#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
KIAA2013	90231	hgsc.bcm.edu	37	1	11983301	11983301	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr1:11983301A>G	ENST00000376572.3	-	2	1464	c.1279T>C	c.(1279-1281)Tct>Cct	p.S427P	KIAA2013_ENST00000376576.3_Missense_Mutation_p.S427P	NM_138346.2	NP_612355.1	Q8IYS2	K2013_HUMAN	KIAA2013	427						integral component of membrane (GO:0016021)|membrane (GO:0016020)				endometrium(1)|lung(3)|ovary(1)|prostate(1)|skin(1)	7	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00149)|all_lung(284;0.00189)|Breast(348;0.00586)|Colorectal(325;0.0062)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0556)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;4.88e-06)|COAD - Colon adenocarcinoma(227;0.000241)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|Kidney(185;0.000722)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		CACAGGTCAGAGAGCTGCAGG	0.647																																					p.S427P		Atlas-SNP	.											.	KIAA2013	25	.	0			c.T1279C						.						22.0	22.0	22.0					1																	11983301		2202	4300	6502	SO:0001583	missense	90231	exon2			GGTCAGAGAGCTG	AB095933	CCDS141.1	1p36.22	2011-02-09			ENSG00000116685	ENSG00000116685			28513	protein-coding gene	gene with protein product						12477932	Standard	NM_138346		Approved	MGC33867, RP5-1077B9.1	uc001atk.3	Q8IYS2	OTTHUMG00000002391	ENST00000376572.3:c.1279T>C	chr1.hg19:g.11983301A>G	ENSP00000365756:p.Ser427Pro	161.0	0.0		89.0	4.0	NM_138346	Q5JXC1|Q8IVF8|Q8NDI7|Q9BSY1	Missense_Mutation	SNP	ENST00000376572.3	hg19	CCDS141.1	.	.	.	.	.	.	.	.	.	.	A	11.08	1.533212	0.27387	.	.	ENSG00000116685	ENST00000376572;ENST00000376576	.	.	.	5.52	3.1	0.35709	.	0.594816	0.17241	N	0.181556	T	0.32194	0.0821	L	0.38175	1.15	0.09310	N	0.999998	B;B	0.34264	0.446;0.163	B;B	0.34038	0.17;0.174	T	0.08597	-1.0714	9	0.29301	T	0.29	-14.3534	11.823	0.52250	0.7114:0.2886:0.0:0.0	.	427;427	Q8IYS2-2;Q8IYS2	.;K2013_HUMAN	P	427	.	ENSP00000365756:S427P	S	-	1	0	KIAA2013	11905888	0.838000	0.29461	0.107000	0.21349	0.885000	0.51271	2.858000	0.48356	0.431000	0.26258	0.528000	0.53228	TCT	.	.		0.647	KIAA2013-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006858.1	NM_138346	
IGSF21	84966	hgsc.bcm.edu	37	1	18691796	18691796	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr1:18691796A>G	ENST00000251296.1	+	6	1003	c.620A>G	c.(619-621)cAg>cGg	p.Q207R		NM_032880.4	NP_116269.3	Q96ID5	IGS21_HUMAN	immunoglobin superfamily, member 21	207						extracellular region (GO:0005576)				endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(16)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	40		Colorectal(325;0.000147)|Renal(390;0.00145)|all_lung(284;0.00366)|Lung NSC(340;0.00376)|Breast(348;0.00387)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0439)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0121)|BRCA - Breast invasive adenocarcinoma(304;5.52e-05)|Kidney(64;0.00103)|KIRC - Kidney renal clear cell carcinoma(64;0.0102)|STAD - Stomach adenocarcinoma(196;0.0118)|READ - Rectum adenocarcinoma(331;0.157)		GGCCCCCTACAGGACAGCAGG	0.602																																					p.Q207R		Atlas-SNP	.											.	IGSF21	87	.	0			c.A620G						.						48.0	54.0	52.0					1																	18691796		2203	4300	6503	SO:0001583	missense	84966	exon6			CCCTACAGGACAG	AK075316	CCDS184.1	1p36.13	2013-01-29			ENSG00000117154	ENSG00000117154		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	28246	protein-coding gene	gene with protein product						12477932	Standard	NM_032880		Approved	MGC15730, RP11-121A23.1	uc001bau.2	Q96ID5	OTTHUMG00000002432	ENST00000251296.1:c.620A>G	chr1.hg19:g.18691796A>G	ENSP00000251296:p.Gln207Arg	135.0	0.0		68.0	4.0	NM_032880	Q8NBR8	Missense_Mutation	SNP	ENST00000251296.1	hg19	CCDS184.1	.	.	.	.	.	.	.	.	.	.	A	5.218	0.225751	0.09916	.	.	ENSG00000117154	ENST00000251296	T	0.29917	1.55	4.63	2.19	0.27852	.	0.374960	0.29609	N	0.011676	T	0.14485	0.0350	N	0.19112	0.55	0.28472	N	0.915381	B	0.02656	0.0	B	0.04013	0.001	T	0.25467	-1.0131	10	0.13108	T	0.6	-10.6533	4.7798	0.13197	0.7072:0.1906:0.1022:0.0	.	207	Q96ID5	IGS21_HUMAN	R	207	ENSP00000251296:Q207R	ENSP00000251296:Q207R	Q	+	2	0	IGSF21	18564383	0.968000	0.33430	0.979000	0.43373	0.780000	0.44128	1.073000	0.30691	0.216000	0.20781	0.379000	0.24179	CAG	.	.		0.602	IGSF21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006924.1	NM_032880	
TAS1R2	80834	hgsc.bcm.edu	37	1	19186095	19186095	+	Missense_Mutation	SNP	C	C	G			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr1:19186095C>G	ENST00000375371.3	-	1	81	c.60G>C	c.(58-60)gaG>gaC	p.E20D	RP13-279N23.2_ENST00000494072.3_3'UTR	NM_152232.2	NP_689418.2	Q8TE23	TS1R2_HUMAN	taste receptor, type 1, member 2	20					detection of chemical stimulus involved in sensory perception of sweet taste (GO:0001582)|G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of cytokinesis (GO:0032467)|sensory perception of sweet taste (GO:0050916)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	protein heterodimerization activity (GO:0046982)|taste receptor activity (GO:0008527)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(10)|lung(14)|ovary(1)|pancreas(3)|prostate(1)|skin(3)|stomach(1)	45		Colorectal(325;3.46e-05)|all_lung(284;0.000321)|Lung NSC(340;0.000398)|Renal(390;0.000518)|Breast(348;0.000812)|Ovarian(437;0.00764)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00466)|BRCA - Breast invasive adenocarcinoma(304;3.56e-05)|Kidney(64;0.000177)|KIRC - Kidney renal clear cell carcinoma(64;0.00262)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)	Aspartame(DB00168)	TCTCAGCCGGCTCAGCCAGGA	0.577																																					p.E20D		Atlas-SNP	.											.	TAS1R2	134	.	0			c.G60C						.						120.0	111.0	114.0					1																	19186095		2203	4300	6503	SO:0001583	missense	80834	exon1			AGCCGGCTCAGCC		CCDS187.1	1p36.13	2012-08-22	2003-03-07		ENSG00000179002	ENSG00000179002		"""Taste receptors / Type 1"", ""GPCR / Unclassified : Taste receptors"""	14905	protein-coding gene	gene with protein product		606226	"""G protein-coupled receptor 71"""	GPR71			Standard	NM_152232		Approved	T1R2, TR2	uc001bba.1	Q8TE23	OTTHUMG00000002442	ENST00000375371.3:c.60G>C	chr1.hg19:g.19186095C>G	ENSP00000364520:p.Glu20Asp	186.0	0.0		135.0	90.0	NM_152232	Q5TZ19	Missense_Mutation	SNP	ENST00000375371.3	hg19	CCDS187.1	.	.	.	.	.	.	.	.	.	.	C	12.20	1.866326	0.32977	.	.	ENSG00000179002	ENST00000375371	D	0.88896	-2.44	4.47	2.58	0.30949	.	.	.	.	.	T	0.79511	0.4458	L	0.40543	1.245	0.09310	N	1	P	0.38922	0.651	B	0.32677	0.15	T	0.64241	-0.6454	9	0.14656	T	0.56	.	7.1459	0.25583	0.0:0.7855:0.0:0.2145	.	20	Q8TE23	TS1R2_HUMAN	D	20	ENSP00000364520:E20D	ENSP00000364520:E20D	E	-	3	2	TAS1R2	19058682	0.000000	0.05858	0.001000	0.08648	0.082000	0.17680	0.321000	0.19558	0.446000	0.26666	0.313000	0.20887	GAG	.	.		0.577	TAS1R2-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000006953.1		
SRRM1	10250	hgsc.bcm.edu	37	1	24997900	24997900	+	Silent	SNP	A	A	G			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr1:24997900A>G	ENST00000323848.9	+	16	2739	c.2424A>G	c.(2422-2424)ggA>ggG	p.G808G	SRRM1_ENST00000374389.4_Silent_p.G817G|SRRM1_ENST00000447431.2_Silent_p.G820G|SRRM1_ENST00000479034.1_3'UTR	NM_005839.3	NP_005830.2	Q8IYB3	SRRM1_HUMAN	serine/arginine repetitive matrix 1	808					gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	catalytic step 2 spliceosome (GO:0071013)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(12)|lung(9)|ovary(2)|prostate(1)|urinary_tract(2)	36		Colorectal(325;3.46e-05)|Renal(390;0.0007)|Lung NSC(340;0.000946)|all_lung(284;0.00125)|Ovarian(437;0.00764)|Breast(348;0.0148)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.19)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0422)|OV - Ovarian serous cystadenocarcinoma(117;1.01e-24)|Colorectal(126;5.95e-08)|COAD - Colon adenocarcinoma(152;3.24e-06)|GBM - Glioblastoma multiforme(114;0.000148)|BRCA - Breast invasive adenocarcinoma(304;0.00177)|KIRC - Kidney renal clear cell carcinoma(1967;0.00348)|STAD - Stomach adenocarcinoma(196;0.00483)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.138)		AAGGAGGTGGAaagaaaaaga	0.358																																					p.G808G	Ovarian(68;897 1494 3282 17478)	Atlas-SNP	.											.	SRRM1	81	.	0			c.A2424G						.						40.0	42.0	41.0					1																	24997900		2203	4300	6503	SO:0001819	synonymous_variant	10250	exon16			AGGTGGAAAGAAA	AF048977	CCDS255.1	1p36	2010-04-22			ENSG00000133226	ENSG00000133226			16638	protein-coding gene	gene with protein product	"""Ser/Arg-related nuclear matrix protein"", ""plenty of prolines 101-like"""	605975				9531537	Standard	NM_005839		Approved	SRM160, POP101, MGC39488	uc001bjm.3	Q8IYB3	OTTHUMG00000003320	ENST00000323848.9:c.2424A>G	chr1.hg19:g.24997900A>G		100.0	0.0		66.0	4.0	NM_005839	O60585|Q5VVN4	Silent	SNP	ENST00000323848.9	hg19	CCDS255.1																																																																																			.	.		0.358	SRRM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000009292.2	NM_005839	
SLFNL1	200172	hgsc.bcm.edu	37	1	41481866	41481866	+	Missense_Mutation	SNP	T	T	A	rs558283454	byFrequency	TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr1:41481866T>A	ENST00000359345.1	-	4	3712	c.1136A>T	c.(1135-1137)aAg>aTg	p.K379M	SLFNL1_ENST00000372613.2_Missense_Mutation_p.K331M|SLFNL1_ENST00000302946.8_Missense_Mutation_p.K379M|SLFNL1_ENST00000372611.1_Missense_Mutation_p.K320M|SLFNL1_ENST00000397197.2_Missense_Mutation_p.K331M|SLFNL1_ENST00000439569.2_Missense_Mutation_p.K379M	NM_144990.3	NP_659427.3	Q499Z3	SLNL1_HUMAN	schlafen-like 1	379							ATP binding (GO:0005524)			endometrium(3)|large_intestine(3)|lung(2)|prostate(1)|skin(1)	10	Ovarian(52;0.00769)|all_hematologic(146;0.0977)|Breast(333;0.1)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0393)				CGCCTTCATCTTCTCTTCCAG	0.637																																					p.K379M		Atlas-SNP	.											.	SLFNL1	37	.	0			c.A1136T						.						93.0	85.0	88.0					1																	41481866		2203	4300	6503	SO:0001583	missense	200172	exon6			TTCATCTTCTCTT	BC022037	CCDS460.1, CCDS72766.1	1p34.2	2008-02-05			ENSG00000171790	ENSG00000171790			26313	protein-coding gene	gene with protein product							Standard	NM_144990		Approved	FLJ23878	uc001cgm.2	Q499Z3	OTTHUMG00000005719	ENST00000359345.1:c.1136A>T	chr1.hg19:g.41481866T>A	ENSP00000352299:p.Lys379Met	138.0	0.0		176.0	12.0	NM_001168247	A8K8D1|Q49AG8|Q5VW72|Q5VW74|Q8N7V7|Q8TCH6|Q8WVZ8	Missense_Mutation	SNP	ENST00000359345.1	hg19	CCDS460.1	.	.	.	.	.	.	.	.	.	.	T	14.03	2.414547	0.42817	.	.	ENSG00000171790	ENST00000302946;ENST00000372613;ENST00000372611;ENST00000359345;ENST00000439569;ENST00000397197	T;T;T;T;T;T	0.32515	1.45;1.7;1.55;1.45;1.45;1.7	5.25	-2.72	0.05968	.	0.516811	0.17718	N	0.164340	T	0.27063	0.0663	N	0.24115	0.695	0.22827	N	0.998686	P;P;P	0.49696	0.927;0.83;0.881	P;P;P	0.53062	0.717;0.508;0.525	T	0.28364	-1.0046	10	0.72032	D	0.01	-45.9013	10.1794	0.42959	0.0:0.3847:0.0:0.6153	.	331;320;379	Q499Z3-3;Q499Z3-2;Q499Z3	.;.;SLNL1_HUMAN	M	379;331;320;379;379;331	ENSP00000304401:K379M;ENSP00000361696:K331M;ENSP00000361694:K320M;ENSP00000352299:K379M;ENSP00000398938:K379M;ENSP00000380381:K331M	ENSP00000304401:K379M	K	-	2	0	SLFNL1	41254453	0.000000	0.05858	0.632000	0.29296	0.291000	0.27294	-0.048000	0.11944	-0.239000	0.09710	-1.545000	0.00906	AAG	.	.		0.637	SLFNL1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000015650.1	NM_144990	
CCDC30	728621	hgsc.bcm.edu	37	1	43076653	43076653	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr1:43076653T>C	ENST00000340612.4	+	9	1388	c.1388T>C	c.(1387-1389)gTc>gCc	p.V463A	CCDC30_ENST00000390640.4_Missense_Mutation_p.V252A|CCDC30_ENST00000428554.2_Missense_Mutation_p.V463A|CCDC30_ENST00000507855.1_Missense_Mutation_p.V252A|CCDC30_ENST00000342022.4_Missense_Mutation_p.V463A			Q5VVM6	CCD30_HUMAN	coiled-coil domain containing 30	463						extracellular vesicular exosome (GO:0070062)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(11)|ovary(1)|pancreas(1)|prostate(1)|urinary_tract(2)	30						TTTCAGCATGTCAAAAGCAAC	0.348																																					p.V463A		Atlas-SNP	.											.	CCDC30	78	.	0			c.T1388C						.						92.0	88.0	89.0					1																	43076653		2203	4300	6503	SO:0001583	missense	728621	exon10			AGCATGTCAAAAG	AY639646	CCDS30690.1	1p34.2	2009-07-09			ENSG00000186409	ENSG00000186409			26103	protein-coding gene	gene with protein product	"""prefoldin 6-like"""					16710767	Standard	NM_001080850		Approved	FLJ20972, PFD6L, LOC728621	uc009vwk.1	Q5VVM6	OTTHUMG00000007334	ENST00000340612.4:c.1388T>C	chr1.hg19:g.43076653T>C	ENSP00000340378:p.Val463Ala	82.0	0.0		65.0	4.0	NM_001080850	Q14F06|Q5VVM5	Missense_Mutation	SNP	ENST00000340612.4	hg19	CCDS30690.1	.	.	.	.	.	.	.	.	.	.	T	11.46	1.646364	0.29246	.	.	ENSG00000186409	ENST00000428554;ENST00000507855;ENST00000340612;ENST00000342022;ENST00000390640	T;T;T;T;T	0.42131	0.98;0.98;0.98;0.98;0.98	5.68	5.68	0.88126	.	0.833727	0.10772	N	0.635922	T	0.33962	0.0881	L	0.40543	1.245	0.19775	N	0.999952	B;P	0.42871	0.341;0.792	B;B	0.37601	0.116;0.254	T	0.11567	-1.0582	10	0.18710	T	0.47	.	12.3251	0.55007	0.0:0.0:0.0:1.0	.	463;252	Q5VVM6;Q5VVM6-2	CCD30_HUMAN;.	A	463;252;463;463;252	ENSP00000397035:V463A;ENSP00000426711:V252A;ENSP00000340378:V463A;ENSP00000339280:V463A;ENSP00000375051:V252A	ENSP00000340378:V463A	V	+	2	0	CCDC30	42849240	0.636000	0.27207	0.784000	0.31847	0.131000	0.20780	0.634000	0.24614	2.156000	0.67533	0.460000	0.39030	GTC	.	.		0.348	CCDC30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019524.3	NM_025030	
CFAP57	149465	hgsc.bcm.edu	37	1	43649297	43649297	+	Silent	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr1:43649297T>C	ENST00000372492.4	+	4	834	c.510T>C	c.(508-510)tgT>tgC	p.C170C	WDR65_ENST00000528956.1_Silent_p.C170C	NM_001195831.2	NP_001182760.2	Q96MR6	WDR65_HUMAN		170										NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(7)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	23	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)				CTCAGGTGTGTGTCACTGGAA	0.413																																					p.C170C		Atlas-SNP	.											.	WDR65	76	.	0			c.T510C						.						84.0	86.0	85.0					1																	43649297		2203	4300	6503	SO:0001819	synonymous_variant	149465	exon4			GGTGTGTGTCACT																												ENST00000372492.4:c.510T>C	chr1.hg19:g.43649297T>C		87.0	0.0		119.0	5.0	NM_152498	A6NKQ3|Q17RI9|Q5TAI0	Silent	SNP	ENST00000372492.4	hg19																																																																																				.	.		0.413	WDR65-002	NOVEL	not_organism_supported|basic|appris_principal|exp_conf	protein_coding	protein_coding	OTTHUMT00000384325.1		
TESK2	10420	hgsc.bcm.edu	37	1	45811552	45811552	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr1:45811552T>C	ENST00000372086.3	-	10	1394	c.994A>G	c.(994-996)Agg>Ggg	p.R332G	TESK2_ENST00000538496.1_Missense_Mutation_p.R249G|TESK2_ENST00000486676.1_5'UTR|TESK2_ENST00000372084.1_Missense_Mutation_p.R303G|TESK2_ENST00000341771.6_Missense_Mutation_p.R303G	NM_007170.2	NP_009101.2	Q96S53	TESK2_HUMAN	testis-specific kinase 2	332					actin cytoskeleton organization (GO:0030036)|focal adhesion assembly (GO:0048041)|protein phosphorylation (GO:0006468)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)			breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|liver(1)|lung(9)|ovary(2)|pancreas(2)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	32	Acute lymphoblastic leukemia(166;0.155)					CTCTTACCCCTGGCTGTGGGC	0.557																																					p.R332G		Atlas-SNP	.											.	TESK2	60	.	0			c.A994G						.						95.0	96.0	95.0					1																	45811552		1915	4127	6042	SO:0001583	missense	10420	exon10			TACCCCTGGCTGT	AJ132545	CCDS41323.1	1p32	2010-04-27			ENSG00000070759	ENSG00000070759	2.7.12.1		11732	protein-coding gene	gene with protein product		604746				10512679	Standard	NM_007170		Approved		uc001cns.1	Q96S53	OTTHUMG00000007680	ENST00000372086.3:c.994A>G	chr1.hg19:g.45811552T>C	ENSP00000361158:p.Arg332Gly	104.0	0.0		110.0	5.0	NM_007170	Q5T422|Q5T423|Q8N520|Q9Y3Q6	Missense_Mutation	SNP	ENST00000372086.3	hg19	CCDS41323.1	.	.	.	.	.	.	.	.	.	.	T	12.33	1.904575	0.33628	.	.	ENSG00000070759	ENST00000372084;ENST00000372086;ENST00000372083;ENST00000341771;ENST00000538496	T;T;T;T	0.75260	-0.16;-0.65;-0.16;-0.92	5.67	5.67	0.87782	Protein kinase-like domain (1);	0.409870	0.25572	N	0.029742	T	0.51295	0.1666	N	0.03608	-0.345	0.80722	D	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.50457	-0.8826	10	0.37606	T	0.19	.	10.8885	0.46981	0.0:0.0:0.1574:0.8426	.	303;332	Q96S53-3;Q96S53	.;TESK2_HUMAN	G	303;332;316;303;249	ENSP00000361156:R303G;ENSP00000361158:R332G;ENSP00000343940:R303G;ENSP00000441746:R249G	ENSP00000343940:R303G	R	-	1	2	TESK2	45584139	0.997000	0.39634	0.856000	0.33681	0.442000	0.32017	5.878000	0.69682	2.168000	0.68352	0.529000	0.55759	AGG	.	.		0.557	TESK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000020523.1	NM_007170	
DMBX1	127343	hgsc.bcm.edu	37	1	46976674	46976674	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr1:46976674A>G	ENST00000360032.3	+	3	415	c.401A>G	c.(400-402)cAg>cGg	p.Q134R	DMBX1_ENST00000371956.4_Missense_Mutation_p.Q139R	NM_172225.1	NP_757379.1			diencephalon/mesencephalon homeobox 1											endometrium(2)|large_intestine(3)|lung(6)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	17	Acute lymphoblastic leukemia(166;0.155)					GAACAGCTCCAGAAGCAGAAG	0.647																																					p.Q139R		Atlas-SNP	.											.	DMBX1	50	.	0			c.A416G						.						41.0	49.0	47.0					1																	46976674		2203	4300	6503	SO:0001583	missense	127343	exon3			AGCTCCAGAAGCA	AB037699	CCDS536.1	1p34.1	2011-06-20	2004-03-29	2004-03-30	ENSG00000197587	ENSG00000197587		"""Homeoboxes / PRD class"""	19026	protein-coding gene	gene with protein product		607410	"""orthodenticle homolog 3 (Drosophila)"""	OTX3			Standard	NM_147192		Approved	PAXB	uc001cpx.3	Q8NFW5	OTTHUMG00000007982	ENST00000360032.3:c.401A>G	chr1.hg19:g.46976674A>G	ENSP00000353132:p.Gln134Arg	124.0	0.0		117.0	43.0	NM_147192		Missense_Mutation	SNP	ENST00000360032.3	hg19	CCDS536.1	.	.	.	.	.	.	.	.	.	.	A	22.4	4.279998	0.80692	.	.	ENSG00000197587	ENST00000371956;ENST00000360032	D;D	0.93906	-3.21;-3.31	5.01	5.01	0.66863	.	0.000000	0.85682	D	0.000000	D	0.94551	0.8245	L	0.55990	1.75	0.80722	D	1	D;D	0.71674	0.997;0.998	D;D	0.79784	0.985;0.993	D	0.92307	0.5854	10	0.09590	T	0.72	.	13.9043	0.63823	1.0:0.0:0.0:0.0	.	139;134	Q8NFW5;Q8NFW5-2	DMBX1_HUMAN;.	R	139;134	ENSP00000361024:Q139R;ENSP00000353132:Q134R	ENSP00000353132:Q134R	Q	+	2	0	DMBX1	46749261	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	9.333000	0.96459	1.894000	0.54839	0.482000	0.46254	CAG	.	.		0.647	DMBX1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000021895.1		
CDKN2C	1031	hgsc.bcm.edu	37	1	51436144	51436144	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr1:51436144A>G	ENST00000262662.1	+	3	2138	c.104A>G	c.(103-105)aAt>aGt	p.N35S	CDKN2C_ENST00000396148.1_Missense_Mutation_p.N35S|CDKN2C_ENST00000371761.3_Missense_Mutation_p.N35S			P42773	CDN2C_HUMAN	cyclin-dependent kinase inhibitor 2C (p18, inhibits CDK4)	35					cell cycle arrest (GO:0007050)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of phosphorylation (GO:0042326)|negative regulation of protein serine/threonine kinase activity (GO:0071901)|oligodendrocyte differentiation (GO:0048709)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	cyclin-dependent protein serine/threonine kinase inhibitor activity (GO:0004861)|protein kinase binding (GO:0019901)	p.0?(11)		central_nervous_system(8)|haematopoietic_and_lymphoid_tissue(5)|kidney(2)|large_intestine(2)|lung(2)|ovary(2)|prostate(1)|thyroid(1)	23				GBM - Glioblastoma multiforme(3;3.61e-13)|all cancers(3;0.00151)		AATGCACAAAATGGATTTGGA	0.488			D		"""glioma, MM"""																																p.N35S	Melanoma(47;50 1155 4767 22863 47597)	Atlas-SNP	.		Rec	yes		1	1p32	1031	"""cyclin-dependent kinase inhibitor 2C (p18, inhibits CDK4)"""		"""O, L"""	.	CDKN2C	24	.	11	Whole gene deletion(11)	central_nervous_system(6)|haematopoietic_and_lymphoid_tissue(4)|thyroid(1)	c.A104G						.						104.0	106.0	105.0					1																	51436144		2203	4300	6503	SO:0001583	missense	1031	exon2			CACAAAATGGATT	BC000598	CCDS555.1	1p32.3	2013-01-10			ENSG00000123080	ENSG00000123080		"""Ankyrin repeat domain containing"""	1789	protein-coding gene	gene with protein product		603369				8001816, 9636670	Standard	NM_001262		Approved	INK4C, p18	uc001csg.3	P42773	OTTHUMG00000008046	ENST00000262662.1:c.104A>G	chr1.hg19:g.51436144A>G	ENSP00000262662:p.Asn35Ser	89.0	0.0		94.0	4.0	NM_001262	Q8TB83	Missense_Mutation	SNP	ENST00000262662.1	hg19	CCDS555.1	.	.	.	.	.	.	.	.	.	.	A	17.83	3.486198	0.63962	.	.	ENSG00000123080	ENST00000262662;ENST00000396148;ENST00000371761	T;T;T	0.68765	-0.35;-0.35;-0.35	5.23	4.07	0.47477	Ankyrin repeat-containing domain (4);	0.000000	0.85682	D	0.000000	T	0.69682	0.3138	M	0.79258	2.445	0.52099	D	0.999946	P	0.49559	0.925	P	0.45681	0.49	T	0.72906	-0.4150	10	0.62326	D	0.03	-6.7408	11.3684	0.49686	0.8641:0.0:0.0:0.1359	.	35	P42773	CDN2C_HUMAN	S	35	ENSP00000262662:N35S;ENSP00000379452:N35S;ENSP00000360826:N35S	ENSP00000262662:N35S	N	+	2	0	CDKN2C	51208732	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.939000	0.87685	0.965000	0.38133	0.533000	0.62120	AAT	.	.		0.488	CDKN2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022058.1	NM_001262	
NRD1	4898	hgsc.bcm.edu	37	1	52306079	52306079	+	Missense_Mutation	SNP	T	T	A	rs62648104		TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr1:52306079T>A	ENST00000354831.7	-	2	638	c.449A>T	c.(448-450)gAg>gTg	p.E150V	NRD1_ENST00000352171.7_Missense_Mutation_p.E150V|NRD1_ENST00000544028.1_Missense_Mutation_p.E18V|NRD1_ENST00000539524.1_Missense_Mutation_p.E18V|NRD1_ENST00000485608.1_5'UTR	NM_002525.2	NP_002516.2	O43847	NRDC_HUMAN	nardilysin (N-arginine dibasic convertase)	0	Asp/Glu-rich (highly acidic).|Poly-Glu.				cell migration (GO:0016477)|cell proliferation (GO:0008283)|neuromuscular junction development (GO:0007528)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)|proteolysis (GO:0006508)|regulation of endopeptidase activity (GO:0052548)	cell surface (GO:0009986)|cytosol (GO:0005829)	epidermal growth factor binding (GO:0048408)|metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)			NS(1)|breast(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(6)|lung(9)|pancreas(1)|prostate(1)|skin(1)	27						ttcttcttcctccacctcctc	0.378																																					p.E150V		Atlas-SNP	.											.	NRD1	89	.	0			c.A449T						.						163.0	138.0	146.0					1																	52306079		2203	4300	6503	SO:0001583	missense	4898	exon2			TCTTCCTCCACCT	X93207	CCDS559.1, CCDS41335.1, CCDS55599.1	1p32.2-p32.1	2008-07-18			ENSG00000078618	ENSG00000078618			7995	protein-coding gene	gene with protein product		602651				9581555, 9479496	Standard	NM_002525		Approved	hNRD1, hNRD2	uc001ctc.4	O43847	OTTHUMG00000008278	ENST00000354831.7:c.449A>T	chr1.hg19:g.52306079T>A	ENSP00000346890:p.Glu150Val	235.0	0.0		233.0	36.0	NM_001101662	A6NI41|O15241|O15242|Q5VUL0|Q96HB2|Q9NU57	Missense_Mutation	SNP	ENST00000354831.7	hg19	CCDS559.1	.	.	.	.	.	.	.	.	.	.	T	3.056	-0.194350	0.06259	.	.	ENSG00000078618	ENST00000352171;ENST00000354831;ENST00000539524;ENST00000546169;ENST00000544028	T;T;T;T	0.38240	1.31;3.15;1.15;1.22	5.25	2.92	0.33932	Metalloenzyme, LuxS/M16 peptidase-like, metal-binding (1);	0.525899	0.19688	N	0.108344	T	0.18341	0.0440	N	0.14661	0.345	0.09310	N	1	B;B;B	0.23650	0.062;0.089;0.01	B;B;B	0.17098	0.017;0.007;0.007	T	0.14755	-1.0461	10	0.38643	T	0.18	-0.0317	5.1939	0.15225	0.0:0.1704:0.2022:0.6274	rs62648104	150;150;150	F5H6R2;O43847;B1AKJ5	.;NRDC_HUMAN;.	V	150;150;18;150;18	ENSP00000262679:E150V;ENSP00000346890:E150V;ENSP00000444416:E18V;ENSP00000442262:E18V	ENSP00000262679:E150V	E	-	2	0	NRD1	52078667	0.129000	0.22400	0.012000	0.15200	0.145000	0.21501	0.870000	0.28010	0.317000	0.23160	0.454000	0.30748	GAG	.	T|0.024;A|0.976		0.378	NRD1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000023045.1	NM_002525	
ACADM	34	hgsc.bcm.edu	37	1	76216192	76216192	+	Silent	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr1:76216192T>C	ENST00000370841.4	+	10	1343	c.906T>C	c.(904-906)taT>taC	p.Y302Y	ACADM_ENST00000481374.1_3'UTR|ACADM_ENST00000420607.2_Silent_p.Y306Y|ACADM_ENST00000541113.1_Silent_p.Y266Y|ACADM_ENST00000370834.5_Silent_p.Y335Y|ACADM_ENST00000543667.1_Silent_p.Y113Y	NM_000016.4|NM_001127328.1	NP_000007.1|NP_001120800.1	P11310	ACADM_HUMAN	acyl-CoA dehydrogenase, C-4 to C-12 straight chain	302					cardiac muscle cell differentiation (GO:0055007)|carnitine biosynthetic process (GO:0045329)|carnitine metabolic process, CoA-linked (GO:0019254)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|fatty acid beta-oxidation using acyl-CoA dehydrogenase (GO:0033539)|glycogen biosynthetic process (GO:0005978)|liver development (GO:0001889)|medium-chain fatty acid catabolic process (GO:0051793)|medium-chain fatty acid metabolic process (GO:0051791)|oxidation-reduction process (GO:0055114)|post-embryonic development (GO:0009791)|regulation of gluconeogenesis (GO:0006111)|response to cold (GO:0009409)|response to starvation (GO:0042594)|small molecule metabolic process (GO:0044281)	axon (GO:0030424)|extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	acyl-CoA dehydrogenase activity (GO:0003995)|flavin adenine dinucleotide binding (GO:0050660)|identical protein binding (GO:0042802)|medium-chain-acyl-CoA dehydrogenase activity (GO:0070991)			breast(3)|kidney(1)|large_intestine(7)|lung(5)|ovary(1)|skin(1)	18					Flavin adenine dinucleotide(DB03147)	CTACCAAGTATGCCCTGGAAA	0.333																																					p.Y306Y		Atlas-SNP	.											.	ACADM	50	.	0			c.T918C						.						66.0	73.0	71.0					1																	76216192		2203	4300	6503	SO:0001819	synonymous_variant	34	exon10			CAAGTATGCCCTG	M16827	CCDS668.1, CCDS44165.1, CCDS65562.1, CCDS72807.1	1p31	2014-09-17	2010-04-30		ENSG00000117054	ENSG00000117054	1.3.99.3		89	protein-coding gene	gene with protein product		607008	"""acyl-Coenzyme A dehydrogenase, C-4 to C-12 straight chain"""			3035565	Standard	NM_000016		Approved	MCAD, MCADH, ACAD1	uc009wbp.3	P11310	OTTHUMG00000009784	ENST00000370841.4:c.906T>C	chr1.hg19:g.76216192T>C		75.0	0.0		86.0	4.0	NM_001127328	Q5T4U4|Q9NYF1	Silent	SNP	ENST00000370841.4	hg19	CCDS668.1																																																																																			.	.		0.333	ACADM-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000026967.1		
GBP5	115362	hgsc.bcm.edu	37	1	89728392	89728392	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr1:89728392A>G	ENST00000370459.3	-	9	1566	c.1439T>C	c.(1438-1440)cTc>cCc	p.L480P	GBP5_ENST00000471171.1_5'Flank|RP4-620F22.2_ENST00000437128.1_RNA|GBP5_ENST00000343435.5_Missense_Mutation_p.L480P			Q96PP8	GBP5_HUMAN	guanylate binding protein 5	480						cytoplasm (GO:0005737)|membrane (GO:0016020)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)			breast(1)|endometrium(1)|large_intestine(6)|lung(14)|ovary(1)|prostate(1)	24				all cancers(265;0.00784)|Epithelial(280;0.0286)		CGTCTCTGTGAGAGCCTGGTC	0.383																																					p.L480P		Atlas-SNP	.											.	GBP5	65	.	0			c.T1439C						.						80.0	81.0	81.0					1																	89728392		2203	4300	6503	SO:0001583	missense	115362	exon10			TCTGTGAGAGCCT	AF430642	CCDS722.1	1p22.2	2008-02-05			ENSG00000154451	ENSG00000154451			19895	protein-coding gene	gene with protein product		611467					Standard	NM_052942		Approved		uc001dnd.3	Q96PP8	OTTHUMG00000010006	ENST00000370459.3:c.1439T>C	chr1.hg19:g.89728392A>G	ENSP00000359488:p.Leu480Pro	102.0	0.0		75.0	4.0	NM_052942	B2RCE1|Q86TM5	Missense_Mutation	SNP	ENST00000370459.3	hg19	CCDS722.1	.	.	.	.	.	.	.	.	.	.	A	23.1	4.372748	0.82573	.	.	ENSG00000154451	ENST00000343435;ENST00000370459;ENST00000443807	T;T;T	0.72725	-0.68;-0.68;-0.68	4.86	4.86	0.63082	Guanylate-binding protein, C-terminal (3);	0.000000	0.64402	D	0.000001	D	0.84070	0.5391	M	0.90922	3.16	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.87593	0.2492	10	0.87932	D	0	-17.0177	12.8668	0.57944	1.0:0.0:0.0:0.0	.	480	Q96PP8	GBP5_HUMAN	P	480	ENSP00000340396:L480P;ENSP00000359488:L480P;ENSP00000403010:L480P	ENSP00000340396:L480P	L	-	2	0	GBP5	89500980	1.000000	0.71417	0.997000	0.53966	0.295000	0.27426	4.243000	0.58721	2.198000	0.70561	0.524000	0.50904	CTC	.	.		0.383	GBP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027700.1	NM_052942	
COL11A1	1301	hgsc.bcm.edu	37	1	103491481	103491481	+	Intron	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr1:103491481T>C	ENST00000370096.3	-	6	1210				COL11A1_ENST00000353414.4_Intron|COL11A1_ENST00000358392.2_Missense_Mutation_p.M270V|COL11A1_ENST00000512756.1_Intron	NM_001854.3	NP_001845.3	P12107	COBA1_HUMAN	collagen, type XI, alpha 1						cartilage condensation (GO:0001502)|chondrocyte development (GO:0002063)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|embryonic skeletal system morphogenesis (GO:0048704)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|inner ear morphogenesis (GO:0042472)|proteoglycan metabolic process (GO:0006029)|sensory perception of sound (GO:0007605)|tendon development (GO:0035989)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|visual perception (GO:0007601)	collagen type XI trimer (GO:0005592)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix binding (GO:0050840)|extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)|protein binding, bridging (GO:0030674)			NS(3)|biliary_tract(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(17)|kidney(8)|large_intestine(28)|lung(157)|ovary(6)|pancreas(2)|prostate(6)|skin(9)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(1)	258		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)		ACTGTCCTCATCTTCTTTTTG	0.333																																					p.M270V		Atlas-SNP	.											COL11A1,NS,carcinoma,0,1	COL11A1	972	.	0			c.A808G						.						108.0	116.0	113.0					1																	103491481		2202	4300	6502	SO:0001627	intron_variant	1301	exon6			TCCTCATCTTCTT	J04177	CCDS778.1, CCDS780.1, CCDS780.2, CCDS53348.1	1p21	2013-01-16			ENSG00000060718	ENSG00000060718		"""Collagens"""	2186	protein-coding gene	gene with protein product	"""collagen XI, alpha-1 polypeptide"""	120280		COLL6		3182841	Standard	NM_080630		Approved	STL2, CO11A1	uc001dul.3	P12107	OTTHUMG00000010872	ENST00000370096.3:c.897+290A>G	chr1.hg19:g.103491481T>C		63.0	0.0		35.0	2.0	NM_080629	B1ASK7|D3DT73|E9PCU0|Q14034|Q149N0|Q9UIT4|Q9UIT5|Q9UIT6	Missense_Mutation	SNP	ENST00000370096.3	hg19	CCDS778.1	.	.	.	.	.	.	.	.	.	.	T	6.480	0.456688	0.12283	.	.	ENSG00000060718	ENST00000358392;ENST00000427239	T;T	0.70986	-0.5;-0.53	5.54	5.54	0.83059	.	3.549350	0.00424	N	0.000067	T	0.39332	0.1074	N	0.08118	0	0.80722	D	1	B	0.02656	0.0	B	0.06405	0.002	T	0.00400	-1.1763	10	0.16896	T	0.51	.	15.6738	0.77300	0.0:0.0:0.0:1.0	.	270	P12107-2	.	V	270	ENSP00000351163:M270V;ENSP00000408640:M270V	ENSP00000351163:M270V	M	-	1	0	COL11A1	103264069	1.000000	0.71417	0.931000	0.37212	0.990000	0.78478	5.758000	0.68776	2.109000	0.64355	0.523000	0.50628	ATG	.	.		0.333	COL11A1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000029997.1	NM_080630	
ADORA3	140	hgsc.bcm.edu	37	1	112033360	112033360	+	Silent	SNP	C	C	T			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr1:112033360C>T	ENST00000369716.4	-	2	508	c.375G>A	c.(373-375)ggG>ggA	p.G125G	RNU6-792P_ENST00000363490.1_RNA|ADORA3_ENST00000369717.4_Silent_p.G44G	NM_020683.6	NP_065734.5	P33765	AA3R_HUMAN	adenosine A3 receptor	250					activation of adenylate cyclase activity (GO:0007190)|histamine secretion by mast cell (GO:0002553)|inflammatory response (GO:0006954)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of inflammatory response (GO:0050729)|positive regulation of leukocyte migration (GO:0002687)|positive regulation of mast cell degranulation (GO:0043306)|positive regulation of mucus secretion (GO:0070257)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|regulation of heart contraction (GO:0008016)|response to wounding (GO:0009611)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|mast cell granule (GO:0042629)|plasma membrane (GO:0005886)	G-protein coupled adenosine receptor activity (GO:0001609)	p.G125G(1)		NS(1)|breast(2)|endometrium(1)|large_intestine(2)|lung(3)|ovary(2)|skin(1)	12		all_cancers(81;1.63e-06)|all_epithelial(167;5.01e-06)|all_lung(203;8.02e-05)|Lung NSC(277;0.000156)		all cancers(265;0.0185)|Colorectal(144;0.0186)|Lung(183;0.0238)|COAD - Colon adenocarcinoma(174;0.0644)|Epithelial(280;0.0872)|LUSC - Lung squamous cell carcinoma(189;0.134)	Adenosine(DB00640)|Aminophylline(DB01223)|Enprofylline(DB00824)	ATAGAATGCACCCAGGGAGCC	0.448																																					p.G125G		Atlas-SNP	.											ADORA3_ENST00000369716,NS,carcinoma,0,1	ADORA3	104	.	1	Substitution - coding silent(1)	ovary(1)	c.G375A						.						101.0	95.0	97.0					1																	112033360		2203	4300	6503	SO:0001819	synonymous_variant	140	exon2			AATGCACCCAGGG	BC029831	CCDS838.1, CCDS839.1, CCDS41369.1	1p13.2	2014-09-17			ENSG00000121933	ENSG00000121933		"""GPCR / Class A : Adenosine receptors"", ""Immunoglobulin superfamily / V-set domain containing"""	268	protein-coding gene	gene with protein product		600445				7607699	Standard	NM_020683		Approved	AD026	uc001ebf.3	P33765	OTTHUMG00000011957	ENST00000369716.4:c.375G>A	chr1.hg19:g.112033360C>T		29.0	0.0		43.0	2.0	NM_020683	A2A3P4|Q6UWU0|Q9BYZ1	Silent	SNP	ENST00000369716.4	hg19	CCDS838.1																																																																																			.	.		0.448	ADORA3-007	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000157679.1	NM_000677, NM_020683	
OLFML2B	25903	hgsc.bcm.edu	37	1	161989875	161989875	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr1:161989875C>A	ENST00000294794.3	-	2	695	c.272G>T	c.(271-273)aGg>aTg	p.R91M	OLFML2B_ENST00000367940.2_Missense_Mutation_p.R91M	NM_015441.1	NP_056256.1	Q68BL8	OLM2B_HUMAN	olfactomedin-like 2B	91					extracellular matrix organization (GO:0030198)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)	extracellular matrix binding (GO:0050840)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(11)|lung(22)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	48	all_hematologic(112;0.156)		BRCA - Breast invasive adenocarcinoma(70;0.0172)			CGCATTGATCCTCTGGCAGGC	0.592																																					p.R91M		Atlas-SNP	.											.	OLFML2B	114	.	0			c.G272T						.						80.0	81.0	80.0					1																	161989875		2203	4300	6503	SO:0001583	missense	25903	exon2			TTGATCCTCTGGC	BX648975	CCDS1236.1, CCDS72966.1	1q23.1	2008-02-05			ENSG00000162745	ENSG00000162745			24558	protein-coding gene	gene with protein product							Standard	XM_005245075		Approved	DKFZP586L151	uc001gbu.3	Q68BL8	OTTHUMG00000024047	ENST00000294794.3:c.272G>T	chr1.hg19:g.161989875C>A	ENSP00000294794:p.Arg91Met	127.0	0.0		223.0	49.0	NM_015441	B7ZA39|Q5VU96|Q6NX46|Q86X11|Q9Y3X6	Missense_Mutation	SNP	ENST00000294794.3	hg19	CCDS1236.1	.	.	.	.	.	.	.	.	.	.	C	23.2	4.391902	0.83011	.	.	ENSG00000162745	ENST00000294794;ENST00000367940	T;T	0.49720	0.77;0.77	4.5	4.5	0.54988	.	.	.	.	.	T	0.52613	0.1745	L	0.55213	1.73	0.38414	D	0.945999	D;D	0.76494	0.997;0.999	P;P	0.61201	0.781;0.885	T	0.58662	-0.7597	8	0.87932	D	0	.	15.0948	0.72226	0.0:1.0:0.0:0.0	.	91;91	F2Z3N3;Q68BL8	.;OLM2B_HUMAN	M	91	ENSP00000294794:R91M;ENSP00000356917:R91M	ENSP00000294794:R91M	R	-	2	0	OLFML2B	160256499	1.000000	0.71417	0.942000	0.38095	0.789000	0.44602	6.931000	0.75863	2.487000	0.83934	0.561000	0.74099	AGG	.	.		0.592	OLFML2B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000060552.2	NM_015441	
CEP350	9857	hgsc.bcm.edu	37	1	179972310	179972310	+	Splice_Site	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr1:179972310T>C	ENST00000367607.3	+	7	1438	c.1020T>C	c.(1018-1020)ggT>ggC	p.G340G		NM_014810.4	NP_055625.4	Q5VT06	CE350_HUMAN	centrosomal protein 350kDa	340					microtubule anchoring (GO:0034453)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)				central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(7)|lung(35)|ovary(4)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	66						ATGTATTAGGTTTCAACCCTT	0.343																																					p.G340G		Atlas-SNP	.											.	CEP350	418	.	0			c.T1020C						.						76.0	71.0	72.0					1																	179972310		2203	4300	6503	SO:0001630	splice_region_variant	9857	exon7			ATTAGGTTTCAAC	AF287356	CCDS1336.1	1q25.2	2014-02-20			ENSG00000135837	ENSG00000135837			24238	protein-coding gene	gene with protein product	"""centrosome associated protein 350"""					16314388, 15615782	Standard	NM_014810		Approved	KIAA0480, CAP350	uc001gnt.3	Q5VT06	OTTHUMG00000035269	ENST00000367607.3:c.1019-1T>C	chr1.hg19:g.179972310T>C		68.0	0.0		117.0	5.0	NM_014810	O75068|Q8TDK3|Q8WY20	Silent	SNP	ENST00000367607.3	hg19	CCDS1336.1																																																																																			.	.		0.343	CEP350-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085315.2	NM_014810	Silent
PLA2G4A	5321	hgsc.bcm.edu	37	1	186919790	186919790	+	Splice_Site	SNP	A	A	G			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr1:186919790A>G	ENST00000367466.3	+	13	1418	c.1266A>G	c.(1264-1266)gaA>gaG	p.E422E	PLA2G4A_ENST00000442353.2_Splice_Site_p.E362E	NM_024420.2	NP_077734	P47712	PA24A_HUMAN	phospholipase A2, group IVA (cytosolic, calcium-dependent)	422	PLA2c. {ECO:0000255|PROSITE- ProRule:PRU00555}.				arachidonic acid metabolic process (GO:0019369)|arachidonic acid secretion (GO:0050482)|blood coagulation (GO:0007596)|cardiolipin acyl-chain remodeling (GO:0035965)|cellular response to antibiotic (GO:0071236)|glycerophospholipid biosynthetic process (GO:0046474)|icosanoid biosynthetic process (GO:0046456)|icosanoid metabolic process (GO:0006690)|phosphatidic acid biosynthetic process (GO:0006654)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylglycerol acyl-chain remodeling (GO:0036148)|phosphatidylinositol acyl-chain remodeling (GO:0036149)|phosphatidylserine acyl-chain remodeling (GO:0036150)|phospholipid catabolic process (GO:0009395)|phospholipid metabolic process (GO:0006644)|platelet activating factor biosynthetic process (GO:0006663)|platelet activation (GO:0030168)|regulation of cell proliferation (GO:0042127)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|mitochondrial inner membrane (GO:0005743)	calcium ion binding (GO:0005509)|calcium-dependent phospholipase A2 activity (GO:0047498)|calcium-dependent phospholipid binding (GO:0005544)|lysophospholipase activity (GO:0004622)|phospholipase A2 activity (GO:0004623)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(9)|lung(22)|ovary(1)|prostate(3)|skin(4)|stomach(1)	53					Aldesleukin(DB00041)|Carbachol(DB00411)|Carbenicillin(DB00578)|Epirubicin(DB00445)|Fluocinolone Acetonide(DB00591)|Fluticasone Propionate(DB00588)|Niflumic Acid(DB04552)|Orlistat(DB01083)|Quinacrine(DB01103)|Streptokinase(DB00086)|Suramin(DB04786)	TTTTCACAGAAAATATTACCA	0.348																																					p.E422E		Atlas-SNP	.											PLA2G4A,NS,carcinoma,0,1	PLA2G4A	125	.	0			c.A1266G						.						41.0	41.0	41.0					1																	186919790		2203	4300	6503	SO:0001630	splice_region_variant	5321	exon13			CACAGAAAATATT	M72393	CCDS1372.1	1q25	2014-09-17			ENSG00000116711	ENSG00000116711	3.1.1.4, 3.1.1.5		9035	protein-coding gene	gene with protein product		600522		PLA2G4		8175726	Standard	NM_024420		Approved	cPLA2-alpha	uc001gsc.3	P47712	OTTHUMG00000035512	ENST00000367466.3:c.1265-1A>G	chr1.hg19:g.186919790A>G		38.0	0.0		73.0	3.0	NM_024420	B1AKG4|Q29R80	Silent	SNP	ENST00000367466.3	hg19	CCDS1372.1																																																																																			.	.		0.348	PLA2G4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086236.1	NM_024420	Silent
ZBTB41	360023	hgsc.bcm.edu	37	1	197169179	197169179	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr1:197169179A>G	ENST00000367405.4	-	1	493	c.425T>C	c.(424-426)tTt>tCt	p.F142S	ZBTB41_ENST00000467322.1_5'UTR|CRB1_ENST00000535699.1_5'Flank	NM_194314.2	NP_919290.2	Q5SVQ8	ZBT41_HUMAN	zinc finger and BTB domain containing 41	142	BTB. {ECO:0000255|PROSITE- ProRule:PRU00037}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|breast(3)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(11)|lung(11)|ovary(1)|skin(3)|upper_aerodigestive_tract(2)	40						TGTGTAAAGAAATTCAAGCAA	0.343																																					p.F142S		Atlas-SNP	.											.	ZBTB41	116	.	0			c.T425C						.						48.0	47.0	47.0					1																	197169179		2203	4300	6503	SO:0001583	missense	360023	exon1			TAAAGAAATTCAA		CCDS30960.1	1q31.3	2013-01-08			ENSG00000177888	ENSG00000177888		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	24819	protein-coding gene	gene with protein product							Standard	NM_194314		Approved	FRBZ1, FLJ36199, DKFZp686C06120, ZNF924	uc001gtx.1	Q5SVQ8	OTTHUMG00000036275	ENST00000367405.4:c.425T>C	chr1.hg19:g.197169179A>G	ENSP00000356375:p.Phe142Ser	42.0	0.0		83.0	4.0	NM_194314	A2RUA8|Q6MZT8|Q6ZR25|Q7Z4T1|Q8IZ99	Missense_Mutation	SNP	ENST00000367405.4	hg19	CCDS30960.1	.	.	.	.	.	.	.	.	.	.	A	19.48	3.835592	0.71373	.	.	ENSG00000177888	ENST00000367405	T	0.72394	-0.65	4.77	4.77	0.60923	BTB/POZ-like (2);BTB/POZ (1);BTB/POZ fold (2);	0.000000	0.44902	D	0.000411	D	0.82412	0.5031	M	0.75777	2.31	0.53688	D	0.99997	D	0.76494	0.999	D	0.67231	0.95	D	0.85099	0.0956	10	0.87932	D	0	.	14.2994	0.66336	1.0:0.0:0.0:0.0	.	142	Q5SVQ8	ZBT41_HUMAN	S	142	ENSP00000356375:F142S	ENSP00000356375:F142S	F	-	2	0	ZBTB41	195435802	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	8.957000	0.93082	1.755000	0.51935	0.254000	0.18369	TTT	.	.		0.343	ZBTB41-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088249.2	NM_194314	
PIK3C2B	5287	hgsc.bcm.edu	37	1	204401382	204401382	+	Missense_Mutation	SNP	G	G	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr1:204401382G>C	ENST00000367187.3	-	28	4657	c.4101C>G	c.(4099-4101)atC>atG	p.I1367M	PIK3C2B_ENST00000424712.2_Missense_Mutation_p.I1339M|RP11-739N20.2_ENST00000443515.1_RNA	NM_002646.3	NP_002637.3	O00750	P3C2B_HUMAN	phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 beta	1367	PX. {ECO:0000255|PROSITE- ProRule:PRU00147}.				phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|protein kinase B signaling (GO:0043491)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|lipid kinase activity (GO:0001727)|phosphatidylinositol binding (GO:0035091)			breast(3)|central_nervous_system(1)|cervix(2)|endometrium(4)|large_intestine(11)|lung(24)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	52	all_cancers(21;0.00347)|all_neural(3;0.0218)|Glioma(3;0.0382)|all_epithelial(62;0.171)|Breast(84;0.179)|Prostate(682;0.227)		GBM - Glioblastoma multiforme(2;2.69e-45)|all cancers(3;1.66e-30)|KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.143)|Epithelial(59;0.193)			AAACATCACTGATTCGGCCAG	0.517																																					p.I1367M		Atlas-SNP	.											.	PIK3C2B	142	.	0			c.C4101G						.						131.0	130.0	130.0					1																	204401382		2203	4300	6503	SO:0001583	missense	5287	exon28			ATCACTGATTCGG	Y11312	CCDS1446.1	1q32	2012-07-13	2012-07-13		ENSG00000133056	ENSG00000133056	2.7.1.154		8972	protein-coding gene	gene with protein product		602838	"""phosphoinositide-3-kinase, class 2, beta polypeptide"""			9144573, 9830063	Standard	NM_002646		Approved	C2-PI3K, PI3K-C2beta	uc001haw.3	O00750	OTTHUMG00000036101	ENST00000367187.3:c.4101C>G	chr1.hg19:g.204401382G>C	ENSP00000356155:p.Ile1367Met	184.0	0.0		360.0	81.0	NM_002646	O95666|Q5SW99	Missense_Mutation	SNP	ENST00000367187.3	hg19	CCDS1446.1	.	.	.	.	.	.	.	.	.	.	G	14.94	2.686187	0.47991	.	.	ENSG00000133056	ENST00000367187;ENST00000424712	T;T	0.45276	0.9;0.9	6.08	4.18	0.49190	Phox homologous domain (5);	0.104907	0.64402	D	0.000005	T	0.64182	0.2575	M	0.82823	2.61	0.40977	D	0.984742	P;B	0.52463	0.953;0.331	P;P	0.59357	0.856;0.448	T	0.71823	-0.4476	10	0.87932	D	0	.	15.3304	0.74203	0.0:0.0:0.744:0.256	.	1339;1367	F5GWN5;O00750	.;P3C2B_HUMAN	M	1367;1339	ENSP00000356155:I1367M;ENSP00000400561:I1339M	ENSP00000356155:I1367M	I	-	3	3	PIK3C2B	202668005	1.000000	0.71417	0.727000	0.30756	0.312000	0.27988	4.878000	0.63093	0.880000	0.35969	-0.181000	0.13052	ATC	.	.		0.517	PIK3C2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087965.1	NM_002646	
WDR26	80232	hgsc.bcm.edu	37	1	224621626	224621626	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr1:224621626G>A	ENST00000414423.2	-	1	375	c.182C>T	c.(181-183)cCt>cTt	p.P61L	WDR26_ENST00000295024.6_5'UTR|WDR26_ENST00000366852.2_Missense_Mutation_p.P61L	NM_001115113.2|NM_025160.6	NP_001108585.2|NP_079436.4	Q9H7D7	WDR26_HUMAN	WD repeat domain 26	61						cytoplasm (GO:0005737)|nucleus (GO:0005634)				biliary_tract(1)|breast(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(6)	18				GBM - Glioblastoma multiforme(131;0.0104)		GGGGGCGGAAGGCAGGAGCCC	0.697																																					p.P61L		Atlas-SNP	.											.	WDR26	104	.	0			c.C182T						.						15.0	22.0	20.0					1																	224621626		692	1588	2280	SO:0001583	missense	80232	exon1			GCGGAAGGCAGGA	AK024669	CCDS31037.1, CCDS31037.2	1q42.13	2013-01-09			ENSG00000162923	ENSG00000162923		"""WD repeat domain containing"""	21208	protein-coding gene	gene with protein product	"""GID complex subunit 7 homolog (S. cerevisiae)"""						Standard	NM_001115113		Approved	FLJ21016, GID7	uc001hop.4	Q9H7D7	OTTHUMG00000037636	ENST00000414423.2:c.182C>T	chr1.hg19:g.224621626G>A	ENSP00000408108:p.Pro61Leu	1.0	0.0		4.0	4.0	NM_001115113	A0MNN3|Q4G100|Q59EC4|Q5GLZ9|Q86UY4|Q9H3C2	Missense_Mutation	SNP	ENST00000414423.2	hg19	CCDS31037.2	.	.	.	.	.	.	.	.	.	.	G	21.4	4.147928	0.78001	.	.	ENSG00000162923	ENST00000414423;ENST00000366852	T;D	0.83992	0.77;-1.79	3.93	3.93	0.45458	.	.	.	.	.	T	0.74612	0.3739	N	0.08118	0	0.46521	D	0.999086	.	.	.	.	.	.	T	0.78871	-0.2033	7	0.62326	D	0.03	.	13.7722	0.63034	0.0:0.0:1.0:0.0	.	.	.	.	L	61	ENSP00000408108:P61L;ENSP00000355817:P61L	ENSP00000355817:P61L	P	-	2	0	WDR26	222688249	0.998000	0.40836	1.000000	0.80357	0.995000	0.86356	3.385000	0.52485	1.748000	0.51833	0.555000	0.69702	CCT	.	.		0.697	WDR26-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000091760.2	NM_025160	
ITPKB	3707	hgsc.bcm.edu	37	1	226923808	226923808	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr1:226923808C>T	ENST00000272117.3	-	1	1351	c.1352G>A	c.(1351-1353)gGc>gAc	p.G451D	ITPKB_ENST00000429204.1_Missense_Mutation_p.G451D|ITPKB_ENST00000366784.1_Missense_Mutation_p.G451D			P27987	IP3KB_HUMAN	inositol-trisphosphate 3-kinase B	451					cell surface receptor signaling pathway (GO:0007166)|inositol phosphate metabolic process (GO:0043647)|MAPK cascade (GO:0000165)|positive regulation of alpha-beta T cell differentiation (GO:0046638)|positive regulation of Ras protein signal transduction (GO:0046579)|positive thymic T cell selection (GO:0045059)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	ATP binding (GO:0005524)|inositol-1,4,5-trisphosphate 3-kinase activity (GO:0008440)			central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(4)|lung(13)|ovary(4)|prostate(1)|skin(1)	30		Prostate(94;0.0773)				CCCAAGCAAGCCCAGCGTTGG	0.692																																					p.G451D	Colon(84;110 1851 5306 33547)	Atlas-SNP	.											.	ITPKB	158	.	0			c.G1352A						.						23.0	28.0	26.0					1																	226923808		2190	4295	6485	SO:0001583	missense	3707	exon2			AGCAAGCCCAGCG	AJ242780	CCDS1555.1	1q42.12	2011-04-28	2011-04-28		ENSG00000143772	ENSG00000143772	2.7.1.127		6179	protein-coding gene	gene with protein product		147522	"""inositol 1,4,5-trisphosphate 3-kinase B"""			1654894, 1330886	Standard	NM_002221		Approved	IP3KB, IP3-3KB	uc010pvo.2	P27987	OTTHUMG00000037582	ENST00000272117.3:c.1352G>A	chr1.hg19:g.226923808C>T	ENSP00000272117:p.Gly451Asp	55.0	0.0		84.0	4.0	NM_002221	Q5VWL9|Q5VWM0|Q96BZ2|Q96JS1|Q9UH47	Missense_Mutation	SNP	ENST00000272117.3	hg19	CCDS1555.1	.	.	.	.	.	.	.	.	.	.	C	20.9	4.072740	0.76415	.	.	ENSG00000143772	ENST00000272117;ENST00000429204;ENST00000366784	T;T;T	0.47177	0.96;0.96;0.85	4.91	4.91	0.64330	.	0.357050	0.24415	N	0.038733	T	0.50701	0.1631	L	0.27053	0.805	0.21933	N	0.999462	D	0.69078	0.997	D	0.63597	0.916	T	0.40079	-0.9582	10	0.14656	T	0.56	-23.278	15.4562	0.75314	0.0:1.0:0.0:0.0	.	451	P27987	IP3KB_HUMAN	D	451	ENSP00000272117:G451D;ENSP00000411152:G451D;ENSP00000355748:G451D	ENSP00000272117:G451D	G	-	2	0	ITPKB	224990431	0.000000	0.05858	0.639000	0.29394	0.820000	0.46376	0.640000	0.24705	2.707000	0.92482	0.484000	0.47621	GGC	.	.		0.692	ITPKB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091632.1	NM_002221	
APOB	338	hgsc.bcm.edu	37	2	21250701	21250701	+	Splice_Site	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr2:21250701T>C	ENST00000233242.1	-	14	2193	c.2066A>G	c.(2065-2067)gAg>gGg	p.E689G	APOB_ENST00000399256.4_Splice_Site_p.E689G	NM_000384.2	NP_000375	P04114	APOB_HUMAN	apolipoprotein B	689					artery morphogenesis (GO:0048844)|blood coagulation (GO:0007596)|cellular response to prostaglandin stimulus (GO:0071379)|cellular response to tumor necrosis factor (GO:0071356)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle remodeling (GO:0034374)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol biosynthetic process (GO:0045540)|response to carbohydrate (GO:0009743)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to virus (GO:0009615)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|triglyceride catabolic process (GO:0019433)|triglyceride mobilization (GO:0006642)|very-low-density lipoprotein particle assembly (GO:0034379)	actin cytoskeleton (GO:0015629)|chylomicron (GO:0042627)|chylomicron remnant (GO:0034360)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome lumen (GO:0031904)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate-density lipoprotein particle (GO:0034363)|intracellular membrane-bounded organelle (GO:0043231)|low-density lipoprotein particle (GO:0034362)|mature chylomicron (GO:0034359)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|lipase binding (GO:0035473)|low-density lipoprotein particle receptor binding (GO:0050750)|phospholipid binding (GO:0005543)			NS(5)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(19)|kidney(10)|large_intestine(63)|liver(5)|lung(125)|ovary(16)|pancreas(1)|prostate(5)|skin(31)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(6)	305	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CACACTTACCTCGATGAGGTC	0.438																																					p.E689G		Atlas-SNP	.											.	APOB	761	.	0			c.A2066G						.						76.0	82.0	80.0					2																	21250701		2202	4300	6502	SO:0001630	splice_region_variant	338	exon14			CTTACCTCGATGA	M14162	CCDS1703.1	2p24-p23	2013-05-29	2013-05-29		ENSG00000084674	ENSG00000084674		"""Apolipoproteins"""	603	protein-coding gene	gene with protein product		107730	"""apolipoprotein B (including Ag(x) antigen)"""				Standard	NM_000384		Approved		uc002red.3	P04114	OTTHUMG00000090785	ENST00000233242.1:c.2067+1A>G	chr2.hg19:g.21250701T>C		92.0	0.0		98.0	4.0	NM_000384	O00502|P78479|P78480|P78481|Q13779|Q13785|Q13786|Q13787|Q13788|Q4ZG63|Q53QC8|Q7Z600|Q9UMN0	Missense_Mutation	SNP	ENST00000233242.1	hg19	CCDS1703.1	.	.	.	.	.	.	.	.	.	.	T	23.6	4.439747	0.83885	.	.	ENSG00000084674	ENST00000233242;ENST00000535079;ENST00000399256	T;T	0.39406	1.08;1.08	5.73	5.73	0.89815	Vitellinogen, open beta-sheet, subdomain 1 (1);Lipid transport protein, beta-sheet shell (1);Vitellinogen, open beta-sheet (1);	0.000000	0.85682	D	0.000000	T	0.68357	0.2992	M	0.83953	2.67	0.58432	D	0.999997	D	0.89917	1.0	D	0.97110	1.0	T	0.73487	-0.3967	10	0.87932	D	0	.	16.3259	0.82979	0.0:0.0:0.0:1.0	.	689	P04114	APOB_HUMAN	G	689	ENSP00000233242:E689G;ENSP00000382200:E689G	ENSP00000233242:E689G	E	-	2	0	APOB	21104206	1.000000	0.71417	0.999000	0.59377	0.590000	0.36582	6.489000	0.73641	2.319000	0.78375	0.533000	0.62120	GAG	.	.		0.438	APOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207571.1		Missense_Mutation
PPM1G	5496	hgsc.bcm.edu	37	2	27608639	27608639	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr2:27608639T>A	ENST00000344034.4	-	4	648	c.384A>T	c.(382-384)aaA>aaT	p.K128N	PPM1G_ENST00000350803.4_Missense_Mutation_p.K128N	NM_177983.2	NP_817092.1	O15355	PPM1G_HUMAN	protein phosphatase, Mg2+/Mn2+ dependent, 1G	128					cell cycle arrest (GO:0007050)|peptidyl-threonine dephosphorylation (GO:0035970)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|protein serine/threonine phosphatase activity (GO:0004722)			endometrium(2)|kidney(1)|large_intestine(2)|lung(9)|ovary(1)|prostate(2)|urinary_tract(2)	19	Acute lymphoblastic leukemia(172;0.155)					CTACTTTTTCTTTTTCATCTT	0.393																																					p.K128N		Atlas-SNP	.											.	PPM1G	42	.	0			c.A384T						.						160.0	155.0	157.0					2																	27608639		2203	4300	6503	SO:0001583	missense	5496	exon4			TTTTTCTTTTTCA	Y13936	CCDS1752.1	2p23.3	2012-04-17	2010-03-05		ENSG00000115241	ENSG00000115241	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"""	9278	protein-coding gene	gene with protein product	"""PP2C, gamma"", ""protein phosphatase 2C, gamma isoform"""	605119	"""protein phosphatase 1G (formerly 2C), magnesium-dependent, gamma isoform"""			9276438	Standard	NM_177983		Approved	PP2CG, PP2Cgamma	uc002rkl.4	O15355	OTTHUMG00000097788	ENST00000344034.4:c.384A>T	chr2.hg19:g.27608639T>A	ENSP00000342778:p.Lys128Asn	149.0	0.0		166.0	26.0	NM_177983		Missense_Mutation	SNP	ENST00000344034.4	hg19	CCDS1752.1	.	.	.	.	.	.	.	.	.	.	T	13.03	2.115052	0.37339	.	.	ENSG00000115241	ENST00000344034;ENST00000350803;ENST00000544412	T;T	0.48201	0.82;0.82	5.75	3.4	0.38934	Protein phosphatase 2C-like (4);	0.252181	0.41097	D	0.000947	T	0.34774	0.0909	L	0.52364	1.645	0.42093	D	0.991308	P	0.35011	0.48	B	0.28638	0.092	T	0.10382	-1.0632	10	0.39692	T	0.17	-13.5374	6.391	0.21587	0.0:0.3351:0.0:0.6649	.	128	O15355	PPM1G_HUMAN	N	128;128;111	ENSP00000342778:K128N;ENSP00000264714:K128N	ENSP00000342778:K128N	K	-	3	2	PPM1G	27462143	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	1.406000	0.34646	0.448000	0.26722	-1.139000	0.01908	AAA	.	.		0.393	PPM1G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215032.1	NM_002707	
PPM1G	5496	hgsc.bcm.edu	37	2	27608641	27608641	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr2:27608641T>C	ENST00000344034.4	-	4	646	c.382A>G	c.(382-384)Aaa>Gaa	p.K128E	PPM1G_ENST00000350803.4_Missense_Mutation_p.K128E	NM_177983.2	NP_817092.1	O15355	PPM1G_HUMAN	protein phosphatase, Mg2+/Mn2+ dependent, 1G	128					cell cycle arrest (GO:0007050)|peptidyl-threonine dephosphorylation (GO:0035970)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|protein serine/threonine phosphatase activity (GO:0004722)			endometrium(2)|kidney(1)|large_intestine(2)|lung(9)|ovary(1)|prostate(2)|urinary_tract(2)	19	Acute lymphoblastic leukemia(172;0.155)					ACTTTTTCTTTTTCATCTTCA	0.398																																					p.K128E		Atlas-SNP	.											.	PPM1G	42	.	0			c.A382G						.						160.0	155.0	156.0					2																	27608641		2203	4300	6503	SO:0001583	missense	5496	exon4			TTTCTTTTTCATC	Y13936	CCDS1752.1	2p23.3	2012-04-17	2010-03-05		ENSG00000115241	ENSG00000115241	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"""	9278	protein-coding gene	gene with protein product	"""PP2C, gamma"", ""protein phosphatase 2C, gamma isoform"""	605119	"""protein phosphatase 1G (formerly 2C), magnesium-dependent, gamma isoform"""			9276438	Standard	NM_177983		Approved	PP2CG, PP2Cgamma	uc002rkl.4	O15355	OTTHUMG00000097788	ENST00000344034.4:c.382A>G	chr2.hg19:g.27608641T>C	ENSP00000342778:p.Lys128Glu	152.0	0.0		168.0	25.0	NM_177983		Missense_Mutation	SNP	ENST00000344034.4	hg19	CCDS1752.1	.	.	.	.	.	.	.	.	.	.	T	16.04	3.009702	0.54361	.	.	ENSG00000115241	ENST00000344034;ENST00000350803;ENST00000544412	T;T	0.46063	0.88;0.88	5.75	5.75	0.90469	Protein phosphatase 2C-like (4);	0.252181	0.41097	D	0.000947	T	0.38427	0.1040	L	0.52364	1.645	0.38452	D	0.946972	B	0.30326	0.276	B	0.27796	0.083	T	0.30534	-0.9975	10	0.33141	T	0.24	-13.5374	14.8904	0.70604	0.0:0.0:0.0:1.0	.	128	O15355	PPM1G_HUMAN	E	128;128;111	ENSP00000342778:K128E;ENSP00000264714:K128E	ENSP00000342778:K128E	K	-	1	0	PPM1G	27462145	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	2.167000	0.42415	2.201000	0.70794	0.533000	0.62120	AAA	.	.		0.398	PPM1G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215032.1	NM_002707	
LHCGR	3973	hgsc.bcm.edu	37	2	48915345	48915345	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr2:48915345T>C	ENST00000294954.7	-	11	1612	c.1591A>G	c.(1591-1593)Atc>Gtc	p.I531V	LHCGR_ENST00000344775.3_Missense_Mutation_p.I469V|LHCGR_ENST00000403273.1_3'UTR|LHCGR_ENST00000401907.1_Intron|STON1-GTF2A1L_ENST00000402114.2_Intron|LHCGR_ENST00000405626.1_Missense_Mutation_p.I504V	NM_000233.3	NP_000224.2	P22888	LSHR_HUMAN	luteinizing hormone/choriogonadotropin receptor	531					activation of adenylate cyclase activity (GO:0007190)|cellular response to gonadotropin stimulus (GO:0071371)|cognition (GO:0050890)|development of secondary male sexual characteristics (GO:0046544)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|male genitalia development (GO:0030539)|male gonad development (GO:0008584)|ovarian follicle development (GO:0001541)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of inositol trisphosphate biosynthetic process (GO:0032962)|regulation of steroid hormone biosynthetic process (GO:0090030)|seminiferous tubule development (GO:0072520)|spermatogenesis (GO:0007283)|uterus development (GO:0060065)	endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	choriogonadotropin hormone binding (GO:0038106)|choriogonadotropin hormone receptor activity (GO:0035472)|luteinizing hormone receptor activity (GO:0004964)			NS(1)|breast(6)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(5)|liver(1)|lung(23)|ovary(3)|pancreas(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	56		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.176)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)		Buserelin(DB06719)|Cetrorelix(DB00050)|Choriogonadotropin alfa(DB00097)|Goserelin(DB00014)|Lutropin alfa(DB00044)|Menotropins(DB00032)	AGAATCAGGATGGTTAATATA	0.393																																					p.I531V		Atlas-SNP	.											.	LHCGR	154	.	0			c.A1591G						.						111.0	113.0	112.0					2																	48915345		2203	4300	6503	SO:0001583	missense	3973	exon11			TCAGGATGGTTAA		CCDS1842.1	2p21	2012-08-10			ENSG00000138039	ENSG00000138039		"""GPCR / Class A : Gonadotropin and TSH receptors"""	6585	protein-coding gene	gene with protein product		152790	"""hypergonadotropic hypogonadism"""	HHG			Standard	NM_000233		Approved	LHR, LCGR, LGR2, ULG5	uc002rwu.4	P22888	OTTHUMG00000129257	ENST00000294954.7:c.1591A>G	chr2.hg19:g.48915345T>C	ENSP00000294954:p.Ile531Val	113.0	0.0		87.0	4.0	NM_000233	Q14751|Q15996|Q9UEW9	Missense_Mutation	SNP	ENST00000294954.7	hg19	CCDS1842.1	.	.	.	.	.	.	.	.	.	.	T	8.373	0.835702	0.16820	.	.	ENSG00000138039	ENST00000344775;ENST00000294954;ENST00000405626	T;T;T	0.71934	-0.61;-0.61;-0.61	5.68	4.46	0.54185	GPCR, rhodopsin-like superfamily (1);	0.251853	0.42682	D	0.000665	T	0.61311	0.2337	N	0.11201	0.11	0.45161	D	0.998173	P	0.50272	0.933	P	0.53912	0.737	T	0.60214	-0.7307	9	.	.	.	.	11.7903	0.52065	0.0:0.0:0.1466:0.8534	.	531	P22888	LSHR_HUMAN	V	469;531;504	ENSP00000344301:I469V;ENSP00000294954:I531V;ENSP00000386033:I504V	.	I	-	1	0	LHCGR	48768849	0.993000	0.37304	1.000000	0.80357	0.980000	0.70556	0.852000	0.27764	2.176000	0.68965	0.477000	0.44152	ATC	.	.		0.393	LHCGR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251364.4	NM_000233.3	
EFEMP1	2202	hgsc.bcm.edu	37	2	56145028	56145028	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr2:56145028C>T	ENST00000394555.2	-	4	724	c.289G>A	c.(289-291)Gca>Aca	p.A97T	EFEMP1_ENST00000394554.1_Missense_Mutation_p.A97T|EFEMP1_ENST00000424836.2_Missense_Mutation_p.A39T|EFEMP1_ENST00000355426.3_Missense_Mutation_p.A97T	NM_001039348.2|NM_001039349.2	NP_001034437.1|NP_001034438.1	Q12805	FBLN3_HUMAN	EGF containing fibulin-like extracellular matrix protein 1	97					epidermal growth factor receptor signaling pathway (GO:0007173)|extracellular matrix organization (GO:0030198)|negative regulation of chondrocyte differentiation (GO:0032331)|peptidyl-tyrosine phosphorylation (GO:0018108)|regulation of transcription, DNA-templated (GO:0006355)|visual perception (GO:0007601)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|epidermal growth factor receptor binding (GO:0005154)|epidermal growth factor-activated receptor activity (GO:0005006)			NS(1)|breast(2)|endometrium(4)|large_intestine(6)|lung(5)|ovary(5)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	28			LUSC - Lung squamous cell carcinoma(58;0.127)|Lung(47;0.132)			CCGGTGGTTGCCCCTGAGGTT	0.557																																					p.A97T	GBM(92;934 1319 7714 28760 40110)	Atlas-SNP	.											.	EFEMP1	81	.	0			c.G289A						.						97.0	97.0	97.0					2																	56145028		2203	4300	6503	SO:0001583	missense	2202	exon4			TGGTTGCCCCTGA	U03877	CCDS1857.1	2p16	2013-01-08	2011-01-25		ENSG00000115380	ENSG00000115380		"""Fibulins"""	3218	protein-coding gene	gene with protein product	"""fibulin 3"""	601548	"""fibrillin-like"", ""EGF-containing fibulin-like extracellular matrix protein 1"""	DHRD, FBNL		8812496, 7799918	Standard	NM_001039348		Approved	S1-5, FBLN3, MTLV	uc002rzi.3	Q12805	OTTHUMG00000129343	ENST00000394555.2:c.289G>A	chr2.hg19:g.56145028C>T	ENSP00000378058:p.Ala97Thr	217.0	0.0		199.0	78.0	NM_001039349	A8K3I4|B4DW75|D6W5D2|Q541U7	Missense_Mutation	SNP	ENST00000394555.2	hg19	CCDS1857.1	.	.	.	.	.	.	.	.	.	.	C	11.97	1.797549	0.31777	.	.	ENSG00000115380	ENST00000394555;ENST00000394554;ENST00000424836;ENST00000355426;ENST00000438672;ENST00000439193;ENST00000440439	D;D;T;D;T;T;T	0.83591	-1.74;-1.74;-1.28;-1.74;-1.23;-1.25;-1.12	5.34	-0.879	0.10613	.	0.646499	0.13744	N	0.365742	T	0.64450	0.2599	N	0.08118	0	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.06405	0.002;0.002	T	0.53816	-0.8385	10	0.48119	T	0.1	.	9.9113	0.41408	0.0:0.5395:0.0:0.4605	.	39;97	B4DW75;Q12805	.;FBLN3_HUMAN	T	97;97;39;97;97;97;97	ENSP00000378058:A97T;ENSP00000378057:A97T;ENSP00000399145:A39T;ENSP00000347596:A97T;ENSP00000392055:A97T;ENSP00000408195:A97T;ENSP00000398345:A97T	ENSP00000347596:A97T	A	-	1	0	EFEMP1	55998532	0.000000	0.05858	0.002000	0.10522	0.802000	0.45316	-0.396000	0.07278	-0.104000	0.12154	0.650000	0.86243	GCA	.	.		0.557	EFEMP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251491.2		
DNAH6	1768	hgsc.bcm.edu	37	2	84806671	84806671	+	Silent	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr2:84806671T>C	ENST00000237449.6	+	13	2105	c.2097T>C	c.(2095-2097)ccT>ccC	p.P699P	DNAH6_ENST00000398278.2_Silent_p.P699P|DNAH6_ENST00000389394.3_Silent_p.P699P			Q9C0G6	DYH6_HUMAN	dynein, axonemal, heavy chain 6	699	Stem. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(2)|breast(9)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(3)|lung(14)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	57						TTATGCTTCCTCGTCAAAGCA	0.328																																					p.P699P		Atlas-SNP	.											.	DNAH6	194	.	0			c.T2097C						.						108.0	104.0	106.0					2																	84806671		2203	4300	6503	SO:0001819	synonymous_variant	1768	exon14			GCTTCCTCGTCAA	U61736	CCDS46348.1	2p11.2	2011-05-24	2006-09-04		ENSG00000115423	ENSG00000115423		"""Axonemal dyneins"""	2951	protein-coding gene	gene with protein product		603336	"""dynein, axonemal, heavy polypeptide 6"", ""dynein heavy chain-like 1"""	DNHL1		8812413	Standard	NM_001370		Approved	Dnahc6, HL-2, FLJ37357	uc010fgb.3	Q9C0G6	OTTHUMG00000128957	ENST00000237449.6:c.2097T>C	chr2.hg19:g.84806671T>C		81.0	0.0		90.0	4.0	NM_001370	A0PJN9|B5MEE0|B7ZL99|O95493|Q53QZ1|Q53TE5|Q8N1W6|Q92861|Q96BL6|Q9H030|Q9H5E1	Silent	SNP	ENST00000237449.6	hg19	CCDS46348.1																																																																																			.	.		0.328	DNAH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328537.2	NM_001370	
CLASP1	23332	hgsc.bcm.edu	37	2	122159109	122159109	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr2:122159109A>G	ENST00000263710.4	-	28	3265	c.2876T>C	c.(2875-2877)gTt>gCt	p.V959A	CLASP1_ENST00000545861.1_Missense_Mutation_p.V705A|CLASP1_ENST00000397587.3_Missense_Mutation_p.V938A|CLASP1_ENST00000541859.1_Missense_Mutation_p.V715A|CLASP1_ENST00000455322.2_Missense_Mutation_p.V954A|CLASP1_ENST00000409078.3_Missense_Mutation_p.V931A|CLASP1_ENST00000541377.1_Missense_Mutation_p.V937A	NM_015282.2	NP_056097.1	Q7Z460	CLAP1_HUMAN	cytoplasmic linker associated protein 1	959					axon guidance (GO:0007411)|cell division (GO:0051301)|establishment of spindle orientation (GO:0051294)|establishment or maintenance of cell polarity (GO:0007163)|exit from mitosis (GO:0010458)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule anchoring (GO:0034453)|microtubule bundle formation (GO:0001578)|microtubule cytoskeleton organization (GO:0000226)|microtubule nucleation (GO:0007020)|microtubule organizing center organization (GO:0031023)|mitotic cell cycle (GO:0000278)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of microtubule polymerization or depolymerization (GO:0031111)	cell cortex (GO:0005938)|centrosomal corona (GO:0031592)|centrosome (GO:0005813)|cortical microtubule cytoskeleton (GO:0030981)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|kinetochore (GO:0000776)|kinetochore microtubule (GO:0005828)|membrane (GO:0016020)|spindle microtubule (GO:0005876)	kinetochore binding (GO:0043515)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)			NS(2)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(8)|kidney(4)|large_intestine(8)|lung(19)|ovary(1)|prostate(1)	47	Renal(3;0.0496)					AGCCTTTTGAACTTTTGCTTG	0.348																																					p.V959A		Atlas-SNP	.											.	CLASP1	135	.	0			c.T2876C						.						248.0	244.0	245.0					2																	122159109		1853	4095	5948	SO:0001583	missense	23332	exon27			TTTTGAACTTTTG	AB014522		2q14.2-q14.3	2013-01-18			ENSG00000074054	ENSG00000074054			17088	protein-coding gene	gene with protein product	"""multiple asters 1"""	605852				9734811, 10899121, 16914514	Standard	NM_015282		Approved	KIAA0622, MAST1	uc002tnc.3	Q7Z460	OTTHUMG00000153331	ENST00000263710.4:c.2876T>C	chr2.hg19:g.122159109A>G	ENSP00000263710:p.Val959Ala	95.0	0.0		122.0	5.0	NM_015282	B7ZLX3|O75118|Q2KHQ9|Q5H9P0|Q8N5B8|Q9BQT5	Missense_Mutation	SNP	ENST00000263710.4	hg19		.	.	.	.	.	.	.	.	.	.	A	28.2	4.900940	0.92035	.	.	ENSG00000074054	ENST00000263710;ENST00000455322;ENST00000397587;ENST00000541377;ENST00000541859;ENST00000409078;ENST00000545861	T;T;T;T;T;T;T	0.54866	0.55;0.55;0.55;0.55;0.55;0.55;0.55	5.58	5.58	0.84498	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.68641	0.3023	L	0.55103	1.725	0.58432	D	0.999998	D;D;D	0.67145	0.994;0.992;0.996	D;D;D	0.75484	0.97;0.945;0.986	T	0.71527	-0.4566	10	0.87932	D	0	-1.8452	16.0303	0.80572	1.0:0.0:0.0:0.0	.	931;938;959	E7EUA5;F5GWS0;Q7Z460	.;.;CLAP1_HUMAN	A	959;954;938;937;715;931;705	ENSP00000263710:V959A;ENSP00000389372:V954A;ENSP00000380717:V938A;ENSP00000441625:V937A;ENSP00000441770:V715A;ENSP00000386442:V931A;ENSP00000438620:V705A	ENSP00000263710:V959A	V	-	2	0	CLASP1	121875579	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	8.859000	0.92264	2.243000	0.73865	0.482000	0.46254	GTT	.	.		0.348	CLASP1-201	KNOWN	basic	protein_coding	protein_coding		NM_015282	
UGGT1	56886	hgsc.bcm.edu	37	2	128930206	128930206	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr2:128930206A>G	ENST00000259253.6	+	29	3211	c.3164A>G	c.(3163-3165)aAg>aGg	p.K1055R	UGGT1_ENST00000375990.3_Missense_Mutation_p.K1031R	NM_020120.3	NP_064505.1	Q9NYU2	UGGG1_HUMAN	UDP-glucose glycoprotein glucosyltransferase 1	1055					'de novo' posttranslational protein folding (GO:0051084)|cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular vesicular exosome (GO:0070062)	UDP-glucose:glycoprotein glucosyltransferase activity (GO:0003980)|unfolded protein binding (GO:0051082)			NS(1)|breast(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(14)|lung(20)|ovary(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	63						AGTTTTGCTAAGGGTCCAATC	0.383																																					p.K1055R		Atlas-SNP	.											.	UGGT1	126	.	0			c.A3164G						.						140.0	134.0	136.0					2																	128930206		2203	4300	6503	SO:0001583	missense	56886	exon29			TTGCTAAGGGTCC	AF227905	CCDS2154.1	2q14.3	2009-07-23	2009-07-23	2009-07-23	ENSG00000136731	ENSG00000136731			15663	protein-coding gene	gene with protein product		605897	"""UDP-glucose ceramide glucosyltransferase-like 1"""	UGCGL1		10694380	Standard	NM_020120		Approved	HUGT1	uc002tps.3	Q9NYU2	OTTHUMG00000131570	ENST00000259253.6:c.3164A>G	chr2.hg19:g.128930206A>G	ENSP00000259253:p.Lys1055Arg	83.0	0.0		97.0	4.0	NM_020120	Q53QP2|Q53SL3|Q8IW30|Q9H8I4	Missense_Mutation	SNP	ENST00000259253.6	hg19	CCDS2154.1	.	.	.	.	.	.	.	.	.	.	A	13.33	2.204200	0.38905	.	.	ENSG00000136731	ENST00000375990;ENST00000259253	T;T	0.30714	1.52;1.52	5.81	3.26	0.37387	.	0.337771	0.31246	N	0.007983	T	0.16128	0.0388	N	0.05230	-0.09	0.29449	N	0.858624	B	0.20988	0.05	B	0.35770	0.21	T	0.28554	-1.0040	9	.	.	.	.	7.1817	0.25776	0.5488:0.3374:0.0:0.1138	.	1055	Q9NYU2	UGGG1_HUMAN	R	1031;1055	ENSP00000365158:K1031R;ENSP00000259253:K1055R	.	K	+	2	0	UGGT1	128646676	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.994000	0.63901	0.999000	0.39023	0.482000	0.46254	AAG	.	.		0.383	UGGT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254435.2	NM_020120	
LRP1B	53353	hgsc.bcm.edu	37	2	141092035	141092035	+	Silent	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr2:141092035T>C	ENST00000389484.3	-	79	13181	c.12210A>G	c.(12208-12210)ttA>ttG	p.L4070L		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	4070					protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)			NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		TGGGTCTCTGTAAGTTCTTTT	0.378										TSP Lung(27;0.18)																											p.L4070L	Colon(99;50 2074 2507 20106)	Atlas-SNP	.											.	LRP1B	1315	.	0			c.A12210G						.						164.0	152.0	156.0					2																	141092035		2203	4300	6503	SO:0001819	synonymous_variant	53353	exon79			TCTCTGTAAGTTC	AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.12210A>G	chr2.hg19:g.141092035T>C		288.0	0.0		252.0	94.0	NM_018557	Q8WY29|Q8WY30|Q8WY31	Silent	SNP	ENST00000389484.3	hg19	CCDS2182.1	.	.	.	.	.	.	.	.	.	.	T	9.331	1.060628	0.19987	.	.	ENSG00000168702	ENST00000437977	.	.	.	6.08	-1.42	0.08913	.	.	.	.	.	T	0.51449	0.1675	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.43458	-0.9390	4	.	.	.	.	6.9361	0.24466	0.0:0.3497:0.208:0.4423	.	.	.	.	C	302	.	.	Y	-	2	0	LRP1B	140808505	1.000000	0.71417	0.985000	0.45067	0.938000	0.57974	0.736000	0.26130	-0.136000	0.11475	0.482000	0.46254	TAC	.	.		0.378	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254736.2	NM_018557	
TTN	7273	hgsc.bcm.edu	37	2	179628973	179628973	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr2:179628973T>C	ENST00000591111.1	-	43	10269	c.10045A>G	c.(10045-10047)Acc>Gcc	p.T3349A	TTN-AS1_ENST00000578746.1_RNA|TTN_ENST00000360870.5_Missense_Mutation_p.T3349A|TTN_ENST00000589042.1_Missense_Mutation_p.T3349A|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000610005.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.T3303A|TTN_ENST00000342992.6_Missense_Mutation_p.T3349A|TTN_ENST00000359218.5_Missense_Mutation_p.T3303A|TTN_ENST00000460472.2_Missense_Mutation_p.T3303A			Q8WZ42	TITIN_HUMAN	titin	13665	Ig-like 20.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TGAAGCGGGGTGATGATGGCA	0.458																																					p.T3349A		Atlas-SNP	.											.	TTN	18412	.	0			c.A10045G						.						86.0	83.0	84.0					2																	179628973		2203	4300	6503	SO:0001583	missense	7273	exon43			GCGGGGTGATGAT	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.10045A>G	chr2.hg19:g.179628973T>C	ENSP00000465570:p.Thr3349Ala	123.0	0.0		93.0	6.0	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	hg19		.	.	.	.	.	.	.	.	.	.	T	14.91	2.675966	0.47886	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127;ENST00000360870	T;T;T;T;T	0.67698	-0.28;-0.28;-0.28;-0.28;-0.28	5.69	0.208	0.15221	Immunoglobulin I-set (1);Immunoglobulin-like (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.50188	0.1601	L	0.34521	1.04	0.20703	N	0.999866	B;B;B;B;B	0.06786	0.0;0.0;0.0;0.0;0.001	B;B;B;B;B	0.09377	0.001;0.001;0.001;0.001;0.004	T	0.44711	-0.9310	9	0.87932	D	0	.	4.3501	0.11151	0.2248:0.1916:0.0:0.5837	.	3303;3303;3303;3349;3349	D3DPF9;E7EQE6;E7ET18;Q8WZ42;Q8WZ42-6	.;.;.;TITIN_HUMAN;.	A	3349;3303;3303;3303;3303;3349	ENSP00000343764:T3349A;ENSP00000434586:T3303A;ENSP00000340554:T3303A;ENSP00000352154:T3303A;ENSP00000354117:T3349A	ENSP00000340554:T3303A	T	-	1	0	TTN	179337218	0.997000	0.39634	0.748000	0.31131	0.966000	0.64601	0.563000	0.23547	0.079000	0.16929	0.533000	0.62120	ACC	.	.		0.458	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
TMEFF2	23671	hgsc.bcm.edu	37	2	193056689	193056689	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr2:193056689A>G	ENST00000272771.5	-	2	1383	c.199T>C	c.(199-201)Ttc>Ctc	p.F67L	TMEFF2_ENST00000409056.3_Missense_Mutation_p.F67L|TMEFF2_ENST00000392314.1_Missense_Mutation_p.F67L	NM_016192.2	NP_057276.2	Q9UIK5	TEFF2_HUMAN	transmembrane protein with EGF-like and two follistatin-like domains 2	67						extracellular region (GO:0005576)|integral component of membrane (GO:0016021)				breast(2)|cervix(1)|kidney(2)|large_intestine(4)|liver(1)|lung(12)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	27			OV - Ovarian serous cystadenocarcinoma(117;0.0835)			TCACAGAGGAAGAGATCATTT	0.348																																					p.F67L	Pancreas(50;1277 1381 28487 47072)	Atlas-SNP	.											.	TMEFF2	54	.	0			c.T199C						.						91.0	87.0	89.0					2																	193056689		2203	4300	6503	SO:0001583	missense	23671	exon2			AGAGGAAGAGATC	AB017269	CCDS2314.1	2q32.3	2010-05-04			ENSG00000144339	ENSG00000144339			11867	protein-coding gene	gene with protein product	"""transmembrane protein TENB2"", ""tomoregulin"", ""cancer/testis antigen family 120, member 2"""	605734				10903839	Standard	NM_016192		Approved	TENB2, HPP1, TR, TPEF, CT120.2	uc002utc.3	Q9UIK5	OTTHUMG00000132723	ENST00000272771.5:c.199T>C	chr2.hg19:g.193056689A>G	ENSP00000272771:p.Phe67Leu	86.0	0.0		91.0	4.0	NM_016192	Q2FA44|Q4ZFW4|Q53H90|Q53RE1|Q8N2R5|Q9NR15|Q9NSS5|Q9P2Y9|Q9UK65	Missense_Mutation	SNP	ENST00000272771.5	hg19	CCDS2314.1	.	.	.	.	.	.	.	.	.	.	A	21.4	4.137932	0.77775	.	.	ENSG00000144339	ENST00000392314;ENST00000272771;ENST00000409056	T;T;T	0.67865	0.34;0.33;-0.29	6.03	6.03	0.97812	.	0.000000	0.85682	D	0.000000	T	0.76198	0.3954	L	0.54323	1.7	0.58432	D	0.999999	D;P	0.71674	0.998;0.863	D;P	0.63283	0.913;0.53	T	0.72972	-0.4129	10	0.27785	T	0.31	-15.4577	16.5655	0.84588	1.0:0.0:0.0:0.0	.	67;67	Q9UIK5-3;Q9UIK5	.;TEFF2_HUMAN	L	67	ENSP00000376128:F67L;ENSP00000272771:F67L;ENSP00000386871:F67L	ENSP00000272771:F67L	F	-	1	0	TMEFF2	192764934	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.801000	0.75170	2.302000	0.77476	0.533000	0.62120	TTC	.	.		0.348	TMEFF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256065.2	NM_016192	
DNAH7	56171	hgsc.bcm.edu	37	2	196750895	196750895	+	Silent	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr2:196750895T>C	ENST00000312428.6	-	34	5608	c.5508A>G	c.(5506-5508)agA>agG	p.R1836R		NM_018897.2	NP_061720.2	Q8WXX0	DYH7_HUMAN	dynein, axonemal, heavy chain 7	1836					cilium movement (GO:0003341)|cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)	axonemal dynein complex (GO:0005858)|cilium (GO:0005929)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|microtubule motor activity (GO:0003777)			NS(4)|breast(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(28)|liver(3)|lung(100)|ovary(4)|prostate(5)|skin(26)|upper_aerodigestive_tract(2)|urinary_tract(3)	205						CTCGATCATTTCTCTCCTTTA	0.398																																					p.R1836R		Atlas-SNP	.											.	DNAH7	512	.	0			c.A5508G						.						154.0	154.0	154.0					2																	196750895		1878	4111	5989	SO:0001819	synonymous_variant	56171	exon34			ATCATTTCTCTCC	AF327442	CCDS42794.1	2q33.1	2013-01-10	2006-09-04		ENSG00000118997	ENSG00000118997		"""Axonemal dyneins"", ""EF-hand domain containing"""	18661	protein-coding gene	gene with protein product		610061	"""dynein, axonemal, heavy polypeptide 7"""			9373155, 11877439	Standard	NM_018897		Approved	KIAA0944	uc002utj.4	Q8WXX0	OTTHUMG00000154438	ENST00000312428.6:c.5508A>G	chr2.hg19:g.196750895T>C		58.0	0.0		100.0	4.0	NM_018897	B8ZZX8|O00433|O95492|Q4G152|Q53QX7|Q53S64|Q53T02|Q68CY5|Q8N1Z2|Q9UMS3|Q9Y2F3	Silent	SNP	ENST00000312428.6	hg19	CCDS42794.1																																																																																			.	.		0.398	DNAH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335202.3	NM_018897	
STK17B	9262	hgsc.bcm.edu	37	2	197021354	197021354	+	Silent	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr2:197021354T>C	ENST00000263955.4	-	3	430	c.144A>G	c.(142-144)agA>agG	p.R48R	RP11-347P5.1_ENST00000606818.1_RNA|STK17B_ENST00000409228.1_Silent_p.R48R	NM_004226.3	NP_004217.1	O94768	ST17B_HUMAN	serine/threonine kinase 17b	48	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic process (GO:0006915)|intracellular signal transduction (GO:0035556)|positive regulation of fibroblast apoptotic process (GO:2000271)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)	actin cytoskeleton (GO:0015629)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|cervix(1)|kidney(2)|large_intestine(1)|lung(10)	15			OV - Ovarian serous cystadenocarcinoma(117;0.141)			ATATACATTGTCTAACCACAG	0.348																																					p.R48R		Atlas-SNP	.											.	STK17B	28	.	0			c.A144G						.						85.0	88.0	87.0					2																	197021354		2203	4300	6503	SO:0001819	synonymous_variant	9262	exon3			ACATTGTCTAACC	AB011421	CCDS2315.1	2q33.1	2008-02-05	2007-02-12		ENSG00000081320	ENSG00000081320			11396	protein-coding gene	gene with protein product	"""death-associated protein kinase-related 2"""	604727	"""serine/threonine kinase 17b (apoptosis-inducing)"""			9786912	Standard	NM_004226		Approved	DRAK2	uc002utk.3	O94768	OTTHUMG00000132735	ENST00000263955.4:c.144A>G	chr2.hg19:g.197021354T>C		102.0	0.0		98.0	4.0	NM_004226		Silent	SNP	ENST00000263955.4	hg19	CCDS2315.1																																																																																			.	.		0.348	STK17B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256092.2		
SGOL2	151246	hgsc.bcm.edu	37	2	201437542	201437542	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr2:201437542A>G	ENST00000357799.4	+	7	2571	c.2473A>G	c.(2473-2475)Ata>Gta	p.I825V		NM_001160033.1|NM_001160046.1|NM_152524.5	NP_001153505.1|NP_001153518.1|NP_689737.4	Q562F6	SGOL2_HUMAN	shugoshin-like 2 (S. pombe)	825					meiotic sister chromatid cohesion, centromeric (GO:0051754)|mitotic cell cycle (GO:0000278)	chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|kinetochore (GO:0000776)|mitotic cohesin complex (GO:0030892)|nucleus (GO:0005634)				NS(2)|breast(2)|cervix(3)|endometrium(1)|kidney(2)|large_intestine(7)|lung(20)|ovary(2)|prostate(2)|skin(2)|stomach(1)|urinary_tract(2)	46						AACCAACCAAATATATGAGAA	0.323																																					p.I825V		Atlas-SNP	.											.	SGOL2	126	.	0			c.A2473G						.						90.0	87.0	88.0					2																	201437542		1830	4085	5915	SO:0001583	missense	151246	exon7			AACCAAATATATG	AY094614	CCDS42796.1	2q33.2	2008-02-05			ENSG00000163535	ENSG00000163535			30812	protein-coding gene	gene with protein product		612425					Standard	NM_001160046		Approved	TRIPIN, FLJ25211	uc002uvw.2	Q562F6	OTTHUMG00000154535	ENST00000357799.4:c.2473A>G	chr2.hg19:g.201437542A>G	ENSP00000350447:p.Ile825Val	116.0	0.0		119.0	5.0	NM_001160046	Q53RR9|Q53T20|Q86XY4|Q8IWK2|Q8IZK1|Q8N1Q5|Q96LQ3	Missense_Mutation	SNP	ENST00000357799.4	hg19	CCDS42796.1	.	.	.	.	.	.	.	.	.	.	A	0.141	-1.101785	0.01828	.	.	ENSG00000163535	ENST00000357799	T	0.14766	2.48	5.0	1.3	0.21679	.	0.530450	0.18477	N	0.140028	T	0.13927	0.0337	M	0.69823	2.125	0.09310	N	1	B;B;B	0.20887	0.049;0.018;0.007	B;B;B	0.10450	0.005;0.005;0.003	T	0.21245	-1.0251	10	0.31617	T	0.26	-0.2792	6.9476	0.24528	0.7311:0.0:0.2689:0.0	.	825;825;825	B7Z7S9;Q562F6-2;Q562F6	.;.;SGOL2_HUMAN	V	825	ENSP00000350447:I825V	ENSP00000350447:I825V	I	+	1	0	SGOL2	201145787	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.168000	0.09925	0.136000	0.18733	-0.359000	0.07587	ATA	.	.		0.323	SGOL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335834.1	NM_152524	
CYP27A1	1593	hgsc.bcm.edu	37	2	219646908	219646908	+	Start_Codon_SNP	SNP	G	G	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr2:219646908G>C	ENST00000258415.4	+	1	430	c.3G>C	c.(1-3)atG>atC	p.M1I		NM_000784.3	NP_000775.1	Q02318	CP27A_HUMAN	cytochrome P450, family 27, subfamily A, polypeptide 1	1					bile acid biosynthetic process (GO:0006699)|bile acid metabolic process (GO:0008206)|cholesterol metabolic process (GO:0008203)|small molecule metabolic process (GO:0044281)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)	cholestanetriol 26-monooxygenase activity (GO:0047749)|cholesterol 26-hydroxylase activity (GO:0031073)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|steroid hydroxylase activity (GO:0008395)|vitamin D3 25-hydroxylase activity (GO:0030343)			breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(13)|ovary(1)|prostate(3)|urinary_tract(1)	26		Renal(207;0.0474)		Epithelial(149;9.48e-07)|all cancers(144;0.000171)|LUSC - Lung squamous cell carcinoma(224;0.00813)|Lung(261;0.00981)	Chenodeoxycholic acid(DB06777)|Cholecalciferol(DB00169)|Ergocalciferol(DB00153)|Pegvisomant(DB00082)	CACAACCCATGGCTGCGCTGG	0.746																																					p.M1I		Atlas-SNP	.											.	CYP27A1	52	.	0			c.G3C						.						2.0	2.0	2.0					2																	219646908		1367	2852	4219	SO:0001582	initiator_codon_variant	1593	exon1			ACCCATGGCTGCG	BC017044	CCDS2423.1	2q35	2013-09-19	2003-01-14		ENSG00000135929	ENSG00000135929		"""Cytochrome P450s"""	2605	protein-coding gene	gene with protein product	"""cerebrotendinous xanthomatosis"""	606530	"""cytochrome P450, subfamily XXVIIA (steroid 27-hydroxylase, cerebrotendinous xanthomatosis), polypeptide 1"""	CYP27		2019602	Standard	NM_000784		Approved	CTX, CP27	uc002viz.4	Q02318	OTTHUMG00000048238	ENST00000258415.4:c.3G>C	chr2.hg19:g.219646908G>C	ENSP00000258415:p.Met1Ile	3.0	0.0		10.0	6.0	NM_000784	A8K303|Q6LDB4|Q86YQ6	Missense_Mutation	SNP	ENST00000258415.4	hg19	CCDS2423.1	.	.	.	.	.	.	.	.	.	.	G	9.879	1.201078	0.22121	.	.	ENSG00000135929	ENST00000258415	T	0.74106	-0.81	3.9	3.9	0.45041	.	1.634820	0.03185	N	0.172653	T	0.68769	0.3037	.	.	.	0.80722	D	1	B	0.30914	0.3	B	0.26202	0.067	T	0.56541	-0.7962	9	0.62326	D	0.03	-14.7634	11.2174	0.48833	0.0:0.0:1.0:0.0	.	1	Q02318	CP27A_HUMAN	I	1	ENSP00000258415:M1I	ENSP00000258415:M1I	M	+	3	0	CYP27A1	219355152	0.947000	0.32204	0.934000	0.37439	0.031000	0.12232	1.554000	0.36266	1.977000	0.57605	0.462000	0.41574	ATG	.	.		0.746	CYP27A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109734.4		Missense_Mutation
NCL	4691	hgsc.bcm.edu	37	2	232325414	232325414	+	Missense_Mutation	SNP	T	T	A	rs540030591|rs139777351|rs371359723|rs199689485|rs527711138|rs368566589	byFrequency	TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr2:232325414T>A	ENST00000322723.4	-	4	1017	c.777A>T	c.(775-777)gaA>gaT	p.E259D	SNORD82_ENST00000365530.1_RNA	NM_005381.2	NP_005372.2	P19338	NUCL_HUMAN	nucleolin	259	Asp/Glu-rich (acidic).				angiogenesis (GO:0001525)|positive regulation of transcription of nuclear large rRNA transcript from RNA polymerase I promoter (GO:1901838)	cell cortex (GO:0005938)|cytoplasmic ribonucleoprotein granule (GO:0036464)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	identical protein binding (GO:0042802)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)|RNA binding (GO:0003723)|telomeric DNA binding (GO:0042162)			breast(3)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(8)|lung(7)|ovary(2)|pancreas(2)|prostate(2)|skin(3)	35		Ovarian(221;1.34e-05)|Renal(207;0.0112)|Lung NSC(271;0.0339)|all_lung(227;0.0616)|all_hematologic(139;0.0748)|Hepatocellular(293;0.137)|Acute lymphoblastic leukemia(138;0.167)		Epithelial(121;1.65e-111)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(119;0.014)|COAD - Colon adenocarcinoma(134;0.141)|STAD - Stomach adenocarcinoma(1183;0.18)		CCtcatcatcttcatcatcat	0.438																																					p.E259D		Atlas-SNP	.											.	NCL	80	.	0			c.A777T						.						229.0	194.0	206.0					2																	232325414		2203	4300	6503	SO:0001583	missense	4691	exon4			ATCATCTTCATCA		CCDS33397.1	2q37.1	2013-09-19			ENSG00000115053	ENSG00000115053		"""RNA binding motif (RRM) containing"""	7667	protein-coding gene	gene with protein product		164035				2394707, 3409881	Standard	NM_005381		Approved	C23	uc002vru.3	P19338	OTTHUMG00000153866	ENST00000322723.4:c.777A>T	chr2.hg19:g.232325414T>A	ENSP00000318195:p.Glu259Asp	209.0	0.0		206.0	18.0	NM_005381	Q53SK1|Q8NB06|Q9UCF0|Q9UDG1	Missense_Mutation	SNP	ENST00000322723.4	hg19	CCDS33397.1	.	.	.	.	.	.	.	.	.	.	T	0.028	-1.357543	0.01245	.	.	ENSG00000115053	ENST00000322723;ENST00000392033	T	0.23552	1.9	4.93	-9.86	0.00473	.	1.633390	0.02710	N	0.112777	T	0.06554	0.0168	N	0.03608	-0.345	0.19945	N	0.999949	B	0.02656	0.0	B	0.08055	0.003	T	0.26677	-1.0096	10	0.02654	T	1	0.5096	0.6058	0.00752	0.2352:0.1751:0.2128:0.3769	.	259	P19338	NUCL_HUMAN	D	259;151	ENSP00000318195:E259D	ENSP00000318195:E259D	E	-	3	2	NCL	232033658	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-4.197000	0.00276	-4.228000	0.00063	-3.370000	0.00041	GAA	.	.		0.438	NCL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000332731.1	NM_005381	
GIGYF2	26058	hgsc.bcm.edu	37	2	233684562	233684562	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr2:233684562A>G	ENST00000409547.1	+	23	2707	c.2396A>G	c.(2395-2397)gAg>gGg	p.E799G	GIGYF2_ENST00000409196.3_Missense_Mutation_p.E793G|GIGYF2_ENST00000409451.3_Missense_Mutation_p.E820G|GIGYF2_ENST00000373563.4_Missense_Mutation_p.E799G|GIGYF2_ENST00000373566.3_Missense_Mutation_p.E821G|GIGYF2_ENST00000409480.1_Missense_Mutation_p.E821G|GIGYF2_ENST00000452341.2_Missense_Mutation_p.E630G	NM_015575.3	NP_056390.2	Q6Y7W6	PERQ2_HUMAN	GRB10 interacting GYF protein 2	799	Gln-rich.|Glu-rich.				adult locomotory behavior (GO:0008344)|cell death (GO:0008219)|cellular protein metabolic process (GO:0044267)|feeding behavior (GO:0007631)|homeostasis of number of cells within a tissue (GO:0048873)|insulin-like growth factor receptor signaling pathway (GO:0048009)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|musculoskeletal movement (GO:0050881)|negative regulation of translation (GO:0017148)|neuromuscular process controlling balance (GO:0050885)|post-embryonic development (GO:0009791)|spinal cord motor neuron differentiation (GO:0021522)	membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)			NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(4)|cervix(1)|endometrium(11)|kidney(2)|large_intestine(17)|lung(11)|ovary(5)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	63		Breast(86;0.00279)|all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0271)|Lung NSC(271;0.0839)		Epithelial(121;7.37e-16)|BRCA - Breast invasive adenocarcinoma(100;0.000472)|LUSC - Lung squamous cell carcinoma(224;0.00902)|Lung(119;0.0118)|GBM - Glioblastoma multiforme(43;0.0145)		CGCCAGCGGGAGCAAGAAATT	0.478																																					p.E820G		Atlas-SNP	.											.	GIGYF2	288	.	0			c.A2459G						.						53.0	57.0	55.0					2																	233684562		2203	4300	6503	SO:0001583	missense	26058	exon23			AGCGGGAGCAAGA	U80751	CCDS33401.1, CCDS46542.1, CCDS46543.1	2q37.1	2011-07-06	2008-02-11	2008-02-11	ENSG00000204120	ENSG00000204120		"""Trinucleotide (CAG) repeat containing"""	11960	protein-coding gene	gene with protein product	"""GYF domain containing 2"""	612003	"""PERQ amino acid rich, with GYF domain 2"", ""PERQ amino acid rich, with GYF domain 3"", ""trinucleotide repeat containing 15"", ""Parkinson disease (autosomal recessive, early onset) 11"""	PERQ2, PERQ3, TNRC15, PARK11		9225980, 9734811, 12771153, 18358451, 19279319	Standard	NM_015575		Approved	KIAA0642, GYF2	uc002vtk.4	Q6Y7W6	OTTHUMG00000153237	ENST00000409547.1:c.2396A>G	chr2.hg19:g.233684562A>G	ENSP00000386537:p.Glu799Gly	79.0	0.0		87.0	6.0	NM_001103147	A6H8W4|B9EG55|E9PBB0|O75137|Q7Z2Z8|Q7Z3I2|Q96HU4|Q9NV82	Missense_Mutation	SNP	ENST00000409547.1	hg19	CCDS33401.1	.	.	.	.	.	.	.	.	.	.	A	19.09	3.760744	0.69763	.	.	ENSG00000204120	ENST00000373566;ENST00000373563;ENST00000409480;ENST00000409547;ENST00000409196;ENST00000409451;ENST00000440945;ENST00000452341	T;T;T;T;T;T;T;T	0.76578	-1.03;-1.03;-1.03;-1.03;-1.03;-1.03;-1.03;-1.03	5.04	5.04	0.67666	.	0.000000	0.85682	D	0.000000	D	0.85517	0.5715	L	0.56769	1.78	0.58432	D	0.999999	D;D;D;D	0.76494	0.999;0.998;0.998;0.998	D;D;D;D	0.83275	0.996;0.979;0.979;0.979	D	0.86381	0.1729	10	0.54805	T	0.06	-9.0267	14.7797	0.69756	1.0:0.0:0.0:0.0	.	630;820;799;793	E9PC50;A6H8W4;Q6Y7W6;E9PBB0	.;.;PERQ2_HUMAN;.	G	821;799;821;799;793;820;793;630	ENSP00000362667:E821G;ENSP00000362664:E799G;ENSP00000386765:E821G;ENSP00000386537:E799G;ENSP00000387070:E793G;ENSP00000387170:E820G;ENSP00000410297:E793G;ENSP00000411505:E630G	ENSP00000362664:E799G	E	+	2	0	GIGYF2	233392806	1.000000	0.71417	1.000000	0.80357	0.927000	0.56198	5.494000	0.66905	1.891000	0.54761	0.379000	0.24179	GAG	.	.		0.478	GIGYF2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000330316.2	NM_001103146	
COL6A3	1293	hgsc.bcm.edu	37	2	238244875	238244875	+	Silent	SNP	A	A	G	rs398102314		TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr2:238244875A>G	ENST00000295550.4	-	40	9320	c.8868T>C	c.(8866-8868)gcT>gcC	p.A2956A	COL6A3_ENST00000346358.4_Silent_p.A2756A|COL6A3_ENST00000409809.1_Silent_p.A2750A|COL6A3_ENST00000353578.4_Silent_p.A2750A|COL6A3_ENST00000347401.3_Silent_p.A2755A|COL6A3_ENST00000472056.1_Silent_p.A2349A	NM_004369.3	NP_004360.2	P12111	CO6A3_HUMAN	collagen, type VI, alpha 3	2956	Ala-rich.|Nonhelical region.			Missing (in Ref. 1; CAA36267). {ECO:0000305}.	axon guidance (GO:0007411)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|muscle organ development (GO:0007517)|response to glucose (GO:0009749)	collagen type VI trimer (GO:0005589)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)|vesicle (GO:0031982)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(6)|central_nervous_system(7)|cervix(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(64)|lung(62)|ovary(14)|pancreas(2)|prostate(11)|skin(14)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	217		Breast(86;0.000301)|Renal(207;0.000966)|all_hematologic(139;0.067)|Ovarian(221;0.0694)|all_lung(227;0.0943)|Melanoma(123;0.203)		Epithelial(121;1.23e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.34e-10)|Kidney(56;5.71e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.51e-07)|BRCA - Breast invasive adenocarcinoma(100;0.00025)|Lung(119;0.0142)|LUSC - Lung squamous cell carcinoma(224;0.034)		CAGCAGCAGCAGCGGGGGGTC	0.617																																					p.A2956A		Atlas-SNP	.											.,7	COL6A3	608	.	0			c.T8868C						.						37.0	41.0	40.0					2																	238244875		2199	4298	6497	SO:0001819	synonymous_variant	1293	exon40			AGCAGCAGCGGGG	X52022	CCDS33409.1, CCDS33410.1, CCDS33411.1, CCDS33412.1, CCDS33410.2, CCDS33411.2, CCDS54439.1	2q37	2014-09-17			ENSG00000163359	ENSG00000163359		"""Collagens"""	2213	protein-coding gene	gene with protein product		120250				1339440, 11992252	Standard	NM_004369		Approved		uc002vwl.2	P12111	OTTHUMG00000150020	ENST00000295550.4:c.8868T>C	chr2.hg19:g.238244875A>G		73.0	0.0		65.0	3.0	NM_004369	A8MT30|B4E3U5|B7ZMJ7|E9PFQ6|E9PGQ9|Q16501|Q53QF4|Q53QF6	Silent	SNP	ENST00000295550.4	hg19	CCDS33412.1																																																																																			.	.		0.617	COL6A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000315790.2	NM_004369	
CAPN10	11132	hgsc.bcm.edu	37	2	241534647	241534647	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr2:241534647G>T	ENST00000391984.2	+	7	1400	c.1204G>T	c.(1204-1206)Gac>Tac	p.D402Y	CAPN10_ENST00000270364.7_Intron|CAPN10_ENST00000354082.4_Missense_Mutation_p.D402Y|CAPN10_ENST00000352879.4_Intron|CAPN10_ENST00000391982.2_Missense_Mutation_p.D402Y|CAPN10_ENST00000404753.3_Missense_Mutation_p.D402Y	NM_023083.3	NP_075571	Q9HC96	CAN10_HUMAN	calpain 10	402	Domain III 1.				actin cytoskeleton reorganization (GO:0031532)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to insulin stimulus (GO:0032869)|positive regulation of glucose import (GO:0046326)|positive regulation of insulin secretion (GO:0032024)|positive regulation of intracellular transport (GO:0032388)|positive regulation of type B pancreatic cell apoptotic process (GO:2000676)|proteolysis (GO:0006508)|type B pancreatic cell apoptotic process (GO:0097050)	cell (GO:0005623)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|cytoskeletal protein binding (GO:0008092)|SNARE binding (GO:0000149)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(11)|ovary(3)|urinary_tract(1)	27		all_epithelial(40;1.72e-15)|Breast(86;2.14e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0294)|all_neural(83;0.0459)|Lung NSC(271;0.094)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;1.13e-31)|all cancers(36;3.24e-29)|OV - Ovarian serous cystadenocarcinoma(60;2.82e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;5.1e-06)|Lung(119;0.00168)|Colorectal(34;0.00495)|LUSC - Lung squamous cell carcinoma(224;0.00813)|COAD - Colon adenocarcinoma(134;0.032)		ACTGGTGGGTGACAGTCATAC	0.657																																					p.D402Y		Atlas-SNP	.											.	CAPN10	105	.	0			c.G1204T						.						40.0	44.0	42.0					2																	241534647		2203	4299	6502	SO:0001583	missense	11132	exon7			GTGGGTGACAGTC	AF089088	CCDS33420.1, CCDS42838.1	2q37.3	2008-05-22			ENSG00000142330	ENSG00000142330			1477	protein-coding gene	gene with protein product		605286				11017071, 11018080	Standard	NM_023083		Approved		uc002vzk.2	Q9HC96	OTTHUMG00000133358	ENST00000391984.2:c.1204G>T	chr2.hg19:g.241534647G>T	ENSP00000375844:p.Asp402Tyr	222.0	0.0		293.0	72.0	NM_023085	A8MVS7|Q4ZFV1|Q8NCD4|Q96IG4|Q96JI2|Q9HC89|Q9HC90|Q9HC91|Q9HC92|Q9HC93|Q9HC94|Q9HC95	Missense_Mutation	SNP	ENST00000391984.2	hg19	CCDS42838.1	.	.	.	.	.	.	.	.	.	.	G	14.25	2.480577	0.44044	.	.	ENSG00000142330	ENST00000391984;ENST00000391982;ENST00000404753;ENST00000354082	T;D;T;D	0.88431	1.02;-2.38;1.02;-1.9	4.38	-1.87	0.07737	Peptidase C2, calpain, large subunit, domain III (2);Peptidase C2, calpain, domain III (1);	0.770342	0.11744	N	0.533774	D	0.86560	0.5962	L	0.54323	1.7	0.09310	N	1	P;B;P;B	0.50272	0.889;0.307;0.933;0.307	B;B;P;B	0.49421	0.434;0.232;0.61;0.232	T	0.77915	-0.2409	10	0.87932	D	0	.	5.5588	0.17131	0.4988:0.147:0.3542:0.0	.	402;402;402;402	B7Z6G3;B7WPF5;Q9HC96-3;Q9HC96	.;.;.;CAN10_HUMAN	Y	402	ENSP00000375844:D402Y;ENSP00000375842:D402Y;ENSP00000384422:D402Y;ENSP00000270362:D402Y	ENSP00000270362:D402Y	D	+	1	0	CAPN10	241183320	0.005000	0.15991	0.000000	0.03702	0.010000	0.07245	1.184000	0.32053	-0.289000	0.09038	0.655000	0.94253	GAC	.	.		0.657	CAPN10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257191.3	NM_023083	
NEU4	129807	hgsc.bcm.edu	37	2	242756278	242756278	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr2:242756278G>T	ENST00000391969.2	+	4	1102	c.391G>T	c.(391-393)Gac>Tac	p.D131Y	NEU4_ENST00000404257.1_Missense_Mutation_p.D143Y|NEU4_ENST00000325935.6_Missense_Mutation_p.D144Y|NEU4_ENST00000407683.1_Missense_Mutation_p.D131Y|NEU4_ENST00000405370.1_Missense_Mutation_p.D131Y	NM_001167602.1	NP_001161074.1	Q8WWR8	NEUR4_HUMAN	sialidase 4	131					ganglioside catabolic process (GO:0006689)|glycoprotein catabolic process (GO:0006516)|glycosphingolipid metabolic process (GO:0006687)|oligosaccharide catabolic process (GO:0009313)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	lysosomal lumen (GO:0043202)|lysosome (GO:0005764)|mitochondrion (GO:0005739)|organelle inner membrane (GO:0019866)	exo-alpha-(2->3)-sialidase activity (GO:0052794)|exo-alpha-(2->6)-sialidase activity (GO:0052795)|exo-alpha-(2->8)-sialidase activity (GO:0052796)|exo-alpha-sialidase activity (GO:0004308)			breast(1)|lung(10)|prostate(2)|skin(2)	15		all_cancers(19;1.09e-40)|all_epithelial(40;2.03e-18)|Breast(86;1.53e-05)|all_lung(227;0.00338)|Renal(207;0.00502)|Ovarian(221;0.00716)|Lung NSC(271;0.012)|Esophageal squamous(248;0.129)|Melanoma(123;0.144)|all_hematologic(139;0.158)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;3.84e-33)|all cancers(36;8.08e-31)|OV - Ovarian serous cystadenocarcinoma(60;7.41e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;1.63e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00154)|Colorectal(34;0.0129)|COAD - Colon adenocarcinoma(134;0.0825)		GGCCAGCCGTGACGCCGGCCT	0.711																																					p.D144Y		Atlas-SNP	.											.	NEU4	39	.	0			c.G430T						.						6.0	8.0	7.0					2																	242756278		2038	4048	6086	SO:0001583	missense	129807	exon3			AGCCGTGACGCCG	BC012899	CCDS2553.1, CCDS54441.1, CCDS54442.1	2q37.3	2008-02-05			ENSG00000204099	ENSG00000204099			21328	protein-coding gene	gene with protein product		608527					Standard	NM_001167600		Approved		uc010fzr.3	Q8WWR8	OTTHUMG00000133412	ENST00000391969.2:c.391G>T	chr2.hg19:g.242756278G>T	ENSP00000375830:p.Asp131Tyr	2.0	0.0		38.0	18.0	NM_001167599	A8K056|J3KNJ5|Q96D64	Missense_Mutation	SNP	ENST00000391969.2	hg19	CCDS54442.1	.	.	.	.	.	.	.	.	.	.	G	17.44	3.391018	0.62066	.	.	ENSG00000204099	ENST00000407683;ENST00000405370;ENST00000472793;ENST00000423583;ENST00000404257;ENST00000391969;ENST00000325935;ENST00000420288	D;D;D;D;D;D;D	0.96459	-4.02;-4.02;-4.02;-4.02;-4.02;-4.02;-4.02	4.57	4.57	0.56435	Neuraminidase (2);	0.000000	0.85682	D	0.000000	D	0.98658	0.9550	M	0.94142	3.5	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.99851	1.1072	10	0.87932	D	0	-42.3075	17.3295	0.87258	0.0:0.0:1.0:0.0	.	143;143;131	A8K211;Q8WWR8-2;Q8WWR8	.;.;NEUR4_HUMAN	Y	131;131;141;131;143;131;144;131	ENSP00000385402:D131Y;ENSP00000384804:D131Y;ENSP00000397860:D131Y;ENSP00000385149:D143Y;ENSP00000375830:D131Y;ENSP00000320318:D144Y;ENSP00000388707:D131Y	ENSP00000320318:D144Y	D	+	1	0	NEU4	242404951	1.000000	0.71417	0.528000	0.27938	0.028000	0.11728	6.298000	0.72763	2.077000	0.62373	0.462000	0.41574	GAC	.	.		0.711	NEU4-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257270.2	NM_080741	
TRNT1	51095	hgsc.bcm.edu	37	3	3189269	3189269	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr3:3189269T>C	ENST00000251607.6	+	7	1040	c.938T>C	c.(937-939)tTg>tCg	p.L313S	TRNT1_ENST00000280591.6_Missense_Mutation_p.L293S	NM_182916.2	NP_886552	Q96Q11	TRNT1_HUMAN	tRNA nucleotidyl transferase, CCA-adding, 1	313					protein targeting to mitochondrion (GO:0006626)|tRNA 3'-end processing (GO:0042780)|tRNA 3'-terminal CCA addition (GO:0001680)	intracellular (GO:0005622)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ATP:3'-cytidine-cytidine-tRNA adenylyltransferase activity (GO:0052929)|CTP:3'-cytidine-tRNA cytidylyltransferase activity (GO:0052928)|CTP:tRNA cytidylyltransferase activity (GO:0052927)|tRNA adenylyltransferase activity (GO:0004810)|tRNA binding (GO:0000049)			breast(2)|endometrium(3)|large_intestine(4)|lung(2)|urinary_tract(1)	12				Epithelial(13;0.00226)|OV - Ovarian serous cystadenocarcinoma(96;0.00592)|all cancers(10;0.011)		GATTTGAGGTTGAAGATCGCA	0.333																																					p.L313S		Atlas-SNP	.											.	TRNT1	34	.	0			c.T938C						.						87.0	93.0	91.0					3																	3189269		2203	4300	6503	SO:0001583	missense	51095	exon7			TGAGGTTGAAGAT	AF151805	CCDS2561.2	3p25.1	2002-05-30			ENSG00000072756	ENSG00000072756	2.7.7.25		17341	protein-coding gene	gene with protein product		612907				10810093, 11504732	Standard	NM_182916		Approved	MtCCA, CGI-47, CCA1	uc003bpp.4	Q96Q11	OTTHUMG00000090259	ENST00000251607.6:c.938T>C	chr3.hg19:g.3189269T>C	ENSP00000251607:p.Leu313Ser	148.0	0.0		102.0	5.0	NM_182916	A8K2Z6|B7WP13|C9JKA2|Q8ND57|Q9BS97|Q9Y362	Missense_Mutation	SNP	ENST00000251607.6	hg19	CCDS2561.2	.	.	.	.	.	.	.	.	.	.	T	23.7	4.445521	0.84101	.	.	ENSG00000072756	ENST00000251607;ENST00000280591	T;T	0.54866	0.55;0.59	5.64	5.64	0.86602	.	0.000000	0.64402	D	0.000001	T	0.73297	0.3569	M	0.80183	2.485	0.80722	D	1	P;D	0.76494	0.86;0.999	P;D	0.69654	0.661;0.965	T	0.77760	-0.2467	10	0.87932	D	0	-2.0847	15.5464	0.76104	0.0:0.0:0.0:1.0	.	293;313	Q96Q11-2;Q96Q11	.;TRNT1_HUMAN	S	313;293	ENSP00000251607:L313S;ENSP00000280591:L293S	ENSP00000251607:L313S	L	+	2	0	TRNT1	3164269	1.000000	0.71417	0.998000	0.56505	0.995000	0.86356	7.424000	0.80242	2.155000	0.67459	0.533000	0.62120	TTG	.	.		0.333	TRNT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337616.1		
SRGAP3	9901	hgsc.bcm.edu	37	3	9106232	9106232	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr3:9106232T>C	ENST00000383836.3	-	5	947	c.520A>G	c.(520-522)Agc>Ggc	p.S174G	SRGAP3_ENST00000360413.3_Missense_Mutation_p.S174G|SRGAP3_ENST00000433332.3_5'UTR	NM_014850.3	NP_055665.1	O43295	SRGP3_HUMAN	SLIT-ROBO Rho GTPase activating protein 3	174	F-BAR domain.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)		SRGAP3/RAF1(6)	breast(1)|endometrium(2)|kidney(21)|large_intestine(7)|lung(13)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	54				OV - Ovarian serous cystadenocarcinoma(96;0.0563)		GCACTGATGCTCTCTGCATGG	0.557			T	RAF1	pilocytic astrocytoma																																p.S174G		Atlas-SNP	.		Dom	yes		3	3p25.3	9901	SLIT-ROBO Rho GTPase activating protein 3		M	.	SRGAP3	146	.	0			c.A520G						.						146.0	111.0	123.0					3																	9106232		2203	4300	6503	SO:0001583	missense	9901	exon5			TGATGCTCTCTGC	AB007871	CCDS2572.1, CCDS33689.1	3p25.3	2011-07-04	2004-11-12	2004-11-12	ENSG00000196220	ENSG00000196220		"""Rho GTPase activating proteins"""	19744	protein-coding gene	gene with protein product		606525	"""SLIT-ROBO Rho GTPase activating protein 2"""	SRGAP2		12195014	Standard	NM_014850		Approved	KIAA0411, MEGAP, WRP, ARHGAP14	uc003brf.2	O43295	OTTHUMG00000090589	ENST00000383836.3:c.520A>G	chr3.hg19:g.9106232T>C	ENSP00000373347:p.Ser174Gly	180.0	0.0		101.0	5.0	NM_014850	Q8IX13|Q8IZV8	Missense_Mutation	SNP	ENST00000383836.3	hg19	CCDS2572.1	.	.	.	.	.	.	.	.	.	.	T	24.9	4.586067	0.86748	.	.	ENSG00000196220	ENST00000383836;ENST00000360413;ENST00000544908	T;T	0.14391	2.51;2.51	4.9	4.9	0.64082	.	0.041576	0.85682	N	0.000000	T	0.38799	0.1054	M	0.83012	2.62	0.58432	D	0.999995	D;B;P;P	0.58268	0.982;0.135;0.949;0.915	D;B;P;P	0.67548	0.952;0.12;0.731;0.543	T	0.27400	-1.0075	10	0.42905	T	0.14	.	14.5406	0.67990	0.0:0.0:0.0:1.0	.	174;43;174;174	C7TPG7;Q9ULR4;O43295-2;O43295	.;.;.;SRGP2_HUMAN	G	174;174;54	ENSP00000373347:S174G;ENSP00000353587:S174G	ENSP00000353587:S174G	S	-	1	0	SRGAP3	9081232	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	7.822000	0.86651	1.982000	0.57802	0.333000	0.21579	AGC	.	.		0.557	SRGAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207137.3		
ZNF860	344787	hgsc.bcm.edu	37	3	32031946	32031946	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr3:32031946T>C	ENST00000360311.4	+	2	1924	c.1375T>C	c.(1375-1377)Tgt>Cgt	p.C459R		NM_001137674.2	NP_001131146.2	A6NHJ4	ZN860_HUMAN	zinc finger protein 860	459					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|lung(4)|ovary(1)	8						GTGTAATGAGTGTGGCAAGAC	0.398																																					p.C459R		Atlas-SNP	.											.	ZNF860	96	.	0			c.T1375C						.						44.0	69.0	62.0					3																	32031946		692	1591	2283	SO:0001583	missense	344787	exon2			AATGAGTGTGGCA	AK294003	CCDS46784.1	3p24.1	2013-01-08			ENSG00000197385	ENSG00000197385		"""Zinc fingers, C2H2-type"", ""-"""	34513	protein-coding gene	gene with protein product							Standard	NM_001137674		Approved		uc011axg.2	A6NHJ4	OTTHUMG00000155838	ENST00000360311.4:c.1375T>C	chr3.hg19:g.32031946T>C	ENSP00000373274:p.Cys459Arg	49.0	0.0		33.0	4.0	NM_001137674	B4DFA4	Missense_Mutation	SNP	ENST00000360311.4	hg19	CCDS46784.1	.	.	.	.	.	.	.	.	.	.	t	7.117	0.577209	0.13686	.	.	ENSG00000197385	ENST00000360311	D	0.85955	-2.05	0.336	-0.672	0.11377	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	D	0.93122	0.7810	H	0.97707	4.06	0.36032	D	0.839491	D	0.63046	0.992	D	0.79108	0.992	D	0.88221	0.2897	8	.	.	.	.	4.0308	0.09708	0.0:0.2849:0.0:0.7151	.	459	A6NHJ4	ZN860_HUMAN	R	459	ENSP00000373274:C459R	.	C	+	1	0	ZNF860	32006950	0.999000	0.42202	0.005000	0.12908	0.005000	0.04900	3.829000	0.55760	-0.993000	0.03467	-1.026000	0.02426	TGT	.	.		0.398	ZNF860-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341957.1		
