0.9351	M	0.91510	3.215	0.80722	D	1	D	0.67145	0.996	D	0.63597	0.916	D	0.98626	1.0669	10	0.72032	D	0.01	.	18.0607	0.89377	0.0:1.0:0.0:0.0	.	702	Q14767	LTBP2_HUMAN	V	702	ENSP00000261978:G702V;ENSP00000451477:G702V	ENSP00000261978:G702V	G	-	2	0	LTBP2	74065461	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	5.287000	0.65645	2.804000	0.96469	0.650000	0.86243	GGC	.	.		0.637	LTBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413595.1	NM_000428	
SAMD15	161394	hgsc.bcm.edu	37	14	77844990	77844990	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr14:77844990C>T	ENST00000216471.4	+	1	1515	c.1229C>T	c.(1228-1230)aCc>aTc	p.T410I	TMED8_ENST00000216468.7_5'Flank|SAMD15_ENST00000533095.2_Intron	NM_001010860.1	NP_001010860.1	Q9P1V8	SAM15_HUMAN	sterile alpha motif domain containing 15	410										breast(2)|endometrium(3)|kidney(2)|large_intestine(4)|lung(10)|pancreas(1)|skin(1)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	28						CCAGATGAAACCAAACCAAGG	0.438																																					p.T410I		Atlas-SNP	.											.	SAMD15	60	.	0			c.C1229T						.						78.0	75.0	76.0					14																	77844990		2203	4300	6503	SO:0001583	missense	161394	exon1			ATGAAACCAAACC	AK093282	CCDS32126.1	14q24.3	2013-01-10	2010-10-20	2010-10-20	ENSG00000100583	ENSG00000100583		"""Sterile alpha motif (SAM) domain containing"""	18631	protein-coding gene	gene with protein product			"""family with sequence similarity 15, member A"", ""chromosome 14 open reading frame 174"""	FAM15A, C14orf174			Standard	XM_006720069		Approved	FLJ35963	uc001xtq.1	Q9P1V8		ENST00000216471.4:c.1229C>T	chr14.hg19:g.77844990C>T	ENSP00000216471:p.Thr410Ile	295.0	0.0		417.0	84.0	NM_001010860	Q2M3P3	Missense_Mutation	SNP	ENST00000216471.4	hg19	CCDS32126.1	.	.	.	.	.	.	.	.	.	.	C	12.24	1.877404	0.33162	.	.	ENSG00000100583	ENST00000216471	T	0.18810	2.19	5.6	1.71	0.24356	.	1.066930	0.07477	N	0.903237	T	0.10895	0.0266	N	0.12182	0.205	0.09310	N	1	B	0.32245	0.361	B	0.29942	0.109	T	0.31752	-0.9932	10	0.39692	T	0.17	2.4634	4.0072	0.09607	0.1648:0.5723:0.0:0.2628	.	410	Q9P1V8	SAM15_HUMAN	I	410	ENSP00000216471:T410I	ENSP00000216471:T410I	T	+	2	0	SAMD15	76914743	0.000000	0.05858	0.001000	0.08648	0.304000	0.27724	0.083000	0.14871	0.045000	0.15804	0.555000	0.69702	ACC	.	.		0.438	SAMD15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394587.2	NM_001010860	
TGM7	116179	hgsc.bcm.edu	37	15	43571883	43571883	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr15:43571883C>T	ENST00000452443.2	-	10	1622	c.1618G>A	c.(1618-1620)Ggt>Agt	p.G540S		NM_052955.2	NP_443187.1	Q96PF1	TGM7_HUMAN	transglutaminase 7	540					peptide cross-linking (GO:0018149)		metal ion binding (GO:0046872)|protein-glutamine gamma-glutamyltransferase activity (GO:0003810)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(8)|lung(16)|ovary(2)|prostate(4)|skin(1)	39		all_cancers(109;2.12e-14)|all_epithelial(112;1.99e-12)|Lung NSC(122;2.46e-08)|all_lung(180;2.75e-07)|Melanoma(134;0.0476)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;9.14e-07)	L-Glutamine(DB00130)	TGGGTACCACCCCCATGCAGC	0.642																																					p.G540S		Atlas-SNP	.											.	TGM7	86	.	0			c.G1618A						.						93.0	94.0	94.0					15																	43571883		2202	4299	6501	SO:0001583	missense	116179	exon10			TACCACCCCCATG	AF363393	CCDS32213.1	15q15.2	2004-07-01				ENSG00000159495		"""Transglutaminases"""	30790	protein-coding gene	gene with protein product	"""transglutaminase Z"""	606776				11390390	Standard	NM_052955		Approved	TGMZ	uc001zrf.1	Q96PF1		ENST00000452443.2:c.1618G>A	chr15.hg19:g.43571883C>T	ENSP00000389466:p.Gly540Ser	32.0	0.0		70.0	21.0	NM_052955		Missense_Mutation	SNP	ENST00000452443.2	hg19	CCDS32213.1	.	.	.	.	.	.	.	.	.	.	C	14.68	2.607287	0.46527	.	.	ENSG00000159495	ENST00000452443	T	0.68331	-0.32	4.69	4.69	0.59074	Transglutaminase, C-terminal (1);Immunoglobulin-like fold (1);	0.121727	0.56097	D	0.000026	T	0.71702	0.3371	M	0.78801	2.425	0.19300	N	0.999973	D	0.59767	0.986	P	0.48304	0.573	T	0.69323	-0.5175	10	0.59425	D	0.04	-12.9329	13.0102	0.58727	0.0:1.0:0.0:0.0	.	540	Q96PF1	TGM7_HUMAN	S	540	ENSP00000389466:G540S	ENSP00000389466:G540S	G	-	1	0	TGM7	41359175	0.137000	0.22531	0.076000	0.20297	0.693000	0.40251	1.492000	0.35594	2.427000	0.82271	0.655000	0.94253	GGT	.	.		0.642	TGM7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000432489.1	NM_052955	
LEO1	123169	hgsc.bcm.edu	37	15	52258056	52258056	+	Missense_Mutation	SNP	G	G	C			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr15:52258056G>C	ENST00000299601.5	-	2	764	c.704C>G	c.(703-705)cCa>cGa	p.P235R	LEO1_ENST00000315141.5_Missense_Mutation_p.P235R	NM_138792.2	NP_620147.1	Q8WVC0	LEO1_HUMAN	Leo1, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae)	235	Asp-rich.				endodermal cell fate commitment (GO:0001711)|histone H2B ubiquitination (GO:0033523)|histone monoubiquitination (GO:0010390)|mRNA polyadenylation (GO:0006378)|negative regulation of myeloid cell differentiation (GO:0045638)|positive regulation of mRNA 3'-end processing (GO:0031442)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	Cdc73/Paf1 complex (GO:0016593)				endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(5)|skin(1)	14				all cancers(107;0.00264)		AGACAGCTGTGGTTGTTCTTC	0.423																																					p.P235R	Esophageal Squamous(40;229 896 18505 32465 43844)|Ovarian(53;886 1123 14462 18432 23189)	Atlas-SNP	.											.	LEO1	46	.	0			c.C704G						.						246.0	246.0	246.0					15																	52258056		2195	4293	6488	SO:0001583	missense	123169	exon2			AGCTGTGGTTGTT	AY302186	CCDS10146.1, CCDS66767.1	15q21.2	2008-02-05			ENSG00000166477	ENSG00000166477			30401	protein-coding gene	gene with protein product		610507				15632063	Standard	NM_001286430		Approved		uc002abo.3	Q8WVC0	OTTHUMG00000131843	ENST00000299601.5:c.704C>G	chr15.hg19:g.52258056G>C	ENSP00000299601:p.Pro235Arg	545.0	0.0		563.0	96.0	NM_138792	Q96N99	Missense_Mutation	SNP	ENST00000299601.5	hg19	CCDS10146.1	.	.	.	.	.	.	.	.	.	.	G	12.66	2.003248	0.35320	.	.	ENSG00000166477	ENST00000299601;ENST00000315141	.	.	.	4.84	4.84	0.62591	.	0.261206	0.40818	N	0.001011	T	0.42517	0.1206	N	0.16478	0.41	0.80722	D	1	B;B	0.11235	0.004;0.001	B;B	0.09377	0.004;0.001	T	0.24835	-1.0149	9	0.18276	T	0.48	.	18.1449	0.89651	0.0:0.0:1.0:0.0	.	235;235	Q8WVC0-2;Q8WVC0	.;LEO1_HUMAN	R	235	.	ENSP00000299601:P235R	P	-	2	0	LEO1	50045348	0.997000	0.39634	0.555000	0.28281	0.965000	0.64279	3.722000	0.54948	2.509000	0.84616	0.655000	0.94253	CCA	.	.		0.423	LEO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254791.2	NM_138792	
TTLL13	440307	hgsc.bcm.edu	37	15	90799374	90799374	+	Splice_Site	SNP	T	T	A			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr15:90799374T>A	ENST00000339615.5	+	6	840	c.550T>A	c.(550-552)Tat>Aat	p.Y184N	TTLL13_ENST00000438251.1_Splice_Site_p.Y184N|RP11-697E2.6_ENST00000561573.1_Intron	NM_001029964.2	NP_001025135.2			tubulin tyrosine ligase-like family, member 13											NS(1)|breast(2)|endometrium(4)|kidney(1)|large_intestine(4)|lung(3)|prostate(1)	16	Melanoma(11;0.00551)|Lung NSC(78;0.0178)|all_lung(78;0.0378)		KIRC - Kidney renal clear cell carcinoma(17;0.0286)|BRCA - Breast invasive adenocarcinoma(143;0.0323)|Kidney(142;0.0514)			TGCACATAGCTATGGGGACTT	0.547																																					p.Y184N		Atlas-SNP	.											.	TTLL13	44	.	0			c.T550A						.						80.0	77.0	78.0					15																	90799374		2199	4298	6497	SO:0001630	splice_region_variant	440307	exon6			CATAGCTATGGGG	BC036668		15q26.1	2013-02-14				ENSG00000213471		"""Tubulin tyrosine ligase-like family"""	32484	protein-coding gene	gene with protein product						15890843	Standard	NR_104604		Approved	FLJ46079, MGC33417	uc002bpd.1	A6NNM8		ENST00000339615.5:c.549-1T>A	chr15.hg19:g.90799374T>A		51.0	0.0		70.0	29.0	NM_001029964		Missense_Mutation	SNP	ENST00000339615.5	hg19	CCDS32328.1	.	.	.	.	.	.	.	.	.	.	T	16.62	3.172795	0.57584	.	.	ENSG00000213471	ENST00000438251;ENST00000339615	T;T	0.06142	3.34;3.34	5.18	5.18	0.71444	.	0.369213	0.26586	N	0.023546	T	0.22975	0.0555	M	0.83603	2.65	0.80722	D	1	P	0.45594	0.862	P	0.55455	0.776	T	0.00478	-1.1715	10	0.56958	D	0.05	.	14.3636	0.66789	0.0:0.0:0.0:1.0	.	184	A6NNM8-2	.	N	184	ENSP00000413362:Y184N;ENSP00000345294:Y184N	ENSP00000345294:Y184N	Y	+	1	0	TTLL13	88600378	1.000000	0.71417	0.963000	0.40424	0.267000	0.26476	5.619000	0.67729	2.184000	0.69523	0.459000	0.35465	TAT	.	.		0.547	TTLL13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000435854.1	NM_001029964	Missense_Mutation
HYDIN	54768	hgsc.bcm.edu	37	16	70884513	70884513	+	Silent	SNP	C	C	G			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr16:70884513C>G	ENST00000393567.2	-	74	12639	c.12489G>C	c.(12487-12489)gtG>gtC	p.V4163V	RNU6ATAC25P_ENST00000408798.1_RNA	NM_001270974.1	NP_001257903.1	Q4G0P3	HYDIN_HUMAN	HYDIN, axonemal central pair apparatus protein	4163					cilium assembly (GO:0042384)|cilium movement (GO:0003341)|epithelial cell development (GO:0002064)|trachea development (GO:0060438)|ventricular system development (GO:0021591)	cell projection (GO:0042995)				breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(12)|ovary(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	43		Ovarian(137;0.0654)				AATTAAAGTTCACATCTCCTT	0.428																																					p.V4163V		Atlas-SNP	.											.	HYDIN	788	.	0			c.G12489C						.						75.0	65.0	68.0					16																	70884513		1856	4104	5960	SO:0001819	synonymous_variant	54768	exon74			AAAGTTCACATCT	AK074472	CCDS10897.1, CCDS56004.1, CCDS56005.1, CCDS59269.1	16q22.2	2014-02-05	2012-01-06		ENSG00000157423	ENSG00000157423		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	19368	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 31"""	610812	"""hydrocephalus inducing"", ""hydrocephalus inducing homolog (mouse)"""			12719380, 23022101	Standard	NM_001198542		Approved	DKFZp434D0513, KIAA1864, PPP1R31, CILD5	uc031qwy.1	Q4G0P3	OTTHUMG00000137584	ENST00000393567.2:c.12489G>C	chr16.hg19:g.70884513C>G		173.0	0.0		68.0	34.0	NM_001270974	A6NC70|A6NLZ0|B4DQY4|B4DRN4|F5H6V3|Q8N3H8|Q8N3P6|Q8TC08|Q96JG3|Q96SS4|Q9H5U3|Q9H9B8|Q9NTI0|Q9UBE5	Silent	SNP	ENST00000393567.2	hg19	CCDS59269.1																																																																																			.	.		0.428	HYDIN-001	PUTATIVE	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000398624.3		
GPS2	2874	hgsc.bcm.edu	37	17	7216697	7216697	+	Splice_Site	SNP	A	A	G			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr17:7216697A>G	ENST00000380728.2	-	8	1025		c.e8+1		RP11-542C16.2_ENST00000575474.1_Splice_Site|GPS2_ENST00000389167.5_Splice_Site|GPS2_ENST00000391950.3_Splice_Site			Q13227	GPS2_HUMAN	G protein pathway suppressor 2						cell cycle (GO:0007049)|inactivation of MAPK activity (GO:0000188)|JNK cascade (GO:0007254)|negative regulation of JNK cascade (GO:0046329)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)	nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	GTPase inhibitor activity (GO:0005095)|transcription corepressor activity (GO:0003714)			breast(1)|central_nervous_system(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(1)|ovary(2)|pancreas(1)|prostate(1)|stomach(1)|urinary_tract(4)	24		Prostate(122;0.157)				GGATGTTATCACCTGTCTGAG	0.557											OREG0024133	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									.		Atlas-SNP	.											.	GPS2	44	.	0			c.724+2T>C						.						99.0	102.0	101.0					17																	7216697		2203	4300	6503	SO:0001630	splice_region_variant	2874	exon9			GTTATCACCTGTC	U28963	CCDS11100.1	17p13.1	2006-04-29			ENSG00000132522	ENSG00000132522			4550	protein-coding gene	gene with protein product		601935				8943324	Standard	NM_004489		Approved		uc002gfx.1	Q13227	OTTHUMG00000102198	ENST00000380728.2:c.724+1T>C	chr17.hg19:g.7216697A>G		97.0	0.0	640	98.0	51.0	NM_004489	B4DXA1|Q6FHM8	Splice_Site	SNP	ENST00000380728.2	hg19	CCDS11100.1	.	.	.	.	.	.	.	.	.	.	A	16.16	3.044178	0.55110	.	.	ENSG00000132522	ENST00000391950;ENST00000380728;ENST00000389167;ENST00000315601	.	.	.	3.67	3.67	0.42095	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	10.6611	0.45702	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	GPS2	7157421	0.999000	0.42202	1.000000	0.80357	0.958000	0.62258	4.623000	0.61247	1.899000	0.54978	0.523000	0.50628	.	.	.		0.557	GPS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000220048.4	NM_004489	Intron
KIAA0100	9703	hgsc.bcm.edu	37	17	26967658	26967658	+	Silent	SNP	G	G	A			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr17:26967658G>A	ENST00000528896.2	-	8	884	c.810C>T	c.(808-810)ttC>ttT	p.F270F	KIAA0100_ENST00000389003.3_Silent_p.F127F|KIAA0100_ENST00000544884.1_Silent_p.F127F	NM_014680.3	NP_055495.2	Q14667	K0100_HUMAN	KIAA0100	270						extracellular region (GO:0005576)				breast(3)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(13)|lung(23)|ovary(2)|prostate(2)|skin(6)|stomach(2)|urinary_tract(3)	68	Lung NSC(42;0.00431)					GCTGGAGAAGGAATAGGCCAG	0.448																																					p.F270F		Atlas-SNP	.											.	KIAA0100	175	.	0			c.C810T						.						128.0	120.0	123.0					17																	26967658		2203	4300	6503	SO:0001819	synonymous_variant	9703	exon8			GAGAAGGAATAGG	D43947	CCDS32595.1	17q11.2	2012-11-29			ENSG00000007202	ENSG00000007202			28960	protein-coding gene	gene with protein product	"""cancer/testis antigen 101"", ""breast cancer overexpressed gene 1"""	610664				16289875	Standard	NM_014680		Approved	DKFZp686M0843, MGC111488, BCOX1, CT101, BCOX	uc002hbu.3	Q14667	OTTHUMG00000166587	ENST00000528896.2:c.810C>T	chr17.hg19:g.26967658G>A		251.0	0.0		372.0	127.0	NM_014680	A6NCX3|Q3SYN5|Q49A07|Q5H9T4|Q6WG74|Q6ZP51|Q96HH8	Silent	SNP	ENST00000528896.2	hg19	CCDS32595.1																																																																																			.	.		0.448	KIAA0100-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390571.3	NM_014680	
