#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ANKRD34A	284615	hgsc.bcm.edu	37	1	145474788	145474788	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-5261-01A-01D-A12Z-10	TCGA-CC-5261-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a2f143d6-ba07-4ff0-960d-b29c3c716665	5ad24cf2-db35-428a-a10f-50b2decbe482	g.chr1:145474788G>T	ENST00000323397.4	+	4	2753	c.1460G>T	c.(1459-1461)aGt>aTt	p.S487I	LIX1L_ENST00000369308.3_5'Flank|RP11-315I20.1_ENST00000600340.1_RNA	NM_001039888.2	NP_001034977.1	Q69YU3	AN34A_HUMAN	ankyrin repeat domain 34A	487						cytoplasm (GO:0005737)				endometrium(2)|kidney(2)|large_intestine(2)|lung(12)|prostate(1)|upper_aerodigestive_tract(1)	20	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					GGCTTCCAGAGTCTAGGTGGG	0.627																																					p.S487I		Atlas-SNP	.											.	ANKRD34A	52	.	0			c.G1460T						.						14.0	16.0	15.0					1																	145474788		2202	4299	6501	SO:0001583	missense	284615	exon4			TCCAGAGTCTAGG	AK128050	CCDS72874.1	1q21.1	2013-01-10	2007-11-20	2007-11-20	ENSG00000181039	ENSG00000272031		"""Ankyrin repeat domain containing"""	27639	protein-coding gene	gene with protein product			"""ankyrin repeat domain 34"""	ANKRD34			Standard	NM_001039888		Approved		uc001enq.1	Q69YU3	OTTHUMG00000013740	ENST00000323397.4:c.1460G>T	chr1.hg19:g.145474788G>T	ENSP00000314103:p.Ser487Ile	35.0	0.0		125.0	28.0	NM_001039888	B3KSU3	Missense_Mutation	SNP	ENST00000323397.4	hg19	CCDS30829.1	.	.	.	.	.	.	.	.	.	.	G	14.54	2.567226	0.45694	.	.	ENSG00000181039	ENST00000323397	T	0.72394	-0.65	4.95	4.95	0.65309	.	0.817225	0.11261	N	0.582578	T	0.40645	0.1125	N	0.22421	0.69	0.36766	D	0.883537	P	0.45126	0.851	B	0.35688	0.208	T	0.49204	-0.8964	10	0.87932	D	0	-8.3853	9.2048	0.37282	0.0957:0.0:0.9043:0.0	.	487	Q69YU3	AN34A_HUMAN	I	487	ENSP00000314103:S487I	ENSP00000314103:S487I	S	+	2	0	ANKRD34A	144186145	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	3.040000	0.49799	2.563000	0.86464	0.650000	0.86243	AGT	.	.		0.627	ANKRD34A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000038512.1		
OR10R2	343406	hgsc.bcm.edu	37	1	158450031	158450031	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-5261-01A-01D-A12Z-10	TCGA-CC-5261-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a2f143d6-ba07-4ff0-960d-b29c3c716665	5ad24cf2-db35-428a-a10f-50b2decbe482	g.chr1:158450031T>C	ENST00000368152.1	+	1	364	c.364T>C	c.(364-366)Ttc>Ctc	p.F122L	RP11-144L1.4_ENST00000426251.1_RNA|RP11-144L1.4_ENST00000419738.1_RNA	NM_001004472.1	NP_001004472.1	Q8NGX6	O10R2_HUMAN	olfactory receptor, family 10, subfamily R, member 2	122						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|liver(1)|lung(26)|pancreas(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	41	all_hematologic(112;0.0378)					TCTTCAAATGTTCTTCTTCCT	0.453																																					p.F122L		Atlas-SNP	.											.	OR10R2	81	.	0			c.T364C						.						401.0	335.0	357.0					1																	158450031		2203	4300	6503	SO:0001583	missense	343406	exon1			CAAATGTTCTTCT	AB065640	CCDS30898.1	1q23.1	2012-08-09			ENSG00000198965	ENSG00000198965		"""GPCR / Class A : Olfactory receptors"""	14820	protein-coding gene	gene with protein product							Standard	NM_001004472		Approved	OR10R2Q	uc010pik.2	Q8NGX6	OTTHUMG00000019632	ENST00000368152.1:c.364T>C	chr1.hg19:g.158450031T>C	ENSP00000357134:p.Phe122Leu	396.0	0.0		657.0	53.0	NM_001004472	Q5VWM8|Q6IFS1|Q96R61	Missense_Mutation	SNP	ENST00000368152.1	hg19	CCDS30898.1	.	.	.	.	.	.	.	.	.	.	t	21.6	4.174090	0.78452	.	.	ENSG00000198965	ENST00000368152	T	0.02067	4.47	4.48	4.48	0.54585	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.03477	0.0100	M	0.68728	2.09	0.36402	D	0.863218	P	0.50943	0.94	P	0.52424	0.698	T	0.41360	-0.9513	9	0.52906	T	0.07	.	12.8873	0.58051	0.0:0.0:0.0:1.0	.	122	Q8NGX6	O10R2_HUMAN	L	122	ENSP00000357134:F122L	ENSP00000357134:F122L	F	+	1	0	OR10R2	156716655	0.999000	0.42202	1.000000	0.80357	0.931000	0.56810	3.223000	0.51231	1.847000	0.53656	0.533000	0.62120	TTC	.	.		0.453	OR10R2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051847.2	NM_001004472	
ATP1A2	477	hgsc.bcm.edu	37	1	160106761	160106761	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-5261-01A-01D-A12Z-10	TCGA-CC-5261-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a2f143d6-ba07-4ff0-960d-b29c3c716665	5ad24cf2-db35-428a-a10f-50b2decbe482	g.chr1:160106761A>T	ENST00000361216.3	+	20	2869	c.2780A>T	c.(2779-2781)cAg>cTg	p.Q927L	ATP1A2_ENST00000392233.3_Missense_Mutation_p.Q927L	NM_000702.3	NP_000693.1	P50993	AT1A2_HUMAN	ATPase, Na+/K+ transporting, alpha 2 polypeptide	927					adult locomotory behavior (GO:0008344)|ATP biosynthetic process (GO:0006754)|ATP hydrolysis coupled proton transport (GO:0015991)|cardiac muscle contraction (GO:0060048)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular potassium ion homeostasis (GO:0030007)|cellular response to mechanical stimulus (GO:0071260)|cellular response to steroid hormone stimulus (GO:0071383)|cellular sodium ion homeostasis (GO:0006883)|ion transmembrane transport (GO:0034220)|locomotion (GO:0040011)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|negative regulation of heart contraction (GO:0045822)|negative regulation of striated muscle contraction (GO:0045988)|neurotransmitter uptake (GO:0001504)|potassium ion import (GO:0010107)|potassium ion transport (GO:0006813)|regulation of blood pressure (GO:0008217)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|regulation of smooth muscle contraction (GO:0006940)|regulation of striated muscle contraction (GO:0006942)|regulation of the force of heart contraction (GO:0002026)|regulation of vasoconstriction (GO:0019229)|relaxation of cardiac muscle (GO:0055119)|response to nicotine (GO:0035094)|sodium ion export from cell (GO:0036376)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)|visual learning (GO:0008542)	caveola (GO:0005901)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|endosome (GO:0005768)|plasma membrane (GO:0005886)|sodium:potassium-exchanging ATPase complex (GO:0005890)|synapse (GO:0045202)|T-tubule (GO:0030315)|vesicle (GO:0031982)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|metal ion binding (GO:0046872)|sodium:potassium-exchanging ATPase activity (GO:0005391)|steroid hormone binding (GO:1990239)			NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|lung(30)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	69	all_cancers(52;1.11e-16)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)|LUSC - Lung squamous cell carcinoma(543;0.246)			GTGGTGGTGCAGTGGGCTGAC	0.607																																					p.Q927L		Atlas-SNP	.											.	ATP1A2	167	.	0			c.A2780T						.						184.0	144.0	157.0					1																	160106761		2203	4300	6503	SO:0001583	missense	477	exon20			TGGTGCAGTGGGC	AB018321	CCDS1196.1	1q23.2	2014-09-17	2010-04-20		ENSG00000018625	ENSG00000018625	3.6.3.9	"""ATPases / P-type"""	800	protein-coding gene	gene with protein product	"""sodium/potassium-transporting ATPase subunit alpha-2"", ""sodium pump subunit alpha-2"", ""sodium-potassium ATPase catalytic subunit alpha-2"""	182340	"""migraine, hemiplegic 2"", ""ATPase, Na+/K+ transporting, alpha 2 (+) polypeptide"""	MHP2		9403481	Standard	NM_000702		Approved	FHM2	uc001fvc.3	P50993	OTTHUMG00000024080	ENST00000361216.3:c.2780A>T	chr1.hg19:g.160106761A>T	ENSP00000354490:p.Gln927Leu	116.0	0.0		286.0	52.0	NM_000702	D3DVE4|Q07059|Q5JW74|Q86UZ5|Q9UQ25	Missense_Mutation	SNP	ENST00000361216.3	hg19	CCDS1196.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	a|a	26.6|26.6	4.754991|4.754991	0.89843|0.89843	.|.	.|.	ENSG00000018625|ENSG00000018625	ENST00000361216;ENST00000392233;ENST00000435866|ENST00000447527	D;D|.	0.97256|.	-4.31;-4.31|.	4.65|4.65	4.65|4.65	0.58169|0.58169	ATPase, P-type cation-transporter, C-terminal (1);ATPase, P-type,  transmembrane domain (1);|.	0.060913|.	0.64402|.	D|.	0.000003|.	D|D	0.86251|0.86251	0.5888|0.5888	H|H	0.98295|0.98295	4.195|4.195	0.80722|0.80722	D|D	1|1	D;D|.	0.58268|.	0.977;0.982|.	D;D|.	0.67900|.	0.924;0.954|.	D|D	0.90695|0.90695	0.4616|0.4616	10|5	0.87932|.	D|.	0|.	.|.	12.3814|12.3814	0.55309|0.55309	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	827;927|.	F5GXJ7;P50993|.	.;AT1A2_HUMAN|.	L|C	927;927;630|621	ENSP00000354490:Q927L;ENSP00000376066:Q927L|.	ENSP00000354490:Q927L|.	Q|S	+|+	2|1	0|0	ATP1A2|ATP1A2	158373385|158373385	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.989000|0.989000	0.77384|0.77384	9.084000|9.084000	0.94076|0.94076	2.073000|2.073000	0.62155|0.62155	0.529000|0.529000	0.55759|0.55759	CAG|AGT	.	.		0.607	ATP1A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060642.2	NM_000702	
KIF26B	55083	hgsc.bcm.edu	37	1	245862258	245862258	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-5261-01A-01D-A12Z-10	TCGA-CC-5261-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a2f143d6-ba07-4ff0-960d-b29c3c716665	5ad24cf2-db35-428a-a10f-50b2decbe482	g.chr1:245862258G>A	ENST00000407071.2	+	14	6537	c.6097G>A	c.(6097-6099)Gcg>Acg	p.A2033T	KIF26B_ENST00000366518.4_Missense_Mutation_p.A1652T	NM_018012.3	NP_060482.2	Q2KJY2	KI26B_HUMAN	kinesin family member 26B	2033					establishment of cell polarity (GO:0030010)|metabolic process (GO:0008152)|positive regulation of cell-cell adhesion (GO:0022409)|ureteric bud invasion (GO:0072092)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(21)|ovary(4)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	51	all_cancers(71;3.86e-05)|all_epithelial(71;0.000121)|Ovarian(71;0.0412)|all_lung(81;0.0498)|Lung NSC(105;0.0708)|Breast(184;0.127)		OV - Ovarian serous cystadenocarcinoma(106;0.022)			CGAGGTCCGCGCGAAGTACGA	0.567																																					p.A2033T		Atlas-SNP	.											.	KIF26B	343	.	0			c.G6097A						.						73.0	80.0	78.0					1																	245862258		2105	4222	6327	SO:0001583	missense	55083	exon14			GTCCGCGCGAAGT	AK001019	CCDS44342.1	1q44	2008-02-05			ENSG00000162849	ENSG00000162849		"""Kinesins"""	25484	protein-coding gene	gene with protein product		614026					Standard	NM_018012		Approved	FLJ10157	uc001ibf.1	Q2KJY2	OTTHUMG00000040079	ENST00000407071.2:c.6097G>A	chr1.hg19:g.245862258G>A	ENSP00000385545:p.Ala2033Thr	76.0	0.0		172.0	8.0	NM_018012	Q6ZQR9|Q6ZUZ0|Q8IUN3|Q8IVR1|Q9NWB4	Missense_Mutation	SNP	ENST00000407071.2	hg19	CCDS44342.1	.	.	.	.	.	.	.	.	.	.	G	23.8	4.458239	0.84317	.	.	ENSG00000162849	ENST00000407071;ENST00000366518;ENST00000413001	D;D	0.82433	-1.61;-1.6	5.82	5.82	0.92795	.	.	.	.	.	D	0.90352	0.6981	M	0.65975	2.015	0.58432	D	0.999999	D	0.89917	1.0	D	0.66602	0.945	D	0.90525	0.4491	9	0.87932	D	0	.	20.099	0.97865	0.0:0.0:1.0:0.0	.	2033	Q2KJY2	KI26B_HUMAN	T	2033;1652;1649	ENSP00000385545:A2033T;ENSP00000355475:A1652T	ENSP00000355475:A1652T	A	+	1	0	KIF26B	243928881	1.000000	0.71417	0.991000	0.47740	0.678000	0.39670	9.838000	0.99474	2.752000	0.94435	0.655000	0.94253	GCG	.	.		0.567	KIF26B-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381037.1	XM_371354	