ZNF662	389114	hgsc.bcm.edu	37	3	42954744	42954744	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr3:42954744A>G	ENST00000541208.1	+	4	572	c.203A>G	c.(202-204)gAg>gGg	p.E68G	ZNF662_ENST00000440367.2_Missense_Mutation_p.E68G|ZNF662_ENST00000430067.2_3'UTR|KRBOX1_ENST00000426937.1_Intron|ZNF662_ENST00000328199.6_Intron|ZNF662_ENST00000422021.1_Intron			Q6ZS27	ZN662_HUMAN	zinc finger protein 662	68					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(1)|large_intestine(6)|lung(5)|upper_aerodigestive_tract(1)	15				KIRC - Kidney renal clear cell carcinoma(284;0.217)		CAGGTGGAAGAGCCATTAAAC	0.473																																					p.E68G		Atlas-SNP	.											.	ZNF662	112	.	0			c.A203G						.						95.0	97.0	96.0					3																	42954744		2203	4300	6503	SO:0001583	missense	389114	exon4			TGGAAGAGCCATT	AK127779	CCDS2708.1, CCDS46807.1	3p22.1	2013-01-08			ENSG00000182983	ENSG00000182983		"""Zinc fingers, C2H2-type"", ""-"""	31930	protein-coding gene	gene with protein product							Standard	NM_207404		Approved	FLJ45880	uc003cmk.2	Q6ZS27	OTTHUMG00000133041	ENST00000541208.1:c.203A>G	chr3.hg19:g.42954744A>G	ENSP00000446208:p.Glu68Gly	127.0	0.0		62.0	4.0	NM_207404	A1A4T9|F8W7S8|Q6ZNF8|Q6ZQW8	Missense_Mutation	SNP	ENST00000541208.1	hg19	CCDS2708.1	.	.	.	.	.	.	.	.	.	.	A	7.478	0.648042	0.14516	.	.	ENSG00000182983	ENST00000440367;ENST00000541208	T;T	0.49720	0.77;0.77	3.46	3.46	0.39613	.	.	.	.	.	T	0.48822	0.1521	L	0.34521	1.04	0.21527	N	0.999654	D	0.69078	0.997	P	0.60682	0.878	T	0.25813	-1.0121	9	0.22706	T	0.39	.	8.4924	0.33108	1.0:0.0:0.0:0.0	.	68	Q6ZS27	ZN662_HUMAN	G	68	ENSP00000405047:E68G;ENSP00000446208:E68G	ENSP00000405047:E68G	E	+	2	0	ZNF662	42929748	0.992000	0.36948	0.447000	0.26932	0.016000	0.09150	2.013000	0.40942	1.575000	0.49775	0.460000	0.39030	GAG	.	.		0.473	ZNF662-201	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256646.4	NM_207404	
FYCO1	79443	hgsc.bcm.edu	37	3	46021198	46021198	+	Splice_Site	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr3:46021198T>C	ENST00000296137.2	-	4	492	c.287A>G	c.(286-288)gAg>gGg	p.E96G	FYCO1_ENST00000535325.1_Splice_Site_p.E96G	NM_024513.3	NP_078789.2	Q9BQS8	FYCO1_HUMAN	FYVE and coiled-coil domain containing 1	96	RUN. {ECO:0000255|PROSITE- ProRule:PRU00178}.				plus-end-directed vesicle transport along microtubule (GO:0072383)	autophagic vacuole (GO:0005776)|cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|lysosome (GO:0005764)|membrane (GO:0016020)	metal ion binding (GO:0046872)			NS(4)|breast(3)|central_nervous_system(1)|endometrium(11)|kidney(2)|large_intestine(9)|lung(17)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)	54				BRCA - Breast invasive adenocarcinoma(193;0.00147)|KIRC - Kidney renal clear cell carcinoma(197;0.0272)|Kidney(197;0.0323)		TCAGCTTACCTCTGAGATAGA	0.498																																					p.E96G		Atlas-SNP	.											.	FYCO1	115	.	0			c.A287G						.						192.0	164.0	174.0					3																	46021198		2203	4300	6503	SO:0001630	splice_region_variant	79443	exon4			CTTACCTCTGAGA	AJ292348	CCDS2734.1	3p21.3	2008-02-05			ENSG00000163820	ENSG00000163820		"""Zinc fingers, FYVE domain containing"""	14673	protein-coding gene	gene with protein product		607182				11896456	Standard	NM_024513		Approved	FLJ13335, ZFYVE7	uc003cpb.5	Q9BQS8	OTTHUMG00000133447	ENST00000296137.2:c.288+1A>G	chr3.hg19:g.46021198T>C		210.0	0.0		125.0	5.0	NM_024513	B7ZKT7|Q3MJE6|Q86T41|Q86TB1|Q8TEF9|Q96IV5|Q9H8P9	Missense_Mutation	SNP	ENST00000296137.2	hg19	CCDS2734.1	.	.	.	.	.	.	.	.	.	.	T	18.28	3.590006	0.66105	.	.	ENSG00000163820	ENST00000296137;ENST00000535325	T;T	0.12255	2.7;2.7	5.36	5.36	0.76844	RUN (2);	0.000000	0.85682	D	0.000000	T	0.32734	0.0839	L	0.53249	1.67	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.83275	0.981;0.996	T	0.02797	-1.1109	10	0.72032	D	0.01	-31.7368	13.9155	0.63895	0.0:0.0:0.0:1.0	.	96;96	B7ZKT7;Q9BQS8	.;FYCO1_HUMAN	G	96	ENSP00000296137:E96G;ENSP00000441178:E96G	ENSP00000296137:E96G	E	-	2	0	FYCO1	45996202	1.000000	0.71417	0.994000	0.49952	0.197000	0.23852	7.699000	0.84547	2.033000	0.60031	0.397000	0.26171	GAG	.	.		0.498	FYCO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257320.2	NM_024513	Missense_Mutation
P4HTM	54681	hgsc.bcm.edu	37	3	49041657	49041657	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr3:49041657A>G	ENST00000383729.4	+	5	1222	c.851A>G	c.(850-852)gAg>gGg	p.E284G	WDR6_ENST00000395474.3_5'Flank|P4HTM_ENST00000343546.4_Missense_Mutation_p.E284G	NM_177939.2	NP_808808.1	Q9NXG6	P4HTM_HUMAN	prolyl 4-hydroxylase, transmembrane (endoplasmic reticulum)	284						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|iron ion binding (GO:0005506)|L-ascorbic acid binding (GO:0031418)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)			NS(1)|breast(2)|kidney(1)|large_intestine(1)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(1)	21					Vitamin C(DB00126)	TACCAGGGTGAGGGTGCCCAC	0.597																																					p.E284G		Atlas-SNP	.											.	P4HTM	71	.	0			c.A851G						.						35.0	24.0	28.0					3																	49041657		2062	3995	6057	SO:0001583	missense	54681	exon5			AGGGTGAGGGTGC		CCDS2781.2, CCDS43089.1	3p21.31	2009-01-14			ENSG00000178467	ENSG00000178467			28858	protein-coding gene	gene with protein product	"""Prolyl hydroxlase domain-containing 4"", ""hypoxia inducible factor prolyl 4 hydroxylase"""	614584				12163023, 17726031	Standard	XR_245139		Approved	P4H-TM, PHD4, PH4, HIFPH4, FLJ20262, EGLN4, PH-4	uc003cvh.3	Q9NXG6	OTTHUMG00000074057	ENST00000383729.4:c.851A>G	chr3.hg19:g.49041657A>G	ENSP00000373235:p.Glu284Gly	96.0	0.0		35.0	4.0	NM_177938	Q6PAG6|Q8TCJ9|Q8WV55|Q96F22|Q9BW77	Missense_Mutation	SNP	ENST00000383729.4	hg19	CCDS43089.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	26.7|26.7	4.764168|4.764168	0.89932|0.89932	.|.	.|.	ENSG00000178467|ENSG00000178467	ENST00000383729;ENST00000343546|ENST00000444213	T|.	0.79554|.	-1.28|.	5.76|5.76	5.76|5.76	0.90799|0.90799	Prolyl 4-hydroxylase, alpha subunit (1);|.	0.101208|.	0.64402|.	D|.	0.000001|.	T|.	0.69691|.	0.3139|.	L|L	0.54323|0.54323	1.7|1.7	0.44221|0.44221	D|D	0.997055|0.997055	D;D|.	0.60575|.	0.988;0.979|.	P;P|.	0.58721|.	0.844;0.702|.	T|.	0.67562|.	-0.5639|.	10|.	0.72032|.	D|.	0.01|.	-24.9026|-24.9026	16.0766|16.0766	0.80971|0.80971	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	284;284|.	Q9NXG6-3;Q9NXG6|.	.;P4HTM_HUMAN|.	G|W	284|213	ENSP00000373235:E284G|.	ENSP00000341422:E284G|.	E|X	+|+	2|3	0|0	P4HTM|P4HTM	49016661|49016661	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	4.034000|4.034000	0.57289|0.57289	2.202000|2.202000	0.70862|0.70862	0.533000|0.533000	0.62120|0.62120	GAG|TGA	.	.		0.597	P4HTM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157211.1	NM_177938	
FAM208A	23272	hgsc.bcm.edu	37	3	56667646	56667646	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr3:56667646A>G	ENST00000493960.2	-	18	3183	c.3173T>C	c.(3172-3174)aTg>aCg	p.M1058T	FAM208A_ENST00000431842.2_Missense_Mutation_p.M621T|FAM208A_ENST00000355628.5_Missense_Mutation_p.M997T	NM_001112736.1	NP_001106207.1	Q9UK61	F208A_HUMAN	family with sequence similarity 208, member A	1058							poly(A) RNA binding (GO:0044822)			NS(1)|breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(4)|lung(11)|prostate(3)|skin(1)	32						AAGCCGTTTCATCTTCTCTTG	0.343																																					p.M1058T		Atlas-SNP	.											.	FAM208A	113	.	0			c.T3173C						.						110.0	119.0	116.0					3																	56667646		2203	4300	6503	SO:0001583	missense	23272	exon18			CGTTTCATCTTCT	AF180425	CCDS2877.1, CCDS46853.1	3p14.3	2011-09-14	2011-09-14	2011-09-14	ENSG00000163946	ENSG00000163946			30314	protein-coding gene	gene with protein product			"""chromosome 3 open reading frame 63"""	C3orf63		10470851, 11149944	Standard	NM_015224		Approved	se89-1, RAP140, KIAA1105	uc003die.4	Q9UK61	OTTHUMG00000158827	ENST00000493960.2:c.3173T>C	chr3.hg19:g.56667646A>G	ENSP00000417509:p.Met1058Thr	38.0	0.0		26.0	4.0	NM_001112736	A1L3A4|B5ME28|Q9H2F7|Q9UPP7	Missense_Mutation	SNP	ENST00000493960.2	hg19	CCDS46853.1	.	.	.	.	.	.	.	.	.	.	A	12.34	1.909510	0.33721	.	.	ENSG00000163946	ENST00000431842;ENST00000493960;ENST00000355628	T;T;T	0.12774	2.65;2.89;2.9	5.76	5.76	0.90799	.	0.391146	0.30401	N	0.009705	T	0.15003	0.0362	L	0.59436	1.845	0.33387	D	0.575673	B;B;B;B	0.32467	0.332;0.372;0.218;0.224	B;B;B;B	0.31869	0.137;0.098;0.104;0.101	T	0.16364	-1.0405	10	0.32370	T	0.25	-2.4445	10.6901	0.45867	0.9288:0.0:0.0712:0.0	.	1058;997;621;1058	Q9UK61-3;Q9UK61-4;Q9UK61-2;Q9UK61	.;.;.;F208A_HUMAN	T	621;1058;997	ENSP00000399410:M621T;ENSP00000417509:M1058T;ENSP00000347845:M997T	ENSP00000347845:M997T	M	-	2	0	C3orf63	56642686	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.725000	0.61979	2.323000	0.78572	0.528000	0.53228	ATG	.	.		0.343	FAM208A-004	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352352.2	NM_015224	
DNAH12	201625	hgsc.bcm.edu	37	3	57343779	57343779	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr3:57343779A>G	ENST00000351747.2	-	53	8576	c.8396T>C	c.(8395-8397)cTc>cCc	p.L2799P	DNAH12_ENST00000344804.4_Missense_Mutation_p.L386P	NM_178504.4	NP_848599.3	Q6ZR08	DYH12_HUMAN	dynein, axonemal, heavy chain 12	2799					microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(3)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(4)|lung(7)|pancreas(1)|prostate(1)|skin(1)	25						TCCCTGGGTGAGGAGCAAGGA	0.418																																					p.L2799P		Atlas-SNP	.											.	DNAH12	182	.	0			c.T8396C						.						166.0	159.0	161.0					3																	57343779		692	1591	2283	SO:0001583	missense	201625	exon53			TGGGTGAGGAGCA	U53532, AK126276	CCDS33771.1	3p21.1	2009-02-04	2006-09-04		ENSG00000174844	ENSG00000174844		"""Axonemal dyneins"""	2943	protein-coding gene	gene with protein product		603340	"""dynein, axonemal, heavy polypeptide 12"", ""dynein heavy chain domain 2"", ""dynein heavy domain 2"", ""dynein, axonemal, heavy chain 12-like"", ""dynein, axonemal, heavy chain 7-like"""	DNHD2, DNAH12L, DNAH7L		8812413, 8666668	Standard	NM_198564		Approved	DLP12, Dnahc3, HL-19, hdhc3, DHC3, FLJ40427, FLJ44290	uc003dit.2	Q6ZR08	OTTHUMG00000158598	ENST00000351747.2:c.8396T>C	chr3.hg19:g.57343779A>G	ENSP00000295937:p.Leu2799Pro	150.0	0.0		93.0	4.0	NM_178504	A6NGI2|Q6ZTR8|Q8N7R9|Q8WXK2|Q92816	Missense_Mutation	SNP	ENST00000351747.2	hg19		.	.	.	.	.	.	.	.	.	.	A	19.78	3.891740	0.72524	.	.	ENSG00000174844	ENST00000351747;ENST00000466540;ENST00000344804	T;T;T	0.08984	3.03;3.03;3.03	5.92	5.92	0.95590	Dynein heavy chain (1);	0.000000	0.85682	D	0.000000	T	0.38878	0.1057	M	0.92219	3.285	0.58432	D	0.999995	P;D	0.76494	0.886;0.999	P;D	0.79784	0.785;0.993	T	0.49532	-0.8930	10	0.66056	D	0.02	.	15.5337	0.75986	1.0:0.0:0.0:0.0	.	386;2799	Q6ZR08-2;Q6ZR08	.;DYH12_HUMAN	P	2799;444;386	ENSP00000295937:L2799P;ENSP00000420359:L444P;ENSP00000340464:L386P	ENSP00000340464:L386P	L	-	2	0	DNAH12	57318819	1.000000	0.71417	0.998000	0.56505	0.480000	0.33159	7.343000	0.79319	2.255000	0.74692	0.533000	0.62120	CTC	.	.		0.418	DNAH12-202	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_178504	
SLMAP	7871	hgsc.bcm.edu	37	3	57846497	57846497	+	Silent	SNP	A	A	G			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr3:57846497A>G	ENST00000428312.1	+	8	853	c.759A>G	c.(757-759)acA>acG	p.T253T	SLMAP_ENST00000295951.3_Silent_p.T253T|SLMAP_ENST00000449503.2_Silent_p.T253T|SLMAP_ENST00000295952.3_Silent_p.T253T|SLMAP_ENST00000383718.3_Silent_p.T253T|SLMAP_ENST00000416870.1_5'UTR			Q14BN4	SLMAP_HUMAN	sarcolemma associated protein	253					muscle contraction (GO:0006936)	cytoskeleton (GO:0005856)|integral component of plasma membrane (GO:0005887)|smooth endoplasmic reticulum (GO:0005790)				endometrium(5)|kidney(1)|large_intestine(3)|lung(7)|urinary_tract(2)	18				BRCA - Breast invasive adenocarcinoma(55;0.000271)|KIRC - Kidney renal clear cell carcinoma(284;0.0602)|Kidney(284;0.0754)|OV - Ovarian serous cystadenocarcinoma(275;0.182)		ATGAGACAACAGCCAAAGAGT	0.308																																					p.T253T		Atlas-SNP	.											.	SLMAP	46	.	0			c.A759G						.						37.0	43.0	41.0					3																	57846497		2201	4298	6499	SO:0001819	synonymous_variant	7871	exon8			GACAACAGCCAAA	AF100750	CCDS33774.1	3p21.2-p14.3	2008-07-18			ENSG00000163681	ENSG00000163681			16643	protein-coding gene	gene with protein product	"""Sarcolemmal-associated protein"""	602701				9405447, 11042152	Standard	NM_007159		Approved	SLAP, KIAA1601	uc003djd.1	Q14BN4	OTTHUMG00000133764	ENST00000428312.1:c.759A>G	chr3.hg19:g.57846497A>G		158.0	0.0		115.0	5.0	NM_007159	Q14C95|Q6AI54|Q6UXC9|Q6ZVQ8|Q8NCW9|Q9H297|Q9HCH1|Q9Y681	Silent	SNP	ENST00000428312.1	hg19																																																																																				.	.		0.308	SLMAP-013	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000351584.1	NM_007159	
TMF1	7110	hgsc.bcm.edu	37	3	69079080	69079080	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr3:69079080T>C	ENST00000398559.2	-	11	2696	c.2480A>G	c.(2479-2481)cAg>cGg	p.Q827R	CTD-2013N24.2_ENST00000482368.2_RNA|CTD-2013N24.2_ENST00000596523.1_RNA|CTD-2013N24.2_ENST00000601511.1_RNA|CTD-2013N24.2_ENST00000597366.1_RNA|CTD-2013N24.2_ENST00000601735.1_RNA|CTD-2013N24.2_ENST00000597950.1_RNA|CTD-2013N24.2_ENST00000598783.1_RNA|CTD-2013N24.2_ENST00000595925.1_RNA|CTD-2013N24.2_ENST00000599467.1_RNA|TMF1_ENST00000543976.1_Missense_Mutation_p.Q830R|CTD-2013N24.2_ENST00000596732.1_RNA			P82094	TMF1_HUMAN	TATA element modulatory factor 1	827					acrosome assembly (GO:0001675)|cellular response to organic cyclic compound (GO:0071407)|defense response to bacterium (GO:0042742)|Leydig cell differentiation (GO:0033327)|luteinizing hormone secretion (GO:0032275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of gene expression (GO:0010629)|positive regulation of cytokine production (GO:0001819)|positive regulation of testosterone secretion (GO:2000845)|regulation of proteasomal protein catabolic process (GO:0061136)|regulation of transcription, DNA-templated (GO:0006355)|sperm motility (GO:0030317)|spermatid nucleus differentiation (GO:0007289)|transcription from RNA polymerase II promoter (GO:0006366)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|transcription cofactor activity (GO:0003712)			cervix(1)|kidney(1)|large_intestine(4)|lung(13)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	22		Lung NSC(201;0.0193)|Prostate(884;0.174)		BRCA - Breast invasive adenocarcinoma(55;4.48e-05)|Epithelial(33;0.000274)|LUSC - Lung squamous cell carcinoma(21;0.0123)|KIRC - Kidney renal clear cell carcinoma(39;0.211)|Kidney(39;0.247)		GGAAGACATCTGAATTTTGTT	0.423																																					p.Q827R		Atlas-SNP	.											.	TMF1	77	.	0			c.A2480G						.						156.0	154.0	155.0					3																	69079080		1890	4120	6010	SO:0001583	missense	7110	exon11			GACATCTGAATTT		CCDS43105.1	3p21-p12	2009-02-11			ENSG00000144747	ENSG00000144747			11870	protein-coding gene	gene with protein product		601126				1409643	Standard	NM_007114		Approved	ARA160, TMF	uc003dnn.3	P82094	OTTHUMG00000158771	ENST00000398559.2:c.2480A>G	chr3.hg19:g.69079080T>C	ENSP00000381567:p.Gln827Arg	132.0	0.0		77.0	4.0	NM_007114	B7ZLJ2|Q17R87|Q59GK0	Missense_Mutation	SNP	ENST00000398559.2	hg19	CCDS43105.1	.	.	.	.	.	.	.	.	.	.	T	13.86	2.362304	0.41902	.	.	ENSG00000144747	ENST00000398559;ENST00000543976;ENST00000356248	T;T	0.43294	0.95;0.95	5.66	5.66	0.87406	.	0.000000	0.85682	D	0.000000	T	0.35038	0.0918	L	0.34521	1.04	0.80722	D	1	P;P	0.42518	0.782;0.726	B;B	0.43413	0.419;0.259	T	0.08889	-1.0700	10	0.07644	T	0.81	-10.1573	15.8852	0.79241	0.0:0.0:0.0:1.0	.	830;827	P82094-2;P82094	.;TMF1_HUMAN	R	827;830;743	ENSP00000381567:Q827R;ENSP00000438706:Q830R	ENSP00000348582:Q743R	Q	-	2	0	TMF1	69161770	1.000000	0.71417	0.991000	0.47740	0.997000	0.91878	7.694000	0.84235	2.146000	0.66826	0.477000	0.44152	CAG	.	.		0.423	TMF1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000352106.1	NM_007114	
CNTN3	5067	hgsc.bcm.edu	37	3	74418520	74418520	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr3:74418520T>C	ENST00000263665.6	-	7	793	c.766A>G	c.(766-768)Ata>Gta	p.I256V		NM_020872.1	NP_065923.1	Q9P232	CNTN3_HUMAN	contactin 3 (plasmacytoma associated)	256	Ig-like C2-type 3.				cell adhesion (GO:0007155)|nervous system development (GO:0007399)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)				NS(2)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(39)|ovary(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	83		Lung NSC(201;0.138)|Lung SC(41;0.21)		Epithelial(33;0.00212)|BRCA - Breast invasive adenocarcinoma(55;0.00258)|LUSC - Lung squamous cell carcinoma(21;0.00461)|Lung(16;0.01)		ATCTGAGGTATGGGACTAAGA	0.383																																					p.I256V		Atlas-SNP	.											.	CNTN3	174	.	0			c.A766G						.						43.0	43.0	43.0					3																	74418520		2203	4298	6501	SO:0001583	missense	5067	exon7			GAGGTATGGGACT	AB040929	CCDS33790.1	3p12.3	2013-02-11			ENSG00000113805	ENSG00000113805		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2173	protein-coding gene	gene with protein product		601325		PANG		8661054, 8586965	Standard	XM_005264757		Approved	BIG-1	uc003dpm.1	Q9P232	OTTHUMG00000158813	ENST00000263665.6:c.766A>G	chr3.hg19:g.74418520T>C	ENSP00000263665:p.Ile256Val	184.0	0.0		81.0	4.0	NM_020872	B9EK50|Q9H039	Missense_Mutation	SNP	ENST00000263665.6	hg19	CCDS33790.1	.	.	.	.	.	.	.	.	.	.	T	0.670	-0.802436	0.02841	.	.	ENSG00000113805	ENST00000263665	T	0.65916	-0.18	5.2	-1.46	0.08800	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.272223	0.35708	N	0.003023	T	0.25975	0.0633	N	0.03608	-0.345	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.30357	-0.9981	10	0.02654	T	1	.	6.2168	0.20659	0.0:0.5523:0.1122:0.3355	.	256	Q9P232	CNTN3_HUMAN	V	256	ENSP00000263665:I256V	ENSP00000263665:I256V	I	-	1	0	CNTN3	74501210	0.867000	0.29959	0.051000	0.19133	0.992000	0.81027	1.719000	0.38011	-0.721000	0.04929	0.482000	0.46254	ATA	.	.		0.383	CNTN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352306.1	NM_020872	
PROS1	5627	hgsc.bcm.edu	37	3	93611837	93611837	+	Silent	SNP	A	A	G	rs199469491	byFrequency	TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr3:93611837A>G	ENST00000394236.3	-	10	1411	c.1095T>C	c.(1093-1095)aaT>aaC	p.N365N	PROS1_ENST00000407433.1_Silent_p.N234N	NM_000313.3	NP_000304.2	P07225	PROS_HUMAN	protein S (alpha)	365	Laminin G-like 1. {ECO:0000255|PROSITE- ProRule:PRU00122}.				blood coagulation (GO:0007596)|cellular protein metabolic process (GO:0044267)|fibrinolysis (GO:0042730)|innate immune response (GO:0045087)|leukocyte migration (GO:0050900)|negative regulation of endopeptidase activity (GO:0010951)|peptidyl-glutamic acid carboxylation (GO:0017187)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|post-translational protein modification (GO:0043687)|proteolysis (GO:0006508)|regulation of complement activation (GO:0030449)	blood microparticle (GO:0072562)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|Golgi membrane (GO:0000139)|platelet alpha granule lumen (GO:0031093)	calcium ion binding (GO:0005509)|endopeptidase inhibitor activity (GO:0004866)			endometrium(3)|kidney(5)|large_intestine(8)|lung(26)|ovary(1)|skin(2)|urinary_tract(1)	46					Drotrecogin alfa(DB00055)|Menadione(DB00170)|Sodium Tetradecyl Sulfate(DB00464)	ATGTATGTTCATTCTTAAGCT	0.398																																					p.N365N		Atlas-SNP	.											.	PROS1	126	.	0			c.T1095C						.						130.0	120.0	124.0					3																	93611837		2203	4300	6503	SO:0001819	synonymous_variant	5627	exon10			ATGTTCATTCTTA		CCDS2923.1	3q11.1	2013-06-03			ENSG00000184500	ENSG00000184500			9456	protein-coding gene	gene with protein product		176880		PROS		214811, 1833851	Standard	NM_000313		Approved		uc003drb.4	P07225	OTTHUMG00000150354	ENST00000394236.3:c.1095T>C	chr3.hg19:g.93611837A>G		371.0	0.0		421.0	172.0	NM_000313	A8KAC9|D3DN28|Q15518|Q7Z715|Q9UCZ8	Silent	SNP	ENST00000394236.3	hg19	CCDS2923.1																																																																																			.	A|0.999;C|0.001		0.398	PROS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317762.1	NM_000313	
OR5H6	79295	hgsc.bcm.edu	37	3	97983495	97983495	+	Missense_Mutation	SNP	A	A	C	rs398062605|rs74203917|rs149984587	byFrequency	TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr3:97983495A>C	ENST00000383696.2	+	1	408	c.367A>C	c.(367-369)Act>Cct	p.T123P	RP11-325B23.2_ENST00000508616.1_lincRNA	NM_001005479.1	NP_001005479.1	Q8NGV6	OR5H6_HUMAN	olfactory receptor, family 5, subfamily H, member 6 (gene/pseudogene)	123						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			cervix(2)|endometrium(1)|large_intestine(4)|lung(20)|ovary(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	34						CCTTGTAACCACTGTAACCAC	0.383																																					p.T123P		Atlas-SNP	.											.	OR5H6	89	.	0			c.A367C						.						93.0	59.0	71.0					3																	97983495		2195	4251	6446	SO:0001583	missense	79295	exon1			GTAACCACTGTAA	BK004374	CCDS33800.1	3q12.1	2013-10-10	2013-10-10		ENSG00000230301	ENSG00000230301		"""GPCR / Class A : Olfactory receptors"""	14767	protein-coding gene	gene with protein product			"""olfactory receptor, family 5, subfamily H, member 6"""				Standard	NM_001005479		Approved		uc003dsi.1	Q8NGV6	OTTHUMG00000160078	ENST00000383696.2:c.367A>C	chr3.hg19:g.97983495A>C	ENSP00000373196:p.Thr123Pro	125.0	0.0		126.0	6.0	NM_001005479	Q6IF88	Missense_Mutation	SNP	ENST00000383696.2	hg19	CCDS33800.1	.	.	.	.	.	.	.	.	.	.	-	4.810	0.150643	0.09185	.	.	ENSG00000230301	ENST00000383696	T	0.00479	7.12	2.19	-3.59	0.04583	GPCR, rhodopsin-like superfamily (1);	0.914442	0.09287	N	0.822835	T	0.00241	0.0007	N	0.24115	0.695	0.09310	N	1	B	0.31435	0.323	B	0.27887	0.084	T	0.37337	-0.9710	10	0.72032	D	0.01	.	3.1801	0.06582	0.522:0.0:0.1327:0.3452	.	123	Q8NGV6	OR5H6_HUMAN	P	123	ENSP00000373196:T123P	ENSP00000373196:T123P	T	+	1	0	OR5H6	99466185	0.000000	0.05858	0.011000	0.14972	0.001000	0.01503	-1.002000	0.03686	-0.512000	0.06505	-1.140000	0.01884	ACT	.	.		0.383	OR5H6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359111.2		
HCLS1	3059	hgsc.bcm.edu	37	3	121351335	121351335	+	Missense_Mutation	SNP	C	C	G			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr3:121351335C>G	ENST00000314583.3	-	12	1175	c.1084G>C	c.(1084-1086)Gca>Cca	p.A362P	HCLS1_ENST00000428394.2_Missense_Mutation_p.A325P|HCLS1_ENST00000473883.1_5'UTR	NM_005335.4	NP_005326	P14317	HCLS1_HUMAN	hematopoietic cell-specific Lyn substrate 1	362					actin filament polymerization (GO:0030041)|cellular response to cytokine stimulus (GO:0071345)|erythrocyte differentiation (GO:0030218)|intracellular signal transduction (GO:0035556)|negative regulation of leukocyte apoptotic process (GO:2000107)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of actin cytoskeleton reorganization (GO:2000251)|positive regulation of cell proliferation (GO:0008284)|positive regulation of granulocyte differentiation (GO:0030854)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of transcription factor import into nucleus (GO:0042993)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tyrosine phosphorylation of STAT protein (GO:0042531)|regulation of actin filament polymerization (GO:0030833)|regulation of transcription, DNA-templated (GO:0006355)|response to hormone (GO:0009725)	cytoplasm (GO:0005737)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	protein kinase binding (GO:0019901)|RNA polymerase II transcription factor binding (GO:0001085)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(13)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	35				GBM - Glioblastoma multiforme(114;0.0912)		tcaggctcTGCTTCGTACACT	0.597																																					p.A362P		Atlas-SNP	.											HCLS1,NS,carcinoma,0,1	HCLS1	78	.	0			c.G1084C						.						116.0	111.0	112.0					3																	121351335		2203	4300	6503	SO:0001583	missense	3059	exon12			GCTCTGCTTCGTA		CCDS3003.1	3q13	2007-08-03			ENSG00000180353	ENSG00000180353			4844	protein-coding gene	gene with protein product	"""cortactin-like"""	601306				8978766, 15710041	Standard	NM_001292041		Approved	HS1, CTTNL	uc003eeh.4	P14317	OTTHUMG00000159409	ENST00000314583.3:c.1084G>C	chr3.hg19:g.121351335C>G	ENSP00000320176:p.Ala362Pro	103.0	0.0		134.0	10.0	NM_005335	B4DQ69|Q53Y93|Q6IBK9|Q9UDK0	Missense_Mutation	SNP	ENST00000314583.3	hg19	CCDS3003.1	.	.	.	.	.	.	.	.	.	.	C	0.018	-1.474350	0.01044	.	.	ENSG00000180353	ENST00000314583;ENST00000428394	T;T	0.22743	1.95;1.94	5.06	1.08	0.20341	.	600.137000	0.00166	N	0.000000	T	0.10465	0.0256	N	0.04880	-0.145	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.20306	-1.0279	10	0.25106	T	0.35	2.8309	3.4017	0.07325	0.1646:0.4235:0.3199:0.0919	rs34277781	325;362	E7EVW7;P14317	.;HCLS1_HUMAN	P	362;325	ENSP00000320176:A362P;ENSP00000387645:A325P	ENSP00000320176:A362P	A	-	1	0	HCLS1	122834025	0.013000	0.17824	0.324000	0.25361	0.111000	0.19643	0.495000	0.22483	0.715000	0.32103	0.655000	0.94253	GCA	.	.		0.597	HCLS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355144.1	NM_005335	
KLF15	28999	hgsc.bcm.edu	37	3	126071499	126071499	+	Silent	SNP	G	G	A	rs376071138	byFrequency	TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr3:126071499G>A	ENST00000296233.3	-	2	497	c.267C>T	c.(265-267)ggC>ggT	p.G89G	KLF15_ENST00000509675.1_5'Flank	NM_014079.3	NP_054798.1	Q9UIH9	KLF15_HUMAN	Kruppel-like factor 15	89					cardiac muscle hypertrophy in response to stress (GO:0014898)|cellular response to peptide (GO:1901653)|glial cell differentiation (GO:0010001)|glomerular visceral epithelial cell differentiation (GO:0072112)|glucose transport (GO:0015758)|negative regulation of peptidyl-lysine acetylation (GO:2000757)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|transcription regulatory region DNA binding (GO:0044212)			endometrium(1)|lung(7)|ovary(2)|skin(2)	12				GBM - Glioblastoma multiforme(114;0.147)		CGCTGCCCCCGCCACTGCCCA	0.672													G|||	3	0.000599042	0.0	0.0043	5008	,	,		16334	0.0		0.0	False		,,,				2504	0.0				p.G89G		Atlas-SNP	.											.	KLF15	40	.	0			c.C267T						.	G		2,4374		0,2,2186	8.0	9.0	8.0		267	-6.8	0.0	3		8	2,8524		0,2,4261	no	coding-synonymous	KLF15	NM_014079.3		0,4,6447	AA,AG,GG		0.0235,0.0457,0.031		89/417	126071499	4,12898	2188	4263	6451	SO:0001819	synonymous_variant	28999	exon2			GCCCCCGCCACTG	AB029254	CCDS3036.1	3q21.3	2013-01-08			ENSG00000163884	ENSG00000163884		"""Kruppel-like transcription factors"", ""Zinc fingers, C2H2-type"""	14536	protein-coding gene	gene with protein product	"""kidney-enriched Kruppel-like factor"""	606465				10982849	Standard	NM_014079		Approved	KKLF	uc011bkk.1	Q9UIH9	OTTHUMG00000162689	ENST00000296233.3:c.267C>T	chr3.hg19:g.126071499G>A		64.0	0.0		130.0	60.0	NM_014079		Silent	SNP	ENST00000296233.3	hg19	CCDS3036.1																																																																																			.	.		0.672	KLF15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370096.1	NM_014079	
PODXL2	50512	hgsc.bcm.edu	37	3	127379378	127379378	+	Silent	SNP	A	A	G			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr3:127379378A>G	ENST00000342480.6	+	3	546	c.507A>G	c.(505-507)gaA>gaG	p.E169E		NM_015720.2	NP_056535.1	Q9NZ53	PDXL2_HUMAN	podocalyxin-like 2	169	Glu-rich.				leukocyte tethering or rolling (GO:0050901)	integral component of plasma membrane (GO:0005887)	glycosaminoglycan binding (GO:0005539)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(4)|lung(12)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	26						aggaagaggaagaggaggaga	0.552																																					p.E169E		Atlas-SNP	.											.	PODXL2	53	.	0			c.A507G						.						55.0	60.0	58.0					3																	127379378		2203	4300	6503	SO:0001819	synonymous_variant	50512	exon3			AGAGGAAGAGGAG	AF219137	CCDS3044.1	3q21.3	2005-02-18			ENSG00000114631	ENSG00000114631			17936	protein-coding gene	gene with protein product	"""endoglycan"""					10722749	Standard	NM_015720		Approved	PODLX2, endoglycan	uc003ejq.3	Q9NZ53	OTTHUMG00000159642	ENST00000342480.6:c.507A>G	chr3.hg19:g.127379378A>G		68.0	0.0		72.0	4.0	NM_015720	Q6UVY4|Q8WUV6	Silent	SNP	ENST00000342480.6	hg19	CCDS3044.1																																																																																			.	.		0.552	PODXL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356638.1	NM_015720	
TMCC1	23023	hgsc.bcm.edu	37	3	129546658	129546658	+	Silent	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr3:129546658T>C	ENST00000393238.3	-	3	904	c.564A>G	c.(562-564)ggA>ggG	p.G188G	TMCC1_ENST00000426664.2_Silent_p.G74G	NM_001017395.3	NP_001017395.2	O94876	TMCC1_HUMAN	transmembrane and coiled-coil domain family 1	188						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)			PLXND1/TMCC1(4)	breast(1)|endometrium(3)|large_intestine(8)|lung(12)|skin(1)	25						GCTCCGCAGTTCCCTCCTCTC	0.448																																					p.G188G		Atlas-SNP	.											.	TMCC1	105	.	0			c.A564G						.						44.0	46.0	45.0					3																	129546658		2203	4300	6503	SO:0001819	synonymous_variant	23023	exon3			CGCAGTTCCCTCC	AB018322	CCDS33855.1	3q21.3	2010-04-19	2005-07-13		ENSG00000172765	ENSG00000172765		"""Transmembrane and coiled-coil domain containing"""	29116	protein-coding gene	gene with protein product			"""transmembrane and coiled-coil domains 1"""			9872452	Standard	NR_033361		Approved	KIAA0779	uc021xdy.1	O94876	OTTHUMG00000159579	ENST00000393238.3:c.564A>G	chr3.hg19:g.129546658T>C		58.0	0.0		80.0	5.0	NM_001017395	A8K5Y3|B4DE04|Q68E06|Q8IXM8	Silent	SNP	ENST00000393238.3	hg19	CCDS33855.1																																																																																			.	.		0.448	TMCC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356418.2	NM_015008	
PIK3R4	30849	hgsc.bcm.edu	37	3	130449233	130449233	+	Silent	SNP	A	A	G			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr3:130449233A>G	ENST00000356763.3	-	5	2061	c.1504T>C	c.(1504-1506)Tta>Cta	p.L502L		NM_014602.2	NP_055417.1	Q99570	PI3R4_HUMAN	phosphoinositide-3-kinase, regulatory subunit 4	502					innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|protein phosphorylation (GO:0006468)|small molecule metabolic process (GO:0044281)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)	axoneme (GO:0005930)|cytosol (GO:0005829)|late endosome (GO:0005770)|membrane (GO:0016020)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(6)|kidney(6)|large_intestine(16)|lung(28)|ovary(6)|pancreas(1)|prostate(2)|skin(5)|stomach(1)|urinary_tract(1)	77						AGATTTTTTAACTGTACTAAT	0.303																																					p.L502L		Atlas-SNP	.											.	PIK3R4	145	.	0			c.T1504C						.						73.0	77.0	75.0					3																	130449233		2203	4296	6499	SO:0001819	synonymous_variant	30849	exon5			TTTTTAACTGTAC	Y08991	CCDS3067.1	3q22.1	2013-01-10	2008-02-04		ENSG00000196455	ENSG00000196455		"""WD repeat domain containing"""	8982	protein-coding gene	gene with protein product		602610				8999962	Standard	NM_014602		Approved	VPS15, p150	uc003enj.3	Q99570	OTTHUMG00000159645	ENST00000356763.3:c.1504T>C	chr3.hg19:g.130449233A>G		85.0	0.0		86.0	4.0	NM_014602	Q2TBF4	Silent	SNP	ENST00000356763.3	hg19	CCDS3067.1																																																																																			.	.		0.303	PIK3R4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356668.1	NM_014602	
SERPINI1	5274	hgsc.bcm.edu	37	3	167506954	167506954	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr3:167506954A>G	ENST00000295777.5	+	2	469	c.38A>G	c.(37-39)cAa>cGa	p.Q13R	SERPINI1_ENST00000446050.2_Missense_Mutation_p.Q13R	NM_005025.4	NP_005016.1	Q99574	NEUS_HUMAN	serpin peptidase inhibitor, clade I (neuroserpin), member 1	13					cell death (GO:0008219)|central nervous system development (GO:0007417)|negative regulation of endopeptidase activity (GO:0010951)|peripheral nervous system development (GO:0007422)|regulation of cell adhesion (GO:0030155)|regulation of proteolysis (GO:0030162)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	serine-type endopeptidase inhibitor activity (GO:0004867)			NS(1)|breast(1)|endometrium(2)|kidney(3)|large_intestine(4)|lung(7)|skin(2)	20						CTGGTTCTGCAAAGTATGGCT	0.368																																					p.Q13R		Atlas-SNP	.											.	SERPINI1	52	.	0			c.A38G						.						75.0	77.0	76.0					3																	167506954		2203	4300	6503	SO:0001583	missense	5274	exon2			TTCTGCAAAGTAT	Z81326	CCDS3203.1	3q26.1	2014-02-18	2005-08-18		ENSG00000163536	ENSG00000163536		"""Serine (or cysteine) peptidase inhibitors"""	8943	protein-coding gene	gene with protein product		602445	"""serine (or cysteine) proteinase inhibitor, clade I (neuroserpin), member 1"""	PI12		24172014	Standard	NM_005025		Approved	neuroserpin	uc003ffa.4	Q99574	OTTHUMG00000158450	ENST00000295777.5:c.38A>G	chr3.hg19:g.167506954A>G	ENSP00000295777:p.Gln13Arg	67.0	0.0		75.0	4.0	NM_005025	A8K217|D3DNP1|Q6AHZ4	Missense_Mutation	SNP	ENST00000295777.5	hg19	CCDS3203.1	.	.	.	.	.	.	.	.	.	.	A	1.702	-0.501211	0.04261	.	.	ENSG00000163536	ENST00000472941;ENST00000446050;ENST00000295777;ENST00000472747	T;D;D;T	0.83837	-0.98;-1.77;-1.77;-1.47	5.23	0.972	0.19704	Serpin domain (1);	0.645510	0.17376	N	0.176474	T	0.72819	0.3508	L	0.29908	0.895	0.80722	D	1	B	0.16802	0.019	B	0.16722	0.016	T	0.62272	-0.6889	10	0.24483	T	0.36	.	14.3299	0.66548	0.5344:0.4656:0.0:0.0	.	13	Q99574	NEUS_HUMAN	R	13	ENSP00000420133:Q13R;ENSP00000397373:Q13R;ENSP00000295777:Q13R;ENSP00000420561:Q13R	ENSP00000295777:Q13R	Q	+	2	0	SERPINI1	168989648	0.998000	0.40836	0.680000	0.29994	0.024000	0.10985	0.840000	0.27600	0.319000	0.23209	0.533000	0.62120	CAA	.	.		0.368	SERPINI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351056.1		
GOLIM4	27333	hgsc.bcm.edu	37	3	167747641	167747641	+	Missense_Mutation	SNP	C	C	G	rs550869030	byFrequency	TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr3:167747641C>G	ENST00000470487.1	-	10	2049	c.1360G>C	c.(1360-1362)Gtg>Ctg	p.V454L	GOLIM4_ENST00000309027.4_Missense_Mutation_p.V426L	NM_014498.3	NP_055313.1	O00461	GOLI4_HUMAN	golgi integral membrane protein 4	454	Gln-rich.|Glu-rich.				transport (GO:0006810)	cis-Golgi network (GO:0005801)|endocytic vesicle (GO:0030139)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)				breast(5)|endometrium(2)|large_intestine(8)|lung(26)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	47						TCTCTTGCCACctgctgctgc	0.637																																					p.V454L		Atlas-SNP	.											.,1	GOLIM4	71	.	0			c.G1360C						.						36.0	36.0	36.0					3																	167747641		2203	4300	6503	SO:0001583	missense	27333	exon10			TTGCCACCTGCTG	U55853	CCDS3204.1	3q26	2007-07-30	2007-07-30	2007-07-30	ENSG00000173905	ENSG00000173905			15448	protein-coding gene	gene with protein product		606805	"""golgi phosphoprotein 4"""	GOLPH4		9201717, 15004235	Standard	NM_014498		Approved	GPP130, GIMPC, P138	uc003ffe.2	O00461	OTTHUMG00000158554	ENST00000470487.1:c.1360G>C	chr3.hg19:g.167747641C>G	ENSP00000417354:p.Val454Leu	75.0	0.0		67.0	7.0	NM_014498		Missense_Mutation	SNP	ENST00000470487.1	hg19	CCDS3204.1	.	.	.	.	.	.	.	.	.	.	G	2.085	-0.409763	0.04799	.	.	ENSG00000173905	ENST00000470487;ENST00000309027	.	.	.	2.99	0.777	0.18538	.	1.358100	0.04855	N	0.443063	T	0.08268	0.0206	N	0.00237	-1.79	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.19257	-1.0311	9	0.25751	T	0.34	-0.0494	5.721	0.17986	0.0:0.4155:0.3727:0.2118	.	426;454	F8W785;O00461	.;GOLI4_HUMAN	L	454;426	.	ENSP00000309893:V426L	V	-	1	0	GOLIM4	169230335	0.153000	0.22777	1.000000	0.80357	0.639000	0.38242	2.640000	0.46579	0.120000	0.18254	-0.223000	0.12442	GTG	.	.		0.637	GOLIM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351278.2		
KLHL24	54800	hgsc.bcm.edu	37	3	183381420	183381420	+	Silent	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr3:183381420T>C	ENST00000454652.2	+	5	1481	c.1095T>C	c.(1093-1095)atT>atC	p.I365I	KLHL24_ENST00000476808.1_Silent_p.I365I|KLHL24_ENST00000242810.6_Silent_p.I365I	NM_017644.3	NP_060114.2	Q6TFL4	KLH24_HUMAN	kelch-like family member 24	365						cell projection (GO:0042995)|cytoplasm (GO:0005737)				NS(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(10)|ovary(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	27	all_cancers(143;2.88e-10)|Ovarian(172;0.0303)		all cancers(12;1.43e-42)|Epithelial(37;1.73e-36)|OV - Ovarian serous cystadenocarcinoma(80;8.75e-22)			GGAATGACATTCTTGTTTCAG	0.348																																					p.I365I		Atlas-SNP	.											.	KLHL24	56	.	0			c.T1095C						.						84.0	81.0	82.0					3																	183381420		2203	4300	6503	SO:0001819	synonymous_variant	54800	exon4			TGACATTCTTGTT		CCDS3246.1	3q27.1	2013-02-22	2013-02-22		ENSG00000114796	ENSG00000114796		"""Kelch-like"", ""BTB/POZ domain containing"""	25947	protein-coding gene	gene with protein product		611295	"""kelch-like 24 (Drosophila)"""				Standard	XM_005247552		Approved	DRE1, FLJ20059	uc003flv.3	Q6TFL4	OTTHUMG00000156911	ENST00000454652.2:c.1095T>C	chr3.hg19:g.183381420T>C		95.0	0.0		71.0	4.0	NM_017644	A5PLN8|Q9H620|Q9NXT9	Silent	SNP	ENST00000454652.2	hg19	CCDS3246.1																																																																																			.	.		0.348	KLHL24-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346586.2	NM_017644	
FBXL5	26234	hgsc.bcm.edu	37	4	15629615	15629615	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr4:15629615T>C	ENST00000341285.3	-	7	1058	c.934A>G	c.(934-936)Atg>Gtg	p.M312V	FBXL5_ENST00000412094.2_Missense_Mutation_p.M295V|FBXL5_ENST00000382358.4_Missense_Mutation_p.M186V	NM_001193534.1|NM_001193535.1|NM_012161.3	NP_001180463.1|NP_001180464.1|NP_036293.1	Q9UKA1	FBXL5_HUMAN	F-box and leucine-rich repeat protein 5	312					iron ion homeostasis (GO:0055072)|protein ubiquitination (GO:0016567)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)	perinuclear region of cytoplasm (GO:0048471)|SCF ubiquitin ligase complex (GO:0019005)|ubiquitin ligase complex (GO:0000151)	iron ion binding (GO:0005506)|ubiquitin-protein transferase activity (GO:0004842)			endometrium(2)|large_intestine(3)|lung(5)|ovary(1)|pancreas(1)|prostate(1)	13						CGTTTTTCCATTTGTGCAATG	0.353																																					p.M312V		Atlas-SNP	.											.	FBXL5	52	.	0			c.A934G						.						133.0	120.0	124.0					4																	15629615		2202	4300	6502	SO:0001583	missense	26234	exon7			TTTCCATTTGTGC	AF174591	CCDS3415.1, CCDS54745.1	4p15.33	2011-06-09			ENSG00000118564	ENSG00000118564		"""F-boxes / Leucine-rich repeats"""	13602	protein-coding gene	gene with protein product		605655				10531035	Standard	NM_012161		Approved	FBL4, FBL5, FLR1	uc003goc.2	Q9UKA1	OTTHUMG00000097097	ENST00000341285.3:c.934A>G	chr4.hg19:g.15629615T>C	ENSP00000344866:p.Met312Val	86.0	0.0		82.0	4.0	NM_012161	A8MSK4|B4DIB5|Q4W5A8|Q8NHP3|Q9NXN2|Q9P0I0|Q9P0X5|Q9UJT7|Q9UKC8	Missense_Mutation	SNP	ENST00000341285.3	hg19	CCDS3415.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	12.92|12.92	2.082100|2.082100	0.36758|0.36758	.|.	.|.	ENSG00000118564|ENSG00000118564	ENST00000341285;ENST00000412094;ENST00000382358|ENST00000513163	T;T;T|.	0.28069|.	1.63;1.63;1.63|.	5.63|5.63	5.63|5.63	0.86233|0.86233	.|.	0.130156|.	0.64402|.	D|.	0.000005|.	T|T	0.36690|0.36690	0.0976|0.0976	N|N	0.22421|0.22421	0.69|0.69	0.29150|0.29150	N|N	0.87841|0.87841	B;B|.	0.22480|.	0.07;0.042|.	B;B|.	0.21151|.	0.033;0.015|.	T|T	0.29882|0.29882	-0.9997|-0.9997	10|5	0.20046|.	T|.	0.44|.	-9.9694|-9.9694	14.4046|14.4046	0.67073|0.67073	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	295;312|.	Q9UKA1-2;Q9UKA1|.	.;FBXL5_HUMAN|.	V|S	312;295;186|232	ENSP00000344866:M312V;ENSP00000408679:M295V;ENSP00000371795:M186V|.	ENSP00000344866:M312V|.	M|N	-|-	1|2	0|0	FBXL5|FBXL5	15238713|15238713	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.992000|0.992000	0.81027|0.81027	3.413000|3.413000	0.52686|0.52686	2.138000|2.138000	0.66242|0.66242	0.377000|0.377000	0.23210|0.23210	ATG|AAT	.	.		0.353	FBXL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214235.2		
CORIN	10699	hgsc.bcm.edu	37	4	47685795	47685795	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr4:47685795C>T	ENST00000273857.4	-	7	973	c.974G>A	c.(973-975)tGt>tAt	p.C325Y	CORIN_ENST00000505909.1_Missense_Mutation_p.C325Y|CORIN_ENST00000504584.1_Missense_Mutation_p.C325Y|CORIN_ENST00000502252.1_Missense_Mutation_p.C258Y|CORIN_ENST00000508498.1_Missense_Mutation_p.C186Y	NM_006587.2	NP_006578.2	Q9Y5Q5	CORIN_HUMAN	corin, serine peptidase	325	LDL-receptor class A 2. {ECO:0000255|PROSITE-ProRule:PRU00124}.				female pregnancy (GO:0007565)|peptide hormone processing (GO:0016486)|proteolysis (GO:0006508)|regulation of blood pressure (GO:0008217)|regulation of renal sodium excretion (GO:0035813)|regulation of systemic arterial blood pressure by atrial natriuretic peptide (GO:0003050)	cell surface (GO:0009986)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	serine-type endopeptidase activity (GO:0004252)|serine-type exopeptidase activity (GO:0070008)			NS(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(18)|lung(39)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)	79						ATATCCATCACACACAAGGCT	0.398																																					p.C325Y		Atlas-SNP	.											.	CORIN	154	.	0			c.G974A						.						131.0	123.0	126.0					4																	47685795		2203	4300	6503	SO:0001583	missense	10699	exon7			CCATCACACACAA	AF133845	CCDS3477.1, CCDS63958.1, CCDS75122.1	4p13-p12	2011-08-31	2005-08-17		ENSG00000145244	ENSG00000145244		"""Serine peptidases / Transmembrane"""	19012	protein-coding gene	gene with protein product		605236	"""corin, serine protease"""			10329693	Standard	NM_006587		Approved	PRSC, CRN, ATC2, Lrp4, TMPRSS10	uc003gxm.3	Q9Y5Q5	OTTHUMG00000099441	ENST00000273857.4:c.974G>A	chr4.hg19:g.47685795C>T	ENSP00000273857:p.Cys325Tyr	60.0	0.0		67.0	4.0	NM_006587	B0ZBE3|Q2TBD2|Q4W5E5|Q4W5G6|Q9UHY2	Missense_Mutation	SNP	ENST00000273857.4	hg19	CCDS3477.1	.	.	.	.	.	.	.	.	.	.	C	26.7	4.759066	0.89843	.	.	ENSG00000145244	ENST00000273857;ENST00000508498;ENST00000502252;ENST00000505909;ENST00000504584	D;D;D;D;D	0.99755	-6.64;-6.64;-6.64;-6.64;-6.64	5.83	5.83	0.93111	Low-density lipoprotein (LDL) receptor class A, conserved site (1);	0.000000	0.85682	D	0.000000	D	0.99900	0.9952	H	0.98738	4.315	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	0.999;0.999;1.0;1.0;1.0	D	0.96361	0.9266	10	0.87932	D	0	.	20.1133	0.97917	0.0:1.0:0.0:0.0	.	325;325;258;186;325	B7Z4R1;B4E2W9;B4E1Y7;B4DZA3;Q9Y5Q5	.;.;.;.;CORIN_HUMAN	Y	325;186;258;325;325	ENSP00000273857:C325Y;ENSP00000425597:C186Y;ENSP00000424212:C258Y;ENSP00000425401:C325Y;ENSP00000423216:C325Y	ENSP00000273857:C325Y	C	-	2	0	CORIN	47380552	1.000000	0.71417	0.998000	0.56505	0.979000	0.70002	7.163000	0.77524	2.762000	0.94881	0.591000	0.81541	TGT	.	.		0.398	CORIN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216906.2		
FRYL	285527	hgsc.bcm.edu	37	4	48545872	48545872	+	Silent	SNP	A	A	G			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr4:48545872A>G	ENST00000503238.1	-	41	5543	c.5544T>C	c.(5542-5544)gtT>gtC	p.V1848V	FRYL_ENST00000537810.1_Silent_p.V1848V|FRYL_ENST00000264319.7_5'UTR|FRYL_ENST00000358350.4_Silent_p.V1848V|FRYL_ENST00000507873.2_5'UTR			O94915	FRYL_HUMAN	FRY-like	1848					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)					breast(2)|central_nervous_system(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(21)|lung(38)|ovary(1)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	91						GTCTGGAGAGAACATCAGAAA	0.443																																					p.V1848V		Atlas-SNP	.											.	FRYL	242	.	0			c.T5544C						.						90.0	88.0	89.0					4																	48545872		1866	4109	5975	SO:0001819	synonymous_variant	285527	exon44			GGAGAGAACATCA	AL833170	CCDS43227.1	4p12	2011-08-03	2006-11-17	2005-11-24	ENSG00000075539	ENSG00000075539			29127	protein-coding gene	gene with protein product			"""KIAA0826"", ""furry homolog-like (Drosophila)"""	KIAA0826		10048485	Standard	NM_015030		Approved	DKFZp686E205	uc003gyh.1	O94915	OTTHUMG00000160608	ENST00000503238.1:c.5544T>C	chr4.hg19:g.48545872A>G		68.0	0.0		90.0	4.0	NM_015030	O95640|Q8WTZ5|Q9NT40	Silent	SNP	ENST00000503238.1	hg19	CCDS43227.1	.	.	.	.	.	.	.	.	.	.	A	8.997	0.979145	0.18812	.	.	ENSG00000075539	ENST00000514617	.	.	.	5.46	-1.56	0.08532	.	.	.	.	.	T	0.49847	0.1581	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.41016	-0.9532	4	.	.	.	.	5.3753	0.16162	0.5375:0.2533:0.2092:0.0	.	.	.	.	P	718	.	.	S	-	1	0	FRYL	48240629	1.000000	0.71417	0.997000	0.53966	0.778000	0.44026	0.968000	0.29357	-0.088000	0.12506	0.533000	0.62120	TCT	.	.		0.443	FRYL-011	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000369265.2		
FIP1L1	81608	hgsc.bcm.edu	37	4	54265931	54265931	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr4:54265931A>G	ENST00000337488.6	+	10	934	c.740A>G	c.(739-741)gAa>gGa	p.E247G	FIP1L1_ENST00000507922.1_Missense_Mutation_p.E232G|FIP1L1_ENST00000507166.1_Missense_Mutation_p.E247G|FIP1L1_ENST00000358575.5_Missense_Mutation_p.E232G|FIP1L1_ENST00000306932.6_Missense_Mutation_p.E209G	NM_030917.3	NP_112179.2	Q6UN15	FIP1_HUMAN	factor interacting with PAPOLA and CPSF1	247	Necessary for stimulating PAPOLA activity.				mRNA processing (GO:0006397)	mRNA cleavage and polyadenylation specificity factor complex (GO:0005847)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			large_intestine(3)|liver(1)|ovary(1)|skin(1)	6			GBM - Glioblastoma multiforme(3;3.31e-36)|LUSC - Lung squamous cell carcinoma(32;0.0134)			TCAGAGAAAGAAACTGCCCTT	0.373			T	PDGFRA	idiopathic hypereosinophilic syndrome																																p.E247G		Atlas-SNP	.		Dom	yes		4	4q12	81608	FIP1 like 1 (S. cerevisiae)		L	.	FIP1L1	60	.	0			c.A740G						.						169.0	163.0	165.0					4																	54265931		2203	4300	6503	SO:0001583	missense	81608	exon10			AGAAAGAAACTGC	AF161429	CCDS3491.1, CCDS47055.1, CCDS47056.1	4q12	2013-06-18	2013-06-18		ENSG00000145216	ENSG00000145216			19124	protein-coding gene	gene with protein product		607686	"""FIP1 like 1 (S. cerevisiae)"", ""FIP1L1 cleavage and polyadenylation specific factor subunit"""			11230166, 14749727	Standard	NM_030917		Approved	DKFZp586K0717, FIP1	uc003hae.3	Q6UN15	OTTHUMG00000128701	ENST00000337488.6:c.740A>G	chr4.hg19:g.54265931A>G	ENSP00000336752:p.Glu247Gly	108.0	0.0		87.0	5.0	NM_030917	B4DIR3|G3XAD6|Q0VGE0|Q499Y4|Q49AU3|Q7Z608|Q8WVN3|Q96F80|Q9H077	Missense_Mutation	SNP	ENST00000337488.6	hg19	CCDS3491.1	.	.	.	.	.	.	.	.	.	.	A	24.5	4.539816	0.85917	.	.	ENSG00000145216	ENST00000337488;ENST00000358575;ENST00000507922;ENST00000306932;ENST00000507166	T;T;T;T;T	0.51071	0.72;0.72;0.72;0.72;0.72	5.38	5.38	0.77491	.	0.068969	0.64402	D	0.000013	T	0.58595	0.2133	L	0.43152	1.355	0.58432	D	0.99999	D;D;D;D;D;D	0.69078	0.994;0.997;0.99;0.969;0.983;0.983	P;D;P;P;P;P	0.64687	0.854;0.928;0.718;0.723;0.791;0.858	T	0.54938	-0.8218	10	0.32370	T	0.25	-13.739	15.6962	0.77502	1.0:0.0:0.0:0.0	.	232;51;232;209;247;232	G3XAD6;B4DTW7;B4DIR3;Q6UN15-3;Q6UN15;Q6UN15-4	.;.;.;.;FIP1_HUMAN;.	G	247;232;232;209;247	ENSP00000336752:E247G;ENSP00000351383:E232G;ENSP00000425456:E232G;ENSP00000302993:E209G;ENSP00000423325:E247G	ENSP00000302993:E209G	E	+	2	0	FIP1L1	53960688	1.000000	0.71417	0.992000	0.48379	0.963000	0.63663	5.426000	0.66476	2.168000	0.68352	0.533000	0.62120	GAA	.	.		0.373	FIP1L1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000250602.1	NM_030917	
LPHN3	23284	hgsc.bcm.edu	37	4	62936570	62936570	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr4:62936570G>A	ENST00000514591.1	+	25	4683	c.4354G>A	c.(4354-4356)Ggg>Agg	p.G1452R	LPHN3_ENST00000504896.1_3'UTR|LPHN3_ENST00000514157.1_3'UTR|LPHN3_ENST00000512091.2_3'UTR|LPHN3_ENST00000511324.1_3'UTR|LPHN3_ENST00000506720.1_Missense_Mutation_p.G1563R|RP11-84A1.3_ENST00000509461.1_RNA|LPHN3_ENST00000508693.1_3'UTR|LPHN3_ENST00000508946.1_Missense_Mutation_p.G1495R|LPHN3_ENST00000507625.1_Missense_Mutation_p.G1511R|RP11-84A1.3_ENST00000506704.1_RNA|LPHN3_ENST00000509896.1_3'UTR|LPHN3_ENST00000514996.1_Missense_Mutation_p.G1486R|LPHN3_ENST00000506746.1_Missense_Mutation_p.G1554R|LPHN3_ENST00000507164.1_3'UTR|RP11-84A1.3_ENST00000504135.1_RNA|LPHN3_ENST00000506700.1_3'UTR|LPHN3_ENST00000545650.1_Missense_Mutation_p.G1452R			Q9HAR2	LPHN3_HUMAN	latrophilin 3	1430					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|G-protein coupled receptor activity (GO:0004930)			breast(5)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(5)|kidney(4)|large_intestine(21)|lung(73)|ovary(1)|pancreas(1)|prostate(6)|upper_aerodigestive_tract(1)	125						AAACAAAGATGGGACCCCTCC	0.483																																					p.G1452R		Atlas-SNP	.											.	LPHN3	800	.	0			c.G4354A						.						62.0	60.0	61.0					4																	62936570		692	1591	2283	SO:0001583	missense	23284	exon23			AAAGATGGGACCC	AB018311	CCDS54768.1	4q13.1	2014-08-08				ENSG00000150471		"""-"", ""GPCR / Class B : Orphans"""	20974	protein-coding gene	gene with protein product						10994649	Standard	NM_015236		Approved	KIAA0768, LEC3	uc010ihh.3	Q9HAR2		ENST00000514591.1:c.4354G>A	chr4.hg19:g.62936570G>A	ENSP00000422533:p.Gly1452Arg	90.0	0.0		83.0	32.0	NM_015236	E9PE04|O94867|Q9NWK5	Missense_Mutation	SNP	ENST00000514591.1	hg19	CCDS54768.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	19.69|19.69	3.874474|3.874474	0.72180|0.72180	.|.	.|.	ENSG00000150471|ENSG00000150471	ENST00000514591;ENST00000545650;ENST00000295349;ENST00000507625;ENST00000508946;ENST00000506720;ENST00000506746;ENST00000514996|ENST00000502815	T;T;T;T;T;T;T|.	0.71698|.	-0.57;-0.57;-0.59;-0.54;-0.55;-0.55;-0.54|.	5.5|5.5	5.5|5.5	0.81552|0.81552	GPCR, family 2, latrophilin, C-terminal (1);|.	0.112670|.	0.64402|.	D|.	0.000010|.	T|.	0.68540|.	0.3012|.	L|L	0.43923|0.43923	1.385|1.385	0.54753|0.54753	D|D	0.999981|0.999981	D;D|.	0.62365|.	0.966;0.991|.	P;D|.	0.64877|.	0.837;0.93|.	T|.	0.63730|.	-0.6571|.	10|.	0.87932|.	D|.	0|.	.|.	19.4053|19.4053	0.94646|0.94646	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	1452;1430|.	E9PE04;Q9HAR2|.	.;LPHN3_HUMAN|.	R|X	1452;1452;1430;1511;1495;1563;1554;1486|900	ENSP00000422533:G1452R;ENSP00000439831:G1452R;ENSP00000421372:G1511R;ENSP00000421627:G1495R;ENSP00000420931:G1563R;ENSP00000425884:G1554R;ENSP00000424258:G1486R|.	ENSP00000295349:G1430R|.	G|W	+|+	1|2	0|0	LPHN3|LPHN3	62619165|62619165	1.000000|1.000000	0.71417|0.71417	0.993000|0.993000	0.49108|0.49108	0.990000|0.990000	0.78478|0.78478	9.416000|9.416000	0.97383|0.97383	2.607000|2.607000	0.88179|0.88179	0.591000|0.591000	0.81541|0.81541	GGG|TGG	.	.		0.483	LPHN3-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000361765.1		
MTHFD2L	441024	hgsc.bcm.edu	37	4	75023925	75023925	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr4:75023925A>G	ENST00000395759.2	+	1	97	c.70A>G	c.(70-72)Agc>Ggc	p.S24G	MTHFD2L_ENST00000331145.6_5'UTR|MTHFD2L_ENST00000325278.6_5'UTR|AC093677.1_ENST00000600169.1_Missense_Mutation_p.L54P|MTHFD2L_ENST00000461101.1_3'UTR|MTHFD2L_ENST00000433372.1_Intron	NM_001144978.1	NP_001138450.1	Q9H903	MTD2L_HUMAN	methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2-like	24					folic acid-containing compound biosynthetic process (GO:0009396)|histidine biosynthetic process (GO:0000105)|methionine biosynthetic process (GO:0009086)|one-carbon metabolic process (GO:0006730)|purine nucleotide biosynthetic process (GO:0006164)|tetrahydrofolate interconversion (GO:0035999)	mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	methenyltetrahydrofolate cyclohydrolase activity (GO:0004477)|methylenetetrahydrofolate dehydrogenase (NAD+) activity (GO:0004487)|methylenetetrahydrofolate dehydrogenase (NADP+) activity (GO:0004488)			central_nervous_system(1)|endometrium(1)|lung(4)|ovary(2)	8			all cancers(17;0.0101)|Lung(101;0.196)			GTTGGGCAGAAGCACAGCACC	0.746																																					p.S24G		Atlas-SNP	.											.	MTHFD2L	41	.	0			c.A70G						.						7.0	12.0	11.0					4																	75023925		673	1565	2238	SO:0001583	missense	441024	exon1			GGCAGAAGCACAG	BC065771	CCDS47075.1	4q13.3	2011-08-03			ENSG00000163738	ENSG00000163738			31865	protein-coding gene	gene with protein product		614047				21163947	Standard	NM_001144978		Approved	MGC72244	uc011cbk.2	Q9H903	OTTHUMG00000157135	ENST00000395759.2:c.70A>G	chr4.hg19:g.75023925A>G	ENSP00000379108:p.Ser24Gly	36.0	0.0		101.0	5.0	NM_001144978	Q6P079|Q8N560	Missense_Mutation	SNP	ENST00000395759.2	hg19	CCDS47075.1	.	.	.	.	.	.	.	.	.	.	A	9.307	1.054588	0.19907	.	.	ENSG00000163738	ENST00000395759	T	0.22945	1.93	2.18	-3.69	0.04450	Tetrahydrofolate dehydrogenase/cyclohydrolase, catalytic domain (1);	.	.	.	.	T	0.12050	0.0293	N	0.22421	0.69	0.09310	N	0.999992	B;B	0.02656	0.0;0.0	B;B	0.04013	0.0;0.001	T	0.36890	-0.9729	9	0.13853	T	0.58	.	5.2508	0.15521	0.2217:0.2008:0.5775:0.0	.	24;24	Q9H903;Q9H903-5	MTD2L_HUMAN;.	G	24	ENSP00000379108:S24G	ENSP00000379108:S24G	S	+	1	0	MTHFD2L	75242789	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-1.155000	0.03163	-0.982000	0.03515	-0.334000	0.08254	AGC	.	.		0.746	MTHFD2L-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001004346	
ART3	419	hgsc.bcm.edu	37	4	77003153	77003153	+	Silent	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr4:77003153T>C	ENST00000355810.4	+	3	365	c.246T>C	c.(244-246)acT>acC	p.T82T	ART3_ENST00000349321.3_Silent_p.T82T|ART3_ENST00000341029.5_Silent_p.T82T|ART3_ENST00000513494.1_3'UTR	NM_001130016.2	NP_001123488.1	Q13508	NAR3_HUMAN	ADP-ribosyltransferase 3	82					protein ADP-ribosylation (GO:0006471)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	NAD(P)+-protein-arginine ADP-ribosyltransferase activity (GO:0003956)|NAD+ ADP-ribosyltransferase activity (GO:0003950)			autonomic_ganglia(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(2)|stomach(1)	16			Lung(101;0.0809)|LUSC - Lung squamous cell carcinoma(112;0.0934)			CCCGAAAGACTCAAATCTTTC	0.418																																					p.T82T		Atlas-SNP	.											.	ART3	34	.	0			c.T246C						.						77.0	78.0	78.0					4																	77003153		2203	4300	6503	SO:0001819	synonymous_variant	419	exon3			AAAGACTCAAATC	X95827	CCDS3575.1, CCDS47079.1, CCDS47080.1	4q21.1	2008-05-15			ENSG00000156219	ENSG00000156219			725	protein-coding gene	gene with protein product		603086				9119374	Standard	NM_001130017		Approved		uc003hjo.3	Q13508	OTTHUMG00000130110	ENST00000355810.4:c.246T>C	chr4.hg19:g.77003153T>C		62.0	0.0		61.0	4.0	NM_001130017	Q53XW3|Q6FHT7|Q8WVJ7|Q93069|Q96HL1	Silent	SNP	ENST00000355810.4	hg19	CCDS47079.1																																																																																			.	.		0.418	ART3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252416.2	NM_001179	
SHROOM3	57619	hgsc.bcm.edu	37	4	77663055	77663055	+	Silent	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr4:77663055T>C	ENST00000296043.6	+	5	4682	c.3729T>C	c.(3727-3729)tcT>tcC	p.S1243S		NM_020859.3	NP_065910.3	Q8TF72	SHRM3_HUMAN	shroom family member 3	1243					actin cytoskeleton organization (GO:0030036)|apical protein localization (GO:0045176)|cell morphogenesis (GO:0000902)|cellular pigment accumulation (GO:0043482)|columnar/cuboidal epithelial cell development (GO:0002066)|neural tube closure (GO:0001843)|pattern specification process (GO:0007389)|regulation of cell shape (GO:0008360)	adherens junction (GO:0005912)|apical junction complex (GO:0043296)|apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|microtubule (GO:0005874)				NS(3)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(10)|kidney(2)|large_intestine(6)|lung(29)|ovary(1)|skin(5)|upper_aerodigestive_tract(1)	60			Lung(101;0.0903)			CCAGGTCATCTCCCGCCACCG	0.662																																					p.S1243S		Atlas-SNP	.											.	SHROOM3	134	.	0			c.T3729C						.						21.0	19.0	20.0					4																	77663055		2170	4244	6414	SO:0001819	synonymous_variant	57619	exon5			GTCATCTCCCGCC	AB055660	CCDS3579.2	4q21.1	2009-11-25			ENSG00000138771	ENSG00000138771			30422	protein-coding gene	gene with protein product		604570				10589677, 16615870	Standard	NM_020859		Approved	ShrmL, SHRM, KIAA1481, APXL3	uc011cbx.2	Q8TF72	OTTHUMG00000157075	ENST00000296043.6:c.3729T>C	chr4.hg19:g.77663055T>C		148.0	0.0		153.0	8.0	NM_020859	Q5QTQ3|Q6ZRW3|Q96IR9|Q9P247	Silent	SNP	ENST00000296043.6	hg19	CCDS3579.2																																																																																			.	.		0.662	SHROOM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252408.2	NM_020859	
MMRN1	22915	hgsc.bcm.edu	37	4	90844418	90844418	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr4:90844418A>G	ENST00000394980.1	+	5	1269	c.950A>G	c.(949-951)gAc>gGc	p.D317G	MMRN1_ENST00000264790.2_Missense_Mutation_p.D317G|MMRN1_ENST00000394981.1_Missense_Mutation_p.D283G|MMRN1_ENST00000508372.1_Missense_Mutation_p.D59G			Q13201	MMRN1_HUMAN	multimerin 1	317					blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	extracellular region (GO:0005576)|platelet alpha granule lumen (GO:0031093)				breast(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(12)|liver(2)|lung(34)|ovary(5)|prostate(1)|skin(6)|stomach(1)|urinary_tract(2)	72		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;6.96e-05)		GGCTGTGGTGACCCAGGTCAT	0.433																																					p.D317G		Atlas-SNP	.											.	MMRN1	174	.	0			c.A950G						.						159.0	160.0	160.0					4																	90844418		2203	4300	6503	SO:0001583	missense	22915	exon4			GTGGTGACCCAGG	U27109	CCDS3635.1	4q22	2008-02-05	2004-03-02	2004-03-02	ENSG00000138722	ENSG00000138722		"""EMI domain containing"""	7178	protein-coding gene	gene with protein product	"""glycoprotein Ia*"""	601456	"""multimerin"""	MMRN		7629143, 10828608	Standard	NM_007351		Approved	ECM, EMILIN4, GPIa*	uc003hst.3	Q13201	OTTHUMG00000130947	ENST00000394980.1:c.950A>G	chr4.hg19:g.90844418A>G	ENSP00000378431:p.Asp317Gly	118.0	0.0		123.0	5.0	NM_007351	Q4W5L1|Q6P3T8|Q6ZUL9	Missense_Mutation	SNP	ENST00000394980.1	hg19	CCDS3635.1	.	.	.	.	.	.	.	.	.	.	A	14.26	2.481750	0.44147	.	.	ENSG00000138722	ENST00000394980;ENST00000264790;ENST00000394981;ENST00000508372	T;T;T;T	0.73363	0.06;0.06;-0.74;-0.34	5.36	4.17	0.49024	.	0.304283	0.31507	N	0.007531	T	0.67249	0.2873	L	0.53249	1.67	0.25111	N	0.990715	B;B	0.17268	0.021;0.012	B;B	0.19946	0.027;0.004	T	0.58912	-0.7552	10	0.42905	T	0.14	.	8.5906	0.33686	0.8417:0.0:0.1583:0.0	.	283;317	Q13201-2;Q13201	.;MMRN1_HUMAN	G	317;317;283;59	ENSP00000378431:D317G;ENSP00000264790:D317G;ENSP00000378432:D283G;ENSP00000426461:D59G	ENSP00000264790:D317G	D	+	2	0	MMRN1	91063441	0.990000	0.36364	0.878000	0.34440	0.889000	0.51656	2.647000	0.46639	1.120000	0.41904	0.482000	0.46254	GAC	.	.		0.433	MMRN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253546.2	NM_007351	
GSTCD	79807	hgsc.bcm.edu	37	4	106650634	106650634	+	Silent	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr4:106650634T>C	ENST00000515279.1	+	5	1438	c.1218T>C	c.(1216-1218)ccT>ccC	p.P406P	GSTCD_ENST00000360505.5_Silent_p.P406P|GSTCD_ENST00000507281.1_Silent_p.P319P|GSTCD_ENST00000394728.3_Silent_p.P406P|GSTCD_ENST00000394730.3_Silent_p.P319P|GSTCD_ENST00000515255.1_3'UTR			Q8NEC7	GSTCD_HUMAN	glutathione S-transferase, C-terminal domain containing	406						extracellular vesicular exosome (GO:0070062)				breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(5)|lung(2)|ovary(1)|skin(1)	14		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;3.15e-07)|READ - Rectum adenocarcinoma(30;0.139)		ATGTTCTCCCTGCAGCAGTCA	0.383																																					p.P406P		Atlas-SNP	.											.	GSTCD	69	.	0			c.T1218C						.						103.0	103.0	103.0					4																	106650634		2203	4300	6503	SO:0001819	synonymous_variant	79807	exon5			TCTCCCTGCAGCA	BC032942	CCDS3672.2, CCDS43257.1	4q24	2008-02-05	2006-05-09		ENSG00000138780	ENSG00000138780			25806	protein-coding gene	gene with protein product		615912	"""Glutathione S-transferase, C-terminal domain containing"""			12477932	Standard	NM_001031720		Approved	FLJ13273	uc003hxz.4	Q8NEC7	OTTHUMG00000131211	ENST00000515279.1:c.1218T>C	chr4.hg19:g.106650634T>C		96.0	0.0		95.0	4.0	NM_001031720	A8K8J0|A8MVD3|H9KV97|Q9H8S3	Silent	SNP	ENST00000515279.1	hg19	CCDS43257.1																																																																																			.	.		0.383	GSTCD-006	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363981.1	NM_024751	
NAF1	92345	hgsc.bcm.edu	37	4	164058390	164058390	+	Silent	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr4:164058390T>C	ENST00000274054.2	-	6	1084	c.891A>G	c.(889-891)tcA>tcG	p.S297S	NAF1_ENST00000509434.1_Silent_p.S25S|NAF1_ENST00000422287.2_Silent_p.S297S	NM_138386.2	NP_612395.2	Q96HR8	NAF1_HUMAN	nuclear assembly factor 1 ribonucleoprotein	297					pseudouridine synthesis (GO:0001522)|ribosome biogenesis (GO:0042254)|rRNA processing (GO:0006364)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|small nucleolar ribonucleoprotein complex (GO:0005732)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			NS(1)|autonomic_ganglia(1)|endometrium(3)|kidney(3)|large_intestine(1)|lung(10)|ovary(2)	21	all_hematologic(180;0.166)	Prostate(90;0.109)				ATGATGCATCTGATCCCTTAT	0.353																																					p.S297S		Atlas-SNP	.											.	NAF1	69	.	0			c.A891G						.						103.0	96.0	99.0					4																	164058390		2203	4300	6503	SO:0001819	synonymous_variant	92345	exon6			TGCATCTGATCCC		CCDS3803.1, CCDS47159.1	4q32.2	2013-03-05	2013-03-05			ENSG00000145414			25126	protein-coding gene	gene with protein product			"""nuclear assembly factor 1 homolog (S. cerevisiae)"""			16618814, 16601202	Standard	NM_138386		Approved		uc003iqj.3	Q96HR8		ENST00000274054.2:c.891A>G	chr4.hg19:g.164058390T>C		144.0	0.0		69.0	4.0	NM_138386	D3DP28|E9PAZ2	Silent	SNP	ENST00000274054.2	hg19	CCDS3803.1																																																																																			.	.		0.353	NAF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000364684.2	NM_138386	
CEP44	80817	hgsc.bcm.edu	37	4	175224972	175224972	+	Missense_Mutation	SNP	A	A	G	rs143573166		TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr4:175224972A>G	ENST00000503780.1	+	5	770	c.356A>G	c.(355-357)aAg>aGg	p.K119R	CEP44_ENST00000457424.2_Missense_Mutation_p.K119R|CEP44_ENST00000426172.1_Missense_Mutation_p.K119R|CEP44_ENST00000296519.4_Missense_Mutation_p.K119R	NM_001040157.2	NP_001035247.1	Q9C0F1	CEP44_HUMAN	centrosomal protein 44kDa	119						centrosome (GO:0005813)|cytoplasm (GO:0005737)|midbody (GO:0030496)|spindle pole (GO:0000922)				endometrium(2)|large_intestine(4)|lung(5)|stomach(1)	12						GTGATGAAAAAGCACAAGGAA	0.279																																					p.K119R		Atlas-SNP	.											.	CEP44	35	.	0			c.A356G						.						71.0	74.0	73.0					4																	175224972		2202	4300	6502	SO:0001583	missense	80817	exon5			TGAAAAAGCACAA	AB051499	CCDS34106.1, CCDS47163.1	4q34	2014-02-20	2011-05-06	2011-05-06	ENSG00000164118	ENSG00000164118			29356	protein-coding gene	gene with protein product			"""KIAA1712"""	KIAA1712		21399614	Standard	NM_001040157		Approved		uc010iro.2	Q9C0F1	OTTHUMG00000160752	ENST00000503780.1:c.356A>G	chr4.hg19:g.175224972A>G	ENSP00000423153:p.Lys119Arg	166.0	0.0		96.0	4.0	NM_001040157	A8K8W9|A8MW11|B3KT53|D3DP42|Q8IXZ4	Missense_Mutation	SNP	ENST00000503780.1	hg19	CCDS34106.1	.	.	.	.	.	.	.	.	.	.	A	13.52	2.261564	0.39995	.	.	ENSG00000164118	ENST00000503780;ENST00000457424;ENST00000515299;ENST00000503053;ENST00000426172;ENST00000296519	T;T;T;T;T	0.50548	0.77;0.74;0.81;0.74;0.77	5.61	4.43	0.53597	.	0.049693	0.85682	D	0.000000	T	0.35068	0.0919	L	0.37897	1.145	0.42321	D	0.992254	P;P	0.45474	0.859;0.859	B;B	0.40782	0.34;0.34	T	0.08659	-1.0711	10	0.27082	T	0.32	.	9.4081	0.38473	0.8643:0.0:0.1357:0.0	.	119;119	Q9C0F1-2;Q9C0F1	.;CEP44_HUMAN	R	119	ENSP00000423153:K119R;ENSP00000389427:K119R;ENSP00000421128:K119R;ENSP00000408221:K119R;ENSP00000296519:K119R	ENSP00000296519:K119R	K	+	2	0	CEP44	175461547	1.000000	0.71417	1.000000	0.80357	0.824000	0.46624	3.650000	0.54424	2.263000	0.75096	0.528000	0.53228	AAG	.	A|1.000;C|0.000		0.279	CEP44-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362109.2	NM_030633	
SORBS2	8470	hgsc.bcm.edu	37	4	186544675	186544675	+	Silent	SNP	G	G	A			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr4:186544675G>A	ENST00000284776.7	-	13	2405	c.1896C>T	c.(1894-1896)tcC>tcT	p.S632S	SORBS2_ENST00000319471.9_Intron|SORBS2_ENST00000498125.1_Intron|SORBS2_ENST00000437304.2_Intron|SORBS2_ENST00000393528.3_Intron|SORBS2_ENST00000448662.2_Intron|SORBS2_ENST00000418609.1_Silent_p.S536S|SORBS2_ENST00000355634.5_Silent_p.S732S|SORBS2_ENST00000449407.2_Intron|SORBS2_ENST00000431808.1_Silent_p.S632S	NM_021069.4	NP_066547.1	O94875	SRBS2_HUMAN	sorbin and SH3 domain containing 2	632					actin filament organization (GO:0007015)|cell adhesion (GO:0007155)|cell migration (GO:0016477)	actin cytoskeleton (GO:0015629)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|Z disc (GO:0030018)	cytoskeletal adaptor activity (GO:0008093)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)			endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(9)|lung(21)|ovary(2)|prostate(2)|skin(4)|urinary_tract(1)	53		all_cancers(14;4.27e-52)|all_epithelial(14;6.58e-39)|all_lung(41;1.42e-13)|Lung NSC(41;3.73e-13)|Melanoma(20;1.91e-06)|Colorectal(36;0.00692)|Hepatocellular(41;0.00826)|Renal(120;0.00994)|Prostate(90;0.0101)|all_hematologic(60;0.0174)|all_neural(102;0.244)		OV - Ovarian serous cystadenocarcinoma(60;1.54e-09)|BRCA - Breast invasive adenocarcinoma(30;0.000232)|GBM - Glioblastoma multiforme(59;0.000385)|STAD - Stomach adenocarcinoma(60;0.00109)|LUSC - Lung squamous cell carcinoma(40;0.0205)		AAAAGCTTTCGGAGGATGTGA	0.557																																					p.S732S	Esophageal Squamous(153;41 2433 9491 36028)	Atlas-SNP	.											SORBS2,NS,haematopoietic_neoplasm,0,1	SORBS2	300	.	0			c.C2196T						.						55.0	51.0	52.0					4																	186544675		2203	4300	6503	SO:0001819	synonymous_variant	8470	exon16			GCTTTCGGAGGAT		CCDS3845.1, CCDS43289.2, CCDS47173.1, CCDS47174.1, CCDS47175.1, CCDS47176.1, CCDS54825.1, CCDS59482.1	4q35.1	2008-02-05			ENSG00000154556	ENSG00000154556			24098	protein-coding gene	gene with protein product	"""Arg/Abl interacting protein"""					9211900, 9872452	Standard	NM_021069		Approved	ARGBP2, KIAA0777	uc003iym.3	O94875	OTTHUMG00000157215	ENST00000284776.7:c.1896C>T	chr4.hg19:g.186544675G>A		59.0	0.0		45.0	2.0	NM_001270771	A6NEK9|B3KPQ7|B7Z1G5|B7Z3X6|C9JKV9|D3DP62|D3DP63|E9PAS5|E9PAW4|G3XAI0|H7BXR4|J3KNZ5|O60592|O60593|Q96EX0	Silent	SNP	ENST00000284776.7	hg19	CCDS3845.1																																																																																			.	.		0.557	SORBS2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000347944.3	NM_003603	
CDH6	1004	hgsc.bcm.edu	37	5	31305284	31305284	+	Silent	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr5:31305284T>C	ENST00000265071.2	+	7	1268	c.1003T>C	c.(1003-1005)Ttg>Ctg	p.L335L	CDH6_ENST00000514738.1_Silent_p.L280L	NM_004932.3	NP_004923.1	P55285	CADH6_HUMAN	cadherin 6, type 2, K-cadherin (fetal kidney)	335	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(3)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(42)|ovary(4)|prostate(6)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(1)	77						CCTCAAGCTCTTGGACTTTGA	0.428																																					p.L335L		Atlas-SNP	.											.	CDH6	175	.	0			c.T1003C						.						71.0	73.0	72.0					5																	31305284		2203	4300	6503	SO:0001819	synonymous_variant	1004	exon7			AAGCTCTTGGACT	D31784	CCDS3894.1	5p13.3	2010-01-26			ENSG00000113361	ENSG00000113361		"""Cadherins / Major cadherins"""	1765	protein-coding gene	gene with protein product	"""K-Cadherin"""	603007				7743525, 10191097	Standard	NM_004932		Approved		uc003jhe.2	P55285	OTTHUMG00000090673	ENST00000265071.2:c.1003T>C	chr5.hg19:g.31305284T>C		61.0	0.0		54.0	5.0	NM_004932	A8K5H5|Q9BWS0	Silent	SNP	ENST00000265071.2	hg19	CCDS3894.1																																																																																			.	.		0.428	CDH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207355.2	NM_004932	
RANBP3L	202151	hgsc.bcm.edu	37	5	36301506	36301506	+	Missense_Mutation	SNP	G	G	A	rs555708030		TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr5:36301506G>A	ENST00000296604.3	-	1	498	c.13C>T	c.(13-15)Cca>Tca	p.P5S	RANBP3L_ENST00000502994.1_Missense_Mutation_p.P5S|RANBP3L_ENST00000515759.1_Missense_Mutation_p.P5S	NM_145000.3	NP_659437.3	Q86VV4	RNB3L_HUMAN	RAN binding protein 3-like	5					intracellular transport (GO:0046907)					endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(5)|ovary(1)|urinary_tract(1)	16	all_lung(31;4.52e-05)		Epithelial(62;0.0543)|Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|all cancers(62;0.149)|Colorectal(62;0.202)			CCTTTTCTTGGTATGGTAGTC	0.557																																					p.P5S		Atlas-SNP	.											.	RANBP3L	41	.	0			c.C13T						.						136.0	125.0	129.0					5																	36301506		2203	4300	6503	SO:0001583	missense	202151	exon1			TTCTTGGTATGGT	BC047660	CCDS3918.1, CCDS54843.1	5p13.2	2008-02-05			ENSG00000164188	ENSG00000164188			26353	protein-coding gene	gene with protein product						12477932	Standard	NM_145000		Approved	FLJ25422	uc011cow.2	Q86VV4	OTTHUMG00000131110	ENST00000296604.3:c.13C>T	chr5.hg19:g.36301506G>A	ENSP00000296604:p.Pro5Ser	86.0	0.0		75.0	4.0	NM_001161429	B7Z866|E9PGP9|Q96LK2	Missense_Mutation	SNP	ENST00000296604.3	hg19	CCDS3918.1	.	.	.	.	.	.	.	.	.	.	G	12.32	1.902078	0.33628	.	.	ENSG00000164188	ENST00000296604;ENST00000502994;ENST00000515759;ENST00000505865	T;T;T;T	0.42131	2.02;1.95;1.99;0.98	5.71	4.84	0.62591	.	0.994632	0.08147	N	0.990705	T	0.31544	0.0800	N	0.19112	0.55	0.09310	N	1	B;B	0.13145	0.007;0.007	B;B	0.06405	0.002;0.002	T	0.18366	-1.0339	10	0.44086	T	0.13	2.376	10.8368	0.46692	0.0869:0.0:0.9131:0.0	.	5;5	E9PGP9;Q86VV4	.;RNB3L_HUMAN	S	5	ENSP00000296604:P5S;ENSP00000421853:P5S;ENSP00000421149:P5S;ENSP00000427147:P5S	ENSP00000296604:P5S	P	-	1	0	RANBP3L	36337263	0.146000	0.22672	0.002000	0.10522	0.040000	0.13550	4.332000	0.59279	1.558000	0.49541	0.650000	0.86243	CCA	.	.		0.557	RANBP3L-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000253773.2	NM_145000	
C5orf42	65250	hgsc.bcm.edu	37	5	37183712	37183712	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr5:37183712T>C	ENST00000508244.1	-	25	4664	c.4571A>G	c.(4570-4572)aAa>aGa	p.K1524R	C5orf42_ENST00000274258.7_Missense_Mutation_p.K405R|C5orf42_ENST00000425232.2_Missense_Mutation_p.K1524R			Q9H799	CE042_HUMAN	chromosome 5 open reading frame 42	1524						integral component of membrane (GO:0016021)				breast(5)|endometrium(3)|kidney(8)|large_intestine(24)|lung(28)|ovary(4)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	79	all_lung(31;0.000616)		COAD - Colon adenocarcinoma(61;0.14)|Epithelial(62;0.177)|Colorectal(62;0.202)			ATGATCTTCTTTCTTTGTAGG	0.303																																					p.K1524R		Atlas-SNP	.											.	C5orf42	422	.	0			c.A4571G						.						46.0	45.0	45.0					5																	37183712		2202	4296	6498	SO:0001583	missense	65250	exon26			TCTTCTTTCTTTG		CCDS34146.1, CCDS34146.2	5p13.2	2014-01-28			ENSG00000197603	ENSG00000197603			25801	protein-coding gene	gene with protein product		614571				22264561	Standard	NM_023073		Approved	FLJ13231, JBTS17	uc011cpa.1	Q9H799	OTTHUMG00000160492	ENST00000508244.1:c.4571A>G	chr5.hg19:g.37183712T>C	ENSP00000421690:p.Lys1524Arg	90.0	0.0		68.0	4.0	NM_023073	A8MUB7|B7ZLV7|Q4G174|Q6DK46|Q8N8L4|Q9H5T1|Q9H8T9	Missense_Mutation	SNP	ENST00000508244.1	hg19	CCDS34146.2	.	.	.	.	.	.	.	.	.	.	T	8.255	0.809778	0.16537	.	.	ENSG00000197603	ENST00000508244;ENST00000425232;ENST00000274258;ENST00000514429;ENST00000388739	T;T;T;T	0.70631	-0.5;-0.5;-0.5;-0.5	4.53	3.36	0.38483	.	0.446903	0.18946	N	0.126810	T	0.47967	0.1474	N	0.14661	0.345	0.20196	N	0.999929	B;B	0.31459	0.184;0.324	B;B	0.30179	0.112;0.112	T	0.29579	-1.0007	10	0.10902	T	0.67	.	9.5851	0.39512	0.0:0.0849:0.0:0.9151	.	1524;405	E9PH94;Q9H799	.;CE042_HUMAN	R	1524;1524;405;572;405	ENSP00000421690:K1524R;ENSP00000389014:K1524R;ENSP00000274258:K405R;ENSP00000424223:K572R	ENSP00000274258:K405R	K	-	2	0	C5orf42	37219469	0.208000	0.23494	0.852000	0.33557	0.471000	0.32888	1.699000	0.37804	0.743000	0.32719	0.533000	0.62120	AAA	.	.		0.303	C5orf42-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360806.1	NM_023073	
FBXO4	26272	hgsc.bcm.edu	37	5	41941379	41941379	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr5:41941379G>A	ENST00000281623.3	+	7	1216	c.1160G>A	c.(1159-1161)aGa>aAa	p.R387K	FBXO4_ENST00000509134.1_3'UTR	NM_012176.2	NP_036308.1	Q9UKT5	FBX4_HUMAN	F-box protein 4	387					positive regulation of protein ubiquitination (GO:0031398)|protein polyubiquitination (GO:0000209)|protein ubiquitination (GO:0016567)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)|telomere maintenance (GO:0000723)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|SCF ubiquitin ligase complex (GO:0019005)|ubiquitin ligase complex (GO:0000151)	protein homodimerization activity (GO:0042803)|ubiquitin-protein transferase activity (GO:0004842)	p.R387K(1)		breast(2)|endometrium(1)|kidney(2)|large_intestine(6)|liver(1)|lung(11)|prostate(1)|stomach(1)|urinary_tract(2)	27		Lung NSC(810;4.15e-05)|Breast(839;0.00093)|Ovarian(839;0.00965)|Myeloproliferative disorder(839;0.0255)|all_neural(839;0.0604)				AAGCGTGCAAGATGATTCTCT	0.413																																					p.R387K		Atlas-SNP	.											FBXO4,NS,carcinoma,0,1	FBXO4	42	.	1	Substitution - Missense(1)	lung(1)	c.G1160A						.						119.0	113.0	115.0					5																	41941379		2203	4300	6503	SO:0001583	missense	26272	exon7			GTGCAAGATGATT	AF129534	CCDS3938.1, CCDS3939.1, CCDS75238.1	5p12	2008-02-05	2004-06-15		ENSG00000151876	ENSG00000151876		"""F-boxes /  ""other"""""	13583	protein-coding gene	gene with protein product		609090	"""F-box only protein 4"""			10531035, 10531037	Standard	NM_033484		Approved	FBX4	uc003jmq.3	Q9UKT5	OTTHUMG00000094799	ENST00000281623.3:c.1160G>A	chr5.hg19:g.41941379G>A	ENSP00000281623:p.Arg387Lys	112.0	0.0		97.0	4.0	NM_012176	Q68CU8|Q86VT8|Q9UK98	Missense_Mutation	SNP	ENST00000281623.3	hg19	CCDS3938.1	.	.	.	.	.	.	.	.	.	.	G	11.74	1.728007	0.30593	.	.	ENSG00000151876	ENST00000281623	.	.	.	5.29	2.41	0.29592	.	0.391635	0.24757	N	0.035848	T	0.41213	0.1149	L	0.36672	1.1	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.11867	-1.0570	9	0.18710	T	0.47	-23.5446	7.7053	0.28646	0.3786:0.0:0.6214:0.0	.	387	Q9UKT5	FBX4_HUMAN	K	387	.	ENSP00000281623:R387K	R	+	2	0	FBXO4	41977136	0.996000	0.38824	0.985000	0.45067	0.680000	0.39746	0.612000	0.24283	0.327000	0.23409	0.556000	0.70494	AGA	.	.		0.413	FBXO4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211614.1		
ITGA1	3672	hgsc.bcm.edu	37	5	52214692	52214692	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr5:52214692A>G	ENST00000282588.6	+	16	2577	c.2119A>G	c.(2119-2121)Aaa>Gaa	p.K707E		NM_181501.1	NP_852478.1	P56199	ITA1_HUMAN	integrin, alpha 1	707					activation of MAPK activity (GO:0000187)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell-matrix adhesion (GO:0007160)|cellular extravasation (GO:0045123)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)|muscle contraction (GO:0006936)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|neutrophil chemotaxis (GO:0030593)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of phosphoprotein phosphatase activity (GO:0032516)|vasodilation (GO:0042311)	acrosomal vesicle (GO:0001669)|basal part of cell (GO:0045178)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integrin alpha1-beta1 complex (GO:0034665)|integrin complex (GO:0008305)|membrane (GO:0016020)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)	collagen binding (GO:0005518)|collagen binding involved in cell-matrix adhesion (GO:0098639)|metal ion binding (GO:0046872)|protein phosphatase binding (GO:0019903)			NS(1)|breast(3)|central_nervous_system(4)|endometrium(3)|kidney(4)|large_intestine(6)|liver(2)|lung(19)|ovary(2)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	51		Lung NSC(810;5.05e-05)|Breast(144;0.0851)				TTTTGATGTGAAATTAAAGTC	0.328																																					p.K707E		Atlas-SNP	.											.	ITGA1	112	.	0			c.A2119G						.						94.0	87.0	90.0					5																	52214692		2203	4299	6502	SO:0001583	missense	3672	exon16			GATGTGAAATTAA	X68742	CCDS3955.1	5q11.1	2010-03-23			ENSG00000213949	ENSG00000213949		"""CD molecules"", ""Integrins"""	6134	protein-coding gene	gene with protein product		192968				8428973, 11937138	Standard	NM_181501		Approved	VLA1, CD49a	uc003jou.3	P56199	OTTHUMG00000131163	ENST00000282588.6:c.2119A>G	chr5.hg19:g.52214692A>G	ENSP00000282588:p.Lys707Glu	81.0	0.0		90.0	5.0	NM_181501	B2RNU0	Missense_Mutation	SNP	ENST00000282588.6	hg19	CCDS3955.1	.	.	.	.	.	.	.	.	.	.	A	16.96	3.264894	0.59431	.	.	ENSG00000213949	ENST00000282588	T	0.47869	0.83	5.51	5.51	0.81932	Integrin alpha-2 (1);	0.308515	0.35677	N	0.003055	T	0.36193	0.0958	L	0.38175	1.15	0.31469	N	0.668637	B	0.28258	0.205	B	0.29077	0.098	T	0.37979	-0.9682	10	0.13853	T	0.58	.	11.8599	0.52459	0.8542:0.1458:0.0:0.0	.	707	P56199	ITA1_HUMAN	E	707	ENSP00000282588:K707E	ENSP00000282588:K707E	K	+	1	0	ITGA1	52250449	0.998000	0.40836	0.997000	0.53966	0.992000	0.81027	3.299000	0.51826	2.210000	0.71456	0.533000	0.62120	AAA	.	.		0.328	ITGA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253855.3	NM_181501	
ADAMTS6	11174	hgsc.bcm.edu	37	5	64466487	64466487	+	5'UTR	SNP	C	C	T			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr5:64466487C>T	ENST00000314351.5	-	0	860							Q9UKP5	ATS6_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 6							proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(7)|pancreas(1)|prostate(1)|skin(3)	18		Lung NSC(167;2.44e-06)|Prostate(74;0.014)|Ovarian(174;0.0549)|Breast(144;0.111)|Colorectal(97;0.235)		Lung(70;0.00942)		TGCTTTCACACTGCTGCATTG	0.498																																					p.Q1067Q		Atlas-SNP	.											.	ADAMTS6	174	.	0			c.G3201A						.						90.0	80.0	83.0					5																	64466487		2203	4300	6503	SO:0001623	5_prime_UTR_variant	11174	exon24			TTCACACTGCTGC	AF140674	CCDS3983.2	5q13	2008-07-18	2005-08-19		ENSG00000049192	ENSG00000049192		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	222	protein-coding gene	gene with protein product	"""a disintegrin and metalloproteinase with thrombospondin motifs 6"""	605008	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 6"""			10464288	Standard	NM_197941		Approved	ADAM-TS6	uc003jtp.3	Q9UKP5	OTTHUMG00000074079	ENST00000314351.5:c.-462G>A	chr5.hg19:g.64466487C>T		106.0	0.0		98.0	4.0	NM_197941	Q59EX6|Q5IR87|Q5IR88|Q5IR89|Q68DL1	Silent	SNP	ENST00000314351.5	hg19																																																																																				.	.		0.498	ADAMTS6-006	KNOWN	basic	processed_transcript	protein_coding	OTTHUMT00000157334.2	NM_197941	
RASA1	5921	hgsc.bcm.edu	37	5	86665661	86665661	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr5:86665661T>A	ENST00000274376.6	+	12	2206	c.1642T>A	c.(1642-1644)Ttt>Att	p.F548I	RASA1_ENST00000456692.2_Missense_Mutation_p.F371I|RASA1_ENST00000512763.1_Missense_Mutation_p.F381I|RASA1_ENST00000506290.1_Missense_Mutation_p.F382I	NM_002890.2	NP_002881.1	P20936	RASA1_HUMAN	RAS p21 protein activator (GTPase activating protein) 1	548	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				blood vessel morphogenesis (GO:0048514)|embryo development (GO:0009790)|intracellular signal transduction (GO:0035556)|mitotic cytokinesis (GO:0000281)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of Ras GTPase activity (GO:0032320)|regulation of actin filament polymerization (GO:0030833)|regulation of cell shape (GO:0008360)|regulation of RNA metabolic process (GO:0051252)|signal transduction (GO:0007165)|vasculogenesis (GO:0001570)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|ruffle (GO:0001726)	glycoprotein binding (GO:0001948)|GTPase binding (GO:0051020)|potassium channel inhibitor activity (GO:0019870)|Ras GTPase activator activity (GO:0005099)|receptor binding (GO:0005102)			NS(1)|cervix(1)|endometrium(7)|kidney(4)|large_intestine(12)|lung(13)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	48		all_cancers(142;8.25e-07)|Lung NSC(167;0.000185)|all_lung(232;0.000222)|Colorectal(57;0.00542)|Ovarian(174;0.0423)		OV - Ovarian serous cystadenocarcinoma(54;4.72e-41)|Epithelial(54;1.51e-36)|all cancers(79;3.76e-31)		AGTTCAGCACTTTAGTGAAGA	0.308																																					p.F548I		Atlas-SNP	.											.	RASA1	213	.	0			c.T1642A						.						64.0	64.0	64.0					5																	86665661		2203	4298	6501	SO:0001583	missense	5921	exon12			CAGCACTTTAGTG		CCDS34200.1, CCDS47243.1	5q13	2013-02-14			ENSG00000145715	ENSG00000145715		"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	9871	protein-coding gene	gene with protein product	"""capillary malformation-arteriovenous malformation"""	139150		RASA		15917201	Standard	NM_022650		Approved	GAP, CM-AVM, p120GAP, p120RASGAP	uc003kiw.3	P20936	OTTHUMG00000162605	ENST00000274376.6:c.1642T>A	chr5.hg19:g.86665661T>A	ENSP00000274376:p.Phe548Ile	203.0	0.0		142.0	10.0	NM_002890	B2R6W3|Q9UDI1	Missense_Mutation	SNP	ENST00000274376.6	hg19	CCDS34200.1	.	.	.	.	.	.	.	.	.	.	T	19.32	3.805315	0.70682	.	.	ENSG00000145715	ENST00000274376;ENST00000534133;ENST00000456692;ENST00000512763;ENST00000506290	T;T;T;T	0.75050	-0.9;-0.9;-0.9;-0.9	5.43	5.43	0.79202	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.000000	0.85682	D	0.000000	T	0.59932	0.2230	N	0.10760	0.04	0.80722	D	1	P;P;P;P;P	0.36199	0.543;0.543;0.543;0.488;0.543	B;B;B;B;B	0.40256	0.304;0.324;0.324;0.217;0.304	T	0.62148	-0.6915	10	0.30078	T	0.28	.	15.4775	0.75497	0.0:0.0:0.0:1.0	.	382;381;382;371;548	E9PGC0;B4DTL2;B4DTX4;P20936-2;P20936	.;.;.;.;RASA1_HUMAN	I	548;581;371;381;382	ENSP00000274376:F548I;ENSP00000411221:F371I;ENSP00000422008:F381I;ENSP00000420905:F382I	ENSP00000274376:F548I	F	+	1	0	RASA1	86701417	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.643000	0.83403	2.066000	0.61787	0.533000	0.62120	TTT	.	.		0.308	RASA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000369729.1	NM_002890	
RIOK2	55781	hgsc.bcm.edu	37	5	96514829	96514829	+	Silent	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr5:96514829T>C	ENST00000283109.3	-	2	203	c.135A>G	c.(133-135)aaA>aaG	p.K45K	CTD-2215E18.1_ENST00000509481.1_Intron|RIOK2_ENST00000508447.1_Silent_p.K45K	NM_018343.2	NP_060813.2	Q9BVS4	RIOK2_HUMAN	RIO kinase 2	45							ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|endometrium(2)|kidney(2)|large_intestine(4)|lung(9)|pancreas(1)|prostate(1)|urinary_tract(2)	23		all_cancers(142;0.000125)|all_epithelial(76;8.48e-07)|all_lung(232;0.0131)|Lung NSC(167;0.0161)|Colorectal(57;0.0676)|Ovarian(225;0.105)		COAD - Colon adenocarcinoma(37;0.0657)		AGCCACCATGTTTAAGGCTGG	0.348																																					p.K45K		Atlas-SNP	.											.	RIOK2	82	.	0			c.A135G						.						84.0	81.0	82.0					5																	96514829		2203	4300	6503	SO:0001819	synonymous_variant	55781	exon2			ACCATGTTTAAGG	AK002021	CCDS4089.1, CCDS54884.1	5q14	2012-12-10	2012-12-10		ENSG00000058729	ENSG00000058729			18999	protein-coding gene	gene with protein product			"""RIO kinase 2 (yeast)"""				Standard	NM_018343		Approved	FLJ11159	uc003kmz.3	Q9BVS4	OTTHUMG00000128723	ENST00000283109.3:c.135A>G	chr5.hg19:g.96514829T>C		51.0	0.0		48.0	4.0	NM_001159749	D6RDI3|Q9NUT0	Silent	SNP	ENST00000283109.3	hg19	CCDS4089.1																																																																																			.	.		0.348	RIOK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250628.1	NM_018343	
KLHL3	26249	hgsc.bcm.edu	37	5	136963985	136963985	+	Splice_Site	SNP	C	C	A			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr5:136963985C>A	ENST00000309755.4	-	13	2035		c.e13+1		KLHL3_ENST00000506491.1_Splice_Site|KLHL3_ENST00000506873.1_Splice_Site|KLHL3_ENST00000508657.1_Splice_Site|KLHL3_ENST00000541417.1_Splice_Site	NM_017415.2	NP_059111.2	Q9UH77	KLHL3_HUMAN	kelch-like family member 3						distal tubule morphogenesis (GO:0072156)|ion homeostasis (GO:0050801)|protein K48-linked ubiquitination (GO:0070936)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|renal sodium ion absorption (GO:0070294)	Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)	structural molecule activity (GO:0005198)			breast(2)|endometrium(3)|kidney(2)|large_intestine(4)|lung(8)|stomach(1)|upper_aerodigestive_tract(1)	21		all_hematologic(541;3.67e-07)|Breast(839;7.61e-05)|Prostate(281;0.000825)|Ovarian(839;0.0481)|all_lung(232;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)	GBM - Glioblastoma multiforme(465;0.0223)		GCAGTCATTACCTGCGTTGCG	0.532																																					.		Atlas-SNP	.											KLHL3,NS,carcinoma,0,1	KLHL3	54	.	0			c.1591+1G>T						.						208.0	180.0	190.0					5																	136963985		2203	4300	6503	SO:0001630	splice_region_variant	26249	exon14			TCATTACCTGCGT	AB032955	CCDS4192.1, CCDS58969.1, CCDS58970.1	5q31	2013-01-30	2013-01-30		ENSG00000146021	ENSG00000146021		"""Kelch-like"", ""BTB/POZ domain containing"""	6354	protein-coding gene	gene with protein product		605775	"""kelch (Drosophila)-like 3"", ""kelch-like 3 (Drosophila)"""			10843806	Standard	NM_017415		Approved	KIAA1129	uc010jek.3	Q9UH77	OTTHUMG00000129155	ENST00000309755.4:c.1591+1G>T	chr5.hg19:g.136963985C>A		99.0	0.0		93.0	42.0	NM_017415	B2RBK7|Q9UH75|Q9UH76|Q9ULU0|Q9Y6V6	Splice_Site	SNP	ENST00000309755.4	hg19	CCDS4192.1	.	.	.	.	.	.	.	.	.	.	C	20.5	3.995012	0.74703	.	.	ENSG00000146021	ENST00000506491;ENST00000508657;ENST00000309755	.	.	.	5.54	5.54	0.83059	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.6787	0.95950	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	KLHL3	136991884	1.000000	0.71417	1.000000	0.80357	0.706000	0.40770	7.651000	0.83577	2.884000	0.98904	0.655000	0.94253	.	.	.		0.532	KLHL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251220.2		Intron
HBEGF	1839	hgsc.bcm.edu	37	5	139725515	139725515	+	Silent	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr5:139725515T>C	ENST00000230990.6	-	2	503	c.201A>G	c.(199-201)gcA>gcG	p.A67A	CTC-329D1.3_ENST00000520443.1_RNA|HBEGF_ENST00000507104.1_Silent_p.A67A	NM_001945.2	NP_001936.1	Q99075	HBEGF_HUMAN	heparin-binding EGF-like growth factor	67					epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|muscle organ development (GO:0007517)|negative regulation of elastin biosynthetic process (GO:0051545)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell growth (GO:0030307)|positive regulation of cell migration (GO:0030335)|positive regulation of keratinocyte migration (GO:0051549)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of wound healing (GO:0090303)|regulation of heart contraction (GO:0008016)|signal transduction (GO:0007165)|wound healing, spreading of epidermal cells (GO:0035313)	cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)	epidermal growth factor receptor binding (GO:0005154)|growth factor activity (GO:0008083)|heparin binding (GO:0008201)			breast(1)|kidney(1)|large_intestine(1)|lung(3)|stomach(1)	7			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGTCCAGATCTGCCTCTTGCA	0.587											OREG0016844	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.A67A		Atlas-SNP	.											.	HBEGF	12	.	0			c.A201G						.						61.0	62.0	62.0					5																	139725515		2203	4300	6503	SO:0001819	synonymous_variant	1839	exon2			CAGATCTGCCTCT		CCDS4223.1	5q23	2012-10-02	2005-01-14	2005-01-14	ENSG00000113070	ENSG00000113070			3059	protein-coding gene	gene with protein product	"""Diphtheria toxin receptor (heparin-binding EGF-like growth factor)"", ""heparin-binding epidermal growth factor"""	126150	"""diphtheria toxin receptor (heparin-binding epidermal growth factor-like growth factor)"""	HEGFL, DTS, DTR		7590736, 12163414	Standard	NM_001945		Approved		uc003lfi.3	Q99075	OTTHUMG00000129496	ENST00000230990.6:c.201A>G	chr5.hg19:g.139725515T>C		188.0	0.0	1651	124.0	5.0	NM_001945	B2R821	Silent	SNP	ENST00000230990.6	hg19	CCDS4223.1																																																																																			.	.		0.587	HBEGF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251665.2	NM_001945	
PCDHB8	56128	hgsc.bcm.edu	37	5	140559337	140559337	+	Silent	SNP	C	C	T	rs374710779		TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr5:140559337C>T	ENST00000239444.2	+	1	1967	c.1722C>T	c.(1720-1722)acC>acT	p.T574T	PCDHB16_ENST00000361016.2_5'Flank	NM_019120.3	NP_061993.2	Q9UN66	PCDB8_HUMAN	protocadherin beta 8	574	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(2)|breast(1)|cervix(2)|endometrium(5)|kidney(6)|large_intestine(14)|liver(1)|lung(38)|prostate(6)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	83			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CGCCCTGCACCGAGCTGGTGC	0.701																																					p.T574T		Atlas-SNP	.											PCDHB8,NS,carcinoma,0,1	PCDHB8	199	.	0			c.C1722T						.						9.0	18.0	15.0					5																	140559337		2148	4213	6361	SO:0001819	synonymous_variant	56128	exon1			CTGCACCGAGCTG	AF152501	CCDS4250.1	5q31	2010-01-26			ENSG00000120322	ENSG00000120322		"""Cadherins / Protocadherins : Clustered"""	8693	other	protocadherin		606334				10380929	Standard	NM_019120		Approved	PCDH-BETA8, PCDH3I	uc011dai.2	Q9UN66	OTTHUMG00000129621	ENST00000239444.2:c.1722C>T	chr5.hg19:g.140559337C>T		23.0	0.0		99.0	4.0	NM_019120	B9EGV1	Silent	SNP	ENST00000239444.2	hg19	CCDS4250.1																																																																																			.	.		0.701	PCDHB8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251816.2	NM_019120	
HMGXB3	22993	hgsc.bcm.edu	37	5	149390055	149390055	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr5:149390055A>G	ENST00000502717.1	+	4	1158	c.694A>G	c.(694-696)Aca>Gca	p.T232A	HMGXB3_ENST00000503427.1_Missense_Mutation_p.T232A	NM_014983.2	NP_055798	Q12766	HMGX3_HUMAN	HMG box domain containing 3	478	Arg-rich.				phosphorylation (GO:0016310)	nucleus (GO:0005634)	DNA binding (GO:0003677)|kinase activity (GO:0016301)			central_nervous_system(1)|endometrium(3)|kidney(3)|skin(2)	9						ACCTTACCAGACAAGCCTGGT	0.567																																					p.T232A		Atlas-SNP	.											.	HMGXB3	31	.	0			c.A694G						.						24.0	27.0	26.0					5																	149390055		692	1591	2283	SO:0001583	missense	22993	exon4			TACCAGACAAGCC	D83778	CCDS54935.1	5q33.1	2011-07-01		2009-01-05	ENSG00000113716	ENSG00000113716		"""High mobility group / Non-canonical"""	28982	protein-coding gene	gene with protein product				HMGX3		8724849	Standard	NM_014983		Approved	SMF, KIAA0194	uc003lrk.4	Q12766	OTTHUMG00000163493	ENST00000502717.1:c.694A>G	chr5.hg19:g.149390055A>G	ENSP00000421917:p.Thr232Ala	124.0	0.0		99.0	4.0	NM_014983	G5E9Y4|Q86UG3|Q9UMF4	Missense_Mutation	SNP	ENST00000502717.1	hg19	CCDS54935.1	.	.	.	.	.	.	.	.	.	.	A	14.64	2.596110	0.46318	.	.	ENSG00000113716	ENST00000503427;ENST00000502717	.	.	.	5.91	5.91	0.95273	.	0.105192	0.64402	D	0.000009	T	0.58409	0.2120	L	0.59436	1.845	0.41644	D	0.989095	B	0.21606	0.058	B	0.17098	0.017	T	0.59669	-0.7411	9	0.87932	D	0	-10.1806	11.39	0.49809	0.9301:0.0:0.0699:0.0	.	478	Q12766	HMGX3_HUMAN	A	232	.	ENSP00000421917:T232A	T	+	1	0	HMGXB3	149370248	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	2.911000	0.48774	2.269000	0.75478	0.533000	0.62120	ACA	.	.		0.567	HMGXB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373771.1	XM_001717202	
HAVCR1	26762	hgsc.bcm.edu	37	5	156479571	156479571	+	Missense_Mutation	SNP	C	C	T	rs6149307|rs386693994|rs183130208|rs141023871	byFrequency	TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr5:156479571C>T	ENST00000339252.3	-	3	1006	c.474G>A	c.(472-474)atG>atA	p.M158I	HAVCR1_ENST00000425854.1_Missense_Mutation_p.M158I|HAVCR1_ENST00000522693.1_Missense_Mutation_p.M158I|HAVCR1_ENST00000544197.1_Missense_Mutation_p.M158I|HAVCR1_ENST00000523175.1_Missense_Mutation_p.M158I	NM_012206.2	NP_036338.2	Q96D42	HAVR1_HUMAN	hepatitis A virus cellular receptor 1	0	11 X 6 AA approximate tandem repeats of V-P-T-T-T-T].|Thr-rich.				viral process (GO:0016032)	integral component of membrane (GO:0016021)	virus receptor activity (GO:0001618)			endometrium(3)|large_intestine(2)|lung(17)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	28	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.0999)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			GAACAGTCGTCATTGGAACAG	0.488																																					p.M158I		Atlas-SNP	.											.	HAVCR1	84	.	0			c.G474A						.						413.0	302.0	340.0					5																	156479571		2079	3991	6070	SO:0001583	missense	26762	exon4			AGTCGTCATTGGA	AF043724	CCDS43392.1	5q33.2	2014-01-14			ENSG00000113249	ENSG00000113249		"""Immunoglobulin superfamily / V-set domain containing"""	17866	protein-coding gene	gene with protein product	"""T-cell immunoglobulin mucin family member 1"""	606518				9658108, 11725301	Standard	NM_012206		Approved	HAVCR-1, TIM-1, TIM1, HAVCR, TIMD1	uc021ygj.1	Q96D42	OTTHUMG00000163466	ENST00000339252.3:c.474G>A	chr5.hg19:g.156479571C>T	ENSP00000344844:p.Met158Ile	3.0	0.0		242.0	25.0	NM_001099414	O43656	Missense_Mutation	SNP	ENST00000339252.3	hg19	CCDS43392.1	.	.	.	.	.	.	.	.	.	.	C	2.575	-0.298775	0.05532	.	.	ENSG00000113249	ENST00000522693;ENST00000523175;ENST00000339252;ENST00000425854;ENST00000544197;ENST00000518745	T;T;T;T;T;T	0.13901	2.55;2.6;2.6;2.55;2.6;2.57	1.56	-3.12	0.05282	.	.	.	.	.	T	0.05181	0.0138	N	0.08118	0	0.09310	N	1	.	.	.	.	.	.	T	0.31392	-0.9945	7	0.62326	D	0.03	.	0.1239	0.00067	0.2901:0.1916:0.1631:0.3551	.	.	.	.	I	158	ENSP00000428524:M158I;ENSP00000427898:M158I;ENSP00000344844:M158I;ENSP00000403333:M158I;ENSP00000440258:M158I;ENSP00000428422:M158I	ENSP00000344844:M158I	M	-	3	0	HAVCR1	156412149	0.002000	0.14202	0.000000	0.03702	0.003000	0.03518	0.878000	0.28126	-1.479000	0.01867	-0.507000	0.04495	ATG	.	.		0.488	HAVCR1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373698.1		
TENM2	57451	hgsc.bcm.edu	37	5	167689611	167689611	+	Silent	SNP	C	C	G			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr5:167689611C>G	ENST00000518659.1	+	29	8160	c.8121C>G	c.(8119-8121)gcC>gcG	p.A2707A	TENM2_ENST00000519204.1_Silent_p.A2586A|TENM2_ENST00000520394.1_Silent_p.A2468A|TENM2_ENST00000545108.1_Silent_p.A2706A|TENM2_ENST00000403607.2_Silent_p.A2531A	NM_001122679.1	NP_001116151.1	Q9NT68	TEN2_HUMAN	teneurin transmembrane protein 2	2707					axon guidance (GO:0007411)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|heterophilic cell-cell adhesion (GO:0007157)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of filopodium assembly (GO:0051491)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cell-cell junction (GO:0005911)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|endoplasmic reticulum (GO:0005783)|filopodium (GO:0030175)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|PML body (GO:0016605)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)										TGGGCACGGCCTGGGCCAAGG	0.687																																					p.A2698A		Atlas-SNP	.											.	.	.	.	0			c.C8094G						.						11.0	12.0	12.0					5																	167689611		1984	4145	6129	SO:0001819	synonymous_variant	57451	exon29			CACGGCCTGGGCC	AB032953		5q35	2012-10-02	2012-10-02	2012-10-02	ENSG00000145934	ENSG00000145934			29943	protein-coding gene	gene with protein product		610119	"""odz, odd Oz/ten-m homolog 2 (Drosophila)"""	ODZ2		10625539	Standard	NM_001122679		Approved	KIAA1127, Ten-M2	uc010jjd.3	Q9NT68	OTTHUMG00000162928	ENST00000518659.1:c.8121C>G	chr5.hg19:g.167689611C>G		60.0	0.0		63.0	26.0	NM_001122679	Q9ULU2	Silent	SNP	ENST00000518659.1	hg19																																																																																				.	.		0.687	TENM2-001	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000376096.1	NM_001122679	
CAGE1	285782	hgsc.bcm.edu	37	6	7366104	7366104	+	Intron	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr6:7366104T>C	ENST00000512086.1	-	8	2207				CAGE1_ENST00000296742.7_Intron|CAGE1_ENST00000502583.1_Missense_Mutation_p.K673R|CAGE1_ENST00000379918.4_Missense_Mutation_p.K651R|CAGE1_ENST00000338150.4_Missense_Mutation_p.K673R			Q8TC20	CAGE1_HUMAN	cancer antigen 1											breast(1)|cervix(1)|endometrium(3)|kidney(2)|lung(11)|urinary_tract(1)	19	Ovarian(93;0.0418)					GATTCTATCTTTATGTTTCAG	0.308																																					p.K673R		Atlas-SNP	.											.	CAGE1	165	.	0			c.A2018G						.						139.0	124.0	129.0					6																	7366104		692	1591	2283	SO:0001627	intron_variant	285782	exon8			CTATCTTTATGTT	BC026194	CCDS47367.1, CCDS54964.1, CCDS54965.1	6p24.3	2009-08-06	2005-01-26	2005-01-27	ENSG00000164304	ENSG00000164304			21622	protein-coding gene	gene with protein product	"""cancer/testis antigen 95"""	608304	"""cancer/testis antigen 3"""	CTAG3		12531476	Standard	NM_205864		Approved	bA69L16.7, CT95	uc003mxl.2	Q8TC20	OTTHUMG00000014200	ENST00000512086.1:c.2005-296A>G	chr6.hg19:g.7366104T>C		71.0	0.0		59.0	4.0	NM_001170693	D6RCT9|Q5TAM0|Q86TM4|Q8N7R5	Missense_Mutation	SNP	ENST00000512086.1	hg19		.	.	.	.	.	.	.	.	.	.	T	13.42	2.233347	0.39498	.	.	ENSG00000164304	ENST00000379918;ENST00000502583;ENST00000338150;ENST00000542431	T;T;T	0.35789	1.29;1.43;1.43	5.43	1.7	0.24286	.	0.196102	0.35739	N	0.003018	T	0.08179	0.0204	N	0.25890	0.77	0.27234	N	0.95932	B;B	0.24576	0.106;0.106	B;B	0.26969	0.075;0.045	T	0.33777	-0.9855	10	0.23302	T	0.38	-15.0625	6.6693	0.23060	0.0:0.2787:0.0:0.7213	.	673;673	Q8TC20-3;D6RCT9	.;.	R	651;673;673;673	ENSP00000369250:K651R;ENSP00000425493:K673R;ENSP00000338107:K673R	ENSP00000338107:K673R	K	-	2	0	CAGE1	7311103	1.000000	0.71417	0.986000	0.45419	0.819000	0.46315	0.434000	0.21494	0.341000	0.23771	0.460000	0.39030	AAA	.	.		0.308	CAGE1-008	PUTATIVE	non_canonical_conserved|basic	protein_coding	protein_coding	OTTHUMT00000367136.1	NM_175745	
DSP	1832	hgsc.bcm.edu	37	6	7580098	7580098	+	Silent	SNP	C	C	G			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr6:7580098C>G	ENST00000379802.3	+	23	4016	c.3675C>G	c.(3673-3675)tcC>tcG	p.S1225S	DSP_ENST00000418664.2_Intron	NM_004415.2	NP_004406.2	P15924	DESP_HUMAN	desmoplakin	1225	Central fibrous rod domain.				adherens junction organization (GO:0034332)|apoptotic process (GO:0006915)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|desmosome organization (GO:0002934)|epidermis development (GO:0008544)|intermediate filament organization (GO:0045109)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)|protein localization to adherens junction (GO:0071896)|regulation of heart rate by cardiac conduction (GO:0086091)|single organismal cell-cell adhesion (GO:0016337)|ventricular cardiac muscle cell action potential (GO:0086005)|ventricular compact myocardium morphogenesis (GO:0003223)|wound healing (GO:0042060)	basolateral plasma membrane (GO:0016323)|cornified envelope (GO:0001533)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|intercalated disc (GO:0014704)|intermediate filament (GO:0005882)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)|protein binding, bridging (GO:0030674)|protein kinase C binding (GO:0005080)|scaffold protein binding (GO:0097110)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			biliary_tract(1)|breast(6)|central_nervous_system(7)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(16)|liver(2)|lung(27)|ovary(4)|prostate(1)|skin(8)|stomach(3)|upper_aerodigestive_tract(7)|urinary_tract(5)	101	Ovarian(93;0.0584)	all_hematologic(90;0.236)		OV - Ovarian serous cystadenocarcinoma(45;0.000508)		AGGAGATATCCATGCAAAAAG	0.368																																					p.S1225S		Atlas-SNP	.											.	DSP	306	.	0			c.C3675G						.						75.0	72.0	73.0					6																	7580098		2203	4300	6503	SO:0001819	synonymous_variant	1832	exon23			GATATCCATGCAA	J05211	CCDS4501.1, CCDS47368.1	6p24.3	2014-09-17	2003-05-20		ENSG00000096696	ENSG00000096696			3052	protein-coding gene	gene with protein product		125647	"""desmoplakin (DPI, DPII)"""			1889810	Standard	NM_004415		Approved	KPPS2, PPKS2, DPI, DPII	uc003mxp.1	P15924	OTTHUMG00000014212	ENST00000379802.3:c.3675C>G	chr6.hg19:g.7580098C>G		116.0	0.0		91.0	39.0	NM_004415	B2RTT2|D7RX09|O75993|Q14189|Q9UHN4	Silent	SNP	ENST00000379802.3	hg19	CCDS4501.1																																																																																			.	.		0.368	DSP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039786.2	NM_004415	
ALDH5A1	7915	hgsc.bcm.edu	37	6	24523152	24523152	+	Splice_Site	SNP	A	A	G			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr6:24523152A>G	ENST00000357578.3	+	7	1317	c.1172A>G	c.(1171-1173)aAg>aGg	p.K391R	ALDH5A1_ENST00000546278.1_Splice_Site_p.K303R|ALDH5A1_ENST00000348925.2_Splice_Site_p.K404R|ALDH5A1_ENST00000491546.1_Splice_Site_p.K363R	NM_001080.3	NP_001071.1	P51649	SSDH_HUMAN	aldehyde dehydrogenase 5 family, member A1	391					acetate metabolic process (GO:0006083)|central nervous system development (GO:0007417)|galactosylceramide metabolic process (GO:0006681)|gamma-aminobutyric acid catabolic process (GO:0009450)|glucose metabolic process (GO:0006006)|glucosylceramide metabolic process (GO:0006678)|glutamate metabolic process (GO:0006536)|glutamine metabolic process (GO:0006541)|glutathione metabolic process (GO:0006749)|glycerophospholipid metabolic process (GO:0006650)|neurotransmitter catabolic process (GO:0042135)|neurotransmitter secretion (GO:0007269)|post-embryonic development (GO:0009791)|protein homotetramerization (GO:0051289)|respiratory electron transport chain (GO:0022904)|short-chain fatty acid metabolic process (GO:0046459)|succinate metabolic process (GO:0006105)|synaptic transmission (GO:0007268)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	protein homodimerization activity (GO:0042803)|succinate-semialdehyde dehydrogenase (NAD+) activity (GO:0004777)|succinate-semialdehyde dehydrogenase [NAD(P)+] activity (GO:0009013)			breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(7)|skin(2)|urinary_tract(1)	20					Chlormerodrin(DB00534)|Succinic acid(DB00139)|Valproic Acid(DB00313)	GCGGTAGAAAAGGTAAGTATA	0.393																																					p.K404R		Atlas-SNP	.											ALDH5A1,colon,carcinoma,0,1	ALDH5A1	42	.	0			c.A1211G						.						79.0	82.0	81.0					6																	24523152		2203	4300	6503	SO:0001630	splice_region_variant	7915	exon8			TAGAAAAGGTAAG	L34820	CCDS4555.1, CCDS4556.1	6p22	2013-06-03	2008-07-31		ENSG00000112294	ENSG00000112294	1.2.1.24	"""Aldehyde dehydrogenases"""	408	protein-coding gene	gene with protein product	"""succinate-semialdehyde dehydrogenase"""	610045				7814412, 9059628	Standard	NM_001080		Approved	SSADH, SSDH	uc003nef.3	P51649	OTTHUMG00000014356	ENST00000357578.3:c.1173+1A>G	chr6.hg19:g.24523152A>G		30.0	0.0		30.0	2.0	NM_170740	B2RD26|G5E949|Q546H9|Q8N3W6	Missense_Mutation	SNP	ENST00000357578.3	hg19	CCDS4555.1	.	.	.	.	.	.	.	.	.	.	A	20.9	4.070766	0.76301	.	.	ENSG00000112294	ENST00000357578;ENST00000546278;ENST00000491546;ENST00000348925	T;T;T;T	0.75821	-0.97;-0.97;-0.97;-0.97	5.2	5.2	0.72013	Aldehyde dehydrogenase domain (1);Aldehyde dehydrogenase, C-terminal (1);Aldehyde/histidinol dehydrogenase (1);	0.000000	0.85682	D	0.000000	T	0.76608	0.4011	L	0.37466	1.105	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.997	T	0.80522	-0.1345	10	0.87932	D	0	-8.0048	15.5259	0.75905	1.0:0.0:0.0:0.0	.	391;404	P51649;G5E949	SSDH_HUMAN;.	R	391;303;363;404	ENSP00000350191:K391R;ENSP00000438193:K303R;ENSP00000417687:K363R;ENSP00000314649:K404R	ENSP00000314649:K404R	K	+	2	0	ALDH5A1	24631131	1.000000	0.71417	1.000000	0.80357	0.527000	0.34593	8.873000	0.92357	2.308000	0.77769	0.533000	0.62120	AAG	.	.		0.393	ALDH5A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040007.2		Missense_Mutation
SKIV2L	6499	hgsc.bcm.edu	37	6	31931312	31931312	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr6:31931312C>T	ENST00000375394.2	+	14	1639	c.1526C>T	c.(1525-1527)tCc>tTc	p.S509F	SKIV2L_ENST00000544581.1_Missense_Mutation_p.S316F	NM_006929.4	NP_008860.4	Q15477	SKIV2_HUMAN	superkiller viralicidic activity 2-like (S. cerevisiae)	509					ATP catabolic process (GO:0006200)	nucleus (GO:0005634)|Ski complex (GO:0055087)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|RNA binding (GO:0003723)			breast(1)|central_nervous_system(1)|large_intestine(1)|ovary(1)	4						TTGCTGGACTCCCGAGGAGCC	0.577																																					p.S509F		Atlas-SNP	.											.	SKIV2L	97	.	0			c.C1526T						.						40.0	43.0	42.0					6																	31931312		2203	4300	6503	SO:0001583	missense	6499	exon14			TGGACTCCCGAGG		CCDS4731.1	6p21	2010-02-17	2001-11-28		ENSG00000204351	ENSG00000204351			10898	protein-coding gene	gene with protein product		600478	"""superkiller viralicidic activity 2 (S. cerevisiae homolog)-like"""	SKIV2		7759100, 9799600	Standard	XM_006715168		Approved	HLP, DDX13, SKI2W, 170A	uc003nyn.1	Q15477	OTTHUMG00000031146	ENST00000375394.2:c.1526C>T	chr6.hg19:g.31931312C>T	ENSP00000364543:p.Ser509Phe	136.0	0.0		102.0	5.0	NM_006929	O15005|Q12902|Q15476|Q5ST66	Missense_Mutation	SNP	ENST00000375394.2	hg19	CCDS4731.1	.	.	.	.	.	.	.	.	.	.	C	17.85	3.490153	0.64074	.	.	ENSG00000204351	ENST00000375394;ENST00000433155;ENST00000544581	T;T	0.50813	0.81;0.73	5.25	5.25	0.73442	.	0.174960	0.49305	D	0.000141	T	0.47857	0.1468	M	0.80982	2.52	0.46396	D	0.999021	B	0.24651	0.108	B	0.33960	0.173	T	0.53885	-0.8375	10	0.72032	D	0.01	-9.5684	17.828	0.88672	0.0:1.0:0.0:0.0	.	509	Q15477	SKIV2_HUMAN	F	509;351;316	ENSP00000364543:S509F;ENSP00000442645:S316F	ENSP00000364543:S509F	S	+	2	0	SKIV2L	32039291	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	4.720000	0.61944	2.733000	0.93635	0.650000	0.86243	TCC	.	.		0.577	SKIV2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076264.3		
NOTCH4	4855	hgsc.bcm.edu	37	6	32187547	32187547	+	Silent	SNP	A	A	G			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr6:32187547A>G	ENST00000375023.3	-	8	1470	c.1332T>C	c.(1330-1332)agT>agC	p.S444S		NM_004557.3	NP_004548.3	Q99466	NOTC4_HUMAN	notch 4	444	EGF-like 11; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				cell differentiation (GO:0030154)|cell fate determination (GO:0001709)|embryo development (GO:0009790)|endothelial cell morphogenesis (GO:0001886)|gene expression (GO:0010467)|hemopoiesis (GO:0030097)|mammary gland development (GO:0030879)|morphogenesis of a branching structure (GO:0001763)|negative regulation of cell differentiation (GO:0045596)|negative regulation of endothelial cell differentiation (GO:0045602)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|patterning of blood vessels (GO:0001569)|positive regulation of transcription of Notch receptor target (GO:0007221)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cell surface (GO:0009986)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|protein heterodimerization activity (GO:0046982)|receptor activity (GO:0004872)			NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(4)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(47)|ovary(5)|prostate(4)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(1)	100						GTTCACAGGGACTTGGGCCTT	0.612																																					p.S444S		Atlas-SNP	.											.	NOTCH4	201	.	0			c.T1332C						.						75.0	53.0	61.0					6																	32187547		1510	2709	4219	SO:0001819	synonymous_variant	4855	exon8			ACAGGGACTTGGG		CCDS34420.1	6p21.3	2013-01-10	2010-06-24		ENSG00000204301	ENSG00000204301		"""Ankyrin repeat domain containing"""	7884	protein-coding gene	gene with protein product		164951	"""Notch (Drosophila) homolog 4"", ""Notch homolog 4 (Drosophila)"""	INT3		7835890	Standard	NM_004557		Approved		uc003obb.3	Q99466	OTTHUMG00000031044	ENST00000375023.3:c.1332T>C	chr6.hg19:g.32187547A>G		151.0	0.0		118.0	5.0	NM_004557	B0V183|B0V1X5|O00306|Q5SSY7|Q99458|Q99940|Q9H3S8|Q9UII9|Q9UIJ0	Silent	SNP	ENST00000375023.3	hg19	CCDS34420.1																																																																																			.	.		0.612	NOTCH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076045.2		