LYZL6	57151	hgsc.bcm.edu	37	17	34266279	34266279	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr17:34266279C>T	ENST00000585556.1	-	2	416	c.82G>A	c.(82-84)Gcc>Acc	p.A28T	LYZL6_ENST00000492340.2_5'Flank|LYZL6_ENST00000293274.4_Missense_Mutation_p.A28T|LYZL6_ENST00000394523.3_Missense_Mutation_p.A28T			O75951	LYZL6_HUMAN	lysozyme-like 6	28					cell wall macromolecule catabolic process (GO:0016998)	extracellular region (GO:0005576)	lysozyme activity (GO:0003796)			breast(1)|endometrium(1)|large_intestine(1)|lung(8)|stomach(1)	12				UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		AGCACCTGGGCCAAGTCACAG	0.562																																					p.A28T		Atlas-SNP	.											.	LYZL6	18	.	0			c.G82A						.						107.0	100.0	103.0					17																	34266279		2203	4300	6503	SO:0001583	missense	57151	exon1			CCTGGGCCAAGTC	AF088219, AY742214	CCDS11302.1	17q11.2	2014-04-10			ENSG00000161572	ENSG00000275722			29614	protein-coding gene	gene with protein product		612751				10213461	Standard	NM_020426		Approved	LYC1, PRO1485, TKAL754	uc002hkj.2	O75951	OTTHUMG00000188400	ENST00000585556.1:c.82G>A	chr17.hg19:g.34266279C>T	ENSP00000468094:p.Ala28Thr	84.0	0.0		59.0	28.0	NM_020426	Q6UW30	Missense_Mutation	SNP	ENST00000585556.1	hg19	CCDS11302.1	.	.	.	.	.	.	.	.	.	.	C	23.3	4.396060	0.83011	.	.	ENSG00000161572	ENST00000293274;ENST00000394523	T;T	0.54675	0.56;0.56	5.29	5.29	0.74685	Lysozyme-like domain (1);	0.270354	0.30455	N	0.009588	T	0.72187	0.3429	M	0.81112	2.525	0.44807	D	0.997812	D	0.65815	0.995	D	0.65573	0.936	T	0.75786	-0.3195	10	0.72032	D	0.01	-7.5879	14.8301	0.70142	0.0:1.0:0.0:0.0	.	28	O75951	LYZL6_HUMAN	T	28	ENSP00000293274:A28T;ENSP00000378031:A28T	ENSP00000293274:A28T	A	-	1	0	LYZL6	31290392	0.996000	0.38824	0.959000	0.39883	0.729000	0.41735	2.433000	0.44793	2.646000	0.89796	0.655000	0.94253	GCC	.	.		0.562	LYZL6-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256578.2	NM_020426	
ACACA	31	hgsc.bcm.edu	37	17	35538246	35538246	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr17:35538246T>C	ENST00000394406.2	-	40	4907	c.4717A>G	c.(4717-4719)Atc>Gtc	p.I1573V	ACACA_ENST00000335166.5_Missense_Mutation_p.I1495V|ACACA_ENST00000360679.3_Missense_Mutation_p.I1515V|ACACA_ENST00000353139.5_Missense_Mutation_p.I1610V	NM_198836.1	NP_942133.1	Q13085	ACACA_HUMAN	acetyl-CoA carboxylase alpha	1573					acetyl-CoA metabolic process (GO:0006084)|biotin metabolic process (GO:0006768)|carnitine shuttle (GO:0006853)|cellular lipid metabolic process (GO:0044255)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|lipid homeostasis (GO:0055088)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|malonyl-CoA biosynthetic process (GO:2001295)|multicellular organismal protein metabolic process (GO:0044268)|positive regulation of cellular metabolic process (GO:0031325)|protein homotetramerization (GO:0051289)|small molecule metabolic process (GO:0044281)|tissue homeostasis (GO:0001894)|triglyceride biosynthetic process (GO:0019432)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	acetyl-CoA carboxylase activity (GO:0003989)|ATP binding (GO:0005524)|biotin carboxylase activity (GO:0004075)|metal ion binding (GO:0046872)			NS(2)|breast(5)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(24)|lung(23)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	83		Breast(25;0.00157)|Ovarian(249;0.15)			Biotin(DB00121)	GGAGTATTGATTAACATTCCA	0.408																																					p.I1610V	Colon(23;82 258 739 2117 10493 24037 27661 34815 35438 36249)	Atlas-SNP	.											.	ACACA	395	.	0			c.A4828G						.						204.0	187.0	193.0					17																	35538246		2203	4300	6503	SO:0001583	missense	31	exon40			TATTGATTAACAT	U19822	CCDS11317.1, CCDS11318.1, CCDS42302.1, CCDS42303.1	17q21	2014-05-06	2010-04-30		ENSG00000132142	ENSG00000278540	6.4.1.2		84	protein-coding gene	gene with protein product	"""acetyl-CoA carboxylase 1"""	200350	"""acetyl-Coenzyme A carboxylase alpha"""	ACAC, ACC			Standard	NM_198837		Approved	ACC1	uc002hno.3	Q13085	OTTHUMG00000188463	ENST00000394406.2:c.4717A>G	chr17.hg19:g.35538246T>C	ENSP00000377928:p.Ile1573Val	345.0	0.0		224.0	112.0	NM_198834	B2RP68|Q6KEV6|Q6XDA8|Q7Z2G8|Q7Z561|Q7Z563|Q7Z564|Q86WB2|Q86WB3	Missense_Mutation	SNP	ENST00000394406.2	hg19	CCDS11317.1	.	.	.	.	.	.	.	.	.	.	T	11.90	1.777983	0.31502	.	.	ENSG00000132142	ENST00000353139;ENST00000360679;ENST00000394406;ENST00000452074;ENST00000335166;ENST00000427330	D;D;D;D	0.94497	-3.44;-3.43;-3.44;-3.43	5.37	5.37	0.77165	.	0.000000	0.85682	D	0.000000	D	0.88782	0.6530	L	0.31476	0.935	0.80722	D	1	B;P;B;B	0.39480	0.296;0.675;0.015;0.026	B;B;B;B	0.37601	0.101;0.254;0.016;0.035	D	0.87674	0.2543	10	0.02654	T	1	-15.0967	15.6571	0.77150	0.0:0.0:0.0:1.0	.	321;1610;1573;1515	F8W6G0;Q13085-4;Q13085;Q13085-2	.;.;ACACA_HUMAN;.	V	1610;1515;1573;1597;1495;321	ENSP00000344789:I1610V;ENSP00000353898:I1515V;ENSP00000377928:I1573V;ENSP00000335323:I1495V	ENSP00000335323:I1495V	I	-	1	0	ACACA	32612359	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.993000	0.88291	2.161000	0.67846	0.528000	0.53228	ATC	.	.		0.408	ACACA-009	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256696.1	NM_198836	
HEATR6	63897	hgsc.bcm.edu	37	17	58156056	58156056	+	Splice_Site	SNP	C	C	T			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr17:58156056C>T	ENST00000184956.6	-	1	236		c.e1+1		HEATR6_ENST00000585712.1_Splice_Site|CTD-2319I12.2_ENST00000589740.1_lincRNA|HEATR6_ENST00000585976.1_Splice_Site	NM_022070.4	NP_071353.4	Q6AI08	HEAT6_HUMAN	HEAT repeat containing 6								poly(A) RNA binding (GO:0044822)			NS(1)|breast(4)|endometrium(5)|kidney(2)|large_intestine(4)|lung(7)|ovary(2)|pancreas(1)|prostate(4)|skin(10)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	44	all_cancers(5;2.25e-13)|Breast(5;4.84e-25)|all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		BRCA - Breast invasive adenocarcinoma(1;5.93e-19)|Epithelial(12;7.59e-12)|all cancers(12;1.26e-10)			GCGCCGCCTACCTCCGGGGCC	0.711																																					.		Atlas-SNP	.											.	HEATR6	98	.	0			c.219+1G>A						.						8.0	7.0	7.0					17																	58156056		2071	4060	6131	SO:0001630	splice_region_variant	63897	exon2			CGCCTACCTCCGG	BX640819	CCDS11623.1	17q23.2	2007-05-01				ENSG00000068097			24076	protein-coding gene	gene with protein product	"""amplified in breast cancer 1"""					12755490	Standard	NM_022070		Approved	ABC1, FLJ22087	uc002iyk.1	Q6AI08		ENST00000184956.6:c.219+1G>A	chr17.hg19:g.58156056C>T		14.0	0.0		38.0	14.0	NM_022070	B3KXP3|Q6MZX1|Q6MZY2|Q8TDM9|Q9H6B3|Q9H6M7	Splice_Site	SNP	ENST00000184956.6	hg19	CCDS11623.1	.	.	.	.	.	.	.	.	.	.	.	16.87	3.240773	0.58995	.	.	ENSG00000068097	ENST00000184956	.	.	.	4.58	4.58	0.56647	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.6658	0.62393	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	HEATR6	55510838	1.000000	0.71417	1.000000	0.80357	0.588000	0.36517	4.277000	0.58939	2.479000	0.83701	0.558000	0.71614	.	.	.		0.711	HEATR6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449165.1	NM_022070	Intron
PTPRM	5797	hgsc.bcm.edu	37	18	8088802	8088802	+	Silent	SNP	C	C	T			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr18:8088802C>T	ENST00000332175.8	+	11	2846	c.1809C>T	c.(1807-1809)acC>acT	p.T603T	PTPRM_ENST00000400060.4_Silent_p.T603T|PTPRM_ENST00000400053.4_Silent_p.T541T|PTPRM_ENST00000580170.1_Silent_p.T603T|PTPRM_ENST00000444013.1_Silent_p.T390T|PTPRM_ENST00000578571.1_3'UTR	NM_002845.3	NP_002836.3	P28827	PTPRM_HUMAN	protein tyrosine phosphatase, receptor type, M	603	Fibronectin type-III 4. {ECO:0000255|PROSITE-ProRule:PRU00316}.				homophilic cell adhesion (GO:0007156)|negative regulation of angiogenesis (GO:0016525)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of endothelial cell proliferation (GO:0001937)|neuron projection development (GO:0031175)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of vasodilation (GO:0045909)|protein dephosphorylation (GO:0006470)|response to drug (GO:0042493)|retina layer formation (GO:0010842)|retinal ganglion cell axon guidance (GO:0031290)|signal transduction (GO:0007165)	cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|perinuclear region of cytoplasm (GO:0048471)	cadherin binding (GO:0045296)|identical protein binding (GO:0042802)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)	p.T603T(1)		breast(3)|central_nervous_system(1)|cervix(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(32)|lung(25)|ovary(2)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	90		Colorectal(10;0.234)				CTGACAATACCGTGACAGTCA	0.463																																					p.T603T		Atlas-SNP	.											PTPRM,NS,carcinoma,0,1	PTPRM	185	.	1	Substitution - coding silent(1)	breast(1)	c.C1809T						.						123.0	108.0	113.0					18																	8088802		2203	4300	6503	SO:0001819	synonymous_variant	5797	exon11			CAATACCGTGACA	X58288	CCDS11840.1, CCDS58613.1	18p11.2	2013-02-11			ENSG00000173482	ENSG00000173482		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	9675	protein-coding gene	gene with protein product		176888		PTPRL1		1655529, 8404049	Standard	NM_002845		Approved	RPTPU, hR-PTPu	uc010dkv.3	P28827	OTTHUMG00000131575	ENST00000332175.8:c.1809C>T	chr18.hg19:g.8088802C>T		123.0	1.0		67.0	29.0	NM_001105244	A7MBN1|D3DUH8|J3QL11	Silent	SNP	ENST00000332175.8	hg19	CCDS11840.1																																																																																			.	.		0.463	PTPRM-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000254456.1		
DYM	54808	hgsc.bcm.edu	37	18	46860102	46860102	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr18:46860102G>A	ENST00000269445.6	-	7	1073	c.616C>T	c.(616-618)Cca>Tca	p.P206S	DYM_ENST00000442713.2_Intron|DYM_ENST00000578396.1_Missense_Mutation_p.P51S	NM_017653.3	NP_060123.3	Q7RTS9	DYM_HUMAN	dymeclin	206					bone development (GO:0060348)|Golgi organization (GO:0007030)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)	enzyme binding (GO:0019899)			NS(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(6)|skin(1)|upper_aerodigestive_tract(1)	18						ACATACCATGGACCTCGCATC	0.373																																					p.P206S		Atlas-SNP	.											.	DYM	52	.	0			c.C616T						.						103.0	99.0	100.0					18																	46860102		2203	4300	6503	SO:0001583	missense	54808	exon7			ACCATGGACCTCG	AK000078	CCDS11937.1	18q21.1	2008-03-12			ENSG00000141627	ENSG00000141627			21317	protein-coding gene	gene with protein product		607461					Standard	NM_017653		Approved	FLJ20071, DMC, SMC	uc002ldi.1	Q7RTS9	OTTHUMG00000132659	ENST00000269445.6:c.616C>T	chr18.hg19:g.46860102G>A	ENSP00000269445:p.Pro206Ser	80.0	0.0		80.0	12.0	NM_017653	A8K5I8|B2RCF9|B4DKI7|Q3ZTS8|Q6P2P5|Q8N2M0|Q9BVE9|Q9NPU7	Missense_Mutation	SNP	ENST00000269445.6	hg19	CCDS11937.1	.	.	.	.	.	.	.	.	.	.	G	12.64	1.997369	0.35226	.	.	ENSG00000141627	ENST00000269445	D	0.81499	-1.5	4.43	4.43	0.53597	.	0.260980	0.39475	N	0.001351	T	0.69949	0.3168	N	0.16790	0.44	0.44771	D	0.997773	B;B	0.10296	0.003;0.002	B;B	0.11329	0.006;0.006	T	0.66164	-0.5992	10	0.45353	T	0.12	.	18.0098	0.89219	0.0:0.0:1.0:0.0	.	28;206	Q9NXS9;Q7RTS9	.;DYM_HUMAN	S	206	ENSP00000269445:P206S	ENSP00000269445:P206S	P	-	1	0	DYM	45114100	1.000000	0.71417	0.999000	0.59377	0.670000	0.39368	6.997000	0.76270	2.424000	0.82194	0.454000	0.30748	CCA	.	.		0.373	DYM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255912.3	NM_017653	
GMIP	51291	hgsc.bcm.edu	37	19	19740822	19740822	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr19:19740822C>T	ENST00000203556.4	-	21	3000	c.2863G>A	c.(2863-2865)Gcc>Acc	p.A955T	LPAR2_ENST00000407877.3_5'Flank|LPAR2_ENST00000542587.1_5'Flank|LPAR2_ENST00000589311.1_5'Flank|GMIP_ENST00000445806.2_Missense_Mutation_p.A926T|GMIP_ENST00000587238.1_Missense_Mutation_p.A929T|LPAR2_ENST00000586703.1_5'Flank	NM_016573.2	NP_057657.2	Q9P107	GMIP_HUMAN	GEM interacting protein	955					intracellular signal transduction (GO:0035556)|negative regulation of Rho GTPase activity (GO:0034259)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|intracellular (GO:0005622)	metal ion binding (GO:0046872)|Rho GTPase activator activity (GO:0005100)			breast(1)|endometrium(6)|kidney(1)|large_intestine(2)|lung(9)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	24						CAGCAGGTGGCCCTGGGCACA	0.627																																					p.A955T		Atlas-SNP	.											.	GMIP	55	.	0			c.G2863A						.						17.0	17.0	17.0					19																	19740822		2203	4300	6503	SO:0001583	missense	51291	exon21			AGGTGGCCCTGGG	AF132541	CCDS12408.1, CCDS74318.1	19p13.11	2011-09-07				ENSG00000089639		"""Rho GTPase activating proteins"""	24852	protein-coding gene	gene with protein product		609694				12093360, 16086184	Standard	XM_005259927		Approved	ARHGAP46	uc002nnd.3	Q9P107		ENST00000203556.4:c.2863G>A	chr19.hg19:g.19740822C>T	ENSP00000203556:p.Ala955Thr	90.0	0.0		182.0	38.0	NM_016573	A0AVN9|B7ZLZ0	Missense_Mutation	SNP	ENST00000203556.4	hg19	CCDS12408.1	.	.	.	.	.	.	.	.	.	.	C	15.54	2.863421	0.51482	.	.	ENSG00000089639	ENST00000203556;ENST00000445806	T;T	0.21543	2.0;2.0	5.11	-1.89	0.07689	.	0.424132	0.17523	N	0.171189	T	0.09158	0.0226	N	0.17082	0.46	0.09310	N	1	B;B;B	0.06786	0.001;0.001;0.001	B;B;B	0.04013	0.001;0.001;0.001	T	0.40308	-0.9570	10	0.08179	T	0.78	-7.6898	9.0822	0.36558	0.0:0.4364:0.0:0.5636	.	926;929;955	E7ERB7;B7ZLZ0;Q9P107	.;.;GMIP_HUMAN	T	955;926	ENSP00000203556:A955T;ENSP00000397075:A926T	ENSP00000203556:A955T	A	-	1	0	GMIP	19601822	0.000000	0.05858	0.006000	0.13384	0.922000	0.55478	-0.356000	0.07661	-0.126000	0.11682	0.561000	0.74099	GCC	.	.		0.627	GMIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460551.1	NM_016573	
ZNF681	148213	hgsc.bcm.edu	37	19	23927076	23927076	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr19:23927076T>C	ENST00000402377.3	-	4	1417	c.1276A>G	c.(1276-1278)Aaa>Gaa	p.K426E	ZNF681_ENST00000395385.3_Missense_Mutation_p.K357E	NM_138286.2	NP_612143.2	Q96N22	ZN681_HUMAN	zinc finger protein 681	426					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(10)|prostate(1)|skin(1)|urinary_tract(3)	21		all_lung(12;0.11)|Lung NSC(12;0.163)|all_epithelial(12;0.206)				TTGCCACATTTTTCACACTGG	0.378																																					p.K426E		Atlas-SNP	.											.	ZNF681	76	.	0			c.A1276G						.						74.0	78.0	77.0					19																	23927076		2203	4300	6503	SO:0001583	missense	148213	exon4			CACATTTTTCACA	AK056088	CCDS12414.2	19p12	2013-01-08			ENSG00000196172	ENSG00000196172		"""Zinc fingers, C2H2-type"", ""-"""	26457	protein-coding gene	gene with protein product	"""hypothetical protein FLJ31526"""						Standard	NM_138286		Approved	FLJ31526	uc002nrk.4	Q96N22	OTTHUMG00000150831	ENST00000402377.3:c.1276A>G	chr19.hg19:g.23927076T>C	ENSP00000384000:p.Lys426Glu	161.0	0.0		134.0	47.0	NM_138286	B3KVF7	Missense_Mutation	SNP	ENST00000402377.3	hg19	CCDS12414.2	.	.	.	.	.	.	.	.	.	.	.	0.001	-3.293486	0.00019	.	.	ENSG00000196172	ENST00000402377;ENST00000395385	T;T	0.07444	3.19;3.19	1.51	-3.01	0.05463	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.01730	0.0055	N	0.00894	-1.105	0.09310	N	1	B	0.14805	0.011	B	0.08055	0.003	T	0.45731	-0.9241	9	0.02654	T	1	.	4.3373	0.11092	0.0:0.5774:0.2273:0.1952	.	426	Q96N22	ZN681_HUMAN	E	426;357	ENSP00000384000:K426E;ENSP00000378783:K357E	ENSP00000378783:K357E	K	-	1	0	ZNF681	23718916	0.000000	0.05858	0.262000	0.24481	0.016000	0.09150	-1.519000	0.02243	-0.127000	0.11661	-0.736000	0.03550	AAA	.	.		0.378	ZNF681-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320248.2	NM_138286	