MAP3K2	10746	hgsc.bcm.edu	37	2	128075798	128075798	+	Nonsense_Mutation	SNP	C	C	A			TCGA-CC-5261-01A-01D-A12Z-10	TCGA-CC-5261-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a2f143d6-ba07-4ff0-960d-b29c3c716665	5ad24cf2-db35-428a-a10f-50b2decbe482	g.chr2:128075798C>A	ENST00000409947.1	-	13	1423	c.1141G>T	c.(1141-1143)Gaa>Taa	p.E381*	MAP3K2_ENST00000344908.5_Nonsense_Mutation_p.E381*|RNU6-1147P_ENST00000363380.1_RNA			Q9Y2U5	M3K2_HUMAN	mitogen-activated protein kinase kinase kinase 2	381	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of JUN kinase activity (GO:0007257)|activation of MAPK activity (GO:0000187)|cellular response to mechanical stimulus (GO:0071260)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|MAP kinase kinase kinase activity (GO:0004709)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)	p.E381*(1)		central_nervous_system(1)|large_intestine(1)|lung(3)|ovary(2)	7	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0706)	Bosutinib(DB06616)	ACAGCCAATTCTCTTCCTGTA	0.438																																					p.E381X		Atlas-SNP	.											MAP3K2_ENST00000409947,NS,carcinoma,0,5	MAP3K2	78	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.G1141T						.						109.0	106.0	107.0					2																	128075798		1862	4093	5955	SO:0001587	stop_gained	10746	exon12			CCAATTCTCTTCC	AF111105	CCDS46404.1	2q21.1	2011-06-09			ENSG00000169967	ENSG00000169967		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6854	protein-coding gene	gene with protein product	"""MAP/ERK kinase kinase 2"""	609487		MEKK2		8621389, 10085062	Standard	NM_006609		Approved	MEKK2B	uc002toj.2	Q9Y2U5	OTTHUMG00000153397	ENST00000409947.1:c.1141G>T	chr2.hg19:g.128075798C>A	ENSP00000387246:p.Glu381*	118.0	0.0		114.0	13.0	NM_006609	B9EG87|Q53QL9|Q53S75|Q59GZ6|Q8NC32|Q9NYK3	Nonsense_Mutation	SNP	ENST00000409947.1	hg19	CCDS46404.1	.	.	.	.	.	.	.	.	.	.	C	39	7.772382	0.98480	.	.	ENSG00000169967	ENST00000409947;ENST00000344908	.	.	.	5.69	4.81	0.61882	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	.	16.6685	0.85259	0.0:0.8701:0.1299:0.0	.	.	.	.	X	381	.	ENSP00000343463:E381X	E	-	1	0	MAP3K2	127792268	1.000000	0.71417	0.998000	0.56505	0.981000	0.71138	7.734000	0.84928	1.389000	0.46526	-0.291000	0.09656	GAA	.	.		0.438	MAP3K2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331014.1	NM_006609	
PIKFYVE	200576	hgsc.bcm.edu	37	2	209190043	209190043	+	Silent	SNP	C	C	T			TCGA-CC-5261-01A-01D-A12Z-10	TCGA-CC-5261-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a2f143d6-ba07-4ff0-960d-b29c3c716665	5ad24cf2-db35-428a-a10f-50b2decbe482	g.chr2:209190043C>T	ENST00000264380.4	+	20	2666	c.2508C>T	c.(2506-2508)ggC>ggT	p.G836G		NM_015040.3	NP_055855.2	Q9Y2I7	FYV1_HUMAN	phosphoinositide kinase, FYVE finger containing	836					cellular protein metabolic process (GO:0044267)|intracellular signal transduction (GO:0035556)|myelin assembly (GO:0032288)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phospholipid metabolic process (GO:0006644)|protein localization to nucleus (GO:0034504)|retrograde transport, endosome to Golgi (GO:0042147)|small molecule metabolic process (GO:0044281)	cell-cell junction (GO:0005911)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|early endosome membrane (GO:0031901)|endosome membrane (GO:0010008)|Golgi membrane (GO:0000139)|late endosome membrane (GO:0031902)|membrane raft (GO:0045121)|perinuclear region of cytoplasm (GO:0048471)|vesicle membrane (GO:0012506)	1-phosphatidylinositol-3-phosphate 5-kinase activity (GO:0000285)|1-phosphatidylinositol-4-phosphate 5-kinase activity (GO:0016308)|ATP binding (GO:0005524)|phosphatidylinositol-3,5-bisphosphate 5-phosphatase activity (GO:0043813)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(14)|kidney(6)|large_intestine(25)|lung(40)|ovary(7)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	107						AGCACCTAGGCTGTACAATCA	0.398																																					p.G836G		Atlas-SNP	.											.	PIKFYVE	223	.	0			c.C2508T						.						80.0	74.0	76.0					2																	209190043		2203	4300	6503	SO:0001819	synonymous_variant	200576	exon20			CCTAGGCTGTACA	AB023198	CCDS2382.1, CCDS33368.1, CCDS54431.1	2q34	2014-01-15	2009-04-17	2009-04-17	ENSG00000115020	ENSG00000115020		"""Zinc fingers, FYVE domain containing"""	23785	protein-coding gene	gene with protein product	"""zinc finger, FYVE domain containing 29"""	609414	"""phosphatidylinositol-3-phosphate/phosphatidylinositol 5-kinase, type III"""	PIP5K3		9858586, 12270933	Standard	NM_015040		Approved	MGC40423, KIAA0981, PIKfyve, PIP5K, p235, ZFYVE29, FAB1	uc002vcz.3	Q9Y2I7	OTTHUMG00000132945	ENST00000264380.4:c.2508C>T	chr2.hg19:g.209190043C>T		153.0	0.0		158.0	23.0	NM_015040	Q08AR7|Q08AR8|Q53ST3|Q53T36|Q8N5H0|Q8NB67	Silent	SNP	ENST00000264380.4	hg19	CCDS2382.1																																																																																			.	.		0.398	PIKFYVE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256477.2	NM_015040	
DLEC1	9940	hgsc.bcm.edu	37	3	38150949	38150949	+	Silent	SNP	T	T	A			TCGA-CC-5261-01A-01D-A12Z-10	TCGA-CC-5261-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a2f143d6-ba07-4ff0-960d-b29c3c716665	5ad24cf2-db35-428a-a10f-50b2decbe482	g.chr3:38150949T>A	ENST00000308059.6	+	22	3177	c.3156T>A	c.(3154-3156)ccT>ccA	p.P1052P	DLEC1_ENST00000452631.2_Silent_p.P1052P|DLEC1_ENST00000346219.3_Silent_p.P1052P					deleted in lung and esophageal cancer 1											NS(1)|breast(3)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(14)|ovary(3)|pancreas(3)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)	51				KIRC - Kidney renal clear cell carcinoma(284;0.0664)|Kidney(284;0.0827)		TGGCCCTCCCTTGTCACGTGT	0.562																																					p.P1052P		Atlas-SNP	.											.	DLEC1	278	.	0			c.T3156A						.						95.0	95.0	95.0					3																	38150949		1902	4128	6030	SO:0001819	synonymous_variant	9940	exon22			CCTCCCTTGTCAC	AB020522	CCDS2672.2	3p21.3	2014-07-31			ENSG00000008226	ENSG00000008226			2899	protein-coding gene	gene with protein product	"""cilia and flagella associated protein 81"""	604050				10213508	Standard	XM_005265630		Approved	DLC1, CFAP81	uc003chp.1	Q9Y238	OTTHUMG00000131085	ENST00000308059.6:c.3156T>A	chr3.hg19:g.38150949T>A		65.0	0.0		78.0	11.0	NM_007337		Silent	SNP	ENST00000308059.6	hg19	CCDS2672.2																																																																																			.	.		0.562	DLEC1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000253745.3	NM_007337	
ROBO2	6092	hgsc.bcm.edu	37	3	77607249	77607250	+	Missense_Mutation	DNP	TC	TC	AT			TCGA-CC-5261-01A-01D-A12Z-10	TCGA-CC-5261-10A-01D-A12Z-10	T|C	T|C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a2f143d6-ba07-4ff0-960d-b29c3c716665	5ad24cf2-db35-428a-a10f-50b2decbe482	g.chr3:77607249_77607250TC>AT	ENST00000461745.1	+	9	2286_2287	c.1386_1387TC>AT	c.(1384-1389)gaTCca>gaATca	p.462_463DP>ES	ROBO2_ENST00000487694.3_Missense_Mutation_p.478_479DP>ES|ROBO2_ENST00000332191.8_Missense_Mutation_p.462_463DP>ES	NM_002942.4	NP_002933.1	Q9HCK4	ROBO2_HUMAN	roundabout, axon guidance receptor, homolog 2 (Drosophila)	462	Ig-like C2-type 5.				apoptotic process involved in luteolysis (GO:0061364)|axon guidance (GO:0007411)|axon midline choice point recognition (GO:0016199)|brain development (GO:0007420)|cellular response to hormone stimulus (GO:0032870)|central nervous system development (GO:0007417)|homophilic cell adhesion (GO:0007156)|metanephros development (GO:0001656)|negative regulation of negative chemotaxis (GO:0050925)|negative regulation of synapse assembly (GO:0051964)|olfactory bulb interneuron development (GO:0021891)|positive regulation of axonogenesis (GO:0050772)|retinal ganglion cell axon guidance (GO:0031290)|ureteric bud development (GO:0001657)	axolemma (GO:0030673)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	axon guidance receptor activity (GO:0008046)|identical protein binding (GO:0042802)			NS(1)|biliary_tract(5)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(23)|liver(1)|lung(52)|ovary(2)|pancreas(2)|prostate(5)|skin(8)|upper_aerodigestive_tract(1)	117				Epithelial(33;0.00199)|LUSC - Lung squamous cell carcinoma(21;0.008)|BRCA - Breast invasive adenocarcinoma(55;0.00884)|Lung(72;0.0183)|KIRC - Kidney renal clear cell carcinoma(39;0.0832)|Kidney(39;0.103)		CGGGTAGAGATCCAAGAGCAAC	0.406																																					p.D462E|p.P463S		Atlas-SNP	.											.	ROBO2	527	.	0			c.T1386A|c.C1387T						.																																			SO:0001583	missense	6092	exon9			TAGAGATCCAAGA|AGAGATCCAAGAG	AF040991	CCDS43109.1, CCDS54609.1	3p12.3	2013-02-11	2001-11-28		ENSG00000185008	ENSG00000185008		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	10250	protein-coding gene	gene with protein product		602431	"""roundabout (axon guidance receptor, Drosophila) homolog 2"""			9458045	Standard	NM_002942		Approved	KIAA1568	uc003dpy.4	Q9HCK4	OTTHUMG00000158935	Exception_encountered	chr3.hg19:g.77607249_77607250delinsAT	ENSP00000417164:p.D462_P463delinsES	114.0|116.0	0.0		165.0|163.0	65.0|64.0	NM_002942	O43608|Q19AB4|Q19AB5	Missense_Mutation	SNP	ENST00000461745.1	hg19	CCDS43109.1																																																																																			.	.		0.406	ROBO2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000352600.2	XM_031246	
GTPBP8	29083	hgsc.bcm.edu	37	3	112711969	112711969	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-5261-01A-01D-A12Z-10	TCGA-CC-5261-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a2f143d6-ba07-4ff0-960d-b29c3c716665	5ad24cf2-db35-428a-a10f-50b2decbe482	g.chr3:112711969C>A	ENST00000383678.2	+	2	515	c.433C>A	c.(433-435)Cca>Aca	p.P145T	GTPBP8_ENST00000467752.1_Missense_Mutation_p.P34T|GTPBP8_ENST00000383677.3_Intron|GTPBP8_ENST00000473129.1_5'UTR|RP11-484K9.4_ENST00000609673.1_RNA	NM_014170.2	NP_054889.2	Q8N3Z3	GTPB8_HUMAN	GTP-binding protein 8 (putative)	145	EngB-type G.				barrier septum assembly (GO:0000917)	mitochondrion (GO:0005739)	GTP binding (GO:0005525)|metal ion binding (GO:0046872)			kidney(1)|large_intestine(2)|lung(2)|upper_aerodigestive_tract(1)	6						CTCCAAAAAACCAGTATGTTG	0.333																																					p.P145T		Atlas-SNP	.											.	GTPBP8	22	.	0			c.C433A						.						97.0	97.0	97.0					3																	112711969		2203	4300	6503	SO:0001583	missense	29083	exon2			AAAAAACCAGTAT	BC037163	CCDS33820.1, CCDS33821.1	3q13.2	2008-02-05			ENSG00000163607	ENSG00000163607			25007	protein-coding gene	gene with protein product							Standard	NM_014170		Approved	HSPC135	uc003dzn.3	Q8N3Z3	OTTHUMG00000159268	ENST00000383678.2:c.433C>A	chr3.hg19:g.112711969C>A	ENSP00000373176:p.Pro145Thr	360.0	0.0		284.0	17.0	NM_014170	A6NE99|A6NN11|A8K0P6|Q5I0Y4	Missense_Mutation	SNP	ENST00000383678.2	hg19	CCDS33820.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	22.5|22.5	4.301768|4.301768	0.81136|0.81136	.|.	.|.	ENSG00000163607|ENSG00000163607	ENST00000305485|ENST00000383678;ENST00000467752	.|T;T	.|0.22743	.|1.94;1.94	5.65|5.65	5.65|5.65	0.86999|0.86999	.|GTP-binding domain, HSR1-related (1);	1.009650|.	0.07954|.	N|.	0.981389|.	T|T	0.59046|0.59046	0.2165|0.2165	H|H	0.95470|0.95470	3.675|3.675	0.80722|0.80722	D|D	1|1	.|D	.|0.59767	.|0.986	.|P	.|0.62885	.|0.908	T|T	0.72141|0.72141	-0.4380|-0.4380	7|9	0.52906|0.87932	T|D	0.07|0	-28.0696|-28.0696	18.5031|18.5031	0.90889|0.90889	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|145	.|Q8N3Z3	.|GTPB8_HUMAN	K|T	168|145;34	.|ENSP00000373176:P145T;ENSP00000417632:P34T	ENSP00000303802:N168K|ENSP00000373176:P145T	N|P	+|+	3|1	2|0	GTPBP8|GTPBP8	114194659|114194659	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.902000|0.902000	0.53008|0.53008	6.916000|6.916000	0.75776|0.75776	2.661000|2.661000	0.90470|0.90470	0.467000|0.467000	0.42956|0.42956	AAC|CCA	.	.		0.333	GTPBP8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354260.2	NM_014170	
CPZ	8532	hgsc.bcm.edu	37	4	8605903	8605903	+	Nonsense_Mutation	SNP	C	C	T			TCGA-CC-5261-01A-01D-A12Z-10	TCGA-CC-5261-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a2f143d6-ba07-4ff0-960d-b29c3c716665	5ad24cf2-db35-428a-a10f-50b2decbe482	g.chr4:8605903C>T	ENST00000360986.4	+	4	871	c.697C>T	c.(697-699)Cag>Tag	p.Q233*	CPZ_ENST00000382480.2_Nonsense_Mutation_p.Q96*|CPZ_ENST00000315782.6_Nonsense_Mutation_p.Q222*|CPZ_ENST00000429646.2_5'UTR	NM_001014447.2	NP_001014447	Q66K79	CBPZ_HUMAN	carboxypeptidase Z	233					proteolysis (GO:0006508)|Wnt signaling pathway (GO:0016055)	extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)			cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(23)|ovary(3)|pancreas(1)|skin(1)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	46						CCGCCCCGGCCAGCACGAGCT	0.692																																					p.Q233X		Atlas-SNP	.											.	CPZ	95	.	0			c.C697T						.						9.0	10.0	9.0					4																	8605903		2179	4266	6445	SO:0001587	stop_gained	8532	exon4			CCCGGCCAGCACG	U83411	CCDS3404.1, CCDS33953.1, CCDS43212.1	4p16.1	2012-02-10			ENSG00000109625	ENSG00000109625			2333	protein-coding gene	gene with protein product	"""metallocarboxypeptidase Z"""	603105				9099699	Standard	NM_001014447		Approved		uc003glm.3	Q66K79	OTTHUMG00000090513	ENST00000360986.4:c.697C>T	chr4.hg19:g.8605903C>T	ENSP00000354255:p.Gln233*	55.0	0.0		88.0	46.0	NM_001014447	O00520|Q96MX2	Nonsense_Mutation	SNP	ENST00000360986.4	hg19	CCDS33953.1	.	.	.	.	.	.	.	.	.	.	C	38	6.749772	0.97809	.	.	ENSG00000109625	ENST00000360986;ENST00000382480;ENST00000315782	.	.	.	3.86	3.86	0.44501	.	0.477193	0.23416	N	0.048414	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.20046	T	0.44	-25.9624	15.9374	0.79723	0.0:1.0:0.0:0.0	.	.	.	.	X	233;96;222	.	ENSP00000315074:Q222X	Q	+	1	0	CPZ	8656803	0.923000	0.31300	1.000000	0.80357	0.884000	0.51177	1.265000	0.33027	1.973000	0.57446	0.555000	0.69702	CAG	.	.		0.692	CPZ-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000207001.4	NM_003652	