PTK7	5754	hgsc.bcm.edu	37	6	43097478	43097478	+	Silent	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr6:43097478T>C	ENST00000230419.4	+	3	602	c.381T>C	c.(379-381)ggT>ggC	p.G127G	PTK7_ENST00000471863.1_Silent_p.G127G|PTK7_ENST00000349241.2_Silent_p.G127G|PTK7_ENST00000345201.2_Silent_p.G127G|PTK7_ENST00000352931.2_Silent_p.G127G|PTK7_ENST00000481273.1_Silent_p.G135G	NM_002821.4	NP_002812.2	Q13308	PTK7_HUMAN	protein tyrosine kinase 7	127					actin cytoskeleton reorganization (GO:0031532)|axis elongation (GO:0003401)|canonical Wnt signaling pathway (GO:0060070)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|cellular response to retinoic acid (GO:0071300)|cochlea morphogenesis (GO:0090103)|convergent extension (GO:0060026)|establishment of epithelial cell apical/basal polarity (GO:0045198)|establishment of planar polarity (GO:0001736)|lung-associated mesenchyme development (GO:0060484)|neural tube closure (GO:0001843)|peptidyl-tyrosine phosphorylation (GO:0018108)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|positive regulation of neuron projection development (GO:0010976)|signal transduction (GO:0007165)|wound healing (GO:0042060)	cell-cell junction (GO:0005911)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(12)|ovary(2)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	46			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.00784)|OV - Ovarian serous cystadenocarcinoma(102;0.0423)			TTGAGGCAGGTCCTGTGGTCC	0.607											OREG0017449	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.G135G		Atlas-SNP	.											.	PTK7	101	.	0			c.T405C						.						87.0	74.0	79.0					6																	43097478		2203	4300	6503	SO:0001819	synonymous_variant	5754	exon3			GGCAGGTCCTGTG	AF447176	CCDS4884.1, CCDS4885.1, CCDS4886.1, CCDS4887.1, CCDS59021.1	6p21.1-p12.2	2013-02-18	2013-02-18		ENSG00000112655	ENSG00000112655	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9618	protein-coding gene	gene with protein product		601890	"""PTK7 protein tyrosine kinase 7"""			7478540	Standard	NM_002821		Approved	CCK4	uc011dve.2	Q13308	OTTHUMG00000014721	ENST00000230419.4:c.381T>C	chr6.hg19:g.43097478T>C		134.0	0.0	913	85.0	4.0	NM_001270398	A8K974|B7Z477|E9PFZ5|Q13417|Q5T650|Q6IQ54|Q8NFA5|Q8NFA6|Q8NFA7|Q8NFA8	Silent	SNP	ENST00000230419.4	hg19	CCDS4884.1																																																																																			.	.		0.607	PTK7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040580.2		
MAD2L1BP	9587	hgsc.bcm.edu	37	6	43604135	43604135	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr6:43604135A>G	ENST00000372171.4	+	2	121	c.64A>G	c.(64-66)Aag>Gag	p.K22E	MAD2L1BP_ENST00000508232.1_3'UTR|MAD2L1BP_ENST00000451025.2_Missense_Mutation_p.K54E	NM_014628.2	NP_055443.1	Q15013	MD2BP_HUMAN	MAD2L1 binding protein	22					mitotic cell cycle checkpoint (GO:0007093)|regulation of exit from mitosis (GO:0007096)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|intracellular membrane-bounded organelle (GO:0043231)|nucleolus (GO:0005730)|nucleus (GO:0005634)				breast(1)|large_intestine(1)|lung(3)	5	all_cancers(18;9.36e-06)|Lung NSC(15;0.00161)|all_lung(25;0.004)		all cancers(41;0.000351)|Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|STAD - Stomach adenocarcinoma(11;0.0826)|OV - Ovarian serous cystadenocarcinoma(102;0.167)			GTGGTATGAGAAGTCCGAAGA	0.468																																					p.K54E		Atlas-SNP	.											.	MAD2L1BP	12	.	0			c.A160G						.						78.0	77.0	77.0					6																	43604135		2203	4300	6503	SO:0001583	missense	9587	exon3			TATGAGAAGTCCG	BC002904	CCDS4904.1, CCDS47431.1	6p21.1	2003-06-23			ENSG00000124688	ENSG00000124688			21059	protein-coding gene	gene with protein product						7788527, 12456649	Standard	NM_014628		Approved	CMT2, KIAA0110, dJ261G23.1	uc003ovu.3	Q15013	OTTHUMG00000014747	ENST00000372171.4:c.64A>G	chr6.hg19:g.43604135A>G	ENSP00000361244:p.Lys22Glu	82.0	0.0		100.0	4.0	NM_001003690	B4DLV3|E9PAT7|Q6IBB1	Missense_Mutation	SNP	ENST00000372171.4	hg19	CCDS4904.1	.	.	.	.	.	.	.	.	.	.	A	17.24	3.338237	0.60963	.	.	ENSG00000124688	ENST00000451025;ENST00000372171	T	0.13657	2.57	5.69	1.77	0.24775	.	0.448313	0.20991	N	0.082034	T	0.02047	0.0064	N	0.14661	0.345	0.25502	N	0.987542	B;B	0.09022	0.001;0.002	B;B	0.08055	0.002;0.003	T	0.41698	-0.9494	10	0.66056	D	0.02	-0.8498	3.2583	0.06840	0.4998:0.2136:0.2865:0.0	.	22;54	Q15013;E9PAT7	MD2BP_HUMAN;.	E	54;22	ENSP00000410818:K54E	ENSP00000361244:K22E	K	+	1	0	MAD2L1BP	43712113	0.998000	0.40836	0.528000	0.27938	0.523000	0.34469	1.126000	0.31344	0.363000	0.24346	0.459000	0.35465	AAG	.	.		0.468	MAD2L1BP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040692.2	NM_014628	
CRISP3	10321	hgsc.bcm.edu	37	6	49705125	49705125	+	5'Flank	SNP	A	A	G			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr6:49705125A>G	ENST00000393666.1	-	0	0				CRISP3_ENST00000371159.4_Silent_p.G26G|CRISP3_ENST00000423399.2_Intron|CRISP3_ENST00000433368.2_Silent_p.G18G|CRISP3_ENST00000263045.4_Intron			P54108	CRIS3_HUMAN	cysteine-rich secretory protein 3						defense response (GO:0006952)|innate immune response (GO:0045087)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)|specific granule (GO:0042581)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(14)|skin(6)|upper_aerodigestive_tract(1)	27	Lung NSC(77;0.0161)		KIRC - Kidney renal clear cell carcinoma(2;0.106)|Kidney(12;0.156)			GGAAAACAAAACCGGTGGAAC	0.428																																					p.G18G		Atlas-SNP	.											.	CRISP3	67	.	0			c.T54C						.						78.0	77.0	77.0					6																	49705125		2203	4300	6503	SO:0001631	upstream_gene_variant	10321	exon2			AACAAAACCGGTG	X94323	CCDS4929.1, CCDS4929.2, CCDS55019.1	6p12.3	2008-02-05			ENSG00000096006	ENSG00000096006			16904	protein-coding gene	gene with protein product						8665901, 12223513	Standard	NM_006061		Approved	SGP28, CRISP-3, CRS3, dJ442L6.3, Aeg2	uc003ozs.3	P54108	OTTHUMG00000014823		chr6.hg19:g.49705125A>G	Exception_encountered	137.0	0.0		115.0	5.0	NM_001190986	A8K9S1|B2R8I8|Q15512|Q3MJ82|Q53FA9|Q5JW83|Q9H108	Silent	SNP	ENST00000393666.1	hg19																																																																																				.	.		0.428	CRISP3-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_006061	
EYS	346007	hgsc.bcm.edu	37	6	64498005	64498005	+	Silent	SNP	A	A	G			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr6:64498005A>G	ENST00000370621.3	-	39	8242	c.7716T>C	c.(7714-7716)ggT>ggC	p.G2572G	EYS_ENST00000370616.2_Silent_p.G2572G|EYS_ENST00000503581.1_Silent_p.G2572G|EYS_ENST00000486069.1_5'UTR			Q5T1H1	EYS_HUMAN	eyes shut homolog (Drosophila)	2572	Laminin G-like 3. {ECO:0000255|PROSITE- ProRule:PRU00122}.				detection of light stimulus involved in visual perception (GO:0050908)|skeletal muscle tissue regeneration (GO:0043403)	extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(42)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)	69						TACCTTGAAAACCATTTTTAA	0.333																																					p.G2572G		Atlas-SNP	.											.	EYS	527	.	0			c.T7716C						.						124.0	102.0	109.0					6																	64498005		692	1591	2283	SO:0001819	synonymous_variant	346007	exon39			TTGAAAACCATTT		CCDS4967.1, CCDS47445.1, CCDS47446.1	6q12	2014-01-28	2008-10-20	2008-10-20	ENSG00000188107	ENSG00000188107			21555	protein-coding gene	gene with protein product		612424	"""chromosome 6 open reading frame 180"", ""EGF-like-domain, multiple 11"", ""retinitis pigmentosa 25 (autosomal recessive)"", ""EGF-like-domain, multiple 10"", ""chromosome 6 open reading frame 178"", ""chromosome 6 open reading frame 179"""	C6orf180, EGFL11, RP25, EGFL10, C6orf178, C6orf179		18836446, 18976725	Standard	NM_001142800		Approved	dJ1018A4.2, bA166P24.2, SPAM, bA307F22.3, dJ303F19.1, bA74E24.1	uc011dxu.1	Q5T1H1	OTTHUMG00000014971	ENST00000370621.3:c.7716T>C	chr6.hg19:g.64498005A>G		58.0	0.0		56.0	5.0	NM_001142800	A2RUR2|A8MVE7|B7TYK8|B7UUQ3|B7ZBE7|B7ZBE8|B7ZBR3|B9ZVD2|Q5SZM4|Q5T3C8|Q5T669|Q5TEL3|Q5TEL4|Q5VVG4|Q6UY05|Q9H557|Q9NQ15	Silent	SNP	ENST00000370621.3	hg19		.	.	.	.	.	.	.	.	.	.	A	8.281	0.815531	0.16607	.	.	ENSG00000188107	ENST00000398580	.	.	.	4.1	-0.136	0.13473	.	.	.	.	.	T	0.34019	0.0883	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.22277	-1.0221	4	.	.	.	.	4.9725	0.14123	0.2999:0.3246:0.3755:0.0	.	.	.	.	A	344	.	.	V	-	2	0	EYS	64555964	0.970000	0.33590	0.995000	0.50966	0.998000	0.95712	0.006000	0.13152	-0.216000	0.10048	0.533000	0.62120	GTT	.	.		0.333	EYS-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000351351.3	XM_294050	
SENP6	26054	hgsc.bcm.edu	37	6	76388329	76388329	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr6:76388329A>G	ENST00000447266.2	+	15	2357	c.1879A>G	c.(1879-1881)Agc>Ggc	p.S627G	SENP6_ENST00000370014.3_Missense_Mutation_p.S627G|SENP6_ENST00000327284.8_Missense_Mutation_p.S620G|SENP6_ENST00000541192.1_Missense_Mutation_p.S223G|SENP6_ENST00000370010.2_Missense_Mutation_p.S620G	NM_015571.2	NP_056386.2	Q9GZR1	SENP6_HUMAN	SUMO1/sentrin specific peptidase 6	627					protein desumoylation (GO:0016926)|protein modification by small protein removal (GO:0070646)|protein sumoylation (GO:0016925)|regulation of kinetochore assembly (GO:0090234)|regulation of spindle assembly (GO:0090169)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	SUMO-specific protease activity (GO:0016929)			breast(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(2)|lung(12)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	27		all_hematologic(105;0.189)				ACAACTTAGAAGCAAACAAGA	0.308																																					p.S627G		Atlas-SNP	.											.	SENP6	189	.	0			c.A1879G						.						95.0	90.0	92.0					6																	76388329		1796	4060	5856	SO:0001583	missense	26054	exon15			CTTAGAAGCAAAC		CCDS43483.1, CCDS47454.1	6q13-q14.3	2008-02-05	2005-08-17		ENSG00000112701	ENSG00000112701			20944	protein-coding gene	gene with protein product		605003	"""SUMO1/sentrin specific protease 6"""				Standard	NM_015571		Approved	SUSP1, KIAA0797	uc003pid.4	Q9GZR1	OTTHUMG00000015060	ENST00000447266.2:c.1879A>G	chr6.hg19:g.76388329A>G	ENSP00000402527:p.Ser627Gly	120.0	0.0		99.0	4.0	NM_015571	A6NNY9|O94891|Q5VUL3|Q5VUL4|Q8TBY4|Q9UJV5	Missense_Mutation	SNP	ENST00000447266.2	hg19	CCDS47454.1	.	.	.	.	.	.	.	.	.	.	A	15.64	2.893688	0.52121	.	.	ENSG00000112701	ENST00000370010;ENST00000370014;ENST00000327284;ENST00000447266;ENST00000424947;ENST00000541192	T;T;T;T;T;T	0.30981	2.73;2.73;1.53;2.73;1.53;1.51	5.71	5.71	0.89125	.	0.629814	0.18288	N	0.145788	T	0.10852	0.0265	N	0.22421	0.69	0.25468	N	0.987859	B;B;B	0.20164	0.041;0.011;0.042	B;B;B	0.23574	0.047;0.015;0.046	T	0.12941	-1.0528	10	0.25106	T	0.35	-2.5798	15.9778	0.80083	1.0:0.0:0.0:0.0	.	620;627;620	Q9GZR1-2;Q9GZR1;F8W6D9	.;SENP6_HUMAN;.	G	620;627;620;627;517;223	ENSP00000359027:S620G;ENSP00000359031:S627G;ENSP00000321820:S620G;ENSP00000402527:S627G;ENSP00000391426:S517G;ENSP00000441715:S223G	ENSP00000321820:S620G	S	+	1	0	SENP6	76445049	1.000000	0.71417	0.562000	0.28370	0.911000	0.54048	6.379000	0.73154	2.173000	0.68751	0.533000	0.62120	AGC	.	.		0.308	SENP6-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000041272.2	NM_015571	
ME1	4199	hgsc.bcm.edu	37	6	84108172	84108172	+	Silent	SNP	A	A	G			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr6:84108172A>G	ENST00000369705.3	-	3	392	c.276T>C	c.(274-276)tcT>tcC	p.S92S	ME1_ENST00000541327.1_Intron|ME1_ENST00000543031.1_Silent_p.S17S	NM_002395.4	NP_002386.1	P48163	MAOX_HUMAN	malic enzyme 1, NADP(+)-dependent, cytosolic	92					carbohydrate metabolic process (GO:0005975)|cellular lipid metabolic process (GO:0044255)|malate metabolic process (GO:0006108)|NADP biosynthetic process (GO:0006741)|protein tetramerization (GO:0051262)|response to carbohydrate (GO:0009743)|response to hormone (GO:0009725)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|mitochondrion (GO:0005739)	ADP binding (GO:0043531)|electron carrier activity (GO:0009055)|malate dehydrogenase (decarboxylating) (NAD+) activity (GO:0004471)|malate dehydrogenase (decarboxylating) (NADP+) activity (GO:0004473)|malic enzyme activity (GO:0004470)|manganese ion binding (GO:0030145)|NAD binding (GO:0051287)|NADP binding (GO:0050661)|oxaloacetate decarboxylase activity (GO:0008948)			NS(2)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(7)|ovary(2)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	36		all_cancers(76;1.28e-06)|Acute lymphoblastic leukemia(125;5.03e-07)|all_hematologic(105;0.000238)|all_epithelial(107;0.00218)		BRCA - Breast invasive adenocarcinoma(397;0.0641)		TCTCAATGTCAGATGTCAGCA	0.363																																					p.S92S		Atlas-SNP	.											.	ME1	68	.	0			c.T276C						.						70.0	66.0	67.0					6																	84108172		2203	4300	6503	SO:0001819	synonymous_variant	4199	exon3			AATGTCAGATGTC	X77244	CCDS34492.1	6q12	2012-10-02			ENSG00000065833	ENSG00000065833	1.1.1.40		6983	protein-coding gene	gene with protein product		154250				8187880	Standard	NM_002395		Approved		uc003pjy.3	P48163	OTTHUMG00000015111	ENST00000369705.3:c.276T>C	chr6.hg19:g.84108172A>G		128.0	0.0		99.0	4.0	NM_002395	B4DZ70|Q16797|Q16855|Q53F72|Q5VWA2|Q9BWX8|Q9H1W3|Q9UIY4	Silent	SNP	ENST00000369705.3	hg19	CCDS34492.1																																																																																			.	.		0.363	ME1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041350.1		
SNAP91	9892	hgsc.bcm.edu	37	6	84371275	84371275	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr6:84371275T>C	ENST00000439399.2	-	5	714	c.398A>G	c.(397-399)gAa>gGa	p.E133G	SNAP91_ENST00000521743.1_Missense_Mutation_p.E133G|SNAP91_ENST00000369694.2_Missense_Mutation_p.E133G|SNAP91_ENST00000195649.6_Missense_Mutation_p.E133G|SNAP91_ENST00000521485.1_Missense_Mutation_p.E133G|SNAP91_ENST00000437520.1_Missense_Mutation_p.E133G|SNAP91_ENST00000520302.1_Missense_Mutation_p.E133G|SNAP91_ENST00000520213.1_Missense_Mutation_p.E133G|SNAP91_ENST00000428679.2_Missense_Mutation_p.E133G	NM_014841.2	NP_055656.1	O60641	AP180_HUMAN	synaptosomal-associated protein, 91kDa	133	ENTH. {ECO:0000255|PROSITE- ProRule:PRU00243}.				clathrin coat assembly (GO:0048268)|protein transport (GO:0015031)	clathrin coat (GO:0030118)|coated pit (GO:0005905)|plasma membrane (GO:0005886)	1-phosphatidylinositol binding (GO:0005545)|protein kinase binding (GO:0019901)			breast(2)|endometrium(2)|kidney(1)|large_intestine(4)|lung(22)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	37		all_cancers(76;0.000243)|Acute lymphoblastic leukemia(125;2.91e-07)|all_hematologic(105;0.000337)|all_epithelial(107;0.0575)		BRCA - Breast invasive adenocarcinoma(397;0.0967)		AAAAGCCTTTTCATTCAAATA	0.328																																					p.E133G		Atlas-SNP	.											.	SNAP91	199	.	0			c.A398G						.						57.0	56.0	56.0					6																	84371275		1808	4070	5878	SO:0001583	missense	9892	exon5			GCCTTTTCATTCA	AB014556	CCDS47455.1, CCDS56437.1, CCDS56438.1	6q15	2012-12-07	2012-12-07		ENSG00000065609	ENSG00000065609			14986	protein-coding gene	gene with protein product		607923	"""synaptosomal-associated protein, 91 kDa (mouse) homolog"", ""synaptosomal-associated protein, 91kDa homolog (mouse)"""			9734811, 12493563, 10436022	Standard	NM_014841		Approved	KIAA0656, AP180, CALM	uc003pka.3	O60641	OTTHUMG00000015114	ENST00000439399.2:c.398A>G	chr6.hg19:g.84371275T>C	ENSP00000400459:p.Glu133Gly	134.0	0.0		72.0	4.0	NM_001242794	A8K0L7|E5RI02|Q5JX13|Q68DL9|Q6P9D3|Q9NTY7	Missense_Mutation	SNP	ENST00000439399.2	hg19	CCDS47455.1	.	.	.	.	.	.	.	.	.	.	T	25.8	4.679502	0.88542	.	.	ENSG00000065609	ENST00000521485;ENST00000369694;ENST00000439399;ENST00000195649;ENST00000428679;ENST00000437520;ENST00000520302;ENST00000521743;ENST00000520213;ENST00000521931;ENST00000519779;ENST00000518309;ENST00000369690	T;T;T;T;T;T;T;T;T;T;T;T;T	0.37235	1.21;1.21;1.21;1.21;1.21;1.21;1.21;1.21;1.21;1.21;1.21;1.21;1.21	5.13	5.13	0.70059	ENTH/VHS (2);ANTH (1);Epsin-like, N-terminal (2);	0.099801	0.64402	D	0.000002	T	0.65037	0.2653	H	0.94847	3.59	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;0.996;1.0	D;D;D;D	0.83275	0.996;0.995;0.921;0.995	T	0.77000	-0.2750	10	0.87932	D	0	-16.6735	15.2297	0.73378	0.0:0.0:0.0:1.0	.	133;133;133;133	O60641-3;E5RI02;O60641;E1P549	.;.;AP180_HUMAN;.	G	133	ENSP00000429776:E133G;ENSP00000358708:E133G;ENSP00000400459:E133G;ENSP00000195649:E133G;ENSP00000412492:E133G;ENSP00000413277:E133G;ENSP00000428511:E133G;ENSP00000428215:E133G;ENSP00000428026:E133G;ENSP00000430071:E133G;ENSP00000429429:E133G;ENSP00000430441:E133G;ENSP00000358704:E133G	ENSP00000195649:E133G	E	-	2	0	SNAP91	84427994	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.932000	0.87634	2.056000	0.61249	0.460000	0.39030	GAA	.	.		0.328	SNAP91-007	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000375296.1		
MANEA	79694	hgsc.bcm.edu	37	6	96052708	96052708	+	Silent	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr6:96052708T>C	ENST00000358812.4	+	4	794	c.660T>C	c.(658-660)acT>acC	p.T220T	MANEA_ENST00000474553.1_3'UTR	NM_024641.3	NP_078917.2	Q5SRI9	MANEA_HUMAN	mannosidase, endo-alpha	220	Catalytic. {ECO:0000305}.				cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	glycoprotein endo-alpha-1,2-mannosidase activity (GO:0004569)			breast(2)|endometrium(3)|kidney(2)|liver(2)|lung(13)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	26		all_cancers(76;1.01e-06)|Acute lymphoblastic leukemia(125;3.58e-09)|all_hematologic(75;1.22e-06)|all_epithelial(107;0.00433)|Colorectal(196;0.0341)		BRCA - Breast invasive adenocarcinoma(108;0.148)		TTTAGGTTACTTTTCACATAG	0.229																																					p.T220T		Atlas-SNP	.											.	MANEA	58	.	0			c.T660C						.						28.0	29.0	29.0					6																	96052708		2157	4207	6364	SO:0001819	synonymous_variant	79694	exon4			GGTTACTTTTCAC	AK022900	CCDS5032.1	6q16.2	2008-02-05			ENSG00000172469	ENSG00000172469			21072	protein-coding gene	gene with protein product		612327					Standard	NM_024641		Approved	FLJ12838, mandaselin	uc003poo.2	Q5SRI9	OTTHUMG00000016296	ENST00000358812.4:c.660T>C	chr6.hg19:g.96052708T>C		171.0	0.0		92.0	4.0	NM_024641	A6H8M6|Q5SRJ0|Q6MZV0|Q70JE9|Q7Z3V7|Q8WWX5|Q9H9D2	Silent	SNP	ENST00000358812.4	hg19	CCDS5032.1																																																																																			.	.		0.229	MANEA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043644.1	NM_024641	
HACE1	57531	hgsc.bcm.edu	37	6	105244550	105244550	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr6:105244550C>T	ENST00000262903.4	-	9	1072	c.796G>A	c.(796-798)Gaa>Aaa	p.E266K	HACE1_ENST00000369125.2_Missense_Mutation_p.E266K	NM_020771.3	NP_065822.2	Q8IYU2	HACE1_HUMAN	HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1	266					cell cycle (GO:0007049)|Golgi organization (GO:0007030)|membrane fusion (GO:0061025)|protein K48-linked ubiquitination (GO:0070936)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|Rac protein signal transduction (GO:0016601)|regulation of cell migration (GO:0030334)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	endoplasmic reticulum (GO:0005783)|Golgi membrane (GO:0000139)|nucleus (GO:0005634)	ligase activity (GO:0016874)|Rab GTPase binding (GO:0017137)|Rac GTPase binding (GO:0048365)|ubiquitin-protein transferase activity (GO:0004842)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(11)|lung(17)|ovary(5)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)	44		all_cancers(87;6.89e-05)|Acute lymphoblastic leukemia(125;1.9e-08)|all_hematologic(75;9.25e-07)|all_epithelial(87;0.0216)|Colorectal(196;0.202)		BRCA - Breast invasive adenocarcinoma(108;0.122)|Epithelial(106;0.204)		CGGAGGTCTTCATTCTGTGTC	0.338																																					p.E266K		Atlas-SNP	.											.	HACE1	96	.	0			c.G796A						.						81.0	81.0	81.0					6																	105244550		2203	4298	6501	SO:0001583	missense	57531	exon9			GGTCTTCATTCTG	BC034982	CCDS5050.1	6q21	2013-01-10	2012-02-23		ENSG00000085382	ENSG00000085382		"""Ankyrin repeat domain containing"""	21033	protein-coding gene	gene with protein product		610876				10718198	Standard	NM_020771		Approved	KIAA1320	uc003pqu.1	Q8IYU2	OTTHUMG00000015287	ENST00000262903.4:c.796G>A	chr6.hg19:g.105244550C>T	ENSP00000262903:p.Glu266Lys	114.0	0.0		44.0	23.0	NM_020771	A8K6U5|B3KY89|B4DFM6|B4DTQ4|B7Z9X6|E9PGP0|Q5VU99|Q5VUA0|Q8ND12|Q9P2M6	Missense_Mutation	SNP	ENST00000262903.4	hg19	CCDS5050.1	.	.	.	.	.	.	.	.	.	.	C	27.2	4.811993	0.90707	.	.	ENSG00000085382	ENST00000262903;ENST00000369125	T;T	0.36520	1.25;1.29	5.6	5.6	0.85130	.	0.093200	0.64402	D	0.000001	T	0.13415	0.0325	N	0.19112	0.55	0.58432	D	0.999999	P;P	0.34522	0.455;0.455	B;B	0.27076	0.076;0.076	T	0.05099	-1.0906	10	0.22109	T	0.4	.	19.6045	0.95575	0.0:1.0:0.0:0.0	.	266;266	E9PGP0;Q8IYU2	.;HACE1_HUMAN	K	266	ENSP00000262903:E266K;ENSP00000358121:E266K	ENSP00000262903:E266K	E	-	1	0	HACE1	105351243	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.400000	0.66320	2.623000	0.88846	0.585000	0.79938	GAA	.	.		0.338	HACE1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041643.2	XM_045095	
AIM1	202	hgsc.bcm.edu	37	6	106960807	106960807	+	Silent	SNP	A	A	G			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr6:106960807A>G	ENST00000369066.3	+	1	1078	c.591A>G	c.(589-591)agA>agG	p.R197R		NM_001624.2	NP_001615	Q9UMX9	S45A2_HUMAN	absent in melanoma 1	0					developmental pigmentation (GO:0048066)|melanin biosynthetic process (GO:0042438)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)				breast(8)|central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(7)|large_intestine(13)|lung(20)|ovary(5)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	69	Breast(9;0.0138)|all_epithelial(6;0.169)	all_cancers(87;4.67e-25)|all_epithelial(87;5.46e-21)|Acute lymphoblastic leukemia(125;2.15e-07)|all_hematologic(75;5.28e-06)|Colorectal(196;3.46e-05)|all_lung(197;5.94e-05)|Lung NSC(302;7.26e-05)|Ovarian(999;0.00473)	Epithelial(6;0.00114)|all cancers(7;0.00726)|BRCA - Breast invasive adenocarcinoma(8;0.0114)|OV - Ovarian serous cystadenocarcinoma(5;0.0305)	all cancers(137;1.73e-50)|Epithelial(106;2.42e-48)|OV - Ovarian serous cystadenocarcinoma(136;1.51e-27)|BRCA - Breast invasive adenocarcinoma(108;0.00104)|GBM - Glioblastoma multiforme(226;0.00858)		GTCGAAGCAGAGAGCTGGGCA	0.657																																					p.R197R		Atlas-SNP	.											.	AIM1	161	.	0			c.A591G						.						13.0	18.0	16.0					6																	106960807		2195	4289	6484	SO:0001819	synonymous_variant	202	exon1			AAGCAGAGAGCTG	U83115	CCDS34506.1	6q21	2014-01-29			ENSG00000112297	ENSG00000112297			356	protein-coding gene	gene with protein product	"""suppression of tumorigenicity 4"", ""beta-gamma crystallin domain containing 1"""	601797	"""suppression of tumorigenicity 4 (malignant melanoma)"""	ST4		1680551, 12693952	Standard	NM_001624		Approved	CRYBG1	uc003prh.3	Q9Y4K1	OTTHUMG00000015302	ENST00000369066.3:c.591A>G	chr6.hg19:g.106960807A>G		81.0	0.0		79.0	4.0	NM_001624	Q6P2P0|Q9BTM3	Silent	SNP	ENST00000369066.3	hg19	CCDS34506.1																																																																																			.	.		0.657	AIM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041669.1		
SNX3	8724	hgsc.bcm.edu	37	6	108544209	108544209	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr6:108544209C>T	ENST00000230085.8	-	2	541	c.203G>A	c.(202-204)aGa>aAa	p.R68K	SNX3_ENST00000426155.2_Intron|SNX3_ENST00000368982.4_Missense_Mutation_p.R68K|SNX3_ENST00000349379.5_Missense_Mutation_p.R46K	NM_003795.4	NP_003786.1	O60493	SNX3_HUMAN	sorting nexin 3	68	PX. {ECO:0000255|PROSITE- ProRule:PRU00147}.				hemoglobin biosynthetic process (GO:0042541)|intracellular protein transport (GO:0006886)|intralumenal vesicle formation (GO:0070676)|membrane invagination (GO:0010324)|negative regulation of early endosome to late endosome transport (GO:2000642)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of protein transport (GO:0051224)|negative regulation of viral entry into host cell (GO:0046597)|regulation of cellular protein metabolic process (GO:0032268)|regulation of intracellular protein transport (GO:0033157)|transferrin transport (GO:0033572)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|early endosome membrane (GO:0031901)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)	phosphatidylinositol-3-phosphate binding (GO:0032266)|protein phosphatase binding (GO:0019903)			large_intestine(1)	1		all_cancers(87;3.82e-07)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;0.000195)|Colorectal(196;0.0293)|all_lung(197;0.0938)		BRCA - Breast invasive adenocarcinoma(108;0.0136)|Epithelial(106;0.0564)|OV - Ovarian serous cystadenocarcinoma(136;0.0717)|all cancers(137;0.0743)		GTATCTTCTTCTAACAGTAGA	0.328																																					p.R68K		Atlas-SNP	.											.	SNX3	11	.	0			c.G203A						.						85.0	78.0	80.0					6																	108544209		2203	4297	6500	SO:0001583	missense	8724	exon2			CTTCTTCTAACAG	AF034546	CCDS5064.1, CCDS5065.1, CCDS75501.1	6q21	2010-08-05			ENSG00000112335	ENSG00000112335		"""Sorting nexins"""	11174	protein-coding gene	gene with protein product		605930				9819414	Standard	XM_005267192		Approved	Grd19	uc003psh.3	O60493	OTTHUMG00000015323	ENST00000230085.8:c.203G>A	chr6.hg19:g.108544209C>T	ENSP00000230085:p.Arg68Lys	71.0	0.0		50.0	4.0	NM_003795	A8K0B1|E1P5E4|E1P5E5|O60718|Q4TT29|Q4TT31|Q5JXJ7|Q5JXJ8|Q96AP9|Q9C0J5|Q9NU45	Missense_Mutation	SNP	ENST00000230085.8	hg19	CCDS5064.1	.	.	.	.	.	.	.	.	.	.	C	20.8	4.044505	0.75732	.	.	ENSG00000112335	ENST00000230085;ENST00000349379;ENST00000368982	T;T;T	0.36699	1.24;1.24;1.24	6.08	6.08	0.98989	Phox homologous domain (5);	0.129957	0.64402	D	0.000004	T	0.31136	0.0787	M	0.64080	1.96	0.80722	D	1	B	0.09022	0.002	B	0.28991	0.097	T	0.06899	-1.0801	10	0.29301	T	0.29	-16.5963	20.6647	0.99678	0.0:1.0:0.0:0.0	.	68	O60493	SNX3_HUMAN	K	68;46;68	ENSP00000230085:R68K;ENSP00000296991:R46K;ENSP00000357978:R68K	ENSP00000230085:R68K	R	-	2	0	SNX3	108650902	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.800000	0.62524	2.890000	0.99128	0.655000	0.94253	AGA	.	.		0.328	SNX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041717.1		
DCBLD1	285761	hgsc.bcm.edu	37	6	117861869	117861869	+	Silent	SNP	A	A	G			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr6:117861869A>G	ENST00000338728.5	+	10	1260	c.1140A>G	c.(1138-1140)caA>caG	p.Q380Q	DCBLD1_ENST00000296955.8_Silent_p.Q380Q|GOPC_ENST00000467125.1_Intron|DCBLD1_ENST00000534777.1_3'UTR|DCBLD1_ENST00000368503.4_Intron			Q8N8Z6	DCBD1_HUMAN	discoidin, CUB and LCCL domain containing 1	380	F5/8 type C. {ECO:0000255|PROSITE- ProRule:PRU00081}.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(15)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	26		all_cancers(87;0.171)		GBM - Glioblastoma multiforme(226;0.0447)|OV - Ovarian serous cystadenocarcinoma(136;0.0921)|all cancers(137;0.125)		ACCCAGTGCAAAACAATTTCA	0.448																																					p.Q380Q		Atlas-SNP	.											.	DCBLD1	56	.	0			c.A1140G						.						133.0	133.0	133.0					6																	117861869		2203	4300	6503	SO:0001819	synonymous_variant	285761	exon10			AGTGCAAAACAAT	AK055462	CCDS34522.1	6q22.31	2003-06-20			ENSG00000164465	ENSG00000164465			21479	protein-coding gene	gene with protein product							Standard	NM_173674		Approved	MGC46341, dJ94G16.1	uc003pxs.3	Q8N8Z6	OTTHUMG00000015455	ENST00000338728.5:c.1140A>G	chr6.hg19:g.117861869A>G		131.0	0.0		95.0	4.0	NM_173674	Q5H992|Q8IYK5|Q8N7L9|Q96NH2	Silent	SNP	ENST00000338728.5	hg19																																																																																				.	.		0.448	DCBLD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000041979.2	NM_173674	
HDDC2	51020	hgsc.bcm.edu	37	6	125619942	125619942	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr6:125619942A>G	ENST00000398153.2	-	3	269	c.227T>C	c.(226-228)gTt>gCt	p.V76A	HDDC2_ENST00000608284.1_Missense_Mutation_p.V76A|HDDC2_ENST00000368377.4_Intron|HDDC2_ENST00000608295.1_Missense_Mutation_p.V76A	NM_016063.2	NP_057147.2	Q7Z4H3	HDDC2_HUMAN	HD domain containing 2	76	HD.					extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)				endometrium(1)|large_intestine(1)|lung(4)	6			LUSC - Lung squamous cell carcinoma(4;0.0263)|Lung(4;0.0828)	GBM - Glioblastoma multiforme(226;0.0186)		CATATCATGAACCAGGGCTAG	0.403																																					p.V76A		Atlas-SNP	.											.	HDDC2	21	.	0			c.T227C						.						174.0	151.0	158.0					6																	125619942		1918	4165	6083	SO:0001583	missense	51020	exon3			TCATGAACCAGGG	AF151888	CCDS43503.1	6q13-q24.3	2008-02-05	2005-08-22	2005-08-22	ENSG00000111906	ENSG00000111906			21078	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 74"""	C6orf74		10810093	Standard	NM_016063		Approved	CGI-130, dJ167O5.2	uc003qaa.1	Q7Z4H3	OTTHUMG00000015506	ENST00000398153.2:c.227T>C	chr6.hg19:g.125619942A>G	ENSP00000381220:p.Val76Ala	131.0	0.0		89.0	4.0	NM_016063	Q5TDQ4|Q6NZ49|Q9BTT2|Q9BV31|Q9Y3D1	Missense_Mutation	SNP	ENST00000398153.2	hg19	CCDS43503.1	.	.	.	.	.	.	.	.	.	.	A	28.5	4.922341	0.92319	.	.	ENSG00000111906	ENST00000398153	T	0.48836	0.8	5.53	5.53	0.82687	Metal-dependent phosphohydrolase, HD domain (1);Metal-dependent phosphohydrolase, HD subdomain (1);HD domain (1);	0.000000	0.64402	U	0.000001	T	0.67988	0.2952	M	0.92268	3.29	0.80722	D	1	D	0.59767	0.986	P	0.61328	0.887	T	0.77616	-0.2521	10	0.87932	D	0	.	14.9197	0.70829	1.0:0.0:0.0:0.0	.	76	Q7Z4H3	HDDC2_HUMAN	A	76	ENSP00000381220:V76A	ENSP00000381220:V76A	V	-	2	0	HDDC2	125661641	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	8.852000	0.92215	2.229000	0.72834	0.533000	0.62120	GTT	.	.		0.403	HDDC2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000472493.1	NM_016063	
ENPP3	5169	hgsc.bcm.edu	37	6	132047295	132047295	+	Silent	SNP	A	A	G			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr6:132047295A>G	ENST00000414305.1	+	21	2236	c.1908A>G	c.(1906-1908)aaA>aaG	p.K636K	ENPP3_ENST00000358229.5_Silent_p.K636K|ENPP3_ENST00000357639.3_Silent_p.K636K			O14638	ENPP3_HUMAN	ectonucleotide pyrophosphatase/phosphodiesterase 3	636	Nuclease.				immune response (GO:0006955)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleoside triphosphate catabolic process (GO:0009143)|phosphate-containing compound metabolic process (GO:0006796)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|perinuclear region of cytoplasm (GO:0048471)	metal ion binding (GO:0046872)|NADH pyrophosphatase activity (GO:0035529)|nucleic acid binding (GO:0003676)|nucleoside-triphosphate diphosphatase activity (GO:0047429)|nucleotide diphosphatase activity (GO:0004551)|phosphodiesterase I activity (GO:0004528)|polysaccharide binding (GO:0030247)|scavenger receptor activity (GO:0005044)			NS(1)|breast(2)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(5)|lung(24)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	53	Breast(56;0.0753)			GBM - Glioblastoma multiforme(226;0.0252)|OV - Ovarian serous cystadenocarcinoma(155;0.0511)		GATTTGGAAAAGCTATGAGGA	0.448																																					p.K636K		Atlas-SNP	.											.	ENPP3	117	.	0			c.A1908G						.						173.0	162.0	166.0					6																	132047295		2203	4300	6503	SO:0001819	synonymous_variant	5169	exon20			TGGAAAAGCTATG	AF005632	CCDS5148.1	6q22	2010-06-23			ENSG00000154269	ENSG00000154269	3.1.4.1, 3.6.1.9	"""CD molecules"""	3358	protein-coding gene	gene with protein product		602182		PDNP3		9344668	Standard	NM_005021		Approved	PD-IBETA, gp130RB13-6, B10, CD203c	uc003qcv.3	O14638	OTTHUMG00000016292	ENST00000414305.1:c.1908A>G	chr6.hg19:g.132047295A>G		156.0	0.0		98.0	4.0	NM_005021	Q5JTL3	Silent	SNP	ENST00000414305.1	hg19	CCDS5148.1																																																																																			.	.		0.448	ENPP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043627.2		
NHSL1	57224	hgsc.bcm.edu	37	6	138753581	138753581	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr6:138753581T>C	ENST00000427025.2	-	5	2541	c.1913A>G	c.(1912-1914)cAc>cGc	p.H638R	MIR3145_ENST00000580727.1_RNA|NHSL1_ENST00000343505.5_Missense_Mutation_p.H634R	NM_020464.1	NP_065197.1	Q5SYE7	NHSL1_HUMAN	NHS-like 1	638										breast(2)|endometrium(4)|kidney(1)	7						GATCACGCTGTGCCTGGGGTT	0.473																																					p.H638R		Atlas-SNP	.											.	NHSL1	99	.	0			c.A1913G						.						144.0	122.0	129.0					6																	138753581		692	1591	2283	SO:0001583	missense	57224	exon5			ACGCTGTGCCTGG	AB037778	CCDS47487.1, CCDS55063.1	6q23.3	2009-02-18	2004-10-07	2004-10-07	ENSG00000135540	ENSG00000135540			21021	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 63"""	C6orf63			Standard	NM_001144060		Approved	bA43P8.1, KIAA1357	uc011edp.2	Q5SYE7	OTTHUMG00000016321	ENST00000427025.2:c.1913A>G	chr6.hg19:g.138753581T>C	ENSP00000394546:p.His638Arg	128.0	0.0		75.0	4.0	NM_020464	Q3ZCS5|Q5SYE8|Q9P2J0	Missense_Mutation	SNP	ENST00000427025.2	hg19	CCDS55063.1	.	.	.	.	.	.	.	.	.	.	T	13.63	2.293176	0.40594	.	.	ENSG00000135540	ENST00000427025;ENST00000343505	T;T	0.36340	1.26;1.74	5.14	3.89	0.44902	.	0.261346	0.36409	N	0.002616	T	0.20007	0.0481	L	0.55834	1.745	0.47547	D	0.99945	P;P	0.42456	0.78;0.78	B;B	0.36959	0.237;0.237	T	0.09015	-1.0694	10	0.56958	D	0.05	-14.7625	11.9114	0.52741	0.0:0.0:0.1453:0.8547	.	634;638	E2QRJ1;Q5SYE7	.;NHSL1_HUMAN	R	638;634	ENSP00000394546:H638R;ENSP00000344672:H634R	ENSP00000344672:H634R	H	-	2	0	NHSL1	138795274	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	3.961000	0.56759	2.066000	0.61787	0.533000	0.62120	CAC	.	.		0.473	NHSL1-001	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000043700.2	XM_050421	
ZC3H12D	340152	hgsc.bcm.edu	37	6	149783104	149783104	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr6:149783104T>C	ENST00000409806.3	-	3	626	c.308A>G	c.(307-309)cAt>cGt	p.H103R	ZC3H12D_ENST00000409948.1_Missense_Mutation_p.H103R|ZC3H12D_ENST00000389942.5_Missense_Mutation_p.H103R|ZC3H12D_ENST00000542614.1_Missense_Mutation_p.H103R|ZC3H12D_ENST00000416573.2_Missense_Mutation_p.H103R			A2A288	ZC12D_HUMAN	zinc finger CCCH-type containing 12D	103					negative regulation of cell growth (GO:0030308)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	endonuclease activity (GO:0004519)|metal ion binding (GO:0046872)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(1)|prostate(1)	6		Ovarian(120;0.0907)		OV - Ovarian serous cystadenocarcinoma(155;1.23e-11)|GBM - Glioblastoma multiforme(68;0.0921)		TTTATTTCCATGGCTACAATG	0.443																																					p.H103R		Atlas-SNP	.											.	ZC3H12D	21	.	0			c.A308G						.						46.0	46.0	46.0					6																	149783104		1914	4129	6043	SO:0001583	missense	340152	exon3			TTTCCATGGCTAC			6q25.1	2012-07-05	2005-06-30	2005-06-30	ENSG00000178199	ENSG00000178199		"""Zinc fingers, CCCH-type domain containing"""	21175	protein-coding gene	gene with protein product	"""MCP induced protein 4"""	611106	"""chromosome 6 open reading frame 95"""	C6orf95		18178554	Standard	NM_207360		Approved	dJ281H8.1, MCPIP4	uc010kid.3	A2A288	OTTHUMG00000015786	ENST00000409806.3:c.308A>G	chr6.hg19:g.149783104T>C	ENSP00000386616:p.His103Arg	94.0	0.0		41.0	4.0	NM_207360	A1L178|B2RXF4|B7WNU7|B9ZZP9|B9ZZQ0|Q6ZRW2	Missense_Mutation	SNP	ENST00000409806.3	hg19		.	.	.	.	.	.	.	.	.	.	T	24.0	4.478196	0.84747	.	.	ENSG00000178199	ENST00000389942;ENST00000416573;ENST00000409806;ENST00000542614;ENST00000409948	T;T;T;T;T	0.52295	0.67;0.67;0.67;0.67;0.67	5.19	5.19	0.71726	Ribonuclease Zc3h12a-like (1);	0.000000	0.85682	D	0.000000	T	0.67439	0.2893	M	0.86420	2.815	0.53005	D	0.999969	D;D	0.89917	0.999;1.0	D;D	0.87578	0.996;0.998	T	0.74951	-0.3489	10	0.87932	D	0	-15.4523	15.2075	0.73190	0.0:0.0:0.0:1.0	.	103;103	A2A288;B7WNU7	ZC12D_HUMAN;.	R	103	ENSP00000374592:H103R;ENSP00000408686:H103R;ENSP00000386616:H103R;ENSP00000440813:H103R;ENSP00000387062:H103R	ENSP00000374592:H103R	H	-	2	0	ZC3H12D	149824797	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.388000	0.79795	2.187000	0.69744	0.460000	0.39030	CAT	.	.		0.443	ZC3H12D-003	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000286400.2	NM_207360	
KATNA1	11104	hgsc.bcm.edu	37	6	149959680	149959680	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr6:149959680T>C	ENST00000335647.5	-	1	48	c.4A>G	c.(4-6)Agt>Ggt	p.S2G	KATNA1_ENST00000335643.8_Missense_Mutation_p.S2G|KATNA1_ENST00000367411.2_Missense_Mutation_p.S2G					katanin p60 (ATPase containing) subunit A 1									p.S2G(1)		endometrium(1)|kidney(1)|large_intestine(2)|lung(5)|ovary(1)|skin(1)|urinary_tract(1)	12		Ovarian(120;0.0164)		OV - Ovarian serous cystadenocarcinoma(155;2.95e-12)|GBM - Glioblastoma multiforme(68;0.173)		ATAAGAAGACTCATGTTCAAC	0.328																																					p.S2G		Atlas-SNP	.											KATNA1,NS,carcinoma,0,1	KATNA1	34	.	1	Substitution - Missense(1)	lung(1)	c.A4G						.						124.0	130.0	128.0					6																	149959680		2203	4300	6503	SO:0001583	missense	11104	exon2			GAAGACTCATGTT	AF056022	CCDS5217.1, CCDS56456.1	6q24.3	2011-01-25	2011-01-25		ENSG00000186625	ENSG00000186625		"""ATPases / AAA-type"""	6216	protein-coding gene	gene with protein product		606696	"""katanin p60 (ATPase-containing) subunit A 1"""			9658175	Standard	NM_007044		Approved		uc003qms.3	O75449	OTTHUMG00000015787	ENST00000335647.5:c.4A>G	chr6.hg19:g.149959680T>C	ENSP00000335106:p.Ser2Gly	93.0	0.0		57.0	3.0	NM_007044		Missense_Mutation	SNP	ENST00000335647.5	hg19	CCDS5217.1	.	.	.	.	.	.	.	.	.	.	T	22.2	4.257679	0.80246	.	.	ENSG00000186625	ENST00000335647;ENST00000335643;ENST00000367411;ENST00000444282;ENST00000420200	D;D;D;D	0.96168	-3.48;-3.69;-3.48;-3.93	5.75	5.75	0.90469	.	0.075885	0.85682	D	0.000000	D	0.93400	0.7895	L	0.55481	1.735	0.58432	D	0.999998	P;P;P	0.45715	0.859;0.865;0.859	B;P;B	0.46940	0.403;0.532;0.403	D	0.92941	0.6372	9	.	.	.	.	16.1166	0.81309	0.0:0.0:0.0:1.0	.	2;2;2	A8K7S5;O75449-2;O75449	.;.;KTNA1_HUMAN	G	2	ENSP00000335106:S2G;ENSP00000335180:S2G;ENSP00000356381:S2G;ENSP00000390322:S2G	.	S	-	1	0	KATNA1	150001373	1.000000	0.71417	1.000000	0.80357	0.923000	0.55619	7.692000	0.84203	2.204000	0.70986	0.529000	0.55759	AGT	.	.		0.328	KATNA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042641.2	NM_007044	
PLEKHG1	57480	hgsc.bcm.edu	37	6	151161732	151161732	+	Silent	SNP	A	A	G			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr6:151161732A>G	ENST00000358517.2	+	16	4069	c.3858A>G	c.(3856-3858)gaA>gaG	p.E1286E	PLEKHG1_ENST00000367328.1_Silent_p.E1286E			Q9ULL1	PKHG1_HUMAN	pleckstrin homology domain containing, family G (with RhoGef domain) member 1	1286							Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(3)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(10)|lung(19)|ovary(5)|prostate(4)|stomach(1)|urinary_tract(3)	53			BRCA - Breast invasive adenocarcinoma(37;0.0923)	OV - Ovarian serous cystadenocarcinoma(155;6.69e-13)		TCAAGTCAGAAGAAGATGAGT	0.388																																					p.E1286E		Atlas-SNP	.											.	PLEKHG1	97	.	0			c.A3858G						.						107.0	109.0	109.0					6																	151161732		2203	4300	6503	SO:0001819	synonymous_variant	57480	exon17			GTCAGAAGAAGAT	AB033035	CCDS34552.1	6q25.1	2013-01-11			ENSG00000120278	ENSG00000120278		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	20884	protein-coding gene	gene with protein product						10574462	Standard	XM_005267064		Approved	KIAA1209, ARHGEF41	uc003qny.1	Q9ULL1	OTTHUMG00000015824	ENST00000358517.2:c.3858A>G	chr6.hg19:g.151161732A>G		157.0	0.0		97.0	4.0	NM_001029884	Q5T1F2	Silent	SNP	ENST00000358517.2	hg19	CCDS34552.1																																																																																			.	.		0.388	PLEKHG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042691.1		
SYNE1	23345	hgsc.bcm.edu	37	6	152763360	152763360	+	Silent	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr6:152763360T>C	ENST00000367255.5	-	31	4459	c.3858A>G	c.(3856-3858)tcA>tcG	p.S1286S	SYNE1_ENST00000341594.5_Silent_p.S1352S|SYNE1_ENST00000367248.3_Silent_p.S1276S|SYNE1_ENST00000265368.4_Silent_p.S1286S|SYNE1_ENST00000423061.1_Silent_p.S1293S|SYNE1_ENST00000448038.1_Silent_p.S1293S|SYNE1_ENST00000367253.4_Silent_p.S1286S|SYNE1_ENST00000413186.2_Silent_p.S1286S	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	1286					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		TCTTCTTTGCTGAGATCCGCT	0.522										HNSCC(10;0.0054)																											p.S1293S		Atlas-SNP	.											.	SYNE1	3227	.	0			c.A3879G						.						78.0	68.0	71.0					6																	152763360		2203	4300	6503	SO:0001819	synonymous_variant	23345	exon31			CTTTGCTGAGATC	AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.3858A>G	chr6.hg19:g.152763360T>C		107.0	0.0		73.0	4.0	NM_033071	E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Silent	SNP	ENST00000367255.5	hg19	CCDS5236.2																																																																																			.	.		0.522	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000334755.2	NM_182961	
SLC22A3	6581	hgsc.bcm.edu	37	6	160857848	160857848	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr6:160857848T>C	ENST00000275300.2	+	6	1164	c.1012T>C	c.(1012-1014)Ttt>Ctt	p.F338L	SLC22A3_ENST00000392145.1_Missense_Mutation_p.F338L	NM_021977.3	NP_068812.1	O75751	S22A3_HUMAN	solute carrier family 22 (organic cation transporter), member 3	338					dopamine transport (GO:0015872)|drug transmembrane transport (GO:0006855)|histamine uptake (GO:0051615)|organic cation transport (GO:0015695)|quaternary ammonium group transport (GO:0015697)|regulation of appetite (GO:0032098)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	dopamine transmembrane transporter activity (GO:0005329)|organic cation transmembrane transporter activity (GO:0015101)|quaternary ammonium group transmembrane transporter activity (GO:0015651)|toxin transporter activity (GO:0019534)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(5)|ovary(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	27		Breast(66;0.00028)|Ovarian(120;0.0308)|Prostate(117;0.218)		OV - Ovarian serous cystadenocarcinoma(65;9.47e-17)|BRCA - Breast invasive adenocarcinoma(81;9.75e-06)	Adefovir Dipivoxil(DB00718)|Amphetamine(DB00182)|Choline(DB00122)|Cimetidine(DB00501)|Clonidine(DB00575)|Colchicine(DB01394)|Desipramine(DB01151)|Dopamine(DB00988)|Estradiol(DB00783)|Guanidine(DB00536)|Histamine Phosphate(DB00667)|Imipramine(DB00458)|Irinotecan(DB00762)|Lamivudine(DB00709)|Melphalan(DB01042)|Metformin(DB00331)|Methamphetamine(DB01577)|Nicotine(DB00184)|Norepinephrine(DB00368)|Oxaliplatin(DB00526)|Phenoxybenzamine(DB00925)|Prazosin(DB00457)|Procainamide(DB01035)|Progesterone(DB00396)|Testosterone(DB00624)|Vincristine(DB00541)	TAATCCATCCTTTTTAGATCT	0.338																																					p.F338L		Atlas-SNP	.											.	SLC22A3	58	.	0			c.T1012C						.						114.0	103.0	107.0					6																	160857848		2203	4300	6503	SO:0001583	missense	6581	exon6			CCATCCTTTTTAG	AF078749	CCDS5277.1	6q25.3	2013-07-18	2013-07-18		ENSG00000146477	ENSG00000146477		"""Solute carriers"""	10967	protein-coding gene	gene with protein product		604842	"""solute carrier family 22 (extraneuronal monoamine transporter), member 3"""			9632645, 9933568	Standard	NM_021977		Approved	OCT3, EMT	uc003qti.4	O75751	OTTHUMG00000015953	ENST00000275300.2:c.1012T>C	chr6.hg19:g.160857848T>C	ENSP00000275300:p.Phe338Leu	130.0	0.0		100.0	4.0	NM_021977	Q5SYN6|Q9UP02	Missense_Mutation	SNP	ENST00000275300.2	hg19	CCDS5277.1	.	.	.	.	.	.	.	.	.	.	T	13.92	2.382332	0.42207	.	.	ENSG00000146477	ENST00000275300;ENST00000392145	T;T	0.56776	0.44;0.44	5.73	3.23	0.37069	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.288191	0.34676	N	0.003772	T	0.13713	0.0332	L	0.29908	0.895	0.30549	N	0.76569	B	0.10296	0.003	B	0.17722	0.019	T	0.23368	-1.0190	10	0.11182	T	0.66	.	5.2391	0.15462	0.298:0.0738:0.0:0.6282	.	338	O75751	S22A3_HUMAN	L	338	ENSP00000275300:F338L;ENSP00000375989:F338L	ENSP00000275300:F338L	F	+	1	0	SLC22A3	160777838	1.000000	0.71417	0.981000	0.43875	0.988000	0.76386	1.065000	0.30592	0.382000	0.24878	-0.438000	0.05819	TTT	.	.		0.338	SLC22A3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000042953.1	NM_021977	
LFNG	3955	hgsc.bcm.edu	37	7	2552910	2552911	+	Missense_Mutation	DNP	AG	AG	GA	rs199517402		TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	A|G	A|G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr7:2552910_2552911AG>GA	ENST00000402506.1	+	2	293_294	c.167_168AG>GA	c.(166-168)gAG>gGA	p.E56G		NM_001166355.1	NP_001159827.1	Q8NES3	LFNG_HUMAN	LFNG O-fucosylpeptide 3-beta-N-acetylglucosaminyltransferase	0					compartment pattern specification (GO:0007386)|female meiotic division (GO:0007143)|metabolic process (GO:0008152)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|ovarian follicle development (GO:0001541)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of protein binding (GO:0032092)|regulation of Notch signaling pathway (GO:0008593)|regulation of somitogenesis (GO:0014807)|somitogenesis (GO:0001756)	extracellular region (GO:0005576)|integral component of Golgi membrane (GO:0030173)|vesicle (GO:0031982)	metal ion binding (GO:0046872)|O-fucosylpeptide 3-beta-N-acetylglucosaminyltransferase activity (GO:0033829)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|lung(1)|ovary(1)|urinary_tract(2)	6		Ovarian(82;0.0112)		OV - Ovarian serous cystadenocarcinoma(56;2.54e-14)		tggatggatgagtggaGCCCAA	0.55																																					p.E56G|p.E56E		Atlas-SNP	.											.	LFNG	57	.	0			c.A167G|c.G168A						.																																			SO:0001583	missense	3955	exon2			TGGATGAGTGGAG|GGATGAGTGGAGC	BC014851	CCDS34586.1, CCDS34587.1, CCDS55081.1, CCDS55082.1	7p22.3	2013-02-19	2006-11-13		ENSG00000106003	ENSG00000106003	2.4.1.222	"""Beta 3-glycosyltransferases"""	6560	protein-coding gene	gene with protein product		602576	"""lunatic fringe (Drosophila) homolog"", ""lunatic fringe homolog (Drosophila)"""			9878264, 9187150	Standard	NM_001166355		Approved	SCDO3	uc003smf.3	Q8NES3	OTTHUMG00000152043	Exception_encountered	chr7.hg19:g.2552910_2552911delinsGA	ENSP00000385764:p.Glu56Gly	94.0	0.0		110.0	6.0|5.0	NM_001166355	B3KTY6|B5MCR5|O00589|Q96C39|Q9UJW5	Missense_Mutation|Silent	SNP	ENST00000402506.1	hg19	CCDS55081.1																																																																																			.	.		0.550	LFNG-003	PUTATIVE	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000325023.1	NM_002304	
PAPOLB	56903	hgsc.bcm.edu	37	7	4900926	4900926	+	Silent	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr7:4900926T>C	ENST00000404991.1	-	1	699	c.513A>G	c.(511-513)gcA>gcG	p.A171A	RADIL_ENST00000536091.1_Intron|RADIL_ENST00000399583.3_Intron	NM_020144.4	NP_064529.4	Q9NRJ5	PAPOB_HUMAN	poly(A) polymerase beta (testis specific)	171					mRNA polyadenylation (GO:0006378)|mRNA splicing, via spliceosome (GO:0000398)|termination of RNA polymerase II transcription (GO:0006369)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|polynucleotide adenylyltransferase activity (GO:0004652)|RNA binding (GO:0003723)			kidney(1)|large_intestine(6)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|stomach(1)	14		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.089)|OV - Ovarian serous cystadenocarcinoma(56;2.06e-14)		GTGCTAATCTTGCAAATAAAA	0.368																																					p.A172A		Atlas-SNP	.											.	PAPOLB	93	.	0			c.A516G						.						62.0	63.0	63.0					7																	4900926		2013	4213	6226	SO:0001819	synonymous_variant	56903	exon1			TAATCTTGCAAAT	AF218840		7p22.1	2008-02-08			ENSG00000218823	ENSG00000218823	2.7.7.19		15970	protein-coding gene	gene with protein product		607436				11150526	Standard	NM_020144		Approved	PAPT	uc003snk.3	Q9NRJ5	OTTHUMG00000151759	ENST00000404991.1:c.513A>G	chr7.hg19:g.4900926T>C		67.0	0.0		54.0	4.0	NM_020144	Q75LH1|Q8NE14	Silent	SNP	ENST00000404991.1	hg19																																																																																				.	.		0.368	PAPOLB-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000323797.1	NM_020144	
BBS9	27241	hgsc.bcm.edu	37	7	33217138	33217138	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr7:33217138T>C	ENST00000242067.6	+	5	898	c.377T>C	c.(376-378)aTg>aCg	p.M126T	RNA5SP229_ENST00000410809.1_RNA|BBS9_ENST00000350941.3_Missense_Mutation_p.M126T|BBS9_ENST00000354265.4_Missense_Mutation_p.M126T|BBS9_ENST00000396127.2_Missense_Mutation_p.M126T|BBS9_ENST00000355070.2_Missense_Mutation_p.M126T|BBS9_ENST00000425508.2_Missense_Mutation_p.M81T	NM_198428.2	NP_940820.1	Q3SYG4	PTHB1_HUMAN	Bardet-Biedl syndrome 9	126					cilium assembly (GO:0042384)|fat cell differentiation (GO:0045444)|protein transport (GO:0015031)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	BBSome (GO:0034464)|cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|plasma membrane (GO:0005886)			BBS9/PKD1L1(2)	NS(1)|autonomic_ganglia(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(27)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	50			GBM - Glioblastoma multiforme(11;0.0894)			ATGAAATTGATGTATGAACAT	0.328									Bardet-Biedl syndrome																												p.M126T		Atlas-SNP	.											.	BBS9	194	.	0			c.T377C						.						170.0	160.0	163.0					7																	33217138		2203	4300	6503	SO:0001583	missense	27241	exon5	Familial Cancer Database	BBS, Bardet-Biedl syndrome, type 1-12: BBS1-12,Laurence-Moon-Biedl syndrome	AATTGATGTATGA		CCDS5441.1, CCDS34618.1, CCDS43566.1, CCDS47572.1	7p14	2014-06-17			ENSG00000122507	ENSG00000122507			30000	protein-coding gene	gene with protein product	"""parathyroid hormone responsive B1 gene"""	607968				16380913, 10221542	Standard	XM_005249701		Approved	B1, PTHB1	uc003tdn.1	Q3SYG4	OTTHUMG00000128659	ENST00000242067.6:c.377T>C	chr7.hg19:g.33217138T>C	ENSP00000242067:p.Met126Thr	64.0	0.0		70.0	4.0	NM_014451	E9PDC9|P78514|Q7KYS6|Q7KYS7|Q8N570|Q99844|Q99854|Q9Y699|Q9Y6A0	Missense_Mutation	SNP	ENST00000242067.6	hg19	CCDS43566.1	.	.	.	.	.	.	.	.	.	.	T	16.05	3.011872	0.54468	.	.	ENSG00000122507	ENST00000242067;ENST00000350941;ENST00000396127;ENST00000355070;ENST00000354265;ENST00000396132;ENST00000396125;ENST00000425508;ENST00000442858;ENST00000537775	D;D;D;D;D;D;D	0.82081	-1.57;-1.57;-1.57;-1.57;-1.57;-1.57;-1.57	5.61	5.61	0.85477	.	0.088451	0.85682	D	0.000000	T	0.81574	0.4851	L	0.43152	1.355	0.51482	D	0.999929	P;P;B;P;B	0.38370	0.628;0.591;0.057;0.591;0.127	B;B;B;B;B	0.42827	0.236;0.399;0.085;0.399;0.147	T	0.81690	-0.0818	10	0.45353	T	0.12	-21.6	16.1045	0.81212	0.0:0.0:0.0:1.0	.	126;126;126;126;126	B3KQ86;Q3SYG4-2;E9PDC9;Q3SYG4-4;Q3SYG4	.;.;.;.;PTHB1_HUMAN	T	126;126;126;126;126;126;126;81;4;4	ENSP00000242067:M126T;ENSP00000313122:M126T;ENSP00000379433:M126T;ENSP00000347182:M126T;ENSP00000346214:M126T;ENSP00000405151:M81T;ENSP00000388646:M4T	ENSP00000242067:M126T	M	+	2	0	BBS9	33183663	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.434000	0.80377	2.267000	0.75376	0.533000	0.62120	ATG	.	.		0.328	BBS9-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000329064.1		
MLXIPL	51085	hgsc.bcm.edu	37	7	73011792	73011792	+	Silent	SNP	A	A	G			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr7:73011792A>G	ENST00000313375.3	-	9	1370	c.1323T>C	c.(1321-1323)ccT>ccC	p.P441P	MLXIPL_ENST00000395189.1_Silent_p.P348P|MLXIPL_ENST00000354613.1_Silent_p.P441P|MLXIPL_ENST00000429400.2_Silent_p.P441P|MLXIPL_ENST00000414749.2_Silent_p.P441P|MLXIPL_ENST00000434326.1_Silent_p.P348P	NM_032951.2|NM_032953.2	NP_116569.1|NP_116571.1	Q9NP71	MLXPL_HUMAN	MLX interacting protein-like	441					anatomical structure morphogenesis (GO:0009653)|energy reserve metabolic process (GO:0006112)|fatty acid homeostasis (GO:0055089)|glucose homeostasis (GO:0042593)|glucose mediated signaling pathway (GO:0010255)|intracellular signal transduction (GO:0035556)|negative regulation of cell cycle arrest (GO:0071157)|negative regulation of oxidative phosphorylation (GO:0090324)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cellular metabolic process (GO:0031325)|positive regulation of fatty acid biosynthetic process (GO:0045723)|positive regulation of glycolytic process (GO:0045821)|positive regulation of lipid biosynthetic process (GO:0046889)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of energy homeostasis (GO:2000505)|regulation of fatty acid biosynthetic process (GO:0042304)|regulation of transcription, DNA-templated (GO:0006355)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)|triglyceride homeostasis (GO:0070328)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	carbohydrate response element binding (GO:0035538)|DNA binding (GO:0003677)|protein heterodimerization activity (GO:0046982)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			cervix(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	13		Lung NSC(55;0.0659)|all_lung(88;0.152)				CTGGGGCAGGAGGGACGGTGG	0.667																																					p.P441P		Atlas-SNP	.											.	MLXIPL	54	.	0			c.T1323C						.						36.0	25.0	29.0					7																	73011792		2071	4074	6145	SO:0001819	synonymous_variant	51085	exon9			GGCAGGAGGGACG	AK055029	CCDS5553.1, CCDS5554.1, CCDS47605.1, CCDS47606.1	7q11.23	2013-05-21	2005-10-31	2005-10-31	ENSG00000009950	ENSG00000009950			12744	protein-coding gene	gene with protein product	"""carbohydrate response element binding protein"""	605678	"""Williams Beuren syndrome chromosome region 14"""	WBSCR14		9860302	Standard	XM_005250399		Approved	WS-bHLH, MIO, CHREBP, MONDOB, bHLHd14	uc003tyn.1	Q9NP71	OTTHUMG00000129995	ENST00000313375.3:c.1323T>C	chr7.hg19:g.73011792A>G		90.0	0.0		89.0	4.0	NM_032954	C5HU02|C5HU03|C5HU04|Q96E48|Q9BY03|Q9BY04|Q9BY05|Q9BY06|Q9Y2P3	Silent	SNP	ENST00000313375.3	hg19	CCDS5553.1																																																																																			.	.		0.667	MLXIPL-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252262.1	NM_032951	
RFC2	5982	hgsc.bcm.edu	37	7	73646540	73646540	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr7:73646540C>T	ENST00000055077.3	-	11	1021	c.961G>A	c.(961-963)Gga>Aga	p.G321R	RFC2_ENST00000352131.3_Missense_Mutation_p.G287R	NM_181471.1	NP_852136.1	P35250	RFC2_HUMAN	replication factor C (activator 1) 2, 40kDa	321					DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA strand elongation involved in DNA replication (GO:0006271)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA gap filling (GO:0006297)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|transcription-coupled nucleotide-excision repair (GO:0006283)	DNA replication factor C complex (GO:0005663)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|DNA binding (GO:0003677)			central_nervous_system(1)|endometrium(2)|large_intestine(1)|liver(1)|lung(3)	8						TGAGTGTATCCAATTTCCTGA	0.398																																					p.G321R		Atlas-SNP	.											.	RFC2	27	.	0			c.G961A						.						63.0	62.0	62.0					7																	73646540		2203	4300	6503	SO:0001583	missense	5982	exon11			TGTATCCAATTTC		CCDS5567.1, CCDS5568.1, CCDS75618.1	7q11.23	2010-04-21	2002-08-29		ENSG00000049541	ENSG00000049541		"""ATPases / AAA-type"""	9970	protein-coding gene	gene with protein product	"""activator 1"""	600404	"""replication factor C (activator 1) 2 (40kD)"""			1313560, 7774928	Standard	NM_181471		Approved	A1, RFC40	uc003uaj.3	P35250	OTTHUMG00000023239	ENST00000055077.3:c.961G>A	chr7.hg19:g.73646540C>T	ENSP00000055077:p.Gly321Arg	77.0	0.0		91.0	4.0	NM_181471	B5BU07|D3DXG3|P32846|Q9BU93	Missense_Mutation	SNP	ENST00000055077.3	hg19	CCDS5568.1	.	.	.	.	.	.	.	.	.	.	C	27.9	4.872914	0.91664	.	.	ENSG00000049541	ENST00000352131;ENST00000055077	T;T	0.50277	0.75;0.75	5.22	5.22	0.72569	Replication factor C (1);DNA polymerase III, clamp loader complex, gamma/delta/delta subunit, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.66406	0.2786	M	0.89968	3.075	0.80722	D	1	B;B;P	0.44578	0.26;0.306;0.838	B;P;P	0.48189	0.322;0.451;0.57	T	0.75158	-0.3416	10	0.87932	D	0	.	17.7123	0.88325	0.0:1.0:0.0:0.0	.	287;287;321	P35250-2;Q75MT5;P35250	.;.;RFC2_HUMAN	R	287;321	ENSP00000275627:G287R;ENSP00000055077:G321R	ENSP00000055077:G321R	G	-	1	0	RFC2	73284476	1.000000	0.71417	0.998000	0.56505	0.972000	0.66771	7.322000	0.79097	2.610000	0.88304	0.650000	0.86243	GGA	.	.		0.398	RFC2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252459.2	NM_181471	
PCLO	27445	hgsc.bcm.edu	37	7	82580361	82580361	+	Silent	SNP	A	A	G			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr7:82580361A>G	ENST00000333891.9	-	6	9880	c.9543T>C	c.(9541-9543)gtT>gtC	p.V3181V	PCLO_ENST00000437081.1_5'Flank|PCLO_ENST00000423517.2_Silent_p.V3181V	NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein											breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						TTAAAGTGGGAACAGAGTCTA	0.433																																					p.V3181V		Atlas-SNP	.											.	PCLO	1506	.	0			c.T9543C						.						52.0	49.0	50.0					7																	82580361		1922	4153	6075	SO:0001819	synonymous_variant	27445	exon6			AGTGGGAACAGAG	AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.9543T>C	chr7.hg19:g.82580361A>G		90.0	0.0		100.0	4.0	NM_014510		Silent	SNP	ENST00000333891.9	hg19	CCDS47630.1																																																																																			.	.		0.433	PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337368.5	NM_014510	
COL1A2	1278	hgsc.bcm.edu	37	7	94035575	94035575	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr7:94035575T>C	ENST00000297268.6	+	12	1025	c.554T>C	c.(553-555)cTg>cCg	p.L185P		NM_000089.3	NP_000080.2	P08123	CO1A2_HUMAN	collagen, type I, alpha 2	185			Missing (in OI4). {ECO:0000269|PubMed:1642148}.		blood coagulation (GO:0007596)|blood vessel development (GO:0001568)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|leukocyte migration (GO:0050900)|odontogenesis (GO:0042476)|platelet activation (GO:0030168)|protein heterotrimerization (GO:0070208)|regulation of blood pressure (GO:0008217)|Rho protein signal transduction (GO:0007266)|skeletal system development (GO:0001501)|skin morphogenesis (GO:0043589)|transforming growth factor beta receptor signaling pathway (GO:0007179)	collagen type I trimer (GO:0005584)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	extracellular matrix structural constituent (GO:0005201)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)|protein binding, bridging (GO:0030674)		COL1A2/PLAG1(3)	NS(2)|breast(2)|central_nervous_system(4)|cervix(1)|endometrium(6)|kidney(8)|large_intestine(21)|lung(51)|ovary(2)|prostate(1)|skin(7)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(1)	115	all_cancers(62;2.46e-09)|all_epithelial(64;2.7e-08)		STAD - Stomach adenocarcinoma(171;0.0031)		Collagenase(DB00048)	CACAATGGTCTGGATGGATTG	0.378										HNSCC(75;0.22)																											p.L185P		Atlas-SNP	.											.	COL1A2	240	.	0			c.T554C						.						97.0	94.0	95.0					7																	94035575		2203	4300	6503	SO:0001583	missense	1278	exon12			ATGGTCTGGATGG	Z74616	CCDS34682.1	7q21.3	2014-09-17	2002-02-13		ENSG00000164692	ENSG00000164692		"""Collagens"""	2198	protein-coding gene	gene with protein product	"""alpha 2(I)-collagen"", ""alpha-2 collagen type I"", ""type I procollagen"", ""collagen I, alpha-2 polypeptide"", ""collagen of skin, tendon and bone, alpha-2 chain"""	120160	"""osteogenesis imperfecta type IV"""	OI4		3857213, 2897363	Standard	NM_000089		Approved		uc003ung.1	P08123	OTTHUMG00000148675	ENST00000297268.6:c.554T>C	chr7.hg19:g.94035575T>C	ENSP00000297268:p.Leu185Pro	68.0	0.0		91.0	4.0	NM_000089	P02464|Q13897|Q13997|Q13998|Q14038|Q14057|Q15177|Q15947|Q16480|Q16511|Q7Z5S6|Q9UEB6|Q9UEF9|Q9UM83|Q9UMI1|Q9UML5|Q9UMM6|Q9UPH0	Missense_Mutation	SNP	ENST00000297268.6	hg19	CCDS34682.1	.	.	.	.	.	.	.	.	.	.	T	12.67	2.006525	0.35415	.	.	ENSG00000164692	ENST00000297268;ENST00000545487	D	0.94376	-3.41	5.34	2.92	0.33932	.	0.436644	0.23349	N	0.049146	D	0.89674	0.6783	N	0.04063	-0.285	0.58432	D	0.999999	B	0.23591	0.088	P	0.48425	0.577	T	0.82950	-0.0203	10	0.36615	T	0.2	.	10.2776	0.43519	0.0:0.1119:0.0:0.8881	.	185	P08123	CO1A2_HUMAN	P	185;186	ENSP00000297268:L185P	ENSP00000297268:L185P	L	+	2	0	COL1A2	93873511	1.000000	0.71417	0.999000	0.59377	0.883000	0.51084	4.530000	0.60595	0.516000	0.28340	-0.248000	0.11899	CTG	.	.		0.378	COL1A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000309045.2	NM_000089	
SLC26A5	375611	hgsc.bcm.edu	37	7	103050911	103050911	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr7:103050911A>G	ENST00000306312.3	-	7	917	c.656T>C	c.(655-657)gTg>gCg	p.V219A	SLC26A5_ENST00000393729.1_Missense_Mutation_p.V182A|SLC26A5_ENST00000356767.4_Missense_Mutation_p.V219A|SLC26A5_ENST00000393723.1_Missense_Mutation_p.V219A|SLC26A5_ENST00000393730.1_Missense_Mutation_p.V219A|SLC26A5_ENST00000354356.4_5'UTR|SLC26A5_ENST00000432958.2_Missense_Mutation_p.V219A|SLC26A5_ENST00000339444.6_Missense_Mutation_p.V219A|SLC26A5_ENST00000393727.1_Missense_Mutation_p.V219A|SLC26A5_ENST00000393735.2_Missense_Mutation_p.V219A	NM_198999.2	NP_945350.1	P58743	S26A5_HUMAN	solute carrier family 26 (anion exchanger), member 5	219					regulation of cell shape (GO:0008360)|regulation of membrane potential (GO:0042391)|sensory perception of sound (GO:0007605)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)|lateral plasma membrane (GO:0016328)	secondary active sulfate transmembrane transporter activity (GO:0008271)			endometrium(5)|kidney(2)|large_intestine(9)|lung(15)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(5)	43						GAAGACATGCACAGCTGCTGC	0.418																																					p.V219A		Atlas-SNP	.											.	SLC26A5	231	.	0			c.T656C						.						72.0	70.0	71.0					7																	103050911		2203	4300	6503	SO:0001583	missense	375611	exon7			ACATGCACAGCTG	AC005064	CCDS5733.1, CCDS43630.1, CCDS55150.1, CCDS5732.1, CCDS43629.1	7q22	2013-07-18	2013-07-18	2005-09-13	ENSG00000170615	ENSG00000170615		"""Solute carriers"""	9359	protein-coding gene	gene with protein product	"""deafness, neurosensory, autosomal recessive, 61"""	604943	"""prestin (motor protein)"""	PRES		10821263	Standard	NM_206883		Approved	DFNB61	uc003vbz.3	P58743	OTTHUMG00000149911	ENST00000306312.3:c.656T>C	chr7.hg19:g.103050911A>G	ENSP00000304783:p.Val219Ala	104.0	0.0		113.0	5.0	NM_206883	Q496J2|Q7Z7F3|Q86UF8|Q86UF9|Q86UG0	Missense_Mutation	SNP	ENST00000306312.3	hg19	CCDS5733.1	.	.	.	.	.	.	.	.	.	.	A	17.58	3.424191	0.62733	.	.	ENSG00000170615	ENST00000339444;ENST00000356767;ENST00000393735;ENST00000306312;ENST00000393730;ENST00000432958;ENST00000393729;ENST00000393727;ENST00000393723	D;D;D;D;D;D;D;D;D	0.93811	-3.29;-3.29;-3.29;-3.29;-3.29;-3.29;-3.29;-3.29;-3.29	5.72	5.72	0.89469	Sulphate transporter (1);	0.057214	0.64402	D	0.000001	D	0.92264	0.7546	M	0.66560	2.04	0.80722	D	1	B;P;B;P;B	0.36222	0.152;0.456;0.057;0.544;0.319	B;B;B;B;B	0.35688	0.189;0.208;0.037;0.132;0.132	D	0.91741	0.5404	10	0.44086	T	0.13	.	16.0046	0.80354	1.0:0.0:0.0:0.0	.	219;219;219;219;219	P58743;Q496J2;P58743-4;P58743-3;P58743-2	S26A5_HUMAN;.;.;.;.	A	219;219;219;219;219;219;182;219;219	ENSP00000342396:V219A;ENSP00000349210:V219A;ENSP00000377336:V219A;ENSP00000304783:V219A;ENSP00000377331:V219A;ENSP00000389733:V219A;ENSP00000377330:V182A;ENSP00000377328:V219A;ENSP00000377324:V219A	ENSP00000304783:V219A	V	-	2	0	SLC26A5	102838147	1.000000	0.71417	0.927000	0.36925	0.911000	0.54048	7.022000	0.76431	2.186000	0.69663	0.482000	0.46254	GTG	.	.		0.418	SLC26A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313860.1	NM_198999	
RELN	5649	hgsc.bcm.edu	37	7	103162472	103162472	+	Silent	SNP	A	A	G			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr7:103162472A>G	ENST00000428762.1	-	48	7824	c.7665T>C	c.(7663-7665)agT>agC	p.S2555S	RELN_ENST00000424685.2_Silent_p.S2555S|RELN_ENST00000343529.5_Silent_p.S2555S	NM_005045.3	NP_005036.2	P78509	RELN_HUMAN	reelin	2555					associative learning (GO:0008306)|axon guidance (GO:0007411)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cell morphogenesis involved in differentiation (GO:0000904)|central nervous system development (GO:0007417)|cerebral cortex tangential migration (GO:0021800)|dendrite development (GO:0016358)|glial cell differentiation (GO:0010001)|hippocampus development (GO:0021766)|lateral motor column neuron migration (GO:0097477)|layer formation in cerebral cortex (GO:0021819)|long-term memory (GO:0007616)|N-methyl-D-aspartate receptor clustering (GO:0097114)|neuron migration (GO:0001764)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000969)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of lateral motor column neuron migration (GO:1902078)|positive regulation of long-term synaptic potentiation (GO:1900273)|positive regulation of neuron projection development (GO:0010976)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of TOR signaling (GO:0032008)|postsynaptic density protein 95 clustering (GO:0097119)|receptor localization to synapse (GO:0097120)|reelin-mediated signaling pathway (GO:0038026)|regulation of behavior (GO:0050795)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of synaptic transmission (GO:0050804)|response to pain (GO:0048265)|spinal cord patterning (GO:0021511)|ventral spinal cord development (GO:0021517)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	lipoprotein particle receptor binding (GO:0070325)|metal ion binding (GO:0046872)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|serine-type peptidase activity (GO:0008236)|very-low-density lipoprotein particle receptor binding (GO:0070326)			NS(3)|breast(8)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|lung(101)|ovary(9)|pancreas(2)|prostate(4)|skin(14)|stomach(2)|upper_aerodigestive_tract(12)|urinary_tract(2)	227				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)		CACTCACCCCACTGAAATGGA	0.478																																					p.S2555S	NSCLC(146;835 1944 15585 22231 52158)	Atlas-SNP	.											.	RELN	593	.	0			c.T7665C						.						135.0	124.0	128.0					7																	103162472		2203	4300	6503	SO:0001819	synonymous_variant	5649	exon48			CACCCCACTGAAA		CCDS34722.1, CCDS47680.1	7q22	2008-07-18			ENSG00000189056	ENSG00000189056			9957	protein-coding gene	gene with protein product		600514				9049633	Standard	NM_005045		Approved	RL, PRO1598	uc010liz.3	P78509	OTTHUMG00000157247	ENST00000428762.1:c.7665T>C	chr7.hg19:g.103162472A>G		57.0	0.0		75.0	4.0	NM_173054	A4D0P9|A4D0Q0|Q86UJ0|Q86UJ8|Q8NDV0|Q9UDQ2	Silent	SNP	ENST00000428762.1	hg19	CCDS47680.1																																																																																			.	.		0.478	RELN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000348148.1	NM_005045	
MET	4233	hgsc.bcm.edu	37	7	116371722	116371722	+	Splice_Site	SNP	A	A	G			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr7:116371722A>G	ENST00000318493.6	+	3	1388	c.1201A>G	c.(1201-1203)Aca>Gca	p.T401A	MET_ENST00000436117.2_Splice_Site_p.T401A|MET_ENST00000495962.1_3'UTR|MET_ENST00000397752.3_Splice_Site_p.T401A			Q9NWH9	SLTM_HUMAN	MET proto-oncogene, receptor tyrosine kinase	0	RRM. {ECO:0000255|PROSITE- ProRule:PRU00176}.				apoptotic process (GO:0006915)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(10)|breast(4)|central_nervous_system(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(5)|kidney(25)|large_intestine(8)|liver(3)|lung(70)|ovary(10)|pleura(2)|prostate(4)|skin(5)|stomach(6)|testis(1)|thyroid(4)|upper_aerodigestive_tract(64)|urinary_tract(3)	233	all_cancers(3;1.25e-07)|all_epithelial(6;4.07e-08)|Lung NSC(10;0.00108)|all_lung(10;0.00125)	Ovarian(593;0.133)	GBM - Glioblastoma multiforme(2;2.31e-07)|all cancers(2;0.000419)|STAD - Stomach adenocarcinoma(10;0.000512)			TTTATTCCAGACACTTCTGAG	0.423			Mis		"""papillary renal, head-neck squamous cell """	papillary renal			Hereditary Papillary Renal Carcinoma (type 1)																												p.T401A		Atlas-SNP	.		Dom	yes	Familial Papillary Renal Cancer	7	7q31	4233	met proto-oncogene (hepatocyte growth factor receptor)		E	.	MET	412	.	0			c.A1201G						.						73.0	66.0	68.0					7																	116371722		1862	4092	5954	SO:0001630	splice_region_variant	4233	exon3	Familial Cancer Database	HPRC, Hereditary Papillary Renal Cell Cancer	TTCCAGACACTTC	M35073	CCDS43636.1, CCDS47689.1	7q31	2014-09-17	2014-06-26		ENSG00000105976	ENSG00000105976	2.7.10.1		7029	protein-coding gene	gene with protein product	"""hepatocyte growth factor receptor"""	164860	"""met proto-oncogene"""			1846706, 1611909	Standard	NM_001127500		Approved	HGFR, RCCP2	uc010lkh.3	P08581	OTTHUMG00000023299	ENST00000318493.6:c.1201-1A>G	chr7.hg19:g.116371722A>G		93.0	0.0		90.0	4.0	NM_000245	A8K5V8|B2RTX3|Q2VPK7|Q52MB3|Q658J7|Q6ZNF2|Q86TK6|Q9H7C3|Q9H8U9	Missense_Mutation	SNP	ENST00000318493.6	hg19	CCDS47689.1	.	.	.	.	.	.	.	.	.	.	A	13.04	2.117647	0.37339	.	.	ENSG00000105976	ENST00000397752;ENST00000318493;ENST00000436117	T;T;T	0.10288	2.89;2.89;2.89	5.71	5.71	0.89125	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	0.182658	0.46442	D	0.000294	T	0.10895	0.0266	L	0.43152	1.355	0.80722	D	1	B;B;B;B;B;B;B;B;B;B;B	0.22983	0.034;0.025;0.044;0.044;0.044;0.044;0.078;0.019;0.016;0.006;0.07	B;B;B;B;B;B;B;B;B;B;B	0.27262	0.026;0.065;0.026;0.04;0.065;0.04;0.057;0.078;0.013;0.026;0.046	T	0.16100	-1.0414	9	.	.	.	.	10.6403	0.45590	0.9196:0.0:0.0804:0.0	.	401;401;401;401;401;401;401;401;401;401;401	B5A929;E7EQ94;B5A930;B5A934;B5A936;B5A937;B5A939;B5A941;P08581-2;B5A942;P08581	.;.;.;.;.;.;.;.;.;.;MET_HUMAN	A	401	ENSP00000380860:T401A;ENSP00000317272:T401A;ENSP00000410980:T401A	.	T	+	1	0	MET	116158958	1.000000	0.71417	1.000000	0.80357	0.944000	0.59088	4.095000	0.57728	2.169000	0.68431	0.533000	0.62120	ACA	.	.		0.423	MET-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000059620.3		Missense_Mutation
PRRT4	401399	hgsc.bcm.edu	37	7	127992597	127992597	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr7:127992597T>C	ENST00000446477.2	-	6	1326	c.1013A>G	c.(1012-1014)gAg>gGg	p.E338G	PRRT4_ENST00000435512.1_Missense_Mutation_p.E338G|PRRT4_ENST00000535159.1_Missense_Mutation_p.E338G|PRRT4_ENST00000489835.2_Missense_Mutation_p.E338G	NM_001174164.1	NP_001167635.1	C9JH25	PRRT4_HUMAN	proline-rich transmembrane protein 4	338						integral component of membrane (GO:0016021)				endometrium(4)|prostate(1)	5						CCTCGGCGCCTCGGGAGGCTG	0.711																																					p.E338G		Atlas-SNP	.											.	PRRT4	31	.	0			c.A1013G						.						45.0	55.0	52.0					7																	127992597		692	1591	2283	SO:0001583	missense	401399	exon6			GGCGCCTCGGGAG	BC063892	CCDS47698.1, CCDS47698.2, CCDS55160.1	7q32.1	2011-10-10			ENSG00000224940	ENSG00000224940		"""Proline-rich transmembrane proteins"""	37280	protein-coding gene	gene with protein product							Standard	NM_001114726		Approved		uc022aky.1	C9JH25	OTTHUMG00000157714	ENST00000446477.2:c.1013A>G	chr7.hg19:g.127992597T>C	ENSP00000415026:p.Glu338Gly	74.0	0.0		94.0	4.0	NM_001174164	A4D0Z9|C9JVW7	Missense_Mutation	SNP	ENST00000446477.2	hg19	CCDS55160.1	.	.	.	.	.	.	.	.	.	.	T	13.54	2.268957	0.40095	.	.	ENSG00000224940	ENST00000489835;ENST00000446477;ENST00000535159;ENST00000435512;ENST00000489517	.	.	.	4.1	-1.07	0.09968	.	.	.	.	.	T	0.16342	0.0393	N	0.14661	0.345	0.09310	N	0.999994	B	0.02656	0.0	B	0.04013	0.001	T	0.21348	-1.0248	8	0.42905	T	0.14	-8.9875	0.5879	0.00723	0.3096:0.167:0.3453:0.1782	.	338	C9JH25	PRRT4_HUMAN	G	338	.	ENSP00000410779:E338G	E	-	2	0	PRRT4	127779833	0.000000	0.05858	0.003000	0.11579	0.027000	0.11550	-0.126000	0.10563	-0.089000	0.12484	-0.495000	0.04643	GAG	.	.		0.711	PRRT4-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001114726	
CCDC136	64753	hgsc.bcm.edu	37	7	128452197	128452197	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr7:128452197A>G	ENST00000297788.4	+	13	2739	c.2372A>G	c.(2371-2373)gAc>gGc	p.D791G	CCDC136_ENST00000378685.4_Intron|CCDC136_ENST00000487361.1_Intron|CCDC136_ENST00000464832.1_Intron	NM_022742.4	NP_073579	Q96JN2	CC136_HUMAN	coiled-coil domain containing 136	791	Ser-rich.					integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)				breast(2)|endometrium(3)|kidney(1)|large_intestine(4)|lung(11)|ovary(3)	24						AAGAGCTATGACAGCAGCACC	0.488																																					p.D791G		Atlas-SNP	.											.	CCDC136	170	.	0			c.A2372G						.						85.0	86.0	85.0					7																	128452197		2124	4238	6362	SO:0001583	missense	64753	exon13			GCTATGACAGCAG		CCDS47704.1, CCDS56510.1	7q33	2007-08-01			ENSG00000128596	ENSG00000128596			22225	protein-coding gene	gene with protein product		611902				15112360	Standard	NM_022742		Approved	KIAA1793, NAG6, DKFZP434G156	uc003vnv.2	Q96JN2	OTTHUMG00000158310	ENST00000297788.4:c.2372A>G	chr7.hg19:g.128452197A>G	ENSP00000297788:p.Asp791Gly	110.0	0.0		103.0	5.0	NM_022742	A4D1K1|A7MCY7|A8MYA7|Q6ZVK7|Q9H8M3|Q9UFE1	Missense_Mutation	SNP	ENST00000297788.4	hg19	CCDS47704.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	15.27|15.27	2.785155|2.785155	0.49997|0.49997	.|.	.|.	ENSG00000128596|ENSG00000128596	ENST00000297788;ENST00000397697;ENST00000320524;ENST00000464672|ENST00000494552	T;T|.	0.50548|.	0.74;0.74|.	5.77|5.77	-2.62|-2.62	0.06152|0.06152	.|.	0.899797|.	0.09590|.	N|.	0.781606|.	T|T	0.37128|0.37128	0.0992|0.0992	M|M	0.63843|0.63843	1.955|1.955	0.09310|0.09310	N|N	1|1	B;B;B|.	0.06786|.	0.001;0.001;0.001|.	B;B;B|.	0.09377|.	0.004;0.004;0.001|.	T|T	0.40136|0.40136	-0.9579|-0.9579	10|5	0.46703|.	T|.	0.11|.	-0.7923|-0.7923	1.6647|1.6647	0.02799|0.02799	0.4178:0.139:0.309:0.1342|0.4178:0.139:0.309:0.1342	.|.	791;791;791|.	Q96JN2-4;Q96JN2-2;Q96JN2|.	.;.;CC136_HUMAN|.	G|A	791;791;791;382|668	ENSP00000297788:D791G;ENSP00000417991:D382G|.	ENSP00000297788:D791G|.	D|T	+|+	2|1	0|0	CCDC136|CCDC136	128239433|128239433	0.000000|0.000000	0.05858|0.05858	0.066000|0.066000	0.19879|0.19879	0.666000|0.666000	0.39218|0.39218	-0.072000|-0.072000	0.11486|0.11486	-0.347000|-0.347000	0.08299|0.08299	-0.250000|-0.250000	0.11733|0.11733	GAC|ACA	.	.		0.488	CCDC136-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000350641.1	NM_022742	
DGKI	9162	hgsc.bcm.edu	37	7	137374712	137374712	+	Silent	SNP	A	A	G			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr7:137374712A>G	ENST00000288490.5	-	2	438	c.438T>C	c.(436-438)gcT>gcC	p.A146A	DGKI_ENST00000424189.2_Silent_p.A146A|DGKI_ENST00000453654.2_Intron|DGKI_ENST00000446122.1_Silent_p.A146A	NM_004717.2	NP_004708.1	O75912	DGKI_HUMAN	diacylglycerol kinase, iota	146					blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|platelet activation (GO:0030168)|positive regulation of Ras protein signal transduction (GO:0046579)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of Rap GTPase activity (GO:0032317)	cytoplasm (GO:0005737)|guanyl-nucleotide exchange factor complex (GO:0032045)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|diacylglycerol kinase activity (GO:0004143)|GTPase inhibitor activity (GO:0005095)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)			breast(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(46)|ovary(2)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	84						GATGTGCAGGAGCCAGATGCT	0.483																																					p.A146A		Atlas-SNP	.											.	DGKI	335	.	0			c.T438C						.						72.0	71.0	71.0					7																	137374712		2203	4300	6503	SO:0001819	synonymous_variant	9162	exon2			TGCAGGAGCCAGA	AF061936	CCDS5845.1	7q32.3-q33	2013-01-10			ENSG00000157680	ENSG00000157680		"""Ankyrin repeat domain containing"""	2855	protein-coding gene	gene with protein product		604072				9830018	Standard	NM_004717		Approved	DGK-IOTA	uc003vtt.3	O75912	OTTHUMG00000155697	ENST00000288490.5:c.438T>C	chr7.hg19:g.137374712A>G		75.0	0.0		87.0	5.0	NM_004717	A4D1Q9|Q9NZ49	Silent	SNP	ENST00000288490.5	hg19	CCDS5845.1																																																																																			.	.		0.483	DGKI-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000341286.3	NM_004717	
ZNF777	27153	hgsc.bcm.edu	37	7	149129992	149129992	+	Silent	SNP	G	G	A			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr7:149129992G>A	ENST00000247930.4	-	6	1694	c.1371C>T	c.(1369-1371)gaC>gaT	p.D457D		NM_015694.2	NP_056509.2	Q9ULD5	ZN777_HUMAN	zinc finger protein 777	457	Glu-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			large_intestine(5)|lung(17)|ovary(1)|skin(2)|urinary_tract(1)	26	Melanoma(164;0.165)		OV - Ovarian serous cystadenocarcinoma(82;0.00358)			cttcctcctcGTCTTGTTCCT	0.582																																					p.D457D		Atlas-SNP	.											.	ZNF777	63	.	0			c.C1371T						.						11.0	12.0	12.0					7																	149129992		2132	4244	6376	SO:0001819	synonymous_variant	27153	exon6			CTCCTCGTCTTGT	AB033111	CCDS43675.1	7q36.1	2013-01-08			ENSG00000196453	ENSG00000196453		"""Zinc fingers, C2H2-type"", ""-"""	22213	protein-coding gene	gene with protein product							Standard	NM_015694		Approved	KIAA1285	uc003wfv.3	Q9ULD5	OTTHUMG00000158967	ENST00000247930.4:c.1371C>T	chr7.hg19:g.149129992G>A		141.0	0.0		143.0	63.0	NM_015694	Q8N2R2|Q8N659	Silent	SNP	ENST00000247930.4	hg19	CCDS43675.1																																																																																			.	.		0.582	ZNF777-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352708.1	NM_015694	
DLC1	10395	hgsc.bcm.edu	37	8	13357252	13357252	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr8:13357252A>G	ENST00000276297.4	-	2	738	c.329T>C	c.(328-330)gTt>gCt	p.V110A	DLC1_ENST00000316609.5_Missense_Mutation_p.V110A|DLC1_ENST00000511869.1_Missense_Mutation_p.V110A	NM_182643.2	NP_872584.2	Q96QB1	RHG07_HUMAN	DLC1 Rho GTPase activating protein	110					actin cytoskeleton organization (GO:0030036)|activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|focal adhesion assembly (GO:0048041)|forebrain development (GO:0030900)|heart morphogenesis (GO:0003007)|hindbrain morphogenesis (GO:0021575)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of Rho protein signal transduction (GO:0035024)|negative regulation of stress fiber assembly (GO:0051497)|neural tube closure (GO:0001843)|positive regulation of execution phase of apoptosis (GO:1900119)|positive regulation of protein dephosphorylation (GO:0035307)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	caveola (GO:0005901)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	lipid binding (GO:0008289)|Rho GTPase activator activity (GO:0005100)|SH2 domain binding (GO:0042169)			NS(2)|breast(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(39)|lung(32)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	110						CTCATCAGAAACATGCACTAG	0.413																																					p.V110A		Atlas-SNP	.											.	DLC1	411	.	0			c.T329C						.						215.0	216.0	215.0					8																	13357252		2203	4300	6503	SO:0001583	missense	10395	exon2			TCAGAAACATGCA	AF035119	CCDS5989.1, CCDS5990.1, CCDS5991.1, CCDS5991.2, CCDS55201.1	8p22	2014-06-20	2014-06-20		ENSG00000164741	ENSG00000164741		"""Rho GTPase activating proteins"", ""StAR-related lipid transfer (START) domain containing"""	2897	protein-coding gene	gene with protein product	"""StAR-related lipid transfer (START) domain containing 12"""	604258	"""deleted in liver cancer 1"""			9605766, 11214970	Standard	NM_182643		Approved	HP, ARHGAP7, STARD12, DLC-1, p122-RhoGAP	uc003wwm.2	Q96QB1	OTTHUMG00000090825	ENST00000276297.4:c.329T>C	chr8.hg19:g.13357252A>G	ENSP00000276297:p.Val110Ala	91.0	0.0		89.0	4.0	NM_182643	B4DR10|B8PTI0|E9PDZ8|E9PF76|E9PGY9|O14868|O43199|Q7Z5R8|Q86UC6|Q9C0E0|Q9H7A2	Missense_Mutation	SNP	ENST00000276297.4	hg19	CCDS5989.1	.	.	.	.	.	.	.	.	.	.	A	15.28	2.787364	0.49997	.	.	ENSG00000164741	ENST00000276297;ENST00000316609;ENST00000511869	T;T;T	0.33654	1.4;1.4;1.4	5.55	5.55	0.83447	.	0.182461	0.26742	N	0.022732	T	0.31949	0.0813	L	0.43923	1.385	0.19945	N	0.99994	P;P;B	0.46142	0.787;0.873;0.084	B;B;B	0.40782	0.164;0.34;0.03	T	0.38286	-0.9668	10	0.87932	D	0	.	11.1412	0.48404	0.8624:0.0:0.0:0.1376	.	110;110;110	E9PF76;Q96QB1-3;Q96QB1	.;.;RHG07_HUMAN	A	110	ENSP00000276297:V110A;ENSP00000321034:V110A;ENSP00000425878:V110A	ENSP00000276297:V110A	V	-	2	0	DLC1	13401623	0.952000	0.32445	0.983000	0.44433	0.976000	0.68499	3.749000	0.55150	2.250000	0.74265	0.533000	0.62120	GTT	.	.		0.413	DLC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000207632.2	NM_182643, NM_006094	
PIWIL2	55124	hgsc.bcm.edu	37	8	22172606	22172606	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr8:22172606T>C	ENST00000454009.2	+	18	2665	c.2156T>C	c.(2155-2157)cTt>cCt	p.L719P	PIWIL2_ENST00000356766.6_Missense_Mutation_p.L719P|PIWIL2_ENST00000521356.1_Missense_Mutation_p.L719P	NM_001135721.1	NP_001129193.1	Q8TC59	PIWL2_HUMAN	piwi-like RNA-mediated gene silencing 2	719	Piwi. {ECO:0000255|PROSITE- ProRule:PRU00150}.				DNA methylation involved in gamete generation (GO:0043046)|gene silencing by RNA (GO:0031047)|germ-line stem cell maintenance (GO:0030718)|meiotic nuclear division (GO:0007126)|multicellular organismal development (GO:0007275)|oogenesis (GO:0048477)|piRNA metabolic process (GO:0034587)|positive regulation of meiosis I (GO:0060903)|positive regulation of translation (GO:0045727)|RNA 5'-end processing (GO:0000966)|spermatogenesis (GO:0007283)	chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|P granule (GO:0043186)|pi-body (GO:0071546)|polysome (GO:0005844)	mRNA binding (GO:0003729)|piRNA binding (GO:0034584)			NS(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(14)|lung(14)|prostate(4)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)	46				Colorectal(74;0.018)|COAD - Colon adenocarcinoma(73;0.0707)		AAGATTTTACTTCAGATTAAC	0.488																																					p.L719P		Atlas-SNP	.											.	PIWIL2	100	.	0			c.T2156C						.						139.0	135.0	137.0					8																	22172606		2203	4300	6503	SO:0001583	missense	55124	exon18			TTTTACTTCAGAT	AK001213	CCDS6029.1	8p24	2013-02-15	2013-02-15		ENSG00000197181	ENSG00000197181		"""Argonaute/PIWI family"""	17644	protein-coding gene	gene with protein product	"""Hiwi-like"", ""cancer/testis antigen 80"""	610312	"""piwi-like 2 (Drosophila)"""			11279525, 12906857	Standard	NM_018068		Approved	HILI, FLJ10351, Mili, CT80	uc003xbn.2	Q8TC59	OTTHUMG00000097767	ENST00000454009.2:c.2156T>C	chr8.hg19:g.22172606T>C	ENSP00000406956:p.Leu719Pro	158.0	0.0		92.0	4.0	NM_001135721	A8K4S3|A8K8S5|B0AZN9|B0AZP2|B4DR22|E7ECA4|Q96SW6|Q9NW28	Missense_Mutation	SNP	ENST00000454009.2	hg19	CCDS6029.1	.	.	.	.	.	.	.	.	.	.	T	23.1	4.369495	0.82463	.	.	ENSG00000197181	ENST00000356766;ENST00000521356;ENST00000454009	T;T;T	0.17691	2.26;2.26;2.26	5.75	5.75	0.90469	Stem cell self-renewal protein Piwi (3);Ribonuclease H-like (1);	0.000000	0.85682	D	0.000000	T	0.56124	0.1964	H	0.96547	3.84	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.80764	0.99;0.994	T	0.71083	-0.4695	10	0.87932	D	0	-0.0015	15.3343	0.74238	0.0:0.0:0.0:1.0	.	719;719	E7ECA4;Q8TC59	.;PIWL2_HUMAN	P	719	ENSP00000349208:L719P;ENSP00000428267:L719P;ENSP00000406956:L719P	ENSP00000349208:L719P	L	+	2	0	PIWIL2	22228551	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.030000	0.76484	2.311000	0.77944	0.528000	0.53228	CTT	.	.		0.488	PIWIL2-003	PUTATIVE	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000375438.1		
ERLIN2	11160	hgsc.bcm.edu	37	8	37611578	37611578	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr8:37611578A>G	ENST00000276461.5	+	12	1032	c.965A>G	c.(964-966)aAg>aGg	p.K322R	ERLIN2_ENST00000519638.1_Missense_Mutation_p.K322R	NM_007175.6	NP_009106.1	O94905	ERLN2_HUMAN	ER lipid raft associated 2	322					cell death (GO:0008219)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|protein complex (GO:0043234)				NS(1)|large_intestine(1)|lung(5)	7		Lung NSC(58;0.174)	BRCA - Breast invasive adenocarcinoma(5;6.14e-24)|LUSC - Lung squamous cell carcinoma(8;3.5e-10)			CTAGCTGACAAGCTAAGCTTT	0.423																																					p.K322R		Atlas-SNP	.											.	ERLIN2	27	.	0			c.A965G						.						99.0	90.0	93.0					8																	37611578		2203	4300	6503	SO:0001583	missense	11160	exon12			CTGACAAGCTAAG	AY358108	CCDS6095.1, CCDS34879.1	8p11.2	2012-11-23	2007-01-26	2007-01-26	ENSG00000147475	ENSG00000147475			1356	protein-coding gene	gene with protein product		611605	"""chromosome 8 open reading frame 2"", ""SPFH domain family, member 2"""	C8orf2, SPFH2, Erlin-2		10449903, 15897872, 16835267	Standard	NM_007175		Approved	NET32, SPG18	uc003xke.4	O94905	OTTHUMG00000164005	ENST00000276461.5:c.965A>G	chr8.hg19:g.37611578A>G	ENSP00000276461:p.Lys322Arg	140.0	0.0		95.0	4.0	NM_007175	A0JLQ1|A8K5S9|B4DM38|D3DSW0|Q6NW21|Q86VS6|Q86W49	Missense_Mutation	SNP	ENST00000276461.5	hg19	CCDS6095.1	.	.	.	.	.	.	.	.	.	.	A	12.74	2.028138	0.35797	.	.	ENSG00000147475	ENST00000276461;ENST00000521644;ENST00000519638	T;T;T	0.64803	-0.12;-0.12;-0.12	5.99	4.81	0.61882	.	0.441828	0.26991	N	0.021461	T	0.36220	0.0959	N	0.04636	-0.2	0.28092	N	0.931759	B	0.09022	0.002	B	0.08055	0.003	T	0.19160	-1.0314	10	0.30078	T	0.28	-17.689	8.0033	0.30310	0.7875:0.138:0.0745:0.0	.	322	O94905	ERLN2_HUMAN	R	322	ENSP00000276461:K322R;ENSP00000429621:K322R;ENSP00000428112:K322R	ENSP00000276461:K322R	K	+	2	0	ERLIN2	37730736	1.000000	0.71417	1.000000	0.80357	0.572000	0.35998	3.250000	0.51445	1.054000	0.40438	0.533000	0.62120	AAG	.	.		0.423	ERLIN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376712.2	NM_007175	
GPR124	25960	hgsc.bcm.edu	37	8	37702706	37702706	+	IGR	SNP	A	A	G			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr8:37702706A>G	ENST00000412232.2	+	0	5651				BRF2_ENST00000220659.6_Missense_Mutation_p.S188P|BRF2_ENST00000520601.1_3'UTR	NM_032777.9	NP_116166.9	Q96PE1	GP124_HUMAN	G protein-coupled receptor 124						central nervous system development (GO:0007417)|endothelial cell migration (GO:0043542)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of vascular endothelial growth factor signaling pathway (GO:1900747)|neuropeptide signaling pathway (GO:0007218)|positive regulation of endothelial cell migration (GO:0010595)|regulation of angiogenesis (GO:0045765)|regulation of chemotaxis (GO:0050920)|regulation of establishment of blood-brain barrier (GO:0090210)|sprouting angiogenesis (GO:0002040)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(4)|lung(16)|ovary(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	37			BRCA - Breast invasive adenocarcinoma(5;2.75e-24)|LUSC - Lung squamous cell carcinoma(8;3.5e-10)			GCTGGCACAGAAGGTGAAGCT	0.498																																					p.S188P		Atlas-SNP	.											.	BRF2	33	.	0			c.T562C						.						76.0	79.0	78.0					8																	37702706		2203	4300	6503	SO:0001628	intergenic_variant	55290	exon4			GCACAGAAGGTGA	AB040964	CCDS6097.2	8p11.22	2014-08-08			ENSG00000020181	ENSG00000020181		"""-"", ""GPCR / Class B : Orphans"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	17849	protein-coding gene	gene with protein product	"""tumor endothelial marker 5"""	606823				11559528, 12565841	Standard	NM_032777		Approved	TEM5, DKFZp434C211, DKFZp434J0911, KIAA1531, FLJ14390	uc003xkj.3	Q96PE1	OTTHUMG00000156182		chr8.hg19:g.37702706A>G		187.0	0.0		97.0	4.0	NM_018310	A6H8W3|D3DSW4|Q8N3R1|Q8TEM3|Q96KB2|Q9P1Z7|Q9UFY4	Missense_Mutation	SNP	ENST00000412232.2	hg19	CCDS6097.2	.	.	.	.	.	.	.	.	.	.	A	6.958	0.546617	0.13312	.	.	ENSG00000104221	ENST00000220659;ENST00000545765	.	.	.	5.27	2.74	0.32292	.	0.427833	0.27164	N	0.020631	T	0.36082	0.0954	L	0.44542	1.39	0.30998	N	0.720632	B	0.06786	0.001	B	0.08055	0.003	T	0.29397	-1.0013	9	0.40728	T	0.16	.	7.7416	0.28845	0.4195:0.4554:0.0:0.1251	.	188	Q9HAW0	BRF2_HUMAN	P	188;165	.	ENSP00000220659:S188P	S	-	1	0	BRF2	37821864	0.000000	0.05858	0.040000	0.18447	0.404000	0.30871	0.356000	0.20181	0.267000	0.21916	0.533000	0.62120	TCT	.	.		0.498	GPR124-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343331.2		
SGK3	23678	hgsc.bcm.edu	37	8	67752280	67752280	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr8:67752280A>G	ENST00000396596.1	+	11	998	c.784A>G	c.(784-786)Aga>Gga	p.R262G	SGK3_ENST00000345714.4_Missense_Mutation_p.R262G|SGK3_ENST00000520976.1_Missense_Mutation_p.R262G|SGK3_ENST00000521435.1_3'UTR|C8orf44-SGK3_ENST00000519289.1_Missense_Mutation_p.R262G|SGK3_ENST00000522398.1_Missense_Mutation_p.R262G|SGK3_ENST00000521198.2_Missense_Mutation_p.R262G	NM_013257.4	NP_037389.4	Q96BR1	SGK3_HUMAN	serum/glucocorticoid regulated kinase family, member 3	262	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				ion transmembrane transport (GO:0034220)|protein phosphorylation (GO:0006468)|regulation of cell growth (GO:0001558)|regulation of cell migration (GO:0030334)|regulation of cell proliferation (GO:0042127)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|response to stress (GO:0006950)|transmembrane transport (GO:0055085)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endosome (GO:0005768)	ATP binding (GO:0005524)|calcium channel regulator activity (GO:0005246)|chloride channel regulator activity (GO:0017081)|phosphatidylinositol binding (GO:0035091)|potassium channel regulator activity (GO:0015459)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|sodium channel regulator activity (GO:0017080)			breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(9)|ovary(1)|upper_aerodigestive_tract(1)	18	Breast(64;0.186)	Lung NSC(129;0.0908)|all_lung(136;0.152)	Epithelial(68;0.0046)|OV - Ovarian serous cystadenocarcinoma(28;0.0112)|all cancers(69;0.0141)|BRCA - Breast invasive adenocarcinoma(89;0.206)			TCCTGAGCACAGAGCTAGGTT	0.383																																					p.R262G		Atlas-SNP	.											.	SGK3	92	.	0			c.A784G						.						129.0	113.0	119.0					8																	67752280		2203	4300	6503	SO:0001583	missense	23678	exon11			GAGCACAGAGCTA		CCDS6195.1, CCDS6196.1	8q12	2008-07-28	2005-09-13	2005-09-13		ENSG00000104205			10812	protein-coding gene	gene with protein product		607591	"""serum/glucocorticoid regulated kinase-like"""	SGK2, SGKL		10585774, 10548550	Standard	NM_013257		Approved		uc003xwr.3	Q96BR1		ENST00000396596.1:c.784A>G	chr8.hg19:g.67752280A>G	ENSP00000379842:p.Arg262Gly	85.0	0.0		75.0	4.0	NM_001033578	A8K5W3|B3KQC2|Q9P1Q7|Q9UKG5	Missense_Mutation	SNP	ENST00000396596.1	hg19	CCDS6195.1	.	.	.	.	.	.	.	.	.	.	A	14.97	2.693556	0.48202	.	.	ENSG00000104205	ENST00000519289;ENST00000521198;ENST00000262211;ENST00000522398;ENST00000520976;ENST00000396596;ENST00000345714;ENST00000521152	T;T;T;T;T;T;T	0.65549	-0.16;-0.16;-0.16;-0.16;-0.16;-0.16;-0.16	5.29	4.12	0.48240	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.74435	0.3716	L	0.60455	1.87	0.49582	D	0.999809	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.80768	-0.1235	9	0.87932	D	0	.	12.3914	0.55360	0.8591:0.1409:0.0:0.0	.	262;262	Q96BR1-2;Q96BR1	.;SGK3_HUMAN	G	262;262;262;262;262;262;262;159	ENSP00000429022:R262G;ENSP00000430463:R262G;ENSP00000430256:R262G;ENSP00000430691:R262G;ENSP00000379842:R262G;ENSP00000331816:R262G;ENSP00000429565:R159G	ENSP00000262211:R262G	R	+	1	2	SGK3	67914834	1.000000	0.71417	0.997000	0.53966	0.090000	0.18270	7.234000	0.78134	0.813000	0.34350	-0.321000	0.08615	AGA	.	.		0.383	SGK3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379232.3		
CSPP1	79848	hgsc.bcm.edu	37	8	68070772	68070772	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr8:68070772G>A	ENST00000262210.5	+	18	2348	c.2317G>A	c.(2317-2319)Gca>Aca	p.A773T	CSPP1_ENST00000412460.1_Missense_Mutation_p.A428T|CSPP1_ENST00000521168.1_3'UTR	NM_024790.6	NP_079066.5	Q1MSJ5	CSPP1_HUMAN	centrosome and spindle pole associated protein 1	808					positive regulation of cell division (GO:0051781)|positive regulation of cytokinesis (GO:0032467)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|spindle (GO:0005819)|spindle pole (GO:0000922)				NS(1)|breast(3)|endometrium(4)|kidney(3)|large_intestine(11)|lung(17)|ovary(5)|prostate(3)|skin(1)|urinary_tract(1)	49	Breast(64;0.214)	Lung NSC(129;0.0908)|all_lung(136;0.152)	Epithelial(68;0.00145)|OV - Ovarian serous cystadenocarcinoma(28;0.00589)|all cancers(69;0.0069)|BRCA - Breast invasive adenocarcinoma(89;0.153)			AGAACAGAGGGCACGAATTCa	0.398																																					p.A773T		Atlas-SNP	.											.	CSPP1	129	.	0			c.G2317A						.						60.0	59.0	60.0					8																	68070772		1859	4091	5950	SO:0001583	missense	79848	exon18			CAGAGGGCACGAA	AJ583433	CCDS43744.1	8q13.2	2014-02-24			ENSG00000104218	ENSG00000104218			26193	protein-coding gene	gene with protein product		611654				15580290, 24360807	Standard	NM_024790		Approved	FLJ22490, CSPP, JBTS21	uc003xxj.3	Q1MSJ5	OTTHUMG00000164564	ENST00000262210.5:c.2317G>A	chr8.hg19:g.68070772G>A	ENSP00000262210:p.Ala773Thr	104.0	0.0		83.0	4.0	NM_024790	A6ND63|Q70F00|Q8TBC1	Missense_Mutation	SNP	ENST00000262210.5	hg19	CCDS43744.1	.	.	.	.	.	.	.	.	.	.	G	22.9	4.349532	0.82132	.	.	ENSG00000104218	ENST00000262210;ENST00000389042;ENST00000412460;ENST00000519668	T;T;T	0.43294	0.95;1.34;1.34	5.17	5.17	0.71159	.	0.350989	0.26851	N	0.022162	T	0.47210	0.1433	N	0.24115	0.695	0.39075	D	0.960788	D;D;D;D	0.89917	1.0;0.999;0.999;0.999	D;D;D;D	0.69479	0.964;0.935;0.935;0.935	T	0.39396	-0.9616	10	0.29301	T	0.29	-3.447	13.3954	0.60849	0.0788:0.0:0.9212:0.0	.	428;773;808;808	Q1MSJ5-2;Q1MSJ5-1;Q1MSJ5;F8W7C3	.;.;CSPP1_HUMAN;.	T	773;808;428;428	ENSP00000262210:A773T;ENSP00000415782:A428T;ENSP00000430092:A428T	ENSP00000262210:A773T	A	+	1	0	CSPP1	68233326	1.000000	0.71417	0.988000	0.46212	0.735000	0.41995	4.321000	0.59209	2.553000	0.86117	0.563000	0.77884	GCA	.	.		0.398	CSPP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000379254.1	NM_024790	
ZFHX4	79776	hgsc.bcm.edu	37	8	77766356	77766356	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr8:77766356A>G	ENST00000521891.2	+	10	7647	c.7199A>G	c.(7198-7200)gAg>gGg	p.E2400G	ZFHX4_ENST00000518282.1_Missense_Mutation_p.E2374G|ZFHX4_ENST00000050961.6_Missense_Mutation_p.E2355G|ZFHX4_ENST00000455469.2_Missense_Mutation_p.E2355G	NM_024721.4	NP_078997.4	Q86UP3	ZFHX4_HUMAN	zinc finger homeobox 4	2355	Pro-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)			NS(3)|breast(11)|central_nervous_system(1)|endometrium(36)|haematopoietic_and_lymphoid_tissue(2)|kidney(15)|large_intestine(66)|liver(2)|lung(245)|ovary(11)|pancreas(3)|prostate(11)|skin(7)|upper_aerodigestive_tract(13)|urinary_tract(6)	432			BRCA - Breast invasive adenocarcinoma(89;0.0895)			CCAGAACCTGAGAAGACTTCT	0.552										HNSCC(33;0.089)																											p.E2400G		Atlas-SNP	.											.	ZFHX4	878	.	0			c.A7199G						.						38.0	46.0	43.0					8																	77766356		1930	4135	6065	SO:0001583	missense	79776	exon10			AACCTGAGAAGAC		CCDS47878.1, CCDS47878.2	8q21.11	2012-07-02	2007-07-16		ENSG00000091656	ENSG00000091656		"""Homeoboxes / ZF class"""	30939	protein-coding gene	gene with protein product		606940	"""zinc finger homeodomain 4"""			10873665, 11935336	Standard	NM_024721		Approved	ZFH4, FLJ20980	uc003yau.2	Q86UP3	OTTHUMG00000164557	ENST00000521891.2:c.7199A>G	chr8.hg19:g.77766356A>G	ENSP00000430497:p.Glu2400Gly	92.0	0.0		91.0	4.0	NM_024721	G3V138|Q18PS0|Q6ZN20	Missense_Mutation	SNP	ENST00000521891.2	hg19	CCDS47878.2	.	.	.	.	.	.	.	.	.	.	A	15.01	2.707427	0.48412	.	.	ENSG00000091656	ENST00000521891;ENST00000399468;ENST00000455469;ENST00000050961;ENST00000518282	T;T;T;T	0.50001	0.76;0.8;0.77;0.77	5.23	5.23	0.72850	.	0.000000	0.44688	U	0.000429	T	0.38772	0.1053	L	0.38175	1.15	0.37762	D	0.926354	B;B;B	0.06786	0.0;0.001;0.001	B;B;B	0.06405	0.001;0.002;0.002	T	0.29458	-1.0011	10	0.23891	T	0.37	.	15.2884	0.73849	1.0:0.0:0.0:0.0	.	2355;2355;2400	Q86UP3;Q86UP3-4;G3V138	ZFHX4_HUMAN;.;.	G	2400;2384;2355;2355;2374	ENSP00000430497:E2400G;ENSP00000399605:E2355G;ENSP00000050961:E2355G;ENSP00000430848:E2374G	ENSP00000050961:E2355G	E	+	2	0	ZFHX4	77928911	1.000000	0.71417	0.992000	0.48379	0.865000	0.49528	6.539000	0.73856	2.197000	0.70478	0.528000	0.53228	GAG	.	.		0.552	ZFHX4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000379197.2	NM_024721	
MATN2	4147	hgsc.bcm.edu	37	8	98943556	98943556	+	Missense_Mutation	SNP	C	C	G			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr8:98943556C>G	ENST00000520016.1	+	2	642	c.518C>G	c.(517-519)cCt>cGt	p.P173R	MATN2_ENST00000524308.1_Missense_Mutation_p.P173R|MATN2_ENST00000254898.5_Missense_Mutation_p.P173R|MATN2_ENST00000521689.1_Missense_Mutation_p.P173R|MATN2_ENST00000522025.2_Intron			O00339	MATN2_HUMAN	matrilin 2	173	VWFA 1. {ECO:0000255|PROSITE- ProRule:PRU00219}.					proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)			breast(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(17)|ovary(2)|urinary_tract(1)	31	Breast(36;1.43e-06)		OV - Ovarian serous cystadenocarcinoma(57;0.244)			GATGGGAGACCTCAGGACTCC	0.577																																					p.P173R		Atlas-SNP	.											.	MATN2	165	.	0			c.C518G						.						38.0	44.0	42.0					8																	98943556		2125	4241	6366	SO:0001583	missense	4147	exon3			GGAGACCTCAGGA	U69263	CCDS55264.1, CCDS55265.1	8q22.1-q22.2	2008-05-15							6908	protein-coding gene	gene with protein product		602108				9083061, 11852232	Standard	XM_005250920		Approved		uc003yic.3	O00339		ENST00000520016.1:c.518C>G	chr8.hg19:g.98943556C>G	ENSP00000430487:p.Pro173Arg	73.0	0.0		95.0	18.0	NM_002380	A8K106|E7EW74|E9PD48|E9PGL2|Q6UWA5|Q7Z5X1|Q8NDE6|Q96FT5|Q9NSZ1	Missense_Mutation	SNP	ENST00000520016.1	hg19	CCDS55264.1	.	.	.	.	.	.	.	.	.	.	C	21.3	4.128974	0.77549	.	.	ENSG00000132561	ENST00000521689;ENST00000254898;ENST00000378716;ENST00000524308;ENST00000520016	D;D;D;D	0.84070	-1.8;-1.8;-1.8;-1.8	5.82	5.82	0.92795	von Willebrand factor, type A (3);	0.000000	0.64402	D	0.000008	D	0.92747	0.7694	M	0.87180	2.865	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	D	0.92955	0.6384	10	0.66056	D	0.02	-16.2546	20.1001	0.97870	0.0:1.0:0.0:0.0	.	173;173;173;173	E9PF03;O00339-2;O00339;Q8N2G3	.;.;MATN2_HUMAN;.	R	173	ENSP00000429977:P173R;ENSP00000254898:P173R;ENSP00000430221:P173R;ENSP00000430487:P173R	ENSP00000254898:P173R	P	+	2	0	MATN2	99012732	1.000000	0.71417	0.966000	0.40874	0.501000	0.33797	7.770000	0.85390	2.760000	0.94817	0.655000	0.94253	CCT	.	.		0.577	MATN2-004	KNOWN	non_canonical_conserved|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000380332.1		
KCNQ3	3786	hgsc.bcm.edu	37	8	133492571	133492571	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr8:133492571T>C	ENST00000388996.4	-	1	629	c.209A>G	c.(208-210)gAg>gGg	p.E70G	KCNQ3_ENST00000519445.1_Missense_Mutation_p.E70G	NM_004519.3	NP_004510.1	O43525	KCNQ3_HUMAN	potassium voltage-gated channel, KQT-like subfamily, member 3	70					axon guidance (GO:0007411)|membrane hyperpolarization (GO:0060081)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	axon initial segment (GO:0043194)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|potassium channel activity (GO:0005267)|voltage-gated potassium channel activity (GO:0005249)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(21)|lung(22)|ovary(2)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	70	Esophageal squamous(12;0.00507)|Ovarian(258;0.00579)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000311)		Amitriptyline(DB00321)|Diclofenac(DB00586)|Ezogabine(DB04953)|Meclofenamic acid(DB00939)	GCCGCCGCCCTCCAGCAGCAG	0.721																																					p.E70G		Atlas-SNP	.											.	KCNQ3	164	.	0			c.A209G						.						12.0	15.0	14.0					8																	133492571		2193	4269	6462	SO:0001583	missense	3786	exon1			CCGCCCTCCAGCA	AB208890	CCDS34943.1, CCDS56554.1	8q24	2012-07-05			ENSG00000184156	ENSG00000184156		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6297	protein-coding gene	gene with protein product		602232		EBN2		9425900, 16382104	Standard	NM_004519		Approved	Kv7.3	uc003ytj.3	O43525	OTTHUMG00000137472	ENST00000388996.4:c.209A>G	chr8.hg19:g.133492571T>C	ENSP00000373648:p.Glu70Gly	1.0	0.0		73.0	4.0	NM_004519	A2VCT8|B4DJY4|E7EQ89	Missense_Mutation	SNP	ENST00000388996.4	hg19	CCDS34943.1	.	.	.	.	.	.	.	.	.	.	T	8.542	0.873466	0.17322	.	.	ENSG00000184156	ENST00000388996;ENST00000519445;ENST00000542679	D;D	0.98958	-5.25;-5.27	4.33	3.17	0.36434	.	0.114902	0.33364	N	0.004990	D	0.91713	0.7380	N	0.08118	0	0.28278	N	0.924109	P;P	0.43477	0.808;0.808	B;B	0.33295	0.161;0.161	D	0.89366	0.3671	10	0.07644	T	0.81	-10.2153	7.7694	0.28999	0.0:0.0963:0.0:0.9037	.	70;70	E7ET42;O43525	.;KCNQ3_HUMAN	G	70;70;59	ENSP00000373648:E70G;ENSP00000428790:E70G	ENSP00000373648:E70G	E	-	2	0	KCNQ3	133561753	1.000000	0.71417	1.000000	0.80357	0.017000	0.09413	1.536000	0.36072	0.703000	0.31848	0.455000	0.32223	GAG	.	.		0.721	KCNQ3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268621.2	NM_004519	
MROH6	642475	hgsc.bcm.edu	37	8	144650754	144650754	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr8:144650754G>A	ENST00000398882.3	-	10	1868	c.1612C>T	c.(1612-1614)Cgc>Tgc	p.R538C	MROH6_ENST00000534459.1_5'UTR|MROH6_ENST00000524906.1_5'UTR|MROH6_ENST00000533679.1_5'UTR|MROH6_ENST00000532704.1_5'Flank	NM_001100878.1	NP_001094348.1	A6NGR9	MROH6_HUMAN	maestro heat-like repeat family member 6	538	Leu-rich.																TCATGCAGGCGCAGCAGCAGC	0.721																																					p.R538C		Atlas-SNP	.											.	.	.	.	0			c.C1612T						.						4.0	5.0	4.0					8																	144650754		1835	3855	5690	SO:0001583	missense	642475	exon10			GCAGGCGCAGCAG	AF289596	CCDS47928.1	8q24.3	2012-12-19	2012-12-19	2012-12-19	ENSG00000204839	ENSG00000204839		"""maestro heat-like repeat containing"""	27814	protein-coding gene	gene with protein product			"""chromosome 8 open reading frame 73"""	C8orf73		12477932	Standard	NM_001100878		Approved		uc010mff.3	A6NGR9	OTTHUMG00000165164	ENST00000398882.3:c.1612C>T	chr8.hg19:g.144650754G>A	ENSP00000381857:p.Arg538Cys	1.0	0.0		17.0	5.0	NM_001100878	A8MWB1	Missense_Mutation	SNP	ENST00000398882.3	hg19	CCDS47928.1	.	.	.	.	.	.	.	.	.	.	g	18.79	3.699009	0.68501	.	.	ENSG00000204839	ENST00000398882	T	0.43294	0.95	4.89	4.89	0.63831	Armadillo-like helical (1);Armadillo-type fold (1);	.	.	.	.	T	0.56572	0.1994	L	0.44542	1.39	0.80722	D	1	D	0.89917	1.0	D	0.79108	0.992	T	0.57825	-0.7744	9	0.54805	T	0.06	-48.715	15.5415	0.76052	0.0:0.0:1.0:0.0	.	538	A6NGR9	CH073_HUMAN	C	538	ENSP00000381857:R538C	ENSP00000381857:R538C	R	-	1	0	C8orf73	144721897	1.000000	0.71417	0.998000	0.56505	0.373000	0.29922	5.761000	0.68801	2.266000	0.75297	0.543000	0.68304	CGC	.	.		0.721	MROH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382330.3	NM_001100878	
DOCK8	81704	hgsc.bcm.edu	37	9	441995	441995	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr9:441995T>C	ENST00000453981.1	+	42	5588	c.5476T>C	c.(5476-5478)Tca>Cca	p.S1826P	DOCK8_ENST00000432829.2_Missense_Mutation_p.S1758P|DOCK8_ENST00000469391.1_Missense_Mutation_p.S1726P|DOCK8_ENST00000382329.1_Missense_Mutation_p.S1293P			Q8NF50	DOCK8_HUMAN	dedicator of cytokinesis 8	1826	DHR-2.				blood coagulation (GO:0007596)|dendritic cell migration (GO:0036336)|immunological synapse formation (GO:0001771)|memory T cell proliferation (GO:0061485)|negative regulation of T cell apoptotic process (GO:0070233)|small GTPase mediated signal transduction (GO:0007264)	cell leading edge (GO:0031252)|cytosol (GO:0005829)|membrane (GO:0016020)	guanyl-nucleotide exchange factor activity (GO:0005085)			breast(1)|central_nervous_system(5)|endometrium(2)|kidney(6)|large_intestine(13)|lung(22)|ovary(3)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	65		all_cancers(5;2.13e-17)|all_epithelial(5;2.15e-12)|all_lung(10;6.69e-11)|Lung NSC(10;1.08e-10)|Acute lymphoblastic leukemia(5;0.000242)|all_hematologic(5;0.00317)|Breast(48;0.0151)|Prostate(43;0.128)		all cancers(5;9.3e-07)|GBM - Glioblastoma multiforme(5;2.41e-06)|Epithelial(6;0.00557)|Lung(218;0.00942)		TCCTGAGATCTCACATAGACT	0.398																																					p.S1826P		Atlas-SNP	.											.	DOCK8	401	.	0			c.T5476C						.						109.0	105.0	106.0					9																	441995		2203	4300	6503	SO:0001583	missense	81704	exon42			GAGATCTCACATA	AK090429	CCDS6440.1, CCDS6440.2, CCDS55283.1, CCDS55284.1	9p24.3	2014-09-17			ENSG00000107099	ENSG00000107099			19191	protein-coding gene	gene with protein product		611432				11214971	Standard	NM_203447		Approved	FLJ00026, FLJ00152, ZIR8, FLJ00346	uc003zgf.2	Q8NF50	OTTHUMG00000078789	ENST00000453981.1:c.5476T>C	chr9.hg19:g.441995T>C	ENSP00000408464:p.Ser1826Pro	50.0	0.0		51.0	4.0	NM_203447	A2A350|A2BDF2|A4FU78|B7ZLP0|E9PH09|Q3MV16|Q5JPJ1|Q8TEP1|Q8WUY2|Q9BYJ5|Q9H1Q2|Q9H1Q3|Q9H308|Q9H7P2	Missense_Mutation	SNP	ENST00000453981.1	hg19	CCDS6440.2	.	.	.	.	.	.	.	.	.	.	T	24.0	4.481952	0.84747	.	.	ENSG00000107099	ENST00000453981;ENST00000287364;ENST00000432829;ENST00000469391;ENST00000382329	T;T;T;T	0.19806	2.34;2.34;2.35;2.12	5.46	5.46	0.80206	.	0.118609	0.64402	D	0.000012	T	0.48077	0.1480	M	0.92604	3.325	0.80722	D	1	P;P;P	0.50943	0.866;0.94;0.94	P;P;P	0.52031	0.688;0.566;0.688	T	0.61466	-0.7057	10	0.62326	D	0.03	.	15.7119	0.77635	0.0:0.0:0.0:1.0	.	1726;1293;1826	E9PH09;A2A369;Q8NF50	.;.;DOCK8_HUMAN	P	1826;1794;1758;1726;1293	ENSP00000408464:S1826P;ENSP00000394888:S1758P;ENSP00000419438:S1726P;ENSP00000371766:S1293P	ENSP00000287364:S1794P	S	+	1	0	DOCK8	431995	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.778000	0.85637	2.291000	0.77112	0.533000	0.62120	TCA	.	.		0.398	DOCK8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000171792.5	XM_036307	