KMT2B	9757	hgsc.bcm.edu	37	19	36214013	36214013	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr19:36214013C>A	ENST00000222270.7	+	6	2839	c.2839C>A	c.(2839-2841)Cac>Aac	p.H947N	KMT2B_ENST00000607650.1_RNA|KMT2B_ENST00000420124.1_Missense_Mutation_p.H947N	NM_014727.1	NP_055542.1	Q9UMN6	KMT2B_HUMAN	lysine (K)-specific methyltransferase 2B	947					chromatin-mediated maintenance of transcription (GO:0048096)|gene silencing (GO:0016458)|histone H3-K4 methylation (GO:0051568)|histone H3-K4 trimethylation (GO:0080182)|oocyte differentiation (GO:0009994)|ovarian follicle development (GO:0001541)|ovulation (GO:0030728)|regulation of histone H3-K4 methylation (GO:0051569)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)										GACCCTGGCCCACACACCCCG	0.662																																					p.H947N		Atlas-SNP	.											.	MLL4	229	.	0			c.C2839A						.						42.0	52.0	49.0					19																	36214013		2097	4211	6308	SO:0001583	missense	8085	exon6			CTGGCCCACACAC	AJ007041	CCDS46055.1	19q13.1	2014-02-18			ENSG00000105663	ENSG00000272333		"""Chromatin-modifying enzymes / K-methyltransferases"""	15840	protein-coding gene	gene with protein product	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila) 4"""	606834				10409430, 10637508	Standard	XM_006723513		Approved	KIAA0304, MLL2, TRX2, HRX2, WBP7, MLL1B, MLL4		Q9UMN6	OTTHUMG00000048119	ENST00000222270.7:c.2839C>A	chr19.hg19:g.36214013C>A	ENSP00000222270:p.His947Asn	35.0	0.0		46.0	7.0	NM_014727	O15022|O95836|Q96GP2|Q96IP3|Q9UK25|Q9Y668|Q9Y669	Missense_Mutation	SNP	ENST00000222270.7	hg19	CCDS46055.1	.	.	.	.	.	.	.	.	.	.	C	11.71	1.718681	0.30503	.	.	ENSG00000105663	ENST00000222270;ENST00000420124	D;D	0.83075	-1.68;-1.68	5.82	4.73	0.59995	.	0.337529	0.21381	N	0.075480	T	0.74703	0.3751	L	0.36672	1.1	0.26207	N	0.979354	B	0.23735	0.09	B	0.18871	0.023	T	0.62909	-0.6754	10	0.32370	T	0.25	.	12.9635	0.58472	0.1618:0.8382:0.0:0.0	.	947	Q9UMN6	MLL4_HUMAN	N	947	ENSP00000222270:H947N;ENSP00000398837:H947N	ENSP00000222270:H947N	H	+	1	0	AD000671.1	40905853	0.006000	0.16342	0.998000	0.56505	0.963000	0.63663	0.956000	0.29202	2.757000	0.94681	0.655000	0.94253	CAC	.	.		0.662	KMT2B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_014727	
TGFB1	7040	hgsc.bcm.edu	37	19	41850671	41850671	+	Silent	SNP	C	C	A			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr19:41850671C>A	ENST00000221930.5	-	3	1481	c.615G>T	c.(613-615)cgG>cgT	p.R205R		NM_000660.4	NP_000651.3	P01137	TGFB1_HUMAN	transforming growth factor, beta 1	205	Arm domain. {ECO:0000250}.				active induction of host immune response by virus (GO:0046732)|adaptive immune response based on somatic recombination of immune receptors built from immunoglobulin superfamily domains (GO:0002460)|aging (GO:0007568)|ATP biosynthetic process (GO:0006754)|blood coagulation (GO:0007596)|branch elongation involved in mammary gland duct branching (GO:0060751)|cell cycle arrest (GO:0007050)|cell growth (GO:0016049)|cell-cell junction organization (GO:0045216)|cellular calcium ion homeostasis (GO:0006874)|cellular response to dexamethasone stimulus (GO:0071549)|cellular response to organic cyclic compound (GO:0071407)|cellular response to transforming growth factor beta stimulus (GO:0071560)|chondrocyte differentiation (GO:0002062)|common-partner SMAD protein phosphorylation (GO:0007182)|connective tissue replacement involved in inflammatory response wound healing (GO:0002248)|defense response to fungus, incompatible interaction (GO:0009817)|digestive tract development (GO:0048565)|embryo development (GO:0009790)|endoderm development (GO:0007492)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial to mesenchymal transition (GO:0001837)|evasion or tolerance of host defenses by virus (GO:0019049)|extracellular matrix assembly (GO:0085029)|extracellular matrix organization (GO:0030198)|extrinsic apoptotic signaling pathway (GO:0097191)|face morphogenesis (GO:0060325)|female pregnancy (GO:0007565)|frontal suture morphogenesis (GO:0060364)|germ cell migration (GO:0008354)|hematopoietic progenitor cell differentiation (GO:0002244)|hyaluronan catabolic process (GO:0030214)|inflammatory response (GO:0006954)|inner ear development (GO:0048839)|lens fiber cell differentiation (GO:0070306)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|lymph node development (GO:0048535)|macrophage derived foam cell differentiation (GO:0010742)|mammary gland branching involved in thelarche (GO:0060744)|MAPK cascade (GO:0000165)|mitotic cell cycle checkpoint (GO:0007093)|modulation by virus of host morphology or physiology (GO:0019048)|mononuclear cell proliferation (GO:0032943)|myelination (GO:0042552)|myeloid dendritic cell differentiation (GO:0043011)|negative regulation of blood vessel endothelial cell migration (GO:0043537)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of DNA replication (GO:0008156)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of extracellular matrix disassembly (GO:0010716)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of gene expression (GO:0010629)|negative regulation of hyaluronan biosynthetic process (GO:1900126)|negative regulation of immune response (GO:0050777)|negative regulation of macrophage cytokine production (GO:0010936)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of ossification (GO:0030279)|negative regulation of phagocytosis (GO:0050765)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of release of sequestered calcium ion into cytosol (GO:0051280)|negative regulation of skeletal muscle tissue development (GO:0048642)|negative regulation of T cell proliferation (GO:0042130)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|organ regeneration (GO:0031100)|ossification involved in bone remodeling (GO:0043932)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|phosphate-containing compound metabolic process (GO:0006796)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of apoptotic process (GO:0043065)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of bone mineralization (GO:0030501)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cellular protein metabolic process (GO:0032270)|positive regulation of chemotaxis (GO:0050921)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of exit from mitosis (GO:0031536)|positive regulation of extracellular matrix assembly (GO:1901203)|positive regulation of fibroblast migration (GO:0010763)|positive regulation of gene expression (GO:0010628)|positive regulation of histone acetylation (GO:0035066)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of interleukin-17 production (GO:0032740)|positive regulation of isotype switching to IgA isotypes (GO:0048298)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NAD+ ADP-ribosyltransferase activity (GO:1901666)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of odontogenesis (GO:0042482)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of protein complex assembly (GO:0031334)|positive regulation of protein dephosphorylation (GO:0035307)|positive regulation of protein import into nucleus (GO:0042307)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein localization to nucleus (GO:1900182)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein secretion (GO:0050714)|positive regulation of SMAD protein import into nucleus (GO:0060391)|positive regulation of smooth muscle cell differentiation (GO:0051152)|positive regulation of superoxide anion generation (GO:0032930)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription regulatory region DNA binding (GO:2000679)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation vascular endothelial growth factor production (GO:0010575)|protein export from nucleus (GO:0006611)|protein import into nucleus, translocation (GO:0000060)|protein kinase B signaling (GO:0043491)|protein phosphorylation (GO:0006468)|receptor catabolic process (GO:0032801)|regulation of actin cytoskeleton reorganization (GO:2000249)|regulation of binding (GO:0051098)|regulation of blood vessel remodeling (GO:0060312)|regulation of branching involved in mammary gland duct morphogenesis (GO:0060762)|regulation of cartilage development (GO:0061035)|regulation of cell migration (GO:0030334)|regulation of DNA binding (GO:0051101)|regulation of miRNA metabolic process (GO:2000628)|regulation of protein import into nucleus (GO:0042306)|regulation of sodium ion transport (GO:0002028)|regulation of striated muscle tissue development (GO:0016202)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|regulatory T cell differentiation (GO:0045066)|response to cholesterol (GO:0070723)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to glucose (GO:0009749)|response to hypoxia (GO:0001666)|response to laminar fluid shear stress (GO:0034616)|response to progesterone (GO:0032570)|response to radiation (GO:0009314)|response to vitamin D (GO:0033280)|response to wounding (GO:0009611)|salivary gland morphogenesis (GO:0007435)|SMAD protein complex assembly (GO:0007183)|SMAD protein import into nucleus (GO:0007184)|T cell homeostasis (GO:0043029)|tolerance induction to self antigen (GO:0002513)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ureteric bud development (GO:0001657)|viral life cycle (GO:0019058)	axon (GO:0030424)|blood microparticle (GO:0072562)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)|proteinaceous extracellular matrix (GO:0005578)	antigen binding (GO:0003823)|cytokine activity (GO:0005125)|enzyme binding (GO:0019899)|glycoprotein binding (GO:0001948)|type II transforming growth factor beta receptor binding (GO:0005114)			endometrium(1)|large_intestine(2)|lung(4)|skin(1)	8					Hyaluronidase(DB00070)	TCAACCACTGCCGCACAACTC	0.557																																					p.R205R		Atlas-SNP	.											.	TGFB1	27	.	0			c.G615T						.						117.0	81.0	93.0					19																	41850671		2203	4300	6503	SO:0001819	synonymous_variant	7040	exon3			CCACTGCCGCACA	X02812	CCDS33031.1	19q13.1	2014-01-30	2007-02-16			ENSG00000105329		"""Endogenous ligands"""	11766	protein-coding gene	gene with protein product	"""Camurati-Engelmann disease"", ""prepro-transforming growth factor beta-1"""	190180		TGFB, DPD1		10631145, 10843814	Standard	NM_000660		Approved	CED, TGFbeta	uc002oqh.2	P01137		ENST00000221930.5:c.615G>T	chr19.hg19:g.41850671C>A		57.0	0.0		71.0	19.0	NM_000660	A8K792|Q9UCG4	Silent	SNP	ENST00000221930.5	hg19	CCDS33031.1																																																																																			.	.		0.557	TGFB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463500.2		
GIPR	2696	hgsc.bcm.edu	37	19	46185002	46185002	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr19:46185002C>A	ENST00000590918.1	+	14	1309	c.1210C>A	c.(1210-1212)Cgc>Agc	p.R404S	GIPR_ENST00000304207.8_Missense_Mutation_p.R368S|GIPR_ENST00000263281.3_3'UTR	NM_000164.2	NP_000155.1	P48546	GIPR_HUMAN	gastric inhibitory polypeptide receptor	404					activation of adenylate cyclase activity (GO:0007190)|cell surface receptor signaling pathway (GO:0007166)|desensitization of G-protein coupled receptor protein signaling pathway (GO:0002029)|endocrine pancreas development (GO:0031018)|generation of precursor metabolites and energy (GO:0006091)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of insulin secretion (GO:0032024)|response to axon injury (GO:0048678)|response to calcium ion (GO:0051592)|response to fatty acid (GO:0070542)|response to glucose (GO:0009749)|response to nutrient (GO:0007584)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	gastric inhibitory peptide receptor activity (GO:0016519)|peptide hormone binding (GO:0017046)|transmembrane signaling receptor activity (GO:0004888)			endometrium(1)|kidney(2)|lung(5)|prostate(1)|skin(2)|urinary_tract(1)	12		Ovarian(192;0.051)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.0056)|GBM - Glioblastoma multiforme(486;0.0832)|Epithelial(262;0.199)		GTCGGAGATCCGCCGTGGCTG	0.771																																					p.R404S		Atlas-SNP	.											.	GIPR	36	.	0			c.C1210A						.						8.0	11.0	10.0					19																	46185002		2118	4158	6276	SO:0001583	missense	2696	exon14			GAGATCCGCCGTG		CCDS12671.1	19q13.2-q13.3	2012-08-10				ENSG00000010310		"""GPCR / Class B : Glucagon receptors"""	4271	protein-coding gene	gene with protein product		137241				7490109	Standard	NM_000164		Approved		uc002pcu.1	P48546		ENST00000590918.1:c.1210C>A	chr19.hg19:g.46185002C>A	ENSP00000467494:p.Arg404Ser	3.0	0.0		22.0	11.0	NM_000164	B7WP14|B7ZKQ0|Q14401|Q16400|Q52M04|Q9UPI1	Missense_Mutation	SNP	ENST00000590918.1	hg19	CCDS12671.1	.	.	.	.	.	.	.	.	.	.	C	26.8	4.774468	0.90108	.	.	ENSG00000010310	ENST00000263281;ENST00000304207	T	0.65178	-0.14	5.2	5.2	0.72013	.	0.155416	0.31909	N	0.006861	T	0.63058	0.2479	M	0.62723	1.935	0.41404	D	0.987691	P;D	0.54601	0.943;0.967	B;P	0.45138	0.343;0.471	T	0.68247	-0.5459	10	0.56958	D	0.05	.	14.0841	0.64944	0.0:1.0:0.0:0.0	.	368;404	B7WP14;P48546	.;GIPR_HUMAN	S	404;368	ENSP00000305321:R368S	ENSP00000263281:R404S	R	+	1	0	GIPR	50876842	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	5.304000	0.65744	2.705000	0.92388	0.561000	0.74099	CGC	.	.		0.771	GIPR-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000459640.1		
ZNF677	342926	hgsc.bcm.edu	37	19	53747099	53747099	+	Missense_Mutation	SNP	C	C	G			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr19:53747099C>G	ENST00000598513.1	-	4	217	c.67G>C	c.(67-69)Gag>Cag	p.E23Q	ZNF677_ENST00000599012.1_Missense_Mutation_p.E23Q|ZNF677_ENST00000594681.1_Missense_Mutation_p.E23Q|ZNF677_ENST00000601828.1_Missense_Mutation_p.E23Q|ZNF677_ENST00000601413.1_Missense_Mutation_p.E23Q|ZNF677_ENST00000333952.4_Missense_Mutation_p.E23Q|ZNF677_ENST00000598806.1_Missense_Mutation_p.E23Q|CTD-2245F17.6_ENST00000596041.1_RNA	NM_182609.2	NP_872415.1	Q86XU0	ZN677_HUMAN	zinc finger protein 677	23	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(13)|lung(6)|ovary(1)|pancreas(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	36				GBM - Glioblastoma multiforme(134;0.00352)		TCCAGGCACTCCCACTCCTCT	0.468																																					p.E23Q		Atlas-SNP	.											.	ZNF677	94	.	0			c.G67C						.						101.0	94.0	97.0					19																	53747099		2203	4300	6503	SO:0001583	missense	342926	exon4			GGCACTCCCACTC	BC050038	CCDS12861.1	19q13.42	2013-01-08				ENSG00000197928		"""Zinc fingers, C2H2-type"", ""-"""	28730	protein-coding gene	gene with protein product	"""hypothetical protein MGC48625"""					12477932	Standard	NM_182609		Approved	MGC48625	uc002qbg.1	Q86XU0		ENST00000598513.1:c.67G>C	chr19.hg19:g.53747099C>G	ENSP00000469391:p.Glu23Gln	153.0	0.0		134.0	45.0	NM_182609		Missense_Mutation	SNP	ENST00000598513.1	hg19	CCDS12861.1	.	.	.	.	.	.	.	.	.	.	C	15.80	2.941521	0.53079	.	.	ENSG00000197928	ENST00000416063;ENST00000333952	T	0.01918	4.56	2.02	2.02	0.26589	Krueppel-associated box (4);	0.225060	0.22744	N	0.056176	T	0.07052	0.0179	L	0.53780	1.695	0.25115	N	0.990686	D	0.76494	0.999	D	0.87578	0.998	T	0.26710	-1.0095	10	0.21014	T	0.42	.	10.0974	0.42484	0.0:1.0:0.0:0.0	.	23	Q86XU0	ZN677_HUMAN	Q	23	ENSP00000334394:E23Q	ENSP00000334394:E23Q	E	-	1	0	ZNF677	58438911	0.169000	0.23002	0.941000	0.38009	0.871000	0.50021	0.249000	0.18216	1.449000	0.47699	0.561000	0.74099	GAG	.	.		0.468	ZNF677-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464189.1	NM_182609	
