#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
SCNN1D	6339	hgsc.bcm.edu	37	1	1222886	1222886	+	Splice_Site	SNP	A	A	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr1:1222886A>T	ENST00000338555.2	+	7	1962		c.e7-1		SCNN1D_ENST00000400928.3_Splice_Site|SCNN1D_ENST00000325425.8_Splice_Site|SCNN1D_ENST00000379116.5_Splice_Site			P51172	SCNND_HUMAN	sodium channel, non-voltage-gated 1, delta subunit						ion transmembrane transport (GO:0034220)|response to stimulus (GO:0050896)|sensory perception of taste (GO:0050909)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	actin cytoskeleton (GO:0015629)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ligand-gated sodium channel activity (GO:0015280)			lung(6)|skin(1)	7	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		Epithelial(90;3.01e-35)|OV - Ovarian serous cystadenocarcinoma(86;2.46e-21)|Colorectal(212;0.000157)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00229)|BRCA - Breast invasive adenocarcinoma(365;0.00251)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.034)|Lung(427;0.199)	Amiloride(DB00594)|Triamterene(DB00384)	TTCTCATTCCAGACAGTTCCG	0.652																																					.		Atlas-SNP	.											.	SCNN1D	60	.	0			c.1311-2A>T						.						49.0	50.0	50.0					1																	1222886		2199	4295	6494	SO:0001630	splice_region_variant	6339	exon10			CATTCCAGACAGT	U38254	CCDS44037.1, CCDS44037.2	1p36.3-p36.2	2012-02-28	2012-02-28		ENSG00000162572	ENSG00000162572		"""Ion channels / Sodium channel, nonvoltage-gated"", ""Sodium channels"""	10601	protein-coding gene	gene with protein product		601328	"""sodium channel, nonvoltage-gated 1, delta"", ""sodium channel, non-voltage-gated 1, delta"""			8661065	Standard	NM_001130413		Approved	ENaCdelta, dNaCh	uc001adt.1	P51172	OTTHUMG00000002081	ENST00000338555.2:c.819-1A>T	chr1.hg19:g.1222886A>T		114.0	0.0		71.0	24.0	NM_001130413	A9Z1X6|B1PS44|Q08AQ3|Q09HT0|Q5T7L3|Q8NA24	Splice_Site	SNP	ENST00000338555.2	hg19		.	.	.	.	.	.	.	.	.	.	A	6.305	0.424337	0.11928	.	.	ENSG00000162572	ENST00000379110;ENST00000379116;ENST00000338555;ENST00000325425;ENST00000400928;ENST00000379099	.	.	.	3.22	3.22	0.36961	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	9.6748	0.40034	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	SCNN1D	1212749	0.025000	0.19082	0.876000	0.34364	0.165000	0.22458	0.354000	0.20146	1.464000	0.47987	0.260000	0.18958	.	.	.		0.652	SCNN1D-001	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000005802.2	NM_002978	Intron
EXOSC10	5394	hgsc.bcm.edu	37	1	11141273	11141273	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr1:11141273T>A	ENST00000376936.4	-	11	1352	c.1303A>T	c.(1303-1305)Agc>Tgc	p.S435C	EXOSC10_ENST00000485606.1_5'UTR|EXOSC10_ENST00000304457.7_Missense_Mutation_p.S435C|EXOSC10_ENST00000544779.1_Missense_Mutation_p.S435C	NM_001001998.1	NP_001001998.1	Q01780	EXOSX_HUMAN	exosome component 10	435					CUT catabolic process (GO:0071034)|dosage compensation by inactivation of X chromosome (GO:0009048)|histone mRNA catabolic process (GO:0071044)|maturation of 5.8S rRNA (GO:0000460)|nuclear mRNA surveillance (GO:0071028)|nuclear polyadenylation-dependent rRNA catabolic process (GO:0071035)|nuclear retention of unspliced pre-mRNA at the site of transcription (GO:0071048)|nuclear-transcribed mRNA catabolic process (GO:0000956)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)	cytoplasm (GO:0005737)|exosome (RNase complex) (GO:0000178)|membrane (GO:0016020)|nuclear exosome (RNase complex) (GO:0000176)|nucleolus (GO:0005730)|nucleus (GO:0005634)|transcriptionally active chromatin (GO:0035327)	3'-5' exonuclease activity (GO:0008408)|exoribonuclease activity (GO:0004532)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(9)|prostate(1)|stomach(3)|upper_aerodigestive_tract(1)	27	Ovarian(185;0.249)	Lung NSC(185;1.74e-05)|all_lung(284;2.05e-05)|Renal(390;0.000147)|Colorectal(325;0.00205)|Breast(348;0.00262)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;4.18e-07)|COAD - Colon adenocarcinoma(227;8.33e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000315)|Kidney(185;0.000832)|KIRC - Kidney renal clear cell carcinoma(229;0.00269)|READ - Rectum adenocarcinoma(331;0.0526)|STAD - Stomach adenocarcinoma(313;0.202)		CGGGCGTAGCTGAGCATCTCC	0.542																																					p.S435C	Colon(179;105 1987 14326 27364 29542)	Atlas-SNP	.											.	EXOSC10	59	.	0			c.A1303T						.						82.0	83.0	82.0					1																	11141273		2203	4300	6503	SO:0001583	missense	5394	exon11			CGTAGCTGAGCAT	BC073788	CCDS126.1, CCDS30584.1	1p36.22	2008-02-05	2004-06-16	2004-06-18	ENSG00000171824	ENSG00000171824			9138	protein-coding gene	gene with protein product	"""polymyositis/scleroderma autoantigen 2 (100kD)"""	605960	"""polymyositis/scleroderma autoantigen 2, 100kDa"""	PMSCL2		1383382, 1644924	Standard	NM_001001998		Approved	PM-Scl, PM/Scl-100, Rrp6p, RRP6, p2, p3, p4	uc001asa.3	Q01780	OTTHUMG00000002123	ENST00000376936.4:c.1303A>T	chr1.hg19:g.11141273T>A	ENSP00000366135:p.Ser435Cys	161.0	0.0		128.0	55.0	NM_001001998	B1AKQ0|B1AKQ1|Q15158	Missense_Mutation	SNP	ENST00000376936.4	hg19	CCDS30584.1	.	.	.	.	.	.	.	.	.	.	T	12.45	1.941753	0.34283	.	.	ENSG00000171824	ENST00000376936;ENST00000304457;ENST00000544779	T;T;T	0.64618	-0.11;-0.11;-0.11	5.77	-2.5	0.06384	-5&apos (2);Ribonuclease H-like (1); exonuclease (2);3&apos (2);	0.804998	0.12628	N	0.452412	T	0.60051	0.2239	L	0.46157	1.445	0.09310	N	1	P;P	0.43607	0.775;0.812	P;P	0.54856	0.649;0.762	T	0.54289	-0.8316	10	0.59425	D	0.04	-0.6509	3.0404	0.06137	0.1946:0.1299:0.46:0.2156	.	435;435	Q01780-2;Q01780	.;EXOSX_HUMAN	C	435	ENSP00000366135:S435C;ENSP00000307307:S435C;ENSP00000439473:S435C	ENSP00000307307:S435C	S	-	1	0	EXOSC10	11063860	0.008000	0.16893	0.004000	0.12327	0.029000	0.11900	0.306000	0.19279	-0.625000	0.05604	-1.137000	0.01932	AGC	.	.		0.542	EXOSC10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000006078.1	NM_001001998	
PRAMEF12	390999	hgsc.bcm.edu	37	1	12837669	12837669	+	Missense_Mutation	SNP	G	G	A	rs201008398	byFrequency	TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr1:12837669G>A	ENST00000357726.4	+	3	1406	c.1379G>A	c.(1378-1380)gGc>gAc	p.G460D		NM_001080830.1	NP_001074299.1	O95522	PRA12_HUMAN	PRAME family member 12	460					negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)					NS(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(3)|lung(9)|ovary(3)|skin(1)|urinary_tract(1)	23	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.0042)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00818)|Colorectal(212;5.04e-06)|Kidney(185;4.99e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000198)|COAD - Colon adenocarcinoma(227;0.000245)|BRCA - Breast invasive adenocarcinoma(304;0.000295)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		CCTCGCTGTGGCATCAGGGCC	0.507																																					p.G460D		Atlas-SNP	.											.	PRAMEF12	69	.	0			c.G1379A						.						106.0	108.0	107.0					1																	12837669		2203	4300	6503	SO:0001583	missense	390999	exon3			GCTGTGGCATCAG		CCDS41254.1	1p36.21	2013-01-17			ENSG00000116726	ENSG00000116726		"""-"""	22125	protein-coding gene	gene with protein product							Standard	NM_001080830		Approved	OTTHUMG00000001927	uc001aui.3	O95522	OTTHUMG00000001927	ENST00000357726.4:c.1379G>A	chr1.hg19:g.12837669G>A	ENSP00000350358:p.Gly460Asp	291.0	0.0		275.0	125.0	NM_001080830		Missense_Mutation	SNP	ENST00000357726.4	hg19	CCDS41254.1	.	.	.	.	.	.	.	.	.	.	.	14.06	2.421439	0.42918	.	.	ENSG00000116726	ENST00000357726	T	0.61859	0.07	2.24	-1.22	0.09494	.	1.264420	0.05864	N	0.623511	T	0.55625	0.1932	M	0.67953	2.075	0.09310	N	1	P	0.44877	0.845	P	0.45037	0.467	T	0.48210	-0.9055	10	0.51188	T	0.08	.	3.0303	0.06104	0.3141:0.2341:0.4519:0.0	.	460	O95522	PRA12_HUMAN	D	460	ENSP00000350358:G460D	ENSP00000350358:G460D	G	+	2	0	PRAMEF12	12760256	0.000000	0.05858	0.000000	0.03702	0.568000	0.35870	-0.711000	0.05019	-0.296000	0.08947	0.205000	0.17691	GGC	.	G|0.993;T|0.007		0.507	PRAMEF12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005457.1	XM_372760	
PRAMEF4	400735	hgsc.bcm.edu	37	1	12942173	12942173	+	Missense_Mutation	SNP	C	C	G	rs201789683		TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr1:12942173C>G	ENST00000235349.5	-	3	447	c.377G>C	c.(376-378)tGc>tCc	p.C126S		NM_001009611.2	NP_001009611.1	O60810	PRAM4_HUMAN	PRAME family member 4	126					negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)					breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(10)|ovary(2)|prostate(3)|skin(1)	24	Ovarian(185;0.249)	Lung NSC(185;3.67e-05)|all_lung(284;4.03e-05)|Renal(390;0.000147)|Breast(348;0.000278)|Colorectal(325;0.00058)|Ovarian(437;0.00965)|Hepatocellular(190;0.0245)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;4.88e-06)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|COAD - Colon adenocarcinoma(227;0.000241)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		ATTGAGGAAGCACCCATGGGC	0.493																																					p.C126S		Atlas-SNP	.											PRAMEF4,NS,carcinoma,0,1	PRAMEF4	62	.	0			c.G377C						.						44.0	56.0	52.0					1																	12942173		1381	2629	4010	SO:0001583	missense	400735	exon3			AGGAAGCACCCAT		CCDS30592.1	1p36.21	2013-01-17			ENSG00000243073	ENSG00000243073		"""-"""	31971	protein-coding gene	gene with protein product							Standard	NM_001009611		Approved	RP5-845O24.6	uc001aun.2	O60810	OTTHUMG00000001987	ENST00000235349.5:c.377G>C	chr1.hg19:g.12942173C>G	ENSP00000235349:p.Cys126Ser	23.0	1.0		22.0	3.0	NM_001009611	Q5LJB5	Missense_Mutation	SNP	ENST00000235349.5	hg19	CCDS30592.1	.	.	.	.	.	.	.	.	.	.	c	8.575	0.881031	0.17467	.	.	ENSG00000243073	ENST00000235349	T	0.18016	2.24	1.35	0.315	0.15852	.	1.371720	0.04624	N	0.402516	T	0.19406	0.0466	L	0.53671	1.685	0.09310	N	1	P	0.50272	0.933	P	0.44811	0.461	T	0.23190	-1.0195	10	0.33940	T	0.23	.	5.2546	0.15540	0.0:0.6297:0.3703:0.0	.	126	O60810	PRAM4_HUMAN	S	126	ENSP00000235349:C126S	ENSP00000235349:C126S	C	-	2	0	PRAMEF4	12864760	0.002000	0.14202	0.003000	0.11579	0.008000	0.06430	0.188000	0.17018	0.112000	0.17975	0.194000	0.17425	TGC	.	C|0.500;G|0.500		0.493	PRAMEF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005518.1	NM_001009611	
FHAD1	114827	hgsc.bcm.edu	37	1	15707218	15707218	+	Missense_Mutation	SNP	G	G	A	rs564119298		TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr1:15707218G>A	ENST00000375998.4	+	27	3661	c.3661G>A	c.(3661-3663)Gca>Aca	p.A1221T	FHAD1_ENST00000314740.8_Missense_Mutation_p.A474T|FHAD1_ENST00000471347.1_3'UTR|FHAD1_ENST00000417793.1_Missense_Mutation_p.A1185T|FHAD1_ENST00000375999.3_Missense_Mutation_p.A1221T|FHAD1_ENST00000358897.4_Missense_Mutation_p.A1221T			B1AJZ9	FHAD1_HUMAN	forkhead-associated (FHA) phosphopeptide binding domain 1	1221										skin(1)|stomach(1)	2						CCTTTGCAACGCAAGGTTCGG	0.478													G|||	1	0.000199681	0.0008	0.0	5008	,	,		20277	0.0		0.0	False		,,,				2504	0.0				p.A1221T		Atlas-SNP	.											.	FHAD1	78	.	0			c.G3661A						.						62.0	59.0	60.0					1																	15707218		692	1591	2283	SO:0001583	missense	114827	exon28			TGCAACGCAAGGT	AK093300		1p36.21	2012-04-19			ENSG00000142621	ENSG00000142621			29408	protein-coding gene	gene with protein product						11572484	Standard	NM_052929		Approved	KIAA1937	uc001awb.2	B1AJZ9	OTTHUMG00000002088	ENST00000375998.4:c.3661G>A	chr1.hg19:g.15707218G>A	ENSP00000365166:p.Ala1221Thr	75.0	0.0		86.0	40.0	NM_052929	Q0P6F5|Q8N8D3|Q8N9T6|Q8NA05	Missense_Mutation	SNP	ENST00000375998.4	hg19		.	.	.	.	.	.	.	.	.	.	G	7.900	0.734185	0.15574	.	.	ENSG00000142621	ENST00000358897;ENST00000417793;ENST00000375999;ENST00000375998;ENST00000529606;ENST00000314740;ENST00000314668	T;T;T;T;T;T;T	0.47528	0.86;0.86;0.84;0.86;0.87;0.87;0.87	4.09	-6.19	0.02078	.	.	.	.	.	T	0.28532	0.0706	L	0.38175	1.15	0.09310	N	1	B;B	0.17852	0.024;0.008	B;B	0.10450	0.005;0.002	T	0.27640	-1.0068	9	0.15066	T	0.55	.	7.0259	0.24940	0.0:0.4508:0.2727:0.2765	.	474;1221	B7WPP2;B1AJZ9	.;FHAD1_HUMAN	T	1221;1185;1221;1221;492;474;456	ENSP00000351770:A1221T;ENSP00000407615:A1185T;ENSP00000365167:A1221T;ENSP00000365166:A1221T;ENSP00000434909:A492T;ENSP00000322979:A474T;ENSP00000318812:A456T	ENSP00000318812:A456T	A	+	1	0	FHAD1	15579805	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.773000	0.04689	-1.338000	0.02233	-0.867000	0.03001	GCA	.	.		0.478	FHAD1-026	PUTATIVE	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000393400.2	NM_052929	
EPHA2	1969	hgsc.bcm.edu	37	1	16459692	16459692	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr1:16459692T>A	ENST00000358432.5	-	11	2190	c.2036A>T	c.(2035-2037)gAg>gTg	p.E679V		NM_004431.3	NP_004422.2	P29317	EPHA2_HUMAN	EPH receptor A2	679	Mediates interaction with ARHGEF16 and ELMO2.|Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of Rac GTPase activity (GO:0032863)|angiogenesis (GO:0001525)|axial mesoderm formation (GO:0048320)|bone remodeling (GO:0046849)|branching involved in mammary gland duct morphogenesis (GO:0060444)|cell adhesion (GO:0007155)|cell chemotaxis (GO:0060326)|cell migration (GO:0016477)|ephrin receptor signaling pathway (GO:0048013)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|keratinocyte differentiation (GO:0030216)|lens fiber cell morphogenesis (GO:0070309)|mammary gland epithelial cell proliferation (GO:0033598)|multicellular organismal development (GO:0007275)|negative regulation of protein kinase B signaling (GO:0051898)|neural tube development (GO:0021915)|neuron differentiation (GO:0030182)|notochord cell development (GO:0060035)|notochord formation (GO:0014028)|osteoblast differentiation (GO:0001649)|osteoclast differentiation (GO:0030316)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|post-anal tail morphogenesis (GO:0036342)|protein kinase B signaling (GO:0043491)|regulation of angiogenesis (GO:0045765)|regulation of blood vessel endothelial cell migration (GO:0043535)|regulation of cell adhesion mediated by integrin (GO:0033628)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of lamellipodium assembly (GO:0010591)|response to growth factor (GO:0070848)|skeletal system development (GO:0001501)|vasculogenesis (GO:0001570)|viral process (GO:0016032)	cell projection (GO:0042995)|cell surface (GO:0009986)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|leading edge membrane (GO:0031256)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(3)|cervix(2)|endometrium(1)|kidney(1)|large_intestine(6)|lung(12)|ovary(2)|pancreas(1)|prostate(3)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	42		Colorectal(325;3.46e-05)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0181)|Colorectal(212;3.63e-07)|COAD - Colon adenocarcinoma(227;2.25e-05)|BRCA - Breast invasive adenocarcinoma(304;9.58e-05)|Kidney(64;0.000175)|KIRC - Kidney renal clear cell carcinoma(64;0.00261)|STAD - Stomach adenocarcinoma(313;0.00669)|READ - Rectum adenocarcinoma(331;0.0649)	Dasatinib(DB01254)|Regorafenib(DB08896)	GATGACGCCCTCTAGGCGGAT	0.612																																					p.E679V		Atlas-SNP	.											.	EPHA2	102	.	0			c.A2036T						.						71.0	70.0	70.0					1																	16459692		2203	4300	6503	SO:0001583	missense	1969	exon11			ACGCCCTCTAGGC	BC037166	CCDS169.1	1p36	2013-02-11	2004-10-28		ENSG00000142627	ENSG00000142627	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3386	protein-coding gene	gene with protein product		176946	"""EphA2"""	ECK		9119409	Standard	NM_004431		Approved		uc001aya.2	P29317	OTTHUMG00000009527	ENST00000358432.5:c.2036A>T	chr1.hg19:g.16459692T>A	ENSP00000351209:p.Glu679Val	52.0	0.0		47.0	25.0	NM_004431	B5A968|Q8N3Z2	Missense_Mutation	SNP	ENST00000358432.5	hg19	CCDS169.1	.	.	.	.	.	.	.	.	.	.	t	27.9	4.873054	0.91664	.	.	ENSG00000142627	ENST00000358432	T	0.61040	0.14	5.5	5.5	0.81552	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.53938	D	0.000046	T	0.47563	0.1452	N	0.00611	-1.325	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.71758	-0.4496	10	0.87932	D	0	.	14.4836	0.67599	0.0:0.0:0.0:1.0	.	679	P29317	EPHA2_HUMAN	V	679	ENSP00000351209:E679V	ENSP00000351209:E679V	E	-	2	0	EPHA2	16332279	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	8.030000	0.88816	2.119000	0.64992	0.515000	0.50301	GAG	.	.		0.612	EPHA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026322.1	NM_004431	
UBR4	23352	hgsc.bcm.edu	37	1	19433356	19433356	+	Silent	SNP	G	G	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr1:19433356G>A	ENST00000375254.3	-	82	12237	c.12210C>T	c.(12208-12210)gcC>gcT	p.A4070A	UBR4_ENST00000375226.2_Silent_p.A4046A|UBR4_ENST00000375267.2_Silent_p.A4070A|UBR4_ENST00000375224.1_5'Flank|UBR4_ENST00000375217.2_Silent_p.A4063A	NM_020765.2	NP_065816.2	Q5T4S7	UBR4_HUMAN	ubiquitin protein ligase E3 component n-recognin 4	4070					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|viral process (GO:0016032)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(7)|central_nervous_system(1)|cervix(2)|endometrium(23)|kidney(25)|large_intestine(25)|liver(2)|lung(47)|ovary(10)|pancreas(2)|prostate(7)|skin(5)|stomach(5)|upper_aerodigestive_tract(4)|urinary_tract(6)	171		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000328)|Lung NSC(340;0.000406)|Breast(348;0.000814)|Ovarian(437;0.00774)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00674)|BRCA - Breast invasive adenocarcinoma(304;5.43e-05)|Kidney(64;0.000337)|KIRC - Kidney renal clear cell carcinoma(64;0.00426)|STAD - Stomach adenocarcinoma(196;0.00715)|READ - Rectum adenocarcinoma(331;0.0816)		ACTTCTTCCAGGCATCATAGG	0.537																																					p.A4070A		Atlas-SNP	.											.	UBR4	415	.	0			c.C12210T						.						60.0	60.0	60.0					1																	19433356		2203	4300	6503	SO:0001819	synonymous_variant	23352	exon82			CTTCCAGGCATCA	AF348492	CCDS189.1	1p36.13	2008-06-23	2007-06-19	2007-06-19	ENSG00000127481	ENSG00000127481		"""Ubiquitin protein ligase E3 component n-recognins"""	30313	protein-coding gene	gene with protein product		609890	"""zinc finger, UBR1 type 1"""	ZUBR1		14702039, 10718198, 16055722	Standard	XM_005245802		Approved	KIAA1307, KIAA0462, RBAF600	uc001bbi.3	Q5T4S7	OTTHUMG00000002498	ENST00000375254.3:c.12210C>T	chr1.hg19:g.19433356G>A		255.0	0.0		184.0	83.0	NM_020765	A8MPT2|A8MQ33|A8MQB1|O60646|O75050|Q4QRK5|Q5T4S8|Q5T4S9|Q5TBN8|Q5TBP2|Q6DKH8|Q6P4A4|Q7L8P7|Q8IXJ4|Q8TDN5|Q8WV67|Q9HA46|Q9P2N9|Q9UG82	Silent	SNP	ENST00000375254.3	hg19	CCDS189.1																																																																																			.	.		0.537	UBR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007085.1	NM_020765	
CAMK2N1	55450	hgsc.bcm.edu	37	1	20811760	20811760	+	Missense_Mutation	SNP	G	G	C			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr1:20811760G>C	ENST00000375078.3	-	1	953	c.113C>G	c.(112-114)gCc>gGc	p.A38G	CAMK2N1_ENST00000489020.1_5'Flank	NM_018584.5	NP_061054.2	Q7Z7J9	CK2N1_HUMAN	calcium/calmodulin-dependent protein kinase II inhibitor 1	38						cell junction (GO:0030054)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	calcium-dependent protein kinase inhibitor activity (GO:0008427)			lung(1)	1		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000247)|Lung NSC(340;0.000285)|Breast(348;0.0013)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|COAD - Colon adenocarcinoma(152;1.11e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000132)|Kidney(64;0.00016)|GBM - Glioblastoma multiforme(114;0.00116)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.195)		GTTCTGCCCGGCGCCGAAGAA	0.692																																					p.A38G		Atlas-SNP	.											.	CAMK2N1	7	.	0			c.C113G						.						13.0	17.0	15.0					1																	20811760		2195	4294	6489	SO:0001583	missense	55450	exon1			TGCCCGGCGCCGA	AY204901	CCDS207.1	1p36.12	2008-02-05			ENSG00000162545	ENSG00000162545			24190	protein-coding gene	gene with protein product		614986				12477932	Standard	NM_018584		Approved	CaMKIINalpha	uc001bdh.3	Q7Z7J9	OTTHUMG00000002837	ENST00000375078.3:c.113C>G	chr1.hg19:g.20811760G>C	ENSP00000364219:p.Ala38Gly	47.0	0.0		46.0	17.0	NM_018584		Missense_Mutation	SNP	ENST00000375078.3	hg19	CCDS207.1	.	.	.	.	.	.	.	.	.	.	G	10.73	1.433215	0.25813	.	.	ENSG00000162545	ENST00000375078	.	.	.	3.09	3.09	0.35607	.	0.528419	0.14185	N	0.335737	T	0.14270	0.0345	.	.	.	0.22728	N	0.998808	B	0.09022	0.002	B	0.04013	0.001	T	0.26121	-1.0112	8	0.02654	T	1	-11.6906	8.3155	0.32097	0.0:0.2454:0.7546:0.0	.	38	Q7Z7J9	CK2N1_HUMAN	G	38	.	ENSP00000364219:A38G	A	-	2	0	CAMK2N1	20684347	0.119000	0.22226	1.000000	0.80357	0.917000	0.54804	0.947000	0.29082	1.732000	0.51606	0.591000	0.81541	GCC	.	.		0.692	CAMK2N1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007949.1	NM_018584	
RAP1GAP	5909	hgsc.bcm.edu	37	1	21940198	21940198	+	Splice_Site	SNP	T	T	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr1:21940198T>A	ENST00000374765.4	-	9	597	c.397A>T	c.(397-399)Acc>Tcc	p.T133S	RAP1GAP_ENST00000374763.2_Splice_Site_p.T133S|RAP1GAP_ENST00000290101.4_Splice_Site_p.T197S|RAP1GAP_ENST00000374757.3_5'UTR|RAP1GAP_ENST00000374761.2_Splice_Site_p.T164S|RAP1GAP_ENST00000542643.2_Splice_Site_p.T133S	NM_002885.2	NP_002876.2	P47736	RPGP1_HUMAN	RAP1 GTPase activating protein	133					GTP catabolic process (GO:0006184)|positive regulation of Rap GTPase activity (GO:0032854)|regulation of Ras GTPase activity (GO:0032318)|signal transduction (GO:0007165)	cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)|GTPase activity (GO:0003924)|protein homodimerization activity (GO:0042803)|Rap GTPase activator activity (GO:0046582)|Ras GTPase binding (GO:0017016)			breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(7)|ovary(2)|skin(1)	17		Colorectal(325;0.000147)|Renal(390;0.000734)|Lung NSC(340;0.000861)|all_lung(284;0.000901)|Breast(348;0.012)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0427)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0192)|OV - Ovarian serous cystadenocarcinoma(117;2.3e-26)|COAD - Colon adenocarcinoma(152;1.59e-05)|GBM - Glioblastoma multiforme(114;2.7e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000354)|STAD - Stomach adenocarcinoma(196;0.00645)|KIRC - Kidney renal clear cell carcinoma(1967;0.00862)|READ - Rectum adenocarcinoma(331;0.0625)|Lung(427;0.146)		CGGCACTTGGTCCTGAGAAGA	0.572																																					p.T197S		Atlas-SNP	.											.	RAP1GAP	119	.	0			c.A589T						.						141.0	121.0	128.0					1																	21940198		2203	4300	6503	SO:0001630	splice_region_variant	5909	exon9			ACTTGGTCCTGAG	BC054490	CCDS218.1, CCDS53276.1, CCDS53277.1	1p36.1-p35	2009-09-14	2006-04-12	2006-04-12	ENSG00000076864	ENSG00000076864			9858	protein-coding gene	gene with protein product		600278	"""RAP1, GTPase activating protein 1"""	RAP1GA1		1904317	Standard	NM_001145657		Approved	KIAA0474, RAP1GAP1, RAP1GAPII	uc001bew.3	P47736	OTTHUMG00000007513	ENST00000374765.4:c.396-1A>T	chr1.hg19:g.21940198T>A		54.0	0.0		36.0	18.0	NM_001145658	J3QSS6|O75062|Q5T3S9|Q5T3T4|Q7Z5S8|Q9UQ51	Missense_Mutation	SNP	ENST00000374765.4	hg19	CCDS218.1	.	.	.	.	.	.	.	.	.	.	T	10.35	1.325947	0.24080	.	.	ENSG00000076864	ENST00000290101;ENST00000374761;ENST00000542643;ENST00000374765;ENST00000374763;ENST00000374758;ENST00000359708;ENST00000374757	D;D;D;D;D	0.94330	-3.4;-3.4;-3.4;-3.4;-3.4	4.82	2.44	0.29823	.	0.000000	0.85682	D	0.000000	D	0.85375	0.5682	L	0.31476	0.935	0.80722	D	1	B;B;B;B	0.22604	0.072;0.061;0.002;0.035	B;B;B;B	0.24974	0.057;0.031;0.007;0.017	T	0.72174	-0.4370	10	0.09843	T	0.71	-7.3747	6.839	0.23953	0.0:0.1911:0.0:0.8089	.	133;133;164;133	P47736-2;P47736;P47736-3;Q7Z5S8	.;RPGP1_HUMAN;.;.	S	197;164;133;133;164;133;197;275	ENSP00000290101:T197S;ENSP00000363893:T164S;ENSP00000441661:T133S;ENSP00000363897:T133S;ENSP00000352739:T197S	ENSP00000290101:T197S	T	-	1	0	RAP1GAP	21812785	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	3.197000	0.51028	0.289000	0.22422	0.459000	0.35465	ACC	.	.		0.572	RAP1GAP-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000019759.2	NM_002885	Missense_Mutation
WNT4	54361	hgsc.bcm.edu	37	1	22446623	22446623	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr1:22446623A>G	ENST00000290167.6	-	5	1019	c.976T>C	c.(976-978)Tgc>Cgc	p.C326R	WNT4_ENST00000542383.1_Missense_Mutation_p.C271R	NM_030761.4	NP_110388.2	P56705	WNT4_HUMAN	wingless-type MMTV integration site family, member 4	326					adrenal gland development (GO:0030325)|androgen biosynthetic process (GO:0006702)|branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|cell fate commitment (GO:0045165)|cellular response to starvation (GO:0009267)|cellular response to transforming growth factor beta stimulus (GO:0071560)|embryonic epithelial tube formation (GO:0001838)|epithelial to mesenchymal transition (GO:0001837)|establishment of protein localization to plasma membrane (GO:0090002)|female gonad development (GO:0008585)|female sex determination (GO:0030237)|immature T cell proliferation in thymus (GO:0033080)|kidney development (GO:0001822)|liver development (GO:0001889)|male gonad development (GO:0008584)|mammary gland epithelium development (GO:0061180)|mesenchymal to epithelial transition (GO:0060231)|metanephric mesenchymal cell differentiation (GO:0072162)|metanephric nephron morphogenesis (GO:0072273)|metanephric tubule formation (GO:0072174)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell differentiation (GO:0045596)|negative regulation of cell migration (GO:0030336)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|negative regulation of gene expression (GO:0010629)|negative regulation of male gonad development (GO:2000019)|negative regulation of steroid biosynthetic process (GO:0010894)|negative regulation of testicular blood vessel morphogenesis (GO:0061369)|negative regulation of testosterone biosynthetic process (GO:2000225)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of wound healing (GO:0061045)|neuron differentiation (GO:0030182)|non-canonical Wnt signaling pathway via MAPK cascade (GO:0038030)|oocyte development (GO:0048599)|paramesonephric duct development (GO:0061205)|positive regulation of aldosterone biosynthetic process (GO:0032349)|positive regulation of bone mineralization (GO:0030501)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of cortisol biosynthetic process (GO:2000066)|positive regulation of dermatome development (GO:0061184)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of meiosis (GO:0045836)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of transcription, DNA-templated (GO:0045893)|protein palmitoylation (GO:0018345)|regulation of cell-cell adhesion (GO:0022407)|renal vesicle formation (GO:0072033)|renal vesicle induction (GO:0072034)|smooth muscle cell differentiation (GO:0051145)|somatotropin secreting cell differentiation (GO:0060126)|tertiary branching involved in mammary gland duct morphogenesis (GO:0060748)|thyroid-stimulating hormone-secreting cell differentiation (GO:0060129)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	frizzled binding (GO:0005109)|receptor agonist activity (GO:0048018)|transcription corepressor activity (GO:0003714)			breast(1)|endometrium(1)|large_intestine(2)|lung(1)|ovary(1)|prostate(2)	8		Colorectal(325;3.46e-05)|all_lung(284;5.94e-05)|Lung NSC(340;6.55e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;9.02e-26)|Colorectal(126;1.71e-07)|COAD - Colon adenocarcinoma(152;1.17e-05)|GBM - Glioblastoma multiforme(114;2.01e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000568)|KIRC - Kidney renal clear cell carcinoma(1967;0.00277)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.138)		TTGCAGCTGCAGCGTTCAGCC	0.657																																					p.C326R		Atlas-SNP	.											.	WNT4	33	.	0			c.T976C						.						38.0	34.0	36.0					1																	22446623		2203	4300	6503	SO:0001583	missense	54361	exon5			AGCTGCAGCGTTC	AL031281	CCDS223.1	1p36.23-p35.1	2013-02-28			ENSG00000162552	ENSG00000162552		"""Wingless-type MMTV integration sites"", ""Endogenous ligands"""	12783	protein-coding gene	gene with protein product		603490				8168088	Standard	NM_030761		Approved	WNT-4	uc001bfs.4	P56705	OTTHUMG00000002894	ENST00000290167.6:c.976T>C	chr1.hg19:g.22446623A>G	ENSP00000290167:p.Cys326Arg	57.0	0.0		33.0	15.0	NM_030761	B4DJF9|Q5TZQ0|Q96T81|Q9BXF5|Q9H1J8|Q9UJM2	Missense_Mutation	SNP	ENST00000290167.6	hg19	CCDS223.1	.	.	.	.	.	.	.	.	.	.	a	20.8	4.053594	0.75960	.	.	ENSG00000162552	ENST00000290167;ENST00000542383	D;D	0.91686	-2.89;-2.89	4.69	4.69	0.59074	.	0.000000	0.85682	D	0.000000	D	0.97586	0.9209	H	0.98487	4.245	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98616	1.0665	10	0.87932	D	0	.	13.2728	0.60170	1.0:0.0:0.0:0.0	.	326	P56705	WNT4_HUMAN	R	326;271	ENSP00000290167:C326R;ENSP00000441033:C271R	ENSP00000290167:C326R	C	-	1	0	WNT4	22319210	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	9.261000	0.95576	1.874000	0.54306	0.370000	0.22315	TGC	.	.		0.657	WNT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008088.2		