SMARCA2	6595	hgsc.bcm.edu	37	9	2039815	2039815	+	Silent	SNP	G	G	A	rs574062756	byFrequency	TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr9:2039815G>A	ENST00000382203.1	+	4	914	c.705G>A	c.(703-705)caG>caA	p.Q235Q	SMARCA2_ENST00000491574.1_3'UTR|RP11-264I13.2_ENST00000426860.1_RNA|SMARCA2_ENST00000357248.2_Silent_p.Q235Q|SMARCA2_ENST00000349721.2_Silent_p.Q235Q|SMARCA2_ENST00000382194.1_Silent_p.Q235Q			P51531	SMCA2_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2	235	Poly-Gln.				aortic smooth muscle cell differentiation (GO:0035887)|ATP catabolic process (GO:0006200)|chromatin remodeling (GO:0006338)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)	intermediate filament cytoskeleton (GO:0045111)|intracellular membrane-bounded organelle (GO:0043231)|nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	ATP binding (GO:0005524)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)|RNA polymerase II transcription coactivator activity (GO:0001105)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(11)|liver(2)|lung(19)|ovary(3)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	56		all_lung(10;2.06e-09)|Lung NSC(10;2.43e-09)		GBM - Glioblastoma multiforme(50;0.0475)		agcagcagcagcaacagcagc	0.587													G|||	41	0.0081869	0.0151	0.0029	5008	,	,		10366	0.0089		0.0	False		,,,				2504	0.0102				p.Q235Q		Atlas-SNP	.											.	SMARCA2	313	.	0			c.G705A						.						10.0	13.0	12.0					9																	2039815		2161	4205	6366	SO:0001819	synonymous_variant	6595	exon4			GCAGCAGCAACAG	D26155	CCDS34977.1, CCDS34978.1, CCDS75807.1, CCDS75808.1	9p24.3	2008-11-11	2006-11-09		ENSG00000080503	ENSG00000080503			11098	protein-coding gene	gene with protein product		600014		SNF2L2		8012116	Standard	NM_003070		Approved	BAF190, hSNF2a, hBRM, Sth1p, SNF2LA, BRM, SNF2, SWI2	uc003zhc.3	P51531	OTTHUMG00000019445	ENST00000382203.1:c.705G>A	chr9.hg19:g.2039815G>A		94.0	0.0		97.0	6.0	NM_139045	B1ALG3|B1ALG4|D3DRH4|D3DRH5	Silent	SNP	ENST00000382203.1	hg19	CCDS34977.1																																																																																			.	.		0.587	SMARCA2-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000051505.1	NM_003070	
TLN1	7094	hgsc.bcm.edu	37	9	35700292	35700292	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr9:35700292T>C	ENST00000314888.9	-	49	6909	c.6556A>G	c.(6556-6558)Acc>Gcc	p.T2186A	TLN1_ENST00000540444.1_Missense_Mutation_p.T2074A	NM_006289.3	NP_006280.3	Q9Y490	TLN1_HUMAN	talin 1	2186					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell-cell junction assembly (GO:0007043)|cell-substrate junction assembly (GO:0007044)|cellular component movement (GO:0006928)|cellular protein metabolic process (GO:0044267)|cortical actin cytoskeleton organization (GO:0030866)|cytoskeletal anchoring at plasma membrane (GO:0007016)|endoplasmic reticulum unfolded protein response (GO:0030968)|muscle contraction (GO:0006936)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)	actin cytoskeleton (GO:0015629)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|microtubule organizing center (GO:0005815)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	integrin binding (GO:0005178)|LIM domain binding (GO:0030274)|structural constituent of cytoskeleton (GO:0005200)|vinculin binding (GO:0017166)			NS(2)|breast(8)|central_nervous_system(2)|endometrium(10)|kidney(5)|large_intestine(9)|lung(32)|ovary(3)|prostate(5)|skin(3)|upper_aerodigestive_tract(6)	85	all_epithelial(49;0.167)		Lung(28;0.00276)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)			GCCTTGGCGGTTGCCATGGTG	0.557																																					p.T2186A		Atlas-SNP	.											.	TLN1	185	.	0			c.A6556G						.						70.0	70.0	70.0					9																	35700292		2203	4300	6503	SO:0001583	missense	7094	exon49			TGGCGGTTGCCAT	AB028950	CCDS35009.1	9p23-p21	2008-02-05			ENSG00000137076	ENSG00000137076			11845	protein-coding gene	gene with protein product		186745		TLN		7635475, 10610730	Standard	NM_006289		Approved	ILWEQ	uc003zxt.2	Q9Y490	OTTHUMG00000019874	ENST00000314888.9:c.6556A>G	chr9.hg19:g.35700292T>C	ENSP00000316029:p.Thr2186Ala	138.0	0.0		100.0	4.0	NM_006289	A6NMY0|Q86YD0|Q9NZQ2|Q9UHH8|Q9UPX3	Missense_Mutation	SNP	ENST00000314888.9	hg19	CCDS35009.1	.	.	.	.	.	.	.	.	.	.	T	27.6	4.846765	0.91277	.	.	ENSG00000137076	ENST00000314888;ENST00000540444	T;T	0.69806	-0.43;-0.41	5.2	5.2	0.72013	.	0.051237	0.85682	D	0.000000	T	0.76126	0.3944	M	0.78916	2.43	0.80722	D	1	D	0.57899	0.981	P	0.53401	0.725	T	0.78211	-0.2292	10	0.44086	T	0.13	-13.177	14.7488	0.69508	0.0:0.0:0.0:1.0	.	2186	Q9Y490	TLN1_HUMAN	A	2186;2074	ENSP00000316029:T2186A;ENSP00000442981:T2074A	ENSP00000316029:T2186A	T	-	1	0	TLN1	35690292	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	7.967000	0.87967	1.972000	0.57404	0.533000	0.62120	ACC	.	.		0.557	TLN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052353.2	NM_006289	
GNE	10020	hgsc.bcm.edu	37	9	36246060	36246060	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr9:36246060T>C	ENST00000539815.1	-	2	624	c.584A>G	c.(583-585)aAa>aGa	p.K195R	GNE_ENST00000539208.1_Missense_Mutation_p.K136R|GNE_ENST00000377902.5_Missense_Mutation_p.K195R|GNE_ENST00000447283.2_Missense_Mutation_p.K195R|GNE_ENST00000543356.2_Missense_Mutation_p.K190R|GNE_ENST00000396594.3_Missense_Mutation_p.K226R			Q9Y223	GLCNE_HUMAN	glucosamine (UDP-N-acetyl)-2-epimerase/N-acetylmannosamine kinase	195					carbohydrate phosphorylation (GO:0046835)|cell adhesion (GO:0007155)|N-acetylglucosamine biosynthetic process (GO:0006045)|N-acetylneuraminate metabolic process (GO:0006054)|UDP-N-acetylglucosamine metabolic process (GO:0006047)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	ATP binding (GO:0005524)|hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)|metal ion binding (GO:0046872)|N-acylmannosamine kinase activity (GO:0009384)|UDP-N-acetylglucosamine 2-epimerase activity (GO:0008761)			endometrium(8)|kidney(1)|large_intestine(3)|lung(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	19			STAD - Stomach adenocarcinoma(86;0.228)			CATGTAGTCTTTGTTCTTGGC	0.458																																					p.K226R	GBM(184;106 2118 20004 35750 50727)	Atlas-SNP	.											.	GNE	141	.	0			c.A677G						.						142.0	124.0	130.0					9																	36246060		2203	4300	6503	SO:0001583	missense	10020	exon3			TAGTCTTTGTTCT	AF051852	CCDS6602.1, CCDS47965.1, CCDS55308.1, CCDS55309.1, CCDS55310.1	9p13.1	2008-02-05	2003-12-01		ENSG00000159921	ENSG00000159921			23657	protein-coding gene	gene with protein product		603824	"""UDP-N-acetylglucosamine-2-epimerase/N-acetylmannosamine kinase"""	IBM2		9305887, 9305888	Standard	NM_005476		Approved	Uae1	uc010mli.3	Q9Y223	OTTHUMG00000019899	ENST00000539815.1:c.584A>G	chr9.hg19:g.36246060T>C	ENSP00000439155:p.Lys195Arg	81.0	0.0		93.0	4.0	NM_001128227	A6PZH2|A6PZH3|A7UNU7|B2R6E1|B7Z372|B7Z428|D3DRP7|F5H499|H0YFA7|Q0VA94	Missense_Mutation	SNP	ENST00000539815.1	hg19	CCDS6602.1	.	.	.	.	.	.	.	.	.	.	T	12.40	1.927134	0.34002	.	.	ENSG00000159921	ENST00000377902;ENST00000396594;ENST00000339267;ENST00000539815;ENST00000543356;ENST00000539208;ENST00000447283	D;D;D;D;D	0.98978	-5.29;-5.29;-5.29;-5.29;-5.29	5.52	5.52	0.82312	.	0.094405	0.64402	D	0.000001	D	0.95544	0.8552	N	0.11560	0.145	0.38069	D	0.936301	B;B;B;B;B	0.10296	0.0;0.001;0.0;0.001;0.003	B;B;B;B;B	0.09377	0.001;0.001;0.001;0.002;0.004	D	0.94273	0.7512	10	0.23891	T	0.37	-20.9812	13.5913	0.61961	0.0:0.0:0.0:1.0	.	136;154;226;195;195	F5H499;Q9Y223-3;Q9Y223-2;Q9Y223;A7UNU7	.;.;.;GLCNE_HUMAN;.	R	195;226;190;195;167;136;195	ENSP00000367134:K195R;ENSP00000379839:K226R;ENSP00000439155:K195R;ENSP00000445117:K136R;ENSP00000414760:K195R	ENSP00000340770:K190R	K	-	2	0	GNE	36236060	0.998000	0.40836	1.000000	0.80357	0.956000	0.61745	2.672000	0.46850	2.106000	0.64143	0.383000	0.25322	AAA	.	.		0.458	GNE-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052412.4	NM_005476	
PTAR1	375743	hgsc.bcm.edu	37	9	72356709	72356709	+	Splice_Site	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr9:72356709T>C	ENST00000340434.4	-	3	325	c.322A>G	c.(322-324)Agg>Ggg	p.R108G	PTAR1_ENST00000377200.5_Intron	NM_001099666.1	NP_001093136.1	Q7Z6K3	PTAR1_HUMAN	protein prenyltransferase alpha subunit repeat containing 1	108					protein prenylation (GO:0018342)		protein prenyltransferase activity (GO:0008318)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)	5						ATGACATACCTCACGTTCCAT	0.333																																					p.R108G		Atlas-SNP	.											.	PTAR1	46	.	0			c.A322G						.						82.0	76.0	77.0					9																	72356709		1875	4118	5993	SO:0001630	splice_region_variant	375743	exon3			CATACCTCACGTT	BC053622	CCDS47978.1	9q21.13	2008-10-01			ENSG00000188647	ENSG00000188647		"""Prenyltransferase alpha subunit repeat containing"""	30449	protein-coding gene	gene with protein product						12477932	Standard	NM_001099666		Approved		uc004ahj.4	Q7Z6K3	OTTHUMG00000019982	ENST00000340434.4:c.323+1A>G	chr9.hg19:g.72356709T>C		85.0	0.0		98.0	5.0	NM_001099666	Q5T7V5|Q5T7V6	Missense_Mutation	SNP	ENST00000340434.4	hg19	CCDS47978.1	.	.	.	.	.	.	.	.	.	.	T	22.3	4.270626	0.80469	.	.	ENSG00000188647	ENST00000340434	T	0.70749	-0.51	5.74	5.74	0.90152	Protein prenyltransferase (1);	.	.	.	.	T	0.77103	0.4081	M	0.70595	2.14	0.80722	D	1	D	0.58620	0.983	P	0.49683	0.619	T	0.80845	-0.1200	9	0.87932	D	0	.	16.0405	0.80679	0.0:0.0:0.0:1.0	.	108	Q7Z6K3	PTAR1_HUMAN	G	108	ENSP00000344299:R108G	ENSP00000344299:R108G	R	-	1	2	PTAR1	71546529	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	4.519000	0.60517	2.187000	0.69744	0.519000	0.50382	AGG	.	.		0.333	PTAR1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052582.4	NM_001099666	Missense_Mutation
VPS13A	23230	hgsc.bcm.edu	37	9	79834895	79834895	+	Silent	SNP	C	C	T			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr9:79834895C>T	ENST00000360280.3	+	11	1040	c.780C>T	c.(778-780)gcC>gcT	p.A260A	VPS13A_ENST00000376634.4_Silent_p.A260A|VPS13A_ENST00000357409.5_Silent_p.A260A|VPS13A_ENST00000376636.3_Silent_p.A260A	NM_033305.2	NP_150648.2	Q96RL7	VP13A_HUMAN	vacuolar protein sorting 13 homolog A (S. cerevisiae)	260					cell death (GO:0008219)|Golgi to endosome transport (GO:0006895)|locomotory behavior (GO:0007626)|nervous system development (GO:0007399)|protein localization (GO:0008104)|protein transport (GO:0015031)|social behavior (GO:0035176)	dense core granule (GO:0031045)|intracellular (GO:0005622)				breast(4)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(28)|liver(1)|lung(42)|ovary(3)|pancreas(3)|prostate(3)|skin(9)|upper_aerodigestive_tract(1)|urinary_tract(1)	104						CTGCTAATGCCAAACTTGTGA	0.318																																					p.A260A		Atlas-SNP	.											.	VPS13A	735	.	0			c.C780T						.						78.0	80.0	80.0					9																	79834895		2203	4299	6502	SO:0001819	synonymous_variant	23230	exon11			TAATGCCAAACTT	AB023203	CCDS6655.1, CCDS6656.1, CCDS47983.1, CCDS55321.1	9q21	2014-01-30	2006-04-04	2004-02-11	ENSG00000197969	ENSG00000197969			1908	protein-coding gene	gene with protein product	"""chorein"""	605978	"""chorea acanthocytosis"", ""vacuolar protein sorting 13A (yeast)"""	CHAC		9382101, 11381253	Standard	NM_001018038		Approved	KIAA0986	uc004akr.3	Q96RL7	OTTHUMG00000020055	ENST00000360280.3:c.780C>T	chr9.hg19:g.79834895C>T		93.0	0.0		75.0	4.0	NM_001018038	Q5JSX9|Q5JSY0|Q5VYR5|Q702P4|Q709D0|Q86YF8|Q96S61|Q9H995|Q9Y2J1	Silent	SNP	ENST00000360280.3	hg19	CCDS6655.1																																																																																			.	.		0.318	VPS13A-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000052753.2	NM_015186	
RASEF	158158	hgsc.bcm.edu	37	9	85627416	85627416	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr9:85627416T>C	ENST00000376447.3	-	5	1036	c.776A>G	c.(775-777)cAa>cGa	p.Q259R		NM_152573.2	NP_689786.2	Q8IZ41	RASEF_HUMAN	RAS and EF-hand domain containing	259					protein transport (GO:0015031)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)|GTP binding (GO:0005525)			NS(1)|breast(1)|endometrium(2)|kidney(4)|large_intestine(4)|liver(1)|lung(15)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	33						GCGTTTTGATTGTTCTTCGAG	0.328																																					p.Q259R		Atlas-SNP	.											.	RASEF	69	.	0			c.A776G						.						115.0	96.0	102.0					9																	85627416		2200	4298	6498	SO:0001583	missense	158158	exon5			TTTGATTGTTCTT	AK056176	CCDS6662.1	9q21.33	2014-05-09	2004-06-11	2004-06-16	ENSG00000165105	ENSG00000165105		"""EF-hand domain containing"", ""RAB, member RAS oncogene"""	26464	protein-coding gene	gene with protein product		611344	"""RAB45, member RAS oncogene family"""	RAB45		17448446	Standard	NM_152573		Approved	FLJ31614	uc004amo.2	Q8IZ41	OTTHUMG00000020100	ENST00000376447.3:c.776A>G	chr9.hg19:g.85627416T>C	ENSP00000365630:p.Gln259Arg	74.0	0.0		77.0	4.0	NM_152573	A6NC29|Q96N04	Missense_Mutation	SNP	ENST00000376447.3	hg19	CCDS6662.1	.	.	.	.	.	.	.	.	.	.	T	17.05	3.289356	0.59976	.	.	ENSG00000165105	ENST00000376447	T	0.61742	0.08	5.22	5.22	0.72569	.	0.122400	0.56097	D	0.000030	T	0.59238	0.2179	M	0.67953	2.075	0.80722	D	1	P	0.46142	0.873	B	0.42422	0.387	T	0.66763	-0.5841	10	0.87932	D	0	.	14.3933	0.66994	0.0:0.0:0.0:1.0	.	259	Q8IZ41	RASEF_HUMAN	R	259	ENSP00000365630:Q259R	ENSP00000365630:Q259R	Q	-	2	0	RASEF	84817236	1.000000	0.71417	0.974000	0.42286	0.874000	0.50279	5.042000	0.64202	2.093000	0.63338	0.528000	0.53228	CAA	.	.		0.328	RASEF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052825.1	NM_152573	
IARS	3376	hgsc.bcm.edu	37	9	95050074	95050074	+	Splice_Site	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr9:95050074T>C	ENST00000375643.3	-	4	661	c.395A>G	c.(394-396)aAg>aGg	p.K132R	IARS_ENST00000375629.3_5'UTR|IARS_ENST00000443024.2_Splice_Site_p.K132R|IARS_ENST00000447699.2_Splice_Site_p.K22R	NM_013417.2	NP_038203.2	P41252	SYIC_HUMAN	isoleucyl-tRNA synthetase	132					gene expression (GO:0010467)|isoleucyl-tRNA aminoacylation (GO:0006428)|osteoblast differentiation (GO:0001649)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	aminoacyl-tRNA editing activity (GO:0002161)|ATP binding (GO:0005524)|isoleucine-tRNA ligase activity (GO:0004822)			breast(3)|endometrium(2)|kidney(4)|large_intestine(7)|lung(14)|ovary(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	35					L-Isoleucine(DB00167)	CCAACATACCTTCCACTCAGC	0.383																																					p.K132R		Atlas-SNP	.											.	IARS	74	.	0			c.A395G						.						182.0	157.0	166.0					9																	95050074		2203	4300	6503	SO:0001630	splice_region_variant	3376	exon4			CATACCTTCCACT	AB209234	CCDS6694.1	9q21	2011-07-01	2007-02-26		ENSG00000196305	ENSG00000196305	6.1.1.5	"""Aminoacyl tRNA synthetases / Class I"""	5330	protein-coding gene	gene with protein product	"""isoleucine tRNA ligase 1, cytoplasmic"""	600709				8812440	Standard	NM_002161		Approved	ILRS, IARS1	uc004aru.4	P41252	OTTHUMG00000020219	ENST00000375643.3:c.396+1A>G	chr9.hg19:g.95050074T>C		143.0	0.0		136.0	6.0	NM_013417	A8KAE9|Q5TCD0|Q7Z3T4|Q9H588	Missense_Mutation	SNP	ENST00000375643.3	hg19	CCDS6694.1	.	.	.	.	.	.	.	.	.	.	T	1.235	-0.623029	0.03636	.	.	ENSG00000196305	ENST00000375643;ENST00000443024;ENST00000447699;ENST00000375660;ENST00000395554	T;T;T;T	0.35048	1.33;1.33;1.33;1.33	5.79	0.578	0.17391	Rossmann-like alpha/beta/alpha sandwich fold (1);Aminoacyl-tRNA synthetase, class Ia (1);	0.486738	0.23583	N	0.046623	T	0.17959	0.0431	N	0.12920	0.275	0.80722	D	1	B	0.02656	0.0	B	0.08055	0.003	T	0.17623	-1.0363	10	0.10902	T	0.67	-4.5741	11.094	0.48132	0.0:0.2823:0.0:0.7177	.	132	P41252	SYIC_HUMAN	R	132;132;22;132;132	ENSP00000364794:K132R;ENSP00000406448:K132R;ENSP00000415020:K22R;ENSP00000378922:K132R	ENSP00000364794:K132R	K	-	2	0	IARS	94089895	1.000000	0.71417	0.989000	0.46669	0.168000	0.22595	2.306000	0.43673	-0.415000	0.07484	-1.447000	0.01057	AAG	.	.		0.383	IARS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053059.2	NM_002161	Missense_Mutation
NUTM2F	54754	hgsc.bcm.edu	37	9	97080944	97080944	+	Missense_Mutation	SNP	G	G	C	rs150455117	byFrequency	TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr9:97080944G>C	ENST00000253262.4	-	7	2094	c.2074C>G	c.(2074-2076)Cct>Gct	p.P692A	NUTM2F_ENST00000341207.4_Missense_Mutation_p.P677A|NUTM2F_ENST00000335456.7_Intron	NM_017561.1	NP_060031.1	A1L443	NTM2F_HUMAN	NUT family member 2F	692																	TTGCTGGCAGGAGAAGGTGAT	0.607																																					p.P692A		Atlas-SNP	.											.	FAM22F	72	.	0			c.C2074G						.						21.0	19.0	20.0					9																	97080944		1843	4069	5912	SO:0001583	missense	54754	exon7			TGGCAGGAGAAGG		CCDS47994.1	9q22.32	2013-05-02	2013-03-14	2013-05-02	ENSG00000130950	ENSG00000130950			23450	protein-coding gene	gene with protein product			"""family with sequence similarity 22, member F"""	FAM22F			Standard	NM_017561		Approved	DKFZp434I1117		A1L443	OTTHUMG00000020260	ENST00000253262.4:c.2074C>G	chr9.hg19:g.97080944G>C	ENSP00000253262:p.Pro692Ala	377.0	0.0		390.0	17.0	NM_017561	B6ZDF0|Q5SR58|Q5SR59|Q9UFB1	Missense_Mutation	SNP	ENST00000253262.4	hg19	CCDS47994.1	.	.	.	.	.	.	.	.	.	.	G	0.014	-1.581686	0.00879	.	.	ENSG00000130950	ENST00000253262;ENST00000341207;ENST00000375347	T;T	0.14640	2.49;2.52	1.52	-3.04	0.05412	Nuclear Testis protein, C-terminal (1);	2.077270	0.02242	N	0.065820	T	0.12561	0.0305	L	0.56769	1.78	0.09310	N	1	B	0.13594	0.008	B	0.16289	0.015	T	0.30621	-0.9972	10	0.09084	T	0.74	.	5.0244	0.14378	0.1751:0.5512:0.2738:0.0	.	692	A1L443	FA22F_HUMAN	A	692;677;526	ENSP00000253262:P692A;ENSP00000343865:P677A	ENSP00000253262:P692A	P	-	1	0	FAM22F	96120765	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.495000	0.06443	-1.287000	0.02381	-0.518000	0.04402	CCT	.	.		0.607	NUTM2F-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000053173.2	NM_017561	
IKBKAP	8518	hgsc.bcm.edu	37	9	111644428	111644428	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr9:111644428C>T	ENST00000374647.5	-	30	3569	c.3262G>A	c.(3262-3264)Gcc>Acc	p.A1088T	IKBKAP_ENST00000467959.1_5'UTR|IKBKAP_ENST00000537196.1_Missense_Mutation_p.A739T	NM_003640.3	NP_003631.2	O95163	ELP1_HUMAN	inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase complex-associated protein	1088					chromatin organization (GO:0006325)|immune response (GO:0006955)|positive regulation of cell migration (GO:0030335)|protein complex assembly (GO:0006461)|protein phosphorylation (GO:0006468)|regulation of protein kinase activity (GO:0045859)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|signal transduction (GO:0007165)|transcription elongation from RNA polymerase II promoter (GO:0006368)	cytoplasm (GO:0005737)|DNA-directed RNA polymerase II, holoenzyme (GO:0016591)|Elongator holoenzyme complex (GO:0033588)|nucleolus (GO:0005730)|transcription elongation factor complex (GO:0008023)	phosphorylase kinase regulator activity (GO:0008607)|signal transducer activity (GO:0004871)			NS(2)|breast(3)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(7)|large_intestine(4)|lung(13)|ovary(2)|pancreas(1)|prostate(5)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	53						TCTTCCCAGGCAGCTCCTTCT	0.473																																					p.A1088T		Atlas-SNP	.											.	IKBKAP	122	.	0			c.G3262A						.						76.0	72.0	73.0					9																	111644428		2203	4300	6503	SO:0001583	missense	8518	exon30			CCCAGGCAGCTCC	AF044195	CCDS6773.1	9q31	2014-09-17	2003-12-02		ENSG00000070061	ENSG00000070061		"""Elongator acetyltransferase complex subunits"""	5959	protein-coding gene	gene with protein product	"""elongator acetyltransferase complex subunit 1"""	603722	"""dysautonomia (Riley-Day syndrome, hereditary sensory autonomic neuropathy type III)"""	DYS		9751059, 11179008	Standard	NM_003640		Approved	IKAP, TOT1, ELP1, IKI3	uc004bdm.4	O95163	OTTHUMG00000020465	ENST00000374647.5:c.3262G>A	chr9.hg19:g.111644428C>T	ENSP00000363779:p.Ala1088Thr	93.0	0.0		94.0	4.0	NM_003640	Q5JSV2|Q9H327|Q9UG87	Missense_Mutation	SNP	ENST00000374647.5	hg19	CCDS6773.1	.	.	.	.	.	.	.	.	.	.	C	13.34	2.209239	0.39003	.	.	ENSG00000070061	ENST00000374647;ENST00000537196	T;T	0.36878	1.23;1.23	5.9	3.99	0.46301	.	0.416662	0.25119	N	0.032984	T	0.25901	0.0631	L	0.51422	1.61	0.27865	N	0.94025	B	0.31910	0.346	B	0.22386	0.039	T	0.07083	-1.0791	10	0.22706	T	0.39	-15.0669	8.4608	0.32927	0.1451:0.5873:0.2676:0.0	.	1088	O95163	ELP1_HUMAN	T	1088;739	ENSP00000363779:A1088T;ENSP00000439367:A739T	ENSP00000363779:A1088T	A	-	1	0	IKBKAP	110684249	0.281000	0.24258	1.000000	0.80357	0.959000	0.62525	0.071000	0.14594	2.788000	0.95919	0.650000	0.86243	GCC	.	.		0.473	IKBKAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053574.1		
CTNNAL1	8727	hgsc.bcm.edu	37	9	111735058	111735058	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr9:111735058T>C	ENST00000325551.4	-	9	1330	c.1244A>G	c.(1243-1245)cAt>cGt	p.H415R	CTNNAL1_ENST00000488130.1_5'UTR|CTNNAL1_ENST00000325580.6_Intron|CTNNAL1_ENST00000374595.4_Missense_Mutation_p.H415R	NM_003798.2	NP_003789.1	Q9UBT7	CTNL1_HUMAN	catenin (cadherin-associated protein), alpha-like 1	415					cell adhesion (GO:0007155)|Rho protein signal transduction (GO:0007266)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	structural molecule activity (GO:0005198)			cervix(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(5)|ovary(1)|prostate(4)|urinary_tract(2)	25				STAD - Stomach adenocarcinoma(157;0.0768)		TAGAACCACATGATCAGCATG	0.448																																					p.H415R		Atlas-SNP	.											.	CTNNAL1	51	.	0			c.A1244G						.						100.0	99.0	99.0					9																	111735058		2203	4300	6503	SO:0001583	missense	8727	exon9			ACCACATGATCAG	AF030233	CCDS6775.1, CCDS69638.1	9q31.2	2008-07-21			ENSG00000119326	ENSG00000119326			2512	protein-coding gene	gene with protein product	"""alpha-catulin"", ""alpha2-catulin"""	604785				9806841	Standard	XM_005252291		Approved	CLLP, alpha-CATU	uc004bdo.1	Q9UBT7	OTTHUMG00000020466	ENST00000325551.4:c.1244A>G	chr9.hg19:g.111735058T>C	ENSP00000320434:p.His415Arg	88.0	0.0		82.0	4.0	NM_003798	B5BU47|O76084|Q53FQ2|Q5JTQ7|Q5JTQ8|Q9Y401	Missense_Mutation	SNP	ENST00000325551.4	hg19	CCDS6775.1	.	.	.	.	.	.	.	.	.	.	T	19.04	3.749298	0.69533	.	.	ENSG00000119326	ENST00000374595;ENST00000325551	T;T	0.34667	1.35;1.35	6.03	4.9	0.64082	.	0.092956	0.85682	N	0.000000	T	0.45175	0.1329	M	0.65975	2.015	0.80722	D	1	D;P;D	0.53619	0.961;0.778;0.961	P;B;P	0.52514	0.701;0.299;0.701	T	0.33752	-0.9856	10	0.24483	T	0.36	-8.5087	10.1304	0.42676	0.0:0.078:0.0:0.922	.	415;415;415	B2RBI4;Q9UBT7-2;Q9UBT7	.;.;CTNL1_HUMAN	R	415	ENSP00000363723:H415R;ENSP00000320434:H415R	ENSP00000320434:H415R	H	-	2	0	CTNNAL1	110774879	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.735000	0.62051	1.108000	0.41662	0.533000	0.62120	CAT	.	.		0.448	CTNNAL1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000053577.1	NM_003798	
ZBTB6	10773	hgsc.bcm.edu	37	9	125673934	125673934	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr9:125673934T>C	ENST00000373659.3	-	2	506	c.418A>G	c.(418-420)Act>Gct	p.T140A		NM_006626.5	NP_006617.1	Q15916	ZBTB6_HUMAN	zinc finger and BTB domain containing 6	140					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(3)|endometrium(3)|kidney(1)|large_intestine(2)|lung(1)|skin(1)	11						CACAGGTCAGTGTGTTGGTTG	0.358																																					p.T140A		Atlas-SNP	.											.	ZBTB6	32	.	0			c.A418G						.						70.0	69.0	70.0					9																	125673934		2203	4300	6503	SO:0001583	missense	10773	exon2			GGTCAGTGTGTTG	X82018	CCDS6846.1	9q33.1-q33.3	2013-01-08	2006-04-10	2006-04-10	ENSG00000186130	ENSG00000186130		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	16764	protein-coding gene	gene with protein product		605976	"""zinc finger protein 482"""	ZNF482		7958847	Standard	NM_006626		Approved	ZID	uc004bnh.4	Q15916	OTTHUMG00000020628	ENST00000373659.3:c.418A>G	chr9.hg19:g.125673934T>C	ENSP00000362763:p.Thr140Ala	75.0	0.0		55.0	4.0	NM_006626	A8K8N6	Missense_Mutation	SNP	ENST00000373659.3	hg19	CCDS6846.1	.	.	.	.	.	.	.	.	.	.	T	2.358	-0.347348	0.05208	.	.	ENSG00000186130	ENST00000373659	T	0.08546	3.08	5.96	-0.543	0.11851	.	0.764063	0.12114	N	0.498263	T	0.02012	0.0063	N	0.01874	-0.695	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.45293	-0.9271	10	0.07644	T	0.81	.	1.5049	0.02484	0.18:0.3724:0.1373:0.3104	.	140	Q15916	ZBTB6_HUMAN	A	140	ENSP00000362763:T140A	ENSP00000362763:T140A	T	-	1	0	ZBTB6	124713755	0.004000	0.15560	0.988000	0.46212	0.992000	0.81027	-0.037000	0.12164	0.095000	0.17434	0.533000	0.62120	ACT	.	.		0.358	ZBTB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053962.1	NM_006626	
DOLPP1	57171	hgsc.bcm.edu	37	9	131847308	131847308	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr9:131847308T>C	ENST00000372546.4	+	3	216	c.184T>C	c.(184-186)Ttc>Ctc	p.F62L	DOLPP1_ENST00000540102.1_Intron|DOLPP1_ENST00000406974.3_Missense_Mutation_p.F62L	NM_020438.4	NP_065171.2	Q86YN1	DOPP1_HUMAN	dolichyldiphosphatase 1	62					cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|dolichyl diphosphate biosynthetic process (GO:0006489)|lipid biosynthetic process (GO:0008610)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation (GO:0006487)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)	dolichyldiphosphatase activity (GO:0047874)			endometrium(3)|kidney(2)|lung(7)|skin(1)	13						GCAGATCTCCTTCCTTGGGGG	0.617																																					p.F62L		Atlas-SNP	.											.	DOLPP1	17	.	0			c.T184C						.						51.0	54.0	53.0					9																	131847308		2203	4300	6503	SO:0001583	missense	57171	exon3			ATCTCCTTCCTTG	BC009493	CCDS6918.1, CCDS48039.1	9q34.1	2013-05-21	2013-05-21		ENSG00000167130	ENSG00000167130	3.6.1.43		29565	protein-coding gene	gene with protein product	"""linked to Surfeit genes in Fugu rubripes 2"""	614516	"""dolichyl pyrophosphate phosphatase 1"""			10369878, 12198133	Standard	NM_020438		Approved	LSFR2	uc004bxc.3	Q86YN1	OTTHUMG00000020771	ENST00000372546.4:c.184T>C	chr9.hg19:g.131847308T>C	ENSP00000361625:p.Phe62Leu	57.0	0.0		64.0	4.0	NM_001135917	A8K3U8|B0QZG4|Q96GF8|Q9Y3G1	Missense_Mutation	SNP	ENST00000372546.4	hg19	CCDS6918.1	.	.	.	.	.	.	.	.	.	.	T	26.2	4.714515	0.89112	.	.	ENSG00000167130	ENST00000372546;ENST00000406974	T;T	0.71461	-0.57;-0.57	5.44	5.44	0.79542	Phosphatidic acid phosphatase/chloroperoxidase, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.77485	0.4137	L	0.51914	1.62	0.80722	D	1	P;D	0.59767	0.941;0.986	P;P	0.59357	0.676;0.856	T	0.78874	-0.2032	10	0.54805	T	0.06	-18.2171	14.3128	0.66426	0.0:0.0:0.0:1.0	.	62;62	B0QZG4;Q86YN1	.;DOPP1_HUMAN	L	62	ENSP00000361625:F62L;ENSP00000384043:F62L	ENSP00000361625:F62L	F	+	1	0	DOLPP1	130887129	1.000000	0.71417	0.906000	0.35671	0.868000	0.49771	7.186000	0.77722	2.061000	0.61500	0.402000	0.26972	TTC	.	.		0.617	DOLPP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054548.4	NM_020438	
FAM78A	286336	hgsc.bcm.edu	37	9	134136640	134136640	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr9:134136640T>C	ENST00000372271.3	-	2	788	c.421A>G	c.(421-423)Acc>Gcc	p.T141A	FAM78A_ENST00000372269.3_Missense_Mutation_p.T138A|FAM78A_ENST00000247295.4_5'UTR	NM_033387.3	NP_203745.2	Q5JUQ0	FA78A_HUMAN	family with sequence similarity 78, member A	141										NS(1)|endometrium(1)|large_intestine(2)|lung(3)|ovary(1)|skin(1)	9	all_hematologic(7;0.0028)	Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;2.15e-05)|Epithelial(140;0.000267)		ATGGTGCAGGTCTCTGTGGTG	0.602																																					p.T141A		Atlas-SNP	.											.	FAM78A	28	.	0			c.A421G						.						86.0	77.0	80.0					9																	134136640		2203	4300	6503	SO:0001583	missense	286336	exon2			TGCAGGTCTCTGT	AK095423	CCDS6941.2	9q34	2008-02-05	2005-07-18	2005-07-18	ENSG00000126882	ENSG00000126882			25465	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 59"""	C9orf59		11214971	Standard	NM_033387		Approved	FLJ00024	uc004cak.3	Q5JUQ0	OTTHUMG00000020821	ENST00000372271.3:c.421A>G	chr9.hg19:g.134136640T>C	ENSP00000361345:p.Thr141Ala	76.0	0.0		69.0	4.0	NM_033387	Q86VQ9|Q9H7P4	Missense_Mutation	SNP	ENST00000372271.3	hg19	CCDS6941.2	.	.	.	.	.	.	.	.	.	.	T	21.1	4.094409	0.76870	.	.	ENSG00000126882	ENST00000372269;ENST00000372271;ENST00000464831	.	.	.	4.75	4.75	0.60458	.	0.000000	0.85682	D	0.000000	T	0.73528	0.3598	M	0.63843	1.955	0.80722	D	1	D;D	0.69078	0.996;0.997	D;D	0.75484	0.986;0.985	T	0.70114	-0.4961	9	0.18710	T	0.47	-35.1641	13.7403	0.62845	0.0:0.0:0.0:1.0	.	141;138	Q5JUQ0;Q5JUQ2	FA78A_HUMAN;.	A	138;141;110	.	ENSP00000361343:T138A	T	-	1	0	FAM78A	133126461	1.000000	0.71417	0.997000	0.53966	0.915000	0.54546	7.997000	0.88414	1.894000	0.54839	0.379000	0.24179	ACC	.	.		0.602	FAM78A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054720.1	NM_033387	
SEC16A	9919	hgsc.bcm.edu	37	9	139358965	139358965	+	Silent	SNP	A	A	G			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr9:139358965A>G	ENST00000371706.3	-	7	3852	c.3819T>C	c.(3817-3819)tgT>tgC	p.C1273C	SEC16A_ENST00000290037.6_Silent_p.C1273C|SEC16A_ENST00000313050.7_Silent_p.C1451C|SEC16A_ENST00000431893.2_Silent_p.C1273C			O15027	SC16A_HUMAN	SEC16 homolog A (S. cerevisiae)	1273					COPII vesicle coating (GO:0048208)|endoplasmic reticulum organization (GO:0007029)|protein transport (GO:0015031)|substantia nigra development (GO:0021762)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)				breast(1)|central_nervous_system(3)|endometrium(7)|kidney(5)|large_intestine(15)|lung(14)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51		Myeloproliferative disorder(178;0.0511)		Epithelial(140;2.9e-06)|OV - Ovarian serous cystadenocarcinoma(145;5.88e-06)		CAAACCTGGCACAGACATGAG	0.453																																					p.C1451C		Atlas-SNP	.											.	SEC16A	249	.	0			c.T4353C						.						72.0	76.0	75.0					9																	139358965		1901	4116	6017	SO:0001819	synonymous_variant	9919	exon9			CCTGGCACAGACA	AK074565	CCDS55351.1, CCDS75936.1	9q34.3	2007-06-20	2007-06-20	2007-06-20	ENSG00000148396	ENSG00000148396			29006	protein-coding gene	gene with protein product		612854	"""KIAA0310"""	KIAA0310		9205841	Standard	NM_014866		Approved	p250	uc004chx.3	O15027	OTTHUMG00000020932	ENST00000371706.3:c.3819T>C	chr9.hg19:g.139358965A>G		78.0	0.0		78.0	4.0	NM_014866	A1YCA4|Q4G0D7|Q5SXP0|Q5SXP1|Q8N347|Q96HP1	Silent	SNP	ENST00000371706.3	hg19																																																																																				.	.		0.453	SEC16A-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000055077.1	XM_088459	
ASB13	79754	hgsc.bcm.edu	37	10	5691033	5691033	+	Silent	SNP	G	G	A			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr10:5691033G>A	ENST00000357700.6	-	4	443	c.417C>T	c.(415-417)gtC>gtT	p.V139V	ASB13_ENST00000479033.1_5'UTR	NM_024701.3	NP_078977.2	Q8WXK3	ASB13_HUMAN	ankyrin repeat and SOCS box containing 13	139					intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)					NS(1)|endometrium(3)|lung(3)|ovary(1)	8				GBM - Glioblastoma multiforme(2;9.59e-09)		GATTGGCCCCGACGTCAATAA	0.527																																					p.V139V		Atlas-SNP	.											.	ASB13	26	.	0			c.C417T						.						120.0	108.0	112.0					10																	5691033		2203	4300	6503	SO:0001819	synonymous_variant	79754	exon4			GGCCCCGACGTCA	AK091935	CCDS7070.1	10p15.1	2013-01-10	2011-01-25		ENSG00000196372	ENSG00000196372		"""Ankyrin repeat domain containing"""	19765	protein-coding gene	gene with protein product		615055	"""ankyrin repeat and SOCS box-containing 13"""			12076535	Standard	NM_024701		Approved	FLJ13134, MGC19879	uc001iig.2	Q8WXK3	OTTHUMG00000017603	ENST00000357700.6:c.417C>T	chr10.hg19:g.5691033G>A		98.0	0.0		105.0	61.0	NM_024701	A8K7Q6|D3DRR2|Q96EP7|Q9H8Z1	Silent	SNP	ENST00000357700.6	hg19	CCDS7070.1																																																																																			.	.		0.527	ASB13-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046564.1		
UBE2D1	7321	hgsc.bcm.edu	37	10	60123367	60123367	+	Splice_Site	SNP	A	A	G			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr10:60123367A>G	ENST00000373910.4	+	4	347		c.e4-1			NM_001204880.1|NM_003338.4	NP_001191809.1|NP_003329.1	P51668	UB2D1_HUMAN	ubiquitin-conjugating enzyme E2D 1						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|BMP signaling pathway (GO:0030509)|cellular response to hypoxia (GO:0071456)|gene expression (GO:0010467)|innate immune response (GO:0045087)|mitotic cell cycle (GO:0000278)|mitotic spindle assembly checkpoint (GO:0007094)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K48-linked ubiquitination (GO:0070936)|protein polyubiquitination (GO:0000209)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|protein complex (GO:0043234)|ubiquitin ligase complex (GO:0000151)	acid-amino acid ligase activity (GO:0016881)|ATP binding (GO:0005524)|ubiquitin-protein transferase activity (GO:0004842)			central_nervous_system(1)|kidney(3)|large_intestine(1)|lung(2)|prostate(1)|skin(2)	10						TTGTAATTTCAGCCTGATAGC	0.299																																					.		Atlas-SNP	.											.	UBE2D1	16	.	0			c.7-2A>G						.						102.0	95.0	98.0					10																	60123367		2203	4299	6502	SO:0001630	splice_region_variant	7321	exon3			AATTTCAGCCTGA	BC015997	CCDS7252.1, CCDS73139.1	10q21.1	2011-05-19	2011-05-19		ENSG00000072401	ENSG00000072401		"""Ubiquitin-conjugating enzymes E2"""	12474	protein-coding gene	gene with protein product		602961	"""stimulator of Fe transport"", ""ubiquitin-conjugating enzyme E2D 1 (UBC4/5 homolog, yeast)"""	SFT		10072594, 8530467	Standard	NM_003338		Approved	UbcH5A, UBCH5, UBC4/5, E2(17)KB1	uc001jke.2	P51668	OTTHUMG00000018269	ENST00000373910.4:c.121-1A>G	chr10.hg19:g.60123367A>G		76.0	0.0		111.0	5.0	NM_001204880	A6NLF6|A8K786	Splice_Site	SNP	ENST00000373910.4	hg19	CCDS7252.1	.	.	.	.	.	.	.	.	.	.	A	18.56	3.649783	0.67358	.	.	ENSG00000072401	ENST00000373910	.	.	.	5.72	4.57	0.56435	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.251	0.49026	0.8465:0.1535:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	UBE2D1	59793373	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	8.993000	0.93524	0.972000	0.38314	0.455000	0.32223	.	.	.		0.299	UBE2D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048143.2	NM_003338	Intron
KAT6B	23522	hgsc.bcm.edu	37	10	76790247	76790247	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr10:76790247A>G	ENST00000287239.4	+	18	6154	c.5665A>G	c.(5665-5667)Atg>Gtg	p.M1889V	KAT6B_ENST00000372725.1_Missense_Mutation_p.M1597V|KAT6B_ENST00000372714.1_Missense_Mutation_p.M1597V|KAT6B_ENST00000372724.1_Missense_Mutation_p.M1597V|KAT6B_ENST00000372711.1_Missense_Mutation_p.M1706V	NM_001256468.1|NM_012330.3	NP_001243397.1|NP_036462.2	Q8WYB5	KAT6B_HUMAN	K(lysine) acetyltransferase 6B	1889	Interaction with RUNX1 and RUNX2.				chromatin organization (GO:0006325)|histone acetylation (GO:0016573)|histone H3 acetylation (GO:0043966)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome assembly (GO:0006334)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	MOZ/MORF histone acetyltransferase complex (GO:0070776)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	acetyltransferase activity (GO:0016407)|DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)										TCCTCCTCCAATGAATCTGCC	0.557																																					p.M1889V		Atlas-SNP	.											.	.	.	.	0			c.A5665G						.						133.0	150.0	144.0					10																	76790247		2203	4300	6503	SO:0001583	missense	23522	exon18			CCTCCAATGAATC	AF113514	CCDS7345.1, CCDS58084.1, CCDS58085.1	10q22.2	2013-01-28	2011-07-21	2011-07-21	ENSG00000156650	ENSG00000156650		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Zinc fingers, C2HC-type containing"", ""Zinc fingers, PHD-type"""	17582	protein-coding gene	gene with protein product	"""MOZ-related factor"""	605880	"""MYST histone acetyltransferase (monocytic leukemia) 4"""	MYST4		9205841, 10497217	Standard	NM_012330		Approved	querkopf, qkf, Morf, MOZ2, ZC2HC6B	uc001jwn.2	Q8WYB5	OTTHUMG00000018509	ENST00000287239.4:c.5665A>G	chr10.hg19:g.76790247A>G	ENSP00000287239:p.Met1889Val	106.0	0.0		216.0	73.0	NM_012330	O15087|Q86Y05|Q8WU81|Q9UKW2|Q9UKW3|Q9UKX0	Missense_Mutation	SNP	ENST00000287239.4	hg19	CCDS7345.1	.	.	.	.	.	.	.	.	.	.	A	13.09	2.132500	0.37630	.	.	ENSG00000156650	ENST00000372725;ENST00000372724;ENST00000287239;ENST00000372714;ENST00000372711	T;T;T;T;T	0.79749	-1.25;-1.25;-1.3;-1.25;-1.25	5.54	5.54	0.83059	.	0.000000	0.64402	D	0.000009	D	0.83769	0.5326	L	0.29908	0.895	0.42035	D	0.99104	P;P;D	0.53312	0.679;0.811;0.959	P;P;D	0.65443	0.65;0.879;0.935	D	0.86093	0.1551	10	0.72032	D	0.01	-10.0301	15.6712	0.77279	1.0:0.0:0.0:0.0	.	1706;1597;1889	Q8WYB5-2;Q8WYB5-3;Q8WYB5	.;.;KAT6B_HUMAN	V	1597;1597;1889;1597;1706	ENSP00000361810:M1597V;ENSP00000361809:M1597V;ENSP00000287239:M1889V;ENSP00000361799:M1597V;ENSP00000361796:M1706V	ENSP00000287239:M1889V	M	+	1	0	KAT6B	76460253	1.000000	0.71417	0.962000	0.40283	0.992000	0.81027	5.662000	0.68032	2.095000	0.63458	0.460000	0.39030	ATG	.	.		0.557	KAT6B-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048771.1	NM_012330	
ATAD1	84896	hgsc.bcm.edu	37	10	89544340	89544340	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr10:89544340A>G	ENST00000308448.7	-	5	848	c.470T>C	c.(469-471)cTt>cCt	p.L157P	ATAD1_ENST00000400215.3_Missense_Mutation_p.L99P|ATAD1_ENST00000495903.1_5'UTR|ATAD1_ENST00000541004.1_Missense_Mutation_p.L157P|ATAD1_ENST00000328142.3_Missense_Mutation_p.L157P	NM_032810.2	NP_116199.2	Q8NBU5	ATAD1_HUMAN	ATPase family, AAA domain containing 1	157					ATP catabolic process (GO:0006200)|learning (GO:0007612)|memory (GO:0007613)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|positive regulation of receptor internalization (GO:0002092)	cell junction (GO:0030054)|membrane (GO:0016020)|mitochondrion (GO:0005739)|peroxisomal membrane (GO:0005778)|postsynaptic membrane (GO:0045211)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			kidney(1)|large_intestine(4)|lung(4)|ovary(1)	10		all_cancers(4;6.78e-12)|Prostate(4;3.56e-12)|all_epithelial(4;5.58e-09)|Melanoma(5;0.0273)|Breast(4;0.0424)|all_hematologic(4;0.0846)|Colorectal(252;0.207)|Glioma(4;0.217)|all_neural(4;0.224)		UCEC - Uterine corpus endometrioid carcinoma (6;0.00131)|GBM - Glioblastoma multiforme(1;1.1e-32)|Lung(2;1.4e-05)|LUSC - Lung squamous cell carcinoma(2;2.69e-05)|Colorectal(12;7.09e-05)|COAD - Colon adenocarcinoma(12;0.000261)|STAD - Stomach adenocarcinoma(243;0.235)		CGAAGGCTGAAGGTTAATAAA	0.463																																					p.L157P		Atlas-SNP	.											.	ATAD1	32	.	0			c.T470C						.						142.0	130.0	134.0					10																	89544340		2203	4300	6503	SO:0001583	missense	84896	exon5			GGCTGAAGGTTAA	AL834370	CCDS7386.1	10q23.31	2010-04-21		2007-02-08	ENSG00000138138	ENSG00000138138		"""ATPases / AAA-type"""	25903	protein-coding gene	gene with protein product		614452				12477932	Standard	NM_032810		Approved	FLJ14600	uc001kez.1	Q8NBU5	OTTHUMG00000018685	ENST00000308448.7:c.470T>C	chr10.hg19:g.89544340A>G	ENSP00000339017:p.Leu157Pro	108.0	0.0		89.0	5.0	NM_032810	D3DR26|Q6DKG1|Q6P4B9|Q8N3G1|Q8WYR9|Q969Y3	Missense_Mutation	SNP	ENST00000308448.7	hg19	CCDS7386.1	.	.	.	.	.	.	.	.	.	.	A	26.0	4.695430	0.88830	.	.	ENSG00000138138	ENST00000308448;ENST00000328142;ENST00000400215;ENST00000541004	D;D;D;D	0.94232	-3.38;-3.38;-3.38;-3.38	5.35	5.35	0.76521	ATPase, AAA-type, core (1);ATPase, AAA+ type, core (1);	0.000000	0.85682	D	0.000000	D	0.97195	0.9083	M	0.89968	3.075	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.97875	1.0288	9	.	.	.	-20.4442	15.6409	0.77001	1.0:0.0:0.0:0.0	.	99;157	B4E2J1;Q8NBU5	.;ATAD1_HUMAN	P	157;157;99;157	ENSP00000339017:L157P;ENSP00000339016:L157P;ENSP00000412968:L99P;ENSP00000445500:L157P	.	L	-	2	0	ATAD1	89534320	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.962000	0.93254	2.151000	0.67156	0.460000	0.39030	CTT	.	.		0.463	ATAD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049235.1	NM_032810	
IFIT5	24138	hgsc.bcm.edu	37	10	91177501	91177501	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr10:91177501T>C	ENST00000371795.4	+	2	758	c.545T>C	c.(544-546)aTc>aCc	p.I182T	IFIT5_ENST00000416601.1_Intron	NM_012420.2	NP_036552.1	Q13325	IFIT5_HUMAN	interferon-induced protein with tetratricopeptide repeats 5	182					defense response to virus (GO:0051607)|innate immune response (GO:0045087)	actin cytoskeleton (GO:0015629)|apical part of cell (GO:0045177)|ruffle membrane (GO:0032587)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|single-stranded RNA binding (GO:0003727)|tRNA binding (GO:0000049)			endometrium(1)|large_intestine(4)|lung(4)	9						GGCTATGCTATCACAGTGTAT	0.443																																					p.I182T		Atlas-SNP	.											.	IFIT5	32	.	0			c.T545C						.						65.0	71.0	69.0					10																	91177501		2203	4300	6503	SO:0001583	missense	24138	exon2			ATGCTATCACAGT	U34605	CCDS7403.1	10q23.31	2013-01-10			ENSG00000152778	ENSG00000152778		"""Tetratricopeptide (TTC) repeat domain containing"""	13328	protein-coding gene	gene with protein product	"""retinoic acid- and interferon-inducible protein (58kD)"""					9398535	Standard	NM_012420		Approved	RI58	uc010qnh.2	Q13325	OTTHUMG00000018713	ENST00000371795.4:c.545T>C	chr10.hg19:g.91177501T>C	ENSP00000360860:p.Ile182Thr	191.0	0.0		92.0	4.0	NM_012420	B2R5X9|B4DDV1|Q5T7I9|Q6IAX3	Missense_Mutation	SNP	ENST00000371795.4	hg19	CCDS7403.1	.	.	.	.	.	.	.	.	.	.	T	13.61	2.289354	0.40494	.	.	ENSG00000152778	ENST00000371795	T	0.52754	0.65	6.03	6.03	0.97812	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.157599	0.53938	D	0.000056	T	0.37183	0.0994	L	0.49350	1.555	0.80722	D	1	B	0.32918	0.39	B	0.24541	0.054	T	0.27191	-1.0081	10	0.34782	T	0.22	-4.6845	8.8211	0.35027	0.0:0.1422:0.0:0.8578	.	182	Q13325	IFIT5_HUMAN	T	182	ENSP00000360860:I182T	ENSP00000360860:I182T	I	+	2	0	IFIT5	91167481	0.999000	0.42202	0.999000	0.59377	0.921000	0.55340	3.787000	0.55439	2.308000	0.77769	0.533000	0.62120	ATC	.	.		0.443	IFIT5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049303.1	NM_012420	
IFIT5	24138	hgsc.bcm.edu	37	10	91177909	91177909	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr10:91177909A>G	ENST00000371795.4	+	2	1166	c.953A>G	c.(952-954)gAg>gGg	p.E318G	IFIT5_ENST00000416601.1_Missense_Mutation_p.E270G	NM_012420.2	NP_036552.1	Q13325	IFIT5_HUMAN	interferon-induced protein with tetratricopeptide repeats 5	318					defense response to virus (GO:0051607)|innate immune response (GO:0045087)	actin cytoskeleton (GO:0015629)|apical part of cell (GO:0045177)|ruffle membrane (GO:0032587)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|single-stranded RNA binding (GO:0003727)|tRNA binding (GO:0000049)			endometrium(1)|large_intestine(4)|lung(4)	9						AAGGTTGATGAGCTGATTTCA	0.438																																					p.E318G		Atlas-SNP	.											.	IFIT5	32	.	0			c.A953G						.						140.0	133.0	136.0					10																	91177909		2203	4300	6503	SO:0001583	missense	24138	exon2			TTGATGAGCTGAT	U34605	CCDS7403.1	10q23.31	2013-01-10			ENSG00000152778	ENSG00000152778		"""Tetratricopeptide (TTC) repeat domain containing"""	13328	protein-coding gene	gene with protein product	"""retinoic acid- and interferon-inducible protein (58kD)"""					9398535	Standard	NM_012420		Approved	RI58	uc010qnh.2	Q13325	OTTHUMG00000018713	ENST00000371795.4:c.953A>G	chr10.hg19:g.91177909A>G	ENSP00000360860:p.Glu318Gly	111.0	0.0		95.0	4.0	NM_012420	B2R5X9|B4DDV1|Q5T7I9|Q6IAX3	Missense_Mutation	SNP	ENST00000371795.4	hg19	CCDS7403.1	.	.	.	.	.	.	.	.	.	.	A	12.82	2.053313	0.36181	.	.	ENSG00000152778	ENST00000371795;ENST00000416601	T;T	0.38887	1.11;1.11	6.03	3.6	0.41247	Tetratricopeptide-like helical (1);	0.463546	0.25219	N	0.032254	T	0.31949	0.0813	L	0.46157	1.445	0.24281	N	0.995206	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.18618	-1.0331	10	0.16420	T	0.52	-7.3931	9.4161	0.38523	0.8431:0.0:0.1569:0.0	.	318;270	Q13325;B4DDV1	IFIT5_HUMAN;.	G	318;270	ENSP00000360860:E318G;ENSP00000414042:E270G	ENSP00000360860:E318G	E	+	2	0	IFIT5	91167889	0.097000	0.21791	0.545000	0.28153	0.884000	0.51177	2.149000	0.42244	1.042000	0.40150	0.533000	0.62120	GAG	.	.		0.438	IFIT5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049303.1	NM_012420	
IDE	3416	hgsc.bcm.edu	37	10	94274762	94274762	+	Silent	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr10:94274762T>C	ENST00000265986.6	-	5	755	c.699A>G	c.(697-699)gaA>gaG	p.E233E		NM_004969.3	NP_004960.2	P14735	IDE_HUMAN	insulin-degrading enzyme	233					beta-amyloid metabolic process (GO:0050435)|bradykinin catabolic process (GO:0010815)|determination of adult lifespan (GO:0008340)|hormone catabolic process (GO:0042447)|insulin catabolic process (GO:1901143)|insulin metabolic process (GO:1901142)|insulin receptor signaling pathway (GO:0008286)|negative regulation of proteolysis (GO:0045861)|positive regulation of protein oligomerization (GO:0032461)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|protein homotetramerization (GO:0051289)|proteolysis (GO:0006508)|proteolysis involved in cellular protein catabolic process (GO:0051603)|ubiquitin homeostasis (GO:0010992)|viral process (GO:0016032)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic proteasome complex (GO:0031597)|extracellular space (GO:0005615)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|beta-amyloid binding (GO:0001540)|beta-endorphin binding (GO:0031626)|glycoprotein binding (GO:0001948)|insulin binding (GO:0043559)|metalloendopeptidase activity (GO:0004222)|peptide binding (GO:0042277)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)|ubiquitin binding (GO:0043130)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(10)|liver(1)|lung(10)|ovary(2)|urinary_tract(2)	33					"""""""Insulin(DB00071)|Bacitracin(DB00626)|Insulin Regular(DB00030)"""	CATCAATGCCTTCTTGGTTTG	0.363																																					p.E233E		Atlas-SNP	.											.	IDE	77	.	0			c.A699G						.						183.0	190.0	188.0					10																	94274762		2203	4300	6503	SO:0001819	synonymous_variant	3416	exon5			AATGCCTTCTTGG	M21188	CCDS7421.1, CCDS53554.1	10q23-q25	2007-03-27			ENSG00000119912	ENSG00000119912			5381	protein-coding gene	gene with protein product	"""insulysin"""	146680				2293021	Standard	NM_004969		Approved		uc001kia.3	P14735	OTTHUMG00000018759	ENST00000265986.6:c.699A>G	chr10.hg19:g.94274762T>C		108.0	0.0		64.0	4.0	NM_004969	B2R721|B7ZAU2|D3DR35|Q5T5N2	Silent	SNP	ENST00000265986.6	hg19	CCDS7421.1																																																																																			.	.		0.363	IDE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049393.1	NM_004969	
CCNJ	54619	hgsc.bcm.edu	37	10	97816897	97816897	+	Silent	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr10:97816897T>C	ENST00000265992.5	+	5	967	c.600T>C	c.(598-600)gcT>gcC	p.A200A	CCNJ_ENST00000534974.1_Silent_p.A200A|ENTPD1-AS1_ENST00000458228.1_RNA|ENTPD1-AS1_ENST00000416301.1_RNA|ENTPD1-AS1_ENST00000454638.1_RNA|ENTPD1-AS1_ENST00000452728.1_RNA|CCNJ_ENST00000403870.3_Silent_p.A199A|ENTPD1-AS1_ENST00000451364.1_RNA|CCNJ_ENST00000465148.2_Silent_p.A211A|ENTPD1-AS1_ENST00000427846.1_RNA	NM_001134375.1|NM_001134376.1|NM_019084.4	NP_001127847.1|NP_001127848.1|NP_061957.2	Q5T5M9	CCNJ_HUMAN	cyclin J	200						nucleus (GO:0005634)				breast(2)|endometrium(2)|kidney(2)|large_intestine(1)|lung(2)|ovary(1)|skin(1)	11				Epithelial(162;6.1e-08)|all cancers(201;2.32e-06)		CATGTGTGGCTTCTTCGAGGA	0.423																																					p.A211A		Atlas-SNP	.											.	CCNJ	27	.	0			c.T633C						.						245.0	213.0	224.0					10																	97816897		2203	4300	6503	SO:0001819	synonymous_variant	54619	exon5			TGTGGCTTCTTCG	AK001757	CCDS7445.1, CCDS44462.1, CCDS44463.1	10q23.33	2008-05-14			ENSG00000107443	ENSG00000107443			23434	protein-coding gene	gene with protein product						12477932	Standard	NM_019084		Approved	FLJ10895, bA690P14.1	uc010qoq.2	Q5T5M9	OTTHUMG00000018823	ENST00000265992.5:c.600T>C	chr10.hg19:g.97816897T>C		293.0	0.0		133.0	6.0	NM_001134375	B7Z4E7|Q86XL1|Q9NV69	Silent	SNP	ENST00000265992.5	hg19	CCDS7445.1																																																																																			.	.		0.423	CCNJ-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000090166.3	NM_019084	
SEC31B	25956	hgsc.bcm.edu	37	10	102256018	102256018	+	Silent	SNP	A	A	G			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr10:102256018A>G	ENST00000370345.3	-	18	2404	c.2307T>C	c.(2305-2307)gcT>gcC	p.A769A	SEC31B_ENST00000494350.1_5'Flank	NM_015490.3	NP_056305.1	Q9NQW1	SC31B_HUMAN	SEC31 homolog B (S. cerevisiae)	769					protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	endoplasmic reticulum (GO:0005783)|vesicle coat (GO:0030120)		p.A769A(1)		NS(1)|breast(2)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(3)|lung(17)|ovary(1)|urinary_tract(1)	36		Colorectal(252;0.117)		Epithelial(162;2.36e-10)|all cancers(201;2.09e-08)		CACTTACCTGAGCACAGTCCC	0.537																																					p.A769A		Atlas-SNP	.											SEC31B,colon,carcinoma,0,1	SEC31B	84	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T2307C						.						86.0	73.0	77.0					10																	102256018		2203	4300	6503	SO:0001819	synonymous_variant	25956	exon18			TACCTGAGCACAG	AF274863	CCDS7495.1	10q24.32	2013-01-10	2006-10-05	2006-09-07	ENSG00000075826	ENSG00000075826		"""WD repeat domain containing"""	23197	protein-coding gene	gene with protein product		610258	"""SEC31-like 2 (S. cerevisiae)"""	SEC31L2		16495487	Standard	NM_015490		Approved	SEC31B-1, DKFZP434M183	uc001krc.1	Q9NQW1	OTTHUMG00000019342	ENST00000370345.3:c.2307T>C	chr10.hg19:g.102256018A>G		127.0	0.0		96.0	4.0	NM_015490	B7ZM75|Q6MZS3|Q86UF0|Q9Y4Q8	Silent	SNP	ENST00000370345.3	hg19	CCDS7495.1																																																																																			.	.		0.537	SEC31B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051198.1	NM_015490	
POLL	27343	hgsc.bcm.edu	37	10	103347044	103347044	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr10:103347044A>G	ENST00000370162.3	-	2	568	c.74T>C	c.(73-75)cTt>cCt	p.L25P	POLL_ENST00000370169.1_Missense_Mutation_p.L25P|DPCD_ENST00000370151.4_5'Flank|DPCD_ENST00000470165.1_3'UTR|DPCD_ENST00000416979.2_5'UTR|DPCD_ENST00000370148.2_5'Flank|POLL_ENST00000370158.3_Silent_p.L9L|POLL_ENST00000436284.2_Intron|POLL_ENST00000370172.1_Intron|POLL_ENST00000456836.2_Silent_p.L7L|DPCD_ENST00000370147.1_5'Flank|POLL_ENST00000299206.4_Missense_Mutation_p.L25P|POLL_ENST00000339310.3_Silent_p.L7L	NM_001174084.1|NM_001174085.1|NM_013274.3	NP_001167555.1|NP_001167556.1|NP_037406.1	Q9UGP5	DPOLL_HUMAN	polymerase (DNA directed), lambda	25					DNA replication (GO:0006260)|DNA-dependent DNA replication (GO:0006261)|nucleotide-excision repair (GO:0006289)|somatic hypermutation of immunoglobulin genes (GO:0016446)	nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|lyase activity (GO:0016829)|metal ion binding (GO:0046872)			biliary_tract(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(2)|lung(7)|upper_aerodigestive_tract(2)	19		Colorectal(252;0.234)		Epithelial(162;1.55e-08)|all cancers(201;6.64e-07)		AATCTTTGCAAGTACTTTTGA	0.498								DNA polymerases (catalytic subunits)																													p.L25P		Atlas-SNP	.											.	POLL	43	.	0			c.T74C						.						212.0	192.0	199.0					10																	103347044		2203	4300	6503	SO:0001583	missense	27343	exon2			TTTGCAAGTACTT	AF161019	CCDS7513.1	10q23	2012-05-18			ENSG00000166169	ENSG00000166169		"""DNA polymerases"""	9184	protein-coding gene	gene with protein product		606343				17686665	Standard	NM_001174084		Approved		uc001kti.2	Q9UGP5	OTTHUMG00000018933	ENST00000370162.3:c.74T>C	chr10.hg19:g.103347044A>G	ENSP00000359181:p.Leu25Pro	125.0	0.0		86.0	4.0	NM_013274	D3DR76|Q5JQP5|Q6NUM2|Q9BTN8|Q9HA10|Q9HB35	Missense_Mutation	SNP	ENST00000370162.3	hg19	CCDS7513.1	.	.	.	.	.	.	.	.	.	.	A	5.172	0.217390	0.09810	.	.	ENSG00000166169	ENST00000299206;ENST00000370174;ENST00000370169;ENST00000370162;ENST00000370157;ENST00000415897;ENST00000413344;ENST00000430045	T;T;T;T;T	0.43688	2.75;2.75;2.75;2.27;0.94	5.18	1.6	0.23607	.	0.493920	0.20428	N	0.092535	T	0.28566	0.0707	L	0.48362	1.52	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.0;0.001	T	0.15464	-1.0436	10	0.33141	T	0.24	-0.3554	2.6016	0.04867	0.5349:0.0:0.2696:0.1955	.	25;25	Q9UGP5;A8K860	DPOLL_HUMAN;.	P	25	ENSP00000299206:L25P;ENSP00000359188:L25P;ENSP00000359181:L25P;ENSP00000400676:L25P;ENSP00000400517:L25P	ENSP00000299206:L25P	L	-	2	0	POLL	103337034	0.000000	0.05858	0.373000	0.26003	0.180000	0.23129	0.329000	0.19698	0.305000	0.22832	0.533000	0.62120	CTT	.	.		0.498	POLL-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049946.1	NM_013274	
SORCS3	22986	hgsc.bcm.edu	37	10	106865182	106865182	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr10:106865182A>G	ENST00000369701.3	+	7	1348	c.1121A>G	c.(1120-1122)cAg>cGg	p.Q374R		NM_014978.1	NP_055793.1	Q9UPU3	SORC3_HUMAN	sortilin-related VPS10 domain containing receptor 3	374					learning (GO:0007612)|memory (GO:0007613)|neuropeptide signaling pathway (GO:0007218)|regulation of long term synaptic depression (GO:1900452)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|neuronal postsynaptic density (GO:0097481)	neuropeptide receptor activity (GO:0008188)			autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(19)|lung(63)|ovary(6)|pancreas(1)|prostate(6)|skin(8)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	131		Colorectal(252;0.134)|Breast(234;0.142)|Lung NSC(174;0.191)		Epithelial(162;1.58e-07)|all cancers(201;1.02e-05)|BRCA - Breast invasive adenocarcinoma(275;0.0628)		TGCAGGATCCAGGAATGTGCC	0.478																																					p.Q374R	NSCLC(116;1497 1690 7108 13108 14106)	Atlas-SNP	.											.	SORCS3	282	.	0			c.A1121G						.						139.0	111.0	120.0					10																	106865182		2203	4300	6503	SO:0001583	missense	22986	exon7			GGATCCAGGAATG	AB028982	CCDS7558.1	10q23-q25	2006-04-12			ENSG00000156395	ENSG00000156395			16699	protein-coding gene	gene with protein product		606285				11499680	Standard	NM_014978		Approved	KIAA1059, SORCS	uc001kyi.1	Q9UPU3	OTTHUMG00000019011	ENST00000369701.3:c.1121A>G	chr10.hg19:g.106865182A>G	ENSP00000358715:p.Gln374Arg	167.0	0.0		92.0	4.0	NM_014978	Q5VXF9|Q9NQJ2	Missense_Mutation	SNP	ENST00000369701.3	hg19	CCDS7558.1	.	.	.	.	.	.	.	.	.	.	A	20.4	3.991742	0.74703	.	.	ENSG00000156395	ENST00000369701	T	0.39787	1.06	5.43	5.43	0.79202	VPS10 (1);	0.000000	0.85682	D	0.000000	T	0.60766	0.2294	M	0.70595	2.14	0.46356	D	0.999	D	0.71674	0.998	D	0.67900	0.954	T	0.64516	-0.6389	10	0.66056	D	0.02	.	11.8572	0.52444	1.0:0.0:0.0:0.0	.	374	Q9UPU3	SORC3_HUMAN	R	374	ENSP00000358715:Q374R	ENSP00000358715:Q374R	Q	+	2	0	SORCS3	106855172	1.000000	0.71417	1.000000	0.80357	0.815000	0.46073	7.460000	0.80816	2.050000	0.60909	0.379000	0.24179	CAG	.	.		0.478	SORCS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050221.1	NM_014978	
GPAM	57678	hgsc.bcm.edu	37	10	113940243	113940243	+	Silent	SNP	A	A	G			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr10:113940243A>G	ENST00000348367.4	-	4	410	c.213T>C	c.(211-213)acT>acC	p.T71T	GPAM_ENST00000480130.1_5'Flank|GPAM_ENST00000369425.1_Silent_p.T71T|GPAM_ENST00000423155.1_Silent_p.T71T			Q9HCL2	GPAT1_HUMAN	glycerol-3-phosphate acyltransferase, mitochondrial	71					acyl-CoA metabolic process (GO:0006637)|CDP-diacylglycerol biosynthetic process (GO:0016024)|cellular lipid metabolic process (GO:0044255)|defense response to virus (GO:0051607)|fatty acid homeostasis (GO:0055089)|fatty acid metabolic process (GO:0006631)|glycerophospholipid biosynthetic process (GO:0046474)|interleukin-2 secretion (GO:0070970)|negative regulation of activation-induced cell death of T cells (GO:0070236)|phosphatidic acid biosynthetic process (GO:0006654)|phospholipid homeostasis (GO:0055091)|phospholipid metabolic process (GO:0006644)|positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of multicellular organism growth (GO:0040018)|regulation of cytokine secretion (GO:0050707)|response to glucose (GO:0009749)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial outer membrane (GO:0005741)|plasma membrane (GO:0005886)	glycerol-3-phosphate O-acyltransferase activity (GO:0004366)			breast(2)|central_nervous_system(2)|endometrium(8)|kidney(2)|large_intestine(5)|lung(8)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	31				Epithelial(162;0.0306)|all cancers(201;0.123)		AGCTCTGGGGAGTGCAGGAGT	0.398																																					p.T71T	Ovarian(161;1017 2606 18293 52943)	Atlas-SNP	.											.	GPAM	68	.	0			c.T213C						.						115.0	95.0	102.0					10																	113940243		2203	4300	6503	SO:0001819	synonymous_variant	57678	exon4			CTGGGGAGTGCAG	AL832464	CCDS7570.1	10q25.3	2009-07-15			ENSG00000119927	ENSG00000119927			24865	protein-coding gene	gene with protein product	"""glycerol-3-phosphate acyltransferase 1, mitochondrial"""	602395				10997877, 8369314	Standard	NM_020918		Approved	KIAA1560, MGC26846, GPAT1	uc001kzp.3	Q9HCL2	OTTHUMG00000019055	ENST00000348367.4:c.213T>C	chr10.hg19:g.113940243A>G		92.0	0.0		47.0	4.0	NM_001244949	Q5VW51|Q86TA3	Silent	SNP	ENST00000348367.4	hg19	CCDS7570.1																																																																																			.	.		0.398	GPAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050377.1	NM_020918	
VWA2	340706	hgsc.bcm.edu	37	10	116045937	116045937	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr10:116045937A>G	ENST00000392982.3	+	11	1487	c.1237A>G	c.(1237-1239)Att>Gtt	p.I413V	VWA2_ENST00000603594.1_Missense_Mutation_p.I413V			Q5GFL6	VWA2_HUMAN	von Willebrand factor A domain containing 2	413	VWFA 2. {ECO:0000255|PROSITE- ProRule:PRU00219}.				calcium-independent cell-matrix adhesion (GO:0007161)|protein homooligomerization (GO:0051260)|regulation of insulin receptor signaling pathway (GO:0046626)	basement membrane (GO:0005604)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	identical protein binding (GO:0042802)			central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(7)|lung(6)|ovary(2)|prostate(1)|skin(1)|stomach(1)	26				Epithelial(162;0.036)|all cancers(201;0.0793)		CCTCGATGGCATTCCCTTCCG	0.697																																					p.I413V		Atlas-SNP	.											.	VWA2	64	.	0			c.A1237G						.						76.0	69.0	72.0					10																	116045937		2203	4300	6503	SO:0001583	missense	340706	exon11			GATGGCATTCCCT	AK127756	CCDS7589.1, CCDS7589.2	10q25.3	2009-11-06			ENSG00000165816	ENSG00000165816			24709	protein-coding gene	gene with protein product						15580307, 14506275	Standard	NM_001272046		Approved	FLJ45857, FLJ16213, CCSP-2, AMACO, NET42	uc001lbl.2	Q5GFL6	OTTHUMG00000019082	ENST00000392982.3:c.1237A>G	chr10.hg19:g.116045937A>G	ENSP00000376708:p.Ile413Val	115.0	0.0		72.0	4.0	NM_001272046	A1A5D4|B5MDJ8|Q6ZS39|Q6ZWJ7|Q708C5|Q70UZ8	Missense_Mutation	SNP	ENST00000392982.3	hg19		.	.	.	.	.	.	.	.	.	.	A	0.011	-1.730903	0.00687	.	.	ENSG00000165816	ENST00000392982;ENST00000298715	T	0.80123	-1.34	5.6	-5.49	0.02584	von Willebrand factor, type A (3);	0.762112	0.12551	N	0.459047	T	0.57902	0.2085	N	0.25060	0.705	0.09310	N	0.999999	B;B;B	0.06786	0.001;0.001;0.0	B;B;B	0.08055	0.003;0.003;0.002	T	0.40232	-0.9574	10	0.29301	T	0.29	.	2.9749	0.05934	0.3066:0.3463:0.2545:0.0926	.	109;413;413	Q5GFL6-3;Q5GFL6;Q5GFL6-2	.;VWA2_HUMAN;.	V	413	ENSP00000376708:I413V	ENSP00000298715:I413V	I	+	1	0	VWA2	116035927	0.010000	0.17322	0.000000	0.03702	0.153000	0.21895	0.219000	0.17641	-0.875000	0.04022	-0.376000	0.06991	ATT	.	.		0.697	VWA2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000050456.3	NM_198496	
FANK1	92565	hgsc.bcm.edu	37	10	127697829	127697829	+	Silent	SNP	C	C	T			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr10:127697829C>T	ENST00000368693.1	+	10	1070	c.966C>T	c.(964-966)gaC>gaT	p.D322D	FANK1_ENST00000368695.1_Silent_p.D316D|FANK1_ENST00000477963.1_3'UTR			Q8TC84	FANK1_HUMAN	fibronectin type III and ankyrin repeat domains 1	322						cytoplasm (GO:0005737)|nucleus (GO:0005634)				central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(6)|lung(10)|ovary(1)|urinary_tract(1)	21		all_lung(145;0.00752)|Lung NSC(174;0.0115)|Colorectal(57;0.0847)|all_neural(114;0.0936)				GAGTTTTTGACAGACAGGTTG	0.413																																					p.D322D		Atlas-SNP	.											.	FANK1	46	.	0			c.C966T						.						164.0	172.0	169.0					10																	127697829		2203	4300	6503	SO:0001819	synonymous_variant	92565	exon10			TTTTGACAGACAG	BC024189	CCDS31309.1	10q26.2	2013-02-11	2005-03-01		ENSG00000203780	ENSG00000203780		"""Ankyrin repeat domain containing"", ""Fibronectin type III domain containing"""	23527	protein-coding gene	gene with protein product		611640	"""fibronectin type 3 and ankyrin repeat domains 1"""			12477932	Standard	NM_145235		Approved		uc001ljh.4	Q8TC84	OTTHUMG00000019241	ENST00000368693.1:c.966C>T	chr10.hg19:g.127697829C>T		106.0	0.0		58.0	5.0	NM_145235	Q6UXY9|Q6X7T6	Silent	SNP	ENST00000368693.1	hg19	CCDS31309.1																																																																																			.	.		0.413	FANK1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_145235	
MKI67	4288	hgsc.bcm.edu	37	10	129907660	129907660	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr10:129907660T>C	ENST00000368654.3	-	13	2819	c.2444A>G	c.(2443-2445)aAt>aGt	p.N815S	MKI67_ENST00000484853.1_5'Flank|MKI67_ENST00000368653.3_Missense_Mutation_p.N455S	NM_002417.4	NP_002408.3	P46013	KI67_HUMAN	marker of proliferation Ki-67	815					cell proliferation (GO:0008283)|cellular response to heat (GO:0034605)|DNA metabolic process (GO:0006259)|hyaluronan metabolic process (GO:0030212)|meiotic nuclear division (GO:0007126)|organ regeneration (GO:0031100)|response to organic cyclic compound (GO:0014070)	chromosome, centromeric region (GO:0000775)|condensed chromosome (GO:0000793)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)			NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(5)|kidney(7)|large_intestine(30)|lung(64)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|soft_tissue(1)|stomach(10)|upper_aerodigestive_tract(4)|urinary_tract(4)	159		all_epithelial(44;2.12e-05)|all_lung(145;0.00679)|Lung NSC(174;0.00998)|all_neural(114;0.0936)|Colorectal(57;0.14)|Breast(234;0.166)|Melanoma(40;0.203)				TTTTGCTGCATTCTGTGCACT	0.398																																					p.N815S		Atlas-SNP	.											.	MKI67	363	.	0			c.A2444G						.						112.0	109.0	110.0					10																	129907660		2203	4300	6503	SO:0001583	missense	4288	exon13			GCTGCATTCTGTG	X65550	CCDS7659.1, CCDS53588.1	10q26.2	2014-06-12	2013-10-10		ENSG00000148773	ENSG00000148773			7107	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 105"""	176741	"""antigen identified by monoclonal antibody Ki-67"""			2571566, 16206250	Standard	NM_002417		Approved	MIB-, PPP1R105	uc001lke.3	P46013	OTTHUMG00000019255	ENST00000368654.3:c.2444A>G	chr10.hg19:g.129907660T>C	ENSP00000357643:p.Asn815Ser	122.0	0.0		95.0	4.0	NM_002417	Q5VWH2	Missense_Mutation	SNP	ENST00000368654.3	hg19	CCDS7659.1	.	.	.	.	.	.	.	.	.	.	T	14.55	2.570049	0.45798	.	.	ENSG00000148773	ENST00000368654;ENST00000368653;ENST00000537609;ENST00000368652	T;T	0.01767	4.68;4.65	4.02	4.02	0.46733	.	0.896444	0.09569	N	0.784480	T	0.06005	0.0156	L	0.50333	1.59	0.09310	N	1	D;D;D	0.64830	0.994;0.994;0.989	P;P;P	0.61477	0.889;0.889;0.777	T	0.44314	-0.9336	10	0.39692	T	0.17	.	9.5304	0.39191	0.0:0.0:0.0:1.0	.	814;455;815	F5H4V4;P46013-2;P46013	.;.;KI67_HUMAN	S	815;455;814;390	ENSP00000357643:N815S;ENSP00000357642:N455S	ENSP00000357641:N390S	N	-	2	0	MKI67	129797650	0.001000	0.12720	0.014000	0.15608	0.007000	0.05969	0.792000	0.26929	1.829000	0.53265	0.460000	0.39030	AAT	.	.		0.398	MKI67-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000050999.1	NM_002417	
TUBGCP2	10844	hgsc.bcm.edu	37	10	135111545	135111545	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr10:135111545A>G	ENST00000252936.3	-	4	566	c.527T>C	c.(526-528)aTc>aCc	p.I176T	TUBGCP2_ENST00000368563.2_Missense_Mutation_p.I176T|TUBGCP2_ENST00000543663.1_Missense_Mutation_p.I176T|TUBGCP2_ENST00000470829.1_5'Flank|TUBGCP2_ENST00000417178.2_Missense_Mutation_p.I46T|RP11-122K13.12_ENST00000424450.1_RNA			Q9BSJ2	GCP2_HUMAN	tubulin, gamma complex associated protein 2	176					G2/M transition of mitotic cell cycle (GO:0000086)|microtubule nucleation (GO:0007020)|mitotic cell cycle (GO:0000278)|protein complex assembly (GO:0006461)	centrosome (GO:0005813)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|spindle pole (GO:0000922)				breast(2)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(6)|lung(16)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)	35		all_cancers(35;1.14e-09)|all_epithelial(44;5.79e-08)|Lung NSC(174;0.00263)|all_lung(145;0.0039)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.172)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;8.87e-06)|all cancers(32;8.98e-06)|Epithelial(32;1.15e-05)		TGCTGGGAAGATGGGGAGGTG	0.473																																					p.I176T		Atlas-SNP	.											.	TUBGCP2	79	.	0			c.T527C						.						188.0	168.0	175.0					10																	135111545		2203	4300	6503	SO:0001583	missense	10844	exon5			GGGAAGATGGGGA	AF042379	CCDS7676.1, CCDS58104.1, CCDS58105.1	10q26.3	2008-07-28			ENSG00000130640	ENSG00000130640			18599	protein-coding gene	gene with protein product						9566967	Standard	NM_001256617		Approved	GCP2, Spc97p, SPBC97	uc010qvc.2	Q9BSJ2	OTTHUMG00000019319	ENST00000252936.3:c.527T>C	chr10.hg19:g.135111545A>G	ENSP00000252936:p.Ile176Thr	222.0	0.0		100.0	5.0	NM_006659	B4DM18|B7ZKL8|F5H4E0|F5H4L0|O43632|Q5VWX7	Missense_Mutation	SNP	ENST00000252936.3	hg19	CCDS7676.1	.	.	.	.	.	.	.	.	.	.	A	9.146	1.015071	0.19355	.	.	ENSG00000130640	ENST00000252936;ENST00000417178;ENST00000368563;ENST00000543663	T;T;T;T	0.16073	2.63;2.37;2.63;2.63	5.24	4.12	0.48240	.	0.173608	0.50627	N	0.000110	T	0.06645	0.0170	N	0.03608	-0.345	0.20975	N	0.999812	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.08055	0.003;0.001;0.001	T	0.38520	-0.9657	10	0.10377	T	0.69	-31.4391	9.9033	0.41362	0.919:0.0:0.081:0.0	.	176;176;176	F5H4L0;B7ZKL8;Q9BSJ2	.;.;GCP2_HUMAN	T	176;46;176;176	ENSP00000252936:I176T;ENSP00000395666:I46T;ENSP00000357551:I176T;ENSP00000446093:I176T	ENSP00000252936:I176T	I	-	2	0	TUBGCP2	134961535	0.999000	0.42202	0.789000	0.31954	0.790000	0.44656	4.100000	0.57762	0.962000	0.38057	0.459000	0.35465	ATC	.	.		0.473	TUBGCP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051148.1		
PSMD13	5719	hgsc.bcm.edu	37	11	248788	248788	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr11:248788A>G	ENST00000532097.1	+	8	1085	c.581A>G	c.(580-582)cAg>cGg	p.Q194R	PSMD13_ENST00000352303.5_Missense_Mutation_p.Q194R|PSMD13_ENST00000431206.2_Missense_Mutation_p.Q196R	NM_002817.3	NP_002808.3	Q9UNM6	PSD13_HUMAN	proteasome (prosome, macropain) 26S subunit, non-ATPase, 13	194					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|meiosis I (GO:0007127)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)|proteasome regulatory particle (GO:0005838)				NS(1)|large_intestine(2)|lung(5)|ovary(1)|skin(1)	10		all_cancers(49;1.58e-09)|all_epithelial(84;2.71e-06)|Breast(177;0.000162)|Ovarian(85;0.000626)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.0538)|all_lung(207;0.0713)		all cancers(45;7.79e-27)|Epithelial(43;4e-26)|OV - Ovarian serous cystadenocarcinoma(40;6.02e-21)|BRCA - Breast invasive adenocarcinoma(625;3.93e-05)|Lung(200;0.112)|LUSC - Lung squamous cell carcinoma(625;0.129)		TCTGAGCAGCAGGAGAGAGCC	0.443																																					p.Q196R		Atlas-SNP	.											.	PSMD13	53	.	0			c.A587G						.						77.0	75.0	75.0					11																	248788		2203	4300	6503	SO:0001583	missense	5719	exon6			AGCAGCAGGAGAG	AB009398	CCDS7692.1, CCDS44504.1	11p15.5	2008-05-22			ENSG00000185627	ENSG00000185627		"""Proteasome (prosome, macropain) subunits"""	9558	protein-coding gene	gene with protein product		603481				9714768, 8811196	Standard	NM_002817		Approved	p40.5, Rpn9	uc001loo.2	Q9UNM6	OTTHUMG00000119072	ENST00000532097.1:c.581A>G	chr11.hg19:g.248788A>G	ENSP00000436186:p.Gln194Arg	119.0	0.0		72.0	4.0	NM_175932	B3KT15|O75831|Q53XU2|Q9UNV3	Missense_Mutation	SNP	ENST00000532097.1	hg19	CCDS7692.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	11.87|11.87	1.768985|1.768985	0.31320|0.31320	.|.	.|.	ENSG00000185627|ENSG00000185627	ENST00000532097;ENST00000538343;ENST00000431206;ENST00000528906;ENST00000352303|ENST00000526783	T;T;T;T|.	0.18502|.	2.22;2.22;2.24;2.21|.	5.45|5.45	3.14|3.14	0.36123|0.36123	.|.	0.222920|.	0.47455|.	D|.	0.000236|.	T|T	0.51244|0.51244	0.1663|0.1663	L|L	0.38175|0.38175	1.15|1.15	0.52501|0.52501	D|D	0.999957|0.999957	B;B;B;B|.	0.13594|.	0.008;0.002;0.001;0.001|.	B;B;B;B|.	0.09377|.	0.004;0.003;0.002;0.002|.	T|T	0.35201|0.35201	-0.9798|-0.9798	10|5	0.11182|.	T|.	0.66|.	.|.	9.0653|9.0653	0.36460|0.36460	0.8486:0.0:0.1514:0.0|0.8486:0.0:0.1514:0.0	.|.	196;129;194;194|.	Q9UNM6-2;B4DJ66;B2RBM7;Q9UNM6|.	.;.;.;PSD13_HUMAN|.	R|G	194;129;196;156;194|105	ENSP00000436186:Q194R;ENSP00000396937:Q196R;ENSP00000433364:Q156R;ENSP00000333811:Q194R|.	ENSP00000333811:Q194R|.	Q|R	+|+	2|1	0|2	PSMD13|PSMD13	238788|238788	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.992000|0.992000	0.81027|0.81027	7.408000|7.408000	0.80041|0.80041	0.471000|0.471000	0.27319|0.27319	0.529000|0.529000	0.55759|0.55759	CAG|AGG	.	.		0.443	PSMD13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239286.2	NM_002817	
IFITM3	10410	hgsc.bcm.edu	37	11	320723	320723	+	Missense_Mutation	SNP	C	C	T	rs199582787	byFrequency	TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr11:320723C>T	ENST00000399808.4	-	1	327	c.91G>A	c.(91-93)Gtg>Atg	p.V31M	RP11-326C3.14_ENST00000602809.1_lincRNA|RP11-326C3.11_ENST00000602429.1_RNA|IFITM3_ENST00000602735.1_Missense_Mutation_p.V10M|RP11-326C3.11_ENST00000602756.1_RNA|RP11-326C3.11_ENST00000508004.2_RNA|RP11-326C3.10_ENST00000534271.1_RNA|IFITM3_ENST00000526811.1_Missense_Mutation_p.V10M	NM_021034.2	NP_066362.2	Q01628	IFM3_HUMAN	interferon induced transmembrane protein 3	31					cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|immune response (GO:0006955)|negative regulation of viral entry into host cell (GO:0046597)|negative regulation of viral genome replication (GO:0045071)|negative regulation of viral transcription (GO:0032897)|response to interferon-alpha (GO:0035455)|response to interferon-beta (GO:0035456)|response to interferon-gamma (GO:0034341)|response to virus (GO:0009615)|type I interferon signaling pathway (GO:0060337)	endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|plasma membrane (GO:0005886)				central_nervous_system(7)|endometrium(7)|kidney(2)|large_intestine(1)|lung(1)	18		all_cancers(49;2e-09)|all_epithelial(84;3.36e-06)|Breast(177;0.000162)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.0538)|all_lung(207;0.0713)		all cancers(45;8.85e-28)|Epithelial(43;5.52e-27)|OV - Ovarian serous cystadenocarcinoma(40;1.11e-20)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.0327)|LUSC - Lung squamous cell carcinoma(625;0.122)		GCCCCCAGCACAGCCACCTCG	0.612																																					p.V31M		Atlas-SNP	.											IFITM3,brain,glioma,0,1	IFITM3	132	.	0			c.G91A						.						87.0	98.0	95.0					11																	320723		1967	4140	6107	SO:0001583	missense	10410	exon1			CCAGCACAGCCAC	X57352	CCDS41585.1	11p15.5	2011-05-24	2011-05-24		ENSG00000142089	ENSG00000142089			5414	protein-coding gene	gene with protein product		605579	"""interferon induced transmembrane protein 3 (1-8U)"""			1906403, 16326387	Standard	NM_021034		Approved	1-8U	uc001lpa.2	Q01628		ENST00000399808.4:c.91G>A	chr11.hg19:g.320723C>T	ENSP00000382707:p.Val31Met	96.0	1.0		58.0	3.0	NM_021034	Q53Y76|Q96HK8|Q96J15	Missense_Mutation	SNP	ENST00000399808.4	hg19	CCDS41585.1	.	.	.	.	.	.	.	.	.	.	C	11.06	1.526447	0.27299	.	.	ENSG00000142089	ENST00000399808;ENST00000270031;ENST00000526811	T;T	0.79454	-1.03;-1.27	4.61	-4.91	0.03085	.	11.488500	0.02440	N	0.084490	T	0.64516	0.2605	L	0.39147	1.195	0.09310	N	1	B	0.16802	0.019	B	0.15484	0.013	T	0.46400	-0.9194	10	0.13108	T	0.6	0.9022	6.4601	0.21952	0.1231:0.361:0.0:0.5159	.	31	Q01628	IFM3_HUMAN	M	31;15;10	ENSP00000382707:V31M;ENSP00000432108:V10M	ENSP00000372047:V15M	V	-	1	0	IFITM3	310723	0.000000	0.05858	0.000000	0.03702	0.034000	0.12701	-1.638000	0.02013	-0.562000	0.06086	-1.790000	0.00627	GTG	.	.		0.612	IFITM3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000384765.1	NM_021034	
C11orf40	143501	hgsc.bcm.edu	37	11	4592711	4592712	+	Missense_Mutation	DNP	TT	TT	AG	rs78543312|rs78387367		TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr11:4592711_4592712TT>AG	ENST00000307616.1	-	4	594_595	c.595_596AA>CT	c.(595-597)AAc>CTc	p.N199L		NM_144663.1	NP_653264.1	Q8WZ69	CK040_HUMAN	chromosome 11 open reading frame 40	199										large_intestine(3)|lung(1)|ovary(2)|stomach(1)	7		Medulloblastoma(188;0.0075)|Breast(177;0.0461)|all_neural(188;0.0577)		Epithelial(150;4.28e-12)|BRCA - Breast invasive adenocarcinoma(625;0.0288)|LUSC - Lung squamous cell carcinoma(625;0.192)		atccatacagtttttccCTGCA	0.441																																					p.N199I|p.N199H		Atlas-SNP	.											.	C11orf40	37	.	0			c.A596T|c.A595C						.																																			SO:0001583	missense	143501	exon4			ATACAGTTTTTCC|TACAGTTTTTCCC		CCDS31354.1	11p15.5	2005-10-03			ENSG00000171987	ENSG00000171987			23986	protein-coding gene	gene with protein product							Standard	NM_144663		Approved	NOV1	uc010qyg.2	Q8WZ69	OTTHUMG00000165345	ENST00000307616.1:c.595_596delinsAG	chr11.hg19:g.4592711_4592712delinsAG	ENSP00000302918:p.Asn199Leu	155.0|154.0	0.0		133.0|130.0	10.0|7.0	NM_144663		Missense_Mutation	SNP	ENST00000307616.1	hg19	CCDS31354.1																																																																																			.	.		0.441	C11orf40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383529.1	NM_144663	
ARFIP2	23647	hgsc.bcm.edu	37	11	6501574	6501574	+	Silent	SNP	A	A	G			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr11:6501574A>G	ENST00000254584.2	-	2	161	c.78T>C	c.(76-78)ccT>ccC	p.P26P	ARFIP2_ENST00000423813.2_Intron|ARFIP2_ENST00000525235.1_Silent_p.P26P|TIMM10B_ENST00000530751.1_5'Flank|ARFIP2_ENST00000396777.3_Silent_p.P26P|TIMM10B_ENST00000472836.1_5'Flank|TIMM10B_ENST00000254616.6_5'Flank|ARFIP2_ENST00000445086.2_Intron	NM_012402.3	NP_036534.1	P53365	ARFP2_HUMAN	ADP-ribosylation factor interacting protein 2	26					actin cytoskeleton organization (GO:0030036)|cellular component movement (GO:0006928)|lamellipodium assembly (GO:0030032)|ruffle organization (GO:0031529)|small GTPase mediated signal transduction (GO:0007264)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	GTP binding (GO:0005525)|GTP-dependent protein binding (GO:0030742)|Rac GTPase binding (GO:0048365)			endometrium(2)|large_intestine(4)|liver(1)|lung(4)|pancreas(1)|prostate(1)|skin(2)	15		Medulloblastoma(188;0.00263)|all_neural(188;0.026)|Breast(177;0.029)		Epithelial(150;3.41e-08)|BRCA - Breast invasive adenocarcinoma(625;0.189)		CATCATCTTCAGGAAGCTGCC	0.483																																					p.P26P	Melanoma(119;796 1674 9049 20480 24794)	Atlas-SNP	.											.	ARFIP2	23	.	0			c.T78C						.						69.0	59.0	62.0					11																	6501574		2201	4296	6497	SO:0001819	synonymous_variant	23647	exon2			ATCTTCAGGAAGC	BC000392	CCDS7765.1, CCDS55739.1, CCDS55740.1, CCDS73250.1	11p15	2008-08-01	2008-08-01		ENSG00000132254	ENSG00000132254			17160	protein-coding gene	gene with protein product	"""arfaptin 2"""	601638				8670882, 9038142	Standard	NM_012402		Approved	POR1	uc010ran.2	P53365	OTTHUMG00000133406	ENST00000254584.2:c.78T>C	chr11.hg19:g.6501574A>G		132.0	0.0		70.0	4.0	NM_012402	B4DX86|B4E306|D3DQT5	Silent	SNP	ENST00000254584.2	hg19	CCDS7765.1																																																																																			.	.		0.483	ARFIP2-008	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387044.1	NM_012402	
DCHS1	8642	hgsc.bcm.edu	37	11	6662744	6662744	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr11:6662744C>A	ENST00000299441.3	-	2	512	c.101G>T	c.(100-102)gGg>gTg	p.G34V		NM_003737.2	NP_003728.1	Q96JQ0	PCD16_HUMAN	dachsous cadherin-related 1	34					branching involved in ureteric bud morphogenesis (GO:0001658)|calcium-dependent cell-cell adhesion (GO:0016339)|cochlea development (GO:0090102)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|neural tube development (GO:0021915)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|post-anal tail morphogenesis (GO:0036342)	apical part of cell (GO:0045177)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(16)|liver(1)|lung(41)|ovary(4)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	103		Medulloblastoma(188;0.00263)|all_neural(188;0.026)		Epithelial(150;6.35e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		CACCCCAGCCCCcagcagcag	0.642																																					p.G34V		Atlas-SNP	.											.	DCHS1	277	.	0			c.G101T						.						8.0	8.0	8.0					11																	6662744		2165	4229	6394	SO:0001583	missense	8642	exon2			CCAGCCCCCAGCA	AB000895	CCDS7771.1	11p15.4	2013-10-04	2013-10-04	2004-09-03	ENSG00000166341	ENSG00000166341		"""Cadherins / Cadherin-related"""	13681	protein-coding gene	gene with protein product	"""cadherin-related family member 6"""	603057	"""protocadherin 16"", ""dachsous 1 (Drosophila)"""	CDH25, PCDH16		9199196	Standard	XM_005253207		Approved	FIB1, KIAA1773, FLJ11790, CDHR6	uc001mem.1	Q96JQ0	OTTHUMG00000133398	ENST00000299441.3:c.101G>T	chr11.hg19:g.6662744C>A	ENSP00000299441:p.Gly34Val	53.0	0.0		31.0	6.0	NM_003737	O15098	Missense_Mutation	SNP	ENST00000299441.3	hg19	CCDS7771.1	.	.	.	.	.	.	.	.	.	.	C	14.44	2.535676	0.45176	.	.	ENSG00000166341	ENST00000299441	T	0.54279	0.58	5.32	5.32	0.75619	.	0.000000	0.40554	N	0.001076	T	0.65176	0.2666	M	0.68952	2.095	0.47584	D	0.999464	D	0.64830	0.994	P	0.61328	0.887	T	0.60286	-0.7293	10	0.10902	T	0.67	.	16.1489	0.81599	0.0:1.0:0.0:0.0	.	34	Q96JQ0	PCD16_HUMAN	V	34	ENSP00000299441:G34V	ENSP00000299441:G34V	G	-	2	0	DCHS1	6619320	0.845000	0.29573	0.928000	0.36995	0.824000	0.46624	1.469000	0.35343	2.489000	0.83994	0.579000	0.79373	GGG	.	.		0.642	DCHS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257258.1	NM_003737	
MRVI1	10335	hgsc.bcm.edu	37	11	10647928	10647928	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr11:10647928A>G	ENST00000436272.1	-	8	950	c.872T>C	c.(871-873)cTg>cCg	p.L291P	MRVI1_ENST00000424001.1_Missense_Mutation_p.L3P|MRVI1_ENST00000423302.2_Missense_Mutation_p.L318P|MRVI1_ENST00000558540.1_Missense_Mutation_p.L3P|MRVI1_ENST00000534266.2_Missense_Mutation_p.L3P|MRVI1_ENST00000527509.2_Missense_Mutation_p.L227P|MRVI1_ENST00000545852.1_Missense_Mutation_p.L3P|MRVI1_ENST00000421747.1_Missense_Mutation_p.L309P|MRVI1_ENST00000547195.1_Missense_Mutation_p.L227P|MRVI1_ENST00000541483.1_Intron|MRVI1_ENST00000552103.1_Missense_Mutation_p.L227P|MRVI1_ENST00000531107.1_Missense_Mutation_p.L310P			Q9Y6F6	MRVI1_HUMAN	murine retrovirus integration site 1 homolog	291					blood coagulation (GO:0007596)|cGMP-mediated signaling (GO:0019934)|relaxation of vascular smooth muscle (GO:0060087)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|platelet dense tubular network membrane (GO:0031095)|sarcoplasmic reticulum (GO:0016529)				central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(4)|ovary(2)|prostate(2)	22				all cancers(16;2.68e-07)|Epithelial(150;3.04e-07)|BRCA - Breast invasive adenocarcinoma(625;0.0723)		AGGGCTGTTCAGGGCCATTTT	0.572																																					p.L318P		Atlas-SNP	.											.	MRVI1	113	.	0			c.T953C						.						72.0	78.0	76.0					11																	10647928		1942	4138	6080	SO:0001583	missense	10335	exon9			CTGTTCAGGGCCA	AF081249	CCDS44538.1, CCDS44539.1, CCDS44540.1, CCDS44538.2, CCDS55745.1, CCDS55746.1	11p15.4	2014-09-11			ENSG00000072952	ENSG00000072952			7237	protein-coding gene	gene with protein product	"""inositol 1,4,5-triphosphate-associated cGMP kinase substrate"", ""IP3R-associated cGMP kinase substrate"""	604673				10321731	Standard	NM_001098579		Approved	JAW1L, IRAG	uc010rcb.1	Q9Y6F6	OTTHUMG00000165773	ENST00000436272.1:c.872T>C	chr11.hg19:g.10647928A>G	ENSP00000412229:p.Leu291Pro	176.0	0.0		91.0	4.0	NM_130385	B7Z3T4|B7Z6I2|B7Z9A3|E9PQY6|F5H6A1|J3KQZ7|Q17S00|Q9UNY1	Missense_Mutation	SNP	ENST00000436272.1	hg19		.	.	.	.	.	.	.	.	.	.	A	15.04	2.713778	0.48622	.	.	ENSG00000072952	ENST00000421747;ENST00000308763;ENST00000436272;ENST00000547195;ENST00000552103;ENST00000545852;ENST00000424001;ENST00000423302;ENST00000531107;ENST00000527509	T;T;T;T;T;T;T;T;T	0.35789	2.2;2.66;1.64;1.64;1.29;1.29;2.01;2.2;1.64	5.71	5.71	0.89125	.	0.230509	0.30556	N	0.009363	T	0.59348	0.2187	M	0.66939	2.045	0.58432	D	0.999999	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.998;0.998;0.999	T	0.60845	-0.7182	10	0.54805	T	0.06	-8.5711	15.9822	0.80121	1.0:0.0:0.0:0.0	.	291;310;309	Q9Y6F6;E9PQY6;Q9Y6F6-4	MRVI1_HUMAN;.;.	P	309;292;291;227;227;3;3;318;310;227	ENSP00000414598:L309P;ENSP00000412229:L291P;ENSP00000448278:L227P;ENSP00000446764:L227P;ENSP00000441971:L3P;ENSP00000401205:L3P;ENSP00000412130:L318P;ENSP00000432436:L310P;ENSP00000432067:L227P	ENSP00000307885:L292P	L	-	2	0	MRVI1	10604504	1.000000	0.71417	1.000000	0.80357	0.486000	0.33341	4.760000	0.62235	2.189000	0.69895	0.460000	0.39030	CTG	.	.		0.572	MRVI1-203	KNOWN	basic	protein_coding	protein_coding		NM_001098579	
USP47	55031	hgsc.bcm.edu	37	11	11941963	11941963	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr11:11941963G>A	ENST00000399455.2	+	11	1320	c.1200G>A	c.(1198-1200)atG>atA	p.M400I	USP47_ENST00000539466.1_5'UTR|USP47_ENST00000527733.1_Missense_Mutation_p.M380I|USP47_ENST00000339865.5_Missense_Mutation_p.M312I	NM_001282659.1	NP_001269588.1	Q96K76	UBP47_HUMAN	ubiquitin specific peptidase 47	400	USP.				base-excision repair (GO:0006284)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to UV (GO:0034644)|monoubiquitinated protein deubiquitination (GO:0035520)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of G2/M transition of mitotic cell cycle (GO:0010972)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell growth (GO:0030307)|response to drug (GO:0042493)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|SCF ubiquitin ligase complex (GO:0019005)	ubiquitin-specific protease activity (GO:0004843)|WD40-repeat domain binding (GO:0071987)			breast(4)|endometrium(7)|kidney(2)|large_intestine(8)|liver(2)|lung(14)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	46				Epithelial(150;0.000339)		ATACAACCATGCATAGGATTA	0.338																																					p.M312I		Atlas-SNP	.											.	USP47	91	.	0			c.G936A						.						109.0	103.0	105.0					11																	11941963		1823	4075	5898	SO:0001583	missense	55031	exon9			AACCATGCATAGG	AK027362	CCDS41619.1, CCDS60725.1	11p15.2	2008-02-05	2005-08-08		ENSG00000170242	ENSG00000170242		"""Ubiquitin-specific peptidases"""	20076	protein-coding gene	gene with protein product		614460	"""Trf (TATA binding protein-related factor)-proximal homolog (Drosophila)"", ""ubiquitin specific protease 47"""			12838346	Standard	XM_005252997		Approved		uc001mjr.3	Q96K76	OTTHUMG00000165685	ENST00000399455.2:c.1200G>A	chr11.hg19:g.11941963G>A	ENSP00000382382:p.Met400Ile	102.0	0.0		58.0	4.0	NM_017944	B3KXF5|E9PM46|Q658U0|Q86Y73|Q8TEP6|Q9BWI0|Q9NWN1	Missense_Mutation	SNP	ENST00000399455.2	hg19		.	.	.	.	.	.	.	.	.	.	G	25.9	4.687971	0.88639	.	.	ENSG00000170242	ENST00000339865;ENST00000527733;ENST00000399455;ENST00000535588	T;T;T	0.29917	1.55;1.55;1.55	5.5	5.5	0.81552	.	0.105200	0.85682	D	0.000000	T	0.47284	0.1437	L	0.55990	1.75	0.80722	D	1	P;P	0.47677	0.899;0.745	P;P	0.56865	0.808;0.6	T	0.11941	-1.0567	10	0.26408	T	0.33	.	18.9869	0.92775	0.0:0.0:1.0:0.0	.	380;312	E9PM46;Q96K76-2	.;.	I	312;380;400;400	ENSP00000339957:M312I;ENSP00000433146:M380I;ENSP00000382382:M400I	ENSP00000339957:M312I	M	+	3	0	USP47	11898539	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.062000	0.89475	2.591000	0.87537	0.563000	0.77884	ATG	.	.		0.338	USP47-003	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000385853.2	NM_017944	
NUCB2	4925	hgsc.bcm.edu	37	11	17352479	17352480	+	Missense_Mutation	DNP	CA	CA	TT	rs189362726|rs535406012|rs3842269	byFrequency	TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	C|A	C|A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr11:17352479_17352480CA>TT	ENST00000529010.1	+	13	1423_1424	c.1204_1205CA>TT	c.(1204-1206)CAa>TTa	p.Q402L	NUCB2_ENST00000458064.2_Missense_Mutation_p.Q372L|NUCB2_ENST00000323688.6_Missense_Mutation_p.Q402L	NM_005013.2	NP_005004	P80303	NUCB2_HUMAN	nucleobindin 2	402	Binds to necdin. {ECO:0000250}.		Missing. {ECO:0000269|PubMed:12087473, ECO:0000269|PubMed:14702039}.			cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|nuclear outer membrane (GO:0005640)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|DNA binding (GO:0003677)			kidney(1)|large_intestine(2)|lung(8)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	14						AAAAAAATTACAACAAGGAATT	0.322																																					p.Q402X|p.Q402L		Atlas-SNP	.											.	NUCB2	31	.	0			c.C1204T|c.A1205T						.																																			SO:0001583	missense	4925	exon13			AAATTACAACAAG|AATTACAACAAGG	AF052642	CCDS41623.1	11p15.1	2013-01-10						"""EF-hand domain containing"""	8044	protein-coding gene	gene with protein product		608020				7811391	Standard	NM_005013		Approved	NEFA	uc001mmw.3	P80303		Exception_encountered	chr11.hg19:g.17352479_17352480delinsTT	ENSP00000436455:p.Gln402Leu	1.0	0.0		16.0|14.0	6.0	NM_005013	A8K642|D3DQX5|Q8NFT5	Nonsense_Mutation|Missense_Mutation	SNP	ENST00000529010.1	hg19	CCDS41623.1																																																																																			.	.		0.322	NUCB2-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000387614.2	NM_005013	
SLC17A6	57084	hgsc.bcm.edu	37	11	22381052	22381052	+	Silent	SNP	A	A	G			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr11:22381052A>G	ENST00000263160.3	+	4	989	c.552A>G	c.(550-552)agA>agG	p.R184R	CTD-2140G10.4_ENST00000534543.1_RNA	NM_020346.2	NP_065079.1	Q9P2U8	VGLU2_HUMAN	solute carrier family 17 (vesicular glutamate transporter), member 6	184					ion transport (GO:0006811)|neurotransmitter uptake (GO:0001504)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|synaptic vesicle membrane (GO:0030672)	L-glutamate transmembrane transporter activity (GO:0005313)|symporter activity (GO:0015293)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(3)|lung(28)|ovary(3)|skin(4)|upper_aerodigestive_tract(3)	50						TCTTTGTCAGAATACTGCAGG	0.408																																					p.R184R		Atlas-SNP	.											.	SLC17A6	135	.	0			c.A552G						.						148.0	133.0	138.0					11																	22381052		2203	4300	6503	SO:0001819	synonymous_variant	57084	exon4			TGTCAGAATACTG	AB032435	CCDS7856.1	11p14.3	2013-07-18	2013-07-18		ENSG00000091664	ENSG00000091664		"""Solute carriers"""	16703	protein-coding gene	gene with protein product	"""vesicular glutamate transporter 2"", ""differentiation-associated Na-dependent inorganic phosphate cotransporter"""	607563	"""solute carrier family 17 (sodium-dependent inorganic phosphate cotransporter), member 6"""			11306821	Standard	NM_020346		Approved	DNPI, VGLUT2	uc001mqk.3	Q9P2U8	OTTHUMG00000166063	ENST00000263160.3:c.552A>G	chr11.hg19:g.22381052A>G		139.0	0.0		96.0	4.0	NM_020346	A6NKS2	Silent	SNP	ENST00000263160.3	hg19	CCDS7856.1																																																																																			.	.		0.408	SLC17A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387671.1	NM_020346	
QSER1	79832	hgsc.bcm.edu	37	11	32977609	32977609	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr11:32977609A>G	ENST00000399302.2	+	7	4641	c.4306A>G	c.(4306-4308)Aag>Gag	p.K1436E	QSER1_ENST00000527788.1_Missense_Mutation_p.K1197E	NM_001076786.1	NP_001070254.1	Q2KHR3	QSER1_HUMAN	glutamine and serine rich 1	1436										breast(5)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(16)|ovary(4)|prostate(1)|skin(5)|stomach(1)|urinary_tract(1)	48	Breast(20;0.158)					TGCAAACAAGAAGGAATATGT	0.308																																					p.K1436E		Atlas-SNP	.											.	QSER1	153	.	0			c.A4306G						.						142.0	135.0	137.0					11																	32977609		1820	4069	5889	SO:0001583	missense	79832	exon7			AACAAGAAGGAAT	AL834141	CCDS41631.1	11p13	2014-02-12			ENSG00000060749	ENSG00000060749			26154	protein-coding gene	gene with protein product							Standard	XM_006718323		Approved	FLJ21924	uc001mty.3	Q2KHR3		ENST00000399302.2:c.4306A>G	chr11.hg19:g.32977609A>G	ENSP00000382241:p.Lys1436Glu	115.0	0.0		71.0	4.0	NM_001076786	Q6ZU30|Q6ZUR5	Missense_Mutation	SNP	ENST00000399302.2	hg19	CCDS41631.1	.	.	.	.	.	.	.	.	.	.	A	22.4	4.279215	0.80692	.	.	ENSG00000060749	ENST00000399302;ENST00000078652;ENST00000527788	T;T	0.31769	1.81;1.48	5.57	5.57	0.84162	.	0.000000	0.64402	D	0.000006	T	0.50069	0.1594	M	0.66939	2.045	0.42105	D	0.991359	D;D;D	0.67145	0.99;0.982;0.996	P;P;P	0.58266	0.768;0.628;0.836	T	0.54556	-0.8276	10	0.72032	D	0.01	.	15.7316	0.77810	1.0:0.0:0.0:0.0	.	1197;1197;1436	C9JJ88;Q2KHR3-2;Q2KHR3	.;.;QSER1_HUMAN	E	1436;1197;1197	ENSP00000382241:K1436E;ENSP00000432766:K1197E	ENSP00000078652:K1197E	K	+	1	0	QSER1	32934185	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	5.629000	0.67798	2.109000	0.64355	0.482000	0.46254	AAG	.	.		0.308	QSER1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388448.1	NM_024774	
NAT10	55226	hgsc.bcm.edu	37	11	34145347	34145347	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr11:34145347A>G	ENST00000257829.3	+	10	1159	c.953A>G	c.(952-954)aAc>aGc	p.N318S	NAT10_ENST00000527971.1_Intron|NAT10_ENST00000531159.2_Missense_Mutation_p.N246S	NM_024662.2	NP_078938	Q9H0A0	NAT10_HUMAN	N-acetyltransferase 10 (GCN5-related)	318						membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|N-acetyltransferase activity (GO:0008080)|poly(A) RNA binding (GO:0044822)			endometrium(4)|large_intestine(8)|lung(8)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	23		Acute lymphoblastic leukemia(5;0.0119)|all_hematologic(20;0.0231)				AGCCCTGATAACCTCCATACT	0.323																																					p.N318S		Atlas-SNP	.											.	NAT10	78	.	0			c.A953G						.						122.0	120.0	120.0					11																	34145347		2202	4298	6500	SO:0001583	missense	55226	exon10			CTGATAACCTCCA	AF489535	CCDS7889.1, CCDS44568.1	11p13	2011-11-16	2008-09-24		ENSG00000135372	ENSG00000135372	2.3.1.-		29830	protein-coding gene	gene with protein product		609221	"""N-acetyltransferase 10"""			14592445, 21177859	Standard	NM_024662		Approved	hALP, FLJ10774, FLJ12179, NET43, KIAA1709	uc001mvk.3	Q9H0A0	OTTHUMG00000166249	ENST00000257829.3:c.953A>G	chr11.hg19:g.34145347A>G	ENSP00000257829:p.Asn318Ser	178.0	0.0		99.0	4.0	NM_024662	B4DFD5|E7ESU4|E9PMN9|Q86WK5|Q9C0F4|Q9HA61|Q9NVF2	Missense_Mutation	SNP	ENST00000257829.3	hg19	CCDS7889.1	.	.	.	.	.	.	.	.	.	.	A	24.7	4.556601	0.86231	.	.	ENSG00000135372	ENST00000257829;ENST00000531159	T;T	0.46819	0.86;0.86	5.36	5.36	0.76844	Domain of unknown function DUF699, exodeoxyribonuclease V alpha chain (1);	0.083040	0.85682	D	0.000000	T	0.63355	0.2504	M	0.64404	1.975	0.80722	D	1	D	0.63880	0.993	D	0.63033	0.91	T	0.63337	-0.6660	10	0.42905	T	0.14	-32.1786	15.3831	0.74676	1.0:0.0:0.0:0.0	.	318	Q9H0A0	NAT10_HUMAN	S	318;246	ENSP00000257829:N318S;ENSP00000433011:N246S	ENSP00000257829:N318S	N	+	2	0	NAT10	34101923	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	9.053000	0.93860	2.181000	0.69327	0.524000	0.50904	AAC	.	.		0.323	NAT10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388693.1	NM_024662	
EXT2	2132	hgsc.bcm.edu	37	11	44228357	44228357	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr11:44228357A>G	ENST00000343631.3	+	10	1639	c.1510A>G	c.(1510-1512)Aaa>Gaa	p.K504E	EXT2_ENST00000533608.1_Missense_Mutation_p.K504E|EXT2_ENST00000358681.4_Missense_Mutation_p.K514E|EXT2_ENST00000395673.3_Missense_Mutation_p.K537E			Q93063	EXT2_HUMAN	exostosin glycosyltransferase 2	504					carbohydrate metabolic process (GO:0005975)|cell differentiation (GO:0030154)|cellular polysaccharide biosynthetic process (GO:0033692)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)|heparan sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process (GO:0015014)|mesoderm formation (GO:0001707)|ossification (GO:0001503)|protein glycosylation (GO:0006486)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|intrinsic component of endoplasmic reticulum membrane (GO:0031227)|membrane (GO:0016020)	glucuronosyl-N-acetylglucosaminyl-proteoglycan 4-alpha-N-acetylglucosaminyltransferase activity (GO:0050508)|glucuronosyltransferase activity (GO:0015020)|heparan sulfate N-acetylglucosaminyltransferase activity (GO:0042328)|N-acetylglucosaminyl-proteoglycan 4-beta-glucuronosyltransferase activity (GO:0050509)|protein heterodimerization activity (GO:0046982)|transferase activity, transferring glycosyl groups (GO:0016757)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|lung(17)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)	32						TCTCTGGCCCAAAATCCGGGT	0.388			"""Mis, N, F, S"""			"""exostoses, osteosarcoma"""			Hereditary Multiple Exostoses																												p.K537E		Atlas-SNP	.	yes	Rec		Multiple Exostoses Type 2	11	11p12-p11	2132	multiple exostoses type 2 gene		M	EXT2_ENST00000358681,NS,carcinoma,0,2	EXT2	129	.	0			c.A1609G						.						94.0	95.0	95.0					11																	44228357		2203	4299	6502	SO:0001583	missense	2132	exon10	Familial Cancer Database	HME, Hereditary Exostoses, Multiple Osteochondromatosis, Multiple Cartilaginous Exostoses	TGGCCCAAAATCC		CCDS7908.1, CCDS53618.1, CCDS53619.1	11p12-p11	2014-09-17	2013-03-01		ENSG00000151348	ENSG00000151348	2.4.1.224, 2.4.1.225	"""Exostosin glycosyltransferase family"""	3513	protein-coding gene	gene with protein product	"""Glucuronosyl-N-acetylglucosaminyl-proteoglycan 4-alpha-N- acetylglucosaminyltransferase"", ""N-acetylglucosaminyl-proteoglycan 4-beta-glucuronosyltransferase"""	608210	"""exostoses (multiple) 2"", ""exostosin 2"""			8162019, 9576285	Standard	NM_000401		Approved	SOTV	uc001mya.3	Q93063	OTTHUMG00000166498	ENST00000343631.3:c.1510A>G	chr11.hg19:g.44228357A>G	ENSP00000342656:p.Lys504Glu	67.0	0.0		39.0	2.0	NM_000401	B2R5Z6|C9JU51|J3KPT2|O15288	Missense_Mutation	SNP	ENST00000343631.3	hg19	CCDS7908.1	.	.	.	.	.	.	.	.	.	.	A	16.08	3.022363	0.54683	.	.	ENSG00000151348	ENST00000533608;ENST00000358681;ENST00000395673;ENST00000343631	D;D;D;D	0.85556	-2.0;-2.0;-2.0;-2.0	5.81	3.44	0.39384	EXTL2, alpha-1,4-N-acetylhexosaminyltransferase (1);	0.000000	0.85682	D	0.000000	T	0.79890	0.4524	L	0.33293	1	0.53688	D	0.999975	B;P;P;P;P	0.41978	0.174;0.642;0.589;0.767;0.767	B;P;B;P;P	0.46144	0.068;0.505;0.372;0.505;0.505	T	0.71836	-0.4472	10	0.10902	T	0.67	-27.0637	12.8389	0.57790	0.7435:0.2565:0.0:0.0	.	504;514;514;504;517	Q6NUL1;C9JU51;Q93063-2;Q93063;D3DR24	.;.;.;EXT2_HUMAN;.	E	504;514;537;504	ENSP00000431173:K504E;ENSP00000351509:K514E;ENSP00000379032:K537E;ENSP00000342656:K504E	ENSP00000342656:K504E	K	+	1	0	EXT2	44184933	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	7.182000	0.77689	0.434000	0.26340	-1.243000	0.01532	AAA	.	.		0.388	EXT2-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390074.1	NM_000401	
ANAPC15	25906	hgsc.bcm.edu	37	11	71819858	71819858	+	IGR	SNP	C	C	A			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr11:71819858C>A	ENST00000227618.4	-	0	886				ANAPC15_ENST00000502597.2_Intron|ANAPC15_ENST00000543050.1_Intron|LRTOMT_ENST00000435085.1_Missense_Mutation_p.Q255K|LRTOMT_ENST00000419228.1_Missense_Mutation_p.Q215K|LRTOMT_ENST00000307198.7_Missense_Mutation_p.Q255K|ANAPC15_ENST00000543015.1_5'Flank	NM_001278487.1|NM_001278491.1|NM_014042.2	NP_001265416.1|NP_001265420.1|NP_054761.1	P60006	APC15_HUMAN	anaphase promoting complex subunit 15						mitotic nuclear division (GO:0007067)|regulation of mitotic cell cycle spindle assembly checkpoint (GO:0090266)	anaphase-promoting complex (GO:0005680)|intracellular (GO:0005622)											CCGCTTCTTGCAGTATGCTAA	0.622																																					p.Q255K		Atlas-SNP	.											.	LRTOMT	20	.	0			c.C763A						.						75.0	67.0	69.0					11																	71819858		692	1591	2283	SO:0001628	intergenic_variant	220074	exon9			TTCTTGCAGTATG	AL080071	CCDS8210.1, CCDS60880.1	11q13.4	2012-10-17	2012-05-31	2012-05-31	ENSG00000110200	ENSG00000110200		"""Anaphase promoting complex subunits"""	24531	protein-coding gene	gene with protein product		614717	"""chromosome 11 open reading frame 51"""	C11orf51		21926987	Standard	NM_014042		Approved	HSPC020, DKFZP564M082, APC15	uc001orw.3	P60006	OTTHUMG00000167865		chr11.hg19:g.71819858C>A		108.0	0.0		125.0	45.0	NM_001145309	G3V1Q3|Q9CXK2|Q9Y269	Missense_Mutation	SNP	ENST00000227618.4	hg19	CCDS8210.1	.	.	.	.	.	.	.	.	.	.	C	15.00	2.704317	0.48412	.	.	ENSG00000184154	ENST00000419228;ENST00000435085;ENST00000307198	T;T;T	0.70282	-0.47;-0.47;-0.47	5.53	4.6	0.57074	.	.	.	.	.	T	0.51500	0.1678	N	0.12182	0.205	0.80722	D	1	P;P	0.39022	0.454;0.655	B;B	0.38264	0.266;0.269	T	0.51601	-0.8685	9	0.08599	T	0.76	-10.8557	15.9651	0.79966	0.0:0.8648:0.1352:0.0	.	255;215	Q8WZ04;Q8WZ04-2	TOMT_HUMAN;.	K	215;255;255	ENSP00000392233:Q215K;ENSP00000409789:Q255K;ENSP00000305742:Q255K	ENSP00000305742:Q215K	Q	+	1	0	LRTOMT	71497506	1.000000	0.71417	0.999000	0.59377	0.981000	0.71138	4.200000	0.58433	1.513000	0.48852	0.651000	0.88453	CAG	.	.		0.622	ANAPC15-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000396695.1	NM_014042	
DYNC2H1	79659	hgsc.bcm.edu	37	11	103018563	103018563	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr11:103018563T>C	ENST00000375735.2	+	19	2909	c.2765T>C	c.(2764-2766)cTc>cCc	p.L922P	DYNC2H1_ENST00000334267.7_Intron|DYNC2H1_ENST00000398093.3_Missense_Mutation_p.L922P	NM_001080463.1|NM_001377.2	NP_001073932.1|NP_001368.2	Q8NCM8	DYHC2_HUMAN	dynein, cytoplasmic 2, heavy chain 1	922	Stem. {ECO:0000250}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|asymmetric protein localization (GO:0008105)|cilium assembly (GO:0042384)|determination of left/right symmetry (GO:0007368)|dorsal/ventral pattern formation (GO:0009953)|embryonic limb morphogenesis (GO:0030326)|forebrain development (GO:0030900)|Golgi organization (GO:0007030)|intraciliary retrograde transport (GO:0035721)|positive regulation of smoothened signaling pathway (GO:0045880)|protein processing (GO:0016485)|spinal cord motor neuron differentiation (GO:0021522)	apical part of cell (GO:0045177)|axoneme (GO:0005930)|cytosol (GO:0005829)|dynein complex (GO:0030286)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|motile primary cilium (GO:0031512)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			NS(1)|endometrium(4)|kidney(5)|large_intestine(9)|lung(9)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)	33		Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.00348)		BRCA - Breast invasive adenocarcinoma(274;0.000177)|Epithelial(105;0.0785)		ATTGATGATCTCATCCAGAAG	0.303																																					p.L922P		Atlas-SNP	.											.	DYNC2H1	246	.	0			c.T2765C						.						120.0	116.0	117.0					11																	103018563		1839	4078	5917	SO:0001583	missense	79659	exon19			ATGATCTCATCCA	AB082528	CCDS44717.1, CCDS53701.1	11q21-q22.1	2011-06-02	2005-11-24	2005-11-24	ENSG00000187240	ENSG00000187240		"""Cytoplasmic dyneins"""	2962	protein-coding gene	gene with protein product		603297	"""dynein, cytoplasmic, heavy polypeptide 2"""	DNCH2		9763680, 9373155	Standard	NM_001080463		Approved	hdhc11, DHC2, DHC1b, DYH1B	uc001phn.1	Q8NCM8	OTTHUMG00000165941	ENST00000375735.2:c.2765T>C	chr11.hg19:g.103018563T>C	ENSP00000364887:p.Leu922Pro	41.0	0.0		64.0	4.0	NM_001377	O00432|Q16693|Q3C1U8|Q4AC93|Q6ZMX7|Q6ZUM6|Q7Z363|Q8N977|Q92815|Q9HAE4	Missense_Mutation	SNP	ENST00000375735.2	hg19	CCDS53701.1	.	.	.	.	.	.	.	.	.	.	T	17.45	3.393574	0.62066	.	.	ENSG00000187240	ENST00000375735;ENST00000398093	T;T	0.28895	1.59;1.59	5.49	5.49	0.81192	.	0.385199	0.20577	U	0.089603	T	0.48295	0.1492	M	0.71581	2.175	0.80722	D	1	P;P	0.39576	0.679;0.619	P;P	0.51355	0.466;0.667	T	0.32929	-0.9888	10	0.29301	T	0.29	.	15.8882	0.79269	0.0:0.0:0.0:1.0	.	922;922	Q8NCM8;Q8NCM8-2	DYHC2_HUMAN;.	P	922	ENSP00000364887:L922P;ENSP00000381167:L922P	ENSP00000364887:L922P	L	+	2	0	DYNC2H1	102523773	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.619000	0.83057	2.220000	0.72140	0.528000	0.53228	CTC	.	.		0.303	DYNC2H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387196.1	XM_370652	
SNX19	399979	hgsc.bcm.edu	37	11	130780180	130780180	+	Silent	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr11:130780180T>C	ENST00000265909.4	-	3	2468	c.1899A>G	c.(1897-1899)ctA>ctG	p.L633L	SNX19_ENST00000528555.1_Silent_p.L13L|SNX19_ENST00000530356.1_Silent_p.L13L|SNX19_ENST00000545537.1_5'UTR|SNX19_ENST00000539184.1_Silent_p.L76L|SNX19_ENST00000533214.1_Silent_p.L633L|SNX19_ENST00000534726.1_5'Flank|SNX19_ENST00000533318.1_5'UTR	NM_014758.2	NP_055573	Q92543	SNX19_HUMAN	sorting nexin 19	633	PX. {ECO:0000255|PROSITE- ProRule:PRU00147}.				protein transport (GO:0015031)	cytoplasmic vesicle (GO:0031410)|membrane (GO:0016020)	phosphatidylinositol binding (GO:0035091)			central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(8)|ovary(3)|prostate(1)|skin(6)|urinary_tract(1)	35	all_hematologic(175;0.0597)	Lung NSC(97;0.000272)|all_lung(97;0.000608)|Breast(109;0.000962)|all_neural(223;0.0298)|Medulloblastoma(222;0.0425)		OV - Ovarian serous cystadenocarcinoma(99;0.0195)|Lung(977;0.233)		GGAATGATTCTAGGAGGCTCT	0.448																																					p.L633L		Atlas-SNP	.											SNX19,NS,carcinoma,0,1	SNX19	84	.	0			c.A1899G						.						91.0	91.0	91.0					11																	130780180		2201	4296	6497	SO:0001819	synonymous_variant	399979	exon3			TGATTCTAGGAGG	D87443	CCDS31721.1, CCDS73416.1	11q25	2010-04-20			ENSG00000120451	ENSG00000120451		"""Sorting nexins"""	21532	protein-coding gene	gene with protein product							Standard	NM_014758		Approved	KIAA0254, CHET8	uc001qgk.4	Q92543	OTTHUMG00000165663	ENST00000265909.4:c.1899A>G	chr11.hg19:g.130780180T>C		66.0	0.0		47.0	2.0	NM_014758	E9PKB9|Q8IV55	Silent	SNP	ENST00000265909.4	hg19	CCDS31721.1																																																																																			.	.		0.448	SNX19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385649.1	NM_014758	
CACNA1C	775	hgsc.bcm.edu	37	12	2764398	2764398	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr12:2764398T>C	ENST00000347598.4	+	36	4370	c.4370T>C	c.(4369-4371)cTc>cCc	p.L1457P	CACNA1C_ENST00000402845.3_Missense_Mutation_p.L1409P|CACNA1C_ENST00000399601.1_Missense_Mutation_p.L1409P|CACNA1C_ENST00000344100.3_Missense_Mutation_p.L1431P|CACNA1C_ENST00000399655.1_Missense_Mutation_p.L1409P|CACNA1C_ENST00000399644.1_Missense_Mutation_p.L1409P|CACNA1C_ENST00000399597.1_Missense_Mutation_p.L1409P|CACNA1C_ENST00000399591.1_Missense_Mutation_p.L1398P|CACNA1C_ENST00000399637.1_Missense_Mutation_p.L1409P|CACNA1C_ENST00000399629.1_Missense_Mutation_p.L1426P|CACNA1C_ENST00000399621.1_Missense_Mutation_p.L1409P|CACNA1C_ENST00000327702.7_Missense_Mutation_p.L1409P|CACNA1C_ENST00000399649.1_Missense_Mutation_p.L1396P|CACNA1C_ENST00000406454.3_Missense_Mutation_p.L1409P|CACNA1C_ENST00000399603.1_Missense_Mutation_p.L1409P|CACNA1C_ENST00000399638.1_Missense_Mutation_p.L1437P|CACNA1C_ENST00000399641.1_Missense_Mutation_p.L1409P|CACNA1C_ENST00000399634.1_Missense_Mutation_p.L1409P|CACNA1C_ENST00000399606.1_Missense_Mutation_p.L1429P|CACNA1C_ENST00000399617.1_Missense_Mutation_p.L1409P|CACNA1C_ENST00000399595.1_Missense_Mutation_p.L1398P|CACNA1C_ENST00000335762.5_Missense_Mutation_p.L1434P	NM_001129827.1|NM_199460.2	NP_001123299.1|NP_955630.2	Q13936	CAC1C_HUMAN	calcium channel, voltage-dependent, L type, alpha 1C subunit	1457					adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transport into cytosol (GO:0060402)|calcium ion-dependent exocytosis (GO:0017156)|calcium-mediated signaling using extracellular calcium source (GO:0035585)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|energy reserve metabolic process (GO:0006112)|glucose homeostasis (GO:0042593)|growth hormone secretion (GO:0030252)|insulin secretion (GO:0030073)|membrane depolarization during action potential (GO:0086010)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of blood pressure (GO:0008217)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of insulin secretion (GO:0050796)|regulation of organ growth (GO:0046620)|regulation of vasoconstriction (GO:0019229)|small molecule metabolic process (GO:0044281)|smooth muscle contraction involved in micturition (GO:0060083)|synaptic transmission (GO:0007268)|visual learning (GO:0008542)	caveolar macromolecular signaling complex (GO:0002095)|cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|voltage-gated calcium channel complex (GO:0005891)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|calmodulin binding (GO:0005516)|high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			NS(3)|breast(4)|central_nervous_system(4)|cervix(2)|endometrium(12)|kidney(9)|large_intestine(20)|lung(55)|ovary(10)|pancreas(1)|prostate(5)|skin(3)|upper_aerodigestive_tract(4)	132			OV - Ovarian serous cystadenocarcinoma(31;0.00256)	LUAD - Lung adenocarcinoma(1;0.134)	Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Drotaverine(DB06751)|Felodipine(DB01023)|Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	GTGCTGCTCCTCTTCAGGTGG	0.532																																					p.L1457P		Atlas-SNP	.											.	CACNA1C	1023	.	0			c.T4370C						.						77.0	81.0	80.0					12																	2764398		2124	4264	6388	SO:0001583	missense	775	exon36			TGCTCCTCTTCAG	AF070589	CCDS44787.1, CCDS44788.1, CCDS44789.1, CCDS44790.1, CCDS44791.1, CCDS44792.1, CCDS44793.1, CCDS44794.1, CCDS44795.1, CCDS44796.1, CCDS44797.1, CCDS44798.1, CCDS44799.1, CCDS44800.1, CCDS44801.1, CCDS53733.1, CCDS53734.1, CCDS53735.1, CCDS53736.1	12p13.3	2014-09-17			ENSG00000151067	ENSG00000151067		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1390	protein-coding gene	gene with protein product		114205		CCHL1A1, CACNL1A1		1650913, 16382099	Standard	NM_001129832		Approved	Cav1.2, CACH2, CACN2, TS, LQT8	uc001qjy.3	Q13936	OTTHUMG00000150243	ENST00000347598.4:c.4370T>C	chr12.hg19:g.2764398T>C	ENSP00000266376:p.Leu1457Pro	92.0	0.0		91.0	4.0	NM_199460	B2RUT3|E9PDJ0|Q13917|Q13918|Q13919|Q13920|Q13921|Q13922|Q13923|Q13924|Q13925|Q13926|Q13927|Q13928|Q13929|Q13930|Q13932|Q13933|Q14743|Q14744|Q15877|Q4VMI7|Q4VMI8|Q4VMI9|Q6PKM7|Q8N6C0|Q99025|Q99241|Q99875	Missense_Mutation	SNP	ENST00000347598.4	hg19	CCDS44788.1	.	.	.	.	.	.	.	.	.	.	T	21.1	4.097917	0.76870	.	.	ENSG00000151067	ENST00000335762;ENST00000399655;ENST00000399644;ENST00000399638;ENST00000399597;ENST00000399621;ENST00000399637;ENST00000399591;ENST00000399641;ENST00000347598;ENST00000399606;ENST00000399601;ENST00000344100;ENST00000399629;ENST00000327702;ENST00000399649;ENST00000402845;ENST00000399603;ENST00000399634;ENST00000399617;ENST00000406454;ENST00000399595;ENST00000322367	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.97731	-4.51;-4.51;-4.51;-4.51;-4.51;-4.51;-4.51;-4.51;-4.51;-4.51;-4.51;-4.51;-4.51;-4.51;-4.51;-4.51;-4.51;-4.51;-4.51;-4.51;-4.51;-4.51	3.96	3.96	0.45880	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.99239	0.9735	H	0.98883	4.36	0.80722	D	1	D;D;D;D;D;D;D;D;P;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.89917	0.995;0.999;1.0;0.995;0.999;0.999;1.0;0.999;0.837;1.0;0.999;1.0;1.0;0.999;1.0;0.999;0.999;0.972;1.0;0.984;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D;D;P;D;D;D;D;D;D;D;D;D;D;P;D;D;D;D;D	0.97110	0.932;0.998;0.996;0.949;0.998;0.996;0.996;0.997;0.832;0.999;0.996;0.996;1.0;1.0;0.999;0.998;0.996;0.914;0.999;0.843;0.996;0.999;0.999;0.996;0.996	D	0.98459	1.0595	10	0.87932	D	0	.	13.3114	0.60382	0.0:0.0:0.0:1.0	.	100;1431;1406;1457;1409;1409;1409;1426;1437;1409;1429;1409;1369;1457;1409;1409;1409;1398;1396;1398;1398;1409;1409;1409;1409	B7Z7Z5;Q13936-14;Q13936-35;Q13936;Q13936-33;Q13936-13;Q13936-22;Q13936-32;Q13936-31;Q13936-21;Q13936-30;Q13936-23;Q13936-28;Q13936-11;E9PDJ1;E9PDJ0;F5GY28;Q13936-25;Q13936-15;Q13936-29;Q13936-19;Q13936-24;Q13936-27;Q13936-20;Q13936-12	.;.;.;CAC1C_HUMAN;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.	P	1434;1409;1409;1437;1409;1409;1409;1398;1409;1457;1429;1409;1431;1426;1409;1396;1409;1409;1409;1409;1409;1398;1239	ENSP00000336982:L1434P;ENSP00000382563:L1409P;ENSP00000382552:L1409P;ENSP00000382547:L1437P;ENSP00000382506:L1409P;ENSP00000382530:L1409P;ENSP00000382546:L1409P;ENSP00000382500:L1398P;ENSP00000382549:L1409P;ENSP00000266376:L1457P;ENSP00000382515:L1429P;ENSP00000382510:L1409P;ENSP00000341092:L1431P;ENSP00000382537:L1426P;ENSP00000329877:L1409P;ENSP00000382557:L1396P;ENSP00000385724:L1409P;ENSP00000382512:L1409P;ENSP00000382542:L1409P;ENSP00000382526:L1409P;ENSP00000385896:L1409P;ENSP00000382504:L1398P	ENSP00000323129:L1239P	L	+	2	0	CACNA1C	2634659	1.000000	0.71417	0.997000	0.53966	0.959000	0.62525	7.821000	0.86641	1.780000	0.52325	0.459000	0.35465	CTC	.	.		0.532	CACNA1C-017	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000317035.1	NM_000719	