FBN2	2201	hgsc.bcm.edu	37	5	127873149	127873149	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-5261-01A-01D-A12Z-10	TCGA-CC-5261-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a2f143d6-ba07-4ff0-960d-b29c3c716665	5ad24cf2-db35-428a-a10f-50b2decbe482	g.chr5:127873149C>A	ENST00000508053.1	-	7	1122	c.148G>T	c.(148-150)Gct>Tct	p.A50S	FBN2_ENST00000508989.1_Missense_Mutation_p.A50S|FBN2_ENST00000262464.4_Missense_Mutation_p.A50S			P35556	FBN2_HUMAN	fibrillin 2	50					anatomical structure morphogenesis (GO:0009653)|bone trabecula formation (GO:0060346)|embryonic limb morphogenesis (GO:0030326)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|sequestering of TGFbeta in extracellular matrix (GO:0035583)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(37)|liver(1)|lung(89)|ovary(9)|pancreas(2)|prostate(6)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	197		all_cancers(142;0.0216)|Prostate(80;0.0551)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)		CCTGCTGTAGCGGACCGAACC	0.736																																					p.A50S		Atlas-SNP	.											.	FBN2	858	.	0			c.G148T						.						13.0	16.0	15.0					5																	127873149		2191	4290	6481	SO:0001583	missense	2201	exon1			CTGTAGCGGACCG	U03272	CCDS34222.1	5q23-q31	2008-08-01	2008-08-01			ENSG00000138829			3604	protein-coding gene	gene with protein product	"""fibrillin 5"""	612570	"""congenital contractural arachnodactyly"""	CCA		1852206, 8120105	Standard	NM_001999		Approved	DA9	uc003kuu.3	P35556		ENST00000508053.1:c.148G>T	chr5.hg19:g.127873149C>A	ENSP00000424571:p.Ala50Ser	17.0	0.0		51.0	16.0	NM_001999	B4DU01|Q59ES6	Missense_Mutation	SNP	ENST00000508053.1	hg19	CCDS34222.1	.	.	.	.	.	.	.	.	.	.	C	13.35	2.210148	0.39003	.	.	ENSG00000138829	ENST00000262464;ENST00000508053;ENST00000508989;ENST00000502468	D;D;D;T	0.85773	-1.82;-1.82;-2.03;-0.59	4.92	4.92	0.64577	.	0.000000	0.51477	D	0.000091	T	0.69806	0.3152	N	0.08118	0	0.25687	N	0.98574	P;P;P;B	0.47034	0.777;0.789;0.889;0.358	B;B;B;B	0.41236	0.241;0.17;0.351;0.122	T	0.63708	-0.6576	10	0.29301	T	0.29	.	10.8968	0.47027	0.0:0.911:0.0:0.089	.	50;50;50;50	P35556-2;E9PHW4;D6RJI3;P35556	.;.;.;FBN2_HUMAN	S	50	ENSP00000262464:A50S;ENSP00000424571:A50S;ENSP00000425596:A50S;ENSP00000424753:A50S	ENSP00000262464:A50S	A	-	1	0	FBN2	127901048	0.615000	0.27026	0.991000	0.47740	0.144000	0.21451	1.017000	0.29989	2.431000	0.82371	0.591000	0.81541	GCT	.	.		0.736	FBN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371618.2	NM_001999	
SH3TC2	79628	hgsc.bcm.edu	37	5	148407322	148407322	+	Missense_Mutation	SNP	C	C	T	rs138040787		TCGA-CC-5261-01A-01D-A12Z-10	TCGA-CC-5261-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a2f143d6-ba07-4ff0-960d-b29c3c716665	5ad24cf2-db35-428a-a10f-50b2decbe482	g.chr5:148407322C>T	ENST00000515425.1	-	11	2074	c.1973G>A	c.(1972-1974)cGc>cAc	p.R658H	SH3TC2_ENST00000512049.1_Missense_Mutation_p.R651H|SH3TC2_ENST00000394358.2_Missense_Mutation_p.R543H|SH3TC2_ENST00000513340.1_5'Flank|SH3TC2_ENST00000538184.1_Missense_Mutation_p.R205H	NM_024577.3	NP_078853.2	Q8TF17	S3TC2_HUMAN	SH3 domain and tetratricopeptide repeats 2	658			R -> C (in CMT4C; heterozygous in one German patient with affected sibling). {ECO:0000269|PubMed:14574644}.		cell death (GO:0008219)|peripheral nervous system myelin maintenance (GO:0032287)|regulation of ERBB signaling pathway (GO:1901184)|regulation of intracellular protein transport (GO:0033157)	cytoplasmic vesicle (GO:0031410)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)				breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(12)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	39			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GAGCTGCAGGCGCTCGGCAAA	0.617																																					p.R658H		Atlas-SNP	.											.	SH3TC2	178	.	0			c.G1973A						.	C	HIS/ARG	0,4406		0,0,2203	47.0	54.0	52.0		1973	6.2	1.0	5	dbSNP_134	52	3,8597	3.0+/-9.4	0,3,4297	yes	missense	SH3TC2	NM_024577.3	29	0,3,6500	TT,TC,CC		0.0349,0.0,0.0231	possibly-damaging	658/1289	148407322	3,13003	2203	4300	6503	SO:0001583	missense	79628	exon11			TGCAGGCGCTCGG	AK127248	CCDS4293.1	5q32	2014-09-17			ENSG00000169247	ENSG00000169247		"""Tetratricopeptide (TTC) repeat domain containing"""	29427	protein-coding gene	gene with protein product		608206				14574644	Standard	NM_024577		Approved	KIAA1985, CMT4C	uc003lpu.3	Q8TF17	OTTHUMG00000129930	ENST00000515425.1:c.1973G>A	chr5.hg19:g.148407322C>T	ENSP00000423660:p.Arg658His	46.0	0.0		60.0	14.0	NM_024577	B3KWE5|Q14CC0|Q14CF5|Q9H8I5	Missense_Mutation	SNP	ENST00000515425.1	hg19	CCDS4293.1	.	.	.	.	.	.	.	.	.	.	C	15.79	2.938799	0.52972	0.0	3.49E-4	ENSG00000169247	ENST00000538184;ENST00000515425;ENST00000512049;ENST00000394358	T;T;T;T	0.65916	-0.18;-0.18;-0.18;-0.18	6.16	6.16	0.99307	Tetratricopeptide-like helical (1);	0.000000	0.85682	D	0.000000	T	0.59459	0.2195	M	0.67700	2.07	0.54753	D	0.999983	P;D;D;D	0.58268	0.896;0.982;0.982;0.982	B;B;B;B	0.41571	0.189;0.36;0.36;0.36	T	0.62817	-0.6774	10	0.44086	T	0.13	-17.8698	11.6865	0.51490	0.0:0.8957:0.0:0.1043	.	543;651;658;658	C9JLC3;Q14CC0;E9PDF1;Q8TF17	.;.;.;S3TC2_HUMAN	H	205;658;651;543	ENSP00000441427:R205H;ENSP00000423660:R658H;ENSP00000421860:R651H;ENSP00000377886:R543H	ENSP00000377886:R543H	R	-	2	0	SH3TC2	148387515	0.996000	0.38824	0.985000	0.45067	0.827000	0.46813	3.263000	0.51546	2.937000	0.99478	0.650000	0.86243	CGC	.	C|1.000;T|0.000		0.617	SH3TC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252186.2	NM_024577	
PRSS16	10279	hgsc.bcm.edu	37	6	27218849	27218849	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-5261-01A-01D-A12Z-10	TCGA-CC-5261-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a2f143d6-ba07-4ff0-960d-b29c3c716665	5ad24cf2-db35-428a-a10f-50b2decbe482	g.chr6:27218849C>T	ENST00000230582.3	+	6	635	c.620C>T	c.(619-621)gCc>gTc	p.A207V	PRSS16_ENST00000421826.2_Intron	NM_005865.3	NP_005856.1	Q9NQE7	TSSP_HUMAN	protease, serine, 16 (thymus)	207					protein catabolic process (GO:0030163)	cytoplasmic vesicle (GO:0031410)|endosome (GO:0005768)|lysosome (GO:0005764)	serine-type peptidase activity (GO:0008236)			central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(5)|lung(9)|ovary(3)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	26						GCGTCGGTCGCCTCCTCCGCC	0.642																																					p.A207V	NSCLC(178;1118 2105 17078 23587 44429)	Atlas-SNP	.											.	PRSS16	66	.	0			c.C620T						.						68.0	77.0	74.0					6																	27218849		2203	4300	6503	SO:0001583	missense	10279	exon6			CGGTCGCCTCCTC	AF052514	CCDS4623.1	6p21	2010-05-07			ENSG00000112812	ENSG00000112812		"""Serine peptidases / Serine peptidases"""	9480	protein-coding gene	gene with protein product		607169				10527559	Standard	NM_005865		Approved	TSSP	uc003nja.3	Q9NQE7	OTTHUMG00000016167	ENST00000230582.3:c.620C>T	chr6.hg19:g.27218849C>T	ENSP00000230582:p.Ala207Val	69.0	0.0		115.0	26.0	NM_005865	O75416	Missense_Mutation	SNP	ENST00000230582.3	hg19	CCDS4623.1	.	.	.	.	.	.	.	.	.	.	C	23.3	4.398981	0.83120	.	.	ENSG00000112812	ENST00000230582;ENST00000343467	T	0.26660	1.72	3.87	3.87	0.44632	.	0.000000	0.85682	D	0.000000	T	0.45597	0.1350	M	0.86740	2.835	0.51482	D	0.999928	D;P	0.69078	0.997;0.736	D;B	0.79108	0.992;0.367	T	0.50206	-0.8855	10	0.62326	D	0.03	-11.4193	11.6135	0.51074	0.0:1.0:0.0:0.0	.	207;207	C9JI59;Q9NQE7	.;TSSP_HUMAN	V	207	ENSP00000230582:A207V	ENSP00000230582:A207V	A	+	2	0	PRSS16	27326828	1.000000	0.71417	1.000000	0.80357	0.905000	0.53344	2.658000	0.46733	2.456000	0.83038	0.563000	0.77884	GCC	.	.		0.642	PRSS16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043418.2		
C6orf136	221545	hgsc.bcm.edu	37	6	30615170	30615170	+	Intron	SNP	C	C	T	rs372110822	byFrequency	TCGA-CC-5261-01A-01D-A12Z-10	TCGA-CC-5261-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a2f143d6-ba07-4ff0-960d-b29c3c716665	5ad24cf2-db35-428a-a10f-50b2decbe482	g.chr6:30615170C>T	ENST00000376473.5	+	1	231				AL662800.2_ENST00000583820.1_RNA|C6orf136_ENST00000376471.4_Intron|C6orf136_ENST00000493705.1_Intron|C6orf136_ENST00000293604.6_Silent_p.S54S|C6orf136_ENST00000528347.2_5'Flank	NM_001109938.2	NP_001103408.1	Q5SQH8	CF136_HUMAN	chromosome 6 open reading frame 136							mitochondrion (GO:0005739)				endometrium(1)|large_intestine(2)|lung(6)|ovary(1)	10						CGCTGGGTTCCGCGCAGGCGC	0.746													C|||	11	0.00219649	0.0	0.0	5008	,	,		10938	0.0109		0.0	False		,,,				2504	0.0				p.S54S		Atlas-SNP	.											.	C6orf136	31	.	0			c.C162T						.						2.0	3.0	3.0					6																	30615170		487	1257	1744	SO:0001627	intron_variant	221545	exon1			GGGTTCCGCGCAG	BC016167	CCDS4684.1, CCDS43443.1, CCDS4684.2, CCDS54979.1	6p21.32	2012-02-06			ENSG00000204564	ENSG00000204564			21301	protein-coding gene	gene with protein product							Standard	NM_001109938		Approved	Em:AB023049.8	uc003nqx.4	Q5SQH8	OTTHUMG00000031221	ENST00000376473.5:c.72+90C>T	chr6.hg19:g.30615170C>T		1.0	0.0		16.0	5.0	NM_001161376	A9R9P9|F8VX15|Q5SU01|Q6ZSB7|Q8TB84	Silent	SNP	ENST00000376473.5	hg19	CCDS43443.1																																																																																			.	.		0.746	C6orf136-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076457.4	NM_145029	
ALDH8A1	64577	hgsc.bcm.edu	37	6	135265052	135265052	+	Missense_Mutation	SNP	C	C	T	rs200812012		TCGA-CC-5261-01A-01D-A12Z-10	TCGA-CC-5261-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a2f143d6-ba07-4ff0-960d-b29c3c716665	5ad24cf2-db35-428a-a10f-50b2decbe482	g.chr6:135265052C>T	ENST00000265605.2	-	2	259	c.191G>A	c.(190-192)cGc>cAc	p.R64H	ALDH8A1_ENST00000367845.2_Missense_Mutation_p.R64H|ALDH8A1_ENST00000367847.2_Missense_Mutation_p.R64H|RP11-349J5.2_ENST00000416448.2_RNA	NM_022568.3	NP_072090.1	Q9H2A2	AL8A1_HUMAN	aldehyde dehydrogenase 8 family, member A1	64					9-cis-retinoic acid biosynthetic process (GO:0042904)|retinal metabolic process (GO:0042574)|retinoic acid metabolic process (GO:0042573)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)	retinal dehydrogenase activity (GO:0001758)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(16)|ovary(2)|pancreas(1)|prostate(1)|skin(2)	36	Colorectal(23;0.221)			OV - Ovarian serous cystadenocarcinoma(155;0.00401)|GBM - Glioblastoma multiforme(68;0.0058)		CTGGGGGCTGCGGGATGACCA	0.592																																					p.R64H		Atlas-SNP	.											.	ALDH8A1	68	.	0			c.G191A						.						45.0	49.0	47.0					6																	135265052		2203	4300	6503	SO:0001583	missense	64577	exon2			GGGCTGCGGGATG	AL021939	CCDS5171.1, CCDS5172.1, CCDS55057.1	6q24.1-q25.1	2008-07-03			ENSG00000118514	ENSG00000118514		"""Aldehyde dehydrogenases"""	15471	protein-coding gene	gene with protein product		606467				11007799	Standard	NM_001193480		Approved	ALDH12	uc003qew.3	Q9H2A2	OTTHUMG00000015623	ENST00000265605.2:c.191G>A	chr6.hg19:g.135265052C>T	ENSP00000265605:p.Arg64His	33.0	0.0		41.0	27.0	NM_022568	B7Z521|O60793|Q24JS9|Q53GT3|Q5TI80	Missense_Mutation	SNP	ENST00000265605.2	hg19	CCDS5171.1	.	.	.	.	.	.	.	.	.	.	c	11.91	1.780245	0.31502	.	.	ENSG00000118514	ENST00000265605;ENST00000367845;ENST00000367847	T;T;T	0.76186	-1.0;-1.0;1.53	6.07	0.0747	0.14396	Aldehyde dehydrogenase domain (1);Aldehyde dehydrogenase, N-terminal (1);Aldehyde/histidinol dehydrogenase (1);	0.550434	0.19098	N	0.122762	T	0.38612	0.1047	L	0.41710	1.295	0.09310	N	1	B;B;B	0.17038	0.02;0.016;0.02	B;B;B	0.13407	0.009;0.005;0.009	T	0.29088	-1.0023	10	0.59425	D	0.04	.	2.1588	0.03819	0.1224:0.3694:0.1202:0.388	.	64;64;64	B7Z521;Q9H2A2-2;Q9H2A2	.;.;AL8A1_HUMAN	H	64	ENSP00000265605:R64H;ENSP00000356819:R64H;ENSP00000356821:R64H	ENSP00000265605:R64H	R	-	2	0	ALDH8A1	135306745	0.004000	0.15560	0.525000	0.27900	0.798000	0.45092	0.448000	0.21726	0.476000	0.27440	-0.235000	0.12190	CGC	.	.		0.592	ALDH8A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042334.2		
