#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
CROCC	9696	hgsc.bcm.edu	37	1	17273389	17273389	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A7IE-01A-21D-A382-10	TCGA-CC-A7IE-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c1caf517-5052-48e3-ad80-8458b3d2ff5f	ab81329b-c119-4a5a-863c-5b50f48cee3f	g.chr1:17273389G>T	ENST00000375541.5	+	17	2486	c.2417G>T	c.(2416-2418)gGc>gTc	p.G806V	CROCC_ENST00000467938.1_3'UTR	NM_014675.3	NP_055490.3			ciliary rootlet coiled-coil, rootletin											breast(3)|central_nervous_system(2)|cervix(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(12)|large_intestine(1)|lung(20)|ovary(3)|prostate(9)|skin(3)|urinary_tract(1)	62		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000174)|all_lung(284;0.000234)|Renal(390;0.000518)|Ovarian(437;0.00669)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.63e-06)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(64;0.000163)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.181)		GGCCTGGAGGGCTCCCTACGA	0.697																																					p.G806V		Atlas-SNP	.											.	CROCC	185	.	0			c.G2417T						.						15.0	14.0	14.0					1																	17273389		2159	4240	6399	SO:0001583	missense	9696	exon17			TGGAGGGCTCCCT	AB007914	CCDS30616.1	1p36.13	2010-06-04	2009-03-04	2009-03-04	ENSG00000058453	ENSG00000058453			21299	protein-coding gene	gene with protein product	"""rootletin, ciliary rootlet protein"""	615776				12427867, 17971504	Standard	XM_006711056		Approved	rootletin, ROLT	uc001azt.2	Q5TZA2	OTTHUMG00000002200	ENST00000375541.5:c.2417G>T	chr1.hg19:g.17273389G>T	ENSP00000364691:p.Gly806Val	226.0	0.0		203.0	40.0	NM_014675		Missense_Mutation	SNP	ENST00000375541.5	hg19	CCDS30616.1	.	.	.	.	.	.	.	.	.	.	G	13.20	2.165929	0.38217	.	.	ENSG00000058453	ENST00000375541;ENST00000445545	T	0.09630	2.96	3.35	3.35	0.38373	.	.	.	.	.	T	0.17662	0.0424	L	0.44542	1.39	0.52501	D	0.999953	D;D;D	0.71674	0.998;0.997;0.997	P;P;P	0.62184	0.862;0.899;0.899	T	0.00936	-1.1508	9	0.38643	T	0.18	.	6.674	0.23083	0.1271:0.0:0.8729:0.0	.	669;109;806	A1L0S8;Q5TZA2-2;Q5TZA2	.;.;CROCC_HUMAN	V	806;687	ENSP00000364691:G806V	ENSP00000364691:G806V	G	+	2	0	CROCC	17145976	1.000000	0.71417	1.000000	0.80357	0.837000	0.47467	3.046000	0.49846	2.167000	0.68274	0.462000	0.41574	GGC	.	.		0.697	CROCC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006249.2	NM_014675	
TMEM59	9528	hgsc.bcm.edu	37	1	54506502	54506502	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A7IE-01A-21D-A382-10	TCGA-CC-A7IE-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c1caf517-5052-48e3-ad80-8458b3d2ff5f	ab81329b-c119-4a5a-863c-5b50f48cee3f	g.chr1:54506502T>C	ENST00000234831.5	-	6	883	c.634A>G	c.(634-636)Atg>Gtg	p.M212V	TMEM59_ENST00000371348.1_Missense_Mutation_p.M81V|TMEM59_ENST00000371341.1_Missense_Mutation_p.M81V|TMEM59_ENST00000371344.1_Missense_Mutation_p.M81V	NM_004872.3	NP_004863.2	Q9BXS4	TMM59_HUMAN	transmembrane protein 59	212					autophagy (GO:0006914)|negative regulation of establishment of protein localization to plasma membrane (GO:0090005)|negative regulation of protein glycosylation in Golgi (GO:0090285)|negative regulation of protein processing (GO:0010955)|positive regulation of autophagy (GO:0010508)	extracellular vesicular exosome (GO:0070062)|Golgi cis cisterna (GO:0000137)|Golgi medial cisterna (GO:0005797)|Golgi trans cisterna (GO:0000138)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|lysosome (GO:0005764)|plasma membrane (GO:0005886)	endopeptidase activity (GO:0004175)			kidney(3)|lung(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	7						GAATTTCTCATTTGCAGATCT	0.328																																					p.M212V		Atlas-SNP	.											.	TMEM59	28	.	0			c.A634G						.						91.0	91.0	91.0					1																	54506502		2203	4298	6501	SO:0001583	missense	9528	exon6			TTCTCATTTGCAG	AF047439	CCDS586.1	1p32.3	2008-05-14	2005-07-22	2005-07-22	ENSG00000116209	ENSG00000116209			1239	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 8"""	C1orf8		9653160	Standard	NM_004872		Approved	HSPC001	uc001cwp.3	Q9BXS4	OTTHUMG00000008437	ENST00000234831.5:c.634A>G	chr1.hg19:g.54506502T>C	ENSP00000234831:p.Met212Val	210.0	0.0		210.0	35.0	NM_004872	B3KQL7|O75393|Q4VBP9|Q5T705|Q96KX7	Missense_Mutation	SNP	ENST00000234831.5	hg19	CCDS586.1	.	.	.	.	.	.	.	.	.	.	T	11.22	1.574744	0.28092	.	.	ENSG00000116209	ENST00000371348;ENST00000371344;ENST00000234831;ENST00000371341;ENST00000371338;ENST00000420738;ENST00000440019;ENST00000452421	T;T	0.39592	1.1;1.07	5.23	2.81	0.32909	.	0.146289	0.64402	D	0.000007	T	0.25158	0.0611	N	0.19112	0.55	0.80722	D	1	B;B;B;B	0.33073	0.396;0.396;0.002;0.007	B;B;B;B	0.35550	0.205;0.205;0.007;0.016	T	0.04621	-1.0938	10	0.39692	T	0.17	-4.9108	5.8473	0.18673	0.1319:0.0:0.2803:0.5878	.	223;223;213;212	E9PGZ9;Q5T704;D3DQ48;Q9BXS4	.;.;.;TMM59_HUMAN	V	81;81;212;81;223;81;81;223	ENSP00000234831:M212V;ENSP00000397772:M223V	ENSP00000234831:M212V	M	-	1	0	TMEM59	54279090	0.987000	0.35691	0.997000	0.53966	0.985000	0.73830	2.054000	0.41335	0.958000	0.37956	0.528000	0.53228	ATG	.	.		0.328	TMEM59-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000023254.2	NM_004872	
LRRIQ3	127255	hgsc.bcm.edu	37	1	74507591	74507591	+	Missense_Mutation	SNP	C	C	G			TCGA-CC-A7IE-01A-21D-A382-10	TCGA-CC-A7IE-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c1caf517-5052-48e3-ad80-8458b3d2ff5f	ab81329b-c119-4a5a-863c-5b50f48cee3f	g.chr1:74507591C>G	ENST00000395089.1	-	6	1023	c.1024G>C	c.(1024-1026)Gat>Cat	p.D342H	LRRIQ3_ENST00000354431.4_Missense_Mutation_p.D342H			A6PVS8	LRIQ3_HUMAN	leucine-rich repeats and IQ motif containing 3	342										NS(2)|breast(1)|central_nervous_system(2)|endometrium(7)|kidney(5)|large_intestine(13)|liver(1)|lung(27)|ovary(3)|prostate(1)|skin(5)|soft_tissue(1)|upper_aerodigestive_tract(5)	73						AATTTTTCATCCACAATTTCA	0.308																																					p.D342H		Atlas-SNP	.											.	LRRIQ3	146	.	0			c.G1024C						.						35.0	35.0	35.0					1																	74507591		1815	4038	5853	SO:0001583	missense	127255	exon7			TTTCATCCACAAT	BX647210	CCDS41350.1	1p31.1	2008-06-12	2008-06-12	2008-06-12	ENSG00000162620	ENSG00000162620			28318	protein-coding gene	gene with protein product			"""leucine rich repeat containing 44"""	LRRC44		12477932	Standard	NM_001105659		Approved	MGC22773	uc001dfy.4	A6PVS8	OTTHUMG00000009508	ENST00000395089.1:c.1024G>C	chr1.hg19:g.74507591C>G	ENSP00000378524:p.Asp342His	48.0	0.0		60.0	8.0	NM_001105659	A6PVS9|Q6P5P7|Q6ZMV4|Q8WUE0	Missense_Mutation	SNP	ENST00000395089.1	hg19	CCDS41350.1	.	.	.	.	.	.	.	.	.	.	C	13.94	2.387115	0.42308	.	.	ENSG00000162620	ENST00000395089;ENST00000354431	T;T	0.12984	2.63;2.63	5.21	2.14	0.27477	.	0.533626	0.15733	N	0.247334	T	0.04952	0.0133	L	0.29908	0.895	0.09310	N	1	P	0.44578	0.838	P	0.47206	0.541	T	0.24657	-1.0154	10	0.52906	T	0.07	.	5.5334	0.16997	0.1583:0.6752:0.0:0.1666	.	342	A6PVS8	LRIQ3_HUMAN	H	342	ENSP00000378524:D342H;ENSP00000346414:D342H	ENSP00000346414:D342H	D	-	1	0	LRRIQ3	74280179	0.072000	0.21174	0.001000	0.08648	0.002000	0.02628	0.920000	0.28705	0.710000	0.31997	0.650000	0.86243	GAT	.	.		0.308	LRRIQ3-008	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316539.1	NM_145258	
FPGT-TNNI3K	100526835	hgsc.bcm.edu	37	1	74737339	74737339	+	Nonsense_Mutation	SNP	G	G	T			TCGA-CC-A7IE-01A-21D-A382-10	TCGA-CC-A7IE-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c1caf517-5052-48e3-ad80-8458b3d2ff5f	ab81329b-c119-4a5a-863c-5b50f48cee3f	g.chr1:74737339G>T	ENST00000370899.3	+	7	731	c.694G>T	c.(694-696)Gga>Tga	p.G232*	FPGT-TNNI3K_ENST00000370895.1_Nonsense_Mutation_p.G232*|TNNI3K_ENST00000370891.2_Nonsense_Mutation_p.G232*|TNNI3K_ENST00000326637.3_Nonsense_Mutation_p.G131*|FPGT-TNNI3K_ENST00000557284.2_Nonsense_Mutation_p.G245*	NM_001199327.1	NP_001186256			FPGT-TNNI3K readthrough																		ACAGCAGGTTGGATACGGTGG	0.423																																					p.G232X		Atlas-SNP	.											TNNI3K,caecum,carcinoma,0,1	.	.	.	0			c.G694T						.						187.0	178.0	181.0					1																	74737339		2203	4299	6502	SO:0001587	stop_gained	100526835	exon7			CAGGTTGGATACG			1p31.3	2014-03-14			ENSG00000259030	ENSG00000259030			42952	other	readthrough							Standard	NM_001112808		Approved		uc001dge.2		OTTHUMG00000166281	ENST00000370899.3:c.694G>T	chr1.hg19:g.74737339G>T	ENSP00000359936:p.Gly232*	95.0	0.0		113.0	13.0	NM_001112808		Nonsense_Mutation	SNP	ENST00000370899.3	hg19		.	.	.	.	.	.	.	.	.	.	G	38	6.713695	0.97784	.	.	ENSG00000259030;ENSG00000259030;ENSG00000259030;ENSG00000116783;ENSG00000116783	ENST00000370899;ENST00000370895;ENST00000557284;ENST00000370891;ENST00000326637	.	.	.	5.7	5.7	0.88788	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.59425	D	0.04	.	18.6094	0.91279	0.0:0.0:1.0:0.0	.	.	.	.	X	232;232;232;232;131	.	ENSP00000322251:G131X	G	+	1	0	RP11-653A5.2;AC093158.1	74509927	1.000000	0.71417	0.998000	0.56505	0.930000	0.56654	8.212000	0.89756	2.696000	0.92011	0.655000	0.94253	GGA	.	.		0.423	FPGT-TNNI3K-003	NOVEL	basic|appris_candidate|readthrough_transcript|exp_conf	protein_coding	protein_coding	OTTHUMT00000026438.3		
KIAA1107	23285	hgsc.bcm.edu	37	1	92648122	92648122	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-A7IE-01A-21D-A382-10	TCGA-CC-A7IE-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c1caf517-5052-48e3-ad80-8458b3d2ff5f	ab81329b-c119-4a5a-863c-5b50f48cee3f	g.chr1:92648122A>T	ENST00000370378.4	+	8	3666	c.3568A>T	c.(3568-3570)Act>Tct	p.T1190S	KIAA1107_ENST00000409154.4_Missense_Mutation_p.T1245S	NM_015237.2	NP_056052.2	Q9UPP5	K1107_HUMAN	KIAA1107	1245										breast(4)|central_nervous_system(1)|endometrium(3)|kidney(2)|prostate(1)|skin(3)	14						TTCTACAACTACTGAAAAAGC	0.343																																					p.T1190S		Atlas-SNP	.											.	KIAA1107	60	.	0			c.A3568T						.						19.0	17.0	18.0					1																	92648122		692	1591	2283	SO:0001583	missense	23285	exon8			ACAACTACTGAAA	AB029030	CCDS44172.1	1p22.1	2008-02-05			ENSG00000069712	ENSG00000069712			29192	protein-coding gene	gene with protein product						10470851	Standard	NM_015237		Approved		uc010otd.2	Q9UPP5	OTTHUMG00000010292	ENST00000370378.4:c.3568A>T	chr1.hg19:g.92648122A>T	ENSP00000359404:p.Thr1190Ser	459.0	0.0		459.0	72.0	NM_015237	O14767|Q8N3X7	Missense_Mutation	SNP	ENST00000370378.4	hg19	CCDS44172.1	.	.	.	.	.	.	.	.	.	.	A	6.407	0.443156	0.12164	.	.	ENSG00000069712	ENST00000409154;ENST00000370378	T;T	0.04862	3.55;3.54	5.96	2.12	0.27331	.	0.542200	0.19930	N	0.102885	T	0.01254	0.0041	L	0.37630	1.12	0.20196	N	0.999926	B	0.32753	0.383	B	0.34418	0.182	T	0.46034	-0.9220	10	0.13470	T	0.59	.	2.9237	0.05777	0.5056:0.2867:0.0774:0.1304	.	1190	E9PEZ5	.	S	1245;1190	ENSP00000386957:T1245S;ENSP00000359404:T1190S	ENSP00000359404:T1190S	T	+	1	0	KIAA1107	92420710	0.998000	0.40836	0.995000	0.50966	0.979000	0.70002	0.763000	0.26517	0.481000	0.27557	0.533000	0.62120	ACT	.	.		0.343	KIAA1107-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000028375.3	XM_034086	
CHIA	27159	hgsc.bcm.edu	37	1	111861237	111861237	+	Silent	SNP	C	C	T			TCGA-CC-A7IE-01A-21D-A382-10	TCGA-CC-A7IE-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c1caf517-5052-48e3-ad80-8458b3d2ff5f	ab81329b-c119-4a5a-863c-5b50f48cee3f	g.chr1:111861237C>T	ENST00000369740.1	+	9	955	c.852C>T	c.(850-852)ccC>ccT	p.P284P	CHIA_ENST00000343320.6_Silent_p.P284P|CHIA_ENST00000451398.2_Silent_p.P123P|RP5-1125M8.2_ENST00000426321.1_RNA|CHIA_ENST00000483391.1_Silent_p.P123P|CHIA_ENST00000430615.1_Silent_p.P176P|CHIA_ENST00000353665.6_Silent_p.P123P	NM_001258001.1|NM_201653.3	NP_001244930.1|NP_970615.2	Q9BZP6	CHIA_HUMAN	chitinase, acidic	284					apoptotic process (GO:0006915)|cell wall chitin metabolic process (GO:0006037)|chitin catabolic process (GO:0006032)|chitin metabolic process (GO:0006030)|digestion (GO:0007586)|immune response (GO:0006955)|polysaccharide catabolic process (GO:0000272)|positive regulation of chemokine secretion (GO:0090197)|production of molecular mediator involved in inflammatory response (GO:0002532)|response to fungus (GO:0009620)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	carbohydrate binding (GO:0030246)|chitin binding (GO:0008061)|chitinase activity (GO:0004568)|kinase binding (GO:0019900)|lysozyme activity (GO:0003796)			central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(3)|lung(9)|ovary(1)|skin(1)	23		all_cancers(81;3.23e-05)|all_epithelial(167;1.2e-05)|all_lung(203;0.000154)|Lung NSC(277;0.000304)		Colorectal(144;0.0115)|Lung(183;0.0292)|COAD - Colon adenocarcinoma(174;0.0314)|all cancers(265;0.0477)|Epithelial(280;0.0918)|LUSC - Lung squamous cell carcinoma(189;0.154)		TTGGTGCCCCCACCTCTGGTG	0.532																																					p.P284P		Atlas-SNP	.											.	CHIA	115	.	0			c.C852T						.						147.0	143.0	144.0					1																	111861237		2203	4300	6503	SO:0001819	synonymous_variant	27159	exon9			TGCCCCCACCTCT	AF290004	CCDS832.1, CCDS41368.1, CCDS58017.1	1p13.2	2008-05-14			ENSG00000134216	ENSG00000134216			17432	protein-coding gene	gene with protein product		606080				11085997	Standard	NM_021797		Approved	AMCase, TSA1902, CHIT2	uc001eas.4	Q9BZP6	OTTHUMG00000011165	ENST00000369740.1:c.852C>T	chr1.hg19:g.111861237C>T		157.0	0.0		149.0	27.0	NM_201653	Q32W79|Q32W80|Q3B866|Q5U5Z5|Q5VUV4|Q86UD8|Q9ULY3|Q9ULY4	Silent	SNP	ENST00000369740.1	hg19	CCDS41368.1																																																																																			.	.		0.532	CHIA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030710.1		
LOR	4014	hgsc.bcm.edu	37	1	153233779	153233779	+	Silent	SNP	C	C	G			TCGA-CC-A7IE-01A-21D-A382-10	TCGA-CC-A7IE-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c1caf517-5052-48e3-ad80-8458b3d2ff5f	ab81329b-c119-4a5a-863c-5b50f48cee3f	g.chr1:153233779C>G	ENST00000368742.3	+	2	411	c.354C>G	c.(352-354)ggC>ggG	p.G118G		NM_000427.2	NP_000418.2	P23490	LORI_HUMAN	loricrin	118					keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)	cornified envelope (GO:0001533)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	protein binding, bridging (GO:0030674)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			lung(2)	2	all_lung(78;3.35e-32)|Lung NSC(65;1.22e-30)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			cctccggtggcggcggctcct	0.766																																					p.G118G		Atlas-SNP	.											.	LOR	19	.	0			c.C354G						.																																			SO:0001819	synonymous_variant	4014	exon2			CGGTGGCGGCGGC	M61120	CCDS30870.1	1q21	2008-02-05			ENSG00000203782	ENSG00000203782			6663	protein-coding gene	gene with protein product		152445				2007607, 1355480	Standard	NM_000427		Approved		uc001fbm.3	P23490	OTTHUMG00000013938	ENST00000368742.3:c.354C>G	chr1.hg19:g.153233779C>G		31.0	0.0		29.0	6.0	NM_000427	Q5T869|Q5XKF8	Silent	SNP	ENST00000368742.3	hg19	CCDS30870.1																																																																																			.	.		0.766	LOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039107.1	NM_000427	
OR6P1	128366	hgsc.bcm.edu	37	1	158532474	158532474	+	Silent	SNP	G	G	A			TCGA-CC-A7IE-01A-21D-A382-10	TCGA-CC-A7IE-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c1caf517-5052-48e3-ad80-8458b3d2ff5f	ab81329b-c119-4a5a-863c-5b50f48cee3f	g.chr1:158532474G>A	ENST00000334632.1	-	1	920	c.921C>T	c.(919-921)ggC>ggT	p.G307G		NM_001160325.1	NP_001153797.1	Q8NGX9	OR6P1_HUMAN	olfactory receptor, family 6, subfamily P, member 1	307						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(4)|lung(1)	6						AGTGACATCTGCCCATCACTG	0.468																																					p.G307G		Atlas-SNP	.											.	OR6P1	47	.	0			c.C921T						.						92.0	73.0	79.0					1																	158532474		692	1591	2283	SO:0001819	synonymous_variant	128366	exon1			ACATCTGCCCATC	BK004193	CCDS53391.1	1q23.1	2012-08-09			ENSG00000186440	ENSG00000186440		"""GPCR / Class A : Olfactory receptors"""	15036	protein-coding gene	gene with protein product							Standard	NM_001160325		Approved		uc010pim.2	Q8NGX9	OTTHUMG00000019633	ENST00000334632.1:c.921C>T	chr1.hg19:g.158532474G>A		83.0	0.0		92.0	39.0	NM_001160325	Q6IFR9	Silent	SNP	ENST00000334632.1	hg19	CCDS53391.1																																																																																			.	.		0.468	OR6P1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051848.1		
SPTA1	6708	hgsc.bcm.edu	37	1	158583532	158583532	+	Missense_Mutation	SNP	A	A	T	rs536323126		TCGA-CC-A7IE-01A-21D-A382-10	TCGA-CC-A7IE-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c1caf517-5052-48e3-ad80-8458b3d2ff5f	ab81329b-c119-4a5a-863c-5b50f48cee3f	g.chr1:158583532A>T	ENST00000368147.4	-	50	7148	c.6968T>A	c.(6967-6969)cTg>cAg	p.L2323Q	SPTA1_ENST00000485680.1_5'Flank	NM_003126.2	NP_003117.2	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	2323	EF-hand 2. {ECO:0000255|PROSITE- ProRule:PRU00448}.				actin filament capping (GO:0051693)|actin filament organization (GO:0007015)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|lymphocyte homeostasis (GO:0002260)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of protein binding (GO:0032092)|positive regulation of T cell proliferation (GO:0042102)|regulation of cell shape (GO:0008360)	actin cytoskeleton (GO:0015629)|cuticular plate (GO:0032437)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)			NS(3)|breast(7)|cervix(1)|endometrium(22)|kidney(9)|large_intestine(29)|liver(2)|lung(183)|ovary(5)|prostate(18)|skin(11)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(6)	307	all_hematologic(112;0.0378)					CACAGCATCCAGGAACTTCTC	0.522																																					p.L2323Q		Atlas-SNP	.											.	SPTA1	720	.	0			c.T6968A						.						74.0	72.0	73.0					1																	158583532		1945	4143	6088	SO:0001583	missense	6708	exon50			GCATCCAGGAACT	M61877	CCDS41423.1	1q21	2014-06-23	2014-06-23		ENSG00000163554	ENSG00000163554		"""EF-hand domain containing"""	11272	protein-coding gene	gene with protein product	"""elliptocytosis 2"""	182860	"""spectrin, alpha, erythrocytic 1 (elliptocytosis 2)"""				Standard	NM_003126		Approved	EL2	uc001fst.1	P02549	OTTHUMG00000019636	ENST00000368147.4:c.6968T>A	chr1.hg19:g.158583532A>T	ENSP00000357129:p.Leu2323Gln	144.0	0.0		187.0	25.0	NM_003126	Q15514|Q5VYL1|Q5VYL2|Q6LDY5	Missense_Mutation	SNP	ENST00000368147.4	hg19	CCDS41423.1	.	.	.	.	.	.	.	.	.	.	A	22.5	4.301405	0.81136	.	.	ENSG00000163554	ENST00000368148;ENST00000368147	T;T	0.25414	1.8;1.8	5.1	5.1	0.69264	EF-hand-like domain (1);	0.000000	0.26800	N	0.022435	T	0.42698	0.1214	M	0.74647	2.275	0.52501	D	0.999952	D	0.89917	1.0	D	0.83275	0.996	T	0.45702	-0.9243	10	0.87932	D	0	.	13.8682	0.63600	1.0:0.0:0.0:0.0	.	2323	P02549	SPTA1_HUMAN	Q	2323;2320	ENSP00000357130:L2323Q;ENSP00000357129:L2320Q	ENSP00000357129:L2320Q	L	-	2	0	SPTA1	156850156	1.000000	0.71417	0.974000	0.42286	0.883000	0.51084	8.258000	0.89853	2.150000	0.67090	0.528000	0.53228	CTG	.	.		0.522	SPTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051851.3	NM_003126	
SPTA1	6708	hgsc.bcm.edu	37	1	158609400	158609400	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-A7IE-01A-21D-A382-10	TCGA-CC-A7IE-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c1caf517-5052-48e3-ad80-8458b3d2ff5f	ab81329b-c119-4a5a-863c-5b50f48cee3f	g.chr1:158609400A>T	ENST00000368147.4	-	35	5132	c.4952T>A	c.(4951-4953)cTa>cAa	p.L1651Q		NM_003126.2	NP_003117.2	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	1651					actin filament capping (GO:0051693)|actin filament organization (GO:0007015)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|lymphocyte homeostasis (GO:0002260)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of protein binding (GO:0032092)|positive regulation of T cell proliferation (GO:0042102)|regulation of cell shape (GO:0008360)	actin cytoskeleton (GO:0015629)|cuticular plate (GO:0032437)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)			NS(3)|breast(7)|cervix(1)|endometrium(22)|kidney(9)|large_intestine(29)|liver(2)|lung(183)|ovary(5)|prostate(18)|skin(11)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(6)	307	all_hematologic(112;0.0378)					TCTCTCCAATAGCTGATGCTT	0.473																																					p.L1651Q		Atlas-SNP	.											.	SPTA1	720	.	0			c.T4952A						.						174.0	166.0	168.0					1																	158609400		1911	4138	6049	SO:0001583	missense	6708	exon35			TCCAATAGCTGAT	M61877	CCDS41423.1	1q21	2014-06-23	2014-06-23		ENSG00000163554	ENSG00000163554		"""EF-hand domain containing"""	11272	protein-coding gene	gene with protein product	"""elliptocytosis 2"""	182860	"""spectrin, alpha, erythrocytic 1 (elliptocytosis 2)"""				Standard	NM_003126		Approved	EL2	uc001fst.1	P02549	OTTHUMG00000019636	ENST00000368147.4:c.4952T>A	chr1.hg19:g.158609400A>T	ENSP00000357129:p.Leu1651Gln	63.0	0.0		93.0	8.0	NM_003126	Q15514|Q5VYL1|Q5VYL2|Q6LDY5	Missense_Mutation	SNP	ENST00000368147.4	hg19	CCDS41423.1	.	.	.	.	.	.	.	.	.	.	A	26.1	4.707908	0.89018	.	.	ENSG00000163554	ENST00000368148;ENST00000368147	T;T	0.48201	0.82;0.82	5.35	5.35	0.76521	.	0.000000	0.26939	N	0.021725	T	0.60117	0.2244	M	0.83483	2.645	0.58432	D	0.999993	D	0.89917	1.0	D	0.81914	0.995	T	0.60167	-0.7316	10	0.17832	T	0.49	.	14.5989	0.68427	1.0:0.0:0.0:0.0	.	1651	P02549	SPTA1_HUMAN	Q	1651	ENSP00000357130:L1651Q;ENSP00000357129:L1651Q	ENSP00000357129:L1651Q	L	-	2	0	SPTA1	156876024	1.000000	0.71417	0.937000	0.37676	0.988000	0.76386	8.385000	0.90163	2.371000	0.80710	0.533000	0.62120	CTA	.	.		0.473	SPTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051851.3	NM_003126	
SPTA1	6708	hgsc.bcm.edu	37	1	158650442	158650442	+	Silent	SNP	G	G	A			TCGA-CC-A7IE-01A-21D-A382-10	TCGA-CC-A7IE-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c1caf517-5052-48e3-ad80-8458b3d2ff5f	ab81329b-c119-4a5a-863c-5b50f48cee3f	g.chr1:158650442G>A	ENST00000368147.4	-	5	789	c.609C>T	c.(607-609)ttC>ttT	p.F203F		NM_003126.2	NP_003117.2	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	203					actin filament capping (GO:0051693)|actin filament organization (GO:0007015)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|lymphocyte homeostasis (GO:0002260)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of protein binding (GO:0032092)|positive regulation of T cell proliferation (GO:0042102)|regulation of cell shape (GO:0008360)	actin cytoskeleton (GO:0015629)|cuticular plate (GO:0032437)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)	p.Q204fs*5(1)		NS(3)|breast(7)|cervix(1)|endometrium(22)|kidney(9)|large_intestine(29)|liver(2)|lung(183)|ovary(5)|prostate(18)|skin(11)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(6)	307	all_hematologic(112;0.0378)					GCTCCACTTGGAAGTCTTCAA	0.478																																					p.F203F		Atlas-SNP	.											SPTA1,NS,carcinoma,-2,1	SPTA1	720	.	1	Deletion - Frameshift(1)	endometrium(1)	c.C609T						.						134.0	134.0	134.0					1																	158650442		1902	4120	6022	SO:0001819	synonymous_variant	6708	exon5			CACTTGGAAGTCT	M61877	CCDS41423.1	1q21	2014-06-23	2014-06-23		ENSG00000163554	ENSG00000163554		"""EF-hand domain containing"""	11272	protein-coding gene	gene with protein product	"""elliptocytosis 2"""	182860	"""spectrin, alpha, erythrocytic 1 (elliptocytosis 2)"""				Standard	NM_003126		Approved	EL2	uc001fst.1	P02549	OTTHUMG00000019636	ENST00000368147.4:c.609C>T	chr1.hg19:g.158650442G>A		77.0	0.0		135.0	33.0	NM_003126	Q15514|Q5VYL1|Q5VYL2|Q6LDY5	Silent	SNP	ENST00000368147.4	hg19	CCDS41423.1																																																																																			.	.		0.478	SPTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051851.3	NM_003126	
NOS1AP	9722	hgsc.bcm.edu	37	1	162336963	162336963	+	Silent	SNP	T	T	C			TCGA-CC-A7IE-01A-21D-A382-10	TCGA-CC-A7IE-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c1caf517-5052-48e3-ad80-8458b3d2ff5f	ab81329b-c119-4a5a-863c-5b50f48cee3f	g.chr1:162336963T>C	ENST00000361897.5	+	10	1629	c.1227T>C	c.(1225-1227)gcT>gcC	p.A409A	RP11-565P22.6_ENST00000431696.1_Silent_p.A95A|NOS1AP_ENST00000530878.1_Silent_p.A404A|NOS1AP_ENST00000454693.1_3'UTR|NOS1AP_ENST00000493151.1_Silent_p.A114A	NM_001164757.1|NM_014697.2	NP_001158229.1|NP_055512.1	O75052	CAPON_HUMAN	nitric oxide synthase 1 (neuronal) adaptor protein	409					regulation of apoptotic process (GO:0042981)|regulation of nitric oxide biosynthetic process (GO:0045428)|regulation of nitric-oxide synthase activity (GO:0050999)		nitric-oxide synthase binding (GO:0050998)			NS(1)|breast(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(7)|lung(12)|skin(1)|upper_aerodigestive_tract(2)	32	all_hematologic(112;0.203)		BRCA - Breast invasive adenocarcinoma(70;0.0537)			CGGGCTTGGCTGACTTTGCCC	0.677																																					p.A409A		Atlas-SNP	.											.	NOS1AP	139	.	0			c.T1227C						.						61.0	69.0	66.0					1																	162336963		2203	4300	6503	SO:0001819	synonymous_variant	9722	exon10			CTTGGCTGACTTT	AB007933	CCDS1237.1, CCDS44267.1, CCDS53421.1	1q23.3	2010-08-20			ENSG00000198929	ENSG00000198929			16859	protein-coding gene	gene with protein product	"""C-terminal PDZ domain ligand of neuronal nitric oxide synthase"""	605551				9455484, 9459447	Standard	NM_001126060		Approved	KIAA0464, CAPON	uc001gbv.2	O75052	OTTHUMG00000024049	ENST00000361897.5:c.1227T>C	chr1.hg19:g.162336963T>C		86.0	0.0		92.0	9.0	NM_014697	B7ZLF5|O43564|Q3T551|Q5VU95	Silent	SNP	ENST00000361897.5	hg19	CCDS1237.1																																																																																			.	.		0.677	NOS1AP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000060555.2	NM_014697	
IER5	51278	hgsc.bcm.edu	37	1	181058762	181058762	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A7IE-01A-21D-A382-10	TCGA-CC-A7IE-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c1caf517-5052-48e3-ad80-8458b3d2ff5f	ab81329b-c119-4a5a-863c-5b50f48cee3f	g.chr1:181058762C>T	ENST00000367577.4	+	1	1125	c.724C>T	c.(724-726)Ccc>Tcc	p.P242S	RP11-309G3.3_ENST00000606938.1_lincRNA	NM_016545.4	NP_057629.2	Q5VY09	IER5_HUMAN	immediate early response 5	242										lung(1)|ovary(1)|pancreas(1)|urinary_tract(1)	4						GCTCAAGAAGCCCCGCCGGAA	0.736																																					p.P242S		Atlas-SNP	.											.	IER5	15	.	0			c.C724T						.						16.0	16.0	16.0					1																	181058762		2068	4075	6143	SO:0001583	missense	51278	exon1			AAGAAGCCCCGCC	BC000128	CCDS1343.1	1q25.3	2008-02-05			ENSG00000162783	ENSG00000162783			5393	protein-coding gene	gene with protein product		607177				10049588, 11102586	Standard	NM_016545		Approved		uc001got.4	Q5VY09	OTTHUMG00000035178	ENST00000367577.4:c.724C>T	chr1.hg19:g.181058762C>T	ENSP00000356549:p.Pro242Ser	86.0	0.0		116.0	22.0	NM_016545	B2RBV3|Q8WY68|Q9NY49|Q9NZP9	Missense_Mutation	SNP	ENST00000367577.4	hg19	CCDS1343.1	.	.	.	.	.	.	.	.	.	.	C	14.42	2.530484	0.45073	.	.	ENSG00000162783	ENST00000367577	T	0.10099	2.91	3.82	1.86	0.25419	.	0.193681	0.33110	U	0.005280	T	0.09598	0.0236	L	0.50333	1.59	0.32883	D	0.510825	B	0.29085	0.232	B	0.30855	0.121	T	0.16867	-1.0388	10	0.27785	T	0.31	.	6.6991	0.23215	0.0:0.7184:0.18:0.1016	.	242	Q5VY09	IER5_HUMAN	S	242	ENSP00000356549:P242S	ENSP00000356549:P242S	P	+	1	0	IER5	179325385	0.995000	0.38212	0.989000	0.46669	0.969000	0.65631	2.267000	0.43329	0.113000	0.18004	0.456000	0.33151	CCC	.	.		0.736	IER5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085142.1	NM_016545	
CACNA1E	777	hgsc.bcm.edu	37	1	181479649	181479649	+	Silent	SNP	C	C	A			TCGA-CC-A7IE-01A-21D-A382-10	TCGA-CC-A7IE-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c1caf517-5052-48e3-ad80-8458b3d2ff5f	ab81329b-c119-4a5a-863c-5b50f48cee3f	g.chr1:181479649C>A	ENST00000367573.2	+	2	303	c.303C>A	c.(301-303)gcC>gcA	p.A101A	CACNA1E_ENST00000526775.1_Silent_p.A101A|CACNA1E_ENST00000358338.5_Silent_p.A52A|CACNA1E_ENST00000367570.1_Silent_p.A101A|CACNA1E_ENST00000367567.4_5'UTR|CACNA1E_ENST00000360108.3_Silent_p.A101A|CACNA1E_ENST00000357570.5_Silent_p.A52A	NM_001205293.1	NP_001192222.1	Q15878	CAC1E_HUMAN	calcium channel, voltage-dependent, R type, alpha 1E subunit	101					calcium ion import (GO:0070509)|energy reserve metabolic process (GO:0006112)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	calcium ion binding (GO:0005509)|high voltage-gated calcium channel activity (GO:0008331)|voltage-gated calcium channel activity (GO:0005245)			NS(2)|breast(9)|central_nervous_system(3)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(6)|kidney(4)|large_intestine(34)|lung(99)|ovary(6)|pancreas(1)|prostate(9)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	204						CCATCATTGCCAACTGCATCG	0.552																																					p.A101A		Atlas-SNP	.											.	CACNA1E	778	.	0			c.C303A						.						125.0	125.0	125.0					1																	181479649		2124	4228	6352	SO:0001819	synonymous_variant	777	exon2			CATTGCCAACTGC	AK096563	CCDS53443.1, CCDS55664.1, CCDS55665.1	1q25.3	2013-01-10	2007-02-16		ENSG00000198216	ENSG00000198216		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"", ""EF-hand domain containing"""	1392	protein-coding gene	gene with protein product		601013		CACNL1A6		8388125, 16382099	Standard	NM_001205293		Approved	Cav2.3, BII, CACH6	uc009wxt.3	Q15878	OTTHUMG00000037301	ENST00000367573.2:c.303C>A	chr1.hg19:g.181479649C>A		124.0	0.0		134.0	25.0	NM_001205293	B1AM12|B1AM13|B1AM14|Q14580|Q14581	Silent	SNP	ENST00000367573.2	hg19	CCDS55664.1																																																																																			.	.		0.552	CACNA1E-003	KNOWN	non_canonical_U12|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000090793.2	NM_000721	
CR2	1380	hgsc.bcm.edu	37	1	207647159	207647159	+	Missense_Mutation	SNP	T	T	A	rs566892752		TCGA-CC-A7IE-01A-21D-A382-10	TCGA-CC-A7IE-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c1caf517-5052-48e3-ad80-8458b3d2ff5f	ab81329b-c119-4a5a-863c-5b50f48cee3f	g.chr1:207647159T>A	ENST00000367058.3	+	11	2181	c.1992T>A	c.(1990-1992)caT>caA	p.H664Q	CR2_ENST00000367059.3_Missense_Mutation_p.H664Q|CR2_ENST00000458541.2_Missense_Mutation_p.H637Q|CR2_ENST00000367057.3_Missense_Mutation_p.H723Q	NM_001877.4	NP_001868.2	P20023	CR2_HUMAN	complement component (3d/Epstein Barr virus) receptor 2	664	Sushi 11. {ECO:0000255|PROSITE- ProRule:PRU00302}.				B cell differentiation (GO:0030183)|B cell proliferation (GO:0042100)|complement activation, classical pathway (GO:0006958)|immune response (GO:0006955)|innate immune response (GO:0045087)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	complement binding (GO:0001848)|complement receptor activity (GO:0004875)|DNA binding (GO:0003677)|protein homodimerization activity (GO:0042803)|transmembrane signaling receptor activity (GO:0004888)			NS(2)|breast(3)|endometrium(4)|kidney(3)|large_intestine(12)|lung(26)|ovary(1)|pancreas(1)|prostate(1)|skin(12)|upper_aerodigestive_tract(3)|urinary_tract(1)	69						CATGCCAGCATGTGAGACAGA	0.423																																					p.H723Q		Atlas-SNP	.											.	CR2	164	.	0			c.T2169A						.						129.0	130.0	129.0					1																	207647159		2203	4300	6503	SO:0001583	missense	1380	exon12			CCAGCATGTGAGA	M26004	CCDS1478.1, CCDS31007.1	1q32	2014-09-17			ENSG00000117322	ENSG00000117322		"""CD molecules"", ""Complement system"""	2336	protein-coding gene	gene with protein product		120650					Standard	NM_001006658		Approved	CD21	uc001hfv.3	P20023	OTTHUMG00000036307	ENST00000367058.3:c.1992T>A	chr1.hg19:g.207647159T>A	ENSP00000356025:p.His664Gln	90.0	0.0		149.0	19.0	NM_001006658	C9JHD2|Q13866|Q14212|Q53EL2|Q5BKT9|Q5SR46|Q5SR48	Missense_Mutation	SNP	ENST00000367058.3	hg19	CCDS1478.1	.	.	.	.	.	.	.	.	.	.	T	12.56	1.973641	0.34848	.	.	ENSG00000117322	ENST00000367058;ENST00000367057;ENST00000367059;ENST00000458541	T;T;T;T	0.47528	1.9;0.84;1.9;1.9	5.47	0.472	0.16758	Complement control module (1);Sushi/SCR/CCP (2);	.	.	.	.	T	0.22820	0.0551	N	0.08118	0	0.09310	N	1	B;B;B	0.21225	0.011;0.053;0.016	B;B;B	0.23574	0.034;0.043;0.047	T	0.23904	-1.0175	9	0.21540	T	0.41	.	4.5686	0.12198	0.0:0.2594:0.1579:0.5827	.	664;664;723	Q5SR47;P20023;P20023-3	.;CR2_HUMAN;.	Q	664;723;664;637	ENSP00000356025:H664Q;ENSP00000356024:H723Q;ENSP00000356026:H664Q;ENSP00000404222:H637Q	ENSP00000356024:H723Q	H	+	3	2	CR2	205713782	0.000000	0.05858	0.019000	0.16419	0.379000	0.30106	-0.058000	0.11750	0.067000	0.16545	0.533000	0.62120	CAT	.	.		0.423	CR2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000088274.1	NM_001877	
KIF3C	3797	hgsc.bcm.edu	37	2	26203290	26203290	+	Missense_Mutation	SNP	G	G	C			TCGA-CC-A7IE-01A-21D-A382-10	TCGA-CC-A7IE-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c1caf517-5052-48e3-ad80-8458b3d2ff5f	ab81329b-c119-4a5a-863c-5b50f48cee3f	g.chr2:26203290G>C	ENST00000264712.3	-	1	2076	c.1497C>G	c.(1495-1497)gaC>gaG	p.D499E	KIF3C_ENST00000405914.1_Missense_Mutation_p.D499E	NM_002254.6	NP_002245	O14782	KIF3C_HUMAN	kinesin family member 3C	499					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|cytoskeleton-dependent intracellular transport (GO:0030705)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|organelle transport along microtubule (GO:0072384)	cytosol (GO:0005829)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			breast(3)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(8)|ovary(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	29	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CCCGCCGCAGGTCCTCCAGCA	0.642																																					p.D499E		Atlas-SNP	.											.	KIF3C	79	.	0			c.C1497G						.						61.0	59.0	60.0					2																	26203290		2203	4300	6503	SO:0001583	missense	3797	exon1			CCGCAGGTCCTCC		CCDS1719.1	2p23	2008-02-05			ENSG00000084731	ENSG00000084731		"""Kinesins"""	6321	protein-coding gene	gene with protein product		602845				9480755	Standard	NM_002254		Approved		uc002rgu.2	O14782	OTTHUMG00000094797	ENST00000264712.3:c.1497C>G	chr2.hg19:g.26203290G>C	ENSP00000264712:p.Asp499Glu	69.0	0.0		81.0	25.0	NM_002254	O43544|Q4ZG18|Q53SX5|Q562F7	Missense_Mutation	SNP	ENST00000264712.3	hg19	CCDS1719.1	.	.	.	.	.	.	.	.	.	.	G	4.176	0.031237	0.08101	.	.	ENSG00000084731	ENST00000264712;ENST00000542511;ENST00000405914	T;T	0.70869	-0.52;-0.52	5.62	1.17	0.20885	.	0.237978	0.47852	N	0.000220	T	0.37544	0.1007	N	0.04820	-0.15	0.34777	D	0.734384	B;B	0.26258	0.014;0.145	B;B	0.20955	0.01;0.032	T	0.29088	-1.0023	10	0.07644	T	0.81	.	4.2636	0.10752	0.3725:0.0:0.4803:0.1472	.	499;499	B7ZM25;O14782	.;KIF3C_HUMAN	E	499;305;499	ENSP00000264712:D499E;ENSP00000385030:D499E	ENSP00000264712:D499E	D	-	3	2	KIF3C	26056794	0.996000	0.38824	0.995000	0.50966	0.988000	0.76386	0.357000	0.20199	-0.070000	0.12908	-0.136000	0.14681	GAC	.	.		0.642	KIF3C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211611.1		
FAM98A	25940	hgsc.bcm.edu	37	2	33810623	33810623	+	Nonsense_Mutation	SNP	C	C	A			TCGA-CC-A7IE-01A-21D-A382-10	TCGA-CC-A7IE-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c1caf517-5052-48e3-ad80-8458b3d2ff5f	ab81329b-c119-4a5a-863c-5b50f48cee3f	g.chr2:33810623C>A	ENST00000238823.8	-	7	1002	c.862G>T	c.(862-864)Gaa>Taa	p.E288*	FAM98A_ENST00000403368.1_Nonsense_Mutation_p.E288*|FAM98A_ENST00000498340.1_5'Flank|FAM98A_ENST00000441530.2_Nonsense_Mutation_p.E93*			Q8NCA5	FA98A_HUMAN	family with sequence similarity 98, member A	289							poly(A) RNA binding (GO:0044822)			NS(1)|breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(12)|ovary(1)|prostate(1)|skin(1)	24	all_hematologic(175;0.115)					GCAGTCTTTTCTCTTATAGAG	0.348																																					p.E288X		Atlas-SNP	.											.	FAM98A	42	.	0			c.G862T						.						55.0	57.0	56.0					2																	33810623		2203	4300	6503	SO:0001587	stop_gained	25940	exon7			TCTTTTCTCTTAT		CCDS33179.1	2p22.3	2006-11-29		2005-11-20	ENSG00000119812	ENSG00000119812			24520	protein-coding gene	gene with protein product						12477932	Standard	NM_015475		Approved	DKFZP564F0522	uc002rpa.1	Q8NCA5	OTTHUMG00000152152	ENST00000238823.8:c.862G>T	chr2.hg19:g.33810623C>A	ENSP00000238823:p.Glu288*	222.0	0.0		232.0	62.0	NM_015475	B2RNA2|Q9Y3Y6	Nonsense_Mutation	SNP	ENST00000238823.8	hg19	CCDS33179.1	.	.	.	.	.	.	.	.	.	.	C	18.26	3.585137	0.66105	.	.	ENSG00000119812	ENST00000238823;ENST00000395190;ENST00000403368;ENST00000441530	.	.	.	5.37	5.37	0.77165	.	0.052327	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.07175	T	0.84	-17.6522	19.4591	0.94908	0.0:1.0:0.0:0.0	.	.	.	.	X	288;289;288;93	.	ENSP00000238823:E288X	E	-	1	0	FAM98A	33664127	1.000000	0.71417	1.000000	0.80357	0.807000	0.45602	5.866000	0.69590	2.681000	0.91329	0.313000	0.20887	GAA	.	.		0.348	FAM98A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325457.2	NM_015475	
SLC8A1	6546	hgsc.bcm.edu	37	2	40656977	40656977	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A7IE-01A-21D-A382-10	TCGA-CC-A7IE-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c1caf517-5052-48e3-ad80-8458b3d2ff5f	ab81329b-c119-4a5a-863c-5b50f48cee3f	g.chr2:40656977C>A	ENST00000403092.1	-	2	477	c.444G>T	c.(442-444)gaG>gaT	p.E148D	SLC8A1_ENST00000332839.4_Missense_Mutation_p.E148D|SLC8A1_ENST00000542756.1_Missense_Mutation_p.E148D|SLC8A1_ENST00000405269.1_Missense_Mutation_p.E148D|SLC8A1_ENST00000406391.2_Missense_Mutation_p.E148D|SLC8A1_ENST00000402441.1_Missense_Mutation_p.E148D|SLC8A1_ENST00000542024.1_Missense_Mutation_p.E148D|SLC8A1_ENST00000406785.2_Missense_Mutation_p.E148D|SLC8A1_ENST00000408028.2_Missense_Mutation_p.E148D|SLC8A1_ENST00000405901.3_Missense_Mutation_p.E148D			P32418	NAC1_HUMAN	solute carrier family 8 (sodium/calcium exchanger), member 1	148					blood coagulation (GO:0007596)|calcium ion export (GO:1901660)|calcium ion homeostasis (GO:0055074)|calcium ion import (GO:0070509)|calcium ion transport into cytosol (GO:0060402)|cardiac muscle cell development (GO:0055013)|cardiac muscle contraction (GO:0060048)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular response to caffeine (GO:0071313)|cellular response to reactive oxygen species (GO:0034614)|cellular sodium ion homeostasis (GO:0006883)|cytosolic calcium ion transport (GO:0060401)|embryonic heart tube development (GO:0035050)|embryonic placenta development (GO:0001892)|heart morphogenesis (GO:0003007)|ion transport (GO:0006811)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|muscle contraction (GO:0006936)|muscle fiber development (GO:0048747)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|post-embryonic development (GO:0009791)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of the force of heart contraction (GO:0002026)|relaxation of cardiac muscle (GO:0055119)|relaxation of smooth muscle (GO:0044557)|sodium ion export (GO:0071436)|sodium ion import (GO:0097369)|transmembrane transport (GO:0055085)|vascular smooth muscle contraction (GO:0014829)	basolateral plasma membrane (GO:0016323)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|calcium:sodium antiporter activity (GO:0005432)|cytoskeletal protein binding (GO:0008092)|ion channel binding (GO:0044325)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(1)|endometrium(7)|kidney(5)|large_intestine(14)|liver(1)|lung(57)|ovary(2)|pancreas(1)|skin(7)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(2)	100					Alpha-Linolenic Acid(DB00132)|Icosapent(DB00159)	AAAGGAGAATCTCAGGAGCAG	0.468																																					p.E148D		Atlas-SNP	.											SLC8A1,NS,carcinoma,0,1	SLC8A1	221	.	0			c.G444T						.						127.0	117.0	120.0					2																	40656977		2203	4300	6503	SO:0001583	missense	6546	exon1			GAGAATCTCAGGA		CCDS1806.1, CCDS46264.1, CCDS46265.1, CCDS59430.1	2p22.1	2013-07-15			ENSG00000183023	ENSG00000183023		"""Solute carriers"""	11068	protein-coding gene	gene with protein product	"""Na+/Ca++ exchanger"""	182305		NCX1		1559714	Standard	NM_021097		Approved		uc002rrx.3	P32418	OTTHUMG00000102183	ENST00000403092.1:c.444G>T	chr2.hg19:g.40656977C>A	ENSP00000384763:p.Glu148Asp	62.0	0.0		91.0	34.0	NM_001252624	A8K6N1|D6W595|O95849|Q4QQG6|Q587I6|Q59GN4|Q9UBL8|Q9UD55|Q9UDN1|Q9UDN2|Q9UKX6	Missense_Mutation	SNP	ENST00000403092.1	hg19	CCDS1806.1	.	.	.	.	.	.	.	.	.	.	C	15.18	2.756586	0.49362	.	.	ENSG00000183023	ENST00000406785;ENST00000378715;ENST00000542756;ENST00000403092;ENST00000405901;ENST00000402441;ENST00000405269;ENST00000332839;ENST00000408028;ENST00000535962;ENST00000406391;ENST00000542024	T;T;T;T;T;T;T;T;T;T	0.70516	-0.49;-0.49;-0.49;-0.49;-0.49;-0.49;-0.49;-0.49;-0.49;-0.49	5.59	3.8	0.43715	Sodium/calcium exchanger membrane region (1);	0.048392	0.85682	D	0.000000	D	0.84795	0.5551	M	0.91510	3.215	0.80722	D	1	D;D;D;D;D	0.89917	1.0;0.988;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;0.992;1.0;1.0;1.0	D	0.84502	0.0617	10	0.87932	D	0	.	7.5544	0.27817	0.0:0.7416:0.0:0.2584	.	148;148;148;148;148	P32418-4;P32418-2;P32418-3;F6VPY9;P32418	.;.;.;.;NAC1_HUMAN	D	148	ENSP00000383886:E148D;ENSP00000440727:E148D;ENSP00000384763:E148D;ENSP00000385678:E148D;ENSP00000385188:E148D;ENSP00000385535:E148D;ENSP00000332931:E148D;ENSP00000384908:E148D;ENSP00000385811:E148D;ENSP00000443515:E148D	ENSP00000332931:E148D	E	-	3	2	SLC8A1	40510481	1.000000	0.71417	0.999000	0.59377	0.993000	0.82548	0.814000	0.27239	0.734000	0.32515	0.563000	0.77884	GAG	.	.		0.468	SLC8A1-010	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326065.1	NM_021097	
KIAA1841	84542	hgsc.bcm.edu	37	2	61298747	61298747	+	Nonsense_Mutation	SNP	A	A	T			TCGA-CC-A7IE-01A-21D-A382-10	TCGA-CC-A7IE-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c1caf517-5052-48e3-ad80-8458b3d2ff5f	ab81329b-c119-4a5a-863c-5b50f48cee3f	g.chr2:61298747A>T	ENST00000402291.1	+	4	398	c.157A>T	c.(157-159)Aaa>Taa	p.K53*	KIAA1841_ENST00000482513.1_3'UTR|KIAA1841_ENST00000356719.2_Nonsense_Mutation_p.K53*|KIAA1841_ENST00000453873.1_Nonsense_Mutation_p.K53*|KIAA1841_ENST00000295031.5_Nonsense_Mutation_p.K53*	NM_001129993.1	NP_001123465.1	Q6NSI8	K1841_HUMAN	KIAA1841	53										breast(3)|kidney(1)|large_intestine(4)|lung(12)|ovary(1)|skin(2)|stomach(1)|urinary_tract(1)	25			Epithelial(17;0.193)			ACAGTGTGCAAAAAGGTTTGA	0.408																																					p.K53X		Atlas-SNP	.											.	KIAA1841	95	.	0			c.A157T						.						59.0	61.0	61.0					2																	61298747		2203	4300	6503	SO:0001587	stop_gained	84542	exon4			TGTGCAAAAAGGT	BC070104	CCDS1867.1, CCDS46296.1	2p15	2010-06-22			ENSG00000162929	ENSG00000162929			29387	protein-coding gene	gene with protein product						11347906	Standard	NM_032506		Approved		uc002saw.4	Q6NSI8	OTTHUMG00000129421	ENST00000402291.1:c.157A>T	chr2.hg19:g.61298747A>T	ENSP00000385579:p.Lys53*	99.0	0.0		148.0	44.0	NM_032506	Q49AF0|Q6ZND0|Q96JI6	Nonsense_Mutation	SNP	ENST00000402291.1	hg19	CCDS46296.1	.	.	.	.	.	.	.	.	.	.	A	36	5.819980	0.96989	.	.	ENSG00000162929	ENST00000402291;ENST00000295031;ENST00000356719;ENST00000453873	.	.	.	5.71	5.71	0.89125	.	0.126684	0.56097	D	0.000029	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-20.4043	15.9958	0.80243	1.0:0.0:0.0:0.0	.	.	.	.	X	53	.	ENSP00000295031:K53X	K	+	1	0	KIAA1841	61152251	1.000000	0.71417	0.998000	0.56505	0.996000	0.88848	4.478000	0.60230	2.188000	0.69820	0.533000	0.62120	AAA	.	.		0.408	KIAA1841-003	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325477.1	NM_032506	
TTC31	64427	hgsc.bcm.edu	37	2	74718274	74718274	+	Missense_Mutation	SNP	G	G	T	rs368112249		TCGA-CC-A7IE-01A-21D-A382-10	TCGA-CC-A7IE-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c1caf517-5052-48e3-ad80-8458b3d2ff5f	ab81329b-c119-4a5a-863c-5b50f48cee3f	g.chr2:74718274G>T	ENST00000233623.5	+	6	573	c.566G>T	c.(565-567)cGa>cTa	p.R189L	TTC31_ENST00000463189.1_3'UTR|TTC31_ENST00000410003.1_Missense_Mutation_p.R189L|TTC31_ENST00000442235.2_Missense_Mutation_p.R45L	NM_022492.4	NP_071937.4	Q49AM3	TTC31_HUMAN	tetratricopeptide repeat domain 31	189										breast(1)|endometrium(1)|large_intestine(4)|lung(2)|skin(1)	9						GAACGGAAGCGACAGGAGCGT	0.488																																					p.R189L		Atlas-SNP	.											.	TTC31	23	.	0			c.G566T						.						121.0	123.0	122.0					2																	74718274		2065	4199	6264	SO:0001583	missense	64427	exon6			GGAAGCGACAGGA	AK026819	CCDS42701.1	2p13.1	2013-01-11			ENSG00000115282	ENSG00000115282		"""Tetratricopeptide (TTC) repeat domain containing"""	25759	protein-coding gene	gene with protein product						12477932	Standard	NM_022492		Approved	FLJ12788	uc002slt.2	Q49AM3	OTTHUMG00000152887	ENST00000233623.5:c.566G>T	chr2.hg19:g.74718274G>T	ENSP00000233623:p.Arg189Leu	111.0	0.0		152.0	52.0	NM_022492	Q4KN40|Q53FD4|Q9H9F7	Missense_Mutation	SNP	ENST00000233623.5	hg19	CCDS42701.1	.	.	.	.	.	.	.	.	.	.	G	15.64	2.892047	0.52014	.	.	ENSG00000115282	ENST00000545977;ENST00000410003;ENST00000441635;ENST00000442235;ENST00000233623	T;T;T	0.68479	1.0;0.4;-0.33	3.85	1.96	0.26148	.	0.351137	0.24975	N	0.034108	T	0.54208	0.1844	L	0.49350	1.555	0.09310	N	1	B;B;B;B	0.15141	0.004;0.012;0.002;0.004	B;B;B;B	0.15052	0.012;0.005;0.003;0.008	T	0.51450	-0.8704	10	0.72032	D	0.01	-7.975	4.1987	0.10455	0.123:0.0:0.6108:0.2663	.	45;159;189;118	B4DZV1;Q86XF2;Q49AM3;F5H175	.;.;TTC31_HUMAN;.	L	118;189;189;45;189	ENSP00000387213:R189L;ENSP00000416823:R45L;ENSP00000233623:R189L	ENSP00000233623:R189L	R	+	2	0	TTC31	74571782	0.784000	0.28713	0.102000	0.21198	0.989000	0.77384	-0.061000	0.11693	0.547000	0.28938	0.561000	0.74099	CGA	.	.		0.488	TTC31-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328422.1	NM_022492	
LRP1B	53353	hgsc.bcm.edu	37	2	141083347	141083347	+	Silent	SNP	A	A	C			TCGA-CC-A7IE-01A-21D-A382-10	TCGA-CC-A7IE-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c1caf517-5052-48e3-ad80-8458b3d2ff5f	ab81329b-c119-4a5a-863c-5b50f48cee3f	g.chr2:141083347A>C	ENST00000389484.3	-	80	13295	c.12324T>G	c.(12322-12324)tcT>tcG	p.S4108S		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	4108					protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)			NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		TGCTGCTGACAGAGACTACTG	0.358										TSP Lung(27;0.18)																											p.S4108S	Colon(99;50 2074 2507 20106)	Atlas-SNP	.											.	LRP1B	1315	.	0			c.T12324G						.						107.0	97.0	100.0					2																	141083347		2203	4300	6503	SO:0001819	synonymous_variant	53353	exon80			GCTGACAGAGACT	AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.12324T>G	chr2.hg19:g.141083347A>C		95.0	0.0		120.0	43.0	NM_018557	Q8WY29|Q8WY30|Q8WY31	Silent	SNP	ENST00000389484.3	hg19	CCDS2182.1	.	.	.	.	.	.	.	.	.	.	A	1.845	-0.466487	0.04476	.	.	ENSG00000168702	ENST00000437977	.	.	.	5.22	-2.71	0.05986	.	.	.	.	.	T	0.50394	0.1613	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.44003	-0.9356	4	.	.	.	.	6.904	0.24299	0.4589:0.0:0.4211:0.12	.	.	.	.	R	340	.	.	L	-	2	0	LRP1B	140799817	0.057000	0.20700	0.811000	0.32455	0.204000	0.24138	-0.417000	0.07088	-0.523000	0.06409	-1.150000	0.01838	CTG	.	.		0.358	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254736.2	NM_018557	
ZEB2	9839	hgsc.bcm.edu	37	2	145182398	145182399	+	Missense_Mutation	DNP	TC	TC	AA			TCGA-CC-A7IE-01A-21D-A382-10	TCGA-CC-A7IE-10A-01D-A385-10	T|C	T|C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c1caf517-5052-48e3-ad80-8458b3d2ff5f	ab81329b-c119-4a5a-863c-5b50f48cee3f	g.chr2:145182398_145182399TC>AA	ENST00000558170.2	-	4	1551_1552	c.367_368GA>TT	c.(367-369)GAa>TTa	p.E123L	ZEB2_ENST00000539609.3_Intron|ZEB2_ENST00000409487.3_Missense_Mutation_p.E123L|ZEB2_ENST00000303660.4_Missense_Mutation_p.E123L	NM_014795.3	NP_055610.1	O60315	ZEB2_HUMAN	zinc finger E-box binding homeobox 2	123					cell proliferation in forebrain (GO:0021846)|developmental pigmentation (GO:0048066)|hippocampus development (GO:0021766)|melanocyte migration (GO:0097324)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|neural crest cell migration (GO:0001755)|neural tube closure (GO:0001843)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of melanin biosynthetic process (GO:0048023)|positive regulation of melanocyte differentiation (GO:0045636)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of melanosome organization (GO:1903056)|somitogenesis (GO:0001756)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|phosphatase regulator activity (GO:0019208)			breast(3)|central_nervous_system(1)|cervix(2)|endometrium(7)|kidney(6)|large_intestine(23)|lung(45)|ovary(5)|pancreas(2)|prostate(6)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	107				BRCA - Breast invasive adenocarcinoma(221;0.112)		GATCGTGGCTTCTGGCCCCATA	0.446																																					p.E123V|p.E123X	Melanoma(33;1235 1264 5755 16332)	Atlas-SNP	.											.	ZEB2	218	.	0			c.A368T|c.G367T						.																																			SO:0001583	missense	9839	exon4			GTGGCTTCTGGCC|TGGCTTCTGGCCC	AB011141	CCDS2186.1, CCDS54403.1	2q22.3	2013-01-08	2007-02-15	2007-02-15	ENSG00000169554	ENSG00000169554		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	14881	protein-coding gene	gene with protein product	"""SMAD interacting protein 1"""	605802	"""zinc finger homeobox 1b"""	ZFHX1B			Standard	NM_014795		Approved	KIAA0569, SIP-1, SIP1	uc002tvu.3	O60315	OTTHUMG00000131834	ENST00000558170.2:c.367_368delinsAA	chr2.hg19:g.145182398_145182399delinsAA	ENSP00000454157:p.Glu123Leu	101.0|100.0	0.0		118.0|116.0	34.0|33.0	NM_014795	A0JP09|B7Z2P2|F5H814|Q9UED1	Missense_Mutation|Nonsense_Mutation	SNP	ENST00000558170.2	hg19	CCDS2186.1																																																																																			.	.		0.446	ZEB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254778.5	NM_014795	