PCNT	5116	hgsc.bcm.edu	37	21	47850032	47850032	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr21:47850032C>T	ENST00000359568.5	+	36	7906	c.7799C>T	c.(7798-7800)gCg>gTg	p.A2600V	PCNT_ENST00000480896.1_3'UTR	NM_006031.5	NP_006022.3	O95613	PCNT_HUMAN	pericentrin	2600					brain morphogenesis (GO:0048854)|cerebellar cortex morphogenesis (GO:0021696)|cilium assembly (GO:0042384)|G2/M transition of mitotic cell cycle (GO:0000086)|in utero embryonic development (GO:0001701)|limb morphogenesis (GO:0035108)|microtubule cytoskeleton organization (GO:0000226)|mitotic cell cycle (GO:0000278)|multicellular organism growth (GO:0035264)|negative regulation of apoptotic process (GO:0043066)|neural precursor cell proliferation (GO:0061351)|neuron migration (GO:0001764)|olfactory bulb development (GO:0021772)|positive regulation of intracellular protein transport (GO:0090316)|spindle organization (GO:0007051)	centriolar satellite (GO:0034451)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intercellular bridge (GO:0045171)|membrane (GO:0016020)|microtubule (GO:0005874)|motile cilium (GO:0031514)|pericentriolar material (GO:0000242)				NS(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(15)|liver(2)|lung(41)|ovary(5)|pancreas(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	104	Breast(49;0.112)					AAGCTCCTGGCGGCGGAGCAG	0.562																																					p.A2600V		Atlas-SNP	.											.	PCNT	283	.	0			c.C7799T						.						101.0	95.0	97.0					21																	47850032		2203	4300	6503	SO:0001583	missense	5116	exon36			TCCTGGCGGCGGA	AB007862	CCDS33592.1	21q22.3	2014-02-20	2008-01-30	2005-11-03	ENSG00000160299	ENSG00000160299			16068	protein-coding gene	gene with protein product	"""kendrin"", ""Seckel syndrome 4"""	605925	"""pericentrin 2 (kendrin)"""	PCNT2		8812505, 9455477	Standard	NM_006031		Approved	KEN, KIAA0402, PCN, PCNTB, SCKL4	uc002zji.4	O95613	OTTHUMG00000090665	ENST00000359568.5:c.7799C>T	chr21.hg19:g.47850032C>T	ENSP00000352572:p.Ala2600Val	166.0	0.0		315.0	55.0	NM_006031	O43152|Q7Z7C9	Missense_Mutation	SNP	ENST00000359568.5	hg19	CCDS33592.1	.	.	.	.	.	.	.	.	.	.	C	0.014	-1.589419	0.00864	.	.	ENSG00000160299	ENST00000359568	T	0.01464	4.86	4.32	-2.5	0.06384	.	.	.	.	.	T	0.00724	0.0024	N	0.01576	-0.805	0.09310	N	1	B;B	0.17852	0.006;0.024	B;B	0.08055	0.003;0.003	T	0.47983	-0.9074	9	0.17832	T	0.49	.	6.886	0.24199	0.0:0.3494:0.1207:0.5299	.	2482;2600	O95613-2;O95613	.;PCNT_HUMAN	V	2600	ENSP00000352572:A2600V	ENSP00000352572:A2600V	A	+	2	0	PCNT	46674460	0.003000	0.15002	0.023000	0.16930	0.207000	0.24258	0.099000	0.15210	-0.578000	0.05959	0.462000	0.41574	GCG	.	.		0.562	PCNT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207336.1	NM_006031	
TRIOBP	11078	hgsc.bcm.edu	37	22	38119347	38119347	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr22:38119347G>A	ENST00000406386.3	+	7	1039	c.784G>A	c.(784-786)Gcc>Acc	p.A262T		NM_001039141.2	NP_001034230.1	Q9H2D6	TARA_HUMAN	TRIO and F-actin binding protein	262					actin modification (GO:0030047)|barbed-end actin filament capping (GO:0051016)|mitotic nuclear division (GO:0007067)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	actin filament binding (GO:0051015)|GTP-Rho binding (GO:0017049)|myosin II binding (GO:0045159)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	12	Melanoma(58;0.0574)					GGCTTCTCCTGCCCAAAGGGA	0.607																																					p.A262T		Atlas-SNP	.											.	TRIOBP	262	.	0			c.G784A						.						70.0	81.0	77.0					22																	38119347		2122	4238	6360	SO:0001583	missense	11078	exon7			TCTCCTGCCCAAA	AB051449	CCDS33644.1, CCDS43015.1, CCDS43016.1	22q13.1	2014-06-03			ENSG00000100106	ENSG00000100106		"""Pleckstrin homology (PH) domain containing"""	17009	protein-coding gene	gene with protein product		609761		DFNB28		11148140, 16385457, 16385458	Standard	NM_001039141		Approved	HRIHFB2122, KIAA1662, Tara, TAP68	uc003atr.3	Q9H2D6	OTTHUMG00000150657	ENST00000406386.3:c.784G>A	chr22.hg19:g.38119347G>A	ENSP00000384312:p.Ala262Thr	62.0	0.0		122.0	30.0	NM_001039141	B1AHD4|B1AHD7|F2Z2W0|F8W6V6|O94797|Q2PZW8|Q2Q3Z9|Q2Q400|Q5R3M6|Q96DW1|Q9BT77|Q9BTL7|Q9BY98|Q9Y3L4	Missense_Mutation	SNP	ENST00000406386.3	hg19	CCDS43015.1	.	.	.	.	.	.	.	.	.	.	G	13.50	2.255830	0.39896	.	.	ENSG00000100106	ENST00000406386;ENST00000417174	T	0.27720	1.65	3.91	-2.33	0.06724	.	.	.	.	.	T	0.13200	0.0320	N	0.08118	0	0.18873	N	0.999984	B	0.18013	0.025	B	0.13407	0.009	T	0.27088	-1.0084	9	0.33141	T	0.24	.	6.9194	0.24378	0.1743:0.4047:0.421:0.0	.	262	Q9H2D6	TARA_HUMAN	T	262	ENSP00000384312:A262T	ENSP00000384312:A262T	A	+	1	0	TRIOBP	36449293	0.000000	0.05858	0.510000	0.27712	0.006000	0.05464	0.005000	0.13129	-0.146000	0.11274	-0.370000	0.07254	GCC	.	.		0.607	TRIOBP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000319439.2		
PAGE2	203569	hgsc.bcm.edu	37	X	55117891	55117891	+	Splice_Site	SNP	G	G	A			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chrX:55117891G>A	ENST00000374968.4	+	4	423		c.e4+1		PAGE2_ENST00000374965.1_Splice_Site	NM_207339.2	NP_997222.1	Q7Z2X7	PAGE2_HUMAN	P antigen family, member 2 (prostate associated)											endometrium(1)|large_intestine(2)|lung(1)|ovary(2)	6						CTGGAAGCAGGTTTGTTATTC	0.383																																					.		Atlas-SNP	.											.	PAGE2	26	.	0			c.319+1G>A						.						94.0	108.0	104.0					X																	55117891		2172	4296	6468	SO:0001630	splice_region_variant	203569	exon4			AAGCAGGTTTGTT	BC054022	CCDS14367.1	Xp11.22	2009-06-17			ENSG00000234068	ENSG00000234068			31804	protein-coding gene	gene with protein product		300738	"""G antigen, family C, 2"""	GAGEC2		9724777	Standard	NM_207339		Approved	MGC62094, PAGE-2, CT16.4		Q7Z2X7	OTTHUMG00000021648	ENST00000374968.4:c.319+1G>A	chrX.hg19:g.55117891G>A		321.0	0.0		334.0	104.0	NM_207339	Q5JRK7|Q5JRK8	Splice_Site	SNP	ENST00000374968.4	hg19	CCDS14367.1	.	.	.	.	.	.	.	.	.	.	g	2.931	-0.221059	0.06061	.	.	ENSG00000234068	ENST00000374968;ENST00000374965	.	.	.	1.13	1.13	0.20643	.	.	.	.	.	.	.	.	.	.	.	0.21473	N	0.999673	.	.	.	.	.	.	.	.	.	.	.	.	.	.	5.3082	0.15815	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	PAGE2	55134616	0.973000	0.33851	0.014000	0.15608	0.012000	0.07955	1.535000	0.36061	0.862000	0.35528	0.287000	0.19450	.	.	.		0.383	PAGE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056857.1	NM_207339	Intron
NAP1L3	4675	hgsc.bcm.edu	37	X	92927476	92927476	+	Silent	SNP	T	T	A			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chrX:92927476T>A	ENST00000373079.3	-	1	1091	c.828A>T	c.(826-828)gcA>gcT	p.A276A	FAM133A_ENST00000538690.1_5'Flank|FAM133A_ENST00000322139.4_5'Flank|FAM133A_ENST00000355813.5_5'Flank|NAP1L3_ENST00000475430.2_Silent_p.A269A|FAM133A_ENST00000332647.4_5'Flank	NM_004538.5	NP_004529.2	Q99457	NP1L3_HUMAN	nucleosome assembly protein 1-like 3	276					nucleosome assembly (GO:0006334)	nucleus (GO:0005634)		p.A276A(1)		haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(16)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	34						TCTCTCTTACTGCAGCCCTTG	0.448																																					p.A276A		Atlas-SNP	.											.	NAP1L3	81	.	1	Substitution - coding silent(1)	lung(1)	c.A828T						.						116.0	108.0	111.0					X																	92927476		2203	4300	6503	SO:0001819	synonymous_variant	4675	exon1			TCTTACTGCAGCC		CCDS14465.1	Xq21.3-q22	2008-08-01			ENSG00000186310	ENSG00000186310			7639	protein-coding gene	gene with protein product		300117				8976385	Standard	NM_004538		Approved	MB20, NPL3, MGC26312	uc004efq.3	Q99457	OTTHUMG00000021974	ENST00000373079.3:c.828A>T	chrX.hg19:g.92927476T>A		133.0	0.0		231.0	166.0	NM_004538	B2RCM0|O60788	Silent	SNP	ENST00000373079.3	hg19	CCDS14465.1																																																																																			.	.		0.448	NAP1L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057449.1	NM_004538	
PIGS	94005	hgsc.bcm.edu	37	17	26898507	26898508	+	Frame_Shift_Ins	INS	-	-	C			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr17:26898507_26898508insC	ENST00000308360.7	-	1	382_383	c.7_8insG	c.(7-9)gccfs	p.A3fs	PIGS_ENST00000395346.2_5'UTR|RP11-192H23.5_ENST00000585189.1_RNA|PIGS_ENST00000543734.1_5'UTR	NM_033198.3	NP_149975.1	Q96S52	PIGS_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class S	3					attachment of GPI anchor to protein (GO:0016255)|C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)	endoplasmic reticulum membrane (GO:0005789)|GPI-anchor transamidase complex (GO:0042765)|membrane (GO:0016020)	GPI-anchor transamidase activity (GO:0003923)			breast(3)|endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	16	Lung NSC(42;0.00431)					AGCCCCGGCGGCCGCCATGCTA	0.688																																					p.A3fs		Atlas-INDEL	.											.	PIGS	42	.	0			c.8_9insG						.																																			SO:0001589	frameshift_variant	94005	exon1			.		CCDS11235.1	17p13.2	2013-02-26	2006-06-28		ENSG00000087111	ENSG00000087111		"""Phosphatidylinositol glycan anchor biosynthesis"""	14937	protein-coding gene	gene with protein product	"""GPI transamidase subunit"""	610271	"""phosphatidylinositol glycan, class S"""				Standard	NM_033198		Approved		uc002hbo.2	Q96S52	OTTHUMG00000132604	ENST00000308360.7:c.8dupG	chr17.hg19:g.26898509_26898509dupC	ENSP00000309430:p.Ala3fs	90.0	0.0		215.0	19.0	NM_033198	Q6UVX6	Frame_Shift_Ins	INS	ENST00000308360.7	hg19	CCDS11235.1																																																																																			.	.		0.688	PIGS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255833.3	NM_033198	
TFCP2L1	29842	hgsc.bcm.edu	37	2	121989435	121989436	+	Frame_Shift_Ins	INS	-	-	CC			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr2:121989435_121989436insCC	ENST00000263707.5	-	13	1404_1405	c.1307_1308insGG	c.(1306-1308)ggcfs	p.G436fs		NM_014553.2	NP_055368.1	Q9NZI6	TF2L1_HUMAN	transcription factor CP2-like 1	436					cell morphogenesis (GO:0000902)|cytoplasm organization (GO:0007028)|determination of adult lifespan (GO:0008340)|epithelial cell maturation (GO:0002070)|female pregnancy (GO:0007565)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of growth (GO:0045927)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|salivary gland development (GO:0007431)|steroid biosynthetic process (GO:0006694)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			cervix(1)|endometrium(4)|large_intestine(5)|lung(7)|ovary(1)|pancreas(2)|skin(1)|stomach(1)	22	Renal(3;0.01)					TGCCCGTGGGGCCCTGCCGGTA	0.634																																					p.G436fs		Atlas-INDEL	.											.,1	TFCP2L1	54	.	0			c.1308_1309insGG						.																																			SO:0001589	frameshift_variant	29842	exon13			.	AF198488	CCDS2134.1	2q14	2008-02-05			ENSG00000115112	ENSG00000115112			17925	protein-coding gene	gene with protein product		609785				10644752, 11073954	Standard	NM_014553		Approved	LBP-9, CRTR1	uc002tmx.3	Q9NZI6	OTTHUMG00000131443	ENST00000263707.5:c.1306_1307dupGG	chr2.hg19:g.121989436_121989437dupCC	ENSP00000263707:p.Gly436fs	53.0	0.0		145.0	14.0	NM_014553	Q4ZG43	Frame_Shift_Ins	INS	ENST00000263707.5	hg19	CCDS2134.1																																																																																			.	.		0.634	TFCP2L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338539.1	NM_014553	
COL22A1	169044	hgsc.bcm.edu	37	8	139895383	139895384	+	Frame_Shift_Ins	INS	-	-	C			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr8:139895383_139895384insC	ENST00000303045.6	-	2	478_479	c.32_33insG	c.(31-33)ggcfs	p.G11fs	COL22A1_ENST00000435777.1_Frame_Shift_Ins_p.G11fs	NM_152888.1	NP_690848.1	Q8NFW1	COMA1_HUMAN	collagen, type XXII, alpha 1	11					extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)		p.G11D(1)		breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(14)|large_intestine(29)|lung(107)|ovary(13)|pancreas(1)|prostate(3)|skin(12)|upper_aerodigestive_tract(15)|urinary_tract(4)	211	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0517)			TCCAGAGGAGGCCAGCCACAGC	0.663										HNSCC(7;0.00092)																											p.G11fs		Atlas-INDEL	.											.	COL22A1	390	.	1	Substitution - Missense(1)	endometrium(1)	c.33_34insG						.																																			SO:0001589	frameshift_variant	169044	exon2			.	AF406780	CCDS6376.1	8q24.3	2013-01-16			ENSG00000169436	ENSG00000169436		"""Collagens"""	22989	protein-coding gene	gene with protein product		610026					Standard	NM_152888		Approved		uc003yvd.3	Q8NFW1	OTTHUMG00000150035	ENST00000303045.6:c.33dupG	chr8.hg19:g.139895385_139895385dupC	ENSP00000303153:p.Gly11fs	25.0	0.0		107.0	15.0	NM_152888	B7ZMH0|C9K0G4|Q8IVT9	Frame_Shift_Ins	INS	ENST00000303045.6	hg19	CCDS6376.1																																																																																			.	.		0.663	COL22A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000315905.2	XM_291257	