NMBR	4829	hgsc.bcm.edu	37	6	142396836	142396836	+	Silent	SNP	G	G	C			TCGA-CC-5261-01A-01D-A12Z-10	TCGA-CC-5261-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a2f143d6-ba07-4ff0-960d-b29c3c716665	5ad24cf2-db35-428a-a10f-50b2decbe482	g.chr6:142396836G>C	ENST00000258042.1	-	3	1262	c.1122C>G	c.(1120-1122)acC>acG	p.T374T	NMBR_ENST00000480652.1_Intron	NM_002511.2	NP_002502.2	P28336	NMBR_HUMAN	neuromedin B receptor	374					G-protein coupled receptor signaling pathway (GO:0007186)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	bombesin receptor activity (GO:0004946)			breast(2)|central_nervous_system(3)|endometrium(3)|large_intestine(3)|lung(8)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	23	Breast(32;0.155)			OV - Ovarian serous cystadenocarcinoma(155;9.93e-06)|GBM - Glioblastoma multiforme(68;0.0013)		AAACAGAATTGGTCACCATGT	0.443																																					p.T374T		Atlas-SNP	.											.	NMBR	62	.	0			c.C1122G						.						117.0	106.0	110.0					6																	142396836		2203	4300	6503	SO:0001819	synonymous_variant	4829	exon3			AGAATTGGTCACC		CCDS5196.1	6q24.1	2014-02-21			ENSG00000135577	ENSG00000135577		"""GPCR / Class A : Bombesin receptors"""	7843	protein-coding gene	gene with protein product	"""bombesin receptor 1"""	162341					Standard	NM_002511		Approved	BB1	uc003qiu.3	P28336	OTTHUMG00000015704	ENST00000258042.1:c.1122C>G	chr6.hg19:g.142396836G>C		168.0	0.0		169.0	46.0	NM_002511	E9KL38|Q5VUK8	Silent	SNP	ENST00000258042.1	hg19	CCDS5196.1																																																																																			.	.		0.443	NMBR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042479.1		
BAZ1B	9031	hgsc.bcm.edu	37	7	72903721	72903721	+	Splice_Site	SNP	T	T	C			TCGA-CC-5261-01A-01D-A12Z-10	TCGA-CC-5261-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a2f143d6-ba07-4ff0-960d-b29c3c716665	5ad24cf2-db35-428a-a10f-50b2decbe482	g.chr7:72903721T>C	ENST00000339594.4	-	6	1032	c.694A>G	c.(694-696)Atc>Gtc	p.I232V	BAZ1B_ENST00000404251.1_Splice_Site_p.I232V	NM_032408.3	NP_115784.1	Q9UIG0	BAZ1B_HUMAN	bromodomain adjacent to zinc finger domain, 1B	232	Mediates the tyrosine-protein kinase activity.				cellular response to DNA damage stimulus (GO:0006974)|chromatin assembly or disassembly (GO:0006333)|chromatin-mediated maintenance of transcription (GO:0048096)|double-strand break repair (GO:0006302)|heart morphogenesis (GO:0003007)|histone phosphorylation (GO:0016572)|peptidyl-tyrosine phosphorylation (GO:0018108)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	condensed chromosome (GO:0000793)|nucleus (GO:0005634)|pericentric heterochromatin (GO:0005721)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|histone kinase activity (GO:0035173)|lysine-acetylated histone binding (GO:0070577)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)|vitamin D receptor activator activity (GO:0071884)|zinc ion binding (GO:0008270)			NS(1)|breast(5)|cervix(1)|endometrium(5)|kidney(5)|large_intestine(12)|lung(20)|ovary(5)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	61		Lung NSC(55;0.0659)|all_lung(88;0.152)				TTACTGATGATCTAGGTTAAA	0.393																																					p.I232V	Esophageal Squamous(112;1167 1561 21085 43672 48228)	Atlas-SNP	.											.	BAZ1B	147	.	0			c.A694G						.						108.0	94.0	99.0					7																	72903721		2203	4300	6503	SO:0001630	splice_region_variant	9031	exon6			TGATGATCTAGGT	AF084479	CCDS5549.1	7q11.23	2013-01-28			ENSG00000009954	ENSG00000009954		"""Zinc fingers, PHD-type"""	961	protein-coding gene	gene with protein product	"""Williams-Beuren syndrome chromosome region 9"", ""Williams-Beuren syndrome chromosome region 10"", ""transcription factor WSTF"""	605681		WBSCR9, WBSCR10		9858827, 9828126	Standard	NM_032408		Approved	WSTF	uc003tyc.3	Q9UIG0	OTTHUMG00000023847	ENST00000339594.4:c.694-1A>G	chr7.hg19:g.72903721T>C		269.0	0.0		214.0	12.0	NM_032408	B9EGK3|D3DXE9|O95039|O95247|O95277|Q6P1K4|Q86UJ6	Missense_Mutation	SNP	ENST00000339594.4	hg19	CCDS5549.1	.	.	.	.	.	.	.	.	.	.	T	4.518	0.096070	0.08681	.	.	ENSG00000009954	ENST00000339594;ENST00000404251	T;T	0.57436	0.4;0.4	5.88	4.72	0.59763	.	0.113674	0.64402	N	0.000009	T	0.25865	0.0630	N	0.08118	0	0.38723	D	0.953488	B	0.02656	0.0	B	0.04013	0.001	T	0.14727	-1.0462	10	0.05721	T	0.95	-9.0796	8.3585	0.32344	0.0:0.1502:0.0:0.8498	.	232	Q9UIG0	BAZ1B_HUMAN	V	232	ENSP00000342434:I232V;ENSP00000385442:I232V	ENSP00000342434:I232V	I	-	1	0	BAZ1B	72541657	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	3.480000	0.53172	1.050000	0.40346	0.533000	0.62120	ATC	.	.		0.393	BAZ1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252123.4	NM_032408	Missense_Mutation
GALNTL5	168391	hgsc.bcm.edu	37	7	151664464	151664464	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-5261-01A-01D-A12Z-10	TCGA-CC-5261-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a2f143d6-ba07-4ff0-960d-b29c3c716665	5ad24cf2-db35-428a-a10f-50b2decbe482	g.chr7:151664464G>A	ENST00000392800.2	+	2	387	c.133G>A	c.(133-135)Gct>Act	p.A45T	GALNTL5_ENST00000431418.2_Missense_Mutation_p.A45T	NM_145292.3	NP_660335.2	Q7Z4T8	GLTL5_HUMAN	polypeptide N-acetylgalactosaminyltransferase-like 5	45					spermatid development (GO:0007286)	endosome (GO:0005768)|integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)			NS(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(9)|lung(11)|ovary(2)|prostate(2)|skin(3)	32	all_neural(206;0.187)	all_hematologic(28;0.0749)	OV - Ovarian serous cystadenocarcinoma(82;0.00427)	UCEC - Uterine corpus endometrioid carcinoma (81;0.18)|BRCA - Breast invasive adenocarcinoma(188;0.166)		GCCTCTGTCAGCTTGGTCCCC	0.428																																					p.A45T		Atlas-SNP	.											.	GALNTL5	87	.	0			c.G133A						.						62.0	63.0	63.0					7																	151664464		2203	4300	6503	SO:0001583	missense	168391	exon2			CTGTCAGCTTGGT	AF440400	CCDS5929.1	7q36.2	2014-03-13	2014-03-13	2004-07-28	ENSG00000106648	ENSG00000106648		"""Glycosyltransferase family 2 domain containing"""	21725	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase-like 5"""	615133	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 15"", ""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 5"""	GALNT15			Standard	NM_145292		Approved	GalNAc-T5L	uc003wkp.3	Q7Z4T8	OTTHUMG00000157306	ENST00000392800.2:c.133G>A	chr7.hg19:g.151664464G>A	ENSP00000376548:p.Ala45Thr	264.0	0.0		203.0	12.0	NM_145292	Q75KN2|Q75MD3|Q8NCV4|Q8WW05|Q9UDR9	Missense_Mutation	SNP	ENST00000392800.2	hg19	CCDS5929.1	.	.	.	.	.	.	.	.	.	.	G	9.617	1.132789	0.21041	.	.	ENSG00000106648	ENST00000431418;ENST00000392800	T;T	0.59224	0.28;0.28	4.33	-8.67	0.00863	.	1.962090	0.02605	N	0.101470	T	0.33323	0.0859	N	0.22421	0.69	0.09310	N	1	B	0.22604	0.072	B	0.18871	0.023	T	0.11567	-1.0582	10	0.21014	T	0.42	.	2.7292	0.05222	0.5072:0.2096:0.1778:0.1054	.	45	Q7Z4T8	GLTL5_HUMAN	T	45	ENSP00000392582:A45T;ENSP00000376548:A45T	ENSP00000376548:A45T	A	+	1	0	GALNTL5	151295397	0.000000	0.05858	0.000000	0.03702	0.037000	0.13140	-1.359000	0.02602	-1.821000	0.01213	0.650000	0.86243	GCT	.	.		0.428	GALNTL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348395.1	NM_145292	
C8orf34	116328	hgsc.bcm.edu	37	8	69434170	69434170	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-5261-01A-01D-A12Z-10	TCGA-CC-5261-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a2f143d6-ba07-4ff0-960d-b29c3c716665	5ad24cf2-db35-428a-a10f-50b2decbe482	g.chr8:69434170G>T	ENST00000539993.1	+	6	1193	c.644G>T	c.(643-645)tGg>tTg	p.W215L	C8orf34_ENST00000518698.1_Missense_Mutation_p.W301L|C8orf34_ENST00000337103.4_Missense_Mutation_p.W190L|C8orf34_ENST00000349492.3_3'UTR|C8orf34_ENST00000348340.2_Missense_Mutation_p.W215L			Q49A92	CH034_HUMAN	chromosome 8 open reading frame 34	215										NS(1)|breast(2)|endometrium(3)|kidney(2)|large_intestine(9)|lung(12)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	36			Epithelial(68;0.0117)|OV - Ovarian serous cystadenocarcinoma(28;0.0227)|all cancers(69;0.0502)			AATGACCAATGGGAAAGTGAA	0.418																																					p.W301L		Atlas-SNP	.											.	C8orf34	170	.	0			c.G902T						.						101.0	97.0	98.0					8																	69434170		2203	4300	6503	SO:0001583	missense	116328	exon6			ACCAATGGGAAAG	AB056652	CCDS6203.1, CCDS6203.2	8q13	2009-10-01			ENSG00000165084	ENSG00000165084			30905	protein-coding gene	gene with protein product	"""vestibule 1"""						Standard	NM_052958		Approved	vest-1, VEST1	uc010lyz.3	Q49A92	OTTHUMG00000164438	ENST00000539993.1:c.644G>T	chr8.hg19:g.69434170G>T	ENSP00000438159:p.Trp215Leu	128.0	0.0		95.0	7.0	NM_052958	A8K5X1|G3XAM6|Q8N1X0|Q8N9M7|Q8ND19|Q96Q28	Missense_Mutation	SNP	ENST00000539993.1	hg19		.	.	.	.	.	.	.	.	.	.	G	24.8	4.568212	0.86439	.	.	ENSG00000165084	ENST00000518698;ENST00000539993;ENST00000348340;ENST00000337103	T;T;T	0.44482	0.92;0.95;0.95	5.59	5.59	0.84812	.	0.000000	0.85682	D	0.000000	T	0.62913	0.2467	L	0.60455	1.87	0.50039	D	0.999845	P;D	0.71674	0.952;0.998	P;D	0.80764	0.6;0.994	T	0.57825	-0.7744	9	.	.	.	-6.5266	19.961	0.97250	0.0:0.0:1.0:0.0	.	215;215	Q49A92;Q49A92-3	CH034_HUMAN;.	L	301;215;215;190	ENSP00000427820:W301L;ENSP00000438159:W215L;ENSP00000337174:W190L	.	W	+	2	0	C8orf34	69596724	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.551000	0.73909	2.783000	0.95769	0.655000	0.94253	TGG	.	.		0.418	C8orf34-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_052958	
TRHR	7201	hgsc.bcm.edu	37	8	110131528	110131528	+	Missense_Mutation	SNP	C	C	G			TCGA-CC-5261-01A-01D-A12Z-10	TCGA-CC-5261-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a2f143d6-ba07-4ff0-960d-b29c3c716665	5ad24cf2-db35-428a-a10f-50b2decbe482	g.chr8:110131528C>G	ENST00000518632.1	+	3	1392	c.1041C>G	c.(1039-1041)aaC>aaG	p.N347K	TRHR_ENST00000311762.2_Missense_Mutation_p.N347K			P34981	TRFR_HUMAN	thyrotropin-releasing hormone receptor	347					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	thyrotropin-releasing hormone receptor activity (GO:0004997)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(12)|prostate(4)|skin(4)|urinary_tract(1)	37			OV - Ovarian serous cystadenocarcinoma(57;2.3e-11)			AACCTGCTAACTACAGTGTGG	0.473																																					p.N347K		Atlas-SNP	.											.	TRHR	74	.	0			c.C1041G						.						151.0	144.0	146.0					8																	110131528		2203	4299	6502	SO:0001583	missense	7201	exon2			TGCTAACTACAGT		CCDS6311.1	8q23.1	2013-09-20			ENSG00000174417	ENSG00000174417			12299	protein-coding gene	gene with protein product		188545				8128317	Standard	NM_003301		Approved		uc003ymz.4	P34981	OTTHUMG00000164910	ENST00000518632.1:c.1041C>G	chr8.hg19:g.110131528C>G	ENSP00000430711:p.Asn347Lys	163.0	0.0		222.0	27.0	NM_003301	Q2M339	Missense_Mutation	SNP	ENST00000518632.1	hg19	CCDS6311.1	.	.	.	.	.	.	.	.	.	.	C	2.612	-0.290575	0.05568	.	.	ENSG00000174417	ENST00000518632;ENST00000311762	T;T	0.57436	0.4;0.4	5.86	4.99	0.66335	.	0.338377	0.38492	N	0.001661	T	0.34077	0.0885	L	0.31207	0.915	0.45307	D	0.998304	B	0.06786	0.001	B	0.06405	0.002	T	0.14811	-1.0459	10	0.13470	T	0.59	-10.856	5.968	0.19336	0.0:0.6717:0.1587:0.1696	.	347	P34981	TRFR_HUMAN	K	347	ENSP00000430711:N347K;ENSP00000309818:N347K	ENSP00000309818:N347K	N	+	3	2	TRHR	110200704	0.449000	0.25689	0.996000	0.52242	0.928000	0.56348	0.646000	0.24797	1.492000	0.48499	0.585000	0.79938	AAC	.	.		0.473	TRHR-002	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380892.1		