ZNF436	80818	hgsc.bcm.edu	37	1	23689069	23689069	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr1:23689069T>C	ENST00000314011.4	-	4	942	c.806A>G	c.(805-807)cAg>cGg	p.Q269R	ZNF436_ENST00000374608.3_Missense_Mutation_p.Q269R	NM_001077195.1	NP_001070663.1	Q9C0F3	ZN436_HUMAN	zinc finger protein 436	269					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(2)|lung(8)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	19		Colorectal(325;3.46e-05)|Lung NSC(340;4.15e-05)|all_lung(284;6.64e-05)|Renal(390;0.000219)|Breast(348;0.00262)|Ovarian(437;0.00539)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0227)|OV - Ovarian serous cystadenocarcinoma(117;6.44e-26)|Colorectal(126;5.5e-08)|COAD - Colon adenocarcinoma(152;3.09e-06)|GBM - Glioblastoma multiforme(114;5.97e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000977)|KIRC - Kidney renal clear cell carcinoma(1967;0.00336)|STAD - Stomach adenocarcinoma(196;0.0127)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.0853)|LUSC - Lung squamous cell carcinoma(448;0.187)		GTGGGTCCTCTGGTGCTGAGC	0.517																																					p.Q269R		Atlas-SNP	.											.	ZNF436	49	.	0			c.A806G						.						103.0	108.0	106.0					1																	23689069		2203	4300	6503	SO:0001583	missense	80818	exon4			GTCCTCTGGTGCT	AB051497	CCDS233.1	1p36	2013-01-08			ENSG00000125945	ENSG00000125945		"""Zinc fingers, C2H2-type"", ""-"""	20814	protein-coding gene	gene with protein product		611703				11214970	Standard	NM_001077195		Approved	KIAA1710, Zfp46	uc001bgt.3	Q9C0F3	OTTHUMG00000003232	ENST00000314011.4:c.806A>G	chr1.hg19:g.23689069T>C	ENSP00000313582:p.Gln269Arg	140.0	0.0		114.0	5.0	NM_001077195	Q658I9	Missense_Mutation	SNP	ENST00000314011.4	hg19	CCDS233.1	.	.	.	.	.	.	.	.	.	.	T	15.89	2.967856	0.53507	.	.	ENSG00000125945	ENST00000314011;ENST00000374609;ENST00000374608	T;T;T	0.34667	1.35;3.2;1.35	5.79	5.79	0.91817	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.56097	D	0.000035	T	0.18551	0.0445	N	0.19112	0.55	0.29126	N	0.87995	P	0.42161	0.772	B	0.27262	0.078	T	0.19745	-1.0296	10	0.49607	T	0.09	-36.6231	9.3961	0.38404	0.1588:0.0:0.0:0.8412	.	269	Q9C0F3	ZN436_HUMAN	R	269	ENSP00000313582:Q269R;ENSP00000363737:Q269R;ENSP00000363736:Q269R	ENSP00000313582:Q269R	Q	-	2	0	ZNF436	23561656	0.082000	0.21442	1.000000	0.80357	0.975000	0.68041	0.427000	0.21379	2.212000	0.71576	0.533000	0.62120	CAG	.	.		0.517	ZNF436-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008908.1	NM_030634	
ZNF683	257101	hgsc.bcm.edu	37	1	26694278	26694278	+	Missense_Mutation	SNP	G	G	C			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr1:26694278G>C	ENST00000436292.1	-	3	245	c.125C>G	c.(124-126)gCc>gGc	p.A42G	ZNF683_ENST00000403843.1_Missense_Mutation_p.A42G|ZNF683_ENST00000374204.1_Missense_Mutation_p.A42G|ZNF683_ENST00000349618.3_Missense_Mutation_p.A42G			Q8IZ20	ZN683_HUMAN	zinc finger protein 683	42					natural killer cell differentiation (GO:0001779)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(8)|prostate(1)|skin(1)	15		all_cancers(24;2.39e-25)|Colorectal(325;3.46e-05)|all_lung(284;5.94e-05)|Lung NSC(340;7.26e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.00637)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|OV - Ovarian serous cystadenocarcinoma(117;1.76e-26)|Colorectal(126;1.38e-08)|COAD - Colon adenocarcinoma(152;9.31e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.000751)|BRCA - Breast invasive adenocarcinoma(304;0.00099)|STAD - Stomach adenocarcinoma(196;0.00151)|GBM - Glioblastoma multiforme(114;0.00793)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.159)|LUSC - Lung squamous cell carcinoma(448;0.233)		TGGTCTGCAGGCTGAGAAGAC	0.622																																					p.A42G		Atlas-SNP	.											.	ZNF683	51	.	0			c.C125G						.						19.0	17.0	18.0					1																	26694278		2203	4299	6502	SO:0001583	missense	257101	exon3			CTGCAGGCTGAGA	BC029505	CCDS279.2	1p36.11	2013-01-08			ENSG00000176083	ENSG00000176083		"""Zinc fingers, C2H2-type"""	28495	protein-coding gene	gene with protein product	"""hypothetical protein MGC33414"""					12477932	Standard	NM_173574		Approved	MGC33414	uc009vsj.1	Q8IZ20	OTTHUMG00000003521	ENST00000436292.1:c.125C>G	chr1.hg19:g.26694278G>C	ENSP00000388792:p.Ala42Gly	107.0	0.0		75.0	36.0	NM_173574	Q5T141|Q5T146|Q5T147|Q5T149|Q8NEN4	Missense_Mutation	SNP	ENST00000436292.1	hg19		.	.	.	.	.	.	.	.	.	.	G	18.45	3.626722	0.66901	.	.	ENSG00000176083	ENST00000403843;ENST00000436292;ENST00000374204;ENST00000349618;ENST00000455900;ENST00000451801;ENST00000423508;ENST00000416125	T;T;T;T;T;T;T;T	0.31247	2.79;2.79;2.72;2.72;1.88;1.89;1.5;1.52	3.97	2.01	0.26516	.	0.373374	0.19610	N	0.110164	T	0.35189	0.0923	L	0.27053	0.805	0.09310	N	1	D;B	0.76494	0.999;0.024	D;B	0.79108	0.992;0.014	T	0.08186	-1.0734	10	0.37606	T	0.19	-2.1331	6.8965	0.24259	0.0:0.1936:0.6063:0.2002	.	42;42	Q8IZ20-2;Q8IZ20	.;ZN683_HUMAN	G	42;42;42;42;50;42;50;42	ENSP00000384782:A42G;ENSP00000388792:A42G;ENSP00000363320:A42G;ENSP00000344095:A42G;ENSP00000411289:A50G;ENSP00000411290:A42G;ENSP00000391584:A50G;ENSP00000401961:A42G	ENSP00000344095:A42G	A	-	2	0	ZNF683	26566865	0.008000	0.16893	0.058000	0.19502	0.948000	0.59901	0.626000	0.24492	0.424000	0.26061	0.462000	0.41574	GCC	.	.		0.622	ZNF683-202	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000009794.2	NM_173574	
NUDC	10726	hgsc.bcm.edu	37	1	27268120	27268120	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr1:27268120A>G	ENST00000321265.5	+	3	455	c.332A>G	c.(331-333)gAg>gGg	p.E111G		NM_006600.3	NP_006591.1	Q9Y266	NUDC_HUMAN	nudC nuclear distribution protein	111				E -> K (in Ref. 4; BAA76628). {ECO:0000305}.	cell proliferation (GO:0008283)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|multicellular organismal development (GO:0007275)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|microtubule (GO:0005874)|nucleoplasm (GO:0005654)				cervix(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|ovary(1)	8				UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Epithelial(14;6.1e-51)|OV - Ovarian serous cystadenocarcinoma(117;2.87e-29)|Colorectal(126;5.74e-09)|COAD - Colon adenocarcinoma(152;9.31e-07)|BRCA - Breast invasive adenocarcinoma(304;0.000281)|STAD - Stomach adenocarcinoma(196;0.000604)|KIRC - Kidney renal clear cell carcinoma(1967;0.000739)|READ - Rectum adenocarcinoma(331;0.0421)		ACTGATGAAGAGGCAGAGAGG	0.637																																					p.E111G		Atlas-SNP	.											.	NUDC	15	.	0			c.A332G						.						38.0	39.0	38.0					1																	27268120		2203	4300	6503	SO:0001583	missense	10726	exon3			ATGAAGAGGCAGA		CCDS292.1	1p35-p34	2013-08-06	2013-08-06		ENSG00000090273	ENSG00000090273			8045	protein-coding gene	gene with protein product		610325	"""nuclear distribution gene C homolog (A. nidulans)"", ""nuclear distribution C homolog (A. nidulans)"""				Standard	NM_006600		Approved	NudC	uc001bng.2	Q9Y266	OTTHUMG00000004226	ENST00000321265.5:c.332A>G	chr1.hg19:g.27268120A>G	ENSP00000319664:p.Glu111Gly	200.0	0.0		175.0	15.0	NM_006600	Q5QP31|Q5QP35|Q9H0N2|Q9Y2B6	Missense_Mutation	SNP	ENST00000321265.5	hg19	CCDS292.1	.	.	.	.	.	.	.	.	.	.	A	24.8	4.572324	0.86542	.	.	ENSG00000090273	ENST00000435827;ENST00000321265;ENST00000452707	D	0.82081	-1.57	5.52	4.33	0.51752	.	0.141972	0.64402	D	0.000007	D	0.91209	0.7230	M	0.88906	2.99	0.58432	D	0.999999	D;D	0.76494	0.999;0.983	D;D	0.71184	0.972;0.917	D	0.92198	0.5765	10	0.59425	D	0.04	.	12.2401	0.54538	0.8581:0.1419:0.0:0.0	.	62;111	Q9H2R7;Q9Y266	.;NUDC_HUMAN	G	115;111;62	ENSP00000319664:E111G	ENSP00000319664:E111G	E	+	2	0	NUDC	27140707	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.148000	0.77389	2.111000	0.64477	0.533000	0.62120	GAG	.	.		0.637	NUDC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012172.2		
LAPTM5	7805	hgsc.bcm.edu	37	1	31215394	31215394	+	Missense_Mutation	SNP	G	G	C			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr1:31215394G>C	ENST00000294507.3	-	2	164	c.90C>G	c.(88-90)atC>atG	p.I30M	LAPTM5_ENST00000476492.1_5'UTR	NM_006762.2	NP_006753.1	Q13571	LAPM5_HUMAN	lysosomal protein transmembrane 5	30					transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)				large_intestine(2)|lung(7)|skin(1)	10		Colorectal(325;0.0199)|Myeloproliferative disorder(586;0.0393)|all_neural(195;0.0966)|Medulloblastoma(700;0.151)|Ovarian(437;0.192)		STAD - Stomach adenocarcinoma(196;0.0196)|READ - Rectum adenocarcinoma(331;0.0649)		AGACGCTCATGATCTGGAGGC	0.587																																					p.I30M		Atlas-SNP	.											.	LAPTM5	30	.	0			c.C90G						.						84.0	66.0	72.0					1																	31215394		2203	4300	6503	SO:0001583	missense	7805	exon2			GCTCATGATCTGG	U51240	CCDS337.1	1p34	2009-07-20	2009-07-20		ENSG00000162511	ENSG00000162511			29612	protein-coding gene	gene with protein product		601476	"""lysosomal multispanning membrane protein 5"""			8661146, 12527926	Standard	NM_006762		Approved		uc001bsc.2	Q13571	OTTHUMG00000003707	ENST00000294507.3:c.90C>G	chr1.hg19:g.31215394G>C	ENSP00000294507:p.Ile30Met	102.0	0.0		59.0	27.0	NM_006762	Q13240|Q14698|Q3KP54	Missense_Mutation	SNP	ENST00000294507.3	hg19	CCDS337.1	.	.	.	.	.	.	.	.	.	.	G	17.84	3.488883	0.64074	.	.	ENSG00000162511	ENST00000294507;ENST00000424259	T	0.52295	0.67	5.05	2.9	0.33743	.	0.275088	0.29940	N	0.010806	T	0.51907	0.1702	L	0.51422	1.61	0.26252	N	0.978716	D	0.56746	0.977	P	0.58721	0.844	T	0.33059	-0.9883	10	0.44086	T	0.13	-30.0457	7.9368	0.29935	0.0:0.1722:0.6505:0.1773	.	30	Q13571	LAPM5_HUMAN	M	30	ENSP00000294507:I30M	ENSP00000294507:I30M	I	-	3	3	LAPTM5	30987981	1.000000	0.71417	1.000000	0.80357	0.807000	0.45602	0.985000	0.29578	2.363000	0.80096	0.462000	0.41574	ATC	.	.		0.587	LAPTM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000010463.1	NM_006762	
PEF1	553115	hgsc.bcm.edu	37	1	32101091	32101091	+	Silent	SNP	T	T	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr1:32101091T>A	ENST00000373703.4	-	2	79	c.57A>T	c.(55-57)ggA>ggT	p.G19G	PEF1_ENST00000440872.2_Silent_p.G19G|PEF1_ENST00000492061.1_5'UTR	NM_012392.3	NP_036524.1	Q9UBV8	PEF1_HUMAN	penta-EF-hand domain containing 1	19					proteolysis (GO:0006508)|response to calcium ion (GO:0051592)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|poly(A) RNA binding (GO:0044822)|protein dimerization activity (GO:0046983)|protein heterodimerization activity (GO:0046982)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|lung(1)|prostate(2)|upper_aerodigestive_tract(1)	7		Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.104)|all_neural(195;0.186)		STAD - Stomach adenocarcinoma(196;0.0546)		CCGGAGGGGCTCCTGGTGCTT	0.587																																					p.G19G		Atlas-SNP	.											.	PEF1	20	.	0			c.A57T						.						20.0	22.0	21.0					1																	32101091		2192	4289	6481	SO:0001819	synonymous_variant	553115	exon2			AGGGGCTCCTGGT		CCDS345.1	1p34	2013-01-10			ENSG00000162517	ENSG00000162517		"""EF-hand domain containing"""	30009	protein-coding gene	gene with protein product	"""peflin"""	610033				10486255, 11883899	Standard	NM_012392		Approved	PEF1A	uc001bth.2	Q9UBV8	OTTHUMG00000003877	ENST00000373703.4:c.57A>T	chr1.hg19:g.32101091T>A		308.0	0.0		270.0	106.0	NM_012392		Silent	SNP	ENST00000373703.4	hg19	CCDS345.1																																																																																			.	.		0.587	PEF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011046.1	NM_012392	
CSMD2	114784	hgsc.bcm.edu	37	1	34174805	34174805	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr1:34174805A>G	ENST00000373380.1	-	1	299	c.79T>C	c.(79-81)Ttt>Ctt	p.F27L	CSMD2_ENST00000373388.2_5'UTR|CSMD2_ENST00000373381.4_Missense_Mutation_p.F1154L			Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2	1114	CUB 1. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(5)|breast(5)|central_nervous_system(3)|cervix(2)|endometrium(20)|haematopoietic_and_lymphoid_tissue(4)|kidney(9)|large_intestine(43)|lung(114)|ovary(8)|pancreas(1)|prostate(6)|skin(20)|upper_aerodigestive_tract(5)|urinary_tract(1)	246		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)				TTCACAGGAAAGTTGGGGGAC	0.483																																					p.F1114L		Atlas-SNP	.											CSMD2,NS,carcinoma,0,1	CSMD2	946	.	0			c.T3340C						.						102.0	92.0	95.0					1																	34174805		2203	4300	6503	SO:0001583	missense	114784	exon22			CAGGAAAGTTGGG	AY210418	CCDS380.1, CCDS60082.1	1p34.3	2014-01-28			ENSG00000121904	ENSG00000121904			19290	protein-coding gene	gene with protein product		608398				11472063, 11572484	Standard	NM_001281956		Approved	KIAA1884	uc001bxn.1	Q7Z408	OTTHUMG00000011135	ENST00000373380.1:c.79T>C	chr1.hg19:g.34174805A>G	ENSP00000362478:p.Phe27Leu	152.0	1.0		97.0	34.0	NM_052896	B1AM50|E7EUA6|Q53TY4|Q5VT59|Q8N963|Q96Q03|Q9H4V7|Q9H4V8|Q9H4V9|Q9H4W0|Q9H4W1|Q9H4W2|Q9H4W3|Q9H4W4|Q9HCY5|Q9HCY6|Q9HCY7	Missense_Mutation	SNP	ENST00000373380.1	hg19		.	.	.	.	.	.	.	.	.	.	A	26.3	4.720707	0.89205	.	.	ENSG00000121904	ENST00000373381;ENST00000373380	T;T	0.20200	2.09;2.09	5.6	5.6	0.85130	CUB (5);	0.067939	0.64402	D	0.000010	T	0.41119	0.1145	M	0.85041	2.73	0.80722	D	1	B;P;P	0.49358	0.133;0.923;0.866	B;P;P	0.50570	0.287;0.644;0.644	T	0.43245	-0.9403	10	0.48119	T	0.1	.	14.9681	0.71210	1.0:0.0:0.0:0.0	.	27;1114;1154	Q7Z408-2;Q7Z408;E7EUA6	.;CSMD2_HUMAN;.	L	1154;27	ENSP00000362479:F1154L;ENSP00000362478:F27L	ENSP00000241312:F1114L	F	-	1	0	CSMD2	33947392	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.576000	0.82467	2.143000	0.66587	0.459000	0.35465	TTT	.	.		0.483	CSMD2-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000030635.4	NM_052896	
C1orf94	84970	hgsc.bcm.edu	37	1	34663030	34663030	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr1:34663030A>T	ENST00000488417.1	+	2	645	c.525A>T	c.(523-525)agA>agT	p.R175S	C1orf94_ENST00000373374.3_5'UTR	NM_001134734.1	NP_001128206.1	Q6P1W5	CA094_HUMAN	chromosome 1 open reading frame 94	175										central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(15)|skin(4)|upper_aerodigestive_tract(2)	32		Myeloproliferative disorder(586;0.0393)				AGCGCCCCAGAGCCTCCATCA	0.597																																					p.R175S		Atlas-SNP	.											.	C1orf94	156	.	0			c.A525T						.						35.0	37.0	36.0					1																	34663030		2203	4300	6503	SO:0001583	missense	84970	exon2			CCCCAGAGCCTCC	AK123355	CCDS381.1, CCDS44108.1	1p34.3	2012-06-26			ENSG00000142698	ENSG00000142698			28250	protein-coding gene	gene with protein product						12477932	Standard	NM_001134734		Approved	MGC15882	uc001bxt.3	Q6P1W5	OTTHUMG00000004012	ENST00000488417.1:c.525A>T	chr1.hg19:g.34663030A>T	ENSP00000435634:p.Arg175Ser	88.0	0.0		104.0	46.0	NM_001134734	B3KVT1|D3DPR3|E9PJ76|Q96IC8	Missense_Mutation	SNP	ENST00000488417.1	hg19	CCDS44108.1	.	.	.	.	.	.	.	.	.	.	A	0.435	-0.901394	0.02453	.	.	ENSG00000142698	ENST00000488417	T	0.22134	1.97	4.5	0.84	0.18912	.	.	.	.	.	T	0.10508	0.0257	N	0.22421	0.69	0.09310	N	1	B	0.20780	0.048	B	0.19391	0.025	T	0.39057	-0.9632	9	0.12103	T	0.63	-29.7401	3.4935	0.07646	0.5887:0.2007:0.2107:0.0	.	175	Q6P1W5	CA094_HUMAN	S	175	ENSP00000435634:R175S	ENSP00000435634:R175S	R	+	3	2	C1orf94	34435617	0.000000	0.05858	0.017000	0.16124	0.172000	0.22775	0.468000	0.22051	0.309000	0.22966	0.533000	0.62120	AGA	.	.		0.597	C1orf94-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000036845.2	NM_032884	
GRIK3	2899	hgsc.bcm.edu	37	1	37315910	37315910	+	Splice_Site	SNP	A	A	G			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr1:37315910A>G	ENST00000373091.3	-	9	1343		c.e9+1		GRIK3_ENST00000462621.1_Splice_Site|GRIK3_ENST00000373093.4_Splice_Site	NM_000831.3	NP_000822.2	Q13003	GRIK3_HUMAN	glutamate receptor, ionotropic, kainate 3						adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|G-protein coupled glutamate receptor signaling pathway (GO:0007216)|glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	axon (GO:0030424)|cell junction (GO:0030054)|dendrite (GO:0030425)|dendrite cytoplasm (GO:0032839)|integral component of plasma membrane (GO:0005887)|kainate selective glutamate receptor complex (GO:0032983)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	adenylate cyclase inhibiting G-protein coupled glutamate receptor activity (GO:0001640)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glutamate receptor activity (GO:0008066)|ionotropic glutamate receptor activity (GO:0004970)|kainate selective glutamate receptor activity (GO:0015277)			breast(4)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(27)|lung(35)|ovary(5)|prostate(3)|skin(5)|stomach(1)|urinary_tract(1)	89		Myeloproliferative disorder(586;0.0258)|all_neural(195;0.169)				GCAGGCTCTTACCAGCACTGT	0.612																																					.		Atlas-SNP	.											.	GRIK3	195	.	0			c.1326+2T>C						.						118.0	99.0	106.0					1																	37315910		2203	4300	6503	SO:0001630	splice_region_variant	2899	exon10			GCTCTTACCAGCA	U16127	CCDS416.1	1p34.3	2012-08-29			ENSG00000163873	ENSG00000163873		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4581	protein-coding gene	gene with protein product		138243				8128318	Standard	NM_000831		Approved	GluK3, GLUR7	uc001caz.2	Q13003	OTTHUMG00000004189	ENST00000373091.3:c.1326+1T>C	chr1.hg19:g.37315910A>G		53.0	0.0		45.0	16.0	NM_000831	A9Z1Z8|B1AMS6|Q13004|Q16136	Splice_Site	SNP	ENST00000373091.3	hg19	CCDS416.1	.	.	.	.	.	.	.	.	.	.	A	24.7	4.558367	0.86231	.	.	ENSG00000163873	ENST00000373091;ENST00000373093	.	.	.	5.58	5.58	0.84498	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.7583	0.78054	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	GRIK3	37088497	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	8.962000	0.93254	2.116000	0.64780	0.454000	0.30748	.	.	.		0.612	GRIK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012053.1	NM_000831	Intron
ZFYVE9	9372	hgsc.bcm.edu	37	1	52761649	52761649	+	Splice_Site	SNP	A	A	G			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr1:52761649A>G	ENST00000371591.1	+	11	3464	c.3333A>G	c.(3331-3333)gcA>gcG	p.A1111A	ZFYVE9_ENST00000357206.2_Splice_Site_p.A1052A|ZFYVE9_ENST00000469134.1_3'UTR|ZFYVE9_ENST00000287727.3_Splice_Site_p.A1111A	NM_004799.2|NM_007324.2	NP_004790.2|NP_015563.2	O95405	ZFYV9_HUMAN	zinc finger, FYVE domain containing 9	1111					endocytosis (GO:0006897)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|proteolysis (GO:0006508)|SMAD protein complex assembly (GO:0007183)|SMAD protein import into nucleus (GO:0007184)|transforming growth factor beta receptor signaling pathway (GO:0007179)	early endosome (GO:0005769)|early endosome membrane (GO:0031901)	1-phosphatidylinositol binding (GO:0005545)|metal ion binding (GO:0046872)|serine-type peptidase activity (GO:0008236)			breast(1)|central_nervous_system(4)|endometrium(3)|kidney(1)|large_intestine(12)|lung(17)|ovary(2)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(6)	53						ATCTTCTTGCAGTAAGTTGGG	0.398																																					p.A1111A		Atlas-SNP	.											.	ZFYVE9	131	.	0			c.A3333G						.						196.0	179.0	185.0					1																	52761649		2203	4300	6503	SO:0001630	splice_region_variant	9372	exon12			TCTTGCAGTAAGT	AF104304	CCDS563.1, CCDS564.1	1p32.3	2014-06-13	2004-05-21	2004-05-26	ENSG00000157077	ENSG00000157077		"""Zinc fingers, FYVE domain containing"""	6775	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 173"""	603755	"""MAD, mothers against decapentaplegic homolog (Drosophila) interacting protein, receptor activation anchor"""	MADHIP		9865696	Standard	NM_007324		Approved	SMADIP, SARA, PPP1R173	uc001cto.4	O95405	OTTHUMG00000008061	ENST00000371591.1:c.3333+1A>G	chr1.hg19:g.52761649A>G		115.0	0.0		102.0	43.0	NM_004799	Q5T0F6|Q5T0F7|Q9UNE1|Q9Y5R7	Silent	SNP	ENST00000371591.1	hg19	CCDS563.1																																																																																			.	.		0.398	ZFYVE9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022083.1	NM_007324	Silent
ROR1	4919	hgsc.bcm.edu	37	1	64515633	64515633	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr1:64515633T>C	ENST00000371079.1	+	3	809	c.434T>C	c.(433-435)gTc>gCc	p.V145A	ROR1_ENST00000482426.1_3'UTR|ROR1_ENST00000371080.1_Missense_Mutation_p.V145A	NM_005012.3	NP_005003.2	Q01973	ROR1_HUMAN	receptor tyrosine kinase-like orphan receptor 1	145	Ig-like C2-type.				peptidyl-tyrosine phosphorylation (GO:0018108)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|Wnt-protein binding (GO:0017147)			breast(7)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(14)|lung(10)|ovary(6)|prostate(1)|skin(5)|stomach(2)|upper_aerodigestive_tract(1)	51						TCCACTGGAGTCTTGTTTGTC	0.537																																					p.V145A		Atlas-SNP	.											.	ROR1	113	.	0			c.T434C						.						98.0	102.0	100.0					1																	64515633		2203	4300	6503	SO:0001583	missense	4919	exon3			CTGGAGTCTTGTT	M97675	CCDS626.1, CCDS41344.1	1p32-p31	2013-01-11			ENSG00000185483	ENSG00000185483		"""Immunoglobulin superfamily / I-set domain containing"""	10256	protein-coding gene	gene with protein product		602336		NTRKR1		1334494, 8875995	Standard	NM_001083592		Approved		uc001dbj.3	Q01973	OTTHUMG00000009022	ENST00000371079.1:c.434T>C	chr1.hg19:g.64515633T>C	ENSP00000360120:p.Val145Ala	97.0	0.0		75.0	26.0	NM_001083592	Q5VVX6|Q66K77|Q92776	Missense_Mutation	SNP	ENST00000371079.1	hg19	CCDS626.1	.	.	.	.	.	.	.	.	.	.	T	21.4	4.149273	0.78001	.	.	ENSG00000185483	ENST00000371080;ENST00000371079;ENST00000544776	T;T	0.39229	1.09;1.09	5.79	5.79	0.91817	Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.38778	N	0.001568	T	0.36220	0.0959	L	0.48218	1.51	0.80722	D	1	B;P	0.43024	0.3;0.798	B;P	0.48795	0.411;0.59	T	0.09530	-1.0670	10	0.36615	T	0.2	.	16.1341	0.81471	0.0:0.0:0.0:1.0	.	145;145	Q01973;Q66K77	ROR1_HUMAN;.	A	145;145;148	ENSP00000360121:V145A;ENSP00000360120:V145A	ENSP00000360120:V145A	V	+	2	0	ROR1	64288221	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.671000	0.83941	2.200000	0.70718	0.455000	0.32223	GTC	.	.		0.537	ROR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025002.1	NM_005012	
LRRIQ3	127255	hgsc.bcm.edu	37	1	74621535	74621535	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr1:74621535C>T	ENST00000395089.1	-	3	588	c.589G>A	c.(589-591)Gag>Aag	p.E197K	LRRIQ3_ENST00000468759.1_5'Flank|LRRIQ3_ENST00000370909.2_Missense_Mutation_p.E89K|LRRIQ3_ENST00000354431.4_Missense_Mutation_p.E197K			A6PVS8	LRIQ3_HUMAN	leucine-rich repeats and IQ motif containing 3	197										NS(2)|breast(1)|central_nervous_system(2)|endometrium(7)|kidney(5)|large_intestine(13)|liver(1)|lung(27)|ovary(3)|prostate(1)|skin(5)|soft_tissue(1)|upper_aerodigestive_tract(5)	73						TTAATTTCCTCTTCATAGGTT	0.239																																					p.E197K		Atlas-SNP	.											.	LRRIQ3	146	.	0			c.G589A						.						28.0	26.0	27.0					1																	74621535		1763	4015	5778	SO:0001583	missense	127255	exon4			TTTCCTCTTCATA	BX647210	CCDS41350.1	1p31.1	2008-06-12	2008-06-12	2008-06-12	ENSG00000162620	ENSG00000162620			28318	protein-coding gene	gene with protein product			"""leucine rich repeat containing 44"""	LRRC44		12477932	Standard	NM_001105659		Approved	MGC22773	uc001dfy.4	A6PVS8	OTTHUMG00000009508	ENST00000395089.1:c.589G>A	chr1.hg19:g.74621535C>T	ENSP00000378524:p.Glu197Lys	327.0	0.0		347.0	136.0	NM_001105659	A6PVS9|Q6P5P7|Q6ZMV4|Q8WUE0	Missense_Mutation	SNP	ENST00000395089.1	hg19	CCDS41350.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	17.07|17.07	3.295220|3.295220	0.60086|0.60086	.|.	.|.	ENSG00000162620|ENSG00000162620	ENST00000395089;ENST00000354431;ENST00000370909;ENST00000388972|ENST00000444984	T;T;T|.	0.33865|.	3.08;3.08;1.39|.	4.75|4.75	1.76|1.76	0.24704|0.24704	.|.	0.604283|.	0.15165|.	N|.	0.276963|.	T|T	0.14098|0.14098	0.0341|0.0341	L|L	0.27053|0.27053	0.805|0.805	0.21984|0.21984	N|N	0.999432|0.999432	B|.	0.29716|.	0.255|.	B|.	0.21360|.	0.034|.	T|T	0.26467|0.26467	-1.0102|-1.0102	10|5	0.62326|.	D|.	0.03|.	.|.	8.7276|8.7276	0.34478|0.34478	0.0:0.7282:0.0:0.2718|0.0:0.7282:0.0:0.2718	.|.	197|.	A6PVS8|.	LRIQ3_HUMAN|.	K|K	197;197;89;197|31	ENSP00000378524:E197K;ENSP00000346414:E197K;ENSP00000359946:E89K|.	ENSP00000346414:E197K|.	E|R	-|-	1|2	0|0	LRRIQ3|LRRIQ3	74394123|74394123	0.697000|0.697000	0.27767|0.27767	0.827000|0.827000	0.32855|0.32855	0.731000|0.731000	0.41821|0.41821	0.580000|0.580000	0.23803|0.23803	0.545000|0.545000	0.28902|0.28902	0.655000|0.655000	0.94253|0.94253	GAG|AGA	.	.		0.239	LRRIQ3-008	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316539.1	NM_145258	
FPGT-TNNI3K	100526835	hgsc.bcm.edu	37	1	74833633	74833633	+	Nonsense_Mutation	SNP	A	A	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr1:74833633A>T	ENST00000370899.3	+	15	1646	c.1609A>T	c.(1609-1611)Aaa>Taa	p.K537*	FPGT-TNNI3K_ENST00000557284.2_Nonsense_Mutation_p.K550*|FPGT-TNNI3K_ENST00000370895.1_Nonsense_Mutation_p.K537*|TNNI3K_ENST00000370891.2_Nonsense_Mutation_p.K537*|RP11-439H8.4_ENST00000415549.2_RNA|TNNI3K_ENST00000326637.3_Nonsense_Mutation_p.K436*	NM_001199327.1	NP_001186256			FPGT-TNNI3K readthrough																		GGGGAAGATTAAAAGCATGAC	0.289																																					p.K537X		Atlas-SNP	.											.	.	.	.	0			c.A1609T						.						66.0	67.0	67.0					1																	74833633		2203	4298	6501	SO:0001587	stop_gained	100526835	exon15			AAGATTAAAAGCA			1p31.3	2014-03-14			ENSG00000259030	ENSG00000259030			42952	other	readthrough							Standard	NM_001112808		Approved		uc001dge.2		OTTHUMG00000166281	ENST00000370899.3:c.1609A>T	chr1.hg19:g.74833633A>T	ENSP00000359936:p.Lys537*	379.0	0.0		332.0	114.0	NM_001112808		Nonsense_Mutation	SNP	ENST00000370899.3	hg19		.	.	.	.	.	.	.	.	.	.	A	37	6.086027	0.97271	.	.	ENSG00000259030;ENSG00000259030;ENSG00000259030;ENSG00000259030;ENSG00000116783;ENSG00000116783	ENST00000370899;ENST00000370895;ENST00000534632;ENST00000557284;ENST00000370891;ENST00000326637	.	.	.	5.9	4.77	0.60923	.	0.046829	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	11.6637	0.51363	0.9311:0.0:0.0689:0.0	.	.	.	.	X	537;537;158;537;537;436	.	ENSP00000322251:K436X	K	+	1	0	RP11-653A5.2;AC093158.1	74606221	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.788000	0.75105	1.069000	0.40788	0.528000	0.53228	AAA	.	.		0.289	FPGT-TNNI3K-003	NOVEL	basic|appris_candidate|readthrough_transcript|exp_conf	protein_coding	protein_coding	OTTHUMT00000026438.3		
GBP6	163351	hgsc.bcm.edu	37	1	89848365	89848365	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr1:89848365A>G	ENST00000370456.4	+	8	1388	c.1295A>G	c.(1294-1296)cAc>cGc	p.H432R	GBP6_ENST00000535065.1_Missense_Mutation_p.H302R	NM_198460.2	NP_940862.2	Q6ZN66	GBP6_HUMAN	guanylate binding protein family, member 6	432					cellular response to interferon-gamma (GO:0071346)|defense response to bacterium (GO:0042742)|immune response (GO:0006955)	extracellular vesicular exosome (GO:0070062)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(11)|large_intestine(8)|lung(10)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	42		Lung NSC(277;0.0908)		all cancers(265;0.0108)|Epithelial(280;0.0398)		CCTGGAGGGCACAAGCTCTAC	0.448																																					p.H432R		Atlas-SNP	.											.	GBP6	87	.	0			c.A1295G						.						81.0	83.0	82.0					1																	89848365		2203	4300	6503	SO:0001583	missense	163351	exon8			GAGGGCACAAGCT	BX537949	CCDS723.1	1p22	2008-02-05			ENSG00000183347	ENSG00000183347			25395	protein-coding gene	gene with protein product		612467					Standard	NM_198460		Approved	DKFZp686G0786	uc001dnf.2	Q6ZN66	OTTHUMG00000010123	ENST00000370456.4:c.1295A>G	chr1.hg19:g.89848365A>G	ENSP00000359485:p.His432Arg	200.0	0.0		169.0	54.0	NM_198460	A2RRM3|Q6ZN86|Q7Z3F0	Missense_Mutation	SNP	ENST00000370456.4	hg19	CCDS723.1	.	.	.	.	.	.	.	.	.	.	A	16.42	3.118344	0.56505	.	.	ENSG00000183347	ENST00000544311;ENST00000370456;ENST00000535065	T;T	0.02258	4.37;4.37	5.12	3.98	0.46160	Guanylate-binding protein, C-terminal (3);	0.412335	0.24436	N	0.038550	T	0.04952	0.0133	M	0.86953	2.85	0.09310	N	1	D	0.53151	0.958	P	0.58780	0.845	T	0.16837	-1.0389	10	0.87932	D	0	-5.2703	9.5907	0.39543	0.8433:0.0:0.0:0.1567	.	432	Q6ZN66	GBP6_HUMAN	R	403;432;302	ENSP00000359485:H432R;ENSP00000442530:H302R	ENSP00000359485:H432R	H	+	2	0	GBP6	89620953	0.027000	0.19231	0.003000	0.11579	0.751000	0.42716	3.308000	0.51896	0.766000	0.33244	0.482000	0.46254	CAC	.	.		0.448	GBP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000028001.1	NM_198460	
BRDT	676	hgsc.bcm.edu	37	1	92428482	92428482	+	Silent	SNP	T	T	C			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr1:92428482T>C	ENST00000362005.3	+	3	589	c.171T>C	c.(169-171)gaT>gaC	p.D57D	BRDT_ENST00000370389.2_Intron|BRDT_ENST00000399546.2_Silent_p.D57D|BRDT_ENST00000402388.1_Silent_p.D57D|BRDT_ENST00000394530.3_Silent_p.D57D	NM_001242805.1	NP_001229734	Q58F21	BRDT_HUMAN	bromodomain, testis-specific	57	Bromo 1. {ECO:0000255|PROSITE- ProRule:PRU00035}.				cell differentiation (GO:0030154)|chromatin remodeling (GO:0006338)|histone displacement (GO:0001207)|male meiosis (GO:0007140)|male meiosis I (GO:0007141)|mRNA processing (GO:0006397)|positive regulation of transcription during meiosis (GO:0051039)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	histone binding (GO:0042393)|lysine-acetylated histone binding (GO:0070577)|transcription coactivator activity (GO:0003713)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|lung(24)|ovary(1)|prostate(4)|skin(2)|stomach(2)|urinary_tract(2)	56		all_lung(203;0.00531)|Lung NSC(277;0.0194)		all cancers(265;0.0228)|Epithelial(280;0.133)		GTCCTGTGGATGCTGTGAAAC	0.343																																					p.D57D		Atlas-SNP	.											.	BRDT	133	.	0			c.T171C						.						113.0	111.0	112.0					1																	92428482		2203	4300	6503	SO:0001819	synonymous_variant	676	exon2			TGTGGATGCTGTG	AF019085	CCDS735.1, CCDS55615.1, CCDS55616.1, CCDS72820.1	1p22.1	2010-12-23			ENSG00000137948	ENSG00000137948			1105	protein-coding gene	gene with protein product	"""cancer/testis antigen 9"""	602144				9367677	Standard	NM_001726		Approved	BRD6, CT9	uc010osz.2	Q58F21	OTTHUMG00000010113	ENST00000362005.3:c.171T>C	chr1.hg19:g.92428482T>C		124.0	0.0		128.0	46.0	NM_001242806	A6NF68|B7Z811|B7Z890|B7ZAX7|D3DT32|O14789|Q05DQ4|Q6P5T1|Q7Z4A6|Q8IWI6	Silent	SNP	ENST00000362005.3	hg19	CCDS735.1																																																																																			.	.		0.343	BRDT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027980.2	NM_207189	