CRYGA	1418	hgsc.bcm.edu	37	2	209028038	209028038	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A7IE-01A-21D-A382-10	TCGA-CC-A7IE-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c1caf517-5052-48e3-ad80-8458b3d2ff5f	ab81329b-c119-4a5a-863c-5b50f48cee3f	g.chr2:209028038G>T	ENST00000304502.4	-	2	161	c.142C>A	c.(142-144)Cgt>Agt	p.R48S		NM_014617.3	NP_055432.2	P11844	CRGA_HUMAN	crystallin, gamma A	48	Beta/gamma crystallin 'Greek key' 2. {ECO:0000255|PROSITE-ProRule:PRU00028}.				lens development in camera-type eye (GO:0002088)|visual perception (GO:0007601)		structural constituent of eye lens (GO:0005212)			endometrium(1)|kidney(3)|large_intestine(1)|lung(7)	12				Epithelial(149;0.067)|LUSC - Lung squamous cell carcinoma(261;0.0708)|Lung(261;0.135)		TAATTGGGACGCTCATAGAGC	0.587																																					p.R48S		Atlas-SNP	.											.	CRYGA	31	.	0			c.C142A						.						52.0	57.0	55.0					2																	209028038		2203	4300	6503	SO:0001583	missense	1418	exon2			TGGGACGCTCATA		CCDS33367.1	2q34	2013-02-14			ENSG00000168582	ENSG00000168582			2408	protein-coding gene	gene with protein product	"""gamma crystallin 5"""	123660		CRYG1			Standard	NM_014617		Approved	CRYG5, CRY-g-A		P11844	OTTHUMG00000154796	ENST00000304502.4:c.142C>A	chr2.hg19:g.209028038G>T	ENSP00000302105:p.Arg48Ser	123.0	0.0		212.0	73.0	NM_014617	Q53ST5	Missense_Mutation	SNP	ENST00000304502.4	hg19	CCDS33367.1	.	.	.	.	.	.	.	.	.	.	G	15.10	2.732041	0.48939	.	.	ENSG00000168582	ENST00000304502	T	0.74947	-0.89	4.64	3.76	0.43208	Beta/gamma crystallin (5);Gamma-crystallin-related (1);	0.188078	0.46145	D	0.000305	T	0.73442	0.3587	M	0.89353	3.025	0.47659	D	0.999486	P	0.44309	0.832	B	0.36989	0.238	T	0.76599	-0.2900	10	0.66056	D	0.02	.	7.4831	0.27417	0.1939:0.0:0.8061:0.0	.	48	P11844	CRGA_HUMAN	S	48	ENSP00000302105:R48S	ENSP00000302105:R48S	R	-	1	0	CRYGA	208736283	0.380000	0.25131	1.000000	0.80357	0.990000	0.78478	0.842000	0.27627	1.287000	0.44583	0.655000	0.94253	CGT	.	.		0.587	CRYGA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337096.1	NM_014617	
CPS1	1373	hgsc.bcm.edu	37	2	211459263	211459263	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A7IE-01A-21D-A382-10	TCGA-CC-A7IE-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c1caf517-5052-48e3-ad80-8458b3d2ff5f	ab81329b-c119-4a5a-863c-5b50f48cee3f	g.chr2:211459263A>G	ENST00000233072.5	+	12	1392	c.1196A>G	c.(1195-1197)aAg>aGg	p.K399R	CPS1_ENST00000451903.2_5'UTR|CPS1_ENST00000430249.2_Missense_Mutation_p.K405R	NM_001875.4	NP_001866.2	P31327	CPSM_HUMAN	carbamoyl-phosphate synthase 1, mitochondrial	399	Glutamine amidotransferase type-1.				anion homeostasis (GO:0055081)|carbamoyl phosphate biosynthetic process (GO:0070409)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to cAMP (GO:0071320)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cellular response to glucagon stimulus (GO:0071377)|cellular response to oleic acid (GO:0071400)|citrulline biosynthetic process (GO:0019240)|glutamine catabolic process (GO:0006543)|glycogen catabolic process (GO:0005980)|hepatocyte differentiation (GO:0070365)|homocysteine metabolic process (GO:0050667)|midgut development (GO:0007494)|nitric oxide metabolic process (GO:0046209)|positive regulation of vasodilation (GO:0045909)|response to amine (GO:0014075)|response to amino acid (GO:0043200)|response to dexamethasone (GO:0071548)|response to drug (GO:0042493)|response to food (GO:0032094)|response to growth hormone (GO:0060416)|response to lipopolysaccharide (GO:0032496)|response to starvation (GO:0042594)|response to toxic substance (GO:0009636)|response to zinc ion (GO:0010043)|small molecule metabolic process (GO:0044281)|triglyceride catabolic process (GO:0019433)|urea cycle (GO:0000050)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|carbamoyl-phosphate synthase (ammonia) activity (GO:0004087)|endopeptidase activity (GO:0004175)|glutamate binding (GO:0016595)|modified amino acid binding (GO:0072341)|phospholipid binding (GO:0005543)			breast(1)|central_nervous_system(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(17)|lung(85)|ovary(8)|pancreas(1)|prostate(6)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	142				Epithelial(149;0.00697)|Lung(261;0.0521)|LUSC - Lung squamous cell carcinoma(261;0.0544)|all cancers(144;0.0843)	Carglumic Acid(DB06775)	TCACTGATAAAGAAAGGAAAA	0.363																																					p.K405R		Atlas-SNP	.											.	CPS1	485	.	0			c.A1214G						.						128.0	117.0	121.0					2																	211459263		2203	4300	6503	SO:0001583	missense	1373	exon13			TGATAAAGAAAGG	AF154830	CCDS2393.1, CCDS46505.1, CCDS46506.1	2p	2014-09-17	2010-05-11		ENSG00000021826	ENSG00000021826	6.3.4.16		2323	protein-coding gene	gene with protein product		608307	"""carbamoyl-phosphate synthetase 1, mitochondrial"""				Standard	NM_001122633		Approved		uc002vee.4	P31327	OTTHUMG00000132994	ENST00000233072.5:c.1196A>G	chr2.hg19:g.211459263A>G	ENSP00000233072:p.Lys399Arg	83.0	0.0		95.0	24.0	NM_001122633	B7Z818|J3KQL0|O43774|Q53TL5|Q59HF8|Q7Z5I5	Missense_Mutation	SNP	ENST00000233072.5	hg19	CCDS2393.1	.	.	.	.	.	.	.	.	.	.	A	12.41	1.928851	0.34002	.	.	ENSG00000021826	ENST00000430249;ENST00000539150;ENST00000233072;ENST00000536125	D;D	0.89810	-2.57;-2.57	5.88	5.88	0.94601	Pre-ATP-grasp fold (1);Glutamine amidotransferase type 1 (1);	0.092296	0.64402	D	0.000001	D	0.83691	0.5309	L	0.33245	0.995	0.80722	D	1	B;B	0.13145	0.007;0.007	B;B	0.13407	0.009;0.009	T	0.78468	-0.2192	10	0.22109	T	0.4	5.7195	16.275	0.82640	1.0:0.0:0.0:0.0	.	409;399	Q59HF8;P31327	.;CPSM_HUMAN	R	405;407;399;399	ENSP00000402608:K405R;ENSP00000233072:K399R	ENSP00000233072:K399R	K	+	2	0	CPS1	211167508	1.000000	0.71417	1.000000	0.80357	0.617000	0.37484	6.295000	0.72744	2.248000	0.74166	0.477000	0.44152	AAG	.	.		0.363	CPS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256569.5		
MARCH4	57574	hgsc.bcm.edu	37	2	217124066	217124066	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A7IE-01A-21D-A382-10	TCGA-CC-A7IE-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c1caf517-5052-48e3-ad80-8458b3d2ff5f	ab81329b-c119-4a5a-863c-5b50f48cee3f	g.chr2:217124066C>A	ENST00000273067.4	-	4	2968	c.1202G>T	c.(1201-1203)cGa>cTa	p.R401L	AC012513.6_ENST00000417481.1_RNA	NM_020814.2	NP_065865.1	Q9P2E8	MARH4_HUMAN	membrane-associated ring finger (C3HC4) 4, E3 ubiquitin protein ligase	401						Golgi stack (GO:0005795)|integral component of membrane (GO:0016021)|trans-Golgi network (GO:0005802)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.R401Q(1)		breast(1)|large_intestine(5)|lung(11)|ovary(1)|prostate(1)|skin(1)	20		Renal(323;0.0854)		Epithelial(149;2.19e-05)|all cancers(144;0.00121)|LUSC - Lung squamous cell carcinoma(224;0.00902)|Lung(261;0.0125)		GACCAGCTCTCGGCTGCTGCC	0.612																																					p.R401L		Atlas-SNP	.											MARCH4,right_upper_lobe,carcinoma,-1,1	MARCH4	50	.	1	Substitution - Missense(1)	lung(1)	c.G1202T						.						79.0	79.0	79.0					2																	217124066		2203	4300	6503	SO:0001583	missense	57574	exon4			AGCTCTCGGCTGC	AB037820	CCDS33376.1	2q35	2013-01-09	2012-02-23		ENSG00000144583	ENSG00000144583		"""MARCH membrane-associated ring fingers"", ""RING-type (C3HC4) zinc fingers"""	29269	protein-coding gene	gene with protein product		608208	"""membrane-associated ring finger (C3HC4) 4"""			10718198, 14722266	Standard	NM_020814		Approved	KIAA1399, MARCH-IV, RNF174	uc002vgb.3	Q9P2E8	OTTHUMG00000154824	ENST00000273067.4:c.1202G>T	chr2.hg19:g.217124066C>A	ENSP00000273067:p.Arg401Leu	106.0	0.0		95.0	28.0	NM_020814	Q4KMN7|Q86WR8	Missense_Mutation	SNP	ENST00000273067.4	hg19	CCDS33376.1	.	.	.	.	.	.	.	.	.	.	C	26.1	4.708330	0.89018	.	.	ENSG00000144583	ENST00000273067	T	0.21031	2.03	5.47	5.47	0.80525	.	0.200639	0.41500	D	0.000876	T	0.45357	0.1338	M	0.64997	1.995	0.58432	D	0.999999	D	0.71674	0.998	D	0.70016	0.967	T	0.30268	-0.9984	10	0.56958	D	0.05	-15.6821	18.3253	0.90251	0.0:1.0:0.0:0.0	.	401	Q9P2E8	MARH4_HUMAN	L	401	ENSP00000273067:R401L	ENSP00000273067:R401L	R	-	2	0	MARCH4	216832311	1.000000	0.71417	0.997000	0.53966	0.902000	0.53008	5.999000	0.70665	2.567000	0.86603	0.561000	0.74099	CGA	.	.		0.612	MARCH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337272.2	NM_020814	
EPHA4	2043	hgsc.bcm.edu	37	2	222301824	222301824	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A7IE-01A-21D-A382-10	TCGA-CC-A7IE-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c1caf517-5052-48e3-ad80-8458b3d2ff5f	ab81329b-c119-4a5a-863c-5b50f48cee3f	g.chr2:222301824A>G	ENST00000281821.2	-	12	2134	c.2093T>C	c.(2092-2094)aTa>aCa	p.I698T	EPHA4_ENST00000392071.4_Missense_Mutation_p.I647T|EPHA4_ENST00000409938.1_Missense_Mutation_p.I698T|EPHA4_ENST00000409854.1_Missense_Mutation_p.I698T	NM_004438.3	NP_004429.1	P54764	EPHA4_HUMAN	EPH receptor A4	698	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				adult walking behavior (GO:0007628)|cell adhesion (GO:0007155)|corticospinal tract morphogenesis (GO:0021957)|fasciculation of motor neuron axon (GO:0097156)|fasciculation of sensory neuron axon (GO:0097155)|glial cell migration (GO:0008347)|motor neuron axon guidance (GO:0008045)|negative regulation of axon regeneration (GO:0048681)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of Rho guanyl-nucleotide exchange factor activity (GO:2001108)|protein autophosphorylation (GO:0046777)|regulation of astrocyte differentiation (GO:0048710)|regulation of axonogenesis (GO:0050770)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of Rac GTPase activity (GO:0032314)|regulation of Rap GTPase activity (GO:0032317)	axon (GO:0030424)|axon terminus (GO:0043679)|axonal growth cone (GO:0044295)|cell junction (GO:0030054)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|early endosome membrane (GO:0031901)|endoplasmic reticulum (GO:0005783)|filopodium (GO:0030175)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|mitochondrial outer membrane (GO:0005741)|neuromuscular junction (GO:0031594)|perikaryon (GO:0043204)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	ATP binding (GO:0005524)|DH domain binding (GO:0097161)|GPI-linked ephrin receptor activity (GO:0005004)|PH domain binding (GO:0042731)|protein kinase activity (GO:0004672)|transmembrane-ephrin receptor activity (GO:0005005)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(9)|liver(1)|lung(21)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	49		Renal(207;0.0183)		Epithelial(121;5.38e-09)|all cancers(144;2.47e-06)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(261;0.0154)		GTACTCTGTTATGATCATTAC	0.373																																					p.I698T		Atlas-SNP	.											.	EPHA4	263	.	0			c.T2093C						.						105.0	107.0	107.0					2																	222301824		2203	4300	6503	SO:0001583	missense	2043	exon12			TCTGTTATGATCA	L36645	CCDS2447.1	2q36.3	2013-02-11	2004-10-28		ENSG00000116106	ENSG00000116106	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3388	protein-coding gene	gene with protein product		602188	"""EphA4"""	TYRO1		9267020	Standard	NM_004438		Approved	Hek8	uc002vmq.3	P54764	OTTHUMG00000133142	ENST00000281821.2:c.2093T>C	chr2.hg19:g.222301824A>G	ENSP00000281821:p.Ile698Thr	92.0	0.0		79.0	20.0	NM_004438	A8K2P1|B2R601|B7Z6Q8|Q2M380	Missense_Mutation	SNP	ENST00000281821.2	hg19	CCDS2447.1	.	.	.	.	.	.	.	.	.	.	A	19.52	3.842526	0.71488	.	.	ENSG00000116106	ENST00000281821;ENST00000409854;ENST00000409938;ENST00000392071	D;D;D;D	0.86366	-2.11;-2.11;-2.11;-2.11	6.03	6.03	0.97812	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.93471	0.7917	M	0.79926	2.475	0.80722	D	1	D	0.64830	0.994	D	0.69142	0.962	D	0.94130	0.7387	10	0.87932	D	0	.	16.5655	0.84588	1.0:0.0:0.0:0.0	.	698	P54764	EPHA4_HUMAN	T	698;698;698;647	ENSP00000281821:I698T;ENSP00000386276:I698T;ENSP00000386829:I698T;ENSP00000375923:I647T	ENSP00000281821:I698T	I	-	2	0	EPHA4	222010068	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.339000	0.96797	2.302000	0.77476	0.533000	0.62120	ATA	.	.		0.373	EPHA4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256836.3		
DOCK10	55619	hgsc.bcm.edu	37	2	225659771	225659771	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A7IE-01A-21D-A382-10	TCGA-CC-A7IE-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c1caf517-5052-48e3-ad80-8458b3d2ff5f	ab81329b-c119-4a5a-863c-5b50f48cee3f	g.chr2:225659771C>T	ENST00000258390.7	-	45	5046	c.4979G>A	c.(4978-4980)cGt>cAt	p.R1660H	DOCK10_ENST00000409592.3_Missense_Mutation_p.R1654H	NM_014689.2	NP_055504.2	Q96BY6	DOC10_HUMAN	dedicator of cytokinesis 10	1660					regulation of cell migration (GO:0030334)|small GTPase mediated signal transduction (GO:0007264)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.R1658H(1)|p.R198H(1)		NS(1)|breast(3)|cervix(1)|endometrium(6)|kidney(10)|large_intestine(16)|lung(40)|ovary(2)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	87		Renal(207;0.0113)|all_lung(227;0.0486)|Lung NSC(271;0.0653)|all_hematologic(139;0.14)		Epithelial(121;2.37e-10)|all cancers(144;2.26e-07)|Lung(261;0.0143)|LUSC - Lung squamous cell carcinoma(224;0.0178)		AGTCCTTATACGCTTAGTCAG	0.478																																					p.R1660H		Atlas-SNP	.											DOCK10_ENST00000373702,colon,carcinoma,0,2	DOCK10	308	.	2	Substitution - Missense(2)	large_intestine(2)	c.G4979A						.						142.0	143.0	143.0					2																	225659771		2005	4185	6190	SO:0001583	missense	55619	exon45			CTTATACGCTTAG	AB014594	CCDS46528.1, CCDS74661.1	2q36.3	2013-01-10			ENSG00000135905	ENSG00000135905		"""Pleckstrin homology (PH) domain containing"""	23479	protein-coding gene	gene with protein product	"""zizimin3"""	611518				12432077	Standard	NM_014689		Approved	ZIZ3, KIAA0694	uc010fwz.1	Q96BY6	OTTHUMG00000153428	ENST00000258390.7:c.4979G>A	chr2.hg19:g.225659771C>T	ENSP00000258390:p.Arg1660His	103.0	0.0		137.0	32.0	NM_014689	B3FL70|O75178|Q9NW06|Q9NXI8	Missense_Mutation	SNP	ENST00000258390.7	hg19	CCDS46528.1	.	.	.	.	.	.	.	.	.	.	C	35	5.577896	0.96565	.	.	ENSG00000135905	ENST00000409592;ENST00000258390;ENST00000373702	T;T	0.65178	4.66;-0.14	5.8	5.8	0.92144	.	0.000000	0.85682	D	0.000000	D	0.83603	0.5290	M	0.91090	3.175	0.58432	D	0.999999	D;P;D;D	0.76494	0.972;0.95;0.984;0.999	B;B;P;D	0.64410	0.444;0.439;0.74;0.925	D	0.86564	0.1843	10	0.87932	D	0	.	20.0637	0.97700	0.0:1.0:0.0:0.0	.	1660;514;1654;322	Q96BY6;B4DF07;B3FL70;B4DEY4	DOC10_HUMAN;.;.;.	H	1654;1660;198	ENSP00000386694:R1654H;ENSP00000258390:R1660H	ENSP00000258390:R1660H	R	-	2	0	DOCK10	225368015	1.000000	0.71417	0.985000	0.45067	0.992000	0.81027	7.487000	0.81328	2.751000	0.94390	0.650000	0.86243	CGT	.	.		0.478	DOCK10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331246.1		
C2orf54	79919	hgsc.bcm.edu	37	2	241834941	241834941	+	Silent	SNP	T	T	C			TCGA-CC-A7IE-01A-21D-A382-10	TCGA-CC-A7IE-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c1caf517-5052-48e3-ad80-8458b3d2ff5f	ab81329b-c119-4a5a-863c-5b50f48cee3f	g.chr2:241834941T>C	ENST00000388934.4	-	1	632	c.474A>G	c.(472-474)gcA>gcG	p.A158A		NM_001085437.1	NP_001078906	Q08AI8	CB054_HUMAN	chromosome 2 open reading frame 54	158										haematopoietic_and_lymphoid_tissue(1)|lung(4)|prostate(1)	6		all_epithelial(40;3.99e-16)|Breast(86;2.35e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0294)|Lung NSC(271;0.094)|Esophageal squamous(248;0.129)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;8.14e-32)|all cancers(36;4.77e-29)|OV - Ovarian serous cystadenocarcinoma(60;2.38e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;4.88e-06)|Lung(119;0.000452)|LUSC - Lung squamous cell carcinoma(224;0.00415)|Colorectal(34;0.021)|COAD - Colon adenocarcinoma(134;0.15)		GTACGATGGCTGCTACCAGCA	0.607																																					p.A158A		Atlas-SNP	.											.	C2orf54	14	.	0			c.A474G						.						20.0	24.0	23.0					2																	241834941		2198	4292	6490	SO:0001819	synonymous_variant	79919	exon1			GATGGCTGCTACC	AK026324, AK056601	CCDS42839.1, CCDS42840.1, CCDS63187.1	2q37.3	2011-02-23			ENSG00000172478	ENSG00000172478			26216	protein-coding gene	gene with protein product							Standard	NM_001282921		Approved	FLJ22671	uc002wae.4	Q08AI8	OTTHUMG00000151906	ENST00000388934.4:c.474A>G	chr2.hg19:g.241834941T>C		83.0	0.0		78.0	17.0	NM_001085437	B3KPP9|H7BXM3|Q08AI9|Q53QU5|Q9H622	Silent	SNP	ENST00000388934.4	hg19	CCDS42839.1																																																																																			.	.		0.607	C2orf54-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000324353.1	NM_024861, NM_001085437	
CHL1	10752	hgsc.bcm.edu	37	3	407776	407776	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A7IE-01A-21D-A382-10	TCGA-CC-A7IE-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c1caf517-5052-48e3-ad80-8458b3d2ff5f	ab81329b-c119-4a5a-863c-5b50f48cee3f	g.chr3:407776A>G	ENST00000256509.2	+	15	2371	c.1729A>G	c.(1729-1731)Att>Gtt	p.I577V	CHL1-AS1_ENST00000608098.1_RNA|CHL1_ENST00000397491.2_Missense_Mutation_p.I561V|CHL1-AS1_ENST00000417612.1_RNA	NM_001253387.1|NM_001253388.1|NM_006614.3	NP_001240316.1|NP_001240317.1|NP_006605.2	Q96FC9	DDX11_HUMAN	cell adhesion molecule L1-like	0					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|ATP catabolic process (GO:0006200)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|sister chromatid cohesion (GO:0007062)|viral process (GO:0016032)	midbody (GO:0030496)|nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle pole (GO:0000922)	4 iron, 4 sulfur cluster binding (GO:0051539)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA-dependent ATPase activity (GO:0008094)|double-stranded DNA binding (GO:0003690)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|RNA binding (GO:0003723)|single-stranded DNA binding (GO:0003697)			NS(1)|central_nervous_system(5)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(25)|lung(31)|ovary(1)|prostate(4)|skin(10)|stomach(1)	93		all_cancers(2;1.14e-06)|all_epithelial(2;0.00367)|all_lung(1;0.061)|Lung NSC(2;0.201)		Epithelial(13;5.36e-06)|all cancers(10;1.4e-05)|OV - Ovarian serous cystadenocarcinoma(96;0.00323)|COAD - Colon adenocarcinoma(1;0.00925)|Colorectal(20;0.0198)		AGCCTTTGAAATTAATGGCAC	0.348																																					p.I577V		Atlas-SNP	.											.	CHL1	242	.	0			c.A1729G						.						118.0	114.0	115.0					3																	407776		2203	4300	6503	SO:0001583	missense	10752	exon13			TTTGAAATTAATG	AF002246	CCDS2556.1, CCDS58812.1, CCDS74887.1	3p26	2013-05-01	2013-05-01		ENSG00000134121	ENSG00000134121		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	1939	protein-coding gene	gene with protein product	"""neural cell adhesion molecule"", ""close homolog of L1"""	607416	"""cell adhesion molecule with homology to L1CAM (close homologue of L1)"", ""cell adhesion molecule with homology to L1CAM (close homolog of L1)"""			9799093	Standard	NM_006614		Approved	CALL, L1CAM2, FLJ44930, MGC132578	uc003bot.3	O00533	OTTHUMG00000090601	ENST00000256509.2:c.1729A>G	chr3.hg19:g.407776A>G	ENSP00000256509:p.Ile577Val	136.0	0.0		204.0	18.0	NM_001253388	Q13333|Q86VQ4|Q86W62|Q92498|Q92770|Q92998|Q92999	Missense_Mutation	SNP	ENST00000256509.2	hg19	CCDS2556.1	.	.	.	.	.	.	.	.	.	.	A	5.461	0.270192	0.10349	.	.	ENSG00000134121	ENST00000256509;ENST00000397491	T;T	0.79141	-1.24;-1.24	5.18	1.2	0.21068	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	1.545750	0.03247	N	0.181280	T	0.64843	0.2635	L	0.27975	0.815	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.12837	0.008;0.008;0.002	T	0.43621	-0.9380	10	0.31617	T	0.26	.	3.1981	0.06640	0.5311:0.0:0.1763:0.2926	.	561;561;577	B3KX75;O00533;O00533-2	.;CHL1_HUMAN;.	V	577;561	ENSP00000256509:I577V;ENSP00000380628:I561V	ENSP00000256509:I577V	I	+	1	0	CHL1	382776	0.010000	0.17322	0.000000	0.03702	0.948000	0.59901	0.478000	0.22212	0.017000	0.15025	0.460000	0.39030	ATT	.	.		0.348	CHL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207155.2	NM_006614	
SETD2	29072	hgsc.bcm.edu	37	3	47088108	47088108	+	Missense_Mutation	SNP	A	A	C			TCGA-CC-A7IE-01A-21D-A382-10	TCGA-CC-A7IE-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c1caf517-5052-48e3-ad80-8458b3d2ff5f	ab81329b-c119-4a5a-863c-5b50f48cee3f	g.chr3:47088108A>C	ENST00000409792.3	-	16	7009	c.6967T>G	c.(6967-6969)Tat>Gat	p.Y2323D		NM_014159.6	NP_054878.5	Q9BYW2	SETD2_HUMAN	SET domain containing 2	2323	Gln-rich.|Low charge region.				angiogenesis (GO:0001525)|cell migration involved in vasculogenesis (GO:0035441)|coronary vasculature morphogenesis (GO:0060977)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic placenta morphogenesis (GO:0060669)|forebrain development (GO:0030900)|histone H3-K36 trimethylation (GO:0097198)|mesoderm morphogenesis (GO:0048332)|mismatch repair (GO:0006298)|morphogenesis of a branching structure (GO:0001763)|neural tube closure (GO:0001843)|nucleosome organization (GO:0034728)|pericardium development (GO:0060039)|regulation of mRNA export from nucleus (GO:0010793)|regulation of transcription, DNA-templated (GO:0006355)|stem cell development (GO:0048864)|transcription elongation from RNA polymerase II promoter (GO:0006368)	chromosome (GO:0005694)|nucleus (GO:0005634)	histone-lysine N-methyltransferase activity (GO:0018024)			breast(6)|central_nervous_system(5)|endometrium(4)|kidney(63)|large_intestine(18)|lung(26)|ovary(6)|prostate(2)|skin(3)|soft_tissue(1)|stomach(2)|urinary_tract(5)	141		Acute lymphoblastic leukemia(5;0.0169)		BRCA - Breast invasive adenocarcinoma(193;0.000302)|KIRC - Kidney renal clear cell carcinoma(197;0.00732)|Kidney(197;0.00844)		GGCTGGGCATAACTCTAAAAG	0.393			"""N, F, S, Mis"""		clear cell renal carcinoma																																p.Y2323D		Atlas-SNP	.		Rec	yes		3	3p21.31	29072	SET domain containing 2		E	.	SETD2	721	.	0			c.T6967G						.						50.0	51.0	51.0					3																	47088108		2203	4300	6503	SO:0001583	missense	29072	exon16			GGGCATAACTCTA	AJ238403	CCDS2749.2	3p21.31	2014-09-17			ENSG00000181555	ENSG00000181555		"""Chromatin-modifying enzymes / K-methyltransferases"""	18420	protein-coding gene	gene with protein product		612778				16118227, 11461154	Standard	NM_014159		Approved	HYPB, HIF-1, KIAA1732, FLJ23184, KMT3A	uc003cqs.3	Q9BYW2	OTTHUMG00000133514	ENST00000409792.3:c.6967T>G	chr3.hg19:g.47088108A>C	ENSP00000386759:p.Tyr2323Asp	86.0	0.0		92.0	26.0	NM_014159	O75397|O75405|Q17RW8|Q5BKS9|Q5QGN2|Q69YI5|Q6IN64|Q6ZN53|Q6ZS25|Q8N3R0|Q8TCN0|Q9C0D1|Q9H696|Q9NZW9	Missense_Mutation	SNP	ENST00000409792.3	hg19	CCDS2749.2	.	.	.	.	.	.	.	.	.	.	A	23.6	4.436419	0.83885	.	.	ENSG00000181555	ENST00000451092;ENST00000409792	T	0.47869	0.83	5.87	5.87	0.94306	.	0.000000	0.49916	D	0.000134	T	0.65249	0.2673	L	0.53249	1.67	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	T	0.66168	-0.5991	10	0.56958	D	0.05	.	16.2718	0.82624	1.0:0.0:0.0:0.0	.	2323;2323	F2Z317;Q9BYW2	.;SETD2_HUMAN	D	2323	ENSP00000386759:Y2323D	ENSP00000386759:Y2323D	Y	-	1	0	SETD2	47063112	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.993000	0.88291	2.239000	0.73571	0.528000	0.53228	TAT	.	.		0.393	SETD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257479.2	NM_014159	
CELSR3	1951	hgsc.bcm.edu	37	3	48699314	48699314	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A7IE-01A-21D-A382-10	TCGA-CC-A7IE-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c1caf517-5052-48e3-ad80-8458b3d2ff5f	ab81329b-c119-4a5a-863c-5b50f48cee3f	g.chr3:48699314C>A	ENST00000164024.4	-	1	1034	c.754G>T	c.(754-756)Gcg>Tcg	p.A252S	RP11-148G20.1_ENST00000421275.1_RNA|CELSR3_ENST00000544264.1_Missense_Mutation_p.A252S	NM_001407.2	NP_001398.2	Q9NYQ7	CELR3_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 3	252					axonal fasciculation (GO:0007413)|cilium assembly (GO:0042384)|G-protein coupled receptor signaling pathway (GO:0007186)|homophilic cell adhesion (GO:0007156)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|regulation of protein localization (GO:0032880)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(1)|biliary_tract(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(23)|ovary(9)|prostate(6)|skin(7)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	83				BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00549)|Kidney(197;0.00619)		GCTGTCCTCGCCGTGCGTGGT	0.692											OREG0004260	type=TRANSCRIPTION FACTOR BINDING SITE|Gene=CELSR3|TFbs=REST|Dataset=NRSF/REST ChIPSeq sites|EvidenceSubtype=Chromatin immunoprecipitation with tag sequencing (ChIP-TS)																									p.A252S		Atlas-SNP	.											.	CELSR3	237	.	0			c.G754T						.						30.0	37.0	35.0					3																	48699314		2198	4292	6490	SO:0001583	missense	1951	exon1			TCCTCGCCGTGCG	AF231023	CCDS2775.1	3p21.31	2014-08-08	2013-02-18		ENSG00000008300	ENSG00000008300		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	3230	protein-coding gene	gene with protein product	"""flamingo homolog 1 (Drosophila)"""	604264	"""cadherin EGF LAG seven-pass G-type receptor 3, flamingo (Drosophila) homolog"""	EGFL1		9693030	Standard	NM_001407		Approved	MEGF2, HFMI1, FMI1, CDHF11	uc003cuf.1	Q9NYQ7	OTTHUMG00000133544	ENST00000164024.4:c.754G>T	chr3.hg19:g.48699314C>A	ENSP00000164024:p.Ala252Ser	66.0	0.0	956	77.0	11.0	NM_001407	O75092	Missense_Mutation	SNP	ENST00000164024.4	hg19	CCDS2775.1	.	.	.	.	.	.	.	.	.	.	C	12.04	1.817406	0.32145	.	.	ENSG00000008300	ENST00000164024;ENST00000544264	T;T	0.70399	-0.48;-0.47	5.2	5.2	0.72013	.	.	.	.	.	T	0.52306	0.1726	N	0.08118	0	0.09310	N	1	B;B	0.14012	0.002;0.009	B;B	0.11329	0.004;0.006	T	0.11324	-1.0592	9	0.12430	T	0.62	.	17.6776	0.88235	0.0:1.0:0.0:0.0	.	252;322	Q9NYQ7;Q5Y190	CELR3_HUMAN;.	S	252	ENSP00000164024:A252S;ENSP00000445694:A252S	ENSP00000164024:A252S	A	-	1	0	CELSR3	48674318	0.000000	0.05858	0.253000	0.24343	0.683000	0.39861	0.447000	0.21710	2.722000	0.93159	0.655000	0.94253	GCG	.	.		0.692	CELSR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257523.1	NM_001407	
NISCH	11188	hgsc.bcm.edu	37	3	52525454	52525454	+	Missense_Mutation	SNP	T	T	G			TCGA-CC-A7IE-01A-21D-A382-10	TCGA-CC-A7IE-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c1caf517-5052-48e3-ad80-8458b3d2ff5f	ab81329b-c119-4a5a-863c-5b50f48cee3f	g.chr3:52525454T>G	ENST00000479054.1	+	21	3901	c.3829T>G	c.(3829-3831)Tcc>Gcc	p.S1277A	NISCH_ENST00000345716.4_Missense_Mutation_p.S1277A			Q9Y2I1	NISCH_HUMAN	nischarin	1277					actin cytoskeleton organization (GO:0030036)|apoptotic process (GO:0006915)|glucose metabolic process (GO:0006006)|negative regulation of cell migration (GO:0030336)|norepinephrine secretion (GO:0048243)|Rac protein signal transduction (GO:0016601)|regulation of blood pressure (GO:0008217)|regulation of synaptic transmission, GABAergic (GO:0032228)	cytosol (GO:0005829)|endosome (GO:0005768)|membrane (GO:0016020)|plasma membrane (GO:0005886)	G-protein coupled amine receptor activity (GO:0008227)|identical protein binding (GO:0042802)|phosphatidylinositol binding (GO:0035091)			NS(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(9)|ovary(4)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(4)	33				BRCA - Breast invasive adenocarcinoma(193;1.93e-05)|Kidney(197;0.00216)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)|OV - Ovarian serous cystadenocarcinoma(275;0.0577)	Tizanidine(DB00697)	GGTCGTGCTGTCCTCTCTGGA	0.607																																					p.S1277A		Atlas-SNP	.											.	NISCH	97	.	0			c.T3829G						.						85.0	64.0	71.0					3																	52525454		2203	4300	6503	SO:0001583	missense	11188	exon20			GTGCTGTCCTCTC	AF082516	CCDS33767.1, CCDS63651.1, CCDS63652.1	3p21.1	2008-07-18			ENSG00000010322	ENSG00000010322			18006	protein-coding gene	gene with protein product	"""imidazoline receptor candidate"", ""I-1 receptor candidate protein"", ""imidazoline receptor antisera selected"""	615507				11912194, 10882231	Standard	NM_007184		Approved	KIAA0975, I-1, IRAS	uc003ded.4	Q9Y2I1	OTTHUMG00000158571	ENST00000479054.1:c.3829T>G	chr3.hg19:g.52525454T>G	ENSP00000418232:p.Ser1277Ala	63.0	0.0		77.0	26.0	NM_007184	C9J245|Q6PGP3|Q6PIB4|Q7L8M3|Q7Z2X6|Q9UES6|Q9UEU4|Q9UFW3	Missense_Mutation	SNP	ENST00000479054.1	hg19	CCDS33767.1	.	.	.	.	.	.	.	.	.	.	T	21.0	4.079608	0.76528	.	.	ENSG00000010322	ENST00000479054;ENST00000345716;ENST00000433196;ENST00000414197	T;T	0.17691	2.26;2.26	5.8	4.64	0.57946	.	0.180012	0.50627	D	0.000105	T	0.14614	0.0353	L	0.34521	1.04	0.39107	D	0.961404	B	0.23650	0.089	B	0.23852	0.049	T	0.04467	-1.0949	10	0.51188	T	0.08	-32.8662	11.8542	0.52427	0.0:0.0681:0.0:0.9318	.	1277	Q9Y2I1	NISCH_HUMAN	A	1277;1277;201;621	ENSP00000418232:S1277A;ENSP00000339958:S1277A	ENSP00000339958:S1277A	S	+	1	0	NISCH	52500494	0.998000	0.40836	0.944000	0.38274	0.804000	0.45430	3.187000	0.50950	1.029000	0.39812	0.459000	0.35465	TCC	.	.		0.607	NISCH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351357.1	NM_007184	
IGSF10	285313	hgsc.bcm.edu	37	3	151162741	151162741	+	Silent	SNP	G	G	A			TCGA-CC-A7IE-01A-21D-A382-10	TCGA-CC-A7IE-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c1caf517-5052-48e3-ad80-8458b3d2ff5f	ab81329b-c119-4a5a-863c-5b50f48cee3f	g.chr3:151162741G>A	ENST00000282466.3	-	4	5027	c.5028C>T	c.(5026-5028)ccC>ccT	p.P1676P		NM_001178145.1|NM_001178146.1|NM_178822.4	NP_001171616.1|NP_001171617.1|NP_849144.2	Q6WRI0	IGS10_HUMAN	immunoglobulin superfamily, member 10	1676	Ig-like C2-type 3.				cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)	extracellular region (GO:0005576)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(24)|liver(4)|lung(43)|ovary(8)|prostate(4)|skin(9)|stomach(1)|urinary_tract(3)	116			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			TGGTGGGCAGGGGATTTCCAA	0.388																																					p.P1676P		Atlas-SNP	.											.	IGSF10	279	.	0			c.C5028T						.						78.0	82.0	80.0					3																	151162741		2203	4300	6503	SO:0001819	synonymous_variant	285313	exon4			GGGCAGGGGATTT	AY273815	CCDS3160.1	3q25.1	2013-01-11			ENSG00000152580	ENSG00000152580		"""Immunoglobulin superfamily / I-set domain containing"""	26384	protein-coding gene	gene with protein product						12477932	Standard	NM_178822		Approved	FLJ25972, CMF608	uc011bod.2	Q6WRI0	OTTHUMG00000159856	ENST00000282466.3:c.5028C>T	chr3.hg19:g.151162741G>A		81.0	0.0		95.0	9.0	NM_178822	Q86YJ9|Q8N772|Q8NA84	Silent	SNP	ENST00000282466.3	hg19	CCDS3160.1																																																																																			.	.		0.388	IGSF10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357782.1	NM_178822	
GMPS	8833	hgsc.bcm.edu	37	3	155655379	155655379	+	Splice_Site	SNP	G	G	A			TCGA-CC-A7IE-01A-21D-A382-10	TCGA-CC-A7IE-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c1caf517-5052-48e3-ad80-8458b3d2ff5f	ab81329b-c119-4a5a-863c-5b50f48cee3f	g.chr3:155655379G>A	ENST00000496455.2	+	16	2315		c.e16-1		GMPS_ENST00000295920.7_Splice_Site	NM_003875.2	NP_003866.1	P49915	GUAA_HUMAN	guanine monphosphate synthase						glutamine metabolic process (GO:0006541)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase biosynthetic process (GO:0009113)|purine nucleobase metabolic process (GO:0006144)|purine ribonucleoside monophosphate biosynthetic process (GO:0009168)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	ATP binding (GO:0005524)|GMP synthase (glutamine-hydrolyzing) activity (GO:0003922)|GMP synthase activity (GO:0003921)|pyrophosphatase activity (GO:0016462)			breast(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(5)|lung(12)|ovary(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	32			Lung(72;0.11)|LUSC - Lung squamous cell carcinoma(72;0.114)		L-Glutamine(DB00130)	TTTTTTAATAGGTGGTATTAA	0.353			T	MLL	AML																																.	Ovarian(153;896 1876 4149 15499 28134)	Atlas-SNP	.		Dom	yes		3	3q24	8833	guanine monphosphate synthetase		L	.	GMPS	70	.	0			c.1981-1G>A						.						58.0	58.0	58.0					3																	155655379		1808	4074	5882	SO:0001630	splice_region_variant	8833	exon16			TTAATAGGTGGTA	U10860	CCDS46941.1	3q25.31	2013-06-18	2013-06-18		ENSG00000163655	ENSG00000163655	6.3.5.2		4378	protein-coding gene	gene with protein product	"""GMP synthase"""	600358	"""guanine monphosphate synthetase"""			8089153, 9195163	Standard	NM_003875		Approved		uc003faq.3	P49915	OTTHUMG00000158551	ENST00000496455.2:c.1981-1G>A	chr3.hg19:g.155655379G>A		165.0	0.0		221.0	112.0	NM_003875	A8K639|B4DXV7|F8W720	Splice_Site	SNP	ENST00000496455.2	hg19	CCDS46941.1	.	.	.	.	.	.	.	.	.	.	G	22.4	4.283208	0.80803	.	.	ENSG00000163655	ENST00000496455;ENST00000295920;ENST00000537975;ENST00000541628	.	.	.	4.97	4.97	0.65823	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.2479	0.89993	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	GMPS	157138073	1.000000	0.71417	1.000000	0.80357	0.902000	0.53008	9.185000	0.94900	2.322000	0.78497	0.655000	0.94253	.	.	.		0.353	GMPS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351260.2		Intron
SLITRK3	22865	hgsc.bcm.edu	37	3	164907422	164907422	+	Silent	SNP	G	G	A			TCGA-CC-A7IE-01A-21D-A382-10	TCGA-CC-A7IE-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c1caf517-5052-48e3-ad80-8458b3d2ff5f	ab81329b-c119-4a5a-863c-5b50f48cee3f	g.chr3:164907422G>A	ENST00000475390.1	-	2	1640	c.1197C>T	c.(1195-1197)aaC>aaT	p.N399N	SLITRK3_ENST00000241274.3_Silent_p.N399N			O94933	SLIK3_HUMAN	SLIT and NTRK-like family, member 3	399	LRRNT.				axonogenesis (GO:0007409)	integral component of membrane (GO:0016021)				NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|lung(66)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(5)	119						GTTCAGAAATGTTATTAAATC	0.403										HNSCC(40;0.11)																											p.N399N		Atlas-SNP	.											.	SLITRK3	263	.	0			c.C1197T						.						109.0	109.0	109.0					3																	164907422		2203	4300	6503	SO:0001819	synonymous_variant	22865	exon2			AGAAATGTTATTA	AB020655	CCDS3197.1	3q26.1	2004-07-28			ENSG00000121871	ENSG00000121871			23501	protein-coding gene	gene with protein product		609679				10048485, 14557068	Standard	NM_014926		Approved	KIAA0848	uc003fek.3	O94933	OTTHUMG00000158072	ENST00000475390.1:c.1197C>T	chr3.hg19:g.164907422G>A		111.0	0.0		145.0	13.0	NM_014926	Q1RMY6	Silent	SNP	ENST00000475390.1	hg19	CCDS3197.1																																																																																			.	.		0.403	SLITRK3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350126.1	NM_014926	
TFRC	7037	hgsc.bcm.edu	37	3	195792415	195792415	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A7IE-01A-21D-A382-10	TCGA-CC-A7IE-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c1caf517-5052-48e3-ad80-8458b3d2ff5f	ab81329b-c119-4a5a-863c-5b50f48cee3f	g.chr3:195792415A>G	ENST00000360110.4	-	10	1266	c.1097T>C	c.(1096-1098)gTa>gCa	p.V366A	TFRC_ENST00000535031.1_Missense_Mutation_p.V84A|TFRC_ENST00000392396.3_Missense_Mutation_p.V366A|TFRC_ENST00000540528.1_3'UTR|TFRC_ENST00000420415.1_Missense_Mutation_p.V285A|TFRC_ENST00000465288.1_5'Flank	NM_001128148.1	NP_001121620.1	P02786	TFR1_HUMAN	transferrin receptor	366					cellular iron ion homeostasis (GO:0006879)|iron ion import (GO:0097286)|osteoclast differentiation (GO:0030316)|positive regulation of bone resorption (GO:0045780)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	blood microparticle (GO:0072562)|cell surface (GO:0009986)|coated pit (GO:0005905)|cytoplasmic membrane-bounded vesicle (GO:0016023)|endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)|vesicle (GO:0031982)	double-stranded RNA binding (GO:0003725)|identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)|transferrin receptor activity (GO:0004998)			NS(1)|breast(2)|endometrium(1)|kidney(3)|large_intestine(4)|lung(10)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	27	all_cancers(143;1.94e-08)|Ovarian(172;0.0634)|Breast(254;0.206)		Epithelial(36;1.36e-24)|all cancers(36;3.34e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.17e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00233)	Gallium nitrate(DB05260)	TTCTGAGGTTACCATCCTACA	0.398			T	BCL6	NHL																																p.V366A		Atlas-SNP	.		Dom	yes		3	3q29	7037	"""transferrin receptor (p90, CD71)"""		L	.	TFRC	54	.	0			c.T1097C						.						148.0	147.0	148.0					3																	195792415		2203	4300	6503	SO:0001583	missense	7037	exon10			GAGGTTACCATCC	X01060	CCDS3312.1	3q29	2013-09-19	2013-09-19		ENSG00000072274	ENSG00000072274		"""CD molecules"""	11763	protein-coding gene	gene with protein product		190010	"""transferrin receptor (p90, CD71)"""				Standard	NM_003234		Approved	CD71, TFR1, p90	uc003fwa.4	P02786	OTTHUMG00000155714	ENST00000360110.4:c.1097T>C	chr3.hg19:g.195792415A>G	ENSP00000353224:p.Val366Ala	33.0	0.0		60.0	4.0	NM_001128148	D3DXB0|Q1HE24|Q59G55|Q9UCN0|Q9UCU5|Q9UDF9|Q9UK21	Missense_Mutation	SNP	ENST00000360110.4	hg19	CCDS3312.1	.	.	.	.	.	.	.	.	.	.	A	7.515	0.655395	0.14580	.	.	ENSG00000072274	ENST00000360110;ENST00000420415;ENST00000392396;ENST00000535031	T;T;T;T	0.73258	3.11;3.11;3.11;-0.73	4.98	-7.22	0.01485	.	2.290060	0.01034	N	0.004191	T	0.57021	0.2025	L	0.60455	1.87	0.09310	N	1	B	0.12630	0.006	B	0.06405	0.002	T	0.36138	-0.9760	10	0.13470	T	0.59	2.6608	2.5417	0.04727	0.486:0.2724:0.0999:0.1417	.	366	P02786	TFR1_HUMAN	A	366;285;366;84	ENSP00000353224:V366A;ENSP00000390133:V285A;ENSP00000376197:V366A;ENSP00000437753:V84A	ENSP00000353224:V366A	V	-	2	0	TFRC	197276812	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-1.984000	0.01487	-1.103000	0.03019	-0.619000	0.04042	GTA	.	.		0.398	TFRC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341346.1		
KIAA0232	9778	hgsc.bcm.edu	37	4	6863293	6863293	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-A7IE-01A-21D-A382-10	TCGA-CC-A7IE-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c1caf517-5052-48e3-ad80-8458b3d2ff5f	ab81329b-c119-4a5a-863c-5b50f48cee3f	g.chr4:6863293A>T	ENST00000307659.5	+	7	1639	c.1184A>T	c.(1183-1185)gAg>gTg	p.E395V	KIAA0232_ENST00000425103.1_Missense_Mutation_p.E395V	NM_014743.2	NP_055558.2	Q92628	K0232_HUMAN	KIAA0232	395							ATP binding (GO:0005524)			breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(12)|ovary(2)|prostate(4)|skin(1)|urinary_tract(1)	41						AAGGACACAGAGTATAAAGAG	0.438																																					p.E395V		Atlas-SNP	.											.	KIAA0232	102	.	0			c.A1184T						.						60.0	63.0	62.0					4																	6863293		1867	4102	5969	SO:0001583	missense	9778	exon7			ACACAGAGTATAA	D86985	CCDS43209.1	4p16.1	2012-11-29			ENSG00000170871	ENSG00000170871			28992	protein-coding gene	gene with protein product						9039502	Standard	NM_014743		Approved		uc003gjq.4	Q92628	OTTHUMG00000160072	ENST00000307659.5:c.1184A>T	chr4.hg19:g.6863293A>T	ENSP00000303928:p.Glu395Val	108.0	0.0		78.0	11.0	NM_014743	A7E2D2	Missense_Mutation	SNP	ENST00000307659.5	hg19	CCDS43209.1	.	.	.	.	.	.	.	.	.	.	A	15.00	2.703767	0.48412	.	.	ENSG00000170871	ENST00000425103;ENST00000307659	.	.	.	5.9	4.71	0.59529	.	0.000000	0.85682	D	0.000000	T	0.64427	0.2597	M	0.66939	2.045	0.54753	D	0.999989	P	0.45715	0.865	P	0.49665	0.618	T	0.67333	-0.5697	9	0.87932	D	0	-24.7468	11.7686	0.51945	0.9313:0.0:0.0687:0.0	.	395	Q92628	K0232_HUMAN	V	395	.	ENSP00000303928:E395V	E	+	2	0	KIAA0232	6914194	1.000000	0.71417	0.159000	0.22649	0.076000	0.17211	6.893000	0.75649	1.049000	0.40321	0.533000	0.62120	GAG	.	.		0.438	KIAA0232-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359102.2	NM_014743	
CPZ	8532	hgsc.bcm.edu	37	4	8605757	8605757	+	Missense_Mutation	SNP	G	G	A	rs376798665		TCGA-CC-A7IE-01A-21D-A382-10	TCGA-CC-A7IE-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c1caf517-5052-48e3-ad80-8458b3d2ff5f	ab81329b-c119-4a5a-863c-5b50f48cee3f	g.chr4:8605757G>A	ENST00000360986.4	+	4	725	c.551G>A	c.(550-552)cGc>cAc	p.R184H	CPZ_ENST00000382480.2_Missense_Mutation_p.R47H|CPZ_ENST00000429646.2_5'UTR|CPZ_ENST00000315782.6_Missense_Mutation_p.R173H	NM_001014447.2	NP_001014447	Q66K79	CBPZ_HUMAN	carboxypeptidase Z	184					proteolysis (GO:0006508)|Wnt signaling pathway (GO:0016055)	extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)			cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(23)|ovary(3)|pancreas(1)|skin(1)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	46						ACCTTCATCCGCTTCAGCCAC	0.701																																					p.R184H		Atlas-SNP	.											.	CPZ	95	.	0			c.G551A						.	G	HIS/ARG,HIS/ARG,HIS/ARG	0,4348		0,0,2174	30.0	25.0	26.0		551,140,518	-2.9	0.2	4		26	2,8516		0,2,4257	no	missense,missense,missense	CPZ	NM_001014447.2,NM_001014448.2,NM_003652.3	29,29,29	0,2,6431	AA,AG,GG		0.0235,0.0,0.0155	benign,benign,benign	184/653,47/516,173/642	8605757	2,12864	2174	4259	6433	SO:0001583	missense	8532	exon4			TCATCCGCTTCAG	U83411	CCDS3404.1, CCDS33953.1, CCDS43212.1	4p16.1	2012-02-10			ENSG00000109625	ENSG00000109625			2333	protein-coding gene	gene with protein product	"""metallocarboxypeptidase Z"""	603105				9099699	Standard	NM_001014447		Approved		uc003glm.3	Q66K79	OTTHUMG00000090513	ENST00000360986.4:c.551G>A	chr4.hg19:g.8605757G>A	ENSP00000354255:p.Arg184His	90.0	0.0		69.0	13.0	NM_001014447	O00520|Q96MX2	Missense_Mutation	SNP	ENST00000360986.4	hg19	CCDS33953.1	.	.	.	.	.	.	.	.	.	.	G	7.156	0.584727	0.13749	0.0	2.35E-4	ENSG00000109625	ENST00000360986;ENST00000382480;ENST00000315782	T;T;T	0.03301	3.98;3.98;3.98	3.86	-2.92	0.05615	.	0.595436	0.18160	N	0.149807	T	0.01870	0.0059	N	0.12182	0.205	0.80722	D	1	B;B	0.20671	0.047;0.028	B;B	0.14578	0.011;0.005	T	0.49021	-0.8982	10	0.54805	T	0.06	-15.3796	5.3119	0.15835	0.6471:0.0:0.2035:0.1494	.	173;184	Q66K79-2;Q66K79	.;CBPZ_HUMAN	H	184;47;173	ENSP00000354255:R184H;ENSP00000371920:R47H;ENSP00000315074:R173H	ENSP00000315074:R173H	R	+	2	0	CPZ	8656657	0.061000	0.20836	0.155000	0.22561	0.108000	0.19459	-0.006000	0.12833	-0.543000	0.06240	-0.228000	0.12330	CGC	.	.		0.701	CPZ-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000207001.4	NM_003652	
GC	2638	hgsc.bcm.edu	37	4	72634108	72634108	+	Silent	SNP	A	A	G			TCGA-CC-A7IE-01A-21D-A382-10	TCGA-CC-A7IE-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c1caf517-5052-48e3-ad80-8458b3d2ff5f	ab81329b-c119-4a5a-863c-5b50f48cee3f	g.chr4:72634108A>G	ENST00000273951.8	-	3	514	c.171T>C	c.(169-171)ttT>ttC	p.F57F	GC_ENST00000503472.1_5'UTR|GC_ENST00000513476.1_Silent_p.F57F|GC_ENST00000504199.1_Silent_p.F76F	NM_000583.3|NM_001204306.1	NP_000574.2|NP_001191235.1	P02774	VTDB_HUMAN	group-specific component (vitamin D binding protein)	57	Albumin 1. {ECO:0000255|PROSITE- ProRule:PRU00769}.				small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D metabolic process (GO:0042359)|vitamin transport (GO:0051180)	blood microparticle (GO:0072562)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)	actin binding (GO:0003779)|calcidiol binding (GO:1902118)|vitamin D binding (GO:0005499)|vitamin transporter activity (GO:0051183)			endometrium(5)|kidney(1)|large_intestine(4)|lung(21)|ovary(2)|pancreas(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(4)	45		all_hematologic(202;0.107)	Lung(101;0.148)		Alfacalcidol(DB01436)|Cholecalciferol(DB00169)	TGACCTGTTCAAACGTGCCAC	0.453																																					p.F76F		Atlas-SNP	.											.	GC	132	.	0			c.T228C						.						66.0	59.0	61.0					4																	72634108		2203	4300	6503	SO:0001819	synonymous_variant	2638	exon4			CTGTTCAAACGTG	L10641	CCDS3550.1, CCDS56332.1	4q12-q13	2008-08-29			ENSG00000145321	ENSG00000145321			4187	protein-coding gene	gene with protein product		139200				558959	Standard	NM_000583		Approved	DBP, VDBP, hDBP	uc010iif.3	P02774	OTTHUMG00000129915	ENST00000273951.8:c.171T>C	chr4.hg19:g.72634108A>G		291.0	0.0		230.0	14.0	NM_001204307	B4DPP2|D6RAK8|Q16309|Q16310|Q53F31|Q6GTG1	Silent	SNP	ENST00000273951.8	hg19	CCDS3550.1																																																																																			.	.		0.453	GC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252167.2		
MAPK10	5602	hgsc.bcm.edu	37	4	87022310	87022310	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A7IE-01A-21D-A382-10	TCGA-CC-A7IE-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c1caf517-5052-48e3-ad80-8458b3d2ff5f	ab81329b-c119-4a5a-863c-5b50f48cee3f	g.chr4:87022310C>T	ENST00000359221.3	-	8	1151	c.625G>A	c.(625-627)Gga>Aga	p.G209R	MAPK10_ENST00000395161.2_Missense_Mutation_p.G209R|MAPK10_ENST00000513839.1_5'Flank|MAPK10_ENST00000395157.3_Missense_Mutation_p.G64R|MAPK10_ENST00000449047.2_Missense_Mutation_p.G64R|MAPK10_ENST00000395169.3_Missense_Mutation_p.G171R|MAPK10_ENST00000395166.1_Missense_Mutation_p.G171R|MAPK10_ENST00000395160.3_Missense_Mutation_p.G64R|MAPK10_ENST00000361569.2_Missense_Mutation_p.G209R			P53779	MK10_HUMAN	mitogen-activated protein kinase 10	209	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPK activity (GO:0000187)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|JNK cascade (GO:0007254)|JUN phosphorylation (GO:0007258)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|JUN kinase activity (GO:0004705)|MAP kinase kinase activity (GO:0004708)			breast(1)|central_nervous_system(1)|stomach(1)	3		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.243)		OV - Ovarian serous cystadenocarcinoma(123;0.002)		CTGGCCAGTCCAAAGTCCAGG	0.438																																					p.G209R		Atlas-SNP	.											.	MAPK10	106	.	0			c.G625A						.						109.0	93.0	99.0					4																	87022310		2203	4300	6503	SO:0001583	missense	5602	exon8			CCAGTCCAAAGTC	U07620	CCDS3612.1, CCDS3613.1, CCDS34026.1, CCDS43247.1	4q22-q23	2011-06-09			ENSG00000109339	ENSG00000109339	2.7.11.1	"""Mitogen-activated protein kinase cascade / Kinases"""	6872	protein-coding gene	gene with protein product		602897		PRKM10		8654373, 12436199	Standard	NM_002753		Approved	JNK3, p493F12, p54bSAPK	uc003hpt.3	P53779	OTTHUMG00000130604	ENST00000359221.3:c.625G>A	chr4.hg19:g.87022310C>T	ENSP00000352157:p.Gly209Arg	128.0	0.0		107.0	25.0	NM_002753	A6NFS3|A6NG28|B3KQ94|Q15707|Q49AP1	Missense_Mutation	SNP	ENST00000359221.3	hg19	CCDS34026.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	29.3|29.3	4.991094|4.991094	0.93106|0.93106	.|.	.|.	ENSG00000109339|ENSG00000109339	ENST00000395169;ENST00000359221;ENST00000395157;ENST00000361569;ENST00000395166;ENST00000395160;ENST00000449047;ENST00000395161|ENST00000515400	D;D;D;D;D;D;D;D|.	0.98192|.	-4.78;-4.78;-4.78;-4.78;-4.78;-4.78;-4.78;-4.78|.	6.03|6.03	5.19|5.19	0.71726|0.71726	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);|.	0.095507|.	0.64402|.	D|.	0.000001|.	D|.	0.88187|.	0.6369|.	H|H	0.97659|0.97659	4.05|4.05	0.80722|0.80722	D|D	1|1	D;D;D;D;D|.	0.89917|.	1.0;1.0;1.0;1.0;1.0|.	D;D;D;D;D|.	0.97110|.	1.0;1.0;0.995;0.997;0.998|.	D|.	0.92335|.	0.5877|.	10|.	0.87932|.	D|.	0|.	-6.5185|-6.5185	15.2436|15.2436	0.73490|0.73490	0.0:0.9329:0.0:0.0671|0.0:0.9329:0.0:0.0671	.|.	95;64;171;209;209|.	B7Z1Z1;Q499Y8;P53779-3;P53779-2;P53779|.	.;.;.;.;MK10_HUMAN|.	R|X	171;209;64;209;171;64;64;209|121	ENSP00000378598:G171R;ENSP00000352157:G209R;ENSP00000378586:G64R;ENSP00000355297:G209R;ENSP00000378595:G171R;ENSP00000378589:G64R;ENSP00000414469:G64R;ENSP00000378590:G209R|.	ENSP00000352157:G209R|.	G|W	-|-	1|2	0|0	MAPK10|MAPK10	87241334|87241334	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.993000|0.993000	0.82548|0.82548	7.818000|7.818000	0.86416|0.86416	1.558000|1.558000	0.49541|0.49541	0.557000|0.557000	0.71058|0.71058	GGA|TGG	.	.		0.438	MAPK10-012	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000361363.2		
CXXC4	80319	hgsc.bcm.edu	37	4	105393500	105393500	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A7IE-01A-21D-A382-10	TCGA-CC-A7IE-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c1caf517-5052-48e3-ad80-8458b3d2ff5f	ab81329b-c119-4a5a-863c-5b50f48cee3f	g.chr4:105393500T>A	ENST00000426831.1	-	2	590	c.576A>T	c.(574-576)gaA>gaT	p.E192D	CXXC4_ENST00000394767.2_Missense_Mutation_p.E361D|CXXC4_ENST00000466963.1_5'UTR			Q9H2H0	CXXC4_HUMAN	CXXC finger protein 4	192					negative regulation of Wnt signaling pathway (GO:0030178)|Wnt signaling pathway (GO:0016055)|zygotic specification of dorsal/ventral axis (GO:0007352)	cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytoplasmic vesicle (GO:0031410)	DNA binding (GO:0003677)|PDZ domain binding (GO:0030165)|zinc ion binding (GO:0008270)			kidney(1)|large_intestine(1)|lung(5)|ovary(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	11				OV - Ovarian serous cystadenocarcinoma(123;3.05e-08)		ATCGGAATGCTTCAGCGCTGG	0.338																																					p.E361D		Atlas-SNP	.											.	CXXC4	20	.	0			c.A1083T						.						104.0	109.0	107.0					4																	105393500		2202	4299	6501	SO:0001583	missense	80319	exon3			GAATGCTTCAGCG		CCDS3665.1, CCDS3665.2	4q22-q24	2014-02-18	2011-12-01		ENSG00000168772	ENSG00000168772			24593	protein-coding gene	gene with protein product	"""Dvl-binding protein IDAX (inhibition of the Dvl and Axin complex)"""	611645				11113207	Standard	NM_025212		Approved	IDAX	uc003hxf.2	Q9H2H0	OTTHUMG00000131121	ENST00000426831.1:c.576A>T	chr4.hg19:g.105393500T>A	ENSP00000412267:p.Glu192Asp	671.0	1.0		522.0	109.0	NM_025212		Missense_Mutation	SNP	ENST00000426831.1	hg19		.	.	.	.	.	.	.	.	.	.	T	12.92	2.081517	0.36758	.	.	ENSG00000168772	ENST00000394767;ENST00000426831	.	.	.	5.36	5.36	0.76844	.	0.930043	0.09045	N	0.856610	T	0.64800	0.2631	N	0.22421	0.69	0.42198	D	0.991753	P	0.52842	0.956	P	0.62184	0.899	T	0.58869	-0.7560	9	0.48119	T	0.1	-0.5135	15.3495	0.74370	0.0:0.0:0.0:1.0	.	192	Q9H2H0	CXXC4_HUMAN	D	192	.	ENSP00000378248:E192D	E	-	3	2	CXXC4	105612949	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.927000	0.56499	2.028000	0.59812	0.533000	0.62120	GAA	.	.		0.338	CXXC4-201	KNOWN	basic	protein_coding	protein_coding		NM_025212	