CLECL1	160365	hgsc.bcm.edu	37	12	9885707	9885707	+	Missense_Mutation	SNP	A	A	T	rs71929655|rs113575400|rs113222621|rs71045297|rs398070028		TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr12:9885707A>T	ENST00000327839.3	-	1	188	c.154T>A	c.(154-156)Tca>Aca	p.S52T		NM_172004.3	NP_742001.1	Q8IZS7	CLCL1_HUMAN	C-type lectin-like 1	52						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)	p.S52fs*26(1)		breast(1)|kidney(1)|large_intestine(4)|lung(3)	9						GAAACTTCTGATAAGTAAATT	0.403																																					p.S52T		Atlas-SNP	.											.,2	CLECL1	18	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.T154A						.						76.0	79.0	78.0					12																	9885707		2203	4300	6503	SO:0001583	missense	160365	exon1			CTTCTGATAAGTA	AF518873	CCDS8603.1, CCDS73441.1	12p13.31	2007-06-21				ENSG00000184293			24462	protein-coding gene	gene with protein product	"""dendritic cell associated lectin 1"""	607467				12421943	Standard	NM_172004		Approved	DCAL1	uc001qwi.3	Q8IZS7		ENST00000327839.3:c.154T>A	chr12.hg19:g.9885707A>T	ENSP00000331766:p.Ser52Thr	108.0	0.0		99.0	9.0	NM_001267701		Missense_Mutation	SNP	ENST00000327839.3	hg19	CCDS8603.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	7.803|7.803	0.714090|0.714090	0.15306|0.15306	.|.	.|.	ENSG00000184293|ENSG00000184293	ENST00000327839|ENST00000542530	T|.	0.54071|.	0.59|.	1.85|1.85	1.85|1.85	0.25348|0.25348	.|.	.|.	.|.	.|.	.|.	T|.	0.15739|.	0.0379|.	N|N	0.08118|0.08118	0|0	0.09310|0.09310	N|N	1|1	B|.	0.06786|.	0.001|.	B|.	0.01281|.	0.0|.	T|.	0.24799|.	-1.0150|.	8|.	.|.	.|.	.|.	.|.	4.4866|4.4866	0.11792|0.11792	0.1978:0.0:0.8022:0.0|0.1978:0.0:0.8022:0.0	.|.	52|.	Q8IZS7|.	CLCL1_HUMAN|.	T|X	52|3	ENSP00000331766:S52T|.	.|.	S|Y	-|-	1|3	0|2	CLECL1|CLECL1	9776974|9776974	0.000000|0.000000	0.05858|0.05858	0.001000|0.001000	0.08648|0.08648	0.036000|0.036000	0.12997|0.12997	-0.740000|-0.740000	0.04861|0.04861	0.333000|0.333000	0.23563|0.23563	-0.131000|-0.131000	0.14894|0.14894	TCA|TAT	.	T|1.000;|0.000		0.403	CLECL1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399815.1	NM_172004	
CLECL1	160365	hgsc.bcm.edu	37	12	9885713	9885713	+	Missense_Mutation	SNP	A	A	T	rs200639830		TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr12:9885713A>T	ENST00000327839.3	-	1	182	c.148T>A	c.(148-150)Tac>Aac	p.Y50N		NM_172004.3	NP_742001.1	Q8IZS7	CLCL1_HUMAN	C-type lectin-like 1	50						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)			breast(1)|kidney(1)|large_intestine(4)|lung(3)	9						TCTGATAAGTAAATTGAGATG	0.403																																					p.Y50N		Atlas-SNP	.											.	CLECL1	18	.	0			c.T148A						.						77.0	80.0	79.0					12																	9885713		2203	4300	6503	SO:0001583	missense	160365	exon1			ATAAGTAAATTGA	AF518873	CCDS8603.1, CCDS73441.1	12p13.31	2007-06-21				ENSG00000184293			24462	protein-coding gene	gene with protein product	"""dendritic cell associated lectin 1"""	607467				12421943	Standard	NM_172004		Approved	DCAL1	uc001qwi.3	Q8IZS7		ENST00000327839.3:c.148T>A	chr12.hg19:g.9885713A>T	ENSP00000331766:p.Tyr50Asn	110.0	0.0		103.0	9.0	NM_001267701		Missense_Mutation	SNP	ENST00000327839.3	hg19	CCDS8603.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	6.915|6.915	0.538458|0.538458	0.13250|0.13250	.|.	.|.	ENSG00000184293|ENSG00000184293	ENST00000542530|ENST00000327839	.|T	.|0.56275	.|0.47	1.86|1.86	0.666|0.666	0.17901|0.17901	.|.	.|.	.|.	.|.	.|.	T|T	0.21590|0.21590	0.0520|0.0520	N|N	0.03608|0.03608	-0.345|-0.345	0.09310|0.09310	N|N	1|1	.|P	.|0.51147	.|0.942	.|B	.|0.39217	.|0.294	T|T	0.08027|0.08027	-1.0742|-1.0742	5|8	.|.	.|.	.|.	.|.	3.7406|3.7406	0.08528|0.08528	0.7983:0.0:0.2017:0.0|0.7983:0.0:0.2017:0.0	.|.	.|50	.|Q8IZS7	.|CLCL1_HUMAN	L|N	1|50	.|ENSP00000331766:Y50N	.|.	F|Y	-|-	3|1	2|0	CLECL1|CLECL1	9776980|9776980	0.002000|0.002000	0.14202|0.14202	0.001000|0.001000	0.08648|0.08648	0.004000|0.004000	0.04260|0.04260	1.812000|1.812000	0.38952|0.38952	0.170000|0.170000	0.19704|0.19704	-0.463000|-0.463000	0.05309|0.05309	TTT|TAC	.	.		0.403	CLECL1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399815.1	NM_172004	
SLCO1B3	28234	hgsc.bcm.edu	37	12	21068948	21068948	+	Silent	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr12:21068948T>C	ENST00000381545.3	+	16	2095	c.1876T>C	c.(1876-1878)Ttg>Ctg	p.L626L	SLCO1B7_ENST00000554957.1_Intron|LST3_ENST00000381541.3_Intron|SLCO1B3_ENST00000553473.1_Intron|SLCO1B3_ENST00000261196.2_Silent_p.L626L|LST3_ENST00000540229.1_Intron	NM_019844.3	NP_062818.1	Q9NPD5	SO1B3_HUMAN	solute carrier organic anion transporter family, member 1B3	626					bile acid and bile salt transport (GO:0015721)|bile acid metabolic process (GO:0008206)|organic anion transport (GO:0015711)|small molecule metabolic process (GO:0044281)|sodium-independent organic anion transport (GO:0043252)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	organic anion transmembrane transporter activity (GO:0008514)			breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(23)|ovary(2)|prostate(2)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(2)	63	Esophageal squamous(101;0.149)				Atorvastatin(DB01076)|Cabazitaxel(DB06772)|Caspofungin(DB00520)|Conjugated Estrogens(DB00286)|Dabrafenib(DB08912)|Digoxin(DB00390)|Docetaxel(DB01248)|Estradiol(DB00783)|Fexofenadine(DB00950)|Fluvastatin(DB01095)|Gadoxetate(DB08884)|Levothyroxine(DB00451)|Liothyronine(DB00279)|Liotrix(DB01583)|Methotrexate(DB00563)|Mycophenolate mofetil(DB00688)|Olmesartan(DB00275)|Ouabain(DB01092)|Paclitaxel(DB01229)|Pioglitazone(DB01132)|Pitavastatin(DB08860)|Pravastatin(DB00175)|Rifampicin(DB01045)|Rilpivirine(DB08864)|Rosuvastatin(DB01098)|Valsartan(DB00177)	AAGGGTCTACTTGGGCTTATC	0.299																																					p.L626L		Atlas-SNP	.											.	SLCO1B3	151	.	0			c.T1876C						.						77.0	77.0	77.0					12																	21068948		2201	4299	6500	SO:0001819	synonymous_variant	28234	exon16			GTCTACTTGGGCT		CCDS8684.1	12p12	2013-05-22	2003-11-25	2003-11-26		ENSG00000111700		"""Solute carriers"""	10961	protein-coding gene	gene with protein product		605495	"""solute carrier family 21 (organic anion transporter), member 8"""	SLC21A8			Standard	NM_019844		Approved	OATP8, OATP1B3	uc001rel.4	Q9NPD5	OTTHUMG00000169011	ENST00000381545.3:c.1876T>C	chr12.hg19:g.21068948T>C		59.0	0.0		58.0	5.0	NM_019844	E7EMT8|Q5JAR4	Silent	SNP	ENST00000381545.3	hg19	CCDS8684.1																																																																																			.	.		0.299	SLCO1B3-001	KNOWN	upstream_ATG|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000401936.1	NM_019844	
IPO8	10526	hgsc.bcm.edu	37	12	30814173	30814173	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr12:30814173T>C	ENST00000256079.4	-	16	2121	c.1783A>G	c.(1783-1785)Agt>Ggt	p.S595G	IPO8_ENST00000544829.1_Missense_Mutation_p.S390G	NM_006390.3	NP_006381.2	O15397	IPO8_HUMAN	importin 8	595					intracellular protein transport (GO:0006886)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	Ran GTPase binding (GO:0008536)	p.S595C(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(16)|liver(1)|lung(22)|prostate(2)|skin(2)|urinary_tract(2)	52	all_lung(12;6.66e-10)|Lung NSC(12;4.84e-08)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0355)|Lung SC(12;0.0905)|Esophageal squamous(101;0.233)					TATTCATCACTTTGAAGAACT	0.328																																					p.S595G		Atlas-SNP	.											IPO8,NS,carcinoma,0,1	IPO8	105	.	1	Substitution - Missense(1)	lung(1)	c.A1783G						.						110.0	105.0	106.0					12																	30814173		2201	4300	6501	SO:0001583	missense	10526	exon16			CATCACTTTGAAG	U77494	CCDS8719.1, CCDS53773.1	12p11.21	2011-05-23	2003-03-11	2003-03-14	ENSG00000133704	ENSG00000133704		"""Importins"""	9853	protein-coding gene	gene with protein product		605600	"""RAN binding protein 8"""	RANBP8		9214382	Standard	NM_006390		Approved	IMP8	uc001rjd.3	O15397	OTTHUMG00000169172	ENST00000256079.4:c.1783A>G	chr12.hg19:g.30814173T>C	ENSP00000256079:p.Ser595Gly	70.0	0.0		45.0	2.0	NM_006390	B7Z7M3	Missense_Mutation	SNP	ENST00000256079.4	hg19	CCDS8719.1	.	.	.	.	.	.	.	.	.	.	T	16.56	3.156055	0.57259	.	.	ENSG00000133704	ENST00000256079;ENST00000545286;ENST00000544829	T;T	0.68025	-0.3;-0.3	4.42	4.42	0.53409	Armadillo-like helical (1);Armadillo-type fold (1);	0.042986	0.85682	D	0.000000	T	0.72423	0.3458	L	0.48642	1.525	0.80722	D	1	B;D;B	0.61697	0.055;0.99;0.026	B;P;B	0.58820	0.075;0.846;0.02	T	0.74100	-0.3774	10	0.49607	T	0.09	-11.8667	13.9505	0.64113	0.0:0.0:0.0:1.0	.	390;71;595	B7Z7M3;Q59F59;O15397	.;.;IPO8_HUMAN	G	595;71;390	ENSP00000256079:S595G;ENSP00000444520:S390G	ENSP00000256079:S595G	S	-	1	0	IPO8	30705440	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	7.424000	0.80242	1.748000	0.51833	0.402000	0.26972	AGT	.	.		0.328	IPO8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402700.2	NM_006390	
TMEM106C	79022	hgsc.bcm.edu	37	12	48359893	48359893	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr12:48359893T>C	ENST00000429772.2	+	5	546	c.433T>C	c.(433-435)Tcc>Ccc	p.S145P	TMEM106C_ENST00000552561.1_Missense_Mutation_p.S145P|TMEM106C_ENST00000552546.1_Missense_Mutation_p.S74P|TMEM106C_ENST00000549288.1_Intron|TMEM106C_ENST00000449758.2_Missense_Mutation_p.S145P|TMEM106C_ENST00000256686.6_Missense_Mutation_p.S145P|TMEM106C_ENST00000550552.1_Missense_Mutation_p.S145P	NM_001143842.1	NP_001137314.1	Q9BVX2	T106C_HUMAN	transmembrane protein 106C	145						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(6)|skin(3)|upper_aerodigestive_tract(1)	14		Acute lymphoblastic leukemia(13;0.11)		GBM - Glioblastoma multiforme(48;0.241)		AATCAGGAACTCCAACTTCTA	0.512																																					p.S145P		Atlas-SNP	.											.	TMEM106C	24	.	0			c.T433C						.						109.0	93.0	98.0					12																	48359893		2203	4300	6503	SO:0001583	missense	79022	exon5			AGGAACTCCAACT	BC000854	CCDS8758.1, CCDS44867.1	12q13.1	2005-12-19				ENSG00000134291			28775	protein-coding gene	gene with protein product							Standard	NM_024056		Approved	MGC5576	uc001rqr.3	Q9BVX2	OTTHUMG00000169892	ENST00000429772.2:c.433T>C	chr12.hg19:g.48359893T>C	ENSP00000400471:p.Ser145Pro	122.0	0.0		94.0	4.0	NM_001143843	B2R998|B7Z5M4|Q3B761	Missense_Mutation	SNP	ENST00000429772.2	hg19	CCDS8758.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	12.98|12.98	2.101176|2.101176	0.37048|0.37048	.|.	.|.	ENSG00000134291|ENSG00000134291	ENST00000547682|ENST00000256686;ENST00000552561;ENST00000546749;ENST00000552546;ENST00000550552;ENST00000429772;ENST00000449758;ENST00000548640	.|T;T;T;T;T;T;T;T	.|0.26518	.|1.73;3.67;1.73;3.67;1.73;3.67;1.73;1.73	4.68|4.68	3.52|3.52	0.40303|0.40303	.|.	.|0.129485	.|0.53938	.|D	.|0.000049	T|T	0.21509|0.21509	0.0518|0.0518	L|L	0.45137|0.45137	1.4|1.4	0.49687|0.49687	D|D	0.999811|0.999811	.|B;B	.|0.28605	.|0.217;0.181	.|B;B	.|0.30855	.|0.121;0.074	T|T	0.03887|0.03887	-1.0995|-1.0995	5|10	.|0.23302	.|T	.|0.38	1.8348|1.8348	11.2577|11.2577	0.49063|0.49063	0.0:0.0:0.1535:0.8465|0.0:0.0:0.1535:0.8465	.|.	.|145;145	.|Q9BVX2;Q9BVX2-2	.|T106C_HUMAN;.	P|P	31|145;145;9;74;145;145;145;74	.|ENSP00000256686:S145P;ENSP00000446657:S145P;ENSP00000446622:S9P;ENSP00000448268:S74P;ENSP00000449737:S145P;ENSP00000400471:S145P;ENSP00000402705:S145P;ENSP00000447254:S74P	.|ENSP00000256686:S145P	L|S	+|+	2|1	0|0	TMEM106C|TMEM106C	46646160|46646160	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.911000|0.911000	0.54048|0.54048	2.537000|2.537000	0.45702|0.45702	1.096000|1.096000	0.41439|0.41439	0.533000|0.533000	0.62120|0.62120	CTC|TCC	.	.		0.512	TMEM106C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406452.1	NM_024056	
COL2A1	1280	hgsc.bcm.edu	37	12	48372091	48372091	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr12:48372091C>T	ENST00000380518.3	-	43	3150	c.2986G>A	c.(2986-2988)Ggc>Agc	p.G996S	COL2A1_ENST00000337299.6_Missense_Mutation_p.G927S|COL2A1_ENST00000493991.1_5'UTR	NM_001844.4|NM_033150.2	NP_001835.3|NP_149162.2	P02458	CO2A1_HUMAN	collagen, type II, alpha 1	996	Triple-helical region.				axon guidance (GO:0007411)|cartilage condensation (GO:0001502)|cartilage development (GO:0051216)|cartilage development involved in endochondral bone morphogenesis (GO:0060351)|cellular response to BMP stimulus (GO:0071773)|central nervous system development (GO:0007417)|chondrocyte differentiation (GO:0002062)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|embryonic skeletal joint morphogenesis (GO:0060272)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|heart morphogenesis (GO:0003007)|inner ear morphogenesis (GO:0042472)|limb bud formation (GO:0060174)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|notochord development (GO:0030903)|otic vesicle development (GO:0071599)|palate development (GO:0060021)|proteoglycan metabolic process (GO:0006029)|regulation of gene expression (GO:0010468)|sensory perception of sound (GO:0007605)|skeletal system development (GO:0001501)|tissue homeostasis (GO:0001894)|visual perception (GO:0007601)	basement membrane (GO:0005604)|collagen type II trimer (GO:0005585)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(9)|lung(25)|ovary(1)|prostate(1)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(3)	64		Acute lymphoblastic leukemia(13;0.108)|all_hematologic(14;0.214)			Collagenase(DB00048)	CCAGGCAAGCCAGGGAATCCT	0.647																																					p.G996S		Atlas-SNP	.											.	COL2A1	368	.	0			c.G2986A						.						133.0	80.0	98.0					12																	48372091		2203	4300	6503	SO:0001583	missense	1280	exon43			GCAAGCCAGGGAA	X16468	CCDS8759.1, CCDS41778.1	12q12-q13.2	2013-11-14	2008-02-04		ENSG00000139219	ENSG00000139219		"""Collagens"""	2200	protein-coding gene	gene with protein product		120140	"""collagen, type II, alpha 1 (primary osteoarthritis, spondyloepiphyseal dysplasia, congenital)"", ""arthroophthalmopathy, progressive (Stickler syndrome)"""	SEDC, AOM		1677770	Standard	NM_033150		Approved	STL1	uc001rqu.3	P02458	OTTHUMG00000149896	ENST00000380518.3:c.2986G>A	chr12.hg19:g.48372091C>T	ENSP00000369889:p.Gly996Ser	143.0	0.0		91.0	4.0	NM_001844	A6NGA0|Q12985|Q14009|Q14044|Q14045|Q14046|Q14047|Q14056|Q14058|Q16672|Q1JQ82|Q2V4X7|Q6LBY1|Q6LBY2|Q6LBY3|Q96IT5|Q99227|Q9UE38|Q9UE39|Q9UE40|Q9UE41|Q9UE42|Q9UE43	Missense_Mutation	SNP	ENST00000380518.3	hg19	CCDS41778.1	.	.	.	.	.	.	.	.	.	.	C	18.68	3.676915	0.67928	.	.	ENSG00000139219	ENST00000380518;ENST00000395281;ENST00000337299	D;D	0.99527	-6.09;-6.09	5.44	5.44	0.79542	.	0.000000	0.85682	D	0.000000	D	0.99806	0.9916	H	0.99336	4.52	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.91635	0.999;0.998	D	0.96694	0.9513	10	0.87932	D	0	.	18.8574	0.92259	0.0:1.0:0.0:0.0	.	927;996	P02458-1;P02458	.;CO2A1_HUMAN	S	996;927;927	ENSP00000369889:G996S;ENSP00000338213:G927S	ENSP00000338213:G927S	G	-	1	0	COL2A1	46658358	1.000000	0.71417	0.949000	0.38748	0.336000	0.28762	7.751000	0.85126	2.550000	0.86006	0.462000	0.41574	GGC	.	.		0.647	COL2A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313810.2	NM_001844	
ATF7	11016	hgsc.bcm.edu	37	12	53911113	53911113	+	Silent	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr12:53911113T>C	ENST00000548446.2	-	12	1405	c.1293A>G	c.(1291-1293)ccA>ccG	p.P431P	ATF7_ENST00000328463.7_Silent_p.P431P|ATF7_ENST00000415113.1_Silent_p.P399P|ATF7_ENST00000546661.1_5'UTR|RP11-793H13.3_ENST00000548347.1_RNA|RP11-793H13.10_ENST00000591834.1_Intron|ATF7_ENST00000420353.2_Silent_p.P420P|ATF7_ENST00000456903.4_Silent_p.P420P			P17544	ATF7_HUMAN	activating transcription factor 7	431	Essential for binding adenovirus 2 E1A.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nuclear periphery (GO:0034399)|nucleus (GO:0005634)	enzyme binding (GO:0019899)|metal ion binding (GO:0046872)|mitogen-activated protein kinase binding (GO:0051019)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			endometrium(2)|kidney(1)|large_intestine(2)|lung(1)|ovary(1)|skin(1)|urinary_tract(1)	9					Pseudoephedrine(DB00852)	GAGAACCCGTTGGCTCTGAGC	0.557																																					p.P420P		Atlas-SNP	.											.	ATF7	51	.	0			c.A1260G						.						57.0	60.0	59.0					12																	53911113		1986	4167	6153	SO:0001819	synonymous_variant	11016	exon12			ACCCGTTGGCTCT	X52943	CCDS44906.1, CCDS58238.1	12q13	2013-01-10				ENSG00000170653		"""basic leucine zipper proteins"""	792	protein-coding gene	gene with protein product		606371				1694576, 11278933	Standard	NM_006856		Approved	ATFA	uc001sdz.3	P17544	OTTHUMG00000169776	ENST00000548446.2:c.1293A>G	chr12.hg19:g.53911113T>C		144.0	0.0		89.0	4.0	NM_006856	A5D6Y4|B2RMP1|B4DQL4|Q13814|Q8IVR8|Q9UD83	Silent	SNP	ENST00000548446.2	hg19																																																																																				.	.		0.557	ATF7-007	KNOWN	NMD_exception|basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000406302.2	NM_001130059	
DTX3	196403	hgsc.bcm.edu	37	12	58001168	58001168	+	Silent	SNP	C	C	T			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr12:58001168C>T	ENST00000548198.1	+	3	2026	c.522C>T	c.(520-522)gcC>gcT	p.A174A	DTX3_ENST00000548804.1_Silent_p.A174A|DTX3_ENST00000551632.1_Silent_p.A177A|ARHGEF25_ENST00000333972.7_5'Flank|DTX3_ENST00000337737.3_Silent_p.A174A			Q8N9I9	DTX3_HUMAN	deltex 3, E3 ubiquitin ligase	174					Notch signaling pathway (GO:0007219)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|large_intestine(1)|lung(6)|urinary_tract(1)	12	Melanoma(17;0.122)					TCCAGAATGCCAAGACATTGG	0.632																																					p.A174A		Atlas-SNP	.											.	DTX3	27	.	0			c.C522T						.						21.0	23.0	22.0					12																	58001168		1917	4113	6030	SO:0001819	synonymous_variant	196403	exon5			GAATGCCAAGACA	AK094385	CCDS41800.1, CCDS66410.1	12q13.2	2014-01-28	2014-01-28			ENSG00000178498		"""RING-type (C3HC4) zinc fingers"""	24457	protein-coding gene	gene with protein product		613142	"""deltex 3 homolog (Drosophila)"", ""deltex homolog 3 (Drosophila)"""			12670957	Standard	XM_005268697		Approved	FLJ34766, RNF154	uc001sow.1	Q8N9I9		ENST00000548198.1:c.522C>T	chr12.hg19:g.58001168C>T		189.0	0.0		123.0	5.0	NM_178502	Q53ZZ2|Q8NAU6|Q8NDS8	Silent	SNP	ENST00000548198.1	hg19	CCDS41800.1																																																																																			.	.		0.632	DTX3-003	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000407848.1	NM_178502	
USP15	9958	hgsc.bcm.edu	37	12	62790141	62790141	+	Silent	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr12:62790141T>C	ENST00000280377.5	+	20	2695	c.2637T>C	c.(2635-2637)gcT>gcC	p.A879A	USP15_ENST00000353364.3_Silent_p.A850A|USP15_ENST00000393654.3_Silent_p.A854A	NM_001252078.1	NP_001239007.1	Q9Y4E8	UBP15_HUMAN	ubiquitin specific peptidase 15	879	USP.				BMP signaling pathway (GO:0030509)|monoubiquitinated protein deubiquitination (GO:0035520)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|protein deubiquitination (GO:0016579)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|identical protein binding (GO:0042802)|SMAD binding (GO:0046332)|transforming growth factor beta receptor binding (GO:0005160)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(5)|large_intestine(8)|lung(15)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)	37			GBM - Glioblastoma multiforme(1;0.000276)	GBM - Glioblastoma multiforme(28;0.0622)		ATCTGATTGCTGTTTCCAACC	0.378																																					p.A879A	Melanoma(181;615 2041 39364 49691 50001)	Atlas-SNP	.											.	USP15	105	.	0			c.T2637C						.						127.0	117.0	120.0					12																	62790141		2203	4300	6503	SO:0001819	synonymous_variant	9958	exon20			GATTGCTGTTTCC	AB011101	CCDS8963.1, CCDS58250.1, CCDS58251.1	12q14	2006-07-18	2005-08-08					"""Ubiquitin-specific peptidases"""	12613	protein-coding gene	gene with protein product		604731	"""ubiquitin specific protease 15"""			12838346	Standard	NM_001252078		Approved	KIAA0529, UNPH4	uc001src.2	Q9Y4E8	OTTHUMG00000170186	ENST00000280377.5:c.2637T>C	chr12.hg19:g.62790141T>C		124.0	0.0		75.0	6.0	NM_001252078	Q08AL5|Q9H8G9|Q9HCA6|Q9UNP0|Q9Y5B5	Silent	SNP	ENST00000280377.5	hg19	CCDS58251.1																																																																																			.	.		0.378	USP15-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000407831.2	NM_006313	
PPP1R12A	4659	hgsc.bcm.edu	37	12	80266678	80266678	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr12:80266678A>G	ENST00000450142.2	-	2	544	c.278T>C	c.(277-279)gTa>gCa	p.V93A	PPP1R12A_ENST00000437004.2_Missense_Mutation_p.V93A|PPP1R12A_ENST00000546369.1_Missense_Mutation_p.V6A|PPP1R12A_ENST00000550107.1_Missense_Mutation_p.V93A|PPP1R12A_ENST00000261207.5_Missense_Mutation_p.V93A	NM_002480.2	NP_002471.1	O14974	MYPT1_HUMAN	protein phosphatase 1, regulatory subunit 12A	93					centrosome organization (GO:0051297)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of catalytic activity (GO:0043086)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein dephosphorylation (GO:0006470)|regulation of cell adhesion (GO:0030155)|regulation of myosin-light-chain-phosphatase activity (GO:0035507)|regulation of nucleocytoplasmic transport (GO:0046822)|signal transduction (GO:0007165)	actin cytoskeleton (GO:0015629)|centrosome (GO:0005813)|contractile fiber (GO:0043292)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|kinetochore (GO:0000776)|nucleoplasm (GO:0005654)|PTW/PP1 phosphatase complex (GO:0072357)	14-3-3 protein binding (GO:0071889)|enzyme inhibitor activity (GO:0004857)|phosphatase regulator activity (GO:0019208)|protein kinase binding (GO:0019901)|signal transducer activity (GO:0004871)			breast(5)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(7)|liver(1)|lung(4)|ovary(2)|skin(1)	29						TCCATTTTCTACCAGAAACTT	0.358																																					p.V93A		Atlas-SNP	.											.	PPP1R12A	76	.	0			c.T278C						.						102.0	95.0	97.0					12																	80266678		1883	4160	6043	SO:0001583	missense	4659	exon2			TTTTCTACCAGAA	D87930	CCDS44947.1, CCDS44948.1, CCDS58259.1, CCDS58260.1	12q15-q21	2013-01-18	2011-10-04	2001-08-10	ENSG00000058272	ENSG00000058272		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Ankyrin repeat domain containing"""	7618	protein-coding gene	gene with protein product	"""myosin phosphatase-targeting subunit 1"", ""myosin binding subunit"""	602021	"""protein phosphatase 1, regulatory (inhibitor) subunit 12A"""	MYPT1		9286714	Standard	NM_002480		Approved	MBS, M130	uc001syz.3	O14974	OTTHUMG00000170100	ENST00000450142.2:c.278T>C	chr12.hg19:g.80266678A>G	ENSP00000389168:p.Val93Ala	122.0	0.0		74.0	4.0	NM_002480	B4DZ09|F8VWB4|Q2NKL4|Q569H0|Q86WU3|Q8NFR6|Q9BYH0	Missense_Mutation	SNP	ENST00000450142.2	hg19	CCDS44947.1	.	.	.	.	.	.	.	.	.	.	A	25.4	4.632309	0.87660	.	.	ENSG00000058272	ENST00000261207;ENST00000546189;ENST00000360825;ENST00000341878;ENST00000312727;ENST00000450142;ENST00000437004;ENST00000546369;ENST00000550107;ENST00000547330;ENST00000550510	T;T;T;D;T;T;T	0.83163	-0.24;-0.24;-0.24;-1.69;-0.24;-0.1;-0.17	5.02	5.02	0.67125	Ankyrin repeat-containing domain (3);	0.000000	0.85682	D	0.000000	D	0.87398	0.6167	L	0.41573	1.285	0.80722	D	1	D;P;D;D	0.64830	0.993;0.878;0.982;0.994	D;D;D;D	0.83275	0.993;0.972;0.989;0.996	D	0.88754	0.3252	10	0.72032	D	0.01	.	15.0448	0.71819	1.0:0.0:0.0:0.0	.	93;93;93;93	F8W8Q6;O14974-2;O14974-3;O14974	.;.;.;MYPT1_HUMAN	A	93;93;93;93;93;93;93;6;93;93;21	ENSP00000261207:V93A;ENSP00000389168:V93A;ENSP00000416769:V93A;ENSP00000449514:V6A;ENSP00000446855:V93A;ENSP00000446816:V93A;ENSP00000447338:V21A	ENSP00000261207:V93A	V	-	2	0	PPP1R12A	78790809	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.087000	0.94110	2.006000	0.58801	0.477000	0.44152	GTA	.	.		0.358	PPP1R12A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407254.2	NM_002480	
CEP290	80184	hgsc.bcm.edu	37	12	88523495	88523495	+	Silent	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr12:88523495T>C	ENST00000552810.1	-	10	1171	c.828A>G	c.(826-828)aaA>aaG	p.K276K	CEP290_ENST00000397838.3_5'Flank|CEP290_ENST00000309041.7_Silent_p.K276K	NM_025114.3	NP_079390.3	O15078	CE290_HUMAN	centrosomal protein 290kDa	276					cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|establishment or maintenance of cell polarity (GO:0007163)|eye photoreceptor cell development (GO:0042462)|G2/M transition of mitotic cell cycle (GO:0000086)|hindbrain development (GO:0030902)|mitotic cell cycle (GO:0000278)|otic vesicle formation (GO:0030916)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of transcription, DNA-templated (GO:0045893)|pronephros development (GO:0048793)|protein transport (GO:0015031)|regulation of cAMP metabolic process (GO:0030814)|regulation of establishment of protein localization (GO:0070201)|retina development in camera-type eye (GO:0060041)	centriolar satellite (GO:0034451)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|photoreceptor connecting cilium (GO:0032391)|protein complex (GO:0043234)|TCTN-B9D complex (GO:0036038)				breast(4)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(20)|liver(1)|lung(18)|ovary(5)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	73						GATCGTTTTCTTTTTTTAACT	0.274																																					p.K276K		Atlas-SNP	.											.,1	CEP290	195	.	0			c.A828G						.						45.0	40.0	41.0					12																	88523495		1734	3858	5592	SO:0001819	synonymous_variant	80184	exon10			GTTTTCTTTTTTT	AB002371	CCDS55858.1	12q21.33	2014-09-17				ENSG00000198707			29021	protein-coding gene	gene with protein product	"""Joubert syndrome 5"", ""nephrocystin-6"", ""cancer/testis antigen 87"", ""POC3 centriolar protein homolog (Chlamydomonas)"", ""Meckel syndrome, type 4"""	610142				15474516, 16682973, 16632484	Standard	NM_025114		Approved	KIAA0373, FLJ13615, 3H11Ag, rd16, NPHP6, JBTS5, SLSN6, LCA10, MKS4, BBS14, CT87, POC3	uc001tar.3	O15078		ENST00000552810.1:c.828A>G	chr12.hg19:g.88523495T>C		154.0	0.0		62.0	3.0	NM_025114	Q1PSK5|Q66GS8|Q9H2G6|Q9H6Q7|Q9H8I0	Silent	SNP	ENST00000552810.1	hg19	CCDS55858.1																																																																																			.	.		0.274	CEP290-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000406344.1	NM_025114	
PLXNC1	10154	hgsc.bcm.edu	37	12	94631455	94631455	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr12:94631455T>C	ENST00000258526.4	+	10	2245	c.1996T>C	c.(1996-1998)Tcc>Ccc	p.S666P		NM_005761.2	NP_005752.1	O60486	PLXC1_HUMAN	plexin C1	666					axon guidance (GO:0007411)|cell adhesion (GO:0007155)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|membrane (GO:0016020)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)|receptor binding (GO:0005102)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(4)|kidney(4)|large_intestine(12)|lung(30)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	64						CTACATTAAGTCCATTGAGCC	0.408																																					p.S666P		Atlas-SNP	.											.	PLXNC1	135	.	0			c.T1996C						.						77.0	69.0	71.0					12																	94631455		2203	4300	6503	SO:0001583	missense	10154	exon10			ATTAAGTCCATTG	AF030339	CCDS9049.1	12q23	2009-04-17				ENSG00000136040		"""CD molecules"", ""Plexins"""	9106	protein-coding gene	gene with protein product		604259					Standard	NR_037687		Approved	VESPR, CD232	uc001tdc.3	O60486	OTTHUMG00000170235	ENST00000258526.4:c.1996T>C	chr12.hg19:g.94631455T>C	ENSP00000258526:p.Ser666Pro	71.0	0.0		55.0	4.0	NM_005761	Q59H25	Missense_Mutation	SNP	ENST00000258526.4	hg19	CCDS9049.1	.	.	.	.	.	.	.	.	.	.	T	14.97	2.694898	0.48202	.	.	ENSG00000136040	ENST00000258526	T	0.80994	-1.44	5.75	2.08	0.27032	Cell surface receptor IPT/TIG (1);Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.446825	0.25848	N	0.027909	T	0.73908	0.3647	L	0.29908	0.895	0.80722	D	1	P	0.42518	0.782	P	0.48598	0.583	T	0.70963	-0.4729	10	0.59425	D	0.04	.	7.2307	0.26040	0.1253:0.0:0.3471:0.5276	.	666	O60486	PLXC1_HUMAN	P	666	ENSP00000258526:S666P	ENSP00000258526:S666P	S	+	1	0	PLXNC1	93155586	0.999000	0.42202	0.999000	0.59377	0.991000	0.79684	2.268000	0.43338	0.509000	0.28195	0.533000	0.62120	TCC	.	.		0.408	PLXNC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408126.2		
ANKS1B	56899	hgsc.bcm.edu	37	12	99447084	99447084	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr12:99447084T>C	ENST00000547776.2	-	17	2628	c.2629A>G	c.(2629-2631)Aga>Gga	p.R877G	ANKS1B_ENST00000549558.2_Missense_Mutation_p.R103G|ANKS1B_ENST00000549025.2_Missense_Mutation_p.R46G|ANKS1B_ENST00000546960.1_Missense_Mutation_p.R103G|ANKS1B_ENST00000550693.2_Missense_Mutation_p.R103G|ANKS1B_ENST00000332712.7_Missense_Mutation_p.R103G|ANKS1B_ENST00000549493.2_Missense_Mutation_p.R103G|ANKS1B_ENST00000547010.1_Missense_Mutation_p.R453G|ANKS1B_ENST00000329257.7_Missense_Mutation_p.R877G|ANKS1B_ENST00000547446.1_Missense_Mutation_p.R72G|ANKS1B_ENST00000546568.1_Missense_Mutation_p.R103G	NM_152788.4	NP_690001.3	Q7Z6G8	ANS1B_HUMAN	ankyrin repeat and sterile alpha motif domain containing 1B	877						cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)	ephrin receptor binding (GO:0046875)			NS(1)|breast(1)|cervix(1)|endometrium(4)|kidney(6)|large_intestine(15)|lung(38)|pancreas(1)|prostate(2)|skin(1)	70		all_cancers(3;0.0197)|all_epithelial(3;0.0101)|Esophageal squamous(3;0.0559)|Breast(359;0.209)		OV - Ovarian serous cystadenocarcinoma(2;2.89e-08)|Epithelial(2;6.12e-08)|all cancers(2;4.07e-06)		CCAATGGGTCTCATCTGTAAT	0.398																																					p.R877G		Atlas-SNP	.											.	ANKS1B	180	.	0			c.A2629G						.						46.0	44.0	44.0					12																	99447084		1898	4121	6019	SO:0001583	missense	56899	exon17			TGGGTCTCATCTG	AF145204	CCDS55864.1, CCDS55865.1, CCDS55866.1, CCDS55867.1, CCDS55868.1, CCDS55869.1, CCDS55870.1, CCDS55871.1, CCDS55872.1	12q23.1	2013-01-10						"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	24600	protein-coding gene	gene with protein product		607815				10490826, 12415113	Standard	NM_020140		Approved	EB-1, AIDA-1, cajalin-2, ANKS2	uc001tge.2	Q7Z6G8		ENST00000547776.2:c.2629A>G	chr12.hg19:g.99447084T>C	ENSP00000449629:p.Arg877Gly	93.0	0.0		71.0	4.0	NM_152788	A5PKY5|A7E259|A8K153|A8MSN4|B4DFP6|B4DH98|F8VPM3|F8VZR9|F8WC27|Q5XLJ0|Q6IVB5|Q6NUS4|Q7Z6G6|Q7Z6G7|Q8TAP3|Q9NRX7|Q9Y5K9	Missense_Mutation	SNP	ENST00000547776.2	hg19	CCDS55872.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	13.21|13.21	2.168333|2.168333	0.38315|0.38315	.|.	.|.	ENSG00000185046|ENSG00000185046	ENST00000549558;ENST00000547776;ENST00000547010;ENST00000329257;ENST00000538702;ENST00000550693;ENST00000549025;ENST00000549493;ENST00000547446;ENST00000546568;ENST00000332712;ENST00000407362;ENST00000546960;ENST00000552245|ENST00000550778	D;D;D;D;D;D;D;D;D;D;D|.	0.81821|.	-1.54;-1.54;-1.54;-1.54;-1.54;-1.54;-1.54;-1.54;-1.54;-1.54;-1.54|.	6.16|6.16	5.0|5.0	0.66597|0.66597	Sterile alpha motif/pointed domain (2);|.	0.057170|.	0.64402|.	D|.	0.000003|.	T|.	0.51890|.	0.1701|.	L|L	0.29908|0.29908	0.895|0.895	0.39116|0.39116	D|D	0.961567|0.961567	B;B;B;B;B;B;P;B;B;B;B|.	0.35456|.	0.006;0.0;0.02;0.159;0.024;0.0;0.502;0.001;0.032;0.064;0.024|.	B;B;B;B;B;B;B;B;B;B;B|.	0.37451|.	0.026;0.001;0.028;0.153;0.072;0.004;0.25;0.004;0.069;0.063;0.072|.	T|.	0.50457|.	-0.8826|.	10|.	0.72032|.	D|.	0.01|.	-13.3012|-13.3012	12.2552|12.2552	0.54619|0.54619	0.0:0.0:0.1417:0.8583|0.0:0.0:0.1417:0.8583	.|.	72;103;103;103;91;103;103;46;453;877;103|.	F8VPM3;Q7Z6G8-4;Q7Z6G8-5;F8VZ47;F8VQW6;Q7Z6G8-2;Q7Z6G8-3;F8VZR9;Q7Z6G8-6;Q7Z6G8;Q7Z6G8-7|.	.;.;.;.;.;.;.;.;.;ANS1B_HUMAN;.|.	G|W	103;877;453;877;452;103;46;103;72;103;103;39;103;103|148	ENSP00000448993:R103G;ENSP00000449629:R877G;ENSP00000448512:R453G;ENSP00000331381:R877G;ENSP00000447999:R103G;ENSP00000447312:R46G;ENSP00000448203:R103G;ENSP00000450015:R72G;ENSP00000448205:R103G;ENSP00000332683:R103G;ENSP00000447839:R103G|.	ENSP00000331381:R877G|.	R|X	-|-	1|3	2|0	ANKS1B|ANKS1B	97971215|97971215	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.978000|0.978000	0.69477|0.69477	1.738000|1.738000	0.38207|0.38207	1.116000|1.116000	0.41820|0.41820	0.528000|0.528000	0.53228|0.53228	AGA|TGA	.	.		0.398	ANKS1B-003	KNOWN	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000408421.3	NM_020140	
ANO4	121601	hgsc.bcm.edu	37	12	101333217	101333217	+	Silent	SNP	A	A	G			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr12:101333217A>G	ENST00000392977.3	+	4	495	c.285A>G	c.(283-285)gaA>gaG	p.E95E	ANO4_ENST00000538618.1_Silent_p.E261E|ANO4_ENST00000299222.9_5'UTR|ANO4_ENST00000392979.3_Silent_p.E60E			Q32M45	ANO4_HUMAN	anoctamin 4	95					chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	intracellular calcium activated chloride channel activity (GO:0005229)			NS(1)|biliary_tract(1)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(33)|ovary(4)|prostate(5)|skin(7)|stomach(2)|urinary_tract(1)	78						GCAGATTGGAAGCCGGGGGAG	0.428										HNSCC(74;0.22)																											p.E60E		Atlas-SNP	.											.	ANO4	183	.	0			c.A180G						.						91.0	93.0	92.0					12																	101333217		2203	4300	6503	SO:0001819	synonymous_variant	121601	exon3			ATTGGAAGCCGGG	AK091540	CCDS31884.1, CCDS66445.1	12q23.3	2014-04-09	2008-08-28	2008-08-28	ENSG00000151572	ENSG00000151572		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	23837	protein-coding gene	gene with protein product		610111	"""transmembrane protein 16D"""	TMEM16D		12739008, 15067359, 24692353	Standard	NM_178826		Approved	FLJ34221, FLJ34272, FLJ35277	uc001thw.2	Q32M45		ENST00000392977.3:c.285A>G	chr12.hg19:g.101333217A>G		110.0	0.0		63.0	4.0	NM_178826	Q8NAJ0|Q8NB39|Q8NB53	Silent	SNP	ENST00000392977.3	hg19																																																																																				.	.		0.428	ANO4-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000409295.1	NM_178826	
SYCP3	50511	hgsc.bcm.edu	37	12	102122736	102122736	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr12:102122736A>G	ENST00000392927.3	-	9	811	c.680T>C	c.(679-681)gTt>gCt	p.V227A	SYCP3_ENST00000392924.1_Missense_Mutation_p.V227A|SYCP3_ENST00000266743.2_Missense_Mutation_p.V227A|CHPT1_ENST00000229266.3_3'UTR	NM_001177948.1|NM_001177949.1|NM_153694.4	NP_001171419.1|NP_001171420.1|NP_710161.1	Q8IZU3	SYCP3_HUMAN	synaptonemal complex protein 3	227	Gln-rich.				male meiosis I (GO:0007141)|spermatogenesis, exchange of chromosomal proteins (GO:0035093)	chromosome (GO:0005694)|nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(2)|kidney(2)|large_intestine(1)|lung(5)|skin(1)	11						AGACTTCCGAACACTTGCTAT	0.299																																					p.V227A		Atlas-SNP	.											.	SYCP3	19	.	0			c.T680C						.						115.0	112.0	113.0					12																	102122736		2203	4297	6500	SO:0001583	missense	50511	exon9			TTCCGAACACTTG	AF492003, AI075991	CCDS9087.1	12q23.2	2007-02-05			ENSG00000139351	ENSG00000139351			18130	protein-coding gene	gene with protein product		604759				12213195, 10854409	Standard	NM_153694		Approved		uc001tis.3	Q8IZU3	OTTHUMG00000150132	ENST00000392927.3:c.680T>C	chr12.hg19:g.102122736A>G	ENSP00000376658:p.Val227Ala	118.0	0.0		71.0	4.0	NM_001177949		Missense_Mutation	SNP	ENST00000392927.3	hg19	CCDS9087.1	.	.	.	.	.	.	.	.	.	.	A	23.8	4.463282	0.84425	.	.	ENSG00000139351	ENST00000266743;ENST00000392927;ENST00000392924	.	.	.	5.46	5.46	0.80206	.	0.000000	0.64402	D	0.000002	T	0.79695	0.4490	M	0.81682	2.555	0.58432	D	0.999997	D	0.89917	1.0	D	0.71184	0.972	T	0.82975	-0.0190	9	0.87932	D	0	-2.195	15.5193	0.75854	1.0:0.0:0.0:0.0	.	227	Q8IZU3	SYCP3_HUMAN	A	227	.	ENSP00000266743:V227A	V	-	2	0	SYCP3	100646867	1.000000	0.71417	0.997000	0.53966	0.979000	0.70002	6.341000	0.72977	2.067000	0.61834	0.374000	0.22700	GTT	.	.		0.299	SYCP3-001	KNOWN	alternative_5_UTR|upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316478.2	NM_153694	
STAB2	55576	hgsc.bcm.edu	37	12	104157304	104157304	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr12:104157304A>G	ENST00000388887.2	+	68	7727	c.7523A>G	c.(7522-7524)aAg>aGg	p.K2508R	RP11-341G23.4_ENST00000551299.1_RNA|RP11-341G23.4_ENST00000550029.1_RNA	NM_017564.9	NP_060034.9			stabilin 2											NS(4)|breast(7)|central_nervous_system(1)|cervix(1)|endometrium(15)|kidney(11)|large_intestine(26)|lung(77)|ovary(10)|pancreas(1)|prostate(5)|skin(14)|stomach(2)	174						GCTCTTGGCAAGCAGCAGCCT	0.512																																					p.K2508R		Atlas-SNP	.											.	STAB2	370	.	0			c.A7523G						.						282.0	270.0	274.0					12																	104157304		2203	4300	6503	SO:0001583	missense	55576	exon68			TTGGCAAGCAGCA	AF160476	CCDS31888.1	12q23.3	2007-01-29				ENSG00000136011			18629	protein-coding gene	gene with protein product	"""hyaluronic acid receptor for endocytosis"""	608561				11829752, 12077138	Standard	XR_429107		Approved	DKFZP434E0321, FELL, STAB-2, HARE, FEEL-2	uc001tjw.3	Q8WWQ8	OTTHUMG00000170056	ENST00000388887.2:c.7523A>G	chr12.hg19:g.104157304A>G	ENSP00000373539:p.Lys2508Arg	156.0	0.0		92.0	4.0	NM_017564		Missense_Mutation	SNP	ENST00000388887.2	hg19	CCDS31888.1	.	.	.	.	.	.	.	.	.	.	A	12.30	1.896213	0.33442	.	.	ENSG00000136011	ENST00000388887;ENST00000552777	T;T	0.64260	-0.09;0.21	4.52	2.15	0.27550	.	0.637583	0.13848	N	0.358543	T	0.46678	0.1405	L	0.49350	1.555	0.27930	N	0.937906	P	0.43094	0.799	B	0.37943	0.261	T	0.37174	-0.9717	10	0.07325	T	0.83	.	6.9649	0.24617	0.8163:0.0:0.1837:0.0	.	2508	Q8WWQ8	STAB2_HUMAN	R	2508;10	ENSP00000373539:K2508R;ENSP00000446629:K10R	ENSP00000373539:K2508R	K	+	2	0	STAB2	102681434	0.997000	0.39634	0.999000	0.59377	0.747000	0.42532	3.766000	0.55280	0.270000	0.21984	0.379000	0.24179	AAG	.	.		0.512	STAB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407089.1		
NT5DC3	51559	hgsc.bcm.edu	37	12	104208807	104208807	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr12:104208807A>G	ENST00000392876.3	-	2	341	c.301T>C	c.(301-303)Ttc>Ctc	p.F101L		NM_001031701.2	NP_001026871.1	Q86UY8	NT5D3_HUMAN	5'-nucleotidase domain containing 3	101						cytosol (GO:0005829)|mitochondrion (GO:0005739)|receptor complex (GO:0043235)	hydrolase activity (GO:0016787)|metal ion binding (GO:0046872)			NS(1)|breast(1)|endometrium(1)|kidney(4)|large_intestine(3)|lung(15)|ovary(2)|skin(1)|stomach(2)	30						TCATAATCGAAGCCATAGATT	0.403																																					p.F101L		Atlas-SNP	.											.	NT5DC3	113	.	0			c.T301C						.						124.0	114.0	118.0					12																	104208807		2203	4300	6503	SO:0001583	missense	51559	exon2			AATCGAAGCCATA	AB032786	CCDS41824.1	12q22-q23.1	2006-02-03			ENSG00000111696	ENSG00000111696			30826	protein-coding gene	gene with protein product		611076					Standard	NM_001031701		Approved	TU12B1-TY, FLJ11266	uc010swe.1	Q86UY8	OTTHUMG00000157017	ENST00000392876.3:c.301T>C	chr12.hg19:g.104208807A>G	ENSP00000376615:p.Phe101Leu	183.0	0.0		98.0	5.0	NM_001031701	Q9NUM7|Q9P2T2|Q9P2T3	Missense_Mutation	SNP	ENST00000392876.3	hg19	CCDS41824.1	.	.	.	.	.	.	.	.	.	.	A	35	5.459670	0.96240	.	.	ENSG00000111696	ENST00000392876	T	0.50548	0.74	5.87	5.87	0.94306	HAD-like domain (2);	0.000000	0.85682	D	0.000000	T	0.77343	0.4116	M	0.93678	3.445	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.83617	0.0137	10	0.87932	D	0	-27.9503	16.5764	0.84681	1.0:0.0:0.0:0.0	.	101	Q86UY8	NT5D3_HUMAN	L	101	ENSP00000376615:F101L	ENSP00000376615:F101L	F	-	1	0	NT5DC3	102732937	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	8.877000	0.92386	2.371000	0.80710	0.533000	0.62120	TTC	.	.		0.403	NT5DC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347118.2	NM_016575	
DAO	1610	hgsc.bcm.edu	37	12	109288138	109288138	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr12:109288138A>G	ENST00000228476.3	+	7	811	c.607A>G	c.(607-609)Atg>Gtg	p.M203V	DAO_ENST00000551281.1_Missense_Mutation_p.M137V	NM_001917.4	NP_001908.3	P14920	OXDA_HUMAN	D-amino-acid oxidase	203					cellular nitrogen compound metabolic process (GO:0034641)|D-alanine catabolic process (GO:0055130)|D-serine catabolic process (GO:0036088)|D-serine metabolic process (GO:0070178)|dopamine biosynthetic process (GO:0042416)|glyoxylate metabolic process (GO:0046487)|leucine metabolic process (GO:0006551)|proline catabolic process (GO:0006562)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|peroxisomal matrix (GO:0005782)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	cofactor binding (GO:0048037)|D-amino-acid oxidase activity (GO:0003884)|FAD binding (GO:0071949)|protein dimerization activity (GO:0046983)|receptor binding (GO:0005102)			NS(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(9)|ovary(1)|prostate(2)|skin(1)	26					Flavin adenine dinucleotide(DB03147)	GGGGCAGATCATGAAGGTGAG	0.532																																					p.M203V		Atlas-SNP	.											.	DAO	58	.	0			c.A607G						.						48.0	39.0	42.0					12																	109288138		2203	4300	6503	SO:0001583	missense	1610	exon7			CAGATCATGAAGG	D11370	CCDS9122.1	12q24.11	2013-09-20			ENSG00000110887	ENSG00000110887	1.4.3.3		2671	protein-coding gene	gene with protein product		124050				1356107, 8182053	Standard	NM_001917		Approved	DAMOX	uc001tnr.4	P14920	OTTHUMG00000169360	ENST00000228476.3:c.607A>G	chr12.hg19:g.109288138A>G	ENSP00000228476:p.Met203Val	83.0	0.0		44.0	4.0	NM_001917	B2R7I5|Q16758|Q8N6R2	Missense_Mutation	SNP	ENST00000228476.3	hg19	CCDS9122.1	.	.	.	.	.	.	.	.	.	.	A	12.85	2.062280	0.36373	.	.	ENSG00000110887	ENST00000551281;ENST00000228476;ENST00000547768	T;T;T	0.79454	-1.27;-1.27;-1.27	5.51	4.3	0.51218	FAD dependent oxidoreductase (1);	0.088548	0.85682	D	0.000000	T	0.44623	0.1302	N	0.01015	-1.05	0.23435	N	0.997689	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.26155	-1.0111	10	0.02654	T	1	-18.9327	12.0939	0.53744	0.7717:0.2283:0.0:0.0	.	203;186	P14920;Q7Z312	OXDA_HUMAN;.	V	137;203;80	ENSP00000446853:M137V;ENSP00000228476:M203V;ENSP00000449967:M80V	ENSP00000228476:M203V	M	+	1	0	DAO	107812267	1.000000	0.71417	1.000000	0.80357	0.946000	0.59487	2.955000	0.49121	2.108000	0.64289	0.409000	0.27619	ATG	.	.		0.532	DAO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403682.1		
CIT	11113	hgsc.bcm.edu	37	12	120241020	120241020	+	Missense_Mutation	SNP	C	C	G	rs145965687	byFrequency	TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr12:120241020C>G	ENST00000261833.7	-	10	1337	c.1285G>C	c.(1285-1287)Ggt>Cgt	p.G429R	CIT_ENST00000392521.2_Missense_Mutation_p.G429R	NM_007174.2	NP_009105.1	O14578	CTRO_HUMAN	citron rho-interacting serine/threonine kinase	429	AGC-kinase C-terminal.				cytokinesis (GO:0000910)|dendrite development (GO:0016358)|G2/M transition of mitotic cell cycle (GO:0000086)|generation of neurons (GO:0048699)|Golgi organization (GO:0007030)|intracellular signal transduction (GO:0035556)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic nuclear division (GO:0007067)|mitotic sister chromatid segregation (GO:0000070)|negative regulation of dendrite morphogenesis (GO:0050774)|regulation of actin polymerization or depolymerization (GO:0008064)|spermatogenesis (GO:0007283)	actin cytoskeleton (GO:0015629)|Golgi cisterna (GO:0031985)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|vacuole (GO:0005773)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|PDZ domain binding (GO:0030165)|protein serine/threonine kinase activity (GO:0004674)|small GTPase regulator activity (GO:0005083)			breast(6)|endometrium(9)|kidney(4)|large_intestine(15)|liver(1)|lung(29)|ovary(7)|prostate(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(6)	86	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)	Myeloproliferative disorder(1001;0.0255)		BRCA - Breast invasive adenocarcinoma(302;0.211)		TCAGATCTACCAAGAATCCCC	0.532																																					p.G429R		Atlas-SNP	.											.	CIT	535	.	0			c.G1285C						.						82.0	84.0	83.0					12																	120241020		2203	4300	6503	SO:0001583	missense	11113	exon10			ATCTACCAAGAAT	AB023166	CCDS9192.1, CCDS55891.1	12q24.23	2014-04-23	2014-04-23		ENSG00000122966	ENSG00000122966			1985	protein-coding gene	gene with protein product	"""serine/threonine kinase 21"""	605629	"""citron (rho-interacting, serine/threonine kinase 21)"""			9792683	Standard	NM_001206999		Approved	KIAA0949, STK21, CRIK	uc001txj.2	O14578	OTTHUMG00000134325	ENST00000261833.7:c.1285G>C	chr12.hg19:g.120241020C>G	ENSP00000261833:p.Gly429Arg	112.0	0.0		77.0	53.0	NM_001206999	Q2M5E1|Q6XUH8|Q86UQ9|Q9UPZ7	Missense_Mutation	SNP	ENST00000261833.7	hg19	CCDS9192.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	14.41|14.41	2.527671|2.527671	0.44969|0.44969	.|.	.|.	ENSG00000122966|ENSG00000122966	ENST00000392521;ENST00000261833|ENST00000392520	T;T|T	0.64438|0.13307	-0.1;-0.09|2.6	5.43|5.43	5.43|5.43	0.79202|0.79202	AGC-kinase, C-terminal (1);|.	0.340590|.	0.27861|.	N|.	0.017557|.	T|T	0.09642|0.09642	0.0237|0.0237	N|N	0.08118|0.08118	0|0	0.34036|0.34036	D|D	0.654392|0.654392	B;B|.	0.22683|.	0.008;0.073|.	B;B|.	0.23716|.	0.003;0.048|.	T|T	0.26052|0.26052	-1.0114|-1.0114	10|7	0.28530|0.37606	T|T	0.3|0.19	.|.	10.2233|10.2233	0.43209|0.43209	0.0:0.9107:0.0:0.0893|0.0:0.9107:0.0:0.0893	.|.	429;429|.	Q2M5E1;O14578|.	.;CTRO_HUMAN|.	R|F	429|56	ENSP00000376306:G429R;ENSP00000261833:G429R|ENSP00000376305:L56F	ENSP00000261833:G429R|ENSP00000376305:L56F	G|L	-|-	1|3	0|2	CIT|CIT	118725403|118725403	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	2.429000|2.429000	0.44758|0.44758	2.546000|2.546000	0.85860|0.85860	0.655000|0.655000	0.94253|0.94253	GGT|TTG	.	C|1.000;T|0.000		0.532	CIT-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000259410.4	NM_007174	
CCDC62	84660	hgsc.bcm.edu	37	12	123285708	123285708	+	Missense_Mutation	SNP	C	C	T	rs373036488		TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr12:123285708C>T	ENST00000253079.6	+	9	1359	c.1015C>T	c.(1015-1017)Cca>Tca	p.P339S	CCDC62_ENST00000392441.4_Missense_Mutation_p.P339S|CCDC62_ENST00000537566.1_Missense_Mutation_p.P100S|CCDC62_ENST00000392440.2_Missense_Mutation_p.P100S	NM_201435.4	NP_958843.2	Q6P9F0	CCD62_HUMAN	coiled-coil domain containing 62	339					cellular response to estradiol stimulus (GO:0071392)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	estrogen receptor binding (GO:0030331)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)			breast(1)|kidney(1)|large_intestine(4)|lung(9)|ovary(2)|pancreas(1)|skin(1)|urinary_tract(1)	20	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;6.51e-06)|Epithelial(86;2.65e-05)|BRCA - Breast invasive adenocarcinoma(302;0.206)		AAATAACCACCCAAAAGTCGA	0.358																																					p.P339S		Atlas-SNP	.											.	CCDC62	119	.	0			c.C1015T						.						64.0	67.0	66.0					12																	123285708		2203	4300	6503	SO:0001583	missense	84660	exon9			AACCACCCAAAAG		CCDS9238.1	12q24.31	2009-08-18			ENSG00000130783	ENSG00000130783			30723	protein-coding gene	gene with protein product	"""cancer/testis antigen 109"""	613481				18563714, 19126643	Standard	NM_201435		Approved	TSP-NY, FLJ40344, CT109, ERAP75	uc001udc.3	Q6P9F0	OTTHUMG00000168764	ENST00000253079.6:c.1015C>T	chr12.hg19:g.123285708C>T	ENSP00000253079:p.Pro339Ser	124.0	0.0		81.0	4.0	NM_201435	A8K8V1|B3KUP3|Q6ZVF2|Q86VJ0|Q9BYZ5	Missense_Mutation	SNP	ENST00000253079.6	hg19	CCDS9238.1	.	.	.	.	.	.	.	.	.	.	C	6.804	0.517475	0.13005	.	.	ENSG00000130783	ENST00000253079;ENST00000392441;ENST00000537566;ENST00000392440	T;T;T;T	0.47177	1.47;1.47;0.85;0.85	5.41	0.358	0.16084	.	0.628588	0.14138	N	0.338882	T	0.29817	0.0745	L	0.29908	0.895	0.09310	N	1	B;B;B	0.20671	0.047;0.018;0.009	B;B;B	0.18561	0.019;0.022;0.007	T	0.22626	-1.0211	10	0.16896	T	0.51	0.043	7.9296	0.29895	0.0:0.5458:0.0:0.4542	.	339;100;339	Q6P9F0-2;Q6P9F0-3;Q6P9F0	.;.;CCD62_HUMAN	S	339;339;100;100	ENSP00000253079:P339S;ENSP00000376236:P339S;ENSP00000445045:P100S;ENSP00000376235:P100S	ENSP00000253079:P339S	P	+	1	0	CCDC62	121851661	0.138000	0.22547	0.043000	0.18650	0.432000	0.31715	0.298000	0.19120	-0.210000	0.10140	-0.150000	0.13652	CCA	.	.		0.358	CCDC62-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400930.1	NM_032573	
DDX55	57696	hgsc.bcm.edu	37	12	124104625	124104625	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr12:124104625A>G	ENST00000238146.4	+	14	1791	c.1741A>G	c.(1741-1743)Act>Gct	p.T581A	DDX55_ENST00000538744.1_Missense_Mutation_p.T550A|DDX55_ENST00000421670.3_Missense_Mutation_p.T188A	NM_020936.1	NP_065987.1	Q8NHQ9	DDX55_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 55	581						membrane (GO:0016020)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)			autonomic_ganglia(1)|breast(1)|endometrium(1)|large_intestine(3)|liver(1)|lung(4)|ovary(1)|prostate(1)|skin(1)	14	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000142)|Epithelial(86;0.000637)|all cancers(50;0.00772)		CTTGTTGACAACTGGCAAAAG	0.398																																					p.T581A		Atlas-SNP	.											.	DDX55	51	.	0			c.A1741G						.						104.0	103.0	104.0					12																	124104625		2203	4300	6503	SO:0001583	missense	57696	exon14			TTGACAACTGGCA	AB046815	CCDS9251.1	12q24.31	2003-06-13			ENSG00000111364	ENSG00000111364		"""DEAD-boxes"""	20085	protein-coding gene	gene with protein product						10997877	Standard	NM_020936		Approved	KIAA1595	uc001ufi.3	Q8NHQ9	OTTHUMG00000168695	ENST00000238146.4:c.1741A>G	chr12.hg19:g.124104625A>G	ENSP00000238146:p.Thr581Ala	149.0	0.0		88.0	4.0	NM_020936	Q658L6|Q8IYH0|Q9HCH7	Missense_Mutation	SNP	ENST00000238146.4	hg19	CCDS9251.1	.	.	.	.	.	.	.	.	.	.	A	9.954	1.220976	0.22457	.	.	ENSG00000111364	ENST00000238146;ENST00000538744;ENST00000421670	T;T;T	0.40756	4.11;3.83;1.02	5.85	2.08	0.27032	.	2.145490	0.01173	N	0.006909	T	0.24353	0.0590	N	0.19112	0.55	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.20739	-1.0266	10	0.08837	T	0.75	-18.306	1.0416	0.01560	0.4427:0.1518:0.2584:0.147	.	581	Q8NHQ9	DDX55_HUMAN	A	581;550;188	ENSP00000238146:T581A;ENSP00000443114:T550A;ENSP00000442332:T188A	ENSP00000238146:T581A	T	+	1	0	DDX55	122670578	0.006000	0.16342	0.766000	0.31476	0.917000	0.54804	0.200000	0.17257	1.038000	0.40049	0.533000	0.62120	ACT	.	.		0.398	DDX55-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400616.2		
NCOR2	9612	hgsc.bcm.edu	37	12	124824953	124824953	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr12:124824953G>A	ENST00000405201.1	-	36	5375	c.5375C>T	c.(5374-5376)tCc>tTc	p.S1792F	NCOR2_ENST00000404621.1_Missense_Mutation_p.S1782F|NCOR2_ENST00000429285.2_Missense_Mutation_p.S1782F|NCOR2_ENST00000356219.3_Missense_Mutation_p.S1799F|NCOR2_ENST00000404121.2_Missense_Mutation_p.S1353F|NCOR2_ENST00000397355.1_Missense_Mutation_p.S1783F			Q9Y618	NCOR2_HUMAN	nuclear receptor corepressor 2	1800					cellular lipid metabolic process (GO:0044255)|gene expression (GO:0010467)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|regulation of cellular ketone metabolic process by negative regulation of transcription from RNA polymerase II promoter (GO:0072365)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	membrane (GO:0016020)|nuclear body (GO:0016604)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone deacetylase binding (GO:0042826)|Notch binding (GO:0005112)|protein N-terminus binding (GO:0047485)|transcription corepressor activity (GO:0003714)			breast(5)|central_nervous_system(2)|endometrium(7)|kidney(5)|large_intestine(7)|lung(28)|ovary(3)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	69	all_neural(191;0.0804)|Medulloblastoma(191;0.163)			Epithelial(86;3.99e-05)|OV - Ovarian serous cystadenocarcinoma(86;9.14e-05)|all cancers(50;0.000402)|BRCA - Breast invasive adenocarcinoma(302;0.0764)		CTCGGACGAGGACGTGGTGGT	0.622																																					p.S1792F		Atlas-SNP	.											.	NCOR2	475	.	0			c.C5375T						.						71.0	81.0	77.0					12																	124824953		2080	4215	6295	SO:0001583	missense	9612	exon38			GACGAGGACGTGG	U37146	CCDS41857.1, CCDS41858.1, CCDS41857.2, CCDS41858.2, CCDS55892.1	12q24	2010-06-10	2010-06-10		ENSG00000196498	ENSG00000196498			7673	protein-coding gene	gene with protein product		600848	"""nuclear receptor co-repressor 2"""			7566127, 8813722	Standard	NM_001077261		Approved	SMRT, SMRTE, TRAC-1, CTG26, TNRC14	uc010tbb.2	Q9Y618	OTTHUMG00000150455	ENST00000405201.1:c.5375C>T	chr12.hg19:g.124824953G>A	ENSP00000384018:p.Ser1792Phe	90.0	0.0		51.0	4.0	NM_006312	O00613|O15416|O15421|Q13354|Q56D06|Q59GM0|Q9Y5U0	Missense_Mutation	SNP	ENST00000405201.1	hg19	CCDS41858.2	.	.	.	.	.	.	.	.	.	.	G	11.24	1.580150	0.28180	.	.	ENSG00000196498	ENST00000405201;ENST00000404621;ENST00000356219;ENST00000397355;ENST00000447011;ENST00000404121;ENST00000429285	T;T;T;T;T;T	0.20881	2.05;2.3;2.04;2.3;2.04;2.3	3.89	3.89	0.44902	.	0.424514	0.24029	N	0.042206	T	0.38532	0.1044	L	0.43152	1.355	0.44432	D	0.997353	D;D;D	0.76494	0.998;0.998;0.999	D;D;D	0.78314	0.915;0.991;0.961	T	0.30794	-0.9966	10	0.72032	D	0.01	-11.8694	15.4561	0.75314	0.0:0.0:1.0:0.0	.	1782;1783;1792	C9J0Q5;C9J239;C9JFD3	.;.;.	F	1792;1782;1799;1783;1791;1353;1782	ENSP00000384018:S1792F;ENSP00000384202:S1782F;ENSP00000348551:S1799F;ENSP00000380513:S1783F;ENSP00000385618:S1353F;ENSP00000400281:S1782F	ENSP00000348551:S1799F	S	-	2	0	NCOR2	123390906	0.963000	0.33076	0.356000	0.25785	0.152000	0.21847	6.150000	0.71801	1.701000	0.51217	0.491000	0.48974	TCC	.	.		0.622	NCOR2-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318173.2	NM_006312	
SACS	26278	hgsc.bcm.edu	37	13	23909856	23909856	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr13:23909856T>C	ENST00000382292.3	-	9	8432	c.8159A>G	c.(8158-8160)gAc>gGc	p.D2720G	SACS_ENST00000382298.3_Missense_Mutation_p.D2720G|SACS_ENST00000402364.1_Missense_Mutation_p.D1970G			Q9NZJ4	SACS_HUMAN	sacsin molecular chaperone	2720					cell death (GO:0008219)|negative regulation of inclusion body assembly (GO:0090084)|protein folding (GO:0006457)	axon (GO:0030424)|cell body fiber (GO:0070852)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	chaperone binding (GO:0051087)|Hsp70 protein binding (GO:0030544)|proteasome binding (GO:0070628)			NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(54)|lung(49)|ovary(7)|pancreas(1)|prostate(4)|skin(10)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(11)	189		all_cancers(29;1.51e-22)|all_epithelial(30;7.82e-19)|all_lung(29;4.71e-18)|Lung SC(185;0.0225)|Breast(139;0.128)		all cancers(112;0.00197)|Epithelial(112;0.00854)|OV - Ovarian serous cystadenocarcinoma(117;0.0298)|Lung(94;0.189)		GACCATTCTGTCTGATGCTGG	0.373																																					p.D2720G		Atlas-SNP	.											.	SACS	871	.	0			c.A8159G						.						69.0	70.0	70.0					13																	23909856		2203	4299	6502	SO:0001583	missense	26278	exon10			ATTCTGTCTGATG	AF193556	CCDS9300.2	13q11	2014-06-13	2014-01-30		ENSG00000151835	ENSG00000151835		"""Heat shock proteins / DNAJ (HSP40)"""	10519	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 138"""	604490	"""spastic ataxia of Charlevoix-Saguenay (sacsin)"""			10610707, 15057823, 21726565	Standard	NM_001278055		Approved	ARSACS, KIAA0730, DKFZp686B15167, DNAJC29, SPAX6, PPP1R138	uc001uon.3	Q9NZJ4	OTTHUMG00000016562	ENST00000382292.3:c.8159A>G	chr13.hg19:g.23909856T>C	ENSP00000371729:p.Asp2720Gly	106.0	0.0		72.0	4.0	NM_014363	O94835|Q5T9J5|Q5T9J7|Q5T9J8|Q68DF5|Q6MZR4|Q8NBF9	Missense_Mutation	SNP	ENST00000382292.3	hg19	CCDS9300.2	.	.	.	.	.	.	.	.	.	.	T	25.4	4.635701	0.87760	.	.	ENSG00000151835	ENST00000382292;ENST00000402364;ENST00000382298	D;D;D	0.93811	-3.29;-3.29;-3.29	5.56	5.56	0.83823	ATPase-like, ATP-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.95089	0.8409	L	0.44542	1.39	0.53688	D	0.999978	D	0.89917	1.0	D	0.87578	0.998	D	0.95378	0.8470	10	0.56958	D	0.05	.	15.7067	0.77588	0.0:0.0:0.0:1.0	.	2720	Q9NZJ4	SACS_HUMAN	G	2720;1970;2720	ENSP00000371729:D2720G;ENSP00000385844:D1970G;ENSP00000371735:D2720G	ENSP00000371729:D2720G	D	-	2	0	SACS	22807856	1.000000	0.71417	1.000000	0.80357	0.916000	0.54674	7.698000	0.84413	2.116000	0.64780	0.379000	0.24179	GAC	.	.		0.373	SACS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044148.3	NM_014363	
FLT3	2322	hgsc.bcm.edu	37	13	28608538	28608538	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr13:28608538A>G	ENST00000241453.7	-	13	1685	c.1604T>C	c.(1603-1605)tTc>tCc	p.F535S	FLT3_ENST00000537084.1_Missense_Mutation_p.F535S|FLT3_ENST00000380982.4_Missense_Mutation_p.F535S	NM_004119.2	NP_004110.2	P36888	FLT3_HUMAN	fms-related tyrosine kinase 3	535					B cell differentiation (GO:0030183)|cellular response to cytokine stimulus (GO:0071345)|common myeloid progenitor cell proliferation (GO:0035726)|cytokine-mediated signaling pathway (GO:0019221)|dendritic cell differentiation (GO:0097028)|hemopoiesis (GO:0030097)|leukocyte homeostasis (GO:0001776)|lymphocyte proliferation (GO:0046651)|myeloid progenitor cell differentiation (GO:0002318)|negative regulation of B cell differentiation (GO:0045578)|negative regulation of cell proliferation (GO:0008285)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell proliferation (GO:0008284)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of tyrosine phosphorylation of STAT protein (GO:0042531)|pro-B cell differentiation (GO:0002328)|pro-T cell differentiation (GO:0002572)|protein autophosphorylation (GO:0046777)|regulation of apoptotic process (GO:0042981)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vascular endothelial growth factor signaling pathway (GO:0038084)	endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|cytokine receptor activity (GO:0004896)|protein homodimerization activity (GO:0042803)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor-activated receptor activity (GO:0005021)			NS(1)|breast(3)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(12329)|kidney(2)|large_intestine(8)|lung(30)|ovary(4)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	12390	Acute lymphoblastic leukemia(6;0.04)	Lung SC(185;0.0156)|Ovarian(182;0.0392)	Colorectal(13;0.000157)|READ - Rectum adenocarcinoma(15;0.105)	OV - Ovarian serous cystadenocarcinoma(117;0.00154)|all cancers(112;0.00459)|GBM - Glioblastoma multiforme(144;0.00562)|Epithelial(112;0.0959)|Lung(94;0.212)	Ponatinib(DB08901)|Sorafenib(DB00398)|Sunitinib(DB01268)	GATGAAAGGGAAGGGGCCTGC	0.388			"""Mis, O"""		"""AML, ALL"""																																p.F535S		Atlas-SNP	.		Dom	yes		13	13q12	2322	fms-related tyrosine kinase 3		L	.	FLT3	15525	.	0			c.T1604C						.						84.0	78.0	80.0					13																	28608538		2203	4300	6503	SO:0001583	missense	2322	exon13			AAAGGGAAGGGGC	U02687	CCDS31953.1	13q12	2014-09-17			ENSG00000122025	ENSG00000122025	2.7.10.1	"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3765	protein-coding gene	gene with protein product		136351				8394751	Standard	NM_004119		Approved	STK1, FLK2, CD135	uc001urw.3	P36888	OTTHUMG00000016646	ENST00000241453.7:c.1604T>C	chr13.hg19:g.28608538A>G	ENSP00000241453:p.Phe535Ser	144.0	0.0		90.0	4.0	NM_004119	A0AVG9|B7ZLT7|B7ZLT8|F5H0A0|Q13414	Missense_Mutation	SNP	ENST00000241453.7	hg19	CCDS31953.1	.	.	.	.	.	.	.	.	.	.	A	14.16	2.451128	0.43531	.	.	ENSG00000122025	ENST00000241453;ENST00000380982;ENST00000537084	T;T;T	0.77098	-1.0;-1.07;-0.79	5.62	4.39	0.52855	.	0.370601	0.26324	N	0.025031	T	0.59582	0.2204	N	0.22421	0.69	0.28042	N	0.933702	B;B	0.30664	0.014;0.289	B;B	0.23275	0.014;0.045	T	0.50608	-0.8808	10	0.19590	T	0.45	.	10.0892	0.42436	0.8513:0.0:0.0:0.1487	.	535;535	P36888-2;P36888	.;FLT3_HUMAN	S	535	ENSP00000241453:F535S;ENSP00000370369:F535S;ENSP00000438139:F535S	ENSP00000241453:F535S	F	-	2	0	FLT3	27506538	1.000000	0.71417	1.000000	0.80357	0.905000	0.53344	4.966000	0.63715	2.139000	0.66308	0.533000	0.62120	TTC	.	.		0.388	FLT3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000044319.2		
RB1	5925	hgsc.bcm.edu	37	13	49027248	49027248	+	Splice_Site	SNP	G	G	A			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr13:49027248G>A	ENST00000267163.4	+	18	1952		c.e18+1			NM_000321.2	NP_000312.2	P06400	RB_HUMAN	retinoblastoma 1						androgen receptor signaling pathway (GO:0030521)|cell cycle arrest (GO:0007050)|cell cycle checkpoint (GO:0000075)|cell morphogenesis involved in neuron differentiation (GO:0048667)|chromatin remodeling (GO:0006338)|digestive tract development (GO:0048565)|enucleate erythrocyte differentiation (GO:0043353)|G1/S transition of mitotic cell cycle (GO:0000082)|glial cell apoptotic process (GO:0034349)|hepatocyte apoptotic process (GO:0097284)|maintenance of mitotic sister chromatid cohesion (GO:0034088)|mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|myoblast differentiation (GO:0045445)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter during mitosis (GO:0007070)|negative regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0071930)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron apoptotic process (GO:0051402)|neuron maturation (GO:0042551)|neuron projection development (GO:0031175)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein localization to chromosome, centromeric region (GO:0071459)|Ras protein signal transduction (GO:0007265)|regulation of centromere complex assembly (GO:0090230)|regulation of cohesin localization to chromatin (GO:0071922)|regulation of lipid kinase activity (GO:0043550)|regulation of mitotic cell cycle (GO:0007346)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|sister chromatid biorientation (GO:0031134)|skeletal muscle cell differentiation (GO:0035914)|striated muscle cell differentiation (GO:0051146)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	chromatin (GO:0000785)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|Rb-E2F complex (GO:0035189)|spindle (GO:0005819)|SWI/SNF complex (GO:0016514)	androgen receptor binding (GO:0050681)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|identical protein binding (GO:0042802)|kinase binding (GO:0019900)|phosphoprotein binding (GO:0051219)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|ubiquitin protein ligase binding (GO:0031625)	p.0?(15)|p.?(12)		NS(3)|adrenal_gland(1)|bone(22)|breast(30)|central_nervous_system(48)|cervix(3)|endometrium(14)|eye(95)|gastrointestinal_tract_(site_indeterminate)(1)|haematopoietic_and_lymphoid_tissue(20)|kidney(3)|large_intestine(10)|liver(3)|lung(153)|oesophagus(1)|ovary(13)|pancreas(5)|pituitary(1)|prostate(14)|salivary_gland(2)|skin(9)|soft_tissue(9)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(31)	496		all_cancers(8;6.9e-71)|all_epithelial(8;4.61e-22)|Acute lymphoblastic leukemia(8;1.1e-21)|all_hematologic(8;2.3e-21)|all_lung(13;1.51e-09)|Lung NSC(96;7.03e-07)|Breast(56;1.53e-05)|Prostate(109;0.000493)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|all_neural(104;0.0227)|Glioma(44;0.0286)|Lung SC(185;0.0301)		GBM - Glioblastoma multiforme(2;9.98e-18)|LUSC - Lung squamous cell carcinoma(3;0.013)	"""""""Insulin(DB00071)|Insulin Regular(DB00030)"""	CAGCAGATATGTAAGCAAAAT	0.338		6	"""D, Mis, N, F, S"""		"""retinoblastoma, sarcoma, breast, small cell lung"""	"""retinoblastoma, sarcoma, breast, small cell lung"""			Hereditary Retinoblastoma	TCGA GBM(7;6.82e-08)|TSP Lung(12;0.097)|TCGA Ovarian(6;0.080)																											.		Atlas-SNP	.	yes	Rec	yes	Familial retinoblastoma	13	13q14	5925	retinoblastoma gene		"""L, E, M, O"""	RB1_ENST00000267163,bladder,carcinoma,0,1	RB1	1068	.	27	Whole gene deletion(15)|Unknown(12)	bone(10)|haematopoietic_and_lymphoid_tissue(4)|breast(4)|urinary_tract(3)|adrenal_gland(1)|eye(1)|soft_tissue(1)|endometrium(1)|lung(1)|liver(1)	c.1814+1G>A	GRCh37	CS961682	RB1	S		.						85.0	81.0	82.0					13																	49027248		2203	4300	6503	SO:0001630	splice_region_variant	5925	exon18	Familial Cancer Database		AGATATGTAAGCA	M15400	CCDS31973.1	13q14.2	2014-09-17	2008-07-31		ENSG00000139687	ENSG00000139687		"""Endogenous ligands"""	9884	protein-coding gene	gene with protein product	"""prepro-retinoblastoma-associated protein"", ""protein phosphatase 1, regulatory subunit 130"""	614041	"""osteosarcoma"""	OSRC		1857421, 15057823	Standard	NM_000321		Approved	RB, PPP1R130	uc001vcb.3	P06400	OTTHUMG00000016900	ENST00000267163.4:c.1814+1G>A	chr13.hg19:g.49027248G>A		40.0	0.0		24.0	2.0	NM_000321	A8K5E3|P78499|Q5VW46|Q8IZL4	Splice_Site	SNP	ENST00000267163.4	hg19	CCDS31973.1	.	.	.	.	.	.	.	.	.	.	G	23.0	4.362184	0.82353	.	.	ENSG00000139687	ENST00000542917;ENST00000267163	.	.	.	5.75	5.75	0.90469	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.5489	0.95310	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	RB1	47925249	1.000000	0.71417	1.000000	0.80357	0.888000	0.51559	7.717000	0.84732	2.717000	0.92951	0.655000	0.94253	.	.	.		0.338	RB1-002	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000044884.1		Intron
DIAPH3	81624	hgsc.bcm.edu	37	13	60240729	60240729	+	Nonsense_Mutation	SNP	G	G	A	rs546723182		TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr13:60240729G>A	ENST00000400324.4	-	28	3791	c.3571C>T	c.(3571-3573)Cga>Tga	p.R1191*	DIAPH3_ENST00000400320.1_Nonsense_Mutation_p.R1145*|DIAPH3_ENST00000377908.2_Nonsense_Mutation_p.R1180*|DIAPH3_ENST00000400319.1_Nonsense_Mutation_p.R1121*|DIAPH3_ENST00000400330.1_Nonsense_Mutation_p.R1191*	NM_001042517.1|NM_001258366.1	NP_001035982.1|NP_001245295.1	Q9NSV4	DIAP3_HUMAN	diaphanous-related formin 3	1191					actin cytoskeleton organization (GO:0030036)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(7)|liver(1)|lung(20)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	46		Breast(118;0.052)|Prostate(109;0.103)|Hepatocellular(98;0.132)		GBM - Glioblastoma multiforme(99;2.77e-05)		TATAAAGCTCGTAATCTTGCC	0.323																																					p.R1191X		Atlas-SNP	.											DIAPH3,colon,carcinoma,0,1	DIAPH3	139	.	0			c.C3571T						.						66.0	62.0	63.0					13																	60240729		1802	4064	5866	SO:0001587	stop_gained	81624	exon28			AAGCTCGTAATCT	AL137718	CCDS41898.1, CCDS58294.1, CCDS58295.1, CCDS58296.1, CCDS58297.1, CCDS73579.1, CCDS73580.1	13q21.2	2013-05-24	2013-05-24		ENSG00000139734	ENSG00000139734			15480	protein-coding gene	gene with protein product		614567	"""diaphanous (Drosophila, homolog) 3"", ""auditory neuropathy, autosomal dominant 1"", ""diaphanous homolog 3 (Drosophila)"""	AUNA1		14767582, 20624953	Standard	NM_030932		Approved	DRF3, FLJ34705, AN, NSDAN	uc001vht.4	Q9NSV4	OTTHUMG00000017004	ENST00000400324.4:c.3571C>T	chr13.hg19:g.60240729G>A	ENSP00000383178:p.Arg1191*	80.0	0.0		50.0	2.0	NM_001042517	A2A3B8|A2A3B9|A2A3C0|Q18P99|Q18PA0|Q18PA1|Q2KPB6|Q3ZK23|Q5JTP8|Q5T2S7|Q5XKF6|Q6MZF0|Q6NUP0|Q86VS4|Q8NAV4	Nonsense_Mutation	SNP	ENST00000400324.4	hg19	CCDS41898.1	.	.	.	.	.	.	.	.	.	.	G	41	8.741087	0.98935	.	.	ENSG00000139734	ENST00000400324;ENST00000400330;ENST00000400327;ENST00000413168;ENST00000400329;ENST00000377908;ENST00000400319;ENST00000400320	.	.	.	5.55	3.72	0.42706	.	1.783920	0.04654	U	0.407671	.	.	.	.	.	.	0.21064	N	0.999792	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	11.3327	0.49485	0.0696:0.0:0.8023:0.1281	.	.	.	.	X	1191;1191;1180;1145;1121;1180;1121;1145	.	ENSP00000367141:R1180X	R	-	1	2	DIAPH3	59138730	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.694000	0.47035	2.602000	0.87976	0.655000	0.94253	CGA	.	.		0.323	DIAPH3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000045166.3	NM_001042517	
SLITRK6	84189	hgsc.bcm.edu	37	13	86370190	86370190	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr13:86370190C>T	ENST00000400286.2	-	2	1052	c.454G>A	c.(454-456)Gaa>Aaa	p.E152K		NM_032229.2	NP_115605.2	Q9H5Y7	SLIK6_HUMAN	SLIT and NTRK-like family, member 6	152					adult locomotory behavior (GO:0008344)|auditory behavior (GO:0031223)|auditory receptor cell morphogenesis (GO:0002093)|axonogenesis (GO:0007409)|cochlea development (GO:0090102)|innervation (GO:0060384)|lens development in camera-type eye (GO:0002088)|linear vestibuloocular reflex (GO:0060007)|multicellular organism growth (GO:0035264)|sensory perception of sound (GO:0007605)|startle response (GO:0001964)|synapse assembly (GO:0007416)|vestibulocochlear nerve development (GO:0021562)|visual perception (GO:0007601)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)				breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(13)|lung(18)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_neural(89;0.117)|Medulloblastoma(90;0.163)			GBM - Glioblastoma multiforme(99;0.0456)		GCACTTGGTTCAATCACTGTG	0.353																																					p.E152K		Atlas-SNP	.											.	SLITRK6	150	.	0			c.G454A						.						126.0	119.0	121.0					13																	86370190		1853	4084	5937	SO:0001583	missense	84189	exon2			TTGGTTCAATCAC	AK026427	CCDS41903.1	13q31.1	2006-04-12			ENSG00000184564	ENSG00000184564			23503	protein-coding gene	gene with protein product		609681				14557068	Standard	NM_032229		Approved	FLJ22774	uc001vll.1	Q9H5Y7	OTTHUMG00000017157	ENST00000400286.2:c.454G>A	chr13.hg19:g.86370190C>T	ENSP00000383143:p.Glu152Lys	124.0	0.0		72.0	4.0	NM_032229	A8K9S8|Q495Q0|Q6AW93|Q9HAA8|Q9NT60	Missense_Mutation	SNP	ENST00000400286.2	hg19	CCDS41903.1	.	.	.	.	.	.	.	.	.	.	C	24.0	4.479653	0.84747	.	.	ENSG00000184564	ENST00000400286	T	0.53206	0.63	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	T	0.57460	0.2055	N	0.24115	0.695	0.80722	D	1	D	0.76494	0.999	D	0.83275	0.996	T	0.51810	-0.8658	10	0.33940	T	0.23	-20.3885	19.4432	0.94831	0.0:1.0:0.0:0.0	.	152	Q9H5Y7	SLIK6_HUMAN	K	152	ENSP00000383143:E152K	ENSP00000383143:E152K	E	-	1	0	SLITRK6	85268191	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.818000	0.86416	2.941000	0.99782	0.655000	0.94253	GAA	.	.		0.353	SLITRK6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045404.2	NM_032229	
FARP1	10160	hgsc.bcm.edu	37	13	99038053	99038053	+	Silent	SNP	A	A	T			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr13:99038053A>T	ENST00000319562.6	+	8	1009	c.744A>T	c.(742-744)ggA>ggT	p.G248G	FARP1_ENST00000595437.1_Silent_p.G248G|FARP1_ENST00000376586.2_Silent_p.G248G	NM_005766.2	NP_005757.1	Q9Y4F1	FARP1_HUMAN	FERM, RhoGEF (ARHGEF) and pleckstrin domain protein 1 (chondrocyte-derived)	248	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				dendrite morphogenesis (GO:0048813)|negative regulation of phosphatase activity (GO:0010923)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rho GTPase activity (GO:0032321)|synapse assembly (GO:0007416)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendrite (GO:0030425)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|synapse (GO:0045202)	Rac guanyl-nucleotide exchange factor activity (GO:0030676)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(3)|endometrium(6)|kidney(6)|large_intestine(13)|lung(16)|ovary(1)|skin(3)|urinary_tract(1)	49	all_neural(89;0.0982)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)		BRCA - Breast invasive adenocarcinoma(86;0.233)			CCAACACGGGAATTCTAGTGT	0.537																																					p.G248G		Atlas-SNP	.											.	FARP1	207	.	0			c.A744T						.						99.0	85.0	90.0					13																	99038053		2203	4300	6503	SO:0001819	synonymous_variant	10160	exon8			CACGGGAATTCTA	AB008430	CCDS9487.1, CCDS32000.1, CCDS66572.1	13q32.2	2013-01-10			ENSG00000152767	ENSG00000152767		"""Rho guanine nucleotide exchange factors"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Pleckstrin homology (PH) domain containing"""	3591	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 75"""	602654				9425278	Standard	NM_005766		Approved	CDEP, PLEKHC2, MGC87400, PPP1R75	uc001vnj.3	Q9Y4F1	OTTHUMG00000017248	ENST00000319562.6:c.744A>T	chr13.hg19:g.99038053A>T		25.0	0.0		39.0	20.0	NM_005766	Q5JVI9|Q6IQ29	Silent	SNP	ENST00000319562.6	hg19	CCDS9487.1																																																																																			.	.		0.537	FARP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045541.3	NM_005766	
TM9SF2	9375	hgsc.bcm.edu	37	13	100172292	100172292	+	Missense_Mutation	SNP	T	T	C	rs376468098		TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr13:100172292T>C	ENST00000376387.4	+	3	432	c.242T>C	c.(241-243)tTt>tCt	p.F81S	TM9SF2_ENST00000463709.1_3'UTR	NM_004800.1	NP_004791.1	Q99805	TM9S2_HUMAN	transmembrane 9 superfamily member 2	81					transport (GO:0006810)	endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)				endometrium(3)|kidney(1)|large_intestine(5)|lung(5)|ovary(1)|prostate(2)	17	all_neural(89;0.0837)|Medulloblastoma(90;0.18)|Lung SC(71;0.218)					TCTCCCAGGTTTGATTTTTGC	0.368																																					p.F81S		Atlas-SNP	.											.	TM9SF2	52	.	0			c.T242C						.						67.0	67.0	67.0					13																	100172292		2203	4300	6503	SO:0001583	missense	9375	exon3			CCAGGTTTGATTT	U81006	CCDS9493.1	13q32.2	2011-03-28			ENSG00000125304	ENSG00000125304			11865	protein-coding gene	gene with protein product		604678				9729438	Standard	NM_004800		Approved	P76	uc001voj.2	Q99805	OTTHUMG00000017272	ENST00000376387.4:c.242T>C	chr13.hg19:g.100172292T>C	ENSP00000365567:p.Phe81Ser	75.0	0.0		86.0	4.0	NM_004800	A8K399|Q2TAY5	Missense_Mutation	SNP	ENST00000376387.4	hg19	CCDS9493.1	.	.	.	.	.	.	.	.	.	.	T	20.8	4.046988	0.75846	.	.	ENSG00000125304	ENST00000376387	T	0.50277	0.75	5.75	5.75	0.90469	.	0.045387	0.85682	D	0.000000	T	0.71929	0.3398	H	0.95611	3.695	0.80722	D	1	D;P	0.52996	0.957;0.721	P;P	0.52267	0.694;0.694	T	0.81961	-0.0693	10	0.87932	D	0	-19.6936	16.0933	0.81104	0.0:0.0:0.0:1.0	.	81;81	E9PHW5;Q99805	.;TM9S2_HUMAN	S	81	ENSP00000365567:F81S	ENSP00000365567:F81S	F	+	2	0	TM9SF2	98970293	1.000000	0.71417	1.000000	0.80357	0.733000	0.41908	6.592000	0.74095	2.207000	0.71202	0.477000	0.44152	TTT	.	.		0.368	TM9SF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045602.3		
F10	2159	hgsc.bcm.edu	37	13	113803258	113803258	+	Silent	SNP	C	C	T			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr13:113803258C>T	ENST00000375559.3	+	8	932	c.894C>T	c.(892-894)ggC>ggT	p.G298G	F10_ENST00000375551.3_Missense_Mutation_p.A295V|F10_ENST00000409306.1_Missense_Mutation_p.A297V	NM_000504.3	NP_000495.1	P00742	FA10_HUMAN	coagulation factor X	298	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				blood coagulation (GO:0007596)|blood coagulation, extrinsic pathway (GO:0007598)|blood coagulation, intrinsic pathway (GO:0007597)|cellular protein metabolic process (GO:0044267)|peptidyl-glutamic acid carboxylation (GO:0017187)|positive regulation of cell migration (GO:0030335)|positive regulation of protein kinase B signaling (GO:0051897)|post-translational protein modification (GO:0043687)|proteolysis (GO:0006508)	endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|intrinsic component of external side of plasma membrane (GO:0031233)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|phospholipid binding (GO:0005543)|serine-type endopeptidase activity (GO:0004252)			endometrium(2)|large_intestine(4)|lung(10)|pancreas(1)|stomach(1)	18	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)	all_cancers(25;0.113)|all_lung(25;0.0364)|all_epithelial(44;0.0373)|Lung NSC(25;0.128)|Breast(118;0.188)	all cancers(43;0.0805)|Epithelial(84;0.231)		Antihemophilic Factor(DB00025)|Apixaban(DB06605)|Coagulation Factor IX(DB00100)|Coagulation factor VIIa(DB00036)|Enoxaparin(DB01225)|Fondaparinux sodium(DB00569)|Heparin(DB01109)|Menadione(DB00170)|Rivaroxaban(DB06228)	AGGAGGAGGGCGGTGAGGCGG	0.607																																					p.G298G		Atlas-SNP	.											.	F10	53	.	0			c.C894T						.						161.0	136.0	144.0					13																	113803258		2203	4300	6503	SO:0001819	synonymous_variant	2159	exon8			GGAGGGCGGTGAG		CCDS9530.1	13q34	2012-10-02			ENSG00000126218	ENSG00000126218	3.4.21.6		3528	protein-coding gene	gene with protein product		613872					Standard	XM_005268298		Approved		uc001vsx.3	P00742	OTTHUMG00000017374	ENST00000375559.3:c.894C>T	chr13.hg19:g.113803258C>T		361.0	0.0		420.0	26.0	NM_000504	Q14340	Silent	SNP	ENST00000375559.3	hg19	CCDS9530.1	.	.	.	.	.	.	.	.	.	.	C	0.094	-1.162845	0.01673	.	.	ENSG00000126218	ENST00000409306;ENST00000375551	D;D	0.95656	-3.71;-3.77	4.99	-0.441	0.12257	.	.	.	.	.	D	0.90710	0.7085	.	.	.	0.09310	N	1	P;P	0.44006	0.824;0.824	B;B	0.41135	0.24;0.348	T	0.82995	-0.0180	8	0.38643	T	0.18	.	5.7129	0.17945	0.2181:0.3549:0.359:0.0681	.	297;295	B7ZBK1;Q5JVE8	.;.	V	297;295	ENSP00000387092:A297V;ENSP00000364701:A295V	ENSP00000364701:A295V	A	+	2	0	F10	112851259	0.244000	0.23889	0.153000	0.22517	0.139000	0.21198	0.516000	0.22817	0.101000	0.17610	0.313000	0.20887	GCG	.	.		0.607	F10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045841.3		
DCUN1D2	55208	hgsc.bcm.edu	37	13	114112422	114112422	+	Splice_Site	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr13:114112422T>C	ENST00000478244.1	-	7	984	c.702A>G	c.(700-702)ggA>ggG	p.G234G	DCUN1D2_ENST00000332592.3_Splice_Site_p.G101G	NM_001014283.1	NP_001014305.1	Q6PH85	DCNL2_HUMAN	DCN1, defective in cullin neddylation 1, domain containing 2	234	DCUN1. {ECO:0000255|PROSITE- ProRule:PRU00574}.									breast(1)|endometrium(1)|large_intestine(1)|lung(3)|stomach(1)	7	Lung NSC(43;0.0161)|all_neural(89;0.0337)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.0395)|all_epithelial(44;0.011)|all_lung(25;0.0271)|Lung NSC(25;0.0977)|Breast(118;0.188)	all cancers(43;0.029)|GBM - Glioblastoma multiforme(44;0.234)			CGGGCCAAGCTCCTAAAGGAA	0.438											OREG0022535	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.G234G		Atlas-SNP	.											.	DCUN1D2	17	.	0			c.A702G						.						152.0	157.0	155.0					13																	114112422		2203	4300	6503	SO:0001630	splice_region_variant	55208	exon7			CCAAGCTCCTAAA	AK001566	CCDS32013.1	13q34	2013-06-10	2013-06-10	2005-10-04	ENSG00000150401	ENSG00000150401			20328	protein-coding gene	gene with protein product			"""chromosome 13 open reading frame 17"", ""DCN1, defective in cullin neddylation 1, domain containing 2 (S. cerevisiae)"""	C13orf17		15988528	Standard	XM_005268320		Approved	FLJ10704, FLJ20092	uc001vtr.1	Q6PH85	OTTHUMG00000017390	ENST00000478244.1:c.701-1A>G	chr13.hg19:g.114112422T>C		79.0	0.0	1455	89.0	5.0	NM_001014283	Q5JSA5|Q5JSA6|Q5JSA7|Q9NVJ1|Q9NXR6	Silent	SNP	ENST00000478244.1	hg19	CCDS32013.1																																																																																			.	.		0.438	DCUN1D2-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045938.4	NM_018185	Silent
OR11H6	122748	hgsc.bcm.edu	37	14	20692756	20692756	+	Silent	SNP	C	C	T			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr14:20692756C>T	ENST00000315519.2	+	1	966	c.888C>T	c.(886-888)taC>taT	p.Y296Y		NM_001004480.1	NP_001004480.1	Q8NGC7	O11H6_HUMAN	olfactory receptor, family 11, subfamily H, member 6	296						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			cervix(1)|endometrium(2)|kidney(1)|large_intestine(6)|liver(1)|lung(13)|ovary(2)|prostate(1)|skin(2)	29	all_cancers(95;0.00108)		Epithelial(56;1.75e-06)|all cancers(55;1.22e-05)	GBM - Glioblastoma multiforme(265;0.0143)		CTCTGGTATACACAGCAATGA	0.423																																					p.Y296Y		Atlas-SNP	.											.	OR11H6	60	.	0			c.C888T						.						116.0	112.0	113.0					14																	20692756		2203	4300	6503	SO:0001819	synonymous_variant	122748	exon1			GGTATACACAGCA		CCDS32033.1	14q11.2	2013-09-24			ENSG00000176219	ENSG00000176219		"""GPCR / Class A : Olfactory receptors"""	15349	protein-coding gene	gene with protein product							Standard	NM_001004480		Approved		uc010tlc.2	Q8NGC7	OTTHUMG00000170850	ENST00000315519.2:c.888C>T	chr14.hg19:g.20692756C>T		117.0	0.0		97.0	4.0	NM_001004480	Q6IF08	Silent	SNP	ENST00000315519.2	hg19	CCDS32033.1																																																																																			.	.		0.423	OR11H6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410676.1		
TEP1	7011	hgsc.bcm.edu	37	14	20859791	20859791	+	Silent	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr14:20859791T>C	ENST00000262715.5	-	13	2104	c.2064A>G	c.(2062-2064)gcA>gcG	p.A688A	TEP1_ENST00000556935.1_Silent_p.A580A	NM_007110.4	NP_009041.2	Q99973	TEP1_HUMAN	telomerase-associated protein 1	688					RNA-dependent DNA replication (GO:0006278)|telomere maintenance via recombination (GO:0000722)	chromosome, telomeric region (GO:0000781)|cytoplasm (GO:0005737)|nuclear matrix (GO:0016363)|ribonucleoprotein complex (GO:0030529)|telomerase holoenzyme complex (GO:0005697)	ATP binding (GO:0005524)|RNA binding (GO:0003723)			NS(4)|breast(1)|central_nervous_system(4)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(48)|ovary(7)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	96	all_cancers(95;0.00123)	all_lung(585;0.235)	Epithelial(56;7.42e-08)|all cancers(55;6.46e-07)	GBM - Glioblastoma multiforme(265;0.028)|READ - Rectum adenocarcinoma(17;0.233)		AGAGCCTGTCTGCATTAGCAT	0.542																																					p.A688A		Atlas-SNP	.											.	TEP1	224	.	0			c.A2064G						.						150.0	131.0	137.0					14																	20859791		2203	4300	6503	SO:0001819	synonymous_variant	7011	exon13			CCTGTCTGCATTA		CCDS9548.1	14q11.2	2013-01-10			ENSG00000129566	ENSG00000129566		"""WD repeat domain containing"""	11726	protein-coding gene	gene with protein product	"""TROVE domain family, member 1"""	601686				9403057	Standard	NM_007110		Approved	TP1, TLP1, VAULT2, p240, TROVE1	uc001vxe.3	Q99973	OTTHUMG00000029515	ENST00000262715.5:c.2064A>G	chr14.hg19:g.20859791T>C		149.0	0.0		72.0	4.0	NM_007110	A0AUV9	Silent	SNP	ENST00000262715.5	hg19	CCDS9548.1																																																																																			.	.		0.542	TEP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000073563.2	NM_007110	
ACIN1	22985	hgsc.bcm.edu	37	14	23530644	23530644	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr14:23530644T>C	ENST00000262710.1	-	17	3788	c.3461A>G	c.(3460-3462)gAg>gGg	p.E1154G	ACIN1_ENST00000357481.2_Missense_Mutation_p.E396G|ACIN1_ENST00000557515.1_Missense_Mutation_p.E395G|ACIN1_ENST00000397341.3_Missense_Mutation_p.E396G|ACIN1_ENST00000457657.1_Missense_Mutation_p.E1114G|ACIN1_ENST00000605057.1_Missense_Mutation_p.E1096G|ACIN1_ENST00000555053.1_Missense_Mutation_p.E1141G|ACIN1_ENST00000338631.6_Missense_Mutation_p.E427G	NM_001164814.1|NM_014977.3	NP_001158286.1|NP_055792	Q9UKV3	ACINU_HUMAN	apoptotic chromatin condensation inducer 1	1154	Arg/Asp/Glu/Lys-rich.				apoptotic chromosome condensation (GO:0030263)|apoptotic process (GO:0006915)|ATP catabolic process (GO:0006200)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|erythrocyte differentiation (GO:0030218)|mRNA processing (GO:0006397)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|positive regulation of apoptotic process (GO:0043065)|positive regulation of monocyte differentiation (GO:0045657)|RNA splicing (GO:0008380)	ASAP complex (GO:0061574)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATPase activity (GO:0016887)|enzyme binding (GO:0019899)|nucleic acid binding (GO:0003676)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(6)|kidney(4)|large_intestine(9)|lung(10)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	37	all_cancers(95;1.36e-05)			GBM - Glioblastoma multiforme(265;0.00816)		CTCCCGCCGCTCCATTTCCCG	0.677																																					p.E1154G		Atlas-SNP	.											.	ACIN1	147	.	0			c.A3461G						.						62.0	65.0	64.0					14																	23530644		2203	4300	6503	SO:0001583	missense	22985	exon17			CGCCGCTCCATTT	AB014570	CCDS9587.1, CCDS53887.1, CCDS53888.1, CCDS53889.1, CCDS55905.1	14q11.2	2008-11-25	2004-03-31	2004-04-01	ENSG00000100813	ENSG00000100813			17066	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 152"""	604562	"""apoptotic chromatin condensation inducer in the nucleus"""	ACINUS		9734811, 10490026	Standard	NM_014977		Approved	KIAA0670, fSAP152	uc001wit.4	Q9UKV3	OTTHUMG00000028716	ENST00000262710.1:c.3461A>G	chr14.hg19:g.23530644T>C	ENSP00000262710:p.Glu1154Gly	136.0	0.0		89.0	4.0	NM_014977	B2RTT4|D3DS45|O75158|Q9UG91|Q9UKV1|Q9UKV2	Missense_Mutation	SNP	ENST00000262710.1	hg19	CCDS9587.1	.	.	.	.	.	.	.	.	.	.	T	22.6	4.306310	0.81247	.	.	ENSG00000100813	ENST00000557515;ENST00000338631;ENST00000357481;ENST00000262710;ENST00000457657;ENST00000397341;ENST00000555053	T;T;T;T;T;T;T	0.08008	3.14;3.14;3.14;3.14;3.14;3.14;3.14	4.79	3.63	0.41609	.	0.000000	0.40064	N	0.001186	T	0.16257	0.0391	L	0.52573	1.65	0.54753	D	0.999981	D;D;P;P;P	0.59767	0.986;0.976;0.935;0.844;0.844	P;P;P;B;B	0.58721	0.844;0.703;0.575;0.347;0.347	T	0.01252	-1.1405	10	0.36615	T	0.2	-13.8898	9.8837	0.41249	0.0:0.0831:0.0:0.9169	.	1141;1154;1114;427;396	G3V3M7;Q9UKV3;E7EQT4;Q9UKV3-2;Q9UKV3-3	.;ACINU_HUMAN;.;.;.	G	395;427;396;1154;1114;396;1141	ENSP00000451138:E395G;ENSP00000345541:E427G;ENSP00000350073:E396G;ENSP00000262710:E1154G;ENSP00000405677:E1114G;ENSP00000380502:E396G;ENSP00000451328:E1141G	ENSP00000262710:E1154G	E	-	2	0	ACIN1	22600484	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.439000	0.73430	0.940000	0.37473	0.460000	0.39030	GAG	.	.		0.677	ACIN1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000071707.3	NM_014977	
NYNRIN	57523	hgsc.bcm.edu	37	14	24884365	24884365	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr14:24884365C>T	ENST00000382554.3	+	9	3728	c.3410C>T	c.(3409-3411)gCc>gTc	p.A1137V		NM_025081.2	NP_079357.2	Q9P2P1	NYNRI_HUMAN	NYN domain and retroviral integrase containing	1137					DNA integration (GO:0015074)	integral component of membrane (GO:0016021)	nucleic acid binding (GO:0003676)			breast(3)|central_nervous_system(1)|endometrium(7)|kidney(6)|large_intestine(8)|lung(21)|ovary(2)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	56						CATGAGGAGGCCTTCCTGGCC	0.657																																					p.A1137V		Atlas-SNP	.											.	NYNRIN	120	.	0			c.C3410T						.						37.0	43.0	41.0					14																	24884365		2089	4196	6285	SO:0001583	missense	57523	exon9			AGGAGGCCTTCCT	AB037726	CCDS45090.1	14q11.2	2009-10-14	2009-10-14	2009-10-14		ENSG00000205978			20165	protein-coding gene	gene with protein product	"""Cousin of GIN1"""		"""KIAA1305"""	KIAA1305		19561090, 17114934	Standard	NM_025081		Approved	FLJ11811, CGIN1	uc001wpf.4	Q9P2P1		ENST00000382554.3:c.3410C>T	chr14.hg19:g.24884365C>T	ENSP00000371994:p.Ala1137Val	36.0	0.0		15.0	12.0	NM_025081	Q6P153|Q86TR3|Q9HAC4	Missense_Mutation	SNP	ENST00000382554.3	hg19	CCDS45090.1	.	.	.	.	.	.	.	.	.	.	C	18.92	3.725702	0.69074	.	.	ENSG00000205978	ENST00000382554	T	0.54279	0.58	4.61	4.61	0.57282	.	.	.	.	.	T	0.60945	0.2308	M	0.72353	2.195	0.26064	N	0.981317	D	0.54047	0.964	P	0.49561	0.615	T	0.58702	-0.7590	9	0.87932	D	0	.	12.8162	0.57667	0.0:1.0:0.0:0.0	.	1137	Q9P2P1	NYNRI_HUMAN	V	1137	ENSP00000371994:A1137V	ENSP00000371994:A1137V	A	+	2	0	NYNRIN	23954205	0.997000	0.39634	1.000000	0.80357	0.987000	0.75469	3.304000	0.51866	2.379000	0.81126	0.561000	0.74099	GCC	.	.		0.657	NYNRIN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412939.1		
NYNRIN	57523	hgsc.bcm.edu	37	14	24885708	24885708	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr14:24885708A>G	ENST00000382554.3	+	9	5071	c.4753A>G	c.(4753-4755)Agc>Ggc	p.S1585G		NM_025081.2	NP_079357.2	Q9P2P1	NYNRI_HUMAN	NYN domain and retroviral integrase containing	1585					DNA integration (GO:0015074)	integral component of membrane (GO:0016021)	nucleic acid binding (GO:0003676)			breast(3)|central_nervous_system(1)|endometrium(7)|kidney(6)|large_intestine(8)|lung(21)|ovary(2)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	56						TTACTGCAGGAGCTGCTTGTT	0.587																																					p.S1585G		Atlas-SNP	.											.	NYNRIN	120	.	0			c.A4753G						.						49.0	52.0	51.0					14																	24885708		2015	4170	6185	SO:0001583	missense	57523	exon9			TGCAGGAGCTGCT	AB037726	CCDS45090.1	14q11.2	2009-10-14	2009-10-14	2009-10-14		ENSG00000205978			20165	protein-coding gene	gene with protein product	"""Cousin of GIN1"""		"""KIAA1305"""	KIAA1305		19561090, 17114934	Standard	NM_025081		Approved	FLJ11811, CGIN1	uc001wpf.4	Q9P2P1		ENST00000382554.3:c.4753A>G	chr14.hg19:g.24885708A>G	ENSP00000371994:p.Ser1585Gly	83.0	0.0		55.0	4.0	NM_025081	Q6P153|Q86TR3|Q9HAC4	Missense_Mutation	SNP	ENST00000382554.3	hg19	CCDS45090.1	.	.	.	.	.	.	.	.	.	.	A	11.00	1.511102	0.27036	.	.	ENSG00000205978	ENST00000382554;ENST00000206466	T	0.10573	2.86	5.25	4.05	0.47172	.	0.195318	0.31660	N	0.007269	T	0.05090	0.0136	N	0.12887	0.27	0.24807	N	0.992663	P	0.42409	0.779	B	0.37989	0.262	T	0.26643	-1.0097	10	0.48119	T	0.1	.	4.6423	0.12555	0.743:0.0:0.0889:0.1681	.	1585	Q9P2P1	NYNRI_HUMAN	G	1585;114	ENSP00000371994:S1585G	ENSP00000206466:S114G	S	+	1	0	NYNRIN	23955548	1.000000	0.71417	1.000000	0.80357	0.195000	0.23768	2.786000	0.47790	2.194000	0.70268	0.533000	0.62120	AGC	.	.		0.587	NYNRIN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412939.1		
STRN3	29966	hgsc.bcm.edu	37	14	31425396	31425396	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr14:31425396T>C	ENST00000357479.5	-	2	531	c.335A>G	c.(334-336)aAg>aGg	p.K112R	STRN3_ENST00000355683.5_Missense_Mutation_p.K112R	NM_001083893.1	NP_001077362.1	Q13033	STRN3_HUMAN	striatin, calmodulin binding protein 3	112					negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to estradiol (GO:0032355)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|Golgi apparatus (GO:0005794)|neuronal cell body (GO:0043025)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	armadillo repeat domain binding (GO:0070016)|calmodulin binding (GO:0005516)|protein complex binding (GO:0032403)|protein phosphatase 2A binding (GO:0051721)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(1)|endometrium(2)|kidney(3)|large_intestine(2)|lung(7)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	20	Hepatocellular(127;0.0877)|Breast(36;0.148)		LUAD - Lung adenocarcinoma(48;0.00192)|Lung(238;0.0119)|BRCA - Breast invasive adenocarcinoma(188;0.0805)	GBM - Glioblastoma multiforme(265;0.0124)		TACTAAGTCCTTCTTCAGGTT	0.323																																					p.K112R		Atlas-SNP	.											.	STRN3	117	.	0			c.A335G						.						173.0	148.0	157.0					14																	31425396		2203	4298	6501	SO:0001583	missense	29966	exon2			AAGTCCTTCTTCA		CCDS9641.1, CCDS41938.1	14q13-q21	2013-01-10			ENSG00000196792	ENSG00000196792		"""WD repeat domain containing"""	15720	protein-coding gene	gene with protein product	"""cell cycle S/G2 nuclear autoantigen"""	614766				7864889, 10681496	Standard	NM_014574		Approved	SG2NA	uc001wqu.2	Q13033	OTTHUMG00000140201	ENST00000357479.5:c.335A>G	chr14.hg19:g.31425396T>C	ENSP00000350071:p.Lys112Arg	148.0	0.0		93.0	4.0	NM_001083893	A2RTX7|A6NHZ7|Q9NRA5	Missense_Mutation	SNP	ENST00000357479.5	hg19	CCDS41938.1	.	.	.	.	.	.	.	.	.	.	t	15.92	2.976434	0.53720	.	.	ENSG00000196792	ENST00000355683;ENST00000357479	D;D	0.85258	-1.96;-1.96	5.26	5.26	0.73747	Striatin, N-terminal (1);	0.086613	0.85682	D	0.000000	T	0.80639	0.4661	L	0.48174	1.505	0.41730	D	0.989555	B;P	0.37914	0.372;0.611	B;B	0.36959	0.114;0.237	T	0.78420	-0.2211	10	0.19147	T	0.46	-6.4889	15.4709	0.75439	0.0:0.0:0.0:1.0	.	112;112	Q13033-2;Q13033	.;STRN3_HUMAN	R	112	ENSP00000347909:K112R;ENSP00000350071:K112R	ENSP00000347909:K112R	K	-	2	0	STRN3	30495147	1.000000	0.71417	1.000000	0.80357	0.905000	0.53344	6.102000	0.71486	2.111000	0.64477	0.454000	0.30748	AAG	.	.		0.323	STRN3-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409713.1	NM_014574	
HECTD1	25831	hgsc.bcm.edu	37	14	31583498	31583498	+	Silent	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr14:31583498T>C	ENST00000399332.1	-	31	6155	c.5667A>G	c.(5665-5667)ggA>ggG	p.G1889G	HECTD1_ENST00000553700.1_Silent_p.G1889G	NM_015382.2	NP_056197.2	Q9ULT8	HECD1_HUMAN	HECT domain containing E3 ubiquitin protein ligase 1	1889					neural tube closure (GO:0001843)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|metal ion binding (GO:0046872)|ubiquitin-protein transferase activity (GO:0004842)			breast(10)|endometrium(7)|kidney(5)|large_intestine(12)|lung(23)|ovary(4)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	70	Hepatocellular(127;0.0877)|Breast(36;0.176)		LUAD - Lung adenocarcinoma(48;0.00292)|Lung(238;0.0164)|BRCA - Breast invasive adenocarcinoma(188;0.111)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.00617)		TTACCATTTTTCCATTTTCCT	0.274																																					p.G1889G		Atlas-SNP	.											.	HECTD1	159	.	0			c.A5667G						.						78.0	68.0	71.0					14																	31583498		1803	4059	5862	SO:0001819	synonymous_variant	25831	exon31			CATTTTTCCATTT	AB032957	CCDS41939.1	14q12	2013-01-10	2012-02-23		ENSG00000092148	ENSG00000092148		"""Ankyrin repeat domain containing"""	20157	protein-coding gene	gene with protein product			"""HECT domain containing 1"""			10574461	Standard	XM_005267502		Approved	KIAA1131	uc001wrc.1	Q9ULT8	OTTHUMG00000170670	ENST00000399332.1:c.5667A>G	chr14.hg19:g.31583498T>C		204.0	0.0		98.0	4.0	NM_015382	D3DS86|Q6P445|Q86VJ1|Q96F34|Q9UFZ7	Silent	SNP	ENST00000399332.1	hg19	CCDS41939.1	.	.	.	.	.	.	.	.	.	.	T	5.688	0.311445	0.10789	.	.	ENSG00000092148	ENST00000554882	.	.	.	5.72	1.68	0.24146	.	.	.	.	.	T	0.51295	0.1666	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.34428	-0.9829	4	.	.	.	-12.7179	4.976	0.14140	0.0:0.2838:0.1454:0.5707	.	.	.	.	G	255	.	.	E	-	2	0	HECTD1	30653249	1.000000	0.71417	0.999000	0.59377	0.994000	0.84299	0.770000	0.26618	0.036000	0.15547	0.482000	0.46254	GAA	.	.		0.274	HECTD1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409942.1		
DTD2	112487	hgsc.bcm.edu	37	14	31917645	31917645	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr14:31917645T>C	ENST00000310850.4	-	3	313	c.197A>G	c.(196-198)aAt>aGt	p.N66S	CTD-2213F21.2_ENST00000502430.2_RNA|RP11-176H8.1_ENST00000547378.1_Intron|DTD2_ENST00000356180.4_Missense_Mutation_p.N66S	NM_080664.2	NP_542395.1	Q96FN9	DTD2_HUMAN	D-tyrosyl-tRNA deacylase 2 (putative)	66					D-amino acid catabolic process (GO:0019478)	cytoplasm (GO:0005737)	hydrolase activity, acting on ester bonds (GO:0016788)										TAATTTCACATTTAACAGTGT	0.358																																					p.N66S		Atlas-SNP	.											.	.	.	.	0			c.A197G						.						74.0	78.0	77.0					14																	31917645		2203	4300	6503	SO:0001583	missense	112487	exon3			TTCACATTTAACA	BC010618	CCDS9643.1	14q12	2012-09-25	2012-09-25	2012-09-25	ENSG00000129480	ENSG00000129480			20277	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 126"""	C14orf126			Standard	NM_080664		Approved	MGC9912	uc001wrj.3	Q96FN9	OTTHUMG00000140205	ENST00000310850.4:c.197A>G	chr14.hg19:g.31917645T>C	ENSP00000312224:p.Asn66Ser	123.0	0.0		74.0	4.0	NM_080664	D3DS87	Missense_Mutation	SNP	ENST00000310850.4	hg19	CCDS9643.1	.	.	.	.	.	.	.	.	.	.	T	15.34	2.803867	0.50315	.	.	ENSG00000129480	ENST00000310850;ENST00000356180	T;T	0.49432	0.78;0.78	5.96	5.96	0.96718	D-Tyr tRNAtyr deacylase-like domain (2);	0.041873	0.85682	D	0.000000	T	0.46870	0.1415	L	0.55213	1.73	0.53688	D	0.999975	P	0.40909	0.732	B	0.42495	0.389	T	0.49597	-0.8923	10	0.54805	T	0.06	-1.1029	10.7267	0.46072	0.0:0.0707:0.0:0.9293	.	66	Q96FN9	DTD2_HUMAN	S	66	ENSP00000312224:N66S;ENSP00000348503:N66S	ENSP00000312224:N66S	N	-	2	0	C14orf126	30987396	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.606000	0.61126	2.270000	0.75569	0.533000	0.62120	AAT	.	.		0.358	DTD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276614.2	NM_080664	
FANCM	57697	hgsc.bcm.edu	37	14	45644656	45644656	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr14:45644656C>T	ENST00000267430.5	+	14	2784	c.2699C>T	c.(2698-2700)aCa>aTa	p.T900I	FANCM_ENST00000542564.2_Missense_Mutation_p.T874I	NM_020937.2	NP_065988.1	Q8IYD8	FANCM_HUMAN	Fanconi anemia, complementation group M	900					DNA repair (GO:0006281)|replication fork processing (GO:0031297)|resolution of meiotic recombination intermediates (GO:0000712)	FANCM-MHF complex (GO:0071821)|Fanconi anaemia nuclear complex (GO:0043240)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|nuclease activity (GO:0004518)			breast(4)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(18)|liver(2)|lung(31)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(6)|urinary_tract(1)	85						GATAAAAGGACATCAGATACA	0.294								Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																												p.T900I		Atlas-SNP	.											.,1	FANCM	225	.	0			c.C2699T						.						78.0	86.0	84.0					14																	45644656		2203	4293	6496	SO:0001583	missense	57697	exon14	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	AAAGGACATCAGA	AK001672	CCDS32070.1	14q21.3	2014-09-17	2005-09-01	2005-09-01		ENSG00000187790		"""Fanconi anemia, complementation groups"""	23168	protein-coding gene	gene with protein product		609644	"""KIAA1596"""	KIAA1596		10997877, 16116422	Standard	NM_020937		Approved	FAAP250	uc001wwd.4	Q8IYD8		ENST00000267430.5:c.2699C>T	chr14.hg19:g.45644656C>T	ENSP00000267430:p.Thr900Ile	76.0	0.0		30.0	2.0	NM_020937	B2RTQ9|Q3YFH9|Q8N9X6|Q9HCH6	Missense_Mutation	SNP	ENST00000267430.5	hg19	CCDS32070.1	.	.	.	.	.	.	.	.	.	.	C	9.134	1.012218	0.19277	.	.	ENSG00000187790	ENST00000267430;ENST00000542564;ENST00000556250	T;T;T	0.18502	2.82;2.82;2.21	5.24	-2.59	0.06209	.	3.122250	0.00921	N	0.002597	T	0.08268	0.0206	N	0.08118	0	0.09310	N	1	B;B	0.30763	0.294;0.146	B;B	0.14023	0.01;0.01	T	0.28138	-1.0053	10	0.62326	D	0.03	.	6.2592	0.20891	0.0:0.3897:0.1274:0.4828	.	874;900	B2RTQ9;Q8IYD8	.;FANCM_HUMAN	I	900;874;416	ENSP00000267430:T900I;ENSP00000442493:T874I;ENSP00000452033:T416I	ENSP00000267430:T900I	T	+	2	0	FANCM	44714406	0.004000	0.15560	0.000000	0.03702	0.697000	0.40408	-0.116000	0.10724	-0.368000	0.08040	0.591000	0.81541	ACA	.	.		0.294	FANCM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410474.1	XM_048128	
POLE2	5427	hgsc.bcm.edu	37	14	50118040	50118040	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr14:50118040T>C	ENST00000216367.5	-	16	1366	c.1267A>G	c.(1267-1269)Atg>Gtg	p.M423V	POLE2_ENST00000554396.1_Missense_Mutation_p.M423V|POLE2_ENST00000539565.2_Missense_Mutation_p.M397V|POLE2_ENST00000556584.1_5'UTR	NM_002692.3	NP_002683.2	P56282	DPOE2_HUMAN	polymerase (DNA directed), epsilon 2, accessory subunit	423					DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA gap filling (GO:0006297)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|transcription-coupled nucleotide-excision repair (GO:0006283)	epsilon DNA polymerase complex (GO:0008622)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)			kidney(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	10	all_epithelial(31;0.0021)|Breast(41;0.0124)				Cladribine(DB00242)	TTTCTGCACATTTTATTTACT	0.338																																					p.M423V		Atlas-SNP	.											.	POLE2	36	.	0			c.A1267G						.						74.0	75.0	75.0					14																	50118040		2203	4300	6503	SO:0001583	missense	5427	exon16			TGCACATTTTATT	AF025840	CCDS32073.1, CCDS55914.1, CCDS55915.1	14q21-q22	2012-05-18	2012-05-18		ENSG00000100479	ENSG00000100479		"""DNA polymerases"""	9178	protein-coding gene	gene with protein product	"""DNA polymerase epsilon subunit B"""	602670	"""polymerase (DNA directed), epsilon 2 (p59 subunit)"""			9405441, 9443964	Standard	NM_002692		Approved	DPE2	uc001wwu.3	P56282	OTTHUMG00000170813	ENST00000216367.5:c.1267A>G	chr14.hg19:g.50118040T>C	ENSP00000216367:p.Met423Val	159.0	0.0		83.0	4.0	NM_001197331	A0AV55|A4FU92|A4LBB7|A6NH58|B4DDE6|O43560	Missense_Mutation	SNP	ENST00000216367.5	hg19	CCDS32073.1	.	.	.	.	.	.	.	.	.	.	T	15.95	2.984872	0.53934	.	.	ENSG00000100479	ENST00000216367;ENST00000539565;ENST00000554396	T;T;T	0.27557	1.66;1.66;1.66	5.52	5.52	0.82312	DNA polymerase alpha/epsilon, subunit B (1);	0.000000	0.85682	D	0.000000	T	0.43831	0.1265	M	0.79614	2.46	0.58432	D	0.999999	B;B;B	0.18863	0.031;0.01;0.006	B;B;B	0.33846	0.171;0.06;0.032	T	0.41413	-0.9510	10	0.54805	T	0.06	-17.3453	15.938	0.79729	0.0:0.0:0.0:1.0	.	423;397;423	A4FU92;B4DDE6;P56282	.;.;DPOE2_HUMAN	V	423;397;423	ENSP00000216367:M423V;ENSP00000446313:M397V;ENSP00000451621:M423V	ENSP00000216367:M423V	M	-	1	0	POLE2	49187790	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.836000	0.86788	2.222000	0.72286	0.533000	0.62120	ATG	.	.		0.338	POLE2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410512.1	NM_002692	
OTX2	5015	hgsc.bcm.edu	37	14	57268484	57268484	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr14:57268484T>A	ENST00000555006.1	-	4	1247	c.839A>T	c.(838-840)cAg>cTg	p.Q280L	OTX2_ENST00000408990.3_Missense_Mutation_p.Q280L|RP11-1085N6.6_ENST00000602485.1_lincRNA|OTX2_ENST00000339475.5_Missense_Mutation_p.Q288L			P32243	OTX2_HUMAN	orthodenticle homeobox 2	280					axon guidance (GO:0007411)|cell fate specification (GO:0001708)|diencephalon morphogenesis (GO:0048852)|dorsal/ventral pattern formation (GO:0009953)|endoderm development (GO:0007492)|eye photoreceptor cell fate commitment (GO:0042706)|forebrain development (GO:0030900)|inner ear morphogenesis (GO:0042472)|metencephalon development (GO:0022037)|midbrain development (GO:0030901)|neuron fate determination (GO:0048664)|positive regulation of embryonic development (GO:0040019)|positive regulation of gastrulation (GO:2000543)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|primitive streak formation (GO:0090009)|protein complex assembly (GO:0006461)|regulation of fibroblast growth factor receptor signaling pathway (GO:0040036)|regulation of smoothened signaling pathway (GO:0008589)|somite rostral/caudal axis specification (GO:0032525)	cytoplasm (GO:0005737)|growth cone (GO:0030426)|nucleus (GO:0005634)|protein complex (GO:0043234)	eukaryotic initiation factor 4E binding (GO:0008190)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(7)|ovary(1)|prostate(1)|urinary_tract(1)	19	Medulloblastoma(1;0.00184)|all_neural(1;0.00414)					CGAGGATGTCTGATCTTTATA	0.413																																					p.Q288L		Atlas-SNP	.											.	OTX2	47	.	0			c.A863T						.						66.0	70.0	69.0					14																	57268484		2203	4300	6503	SO:0001583	missense	5015	exon3			GATGTCTGATCTT	AF298117	CCDS9728.1, CCDS41960.1	14q22.3	2014-09-17	2007-02-15		ENSG00000165588	ENSG00000165588		"""Homeoboxes / PRD class"""	8522	protein-coding gene	gene with protein product		600037	"""orthodenticle homolog 2 (Drosophila)"""			7959790	Standard	NM_021728		Approved		uc031qor.1	P32243	OTTHUMG00000152338	ENST00000555006.1:c.839A>T	chr14.hg19:g.57268484T>A	ENSP00000452336:p.Gln280Leu	149.0	0.0		78.0	4.0	NM_001270525	B2RAN5|Q6GTV3|Q9HAW3|Q9P2R1	Missense_Mutation	SNP	ENST00000555006.1	hg19	CCDS41960.1	.	.	.	.	.	.	.	.	.	.	T	13.85	2.358934	0.41801	.	.	ENSG00000165588	ENST00000339475;ENST00000408990;ENST00000555006	D;D;D	0.95980	-3.87;-3.83;-3.83	5.65	5.65	0.86999	.	0.378689	0.19745	N	0.107022	D	0.96528	0.8867	M	0.88377	2.95	0.80722	D	1	P;P	0.45902	0.868;0.716	B;P	0.45794	0.358;0.493	D	0.97198	0.9862	10	0.87932	D	0	.	15.2098	0.73214	0.0:0.0:0.0:1.0	.	288;280	F1T0D1;P32243	.;OTX2_HUMAN	L	288;280;280	ENSP00000343819:Q288L;ENSP00000386185:Q280L;ENSP00000452336:Q280L	ENSP00000343819:Q288L	Q	-	2	0	OTX2	56338237	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.857000	0.86963	2.371000	0.80710	0.533000	0.62120	CAG	.	.		0.413	OTX2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411522.1	NM_021728.	