ABCA4	24	hgsc.bcm.edu	37	1	94568641	94568641	+	Missense_Mutation	SNP	A	A	C			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr1:94568641A>C	ENST00000370225.3	-	5	586	c.500T>G	c.(499-501)cTc>cGc	p.L167R	ABCA4_ENST00000535735.1_Missense_Mutation_p.L167R	NM_000350.2	NP_000341.2	P78363	ABCA4_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 4	167					phospholipid transfer to membrane (GO:0006649)|photoreceptor cell maintenance (GO:0045494)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|transmembrane transport (GO:0055085)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|photoreceptor disc membrane (GO:0097381)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|phospholipid-translocating ATPase activity (GO:0004012)|transporter activity (GO:0005215)			NS(2)|breast(6)|central_nervous_system(5)|endometrium(9)|haematopoietic_and_lymphoid_tissue(5)|kidney(10)|large_intestine(25)|lung(57)|ovary(4)|pancreas(1)|prostate(4)|skin(10)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(2)	147		all_lung(203;0.000757)|Lung NSC(277;0.00335)		all cancers(265;0.00432)|GBM - Glioblastoma multiforme(16;0.00715)|Epithelial(280;0.171)		GTTTTTAATGAGAAATAGTGT	0.443																																					p.L167R		Atlas-SNP	.											.	ABCA4	275	.	0			c.T500G						.						274.0	259.0	264.0					1																	94568641		2203	4300	6503	SO:0001583	missense	24	exon5			TTAATGAGAAATA	U88667	CCDS747.1	1p22	2013-01-23			ENSG00000198691	ENSG00000198691		"""ATP binding cassette transporters / subfamily A"""	34	protein-coding gene	gene with protein product	"""Stargardt disease"""	601691	"""ATP-binding cassette transporter, retinal-specific"""	STGD1, ABCR, RP19, STGD		9490294	Standard	NM_000350		Approved	FFM, ARMD2, CORD3	uc001dqh.3	P78363	OTTHUMG00000010622	ENST00000370225.3:c.500T>G	chr1.hg19:g.94568641A>C	ENSP00000359245:p.Leu167Arg	113.0	0.0		97.0	33.0	NM_000350	O15112|O60438|O60915|Q0QD48|Q4LE31	Missense_Mutation	SNP	ENST00000370225.3	hg19	CCDS747.1	.	.	.	.	.	.	.	.	.	.	A	20.3	3.973951	0.74246	.	.	ENSG00000198691	ENST00000370225;ENST00000535735	D;D	0.95853	-3.47;-3.83	5.42	5.42	0.78866	.	0.000000	0.64402	D	0.000002	D	0.97757	0.9264	M	0.88704	2.975	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.991	D	0.98866	1.0764	10	0.87932	D	0	.	15.1696	0.72862	1.0:0.0:0.0:0.0	.	167;167	F5H6E5;P78363	.;ABCA4_HUMAN	R	167	ENSP00000359245:L167R;ENSP00000437682:L167R	ENSP00000359245:L167R	L	-	2	0	ABCA4	94341229	1.000000	0.71417	0.900000	0.35374	0.486000	0.33341	8.308000	0.89966	2.058000	0.61347	0.533000	0.62120	CTC	.	.		0.443	ABCA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029320.1	NM_000350	
COL11A1	1301	hgsc.bcm.edu	37	1	103453234	103453234	+	Silent	SNP	T	T	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr1:103453234T>A	ENST00000370096.3	-	30	2769	c.2457A>T	c.(2455-2457)gcA>gcT	p.A819A	COL11A1_ENST00000353414.4_Silent_p.A780A|COL11A1_ENST00000512756.1_Silent_p.A703A|COL11A1_ENST00000358392.2_Silent_p.A831A	NM_001854.3	NP_001845.3	P12107	COBA1_HUMAN	collagen, type XI, alpha 1	819	Triple-helical region.				cartilage condensation (GO:0001502)|chondrocyte development (GO:0002063)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|embryonic skeletal system morphogenesis (GO:0048704)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|inner ear morphogenesis (GO:0042472)|proteoglycan metabolic process (GO:0006029)|sensory perception of sound (GO:0007605)|tendon development (GO:0035989)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|visual perception (GO:0007601)	collagen type XI trimer (GO:0005592)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix binding (GO:0050840)|extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)|protein binding, bridging (GO:0030674)			NS(3)|biliary_tract(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(17)|kidney(8)|large_intestine(28)|lung(157)|ovary(6)|pancreas(2)|prostate(6)|skin(9)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(1)	258		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)		CAGTTGGGCCTGCTCGACCTT	0.473																																					p.A831A		Atlas-SNP	.											.	COL11A1	972	.	0			c.A2493T						.						93.0	87.0	89.0					1																	103453234		2203	4300	6503	SO:0001819	synonymous_variant	1301	exon30			TGGGCCTGCTCGA	J04177	CCDS778.1, CCDS780.1, CCDS780.2, CCDS53348.1	1p21	2013-01-16			ENSG00000060718	ENSG00000060718		"""Collagens"""	2186	protein-coding gene	gene with protein product	"""collagen XI, alpha-1 polypeptide"""	120280		COLL6		3182841	Standard	NM_080630		Approved	STL2, CO11A1	uc001dul.3	P12107	OTTHUMG00000010872	ENST00000370096.3:c.2457A>T	chr1.hg19:g.103453234T>A		113.0	0.0		91.0	35.0	NM_080629	B1ASK7|D3DT73|E9PCU0|Q14034|Q149N0|Q9UIT4|Q9UIT5|Q9UIT6	Silent	SNP	ENST00000370096.3	hg19	CCDS778.1	.	.	.	.	.	.	.	.	.	.	T	9.460	1.092840	0.20471	.	.	ENSG00000060718	ENST00000370090	.	.	.	4.39	-1.07	0.09968	.	.	.	.	.	T	0.22975	0.0555	.	.	.	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.10382	-1.0632	7	0.46703	T	0.11	.	5.7385	0.18079	0.4963:0.074:0.0:0.4297	.	34	F5H5Z5	.	L	34	.	ENSP00000359108:Q34L	Q	-	2	0	COL11A1	103225822	0.907000	0.30839	0.996000	0.52242	0.754000	0.42855	-0.121000	0.10643	-0.290000	0.09025	0.377000	0.23210	CAG	.	.		0.473	COL11A1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000029997.1	NM_080630	
WDR47	22911	hgsc.bcm.edu	37	1	109525342	109525342	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr1:109525342C>T	ENST00000369962.3	-	12	2377	c.2155G>A	c.(2155-2157)Ggc>Agc	p.G719S	WDR47_ENST00000369965.4_Missense_Mutation_p.G720S|WDR47_ENST00000357672.3_Missense_Mutation_p.G691S|WDR47_ENST00000400794.3_Missense_Mutation_p.G727S|WDR47_ENST00000361054.3_Missense_Mutation_p.G691S			O94967	WDR47_HUMAN	WD repeat domain 47	719					multicellular organismal development (GO:0007275)	cytoplasm (GO:0005737)|microtubule (GO:0005874)				breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(7)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	20		all_lung(203;0.00519)|all_epithelial(167;0.00611)|Lung NSC(277;0.00822)		Colorectal(144;0.0165)|Lung(183;0.0484)|COAD - Colon adenocarcinoma(174;0.128)|Epithelial(280;0.168)|all cancers(265;0.201)|LUSC - Lung squamous cell carcinoma(189;0.244)		CTTTCTGGGCCTTCCATAAAT	0.403																																					p.G727S		Atlas-SNP	.											.	WDR47	56	.	0			c.G2179A						.						86.0	88.0	88.0					1																	109525342		2203	4300	6503	SO:0001583	missense	22911	exon12			CTGGGCCTTCCAT	AB020700	CCDS30787.1, CCDS44186.1, CCDS44187.1	1p13.3	2013-01-09			ENSG00000085433	ENSG00000085433		"""WD repeat domain containing"""	29141	protein-coding gene	gene with protein product		615734				10048485	Standard	NM_014969		Approved	KIAA0893	uc001dwl.3	O94967	OTTHUMG00000011734	ENST00000369962.3:c.2155G>A	chr1.hg19:g.109525342C>T	ENSP00000358979:p.Gly719Ser	133.0	0.0		138.0	61.0	NM_001142550	A8MX09|Q5TYV7|Q5TYV8|Q5TYV9|Q8IXT7|Q8IYU9	Missense_Mutation	SNP	ENST00000369962.3	hg19	CCDS44187.1	.	.	.	.	.	.	.	.	.	.	C	21.7	4.190473	0.78789	.	.	ENSG00000085433	ENST00000400794;ENST00000369962;ENST00000361054;ENST00000369965;ENST00000357672	T;T;T;T;T	0.56275	0.47;0.52;0.49;0.47;0.49	5.25	5.25	0.73442	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.051254	0.85682	D	0.000000	T	0.18551	0.0445	N	0.08118	0	0.80722	D	1	B;B;P;B	0.43633	0.332;0.156;0.813;0.086	B;B;B;B	0.35413	0.076;0.015;0.202;0.044	T	0.05954	-1.0854	10	0.30078	T	0.28	-9.8677	17.0163	0.86420	0.0:1.0:0.0:0.0	.	691;727;719;720	O94967-2;A8MX09;O94967;O94967-3	.;.;WDR47_HUMAN;.	S	727;719;691;720;691	ENSP00000383599:G727S;ENSP00000358979:G719S;ENSP00000354339:G691S;ENSP00000358982:G720S;ENSP00000350301:G691S	ENSP00000350301:G691S	G	-	1	0	WDR47	109326865	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.487000	0.81328	2.452000	0.82932	0.561000	0.74099	GGC	.	.		0.403	WDR47-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000032414.2	NM_014969	
CELSR2	1952	hgsc.bcm.edu	37	1	109801366	109801366	+	Missense_Mutation	SNP	G	G	C			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr1:109801366G>C	ENST00000271332.3	+	2	3684	c.3623G>C	c.(3622-3624)cGc>cCc	p.R1208P		NM_001408.2	NP_001399.1	Q9HCU4	CELR2_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 2	1208					cerebrospinal fluid secretion (GO:0033326)|cilium assembly (GO:0042384)|cilium movement (GO:0003341)|dendrite morphogenesis (GO:0048813)|G-protein coupled receptor signaling pathway (GO:0007186)|homophilic cell adhesion (GO:0007156)|neural plate anterior/posterior regionalization (GO:0021999)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|regulation of cell-cell adhesion (GO:0022407)|regulation of protein localization (GO:0032880)|regulation of transcription, DNA-templated (GO:0006355)|ventricular system development (GO:0021591)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|lung(27)|ovary(5)|prostate(1)|skin(3)|urinary_tract(2)	82		all_epithelial(167;0.000114)|all_lung(203;0.000321)|Lung NSC(277;0.000626)|Breast(1374;0.244)		Colorectal(144;0.0296)|Lung(183;0.067)|COAD - Colon adenocarcinoma(174;0.114)|Epithelial(280;0.193)|all cancers(265;0.219)		CTGCAGGAGCGCCTATACCTC	0.701																																					p.R1208P	NSCLC(158;1285 2011 34800 34852 42084)	Atlas-SNP	.											.	CELSR2	228	.	0			c.G3623C						.						17.0	16.0	16.0					1																	109801366		2195	4296	6491	SO:0001583	missense	1952	exon2			AGGAGCGCCTATA	D87469	CCDS796.1	1p13.3	2014-08-08	2013-02-18		ENSG00000143126	ENSG00000143126		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	3231	protein-coding gene	gene with protein product		604265	"""cadherin, EGF LAG seven-pass G-type receptor 2, flamingo (Drosophila) homolog"""	EGFL2		9693030, 10907856	Standard	NM_001408		Approved	KIAA0279, MEGF3, Flamingo1, CDHF10	uc001dxa.4	Q9HCU4	OTTHUMG00000012003	ENST00000271332.3:c.3623G>C	chr1.hg19:g.109801366G>C	ENSP00000271332:p.Arg1208Pro	74.0	0.0		57.0	25.0	NM_001408	Q5T2Y7|Q92566	Missense_Mutation	SNP	ENST00000271332.3	hg19	CCDS796.1	.	.	.	.	.	.	.	.	.	.	G	21.0	4.084118	0.76642	.	.	ENSG00000143126	ENST00000271332	T	0.69435	-0.4	4.43	4.43	0.53597	.	.	.	.	.	T	0.43478	0.1249	L	0.36672	1.1	0.51767	D	0.999934	P	0.45986	0.87	B	0.42625	0.393	T	0.47971	-0.9075	9	0.44086	T	0.13	.	8.6214	0.33864	0.1737:0.0:0.8263:0.0	.	1208	Q9HCU4	CELR2_HUMAN	P	1208	ENSP00000271332:R1208P	ENSP00000271332:R1208P	R	+	2	0	CELSR2	109602889	0.962000	0.33011	1.000000	0.80357	0.971000	0.66376	0.845000	0.27668	2.450000	0.82876	0.462000	0.41574	CGC	.	.		0.701	CELSR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033200.1	NM_001408	
UBL4B	164153	hgsc.bcm.edu	37	1	110655547	110655547	+	Nonsense_Mutation	SNP	G	G	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr1:110655547G>T	ENST00000334179.3	+	1	486	c.391G>T	c.(391-393)Gag>Tag	p.E131*		NM_203412.1	NP_981957.1	Q8N7F7	UBL4B_HUMAN	ubiquitin-like 4B	131						cytoplasm (GO:0005737)				endometrium(1)|kidney(1)|large_intestine(1)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	7		all_cancers(81;1.14e-05)|all_epithelial(167;3.23e-06)|all_lung(203;0.000116)|Lung NSC(277;0.000233)		Lung(183;0.0236)|all cancers(265;0.0823)|Epithelial(280;0.0917)|Colorectal(144;0.109)|LUSC - Lung squamous cell carcinoma(189;0.134)		GGAGCACCTGGAGCAGCTGGC	0.612																																					p.E131X		Atlas-SNP	.											UBL4B,right_upper_lobe,carcinoma,0,1	UBL4B	22	.	0			c.G391T						.						19.0	22.0	21.0					1																	110655547		2203	4299	6502	SO:0001587	stop_gained	164153	exon1			CACCTGGAGCAGC		CCDS820.1	1p13.3	2013-09-24			ENSG00000186150	ENSG00000186150			32309	protein-coding gene	gene with protein product		611127				16872915	Standard	NM_203412		Approved	FLJ25690	uc001dzc.3	Q8N7F7	OTTHUMG00000166989	ENST00000334179.3:c.391G>T	chr1.hg19:g.110655547G>T	ENSP00000334044:p.Glu131*	117.0	1.0		98.0	37.0	NM_203412		Nonsense_Mutation	SNP	ENST00000334179.3	hg19	CCDS820.1	.	.	.	.	.	.	.	.	.	.	G	33	5.250994	0.95305	.	.	ENSG00000186150	ENST00000334179	.	.	.	4.19	3.25	0.37280	.	0.000000	0.85682	U	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-8.1074	10.982	0.47499	0.0:0.1903:0.8097:0.0	.	.	.	.	X	131	.	ENSP00000334044:E131X	E	+	1	0	UBL4B	110457070	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	4.358000	0.59442	0.919000	0.36945	0.491000	0.48974	GAG	.	.		0.612	UBL4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392303.1	NM_203412	
KCNA2	3737	hgsc.bcm.edu	37	1	111146974	111146974	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr1:111146974T>A	ENST00000485317.1	-	3	1104	c.431A>T	c.(430-432)gAg>gTg	p.E144V	KCNA2_ENST00000316361.4_Missense_Mutation_p.E144V|KCNA2_ENST00000525120.1_Intron|KCNA2_ENST00000440270.1_Missense_Mutation_p.E144V|KCNA2_ENST00000369770.3_Missense_Mutation_p.E144V			P16389	KCNA2_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 2	144					optic nerve structural organization (GO:0021633)|potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	juxtaparanode region of axon (GO:0044224)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|outward rectifier potassium channel activity (GO:0015271)|potassium channel activity (GO:0005267)|voltage-gated potassium channel activity (GO:0005249)			endometrium(1)|kidney(1)|large_intestine(6)|liver(1)|lung(18)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	32		all_cancers(81;5.55e-06)|all_epithelial(167;1.87e-05)|all_lung(203;0.000199)|Lung NSC(277;0.000398)		Colorectal(144;0.00878)|Lung(183;0.0234)|all cancers(265;0.0492)|Epithelial(280;0.0529)|COAD - Colon adenocarcinoma(174;0.131)|LUSC - Lung squamous cell carcinoma(189;0.133)|READ - Rectum adenocarcinoma(129;0.191)	Dalfampridine(DB06637)	TCTCTGAAACTCATTTTCAGG	0.458																																					p.E144V	Pancreas(18;568 735 10587 23710 36357)	Atlas-SNP	.											.	KCNA2	61	.	0			c.A431T						.						56.0	57.0	57.0					1																	111146974		2203	4300	6503	SO:0001583	missense	3737	exon3			TGAAACTCATTTT	L02752	CCDS827.1, CCDS55625.1	1p13	2012-07-05			ENSG00000177301	ENSG00000177301		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6220	protein-coding gene	gene with protein product		176262				16382104	Standard	NM_004974		Approved	Kv1.2, HK4	uc009wfw.3	P16389	OTTHUMG00000011567	ENST00000485317.1:c.431A>T	chr1.hg19:g.111146974T>A	ENSP00000433109:p.Glu144Val	82.0	0.0		95.0	45.0	NM_001204269	Q86XG6	Missense_Mutation	SNP	ENST00000485317.1	hg19	CCDS827.1	.	.	.	.	.	.	.	.	.	.	T	13.80	2.343884	0.41498	.	.	ENSG00000177301	ENST00000369770;ENST00000485317;ENST00000440270;ENST00000316361	T;T;T;T	0.67345	-0.26;-0.26;-0.26;-0.26	5.81	5.81	0.92471	.	0.636549	0.16168	N	0.226417	T	0.75064	0.3799	M	0.82193	2.58	0.80722	D	1	B;P	0.36392	0.002;0.551	B;P	0.49597	0.006;0.616	T	0.78064	-0.2350	10	0.72032	D	0.01	.	16.158	0.81680	0.0:0.0:0.0:1.0	.	144;144	Q86XG6;P16389	.;KCNA2_HUMAN	V	144	ENSP00000358785:E144V;ENSP00000433109:E144V;ENSP00000415257:E144V;ENSP00000314520:E144V	ENSP00000314520:E144V	E	-	2	0	KCNA2	110948497	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.883000	0.87264	2.220000	0.72140	0.496000	0.49642	GAG	.	.		0.458	KCNA2-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128001.2	NM_004974	
KCNA3	3738	hgsc.bcm.edu	37	1	111216207	111216207	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr1:111216207C>A	ENST00000369769.2	-	1	1448	c.1225G>T	c.(1225-1227)Gtc>Ttc	p.V409F		NM_002232.3	NP_002223.3	P22001	KCNA3_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 3	409					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	membrane raft (GO:0045121)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|outward rectifier potassium channel activity (GO:0015271)|voltage-gated ion channel activity (GO:0005244)			endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(13)|lung(7)|ovary(4)|pancreas(1)|prostate(3)|skin(1)	38		all_cancers(81;3.92e-06)|all_epithelial(167;1.28e-05)|all_lung(203;0.000199)|Lung NSC(277;0.000398)		Lung(183;0.0235)|Colorectal(144;0.0306)|all cancers(265;0.0752)|Epithelial(280;0.0821)|COAD - Colon adenocarcinoma(174;0.132)|LUSC - Lung squamous cell carcinoma(189;0.133)	Dalfampridine(DB06637)	AAAAGGATGACCCCAATAAAG	0.582																																					p.V409F		Atlas-SNP	.											.	KCNA3	91	.	0			c.G1225T						.						56.0	54.0	55.0					1																	111216207		2203	4300	6503	SO:0001583	missense	3738	exon1			GGATGACCCCAAT	L23499	CCDS828.2	1p13.3	2012-07-05			ENSG00000177272	ENSG00000177272		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6221	protein-coding gene	gene with protein product		176263				2251283, 16382104	Standard	NM_002232		Approved	Kv1.3, MK3, HLK3, HPCN3	uc001dzv.1	P22001	OTTHUMG00000034493	ENST00000369769.2:c.1225G>T	chr1.hg19:g.111216207C>A	ENSP00000358784:p.Val409Phe	92.0	0.0		70.0	28.0	NM_002232	Q5VWN2	Missense_Mutation	SNP	ENST00000369769.2	hg19	CCDS828.2	.	.	.	.	.	.	.	.	.	.	C	22.2	4.264204	0.80358	.	.	ENSG00000177272	ENST00000369769	D	0.97232	-4.3	5.71	5.71	0.89125	Ion transport (1);	0.000000	0.64402	U	0.000001	D	0.98804	0.9597	M	0.90145	3.09	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.99552	1.0966	10	0.87932	D	0	.	19.8489	0.96731	0.0:1.0:0.0:0.0	.	409	P22001	KCNA3_HUMAN	F	409	ENSP00000358784:V409F	ENSP00000358784:V409F	V	-	1	0	KCNA3	111017730	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.814000	0.86154	2.689000	0.91719	0.655000	0.94253	GTC	.	.		0.582	KCNA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083391.1	NM_002232	
SIKE1	80143	hgsc.bcm.edu	37	1	115318966	115318966	+	Splice_Site	SNP	C	C	G			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr1:115318966C>G	ENST00000060969.5	-	4	592		c.e4+1		SIKE1_ENST00000369528.5_Splice_Site|SIKE1_ENST00000506320.1_5'Flank			Q9BRV8	SIKE1_HUMAN	suppressor of IKBKE 1						innate immune response (GO:0045087)	cytosol (GO:0005829)				endometrium(1)|kidney(2)|large_intestine(1)|lung(2)	6						TACAATCTTACCTCTAATTGG	0.373																																					.		Atlas-SNP	.											SIKE1,bladder,carcinoma,0,1	SIKE1	12	.	0			c.534+1G>C						.						150.0	146.0	147.0					1																	115318966		2203	4300	6503	SO:0001630	splice_region_variant	80143	exon5			ATCTTACCTCTAA	AK024821	CCDS878.1, CCDS41371.1	1p13.1	2009-08-13			ENSG00000052723	ENSG00000052723			26119	protein-coding gene	gene with protein product	"""suppressor of IKK epsilon"""	611656				16281057	Standard	NM_025073		Approved	FLJ21168, SIKE	uc001efp.4	Q9BRV8	OTTHUMG00000012061	ENST00000060969.5:c.522+1G>C	chr1.hg19:g.115318966C>G		106.0	1.0		118.0	9.0	NM_001102396	Q5TEZ7|Q5TEZ9|Q68DZ4|Q9H778	Splice_Site	SNP	ENST00000060969.5	hg19	CCDS878.1	.	.	.	.	.	.	.	.	.	.	C	25.3	4.628525	0.87560	.	.	ENSG00000052723	ENST00000369528;ENST00000060969	.	.	.	5.78	5.78	0.91487	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.6101	0.95602	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	SIKE1	115120489	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	7.217000	0.77982	2.717000	0.92951	0.585000	0.79938	.	.	.		0.373	SIKE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033401.1	NM_025073	Intron
CD101	9398	hgsc.bcm.edu	37	1	117556093	117556093	+	Missense_Mutation	SNP	G	G	T	rs201304832		TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr1:117556093G>T	ENST00000256652.4	+	4	965	c.907G>T	c.(907-909)Gtt>Ttt	p.V303F	CD101_ENST00000369470.1_Missense_Mutation_p.V303F	NM_001256106.1|NM_001256109.1|NM_001256111.1|NM_004258.4	NP_001243035.1|NP_001243038.1|NP_001243040.1|NP_004249.2	Q93033	IGSF2_HUMAN	CD101 molecule	303	Ig-like C2-type 3.				cell surface receptor signaling pathway (GO:0007166)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amides (GO:0016812)			NS(1)|breast(1)|endometrium(6)|kidney(3)|large_intestine(14)|lung(18)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	49						CTTAGAACTGGTTTGCCTGGT	0.468																																					p.V303F		Atlas-SNP	.											CD101,NS,lymphoid_neoplasm,0,1	CD101	95	.	0			c.G907T						.						128.0	132.0	130.0					1																	117556093		2203	4300	6503	SO:0001583	missense	9398	exon4			GAACTGGTTTGCC	Z33642	CCDS891.1	1p13	2013-01-29	2009-10-27	2009-10-27	ENSG00000134256	ENSG00000134256		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5949	protein-coding gene	gene with protein product		604516	"""immunoglobulin superfamily, member 2"""	IGSF2		7722300	Standard	NM_004258		Approved	V7	uc010oxb.2	Q93033	OTTHUMG00000012029	ENST00000256652.4:c.907G>T	chr1.hg19:g.117556093G>T	ENSP00000256652:p.Val303Phe	136.0	0.0		108.0	42.0	NM_001256109	Q15856	Missense_Mutation	SNP	ENST00000256652.4	hg19	CCDS891.1	.	.	.	.	.	.	.	.	.	.	G	14.63	2.594026	0.46214	.	.	ENSG00000134256	ENST00000256652;ENST00000369470	T;T	0.02656	4.21;4.21	5.85	-3.41	0.04839	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.940590	0.08843	N	0.885539	T	0.01124	0.0037	M	0.65975	2.015	0.09310	N	0.999997	P	0.50369	0.934	P	0.47206	0.541	T	0.36553	-0.9743	10	0.09843	T	0.71	-3.2284	1.2286	0.01938	0.3934:0.2706:0.1991:0.137	.	303	Q93033	IGSF2_HUMAN	F	303	ENSP00000256652:V303F;ENSP00000358482:V303F	ENSP00000256652:V303F	V	+	1	0	CD101	117357616	0.000000	0.05858	0.066000	0.19879	0.792000	0.44763	-0.184000	0.09698	-0.426000	0.07360	-1.045000	0.02358	GTT	.	G|0.999;A|0.001		0.468	CD101-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033274.1	NM_004258	
GPR89B	51463	hgsc.bcm.edu	37	1	147408746	147408746	+	Silent	SNP	A	A	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr1:147408746A>T	ENST00000314163.7	+	2	192	c.48A>T	c.(46-48)ctA>ctT	p.L16L		NM_016334.3	NP_057418.1	P0CG08	GPHRB_HUMAN	G protein-coupled receptor 89B	16					protein transport (GO:0015031)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	voltage-gated ion channel activity (GO:0005244)			large_intestine(1)	1	all_hematologic(923;0.0276)					TCCAGATACTATTTTTTGGAT	0.308																																					p.L16L		Atlas-SNP	.											.	GPR89B	6	.	0			c.A48T						.						131.0	123.0	126.0					1																	147408746		2203	4298	6501	SO:0001819	synonymous_variant	51463	exon2			GATACTATTTTTT	U78723	CCDS930.1	1q21.1	2014-06-19	2007-06-06	2007-06-06	ENSG00000188092	ENSG00000188092			13840	protein-coding gene	gene with protein product		612806	"""G protein-coupled receptor 89"", ""G protein-coupled receptor 89C"""	GPR89, GPR89C		11042152	Standard	NM_016334		Approved	SH120	uc001epv.4	P0CG08	OTTHUMG00000013452	ENST00000314163.7:c.48A>T	chr1.hg19:g.147408746A>T		249.0	0.0		383.0	87.0	NM_016334	A6NN37|B2RUV3|B3KMN3|Q53FQ9|Q5T2V8|Q5T5P5|Q659E2|Q6NVY5|Q9P0S4|Q9Y302	Silent	SNP	ENST00000314163.7	hg19	CCDS930.1																																																																																			.	.		0.308	GPR89B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000037481.2	NM_016334	
MTMR11	10903	hgsc.bcm.edu	37	1	149902441	149902441	+	Splice_Site	SNP	T	T	C			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr1:149902441T>C	ENST00000439741.2	-	15	1715		c.e15-2		MTMR11_ENST00000492824.1_5'UTR|MTMR11_ENST00000369140.3_Splice_Site|MTMR11_ENST00000406732.3_Splice_Site|MTMR11_ENST00000361405.6_Splice_Site|SF3B4_ENST00000271628.8_5'Flank	NM_001145862.1	NP_001139334.1	A4FU01	MTMRB_HUMAN	myotubularin related protein 11								phosphatase activity (GO:0016791)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(3)|lung(13)|prostate(2)|stomach(1)|urinary_tract(4)	34	Breast(34;0.0009)|Ovarian(49;0.0377)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.221)|STAD - Stomach adenocarcinoma(528;0.247)			GGAGTTTAACTGGACAGAGGA	0.463																																					.		Atlas-SNP	.											.	MTMR11	136	.	0			c.1249-2A>G						.						102.0	109.0	107.0					1																	149902441		2203	4300	6503	SO:0001630	splice_region_variant	10903	exon15			TTTAACTGGACAG	AK097000	CCDS72901.1, CCDS72902.1	1q12-q21	2011-06-09			ENSG00000014914	ENSG00000014914		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	24307	protein-coding gene	gene with protein product	"""cisplatin resistance associated"""					12495846	Standard	NM_181873		Approved	CRA	uc001etl.4	A4FU01	OTTHUMG00000012207	ENST00000439741.2:c.1465-2A>G	chr1.hg19:g.149902441T>C		35.0	0.0		76.0	11.0	NM_181873	B3KUE4|B4DJI6|B4DQF5|B4E3Q6|Q3ZCP7|Q5SZ62|Q6P2Q8|Q99752|Q99753	Splice_Site	SNP	ENST00000439741.2	hg19	CCDS53360.1	.	.	.	.	.	.	.	.	.	.	T	8.968	0.972170	0.18736	.	.	ENSG00000014914	ENST00000369140;ENST00000439741	.	.	.	5.27	5.27	0.74061	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.5219	0.50555	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	MTMR11	148169065	0.997000	0.39634	0.591000	0.28745	0.258000	0.26162	3.989000	0.56958	2.209000	0.71365	0.533000	0.62120	.	.	.		0.463	MTMR11-203	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_181873	Intron
TCHH	7062	hgsc.bcm.edu	37	1	152081242	152081242	+	Missense_Mutation	SNP	T	T	C	rs71582212		TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr1:152081242T>C	ENST00000368804.1	-	2	4450	c.4451A>G	c.(4450-4452)gAc>gGc	p.D1484G		NM_007113.2	NP_009044.2	Q07283	TRHY_HUMAN	trichohyalin	1484	23 X 26 AA approximate tandem repeats.				keratinization (GO:0031424)	cytoskeleton (GO:0005856)	calcium ion binding (GO:0005509)			NS(2)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(20)|kidney(9)|large_intestine(16)|lung(33)|ovary(3)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(4)	105	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			GAATTTTCTGTCACGCTCTTG	0.552																																					p.D1484G		Atlas-SNP	.											.	TCHH	275	.	0			c.A4451G						.						96.0	95.0	95.0					1																	152081242		1896	4105	6001	SO:0001583	missense	7062	exon3			TTTCTGTCACGCT	L09190	CCDS41396.1	1q21-q23	2013-01-10		2006-01-27	ENSG00000159450	ENSG00000159450		"""EF-hand domain containing"""	11791	protein-coding gene	gene with protein product		190370		THH		1431214	Standard	NM_007113		Approved		uc001ezp.3	Q07283	OTTHUMG00000013066	ENST00000368804.1:c.4451A>G	chr1.hg19:g.152081242T>C	ENSP00000357794:p.Asp1484Gly	147.0	0.0		246.0	49.0	NM_007113	Q5VUI3	Missense_Mutation	SNP	ENST00000368804.1	hg19	CCDS41396.1	.	.	.	.	.	.	.	.	.	.	N	10.48	1.360690	0.24598	.	.	ENSG00000159450	ENST00000368804	T	0.08807	3.05	3.51	3.51	0.40186	.	.	.	.	.	T	0.06096	0.0158	L	0.61218	1.895	0.09310	N	1	P	0.51791	0.948	P	0.48189	0.57	T	0.24657	-1.0154	9	0.33141	T	0.24	.	10.0217	0.42046	0.0:0.0:0.0:1.0	.	1484	Q07283	TRHY_HUMAN	G	1484	ENSP00000357794:D1484G	ENSP00000357794:D1484G	D	-	2	0	TCHH	150347866	0.001000	0.12720	0.011000	0.14972	0.044000	0.14063	0.426000	0.21363	1.461000	0.47929	0.164000	0.16699	GAC	.	.		0.552	TCHH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000036671.2	NM_007113	
FLG	2312	hgsc.bcm.edu	37	1	152280562	152280562	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr1:152280562T>A	ENST00000368799.1	-	3	6835	c.6800A>T	c.(6799-6801)cAt>cTt	p.H2267L	FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000420707.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	2267	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			AGATCCATGATGGTTTCTGGA	0.582									Ichthyosis																												p.H2267L		Atlas-SNP	.											.	FLG	900	.	0			c.A6800T						.						193.0	193.0	193.0					1																	152280562		2203	4300	6503	SO:0001583	missense	2312	exon3	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	CCATGATGGTTTC	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.6800A>T	chr1.hg19:g.152280562T>A	ENSP00000357789:p.His2267Leu	245.0	0.0		367.0	71.0	NM_002016	Q01720|Q5T583|Q9UC71	Missense_Mutation	SNP	ENST00000368799.1	hg19	CCDS30860.1	.	.	.	.	.	.	.	.	.	.	T	3.954	-0.011622	0.07727	.	.	ENSG00000143631	ENST00000368799;ENST00000271820	T	0.02140	4.43	3.41	-0.55	0.11825	.	.	.	.	.	T	0.00936	0.0031	M	0.72118	2.19	0.09310	N	1	B	0.29432	0.244	B	0.21151	0.033	T	0.39583	-0.9607	9	0.46703	T	0.11	.	5.4479	0.16546	0.0:0.1064:0.3284:0.5652	.	2267	P20930	FILA_HUMAN	L	2267;177	ENSP00000357789:H2267L	ENSP00000271820:H177L	H	-	2	0	FLG	150547186	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.175000	0.09825	-0.615000	0.05679	-2.091000	0.00372	CAT	.	.		0.582	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033742.1	NM_002016	
FLG2	388698	hgsc.bcm.edu	37	1	152329823	152329823	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr1:152329823A>T	ENST00000388718.5	-	3	511	c.439T>A	c.(439-441)Tca>Aca	p.S147T	FLG-AS1_ENST00000392688.2_RNA|FLG-AS1_ENST00000445097.1_RNA	NM_001014342.2	NP_001014364.1	Q5D862	FILA2_HUMAN	filaggrin family member 2	147	Ser-rich.				establishment of skin barrier (GO:0061436)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			NS(2)|breast(7)|cervix(3)|endometrium(11)|kidney(9)|large_intestine(24)|liver(1)|lung(85)|ovary(12)|pancreas(1)|prostate(6)|skin(17)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	188	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			GTTCCCCTTGAGTGCCCAGAA	0.463																																					p.S147T		Atlas-SNP	.											.	FLG2	431	.	0			c.T439A						.						235.0	232.0	233.0					1																	152329823		2203	4300	6503	SO:0001583	missense	388698	exon3			CCCTTGAGTGCCC	AY827490	CCDS30861.1	1q21.3	2013-01-10			ENSG00000143520	ENSG00000143520		"""EF-hand domain containing"""	33276	protein-coding gene	gene with protein product						12477932	Standard	NM_001014342		Approved	IFPS	uc001ezw.4	Q5D862	OTTHUMG00000012245	ENST00000388718.5:c.439T>A	chr1.hg19:g.152329823A>T	ENSP00000373370:p.Ser147Thr	266.0	0.0		388.0	272.0	NM_001014342	Q9H4U1	Missense_Mutation	SNP	ENST00000388718.5	hg19	CCDS30861.1	.	.	.	.	.	.	.	.	.	.	A	1.564	-0.535914	0.04082	.	.	ENSG00000143520	ENST00000388718	T	0.00768	5.72	5.62	5.62	0.85841	.	.	.	.	.	T	0.00815	0.0027	L	0.46157	1.445	0.09310	N	1	D	0.61080	0.989	P	0.60068	0.868	T	0.58842	-0.7565	9	0.13470	T	0.59	0.2772	12.2215	0.54437	1.0:0.0:0.0:0.0	.	147	Q5D862	FILA2_HUMAN	T	147	ENSP00000373370:S147T	ENSP00000373370:S147T	S	-	1	0	FLG2	150596447	0.003000	0.15002	0.144000	0.22314	0.106000	0.19336	1.894000	0.39768	2.148000	0.66965	0.455000	0.32223	TCA	.	.		0.463	FLG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034018.5	NM_001014342	