ANK2	287	hgsc.bcm.edu	37	4	114244937	114244937	+	Intron	SNP	C	C	T			TCGA-CC-A7IE-01A-21D-A382-10	TCGA-CC-A7IE-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c1caf517-5052-48e3-ad80-8458b3d2ff5f	ab81329b-c119-4a5a-863c-5b50f48cee3f	g.chr4:114244937C>T	ENST00000357077.4	+	26	2953				ANK2_ENST00000506722.1_Missense_Mutation_p.R954C|ANK2_ENST00000264366.6_Intron|ANK2_ENST00000394537.3_Intron|ANK2_ENST00000509550.1_Intron	NM_001148.4	NP_001139.3	Q01484	ANK2_HUMAN	ankyrin 2, neuronal						atrial cardiac muscle cell action potential (GO:0086014)|atrial cardiac muscle cell to AV node cell communication (GO:0086066)|atrial septum development (GO:0003283)|axon guidance (GO:0007411)|cardiac muscle contraction (GO:0060048)|cellular calcium ion homeostasis (GO:0006874)|cellular protein localization (GO:0034613)|membrane depolarization during SA node cell action potential (GO:0086046)|paranodal junction assembly (GO:0030913)|positive regulation of calcium ion transmembrane transporter activity (GO:1901021)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cation channel activity (GO:2001259)|positive regulation of gene expression (GO:0010628)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of potassium ion transport (GO:0043268)|protein localization to cell surface (GO:0034394)|protein localization to endoplasmic reticulum (GO:0070972)|protein localization to M-band (GO:0036309)|protein localization to organelle (GO:0033365)|protein localization to plasma membrane (GO:0072659)|protein localization to T-tubule (GO:0036371)|protein stabilization (GO:0050821)|protein targeting to plasma membrane (GO:0072661)|regulation of calcium ion transmembrane transporter activity (GO:1901019)|regulation of calcium ion transport (GO:0051924)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of protein stability (GO:0031647)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to methylmercury (GO:0051597)|SA node cell action potential (GO:0086015)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|T-tubule organization (GO:0033292)|ventricular cardiac muscle cell action potential (GO:0086005)	A band (GO:0031672)|basolateral plasma membrane (GO:0016323)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intracellular (GO:0005622)|M band (GO:0031430)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|enzyme binding (GO:0019899)|ion channel binding (GO:0044325)|potassium channel regulator activity (GO:0015459)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(10)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(54)|liver(2)|lung(112)|ovary(8)|pancreas(1)|prostate(7)|skin(11)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(10)	248		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)		ATGTCTTGAACGTGACAACAG	0.448																																					p.R954C		Atlas-SNP	.											.	ANK2	576	.	0			c.C2860T						.						98.0	86.0	90.0					4																	114244937		1568	3582	5150	SO:0001627	intron_variant	287	exon28			CTTGAACGTGACA	M37123	CCDS3702.1, CCDS43261.1, CCDS54796.1	4q25-q26	2014-09-17	2003-03-12		ENSG00000145362	ENSG00000145362		"""Ankyrin repeat domain containing"""	493	protein-coding gene	gene with protein product		106410	"""long (electrocardiographic) QT syndrome 4"""	LQT4		7485162, 12571597	Standard	NM_001148		Approved		uc003ibe.4	Q01484	OTTHUMG00000132912	ENST00000357077.4:c.2900+5161C>T	chr4.hg19:g.114244937C>T		101.0	0.0		94.0	20.0	NM_001127493	Q01485|Q08AC7|Q08AC8|Q7Z3L5	Missense_Mutation	SNP	ENST00000357077.4	hg19	CCDS3702.1	.	.	.	.	.	.	.	.	.	.	C	16.60	3.168322	0.57584	.	.	ENSG00000145362	ENST00000506722;ENST00000343056	T	0.66815	-0.23	5.53	5.53	0.82687	.	.	.	.	.	T	0.52597	0.1744	N	0.08118	0	0.80722	D	1	P	0.47350	0.894	B	0.43052	0.406	T	0.58053	-0.7704	9	0.38643	T	0.18	.	19.4713	0.94963	0.0:1.0:0.0:0.0	.	954	Q01484-5	.	C	954	ENSP00000421067:R954C	ENSP00000340561:R954C	R	+	1	0	ANK2	114464386	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	5.380000	0.66202	2.587000	0.87381	0.563000	0.77884	CGT	.	.		0.448	ANK2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256422.2	NM_001148	
DCHS2	54798	hgsc.bcm.edu	37	4	155252859	155252859	+	Silent	SNP	T	T	A			TCGA-CC-A7IE-01A-21D-A382-10	TCGA-CC-A7IE-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c1caf517-5052-48e3-ad80-8458b3d2ff5f	ab81329b-c119-4a5a-863c-5b50f48cee3f	g.chr4:155252859T>A	ENST00000357232.4	-	10	2240	c.2241A>T	c.(2239-2241)gcA>gcT	p.A747A	DCHS2_ENST00000507542.1_5'Flank|DCHS2_ENST00000339452.1_Intron	NM_017639.3	NP_060109.2	Q6V1P9	PCD23_HUMAN	dachsous cadherin-related 2	747	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(1)|cervix(3)|endometrium(8)|kidney(5)|large_intestine(54)|lung(63)|ovary(4)|pancreas(1)|prostate(14)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	176	all_hematologic(180;0.208)	Renal(120;0.0854)		LUSC - Lung squamous cell carcinoma(193;0.107)		AGATGGTGCCTGCTGGACCTG	0.473																																					p.A747A		Atlas-SNP	.											.	DCHS2	594	.	0			c.A2241T						.						49.0	43.0	45.0					4																	155252859		2203	4300	6503	SO:0001819	synonymous_variant	54798	exon10			GGTGCCTGCTGGA	BC140919	CCDS3785.1, CCDS47150.1	4q32.1	2014-06-04	2013-10-04	2004-09-03		ENSG00000197410		"""Cadherins / Cadherin-related"""	23111	protein-coding gene	gene with protein product	"""cadherin-related family member 7"""	612486	"""cadherin-like 27"", ""dachsous 2 (Drosophila)"""	CDH27, PCDH23		15003449	Standard	NM_017639		Approved	CDHJ, FLJ20047, PCDHJ, CDHR7	uc003inw.2	Q6V1P9		ENST00000357232.4:c.2241A>T	chr4.hg19:g.155252859T>A		192.0	0.0		170.0	42.0	NM_017639	B2RU14|E9PC11|Q4W5P9|Q6ZS61|Q9NXU8	Silent	SNP	ENST00000357232.4	hg19	CCDS3785.1																																																																																			.	.		0.473	DCHS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365281.2	NM_001142552	
FAM151B	167555	hgsc.bcm.edu	37	5	79817830	79817830	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A7IE-01A-21D-A382-10	TCGA-CC-A7IE-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c1caf517-5052-48e3-ad80-8458b3d2ff5f	ab81329b-c119-4a5a-863c-5b50f48cee3f	g.chr5:79817830T>C	ENST00000282226.4	+	5	699	c.544T>C	c.(544-546)Tgg>Cgg	p.W182R	FAM151B_ENST00000511718.1_3'UTR	NM_205548.2	NP_991111.2	Q6UXP7	F151B_HUMAN	family with sequence similarity 151, member B	182										breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(1)|ovary(1)	7		Lung NSC(167;0.0427)|all_lung(232;0.0464)|Ovarian(174;0.113)		OV - Ovarian serous cystadenocarcinoma(54;8.21e-47)|Epithelial(54;8.3e-42)|all cancers(79;1.97e-36)		AGGGTACAGTTGGACAATGGT	0.318																																					p.W182R		Atlas-SNP	.											.	FAM151B	25	.	0			c.T544C						.						90.0	85.0	87.0					5																	79817830		2203	4300	6503	SO:0001583	missense	167555	exon5			TACAGTTGGACAA		CCDS4051.1	5q14.1	2007-12-18	2007-12-18		ENSG00000152380	ENSG00000152380			33716	protein-coding gene	gene with protein product							Standard	NM_205548		Approved	UNQ9217	uc003kgv.2	Q6UXP7	OTTHUMG00000131303	ENST00000282226.4:c.544T>C	chr5.hg19:g.79817830T>C	ENSP00000282226:p.Trp182Arg	61.0	0.0		54.0	20.0	NM_205548	A2RRE4	Missense_Mutation	SNP	ENST00000282226.4	hg19	CCDS4051.1	.	.	.	.	.	.	.	.	.	.	T	10.87	1.472617	0.26423	.	.	ENSG00000152380	ENST00000282226	T	0.10288	2.89	5.77	5.77	0.91146	.	0.108809	0.64402	D	0.000002	T	0.21307	0.0513	L	0.42686	1.345	0.80722	D	1	D	0.89917	1.0	D	0.73380	0.98	T	0.03453	-1.1035	10	0.06236	T	0.91	-13.1571	15.0752	0.72071	0.0:0.0:0.0:1.0	.	182	Q6UXP7	F151B_HUMAN	R	182	ENSP00000282226:W182R	ENSP00000282226:W182R	W	+	1	0	FAM151B	79853586	1.000000	0.71417	0.990000	0.47175	0.993000	0.82548	6.945000	0.75947	2.208000	0.71279	0.533000	0.62120	TGG	.	.		0.318	FAM151B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254072.1	NM_205548	
MAN2A1	4124	hgsc.bcm.edu	37	5	109178131	109178131	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A7IE-01A-21D-A382-10	TCGA-CC-A7IE-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c1caf517-5052-48e3-ad80-8458b3d2ff5f	ab81329b-c119-4a5a-863c-5b50f48cee3f	g.chr5:109178131A>G	ENST00000261483.4	+	17	3721	c.2669A>G	c.(2668-2670)aAt>aGt	p.N890S		NM_002372.2	NP_002363.2	Q16706	MA2A1_HUMAN	mannosidase, alpha, class 2A, member 1	890					cellular protein metabolic process (GO:0044267)|in utero embryonic development (GO:0001701)|liver development (GO:0001889)|lung alveolus development (GO:0048286)|mannose metabolic process (GO:0006013)|mitochondrion organization (GO:0007005)|N-glycan processing (GO:0006491)|positive regulation of neurogenesis (GO:0050769)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|respiratory gaseous exchange (GO:0007585)|retina morphogenesis in camera-type eye (GO:0060042)|vacuole organization (GO:0007033)	cis-Golgi network (GO:0005801)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	carbohydrate binding (GO:0030246)|hydrolase activity, hydrolyzing N-glycosyl compounds (GO:0016799)|mannosyl-oligosaccharide 1,3-1,6-alpha-mannosidase activity (GO:0004572)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(2)|endometrium(7)|kidney(2)|large_intestine(13)|lung(20)|ovary(3)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	55		all_cancers(142;8.66e-07)|all_epithelial(76;7.73e-09)|Prostate(80;0.000303)|Lung NSC(167;0.0186)|all_lung(232;0.0241)|Ovarian(225;0.0444)|Colorectal(57;0.0959)|Breast(839;0.244)		OV - Ovarian serous cystadenocarcinoma(64;2.17e-10)|Epithelial(69;1.37e-09)|COAD - Colon adenocarcinoma(37;0.141)		AAAAGCCAAAATAGATTTTAT	0.313																																					p.N890S		Atlas-SNP	.											.	MAN2A1	136	.	0			c.A2669G						.						51.0	57.0	55.0					5																	109178131		2201	4287	6488	SO:0001583	missense	4124	exon17			GCCAAAATAGATT		CCDS34209.1	5q21.3	2013-09-20			ENSG00000112893	ENSG00000112893	3.2.1.114		6824	protein-coding gene	gene with protein product	"""golgi integral membrane protein 7"""	154582		MANA2		1757461, 15004235	Standard	NM_002372		Approved	GOLIM7	uc003kou.1	Q16706	OTTHUMG00000162834	ENST00000261483.4:c.2669A>G	chr5.hg19:g.109178131A>G	ENSP00000261483:p.Asn890Ser	449.0	0.0		473.0	178.0	NM_002372	Q16767	Missense_Mutation	SNP	ENST00000261483.4	hg19	CCDS34209.1	.	.	.	.	.	.	.	.	.	.	A	13.91	2.378208	0.42105	.	.	ENSG00000112893	ENST00000261483	D	0.83075	-1.68	5.49	4.32	0.51571	Glycosyl hydrolases 38, C-terminal (1);Glycoside hydrolase-type carbohydrate-binding (1);	0.202673	0.51477	N	0.000091	T	0.75788	0.3897	L	0.43152	1.355	0.44834	D	0.997846	B	0.21071	0.051	B	0.25405	0.06	T	0.67177	-0.5736	10	0.18276	T	0.48	-21.9466	11.4115	0.49929	0.9288:0.0:0.0712:0.0	.	890	Q16706	MA2A1_HUMAN	S	890	ENSP00000261483:N890S	ENSP00000261483:N890S	N	+	2	0	MAN2A1	109206030	1.000000	0.71417	0.992000	0.48379	0.992000	0.81027	8.239000	0.89811	1.012000	0.39366	0.477000	0.44152	AAT	.	.		0.313	MAN2A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370680.1		
SLC12A2	6558	hgsc.bcm.edu	37	5	127520082	127520082	+	Silent	SNP	T	T	A			TCGA-CC-A7IE-01A-21D-A382-10	TCGA-CC-A7IE-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c1caf517-5052-48e3-ad80-8458b3d2ff5f	ab81329b-c119-4a5a-863c-5b50f48cee3f	g.chr5:127520082T>A	ENST00000262461.2	+	25	3513	c.3324T>A	c.(3322-3324)atT>atA	p.I1108I	SLC12A2_ENST00000343225.4_Silent_p.I1092I|SLC12A2_ENST00000507791.1_3'UTR	NM_001046.2	NP_001037.1	P55011	S12A2_HUMAN	solute carrier family 12 (sodium/potassium/chloride transporter), member 2	1108					ammonium transmembrane transport (GO:0072488)|ammonium transport (GO:0015696)|branching involved in mammary gland duct morphogenesis (GO:0060444)|chloride transmembrane transport (GO:1902476)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|gamma-aminobutyric acid signaling pathway (GO:0007214)|hyperosmotic response (GO:0006972)|ion transport (GO:0006811)|mammary duct terminal end bud growth (GO:0060763)|multicellular organism growth (GO:0035264)|positive regulation of cell volume (GO:0045795)|potassium ion transport (GO:0006813)|sodium ion transport (GO:0006814)|transepithelial ammonium transport (GO:0070634)|transepithelial chloride transport (GO:0030321)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	ammonium transmembrane transporter activity (GO:0008519)|sodium:potassium:chloride symporter activity (GO:0008511)			breast(3)|endometrium(5)|kidney(5)|large_intestine(12)|lung(16)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	48		all_cancers(142;0.0972)|Prostate(80;0.151)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	Epithelial(69;0.0433)|OV - Ovarian serous cystadenocarcinoma(64;0.0978)	Bumetanide(DB00887)|Potassium Chloride(DB00761)|Quinethazone(DB01325)	AGGAAATCATTGAGCCATACA	0.284																																					p.I1108I		Atlas-SNP	.											.	SLC12A2	119	.	0			c.T3324A						.						97.0	99.0	98.0					5																	127520082		2202	4300	6502	SO:0001819	synonymous_variant	6558	exon25			AATCATTGAGCCA		CCDS4144.1, CCDS58965.1	5q23.3	2014-06-13	2013-07-18		ENSG00000064651	ENSG00000064651		"""Solute carriers"""	10911	protein-coding gene	gene with protein product	"""bumetanide-sensitive sodium-(potassium)-chloride cotransporter 1"", ""basolateral Na-K-Cl symporter"", ""protein phosphatase 1, regulatory subunit 141"""	600840				7629105	Standard	NM_001256461		Approved	NKCC1, BSC, BSC2, PPP1R141	uc003kus.3	P55011	OTTHUMG00000128983	ENST00000262461.2:c.3324T>A	chr5.hg19:g.127520082T>A		323.0	0.0		345.0	61.0	NM_001046	Q8N713|Q8WWH7	Silent	SNP	ENST00000262461.2	hg19	CCDS4144.1																																																																																			.	.		0.284	SLC12A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250972.1	NM_001046	
PCDHB2	56133	hgsc.bcm.edu	37	5	140476346	140476346	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A7IE-01A-21D-A382-10	TCGA-CC-A7IE-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c1caf517-5052-48e3-ad80-8458b3d2ff5f	ab81329b-c119-4a5a-863c-5b50f48cee3f	g.chr5:140476346G>A	ENST00000194155.4	+	1	2120	c.1972G>A	c.(1972-1974)Gcc>Acc	p.A658T		NM_018936.2	NP_061759.1	Q9Y5E7	PCDB2_HUMAN	protocadherin beta 2	658	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.A658T(1)		NS(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(22)|lung(24)|ovary(3)|pancreas(1)|prostate(3)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(2)	71			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CTCGGCCACCGCCACGCTGCA	0.711																																					p.A658T		Atlas-SNP	.											PCDHB2,NS,carcinoma,0,1	PCDHB2	163	.	1	Substitution - Missense(1)	prostate(1)	c.G1972A						.						35.0	35.0	35.0					5																	140476346		1915	3814	5729	SO:0001583	missense	56133	exon1			GCCACCGCCACGC	AF152495	CCDS4244.1	5q31	2010-01-26			ENSG00000112852	ENSG00000112852		"""Cadherins / Protocadherins : Clustered"""	8687	other	protocadherin		606328				10380929	Standard	NM_018936		Approved	PCDH-BETA2	uc003lil.3	Q9Y5E7	OTTHUMG00000129606	ENST00000194155.4:c.1972G>A	chr5.hg19:g.140476346G>A	ENSP00000194155:p.Ala658Thr	107.0	0.0		74.0	28.0	NM_018936	Q4KMU1	Missense_Mutation	SNP	ENST00000194155.4	hg19	CCDS4244.1	.	.	.	.	.	.	.	.	.	.	G	12.99	2.104468	0.37145	.	.	ENSG00000112852	ENST00000194155	T	0.50548	0.74	3.99	3.99	0.46301	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.44871	0.1314	L	0.49571	1.57	0.28971	N	0.889222	B	0.29590	0.25	B	0.24848	0.056	T	0.50406	-0.8832	9	0.66056	D	0.02	.	16.1298	0.81418	0.0:0.0:1.0:0.0	.	658	Q9Y5E7	PCDB2_HUMAN	T	658	ENSP00000194155:A658T	ENSP00000194155:A658T	A	+	1	0	PCDHB2	140456530	0.260000	0.24053	1.000000	0.80357	0.344000	0.29017	3.030000	0.49720	1.921000	0.55644	0.456000	0.33151	GCC	.	.		0.711	PCDHB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251801.2	NM_018936	
PCDHB16	57717	hgsc.bcm.edu	37	5	140562936	140562936	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A7IE-01A-21D-A382-10	TCGA-CC-A7IE-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c1caf517-5052-48e3-ad80-8458b3d2ff5f	ab81329b-c119-4a5a-863c-5b50f48cee3f	g.chr5:140562936G>T	ENST00000361016.2	+	1	1957	c.802G>T	c.(802-804)Gat>Tat	p.D268Y		NM_020957.1	NP_066008.1	Q9NRJ7	PCDBG_HUMAN	protocadherin beta 16	268	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|endometrium(10)|kidney(3)|large_intestine(14)|lung(29)|ovary(5)|pancreas(2)|prostate(3)|skin(1)|urinary_tract(1)	69			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CTCCGCCAGGGATTTAGACGG	0.478																																					p.D268Y		Atlas-SNP	.											.	PCDHB16	159	.	0			c.G802T						.						62.0	64.0	64.0					5																	140562936		2203	4300	6503	SO:0001583	missense	57717	exon1			GCCAGGGATTTAG	AF217757	CCDS4251.1	5q31	2014-04-11			ENSG00000196963			"""Cadherins / Protocadherins : Clustered"""	14546	other	protocadherin	"""cadherin ME1"", ""protocadherin-3x"", ""PCDHbeta 16"""	606345				11230163, 11322959	Standard	NM_020957		Approved	PCDHB8a, PCDH3X, KIAA1621, PCDH-BETA16, ME1	uc003liv.3	Q9NRJ7	OTTHUMG00000188325	ENST00000361016.2:c.802G>T	chr5.hg19:g.140562936G>T	ENSP00000354293:p.Asp268Tyr	68.0	0.0		72.0	20.0	NM_020957	B3KPK5|Q8IYD5|Q96SE9|Q9HCF1	Missense_Mutation	SNP	ENST00000361016.2	hg19	CCDS4251.1	.	.	.	.	.	.	.	.	.	.	G	23.1	4.377667	0.82682	.	.	ENSG00000196963	ENST00000361016	T	0.75260	-0.92	4.75	4.75	0.60458	Cadherin (5);Cadherin-like (1);	0.000000	0.35585	N	0.003116	D	0.93141	0.7816	H	0.99820	4.81	0.54753	D	0.999984	D	0.89917	1.0	D	0.97110	1.0	D	0.96830	0.9610	10	0.87932	D	0	.	17.7391	0.88403	0.0:0.0:1.0:0.0	.	268	Q9NRJ7	PCDBG_HUMAN	Y	268	ENSP00000354293:D268Y	ENSP00000354293:D268Y	D	+	1	0	PCDHB16	140543120	1.000000	0.71417	0.142000	0.22268	0.891000	0.51852	9.792000	0.99085	2.169000	0.68431	0.591000	0.81541	GAT	.	.		0.478	PCDHB16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251800.1	NM_020957	
SOX30	11063	hgsc.bcm.edu	37	5	157053481	157053481	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A7IE-01A-21D-A382-10	TCGA-CC-A7IE-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c1caf517-5052-48e3-ad80-8458b3d2ff5f	ab81329b-c119-4a5a-863c-5b50f48cee3f	g.chr5:157053481G>A	ENST00000265007.6	-	5	2470	c.2129C>T	c.(2128-2130)cCt>cTt	p.P710L	SOX30_ENST00000311371.5_3'UTR|SOX30_ENST00000519442.1_Missense_Mutation_p.P405L	NM_178424.1	NP_848511.1	O94993	SOX30_HUMAN	SRY (sex determining region Y)-box 30	710					regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|response to corticosteroid (GO:0031960)|spermatogenesis (GO:0007283)|transcription from RNA polymerase II promoter (GO:0006366)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(9)|ovary(1)|pancreas(1)|prostate(1)|urinary_tract(1)	23	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.138)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			CTGAGGCACAGGGTTTAAGTT	0.458																																					p.P710L	Esophageal Squamous(31;525 799 19355 21125 41744)	Atlas-SNP	.											.	SOX30	67	.	0			c.C2129T						.						135.0	113.0	120.0					5																	157053481		2203	4300	6503	SO:0001583	missense	11063	exon5			GGCACAGGGTTTA	AB022083	CCDS4339.1, CCDS4340.1	5q33	2010-10-21			ENSG00000039600	ENSG00000039600		"""SRY (sex determining region Y)-boxes"""	30635	protein-coding gene	gene with protein product		606698				15019997, 11678506	Standard	NM_178424		Approved		uc003lxb.1	O94993	OTTHUMG00000130247	ENST00000265007.6:c.2129C>T	chr5.hg19:g.157053481G>A	ENSP00000265007:p.Pro710Leu	82.0	0.0		78.0	49.0	NM_178424	O94995|Q8IYX6	Missense_Mutation	SNP	ENST00000265007.6	hg19	CCDS4339.1	.	.	.	.	.	.	.	.	.	.	G	8.431	0.848514	0.17034	.	.	ENSG00000039600	ENST00000265007;ENST00000519442	D;D	0.98234	-4.54;-4.81	5.56	3.79	0.43588	.	0.101159	0.44285	D	0.000466	D	0.94231	0.8148	N	0.24115	0.695	0.46874	D	0.999231	B;B	0.32653	0.027;0.379	B;B	0.23716	0.012;0.048	D	0.92207	0.5773	10	0.87932	D	0	.	11.0271	0.47751	0.145:0.0:0.855:0.0	.	405;710	B4DXW7;O94993	.;SOX30_HUMAN	L	710;405	ENSP00000265007:P710L;ENSP00000427984:P405L	ENSP00000265007:P710L	P	-	2	0	SOX30	156986059	1.000000	0.71417	0.162000	0.22713	0.027000	0.11550	4.668000	0.61568	0.833000	0.34828	-0.142000	0.14014	CCT	.	.		0.458	SOX30-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252571.2	NM_007017	
TLX3	30012	hgsc.bcm.edu	37	5	170736625	170736626	+	Missense_Mutation	DNP	GG	GG	AT	rs368190023		TCGA-CC-A7IE-01A-21D-A382-10	TCGA-CC-A7IE-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c1caf517-5052-48e3-ad80-8458b3d2ff5f	ab81329b-c119-4a5a-863c-5b50f48cee3f	g.chr5:170736625_170736626GG>AT	ENST00000296921.5	+	1	338_339	c.256_257GG>AT	c.(256-258)GGc>ATc	p.G86I		NM_021025.2	NP_066305.2	O43711	TLX3_HUMAN	T-cell leukemia homeobox 3	86					central nervous system development (GO:0007417)|negative regulation of neuron differentiation (GO:0045665)|neuron fate specification (GO:0048665)|neuron migration (GO:0001764)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|regulation of transcription, DNA-templated (GO:0006355)|respiratory gaseous exchange (GO:0007585)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			central_nervous_system(1)	1	Renal(175;0.000159)|Lung NSC(126;0.00576)|all_lung(126;0.00963)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			AGCGCCCGCAGGCGTGATCCGG	0.733			T	BCL11B	T-ALL																																p.G86S|p.G86V	Esophageal Squamous(33;43 807 3116 3348 30094)	Atlas-SNP	.		Dom	yes		5	5q35.1	30012	"""T-cell leukemia, homeobox 3 (HOX11L2)"""		L	.	TLX3	23	.	0			c.G256A|c.G257T						.																																			SO:0001583	missense	30012	exon1			CCCGCAGGCGTGA|CCGCAGGCGTGAT	AJ223798	CCDS34288.1	5q35.1	2011-06-20	2005-12-22	2002-05-31	ENSG00000164438	ENSG00000164438		"""Homeoboxes / ANTP class : NKL subclass"""	13532	protein-coding gene	gene with protein product		604640	"""homeo box 11-like 2"", ""T-cell leukemia, homeobox 3"""	HOX11L2		11435718, 11435716	Standard	NM_021025		Approved	RNX	uc003mbf.3	O43711	OTTHUMG00000163207	Exception_encountered	chr5.hg19:g.170736625_170736626delinsAT	ENSP00000296921:p.Gly86Ile	118.0|117.0	0.0		129.0|130.0	64.0|65.0	NM_021025	Q96AD3	Missense_Mutation	SNP	ENST00000296921.5	hg19	CCDS34288.1																																																																																			.	.		0.733	TLX3-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000372076.3		
CNOT6	57472	hgsc.bcm.edu	37	5	180001165	180001165	+	Missense_Mutation	SNP	C	C	G			TCGA-CC-A7IE-01A-21D-A382-10	TCGA-CC-A7IE-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c1caf517-5052-48e3-ad80-8458b3d2ff5f	ab81329b-c119-4a5a-863c-5b50f48cee3f	g.chr5:180001165C>G	ENST00000393356.1	+	14	2063	c.1639C>G	c.(1639-1641)Caa>Gaa	p.Q547E	CNOT6_ENST00000261951.4_Missense_Mutation_p.Q547E			Q9ULM6	CNOT6_HUMAN	CCR4-NOT transcription complex, subunit 6	547	Nuclease domain. {ECO:0000250}.				exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|gene silencing by miRNA (GO:0035195)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA catabolic process, no-go decay (GO:0070966)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytoplasmic mRNA processing body assembly (GO:0010606)|positive regulation of ligand-dependent nuclear receptor transcription coactivator activity (GO:2000327)|regulation of transcription, DNA-templated (GO:0006355)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|transcription, DNA-templated (GO:0006351)	CCR4-NOT complex (GO:0030014)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	exoribonuclease activity (GO:0004532)|metal ion binding (GO:0046872)|poly(A)-specific ribonuclease activity (GO:0004535)|RNA binding (GO:0003723)			central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(10)|skin(1)	23	all_cancers(89;3.3e-05)|all_epithelial(37;7.38e-06)|Renal(175;0.000159)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.114)	all_cancers(40;0.00543)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_hematologic(541;0.163)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	OV - Ovarian serous cystadenocarcinoma(192;0.023)		TTTCCTGCCCCAAGTCAACGG	0.517																																					p.Q547E		Atlas-SNP	.											.	CNOT6	47	.	0			c.C1639G						.						115.0	120.0	118.0					5																	180001165		2203	4300	6503	SO:0001583	missense	57472	exon12			CTGCCCCAAGTCA	AB033020	CCDS4455.1	5q35.3	2014-06-17			ENSG00000113300	ENSG00000113300			14099	protein-coding gene	gene with protein product		608951				11889047	Standard	XM_005265953		Approved	CCR4, KIAA1194, Ccr4a	uc003mlx.3	Q9ULM6	OTTHUMG00000130935	ENST00000393356.1:c.1639C>G	chr5.hg19:g.180001165C>G	ENSP00000377024:p.Gln547Glu	129.0	0.0		132.0	37.0	NM_015455	A7MD46|D3DWR0	Missense_Mutation	SNP	ENST00000393356.1	hg19	CCDS4455.1	.	.	.	.	.	.	.	.	.	.	C	2.020	-0.424892	0.04701	.	.	ENSG00000113300	ENST00000261951;ENST00000393356	T;T	0.28666	1.6;1.6	5.62	4.75	0.60458	.	0.354425	0.29473	N	0.012058	T	0.22399	0.0540	L	0.38175	1.15	0.34626	D	0.71911	B	0.09022	0.002	B	0.12156	0.007	T	0.16719	-1.0393	9	.	.	.	-0.0497	9.6219	0.39727	0.0:0.7834:0.1427:0.0739	.	547	Q9ULM6	CNOT6_HUMAN	E	547	ENSP00000261951:Q547E;ENSP00000377024:Q547E	.	Q	+	1	0	CNOT6	179933771	1.000000	0.71417	0.980000	0.43619	0.779000	0.44077	1.192000	0.32150	2.639000	0.89480	0.585000	0.79938	CAA	.	.		0.517	CNOT6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253532.1	NM_015455	
HIST1H4D	8360	hgsc.bcm.edu	37	6	26189297	26189297	+	Missense_Mutation	SNP	C	C	G			TCGA-CC-A7IE-01A-21D-A382-10	TCGA-CC-A7IE-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c1caf517-5052-48e3-ad80-8458b3d2ff5f	ab81329b-c119-4a5a-863c-5b50f48cee3f	g.chr6:26189297C>G	ENST00000340756.2	-	1	7	c.8G>C	c.(7-9)gGc>gCc	p.G3A		NM_003539.3	NP_003530.1	P62805	H4_HUMAN	histone cluster 1, H4d	3					CENP-A containing nucleosome assembly (GO:0034080)|chromatin organization (GO:0006325)|DNA replication-dependent nucleosome assembly (GO:0006335)|DNA replication-independent nucleosome assembly (GO:0006336)|histone H4-K20 demethylation (GO:0035574)|mitotic cell cycle (GO:0000278)|negative regulation of megakaryocyte differentiation (GO:0045653)|nucleosome assembly (GO:0006334)|telomere maintenance (GO:0000723)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|histone demethylase activity (H4-K20 specific) (GO:0035575)|poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(2)|large_intestine(2)|lung(1)|prostate(1)	8		all_hematologic(11;0.196)				CTTACCGCGGCCAGACATCTT	0.512																																					p.G3A		Atlas-SNP	.											.	HIST1H4D	28	.	0			c.G8C						.						49.0	53.0	51.0					6																	26189297		2203	4300	6503	SO:0001583	missense	8360	exon1			CCGCGGCCAGACA	X60482	CCDS4589.1	6p22.1	2011-01-27	2006-10-11	2003-02-21	ENSG00000188987	ENSG00000277157		"""Histones / Replication-dependent"""	4782	protein-coding gene	gene with protein product		602823	"""H4 histone family, member B"", ""histone 1, H4d"""	H4FB		9119399, 12408966	Standard	NM_003539		Approved	H4/b	uc003ngu.3	P62805	OTTHUMG00000014423	ENST00000340756.2:c.8G>C	chr6.hg19:g.26189297C>G	ENSP00000343282:p.Gly3Ala	38.0	0.0		60.0	17.0	NM_003539	A2VCL0|P02304|P02305|Q6DRA9|Q6FGB8|Q6NWP7	Missense_Mutation	SNP	ENST00000340756.2	hg19	CCDS4589.1	.	.	.	.	.	.	.	.	.	.	.	13.03	2.116706	0.37339	.	.	ENSG00000188987	ENST00000340756	.	.	.	5.32	4.46	0.54185	.	0.000000	0.85682	D	0.000000	T	0.65091	0.2658	.	.	.	0.40658	D	0.982103	.	.	.	.	.	.	T	0.71279	-0.4640	6	0.87932	D	0	.	13.0254	0.58812	0.0:0.9221:0.0:0.0779	.	.	.	.	A	3	.	ENSP00000343282:G3A	G	-	2	0	HIST1H4D	26297276	1.000000	0.71417	0.842000	0.33263	0.030000	0.12068	7.434000	0.80377	1.254000	0.44035	-0.142000	0.14014	GGC	.	.		0.512	HIST1H4D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040085.1	NM_003539	
MEP1A	4224	hgsc.bcm.edu	37	6	46803136	46803136	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-A7IE-01A-21D-A382-10	TCGA-CC-A7IE-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c1caf517-5052-48e3-ad80-8458b3d2ff5f	ab81329b-c119-4a5a-863c-5b50f48cee3f	g.chr6:46803136A>T	ENST00000230588.4	+	13	1943	c.1934A>T	c.(1933-1935)cAg>cTg	p.Q645L		NM_005588.2	NP_005579.2	Q16819	MEP1A_HUMAN	meprin A, alpha (PABA peptide hydrolase)	645					digestion (GO:0007586)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|meprin A complex (GO:0017090)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(5)|kidney(2)|large_intestine(4)|lung(21)|ovary(1)|pancreas(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	42			Lung(136;0.192)			AGCCTGAGCCAGGGGCAGCCC	0.607																																					p.Q645L		Atlas-SNP	.											.	MEP1A	93	.	0			c.A1934T						.						22.0	21.0	21.0					6																	46803136		2203	4300	6503	SO:0001583	missense	4224	exon13			TGAGCCAGGGGCA		CCDS4918.1	6p12-p11	2010-10-18			ENSG00000112818	ENSG00000112818	3.4.24.18		7015	protein-coding gene	gene with protein product		600388				7774936	Standard	NM_005588		Approved	PPHA	uc010jzh.1	Q16819	OTTHUMG00000014790	ENST00000230588.4:c.1934A>T	chr6.hg19:g.46803136A>T	ENSP00000230588:p.Gln645Leu	88.0	0.0		108.0	35.0	NM_005588	A2RRM4|B0AZP9|B2RCS2|Q8TDC9|Q9H1R1	Missense_Mutation	SNP	ENST00000230588.4	hg19	CCDS4918.1	.	.	.	.	.	.	.	.	.	.	A	7.561	0.664682	0.14710	.	.	ENSG00000112818	ENST00000230588	T	0.24908	1.83	5.35	2.88	0.33553	.	0.784026	0.12295	N	0.481627	T	0.08582	0.0213	L	0.56769	1.78	0.18873	N	0.999981	B;B	0.30482	0.118;0.281	B;B	0.22601	0.025;0.04	T	0.27191	-1.0081	10	0.33940	T	0.23	-3.3402	6.602	0.22705	0.7619:0.1552:0.0828:0.0	.	673;645	B7ZL91;Q16819	.;MEP1A_HUMAN	L	645	ENSP00000230588:Q645L	ENSP00000230588:Q645L	Q	+	2	0	MEP1A	46911095	0.973000	0.33851	0.102000	0.21198	0.027000	0.11550	1.558000	0.36309	0.330000	0.23485	0.528000	0.53228	CAG	.	.		0.607	MEP1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040803.1	NM_005588	
CRISP1	167	hgsc.bcm.edu	37	6	49825047	49825047	+	Splice_Site	SNP	C	C	A			TCGA-CC-A7IE-01A-21D-A382-10	TCGA-CC-A7IE-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c1caf517-5052-48e3-ad80-8458b3d2ff5f	ab81329b-c119-4a5a-863c-5b50f48cee3f	g.chr6:49825047C>A	ENST00000335847.4	-	2	168		c.e2+1		CRISP1_ENST00000329411.5_Splice_Site|CRISP1_ENST00000507853.1_Splice_Site|CRISP1_ENST00000355791.2_Splice_Site|CRISP1_ENST00000505118.1_Splice_Site|CRISP1_ENST00000536021.1_Splice_Site	NM_001131.2	NP_001122.2	P54107	CRIS1_HUMAN	cysteine-rich secretory protein 1						binding of sperm to zona pellucida (GO:0007339)|fusion of sperm to egg plasma membrane (GO:0007342)|regulation of acrosome reaction (GO:0060046)	extracellular space (GO:0005615)|nucleus (GO:0005634)	calcium channel regulator activity (GO:0005246)			endometrium(1)|kidney(2)|large_intestine(6)|lung(15)|skin(2)|upper_aerodigestive_tract(1)	27	Lung NSC(77;0.0358)					CCCTCACATACTTTCATGGAC	0.348																																					.		Atlas-SNP	.											.	CRISP1	45	.	0			c.66+1G>T						.						84.0	77.0	79.0					6																	49825047		2203	4300	6503	SO:0001630	splice_region_variant	167	exon3			CACATACTTTCAT	D38451	CCDS4931.1, CCDS4932.1	6p21.2-p21.1	2008-02-05	2003-09-03	2003-09-05	ENSG00000124812	ENSG00000124812			304	protein-coding gene	gene with protein product		601193	"""acidic epididymal glycoprotein-like 1"""	AEGL1		8838800	Standard	NM_001131		Approved	CRISP-1, ARP, HUMARP, HSCRISP1D, HSCRISP1G	uc003ozw.2	P54107	OTTHUMG00000014827	ENST00000335847.4:c.66+1G>T	chr6.hg19:g.49825047C>A		335.0	0.0		416.0	118.0	NM_170609	B5BU98|O00698|Q13248|Q14082|Q96SF6	Splice_Site	SNP	ENST00000335847.4	hg19	CCDS4931.1	.	.	.	.	.	.	.	.	.	.	C	7.857	0.725186	0.15439	.	.	ENSG00000124812	ENST00000507853;ENST00000335847;ENST00000355791;ENST00000329411;ENST00000505118;ENST00000536021	.	.	.	4.22	2.45	0.29901	.	.	.	.	.	.	.	.	.	.	.	0.58432	D	0.999995	.	.	.	.	.	.	.	.	.	.	.	.	.	.	6.7782	0.23630	0.0:0.791:0.0:0.209	.	.	.	.	.	-1	.	.	.	-	.	.	CRISP1	49933006	0.797000	0.28877	0.530000	0.27963	0.018000	0.09664	1.357000	0.34090	0.743000	0.32719	0.655000	0.94253	.	.	.		0.348	CRISP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040875.2	NM_001131	Intron
COL12A1	1303	hgsc.bcm.edu	37	6	75853040	75853040	+	Silent	SNP	A	A	G			TCGA-CC-A7IE-01A-21D-A382-10	TCGA-CC-A7IE-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c1caf517-5052-48e3-ad80-8458b3d2ff5f	ab81329b-c119-4a5a-863c-5b50f48cee3f	g.chr6:75853040A>G	ENST00000322507.8	-	26	5064	c.4755T>C	c.(4753-4755)ttT>ttC	p.F1585F	COL12A1_ENST00000345356.6_Silent_p.F421F|COL12A1_ENST00000483888.2_Silent_p.F1585F|COL12A1_ENST00000416123.2_Silent_p.F1585F	NM_004370.5	NP_004361.3	Q99715	COCA1_HUMAN	collagen, type XII, alpha 1	1585	Fibronectin type-III 11. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skeletal system development (GO:0001501)	collagen type XII trimer (GO:0005595)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|vesicle (GO:0031982)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)			breast(7)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(5)|kidney(5)|large_intestine(44)|liver(1)|lung(77)|ovary(7)|prostate(3)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(2)	169						CAGGTTCCCAAAAGACATTCA	0.408																																					p.F1585F		Atlas-SNP	.											.	COL12A1	385	.	0			c.T4755C						.						143.0	130.0	134.0					6																	75853040		1870	4121	5991	SO:0001819	synonymous_variant	1303	exon26			TTCCCAAAAGACA	U73779	CCDS43481.1, CCDS43482.1	6q12-q13	2013-02-11	2003-07-24		ENSG00000111799	ENSG00000111799		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"", ""Fibronectin type III domain containing"""	2188	protein-coding gene	gene with protein product	"""collagen type XII proteoglycan"""	120320	"""collagen, type XII, alpha 1-like"""	COL12A1L		9143499	Standard	XM_006715334		Approved		uc003phs.3	Q99715	OTTHUMG00000015051	ENST00000322507.8:c.4755T>C	chr6.hg19:g.75853040A>G		109.0	0.0		122.0	23.0	NM_004370	O43853|Q15955|Q5VYK1|Q5VYK2|Q71UR3|Q99716	Silent	SNP	ENST00000322507.8	hg19	CCDS43482.1																																																																																			.	.		0.408	COL12A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041249.3	NM_004370	
FAXC	84553	hgsc.bcm.edu	37	6	99781226	99781227	+	Splice_Site	DNP	CC	CC	AG			TCGA-CC-A7IE-01A-21D-A382-10	TCGA-CC-A7IE-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c1caf517-5052-48e3-ad80-8458b3d2ff5f	ab81329b-c119-4a5a-863c-5b50f48cee3f	g.chr6:99781226_99781227CC>AG	ENST00000389677.5	-	3	881_882	c.599_600GG>CT	c.(598-600)tGG>tCT	p.W200S	FAXC_ENST00000538471.1_Intron	NM_032511.2	NP_115900.1	Q5TGI0	FAXC_HUMAN	failed axon connections homolog (Drosophila)	200						integral component of membrane (GO:0016021)											AGGGGACTCACCAGTAGAAGTG	0.495																																					.|p.W200S		Atlas-SNP	.											.	.	.	.	0			c.599+1G>T|c.G599C						.																																			SO:0001630	splice_region_variant	84553	exon4|exon3			GACTCACCAGTAG|ACTCACCAGTAGA	BC011583	CCDS34500.1	6q16.3	2012-02-07	2012-02-07	2012-02-07	ENSG00000146267	ENSG00000146267			20742	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 168"""	C6orf168		12477932	Standard	NM_032511		Approved	MGC2817, dJ273F20	uc003ppj.4	Q5TGI0	OTTHUMG00000015261	ENST00000389677.5:c.599_600delinsAG	chr6.hg19:g.99781226_99781227delinsAG		81.0|83.0	0.0		79.0|81.0	22.0|23.0	NM_032511	B3KU39|Q96F61|Q96LU3|Q9BR58|Q9BSS2	Splice_Site|Missense_Mutation	SNP	ENST00000389677.5	hg19	CCDS34500.1																																																																																			.	.		0.495	FAXC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041589.4	NM_032511	Missense_Mutation
WASF1	8936	hgsc.bcm.edu	37	6	110448713	110448713	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A7IE-01A-21D-A382-10	TCGA-CC-A7IE-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c1caf517-5052-48e3-ad80-8458b3d2ff5f	ab81329b-c119-4a5a-863c-5b50f48cee3f	g.chr6:110448713T>A	ENST00000392589.1	-	4	928	c.92A>T	c.(91-93)aAt>aTt	p.N31I	WASF1_ENST00000359451.2_Missense_Mutation_p.N31I|WASF1_ENST00000392587.2_Missense_Mutation_p.N31I|WASF1_ENST00000392588.1_Missense_Mutation_p.N31I|WASF1_ENST00000392586.1_Missense_Mutation_p.N31I	NM_003931.2	NP_003922.1	Q92558	WASF1_HUMAN	WAS protein family, member 1	31					actin filament polymerization (GO:0030041)|cellular component movement (GO:0006928)|lamellipodium morphogenesis (GO:0072673)|positive regulation of Arp2/3 complex-mediated actin nucleation (GO:2000601)|protein complex assembly (GO:0006461)|Rac protein signal transduction (GO:0016601)	actin cytoskeleton (GO:0015629)|cell junction (GO:0030054)|cytoskeleton (GO:0005856)|lamellipodium (GO:0030027)|mitochondrial outer membrane (GO:0005741)|SCAR complex (GO:0031209)|synapse (GO:0045202)	protein complex binding (GO:0032403)			breast(1)|central_nervous_system(1)|kidney(2)|large_intestine(3)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	16		all_cancers(87;1.18e-05)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;0.00159)|Colorectal(196;0.0488)		OV - Ovarian serous cystadenocarcinoma(136;0.0364)|Epithelial(106;0.051)|all cancers(137;0.0687)		CAAGGAAATATTGGTTACACA	0.358																																					p.N31I		Atlas-SNP	.											.	WASF1	35	.	0			c.A92T						.						105.0	102.0	103.0					6																	110448713		2203	4300	6503	SO:0001583	missense	8936	exon3			GAAATATTGGTTA	D87459	CCDS5080.1	6q21	2010-08-20			ENSG00000112290	ENSG00000112290		"""A-kinase anchor proteins"""	12732	protein-coding gene	gene with protein product		605035				9843499, 9889097	Standard	XM_005267204		Approved	WAVE1, SCAR1, KIAA0269, WAVE	uc003pty.1	Q92558	OTTHUMG00000015357	ENST00000392589.1:c.92A>T	chr6.hg19:g.110448713T>A	ENSP00000376368:p.Asn31Ile	125.0	0.0		135.0	28.0	NM_001024935	E1P5F2|Q5SZK7	Missense_Mutation	SNP	ENST00000392589.1	hg19	CCDS5080.1	.	.	.	.	.	.	.	.	.	.	T	20.6	4.017181	0.75161	.	.	ENSG00000112290	ENST00000392586;ENST00000392587;ENST00000392589;ENST00000392588;ENST00000359451;ENST00000444391;ENST00000265601;ENST00000368938;ENST00000419252;ENST00000447287	T;T;T;T;T;T;T;T;T;T	0.50001	0.76;0.76;0.76;0.76;0.76;0.76;0.76;0.76;0.76;0.76	5.97	5.97	0.96955	.	0.000000	0.85682	D	0.000000	T	0.68970	0.3059	M	0.89904	3.07	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.72890	-0.4155	10	0.39692	T	0.17	.	16.4534	0.84003	0.0:0.0:0.0:1.0	.	31	Q92558	WASF1_HUMAN	I	31	ENSP00000376365:N31I;ENSP00000376366:N31I;ENSP00000376368:N31I;ENSP00000376367:N31I;ENSP00000352425:N31I;ENSP00000407041:N31I;ENSP00000265601:N31I;ENSP00000357934:N31I;ENSP00000404142:N31I;ENSP00000402663:N31I	ENSP00000265601:N31I	N	-	2	0	WASF1	110555406	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.698000	0.84413	2.285000	0.76669	0.477000	0.44152	AAT	.	.		0.358	WASF1-203	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041784.3	NM_003931	
DSE	29940	hgsc.bcm.edu	37	6	116756880	116756880	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A7IE-01A-21D-A382-10	TCGA-CC-A7IE-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c1caf517-5052-48e3-ad80-8458b3d2ff5f	ab81329b-c119-4a5a-863c-5b50f48cee3f	g.chr6:116756880T>C	ENST00000331677.3	+	7	1693	c.1249T>C	c.(1249-1251)Ttc>Ctc	p.F417L	DSE_ENST00000359564.2_Missense_Mutation_p.F417L|DSE_ENST00000452085.3_Missense_Mutation_p.F417L|DSE_ENST00000537543.1_Missense_Mutation_p.F436L			Q9UL01	DSE_HUMAN	dermatan sulfate epimerase	417					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	chondroitin-glucuronate 5-epimerase activity (GO:0047757)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|liver(2)|lung(12)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	35		all_cancers(87;0.00019)|all_epithelial(87;0.000416)|Ovarian(999;0.133)|Colorectal(196;0.234)		Epithelial(106;0.00915)|OV - Ovarian serous cystadenocarcinoma(136;0.0149)|GBM - Glioblastoma multiforme(226;0.0189)|all cancers(137;0.0262)		TTTCCTTTCCTTCAAGTCTGG	0.423																																					p.F417L		Atlas-SNP	.											.	DSE	98	.	0			c.T1249C						.						77.0	73.0	75.0					6																	116756880		2203	4300	6503	SO:0001583	missense	29940	exon6			CTTTCCTTCAAGT	AF098066	CCDS5107.1	6q22	2008-02-05	2007-01-29	2007-01-29	ENSG00000111817	ENSG00000111817	5.1.3.19		21144	protein-coding gene	gene with protein product		605942	"""squamous cell carcinoma antigen recognized by T cells 2"""	SART2		11920522, 16505484	Standard	NM_001080976		Approved	DSEPI	uc003pws.3	Q9UL01	OTTHUMG00000015434	ENST00000331677.3:c.1249T>C	chr6.hg19:g.116756880T>C	ENSP00000332151:p.Phe417Leu	149.0	0.0		199.0	52.0	NM_001080976	Q5R3K6	Missense_Mutation	SNP	ENST00000331677.3	hg19	CCDS5107.1	.	.	.	.	.	.	.	.	.	.	T	22.9	4.354546	0.82243	.	.	ENSG00000111817	ENST00000452085;ENST00000537543;ENST00000331677;ENST00000359564	T;T;T;T	0.26518	1.73;1.73;1.73;1.73	5.99	5.99	0.97316	.	0.000000	0.85682	D	0.000000	T	0.44286	0.1286	M	0.75777	2.31	0.80722	D	1	D;D	0.67145	0.996;0.996	D;D	0.73380	0.98;0.98	T	0.44877	-0.9299	10	0.62326	D	0.03	-21.5989	16.4943	0.84223	0.0:0.0:0.0:1.0	.	436;417	B7Z765;Q9UL01	.;DSE_HUMAN	L	417;436;417;417	ENSP00000404049:F417L;ENSP00000441152:F436L;ENSP00000332151:F417L;ENSP00000352567:F417L	ENSP00000332151:F417L	F	+	1	0	DSE	116863573	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.985000	0.88162	2.291000	0.77112	0.533000	0.62120	TTC	.	.		0.423	DSE-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041940.2	NM_013352	
TRDN	10345	hgsc.bcm.edu	37	6	123673710	123673710	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A7IE-01A-21D-A382-10	TCGA-CC-A7IE-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c1caf517-5052-48e3-ad80-8458b3d2ff5f	ab81329b-c119-4a5a-863c-5b50f48cee3f	g.chr6:123673710T>A	ENST00000398178.3	-	21	1364	c.1343A>T	c.(1342-1344)gAg>gTg	p.E448V	TRDN_ENST00000334268.4_Missense_Mutation_p.E448V	NM_006073.3	NP_006064.2	Q13061	TRDN_HUMAN	triadin	448					cellular calcium ion homeostasis (GO:0006874)|cytoplasmic microtubule organization (GO:0031122)|endoplasmic reticulum membrane organization (GO:0090158)|heart contraction (GO:0060047)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|myotube differentiation (GO:0014902)|negative regulation of ryanodine-sensitive calcium-release channel activity (GO:0060315)|positive regulation of cell communication by electrical coupling involved in cardiac conduction (GO:1901846)|positive regulation of ryanodine-sensitive calcium-release channel activity (GO:0060316)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of cell communication by electrical coupling (GO:0010649)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to organic cyclic compound (GO:0014070)|transmembrane transport (GO:0055085)	calcium channel complex (GO:0034704)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum lumen (GO:0033018)|sarcoplasmic reticulum membrane (GO:0033017)	ion channel binding (GO:0044325)|protein binding, bridging (GO:0030674)|protein homodimerization activity (GO:0042803)			NS(1)|endometrium(1)|kidney(1)|large_intestine(8)|liver(1)|lung(22)|ovary(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	41				GBM - Glioblastoma multiforme(226;0.184)		GGTTGTTTTCTCTTCCTTCTT	0.383																																					p.E449V		Atlas-SNP	.											.	TRDN	88	.	0			c.A1346T						.						162.0	148.0	152.0					6																	123673710		1835	4090	5925	SO:0001583	missense	10345	exon21			GTTTTCTCTTCCT	U18985	CCDS59035.1, CCDS75511.1	6q22.31	2008-05-15			ENSG00000186439	ENSG00000186439			12261	protein-coding gene	gene with protein product		603283				7588753	Standard	NM_001251987		Approved		uc003pzj.2	Q13061	OTTHUMG00000015497	ENST00000398178.3:c.1343A>T	chr6.hg19:g.123673710T>A	ENSP00000381240:p.Glu448Val	103.0	0.0		99.0	26.0	NM_001251987	A5D6W5|F5H2W7|Q6NSB8	Missense_Mutation	SNP	ENST00000398178.3	hg19	CCDS55053.1	.	.	.	.	.	.	.	.	.	.	T	20.5	4.008482	0.75046	.	.	ENSG00000186439	ENST00000398178;ENST00000398161;ENST00000334268	T;T	0.30182	1.54;1.55	5.66	5.66	0.87406	.	0.109888	0.40554	N	0.001071	T	0.31104	0.0786	L	0.27053	0.805	0.80722	D	1	D;D;D	0.89917	0.999;0.999;1.0	D;D;D	0.85130	0.996;0.996;0.997	T	0.09997	-1.0649	10	0.41790	T	0.15	-12.9629	13.5732	0.61858	0.0:0.0:0.0:1.0	.	448;449;448	Q5SWK9;Q8IVK2;Q13061	.;.;TRDN_HUMAN	V	448;450;448	ENSP00000381240:E448V;ENSP00000333984:E448V	ENSP00000333984:E448V	E	-	2	0	TRDN	123715409	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.933000	0.48948	2.285000	0.76669	0.533000	0.62120	GAG	.	.		0.383	TRDN-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding			
TAB2	23118	hgsc.bcm.edu	37	6	149700569	149700569	+	Silent	SNP	C	C	A			TCGA-CC-A7IE-01A-21D-A382-10	TCGA-CC-A7IE-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c1caf517-5052-48e3-ad80-8458b3d2ff5f	ab81329b-c119-4a5a-863c-5b50f48cee3f	g.chr6:149700569C>A	ENST00000367456.1	+	4	2095	c.1518C>A	c.(1516-1518)ctC>ctA	p.L506L	TAB2_ENST00000286332.5_Silent_p.L506L|TAB2_ENST00000536230.1_Silent_p.L474L|TAB2_ENST00000392282.1_Silent_p.L506L|TAB2_ENST00000538427.1_Silent_p.L506L			Q9NYJ8	TAB2_HUMAN	TGF-beta activated kinase 1/MAP3K7 binding protein 2	506					activation of MAPK activity (GO:0000187)|Fc-epsilon receptor signaling pathway (GO:0038095)|heart development (GO:0007507)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|innate immune response (GO:0045087)|JNK cascade (GO:0007254)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of protein kinase activity (GO:0045860)|stress-activated MAPK cascade (GO:0051403)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|endosome membrane (GO:0010008)|plasma membrane (GO:0005886)	K63-linked polyubiquitin binding (GO:0070530)|zinc ion binding (GO:0008270)			breast(2)|endometrium(6)|kidney(3)|large_intestine(2)|lung(7)|ovary(1)|urinary_tract(1)	22						TTCAGCACCTCACGGACCCTA	0.428																																					p.L506L		Atlas-SNP	.											.	TAB2	55	.	0			c.C1518A						.						92.0	86.0	88.0					6																	149700569		2203	4300	6503	SO:0001819	synonymous_variant	23118	exon5			GCACCTCACGGAC	AF241230	CCDS5214.1	6q25.1	2010-08-05	2010-02-05	2010-02-05	ENSG00000055208	ENSG00000055208			17075	protein-coding gene	gene with protein product		605101	"""mitogen-activated protein kinase kinase kinase 7 interacting protein 2"""	MAP3K7IP2		9872452, 10882101	Standard	XR_250046		Approved	KIAA0733	uc010kib.2	Q9NYJ8	OTTHUMG00000015783	ENST00000367456.1:c.1518C>A	chr6.hg19:g.149700569C>A		152.0	0.0		190.0	57.0	NM_015093	B2RCC4|E1P5A0|O94838|Q6I9W8|Q76N06|Q9UFP7	Silent	SNP	ENST00000367456.1	hg19	CCDS5214.1																																																																																			.	.		0.428	TAB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042633.3		
CYP2W1	54905	hgsc.bcm.edu	37	7	1026832	1026832	+	Silent	SNP	C	C	T			TCGA-CC-A7IE-01A-21D-A382-10	TCGA-CC-A7IE-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c1caf517-5052-48e3-ad80-8458b3d2ff5f	ab81329b-c119-4a5a-863c-5b50f48cee3f	g.chr7:1026832C>T	ENST00000308919.7	+	6	922	c.909C>T	c.(907-909)gcC>gcT	p.A303A	CYP2W1_ENST00000340150.6_Silent_p.A247A	NM_017781.2	NP_060251.2	Q8TAV3	CP2W1_HUMAN	cytochrome P450, family 2, subfamily W, polypeptide 1	303					small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen (GO:0016705)			breast(1)|large_intestine(1)|lung(4)|urinary_tract(1)	7		Ovarian(82;0.0112)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0178)|OV - Ovarian serous cystadenocarcinoma(56;1.74e-15)		CGACCTCGGCCACGCTGCAGT	0.726																																					p.A303A		Atlas-SNP	.											.	CYP2W1	28	.	0			c.C909T						.						12.0	14.0	13.0					7																	1026832		2155	4233	6388	SO:0001819	synonymous_variant	54905	exon6			CTCGGCCACGCTG	AK000366	CCDS5319.2	7p22.3	2004-07-05			ENSG00000073067	ENSG00000073067		"""Cytochrome P450s"""	20243	protein-coding gene	gene with protein product		615967					Standard	XM_005249792		Approved	FLJ20359, MGC34287	uc003sjq.1	Q8TAV3	OTTHUMG00000074071	ENST00000308919.7:c.909C>T	chr7.hg19:g.1026832C>T		100.0	0.0		151.0	68.0	NM_017781		Silent	SNP	ENST00000308919.7	hg19	CCDS5319.2																																																																																			.	.		0.726	CYP2W1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157249.1	NM_017781	
GRID2IP	392862	hgsc.bcm.edu	37	7	6547736	6547736	+	Silent	SNP	G	G	A			TCGA-CC-A7IE-01A-21D-A382-10	TCGA-CC-A7IE-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c1caf517-5052-48e3-ad80-8458b3d2ff5f	ab81329b-c119-4a5a-863c-5b50f48cee3f	g.chr7:6547736G>A	ENST00000457091.2	-	13	2423	c.2424C>T	c.(2422-2424)ccC>ccT	p.P808P	GRID2IP_ENST00000452113.1_Silent_p.P617P|GRID2IP_ENST00000435185.1_Silent_p.P624P	NM_001145118.1	NP_001138590.1	A4D2P6	GRD2I_HUMAN	glutamate receptor, ionotropic, delta 2 (Grid2) interacting protein	808	Pro-rich.				long term synaptic depression (GO:0060292)	cell junction (GO:0030054)|postsynaptic membrane (GO:0045211)				endometrium(4)	4						GGGGTGCACAGGGCACGGGTG	0.706																																					p.P808P		Atlas-SNP	.											.	GRID2IP	82	.	0			c.C2424T						.						1.0	1.0	1.0					7																	6547736		472	1091	1563	SO:0001819	synonymous_variant	392862	exon13			TGCACAGGGCACG		CCDS47537.1	7p22	2007-10-05	2006-03-01		ENSG00000215045	ENSG00000215045			18464	protein-coding gene	gene with protein product		610639	"""glutamate receptor, ionotropic, delta 2 (Grid2) interacting protein 1"""			14612983	Standard	NM_001145118		Approved		uc011jwx.2	A4D2P6	OTTHUMG00000155531	ENST00000457091.2:c.2424C>T	chr7.hg19:g.6547736G>A		23.0	0.0		33.0	10.0	NM_001145118		Silent	SNP	ENST00000457091.2	hg19	CCDS47537.1																																																																																			.	.		0.706	GRID2IP-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340534.1	XM_294249	
VWDE	221806	hgsc.bcm.edu	37	7	12397064	12397064	+	Missense_Mutation	SNP	C	C	A	rs575787774		TCGA-CC-A7IE-01A-21D-A382-10	TCGA-CC-A7IE-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c1caf517-5052-48e3-ad80-8458b3d2ff5f	ab81329b-c119-4a5a-863c-5b50f48cee3f	g.chr7:12397064C>A	ENST00000275358.3	-	17	3540	c.3352G>T	c.(3352-3354)Gtg>Ttg	p.V1118L		NM_001135924.1	NP_001129396.1	Q8N2E2	VWDE_HUMAN	von Willebrand factor D and EGF domains	1118						extracellular region (GO:0005576)				breast(4)|endometrium(2)|kidney(1)|skin(1)	8						TCGAAGGCCACGAACTGATAC	0.428																																					p.V1118L		Atlas-SNP	.											.	VWDE	123	.	0			c.G3352T						.						106.0	95.0	98.0					7																	12397064		692	1591	2283	SO:0001583	missense	221806	exon17			AGGCCACGAACTG		CCDS47544.1	7p21.3	2008-09-23			ENSG00000146530	ENSG00000146530			21897	protein-coding gene	gene with protein product						14702039, 16303743	Standard	NM_001135924		Approved	FLJ14712	uc003ssj.2	Q8N2E2	OTTHUMG00000152315	ENST00000275358.3:c.3352G>T	chr7.hg19:g.12397064C>A	ENSP00000275358:p.Val1118Leu	108.0	0.0		131.0	16.0	NM_001135924	B7ZM77|Q96SQ3	Missense_Mutation	SNP	ENST00000275358.3	hg19	CCDS47544.1	.	.	.	.	.	.	.	.	.	.	c	2.966	-0.213548	0.06140	.	.	ENSG00000146530	ENST00000275358;ENST00000536307	D	0.81659	-1.52	3.96	-1.68	0.08212	.	1.040500	0.07480	N	0.903669	T	0.64394	0.2594	L	0.33485	1.01	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.43393	-0.9394	10	0.22706	T	0.39	.	1.7426	0.02955	0.1434:0.3372:0.1302:0.3893	.	1118	Q8N2E2	VWDE_HUMAN	L	1118;572	ENSP00000275358:V1118L	ENSP00000275358:V1118L	V	-	1	0	VWDE	12363589	0.000000	0.05858	0.709000	0.30452	0.633000	0.38033	-0.381000	0.07417	-0.083000	0.12618	-0.300000	0.09419	GTG	.	.		0.428	VWDE-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325870.3	XM_371878	
VWDE	221806	hgsc.bcm.edu	37	7	12407058	12407058	+	Silent	SNP	A	A	G			TCGA-CC-A7IE-01A-21D-A382-10	TCGA-CC-A7IE-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c1caf517-5052-48e3-ad80-8458b3d2ff5f	ab81329b-c119-4a5a-863c-5b50f48cee3f	g.chr7:12407058A>G	ENST00000275358.3	-	13	3011	c.2823T>C	c.(2821-2823)aaT>aaC	p.N941N		NM_001135924.1	NP_001129396.1	Q8N2E2	VWDE_HUMAN	von Willebrand factor D and EGF domains	941						extracellular region (GO:0005576)				breast(4)|endometrium(2)|kidney(1)|skin(1)	8						CCATCATACAATTATATTTTT	0.303																																					p.N941N		Atlas-SNP	.											.	VWDE	123	.	0			c.T2823C						.						92.0	82.0	85.0					7																	12407058		692	1587	2279	SO:0001819	synonymous_variant	221806	exon13			CATACAATTATAT		CCDS47544.1	7p21.3	2008-09-23			ENSG00000146530	ENSG00000146530			21897	protein-coding gene	gene with protein product						14702039, 16303743	Standard	NM_001135924		Approved	FLJ14712	uc003ssj.2	Q8N2E2	OTTHUMG00000152315	ENST00000275358.3:c.2823T>C	chr7.hg19:g.12407058A>G		282.0	0.0		328.0	139.0	NM_001135924	B7ZM77|Q96SQ3	Silent	SNP	ENST00000275358.3	hg19	CCDS47544.1																																																																																			.	.		0.303	VWDE-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325870.3	XM_371878	