CIITA	4261	hgsc.bcm.edu	37	16	11001148	11001149	+	Frame_Shift_Ins	INS	-	-	C			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr16:11001148_11001149insC	ENST00000324288.8	+	11	1932_1933	c.1799_1800insC	c.(1798-1803)gaccggfs	p.R601fs	CIITA_ENST00000381835.5_Intron|CIITA_ENST00000537380.1_Intron	NM_000246.3	NP_000237	P33076	C2TA_HUMAN	class II, major histocompatibility complex, transactivator	601	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.				aging (GO:0007568)|cellular response to electrical stimulus (GO:0071257)|cellular response to exogenous dsRNA (GO:0071360)|cytokine-mediated signaling pathway (GO:0019221)|immune response (GO:0006955)|inflammatory response (GO:0006954)|interferon-gamma-mediated signaling pathway (GO:0060333)|negative regulation of collagen biosynthetic process (GO:0032966)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of MHC class I biosynthetic process (GO:0045345)|positive regulation of MHC class II biosynthetic process (GO:0045348)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|response to antibiotic (GO:0046677)|response to interferon-gamma (GO:0034341)|transcription, DNA-templated (GO:0006351)	cell surface (GO:0009986)|nucleoplasm (GO:0005654)|PML body (GO:0016605)	activating transcription factor binding (GO:0033613)|ATP binding (GO:0005524)|GTP binding (GO:0005525)|kinase activity (GO:0016301)|protein C-terminus binding (GO:0008022)|protein complex binding (GO:0032403)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)|transferase activity, transferring acyl groups (GO:0016746)			central_nervous_system(1)|large_intestine(7)|ovary(1)|skin(1)|stomach(2)	12						CTCCTCCGGGACCGGCCACTTC	0.624			T	"""FLJ27352, CD274, CD273, RALGDS, RUNDC2A, C16orf75, BCL6"""	"""PMBL, Hodgkin Lymphona, """																																p.D600fs		Atlas-INDEL	.		Dom	yes		16	16p13	4261	"""class II, major histocompatibility complex, transactivator"""		L	.	CIITA	92	.	0			c.1799_1800insC						.																																			SO:0001589	frameshift_variant	4261	exon11			.	U18259	CCDS10544.1, CCDS66943.1, CCDS73826.1	16p13	2014-09-17	2005-08-12	2005-08-12	ENSG00000179583	ENSG00000179583		"""Nucleotide-binding domain and leucine rich repeat containing"""	7067	protein-coding gene	gene with protein product	"""NLR family, acid domain containing"", ""nucleotide-binding oligomerization domain, leucine rich repeat and acid domain containing"""	600005	"""MHC class II transactivator"""	MHC2TA		8402893	Standard	NM_000246		Approved	C2TA, NLRA	uc002dai.4	P33076	OTTHUMG00000129753	ENST00000324288.8:c.1801dupC	chr16.hg19:g.11001150_11001150dupC	ENSP00000316328:p.Arg601fs	108.0	0.0		171.0	12.0	NM_000246	A0N0N9|D3DUG0|E9PFE0|Q29675|Q8SNB8|Q96KL4	Frame_Shift_Ins	INS	ENST00000324288.8	hg19	CCDS10544.1																																																																																			.	.		0.624	CIITA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251966.2	NM_000246	
ZYX	7791	hgsc.bcm.edu	37	7	143080154	143080155	+	Frame_Shift_Ins	INS	-	-	C			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr7:143080154_143080155insC	ENST00000322764.5	+	5	1107_1108	c.762_763insC	c.(763-765)cccfs	p.P255fs	ZYX_ENST00000449423.2_Frame_Shift_Ins_p.P168fs|AC093673.5_ENST00000429630.1_RNA|ZYX_ENST00000477373.1_3'UTR|ZYX_ENST00000392910.2_Frame_Shift_Ins_p.P98fs	NM_001010972.1|NM_003461.4	NP_001010972.1|NP_003452.1	Q15942	ZYX_HUMAN	zyxin	255					cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|cell-matrix adhesion (GO:0007160)|integrin-mediated signaling pathway (GO:0007229)|regulation of inflammatory response (GO:0050727)|signal transduction (GO:0007165)|stress fiber assembly (GO:0043149)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|stress fiber (GO:0001725)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			breast(1)|endometrium(5)|kidney(1)|large_intestine(1)|lung(8)|pancreas(1)	17	Melanoma(164;0.205)					AGCCCCGAGGGCCCCCAGCCTC	0.599																																					p.G254fs		Atlas-INDEL	.											.	ZYX	46	.	0			c.762_763insC						.																																			SO:0001589	frameshift_variant	7791	exon5			.	X95735	CCDS5883.1	7q32	2010-02-26			ENSG00000159840	ENSG00000159840			13200	protein-coding gene	gene with protein product		602002				8917469, 8940160	Standard	XM_005250052		Approved		uc003wcx.3	Q15942	OTTHUMG00000023822	ENST00000322764.5:c.767dupC	chr7.hg19:g.143080159_143080159dupC	ENSP00000324422:p.Pro255fs	99.0	0.0		204.0	14.0	NM_003461	A4D2G6|Q6I9S4	Frame_Shift_Ins	INS	ENST00000322764.5	hg19	CCDS5883.1																																																																																			.	.		0.599	ZYX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000156296.2	NM_003461	
PTTG1IP	754	hgsc.bcm.edu	37	21	46281119	46281120	+	Frame_Shift_Ins	INS	-	-	A			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr21:46281119_46281120insA	ENST00000330938.3	-	3	455_456	c.235_236insT	c.(235-237)tccfs	p.S79fs	PTTG1IP_ENST00000445724.2_Intron|PTTG1IP_ENST00000397886.3_Frame_Shift_Ins_p.S58fs|PTTG1IP_ENST00000397887.3_Frame_Shift_Ins_p.S79fs|PTTG1IP_ENST00000494690.1_5'UTR	NM_004339.3	NP_004330.1	P53801	PTTG_HUMAN	pituitary tumor-transforming 1 interacting protein	79	PSI.				multicellular organismal development (GO:0007275)|protein import into nucleus (GO:0006606)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	receptor activity (GO:0004872)			ovary(1)|prostate(1)	2				Colorectal(79;0.0659)		TTTACAAAGGGAAGCCGGTGGC	0.431																																					p.S79fs		Atlas-INDEL	.											.	PTTG1IP	22	.	0			c.236_237insT						.																																			SO:0001589	frameshift_variant	754	exon3			.	AF149785	CCDS13715.1, CCDS68221.1	21q22.3	2008-07-04			ENSG00000183255	ENSG00000183255			13524	protein-coding gene	gene with protein product		603784		C21orf3, C21orf1		9570958, 10830953	Standard	NM_004339		Approved	PBF	uc002zgb.2	P53801	OTTHUMG00000090254	ENST00000330938.3:c.236dupT	chr21.hg19:g.46281121_46281121dupA	ENSP00000328325:p.Ser79fs	99.0	0.0		182.0	17.0	NM_004339	B2RDP7|D3DSL9|Q9NS09	Frame_Shift_Ins	INS	ENST00000330938.3	hg19	CCDS13715.1																																																																																			.	.		0.431	PTTG1IP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206553.1		
CTCFL	140690	hgsc.bcm.edu	37	20	56098886	56098887	+	Frame_Shift_Ins	INS	-	-	C			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr20:56098886_56098887insC	ENST00000608263.1	-	1	1036_1037	c.375_376insG	c.(373-378)gggcccfs	p.P126fs	CTCFL_ENST00000423479.3_Frame_Shift_Ins_p.P126fs|CTCFL_ENST00000608903.1_Intron|CTCFL_ENST00000609232.1_Frame_Shift_Ins_p.P126fs|CTCFL_ENST00000432255.2_Frame_Shift_Ins_p.P126fs|CTCFL_ENST00000243914.3_Frame_Shift_Ins_p.P126fs|CTCFL_ENST00000433949.3_Intron|CTCFL_ENST00000608440.1_Frame_Shift_Ins_p.P126fs|CTCFL_ENST00000608425.1_Frame_Shift_Ins_p.P126fs|CTCFL_ENST00000422869.2_Frame_Shift_Ins_p.P126fs|CTCFL_ENST00000371196.2_Frame_Shift_Ins_p.P126fs|CTCFL_ENST00000429804.3_Frame_Shift_Ins_p.P126fs|CTCFL_ENST00000608158.1_Frame_Shift_Ins_p.P126fs|CTCFL_ENST00000502686.2_Intron|CTCFL_ENST00000608858.1_Intron|CTCFL_ENST00000481655.2_Frame_Shift_Ins_p.P126fs|CTCFL_ENST00000539382.1_Intron	NM_001269041.1	NP_001255970.1	Q8NI51	CTCFL_HUMAN	CCCTC-binding factor (zinc finger protein)-like	126					cell cycle (GO:0007049)|DNA methylation involved in gamete generation (GO:0043046)|histone methylation (GO:0016571)|positive regulation of gene expression (GO:0010628)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of gene expression by genetic imprinting (GO:0006349)|regulation of histone H3-K4 methylation (GO:0051569)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone binding (GO:0042393)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|breast(1)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(9)|lung(28)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	58	Lung NSC(12;0.00132)|all_lung(29;0.00433)|Melanoma(10;0.242)		BRCA - Breast invasive adenocarcinoma(13;3.95e-12)|Epithelial(14;3.41e-08)|all cancers(14;2.09e-07)			CTCTGCCGGGGCCCTTCCTCAA	0.579																																					p.P126fs		Atlas-INDEL	.											.	CTCFL	97	.	0			c.376_377insG						.																																			SO:0001589	frameshift_variant	140690	exon1			.		CCDS13459.1, CCDS58776.1, CCDS58777.1, CCDS58778.1, CCDS58779.1, CCDS58780.1, CCDS58781.1, CCDS58782.1, CCDS68161.1, CCDS68162.1, CCDS68163.1, CCDS68164.1	20q13.31	2013-01-08			ENSG00000124092	ENSG00000124092		"""Zinc fingers, C2H2-type"""	16234	protein-coding gene	gene with protein product	"""cancer/testis antigen 27"""	607022					Standard	NM_001269040		Approved	dJ579F20.2, BORIS, CT27	uc010giw.1	Q8NI51	OTTHUMG00000032829	ENST00000608263.1:c.376dupG	chr20.hg19:g.56098889_56098889dupC	ENSP00000476783:p.Pro126fs	83.0	0.0		139.0	11.0	NM_001269044	A0S6W1|A1L4C6|A6XGL8|A6XGM2|A6XGM3|A6XGM8|A6XGN0|A6XGN1|A6XGN2|A6XGN3|A6XGN4|E7EQ27|E7EUE3|E9PBA9|Q5JUG4|Q9BZ30|Q9NQJ3	Frame_Shift_Ins	INS	ENST00000608263.1	hg19	CCDS13459.1																																																																																			.	.		0.579	CTCFL-019	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000472040.1	NM_080618	
NFKB2	4791	hgsc.bcm.edu	37	10	104157402	104157403	+	Frame_Shift_Ins	INS	-	-	C			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr10:104157402_104157403insC	ENST00000369966.3	+	8	871_872	c.621_622insC	c.(622-624)cccfs	p.P208fs	NFKB2_ENST00000189444.6_Frame_Shift_Ins_p.P208fs|NFKB2_ENST00000428099.1_Frame_Shift_Ins_p.P208fs	NM_001077494.2	NP_001070962.1	Q00653	NFKB2_HUMAN	nuclear factor of kappa light polypeptide gene enhancer in B-cells 2 (p49/p100)	208	RHD. {ECO:0000255|PROSITE- ProRule:PRU00265}.				extracellular matrix organization (GO:0030198)|follicular dendritic cell differentiation (GO:0002268)|germinal center formation (GO:0002467)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|NIK/NF-kappaB signaling (GO:0038061)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of type I interferon production (GO:0032481)|regulation of transcription, DNA-templated (GO:0006355)|rhythmic process (GO:0048511)|spleen development (GO:0048536)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription, DNA-templated (GO:0006351)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	Bcl3/NF-kappaB2 complex (GO:0033257)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			NS(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(10)|skin(2)	23		Colorectal(252;0.00957)		Epithelial(162;3.4e-08)|all cancers(201;6.41e-07)	Acetylsalicylic acid(DB00945)|Glucosamine(DB01296)	CCTTCTCCCTGCCCCTGAAGCC	0.579			T	IGH@	B-NHL																																p.L207fs		Atlas-INDEL	.		Dom	yes		10	10q24	4791	nuclear factor of kappa light polypeptide gene enhancer in B-cells 2 (p49/p100)		L	.	NFKB2	48	.	0			c.621_622insC						.																																			SO:0001589	frameshift_variant	4791	exon8			.	X61498	CCDS41564.1, CCDS41565.1	10q24	2013-01-10			ENSG00000077150	ENSG00000077150		"""Ankyrin repeat domain containing"""	7795	protein-coding gene	gene with protein product		164012				1876189	Standard	XM_005269860		Approved	LYT-10, p52, p105, NF-kB2	uc001kvb.4	Q00653	OTTHUMG00000018962	ENST00000369966.3:c.625dupC	chr10.hg19:g.104157406_104157406dupC	ENSP00000358983:p.Pro208fs	134.0	0.0		218.0	15.0	NM_002502	A8K9D9|D3DR83|Q04860|Q9BU75|Q9H471|Q9H472	Frame_Shift_Ins	INS	ENST00000369966.3	hg19	CCDS41564.1																																																																																			.	.		0.579	NFKB2-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000050080.2		
SLC12A3	6559	hgsc.bcm.edu	37	16	56920341	56920341	+	Frame_Shift_Del	DEL	C	C	-			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr16:56920341delC	ENST00000563236.1	+	16	2016	c.1991delC	c.(1990-1992)accfs	p.T664fs	SLC12A3_ENST00000262502.5_Frame_Shift_Del_p.T663fs|SLC12A3_ENST00000438926.2_Frame_Shift_Del_p.T664fs|SLC12A3_ENST00000566786.1_Frame_Shift_Del_p.T663fs			P55017	S12A3_HUMAN	solute carrier family 12 (sodium/chloride transporter), member 3	664					chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transport (GO:0006811)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	sodium:chloride symporter activity (GO:0015378)|transporter activity (GO:0005215)			breast(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(28)|ovary(2)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	50					Bendroflumethiazide(DB00436)|Benzthiazide(DB00562)|Chlorothiazide(DB00880)|Diazoxide(DB01119)|Hydrochlorothiazide(DB00999)|Metolazone(DB00524)|Polythiazide(DB01324)|Quinethazone(DB01325)	TTTGTGGGCACCTTCACCCGG	0.657																																					p.T664fs		Atlas-Indel,Pindel	.											.	SLC12A3	99	.	0			c.1990delA						.						55.0	55.0	55.0					16																	56920341		2198	4300	6498	SO:0001589	frameshift_variant	6559	exon16			.		CCDS10770.1, CCDS45491.1, CCDS58464.1	16q13	2013-07-18	2013-07-18		ENSG00000070915	ENSG00000070915		"""Solute carriers"""	10912	protein-coding gene	gene with protein product		600968				8812482	Standard	NM_000339		Approved	NCCT	uc002ekd.4	P55017	OTTHUMG00000133284	ENST00000563236.1:c.1991delC	chr16.hg19:g.56920341delC	ENSP00000456149:p.Thr664fs	46.0	0.0		73.0	38.0	NM_001126108	A8MSJ2|C9JNN9	Frame_Shift_Del	DEL	ENST00000563236.1	hg19	CCDS58464.1																																																																																			.	.		0.657	SLC12A3-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000432337.1		
SEMA3F	6405	hgsc.bcm.edu	37	3	50222142	50222143	+	Frame_Shift_Ins	INS	-	-	G	rs145958913|rs546599637		TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr3:50222142_50222143insG	ENST00000002829.3	+	13	1835_1836	c.1351_1352insG	c.(1351-1353)cggfs	p.R451fs	SEMA3F_ENST00000434342.1_Frame_Shift_Ins_p.R420fs|SEMA3F_ENST00000413852.1_Frame_Shift_Ins_p.R352fs	NM_004186.3	NP_004177.3	Q13275	SEM3F_HUMAN	sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3F	451	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|branchiomotor neuron axon guidance (GO:0021785)|facial nerve structural organization (GO:0021612)|negative regulation of axon extension involved in axon guidance (GO:0048843)|nerve development (GO:0021675)|neural crest cell migration (GO:0001755)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|semaphorin-plexin signaling pathway involved in neuron projection guidance (GO:1902285)|sympathetic ganglion development (GO:0061549)|sympathetic neuron projection extension (GO:0097490)|sympathetic neuron projection guidance (GO:0097491)|trigeminal nerve structural organization (GO:0021637)	extracellular space (GO:0005615)|membrane (GO:0016020)	chemorepellent activity (GO:0045499)|receptor activity (GO:0004872)			central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(9)|ovary(1)|prostate(1)|skin(2)	17				BRCA - Breast invasive adenocarcinoma(193;0.00013)|KIRC - Kidney renal clear cell carcinoma(197;0.00599)|Kidney(197;0.00688)		TCTGCAGCGGCGGCCCCTGGTA	0.599																																					p.R451fs		Atlas-INDEL	.											.	SEMA3F	62	.	0			c.1351_1352insG						.																																			SO:0001589	frameshift_variant	6405	exon13			.	U33920	CCDS2811.1	3p21.3	2013-01-11			ENSG00000001617	ENSG00000001617		"""Semaphorins"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10728	protein-coding gene	gene with protein product	"""sema IV"""	601124				8786119, 8649831	Standard	NM_004186		Approved	SEMAK, Sema4	uc003cyj.3	Q13275	OTTHUMG00000156806	ENST00000002829.3:c.1353dupG	chr3.hg19:g.50222144_50222144dupG	ENSP00000002829:p.Arg451fs	40.0	0.0		121.0	22.0	NM_004186	C9JQ85|Q13274|Q13372|Q15704|Q6GTR4	Frame_Shift_Ins	INS	ENST00000002829.3	hg19	CCDS2811.1																																																																																			.	.		0.599	SEMA3F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345929.1	NM_004186	