SPTA1	6708	hgsc.bcm.edu	37	1	158632708	158632708	+	Missense_Mutation	SNP	C	C	G			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr1:158632708C>G	ENST00000368147.4	-	17	2428	c.2248G>C	c.(2248-2250)Gct>Cct	p.A750P		NM_003126.2	NP_003117.2	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	750					actin filament capping (GO:0051693)|actin filament organization (GO:0007015)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|lymphocyte homeostasis (GO:0002260)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of protein binding (GO:0032092)|positive regulation of T cell proliferation (GO:0042102)|regulation of cell shape (GO:0008360)	actin cytoskeleton (GO:0015629)|cuticular plate (GO:0032437)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)			NS(3)|breast(7)|cervix(1)|endometrium(22)|kidney(9)|large_intestine(29)|liver(2)|lung(183)|ovary(5)|prostate(18)|skin(11)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(6)	307	all_hematologic(112;0.0378)					AAATATGCAGCCAGGTCTGTA	0.433																																					p.A750P		Atlas-SNP	.											.	SPTA1	720	.	0			c.G2248C						.						75.0	73.0	74.0					1																	158632708		1871	4092	5963	SO:0001583	missense	6708	exon17			ATGCAGCCAGGTC	M61877	CCDS41423.1	1q21	2014-06-23	2014-06-23		ENSG00000163554	ENSG00000163554		"""EF-hand domain containing"""	11272	protein-coding gene	gene with protein product	"""elliptocytosis 2"""	182860	"""spectrin, alpha, erythrocytic 1 (elliptocytosis 2)"""				Standard	NM_003126		Approved	EL2	uc001fst.1	P02549	OTTHUMG00000019636	ENST00000368147.4:c.2248G>C	chr1.hg19:g.158632708C>G	ENSP00000357129:p.Ala750Pro	148.0	0.0		209.0	10.0	NM_003126	Q15514|Q5VYL1|Q5VYL2|Q6LDY5	Missense_Mutation	SNP	ENST00000368147.4	hg19	CCDS41423.1	.	.	.	.	.	.	.	.	.	.	C	18.51	3.640181	0.67244	.	.	ENSG00000163554	ENST00000368148;ENST00000368147	T;T	0.42131	0.98;0.98	4.41	4.41	0.53225	.	0.267990	0.19856	N	0.104525	T	0.64091	0.2567	M	0.89904	3.07	0.51767	D	0.999932	D	0.76494	0.999	D	0.76575	0.988	T	0.72268	-0.4343	10	0.87932	D	0	.	13.8662	0.63590	0.0:1.0:0.0:0.0	.	750	P02549	SPTA1_HUMAN	P	750	ENSP00000357130:A750P;ENSP00000357129:A750P	ENSP00000357129:A750P	A	-	1	0	SPTA1	156899332	1.000000	0.71417	0.383000	0.26132	0.606000	0.37113	6.820000	0.75267	2.270000	0.75569	0.655000	0.94253	GCT	.	.		0.433	SPTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051851.3	NM_003126	
ACKR1	2532	hgsc.bcm.edu	37	1	159176146	159176146	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr1:159176146T>C	ENST00000368122.2	+	2	1596	c.917T>C	c.(916-918)cTa>cCa	p.L306P	DARC_ENST00000537147.1_Missense_Mutation_p.L306P|CTA-134P22.2_ENST00000609696.1_RNA|DARC_ENST00000368121.2_Missense_Mutation_p.L308P	NM_002036.3	NP_002027.2	Q16570	ACKR1_HUMAN		306					chemokine-mediated signaling pathway (GO:0070098)|defense response (GO:0006952)|inflammatory response (GO:0006954)|regulation of chemokine production (GO:0032642)	endosome (GO:0005768)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	C-C chemokine binding (GO:0019957)|G-protein coupled receptor activity (GO:0004930)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)	p.L308Q(1)		large_intestine(2)|lung(1)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	8	all_hematologic(112;0.0429)					CTCCTCGCCCTATTCTGCCAC	0.587																																					p.L308P		Atlas-SNP	.											DARC_ENST00000368121,NS,carcinoma,0,1	DARC	76	.	1	Substitution - Missense(1)	lung(1)	c.T923C						.						190.0	205.0	200.0					1																	159176146		2203	4300	6503	SO:0001583	missense	2532	exon1			TCGCCCTATTCTG																												ENST00000368122.2:c.917T>C	chr1.hg19:g.159176146T>C	ENSP00000357104:p.Leu306Pro	104.0	0.0		160.0	37.0	NM_001122951	A8YPG5|O75898|Q16300|Q8WWE3|Q9UJP0|Q9UKZ5|Q9UKZ6|Q9UQE1	Missense_Mutation	SNP	ENST00000368122.2	hg19	CCDS1183.1	.	.	.	.	.	.	.	.	.	.	T	15.15	2.747346	0.49257	.	.	ENSG00000213088	ENST00000368122;ENST00000537147;ENST00000359381;ENST00000368121	T;T;T	0.49720	0.77;0.77;0.77	5.4	-0.0751	0.13728	.	0.547088	0.12038	U	0.505302	T	0.34164	0.0888	L	0.43923	1.385	0.19945	N	0.999943	D;D	0.62365	0.991;0.991	P;P	0.59643	0.861;0.861	T	0.09773	-1.0659	10	0.87932	D	0	-16.7268	5.3877	0.16227	0.2878:0.0:0.2979:0.4143	.	308;306	Q5Y7A1;Q16570	.;DUFFY_HUMAN	P	306;306;306;308	ENSP00000357104:L306P;ENSP00000441985:L306P;ENSP00000357103:L308P	ENSP00000352341:L306P	L	+	2	0	DARC	157442770	0.001000	0.12720	0.012000	0.15200	0.575000	0.36095	0.422000	0.21296	0.084000	0.17077	0.533000	0.62120	CTA	.	.		0.587	DARC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090338.2		
LY9	4063	hgsc.bcm.edu	37	1	160784465	160784465	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr1:160784465T>C	ENST00000263285.6	+	4	1016	c.986T>C	c.(985-987)aTa>aCa	p.I329T	LY9_ENST00000368037.5_Missense_Mutation_p.I329T|LY9_ENST00000368040.1_5'UTR|LY9_ENST00000341032.4_Missense_Mutation_p.I329T|LY9_ENST00000368041.2_Missense_Mutation_p.I289T|LY9_ENST00000392203.4_Missense_Mutation_p.I329T			Q9HBG7	LY9_HUMAN	lymphocyte antigen 9	329	Ig-like V-type 2.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			autonomic_ganglia(1)|breast(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(17)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	36	all_cancers(52;2.72e-17)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00737)			CAGCTGAAGATAGAGGACGCC	0.577																																					p.I329T		Atlas-SNP	.											.	LY9	115	.	0			c.T986C						.						64.0	58.0	60.0					1																	160784465		2203	4300	6503	SO:0001583	missense	4063	exon4			TGAAGATAGAGGA	L42621	CCDS30916.1, CCDS30917.1, CCDS65695.1, CCDS65696.1	1q23.3	2013-01-11			ENSG00000122224	ENSG00000122224		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6730	protein-coding gene	gene with protein product		600684				8537117, 7797269	Standard	NM_001261457		Approved	CD229, mLY9, SLAMF3, hly9	uc001fwu.4	Q9HBG7	OTTHUMG00000024007	ENST00000263285.6:c.986T>C	chr1.hg19:g.160784465T>C	ENSP00000263285:p.Ile329Thr	164.0	1.0		265.0	163.0	NM_001261457	A8K7N3|Q14775|Q5VYI3|Q6P2J4|Q9H4N5|Q9NQ24	Missense_Mutation	SNP	ENST00000263285.6	hg19	CCDS30916.1	.	.	.	.	.	.	.	.	.	.	T	9.851	1.193695	0.22037	.	.	ENSG00000122224	ENST00000368041;ENST00000341032;ENST00000263285;ENST00000542780;ENST00000392203;ENST00000368037;ENST00000368036	T;T	0.01505	4.82;4.82	3.71	1.24	0.21308	Immunoglobulin subtype (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.00468	0.0015	N	0.19112	0.55	0.18873	N	0.999982	P;P;B;P;P;P	0.43231	0.665;0.665;0.001;0.801;0.774;0.665	B;B;B;B;B;B	0.37780	0.119;0.119;0.001;0.258;0.236;0.119	T	0.49341	-0.8950	9	0.72032	D	0.01	-3.3458	4.1983	0.10453	0.0:0.1164:0.2068:0.6769	.	329;289;289;329;329;329	B4E0J5;Q5VYH7;Q5VYH9;E7EME5;Q9HBG7-2;Q9HBG7	.;.;.;.;.;LY9_HUMAN	T	329;329;329;329;289;289;231	ENSP00000342921:I329T;ENSP00000263285:I329T	ENSP00000263285:I329T	I	+	2	0	LY9	159051089	0.948000	0.32251	0.011000	0.14972	0.016000	0.09150	0.329000	0.19698	0.102000	0.17638	0.460000	0.39030	ATA	.	.		0.577	LY9-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000060457.3	NM_002348	
FCGR2A	2212	hgsc.bcm.edu	37	1	161479767	161479767	+	Silent	SNP	C	C	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr1:161479767C>T	ENST00000271450.6	+	4	560	c.522C>T	c.(520-522)atC>atT	p.I174I	FCGR2A_ENST00000367972.4_Silent_p.I173I	NM_001136219.1|NM_021642.3	NP_001129691.1|NP_067674.2	P12318	FCG2A_HUMAN	Fc fragment of IgG, low affinity IIa, receptor (CD32)	174	Ig-like C2-type 2.				Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				autonomic_ganglia(1)|breast(2)|endometrium(2)|large_intestine(2)|lung(11)|ovary(1)	19	all_cancers(52;4.89e-16)|all_hematologic(112;0.0207)		BRCA - Breast invasive adenocarcinoma(70;0.00376)		Abciximab(DB00054)|Adalimumab(DB00051)|Alefacept(DB00092)|Alemtuzumab(DB00087)|Basiliximab(DB00074)|Bevacizumab(DB00112)|Cetuximab(DB00002)|Daclizumab(DB00111)|Efalizumab(DB00095)|Etanercept(DB00005)|Gemtuzumab ozogamicin(DB00056)|Ibritumomab(DB00078)|Intravenous Immunoglobulin(DB00028)|Muromonab(DB00075)|Natalizumab(DB00108)|Palivizumab(DB00110)|Rituximab(DB00073)|Tositumomab(DB00081)|Trastuzumab(DB00072)	CCTTCTCCATCCCACAAGCAA	0.498																																					p.I174I		Atlas-SNP	.											.	FCGR2A	38	.	0			c.C522T						.						137.0	120.0	126.0					1																	161479767		2203	4300	6503	SO:0001819	synonymous_variant	2212	exon4			CTCCATCCCACAA	J03619	CCDS30922.1, CCDS44264.1	1q23	2013-01-11	2005-02-02		ENSG00000143226	ENSG00000143226		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3616	protein-coding gene	gene with protein product	"""Immunoglobulin G Fc receptor II"""	146790	"""Fc fragment of IgG, low affinity IIa, receptor for (CD32)"""	FCG2, FCGR2A1, FCGR2		2139735	Standard	NM_021642		Approved	CD32, CD32A, IGFR2, CDw32	uc001gan.3	P12318	OTTHUMG00000034469	ENST00000271450.6:c.522C>T	chr1.hg19:g.161479767C>T		853.0	1.0		1276.0	240.0	NM_001136219	Q8WUN1|Q8WW64	Silent	SNP	ENST00000271450.6	hg19	CCDS44264.1																																																																																			.	.		0.498	FCGR2A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000083318.3	NM_021642	
METTL13	51603	hgsc.bcm.edu	37	1	171753199	171753199	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr1:171753199G>T	ENST00000361735.3	+	2	739	c.473G>T	c.(472-474)tGc>tTc	p.C158F	METTL13_ENST00000458517.1_Missense_Mutation_p.C157F|METTL13_ENST00000367737.5_Intron|METTL13_ENST00000362019.3_Missense_Mutation_p.C72F	NM_015935.4	NP_057019.3	Q8N6R0	MET13_HUMAN	methyltransferase like 13	158							methyltransferase activity (GO:0008168)			breast(3)|cervix(1)|endometrium(4)|kidney(5)|large_intestine(8)|lung(17)|stomach(3)	41						CGCTATCTCTGCATCTCCCTG	0.597																																					p.C158F		Atlas-SNP	.											.	METTL13	67	.	0			c.G473T						.						86.0	75.0	78.0					1																	171753199		2203	4300	6503	SO:0001583	missense	51603	exon2			ATCTCTGCATCTC	AF132936	CCDS1299.1, CCDS1300.1, CCDS30936.1	1q24-q25.3	2009-02-23	2009-02-23	2009-02-23	ENSG00000010165	ENSG00000010165			24248	protein-coding gene	gene with protein product			"""KIAA0859"""	KIAA0859		10810093, 10048485	Standard	NM_001007239		Approved	CGI-01	uc001ghz.3	Q8N6R0	OTTHUMG00000034912	ENST00000361735.3:c.473G>T	chr1.hg19:g.171753199G>T	ENSP00000354920:p.Cys158Phe	112.0	0.0		190.0	49.0	NM_015935	A6NFK0|A8K6S5|O94940|Q53EZ6|Q5TGP9|Q5TGQ0|Q8N2P8|Q96J11|Q96SQ0|Q9Y2Z1|Q9Y3M6	Missense_Mutation	SNP	ENST00000361735.3	hg19	CCDS1299.1	.	.	.	.	.	.	.	.	.	.	G	20.5	3.999889	0.74818	.	.	ENSG00000010165	ENST00000458517;ENST00000362019;ENST00000361735;ENST00000367736;ENST00000341850	T;T;T;T	0.40225	1.04;1.04;1.04;1.04	5.33	5.33	0.75918	.	0.000000	0.85682	D	0.000000	T	0.49287	0.1548	L	0.39692	1.235	0.80722	D	1	D;D	0.89917	0.998;1.0	D;D	0.77557	0.984;0.99	T	0.46992	-0.9151	10	0.48119	T	0.1	-10.6217	18.6244	0.91332	0.0:0.0:1.0:0.0	.	157;158	B4E2X3;Q8N6R0	.;MTL13_HUMAN	F	157;72;158;75;72	ENSP00000401955:C157F;ENSP00000355393:C72F;ENSP00000354920:C158F;ENSP00000356710:C75F	ENSP00000341732:C72F	C	+	2	0	METTL13	170019822	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.443000	0.80521	2.454000	0.82982	0.655000	0.94253	TGC	.	.		0.597	METTL13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084528.5	NM_014955	
SLC9C2	284525	hgsc.bcm.edu	37	1	173526479	173526479	+	Splice_Site	SNP	C	C	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr1:173526479C>A	ENST00000367714.3	-	10	1637	c.1215G>T	c.(1213-1215)atG>atT	p.M405I	SLC9C2_ENST00000536496.1_Splice_Site_p.M303I|RP3-436N22.3_ENST00000431459.1_RNA|SLC9C2_ENST00000466087.1_5'UTR	NM_178527.3	NP_848622.2	Q5TAH2	SL9C2_HUMAN	solute carrier family 9, member C2 (putative)	405					sodium ion transport (GO:0006814)	integral component of membrane (GO:0016021)	solute:proton antiporter activity (GO:0015299)										TCTTTCCTACCATTTGTGGTA	0.353																																					p.M405I		Atlas-SNP	.											.	.	.	.	0			c.G1215T						.						93.0	101.0	98.0					1																	173526479		2203	4300	6503	SO:0001630	splice_region_variant	284525	exon10			TCCTACCATTTGT	AK128104	CCDS1308.1	1q25.1	2013-07-18	2013-07-18	2012-03-22	ENSG00000162753	ENSG00000162753		"""Solute carriers"""	28664	protein-coding gene	gene with protein product			"""solute carrier family 9, isoform 11"", ""solute carrier family 9, member 11"", ""solute carrier family 9, member C2"""	SLC9A11			Standard	NM_178527		Approved	MGC43026	uc001giz.2	Q5TAH2	OTTHUMG00000034800	ENST00000367714.3:c.1215+1G>T	chr1.hg19:g.173526479C>A		262.0	0.0		445.0	95.0	NM_178527	Q86UF3	Missense_Mutation	SNP	ENST00000367714.3	hg19	CCDS1308.1	.	.	.	.	.	.	.	.	.	.	C	0.767	-0.767252	0.02974	.	.	ENSG00000162753	ENST00000367714;ENST00000536496	T;T	0.21361	2.01;2.01	5.26	5.26	0.73747	Cation/H+ exchanger (1);	0.478827	0.21379	N	0.075506	T	0.04861	0.0131	N	0.08118	0	0.29323	N	0.867211	B	0.29862	0.259	B	0.31946	0.138	T	0.30534	-0.9975	9	.	.	.	-11.0681	14.7399	0.69445	0.0:1.0:0.0:0.0	.	405	Q5TAH2	S9A11_HUMAN	I	405;303	ENSP00000356687:M405I;ENSP00000445437:M303I	.	M	-	3	0	SLC9A11	171793102	0.996000	0.38824	0.980000	0.43619	0.142000	0.21351	3.394000	0.52551	2.626000	0.88956	0.585000	0.79938	ATG	.	.		0.353	SLC9C2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084205.1	NM_178527	Missense_Mutation
ZBTB37	84614	hgsc.bcm.edu	37	1	173842760	173842760	+	Intron	SNP	A	A	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr1:173842760A>T	ENST00000367701.5	+	3	1214				ZBTB37_ENST00000432989.1_Missense_Mutation_p.Y360F|ZBTB37_ENST00000427304.1_Intron|ZBTB37_ENST00000367702.1_Missense_Mutation_p.Y360F|ZBTB37_ENST00000367704.1_Intron			Q5TC79	ZBT37_HUMAN	zinc finger and BTB domain containing 37						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|large_intestine(1)|lung(4)|ovary(1)|prostate(1)|skin(1)|urinary_tract(4)	13						GCTACTGTGTATGAATAGAAA	0.408																																					p.Y360F		Atlas-SNP	.											.	ZBTB37	38	.	0			c.A1079T						.						76.0	74.0	75.0					1																	173842760		2203	4300	6503	SO:0001627	intron_variant	84614	exon4			CTGTGTATGAATA	AK057310	CCDS1312.1, CCDS44278.1	1q24.2	2013-01-08			ENSG00000185278	ENSG00000185278		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	28365	protein-coding gene	gene with protein product						12477932	Standard	NM_032522		Approved	MGC2629, ZNF908	uc009wwp.1	Q5TC79	OTTHUMG00000037274	ENST00000367701.5:c.1023+56A>T	chr1.hg19:g.173842760A>T		130.0	0.0		234.0	38.0	NM_032522	Q5TC80|Q96M87|Q9BQ88	Missense_Mutation	SNP	ENST00000367701.5	hg19	CCDS44278.1	.	.	.	.	.	.	.	.	.	.	A	11.95	1.791859	0.31685	.	.	ENSG00000185278	ENST00000432989;ENST00000367702	T;T	0.75050	-0.9;-0.9	3.64	-1.33	0.09172	.	.	.	.	.	T	0.29355	0.0731	.	.	.	0.09310	N	1	B	0.15141	0.012	B	0.14023	0.01	T	0.15235	-1.0444	7	.	.	.	.	3.9418	0.09331	0.3697:0.3753:0.2551:0.0	.	360	Q5TC79-2	.	F	360	ENSP00000409408:Y360F;ENSP00000356675:Y360F	.	Y	+	2	0	ZBTB37	172109383	0.918000	0.31147	0.002000	0.10522	0.035000	0.12851	0.326000	0.19646	-0.241000	0.09681	-0.250000	0.11733	TAT	.	.		0.408	ZBTB37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090729.2	NM_032522	
ASTN1	460	hgsc.bcm.edu	37	1	176927577	176927577	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr1:176927577C>T	ENST00000367654.3	-	10	1875	c.1664G>A	c.(1663-1665)aGc>aAc	p.S555N	ASTN1_ENST00000424564.2_Missense_Mutation_p.S547N|ASTN1_ENST00000281881.3_5'UTR|ASTN1_ENST00000367657.3_Missense_Mutation_p.S547N|ASTN1_ENST00000361833.2_Missense_Mutation_p.S547N	NM_004319.1	NP_004310.1	O14525	ASTN1_HUMAN	astrotactin 1	555					locomotory behavior (GO:0007626)|neuron cell-cell adhesion (GO:0007158)|neuron migration (GO:0001764)	endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)				NS(4)|breast(5)|central_nervous_system(2)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(23)|liver(1)|lung(81)|ovary(6)|prostate(5)|skin(10)|urinary_tract(3)	153						AAAGCTCTTGCTGAGGGGCAA	0.562																																					p.S547N		Atlas-SNP	.											.	ASTN1	314	.	0			c.G1640A						.						96.0	73.0	81.0					1																	176927577		2203	4300	6503	SO:0001583	missense	460	exon10			CTCTTGCTGAGGG	AB006627	CCDS1319.1, CCDS44280.1, CCDS65732.1	1q25.2	2008-02-05	2006-08-24	2006-08-24	ENSG00000152092	ENSG00000152092			773	protein-coding gene	gene with protein product		600904	"""astrotactin"""	ASTN		9070947	Standard	NM_001286164		Approved		uc001glc.3	O14525	OTTHUMG00000035041	ENST00000367654.3:c.1664G>A	chr1.hg19:g.176927577C>T	ENSP00000356626:p.Ser555Asn	206.0	0.0		278.0	72.0	NM_004319	A5PL12|B4DHI9|E9PFR8|O60799|Q5W0V7|Q5W0V8	Missense_Mutation	SNP	ENST00000367654.3	hg19		.	.	.	.	.	.	.	.	.	.	C	34	5.352254	0.95830	.	.	ENSG00000152092	ENST00000367657;ENST00000361833;ENST00000367654;ENST00000424564;ENST00000541808	T;T;T;T	0.21932	1.98;2.4;2.39;1.99	5.5	5.5	0.81552	.	0.000000	0.85682	D	0.000000	T	0.36936	0.0985	L	0.29908	0.895	0.80722	D	1	D;D;D	0.67145	0.996;0.989;0.989	D;D;D	0.75484	0.986;0.979;0.979	T	0.07177	-1.0786	10	0.49607	T	0.09	-31.6642	18.9852	0.92766	0.0:1.0:0.0:0.0	.	555;547;547	O14525;O14525-2;B1AJS1	ASTN1_HUMAN;.;.	N	547;547;555;547;547	ENSP00000356629:S547N;ENSP00000354536:S547N;ENSP00000356626:S555N;ENSP00000395041:S547N	ENSP00000354536:S547N	S	-	2	0	ASTN1	175194200	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.695000	0.84257	2.572000	0.86782	0.655000	0.94253	AGC	.	.		0.562	ASTN1-201	KNOWN	basic	protein_coding	protein_coding		NM_004319	
BRINP2	57795	hgsc.bcm.edu	37	1	177245534	177245534	+	Missense_Mutation	SNP	T	T	C	rs368629885		TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr1:177245534T>C	ENST00000361539.4	+	6	1288	c.976T>C	c.(976-978)Tcc>Ccc	p.S326P	BRINP2_ENST00000478325.1_3'UTR	NM_021165.2	NP_066988.1	Q9C0B6	BRNP2_HUMAN	bone morphogenetic protein/retinoic acid inducible neural-specific 2	326					cell cycle arrest (GO:0007050)|cellular response to retinoic acid (GO:0071300)|negative regulation of mitotic cell cycle (GO:0045930)|positive regulation of neuron differentiation (GO:0045666)	extracellular region (GO:0005576)											GATCCAGGACTCCTGGGCCAC	0.567																																					p.S326P		Atlas-SNP	.											.	FAM5B	191	.	0			c.T976C						.						63.0	55.0	58.0					1																	177245534		2203	4300	6503	SO:0001583	missense	57795	exon6			CAGGACTCCTGGG		CCDS1320.1	1q24	2013-08-06	2013-08-06	2013-07-31	ENSG00000198797	ENSG00000198797			13746	protein-coding gene	gene with protein product			"""family with sequence similarity 5, member B"""	FAM5B		15193423	Standard	NM_021165		Approved	DBCCR1L2	uc001glf.3	Q9C0B6	OTTHUMG00000034953	ENST00000361539.4:c.976T>C	chr1.hg19:g.177245534T>C	ENSP00000354481:p.Ser326Pro	495.0	0.0		691.0	69.0	NM_021165	O95560|Q6ZWC1|Q7LCZ9|Q8N360	Missense_Mutation	SNP	ENST00000361539.4	hg19	CCDS1320.1	.	.	.	.	.	.	.	.	.	.	T	15.57	2.871574	0.51695	.	.	ENSG00000198797	ENST00000536589;ENST00000361539	T	0.15256	2.44	6.07	0.802	0.18686	.	0.390200	0.28209	N	0.016191	T	0.13114	0.0318	L	0.39898	1.24	0.36544	D	0.871453	B;P;B	0.37038	0.256;0.579;0.037	B;B;B	0.38755	0.189;0.281;0.029	T	0.12708	-1.0537	10	0.72032	D	0.01	-17.6413	6.0285	0.19667	0.3365:0.0:0.3715:0.2919	.	76;221;326	F5H8E0;Q9C0B6-2;Q9C0B6	.;.;FAM5B_HUMAN	P	76;326	ENSP00000354481:S326P	ENSP00000354481:S326P	S	+	1	0	FAM5B	175512157	0.029000	0.19370	1.000000	0.80357	0.994000	0.84299	0.314000	0.19432	0.475000	0.27415	0.533000	0.62120	TCC	.	.		0.567	BRINP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084599.1	NM_021165	
FAM163A	148753	hgsc.bcm.edu	37	1	179783192	179783192	+	Missense_Mutation	SNP	T	T	G			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr1:179783192T>G	ENST00000341785.4	+	5	768	c.372T>G	c.(370-372)ttT>ttG	p.F124L	RP11-12M5.3_ENST00000453051.1_RNA|RP11-12M5.3_ENST00000415218.1_RNA	NM_173509.2	NP_775780.1	Q96GL9	F163A_HUMAN	family with sequence similarity 163, member A	124						integral component of membrane (GO:0016021)				endometrium(2)|large_intestine(4)|lung(6)|ovary(1)|pancreas(1)|prostate(1)	15						GGCTCTCCTTTGCTCCCACAT	0.617																																					p.F124L		Atlas-SNP	.											.	FAM163A	24	.	0			c.T372G						.						64.0	65.0	65.0					1																	179783192		2203	4300	6503	SO:0001583	missense	148753	exon5			CTCCTTTGCTCCC	BC009382	CCDS1333.1	1q25.2	2008-06-05	2008-06-05	2008-06-05	ENSG00000143340	ENSG00000143340			28274	protein-coding gene	gene with protein product		611727	"""chromosome 1 open reading frame 76"""	C1orf76		12477932	Standard	NM_173509		Approved	MGC16664	uc001gnj.3	Q96GL9	OTTHUMG00000035262	ENST00000341785.4:c.372T>G	chr1.hg19:g.179783192T>G	ENSP00000354891:p.Phe124Leu	229.0	0.0		356.0	37.0	NM_173509	A8K8R7	Missense_Mutation	SNP	ENST00000341785.4	hg19	CCDS1333.1	.	.	.	.	.	.	.	.	.	.	T	13.37	2.217662	0.39201	.	.	ENSG00000143340	ENST00000341785	.	.	.	4.57	-4.02	0.04034	.	0.134260	0.51477	N	0.000085	T	0.23210	0.0561	N	0.22421	0.69	0.28849	N	0.896145	B	0.02656	0.0	B	0.06405	0.002	T	0.05053	-1.0909	9	0.66056	D	0.02	-4.7195	9.1058	0.36696	0.0:0.7175:0.1263:0.1563	.	124	Q96GL9	F163A_HUMAN	L	124	.	ENSP00000354891:F124L	F	+	3	2	FAM163A	178049815	0.988000	0.35896	0.071000	0.20095	0.190000	0.23558	0.344000	0.19962	-1.001000	0.03434	0.460000	0.39030	TTT	.	.		0.617	FAM163A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085300.1	NM_173509	
CACNA1E	777	hgsc.bcm.edu	37	1	181753861	181753861	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr1:181753861C>A	ENST00000367573.2	+	41	5535	c.5535C>A	c.(5533-5535)caC>caA	p.H1845Q	CACNA1E_ENST00000358338.5_Missense_Mutation_p.H1777Q|CACNA1E_ENST00000360108.3_Missense_Mutation_p.H1826Q|CACNA1E_ENST00000367570.1_Missense_Mutation_p.H1845Q|CACNA1E_ENST00000526775.1_Missense_Mutation_p.H1826Q|CACNA1E_ENST00000367567.4_Missense_Mutation_p.H1452Q|CACNA1E_ENST00000357570.5_Missense_Mutation_p.H1796Q	NM_001205293.1	NP_001192222.1	Q15878	CAC1E_HUMAN	calcium channel, voltage-dependent, R type, alpha 1E subunit	1845					calcium ion import (GO:0070509)|energy reserve metabolic process (GO:0006112)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	calcium ion binding (GO:0005509)|high voltage-gated calcium channel activity (GO:0008331)|voltage-gated calcium channel activity (GO:0005245)			NS(2)|breast(9)|central_nervous_system(3)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(6)|kidney(4)|large_intestine(34)|lung(99)|ovary(6)|pancreas(1)|prostate(9)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	204						TCTGGCCTCACCTATCCCAGA	0.488																																					p.H1845Q		Atlas-SNP	.											.	CACNA1E	778	.	0			c.C5535A						.						56.0	62.0	60.0					1																	181753861		1953	4138	6091	SO:0001583	missense	777	exon41			GCCTCACCTATCC	AK096563	CCDS53443.1, CCDS55664.1, CCDS55665.1	1q25.3	2013-01-10	2007-02-16		ENSG00000198216	ENSG00000198216		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"", ""EF-hand domain containing"""	1392	protein-coding gene	gene with protein product		601013		CACNL1A6		8388125, 16382099	Standard	NM_001205293		Approved	Cav2.3, BII, CACH6	uc009wxt.3	Q15878	OTTHUMG00000037301	ENST00000367573.2:c.5535C>A	chr1.hg19:g.181753861C>A	ENSP00000356545:p.His1845Gln	152.0	0.0		202.0	42.0	NM_001205293	B1AM12|B1AM13|B1AM14|Q14580|Q14581	Missense_Mutation	SNP	ENST00000367573.2	hg19	CCDS55664.1	.	.	.	.	.	.	.	.	.	.	C	17.01	3.280518	0.59758	.	.	ENSG00000198216	ENST00000367570;ENST00000526775;ENST00000357570;ENST00000358338;ENST00000367567;ENST00000360108;ENST00000367573	T;T;T;T;T;T;T	0.62498	0.02;0.02;0.02;0.02;0.02;0.02;0.02	5.57	5.57	0.84162	.	0.244272	0.47093	D	0.000250	T	0.46639	0.1403	N	0.08118	0	0.48511	D	0.999666	B;P	0.37276	0.018;0.589	B;B	0.41619	0.024;0.361	T	0.53711	-0.8400	10	0.54805	T	0.06	.	12.5104	0.56003	0.0:0.923:0.0:0.077	.	1826;1845	Q15878-2;Q15878-3	.;.	Q	1845;1826;1796;1777;1452;1826;1845	ENSP00000356542:H1845Q;ENSP00000434814:H1826Q;ENSP00000350183:H1796Q;ENSP00000351101:H1777Q;ENSP00000356539:H1452Q;ENSP00000353222:H1826Q;ENSP00000356545:H1845Q	ENSP00000350183:H1796Q	H	+	3	2	CACNA1E	180020484	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	1.902000	0.39848	2.610000	0.88304	0.563000	0.77884	CAC	.	.		0.488	CACNA1E-003	KNOWN	non_canonical_U12|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000090793.2	NM_000721	
DHX9	1660	hgsc.bcm.edu	37	1	182836133	182836133	+	Silent	SNP	A	A	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr1:182836133A>T	ENST00000367549.3	+	14	1622	c.1512A>T	c.(1510-1512)ggA>ggT	p.G504G		NM_001357.4	NP_001348.2	Q08211	DHX9_HUMAN	DEAH (Asp-Glu-Ala-His) box helicase 9	504	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				ATP catabolic process (GO:0006200)|cellular response to heat (GO:0034605)|circadian rhythm (GO:0007623)|CRD-mediated mRNA stabilization (GO:0070934)|DNA duplex unwinding (GO:0032508)|gene expression (GO:0010467)|innate immune response (GO:0045087)|mRNA splicing, via spliceosome (GO:0000398)|osteoblast differentiation (GO:0001649)|positive regulation of type I interferon production (GO:0032481)|RNA splicing (GO:0008380)	centrosome (GO:0005813)|CRD-mediated mRNA stability complex (GO:0070937)|cytoplasm (GO:0005737)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|ATP-dependent RNA helicase activity (GO:0004004)|DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|RNA helicase activity (GO:0003724)|RNA polymerase II transcription factor binding (GO:0001085)			NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(10)|kidney(3)|large_intestine(7)|liver(1)|lung(19)|ovary(2)|prostate(1)|skin(1)|urinary_tract(2)	49						GCATTCGAGGAATCAGTCATG	0.308																																					p.G504G	Colon(69;210 1162 3697 13559 39565)	Atlas-SNP	.											.	DHX9	114	.	0			c.A1512T						.						176.0	159.0	164.0					1																	182836133		1824	4081	5905	SO:0001819	synonymous_variant	1660	exon14			TCGAGGAATCAGT	L13848	CCDS41444.1	1q25	2013-05-13	2013-05-13	2003-06-20	ENSG00000135829	ENSG00000135829		"""DEAH-boxes"""	2750	protein-coding gene	gene with protein product	"""NDH II"", ""RNA helicase A"""	603115	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 9 (RNA helicase A, nuclear DNA helicase II; leukophysin)"", ""DEAH (Asp-Glu-Ala-His) box polypeptide 9"""	LKP, DDX9		8344961, 9111062	Standard	NM_001357		Approved	RHA	uc001gpr.3	Q08211	OTTHUMG00000035337	ENST00000367549.3:c.1512A>T	chr1.hg19:g.182836133A>T		117.0	0.0		167.0	35.0	NM_001357	B2RNV4|Q05CI5|Q12803|Q32Q22|Q5VY62|Q6PD69|Q99556	Silent	SNP	ENST00000367549.3	hg19	CCDS41444.1																																																																																			.	.		0.308	DHX9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085522.2	NM_030588	
COLGALT2	23127	hgsc.bcm.edu	37	1	183908097	183908097	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr1:183908097G>A	ENST00000361927.4	-	12	2050	c.1679C>T	c.(1678-1680)aCg>aTg	p.T560M	COLGALT2_ENST00000486375.1_Intron|COLGALT2_ENST00000546159.1_Intron|COLGALT2_ENST00000367520.3_Missense_Mutation_p.T297M|COLGALT2_ENST00000367521.1_Missense_Mutation_p.T168M	NM_015101.2	NP_055916.1	Q8IYK4	GT252_HUMAN	collagen beta(1-O)galactosyltransferase 2	560					extracellular matrix organization (GO:0030198)|lipopolysaccharide biosynthetic process (GO:0009103)	endoplasmic reticulum lumen (GO:0005788)	procollagen galactosyltransferase activity (GO:0050211)	p.T560M(1)									TGTGTAGTGCGTAGGGTAGAT	0.557																																					p.T560M		Atlas-SNP	.											GLT25D2,colon,carcinoma,0,2	.	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1679T						.						124.0	117.0	119.0					1																	183908097		2203	4300	6503	SO:0001583	missense	23127	exon12			TAGTGCGTAGGGT	AF288389	CCDS1360.1	1q25	2013-02-27	2013-02-27	2013-02-27	ENSG00000198756	ENSG00000198756			16790	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 17"", ""glycosyltransferase 25 domain containing 2"""	C1orf17, GLT25D2		19075007	Standard	XM_005245008		Approved	KIAA0584	uc001gqr.3	Q8IYK4	OTTHUMG00000035460	ENST00000361927.4:c.1679C>T	chr1.hg19:g.183908097G>A	ENSP00000354960:p.Thr560Met	277.0	2.0		472.0	321.0	NM_015101	O60327|Q9BZR0	Missense_Mutation	SNP	ENST00000361927.4	hg19	CCDS1360.1	.	.	.	.	.	.	.	.	.	.	G	26.1	4.704101	0.88924	.	.	ENSG00000198756	ENST00000361927;ENST00000367521;ENST00000367520	T	0.79940	-1.32	5.21	5.21	0.72293	.	0.049946	0.85682	D	0.000000	D	0.90707	0.7084	M	0.84219	2.685	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.996	D	0.92015	0.5621	10	0.87932	D	0	.	18.7471	0.91797	0.0:0.0:1.0:0.0	.	560;297	Q8IYK4;Q5SXQ3	GT252_HUMAN;.	M	560;168;297	ENSP00000354960:T560M	ENSP00000354960:T560M	T	-	2	0	GLT25D2	182174720	1.000000	0.71417	0.919000	0.36401	0.853000	0.48598	7.694000	0.84235	2.411000	0.81874	0.563000	0.77884	ACG	.	.		0.557	COLGALT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086128.1	NM_015101	