CBX3	11335	hgsc.bcm.edu	37	7	26246056	26246056	+	Silent	SNP	C	C	T	rs575959807		TCGA-CC-A7IE-01A-21D-A382-10	TCGA-CC-A7IE-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c1caf517-5052-48e3-ad80-8458b3d2ff5f	ab81329b-c119-4a5a-863c-5b50f48cee3f	g.chr7:26246056C>T	ENST00000337620.4	+	3	521	c.93C>T	c.(91-93)gtC>gtT	p.V31V	CBX3_ENST00000396386.2_Silent_p.V31V|CBX3_ENST00000409747.1_Silent_p.V31V|CBX3_ENST00000497498.1_3'UTR	NM_007276.4	NP_009207.2	Q13185	CBX3_HUMAN	chromobox homolog 3	31	Chromo 1. {ECO:0000255|PROSITE- ProRule:PRU00053}.				chromatin remodeling (GO:0006338)|negative regulation of transcription, DNA-templated (GO:0045892)|rhythmic process (GO:0048511)|transcription, DNA-templated (GO:0006351)	chromatin (GO:0000785)|condensed chromosome, centromeric region (GO:0000779)|nuclear envelope (GO:0005635)|nuclear euchromatin (GO:0005719)|nuclear heterochromatin (GO:0005720)|nuclear inner membrane (GO:0005637)|nuclear pericentric heterochromatin (GO:0031618)|nucleus (GO:0005634)|spindle (GO:0005819)	enzyme binding (GO:0019899)|histone methyltransferase binding (GO:1990226)|identical protein binding (GO:0042802)|protein domain specific binding (GO:0019904)			endometrium(4)|large_intestine(2)|lung(2)|ovary(1)	9						AAGAATTTGTCGTGGAAAAAG	0.333													c|||	1	0.000199681	0.0	0.0	5008	,	,		22801	0.0		0.0	False		,,,				2504	0.001				p.V31V		Atlas-SNP	.											CBX3,NS,carcinoma,0,1	CBX3	25	.	0			c.C93T						.						127.0	131.0	129.0					7																	26246056		2203	4300	6503	SO:0001819	synonymous_variant	11335	exon3			ATTTGTCGTGGAA	U26312	CCDS5398.1	7p15.2	2010-07-06	2010-06-24		ENSG00000122565	ENSG00000122565			1553	protein-coding gene	gene with protein product	"""HP1 gamma homolog (Drosophila)"""	604477	"""chromobox homolog 3 (Drosophila HP1 gamma)"""			8663349	Standard	NM_016587		Approved	HP1Hs-gamma	uc003sxu.3	Q13185	OTTHUMG00000022911	ENST00000337620.4:c.93C>T	chr7.hg19:g.26246056C>T		135.0	0.0		158.0	22.0	NM_016587	Q96CD7|Q99409|Q9BVS3|Q9P0Z6	Silent	SNP	ENST00000337620.4	hg19	CCDS5398.1																																																																																			.	.		0.333	CBX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214117.1	NM_007276	
GNAT3	346562	hgsc.bcm.edu	37	7	80088145	80088145	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A7IE-01A-21D-A382-10	TCGA-CC-A7IE-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c1caf517-5052-48e3-ad80-8458b3d2ff5f	ab81329b-c119-4a5a-863c-5b50f48cee3f	g.chr7:80088145T>C	ENST00000398291.3	-	8	1000	c.907A>G	c.(907-909)Atc>Gtc	p.I303V	CD36_ENST00000435819.1_Intron	NM_001102386.1	NP_001095856.1	A8MTJ3	GNAT3_HUMAN	guanine nucleotide binding protein, alpha transducing 3	303					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|blood coagulation (GO:0007596)|detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|detection of visible light (GO:0009584)|platelet activation (GO:0030168)|response to nicotine (GO:0035094)|sensory perception of sweet taste (GO:0050916)|sensory perception of umami taste (GO:0050917)|synaptic transmission (GO:0007268)	acrosomal vesicle (GO:0001669)|apical plasma membrane (GO:0016324)|axoneme (GO:0005930)|heterotrimeric G-protein complex (GO:0005834)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	G-protein beta/gamma-subunit complex binding (GO:0031683)|G-protein coupled photoreceptor activity (GO:0008020)|G-protein coupled receptor binding (GO:0001664)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)			endometrium(1)|large_intestine(2)|lung(5)|ovary(1)	9						TGGTTCTTGATGTAGTTTCCT	0.308																																					p.I303V		Atlas-SNP	.											.	GNAT3	65	.	0			c.A907G						.						59.0	56.0	57.0					7																	80088145		1811	4081	5892	SO:0001583	missense	346562	exon8			TCTTGATGTAGTT		CCDS47625.1	7q21.11	2007-06-13			ENSG00000214415	ENSG00000214415			22800	protein-coding gene	gene with protein product		139395					Standard	NM_001102386		Approved	gustducin, GDCA	uc011kgu.2	A8MTJ3	OTTHUMG00000155401	ENST00000398291.3:c.907A>G	chr7.hg19:g.80088145T>C	ENSP00000381339:p.Ile303Val	70.0	0.0		64.0	11.0	NM_001102386	A4D1B2|A4D1B3|B9EJG5	Missense_Mutation	SNP	ENST00000398291.3	hg19	CCDS47625.1	.	.	.	.	.	.	.	.	.	.	T	20.3	3.968736	0.74131	.	.	ENSG00000214415	ENST00000398291	D	0.89415	-2.51	5.47	5.47	0.80525	.	0.000000	0.85682	U	0.000000	D	0.95191	0.8441	M	0.88031	2.925	0.80722	D	1	D	0.58268	0.982	D	0.81914	0.995	D	0.95681	0.8732	9	.	.	.	.	15.8518	0.78937	0.0:0.0:0.0:1.0	.	303	A8MTJ3	GNAT3_HUMAN	V	303	ENSP00000381339:I303V	.	I	-	1	0	GNAT3	79926081	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.281000	0.72632	2.216000	0.71823	0.528000	0.53228	ATC	.	.		0.308	GNAT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339909.3	XM_294370	
LAMB4	22798	hgsc.bcm.edu	37	7	107689935	107689935	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A7IE-01A-21D-A382-10	TCGA-CC-A7IE-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c1caf517-5052-48e3-ad80-8458b3d2ff5f	ab81329b-c119-4a5a-863c-5b50f48cee3f	g.chr7:107689935A>G	ENST00000388781.3	-	27	4041	c.3958T>C	c.(3958-3960)Tct>Cct	p.S1320P	LAMB4_ENST00000388780.3_Missense_Mutation_p.S1320P|LAMB4_ENST00000205386.4_Missense_Mutation_p.S1320P	NM_007356.2	NP_031382.2	A4D0S4	LAMB4_HUMAN	laminin, beta 4	1320	Domain II.				cell adhesion (GO:0007155)	basement membrane (GO:0005604)				NS(1)|breast(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(22)|lung(40)|ovary(4)|prostate(5)|skin(4)	97						TTTTCAGCAGATGATGATATG	0.299																																					p.S1320P		Atlas-SNP	.											.	LAMB4	253	.	0			c.T3958C						.						164.0	143.0	150.0					7																	107689935		2202	4299	6501	SO:0001583	missense	22798	exon27			CAGCAGATGATGA	AF028816	CCDS34732.1	7q31	2013-03-01			ENSG00000091128	ENSG00000091128		"""Laminins"""	6491	protein-coding gene	gene with protein product							Standard	NM_007356		Approved		uc010ljo.1	A4D0S4	OTTHUMG00000154874	ENST00000388781.3:c.3958T>C	chr7.hg19:g.107689935A>G	ENSP00000373433:p.Ser1320Pro	79.0	0.0		77.0	19.0	NM_007356	A5PKU6|B2RTT3|B5MEB9|Q86TP7|Q86XN2|Q8NBX5	Missense_Mutation	SNP	ENST00000388781.3	hg19	CCDS34732.1	.	.	.	.	.	.	.	.	.	.	A	12.68	2.011560	0.35511	.	.	ENSG00000091128	ENST00000205386;ENST00000388781;ENST00000422975;ENST00000388780	T;T;T;T	0.32988	1.43;1.43;1.86;1.45	4.97	3.8	0.43715	.	0.364446	0.21981	N	0.066320	T	0.26774	0.0655	N	0.19112	0.55	0.58432	D	0.999992	P;D	0.54047	0.731;0.964	B;P	0.52267	0.395;0.694	T	0.03296	-1.1051	10	0.54805	T	0.06	.	6.8523	0.24022	0.7614:0.1538:0.0848:0.0	.	1320;1320	A4D0S4-3;A4D0S4	.;LAMB4_HUMAN	P	1320;1320;346;1320	ENSP00000205386:S1320P;ENSP00000373433:S1320P;ENSP00000416562:S346P;ENSP00000373432:S1320P	ENSP00000205386:S1320P	S	-	1	0	LAMB4	107477171	0.966000	0.33281	0.831000	0.32960	0.992000	0.81027	2.172000	0.42463	0.890000	0.36211	0.533000	0.62120	TCT	.	.		0.299	LAMB4-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337442.1	XM_209857	
PRSS37	136242	hgsc.bcm.edu	37	7	141537856	141537856	+	Silent	SNP	C	C	T	rs201423018		TCGA-CC-A7IE-01A-21D-A382-10	TCGA-CC-A7IE-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c1caf517-5052-48e3-ad80-8458b3d2ff5f	ab81329b-c119-4a5a-863c-5b50f48cee3f	g.chr7:141537856C>T	ENST00000350549.3	-	3	605	c.234G>A	c.(232-234)caG>caA	p.Q78Q	PRSS37_ENST00000438520.1_Silent_p.Q78Q	NM_001008270.2|NM_001171951.1	NP_001008271.2|NP_001165422.1	A4D1T9	PRS37_HUMAN	protease, serine, 37	78	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				binding of sperm to zona pellucida (GO:0007339)|cell migration (GO:0016477)|protein maturation (GO:0051604)	extracellular region (GO:0005576)|nucleus (GO:0005634)	serine-type endopeptidase activity (GO:0004252)			central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|skin(3)	15						GGTTAATTGTCTGTTCAGTAC	0.483																																					p.Q78Q		Atlas-SNP	.											.	PRSS37	42	.	0			c.G234A						.						248.0	211.0	224.0					7																	141537856		2203	4300	6503	SO:0001819	synonymous_variant	136242	exon3			AATTGTCTGTTCA		CCDS34764.1	7q34	2010-05-07			ENSG00000165076	ENSG00000165076		"""Serine peptidases / Serine peptidases"""	29211	protein-coding gene	gene with protein product							Standard	NM_001008270		Approved		uc003vws.2	A4D1T9	OTTHUMG00000157174	ENST00000350549.3:c.234G>A	chr7.hg19:g.141537856C>T		114.0	0.0		127.0	46.0	NM_001171951	B2RPB5	Silent	SNP	ENST00000350549.3	hg19	CCDS34764.1																																																																																			.	C|1.000;G|0.000		0.483	PRSS37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347763.1	NM_001008270	
KCNS2	3788	hgsc.bcm.edu	37	8	99440321	99440321	+	Silent	SNP	C	C	T			TCGA-CC-A7IE-01A-21D-A382-10	TCGA-CC-A7IE-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c1caf517-5052-48e3-ad80-8458b3d2ff5f	ab81329b-c119-4a5a-863c-5b50f48cee3f	g.chr8:99440321C>T	ENST00000287042.4	+	2	464	c.114C>T	c.(112-114)ttC>ttT	p.F38F	KCNS2_ENST00000521839.1_Silent_p.F38F	NM_020697.2	NP_065748.1	Q9ULS6	KCNS2_HUMAN	potassium voltage-gated channel, delayed-rectifier, subfamily S, member 2	38					protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)			autonomic_ganglia(1)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(11)|ovary(1)|prostate(1)|skin(1)|urinary_tract(2)	31	Breast(36;2.4e-06)		OV - Ovarian serous cystadenocarcinoma(57;0.0448)			TGCTGCGCTTCCCCGAGACGC	0.657																																					p.F38F	Pancreas(138;844 2489 9202 24627)	Atlas-SNP	.											.	KCNS2	93	.	0			c.C114T						.						46.0	42.0	44.0					8																	99440321		2203	4300	6503	SO:0001819	synonymous_variant	3788	exon2			GCGCTTCCCCGAG	AB032970	CCDS6279.1	8q22	2011-07-05			ENSG00000156486	ENSG00000156486		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6301	protein-coding gene	gene with protein product		602906				9305895, 16382104	Standard	NM_020697		Approved	Kv9.2	uc003yin.3	Q9ULS6	OTTHUMG00000044337	ENST00000287042.4:c.114C>T	chr8.hg19:g.99440321C>T		82.0	0.0		154.0	17.0	NM_020697	A8KAN1	Silent	SNP	ENST00000287042.4	hg19	CCDS6279.1																																																																																			.	.		0.657	KCNS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000103134.1	NM_020697	
CSMD3	114788	hgsc.bcm.edu	37	8	113326738	113326738	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-A7IE-01A-21D-A382-10	TCGA-CC-A7IE-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c1caf517-5052-48e3-ad80-8458b3d2ff5f	ab81329b-c119-4a5a-863c-5b50f48cee3f	g.chr8:113326738A>T	ENST00000297405.5	-	48	7713	c.7469T>A	c.(7468-7470)gTg>gAg	p.V2490E	CSMD3_ENST00000352409.3_Missense_Mutation_p.V2420E|CSMD3_ENST00000343508.3_Missense_Mutation_p.V2450E|CSMD3_ENST00000455883.2_Missense_Mutation_p.V2386E	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	2490	CUB 14. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						ACCCTTTTCCACTGAAATGCT	0.388										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																											p.V2490E		Atlas-SNP	.											.	CSMD3	2325	.	0			c.T7469A						.						122.0	116.0	118.0					8																	113326738		2203	4300	6503	SO:0001583	missense	114788	exon48			TTTTCCACTGAAA	AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.7469T>A	chr8.hg19:g.113326738A>T	ENSP00000297405:p.Val2490Glu	169.0	0.0		252.0	47.0	NM_198123	Q96PZ3	Missense_Mutation	SNP	ENST00000297405.5	hg19	CCDS6315.1	.	.	.	.	.	.	.	.	.	.	A	25.8	4.679435	0.88542	.	.	ENSG00000164796	ENST00000343508;ENST00000297405;ENST00000339701;ENST00000455883;ENST00000352409	T;T;T;T;T	0.39406	1.08;1.08;1.08;1.08;1.08	4.98	4.98	0.66077	CUB (5);	0.000000	0.64402	D	0.000008	T	0.76176	0.3951	H	0.97758	4.07	0.58432	D	0.999999	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;0.999;1.0	D	0.84232	0.0467	10	0.51188	T	0.08	.	14.8078	0.69971	1.0:0.0:0.0:0.0	.	2386;2490;2450	Q7Z407-3;Q7Z407;Q7Z407-2	.;CSMD3_HUMAN;.	E	2450;2490;1760;2386;2420	ENSP00000345799:V2450E;ENSP00000297405:V2490E;ENSP00000341558:V1760E;ENSP00000412263:V2386E;ENSP00000343124:V2420E	ENSP00000297405:V2490E	V	-	2	0	CSMD3	113395914	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.135000	0.94478	2.081000	0.62600	0.472000	0.43445	GTG	.	.		0.388	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347141.1	NM_052900	
GPAA1	8733	hgsc.bcm.edu	37	8	145140854	145140854	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A7IE-01A-21D-A382-10	TCGA-CC-A7IE-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c1caf517-5052-48e3-ad80-8458b3d2ff5f	ab81329b-c119-4a5a-863c-5b50f48cee3f	g.chr8:145140854G>T	ENST00000355091.4	+	12	1813	c.1692G>T	c.(1690-1692)tgG>tgT	p.W564C	GPAA1_ENST00000361036.6_Missense_Mutation_p.W504C	NM_003801.3	NP_003792.1	O43292	GPAA1_HUMAN	glycosylphosphatidylinositol anchor attachment 1	564					attachment of GPI anchor to protein (GO:0016255)|C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein complex assembly (GO:0006461)|protein retention in ER lumen (GO:0006621)	endoplasmic reticulum membrane (GO:0005789)|GPI-anchor transamidase complex (GO:0042765)|membrane (GO:0016020)	tubulin binding (GO:0015631)			breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(10)|upper_aerodigestive_tract(2)	19	all_cancers(97;2.87e-11)|all_epithelial(106;2.16e-09)|Lung NSC(106;5.89e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;3.38e-41)|Epithelial(56;6.02e-40)|all cancers(56;2.11e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			TGTTCCTGTGGCGGGAGCTGC	0.672																																					p.W564C		Atlas-SNP	.											.	GPAA1	40	.	0			c.G1692T						.						31.0	35.0	33.0					8																	145140854		1956	4114	6070	SO:0001583	missense	8733	exon12			CCTGTGGCGGGAG	AB006969	CCDS43776.1	8q24.3	2012-12-10	2012-12-10		ENSG00000197858	ENSG00000197858			4446	protein-coding gene	gene with protein product	"""GPI transamidase subunit"""	603048	"""anchor attachment protein 1 (Gaa1p, yeast) homolog"", ""GPAA1P anchor attachment protein 1 homolog (yeast)"", ""glycosylphosphatidylinositol anchor attachment protein 1 homolog (yeast)"""			9828142	Standard	NM_003801		Approved	GAA1, hGAA1	uc003zax.3	O43292	OTTHUMG00000165438	ENST00000355091.4:c.1692G>T	chr8.hg19:g.145140854G>T	ENSP00000347206:p.Trp564Cys	19.0	0.0		44.0	11.0	NM_003801	Q9NSS0|Q9UQ31	Missense_Mutation	SNP	ENST00000355091.4	hg19	CCDS43776.1	.	.	.	.	.	.	.	.	.	.	G	15.14	2.745914	0.49151	.	.	ENSG00000197858	ENST00000355091;ENST00000361036	.	.	.	5.53	5.53	0.82687	.	0.195419	0.46758	D	0.000261	T	0.65322	0.2680	L	0.55990	1.75	0.58432	D	0.999991	D	0.62365	0.991	P	0.57204	0.815	T	0.64390	-0.6419	9	0.42905	T	0.14	-14.3805	12.6505	0.56757	0.0:0.1663:0.8337:0.0	.	564	O43292	GPAA1_HUMAN	C	564;504	.	ENSP00000347206:W564C	W	+	3	0	GPAA1	145212842	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	2.246000	0.43142	2.602000	0.87976	0.655000	0.94253	TGG	.	.		0.672	GPAA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384070.1	NM_003801	
MFSD3	113655	hgsc.bcm.edu	37	8	145737119	145737119	+	IGR	SNP	C	C	T			TCGA-CC-A7IE-01A-21D-A382-10	TCGA-CC-A7IE-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c1caf517-5052-48e3-ad80-8458b3d2ff5f	ab81329b-c119-4a5a-863c-5b50f48cee3f	g.chr8:145737119C>T	ENST00000301327.4	+	0	1548				RECQL4_ENST00000428558.2_Silent_p.L1149L|RECQL4_ENST00000532237.1_5'UTR|CTD-2517M22.17_ENST00000580385.1_RNA	NM_138431.1	NP_612440.1	Q96ES6	MFSD3_HUMAN	major facilitator superfamily domain containing 3						transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)				central_nervous_system(2)|endometrium(1)|kidney(1)|lung(4)	8	all_cancers(97;5.56e-11)|all_epithelial(106;3.54e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.48e-41)|Epithelial(56;1.85e-40)|all cancers(56;3.59e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0483)|Colorectal(110;0.055)			CCTCTGGCCTCAGGGACAGGA	0.672																																					p.L1149L		Atlas-SNP	.											.	RECQL4	75	.	0			c.G3447A						.						66.0	79.0	75.0					8																	145737119		2162	4256	6418	SO:0001628	intergenic_variant	9401	exon21			TGGCCTCAGGGAC		CCDS6431.1	8q24.3	2005-11-17			ENSG00000167700	ENSG00000167700			25157	protein-coding gene	gene with protein product							Standard	NM_138431		Approved		uc003zdi.1	Q96ES6	OTTHUMG00000165177		chr8.hg19:g.145737119C>T		71.0	0.0		118.0	7.0	NM_004260		Silent	SNP	ENST00000301327.4	hg19	CCDS6431.1																																																																																			.	.		0.672	MFSD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382478.2	NM_138431	
ZNF7	7553	hgsc.bcm.edu	37	8	146067302	146067302	+	Silent	SNP	A	A	G			TCGA-CC-A7IE-01A-21D-A382-10	TCGA-CC-A7IE-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c1caf517-5052-48e3-ad80-8458b3d2ff5f	ab81329b-c119-4a5a-863c-5b50f48cee3f	g.chr8:146067302A>G	ENST00000528372.1	+	5	1050	c.810A>G	c.(808-810)agA>agG	p.R270R	ZNF7_ENST00000325241.6_Silent_p.R270R|ZNF7_ENST00000544249.1_Silent_p.R174R|ZNF7_ENST00000529819.1_3'UTR|ZNF7_ENST00000446747.2_Silent_p.R281R|ZNF7_ENST00000325217.5_Intron|ZNF7_ENST00000525266.1_Intron			P17097	ZNF7_HUMAN	zinc finger protein 7	270					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|kidney(1)|large_intestine(7)|lung(6)|ovary(5)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25	all_cancers(97;1.03e-11)|all_epithelial(106;6.69e-11)|Lung NSC(106;4.08e-05)|all_lung(105;0.000125)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)	Breast(495;0.0812)|Ovarian(118;0.0822)|Acute lymphoblastic leukemia(644;0.143)	Epithelial(56;8.75e-39)|OV - Ovarian serous cystadenocarcinoma(54;1.13e-38)|all cancers(56;8.48e-34)|BRCA - Breast invasive adenocarcinoma(115;0.0355)|Colorectal(110;0.055)	GBM - Glioblastoma multiforme(99;2.11e-07)		AGCATCAGAGAATCCACACGG	0.478																																					p.R270R		Atlas-SNP	.											.	ZNF7	62	.	0			c.A810G						.						78.0	81.0	80.0					8																	146067302		2203	4300	6503	SO:0001819	synonymous_variant	7553	exon5			TCAGAGAATCCAC	AB209619	CCDS6435.1, CCDS64996.1, CCDS64998.1, CCDS64999.1	8q24	2013-01-08	2006-05-09		ENSG00000147789	ENSG00000147789		"""Zinc fingers, C2H2-type"", ""-"""	13139	protein-coding gene	gene with protein product		194531	"""zinc finger protein 7 (KOX 4, clone HF.16)"""			2106481, 1946370	Standard	NM_003416		Approved	KOX4, HF.16	uc003zeg.4	P17097	OTTHUMG00000165200	ENST00000528372.1:c.810A>G	chr8.hg19:g.146067302A>G		63.0	0.0		140.0	60.0	NM_003416	B4DT08|D3DWN6|P17015|Q8N8Y4	Silent	SNP	ENST00000528372.1	hg19	CCDS6435.1																																																																																			.	.		0.478	ZNF7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382660.1	NM_003416	
NTRK2	4915	hgsc.bcm.edu	37	9	87342704	87342704	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A7IE-01A-21D-A382-10	TCGA-CC-A7IE-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c1caf517-5052-48e3-ad80-8458b3d2ff5f	ab81329b-c119-4a5a-863c-5b50f48cee3f	g.chr9:87342704T>C	ENST00000323115.4	+	8	1342	c.989T>C	c.(988-990)aTc>aCc	p.I330T	NTRK2_ENST00000304053.6_Missense_Mutation_p.I330T|NTRK2_ENST00000376213.1_Missense_Mutation_p.I330T|NTRK2_ENST00000359847.3_Missense_Mutation_p.I330T|NTRK2_ENST00000277120.3_Missense_Mutation_p.I330T|NTRK2_ENST00000376214.1_Missense_Mutation_p.I330T|NTRK2_ENST00000376208.1_Missense_Mutation_p.I330T|NTRK2_ENST00000395882.1_Missense_Mutation_p.I330T|NTRK2_ENST00000395866.2_Missense_Mutation_p.I174T			Q16620	NTRK2_HUMAN	neurotrophic tyrosine kinase, receptor, type 2	330	Ig-like C2-type 2.				activation of adenylate cyclase activity (GO:0007190)|aging (GO:0007568)|brain-derived neurotrophic factor receptor signaling pathway (GO:0031547)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|central nervous system neuron development (GO:0021954)|cerebral cortex development (GO:0021987)|circadian rhythm (GO:0007623)|feeding behavior (GO:0007631)|glutamate secretion (GO:0014047)|learning (GO:0007612)|long-term memory (GO:0007616)|long-term synaptic potentiation (GO:0060291)|mechanoreceptor differentiation (GO:0042490)|negative regulation of anoikis (GO:2000811)|negative regulation of neuron apoptotic process (GO:0043524)|neuromuscular junction development (GO:0007528)|neuron differentiation (GO:0030182)|neuron migration (GO:0001764)|neurotrophin TRK receptor signaling pathway (GO:0048011)|oligodendrocyte differentiation (GO:0048709)|peripheral nervous system neuron development (GO:0048935)|positive regulation of axonogenesis (GO:0050772)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of neuron projection development (GO:0010976)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|protein autophosphorylation (GO:0046777)|regulation of dendrite development (GO:0050773)|regulation of neurotransmitter secretion (GO:0046928)|regulation of protein kinase B signaling (GO:0051896)|regulation of Rac GTPase activity (GO:0032314)|response to auditory stimulus (GO:0010996)|retinal rod cell development (GO:0046548)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vasculogenesis (GO:0001570)	cell surface (GO:0009986)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|endosome (GO:0005768)|excitatory synapse (GO:0060076)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|neuronal postsynaptic density (GO:0097481)|postsynaptic membrane (GO:0045211)|presynaptic active zone (GO:0048786)|receptor complex (GO:0043235)|terminal bouton (GO:0043195)	ATP binding (GO:0005524)|brain-derived neurotrophic factor binding (GO:0048403)|brain-derived neurotrophic factor-activated receptor activity (GO:0060175)|neurotrophin binding (GO:0043121)|protein homodimerization activity (GO:0042803)			breast(2)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|liver(1)|lung(23)|ovary(1)|pancreas(1)|prostate(1)|skin(2)	46					Amitriptyline(DB00321)	TCCAAATACATCTGTACTAAA	0.468										TSP Lung(25;0.17)																											p.I330T		Atlas-SNP	.											.	NTRK2	331	.	0			c.T989C						.						118.0	115.0	116.0					9																	87342704		2203	4300	6503	SO:0001583	missense	4915	exon9			AATACATCTGTAC	AF410902	CCDS6671.1, CCDS35050.1, CCDS35051.1, CCDS35052.1, CCDS35053.1	9q22.1	2013-01-11			ENSG00000148053	ENSG00000148053	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"""	8032	protein-coding gene	gene with protein product		600456				7789988	Standard	NM_001018065		Approved	TRKB	uc004anz.1	Q16620	OTTHUMG00000020120	ENST00000323115.4:c.989T>C	chr9.hg19:g.87342704T>C	ENSP00000314586:p.Ile330Thr	132.0	0.0		140.0	45.0	NM_001018065	B1ANZ4|B4DFV9|Q16675|Q59GJ1|Q8WXJ5|Q8WXJ6|Q8WXJ7	Missense_Mutation	SNP	ENST00000323115.4	hg19	CCDS35050.1	.	.	.	.	.	.	.	.	.	.	T	19.60	3.858801	0.71834	.	.	ENSG00000148053	ENST00000376214;ENST00000376213;ENST00000395882;ENST00000376208;ENST00000304053;ENST00000277120;ENST00000323115;ENST00000359847;ENST00000395866	T;T;T;T;T;T;T;T;T	0.55760	0.5;0.5;0.5;0.5;0.5;0.5;0.5;0.5;0.5	5.91	5.91	0.95273	Immunoglobulin I-set (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.73598	0.3607	M	0.78801	2.425	0.54753	D	0.999988	D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;0.999;0.998;1.0;1.0	D;D;D;D;D;D;D;D	0.97110	1.0;0.996;0.996;0.999;0.969;0.948;1.0;0.998	T	0.75405	-0.3329	10	0.51188	T	0.08	.	16.3333	0.83050	0.0:0.0:0.0:1.0	.	174;330;330;330;330;330;376;330	B4DFV9;Q16620-3;Q16620-5;Q5VWE5;Q16620;Q16620-4;Q59GJ1;Q16620-2	.;.;.;.;NTRK2_HUMAN;.;.;.	T	330;330;330;330;330;330;330;330;174	ENSP00000365387:I330T;ENSP00000365386:I330T;ENSP00000379221:I330T;ENSP00000365381:I330T;ENSP00000306167:I330T;ENSP00000277120:I330T;ENSP00000314586:I330T;ENSP00000352906:I330T;ENSP00000379207:I174T	ENSP00000277120:I330T	I	+	2	0	NTRK2	86532524	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.961000	0.70356	2.258000	0.74832	0.477000	0.44152	ATC	.	.		0.468	NTRK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052882.1		
PDCL	5082	hgsc.bcm.edu	37	9	125585315	125585315	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A7IE-01A-21D-A382-10	TCGA-CC-A7IE-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c1caf517-5052-48e3-ad80-8458b3d2ff5f	ab81329b-c119-4a5a-863c-5b50f48cee3f	g.chr9:125585315G>T	ENST00000259467.4	-	3	499	c.334C>A	c.(334-336)Cag>Aag	p.Q112K		NM_005388.4	NP_005379.3	Q13371	PHLP_HUMAN	phosducin-like	112					heterotrimeric G-protein complex assembly (GO:1902605)|intracellular signal transduction (GO:0035556)|negative regulation of protein refolding (GO:0061084)|protein folding (GO:0006457)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|signal transduction (GO:0007165)|visual perception (GO:0007601)	cytoplasm (GO:0005737)	receptor signaling protein activity (GO:0005057)	p.Q112*(2)		endometrium(1)|large_intestine(2)|lung(5)|skin(1)|stomach(1)	10						ATCTTCTCCTGGAGGTCTTTC	0.507																																					p.Q112K		Atlas-SNP	.											PDCL,NS,carcinoma,0,1	PDCL	24	.	2	Substitution - Nonsense(2)	lung(2)	c.C334A						.						255.0	212.0	227.0					9																	125585315		2203	4300	6503	SO:0001583	missense	5082	exon3			TCTCCTGGAGGTC	AF083325	CCDS6845.1	9q12-q13	2008-07-21			ENSG00000136940	ENSG00000136940			8770	protein-coding gene	gene with protein product		604421				10095058	Standard	NM_005388		Approved	PhLP, DKFZp564M1863	uc004bmz.2	Q13371	OTTHUMG00000020624	ENST00000259467.4:c.334C>A	chr9.hg19:g.125585315G>T	ENSP00000259467:p.Gln112Lys	91.0	0.0		74.0	4.0	NM_005388	Q4VXB6|Q96AF1|Q9UEW7|Q9UFL0|Q9UNX1|Q9UNX2	Missense_Mutation	SNP	ENST00000259467.4	hg19	CCDS6845.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	18.39|18.39	3.613184|3.613184	0.66672|0.66672	.|.	.|.	ENSG00000136940|ENSG00000136940	ENST00000436632;ENST00000394285|ENST00000259467	.|T	.|0.39056	.|1.1	5.98|5.98	5.07|5.07	0.68467|0.68467	.|Thioredoxin-like fold (1);Phosducin, thioredoxin-like domain (1);Phosducin, domain 2 (1);	.|0.153488	.|0.64402	.|D	.|0.000013	T|T	0.32224|0.32224	0.0822|0.0822	L|L	0.29908|0.29908	0.895|0.895	0.48341|0.48341	D|D	0.99963|0.99963	.|B;B	.|0.14012	.|0.009;0.009	.|B;B	.|0.17098	.|0.017;0.017	T|T	0.07102|0.07102	-1.0790|-1.0790	5|10	.|0.21014	.|T	.|0.42	-19.7386|-19.7386	14.6783|14.6783	0.68998|0.68998	0.0:0.2755:0.7245:0.0|0.0:0.2755:0.7245:0.0	.|.	.|112;112	.|Q4VXB6;Q13371	.|.;PHLP_HUMAN	Q|K	78;100|112	.|ENSP00000259467:Q112K	.|ENSP00000259467:Q112K	P|Q	-|-	2|1	0|0	PDCL|PDCL	124625136|124625136	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.979000|0.979000	0.70002|0.70002	3.644000|3.644000	0.54381|0.54381	1.497000|1.497000	0.48584|0.48584	0.563000|0.563000	0.77884|0.77884	CCA|CAG	.	.		0.507	PDCL-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053956.1	NM_005388	
KCNT1	57582	hgsc.bcm.edu	37	9	138647016	138647016	+	Splice_Site	SNP	G	G	T			TCGA-CC-A7IE-01A-21D-A382-10	TCGA-CC-A7IE-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c1caf517-5052-48e3-ad80-8458b3d2ff5f	ab81329b-c119-4a5a-863c-5b50f48cee3f	g.chr9:138647016G>T	ENST00000263604.3	+	6	483		c.e6+1		KCNT1_ENST00000486577.2_Splice_Site|KCNT1_ENST00000371757.2_Splice_Site|KCNT1_ENST00000490355.2_Splice_Site|KCNT1_ENST00000491806.2_Splice_Site|KCNT1_ENST00000487664.1_Splice_Site|KCNT1_ENST00000298480.5_Splice_Site|KCNT1_ENST00000488444.2_Splice_Site			Q5JUK3	KCNT1_HUMAN	potassium channel, subfamily T, member 1						potassium ion transmembrane transport (GO:0071805)	voltage-gated potassium channel complex (GO:0008076)	calcium-activated potassium channel activity (GO:0015269)|voltage-gated potassium channel activity (GO:0005249)			breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(18)|ovary(1)|pancreas(3)|prostate(5)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	50		Myeloproliferative disorder(178;0.0821)		OV - Ovarian serous cystadenocarcinoma(145;2.11e-07)|Epithelial(140;1.57e-06)|all cancers(34;9.22e-05)		GGCGATCCAGGTGAGTGCCCT	0.592																																					.		Atlas-SNP	.											.	KCNT1	139	.	0			c.540+1G>T						.						102.0	80.0	88.0					9																	138647016		2203	4300	6503	SO:0001630	splice_region_variant	57582	exon6			ATCCAGGTGAGTG	AB037843	CCDS35175.1, CCDS35175.2, CCDS65188.1	9q34.3	2012-07-05			ENSG00000107147	ENSG00000107147		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	18865	protein-coding gene	gene with protein product		608167				10718198, 16382103	Standard	NM_020822		Approved	KCa4.1, KIAA1422	uc011mdq.2	Q5JUK3	OTTHUMG00000020917	ENST00000263604.3:c.483+1G>T	chr9.hg19:g.138647016G>T		43.0	0.0		57.0	25.0	NM_020822	B3KXF7|B7ZVY4|B9EGP2|G5E9V0|Q9P2C5	Splice_Site	SNP	ENST00000263604.3	hg19		.	.	.	.	.	.	.	.	.	.	G	9.364	1.068823	0.20147	.	.	ENSG00000107147	ENST00000487664;ENST00000298480;ENST00000371757;ENST00000473941;ENST00000486577;ENST00000491806;ENST00000488444;ENST00000490355;ENST00000263604	.	.	.	3.11	3.11	0.35812	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.1028	0.59231	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	KCNT1	137786837	1.000000	0.71417	0.994000	0.49952	0.079000	0.17450	8.526000	0.90588	1.456000	0.47831	0.313000	0.20887	.	.	.		0.592	KCNT1-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_020822	Intron
TAF3	83860	hgsc.bcm.edu	37	10	8051256	8051256	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A7IE-01A-21D-A382-10	TCGA-CC-A7IE-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c1caf517-5052-48e3-ad80-8458b3d2ff5f	ab81329b-c119-4a5a-863c-5b50f48cee3f	g.chr10:8051256T>A	ENST00000344293.5	+	5	2737	c.2531T>A	c.(2530-2532)gTg>gAg	p.V844E		NM_031923.3	NP_114129.1	Q5VWG9	TAF3_HUMAN	TAF3 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 140kDa	844					maintenance of protein location in nucleus (GO:0051457)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor TFIID complex (GO:0005669)	zinc ion binding (GO:0008270)			NS(2)|breast(4)|endometrium(2)|kidney(1)|large_intestine(6)|lung(16)|ovary(3)|prostate(4)|skin(2)	40						AAAGCCCCCGTGCGCAGCGTG	0.721																																					p.V844E		Atlas-SNP	.											.	TAF3	93	.	0			c.T2531A						.						11.0	11.0	11.0					10																	8051256		1724	3622	5346	SO:0001583	missense	83860	exon5			CCCCCGTGCGCAG	AJ292190	CCDS41487.1	10p15.1	2013-01-28	2002-08-29		ENSG00000165632	ENSG00000165632		"""Zinc fingers, PHD-type"""	17303	protein-coding gene	gene with protein product		606576	"""TAF3 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 140 kD"""			11438666, 18549481	Standard	NM_031923		Approved	TAF140, TAFII140	uc010qbd.3	Q5VWG9	OTTHUMG00000017643	ENST00000344293.5:c.2531T>A	chr10.hg19:g.8051256T>A	ENSP00000340271:p.Val844Glu	78.0	0.0		85.0	14.0	NM_031923	Q05DA0|Q6GMS5|Q6P6B5|Q86VY6|Q9BQS9|Q9UFI8	Missense_Mutation	SNP	ENST00000344293.5	hg19	CCDS41487.1	.	.	.	.	.	.	.	.	.	.	T	15.79	2.937558	0.52972	.	.	ENSG00000165632	ENST00000344293	D	0.84873	-1.91	6.07	6.07	0.98685	Zinc finger, FYVE/PHD-type (1);	0.000000	0.56097	D	0.000027	D	0.87597	0.6217	M	0.73962	2.25	0.58432	D	0.999999	D	0.57257	0.979	P	0.51487	0.671	D	0.85276	0.1059	10	0.07813	T	0.8	-21.776	16.6407	0.85098	0.0:0.0:0.0:1.0	.	844	Q5VWG9	TAF3_HUMAN	E	844	ENSP00000340271:V844E	ENSP00000340271:V844E	V	+	2	0	TAF3	8091262	1.000000	0.71417	0.066000	0.19879	0.042000	0.13812	5.716000	0.68437	2.326000	0.78906	0.533000	0.62120	GTG	.	.		0.721	TAF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046725.1	NM_031923	
C1QL3	389941	hgsc.bcm.edu	37	10	16562897	16562897	+	Silent	SNP	G	G	A			TCGA-CC-A7IE-01A-21D-A382-10	TCGA-CC-A7IE-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c1caf517-5052-48e3-ad80-8458b3d2ff5f	ab81329b-c119-4a5a-863c-5b50f48cee3f	g.chr10:16562897G>A	ENST00000298943.3	-	1	1107	c.168C>T	c.(166-168)ccC>ccT	p.P56P		NM_001010908.1	NP_001010908.1	Q5VWW1	C1QL3_HUMAN	complement component 1, q subcomponent-like 3	56					regulation of synapse organization (GO:0050807)	collagen trimer (GO:0005581)|extracellular region (GO:0005576)				breast(1)|endometrium(3)|kidney(1)|lung(4)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	13						GGATGAAGGTGGGCAGGGACT	0.771																																					p.P56P		Atlas-SNP	.											.	C1QL3	27	.	0			c.C168T						.						4.0	8.0	7.0					10																	16562897		1843	3924	5767	SO:0001819	synonymous_variant	389941	exon1			GAAGGTGGGCAGG		CCDS31156.1	10p13	2012-03-26			ENSG00000165985	ENSG00000165985			19359	protein-coding gene	gene with protein product		615227				21378161	Standard	NM_001010908		Approved	K100, C1ql, C1QTNF13, CTRP13	uc001ioj.1	Q5VWW1	OTTHUMG00000017738	ENST00000298943.3:c.168C>T	chr10.hg19:g.16562897G>A		28.0	0.0		36.0	7.0	NM_001010908	A0PJY4|A0PJY5	Silent	SNP	ENST00000298943.3	hg19	CCDS31156.1																																																																																			.	.		0.771	C1QL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047003.1	XM_372305	
GDF2	2658	hgsc.bcm.edu	37	10	48416588	48416588	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A7IE-01A-21D-A382-10	TCGA-CC-A7IE-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c1caf517-5052-48e3-ad80-8458b3d2ff5f	ab81329b-c119-4a5a-863c-5b50f48cee3f	g.chr10:48416588T>C	ENST00000249598.1	-	1	265	c.106A>G	c.(106-108)Aac>Gac	p.N36D		NM_016204.1	NP_057288.1	Q9UK05	GDF2_HUMAN	growth differentiation factor 2	36					activin receptor signaling pathway (GO:0032924)|angiogenesis (GO:0001525)|blood vessel morphogenesis (GO:0048514)|BMP signaling pathway (GO:0030509)|cartilage development (GO:0051216)|cellular iron ion homeostasis (GO:0006879)|cellular response to BMP stimulus (GO:0071773)|growth (GO:0040007)|negative regulation of angiogenesis (GO:0016525)|negative regulation of blood vessel endothelial cell migration (GO:0043537)|negative regulation of cell growth (GO:0030308)|negative regulation of DNA biosynthetic process (GO:2000279)|negative regulation of DNA replication (GO:0008156)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of endothelial cell proliferation (GO:0001937)|ossification (GO:0001503)|osteoblast differentiation (GO:0001649)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|patterning of blood vessels (GO:0001569)|positive regulation of angiogenesis (GO:0045766)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|vasculogenesis (GO:0001570)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)				breast(1)|endometrium(2)|large_intestine(3)|lung(14)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	28						CTGTGGGCGTTTCCCCCAGCA	0.647																																					p.N36D		Atlas-SNP	.											.	GDF2	77	.	0			c.A106G						.						29.0	29.0	29.0					10																	48416588		2202	4300	6502	SO:0001583	missense	2658	exon1			GGGCGTTTCCCCC	AF156891	CCDS73118.1	10q11.22	2014-05-06			ENSG00000128802	ENSG00000263761		"""Endogenous ligands"""	4217	protein-coding gene	gene with protein product		605120				10849432	Standard	NM_016204		Approved	BMP-9, BMP9	uc001jfa.1	Q9UK05	OTTHUMG00000188320	ENST00000249598.1:c.106A>G	chr10.hg19:g.48416588T>C	ENSP00000249598:p.Asn36Asp	76.0	0.0		79.0	21.0	NM_016204	Q5VSQ9|Q9Y571	Missense_Mutation	SNP	ENST00000249598.1	hg19	CCDS7219.1	.	.	.	.	.	.	.	.	.	.	T	0.422	-0.907819	0.02434	.	.	ENSG00000128802	ENST00000249598	T	0.76060	-0.99	5.19	1.67	0.24075	.	0.750927	0.13464	N	0.385950	T	0.41351	0.1155	N	0.03608	-0.345	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.32107	-0.9919	10	0.05833	T	0.94	.	3.5212	0.07743	0.1759:0.3694:0.0:0.4547	.	36	Q9UK05	GDF2_HUMAN	D	36	ENSP00000249598:N36D	ENSP00000249598:N36D	N	-	1	0	GDF2	48036594	0.002000	0.14202	0.000000	0.03702	0.000000	0.00434	1.322000	0.33689	0.114000	0.18032	-0.290000	0.09829	AAC	.	.		0.647	GDF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047891.1	NM_016204	
SUPV3L1	6832	hgsc.bcm.edu	37	10	70967559	70967559	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A7IE-01A-21D-A382-10	TCGA-CC-A7IE-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c1caf517-5052-48e3-ad80-8458b3d2ff5f	ab81329b-c119-4a5a-863c-5b50f48cee3f	g.chr10:70967559A>G	ENST00000359655.4	+	14	1847	c.1787A>G	c.(1786-1788)cAg>cGg	p.Q596R		NM_003171.3	NP_003162.2	Q8IYB8	SUV3_HUMAN	suppressor of var1, 3-like 1 (S. cerevisiae)	596					ATP catabolic process (GO:0006200)|chromatin maintenance (GO:0070827)|DNA duplex unwinding (GO:0032508)|DNA recombination (GO:0006310)|mitochondrial mRNA catabolic process (GO:0000958)|mitochondrial mRNA surveillance (GO:0035946)|mitochondrial ncRNA surveillance (GO:0035945)|mitochondrial RNA 3'-end processing (GO:0000965)|mitochondrial RNA surveillance (GO:2000827)|mitochondrion morphogenesis (GO:0070584)|negative regulation of apoptotic process (GO:0043066)|positive regulation of cell growth (GO:0030307)|positive regulation of mitochondrial RNA catabolic process (GO:0000962)|RNA catabolic process (GO:0006401)	mitochondrial degradosome (GO:0045025)|mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	3'-5' RNA helicase activity (GO:0034458)|ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|double-stranded RNA binding (GO:0003725)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)|RNA binding (GO:0003723)			NS(1)|breast(2)|endometrium(5)|kidney(5)|large_intestine(3)|lung(6)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	30						TTTGCCAGGCAGTATAGCAGG	0.393																																					p.Q596R		Atlas-SNP	.											.	SUPV3L1	61	.	0			c.A1787G						.						110.0	95.0	100.0					10																	70967559		2203	4300	6503	SO:0001583	missense	6832	exon14			CCAGGCAGTATAG	AF042169	CCDS7287.1	10q22.1	2008-08-01	2001-11-28		ENSG00000156502	ENSG00000156502			11471	protein-coding gene	gene with protein product		605122	"""suppressor of var1 (S.cerevisiae) 3-like 1"""			9925937, 16176273	Standard	XM_005270068		Approved	SUV3	uc001jpe.1	Q8IYB8	OTTHUMG00000018375	ENST00000359655.4:c.1787A>G	chr10.hg19:g.70967559A>G	ENSP00000352678:p.Gln596Arg	123.0	0.0		150.0	21.0	NM_003171	A8K301|O43630	Missense_Mutation	SNP	ENST00000359655.4	hg19	CCDS7287.1	.	.	.	.	.	.	.	.	.	.	A	13.96	2.392124	0.42410	.	.	ENSG00000156502	ENST00000359655	T	0.39056	1.1	5.58	5.58	0.84498	.	0.000000	0.85682	D	0.000000	T	0.34803	0.0910	L	0.41573	1.285	0.80722	D	1	B	0.24721	0.11	B	0.22880	0.042	T	0.11842	-1.0571	10	0.17832	T	0.49	-4.1582	15.4121	0.74933	1.0:0.0:0.0:0.0	.	596	Q8IYB8	SUV3_HUMAN	R	596	ENSP00000352678:Q596R	ENSP00000352678:Q596R	Q	+	2	0	SUPV3L1	70637565	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	6.976000	0.76135	2.113000	0.64589	0.528000	0.53228	CAG	.	.		0.393	SUPV3L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048396.2	NM_003171	
TYSND1	219743	hgsc.bcm.edu	37	10	71902607	71902607	+	Missense_Mutation	SNP	C	C	T	rs143461435		TCGA-CC-A7IE-01A-21D-A382-10	TCGA-CC-A7IE-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c1caf517-5052-48e3-ad80-8458b3d2ff5f	ab81329b-c119-4a5a-863c-5b50f48cee3f	g.chr10:71902607C>T	ENST00000287078.6	-	3	1299	c.1300G>A	c.(1300-1302)Gag>Aag	p.E434K	TYSND1_ENST00000335494.5_Intron|TYSND1_ENST00000494143.1_5'UTR	NM_173555.2	NP_775826.2	Q2T9J0	TYSD1_HUMAN	trypsin domain containing 1	434	Serine protease.				protein homooligomerization (GO:0051260)|protein processing (GO:0016485)|proteolysis (GO:0006508)|regulation of fatty acid beta-oxidation (GO:0031998)	membrane (GO:0016020)|peroxisome (GO:0005777)	identical protein binding (GO:0042802)|protease binding (GO:0002020)|serine-type endopeptidase activity (GO:0004252)			endometrium(2)|large_intestine(2)|liver(1)|lung(3)|prostate(1)	9						CTCACAGCCTCGCCTGCCAGG	0.597																																					p.E434K		Atlas-SNP	.											.	TYSND1	20	.	0			c.G1300A						.	C	,LYS/GLU	0,4406		0,0,2203	53.0	39.0	44.0		,1300	3.4	0.6	10	dbSNP_134	44	1,8599	1.2+/-3.3	0,1,4299	no	intron,missense	TYSND1	NM_001040273.1,NM_173555.2	,56	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	,benign	,434/567	71902607	1,13005	2203	4300	6503	SO:0001583	missense	219743	exon3			CAGCCTCGCCTGC	BC016840	CCDS31213.1, CCDS31214.1	10q22.1	2009-11-06		2006-09-21	ENSG00000156521	ENSG00000156521			28531	protein-coding gene	gene with protein product		611017				17255948	Standard	NM_173555		Approved	MGC34695, NET41	uc001jqr.4	Q2T9J0	OTTHUMG00000018397	ENST00000287078.6:c.1300G>A	chr10.hg19:g.71902607C>T	ENSP00000287078:p.Glu434Lys	71.0	0.0		54.0	7.0	NM_173555	Q5SQT4|Q5SQU1|Q8N6H2|Q96AR5	Missense_Mutation	SNP	ENST00000287078.6	hg19	CCDS31213.1	.	.	.	.	.	.	.	.	.	.	C	14.96	2.692646	0.48202	0.0	1.16E-4	ENSG00000156521	ENST00000287078	D	0.89552	-2.53	5.2	3.36	0.38483	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (2);	0.285900	0.33217	N	0.005145	D	0.86764	0.6011	M	0.85777	2.775	0.80722	D	1	P	0.35844	0.524	B	0.28991	0.097	D	0.84257	0.0481	10	0.59425	D	0.04	-12.7479	6.8769	0.24151	0.0:0.7261:0.0:0.2739	.	434	Q2T9J0	TYSD1_HUMAN	K	434	ENSP00000287078:E434K	ENSP00000287078:E434K	E	-	1	0	TYSND1	71572613	0.996000	0.38824	0.582000	0.28627	0.831000	0.47069	3.706000	0.54830	0.784000	0.33661	0.585000	0.79938	GAG	.	C|1.000;T|0.000		0.597	TYSND1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048483.1	NM_173555	
ADAMTS14	140766	hgsc.bcm.edu	37	10	72518013	72518013	+	Silent	SNP	C	C	G			TCGA-CC-A7IE-01A-21D-A382-10	TCGA-CC-A7IE-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c1caf517-5052-48e3-ad80-8458b3d2ff5f	ab81329b-c119-4a5a-863c-5b50f48cee3f	g.chr10:72518013C>G	ENST00000373207.1	+	21	3150	c.3150C>G	c.(3148-3150)ccC>ccG	p.P1050P	ADAMTS14_ENST00000373208.1_Silent_p.P1053P	NM_080722.3	NP_542453.2	Q8WXS8	ATS14_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 14	1050					collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(11)|lung(15)|ovary(7)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	50						AATCTGAACCCCTACATCCCA	0.552																																					p.P1053P		Atlas-SNP	.											.	ADAMTS14	148	.	0			c.C3159G						.						116.0	102.0	107.0					10																	72518013		2203	4300	6503	SO:0001819	synonymous_variant	140766	exon21			TGAACCCCTACAT	AF358666	CCDS7306.1, CCDS7307.1	10q21	2008-08-01	2005-08-19		ENSG00000138316	ENSG00000138316		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	14899	protein-coding gene	gene with protein product		607506	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 14"""			11779638	Standard	NM_139155		Approved		uc001jrg.3	Q8WXS8	OTTHUMG00000018414	ENST00000373207.1:c.3150C>G	chr10.hg19:g.72518013C>G		91.0	0.0		92.0	17.0	NM_139155	Q5T4G0|Q5T4G1|Q8TE55|Q8TEY8	Silent	SNP	ENST00000373207.1	hg19	CCDS7306.1																																																																																			.	.		0.552	ADAMTS14-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000048522.1	NM_080722	
DYDC1	143241	hgsc.bcm.edu	37	10	82098285	82098285	+	Missense_Mutation	SNP	C	C	T	rs140462481	byFrequency	TCGA-CC-A7IE-01A-21D-A382-10	TCGA-CC-A7IE-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c1caf517-5052-48e3-ad80-8458b3d2ff5f	ab81329b-c119-4a5a-863c-5b50f48cee3f	g.chr10:82098285C>T	ENST00000372204.3	-	7	606	c.442G>A	c.(442-444)Gat>Aat	p.D148N	DYDC1_ENST00000421924.2_Missense_Mutation_p.D148N|DYDC1_ENST00000372202.1_Missense_Mutation_p.D148N	NM_138812.3	NP_620167.1	Q8WWB3	DYDC1_HUMAN	DPY30 domain containing 1	148										kidney(1)|large_intestine(3)|skin(1)	5			Colorectal(32;0.229)			CCATAACGATCGCTGATTTCA	0.333																																					p.D148N		Atlas-SNP	.											.	DYDC1	15	.	0			c.G442A						.						198.0	180.0	186.0					10																	82098285		2203	4300	6503	SO:0001583	missense	143241	exon6			AACGATCGCTGAT	BC019250	CCDS7366.1	10q22.3	2006-02-01			ENSG00000170788	ENSG00000170788			23460	protein-coding gene	gene with protein product		615154					Standard	NM_138812		Approved	bA36D19.5, DPY30D1	uc031pwj.1	Q8WWB3	OTTHUMG00000018609	ENST00000372204.3:c.442G>A	chr10.hg19:g.82098285C>T	ENSP00000361278:p.Asp148Asn	105.0	0.0		120.0	36.0	NM_001269053	A8K927|Q5QP03|Q5QP04|Q6WNP4|Q6ZU87	Missense_Mutation	SNP	ENST00000372204.3	hg19	CCDS7366.1	.	.	.	.	.	.	.	.	.	.	C	14.83	2.651479	0.47362	.	.	ENSG00000170788	ENST00000372204;ENST00000372202;ENST00000421924;ENST00000454362	.	.	.	4.94	4.94	0.65067	.	0.000000	0.85682	D	0.000000	T	0.53932	0.1827	M	0.68952	2.095	0.33019	D	0.528534	B;B	0.27951	0.195;0.087	B;B	0.20577	0.03;0.019	T	0.63673	-0.6584	9	0.33940	T	0.23	-28.3449	14.0068	0.64468	0.0:1.0:0.0:0.0	.	148;148	A8K927;Q8WWB3	.;DYDC1_HUMAN	N	148	.	ENSP00000361276:D148N	D	-	1	0	DYDC1	82088265	0.194000	0.23325	0.199000	0.23439	0.697000	0.40408	1.883000	0.39658	2.459000	0.83118	0.655000	0.94253	GAT	.	C|1.000;A|0.000		0.333	DYDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049059.1	NM_138812	
PAPSS2	9060	hgsc.bcm.edu	37	10	89472858	89472858	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A7IE-01A-21D-A382-10	TCGA-CC-A7IE-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c1caf517-5052-48e3-ad80-8458b3d2ff5f	ab81329b-c119-4a5a-863c-5b50f48cee3f	g.chr10:89472858A>G	ENST00000361175.4	+	3	541	c.172A>G	c.(172-174)Ata>Gta	p.I58V	PAPSS2_ENST00000456849.1_Missense_Mutation_p.I58V|PAPSS2_ENST00000482258.1_3'UTR|PAPSS2_ENST00000427144.2_Missense_Mutation_p.I62V	NM_004670.3	NP_004661.2	O95340	PAPS2_HUMAN	3'-phosphoadenosine 5'-phosphosulfate synthase 2	58					3'-phosphoadenosine 5'-phosphosulfate biosynthetic process (GO:0050428)|3'-phosphoadenosine 5'-phosphosulfate metabolic process (GO:0050427)|blood coagulation (GO:0007596)|bone development (GO:0060348)|carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|skeletal system development (GO:0001501)|small molecule metabolic process (GO:0044281)|sulfate assimilation (GO:0000103)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	adenylylsulfate kinase activity (GO:0004020)|ATP binding (GO:0005524)|nucleotidyltransferase activity (GO:0016779)|sulfate adenylyltransferase (ATP) activity (GO:0004781)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(8)|ovary(1)|skin(1)|stomach(1)	20		Melanoma(5;0.019)|Colorectal(252;0.123)		UCEC - Uterine corpus endometrioid carcinoma (6;0.00164)|Colorectal(12;0.000323)|COAD - Colon adenocarcinoma(12;0.00124)		AAAAACAACGATAAGTTTTGC	0.448																																					p.I58V		Atlas-SNP	.											.	PAPSS2	46	.	0			c.A172G						.						145.0	149.0	148.0					10																	89472858		2203	4300	6503	SO:0001583	missense	9060	exon3			ACAACGATAAGTT	AF091242	CCDS7385.1, CCDS44453.1	10q24	2008-02-07			ENSG00000198682	ENSG00000198682	2.7.7.4, 2.7.1.25		8604	protein-coding gene	gene with protein product		603005				9771708	Standard	NM_004670		Approved	ATPSK2	uc001kex.3	O95340	OTTHUMG00000018683	ENST00000361175.4:c.172A>G	chr10.hg19:g.89472858A>G	ENSP00000354436:p.Ile58Val	163.0	0.0		163.0	55.0	NM_001015880	Q9BZL2|Q9P0G6|Q9UHM1|Q9UKD3|Q9UP30	Missense_Mutation	SNP	ENST00000361175.4	hg19	CCDS7385.1	.	.	.	.	.	.	.	.	.	.	A	2.035	-0.421352	0.04734	.	.	ENSG00000198682	ENST00000361175;ENST00000456849;ENST00000427144;ENST00000371981	T;T;T	0.78246	-1.16;-1.16;-1.16	5.87	0.992	0.19819	Adenylylsulphate kinase, C-terminal (3);	0.144289	0.64402	N	0.000009	T	0.58119	0.2100	N	0.25890	0.77	0.54753	D	0.999983	B;B	0.06786	0.001;0.001	B;B	0.18263	0.021;0.007	T	0.30679	-0.9970	10	0.13853	T	0.58	-13.112	5.8466	0.18669	0.607:0.1267:0.2662:0.0	.	58;58	O95340;O95340-2	PAPS2_HUMAN;.	V	58;58;62;57	ENSP00000354436:I58V;ENSP00000406157:I58V;ENSP00000397123:I62V	ENSP00000354436:I58V	I	+	1	0	PAPSS2	89462838	0.584000	0.26766	0.029000	0.17559	0.045000	0.14185	1.444000	0.35068	-0.074000	0.12820	-1.069000	0.02264	ATA	.	.		0.448	PAPSS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049229.1		
PLCE1	51196	hgsc.bcm.edu	37	10	96084326	96084326	+	Splice_Site	SNP	T	T	C			TCGA-CC-A7IE-01A-21D-A382-10	TCGA-CC-A7IE-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c1caf517-5052-48e3-ad80-8458b3d2ff5f	ab81329b-c119-4a5a-863c-5b50f48cee3f	g.chr10:96084326T>C	ENST00000371380.3	+	30	6955		c.e30+2		PLCE1_ENST00000371375.1_Splice_Site|NOC3L_ENST00000543788.1_Intron|PLCE1_ENST00000371385.3_Splice_Site|PLCE1_ENST00000260766.3_Splice_Site			Q9P212	PLCE1_HUMAN	phospholipase C, epsilon 1						activation of MAPK activity (GO:0000187)|calcium-mediated signaling (GO:0019722)|cell proliferation (GO:0008283)|cytoskeleton organization (GO:0007010)|diacylglycerol biosynthetic process (GO:0006651)|epidermal growth factor receptor signaling pathway (GO:0007173)|glomerulus development (GO:0032835)|heart development (GO:0007507)|inositol phosphate metabolic process (GO:0043647)|inositol phosphate-mediated signaling (GO:0048016)|lipid catabolic process (GO:0016042)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|phospholipid metabolic process (GO:0006644)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of GTPase activity (GO:0043547)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|Ras protein signal transduction (GO:0007265)|regulation of cell growth (GO:0001558)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|regulation of protein kinase activity (GO:0045859)|regulation of Ras protein signal transduction (GO:0046578)|regulation of smooth muscle contraction (GO:0006940)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|enzyme binding (GO:0019899)|guanyl-nucleotide exchange factor activity (GO:0005085)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|Ras GTPase binding (GO:0017016)|receptor signaling protein activity (GO:0005057)			liver(1)|ovary(2)|skin(4)|upper_aerodigestive_tract(1)	8		Colorectal(252;0.0458)				CAGGTGCAGGTAAAGTTTAAA	0.423																																					.		Atlas-SNP	.											.	PLCE1	543	.	0			c.6720+2T>C						.						81.0	80.0	80.0					10																	96084326		1875	4107	5982	SO:0001630	splice_region_variant	51196	exon31			TGCAGGTAAAGTT		CCDS41552.1, CCDS53555.1	10q23	2010-02-22			ENSG00000138193	ENSG00000138193	3.1.4.11		17175	protein-coding gene	gene with protein product	"""nephrosis type 3"""	608414				11022047, 11022048	Standard	NM_016341		Approved	KIAA1516, PLCE, NPHS3	uc001kjk.3	Q9P212	OTTHUMG00000018789	ENST00000371380.3:c.6720+2T>C	chr10.hg19:g.96084326T>C		89.0	0.0		91.0	34.0	NM_016341	A6NGW0|A6NLA1|A7MBN7|A8K1D7|B9EIJ6|Q1X6H8|Q5VWL4|Q5VWL5|Q9H9X8|Q9HBX6|Q9HC53|Q9UHV3	Splice_Site	SNP	ENST00000371380.3	hg19	CCDS41552.1	.	.	.	.	.	.	.	.	.	.	T	17.70	3.455335	0.63401	.	.	ENSG00000138193	ENST00000260766;ENST00000371380;ENST00000371385;ENST00000371375	.	.	.	5.5	5.5	0.81552	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.2675	0.73672	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	PLCE1	96074316	1.000000	0.71417	0.998000	0.56505	0.813000	0.45954	4.325000	0.59234	2.086000	0.62901	0.482000	0.46254	.	.	.		0.423	PLCE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000049469.3	NM_016341	Intron