CASZ1	54897	hgsc.bcm.edu	37	1	10713557	10713558	+	Frame_Shift_Ins	INS	-	-	G	rs576823495		TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr1:10713557_10713558insG	ENST00000377022.3	-	11	2873_2874	c.2556_2557insC	c.(2554-2559)gccgccfs	p.A853fs	RP4-734G22.3_ENST00000606802.1_RNA|CASZ1_ENST00000344008.5_Frame_Shift_Ins_p.A853fs	NM_001079843.2	NP_001073312.1	Q86V15	CASZ1_HUMAN	castor zinc finger 1	853					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(9)|large_intestine(13)|lung(18)|ovary(2)|prostate(5)|skin(2)|urinary_tract(1)	54	Ovarian(185;0.203)|all_lung(157;0.204)	Lung NSC(185;4.96e-06)|all_lung(284;1.22e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00212)|Hepatocellular(190;0.00913)|Ovarian(437;0.0229)|Myeloproliferative disorder(586;0.0255)	STAD - Stomach adenocarcinoma(5;0.0224)	UCEC - Uterine corpus endometrioid carcinoma (279;0.0265)|Colorectal(212;3.54e-08)|COAD - Colon adenocarcinoma(227;9.56e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000219)|Kidney(185;0.00142)|KIRC - Kidney renal clear cell carcinoma(229;0.00381)|READ - Rectum adenocarcinoma(331;0.0419)|STAD - Stomach adenocarcinoma(132;0.0623)		GGGACAGAGGCGGCAGCCACGG	0.678																																					p.A853fs		Atlas-INDEL	.											.	CASZ1	150	.	0			c.2557_2558insC						.																																			SO:0001589	frameshift_variant	54897	exon11			.	AK000328	CCDS120.2, CCDS41246.1	1p36.22	2013-01-07	2007-02-02		ENSG00000130940	ENSG00000130940		"""Zinc fingers, C2H2-type"""	26002	protein-coding gene	gene with protein product	"""zinc finger protein 693"", ""survival related gene"""	609895	"""castor homolog 1, zinc finger (Drosophila)"""			16631614, 21252912	Standard	NM_001079843		Approved	FLJ20321, ZNF693, castor, cst, SRG	uc001aro.4	Q86V15	OTTHUMG00000002035	ENST00000377022.3:c.2557dupC	chr1.hg19:g.10713559_10713559dupG	ENSP00000366221:p.Ala853fs	82.0	0.0		186.0	11.0	NM_017766	Q078S9|Q2EN02|Q5T9S1|Q6ZNM8|Q8WX49|Q8WX50|Q9BT16|Q9NXC6	Frame_Shift_Ins	INS	ENST00000377022.3	hg19	CCDS41246.1																																																																																			.	.		0.678	CASZ1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005673.2	NM_017766	
TLR1	7096	hgsc.bcm.edu	37	4	38798989	38798990	+	Frame_Shift_Ins	INS	-	-	C			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr4:38798989_38798990insC	ENST00000502213.2	-	3	1692_1693	c.1463_1464insG	c.(1462-1464)agcfs	p.S488fs	TLR1_ENST00000308979.2_Frame_Shift_Ins_p.S488fs|TLR1_ENST00000510552.1_5'Flank			Q15399	TLR1_HUMAN	toll-like receptor 1	488					cellular response to triacyl bacterial lipopeptide (GO:0071727)|detection of triacyl bacterial lipopeptide (GO:0042495)|immune response (GO:0006955)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|macrophage activation (GO:0042116)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|positive regulation of interleukin-6 biosynthetic process (GO:0045410)|positive regulation of tumor necrosis factor biosynthetic process (GO:0042535)|regulation of cytokine secretion (GO:0050707)|signal transduction (GO:0007165)|toll-like receptor 1 signaling pathway (GO:0034130)	cytoplasmic vesicle (GO:0031410)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|Toll-like receptor 1-Toll-like receptor 2 protein complex (GO:0035354)	protein heterodimerization activity (GO:0046982)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(11)|ovary(1)|prostate(1)|skin(4)|stomach(2)	28						GGCTGCTAAAGCTGCCACATCC	0.401																																					p.S488fs	GBM(5;216 373 40795 46382)	Atlas-INDEL	.											.	TLR1	70	.	0			c.1464_1465insG						.																																			SO:0001589	frameshift_variant	7096	exon4			.	U88540	CCDS33973.1	4p14	2008-02-05				ENSG00000174125		"""CD molecules"""	11847	protein-coding gene	gene with protein product		601194				9435236, 7584026	Standard	NM_003263		Approved	rsc786, KIAA0012, CD281	uc003gtl.3	Q15399		ENST00000502213.2:c.1464dupG	chr4.hg19:g.38798990_38798990dupC	ENSP00000421259:p.Ser488fs	258.0	0.0		256.0	27.0	NM_003263	D1CS39|D1CS41|O15452|Q32MK3|Q32MK4|Q9UG90	Frame_Shift_Ins	INS	ENST00000502213.2	hg19	CCDS33973.1																																																																																			.	.		0.401	TLR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360510.3		
TP53	7157	hgsc.bcm.edu	37	17	7577150	7577150	+	Frame_Shift_Del	DEL	T	T	-			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr17:7577150delT	ENST00000269305.4	-	8	977	c.788delA	c.(787-789)aatfs	p.N263fs	TP53_ENST00000413465.2_Intron|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000359597.4_Frame_Shift_Del_p.N263fs|TP53_ENST00000455263.2_Frame_Shift_Del_p.N263fs|TP53_ENST00000445888.2_Frame_Shift_Del_p.N263fs|TP53_ENST00000420246.2_Frame_Shift_Del_p.N263fs	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	263	Interaction with AXIN1. {ECO:0000250}.|Interaction with E4F1.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		GN -> PD (in a sporadic cancer; somatic mutation).|N -> D (in sporadic cancers; somatic mutation).|N -> H (in sporadic cancers; somatic mutation).|N -> I (in sporadic cancers; somatic mutation).|N -> K (in a sporadic cancer; somatic mutation).|N -> S (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.0?(8)|p.?(3)|p.G262_F270delGNLLGRNSF(2)|p.N263I(2)|p.G262_S269delGNLLGRNS(2)|p.N263fs*5(1)|p.E258fs*71(1)|p.S261_L264>R(1)|p.G262fs*2(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TCCCAGTAGATTACCACTACT	0.517		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.N263fs	Pancreas(47;798 1329 9957 10801)	Atlas-Indel,Pindel	.	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53,colon,carcinoma,-1,1	TP53	33396	.	21	Whole gene deletion(8)|Deletion - In frame(4)|Unknown(3)|Deletion - Frameshift(3)|Substitution - Missense(2)|Complex - deletion inframe(1)	bone(4)|large_intestine(3)|haematopoietic_and_lymphoid_tissue(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|lung(2)|ovary(2)|eye(1)|urinary_tract(1)|stomach(1)	c.789delT						.						43.0	39.0	40.0					17																	7577150		2203	4299	6502	SO:0001589	frameshift_variant	7157	exon8	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	.	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.788delA	chr17.hg19:g.7577150delT	ENSP00000269305:p.Asn263fs	65.0	0.0		70.0	33.0	NM_001126112	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Frame_Shift_Del	DEL	ENST00000269305.4	hg19	CCDS11118.1																																																																																			.	.		0.517	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
MTIF2	4528	hgsc.bcm.edu	37	2	55470647	55470647	+	Frame_Shift_Del	DEL	G	G	-			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr2:55470647delG	ENST00000263629.4	-	12	1784	c.1469delC	c.(1468-1470)tcafs	p.S490fs	MTIF2_ENST00000403721.1_Frame_Shift_Del_p.S490fs|MTIF2_ENST00000394600.3_Frame_Shift_Del_p.S490fs	NM_002453.2	NP_002444.2	P46199	IF2M_HUMAN	mitochondrial translational initiation factor 2	490					formation of translation initiation complex (GO:0001732)|regulation of translational initiation (GO:0006446)|ribosome disassembly (GO:0032790)	mitochondrion (GO:0005739)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)|ribosomal small subunit binding (GO:0043024)|translation factor activity, nucleic acid binding (GO:0008135)|translation initiation factor activity (GO:0003743)			breast(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(5)|ovary(1)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	24						CCGTAGAATTGATCTCTTCTT	0.363																																					p.S490fs		Atlas-Indel,Pindel	.											.	MTIF2	64	.	0			c.1470delA						.						174.0	171.0	172.0					2																	55470647		2203	4300	6503	SO:0001589	frameshift_variant	4528	exon12			.	L34600	CCDS1853.1	2p16.1	2008-02-05			ENSG00000085760	ENSG00000085760			7441	protein-coding gene	gene with protein product		603766				9925935, 7829522	Standard	XM_005264335		Approved	IF-2mt	uc002ryo.3	P46199	OTTHUMG00000129338	ENST00000263629.4:c.1469delC	chr2.hg19:g.55470647delG	ENSP00000263629:p.Ser490fs	784.0	0.0		612.0	80.0	NM_002453	D6W5D0	Frame_Shift_Del	DEL	ENST00000263629.4	hg19	CCDS1853.1																																																																																			.	.		0.363	MTIF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251486.4	NM_002453	
ARID1A	8289	hgsc.bcm.edu	37	1	27087894	27087898	+	Frame_Shift_Del	DEL	GCCAC	GCCAC	-			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	GCCAC	GCCAC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr1:27087894_27087898delGCCAC	ENST00000324856.7	+	6	2552_2556	c.2181_2185delGCCAC	c.(2179-2187)cggccacccfs	p.PP728fs	RN7SL501P_ENST00000578818.1_RNA|ARID1A_ENST00000374152.2_Frame_Shift_Del_p.PP345fs|ARID1A_ENST00000457599.2_Frame_Shift_Del_p.PP728fs	NM_006015.4	NP_006006.3	O14497	ARI1A_HUMAN	AT rich interactive domain 1A (SWI-like)	728					androgen receptor signaling pathway (GO:0030521)|ATP-dependent chromatin remodeling (GO:0043044)|cardiac chamber development (GO:0003205)|chromatin remodeling (GO:0006338)|chromatin-mediated maintenance of transcription (GO:0048096)|forebrain development (GO:0030900)|glucocorticoid receptor signaling pathway (GO:0042921)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|nucleosome disassembly (GO:0006337)|nucleosome mobilization (GO:0042766)|optic cup formation involved in camera-type eye development (GO:0003408)|placenta blood vessel development (GO:0060674)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	DNA binding (GO:0003677)|ligand-dependent nuclear receptor binding (GO:0016922)|transcription coactivator activity (GO:0003713)	p.R727fs*12(1)|p.P728fs(1)	ARID1A/MAST2_ENST00000361297(2)	NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(13)|central_nervous_system(6)|cervix(2)|endometrium(56)|haematopoietic_and_lymphoid_tissue(8)|kidney(10)|large_intestine(41)|liver(31)|lung(34)|ovary(130)|pancreas(18)|prostate(8)|skin(9)|stomach(14)|upper_aerodigestive_tract(4)|urinary_tract(24)	411		all_cancers(24;6.36e-27)|all_epithelial(13;5.93e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Breast(348;9.7e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.61e-56)|Epithelial(14;7.53e-55)|OV - Ovarian serous cystadenocarcinoma(117;4.5e-30)|Colorectal(126;2.07e-09)|COAD - Colon adenocarcinoma(152;4.29e-07)|BRCA - Breast invasive adenocarcinoma(304;4.13e-05)|STAD - Stomach adenocarcinoma(196;0.000279)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|GBM - Glioblastoma multiforme(114;0.0132)|READ - Rectum adenocarcinoma(331;0.0469)|Lung(427;0.167)|LUSC - Lung squamous cell carcinoma(448;0.242)		TGCCACCTCGGCCACCCAGTGGCCA	0.522			"""Mis, N, F, S, D"""		"""clear cell ovarian carcinoma, RCC"""																																p.727_728del		Atlas-Indel,Pindel	.		Rec	yes		1	1p35.3	8289	AT rich interactive domain 1A (SWI-like)		E	.,1	ARID1A	842	.	2	Deletion - Frameshift(1)|Complex(1)	ovary(1)|liver(1)	c.2180_2184del						.																																			SO:0001589	frameshift_variant	8289	exon6			.	AB001895	CCDS285.1, CCDS44091.1	1p36.1-p35	2014-09-17	2006-11-08	2004-01-30	ENSG00000117713	ENSG00000117713		"""-"""	11110	protein-coding gene	gene with protein product		603024	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily f, member 1"", ""AT rich interactive domain 1A (SWI- like)"""	C1orf4, SMARCF1		9630625, 9434167	Standard	NM_139135		Approved	B120, P270, C10rf4, BAF250, BAF250a	uc001bmv.1	O14497	OTTHUMG00000004004	ENST00000324856.7:c.2181_2185delGCCAC	chr1.hg19:g.27087894_27087898delGCCAC	ENSP00000320485:p.Pro728fs	322.0	0.0		200.0	70.0	NM_139135	D3DPL1|Q53FK9|Q5T0W1|Q5T0W2|Q5T0W3|Q8NFD6|Q96T89|Q9BY33|Q9HBJ5|Q9UPZ1	Frame_Shift_Del	DEL	ENST00000324856.7	hg19	CCDS285.1																																																																																			.	.		0.522	ARID1A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000011437.2	NM_139135	
ZNF99	7652	hgsc.bcm.edu	37	19	22942280	22942281	+	Frame_Shift_Ins	INS	-	-	T	rs564678369	byFrequency	TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr19:22942280_22942281insT	ENST00000596209.1	-	4	520_521	c.430_431insA	c.(430-432)atafs	p.I144fs	ZNF99_ENST00000397104.3_Frame_Shift_Ins_p.I165fs	NM_001080409.2	NP_001073878.2	A8MXY4	ZNF99_HUMAN	zinc finger protein 99	144					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.I165V(1)		NS(1)|breast(1)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(20)|lung(55)|ovary(2)|prostate(10)|skin(5)|stomach(9)|upper_aerodigestive_tract(2)|urinary_tract(3)	124		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.102)				ACACTGAAATATTTTTCCCTGG	0.282																																					p.I144fs		Atlas-Indel,Pindel	.											.	ZNF99	273	.	1	Substitution - Missense(1)	ovary(1)	c.431_432insA						.																																			SO:0001589	frameshift_variant	7652	exon4			.	BC021822	CCDS59369.1	19p12	2013-01-08	2006-01-17		ENSG00000213973	ENSG00000213973		"""Zinc fingers, C2H2-type"", ""-"""	13175	protein-coding gene	gene with protein product		603981	"""zinc finger protein 99 (F8281)"", ""chromosome 19 open reading frame 9"""	C19orf9			Standard	NM_001080409		Approved	MGC24986	uc021urt.1	A8MXY4		ENST00000596209.1:c.431dupA	chr19.hg19:g.22942285_22942285dupT	ENSP00000472969:p.Ile144fs	320.0	0.0		158.0	51.0	NM_001080409	M0R335	Frame_Shift_Ins	INS	ENST00000596209.1	hg19	CCDS59369.1																																																																																			.	.		0.282	ZNF99-001	NOVEL	not_best_in_genome_evidence|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000464591.1	XM_065124	
SFRP5	6425	hgsc.bcm.edu	37	10	99531159	99531160	+	Frame_Shift_Ins	INS	-	-	A			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr10:99531159_99531160insA	ENST00000266066.3	-	1	549_550	c.431_432insT	c.(430-432)ttcfs	p.F144fs		NM_003015.3	NP_003006.2	Q5T4F7	SFRP5_HUMAN	secreted frizzled-related protein 5	144	FZ. {ECO:0000255|PROSITE- ProRule:PRU00090}.				anatomical structure morphogenesis (GO:0009653)|apoptotic process (GO:0006915)|brain development (GO:0007420)|cell differentiation (GO:0030154)|convergent extension involved in axis elongation (GO:0060028)|digestive tract morphogenesis (GO:0048546)|establishment or maintenance of cell polarity (GO:0007163)|gonad development (GO:0008406)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of catenin import into nucleus (GO:0035414)|negative regulation of cell proliferation (GO:0008285)|negative regulation of JUN kinase activity (GO:0043508)|negative regulation of planar cell polarity pathway involved in axis elongation (GO:2000041)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of Wnt signaling pathway involved in digestive tract morphogenesis (GO:2000057)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|post-anal tail morphogenesis (GO:0036342)|signal transduction (GO:0007165)|vasculature development (GO:0001944)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)	PDZ domain binding (GO:0030165)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			large_intestine(1)|lung(4)	5		Colorectal(252;0.234)		Epithelial(162;4.98e-10)|all cancers(201;3.58e-08)		CAGGCCAGGGGAAGCCGTAGGC	0.698																																					p.F144fs		Atlas-INDEL	.											.	SFRP5	32	.	0			c.432_433insT						.																																			SO:0001589	frameshift_variant	6425	exon1			.	AF017988	CCDS7472.1	10q24	2008-07-10			ENSG00000120057	ENSG00000120057		"""Secreted frizzled-related proteins"""	10779	protein-coding gene	gene with protein product	"""secreted apoptosis related protein 3"""	604158				9391078	Standard	NM_003015		Approved	SARP3	uc001kor.4	Q5T4F7	OTTHUMG00000018866	ENST00000266066.3:c.432dupT	chr10.hg19:g.99531161_99531161dupA	ENSP00000266066:p.Phe144fs	39.0	0.0		132.0	10.0	NM_003015	O14780|Q86TH7	Frame_Shift_Ins	INS	ENST00000266066.3	hg19	CCDS7472.1																																																																																			.	.		0.698	SFRP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049742.1	NM_003015	