BRINP3	339479	hgsc.bcm.edu	37	1	190067337	190067337	+	Silent	SNP	T	T	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr1:190067337T>A	ENST00000367462.3	-	8	2343	c.2112A>T	c.(2110-2112)ctA>ctT	p.L704L	BRINP3_ENST00000534846.1_Silent_p.L602L	NM_199051.1	NP_950252.1	Q76B58	BRNP3_HUMAN	bone morphogenetic protein/retinoic acid inducible neural-specific 3	704					cell cycle arrest (GO:0007050)|cellular response to retinoic acid (GO:0071300)|negative regulation of mitotic cell cycle (GO:0045930)|positive regulation of neuron differentiation (GO:0045666)	dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)											CTCTGATCTCTAGTAGTTGCA	0.478																																					p.L704L		Atlas-SNP	.											.	FAM5C	343	.	0			c.A2112T						.						105.0	102.0	103.0					1																	190067337		2203	4300	6503	SO:0001819	synonymous_variant	339479	exon8			GATCTCTAGTAGT	AB111893	CCDS1373.1	1q31.1	2013-09-18	2013-09-18	2013-09-18	ENSG00000162670	ENSG00000162670			22393	protein-coding gene	gene with protein product			"""family with sequence similarity 5, member C"""	FAM5C		16018821, 15193423	Standard	NM_199051		Approved	DBCCR1L, DBCCR1L1	uc001gse.1	Q76B58	OTTHUMG00000035533	ENST00000367462.3:c.2112A>T	chr1.hg19:g.190067337T>A		147.0	0.0		303.0	67.0	NM_199051	B3KVP1|B7Z260|O95726|Q2M330	Silent	SNP	ENST00000367462.3	hg19	CCDS1373.1																																																																																			.	.		0.478	BRINP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086278.1	NM_199051	
CAMSAP2	23271	hgsc.bcm.edu	37	1	200817745	200817745	+	Silent	SNP	A	A	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr1:200817745A>T	ENST00000236925.4	+	12	1930	c.1881A>T	c.(1879-1881)tcA>tcT	p.S627S	CAMSAP2_ENST00000413307.2_Silent_p.S600S|CAMSAP2_ENST00000358823.2_Silent_p.S616S			Q08AD1	CAMP2_HUMAN	calmodulin regulated spectrin-associated protein family, member 2	627					microtubule cytoskeleton organization (GO:0000226)|regulation of organelle organization (GO:0033043)	cytoplasm (GO:0005737)|microtubule minus-end (GO:0036449)	microtubule minus-end binding (GO:0051011)										ACGTTCCTTCAGAAGATATTC	0.378																																					p.S616S		Atlas-SNP	.											.	.	.	.	0			c.A1848T						.						113.0	109.0	110.0					1																	200817745		2203	4300	6503	SO:0001819	synonymous_variant	23271	exon11			TCCTTCAGAAGAT	AB029001	CCDS1404.1, CCDS72998.1, CCDS72999.1	1q32	2011-08-18	2011-08-18	2011-08-18	ENSG00000118200	ENSG00000118200			29188	protein-coding gene	gene with protein product		613775	"""calmodulin regulated spectrin-associated protein 1-like 1"""	CAMSAP1L1		15897902, 19508979	Standard	XM_005245040		Approved	KIAA1078	uc001gvk.3	Q08AD1	OTTHUMG00000035740	ENST00000236925.4:c.1881A>T	chr1.hg19:g.200817745A>T		80.0	0.0		219.0	42.0	NM_203459	B1APG6|Q08AD2|Q6PGN8|Q96FB3|Q9UG20|Q9UPS4	Silent	SNP	ENST00000236925.4	hg19																																																																																				.	.		0.378	CAMSAP2-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000086956.2	NM_203459	
SYT2	127833	hgsc.bcm.edu	37	1	202571584	202571584	+	Silent	SNP	A	A	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr1:202571584A>T	ENST00000367267.1	-	5	747	c.555T>A	c.(553-555)ccT>ccA	p.P185P	RP11-569A11.1_ENST00000428573.1_RNA|SYT2_ENST00000367268.4_Silent_p.P185P	NM_001136504.1	NP_001129976.1	Q8N9I0	SYT2_HUMAN	synaptotagmin II	185	C2 1. {ECO:0000255|PROSITE- ProRule:PRU00041}.|Phospholipid binding. {ECO:0000250}.				neurotransmitter secretion (GO:0007269)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|endocytic vesicle membrane (GO:0030666)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|transporter activity (GO:0005215)			NS(1)|breast(4)|endometrium(3)|kidney(1)|large_intestine(5)|liver(1)|lung(9)|ovary(2)|skin(2)|urinary_tract(1)	29			BRCA - Breast invasive adenocarcinoma(75;0.169)		Botulinum Toxin Type B(DB00042)	TCTTCTTGTCAGGAAGGAGGA	0.527																																					p.P185P		Atlas-SNP	.											.	SYT2	51	.	0			c.T555A						.						128.0	119.0	122.0					1																	202571584		2203	4300	6503	SO:0001819	synonymous_variant	127833	exon5			CTTGTCAGGAAGG	AK090672	CCDS1427.1	1q32.1	2013-01-21			ENSG00000143858	ENSG00000143858		"""Synaptotagmins"""	11510	protein-coding gene	gene with protein product		600104				7749232	Standard	NM_177402		Approved		uc010pqb.2	Q8N9I0	OTTHUMG00000041388	ENST00000367267.1:c.555T>A	chr1.hg19:g.202571584A>T		77.0	0.0		132.0	99.0	NM_177402	Q496K5|Q8NBE5	Silent	SNP	ENST00000367267.1	hg19	CCDS1427.1																																																																																			.	.		0.527	SYT2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000099157.1	NM_177402	
FMOD	2331	hgsc.bcm.edu	37	1	203316593	203316593	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr1:203316593T>C	ENST00000354955.4	-	2	1269	c.806A>G	c.(805-807)aAg>aGg	p.K269R	FMOD_ENST00000493296.1_Intron	NM_002023.4	NP_002014.2	Q06828	FMOD_HUMAN	fibromodulin	269					carbohydrate metabolic process (GO:0005975)|extracellular matrix organization (GO:0030198)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|small molecule metabolic process (GO:0044281)|transforming growth factor beta receptor complex assembly (GO:0007181)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|proteinaceous extracellular matrix (GO:0005578)				breast(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(4)|ovary(2)|prostate(2)|upper_aerodigestive_tract(2)	17			BRCA - Breast invasive adenocarcinoma(75;0.171)			ATACAGCAGCTTGGGCGCCCC	0.577																																					p.K269R		Atlas-SNP	.											.	FMOD	49	.	0			c.A806G						.						114.0	112.0	112.0					1																	203316593		2203	4300	6503	SO:0001583	missense	2331	exon2			AGCAGCTTGGGCG	U05291	CCDS30976.1	1q32	2008-02-05			ENSG00000122176	ENSG00000122176		"""Proteoglycans / Extracellular Matrix : Small leucine-rich repeats"""	3774	protein-coding gene	gene with protein product	"""fibromodulin proteoglycan"""	600245				7851907	Standard	NM_002023		Approved	SLRR2E	uc001gzr.3	Q06828	OTTHUMG00000035910	ENST00000354955.4:c.806A>G	chr1.hg19:g.203316593T>C	ENSP00000347041:p.Lys269Arg	111.0	0.0		183.0	36.0	NM_002023	Q15331|Q8IV47	Missense_Mutation	SNP	ENST00000354955.4	hg19	CCDS30976.1	.	.	.	.	.	.	.	.	.	.	T	13.10	2.137207	0.37728	.	.	ENSG00000122176	ENST00000435105;ENST00000354955	T	0.58060	0.36	5.18	5.18	0.71444	.	0.153803	0.64402	D	0.000020	T	0.32556	0.0833	N	0.12569	0.235	0.39072	D	0.960734	B	0.14012	0.009	B	0.17098	0.017	T	0.19877	-1.0292	10	0.36615	T	0.2	-17.7863	8.5622	0.33518	0.0:0.0867:0.0:0.9133	.	269	Q06828	FMOD_HUMAN	R	256;269	ENSP00000347041:K269R	ENSP00000347041:K269R	K	-	2	0	FMOD	201583216	1.000000	0.71417	1.000000	0.80357	0.937000	0.57800	3.269000	0.51592	1.956000	0.56807	0.533000	0.62120	AAG	.	.		0.577	FMOD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087472.1	NM_002023	
AVPR1B	553	hgsc.bcm.edu	37	1	206230897	206230897	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr1:206230897C>A	ENST00000367126.4	+	2	1495	c.1030C>A	c.(1030-1032)Cac>Aac	p.H344N		NM_000707.3	NP_000698.1	P47901	V1BR_HUMAN	arginine vasopressin receptor 1B	344					activation of phospholipase C activity (GO:0007202)|G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of systemic arterial blood pressure by vasopressin (GO:0001992)	endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	protein kinase C binding (GO:0005080)|vasopressin receptor activity (GO:0005000)			breast(1)|cervix(1)|endometrium(1)|large_intestine(5)|lung(6)|ovary(3)|prostate(1)|skin(2)	20			BRCA - Breast invasive adenocarcinoma(75;0.0312)		Desmopressin(DB00035)|Terlipressin(DB02638)|Vasopressin(DB00067)	CTTCAACAGCCACCTGTTACC	0.617																																					p.H344N		Atlas-SNP	.											.	AVPR1B	47	.	0			c.C1030A						.						49.0	43.0	45.0					1																	206230897		2203	4300	6503	SO:0001583	missense	553	exon2			AACAGCCACCTGT	D31833	CCDS73015.1	1q32	2014-05-06			ENSG00000198049	ENSG00000198049		"""GPCR / Class A : Vasopressin and oxytocin receptors"""	896	protein-coding gene	gene with protein product		600264		AVPR3		7929452, 8586456	Standard	NM_000707		Approved		uc001hds.2	P47901	OTTHUMG00000184377	ENST00000367126.4:c.1030C>A	chr1.hg19:g.206230897C>A	ENSP00000356094:p.His344Asn	138.0	0.0		257.0	72.0	NM_000707	B0M0J6|Q5TZ00	Missense_Mutation	SNP	ENST00000367126.4	hg19	CCDS30994.1	.	.	.	.	.	.	.	.	.	.	C	18.08	3.543997	0.65198	.	.	ENSG00000198049	ENST00000367126	T	0.35236	1.32	5.6	4.49	0.54785	.	0.528955	0.18918	N	0.127567	T	0.36635	0.0974	L	0.50333	1.59	0.31581	N	0.655118	B	0.24483	0.104	B	0.32805	0.153	T	0.35251	-0.9796	10	0.28530	T	0.3	-31.0318	14.3043	0.66375	0.0:0.9132:0.0:0.0868	.	344	P47901	V1BR_HUMAN	N	344	ENSP00000356094:H344N	ENSP00000356094:H344N	H	+	1	0	AVPR1B	204397520	1.000000	0.71417	1.000000	0.80357	0.947000	0.59692	4.727000	0.61993	2.632000	0.89209	0.563000	0.77884	CAC	.	.		0.617	AVPR1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087996.1	NM_000707	
CR2	1380	hgsc.bcm.edu	37	1	207646133	207646133	+	Silent	SNP	A	A	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr1:207646133A>T	ENST00000367058.3	+	10	1776	c.1587A>T	c.(1585-1587)ccA>ccT	p.P529P	CR2_ENST00000458541.2_Missense_Mutation_p.T504S|CR2_ENST00000367059.3_Silent_p.P529P|CR2_ENST00000367057.3_Silent_p.P529P	NM_001877.4	NP_001868.2	P20023	CR2_HUMAN	complement component (3d/Epstein Barr virus) receptor 2	529	Sushi 9. {ECO:0000255|PROSITE- ProRule:PRU00302}.				B cell differentiation (GO:0030183)|B cell proliferation (GO:0042100)|complement activation, classical pathway (GO:0006958)|immune response (GO:0006955)|innate immune response (GO:0045087)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	complement binding (GO:0001848)|complement receptor activity (GO:0004875)|DNA binding (GO:0003677)|protein homodimerization activity (GO:0042803)|transmembrane signaling receptor activity (GO:0004888)			NS(2)|breast(3)|endometrium(4)|kidney(3)|large_intestine(12)|lung(26)|ovary(1)|pancreas(1)|prostate(1)|skin(12)|upper_aerodigestive_tract(3)|urinary_tract(1)	69						CCTGCCCACCACCCCCTGTTA	0.448																																					p.P529P		Atlas-SNP	.											.	CR2	164	.	0			c.A1587T						.						76.0	78.0	78.0					1																	207646133		2203	4300	6503	SO:0001819	synonymous_variant	1380	exon10			CCCACCACCCCCT	M26004	CCDS1478.1, CCDS31007.1	1q32	2014-09-17			ENSG00000117322	ENSG00000117322		"""CD molecules"", ""Complement system"""	2336	protein-coding gene	gene with protein product		120650					Standard	NM_001006658		Approved	CD21	uc001hfv.3	P20023	OTTHUMG00000036307	ENST00000367058.3:c.1587A>T	chr1.hg19:g.207646133A>T		89.0	0.0		135.0	38.0	NM_001006658	C9JHD2|Q13866|Q14212|Q53EL2|Q5BKT9|Q5SR46|Q5SR48	Silent	SNP	ENST00000367058.3	hg19	CCDS1478.1	.	.	.	.	.	.	.	.	.	.	A	6.234	0.411297	0.11812	.	.	ENSG00000117322	ENST00000458541	T	0.31510	1.49	5.75	0.449	0.16619	.	.	.	.	.	T	0.08537	0.0212	.	.	.	0.09310	N	0.999994	.	.	.	.	.	.	T	0.34403	-0.9830	6	0.02654	T	1	.	1.9435	0.03352	0.5071:0.1422:0.0773:0.2734	.	.	.	.	S	504	ENSP00000404222:T504S	ENSP00000404222:T504S	T	+	1	0	CR2	205712756	0.834000	0.29399	1.000000	0.80357	0.987000	0.75469	-0.180000	0.09754	0.095000	0.17434	0.533000	0.62120	ACC	.	.		0.448	CR2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000088274.1	NM_001877	
LAMB3	3914	hgsc.bcm.edu	37	1	209789949	209789949	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr1:209789949T>A	ENST00000356082.4	-	22	3383	c.3249A>T	c.(3247-3249)caA>caT	p.Q1083H	LAMB3_ENST00000391911.1_Missense_Mutation_p.Q1083H|LAMB3_ENST00000367030.3_Missense_Mutation_p.Q1083H	NM_000228.2	NP_000219.2	Q13751	LAMB3_HUMAN	laminin, beta 3	1083	Domain I.				brown fat cell differentiation (GO:0050873)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|endodermal cell differentiation (GO:0035987)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	extracellular region (GO:0005576)|laminin-5 complex (GO:0005610)	structural molecule activity (GO:0005198)			NS(1)|breast(3)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(11)|lung(13)|ovary(1)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	45				OV - Ovarian serous cystadenocarcinoma(81;0.0519)		CAGCATACTTTTGTTTTATTC	0.478																																					p.Q1083H		Atlas-SNP	.											.	LAMB3	136	.	0			c.A3249T						.						101.0	97.0	99.0					1																	209789949		2203	4300	6503	SO:0001583	missense	3914	exon22			ATACTTTTGTTTT	D37766	CCDS1487.1	1q32	2013-03-01	2002-08-29		ENSG00000196878	ENSG00000196878		"""Laminins"""	6490	protein-coding gene	gene with protein product		150310	"""laminin, beta 3 (nicein (125kD), kalinin (140kD), BM600 (125kD))"""	LAMNB1		8088808, 7774918	Standard	NM_001127641		Approved	nicein-125kDa, kalinin-140kDa, BM600-125kDa	uc001hhh.3	Q13751	OTTHUMG00000036360	ENST00000356082.4:c.3249A>T	chr1.hg19:g.209789949T>A	ENSP00000348384:p.Gln1083His	205.0	0.0		281.0	50.0	NM_000228	D3DT88|O14947|Q14733|Q9UJK4|Q9UJL1	Missense_Mutation	SNP	ENST00000356082.4	hg19	CCDS1487.1	.	.	.	.	.	.	.	.	.	.	T	11.90	1.777043	0.31411	.	.	ENSG00000196878	ENST00000391911;ENST00000356082;ENST00000367030;ENST00000455193	T;T;T;T	0.65364	1.97;1.97;1.97;-0.15	4.43	0.632	0.17705	.	0.769070	0.11789	U	0.529406	T	0.42131	0.1189	L	0.29908	0.895	0.20764	N	0.999859	P	0.48162	0.906	B	0.38500	0.275	T	0.26985	-1.0087	10	0.45353	T	0.12	.	4.1608	0.10282	0.0:0.1933:0.1757:0.6309	.	1083	Q13751	LAMB3_HUMAN	H	1083;1083;1083;152	ENSP00000375778:Q1083H;ENSP00000348384:Q1083H;ENSP00000355997:Q1083H;ENSP00000398683:Q152H	ENSP00000348384:Q1083H	Q	-	3	2	LAMB3	207856572	0.997000	0.39634	0.133000	0.22050	0.624000	0.37722	0.177000	0.16801	-0.150000	0.11195	-0.486000	0.04755	CAA	.	.		0.478	LAMB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088525.2	NM_000228	
DIEXF	27042	hgsc.bcm.edu	37	1	210015611	210015611	+	Splice_Site	SNP	A	A	G			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr1:210015611A>G	ENST00000491415.2	+	9	1544	c.1487A>G	c.(1486-1488)cAt>cGt	p.H496R		NM_014388.6	NP_055203.4	Q68CQ4	DIEXF_HUMAN	digestive organ expansion factor homolog (zebrafish)	496					multicellular organismal development (GO:0007275)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(6)|central_nervous_system(2)|cervix(2)|endometrium(2)|kidney(15)|large_intestine(7)|lung(12)|ovary(1)|skin(3)|stomach(1)|urinary_tract(2)	53						CACTCAAAGCATTTGATGAAT	0.408																																					p.H496R		Atlas-SNP	.											.	DIEXF	97	.	0			c.A1487G						.						79.0	71.0	74.0					1																	210015611		2203	4300	6503	SO:0001630	splice_region_variant	27042	exon9			CAAAGCATTTGAT	BC022964	CCDS1493.1	1q32.2	2011-08-12	2011-02-16	2011-02-16	ENSG00000117597	ENSG00000117597			28440	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 107"""	C1orf107		16322560	Standard	NM_014388		Approved	MGC29875, DEF, UTP25	uc001hhr.2	Q68CQ4	OTTHUMG00000036654	ENST00000491415.2:c.1486-1A>G	chr1.hg19:g.210015611A>G		93.0	0.0		162.0	44.0	NM_014388	O75992|Q4VY00|Q63HL9	Missense_Mutation	SNP	ENST00000491415.2	hg19	CCDS1493.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	23.7|23.7	4.442049|4.442049	0.83993|0.83993	.|.	.|.	ENSG00000117597|ENSG00000117597	ENST00000491415|ENST00000457820	T|.	0.38240|.	1.15|.	6.17|6.17	5.03|5.03	0.67393|0.67393	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.71558|0.71558	0.3354|0.3354	M|M	0.70595|0.70595	2.14|2.14	0.80722|0.80722	D|D	1|1	D|.	0.89917|.	1.0|.	D|.	0.97110|.	1.0|.	T|T	0.70699|0.70699	-0.4800|-0.4800	10|5	0.31617|.	T|.	0.26|.	-19.2524|-19.2524	12.8532|12.8532	0.57869|0.57869	0.8777:0.0:0.0:0.1223|0.8777:0.0:0.0:0.1223	.|.	496|.	Q68CQ4|.	DIEXF_HUMAN|.	R|V	496|177	ENSP00000419005:H496R|.	ENSP00000419005:H496R|.	H|I	+|+	2|1	0|0	DIEXF|DIEXF	208082234|208082234	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.989000|0.989000	0.77384|0.77384	9.125000|9.125000	0.94402|0.94402	1.126000|1.126000	0.42016|0.42016	0.533000|0.533000	0.62120|0.62120	CAT|ATT	.	.		0.408	DIEXF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089127.2	NM_014388	Missense_Mutation
KCNH1	3756	hgsc.bcm.edu	37	1	211192594	211192594	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr1:211192594A>T	ENST00000271751.4	-	6	590	c.563T>A	c.(562-564)cTa>cAa	p.L188Q	KCNH1_ENST00000367007.4_Missense_Mutation_p.L188Q			O95259	KCNH1_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 1	188					myoblast fusion (GO:0007520)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	nucleus (GO:0005634)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|phosphorelay sensor kinase activity (GO:0000155)	p.L188P(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(13)|lung(35)|ovary(4)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	68				OV - Ovarian serous cystadenocarcinoma(81;0.0109)|all cancers(67;0.141)|Epithelial(68;0.185)		GCCCAGCTGTAGGACCTGTAC	0.428																																					p.L188Q		Atlas-SNP	.											KCNH1,NS,carcinoma,0,1	KCNH1	199	.	1	Substitution - Missense(1)	lung(1)	c.T563A						.						46.0	51.0	49.0					1																	211192594		2197	4281	6478	SO:0001583	missense	3756	exon6			AGCTGTAGGACCT	AJ001366	CCDS1496.1, CCDS31015.1	1q32.2	2012-07-05			ENSG00000143473	ENSG00000143473		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6250	protein-coding gene	gene with protein product		603305				9738473, 16382104	Standard	NM_172362		Approved	Kv10.1, eag, h-eag, eag1	uc001hib.2	O95259	OTTHUMG00000036309	ENST00000271751.4:c.563T>A	chr1.hg19:g.211192594A>T	ENSP00000271751:p.Leu188Gln	25.0	0.0		58.0	29.0	NM_172362	B1AQ26|O76035|Q14CL3	Missense_Mutation	SNP	ENST00000271751.4	hg19	CCDS1496.1	.	.	.	.	.	.	.	.	.	.	A	18.72	3.684531	0.68157	.	.	ENSG00000143473	ENST00000271751;ENST00000367007	D;D	0.99113	-5.44;-5.42	5.0	5.0	0.66597	.	0.000000	0.64402	D	0.000001	D	0.99202	0.9723	M	0.83483	2.645	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.72338	0.943;0.977	D	0.99342	1.0912	10	0.87932	D	0	.	13.8759	0.63653	1.0:0.0:0.0:0.0	.	188;188	Q14CL3;O95259	.;KCNH1_HUMAN	Q	188	ENSP00000271751:L188Q;ENSP00000355974:L188Q	ENSP00000271751:L188Q	L	-	2	0	KCNH1	209259217	0.999000	0.42202	0.998000	0.56505	0.946000	0.59487	8.924000	0.92827	1.885000	0.54596	0.379000	0.24179	CTA	.	.		0.428	KCNH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088332.1	NM_002238	
SLC30A1	7779	hgsc.bcm.edu	37	1	211751602	211751602	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr1:211751602C>A	ENST00000367001.4	-	1	482	c.353G>T	c.(352-354)gGg>gTg	p.G118V		NM_021194.2	NP_067017.2	Q9Y6M5	ZNT1_HUMAN	solute carrier family 30 (zinc transporter), member 1	118					cadmium ion transmembrane transport (GO:0070574)|calcium ion import (GO:0070509)|cellular calcium ion homeostasis (GO:0006874)|cellular zinc ion homeostasis (GO:0006882)|detoxification of cadmium ion (GO:0071585)|in utero embryonic development (GO:0001701)|negative regulation of calcium ion import (GO:0090281)|negative regulation of neurotransmitter secretion (GO:0046929)|negative regulation of zinc ion transmembrane import (GO:0071584)|transmembrane transport (GO:0055085)|zinc ion transport (GO:0006829)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear membrane (GO:0031965)|plasma membrane (GO:0005886)|T-tubule (GO:0030315)	calcium channel inhibitor activity (GO:0019855)|zinc ion transmembrane transporter activity (GO:0005385)			central_nervous_system(1)|endometrium(1)|large_intestine(3)|liver(1)|lung(1)|ovary(3)|prostate(1)	11				OV - Ovarian serous cystadenocarcinoma(81;0.00535)|GBM - Glioblastoma multiforme(131;0.051)|all cancers(67;0.0604)|Epithelial(68;0.0978)		CACGCCGACCCCAAGGACCAC	0.667																																					p.G118V		Atlas-SNP	.											.	SLC30A1	27	.	0			c.G353T						.						14.0	18.0	16.0					1																	211751602		2199	4292	6491	SO:0001583	missense	7779	exon1			CCGACCCCAAGGA	AF323590	CCDS1499.1	1q32.3	2013-05-22			ENSG00000170385	ENSG00000170385		"""Solute carriers"""	11012	protein-coding gene	gene with protein product		609521		ZNT1			Standard	NM_021194		Approved	ZRC1	uc001hio.1	Q9Y6M5	OTTHUMG00000036995	ENST00000367001.4:c.353G>T	chr1.hg19:g.211751602C>A	ENSP00000355968:p.Gly118Val	105.0	0.0		205.0	43.0	NM_021194	Q0VAK9|Q9BZF6	Missense_Mutation	SNP	ENST00000367001.4	hg19	CCDS1499.1	.	.	.	.	.	.	.	.	.	.	C	5.555	0.287263	0.10513	.	.	ENSG00000170385	ENST00000367001	T	0.64085	-0.08	4.13	-1.49	0.08718	.	0.462385	0.23928	N	0.043162	T	0.38295	0.1035	N	0.11818	0.18	0.80722	D	1	B	0.30870	0.298	B	0.40410	0.328	T	0.07290	-1.0780	10	0.12103	T	0.63	-0.0011	4.2683	0.10775	0.109:0.3585:0.3871:0.1454	.	118	Q9Y6M5	ZNT1_HUMAN	V	118	ENSP00000355968:G118V	ENSP00000355968:G118V	G	-	2	0	SLC30A1	209818225	1.000000	0.71417	0.197000	0.23402	0.954000	0.61252	2.028000	0.41088	-0.534000	0.06315	-0.519000	0.04390	GGG	.	.		0.667	SLC30A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000104738.2		
SPATA45	149643	hgsc.bcm.edu	37	1	213009317	213009317	+	Missense_Mutation	SNP	T	T	G	rs372469118		TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr1:213009317T>G	ENST00000332912.3	-	2	282	c.175A>C	c.(175-177)Act>Cct	p.T59P		NM_001024601.2	NP_001019772.1	Q537H7	SPT45_HUMAN		59										kidney(1)|large_intestine(1)|lung(1)	3						GTGGTATCAGTAAAGGACTGA	0.478																																					p.T59P		Atlas-SNP	.											.	C1orf227	9	.	0			c.A175C						.						154.0	144.0	147.0					1																	213009317		2203	4297	6500	SO:0001583	missense	149643	exon2			TATCAGTAAAGGA																												ENST00000332912.3:c.175A>C	chr1.hg19:g.213009317T>G	ENSP00000419160:p.Thr59Pro	204.0	1.0		302.0	213.0	NM_001024601		Missense_Mutation	SNP	ENST00000332912.3	hg19	CCDS31020.1	.	.	.	.	.	.	.	.	.	.	T	14.55	2.569324	0.45798	.	.	ENSG00000185523	ENST00000332912	T	0.48522	0.81	4.71	-9.43	0.00607	.	2.280910	0.01531	N	0.018794	T	0.28001	0.0690	.	.	.	0.09310	N	1	B	0.09022	0.002	B	0.08055	0.003	T	0.13737	-1.0498	9	0.54805	T	0.06	3.0238	2.9603	0.05890	0.1029:0.3381:0.3126:0.2465	.	59	Q537H7	CA227_HUMAN	P	59	ENSP00000419160:T59P	ENSP00000419160:T59P	T	-	1	0	C1orf227	211075940	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.248000	0.08854	-1.987000	0.00982	-0.297000	0.09499	ACT	.	.		0.478	C1orf227-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089672.2		
DNAH14	127602	hgsc.bcm.edu	37	1	225270296	225270296	+	Intron	SNP	C	C	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr1:225270296C>T	ENST00000445597.2	+	15	2938				DNAH14_ENST00000439375.2_Missense_Mutation_p.T1061I|DNAH14_ENST00000430092.1_Missense_Mutation_p.T1061I			Q0VDD8	DYH14_HUMAN	dynein, axonemal, heavy chain 14						microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			NS(2)|breast(3)|central_nervous_system(3)|endometrium(8)|kidney(4)|large_intestine(2)|lung(2)|skin(2)|stomach(1)	27						CAAGTGGTAACAGAGTTTAAA	0.383																																					p.T1061I		Atlas-SNP	.											.	DNAH14	300	.	0			c.C3182T						.						66.0	60.0	61.0					1																	225270296		692	1591	2283	SO:0001627	intron_variant	127602	exon20			TGGTAACAGAGTT	U61741	CCDS41472.1, CCDS44322.1	1q42.13	2009-02-12	2006-09-04		ENSG00000185842	ENSG00000185842		"""Axonemal dyneins"""	2945	protein-coding gene	gene with protein product		603341	"""dynein, axonemal, heavy polypeptide 14"", ""chromosome 1 open reading frame 67"""	C1orf67		8812413	Standard	NM_144989		Approved	Dnahc14, HL-18, HL18, DKFZp781B1548, MGC27277	uc001how.2	Q0VDD8	OTTHUMG00000037447	ENST00000445597.2:c.2938+1846C>T	chr1.hg19:g.225270296C>T		261.0	0.0		462.0	102.0	NM_001373	A6NG62|A6NNL2|Q0VDD9|Q4VXC7|Q4VXG4|Q4VXG5|Q5VU33|Q5VU34	Missense_Mutation	SNP	ENST00000445597.2	hg19		.	.	.	.	.	.	.	.	.	.	C	11.05	1.524837	0.27299	.	.	ENSG00000185842	ENST00000430092;ENST00000439375;ENST00000328556	T;T;T	0.61392	0.11;0.11;0.11	5.31	-2.21	0.06973	.	.	.	.	.	T	0.36744	0.0978	N	0.22421	0.69	0.80722	D	1	B	0.11235	0.004	B	0.12156	0.007	T	0.07520	-1.0768	9	0.59425	D	0.04	.	5.6572	0.17648	0.1521:0.2203:0.0:0.6276	.	1061	Q0VDD8-4	.	I	1061;1061;139	ENSP00000414402:T1061I;ENSP00000392061:T1061I;ENSP00000332424:T139I	ENSP00000332424:T139I	T	+	2	0	DNAH14	223336919	0.010000	0.17322	0.755000	0.31263	0.477000	0.33069	-0.269000	0.08596	-0.252000	0.09528	0.603000	0.83216	ACA	.	.		0.383	DNAH14-007	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000331217.3	XM_059166	
OBSCN	84033	hgsc.bcm.edu	37	1	228462464	228462464	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr1:228462464G>T	ENST00000422127.1	+	20	5919	c.5875G>T	c.(5875-5877)Gac>Tac	p.D1959Y	RP5-1139B12.3_ENST00000602529.1_RNA|OBSCN_ENST00000570156.2_Missense_Mutation_p.D2334Y|RP5-1139B12.2_ENST00000602517.1_RNA|OBSCN_ENST00000359599.6_Missense_Mutation_p.D806Y|RP5-1139B12.3_ENST00000602947.1_RNA|OBSCN_ENST00000284548.11_Missense_Mutation_p.D1959Y|OBSCN_ENST00000366709.4_5'UTR|OBSCN_ENST00000366707.4_5'UTR	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	1959	Ig-like 19.				apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				GACCATCTCAGACCTGGTGCT	0.647																																					p.D2334Y		Atlas-SNP	.											.	OBSCN	2142	.	0			c.G7000T						.						26.0	35.0	32.0					1																	228462464		2128	4249	6377	SO:0001583	missense	84033	exon24			ATCTCAGACCTGG	AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.5875G>T	chr1.hg19:g.228462464G>T	ENSP00000409493:p.Asp1959Tyr	73.0	0.0		96.0	16.0	NM_001271223	Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Missense_Mutation	SNP	ENST00000422127.1	hg19	CCDS58065.1	.	.	.	.	.	.	.	.	.	.	G	8.989	0.977320	0.18812	.	.	ENSG00000154358	ENST00000284548;ENST00000422127;ENST00000359599	T;T;T	0.78126	0.86;0.86;-1.15	5.71	-6.2	0.02072	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.994904	0.08163	N	0.988239	T	0.78723	0.4328	M	0.67625	2.065	0.09310	N	0.999992	P;D	0.57257	0.56;0.979	B;P	0.53809	0.249;0.735	T	0.74954	-0.3488	10	0.62326	D	0.03	.	8.7186	0.34428	0.5091:0.0:0.3954:0.0955	.	1959;1959	Q5VST9;Q5VST9-3	OBSCN_HUMAN;.	Y	1959;1959;806	ENSP00000284548:D1959Y;ENSP00000409493:D1959Y;ENSP00000352613:D806Y	ENSP00000284548:D1959Y	D	+	1	0	OBSCN	226529087	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.811000	0.04500	-1.489000	0.01844	-0.263000	0.10527	GAC	.	.		0.647	OBSCN-204	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_052843	
OBSCN	84033	hgsc.bcm.edu	37	1	228559946	228559946	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr1:228559946A>T	ENST00000422127.1	+	94	21511	c.21467A>T	c.(21466-21468)gAg>gTg	p.E7156V	OBSCN_ENST00000570156.2_Missense_Mutation_p.E8113V|OBSCN_ENST00000366707.4_Missense_Mutation_p.E4790V	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	7156					apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				CAGGAGGCTGAGGATCTGTCC	0.682																																					p.E8113V		Atlas-SNP	.											.	OBSCN	2142	.	0			c.A24338T						.						12.0	13.0	13.0					1																	228559946		2044	4175	6219	SO:0001583	missense	84033	exon105			AGGCTGAGGATCT	AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.21467A>T	chr1.hg19:g.228559946A>T	ENSP00000409493:p.Glu7156Val	113.0	0.0		192.0	39.0	NM_001271223	Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Missense_Mutation	SNP	ENST00000422127.1	hg19	CCDS58065.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	17.28|17.28	3.348535|3.348535	0.61183|0.61183	.|.	.|.	ENSG00000154358|ENSG00000154358	ENST00000422127;ENST00000366707|ENST00000441106	T;T|.	0.64618|.	-0.11;-0.03|.	4.31|4.31	-6.08|-6.08	0.02151|0.02151	.|.	.|.	.|.	.|.	.|.	T|.	0.24122|.	0.0584|.	N|N	0.24115|0.24115	0.695|0.695	0.09310|0.09310	N|N	1|1	B|.	0.23128|.	0.08|.	B|.	0.19946|.	0.027|.	T|.	0.32640|.	-0.9899|.	9|.	0.29301|.	T|.	0.29|.	.|.	6.7903|6.7903	0.23695|0.23695	0.2233:0.3033:0.4734:0.0|0.2233:0.3033:0.4734:0.0	.|.	7156|.	Q5VST9|.	OBSCN_HUMAN|.	V|C	7156;4790|1772	ENSP00000409493:E7156V;ENSP00000355668:E4790V|.	ENSP00000355668:E4790V|.	E|X	+|+	2|3	0|0	OBSCN|OBSCN	226626569|226626569	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.000000|0.000000	0.00434|0.00434	0.018000|0.018000	0.13422|0.13422	-0.910000|-0.910000	0.03847|0.03847	-1.255000|-1.255000	0.01485|0.01485	GAG|TGA	.	.		0.682	OBSCN-204	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_052843	
TSNAX	7257	hgsc.bcm.edu	37	1	231700443	231700443	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr1:231700443G>T	ENST00000366639.4	+	6	823	c.665G>T	c.(664-666)cGt>cTt	p.R222L	TSNAX-DISC1_ENST00000602962.1_Intron	NM_005999.2	NP_005990.1	Q99598	TSNAX_HUMAN	translin-associated factor X	222					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|protein transport (GO:0015031)|spermatogenesis (GO:0007283)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|protein transporter activity (GO:0008565)|sequence-specific DNA binding (GO:0043565)			endometrium(1)|kidney(1)|large_intestine(2)|lung(5)	9		all_cancers(173;0.0395)|Acute lymphoblastic leukemia(190;3.76e-06)|Prostate(94;0.116)				CAGTTTTTACGTCAGGTTTAT	0.438																																					p.R222L		Atlas-SNP	.											.	TSNAX	14	.	0			c.G665T						.						217.0	204.0	209.0					1																	231700443		2203	4300	6503	SO:0001583	missense	7257	exon6			TTTTACGTCAGGT	X95073	CCDS1596.1	1q42.2	2008-02-05			ENSG00000116918	ENSG00000116918			12380	protein-coding gene	gene with protein product		602964				9013868	Standard	NM_005999		Approved	TRAX	uc001huw.3	Q99598	OTTHUMG00000039486	ENST00000366639.4:c.665G>T	chr1.hg19:g.231700443G>T	ENSP00000355599:p.Arg222Leu	237.0	0.0		359.0	240.0	NM_005999	B1APC6	Missense_Mutation	SNP	ENST00000366639.4	hg19	CCDS1596.1	.	.	.	.	.	.	.	.	.	.	G	34	5.330927	0.95733	.	.	ENSG00000116918	ENST00000366639	.	.	.	5.77	5.77	0.91146	Translin, C-terminal (1);	0.094954	0.85682	D	0.000000	D	0.86573	0.5965	M	0.91920	3.255	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.87894	0.2686	9	0.62326	D	0.03	.	20.3485	0.98803	0.0:0.0:1.0:0.0	.	222	Q99598	TSNAX_HUMAN	L	222	.	ENSP00000355599:R222L	R	+	2	0	TSNAX	229767066	1.000000	0.71417	0.997000	0.53966	0.997000	0.91878	9.316000	0.96319	2.885000	0.99019	0.650000	0.86243	CGT	.	.		0.438	TSNAX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095267.2	NM_005999	