SEC31B	25956	hgsc.bcm.edu	37	10	102267799	102267799	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A7IE-01A-21D-A382-10	TCGA-CC-A7IE-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c1caf517-5052-48e3-ad80-8458b3d2ff5f	ab81329b-c119-4a5a-863c-5b50f48cee3f	g.chr10:102267799C>T	ENST00000370345.3	-	6	602	c.505G>A	c.(505-507)Gag>Aag	p.E169K	SEC31B_ENST00000535773.1_Missense_Mutation_p.E12K|SEC31B_ENST00000451524.1_Missense_Mutation_p.E169K|NDUFB8_ENST00000557395.1_3'UTR|SEC31B_ENST00000370329.5_Missense_Mutation_p.E172K|NDUFB8_ENST00000531258.1_3'UTR	NM_015490.3	NP_056305.1	Q9NQW1	SC31B_HUMAN	SEC31 homolog B (S. cerevisiae)	169					protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	endoplasmic reticulum (GO:0005783)|vesicle coat (GO:0030120)				NS(1)|breast(2)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(3)|lung(17)|ovary(1)|urinary_tract(1)	36		Colorectal(252;0.117)		Epithelial(162;2.36e-10)|all cancers(201;2.09e-08)		TTGATGTCCTCTGGAGGCTGC	0.547																																					p.E169K		Atlas-SNP	.											.	SEC31B	84	.	0			c.G505A						.						148.0	129.0	135.0					10																	102267799		2203	4300	6503	SO:0001583	missense	25956	exon6			TGTCCTCTGGAGG	AF274863	CCDS7495.1	10q24.32	2013-01-10	2006-10-05	2006-09-07	ENSG00000075826	ENSG00000075826		"""WD repeat domain containing"""	23197	protein-coding gene	gene with protein product		610258	"""SEC31-like 2 (S. cerevisiae)"""	SEC31L2		16495487	Standard	NM_015490		Approved	SEC31B-1, DKFZP434M183	uc001krc.1	Q9NQW1	OTTHUMG00000019342	ENST00000370345.3:c.505G>A	chr10.hg19:g.102267799C>T	ENSP00000359370:p.Glu169Lys	56.0	0.0		71.0	19.0	NM_015490	B7ZM75|Q6MZS3|Q86UF0|Q9Y4Q8	Missense_Mutation	SNP	ENST00000370345.3	hg19	CCDS7495.1	.	.	.	.	.	.	.	.	.	.	C	28.5	4.925714	0.92319	.	.	ENSG00000075826	ENST00000370345;ENST00000451524;ENST00000535773;ENST00000370329	T;T;T;T	0.69926	0.62;0.3;-0.44;0.44	5.67	4.75	0.60458	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.80297	0.4597	M	0.69358	2.11	0.80722	D	1	D;P;D;P;D	0.89917	0.982;0.803;1.0;0.803;0.999	P;P;D;B;D	0.83275	0.855;0.468;0.996;0.392;0.985	T	0.82307	-0.0522	10	0.62326	D	0.03	-16.0947	15.7133	0.77649	0.0:0.8631:0.1369:0.0	.	169;172;168;169;169	A8KAL6;B4DGE3;Q9NQW1-5;E9PKR7;Q9NQW1	.;.;.;.;SC31B_HUMAN	K	169;169;12;172	ENSP00000359370:E169K;ENSP00000391178:E169K;ENSP00000442621:E12K;ENSP00000359354:E172K	ENSP00000359354:E172K	E	-	1	0	SEC31B	102257789	1.000000	0.71417	0.909000	0.35828	0.839000	0.47603	7.731000	0.84895	1.387000	0.46486	0.462000	0.41574	GAG	.	.		0.547	SEC31B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051198.1	NM_015490	
CPXM2	119587	hgsc.bcm.edu	37	10	125557598	125557598	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A7IE-01A-21D-A382-10	TCGA-CC-A7IE-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c1caf517-5052-48e3-ad80-8458b3d2ff5f	ab81329b-c119-4a5a-863c-5b50f48cee3f	g.chr10:125557598C>A	ENST00000241305.3	-	6	937	c.783G>T	c.(781-783)gaG>gaT	p.E261D	CPXM2_ENST00000368854.3_5'UTR	NM_198148.2	NP_937791.2	Q8N436	CPXM2_HUMAN	carboxypeptidase X (M14 family), member 2	261	F5/8 type C. {ECO:0000255|PROSITE- ProRule:PRU00081}.				cell adhesion (GO:0007155)	extracellular space (GO:0005615)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(7)|kidney(2)|large_intestine(13)|lung(15)|ovary(2)|prostate(2)|skin(3)	47		all_lung(145;0.174)|Colorectal(57;0.178)|Glioma(114;0.222)|all_neural(114;0.226)|Lung NSC(174;0.233)		COAD - Colon adenocarcinoma(40;0.212)|Colorectal(40;0.237)		GGACGGGTAGCTCATTGAGAA	0.473																																					p.E261D		Atlas-SNP	.											.	CPXM2	120	.	0			c.G783T						.						130.0	111.0	118.0					10																	125557598		2203	4300	6503	SO:0001583	missense	119587	exon6			GGGTAGCTCATTG	AY358565	CCDS7637.1	10q26	2012-02-10			ENSG00000121898	ENSG00000121898			26977	protein-coding gene	gene with protein product	"""cytosolic carboxypeptidase"""					12975309	Standard	NM_198148		Approved	UNQ676, CPX2	uc001lhk.1	Q8N436	OTTHUMG00000019206	ENST00000241305.3:c.783G>T	chr10.hg19:g.125557598C>A	ENSP00000241305:p.Glu261Asp	102.0	0.0		120.0	21.0	NM_198148	B4E3Q2	Missense_Mutation	SNP	ENST00000241305.3	hg19	CCDS7637.1	.	.	.	.	.	.	.	.	.	.	C	5.200	0.222410	0.09863	.	.	ENSG00000121898	ENST00000241305;ENST00000540123;ENST00000418782	D	0.98178	-4.77	4.46	3.53	0.40419	Coagulation factor 5/8 C-terminal type domain (3);Galactose-binding domain-like (1);	0.626440	0.16833	N	0.197668	D	0.93716	0.7992	N	0.16037	0.36	0.80722	D	1	B	0.12630	0.006	B	0.22880	0.042	D	0.90036	0.4138	10	0.23302	T	0.38	-15.9855	9.3275	0.38001	0.0:0.8347:0.0:0.1653	.	261	Q8N436	CPXM2_HUMAN	D	261;94;261	ENSP00000241305:E261D	ENSP00000241305:E261D	E	-	3	2	CPXM2	125547588	1.000000	0.71417	1.000000	0.80357	0.042000	0.13812	1.801000	0.38843	2.292000	0.77174	0.557000	0.71058	GAG	.	.		0.473	CPXM2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050853.1	NM_198148	
SLC6A5	9152	hgsc.bcm.edu	37	11	20652251	20652251	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A7IE-01A-21D-A382-10	TCGA-CC-A7IE-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c1caf517-5052-48e3-ad80-8458b3d2ff5f	ab81329b-c119-4a5a-863c-5b50f48cee3f	g.chr11:20652251T>C	ENST00000525748.1	+	10	1787	c.1514T>C	c.(1513-1515)gTc>gCc	p.V505A	SLC6A5_ENST00000528440.1_3'UTR	NM_004211.3	NP_004202.2	Q9Y345	SC6A5_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 5	505					glycine import (GO:0036233)|synaptic transmission (GO:0007268)|synaptic transmission, glycinergic (GO:0060012)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	glycine:sodium symporter activity (GO:0015375)|neurotransmitter:sodium symporter activity (GO:0005328)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(34)|ovary(2)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	63					Glycine(DB00145)	ACTCTAATTGTCACCTGCACC	0.498																																					p.V505A		Atlas-SNP	.											.	SLC6A5	151	.	0			c.T1514C						.						214.0	186.0	195.0					11																	20652251		2203	4300	6503	SO:0001583	missense	9152	exon10			TAATTGTCACCTG	AF085412	CCDS7854.1	11p15.1	2013-07-19	2013-07-19		ENSG00000165970	ENSG00000165970		"""Solute carriers"""	11051	protein-coding gene	gene with protein product	"""glycine transporter 2"""	604159	"""solute carrier family 6 (neurotransmitter transporter, glycine), member 5"""	NET1		9845349	Standard	NM_004211		Approved	GLYT2	uc001mqd.3	Q9Y345	OTTHUMG00000166024	ENST00000525748.1:c.1514T>C	chr11.hg19:g.20652251T>C	ENSP00000434364:p.Val505Ala	124.0	0.0		170.0	53.0	NM_004211	O95288|Q4VAM7|Q9BX77	Missense_Mutation	SNP	ENST00000525748.1	hg19	CCDS7854.1	.	.	.	.	.	.	.	.	.	.	T	26.7	4.767324	0.90020	.	.	ENSG00000165970	ENST00000525748	T	0.79033	-1.23	5.57	5.57	0.84162	.	0.167862	0.52532	D	0.000072	D	0.88355	0.6414	M	0.81614	2.55	0.80722	D	1	D	0.89917	1.0	D	0.77004	0.989	D	0.89979	0.4099	10	0.87932	D	0	.	15.7239	0.77736	0.0:0.0:0.0:1.0	.	505	Q9Y345	SC6A5_HUMAN	A	505	ENSP00000434364:V505A	ENSP00000434364:V505A	V	+	2	0	SLC6A5	20608827	1.000000	0.71417	0.988000	0.46212	0.923000	0.55619	8.040000	0.89188	2.116000	0.64780	0.533000	0.62120	GTC	.	.		0.498	SLC6A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387497.2	NM_004211	
OR8H2	390151	hgsc.bcm.edu	37	11	55873358	55873358	+	Missense_Mutation	SNP	T	T	G			TCGA-CC-A7IE-01A-21D-A382-10	TCGA-CC-A7IE-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c1caf517-5052-48e3-ad80-8458b3d2ff5f	ab81329b-c119-4a5a-863c-5b50f48cee3f	g.chr11:55873358T>G	ENST00000313503.1	+	1	840	c.840T>G	c.(838-840)atT>atG	p.I280M		NM_001005200.1	NP_001005200.1	Q8N162	OR8H2_HUMAN	olfactory receptor, family 8, subfamily H, member 2	280						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(38)|ovary(1)|skin(3)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	61	Esophageal squamous(21;0.00693)					TTTATACTATTGTGATTCCCG	0.368										HNSCC(53;0.14)																											p.I280M		Atlas-SNP	.											.	OR8H2	117	.	0			c.T840G						.						78.0	86.0	83.0					11																	55873358		2201	4294	6495	SO:0001583	missense	390151	exon1			TACTATTGTGATT	AB065657	CCDS31518.1	11q11	2012-08-09			ENSG00000181767	ENSG00000181767		"""GPCR / Class A : Olfactory receptors"""	15308	protein-coding gene	gene with protein product							Standard	NM_001005200		Approved		uc010riy.2	Q8N162	OTTHUMG00000166832	ENST00000313503.1:c.840T>G	chr11.hg19:g.55873358T>G	ENSP00000323982:p.Ile280Met	155.0	0.0		182.0	59.0	NM_001005200	Q6IFC1	Missense_Mutation	SNP	ENST00000313503.1	hg19	CCDS31518.1	.	.	.	.	.	.	.	.	.	.	t	3.843	-0.033330	0.07543	.	.	ENSG00000181767	ENST00000313503	T	0.00164	8.64	3.35	0.69	0.18039	GPCR, rhodopsin-like superfamily (1);	0.116486	0.39475	N	0.001345	T	0.00178	0.0005	L	0.37750	1.13	0.09310	N	1	D	0.76494	0.999	D	0.76575	0.988	T	0.44772	-0.9306	10	0.07644	T	0.81	.	1.7012	0.02873	0.1367:0.1275:0.3041:0.4317	.	280	Q8N162	OR8H2_HUMAN	M	280	ENSP00000323982:I280M	ENSP00000323982:I280M	I	+	3	3	OR8H2	55629934	0.000000	0.05858	0.984000	0.44739	0.138000	0.21146	-2.914000	0.00697	0.022000	0.15160	0.362000	0.22060	ATT	.	.		0.368	OR8H2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391540.1	NM_001005200	
MRPL21	219927	hgsc.bcm.edu	37	11	68660463	68660463	+	Splice_Site	SNP	T	T	C			TCGA-CC-A7IE-01A-21D-A382-10	TCGA-CC-A7IE-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c1caf517-5052-48e3-ad80-8458b3d2ff5f	ab81329b-c119-4a5a-863c-5b50f48cee3f	g.chr11:68660463T>C	ENST00000362034.2	-	6	459		c.e6-2		MRPL21_ENST00000567045.1_Splice_Site|MRPL21_ENST00000450904.2_Splice_Site	NM_181514.1|NM_181515.1	NP_852615.1|NP_852616.1	Q7Z2W9	RM21_HUMAN	mitochondrial ribosomal protein L21						translation (GO:0006412)	mitochondrion (GO:0005739)|ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			large_intestine(1)|lung(6)|prostate(1)	8			STAD - Stomach adenocarcinoma(18;0.0208)|LUAD - Lung adenocarcinoma(13;0.0713)			AGATCCTTTCTAGAAGGAAGA	0.318																																					.		Atlas-SNP	.											.	MRPL21	13	.	0			c.195-2A>G						.						73.0	67.0	69.0					11																	68660463		2200	4294	6494	SO:0001630	splice_region_variant	219927	exon7			CCTTTCTAGAAGG	AK096756	CCDS8186.1, CCDS44662.1	11q13.3	2012-09-13			ENSG00000197345	ENSG00000197345		"""Mitochondrial ribosomal proteins / large subunits"""	14479	protein-coding gene	gene with protein product		611834				11551941	Standard	NM_181514		Approved		uc001ooi.3	Q7Z2W9	OTTHUMG00000167893	ENST00000362034.2:c.450-2A>G	chr11.hg19:g.68660463T>C		104.0	0.0		74.0	20.0	NM_181515	A6NKU0|C9JPR2	Splice_Site	SNP	ENST00000362034.2	hg19	CCDS8186.1	.	.	.	.	.	.	.	.	.	.	T	14.77	2.636043	0.47049	.	.	ENSG00000197345	ENST00000450904;ENST00000362034;ENST00000447977	.	.	.	4.54	4.54	0.55810	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.9107	0.58179	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	MRPL21	68417039	0.997000	0.39634	0.951000	0.38953	0.655000	0.38815	3.055000	0.49916	1.697000	0.51169	0.528000	0.53228	.	.	.		0.318	MRPL21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396856.1	NM_181512	Intron
GRM5	2915	hgsc.bcm.edu	37	11	88386445	88386445	+	Silent	SNP	T	T	C			TCGA-CC-A7IE-01A-21D-A382-10	TCGA-CC-A7IE-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c1caf517-5052-48e3-ad80-8458b3d2ff5f	ab81329b-c119-4a5a-863c-5b50f48cee3f	g.chr11:88386445T>C	ENST00000305447.4	-	3	1187	c.1038A>G	c.(1036-1038)ccA>ccG	p.P346P	GRM5_ENST00000305432.5_Silent_p.P346P|GRM5_ENST00000455756.2_Silent_p.P346P|GRM5_ENST00000418177.2_Silent_p.P346P|GRM5_ENST00000393297.1_Silent_p.P346P	NM_001143831.2	NP_001137303.1	P41594	GRM5_HUMAN	glutamate receptor, metabotropic 5	346					activation of MAPKKK activity (GO:0000185)|cognition (GO:0050890)|desensitization of G-protein coupled receptor protein signaling pathway (GO:0002029)|G-protein coupled glutamate receptor signaling pathway (GO:0007216)|learning (GO:0007612)|locomotory behavior (GO:0007626)|negative regulation of locomotion (GO:0040013)|phospholipase C-activating G-protein coupled glutamate receptor signaling pathway (GO:0007206)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|protein phosphorylation (GO:0006468)|regulation of synaptic transmission, glutamatergic (GO:0051966)|regulation of transcription, DNA-templated (GO:0006355)|synaptic transmission (GO:0007268)	astrocyte projection (GO:0097449)|cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|dendritic spine (GO:0043197)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)			NS(1)|breast(5)|central_nervous_system(4)|endometrium(5)|kidney(3)|large_intestine(18)|lung(40)|ovary(3)|pancreas(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	90		Acute lymphoblastic leukemia(157;2.54e-05)|all_hematologic(158;0.00834)			Acamprosate(DB00659)|Rufinamide(DB06201)	GGTTTGTTTCTGGCCGGAGCT	0.458																																					p.P346P		Atlas-SNP	.											.	GRM5	414	.	0			c.A1038G						.						92.0	93.0	93.0					11																	88386445		2201	4299	6500	SO:0001819	synonymous_variant	2915	exon4			TGTTTCTGGCCGG	D28538	CCDS8283.1, CCDS44694.1	11q14.3	2014-06-12			ENSG00000168959	ENSG00000168959		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4597	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 86"""	604102				7908515	Standard	NM_001143831		Approved	MGLUR5, GPRC1E, mGlu5, PPP1R86	uc001pcq.3	P41594	OTTHUMG00000134306	ENST00000305447.4:c.1038A>G	chr11.hg19:g.88386445T>C		103.0	0.0		128.0	36.0	NM_000842	Q6J164	Silent	SNP	ENST00000305447.4	hg19	CCDS44694.1																																																																																			.	.		0.458	GRM5-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000259226.1	NM_000842	
FAT3	120114	hgsc.bcm.edu	37	11	92495256	92495256	+	Nonsense_Mutation	SNP	G	G	T	rs568235366		TCGA-CC-A7IE-01A-21D-A382-10	TCGA-CC-A7IE-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c1caf517-5052-48e3-ad80-8458b3d2ff5f	ab81329b-c119-4a5a-863c-5b50f48cee3f	g.chr11:92495256G>T	ENST00000298047.6	+	4	3921	c.3904G>T	c.(3904-3906)Gga>Tga	p.G1302*	FAT3_ENST00000409404.2_Nonsense_Mutation_p.G1302*|RP11-203F8.1_ENST00000529884.1_RNA|FAT3_ENST00000525166.1_Nonsense_Mutation_p.G1152*			Q8TDW7	FAT3_HUMAN	FAT atypical cadherin 3	1302	Cadherin 12. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(10)|kidney(4)|large_intestine(11)|liver(2)|lung(37)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	85		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				GAATGATGACGGAAAGTTCTT	0.428										TCGA Ovarian(4;0.039)																											p.G1302X		Atlas-SNP	.											.	FAT3	1822	.	0			c.G3904T						.						93.0	91.0	92.0					11																	92495256		1887	4117	6004	SO:0001587	stop_gained	120114	exon4			GATGACGGAAAGT	AB076400		11q14.3	2013-05-31	2013-05-31		ENSG00000165323	ENSG00000165323		"""Cadherins / Cadherin-related"""	23112	protein-coding gene	gene with protein product	"""cadherin-related family member 10"""	612483	"""FAT tumor suppressor homolog 3 (Drosophila)"""			11811999	Standard	NM_001008781		Approved	KIAA1989, CDHF15, CDHR10	uc001pdj.4	Q8TDW7	OTTHUMG00000154468	ENST00000298047.6:c.3904G>T	chr11.hg19:g.92495256G>T	ENSP00000298047:p.Gly1302*	126.0	0.0		156.0	41.0	NM_001008781	B5MDB0|Q96AU6	Nonsense_Mutation	SNP	ENST00000298047.6	hg19		.	.	.	.	.	.	.	.	.	.	G	42	9.451075	0.99175	.	.	ENSG00000165323	ENST00000298047;ENST00000409404;ENST00000525166	.	.	.	5.58	5.58	0.84498	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.56958	D	0.05	.	19.5733	0.95430	0.0:0.0:1.0:0.0	.	.	.	.	X	1302;1302;1152	.	ENSP00000298047:G1302X	G	+	1	0	FAT3	92134904	1.000000	0.71417	0.981000	0.43875	0.379000	0.30106	6.557000	0.73937	2.618000	0.88619	0.563000	0.77884	GGA	.	.		0.428	FAT3-201	KNOWN	basic	protein_coding	protein_coding		NM_001008781	
ARHGAP42	143872	hgsc.bcm.edu	37	11	100803985	100803985	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A7IE-01A-21D-A382-10	TCGA-CC-A7IE-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c1caf517-5052-48e3-ad80-8458b3d2ff5f	ab81329b-c119-4a5a-863c-5b50f48cee3f	g.chr11:100803985G>T	ENST00000298815.8	+	7	699	c.696G>T	c.(694-696)ttG>ttT	p.L232F	ARHGAP42_ENST00000524892.2_Missense_Mutation_p.L198F|snoU13_ENST00000459511.1_RNA	NM_152432.2	NP_689645.2	A6NI28	RHG42_HUMAN	Rho GTPase activating protein 42	232	BAR.				signal transduction (GO:0007165)	intracellular (GO:0005622)	GTPase activator activity (GO:0005096)			endometrium(3)|skin(2)	5						AGTTCAACTTGCAGAATGTAA	0.388																																					p.L232F		Atlas-SNP	.											.	ARHGAP42	32	.	0			c.G696T						.						124.0	96.0	104.0					11																	100803985		692	1591	2283	SO:0001583	missense	143872	exon7			CAACTTGCAGAAT			11q22.1	2012-04-19			ENSG00000165895	ENSG00000165895		"""Rho GTPase activating proteins"""	26545	protein-coding gene	gene with protein product		615936				18954304	Standard	NM_152432		Approved	FLJ32810, GRAF3	uc001pge.2	A6NI28	OTTHUMG00000167530	ENST00000298815.8:c.696G>T	chr11.hg19:g.100803985G>T	ENSP00000298815:p.Leu232Phe	54.0	0.0		66.0	21.0	NM_152432	Q96M56	Missense_Mutation	SNP	ENST00000298815.8	hg19		.	.	.	.	.	.	.	.	.	.	G	18.22	3.575583	0.65878	.	.	ENSG00000165895	ENST00000524892;ENST00000298815;ENST00000531183	T;T;T	0.31769	1.48;3.41;3.41	5.69	1.56	0.23342	.	0.000000	0.42172	U	0.000751	T	0.47078	0.1426	M	0.75777	2.31	0.54753	D	0.999981	D	0.63046	0.992	D	0.67900	0.954	T	0.43343	-0.9397	10	0.87932	D	0	.	5.9847	0.19428	0.3148:0.1322:0.553:0.0	.	232	A6NI28	RHG42_HUMAN	F	198;232;88	ENSP00000431776:L198F;ENSP00000298815:L232F;ENSP00000434304:L88F	ENSP00000298815:L232F	L	+	3	2	ARHGAP42	100309195	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	1.013000	0.29937	0.679000	0.31345	0.591000	0.81541	TTG	.	.		0.388	ARHGAP42-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_152432	
ABCG4	64137	hgsc.bcm.edu	37	11	119031060	119031060	+	Missense_Mutation	SNP	G	G	C			TCGA-CC-A7IE-01A-21D-A382-10	TCGA-CC-A7IE-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c1caf517-5052-48e3-ad80-8458b3d2ff5f	ab81329b-c119-4a5a-863c-5b50f48cee3f	g.chr11:119031060G>C	ENST00000449422.2	+	13	1749	c.1561G>C	c.(1561-1563)Ggg>Cgg	p.G521R	ABCG4_ENST00000307417.3_Missense_Mutation_p.G521R|ABCG4_ENST00000531739.1_Missense_Mutation_p.G521R	NM_001142505.1	NP_001135977.1	Q9H172	ABCG4_HUMAN	ATP-binding cassette, sub-family G (WHITE), member 4	521	ABC transmembrane type-2.				cholesterol efflux (GO:0033344)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|cholesterol transporter activity (GO:0017127)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(28)|ovary(2)|prostate(1)|skin(1)	44	all_hematologic(175;0.0977)	Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.7e-05)		CCAATCTTTGGGGCTGCTGAT	0.632																																					p.G521R		Atlas-SNP	.											.	ABCG4	77	.	0			c.G1561C						.						49.0	49.0	49.0					11																	119031060		2200	4295	6495	SO:0001583	missense	64137	exon13			TCTTTGGGGCTGC	AJ300465	CCDS8415.1	11q23	2012-03-14			ENSG00000172350	ENSG00000172350		"""ATP binding cassette transporters / subfamily G"""	13884	protein-coding gene	gene with protein product	"""putative ABC transporter"", ""ATP-binding cassette, subfamily G, member 4"""	607784				11435397	Standard	NM_022169		Approved	WHITE2	uc001pvs.3	Q9H172	OTTHUMG00000166169	ENST00000449422.2:c.1561G>C	chr11.hg19:g.119031060G>C	ENSP00000406874:p.Gly521Arg	56.0	0.0		68.0	17.0	NM_022169	A8K1B5|Q8WWH0|Q8WWH1|Q8WWH2	Missense_Mutation	SNP	ENST00000449422.2	hg19	CCDS8415.1	.	.	.	.	.	.	.	.	.	.	G	34	5.343088	0.95783	.	.	ENSG00000172350	ENST00000307417;ENST00000449422;ENST00000531739	T;T;T	0.79352	-1.26;-1.26;-1.26	5.2	5.2	0.72013	ABC-2 type transporter (1);	0.189632	0.56097	D	0.000027	D	0.92355	0.7574	H	0.96633	3.855	0.80722	D	1	D	0.76494	0.999	D	0.73708	0.981	D	0.94556	0.7758	10	0.87932	D	0	-15.3271	18.9923	0.92798	0.0:0.0:1.0:0.0	.	521	Q9H172	ABCG4_HUMAN	R	521	ENSP00000304111:G521R;ENSP00000406874:G521R;ENSP00000434318:G521R	ENSP00000304111:G521R	G	+	1	0	ABCG4	118536270	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	9.648000	0.98483	2.720000	0.93068	0.558000	0.71614	GGG	.	.		0.632	ABCG4-002	PUTATIVE	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000388215.1	NM_022169	
USP2	9099	hgsc.bcm.edu	37	11	119228005	119228005	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A7IE-01A-21D-A382-10	TCGA-CC-A7IE-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c1caf517-5052-48e3-ad80-8458b3d2ff5f	ab81329b-c119-4a5a-863c-5b50f48cee3f	g.chr11:119228005T>C	ENST00000260187.2	-	12	1916	c.1622A>G	c.(1621-1623)tAc>tGc	p.Y541C	USP2_ENST00000455332.2_Missense_Mutation_p.Y298C|USP2_ENST00000525735.1_Missense_Mutation_p.Y332C	NM_004205.4	NP_004196.4	O75604	UBP2_HUMAN	ubiquitin specific peptidase 2	541	USP.				cell cycle (GO:0007049)|muscle organ development (GO:0007517)|negative regulation of skeletal muscle tissue development (GO:0048642)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of skeletal muscle tissue development (GO:0048643)|protein deubiquitination (GO:0016579)|protein stabilization (GO:0050821)|ubiquitin-dependent protein catabolic process (GO:0006511)	cell cortex (GO:0005938)|centrosome (GO:0005813)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	cyclin binding (GO:0030332)|cysteine-type endopeptidase activity (GO:0004197)|metal ion binding (GO:0046872)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			breast(2)|endometrium(2)|kidney(2)|large_intestine(5)|lung(5)|ovary(2)|prostate(3)|skin(2)|urinary_tract(1)	24		all_hematologic(192;4.65e-05)|Breast(348;0.0101)|all_neural(223;0.0218)|Medulloblastoma(222;0.0425)|Renal(330;0.157)		BRCA - Breast invasive adenocarcinoma(274;3.93e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.000513)|Colorectal(284;0.0116)|Lung(307;0.0853)|LUSC - Lung squamous cell carcinoma(976;0.0889)		GTACAGGTTGTAAACAGCATG	0.597																																					p.Y541C		Atlas-SNP	.											.	USP2	71	.	0			c.A1622G						.						90.0	80.0	83.0					11																	119228005		2199	4295	6494	SO:0001583	missense	9099	exon12			AGGTTGTAAACAG	AF079564	CCDS8422.1, CCDS8423.1, CCDS58189.1	11q23.3	2008-02-05	2005-08-08			ENSG00000036672		"""Ubiquitin-specific peptidases"""	12618	protein-coding gene	gene with protein product		604725	"""ubiquitin specific protease 2"""			12838346	Standard	NM_004205		Approved	UBP41	uc001pwm.4	O75604		ENST00000260187.2:c.1622A>G	chr11.hg19:g.119228005T>C	ENSP00000260187:p.Tyr541Cys	106.0	0.0		141.0	44.0	NM_004205	B0YJB8|E9PPM2|Q8IUM2|Q8IW04|Q96MB9|Q9BQ21	Missense_Mutation	SNP	ENST00000260187.2	hg19	CCDS8422.1	.	.	.	.	.	.	.	.	.	.	T	23.0	4.363808	0.82353	.	.	ENSG00000036672	ENST00000455332;ENST00000260187;ENST00000392808;ENST00000525735	T;T;T	0.22539	1.95;1.95;1.95	5.77	5.77	0.91146	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2, conserved site (1);Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.000000	0.85682	D	0.000000	T	0.65270	0.2675	H	0.99545	4.62	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	T	0.79359	-0.1836	10	0.87932	D	0	-5.887	11.6391	0.51222	0.1328:0.0:0.0:0.8672	.	298;541;332	E9PPM2;O75604;O75604-4	.;UBP2_HUMAN;.	C	298;541;288;332	ENSP00000407842:Y298C;ENSP00000260187:Y541C;ENSP00000436952:Y332C	ENSP00000260187:Y541C	Y	-	2	0	USP2	118733215	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.956000	0.87863	2.201000	0.70794	0.523000	0.50628	TAC	.	.		0.597	USP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388361.2	NM_171997	
LRP6	4040	hgsc.bcm.edu	37	12	12356291	12356291	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A7IE-01A-21D-A382-10	TCGA-CC-A7IE-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c1caf517-5052-48e3-ad80-8458b3d2ff5f	ab81329b-c119-4a5a-863c-5b50f48cee3f	g.chr12:12356291G>A	ENST00000261349.4	-	3	569	c.493C>T	c.(493-495)Cgt>Tgt	p.R165C	LRP6_ENST00000543091.1_Missense_Mutation_p.R165C	NM_002336.2	NP_002327.2	O75581	LRP6_HUMAN	low density lipoprotein receptor-related protein 6	165	Beta-propeller 1.				anterior/posterior pattern specification (GO:0009952)|axis elongation involved in somitogenesis (GO:0090245)|bone morphogenesis (GO:0060349)|bone remodeling (GO:0046849)|branching involved in mammary gland duct morphogenesis (GO:0060444)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in cardiac neural crest cell differentiation involved in heart development (GO:0061310)|canonical Wnt signaling pathway involved in neural crest cell differentiation (GO:0044335)|canonical Wnt signaling pathway involved in positive regulation of cardiac outflow tract cell proliferation (GO:0061324)|canonical Wnt signaling pathway involved in regulation of cell proliferation (GO:0044340)|cell migration involved in gastrulation (GO:0042074)|cellular response to cholesterol (GO:0071397)|cerebellum morphogenesis (GO:0021587)|cerebral cortex cell migration (GO:0021795)|cerebral cortex development (GO:0021987)|convergent extension (GO:0060026)|dopaminergic neuron differentiation (GO:0071542)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic digit morphogenesis (GO:0042733)|embryonic forelimb morphogenesis (GO:0035115)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic limb morphogenesis (GO:0030326)|embryonic pattern specification (GO:0009880)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|external genitalia morphogenesis (GO:0035261)|face morphogenesis (GO:0060325)|forebrain radial glial cell differentiation (GO:0021861)|formation of radial glial scaffolds (GO:0021943)|gastrulation with mouth forming second (GO:0001702)|heart looping (GO:0001947)|mammary placode formation (GO:0060596)|midbrain development (GO:0030901)|midbrain-hindbrain boundary development (GO:0030917)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of planar cell polarity pathway involved in cardiac muscle tissue morphogenesis (GO:2000151)|negative regulation of planar cell polarity pathway involved in cardiac right atrium morphogenesis (GO:2000162)|negative regulation of planar cell polarity pathway involved in neural tube closure (GO:2000168)|negative regulation of planar cell polarity pathway involved in outflow tract morphogenesis (GO:2000164)|negative regulation of planar cell polarity pathway involved in pericardium morphogenesis (GO:2000166)|negative regulation of planar cell polarity pathway involved in ventricular septum morphogenesis (GO:2000149)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of protein serine/threonine kinase activity (GO:0071901)|negative regulation of smooth muscle cell apoptotic process (GO:0034392)|neural crest cell differentiation (GO:0014033)|neural crest formation (GO:0014029)|neural tube closure (GO:0001843)|odontogenesis of dentin-containing tooth (GO:0042475)|palate development (GO:0060021)|pericardium morphogenesis (GO:0003344)|positive regulation of apoptotic process (GO:0043065)|positive regulation of bone resorption (GO:0045780)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell cycle (GO:0045787)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of ossification (GO:0045778)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of Wnt signaling pathway involved in dorsal/ventral axis specification (GO:2000055)|post-anal tail morphogenesis (GO:0036342)|primitive streak formation (GO:0090009)|receptor-mediated endocytosis of low-density lipoprotein particle involved in cholesterol transport (GO:0090118)|regulation of cell development (GO:0060284)|regulation of fat cell differentiation (GO:0045598)|regulation of ossification (GO:0030278)|response to folic acid (GO:0051593)|response to peptide hormone (GO:0043434)|single organismal cell-cell adhesion (GO:0016337)|synaptic transmission (GO:0007268)|thalamus development (GO:0021794)|toxin transport (GO:1901998)|trachea cartilage morphogenesis (GO:0060535)|Wnt signaling pathway (GO:0016055)|Wnt signaling pathway involved in dorsal/ventral axis specification (GO:0044332)|Wnt signaling pathway involved in forebrain neuroblast division (GO:0021874)|Wnt signaling pathway involved in somitogenesis (GO:0090244)	cell surface (GO:0009986)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|synapse (GO:0045202)	apolipoprotein binding (GO:0034185)|coreceptor activity involved in Wnt signaling pathway (GO:0071936)|frizzled binding (GO:0005109)|identical protein binding (GO:0042802)|kinase inhibitor activity (GO:0019210)|low-density lipoprotein receptor activity (GO:0005041)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)|toxin transporter activity (GO:0019534)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(19)|lung(28)|ovary(3)|prostate(2)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	85		Prostate(47;0.0865)				ATTCCAGCACGTTCTATCTTT	0.358																																					p.R165C		Atlas-SNP	.											.	LRP6	170	.	0			c.C493T						.						125.0	119.0	121.0					12																	12356291		2203	4300	6503	SO:0001583	missense	4040	exon3			CAGCACGTTCTAT	AF074264	CCDS8647.1	12p13.2	2013-05-29			ENSG00000070018	ENSG00000070018		"""Low density lipoprotein receptors"""	6698	protein-coding gene	gene with protein product		603507				9704021	Standard	NM_002336		Approved	ADCAD2	uc001rah.4	O75581	OTTHUMG00000168540	ENST00000261349.4:c.493C>T	chr12.hg19:g.12356291G>A	ENSP00000261349:p.Arg165Cys	113.0	0.0		127.0	30.0	NM_002336	Q17RZ2	Missense_Mutation	SNP	ENST00000261349.4	hg19	CCDS8647.1	.	.	.	.	.	.	.	.	.	.	G	19.11	3.763672	0.69878	.	.	ENSG00000070018	ENST00000261349;ENST00000543091;ENST00000535731	D;D;D	0.96200	-3.94;-3.94;-3.94	5.51	5.51	0.81932	Six-bladed beta-propeller, TolB-like (1);	0.000000	0.64402	D	0.000009	D	0.97904	0.9311	M	0.83118	2.625	0.80722	D	1	D;P	0.89917	1.0;0.904	D;B	0.85130	0.997;0.227	D	0.98438	1.0585	10	0.72032	D	0.01	.	19.4043	0.94642	0.0:0.0:1.0:0.0	.	165;165	F5H7J9;O75581	.;LRP6_HUMAN	C	165;165;14	ENSP00000261349:R165C;ENSP00000442472:R165C;ENSP00000439765:R14C	ENSP00000261349:R165C	R	-	1	0	LRP6	12247558	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.265000	0.65519	2.574000	0.86865	0.655000	0.94253	CGT	.	.		0.358	LRP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400137.1		
PKP2	5318	hgsc.bcm.edu	37	12	33031964	33031964	+	Missense_Mutation	SNP	T	T	G			TCGA-CC-A7IE-01A-21D-A382-10	TCGA-CC-A7IE-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c1caf517-5052-48e3-ad80-8458b3d2ff5f	ab81329b-c119-4a5a-863c-5b50f48cee3f	g.chr12:33031964T>G	ENST00000070846.6	-	2	250	c.226A>C	c.(226-228)Aat>Cat	p.N76H	PKP2_ENST00000340811.4_Missense_Mutation_p.N76H	NM_004572.3	NP_004563.2	Q99959	PKP2_HUMAN	plakophilin 2	76			N -> S. {ECO:0000269|Ref.2}.		adherens junction maintenance (GO:0034334)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cardiac muscle cell action potential (GO:0086001)|cardiac muscle cell action potential involved in contraction (GO:0086002)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cell-cell signaling involved in cardiac conduction (GO:0086019)|desmosome assembly (GO:0002159)|gap junction assembly (GO:0016264)|heart development (GO:0007507)|intermediate filament bundle assembly (GO:0045110)|lipid homeostasis (GO:0055088)|maintenance of organ identity (GO:0048496)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|positive regulation of sodium ion transport (GO:0010765)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of tight junction assembly (GO:2000810)|single organismal cell-cell adhesion (GO:0016337)|ventricular cardiac muscle cell action potential (GO:0086005)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	adherens junction (GO:0005912)|cell junction (GO:0030054)|cell-cell junction (GO:0005911)|desmosome (GO:0030057)|integral component of membrane (GO:0016021)|intercalated disc (GO:0014704)|intermediate filament (GO:0005882)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	intermediate filament binding (GO:0019215)|ion channel binding (GO:0044325)|protein complex scaffold (GO:0032947)|protein kinase C binding (GO:0005080)|sodium channel regulator activity (GO:0017080)			NS(1)|breast(2)|endometrium(1)|kidney(9)|large_intestine(8)|lung(21)|ovary(1)|pancreas(2)|prostate(2)|skin(2)|urinary_tract(1)	50	Lung NSC(5;9.35e-07)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.239)					CGGTGAAGATTTCCTGCAATC	0.338																																					p.N76H		Atlas-SNP	.											.	PKP2	110	.	0			c.A226C						.						70.0	67.0	68.0					12																	33031964		2203	4300	6503	SO:0001583	missense	5318	exon2			GAAGATTTCCTGC	X97675	CCDS8731.1, CCDS31771.1	12p11	2014-09-17				ENSG00000057294		"""Armadillo repeat containing"""	9024	protein-coding gene	gene with protein product		602861				8922383	Standard	NM_001005242		Approved		uc001rlj.4	Q99959	OTTHUMG00000169500	ENST00000070846.6:c.226A>C	chr12.hg19:g.33031964T>G	ENSP00000070846:p.Asn76His	86.0	0.0		97.0	26.0	NM_004572	A0AV37|B8QFA1|B8QGS6|B8QGS7|D3DUW9|Q4VC01|Q99960	Missense_Mutation	SNP	ENST00000070846.6	hg19	CCDS8731.1	.	.	.	.	.	.	.	.	.	.	T	21.5	4.152253	0.78001	.	.	ENSG00000057294	ENST00000340811;ENST00000070846;ENST00000537278	D;T	0.81821	-1.54;-1.47	5.7	5.7	0.88788	.	0.305323	0.28296	N	0.015862	D	0.84188	0.5417	L	0.53249	1.67	0.30627	N	0.757873	D;D;D	0.61080	0.986;0.976;0.989	P;P;P	0.55667	0.748;0.564;0.781	D	0.84520	0.0627	10	0.62326	D	0.03	-16.7933	14.1893	0.65628	0.0:0.0:0.0:1.0	.	76;76;76	Q99959-2;A0AV37;Q99959	.;.;PKP2_HUMAN	H	76	ENSP00000342800:N76H;ENSP00000070846:N76H	ENSP00000070846:N76H	N	-	1	0	PKP2	32923231	1.000000	0.71417	0.995000	0.50966	0.992000	0.81027	3.129000	0.50500	2.164000	0.68074	0.528000	0.53228	AAT	.	.		0.338	PKP2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000404449.1	NM_004572	
ARID2	196528	hgsc.bcm.edu	37	12	46230676	46230676	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-A7IE-01A-21D-A382-10	TCGA-CC-A7IE-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c1caf517-5052-48e3-ad80-8458b3d2ff5f	ab81329b-c119-4a5a-863c-5b50f48cee3f	g.chr12:46230676A>T	ENST00000334344.6	+	8	1097	c.925A>T	c.(925-927)Aat>Tat	p.N309Y	ARID2_ENST00000422737.1_Missense_Mutation_p.N160Y|ARID2_ENST00000444670.1_5'Flank|ARID2_ENST00000479608.1_3'UTR	NM_152641.2	NP_689854.2	Q68CP9	ARID2_HUMAN	AT rich interactive domain 2 (ARID, RFX-like)	309					chromatin modification (GO:0016568)|nucleosome disassembly (GO:0006337)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.N309D(1)		NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(3)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(21)|liver(20)|lung(34)|ovary(7)|pancreas(1)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	116	Lung SC(27;0.192)|Renal(347;0.236)	Lung NSC(34;0.106)|all_lung(34;0.22)	OV - Ovarian serous cystadenocarcinoma(5;0.00691)	GBM - Glioblastoma multiforme(48;0.0153)		CTTGGCAGCTAATCGTACCTG	0.408			"""N, S, F"""		hepatocellular carcinoma																																p.N309Y		Atlas-SNP	.		Rec	yes		12	12q12	196528	AT rich interactive domain 2		E	ARID2,colon,carcinoma,0,1	ARID2	311	.	1	Substitution - Missense(1)	large_intestine(1)	c.A925T						.						188.0	176.0	180.0					12																	46230676		2203	4300	6503	SO:0001583	missense	196528	exon8			GCAGCTAATCGTA		CCDS31783.1	12q13.11	2013-02-07			ENSG00000189079	ENSG00000189079		"""-"""	18037	protein-coding gene	gene with protein product		609539					Standard	NM_152641		Approved	KIAA1557, DKFZp686G052, FLJ30619, BAF200	uc001ros.1	Q68CP9	OTTHUMG00000150487	ENST00000334344.6:c.925A>T	chr12.hg19:g.46230676A>T	ENSP00000335044:p.Asn309Tyr	160.0	0.0		166.0	62.0	NM_152641	Q15KG9|Q5EB51|Q645I3|Q6ZRY5|Q7Z3I5|Q86T28|Q96SJ6|Q9HCL5	Missense_Mutation	SNP	ENST00000334344.6	hg19	CCDS31783.1	.	.	.	.	.	.	.	.	.	.	A	19.95	3.921373	0.73213	.	.	ENSG00000189079	ENST00000334344;ENST00000422737	T;T	0.46451	0.87;0.87	5.87	5.87	0.94306	.	0.000000	0.85682	D	0.000000	T	0.64204	0.2577	M	0.65975	2.015	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.67209	-0.5728	10	0.87932	D	0	-13.958	16.2628	0.82557	1.0:0.0:0.0:0.0	.	309	Q68CP9	ARID2_HUMAN	Y	309;160	ENSP00000335044:N309Y;ENSP00000415650:N160Y	ENSP00000335044:N309Y	N	+	1	0	ARID2	44516943	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.265000	0.78442	2.233000	0.73108	0.482000	0.46254	AAT	.	.		0.408	ARID2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318380.2	XM_350875	
ARID2	196528	hgsc.bcm.edu	37	12	46254582	46254582	+	Splice_Site	SNP	A	A	G			TCGA-CC-A7IE-01A-21D-A382-10	TCGA-CC-A7IE-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c1caf517-5052-48e3-ad80-8458b3d2ff5f	ab81329b-c119-4a5a-863c-5b50f48cee3f	g.chr12:46254582A>G	ENST00000334344.6	+	16	4945		c.e16-1		ARID2_ENST00000422737.1_Splice_Site|ARID2_ENST00000444670.1_Splice_Site|ARID2_ENST00000479608.1_Splice_Site|ARID2_ENST00000457135.1_Splice_Site	NM_152641.2	NP_689854.2	Q68CP9	ARID2_HUMAN	AT rich interactive domain 2 (ARID, RFX-like)						chromatin modification (GO:0016568)|nucleosome disassembly (GO:0006337)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(3)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(21)|liver(20)|lung(34)|ovary(7)|pancreas(1)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	116	Lung SC(27;0.192)|Renal(347;0.236)	Lung NSC(34;0.106)|all_lung(34;0.22)	OV - Ovarian serous cystadenocarcinoma(5;0.00691)	GBM - Glioblastoma multiforme(48;0.0153)		TCTTTTTCACAGAACACTCCT	0.393			"""N, S, F"""		hepatocellular carcinoma																																.		Atlas-SNP	.		Rec	yes		12	12q12	196528	AT rich interactive domain 2		E	.	ARID2	311	.	0			c.4774-2A>G						.						60.0	56.0	57.0					12																	46254582		2203	4300	6503	SO:0001630	splice_region_variant	196528	exon16			TTTCACAGAACAC		CCDS31783.1	12q13.11	2013-02-07			ENSG00000189079	ENSG00000189079		"""-"""	18037	protein-coding gene	gene with protein product		609539					Standard	NM_152641		Approved	KIAA1557, DKFZp686G052, FLJ30619, BAF200	uc001ros.1	Q68CP9	OTTHUMG00000150487	ENST00000334344.6:c.4774-1A>G	chr12.hg19:g.46254582A>G		43.0	0.0		67.0	24.0	NM_152641	Q15KG9|Q5EB51|Q645I3|Q6ZRY5|Q7Z3I5|Q86T28|Q96SJ6|Q9HCL5	Splice_Site	SNP	ENST00000334344.6	hg19	CCDS31783.1	.	.	.	.	.	.	.	.	.	.	A	21.8	4.199597	0.79015	.	.	ENSG00000189079	ENST00000334344;ENST00000549153;ENST00000338636;ENST00000422737;ENST00000444670;ENST00000457135	.	.	.	5.86	5.86	0.93980	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.2644	0.82568	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ARID2	44540849	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.877000	0.87225	2.244000	0.73946	0.528000	0.53228	.	.	.		0.393	ARID2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318380.2	XM_350875	Intron
NEUROD4	58158	hgsc.bcm.edu	37	12	55420925	55420925	+	Missense_Mutation	SNP	A	A	C			TCGA-CC-A7IE-01A-21D-A382-10	TCGA-CC-A7IE-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c1caf517-5052-48e3-ad80-8458b3d2ff5f	ab81329b-c119-4a5a-863c-5b50f48cee3f	g.chr12:55420925A>C	ENST00000242994.3	+	2	1080	c.702A>C	c.(700-702)gaA>gaC	p.E234D		NM_021191.2	NP_067014.2	Q9HD90	NDF4_HUMAN	neuronal differentiation 4	234					amacrine cell differentiation (GO:0035881)|cell fate commitment (GO:0045165)|glial cell differentiation (GO:0010001)|neuroblast proliferation (GO:0007405)|neuron development (GO:0048666)|neuron migration (GO:0001764)|Notch signaling pathway (GO:0007219)|positive regulation of cell differentiation (GO:0045597)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(14)|ovary(3)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)	41						GTTTGGGAGAATCGTCCTTTG	0.517																																					p.E234D		Atlas-SNP	.											.	NEUROD4	87	.	0			c.A702C						.						100.0	100.0	100.0					12																	55420925		2203	4300	6503	SO:0001583	missense	58158	exon2			GGGAGAATCGTCC	AF203901	CCDS8886.1	12q13.13	2013-05-21	2012-02-22			ENSG00000123307		"""Basic helix-loop-helix proteins"""	13802	protein-coding gene	gene with protein product		611635	"""neurogenic differentiation 4"""				Standard	NM_021191		Approved	Atoh3, ATH-3, MATH-3, bHLHa4	uc001sgp.4	Q9HD90		ENST00000242994.3:c.702A>C	chr12.hg19:g.55420925A>C	ENSP00000242994:p.Glu234Asp	76.0	0.0		94.0	24.0	NM_021191	B2RAC9	Missense_Mutation	SNP	ENST00000242994.3	hg19	CCDS8886.1	.	.	.	.	.	.	.	.	.	.	A	12.97	2.096016	0.36952	.	.	ENSG00000123307	ENST00000242994	T	0.65549	-0.16	5.71	-3.01	0.05463	Neurogenic differentiation factor, domain of unknown function (1);	0.525209	0.21686	N	0.070655	T	0.38719	0.1051	N	0.16602	0.42	0.25139	N	0.990519	B	0.06786	0.001	B	0.19666	0.026	T	0.22382	-1.0218	10	0.29301	T	0.29	1.2164	9.4234	0.38565	0.1991:0.1942:0.6066:0.0	.	234	Q9HD90	NDF4_HUMAN	D	234	ENSP00000242994:E234D	ENSP00000242994:E234D	E	+	3	2	NEUROD4	53707192	0.001000	0.12720	0.954000	0.39281	0.975000	0.68041	-1.298000	0.02756	-0.341000	0.08376	0.533000	0.62120	GAA	.	.		0.517	NEUROD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406104.1		
MGAT4C	25834	hgsc.bcm.edu	37	12	86373990	86373990	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A7IE-01A-21D-A382-10	TCGA-CC-A7IE-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c1caf517-5052-48e3-ad80-8458b3d2ff5f	ab81329b-c119-4a5a-863c-5b50f48cee3f	g.chr12:86373990T>C	ENST00000604798.1	-	8	1718	c.514A>G	c.(514-516)Ata>Gta	p.I172V	MGAT4C_ENST00000548651.1_Missense_Mutation_p.I172V|MGAT4C_ENST00000332156.1_Missense_Mutation_p.I172V|MGAT4C_ENST00000549405.2_Missense_Mutation_p.I172V|MGAT4C_ENST00000393205.2_Missense_Mutation_p.I201V|MGAT4C_ENST00000552808.2_Missense_Mutation_p.I172V|MGAT4C_ENST00000552435.2_Intron			Q9UBM8	MGT4C_HUMAN	MGAT4 family, member C	172					cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	alpha-1,3-mannosylglycoprotein 4-beta-N-acetylglucosaminyltransferase activity (GO:0008454)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(9)|lung(17)|ovary(4)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	41						GGAGCATGTATAACCATTAAT	0.393																																					p.I172V		Atlas-SNP	.											.	MGAT4C	110	.	0			c.A514G						.						106.0	105.0	105.0					12																	86373990		2203	4300	6503	SO:0001583	missense	25834	exon7			CATGTATAACCAT		CCDS9030.1	12q21	2014-07-14	2014-07-14		ENSG00000182050	ENSG00000182050		"""Mannosyl-glycoprotein beta N-acetylglucosaminyltransferases"""	30871	protein-coding gene	gene with protein product		607385	"""mannosyl (alpha-1,3-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase, isozyme C (putative)"""			10570912	Standard	NM_013244		Approved	HGNT-IV-H	uc001tal.4	Q9UBM8	OTTHUMG00000169846	ENST00000604798.1:c.514A>G	chr12.hg19:g.86373990T>C	ENSP00000474896:p.Ile172Val	102.0	0.0		153.0	41.0	NM_013244	B4DRH2|Q4G199|Q9UIU5	Missense_Mutation	SNP	ENST00000604798.1	hg19	CCDS9030.1	.	.	.	.	.	.	.	.	.	.	T	11.02	1.515840	0.27123	.	.	ENSG00000182050	ENST00000332156;ENST00000393205;ENST00000549405;ENST00000550460;ENST00000552808;ENST00000548651;ENST00000547225	T;T;T;T;T;T	0.50277	0.75;0.75;0.75;0.75;0.75;0.75	5.58	5.58	0.84498	.	0.000000	0.85682	D	0.000000	T	0.48314	0.1493	L	0.41961	1.31	0.58432	D	0.999995	P;P	0.43701	0.815;0.815	P;P	0.46237	0.508;0.508	T	0.39354	-0.9618	10	0.32370	T	0.25	-0.1803	15.7677	0.78141	0.0:0.0:0.0:1.0	.	201;172	B4DRH2;Q9UBM8	.;MGT4C_HUMAN	V	172;201;172;172;172;172;172	ENSP00000331664:I172V;ENSP00000376900:I201V;ENSP00000449022:I172V;ENSP00000446647:I172V;ENSP00000447253:I172V;ENSP00000449172:I172V	ENSP00000331664:I172V	I	-	1	0	MGAT4C	84898121	1.000000	0.71417	0.999000	0.59377	0.006000	0.05464	8.036000	0.88901	2.112000	0.64535	0.533000	0.62120	ATA	.	.		0.393	MGAT4C-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406212.2	NM_013244	
TMCC3	57458	hgsc.bcm.edu	37	12	94976245	94976245	+	Missense_Mutation	SNP	G	G	C			TCGA-CC-A7IE-01A-21D-A382-10	TCGA-CC-A7IE-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c1caf517-5052-48e3-ad80-8458b3d2ff5f	ab81329b-c119-4a5a-863c-5b50f48cee3f	g.chr12:94976245G>C	ENST00000261226.4	-	2	279	c.148C>G	c.(148-150)Ctc>Gtc	p.L50V	TMCC3_ENST00000551457.1_Missense_Mutation_p.L19V	NM_020698.2	NP_065749	Q9ULS5	TMCC3_HUMAN	transmembrane and coiled-coil domain family 3	50						integral component of membrane (GO:0016021)				NS(1)|breast(3)|endometrium(2)|kidney(2)|large_intestine(8)|lung(10)|ovary(1)|skin(1)|urinary_tract(1)	29						TCAAAGTTGAGGTTGGTGTCT	0.463																																					p.L50V		Atlas-SNP	.											.	TMCC3	63	.	0			c.C148G						.						112.0	110.0	111.0					12																	94976245		2203	4300	6503	SO:0001583	missense	57458	exon2			AGTTGAGGTTGGT	AB032971	CCDS31877.1, CCDS73506.1	12q22	2005-01-21	2005-07-13			ENSG00000057704		"""Transmembrane and coiled-coil domain containing"""	29199	protein-coding gene	gene with protein product			"""transmembrane and coiled-coil domains 3"""			10574461	Standard	XM_005269039		Approved	KIAA1145	uc001tdj.2	Q9ULS5	OTTHUMG00000170225	ENST00000261226.4:c.148C>G	chr12.hg19:g.94976245G>C	ENSP00000261226:p.Leu50Val	80.0	0.0		84.0	19.0	NM_020698	Q8IWB2	Missense_Mutation	SNP	ENST00000261226.4	hg19	CCDS31877.1	.	.	.	.	.	.	.	.	.	.	G	16.45	3.126475	0.56721	.	.	ENSG00000057704	ENST00000261226;ENST00000551457;ENST00000548918	T;T	0.49720	1.3;0.77	5.91	5.91	0.95273	.	0.000000	0.85682	D	0.000000	T	0.56775	0.2008	L	0.27053	0.805	0.58432	D	0.999992	D	0.69078	0.997	D	0.72625	0.978	T	0.44892	-0.9298	10	0.18276	T	0.48	-32.3133	20.3522	0.98815	0.0:0.0:1.0:0.0	.	50	Q9ULS5	TMCC3_HUMAN	V	50;19;19	ENSP00000261226:L50V;ENSP00000449888:L19V	ENSP00000261226:L50V	L	-	1	0	TMCC3	93500376	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	3.036000	0.49767	2.821000	0.97095	0.485000	0.47835	CTC	.	.		0.463	TMCC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408113.1	NM_020698	
SRRM4	84530	hgsc.bcm.edu	37	12	119594393	119594393	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A7IE-01A-21D-A382-10	TCGA-CC-A7IE-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c1caf517-5052-48e3-ad80-8458b3d2ff5f	ab81329b-c119-4a5a-863c-5b50f48cee3f	g.chr12:119594393C>A	ENST00000267260.4	+	13	2014	c.1626C>A	c.(1624-1626)agC>agA	p.S542R		NM_194286.3	NP_919262.2	A7MD48	SRRM4_HUMAN	serine/arginine repetitive matrix 4	542	Arg-rich.|Ser-rich.				cell differentiation (GO:0030154)|mRNA processing (GO:0006397)|nervous system development (GO:0007399)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)|sensory perception of sound (GO:0007605)	nucleus (GO:0005634)	mRNA binding (GO:0003729)			breast(2)|central_nervous_system(2)|endometrium(5)|kidney(1)|large_intestine(2)|lung(8)|ovary(3)|upper_aerodigestive_tract(1)	24						GCAGCAGTAGCCGCTCGGCCA	0.697																																					p.S542R		Atlas-SNP	.											.	SRRM4	131	.	0			c.C1626A						.						10.0	15.0	13.0					12																	119594393		1881	3901	5782	SO:0001583	missense	84530	exon13			CAGTAGCCGCTCG	AB058756	CCDS44994.1	12q24.23	2009-09-22	2009-09-21	2009-09-21	ENSG00000139767	ENSG00000139767			29389	protein-coding gene	gene with protein product	"""neural-specific SR-related protein of 100 kDa"""	613103	"""KIAA1853"""	KIAA1853		19737518	Standard	NM_194286		Approved	nSR100	uc001txa.2	A7MD48	OTTHUMG00000168928	ENST00000267260.4:c.1626C>A	chr12.hg19:g.119594393C>A	ENSP00000267260:p.Ser542Arg	140.0	0.0		167.0	54.0	NM_194286	A8K5P6|B2RZH7|Q7Z5F0|Q96JH4	Missense_Mutation	SNP	ENST00000267260.4	hg19	CCDS44994.1	.	.	.	.	.	.	.	.	.	.	C	16.54	3.152019	0.57151	.	.	ENSG00000139767	ENST00000267260	T	0.39406	1.08	5.42	4.5	0.54988	.	0.152448	0.41097	D	0.000946	T	0.36717	0.0977	L	0.50333	1.59	0.38152	D	0.938772	B	0.11235	0.004	B	0.08055	0.003	T	0.22730	-1.0208	9	.	.	.	-7.1558	13.8905	0.63736	0.1517:0.8483:0.0:0.0	.	542	A7MD48	SRRM4_HUMAN	R	542	ENSP00000267260:S542R	.	S	+	3	2	SRRM4	118078776	0.804000	0.28969	1.000000	0.80357	0.992000	0.81027	0.000000	0.12993	2.555000	0.86185	0.650000	0.86243	AGC	.	.		0.697	SRRM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401640.2	NM_194286	
ZMYM5	9205	hgsc.bcm.edu	37	13	20399130	20399130	+	Silent	SNP	T	T	C			TCGA-CC-A7IE-01A-21D-A382-10	TCGA-CC-A7IE-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c1caf517-5052-48e3-ad80-8458b3d2ff5f	ab81329b-c119-4a5a-863c-5b50f48cee3f	g.chr13:20399130T>C	ENST00000337963.4	-	8	1761	c.1497A>G	c.(1495-1497)acA>acG	p.T499T		NM_001142684.1	NP_001136156.1	Q9UJ78	ZMYM5_HUMAN	zinc finger, MYM-type 5	499						nucleus (GO:0005634)	zinc ion binding (GO:0008270)			kidney(1)|large_intestine(5)|lung(9)	15		all_cancers(29;2.96e-22)|all_epithelial(30;3.76e-20)|all_lung(29;4.38e-20)|Lung NSC(5;5.8e-17)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;1.61e-05)|Epithelial(112;4.89e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00171)|Lung(94;0.00942)|LUSC - Lung squamous cell carcinoma(192;0.0431)		gctcttgaaatgtatcagcta	0.418																																					p.T499T		Atlas-SNP	.											.	ZMYM5	73	.	0			c.A1497G						.						70.0	63.0	65.0					13																	20399130		1568	3582	5150	SO:0001819	synonymous_variant	9205	exon8			TTGAAATGTATCA	AF161535	CCDS31942.1, CCDS31943.1	13q12	2013-01-08	2005-09-12	2005-09-12	ENSG00000132950	ENSG00000132950		"""Zinc fingers, MYM type"""	13029	protein-coding gene	gene with protein product			"""zinc finger protein 237"""	ZNF237			Standard	NM_001039650		Approved	ZNF198L1, MYM	uc010tcn.1	Q9UJ78	OTTHUMG00000016504	ENST00000337963.4:c.1497A>G	chr13.hg19:g.20399130T>C		171.0	0.0		208.0	51.0	NM_001142684	B2R6V1|Q5T6E1|Q5T6E2|Q5T6E4|Q96IY6|Q9NZY5|Q9UBW0|Q9UJ77	Silent	SNP	ENST00000337963.4	hg19																																																																																				.	.		0.418	ZMYM5-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_014242	