CYP11B2	1585	hgsc.bcm.edu	37	8	143994118	143994118	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-5261-01A-01D-A12Z-10	TCGA-CC-5261-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a2f143d6-ba07-4ff0-960d-b29c3c716665	5ad24cf2-db35-428a-a10f-50b2decbe482	g.chr8:143994118G>A	ENST00000323110.2	-	8	1228	c.1226C>T	c.(1225-1227)tCg>tTg	p.S409L		NM_000498.3	NP_000489.3	P19099	C11B2_HUMAN	cytochrome P450, family 11, subfamily B, polypeptide 2	409					aldosterone biosynthetic process (GO:0032342)|C21-steroid hormone biosynthetic process (GO:0006700)|cellular response to hormone stimulus (GO:0032870)|cellular response to potassium ion (GO:0035865)|cortisol biosynthetic process (GO:0034651)|mineralocorticoid biosynthetic process (GO:0006705)|potassium ion homeostasis (GO:0055075)|regulation of blood volume by renal aldosterone (GO:0002017)|renal water homeostasis (GO:0003091)|small molecule metabolic process (GO:0044281)|sodium ion homeostasis (GO:0055078)|steroid metabolic process (GO:0008202)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	corticosterone 18-monooxygenase activity (GO:0047783)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|steroid 11-beta-monooxygenase activity (GO:0004507)			cervix(1)|endometrium(2)|kidney(3)|large_intestine(5)|lung(22)|ovary(3)|upper_aerodigestive_tract(3)	39	all_cancers(97;5.56e-11)|all_epithelial(106;2.49e-08)|Lung NSC(106;0.000228)|all_lung(105;0.000633)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)				Eplerenone(DB00700)|Etomidate(DB00292)|Hydrocortisone(DB00741)|Metoclopramide(DB01233)|Metyrapone(DB01011)|Spironolactone(DB00421)	GCGACCCAGCGAGTAGAGGAA	0.622									Familial Hyperaldosteronism type I																												p.S409L		Atlas-SNP	.											.	CYP11B2	107	.	0			c.C1226T						.						93.0	90.0	91.0					8																	143994118		2203	4300	6503	SO:0001583	missense	1585	exon8	Familial Cancer Database	Dexamethasone Sensitive Aldosteronism, FH-I	CCCAGCGAGTAGA	X54741	CCDS6393.1	8q21-q22	2013-06-19	2003-01-14		ENSG00000179142	ENSG00000179142	1.14.15.4	"""Cytochrome P450s"""	2592	protein-coding gene	gene with protein product	"""steroid 11-beta-monooxygenase"""	124080	"""cytochrome P450, subfamily XIB (steroid 11-beta-hydroxylase), polypeptide 2"""	CYP11B		1303253	Standard	NM_000498		Approved	CYP11BL, CPN2, P-450C18, P450aldo, ALDOS	uc003yxk.1	P19099	OTTHUMG00000160254	ENST00000323110.2:c.1226C>T	chr8.hg19:g.143994118G>A	ENSP00000325822:p.Ser409Leu	92.0	0.0		106.0	15.0	NM_000498	B0ZBE4|Q16726	Missense_Mutation	SNP	ENST00000323110.2	hg19	CCDS6393.1	.	.	.	.	.	.	.	.	.	.	.	19.93	3.918803	0.73098	.	.	ENSG00000179142	ENST00000323110	T	0.69435	-0.4	3.52	3.52	0.40303	.	0.442635	0.19241	N	0.119173	T	0.66366	0.2782	L	0.56769	1.78	0.33867	D	0.63453	P	0.47106	0.89	P	0.46659	0.523	T	0.75439	-0.3317	10	0.36615	T	0.2	.	12.9218	0.58237	0.0:0.0:1.0:0.0	.	409	P19099	C11B2_HUMAN	L	409	ENSP00000325822:S409L	ENSP00000325822:S409L	S	-	2	0	CYP11B2	143991120	0.678000	0.27586	0.156000	0.22583	0.007000	0.05969	4.006000	0.57083	1.937000	0.56155	0.563000	0.77884	TCG	.	.		0.622	CYP11B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359904.1		
CPXM2	119587	hgsc.bcm.edu	37	10	125639753	125639753	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-5261-01A-01D-A12Z-10	TCGA-CC-5261-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a2f143d6-ba07-4ff0-960d-b29c3c716665	5ad24cf2-db35-428a-a10f-50b2decbe482	g.chr10:125639753C>A	ENST00000241305.3	-	2	531	c.377G>T	c.(376-378)cGt>cTt	p.R126L	CPXM2_ENST00000368854.3_5'UTR	NM_198148.2	NP_937791.2	Q8N436	CPXM2_HUMAN	carboxypeptidase X (M14 family), member 2	126					cell adhesion (GO:0007155)	extracellular space (GO:0005615)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(7)|kidney(2)|large_intestine(13)|lung(15)|ovary(2)|prostate(2)|skin(3)	47		all_lung(145;0.174)|Colorectal(57;0.178)|Glioma(114;0.222)|all_neural(114;0.226)|Lung NSC(174;0.233)		COAD - Colon adenocarcinoma(40;0.212)|Colorectal(40;0.237)		ACGGGCCACACGGACACTGTG	0.542																																					p.R126L		Atlas-SNP	.											.	CPXM2	120	.	0			c.G377T						.						217.0	205.0	209.0					10																	125639753		2203	4300	6503	SO:0001583	missense	119587	exon2			GCCACACGGACAC	AY358565	CCDS7637.1	10q26	2012-02-10			ENSG00000121898	ENSG00000121898			26977	protein-coding gene	gene with protein product	"""cytosolic carboxypeptidase"""					12975309	Standard	NM_198148		Approved	UNQ676, CPX2	uc001lhk.1	Q8N436	OTTHUMG00000019206	ENST00000241305.3:c.377G>T	chr10.hg19:g.125639753C>A	ENSP00000241305:p.Arg126Leu	207.0	0.0		203.0	61.0	NM_198148	B4E3Q2	Missense_Mutation	SNP	ENST00000241305.3	hg19	CCDS7637.1	.	.	.	.	.	.	.	.	.	.	C	2.986	-0.209163	0.06140	.	.	ENSG00000121898	ENST00000241305;ENST00000418782	D	0.96073	-3.9	3.76	-2.33	0.06724	.	1.253220	0.05575	N	0.571736	D	0.87787	0.6265	N	0.08118	0	0.21762	N	0.999554	B	0.23650	0.089	B	0.20184	0.028	T	0.78170	-0.2308	10	0.46703	T	0.11	-1.6276	7.4296	0.27120	0.0:0.4323:0.318:0.2497	.	126	Q8N436	CPXM2_HUMAN	L	126	ENSP00000241305:R126L	ENSP00000241305:R126L	R	-	2	0	CPXM2	125629743	0.000000	0.05858	0.001000	0.08648	0.137000	0.21094	-0.230000	0.09083	-0.448000	0.07128	-0.211000	0.12701	CGT	.	.		0.542	CPXM2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050853.1	NM_198148	
BRSK2	9024	hgsc.bcm.edu	37	11	1472640	1472640	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-5261-01A-01D-A12Z-10	TCGA-CC-5261-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a2f143d6-ba07-4ff0-960d-b29c3c716665	5ad24cf2-db35-428a-a10f-50b2decbe482	g.chr11:1472640C>T	ENST00000528841.1	+	15	1919	c.1535C>T	c.(1534-1536)tCg>tTg	p.S512L	BRSK2_ENST00000528710.1_Missense_Mutation_p.S452L|BRSK2_ENST00000544817.1_Missense_Mutation_p.S207L|BRSK2_ENST00000308230.5_Missense_Mutation_p.S534L|BRSK2_ENST00000526678.1_Missense_Mutation_p.S534L|BRSK2_ENST00000382179.1_Missense_Mutation_p.S558L|BRSK2_ENST00000308219.9_Missense_Mutation_p.S512L|BRSK2_ENST00000531197.1_Missense_Mutation_p.S512L			Q8IWQ3	BRSK2_HUMAN	BR serine/threonine kinase 2	512					actin cytoskeleton reorganization (GO:0031532)|axonogenesis (GO:0007409)|establishment of cell polarity (GO:0030010)|exocytosis (GO:0006887)|G2/M transition of mitotic cell cycle (GO:0000086)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|mitotic nuclear division (GO:0007067)|neuron differentiation (GO:0030182)|peptidyl-serine phosphorylation (GO:0018105)|protein phosphorylation (GO:0006468)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)|tau-protein kinase activity (GO:0050321)			endometrium(4)|large_intestine(1)|lung(5)	10		all_epithelial(84;4.17e-05)|Breast(177;0.000307)|Ovarian(85;0.0014)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00144)|Lung(200;0.0713)|LUSC - Lung squamous cell carcinoma(625;0.0842)		ACACCAGAGTCGTCCCCAGAG	0.637																																					p.S558L		Atlas-SNP	.											.	BRSK2	97	.	0			c.C1673T						.						87.0	100.0	95.0					11																	1472640		2144	4234	6378	SO:0001583	missense	9024	exon15			CAGAGTCGTCCCC	AF020089	CCDS41590.1, CCDS58106.1, CCDS58107.1, CCDS58108.1, CCDS60696.1	11p15.5	2008-02-05	2003-09-11	2005-01-27	ENSG00000174672	ENSG00000174672			11405	protein-coding gene	gene with protein product	"""serine/threonine kinase 29"""	609236	"""chromsosome 11 open reading frame 7"""	C11orf7, STK29		9852686, 9929968	Standard	NM_001256629		Approved	PEN11B	uc001ltm.4	Q8IWQ3	OTTHUMG00000167089	ENST00000528841.1:c.1535C>T	chr11.hg19:g.1472640C>T	ENSP00000432000:p.Ser512Leu	43.0	0.0		50.0	20.0	NM_001256630	B3KVE9|E9PLM7|O60843|O95099|Q5J5B4|Q6ZMQ4|Q8TB60	Missense_Mutation	SNP	ENST00000528841.1	hg19	CCDS58107.1	.	.	.	.	.	.	.	.	.	.	C	16.75	3.209415	0.58343	.	.	ENSG00000174672	ENST00000308219;ENST00000531197;ENST00000308230;ENST00000528841;ENST00000526678;ENST00000528710;ENST00000382179;ENST00000544817	T;T;T;T;T;T;T;T	0.60920	0.15;0.15;0.15;0.15;0.15;0.15;0.15;0.15	3.81	3.81	0.43845	.	0.000000	0.64402	U	0.000001	T	0.76666	0.4019	M	0.80847	2.515	0.58432	D	0.999993	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.91635	0.999;0.998;0.999;0.972;0.978	T	0.81850	-0.0743	10	0.87932	D	0	.	15.8948	0.79326	0.0:1.0:0.0:0.0	.	534;558;512;512;512	Q8IWQ3-4;Q8IWQ3-5;Q8IWQ3-3;Q8IWQ3;Q8IWQ3-2	.;.;.;BRSK2_HUMAN;.	L	512;512;534;512;534;452;558;207	ENSP00000310697:S512L;ENSP00000431152:S512L;ENSP00000310805:S534L;ENSP00000432000:S512L;ENSP00000433370:S534L;ENSP00000433235:S452L;ENSP00000371614:S558L;ENSP00000445168:S207L	ENSP00000310697:S512L	S	+	2	0	BRSK2	1429216	1.000000	0.71417	0.821000	0.32701	0.078000	0.17371	4.560000	0.60802	1.981000	0.57761	0.462000	0.41574	TCG	.	.		0.637	BRSK2-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000393033.1	NM_003957	
NBEA	26960	hgsc.bcm.edu	37	13	36046548	36046548	+	Missense_Mutation	SNP	C	C	T	rs371213802		TCGA-CC-5261-01A-01D-A12Z-10	TCGA-CC-5261-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a2f143d6-ba07-4ff0-960d-b29c3c716665	5ad24cf2-db35-428a-a10f-50b2decbe482	g.chr13:36046548C>T	ENST00000400445.3	+	41	6994	c.6460C>T	c.(6460-6462)Ctc>Ttc	p.L2154F	NBEA_ENST00000379939.2_Missense_Mutation_p.L2151F|NBEA_ENST00000310336.4_Missense_Mutation_p.L2154F|NBEA_ENST00000540320.1_Missense_Mutation_p.L2154F	NM_015678.4	NP_056493.3	Q8NFP9	NBEA_HUMAN	neurobeachin	2154					protein localization (GO:0008104)	cytosol (GO:0005829)|endomembrane system (GO:0012505)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)				NS(1)|breast(1)|endometrium(14)|kidney(4)|large_intestine(29)|lung(40)|ovary(9)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	108		Breast(139;0.0141)|Lung SC(185;0.0548)|Prostate(109;0.207)		all cancers(112;1.93e-08)|Epithelial(112;1.62e-07)|BRCA - Breast invasive adenocarcinoma(63;0.00033)|OV - Ovarian serous cystadenocarcinoma(117;0.00109)|KIRC - Kidney renal clear cell carcinoma(186;0.00575)|Kidney(163;0.00656)|GBM - Glioblastoma multiforme(144;0.191)|Lung(94;0.199)		CCCAGTGGTTCTCAGCACCCC	0.572																																					p.L2154F		Atlas-SNP	.											.	NBEA	340	.	0			c.C6460T						.						57.0	60.0	59.0					13																	36046548		1997	4162	6159	SO:0001583	missense	26960	exon41			GTGGTTCTCAGCA	AF467288	CCDS45026.1, CCDS55894.1	13q13	2014-09-17			ENSG00000172915	ENSG00000172915		"""A-kinase anchor proteins"", ""WD repeat domain containing"""	7648	protein-coding gene	gene with protein product		604889				10501977	Standard	NM_015678		Approved	KIAA1544, BCL8B, FLJ10197	uc021ric.1	Q8NFP9	OTTHUMG00000016724	ENST00000400445.3:c.6460C>T	chr13.hg19:g.36046548C>T	ENSP00000383295:p.Leu2154Phe	22.0	0.0		32.0	12.0	NM_015678	B7Z2H9|Q5T320|Q9HCM8|Q9NSU1|Q9NW98|Q9Y6J1	Missense_Mutation	SNP	ENST00000400445.3	hg19	CCDS45026.1	.	.	.	.	.	.	.	.	.	.	C	19.23	3.788096	0.70337	.	.	ENSG00000172915	ENST00000540320;ENST00000400445;ENST00000379939;ENST00000310336;ENST00000422518	T;T;T;T	0.56611	0.45;0.45;0.45;0.45	5.51	5.51	0.81932	PH-BEACH domain (1);	0.000000	0.85682	D	0.000000	T	0.49729	0.1574	L	0.51853	1.615	0.80722	D	1	B;B	0.29531	0.024;0.247	B;B	0.22880	0.019;0.042	T	0.47005	-0.9150	10	0.45353	T	0.12	.	19.4328	0.94778	0.0:1.0:0.0:0.0	.	2154;2151	Q8NFP9;Q5T321	NBEA_HUMAN;.	F	2154;2154;2151;2154;781	ENSP00000440951:L2154F;ENSP00000383295:L2154F;ENSP00000369271:L2151F;ENSP00000308534:L2154F	ENSP00000308534:L2154F	L	+	1	0	NBEA	34944548	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.697000	0.61782	2.584000	0.87258	0.563000	0.77884	CTC	.	.		0.572	NBEA-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_015678	