DISC1	27185	hgsc.bcm.edu	37	1	231829654	231829654	+	De_novo_Start_OutOfFrame	SNP	A	A	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr1:231829654A>T	ENST00000366637.3	+	0	203				TSNAX-DISC1_ENST00000602962.1_3'UTR|DISC1_ENST00000602873.1_Intron|DISC1_ENST00000366633.3_Silent_p.T50T|DISC1_ENST00000535983.1_Silent_p.T50T|DISC1_ENST00000537876.1_Silent_p.T50T|DISC1_ENST00000439617.2_Silent_p.T50T|DISC1_ENST00000317586.4_Silent_p.T50T|DISC1_ENST00000602281.1_Silent_p.T50T|DISC1_ENST00000366636.4_Silent_p.T50T|DISC1_ENST00000539444.1_Silent_p.T50T	NM_001012957.1	NP_001012975.1	Q9NRI5	DISC1_HUMAN	disrupted in schizophrenia 1						canonical Wnt signaling pathway (GO:0060070)|cell proliferation in forebrain (GO:0021846)|cellular protein localization (GO:0034613)|cerebral cortex radially oriented cell migration (GO:0021799)|microtubule cytoskeleton organization (GO:0000226)|mitochondrial calcium ion homeostasis (GO:0051560)|neuron migration (GO:0001764)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of neuron projection development (GO:0010975)|regulation of synapse maturation (GO:0090128)|TOR signaling (GO:0031929)	cell junction (GO:0030054)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|microtubule (GO:0005874)|mitochondrion (GO:0005739)|postsynaptic membrane (GO:0045211)				breast(1)|cervix(1)|kidney(1)|large_intestine(1)|liver(2)|lung(6)|skin(2)|upper_aerodigestive_tract(1)	15		all_cancers(173;0.0208)|Prostate(94;0.0975)				GAAGCTCGACAGGGCCTGGGA	0.637																																					p.T50T		Atlas-SNP	.											.	DISC1	207	.	0			c.A150T						.						46.0	46.0	46.0					1																	231829654		2203	4300	6503			27185	exon2			CTCGACAGGGCCT	AF222980	CCDS31055.1, CCDS31056.1, CCDS53482.1, CCDS53483.1, CCDS53484.1, CCDS59205.1, CCDS59206.1, CCDS59207.1	1q42.1	2008-02-05			ENSG00000162946	ENSG00000162946			2888	protein-coding gene	gene with protein product		605210				10814723	Standard	NM_001164550		Approved		uc010pxh.2	Q9NRI5	OTTHUMG00000037835	ENST00000366637.3:c.-1855A>T	chr1.hg19:g.231829654A>T		93.0	0.0		134.0	25.0	NM_001164541	A6NLH2|C4P091|C4P095|C4P0A1|C4P0A3|C4P0B3|C4P0B6|C4P0C1|C9J6D0|O75045|Q5VT44|Q5VT45|Q8IXJ0|Q8IXJ1|Q9BX19|Q9NRI3|Q9NRI4	Silent	SNP	ENST00000366637.3	hg19																																																																																				.	.		0.637	DISC1-002	KNOWN	non_canonical_conserved|basic	protein_coding	protein_coding	OTTHUMT00000092352.2	NM_018662	
C1orf101	257044	hgsc.bcm.edu	37	1	244681971	244681971	+	Silent	SNP	T	T	G			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr1:244681971T>G	ENST00000366534.4	+	8	561	c.507T>G	c.(505-507)gtT>gtG	p.V169V	C1orf101_ENST00000473875.1_Intron|C1orf101_ENST00000366531.3_Silent_p.V18V|C1orf101_ENST00000366533.4_Silent_p.V169V	NM_001130957.1	NP_001124429.1	Q5SY80	CA101_HUMAN	chromosome 1 open reading frame 101	169						CatSper complex (GO:0036128)				NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(8)|ovary(1)|prostate(2)|skin(2)|urinary_tract(3)	36	all_cancers(71;2.99e-05)|all_epithelial(71;0.00015)|all_neural(11;0.0269)|Breast(184;0.0654)|Glioma(6;0.0724)|Ovarian(71;0.0761)|all_lung(81;0.0874)|Lung NSC(105;0.121)		all cancers(7;1.22e-05)|OV - Ovarian serous cystadenocarcinoma(106;0.001)|GBM - Glioblastoma multiforme(7;0.0154)			AGAGAAAAGTTTATTCTTCAA	0.289																																					p.V169V		Atlas-SNP	.											.	C1orf101	158	.	0			c.T507G						.						45.0	51.0	49.0					1																	244681971		2197	4295	6492	SO:0001819	synonymous_variant	257044	exon8			AAAAGTTTATTCT	BC032859	CCDS1625.1, CCDS44340.1, CCDS55693.1	1q44	2012-12-20			ENSG00000179397	ENSG00000179397			28491	protein-coding gene	gene with protein product						12477932	Standard	NM_173807		Approved	MGC33370	uc001iam.3	Q5SY80	OTTHUMG00000040103	ENST00000366534.4:c.507T>G	chr1.hg19:g.244681971T>G		387.0	0.0		623.0	137.0	NM_173807	B4DZR4|B7Z7X5|E9PEA3|Q8IYZ6	Silent	SNP	ENST00000366534.4	hg19	CCDS44340.1																																																																																			.	.		0.289	C1orf101-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096701.1	NM_173807	
OR2G3	81469	hgsc.bcm.edu	37	1	247769234	247769234	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr1:247769234C>A	ENST00000320002.2	+	1	379	c.347C>A	c.(346-348)gCt>gAt	p.A116D	RP11-978I15.10_ENST00000435333.1_RNA|RNU6-691P_ENST00000516585.1_RNA|RP11-978I15.10_ENST00000446347.1_RNA	NM_001001914.1	NP_001001914.1	Q8NGZ4	OR2G3_HUMAN	olfactory receptor, family 2, subfamily G, member 3	116						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(2)|liver(1)|lung(31)|skin(5)	50	all_cancers(71;3.24e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)		OV - Ovarian serous cystadenocarcinoma(106;0.017)			ATCCTCTTGGCTGACATGGCC	0.498																																					p.A116D		Atlas-SNP	.											.	OR2G3	108	.	0			c.C347A						.						255.0	224.0	235.0					1																	247769234		2203	4300	6503	SO:0001583	missense	81469	exon1			TCTTGGCTGACAT	BK004417	CCDS31093.1	1q44	2012-08-09			ENSG00000177476	ENSG00000177476		"""GPCR / Class A : Olfactory receptors"""	15008	protein-coding gene	gene with protein product							Standard	NM_001001914		Approved		uc010pyz.2	Q8NGZ4	OTTHUMG00000040576	ENST00000320002.2:c.347C>A	chr1.hg19:g.247769234C>A	ENSP00000326301:p.Ala116Asp	186.0	1.0		288.0	202.0	NM_001001914	B2RN64|Q5JQT1|Q6IF45	Missense_Mutation	SNP	ENST00000320002.2	hg19	CCDS31093.1	.	.	.	.	.	.	.	.	.	.	C	21.9	4.215100	0.79352	.	.	ENSG00000177476	ENST00000320002	T	0.02067	4.47	3.8	2.88	0.33553	GPCR, rhodopsin-like superfamily (1);	0.207947	0.22925	U	0.053964	T	0.16938	0.0407	H	0.98701	4.305	0.30885	N	0.730952	P	0.50369	0.934	P	0.55455	0.776	T	0.32134	-0.9918	10	0.87932	D	0	.	9.3439	0.38096	0.0:0.8908:0.0:0.1092	.	116	Q8NGZ4	OR2G3_HUMAN	D	116	ENSP00000326301:A116D	ENSP00000326301:A116D	A	+	2	0	OR2G3	245835857	0.003000	0.15002	0.965000	0.40720	0.936000	0.57629	1.559000	0.36320	0.940000	0.37473	0.492000	0.49549	GCT	.	.		0.498	OR2G3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097624.1		
OR2M3	127062	hgsc.bcm.edu	37	1	248366439	248366439	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr1:248366439C>T	ENST00000456743.1	+	1	108	c.70C>T	c.(70-72)Cac>Tac	p.H24Y		NM_001004689.1	NP_001004689.1	Q8NG83	OR2M3_HUMAN	olfactory receptor, family 2, subfamily M, member 3	24						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(6)|large_intestine(4)|lung(33)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	50	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0245)			CAGCCCCACCCACACCTTCCT	0.498																																					p.H24Y		Atlas-SNP	.											.	OR2M3	116	.	0			c.C70T						.						203.0	209.0	207.0					1																	248366439		2203	4300	6503	SO:0001583	missense	127062	exon1			CCCACCCACACCT		CCDS31107.1	1q44	2012-08-09		2004-03-10	ENSG00000228198	ENSG00000228198		"""GPCR / Class A : Olfactory receptors"""	8269	protein-coding gene	gene with protein product				OR2M6, OR2M3P			Standard	NM_001004689		Approved	OST003	uc010pzg.2	Q8NG83	OTTHUMG00000040459	ENST00000456743.1:c.70C>T	chr1.hg19:g.248366439C>T	ENSP00000389625:p.His24Tyr	339.0	0.0		563.0	114.0	NM_001004689	B9EH06|Q6IEY0	Missense_Mutation	SNP	ENST00000456743.1	hg19	CCDS31107.1	.	.	.	.	.	.	.	.	.	.	C	15.60	2.882650	0.51908	.	.	ENSG00000228198	ENST00000456743	T	0.00333	8.07	2.61	1.66	0.24008	.	0.000000	0.33401	U	0.004945	T	0.00328	0.0010	M	0.63428	1.95	0.09310	N	1	P	0.43857	0.819	P	0.46543	0.52	T	0.46020	-0.9221	10	0.59425	D	0.04	.	5.3991	0.16286	0.201:0.6769:0.0:0.1221	.	24	Q8NG83	OR2M3_HUMAN	Y	24	ENSP00000389625:H24Y	ENSP00000389625:H24Y	H	+	1	0	OR2M3	246433062	0.021000	0.18746	0.007000	0.13788	0.701000	0.40568	1.557000	0.36299	1.475000	0.48197	0.398000	0.26397	CAC	.	.		0.498	OR2M3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097355.1	NM_001004689	
OR2G6	391211	hgsc.bcm.edu	37	1	248685871	248685871	+	Silent	SNP	T	T	C			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr1:248685871T>C	ENST00000343414.4	+	1	956	c.924T>C	c.(922-924)agT>agC	p.S308S		NM_001013355.1	NP_001013373.1	Q5TZ20	OR2G6_HUMAN	olfactory receptor, family 2, subfamily G, member 6	308						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|cervix(1)|endometrium(2)|large_intestine(7)|lung(40)|ovary(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	61	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)	all_cancers(173;0.0156)	OV - Ovarian serous cystadenocarcinoma(106;0.0265)			TACTGGGTAGTGCTGCTGGAC	0.473																																					p.S308S		Atlas-SNP	.											.	OR2G6	124	.	0			c.T924C						.						41.0	40.0	40.0					1																	248685871		2203	4297	6500	SO:0001819	synonymous_variant	391211	exon1			GGGTAGTGCTGCT		CCDS31119.1	1q44	2012-08-09			ENSG00000188558	ENSG00000188558		"""GPCR / Class A : Olfactory receptors"""	27019	protein-coding gene	gene with protein product							Standard	NM_001013355		Approved		uc001ien.1	Q5TZ20	OTTHUMG00000040462	ENST00000343414.4:c.924T>C	chr1.hg19:g.248685871T>C		37.0	0.0		74.0	8.0	NM_001013355	B2RP33	Silent	SNP	ENST00000343414.4	hg19	CCDS31119.1																																																																																			.	.		0.473	OR2G6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097358.1	XM_372842	
MYT1L	23040	hgsc.bcm.edu	37	2	1983303	1983303	+	Nonsense_Mutation	SNP	C	C	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr2:1983303C>A	ENST00000399161.2	-	7	826	c.79G>T	c.(79-81)Gag>Tag	p.E27*	MYT1L_ENST00000428368.2_Nonsense_Mutation_p.E27*	NM_015025.2	NP_055840.2	Q9UL68	MYT1L_HUMAN	myelin transcription factor 1-like	27					cell differentiation (GO:0030154)|nervous system development (GO:0007399)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(6)|large_intestine(16)|lung(50)|ovary(5)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	97	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.037)|all_epithelial(98;0.241)		OV - Ovarian serous cystadenocarcinoma(76;0.169)|all cancers(51;0.244)		CTGAACAGCTCTTGTATGGCT	0.453																																					p.E27X		Atlas-SNP	.											.	MYT1L	241	.	0			c.G79T						.						95.0	98.0	97.0					2																	1983303		1919	4132	6051	SO:0001587	stop_gained	23040	exon7			ACAGCTCTTGTAT	AF036943	CCDS46222.1	2p25.3	2013-01-10			ENSG00000186487	ENSG00000186487		"""Zinc fingers, C2HC-type containing"""	7623	protein-coding gene	gene with protein product	"""neural zinc finger transcription factor 1"""	613084				9373037	Standard	XM_006711862		Approved	KIAA1106, NZF1, ZC2HC4B	uc002qxd.3	Q9UL68	OTTHUMG00000151407	ENST00000399161.2:c.79G>T	chr2.hg19:g.1983303C>A	ENSP00000382114:p.Glu27*	141.0	0.0		92.0	32.0	NM_015025	A7E2C7|B2RP54|Q6IQ17|Q9UPP6	Nonsense_Mutation	SNP	ENST00000399161.2	hg19		.	.	.	.	.	.	.	.	.	.	C	45	12.005629	0.99626	.	.	ENSG00000186487	ENST00000399161;ENST00000295067;ENST00000428368	.	.	.	5.38	5.38	0.77491	.	0.000000	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-42.2395	19.143	0.93452	0.0:1.0:0.0:0.0	.	.	.	.	X	27	.	ENSP00000295067:E27X	E	-	1	0	MYT1L	1962310	1.000000	0.71417	0.998000	0.56505	0.993000	0.82548	6.422000	0.73357	2.515000	0.84797	0.655000	0.94253	GAG	.	.		0.453	MYT1L-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000322493.1	NM_015025	
OSR1	130497	hgsc.bcm.edu	37	2	19552136	19552136	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr2:19552136T>C	ENST00000272223.2	-	3	1045	c.701A>G	c.(700-702)cAa>cGa	p.Q234R	OSR1_ENST00000536433.1_Missense_Mutation_p.Q234R	NM_145260.2	NP_660303.1	Q8TAX0	OSR1_HUMAN	odd-skipped related transciption factor 1	234					cell differentiation (GO:0030154)|cell proliferation involved in kidney development (GO:0072111)|cellular response to retinoic acid (GO:0071300)|chondrocyte differentiation (GO:0002062)|embryonic digit morphogenesis (GO:0042733)|embryonic forelimb morphogenesis (GO:0035115)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic skeletal joint development (GO:0072498)|embryonic skeletal joint morphogenesis (GO:0060272)|embryonic skeletal limb joint morphogenesis (GO:0036023)|gonad development (GO:0008406)|heart development (GO:0007507)|intermediate mesoderm development (GO:0048389)|mesangial cell development (GO:0072143)|mesonephric duct morphogenesis (GO:0072180)|mesonephros development (GO:0001823)|metanephric cap mesenchymal cell proliferation involved in metanephros development (GO:0090094)|metanephric epithelium development (GO:0072207)|metanephric glomerulus vasculature development (GO:0072239)|metanephric interstitial fibroblast development (GO:0072259)|metanephric mesenchymal cell differentiation (GO:0072162)|metanephric mesenchyme development (GO:0072075)|metanephric mesenchyme morphogenesis (GO:0072133)|metanephric nephron tubule development (GO:0072234)|metanephric smooth muscle tissue development (GO:0072208)|middle ear morphogenesis (GO:0042474)|negative regulation of apoptotic process (GO:0043066)|negative regulation of epithelial cell differentiation (GO:0030857)|negative regulation of nephron tubule epithelial cell differentiation (GO:0072183)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|odontogenesis (GO:0042476)|palate development (GO:0060021)|pattern specification involved in metanephros development (GO:0072268)|positive regulation of bone mineralization (GO:0030501)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of gastrulation (GO:2000543)|positive regulation of gene expression (GO:0010628)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|posterior mesonephric tubule development (GO:0072166)|pronephros development (GO:0048793)|renal vesicle progenitor cell differentiation (GO:0072184)|specification of anterior mesonephric tubule identity (GO:0072168)|specification of posterior mesonephric tubule identity (GO:0072169)|stem cell differentiation (GO:0048863)|transcription, DNA-templated (GO:0006351)|ureter urothelium development (GO:0072190)|ureteric bud development (GO:0001657)|urogenital system development (GO:0001655)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			breast(1)|large_intestine(2)|lung(4)|ovary(1)	8	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.197)	Acute lymphoblastic leukemia(84;0.221)				CCCACACTCTTGACACTTGAA	0.453																																					p.Q234R		Atlas-SNP	.											.	OSR1	29	.	0			c.A701G						.						148.0	133.0	138.0					2																	19552136		2203	4300	6503	SO:0001583	missense	130497	exon3			CACTCTTGACACT	BC025712	CCDS1694.1	2p24.1	2013-10-17	2013-10-17	2004-11-26	ENSG00000143867	ENSG00000143867		"""Zinc fingers, C2H2-type"""	8111	protein-coding gene	gene with protein product		608891	"""odd-skipped (Drosophila) homolog"", ""odd-skipped related 1 (Drosophila)"""	ODD		2120051, 12119563	Standard	XM_006711942		Approved		uc002rdc.3	Q8TAX0	OTTHUMG00000088793	ENST00000272223.2:c.701A>G	chr2.hg19:g.19552136T>C	ENSP00000272223:p.Gln234Arg	108.0	0.0		115.0	48.0	NM_145260	B3KV97|D6W521	Missense_Mutation	SNP	ENST00000272223.2	hg19	CCDS1694.1	.	.	.	.	.	.	.	.	.	.	T	16.04	3.009850	0.54361	.	.	ENSG00000143867	ENST00000272223;ENST00000536433	T;T	0.03580	3.88;3.88	5.01	3.82	0.43975	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.054217	0.85682	D	0.000000	T	0.03053	0.0090	N	0.20986	0.625	0.45822	D	0.998693	B	0.14805	0.011	B	0.21360	0.034	T	0.50259	-0.8849	9	.	.	.	-10.781	10.7208	0.46040	0.143:0.0:0.0:0.857	.	234	Q8TAX0	OSR1_HUMAN	R	234	ENSP00000272223:Q234R;ENSP00000441801:Q234R	.	Q	-	2	0	OSR1	19415617	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.819000	0.86621	0.879000	0.35944	0.459000	0.35465	CAA	.	.		0.453	OSR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000201432.2	NM_145260	
APOB	338	hgsc.bcm.edu	37	2	21229513	21229513	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr2:21229513A>T	ENST00000233242.1	-	26	10354	c.10227T>A	c.(10225-10227)agT>agA	p.S3409R		NM_000384.2	NP_000375	P04114	APOB_HUMAN	apolipoprotein B	3409	Heparin-binding.				artery morphogenesis (GO:0048844)|blood coagulation (GO:0007596)|cellular response to prostaglandin stimulus (GO:0071379)|cellular response to tumor necrosis factor (GO:0071356)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle remodeling (GO:0034374)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol biosynthetic process (GO:0045540)|response to carbohydrate (GO:0009743)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to virus (GO:0009615)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|triglyceride catabolic process (GO:0019433)|triglyceride mobilization (GO:0006642)|very-low-density lipoprotein particle assembly (GO:0034379)	actin cytoskeleton (GO:0015629)|chylomicron (GO:0042627)|chylomicron remnant (GO:0034360)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome lumen (GO:0031904)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate-density lipoprotein particle (GO:0034363)|intracellular membrane-bounded organelle (GO:0043231)|low-density lipoprotein particle (GO:0034362)|mature chylomicron (GO:0034359)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|lipase binding (GO:0035473)|low-density lipoprotein particle receptor binding (GO:0050750)|phospholipid binding (GO:0005543)			NS(5)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(19)|kidney(10)|large_intestine(63)|liver(5)|lung(125)|ovary(16)|pancreas(1)|prostate(5)|skin(31)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(6)	305	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TACTGTTATGACTACCCTCCA	0.413																																					p.S3409R		Atlas-SNP	.											.	APOB	761	.	0			c.T10227A						.						167.0	165.0	166.0					2																	21229513		2203	4300	6503	SO:0001583	missense	338	exon26			GTTATGACTACCC	M14162	CCDS1703.1	2p24-p23	2013-05-29	2013-05-29		ENSG00000084674	ENSG00000084674		"""Apolipoproteins"""	603	protein-coding gene	gene with protein product		107730	"""apolipoprotein B (including Ag(x) antigen)"""				Standard	NM_000384		Approved		uc002red.3	P04114	OTTHUMG00000090785	ENST00000233242.1:c.10227T>A	chr2.hg19:g.21229513A>T	ENSP00000233242:p.Ser3409Arg	103.0	0.0		109.0	48.0	NM_000384	O00502|P78479|P78480|P78481|Q13779|Q13785|Q13786|Q13787|Q13788|Q4ZG63|Q53QC8|Q7Z600|Q9UMN0	Missense_Mutation	SNP	ENST00000233242.1	hg19	CCDS1703.1	.	.	.	.	.	.	.	.	.	.	A	11.30	1.597645	0.28445	.	.	ENSG00000084674	ENST00000233242;ENST00000535079	T	0.38077	1.16	5.74	-0.997	0.10215	.	0.459902	0.21925	N	0.067102	T	0.32704	0.0838	M	0.85041	2.73	0.80722	D	1	P	0.37548	0.599	B	0.35607	0.206	T	0.17258	-1.0375	10	0.72032	D	0.01	.	0.8145	0.01100	0.3343:0.1458:0.301:0.2189	.	3409	P04114	APOB_HUMAN	R	3409	ENSP00000233242:S3409R	ENSP00000233242:S3409R	S	-	3	2	APOB	21083018	0.000000	0.05858	0.972000	0.41901	0.164000	0.22412	-0.225000	0.09151	-0.172000	0.10779	0.533000	0.62120	AGT	.	.		0.413	APOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207571.1		
KLHL29	114818	hgsc.bcm.edu	37	2	23918605	23918605	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr2:23918605T>A	ENST00000486442.1	+	9	2372	c.1655T>A	c.(1654-1656)cTg>cAg	p.L552Q		NM_052920.1	NP_443152.1	Q96CT2	KLH29_HUMAN	kelch-like family member 29	552										breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|lung(1)|ovary(3)	10						TGCCGGGACCTGGTGAACGAG	0.627																																					p.L552Q		Atlas-SNP	.											.	KLHL29	47	.	0			c.T1655A						.						43.0	43.0	43.0					2																	23918605		692	1591	2283	SO:0001583	missense	114818	exon9			GGGACCTGGTGAA		CCDS54335.1	2p23.3	2013-09-27	2013-02-22	2007-01-09	ENSG00000119771	ENSG00000119771		"""Kelch-like"", ""BTB/POZ domain containing"""	29404	protein-coding gene	gene with protein product			"""kelch repeat and BTB (POZ) domain containing 9"", ""kelch-like 29 (Drosophila)"""	KBTBD9		11572484	Standard	NM_052920		Approved	KIAA1921	uc010ykg.2	Q96CT2	OTTHUMG00000151899	ENST00000486442.1:c.1655T>A	chr2.hg19:g.23918605T>A	ENSP00000420659:p.Leu552Gln	93.0	0.0		64.0	21.0	NM_052920	Q8N388|Q96BF0|Q96PW7	Missense_Mutation	SNP	ENST00000486442.1	hg19	CCDS54335.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	22.1|22.1	4.240900|4.240900	0.79912|0.79912	.|.	.|.	ENSG00000119771|ENSG00000119771	ENST00000486442|ENST00000288548	T|.	0.74421|.	-0.84|.	4.43|4.43	4.43|4.43	0.53597|0.53597	.|.	0.160717|.	0.43110|.	D|.	0.000608|.	T|T	0.77685|0.77685	0.4167|0.4167	M|M	0.85945|0.85945	2.785|2.785	0.80722|0.80722	D|D	1|1	D;P|.	0.54397|.	0.966;0.587|.	P;B|.	0.47470|.	0.548;0.225|.	T|T	0.80888|0.80888	-0.1181|-0.1181	10|5	0.87932|.	D|.	0|.	.|.	14.011|14.011	0.64495|0.64495	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	332;332|.	Q96CT2;Q96CT2-2|.	KLH29_HUMAN;.|.	Q|R	552|392	ENSP00000420659:L552Q|.	ENSP00000420659:L552Q|.	L|W	+|+	2|1	0|0	KLHL29|KLHL29	23772110|23772110	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.979000|0.979000	0.70002|0.70002	8.036000|8.036000	0.88901|0.88901	1.765000|1.765000	0.52091|0.52091	0.459000|0.459000	0.35465|0.35465	CTG|TGG	.	.		0.627	KLHL29-001	KNOWN	mRNA_start_NF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324315.3	NM_052920	
EMILIN1	11117	hgsc.bcm.edu	37	2	27302028	27302028	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr2:27302028A>G	ENST00000380320.4	+	1	594	c.95A>G	c.(94-96)tAc>tGc	p.Y32C		NM_007046.3	NP_008977	Q9Y6C2	EMIL1_HUMAN	elastin microfibril interfacer 1	32					cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)	collagen trimer (GO:0005581)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix constituent conferring elasticity (GO:0030023)			breast(1)|central_nervous_system(1)|kidney(5)|large_intestine(1)|lung(14)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)	26	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TTCAGCCTCTACACAGGTTCC	0.711																																					p.Y32C		Atlas-SNP	.											.	EMILIN1	75	.	0			c.A95G						.						9.0	12.0	11.0					2																	27302028		2168	4273	6441	SO:0001583	missense	11117	exon1			GCCTCTACACAGG	AF088916	CCDS1733.1	2p23.3-p23.2	2008-02-05			ENSG00000138080	ENSG00000138080		"""EMI domain containing"""	19880	protein-coding gene	gene with protein product		130660					Standard	NM_007046		Approved	DKFZp586M121, gp115	uc002rii.4	Q9Y6C2	OTTHUMG00000097069	ENST00000380320.4:c.95A>G	chr2.hg19:g.27302028A>G	ENSP00000369677:p.Tyr32Cys	70.0	0.0		47.0	16.0	NM_007046	A5PL03|H0Y7A0|Q53SY9|Q96G58|Q96IH6|Q9UG76	Missense_Mutation	SNP	ENST00000380320.4	hg19	CCDS1733.1	.	.	.	.	.	.	.	.	.	.	A	14.68	2.607597	0.46527	.	.	ENSG00000138080	ENST00000380320	T	0.64085	-0.08	4.59	4.59	0.56863	.	0.358564	0.23883	N	0.043637	T	0.67173	0.2865	L	0.29908	0.895	0.44155	D	0.996956	D	0.76494	0.999	D	0.79784	0.993	T	0.66826	-0.5825	10	0.41790	T	0.15	-10.918	12.2161	0.54406	1.0:0.0:0.0:0.0	.	32	Q9Y6C2	EMIL1_HUMAN	C	32	ENSP00000369677:Y32C	ENSP00000369677:Y32C	Y	+	2	0	EMILIN1	27155532	1.000000	0.71417	0.989000	0.46669	0.261000	0.26267	3.306000	0.51881	1.849000	0.53698	0.379000	0.24179	TAC	.	.		0.711	EMILIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214185.1	NM_007046	
WDR43	23160	hgsc.bcm.edu	37	2	29169340	29169340	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr2:29169340A>T	ENST00000407426.3	+	17	1885	c.1829A>T	c.(1828-1830)gAt>gTt	p.D610V		NM_015131.1	NP_055946.1	Q15061	WDR43_HUMAN	WD repeat domain 43	610						nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(3)|endometrium(2)|kidney(1)|large_intestine(3)|lung(9)|ovary(1)|prostate(1)	20	Acute lymphoblastic leukemia(172;0.155)					GAGTCTGATGATGAAATAGCA	0.403																																					p.D610V		Atlas-SNP	.											.	WDR43	38	.	0			c.A1829T						.						80.0	73.0	75.0					2																	29169340		1833	4082	5915	SO:0001583	missense	23160	exon17			CTGATGATGAAAT	D87716	CCDS46251.1	2p23.3	2013-01-09			ENSG00000163811	ENSG00000163811		"""WD repeat domain containing"""	28945	protein-coding gene	gene with protein product	"""UTP5, small subunit (SSU) processome component, homolog (yeast)"""					7584026, 7584028, 17699751	Standard	NM_015131		Approved	KIAA0007, NET12, UTP5	uc002rmo.2	Q15061	OTTHUMG00000152015	ENST00000407426.3:c.1829A>T	chr2.hg19:g.29169340A>T	ENSP00000384302:p.Asp610Val	120.0	0.0		126.0	44.0	NM_015131	Q15395|Q92577	Missense_Mutation	SNP	ENST00000407426.3	hg19	CCDS46251.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	10.11|10.11	1.261619|1.261619	0.23051|0.23051	.|.	.|.	ENSG00000163811|ENSG00000163811	ENST00000407426|ENST00000446643	T|.	0.05081|.	3.5|.	5.77|5.77	4.62|4.62	0.57501|0.57501	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.61949|0.61949	0.2388|0.2388	L|L	0.55481|0.55481	1.735|1.735	0.80722|0.80722	D|D	1|1	D|.	0.57899|.	0.981|.	P|.	0.49752|.	0.621|.	T|T	0.59150|0.59150	-0.7508|-0.7508	10|5	0.40728|.	T|.	0.16|.	-25.7841|-25.7841	11.7393|11.7393	0.51784|0.51784	0.9312:0.0:0.0688:0.0|0.9312:0.0:0.0688:0.0	.|.	610|.	Q15061|.	WDR43_HUMAN|.	V|L	610|162	ENSP00000384302:D610V|.	ENSP00000384302:D610V|.	D|M	+|+	2|1	0|0	WDR43|WDR43	29022844|29022844	1.000000|1.000000	0.71417|0.71417	0.999000|0.999000	0.59377|0.59377	0.104000|0.104000	0.19210|0.19210	6.249000|6.249000	0.72427|0.72427	1.123000|1.123000	0.41961|0.41961	0.533000|0.533000	0.62120|0.62120	GAT|ATG	.	.		0.403	WDR43-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324865.1	XM_087089	
QPCT	25797	hgsc.bcm.edu	37	2	37599570	37599570	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr2:37599570T>A	ENST00000338415.3	+	6	1053	c.895T>A	c.(895-897)Tat>Aat	p.Y299N	QPCT_ENST00000537448.1_Missense_Mutation_p.Y250N	NM_012413.3	NP_036545.1	Q16769	QPCT_HUMAN	glutaminyl-peptide cyclotransferase	299					cellular protein modification process (GO:0006464)|peptidyl-pyroglutamic acid biosynthetic process, using glutaminyl-peptide cyclotransferase (GO:0017186)	extracellular vesicular exosome (GO:0070062)	glutaminyl-peptide cyclotransferase activity (GO:0016603)|zinc ion binding (GO:0008270)			central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(3)|prostate(1)|stomach(2)	17		Ovarian(717;0.051)|all_hematologic(82;0.21)				GAATTACAGTTATGGAGGTGT	0.403																																					p.Y299N		Atlas-SNP	.											.	QPCT	34	.	0			c.T895A						.						181.0	177.0	178.0					2																	37599570		2203	4300	6503	SO:0001583	missense	25797	exon6			TACAGTTATGGAG	X71125	CCDS1790.1	2p22	2008-07-31	2008-07-31		ENSG00000115828	ENSG00000115828	2.3.2.5		9753	protein-coding gene	gene with protein product	"""glutaminyl cyclase"""	607065				7999256	Standard	NM_012413		Approved	QC, GCT	uc002rqg.3	Q16769	OTTHUMG00000100963	ENST00000338415.3:c.895T>A	chr2.hg19:g.37599570T>A	ENSP00000344829:p.Tyr299Asn	119.0	0.0		99.0	41.0	NM_012413	Q16770|Q3KRG6|Q53TR4	Missense_Mutation	SNP	ENST00000338415.3	hg19	CCDS1790.1	.	.	.	.	.	.	.	.	.	.	T	6.423	0.446177	0.12164	.	.	ENSG00000115828	ENST00000338415;ENST00000404976;ENST00000537448;ENST00000444022	T;T;T;T	0.47177	0.85;0.85;0.85;0.85	5.3	-0.053	0.13820	Peptidase M28 (1);	0.942842	0.09047	N	0.856433	T	0.28532	0.0706	L	0.31804	0.96	0.09310	N	1	B;B	0.12630	0.006;0.004	B;B	0.06405	0.002;0.002	T	0.21415	-1.0246	10	0.28530	T	0.3	-14.435	1.3634	0.02196	0.1854:0.3073:0.1135:0.3938	.	250;299	Q16769-2;Q16769	.;QPCT_HUMAN	N	299;250;250;64	ENSP00000344829:Y299N;ENSP00000385391:Y250N;ENSP00000441606:Y250N;ENSP00000389227:Y64N	ENSP00000344829:Y299N	Y	+	1	0	QPCT	37453074	0.000000	0.05858	0.001000	0.08648	0.596000	0.36781	-0.091000	0.11146	0.107000	0.17824	0.460000	0.39030	TAT	.	.		0.403	QPCT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000218572.2		
CAMKMT	79823	hgsc.bcm.edu	37	2	44933426	44933426	+	Splice_Site	SNP	G	G	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr2:44933426G>A	ENST00000378494.3	+	5	482	c.438G>A	c.(436-438)agG>agA	p.R146R		NM_024766.4	NP_079042.1	Q7Z624	CMKMT_HUMAN	calmodulin-lysine N-methyltransferase	146						Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	calmodulin-lysine N-methyltransferase activity (GO:0018025)			breast(2)|large_intestine(3)|lung(5)	10						TCTCTTTCAGGGCCCTTGCTG	0.438																																					p.R146R		Atlas-SNP	.											.	CAMKMT	20	.	0			c.G438A						.						161.0	145.0	150.0					2																	44933426		2203	4300	6503	SO:0001630	splice_region_variant	79823	exon5			TTTCAGGGCCCTT		CCDS1820.1	2p21	2011-06-22	2011-03-10	2011-03-10	ENSG00000143919	ENSG00000143919	2.1.1.60		26276	protein-coding gene	gene with protein product	"""CaM KMT"""	609559	"""chromosome 2 open reading frame 34"""	C2orf34		20975703	Standard	NM_024766		Approved	CLNMT	uc002rum.3	Q7Z624	OTTHUMG00000128761	ENST00000378494.3:c.438-1G>A	chr2.hg19:g.44933426G>A		94.0	0.0		90.0	40.0	NM_024766	Q4ZG15|Q53SS6|Q8N6P5|Q9H5G8	Silent	SNP	ENST00000378494.3	hg19	CCDS1820.1																																																																																			.	.		0.438	CAMKMT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250678.2	NM_024766	Silent