FREM2	341640	hgsc.bcm.edu	37	13	39266309	39266309	+	Missense_Mutation	SNP	G	G	C			TCGA-CC-A7IE-01A-21D-A382-10	TCGA-CC-A7IE-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c1caf517-5052-48e3-ad80-8458b3d2ff5f	ab81329b-c119-4a5a-863c-5b50f48cee3f	g.chr13:39266309G>C	ENST00000280481.7	+	1	5044	c.4828G>C	c.(4828-4830)Gag>Cag	p.E1610Q		NM_207361.4	NP_997244.3	Q5SZK8	FREM2_HUMAN	FRAS1 related extracellular matrix protein 2	1610					cell communication (GO:0007154)|homophilic cell adhesion (GO:0007156)|inner ear development (GO:0048839)|morphogenesis of an epithelium (GO:0002009)	basement membrane (GO:0005604)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(35)|lung(39)|ovary(9)|pancreas(2)|prostate(12)|skin(11)|upper_aerodigestive_tract(7)|urinary_tract(2)	148		Lung NSC(96;1.04e-07)|Prostate(109;0.00384)|Breast(139;0.00396)|Lung SC(185;0.0565)|Hepatocellular(188;0.114)		all cancers(112;3.32e-07)|Epithelial(112;1.66e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00154)|BRCA - Breast invasive adenocarcinoma(63;0.00631)|GBM - Glioblastoma multiforme(144;0.0312)		TGATGGCACTGAGTCAAGTGA	0.413																																					p.E1610Q		Atlas-SNP	.											.	FREM2	385	.	0			c.G4828C						.						124.0	116.0	119.0					13																	39266309		2203	4300	6503	SO:0001583	missense	341640	exon1			GGCACTGAGTCAA	BX538150	CCDS31960.1	13q13.3	2004-12-15			ENSG00000150893	ENSG00000150893			25396	protein-coding gene	gene with protein product		608945				15345741	Standard	NM_207361		Approved	DKFZp686J0811	uc001uwv.3	Q5SZK8	OTTHUMG00000016759	ENST00000280481.7:c.4828G>C	chr13.hg19:g.39266309G>C	ENSP00000280481:p.Glu1610Gln	162.0	0.0		166.0	48.0	NM_207361	Q4QQG1|Q5H9N8|Q5T6Q1|Q6N057|Q6ZSB4|Q7Z305|Q7Z341	Missense_Mutation	SNP	ENST00000280481.7	hg19	CCDS31960.1	.	.	.	.	.	.	.	.	.	.	G	15.39	2.819014	0.50633	.	.	ENSG00000150893	ENST00000280481	T	0.47177	0.85	6.08	5.24	0.73138	.	0.094077	0.64402	D	0.000001	T	0.63379	0.2506	M	0.92649	3.33	0.80722	D	1	P	0.40066	0.701	B	0.42959	0.403	T	0.69982	-0.4997	10	0.39692	T	0.17	.	15.6983	0.77517	0.0653:0.0:0.9347:0.0	.	1610	Q5SZK8	FREM2_HUMAN	Q	1610	ENSP00000280481:E1610Q	ENSP00000280481:E1610Q	E	+	1	0	FREM2	38164309	1.000000	0.71417	0.882000	0.34594	0.531000	0.34715	6.796000	0.75145	1.599000	0.50093	-0.126000	0.14955	GAG	.	.		0.413	FREM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044599.2	NM_207361	
FNDC3A	22862	hgsc.bcm.edu	37	13	49742771	49742771	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A7IE-01A-21D-A382-10	TCGA-CC-A7IE-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c1caf517-5052-48e3-ad80-8458b3d2ff5f	ab81329b-c119-4a5a-863c-5b50f48cee3f	g.chr13:49742771A>G	ENST00000492622.2	+	10	1365	c.1060A>G	c.(1060-1062)Ata>Gta	p.I354V	FNDC3A_ENST00000541916.1_Missense_Mutation_p.I354V|FNDC3A_ENST00000398316.3_Missense_Mutation_p.I298V	NM_001079673.1	NP_001073141.1	Q9Y2H6	FND3A_HUMAN	fibronectin type III domain containing 3A	354	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				fertilization (GO:0009566)|Sertoli cell development (GO:0060009)|single organismal cell-cell adhesion (GO:0016337)|spermatid development (GO:0007286)	acrosomal vesicle (GO:0001669)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|vesicle membrane (GO:0012506)	poly(A) RNA binding (GO:0044822)			endometrium(5)|kidney(3)|large_intestine(10)|lung(15)|prostate(5)|skin(2)|urinary_tract(1)	41		all_lung(13;7.44e-08)|Lung NSC(96;4.08e-06)|Breast(56;0.000111)|Prostate(109;0.00174)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|Lung SC(185;0.187)|all_neural(104;0.19)	KIRC - Kidney renal clear cell carcinoma(9;0.206)	GBM - Glioblastoma multiforme(99;2.94e-09)		ATATAATTCTATAAAGGGAAC	0.368																																					p.I354V		Atlas-SNP	.											.	FNDC3A	93	.	0			c.A1060G						.						101.0	105.0	104.0					13																	49742771		2203	4300	6503	SO:0001583	missense	22862	exon10			AATTCTATAAAGG	AB023187	CCDS9413.2, CCDS41886.1	13q14.12	2013-02-11	2005-01-20	2005-01-22	ENSG00000102531	ENSG00000102531		"""Fibronectin type III domain containing"""	20296	protein-coding gene	gene with protein product		615794	"""fibronectin type III domain containing 3"""	FNDC3			Standard	NM_001079673		Approved	bA203I16.5, KIAA0970	uc001vcm.3	Q9Y2H6	OTTHUMG00000016911	ENST00000492622.2:c.1060A>G	chr13.hg19:g.49742771A>G	ENSP00000417257:p.Ile354Val	144.0	0.0		195.0	63.0	NM_001079673	B4DYG1|Q5HYC9|Q5JVF8|Q5JVF9|Q6EVH3|Q6EVH4|Q6N020|Q6P9D5|Q6ZME4|Q9H1W1	Missense_Mutation	SNP	ENST00000492622.2	hg19	CCDS41886.1	.	.	.	.	.	.	.	.	.	.	A	1.681	-0.506548	0.04231	.	.	ENSG00000102531	ENST00000492622;ENST00000337156;ENST00000541916;ENST00000398316	T;T;T	0.56611	0.45;0.45;0.45	5.54	1.77	0.24775	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.314514	0.28360	N	0.015622	T	0.22166	0.0534	N	0.03967	-0.31	0.31818	N	0.626397	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.001;0.001;0.001	T	0.30031	-0.9992	10	0.07175	T	0.84	-2.1323	8.495	0.33123	0.5921:0.0:0.4079:0.0	.	298;354;354	Q9Y2H6-2;G5E9X3;Q9Y2H6	.;.;FND3A_HUMAN	V	354;290;354;298	ENSP00000417257:I354V;ENSP00000441831:I354V;ENSP00000381362:I298V	ENSP00000338579:I290V	I	+	1	0	FNDC3A	48640772	0.955000	0.32602	0.993000	0.49108	0.995000	0.86356	0.715000	0.25822	0.143000	0.18926	0.482000	0.46254	ATA	.	.		0.368	FNDC3A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354845.2	NM_014923	
MYCBP2	23077	hgsc.bcm.edu	37	13	77642923	77642923	+	Missense_Mutation	SNP	C	C	G			TCGA-CC-A7IE-01A-21D-A382-10	TCGA-CC-A7IE-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c1caf517-5052-48e3-ad80-8458b3d2ff5f	ab81329b-c119-4a5a-863c-5b50f48cee3f	g.chr13:77642923C>G	ENST00000544440.2	-	70	11851	c.11834G>C	c.(11833-11835)aGa>aCa	p.R3945T	MYCBP2_ENST00000357337.6_Missense_Mutation_p.R3945T|MYCBP2_ENST00000407578.2_Missense_Mutation_p.R3983T					MYC binding protein 2, E3 ubiquitin protein ligase											NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(51)|ovary(5)|pancreas(2)|prostate(5)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	118		Breast(118;0.212)|Acute lymphoblastic leukemia(28;0.22)		GBM - Glioblastoma multiforme(99;0.109)		TTCACGGACTCTGGTAGCTTC	0.398																																					p.R3983T		Atlas-SNP	.											.	MYCBP2	1029	.	0			c.G11948C						.						203.0	169.0	180.0					13																	77642923		2203	4300	6503	SO:0001583	missense	23077	exon70			CGGACTCTGGTAG	AB020723		13q22	2012-02-23	2012-02-23		ENSG00000005810	ENSG00000005810			23386	protein-coding gene	gene with protein product		610392	"""MYC binding protein 2"""			9689053, 15057823	Standard	NM_015057		Approved	PAM, KIAA0916, FLJ10106	uc021rks.1	O75592	OTTHUMG00000017105	ENST00000544440.2:c.11834G>C	chr13.hg19:g.77642923C>G	ENSP00000444596:p.Arg3945Thr	76.0	0.0		106.0	39.0	NM_015057		Missense_Mutation	SNP	ENST00000544440.2	hg19		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	18.96|18.96	3.734610|3.734610	0.69189|0.69189	.|.	.|.	ENSG00000005810|ENSG00000005810	ENST00000429715|ENST00000357337;ENST00000407578;ENST00000544440	.|T;T;T	.|0.32023	.|1.48;1.47;1.48	5.67|5.67	5.67|5.67	0.87782|0.87782	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.38825|0.38825	0.1055|0.1055	M|M	0.65498|0.65498	2.005|2.005	0.58432|0.58432	D|D	0.999998|0.999998	.|P	.|0.47409	.|0.895	.|B	.|0.41236	.|0.351	T|T	0.41910|0.41910	-0.9482|-0.9482	5|10	.|0.87932	.|D	.|0	.|.	19.7962|19.7962	0.96484|0.96484	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|3945	.|O75592	.|MYCB2_HUMAN	H|T	365|3945;3983;3945	.|ENSP00000349892:R3945T;ENSP00000384288:R3983T;ENSP00000444596:R3945T	.|ENSP00000349892:R3945T	Q|R	-|-	3|2	2|0	MYCBP2|MYCBP2	76540924|76540924	1.000000|1.000000	0.71417|0.71417	0.997000|0.997000	0.53966|0.53966	0.969000|0.969000	0.65631|0.65631	7.442000|7.442000	0.80503|0.80503	2.675000|2.675000	0.91044|0.91044	0.650000|0.650000	0.86243|0.86243	CAG|AGA	.	.		0.398	MYCBP2-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000045326.1	NM_015057	
MYCBP2	23077	hgsc.bcm.edu	37	13	77743838	77743838	+	Missense_Mutation	SNP	G	G	C			TCGA-CC-A7IE-01A-21D-A382-10	TCGA-CC-A7IE-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c1caf517-5052-48e3-ad80-8458b3d2ff5f	ab81329b-c119-4a5a-863c-5b50f48cee3f	g.chr13:77743838G>C	ENST00000544440.2	-	39	5709	c.5692C>G	c.(5692-5694)Cca>Gca	p.P1898A	MYCBP2_ENST00000360084.5_5'UTR|MYCBP2_ENST00000357337.6_Missense_Mutation_p.P1898A|MYCBP2_ENST00000407578.2_Missense_Mutation_p.P1936A					MYC binding protein 2, E3 ubiquitin protein ligase											NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(51)|ovary(5)|pancreas(2)|prostate(5)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	118		Breast(118;0.212)|Acute lymphoblastic leukemia(28;0.22)		GBM - Glioblastoma multiforme(99;0.109)		AGCAGTTCTGGAATGTCATCA	0.388																																					p.P1936A		Atlas-SNP	.											.	MYCBP2	1029	.	0			c.C5806G						.						66.0	68.0	68.0					13																	77743838		2203	4300	6503	SO:0001583	missense	23077	exon39			GTTCTGGAATGTC	AB020723		13q22	2012-02-23	2012-02-23		ENSG00000005810	ENSG00000005810			23386	protein-coding gene	gene with protein product		610392	"""MYC binding protein 2"""			9689053, 15057823	Standard	NM_015057		Approved	PAM, KIAA0916, FLJ10106	uc021rks.1	O75592	OTTHUMG00000017105	ENST00000544440.2:c.5692C>G	chr13.hg19:g.77743838G>C	ENSP00000444596:p.Pro1898Ala	656.0	0.0		724.0	230.0	NM_015057		Missense_Mutation	SNP	ENST00000544440.2	hg19		.	.	.	.	.	.	.	.	.	.	G	15.31	2.794579	0.50102	.	.	ENSG00000005810	ENST00000357337;ENST00000407578;ENST00000544440	T;T;T	0.27256	1.68;1.68;1.68	4.95	4.95	0.65309	.	0.000000	0.85682	D	0.000000	T	0.30070	0.0753	N	0.14661	0.345	0.80722	D	1	D	0.63880	0.993	D	0.68192	0.956	T	0.02464	-1.1155	10	0.06099	T	0.92	.	18.5628	0.91107	0.0:0.0:1.0:0.0	.	1898	O75592	MYCB2_HUMAN	A	1898;1936;1898	ENSP00000349892:P1898A;ENSP00000384288:P1936A;ENSP00000444596:P1898A	ENSP00000349892:P1898A	P	-	1	0	MYCBP2	76641839	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	9.722000	0.98770	2.448000	0.82819	0.650000	0.86243	CCA	.	.		0.388	MYCBP2-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000045326.1	NM_015057	
SLC22A17	51310	hgsc.bcm.edu	37	14	23815904	23815904	+	Missense_Mutation	SNP	G	G	C			TCGA-CC-A7IE-01A-21D-A382-10	TCGA-CC-A7IE-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c1caf517-5052-48e3-ad80-8458b3d2ff5f	ab81329b-c119-4a5a-863c-5b50f48cee3f	g.chr14:23815904G>C	ENST00000206544.8	-	9	1906	c.1570C>G	c.(1570-1572)Cgc>Ggc	p.R524G	SLC22A17_ENST00000397260.3_Missense_Mutation_p.R395G|SLC22A17_ENST00000474057.1_5'UTR|SLC22A17_ENST00000354772.3_Missense_Mutation_p.R506G|SLC22A17_ENST00000397267.1_Missense_Mutation_p.R524G	NM_020372.2	NP_065105.2	Q8WUG5	S22AH_HUMAN	solute carrier family 22, member 17	524					ion transport (GO:0006811)|iron ion homeostasis (GO:0055072)|siderophore transport (GO:0015891)	integral component of organelle membrane (GO:0031301)|integral component of plasma membrane (GO:0005887)|vacuole (GO:0005773)	transmembrane signaling receptor activity (GO:0004888)|transmembrane transporter activity (GO:0022857)			breast(1)|cervix(1)|endometrium(1)|large_intestine(3)|lung(3)|ovary(1)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	15	all_cancers(95;7.12e-06)			GBM - Glioblastoma multiforme(265;0.00643)		TGGTCACAGCGGGTAGGGGGT	0.692																																					p.R524G		Atlas-SNP	.											.	SLC22A17	32	.	0			c.C1570G						.						5.0	7.0	6.0					14																	23815904		2076	4104	6180	SO:0001583	missense	51310	exon9			CACAGCGGGTAGG	AJ243653	CCDS9593.1, CCDS9594.2	14q11.2	2013-05-22	2008-01-11		ENSG00000092096	ENSG00000092096		"""Solute carriers"""	23095	protein-coding gene	gene with protein product	"""neutrophil gelatinase-associated lipocalin receptor"""	611461				16377569	Standard	NM_016609		Approved	BOCT, BOIT, NGALR	uc001wjl.3	Q8WUG5	OTTHUMG00000028740	ENST00000206544.8:c.1570C>G	chr14.hg19:g.23815904G>C	ENSP00000206544:p.Arg524Gly	63.0	0.0		42.0	23.0	NM_020372	A4UA13|A8MUT0|Q2TAB0|Q5BKY8|Q86U04|Q9H1D3|Q9NQD5	Missense_Mutation	SNP	ENST00000206544.8	hg19	CCDS9593.1	.	.	.	.	.	.	.	.	.	.	G	14.38	2.516897	0.44763	.	.	ENSG00000092096	ENST00000354772;ENST00000397260;ENST00000206544;ENST00000397267	T;T;T;T	0.71817	-0.41;-0.6;-0.36;-0.36	5.38	5.38	0.77491	.	0.000000	0.85682	D	0.000000	T	0.65450	0.2692	N	0.08118	0	0.52501	D	0.999954	P;D	0.60575	0.946;0.988	P;P	0.56398	0.597;0.797	T	0.69510	-0.5126	10	0.44086	T	0.13	-17.4291	16.1662	0.81757	0.0:0.0:1.0:0.0	.	506;524	Q8WUG5-2;Q8WUG5	.;S22AH_HUMAN	G	506;395;524;524	ENSP00000346824:R506G;ENSP00000380430:R395G;ENSP00000206544:R524G;ENSP00000380437:R524G	ENSP00000206544:R524G	R	-	1	0	SLC22A17	22885744	1.000000	0.71417	1.000000	0.80357	0.936000	0.57629	4.934000	0.63491	2.804000	0.96469	0.462000	0.41574	CGC	.	.		0.692	SLC22A17-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000157223.3	NM_020372	
MYH7	4625	hgsc.bcm.edu	37	14	23884288	23884288	+	Silent	SNP	C	C	T			TCGA-CC-A7IE-01A-21D-A382-10	TCGA-CC-A7IE-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c1caf517-5052-48e3-ad80-8458b3d2ff5f	ab81329b-c119-4a5a-863c-5b50f48cee3f	g.chr14:23884288C>T	ENST00000355349.3	-	37	5637	c.5475G>A	c.(5473-5475)gaG>gaA	p.E1825E	CTD-2201G16.1_ENST00000557368.1_RNA|MIR208B_ENST00000401172.1_RNA	NM_000257.2	NP_000248.2	P12883	MYH7_HUMAN	myosin, heavy chain 7, cardiac muscle, beta	1825					adult heart development (GO:0007512)|ATP catabolic process (GO:0006200)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|regulation of heart rate (GO:0002027)|regulation of the force of heart contraction (GO:0002026)|striated muscle contraction (GO:0006941)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|muscle myosin complex (GO:0005859)|myosin complex (GO:0016459)|myosin filament (GO:0032982)|nucleus (GO:0005634)|sarcomere (GO:0030017)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)			NS(3)|breast(4)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(19)|lung(57)|ovary(5)|prostate(9)|skin(5)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	137	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00725)		CGGCCTCCAGCTCATTCTCCA	0.652																																					p.E1825E		Atlas-SNP	.											.	MYH7	349	.	0			c.G5475A						.						104.0	101.0	102.0					14																	23884288		2203	4300	6503	SO:0001819	synonymous_variant	4625	exon37			CTCCAGCTCATTC	M58018	CCDS9601.1	14q11.2-q13	2014-09-17	2006-09-29		ENSG00000092054	ENSG00000092054		"""Myosins / Myosin superfamily : Class II"""	7577	protein-coding gene	gene with protein product		160760	"""myopathy, distal 1"", ""myosin, heavy polypeptide 7, cardiac muscle, beta"""	CMH1, MPD1		2494889, 8483915, 15322983	Standard	XM_005267696		Approved	CMD1S	uc001wjx.3	P12883	OTTHUMG00000028755	ENST00000355349.3:c.5475G>A	chr14.hg19:g.23884288C>T		38.0	0.0		39.0	14.0	NM_000257	A2TDB6|B6D424|Q14836|Q14837|Q14904|Q16579|Q2M1Y6|Q92679|Q9H1D5|Q9UDA2|Q9UMM8	Silent	SNP	ENST00000355349.3	hg19	CCDS9601.1																																																																																			.	.		0.652	MYH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071798.3	NM_000257	
PCK2	5106	hgsc.bcm.edu	37	14	24566238	24566238	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-A7IE-01A-21D-A382-10	TCGA-CC-A7IE-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c1caf517-5052-48e3-ad80-8458b3d2ff5f	ab81329b-c119-4a5a-863c-5b50f48cee3f	g.chr14:24566238A>T	ENST00000216780.4	+	2	435	c.167A>T	c.(166-168)cAa>cTa	p.Q56L	NRL_ENST00000396997.1_5'Flank|PCK2_ENST00000560657.1_3'UTR|PCK2_ENST00000561286.1_Intron|PCK2_ENST00000396973.4_Missense_Mutation_p.Q56L|PCK2_ENST00000545054.2_5'UTR|PCK2_ENST00000558096.1_5'UTR|NRL_ENST00000561028.1_Intron|PCK2_ENST00000559250.1_Missense_Mutation_p.Q68L	NM_004563.2	NP_004554.2	Q16822	PCKGM_HUMAN	phosphoenolpyruvate carboxykinase 2 (mitochondrial)	56					carbohydrate metabolic process (GO:0005975)|cellular response to glucose stimulus (GO:0071333)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|NADH oxidation (GO:0006116)|oxaloacetate metabolic process (GO:0006107)|positive regulation of insulin secretion (GO:0032024)|pyruvate metabolic process (GO:0006090)|response to glucocorticoid (GO:0051384)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	GTP binding (GO:0005525)|metal ion binding (GO:0046872)|phosphoenolpyruvate carboxykinase (GTP) activity (GO:0004613)|phosphoenolpyruvate carboxykinase activity (GO:0004611)			breast(2)|endometrium(2)|kidney(3)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)|skin(1)	18				GBM - Glioblastoma multiforme(265;0.0184)		CGCCTGTGCCAACCAGAGGGC	0.572																																					p.Q56L		Atlas-SNP	.											.	PCK2	66	.	0			c.A167T						.						90.0	82.0	85.0					14																	24566238		2203	4300	6503	SO:0001583	missense	5106	exon2			TGTGCCAACCAGA	AK129934	CCDS9609.1, CCDS41928.1	14q12	2006-06-09			ENSG00000100889	ENSG00000100889	4.1.1.32		8725	protein-coding gene	gene with protein product		614095				8645161, 9657976	Standard	XM_005267726		Approved	PEPCK, PEPCK2	uc001wlt.3	Q16822	OTTHUMG00000028791	ENST00000216780.4:c.167A>T	chr14.hg19:g.24566238A>T	ENSP00000216780:p.Gln56Leu	75.0	0.0		81.0	14.0	NM_001018073	O43253|Q86U01|Q9BV62	Missense_Mutation	SNP	ENST00000216780.4	hg19	CCDS9609.1	.	.	.	.	.	.	.	.	.	.	A	27.9	4.876787	0.91664	.	.	ENSG00000100889	ENST00000216780;ENST00000396973	T;T	0.04551	3.6;3.6	5.52	5.52	0.82312	Phosphoenolpyruvate carboxykinase, N-terminal (2);	0.150694	0.64402	D	0.000014	T	0.13030	0.0316	M	0.89478	3.035	0.80722	D	1	B;P;B	0.38767	0.038;0.646;0.013	B;B;B	0.39152	0.061;0.292;0.031	T	0.00715	-1.1597	10	0.62326	D	0.03	-15.7985	13.8779	0.63665	1.0:0.0:0.0:0.0	.	56;56;56	Q16822;Q16822-2;Q6IB91	PCKGM_HUMAN;.;.	L	56	ENSP00000216780:Q56L;ENSP00000380171:Q56L	ENSP00000216780:Q56L	Q	+	2	0	PCK2	23636078	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.909000	0.75735	2.216000	0.71823	0.528000	0.53228	CAA	.	.		0.572	PCK2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071900.3	NM_001018073	
PRPF39	55015	hgsc.bcm.edu	37	14	45584061	45584061	+	Splice_Site	SNP	A	A	G			TCGA-CC-A7IE-01A-21D-A382-10	TCGA-CC-A7IE-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c1caf517-5052-48e3-ad80-8458b3d2ff5f	ab81329b-c119-4a5a-863c-5b50f48cee3f	g.chr14:45584061A>G	ENST00000355765.6	+	14	2125	c.1955A>G	c.(1954-1956)tAc>tGc	p.Y652C		NM_017922.3	NP_060392.3	Q86UA1	PRP39_HUMAN	pre-mRNA processing factor 39	652					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)				breast(2)|endometrium(2)|kidney(4)|lung(3)|ovary(1)	12						TCCTTTCAGTACAATTATCAG	0.328																																					p.Y652C		Atlas-SNP	.											.	PRPF39	46	.	0			c.A1955G						.						104.0	102.0	103.0					14																	45584061		2203	4297	6500	SO:0001630	splice_region_variant	55015	exon14			TTCAGTACAATTA	AK000673	CCDS9682.2	14q21.1	2013-10-03	2013-10-03		ENSG00000185246	ENSG00000185246			20314	protein-coding gene	gene with protein product		614907	"""PRP39 pre-mRNA processing factor 39 homolog (yeast)"", ""PRP39 pre-mRNA processing factor 39 homolog (S. cerevisiae)"""				Standard	NM_017922		Approved	FLJ20666, FLJ11128	uc001wvz.4	Q86UA1	OTTHUMG00000140265	ENST00000355765.6:c.1954-1A>G	chr14.hg19:g.45584061A>G		233.0	0.0		226.0	44.0	NM_017922	Q08AL1|Q08AL2|Q9NUU5	Missense_Mutation	SNP	ENST00000355765.6	hg19	CCDS9682.2	.	.	.	.	.	.	.	.	.	.	A	14.41	2.526476	0.44969	.	.	ENSG00000185246	ENST00000355765	T	0.51325	0.71	5.71	5.71	0.89125	.	0.000000	0.85682	D	0.000000	T	0.64438	0.2598	L	0.55481	1.735	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.63910	-0.6530	10	0.45353	T	0.12	-18.0984	15.6395	0.76984	1.0:0.0:0.0:0.0	.	652	Q86UA1	PRP39_HUMAN	C	652	ENSP00000348010:Y652C	ENSP00000348010:Y652C	Y	+	2	0	PRPF39	44653811	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.376000	0.79658	2.171000	0.68590	0.533000	0.62120	TAC	.	.		0.328	PRPF39-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319683.2		Missense_Mutation
PRPF39	55015	hgsc.bcm.edu	37	14	45584078	45584078	+	Missense_Mutation	SNP	T	T	G			TCGA-CC-A7IE-01A-21D-A382-10	TCGA-CC-A7IE-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c1caf517-5052-48e3-ad80-8458b3d2ff5f	ab81329b-c119-4a5a-863c-5b50f48cee3f	g.chr14:45584078T>G	ENST00000355765.6	+	14	2142	c.1972T>G	c.(1972-1974)Tgg>Ggg	p.W658G		NM_017922.3	NP_060392.3	Q86UA1	PRP39_HUMAN	pre-mRNA processing factor 39	658					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)				breast(2)|endometrium(2)|kidney(4)|lung(3)|ovary(1)	12						TCAGAATCCTTGGAATTATGG	0.303																																					p.W658G		Atlas-SNP	.											.	PRPF39	46	.	0			c.T1972G						.						107.0	105.0	106.0					14																	45584078		2203	4296	6499	SO:0001583	missense	55015	exon14			AATCCTTGGAATT	AK000673	CCDS9682.2	14q21.1	2013-10-03	2013-10-03		ENSG00000185246	ENSG00000185246			20314	protein-coding gene	gene with protein product		614907	"""PRP39 pre-mRNA processing factor 39 homolog (yeast)"", ""PRP39 pre-mRNA processing factor 39 homolog (S. cerevisiae)"""				Standard	NM_017922		Approved	FLJ20666, FLJ11128	uc001wvz.4	Q86UA1	OTTHUMG00000140265	ENST00000355765.6:c.1972T>G	chr14.hg19:g.45584078T>G	ENSP00000348010:p.Trp658Gly	259.0	0.0		247.0	48.0	NM_017922	Q08AL1|Q08AL2|Q9NUU5	Missense_Mutation	SNP	ENST00000355765.6	hg19	CCDS9682.2	.	.	.	.	.	.	.	.	.	.	T	13.01	2.108004	0.37242	.	.	ENSG00000185246	ENST00000355765	T	0.46063	0.88	5.71	5.71	0.89125	.	0.311639	0.37530	N	0.002058	T	0.60379	0.2264	L	0.58101	1.795	0.58432	D	0.999993	D	0.67145	0.996	D	0.75484	0.986	T	0.57711	-0.7764	10	0.35671	T	0.21	-3.8418	15.6395	0.76984	0.0:0.0:0.0:1.0	.	658	Q86UA1	PRP39_HUMAN	G	658	ENSP00000348010:W658G	ENSP00000348010:W658G	W	+	1	0	PRPF39	44653828	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.356000	0.73046	2.171000	0.68590	0.533000	0.62120	TGG	.	.		0.303	PRPF39-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319683.2		
FAM189A1	23359	hgsc.bcm.edu	37	15	29415840	29415840	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A7IE-01A-21D-A382-10	TCGA-CC-A7IE-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c1caf517-5052-48e3-ad80-8458b3d2ff5f	ab81329b-c119-4a5a-863c-5b50f48cee3f	g.chr15:29415840G>T	ENST00000261275.4	-	11	1321	c.1322C>A	c.(1321-1323)gCc>gAc	p.A441D		NM_015307.1	NP_056122.1	O60320	F1891_HUMAN	family with sequence similarity 189, member A1	441						integral component of membrane (GO:0016021)				central_nervous_system(2)|endometrium(2)|kidney(1)|lung(1)|stomach(1)	7						GGCAGCCGTGGCAGAGCGAGA	0.522																																					p.A441D		Atlas-SNP	.											.	FAM189A1	20	.	0			c.C1322A						.						101.0	97.0	98.0					15																	29415840		692	1591	2283	SO:0001583	missense	23359	exon11			GCCGTGGCAGAGC		CCDS45198.1	15q12	2014-02-12				ENSG00000104059			29075	protein-coding gene	gene with protein product	"""transmembrane protein 228"""					9628581	Standard	NM_015307		Approved	KIAA0574, TMEM228	uc010azk.1	O60320		ENST00000261275.4:c.1322C>A	chr15.hg19:g.29415840G>T	ENSP00000261275:p.Ala441Asp	95.0	0.0		100.0	11.0	NM_015307	A0PK09	Missense_Mutation	SNP	ENST00000261275.4	hg19	CCDS45198.1	.	.	.	.	.	.	.	.	.	.	G	18.97	3.735525	0.69189	.	.	ENSG00000104059	ENST00000261275	T	0.02787	4.16	5.37	-2.92	0.05615	.	1.879160	0.02185	N	0.060861	T	0.02455	0.0075	L	0.46157	1.445	0.09310	N	1	P	0.34462	0.454	B	0.26770	0.073	T	0.44283	-0.9338	10	0.12103	T	0.63	-16.6998	3.0944	0.06304	0.2629:0.0937:0.4925:0.1508	.	441	O60320	F1891_HUMAN	D	441	ENSP00000261275:A441D	ENSP00000261275:A441D	A	-	2	0	FAM189A1	27203132	0.000000	0.05858	0.000000	0.03702	0.345000	0.29048	0.548000	0.23314	-0.331000	0.08501	0.655000	0.94253	GCC	.	.		0.522	FAM189A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417254.1	NM_015307	
RYR3	6263	hgsc.bcm.edu	37	15	33926872	33926872	+	Missense_Mutation	SNP	G	G	T	rs369597197		TCGA-CC-A7IE-01A-21D-A382-10	TCGA-CC-A7IE-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c1caf517-5052-48e3-ad80-8458b3d2ff5f	ab81329b-c119-4a5a-863c-5b50f48cee3f	g.chr15:33926872G>T	ENST00000389232.4	+	25	3183	c.3113G>T	c.(3112-3114)cGg>cTg	p.R1038L	RYR3_ENST00000415757.3_Missense_Mutation_p.R1038L	NM_001036.3	NP_001027.3	Q15413	RYR3_HUMAN	ryanodine receptor 3	1038	4 X approximate repeats.|B30.2/SPRY 2. {ECO:0000255|PROSITE- ProRule:PRU00548}.				calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cellular response to ATP (GO:0071318)|cellular response to caffeine (GO:0071313)|cellular response to calcium ion (GO:0071277)|cellular response to magnesium ion (GO:0071286)|ion transmembrane transport (GO:0034220)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|protein homotetramerization (GO:0051289)|striated muscle contraction (GO:0006941)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|ryanodine-sensitive calcium-release channel activity (GO:0005219)			NS(3)|breast(9)|central_nervous_system(8)|cervix(2)|endometrium(29)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(55)|lung(148)|ovary(7)|pancreas(1)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(3)	311		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		GACAGCCTGCGGGAAGCTGTG	0.468																																					p.R1038L		Atlas-SNP	.											.	RYR3	760	.	0			c.G3113T						.						148.0	146.0	147.0					15																	33926872		1932	4139	6071	SO:0001583	missense	6263	exon25			GCCTGCGGGAAGC		CCDS45210.1, CCDS58351.1	15q14-q15	2013-01-10				ENSG00000198838		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10485	protein-coding gene	gene with protein product		180903				8276408	Standard	NM_001036		Approved		uc001zhi.3	Q15413		ENST00000389232.4:c.3113G>T	chr15.hg19:g.33926872G>T	ENSP00000373884:p.Arg1038Leu	110.0	0.0		130.0	40.0	NM_001243996	O15175|Q15412	Missense_Mutation	SNP	ENST00000389232.4	hg19	CCDS45210.1	.	.	.	.	.	.	.	.	.	.	G	18.62	3.663120	0.67700	.	.	ENSG00000198838	ENST00000389232;ENST00000415757;ENST00000361728	D;D	0.91521	-2.86;-2.86	5.2	5.2	0.72013	B30.2/SPRY domain (1);Ryanodine receptor Ryr (1);	0.000000	0.85682	D	0.000000	D	0.92338	0.7569	L	0.33245	0.995	0.80722	D	1	D;D	0.71674	0.997;0.998	D;D	0.79108	0.986;0.992	D	0.89594	0.3830	10	0.23302	T	0.38	.	19.2916	0.94102	0.0:0.0:1.0:0.0	.	1038;1038	Q15413-2;Q15413	.;RYR3_HUMAN	L	1038	ENSP00000373884:R1038L;ENSP00000399610:R1038L	ENSP00000354735:R1038L	R	+	2	0	RYR3	31714164	1.000000	0.71417	0.992000	0.48379	0.973000	0.67179	9.483000	0.97937	2.861000	0.98227	0.655000	0.94253	CGG	.	.		0.468	RYR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000417514.1		
EIF2AK4	440275	hgsc.bcm.edu	37	15	40241361	40241361	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A7IE-01A-21D-A382-10	TCGA-CC-A7IE-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c1caf517-5052-48e3-ad80-8458b3d2ff5f	ab81329b-c119-4a5a-863c-5b50f48cee3f	g.chr15:40241361C>A	ENST00000263791.5	+	4	448	c.405C>A	c.(403-405)agC>agA	p.S135R	snoU13_ENST00000459610.1_RNA|EIF2AK4_ENST00000382727.2_Missense_Mutation_p.S135R|EIF2AK4_ENST00000559624.1_Missense_Mutation_p.S135R	NM_001013703.2	NP_001013725.2	Q9P2K8	E2AK4_HUMAN	eukaryotic translation initiation factor 2 alpha kinase 4	135	RWD. {ECO:0000255|PROSITE- ProRule:PRU00179}.				cellular response to starvation (GO:0009267)|endoplasmic reticulum unfolded protein response (GO:0030968)|negative regulation of translation (GO:0017148)|protein phosphorylation (GO:0006468)|regulation of translational initiation (GO:0006446)|regulation of translational initiation in response to stress (GO:0043558)	cytosolic ribosome (GO:0022626)	ATP binding (GO:0005524)|eukaryotic translation initiation factor 2alpha kinase activity (GO:0004694)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(2)|endometrium(1)|kidney(3)|large_intestine(8)|lung(18)|ovary(1)|prostate(3)|skin(2)|stomach(1)	40		all_cancers(109;1.05e-19)|all_epithelial(112;4.38e-17)|Lung NSC(122;1.09e-12)|all_lung(180;3.56e-11)|Melanoma(134;0.0575)|Ovarian(310;0.0826)|Colorectal(260;0.119)		GBM - Glioblastoma multiforme(113;5.31e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0616)		CATTTCTCAGCGAGCATAACA	0.473																																					p.S135R		Atlas-SNP	.											.	EIF2AK4	107	.	0			c.C405A						.						206.0	186.0	192.0					15																	40241361		1931	4131	6062	SO:0001583	missense	440275	exon4			TCTCAGCGAGCAT	AB037759	CCDS42016.1	15q13.3	2008-08-18				ENSG00000128829			19687	protein-coding gene	gene with protein product		609280				10504407	Standard	XM_005254392		Approved	GCN2, KIAA1338	uc001zkm.1	Q9P2K8		ENST00000263791.5:c.405C>A	chr15.hg19:g.40241361C>A	ENSP00000263791:p.Ser135Arg	79.0	0.0		83.0	18.0	NM_001013703	C9JEC4|Q69YL7|Q6DC97|Q96GN6|Q9H5K1|Q9NSQ3|Q9NSZ5|Q9UJ56	Missense_Mutation	SNP	ENST00000263791.5	hg19	CCDS42016.1	.	.	.	.	.	.	.	.	.	.	C	15.39	2.820748	0.50633	.	.	ENSG00000128829	ENST00000263791;ENST00000382727	T;T	0.48836	0.8;0.8	5.8	-4.04	0.04010	Ubiquitin-conjugating enzyme/RWD-like (2);RWD domain (2);	0.126303	0.64402	D	0.000001	T	0.40886	0.1135	L	0.56124	1.755	0.26713	N	0.970938	B;B	0.33238	0.403;0.264	B;B	0.42030	0.15;0.373	T	0.46062	-0.9218	10	0.15952	T	0.53	-3.654	11.0609	0.47946	0.0824:0.3973:0.0:0.5203	.	135;135	Q9P2K8;Q9P2K8-3	E2AK4_HUMAN;.	R	135	ENSP00000263791:S135R;ENSP00000372174:S135R	ENSP00000263791:S135R	S	+	3	2	EIF2AK4	38028653	0.001000	0.12720	0.797000	0.32132	0.970000	0.65996	-1.617000	0.02051	-0.987000	0.03494	-1.164000	0.01763	AGC	.	.		0.473	EIF2AK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418395.1		
CGNL1	84952	hgsc.bcm.edu	37	15	57732594	57732594	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A7IE-01A-21D-A382-10	TCGA-CC-A7IE-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c1caf517-5052-48e3-ad80-8458b3d2ff5f	ab81329b-c119-4a5a-863c-5b50f48cee3f	g.chr15:57732594A>G	ENST00000281282.5	+	3	1700	c.1622A>G	c.(1621-1623)aAg>aGg	p.K541R		NM_001252335.1|NM_032866.4	NP_001239264.1|NP_116255.2	Q0VF96	CGNL1_HUMAN	cingulin-like 1	541	Head.					myosin complex (GO:0016459)|tight junction (GO:0005923)	motor activity (GO:0003774)			autonomic_ganglia(1)|breast(1)|central_nervous_system(2)|endometrium(5)|kidney(4)|large_intestine(12)|lung(14)|ovary(4)|prostate(4)|skin(10)|stomach(2)|upper_aerodigestive_tract(1)	60				all cancers(107;0.121)|GBM - Glioblastoma multiforme(80;0.186)		GATCTCTTAAAGGGCCAGCAA	0.473																																					p.K541R		Atlas-SNP	.											.	CGNL1	125	.	0			c.A1622G						.						74.0	65.0	68.0					15																	57732594		2192	4292	6484	SO:0001583	missense	84952	exon4			TCTTAAAGGGCCA	AY274808	CCDS10161.1	15q21.3	2011-06-10			ENSG00000128849	ENSG00000128849			25931	protein-coding gene	gene with protein product		607856				11214970	Standard	NM_001252335		Approved	FLJ14957, JACOP, KIAA1749, paracingulin	uc002aeg.3	Q0VF96	OTTHUMG00000166485	ENST00000281282.5:c.1622A>G	chr15.hg19:g.57732594A>G	ENSP00000281282:p.Lys541Arg	142.0	0.0		128.0	41.0	NM_001252335	Q05BZ4|Q52LR0|Q695C7|Q7Z2L3|Q96JV2|Q96MN6|Q9C0B4	Missense_Mutation	SNP	ENST00000281282.5	hg19	CCDS10161.1	.	.	.	.	.	.	.	.	.	.	A	21.4	4.148314	0.78001	.	.	ENSG00000128849	ENST00000281282	T	0.54675	0.56	4.81	4.81	0.61882	.	0.116735	0.37955	N	0.001863	T	0.55625	0.1932	L	0.39326	1.205	0.49389	D	0.999788	P	0.36990	0.577	P	0.48304	0.573	T	0.56884	-0.7905	10	0.45353	T	0.12	-36.2173	14.3915	0.66983	1.0:0.0:0.0:0.0	.	541	Q0VF96	CGNL1_HUMAN	R	541	ENSP00000281282:K541R	ENSP00000281282:K541R	K	+	2	0	CGNL1	55519886	1.000000	0.71417	1.000000	0.80357	0.916000	0.54674	8.946000	0.92992	1.791000	0.52520	0.460000	0.39030	AAG	.	.		0.473	CGNL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255482.2	NM_032866	
THAP10	56906	hgsc.bcm.edu	37	15	71175114	71175114	+	Missense_Mutation	SNP	C	C	T	rs544136510		TCGA-CC-A7IE-01A-21D-A382-10	TCGA-CC-A7IE-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c1caf517-5052-48e3-ad80-8458b3d2ff5f	ab81329b-c119-4a5a-863c-5b50f48cee3f	g.chr15:71175114C>T	ENST00000249861.4	-	2	1075	c.563G>A	c.(562-564)cGt>cAt	p.R188H	LRRC49_ENST00000544974.2_Intron	NM_020147.3	NP_064532.1	Q9P2Z0	THA10_HUMAN	THAP domain containing 10	188							DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|kidney(1)|lung(5)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	12						ACTACGGTGACGGGGCCTTTT	0.378													C|||	1	0.000199681	0.0	0.0	5008	,	,		20264	0.0		0.0	False		,,,				2504	0.001				p.R188H		Atlas-SNP	.											THAP10,NS,carcinoma,0,1	THAP10	19	.	0			c.G563A						.						115.0	113.0	114.0					15																	71175114		2199	4297	6496	SO:0001583	missense	56906	exon2			CGGTGACGGGGCC	AL360202	CCDS10237.1	15q22.32	2013-01-25			ENSG00000129028	ENSG00000129028		"""THAP (C2CH-type zinc finger) domain containing"""	23193	protein-coding gene	gene with protein product		612538				12575992	Standard	NM_020147		Approved		uc002asv.3	Q9P2Z0	OTTHUMG00000133388	ENST00000249861.4:c.563G>A	chr15.hg19:g.71175114C>T	ENSP00000249861:p.Arg188His	177.0	0.0		183.0	29.0	NM_020147	B2R8R0	Missense_Mutation	SNP	ENST00000249861.4	hg19	CCDS10237.1	.	.	.	.	.	.	.	.	.	.	C	0.256	-1.002823	0.02128	.	.	ENSG00000129028	ENST00000249861	.	.	.	3.09	-0.0811	0.13704	.	.	.	.	.	T	0.14960	0.0361	N	0.08118	0	0.09310	N	1	B	0.13145	0.007	B	0.01281	0.0	T	0.19095	-1.0316	8	0.39692	T	0.17	.	1.6666	0.02803	0.1291:0.2141:0.4495:0.2073	.	188	Q9P2Z0	THA10_HUMAN	H	188	.	ENSP00000249861:R188H	R	-	2	0	THAP10	68962168	0.226000	0.23696	0.007000	0.13788	0.412000	0.31113	0.135000	0.15952	-0.222000	0.09958	-2.234000	0.00290	CGT	.	.		0.378	THAP10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257242.2	NM_020147	
MCTP2	55784	hgsc.bcm.edu	37	15	94945187	94945187	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A7IE-01A-21D-A382-10	TCGA-CC-A7IE-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c1caf517-5052-48e3-ad80-8458b3d2ff5f	ab81329b-c119-4a5a-863c-5b50f48cee3f	g.chr15:94945187T>A	ENST00000357742.4	+	16	2024	c.2024T>A	c.(2023-2025)aTg>aAg	p.M675K	MCTP2_ENST00000451018.3_Missense_Mutation_p.M675K|MCTP2_ENST00000557742.1_Missense_Mutation_p.M263K|MCTP2_ENST00000331706.4_Missense_Mutation_p.M263K	NM_018349.3	NP_060819.3	Q6DN12	MCTP2_HUMAN	multiple C2 domains, transmembrane 2	675					calcium-mediated signaling (GO:0019722)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	calcium ion binding (GO:0005509)			autonomic_ganglia(1)|breast(4)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(12)|liver(1)|lung(12)|ovary(1)|pancreas(1)|skin(9)|stomach(2)	49	Lung NSC(78;0.0821)|all_lung(78;0.148)		BRCA - Breast invasive adenocarcinoma(143;0.0323)|OV - Ovarian serous cystadenocarcinoma(32;0.0593)			TGGAATACAATGCAGTTCCTT	0.348																																					p.M675K		Atlas-SNP	.											.	MCTP2	122	.	0			c.T2024A						.						125.0	125.0	125.0					15																	94945187		2197	4298	6495	SO:0001583	missense	55784	exon16			ATACAATGCAGTT	AK002037	CCDS32338.1, CCDS53975.1, CCDS53976.1	15q26.2	2006-02-08				ENSG00000140563			25636	protein-coding gene	gene with protein product						15528213	Standard	NM_018349		Approved	FLJ11175, FLJ33303	uc002btj.3	Q6DN12		ENST00000357742.4:c.2024T>A	chr15.hg19:g.94945187T>A	ENSP00000350377:p.Met675Lys	145.0	0.0		167.0	33.0	NM_001159643	A2RRC2|C6G483|C6G484|Q49AB0|Q8TAX2|Q9NUS2|Q9NUW7	Missense_Mutation	SNP	ENST00000357742.4	hg19	CCDS32338.1	.	.	.	.	.	.	.	.	.	.	T	8.055	0.766831	0.15983	.	.	ENSG00000140563	ENST00000451018;ENST00000331706;ENST00000357742	T;T;T	0.64991	-0.13;0.01;-0.02	5.52	4.26	0.50523	.	1.009490	0.07921	N	0.975937	T	0.44456	0.1294	N	0.08118	0	0.09310	N	1	B;B;B	0.18968	0.0;0.032;0.002	B;B;B	0.22753	0.001;0.041;0.008	T	0.34079	-0.9843	10	0.26408	T	0.33	.	11.0723	0.48010	0.0:0.0785:0.0:0.9215	.	675;263;675	Q6DN12-2;Q6DN12-4;Q6DN12	.;.;MCTP2_HUMAN	K	675;263;675	ENSP00000395109:M675K;ENSP00000329646:M263K;ENSP00000350377:M675K	ENSP00000329646:M263K	M	+	2	0	MCTP2	92746191	0.135000	0.22499	0.001000	0.08648	0.844000	0.47949	3.343000	0.52167	0.802000	0.34089	0.529000	0.55759	ATG	.	.		0.348	MCTP2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415060.3	NM_018349	
IGF1R	3480	hgsc.bcm.edu	37	15	99467196	99467196	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A7IE-01A-21D-A382-10	TCGA-CC-A7IE-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c1caf517-5052-48e3-ad80-8458b3d2ff5f	ab81329b-c119-4a5a-863c-5b50f48cee3f	g.chr15:99467196T>A	ENST00000268035.6	+	12	3188	c.2577T>A	c.(2575-2577)aaT>aaA	p.N859K	IGF1R_ENST00000558762.1_Missense_Mutation_p.N859K	NM_000875.3	NP_000866.1	P08069	IGF1R_HUMAN	insulin-like growth factor 1 receptor	859	Fibronectin type-III 4. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axonogenesis (GO:0007409)|brain development (GO:0007420)|epidermis development (GO:0008544)|establishment of cell polarity (GO:0030010)|exocrine pancreas development (GO:0031017)|immune response (GO:0006955)|inactivation of MAPKK activity (GO:0051389)|insulin receptor signaling pathway (GO:0008286)|insulin-like growth factor receptor signaling pathway (GO:0048009)|male sex determination (GO:0030238)|mammary gland development (GO:0030879)|negative regulation of apoptotic process (GO:0043066)|negative regulation of muscle cell apoptotic process (GO:0010656)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|peptidyl-tyrosine autophosphorylation (GO:0038083)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytokinesis (GO:0032467)|positive regulation of DNA replication (GO:0045740)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mitosis (GO:0045840)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of steroid hormone biosynthetic process (GO:0090031)|prostate gland epithelium morphogenesis (GO:0060740)|protein autophosphorylation (GO:0046777)|protein heterooligomerization (GO:0051291)|protein tetramerization (GO:0051262)|regulation of JNK cascade (GO:0046328)|response to vitamin E (GO:0033197)|signal transduction (GO:0007165)	caveola (GO:0005901)|integral component of plasma membrane (GO:0005887)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|insulin binding (GO:0043559)|insulin receptor binding (GO:0005158)|insulin receptor substrate binding (GO:0043560)|insulin-like growth factor binding (GO:0005520)|insulin-like growth factor I binding (GO:0031994)|insulin-like growth factor-activated receptor activity (GO:0005010)|phosphatidylinositol 3-kinase binding (GO:0043548)|protein tyrosine kinase activity (GO:0004713)			NS(2)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(13)|lung(20)|ovary(1)|prostate(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	63	all_cancers(4;4.17e-14)|all_epithelial(3;4.34e-15)|Lung NSC(78;0.00175)|all_lung(78;0.00351)|Melanoma(26;0.00505)|Medulloblastoma(229;0.163)		Epithelial(2;1.94e-12)|all cancers(5;6.83e-11)|BRCA - Breast invasive adenocarcinoma(2;2.88e-09)|OV - Ovarian serous cystadenocarcinoma(32;0.00261)		"""""""Insulin(DB00071)|Insulin Glargine(DB00047)|Insulin Lispro(DB00046)|Insulin Regular(DB00030)|Mecasermin(DB01277)"""	AGAATCCCAATGGATTGATTC	0.473																																					p.N859K		Atlas-SNP	.											.	IGF1R	147	.	0			c.T2577A						.						85.0	88.0	87.0					15																	99467196		2197	4297	6494	SO:0001583	missense	3480	exon12			TCCCAATGGATTG	M69229	CCDS10378.1, CCDS73785.1	15q26.3	2013-02-11			ENSG00000140443	ENSG00000140443		"""CD molecules"", ""Fibronectin type III domain containing"""	5465	protein-coding gene	gene with protein product		147370				1316909	Standard	XM_006720486		Approved	JTK13, CD221, IGFIR, MGC18216, IGFR	uc002bul.3	P08069	OTTHUMG00000149851	ENST00000268035.6:c.2577T>A	chr15.hg19:g.99467196T>A	ENSP00000268035:p.Asn859Lys	120.0	0.0		169.0	35.0	NM_000875	B1B5Y2|Q14CV2|Q9UCC0	Missense_Mutation	SNP	ENST00000268035.6	hg19	CCDS10378.1	.	.	.	.	.	.	.	.	.	.	T	22.2	4.253717	0.80135	.	.	ENSG00000140443	ENST00000268035	T	0.61158	0.13	5.81	3.5	0.40072	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.64402	D	0.000011	T	0.79064	0.4383	M	0.93197	3.39	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.79184	-0.1908	10	0.87932	D	0	.	8.1816	0.31313	0.0:0.2433:0.0:0.7567	.	859;859	C9J5X1;P08069	.;IGF1R_HUMAN	K	859	ENSP00000268035:N859K	ENSP00000268035:N859K	N	+	3	2	IGF1R	97284719	0.987000	0.35691	1.000000	0.80357	0.998000	0.95712	0.172000	0.16704	0.469000	0.27268	0.482000	0.46254	AAT	.	.		0.473	IGF1R-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000313537.2	NM_000875	
PKD1	5310	hgsc.bcm.edu	37	16	2149932	2149932	+	Missense_Mutation	SNP	C	C	T	rs201780393		TCGA-CC-A7IE-01A-21D-A382-10	TCGA-CC-A7IE-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c1caf517-5052-48e3-ad80-8458b3d2ff5f	ab81329b-c119-4a5a-863c-5b50f48cee3f	g.chr16:2149932C>T	ENST00000262304.4	-	29	10061	c.9853G>A	c.(9853-9855)Gtt>Att	p.V3285I	PKD1_ENST00000423118.1_Missense_Mutation_p.V3285I|RP11-304L19.3_ENST00000565937.1_RNA	NM_001009944.2	NP_001009944	P98161	PKD1_HUMAN	polycystic kidney disease 1 (autosomal dominant)	3285			V -> I (in PKD1). {ECO:0000269|PubMed:11316854}.		anatomical structure morphogenesis (GO:0009653)|branching morphogenesis of an epithelial tube (GO:0048754)|calcium ion transmembrane transport (GO:0070588)|calcium-independent cell-matrix adhesion (GO:0007161)|cartilage condensation (GO:0001502)|cartilage development (GO:0051216)|cation transmembrane transport (GO:0098655)|cell cycle arrest (GO:0007050)|cell-matrix adhesion (GO:0007160)|cytoplasmic sequestering of transcription factor (GO:0042994)|detection of mechanical stimulus (GO:0050982)|digestive tract development (GO:0048565)|embryonic placenta development (GO:0001892)|genitalia development (GO:0048806)|heart development (GO:0007507)|homophilic cell adhesion (GO:0007156)|in utero embryonic development (GO:0001701)|JAK-STAT cascade (GO:0007259)|kidney development (GO:0001822)|liver development (GO:0001889)|lung epithelium development (GO:0060428)|mesonephric duct development (GO:0072177)|mesonephric tubule development (GO:0072164)|metanephric ascending thin limb development (GO:0072218)|metanephric collecting duct development (GO:0072205)|metanephric distal tubule morphogenesis (GO:0072287)|metanephric proximal tubule development (GO:0072237)|neural tube development (GO:0021915)|neuropeptide signaling pathway (GO:0007218)|nitrogen compound metabolic process (GO:0006807)|peptidyl-serine phosphorylation (GO:0018105)|placenta blood vessel development (GO:0060674)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of protein binding (GO:0032092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein export from nucleus (GO:0006611)|regulation of mitotic spindle organization (GO:0060236)|regulation of proteasomal protein catabolic process (GO:0061136)|response to fluid shear stress (GO:0034405)|skin development (GO:0043588)|spinal cord development (GO:0021510)	basolateral plasma membrane (GO:0016323)|cilium (GO:0005929)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lateral plasma membrane (GO:0016328)|motile primary cilium (GO:0031512)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|polycystin complex (GO:0002133)	calcium channel activity (GO:0005262)|carbohydrate binding (GO:0030246)|cation channel activity (GO:0005261)|ion channel binding (GO:0044325)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(7)|kidney(6)|lung(34)|prostate(4)|skin(10)|upper_aerodigestive_tract(3)|urinary_tract(3)	72						ATGAGGAGAACGCAGCAGGTG	0.637																																					p.V3285I		Atlas-SNP	.											.	PKD1	184	.	0			c.G9853A	GRCh37	CM014078	PKD1	M		.						14.0	11.0	12.0					16																	2149932		2135	4195	6330	SO:0001583	missense	5310	exon29			GGAGAACGCAGCA	L33243	CCDS32369.1, CCDS45385.1	16p13.3	2014-01-28			ENSG00000008710	ENSG00000008710		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	9008	protein-coding gene	gene with protein product	"""polycystin 1"", ""transient receptor potential cation channel, subfamily P, member 1"""	601313					Standard	NM_001009944		Approved	PBP, Pc-1, TRPP1	uc002cos.1	P98161	OTTHUMG00000155795	ENST00000262304.4:c.9853G>A	chr16.hg19:g.2149932C>T	ENSP00000262304:p.Val3285Ile	158.0	0.0		152.0	63.0	NM_000296	Q15140|Q15141	Missense_Mutation	SNP	ENST00000262304.4	hg19	CCDS32369.1	.	.	.	.	.	.	.	.	.	.	C	4.104	0.017298	0.07959	.	.	ENSG00000008710	ENST00000262304;ENST00000423118;ENST00000306101	T;T	0.36340	1.26;1.26	4.69	0.366	0.16136	.	0.797162	0.11329	N	0.575245	T	0.24967	0.0606	L	0.46157	1.445	0.09310	N	1	B;B	0.21905	0.062;0.01	B;B	0.15870	0.014;0.004	T	0.27088	-1.0084	10	0.16896	T	0.51	.	5.1969	0.15243	0.2889:0.4834:0.0:0.2277	.	3285;3285	P98161-3;P98161	.;PKD1_HUMAN	I	3285;3285;2620	ENSP00000262304:V3285I;ENSP00000399501:V3285I	ENSP00000262304:V3285I	V	-	1	0	PKD1	2089933	0.012000	0.17670	0.016000	0.15963	0.146000	0.21551	0.011000	0.13264	0.206000	0.20587	-0.324000	0.08512	GTT	.	C|0.999;T|0.001		0.637	PKD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000341688.1		
ZNF75A	7627	hgsc.bcm.edu	37	16	3367850	3367850	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-A7IE-01A-21D-A382-10	TCGA-CC-A7IE-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c1caf517-5052-48e3-ad80-8458b3d2ff5f	ab81329b-c119-4a5a-863c-5b50f48cee3f	g.chr16:3367850A>T	ENST00000574298.1	+	6	1345	c.872A>T	c.(871-873)cAc>cTc	p.H291L	ZNF75A_ENST00000498240.2_3'UTR	NM_153028.2	NP_694573.1	Q96N20	ZN75A_HUMAN	zinc finger protein 75a	291					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|large_intestine(3)|lung(7)|prostate(1)	12						CTTCTTAGACACCAGAAACTC	0.443																																					p.H291L		Atlas-SNP	.											.	ZNF75A	34	.	0			c.A872T						.						46.0	48.0	48.0					16																	3367850		2190	4296	6486	SO:0001583	missense	7627	exon6			TTAGACACCAGAA	X91826	CCDS10501.1	16p13.11	2013-01-08			ENSG00000162086	ENSG00000162086		"""Zinc fingers, C2H2-type"", ""-"""	13146	protein-coding gene	gene with protein product		601473				8661144	Standard	NM_153028		Approved	FLJ31529	uc002cut.4	Q96N20	OTTHUMG00000129356	ENST00000574298.1:c.872A>T	chr16.hg19:g.3367850A>T	ENSP00000459566:p.His291Leu	55.0	0.0		72.0	30.0	NM_153028	Q0VDI8|Q92669	Missense_Mutation	SNP	ENST00000574298.1	hg19	CCDS10501.1	.	.	.	.	.	.	.	.	.	.	A	15.70	2.910117	0.52439	.	.	ENSG00000162086	ENST00000293995	.	.	.	4.57	3.43	0.39272	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.47093	D	0.000242	T	0.72342	0.3448	H	0.97516	4.02	0.34063	D	0.657549	B	0.21688	0.059	B	0.17433	0.018	T	0.77112	-0.2708	9	0.87932	D	0	.	8.6663	0.34123	0.829:0.0:0.0:0.171	.	291	Q96N20	ZN75A_HUMAN	L	291	.	ENSP00000293995:H291L	H	+	2	0	ZNF75A	3307851	1.000000	0.71417	1.000000	0.80357	0.694000	0.40290	6.964000	0.76061	0.832000	0.34804	0.455000	0.32223	CAC	.	.		0.443	ZNF75A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251506.2	NM_153028	
DNAH3	55567	hgsc.bcm.edu	37	16	21080830	21080830	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A7IE-01A-21D-A382-10	TCGA-CC-A7IE-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c1caf517-5052-48e3-ad80-8458b3d2ff5f	ab81329b-c119-4a5a-863c-5b50f48cee3f	g.chr16:21080830A>G	ENST00000261383.3	-	23	3286	c.3287T>C	c.(3286-3288)aTc>aCc	p.I1096T	DNAH3_ENST00000415178.1_Missense_Mutation_p.I1096T	NM_017539.1	NP_060009.1	Q8TD57	DYH3_HUMAN	dynein, axonemal, heavy chain 3	1096	Stem. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			NS(3)|autonomic_ganglia(1)|breast(12)|central_nervous_system(3)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(42)|liver(2)|lung(57)|ovary(14)|pancreas(1)|prostate(7)|skin(11)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(6)	202				GBM - Glioblastoma multiforme(48;0.207)		TGAACTGAAGATTGGTTCCAG	0.438																																					p.I1096T		Atlas-SNP	.											.	DNAH3	1142	.	0			c.T3287C						.						194.0	158.0	170.0					16																	21080830		2201	4300	6501	SO:0001583	missense	55567	exon23			CTGAAGATTGGTT	U83574	CCDS10594.1	16p12.2	2008-08-01	2006-09-04		ENSG00000158486	ENSG00000158486		"""Axonemal dyneins"""	2949	protein-coding gene	gene with protein product		603334	"""dynein, axonemal, heavy polypeptide 3"""			9256245, 9373155	Standard	NM_017539		Approved	Dnahc3b, DLP3, Hsadhc3, DKFZp434N074	uc010vbe.2	Q8TD57	OTTHUMG00000090677	ENST00000261383.3:c.3287T>C	chr16.hg19:g.21080830A>G	ENSP00000261383:p.Ile1096Thr	154.0	0.0		116.0	45.0	NM_017539	O00437|O15437|O43326|Q3C0H2|Q8WUP9|Q9UEM3|Q9UEM5|Q9UG35	Missense_Mutation	SNP	ENST00000261383.3	hg19	CCDS10594.1	.	.	.	.	.	.	.	.	.	.	A	23.4	4.408536	0.83340	.	.	ENSG00000158486	ENST00000261383;ENST00000415178	T;T	0.74315	-0.83;-0.83	5.15	5.15	0.70609	Dynein heavy chain, domain-2 (1);	0.000000	0.85682	D	0.000000	D	0.91573	0.7338	H	0.98426	4.23	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.94762	0.7937	10	0.87932	D	0	.	15.2812	0.73787	1.0:0.0:0.0:0.0	.	1096	Q8TD57	DYH3_HUMAN	T	1096	ENSP00000261383:I1096T;ENSP00000394245:I1096T	ENSP00000261383:I1096T	I	-	2	0	DNAH3	20988331	1.000000	0.71417	0.991000	0.47740	0.994000	0.84299	9.276000	0.95745	2.086000	0.62901	0.533000	0.62120	ATC	.	.		0.438	DNAH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207361.1	NM_017539	
SRCAP	10847	hgsc.bcm.edu	37	16	30749946	30749947	+	Missense_Mutation	DNP	GG	GG	TT			TCGA-CC-A7IE-01A-21D-A382-10	TCGA-CC-A7IE-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c1caf517-5052-48e3-ad80-8458b3d2ff5f	ab81329b-c119-4a5a-863c-5b50f48cee3f	g.chr16:30749946_30749947GG>TT	ENST00000262518.4	+	34	8970_8971	c.8585_8586GG>TT	c.(8584-8586)aGG>aTT	p.R2862I	SRCAP_ENST00000395059.2_Missense_Mutation_p.R2800I|SRCAP_ENST00000344771.4_Missense_Mutation_p.R2704I|RP11-2C24.4_ENST00000483578.1_lincRNA	NM_006662.2	NP_006653.2	Q6ZRS2	SRCAP_HUMAN	Snf2-related CREBBP activator protein	2862	Pro-rich.				histone acetylation (GO:0016573)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|histone acetyltransferase activity (GO:0004402)|transcription coactivator activity (GO:0003713)			NS(1)|breast(3)|cervix(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(22)|liver(3)|lung(62)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(5)	136			Colorectal(24;0.198)			CGGAGGGGGAGGCCCCCCAAGA	0.614																																					p.R2862M|p.R2862S		Atlas-SNP	.											.	SRCAP	298	.	0			c.G8585T|c.G8586T						.																																			SO:0001583	missense	10847	exon34			GGGGGAGGCCCCC|GGGGAGGCCCCCC	AB002307	CCDS10689.2	16p11.2	2009-08-06			ENSG00000080603	ENSG00000080603			16974	protein-coding gene	gene with protein product	"""Swi2/Snf2-related ATPase homolog (S. cerevisiae)"", ""domino homolog 1 (Drosophila)"""	611421				10347196, 9205841	Standard	NM_006662		Approved	KIAA0309, EAF1, SWR1, DOMO1	uc002dze.1	Q6ZRS2	OTTHUMG00000132393	Exception_encountered	chr16.hg19:g.30749946_30749947delinsTT	ENSP00000262518:p.Arg2862Ile	57.0|56.0	0.0		100.0	20.0|19.0	NM_006662	B0JZA6|O15026|Q7Z744|Q9Y5L9	Missense_Mutation	SNP	ENST00000262518.4	hg19	CCDS10689.2																																																																																			.	.		0.614	SRCAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255523.1	NM_006662	