SYNE2	23224	hgsc.bcm.edu	37	14	64641759	64641759	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr14:64641759A>G	ENST00000344113.4	+	95	17545	c.17333A>G	c.(17332-17334)gAg>gGg	p.E5778G	ESR2_ENST00000542956.1_Intron|SYNE2_ENST00000554584.1_Missense_Mutation_p.E5643G|SYNE2_ENST00000555002.1_Missense_Mutation_p.E2412G|SYNE2_ENST00000358025.3_Missense_Mutation_p.E5778G|SYNE2_ENST00000357395.3_Missense_Mutation_p.E2163G|SYNE2_ENST00000394768.2_Missense_Mutation_p.E2163G	NM_015180.4	NP_055995.4	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2	5778					centrosome localization (GO:0051642)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment or maintenance of cell polarity (GO:0007163)|fibroblast migration (GO:0010761)|nuclear envelope organization (GO:0006998)|nuclear migration (GO:0007097)|nuclear migration along microfilament (GO:0031022)|positive regulation of cell migration (GO:0030335)|protein localization to nucleus (GO:0034504)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intermediate filament cytoskeleton (GO:0045111)|lamellipodium membrane (GO:0031258)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nuclear lumen (GO:0031981)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|sarcoplasmic reticulum (GO:0016529)|SUN-KASH complex (GO:0034993)|Z disc (GO:0030018)	actin binding (GO:0003779)			NS(5)|breast(17)|central_nervous_system(3)|cervix(8)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(21)|large_intestine(34)|lung(75)|ovary(10)|pancreas(2)|prostate(8)|skin(8)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(4)	224				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		AAAACTAAAGAGTCTGTGGGT	0.453																																					p.E5778G		Atlas-SNP	.											.	SYNE2	577	.	0			c.A17333G						.						110.0	111.0	111.0					14																	64641759		2203	4300	6503	SO:0001583	missense	23224	exon95			CTAAAGAGTCTGT	AB023228	CCDS9761.2, CCDS41963.1, CCDS45124.1, CCDS45125.1	14q22.1-q22.3	2014-09-17			ENSG00000054654	ENSG00000054654			17084	protein-coding gene	gene with protein product	"""nuclear envelope spectrin repeat-2"", ""nucleus and actin connecting element"""	608442				10231032, 10878022	Standard	NM_182910		Approved	SYNE-2, DKFZP434H2235, Nesprin-2, NUANCE, NUA, KIAA1011, Nesp2	uc001xgl.3	Q8WXH0	OTTHUMG00000140349	ENST00000344113.4:c.17333A>G	chr14.hg19:g.64641759A>G	ENSP00000341781:p.Glu5778Gly	96.0	0.0		59.0	4.0	NM_182914	Q540G1|Q8N1S3|Q8NF49|Q8TER7|Q8WWW3|Q8WWW4|Q8WWW5|Q8WXH1|Q9NU50|Q9UFQ4|Q9Y2L4|Q9Y4R1	Missense_Mutation	SNP	ENST00000344113.4	hg19	CCDS41963.1	.	.	.	.	.	.	.	.	.	.	A	11.81	1.749142	0.30955	.	.	ENSG00000054654	ENST00000358025;ENST00000357395;ENST00000344113;ENST00000554584;ENST00000261678;ENST00000555002;ENST00000394768	T;T;T;T;T;T	0.58060	1.22;1.22;1.22;0.36;1.22;1.22	5.58	4.41	0.53225	.	0.407306	0.21011	N	0.081689	T	0.50086	0.1595	M	0.62723	1.935	0.24361	N	0.994872	B;B;B;B;B	0.31077	0.009;0.001;0.073;0.012;0.307	B;B;B;B;B	0.30572	0.025;0.003;0.037;0.018;0.117	T	0.45775	-0.9238	10	0.46703	T	0.11	.	12.3724	0.55261	0.6757:0.3243:0.0:0.0	.	2163;166;5643;5778;5778	Q8WXH0-7;Q7Z362;G3V5X4;Q8WXH0;Q8WXH0-2	.;.;.;SYNE2_HUMAN;.	G	5778;2163;5778;5643;5649;2412;2163	ENSP00000350719:E5778G;ENSP00000349969:E2163G;ENSP00000341781:E5778G;ENSP00000452570:E5643G;ENSP00000450831:E2412G;ENSP00000378249:E2163G	ENSP00000261678:E5649G	E	+	2	0	SYNE2	63711512	0.925000	0.31364	0.494000	0.27515	0.024000	0.10985	2.650000	0.46665	1.011000	0.39340	0.482000	0.46254	GAG	.	.		0.453	SYNE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276994.2	NM_182914	
ZFYVE26	23503	hgsc.bcm.edu	37	14	68215323	68215323	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr14:68215323A>G	ENST00000347230.4	-	42	7588	c.7450T>C	c.(7450-7452)Tct>Cct	p.S2484P	RN7SL213P_ENST00000463482.2_RNA	NM_015346.3	NP_056161.2	Q68DK2	ZFY26_HUMAN	zinc finger, FYVE domain containing 26	2484					cell death (GO:0008219)|cytokinesis (GO:0000910)|double-strand break repair via homologous recombination (GO:0000724)	centrosome (GO:0005813)|lysosomal membrane (GO:0005765)|midbody (GO:0030496)	metal ion binding (GO:0046872)|phosphatidylinositol-3-phosphate binding (GO:0032266)			NS(1)|breast(3)|cervix(1)|endometrium(6)|kidney(8)|large_intestine(8)|lung(39)|ovary(12)|pancreas(1)|prostate(7)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)	94				all cancers(60;0.000763)|OV - Ovarian serous cystadenocarcinoma(108;0.0011)|BRCA - Breast invasive adenocarcinoma(234;0.0115)		AAGTAGGCAGAACGCAGTTTG	0.542																																					p.S2484P		Atlas-SNP	.											.	ZFYVE26	223	.	0			c.T7450C						.						69.0	57.0	61.0					14																	68215323		2203	4300	6503	SO:0001583	missense	23503	exon42			AGGCAGAACGCAG	AB002319	CCDS9788.1	14q23.3	2012-11-23				ENSG00000072121		"""Zinc fingers, FYVE domain containing"""	20761	protein-coding gene	gene with protein product	"""spastizin"", ""FYVE-CENT"""	612012	"""spastic paraplegia 15 (complicated, autosomal recessive)"""	SPG15		9205841, 18394578	Standard	NM_015346		Approved	KIAA0321	uc001xka.2	Q68DK2		ENST00000347230.4:c.7450T>C	chr14.hg19:g.68215323A>G	ENSP00000251119:p.Ser2484Pro	117.0	0.0		68.0	4.0	NM_015346	B1B5Y3|B4E2U3|O15035|Q68DT9|Q6AW90|Q6ZR50|Q7Z3A4|Q7Z3I1|Q8N4W7	Missense_Mutation	SNP	ENST00000347230.4	hg19	CCDS9788.1	.	.	.	.	.	.	.	.	.	.	A	15.96	2.988091	0.53934	.	.	ENSG00000072121	ENST00000347230;ENST00000411699	T	0.30182	1.54	5.54	5.54	0.83059	.	0.126103	0.53938	D	0.000043	T	0.32526	0.0832	L	0.49126	1.545	0.80722	D	1	B	0.22276	0.067	B	0.22152	0.038	T	0.09530	-1.0670	10	0.72032	D	0.01	-15.0401	15.9657	0.79968	1.0:0.0:0.0:0.0	.	2484	Q68DK2	ZFY26_HUMAN	P	2484;2463	ENSP00000251119:S2484P	ENSP00000251119:S2484P	S	-	1	0	ZFYVE26	67285076	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	5.538000	0.67193	2.236000	0.73375	0.533000	0.62120	TCT	.	.		0.542	ZFYVE26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412736.2	NM_015346	
DLST	1743	hgsc.bcm.edu	37	14	75365074	75365074	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr14:75365074A>G	ENST00000334220.4	+	11	834	c.773A>G	c.(772-774)aAc>aGc	p.N258S	DLST_ENST00000334212.6_Missense_Mutation_p.N172S|DLST_ENST00000555190.1_3'UTR	NM_001933.4	NP_001924.2	P36957	ODO2_HUMAN	dihydrolipoamide S-succinyltransferase (E2 component of 2-oxo-glutarate complex)	258					cellular metabolic process (GO:0044237)|cellular nitrogen compound metabolic process (GO:0034641)|generation of precursor metabolites and energy (GO:0006091)|L-lysine catabolic process to acetyl-CoA via saccharopine (GO:0033512)|lysine catabolic process (GO:0006554)|small molecule metabolic process (GO:0044281)|tricarboxylic acid cycle (GO:0006099)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrial matrix (GO:0005759)|nucleus (GO:0005634)|oxoglutarate dehydrogenase complex (GO:0045252)	dihydrolipoyllysine-residue succinyltransferase activity (GO:0004149)			breast(1)|endometrium(5)|kidney(2)|large_intestine(2)|lung(4)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18				BRCA - Breast invasive adenocarcinoma(234;0.00698)		TTTCACAGTAACATCCAGGAG	0.423																																					p.N258S		Atlas-SNP	.											.	DLST	42	.	0			c.A773G						.						93.0	90.0	91.0					14																	75365074		2203	4300	6503	SO:0001583	missense	1743	exon11			ACAGTAACATCCA		CCDS9833.1	14q23.1	2008-08-11			ENSG00000119689	ENSG00000119689	2.3.1.61		2911	protein-coding gene	gene with protein product		126063		DLTS		8009371	Standard	NM_001933		Approved		uc001xqv.2	P36957		ENST00000334220.4:c.773A>G	chr14.hg19:g.75365074A>G	ENSP00000335304:p.Asn258Ser	140.0	0.0		92.0	4.0	NM_001933	B7Z5W8|E7ESY5|Q7LDY7|Q9BQ32	Missense_Mutation	SNP	ENST00000334220.4	hg19	CCDS9833.1	.	.	.	.	.	.	.	.	.	.	A	12.13	1.845180	0.32606	.	.	ENSG00000119689	ENST00000334220;ENST00000334212;ENST00000554806	T;T;T	0.42131	0.98;0.98;0.98	5.84	5.84	0.93424	2-oxoacid dehydrogenase acyltransferase, catalytic domain (1);Chloramphenicol acetyltransferase-like domain (1);	0.037870	0.85682	D	0.000000	T	0.39279	0.1072	L	0.43554	1.36	0.80722	D	1	B;B;B;B;B	0.28470	0.067;0.213;0.213;0.137;0.135	B;B;B;B;B	0.34346	0.065;0.18;0.18;0.115;0.089	T	0.17319	-1.0373	10	0.14656	T	0.56	-18.3689	16.21	0.82150	1.0:0.0:0.0:0.0	.	172;258;258;170;174	B7Z5W8;Q6IBS5;P36957;Q86TQ8;Q86TW7	.;.;ODO2_HUMAN;.;.	S	258;172;241	ENSP00000335304:N258S;ENSP00000335465:N172S;ENSP00000451957:N241S	ENSP00000238671:N241S	N	+	2	0	DLST	74434827	1.000000	0.71417	1.000000	0.80357	0.911000	0.54048	8.938000	0.92943	2.236000	0.73375	0.528000	0.53228	AAC	.	.		0.423	DLST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413637.1		
CATSPERB	79820	hgsc.bcm.edu	37	14	92102785	92102785	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr14:92102785T>C	ENST00000256343.3	-	17	1882	c.1726A>G	c.(1726-1728)Aaa>Gaa	p.K576E		NM_024764.2	NP_079040.2	Q9H7T0	CTSRB_HUMAN	catsper channel auxiliary subunit beta	576					cell differentiation (GO:0030154)|multicellular organism reproduction (GO:0032504)|multicellular organismal development (GO:0007275)|single fertilization (GO:0007338)|sperm-egg recognition (GO:0035036)|spermatogenesis (GO:0007283)	CatSper complex (GO:0036128)|cilium (GO:0005929)|plasma membrane (GO:0005886)				NS(1)|breast(4)|central_nervous_system(1)|kidney(3)|large_intestine(15)|liver(1)|lung(12)|ovary(2)|pancreas(1)|prostate(3)|skin(9)|urinary_tract(2)	54		all_cancers(154;0.0663)|all_epithelial(191;0.236)				TGTATCACTTTTCCATAGTGT	0.368																																					p.K576E		Atlas-SNP	.											.	CATSPERB	114	.	0			c.A1726G						.						162.0	149.0	153.0					14																	92102785		2203	4300	6503	SO:0001583	missense	79820	exon17			TCACTTTTCCATA	AK024360	CCDS32142.1	14q32.12	2012-02-22	2012-02-22	2007-10-18	ENSG00000133962	ENSG00000133962			20500	protein-coding gene	gene with protein product		611169	"""chromosome 14 open reading frame 161"", ""cation channel, sperm-associated, beta"""	C14orf161		17478420	Standard	NM_024764		Approved	FLJ14298	uc001xzs.1	Q9H7T0	OTTHUMG00000171118	ENST00000256343.3:c.1726A>G	chr14.hg19:g.92102785T>C	ENSP00000256343:p.Lys576Glu	195.0	0.0		123.0	5.0	NM_024764	A0AV51	Missense_Mutation	SNP	ENST00000256343.3	hg19	CCDS32142.1	.	.	.	.	.	.	.	.	.	.	T	15.89	2.965873	0.53507	.	.	ENSG00000133962	ENST00000256343	T	0.52526	0.66	4.26	4.26	0.50523	.	0.000000	0.64402	D	0.000019	T	0.60392	0.2265	M	0.62723	1.935	0.09310	N	0.999998	D	0.64830	0.994	D	0.63597	0.916	T	0.53287	-0.8460	10	0.72032	D	0.01	-31.2804	9.9607	0.41695	0.0:0.0:0.0:1.0	.	576	Q9H7T0	CTSRB_HUMAN	E	576	ENSP00000256343:K576E	ENSP00000256343:K576E	K	-	1	0	CATSPERB	91172538	0.975000	0.34042	0.298000	0.25002	0.163000	0.22366	3.217000	0.51184	1.923000	0.55706	0.260000	0.18958	AAA	.	.		0.368	CATSPERB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411769.1	NM_024764	
CCNK	8812	hgsc.bcm.edu	37	14	99968582	99968582	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr14:99968582T>C	ENST00000389879.5	+	7	737	c.614T>C	c.(613-615)aTc>aCc	p.I205T	CCNK_ENST00000557165.1_3'UTR|CCNK_ENST00000555049.1_Missense_Mutation_p.I205T	NM_001099402.1	NP_001092872.1	O75909	CCNK_HUMAN	cyclin K	205					cellular response to DNA damage stimulus (GO:0006974)|in utero embryonic development (GO:0001701)|mitotic nuclear division (GO:0007067)|negative regulation of cell cycle arrest (GO:0071157)|protein phosphorylation (GO:0006468)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	cyclin K-CDK12 complex (GO:0002944)|cyclin K-CDK13 complex (GO:0002945)|nucleus (GO:0005634)	cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|protein kinase binding (GO:0019901)|RNA polymerase II carboxy-terminal domain kinase activity (GO:0008353)			NS(1)|endometrium(2)|lung(3)	6		all_cancers(154;0.224)|all_epithelial(191;0.0643)|Melanoma(154;0.0866)				GAACCAGAGATCATAGCAGTA	0.398																																					p.I205T		Atlas-SNP	.											.	CCNK	32	.	0			c.T614C						.						95.0	88.0	90.0					14																	99968582		1931	4131	6062	SO:0001583	missense	8812	exon7			CAGAGATCATAGC	AF060515	CCDS45160.1	14q32.2	2014-07-03			ENSG00000090061	ENSG00000090061			1596	protein-coding gene	gene with protein product		603544				9632813, 10574912	Standard	NM_001099402		Approved	CPR4	uc001ygi.4	O75909	OTTHUMG00000171495	ENST00000389879.5:c.614T>C	chr14.hg19:g.99968582T>C	ENSP00000374529:p.Ile205Thr	152.0	0.0		93.0	4.0	NM_001099402	Q59FT6|Q86U16|Q96B63|Q9NNY9	Missense_Mutation	SNP	ENST00000389879.5	hg19	CCDS45160.1	.	.	.	.	.	.	.	.	.	.	T	23.0	4.365861	0.82463	.	.	ENSG00000090061	ENST00000437596;ENST00000216279;ENST00000380246;ENST00000389879;ENST00000557441;ENST00000555049	T;T;T	0.40476	1.03;1.03;1.03	5.95	5.95	0.96441	Cyclin-like (2);	0.049118	0.85682	D	0.000000	T	0.51244	0.1663	N	0.26042	0.785	0.80722	D	1	D;D	0.71674	0.998;0.996	D;D	0.71414	0.973;0.965	T	0.47071	-0.9145	10	0.33940	T	0.23	-15.5048	16.4237	0.83790	0.0:0.0:0.0:1.0	.	205;205	O75909;O75909-2	CCNK_HUMAN;.	T	205;207;207;205;205;205	ENSP00000374529:I205T;ENSP00000450792:I205T;ENSP00000452307:I205T	ENSP00000216279:I207T	I	+	2	0	CCNK	99038335	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.013000	0.88655	2.279000	0.76181	0.533000	0.62120	ATC	.	.		0.398	CCNK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413721.1		
CDC42BPB	9578	hgsc.bcm.edu	37	14	103466024	103466024	+	Silent	SNP	A	A	G			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr14:103466024A>G	ENST00000361246.2	-	5	762	c.474T>C	c.(472-474)ggT>ggC	p.G158G		NM_006035.3	NP_006026.3			CDC42 binding protein kinase beta (DMPK-like)											NS(1)|breast(4)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(11)|liver(1)|lung(14)|ovary(2)|prostate(2)|skin(3)|stomach(1)	49		Melanoma(154;0.155)		Colorectal(3;0.0129)|READ - Rectum adenocarcinoma(2;0.0419)|Epithelial(152;0.0474)|all cancers(159;0.199)		GTAAATCACCACCCACATAGT	0.448																																					p.G158G		Atlas-SNP	.											.	CDC42BPB	123	.	0			c.T474C						.						113.0	97.0	102.0					14																	103466024		2203	4300	6503	SO:0001819	synonymous_variant	9578	exon5			ATCACCACCCACA	AF128625	CCDS9978.1	14q32.32	2010-05-12	2001-11-28		ENSG00000198752	ENSG00000198752			1738	protein-coding gene	gene with protein product		614062	"""CDC42-binding protein kinase beta (DMPK-like)"""			10198171	Standard	NM_006035		Approved	MRCKB, KIAA1124	uc001ymi.1	Q9Y5S2		ENST00000361246.2:c.474T>C	chr14.hg19:g.103466024A>G		175.0	0.0		98.0	5.0	NM_006035		Silent	SNP	ENST00000361246.2	hg19	CCDS9978.1																																																																																			.	.		0.448	CDC42BPB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415711.1	NM_006035	
EIF5	1983	hgsc.bcm.edu	37	14	103803078	103803078	+	Silent	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr14:103803078T>C	ENST00000216554.3	+	5	895	c.219T>C	c.(217-219)cgT>cgC	p.R73R	EIF5_ENST00000558506.1_Silent_p.R73R|EIF5_ENST00000392715.2_Silent_p.R73R|EIF5_ENST00000560200.1_3'UTR|SNORA28_ENST00000606769.1_RNA	NM_001969.4	NP_001960.2	P55010	IF5_HUMAN	eukaryotic translation initiation factor 5	73					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|GTP catabolic process (GO:0006184)|regulation of translational initiation (GO:0006446)|translation (GO:0006412)|translational initiation (GO:0006413)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)|translation factor activity, nucleic acid binding (GO:0008135)|translation initiation factor activity (GO:0003743)			breast(3)|kidney(2)|large_intestine(3)|lung(5)|pancreas(2)|skin(2)|upper_aerodigestive_tract(1)	18		Melanoma(154;0.155)	Epithelial(46;0.182)			AGAATGACCGTTACATTGTCA	0.388																																					p.R73R		Atlas-SNP	.											.	EIF5	40	.	0			c.T219C						.						132.0	121.0	125.0					14																	103803078		2203	4300	6503	SO:0001819	synonymous_variant	1983	exon5			TGACCGTTACATT	U49436	CCDS9980.1	14q32.32	2006-05-11				ENSG00000100664			3299	protein-coding gene	gene with protein product		601710				8663286	Standard	NM_001969		Approved		uc001ymq.4	P55010		ENST00000216554.3:c.219T>C	chr14.hg19:g.103803078T>C		97.0	0.0		80.0	4.0	NM_001969	Q53XB3|Q9H5N2|Q9UG48	Silent	SNP	ENST00000216554.3	hg19	CCDS9980.1																																																																																			.	.		0.388	EIF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415329.2	NM_001969	
PPP1R13B	23368	hgsc.bcm.edu	37	14	104206859	104206859	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr14:104206859A>G	ENST00000202556.9	-	12	2176	c.1894T>C	c.(1894-1896)Tcc>Ccc	p.S632P	PPP1R13B_ENST00000423488.2_Missense_Mutation_p.S51P|PPP1R13B_ENST00000555391.1_5'UTR	NM_015316.2	NP_056131.2	Q96KQ4	ASPP1_HUMAN	protein phosphatase 1, regulatory subunit 13B	632	Pro-rich.				intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|negative regulation of cell cycle (GO:0045786)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				endometrium(6)|kidney(2)|large_intestine(7)|lung(16)|ovary(1)|upper_aerodigestive_tract(1)	33		all_cancers(154;0.173)|all_epithelial(191;0.131)|Melanoma(154;0.155)				GTGCCCGTGGACAGTGACCCG	0.587																																					p.S632P		Atlas-SNP	.											.	PPP1R13B	72	.	0			c.T1894C						.						33.0	42.0	39.0					14																	104206859		2085	4208	6293	SO:0001583	missense	23368	exon12			CCGTGGACAGTGA	AB018314	CCDS41997.1	14q32.33	2013-01-10	2011-10-04		ENSG00000088808	ENSG00000088808		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Ankyrin repeat domain containing"""	14950	protein-coding gene	gene with protein product		606455	"""protein phosphatase 1, regulatory (inhibitor) subunit 13B"""			9872452	Standard	NM_015316		Approved	p53BP2-like, KIAA0771, p85, ASPP1	uc001yof.1	Q96KQ4	OTTHUMG00000171647	ENST00000202556.9:c.1894T>C	chr14.hg19:g.104206859A>G	ENSP00000202556:p.Ser632Pro	114.0	0.0		75.0	5.0	NM_015316	B2RMX5|O94870	Missense_Mutation	SNP	ENST00000202556.9	hg19	CCDS41997.1	.	.	.	.	.	.	.	.	.	.	A	11.64	1.698031	0.30142	.	.	ENSG00000088808	ENST00000202556;ENST00000423488;ENST00000380023	T;T	0.55413	0.7;0.52	5.48	0.92	0.19397	.	0.471590	0.24876	N	0.034887	T	0.28366	0.0701	N	0.14661	0.345	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.13255	-1.0516	10	0.22109	T	0.4	.	6.5986	0.22687	0.3434:0.3871:0.2695:0.0	.	632	Q96KQ4	ASPP1_HUMAN	P	632;51;499	ENSP00000202556:S632P;ENSP00000395213:S51P	ENSP00000202556:S632P	S	-	1	0	PPP1R13B	103276612	0.988000	0.35896	0.005000	0.12908	0.046000	0.14306	1.435000	0.34969	0.125000	0.18397	0.533000	0.62120	TCC	.	.		0.587	PPP1R13B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414591.1	NM_015316	
ATP10A	57194	hgsc.bcm.edu	37	15	26026243	26026243	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr15:26026243A>G	ENST00000356865.6	-	2	688	c.577T>C	c.(577-579)Tgc>Cgc	p.C193R		NM_024490.3	NP_077816.1	O60312	AT10A_HUMAN	ATPase, class V, type 10A	193					ion transmembrane transport (GO:0034220)|phospholipid translocation (GO:0045332)|regulation of cell shape (GO:0008360)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			NS(1)|breast(2)|endometrium(8)|kidney(2)|large_intestine(33)|liver(1)|lung(41)|ovary(3)|pancreas(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	103		all_cancers(20;5.16e-25)|all_lung(180;1.51e-14)|Acute lymphoblastic leukemia(1;2.53e-05)|all_hematologic(1;0.000267)|Breast(32;0.00125)		all cancers(64;9.48e-07)|Epithelial(43;1.69e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0252)|Lung(196;0.244)		TCGATGTGGCATAGCCCGTCG	0.592																																					p.C193R		Atlas-SNP	.											.	ATP10A	270	.	0			c.T577C						.						97.0	95.0	96.0					15																	26026243		2203	4300	6503	SO:0001583	missense	57194	exon2			TGTGGCATAGCCC	AB011138	CCDS32178.1	15q12	2010-04-20	2007-09-19		ENSG00000206190	ENSG00000206190		"""ATPases / P-type"""	13542	protein-coding gene	gene with protein product		605855	"""ATPase, Class V, type 10C"", ""ATPase, Class V, type 10A"""	ATP10C		11015572, 9628581	Standard	NM_024490		Approved	ATPVA, ATPVC, KIAA0566	uc010ayu.3	O60312		ENST00000356865.6:c.577T>C	chr15.hg19:g.26026243A>G	ENSP00000349325:p.Cys193Arg	167.0	0.0		114.0	5.0	NM_024490	Q4G0S9|Q969I4	Missense_Mutation	SNP	ENST00000356865.6	hg19	CCDS32178.1	.	.	.	.	.	.	.	.	.	.	A	22.4	4.289408	0.80914	.	.	ENSG00000206190	ENST00000356865	T	0.76968	-1.06	4.67	4.67	0.58626	ATPase, P-type, ATPase-associated domain (1);ATPase,  P-type, cytoplasmic transduction domain A (1);	0.000000	0.85682	D	0.000000	D	0.93096	0.7802	H	0.99379	4.54	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	D	0.95508	0.8583	10	0.87932	D	0	-28.2241	13.4539	0.61187	1.0:0.0:0.0:0.0	.	193	O60312	AT10A_HUMAN	R	193	ENSP00000349325:C193R	ENSP00000349325:C193R	C	-	1	0	ATP10A	23577336	1.000000	0.71417	0.998000	0.56505	0.893000	0.52053	8.778000	0.91785	1.967000	0.57214	0.459000	0.35465	TGC	.	.		0.592	ATP10A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414830.1	NM_024490	
FMN1	342184	hgsc.bcm.edu	37	15	33091107	33091107	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr15:33091107T>C	ENST00000559047.1	-	16	4027	c.4028A>G	c.(4027-4029)gAg>gGg	p.E1343G	FMN1_ENST00000334528.9_Missense_Mutation_p.E1120G|FMN1_ENST00000561249.1_Missense_Mutation_p.E1245G			Q68DA7	FMN1_HUMAN	formin 1	1343	FH2. {ECO:0000255|PROSITE- ProRule:PRU00774}.				actin nucleation (GO:0045010)	actin filament (GO:0005884)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(3)|lung(14)|ovary(2)|prostate(1)|upper_aerodigestive_tract(3)	29		all_lung(180;1.14e-07)		all cancers(64;3.05e-15)|Epithelial(43;1.67e-10)|GBM - Glioblastoma multiforme(186;4.95e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0262)		GATCTCCTTCTCACCAGACTT	0.423																																					p.E1120G		Atlas-SNP	.											.	FMN1	174	.	0			c.A3359G						.						97.0	86.0	90.0					15																	33091107		1883	4123	6006	SO:0001583	missense	342184	exon15			TCCTTCTCACCAG	AH002864	CCDS45209.1, CCDS61581.1, CCDS61582.1	15q13.3	2013-06-13	2005-01-20	2005-01-22	ENSG00000248905	ENSG00000248905			3768	protein-coding gene	gene with protein product	"""limb deformity protein"""	136535	"""formin (limb deformity)"""	LD, FMN		1673046	Standard	NM_001277313		Approved	DKFZP686C2281, FLJ45135, MGC125288, MGC125289	uc031qrh.1	Q68DA7	OTTHUMG00000172201	ENST00000559047.1:c.4028A>G	chr15.hg19:g.33091107T>C	ENSP00000454047:p.Glu1343Gly	103.0	0.0		78.0	4.0	NM_001103184	Q3B7I6|Q3ZAR4|Q6ZSY1	Missense_Mutation	SNP	ENST00000559047.1	hg19		.	.	.	.	.	.	.	.	.	.	T	19.94	3.919629	0.73098	.	.	ENSG00000248905	ENST00000334528	T	0.42513	0.97	5.86	5.86	0.93980	.	0.095507	0.64402	D	0.000001	T	0.65678	0.2714	M	0.76328	2.33	.	.	.	D	0.89917	1.0	D	0.80764	0.994	T	0.71083	-0.4695	9	0.87932	D	0	.	16.2444	0.82434	0.0:0.0:0.0:1.0	.	1120	Q68DA7-5	.	G	1120	ENSP00000333950:E1120G	ENSP00000333950:E1120G	E	-	2	0	FMN1	30878399	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	7.673000	0.83973	2.237000	0.73441	0.533000	0.62120	GAG	.	.		0.423	FMN1-005	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000417414.1	NM_001103184	
NUTM1	256646	hgsc.bcm.edu	37	15	34646648	34646648	+	Splice_Site	SNP	G	G	A			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr15:34646648G>A	ENST00000333756.4	+	5	1148	c.993G>A	c.(991-993)gtG>gtA	p.V331V	NUTM1_ENST00000537011.1_Splice_Site_p.V359V|NUTM1_ENST00000438749.3_Splice_Site_p.V349V	NM_175741.1	NP_786883	Q86Y26	NUTM1_HUMAN	NUT midline carcinoma, family member 1	331						cytoplasm (GO:0005737)|nucleus (GO:0005634)											TTCCCTTAGTGTACATTCCGA	0.552																																					p.V331V		Atlas-SNP	.											.	C15orf55	110	.	0			c.G993A						.						78.0	81.0	80.0					15																	34646648		2201	4298	6499	SO:0001630	splice_region_variant	256646	exon5			CTTAGTGTACATT	AF482429	CCDS32190.1, CCDS61584.1, CCDS61585.1	15q14	2014-01-28	2013-03-14	2013-03-14	ENSG00000184507	ENSG00000184507			29919	protein-coding gene	gene with protein product	"""nuclear protein in testis"""	608963	"""chromosome 15 open reading frame 55"""	C15orf55		12543779	Standard	NM_175741		Approved	NUT, DKFZp434O192, FAM22H	uc001zif.3	Q86Y26	OTTHUMG00000172348	ENST00000333756.4:c.992-1G>A	chr15.hg19:g.34646648G>A		160.0	0.0		68.0	4.0	NM_175741	B4DZ00|B7Z7Y4|E7EVE8|F5H4I6|Q86YS8|Q8N7F2|Q9NTB3	Silent	SNP	ENST00000333756.4	hg19	CCDS32190.1																																																																																			.	.		0.552	NUTM1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418026.1	NM_175741	Silent
BUB1B	701	hgsc.bcm.edu	37	15	40504778	40504778	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr15:40504778T>C	ENST00000287598.6	+	19	2659	c.2464T>C	c.(2464-2466)Ttt>Ctt	p.F822L	BUB1B_ENST00000412359.3_Missense_Mutation_p.F836L	NM_001211.5	NP_001202	O60566	BUB1B_HUMAN	BUB1 mitotic checkpoint serine/threonine kinase B	822	Protein kinase.				anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|protein localization to chromosome, centromeric region (GO:0071459)|protein localization to kinetochore (GO:0034501)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|condensed chromosome kinetochore (GO:0000777)|condensed chromosome outer kinetochore (GO:0000940)|condensed nuclear chromosome kinetochore (GO:0000778)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|perinuclear region of cytoplasm (GO:0048471)|spindle midzone (GO:0051233)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|endometrium(1)|kidney(2)|large_intestine(7)|liver(2)|lung(17)|ovary(1)|stomach(2)|urinary_tract(2)	36		all_cancers(109;1.12e-18)|all_epithelial(112;1.61e-15)|Lung NSC(122;5.63e-11)|all_lung(180;1.4e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;1.83e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0556)		TTTTGATCATTTTTGCAGCTG	0.323			"""Mis, N, F, S"""			rhabdomyosarcoma			Mosaic Variegated Aneuploidy Syndrome																												p.F822L		Atlas-SNP	.	yes	Rec		Mosaic variegated aneuploidy	15	15q15	701	BUB1 budding uninhibited by benzimidazoles 1 homolog beta (yeast)		M	.	BUB1B	71	.	0			c.T2464C						.						118.0	112.0	114.0					15																	40504778		2203	4300	6503	SO:0001583	missense	701	exon19	Familial Cancer Database	MVA, MVA syndrome, VMA syndrome, variegated mosaic aneuploidy syndrome, premature centromere division	GATCATTTTTGCA	AF107297	CCDS10053.1	15q15	2014-09-17	2013-01-17		ENSG00000156970	ENSG00000156970			1149	protein-coding gene	gene with protein product		602860	"""budding uninhibited by benzimidazoles 1 (yeast homolog), beta"", ""budding uninhibited by benzimidazoles 1 homolog beta (yeast)"""			9889005	Standard	NM_001211		Approved	BUBR1, MAD3L, Bub1A, SSK1	uc001zkx.4	O60566	OTTHUMG00000129877	ENST00000287598.6:c.2464T>C	chr15.hg19:g.40504778T>C	ENSP00000287598:p.Phe822Leu	109.0	0.0		73.0	4.0	NM_001211	B2R6U0|B4DL09|B4DLG3|O60501|O60627|O60758|O75389|Q59HH6|Q8WV50|Q96KM4	Missense_Mutation	SNP	ENST00000287598.6	hg19	CCDS10053.1	.	.	.	.	.	.	.	.	.	.	T	1.869	-0.460686	0.04508	.	.	ENSG00000156970	ENST00000287598;ENST00000412359;ENST00000442874	T;T	0.17528	2.27;2.27	5.1	3.98	0.46160	Protein kinase-like domain (1);	1.512990	0.04034	N	0.301971	T	0.09818	0.0241	N	0.04959	-0.14	0.23089	N	0.998311	B	0.02656	0.0	B	0.01281	0.0	T	0.31613	-0.9937	10	0.09843	T	0.71	-0.0257	9.9917	0.41874	0.0:0.0807:0.0:0.9193	.	822	O60566	BUB1B_HUMAN	L	822;836;705	ENSP00000287598:F822L;ENSP00000398470:F836L	ENSP00000287598:F822L	F	+	1	0	BUB1B	38292070	0.001000	0.12720	0.910000	0.35882	0.483000	0.33249	0.106000	0.15354	0.801000	0.34066	0.533000	0.62120	TTT	.	.		0.323	BUB1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252122.4		
CASC4	113201	hgsc.bcm.edu	37	15	44695118	44695118	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr15:44695118A>G	ENST00000299957.6	+	9	1405	c.1106A>G	c.(1105-1107)gAt>gGt	p.D369G	CASC4_ENST00000345795.2_Intron|RP11-516C1.1_ENST00000558047.1_RNA|CASC4_ENST00000360824.3_Intron	NM_138423.3	NP_612432.2	Q6P4E1	CASC4_HUMAN	cancer susceptibility candidate 4	369						Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)				NS(1)|breast(1)|endometrium(2)|large_intestine(3)|lung(7)|ovary(1)|urinary_tract(2)	17		all_cancers(109;1.69e-13)|all_epithelial(112;3.94e-11)|Lung NSC(122;1.66e-07)|all_lung(180;1.47e-06)|Melanoma(134;0.027)		all cancers(107;2.91e-20)|GBM - Glioblastoma multiforme(94;1.57e-06)|COAD - Colon adenocarcinoma(120;0.217)|Colorectal(105;0.237)		TCCCCTGTTGATCCGCAGCAT	0.443																																					p.D369G		Atlas-SNP	.											.	CASC4	34	.	0			c.A1106G						.						97.0	86.0	89.0					15																	44695118		2198	4298	6496	SO:0001583	missense	113201	exon9			CTGTTGATCCGCA	AF103804	CCDS10108.1, CCDS10109.1	15q15.1	2010-11-24			ENSG00000166734	ENSG00000166734			24892	protein-coding gene	gene with protein product						10497265	Standard	NM_138423		Approved	H63, DKFZp459F1927	uc001ztp.3	Q6P4E1	OTTHUMG00000131133	ENST00000299957.6:c.1106A>G	chr15.hg19:g.44695118A>G	ENSP00000299957:p.Asp369Gly	158.0	0.0		77.0	4.0	NM_138423	B4DPZ6|G5E934|Q6UY45|Q96EM1	Missense_Mutation	SNP	ENST00000299957.6	hg19	CCDS10108.1	.	.	.	.	.	.	.	.	.	.	A	26.2	4.719327	0.89205	.	.	ENSG00000166734	ENST00000299957;ENST00000416522	.	.	.	5.77	5.77	0.91146	.	0.000000	0.85682	D	0.000000	T	0.76463	0.3991	M	0.61703	1.905	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	T	0.74219	-0.3736	9	0.33141	T	0.24	.	16.3948	0.83586	1.0:0.0:0.0:0.0	.	369;369	G5E934;Q6P4E1	.;CASC4_HUMAN	G	369;348	.	ENSP00000299957:D369G	D	+	2	0	CASC4	42482410	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.283000	0.95860	2.326000	0.78906	0.533000	0.62120	GAT	.	.		0.443	CASC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000253815.1	NM_138423	
USP8	9101	hgsc.bcm.edu	37	15	50791193	50791193	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr15:50791193T>C	ENST00000396444.3	+	20	3603	c.3265T>C	c.(3265-3267)Tct>Cct	p.S1089P	RP11-562A8.5_ENST00000560159.1_lincRNA|RP11-562A8.4_ENST00000560380.1_RNA|USP8_ENST00000307179.4_Missense_Mutation_p.S1089P|USP8_ENST00000433963.1_Missense_Mutation_p.S1089P|USP50_ENST00000530218.1_5'Flank|USP8_ENST00000425032.3_Missense_Mutation_p.S983P	NM_001128610.1|NM_005154.3	NP_001122082.1|NP_005145.3	P40818	UBP8_HUMAN	ubiquitin specific peptidase 8	1089	USP.				cell proliferation (GO:0008283)|endosome organization (GO:0007032)|mitotic cytokinesis (GO:0000281)|protein deubiquitination (GO:0016579)|protein K48-linked deubiquitination (GO:0071108)|protein K63-linked deubiquitination (GO:0070536)|Ras protein signal transduction (GO:0007265)|ubiquitin-dependent protein catabolic process (GO:0006511)	acrosomal vesicle (GO:0001669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|extrinsic component of plasma membrane (GO:0019897)|midbody (GO:0030496)|nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|ubiquitin-specific protease activity (GO:0004843)			central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(5)|lung(16)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	35				all cancers(107;0.000225)|GBM - Glioblastoma multiforme(94;0.000771)		TCATGAAGTTTCTGATATCTC	0.428																																					p.S1089P		Atlas-SNP	.											.	USP8	90	.	0			c.T3265C						.						89.0	82.0	85.0					15																	50791193		2196	4294	6490	SO:0001583	missense	9101	exon20			GAAGTTTCTGATA	D29956	CCDS10137.1, CCDS61632.1	15q21.1	2014-03-03	2005-08-08		ENSG00000138592	ENSG00000138592		"""Ubiquitin-specific peptidases"""	12631	protein-coding gene	gene with protein product		603158	"""ubiquitin specific protease 8"""			12838346, 9582025, 24482476	Standard	NM_005154		Approved	HumORF8, KIAA0055, UBPY, SPG59	uc001zyl.4	P40818	OTTHUMG00000131645	ENST00000396444.3:c.3265T>C	chr15.hg19:g.50791193T>C	ENSP00000379721:p.Ser1089Pro	167.0	0.0		77.0	4.0	NM_001128610	B4DKA8|Q2TB31|Q7Z3U2|Q86VA0|Q8IWI7	Missense_Mutation	SNP	ENST00000396444.3	hg19	CCDS10137.1	.	.	.	.	.	.	.	.	.	.	T	17.64	3.438900	0.63067	.	.	ENSG00000138592	ENST00000396444;ENST00000433963;ENST00000307179;ENST00000425032;ENST00000419830;ENST00000396440	T;T;T;T	0.34472	1.36;1.36;1.36;1.36	5.64	3.31	0.37934	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.049041	0.85682	D	0.000000	T	0.57475	0.2056	M	0.88105	2.93	0.80722	D	1	D;D	0.65815	0.984;0.995	P;P	0.60068	0.799;0.868	T	0.59053	-0.7526	10	0.62326	D	0.03	-14.7262	7.9124	0.29798	0.1229:0.0667:0.0:0.8103	.	983;1089	B4DKA8;P40818	.;UBP8_HUMAN	P	1089;1089;1089;983;307;302	ENSP00000379721:S1089P;ENSP00000405537:S1089P;ENSP00000302239:S1089P;ENSP00000412682:S983P	ENSP00000302239:S1089P	S	+	1	0	USP8	48578485	1.000000	0.71417	0.809000	0.32408	0.917000	0.54804	4.536000	0.60636	0.489000	0.27749	0.482000	0.46254	TCT	.	.		0.428	USP8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254541.1	NM_005154	
DMXL2	23312	hgsc.bcm.edu	37	15	51748508	51748508	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr15:51748508T>C	ENST00000251076.5	-	37	8617	c.8330A>G	c.(8329-8331)tAc>tGc	p.Y2777C	RP11-707P17.1_ENST00000561007.1_RNA|DMXL2_ENST00000449909.3_Missense_Mutation_p.Y2141C|RP11-707P17.2_ENST00000560727.1_RNA|DMXL2_ENST00000543779.2_Missense_Mutation_p.Y2778C|RP11-707P17.2_ENST00000559173.1_RNA|RP11-707P17.2_ENST00000559977.1_RNA	NM_001174116.1|NM_015263.3	NP_001167587.1|NP_056078.2	Q8TDJ6	DMXL2_HUMAN	Dmx-like 2	2777						cell junction (GO:0030054)|extracellular space (GO:0005615)|membrane (GO:0016020)|synaptic vesicle (GO:0008021)	Rab GTPase binding (GO:0017137)			breast(4)|central_nervous_system(1)|cervix(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(26)|liver(1)|lung(28)|ovary(7)|prostate(7)|skin(4)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	101				all cancers(107;0.00494)		ATACTTACAGTATTGATGGAC	0.274																																					p.Y2778C		Atlas-SNP	.											.	DMXL2	262	.	0			c.A8333G						.						66.0	72.0	70.0					15																	51748508		2196	4292	6488	SO:0001583	missense	23312	exon37			TTACAGTATTGAT	AB020663	CCDS10141.1, CCDS53945.1, CCDS53946.1	15q21.2	2013-01-10			ENSG00000104093	ENSG00000104093		"""WD repeat domain containing"""	2938	protein-coding gene	gene with protein product	"""rabconnectin 3"""	612186					Standard	NM_001174116		Approved	RC3, KIAA0856	uc010ufy.2	Q8TDJ6	OTTHUMG00000131749	ENST00000251076.5:c.8330A>G	chr15.hg19:g.51748508T>C	ENSP00000251076:p.Tyr2777Cys	197.0	0.0		99.0	4.0	NM_001174116	B2RTR3|B7ZMH3|F5GWF1|O94938	Missense_Mutation	SNP	ENST00000251076.5	hg19	CCDS10141.1	.	.	.	.	.	.	.	.	.	.	T	19.83	3.900687	0.72754	.	.	ENSG00000104093	ENST00000251076;ENST00000543779;ENST00000449909;ENST00000436119	T;T;T	0.01446	4.88;4.88;4.88	5.26	4.14	0.48551	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.09024	0.0223	M	0.73962	2.25	0.80722	D	1	D;D;D;D	0.89917	1.0;0.999;1.0;0.974	D;D;D;P	0.91635	0.999;0.993;0.997;0.727	T	0.00664	-1.1620	10	0.87932	D	0	.	11.0239	0.47734	0.0:0.0727:0.0:0.9273	.	2778;2141;2777;2778	F5GWF1;B2RTR3;Q8TDJ6;B7ZMH3	.;.;DMXL2_HUMAN;.	C	2777;2778;2141;343	ENSP00000251076:Y2777C;ENSP00000441858:Y2778C;ENSP00000400855:Y2141C	ENSP00000251076:Y2777C	Y	-	2	0	DMXL2	49535800	1.000000	0.71417	0.994000	0.49952	0.991000	0.79684	7.501000	0.81600	1.012000	0.39366	0.533000	0.62120	TAC	.	.		0.274	DMXL2-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000254671.2	NM_015263	
NEDD4	4734	hgsc.bcm.edu	37	15	56207944	56207944	+	Silent	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr15:56207944T>C	ENST00000508342.1	-	1	1385	c.1086A>G	c.(1084-1086)agA>agG	p.R362R	NEDD4_ENST00000435532.3_Intron|NEDD4_ENST00000506154.1_Silent_p.R362R|NEDD4_ENST00000338963.2_Silent_p.R362R	NM_001284338.1	NP_001271267.1	P46934	NEDD4_HUMAN	neural precursor cell expressed, developmentally down-regulated 4, E3 ubiquitin protein ligase	362					adaptive immune response (GO:0002250)|blood vessel morphogenesis (GO:0048514)|cellular response to UV (GO:0034644)|cytokine-mediated signaling pathway (GO:0019221)|development involved in symbiotic interaction (GO:0044111)|endocardial cushion development (GO:0003197)|glucocorticoid receptor signaling pathway (GO:0042921)|lysosomal transport (GO:0007041)|negative regulation of sodium ion transport (GO:0010766)|negative regulation of transcription from RNA polymerase II promoter in response to UV-induced DNA damage (GO:0010768)|negative regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030948)|neuromuscular junction development (GO:0007528)|neuron projection development (GO:0031175)|outflow tract morphogenesis (GO:0003151)|positive regulation of nucleocytoplasmic transport (GO:0046824)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein catabolic process (GO:0045732)|progesterone receptor signaling pathway (GO:0050847)|protein K63-linked ubiquitination (GO:0070534)|protein monoubiquitination (GO:0006513)|protein targeting to lysosome (GO:0006622)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|receptor catabolic process (GO:0032801)|receptor internalization (GO:0031623)|regulation of dendrite morphogenesis (GO:0048814)|regulation of ion transmembrane transport (GO:0034765)|regulation of membrane potential (GO:0042391)|regulation of potassium ion transmembrane transporter activity (GO:1901016)|regulation of synapse organization (GO:0050807)|response to calcium ion (GO:0051592)|T cell activation (GO:0042110)|transmission of virus (GO:0019089)|ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway (GO:0043162)	apicolateral plasma membrane (GO:0016327)|cell cortex (GO:0005938)|chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|ubiquitin ligase complex (GO:0000151)	beta-2 adrenergic receptor binding (GO:0031698)|ligase activity (GO:0016874)|phosphoserine binding (GO:0050815)|phosphothreonine binding (GO:0050816)|proline-rich region binding (GO:0070064)|protein domain specific binding (GO:0019904)|RNA polymerase binding (GO:0070063)|sodium channel inhibitor activity (GO:0019871)|ubiquitin binding (GO:0043130)|ubiquitin-protein transferase activity (GO:0004842)			breast(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(15)|ovary(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	43				all cancers(107;0.0299)|GBM - Glioblastoma multiforme(80;0.113)		AGACAGTCTGTCTGGGAGTAT	0.418																																					p.R362R		Atlas-SNP	.											.	NEDD4	167	.	0			c.A1086G						.						49.0	49.0	49.0					15																	56207944		2191	4290	6481	SO:0001819	synonymous_variant	4734	exon1			AGTCTGTCTGGGA	D42055	CCDS10156.1, CCDS45265.1, CCDS61643.1, CCDS61644.1	15q	2012-02-23	2012-02-23		ENSG00000069869	ENSG00000069869			7727	protein-coding gene	gene with protein product	"""receptor-potentiating factor 1"""	602278	"""neural precursor cell expressed, developmentally down-regulated 4"""			9073511, 8649367	Standard	XR_243101		Approved	KIAA0093, MGC176705, NEDD4-1, RPF1	uc002adi.3	P46934	OTTHUMG00000132015	ENST00000508342.1:c.1086A>G	chr15.hg19:g.56207944T>C		67.0	0.0		59.0	4.0	NM_198400	A1KY35|A6ND72|A7MD29|B4E2R7|B7ZM59|B7ZM60|B9EGN5|D6RF89	Silent	SNP	ENST00000508342.1	hg19																																																																																				.	.		0.418	NEDD4-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000359817.1	NM_198400	
ICE2	79664	hgsc.bcm.edu	37	15	60741135	60741135	+	Silent	SNP	A	A	G			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr15:60741135A>G	ENST00000261520.4	-	10	2265	c.2031T>C	c.(2029-2031)ccT>ccC	p.P677P	NARG2_ENST00000439632.1_Silent_p.P540P	NM_024611.4	NP_078887.2														breast(1)|central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(2)|lung(10)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	32						CAGAAACAGAAGGCTGTTTAG	0.393																																					p.P677P		Atlas-SNP	.											NARG2,NS,carcinoma,0,1	NARG2	82	.	0			c.T2031C						.						62.0	66.0	65.0					15																	60741135		2201	4299	6500	SO:0001819	synonymous_variant	79664	exon10			AACAGAAGGCTGT																												ENST00000261520.4:c.2031T>C	chr15.hg19:g.60741135A>G		163.0	0.0		70.0	3.0	NM_024611		Silent	SNP	ENST00000261520.4	hg19	CCDS10176.1																																																																																			.	.		0.393	NARG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256136.1		
IQCH	64799	hgsc.bcm.edu	37	15	67553702	67553702	+	Silent	SNP	A	A	G			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr15:67553702A>G	ENST00000335894.4	+	2	210	c.144A>G	c.(142-144)acA>acG	p.T48T	IQCH_ENST00000512104.1_Silent_p.T48T|IQCH_ENST00000546225.1_5'UTR|IQCH_ENST00000358767.3_5'UTR	NM_001031715.2	NP_001026885	Q86VS3	IQCH_HUMAN	IQ motif containing H	48										NS(1)|breast(1)|cervix(1)|endometrium(2)|large_intestine(9)|lung(9)|ovary(2)|pancreas(2)|skin(5)|upper_aerodigestive_tract(1)	33				Colorectal(3;0.0856)		GTCTTGAAACAGCAATCAAAA	0.368																																					p.T48T		Atlas-SNP	.											.	IQCH	81	.	0			c.A144G						.						96.0	109.0	105.0					15																	67553702		2201	4298	6499	SO:0001819	synonymous_variant	64799	exon2			TGAAACAGCAATC	AY014282	CCDS10223.1, CCDS32273.1, CCDS10223.2, CCDS61680.1, CCDS61681.1	15q23	2005-10-24			ENSG00000103599	ENSG00000103599			25721	protein-coding gene	gene with protein product		612523				12477932	Standard	NM_022784		Approved	FLJ12476	uc002aqo.2	Q86VS3	OTTHUMG00000133231	ENST00000335894.4:c.144A>G	chr15.hg19:g.67553702A>G		81.0	0.0		57.0	4.0	NM_022784	A8K8W3|C9JPR6|D6RJ88|Q4G0S6|Q8NEH9|Q9BWX2|Q9H9Y1|Q9UF88	Silent	SNP	ENST00000335894.4	hg19	CCDS32273.1																																																																																			.	.		0.368	IQCH-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256969.1	NM_022784	
SCAPER	49855	hgsc.bcm.edu	37	15	77059425	77059425	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr15:77059425A>G	ENST00000563290.1	-	11	1348	c.1253T>C	c.(1252-1254)aTg>aCg	p.M418T	SCAPER_ENST00000538941.2_Missense_Mutation_p.M172T|SCAPER_ENST00000324767.7_Missense_Mutation_p.M418T			Q9BY12	SCAPE_HUMAN	S-phase cyclin A-associated protein in the ER	418	Glu-rich.					endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)	metal ion binding (GO:0046872)			NS(1)|breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(16)|ovary(2)|prostate(2)|skin(1)|urinary_tract(2)	39						GACTTCTGCCATGGACTATAA	0.338																																					p.M418T		Atlas-SNP	.											.	SCAPER	160	.	0			c.T1253C						.						68.0	54.0	58.0					15																	77059425		1815	4062	5877	SO:0001583	missense	49855	exon10			TCTGCCATGGACT	AB040887, AF242528	CCDS53961.1, CCDS53962.1	15q24.3	2012-10-05	2009-03-11	2007-08-20	ENSG00000140386	ENSG00000140386		"""Zinc fingers, C2H2-type"""	13081	protein-coding gene	gene with protein product		611611	"""zinc finger protein 291"""	ZNF291		17698606	Standard	NM_020843		Approved	Zfp291	uc002bby.3	Q9BY12	OTTHUMG00000172655	ENST00000563290.1:c.1253T>C	chr15.hg19:g.77059425A>G	ENSP00000454973:p.Met418Thr	155.0	0.0		76.0	4.0	NM_020843	F5H7X8|H3BNR7|Q3B7X7|Q96BS9|Q9H3D8|Q9NT03|Q9P274	Missense_Mutation	SNP	ENST00000563290.1	hg19	CCDS53962.1	.	.	.	.	.	.	.	.	.	.	A	16.95	3.264612	0.59431	.	.	ENSG00000140386	ENST00000324767;ENST00000538941;ENST00000303521	T;T	0.24151	1.9;1.87	5.72	5.72	0.89469	.	0.000000	0.85682	D	0.000000	T	0.32615	0.0835	N	0.14661	0.345	0.53005	D	0.999964	D;D;D	0.69078	0.994;0.997;0.997	D;D;D	0.76575	0.983;0.988;0.988	T	0.14755	-1.0461	10	0.19147	T	0.46	.	15.9905	0.80202	1.0:0.0:0.0:0.0	.	418;439;172	Q6NSF1;Q9BY12-2;F5H7X8	.;.;.	T	418;172;440	ENSP00000326924:M418T;ENSP00000442190:M172T	ENSP00000303560:M440T	M	-	2	0	SCAPER	74846480	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	8.759000	0.91667	2.183000	0.69458	0.397000	0.26171	ATG	.	.		0.338	SCAPER-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419698.1	NM_020843	
DNAJA4	55466	hgsc.bcm.edu	37	15	78572631	78572631	+	Silent	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr15:78572631T>C	ENST00000394852.3	+	7	1213	c.1023T>C	c.(1021-1023)ccT>ccC	p.P341P	DNAJA4_ENST00000343789.3_Silent_p.P341P|WDR61_ENST00000559332.1_5'Flank|DNAJA4_ENST00000394855.3_Silent_p.P370P|DNAJA4_ENST00000446172.2_Silent_p.P314P|RP11-762H8.4_ENST00000558192.1_RNA	NM_001130182.1	NP_001123654.1	Q8WW22	DNJA4_HUMAN	DnaJ (Hsp40) homolog, subfamily A, member 4	341					negative regulation of inclusion body assembly (GO:0090084)|protein refolding (GO:0042026)|response to heat (GO:0009408)	cytosol (GO:0005829)|membrane (GO:0016020)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|metal ion binding (GO:0046872)|unfolded protein binding (GO:0051082)			NS(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(1)|ovary(1)|skin(1)	8						AAAAGCTTCCTCAGCTGGAAG	0.468																																					p.P370P		Atlas-SNP	.											.	DNAJA4	63	.	0			c.T1110C						.						62.0	63.0	63.0					15																	78572631		2196	4293	6489	SO:0001819	synonymous_variant	55466	exon8			GCTTCCTCAGCTG	AF116663	CCDS10299.2, CCDS45316.1, CCDS45317.1	15q24.1	2011-09-02			ENSG00000140403	ENSG00000140403		"""Heat shock proteins / DNAJ (HSP40)"""	14885	protein-coding gene	gene with protein product						11147971	Standard	NM_018602		Approved	PRO1472	uc002bdi.3	Q8WW22	OTTHUMG00000143733	ENST00000394852.3:c.1023T>C	chr15.hg19:g.78572631T>C		76.0	0.0		60.0	4.0	NM_018602	E9PDM9|Q6AW87|Q8N5Z4|Q8N7P2	Silent	SNP	ENST00000394852.3	hg19	CCDS45316.1																																																																																			.	.		0.468	DNAJA4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000289801.1	NM_018602	
IL16	3603	hgsc.bcm.edu	37	15	81517943	81517943	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr15:81517943A>G	ENST00000302987.4	+	1	203	c.203A>G	c.(202-204)gAg>gGg	p.E68G	IL16_ENST00000394660.2_Missense_Mutation_p.E68G			Q14005	IL16_HUMAN	interleukin 16	68					immune response (GO:0006955)|induction of positive chemotaxis (GO:0050930)|leukocyte chemotaxis (GO:0030595)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(5)|large_intestine(12)|lung(20)|ovary(3)|skin(3)|stomach(1)|urinary_tract(1)	57						GACACATCGGAGGCTGGGCCC	0.542																																					p.E68G		Atlas-SNP	.											.	IL16	254	.	0			c.A203G						.						59.0	59.0	59.0					15																	81517943		2016	4184	6200	SO:0001583	missense	3603	exon2			CATCGGAGGCTGG	U82972	CCDS10317.1, CCDS42069.1, CCDS53966.1	15q26.3	2011-07-14	2011-07-14		ENSG00000172349	ENSG00000172349		"""Interleukins and interleukin receptors"""	5980	protein-coding gene	gene with protein product	"""prointerleukin 16"", ""lymphocyte chemoattractant factor"""	603035	"""interleukin 16 (lymphocyte chemoattractant factor)"""			9144227	Standard	NM_004513		Approved	LCF, IL-16, prIL-16, HsT19289, FLJ42735, FLJ16806	uc021ssh.1	Q14005	OTTHUMG00000144186	ENST00000302987.4:c.203A>G	chr15.hg19:g.81517943A>G	ENSP00000302935:p.Glu68Gly	114.0	0.0		69.0	4.0	NM_001172128	A6NM20|A8MU65|B5TY35|B9EGR6|H3BVH5|Q16435|Q6VVE6|Q6ZMQ7|Q9UP18	Missense_Mutation	SNP	ENST00000302987.4	hg19	CCDS42069.1	.	.	.	.	.	.	.	.	.	.	A	15.37	2.813497	0.50527	.	.	ENSG00000172349	ENST00000394655;ENST00000360547;ENST00000394660;ENST00000302987	T;T	0.17213	2.29;2.29	4.18	4.18	0.49190	.	0.000000	0.38778	N	0.001572	T	0.28665	0.0710	M	0.70595	2.14	0.58432	D	0.999999	P;P	0.51057	0.941;0.939	P;P	0.51895	0.683;0.634	T	0.02603	-1.1135	10	0.45353	T	0.12	.	10.2922	0.43603	0.8345:0.1655:0.0:0.0	.	68;68	Q14005;Q14005-2	IL16_HUMAN;.	G	68;110;68;68	ENSP00000378155:E68G;ENSP00000302935:E68G	ENSP00000302935:E68G	E	+	2	0	IL16	79304998	0.999000	0.42202	0.991000	0.47740	0.586000	0.36452	3.924000	0.56476	1.751000	0.51876	0.460000	0.39030	GAG	.	.		0.542	IL16-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000303952.1	NM_172217	
SLC28A1	9154	hgsc.bcm.edu	37	15	85438313	85438313	+	Silent	SNP	C	C	T	rs371921369|rs2277576		TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr15:85438313C>T	ENST00000286749.3	+	5	510	c.420C>T	c.(418-420)ctC>ctT	p.L140L	SLC28A1_ENST00000537703.1_Silent_p.L62L|SLC28A1_ENST00000394573.1_Silent_p.L140L|SLC28A1_ENST00000538177.1_Silent_p.L140L|SLC28A1_ENST00000537216.1_Silent_p.L140L|SLC28A1_ENST00000338602.2_Silent_p.L140L|SLC28A1_ENST00000537624.1_Silent_p.L140L			O00337	S28A1_HUMAN	solute carrier family 28 (concentrative nucleoside transporter), member 1	140			L -> LV (in A). {ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:9124315}.		nucleobase-containing compound metabolic process (GO:0006139)|nucleoside transmembrane transport (GO:1901642)|nucleoside transport (GO:0015858)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	nucleoside binding (GO:0001882)|nucleoside transmembrane transporter activity (GO:0005337)|nucleoside:sodium symporter activity (GO:0005415)	p.L140L(2)		breast(2)|endometrium(4)|kidney(2)|large_intestine(4)|lung(17)|ovary(1)|prostate(4)|skin(3)|stomach(3)|upper_aerodigestive_tract(1)	41			BRCA - Breast invasive adenocarcinoma(143;0.0587)		Gemcitabine(DB00441)|Stavudine(DB00649)|Zidovudine(DB00495)	GGAGGTTTCTCAAGCCTCAGG	0.637																																					p.L140L		Atlas-SNP	.											SLC28A1_ENST00000338602,NS,carcinoma,0,1	SLC28A1	118	.	2	Substitution - coding silent(2)	lung(2)	c.C420T						.						45.0	47.0	47.0					15																	85438313		2203	4298	6501	SO:0001819	synonymous_variant	9154	exon6			GTTTCTCAAGCCT	U62967	CCDS10334.1, CCDS10335.1, CCDS73777.1	15q25.3	2013-07-17	2013-07-17		ENSG00000156222	ENSG00000156222		"""Solute carriers"""	11001	protein-coding gene	gene with protein product		606207	"""solute carrier family 28 (sodium-coupled nucleoside transporter), member 1"""			9124315	Standard	NM_004213		Approved	CNT1	uc002blg.3	O00337	OTTHUMG00000148668	ENST00000286749.3:c.420C>T	chr15.hg19:g.85438313C>T		102.0	2.0		63.0	6.0	NM_201651	A0AV42|A8K7I2|O00335|O00336|Q5U5S6|Q5U648|Q9UEZ9	Silent	SNP	ENST00000286749.3	hg19	CCDS10334.1																																																																																			.	.		0.637	SLC28A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000308998.2		
FANCI	55215	hgsc.bcm.edu	37	15	89804010	89804010	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr15:89804010T>C	ENST00000310775.7	+	4	310	c.224T>C	c.(223-225)tTg>tCg	p.L75S	FANCI_ENST00000567996.1_Missense_Mutation_p.L75S|FANCI_ENST00000451393.2_5'UTR|FANCI_ENST00000300027.8_Missense_Mutation_p.L75S	NM_001113378.1	NP_001106849.1	Q9NVI1	FANCI_HUMAN	Fanconi anemia, complementation group I	75					cell cycle (GO:0007049)|DNA repair (GO:0006281)|positive regulation of protein ubiquitination (GO:0031398)	membrane (GO:0016020)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|DNA polymerase binding (GO:0070182)			breast(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(7)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	31	Lung NSC(78;0.0472)|all_lung(78;0.089)					TGTATCCAGTTGGTGGAATCG	0.428								Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																												p.L75S		Atlas-SNP	.											.	FANCI	129	.	0			c.T224C						.						123.0	116.0	119.0					15																	89804010		2200	4299	6499	SO:0001583	missense	55215	exon4	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	TCCAGTTGGTGGA	BC004277	CCDS10349.2, CCDS45346.1	15q26.1	2014-09-17	2007-05-03	2007-05-03	ENSG00000140525	ENSG00000140525		"""Fanconi anemia, complementation groups"""	25568	protein-coding gene	gene with protein product		611360	"""KIAA1794"""	KIAA1794		14630800, 17460694, 17412408	Standard	NM_001113378		Approved	FLJ10719	uc010bnp.1	Q9NVI1	OTTHUMG00000132993	ENST00000310775.7:c.224T>C	chr15.hg19:g.89804010T>C	ENSP00000310842:p.Leu75Ser	153.0	0.0		93.0	4.0	NM_001113378	A4ZVE4|A5YMH4|A6NJZ0|Q96JN1|Q96ST0|Q9BT96	Missense_Mutation	SNP	ENST00000310775.7	hg19	CCDS45346.1	.	.	.	.	.	.	.	.	.	.	T	31	5.102816	0.94245	.	.	ENSG00000140525	ENST00000300027;ENST00000310775;ENST00000447611	T;T;T	0.43688	0.94;0.94;0.94	5.43	5.43	0.79202	.	0.000000	0.56097	D	0.000035	T	0.63873	0.2548	M	0.70595	2.14	0.80722	D	1	D;D	0.89917	0.979;1.0	P;D	0.91635	0.85;0.999	T	0.65372	-0.6184	10	0.48119	T	0.1	-8.843	15.469	0.75426	0.0:0.0:0.0:1.0	.	75;75	Q9NVI1;Q9NVI1-1	FANCI_HUMAN;.	S	75	ENSP00000300027:L75S;ENSP00000310842:L75S;ENSP00000413249:L75S	ENSP00000300027:L75S	L	+	2	0	FANCI	87605014	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.076000	0.76806	2.050000	0.60909	0.533000	0.62120	TTG	.	.		0.428	FANCI-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000421140.1	NM_018193	
IGF1R	3480	hgsc.bcm.edu	37	15	99460002	99460002	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr15:99460002T>C	ENST00000268035.6	+	10	2709	c.2098T>C	c.(2098-2100)Tgc>Cgc	p.C700R	IGF1R_ENST00000558762.1_Missense_Mutation_p.C700R	NM_000875.3	NP_000866.1	P08069	IGF1R_HUMAN	insulin-like growth factor 1 receptor	700	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axonogenesis (GO:0007409)|brain development (GO:0007420)|epidermis development (GO:0008544)|establishment of cell polarity (GO:0030010)|exocrine pancreas development (GO:0031017)|immune response (GO:0006955)|inactivation of MAPKK activity (GO:0051389)|insulin receptor signaling pathway (GO:0008286)|insulin-like growth factor receptor signaling pathway (GO:0048009)|male sex determination (GO:0030238)|mammary gland development (GO:0030879)|negative regulation of apoptotic process (GO:0043066)|negative regulation of muscle cell apoptotic process (GO:0010656)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|peptidyl-tyrosine autophosphorylation (GO:0038083)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytokinesis (GO:0032467)|positive regulation of DNA replication (GO:0045740)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mitosis (GO:0045840)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of steroid hormone biosynthetic process (GO:0090031)|prostate gland epithelium morphogenesis (GO:0060740)|protein autophosphorylation (GO:0046777)|protein heterooligomerization (GO:0051291)|protein tetramerization (GO:0051262)|regulation of JNK cascade (GO:0046328)|response to vitamin E (GO:0033197)|signal transduction (GO:0007165)	caveola (GO:0005901)|integral component of plasma membrane (GO:0005887)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|insulin binding (GO:0043559)|insulin receptor binding (GO:0005158)|insulin receptor substrate binding (GO:0043560)|insulin-like growth factor binding (GO:0005520)|insulin-like growth factor I binding (GO:0031994)|insulin-like growth factor-activated receptor activity (GO:0005010)|phosphatidylinositol 3-kinase binding (GO:0043548)|protein tyrosine kinase activity (GO:0004713)			NS(2)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(13)|lung(20)|ovary(1)|prostate(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	63	all_cancers(4;4.17e-14)|all_epithelial(3;4.34e-15)|Lung NSC(78;0.00175)|all_lung(78;0.00351)|Melanoma(26;0.00505)|Medulloblastoma(229;0.163)		Epithelial(2;1.94e-12)|all cancers(5;6.83e-11)|BRCA - Breast invasive adenocarcinoma(2;2.88e-09)|OV - Ovarian serous cystadenocarcinoma(32;0.00261)		"""""""Insulin(DB00071)|Insulin Glargine(DB00047)|Insulin Lispro(DB00046)|Insulin Regular(DB00030)|Mecasermin(DB01277)"""	AGGGCCTTGCTGCGCCTGCCC	0.552																																					p.C700R		Atlas-SNP	.											.	IGF1R	147	.	0			c.T2098C						.						71.0	70.0	70.0					15																	99460002		2197	4297	6494	SO:0001583	missense	3480	exon10			CCTTGCTGCGCCT	M69229	CCDS10378.1, CCDS73785.1	15q26.3	2013-02-11			ENSG00000140443	ENSG00000140443		"""CD molecules"", ""Fibronectin type III domain containing"""	5465	protein-coding gene	gene with protein product		147370				1316909	Standard	XM_006720486		Approved	JTK13, CD221, IGFIR, MGC18216, IGFR	uc002bul.3	P08069	OTTHUMG00000149851	ENST00000268035.6:c.2098T>C	chr15.hg19:g.99460002T>C	ENSP00000268035:p.Cys700Arg	150.0	0.0		95.0	4.0	NM_000875	B1B5Y2|Q14CV2|Q9UCC0	Missense_Mutation	SNP	ENST00000268035.6	hg19	CCDS10378.1	.	.	.	.	.	.	.	.	.	.	T	24.1	4.499277	0.85069	.	.	ENSG00000140443	ENST00000268035	T	0.81247	-1.47	5.07	5.07	0.68467	Fibronectin, type III (2);	0.000000	0.64402	D	0.000004	D	0.89361	0.6693	M	0.78916	2.43	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.91635	0.999;0.988	D	0.90827	0.4713	10	0.87932	D	0	.	14.9905	0.71384	0.0:0.0:0.0:1.0	.	700;700	C9J5X1;P08069	.;IGF1R_HUMAN	R	700	ENSP00000268035:C700R	ENSP00000268035:C700R	C	+	1	0	IGF1R	97277525	1.000000	0.71417	0.990000	0.47175	0.969000	0.65631	7.868000	0.87116	2.125000	0.65367	0.533000	0.62120	TGC	.	.		0.552	IGF1R-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000313537.2	NM_000875	
C1QTNF8	390664	hgsc.bcm.edu	37	16	1143730	1143730	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr16:1143730T>C	ENST00000328449.5	-	4	803	c.530A>G	c.(529-531)gAg>gGg	p.E177G		NM_207419.3	NP_997302.2	P60827	C1QT8_HUMAN	C1q and tumor necrosis factor related protein 8	177	C1q. {ECO:0000255|PROSITE- ProRule:PRU00368}.					collagen trimer (GO:0005581)|extracellular region (GO:0005576)				lung(2)|prostate(1)|skin(1)	4		Hepatocellular(780;0.00369)				CAGGTAGGTCTCCTTGTAGTT	0.672																																					p.E177G		Atlas-SNP	.											.	C1QTNF8	15	.	0			c.A530G						.						52.0	55.0	54.0					16																	1143730		2198	4293	6491	SO:0001583	missense	390664	exon4			TAGGTCTCCTTGT	AY358832	CCDS32358.1	16p13.3	2014-08-12			ENSG00000184471	ENSG00000184471			31374	protein-coding gene	gene with protein product		614147				12975309	Standard	NM_207419		Approved	UNQ5829, CTRP8	uc010uuw.1	P60827	OTTHUMG00000167756	ENST00000328449.5:c.530A>G	chr16.hg19:g.1143730T>C	ENSP00000330426:p.Glu177Gly	66.0	0.0		70.0	4.0	NM_207419	B7U178	Missense_Mutation	SNP	ENST00000328449.5	hg19	CCDS32358.1	.	.	.	.	.	.	.	.	.	.	T	13.67	2.307720	0.40795	.	.	ENSG00000184471	ENST00000328449	T	0.75704	-0.96	3.43	2.33	0.28932	Tumour necrosis factor-like (2);Complement C1q protein (2);	0.000000	0.53938	D	0.000055	D	0.83069	0.5174	M	0.87381	2.88	0.39218	D	0.963453	D	0.89917	1.0	D	0.73380	0.98	T	0.79560	-0.1753	10	0.40728	T	0.16	.	3.5733	0.07925	0.1943:0.1084:0.0:0.6973	.	177	P60827	C1QT8_HUMAN	G	177	ENSP00000330426:E177G	ENSP00000330426:E177G	E	-	2	0	C1QTNF8	1083731	1.000000	0.71417	0.939000	0.37840	0.055000	0.15305	4.027000	0.57239	0.423000	0.26033	0.528000	0.53228	GAG	.	.		0.672	C1QTNF8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396120.1	XM_372606	
ZNF263	10127	hgsc.bcm.edu	37	16	3340153	3340153	+	Silent	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr16:3340153T>C	ENST00000219069.5	+	6	2523	c.1647T>C	c.(1645-1647)tcT>tcC	p.S549S	ZNF263_ENST00000538765.1_Silent_p.S197S	NM_005741.4	NP_005732.2	O14978	ZN263_HUMAN	zinc finger protein 263	549					negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|endometrium(2)|large_intestine(4)|lung(5)|ovary(1)|skin(4)|urinary_tract(3)	20						ACCCCTTCTCTGAGTGTGGGG	0.473																																					p.S549S		Atlas-SNP	.											.	ZNF263	58	.	0			c.T1647C						.						43.0	40.0	41.0					16																	3340153		2197	4300	6497	SO:0001819	synonymous_variant	10127	exon6			CTTCTCTGAGTGT	AC004232	CCDS10499.1	16p13.3	2013-01-09			ENSG00000006194	ENSG00000006194		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	13056	protein-coding gene	gene with protein product		604191				9256059	Standard	NM_005741		Approved	FPM315, ZKSCAN12, ZSCAN44	uc002cuq.3	O14978	OTTHUMG00000129323	ENST00000219069.5:c.1647T>C	chr16.hg19:g.3340153T>C		119.0	0.0		118.0	5.0	NM_005741	B2R634|O43387|Q96H95	Silent	SNP	ENST00000219069.5	hg19	CCDS10499.1																																																																																			.	.		0.473	ZNF263-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251463.2		
USP7	7874	hgsc.bcm.edu	37	16	9009382	9009382	+	Splice_Site	SNP	A	A	G			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr16:9009382A>G	ENST00000344836.4	-	9	1105	c.907T>C	c.(907-909)Ttg>Ctg	p.L303L	USP7_ENST00000535863.1_Splice_Site_p.L204L|USP7_ENST00000381886.4_Splice_Site_p.L287L	NM_003470.2	NP_003461.2	Q93009	UBP7_HUMAN	ubiquitin specific peptidase 7 (herpes virus-associated)	303	USP.				maintenance of DNA methylation (GO:0010216)|multicellular organismal development (GO:0007275)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|protein deubiquitination (GO:0016579)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|transcription-coupled nucleotide-excision repair (GO:0006283)|ubiquitin-dependent protein catabolic process (GO:0006511)|viral process (GO:0016032)	cytosol (GO:0005829)|nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|p53 binding (GO:0002039)|protein C-terminus binding (GO:0008022)|transcription factor binding (GO:0008134)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(13)|lung(20)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)	48						TTATCGAGCAACTGAAAAAGA	0.333																																					p.L303L		Atlas-SNP	.											.	USP7	116	.	0			c.T907C						.						78.0	73.0	75.0					16																	9009382		2197	4300	6497	SO:0001630	splice_region_variant	7874	exon9			CGAGCAACTGAAA	Z72499	CCDS32385.1, CCDS66941.1	16p13.3	2008-04-11	2005-08-08			ENSG00000187555		"""Ubiquitin-specific peptidases"""	12630	protein-coding gene	gene with protein product		602519	"""ubiquitin specific protease 7 (herpes virus-associated)"""	HAUSP		12838346, 9925944	Standard	NM_003470		Approved		uc002czl.2	Q93009		ENST00000344836.4:c.907-1T>C	chr16.hg19:g.9009382A>G		132.0	0.0		104.0	5.0	NM_003470	A6NMY8|B7Z815|H0Y3G8	Silent	SNP	ENST00000344836.4	hg19	CCDS32385.1																																																																																			.	.		0.333	USP7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000434268.2		Silent
KNOP1	400506	hgsc.bcm.edu	37	16	19725915	19725915	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr16:19725915A>G	ENST00000219837.7	-	2	521	c.443T>C	c.(442-444)cTc>cCc	p.L148P	IQCK_ENST00000320394.6_5'Flank|KNOP1_ENST00000568230.1_5'Flank|AC002550.5_ENST00000565916.1_RNA	NM_001012991.2	NP_001013009.2	Q1ED39	KNOP1_HUMAN	lysine-rich nucleolar protein 1	148	Lys-rich.					nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)										GTGTTTTTTGAGCTTCTTGCC	0.547																																					p.L148P		Atlas-SNP	.											.	C16orf88	41	.	0			c.T443C						.						48.0	53.0	52.0					16																	19725915		2167	4287	6454	SO:0001583	missense	400506	exon2			TTTTTGAGCTTCT	BC047010	CCDS42127.1	16p12.3	2013-03-12	2013-03-12	2013-03-12	ENSG00000103550	ENSG00000103550			34404	protein-coding gene	gene with protein product	"""family with sequence similarity 191, member A"", ""testis-specific gene 118"""		"""chromosome 16 open reading frame 88"""	C16orf88			Standard	NM_001012991		Approved	101F10.1, FAM191A, TSG118	uc002dgq.3	Q1ED39		ENST00000219837.7:c.443T>C	chr16.hg19:g.19725915A>G	ENSP00000219837:p.Leu148Pro	95.0	0.0		68.0	4.0	NM_001012991	O43328|Q5FWF3	Missense_Mutation	SNP	ENST00000219837.7	hg19	CCDS42127.1	.	.	.	.	.	.	.	.	.	.	A	11.14	1.549815	0.27652	.	.	ENSG00000103550	ENST00000219837	T	0.23950	1.88	4.61	-2.03	0.07365	.	6.817630	0.00397	N	0.000046	T	0.12902	0.0313	N	0.11560	0.145	0.58432	D	0.999999	B	0.11235	0.004	B	0.13407	0.009	T	0.28744	-1.0034	9	.	.	.	-0.066	4.6376	0.12531	0.3509:0.0:0.4689:0.1801	.	148	Q1ED39	CP088_HUMAN	P	148	ENSP00000219837:L148P	.	L	-	2	0	C16orf88	19633416	0.984000	0.35163	0.985000	0.45067	0.901000	0.52897	0.261000	0.18442	-0.158000	0.11040	0.459000	0.35465	CTC	.	.		0.547	KNOP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000435993.2	NM_001012991	
HS3ST2	9956	hgsc.bcm.edu	37	16	22826066	22826066	+	Silent	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr16:22826066T>C	ENST00000261374.3	+	1	569	c.135T>C	c.(133-135)ggT>ggC	p.G45G		NM_006043.1	NP_006034.1	Q9Y278	HS3S2_HUMAN	heparan sulfate (glucosamine) 3-O-sulfotransferase 2	45					carbohydrate metabolic process (GO:0005975)|circadian rhythm (GO:0007623)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	[heparan sulfate]-glucosamine 3-sulfotransferase 2 activity (GO:0033871)|sulfotransferase activity (GO:0008146)			breast(2)|kidney(1)|large_intestine(5)|liver(2)|lung(5)|ovary(1)|pancreas(2)|skin(1)	19				GBM - Glioblastoma multiforme(48;0.0299)		ACGACCTGGGTCGGAGCCGCC	0.701																																					p.G45G		Atlas-SNP	.											.	HS3ST2	59	.	0			c.T135C						.						8.0	10.0	10.0					16																	22826066		2127	4170	6297	SO:0001819	synonymous_variant	9956	exon1			CCTGGGTCGGAGC	AF105374	CCDS10606.1	16p12	2008-02-05			ENSG00000122254	ENSG00000122254	2.8.2.23	"""Sulfotransferases, membrane-bound"""	5195	protein-coding gene	gene with protein product		604056				9988767	Standard	NM_006043		Approved	3OST2	uc002dli.3	Q9Y278	OTTHUMG00000094785	ENST00000261374.3:c.135T>C	chr16.hg19:g.22826066T>C		54.0	0.0		73.0	4.0	NM_006043	Q52LZ1	Silent	SNP	ENST00000261374.3	hg19	CCDS10606.1																																																																																			.	.		0.701	HS3ST2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211598.1	NM_006043	
ARHGAP17	55114	hgsc.bcm.edu	37	16	24958829	24958829	+	Silent	SNP	A	A	G			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr16:24958829A>G	ENST00000289968.6	-	14	1284	c.1215T>C	c.(1213-1215)ccT>ccC	p.P405P	ARHGAP17_ENST00000441763.2_3'UTR|ARHGAP17_ENST00000303665.5_Silent_p.P405P	NM_001006634.1	NP_001006635.1	Q68EM7	RHG17_HUMAN	Rho GTPase activating protein 17	405	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	GTPase activator activity (GO:0005096)			breast(2)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(3)|lung(13)|ovary(1)|urinary_tract(2)	30				GBM - Glioblastoma multiforme(48;0.0407)		ATAACAAGTTAGGGCCTAACA	0.413																																					p.P405P		Atlas-SNP	.											.	ARHGAP17	138	.	0			c.T1215C						.						120.0	104.0	110.0					16																	24958829		2197	4300	6497	SO:0001819	synonymous_variant	55114	exon14			CAAGTTAGGGCCT	AJ306731	CCDS32408.1, CCDS32409.1	16p12.2-p12.1	2011-06-29				ENSG00000140750		"""Rho GTPase activating proteins"""	18239	protein-coding gene	gene with protein product		608293				10967100, 11431473	Standard	XM_005255413		Approved	RICH1, FLJ10308, NADRIN, FLJ13219, WBP15	uc002dnb.3	Q68EM7		ENST00000289968.6:c.1215T>C	chr16.hg19:g.24958829A>G		64.0	0.0		68.0	4.0	NM_001006634	A8K6M6|Q6ZUS4|Q7Z2F2|Q8NDG2|Q96KS2|Q96KS3|Q96SS8|Q9BVF6|Q9H8U5|Q9NW54	Silent	SNP	ENST00000289968.6	hg19	CCDS32409.1																																																																																			.	.		0.413	ARHGAP17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000436548.3	NM_018054	
XPO6	23214	hgsc.bcm.edu	37	16	28124248	28124248	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr16:28124248A>G	ENST00000304658.5	-	16	2628	c.2128T>C	c.(2128-2130)Tct>Cct	p.S710P	XPO6_ENST00000565698.1_Missense_Mutation_p.S696P	NM_015171.3	NP_055986.1	Q96QU8	XPO6_HUMAN	exportin 6	710					protein export from nucleus (GO:0006611)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein transporter activity (GO:0008565)			breast(2)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(4)|lung(6)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	25						CGCAGGGCAGAGGCATCAGTG	0.587																																					p.S710P		Atlas-SNP	.											.	XPO6	177	.	0			c.T2128C						.						60.0	64.0	63.0					16																	28124248		1962	4151	6113	SO:0001583	missense	23214	exon16			GGGCAGAGGCATC	AY026388	CCDS42135.1, CCDS59266.1	16p11.2	2011-04-13	2003-03-11	2003-03-14		ENSG00000169180		"""Exportins"""	19733	protein-coding gene	gene with protein product		608411	"""RAN binding protein 20"""	RANBP20		14592989	Standard	NM_001270940		Approved	KIAA0370, FLJ22519	uc002dpa.2	Q96QU8		ENST00000304658.5:c.2128T>C	chr16.hg19:g.28124248A>G	ENSP00000302790:p.Ser710Pro	66.0	0.0		88.0	4.0	NM_015171	A1L3W4|D3DWF9|Q2YDX3|Q53G88|Q68G50|Q76N88|Q96CP8|Q9BT21	Missense_Mutation	SNP	ENST00000304658.5	hg19	CCDS42135.1	.	.	.	.	.	.	.	.	.	.	A	14.53	2.562942	0.45694	.	.	ENSG00000169180	ENST00000304658	T	0.70282	-0.47	5.64	5.64	0.86602	Armadillo-like helical (1);Armadillo-type fold (1);	0.171220	0.53938	D	0.000053	T	0.59865	0.2225	L	0.40543	1.245	0.46564	D	0.999107	P;P	0.38335	0.497;0.627	B;B	0.34489	0.091;0.184	T	0.59166	-0.7505	10	0.25106	T	0.35	-14.0359	13.816	0.63292	1.0:0.0:0.0:0.0	.	710;710	B7ZM10;Q96QU8	.;XPO6_HUMAN	P	710	ENSP00000302790:S710P	ENSP00000302790:S710P	S	-	1	0	XPO6	28031749	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	5.939000	0.70179	2.162000	0.67917	0.455000	0.32223	TCT	.	.		0.587	XPO6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433732.1	XM_055195	
SETD1A	9739	hgsc.bcm.edu	37	16	30978231	30978231	+	Silent	SNP	A	A	G			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr16:30978231A>G	ENST00000262519.8	+	9	3218	c.2532A>G	c.(2530-2532)caA>caG	p.Q844Q		NM_014712.1	NP_055527.1	O15047	SET1A_HUMAN	SET domain containing 1A	844					histone H3-K4 methylation (GO:0051568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)|Set1C/COMPASS complex (GO:0048188)	histone methyltransferase activity (H3-K4 specific) (GO:0042800)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(9)|lung(21)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	59						CCAAGCAGCAAGCCAAGGAGG	0.642																																					p.Q844Q		Atlas-SNP	.											.	SETD1A	143	.	0			c.A2532G						.						29.0	26.0	27.0					16																	30978231		2185	4285	6470	SO:0001819	synonymous_variant	9739	exon9			GCAGCAAGCCAAG	AB002337	CCDS32435.1	16p11.2	2013-02-12			ENSG00000099381	ENSG00000099381		"""Chromatin-modifying enzymes / K-methyltransferases"", ""RNA binding motif (RRM) containing"""	29010	protein-coding gene	gene with protein product		611052				9205841, 12670868	Standard	XM_005255723		Approved	KIAA0339, Set1, KMT2F	uc002ead.1	O15047	OTTHUMG00000150474	ENST00000262519.8:c.2532A>G	chr16.hg19:g.30978231A>G		82.0	0.0		80.0	4.0	NM_014712	A6NP62|Q6PIF3|Q8TAJ6	Silent	SNP	ENST00000262519.8	hg19	CCDS32435.1																																																																																			.	.		0.642	SETD1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318244.2	NM_014712	
SLC12A3	6559	hgsc.bcm.edu	37	16	56913123	56913123	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr16:56913123T>C	ENST00000563236.1	+	10	1344	c.1319T>C	c.(1318-1320)cTc>cCc	p.L440P	SLC12A3_ENST00000566786.1_Missense_Mutation_p.L439P|SLC12A3_ENST00000262502.5_Missense_Mutation_p.L439P|SLC12A3_ENST00000438926.2_Missense_Mutation_p.L440P			P55017	S12A3_HUMAN	solute carrier family 12 (sodium/chloride transporter), member 3	440					chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transport (GO:0006811)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	sodium:chloride symporter activity (GO:0015378)|transporter activity (GO:0005215)			breast(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(28)|ovary(2)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	50					Bendroflumethiazide(DB00436)|Benzthiazide(DB00562)|Chlorothiazide(DB00880)|Diazoxide(DB01119)|Hydrochlorothiazide(DB00999)|Metolazone(DB00524)|Polythiazide(DB01324)|Quinethazone(DB01325)	CACTACGGCCTCATCAACTAT	0.632																																					p.L440P		Atlas-SNP	.											.	SLC12A3	99	.	0			c.T1319C						.						31.0	33.0	33.0					16																	56913123		2197	4300	6497	SO:0001583	missense	6559	exon10			ACGGCCTCATCAA		CCDS10770.1, CCDS45491.1, CCDS58464.1	16q13	2013-07-18	2013-07-18		ENSG00000070915	ENSG00000070915		"""Solute carriers"""	10912	protein-coding gene	gene with protein product		600968				8812482	Standard	NM_000339		Approved	NCCT	uc002ekd.4	P55017	OTTHUMG00000133284	ENST00000563236.1:c.1319T>C	chr16.hg19:g.56913123T>C	ENSP00000456149:p.Leu440Pro	109.0	0.0		79.0	4.0	NM_001126108	A8MSJ2|C9JNN9	Missense_Mutation	SNP	ENST00000563236.1	hg19	CCDS58464.1	.	.	.	.	.	.	.	.	.	.	T	19.25	3.791560	0.70452	.	.	ENSG00000070915	ENST00000438926;ENST00000262502	.	.	.	4.91	4.91	0.64330	Amino acid permease domain (1);	0.061080	0.64402	D	0.000003	D	0.86698	0.5995	H	0.95470	3.675	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.997;0.998;0.997	D	0.90750	0.4656	9	0.87932	D	0	.	14.5276	0.67900	0.0:0.0:0.0:1.0	.	439;440;440	P55017-3;P55017;P55017-2	.;S12A3_HUMAN;.	P	439;440	.	ENSP00000262502:L440P	L	+	2	0	SLC12A3	55470624	1.000000	0.71417	1.000000	0.80357	0.765000	0.43378	7.906000	0.87423	1.825000	0.53177	0.379000	0.24179	CTC	.	.		0.632	SLC12A3-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000432337.1		
CDH16	1014	hgsc.bcm.edu	37	16	66946026	66946026	+	Silent	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr16:66946026T>C	ENST00000299752.4	-	13	1759	c.1566A>G	c.(1564-1566)gcA>gcG	p.A522A	CDH16_ENST00000568632.1_Silent_p.A425A|CDH16_ENST00000394055.3_Silent_p.A522A|CDH16_ENST00000570262.1_Silent_p.A442A|CDH16_ENST00000565796.1_Silent_p.A522A	NM_001204744.1|NM_001204745.1|NM_004062.3	NP_001191673.1|NP_001191674.1|NP_004053.1	O75309	CAD16_HUMAN	cadherin 16, KSP-cadherin	522	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)	basolateral plasma membrane (GO:0016323)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)			endometrium(1)|kidney(3)|large_intestine(10)|lung(15)|ovary(2)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	41		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0877)|Epithelial(162;0.203)		GACTTGGAGCTGCCTCATAAC	0.642																																					p.A522A		Atlas-SNP	.											.	CDH16	91	.	0			c.A1566G						.						42.0	41.0	42.0					16																	66946026		2200	4300	6500	SO:0001819	synonymous_variant	1014	exon13			TGGAGCTGCCTCA	AF016272	CCDS10823.1, CCDS56002.1, CCDS58471.1, CCDS58472.1	16q22.1	2010-01-26			ENSG00000166589	ENSG00000166589		"""Cadherins / Major cadherins"""	1755	protein-coding gene	gene with protein product		603118				9721215, 7615566	Standard	NM_004062		Approved		uc002eql.3	O75309	OTTHUMG00000137518	ENST00000299752.4:c.1566A>G	chr16.hg19:g.66946026T>C		96.0	0.0		75.0	4.0	NM_004062	B4DPA8|H3BPD3|Q6UW93	Silent	SNP	ENST00000299752.4	hg19	CCDS10823.1																																																																																			.	.		0.642	CDH16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268839.2	NM_004062	
ATP6V0D1	9114	hgsc.bcm.edu	37	16	67477048	67477048	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr16:67477048T>C	ENST00000290949.3	-	4	665	c.515A>G	c.(514-516)gAc>gGc	p.D172G	ATP6V0D1_ENST00000602876.1_Missense_Mutation_p.D95G|ATP6V0D1_ENST00000540149.1_Missense_Mutation_p.D213G|ATP6V0D1_ENST00000567694.1_5'Flank	NM_004691.4	NP_004682.2	P61421	VA0D1_HUMAN	ATPase, H+ transporting, lysosomal 38kDa, V0 subunit d1	172					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|ATP hydrolysis coupled proton transport (GO:0015991)|brain development (GO:0007420)|cellular iron ion homeostasis (GO:0006879)|cellular protein metabolic process (GO:0044267)|cilium assembly (GO:0042384)|endoplasmic reticulum unfolded protein response (GO:0030968)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|proton transport (GO:0015992)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|axon terminus (GO:0043679)|early endosome (GO:0005769)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|phagocytic vesicle membrane (GO:0030670)|proton-transporting V-type ATPase, V0 domain (GO:0033179)|synaptic vesicle (GO:0008021)|vacuolar proton-transporting V-type ATPase complex (GO:0016471)	hydrogen-exporting ATPase activity, phosphorylative mechanism (GO:0008553)			large_intestine(3)|lung(3)|urinary_tract(2)	8		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0439)|Epithelial(162;0.101)		CTCGTCAAGGTCCTGCTCTGA	0.562																																					p.D172G		Atlas-SNP	.											.	ATP6V0D1	25	.	0			c.A515G						.						158.0	144.0	149.0					16																	67477048		2198	4300	6498	SO:0001583	missense	9114	exon4			TCAAGGTCCTGCT	X71490	CCDS10838.1	16q22	2010-04-21	2006-01-20	2002-05-10	ENSG00000159720	ENSG00000159720		"""ATPases / V-type"""	13724	protein-coding gene	gene with protein product		607028	"""ATPase, H+ transporting, lysosomal (vacuolar proton pump), member D"", ""ATPase, H+ transporting, lysosomal 38kDa, V0 subunit d isoform 1"", ""ATPase, H+ transporting, lysosomal 38kDa, V0 subunit D1"""	ATP6D		8250920	Standard	NM_004691		Approved	ATP6DV, VATX, VPATPD, P39, Vma6	uc002ete.1	P61421	OTTHUMG00000137515	ENST00000290949.3:c.515A>G	chr16.hg19:g.67477048T>C	ENSP00000290949:p.Asp172Gly	187.0	0.0		145.0	6.0	NM_004691	P12953|Q02547	Missense_Mutation	SNP	ENST00000290949.3	hg19	CCDS10838.1	.	.	.	.	.	.	.	.	.	.	T	16.57	3.161553	0.57368	.	.	ENSG00000159720	ENST00000290949;ENST00000426604;ENST00000540149	T;T	0.34275	1.37;1.37	5.56	5.56	0.83823	.	0.000000	0.85682	D	0.000000	T	0.70745	0.3259	H	0.95504	3.68	0.80722	D	1	D;D	0.71674	0.998;0.997	D;D	0.78314	0.991;0.989	T	0.80151	-0.1502	10	0.66056	D	0.02	-34.6226	14.546	0.68030	0.0:0.0:0.0:1.0	.	213;172	F5GYQ1;P61421	.;VA0D1_HUMAN	G	172;95;213	ENSP00000290949:D172G;ENSP00000441282:D213G	ENSP00000290949:D172G	D	-	2	0	ATP6V0D1	66034549	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.307000	0.72815	2.133000	0.65898	0.533000	0.62120	GAC	.	.		0.562	ATP6V0D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268835.1	NM_004691	
CENPT	80152	hgsc.bcm.edu	37	16	67864301	67864301	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr16:67864301T>C	ENST00000562787.1	-	11	1402	c.854A>G	c.(853-855)cAg>cGg	p.Q285R	CENPT_ENST00000564817.1_Missense_Mutation_p.Q285R|CENPT_ENST00000440851.2_Missense_Mutation_p.Q285R|CENPT_ENST00000562947.1_5'UTR|CENPT_ENST00000219172.3_Missense_Mutation_p.Q285R	NM_025082.3	NP_079358.3	Q96BT3	CENPT_HUMAN	centromere protein T	285	Flexible stalk domain. {ECO:0000250}.				chromosome organization (GO:0051276)|chromosome segregation (GO:0007059)|kinetochore assembly (GO:0051382)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	chromosome, centromeric region (GO:0000775)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(1)|breast(2)|lung(6)|urinary_tract(1)	10		Acute lymphoblastic leukemia(13;0.000299)|all_hematologic(13;0.0184)|Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.00429)|Epithelial(162;0.019)|all cancers(182;0.124)		ACTATTCTTCTGCAGCCCAGG	0.587																																					p.Q285R		Atlas-SNP	.											.	CENPT	26	.	0			c.A854G						.						66.0	73.0	71.0					16																	67864301		2130	4257	6387	SO:0001583	missense	80152	exon11			TTCTTCTGCAGCC	AK056097	CCDS42182.1	16q22.1	2013-11-05	2006-06-15	2006-06-15		ENSG00000102901			25787	protein-coding gene	gene with protein product		611510	"""chromosome 16 open reading frame 56"""	C16orf56		16622420, 16622419	Standard	NM_025082		Approved	FLJ13111, CENP-T	uc002eun.4	Q96BT3		ENST00000562787.1:c.854A>G	chr16.hg19:g.67864301T>C	ENSP00000457810:p.Gln285Arg	119.0	0.0		94.0	6.0	NM_025082	Q96I29|Q96IC6|Q96NK9|Q9H901	Missense_Mutation	SNP	ENST00000562787.1	hg19	CCDS42182.1	.	.	.	.	.	.	.	.	.	.	T	15.43	2.832296	0.50845	.	.	ENSG00000102901	ENST00000440851;ENST00000219172	T;T	0.50548	0.74;0.74	4.98	2.74	0.32292	.	0.572147	0.16294	N	0.220785	T	0.44350	0.1289	M	0.74881	2.28	0.09310	N	0.999999	B;B	0.11235	0.004;0.004	B;B	0.11329	0.006;0.006	T	0.37572	-0.9700	10	0.34782	T	0.22	-5.75	6.7835	0.23659	0.0:0.1917:0.0:0.8083	.	285;285	Q96BT3;B3KPB2	CENPT_HUMAN;.	R	285	ENSP00000400140:Q285R;ENSP00000219172:Q285R	ENSP00000219172:Q285R	Q	-	2	0	CENPT	66421802	0.832000	0.29368	0.021000	0.16686	0.009000	0.06853	1.969000	0.40510	0.456000	0.26937	-0.376000	0.06991	CAG	.	.		0.587	CENPT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000422020.1	NM_025082	
EDC4	23644	hgsc.bcm.edu	37	16	67916724	67916724	+	Silent	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr16:67916724T>C	ENST00000358933.5	+	26	3824	c.3585T>C	c.(3583-3585)agT>agC	p.S1195S	CTC-479C5.10_ENST00000572067.1_lincRNA|NRN1L_ENST00000576147.1_5'Flank|NRN1L_ENST00000339176.3_5'Flank	NM_014329.4	NP_055144.3	Q6P2E9	EDC4_HUMAN	enhancer of mRNA decapping 4	1195					exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)				breast(3)|central_nervous_system(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(4)|lung(8)|ovary(4)|skin(2)|upper_aerodigestive_tract(4)|urinary_tract(2)	41		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0042)|Epithelial(162;0.0185)|all cancers(182;0.121)		TGGCCGGCAGTGTTCGTGCTG	0.647											OREG0023890	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.S1195S		Atlas-SNP	.											.	EDC4	101	.	0			c.T3585C						.						56.0	52.0	53.0					16																	67916724		2198	4300	6498	SO:0001819	synonymous_variant	23644	exon26			CGGCAGTGTTCGT	U17474	CCDS10849.1	16q22.1	2008-02-05			ENSG00000038358	ENSG00000038358			17157	protein-coding gene	gene with protein product		606030				9067524	Standard	NM_014329		Approved	RCD-8, Ge-1, HEDLS	uc002eur.3	Q6P2E9	OTTHUMG00000137543	ENST00000358933.5:c.3585T>C	chr16.hg19:g.67916724T>C		89.0	0.0	1103	76.0	4.0	NM_014329	A6NGM1|A8K4T4|Q13025|Q13826|Q6ZR12|Q7Z6H7	Silent	SNP	ENST00000358933.5	hg19	CCDS10849.1																																																																																			.	.		0.647	EDC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268874.2	NM_014329	
PHLPP2	23035	hgsc.bcm.edu	37	16	71683278	71683278	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr16:71683278T>C	ENST00000568954.1	-	19	3865	c.3487A>G	c.(3487-3489)Agc>Ggc	p.S1163G	PHLPP2_ENST00000540628.1_Intron|PHLPP2_ENST00000356272.3_Missense_Mutation_p.S1163G|PHLPP2_ENST00000567016.1_Missense_Mutation_p.S1198G|PHLPP2_ENST00000360429.3_Intron|PHLPP2_ENST00000393524.2_Missense_Mutation_p.S1096G			Q6ZVD8	PHLP2_HUMAN	PH domain and leucine rich repeat protein phosphatase 2	1163					epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment membrane (GO:0042622)	metal ion binding (GO:0046872)|protein serine/threonine phosphatase activity (GO:0004722)			central_nervous_system(1)|endometrium(5)|kidney(5)|large_intestine(7)|lung(15)|ovary(1)|prostate(1)|skin(1)|stomach(1)	37						TCTACCTTGCTGCCATTGGTT	0.552																																					p.S1163G		Atlas-SNP	.											.	PHLPP2	96	.	0			c.A3487G						.						69.0	69.0	69.0					16																	71683278		2198	4300	6498	SO:0001583	missense	23035	exon18			CCTTGCTGCCATT	BX647823	CCDS32479.1, CCDS73910.1	16q22.2	2013-01-11	2009-05-26	2009-05-26	ENSG00000040199	ENSG00000040199		"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"", ""Pleckstrin homology (PH) domain containing"""	29149	protein-coding gene	gene with protein product		611066	"""PH domain and leucine rich repeat protein phosphatase-like"""	PHLPPL		17386267	Standard	NM_001289003		Approved	KIAA0931	uc002fax.3	Q6ZVD8		ENST00000568954.1:c.3487A>G	chr16.hg19:g.71683278T>C	ENSP00000457991:p.Ser1163Gly	72.0	0.0		69.0	4.0	NM_015020	A1L374|Q9NV17|Q9Y2E3	Missense_Mutation	SNP	ENST00000568954.1	hg19	CCDS32479.1	.	.	.	.	.	.	.	.	.	.	T	18.48	3.632192	0.67015	.	.	ENSG00000040199	ENST00000356272;ENST00000393524	T;T	0.62639	0.67;0.01	6.03	6.03	0.97812	.	0.000000	0.85682	D	0.000000	T	0.79137	0.4395	M	0.75264	2.295	0.54753	D	0.99998	D;D	0.76494	0.999;0.998	D;D	0.80764	0.994;0.98	T	0.81446	-0.0929	10	0.87932	D	0	-21.3651	15.7393	0.77876	0.0:0.0:0.0:1.0	.	1096;1163	Q6ZVD8-3;Q6ZVD8	.;PHLP2_HUMAN	G	1163;1096	ENSP00000348611:S1163G;ENSP00000377159:S1096G	ENSP00000348611:S1163G	S	-	1	0	PHLPP2	70240779	1.000000	0.71417	1.000000	0.80357	0.532000	0.34746	6.103000	0.71492	2.308000	0.77769	0.533000	0.62120	AGC	.	.		0.552	PHLPP2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000434139.1	NM_015020	
CHST6	4166	hgsc.bcm.edu	37	16	75513087	75513087	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr16:75513087T>C	ENST00000332272.4	-	3	819	c.640A>G	c.(640-642)Aca>Gca	p.T214A	RP11-77K12.4_ENST00000530512.3_RNA|CHST6_ENST00000390664.2_Missense_Mutation_p.T214A	NM_021615.4	NP_067628.1	Q9GZX3	CHST6_HUMAN	carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 6	214					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|N-acetylglucosamine metabolic process (GO:0006044)|small molecule metabolic process (GO:0044281)|sulfur compound metabolic process (GO:0006790)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	N-acetylglucosamine 6-O-sulfotransferase activity (GO:0001517)			central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(1)|lung(7)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	17						GCCTTGGCTGTCTGCTCCCGG	0.726																																					p.T214A		Atlas-SNP	.											.	CHST6	57	.	0			c.A640G						.						21.0	22.0	22.0					16																	75513087		2195	4287	6482	SO:0001583	missense	4166	exon3			TGGCTGTCTGCTC	AF280086	CCDS10918.1	16q22	2008-02-05			ENSG00000183196	ENSG00000183196		"""Sulfotransferases, membrane-bound"""	6938	protein-coding gene	gene with protein product		605294		MCDC1		8644739, 11017086	Standard	NM_021615		Approved		uc002fef.3	Q9GZX3	OTTHUMG00000137612	ENST00000332272.4:c.640A>G	chr16.hg19:g.75513087T>C	ENSP00000328983:p.Thr214Ala	8.0	0.0		75.0	4.0	NM_021615	D3DUK3	Missense_Mutation	SNP	ENST00000332272.4	hg19	CCDS10918.1	.	.	.	.	.	.	.	.	.	.	T	5.691	0.312125	0.10789	.	.	ENSG00000183196	ENST00000332272;ENST00000390664	D;D	0.99716	-6.51;-6.51	4.68	0.867	0.19085	Sulfotransferase domain (1);	0.364119	0.28977	N	0.013535	D	0.95931	0.8675	N	0.04387	-0.21	0.27160	N	0.96118	B	0.10296	0.003	B	0.17979	0.02	D	0.93532	0.6870	10	0.02654	T	1	.	3.3358	0.07101	0.2253:0.329:0.0:0.4457	.	214	Q9GZX3	CHST6_HUMAN	A	214	ENSP00000328983:T214A;ENSP00000375079:T214A	ENSP00000328983:T214A	T	-	1	0	CHST6	74070588	0.754000	0.28360	0.978000	0.43139	0.175000	0.22909	0.095000	0.15127	0.176000	0.19873	-0.376000	0.06991	ACA	.	.		0.726	CHST6-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000435478.1	NM_021615	
CHST5	23563	hgsc.bcm.edu	37	16	75563627	75563627	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr16:75563627A>G	ENST00000336257.3	-	3	2050	c.656T>C	c.(655-657)aTc>aCc	p.I219T	RP11-77K12.7_ENST00000460606.1_3'UTR|CHST5_ENST00000541075.1_Missense_Mutation_p.I225T	NM_024533.4	NP_078809.2	Q9GZS9	CHST5_HUMAN	carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 5	219					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|N-acetylglucosamine metabolic process (GO:0006044)|protein sulfation (GO:0006477)|small molecule metabolic process (GO:0044281)|sulfur compound metabolic process (GO:0006790)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|intrinsic component of Golgi membrane (GO:0031228)	N-acetylglucosamine 6-O-sulfotransferase activity (GO:0001517)|sulfotransferase activity (GO:0008146)			cervix(1)|endometrium(5)|kidney(1)|large_intestine(3)|lung(11)|ovary(1)|prostate(2)	24						CAGGTGCACGATGCGCAGGTT	0.706																																					p.I219T		Atlas-SNP	.											CHST5,right_upper_lobe,carcinoma,0,1	CHST5	47	.	0			c.T656C						.						45.0	49.0	48.0					16																	75563627		2197	4299	6496	SO:0001583	missense	23563	exon3			TGCACGATGCGCA	AF176839	CCDS10919.1	16q23.1	2008-02-05			ENSG00000135702	ENSG00000135702		"""Sulfotransferases, membrane-bound"""	1973	protein-coding gene	gene with protein product		604817				10491328, 11017086	Standard	NM_024533		Approved	I-GLCNAC-6-ST, FLJ22167	uc002fei.3	Q9GZS9	OTTHUMG00000137610	ENST00000336257.3:c.656T>C	chr16.hg19:g.75563627A>G	ENSP00000338783:p.Ile219Thr	23.0	0.0		27.0	2.0	NM_024533	B2RV23|Q7LCN3|Q9UBY3	Missense_Mutation	SNP	ENST00000336257.3	hg19	CCDS10919.1	.	.	.	.	.	.	.	.	.	.	A	13.35	2.210082	0.39003	.	.	ENSG00000135702	ENST00000336257;ENST00000541075	D;D	0.85556	-2.0;-2.0	2.84	2.84	0.33178	Sulfotransferase domain (1);	0.054428	0.64402	D	0.000001	D	0.91509	0.7319	M	0.85462	2.755	0.80722	D	1	D;D	0.69078	0.997;0.997	D;D	0.76071	0.978;0.987	D	0.91667	0.5347	10	0.72032	D	0.01	.	10.0936	0.42462	1.0:0.0:0.0:0.0	.	225;219	Q9GZS9-2;Q9GZS9	.;CHST5_HUMAN	T	219;225	ENSP00000338783:I219T;ENSP00000441220:I225T	ENSP00000338783:I219T	I	-	2	0	CHST5	74121128	1.000000	0.71417	0.999000	0.59377	0.038000	0.13279	8.717000	0.91425	1.296000	0.44742	0.260000	0.18958	ATC	.	.		0.706	CHST5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269025.2	NM_012126	
TAF1C	9013	hgsc.bcm.edu	37	16	84214979	84214979	+	Silent	SNP	C	C	A			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr16:84214979C>A	ENST00000567759.1	-	10	1379	c.1197G>T	c.(1195-1197)gtG>gtT	p.V399V	TAF1C_ENST00000378541.4_Silent_p.V399V|TAF1C_ENST00000570117.1_Silent_p.V67V|TAF1C_ENST00000566732.1_Silent_p.V373V|TAF1C_ENST00000541676.1_Silent_p.V306V|TAF1C_ENST00000341690.6_Silent_p.V306V	NM_005679.3	NP_005670	Q15572	TAF1C_HUMAN	TATA box binding protein (TBP)-associated factor, RNA polymerase I, C, 110kDa	399					gene expression (GO:0010467)|regulation of transcription, DNA-templated (GO:0006355)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase I promoter (GO:0006361)	nucleoplasm (GO:0005654)	DNA binding (GO:0003677)			endometrium(1)|kidney(3)|large_intestine(3)|lung(11)|ovary(3)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	26						CCACGGTCAGCACCCGAGGGT	0.667																																					p.V399V		Atlas-SNP	.											TAF1C,bladder,carcinoma,0,1	TAF1C	60	.	0			c.G1197T						.						45.0	44.0	44.0					16																	84214979		2200	4299	6499	SO:0001819	synonymous_variant	9013	exon10			GGTCAGCACCCGA	L39059	CCDS32496.1, CCDS45535.1, CCDS58488.1, CCDS58489.1	16q24	2008-02-05	2002-08-29			ENSG00000103168			11534	protein-coding gene	gene with protein product		604905	"""TATA box binding protein (TBP)-associated factor, RNA polymerase I, C, 110kD"""			7801123	Standard	NM_005679		Approved	TAFI110, TAFI95, SL1, MGC:39976	uc010vnx.2	Q15572		ENST00000567759.1:c.1197G>T	chr16.hg19:g.84214979C>A		151.0	1.0		160.0	8.0	NM_005679	B7Z5K5|B7Z5S4|B7Z908|B7Z9L7|Q59F67|Q8N6V3	Silent	SNP	ENST00000567759.1	hg19	CCDS32496.1																																																																																			.	.		0.667	TAF1C-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000433045.2	NM_139353	
SMG6	23293	hgsc.bcm.edu	37	17	2203182	2203182	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr17:2203182T>C	ENST00000263073.6	-	2	915	c.865A>G	c.(865-867)Agg>Ggg	p.R289G	SMG6_ENST00000544865.1_Missense_Mutation_p.R258G	NM_017575.4	NP_060045.4	Q86US8	EST1A_HUMAN	SMG6 nonsense mediated mRNA decay factor	289	Interaction with telomeric DNA.				gene expression (GO:0010467)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|regulation of dephosphorylation (GO:0035303)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|telomere maintenance (GO:0000723)	chromosome, telomeric region (GO:0000781)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleolus (GO:0005730)|nucleus (GO:0005634)|telomerase holoenzyme complex (GO:0005697)	endoribonuclease activity (GO:0004521)|metal ion binding (GO:0046872)|telomeric DNA binding (GO:0042162)			NS(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(7)|lung(10)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	45						AGTCGTGGCCTCTCCTTGGTC	0.567																																					p.R289G	Melanoma(59;28 1088 11621 25887 46638 50814)	Atlas-SNP	.											.	SMG6	97	.	0			c.A865G						.						82.0	72.0	75.0					17																	2203182		2203	4300	6503	SO:0001583	missense	23293	exon2			GTGGCCTCTCCTT	AB018275	CCDS11016.1, CCDS58498.1	17p13.3	2013-07-02	2013-07-02	2006-02-16	ENSG00000070366	ENSG00000070366			17809	protein-coding gene	gene with protein product	"""EST1 telomerase component homolog A (S. cerevisiae)"""	610963	"""chromosome 17 open reading frame 31"", ""smg-6 homolog, nonsense mediated mRNA decay factor (C. elegans)"""	C17orf31		12676087, 12699629	Standard	NM_017575		Approved	KIAA0732, SMG-6, EST1A	uc002fub.1	Q86US8	OTTHUMG00000177578	ENST00000263073.6:c.865A>G	chr17.hg19:g.2203182T>C	ENSP00000263073:p.Arg289Gly	135.0	0.0		90.0	4.0	NM_017575	B7Z874|O94837|Q86VH6|Q9UF60	Missense_Mutation	SNP	ENST00000263073.6	hg19	CCDS11016.1	.	.	.	.	.	.	.	.	.	.	T	16.10	3.028541	0.54790	.	.	ENSG00000070366	ENST00000263073;ENST00000544865	T;T	0.11712	2.75;2.75	5.35	4.2	0.49525	.	0.542190	0.21297	N	0.076880	T	0.07728	0.0194	L	0.27053	0.805	0.41774	D	0.989784	B	0.29936	0.262	B	0.21360	0.034	T	0.27571	-1.0070	10	0.39692	T	0.17	-8.2077	11.6871	0.51492	0.0:0.0:0.148:0.852	.	289	Q86US8	EST1A_HUMAN	G	289;258	ENSP00000263073:R289G;ENSP00000443920:R258G	ENSP00000263073:R289G	R	-	1	2	SMG6	2149932	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.087000	0.41653	2.015000	0.59207	0.533000	0.62120	AGG	.	.		0.567	SMG6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437826.3		
PELP1	27043	hgsc.bcm.edu	37	17	4575334	4575334	+	Silent	SNP	T	T	G	rs139398595	byFrequency	TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr17:4575334T>G	ENST00000574876.1	-	16	2969	c.2952A>C	c.(2950-2952)ccA>ccC	p.P984P	PELP1_ENST00000269230.7_Silent_p.P894P|PELP1_ENST00000301396.4_Silent_p.P1128P|PELP1_ENST00000572293.1_Silent_p.P1034P|PELP1_ENST00000436683.2_Intron			Q8IZL8	PELP1_HUMAN	proline, glutamate and leucine rich protein 1	984	Glu-rich.|Pro-rich.				cellular response to estrogen stimulus (GO:0071391)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|membrane (GO:0016020)|MLL1 complex (GO:0071339)|nucleolus (GO:0005730)|nucleus (GO:0005634)|transcriptionally active chromatin (GO:0035327)	chromatin binding (GO:0003682)|poly(A) RNA binding (GO:0044822)|transcription factor binding (GO:0008134)			breast(2)|central_nervous_system(2)|endometrium(2)|large_intestine(2)|lung(3)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	15						GAGGCAGAGCTGGAGGCAGGG	0.617																																					p.P984P		Atlas-SNP	.											.	PELP1	102	.	0			c.A2952C						.						36.0	40.0	38.0					17																	4575334		2011	4156	6167	SO:0001819	synonymous_variant	27043	exon16			CAGAGCTGGAGGC		CCDS58503.1, CCDS58503.2, CCDS62038.1	17p13.2	2012-05-02	2008-02-21			ENSG00000141456			30134	protein-coding gene	gene with protein product		609455	"""proline, glutamic acid and leucine rich protein 1"""			11481323, 12682072	Standard	NM_014389		Approved	MNAR	uc002fyi.4	Q8IZL8		ENST00000574876.1:c.2952A>C	chr17.hg19:g.4575334T>G		48.0	0.0		19.0	5.0	NM_014389	O15450|Q5EGN3|Q6NTE6|Q96FT1|Q9BU60	Silent	SNP	ENST00000574876.1	hg19	CCDS58503.1																																																																																			.	.		0.617	PELP1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000439140.2	NM_014389	
TP53	7157	hgsc.bcm.edu	37	17	7579349	7579349	+	Missense_Mutation	SNP	A	A	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr17:7579349A>C	ENST00000269305.4	-	4	527	c.338T>G	c.(337-339)tTc>tGc	p.F113C	TP53_ENST00000574684.1_5'Flank|TP53_ENST00000420246.2_Missense_Mutation_p.F113C|TP53_ENST00000455263.2_Missense_Mutation_p.F113C|TP53_ENST00000413465.2_Missense_Mutation_p.F113C|TP53_ENST00000359597.4_Missense_Mutation_p.F113C|TP53_ENST00000445888.2_Missense_Mutation_p.F113C	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	113	Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		F -> C (in sporadic cancers; somatic mutation).|F -> G (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|F -> I (in a sporadic cancer; somatic mutation).|F -> L (in sporadic cancers; somatic mutation).|F -> S (in sporadic cancers; somatic mutation).|F -> V (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:17224074}.		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.F113C(11)|p.0?(8)|p.F113S(4)|p.G59fs*23(3)|p.V73fs*9(1)|p.G105_T125del21(1)|p.G112_V122delGFLHSGTAKSV(1)|p.G112fs*9(1)|p.F113del(1)|p.Y107fs*44(1)|p.G112_S116delGFLHS(1)|p.P13fs*18(1)|p.S33fs*23(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	AGAATGCAAGAAGCCCAGACG	0.607		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.F113C	Pancreas(47;798 1329 9957 10801)	Atlas-SNP	.	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53_ENST00000413465,NS,carcinoma,0,16	TP53	33396	.	35	Substitution - Missense(15)|Whole gene deletion(8)|Deletion - Frameshift(8)|Deletion - In frame(4)	upper_aerodigestive_tract(6)|lung(5)|large_intestine(4)|bone(4)|central_nervous_system(3)|ovary(3)|haematopoietic_and_lymphoid_tissue(2)|urinary_tract(2)|breast(2)|stomach(1)|liver(1)|oesophagus(1)|autonomic_ganglia(1)	c.T338G						.						65.0	61.0	62.0					17																	7579349		2203	4300	6503	SO:0001583	missense	7157	exon4	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	TGCAAGAAGCCCA	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.338T>G	chr17.hg19:g.7579349A>C	ENSP00000269305:p.Phe113Cys	200.0	0.0		137.0	84.0	NM_000546	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	hg19	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	A	18.70	3.680367	0.68042	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000508793;ENST00000503591	D;D;D;D;D;D;D;D	0.99867	-7.31;-7.31;-7.31;-7.31;-7.31;-7.31;-7.31;-7.31	4.75	4.75	0.60458	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99854	0.9932	M	0.89414	3.03	0.52099	D	0.999945	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.97110	1.0;1.0;1.0;0.995;1.0;1.0;1.0	D	0.96472	0.9349	10	0.87932	D	0	-31.6488	12.5363	0.56144	1.0:0.0:0.0:0.0	.	74;113;113;113;113;113;113	B4E095;E7EMR6;P04637-2;P04637-3;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	C	113	ENSP00000410739:F113C;ENSP00000352610:F113C;ENSP00000269305:F113C;ENSP00000398846:F113C;ENSP00000391127:F113C;ENSP00000391478:F113C;ENSP00000424104:F113C;ENSP00000426252:F113C	ENSP00000269305:F113C	F	-	2	0	TP53	7520074	1.000000	0.71417	0.986000	0.45419	0.960000	0.62799	5.450000	0.66626	2.125000	0.65367	0.533000	0.62120	TTC	.	.		0.607	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
CTC1	80169	hgsc.bcm.edu	37	17	8131865	8131865	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr17:8131865A>G	ENST00000315684.8	-	22	3477	c.3470T>C	c.(3469-3471)cTt>cCt	p.L1157P		NM_025099.5	NP_079375.3	Q2NKJ3	CTC1_HUMAN	CTS telomere maintenance complex component 1	1157					bone marrow development (GO:0048539)|cellular response to DNA damage stimulus (GO:0006974)|hematopoietic stem cell proliferation (GO:0071425)|multicellular organism growth (GO:0035264)|positive regulation of DNA replication (GO:0045740)|positive regulation of fibroblast proliferation (GO:0048146)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)|replicative senescence (GO:0090399)|spleen development (GO:0048536)|telomere maintenance (GO:0000723)|telomere maintenance via telomere lengthening (GO:0010833)|thymus development (GO:0048538)	nuclear chromosome, telomeric region (GO:0000784)|nucleus (GO:0005634)|Stn1-Ten1 complex (GO:0070188)	single-stranded DNA binding (GO:0003697)			NS(1)|endometrium(6)|kidney(3)|large_intestine(6)|lung(8)|ovary(1)|skin(4)	29						CTCAAAAGAAAGCACAATAGG	0.498																																					p.L1157P		Atlas-SNP	.											.	CTC1	75	.	0			c.T3470C						.						233.0	237.0	235.0					17																	8131865		1955	4141	6096	SO:0001583	missense	80169	exon22			AAAGAAAGCACAA	AL831955	CCDS42259.1	17p13.1	2011-02-21	2011-02-21	2011-02-21	ENSG00000178971	ENSG00000178971			26169	protein-coding gene	gene with protein product	"""conserved telomere maintenance component 1"", ""alpha accessory factor 132"", ""conserved telomere capping protein 1"""	613129	"""tmp494178"", ""chromosome 17 open reading frame 68"""	C17orf68		19854130, 19854131	Standard	NM_025099		Approved	FLJ22170, AAF132	uc002gkq.4	Q2NKJ3		ENST00000315684.8:c.3470T>C	chr17.hg19:g.8131865A>G	ENSP00000313759:p.Leu1157Pro	122.0	0.0		95.0	4.0	NM_025099	B3KR66|C9JEX5|Q1PCD1|Q2TBE3|Q8N3S6|Q9H6L0	Missense_Mutation	SNP	ENST00000315684.8	hg19	CCDS42259.1	.	.	.	.	.	.	.	.	.	.	A	16.96	3.267293	0.59540	.	.	ENSG00000178971	ENST00000315684	D	0.88896	-2.44	5.56	5.56	0.83823	.	0.151994	0.42294	D	0.000721	D	0.93213	0.7838	M	0.69823	2.125	0.80722	D	1	D	0.89917	1.0	D	0.72075	0.976	D	0.93736	0.7046	10	0.87932	D	0	-16.3838	12.1138	0.53854	1.0:0.0:0.0:0.0	.	1157	Q2NKJ3	CTC1_HUMAN	P	1157	ENSP00000313759:L1157P	ENSP00000313759:L1157P	L	-	2	0	CTC1	8072590	0.998000	0.40836	1.000000	0.80357	0.973000	0.67179	4.985000	0.63845	2.133000	0.65898	0.533000	0.62120	CTT	.	.		0.498	CTC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000442012.1	NM_025099	