VWA8	23078	hgsc.bcm.edu	37	13	42303780	42303780	+	Missense_Mutation	SNP	C	C	G			TCGA-CC-5261-01A-01D-A12Z-10	TCGA-CC-5261-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a2f143d6-ba07-4ff0-960d-b29c3c716665	5ad24cf2-db35-428a-a10f-50b2decbe482	g.chr13:42303780C>G	ENST00000379310.3	-	23	2604	c.2536G>C	c.(2536-2538)Gta>Cta	p.V846L	VWA8_ENST00000281496.6_Missense_Mutation_p.V846L	NM_015058.1	NP_055873.1	A3KMH1	VWA8_HUMAN	von Willebrand factor A domain containing 8	846						extracellular region (GO:0005576)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)										GCCTCATCTACTACCAGAATA	0.338																																					p.V846L		Atlas-SNP	.											.	.	.	.	0			c.G2536C						.						143.0	137.0	139.0					13																	42303780		2203	4300	6503	SO:0001583	missense	23078	exon23			CATCTACTACCAG	AB011136	CCDS31963.1, CCDS41881.1	13q14.11	2013-11-18	2012-08-02	2012-08-02	ENSG00000102763	ENSG00000102763			29071	protein-coding gene	gene with protein product			"""KIAA0564"""	KIAA0564		9628581	Standard	NM_015058		Approved		uc001uyj.3	A3KMH1	OTTHUMG00000016799	ENST00000379310.3:c.2536G>C	chr13.hg19:g.42303780C>G	ENSP00000368612:p.Val846Leu	297.0	0.0		227.0	24.0	NM_015058	O60310|Q5JTP6|Q5VW08|Q7Z6I9|Q86YC9|Q8N3E4	Missense_Mutation	SNP	ENST00000379310.3	hg19	CCDS41881.1	.	.	.	.	.	.	.	.	.	.	C	17.40	3.380281	0.61845	.	.	ENSG00000102763	ENST00000251030;ENST00000379310;ENST00000281496	T;T	0.17691	2.26;2.26	5.55	3.84	0.44239	ATPase, AAA+ type, core (1);ATPase, dynein-related, AAA domain (1);	0.354917	0.30011	N	0.010636	T	0.13286	0.0322	N	0.12527	0.23	0.44956	D	0.997976	P	0.44429	0.835	P	0.49477	0.612	T	0.13045	-1.0524	10	0.30078	T	0.28	.	8.537	0.33368	0.0:0.6565:0.0:0.3435	.	846	A3KMH1	K0564_HUMAN	L	750;846;846	ENSP00000368612:V846L;ENSP00000281496:V846L	ENSP00000251030:V750L	V	-	1	0	KIAA0564	41201780	0.947000	0.32204	0.493000	0.27502	0.945000	0.59286	1.660000	0.37397	0.908000	0.36671	0.655000	0.94253	GTA	.	.		0.338	VWA8-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354828.2	NM_015058	
VPS39	23339	hgsc.bcm.edu	37	15	42492106	42492106	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-5261-01A-01D-A12Z-10	TCGA-CC-5261-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a2f143d6-ba07-4ff0-960d-b29c3c716665	5ad24cf2-db35-428a-a10f-50b2decbe482	g.chr15:42492106G>A	ENST00000348544.4	-	2	126	c.127C>T	c.(127-129)Cgg>Tgg	p.R43W	MIR627_ENST00000384979.1_RNA|VPS39_ENST00000568357.1_5'UTR|VPS39_ENST00000318006.5_Missense_Mutation_p.R43W			Q96JC1	VPS39_HUMAN	vacuolar protein sorting 39 homolog (S. cerevisiae)	43	CNH. {ECO:0000255|PROSITE- ProRule:PRU00795}.				intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)	endosome (GO:0005768)|HOPS complex (GO:0030897)|lysosomal membrane (GO:0005765)	small GTPase regulator activity (GO:0005083)			breast(2)|kidney(5)|large_intestine(4)|lung(8)|ovary(1)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	28		all_cancers(109;6.78e-16)|all_epithelial(112;1.81e-14)|Lung NSC(122;5.01e-09)|all_lung(180;2.24e-08)|Melanoma(134;0.0574)|Colorectal(260;0.152)		GBM - Glioblastoma multiforme(94;3.05e-06)		ACGTCCTTCCGAATCCTATAG	0.348																																					p.R43W		Atlas-SNP	.											.	VPS39	53	.	0			c.C127T						.						71.0	71.0	71.0					15																	42492106		2203	4299	6502	SO:0001583	missense	23339	exon2			CCTTCCGAATCCT	AF280814	CCDS10083.1, CCDS73710.1	15q14	2008-02-05	2006-12-19		ENSG00000166887	ENSG00000166887			20593	protein-coding gene	gene with protein product		612188	"""vacuolar protein sorting 39 (yeast)"""			11448994	Standard	XM_005254259		Approved	KIAA0770, VAM6	uc001zpc.3	Q96JC1	OTTHUMG00000130467	ENST00000348544.4:c.127C>T	chr15.hg19:g.42492106G>A	ENSP00000335193:p.Arg43Trp	180.0	0.0		162.0	29.0	NM_015289	O94869|Q71SQ6|Q7Z3V3|Q96B93|Q96RM0	Missense_Mutation	SNP	ENST00000348544.4	hg19	CCDS10083.1	.	.	.	.	.	.	.	.	.	.	G	19.53	3.845655	0.71603	.	.	ENSG00000166887	ENST00000318006;ENST00000348544	T;T	0.18338	2.22;2.22	4.88	3.96	0.45880	Citron-like (2);	0.058692	0.64402	D	0.000004	T	0.24236	0.0587	L	0.34521	1.04	0.36010	D	0.837962	P;P	0.49185	0.92;0.902	P;P	0.55222	0.771;0.502	T	0.23547	-1.0185	10	0.66056	D	0.02	-19.6016	12.9477	0.58382	0.0:0.0:0.5939:0.4061	.	43;43	Q96JC1;Q96JC1-2	VPS39_HUMAN;.	W	43	ENSP00000326534:R43W;ENSP00000335193:R43W	ENSP00000326534:R43W	R	-	1	2	VPS39	40279398	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	3.597000	0.54031	1.403000	0.46800	0.563000	0.77884	CGG	.	.		0.348	VPS39-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000420472.1	NM_015289	
ADAMTS7	11173	hgsc.bcm.edu	37	15	79069906	79069906	+	Silent	SNP	G	G	A	rs377763034		TCGA-CC-5261-01A-01D-A12Z-10	TCGA-CC-5261-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a2f143d6-ba07-4ff0-960d-b29c3c716665	5ad24cf2-db35-428a-a10f-50b2decbe482	g.chr15:79069906G>A	ENST00000388820.4	-	9	1557	c.1347C>T	c.(1345-1347)gaC>gaT	p.D449D	ADAMTS7_ENST00000566303.1_Intron	NM_014272.3	NP_055087.2	Q9UKP4	ATS7_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 7	449	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.				cellular response to BMP stimulus (GO:0071773)|cellular response to interleukin-1 (GO:0071347)|cellular response to tumor necrosis factor (GO:0071356)|negative regulation of chondrocyte differentiation (GO:0032331)|proteolysis involved in cellular protein catabolic process (GO:0051603)	cell surface (GO:0009986)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(2)|lung(23)|ovary(1)|prostate(8)|skin(9)	54						CAGGAGGGTCGTCCAGGCACA	0.647																																					p.D449D		Atlas-SNP	.											.	ADAMTS7	142	.	0			c.C1347T						.	A		0,4380		0,0,2190	58.0	48.0	52.0		1347	-8.0	0.1	15		52	1,8583		0,1,4291	no	coding-synonymous	ADAMTS7	NM_014272.3		0,1,6481	AA,AG,GG		0.0116,0.0,0.0077		449/1687	79069906	1,12963	2190	4292	6482	SO:0001819	synonymous_variant	11173	exon9			AGGGTCGTCCAGG	AF140675	CCDS32303.1	15q25.1	2012-05-16	2005-08-19		ENSG00000136378	ENSG00000136378		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	223	protein-coding gene	gene with protein product	"""COMPase"", ""a disintegrin and metalloprotease with thrombospondin motifs-7 preproprotein"""	605009	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 7"""			10464288	Standard	NM_014272		Approved	ADAM-TS7, DKFZp434H204	uc002bej.4	Q9UKP4	OTTHUMG00000172907	ENST00000388820.4:c.1347C>T	chr15.hg19:g.79069906G>A		55.0	0.0		61.0	17.0	NM_014272	Q14F51|Q6P7J9	Silent	SNP	ENST00000388820.4	hg19	CCDS32303.1																																																																																			.	.		0.647	ADAMTS7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000421331.1	NM_014272	
ANKRD11	29123	hgsc.bcm.edu	37	16	89350737	89350737	+	Missense_Mutation	SNP	C	C	T	rs370690185		TCGA-CC-5261-01A-01D-A12Z-10	TCGA-CC-5261-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a2f143d6-ba07-4ff0-960d-b29c3c716665	5ad24cf2-db35-428a-a10f-50b2decbe482	g.chr16:89350737C>T	ENST00000301030.4	-	9	2673	c.2213G>A	c.(2212-2214)cGt>cAt	p.R738H	ANKRD11_ENST00000378330.2_Missense_Mutation_p.R738H	NM_001256183.1|NM_013275.5	NP_001243112.1|NP_037407.4	Q6UB99	ANR11_HUMAN	ankyrin repeat domain 11	738	Lys-rich.				bone development (GO:0060348)|face morphogenesis (GO:0060325)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|odontogenesis of dentin-containing tooth (GO:0042475)|skeletal system morphogenesis (GO:0048705)|tissue homeostasis (GO:0001894)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(4)|central_nervous_system(3)|endometrium(17)|kidney(2)|large_intestine(18)|lung(20)|ovary(6)|pancreas(1)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	83		all_hematologic(23;0.00824)|Colorectal(91;0.0475)		Epithelial(1;5.33e-11)|all cancers(4;2.6e-09)|OV - Ovarian serous cystadenocarcinoma(4;2.29e-07)|BRCA - Breast invasive adenocarcinoma(80;0.0142)		TTTATTCGAACGGTCTTTCTC	0.373																																					p.R738H		Atlas-SNP	.											.	ANKRD11	195	.	0			c.G2213A						.	C	HIS/ARG	0,4396		0,0,2198	57.0	58.0	57.0		2213	5.7	0.7	16		57	2,8596	2.2+/-6.3	0,2,4297	no	missense	ANKRD11	NM_013275.4	29	0,2,6495	TT,TC,CC		0.0233,0.0,0.0154	possibly-damaging	738/2664	89350737	2,12992	2198	4299	6497	SO:0001583	missense	29123	exon9			TTCGAACGGTCTT	AY373756	CCDS32513.1	16q24.3	2013-01-10				ENSG00000167522		"""Ankyrin repeat domain containing"""	21316	protein-coding gene	gene with protein product		611192				11483580	Standard	NM_001256182		Approved	LZ16, T13	uc002fnc.2	Q6UB99		ENST00000301030.4:c.2213G>A	chr16.hg19:g.89350737C>T	ENSP00000301030:p.Arg738His	578.0	0.0		426.0	206.0	NM_001256183	Q6NTG1|Q6QMF8	Missense_Mutation	SNP	ENST00000301030.4	hg19	CCDS32513.1	.	.	.	.	.	.	.	.	.	.	C	14.38	2.517965	0.44763	0.0	2.33E-4	ENSG00000167522	ENST00000301030;ENST00000378330;ENST00000330736	T;T	0.41400	1.0;1.0	5.7	5.7	0.88788	.	0.081220	0.49305	D	0.000148	T	0.41282	0.1152	L	0.56769	1.78	0.80722	D	1	P;P	0.52463	0.953;0.921	B;B	0.38194	0.267;0.137	T	0.49428	-0.8941	10	0.72032	D	0.01	.	17.3282	0.87255	0.0:1.0:0.0:0.0	.	357;738	Q7Z5E5;Q6UB99	.;ANR11_HUMAN	H	738;738;357	ENSP00000301030:R738H;ENSP00000367581:R738H	ENSP00000301030:R738H	R	-	2	0	ANKRD11	87878238	0.998000	0.40836	0.708000	0.30435	0.064000	0.16182	4.014000	0.57145	2.696000	0.92011	0.561000	0.74099	CGT	.	.		0.373	ANKRD11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000430462.3	NM_013275	
ABR	29	hgsc.bcm.edu	37	17	973210	973210	+	Splice_Site	SNP	C	C	G			TCGA-CC-5261-01A-01D-A12Z-10	TCGA-CC-5261-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a2f143d6-ba07-4ff0-960d-b29c3c716665	5ad24cf2-db35-428a-a10f-50b2decbe482	g.chr17:973210C>G	ENST00000302538.5	-	9	1161	c.1015G>C	c.(1015-1017)Ggg>Cgg	p.G339R	ABR_ENST00000574437.1_Splice_Site_p.G293R|ABR_ENST00000536794.2_Splice_Site_p.G121R|ABR_ENST00000291107.2_Splice_Site_p.G302R|ABR_ENST00000544583.2_Splice_Site_p.G293R	NM_001282149.1|NM_021962.3	NP_001269078.1|NP_068781.2	Q12979	ABR_HUMAN	active BCR-related	339	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|brain development (GO:0007420)|inner ear morphogenesis (GO:0042472)|negative regulation of cell migration (GO:0030336)|negative regulation of inflammatory response (GO:0050728)|negative regulation of neutrophil degranulation (GO:0043314)|neuromuscular process controlling balance (GO:0050885)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of phagocytosis (GO:0050766)|regulation of small GTPase mediated signal transduction (GO:0051056)|response to lipopolysaccharide (GO:0032496)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|membrane (GO:0016020)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)|Rac GTPase activator activity (GO:0030675)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(12)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	39				UCEC - Uterine corpus endometrioid carcinoma (25;0.0228)		CACACTCACCCTGCAGAGGTC	0.652																																					p.G339R	Esophageal Squamous(197;2016 2115 4129 29033 46447)	Atlas-SNP	.											.	ABR	119	.	0			c.G1015C						.						56.0	49.0	51.0					17																	973210		2203	4300	6503	SO:0001630	splice_region_variant	29	exon9			CTCACCCTGCAGA	L19704	CCDS10999.1, CCDS11000.1, CCDS54060.1, CCDS58497.1, CCDS73936.1	17p13	2013-01-10	2012-02-27		ENSG00000159842	ENSG00000159842		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	81	protein-coding gene	gene with protein product		600365	"""active BCR-related gene"""			2587217, 7479768	Standard	NM_001092		Approved	MDB	uc002fsd.4	Q12979	OTTHUMG00000090313	ENST00000302538.5:c.1016+1G>C	chr17.hg19:g.973210C>G		69.0	0.0		94.0	35.0	NM_021962	B3KW89|B7Z6H7|D3DTH3|D3DTH4|F5H3S2|F5H8B3|Q13693|Q13694	Missense_Mutation	SNP	ENST00000302538.5	hg19	CCDS10999.1	.	.	.	.	.	.	.	.	.	.	C	23.4	4.408485	0.83340	.	.	ENSG00000159842	ENST00000302538;ENST00000544583;ENST00000291107;ENST00000536794;ENST00000382259	T;T;T;T	0.29917	1.55;1.55;1.55;1.55	5.77	5.77	0.91146	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.000000	0.85682	D	0.000000	T	0.57888	0.2084	M	0.72353	2.195	0.80722	D	1	D;D;D;D	0.89917	0.996;0.974;1.0;0.996	D;P;D;D	0.97110	0.978;0.78;1.0;0.978	T	0.58446	-0.7635	10	0.72032	D	0.01	.	18.9737	0.92725	0.0:1.0:0.0:0.0	.	121;223;302;339	B7Z683;Q6ZT60;Q12979-2;Q12979	.;.;.;ABR_HUMAN	R	339;293;302;121;223	ENSP00000303909:G339R;ENSP00000442048:G293R;ENSP00000291107:G302R;ENSP00000437429:G121R	ENSP00000291107:G302R	G	-	1	0	ABR	919960	1.000000	0.71417	0.965000	0.40720	0.347000	0.29111	7.800000	0.85949	2.735000	0.93741	0.555000	0.69702	GGG	.	.		0.652	ABR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206675.4		Missense_Mutation