AARS	16	hgsc.bcm.edu	37	16	70301705	70301705	+	Missense_Mutation	SNP	G	G	A	rs561829699		TCGA-CC-A7IE-01A-21D-A382-10	TCGA-CC-A7IE-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c1caf517-5052-48e3-ad80-8458b3d2ff5f	ab81329b-c119-4a5a-863c-5b50f48cee3f	g.chr16:70301705G>A	ENST00000261772.8	-	9	1222	c.1079C>T	c.(1078-1080)gCa>gTa	p.A360V	AARS_ENST00000564359.1_5'Flank	NM_001605.2	NP_001596.2			alanyl-tRNA synthetase											breast(3)|cervix(2)|endometrium(5)|large_intestine(7)|lung(7)|ovary(1)|pancreas(1)|prostate(1)	27		Ovarian(137;0.0365)		BRCA - Breast invasive adenocarcinoma(221;0.161)		CTCAGGAAATGCATCTCCCTG	0.522											OREG0023913	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.A360V		Atlas-SNP	.											.	AARS	62	.	0			c.C1079T						.						106.0	96.0	99.0					16																	70301705		2198	4300	6498	SO:0001583	missense	16	exon9			GGAAATGCATCTC	D32050	CCDS32474.1	16q22.1	2014-09-17			ENSG00000090861	ENSG00000090861	6.1.1.7	"""Aminoacyl tRNA synthetases / Class II"""	20	protein-coding gene	gene with protein product	"""alanine tRNA ligase 1, cytoplasmic"""	601065				8595897	Standard	NM_001605		Approved		uc002eyn.1	P49588	OTTHUMG00000177042	ENST00000261772.8:c.1079C>T	chr16.hg19:g.70301705G>A	ENSP00000261772:p.Ala360Val	68.0	0.0	1121	61.0	11.0	NM_001605		Missense_Mutation	SNP	ENST00000261772.8	hg19	CCDS32474.1	.	.	.	.	.	.	.	.	.	.	G	10.79	1.448504	0.26074	.	.	ENSG00000090861	ENST00000261772	T	0.56611	0.45	5.81	5.81	0.92471	Alanyl-tRNA synthetase, class IIc, anti-codon-binding domain (1);Alanyl-tRNA synthetase, class IIc, core domain (1);Alanyl-tRNA synthetase, class IIc, N-terminal (1);	0.092298	0.85682	D	0.000000	T	0.44030	0.1274	L	0.33245	0.995	0.80722	D	1	B;B	0.31893	0.345;0.22	B;B	0.33392	0.163;0.163	T	0.25572	-1.0128	10	0.15952	T	0.53	-14.2566	17.5723	0.87937	0.0:0.0:1.0:0.0	.	368;360	E7ETK8;P49588	.;SYAC_HUMAN	V	360	ENSP00000261772:A360V	ENSP00000261772:A360V	A	-	2	0	AARS	68859206	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.735000	0.98825	2.736000	0.93811	0.655000	0.94253	GCA	.	.		0.522	AARS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000435021.2	NM_001605	
ADAD2	161931	hgsc.bcm.edu	37	16	84229451	84229451	+	Silent	SNP	G	G	A			TCGA-CC-A7IE-01A-21D-A382-10	TCGA-CC-A7IE-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c1caf517-5052-48e3-ad80-8458b3d2ff5f	ab81329b-c119-4a5a-863c-5b50f48cee3f	g.chr16:84229451G>A	ENST00000315906.5	+	7	1135	c.1083G>A	c.(1081-1083)ccG>ccA	p.P361P	RP11-486L19.2_ENST00000569834.1_RNA|ADAD2_ENST00000268624.3_Silent_p.P443P|RP11-486L19.2_ENST00000561900.1_RNA|RP11-486L19.2_ENST00000565643.1_RNA|RP11-486L19.2_ENST00000536986.1_RNA	NM_001145400.1	NP_001138872.1	Q8NCV1	ADAD2_HUMAN	adenosine deaminase domain containing 2	361	A to I editase. {ECO:0000255|PROSITE- ProRule:PRU00240}.				RNA processing (GO:0006396)		adenosine deaminase activity (GO:0004000)|RNA binding (GO:0003723)			NS(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(3)|ovary(1)|prostate(2)|skin(1)	13						GTGGCCTCCCGCACAGCCCAC	0.701																																					p.P443P		Atlas-SNP	.											.	ADAD2	46	.	0			c.G1329A						.						15.0	18.0	17.0					16																	84229451		2183	4278	6461	SO:0001819	synonymous_variant	161931	exon8			CCTCCCGCACAGC	AF447586	CCDS10944.1, CCDS45536.1	16q24.1	2007-05-31			ENSG00000140955	ENSG00000140955			30714	protein-coding gene	gene with protein product							Standard	NM_139174		Approved	TENRL, FLJ00337	uc002fhr.2	Q8NCV1	OTTHUMG00000137637	ENST00000315906.5:c.1083G>A	chr16.hg19:g.84229451G>A		87.0	0.0		70.0	23.0	NM_139174	B2RCL6|Q8NA94	Silent	SNP	ENST00000315906.5	hg19	CCDS45536.1																																																																																			.	.		0.701	ADAD2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433385.1	NM_139174	
TCF25	22980	hgsc.bcm.edu	37	16	89965023	89965023	+	Missense_Mutation	SNP	C	C	T	rs144328773	byFrequency	TCGA-CC-A7IE-01A-21D-A382-10	TCGA-CC-A7IE-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c1caf517-5052-48e3-ad80-8458b3d2ff5f	ab81329b-c119-4a5a-863c-5b50f48cee3f	g.chr16:89965023C>T	ENST00000263346.8	+	10	1137	c.1081C>T	c.(1081-1083)Cgc>Tgc	p.R361C	TCF25_ENST00000263347.7_Missense_Mutation_p.R126C	NM_014972.2	NP_055787.1	Q9BQ70	TCF25_HUMAN	transcription factor 25 (basic helix-loop-helix)	361					heart development (GO:0007507)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(2)|large_intestine(1)|lung(8)|ovary(3)|skin(1)|urinary_tract(2)	18		all_cancers(9;4.71e-08)|Lung NSC(15;0.000192)|all_lung(18;0.000319)|all_neural(9;0.0122)|all_hematologic(23;0.027)		BRCA - Breast invasive adenocarcinoma(80;0.0288)		AGGCTGCCCGCGCACGGCGCT	0.582																																					p.R361C		Atlas-SNP	.											.	TCF25	61	.	0			c.C1081T						.						74.0	86.0	82.0					16																	89965023		2198	4300	6498	SO:0001583	missense	22980	exon10			TGCCCGCGCACGG	AF322111	CCDS10987.1	16q24.3	2008-02-05			ENSG00000141002	ENSG00000141002			29181	protein-coding gene	gene with protein product		612326				12107429, 16574069	Standard	NM_014972		Approved	Nulp1, KIAA1049	uc002fpb.2	Q9BQ70	OTTHUMG00000138986	ENST00000263346.8:c.1081C>T	chr16.hg19:g.89965023C>T	ENSP00000263346:p.Arg361Cys	33.0	0.0		21.0	10.0	NM_014972	Q2MK75|Q9UPV3	Missense_Mutation	SNP	ENST00000263346.8	hg19	CCDS10987.1	.	.	.	.	.	.	.	.	.	.	C	26.4	4.734572	0.89482	.	.	ENSG00000141002	ENST00000263346;ENST00000263347	T;T	0.74315	-0.83;-0.83	5.63	5.63	0.86233	Tetratricopeptide-like helical (1);	0.053822	0.85682	D	0.000000	D	0.89870	0.6840	M	0.92691	3.335	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	D	0.91847	0.5488	10	0.87932	D	0	.	18.6717	0.91514	0.0:1.0:0.0:0.0	.	126;361	Q9H384;Q9BQ70	.;TCF25_HUMAN	C	361;126	ENSP00000263346:R361C;ENSP00000263347:R126C	ENSP00000263346:R361C	R	+	1	0	TCF25	88492524	1.000000	0.71417	0.986000	0.45419	0.699000	0.40488	5.407000	0.66363	2.654000	0.90174	0.561000	0.74099	CGC	.	C|0.999;A|0.001		0.582	TCF25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000272875.2	NM_014972	
NCOR1	9611	hgsc.bcm.edu	37	17	15976836	15976836	+	Nonsense_Mutation	SNP	C	C	A			TCGA-CC-A7IE-01A-21D-A382-10	TCGA-CC-A7IE-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c1caf517-5052-48e3-ad80-8458b3d2ff5f	ab81329b-c119-4a5a-863c-5b50f48cee3f	g.chr17:15976836C>A	ENST00000268712.3	-	28	3975	c.3718G>T	c.(3718-3720)Gaa>Taa	p.E1240*	NCOR1_ENST00000395851.1_Nonsense_Mutation_p.E1256*|NCOR1_ENST00000395857.3_Intron	NM_006311.3	NP_006302.2	O75376	NCOR1_HUMAN	nuclear receptor corepressor 1	1240	Interaction with ETO.				CD4-positive, CD25-positive, alpha-beta regulatory T cell differentiation (GO:0002361)|cellular lipid metabolic process (GO:0044255)|cholesterol homeostasis (GO:0042632)|chromatin modification (GO:0016568)|circadian regulation of gene expression (GO:0032922)|definitive erythrocyte differentiation (GO:0060318)|gene expression (GO:0010467)|negative regulation of JNK cascade (GO:0046329)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of histone deacetylation (GO:0031065)|regulation of fatty acid transport (GO:2000191)|regulation of glycolytic process by negative regulation of transcription from RNA polymerase II promoter (GO:0072362)|regulation of lipid transport by negative regulation of transcription from RNA polymerase II promoter (GO:0072368)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|spindle assembly (GO:0051225)|thalamus development (GO:0021794)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle microtubule (GO:0005876)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|histone deacetylase binding (GO:0042826)|histone deacetylase regulator activity (GO:0035033)|nuclear hormone receptor binding (GO:0035257)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)			NS(2)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(17)|lung(26)|ovary(1)|prostate(7)|skin(2)|upper_aerodigestive_tract(6)|urinary_tract(10)	107				UCEC - Uterine corpus endometrioid carcinoma (92;0.101)		AAACTGATTTCATGAGCTGTT	0.423																																					p.E1256X		Atlas-SNP	.											.	NCOR1	240	.	0			c.G3766T						.						146.0	126.0	133.0					17																	15976836		2203	4300	6503	SO:0001587	stop_gained	9611	exon27			TGATTTCATGAGC	AF044209	CCDS11175.1, CCDS54094.1, CCDS54095.1	17p11.2	2014-06-12	2010-06-10		ENSG00000141027	ENSG00000141027			7672	protein-coding gene	gene with protein product	"""thyroid hormone- and retinoic acid receptor-associated corepressor 1"", ""protein phosphatase 1, regulatory subunit 109"""	600849	"""nuclear receptor co-repressor 1"""			7566114, 9724795	Standard	NM_006311		Approved	N-CoR, hCIT529I10, TRAC1, hN-CoR, KIAA1047, MGC104216, PPP1R109	uc002gpo.3	O75376	OTTHUMG00000059309	ENST00000268712.3:c.3718G>T	chr17.hg19:g.15976836C>A	ENSP00000268712:p.Glu1240*	60.0	0.0		60.0	18.0	NM_001190440	B3DLF8|E9PGV6|Q86YY0|Q9UPV5|Q9UQ18	Nonsense_Mutation	SNP	ENST00000268712.3	hg19	CCDS11175.1	.	.	.	.	.	.	.	.	.	.	C	39	7.798834	0.98495	.	.	ENSG00000141027	ENST00000268712;ENST00000395851;ENST00000395849	.	.	.	5.91	5.91	0.95273	.	0.090566	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	-14.1607	19.2934	0.94112	0.0:1.0:0.0:0.0	.	.	.	.	X	1240;1256;1147	.	ENSP00000268712:E1240X	E	-	1	0	NCOR1	15917561	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.348000	0.73009	2.808000	0.96608	0.655000	0.94253	GAA	.	.		0.423	NCOR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131751.5	NM_006311	
CCDC144A	9720	hgsc.bcm.edu	37	17	16667283	16667283	+	Missense_Mutation	SNP	A	A	G	rs558127337		TCGA-CC-A7IE-01A-21D-A382-10	TCGA-CC-A7IE-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c1caf517-5052-48e3-ad80-8458b3d2ff5f	ab81329b-c119-4a5a-863c-5b50f48cee3f	g.chr17:16667283A>G	ENST00000360524.8	+	15	3968	c.3892A>G	c.(3892-3894)Aat>Gat	p.N1298D	CCDC144A_ENST00000456009.1_Missense_Mutation_p.N1064D|CCDC144A_ENST00000443444.2_Missense_Mutation_p.N1298D|CCDC144A_ENST00000399273.1_Missense_Mutation_p.N1298D|RP11-219A15.1_ENST00000448331.3_Missense_Mutation_p.N1298D	NM_014695.1	NP_055510.1	A2RUR9	C144A_HUMAN	coiled-coil domain containing 144A	1298																	TCATAGAACTAATGAGATGAT	0.368																																					p.N1298D		Atlas-SNP	.											.	CCDC144A	53	.	0			c.A3892G						.						118.0	129.0	125.0					17																	16667283		1866	4112	5978	SO:0001583	missense	9720	exon15			AGAACTAATGAGA	BC133019	CCDS45621.1	17p11.2	2008-10-23			ENSG00000170160	ENSG00000170160			29072	protein-coding gene	gene with protein product						9628581, 11997339	Standard	NM_014695		Approved	KIAA0565, FLJ43983	uc002gqk.1	A2RUR9	OTTHUMG00000059178	ENST00000360524.8:c.3892A>G	chr17.hg19:g.16667283A>G	ENSP00000353717:p.Asn1298Asp	283.0	0.0		351.0	105.0	NM_014695	O60311|Q6ZU57	Missense_Mutation	SNP	ENST00000360524.8	hg19	CCDS45621.1	.	.	.	.	.	.	.	.	.	.	.	11.14	1.550975	0.27739	.	.	ENSG00000170160	ENST00000399273;ENST00000443444;ENST00000360524;ENST00000456009	T;T;T;T	0.29142	1.58;1.58;1.58;1.58	2.1	-0.848	0.10727	.	.	.	.	.	T	0.26774	0.0655	L	0.33624	1.015	0.09310	N	1	D;P	0.56035	0.974;0.724	P;B	0.50440	0.641;0.258	T	0.16571	-1.0398	9	0.38643	T	0.18	.	6.2207	0.20679	0.4653:0.5347:0.0:0.0	.	1064;1298	A2RUR9-3;A2RUR9	.;C144A_HUMAN	D	1298;1298;1298;1064	ENSP00000382215:N1298D;ENSP00000439262:N1298D;ENSP00000353717:N1298D;ENSP00000394201:N1064D	ENSP00000353717:N1298D	N	+	1	0	CCDC144A	16608008	1.000000	0.71417	0.003000	0.11579	0.146000	0.21551	3.000000	0.49481	-0.402000	0.07633	0.155000	0.16302	AAT	.	.		0.368	CCDC144A-013	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000444093.1		
SLC5A10	125206	hgsc.bcm.edu	37	17	18872377	18872377	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A7IE-01A-21D-A382-10	TCGA-CC-A7IE-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c1caf517-5052-48e3-ad80-8458b3d2ff5f	ab81329b-c119-4a5a-863c-5b50f48cee3f	g.chr17:18872377G>A	ENST00000395645.3	+	6	484	c.466G>A	c.(466-468)Gcg>Acg	p.A156T	SLC5A10_ENST00000395642.1_Missense_Mutation_p.A100T|SLC5A10_ENST00000417251.2_Missense_Mutation_p.A156T|SLC5A10_ENST00000317977.6_Missense_Mutation_p.A100T|FAM83G_ENST00000388995.6_3'UTR|SLC5A10_ENST00000395647.2_Missense_Mutation_p.A156T|SLC5A10_ENST00000395643.2_Missense_Mutation_p.A156T	NM_001042450.2	NP_001035915.1	A0PJK1	SC5AA_HUMAN	solute carrier family 5 (sodium/sugar cotransporter), member 10	156					sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)	p.A156T(1)		central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(3)|ovary(3)|prostate(3)|skin(3)	24						GGACCTGTACGCGGGGGCTCT	0.612																																					p.A156T		Atlas-SNP	.											SLC5A10,NS,carcinoma,0,1	SLC5A10	55	.	1	Substitution - Missense(1)	prostate(1)	c.G466A						.						123.0	97.0	106.0					17																	18872377		2203	4300	6503	SO:0001583	missense	125206	exon6			CTGTACGCGGGGG		CCDS11201.2, CCDS42275.1, CCDS59277.1, CCDS59278.1, CCDS74008.1	17p11.2	2013-07-19	2013-07-19		ENSG00000154025	ENSG00000154025		"""Solute carriers"""	23155	protein-coding gene	gene with protein product			"""solute carrier family 5 (sodium/glucose cotransporter), member 10"""				Standard	NM_152351		Approved	SGLT5	uc002gut.2	A0PJK1	OTTHUMG00000178143	ENST00000395645.3:c.466G>A	chr17.hg19:g.18872377G>A	ENSP00000379007:p.Ala156Thr	43.0	0.0		41.0	10.0	NM_001042450	A8MUC9|B4DPI0|B7WPR4|Q6P5X0|Q8IXM4|Q96LQ1	Missense_Mutation	SNP	ENST00000395645.3	hg19	CCDS42275.1	.	.	.	.	.	.	.	.	.	.	G	15.41	2.825416	0.50739	.	.	ENSG00000154025	ENST00000317977;ENST00000395647;ENST00000395642;ENST00000417251;ENST00000395645;ENST00000395643	D;D;D;D;D;D	0.92397	-3.03;-2.49;-3.03;-2.49;-2.49;-2.67	4.82	2.63	0.31362	.	0.057677	0.64402	D	0.000001	D	0.91576	0.7339	M	0.83774	2.66	0.80722	D	1	P;P;P;P;D	0.56521	0.882;0.857;0.882;0.857;0.976	B;B;B;B;B	0.43508	0.418;0.294;0.418;0.294;0.422	D	0.91139	0.4944	10	0.52906	T	0.07	.	11.5417	0.50669	0.0:0.0:0.4576:0.5424	.	156;156;156;156;100	B4DPI0;A0PJK1-2;A0PJK1;A0PJK1-4;A0PJK1-3	.;.;SC5AA_HUMAN;.;.	T	100;156;100;156;156;156	ENSP00000324346:A100T;ENSP00000379008:A156T;ENSP00000379004:A100T;ENSP00000401875:A156T;ENSP00000379007:A156T;ENSP00000379005:A156T	ENSP00000324346:A100T	A	+	1	0	SLC5A10	18813102	1.000000	0.71417	0.443000	0.26883	0.157000	0.22087	5.242000	0.65389	1.150000	0.42419	0.462000	0.41574	GCG	.	.		0.612	SLC5A10-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132129.2	NM_152351	
NOS2	4843	hgsc.bcm.edu	37	17	26096596	26096596	+	Silent	SNP	C	C	T			TCGA-CC-A7IE-01A-21D-A382-10	TCGA-CC-A7IE-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c1caf517-5052-48e3-ad80-8458b3d2ff5f	ab81329b-c119-4a5a-863c-5b50f48cee3f	g.chr17:26096596C>T	ENST00000313735.6	-	16	2057	c.1824G>A	c.(1822-1824)tcG>tcA	p.S608S		NM_000625.4	NP_000616.3	P35228	NOS2_HUMAN	nitric oxide synthase 2, inducible	608	Flavodoxin-like. {ECO:0000255|PROSITE- ProRule:PRU00088}.		S -> L (in dbSNP:rs2297518). {ECO:0000269|PubMed:7528017, ECO:0000269|PubMed:7531687, ECO:0000269|Ref.10}.		arginine catabolic process (GO:0006527)|blood coagulation (GO:0007596)|cellular response to interferon-gamma (GO:0071346)|cellular response to lipopolysaccharide (GO:0071222)|circadian rhythm (GO:0007623)|defense response to bacterium (GO:0042742)|defense response to Gram-negative bacterium (GO:0050829)|inflammatory response (GO:0006954)|innate immune response in mucosa (GO:0002227)|interaction with host (GO:0051701)|negative regulation of blood pressure (GO:0045776)|negative regulation of gene expression (GO:0010629)|negative regulation of protein catabolic process (GO:0042177)|nitric oxide biosynthetic process (GO:0006809)|nitric oxide mediated signal transduction (GO:0007263)|peptidyl-cysteine S-nitrosylation (GO:0018119)|phagosome maturation (GO:0090382)|positive regulation of guanylate cyclase activity (GO:0031284)|positive regulation of killing of cells of other organism (GO:0051712)|positive regulation of leukocyte mediated cytotoxicity (GO:0001912)|positive regulation of vasodilation (GO:0045909)|regulation of cell proliferation (GO:0042127)|regulation of cellular respiration (GO:0043457)|regulation of insulin secretion (GO:0050796)|response to bacterium (GO:0009617)|response to hypoxia (GO:0001666)|superoxide metabolic process (GO:0006801)	cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular (GO:0005622)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|peroxisome (GO:0005777)	arginine binding (GO:0034618)|flavin adenine dinucleotide binding (GO:0050660)|FMN binding (GO:0010181)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|NADP binding (GO:0050661)|NADPH-hemoprotein reductase activity (GO:0003958)|nitric-oxide synthase activity (GO:0004517)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)|tetrahydrobiopterin binding (GO:0034617)			autonomic_ganglia(1)|breast(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(8)|lung(28)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	56					Dexamethasone(DB01234)|Doxorubicin(DB00997)|L-Arginine(DB00125)|L-Citrulline(DB00155)|Miconazole(DB01110)|Triflusal(DB08814)	GCATGAAGAGCGATTTCTTCA	0.458																																					p.S608S		Atlas-SNP	.											NOS2,right_upper_lobe,carcinoma,0,1	NOS2	113	.	0			c.G1824A						.						111.0	101.0	105.0					17																	26096596		2203	4300	6503	SO:0001819	synonymous_variant	4843	exon16			GAAGAGCGATTTC	U20141	CCDS11223.1	17q11.2	2014-06-12	2008-09-16	2008-09-16	ENSG00000007171	ENSG00000007171	1.14.13.39		7873	protein-coding gene	gene with protein product		163730	"""nitric oxide synthase 2A (inducible, hepatocytes)"""	NOS2A		7682706	Standard	NM_000625		Approved	iNOS, NOS, HEP-NOS	uc002gzu.3	P35228	OTTHUMG00000132445	ENST00000313735.6:c.1824G>A	chr17.hg19:g.26096596C>T		177.0	0.0		234.0	69.0	NM_000625	A1L3U5|B7ZLY2|O60757|O94994|Q16263|Q16692|Q4TTS5|Q9UD42	Silent	SNP	ENST00000313735.6	hg19	CCDS11223.1																																																																																			.	.		0.458	NOS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255597.1	NM_000625	
SARM1	23098	hgsc.bcm.edu	37	17	26715488	26715488	+	Missense_Mutation	SNP	T	T	G			TCGA-CC-A7IE-01A-21D-A382-10	TCGA-CC-A7IE-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c1caf517-5052-48e3-ad80-8458b3d2ff5f	ab81329b-c119-4a5a-863c-5b50f48cee3f	g.chr17:26715488T>G	ENST00000457710.3	+	7	2222	c.1751T>G	c.(1750-1752)gTg>gGg	p.V584G	SARM1_ENST00000379061.4_3'UTR	NM_015077.2	NP_055892.2	Q6SZW1	SARM1_HUMAN	sterile alpha and TIR motif containing 1	618	TIR.				innate immune response (GO:0045087)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|regulation of apoptotic process (GO:0042981)|regulation of dendrite morphogenesis (GO:0048814)|regulation of neuron death (GO:1901214)|response to glucose (GO:0009749)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|extrinsic component of mitochondrial outer membrane (GO:0031315)|microtubule (GO:0005874)|mitochondrion (GO:0005739)|synapse (GO:0045202)				cervix(1)|endometrium(1)|large_intestine(3)|lung(5)|skin(1)|upper_aerodigestive_tract(1)	12	all_lung(13;0.000533)|Lung NSC(42;0.00171)			UCEC - Uterine corpus endometrioid carcinoma (53;0.154)		CGCAACTTTGTGTTGGTGCTA	0.532																																					p.V617G		Atlas-SNP	.											.	SARM1	40	.	0			c.T1850G						.						212.0	185.0	194.0					17																	26715488		2203	4300	6503	SO:0001583	missense	23098	exon8			ACTTTGTGTTGGT	AB011096		17q11	2013-01-10			ENSG00000004139	ENSG00000004139		"""Sterile alpha motif (SAM) domain containing"""	17074	protein-coding gene	gene with protein product		607732				9628581	Standard	NM_015077		Approved	SARM, SAMD2, KIAA0524	uc010crl.1	Q6SZW1	OTTHUMG00000132499	ENST00000457710.3:c.1751T>G	chr17.hg19:g.26715488T>G	ENSP00000406738:p.Val584Gly	64.0	0.0		87.0	27.0	NM_015077	O60277|Q7LGG3|Q9NXY5	Missense_Mutation	SNP	ENST00000457710.3	hg19		.	.	.	.	.	.	.	.	.	.	T	20.9	4.064155	0.76187	.	.	ENSG00000004139	ENST00000457710;ENST00000003834	.	.	.	5.39	5.39	0.77823	Toll/interleukin-1 receptor homology (TIR) domain (2);	0.063724	0.64402	D	0.000004	T	0.75700	0.3885	.	.	.	0.80722	D	1	D	0.65815	0.995	P	0.60415	0.874	T	0.79293	-0.1863	8	0.87932	D	0	-37.1449	14.1311	0.65255	0.0:0.0:0.0:1.0	.	618	Q6SZW1	SARM1_HUMAN	G	616;584	.	ENSP00000003834:V584G	V	+	2	0	SARM1	23739615	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	7.868000	0.87116	2.255000	0.74692	0.533000	0.62120	GTG	.	.		0.532	SARM1-001	NOVEL	basic|appris_principal|exp_conf	protein_coding	protein_coding	OTTHUMT00000255679.3	NM_015077	
DNAH17	8632	hgsc.bcm.edu	37	17	76497896	76497896	+	Silent	SNP	C	C	T			TCGA-CC-A7IE-01A-21D-A382-10	TCGA-CC-A7IE-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c1caf517-5052-48e3-ad80-8458b3d2ff5f	ab81329b-c119-4a5a-863c-5b50f48cee3f	g.chr17:76497896C>T	ENST00000585328.1	-	34	5365	c.5241G>A	c.(5239-5241)agG>agA	p.R1747R	DNAH17-AS1_ENST00000598378.1_3'UTR|DNAH17_ENST00000389840.5_Silent_p.R1739R|RP11-559N14.5_ENST00000591373.1_RNA	NM_173628.3	NP_775899.3	Q9UFH2	DYH17_HUMAN	dynein, axonemal, heavy chain 17	1739	Stem. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(2)|breast(7)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(13)|large_intestine(8)|lung(37)|ovary(8)|prostate(7)|skin(4)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	116			BRCA - Breast invasive adenocarcinoma(99;0.00294)|OV - Ovarian serous cystadenocarcinoma(97;0.0656)			TGATCTTCATCCTGTCGCCAG	0.607																																					p.R1750R		Atlas-SNP	.											.	DNAH17	347	.	0			c.G5250A						.						157.0	159.0	158.0					17																	76497896		2182	4281	6463	SO:0001819	synonymous_variant	8632	exon34			CTTCATCCTGTCG	AJ000522		17q25.3	2012-04-19	2006-09-04		ENSG00000187775	ENSG00000187775		"""Axonemal dyneins"""	2946	protein-coding gene	gene with protein product		610063	"""dynein, axonemal, heavy polypeptide 17"", ""dynein, axonemal, heavy chain like 1"", ""dynein, axonemal, heavy like 1"""	DNAHL1		9545504	Standard	NM_173628		Approved	DNEL2, FLJ40457	uc010dhp.2	Q9UFH2		ENST00000585328.1:c.5241G>A	chr17.hg19:g.76497896C>T		38.0	0.0		49.0	12.0	NM_173628	O00431|O15206|Q2M2Y1|Q6ZRQ2|Q8N7Q7	Silent	SNP	ENST00000585328.1	hg19																																																																																				.	.		0.607	DNAH17-001	PUTATIVE	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000318962.2	NM_173628	
RIT2	6014	hgsc.bcm.edu	37	18	40554066	40554066	+	Silent	SNP	G	G	A			TCGA-CC-A7IE-01A-21D-A382-10	TCGA-CC-A7IE-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c1caf517-5052-48e3-ad80-8458b3d2ff5f	ab81329b-c119-4a5a-863c-5b50f48cee3f	g.chr18:40554066G>A	ENST00000326695.5	-	3	378	c.207C>T	c.(205-207)taC>taT	p.Y69Y	RIT2_ENST00000589109.1_Silent_p.Y69Y|RIT2_ENST00000282028.4_Silent_p.Y69Y|RIT2_ENST00000590910.1_Silent_p.Y69Y	NM_002930.2	NP_002921.1	Q99578	RIT2_HUMAN	Ras-like without CAAX 2	69					neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|synaptic transmission (GO:0007268)	nucleus (GO:0005634)|plasma membrane (GO:0005886)	calmodulin binding (GO:0005516)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)			endometrium(1)|large_intestine(2)|lung(11)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	19						AGATGTCCAAGTAAGCTGGCT	0.368																																					p.Y69Y		Atlas-SNP	.											.	RIT2	56	.	0			c.C207T						.						76.0	66.0	70.0					18																	40554066		2203	4300	6503	SO:0001819	synonymous_variant	6014	exon3			GTCCAAGTAAGCT	BC018060	CCDS11921.1, CCDS62431.1	18q12.3	2014-05-09	2002-09-11	2002-09-13	ENSG00000152214	ENSG00000152214			10017	protein-coding gene	gene with protein product		609592	"""Ric (Drosophila)-like, expressed in neurons"""	RIN		8824319, 8918462	Standard	NM_002930		Approved	RIBA	uc002lav.4	Q99578	OTTHUMG00000132611	ENST00000326695.5:c.207C>T	chr18.hg19:g.40554066G>A		388.0	0.0		346.0	119.0	NM_001272077	B2R9L1|O15295|Q8TD69|Q8WVF6|Q92964	Silent	SNP	ENST00000326695.5	hg19	CCDS11921.1																																																																																			.	.		0.368	RIT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255852.1	NM_002930	
EPG5	57724	hgsc.bcm.edu	37	18	43532421	43532421	+	Silent	SNP	T	T	C			TCGA-CC-A7IE-01A-21D-A382-10	TCGA-CC-A7IE-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c1caf517-5052-48e3-ad80-8458b3d2ff5f	ab81329b-c119-4a5a-863c-5b50f48cee3f	g.chr18:43532421T>C	ENST00000282041.5	-	3	1231	c.1197A>G	c.(1195-1197)gcA>gcG	p.A399A		NM_020964.2	NP_066015.2	Q9HCE0	EPG5_HUMAN	ectopic P-granules autophagy protein 5 homolog (C. elegans)	399					autophagic vacuole maturation (GO:0097352)|autophagy (GO:0006914)|endocytic recycling (GO:0032456)					NS(1)|breast(9)|central_nervous_system(3)|cervix(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(22)|lung(35)|ovary(2)|pancreas(1)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	95						TACTGAGCAATGCATAGATGT	0.433																																					p.A399A		Atlas-SNP	.											.	EPG5	199	.	0			c.A1197G						.						105.0	101.0	102.0					18																	43532421		1936	4134	6070	SO:0001819	synonymous_variant	57724	exon3			GAGCAATGCATAG	AK023817	CCDS11926.2	18q12.3	2011-03-02	2011-03-02	2011-03-02	ENSG00000152223	ENSG00000152223			29331	protein-coding gene	gene with protein product		615068	"""KIAA1632"""	KIAA1632		10997877, 20550938	Standard	XM_005258323		Approved	hEPG5	uc002lbm.3	Q9HCE0	OTTHUMG00000132626	ENST00000282041.5:c.1197A>G	chr18.hg19:g.43532421T>C		76.0	0.0		62.0	19.0	NM_020964	A2BDF3|Q9H8C8	Silent	SNP	ENST00000282041.5	hg19	CCDS11926.2																																																																																			.	.		0.433	EPG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445081.1	NM_020964	
SH3GL1	6455	hgsc.bcm.edu	37	19	4366971	4366971	+	Silent	SNP	T	T	A			TCGA-CC-A7IE-01A-21D-A382-10	TCGA-CC-A7IE-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c1caf517-5052-48e3-ad80-8458b3d2ff5f	ab81329b-c119-4a5a-863c-5b50f48cee3f	g.chr19:4366971T>A	ENST00000269886.3	-	2	244	c.66A>T	c.(64-66)ggA>ggT	p.G22G	SH3GL1_ENST00000417295.2_Silent_p.G22G|AC007292.6_ENST00000594444.1_RNA|SH3GL1_ENST00000598564.1_Silent_p.G22G	NM_003025.3	NP_003016.1	Q99961	SH3G1_HUMAN	SH3-domain GRB2-like 1	22	BAR. {ECO:0000255|PROSITE- ProRule:PRU00361}.				central nervous system development (GO:0007417)|endocytosis (GO:0006897)|signal transduction (GO:0007165)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|endosome (GO:0005768)|membrane (GO:0016020)	identical protein binding (GO:0042802)|lipid binding (GO:0008289)			NS(1)|endometrium(2)|kidney(16)|large_intestine(3)|lung(2)|ovary(2)	26				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0152)|STAD - Stomach adenocarcinoma(1328;0.182)		CCTCGGCCCCTCCGACCTTCT	0.597			T	MLL	AL																																p.G22G	NSCLC(94;1152 2133 30346 33362)	Atlas-SNP	.		Dom	yes		19	19p13.3	6455	SH3-domain GRB2-like 1 (EEN)		L	.	SH3GL1	52	.	0			c.A66T						.						296.0	258.0	271.0					19																	4366971		2203	4300	6503	SO:0001819	synonymous_variant	6455	exon2			GGCCCCTCCGACC		CCDS32874.1, CCDS56076.1, CCDS59335.1	19p13.3	2008-07-22							10830	protein-coding gene	gene with protein product	"""extra 11-19 leukemia fusion"", ""fusion partner of MLL"", ""SH3-containing Grb-2-like 1 protein"", ""SH3-containing protein EEN"", ""SH3 domain GRB2-like 1"""	601768				9169142	Standard	NM_003025		Approved	SH3P8, SH3D2B, CNSA1, EEN, MGC111371	uc002maj.3	Q99961		ENST00000269886.3:c.66A>T	chr19.hg19:g.4366971T>A		51.0	0.0		51.0	6.0	NM_001199944	B4DRA1|E7EVZ4|M0QZV5|Q99668	Silent	SNP	ENST00000269886.3	hg19	CCDS32874.1																																																																																			.	.		0.597	SH3GL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458302.1	NM_003025	
ANGPTL4	51129	hgsc.bcm.edu	37	19	8429440	8429440	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A7IE-01A-21D-A382-10	TCGA-CC-A7IE-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c1caf517-5052-48e3-ad80-8458b3d2ff5f	ab81329b-c119-4a5a-863c-5b50f48cee3f	g.chr19:8429440G>A	ENST00000301455.2	+	1	406	c.235G>A	c.(235-237)Gcc>Acc	p.A79T	ANGPTL4_ENST00000541807.1_Intron|ANGPTL4_ENST00000393962.2_Missense_Mutation_p.A79T	NM_139314.1	NP_647475.1	Q9BY76	ANGL4_HUMAN	angiopoietin-like 4	79					angiogenesis (GO:0001525)|cell differentiation (GO:0030154)|cellular lipid metabolic process (GO:0044255)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of lipoprotein lipase activity (GO:0051005)|positive regulation of angiogenesis (GO:0045766)|protein homooligomerization (GO:0051260)|response to hypoxia (GO:0001666)|small molecule metabolic process (GO:0044281)|triglyceride homeostasis (GO:0070328)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	enzyme inhibitor activity (GO:0004857)			large_intestine(1)|lung(1)|ovary(2)|skin(2)	6						GTGCGGGTCCGCCTGTCAGGG	0.721																																					p.A79T		Atlas-SNP	.											.	ANGPTL4	21	.	0			c.G235A						.						9.0	9.0	9.0					19																	8429440		2124	4147	6271	SO:0001583	missense	51129	exon1			GGGTCCGCCTGTC	AF202636	CCDS12200.1, CCDS42493.1	19p13.3	2013-10-07				ENSG00000167772		"""Fibrinogen C domain containing"""	16039	protein-coding gene	gene with protein product	"""fasting-induced adipose factor"", ""hepatic angiopoietin-related protein"", ""PPARG angiopoietin related protein"", ""hepatic fibrinogen/angiopoietin-related protein"", ""peroxisome proliferator-activated receptor (PPAR) gamma induced angiopoietin-related protein"", ""angiopoietin-related protein 4"""	605910				10698685, 10866690, 23960078	Standard	NM_139314		Approved	pp1158, PGAR, ARP4, HFARP, FIAF, NL2	uc002mjq.1	Q9BY76		ENST00000301455.2:c.235G>A	chr19.hg19:g.8429440G>A	ENSP00000301455:p.Ala79Thr	107.0	0.0		115.0	40.0	NM_001039667	A8MY84|B4E089|D6W670|F5H0I2|Q53HQ6|Q53HU1|Q6UXN0|Q9HBV4|Q9NZU4|Q9Y5B3	Missense_Mutation	SNP	ENST00000301455.2	hg19	CCDS12200.1	.	.	.	.	.	.	.	.	.	.	G	13.73	2.325607	0.41197	.	.	ENSG00000167772	ENST00000301455;ENST00000393962	T;T	0.45276	0.9;0.9	4.89	1.47	0.22746	.	1.117340	0.06816	N	0.791231	T	0.33614	0.0869	L	0.51422	1.61	0.39349	D	0.965725	B;B	0.16802	0.019;0.005	B;B	0.09377	0.004;0.001	T	0.14980	-1.0453	10	0.15066	T	0.55	.	5.955	0.19269	0.1709:0.0:0.6765:0.1526	.	79;79	A8MY84;Q9BY76	.;ANGL4_HUMAN	T	79	ENSP00000301455:A79T;ENSP00000377534:A79T	ENSP00000301455:A79T	A	+	1	0	ANGPTL4	8335440	0.181000	0.23161	0.300000	0.25030	0.061000	0.15899	0.663000	0.25053	0.116000	0.18110	0.486000	0.48141	GCC	.	.		0.721	ANGPTL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460322.1	NM_139314	
LRP3	4037	hgsc.bcm.edu	37	19	33693781	33693781	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A7IE-01A-21D-A382-10	TCGA-CC-A7IE-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c1caf517-5052-48e3-ad80-8458b3d2ff5f	ab81329b-c119-4a5a-863c-5b50f48cee3f	g.chr19:33693781A>G	ENST00000253193.7	+	3	351	c.149A>G	c.(148-150)cAc>cGc	p.H50R		NM_002333.3	NP_002324.2	O75074	LRP3_HUMAN	low density lipoprotein receptor-related protein 3	50	CUB 1. {ECO:0000255|PROSITE- ProRule:PRU00059}.				receptor-mediated endocytosis (GO:0006898)	coated pit (GO:0005905)|integral component of membrane (GO:0016021)				breast(1)|kidney(1)|large_intestine(1)|lung(9)|ovary(1)|pancreas(2)	15	Esophageal squamous(110;0.137)					CTGGAGCAGCACACGGAGCGG	0.672																																					p.H50R		Atlas-SNP	.											.	LRP3	46	.	0			c.A149G						.						34.0	28.0	30.0					19																	33693781		2202	4300	6502	SO:0001583	missense	4037	exon3			AGCAGCACACGGA	AB009462	CCDS12430.1	19q13.11	2013-05-30			ENSG00000130881	ENSG00000130881		"""Low density lipoprotein receptors"""	6695	protein-coding gene	gene with protein product		603159				9693042, 7959795	Standard	NM_002333		Approved	LRP-3, hLRp105	uc010edh.3	O75074	OTTHUMG00000180343	ENST00000253193.7:c.149A>G	chr19.hg19:g.33693781A>G	ENSP00000253193:p.His50Arg	82.0	0.0		91.0	32.0	NM_002333	B3KQD6|B4DKF2	Missense_Mutation	SNP	ENST00000253193.7	hg19	CCDS12430.1	.	.	.	.	.	.	.	.	.	.	A	16.35	3.098979	0.56183	.	.	ENSG00000130881	ENST00000253193	T	0.17370	2.28	5.12	5.12	0.69794	CUB (5);	0.000000	0.85682	D	0.000000	T	0.33118	0.0852	L	0.43923	1.385	0.80722	D	1	D	0.76494	0.999	D	0.69824	0.966	T	0.02966	-1.1088	10	0.56958	D	0.05	-53.6431	14.3813	0.66914	1.0:0.0:0.0:0.0	.	50	O75074	LRP3_HUMAN	R	50	ENSP00000253193:H50R	ENSP00000253193:H50R	H	+	2	0	LRP3	38385621	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	4.892000	0.63193	2.057000	0.61298	0.402000	0.26972	CAC	.	.		0.672	LRP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450842.4		
BCAM	4059	hgsc.bcm.edu	37	19	45315505	45315505	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A7IE-01A-21D-A382-10	TCGA-CC-A7IE-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c1caf517-5052-48e3-ad80-8458b3d2ff5f	ab81329b-c119-4a5a-863c-5b50f48cee3f	g.chr19:45315505G>T	ENST00000270233.6	+	3	312	c.290G>T	c.(289-291)gGc>gTc	p.G97V	BCAM_ENST00000589651.1_Missense_Mutation_p.G97V	NM_001013257.2|NM_005581.4	NP_001013275.1|NP_005572.2	P50895	BCAM_HUMAN	basal cell adhesion molecule (Lutheran blood group)	97	Ig-like V-type 1.				cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|signal transduction (GO:0007165)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	laminin binding (GO:0043236)|laminin receptor activity (GO:0005055)|transmembrane signaling receptor activity (GO:0004888)			central_nervous_system(1)|kidney(3)|large_intestine(4)|lung(9)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	22	Lung NSC(12;0.000789)|all_lung(12;0.00218)	Ovarian(192;0.0728)|all_neural(266;0.112)				GACACCCGGGGCCGCAGTCCC	0.716																																					p.G97V		Atlas-SNP	.											.	BCAM	53	.	0			c.G290T						.						20.0	24.0	23.0					19																	45315505		2200	4296	6496	SO:0001583	missense	4059	exon3			CCCGGGGCCGCAG	X83425	CCDS12644.1, CCDS42575.1	19q12-q13	2014-07-18	2006-02-23	2006-01-12		ENSG00000187244		"""CD molecules"", ""Blood group antigens"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6722	protein-coding gene	gene with protein product		612773	"""Lutheran blood group (Auberger b antigen included)"", ""basal cell adhesion molecule (Lu and Au blood groups)"""	LU			Standard	NM_005581		Approved	CD239	uc002ozu.4	P50895		ENST00000270233.6:c.290G>T	chr19.hg19:g.45315505G>T	ENSP00000270233:p.Gly97Val	123.0	0.0		112.0	40.0	NM_001013257	A8MYF9|A9YWT5|A9YWT6|Q86VC7	Missense_Mutation	SNP	ENST00000270233.6	hg19	CCDS12644.1	.	.	.	.	.	.	.	.	.	.	.	14.89	2.669301	0.47677	.	.	ENSG00000187244	ENST00000270233;ENST00000391955	T;T	0.62364	0.03;0.09	3.43	2.38	0.29361	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.55641	0.1933	L	0.29908	0.895	0.50813	D	0.999898	D	0.54047	0.964	P	0.53809	0.735	T	0.49661	-0.8916	9	0.34782	T	0.22	-9.1272	6.7393	0.23426	0.1352:0.0:0.8648:0.0	.	97	P50895	BCAM_HUMAN	V	97	ENSP00000270233:G97V;ENSP00000375817:G97V	ENSP00000270233:G97V	G	+	2	0	BCAM	50007345	0.959000	0.32827	0.866000	0.34008	0.614000	0.37383	0.446000	0.21694	0.771000	0.33359	0.313000	0.20887	GGC	.	.		0.716	BCAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453220.1	NM_005581	
FCGRT	2217	hgsc.bcm.edu	37	19	50027980	50027980	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A7IE-01A-21D-A382-10	TCGA-CC-A7IE-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c1caf517-5052-48e3-ad80-8458b3d2ff5f	ab81329b-c119-4a5a-863c-5b50f48cee3f	g.chr19:50027980A>G	ENST00000221466.5	+	5	1304	c.818A>G	c.(817-819)tAc>tGc	p.Y273C	FCGRT_ENST00000599988.1_Intron|FCGRT_ENST00000596975.1_Missense_Mutation_p.Y181C|FCGRT_ENST00000426395.3_Missense_Mutation_p.Y273C|RCN3_ENST00000270645.3_5'Flank	NM_001136019.2	NP_001129491.1	P55899	FCGRN_HUMAN	Fc fragment of IgG, receptor, transporter, alpha	273	Alpha-3.|Ig-like C1-type.				antigen processing and presentation (GO:0019882)|IgG immunoglobulin transcytosis in epithelial cells mediated by FcRn immunoglobulin receptor (GO:0002416)|immune response (GO:0006955)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	IgG binding (GO:0019864)			endometrium(3)|kidney(2)|lung(1)|ovary(1)|prostate(1)|skin(1)	9		all_lung(116;7.84e-06)|Lung NSC(112;2.8e-05)|all_neural(266;0.0966)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.00291)|GBM - Glioblastoma multiforme(134;0.0156)		GAGCACCACTACTGCTGCATT	0.642																																					p.Y273C		Atlas-SNP	.											.	FCGRT	23	.	0			c.A818G						.						54.0	45.0	48.0					19																	50027980		2203	4300	6503	SO:0001583	missense	2217	exon5			ACCACTACTGCTG	U12255	CCDS12770.1	19q13.3	2013-01-11				ENSG00000104870		"""Immunoglobulin superfamily / C1-set domain containing"""	3621	protein-coding gene	gene with protein product		601437				7964511, 8646894	Standard	NM_001136019		Approved	FCRN, alpha-chain	uc002pog.2	P55899		ENST00000221466.5:c.818A>G	chr19.hg19:g.50027980A>G	ENSP00000221466:p.Tyr273Cys	14.0	0.0		19.0	6.0	NM_001136019	Q5HYM5|Q9HBV7|Q9NZ19	Missense_Mutation	SNP	ENST00000221466.5	hg19	CCDS12770.1	.	.	.	.	.	.	.	.	.	.	A	15.83	2.948209	0.53186	.	.	ENSG00000104870	ENST00000221466;ENST00000426395	T;T	0.05786	3.39;3.39	4.31	3.3	0.37823	Immunoglobulin/major histocompatibility complex, conserved site (1);Immunoglobulin-like (1);Immunoglobulin C1-set (2);Immunoglobulin-like fold (1);	0.000000	0.40640	N	0.001047	T	0.28001	0.0690	M	0.92833	3.35	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.01874	-1.1256	10	0.87932	D	0	.	6.6251	0.22824	0.8912:0.0:0.1088:0.0	.	273	P55899	FCGRN_HUMAN	C	273	ENSP00000221466:Y273C;ENSP00000410798:Y273C	ENSP00000221466:Y273C	Y	+	2	0	FCGRT	54719792	0.991000	0.36638	1.000000	0.80357	0.747000	0.42532	3.973000	0.56845	0.817000	0.34445	0.379000	0.24179	TAC	.	.		0.642	FCGRT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465267.1		
MRPS26	64949	hgsc.bcm.edu	37	20	3027362	3027362	+	Missense_Mutation	SNP	G	G	C			TCGA-CC-A7IE-01A-21D-A382-10	TCGA-CC-A7IE-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c1caf517-5052-48e3-ad80-8458b3d2ff5f	ab81329b-c119-4a5a-863c-5b50f48cee3f	g.chr20:3027362G>C	ENST00000380325.3	+	3	586	c.462G>C	c.(460-462)gaG>gaC	p.E154D		NM_030811.3	NP_110438.1	Q9BYN8	RT26_HUMAN	mitochondrial ribosomal protein S26	154					DNA damage response, detection of DNA damage (GO:0042769)|peptide biosynthetic process (GO:0043043)	mitochondrial small ribosomal subunit (GO:0005763)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			kidney(1)|lung(1)	2						AGCGCAAGGAGCGGGAAGTGC	0.716																																					p.E154D		Atlas-SNP	.											.	MRPS26	7	.	0			c.G462C						.						11.0	11.0	11.0					20																	3027362		2004	3917	5921	SO:0001583	missense	64949	exon3			CAAGGAGCGGGAA	AB051354	CCDS13043.1	20p13	2012-09-13	2004-09-22		ENSG00000125901	ENSG00000125901		"""Mitochondrial ribosomal proteins / small subunits"""	14045	protein-coding gene	gene with protein product		611988	"""chromosome 20 open reading frame 193"""	C20orf193		11543634	Standard	NM_030811		Approved	MRP-S13, MRP-S26, RPMS13, dJ534B8.3	uc002whs.3	Q9BYN8	OTTHUMG00000031721	ENST00000380325.3:c.462G>C	chr20.hg19:g.3027362G>C	ENSP00000369682:p.Glu154Asp	97.0	0.0		99.0	39.0	NM_030811	Q96Q58	Missense_Mutation	SNP	ENST00000380325.3	hg19	CCDS13043.1	.	.	.	.	.	.	.	.	.	.	G	12.42	1.932963	0.34096	.	.	ENSG00000125901	ENST00000380325	.	.	.	5.19	2.12	0.27331	.	0.000000	0.85682	D	0.000000	T	0.48995	0.1531	M	0.68317	2.08	0.27295	N	0.957731	D	0.56521	0.976	P	0.53266	0.722	T	0.43507	-0.9387	9	0.41790	T	0.15	-26.0267	9.5141	0.39095	0.1774:0.1085:0.7141:0.0	.	154	Q9BYN8	RT26_HUMAN	D	154	.	ENSP00000369682:E154D	E	+	3	2	MRPS26	2975362	0.985000	0.35326	0.624000	0.29186	0.084000	0.17831	2.041000	0.41213	-0.024000	0.13941	-1.587000	0.00848	GAG	.	.		0.716	MRPS26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077692.2	NM_030811	
MACROD2	140733	hgsc.bcm.edu	37	20	16025252	16025252	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A7IE-01A-21D-A382-10	TCGA-CC-A7IE-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c1caf517-5052-48e3-ad80-8458b3d2ff5f	ab81329b-c119-4a5a-863c-5b50f48cee3f	g.chr20:16025252C>A	ENST00000310348.4	+	17	1268	c.1268C>A	c.(1267-1269)cCa>cAa	p.P423Q	MACROD2_ENST00000407045.3_Missense_Mutation_p.P74Q|MACROD2_ENST00000402914.1_Missense_Mutation_p.P188Q|MACROD2_ENST00000217246.4_Intron|MACROD2_ENST00000378058.3_Missense_Mutation_p.P188Q			A1Z1Q3	MACD2_HUMAN	MACRO domain containing 2	423					brain development (GO:0007420)|cellular response to DNA damage stimulus (GO:0006974)|protein de-ADP-ribosylation (GO:0051725)|purine nucleoside metabolic process (GO:0042278)	nucleus (GO:0005634)	deacetylase activity (GO:0019213)|hydrolase activity, acting on glycosyl bonds (GO:0016798)			breast(2)|kidney(4)|large_intestine(5)|lung(8)|skin(1)	20		all_neural(2;0.0381)|Acute lymphoblastic leukemia(2;0.175)				GTAAATGACCCAACAGAGAGT	0.333																																					p.P188Q		Atlas-SNP	.											MACROD2,NS,adenocarcinoma,0,1	MACROD2	34	.	0			c.C563A						.						94.0	88.0	90.0					20																	16025252		2203	4300	6503	SO:0001583	missense	140733	exon13			ATGACCCAACAGA	BC101218	CCDS13120.2, CCDS33443.1	20p12.1	2011-04-28	2007-07-24	2007-07-24	ENSG00000172264	ENSG00000172264			16126	protein-coding gene	gene with protein product		611567	"""chromosome 20 open reading frame 133"""	C20orf133			Standard	NM_080676		Approved	dJ631M13.5	uc002wot.3	A1Z1Q3	OTTHUMG00000031919	ENST00000310348.4:c.1268C>A	chr20.hg19:g.16025252C>A	ENSP00000309809:p.Pro423Gln	162.0	1.0		151.0	38.0	NM_001033087	A6NFF7|B0QZ39|B3KWV0|Q0P6D5|Q495E0|Q5W199|Q6ZN71	Missense_Mutation	SNP	ENST00000310348.4	hg19	CCDS13120.2	.	.	.	.	.	.	.	.	.	.	C	18.33	3.600251	0.66332	.	.	ENSG00000172264	ENST00000310348;ENST00000402914;ENST00000378058;ENST00000407045	T;T;T	0.63255	1.34;-0.03;-0.03	5.81	4.86	0.63082	.	.	.	.	.	T	0.76263	0.3963	.	.	.	0.28303	N	0.923011	D;D	0.67145	0.996;0.981	D;P	0.68483	0.958;0.77	T	0.70110	-0.4962	8	0.48119	T	0.1	.	12.6792	0.56912	0.0:0.923:0.0:0.077	.	74;423	A1Z1Q3-6;A1Z1Q3	.;MACD2_HUMAN	Q	423;188;188;74	ENSP00000309809:P423Q;ENSP00000385290:P188Q;ENSP00000367297:P188Q	ENSP00000309809:P423Q	P	+	2	0	MACROD2	15973252	0.944000	0.32072	1.000000	0.80357	0.908000	0.53690	1.534000	0.36051	1.431000	0.47355	0.655000	0.94253	CCA	.	.		0.333	MACROD2-201	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_080676	
RBM12	10137	hgsc.bcm.edu	37	20	34241608	34241608	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A7IE-01A-21D-A382-10	TCGA-CC-A7IE-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c1caf517-5052-48e3-ad80-8458b3d2ff5f	ab81329b-c119-4a5a-863c-5b50f48cee3f	g.chr20:34241608G>T	ENST00000374114.3	-	3	1900	c.1637C>A	c.(1636-1638)gCc>gAc	p.A546D	CPNE1_ENST00000317677.5_5'Flank|CPNE1_ENST00000352393.4_Intron|CPNE1_ENST00000397442.1_Intron|CPNE1_ENST00000397446.1_Intron|RBM12_ENST00000374104.3_Missense_Mutation_p.A546D|CPNE1_ENST00000397445.1_Intron|CPNE1_ENST00000397443.1_Intron|RP1-309K20.6_ENST00000541176.2_Intron|RBM12_ENST00000359646.1_Missense_Mutation_p.A546D|CPNE1_ENST00000317619.3_Intron	NM_001198838.1|NM_001198840.1|NM_006047.5	NP_001185767.1|NP_001185769.1|NP_006038.2	Q9NTZ6	RBM12_HUMAN	RNA binding motif protein 12	546						nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(3)|endometrium(7)|kidney(1)|large_intestine(3)|lung(14)|ovary(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	36	Lung NSC(9;0.00608)|all_lung(11;0.00918)		BRCA - Breast invasive adenocarcinoma(18;0.00953)			TGTTATGTGGGCACAGACTTT	0.398																																					p.A546D		Atlas-SNP	.											.	RBM12	93	.	0			c.C1637A						.						229.0	219.0	222.0					20																	34241608		2203	4300	6503	SO:0001583	missense	10137	exon2			ATGTGGGCACAGA	AJ289772	CCDS13261.1	20q11.21	2013-02-12			ENSG00000244462	ENSG00000244462		"""RNA binding motif (RRM) containing"""	9898	protein-coding gene	gene with protein product		607179				11435693	Standard	NM_006047		Approved	HRIHFB2091, KIAA0765, SWAN	uc021wcq.1	Q9NTZ6	OTTHUMG00000032350	ENST00000374114.3:c.1637C>A	chr20.hg19:g.34241608G>T	ENSP00000363228:p.Ala546Asp	84.0	0.0		111.0	24.0	NM_001198840	B3KRU2|E1P5R6|O94865|Q8N3B1|Q9H196	Missense_Mutation	SNP	ENST00000374114.3	hg19	CCDS13261.1	.	.	.	.	.	.	.	.	.	.	G	14.15	2.449488	0.43531	.	.	ENSG00000244462	ENST00000374114;ENST00000359646;ENST00000374104;ENST00000349942	T;T;T	0.15487	2.42;2.42;2.42	4.64	4.64	0.57946	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (1);	0.073163	0.53938	D	0.000050	T	0.31670	0.0804	L	0.43152	1.355	0.80722	D	1	D	0.58620	0.983	D	0.66351	0.943	T	0.02026	-1.1227	10	0.72032	D	0.01	-4.7841	13.4776	0.61318	0.0:0.1566:0.8434:0.0	.	546	Q9NTZ6	RBM12_HUMAN	D	546;546;546;345	ENSP00000363228:A546D;ENSP00000352668:A546D;ENSP00000363217:A546D	ENSP00000339879:A345D	A	-	2	0	RBM12	33705022	1.000000	0.71417	0.998000	0.56505	0.993000	0.82548	3.521000	0.53472	2.400000	0.81607	0.563000	0.77884	GCC	.	.		0.398	RBM12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078894.1	NM_006047	
NPBWR2	2832	hgsc.bcm.edu	37	20	62738102	62738102	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A7IE-01A-21D-A382-10	TCGA-CC-A7IE-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c1caf517-5052-48e3-ad80-8458b3d2ff5f	ab81329b-c119-4a5a-863c-5b50f48cee3f	g.chr20:62738102T>C	ENST00000369768.1	-	1	422	c.83A>G	c.(82-84)gAc>gGc	p.D28G		NM_005286.2	NP_005277.2	P48146	NPBW2_HUMAN	neuropeptides B/W receptor 2	28					G-protein coupled receptor signaling pathway (GO:0007186)|opioid receptor signaling pathway (GO:0038003)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	neuropeptide receptor activity (GO:0008188)|opioid receptor activity (GO:0004985)			haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(12)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18	all_cancers(38;2.58e-11)|all_epithelial(29;6.4e-13)|Lung NSC(23;1.25e-09)|all_lung(23;4.21e-09)					AGTGCCATTGTCCTGAGAGAC	0.632																																					p.D28G		Atlas-SNP	.											.	NPBWR2	36	.	0			c.A83G						.						83.0	80.0	81.0					20																	62738102		2203	4298	6501	SO:0001583	missense	2832	exon1			CCATTGTCCTGAG	U22492	CCDS13557.1	20q13.3	2012-08-08	2006-02-15	2006-02-15	ENSG00000125522	ENSG00000125522		"""GPCR / Class A : Neuropeptide receptors : W/B"""	4530	protein-coding gene	gene with protein product		600731	"""G protein-coupled receptor 8"""	GPR8		12401809	Standard	NM_005286		Approved		uc011abt.2	P48146	OTTHUMG00000033032	ENST00000369768.1:c.83A>G	chr20.hg19:g.62738102T>C	ENSP00000358783:p.Asp28Gly	58.0	0.0		70.0	31.0	NM_005286	Q6NWQ6|Q9H4K3	Missense_Mutation	SNP	ENST00000369768.1	hg19	CCDS13557.1	.	.	.	.	.	.	.	.	.	.	T	6.502	0.460805	0.12342	.	.	ENSG00000125522	ENST00000369768	T	0.73258	-0.73	2.75	1.55	0.23275	.	1.408510	0.06480	U	0.732638	T	0.51058	0.1652	N	0.19112	0.55	0.09310	N	1	B	0.09022	0.002	B	0.04013	0.001	T	0.28870	-1.0030	10	0.15952	T	0.53	.	4.4009	0.11386	0.0:0.1197:0.403:0.4773	.	28	P48146	NPBW2_HUMAN	G	28	ENSP00000358783:D28G	ENSP00000358783:D28G	D	-	2	0	NPBWR2	62208546	0.004000	0.15560	0.007000	0.13788	0.081000	0.17604	0.806000	0.27126	0.146000	0.19002	0.254000	0.18369	GAC	.	.		0.632	NPBWR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080300.1	NM_005286	
UMODL1	89766	hgsc.bcm.edu	37	21	43531615	43531615	+	Splice_Site	SNP	G	G	A			TCGA-CC-A7IE-01A-21D-A382-10	TCGA-CC-A7IE-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c1caf517-5052-48e3-ad80-8458b3d2ff5f	ab81329b-c119-4a5a-863c-5b50f48cee3f	g.chr21:43531615G>A	ENST00000408910.2	+	12	1899		c.e12-1		UMODL1_ENST00000400424.2_Splice_Site|UMODL1_ENST00000408989.2_Silent_p.Q761Q|C21orf128_ENST00000329015.2_5'Flank|UMODL1_ENST00000400427.1_Silent_p.Q689Q	NM_001004416.2	NP_001004416	Q5DID0	UROL1_HUMAN	uromodulin-like 1						adipose tissue development (GO:0060612)|cellular response to gonadotropin-releasing hormone (GO:0097211)|multicellular organismal reproductive process (GO:0048609)|regulation of apoptotic process (GO:0042981)|regulation of gene expression (GO:0010468)|regulation of ovarian follicle development (GO:2000354)|single fertilization (GO:0007338)	cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|peptidase inhibitor activity (GO:0030414)			breast(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(5)|lung(22)|ovary(2)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	47						TCCCTGGACAGCTACAGGGAA	0.642																																					p.Q761Q	Pancreas(122;680 807 13940 14411 22888 25505 31742 36028 36332 38435)	Atlas-SNP	.											.	UMODL1	186	.	0			c.G2283A						.						50.0	55.0	53.0					21																	43531615		1972	4145	6117	SO:0001630	splice_region_variant	89766	exon11			TGGACAGCTACAG		CCDS42935.1, CCDS42936.1, CCDS56214.1, CCDS56215.1	21q22.3	2008-07-04			ENSG00000177398	ENSG00000177398			12560	protein-coding gene	gene with protein product	"""olfactorin"""	613859				16026467	Standard	NM_173568		Approved		uc002zag.1	Q5DID0	OTTHUMG00000086788	ENST00000408910.2:c.1900-1G>A	chr21.hg19:g.43531615G>A		99.0	0.0		107.0	35.0	NM_173568	C9JCE6|Q5DIC9|Q6LA40|Q6LA41|Q8N216	Silent	SNP	ENST00000408910.2	hg19	CCDS42936.1	.	.	.	.	.	.	.	.	.	.	G	9.056	0.993182	0.19043	.	.	ENSG00000177398	ENST00000400424;ENST00000408910	.	.	.	4.67	3.77	0.43336	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.1838	0.59670	0.0:0.1625:0.8375:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	UMODL1	42404684	0.000000	0.05858	0.001000	0.08648	0.008000	0.06430	0.347000	0.20014	1.244000	0.43870	-0.175000	0.13238	.	.	.		0.642	UMODL1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195292.2		Intron