GAS7	8522	hgsc.bcm.edu	37	17	9843452	9843452	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr17:9843452T>C	ENST00000432992.2	-	8	957	c.797A>G	c.(796-798)cAg>cGg	p.Q266R	GAS7_ENST00000437099.2_Missense_Mutation_p.Q202R|GAS7_ENST00000580865.1_Missense_Mutation_p.Q126R|GAS7_ENST00000585266.1_Missense_Mutation_p.Q206R|GAS7_ENST00000542249.1_Missense_Mutation_p.Q202R|GAS7_ENST00000323816.4_Missense_Mutation_p.Q206R|GAS7_ENST00000540214.1_Intron|GAS7_ENST00000583882.1_Intron|GAS7_ENST00000396115.2_Intron|GAS7_ENST00000579158.1_Missense_Mutation_p.Q202R	NM_201433.1	NP_958839.1	O60861	GAS7_HUMAN	growth arrest-specific 7	266	FCH. {ECO:0000255|PROSITE- ProRule:PRU00083}.				actin filament bundle assembly (GO:0051017)|actin filament polymerization (GO:0030041)|cell cycle arrest (GO:0007050)|neuron projection morphogenesis (GO:0048812)|regulation of cell shape (GO:0008360)|regulation of transcription, DNA-templated (GO:0006355)	actin filament (GO:0005884)|cytoplasm (GO:0005737)|ruffle (GO:0001726)	sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(5)|large_intestine(7)|lung(18)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(2)	39						CCCTTCCTCCTGTGAAGCCAA	0.512			T	MLL	AML*																																p.Q266R		Atlas-SNP	.		Dom	yes		17	17p	8522	growth arrest-specific 7		L	.	GAS7	113	.	0			c.A797G						.						188.0	164.0	172.0					17																	9843452		2203	4300	6503	SO:0001583	missense	8522	exon8			TCCTCCTGTGAAG	AB007854	CCDS11152.1, CCDS42263.1, CCDS45611.1, CCDS58518.1	17p13.1	2004-02-18							4169	protein-coding gene	gene with protein product		603127				9736752	Standard	NM_001130831		Approved	KIAA0394, MGC1348	uc002gmg.1	O60861		ENST00000432992.2:c.797A>G	chr17.hg19:g.9843452T>C	ENSP00000407552:p.Gln266Arg	130.0	0.0		85.0	4.0	NM_201433	A8KAC2|B2RCK9|O43144|Q53Y77|Q7Z571	Missense_Mutation	SNP	ENST00000432992.2	hg19	CCDS11152.1	.	.	.	.	.	.	.	.	.	.	T	17.80	3.477493	0.63849	.	.	ENSG00000007237	ENST00000323816;ENST00000396115;ENST00000437099;ENST00000432992;ENST00000537970;ENST00000541114	T	0.16897	2.31	4.99	4.99	0.66335	Fps/Fes/Fer/CIP4 homology (3);	0.000000	0.64402	D	0.000001	T	0.17323	0.0416	M	0.64997	1.995	0.58432	D	0.999999	P;P;B;P	0.39535	0.483;0.677;0.076;0.483	B;B;B;B	0.33121	0.11;0.158;0.035;0.158	T	0.02821	-1.1106	9	.	.	.	4.219	12.5728	0.56347	0.0:0.0:0.0:1.0	.	218;206;126;266	B7Z2L1;A8KAC2;O60861-2;O60861	.;.;.;GAS7_HUMAN	R	266;206;205;126;206;80	ENSP00000379421:Q206R	.	Q	-	2	0	GAS7	9784177	1.000000	0.71417	0.998000	0.56505	0.965000	0.64279	7.122000	0.77169	2.223000	0.72356	0.533000	0.62120	CAG	.	.		0.512	GAS7-017	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000439883.1	NM_003644, NM_201432, NM_201433	
MYH3	4621	hgsc.bcm.edu	37	17	10532990	10532990	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr17:10532990G>A	ENST00000583535.1	-	40	5807	c.5720C>T	c.(5719-5721)gCc>gTc	p.A1907V	MYH3_ENST00000226209.7_Missense_Mutation_p.A1907V	NM_002470.3	NP_002461.2	P11055	MYH3_HUMAN	myosin, heavy chain 3, skeletal muscle, embryonic	1907					actin filament-based movement (GO:0030048)|ATP catabolic process (GO:0006200)|embryonic limb morphogenesis (GO:0030326)|face morphogenesis (GO:0060325)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|sarcomere organization (GO:0045214)|skeletal muscle contraction (GO:0003009)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)|sarcomere (GO:0030017)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|ATPase activity, coupled (GO:0042623)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(5)|large_intestine(18)|lung(30)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	83						ACGTTCCTCGGCCTCCTCCAG	0.547																																					p.A1907V		Atlas-SNP	.											.	MYH3	227	.	0			c.C5720T						.						84.0	75.0	78.0					17																	10532990		2203	4300	6503	SO:0001583	missense	4621	exon40			TCCTCGGCCTCCT		CCDS11157.1	17p13.1	2013-09-19	2006-09-29		ENSG00000109063	ENSG00000109063		"""Myosins / Myosin superfamily : Class II"""	7573	protein-coding gene	gene with protein product	"""myosin, skeletal, heavy chain, embryonic 1"", ""muscle embryonic myosin heavy chain 3"""	160720	"""myosin, heavy polypeptide 3, skeletal muscle, embryonic"""			2726495	Standard	NM_002470		Approved	MYHC-EMB, MYHSE1, HEMHC, SMHCE	uc002gmq.2	P11055	OTTHUMG00000130367	ENST00000583535.1:c.5720C>T	chr17.hg19:g.10532990G>A	ENSP00000464317:p.Ala1907Val	114.0	0.0		79.0	4.0	NM_002470	Q15492	Missense_Mutation	SNP	ENST00000583535.1	hg19	CCDS11157.1	.	.	.	.	.	.	.	.	.	.	G	34	5.336525	0.95758	.	.	ENSG00000109063	ENST00000226209	D	0.82984	-1.67	5.0	5.0	0.66597	Myosin tail (1);	.	.	.	.	D	0.93232	0.7844	M	0.94021	3.485	0.53688	D	0.999971	D	0.58970	0.984	D	0.67548	0.952	D	0.94010	0.7283	9	0.54805	T	0.06	.	18.8532	0.92241	0.0:0.0:1.0:0.0	.	1907	P11055	MYH3_HUMAN	V	1907	ENSP00000226209:A1907V	ENSP00000226209:A1907V	A	-	2	0	MYH3	10473715	1.000000	0.71417	0.978000	0.43139	0.916000	0.54674	9.657000	0.98554	2.769000	0.95229	0.655000	0.94253	GCC	.	.		0.547	MYH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252734.2	NM_002470	
ZNF287	57336	hgsc.bcm.edu	37	17	16456389	16456389	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr17:16456389A>G	ENST00000395824.1	-	6	1684	c.1067T>C	c.(1066-1068)aTt>aCt	p.I356T	ZNF287_ENST00000395825.3_Missense_Mutation_p.I356T			Q9HBT7	ZN287_HUMAN	zinc finger protein 287	349					positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cytokine biosynthetic process (GO:0042035)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(5)|prostate(1)|urinary_tract(1)	20				UCEC - Uterine corpus endometrioid carcinoma (92;0.083)		CCTATGTACAATACCATATGA	0.368																																					p.I356T		Atlas-SNP	.											.	ZNF287	60	.	0			c.T1067C						.						87.0	84.0	85.0					17																	16456389		2203	4300	6503	SO:0001583	missense	57336	exon6			TGTACAATACCAT	AF217227	CCDS11179.2	17p11.2	2013-01-09			ENSG00000141040	ENSG00000141040		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	13502	protein-coding gene	gene with protein product							Standard	NM_020653		Approved	ZKSCAN13, ZSCAN45	uc002gqi.2	Q9HBT7	OTTHUMG00000058993	ENST00000395824.1:c.1067T>C	chr17.hg19:g.16456389A>G	ENSP00000379168:p.Ile356Thr	102.0	0.0		86.0	4.0	NM_020653	Q6IAG1	Missense_Mutation	SNP	ENST00000395824.1	hg19	CCDS11179.2	.	.	.	.	.	.	.	.	.	.	A	0.005	-2.213909	0.00289	.	.	ENSG00000141040	ENST00000395825;ENST00000395824	T;T	0.14893	2.47;2.47	5.31	0.626	0.17670	.	0.936048	0.08977	N	0.866350	T	0.08626	0.0214	N	0.19112	0.55	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.42949	-0.9421	10	0.11485	T	0.65	.	4.23	0.10599	0.5157:0.0:0.3338:0.1505	.	349	Q9HBT7	ZN287_HUMAN	T	356	ENSP00000379169:I356T;ENSP00000379168:I356T	ENSP00000379168:I356T	I	-	2	0	ZNF287	16397114	0.000000	0.05858	0.054000	0.19295	0.004000	0.04260	0.902000	0.28459	0.177000	0.19895	-0.297000	0.09499	ATT	.	.		0.368	ZNF287-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000130504.1		
TRIM16L	147166	hgsc.bcm.edu	37	17	18638692	18638692	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr17:18638692G>T	ENST00000449552.2	+	7	2450	c.966G>T	c.(964-966)aaG>aaT	p.K322N	TRIM16L_ENST00000395671.4_Missense_Mutation_p.K322N|TRIM16L_ENST00000572555.1_Missense_Mutation_p.K322N|TRIM16L_ENST00000395672.2_Missense_Mutation_p.K322N|TRIM16L_ENST00000395902.3_Missense_Mutation_p.K376N|TRIM16L_ENST00000571708.1_Missense_Mutation_p.K322N|TRIM16L_ENST00000414850.2_3'UTR			Q309B1	TR16L_HUMAN	tripartite motif containing 16-like	322	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.					cytoplasm (GO:0005737)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(5)	9						GGCTTTCCAAGAAGGAAAACG	0.517																																					p.K322N		Atlas-SNP	.											.	TRIM16L	15	.	0			c.G966T						.						50.0	50.0	50.0					17																	18638692		2203	4300	6503	SO:0001583	missense	147166	exon5			TTCCAAGAAGGAA	DQ232882	CCDS32588.1	17p11.2	2011-02-10	2011-01-25		ENSG00000108448	ENSG00000108448			32670	protein-coding gene	gene with protein product			"""tripartite motif-containing 16-like"""				Standard	XM_005256479		Approved	TRIM70	uc002gui.1	Q309B1	OTTHUMG00000059050	ENST00000449552.2:c.966G>T	chr17.hg19:g.18638692G>T	ENSP00000461386:p.Lys322Asn	161.0	0.0		182.0	74.0	NM_001037330	A0PK10|B2RUW6|B4DQK2|B4DWQ8	Missense_Mutation	SNP	ENST00000449552.2	hg19	CCDS32588.1	.	.	.	.	.	.	.	.	.	.	g	12.62	1.991570	0.35131	.	.	ENSG00000108448	ENST00000395902;ENST00000395672;ENST00000395671	T;T;T	0.69175	-0.38;-0.38;-0.38	3.35	2.37	0.29283	Concanavalin A-like lectin/glucanase (1);SPla/RYanodine receptor subgroup (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);	0.135643	0.49305	U	0.000141	T	0.70842	0.3270	L	0.43554	1.36	0.40720	D	0.982651	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.999	T	0.66945	-0.5795	10	0.34782	T	0.22	-22.435	8.3174	0.32108	0.1242:0.0:0.8758:0.0	.	376;538;322	B4DE22;B3KMJ2;Q309B1	.;.;TR16L_HUMAN	N	376;322;322	ENSP00000379239:K376N;ENSP00000379031:K322N;ENSP00000379030:K322N	ENSP00000379030:K322N	K	+	3	2	TRIM16L	18579417	1.000000	0.71417	1.000000	0.80357	0.435000	0.31806	5.627000	0.67784	0.607000	0.29982	0.194000	0.17425	AAG	.	.		0.517	TRIM16L-012	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000130670.3	NM_001037330	
WSB1	26118	hgsc.bcm.edu	37	17	25630657	25630657	+	Nonsense_Mutation	SNP	T	T	A			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr17:25630657T>A	ENST00000262394.2	+	3	790	c.474T>A	c.(472-474)taT>taA	p.Y158*	WSB1_ENST00000579733.1_Intron|WSB1_ENST00000348811.2_Intron|WSB1_ENST00000427287.2_Nonsense_Mutation_p.Y127*|WSB1_ENST00000583193.1_Intron|WSB1_ENST00000581185.1_Nonsense_Mutation_p.Y158*	NM_015626.8	NP_056441.6	Q9Y6I7	WSB1_HUMAN	WD repeat and SOCS box containing 1	158					intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)	intracellular (GO:0005622)				lung(3)	3	all_cancers(1;2e-13)|all_epithelial(1;4.8e-15)|Lung NSC(42;0.00152)		BRCA - Breast invasive adenocarcinoma(3;0.0152)	UCEC - Uterine corpus endometrioid carcinoma (53;0.154)		GGGATGTATATACAGGTATGG	0.378																																					p.Y158X		Atlas-SNP	.											.	WSB1	29	.	0			c.T474A						.						126.0	133.0	130.0					17																	25630657		2203	4300	6503	SO:0001587	stop_gained	26118	exon3			TGTATATACAGGT	AF069313	CCDS11220.1, CCDS11221.1	17q11.2	2013-01-09	2011-01-25		ENSG00000109046	ENSG00000109046		"""WD repeat domain containing"""	19221	protein-coding gene	gene with protein product		610091	"""WD repeat and SOCS box-containing 1"""			10354473, 12076535	Standard	XR_243778		Approved	DKFZp564A122, DKFZp564B0482, SWIP1	uc002gzd.1	Q9Y6I7	OTTHUMG00000132293	ENST00000262394.2:c.474T>A	chr17.hg19:g.25630657T>A	ENSP00000262394:p.Tyr158*	115.0	0.0		90.0	34.0	NM_015626	Q9NRB1|Q9UBH9|Q9UG25|Q9UNN6|Q9Y656	Nonsense_Mutation	SNP	ENST00000262394.2	hg19	CCDS11220.1	.	.	.	.	.	.	.	.	.	.	T	38	6.910434	0.97928	.	.	ENSG00000109046	ENST00000262394;ENST00000427287	.	.	.	6.04	1.53	0.23141	.	0.000000	0.64402	D	0.000004	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.46703	T	0.11	-6.4536	9.3047	0.37867	0.0:0.4004:0.0:0.5996	.	.	.	.	X	158;127	.	ENSP00000262394:Y158X	Y	+	3	2	WSB1	22654784	0.999000	0.42202	1.000000	0.80357	0.968000	0.65278	0.611000	0.24268	0.547000	0.28938	-0.376000	0.06991	TAT	.	.		0.378	WSB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255391.4	NM_015626	
MYO1D	4642	hgsc.bcm.edu	37	17	31087321	31087321	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr17:31087321A>G	ENST00000318217.5	-	10	1587	c.1283T>C	c.(1282-1284)aTc>aCc	p.I428T	MYO1D_ENST00000583621.1_Missense_Mutation_p.I428T|MYO1D_ENST00000579584.1_Missense_Mutation_p.I428T|MYO1D_ENST00000394649.4_Missense_Mutation_p.I340T|MYO1D_ENST00000584232.1_5'UTR	NM_015194.1	NP_056009.1	O94832	MYO1D_HUMAN	myosin ID	428	Myosin motor.				early endosome to recycling endosome transport (GO:0061502)|negative regulation of phosphatase activity (GO:0010923)	axolemma (GO:0030673)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)|smooth endoplasmic reticulum (GO:0005790)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			breast(1)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(8)|lung(14)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	39			BRCA - Breast invasive adenocarcinoma(9;0.0362)			TTTCCAGGGGATCCCTTCCCG	0.363																																					p.I428T		Atlas-SNP	.											.	MYO1D	93	.	0			c.T1283C						.						189.0	184.0	185.0					17																	31087321		2203	4300	6503	SO:0001583	missense	4642	exon10			CAGGGGATCCCTT	AB018270	CCDS32615.1	17q11-q12	2014-06-12				ENSG00000176658		"""Myosins / Myosin superfamily : Class I"""	7598	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 108"""	606539				8884266	Standard	NM_015194		Approved	KIAA0727, myr4, PPP1R108	uc002hho.1	O94832		ENST00000318217.5:c.1283T>C	chr17.hg19:g.31087321A>G	ENSP00000324527:p.Ile428Thr	95.0	0.0		116.0	5.0	NM_015194	A6H8V3|Q8NHP9	Missense_Mutation	SNP	ENST00000318217.5	hg19	CCDS32615.1	.	.	.	.	.	.	.	.	.	.	A	20.3	3.963843	0.74131	.	.	ENSG00000176658	ENST00000318217	T	0.80393	-1.37	5.46	5.46	0.80206	Myosin head, motor domain (2);	0.000000	0.40064	U	0.001200	D	0.93752	0.8003	H	0.99042	4.41	0.80722	D	1	D;D	0.76494	0.999;0.997	D;D	0.75484	0.986;0.981	D	0.95834	0.8860	10	0.87932	D	0	.	13.7799	0.63077	1.0:0.0:0.0:0.0	.	339;428	Q7Z3N6;O94832	.;MYO1D_HUMAN	T	428	ENSP00000324527:I428T	ENSP00000324527:I428T	I	-	2	0	MYO1D	28111434	1.000000	0.71417	1.000000	0.80357	0.815000	0.46073	9.339000	0.96797	2.206000	0.71126	0.533000	0.62120	ATC	.	.		0.363	MYO1D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000447457.1		
KRT24	192666	hgsc.bcm.edu	37	17	38858135	38858135	+	Missense_Mutation	SNP	A	A	C	rs11309872	byFrequency	TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr17:38858135A>C	ENST00000264651.2	-	2	722	c.666T>G	c.(664-666)aaT>aaG	p.N222K		NM_019016.2	NP_061889.2	Q2M2I5	K1C24_HUMAN	keratin 24	222	Coil 1B.|Rod.					cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)	structural molecule activity (GO:0005198)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(12)|ovary(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29		Breast(137;0.00526)				CCAATCTGGCATTGTCAATGT	0.333																																					p.N222K	GBM(61;380 1051 14702 23642 31441)	Atlas-SNP	.											.,1	KRT24	60	.	0			c.T666G						.						70.0	54.0	60.0					17																	38858135		2078	3619	5697	SO:0001583	missense	192666	exon2			TCTGGCATTGTCA		CCDS11372.1	17q21.2	2013-06-25			ENSG00000167916	ENSG00000167916		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	18527	protein-coding gene	gene with protein product		607742				16831889	Standard	NM_019016		Approved	FLJ20261, MGC138169, MGC138173	uc002hvd.3	Q2M2I5	OTTHUMG00000133372	ENST00000264651.2:c.666T>G	chr17.hg19:g.38858135A>C	ENSP00000264651:p.Asn222Lys	291.0	0.0		341.0	14.0	NM_019016	Q9NXG7	Missense_Mutation	SNP	ENST00000264651.2	hg19	CCDS11372.1	.	.	.	.	.	.	.	.	.	.	A	19.92	3.917086	0.73098	.	.	ENSG00000167916	ENST00000264651	D	0.89050	-2.46	6.04	2.68	0.31781	Filament (1);	.	.	.	.	D	0.95472	0.8529	H	0.96048	3.76	0.43874	D	0.996486	D	0.89917	1.0	D	0.91635	0.999	D	0.94407	0.7628	9	0.87932	D	0	.	9.1141	0.36746	0.7194:0.0:0.2806:0.0	.	222	Q2M2I5	K1C24_HUMAN	K	222	ENSP00000264651:N222K	ENSP00000264651:N222K	N	-	3	2	KRT24	36111661	0.974000	0.33945	1.000000	0.80357	0.995000	0.86356	0.275000	0.18698	0.540000	0.28808	0.459000	0.35465	AAT	.	.		0.333	KRT24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257217.1	NM_019016	
KRTAP29-1	100533177	hgsc.bcm.edu	37	17	39458577	39458577	+	Missense_Mutation	SNP	C	C	G	rs144150438|rs368037290	byFrequency	TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr17:39458577C>G	ENST00000391353.1	-	1	526	c.527G>C	c.(526-528)tGt>tCt	p.C176S		NM_001257309.1	NP_001244238.1	A8MX34	KR291_HUMAN	keratin associated protein 29-1	176	7 X 5 AA repeats of C-C-X(3).					keratin filament (GO:0045095)											ACTAGCTGTACAGATGGTTGG	0.517																																					p.C176S		Atlas-SNP	.											.	KRTAP29-1	2	.	0			c.G527C						.																																			SO:0001583	missense	100533177	exon1			GCTGTACAGATGG		CCDS62183.1	17q21.2	2013-06-20			ENSG00000212658	ENSG00000212658		"""Keratin associated proteins"""	34211	protein-coding gene	gene with protein product							Standard	NM_001257309		Approved	KAP29.2	uc031rai.1	A8MX34	OTTHUMG00000133662	ENST00000391353.1:c.527G>C	chr17.hg19:g.39458577C>G	ENSP00000375148:p.Cys176Ser	37.0	0.0		43.0	5.0	NM_001257309		Missense_Mutation	SNP	ENST00000391353.1	hg19		.	.	.	.	.	.	.	.	.	.	C	13.93	2.383845	0.42308	.	.	ENSG00000212658	ENST00000391353	T	0.05025	3.51	5.26	5.26	0.73747	.	.	.	.	.	T	0.18341	0.0440	.	.	.	.	.	.	.	.	.	.	.	.	T	0.01448	-1.1352	5	0.51188	T	0.08	.	16.3691	0.83347	0.0:1.0:0.0:0.0	.	.	.	.	S	176	ENSP00000375148:C176S	ENSP00000375148:C176S	C	-	2	0	KRTAP29-1	36712103	0.930000	0.31532	0.613000	0.29037	0.062000	0.15995	2.411000	0.44600	2.454000	0.82982	0.455000	0.32223	TGT	.	.		0.517	KRTAP29-1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000257828.2		
GHDC	84514	hgsc.bcm.edu	37	17	40343211	40343211	+	Missense_Mutation	SNP	G	G	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr17:40343211G>C	ENST00000301671.8	-	5	1348	c.907C>G	c.(907-909)Cta>Gta	p.L303V	GHDC_ENST00000590520.1_5'Flank|GHDC_ENST00000428494.2_Missense_Mutation_p.L264V|GHDC_ENST00000587427.1_Missense_Mutation_p.L303V|GHDC_ENST00000414034.3_Missense_Mutation_p.L303V|GHDC_ENST00000436923.2_Missense_Mutation_p.L303V|GHDC_ENST00000593209.1_Missense_Mutation_p.L303V			Q8N2G8	GHDC_HUMAN	GH3 domain containing	303						endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|nucleus (GO:0005634)				central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	13		all_cancers(22;0.000229)|Breast(137;0.00104)|all_epithelial(22;0.00304)		BRCA - Breast invasive adenocarcinoma(366;0.124)		TCTGGCTGTAGGTTTAGGCCC	0.627																																					p.L303V		Atlas-SNP	.											.	GHDC	63	.	0			c.C907G						.						33.0	38.0	36.0					17																	40343211		2203	4300	6503	SO:0001583	missense	84514	exon6			GCTGTAGGTTTAG	AF316997, BC011056	CCDS11422.1, CCDS45682.1	17q21.2	2006-08-02				ENSG00000167925			24438	protein-coding gene	gene with protein product		608587				11161808, 11735219	Standard	NR_024573		Approved	LGP1	uc002hzf.4	Q8N2G8		ENST00000301671.8:c.907C>G	chr17.hg19:g.40343211G>C	ENSP00000301671:p.Leu303Val	71.0	0.0		72.0	34.0	NM_001142623	B4DQS4|E9PDB5|Q9BXM6	Missense_Mutation	SNP	ENST00000301671.8	hg19	CCDS11422.1	.	.	.	.	.	.	.	.	.	.	G	10.96	1.500047	0.26861	.	.	ENSG00000167925	ENST00000393854;ENST00000428494;ENST00000414034;ENST00000301671;ENST00000436923	.	.	.	4.03	2.04	0.26737	.	0.000000	0.64402	D	0.000017	T	0.66167	0.2762	M	0.69185	2.1	0.38752	D	0.954132	D;P;D	0.76494	0.994;0.754;0.999	D;P;D	0.87578	0.94;0.65;0.998	T	0.63328	-0.6662	9	0.30078	T	0.28	-8.7373	4.661	0.12643	0.1912:0.0:0.6372:0.1716	.	264;303;303	E9PDB5;Q8N2G8-2;Q8N2G8	.;.;GHDC_HUMAN	V	247;264;303;303;303	.	ENSP00000301671:L303V	L	-	1	2	GHDC	37596737	1.000000	0.71417	0.979000	0.43373	0.257000	0.26127	1.724000	0.38064	0.383000	0.24910	-0.219000	0.12488	CTA	.	.		0.627	GHDC-006	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000449794.1	NM_032484	
HOXB6	3216	hgsc.bcm.edu	37	17	46673963	46673963	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr17:46673963T>C	ENST00000484302.2	-	3	1109	c.487A>G	c.(487-489)Aag>Gag	p.K163E	HOXB-AS3_ENST00000474040.1_RNA|HOXB3_ENST00000552000.2_Intron|HOXB6_ENST00000225648.3_Missense_Mutation_p.K163E|HOXB-AS3_ENST00000476204.1_RNA|HOXB-AS3_ENST00000467155.2_RNA|HOXB-AS3_ENST00000474324.1_RNA|HOXB-AS3_ENST00000460041.1_RNA|HOXB5_ENST00000239151.5_5'Flank|HOXB-AS3_ENST00000481995.1_RNA|HOXB-AS3_ENST00000480872.1_RNA|HOXB-AS3_ENST00000465846.2_RNA|HOXB6_ENST00000490419.1_5'Flank|HOXB-AS3_ENST00000477144.1_RNA|HOXB-AS3_ENST00000487849.3_RNA|HOXB-AS3_ENST00000466037.2_RNA|HOXB-AS3_ENST00000429755.4_RNA|HOXB-AS3_ENST00000492897.3_RNA			P17509	HXB6_HUMAN	homeobox B6	163					anterior/posterior pattern specification (GO:0009952)|embryonic skeletal system morphogenesis (GO:0048704)|erythrocyte homeostasis (GO:0034101)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.K163E(1)		breast(1)|kidney(1)|large_intestine(1)|lung(4)	7						TGAAACTCCTTCTCCAGCTCC	0.612																																					p.K163E		Atlas-SNP	.											HOXB6,NS,carcinoma,0,1	HOXB6	13	.	1	Substitution - Missense(1)	breast(1)	c.A487G						.						121.0	110.0	114.0					17																	46673963		2203	4299	6502	SO:0001583	missense	3216	exon4			ACTCCTTCTCCAG		CCDS11531.1	17q21.32	2011-06-20	2005-12-22		ENSG00000108511	ENSG00000108511		"""Homeoboxes / ANTP class : HOXL subclass"""	5117	protein-coding gene	gene with protein product		142961	"""homeo box B6"""	HOX2, HOX2B		1973146, 1358459	Standard	XM_005257284		Approved		uc002ins.1	P17509	OTTHUMG00000159912	ENST00000484302.2:c.487A>G	chr17.hg19:g.46673963T>C	ENSP00000420009:p.Lys163Glu	73.0	0.0		85.0	4.0	NM_018952	A8K835|D3DTV5|P09068|Q9HB11|Q9UGH2	Missense_Mutation	SNP	ENST00000484302.2	hg19	CCDS11531.1	.	.	.	.	.	.	.	.	.	.	T	33	5.273866	0.95459	.	.	ENSG00000108511	ENST00000484302;ENST00000225648	D;D	0.96041	-3.89;-3.89	4.84	4.84	0.62591	Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);	0.000000	0.85682	D	0.000000	D	0.97074	0.9044	M	0.66939	2.045	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.97693	1.0180	10	0.87932	D	0	.	14.248	0.66001	0.0:0.0:0.0:1.0	.	163	P17509	HXB6_HUMAN	E	163	ENSP00000420009:K163E;ENSP00000225648:K163E	ENSP00000225648:K163E	K	-	1	0	HOXB6	44028962	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.785000	0.85724	2.037000	0.60232	0.460000	0.39030	AAG	.	.		0.612	HOXB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358146.2		
SEPT4	5414	hgsc.bcm.edu	37	17	56603141	56603141	+	Splice_Site	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr17:56603141T>C	ENST00000317268.3	-	4	629	c.453A>G	c.(451-453)ggA>ggG	p.G151G	SEPT4_ENST00000579371.1_Splice_Site_p.G52G|SEPT4_ENST00000580844.1_Splice_Site_p.G52G|RP11-112H10.4_ENST00000580769.1_RNA|SEPT4_ENST00000393086.1_Splice_Site_p.G132G|SEPT4_ENST00000580809.1_Splice_Site_p.G33G|SEPT4_ENST00000317256.6_Splice_Site_p.G132G|SEPT4_ENST00000580791.1_5'Flank|RP11-112H10.4_ENST00000578022.1_RNA|SEPT4_ENST00000426861.1_Splice_Site_p.G132G|RP11-112H10.4_ENST00000580589.1_RNA|SEPT4_ENST00000412945.3_Splice_Site_p.G143G|SEPT4_ENST00000583114.1_Splice_Site_p.G4G|SEPT4_ENST00000457347.2_Splice_Site_p.G166G	NM_004574.3	NP_004565.1	O43236	SEPT4_HUMAN	septin 4	151	Septin-type G.				apoptotic process (GO:0006915)|brain development (GO:0007420)|cell cycle (GO:0007049)|cell division (GO:0051301)|GTP catabolic process (GO:0006184)|positive regulation of apoptotic process (GO:0043065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of protein ubiquitination (GO:0031398)|regulation of apoptotic process (GO:0042981)|sperm capacitation (GO:0048240)|sperm mitochondrion organization (GO:0030382)	cytoskeleton (GO:0005856)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|sperm annulus (GO:0097227)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural molecule activity (GO:0005198)			NS(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(4)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	18	Medulloblastoma(34;0.127)|all_neural(34;0.237)					GGCCAGACTCTCCTGAGAGGA	0.493																																					p.G166G		Atlas-SNP	.											.	SEPT4	48	.	0			c.A498G						.						72.0	64.0	67.0					17																	56603141		2203	4300	6503	SO:0001630	splice_region_variant	5414	exon5			AGACTCTCCTGAG	AF073312	CCDS11609.1, CCDS11610.1, CCDS45743.1, CCDS56041.1, CCDS58581.1, CCDS58582.1	17q22	2013-01-21	2005-01-11	2005-01-12	ENSG00000108387	ENSG00000108387		"""Septins"""	9165	protein-coding gene	gene with protein product	"""bradeoin"", ""septin-M"""	603696	"""peanut-like 2 (Drosophila)"""	PNUTL2		9889007	Standard	NM_001198713		Approved	H5, CE5B3, hucep-7, ARTS, hCDCREL-2, MART	uc002iwm.2	O43236		ENST00000317268.3:c.452-1A>G	chr17.hg19:g.56603141T>C		80.0	0.0		58.0	4.0	NM_001256782	B2RD42|B3KSX9|B4DXC6|B4DXV5|Q6IAP3|Q9H315|Q9UM58	Silent	SNP	ENST00000317268.3	hg19	CCDS11610.1																																																																																			.	.		0.493	SEPT4-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000445420.1	NM_080417	Silent
TEX14	56155	hgsc.bcm.edu	37	17	56638968	56638968	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr17:56638968T>C	ENST00000240361.8	-	30	4293	c.4208A>G	c.(4207-4209)cAc>cGc	p.H1403R	TEX14_ENST00000349033.5_Missense_Mutation_p.H1357R|TEX14_ENST00000389934.3_Missense_Mutation_p.H1397R|TEX14_ENST00000584699.1_5'UTR			Q8IWB6	TEX14_HUMAN	testis expressed 14	1403					attachment of spindle microtubules to kinetochore (GO:0008608)|intercellular bridge organization (GO:0043063)|male meiosis (GO:0007140)|mitotic sister chromatid separation (GO:0051306)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of cytokinesis (GO:0032466)|negative regulation of protein binding (GO:0032091)	cell (GO:0005623)|cytoplasm (GO:0005737)|intercellular bridge (GO:0045171)|kinetochore (GO:0000776)|midbody (GO:0030496)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)			breast(6)|endometrium(5)|kidney(3)|large_intestine(22)|liver(1)|lung(24)|ovary(4)|pancreas(1)|prostate(1)|skin(5)|stomach(5)|upper_aerodigestive_tract(1)|urinary_tract(3)	81	Medulloblastoma(34;0.127)|all_neural(34;0.237)					CAGAGTAGAGTGAGCTCTGTT	0.483																																					p.H1403R		Atlas-SNP	.											.	TEX14	343	.	0			c.A4208G						.						116.0	111.0	113.0					17																	56638968		2203	4300	6503	SO:0001583	missense	56155	exon30			GTAGAGTGAGCTC	AF285601	CCDS32692.1, CCDS32693.1, CCDS56042.1	17q22	2013-09-20	2007-03-13		ENSG00000121101	ENSG00000121101			11737	protein-coding gene	gene with protein product	"""cancer/testis antigen 113"""	605792	"""testis expressed sequence 14"""			11279525, 12711554	Standard	NM_031272		Approved	CT113	uc010dcz.2	Q8IWB6	OTTHUMG00000179245	ENST00000240361.8:c.4208A>G	chr17.hg19:g.56638968T>C	ENSP00000240361:p.His1403Arg	114.0	0.0		109.0	5.0	NM_001201457	A6NH19|Q7RTP3|Q8ND97|Q9BXT9	Missense_Mutation	SNP	ENST00000240361.8	hg19	CCDS56042.1	.	.	.	.	.	.	.	.	.	.	T	18.39	3.612708	0.66672	.	.	ENSG00000121101	ENST00000240361;ENST00000389934;ENST00000349033	T;T;T	0.25085	1.82;1.82;1.82	5.09	5.09	0.68999	.	0.000000	0.64402	D	0.000012	T	0.46405	0.1391	M	0.63843	1.955	0.34185	D	0.671351	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.87578	0.996;0.998;0.998	T	0.61917	-0.6964	10	0.87932	D	0	-6.7257	11.1812	0.48629	0.0:0.0:0.0:1.0	.	1403;1357;1397	Q8IWB6;Q8IWB6-3;Q8IWB6-2	TEX14_HUMAN;.;.	R	1403;1397;1357	ENSP00000240361:H1403R;ENSP00000374584:H1397R;ENSP00000268910:H1357R	ENSP00000240361:H1403R	H	-	2	0	TEX14	53993967	1.000000	0.71417	0.994000	0.49952	0.979000	0.70002	3.662000	0.54510	2.143000	0.66587	0.533000	0.62120	CAC	.	.		0.483	TEX14-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000445446.1		
PSMD12	5718	hgsc.bcm.edu	37	17	65337110	65337110	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr17:65337110T>C	ENST00000356126.3	-	11	1327	c.1220A>G	c.(1219-1221)gAc>gGc	p.D407G	PSMD12_ENST00000357146.4_Missense_Mutation_p.D387G	NM_002816.3	NP_002807.1	O00232	PSD12_HUMAN	proteasome (prosome, macropain) 26S subunit, non-ATPase, 12	407	PCI.				anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)|proteasome regulatory particle (GO:0005838)				breast(1)|large_intestine(4)|lung(6)|pancreas(1)|urinary_tract(1)	13	all_cancers(12;2.38e-11)|all_epithelial(3;8.27e-13)					TGCTAATCTGTCTACTTTAGC	0.358																																					p.D407G		Atlas-SNP	.											.	PSMD12	32	.	0			c.A1220G						.						84.0	85.0	85.0					17																	65337110		2203	4300	6503	SO:0001583	missense	5718	exon11			AATCTGTCTACTT	AB003103	CCDS11669.1, CCDS11670.1	17q24.3	2008-05-22			ENSG00000197170	ENSG00000197170		"""Proteasome (prosome, macropain) subunits"""	9557	protein-coding gene	gene with protein product		604450				9426256	Standard	NM_002816		Approved	p55, Rpn5	uc002jfy.3	O00232	OTTHUMG00000140376	ENST00000356126.3:c.1220A>G	chr17.hg19:g.65337110T>C	ENSP00000348442:p.Asp407Gly	89.0	0.0		94.0	4.0	NM_002816	A6NP15|Q53HA2|Q6P053	Missense_Mutation	SNP	ENST00000356126.3	hg19	CCDS11669.1	.	.	.	.	.	.	.	.	.	.	T	23.4	4.406055	0.83230	.	.	ENSG00000197170	ENST00000356126;ENST00000357146	T;T	0.70164	-0.46;-0.46	4.81	4.81	0.61882	Winged helix-turn-helix transcription repressor DNA-binding (1);Proteasome component (PCI) domain (2);	0.047814	0.85682	N	0.000000	D	0.85639	0.5743	M	0.93763	3.455	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.81914	0.995;0.995	D	0.89589	0.3826	10	0.87932	D	0	-7.5001	14.3834	0.66926	0.0:0.0:0.0:1.0	.	387;407	A6NP15;O00232	.;PSD12_HUMAN	G	407;387	ENSP00000348442:D407G;ENSP00000349667:D387G	ENSP00000348442:D407G	D	-	2	0	PSMD12	62767572	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.644000	0.83416	1.808000	0.52836	0.397000	0.26171	GAC	.	.		0.358	PSMD12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000277103.1	NM_002816, NM_174871	
NUP85	79902	hgsc.bcm.edu	37	17	73214301	73214301	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr17:73214301T>C	ENST00000245544.4	+	7	568	c.497T>C	c.(496-498)cTc>cCc	p.L166P	NUP85_ENST00000447371.2_Intron|NUP85_ENST00000541827.1_Missense_Mutation_p.L120P|NUP85_ENST00000449421.2_3'UTR|NUP85_ENST00000579298.1_Missense_Mutation_p.L166P|NUP85_ENST00000579324.1_Missense_Mutation_p.L54P	NM_024844.3	NP_079120.1	Q9BW27	NUP85_HUMAN	nucleoporin 85kDa	166					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|lamellipodium assembly (GO:0030032)|macrophage chemotaxis (GO:0048246)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|kinetochore (GO:0000776)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear pore outer ring (GO:0031080)				endometrium(1)|kidney(1)|large_intestine(4)|lung(4)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	16	all_lung(278;0.14)|Lung NSC(278;0.168)		all cancers(21;3.45e-06)			CTCCTCCATCTCCTTGACTGG	0.527																																					p.L166P		Atlas-SNP	.											.	NUP85	44	.	0			c.T497C						.						138.0	117.0	124.0					17																	73214301		2203	4300	6503	SO:0001583	missense	79902	exon7			TCCATCTCCTTGA	AF514995	CCDS32730.1	17q25	2006-11-29	2005-11-03	2005-11-03		ENSG00000125450			8734	protein-coding gene	gene with protein product		170285				8124707	Standard	XM_005257690		Approved	NUP75, FLJ12549	uc002jng.1	Q9BW27		ENST00000245544.4:c.497T>C	chr17.hg19:g.73214301T>C	ENSP00000245544:p.Leu166Pro	115.0	0.0		110.0	6.0	NM_024844	B4DMQ3|B4DPW1|Q8NDI4|Q9H9U1	Missense_Mutation	SNP	ENST00000245544.4	hg19	CCDS32730.1	.	.	.	.	.	.	.	.	.	.	T	14.88	2.668512	0.47677	.	.	ENSG00000125450	ENST00000245544;ENST00000541827;ENST00000449421	.	.	.	5.85	5.85	0.93711	.	0.000000	0.85682	D	0.000000	D	0.84297	0.5441	M	0.86420	2.815	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	D	0.87120	0.2190	9	0.87932	D	0	-20.273	16.2343	0.82363	0.0:0.0:0.0:1.0	.	120;166	B4DMQ3;Q9BW27	.;NUP85_HUMAN	P	166;120;120	.	ENSP00000245544:L166P	L	+	2	0	NUP85	70725896	1.000000	0.71417	0.992000	0.48379	0.983000	0.72400	7.588000	0.82629	2.234000	0.73211	0.533000	0.62120	CTC	.	.		0.527	NUP85-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446619.1	NM_024844	
RNF157	114804	hgsc.bcm.edu	37	17	74169787	74169787	+	Missense_Mutation	SNP	C	C	T	rs144334591		TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr17:74169787C>T	ENST00000269391.6	-	3	424	c.292G>A	c.(292-294)Gtc>Atc	p.V98I	RNF157_ENST00000319945.6_Missense_Mutation_p.V98I	NM_052916.2	NP_443148.1	Q96PX1	RN157_HUMAN	ring finger protein 157	98							zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(1)|large_intestine(3)|lung(12)|ovary(2)|prostate(1)|skin(1)|stomach(2)|urinary_tract(1)	25			LUSC - Lung squamous cell carcinoma(166;0.187)			ACTTACTTGACGAGCCTCAGT	0.567																																					p.V98I	GBM(186;507 2120 27388 27773 52994)	Atlas-SNP	.											.	RNF157	66	.	0			c.G292A						.	C	ILE/VAL	2,4404	6.2+/-15.9	0,2,2201	46.0	40.0	42.0		292	5.3	0.9	17	dbSNP_134	42	0,8600		0,0,4300	no	missense	RNF157	NM_052916.2	29	0,2,6501	TT,TC,CC		0.0,0.0454,0.0154	probably-damaging	98/680	74169787	2,13004	2203	4300	6503	SO:0001583	missense	114804	exon3			ACTTGACGAGCCT	AK091467	CCDS32740.1	17q25.3	2004-02-27			ENSG00000141576	ENSG00000141576		"""RING-type (C3HC4) zinc fingers"""	29402	protein-coding gene	gene with protein product						11572484	Standard	NM_052916		Approved	KIAA1917	uc002jqz.3	Q96PX1	OTTHUMG00000132627	ENST00000269391.6:c.292G>A	chr17.hg19:g.74169787C>T	ENSP00000269391:p.Val98Ile	152.0	0.0		131.0	62.0	NM_052916	Q8NB72|Q96N56	Missense_Mutation	SNP	ENST00000269391.6	hg19	CCDS32740.1	.	.	.	.	.	.	.	.	.	.	C	32	5.129204	0.94473	4.54E-4	0.0	ENSG00000141576	ENST00000269391;ENST00000319945;ENST00000301610	T;T	0.33438	1.41;1.41	5.29	5.29	0.74685	.	0.000000	0.85682	D	0.000000	T	0.49915	0.1585	M	0.63169	1.94	0.80722	D	1	D;P	0.59767	0.986;0.873	P;P	0.58577	0.841;0.459	T	0.45702	-0.9243	10	0.45353	T	0.12	.	18.5089	0.90909	0.0:1.0:0.0:0.0	.	98;98	Q96PX1-2;Q96PX1	.;RN157_HUMAN	I	98;98;60	ENSP00000269391:V98I;ENSP00000321837:V98I	ENSP00000269391:V98I	V	-	1	0	RNF157	71681382	1.000000	0.71417	0.948000	0.38648	0.879000	0.50718	7.689000	0.84165	2.437000	0.82529	0.655000	0.94253	GTC	.	C|1.000;T|0.000		0.567	RNF157-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255874.2	XM_290732	
ST6GALNAC2	10610	hgsc.bcm.edu	37	17	74562230	74562230	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr17:74562230T>C	ENST00000225276.5	-	9	1400	c.1081A>G	c.(1081-1083)Agg>Ggg	p.R361G		NM_006456.2	NP_006447.2	Q9UJ37	SIA7B_HUMAN	ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 2	361					cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)	sialyltransferase activity (GO:0008373)			NS(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	11						TGCAGGTCCCTCCACAGGGCA	0.507																																					p.R361G		Atlas-SNP	.											.	ST6GALNAC2	29	.	0			c.A1081G						.						121.0	106.0	111.0					17																	74562230		2203	4300	6503	SO:0001583	missense	10610	exon9			GGTCCCTCCACAG	U14550	CCDS11747.1	17q25.1	2013-03-01	2003-12-05	2005-02-07	ENSG00000070731	ENSG00000070731	2.4.99.7	"""Sialyltransferases"""	10867	protein-coding gene	gene with protein product		610137	"""sialyltransferase 7 ((alpha-N-acetylneuraminyl-2,3-beta-galactosyl-1,3)-N-acetyl galactosaminide alpha-2,6-sialyltransferase)"", ""sialyltransferase-like 1"""	SIAT7, SIAT7B, SIATL1		11984005	Standard	NM_006456		Approved	ST6GalNAII, STHM	uc002jsg.4	Q9UJ37	OTTHUMG00000180301	ENST00000225276.5:c.1081A>G	chr17.hg19:g.74562230T>C	ENSP00000225276:p.Arg361Gly	94.0	0.0		86.0	4.0	NM_006456	Q12971	Missense_Mutation	SNP	ENST00000225276.5	hg19	CCDS11747.1	.	.	.	.	.	.	.	.	.	.	T	5.185	0.219605	0.09863	.	.	ENSG00000070731	ENST00000225276	T	0.30448	1.53	5.35	-4.58	0.03410	.	0.657770	0.15273	N	0.271114	T	0.18718	0.0449	L	0.45744	1.44	0.20638	N	0.999873	B	0.09022	0.002	B	0.14023	0.01	T	0.17868	-1.0355	10	0.27785	T	0.31	-0.4421	4.7423	0.13020	0.1036:0.1375:0.5154:0.2435	.	361	Q9UJ37	SIA7B_HUMAN	G	361	ENSP00000225276:R361G	ENSP00000225276:R361G	R	-	1	2	ST6GALNAC2	72073825	0.002000	0.14202	0.016000	0.15963	0.124000	0.20399	-0.154000	0.10130	-0.756000	0.04703	-0.313000	0.08912	AGG	.	.		0.507	ST6GALNAC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450650.1	NM_006456	
PTPRM	5797	hgsc.bcm.edu	37	18	8376068	8376068	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr18:8376068A>G	ENST00000332175.8	+	23	4194	c.3157A>G	c.(3157-3159)Atc>Gtc	p.I1053V	PTPRM_ENST00000580170.1_Missense_Mutation_p.I1066V|PTPRM_ENST00000400053.4_Missense_Mutation_p.I991V|PTPRM_ENST00000444013.1_Missense_Mutation_p.I840V|PTPRM_ENST00000400060.4_Missense_Mutation_p.I1067V	NM_002845.3	NP_002836.3	P28827	PTPRM_HUMAN	protein tyrosine phosphatase, receptor type, M	1053	Tyrosine-protein phosphatase 1. {ECO:0000255|PROSITE-ProRule:PRU00160}.				homophilic cell adhesion (GO:0007156)|negative regulation of angiogenesis (GO:0016525)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of endothelial cell proliferation (GO:0001937)|neuron projection development (GO:0031175)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of vasodilation (GO:0045909)|protein dephosphorylation (GO:0006470)|response to drug (GO:0042493)|retina layer formation (GO:0010842)|retinal ganglion cell axon guidance (GO:0031290)|signal transduction (GO:0007165)	cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|perinuclear region of cytoplasm (GO:0048471)	cadherin binding (GO:0045296)|identical protein binding (GO:0042802)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(3)|central_nervous_system(1)|cervix(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(32)|lung(25)|ovary(2)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	90		Colorectal(10;0.234)				AATCCGAGAGATCAGACAGTT	0.547																																					p.I1066V		Atlas-SNP	.											.	PTPRM	185	.	0			c.A3196G						.						92.0	91.0	91.0					18																	8376068		2203	4300	6503	SO:0001583	missense	5797	exon25			CGAGAGATCAGAC	X58288	CCDS11840.1, CCDS58613.1	18p11.2	2013-02-11			ENSG00000173482	ENSG00000173482		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	9675	protein-coding gene	gene with protein product		176888		PTPRL1		1655529, 8404049	Standard	NM_002845		Approved	RPTPU, hR-PTPu	uc010dkv.3	P28827	OTTHUMG00000131575	ENST00000332175.8:c.3157A>G	chr18.hg19:g.8376068A>G	ENSP00000331418:p.Ile1053Val	68.0	0.0		67.0	4.0	NM_001105244	A7MBN1|D3DUH8|J3QL11	Missense_Mutation	SNP	ENST00000332175.8	hg19	CCDS11840.1	.	.	.	.	.	.	.	.	.	.	A	11.71	1.720594	0.30503	.	.	ENSG00000173482	ENST00000332175;ENST00000400060;ENST00000400053;ENST00000444013	T;T;T;T	0.25749	1.78;1.78;1.78;1.78	6.04	6.04	0.98038	Protein-tyrosine phosphatase, receptor/non-receptor type (4);	0.096128	0.64402	D	0.000001	T	0.09113	0.0225	N	0.00894	-1.105	0.58432	D	0.999999	B;B;B	0.18166	0.026;0.004;0.004	B;B;B	0.20577	0.03;0.011;0.011	T	0.25012	-1.0144	10	0.02654	T	1	.	16.6349	0.85050	1.0:0.0:0.0:0.0	.	840;1066;1053	E7EVX9;A7MBN1;P28827	.;.;PTPRM_HUMAN	V	1053;1067;991;840	ENSP00000331418:I1053V;ENSP00000382933:I1067V;ENSP00000382927:I991V;ENSP00000387608:I840V	ENSP00000331418:I1053V	I	+	1	0	PTPRM	8366068	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.369000	0.73109	2.330000	0.79161	0.477000	0.44152	ATC	.	.		0.547	PTPRM-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000254456.1		
DSG4	147409	hgsc.bcm.edu	37	18	28972131	28972131	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr18:28972131T>C	ENST00000308128.4	+	8	968	c.833T>C	c.(832-834)aTt>aCt	p.I278T	RP11-534N16.1_ENST00000581856.1_RNA|DSG4_ENST00000359747.4_Missense_Mutation_p.I278T|RP11-534N16.1_ENST00000578477.1_RNA|RP11-534N16.1_ENST00000581452.1_RNA	NM_177986.3	NP_817123.1	Q86SJ6	DSG4_HUMAN	desmoglein 4	278	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.		Missing (in HYPT6). {ECO:0000269|PubMed:12705872, ECO:0000269|PubMed:15191570}.		anagen (GO:0042640)|BMP signaling pathway (GO:0030509)|homophilic cell adhesion (GO:0007156)|keratinocyte differentiation (GO:0030216)|single organismal cell-cell adhesion (GO:0016337)	desmosome (GO:0030057)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|central_nervous_system(6)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(11)|liver(2)|lung(35)|ovary(4)|skin(1)|stomach(1)|urinary_tract(1)	70			OV - Ovarian serous cystadenocarcinoma(10;0.00504)			TCAGCCAGTATTGAAGAGAAT	0.299																																					p.I278T		Atlas-SNP	.											.	DSG4	343	.	0			c.T833C						.						105.0	105.0	105.0					18																	28972131		2203	4300	6503	SO:0001583	missense	147409	exon8			CCAGTATTGAAGA	AY177664, AY168788	CCDS11897.1, CCDS45845.1	18q12.1	2010-01-26			ENSG00000175065	ENSG00000175065		"""Cadherins / Major cadherins"""	21307	protein-coding gene	gene with protein product		607892				12648213	Standard	NM_001134453		Approved	CDHF13, LAH	uc002kwq.2	Q86SJ6	OTTHUMG00000131979	ENST00000308128.4:c.833T>C	chr18.hg19:g.28972131T>C	ENSP00000311859:p.Ile278Thr	91.0	0.0		91.0	4.0	NM_001134453	A2RUI1|Q6Y9L9|Q8IXV4	Missense_Mutation	SNP	ENST00000308128.4	hg19	CCDS11897.1	.	.	.	.	.	.	.	.	.	.	T	21.9	4.218936	0.79464	.	.	ENSG00000175065	ENST00000308128;ENST00000359747	T;T	0.56776	0.44;0.44	5.66	5.66	0.87406	Cadherin (4);Cadherin-like (1);	0.000000	0.35207	N	0.003361	T	0.77916	0.4202	M	0.90082	3.085	0.44309	D	0.997188	D;D	0.76494	0.999;0.999	D;D	0.97110	1.0;0.995	T	0.82281	-0.0535	10	0.59425	D	0.04	.	16.1787	0.81885	0.0:0.0:0.0:1.0	.	278;278	Q86SJ6-2;Q86SJ6	.;DSG4_HUMAN	T	278	ENSP00000311859:I278T;ENSP00000352785:I278T	ENSP00000311859:I278T	I	+	2	0	DSG4	27226129	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.253000	0.78320	2.283000	0.76528	0.533000	0.62120	ATT	.	.		0.299	DSG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254941.1	NM_177986	
BCL2	596	hgsc.bcm.edu	37	18	60795978	60795978	+	Silent	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr18:60795978T>C	ENST00000398117.1	-	2	2061	c.600A>G	c.(598-600)gaA>gaG	p.E200E	BCL2_ENST00000590515.1_5'UTR|BCL2_ENST00000333681.4_Silent_p.E200E	NM_000633.2	NP_000624.2	P10415	BCL2_HUMAN	B-cell CLL/lymphoma 2	200					actin filament organization (GO:0007015)|apoptotic process (GO:0006915)|axon regeneration (GO:0031103)|axonogenesis (GO:0007409)|B cell homeostasis (GO:0001782)|B cell lineage commitment (GO:0002326)|B cell proliferation (GO:0042100)|B cell receptor signaling pathway (GO:0050853)|behavioral fear response (GO:0001662)|branching involved in ureteric bud morphogenesis (GO:0001658)|CD8-positive, alpha-beta T cell lineage commitment (GO:0043375)|cell aging (GO:0007569)|cell growth (GO:0016049)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to organic substance (GO:0071310)|cochlear nucleus development (GO:0021747)|defense response to virus (GO:0051607)|developmental growth (GO:0048589)|digestive tract morphogenesis (GO:0048546)|ear development (GO:0043583)|endoplasmic reticulum calcium ion homeostasis (GO:0032469)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|female pregnancy (GO:0007565)|focal adhesion assembly (GO:0048041)|gland morphogenesis (GO:0022612)|glomerulus development (GO:0032835)|hair follicle morphogenesis (GO:0031069)|homeostasis of number of cells within a tissue (GO:0048873)|humoral immune response (GO:0006959)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|lymphoid progenitor cell differentiation (GO:0002320)|male gonad development (GO:0008584)|melanin metabolic process (GO:0006582)|melanocyte differentiation (GO:0030318)|mesenchymal cell development (GO:0014031)|metanephros development (GO:0001656)|negative regulation of anoikis (GO:2000811)|negative regulation of apoptotic process (GO:0043066)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of autophagy (GO:0010507)|negative regulation of calcium ion transport into cytosol (GO:0010523)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of cellular pH reduction (GO:0032848)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|negative regulation of mitochondrial depolarization (GO:0051902)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of myeloid cell apoptotic process (GO:0033033)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of ossification (GO:0030279)|negative regulation of osteoblast proliferation (GO:0033689)|negative regulation of retinal cell programmed cell death (GO:0046671)|neuron apoptotic process (GO:0051402)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|oocyte development (GO:0048599)|organ growth (GO:0035265)|ossification (GO:0001503)|ovarian follicle development (GO:0001541)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|pigment granule organization (GO:0048753)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of catalytic activity (GO:0043085)|positive regulation of cell growth (GO:0030307)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of melanocyte differentiation (GO:0045636)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of neuron maturation (GO:0014042)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of skeletal muscle fiber development (GO:0048743)|positive regulation of smooth muscle cell migration (GO:0014911)|post-embryonic development (GO:0009791)|protein dephosphorylation (GO:0006470)|protein polyubiquitination (GO:0000209)|reactive oxygen species metabolic process (GO:0072593)|regulation of calcium ion transport (GO:0051924)|regulation of cell-matrix adhesion (GO:0001952)|regulation of glycoprotein biosynthetic process (GO:0010559)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane potential (GO:0051881)|regulation of nitrogen utilization (GO:0006808)|regulation of protein heterodimerization activity (GO:0043497)|regulation of protein homodimerization activity (GO:0043496)|regulation of protein stability (GO:0031647)|regulation of transmembrane transporter activity (GO:0022898)|regulation of viral genome replication (GO:0045069)|release of cytochrome c from mitochondria (GO:0001836)|renal system process (GO:0003014)|response to acid chemical (GO:0001101)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to gamma radiation (GO:0010332)|response to glucocorticoid (GO:0051384)|response to hydrogen peroxide (GO:0042542)|response to iron ion (GO:0010039)|response to ischemia (GO:0002931)|response to nicotine (GO:0035094)|response to radiation (GO:0009314)|response to toxic substance (GO:0009636)|response to UV-B (GO:0010224)|single organismal cell-cell adhesion (GO:0016337)|spleen development (GO:0048536)|T cell differentiation in thymus (GO:0033077)|T cell homeostasis (GO:0043029)|thymus development (GO:0048538)|transmembrane transport (GO:0055085)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|myelin sheath (GO:0043209)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|pore complex (GO:0046930)	BH3 domain binding (GO:0051434)|channel activity (GO:0015267)|channel inhibitor activity (GO:0016248)|identical protein binding (GO:0042802)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding (GO:0043565)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(106)|kidney(1)|large_intestine(1)|lung(3)	113		all_hematologic(56;1.18e-20)|Prostate(75;0.0872)		Lung(128;0.0234)|READ - Rectum adenocarcinoma(59;0.0935)	Docetaxel(DB01248)|Ibuprofen(DB01050)|Paclitaxel(DB01229)|Rasagiline(DB01367)	GGCCGTACAGTTCCACAAAGG	0.542			T	IGH@	"""NHL, CLL"""																																p.E200E		Atlas-SNP	.		Dom	yes		18	18q21.3	596	B-cell CLL/lymphoma 2		L	.	BCL2	272	.	0			c.A600G						.						39.0	35.0	36.0					18																	60795978		2203	4300	6503	SO:0001819	synonymous_variant	596	exon3			GTACAGTTCCACA	M14745	CCDS11981.1, CCDS45882.1	18q21.3	2014-03-07			ENSG00000171791	ENSG00000171791		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	990	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 50"""	151430					Standard	XM_006722523		Approved	Bcl-2, PPP1R50	uc002lit.1	P10415	OTTHUMG00000132791	ENST00000398117.1:c.600A>G	chr18.hg19:g.60795978T>C		132.0	0.0		119.0	42.0	NM_000633	C9JHD5|P10416|Q13842|Q16197	Silent	SNP	ENST00000398117.1	hg19	CCDS11981.1																																																																																			.	.		0.542	BCL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256199.1	NM_000633, NM_000657	
WDR18	57418	hgsc.bcm.edu	37	19	985884	985884	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr19:985884T>C	ENST00000251289.5	+	2	253	c.230T>C	c.(229-231)aTc>aCc	p.I77T	WDR18_ENST00000591997.1_3'UTR|WDR18_ENST00000587001.2_Missense_Mutation_p.I77T	NM_024100.3	NP_077005.2	Q9BV38	WDR18_HUMAN	WD repeat domain 18	77					multicellular organismal development (GO:0007275)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				endometrium(1)|kidney(2)|lung(2)|skin(2)	7		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CAGCAGAAGATCATGTGCCCC	0.602																																					p.I77T		Atlas-SNP	.											.	WDR18	20	.	0			c.T230C						.						128.0	102.0	111.0					19																	985884		2203	4300	6503	SO:0001583	missense	57418	exon2			AGAAGATCATGTG		CCDS12051.1	19p13.3	2013-01-09				ENSG00000065268		"""WD repeat domain containing"""	17956	protein-coding gene	gene with protein product	"""Involved in Processing ITS2 3 homolog (S. cerevisiae)"""					22190735	Standard	NM_024100		Approved	Ipi3	uc002lqm.1	Q9BV38		ENST00000251289.5:c.230T>C	chr19.hg19:g.985884T>C	ENSP00000251289:p.Ile77Thr	98.0	0.0		96.0	4.0	NM_024100	O60390|Q9BWR2	Missense_Mutation	SNP	ENST00000251289.5	hg19	CCDS12051.1	.	.	.	.	.	.	.	.	.	.	T	14.58	2.576465	0.45902	.	.	ENSG00000065268	ENST00000251289	T	0.16897	2.31	4.09	4.09	0.47781	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.166320	0.51477	D	0.000089	T	0.20210	0.0486	M	0.66939	2.045	0.47341	D	0.999393	P	0.39576	0.679	B	0.39840	0.311	T	0.03695	-1.1012	10	0.22706	T	0.39	.	12.4664	0.55762	0.0:0.0:0.0:1.0	.	77	Q9BV38	WDR18_HUMAN	T	77	ENSP00000251289:I77T	ENSP00000251289:I77T	I	+	2	0	WDR18	936884	1.000000	0.71417	1.000000	0.80357	0.731000	0.41821	7.008000	0.76341	1.732000	0.51606	0.529000	0.55759	ATC	.	.		0.602	WDR18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458225.2		
DAPK3	1613	hgsc.bcm.edu	37	19	3959236	3959236	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr19:3959236T>C	ENST00000545797.2	-	9	1471	c.1228A>G	c.(1228-1230)Aag>Gag	p.K410E	MIR637_ENST00000385000.1_RNA|DAPK3_ENST00000301264.3_Missense_Mutation_p.K410E			O43293	DAPK3_HUMAN	death-associated protein kinase 3	410					apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cellular response to interferon-gamma (GO:0071346)|chromatin modification (GO:0016568)|cytokinesis (GO:0000910)|intracellular signal transduction (GO:0035556)|negative regulation of translation (GO:0017148)|neuron differentiation (GO:0030182)|positive regulation of apoptotic process (GO:0043065)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of actin cytoskeleton reorganization (GO:2000249)|regulation of apoptotic process (GO:0042981)|regulation of autophagy (GO:0010506)|regulation of cell motility (GO:2000145)|regulation of focal adhesion assembly (GO:0051893)|regulation of mitosis (GO:0007088)|regulation of mitotic cell cycle (GO:0007346)|regulation of smooth muscle contraction (GO:0006940)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	chromosome, centromeric region (GO:0000775)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)|PML body (GO:0016605)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)|identical protein binding (GO:0042802)|leucine zipper domain binding (GO:0043522)|protein homodimerization activity (GO:0042803)|protein serine/threonine kinase activity (GO:0004674)|Rho GTPase binding (GO:0017048)			breast(2)|central_nervous_system(3)|cervix(1)|endometrium(3)|large_intestine(2)|lung(7)|ovary(1)|skin(2)	21		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00461)|STAD - Stomach adenocarcinoma(1328;0.18)		AAGCGGCGCTTGAGGCCGCTG	0.701																																					p.K410E		Atlas-SNP	.											.	DAPK3	56	.	0			c.A1228G						.						11.0	12.0	12.0					19																	3959236		2191	4274	6465	SO:0001583	missense	1613	exon8			GGCGCTTGAGGCC	AB007144	CCDS12116.1	19p13.3	2008-02-05				ENSG00000167657			2676	protein-coding gene	gene with protein product		603289				9488481	Standard	XM_005259508		Approved	ZIP, ZIPK	uc002lzc.1	O43293		ENST00000545797.2:c.1228A>G	chr19.hg19:g.3959236T>C	ENSP00000442973:p.Lys410Glu	13.0	0.0		64.0	4.0	NM_001348	A0AVN4|B3KQE2|Q05JY4	Missense_Mutation	SNP	ENST00000545797.2	hg19	CCDS12116.1	.	.	.	.	.	.	.	.	.	.	T	13.76	2.332791	0.41297	.	.	ENSG00000167657	ENST00000301264;ENST00000545797	T;T	0.68624	-0.34;-0.34	4.91	2.72	0.32119	.	0.059737	0.64402	D	0.000004	T	0.48786	0.1519	L	0.27053	0.805	0.35240	D	0.777718	B	0.32160	0.358	B	0.24006	0.05	T	0.51942	-0.8641	10	0.36615	T	0.2	.	11.9147	0.52759	0.0:0.0:0.4192:0.5808	.	410	O43293	DAPK3_HUMAN	E	410	ENSP00000301264:K410E;ENSP00000442973:K410E	ENSP00000301264:K410E	K	-	1	0	DAPK3	3910236	1.000000	0.71417	0.986000	0.45419	0.735000	0.41995	3.590000	0.53979	0.198000	0.20407	0.459000	0.35465	AAG	.	.		0.701	DAPK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457817.2	NM_001348	
GPR108	56927	hgsc.bcm.edu	37	19	6731272	6731272	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr19:6731272T>C	ENST00000264080.7	-	16	1398	c.1372A>G	c.(1372-1374)Acc>Gcc	p.T458A	GPR108_ENST00000598626.1_5'UTR|GPR108_ENST00000430424.4_Missense_Mutation_p.T216A	NM_001080452.1	NP_001073921.1	Q9NPR9	GP108_HUMAN	G protein-coupled receptor 108	458						integral component of membrane (GO:0016021)				breast(2)|cervix(1)|large_intestine(4)|lung(4)|skin(1)|urinary_tract(1)	13						ATGATGCGGGTGAAGTAGACG	0.682																																					p.T458A		Atlas-SNP	.											.	GPR108	35	.	0			c.A1372G						.						41.0	47.0	45.0					19																	6731272		2173	4260	6433	SO:0001583	missense	56927	exon16			TGCGGGTGAAGTA		CCDS42479.1	19p13.3	2014-01-30				ENSG00000125734		"""GPCR / Unclassified : 7TM orphan receptors"""	17829	protein-coding gene	gene with protein product							Standard	NM_001080452		Approved	LUSTR2	uc002mfp.3	Q9NPR9	OTTHUMG00000170129	ENST00000264080.7:c.1372A>G	chr19.hg19:g.6731272T>C	ENSP00000264080:p.Thr458Ala	95.0	0.0		134.0	6.0	NM_001080452	B9EJD7	Missense_Mutation	SNP	ENST00000264080.7	hg19	CCDS42479.1	.	.	.	.	.	.	.	.	.	.	T	15.13	2.741077	0.49151	.	.	ENSG00000125734	ENST00000548402;ENST00000264080;ENST00000430424	T	0.28666	1.6	3.9	3.9	0.45041	.	0.078892	0.48767	U	0.000180	T	0.54727	0.1876	M	0.89353	3.025	0.48040	D	0.999573	D	0.58620	0.983	P	0.59357	0.856	T	0.63028	-0.6728	10	0.72032	D	0.01	-19.1803	10.7038	0.45944	0.0:0.0:0.0:1.0	.	458	Q9NPR9	GP108_HUMAN	A	50;458;216	ENSP00000264080:T458A	ENSP00000264080:T458A	T	-	1	0	GPR108	6682272	1.000000	0.71417	0.831000	0.32960	0.005000	0.04900	4.395000	0.59678	1.429000	0.47314	0.254000	0.18369	ACC	.	.		0.682	GPR108-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407508.2		
MUC16	94025	hgsc.bcm.edu	37	19	9020072	9020072	+	Missense_Mutation	SNP	G	G	A	rs566860711		TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr19:9020072G>A	ENST00000397910.4	-	21	37626	c.37423C>T	c.(37423-37425)Cgg>Tgg	p.R12475W		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	12477	SEA 3. {ECO:0000255|PROSITE- ProRule:PRU00188}.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						CAGTACAGCCGCTCTCTGTTG	0.557																																					p.R12475W		Atlas-SNP	.											MUC16_ENST00000397910,NS,carcinoma,0,1	MUC16	4315	.	0			c.C37423T						.						179.0	157.0	164.0					19																	9020072		1949	4155	6104	SO:0001583	missense	94025	exon21			ACAGCCGCTCTCT	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.37423C>T	chr19.hg19:g.9020072G>A	ENSP00000381008:p.Arg12475Trp	220.0	0.0		247.0	90.0	NM_024690	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	hg19	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	.	11.31	1.602258	0.28534	.	.	ENSG00000181143	ENST00000397910	T	0.38240	1.15	3.32	-3.03	0.05429	.	.	.	.	.	T	0.33673	0.0871	L	0.43923	1.385	.	.	.	D	0.64830	0.994	P	0.51016	0.656	T	0.45600	-0.9250	8	0.87932	D	0	.	5.9414	0.19196	0.0:0.1762:0.2883:0.5355	.	12475	B5ME49	.	W	12475	ENSP00000381008:R12475W	ENSP00000381008:R12475W	R	-	1	2	MUC16	8881072	0.000000	0.05858	0.049000	0.19019	0.498000	0.33706	-1.965000	0.01511	-0.169000	0.10834	0.555000	0.69702	CGG	.	.		0.557	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
ZNF823	55552	hgsc.bcm.edu	37	19	11832694	11832694	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr19:11832694T>C	ENST00000341191.6	-	4	1808	c.1655A>G	c.(1654-1656)gAg>gGg	p.E552G	ZNF823_ENST00000545749.1_Missense_Mutation_p.E370G	NM_001080493.2	NP_001073962.1	P16415	ZN823_HUMAN	zinc finger protein 823	552					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(4)|kidney(1)|large_intestine(3)|lung(10)|ovary(2)|prostate(1)|upper_aerodigestive_tract(4)	26						ATAGGGTTTCTCTCCAGTGTG	0.428										HNSCC(68;0.2)																											p.E552G		Atlas-SNP	.											.	ZNF823	104	.	0			c.A1655G						.						78.0	80.0	79.0					19																	11832694		2203	4300	6503	SO:0001583	missense	55552	exon4			GGTTTCTCTCCAG	X51760	CCDS45981.1	19p13.2	2013-01-08			ENSG00000197933	ENSG00000197933		"""Zinc fingers, C2H2-type"", ""-"""	30936	protein-coding gene	gene with protein product	"""ZFP 36 for a zinc finger protein"""						Standard	XM_006722789		Approved	HSZFP36	uc002msm.2	P16415	OTTHUMG00000156528	ENST00000341191.6:c.1655A>G	chr19.hg19:g.11832694T>C	ENSP00000340683:p.Glu552Gly	98.0	0.0		95.0	4.0	NM_001080493	A0PJL4|B7Z8D4|Q6P4A9	Missense_Mutation	SNP	ENST00000341191.6	hg19	CCDS45981.1	.	.	.	.	.	.	.	.	.	.	-	14.24	2.476478	0.44044	.	.	ENSG00000197933	ENST00000545749;ENST00000341191	T;T	0.27557	1.66;1.66	0.856	0.856	0.19019	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.30854	0.0778	M	0.70903	2.155	0.27682	N	0.946391	B	0.14438	0.01	B	0.11329	0.006	T	0.35076	-0.9803	9	0.72032	D	0.01	.	7.2396	0.26090	0.0:0.0:0.0:1.0	.	552	P16415	ZN823_HUMAN	G	370;552	ENSP00000440162:E370G;ENSP00000340683:E552G	ENSP00000340683:E552G	E	-	2	0	ZNF823	11693694	0.627000	0.27129	0.050000	0.19076	0.472000	0.32918	2.551000	0.45820	0.630000	0.30394	0.254000	0.18369	GAG	.	.		0.428	ZNF823-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344516.2	NM_001080493	
ZNF700	90592	hgsc.bcm.edu	37	19	12059745	12059745	+	Silent	SNP	A	A	G			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr19:12059745A>G	ENST00000254321.5	+	4	1049	c.906A>G	c.(904-906)ggA>ggG	p.G302G	CTD-2006C1.12_ENST00000586394.1_RNA|ZNF700_ENST00000482090.1_Silent_p.G284G|ZNF763_ENST00000591944.1_Intron|ZNF763_ENST00000590798.1_Intron|ZNF763_ENST00000538752.1_Intron	NM_001271848.1|NM_144566.1	NP_001258777.1|NP_653167.1	Q9H0M5	ZN700_HUMAN	zinc finger protein 700	302					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)		ZNF700/MAST1_ENST00000251472(2)	breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(9)|lung(13)|pancreas(1)|prostate(1)|urinary_tract(1)	33						GTCACATGGGAGAGAAGCCTT	0.393																																					p.G305G		Atlas-SNP	.											.	ZNF700	81	.	0			c.A915G						.						55.0	54.0	55.0					19																	12059745		2203	4300	6503	SO:0001819	synonymous_variant	90592	exon4			CATGGGAGAGAAG	AL136732	CCDS32915.1, CCDS74289.1	19p13.2	2013-01-08			ENSG00000196757	ENSG00000196757		"""Zinc fingers, C2H2-type"", ""-"""	25292	protein-coding gene	gene with protein product							Standard	NM_144566		Approved	DKFZp434I1610	uc031rjk.1	Q9H0M5	OTTHUMG00000156421	ENST00000254321.5:c.906A>G	chr19.hg19:g.12059745A>G		63.0	0.0		94.0	4.0	NM_001271848	B9EGU4	Silent	SNP	ENST00000254321.5	hg19	CCDS32915.1																																																																																			.	.		0.393	ZNF700-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344126.2	NM_144566	
RAD23A	5886	hgsc.bcm.edu	37	19	13059162	13059162	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr19:13059162T>C	ENST00000586534.1	+	3	467	c.406T>C	c.(406-408)Tct>Cct	p.S136P	RAD23A_ENST00000316856.3_Missense_Mutation_p.S136P|RAD23A_ENST00000541222.1_5'UTR|RAD23A_ENST00000592268.1_Missense_Mutation_p.S136P|RAD23A_ENST00000588826.2_3'UTR			P54725	RD23A_HUMAN	RAD23 homolog A (S. cerevisiae)	136					nucleotide-excision repair (GO:0006289)|positive regulation of viral genome replication (GO:0045070)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032434)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|proteasome complex (GO:0000502)	damaged DNA binding (GO:0003684)|polyubiquitin binding (GO:0031593)|single-stranded DNA binding (GO:0003697)|ubiquitin-specific protease binding (GO:1990381)			central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(2)|ovary(2)|prostate(1)|skin(1)	12						GTCCCCAGAGTCTGTGTCAGG	0.652								Nucleotide excision repair (NER)																													p.S136P		Atlas-SNP	.											.	RAD23A	29	.	0			c.T406C						.						37.0	43.0	40.0					19																	13059162		2203	4300	6503	SO:0001583	missense	5886	exon3			CCAGAGTCTGTGT		CCDS12289.1, CCDS59357.1, CCDS59358.1	19p13.2	2008-07-17	2001-11-28			ENSG00000179262			9812	protein-coding gene	gene with protein product	"""RAD23, yeast homolog, A"""	600061	"""RAD23 (S. cerevisiae) homolog A"""			7851894	Standard	NM_005053		Approved	HHR23A, MGC111083	uc002mvw.2	P54725		ENST00000586534.1:c.406T>C	chr19.hg19:g.13059162T>C	ENSP00000467024:p.Ser136Pro	79.0	0.0		76.0	4.0	NM_005053	K7ESE3|Q59EU8|Q5M7Z1	Missense_Mutation	SNP	ENST00000586534.1	hg19	CCDS12289.1	.	.	.	.	.	.	.	.	.	.	T	10.72	1.430046	0.25726	.	.	ENSG00000179262	ENST00000316856	T	0.18174	2.23	4.68	2.46	0.29980	.	0.692989	0.14559	N	0.312194	T	0.06325	0.0163	N	0.08118	0	0.80722	D	1	B;B;B	0.27765	0.062;0.001;0.188	B;B;B	0.22152	0.023;0.002;0.038	T	0.29731	-1.0002	10	0.14656	T	0.56	-29.7701	4.2873	0.10862	0.1877:0.0:0.2256:0.5867	.	136;153;136	A8K1J3;Q59EU8;P54725	.;.;RD23A_HUMAN	P	136	ENSP00000321365:S136P	ENSP00000321365:S136P	S	+	1	0	RAD23A	12920162	0.999000	0.42202	0.980000	0.43619	0.969000	0.65631	1.174000	0.31932	1.753000	0.51906	0.528000	0.53228	TCT	.	.		0.652	RAD23A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000452752.1	NM_005053	
DCAF15	90379	hgsc.bcm.edu	37	19	14070706	14070706	+	Splice_Site	SNP	A	A	G	rs3217681|rs141180609|rs373011773	byFrequency	TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr19:14070706A>G	ENST00000254337.6	+	9	1460	c.1439A>G	c.(1438-1440)gAg>gGg	p.E480G		NM_138353.2	NP_612362.2	Q66K64	DCA15_HUMAN	DDB1 and CUL4 associated factor 15	480					protein ubiquitination (GO:0016567)					breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(5)|ovary(1)|pancreas(1)	11						GTCATTCTGGAGGTGGGCCCA	0.592											OREG0025301	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.E480G		Atlas-SNP	.											.	DCAF15	30	.	0			c.A1439G						.						63.0	60.0	61.0					19																	14070706		2203	4300	6503	SO:0001630	splice_region_variant	90379	exon9			TTCTGGAGGTGGG	BC002926	CCDS32926.1	19p13.12	2009-07-17	2009-07-17	2009-07-17	ENSG00000132017	ENSG00000132017		"""DDB1 and CUL4 associated factors"""	25095	protein-coding gene	gene with protein product			"""chromosome 19 open reading frame 72"""	C19orf72			Standard	NM_138353		Approved	MGC99481	uc002mxt.3	Q66K64		ENST00000254337.6:c.1440+1A>G	chr19.hg19:g.14070706A>G		113.0	0.0	692	104.0	6.0	NM_138353	B3KS86|Q96DW0|Q9BU31	Missense_Mutation	SNP	ENST00000254337.6	hg19	CCDS32926.1	.	.	.	.	.	.	.	.	.	.	a	18.18	3.566035	0.65651	.	.	ENSG00000132017	ENST00000254337	.	.	.	4.49	4.49	0.54785	.	0.000000	0.85682	D	0.000000	T	0.47967	0.1474	L	0.32530	0.975	0.58432	D	0.999999	P	0.49783	0.928	P	0.46758	0.526	T	0.53732	-0.8397	9	0.87932	D	0	-22.7842	12.778	0.57459	1.0:0.0:0.0:0.0	.	480	Q66K64	DCA15_HUMAN	G	480	.	ENSP00000254337:E480G	E	+	2	0	DCAF15	13931706	1.000000	0.71417	0.999000	0.59377	0.435000	0.31806	8.035000	0.88872	1.677000	0.50941	0.448000	0.29417	GAG	.	.		0.592	DCAF15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458099.1	NM_138353	Missense_Mutation
AKAP8	10270	hgsc.bcm.edu	37	19	15484733	15484733	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr19:15484733A>G	ENST00000269701.2	-	4	295	c.235T>C	c.(235-237)Tct>Cct	p.S79P		NM_005858.3	NP_005849.1	O43823	AKAP8_HUMAN	A kinase (PRKA) anchor protein 8	79					mitotic chromosome condensation (GO:0007076)|mitotic nuclear division (GO:0007067)|signal transduction (GO:0007165)	condensed chromosome (GO:0000793)|female pronucleus (GO:0001939)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(1)|large_intestine(5)|lung(6)|ovary(2)	26						GGGCCGTAAGAGGCCATGTGC	0.647																																					p.S79P	GBM(190;1671 2163 3274 27186 30476)	Atlas-SNP	.											.	AKAP8	68	.	0			c.T235C						.						46.0	45.0	46.0					19																	15484733		2203	4300	6503	SO:0001583	missense	10270	exon4			CGTAAGAGGCCAT	Y11997	CCDS12329.1	19p13.12	2012-05-16			ENSG00000105127	ENSG00000105127		"""A-kinase anchor proteins"""	378	protein-coding gene	gene with protein product	"""A-kinase anchor protein, 95kDa"""	604692				9473338	Standard	NM_005858		Approved	AKAP95, DKFZp586B1222	uc002nav.3	O43823		ENST00000269701.2:c.235T>C	chr19.hg19:g.15484733A>G	ENSP00000269701:p.Ser79Pro	104.0	0.0		97.0	5.0	NM_005858		Missense_Mutation	SNP	ENST00000269701.2	hg19	CCDS12329.1	.	.	.	.	.	.	.	.	.	.	A	12.18	1.860126	0.32884	.	.	ENSG00000105127	ENST00000269701	T	0.51071	0.72	5.07	1.29	0.21616	.	0.255751	0.28371	N	0.015591	T	0.47021	0.1423	L	0.56769	1.78	0.20703	N	0.999866	D	0.60575	0.988	P	0.53313	0.723	T	0.30387	-0.9980	10	0.35671	T	0.21	-20.7731	4.1839	0.10388	0.4484:0.0:0.0968:0.4548	.	79	O43823	AKAP8_HUMAN	P	79	ENSP00000269701:S79P	ENSP00000269701:S79P	S	-	1	0	AKAP8	15345733	0.938000	0.31826	0.169000	0.22859	0.045000	0.14185	1.071000	0.30666	0.340000	0.23745	-1.182000	0.01712	TCT	.	.		0.647	AKAP8-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461293.3	NM_005858	
EPS15L1	58513	hgsc.bcm.edu	37	19	16513229	16513229	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr19:16513229T>C	ENST00000248070.6	-	16	1833	c.1694A>G	c.(1693-1695)gAc>gGc	p.D565G	EPS15L1_ENST00000597937.1_Missense_Mutation_p.D565G|EPS15L1_ENST00000594975.1_Missense_Mutation_p.D565G|EPS15L1_ENST00000455140.2_Missense_Mutation_p.D565G|EPS15L1_ENST00000602009.1_Missense_Mutation_p.D411G|EPS15L1_ENST00000535753.2_Missense_Mutation_p.D565G	NM_021235.2	NP_067058.1	Q9UBC2	EP15R_HUMAN	epidermal growth factor receptor pathway substrate 15-like 1	565					endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)	clathrin coat of coated pit (GO:0030132)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(3)|lung(12)|ovary(4)|skin(2)	30						GAGCACCTGGTCATACTGCTC	0.587																																					p.D565G		Atlas-SNP	.											.	EPS15L1	81	.	0			c.A1694G						.						73.0	70.0	71.0					19																	16513229		2203	4300	6503	SO:0001583	missense	58513	exon16			ACCTGGTCATACT	AF110265	CCDS32944.1, CCDS58653.1, CCDS58654.1, CCDS59363.1	19p13.12	2013-01-10				ENSG00000127527		"""EF-hand domain containing"""	24634	protein-coding gene	gene with protein product							Standard	NM_001258374		Approved	eps15R	uc002ndx.4	Q9UBC2		ENST00000248070.6:c.1694A>G	chr19.hg19:g.16513229T>C	ENSP00000248070:p.Asp565Gly	84.0	0.0		100.0	4.0	NM_021235	A2RRF3|A5PL29|B4DKA3	Missense_Mutation	SNP	ENST00000248070.6	hg19	CCDS32944.1	.	.	.	.	.	.	.	.	.	.	T	12.03	1.814992	0.32053	.	.	ENSG00000127527	ENST00000455140;ENST00000248070;ENST00000535753	T;T;T	0.32753	1.98;1.9;1.44	5.5	4.46	0.54185	.	0.332800	0.34200	N	0.004179	T	0.17365	0.0417	N	0.14661	0.345	0.34217	D	0.675011	B;B;B;B;B;B	0.25441	0.031;0.008;0.126;0.036;0.017;0.071	B;B;B;B;B;B	0.26969	0.05;0.011;0.034;0.009;0.034;0.075	T	0.18272	-1.0342	10	0.33940	T	0.23	.	7.9339	0.29918	0.0:0.1007:0.0:0.8993	.	565;565;564;565;565;565	A8K5P4;A5PL29;A5PKY0;A2RRF3;Q9UBC2;G3V0H2	.;.;.;.;EP15R_HUMAN;.	G	565	ENSP00000393313:D565G;ENSP00000248070:D565G;ENSP00000440103:D565G	ENSP00000248070:D565G	D	-	2	0	EPS15L1	16374229	0.999000	0.42202	0.061000	0.19648	0.485000	0.33311	2.584000	0.46102	0.917000	0.36895	0.533000	0.62120	GAC	.	.		0.587	EPS15L1-006	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000461040.1	NM_021235	
KCNN1	3780	hgsc.bcm.edu	37	19	18108964	18108964	+	Nonsense_Mutation	SNP	C	C	T			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr19:18108964C>T	ENST00000222249.9	+	11	1700	c.1381C>T	c.(1381-1383)Cag>Tag	p.Q461*	ARRDC2_ENST00000379656.3_5'Flank	NM_002248.3	NP_002239.2	Q92952	KCNN1_HUMAN	potassium intermediate/small conductance calcium-activated channel, subfamily N, member 1	461	Calmodulin-binding. {ECO:0000250}.				potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	calcium-activated potassium channel activity (GO:0015269)|calmodulin binding (GO:0005516)|small conductance calcium-activated potassium channel activity (GO:0016286)			endometrium(1)|kidney(1)|lung(5)|urinary_tract(1)	8					Miconazole(DB01110)|Procaine(DB00721)	CCCGCAGACCCAGACCGTCAT	0.637																																					p.Q461X		Atlas-SNP	.											.	KCNN1	74	.	0			c.C1381T						.						14.0	17.0	16.0					19																	18108964		2170	4269	6439	SO:0001587	stop_gained	3780	exon11			CAGACCCAGACCG	U69883	CCDS67611.1	19p13.1	2012-07-05				ENSG00000105642		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	6290	protein-coding gene	gene with protein product		602982				8781233, 10516439, 16382103	Standard	NM_002248		Approved	KCa2.1, hSK1	uc002nht.3	Q92952		ENST00000222249.9:c.1381C>T	chr19.hg19:g.18108964C>T	ENSP00000476519:p.Gln461*	73.0	0.0		59.0	4.0	NM_002248	Q5KR10|Q6DJU4	Nonsense_Mutation	SNP	ENST00000222249.9	hg19		.	.	.	.	.	.	.	.	.	.	C	36	5.662760	0.96734	.	.	ENSG00000105642	ENST00000222249	.	.	.	4.18	4.18	0.49190	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	-22.2419	14.0513	0.64739	0.0:1.0:0.0:0.0	.	.	.	.	X	478	.	ENSP00000222249:Q478X	Q	+	1	0	KCNN1	17969964	1.000000	0.71417	0.988000	0.46212	0.036000	0.12997	6.975000	0.76128	1.890000	0.54733	0.306000	0.20318	CAG	.	.		0.637	KCNN1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000471896.2	NM_002248	
ZNF714	148206	hgsc.bcm.edu	37	19	21299779	21299779	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr19:21299779A>T	ENST00000596143.1	+	5	634	c.309A>T	c.(307-309)gaA>gaT	p.E103D	ZNF714_ENST00000601416.1_3'UTR|ZNF714_ENST00000596053.1_Intron|ZNF714_ENST00000291770.7_3'UTR	NM_182515.3	NP_872321	Q96N38	ZN714_HUMAN	zinc finger protein 714	103					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(2)|kidney(3)|lung(11)|urinary_tract(2)	18						AAGGTTATGAACTAAACCAGT	0.323																																					p.E103D		Atlas-SNP	.											.	ZNF714	121	.	0			c.A309T						.																																			SO:0001583	missense	148206	exon5			TTATGAACTAAAC	AK056006	CCDS54239.1	19p12	2013-01-08				ENSG00000160352		"""Zinc fingers, C2H2-type"""	27124	protein-coding gene	gene with protein product						12477932	Standard	NM_182515		Approved		uc002npo.4	Q96N38		ENST00000596143.1:c.309A>T	chr19.hg19:g.21299779A>T	ENSP00000472368:p.Glu103Asp	112.0	0.0		106.0	7.0	NM_182515	Q49AI1|Q86W65|Q8ND40	Missense_Mutation	SNP	ENST00000596143.1	hg19	CCDS54239.1	.	.	.	.	.	.	.	.	.	.	.	7.284	0.609628	0.14066	.	.	ENSG00000160352	ENST00000343332;ENST00000291770	.	.	.	0.394	-0.788	0.10939	.	.	.	.	.	T	0.22898	0.0553	L	0.46157	1.445	0.09310	N	1	P;B	0.41848	0.763;0.39	B;B	0.32805	0.153;0.142	T	0.11108	-1.0601	7	0.72032	D	0.01	.	.	.	.	.	104;103	Q96N38-2;A6NEM4	.;.	D	103	.	ENSP00000291770:E103D	E	+	3	2	ZNF714	21091619	0.002000	0.14202	0.001000	0.08648	0.001000	0.01503	0.660000	0.25009	-0.649000	0.05430	-0.714000	0.03626	GAA	.	.		0.323	ZNF714-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463930.1	NM_182515	
GRAMD1A	57655	hgsc.bcm.edu	37	19	35504479	35504479	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr19:35504479A>G	ENST00000317991.5	+	9	946	c.754A>G	c.(754-756)Agc>Ggc	p.S252G	GRAMD1A_ENST00000599564.1_Missense_Mutation_p.S339G|GRAMD1A_ENST00000411896.2_Missense_Mutation_p.S245G|CTD-2527I21.14_ENST00000605640.1_RNA|GRAMD1A_ENST00000504615.2_Missense_Mutation_p.S18G	NM_020895.3	NP_065946.2	Q96CP6	GRM1A_HUMAN	GRAM domain containing 1A	252						integral component of membrane (GO:0016021)				NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(10)|prostate(1)|upper_aerodigestive_tract(1)	19	all_lung(56;2.66e-08)|Lung NSC(56;4.13e-08)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0849)			GATCGCCCTGAGCGACATCAC	0.642																																					p.S252G		Atlas-SNP	.											.	GRAMD1A	39	.	0			c.A754G						.						25.0	28.0	27.0					19																	35504479		2090	4214	6304	SO:0001583	missense	57655	exon9			GCCCTGAGCGACA	AK074864	CCDS42546.1, CCDS46046.1	19q13.13	2008-02-05	2005-11-02	2005-11-02		ENSG00000089351			29305	protein-coding gene	gene with protein product			"""KIAA1533"""	KIAA1533		10819331	Standard	NM_020895		Approved	FLJ90346	uc010xse.1	Q96CP6		ENST00000317991.5:c.754A>G	chr19.hg19:g.35504479A>G	ENSP00000441032:p.Ser252Gly	91.0	0.0		90.0	4.0	NM_020895	A6NKY7|Q8NC77|Q9P1Z5	Missense_Mutation	SNP	ENST00000317991.5	hg19	CCDS42546.1	.	.	.	.	.	.	.	.	.	.	A	16.14	3.039533	0.55003	.	.	ENSG00000089351	ENST00000453966;ENST00000504615;ENST00000317991;ENST00000411896	T;T;T	0.48522	0.81;1.84;1.85	4.71	4.71	0.59529	.	1.745710	0.02419	N	0.082418	T	0.44664	0.1304	L	0.29908	0.895	0.29679	N	0.841835	B;B;B;B;B	0.21905	0.001;0.018;0.062;0.002;0.007	B;B;B;B;B	0.25759	0.003;0.023;0.063;0.005;0.007	T	0.32534	-0.9903	10	0.45353	T	0.12	.	12.2142	0.54396	1.0:0.0:0.0:0.0	.	252;252;18;245;339	Q96CP6-3;Q96CP6;B3KQF7;Q96CP6-2;F5GZ02	.;GRM1A_HUMAN;.;.;.	G	339;18;252;245	ENSP00000423728:S18G;ENSP00000441032:S252G;ENSP00000439267:S245G	ENSP00000441032:S252G	S	+	1	0	GRAMD1A	40196319	1.000000	0.71417	0.996000	0.52242	0.916000	0.54674	2.361000	0.44160	1.988000	0.58038	0.397000	0.26171	AGC	.	.		0.642	GRAMD1A-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000461557.1	NM_020895	
PROSER3	148137	hgsc.bcm.edu	37	19	36258938	36258938	+	Splice_Site	SNP	G	G	A	rs398034467|rs5827939		TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr19:36258938G>A	ENST00000396908.4	+	9	1264	c.1191G>A	c.(1189-1191)caG>caA	p.Q397Q	AC002398.13_ENST00000589397.1_RNA|C19orf55_ENST00000544099.1_Silent_p.Q397Q	NM_001039887.2	NP_001034976.2	Q2NL68	PRSR3_HUMAN		398										cervix(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(3)|ovary(2)|prostate(1)	15	all_lung(56;2.87e-07)|Lung NSC(56;4.32e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			TGCTTGCCCAGGGCCGCCCTG	0.731																																					.		Atlas-SNP	.											.,11	C19orf55	39	.	0			c.1190+1G>A						.						1.0	1.0	1.0					19																	36258938		567	1236	1803	SO:0001630	splice_region_variant	148137	exon9			TGCCCAGGGCCGC																												ENST00000396908.4:c.1191+1G>A	chr19.hg19:g.36258938G>A		10.0	0.0		19.0	4.0	NM_001039887	Q8NDI3|Q8WWC8|Q96NL4	Splice_Site	SNP	ENST00000396908.4	hg19																																																																																				.	.		0.731	C19orf55-201	KNOWN	basic|appris_principal	protein_coding	protein_coding			Silent
KIRREL2	84063	hgsc.bcm.edu	37	19	36351240	36351240	+	Nonsense_Mutation	SNP	C	C	T			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr19:36351240C>T	ENST00000360202.5	+	6	913	c.715C>T	c.(715-717)Cag>Tag	p.Q239*	NPHS1_ENST00000591817.1_Intron|KIRREL2_ENST00000592409.1_Nonsense_Mutation_p.Q239*|KIRREL2_ENST00000262625.7_Nonsense_Mutation_p.Q239*|KIRREL2_ENST00000347900.6_Nonsense_Mutation_p.Q189*	NM_032123.5|NM_199180.2	NP_115499.4|NP_954649.2	Q6UWL6	KIRR2_HUMAN	kin of IRRE like 2 (Drosophila)	239	Ig-like C2-type 3.				cell adhesion (GO:0007155)|negative regulation of protein phosphorylation (GO:0001933)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|slit diaphragm (GO:0036057)				breast(2)|central_nervous_system(1)|endometrium(6)|large_intestine(6)|liver(2)|lung(22)|ovary(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	48	all_lung(56;7.14e-07)|Lung NSC(56;1.12e-06)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			ACACACTGTGCAGGAGGGAGA	0.612																																					p.Q239X		Atlas-SNP	.											.	KIRREL2	170	.	0			c.C715T						.						77.0	63.0	67.0					19																	36351240		2203	4300	6503	SO:0001587	stop_gained	84063	exon6			ACTGTGCAGGAGG	AL136654	CCDS12479.1, CCDS12480.1, CCDS12481.1	19q13.13	2013-01-29				ENSG00000126259		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	18816	protein-coding gene	gene with protein product		607762				12837264, 12504092	Standard	NM_199180		Approved	NLG1, NEPH3, FILTRIN, DKFZp564A1164, MGC15718	uc002ocb.4	Q6UWL6		ENST00000360202.5:c.715C>T	chr19.hg19:g.36351240C>T	ENSP00000353331:p.Gln239*	47.0	0.0		63.0	4.0	NM_199180	C9JHF1|C9JJ76|F1T0I2|Q6P1R1|Q7Z5P1|Q7Z5P2|Q96IQ8|Q9H0T1	Nonsense_Mutation	SNP	ENST00000360202.5	hg19	CCDS12481.1	.	.	.	.	.	.	.	.	.	.	C	36	5.681926	0.96774	.	.	ENSG00000126259	ENST00000262625;ENST00000347900;ENST00000360202;ENST00000341658	.	.	.	3.86	3.86	0.44501	.	0.478185	0.15997	N	0.234521	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.52906	T	0.07	-5.7555	11.5369	0.50643	0.0:1.0:0.0:0.0	.	.	.	.	X	239;189;239;219	.	ENSP00000262625:Q239X	Q	+	1	0	KIRREL2	41043080	0.992000	0.36948	1.000000	0.80357	0.689000	0.40095	2.252000	0.43196	2.182000	0.69389	0.449000	0.29647	CAG	.	.		0.612	KIRREL2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000452561.1	NM_032123	
ZNF567	163081	hgsc.bcm.edu	37	19	37211090	37211090	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr19:37211090G>T	ENST00000536254.2	+	6	1686	c.1464G>T	c.(1462-1464)atG>atT	p.M488I	ZNF567_ENST00000360729.4_Missense_Mutation_p.M457I|ZNF567_ENST00000585696.1_Missense_Mutation_p.M457I|ZNF567_ENST00000392163.2_Missense_Mutation_p.M457I|ZNF850_ENST00000589390.1_Intron|ZNF567_ENST00000588311.1_Missense_Mutation_p.M457I			Q8N184	ZN567_HUMAN	zinc finger protein 567	488					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(8)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	24	Esophageal squamous(110;0.198)		COAD - Colon adenocarcinoma(19;0.0454)|Colorectal(19;0.065)			CCTTTAGAATGAAGTCATACC	0.413																																					p.M457I		Atlas-SNP	.											.	ZNF567	61	.	0			c.G1371T						.						85.0	83.0	83.0					19																	37211090		2203	4300	6503	SO:0001583	missense	163081	exon4			TAGAATGAAGTCA	AK093034	CCDS12495.1, CCDS74349.1	19q13.12	2013-10-08				ENSG00000189042		"""Zinc fingers, C2H2-type"", ""-"""	28696	protein-coding gene	gene with protein product						12477932	Standard	XM_006723064		Approved	MGC45586	uc002oep.4	Q8N184		ENST00000536254.2:c.1464G>T	chr19.hg19:g.37211090G>T	ENSP00000441838:p.Met488Ile	92.0	0.0		108.0	32.0	NM_152603	B3KX49|Q6N044	Missense_Mutation	SNP	ENST00000536254.2	hg19		.	.	.	.	.	.	.	.	.	.	G	12.68	2.011518	0.35511	.	.	ENSG00000189042	ENST00000536254;ENST00000378686;ENST00000360729;ENST00000423498;ENST00000392163	T;T;T	0.35236	1.32;1.32;1.32	4.88	1.58	0.23477	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.128065	0.36101	N	0.002795	T	0.26376	0.0644	N	0.04746	-0.17	0.09310	N	0.999998	B;P	0.44281	0.003;0.831	B;P	0.54664	0.002;0.758	T	0.05241	-1.0897	10	0.42905	T	0.14	.	6.7195	0.23323	0.1726:0.1509:0.6765:0.0	.	488;457	Q8N184;F8WEL6	ZN567_HUMAN;.	I	488;432;457;487;457	ENSP00000441838:M488I;ENSP00000353957:M457I;ENSP00000376003:M457I	ENSP00000353957:M457I	M	+	3	0	ZNF567	41902930	0.000000	0.05858	0.984000	0.44739	0.997000	0.91878	-0.239000	0.08965	0.754000	0.32968	0.561000	0.74099	ATG	.	.		0.413	ZNF567-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000453549.1	NM_152603	
ZNF793	390927	hgsc.bcm.edu	37	19	38023265	38023265	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr19:38023265T>C	ENST00000587143.1	+	4	258	c.23T>C	c.(22-24)gTg>gCg	p.V8A	ZNF793_ENST00000542455.1_Missense_Mutation_p.V8A|ZNF793_ENST00000587986.1_Missense_Mutation_p.V8A|ZNF793_ENST00000588578.1_Missense_Mutation_p.V8A|ZNF793_ENST00000445217.1_Missense_Mutation_p.V8A|ZNF793_ENST00000589319.1_Missense_Mutation_p.V8A			Q6ZN11	ZN793_HUMAN	zinc finger protein 793	8	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			kidney(2)|lung(1)	3			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			CAGATACCTGTGTCATTCAAA	0.493																																					p.V8A	Melanoma(44;400 1431 1499 19093)	Atlas-SNP	.											.	ZNF793	50	.	0			c.T23C						.						53.0	54.0	54.0					19																	38023265		2157	4287	6444	SO:0001583	missense	390927	exon6			TACCTGTGTCATT	AK131417	CCDS46062.1	19q13.12	2013-01-08				ENSG00000188227		"""Zinc fingers, C2H2-type"", ""-"""	33115	protein-coding gene	gene with protein product							Standard	NM_001013659		Approved		uc010efm.3	Q6ZN11		ENST00000587143.1:c.23T>C	chr19.hg19:g.38023265T>C	ENSP00000468605:p.Val8Ala	82.0	0.0		88.0	4.0	NM_001013659	E9PGN4|Q7Z3Q9	Missense_Mutation	SNP	ENST00000587143.1	hg19	CCDS46062.1	.	.	.	.	.	.	.	.	.	.	T	15.92	2.976537	0.53720	.	.	ENSG00000188227	ENST00000542455;ENST00000418827;ENST00000445217;ENST00000322299	T;T	0.05717	3.4;3.4	3.53	3.53	0.40419	Krueppel-associated box (4);	.	.	.	.	T	0.34019	0.0883	H	0.96301	3.8	0.24906	N	0.992077	D;D	0.71674	0.998;0.995	D;P	0.71870	0.975;0.901	T	0.28332	-1.0047	9	0.87932	D	0	.	10.3278	0.43805	0.0:0.0:0.0:1.0	.	8;8	Q6ZN11;E9PGN4	ZN793_HUMAN;.	A	8;8;8;7	ENSP00000444355:V8A;ENSP00000396402:V8A	ENSP00000318811:V7A	V	+	2	0	ZNF793	42715105	1.000000	0.71417	1.000000	0.80357	0.501000	0.33797	4.696000	0.61774	1.590000	0.49995	0.460000	0.39030	GTG	.	.		0.493	ZNF793-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458621.1	NM_001013659	
PSG4	5672	hgsc.bcm.edu	37	19	43699239	43699239	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr19:43699239T>C	ENST00000405312.3	-	4	1133	c.896A>G	c.(895-897)aAt>aGt	p.N299S	PSG4_ENST00000244295.9_Intron|PSG4_ENST00000433626.2_Missense_Mutation_p.N206S	NM_002780.3	NP_002771.2	Q00888	PSG4_HUMAN	pregnancy specific beta-1-glycoprotein 4	299	Ig-like C2-type 2.				female pregnancy (GO:0007565)	extracellular vesicular exosome (GO:0070062)				central_nervous_system(1)|endometrium(2)|large_intestine(8)|lung(10)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	24		Prostate(69;0.00682)				TCTCGTGACATTGGGTAGAAT	0.478																																					p.T299S		Atlas-SNP	.											PSG4_ENST00000405312,NS,carcinoma,0,1	PSG4	129	.	0			c.C896G						.						238.0	218.0	225.0					19																	43699239		2202	4295	6497	SO:0001583	missense	5672	exon4			GTGACATTGGGTA		CCDS33039.1, CCDS46093.1, CCDS62695.1	19q13.2	2013-01-29			ENSG00000243137	ENSG00000243137		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9521	protein-coding gene	gene with protein product	"""pregnancy-specific beta-1-glycoprotein 4"""	176393				2783133	Standard	NM_002780		Approved		uc002ovy.4	Q00888	OTTHUMG00000151544	ENST00000405312.3:c.896A>G	chr19.hg19:g.43699239T>C	ENSP00000384770:p.Asn299Ser	69.0	1.0		67.0	6.0	NM_002780	E7EX79|Q13047|Q13048|Q15234|Q15240|Q9UQ76	Missense_Mutation	SNP	ENST00000405312.3	hg19	CCDS46093.1	.	.	.	.	.	.	.	.	.	.	c	1.820	-0.472562	0.04445	.	.	ENSG00000243137	ENST00000405312;ENST00000433626	T;T	0.10288	2.89;2.89	1.45	-2.17	0.07059	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.04227	0.0117	N	0.05230	-0.09	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.09377	0.001;0.004	T	0.40979	-0.9534	9	0.22706	T	0.39	.	5.8772	0.18836	0.0:0.3561:0.0:0.6439	.	206;299	E7EX79;Q00888	.;PSG4_HUMAN	S	299;206	ENSP00000384770:N299S;ENSP00000387864:N206S	ENSP00000384770:N299S	N	-	2	0	PSG4	48391079	0.000000	0.05858	0.002000	0.10522	0.001000	0.01503	-3.469000	0.00460	-1.969000	0.01005	-2.870000	0.00099	AAT	.	.		0.478	PSG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323073.1	NM_213633	
ZNF576	79177	hgsc.bcm.edu	37	19	44103100	44103100	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr19:44103100G>A	ENST00000336564.4	+	3	357	c.203G>A	c.(202-204)gGg>gAg	p.G68E	IRGQ_ENST00000422989.1_5'Flank|ZNF576_ENST00000528387.1_Missense_Mutation_p.G68E|ZNF576_ENST00000529930.1_Missense_Mutation_p.G68E|SRRM5_ENST00000526798.1_Intron|SRRM5_ENST00000607544.1_Intron|ZNF576_ENST00000391965.2_Missense_Mutation_p.G68E|ZNF576_ENST00000533118.1_Missense_Mutation_p.G68E|ZNF576_ENST00000525771.1_Missense_Mutation_p.G68E	NM_001145347.1	NP_001138819.1	Q9H609	ZN576_HUMAN	zinc finger protein 576	68					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			endometrium(1)|prostate(1)	2		Prostate(69;0.0199)				AAGCTGCAGGGGGTCCTCTTC	0.637																																					p.G68E		Atlas-SNP	.											.	ZNF576	11	.	0			c.G203A						.						91.0	106.0	101.0					19																	44103100		2203	4300	6503	SO:0001583	missense	79177	exon3			TGCAGGGGGTCCT	AK026353	CCDS12625.1	19q13.31	2013-09-20			ENSG00000124444	ENSG00000124444		"""Zinc fingers, C2H2-type"""	28357	protein-coding gene	gene with protein product						12477932	Standard	NM_024327		Approved	MGC2508	uc002owz.2	Q9H609	OTTHUMG00000165479	ENST00000336564.4:c.203G>A	chr19.hg19:g.44103100G>A	ENSP00000337852:p.Gly68Glu	133.0	0.0		173.0	80.0	NM_001145347	Q9BU03	Missense_Mutation	SNP	ENST00000336564.4	hg19	CCDS12625.1	.	.	.	.	.	.	.	.	.	.	G	19.12	3.766090	0.69878	.	.	ENSG00000124444	ENST00000391965;ENST00000525771;ENST00000533118;ENST00000528387;ENST00000529930;ENST00000336564	T;T;T;T;T;T	0.01252	5.1;5.1;5.1;5.1;5.1;5.1	3.93	3.93	0.45458	.	0.164033	0.36972	N	0.002318	T	0.02119	0.0066	N	0.11064	0.09	0.80722	D	1	D	0.76494	0.999	D	0.71414	0.973	T	0.70103	-0.4964	10	0.08381	T	0.77	-15.9544	11.7501	0.51843	0.0:0.0:1.0:0.0	.	68	Q9H609	ZN576_HUMAN	E	68	ENSP00000375827:G68E;ENSP00000436182:G68E;ENSP00000435899:G68E;ENSP00000435934:G68E;ENSP00000435463:G68E;ENSP00000337852:G68E	ENSP00000337852:G68E	G	+	2	0	ZNF576	48794940	0.995000	0.38212	0.999000	0.59377	0.922000	0.55478	1.051000	0.30417	2.500000	0.84329	0.591000	0.81541	GGG	.	.		0.637	ZNF576-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384397.1	NM_024327	
ZNF226	7769	hgsc.bcm.edu	37	19	44679880	44679880	+	Silent	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr19:44679880T>C	ENST00000590089.1	+	7	832	c.465T>C	c.(463-465)ggT>ggC	p.G155G	ZNF226_ENST00000588883.1_3'UTR|ZNF226_ENST00000454662.2_Silent_p.G155G|ZNF226_ENST00000337433.5_Silent_p.G155G			Q9NYT6	ZN226_HUMAN	zinc finger protein 226	155					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)						Prostate(69;0.0352)|all_neural(266;0.202)				AAGCAGATGGTCCCAATAATA	0.408																																					p.G155G	Pancreas(115;581 1665 13228 19278 50070)	Atlas-SNP	.											.	.	.	.	0			c.T465C						.						36.0	33.0	34.0					19																	44679880		1828	4079	5907	SO:0001819	synonymous_variant	7769	exon6			AGATGGTCCCAAT	AF024707	CCDS46102.1, CCDS46103.1	19q13.31	2013-01-08	2012-09-11	2012-09-11	ENSG00000167380	ENSG00000167380		"""Zinc fingers, C2H2-type"", ""-"""	13019	protein-coding gene	gene with protein product							Standard	NM_001146220		Approved		uc002oyp.3	Q9NYT6		ENST00000590089.1:c.465T>C	chr19.hg19:g.44679880T>C		104.0	0.0		81.0	4.0	NM_001032372	Q8WWE6|Q96TE6|Q9NS44	Silent	SNP	ENST00000590089.1	hg19	CCDS46102.1																																																																																			.	.		0.408	ZNF226-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460712.1		
PLEKHA4	57664	hgsc.bcm.edu	37	19	49357343	49357343	+	Splice_Site	SNP	G	G	A			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr19:49357343G>A	ENST00000263265.6	-	11	1652	c.1097C>T	c.(1096-1098)aCg>aTg	p.T366M	PLEKHA4_ENST00000355496.5_Splice_Site_p.T341M	NM_020904.2	NP_065955.2	Q9H4M7	PKHA4_HUMAN	pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 4	366						cytoplasm (GO:0005737)|membrane (GO:0016020)	1-phosphatidylinositol binding (GO:0005545)			NS(1)|breast(5)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(5)|ovary(1)|prostate(3)|skin(2)|urinary_tract(2)	30		all_lung(116;4.89e-05)|Lung NSC(112;8.3e-05)|all_epithelial(76;0.000108)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.00027)|all cancers(93;0.00084)|GBM - Glioblastoma multiforme(486;0.0244)|Epithelial(262;0.0364)		GGTCAGCAGCGTCTGGAGAAA	0.612																																					p.T366M		Atlas-SNP	.											.	PLEKHA4	70	.	0			c.C1097T						.						43.0	43.0	43.0					19																	49357343		2203	4300	6503	SO:0001630	splice_region_variant	57664	exon11			AGCAGCGTCTGGA	AY007233	CCDS12737.1, CCDS54291.1	19q13.33	2013-01-10	2002-01-14			ENSG00000105559		"""Pleckstrin homology (PH) domain containing"""	14339	protein-coding gene	gene with protein product		607769	"""pleckstrin homology domain-containing, family A (phosphoinositide binding specific) member 4"""			11001876	Standard	NM_020904		Approved	PEPP1	uc002pkx.3	Q9H4M7		ENST00000263265.6:c.1096-1C>T	chr19.hg19:g.49357343G>A		106.0	0.0		121.0	59.0	NM_020904	Q8N4M8|Q8N658	Missense_Mutation	SNP	ENST00000263265.6	hg19	CCDS12737.1	.	.	.	.	.	.	.	.	.	.	G	16.25	3.070509	0.55539	.	.	ENSG00000105559	ENST00000263265;ENST00000355496	T;T	0.36340	1.26;1.26	4.91	3.85	0.44370	.	0.165964	0.39544	N	0.001332	T	0.41282	0.1152	L	0.40543	1.245	0.23862	N	0.996632	D;D	0.67145	0.995;0.996	P;P	0.54706	0.759;0.72	T	0.22836	-1.0205	10	0.72032	D	0.01	.	11.2063	0.48771	0.0:0.1854:0.8146:0.0	.	341;366	Q9H4M7-2;Q9H4M7	.;PKHA4_HUMAN	M	366;341	ENSP00000263265:T366M;ENSP00000347683:T341M	ENSP00000263265:T366M	T	-	2	0	PLEKHA4	54049155	0.977000	0.34250	0.783000	0.31826	0.631000	0.37964	2.023000	0.41040	1.393000	0.46605	0.563000	0.77884	ACG	.	.		0.612	PLEKHA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466216.1		Missense_Mutation
DHDH	27294	hgsc.bcm.edu	37	19	49442857	49442857	+	Missense_Mutation	SNP	C	C	G	rs543413361		TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr19:49442857C>G	ENST00000221403.2	+	4	558	c.518C>G	c.(517-519)gCc>gGc	p.A173G	DHDH_ENST00000523250.1_Intron|DHDH_ENST00000522614.1_Missense_Mutation_p.A173G	NM_014475.3	NP_055290.1	Q9UQ10	DHDH_HUMAN	dihydrodiol dehydrogenase (dimeric)	173					carbohydrate metabolic process (GO:0005975)|D-xylose catabolic process (GO:0042843)		D-xylose 1-dehydrogenase (NADP+) activity (GO:0047837)|electron carrier activity (GO:0009055)|NAD(P)+ transhydrogenase activity (GO:0008746)|trans-1,2-dihydrobenzene-1,2-diol dehydrogenase activity (GO:0047115)			central_nervous_system(1)|large_intestine(3)|lung(3)|ovary(1)|soft_tissue(1)	9		all_epithelial(76;5.29e-07)|all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.000158)|all cancers(93;0.000258)|Epithelial(262;0.0173)|GBM - Glioblastoma multiforme(486;0.0179)		GCTGGGGGGGCCCTGCTGGAC	0.602													C|||	1	0.000199681	0.0008	0.0	5008	,	,		17572	0.0		0.0	False		,,,				2504	0.0				p.A173G		Atlas-SNP	.											DHDH,colon,carcinoma,0,1	DHDH	35	.	0			c.C518G						.						53.0	56.0	55.0					19																	49442857		2203	4300	6503	SO:0001583	missense	27294	exon4			GGGGGGCCCTGCT	AB021933	CCDS12741.1	19q13.3	2008-02-05			ENSG00000104808	ENSG00000104808	1.3.1.20		17887	protein-coding gene	gene with protein product		606377				10477285	Standard	NM_014475		Approved	HUM2DD	uc002ple.1	Q9UQ10	OTTHUMG00000165029	ENST00000221403.2:c.518C>G	chr19.hg19:g.49442857C>G	ENSP00000221403:p.Ala173Gly	62.0	0.0		63.0	3.0	NM_014475		Missense_Mutation	SNP	ENST00000221403.2	hg19	CCDS12741.1	.	.	.	.	.	.	.	.	.	.	C	1.710	-0.499278	0.04291	.	.	ENSG00000104808	ENST00000221403;ENST00000522614	T;T	0.38560	1.13;1.13	5.12	0.225	0.15325	.	0.219759	0.45606	N	0.000342	T	0.35653	0.0939	L	0.45228	1.405	0.09310	N	1	B	0.06786	0.001	B	0.01281	0.0	T	0.36138	-0.9760	10	0.42905	T	0.14	-7.1401	17.2381	0.87005	0.0:0.6748:0.3252:0.0	rs58913518	173	Q9UQ10	DHDH_HUMAN	G	173	ENSP00000221403:A173G;ENSP00000428672:A173G	ENSP00000221403:A173G	A	+	2	0	DHDH	54134669	0.094000	0.21725	0.003000	0.11579	0.006000	0.05464	0.971000	0.29396	0.096000	0.17463	-0.270000	0.10280	GCC	.	.		0.602	DHDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381477.1	NM_014475	
ZNF611	81856	hgsc.bcm.edu	37	19	53208850	53208850	+	Silent	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr19:53208850T>C	ENST00000319783.1	-	7	1774	c.1458A>G	c.(1456-1458)gaA>gaG	p.E486E	ZNF611_ENST00000602162.1_Silent_p.E417E|ZNF611_ENST00000453741.2_Silent_p.E417E|ZNF611_ENST00000595798.1_Silent_p.E417E|ZNF611_ENST00000602046.1_5'Flank|ZNF611_ENST00000540744.1_Silent_p.E486E|ZNF611_ENST00000543227.1_Silent_p.E486E	NM_030972.3	NP_112234.3	Q8N823	ZN611_HUMAN	zinc finger protein 611	486					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(4)|kidney(4)|large_intestine(10)|lung(12)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	36				OV - Ovarian serous cystadenocarcinoma(262;0.0233)|GBM - Glioblastoma multiforme(134;0.04)		TCTTCCCACATTCATTACACT	0.358																																					p.E486E		Atlas-SNP	.											.	ZNF611	72	.	0			c.A1458G						.						92.0	94.0	93.0					19																	53208850		2203	4300	6503	SO:0001819	synonymous_variant	81856	exon7			CCCACATTCATTA	AK091389	CCDS12855.1, CCDS54312.1	19q13.42	2013-01-08			ENSG00000213020	ENSG00000213020		"""Zinc fingers, C2H2-type"", ""-"""	28766	protein-coding gene	gene with protein product						12477932	Standard	NM_030972		Approved	MGC5384	uc010ydq.2	Q8N823	OTTHUMG00000154908	ENST00000319783.1:c.1458A>G	chr19.hg19:g.53208850T>C		103.0	0.0		103.0	5.0	NM_030972	B3KRD5|Q69YG9	Silent	SNP	ENST00000319783.1	hg19	CCDS12855.1																																																																																			.	.		0.358	ZNF611-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337612.1	NM_030972	
ZNF816	125893	hgsc.bcm.edu	37	19	53454471	53454471	+	Missense_Mutation	SNP	G	G	C	rs200901929|rs79566976		TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr19:53454471G>C	ENST00000357666.4	-	5	857	c.557C>G	c.(556-558)gCt>gGt	p.A186G	ZNF816_ENST00000434371.2_Intron|ZNF321P_ENST00000391777.3_Intron|ZNF816_ENST00000444460.2_Missense_Mutation_p.A186G	NM_001031665.2	NP_001026835.1	Q0VGE8	ZN816_HUMAN	zinc finger protein 816	186					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(10)|lung(9)|stomach(1)|urinary_tract(2)	27						AGCTGAGGAAGCACCGATAGA	0.373																																					p.A186G		Atlas-SNP	.											.	ZNF816	73	.	0			c.C557G						.						89.0	112.0	104.0					19																	53454471		2202	4300	6502	SO:0001583	missense	125893	exon4			GAGGAAGCACCGA	BC063805	CCDS33096.1	19q13.41	2013-01-08	2010-07-23	2010-07-23		ENSG00000180257		"""Zinc fingers, C2H2-type"", ""-"""	26995	protein-coding gene	gene with protein product			"""zinc finger protein 816A"""	ZNF816A			Standard	NM_001031665		Approved		uc002qam.2	Q0VGE8		ENST00000357666.4:c.557C>G	chr19.hg19:g.53454471G>C	ENSP00000350295:p.Ala186Gly	91.0	0.0		81.0	6.0	NM_001202457	A8K7H5|Q3KR39|Q659B3	Missense_Mutation	SNP	ENST00000357666.4	hg19	CCDS33096.1	.	.	.	.	.	.	.	.	.	.	-	1.630	-0.519183	0.04171	.	.	ENSG00000180257	ENST00000357666;ENST00000444460	T;T	0.05649	3.41;3.41	1.58	0.318	0.15867	.	.	.	.	.	T	0.08758	0.0217	N	0.19112	0.55	0.09310	N	1	D	0.69078	0.997	D	0.75020	0.985	T	0.35624	-0.9781	9	0.15952	T	0.53	.	5.7046	0.17901	0.0:0.4142:0.5858:0.0	.	186	Q0VGE8	ZN816_HUMAN	G	186	ENSP00000350295:A186G;ENSP00000403266:A186G	ENSP00000350295:A186G	A	-	2	0	ZNF816	58146283	0.000000	0.05858	0.002000	0.10522	0.176000	0.22953	-0.783000	0.04638	-0.053000	0.13289	0.185000	0.17295	GCT	.	.		0.373	ZNF816-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396132.1	NM_001031665	
ZNF347	84671	hgsc.bcm.edu	37	19	53643997	53643997	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr19:53643997T>C	ENST00000334197.7	-	5	2152	c.2084A>G	c.(2083-2085)aAg>aGg	p.K695R	ZNF347_ENST00000452676.2_Missense_Mutation_p.K696R|ZNF347_ENST00000601804.1_Intron|ZNF347_ENST00000601469.2_Missense_Mutation_p.K696R	NM_032584.2	NP_115973.2	Q96SE7	ZN347_HUMAN	zinc finger protein 347	695					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|kidney(2)|large_intestine(6)|lung(8)|prostate(3)|skin(1)	23				GBM - Glioblastoma multiforme(134;0.0179)		CCTTGCAAGCTTTGATGTTTG	0.433																																					p.K696R	Melanoma(64;205 1597 17324 45721)	Atlas-SNP	.											.	ZNF347	87	.	0			c.A2087G						.						141.0	134.0	136.0					19																	53643997		2203	4300	6503	SO:0001583	missense	84671	exon5			GCAAGCTTTGATG	AY029765	CCDS33097.1, CCDS54314.1	19q13.3	2013-01-08				ENSG00000197937		"""Zinc fingers, C2H2-type"", ""-"""	16447	protein-coding gene	gene with protein product							Standard	NM_032584		Approved	ZNF1111	uc010eql.2	Q96SE7		ENST00000334197.7:c.2084A>G	chr19.hg19:g.53643997T>C	ENSP00000334146:p.Lys695Arg	88.0	0.0		122.0	6.0	NM_001172675	B3KU77|B9EG59|G5E9N4|Q8TCN1	Missense_Mutation	SNP	ENST00000334197.7	hg19	CCDS33097.1	.	.	.	.	.	.	.	.	.	.	T	1.642	-0.516307	0.04200	.	.	ENSG00000197937	ENST00000334197;ENST00000452676	T;T	0.07688	3.17;3.17	2.87	-0.786	0.10946	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.03564	0.0102	N	0.12887	0.27	0.09310	N	1	B;B	0.28055	0.199;0.029	B;B	0.30572	0.117;0.051	T	0.45498	-0.9257	9	0.15499	T	0.54	.	1.6483	0.02766	0.1603:0.1023:0.3294:0.4081	.	696;695	G5E9N4;Q96SE7	.;ZN347_HUMAN	R	695;696	ENSP00000334146:K695R;ENSP00000405218:K696R	ENSP00000334146:K695R	K	-	2	0	ZNF347	58335809	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.448000	0.02394	-0.409000	0.07553	-1.281000	0.01382	AAG	.	.		0.433	ZNF347-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000464170.1	NM_032584	
ZNF805	390980	hgsc.bcm.edu	37	19	57765823	57765823	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr19:57765823A>G	ENST00000414468.2	+	4	1636	c.1636A>G	c.(1636-1638)Aag>Gag	p.K546E	ZNF805_ENST00000535550.1_Missense_Mutation_p.K413E|ZNF805_ENST00000354309.4_Missense_Mutation_p.K413E	NM_001023563.3	NP_001018857.2	Q5CZA5	ZN805_HUMAN	zinc finger protein 805	546					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(3)|kidney(3)|lung(1)|stomach(1)	9						TGAATGTGGAAAGGCCTTCAG	0.478																																					p.K546E		Atlas-SNP	.											.	ZNF805	30	.	0			c.A1636G						.						106.0	99.0	101.0					19																	57765823		692	1591	2283	SO:0001583	missense	390980	exon4			TGTGGAAAGGCCT	AF024708	CCDS46207.1, CCDS46208.1	19q13.43	2013-01-08			ENSG00000204524	ENSG00000204524		"""Zinc fingers, C2H2-type"", ""-"""	23272	protein-coding gene	gene with protein product							Standard	NM_001023563		Approved		uc010ygt.2	Q5CZA5		ENST00000414468.2:c.1636A>G	chr19.hg19:g.57765823A>G	ENSP00000412999:p.Lys546Glu	91.0	0.0		85.0	4.0	NM_001023563	B4DNM5	Missense_Mutation	SNP	ENST00000414468.2	hg19	CCDS46207.1	.	.	.	.	.	.	.	.	.	.	A	19.89	3.911528	0.72983	.	.	ENSG00000204524	ENST00000535550;ENST00000414468;ENST00000354309	T;T;T	0.27104	1.69;1.69;1.69	4.62	4.62	0.57501	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.51477	D	0.000086	T	0.46483	0.1395	M	0.64170	1.965	0.27692	N	0.946071	D	0.76494	0.999	D	0.71870	0.975	T	0.38802	-0.9644	10	0.87932	D	0	.	13.4151	0.60963	1.0:0.0:0.0:0.0	.	546	Q5CZA5	ZN805_HUMAN	E	413;546;413	ENSP00000440067:K413E;ENSP00000412999:K546E;ENSP00000365414:K413E	ENSP00000365414:K413E	K	+	1	0	ZNF805	62457635	0.996000	0.38824	0.996000	0.52242	0.998000	0.95712	6.541000	0.73865	2.063000	0.61619	0.460000	0.39030	AAG	.	.		0.478	ZNF805-002	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465722.1	NM_001023563	
SMOX	54498	hgsc.bcm.edu	37	20	4162577	4162577	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr20:4162577A>G	ENST00000305958.4	+	4	788	c.563A>G	c.(562-564)gAg>gGg	p.E188G	SMOX_ENST00000346595.2_Intron|SMOX_ENST00000379460.2_Missense_Mutation_p.E188G|SMOX_ENST00000484515.1_3'UTR|SMOX_ENST00000278795.3_Missense_Mutation_p.E188G|SMOX_ENST00000339123.6_Missense_Mutation_p.E188G	NM_175839.2	NP_787033.1	Q9NWM0	SMOX_HUMAN	spermine oxidase	188					cellular nitrogen compound metabolic process (GO:0034641)|oxidation-reduction process (GO:0055114)|polyamine biosynthetic process (GO:0006596)|polyamine catabolic process (GO:0006598)|polyamine metabolic process (GO:0006595)|small molecule metabolic process (GO:0044281)|spermine catabolic process (GO:0046208)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	N1-acetylspermine:oxygen oxidoreductase (N1-acetylspermidine-forming) activity (GO:0052895)|norspermine:oxygen oxidoreductase activity (GO:0052894)|polyamine oxidase activity (GO:0046592)|spermine:oxygen oxidoreductase (spermidine-forming) activity (GO:0052901)			breast(1)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(7)|lung(5)|skin(2)|urinary_tract(1)	26					Spermine(DB00127)	GACGACCCAGAGGCTACCAAG	0.567																																					p.E188G		Atlas-SNP	.											.	SMOX	119	.	0			c.A563G						.						76.0	78.0	77.0					20																	4162577		2203	4300	6503	SO:0001583	missense	54498	exon4			ACCCAGAGGCTAC	AK000753	CCDS13075.1, CCDS13076.1, CCDS13077.1, CCDS13078.1, CCDS74702.1	20p13	2003-10-15	2003-10-15	2003-10-15	ENSG00000088826	ENSG00000088826			15862	protein-coding gene	gene with protein product		615854	"""chromosome 20 open reading frame 16"""	C20orf16		11454677, 12398765	Standard	NM_175839		Approved	FLJ20746, dJ779E11.1, PAO, PAOh1, MGC1010, SMO	uc002wkp.3	Q9NWM0	OTTHUMG00000031777	ENST00000305958.4:c.563A>G	chr20.hg19:g.4162577A>G	ENSP00000307252:p.Glu188Gly	104.0	0.0		92.0	6.0	NM_175839	A2A2P5|A2A2P6|A8BE87|D3DVZ4|Q5TE26|Q5TE27|Q6UY28|Q8IX00|Q96LC3|Q96LC4|Q96QT3|Q9BW38|Q9H6H1|Q9NP51|Q9NPY1|Q9NPY2	Missense_Mutation	SNP	ENST00000305958.4	hg19	CCDS13075.1	.	.	.	.	.	.	.	.	.	.	A	20.0	3.931186	0.73327	.	.	ENSG00000088826	ENST00000339123;ENST00000305958;ENST00000278795;ENST00000379460;ENST00000457205	T;T;T;T;T	0.09911	2.93;2.93;2.93;2.93;2.93	5.44	5.44	0.79542	Amine oxidase (1);	0.105379	0.64402	D	0.000005	T	0.33702	0.0872	M	0.79614	2.46	0.58432	D	0.999998	D;D;D;D;D	0.89917	1.0;0.999;1.0;0.978;0.994	D;D;D;P;P	0.83275	0.996;0.99;0.996;0.844;0.896	T	0.05835	-1.0861	10	0.54805	T	0.06	-19.3387	13.4909	0.61395	1.0:0.0:0.0:0.0	.	165;188;188;188;188	B4DE63;Q9NWM0-6;Q9NWM0;Q9NWM0-2;Q9NWM0-4	.;.;SMOX_HUMAN;.;.	G	188;188;188;188;45	ENSP00000344595:E188G;ENSP00000307252:E188G;ENSP00000278795:E188G;ENSP00000368773:E188G;ENSP00000407269:E45G	ENSP00000278795:E188G	E	+	2	0	SMOX	4110577	1.000000	0.71417	0.996000	0.52242	0.960000	0.62799	5.100000	0.64560	2.082000	0.62665	0.456000	0.33151	GAG	.	.		0.567	SMOX-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077806.1	NM_175842	