DDX58	23586	hgsc.bcm.edu	37	9	32457172	32457178	+	Frame_Shift_Del	DEL	TTCCACT	TTCCACT	-			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	TTCCACT	TTCCACT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr9:32457172_32457178delTTCCACT	ENST00000379883.2	-	18	2877_2883	c.2720_2726delAGTGGAA	c.(2719-2727)aagtggaagfs	p.KWK907fs	DDX58_ENST00000379882.1_Frame_Shift_Del_p.KWK862fs|DDX58_ENST00000542096.1_Frame_Shift_Del_p.KWK836fs|DDX58_ENST00000379868.1_Frame_Shift_Del_p.KWK704fs	NM_014314.3	NP_055129.2	O95786	DDX58_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 58	907	Interaction with ZC3HAV1.|Repressor domain.				cytoplasmic pattern recognition receptor signaling pathway in response to virus (GO:0039528)|detection of virus (GO:0009597)|innate immune response (GO:0045087)|negative regulation of type I interferon production (GO:0032480)|positive regulation of defense response to virus by host (GO:0002230)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription factor import into nucleus (GO:0042993)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell migration (GO:0030334)|regulation of type III interferon production (GO:0034344)|response to exogenous dsRNA (GO:0043330)|response to virus (GO:0009615)|RIG-I signaling pathway (GO:0039529)|viral process (GO:0016032)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	ATP binding (GO:0005524)|double-stranded DNA binding (GO:0003690)|double-stranded RNA binding (GO:0003725)|helicase activity (GO:0004386)|identical protein binding (GO:0042802)|single-stranded RNA binding (GO:0003727)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|liver(1)|lung(9)|ovary(2)|pancreas(1)|prostate(1)	27			LUSC - Lung squamous cell carcinoma(29;0.00813)	GBM - Glioblastoma multiforme(74;0.00056)		ATGAAAGTCCTTCCACTTCGAGTACAG	0.391																																					p.907_909del		Atlas-Indel,Pindel	.											.	DDX58	82	.	0			c.2721_2727del						.																																			SO:0001589	frameshift_variant	23586	exon18			.	AF038963	CCDS6526.1	9p12	2011-08-05			ENSG00000107201	ENSG00000107201		"""DEAD-boxes"""	19102	protein-coding gene	gene with protein product	"""RNA helicase RIG-I"", ""retinoic acid inducible gene I"""	609631				21690088	Standard	NM_014314		Approved	RIG-I, FLJ13599, DKFZp434J1111	uc003zra.3	O95786	OTTHUMG00000019746	ENST00000379883.2:c.2720_2726delAGTGGAA	chr9.hg19:g.32457172_32457178delTTCCACT	ENSP00000369213:p.Lys907fs	246.0	0.0		106.0	22.0	NM_014314	A2RU81|Q5HYE1|Q5VYT1|Q9NT04	Frame_Shift_Del	DEL	ENST00000379883.2	hg19	CCDS6526.1																																																																																			.	.		0.391	DDX58-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052011.1	NM_014314	
KIF20B	9585	hgsc.bcm.edu	37	10	91477208	91477209	+	Frame_Shift_Del	DEL	AC	AC	-			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	AC	AC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr10:91477208_91477209delAC	ENST00000371728.3	+	10	1145_1146	c.1080_1081delAC	c.(1078-1083)ttacagfs	p.Q361fs	KIF20B_ENST00000394289.2_Frame_Shift_Del_p.Q361fs|KIF20B_ENST00000260753.4_Frame_Shift_Del_p.Q361fs|KIF20B_ENST00000416354.1_Frame_Shift_Del_p.Q361fs	NM_001284259.1	NP_001271188.1	Q96Q89	KI20B_HUMAN	kinesin family member 20B	361	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				ATP catabolic process (GO:0006200)|cell cycle arrest (GO:0007050)|microtubule-based movement (GO:0007018)|mitotic nuclear division (GO:0007067)|neural tube closure (GO:0001843)|regulation of establishment of cell polarity (GO:2000114)|regulation of establishment of protein localization (GO:0070201)|regulation of mitosis (GO:0007088)|regulation of neuron migration (GO:2001222)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|WW domain binding (GO:0050699)			endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(20)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)	58						TTAAAATATTACAGATTGAAGA	0.257																																					p.360_360del		Atlas-Indel,Pindel	.											.	KIF20B	191	.	0			c.1079_1080del						.																																			SO:0001589	frameshift_variant	9585	exon10			.	L16782	CCDS7407.1, CCDS60590.1	10q23.31	2009-08-06	2008-07-31	2008-07-31	ENSG00000138182	ENSG00000138182			7212	protein-coding gene	gene with protein product	"""cancer/testis antigen 90"""	605498	"""M-phase phosphoprotein 1"""	MPHOSPH1		8885239, 8290587, 11470801	Standard	NM_016195		Approved	MPP1, KRMP1, CT90	uc001kgr.1	Q96Q89	OTTHUMG00000018725	ENST00000371728.3:c.1080_1081delAC	chr10.hg19:g.91477208_91477209delAC	ENSP00000360793:p.Gln361fs	603.0	0.0		311.0	50.0	NM_016195	A8MXM7|O43277|Q09471|Q2KQ73|Q32NE1|Q561V3|Q58EX8|Q5T9M8|Q5T9M9|Q5T9N0|Q5T9N1|Q7KZ68|Q7Z5E0|Q7Z5E1|Q7Z6M9|Q86X82|Q9H3R8|Q9H6Q9|Q9H755|Q9NTC1|Q9UFR5	Frame_Shift_Del	DEL	ENST00000371728.3	hg19																																																																																				.	.		0.257	KIF20B-003	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000049330.1	NM_016195	
ASPSCR1	79058	hgsc.bcm.edu	37	17	79954362	79954363	+	Frame_Shift_Ins	INS	-	-	G			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr17:79954362_79954363insG	ENST00000306739.4	+	7	670_671	c.573_574insG	c.(574-576)ggcfs	p.G192fs	ASPSCR1_ENST00000306729.7_Frame_Shift_Ins_p.G192fs|ASPSCR1_ENST00000580534.1_Frame_Shift_Ins_p.G115fs	NM_024083.3	NP_076988.1	Q9BZE9	ASPC1_HUMAN	alveolar soft part sarcoma chromosome region, candidate 1	192					glucose homeostasis (GO:0042593)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|regulation of glucose import (GO:0046324)	cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|extrinsic component of membrane (GO:0019898)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|vesicle membrane (GO:0012506)			ASPSCR1/TFE3(167)	breast(2)|large_intestine(2)	4	all_neural(118;0.0878)|Ovarian(332;0.12)|all_lung(278;0.246)		BRCA - Breast invasive adenocarcinoma(99;0.0114)|OV - Ovarian serous cystadenocarcinoma(97;0.0191)			CAGCGTCGGCTGGCCAGGCAGC	0.668			T	TFE3	alveolar soft part sarcoma																																p.A191fs		Atlas-INDEL	.		Dom	yes		17	17q25	79058	"""alveolar soft part sarcoma chromosome region, candidate 1"""		M	.	ASPSCR1	27	.	0			c.573_574insG						.																																			SO:0001589	frameshift_variant	79058	exon7			.	AF324219	CCDS11796.1, CCDS58611.1	17q25	2011-06-28				ENSG00000169696		"""UBX domain containing"""	13825	protein-coding gene	gene with protein product	"""UBX domain protein 9"""	606236				11244503, 10506710	Standard	NM_024083		Approved	ASPS, ASPL, UBXD9, UBXN9	uc002kcy.3	Q9BZE9		ENST00000306739.4:c.575dupG	chr17.hg19:g.79954364_79954364dupG	ENSP00000302176:p.Gly192fs	43.0	0.0		79.0	10.0	NM_024083	A8K3K9|Q7Z6N7|Q8WV59|Q96LS5|Q96M40	Frame_Shift_Ins	INS	ENST00000306739.4	hg19	CCDS11796.1																																																																																			.	.		0.668	ASPSCR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441972.1	NM_024083	
NLGN1	22871	hgsc.bcm.edu	37	3	173996955	173996955	+	Frame_Shift_Del	DEL	C	C	-			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr3:173996955delC	ENST00000457714.1	+	6	1593	c.1164delC	c.(1162-1164)aacfs	p.N388fs	NLGN1_ENST00000361589.4_Frame_Shift_Del_p.N388fs|NLGN1_ENST00000401917.3_Frame_Shift_Del_p.N428fs|NLGN1_ENST00000466350.1_3'UTR|NLGN1_ENST00000545397.1_Frame_Shift_Del_p.N388fs	NM_014932.2	NP_055747.1	Q8N2Q7	NLGN1_HUMAN	neuroligin 1	405					alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor clustering (GO:0097113)|calcium-dependent cell-cell adhesion (GO:0016339)|cytoskeletal matrix organization at active zone (GO:0048789)|establishment of protein localization (GO:0045184)|heterophilic cell-cell adhesion (GO:0007157)|N-methyl-D-aspartate receptor clustering (GO:0097114)|nervous system development (GO:0007399)|neurexin clustering (GO:0097115)|neuron cell-cell adhesion (GO:0007158)|neuronal signal transduction (GO:0023041)|positive regulation of dendritic spine development (GO:0060999)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of intracellular signal transduction (GO:1902533)|positive regulation of ruffle assembly (GO:1900029)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synaptic transmission, GABAergic (GO:0032230)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of synaptic vesicle endocytosis (GO:1900244)|positive regulation of synaptic vesicle exocytosis (GO:2000302)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|protein heterotetramerization (GO:0051290)|protein homooligomerization (GO:0051260)|protein localization to synapse (GO:0035418)|protein targeting (GO:0006605)|receptor localization to synapse (GO:0097120)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of neuron differentiation (GO:0045664)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|synapse assembly (GO:0007416)|synaptic vesicle clustering (GO:0097091)|synaptic vesicle targeting (GO:0016080)|terminal button organization (GO:0072553)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|external side of plasma membrane (GO:0009897)|filopodium tip (GO:0032433)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuronal postsynaptic density (GO:0097481)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|neurexin family protein binding (GO:0042043)|PDZ domain binding (GO:0030165)|protein dimerization activity (GO:0046983)|receptor activity (GO:0004872)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(9)|liver(2)|lung(54)|ovary(1)|pancreas(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	83	Ovarian(172;0.0025)		LUSC - Lung squamous cell carcinoma(14;5.36e-13)|Lung(28;9.49e-13)			TAGGAGTGAACCAAGGGGAAG	0.368																																					p.N388fs		Atlas-Indel,Pindel	.											.	NLGN1	209	.	0			c.1163delA						.						138.0	144.0	142.0					3																	173996955		2203	4300	6503	SO:0001589	frameshift_variant	22871	exon6			.	AB028993	CCDS3222.1	3q26.32	2008-07-18			ENSG00000169760	ENSG00000169760			14291	protein-coding gene	gene with protein product		600568				10767552, 10819331	Standard	NM_014932		Approved	KIAA1070	uc003fio.1	Q8N2Q7	OTTHUMG00000157005	ENST00000457714.1:c.1164delC	chr3.hg19:g.173996955delC	ENSP00000392500:p.Asn388fs	228.0	0.0		131.0	38.0	NM_014932	Q9UPT2	Frame_Shift_Del	DEL	ENST00000457714.1	hg19	CCDS3222.1																																																																																			.	.		0.368	NLGN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000347054.3	NM_014932	
D2HGDH	728294	hgsc.bcm.edu	37	2	242683136	242683137	+	Frame_Shift_Ins	INS	-	-	C			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr2:242683136_242683137insC	ENST00000321264.4	+	5	799_800	c.590_591insC	c.(589-594)agctgcfs	p.C198fs	D2HGDH_ENST00000403782.1_Frame_Shift_Ins_p.C64fs|D2HGDH_ENST00000342518.6_Frame_Shift_Ins_p.C198fs|D2HGDH_ENST00000537090.1_Frame_Shift_Ins_p.C198fs	NM_152783.3	NP_689996.4	Q8N465	D2HDH_HUMAN	D-2-hydroxyglutarate dehydrogenase	198	FAD-binding PCMH-type. {ECO:0000255|PROSITE-ProRule:PRU00718}.				2-oxoglutarate metabolic process (GO:0006103)|cellular metabolic process (GO:0044237)|cellular protein metabolic process (GO:0044267)|response to cobalt ion (GO:0032025)|response to manganese ion (GO:0010042)|response to zinc ion (GO:0010043)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	(R)-2-hydroxyglutarate dehydrogenase activity (GO:0051990)|flavin adenine dinucleotide binding (GO:0050660)|UDP-N-acetylmuramate dehydrogenase activity (GO:0008762)			breast(1)|endometrium(3)|lung(10)|skin(1)|urinary_tract(1)	16		all_cancers(19;1.09e-40)|all_epithelial(40;2.03e-18)|Breast(86;1.53e-05)|all_lung(227;0.00338)|Renal(207;0.00502)|Ovarian(221;0.00716)|Lung NSC(271;0.012)|Esophageal squamous(248;0.129)|Melanoma(123;0.144)|all_hematologic(139;0.158)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;4.59e-33)|all cancers(36;9.89e-31)|OV - Ovarian serous cystadenocarcinoma(60;7.89e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;1.63e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00154)|Colorectal(34;0.0129)|COAD - Colon adenocarcinoma(134;0.0833)		GCCAAGGGCAGCTGCCACATCG	0.609																																					p.S197fs		Atlas-INDEL	.											.	D2HGDH	39	.	0			c.590_591insC						.																																			SO:0001589	frameshift_variant	728294	exon5			.	AK091725	CCDS33426.1, CCDS74684.1	2p25.3	2010-05-11			ENSG00000180902	ENSG00000180902	1.1.99.-		28358	protein-coding gene	gene with protein product		609186				15070399, 15609246	Standard	NM_152783		Approved	MGC25181, D2HGD, FLJ42195	uc002wce.1	Q8N465	OTTHUMG00000151474	ENST00000321264.4:c.591dupC	chr2.hg19:g.242683137_242683137dupC	ENSP00000315351:p.Cys198fs	104.0	0.0		195.0	12.0	NM_152783	B4E3L6|E7ENP2|Q6IQ24|Q8N5Q8	Frame_Shift_Ins	INS	ENST00000321264.4	hg19	CCDS33426.1																																																																																			.	.		0.609	D2HGDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322794.2	NM_152783	