PCBP3	54039	hgsc.bcm.edu	37	21	47350755	47350755	+	Silent	SNP	A	A	G			TCGA-CC-A7IE-01A-21D-A382-10	TCGA-CC-A7IE-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c1caf517-5052-48e3-ad80-8458b3d2ff5f	ab81329b-c119-4a5a-863c-5b50f48cee3f	g.chr21:47350755A>G	ENST00000400314.1	+	13	1190	c.852A>G	c.(850-852)tcA>tcG	p.S284S	PCBP3_ENST00000400310.1_Intron|PCBP3_ENST00000449640.1_Silent_p.S284S|PCBP3_ENST00000400308.1_Silent_p.S258S|PCBP3_ENST00000400309.1_Silent_p.S283S|PRED62_ENST00000593412.1_Intron|PCBP3_ENST00000400304.1_Silent_p.S274S			P57721	PCBP3_HUMAN	poly(rC) binding protein 3	284					mRNA metabolic process (GO:0016071)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			biliary_tract(1)|endometrium(3)|large_intestine(2)|lung(7)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	17	all_hematologic(128;0.24)			Colorectal(79;0.0411)|READ - Rectum adenocarcinoma(84;0.0649)		tgggccagtcatcaggTAACA	0.547																																					p.S284S		Atlas-SNP	.											.	PCBP3	82	.	0			c.A852G						.						56.0	58.0	57.0					21																	47350755		2021	4192	6213	SO:0001819	synonymous_variant	54039	exon11			CCAGTCATCAGGT	AF176329	CCDS42974.2, CCDS46652.1	21q22.3	2013-07-16	2001-11-28		ENSG00000183570	ENSG00000183570			8651	protein-coding gene	gene with protein product		608502	"""poly(rC)-binding protein 3"""			10936052	Standard	NM_020528		Approved		uc002zhq.2	P57721	OTTHUMG00000090399	ENST00000400314.1:c.852A>G	chr21.hg19:g.47350755A>G		45.0	0.0		66.0	21.0	NM_020528	A8MPS2|A8MQ26|B7WNN9|B7WPC1|Q8N9K6|Q96EP6	Silent	SNP	ENST00000400314.1	hg19	CCDS42974.2																																																																																			.	.		0.547	PCBP3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000206808.2		
GGTLC2	91227	hgsc.bcm.edu	37	22	22989284	22989284	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A7IE-01A-21D-A382-10	TCGA-CC-A7IE-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c1caf517-5052-48e3-ad80-8458b3d2ff5f	ab81329b-c119-4a5a-863c-5b50f48cee3f	g.chr22:22989284C>A	ENST00000480559.1	+	2	237	c.237C>A	c.(235-237)gaC>gaA	p.D79E	GGTLC2_ENST00000448514.1_Missense_Mutation_p.D79E|POM121L1P_ENST00000402027.1_RNA	NM_199127.2	NP_954578.2	Q14390	GGTL2_HUMAN	gamma-glutamyltransferase light chain 2	79					glutathione metabolic process (GO:0006749)|leukotriene biosynthetic process (GO:0019370)	anchored component of external side of plasma membrane (GO:0031362)|extracellular vesicular exosome (GO:0070062)	gamma-glutamyltransferase activity (GO:0003840)			endometrium(2)|large_intestine(1)|lung(1)|ovary(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)	11	all_hematologic(9;0.0135)|Acute lymphoblastic leukemia(84;0.17)	all_hematologic(6;1.3e-31)|Acute lymphoblastic leukemia(6;5.54e-23)		READ - Rectum adenocarcinoma(21;0.145)		AAATGGATGACTTCAGCTCTC	0.592																																					p.D79E		Atlas-SNP	.											.	GGTLC2	20	.	0			c.C237A						.						116.0	116.0	116.0					22																	22989284		2203	4299	6502	SO:0001583	missense	91227	exon2			GGATGACTTCAGC	X98922	CCDS13802.2	22q11.21	2008-03-25	2008-03-10	2008-03-10	ENSG00000100121	ENSG00000100121		"""Gamma-glutamyltransferases"""	18596	protein-coding gene	gene with protein product		612339	"""gamma-glutamyltransferase-like 4"""	GGTL4		9074928, 18357469	Standard	NM_199127		Approved		uc010gtt.2	Q14390	OTTHUMG00000151177	ENST00000480559.1:c.237C>A	chr22.hg19:g.22989284C>A	ENSP00000419751:p.Asp79Glu	273.0	0.0		248.0	78.0	NM_199127	A1A516|A2VCM9|Q5NV76|Q6ISH0	Missense_Mutation	SNP	ENST00000480559.1	hg19	CCDS13802.2	.	.	.	.	.	.	.	.	.	.	c	10.97	1.500378	0.26861	.	.	ENSG00000100121	ENST00000480559;ENST00000448514	T;T	0.08634	3.07;3.07	.	.	.	.	0.000000	0.85682	D	0.000000	T	0.29588	0.0738	H	0.98089	4.145	0.28891	N	0.893841	P;P	0.45634	0.581;0.863	B;P	0.55161	0.414;0.77	T	0.22103	-1.0226	9	0.87932	D	0	-33.2948	2.6652	0.05046	0.0:0.5:0.0:0.5	.	79;79	Q14390;B7WND7	GGTL2_HUMAN;.	E	79	ENSP00000419751:D79E;ENSP00000415676:D79E	ENSP00000415676:D79E	D	+	3	2	GGTLC2	21319284	1.000000	0.71417	0.000000	0.03702	0.000000	0.00434	0.548000	0.23314	-0.000000	0.14550	0.000000	0.15137	GAC	.	.		0.592	GGTLC2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000321662.1	NM_199127	
MYO18B	84700	hgsc.bcm.edu	37	22	26291221	26291221	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A7IE-01A-21D-A382-10	TCGA-CC-A7IE-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c1caf517-5052-48e3-ad80-8458b3d2ff5f	ab81329b-c119-4a5a-863c-5b50f48cee3f	g.chr22:26291221A>G	ENST00000407587.2	+	28	4814	c.4645A>G	c.(4645-4647)Aca>Gca	p.T1549A	CTA-125H2.2_ENST00000608507.1_RNA|CTA-125H2.2_ENST00000609889.1_RNA|CTA-125H2.2_ENST00000609570.1_RNA|CTA-125H2.2_ENST00000596813.1_RNA|CTA-125H2.2_ENST00000594856.1_RNA|CTA-125H2.2_ENST00000599792.1_RNA|CTA-125H2.2_ENST00000597548.1_RNA|CTA-125H2.2_ENST00000594585.1_RNA|CTA-125H2.2_ENST00000608115.1_RNA|CTA-125H2.2_ENST00000593715.1_RNA|CTA-125H2.2_ENST00000600269.1_RNA|CTA-125H2.2_ENST00000600211.1_RNA|CTA-125H2.2_ENST00000597284.1_RNA|CTA-125H2.2_ENST00000609823.1_RNA|CTA-125H2.2_ENST00000595102.1_RNA|CTA-125H2.2_ENST00000608257.1_RNA|CTA-125H2.2_ENST00000599080.1_RNA|CTA-125H2.2_ENST00000609809.1_RNA|CTA-125H2.2_ENST00000609157.1_RNA|CTA-125H2.2_ENST00000453457.3_RNA|CTA-125H2.2_ENST00000600903.1_RNA|CTA-125H2.2_ENST00000597614.2_RNA|CTA-125H2.2_ENST00000594542.1_RNA|CTA-125H2.2_ENST00000609820.1_RNA|CTA-125H2.2_ENST00000608921.1_RNA|CTA-125H2.2_ENST00000609275.1_RNA|CTA-125H2.2_ENST00000607895.1_RNA|MYO18B_ENST00000536101.1_Missense_Mutation_p.T1548A|MYO18B_ENST00000335473.7_Missense_Mutation_p.T1548A			Q8IUG5	MY18B_HUMAN	myosin XVIIIB	1548	Tail.					cytoplasm (GO:0005737)|nucleus (GO:0005634)|unconventional myosin complex (GO:0016461)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(2)|breast(6)|central_nervous_system(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(27)|liver(2)|lung(60)|ovary(7)|prostate(8)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(2)	146						CTCGGAGCTGACAGCCAGGAA	0.562																																					p.T1548A		Atlas-SNP	.											.	MYO18B	322	.	0			c.A4642G						.						31.0	37.0	35.0					22																	26291221		2103	4239	6342	SO:0001583	missense	84700	exon28			GAGCTGACAGCCA	AJ310931	CCDS54507.1	22q12.1	2011-09-27			ENSG00000133454	ENSG00000133454		"""Myosins / Myosin superfamily : Class XVIII"""	18150	protein-coding gene	gene with protein product		607295				12209013, 12547197	Standard	NM_032608		Approved	BK125H2.1	uc003abz.1	Q8IUG5	OTTHUMG00000151129	ENST00000407587.2:c.4645A>G	chr22.hg19:g.26291221A>G	ENSP00000386096:p.Thr1549Ala	91.0	0.0		82.0	27.0	NM_032608	B2RWP3|F5GYU7|Q8NDI8|Q8TE65|Q8WWS0|Q96KH2|Q96KR8|Q96KR9	Missense_Mutation	SNP	ENST00000407587.2	hg19		.	.	.	.	.	.	.	.	.	.	A	5.135	0.210428	0.09757	.	.	ENSG00000133454	ENST00000536101;ENST00000335473;ENST00000407587	D;D;T	0.86366	-2.11;-2.11;-1.11	5.26	-1.08	0.09936	.	1.188100	0.05910	N	0.631496	T	0.72309	0.3444	N	0.15975	0.35	0.09310	N	1	B;B;B;B	0.09022	0.001;0.001;0.002;0.001	B;B;B;B	0.09377	0.002;0.002;0.004;0.004	T	0.55835	-0.8078	10	0.20046	T	0.44	.	3.5095	0.07703	0.3633:0.0:0.2608:0.3759	.	1061;1548;1549;1548	Q8IUG5-2;Q8IUG5;F5GXR6;F5GYU7	.;MY18B_HUMAN;.;.	A	1548;1548;1549	ENSP00000441229:T1548A;ENSP00000334563:T1548A;ENSP00000386096:T1549A	ENSP00000334563:T1548A	T	+	1	0	MYO18B	24621221	0.001000	0.12720	0.941000	0.38009	0.238000	0.25445	-0.191000	0.09601	0.028000	0.15324	-0.376000	0.06991	ACA	.	.		0.562	MYO18B-006	NOVEL	non_canonical_conserved|basic|appris_candidate_longest|exp_conf	protein_coding	protein_coding	OTTHUMT00000400691.1	NM_032608	
MYO18B	84700	hgsc.bcm.edu	37	22	26343703	26343703	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-A7IE-01A-21D-A382-10	TCGA-CC-A7IE-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c1caf517-5052-48e3-ad80-8458b3d2ff5f	ab81329b-c119-4a5a-863c-5b50f48cee3f	g.chr22:26343703A>T	ENST00000407587.2	+	36	5829	c.5660A>T	c.(5659-5661)cAg>cTg	p.Q1887L	MYO18B_ENST00000536101.1_Missense_Mutation_p.Q1886L|MYO18B_ENST00000335473.7_Missense_Mutation_p.Q1886L			Q8IUG5	MY18B_HUMAN	myosin XVIIIB	1886	Tail.					cytoplasm (GO:0005737)|nucleus (GO:0005634)|unconventional myosin complex (GO:0016461)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(2)|breast(6)|central_nervous_system(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(27)|liver(2)|lung(60)|ovary(7)|prostate(8)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(2)	146						TACAGGCTGCAGTTTGAGAAG	0.557																																					p.Q1886L		Atlas-SNP	.											.	MYO18B	322	.	0			c.A5657T						.						53.0	56.0	55.0					22																	26343703		2100	4218	6318	SO:0001583	missense	84700	exon36			GGCTGCAGTTTGA	AJ310931	CCDS54507.1	22q12.1	2011-09-27			ENSG00000133454	ENSG00000133454		"""Myosins / Myosin superfamily : Class XVIII"""	18150	protein-coding gene	gene with protein product		607295				12209013, 12547197	Standard	NM_032608		Approved	BK125H2.1	uc003abz.1	Q8IUG5	OTTHUMG00000151129	ENST00000407587.2:c.5660A>T	chr22.hg19:g.26343703A>T	ENSP00000386096:p.Gln1887Leu	60.0	0.0		44.0	15.0	NM_032608	B2RWP3|F5GYU7|Q8NDI8|Q8TE65|Q8WWS0|Q96KH2|Q96KR8|Q96KR9	Missense_Mutation	SNP	ENST00000407587.2	hg19		.	.	.	.	.	.	.	.	.	.	A	22.3	4.271870	0.80469	.	.	ENSG00000133454	ENST00000536101;ENST00000335473;ENST00000407587	D;D;D	0.87491	-2.24;-2.24;-2.26	5.21	5.21	0.72293	.	0.167763	0.41097	D	0.000951	D	0.91456	0.7303	M	0.75264	2.295	0.43603	D	0.995969	P;D;D;D	0.59767	0.952;0.967;0.986;0.981	P;P;P;P	0.58660	0.575;0.684;0.843;0.833	D	0.92150	0.5727	10	0.59425	D	0.04	.	13.9144	0.63887	1.0:0.0:0.0:0.0	.	1399;1886;1887;1886	Q8IUG5-2;Q8IUG5;F5GXR6;F5GYU7	.;MY18B_HUMAN;.;.	L	1886;1886;1887	ENSP00000441229:Q1886L;ENSP00000334563:Q1886L;ENSP00000386096:Q1887L	ENSP00000334563:Q1886L	Q	+	2	0	MYO18B	24673703	1.000000	0.71417	1.000000	0.80357	0.838000	0.47535	8.595000	0.90840	1.976000	0.57569	0.533000	0.62120	CAG	.	.		0.557	MYO18B-006	NOVEL	non_canonical_conserved|basic|appris_candidate_longest|exp_conf	protein_coding	protein_coding	OTTHUMT00000400691.1	NM_032608	
EIF4ENIF1	56478	hgsc.bcm.edu	37	22	31850167	31850167	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A7IE-01A-21D-A382-10	TCGA-CC-A7IE-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c1caf517-5052-48e3-ad80-8458b3d2ff5f	ab81329b-c119-4a5a-863c-5b50f48cee3f	g.chr22:31850167T>C	ENST00000397525.1	-	10	1698	c.1475A>G	c.(1474-1476)aAg>aGg	p.K492R	RP11-247I13.11_ENST00000464523.1_RNA|EIF4ENIF1_ENST00000397523.1_Missense_Mutation_p.K492R|EIF4ENIF1_ENST00000330125.5_Missense_Mutation_p.K492R|EIF4ENIF1_ENST00000344710.5_Splice_Site_p.K329R|EIF4ENIF1_ENST00000382180.2_Missense_Mutation_p.K171R	NM_001164501.1	NP_001157973.1	Q9NRA8	4ET_HUMAN	eukaryotic translation initiation factor 4E nuclear import factor 1	492						cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|protein transporter activity (GO:0008565)			autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(9)|lung(8)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	36						CCCACTTGCCTTCATTGTGCT	0.468																																					p.K492R		Atlas-SNP	.											.	EIF4ENIF1	80	.	0			c.A1475G						.						156.0	126.0	136.0					22																	31850167		2203	4300	6503	SO:0001583	missense	56478	exon10			CTTGCCTTCATTG	AF240775	CCDS13898.1, CCDS54520.1	22q11.2	2007-01-16			ENSG00000184708	ENSG00000184708			16687	protein-coding gene	gene with protein product		607445				10856257	Standard	NM_019843		Approved	4E-T, FLJ21601, Clast4, 2610509L04Rik	uc003akz.2	Q9NRA8	OTTHUMG00000030793	ENST00000397525.1:c.1475A>G	chr22.hg19:g.31850167T>C	ENSP00000380659:p.Lys492Arg	100.0	0.0		110.0	38.0	NM_019843	B1AKL2|B1AKL3|B2RBF1|Q8NCF2|Q9H708	Missense_Mutation	SNP	ENST00000397525.1	hg19	CCDS13898.1	.	.	.	.	.	.	.	.	.	.	T	21.7	4.189057	0.78789	.	.	ENSG00000184708	ENST00000344710;ENST00000397525;ENST00000330125;ENST00000397523;ENST00000382180;ENST00000418321	.	.	.	6.16	6.16	0.99307	.	0.000000	0.85682	D	0.000000	T	0.75221	0.3820	L	0.61218	1.895	0.58432	D	0.999994	D;D;D;D	0.76494	0.99;0.999;0.998;0.997	P;D;D;D	0.83275	0.814;0.996;0.934;0.994	T	0.71590	-0.4547	9	0.23302	T	0.38	-20.1134	14.547	0.68038	0.0:0.0:0.0:1.0	.	329;492;329;492	B1AKL3;Q9NRA8;Q9NRA8-2;B1AKL4	.;4ET_HUMAN;.;.	R	329;492;492;492;171;90	.	ENSP00000328103:K492R	K	-	2	0	EIF4ENIF1	30180167	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.429000	0.80309	2.367000	0.80283	0.528000	0.53228	AAG	.	.		0.468	EIF4ENIF1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000127926.1	NM_019843	
IL2RB	3560	hgsc.bcm.edu	37	22	37524527	37524527	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A7IE-01A-21D-A382-10	TCGA-CC-A7IE-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c1caf517-5052-48e3-ad80-8458b3d2ff5f	ab81329b-c119-4a5a-863c-5b50f48cee3f	g.chr22:37524527G>A	ENST00000216223.5	-	10	1463	c.1265C>T	c.(1264-1266)cCc>cTc	p.P422L		NM_000878.3	NP_000869.1	P14784	IL2RB_HUMAN	interleukin 2 receptor, beta	422					cytokine-mediated signaling pathway (GO:0019221)|interleukin-2-mediated signaling pathway (GO:0038110)|negative regulation of apoptotic process (GO:0043066)|protein complex assembly (GO:0006461)|signal transduction (GO:0007165)|viral process (GO:0016032)	external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	interleukin-2 binding (GO:0019976)|interleukin-2 receptor activity (GO:0004911)			breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(9)|ovary(1)|prostate(1)|skin(5)	23					Aldesleukin(DB00041)|Basiliximab(DB00074)|Daclizumab(DB00111)|Denileukin diftitox(DB00004)	ATCCCTGGAGGGGAAGGTGCA	0.682																																					p.P422L		Atlas-SNP	.											.	IL2RB	44	.	0			c.C1265T						.						24.0	25.0	24.0					22																	37524527		2203	4300	6503	SO:0001583	missense	3560	exon10			CTGGAGGGGAAGG	M26062	CCDS13942.1	22q13	2011-02-15			ENSG00000100385	ENSG00000100385		"""Interleukins and interleukin receptors"", ""CD molecules"""	6009	protein-coding gene	gene with protein product		146710	"""interleukin 15 receptor, beta"""	IL15RB			Standard	NM_000878		Approved	CD122	uc003aqv.1	P14784	OTTHUMG00000150534	ENST00000216223.5:c.1265C>T	chr22.hg19:g.37524527G>A	ENSP00000216223:p.Pro422Leu	73.0	0.0		83.0	31.0	NM_000878	B2R765	Missense_Mutation	SNP	ENST00000216223.5	hg19	CCDS13942.1	.	.	.	.	.	.	.	.	.	.	G	16.45	3.126183	0.56721	.	.	ENSG00000100385	ENST00000216223	T	0.28454	1.61	4.92	4.92	0.64577	.	0.610754	0.16759	N	0.200695	T	0.51805	0.1696	M	0.68952	2.095	0.45035	D	0.998055	D	0.89917	1.0	D	0.97110	1.0	T	0.47636	-0.9102	10	0.49607	T	0.09	-29.9354	11.2985	0.49292	0.0:0.0:0.805:0.195	.	422	P14784	IL2RB_HUMAN	L	422	ENSP00000216223:P422L	ENSP00000216223:P422L	P	-	2	0	IL2RB	35854473	0.994000	0.37717	0.956000	0.39512	0.349000	0.29174	2.688000	0.46984	2.404000	0.81709	0.655000	0.94253	CCC	.	.		0.682	IL2RB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318792.1		
PPARA	5465	hgsc.bcm.edu	37	22	46594481	46594481	+	Silent	SNP	C	C	T			TCGA-CC-A7IE-01A-21D-A382-10	TCGA-CC-A7IE-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c1caf517-5052-48e3-ad80-8458b3d2ff5f	ab81329b-c119-4a5a-863c-5b50f48cee3f	g.chr22:46594481C>T	ENST00000396000.2	+	3	466	c.201C>T	c.(199-201)gtC>gtT	p.V67V	PPARA_ENST00000434345.2_Silent_p.V67V|PPARA_ENST00000262735.5_Silent_p.V67V|PPARA_ENST00000407236.1_Silent_p.V67V|PPARA_ENST00000402126.1_Silent_p.V67V			Q07869	PPARA_HUMAN	peroxisome proliferator-activated receptor alpha	67					behavioral response to nicotine (GO:0035095)|cellular lipid metabolic process (GO:0044255)|circadian regulation of gene expression (GO:0032922)|enamel mineralization (GO:0070166)|epidermis development (GO:0008544)|fatty acid metabolic process (GO:0006631)|fatty acid transport (GO:0015908)|gene expression (GO:0010467)|heart development (GO:0007507)|intracellular receptor signaling pathway (GO:0030522)|lipid metabolic process (GO:0006629)|lipoprotein metabolic process (GO:0042157)|negative regulation of appetite (GO:0032099)|negative regulation of blood pressure (GO:0045776)|negative regulation of cholesterol storage (GO:0010887)|negative regulation of glycolytic process (GO:0045820)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|negative regulation of neuron death (GO:1901215)|negative regulation of protein binding (GO:0032091)|negative regulation of receptor biosynthetic process (GO:0010871)|negative regulation of sequestering of triglyceride (GO:0010891)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription regulatory region DNA binding (GO:2000678)|positive regulation of fatty acid beta-oxidation (GO:0032000)|positive regulation of fatty acid oxidation (GO:0046321)|positive regulation of gluconeogenesis (GO:0045722)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cellular ketone metabolic process by positive regulation of transcription from RNA polymerase II promoter (GO:0072366)|regulation of circadian rhythm (GO:0042752)|regulation of glycolytic by positive regulation of transcription from RNA polymerase II promoter (GO:0072363)|regulation of lipid transport by positive regulation of transcription from RNA polymerase II promoter (GO:0072369)|response to hypoxia (GO:0001666)|response to insulin (GO:0032868)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|wound healing (GO:0042060)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|drug binding (GO:0008144)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|lipid binding (GO:0008289)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II repressing transcription factor binding (GO:0001103)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|ubiquitin conjugating enzyme binding (GO:0031624)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(5)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	15		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00522)	Bezafibrate(DB01393)|Clofibrate(DB00636)|Fenofibrate(DB01039)|Gemfibrozil(DB01241)|Indomethacin(DB00328)	ATGGCTCGGTCATCACGGGTA	0.408																																					p.V67V		Atlas-SNP	.											.	PPARA	36	.	0			c.C201T						.						63.0	66.0	65.0					22																	46594481		2203	4300	6503	SO:0001819	synonymous_variant	5465	exon3			CTCGGTCATCACG	L02932	CCDS33669.1	22q12-q13.1	2013-01-16	2006-10-17		ENSG00000186951	ENSG00000186951		"""Nuclear hormone receptors"""	9232	protein-coding gene	gene with protein product		170998	"""peroxisome proliferative activated receptor, alpha"""	PPAR		7684926, 10591208	Standard	XM_005261655		Approved	hPPAR, NR1C1	uc003bgx.1	Q07869	OTTHUMG00000150443	ENST00000396000.2:c.201C>T	chr22.hg19:g.46594481C>T		98.0	0.0		96.0	17.0	NM_001001928	B0G0X3|Q16241|Q6I9S0|Q92486|Q92689|Q9Y3N1	Silent	SNP	ENST00000396000.2	hg19	CCDS33669.1																																																																																			.	.		0.408	PPARA-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318129.3	NM_001001928	
SHROOM4	57477	hgsc.bcm.edu	37	X	50341497	50341497	+	Silent	SNP	G	G	T			TCGA-CC-A7IE-01A-21D-A382-10	TCGA-CC-A7IE-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c1caf517-5052-48e3-ad80-8458b3d2ff5f	ab81329b-c119-4a5a-863c-5b50f48cee3f	g.chrX:50341497G>T	ENST00000289292.7	-	8	4264	c.3981C>A	c.(3979-3981)gtC>gtA	p.V1327V	SHROOM4_ENST00000376020.2_Silent_p.V1327V|SHROOM4_ENST00000460112.3_Silent_p.V1211V|SHROOM4_ENST00000483955.1_5'Flank			Q9ULL8	SHRM4_HUMAN	shroom family member 4	1327	ASD2. {ECO:0000255|PROSITE- ProRule:PRU00638}.				actin cytoskeleton organization (GO:0030036)|actin filament organization (GO:0007015)|brain development (GO:0007420)|cognition (GO:0050890)	apical plasma membrane (GO:0016324)|basal plasma membrane (GO:0009925)|cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|myosin II complex (GO:0016460)|stress fiber (GO:0001725)	actin filament binding (GO:0051015)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(5)|large_intestine(6)|liver(1)|lung(20)|ovary(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	52	Ovarian(276;0.236)					CCTCCCGCAAGACAGAAAGTT	0.483																																					p.V1327V		Atlas-SNP	.											.	SHROOM4	171	.	0			c.C3981A						.						28.0	23.0	25.0					X																	50341497		2203	4300	6503	SO:0001819	synonymous_variant	57477	exon8			CCGCAAGACAGAA	AB033028	CCDS35277.1	Xp11.22	2008-02-05			ENSG00000158352	ENSG00000158352			29215	protein-coding gene	gene with protein product		300579				10574462, 16615870	Standard	NR_027121		Approved	KIAA1202	uc004dpe.2	Q9ULL8	OTTHUMG00000021521	ENST00000289292.7:c.3981C>A	chrX.hg19:g.50341497G>T		88.0	0.0		111.0	63.0	NM_020717	A7E2X9|D6RFW0|Q96LA0	Silent	SNP	ENST00000289292.7	hg19	CCDS35277.1																																																																																			.	.		0.483	SHROOM4-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056564.4	NM_020717	
DGAT2L6	347516	hgsc.bcm.edu	37	X	69420190	69420190	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A7IE-01A-21D-A382-10	TCGA-CC-A7IE-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c1caf517-5052-48e3-ad80-8458b3d2ff5f	ab81329b-c119-4a5a-863c-5b50f48cee3f	g.chrX:69420190T>C	ENST00000333026.3	+	4	453	c.353T>C	c.(352-354)aTc>aCc	p.I118T		NM_198512.1	NP_940914.1	Q6ZPD8	DG2L6_HUMAN	diacylglycerol O-acyltransferase 2-like 6	118					lipid metabolic process (GO:0006629)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	transferase activity, transferring acyl groups other than amino-acyl groups (GO:0016747)			breast(1)|endometrium(2)|large_intestine(3)|lung(5)|ovary(1)	12						GGTGTCTTCATCAACTTTGCC	0.458																																					p.I118T		Atlas-SNP	.											.	DGAT2L6	40	.	0			c.T353C						.						192.0	141.0	158.0					X																	69420190		2203	4300	6503	SO:0001583	missense	347516	exon4			TCTTCATCAACTT	AK129500	CCDS14397.1	Xq13.1	2008-02-05			ENSG00000184210	ENSG00000184210			23250	protein-coding gene	gene with protein product		300926				15671038	Standard	NM_198512		Approved	DC3, FLJ25989	uc004dxx.1	Q6ZPD8	OTTHUMG00000021774	ENST00000333026.3:c.353T>C	chrX.hg19:g.69420190T>C	ENSP00000328036:p.Ile118Thr	92.0	0.0		100.0	58.0	NM_198512	Q6IEE2	Missense_Mutation	SNP	ENST00000333026.3	hg19	CCDS14397.1	.	.	.	.	.	.	.	.	.	.	T	16.01	3.002015	0.54254	.	.	ENSG00000184210	ENST00000333026	D	0.94758	-3.51	5.35	4.18	0.49190	.	0.153864	0.44902	D	0.000415	D	0.89283	0.6671	L	0.33293	1	0.42425	D	0.992656	B	0.32862	0.387	B	0.36608	0.229	D	0.85012	0.0906	10	0.18276	T	0.48	-6.4929	8.3902	0.32524	0.0:0.0:0.3198:0.6802	.	118	Q6ZPD8	DG2L6_HUMAN	T	118	ENSP00000328036:I118T	ENSP00000328036:I118T	I	+	2	0	DGAT2L6	69336915	1.000000	0.71417	1.000000	0.80357	0.923000	0.55619	4.208000	0.58486	1.982000	0.57802	0.486000	0.48141	ATC	.	.		0.458	DGAT2L6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057067.1	NM_198512	
KIAA1210	57481	hgsc.bcm.edu	37	X	118220842	118220842	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A7IE-01A-21D-A382-10	TCGA-CC-A7IE-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c1caf517-5052-48e3-ad80-8458b3d2ff5f	ab81329b-c119-4a5a-863c-5b50f48cee3f	g.chrX:118220842C>T	ENST00000402510.2	-	11	4350	c.4351G>A	c.(4351-4353)Gaa>Aaa	p.E1451K		NM_020721.1	NP_065772.1	Q9ULL0	K1210_HUMAN	KIAA1210	1451										breast(3)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(31)|ovary(4)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	64						TCAAGATCTTCTTTCTTAGAG	0.458																																					p.E1451K		Atlas-SNP	.											.	KIAA1210	171	.	0			c.G4351A						.						83.0	77.0	79.0					X																	118220842		1855	4092	5947	SO:0001583	missense	57481	exon11			GATCTTCTTTCTT	AB033036	CCDS48156.1	Xq24	2012-10-04			ENSG00000250423	ENSG00000250423			29218	protein-coding gene	gene with protein product						10574462	Standard	NM_020721		Approved		uc004era.4	Q9ULL0	OTTHUMG00000162980	ENST00000402510.2:c.4351G>A	chrX.hg19:g.118220842C>T	ENSP00000384670:p.Glu1451Lys	78.0	0.0		115.0	68.0	NM_020721	B7ZCI8|Q5JPN4	Missense_Mutation	SNP	ENST00000402510.2	hg19	CCDS48156.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	17.75|17.75	3.466020|3.466020	0.63625|0.63625	.|.	.|.	ENSG00000250423|ENSG00000248857	ENST00000402510|ENST00000440399	T|.	0.16597|.	2.33|.	5.13|5.13	4.27|4.27	0.50696|0.50696	.|.	.|.	.|.	.|.	.|.	T|T	0.53400|0.53400	0.1794|0.1794	M|M	0.67953|0.67953	2.075|2.075	0.09310|0.09310	N|N	1|1	P|.	0.50943|.	0.94|.	P|.	0.49421|.	0.61|.	T|T	0.45862|0.45862	-0.9232|-0.9232	8|5	.|.	.|.	.|.	.|.	9.2317|9.2317	0.37441|0.37441	0.0:0.8952:0.0:0.1048|0.0:0.8952:0.0:0.1048	.|.	1451|.	Q9ULL0|.	K1210_HUMAN|.	K|K	1451|857	ENSP00000384670:E1451K|.	.|.	E|R	-|-	1|2	0|0	RP13-347D8.6|KIAA1210	118104870|118104870	0.021000|0.021000	0.18746|0.18746	0.005000|0.005000	0.12908|0.12908	0.007000|0.007000	0.05969|0.05969	1.299000|1.299000	0.33424|0.33424	1.233000|1.233000	0.43693|0.43693	0.513000|0.513000	0.50165|0.50165	GAA|AGA	.	.		0.458	KIAA1210-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371251.2	NM_020721	
MT-CO3	4514	hgsc.bcm.edu	37	M	9605	9605	+	Silent	SNP	C	C	T			TCGA-CC-A7IE-01A-21D-A382-10	TCGA-CC-A7IE-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c1caf517-5052-48e3-ad80-8458b3d2ff5f	ab81329b-c119-4a5a-863c-5b50f48cee3f	g.chrM:9605C>T	ENST00000362079.2	+	1	399	c.399C>T	c.(397-399)aaC>aaT	p.N133N	MT-TS1_ENST00000387416.2_RNA|MT-TG_ENST00000387429.1_RNA|MT-ND4L_ENST00000361335.1_5'Flank|MT-TH_ENST00000387441.1_RNA|MT-TR_ENST00000387439.1_RNA|MT-ND4_ENST00000361381.2_5'Flank|MT-TS2_ENST00000387449.1_RNA|MT-TL2_ENST00000387456.1_RNA|MT-TD_ENST00000387419.1_RNA|MT-TK_ENST00000387421.1_RNA|MT-ND5_ENST00000361567.2_5'Flank|MT-ND3_ENST00000361227.2_5'Flank			P00414	COX3_HUMAN	mitochondrially encoded cytochrome c oxidase III	133					aerobic electron transport chain (GO:0019646)|cellular metabolic process (GO:0044237)|respiratory chain complex IV assembly (GO:0008535)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|respiratory chain complex IV (GO:0045277)	cytochrome-c oxidase activity (GO:0004129)			breast(1)|endometrium(10)|kidney(14)|lung(1)|urinary_tract(1)	27						CCACTCCTAAACACATCCGTA	0.493																																					p.N133N		Atlas-SNP	.											.	.	.	.	0			c.C399T						.																																			SO:0001819	synonymous_variant	5742	exon1			CCTAAACACATCC			mitochondria	2012-11-16	2005-02-15	2005-02-16	ENSG00000198938	ENSG00000198938		"""Mitochondrial respiratory chain complex / Complex IV"""	7422	protein-coding gene	gene with protein product		516050	"""cytochrome c oxidase III"""	MTCO3			Standard			Approved	COX3, COIII, CO3		P00414		ENST00000362079.2:c.399C>T	chrM.hg19:g.9605C>T		54.0	0.0		57.0	29.0	ENST00000362079	Q14Y83	Silent	SNP	ENST00000362079.2	hg19																																																																																				.	.		0.493	MT-CO3-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024032	
KIAA0247	9766	hgsc.bcm.edu	37	14	70171412	70171412	+	Frame_Shift_Del	DEL	G	G	-			TCGA-CC-A7IE-01A-21D-A382-10	TCGA-CC-A7IE-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c1caf517-5052-48e3-ad80-8458b3d2ff5f	ab81329b-c119-4a5a-863c-5b50f48cee3f	g.chr14:70171412delG	ENST00000342745.4	+	4	724	c.411delG	c.(409-411)gtgfs	p.V137fs		NM_014734.3	NP_055549.1	Q92537	K0247_HUMAN	KIAA0247	137						integral component of membrane (GO:0016021)				endometrium(1)|kidney(1)|lung(4)|ovary(3)|upper_aerodigestive_tract(1)	10				all cancers(60;0.00155)|BRCA - Breast invasive adenocarcinoma(234;0.0164)|OV - Ovarian serous cystadenocarcinoma(108;0.0196)		TCCTCGTGGTGCTGTTTGTGC	0.522																																					p.V137fs		Atlas-INDEL	.											.	KIAA0247	30	.	0			c.410delT						.						87.0	69.0	75.0					14																	70171412		2203	4300	6503	SO:0001589	frameshift_variant	9766	exon4			.	D87434	CCDS9796.1	14q24.1	2012-11-29			ENSG00000100647	ENSG00000100647			19956	protein-coding gene	gene with protein product						9039502	Standard	NM_014734		Approved		uc001xlk.3	Q92537	OTTHUMG00000171234	ENST00000342745.4:c.411delG	chr14.hg19:g.70171412delG	ENSP00000344424:p.Val137fs	69.0	0.0		56.0	15.0	NM_014734		Frame_Shift_Del	DEL	ENST00000342745.4	hg19	CCDS9796.1																																																																																			.	.		0.522	KIAA0247-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412453.1	NM_014734	
NEFH	4744	hgsc.bcm.edu	37	22	29885589	29885590	+	In_Frame_Ins	INS	-	-	CCCCTGAGAAGGCCAAGT	rs200984527|rs267607533		TCGA-CC-A7IE-01A-21D-A382-10	TCGA-CC-A7IE-10A-01D-A385-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c1caf517-5052-48e3-ad80-8458b3d2ff5f	ab81329b-c119-4a5a-863c-5b50f48cee3f	g.chr22:29885589_29885590insCCCCTGAGAAGGCCAAGT	ENST00000310624.6	+	4	1993_1994	c.1960_1961insCCCCTGAGAAGGCCAAGT	c.(1960-1962)tcc>tCCCCTGAGAAGGCCAAGTcc	p.654_654S>SPEKAKS		NM_021076.3	NP_066554.2	P12036	NFH_HUMAN	neurofilament, heavy polypeptide	660	30 X 6 AA repeats of K-S-P-[AEPV]-[EAK]- [AEVK].|Tail.				axon development (GO:0061564)|axonogenesis (GO:0007409)|cell death (GO:0008219)|cell projection assembly (GO:0030031)|microtubule cytoskeleton organization (GO:0000226)|neurofilament bundle assembly (GO:0033693)|peripheral nervous system neuron axonogenesis (GO:0048936)|regulation of organelle transport along microtubule (GO:1902513)	axon (GO:0030424)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|neurofibrillary tangle (GO:0097418)|neurofilament (GO:0005883)	dynein binding (GO:0045502)|kinesin binding (GO:0019894)|microtubule binding (GO:0008017)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(12)|ovary(2)|skin(3)	30						GAAGGCCAAGTCCCCAGAGAAG	0.559																																					p.S654delinsSPEKAKS		Atlas-INDEL	.											.,4	NEFH	178	.	0			c.1960_1961insCCCCTGAGAAGGCCAAGT						.																																			SO:0001652	inframe_insertion	4744	exon4			.		CCDS13858.1	22q12.2	2013-01-16	2008-09-19		ENSG00000100285	ENSG00000100285		"""Intermediate filaments type IV"""	7737	protein-coding gene	gene with protein product		162230	"""neurofilament, heavy polypeptide 200kDa"""				Standard	NM_021076		Approved		uc003afo.3	P12036	OTTHUMG00000151155	ENST00000310624.6:c.1943_1960dupCCCCTGAGAAGGCCAAGT	chr22.hg19:g.29885589_29885590insCCCCTGAGAAGGCCAAGT	ENSP00000311997:p.ProGluLysAlaLysSer654dup	267.0	0.0		263.0	135.0	NM_021076	B4DYY4|Q96HF8|Q9UJS7|Q9UQ14	In_Frame_Ins	INS	ENST00000310624.6	hg19	CCDS13858.1																																																																																			.	.		0.559	NEFH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321553.2	NM_021076	
NCOA2	10499	hgsc.bcm.edu	37	8	71082595	71082597	+	In_Frame_Del	DEL	AAG	AAG	-			TCGA-CC-A7IE-01A-21D-A382-10	TCGA-CC-A7IE-10A-01D-A385-10	AAG	AAG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c1caf517-5052-48e3-ad80-8458b3d2ff5f	ab81329b-c119-4a5a-863c-5b50f48cee3f	g.chr8:71082595_71082597delAAG	ENST00000452400.2	-	6	562_564	c.381_383delCTT	c.(379-384)ttcttt>ttt	p.127_128FF>F		NM_006540.2	NP_006531.1	Q15596	NCOA2_HUMAN	nuclear receptor coactivator 2	127	PAS. {ECO:0000255|PROSITE- ProRule:PRU00140}.				cellular lipid metabolic process (GO:0044255)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of glucose metabolic process (GO:0010906)|regulation of transcription, DNA-templated (GO:0006355)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	chromatin binding (GO:0003682)|histone acetyltransferase activity (GO:0004402)|ligand-dependent nuclear receptor binding (GO:0016922)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nuclear hormone receptor binding (GO:0035257)|signal transducer activity (GO:0004871)|thyroid hormone receptor coactivator activity (GO:0030375)|transcription coactivator activity (GO:0003713)		PAX3/NCOA2(4)|HEY1/NCOA2(10)	NS(1)|breast(4)|endometrium(7)|kidney(4)|large_intestine(10)|lung(25)|ovary(1)|pancreas(2)|prostate(2)|skin(4)	60	Breast(64;0.201)		Epithelial(68;0.0147)|OV - Ovarian serous cystadenocarcinoma(28;0.0455)|all cancers(69;0.0606)			GTTCACTACAAAGAAGAACCCAT	0.394			T	"""RUNXBP2, HEY1"""	"""AML, Chondrosarcoma"""																																p.128_128del		Atlas-Indel,Pindel	.		Dom	yes		8	8q13.1	10499	nuclear receptor coactivator 2 (TIF2)		L	.	NCOA2	147	.	0			c.382_384del						.																																			SO:0001651	inframe_deletion	10499	exon6			.	X97674	CCDS47872.1	8q13.3	2011-07-01			ENSG00000140396	ENSG00000140396		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Basic helix-loop-helix proteins"""	7669	protein-coding gene	gene with protein product		601993				9111344, 8670870	Standard	XM_005251128		Approved	TIF2, GRIP1, NCoA-2, KAT13C, bHLHe75	uc003xyn.1	Q15596	OTTHUMG00000164671	ENST00000452400.2:c.381_383delCTT	chr8.hg19:g.71082598_71082600delAAG	ENSP00000399968:p.Phe128del	120.0	0.0		162.0	29.0	NM_006540	Q14CD2	In_Frame_Del	DEL	ENST00000452400.2	hg19	CCDS47872.1																																																																																			.	.		0.394	NCOA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379696.1		
ABHD4	63874	hgsc.bcm.edu	37	14	23072409	23072410	+	Frame_Shift_Ins	INS	-	-	T			TCGA-CC-A7IE-01A-21D-A382-10	TCGA-CC-A7IE-10A-01D-A385-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c1caf517-5052-48e3-ad80-8458b3d2ff5f	ab81329b-c119-4a5a-863c-5b50f48cee3f	g.chr14:23072409_23072410insT	ENST00000428304.2	+	3	297_298	c.227_228insT	c.(226-231)ggttttfs	p.GF76fs	ABHD4_ENST00000544562.1_3'UTR	NM_022060.2	NP_071343.2	Q8TB40	ABHD4_HUMAN	abhydrolase domain containing 4	76					lipid catabolic process (GO:0016042)		hydrolase activity (GO:0016787)			breast(1)|central_nervous_system(1)|endometrium(5)|large_intestine(3)|lung(3)|prostate(1)	14	all_cancers(95;5.49e-05)			GBM - Glioblastoma multiforme(265;0.0153)		ATGGTGCATGGTTTTGGGGGCG	0.579																																					p.G76fs		Atlas-Indel,Pindel	.											.	ABHD4	30	.	0			c.227_228insT						.																																			SO:0001589	frameshift_variant	63874	exon3			.	AK022878	CCDS9572.1	14q11.1	2006-10-06			ENSG00000100439	ENSG00000100439		"""Abhydrolase domain containing"""	20154	protein-coding gene	gene with protein product							Standard	NM_022060		Approved	FLJ12816	uc001wgm.3	Q8TB40	OTTHUMG00000028686	ENST00000428304.2:c.231dupT	chr14.hg19:g.23072413_23072413dupT	ENSP00000414558:p.Gly76fs	114.0	0.0		103.0	29.0	NM_022060	B4DDH7|Q9H9E0	Frame_Shift_Ins	INS	ENST00000428304.2	hg19	CCDS9572.1																																																																																			.	.		0.579	ABHD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071623.3		
MAP4K5	11183	hgsc.bcm.edu	37	14	50904667	50904668	+	Frame_Shift_Ins	INS	-	-	T	rs75938452		TCGA-CC-A7IE-01A-21D-A382-10	TCGA-CC-A7IE-10A-01D-A385-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c1caf517-5052-48e3-ad80-8458b3d2ff5f	ab81329b-c119-4a5a-863c-5b50f48cee3f	g.chr14:50904667_50904668insT	ENST00000013125.4	-	24	2085_2086	c.1767_1768insA	c.(1765-1770)aaaccafs	p.P590fs		NM_006575.4|NM_198794.2	NP_006566.2|NP_942089.1	Q9Y4K4	M4K5_HUMAN	mitogen-activated protein kinase kinase kinase kinase 5	590	CNH. {ECO:0000255|PROSITE- ProRule:PRU00795}.				activation of JUN kinase activity (GO:0007257)|intracellular signal transduction (GO:0035556)|protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|small GTPase regulator activity (GO:0005083)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	15	all_epithelial(31;0.000415)|Breast(41;0.0102)					GCTAATCCTGGTTTTTTGGCAT	0.347																																					p.P590fs		Atlas-Indel,Pindel	.											.	MAP4K5	48	.	0			c.1768_1769insA						.																																			SO:0001589	frameshift_variant	11183	exon24			.	U77129		14q11.2-q21	2011-06-09				ENSG00000012983		"""Mitogen-activated protein kinase cascade / Kinase kinase kinase kinases"""	6867	protein-coding gene	gene with protein product	"""germinal center kinase-related"""	604923				9038372, 8274451	Standard	NM_198794		Approved	KHS1, GCKR, KHS	uc001wyb.3	Q9Y4K4		ENST00000013125.4:c.1768dupA	chr14.hg19:g.50904673_50904673dupT	ENSP00000013125:p.Pro590fs	203.0	0.0		222.0	25.0	NM_006575	Q8IYF6	Frame_Shift_Ins	INS	ENST00000013125.4	hg19																																																																																				.	.		0.347	MAP4K5-001	KNOWN	non_canonical_conserved|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000410880.1	NM_006575	
NCOR2	9612	hgsc.bcm.edu	37	12	124914165	124914166	+	Frame_Shift_Del	DEL	CT	CT	-	rs199934660		TCGA-CC-A7IE-01A-21D-A382-10	TCGA-CC-A7IE-10A-01D-A385-10	CT	CT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c1caf517-5052-48e3-ad80-8458b3d2ff5f	ab81329b-c119-4a5a-863c-5b50f48cee3f	g.chr12:124914165_124914166delCT	ENST00000405201.1	-	10	1142_1143	c.1142_1143delAG	c.(1141-1143)gagfs	p.E381fs	NCOR2_ENST00000397355.1_Frame_Shift_Del_p.E381fs|NCOR2_ENST00000404621.1_Frame_Shift_Del_p.E380fs|NCOR2_ENST00000429285.2_Frame_Shift_Del_p.E380fs|NCOR2_ENST00000356219.3_Frame_Shift_Del_p.E381fs|NCOR2_ENST00000404121.2_5'UTR			Q9Y618	NCOR2_HUMAN	nuclear receptor corepressor 2	381					cellular lipid metabolic process (GO:0044255)|gene expression (GO:0010467)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|regulation of cellular ketone metabolic process by negative regulation of transcription from RNA polymerase II promoter (GO:0072365)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	membrane (GO:0016020)|nuclear body (GO:0016604)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone deacetylase binding (GO:0042826)|Notch binding (GO:0005112)|protein N-terminus binding (GO:0047485)|transcription corepressor activity (GO:0003714)			breast(5)|central_nervous_system(2)|endometrium(7)|kidney(5)|large_intestine(7)|lung(28)|ovary(3)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	69	all_neural(191;0.0804)|Medulloblastoma(191;0.163)			Epithelial(86;3.99e-05)|OV - Ovarian serous cystadenocarcinoma(86;9.14e-05)|all cancers(50;0.000402)|BRCA - Breast invasive adenocarcinoma(302;0.0764)		TCACCTCCTGCTCTGAGAGGCC	0.673																																					p.381_382del		Atlas-Indel,Pindel	.											.	NCOR2	475	.	0			c.1143_1144del						.																																			SO:0001589	frameshift_variant	9612	exon12			.	U37146	CCDS41857.1, CCDS41858.1, CCDS41857.2, CCDS41858.2, CCDS55892.1	12q24	2010-06-10	2010-06-10		ENSG00000196498	ENSG00000196498			7673	protein-coding gene	gene with protein product		600848	"""nuclear receptor co-repressor 2"""			7566127, 8813722	Standard	NM_001077261		Approved	SMRT, SMRTE, TRAC-1, CTG26, TNRC14	uc010tbb.2	Q9Y618	OTTHUMG00000150455	ENST00000405201.1:c.1142_1143delAG	chr12.hg19:g.124914167_124914168delCT	ENSP00000384018:p.Glu381fs	116.0	0.0		115.0	26.0	NM_006312	O00613|O15416|O15421|Q13354|Q56D06|Q59GM0|Q9Y5U0	Frame_Shift_Del	DEL	ENST00000405201.1	hg19	CCDS41858.2																																																																																			.	.		0.673	NCOR2-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318173.2	NM_006312	
GLE1	2733	hgsc.bcm.edu	37	9	131285594	131285601	+	Frame_Shift_Del	DEL	AAGCTGAG	AAGCTGAG	-			TCGA-CC-A7IE-01A-21D-A382-10	TCGA-CC-A7IE-10A-01D-A385-10	AAGCTGAG	AAGCTGAG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c1caf517-5052-48e3-ad80-8458b3d2ff5f	ab81329b-c119-4a5a-863c-5b50f48cee3f	g.chr9:131285594_131285601delAAGCTGAG	ENST00000309971.4	+	5	723_730	c.617_624delAAGCTGAG	c.(616-624)aaagctgagfs	p.KAE206fs	GLE1_ENST00000372770.4_Frame_Shift_Del_p.KAE206fs|GLE1_ENST00000539582.1_5'UTR	NM_001003722.1	NP_001003722.1	Q53GS7	GLE1_HUMAN	GLE1 RNA export mediator	206					mRNA export from nucleus (GO:0006406)|poly(A)+ mRNA export from nucleus (GO:0016973)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|membrane (GO:0016020)|nuclear pore (GO:0005643)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(3)|skin(2)|upper_aerodigestive_tract(1)	16						GAGAAGCTAAAAGCTGAGCACCGTCACA	0.49																																					p.206_208del		Atlas-Indel,Pindel	.											.	GLE1	42	.	0			c.616_623del						.																																			SO:0001589	frameshift_variant	2733	exon5			.	AF058922	CCDS6904.1, CCDS35154.1	9q34.13	2014-09-17	2013-06-18	2007-10-04	ENSG00000119392	ENSG00000119392			4315	protein-coding gene	gene with protein product		603371	"""GLE1 (yeast homolog)-like, RNA export mediator"", ""GLE1 RNA export mediator-like (yeast)"", ""GLE1 RNA export mediator (yeast)"", ""lethal congenital contracture syndrome 1"", ""GLE1 RNA export mediator homolog (yeast)"""	GLE1L, LCCS1		9618489, 18204449	Standard	NM_001499		Approved	hGLE1	uc004bvj.3	Q53GS7	OTTHUMG00000020749	ENST00000309971.4:c.617_624delAAGCTGAG	chr9.hg19:g.131285594_131285601delAAGCTGAG	ENSP00000308622:p.Lys206fs	124.0	0.0		110.0	24.0	NM_001499	O75458|Q53GT9|Q5VVU1|Q8NCP6|Q9UFL6	Frame_Shift_Del	DEL	ENST00000309971.4	hg19	CCDS35154.1																																																																																			.	.		0.490	GLE1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054456.1	NM_001003722	
ANKRD17	26057	hgsc.bcm.edu	37	4	73956454	73956454	+	Frame_Shift_Del	DEL	T	T	-			TCGA-CC-A7IE-01A-21D-A382-10	TCGA-CC-A7IE-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c1caf517-5052-48e3-ad80-8458b3d2ff5f	ab81329b-c119-4a5a-863c-5b50f48cee3f	g.chr4:73956454delT	ENST00000358602.4	-	29	7007	c.6891delA	c.(6889-6891)ttafs	p.L2297fs	ANKRD17_ENST00000330838.6_Frame_Shift_Del_p.L2046fs|ANKRD17_ENST00000509867.2_Frame_Shift_Del_p.L2184fs	NM_032217.3	NP_115593.3	O75179	ANR17_HUMAN	ankyrin repeat domain 17	2297					blood vessel maturation (GO:0001955)|negative regulation of smooth muscle cell differentiation (GO:0051151)|viral process (GO:0016032)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			NS(3)|breast(2)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(39)|ovary(6)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(3)	96	Breast(15;0.000295)		Epithelial(6;8.86e-07)|OV - Ovarian serous cystadenocarcinoma(6;6.22e-06)|all cancers(17;1.51e-05)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			CAGACTGATGTAAAGGATCTG	0.433																																					p.H2298fs		Atlas-Indel,Pindel	.											.	ANKRD17	214	.	0			c.6892delC						.						132.0	139.0	137.0					4																	73956454		2203	4300	6503	SO:0001589	frameshift_variant	26057	exon29			.	AB014597	CCDS34003.1, CCDS34004.1, CCDS68721.1	4q21.1-q21.21	2013-01-10			ENSG00000132466	ENSG00000132466		"""Ankyrin repeat domain containing"""	23575	protein-coding gene	gene with protein product		615929				11165478	Standard	NM_032217		Approved	GTAR, KIAA0697, FLJ22206, NY-BR-16	uc003hgp.3	O75179	OTTHUMG00000160826	ENST00000358602.4:c.6891delA	chr4.hg19:g.73956454delT	ENSP00000351416:p.Leu2297fs	158.0	0.0		146.0	31.0	NM_032217	E7EUV3|G5E964|Q6PJ85|Q6PK85|Q6PKA2|Q86XI3|Q8NDR5|Q96I86|Q9H288|Q9H6J9	Frame_Shift_Del	DEL	ENST00000358602.4	hg19	CCDS34004.1																																																																																			.	.		0.433	ANKRD17-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000362475.1	NM_032217	
TRIM13	10206	hgsc.bcm.edu	37	13	50590444	50590444	+	3'UTR	DEL	A	A	-			TCGA-CC-A7IE-01A-21D-A382-10	TCGA-CC-A7IE-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c1caf517-5052-48e3-ad80-8458b3d2ff5f	ab81329b-c119-4a5a-863c-5b50f48cee3f	g.chr13:50590444delA	ENST00000378182.3	+	0	5106				TRIM13_ENST00000478111.1_Intron|KCNRG_ENST00000360473.4_Intron|KCNRG_ENST00000312942.1_Intron	NM_001007278.1|NM_005798.3|NM_052811.2|NM_213590.1	NP_001007279.1|NP_005789.2|NP_434698.1|NP_998755.1	O60858	TRI13_HUMAN	tripartite motif containing 13						anatomical structure morphogenesis (GO:0009653)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|innate immune response (GO:0045087)|negative regulation of viral release from host cell (GO:1902187)|negative regulation of viral transcription (GO:0032897)|positive regulation of cell death (GO:0010942)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of macroautophagy (GO:0016239)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein autoubiquitination (GO:0051865)|response to gamma radiation (GO:0010332)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|perinuclear endoplasmic reticulum (GO:0097038)	ligase activity (GO:0016874)|signal transducer activity (GO:0004871)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			large_intestine(5)|lung(2)|ovary(2)|upper_aerodigestive_tract(1)	10		Acute lymphoblastic leukemia(7;3.41e-06)|Lung NSC(96;3.08e-05)|Breast(56;9.7e-05)|Prostate(109;0.00174)|Hepatocellular(98;0.0207)|Myeloproliferative disorder(33;0.163)|Lung SC(185;0.187)|all_neural(104;0.19)		GBM - Glioblastoma multiforme(99;1.53e-10)|COAD - Colon adenocarcinoma(199;0.205)		gactgcccagaaaaaactgag	0.323																																					.		Atlas-Indel,Pindel	.											.	TRIM13	30	.	0			.						.																																			SO:0001624	3_prime_UTR_variant	10206	.			.	AF220127	CCDS9423.1, CCDS41888.1	13q14	2013-01-09	2011-01-25	2006-09-26	ENSG00000204977	ENSG00000204977		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	9976	protein-coding gene	gene with protein product		605661	"""ret finger protein 2"", ""tripartite motif-containing 13"""	RFP2		9599022	Standard	NM_213590		Approved	Leu5, RNF77, DLEU5	uc001vdp.1	O60858	OTTHUMG00000016926	ENST00000378182.3:c.*3144A>-	chr13.hg19:g.50590444delA		142.0	0.0		152.0	41.0	.	B2RB49|Q5UBW0|Q5W0U8|Q5W0U9|Q9BQ47|Q9C021	RNA	DEL	ENST00000378182.3	hg19	CCDS9423.1																																																																																			.	.		0.323	TRIM13-005	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000354875.1	NM_001007278	
RPS6	6194	hgsc.bcm.edu	37	9	19376359	19376380	+	Frame_Shift_Del	DEL	TTTGTTCCTGGCGCTTCTCCTT	TTTGTTCCTGGCGCTTCTCCTT	-	rs3206714|rs3209385|rs17852447		TCGA-CC-A7IE-01A-21D-A382-10	TCGA-CC-A7IE-10A-01D-A385-10	TTTGTTCCTGGCGCTTCTCCTT	TTTGTTCCTGGCGCTTCTCCTT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c1caf517-5052-48e3-ad80-8458b3d2ff5f	ab81329b-c119-4a5a-863c-5b50f48cee3f	g.chr9:19376359_19376380delTTTGTTCCTGGCGCTTCTCCTT	ENST00000380394.4	-	6	719_740	c.661_682delAAGGAGAAGCGCCAGGAACAAA	c.(661-684)aaggagaagcgccaggaacaaattfs	p.KEKRQEQI221fs	RPS6_ENST00000380384.1_Frame_Shift_Del_p.KEKRQEQI190fs|RPS6_ENST00000498815.1_5'UTR|RPS6_ENST00000315377.4_Frame_Shift_Del_p.KEKRQEQI190fs|RP11-513M16.8_ENST00000609982.1_RNA	NM_001010.2	NP_001001.2	P62753	RS6_HUMAN	ribosomal protein S6	221			K -> R (in dbSNP:rs17852447). {ECO:0000269|PubMed:15489334}.		activation-induced cell death of T cells (GO:0006924)|cellular protein metabolic process (GO:0044267)|erythrocyte development (GO:0048821)|G1/S transition of mitotic cell cycle (GO:0000082)|gastrulation (GO:0007369)|gene expression (GO:0010467)|glucose homeostasis (GO:0042593)|insulin receptor signaling pathway (GO:0008286)|mitotic cell cycle checkpoint (GO:0007093)|mitotic nuclear division (GO:0007067)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|oogenesis stage (GO:0022605)|placenta development (GO:0001890)|positive regulation of apoptotic process (GO:0043065)|ribosomal small subunit assembly (GO:0000028)|ribosomal small subunit biogenesis (GO:0042274)|RNA metabolic process (GO:0016070)|rRNA processing (GO:0006364)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|T cell differentiation in thymus (GO:0033077)|T cell proliferation involved in immune response (GO:0002309)|TOR signaling (GO:0031929)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cell body (GO:0044297)|cytoplasm (GO:0005737)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytosol (GO:0005829)|cytosolic small ribosomal subunit (GO:0022627)|dendrite (GO:0030425)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|polysome (GO:0005844)|ribonucleoprotein complex (GO:0030529)|small ribosomal subunit (GO:0015935)	poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)|structural constituent of ribosome (GO:0003735)			endometrium(3)|lung(2)|ovary(1)|urinary_tract(1)	7		Colorectal(97;3.46e-05)|Myeloproliferative disorder(762;0.0255)		Lung(42;0.161)|LUSC - Lung squamous cell carcinoma(42;0.234)		CTCTTCGCAATTTGTTCCTGGCGCTTCTCCTTAGCCTCCTAA	0.423																																					p.221_228del		Pindel	.											.	RPS6	25	.	0			c.662_683del						.																																			SO:0001589	frameshift_variant	6194	exon6			.		CCDS6492.1	9p21	2011-04-05			ENSG00000137154	ENSG00000137154		"""S ribosomal proteins"""	10429	protein-coding gene	gene with protein product	"""40S ribosomal protein S6"", ""phosphoprotein NP33"""	180460				1577483	Standard	NM_001010		Approved	S6	uc003znv.1	P62753	OTTHUMG00000019642	ENST00000380394.4:c.661_682delAAGGAGAAGCGCCAGGAACAAA	chr9.hg19:g.19376359_19376380delTTTGTTCCTGGCGCTTCTCCTT	ENSP00000369757:p.Lys221fs	126.0	0.0		97.0	10.0	NM_001010	P08227|P10660|Q4VBY7|Q8N6Z7	Frame_Shift_Del	DEL	ENST00000380394.4	hg19	CCDS6492.1																																																																																			.	.		0.423	RPS6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051858.1	NM_001010	
KIAA0247	9766	hgsc.bcm.edu	37	14	70171412	70171413	+	Frame_Shift_Del	DEL	GC	GC	-			TCGA-CC-A7IE-01A-21D-A382-10	TCGA-CC-A7IE-10A-01D-A385-10	GC	GC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c1caf517-5052-48e3-ad80-8458b3d2ff5f	ab81329b-c119-4a5a-863c-5b50f48cee3f	g.chr14:70171412_70171413delGC	ENST00000342745.4	+	4	724_725	c.411_412delGC	c.(409-414)gtgctgfs	p.L138fs		NM_014734.3	NP_055549.1	Q92537	K0247_HUMAN	KIAA0247	138						integral component of membrane (GO:0016021)				endometrium(1)|kidney(1)|lung(4)|ovary(3)|upper_aerodigestive_tract(1)	10				all cancers(60;0.00155)|BRCA - Breast invasive adenocarcinoma(234;0.0164)|OV - Ovarian serous cystadenocarcinoma(108;0.0196)		TCCTCGTGGTGCTGTTTGTGCT	0.525																																					p.137_137del		Pindel	.											.	KIAA0247	30	.	0			c.410_411del						.																																			SO:0001589	frameshift_variant	9766	exon4			.	D87434	CCDS9796.1	14q24.1	2012-11-29			ENSG00000100647	ENSG00000100647			19956	protein-coding gene	gene with protein product						9039502	Standard	NM_014734		Approved		uc001xlk.3	Q92537	OTTHUMG00000171234	ENST00000342745.4:c.411_412delGC	chr14.hg19:g.70171412_70171413delGC	ENSP00000344424:p.Leu138fs	69.0	0.0		58.0	14.0	NM_014734		Frame_Shift_Del	DEL	ENST00000342745.4	hg19	CCDS9796.1																																																																																			.	.		0.525	KIAA0247-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412453.1	NM_014734	