KIF16B	55614	hgsc.bcm.edu	37	20	16360047	16360047	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr20:16360047T>C	ENST00000354981.2	-	19	2757	c.2600A>G	c.(2599-2601)gAa>gGa	p.E867G	KIF16B_ENST00000378003.2_Missense_Mutation_p.E93G|KIF16B_ENST00000408042.1_Missense_Mutation_p.E867G|KIF16B_ENST00000355755.3_Missense_Mutation_p.E867G	NM_001199865.1|NM_024704.4	NP_001186794.1|NP_078980.3	Q96L93	KI16B_HUMAN	kinesin family member 16B	867	Glu-rich.				ATP catabolic process (GO:0006200)|early endosome to late endosome transport (GO:0045022)|endoderm development (GO:0007492)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|formation of primary germ layer (GO:0001704)|Golgi to endosome transport (GO:0006895)|microtubule-based movement (GO:0007018)|receptor catabolic process (GO:0032801)|regulation of receptor recycling (GO:0001919)	early endosome (GO:0005769)|endosome (GO:0005768)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|phosphatidylinositol-3-phosphate binding (GO:0032266)|plus-end-directed microtubule motor activity (GO:0008574)			NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(6)|large_intestine(15)|lung(24)|ovary(1)|prostate(15)|skin(3)|upper_aerodigestive_tract(2)	74						TTTGTCATGTTCACATTTTAA	0.408																																					p.E867G		Atlas-SNP	.											.	KIF16B	305	.	0			c.A2600G						.						150.0	148.0	149.0					20																	16360047		2203	4300	6503	SO:0001583	missense	55614	exon19			TCATGTTCACATT	AK000142	CCDS13122.1, CCDS56178.1	20p11.23	2008-03-03	2008-03-03	2008-03-03	ENSG00000089177	ENSG00000089177		"""Kinesins"""	15869	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 23"""	C20orf23		16084724, 16782399	Standard	NM_024704		Approved	FLJ20135, dJ971B4.1, SNX23	uc010gci.2	Q96L93	OTTHUMG00000031927	ENST00000354981.2:c.2600A>G	chr20.hg19:g.16360047T>C	ENSP00000347076:p.Glu867Gly	74.0	0.0		82.0	4.0	NM_001199865	A6NKJ9|A7E2A8|B1AKG3|B1AKT7|C9JDN5|C9JI52|C9JSM8|C9JWJ7|Q2TBF5|Q5HYC0|Q5HYK1|Q5JWW3|Q5TFK5|Q86VL9|Q86YS5|Q8IYU0|Q9BQJ8|Q9BQM0|Q9BQM1|Q9BQM5|Q9H5U0|Q9HCI2|Q9NXN9	Missense_Mutation	SNP	ENST00000354981.2	hg19	CCDS13122.1	.	.	.	.	.	.	.	.	.	.	T	3.052	-0.195247	0.06259	.	.	ENSG00000089177	ENST00000354981;ENST00000355755;ENST00000377997;ENST00000378003;ENST00000408042	T;T;T;T	0.18502	2.21;2.21;2.21;2.21	5.6	-5.84	0.02318	.	1.633290	0.02854	N	0.129421	T	0.06371	0.0164	N	0.03608	-0.345	0.09310	N	1	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.04013	0.0;0.001;0.0;0.0	T	0.31724	-0.9933	10	0.21540	T	0.41	.	5.6248	0.17477	0.086:0.2973:0.4689:0.1478	.	867;867;867;867	Q96L93-4;Q96L93-2;Q96L93-6;Q96L93	.;.;.;KI16B_HUMAN	G	867;867;711;93;867	ENSP00000347076:E867G;ENSP00000347995:E867G;ENSP00000367242:E93G;ENSP00000384164:E867G	ENSP00000347076:E867G	E	-	2	0	KIF16B	16308047	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.022000	0.13511	-0.428000	0.07339	-0.263000	0.10527	GAA	.	.		0.408	KIF16B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078104.2	NM_017683	
OVOL2	58495	hgsc.bcm.edu	37	20	18022238	18022238	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr20:18022238A>G	ENST00000278780.6	-	3	693	c.451T>C	c.(451-453)Ttc>Ctc	p.F151L	OVOL2_ENST00000483661.1_5'UTR	NM_021220.2	NP_067043.2	Q9BRP0	OVOL2_HUMAN	ovo-like zinc finger 2	151					angiogenesis (GO:0001525)|dorsal/ventral pattern formation (GO:0009953)|embryonic digestive tract morphogenesis (GO:0048557)|endocardium formation (GO:0060214)|heart looping (GO:0001947)|heart trabecula formation (GO:0060347)|labyrinthine layer blood vessel development (GO:0060716)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of keratinocyte differentiation (GO:0045617)|negative regulation of Notch signaling pathway (GO:0045746)|negative regulation of transcription by competitive promoter binding (GO:0010944)|negative regulation of transcription, DNA-templated (GO:0045892)|neural crest cell migration (GO:0001755)|neural fold formation (GO:0001842)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cell cycle (GO:0051726)|regulation of keratinocyte proliferation (GO:0010837)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|transcription regulatory region DNA binding (GO:0044212)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(3)	6						TTGCCGCAGAAGGTGCACAGG	0.562																																					p.F151L		Atlas-SNP	.											.	OVOL2	18	.	0			c.T451C						.						155.0	97.0	117.0					20																	18022238		2203	4300	6503	SO:0001583	missense	58495	exon3			CGCAGAAGGTGCA	AK022284	CCDS13132.1	20p11.23	2013-10-17	2013-10-17	2005-05-31	ENSG00000125850	ENSG00000125850		"""Zinc fingers, C2H2-type"""	15804	protein-coding gene	gene with protein product			"""zinc finger protein 339"", ""ovo-like 2 (Drosophila)"""	ZNF339			Standard	NM_021220		Approved	bA504H3.3, HOVO2	uc002wqi.1	Q9BRP0	OTTHUMG00000031960	ENST00000278780.6:c.451T>C	chr20.hg19:g.18022238A>G	ENSP00000278780:p.Phe151Leu	114.0	0.0		123.0	5.0	NM_021220	Q5T8B4|Q9BX22|Q9HA54|Q9Y4M0	Missense_Mutation	SNP	ENST00000278780.6	hg19	CCDS13132.1	.	.	.	.	.	.	.	.	.	.	A	36	5.679291	0.96774	.	.	ENSG00000125850	ENST00000278780	T	0.05996	3.36	5.73	5.73	0.89815	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.10637	0.0260	N	0.04805	-0.155	0.80722	D	1	D	0.76494	0.999	D	0.83275	0.996	T	0.52609	-0.8553	10	0.33141	T	0.24	-33.5679	16.0048	0.80354	1.0:0.0:0.0:0.0	.	151	Q9BRP0	OVOL2_HUMAN	L	151	ENSP00000278780:F151L	ENSP00000278780:F151L	F	-	1	0	OVOL2	17970238	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.418000	0.80167	2.180000	0.69256	0.533000	0.62120	TTC	.	.		0.562	OVOL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078148.5	NM_021220	
SLC24A3	57419	hgsc.bcm.edu	37	20	19698204	19698204	+	Silent	SNP	C	C	T			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr20:19698204C>T	ENST00000328041.6	+	16	1949	c.1752C>T	c.(1750-1752)tcC>tcT	p.S584S		NM_020689.3	NP_065740.2	Q9HC58	NCKX3_HUMAN	solute carrier family 24 (sodium/potassium/calcium exchanger), member 3	584					ion transport (GO:0006811)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium, potassium:sodium antiporter activity (GO:0008273)|symporter activity (GO:0015293)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(10)|liver(1)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	39						TGATCTACTCCGTAGGCTTGC	0.507																																					p.S584S		Atlas-SNP	.											.	SLC24A3	92	.	0			c.C1752T						.						293.0	289.0	290.0					20																	19698204		2203	4300	6503	SO:0001819	synonymous_variant	57419	exon16			CTACTCCGTAGGC	AF169257	CCDS13140.1	20p13	2013-05-22			ENSG00000185052	ENSG00000185052		"""Solute carriers"""	10977	protein-coding gene	gene with protein product		609839					Standard	NM_020689		Approved		uc002wrl.3	Q9HC58	OTTHUMG00000031993	ENST00000328041.6:c.1752C>T	chr20.hg19:g.19698204C>T		235.0	0.0		241.0	103.0	NM_020689	B1AKV7|Q9BQJ9|Q9BQL7|Q9BQY3|Q9H519	Silent	SNP	ENST00000328041.6	hg19	CCDS13140.1																																																																																			.	.		0.507	SLC24A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078207.4	NM_020689	
NECAB3	63941	hgsc.bcm.edu	37	20	32246573	32246573	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr20:32246573A>G	ENST00000246190.6	-	9	1002	c.947T>C	c.(946-948)cTg>cCg	p.L316P	NECAB3_ENST00000375238.4_Missense_Mutation_p.L282P|NECAB3_ENST00000606525.1_5'UTR|RP1-63M2.6_ENST00000607224.1_RNA	NM_031232.3	NP_112509.3	Q96P71	NECA3_HUMAN	N-terminal EF-hand calcium binding protein 3	316	ABM.				protein metabolic process (GO:0019538)|protein secretion (GO:0009306)|regulation of amyloid precursor protein biosynthetic process (GO:0042984)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|Golgi cis cisterna (GO:0000137)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)			large_intestine(3)|lung(5)|skin(2)	10						ATAGCAGCGCAGGGCTCGGTG	0.662																																					p.L316P		Atlas-SNP	.											.	NECAB3	27	.	0			c.T947C						.						36.0	40.0	38.0					20																	32246573		1982	4152	6134	SO:0001583	missense	63941	exon9			CAGCGCAGGGCTC	AB039947	CCDS42866.1, CCDS42867.1	20q11.21	2013-01-10	2007-12-06	2007-12-06	ENSG00000125967	ENSG00000125967		"""N-terminal EF-hand calcium binding proteins"", ""EF-hand domain containing"""	15851	protein-coding gene	gene with protein product	"""EF-hand calcium binding protein 3"""	612478	"""amyloid beta (A4) precursor protein-binding, family A, member 2 binding protein"""	SYTIP2, APBA2BP		10833507	Standard	NM_031232		Approved	XB51, dJ63M2.4, NIP1, dJ63M2.5, EFCBP3	uc002wzn.4	Q96P71	OTTHUMG00000032264	ENST00000246190.6:c.947T>C	chr20.hg19:g.32246573A>G	ENSP00000246190:p.Leu316Pro	158.0	0.0		149.0	6.0	NM_031232	A8K780|E1P5N2|Q5JWF5|Q5JWF6|Q5JWF7|Q86VV1|Q9H433|Q9H8G8|Q9HBW7|Q9HCQ9	Missense_Mutation	SNP	ENST00000246190.6	hg19	CCDS42866.1	.	.	.	.	.	.	.	.	.	.	A	20.2	3.954416	0.73902	.	.	ENSG00000125967	ENST00000375238;ENST00000246190;ENST00000439478	T;T;T	0.38560	1.25;1.25;1.13	4.89	4.89	0.63831	Dimeric alpha-beta barrel (1);Antibiotic biosynthesis monooxygenase (1);	0.000000	0.64402	D	0.000004	T	0.65678	0.2714	M	0.81112	2.525	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;0.999	T	0.71307	-0.4632	10	0.87932	D	0	-8.487	13.4869	0.61371	1.0:0.0:0.0:0.0	.	193;316;282	E1P5N3;Q96P71;Q96P71-2	.;NECA3_HUMAN;.	P	282;316;264	ENSP00000364386:L282P;ENSP00000246190:L316P;ENSP00000392064:L264P	ENSP00000246190:L316P	L	-	2	0	NECAB3	31710234	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	7.808000	0.86044	1.841000	0.53522	0.379000	0.24179	CTG	.	.		0.662	NECAB3-010	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000078724.2		
RPN2	6185	hgsc.bcm.edu	37	20	35865012	35865012	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr20:35865012A>G	ENST00000237530.6	+	16	2094	c.1783A>G	c.(1783-1785)Act>Gct	p.T595A	RPN2_ENST00000470352.1_3'UTR|RPN2_ENST00000373622.5_Missense_Mutation_p.T563A	NM_002951.3	NP_002942.2	P04844	RPN2_HUMAN	ribophorin II	595					aging (GO:0007568)|cellular protein metabolic process (GO:0044267)|cellular protein modification process (GO:0006464)|gene expression (GO:0010467)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|response to drug (GO:0042493)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)	autophagic vacuole membrane (GO:0000421)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)|oligosaccharyltransferase complex (GO:0008250)|rough endoplasmic reticulum (GO:0005791)	ribosome binding (GO:0043022)|transferase activity, transferring glycosyl groups (GO:0016757)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(7)|ovary(2)|pancreas(1)|skin(2)|stomach(1)	24		Myeloproliferative disorder(115;0.00878)				TGTCTACTGGACTCAGCTCAA	0.498																																					p.T595A		Atlas-SNP	.											.	RPN2	45	.	0			c.A1783G						.						137.0	107.0	117.0					20																	35865012		2203	4300	6503	SO:0001583	missense	6185	exon16			TACTGGACTCAGC	Y00282	CCDS13291.1, CCDS46599.1	20q12-q13.1	2013-03-06			ENSG00000118705	ENSG00000118705			10382	protein-coding gene	gene with protein product	"""oligosaccharyltransferase complex subunit (non-catalytic)"""	180490					Standard	NM_002951		Approved	SWP1, RPNII, RIBIIR, RPN-II	uc002xgp.3	P04844	OTTHUMG00000032409	ENST00000237530.6:c.1783A>G	chr20.hg19:g.35865012A>G	ENSP00000237530:p.Thr595Ala	126.0	0.0		111.0	5.0	NM_002951	Q5JYR6|Q6IBA5|Q96E21|Q9BUQ3|Q9UBE1	Missense_Mutation	SNP	ENST00000237530.6	hg19	CCDS13291.1	.	.	.	.	.	.	.	.	.	.	A	19.06	3.753956	0.69648	.	.	ENSG00000118705	ENST00000237530;ENST00000373622;ENST00000397161;ENST00000437329	T;T;T	0.45668	0.89;0.89;0.89	5.13	5.13	0.70059	.	0.000000	0.85682	D	0.000000	T	0.53498	0.1800	L	0.54323	1.7	0.58432	D	0.999994	D;P	0.58620	0.983;0.938	P;P	0.60286	0.872;0.831	T	0.48990	-0.8985	10	0.31617	T	0.26	-13.7218	12.941	0.58345	1.0:0.0:0.0:0.0	.	563;595	Q5JYR6;P04844	.;RPN2_HUMAN	A	595;563;102;102	ENSP00000237530:T595A;ENSP00000362724:T563A;ENSP00000409580:T102A	ENSP00000237530:T595A	T	+	1	0	RPN2	35298426	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	8.761000	0.91691	2.153000	0.67306	0.459000	0.35465	ACT	.	.		0.498	RPN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079076.2	NM_002951	
FAM83D	81610	hgsc.bcm.edu	37	20	37576564	37576564	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr20:37576564T>C	ENST00000217429.4	+	3	828	c.787T>C	c.(787-789)Tca>Cca	p.S263P		NM_030919.2	NP_112181.2	Q9H4H8	FA83D_HUMAN	family with sequence similarity 83, member D	233					mitotic nuclear division (GO:0007067)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				endometrium(2)|kidney(2)|large_intestine(7)|lung(12)|ovary(4)|stomach(1)	28		Myeloproliferative disorder(115;0.00878)				CTATGCAAGGTCAGGAACTAA	0.438																																					p.S263P		Atlas-SNP	.											.	FAM83D	60	.	0			c.T787C						.						131.0	126.0	128.0					20																	37576564		1953	4138	6091	SO:0001583	missense	81610	exon3			GCAAGGTCAGGAA	AL023803	CCDS42872.1	20q11.23	2014-03-13	2006-03-23	2006-03-23	ENSG00000101447	ENSG00000101447			16122	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 129"""	C20orf129		23205133	Standard	NM_030919		Approved	dJ616B8.3	uc002xjg.3	Q9H4H8	OTTHUMG00000032462	ENST00000217429.4:c.787T>C	chr20.hg19:g.37576564T>C	ENSP00000217429:p.Ser263Pro	77.0	0.0		88.0	4.0	NM_030919	B4E1I7|Q5THR2|Q68EN1|Q6P457|Q7Z6H0|Q96DF5|Q96N89|Q9BVM8	Missense_Mutation	SNP	ENST00000217429.4	hg19	CCDS42872.1	.	.	.	.	.	.	.	.	.	.	T	28.2	4.896460	0.91962	.	.	ENSG00000101447	ENST00000217429;ENST00000424027	T	0.13089	2.62	6.16	5.01	0.66863	.	0.065751	0.64402	D	0.000005	T	0.41143	0.1146	M	0.86864	2.845	0.54753	D	0.999989	D	0.89917	1.0	D	0.81914	0.995	T	0.42447	-0.9451	10	0.72032	D	0.01	.	12.1733	0.54172	0.128:0.0:0.0:0.872	.	233	Q9H4H8	FA83D_HUMAN	P	263;217	ENSP00000217429:S263P	ENSP00000217429:S263P	S	+	1	0	FAM83D	37009978	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.868000	0.69605	2.367000	0.80283	0.528000	0.53228	TCA	.	.		0.438	FAM83D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079211.1		
OCSTAMP	128506	hgsc.bcm.edu	37	20	45174327	45174327	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr20:45174327A>G	ENST00000279028.2	-	2	699	c.686T>C	c.(685-687)gTc>gCc	p.V229A		NM_080721.1	NP_542452.1	Q9BR26	OCSTP_HUMAN	osteoclast stimulatory transmembrane protein	229					cellular response to estrogen stimulus (GO:0071391)|cellular response to tumor necrosis factor (GO:0071356)|multinuclear osteoclast differentiation (GO:0072674)|positive regulation of macrophage fusion (GO:0034241)|positive regulation of osteoclast differentiation (GO:0045672)|positive regulation of osteoclast proliferation (GO:0090290)	integral component of membrane (GO:0016021)				breast(1)|endometrium(1)	2						CAGCCCTGTGACCACTCGCTG	0.582																																					p.V229A		Atlas-SNP	.											.	OCSTAMP	34	.	0			c.T686C						.						65.0	66.0	65.0					20																	45174327		692	1591	2283	SO:0001583	missense	128506	exon2			CCTGTGACCACTC	AL034424	CCDS54468.1	20q13.12	2012-03-27	2012-03-27	2012-03-27	ENSG00000149635	ENSG00000149635			16116	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 123"""	C20orf123		18064667	Standard	NM_080721		Approved	dJ257E24.3	uc010zxu.2	Q9BR26	OTTHUMG00000032652	ENST00000279028.2:c.686T>C	chr20.hg19:g.45174327A>G	ENSP00000279028:p.Val229Ala	86.0	0.0		87.0	5.0	NM_080721		Missense_Mutation	SNP	ENST00000279028.2	hg19	CCDS54468.1	.	.	.	.	.	.	.	.	.	.	A	11.48	1.651728	0.29336	.	.	ENSG00000149635	ENST00000279028	T	0.46451	0.87	5.11	2.88	0.33553	.	0.305411	0.30901	N	0.008648	T	0.36082	0.0954	M	0.65975	2.015	0.09310	N	1	B	0.22276	0.067	B	0.15052	0.012	T	0.21109	-1.0255	10	0.24483	T	0.36	-29.0634	8.3113	0.32073	0.722:0.0:0.278:0.0	.	229	Q9BR26	CT123_HUMAN	A	229	ENSP00000279028:V229A	ENSP00000279028:V229A	V	-	2	0	C20orf123	44607734	0.212000	0.23540	0.060000	0.19600	0.397000	0.30659	2.223000	0.42936	0.788000	0.33755	0.528000	0.53228	GTC	.	.		0.582	OCSTAMP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079573.2	XM_496476	
TSHZ2	128553	hgsc.bcm.edu	37	20	51872639	51872639	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr20:51872639A>G	ENST00000371497.5	+	2	3529	c.2642A>G	c.(2641-2643)gAg>gGg	p.E881G	TSHZ2_ENST00000329613.6_Missense_Mutation_p.E878G|TSHZ2_ENST00000603338.2_Missense_Mutation_p.E878G|RP4-678D15.1_ENST00000606932.1_RNA	NM_001193421.1|NM_173485.5	NP_001180350.1|NP_775756.3	Q9NRE2	TSH2_HUMAN	teashirt zinc finger homeobox 2	881					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|breast(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(16)|lung(38)|ovary(5)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	84			STAD - Stomach adenocarcinoma(23;0.1)			GGCCCACAAGAGCGTATGCAA	0.502																																					p.E881G		Atlas-SNP	.											.	TSHZ2	209	.	0			c.A2642G						.						86.0	83.0	84.0					20																	51872639		2203	4300	6503	SO:0001583	missense	128553	exon2			CACAAGAGCGTAT	AF230201	CCDS33490.1, CCDS54474.1	20q13.2	2013-11-20	2007-07-16	2006-03-14	ENSG00000182463	ENSG00000182463		"""Teashirt zinc fingers"", ""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	13010	protein-coding gene	gene with protein product		614118	"""chromosome 20 open reading frame 17"", ""zinc finger protein 218"", ""teashirt family zinc finger 2"""	C20orf17, ZNF218		9671742	Standard	NM_173485		Approved	ZABC2, OVC10-2, TSH2	uc021wex.1	Q9NRE2	OTTHUMG00000033058	ENST00000371497.5:c.2642A>G	chr20.hg19:g.51872639A>G	ENSP00000360552:p.Glu881Gly	104.0	0.0		86.0	4.0	NM_173485	B7Z7W1|J3KNQ0|Q4VXM4|Q6N003|Q8N260	Missense_Mutation	SNP	ENST00000371497.5	hg19	CCDS33490.1	.	.	.	.	.	.	.	.	.	.	A	21.9	4.218555	0.79464	.	.	ENSG00000182463	ENST00000371497;ENST00000329613;ENST00000450262	T;T	0.27890	1.64;1.64	5.8	5.8	0.92144	Homeobox (1);Homeodomain-like (1);	0.000000	0.85682	D	0.000000	T	0.50069	0.1594	L	0.47190	1.495	0.80722	D	1	D	0.76494	0.999	D	0.80764	0.994	T	0.50541	-0.8816	10	0.87932	D	0	-1.386	16.1354	0.81481	1.0:0.0:0.0:0.0	.	881	Q9NRE2	TSH2_HUMAN	G	881;878;407	ENSP00000360552:E881G;ENSP00000333114:E878G	ENSP00000333114:E878G	E	+	2	0	TSHZ2	51306046	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	8.956000	0.93066	2.206000	0.71126	0.523000	0.50628	GAG	.	.		0.502	TSHZ2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080398.6	NM_173485	
LSM14B	149986	hgsc.bcm.edu	37	20	60706422	60706422	+	Silent	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr20:60706422T>C	ENST00000279068.6	+	7	1006	c.846T>C	c.(844-846)gcT>gcC	p.A282A	LSM14B_ENST00000253001.4_Silent_p.A282A	NM_144703.2	NP_653304.2	Q9BX40	LS14B_HUMAN	LSM14B, SCD6 homolog B (S. cerevisiae)	282					multicellular organismal development (GO:0007275)|regulation of translation (GO:0006417)	ribonucleoprotein complex (GO:0030529)	poly(A) RNA binding (GO:0044822)			endometrium(3)|kidney(1)|lung(4)	8	Breast(26;3.97e-09)		BRCA - Breast invasive adenocarcinoma(19;1.28e-07)			ATGACAAGGCTGAGAAGGGGG	0.582																																					p.A282A		Atlas-SNP	.											.	LSM14B	62	.	0			c.T846C						.						44.0	49.0	48.0					20																	60706422		2013	4170	6183	SO:0001819	synonymous_variant	149986	exon7			CAAGGCTGAGAAG	AF172328	CCDS46626.1	20q13.33	2010-01-27	2006-12-21	2006-01-24	ENSG00000149657	ENSG00000149657			15887	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 40"", ""family with sequence similarity 61, member B"", ""LSM14 homolog B (SCD6, S. cerevisiae)"""	C20orf40, FAM61B			Standard	NM_144703		Approved	FT005, bA11M20.3, FLJ25473, LSM13, RAP55B	uc010gjy.1	Q9BX40	OTTHUMG00000032901	ENST00000279068.6:c.846T>C	chr20.hg19:g.60706422T>C		99.0	0.0		85.0	4.0	NM_144703	Q6PFW8|Q96LH8	Silent	SNP	ENST00000279068.6	hg19	CCDS46626.1																																																																																			.	.		0.582	LSM14B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079996.4	NM_144703	
GART	2618	hgsc.bcm.edu	37	21	34882122	34882122	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr21:34882122T>C	ENST00000381831.3	-	18	2683	c.2420A>G	c.(2419-2421)aAg>aGg	p.K807R	GART_ENST00000543717.1_Missense_Mutation_p.K359R|GART_ENST00000381839.3_Missense_Mutation_p.K807R|GART_ENST00000381815.4_Missense_Mutation_p.K807R	NM_001136005.1	NP_001129477.1	P22102	PUR2_HUMAN	phosphoribosylglycinamide formyltransferase, phosphoribosylglycinamide synthetase, phosphoribosylaminoimidazole synthetase	807	AIRS.				'de novo' IMP biosynthetic process (GO:0006189)|brainstem development (GO:0003360)|cerebellum development (GO:0021549)|cerebral cortex development (GO:0021987)|glycine metabolic process (GO:0006544)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase biosynthetic process (GO:0009113)|purine nucleobase metabolic process (GO:0006144)|purine ribonucleoside monophosphate biosynthetic process (GO:0009168)|response to inorganic substance (GO:0010035)|response to organic substance (GO:0010033)|small molecule metabolic process (GO:0044281)|tetrahydrofolate biosynthetic process (GO:0046654)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)|phosphoribosylamine-glycine ligase activity (GO:0004637)|phosphoribosylformylglycinamidine cyclo-ligase activity (GO:0004641)|phosphoribosylglycinamide formyltransferase activity (GO:0004644)	p.K807fs*7(2)		NS(2)|breast(1)|endometrium(3)|large_intestine(3)|lung(13)|ovary(3)|prostate(5)|urinary_tract(1)	31					Pemetrexed(DB00642)	CACTCTGGCCTTTTTTTTTTC	0.448																																					p.K807R		Atlas-SNP	.											.,5	GART	81	.	2	Deletion - Frameshift(2)	ovary(2)	c.A2420G						.						66.0	70.0	68.0					21																	34882122		2203	4300	6503	SO:0001583	missense	2618	exon18			CTGGCCTTTTTTT	M32082	CCDS13627.1, CCDS13628.1	21q22.11	2012-10-02			ENSG00000159131	ENSG00000159131	2.1.2.2, 6.3.3.1, 6.3.4.13		4163	protein-coding gene	gene with protein product		138440		PRGS, PGFT		2050105	Standard	NM_001136005		Approved		uc002yrx.3	P22102	OTTHUMG00000065628	ENST00000381831.3:c.2420A>G	chr21.hg19:g.34882122T>C	ENSP00000371253:p.Lys807Arg	58.0	0.0		78.0	4.0	NM_001136005	A8K945|A8KA32|D3DSF3|D3DSF4|O14659|Q52M77	Missense_Mutation	SNP	ENST00000381831.3	hg19	CCDS13627.1	.	.	.	.	.	.	.	.	.	.	T	8.259	0.810646	0.16537	.	.	ENSG00000159131	ENST00000414353;ENST00000381815;ENST00000381831;ENST00000381839;ENST00000543717	T;T;T;T	0.46063	1.46;1.46;1.46;0.88	5.52	1.39	0.22231	.	0.269064	0.42420	N	0.000720	T	0.19927	0.0479	N	0.08118	0	0.42171	D	0.991646	B	0.09022	0.002	B	0.12156	0.007	T	0.05699	-1.0869	10	0.20046	T	0.44	-12.4071	9.947	0.41616	0.0:0.2362:0.0:0.7638	.	807	P22102	PUR2_HUMAN	R	71;807;807;807;359	ENSP00000371236:K807R;ENSP00000371253:K807R;ENSP00000371261:K807R;ENSP00000443579:K359R	ENSP00000371236:K807R	K	-	2	0	GART	33803992	1.000000	0.71417	0.803000	0.32268	0.561000	0.35649	1.563000	0.36364	0.393000	0.25203	0.482000	0.46254	AAG	.	.		0.448	GART-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000140626.3	NM_000819	
FAM3B	54097	hgsc.bcm.edu	37	21	42720630	42720630	+	Silent	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr21:42720630T>C	ENST00000357985.2	+	7	743	c.597T>C	c.(595-597)ccT>ccC	p.P199P	FAM3B_ENST00000398647.3_Silent_p.P151P|FAM3B_ENST00000479810.2_3'UTR|FAM3B_ENST00000398652.3_Silent_p.P238P|FAM3B_ENST00000398646.3_Silent_p.P222P	NM_058186.3	NP_478066.3	P58499	FAM3B_HUMAN	family with sequence similarity 3, member B	199					apoptotic process (GO:0006915)|insulin secretion (GO:0030073)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	cytokine activity (GO:0005125)			central_nervous_system(2)|endometrium(1)|lung(2)	5		Prostate(19;1.57e-07)|all_epithelial(19;0.0404)				TGGAACTCCCTTCCGAAATTC	0.423																																					p.P199P		Atlas-SNP	.											.	FAM3B	22	.	0			c.T597C						.						81.0	77.0	79.0					21																	42720630		2203	4300	6503	SO:0001819	synonymous_variant	54097	exon7			ACTCCCTTCCGAA	AF494379	CCDS13671.1, CCDS42930.1	21q22.3	2014-08-14	2002-05-23	2002-06-20	ENSG00000183844	ENSG00000183844			1253	protein-coding gene	gene with protein product	"""pancreatic-derived factor"""	608617	"""chromosome 21 open reading frame 11"""	C21orf11			Standard	NM_058186		Approved	D21M16SJHU19e, PRED44, 2-21, ORF9, C21orf76, PANDER	uc002yzb.1	P58499	OTTHUMG00000086752	ENST00000357985.2:c.597T>C	chr21.hg19:g.42720630T>C		150.0	0.0		96.0	4.0	NM_058186		Silent	SNP	ENST00000357985.2	hg19	CCDS13671.1																																																																																			.	.		0.423	FAM3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195142.1	NM_058186	
PKNOX1	5316	hgsc.bcm.edu	37	21	44441414	44441414	+	Splice_Site	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr21:44441414T>C	ENST00000291547.5	+	8	933	c.722T>C	c.(721-723)cTt>cCt	p.L241P	PKNOX1_ENST00000432907.2_Splice_Site_p.L124P	NM_004571.3	NP_004562.2	P55347	PKNX1_HUMAN	PBX/knotted 1 homeobox 1	241					angiogenesis (GO:0001525)|camera-type eye development (GO:0043010)|erythrocyte differentiation (GO:0030218)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|T cell differentiation (GO:0030217)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			cervix(3)|endometrium(3)|kidney(2)|large_intestine(3)|liver(1)|lung(8)|ovary(1)|prostate(1)	22						CTTTAAAAGCTTCAGTTACAG	0.418																																					p.L241P		Atlas-SNP	.											.	PKNOX1	40	.	0			c.T722C						.						50.0	48.0	49.0					21																	44441414		2203	4300	6503	SO:0001630	splice_region_variant	5316	exon8			AAAAGCTTCAGTT		CCDS13692.1, CCDS68211.1	21q22.3	2011-06-20			ENSG00000160199	ENSG00000160199		"""Homeoboxes / TALE class"""	9022	protein-coding gene	gene with protein product		602100				9479508	Standard	NM_001286258		Approved	PREP1	uc002zcq.1	P55347	OTTHUMG00000086833	ENST00000291547.5:c.721-1T>C	chr21.hg19:g.44441414T>C		100.0	0.0		100.0	4.0	NM_004571	O00528|Q8IWT7	Missense_Mutation	SNP	ENST00000291547.5	hg19	CCDS13692.1	.	.	.	.	.	.	.	.	.	.	T	18.15	3.560728	0.65538	.	.	ENSG00000160199	ENST00000291547;ENST00000432907	D;D	0.87729	-2.01;-2.29	5.59	5.59	0.84812	.	0.236840	0.33813	N	0.004528	D	0.90618	0.7058	L	0.48362	1.52	0.80722	D	1	D;D	0.71674	0.998;0.996	P;D	0.65874	0.897;0.939	D	0.90970	0.4819	10	0.52906	T	0.07	-12.3065	15.7594	0.78067	0.0:0.0:0.0:1.0	.	241;241	P55347;P55347-2	PKNX1_HUMAN;.	P	241;124	ENSP00000291547:L241P;ENSP00000402243:L124P	ENSP00000291547:L241P	L	+	2	0	PKNOX1	43314483	1.000000	0.71417	0.954000	0.39281	0.759000	0.43091	7.280000	0.78610	2.114000	0.64651	0.533000	0.62120	CTT	.	.		0.418	PKNOX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195520.3		Missense_Mutation
CARD10	29775	hgsc.bcm.edu	37	22	37902375	37902375	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr22:37902375C>A	ENST00000403299.1	-	8	1423	c.1207G>T	c.(1207-1209)Gac>Tac	p.D403Y	CARD10_ENST00000406271.3_Missense_Mutation_p.D117Y|CARD10_ENST00000251973.5_Missense_Mutation_p.D403Y|CARD10_ENST00000494166.1_5'Flank			Q9BWT7	CAR10_HUMAN	caspase recruitment domain family, member 10	403					activation of NF-kappaB-inducing kinase activity (GO:0007250)|protein complex assembly (GO:0006461)|regulation of apoptotic process (GO:0042981)	CBM complex (GO:0032449)|cytoplasm (GO:0005737)	receptor signaling complex scaffold activity (GO:0030159)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	17	Melanoma(58;0.0574)					TGGATCCGGTCACGGCTCTGG	0.622																																					p.D403Y		Atlas-SNP	.											.	CARD10	55	.	0			c.G1207T						.						54.0	50.0	52.0					22																	37902375		2203	4300	6503	SO:0001583	missense	29775	exon7			TCCGGTCACGGCT	AF086324	CCDS13948.1	22q13.1	2008-05-22			ENSG00000100065	ENSG00000100065			16422	protein-coding gene	gene with protein product		607209				11259443, 11356195	Standard	NM_014550		Approved	CARMA3, BIMP1	uc003asu.1	Q9BWT7	OTTHUMG00000150592	ENST00000403299.1:c.1207G>T	chr22.hg19:g.37902375C>A	ENSP00000384570:p.Asp403Tyr	207.0	0.0		230.0	68.0	NM_014550	Q14CQ8|Q5TFG6|Q8NC81|Q9UGR5|Q9UGR6|Q9Y3H0	Missense_Mutation	SNP	ENST00000403299.1	hg19	CCDS13948.1	.	.	.	.	.	.	.	.	.	.	C	21.1	4.095456	0.76870	.	.	ENSG00000100065	ENST00000403299;ENST00000406271;ENST00000251973;ENST00000437756	T;T;T;T	0.79033	-1.23;-1.23;-1.23;-1.16	5.31	4.29	0.51040	.	0.169713	0.50627	D	0.000119	D	0.86514	0.5951	M	0.73962	2.25	0.44092	D	0.996855	D;D	0.89917	1.0;1.0	D;D	0.97110	0.998;1.0	D	0.87541	0.2459	10	0.87932	D	0	-35.6918	12.0009	0.53230	0.0:0.9202:0.0:0.0798	.	403;117	Q9BWT7;Q8NC81	CAR10_HUMAN;.	Y	403;117;403;44	ENSP00000384570:D403Y;ENSP00000385799:D117Y;ENSP00000251973:D403Y;ENSP00000416239:D44Y	ENSP00000251973:D403Y	D	-	1	0	CARD10	36232321	0.999000	0.42202	0.862000	0.33874	0.993000	0.82548	4.295000	0.59049	1.235000	0.43724	0.561000	0.74099	GAC	.	.		0.622	CARD10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318997.1	NM_014550	
TRIOBP	11078	hgsc.bcm.edu	37	22	38119756	38119756	+	Missense_Mutation	SNP	A	A	G	rs71322688|rs67890459|rs201160789|rs77530465|rs55745992	byFrequency	TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr22:38119756A>G	ENST00000406386.3	+	7	1448	c.1193A>G	c.(1192-1194)cAa>cGa	p.Q398R		NM_001039141.2	NP_001034230.1	Q9H2D6	TARA_HUMAN	TRIO and F-actin binding protein	398					actin modification (GO:0030047)|barbed-end actin filament capping (GO:0051016)|mitotic nuclear division (GO:0007067)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	actin filament binding (GO:0051015)|GTP-Rho binding (GO:0017049)|myosin II binding (GO:0045159)|ubiquitin protein ligase binding (GO:0031625)	p.Q398R(1)		central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	12	Melanoma(58;0.0574)					AGAACCACTCAACGAGAGAAT	0.552																																					p.Q398R		Atlas-SNP	.											TRIOBP_ENST00000344404,NS,carcinoma,0,1	TRIOBP	262	.	1	Substitution - Missense(1)	lung(1)	c.A1193G						.						117.0	100.0	106.0					22																	38119756		1849	3515	5364	SO:0001583	missense	11078	exon7			CCACTCAACGAGA	AB051449	CCDS33644.1, CCDS43015.1, CCDS43016.1	22q13.1	2014-06-03			ENSG00000100106	ENSG00000100106		"""Pleckstrin homology (PH) domain containing"""	17009	protein-coding gene	gene with protein product		609761		DFNB28		11148140, 16385457, 16385458	Standard	NM_001039141		Approved	HRIHFB2122, KIAA1662, Tara, TAP68	uc003atr.3	Q9H2D6	OTTHUMG00000150657	ENST00000406386.3:c.1193A>G	chr22.hg19:g.38119756A>G	ENSP00000384312:p.Gln398Arg	1.0	0.0		13.0	8.0	NM_001039141	B1AHD4|B1AHD7|F2Z2W0|F8W6V6|O94797|Q2PZW8|Q2Q3Z9|Q2Q400|Q5R3M6|Q96DW1|Q9BT77|Q9BTL7|Q9BY98|Q9Y3L4	Missense_Mutation	SNP	ENST00000406386.3	hg19	CCDS43015.1	.	.	.	.	.	.	.	.	.	.	A	7.038	0.561918	0.13498	.	.	ENSG00000100106	ENST00000406386;ENST00000417174	T	0.33216	1.42	2.53	2.53	0.30540	.	.	.	.	.	T	0.27629	0.0679	L	0.44542	1.39	0.09310	N	0.99999	P	0.47604	0.898	P	0.47402	0.546	T	0.07578	-1.0765	9	0.21540	T	0.41	.	5.6825	0.17784	0.7186:0.2814:0.0:0.0	.	398	Q9H2D6	TARA_HUMAN	R	398	ENSP00000384312:Q398R	ENSP00000384312:Q398R	Q	+	2	0	TRIOBP	36449702	0.002000	0.14202	0.064000	0.19789	0.071000	0.16799	0.831000	0.27476	1.186000	0.42985	0.165000	0.16767	CAA	.	.		0.552	TRIOBP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000319439.2		
PRR5	55615	hgsc.bcm.edu	37	22	45110469	45110469	+	Splice_Site	SNP	A	A	G			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr22:45110469A>G	ENST00000336985.6	+	2	411		c.e2-1		ARHGAP8_ENST00000389773.5_Splice_Site|PRR5-ARHGAP8_ENST00000352766.7_Splice_Site|PRR5_ENST00000403581.1_Splice_Site|PRR5-ARHGAP8_ENST00000361473.5_Splice_Site|ARHGAP8_ENST00000517296.3_Splice_Site|PRR5_ENST00000477331.1_Splice_Site|PRR5_ENST00000006251.7_Splice_Site	NM_181333.3	NP_851850.1	P85299	PRR5_HUMAN	proline rich 5 (renal)						cell cycle (GO:0007049)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein phosphorylation (GO:0001934)	TORC2 complex (GO:0031932)				central_nervous_system(1)|endometrium(2)|lung(6)|prostate(1)|skin(1)	11		all_neural(38;0.00409)|Ovarian(80;0.024)|Glioma(61;0.0647)		UCEC - Uterine corpus endometrioid carcinoma (28;0.168)		CTCTGCCCCCAGCATCCACAA	0.632																																					.		Atlas-SNP	.											.	PRR5	75	.	0			c.108-2A>G						.						89.0	86.0	87.0					22																	45110469		2203	4300	6503	SO:0001630	splice_region_variant	55615	exon3			GCCCCCAGCATCC	AF177331	CCDS14058.1, CCDS14059.1, CCDS56232.1, CCDS74875.1	22q13.3	2011-02-10			ENSG00000186654	ENSG00000186654			31682	protein-coding gene	gene with protein product	"""protein observed with Rictor-1"""	609406				15718101, 17599906	Standard	NM_001017528		Approved	PP610, FLJ20185k, Protor-1		P85299	OTTHUMG00000150460	ENST00000336985.6:c.135-1A>G	chr22.hg19:g.45110469A>G		82.0	0.0		107.0	5.0	NM_001017528	B1AHF6|B1AHG5|B3KP73|O75983|O95695|Q5BIW2|Q5EAJ8|Q5EAJ9|Q5XKJ6|Q96RW1|Q96RW2|Q9HA49|Q9HC46|Q9NSG0|Q9NVX8|Q9NXL1|Q9UH20	Splice_Site	SNP	ENST00000336985.6	hg19	CCDS14058.1	.	.	.	.	.	.	.	.	.	.	a	13.43	2.234276	0.39498	.	.	ENSG00000186654;ENSG00000186654;ENSG00000186654;ENSG00000186654;ENSG00000186654;ENSG00000186654;ENSG00000248405;ENSG00000248405;ENSG00000241484;ENSG00000241484	ENST00000432186;ENST00000006251;ENST00000403581;ENST00000336985;ENST00000403696;ENST00000457960;ENST00000361473;ENST00000352766;ENST00000517296;ENST00000389773	.	.	.	4.06	4.06	0.47325	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.3195	0.54977	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	PRR5;PRR5-ARHGAP8;ARHGAP8	43489133	1.000000	0.71417	0.982000	0.44146	0.498000	0.33706	3.862000	0.56009	1.857000	0.53885	0.524000	0.50904	.	.	.		0.632	PRR5-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318200.2	NM_001017528	Intron
PLXNB2	23654	hgsc.bcm.edu	37	22	50720335	50720335	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr22:50720335T>C	ENST00000449103.1	-	20	3433	c.3293A>G	c.(3292-3294)gAg>gGg	p.E1098G	PLXNB2_ENST00000496720.1_5'Flank|PLXNB2_ENST00000359337.4_Missense_Mutation_p.E1098G			O15031	PLXB2_HUMAN	plexin B2	1098					brain development (GO:0007420)|neural tube closure (GO:0001843)|neuroblast proliferation (GO:0007405)|positive regulation of axonogenesis (GO:0050772)|regulation of cell shape (GO:0008360)|regulation of neuron migration (GO:2001222)|regulation of protein phosphorylation (GO:0001932)|regulation of Rho GTPase activity (GO:0032319)|semaphorin-plexin signaling pathway (GO:0071526)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)	GTPase activator activity (GO:0005096)|semaphorin receptor activity (GO:0017154)			breast(2)|central_nervous_system(4)|cervix(2)|endometrium(11)|kidney(4)|large_intestine(3)|liver(1)|lung(20)|ovary(5)|prostate(6)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	66		all_cancers(38;5.78e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)		TGTGAAGTTCTCAAAGGTGGG	0.642																																					p.E1098G		Atlas-SNP	.											.	PLXNB2	172	.	0			c.A3293G						.						51.0	59.0	56.0					22																	50720335		2052	4178	6230	SO:0001583	missense	23654	exon20			AAGTTCTCAAAGG		CCDS43035.1	22q13.33	2008-06-12			ENSG00000196576	ENSG00000196576		"""Plexins"""	9104	protein-coding gene	gene with protein product		604293				10520995, 12183458	Standard	NM_012401		Approved	MM1, KIAA0315, PLEXB2	uc003bkv.4	O15031	OTTHUMG00000150219	ENST00000449103.1:c.3293A>G	chr22.hg19:g.50720335T>C	ENSP00000409171:p.Glu1098Gly	38.0	0.0		39.0	4.0	NM_012401	A6QRH0|Q7KZU3|Q9BSU7	Missense_Mutation	SNP	ENST00000449103.1	hg19	CCDS43035.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	17.86|17.86	3.491591|3.491591	0.64074|0.64074	.|.	.|.	ENSG00000196576|ENSG00000196576	ENST00000449103;ENST00000359337|ENST00000427829	T;T|.	0.04119|.	3.7;3.7|.	4.63|4.63	4.63|4.63	0.57726|0.57726	.|.	0.644761|.	0.14308|.	N|.	0.327867|.	T|T	0.58337|0.58337	0.2115|0.2115	L|L	0.40543|0.40543	1.245|1.245	0.46096|0.46096	D|D	0.998869|0.998869	B|.	0.28439|.	0.212|.	B|.	0.27380|.	0.079|.	T|T	0.55866|0.55866	-0.8073|-0.8073	10|5	0.37606|.	T|.	0.19|.	.|.	14.1854|14.1854	0.65603|0.65603	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	1098|.	O15031|.	PLXB2_HUMAN|.	G|G	1098|116	ENSP00000409171:E1098G;ENSP00000352288:E1098G|.	ENSP00000352288:E1098G|.	E|R	-|-	2|1	0|2	PLXNB2|PLXNB2	49062462|49062462	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.819000|0.819000	0.46315|0.46315	5.101000|5.101000	0.64566|0.64566	1.950000|1.950000	0.56595|0.56595	0.260000|0.260000	0.18958|0.18958	GAG|AGA	.	.		0.642	PLXNB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316874.3	NM_012401	
ACOT9	23597	hgsc.bcm.edu	37	X	23726023	23726023	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chrX:23726023T>C	ENST00000336430.7	-	9	805	c.674A>G	c.(673-675)gAg>gGg	p.E225G	ACOT9_ENST00000492081.1_3'UTR|ACOT9_ENST00000379303.5_Missense_Mutation_p.E234G|ACOT9_ENST00000379295.1_Missense_Mutation_p.E165G	NM_001033583.2	NP_001028755.2	Q9Y305	ACOT9_HUMAN	acyl-CoA thioesterase 9	225					acyl-CoA metabolic process (GO:0006637)	mitochondrion (GO:0005739)	acetyl-CoA hydrolase activity (GO:0003986)|carboxylic ester hydrolase activity (GO:0052689)			breast(1)|kidney(1)|large_intestine(4)|lung(3)|ovary(4)|pancreas(1)|skin(1)	15						CTCCTCTTCCTCTGGGCTTTC	0.303																																					p.E234G		Atlas-SNP	.											.	ACOT9	33	.	0			c.A701G						.						31.0	29.0	29.0					X																	23726023		2203	4299	6502	SO:0001583	missense	23597	exon10			TCTTCCTCTGGGC	AF132950	CCDS35216.1, CCDS43924.1	Xp22.11	2008-02-05			ENSG00000123130	ENSG00000123130		"""Acyl CoA thioesterases"""	17152	protein-coding gene	gene with protein product		300862				10383425, 10810093, 16103133, 16940157	Standard	XM_005274471		Approved	CGI-16, MT-ACT48, ACATE2	uc004dao.3	Q9Y305	OTTHUMG00000021257	ENST00000336430.7:c.674A>G	chrX.hg19:g.23726023T>C	ENSP00000336580:p.Glu225Gly	80.0	0.0		79.0	4.0	NM_001037171	B3KNC9|B7ZM94	Missense_Mutation	SNP	ENST00000336430.7	hg19	CCDS35216.1	.	.	.	.	.	.	.	.	.	.	T	21.9	4.220404	0.79464	.	.	ENSG00000123130	ENST00000379303;ENST00000336430;ENST00000379295;ENST00000473710	T;T;T;T	0.35048	1.33;1.33;1.33;1.33	5.4	5.4	0.78164	.	0.044427	0.85682	D	0.000000	T	0.64327	0.2588	M	0.90705	3.14	0.80722	D	1	P;P;D	0.54772	0.954;0.947;0.968	P;P;P	0.61800	0.691;0.611;0.894	T	0.72697	-0.4215	10	0.66056	D	0.02	-19.281	14.4943	0.67674	0.0:0.0:0.0:1.0	.	192;225;234	Q9Y305-2;Q9Y305;Q9Y305-4	.;ACOT9_HUMAN;.	G	234;225;165;151	ENSP00000368605:E234G;ENSP00000336580:E225G;ENSP00000368597:E165G;ENSP00000420490:E151G	ENSP00000336580:E225G	E	-	2	0	ACOT9	23635944	1.000000	0.71417	0.871000	0.34182	0.782000	0.44232	5.477000	0.66799	1.803000	0.52742	0.381000	0.24937	GAG	.	.		0.303	ACOT9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056065.1	NM_012332	
MAGEB10	139422	hgsc.bcm.edu	37	X	27839847	27839847	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chrX:27839847A>G	ENST00000356790.2	+	3	669	c.424A>G	c.(424-426)Acc>Gcc	p.T142A		NM_182506.3	NP_872312.2	Q96LZ2	MAGBA_HUMAN	melanoma antigen family B, 10	142	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.									NS(1)|breast(2)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(12)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	26						GAGAAATGTAACCCAAATGTC	0.438																																					p.T142A		Atlas-SNP	.											.	MAGEB10	107	.	0			c.A424G						.						63.0	60.0	61.0					X																	27839847		2202	4300	6502	SO:0001583	missense	139422	exon3			AATGTAACCCAAA		CCDS35221.1	Xp21.3	2008-02-05			ENSG00000177689	ENSG00000177689			25377	protein-coding gene	gene with protein product		300761				11454705	Standard	NM_182506		Approved	FLJ32965	uc004dbw.3	Q96LZ2	OTTHUMG00000046084	ENST00000356790.2:c.424A>G	chrX.hg19:g.27839847A>G	ENSP00000368304:p.Thr142Ala	113.0	0.0		84.0	4.0	NM_182506	Q494Y6|Q494Y7|Q9BZ78	Missense_Mutation	SNP	ENST00000356790.2	hg19	CCDS35221.1	.	.	.	.	.	.	.	.	.	.	A	0.033	-1.324496	0.01309	.	.	ENSG00000177689	ENST00000356790	T	0.04551	3.6	2.62	0.0418	0.14214	.	0.757856	0.11792	U	0.529088	T	0.03739	0.0106	L	0.43923	1.385	0.09310	N	1	B	0.30973	0.302	B	0.33568	0.166	T	0.44128	-0.9348	10	0.08599	T	0.76	.	2.5435	0.04731	0.5407:0.2854:0.1739:0.0	.	142	Q96LZ2	MAGBA_HUMAN	A	142	ENSP00000368304:T142A	ENSP00000368304:T142A	T	+	1	0	MAGEB10	27749768	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.270000	0.08584	-0.080000	0.12685	0.345000	0.21793	ACC	.	.		0.438	MAGEB10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000106216.1	NM_182506	
USP9X	8239	hgsc.bcm.edu	37	X	41088999	41088999	+	Silent	SNP	A	A	G			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chrX:41088999A>G	ENST00000324545.8	+	43	8031	c.7398A>G	c.(7396-7398)acA>acG	p.T2466T	USP9X_ENST00000378308.2_Silent_p.T2466T	NM_001039590.2|NM_001039591.2	NP_001034679.2|NP_001034680.2	Q93008	USP9X_HUMAN	ubiquitin specific peptidase 9, X-linked	2466					axon extension (GO:0048675)|BMP signaling pathway (GO:0030509)|cerebellar cortex structural organization (GO:0021698)|chromosome segregation (GO:0007059)|female gamete generation (GO:0007292)|gene expression (GO:0010467)|hippocampus development (GO:0021766)|in utero embryonic development (GO:0001701)|mitotic nuclear division (GO:0007067)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron migration (GO:0001764)|post-embryonic development (GO:0009791)|protein deubiquitination (GO:0016579)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ubiquitin-dependent protein catabolic process (GO:0006511)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|growth cone (GO:0030426)|membrane (GO:0016020)	co-SMAD binding (GO:0070410)|cysteine-type endopeptidase activity (GO:0004197)|cysteine-type peptidase activity (GO:0008234)|ubiquitin thiolesterase activity (GO:0004221)			NS(3)|breast(6)|central_nervous_system(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(16)|lung(29)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	87						CTAGGATGACACTTGCAAAAG	0.413																																					p.T2466T	Ovarian(172;1807 2695 35459 49286)	Atlas-SNP	.											.	USP9X	385	.	0			c.A7398G						.						89.0	86.0	87.0					X																	41088999		2203	4300	6503	SO:0001819	synonymous_variant	8239	exon43			GATGACACTTGCA	X98296	CCDS43930.1, CCDS55403.1	Xp11.4	2010-08-03	2006-02-14		ENSG00000124486	ENSG00000124486		"""Ubiquitin-specific peptidases"""	12632	protein-coding gene	gene with protein product		300072	"""ubiquitin specific protease 9, X chromosome (fat facets-like Drosophila)"", ""ubiquitin specific protease 9, X-linked (fat facets-like, Drosophila)"", ""ubiquitin specific peptidase 9, X-linked (fat facets-like, Drosophila)"""			8922996	Standard	NM_001039590		Approved	DFFRX, FAF	uc004dfb.3	Q93008	OTTHUMG00000021367	ENST00000324545.8:c.7398A>G	chrX.hg19:g.41088999A>G		79.0	0.0		108.0	5.0	NM_001039591	O75550|Q8WWT3|Q8WX12	Silent	SNP	ENST00000324545.8	hg19	CCDS43930.1																																																																																			.	.		0.413	USP9X-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000056250.4	NM_004652	
ZNF41	7592	hgsc.bcm.edu	37	X	47307022	47307022	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chrX:47307022T>C	ENST00000377065.4	-	5	2786	c.2147A>G	c.(2146-2148)gAa>gGa	p.E716G	ZNF41_ENST00000397050.2_Missense_Mutation_p.E726G|ZNF41_ENST00000313116.7_Missense_Mutation_p.E716G|ZNF41_ENST00000465311.1_5'Flank	NM_153380.2	NP_700359.1	P51814	ZNF41_HUMAN	zinc finger protein 41	758					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|cervix(1)|endometrium(4)|large_intestine(5)|lung(8)|ovary(3)|upper_aerodigestive_tract(2)	24		all_lung(315;0.000129)				ATAGTGTCTTTCTCCAGTATG	0.408																																					p.E716G		Atlas-SNP	.											.	ZNF41	71	.	0			c.A2147G						.						131.0	115.0	120.0					X																	47307022		2203	4300	6503	SO:0001583	missense	7592	exon5			TGTCTTTCTCCAG	X60155	CCDS14279.1	Xp11.23	2013-01-08			ENSG00000147124	ENSG00000147124		"""Zinc fingers, C2H2-type"", ""-"""	13107	protein-coding gene	gene with protein product		314995				2037297	Standard	NM_007130		Approved	MGC8941, MRX89	uc004dhy.4	P51814	OTTHUMG00000021448	ENST00000377065.4:c.2147A>G	chrX.hg19:g.47307022T>C	ENSP00000366265:p.Glu716Gly	94.0	0.0		78.0	4.0	NM_007130	A8K1V6|B4DH01|Q96LE8|Q9UMC4|Q9UMV5|Q9UMV6|Q9UMV7|Q9UMV8|Q9UMV9|Q9UMW0|Q9UMW1	Missense_Mutation	SNP	ENST00000377065.4	hg19	CCDS14279.1	.	.	.	.	.	.	.	.	.	.	T	16.66	3.184257	0.57800	.	.	ENSG00000147124	ENST00000313116;ENST00000377065;ENST00000397050	T;T;T	0.27557	1.66;1.66;1.66	3.69	3.69	0.42338	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.35615	N	0.003096	T	0.54663	0.1872	M	0.82323	2.585	0.29809	N	0.831831	D;D;D;D;D	0.89917	1.0;1.0;0.999;1.0;1.0	D;D;D;D;D	0.81914	0.946;0.946;0.995;0.963;0.978	T	0.57039	-0.7879	10	0.87932	D	0	.	9.9233	0.41476	0.0:0.0:0.0:1.0	.	716;718;726;750;758	P51814-6;P51814-2;P51814-3;P51814-5;P51814	.;.;.;.;ZNF41_HUMAN	G	716;716;726	ENSP00000315173:E716G;ENSP00000366265:E716G;ENSP00000380243:E726G	ENSP00000315173:E716G	E	-	2	0	ZNF41	47191966	0.554000	0.26522	0.999000	0.59377	0.955000	0.61496	3.389000	0.52516	1.700000	0.51204	0.486000	0.48141	GAA	.	.		0.408	ZNF41-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056429.1	NM_153380	
ZNF630	57232	hgsc.bcm.edu	37	X	47919903	47919903	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chrX:47919903T>C	ENST00000409324.3	-	4	390	c.164A>G	c.(163-165)gAt>gGt	p.D55G	ZNF630_ENST00000442455.3_Missense_Mutation_p.D41G|ZNF630_ENST00000276054.4_5'UTR|ZNF630-AS1_ENST00000436124.1_RNA	NM_001037735.2	NP_001032824.2	Q2M218	ZN630_HUMAN	zinc finger protein 630	55	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(1)|large_intestine(6)|lung(11)|ovary(1)	19						AAAGATTACATCTGGTTTTAT	0.448																																					p.D55G		Atlas-SNP	.											.	ZNF630	71	.	0			c.A164G						.						176.0	134.0	147.0					X																	47919903		1559	3573	5132	SO:0001583	missense	57232	exon4			ATTACATCTGGTT	AK000580	CCDS35237.2, CCDS75971.1	Xp11.3-p11.1	2013-01-08			ENSG00000221994	ENSG00000221994		"""Zinc fingers, C2H2-type"", ""-"""	28855	protein-coding gene	gene with protein product		300819					Standard	NM_001037735		Approved	BC037316, dJ54B20.2, FLJ20573, MGC138344	uc004div.4	Q2M218	OTTHUMG00000021463	ENST00000409324.3:c.164A>G	chrX.hg19:g.47919903T>C	ENSP00000386393:p.Asp55Gly	22.0	0.0		27.0	21.0	NM_001037735	F8WAG4|Q5H8Z5	Missense_Mutation	SNP	ENST00000409324.3	hg19	CCDS35237.2	.	.	.	.	.	.	.	.	.	.	.	9.927	1.213667	0.22289	.	.	ENSG00000221994	ENST00000442455;ENST00000409324;ENST00000428686	T;T;T	0.00892	5.57;5.57;5.57	2.13	-4.27	0.03744	Krueppel-associated box (3);	.	.	.	.	T	0.01029	0.0034	L	0.54323	1.7	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.41448	-0.9508	9	0.45353	T	0.12	.	3.7256	0.08473	0.1795:0.3978:0.0:0.4227	.	55	Q2M218	ZN630_HUMAN	G	41;55;55	ENSP00000393163:D41G;ENSP00000386393:D55G;ENSP00000407278:D55G	ENSP00000386393:D55G	D	-	2	0	ZNF630	47804847	0.000000	0.05858	0.006000	0.13384	0.514000	0.34195	-0.324000	0.07986	-1.222000	0.02587	-0.451000	0.05528	GAT	.	.		0.448	ZNF630-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327254.1	NM_001037735	
AKAP4	8852	hgsc.bcm.edu	37	X	49958534	49958534	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chrX:49958534T>C	ENST00000376056.2	-	5	953	c.803A>G	c.(802-804)gAa>gGa	p.E268G	AKAP4_ENST00000376058.2_Intron|AKAP4_ENST00000481402.1_5'UTR|AKAP4_ENST00000358526.2_Missense_Mutation_p.E277G|AKAP4_ENST00000376064.3_Missense_Mutation_p.E268G					A kinase (PRKA) anchor protein 4											NS(2)|breast(3)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(6)|large_intestine(6)|lung(14)|ovary(1)|skin(4)	41	Ovarian(276;0.236)					TTCCACAGCTTCATAGGCCAT	0.488																																					p.E277G		Atlas-SNP	.											.	AKAP4	131	.	0			c.A830G						.						78.0	70.0	73.0					X																	49958534		2203	4300	6503	SO:0001583	missense	8852	exon5			ACAGCTTCATAGG	AF072756	CCDS14329.1, CCDS14330.1	Xp11.2	2009-03-12			ENSG00000147081	ENSG00000147081		"""A-kinase anchor proteins"""	374	protein-coding gene	gene with protein product	"""A-kinase anchor protein 82 kDa"", ""testis-specific gene HI"", ""protein kinase A anchoring protein 4"", ""cancer/testis antigen 99"""	300185				9822690, 9514854	Standard	NM_003886		Approved	p82, hAKAP82, AKAP82, Fsc1, HI, CT99	uc004dow.1	Q5JQC9	OTTHUMG00000021517	ENST00000376056.2:c.803A>G	chrX.hg19:g.49958534T>C	ENSP00000365224:p.Glu268Gly	46.0	0.0		65.0	4.0	NM_003886		Missense_Mutation	SNP	ENST00000376056.2	hg19	CCDS14330.1	.	.	.	.	.	.	.	.	.	.	T	3.704	-0.060975	0.07317	.	.	ENSG00000147081	ENST00000376056;ENST00000358526;ENST00000376064	T;T;T	0.14391	2.51;2.51;2.51	4.9	3.68	0.42216	A-kinase anchor 110kDa, C-terminal (1);	0.137867	0.32120	N	0.006554	T	0.11707	0.0285	L	0.55990	1.75	0.21064	N	0.999794	B	0.31413	0.322	B	0.26202	0.067	T	0.22312	-1.0220	9	.	.	.	-10.1688	6.8947	0.24249	0.2086:0.0:0.0:0.7914	.	277	Q5JQC9	AKAP4_HUMAN	G	268;277;268	ENSP00000365224:E268G;ENSP00000351327:E277G;ENSP00000365232:E268G	.	E	-	2	0	AKAP4	49845274	0.861000	0.29849	0.091000	0.20842	0.078000	0.17371	2.080000	0.41586	0.496000	0.27904	0.242000	0.17961	GAA	.	.		0.488	AKAP4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056552.1	NM_003886	
HUWE1	10075	hgsc.bcm.edu	37	X	53565344	53565344	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chrX:53565344C>T	ENST00000342160.3	-	76	12407	c.11950G>A	c.(11950-11952)Gtc>Atc	p.V3984I	HUWE1_ENST00000262854.6_Missense_Mutation_p.V3984I			Q7Z6Z7	HUWE1_HUMAN	HECT, UBA and WWE domain containing 1, E3 ubiquitin protein ligase	3984					base-excision repair (GO:0006284)|cell differentiation (GO:0030154)|histone ubiquitination (GO:0016574)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)			NS(1)|breast(15)|central_nervous_system(1)|cervix(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|liver(2)|lung(52)|ovary(11)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	153						TCTACCAGGACAGCAAAAGGC	0.522																																					p.V3984I		Atlas-SNP	.											.	HUWE1	724	.	0			c.G11950A						.						174.0	105.0	128.0					X																	53565344		2203	4300	6503	SO:0001583	missense	10075	exon77			CCAGGACAGCAAA	AB071605	CCDS35301.1	Xp11.22	2014-06-09	2012-02-23		ENSG00000086758	ENSG00000086758			30892	protein-coding gene	gene with protein product		300697	"""HECT, UBA and WWE domain containing 1"""			9205841, 10998601	Standard	NM_031407		Approved	Ib772, KIAA0312, UREB1	uc004dsp.4	Q7Z6Z7	OTTHUMG00000021617	ENST00000342160.3:c.11950G>A	chrX.hg19:g.53565344C>T	ENSP00000340648:p.Val3984Ile	92.0	0.0		85.0	4.0	NM_031407	O15029|Q4G2Z2|Q5H961|Q6P4D0|Q8NG67|Q9BUI0|Q9HCJ4|Q9NSL6|Q9P0A9	Missense_Mutation	SNP	ENST00000342160.3	hg19	CCDS35301.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	17.57|17.57	3.422409|3.422409	0.62622|0.62622	.|.	.|.	ENSG00000086758|ENSG00000086758	ENST00000427052;ENST00000426907|ENST00000342160;ENST00000262854	.|T;T	.|0.38240	.|1.15;1.15	5.42|5.42	5.42|5.42	0.78866|0.78866	.|.	.|0.244896	.|0.33075	.|N	.|0.005303	T|T	0.44350|0.44350	0.1289|0.1289	N|N	0.20807|0.20807	0.61|0.61	0.80722|0.80722	D|D	1|1	.|P;P;D	.|0.61697	.|0.859;0.841;0.99	.|B;P;D	.|0.70935	.|0.259;0.785;0.971	T|T	0.30504|0.30504	-0.9976|-0.9976	5|10	.|0.25751	.|T	.|0.34	.|.	16.9563|16.9563	0.86260|0.86260	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|806;3984;3968	.|Q5H935;Q7Z6Z7;Q7Z6Z7-2	.|.;HUWE1_HUMAN;.	Y|I	3017;806|3984	.|ENSP00000340648:V3984I;ENSP00000262854:V3984I	.|ENSP00000262854:V3984I	C|V	-|-	2|1	0|0	HUWE1|HUWE1	53582069|53582069	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.990000|0.990000	0.78478|0.78478	7.044000|7.044000	0.76578|0.76578	2.267000|2.267000	0.75376|0.75376	0.529000|0.529000	0.55759|0.55759	TGT|GTC	.	.		0.522	HUWE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056766.1	XM_497119	
FAM120C	54954	hgsc.bcm.edu	37	X	54162988	54162988	+	Silent	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chrX:54162988T>C	ENST00000375180.2	-	5	1250	c.1194A>G	c.(1192-1194)aaA>aaG	p.K398K	FAM120C_ENST00000328235.4_Silent_p.K398K	NM_017848.4	NP_060318.3	Q9NX05	F120C_HUMAN	family with sequence similarity 120C	398							poly(A) RNA binding (GO:0044822)			breast(3)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(9)|ovary(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	28						ACTCAACTGCTTTCTTGAATC	0.408																																					p.K398K		Atlas-SNP	.											.	FAM120C	89	.	0			c.A1194G						.						306.0	255.0	272.0					X																	54162988		2203	4300	6503	SO:0001819	synonymous_variant	54954	exon5			AACTGCTTTCTTG	AY150025	CCDS14356.1, CCDS55421.1, CCDS75987.1	Xp11.22	2011-04-13	2006-07-04	2006-07-04	ENSG00000184083	ENSG00000184083			16949	protein-coding gene	gene with protein product		300741	"""chromosome X open reading frame 17"""	CXorf17		14585507	Standard	XM_006724589		Approved	ORF34, FLJ20506	uc004dsz.4	Q9NX05	OTTHUMG00000021625	ENST00000375180.2:c.1194A>G	chrX.hg19:g.54162988T>C		76.0	0.0		75.0	4.0	NM_017848	B2RMT7	Silent	SNP	ENST00000375180.2	hg19	CCDS14356.1																																																																																			.	.		0.408	FAM120C-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000056795.2	NM_017848	
LAS1L	81887	hgsc.bcm.edu	37	X	64754435	64754435	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chrX:64754435A>G	ENST00000374811.3	-	1	201	c.161T>C	c.(160-162)gTg>gCg	p.V54A	LAS1L_ENST00000374804.5_Missense_Mutation_p.V54A|LAS1L_ENST00000374807.5_Missense_Mutation_p.V54A|LAS1L_ENST00000312391.8_Missense_Mutation_p.V54A	NM_031206.4	NP_112483.1	Q9Y4W2	LAS1L_HUMAN	LAS1-like (S. cerevisiae)	54					rRNA processing (GO:0006364)	cytoplasm (GO:0005737)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|MLL1 complex (GO:0071339)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(4)|endometrium(3)|kidney(1)|large_intestine(4)|lung(13)|ovary(4)|prostate(1)|skin(2)|urinary_tract(1)	33						ATAAACCGTCACCTGGTCCCA	0.597																																					p.V54A		Atlas-SNP	.											.	LAS1L	72	.	0			c.T161C						.						112.0	72.0	86.0					X																	64754435		2203	4300	6503	SO:0001583	missense	81887	exon1			ACCGTCACCTGGT	BC014545	CCDS14381.1, CCDS55433.1, CCDS55434.1	Xq12	2008-02-05			ENSG00000001497	ENSG00000001497			25726	protein-coding gene	gene with protein product						12477932	Standard	NM_031206		Approved	FLJ12525	uc004dwa.2	Q9Y4W2	OTTHUMG00000021720	ENST00000374811.3:c.161T>C	chrX.hg19:g.64754435A>G	ENSP00000363944:p.Val54Ala	73.0	0.0		74.0	4.0	NM_031206	A9X410|Q5JXQ0|Q8TEN5|Q9H9V5	Missense_Mutation	SNP	ENST00000374811.3	hg19	CCDS14381.1	.	.	.	.	.	.	.	.	.	.	a	19.91	3.914181	0.72983	.	.	ENSG00000001497	ENST00000374807;ENST00000374811;ENST00000374804;ENST00000312391	.	.	.	5.15	5.15	0.70609	.	0.000000	0.85682	D	0.000000	T	0.77691	0.4168	M	0.78285	2.405	0.45777	D	0.998665	D;D;P	0.76494	0.999;0.957;0.939	D;P;D	0.80764	0.994;0.895;0.958	T	0.80115	-0.1517	9	0.62326	D	0.03	.	11.7215	0.51685	1.0:0.0:0.0:0.0	.	54;54;54	Q9Y4W2-3;Q9Y4W2-2;Q9Y4W2	.;.;LAS1L_HUMAN	A	54	.	ENSP00000308649:V54A	V	-	2	0	LAS1L	64671160	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.451000	0.60047	1.896000	0.54893	0.486000	0.48141	GTG	.	.		0.597	LAS1L-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000056974.1	NM_031206	
YIPF6	286451	hgsc.bcm.edu	37	X	67731743	67731743	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chrX:67731743A>G	ENST00000462683.1	+	2	854	c.110A>G	c.(109-111)gAa>gGa	p.E37G	YIPF6_ENST00000374622.2_Intron|YIPF6_ENST00000470730.1_3'UTR	NM_173834.3	NP_776195.2	Q96EC8	YIPF6_HUMAN	Yip1 domain family, member 6	37					intestinal epithelial cell development (GO:0060576)	cis-Golgi network (GO:0005801)|endoplasmic reticulum (GO:0005783)|ER to Golgi transport vesicle (GO:0030134)|integral component of membrane (GO:0016021)|trans-Golgi network (GO:0005802)				cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(1)|urinary_tract(1)	7						GTAGAAGGAGAAATCACCATT	0.423																																					p.E37G		Atlas-SNP	.											.	YIPF6	27	.	0			c.A110G						.						170.0	149.0	156.0					X																	67731743		2203	4300	6503	SO:0001583	missense	286451	exon2			AAGGAGAAATCAC	BC012469	CCDS14389.1, CCDS56604.1	Xq13.1	2008-02-05			ENSG00000181704	ENSG00000181704		"""Yip1 domain family"""	28304	protein-coding gene	gene with protein product						12477932	Standard	NM_173834		Approved	MGC21416, FinGER6	uc004dwz.3	Q96EC8	OTTHUMG00000021745	ENST00000462683.1:c.110A>G	chrX.hg19:g.67731743A>G	ENSP00000417573:p.Glu37Gly	47.0	0.0		50.0	4.0	NM_173834	B4E1U7|G5E997|Q5JP08	Missense_Mutation	SNP	ENST00000462683.1	hg19	CCDS14389.1	.	.	.	.	.	.	.	.	.	.	A	17.64	3.440731	0.63067	.	.	ENSG00000181704	ENST00000462683	T	0.47528	0.84	5.66	5.66	0.87406	.	0.048265	0.85682	D	0.000000	T	0.41166	0.1147	L	0.54323	1.7	0.80722	D	1	P	0.36683	0.565	B	0.32980	0.156	T	0.27773	-1.0064	10	0.23891	T	0.37	-18.4373	12.7643	0.57383	1.0:0.0:0.0:0.0	.	37	Q96EC8	YIPF6_HUMAN	G	37	ENSP00000417573:E37G	ENSP00000417573:E37G	E	+	2	0	YIPF6	67648468	1.000000	0.71417	1.000000	0.80357	0.866000	0.49608	7.102000	0.77005	1.921000	0.55644	0.427000	0.28365	GAA	.	.		0.423	YIPF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057016.1	NM_173834	
STARD8	9754	hgsc.bcm.edu	37	X	67937131	67937131	+	Silent	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chrX:67937131T>C	ENST00000252336.6	+	5	507	c.135T>C	c.(133-135)tcT>tcC	p.S45S	STARD8_ENST00000374599.3_Silent_p.S125S|STARD8_ENST00000374597.3_Silent_p.S45S	NM_014725.4	NP_055540.2	Q92502	STAR8_HUMAN	StAR-related lipid transfer (START) domain containing 8	45					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell junction (GO:0030054)|cytosol (GO:0005829)	GTPase activator activity (GO:0005096)|lipid binding (GO:0008289)			NS(2)|breast(5)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(25)|ovary(3)|pancreas(1)|prostate(2)|skin(3)|urinary_tract(2)	50						AGTGCTGGTCTCCTATGGGGT	0.577																																					p.S125S		Atlas-SNP	.											.	STARD8	282	.	0			c.T375C						.						72.0	42.0	52.0					X																	67937131		2203	4300	6503	SO:0001819	synonymous_variant	9754	exon6			CTGGTCTCCTATG	D80011	CCDS14390.1, CCDS48134.1	Xq13.1	2011-09-13	2007-08-16		ENSG00000130052	ENSG00000130052		"""Rho GTPase activating proteins"", ""StAR-related lipid transfer (START) domain containing"""	19161	protein-coding gene	gene with protein product		300689	"""START domain containing 8"""			8724849	Standard	NM_001142504		Approved	KIAA0189, ARHGAP38	uc004dxb.3	Q92502	OTTHUMG00000021748	ENST00000252336.6:c.135T>C	chrX.hg19:g.67937131T>C		96.0	0.0		78.0	4.0	NM_001142503	A8K6T2|D3DVT9|Q5JST0|Q68DG7	Silent	SNP	ENST00000252336.6	hg19	CCDS14390.1																																																																																			.	.		0.577	STARD8-201	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000057026.2	NM_014725	
MED12	9968	hgsc.bcm.edu	37	X	70357194	70357194	+	Silent	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chrX:70357194T>C	ENST00000374080.3	+	39	5741	c.5709T>C	c.(5707-5709)ccT>ccC	p.P1903P	MED12_ENST00000333646.6_Silent_p.P1903P|MED12_ENST00000374102.1_Silent_p.P1903P			Q93074	MED12_HUMAN	mediator complex subunit 12	1903	Gln-rich.|Interaction with CTNNB1 and GLI3.				androgen receptor signaling pathway (GO:0030521)|axis elongation involved in somitogenesis (GO:0090245)|canonical Wnt signaling pathway (GO:0060070)|gene expression (GO:0010467)|heart development (GO:0007507)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|negative regulation of Wnt signaling pathway (GO:0030178)|neural tube closure (GO:0001843)|oligodendrocyte development (GO:0014003)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|Schwann cell development (GO:0014044)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)|Wnt signaling pathway, planar cell polarity pathway (GO:0060071)	mediator complex (GO:0016592)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|protein C-terminus binding (GO:0008022)|protein domain specific binding (GO:0019904)|receptor activity (GO:0004872)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II transcription cofactor activity (GO:0001104)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)			breast(6)|central_nervous_system(2)|endometrium(22)|kidney(5)|large_intestine(8)|lung(31)|ovary(2)|pancreas(1)|prostate(11)|skin(5)|soft_tissue(323)|upper_aerodigestive_tract(1)|urinary_tract(3)	420	Renal(35;0.156)					AGCAGCAACCTGCGGTGCCCC	0.592			"""M, S"""		uterine leiomyoma		Opitz-Kaveggia Syndrome																														p.P1903P		Atlas-SNP	.		Dom	yes		X	Xq13	9968	mediator complex subunit 12	Yes	M	.	MED12	984	.	0			c.T5709C						.						38.0	36.0	37.0					X																	70357194		1947	4117	6064	SO:0001819	synonymous_variant	9968	exon39			GCAACCTGCGGTG	U80742	CCDS43970.1	Xq13	2011-02-14	2007-07-30	2004-11-26	ENSG00000184634	ENSG00000184634			11957	protein-coding gene	gene with protein product		300188	"""trinucleotide repeat containing 11 (THR-associated protein, 230kDa subunit)"", ""mediator of RNA polymerase II transcription, subunit 12 homolog (S. cerevisiae)"", ""FG syndrome 1"""	TNRC11, FGS1		9225980, 10198638, 17334363, 20507344	Standard	NM_005120		Approved	CAGH45, HOPA, OPA1, TRAP230, KIAA0192, OKS	uc004dyy.3	Q93074	OTTHUMG00000021788	ENST00000374080.3:c.5709T>C	chrX.hg19:g.70357194T>C		83.0	0.0		86.0	4.0	NM_005120	O15410|O75557|Q9UHV6|Q9UND7	Silent	SNP	ENST00000374080.3	hg19	CCDS43970.1	.	.	.	.	.	.	.	.	.	.	-	5.226	0.227107	0.09916	.	.	ENSG00000184634	ENST00000444034	.	.	.	4.85	0.931	0.19460	.	.	.	.	.	T	0.41511	0.1162	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.21314	-1.0249	4	.	.	.	-12.3723	0.8819	0.01236	0.1563:0.1912:0.1584:0.4941	.	.	.	.	P	124	.	.	L	+	2	0	MED12	70273919	0.148000	0.22702	0.624000	0.29186	0.827000	0.46813	-0.193000	0.09573	-0.107000	0.12088	0.427000	0.28365	CTG	.	.		0.592	MED12-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000057105.1	NM_005120	
Unknown	0	hgsc.bcm.edu	37	X	71379912	71379912	+	IGR	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chrX:71379912T>C								BX119917.1 (7648 upstream) : PIN4 (21613 downstream)														p.V78A(1)									GTCGATAGTGTCATGAATCAT	0.433																																					p.V78A		Atlas-SNP	.											.	FLJ44635	13	.	1	Substitution - Missense(1)	large_intestine(1)	c.T233C						.						96.0	80.0	86.0					X																	71379912		2203	4300	6503	SO:0001628	intergenic_variant	0	exon2			ATAGTGTCATGAA																													chrX.hg19:g.71379912T>C		88.0	0.0		99.0	4.0	NM_207422		Missense_Mutation	SNP		hg19																																																																																				.	.	0	0.433								
GPRASP1	9737	hgsc.bcm.edu	37	X	101909698	101909698	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chrX:101909698G>T	ENST00000361600.5	+	5	1658	c.857G>T	c.(856-858)aGg>aTg	p.R286M	RP4-769N13.7_ENST00000602441.1_RNA|GPRASP1_ENST00000415986.1_Missense_Mutation_p.R286M|GPRASP1_ENST00000537097.1_Missense_Mutation_p.R286M|GPRASP1_ENST00000444152.1_Missense_Mutation_p.R286M	NM_014710.4	NP_055525.3	Q5JY77	GASP1_HUMAN	G protein-coupled receptor associated sorting protein 1	286					endosome to lysosome transport (GO:0008333)|G-protein coupled receptor catabolic process (GO:1990172)	cytoplasm (GO:0005737)				NS(1)|breast(3)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(10)|lung(29)|ovary(2)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	60						TCCAGGTTTAGGTCTAAGAAA	0.488																																					p.R286M		Atlas-SNP	.											.	GPRASP1	140	.	0			c.G857T						.						111.0	110.0	111.0					X																	101909698		2203	4300	6503	SO:0001583	missense	9737	exon3			GGTTTAGGTCTAA	AB007903	CCDS35352.1	Xq22.1	2014-03-21			ENSG00000198932	ENSG00000198932		"""Armadillo repeat containing"""	24834	protein-coding gene	gene with protein product		300417				9455477, 15086532, 16221301	Standard	NM_014710		Approved	GASP, GASP1	uc010nod.3	Q5JY77	OTTHUMG00000022061	ENST00000361600.5:c.857G>T	chrX.hg19:g.101909698G>T	ENSP00000355146:p.Arg286Met	76.0	0.0		80.0	66.0	NM_001099411	O43168|Q96LA1	Missense_Mutation	SNP	ENST00000361600.5	hg19	CCDS35352.1	.	.	.	.	.	.	.	.	.	.	G	9.348	1.064649	0.20067	.	.	ENSG00000198932	ENST00000415986;ENST00000444152;ENST00000361600;ENST00000537097	T;T;T;T	0.23950	1.88;1.88;1.88;1.88	1.95	-0.111	0.13576	.	.	.	.	.	T	0.28532	0.0706	L	0.59436	1.845	0.09310	N	1	P	0.49090	0.919	P	0.49561	0.615	T	0.13575	-1.0504	9	0.48119	T	0.1	-2.244	4.3479	0.11141	0.166:0.2325:0.6015:0.0	.	286	Q5JY77	GASP1_HUMAN	M	286	ENSP00000393691:R286M;ENSP00000409420:R286M;ENSP00000355146:R286M;ENSP00000445683:R286M	ENSP00000355146:R286M	R	+	2	0	GPRASP1	101796354	0.104000	0.21937	0.002000	0.10522	0.241000	0.25554	1.971000	0.40530	-0.116000	0.11893	0.279000	0.19357	AGG	.	.		0.488	GPRASP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057634.2	NM_014710	
GPRASP1	9737	hgsc.bcm.edu	37	X	101912553	101912553	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chrX:101912553T>C	ENST00000361600.5	+	5	4513	c.3712T>C	c.(3712-3714)Tgt>Cgt	p.C1238R	RP4-769N13.7_ENST00000602441.1_RNA|GPRASP1_ENST00000415986.1_Missense_Mutation_p.C1238R|GPRASP1_ENST00000537097.1_Missense_Mutation_p.C1238R|GPRASP1_ENST00000444152.1_Missense_Mutation_p.C1238R	NM_014710.4	NP_055525.3	Q5JY77	GASP1_HUMAN	G protein-coupled receptor associated sorting protein 1	1238	OPRD1-binding.				endosome to lysosome transport (GO:0008333)|G-protein coupled receptor catabolic process (GO:1990172)	cytoplasm (GO:0005737)				NS(1)|breast(3)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(10)|lung(29)|ovary(2)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	60						GACATACATATGTAAAGTGTG	0.408																																					p.C1238R		Atlas-SNP	.											.	GPRASP1	140	.	0			c.T3712C						.						93.0	85.0	88.0					X																	101912553		2203	4300	6503	SO:0001583	missense	9737	exon3			TACATATGTAAAG	AB007903	CCDS35352.1	Xq22.1	2014-03-21			ENSG00000198932	ENSG00000198932		"""Armadillo repeat containing"""	24834	protein-coding gene	gene with protein product		300417				9455477, 15086532, 16221301	Standard	NM_014710		Approved	GASP, GASP1	uc010nod.3	Q5JY77	OTTHUMG00000022061	ENST00000361600.5:c.3712T>C	chrX.hg19:g.101912553T>C	ENSP00000355146:p.Cys1238Arg	57.0	0.0		76.0	4.0	NM_001099411	O43168|Q96LA1	Missense_Mutation	SNP	ENST00000361600.5	hg19	CCDS35352.1	.	.	.	.	.	.	.	.	.	.	T	8.852	0.944939	0.18356	.	.	ENSG00000198932	ENST00000415986;ENST00000444152;ENST00000361600;ENST00000537097	T;T;T;T	0.28666	1.6;1.6;1.6;1.6	2.58	2.58	0.30949	Armadillo-like helical (1);Armadillo-type fold (1);	.	.	.	.	T	0.45657	0.1353	M	0.63428	1.95	0.42123	D	0.991436	D	0.89917	1.0	D	0.91635	0.999	T	0.35649	-0.9780	9	0.40728	T	0.16	-4.7672	6.2679	0.20939	0.0:0.0:0.0:1.0	.	1238	Q5JY77	GASP1_HUMAN	R	1238	ENSP00000393691:C1238R;ENSP00000409420:C1238R;ENSP00000355146:C1238R;ENSP00000445683:C1238R	ENSP00000355146:C1238R	C	+	1	0	GPRASP1	101799209	0.988000	0.35896	0.823000	0.32752	0.747000	0.42532	2.952000	0.49097	1.274000	0.44362	0.376000	0.23039	TGT	.	.		0.408	GPRASP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057634.2	NM_014710	
IL1RAPL2	26280	hgsc.bcm.edu	37	X	104478544	104478544	+	Silent	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chrX:104478544T>C	ENST00000372582.1	+	4	1155	c.399T>C	c.(397-399)gtT>gtC	p.V133V	IL1RAPL2_ENST00000344799.4_Silent_p.V133V	NM_017416.1	NP_059112.1	Q9NP60	IRPL2_HUMAN	interleukin 1 receptor accessory protein-like 2	133					central nervous system development (GO:0007417)|cytokine-mediated signaling pathway (GO:0019221)	integral component of membrane (GO:0016021)	interleukin-1 receptor activity (GO:0004908)|interleukin-1, Type II, blocking receptor activity (GO:0004910)			breast(3)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(14)|lung(23)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	49						CCTTGACTGTTGCAGAGAATG	0.398																																					p.V133V		Atlas-SNP	.											.	IL1RAPL2	105	.	0			c.T399C						.						134.0	127.0	129.0					X																	104478544		2203	4299	6502	SO:0001819	synonymous_variant	26280	exon4			GACTGTTGCAGAG	AF181285	CCDS14517.1	Xq22	2013-01-11			ENSG00000189108	ENSG00000189108		"""Interleukins and interleukin receptors"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5997	protein-coding gene	gene with protein product		300277				10757639	Standard	NM_017416		Approved	IL-1R9, TIGIRR-1, IL1RAPL-2, IL1R9	uc004elz.1	Q9NP60	OTTHUMG00000022141	ENST00000372582.1:c.399T>C	chrX.hg19:g.104478544T>C		64.0	0.0		66.0	4.0	NM_017416	Q2M3U3|Q9NZN0	Silent	SNP	ENST00000372582.1	hg19	CCDS14517.1																																																																																			.	.		0.398	IL1RAPL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057785.1	NM_017416	
SOWAHD	347454	hgsc.bcm.edu	37	X	118893082	118893082	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chrX:118893082T>C	ENST00000343905.3	+	1	507	c.452T>C	c.(451-453)gTt>gCt	p.V151A		NM_001105576.2	NP_001099046.1	A6NJG2	SWAHD_HUMAN	sosondowah ankyrin repeat domain family member D	151																	GGCTACTCGGTTCTGCACTGG	0.692																																					p.V151A		Atlas-SNP	.											.	.	.	.	0			c.T452C						.						5.0	7.0	6.0					X																	118893082		1993	4028	6021	SO:0001583	missense	347454	exon1			ACTCGGTTCTGCA		CCDS43984.1	Xq24	2013-01-10	2012-01-12	2012-01-12	ENSG00000187808	ENSG00000187808		"""Ankyrin repeat domain containing"""	32960	protein-coding gene	gene with protein product			"""ankyrin repeat domain 58"""	ANKRD58		22234889	Standard	NM_001105576		Approved		uc010nql.3	A6NJG2	OTTHUMG00000159606	ENST00000343905.3:c.452T>C	chrX.hg19:g.118893082T>C	ENSP00000340975:p.Val151Ala	26.0	0.0		54.0	4.0	NM_001105576		Missense_Mutation	SNP	ENST00000343905.3	hg19	CCDS43984.1	.	.	.	.	.	.	.	.	.	.	T	7.913	0.736951	0.15574	.	.	ENSG00000187808	ENST00000343905	T	0.60040	0.22	3.96	2.78	0.32641	Ankyrin repeat-containing domain (4);	.	.	.	.	T	0.24890	0.0604	N	0.02842	-0.48	0.24460	N	0.99445	B	0.21071	0.051	B	0.21917	0.037	T	0.34950	-0.9808	9	0.02654	T	1	-11.1899	5.0882	0.14694	0.0:0.2252:0.0:0.7748	.	151	A6NJG2	ANR58_HUMAN	A	151	ENSP00000340975:V151A	ENSP00000340975:V151A	V	+	2	0	ANKRD58	118777110	0.023000	0.18921	0.982000	0.44146	0.884000	0.51177	0.475000	0.22164	1.466000	0.48025	0.153000	0.16174	GTT	.	.		0.692	SOWAHD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356469.1	NM_001105576	
NKAP	79576	hgsc.bcm.edu	37	X	119068493	119068493	+	Missense_Mutation	SNP	T	T	C	rs199876887		TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chrX:119068493T>C	ENST00000371410.3	-	5	867	c.701A>G	c.(700-702)aAa>aGa	p.K234R	NKAP_ENST00000477789.1_5'UTR	NM_024528.3	NP_078804.2	Q8N5F7	NKAP_HUMAN	NFKB activating protein	234	Lys-rich.|Necessary for interaction with CIR1.				granulocyte differentiation (GO:0030851)|hematopoietic stem cell proliferation (GO:0071425)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|positive regulation of alpha-beta T cell differentiation (GO:0046638)|stem cell maintenance (GO:0019827)|T cell differentiation in thymus (GO:0033077)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|chromatin DNA binding (GO:0031490)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(1)|lung(4)|ovary(2)|prostate(1)	20						TTTCTTGGCTTTCTTTGCTCT	0.249																																					p.K234R		Atlas-SNP	.											.	NKAP	53	.	0			c.A701G						.						78.0	78.0	78.0					X																	119068493		2203	4297	6500	SO:0001583	missense	79576	exon5			TTGGCTTTCTTTG	BC012770	CCDS14592.1	Xq24	2010-07-20			ENSG00000101882	ENSG00000101882			29873	protein-coding gene	gene with protein product	"""NF kappaB activating protein"""	300766				14550261	Standard	NM_024528		Approved	FLJ22626	uc004esh.3	Q8N5F7	OTTHUMG00000022284	ENST00000371410.3:c.701A>G	chrX.hg19:g.119068493T>C	ENSP00000360464:p.Lys234Arg	96.0	0.0		97.0	4.0	NM_024528	Q6IPW6|Q96BQ2|Q9H638	Missense_Mutation	SNP	ENST00000371410.3	hg19	CCDS14592.1	.	.	.	.	.	.	.	.	.	.	T	9.027	0.986423	0.18889	.	.	ENSG00000101882	ENST00000371410	T	0.17854	2.25	3.98	3.98	0.46160	.	0.282570	0.38548	N	0.001660	T	0.37046	0.0989	M	0.69823	2.125	0.38612	D	0.950922	D;D	0.67145	0.993;0.996	D;D	0.73708	0.956;0.981	T	0.24512	-1.0158	10	0.35671	T	0.21	-13.9031	11.5561	0.50748	0.0:0.0:0.0:1.0	.	234;234	Q8N5F7;A0PJ73	NKAP_HUMAN;.	R	234	ENSP00000360464:K234R	ENSP00000360464:K234R	K	-	2	0	NKAP	118952521	1.000000	0.71417	0.899000	0.35326	0.018000	0.09664	3.996000	0.57009	1.556000	0.49512	0.441000	0.28932	AAA	.	.		0.249	NKAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058072.1	NM_024528	
XIAP	331	hgsc.bcm.edu	37	X	123020184	123020184	+	Silent	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chrX:123020184T>C	ENST00000371199.3	+	2	971	c.672T>C	c.(670-672)ttT>ttC	p.F224F	XIAP_ENST00000355640.3_Silent_p.F224F|XIAP_ENST00000468691.1_Intron|XIAP_ENST00000434753.3_Silent_p.F224F	NM_001167.3	NP_001158.2	P98170	XIAP_HUMAN	X-linked inhibitor of apoptosis	224					apoptotic process (GO:0006915)|cellular response to DNA damage stimulus (GO:0006974)|copper ion homeostasis (GO:0055070)|inhibition of cysteine-type endopeptidase activity involved in apoptotic process (GO:1990001)|intrinsic apoptotic signaling pathway (GO:0097193)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of neuron apoptotic process (GO:0043524)|neuron apoptotic process (GO:0051402)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of protein linear polyubiquitination (GO:1902530)|positive regulation of protein ubiquitination (GO:0031398)|protein ubiquitination (GO:0016567)|regulation of BMP signaling pathway (GO:0030510)|regulation of cell proliferation (GO:0042127)|regulation of inflammatory response (GO:0050727)|regulation of innate immune response (GO:0045088)|regulation of nucleotide-binding oligomerization domain containing signaling pathway (GO:0070424)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|protein complex (GO:0043234)	cysteine-type endopeptidase inhibitor activity involved in apoptotic process (GO:0043027)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|endometrium(3)|kidney(3)|large_intestine(2)|lung(12)|ovary(3)	25						GGCGACACTTTCCTAATTGCT	0.418									X-linked Lymphoproliferative syndrome																												p.F224F		Atlas-SNP	.											.	XIAP	56	.	0			c.T672C						.						119.0	107.0	111.0					X																	123020184		2203	4300	6503	SO:0001819	synonymous_variant	331	exon2	Familial Cancer Database	XLP, Duncan syndrome, Familial Fatal Epstein-Barr Infection, incl. XLP2	ACACTTTCCTAAT	U45880	CCDS14606.1	Xq25	2014-09-17	2008-03-04	2008-03-04	ENSG00000101966	ENSG00000101966		"""Baculoviral IAP repeat containing"""	592	protein-coding gene	gene with protein product		300079	"""baculoviral IAP repeat-containing 4"""	API3, BIRC4		8552191, 8654366	Standard	NM_001167		Approved	hILP	uc010nqu.3	P98170	OTTHUMG00000022336	ENST00000371199.3:c.672T>C	chrX.hg19:g.123020184T>C		60.0	0.0		90.0	4.0	NM_001204401	D3DTF2|Q9NQ14	Silent	SNP	ENST00000371199.3	hg19	CCDS14606.1																																																																																			.	.		0.418	XIAP-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058165.5	NM_001167	
OCRL	4952	hgsc.bcm.edu	37	X	128695175	128695175	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chrX:128695175A>G	ENST00000371113.4	+	10	1009	c.844A>G	c.(844-846)Agc>Ggc	p.S282G	OCRL_ENST00000357121.5_Missense_Mutation_p.S282G	NM_000276.3	NP_000267.2	Q01968	OCRL_HUMAN	oculocerebrorenal syndrome of Lowe	282	5-phosphatase.				cilium assembly (GO:0042384)|in utero embryonic development (GO:0001701)|inositol phosphate metabolic process (GO:0043647)|lipid metabolic process (GO:0006629)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|positive regulation of Rac GTPase activity (GO:0032855)|regulation of Rac GTPase activity (GO:0032314)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|extracellular vesicular exosome (GO:0070062)|Golgi stack (GO:0005795)|Golgi-associated vesicle (GO:0005798)|nucleus (GO:0005634)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	inositol phosphate phosphatase activity (GO:0052745)|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity (GO:0004439)|Rac GTPase activator activity (GO:0030675)|Rac GTPase binding (GO:0048365)			breast(1)|endometrium(3)|kidney(4)|large_intestine(11)|lung(24)|ovary(2)|upper_aerodigestive_tract(3)	48						ACTGGACTTGAGCACAGAAGC	0.398																																					p.S282G		Atlas-SNP	.											.	OCRL	117	.	0			c.A844G						.						161.0	155.0	157.0					X																	128695175		2203	4300	6503	SO:0001583	missense	4952	exon10			GACTTGAGCACAG	U57627	CCDS35393.1, CCDS35394.1	Xq25	2014-06-18			ENSG00000122126	ENSG00000122126			8108	protein-coding gene	gene with protein product		300535					Standard	NM_001587		Approved	OCRL1	uc004euq.3	Q01968	OTTHUMG00000022706	ENST00000371113.4:c.844A>G	chrX.hg19:g.128695175A>G	ENSP00000360154:p.Ser282Gly	111.0	0.0		112.0	5.0	NM_000276	A6NKI1|A8KAP2|B7ZLX2|O60800|Q15684|Q15774|Q4VY09|Q4VY10|Q5JQF1|Q5JQF2|Q9UJG5|Q9UMA5	Missense_Mutation	SNP	ENST00000371113.4	hg19	CCDS35393.1	.	.	.	.	.	.	.	.	.	.	A	23.0	4.358713	0.82243	.	.	ENSG00000122126	ENST00000371113;ENST00000357121	T;T	0.79940	-1.32;-1.32	5.44	5.44	0.79542	Endonuclease/exonuclease/phosphatase (2);Inositol polyphosphate-related phosphatase (1);	0.000000	0.85682	D	0.000000	D	0.89128	0.6627	M	0.77486	2.375	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.80764	0.976;0.994	D	0.90467	0.4450	10	0.87932	D	0	.	13.7631	0.62979	1.0:0.0:0.0:0.0	.	282;282	Q01968-2;Q01968	.;OCRL_HUMAN	G	282	ENSP00000360154:S282G;ENSP00000349635:S282G	ENSP00000349635:S282G	S	+	1	0	OCRL	128522856	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	8.962000	0.93254	1.915000	0.55452	0.486000	0.48141	AGC	.	.		0.398	OCRL-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058917.1	NM_000276	
ARHGAP36	158763	hgsc.bcm.edu	37	X	130220617	130220617	+	Silent	SNP	T	T	C			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chrX:130220617T>C	ENST00000276211.5	+	11	1809	c.1464T>C	c.(1462-1464)gcT>gcC	p.A488A	ARHGAP36_ENST00000370921.1_Silent_p.A352A|ARHGAP36_ENST00000370922.1_Silent_p.A476A	NM_144967.3	NP_659404.2	Q6ZRI8	RHG36_HUMAN	Rho GTPase activating protein 36	488					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)			breast(1)|central_nervous_system(2)|endometrium(5)|kidney(3)|large_intestine(16)|lung(31)|ovary(4)|prostate(4)|skin(3)|urinary_tract(2)	71						CTGTCCTTGCTCAAAGCAAGC	0.532																																					p.A488A		Atlas-SNP	.											.	ARHGAP36	171	.	0			c.T1464C						.						84.0	75.0	78.0					X																	130220617		2203	4300	6503	SO:0001819	synonymous_variant	158763	exon11			CCTTGCTCAAAGC		CCDS14628.1, CCDS65320.1	Xq26.1	2011-06-29			ENSG00000147256	ENSG00000147256		"""Rho GTPase activating proteins"""	26388	protein-coding gene	gene with protein product							Standard	NM_144967		Approved	FLJ30058	uc004evz.3	Q6ZRI8	OTTHUMG00000022402	ENST00000276211.5:c.1464T>C	chrX.hg19:g.130220617T>C		61.0	0.0		78.0	4.0	NM_144967	B7Z234|B7Z439|Q5JRL9|Q5JRM0|Q5JRM1|Q96NU6	Silent	SNP	ENST00000276211.5	hg19	CCDS14628.1																																																																																			.	.		0.532	ARHGAP36-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355073.1	NM_144967	
SLITRK2	84631	hgsc.bcm.edu	37	X	144905987	144905987	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chrX:144905987G>A	ENST00000370490.1	+	1	6299	c.2044G>A	c.(2044-2046)Ggc>Agc	p.G682S	SLITRK2_ENST00000447897.2_Missense_Mutation_p.G682S|SLITRK2_ENST00000434188.2_Missense_Mutation_p.G682S|TMEM257_ENST00000408967.2_5'Flank|SLITRK2_ENST00000428560.2_Missense_Mutation_p.G682S|SLITRK2_ENST00000413937.2_Missense_Mutation_p.G682S			Q9H156	SLIK2_HUMAN	SLIT and NTRK-like family, member 2	682					axonogenesis (GO:0007409)	integral component of membrane (GO:0016021)				NS(1)|breast(3)|central_nervous_system(1)|endometrium(9)|kidney(1)|large_intestine(17)|lung(40)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	86	Acute lymphoblastic leukemia(192;6.56e-05)					TAAAACAGACGGCCATGTCTA	0.488																																					p.G682S		Atlas-SNP	.											.	SLITRK2	221	.	0			c.G2044A						.						76.0	68.0	71.0					X																	144905987		2203	4300	6503	SO:0001583	missense	84631	exon5			ACAGACGGCCATG	Y19205	CCDS14680.1	Xq27.3	2008-02-05	2004-03-11		ENSG00000185985	ENSG00000185985			13449	protein-coding gene	gene with protein product		300561	"""slit-like 1 (Drosophila)"""	SLITL1		11347906, 14557068	Standard	NM_032539		Approved	KIAA1854, CXorf2	uc011mwr.2	Q9H156	OTTHUMG00000022595	ENST00000370490.1:c.2044G>A	chrX.hg19:g.144905987G>A	ENSP00000359521:p.Gly682Ser	57.0	0.0		51.0	43.0	NM_001144005	A8K117|Q2KHN3|Q5JXB1|Q8NBC7|Q96JH3	Missense_Mutation	SNP	ENST00000370490.1	hg19	CCDS14680.1	.	.	.	.	.	.	.	.	.	.	G	12.89	2.073220	0.36566	.	.	ENSG00000185985	ENST00000335565;ENST00000447897;ENST00000370490;ENST00000434188;ENST00000413937;ENST00000428560	T;T;T;T;T;T	0.55413	0.62;0.52;0.52;0.52;0.52;0.52	5.67	5.67	0.87782	.	0.294597	0.36815	N	0.002391	T	0.45034	0.1322	L	0.55990	1.75	0.30799	N	0.74006	B	0.32396	0.369	B	0.26202	0.067	T	0.48340	-0.9044	10	0.10636	T	0.68	-9.5346	16.0092	0.80385	0.0:0.0:1.0:0.0	.	682	Q9H156	SLIK2_HUMAN	S	682	ENSP00000334374:G682S;ENSP00000411681:G682S;ENSP00000359521:G682S;ENSP00000397015:G682S;ENSP00000407347:G682S;ENSP00000412010:G682S	ENSP00000334374:G682S	G	+	1	0	SLITRK2	144713679	1.000000	0.71417	0.952000	0.39060	0.919000	0.55068	3.575000	0.53870	2.380000	0.81148	0.600000	0.82982	GGC	.	.		0.488	SLITRK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058633.1	NM_032539	
PASD1	139135	hgsc.bcm.edu	37	X	150832684	150832684	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chrX:150832684A>G	ENST00000370357.4	+	11	1180	c.935A>G	c.(934-936)gAc>gGc	p.D312G		NM_173493.2	NP_775764.2	Q8IV76	PASD1_HUMAN	PAS domain containing 1	312						nucleus (GO:0005634)	signal transducer activity (GO:0004871)			breast(2)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(3)|liver(1)|lung(25)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	48	Acute lymphoblastic leukemia(192;6.56e-05)					GATCAGGTGGACTCAGTGGAC	0.587																																					p.D312G		Atlas-SNP	.											.	PASD1	286	.	0			c.A935G						.						110.0	93.0	99.0					X																	150832684		2203	4300	6503	SO:0001583	missense	139135	exon11			AGGTGGACTCAGT	AY270020	CCDS35431.1	Xq28	2009-08-06			ENSG00000166049	ENSG00000166049			20686	protein-coding gene	gene with protein product	"""cancer/testis antigen 63"""					15122589, 15162151	Standard	NM_173493		Approved	CT63	uc004fev.4	Q8IV76	OTTHUMG00000024169	ENST00000370357.4:c.935A>G	chrX.hg19:g.150832684A>G	ENSP00000359382:p.Asp312Gly	131.0	0.0		100.0	4.0	NM_173493	Q3MNE0|Q69HD7|Q8N7X9	Missense_Mutation	SNP	ENST00000370357.4	hg19	CCDS35431.1	.	.	.	.	.	.	.	.	.	.	A	10.90	1.481685	0.26598	.	.	ENSG00000166049	ENST00000370357	T	0.69040	-0.37	3.17	0.718	0.18202	.	.	.	.	.	T	0.45175	0.1329	N	0.19112	0.55	0.09310	N	1	B	0.23650	0.089	B	0.16289	0.015	T	0.26849	-1.0091	9	0.42905	T	0.14	.	4.5669	0.12191	0.6948:0.0:0.3052:0.0	.	312	Q8IV76	PASD1_HUMAN	G	312	ENSP00000359382:D312G	ENSP00000359382:D312G	D	+	2	0	PASD1	150583340	0.003000	0.15002	0.000000	0.03702	0.002000	0.02628	0.264000	0.18497	0.048000	0.15891	0.486000	0.48141	GAC	.	.		0.587	PASD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060879.2	NM_173493	
PLXNB3	5365	hgsc.bcm.edu	37	X	153040831	153040831	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chrX:153040831A>G	ENST00000361971.5	+	25	4421	c.4307A>G	c.(4306-4308)cAc>cGc	p.H1436R	PLXNB3_ENST00000538966.1_Missense_Mutation_p.H1459R|SRPK3_ENST00000489426.1_5'Flank|PLXNB3_ENST00000538776.1_Missense_Mutation_p.H1089R	NM_005393.2	NP_005384.2	Q9ULL4	PLXB3_HUMAN	plexin B3	1436					axon guidance (GO:0007411)|cell chemotaxis (GO:0060326)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell migration (GO:0030336)|negative regulation of GTPase activity (GO:0034260)|negative regulation of lamellipodium assembly (GO:0010593)|positive chemotaxis (GO:0050918)|positive regulation of endothelial cell proliferation (GO:0001938)|semaphorin-plexin signaling pathway (GO:0071526)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	protein domain specific binding (GO:0019904)|semaphorin receptor activity (GO:0017154)			central_nervous_system(1)|endometrium(7)|large_intestine(2)|lung(15)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	32	all_hematologic(71;4.25e-06)|all_lung(58;3.83e-05)|Lung NSC(58;5.54e-05)|Acute lymphoblastic leukemia(192;6.56e-05)					CATTACGTGCACAGGAACCCC	0.652																																					p.H1459R		Atlas-SNP	.											.	PLXNB3	208	.	0			c.A4376G						.						53.0	33.0	40.0					X																	153040831		2190	4293	6483	SO:0001583	missense	5365	exon26			ACGTGCACAGGAA	AF149019	CCDS14729.1, CCDS55536.1	Xq28	2008-02-05			ENSG00000198753	ENSG00000198753		"""Plexins"""	9105	protein-coding gene	gene with protein product		300214		PLXN6		10520995	Standard	NM_005393		Approved	PLEXR, PLEXB3	uc010nuk.2	Q9ULL4	OTTHUMG00000024217	ENST00000361971.5:c.4307A>G	chrX.hg19:g.153040831A>G	ENSP00000355378:p.His1436Arg	43.0	0.0		88.0	4.0	NM_001163257	B7Z3E6|F5H773|Q9HDA4	Missense_Mutation	SNP	ENST00000361971.5	hg19	CCDS14729.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	8.645|8.645	0.896801|0.896801	0.17686|0.17686	.|.	.|.	ENSG00000198753|ENSG00000198753	ENST00000538966;ENST00000361971;ENST00000538776|ENST00000411613	T;T;T|.	0.10860|.	2.83;2.83;2.83|.	5.01|5.01	-0.442|-0.442	0.12253|0.12253	Plexin, cytoplasmic RasGAP domain (1);Rho GTPase activation protein (1);|.	0.836106|.	0.10902|.	N|.	0.621467|.	T|T	0.08980|0.08980	0.0222|0.0222	N|N	0.02011|0.02011	-0.69|-0.69	0.27729|0.27729	N|N	0.944889|0.944889	B;B;B|.	0.06786|.	0.0;0.001;0.0|.	B;B;B|.	0.12837|.	0.008;0.005;0.008|.	T|T	0.34576|0.34576	-0.9823|-0.9823	10|5	0.27785|.	T|.	0.31|.	.|.	5.2162|5.2162	0.15344|0.15344	0.3838:0.3211:0.2951:0.0|0.3838:0.3211:0.2951:0.0	.|.	1089;1459;1436|.	B7Z3H9;F5H773;Q9ULL4|.	.;.;PLXB3_HUMAN|.	R|A	1459;1436;1089|142	ENSP00000442736:H1459R;ENSP00000355378:H1436R;ENSP00000445569:H1089R|.	ENSP00000355378:H1436R|.	H|T	+|+	2|1	0|0	PLXNB3|PLXNB3	152694025|152694025	1.000000|1.000000	0.71417|0.71417	0.131000|0.131000	0.22000|0.22000	0.222000|0.222000	0.24845|0.24845	1.915000|1.915000	0.39976|0.39976	-0.047000|-0.047000	0.13423|0.13423	0.430000|0.430000	0.28490|0.28490	CAC|ACA	.	.		0.652	PLXNB3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000061063.1		
SMIM9	100132963	hgsc.bcm.edu	37	X	154057846	154057846	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chrX:154057846A>G	ENST00000369529.1	-	3	432	c.236T>C	c.(235-237)cTc>cCc	p.L79P	SMIM9_ENST00000478043.1_5'Flank	NM_001162936.1	NP_001156408.1	A6NGZ8	SMIM9_HUMAN	small integral membrane protein 9	79						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)											TGCTGAGGTGAGAAGAAAAGC	0.502																																					p.L79P		Atlas-SNP	.											.	.	.	.	0			c.T236C						.						117.0	99.0	104.0					X																	154057846		692	1591	2283	SO:0001583	missense	100132963	exon4			GAGGTGAGAAGAA		CCDS55546.1	Xq28	2012-11-29	2012-11-29	2012-11-29	ENSG00000203870	ENSG00000203870			41915	protein-coding gene	gene with protein product			"""chromosome X open reading frame 68"""	CXorf68			Standard	NM_001162936		Approved		uc022cik.1	A6NGZ8	OTTHUMG00000024243	ENST00000369529.1:c.236T>C	chrX.hg19:g.154057846A>G	ENSP00000358542:p.Leu79Pro	74.0	0.0		170.0	9.0	NM_001162936		Missense_Mutation	SNP	ENST00000369529.1	hg19	CCDS55546.1	.	.	.	.	.	.	.	.	.	.	a	12.83	2.055163	0.36277	.	.	ENSG00000203870	ENST00000369529	.	.	.	4.46	3.25	0.37280	.	1.579570	0.04332	N	0.352539	T	0.43722	0.1260	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.40098	-0.9581	6	0.72032	D	0.01	-1.8993	7.1449	0.25577	0.7735:0.2265:0.0:0.0	.	.	.	.	P	79	.	ENSP00000358542:L79P	L	-	2	0	CXorf68	153711040	0.009000	0.17119	0.000000	0.03702	0.027000	0.11550	2.614000	0.46359	0.631000	0.30412	0.417000	0.27973	CTC	.	.		0.502	SMIM9-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000061185.2	NM_001162936	
F8	2157	hgsc.bcm.edu	37	X	154194405	154194405	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chrX:154194405C>T	ENST00000360256.4	-	9	1483	c.1283G>A	c.(1282-1284)aGt>aAt	p.S428N	F8_ENST00000483822.1_5'UTR	NM_000132.3	NP_000123.1	P00451	FA8_HUMAN	coagulation factor VIII, procoagulant component	428	F5/8 type A 2.|Plastocyanin-like 3.				acute-phase response (GO:0006953)|blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|cell adhesion (GO:0007155)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)	copper ion binding (GO:0005507)|oxidoreductase activity (GO:0016491)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(27)|liver(1)|lung(47)|ovary(5)|pancreas(3)|prostate(1)|skin(5)|upper_aerodigestive_tract(5)|urinary_tract(2)	120	all_cancers(53;7.19e-17)|all_epithelial(53;9.83e-11)|all_lung(58;6.63e-07)|Lung NSC(58;2.08e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)				Coagulation Factor IX(DB00100)|Drotrecogin alfa(DB00055)	CAAATATTGACTTTTATAACT	0.353																																					p.S428N		Atlas-SNP	.											.	F8	646	.	0			c.G1283A						.						72.0	67.0	69.0					X																	154194405		2203	4300	6503	SO:0001583	missense	2157	exon9			TATTGACTTTTAT	M90707	CCDS35457.1, CCDS44026.1	Xq28	2014-09-17	2008-07-29		ENSG00000185010	ENSG00000185010			3546	protein-coding gene	gene with protein product	"""Factor VIIIF8B"", ""hemophilia A"""	300841		F8C		6438528, 3935400	Standard	NM_000132		Approved	FVIII, DXS1253E, HEMA	uc004fmt.3	P00451	OTTHUMG00000022688	ENST00000360256.4:c.1283G>A	chrX.hg19:g.154194405C>T	ENSP00000353393:p.Ser428Asn	50.0	0.0		91.0	4.0	NM_000132	Q14286|Q5HY69	Missense_Mutation	SNP	ENST00000360256.4	hg19	CCDS35457.1	.	.	.	.	.	.	.	.	.	.	C	9.803	1.181175	0.21787	.	.	ENSG00000185010	ENST00000360256	D	0.98747	-5.11	5.33	3.13	0.36017	Cupredoxin (2);	0.367118	0.34676	N	0.003775	D	0.94706	0.8292	N	0.20328	0.56	0.09310	N	1	B	0.17465	0.022	B	0.14578	0.011	D	0.87998	0.2754	10	0.25751	T	0.34	-5.5738	8.8433	0.35155	0.0:0.7626:0.0:0.2374	.	428	P00451	FA8_HUMAN	N	428	ENSP00000353393:S428N	ENSP00000353393:S428N	S	-	2	0	F8	153847599	0.250000	0.23951	0.933000	0.37362	0.983000	0.72400	0.214000	0.17541	0.966000	0.38159	0.529000	0.55759	AGT	.	.		0.353	F8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058869.4		
ANKRD11	29123	hgsc.bcm.edu	37	16	89341222	89341227	+	Splice_Site	DEL	CTGGCT	CTGGCT	-			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	CTGGCT	CTGGCT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr16:89341222_89341227delCTGGCT	ENST00000301030.4	-	11	8168_8173	c.7708_7713delAGCCAG	c.(7708-7713)agccagdel	p.SQ2570del	ANKRD11_ENST00000378330.2_Splice_Site_p.SQ2570del	NM_001256183.1|NM_013275.5	NP_001243112.1|NP_037407.4	Q6UB99	ANR11_HUMAN	ankyrin repeat domain 11	2570					bone development (GO:0060348)|face morphogenesis (GO:0060325)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|odontogenesis of dentin-containing tooth (GO:0042475)|skeletal system morphogenesis (GO:0048705)|tissue homeostasis (GO:0001894)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(4)|central_nervous_system(3)|endometrium(17)|kidney(2)|large_intestine(18)|lung(20)|ovary(6)|pancreas(1)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	83		all_hematologic(23;0.00824)|Colorectal(91;0.0475)		Epithelial(1;5.33e-11)|all cancers(4;2.6e-09)|OV - Ovarian serous cystadenocarcinoma(4;2.29e-07)|BRCA - Breast invasive adenocarcinoma(80;0.0142)		CGGGCCCTACCTGGCTCTCCAGGGGC	0.641																																					p.2570_2571del		Atlas-Indel,Pindel	.											.	ANKRD11	195	.	0			c.7709_7713del						.																																			SO:0001630	splice_region_variant	29123	exon11			.	AY373756	CCDS32513.1	16q24.3	2013-01-10				ENSG00000167522		"""Ankyrin repeat domain containing"""	21316	protein-coding gene	gene with protein product		611192				11483580	Standard	NM_001256182		Approved	LZ16, T13	uc002fnc.2	Q6UB99		ENST00000301030.4:c.7713+1AGCCAG>-	chr16.hg19:g.89341222_89341227delCTGGCT		90.0	0.0		69.0	18.0	NM_013275	Q6NTG1|Q6QMF8	Frame_Shift_Del	DEL	ENST00000301030.4	hg19	CCDS32513.1																																																																																			.	.		0.641	ANKRD11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000430462.3	NM_013275	In_Frame_Del
NOTCH2	4853	hgsc.bcm.edu	37	1	120458918	120458919	+	Frame_Shift_Ins	INS	-	-	AA			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr1:120458918_120458919insAA	ENST00000256646.2	-	34	6645_6646	c.6426_6427insTT	c.(6424-6429)tctgagfs	p.E2143fs		NM_024408.3	NP_077719.2	Q04721	NOTC2_HUMAN	notch 2	2143					apoptotic process (GO:0006915)|atrial septum morphogenesis (GO:0060413)|bone remodeling (GO:0046849)|cell cycle arrest (GO:0007050)|cell fate determination (GO:0001709)|cell growth (GO:0016049)|ciliary body morphogenesis (GO:0061073)|determination of left/right symmetry (GO:0007368)|embryonic limb morphogenesis (GO:0030326)|gene expression (GO:0010467)|hemopoiesis (GO:0030097)|humoral immune response (GO:0006959)|in utero embryonic development (GO:0001701)|inflammatory response to antigenic stimulus (GO:0002437)|interleukin-4 secretion (GO:0072602)|intracellular receptor signaling pathway (GO:0030522)|morphogenesis of an epithelial sheet (GO:0002011)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|placenta blood vessel development (GO:0060674)|positive regulation of apoptotic process (GO:0043065)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cell proliferation (GO:0008284)|positive regulation of Ras protein signal transduction (GO:0046579)|pulmonary valve morphogenesis (GO:0003184)|regulation of transcription, DNA-templated (GO:0006355)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cell surface (GO:0009986)|cilium (GO:0005929)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|ligand-activated RNA polymerase II transcription factor binding transcription factor activity (GO:0038049)|receptor activity (GO:0004872)			breast(4)|central_nervous_system(6)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(9)|kidney(9)|large_intestine(19)|liver(1)|lung(57)|ovary(4)|pancreas(1)|prostate(7)|skin(24)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	158	all_neural(166;0.153)	all_lung(203;1.96e-06)|Lung NSC(69;1.47e-05)|all_epithelial(167;0.000809)		Lung(183;0.0242)|LUSC - Lung squamous cell carcinoma(189;0.133)		ACTGAACTCTCAGACAGTTGGA	0.485			"""N, F, Mis"""		"""marginal zone lymphoma, DLBCL"""				Alagille Syndrome																												p.E2143fs		Atlas-Indel,Pindel	.		Dom	yes		1	1p13-p11	4853	Notch homolog 2		L	.	NOTCH2	348	.	0			c.6427_6428insTT						.																																			SO:0001589	frameshift_variant	4853	exon34	Familial Cancer Database	ALGS1, ALGS2.Alagille-Watson syndrome	.	AF315356	CCDS908.1	1p13-p11	2013-01-10	2010-06-24		ENSG00000134250	ENSG00000134250		"""Ankyrin repeat domain containing"""	7882	protein-coding gene	gene with protein product		600275	"""Notch (Drosophila) homolog 2"", ""Notch homolog 2 (Drosophila)"""			7698746	Standard	NM_001200001		Approved		uc001eik.3	Q04721	OTTHUMG00000012177	ENST00000256646.2:c.6426_6427insTT	chr1.hg19:g.120458918_120458919insAA	ENSP00000256646:p.Glu2143fs	217.0	0.0		216.0	49.0	NM_024408	Q5T3X7|Q99734|Q9H240	Frame_Shift_Ins	INS	ENST00000256646.2	hg19	CCDS908.1																																																																																			.	.		0.485	NOTCH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033679.1	NM_024408	
ARID2	196528	hgsc.bcm.edu	37	12	46246364	46246376	+	Frame_Shift_Del	DEL	TCCCGACTCAGGA	TCCCGACTCAGGA	-			TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	TCCCGACTCAGGA	TCCCGACTCAGGA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr12:46246364_46246376delTCCCGACTCAGGA	ENST00000334344.6	+	15	4630_4642	c.4458_4470delTCCCGACTCAGGA	c.(4456-4470)gttcccgactcaggafs	p.VPDSG1486fs	ARID2_ENST00000457135.1_Frame_Shift_Del_p.VPDSG94fs|ARID2_ENST00000444670.1_Frame_Shift_Del_p.VPDSG1096fs|ARID2_ENST00000422737.1_Frame_Shift_Del_p.VPDSG1337fs|ARID2_ENST00000479608.1_3'UTR	NM_152641.2	NP_689854.2	Q68CP9	ARID2_HUMAN	AT rich interactive domain 2 (ARID, RFX-like)	1486					chromatin modification (GO:0016568)|nucleosome disassembly (GO:0006337)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(3)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(21)|liver(20)|lung(34)|ovary(7)|pancreas(1)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	116	Lung SC(27;0.192)|Renal(347;0.236)	Lung NSC(34;0.106)|all_lung(34;0.22)	OV - Ovarian serous cystadenocarcinoma(5;0.00691)	GBM - Glioblastoma multiforme(48;0.0153)		TCATAGCAGTTCCCGACTCAGGATCAAAAGTAT	0.451			"""N, S, F"""		hepatocellular carcinoma																																p.1486_1490del		Atlas-Indel,Pindel	.		Rec	yes		12	12q12	196528	AT rich interactive domain 2		E	.	ARID2	311	.	0			c.4457_4469del						.																																			SO:0001589	frameshift_variant	196528	exon15			.		CCDS31783.1	12q13.11	2013-02-07			ENSG00000189079	ENSG00000189079		"""-"""	18037	protein-coding gene	gene with protein product		609539					Standard	NM_152641		Approved	KIAA1557, DKFZp686G052, FLJ30619, BAF200	uc001ros.1	Q68CP9	OTTHUMG00000150487	ENST00000334344.6:c.4458_4470delTCCCGACTCAGGA	chr12.hg19:g.46246364_46246376delTCCCGACTCAGGA	ENSP00000335044:p.Val1486fs	210.0	0.0		81.0	23.0	NM_152641	Q15KG9|Q5EB51|Q645I3|Q6ZRY5|Q7Z3I5|Q86T28|Q96SJ6|Q9HCL5	Frame_Shift_Del	DEL	ENST00000334344.6	hg19	CCDS31783.1																																																																																			.	.		0.451	ARID2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318380.2	XM_350875	
RASA1	5921	hgsc.bcm.edu	37	5	86665656	86665668	+	Frame_Shift_Del	DEL	AGCACTTTAGTGA	AGCACTTTAGTGA	-	rs528357903	byFrequency	TCGA-CC-A3MA-01A-11D-A20W-10	TCGA-CC-A3MA-10A-01D-A20W-10	AGCACTTTAGTGA	AGCACTTTAGTGA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f89d0a39-0177-499b-bb65-3cb17b108023	60141338-5497-4228-a24f-74b33d3d49af	g.chr5:86665656_86665668delAGCACTTTAGTGA	ENST00000274376.6	+	12	2201_2213	c.1637_1649delAGCACTTTAGTGA	c.(1636-1650)cagcactttagtgaafs	p.QHFSE546fs	RASA1_ENST00000456692.2_Frame_Shift_Del_p.QHFSE369fs|RASA1_ENST00000512763.1_Frame_Shift_Del_p.QHFSE379fs|RASA1_ENST00000506290.1_Frame_Shift_Del_p.QHFSE380fs	NM_002890.2	NP_002881.1	P20936	RASA1_HUMAN	RAS p21 protein activator (GTPase activating protein) 1	546	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				blood vessel morphogenesis (GO:0048514)|embryo development (GO:0009790)|intracellular signal transduction (GO:0035556)|mitotic cytokinesis (GO:0000281)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of Ras GTPase activity (GO:0032320)|regulation of actin filament polymerization (GO:0030833)|regulation of cell shape (GO:0008360)|regulation of RNA metabolic process (GO:0051252)|signal transduction (GO:0007165)|vasculogenesis (GO:0001570)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|ruffle (GO:0001726)	glycoprotein binding (GO:0001948)|GTPase binding (GO:0051020)|potassium channel inhibitor activity (GO:0019870)|Ras GTPase activator activity (GO:0005099)|receptor binding (GO:0005102)			NS(1)|cervix(1)|endometrium(7)|kidney(4)|large_intestine(12)|lung(13)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	48		all_cancers(142;8.25e-07)|Lung NSC(167;0.000185)|all_lung(232;0.000222)|Colorectal(57;0.00542)|Ovarian(174;0.0423)		OV - Ovarian serous cystadenocarcinoma(54;4.72e-41)|Epithelial(54;1.51e-36)|all cancers(79;3.76e-31)		ATAGTAGTTCAGCACTTTAGTGAAGAACATTAC	0.31																																					p.546_550del		Pindel	.											.	RASA1	213	.	0			c.1636_1648del						.																																			SO:0001589	frameshift_variant	5921	exon12			.		CCDS34200.1, CCDS47243.1	5q13	2013-02-14			ENSG00000145715	ENSG00000145715		"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	9871	protein-coding gene	gene with protein product	"""capillary malformation-arteriovenous malformation"""	139150		RASA		15917201	Standard	NM_022650		Approved	GAP, CM-AVM, p120GAP, p120RASGAP	uc003kiw.3	P20936	OTTHUMG00000162605	ENST00000274376.6:c.1637_1649delAGCACTTTAGTGA	chr5.hg19:g.86665656_86665668delAGCACTTTAGTGA	ENSP00000274376:p.Gln546fs	0.0	0.0		158.0	20.0	NM_002890	B2R6W3|Q9UDI1	Frame_Shift_Del	DEL	ENST00000274376.6	hg19	CCDS34200.1																																																																																			.	.		0.310	RASA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000369729.1	NM_002890	