NRXN1	9378	hgsc.bcm.edu	37	2	50149221	50149221	+	Nonsense_Mutation	SNP	G	G	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr2:50149221G>T	ENST00000406316.2	-	22	5771	c.4295C>A	c.(4294-4296)tCa>tAa	p.S1432*	NRXN1_ENST00000406859.3_Nonsense_Mutation_p.S1432*|NRXN1_ENST00000401710.1_Nonsense_Mutation_p.S450*|NRXN1_ENST00000404971.1_Nonsense_Mutation_p.S1502*|NRXN1_ENST00000402717.3_Nonsense_Mutation_p.S1454*|NRXN1_ENST00000401669.2_Nonsense_Mutation_p.S1462*|NRXN1_ENST00000342183.5_Nonsense_Mutation_p.S397*|NRXN1_ENST00000405472.3_Nonsense_Mutation_p.S1454*	NM_004801.4	NP_004792.1	Q9ULB1	NRX1A_HUMAN	neurexin 1	1432					adult behavior (GO:0030534)|axon guidance (GO:0007411)|calcium-dependent cell-cell adhesion (GO:0016339)|cerebellar granule cell differentiation (GO:0021707)|establishment of protein localization (GO:0045184)|extracellular matrix organization (GO:0030198)|gamma-aminobutyric acid receptor clustering (GO:0097112)|gephyrin clustering (GO:0097116)|guanylate kinase-associated protein clustering (GO:0097117)|heterophilic cell-cell adhesion (GO:0007157)|learning (GO:0007612)|N-methyl-D-aspartate receptor clustering (GO:0097114)|negative regulation of filopodium assembly (GO:0051490)|neuroligin clustering (GO:0097118)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|neuron maturation (GO:0042551)|neurotransmitter secretion (GO:0007269)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|receptor localization to synapse (GO:0097120)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic vesicle clustering (GO:0097091)|vocal learning (GO:0042297)|vocalization behavior (GO:0071625)	axonal growth cone (GO:0044295)|cell junction (GO:0030054)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	acetylcholine receptor binding (GO:0033130)|calcium channel regulator activity (GO:0005246)|calcium ion binding (GO:0005509)|cell adhesion molecule binding (GO:0050839)|neuroligin family protein binding (GO:0097109)|receptor activity (GO:0004872)			breast(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(33)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	58		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)			CACATGGTATGAGCCTTCATC	0.517																																					p.S1502X		Atlas-SNP	.											NRXN1_ENST00000536085,NS,carcinoma,0,3	NRXN1	1118	.	0			c.C4505A						.						218.0	174.0	189.0					2																	50149221		2203	4300	6503	SO:0001587	stop_gained	9378	exon24			TGGTATGAGCCTT	AB011150	CCDS1845.1, CCDS46282.1, CCDS54360.1	2p16.3	2008-05-15			ENSG00000179915	ENSG00000179915			8008	protein-coding gene	gene with protein product		600565					Standard	NM_001135659		Approved	KIAA0578, Hs.22998	uc021vhj.1	P58400	OTTHUMG00000129263	ENST00000406316.2:c.4295C>A	chr2.hg19:g.50149221G>T	ENSP00000384311:p.Ser1432*	126.0	0.0		125.0	53.0	NM_001135659	A7KRL9|O60323|Q53TJ9|Q53TQ1|Q9C079|Q9C080|Q9C081|Q9H3M2|Q9UDM6	Nonsense_Mutation	SNP	ENST00000406316.2	hg19	CCDS54360.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	50|50	16.278780|16.278780	0.99859|0.99859	.|.	.|.	ENSG00000179915|ENSG00000179915	ENST00000412315|ENST00000342183;ENST00000536347;ENST00000401710;ENST00000404971;ENST00000406316;ENST00000405472;ENST00000401669;ENST00000536085;ENST00000402717;ENST00000406859	.|.	.|.	.|.	5.44|5.44	5.44|5.44	0.79542|0.79542	.|.	.|0.000000	.|0.48286	.|U	.|0.000185	T|.	0.47488|.	0.1448|.	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.34004|.	-0.9846|.	4|.	.|0.02654	.|T	.|1	.|.	19.4586|19.4586	0.94906|0.94906	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|.	.|.	.|.	N|X	165|397;351;450;1502;1432;1454;1462;1503;1454;1432	.|.	.|ENSP00000341184:S397X	H|S	-|-	1|2	0|0	NRXN1|NRXN1	50002725|50002725	1.000000|1.000000	0.71417|0.71417	0.966000|0.966000	0.40874|0.40874	0.997000|0.997000	0.91878|0.91878	9.657000|9.657000	0.98554|0.98554	2.828000|2.828000	0.97474|0.97474	0.655000|0.655000	0.94253|0.94253	CAT|TCA	.	.		0.517	NRXN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000325291.2		
CCT4	10575	hgsc.bcm.edu	37	2	62112155	62112155	+	Splice_Site	SNP	C	C	G			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr2:62112155C>G	ENST00000394440.3	-	2	476	c.180G>C	c.(178-180)atG>atC	p.M60I	CCT4_ENST00000544079.1_Splice_Site_p.M60I|AC107081.5_ENST00000425779.1_RNA|CCT4_ENST00000538252.1_Splice_Site_p.M4I|CCT4_ENST00000544185.1_5'UTR	NM_006430.3	NP_006421.2	P50991	TCPD_HUMAN	chaperonin containing TCP1, subunit 4 (delta)	60					'de novo' posttranslational protein folding (GO:0051084)|binding of sperm to zona pellucida (GO:0007339)|cellular protein metabolic process (GO:0044267)|protein folding (GO:0006457)	cell body (GO:0044297)|centrosome (GO:0005813)|chaperonin-containing T-complex (GO:0005832)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|nucleus (GO:0005634)|zona pellucida receptor complex (GO:0002199)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|unfolded protein binding (GO:0051082)			breast(1)|large_intestine(2)|lung(6)|ovary(2)	11	Lung NSC(7;0.035)|all_lung(7;0.0691)		LUSC - Lung squamous cell carcinoma(7;6.5e-06)|Epithelial(17;0.0647)|all cancers(80;0.221)			AACTCTTTACCATTTTATCCA	0.383																																					p.M60I		Atlas-SNP	.											.	CCT4	38	.	0			c.G180C						.						189.0	156.0	167.0					2																	62112155		2203	4300	6503	SO:0001630	splice_region_variant	10575	exon2			CTTTACCATTTTA		CCDS33206.1, CCDS58711.1	2p15	2011-09-02			ENSG00000115484	ENSG00000115484		"""Heat Shock Proteins / Chaperonins"""	1617	protein-coding gene	gene with protein product		605142				9819444	Standard	NM_001256721		Approved	Cctd	uc002sbo.4	P50991	OTTHUMG00000152166	ENST00000394440.3:c.180+1G>C	chr2.hg19:g.62112155C>G		124.0	0.0		105.0	51.0	NM_001256721	B2R6I3|B7Z8B1|F5H5W3|O14870|Q53QP9|Q96C51	Missense_Mutation	SNP	ENST00000394440.3	hg19	CCDS33206.1	.	.	.	.	.	.	.	.	.	.	C	27.1	4.799156	0.90538	.	.	ENSG00000115484	ENST00000394440;ENST00000544079;ENST00000538252	T;T;T	0.81247	-1.47;2.69;-1.47	4.62	4.62	0.57501	Chaperonin TCP-1, conserved site (1);	0.000000	0.85682	D	0.000000	D	0.88618	0.6485	M	0.72479	2.2	0.80722	D	1	D;D	0.89917	0.991;1.0	P;D	0.73708	0.853;0.981	D	0.88771	0.3264	9	.	.	.	-20.7995	17.451	0.87592	0.0:1.0:0.0:0.0	.	60;60	F5H5W3;P50991	.;TCPD_HUMAN	I	60;60;4	ENSP00000377958:M60I;ENSP00000443061:M60I;ENSP00000442174:M4I	.	M	-	3	0	CCT4	61965659	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	7.620000	0.83070	2.241000	0.73720	0.655000	0.94253	ATG	.	.		0.383	CCT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325548.2		Missense_Mutation
RAB11FIP5	26056	hgsc.bcm.edu	37	2	73315575	73315575	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr2:73315575T>C	ENST00000258098.6	-	3	1411	c.1171A>G	c.(1171-1173)Agt>Ggt	p.S391G	RAB11FIP5_ENST00000493523.2_5'UTR	NM_015470.2	NP_056285.1	Q9BXF6	RFIP5_HUMAN	RAB11 family interacting protein 5 (class I)	391					cellular response to acidic pH (GO:0071468)|insulin secretion involved in cellular response to glucose stimulus (GO:0035773)|protein transport (GO:0015031)|regulated secretory pathway (GO:0045055)|regulation of protein localization to cell surface (GO:2000008)	early endosome (GO:0005769)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|microtubule organizing center (GO:0005815)|mitochondrial outer membrane (GO:0005741)|recycling endosome (GO:0055037)|secretory granule (GO:0030141)	gamma-tubulin binding (GO:0043015)			biliary_tract(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(9)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	23						TTGCTACGACTGCCTCTGGGC	0.627																																					p.S391G		Atlas-SNP	.											.	RAB11FIP5	66	.	0			c.A1171G						.						46.0	49.0	48.0					2																	73315575		2203	4300	6503	SO:0001583	missense	26056	exon3			TACGACTGCCTCT	AF334812	CCDS1923.1	2p13	2008-02-05			ENSG00000135631	ENSG00000135631			24845	protein-coding gene	gene with protein product		605536				10048485, 11163216	Standard	NM_015470		Approved	GAF1, KIAA0857, RIP11, pp75	uc002sis.4	Q9BXF6	OTTHUMG00000129779	ENST00000258098.6:c.1171A>G	chr2.hg19:g.73315575T>C	ENSP00000258098:p.Ser391Gly	39.0	0.0		39.0	15.0	NM_015470	O94939|Q9P0M1	Missense_Mutation	SNP	ENST00000258098.6	hg19	CCDS1923.1	.	.	.	.	.	.	.	.	.	.	T	3.840	-0.034038	0.07543	.	.	ENSG00000135631	ENST00000258098	T	0.48522	0.81	3.66	1.26	0.21427	.	0.409242	0.25598	N	0.029578	T	0.34542	0.0901	L	0.47716	1.5	0.09310	N	0.999996	B;B	0.23591	0.0;0.088	B;B	0.22880	0.0;0.042	T	0.17107	-1.0380	10	0.26408	T	0.33	-3.8624	6.981	0.24704	0.0:0.303:0.0:0.697	.	391;391	Q9BXF6;Q2Z1P3	RFIP5_HUMAN;.	G	391	ENSP00000258098:S391G	ENSP00000258098:S391G	S	-	1	0	RAB11FIP5	73169083	0.006000	0.16342	0.766000	0.31476	0.280000	0.26924	0.419000	0.21247	0.269000	0.21961	-0.464000	0.05259	AGT	.	.		0.627	RAB11FIP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251995.1	NM_015470	
SEMA4F	10505	hgsc.bcm.edu	37	2	74883712	74883712	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr2:74883712C>A	ENST00000357877.2	+	2	346	c.197C>A	c.(196-198)tCt>tAt	p.S66Y	SEMA4F_ENST00000339773.5_Missense_Mutation_p.S66Y	NM_004263.3	NP_004254.2	O95754	SEM4F_HUMAN	sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4F	66	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon guidance (GO:0007411)|cell-cell signaling (GO:0007267)|negative regulation of axon extension (GO:0030517)|nervous system development (GO:0007399)|retinal ganglion cell axon guidance (GO:0031290)	endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	receptor activity (GO:0004872)			biliary_tract(1)|breast(2)|endometrium(8)|kidney(3)|large_intestine(9)|lung(14)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(2)	45						TACAATTACTCTGTTCTCCTT	0.562																																					p.S66Y		Atlas-SNP	.											.	SEMA4F	89	.	0			c.C197A						.						134.0	120.0	125.0					2																	74883712		2203	4300	6503	SO:0001583	missense	10505	exon2			ATTACTCTGTTCT	AF038652	CCDS1955.1, CCDS62942.1, CCDS74529.1	2p13.1	2008-05-21			ENSG00000135622	ENSG00000135622		"""Semaphorins"""	10734	protein-coding gene	gene with protein product	"""m-Sema M"""	603706		SEMAM		10051670	Standard	NM_004263		Approved	SEMAW	uc002sna.2	O95754	OTTHUMG00000129952	ENST00000357877.2:c.197C>A	chr2.hg19:g.74883712C>A	ENSP00000350547:p.Ser66Tyr	148.0	0.0		119.0	52.0	NM_001271662	Q542Y7|Q9NS35	Missense_Mutation	SNP	ENST00000357877.2	hg19	CCDS1955.1	.	.	.	.	.	.	.	.	.	.	C	20.2	3.950111	0.73787	.	.	ENSG00000135622	ENST00000357877;ENST00000339773;ENST00000434486;ENST00000453930	T;T;T;T	0.11604	2.76;2.76;2.76;2.76	4.9	4.9	0.64082	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	0.538685	0.19128	N	0.122017	T	0.30324	0.0761	M	0.68317	2.08	0.26711	N	0.970979	D;D;P;D	0.76494	0.999;0.999;0.693;0.987	D;D;P;D	0.74348	0.983;0.979;0.588;0.954	T	0.02885	-1.1098	10	0.72032	D	0.01	.	13.5155	0.61539	0.0:1.0:0.0:0.0	.	66;66;66;66	B7Z931;C9K0A1;O95754-2;O95754	.;.;.;SEM4F_HUMAN	Y	66	ENSP00000350547:S66Y;ENSP00000342675:S66Y;ENSP00000407698:S66Y;ENSP00000409141:S66Y	ENSP00000342675:S66Y	S	+	2	0	SEMA4F	74737220	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	3.347000	0.52200	2.568000	0.86640	0.650000	0.86243	TCT	.	.		0.562	SEMA4F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252214.2	NM_004263	
VWA3B	200403	hgsc.bcm.edu	37	2	98797635	98797635	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr2:98797635T>C	ENST00000477737.1	+	9	1475	c.1271T>C	c.(1270-1272)aTa>aCa	p.I424T	VWA3B_ENST00000451075.2_Missense_Mutation_p.I274T|VWA3B_ENST00000435344.1_Missense_Mutation_p.I424T	NM_144992.4	NP_659429.4	Q502W6	VWA3B_HUMAN	von Willebrand factor A domain containing 3B	424										NS(3)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(10)|lung(33)|ovary(3)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	70						GTTGTGGATATAAAAGCCAAA	0.562																																					p.I424T		Atlas-SNP	.											.	VWA3B	138	.	0			c.T1271C						.						106.0	110.0	109.0					2																	98797635		2045	4197	6242	SO:0001583	missense	200403	exon9			TGGATATAAAAGC	AL832761	CCDS42718.1	2q11.2	2008-02-05			ENSG00000168658	ENSG00000168658			28385	protein-coding gene	gene with protein product						12477932	Standard	NM_144992		Approved	DKFZp686F2227, MGC26733	uc002syo.3	Q502W6	OTTHUMG00000153104	ENST00000477737.1:c.1271T>C	chr2.hg19:g.98797635T>C	ENSP00000417955:p.Ile424Thr	196.0	0.0		125.0	48.0	NM_144992	B9EK71|Q86T73|Q8N2D0|Q8N770|Q8NA79|Q8ND63|Q8ND65|Q8WW02	Missense_Mutation	SNP	ENST00000477737.1	hg19	CCDS42718.1	.	.	.	.	.	.	.	.	.	.	T	11.99	1.804736	0.31961	.	.	ENSG00000168658	ENST00000435344;ENST00000477737;ENST00000451075	T;T;T	0.29142	1.58;2.9;2.33	5.31	5.31	0.75309	.	0.087235	0.48286	D	0.000196	T	0.32496	0.0831	L	0.48642	1.525	0.24157	N	0.99567	P;P;P	0.51449	0.595;0.945;0.776	B;B;B	0.44044	0.192;0.439;0.36	T	0.29579	-1.0007	10	0.72032	D	0.01	.	14.5317	0.67931	0.0:0.0:0.0:1.0	.	274;424;424	B7Z7Q7;Q502W6;Q502W6-8	.;VWA3B_HUMAN;.	T	424;424;274	ENSP00000401959:I424T;ENSP00000417955:I424T;ENSP00000389463:I274T	ENSP00000388158:I424T	I	+	2	0	VWA3B	98164067	1.000000	0.71417	1.000000	0.80357	0.126000	0.20510	5.416000	0.66417	2.136000	0.66102	0.477000	0.44152	ATA	.	.		0.562	VWA3B-020	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353469.2	NM_144992	
IL18RAP	8807	hgsc.bcm.edu	37	2	103040730	103040730	+	Missense_Mutation	SNP	A	A	T	rs138125296		TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr2:103040730A>T	ENST00000264260.2	+	5	1024	c.435A>T	c.(433-435)ttA>ttT	p.L145F	IL18RAP_ENST00000409369.1_Missense_Mutation_p.L3F	NM_003853.2	NP_003844.1	O95256	I18RA_HUMAN	interleukin 18 receptor accessory protein	145					cell surface receptor signaling pathway (GO:0007166)|immune response (GO:0006955)|inflammatory response (GO:0006954)	integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			autonomic_ganglia(1)|central_nervous_system(2)|endometrium(3)|kidney(4)|large_intestine(5)|lung(10)|ovary(2)|prostate(1)|skin(5)|urinary_tract(4)	37						AGATGATTTTAGAAGTTAAGC	0.418																																					p.L145F		Atlas-SNP	.											.	IL18RAP	102	.	0			c.A435T						.						133.0	126.0	128.0					2																	103040730		2203	4300	6503	SO:0001583	missense	8807	exon5			GATTTTAGAAGTT	AF077346	CCDS2061.1	2q12.1	2013-01-11			ENSG00000115607	ENSG00000115607		"""Interleukins and interleukin receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5989	protein-coding gene	gene with protein product		604509				9792649	Standard	XM_005264034		Approved	AcPL, CD218b	uc002tbx.3	O95256	OTTHUMG00000130777	ENST00000264260.2:c.435A>T	chr2.hg19:g.103040730A>T	ENSP00000264260:p.Leu145Phe	161.0	0.0		177.0	79.0	NM_003853	B2RPJ3|Q3KPE7|Q3KPE8|Q53TT4|Q53TU5	Missense_Mutation	SNP	ENST00000264260.2	hg19	CCDS2061.1	.	.	.	.	.	.	.	.	.	.	A	18.71	3.681327	0.68042	.	.	ENSG00000115607	ENST00000264260;ENST00000409369	T;T	0.24350	1.86;3.87	5.69	-2.62	0.06152	.	0.133415	0.34223	N	0.004159	T	0.42200	0.1192	M	0.72894	2.215	0.21473	N	0.999677	D	0.89917	1.0	D	0.85130	0.997	T	0.28839	-1.0031	10	0.41790	T	0.15	.	10.657	0.45680	0.5309:0.0:0.4691:0.0	.	145	O95256	I18RA_HUMAN	F	145;3	ENSP00000264260:L145F;ENSP00000387201:L3F	ENSP00000264260:L145F	L	+	3	2	IL18RAP	102407162	0.360000	0.24964	0.007000	0.13788	0.834000	0.47266	-0.295000	0.08298	-0.616000	0.05671	0.533000	0.62120	TTA	.	A|1.000;G|0.000		0.418	IL18RAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253291.2	NM_003853	
GPR45	11250	hgsc.bcm.edu	37	2	105858393	105858393	+	Silent	SNP	C	C	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr2:105858393C>A	ENST00000258456.1	+	1	194	c.78C>A	c.(76-78)tcC>tcA	p.S26S		NM_007227.3	NP_009158.3	Q9Y5Y3	GPR45_HUMAN	G protein-coupled receptor 45	26						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(8)|lung(10)|ovary(1)|prostate(1)|stomach(1)|urinary_tract(1)	28						ACTCGGGGTCCACCCAGTTGC	0.597																																					p.S26S		Atlas-SNP	.											.	GPR45	73	.	0			c.C78A						.						105.0	98.0	100.0					2																	105858393		2203	4300	6503	SO:0001819	synonymous_variant	11250	exon1			GGGGTCCACCCAG	AF118266	CCDS2066.1	2q11.1-q12	2012-08-21			ENSG00000135973	ENSG00000135973		"""GPCR / Class A : Orphans"""	4503	protein-coding gene	gene with protein product		604838				10036181	Standard	NM_007227		Approved	PSP24, PSP24A	uc002tco.1	Q9Y5Y3	OTTHUMG00000130805	ENST00000258456.1:c.78C>A	chr2.hg19:g.105858393C>A		132.0	0.0		121.0	50.0	NM_007227	Q6NWS4|Q6NXU6	Silent	SNP	ENST00000258456.1	hg19	CCDS2066.1																																																																																			.	.		0.597	GPR45-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253348.1	NM_007227	
ACOXL	55289	hgsc.bcm.edu	37	2	111556610	111556610	+	Silent	SNP	T	T	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr2:111556610T>A	ENST00000389811.4	+	7	704	c.480T>A	c.(478-480)gtT>gtA	p.V160V	ACOXL_ENST00000340561.4_Silent_p.V160V|ACOXL_ENST00000439055.1_Silent_p.V160V			Q9NUZ1	ACOXL_HUMAN	acyl-CoA oxidase-like	160					fatty acid beta-oxidation (GO:0006635)	peroxisome (GO:0005777)	acyl-CoA dehydrogenase activity (GO:0003995)|acyl-CoA oxidase activity (GO:0003997)			kidney(1)|large_intestine(4)|lung(10)|pancreas(1)|prostate(2)|skin(2)|urinary_tract(1)	21						GTTTCATCGTTCCTGTCCGGG	0.473																																					p.V160V		Atlas-SNP	.											.	ACOXL	93	.	0			c.T480A						.						154.0	132.0	139.0					2																	111556610		2203	4300	6503	SO:0001819	synonymous_variant	55289	exon7			CATCGTTCCTGTC		CCDS46389.1	2q13	2010-06-30	2010-04-30		ENSG00000153093	ENSG00000153093			25621	protein-coding gene	gene with protein product			"""acyl-Coenzyme A oxidase-like"""				Standard	NM_001142807		Approved	FLJ11042	uc010yxk.1	Q9NUZ1	OTTHUMG00000131257	ENST00000389811.4:c.480T>A	chr2.hg19:g.111556610T>A		115.0	0.0		118.0	62.0	NM_001142807	A2RRB7|B7WPB3|B7WPP7|E9PB20|Q53R27|Q53R31|Q53SC6|Q8TCE7	Silent	SNP	ENST00000389811.4	hg19		.	.	.	.	.	.	.	.	.	.	T	10.87	1.471854	0.26423	.	.	ENSG00000153093	ENST00000422487	.	.	.	5.35	-0.451	0.12214	.	.	.	.	.	T	0.54287	0.1849	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.55283	-0.8165	5	0.87932	D	0	-40.3392	1.7734	0.03016	0.127:0.1613:0.1565:0.5552	.	.	.	.	Y	12	.	ENSP00000404255:F12Y	F	+	2	0	ACOXL	111273081	0.872000	0.30054	0.987000	0.45799	0.961000	0.63080	-0.409000	0.07160	0.057000	0.16193	0.528000	0.53228	TTC	.	.		0.473	ACOXL-001	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000254024.2	NM_018308	
DPP10	57628	hgsc.bcm.edu	37	2	116593732	116593732	+	Splice_Site	SNP	G	G	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr2:116593732G>T	ENST00000410059.1	+	22	2430		c.e22-1		DPP10_ENST00000310323.8_Splice_Site|DPP10_ENST00000393147.2_Splice_Site|DPP10_ENST00000409163.1_Splice_Site	NM_001178037.1|NM_020868.3	NP_001171508.1|NP_065919	Q8N608	DPP10_HUMAN	dipeptidyl-peptidase 10 (non-functional)							integral component of membrane (GO:0016021)|membrane (GO:0016020)	serine-type peptidase activity (GO:0008236)			breast(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(24)|liver(2)|lung(48)|ovary(6)|prostate(1)|skin(5)|soft_tissue(1)	101						TTCCCCCCCAGGGTTATGGTG	0.338																																					.		Atlas-SNP	.											.	DPP10	415	.	0			c.1951-1G>T						.						43.0	43.0	43.0					2																	116593732		2203	4300	6503	SO:0001630	splice_region_variant	57628	exon22			CCCCCAGGGTTAT	AY172661	CCDS33278.1, CCDS46400.1, CCDS54388.1, CCDS54389.1	2q14.1	2010-05-04	2010-05-04		ENSG00000175497	ENSG00000175497			20823	protein-coding gene	gene with protein product		608209	"""dipeptidylpeptidase 10"", ""dipeptidyl-peptidase 10"""			10819331, 12662155	Standard	NM_020868		Approved	DPRP3	uc002tle.3	Q8N608	OTTHUMG00000153294	ENST00000410059.1:c.1951-1G>T	chr2.hg19:g.116593732G>T		127.0	0.0		125.0	46.0	NM_020868	A8K1Q2|J3KPP2|J3KQ46|Q0GLB8|Q53QT3|Q53S86|Q53SL8|Q53SS4|Q6TTV4|Q86YR9|Q9P236	Splice_Site	SNP	ENST00000410059.1	hg19	CCDS46400.1	.	.	.	.	.	.	.	.	.	.	G	15.20	2.764343	0.49574	.	.	ENSG00000175497	ENST00000410059;ENST00000409163;ENST00000393147;ENST00000310323	.	.	.	5.67	5.67	0.87782	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.7538	0.91825	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	DPP10	116310202	1.000000	0.71417	0.995000	0.50966	0.508000	0.34012	7.900000	0.87376	2.649000	0.89929	0.655000	0.94253	.	.	.		0.338	DPP10-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000330580.4	NM_020868	Intron
STEAP3	55240	hgsc.bcm.edu	37	2	120020691	120020691	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr2:120020691G>T	ENST00000354888.5	+	6	1748	c.1244G>T	c.(1243-1245)tGg>tTg	p.W415L	STEAP3_ENST00000425223.2_Missense_Mutation_p.W415L|STEAP3_ENST00000393108.2_Missense_Mutation_p.W415L|STEAP3_ENST00000409811.1_3'UTR|STEAP3_ENST00000393106.2_Missense_Mutation_p.W415L|STEAP3_ENST00000393107.2_Missense_Mutation_p.W415L|STEAP3_ENST00000393110.2_Missense_Mutation_p.W425L	NM_182915.2	NP_878919.2	Q658P3	STEA3_HUMAN	STEAP family member 3, metalloreductase	415					apoptotic process (GO:0006915)|cell cycle (GO:0007049)|cellular iron ion homeostasis (GO:0006879)|copper ion import (GO:0015677)|exosomal secretion (GO:1990182)|ferric iron import into cell (GO:0097461)|positive regulation of apoptotic process (GO:0043065)|positive regulation of intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:1902167)|protein secretion (GO:0009306)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|multivesicular body (GO:0005771)|plasma membrane (GO:0005886)	cupric reductase activity (GO:0008823)|ferric-chelate reductase (NADPH) activity (GO:0052851)|ferric-chelate reductase activity (GO:0000293)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(2)|endometrium(6)|kidney(1)|large_intestine(2)|lung(4)|skin(1)	17						ACCTACGGCTGGACCCGCGCC	0.627																																					p.W425L		Atlas-SNP	.											.	STEAP3	44	.	0			c.G1274T						.						85.0	87.0	86.0					2																	120020691		2203	4300	6503	SO:0001583	missense	55240	exon6			ACGGCTGGACCCG	AY029585	CCDS2125.1, CCDS42738.1	2q14.2	2011-09-30	2011-09-30		ENSG00000115107	ENSG00000115107			24592	protein-coding gene	gene with protein product		609671				12606722	Standard	NM_182915		Approved	TSAP6, dudlin-2, STMP3	uc002tlr.3	Q658P3	OTTHUMG00000131402	ENST00000354888.5:c.1244G>T	chr2.hg19:g.120020691G>T	ENSP00000346961:p.Trp415Leu	41.0	0.0		47.0	21.0	NM_182915	A8K6E3|Q4VBR2|Q4ZG36|Q53SQ8|Q7Z389|Q86SF6|Q8NEW6|Q8TDP3|Q8TF03|Q9NVB5	Missense_Mutation	SNP	ENST00000354888.5	hg19	CCDS2125.1	.	.	.	.	.	.	.	.	.	.	G	29.7	5.025250	0.93518	.	.	ENSG00000115107	ENST00000393108;ENST00000354888;ENST00000393110;ENST00000393106;ENST00000393107;ENST00000425223;ENST00000546236	T;T;T;T;T;T	0.07114	3.23;3.23;3.22;3.23;3.23;3.23	4.82	4.82	0.62117	.	0.000000	0.85682	D	0.000000	T	0.31702	0.0805	M	0.80183	2.485	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.996	T	0.03374	-1.1043	9	.	.	.	-14.2374	17.0672	0.86562	0.0:0.0:1.0:0.0	.	425;415	Q658P3-2;Q658P3	.;STEA3_HUMAN	L	415;415;425;415;415;415;59	ENSP00000376820:W415L;ENSP00000346961:W415L;ENSP00000376822:W425L;ENSP00000376818:W415L;ENSP00000376819:W415L;ENSP00000396214:W415L	.	W	+	2	0	STEAP3	119737161	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.263000	0.95617	2.527000	0.85204	0.561000	0.74099	TGG	.	.		0.627	STEAP3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254193.1	NM_018234	
GLI2	2736	hgsc.bcm.edu	37	2	121743964	121743964	+	Silent	SNP	G	G	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr2:121743964G>T	ENST00000452319.1	+	13	2127	c.2067G>T	c.(2065-2067)ggG>ggT	p.G689G	GLI2_ENST00000435313.2_3'UTR|GLI2_ENST00000314490.11_Silent_p.G361G|GLI2_ENST00000361492.4_Silent_p.G689G					GLI family zinc finger 2									p.G689G(1)		NS(1)|breast(3)|central_nervous_system(4)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(7)|lung(24)|ovary(8)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	64	Renal(3;0.0496)	Prostate(154;0.0623)				CGGGGCCCGGGAGCCTGGGAG	0.711																																					p.G689G		Atlas-SNP	.											GLI2,NS,carcinoma,0,1	GLI2	187	.	1	Substitution - coding silent(1)	lung(1)	c.G2067T						.						36.0	45.0	42.0					2																	121743964		2203	4299	6502	SO:0001819	synonymous_variant	2736	exon12			GCCCGGGAGCCTG		CCDS33283.1	2q14	2013-01-25	2009-03-05		ENSG00000074047	ENSG00000074047		"""Zinc fingers, C2H2-type"""	4318	protein-coding gene	gene with protein product	"""tax-responsive element-2 holding protein"", ""tax helper protein 1"", ""tax helper protein 2"""	165230	"""GLI-Kruppel family member GLI2"", ""glioma-associated oncogene family zinc finger 2"""			2850480, 9557682	Standard	NM_005270		Approved	THP2, HPE9, THP1	uc010flp.3	P10070	OTTHUMG00000153741	ENST00000452319.1:c.2067G>T	chr2.hg19:g.121743964G>T		160.0	0.0		138.0	66.0	NM_005270		Silent	SNP	ENST00000452319.1	hg19	CCDS33283.1																																																																																			.	.		0.711	GLI2-009	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000332293.3	NM_005270	
ARHGEF4	50649	hgsc.bcm.edu	37	2	131803692	131803692	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr2:131803692T>C	ENST00000326016.5	+	14	2522	c.2003T>C	c.(2002-2004)cTg>cCg	p.L668P	ARHGEF4_ENST00000409303.1_Missense_Mutation_p.L608P|ARHGEF4_ENST00000525839.1_3'UTR|ARHGEF4_ENST00000428230.2_Missense_Mutation_p.L170P|ARHGEF4_ENST00000392953.3_3'UTR|ARHGEF4_ENST00000355771.3_Missense_Mutation_p.L597P	NM_015320.2	NP_056135.2	Q9NR80	ARHG4_HUMAN	Rho guanine nucleotide exchange factor (GEF) 4	668					apoptotic signaling pathway (GO:0097190)|filopodium assembly (GO:0046847)|lamellipodium assembly (GO:0030032)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|positive regulation of Rac GTPase activity (GO:0032855)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell projection (GO:0042995)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)|protein domain specific binding (GO:0019904)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)			NS(1)|breast(4)|cervix(1)|endometrium(2)|large_intestine(5)|lung(7)|ovary(3)|pancreas(1)|prostate(1)|skin(4)	29		Prostate(154;0.055)		BRCA - Breast invasive adenocarcinoma(221;0.097)		GTCCTGGTGCTGGCGGAGCCC	0.672																																					p.L668P		Atlas-SNP	.											.	ARHGEF4	89	.	0			c.T2003C						.						32.0	38.0	36.0					2																	131803692		2203	4300	6503	SO:0001583	missense	50649	exon14			TGGTGCTGGCGGA	AL137289	CCDS2165.1, CCDS42754.1	2q22	2013-01-10			ENSG00000136002	ENSG00000136002		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	684	protein-coding gene	gene with protein product	"""APC-stimulated guanine nucleotide exchange factor"""	605216				10873612	Standard	NM_015320		Approved	STM6, KIAA1112, ASEF	uc002tsa.1	Q9NR80	OTTHUMG00000131657	ENST00000326016.5:c.2003T>C	chr2.hg19:g.131803692T>C	ENSP00000316845:p.Leu668Pro	57.0	0.0		50.0	13.0	NM_015320	Q9HDC6|Q9UPP0	Missense_Mutation	SNP	ENST00000326016.5	hg19	CCDS2165.1	.	.	.	.	.	.	.	.	.	.	T	22.8	4.332512	0.81801	.	.	ENSG00000136002	ENST00000326016;ENST00000438985;ENST00000428230;ENST00000409303;ENST00000355771	T;T;T;T;T	0.39592	1.07;1.07;1.07;1.07;1.07	5.71	5.71	0.89125	.	0.000000	0.64402	D	0.000002	T	0.61311	0.2337	M	0.68317	2.08	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.68943	0.961;0.961	T	0.63585	-0.6604	10	0.56958	D	0.05	.	13.9228	0.63942	0.0:0.0:0.0:1.0	.	608;668	E9PEM0;Q9NR80	.;ARHG4_HUMAN	P	668;350;170;608;597	ENSP00000316845:L668P;ENSP00000389661:L350P;ENSP00000398455:L170P;ENSP00000387285:L608P;ENSP00000348017:L597P	ENSP00000316845:L668P	L	+	2	0	ARHGEF4	131520162	1.000000	0.71417	1.000000	0.80357	0.711000	0.40976	7.471000	0.80985	2.180000	0.69256	0.379000	0.24179	CTG	.	.		0.672	ARHGEF4-001	KNOWN	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000254554.4		
NEB	4703	hgsc.bcm.edu	37	2	152522831	152522831	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr2:152522831A>T	ENST00000172853.10	-	41	4951	c.4804T>A	c.(4804-4806)Tac>Aac	p.Y1602N	NEB_ENST00000603639.1_Missense_Mutation_p.Y1602N|NEB_ENST00000397345.3_Missense_Mutation_p.Y1602N|NEB_ENST00000604864.1_Missense_Mutation_p.Y1602N|NEB_ENST00000409198.1_Missense_Mutation_p.Y1602N|NEB_ENST00000427231.2_Missense_Mutation_p.Y1602N			P20929	NEBU_HUMAN	nebulin	1602					muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|regulation of actin filament length (GO:0030832)|somatic muscle development (GO:0007525)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Z disc (GO:0030018)	structural constituent of muscle (GO:0008307)			NS(5)|autonomic_ganglia(3)|breast(9)|central_nervous_system(5)|cervix(3)|endometrium(35)|kidney(16)|large_intestine(77)|liver(1)|lung(99)|ovary(9)|pancreas(3)|prostate(13)|skin(7)|stomach(8)|upper_aerodigestive_tract(6)|urinary_tract(2)	301				BRCA - Breast invasive adenocarcinoma(221;0.219)		ACATTCATGTAGTGAACCAGT	0.438																																					p.Y1602N		Atlas-SNP	.											.	NEB	1697	.	0			c.T4804A						.						277.0	253.0	261.0					2																	152522831		1942	4150	6092	SO:0001583	missense	4703	exon41			TCATGTAGTGAAC	X83957	CCDS46424.1, CCDS54407.1, CCDS54408.1, CCDS74588.1	2q22	2014-09-17			ENSG00000183091	ENSG00000183091			7720	protein-coding gene	gene with protein product	"""nemaline myopathy type 2"""	161650		NEM2		10051637, 9359044	Standard	NM_001164507		Approved	NEB177D	uc010fnx.3	P20929	OTTHUMG00000153784	ENST00000172853.10:c.4804T>A	chr2.hg19:g.152522831A>T	ENSP00000172853:p.Tyr1602Asn	93.0	0.0		86.0	34.0	NM_004543	F8WCL5|F8WCP0|Q15346|Q53QQ2|Q53TG8	Missense_Mutation	SNP	ENST00000172853.10	hg19		.	.	.	.	.	.	.	.	.	.	A	23.9	4.469655	0.84533	.	.	ENSG00000183091	ENST00000409198;ENST00000397345;ENST00000427231;ENST00000172853	T;T;T;T	0.44482	0.92;0.92;0.92;0.92	5.76	5.76	0.90799	.	0.065584	0.64402	D	0.000006	T	0.61299	0.2336	M	0.68317	2.08	0.80722	D	1	D	0.60575	0.988	D	0.68483	0.958	T	0.57900	-0.7731	10	0.28530	T	0.3	.	16.0711	0.80936	1.0:0.0:0.0:0.0	.	1602	P20929	NEBU_HUMAN	N	1602	ENSP00000386259:Y1602N;ENSP00000380505:Y1602N;ENSP00000416578:Y1602N;ENSP00000172853:Y1602N	ENSP00000172853:Y1602N	Y	-	1	0	NEB	152231077	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	9.339000	0.96797	2.197000	0.70478	0.482000	0.46254	TAC	.	.		0.438	NEB-201	KNOWN	basic	protein_coding	protein_coding		NM_004543	