ABR	29	hgsc.bcm.edu	37	17	973214	973214	+	Silent	SNP	A	A	T			TCGA-CC-5261-01A-01D-A12Z-10	TCGA-CC-5261-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a2f143d6-ba07-4ff0-960d-b29c3c716665	5ad24cf2-db35-428a-a10f-50b2decbe482	g.chr17:973214A>T	ENST00000302538.5	-	9	1157	c.1011T>A	c.(1009-1011)tcT>tcA	p.S337S	ABR_ENST00000574437.1_Silent_p.S291S|ABR_ENST00000536794.2_Silent_p.S119S|ABR_ENST00000291107.2_Silent_p.S300S|ABR_ENST00000544583.2_Silent_p.S291S	NM_001282149.1|NM_021962.3	NP_001269078.1|NP_068781.2	Q12979	ABR_HUMAN	active BCR-related	337	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|brain development (GO:0007420)|inner ear morphogenesis (GO:0042472)|negative regulation of cell migration (GO:0030336)|negative regulation of inflammatory response (GO:0050728)|negative regulation of neutrophil degranulation (GO:0043314)|neuromuscular process controlling balance (GO:0050885)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of phagocytosis (GO:0050766)|regulation of small GTPase mediated signal transduction (GO:0051056)|response to lipopolysaccharide (GO:0032496)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|membrane (GO:0016020)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)|Rac GTPase activator activity (GO:0030675)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(12)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	39				UCEC - Uterine corpus endometrioid carcinoma (25;0.0228)		CTCACCCTGCAGAGGTCTTCT	0.652																																					p.S337S	Esophageal Squamous(197;2016 2115 4129 29033 46447)	Atlas-SNP	.											.	ABR	119	.	0			c.T1011A						.						59.0	52.0	55.0					17																	973214		2203	4300	6503	SO:0001819	synonymous_variant	29	exon9			CCCTGCAGAGGTC	L19704	CCDS10999.1, CCDS11000.1, CCDS54060.1, CCDS58497.1, CCDS73936.1	17p13	2013-01-10	2012-02-27		ENSG00000159842	ENSG00000159842		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	81	protein-coding gene	gene with protein product		600365	"""active BCR-related gene"""			2587217, 7479768	Standard	NM_001092		Approved	MDB	uc002fsd.4	Q12979	OTTHUMG00000090313	ENST00000302538.5:c.1011T>A	chr17.hg19:g.973214A>T		70.0	0.0		101.0	41.0	NM_021962	B3KW89|B7Z6H7|D3DTH3|D3DTH4|F5H3S2|F5H8B3|Q13693|Q13694	Silent	SNP	ENST00000302538.5	hg19	CCDS10999.1																																																																																			.	.		0.652	ABR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206675.4		
TAF4B	6875	hgsc.bcm.edu	37	18	23807168	23807168	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-5261-01A-01D-A12Z-10	TCGA-CC-5261-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a2f143d6-ba07-4ff0-960d-b29c3c716665	5ad24cf2-db35-428a-a10f-50b2decbe482	g.chr18:23807168C>T	ENST00000269142.5	+	1	1269	c.271C>T	c.(271-273)Cct>Tct	p.P91S	TAF4B_ENST00000400466.2_Missense_Mutation_p.P91S|TAF4B_ENST00000578121.1_Missense_Mutation_p.P91S	NM_005640.1	NP_005631.1	Q92750	TAF4B_HUMAN	TAF4b RNA polymerase II, TATA box binding protein (TBP)-associated factor, 105kDa	91					gene expression (GO:0010467)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor TFIID complex (GO:0005669)	DNA binding (GO:0003677)|NF-kappaB binding (GO:0051059)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(13)|prostate(1)|skin(1)	29	all_cancers(21;0.00151)|Lung NSC(5;0.000401)|all_lung(6;0.00115)|Ovarian(20;0.124)		Epithelial(2;9.57e-07)|all cancers(3;5.15e-06)|OV - Ovarian serous cystadenocarcinoma(3;1.96e-05)|LUSC - Lung squamous cell carcinoma(2;0.00594)|Lung(2;0.0267)			GCTGCCTGCTCCTCAGATAGT	0.607																																					p.P91S		Atlas-SNP	.											.	TAF4B	71	.	0			c.C271T						.						80.0	86.0	84.0					18																	23807168		1977	4162	6139	SO:0001583	missense	6875	exon1			CCTGCTCCTCAGA	Y09321	CCDS42421.1	18q11.1	2008-08-01	2002-08-29	2001-12-07		ENSG00000141384			11538	protein-coding gene	gene with protein product	"""TATA box binding protein (TBP)-associated factor 4B"""	601689	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, C2, 105kD"""	TAF2C2		8858156, 10849440	Standard	XM_005258339		Approved	TAFII105	uc002kvu.4	Q92750		ENST00000269142.5:c.271C>T	chr18.hg19:g.23807168C>T	ENSP00000269142:p.Pro91Ser	155.0	0.0		200.0	33.0	NM_005640	Q29YA4|Q29YA5	Missense_Mutation	SNP	ENST00000269142.5	hg19	CCDS42421.1	.	.	.	.	.	.	.	.	.	.	C	11.15	1.553495	0.27739	.	.	ENSG00000141384	ENST00000418698;ENST00000269142;ENST00000400466	T;T;T	0.36340	1.26;1.49;1.26	4.7	3.81	0.43845	.	0.258920	0.30940	N	0.008579	T	0.44435	0.1293	L	0.59436	1.845	0.26207	N	0.979353	P;D	0.69078	0.924;0.997	P;P	0.57911	0.603;0.829	T	0.22695	-1.0209	10	0.30854	T	0.27	-9.6706	7.8075	0.29211	0.0:0.8871:0.0:0.1129	.	91;91	Q92750;A4PBF7	TAF4B_HUMAN;.	S	91	ENSP00000389365:P91S;ENSP00000269142:P91S;ENSP00000383314:P91S	ENSP00000269142:P91S	P	+	1	0	TAF4B	22061166	1.000000	0.71417	0.932000	0.37286	0.735000	0.41995	2.181000	0.42547	2.140000	0.66376	0.455000	0.32223	CCT	.	.		0.607	TAF4B-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000446260.3	NM_005640	
LBP	3929	hgsc.bcm.edu	37	20	36999419	36999419	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-5261-01A-01D-A12Z-10	TCGA-CC-5261-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a2f143d6-ba07-4ff0-960d-b29c3c716665	5ad24cf2-db35-428a-a10f-50b2decbe482	g.chr20:36999419G>A	ENST00000217407.2	+	11	1348	c.1187G>A	c.(1186-1188)aGc>aAc	p.S396N		NM_004139.3	NP_004130.2	P18428	LBP_HUMAN	lipopolysaccharide binding protein	396					acute-phase response (GO:0006953)|cellular defense response (GO:0006968)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to lipoteichoic acid (GO:0071223)|defense response to Gram-negative bacterium (GO:0050829)|defense response to Gram-positive bacterium (GO:0050830)|detection of molecule of bacterial origin (GO:0032490)|innate immune response (GO:0045087)|leukocyte chemotaxis involved in inflammatory response (GO:0002232)|lipopolysaccharide transport (GO:0015920)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|macrophage activation involved in immune response (GO:0002281)|negative regulation of growth of symbiont in host (GO:0044130)|negative regulation of tumor necrosis factor production (GO:0032720)|opsonization (GO:0008228)|positive regulation of chemokine production (GO:0032722)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of macrophage activation (GO:0043032)|positive regulation of neutrophil chemotaxis (GO:0090023)|positive regulation of respiratory burst involved in inflammatory response (GO:0060265)|positive regulation of toll-like receptor 4 signaling pathway (GO:0034145)|positive regulation of tumor necrosis factor biosynthetic process (GO:0042535)|positive regulation of tumor necrosis factor production (GO:0032760)|response to lipopolysaccharide (GO:0032496)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)	cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	lipopolysaccharide binding (GO:0001530)|lipoteichoic acid binding (GO:0070891)|receptor binding (GO:0005102)			central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(16)|ovary(2)|prostate(1)|urinary_tract(1)	28		Myeloproliferative disorder(115;0.00878)				TTCAATACCAGCAAGATCACT	0.502																																					p.S396N		Atlas-SNP	.											.	LBP	60	.	0			c.G1187A						.						165.0	146.0	153.0					20																	36999419		2203	4300	6503	SO:0001583	missense	3929	exon11			ATACCAGCAAGAT		CCDS13304.1	20q11.23	2011-08-16	2001-11-28		ENSG00000129988	ENSG00000129988		"""BPI fold containing"""	6517	protein-coding gene	gene with protein product	"""BPI fold containing family D, member 2"""	151990	"""lipopolysaccharide-binding protein"""			8432532	Standard	NM_004139		Approved	BPIFD2	uc002xic.2	P18428	OTTHUMG00000032447	ENST00000217407.2:c.1187G>A	chr20.hg19:g.36999419G>A	ENSP00000217407:p.Ser396Asn	135.0	0.0		233.0	22.0	NM_004139	B2R938|O43438|Q92672|Q9H403|Q9UD66	Missense_Mutation	SNP	ENST00000217407.2	hg19	CCDS13304.1	.	.	.	.	.	.	.	.	.	.	G	5.785	0.329173	0.10956	.	.	ENSG00000129988	ENST00000217407;ENST00000538599	T	0.09538	2.97	4.87	1.41	0.22369	Lipid-binding serum glycoprotein, C-terminal (2);Bactericidal permeability-increasing protein, alpha/beta domain (1);	0.297164	0.34484	N	0.003938	T	0.06280	0.0162	L	0.28014	0.82	0.22127	N	0.999342	B	0.14012	0.009	B	0.25405	0.06	T	0.44559	-0.9320	10	0.09843	T	0.71	-10.8147	6.6596	0.23007	0.1187:0.3223:0.559:0.0	.	396	P18428	LBP_HUMAN	N	396	ENSP00000217407:S396N	ENSP00000217407:S396N	S	+	2	0	LBP	36432833	0.999000	0.42202	0.999000	0.59377	0.582000	0.36321	1.820000	0.39032	0.121000	0.18284	-0.300000	0.09419	AGC	.	.		0.502	LBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079174.2	NM_004139	
DGCR6L	85359	hgsc.bcm.edu	37	22	20302911	20302911	+	Missense_Mutation	SNP	C	C	T	rs573329481		TCGA-CC-5261-01A-01D-A12Z-10	TCGA-CC-5261-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a2f143d6-ba07-4ff0-960d-b29c3c716665	5ad24cf2-db35-428a-a10f-50b2decbe482	g.chr22:20302911C>T	ENST00000248879.3	-	4	552	c.461G>A	c.(460-462)aGc>aAc	p.S154N	XXbac-B444P24.13_ENST00000608275.1_RNA|DGCR6L_ENST00000405465.3_Missense_Mutation_p.S116N	NM_033257.3	NP_150282.2	Q9BY27	DGC6L_HUMAN	DiGeorge syndrome critical region gene 6-like	154						nucleus (GO:0005634)				endometrium(1)|kidney(1)|lung(2)|stomach(1)	5	Colorectal(54;0.0993)					CTCCAGTGTGCTCTGCTGGTC	0.677													.|||	1	0.000199681	0.0008	0.0	5008	,	,		16282	0.0		0.0	False		,,,				2504	0.0				p.S154N		Atlas-SNP	.											.	DGCR6L	9	.	0			c.G461A						.						95.0	79.0	84.0					22																	20302911		2203	4299	6502	SO:0001583	missense	85359	exon4			AGTGTGCTCTGCT	AF228708	CCDS13778.1	22q11.21	2013-02-19			ENSG00000128185	ENSG00000128185			18551	protein-coding gene	gene with protein product		609459				11157784	Standard	NM_033257		Approved	FLJ10666	uc002zrx.3	Q9BY27	OTTHUMG00000150583	ENST00000248879.3:c.461G>A	chr22.hg19:g.20302911C>T	ENSP00000248879:p.Ser154Asn	91.0	0.0		134.0	10.0	NM_033257	A8K1N7|B3KMC0|D3DX29|Q9BW33	Missense_Mutation	SNP	ENST00000248879.3	hg19	CCDS13778.1	.	.	.	.	.	.	.	.	.	.	C	14.97	2.693723	0.48202	.	.	ENSG00000128185	ENST00000248879;ENST00000405465	T;T	0.35048	1.33;1.33	2.04	2.04	0.26737	.	0.089386	0.85682	D	0.000000	T	0.34861	0.0912	N	0.16602	0.42	0.36620	D	0.875729	P;D	0.59357	0.489;0.985	B;D	0.67231	0.265;0.95	T	0.30563	-0.9974	10	0.39692	T	0.17	-31.2466	6.6364	0.22885	0.0:0.6984:0.3015:0.0	.	154;154	B3KMC0;Q9BY27	.;DGC6L_HUMAN	N	154;116	ENSP00000248879:S154N;ENSP00000386052:S116N	ENSP00000248879:S154N	S	-	2	0	DGCR6L	18682911	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	1.798000	0.38814	1.463000	0.47967	0.461000	0.40582	AGC	.	.		0.677	DGCR6L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318970.3	NM_033257	