ZBED1	9189	hgsc.bcm.edu	37	X	2406709	2406710	+	Frame_Shift_Ins	INS	-	-	C			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chrX:2406709_2406710insC	ENST00000381223.4	-	2	2254_2255	c.2051_2052insG	c.(2050-2052)ggtfs	p.G684fs	ZBED1_ENST00000381218.3_Frame_Shift_Ins_p.G684fs|DHRSX_ENST00000334651.5_Intron|ZBED1_ENST00000381222.2_Frame_Shift_Ins_p.G684fs|ZBED1_ENST00000515319.1_Intron	NM_001171135.1|NM_001171136.1|NM_004729.3	NP_001164606.1|NP_001164607.1|NP_004720.1	O96006	ZBED1_HUMAN	zinc finger, BED-type containing 1	684					metabolic process (GO:0008152)	nuclear chromosome (GO:0000228)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|transposase activity (GO:0004803)			endometrium(8)|kidney(1)|large_intestine(3)|lung(11)|prostate(1)|upper_aerodigestive_tract(1)	25		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				TGCCAAAGAAACCGCCGCTGAC	0.604																																					p.G684fs		Atlas-INDEL	.											.	ZBED1	64	.	0			c.2052_2053insG						.																																			SO:0001589	frameshift_variant	9189	exon2			.	AB018328	CCDS14118.1	Xp22.33 and Yp11	2013-05-03	2004-01-14	2004-01-16	ENSG00000214717	ENSG00000214717		"""Pseudoautosomal regions / PAR1"", ""Zinc fingers, BED-type"""	447	protein-coding gene	gene with protein product		300178	"""Ac-like transposable element"""	ALTE		9872452, 9887332, 23533661	Standard	NM_001171135		Approved	TRAMP, KIAA0785, DREF, hDREF	uc004cqh.2	O96006	OTTHUMG00000021069	ENST00000381223.4:c.2052dupG	chrX.hg19:g.2406711_2406711dupC	ENSP00000370621:p.Gly684fs	141.0	0.0		194.0	16.0	NM_001171135	Q96BY4	Frame_Shift_Ins	INS	ENST00000381223.4	hg19	CCDS14118.1																																																																																			.	.		0.604	ZBED1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000144310.3	NM_004729	
OR6C65	403282	hgsc.bcm.edu	37	12	55794609	55794610	+	Frame_Shift_Ins	INS	-	-	T			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr12:55794609_55794610insT	ENST00000379665.2	+	1	396_397	c.297_298insT	c.(298-300)tttfs	p.F100fs		NM_001005518.1	NP_001005518.1	A6NJZ3	O6C65_HUMAN	olfactory receptor, family 6, subfamily C, member 65	100						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L102fs*1(1)		cervix(1)|endometrium(2)|large_intestine(3)|lung(9)	15						TGGCCCAAGTATTTTTTTTAAT	0.356																																					p.V99fs		Atlas-Indel,Pindel	.											.	OR6C65	44	.	1	Deletion - Frameshift(1)	large_intestine(1)	c.297_298insT						.																																			SO:0001589	frameshift_variant	403282	exon1			.		CCDS31821.1	12q13.2	2013-09-23			ENSG00000205328	ENSG00000205328		"""GPCR / Class A : Olfactory receptors"""	31295	protein-coding gene	gene with protein product							Standard	NM_001005518		Approved		uc010spl.2	A6NJZ3	OTTHUMG00000169955	ENST00000379665.2:c.305dupT	chr12.hg19:g.55794617_55794617dupT	ENSP00000368986:p.Phe100fs	122.0	0.0		140.0	44.0	NM_001005518	B2RNH9	Frame_Shift_Ins	INS	ENST00000379665.2	hg19	CCDS31821.1																																																																																			.	.		0.356	OR6C65-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406674.1		
TLL2	7093	hgsc.bcm.edu	37	10	98145959	98145960	+	Frame_Shift_Ins	INS	-	-	C	rs374446747		TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr10:98145959_98145960insC	ENST00000357947.3	-	15	2090_2091	c.1865_1866insG	c.(1864-1866)ggtfs	p.G622fs		NM_012465.3	NP_036597.1	Q9Y6L7	TLL2_HUMAN	tolloid-like 2	622	CUB 3. {ECO:0000255|PROSITE- ProRule:PRU00059}.				cell differentiation (GO:0030154)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)	extracellular region (GO:0005576)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(15)|lung(22)|ovary(1)|pancreas(1)|prostate(1)|skin(3)	58		Colorectal(252;0.0846)		Epithelial(162;1.51e-07)|all cancers(201;7.59e-06)		TGGTAATGAAACCGCCACAGGC	0.545																																					p.G622fs		Atlas-INDEL	.											.	TLL2	122	.	0			c.1866_1867insG						.																																			SO:0001589	frameshift_variant	7093	exon15			.	AF059516	CCDS7449.1	10q23-q24	2008-07-29			ENSG00000095587	ENSG00000095587			11844	protein-coding gene	gene with protein product		606743				10516436	Standard	NM_012465		Approved		uc001kml.2	Q9Y6L7	OTTHUMG00000018833	ENST00000357947.3:c.1866dupG	chr10.hg19:g.98145961_98145961dupC	ENSP00000350630:p.Gly622fs	40.0	0.0		98.0	13.0	NM_012465	A6NDK0|Q2M1H1|Q6PJN5|Q9UQ00	Frame_Shift_Ins	INS	ENST00000357947.3	hg19	CCDS7449.1																																																																																			.	.		0.545	TLL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049608.1		
PRSS50	29122	hgsc.bcm.edu	37	3	46757122	46757123	+	Frame_Shift_Ins	INS	-	-	C			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr3:46757122_46757123insC	ENST00000460241.1	-	8	2042_2043	c.372_373insG	c.(370-375)tggcccfs	p.P125fs	PRSS50_ENST00000315170.7_Frame_Shift_Ins_p.P125fs			Q9UI38	TSP50_HUMAN	protease, serine, 50	125	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				proteolysis (GO:0006508)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)	serine-type endopeptidase activity (GO:0004252)|threonine-type endopeptidase activity (GO:0004298)			endometrium(2)|kidney(2)|large_intestine(1)|lung(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	11						ACCATCCAGGGCCACCGCCGAG	0.629																																					p.P125fs	Pancreas(41;915 1239 11561 17469)	Atlas-INDEL	.											.	PRSS50	35	.	0			c.373_374insG						.																																			SO:0001589	frameshift_variant	29122	exon3			.	AF100707	CCDS2745.1	3p21.31	2011-05-24			ENSG00000206549	ENSG00000206549		"""Serine peptidases / Serine peptidases"""	17910	protein-coding gene	gene with protein product	"""cancer/testis antigen 20"", ""testes specific protease 50"""	607950				10397268	Standard	NM_013270		Approved	TSP50, CT20	uc003cqe.1	Q9UI38	OTTHUMG00000164067	ENST00000460241.1:c.373dupG	chr3.hg19:g.46757124_46757124dupC	ENSP00000418875:p.Pro125fs	97.0	0.0		246.0	29.0	NM_013270		Frame_Shift_Ins	INS	ENST00000460241.1	hg19	CCDS2745.1																																																																																			.	.		0.629	PRSS50-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354544.1		
DFFB	1677	hgsc.bcm.edu	37	1	3786299	3786300	+	Frame_Shift_Ins	INS	-	-	C	rs374397595		TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr1:3786299_3786300insC	ENST00000378209.3	+	5	964_965	c.641_642insC	c.(640-645)ggcagcfs	p.S215fs	DFFB_ENST00000338895.3_Frame_Shift_Ins_p.S215fs	NM_004402.2	NP_004393.1	O76075	DFFB_HUMAN	DNA fragmentation factor, 40kDa, beta polypeptide (caspase-activated DNase)	215					apoptotic chromosome condensation (GO:0030263)|apoptotic DNA fragmentation (GO:0006309)|apoptotic process (GO:0006915)|brain development (GO:0007420)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)	cytosol (GO:0005829)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	deoxyribonuclease activity (GO:0004536)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)			endometrium(1)|large_intestine(3)|lung(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	12	all_cancers(77;0.0395)|Ovarian(185;0.0634)|all_lung(157;0.222)|Lung NSC(156;0.227)	all_cancers(23;2.05e-30)|all_epithelial(116;6.22e-21)|all_lung(118;2.65e-08)|Lung NSC(185;6.25e-06)|Breast(487;0.000659)|Renal(390;0.00121)|all_neural(13;0.0019)|Hepatocellular(190;0.00705)|Colorectal(325;0.0113)|all_hematologic(16;0.0194)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0308)|Lung SC(97;0.0548)|Medulloblastoma(700;0.211)		Epithelial(90;1.18e-39)|OV - Ovarian serous cystadenocarcinoma(86;7.28e-23)|GBM - Glioblastoma multiforme(42;2.95e-17)|Colorectal(212;1.23e-05)|COAD - Colon adenocarcinoma(227;5.94e-05)|Kidney(185;0.000371)|BRCA - Breast invasive adenocarcinoma(365;0.00038)|KIRC - Kidney renal clear cell carcinoma(229;0.00571)|STAD - Stomach adenocarcinoma(132;0.00645)|Lung(427;0.124)		GCCAAGGGCGGCAGCCGCCTCT	0.649																																					p.G214fs		Atlas-INDEL	.											.	DFFB	30	.	0			c.641_642insC						.																																			SO:0001589	frameshift_variant	1677	exon5			.		CCDS52.1, CCDS72693.1	1p36.3	2014-03-06	2002-08-29		ENSG00000169598	ENSG00000169598			2773	protein-coding gene	gene with protein product		601883				9108473, 9560346	Standard	NM_004402		Approved	CAD, CPAN, DFF-40, DFF40	uc001alc.3	O76075	OTTHUMG00000003525	ENST00000378209.3:c.642dupC	chr1.hg19:g.3786300_3786300dupC	ENSP00000367454:p.Ser215fs	100.0	0.0		198.0	13.0	NM_004402	O60521|Q5SR22|Q9BYI4|Q9BYI5|Q9BYI6	Frame_Shift_Ins	INS	ENST00000378209.3	hg19	CCDS52.1																																																																																			.	.		0.649	DFFB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000009821.2	NM_001282669	
CELSR3	1951	hgsc.bcm.edu	37	3	48691751	48691752	+	Frame_Shift_Ins	INS	-	-	C			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr3:48691751_48691752insC	ENST00000164024.4	-	7	5402_5403	c.5122_5123insG	c.(5122-5124)gctfs	p.A1708fs	CELSR3_ENST00000544264.1_Frame_Shift_Ins_p.A1708fs	NM_001407.2	NP_001398.2	Q9NYQ7	CELR3_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 3	1708	Laminin G-like 1. {ECO:0000255|PROSITE- ProRule:PRU00122}.				axonal fasciculation (GO:0007413)|cilium assembly (GO:0042384)|G-protein coupled receptor signaling pathway (GO:0007186)|homophilic cell adhesion (GO:0007156)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|regulation of protein localization (GO:0032880)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(1)|biliary_tract(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(23)|ovary(9)|prostate(6)|skin(7)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	83				BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00549)|Kidney(197;0.00619)		TGCGACAAAAGCCGCCATGTCC	0.584																																					p.A1708fs		Atlas-INDEL	.											.	CELSR3	237	.	0			c.5123_5124insG						.																																			SO:0001589	frameshift_variant	1951	exon7			.	AF231023	CCDS2775.1	3p21.31	2014-08-08	2013-02-18		ENSG00000008300	ENSG00000008300		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	3230	protein-coding gene	gene with protein product	"""flamingo homolog 1 (Drosophila)"""	604264	"""cadherin EGF LAG seven-pass G-type receptor 3, flamingo (Drosophila) homolog"""	EGFL1		9693030	Standard	NM_001407		Approved	MEGF2, HFMI1, FMI1, CDHF11	uc003cuf.1	Q9NYQ7	OTTHUMG00000133544	ENST00000164024.4:c.5123dupG	chr3.hg19:g.48691753_48691753dupC	ENSP00000164024:p.Ala1708fs	73.0	0.0		154.0	12.0	NM_001407	O75092	Frame_Shift_Ins	INS	ENST00000164024.4	hg19	CCDS2775.1																																																																																			.	.		0.584	CELSR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257523.1	NM_001407	
ALOX15B	247	hgsc.bcm.edu	37	17	7950032	7950032	+	Frame_Shift_Del	DEL	C	C	-	rs140152561		TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr17:7950032delC	ENST00000380183.4	+	9	1386	c.1247delC	c.(1246-1248)gccfs	p.A416fs	ALOX15B_ENST00000380173.2_Intron|ALOX15B_ENST00000573359.1_Intron|ALOX15B_ENST00000572022.1_Frame_Shift_Del_p.A416fs	NM_001141.2	NP_001132.2	O15296	LX15B_HUMAN	arachidonate 15-lipoxygenase, type B	416	Lipoxygenase. {ECO:0000255|PROSITE- ProRule:PRU00726}.				apoptotic process (GO:0006915)|arachidonic acid metabolic process (GO:0019369)|hepoxilin biosynthetic process (GO:0051122)|linoleic acid metabolic process (GO:0043651)|lipid metabolic process (GO:0006629)|lipoxygenase pathway (GO:0019372)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of growth (GO:0045926)|positive regulation of chemokine secretion (GO:0090197)|positive regulation of keratinocyte differentiation (GO:0045618)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|positive regulation of peroxisome proliferator activated receptor signaling pathway (GO:0035360)|prostate gland development (GO:0030850)|regulation of epithelial cell differentiation (GO:0030856)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|intracellular (GO:0005622)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	arachidonate 15-lipoxygenase activity (GO:0050473)|arachidonate 8(S)-lipoxygenase activity (GO:0036403)|calcium ion binding (GO:0005509)|iron ion binding (GO:0005506)|linoleate 13S-lipoxygenase activity (GO:0016165)|lipid binding (GO:0008289)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(3)|ovary(1)|prostate(2)|skin(2)|stomach(4)|upper_aerodigestive_tract(1)	24						AACACACTCGCCCGGGAGCTG	0.602																																					p.A416fs		Atlas-INDEL	.											.	ALOX15B	66	.	0			c.1246delG						.						66.0	55.0	59.0					17																	7950032		2203	4300	6503	SO:0001589	frameshift_variant	247	exon9			.	U78294	CCDS11128.1, CCDS32558.1, CCDS32559.1	17p13.1	2013-03-20	2006-01-16		ENSG00000179593	ENSG00000179593	1.13.11.33	"""Arachidonate lipoxygenases"""	434	protein-coding gene	gene with protein product		603697	"""arachidonate 15-lipoxygenase, second type"""			9177185	Standard	NM_001039130		Approved	15-LOX-2	uc002gju.3	O15296	OTTHUMG00000108181	ENST00000380183.4:c.1247delC	chr17.hg19:g.7950032delC	ENSP00000369530:p.Ala416fs	54.0	0.0		64.0	11.0	NM_001141	D3DTR2|Q8IYQ2|Q8TEV3|Q8TEV4|Q8TEV5|Q8TEV6|Q9UKM4	Frame_Shift_Del	DEL	ENST00000380183.4	hg19	CCDS11128.1																																																																																			.	.		0.602	ALOX15B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226985.2		
POLR1B	84172	hgsc.bcm.edu	37	2	113300082	113300083	+	Frame_Shift_Ins	INS	-	-	C			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr2:113300082_113300083insC	ENST00000263331.5	+	1	591_592	c.11_12insC	c.(10-15)ggcagcfs	p.S5fs	POLR1B_ENST00000417433.2_Frame_Shift_Ins_p.S5fs|POLR1B_ENST00000409894.3_Frame_Shift_Ins_p.S5fs|POLR1B_ENST00000537335.1_5'UTR|POLR1B_ENST00000541869.1_Frame_Shift_Ins_p.S43fs	NM_019014.4	NP_061887.2	Q9H9Y6	RPA2_HUMAN	polymerase (RNA) I polypeptide B, 128kDa	5					gene expression (GO:0010467)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription from RNA polymerase I promoter (GO:0006360)|transcription initiation from RNA polymerase I promoter (GO:0006361)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|metal ion binding (GO:0046872)|ribonucleoside binding (GO:0032549)			breast(3)|endometrium(9)|kidney(2)|large_intestine(9)|lung(14)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	42						ATGGATCCTGGCAGCCGGTGGC	0.644																																					p.G4fs	Ovarian(16;256 576 9537 23969 41147)	Atlas-INDEL	.											.	POLR1B	95	.	0			c.11_12insC						.																																			SO:0001589	frameshift_variant	84172	exon1			.	AK001678	CCDS2097.1, CCDS46395.1, CCDS62988.1, CCDS62989.1, CCDS62990.1	2q13	2013-01-21			ENSG00000125630	ENSG00000125630		"""RNA polymerase subunits"""	20454	protein-coding gene	gene with protein product		602000					Standard	NM_001137604		Approved	Rpo1-2, FLJ21921, FLJ10816, RPA2	uc002thw.2	Q9H9Y6	OTTHUMG00000131314	ENST00000263331.5:c.12dupC	chr2.hg19:g.113300083_113300083dupC	ENSP00000263331:p.Ser5fs	64.0	0.0		149.0	10.0	NM_019014	B7Z6Y7|B7Z823|F5GZX4|F8W898|Q2TAM4|Q585T5|Q6ZRR2|Q9H9D3	Frame_Shift_Ins	INS	ENST00000263331.5	hg19	CCDS2097.1																																																																																			.	.		0.644	POLR1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254083.1	NM_019014	