POLA1	5422	hgsc.bcm.edu	37	X	24741360	24741360	+	Silent	SNP	G	G	A			TCGA-CC-5261-01A-01D-A12Z-10	TCGA-CC-5261-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a2f143d6-ba07-4ff0-960d-b29c3c716665	5ad24cf2-db35-428a-a10f-50b2decbe482	g.chrX:24741360G>A	ENST00000379059.3	+	11	1173	c.1158G>A	c.(1156-1158)acG>acA	p.T386T	POLA1_ENST00000379068.3_Silent_p.T392T	NM_016937.3	NP_058633.2	P09884	DPOLA_HUMAN	polymerase (DNA directed), alpha 1, catalytic subunit	386					cell proliferation (GO:0008283)|DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA replication, synthesis of RNA primer (GO:0006269)|DNA strand elongation involved in DNA replication (GO:0006271)|double-strand break repair via nonhomologous end joining (GO:0006303)|G1/S transition of mitotic cell cycle (GO:0000082)|lagging strand elongation (GO:0006273)|leading strand elongation (GO:0006272)|mitotic cell cycle (GO:0000278)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|translesion synthesis (GO:0019985)|viral process (GO:0016032)	alpha DNA polymerase:primase complex (GO:0005658)|cytoplasm (GO:0005737)|nuclear envelope (GO:0005635)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	3'-5' exonuclease activity (GO:0008408)|4 iron, 4 sulfur cluster binding (GO:0051539)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)|nucleoside binding (GO:0001882)|nucleotide binding (GO:0000166)|protein kinase binding (GO:0019901)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|ovary(2)|skin(2)	11					Cladribine(DB00242)|Clofarabine(DB00631)|Fludarabine(DB01073)|Nelarabine(DB01280)	TCGAGCGAACGCTTTACTTCC	0.423																																					p.T386T		Atlas-SNP	.											.	POLA1	117	.	0			c.G1158A						.						183.0	166.0	172.0					X																	24741360		2203	4300	6503	SO:0001819	synonymous_variant	5422	exon11			GCGAACGCTTTAC		CCDS14214.1	Xp22.1-p21.3	2014-01-30	2008-08-07	2006-09-26	ENSG00000101868	ENSG00000101868	2.7.7.7	"""DNA polymerases"""	9173	protein-coding gene	gene with protein product		312040	"""polymerase (DNA directed), alpha"", ""polymerase (DNA directed), alpha 1"", ""N syndrome (mental retardation, malformations, chromosome breakage)"""	POLA, NSX		1689958	Standard	NM_016937		Approved	p180	uc004dbl.3	P09884	OTTHUMG00000021277	ENST00000379059.3:c.1158G>A	chrX.hg19:g.24741360G>A		175.0	1.0		194.0	131.0	NM_016937	Q86UQ7	Silent	SNP	ENST00000379059.3	hg19	CCDS14214.1																																																																																			.	.		0.423	POLA1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000056111.1	NM_016937	
HTATSF1	27336	hgsc.bcm.edu	37	X	135593320	135593320	+	Silent	SNP	C	C	G			TCGA-CC-5261-01A-01D-A12Z-10	TCGA-CC-5261-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a2f143d6-ba07-4ff0-960d-b29c3c716665	5ad24cf2-db35-428a-a10f-50b2decbe482	g.chrX:135593320C>G	ENST00000218364.4	+	9	1590	c.1416C>G	c.(1414-1416)ccC>ccG	p.P472P	HTATSF1_ENST00000535601.1_Silent_p.P472P	NM_014500.4	NP_055315.2	O43719	HTSF1_HUMAN	HIV-1 Tat specific factor 1	472	Asp/Glu-rich (acidic).|Mediates interaction with the P-TEFb complex.				regulation of DNA-templated transcription, elongation (GO:0032784)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|viral genome replication (GO:0019079)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(1)|biliary_tract(1)|breast(2)|endometrium(1)|kidney(2)|large_intestine(5)|lung(14)|ovary(3)|prostate(1)	30	Acute lymphoblastic leukemia(192;0.000127)					AGGGCTGCCCCAAAAGAGGGT	0.443																																					p.P472P		Atlas-SNP	.											.	HTATSF1	66	.	0			c.C1416G						.						45.0	50.0	48.0					X																	135593320		2187	4280	6467	SO:0001819	synonymous_variant	27336	exon10			CTGCCCCAAAAGA	U76992	CCDS14657.1	Xq26.3	2013-02-12	2006-01-09		ENSG00000102241	ENSG00000102241		"""RNA binding motif (RRM) containing"""	5276	protein-coding gene	gene with protein product		300346	"""HIV TAT specific factor 1"""			8849451	Standard	NM_014500		Approved	TAT-SF1	uc004ezx.3	O43719	OTTHUMG00000022510	ENST00000218364.4:c.1416C>G	chrX.hg19:g.135593320C>G		66.0	0.0		72.0	14.0	NM_001163280	D3DWG9|Q59G06|Q99730	Silent	SNP	ENST00000218364.4	hg19	CCDS14657.1																																																																																			.	.		0.443	HTATSF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058497.1	NM_014500	
KCNQ4	9132	hgsc.bcm.edu	37	1	41285601	41285602	+	Frame_Shift_Ins	INS	-	-	G			TCGA-CC-5261-01A-01D-A12Z-10	TCGA-CC-5261-10A-01D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a2f143d6-ba07-4ff0-960d-b29c3c716665	5ad24cf2-db35-428a-a10f-50b2decbe482	g.chr1:41285601_41285602insG	ENST00000347132.5	+	6	971_972	c.889_890insG	c.(889-891)aggfs	p.R297fs	KCNQ4_ENST00000509682.2_Frame_Shift_Ins_p.R297fs|KCNQ4_ENST00000506017.1_3'UTR	NM_004700.3|NM_172163.2	NP_004691.2|NP_751895.1	P56696	KCNQ4_HUMAN	potassium voltage-gated channel, KQT-like subfamily, member 4	297					inner ear morphogenesis (GO:0042472)|potassium ion transport (GO:0006813)|sensory perception of sound (GO:0007605)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|potassium channel activity (GO:0005267)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(13)|skin(1)	26	Ovarian(52;0.00769)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;1.38e-17)		Ezogabine(DB04953)	ATGGCTGGGCAGGGTCCTGGCT	0.594																																					p.R297fs		Atlas-INDEL	.											.	KCNQ4	58	.	0			c.889_890insG						.																																			SO:0001589	frameshift_variant	9132	exon6			.	AF105202	CCDS456.1	1p34	2012-07-05			ENSG00000117013	ENSG00000117013		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6298	protein-coding gene	gene with protein product		603537		DFNA2		10025409, 16382104	Standard	NM_004700		Approved	Kv7.4	uc001cgh.2	P56696	OTTHUMG00000007730	ENST00000347132.5:c.892dupG	chr1.hg19:g.41285604_41285604dupG	ENSP00000262916:p.Arg297fs	163.0	0.0		155.0	10.0	NM_004700	O96025	Frame_Shift_Ins	INS	ENST00000347132.5	hg19	CCDS456.1																																																																																			.	.		0.594	KCNQ4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000020812.1	NM_004700	
SBNO2	22904	hgsc.bcm.edu	37	19	1113608	1113609	+	Frame_Shift_Ins	INS	-	-	C			TCGA-CC-5261-01A-01D-A12Z-10	TCGA-CC-5261-10A-01D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a2f143d6-ba07-4ff0-960d-b29c3c716665	5ad24cf2-db35-428a-a10f-50b2decbe482	g.chr19:1113608_1113609insC	ENST00000361757.3	-	19	2409_2410	c.2172_2173insG	c.(2170-2175)cggctgfs	p.L725fs	SBNO2_ENST00000587024.1_Frame_Shift_Ins_p.L715fs|SBNO2_ENST00000438103.2_Frame_Shift_Ins_p.L668fs	NM_014963.2	NP_055778.2	Q9Y2G9	SBNO2_HUMAN	strawberry notch homolog 2 (Drosophila)	725					bone mineralization (GO:0030282)|bone trabecula morphogenesis (GO:0061430)|macrophage activation involved in immune response (GO:0002281)|negative regulation of transcription, DNA-templated (GO:0045892)|osteoclast fusion (GO:0072675)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of inflammatory response (GO:0050727)|transcription, DNA-templated (GO:0006351)					NS(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(2)|lung(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	14		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;7.93e-06)|all_lung(49;1.25e-05)|Breast(49;0.000172)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TCCCGGCCCAGCCGCCGCACTT	0.703																																					p.L725fs		Atlas-INDEL	.											.	SBNO2	112	.	0			c.2173_2174insG						.																																			SO:0001589	frameshift_variant	22904	exon19			.	AK074102	CCDS45894.1, CCDS45895.1	19p13.3	2008-02-05	2006-10-06	2006-10-06		ENSG00000064932			29158	protein-coding gene	gene with protein product		615729	"""KIAA0963"""	KIAA0963		10231032	Standard	NM_014963		Approved	FLJ00173, Stno, Sno	uc002lrk.4	Q9Y2G9		ENST00000361757.3:c.2173dupG	chr19.hg19:g.1113610_1113610dupC	ENSP00000354733:p.Leu725fs	69.0	0.0		148.0	10.0	NM_014963	A8K8P2|B3KWJ1|O75257|Q3KQX0|Q8TEM0	Frame_Shift_Ins	INS	ENST00000361757.3	hg19	CCDS45894.1																																																																																			.	.		0.703	SBNO2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000458065.2	NM_014963	
XRCC5	7520	hgsc.bcm.edu	37	2	217012804	217012813	+	Splice_Site	DEL	TTTCCAACAG	TTTCCAACAG	-			TCGA-CC-5261-01A-01D-A12Z-10	TCGA-CC-5261-10A-01D-A12Z-10	TTTCCAACAG	TTTCCAACAG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a2f143d6-ba07-4ff0-960d-b29c3c716665	5ad24cf2-db35-428a-a10f-50b2decbe482	g.chr2:217012804_217012813delTTTCCAACAG	ENST00000392133.3	+	16	1937_1945	c.1476_1484delTTTCCAACAG	c.(1474-1485)catttccaacag>cag	p.HFQ492fs	XRCC5_ENST00000392132.2_Splice_Site_p.HFQ492fs			P13010	XRCC5_HUMAN	X-ray repair complementing defective repair in Chinese hamster cells 5 (double-strand-break rejoining)	492	Pro-rich.				brain development (GO:0007420)|cell proliferation (GO:0008283)|cellular hyperosmotic salinity response (GO:0071475)|cellular response to fatty acid (GO:0071398)|cellular response to X-ray (GO:0071481)|DNA duplex unwinding (GO:0032508)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via nonhomologous end joining (GO:0006303)|establishment of integrated proviral latency (GO:0075713)|hematopoietic stem cell differentiation (GO:0060218)|innate immune response (GO:0045087)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of neurogenesis (GO:0050769)|positive regulation of type I interferon production (GO:0032481)|response to drug (GO:0042493)|telomere maintenance (GO:0000723)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytosol (GO:0005829)|Ku70:Ku80 complex (GO:0043564)|membrane (GO:0016020)|nonhomologous end joining complex (GO:0070419)|nuclear chromosome, telomeric region (GO:0000784)|nuclear telomere cap complex (GO:0000783)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)|telomeric DNA binding (GO:0042162)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)			endometrium(1)|kidney(3)|large_intestine(8)|lung(9)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	24		Renal(323;0.0328)		Epithelial(149;9.78e-06)|all cancers(144;0.000632)|LUSC - Lung squamous cell carcinoma(224;0.00871)|Lung(261;0.0117)		TTTTTCCAACAGTGTCTGCTGCACAGAGCT	0.438								Non-homologous end-joining																													.		Atlas-Indel,Pindel	.											.	XRCC5	64	.	0			.						.																																			SO:0001630	splice_region_variant	7520	.			.	AF039597	CCDS2402.1	2q35	2008-07-31	2008-07-31		ENSG00000079246	ENSG00000079246			12833	protein-coding gene	gene with protein product	"""Ku autoantigen, 80kDa"""	194364	"""X-ray repair complementing defective repair in Chinese hamster cells 5 (double-strand-break rejoining; Ku autoantigen, 80kD)"""			9636207, 9214634	Standard	NM_021141		Approved	KU80, KARP-1, Ku86, KUB2	uc002vfy.3	P13010	OTTHUMG00000133059	ENST00000392133.3:c.1477-1TTTCCAACAG>-	chr2.hg19:g.217012804_217012813delTTTCCAACAG		305.0	0.0		289.0	22.0	.	A8K3X5|Q0Z7V0|Q4VBQ5|Q53HH7|Q7M4N0|Q9UCQ0|Q9UCQ1	Splice_Site	DEL	ENST00000392133.3	hg19	CCDS2402.1																																																																																			.	.		0.438	XRCC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256675.3	NM_021141	Frame_Shift_Del
SP6	80320	hgsc.bcm.edu	37	17	45924716	45924716	+	Frame_Shift_Del	DEL	G	G	-			TCGA-CC-5261-01A-01D-A12Z-10	TCGA-CC-5261-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a2f143d6-ba07-4ff0-960d-b29c3c716665	5ad24cf2-db35-428a-a10f-50b2decbe482	g.chr17:45924716delG	ENST00000536300.1	-	2	1411	c.1080delC	c.(1078-1080)cccfs	p.P360fs	SP6_ENST00000342234.2_Frame_Shift_Del_p.P360fs	NM_001258248.1	NP_001245177.1	Q3SY56	SP6_HUMAN	Sp6 transcription factor	360					positive regulation of cell proliferation (GO:0008284)|regulation of odontogenesis (GO:0042481)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			large_intestine(1)|lung(5)|prostate(1)|skin(1)	8						CTTTGCCCCCGGGGGGCTCCA	0.721																																					p.G361fs		Pindel	.											.	SP6	26	.	0			c.1081delG						.						8.0	11.0	10.0					17																	45924716		2159	4244	6403	SO:0001589	frameshift_variant	80320	exon2			.		CCDS11520.1	17q21.32	2013-01-08			ENSG00000189120	ENSG00000189120		"""Specificity protein transcription factors"", ""Zinc fingers, C2H2-type"""	14530	protein-coding gene	gene with protein product	"""epiprofin"""	608613				11087666, 14551215	Standard	NM_001258248		Approved	KLF14, Epfn	uc002img.2	Q3SY56	OTTHUMG00000132067	ENST00000536300.1:c.1080delC	chr17.hg19:g.45924716delG	ENSP00000438209:p.Pro360fs	36.0	0.0		105.0	22.0	NM_199262	B3KXS4	Frame_Shift_Del	DEL	ENST00000536300.1	hg19	CCDS11520.1																																																																																			.	.		0.721	SP6-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441395.1	NM_199262	