TANC1	85461	hgsc.bcm.edu	37	2	160087091	160087091	+	Silent	SNP	C	C	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr2:160087091C>A	ENST00000263635.6	+	27	5391	c.5154C>A	c.(5152-5154)ccC>ccA	p.P1718P	TANC1_ENST00000454300.1_Silent_p.P1612P	NM_001145909.1|NM_033394.2	NP_001139381.1|NP_203752.2	Q9C0D5	TANC1_HUMAN	tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 1	1718					dendritic spine maintenance (GO:0097062)|myoblast fusion (GO:0007520)|visual learning (GO:0008542)	axon terminus (GO:0043679)|cell junction (GO:0030054)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)|postsynaptic membrane (GO:0045211)				breast(3)|central_nervous_system(4)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(9)|lung(25)|ovary(7)|pancreas(1)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(2)	77						AGCACAGACCCCGCAACACGC	0.547																																					p.P1718P		Atlas-SNP	.											.	TANC1	157	.	0			c.C5154A						.						107.0	115.0	112.0					2																	160087091		2070	4218	6288	SO:0001819	synonymous_variant	85461	exon27			CAGACCCCGCAAC	AB051515	CCDS42766.1	2q24.2	2013-01-11			ENSG00000115183	ENSG00000115183		"""Ankyrin repeat domain containing"", ""Tetratricopeptide (TTC) repeat domain containing"""	29364	protein-coding gene	gene with protein product	"""rolling pebbles homolog B (Drosophila)"""	611397				15673434	Standard	NM_033394		Approved	KIAA1728, ROLSB	uc002uag.3	Q9C0D5	OTTHUMG00000153945	ENST00000263635.6:c.5154C>A	chr2.hg19:g.160087091C>A		135.0	0.0		111.0	43.0	NM_033394	C9JD88|Q49AI8	Silent	SNP	ENST00000263635.6	hg19	CCDS42766.1																																																																																			.	.		0.547	TANC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333135.1		
SCN1A	6323	hgsc.bcm.edu	37	2	166897949	166897949	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr2:166897949G>A	ENST00000303395.4	-	13	2206	c.2207C>T	c.(2206-2208)cCc>cTc	p.P736L	SCN1A_ENST00000423058.2_Missense_Mutation_p.P736L|AC010127.3_ENST00000595647.1_RNA|SCN1A_ENST00000375405.3_Missense_Mutation_p.P725L|SCN1A_ENST00000409050.1_Missense_Mutation_p.P708L|AC010127.3_ENST00000599041.1_RNA|AC010127.3_ENST00000595268.1_RNA			P35498	SCN1A_HUMAN	sodium channel, voltage-gated, type I, alpha subunit	736					adult walking behavior (GO:0007628)|membrane depolarization during action potential (GO:0086010)|neuromuscular process controlling posture (GO:0050884)|neuronal action potential (GO:0019228)|neuronal action potential propagation (GO:0019227)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon initial segment (GO:0043194)|intercalated disc (GO:0014704)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)|Z disc (GO:0030018)	voltage-gated sodium channel activity (GO:0005248)			NS(4)|breast(5)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(33)|lung(87)|ovary(7)|pancreas(1)|prostate(9)|skin(23)|upper_aerodigestive_tract(2)|urinary_tract(1)	200					Dronedarone(DB04855)|Nitrazepam(DB01595)|Permethrin(DB04930)|Phenacemide(DB01121)|Phenazopyridine(DB01438)|Phenytoin(DB00252)|Topiramate(DB00273)|Valproic Acid(DB00313)|Zonisamide(DB00909)	ATACCAACAGGGTGGGCATTT	0.338																																					p.P736L		Atlas-SNP	.											.	SCN1A	641	.	0			c.C2207T						.						80.0	90.0	86.0					2																	166897949		2203	4300	6503	SO:0001583	missense	6323	exon13			CAACAGGGTGGGC	AB093548	CCDS33316.1, CCDS54413.1, CCDS54414.1	2q24.3	2014-09-17	2007-01-23		ENSG00000144285	ENSG00000144285		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10585	protein-coding gene	gene with protein product		182389	"""febrile convulsions 3"""	SCN1, FEB3		8062593, 16382098, 11823106	Standard	NM_006920		Approved	Nav1.1, GEFSP2, HBSCI, NAC1, SMEI	uc021vsb.1	P35498	OTTHUMG00000044173	ENST00000303395.4:c.2207C>T	chr2.hg19:g.166897949G>A	ENSP00000303540:p.Pro736Leu	72.0	0.0		73.0	30.0	NM_001165963	E9PG49|Q16172|Q585T7|Q8IUJ6|Q96LA3|Q9C008	Missense_Mutation	SNP	ENST00000303395.4	hg19	CCDS54413.1	.	.	.	.	.	.	.	.	.	.	G	23.4	4.406252	0.83230	.	.	ENSG00000144285	ENST00000423058;ENST00000303395;ENST00000375405;ENST00000409050	D;D;D;D	0.96587	-4.06;-4.06;-3.99;-4.0	5.54	5.54	0.83059	.	0.000000	0.64402	D	0.000005	D	0.97929	0.9319	M	0.86864	2.845	0.80722	D	1	P;P;D	0.58970	0.904;0.845;0.984	P;B;P	0.55545	0.571;0.368;0.778	D	0.98481	1.0605	10	0.87932	D	0	.	19.8328	0.96642	0.0:0.0:1.0:0.0	.	725;708;736	P35498-2;E9PG49;P35498	.;.;SCN1A_HUMAN	L	736;736;725;708	ENSP00000407030:P736L;ENSP00000303540:P736L;ENSP00000364554:P725L;ENSP00000386312:P708L	ENSP00000303540:P736L	P	-	2	0	SCN1A	166606195	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	7.817000	0.86213	2.758000	0.94735	0.591000	0.81541	CCC	.	.		0.338	SCN1A-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000102661.1	NM_006920	
NOSTRIN	115677	hgsc.bcm.edu	37	2	169681160	169681160	+	Missense_Mutation	SNP	A	A	C			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr2:169681160A>C	ENST00000317647.7	+	3	359	c.130A>C	c.(130-132)Agc>Cgc	p.S44R	NOSTRIN_ENST00000445023.2_5'UTR|NOSTRIN_ENST00000397209.2_Intron|NOSTRIN_ENST00000458381.2_Missense_Mutation_p.S44R|NOSTRIN_ENST00000444448.2_Missense_Mutation_p.S44R|NOSTRIN_ENST00000421711.2_Intron|NOSTRIN_ENST00000397206.2_5'UTR	NM_001039724.3	NP_001034813.2	Q8IVI9	NOSTN_HUMAN	nitric oxide synthase trafficking	44	FCH. {ECO:0000255|PROSITE- ProRule:PRU00083}.				endocytosis (GO:0006897)|negative regulation of transcription, DNA-templated (GO:0045892)|nitric oxide metabolic process (GO:0046209)|regulation of nitric-oxide synthase activity (GO:0050999)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytoskeleton (GO:0005856)|endocytic vesicle membrane (GO:0030666)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)			kidney(1)|large_intestine(1)|lung(4)|prostate(1)|skin(1)|urinary_tract(1)	9						CCTGGAAATTAGCTATGCCAA	0.453																																					p.S44R		Atlas-SNP	.											.	NOSTRIN	68	.	0			c.A130C						.						86.0	81.0	83.0					2																	169681160		1893	4127	6020	SO:0001583	missense	115677	exon3			GAAATTAGCTATG	AJ532842	CCDS42771.1, CCDS42772.1, CCDS54415.1, CCDS54416.1	2q31.1	2013-08-05	2013-08-05		ENSG00000163072	ENSG00000163072			20203	protein-coding gene	gene with protein product		607496	"""nitric oxide synthase trafficker"""			12446846	Standard	NM_001171631		Approved	MGC20702	uc002ueg.3	Q8IVI9	OTTHUMG00000153990	ENST00000317647.7:c.130A>C	chr2.hg19:g.169681160A>C	ENSP00000318921:p.Ser44Arg	701.0	0.0		600.0	221.0	NM_001039724	A8K2I9|B3KSF5|E7EPT9|Q27HG3|Q53S62|Q96CJ9	Missense_Mutation	SNP	ENST00000317647.7	hg19	CCDS42771.1	.	.	.	.	.	.	.	.	.	.	A	21.5	4.164663	0.78339	.	.	ENSG00000163072	ENST00000458381;ENST00000444448;ENST00000317647	T;T;T	0.17528	2.27;2.27;2.27	5.18	5.18	0.71444	Fps/Fes/Fer/CIP4 homology (2);	0.231859	0.50627	D	0.000103	T	0.25754	0.0627	L	0.56769	1.78	0.36811	D	0.885886	P;P	0.50369	0.81;0.934	B;P	0.50537	0.326;0.643	T	0.14008	-1.0488	10	0.23302	T	0.38	-11.5771	13.2758	0.60186	1.0:0.0:0.0:0.0	.	44;44	Q8IVI9;E7EPT9	NOSTN_HUMAN;.	R	44	ENSP00000402140:S44R;ENSP00000394051:S44R;ENSP00000318921:S44R	ENSP00000318921:S44R	S	+	1	0	NOSTRIN	169389406	1.000000	0.71417	0.978000	0.43139	0.993000	0.82548	6.214000	0.72200	2.088000	0.63022	0.533000	0.62120	AGC	.	.		0.453	NOSTRIN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333356.4	NM_052946	
PPIG	9360	hgsc.bcm.edu	37	2	170465241	170465241	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr2:170465241A>G	ENST00000260970.3	+	7	570	c.350A>G	c.(349-351)aAg>aGg	p.K117R	PPIG_ENST00000448752.2_Missense_Mutation_p.K117R|PPIG_ENST00000462903.1_Missense_Mutation_p.K117R|PPIG_ENST00000409714.3_Missense_Mutation_p.K102R	NM_004792.2	NP_004783.2	Q13427	PPIG_HUMAN	peptidylprolyl isomerase G (cyclophilin G)	117	PPIase cyclophilin-type. {ECO:0000255|PROSITE-ProRule:PRU00156}.				protein folding (GO:0006457)|RNA splicing (GO:0008380)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	cyclosporin A binding (GO:0016018)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)|poly(A) RNA binding (GO:0044822)			NS(2)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(8)|liver(1)|lung(17)|ovary(2)|stomach(1)|urinary_tract(1)	43					L-Proline(DB00172)	AACAGAGGGAAGGATACAAAT	0.373																																					p.K117R		Atlas-SNP	.											.	PPIG	100	.	0			c.A350G						.						85.0	84.0	85.0					2																	170465241		2203	4300	6503	SO:0001583	missense	9360	exon7			GAGGGAAGGATAC	X99717	CCDS2235.1	2q31.1	2010-07-23	2006-01-12		ENSG00000138398	ENSG00000138398	6.1.1.16		14650	protein-coding gene	gene with protein product	"""SR-related CTD-associated factor 10"""	606093	"""peptidyl-prolyl isomerase G (cyclophilin G)"""			8973360, 9153302	Standard	NM_004792		Approved	CARS-Cyp, SRCyp, SCAF10	uc002uez.3	Q13427	OTTHUMG00000132206	ENST00000260970.3:c.350A>G	chr2.hg19:g.170465241A>G	ENSP00000260970:p.Lys117Arg	378.0	0.0		356.0	154.0	NM_004792	D3DPC5|D3DPC6|O00706|Q53R40|Q53SN4|Q96DG9	Missense_Mutation	SNP	ENST00000260970.3	hg19	CCDS2235.1	.	.	.	.	.	.	.	.	.	.	A	16.62	3.174157	0.57692	.	.	ENSG00000138398	ENST00000260970;ENST00000530133;ENST00000433207;ENST00000409714;ENST00000462903;ENST00000448752;ENST00000414307	T;T;T;T;T;T	0.43294	0.95;0.95;0.95;0.95;0.95;0.95	5.06	3.91	0.45181	Peptidyl-prolyl cis-trans isomerase, cyclophilin-type (4);Cyclophilin-like (1);	0.000000	0.85682	D	0.000000	T	0.37489	0.1005	L	0.31845	0.965	0.54753	D	0.999985	P;B;B;B;B	0.39480	0.675;0.447;0.447;0.098;0.402	P;B;B;B;B	0.45474	0.482;0.192;0.26;0.039;0.337	T	0.08126	-1.0737	10	0.33940	T	0.23	-17.2689	10.7459	0.46181	0.9244:0.0:0.0756:0.0	.	113;102;102;117;117	C9JM79;E9PG73;Q2NKQ6;Q13427-2;Q13427	.;.;.;.;PPIG_HUMAN	R	117;117;113;102;117;117;117	ENSP00000260970:K117R;ENSP00000408683:K113R;ENSP00000386245:K102R;ENSP00000435987:K117R;ENSP00000407083:K117R;ENSP00000402222:K117R	ENSP00000260970:K117R	K	+	2	0	PPIG	170173487	1.000000	0.71417	0.999000	0.59377	0.998000	0.95712	9.255000	0.95524	0.876000	0.35872	0.477000	0.44152	AAG	.	.		0.373	PPIG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255264.2		
CDCA7	83879	hgsc.bcm.edu	37	2	174230178	174230178	+	Splice_Site	SNP	A	A	C			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr2:174230178A>C	ENST00000347703.3	+	6	801		c.e6-1		CDCA7_ENST00000410101.3_Splice_Site|CDCA7_ENST00000306721.3_Splice_Site|CDCA7_ENST00000392567.2_Splice_Site|CDCA7_ENST00000410019.3_Splice_Site	NM_145810.2	NP_665809.1	Q9BWT1	CDCA7_HUMAN	cell division cycle associated 7						apoptotic process (GO:0006915)|regulation of cell proliferation (GO:0042127)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(8)|ovary(1)	18			OV - Ovarian serous cystadenocarcinoma(117;0.116)			CTTGTAATGCAGGAAGATGAC	0.408																																					.		Atlas-SNP	.											.	CDCA7	48	.	0			c.895-2A>C						.						66.0	68.0	67.0					2																	174230178		2203	4300	6503	SO:0001630	splice_region_variant	83879	exon7			TAATGCAGGAAGA	BG354580	CCDS2252.1, CCDS2253.1	2q31.1	2008-02-05			ENSG00000144354	ENSG00000144354			14628	protein-coding gene	gene with protein product		609937				11598121, 12188893	Standard	NM_145810		Approved	FLJ14736, JPO1	uc002uic.1	Q9BWT1	OTTHUMG00000132296	ENST00000347703.3:c.658-1A>C	chr2.hg19:g.174230178A>C		80.0	0.0		65.0	34.0	NM_031942	B4DLP8|B4DV66|Q53EW5|Q580W9|Q658K4|Q658N4|Q8NBY9|Q96BV8|Q96SP5	Splice_Site	SNP	ENST00000347703.3	hg19	CCDS2253.1	.	.	.	.	.	.	.	.	.	.	A	16.09	3.025446	0.54683	.	.	ENSG00000144354	ENST00000347703;ENST00000392567;ENST00000306721;ENST00000410101;ENST00000410019	.	.	.	5.74	5.74	0.90152	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.3305	0.83010	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	CDCA7	173938424	1.000000	0.71417	0.963000	0.40424	0.450000	0.32258	4.038000	0.57318	2.317000	0.78254	0.459000	0.35465	.	.	.		0.408	CDCA7-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255400.1	NM_031942	Intron
TTN	7273	hgsc.bcm.edu	37	2	179431803	179431803	+	Silent	SNP	T	T	C			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr2:179431803T>C	ENST00000591111.1	-	276	74357	c.74133A>G	c.(74131-74133)ttA>ttG	p.L24711L	TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN_ENST00000359218.5_Silent_p.L17412L|TTN_ENST00000460472.2_Silent_p.L17287L|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN_ENST00000342175.6_Silent_p.L17479L|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN_ENST00000342992.6_Silent_p.L23784L|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN_ENST00000589042.1_Silent_p.L26352L|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000590932.1_RNA			Q8WZ42	TITIN_HUMAN	titin	24711	Fibronectin type-III 79. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CATTACCTTCTAAGAGTTTGG	0.393																																					p.L26352L		Atlas-SNP	.											.	TTN	18412	.	0			c.A79056G						.						134.0	132.0	133.0					2																	179431803		1848	4096	5944	SO:0001819	synonymous_variant	7273	exon326			ACCTTCTAAGAGT	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.74133A>G	chr2.hg19:g.179431803T>C		120.0	0.0		119.0	43.0	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Silent	SNP	ENST00000591111.1	hg19																																																																																				.	.		0.393	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
TTN	7273	hgsc.bcm.edu	37	2	179587117	179587117	+	Missense_Mutation	SNP	T	T	G			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr2:179587117T>G	ENST00000591111.1	-	75	21670	c.21446A>C	c.(21445-21447)cAg>cCg	p.Q7149P	RP11-171I2.1_ENST00000590024.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000359218.5_Intron|TTN_ENST00000460472.2_Intron|TTN_ENST00000342175.6_Intron|TTN_ENST00000342992.6_Missense_Mutation_p.Q6222P|TTN_ENST00000589042.1_Missense_Mutation_p.Q7466P			Q8WZ42	TITIN_HUMAN	titin	12724	Ig-like 53.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			AAATGAAGTCTGTAGATTTTC	0.418																																					p.Q7466P		Atlas-SNP	.											.	TTN	18412	.	0			c.A22397C						.						55.0	54.0	54.0					2																	179587117		1855	4107	5962	SO:0001583	missense	7273	exon77			GAAGTCTGTAGAT	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.21446A>C	chr2.hg19:g.179587117T>G	ENSP00000465570:p.Gln7149Pro	109.0	0.0		98.0	38.0	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	hg19		.	.	.	.	.	.	.	.	.	.	T	7.050	0.564201	0.13498	.	.	ENSG00000155657	ENST00000342992	T	0.68479	-0.33	6.16	6.16	0.99307	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.71584	0.3357	M	0.84511	2.7	0.80722	D	1	P	0.50443	0.935	B	0.40038	0.317	T	0.78961	-0.1997	9	0.87932	D	0	.	16.8061	0.85666	0.0:0.0:0.0:1.0	.	7149	Q8WZ42	TITIN_HUMAN	P	6222	ENSP00000343764:Q6222P	ENSP00000343764:Q6222P	Q	-	2	0	TTN	179295362	1.000000	0.71417	1.000000	0.80357	0.899000	0.52679	2.658000	0.46733	2.367000	0.80283	0.528000	0.53228	CAG	.	.		0.418	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
DNAH7	56171	hgsc.bcm.edu	37	2	196913052	196913052	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr2:196913052T>A	ENST00000312428.6	-	4	318	c.218A>T	c.(217-219)gAa>gTa	p.E73V	DNAH7_ENST00000410072.1_Missense_Mutation_p.E73V	NM_018897.2	NP_061720.2	Q8WXX0	DYH7_HUMAN	dynein, axonemal, heavy chain 7	73	Stem. {ECO:0000250}.				cilium movement (GO:0003341)|cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)	axonemal dynein complex (GO:0005858)|cilium (GO:0005929)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|microtubule motor activity (GO:0003777)			NS(4)|breast(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(28)|liver(3)|lung(100)|ovary(4)|prostate(5)|skin(26)|upper_aerodigestive_tract(2)|urinary_tract(3)	205						ACTAAATGGTTCTGGACTCTC	0.358																																					p.E73V		Atlas-SNP	.											.	DNAH7	512	.	0			c.A218T						.						130.0	120.0	123.0					2																	196913052		1866	4112	5978	SO:0001583	missense	56171	exon4			AATGGTTCTGGAC	AF327442	CCDS42794.1	2q33.1	2013-01-10	2006-09-04		ENSG00000118997	ENSG00000118997		"""Axonemal dyneins"", ""EF-hand domain containing"""	18661	protein-coding gene	gene with protein product		610061	"""dynein, axonemal, heavy polypeptide 7"""			9373155, 11877439	Standard	NM_018897		Approved	KIAA0944	uc002utj.4	Q8WXX0	OTTHUMG00000154438	ENST00000312428.6:c.218A>T	chr2.hg19:g.196913052T>A	ENSP00000311273:p.Glu73Val	61.0	0.0		59.0	25.0	NM_018897	B8ZZX8|O00433|O95492|Q4G152|Q53QX7|Q53S64|Q53T02|Q68CY5|Q8N1Z2|Q9UMS3|Q9Y2F3	Missense_Mutation	SNP	ENST00000312428.6	hg19	CCDS42794.1	.	.	.	.	.	.	.	.	.	.	T	20.2	3.953804	0.73902	.	.	ENSG00000118997	ENST00000312428;ENST00000410072;ENST00000312446;ENST00000427816	T;T	0.23348	1.91;2.7	4.81	4.81	0.61882	.	0.257338	0.30446	N	0.009615	T	0.21801	0.0525	L	0.46157	1.445	0.18873	N	0.999986	B	0.28128	0.201	B	0.21360	0.034	T	0.14200	-1.0481	10	0.45353	T	0.12	.	10.9236	0.47180	0.0:0.0:0.0:1.0	.	73	Q8WXX0	DYH7_HUMAN	V	73;73;73;48	ENSP00000311273:E73V;ENSP00000386260:E73V	ENSP00000311273:E73V	E	-	2	0	DNAH7	196621297	0.865000	0.29922	0.112000	0.21494	0.506000	0.33950	2.355000	0.44107	2.156000	0.67533	0.477000	0.44152	GAA	.	.		0.358	DNAH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335202.3	NM_018897	
HECW2	57520	hgsc.bcm.edu	37	2	197183894	197183894	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr2:197183894C>T	ENST00000260983.3	-	9	1902	c.1720G>A	c.(1720-1722)Gat>Aat	p.D574N	HECW2_ENST00000409111.1_Missense_Mutation_p.D218N	NM_020760.1	NP_065811.1	Q9P2P5	HECW2_HUMAN	HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2	574					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			biliary_tract(1)|breast(3)|central_nervous_system(4)|cervix(2)|endometrium(7)|kidney(4)|large_intestine(24)|lung(45)|ovary(5)|pancreas(2)|prostate(2)|skin(10)|upper_aerodigestive_tract(2)|urinary_tract(2)	113						GTGGGCTGATCTACCTCTTGA	0.612																																					p.D574N		Atlas-SNP	.											.	HECW2	239	.	0			c.G1720A						.						58.0	52.0	54.0					2																	197183894		2203	4300	6503	SO:0001583	missense	57520	exon9			GCTGATCTACCTC	AL390186	CCDS33354.1	2q32.3	2004-12-13			ENSG00000138411	ENSG00000138411			29853	protein-coding gene	gene with protein product						10718198, 12890487	Standard	NM_020760		Approved	KIAA1301, NEDL2	uc002utm.1	Q9P2P5	OTTHUMG00000154435	ENST00000260983.3:c.1720G>A	chr2.hg19:g.197183894C>T	ENSP00000260983:p.Asp574Asn	108.0	0.0		101.0	39.0	NM_020760	B8ZZB4|Q17RT5|Q68DF8|Q9NPS9	Missense_Mutation	SNP	ENST00000260983.3	hg19	CCDS33354.1	.	.	.	.	.	.	.	.	.	.	C	15.87	2.960448	0.53400	.	.	ENSG00000138411	ENST00000409111;ENST00000260983	T;T	0.34072	1.38;1.41	5.03	5.03	0.67393	.	0.930394	0.09133	N	0.844069	T	0.28433	0.0703	N	0.14661	0.345	0.37176	D	0.903272	B	0.26635	0.155	B	0.23716	0.048	T	0.16276	-1.0408	10	0.52906	T	0.07	.	16.7254	0.85421	0.0:1.0:0.0:0.0	.	574	Q9P2P5	HECW2_HUMAN	N	218;574	ENSP00000386775:D218N;ENSP00000260983:D574N	ENSP00000260983:D574N	D	-	1	0	HECW2	196892139	0.997000	0.39634	0.889000	0.34880	0.853000	0.48598	3.934000	0.56553	2.609000	0.88269	0.561000	0.74099	GAT	.	.		0.612	HECW2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335199.3	NM_020760	
ALS2CR11	151254	hgsc.bcm.edu	37	2	202400648	202400648	+	Intron	SNP	A	A	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr2:202400648A>T	ENST00000286195.3	-	13	1551				ALS2CR11_ENST00000439140.1_Intron|ALS2CR11_ENST00000439802.1_Intron|ALS2CR11_ENST00000450242.1_Silent_p.A534A	NM_152525.5	NP_689738.3	Q53TS8	AL2SA_HUMAN	amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 11											NS(1)|breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(11)|ovary(1)|skin(5)|urinary_tract(3)	33						TCTCCCTTTCAGCTAAGTTTA	0.398																																					p.A534A		Atlas-SNP	.											.	ALS2CR11	194	.	0			c.T1602A						.						146.0	109.0	120.0					2																	202400648		692	1590	2282	SO:0001627	intron_variant	151254	exon13			CCTTTCAGCTAAG	AB053313	CCDS2349.1, CCDS54430.1, CCDS54428.1, CCDS54429.1	2q33	2007-12-07			ENSG00000155754	ENSG00000155754			14438	protein-coding gene	gene with protein product						11586298	Standard	NM_152525		Approved	FLJ25351	uc002uyf.3	Q53TS8	OTTHUMG00000132830	ENST00000286195.3:c.1506+95T>A	chr2.hg19:g.202400648A>T		33.0	0.0		28.0	12.0	NM_001168217	C9IZH7|E9PGG4|Q8NCN6|Q96LN4	Silent	SNP	ENST00000286195.3	hg19	CCDS2349.1																																																																																			.	.		0.398	ALS2CR11-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000256296.2	NM_152525	
ALS2	57679	hgsc.bcm.edu	37	2	202593826	202593826	+	Silent	SNP	C	C	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr2:202593826C>T	ENST00000264276.6	-	14	3033	c.2661G>A	c.(2659-2661)aaG>aaA	p.K887K	ALS2_ENST00000457679.2_Silent_p.K199K	NM_020919.3	NP_065970.2	Q96Q42	ALS2_HUMAN	amyotrophic lateral sclerosis 2 (juvenile)	887					behavioral fear response (GO:0001662)|cell death (GO:0008219)|endosomal transport (GO:0016197)|endosome organization (GO:0007032)|locomotory behavior (GO:0007626)|neuromuscular junction development (GO:0007528)|neuron projection morphogenesis (GO:0048812)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of Rab GTPase activity (GO:0032851)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rac protein signal transduction (GO:0035022)|positive regulation of Ran GTPase activity (GO:0032853)|protein localization (GO:0008104)|receptor recycling (GO:0001881)|regulation of endosome size (GO:0051036)|response to oxidative stress (GO:0006979)|synaptic transmission, glutamatergic (GO:0035249)|vesicle organization (GO:0016050)	centrosome (GO:0005813)|cytosol (GO:0005829)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|early endosome (GO:0005769)|growth cone (GO:0030426)|lamellipodium (GO:0030027)|postsynaptic density (GO:0014069)|protein complex (GO:0043234)|ruffle (GO:0001726)|vesicle (GO:0031982)	protein homodimerization activity (GO:0042803)|protein serine/threonine kinase activator activity (GO:0043539)|Rab GTPase binding (GO:0017137)|Rab guanyl-nucleotide exchange factor activity (GO:0017112)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|Ran guanyl-nucleotide exchange factor activity (GO:0005087)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(22)|ovary(1)|prostate(4)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)	72						ATTCTGCTTCCTTCCTTTTCC	0.453																																					p.K887K		Atlas-SNP	.											.	ALS2	172	.	0			c.G2661A						.						135.0	127.0	130.0					2																	202593826		1858	4102	5960	SO:0001819	synonymous_variant	57679	exon14			TGCTTCCTTCCTT	AB053305	CCDS42800.1, CCDS46492.1	2q33-q35	2014-09-17	2004-06-23		ENSG00000003393	ENSG00000003393		"""Rho guanine nucleotide exchange factors"""	443	protein-coding gene	gene with protein product	"""alsin"""	606352	"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 6"""	ALS2CR6		11586298	Standard	NM_020919		Approved		uc002uyo.3	Q96Q42	OTTHUMG00000154507	ENST00000264276.6:c.2661G>A	chr2.hg19:g.202593826C>T		180.0	0.0		162.0	86.0	NM_020919	Q53TT1|Q53TV2|Q8N1E0|Q96PC4|Q96Q41|Q9H973|Q9HCK9	Silent	SNP	ENST00000264276.6	hg19	CCDS42800.1																																																																																			.	.		0.453	ALS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335562.3	NM_020919	
PARD3B	117583	hgsc.bcm.edu	37	2	206036933	206036933	+	Splice_Site	SNP	A	A	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr2:206036933A>T	ENST00000406610.2	+	12	1827		c.e12-1		PARD3B_ENST00000351153.1_Splice_Site|PARD3B_ENST00000358768.2_Splice_Site|PARD3B_ENST00000349953.3_Splice_Site|PARD3B_ENST00000462231.1_Splice_Site	NM_057177.6|NM_152526.5|NM_205863.3	NP_476518.4|NP_689739.4|NP_995585.2	Q8TEW8	PAR3L_HUMAN	par-3 family cell polarity regulator beta						cell cycle (GO:0007049)|cell division (GO:0051301)	membrane (GO:0016020)|tight junction (GO:0005923)				breast(1)|endometrium(9)|kidney(2)|large_intestine(6)|liver(4)|lung(33)|ovary(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)	65		all_cancers(1;2.88e-06)|all_epithelial(1;3.23e-06)		Epithelial(149;0.0739)		CTTCTGCCTTAGGATGGTCGT	0.398																																					.		Atlas-SNP	.											.	PARD3B	314	.	0			c.1621-2A>T						.						99.0	91.0	94.0					2																	206036933		1902	4118	6020	SO:0001630	splice_region_variant	117583	exon12			TGCCTTAGGATGG	AB053321	CCDS42804.1, CCDS42805.1, CCDS42806.1	2q33.3	2013-08-28	2013-08-28	2006-09-28	ENSG00000116117	ENSG00000116117			14446	protein-coding gene	gene with protein product			"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 19"", ""par-3 partitioning defective 3 homolog B (C. elegans)"""	ALS2CR19		11586298, 12459187	Standard	NM_057177		Approved	Par3L, PAR3beta	uc002vap.2	Q8TEW8	OTTHUMG00000154562	ENST00000406610.2:c.1621-1A>T	chr2.hg19:g.206036933A>T		148.0	0.0		128.0	50.0	NM_057177	E9PE87|Q8IUC7|Q8IUC9|Q96DK9|Q96N09|Q96NX6|Q96NX7|Q96Q29	Splice_Site	SNP	ENST00000406610.2	hg19		.	.	.	.	.	.	.	.	.	.	A	17.86	3.493176	0.64186	.	.	ENSG00000116117	ENST00000406610;ENST00000358768;ENST00000351153;ENST00000349953	.	.	.	5.65	5.65	0.86999	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.8835	0.79222	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	PARD3B	205745178	1.000000	0.71417	0.972000	0.41901	0.493000	0.33554	8.962000	0.93254	2.153000	0.67306	0.477000	0.44152	.	.	.		0.398	PARD3B-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000335992.1	NM_057177	Intron
MAP2	4133	hgsc.bcm.edu	37	2	210557752	210557752	+	Silent	SNP	T	T	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr2:210557752T>A	ENST00000360351.4	+	7	1364	c.858T>A	c.(856-858)ccT>ccA	p.P286P	MAP2_ENST00000392194.1_Intron|MAP2_ENST00000447185.1_Silent_p.P282P|MAP2_ENST00000361559.4_Intron|MAP2_ENST00000199940.6_Intron	NM_002374.3	NP_002365.3	P11137	MTAP2_HUMAN	microtubule-associated protein 2	286					axonogenesis (GO:0007409)|cellular response to organic substance (GO:0071310)|central nervous system neuron development (GO:0021954)|dendrite morphogenesis (GO:0048813)|microtubule bundle formation (GO:0001578)|neuron projection development (GO:0031175)	cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|neuronal cell body (GO:0043025)|nuclear periphery (GO:0034399)	dystroglycan binding (GO:0002162)|structural molecule activity (GO:0005198)			breast(7)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(36)|liver(2)|lung(42)|ovary(11)|pancreas(2)|prostate(2)|skin(2)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	124		Hepatocellular(293;0.137)|Lung NSC(271;0.163)|Renal(323;0.202)		UCEC - Uterine corpus endometrioid carcinoma (47;6.64e-05)|Epithelial(149;3.12e-100)|all cancers(144;6.88e-91)|Lung(261;0.0624)|LUSC - Lung squamous cell carcinoma(261;0.0662)|STAD - Stomach adenocarcinoma(1183;0.18)	Docetaxel(DB01248)|Estramustine(DB01196)|Paclitaxel(DB01229)	CCATATCTCCTGGCCCTCTGA	0.463																																					p.P286P	Pancreas(27;423 979 28787 29963)	Atlas-SNP	.											.	MAP2	372	.	0			c.T858A						.						51.0	52.0	51.0					2																	210557752		2203	4300	6503	SO:0001819	synonymous_variant	4133	exon7			ATCTCCTGGCCCT		CCDS2384.1, CCDS2385.1, CCDS33369.1	2q34-q35	2008-05-27			ENSG00000078018	ENSG00000078018		"""A-kinase anchor proteins"""	6839	protein-coding gene	gene with protein product		157130				3103857, 7479905	Standard	XM_005246554		Approved	MAP2A, MAP2B, MAP2C	uc002vde.1	P11137	OTTHUMG00000132962	ENST00000360351.4:c.858T>A	chr2.hg19:g.210557752T>A		165.0	0.0		141.0	60.0	NM_002374	Q17S04|Q8IUX2|Q99975|Q99976	Silent	SNP	ENST00000360351.4	hg19	CCDS2384.1																																																																																			.	.		0.463	MAP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256521.2	NM_001039538	
UNC80	285175	hgsc.bcm.edu	37	2	210805966	210805966	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr2:210805966T>C	ENST00000439458.1	+	43	6550	c.6470T>C	c.(6469-6471)cTc>cCc	p.L2157P	UNC80_ENST00000272845.6_Missense_Mutation_p.L2152P	NM_032504.1	NP_115893.1	Q8N2C7	UNC80_HUMAN	unc-80 homolog (C. elegans)	2157					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(9)|ovary(1)|prostate(1)	20						CTGTTTGGCCTCGACACTCTT	0.507																																					p.L2157P		Atlas-SNP	.											.	UNC80	280	.	0			c.T6470C						.						127.0	113.0	117.0					2																	210805966		692	1591	2283	SO:0001583	missense	285175	exon43			TTGGCCTCGACAC	AK090815	CCDS2387.1, CCDS46504.1, CCDS2387.2	2q35	2009-08-17	2009-08-17	2009-08-17	ENSG00000144406	ENSG00000144406			26582	protein-coding gene	gene with protein product		612636	"""chromosome 2 open reading frame 21"""	C2orf21		19092807	Standard	NM_032504		Approved	FLJ33496, KIAA1843, UNC-80	uc010zjc.1	Q8N2C7	OTTHUMG00000132963	ENST00000439458.1:c.6470T>C	chr2.hg19:g.210805966T>C	ENSP00000391088:p.Leu2157Pro	135.0	0.0		112.0	52.0	NM_032504	B2RN50|B4DQY9|B4DZB3|C4IXS8|C9J1U3|Q96JI4|Q96SS0	Missense_Mutation	SNP	ENST00000439458.1	hg19	CCDS46504.1	.	.	.	.	.	.	.	.	.	.	T	23.3	4.402461	0.83230	.	.	ENSG00000144406	ENST00000439458;ENST00000272845	T;T	0.47869	0.83;0.83	5.21	5.21	0.72293	.	0.000000	0.85682	D	0.000000	T	0.63745	0.2537	L	0.57536	1.79	0.80722	D	1	D	0.69078	0.997	D	0.66497	0.944	T	0.67604	-0.5628	10	0.87932	D	0	-15.8405	15.0661	0.71996	0.0:0.0:0.0:1.0	.	2157	Q8N2C7	UNC80_HUMAN	P	2157;2152	ENSP00000391088:L2157P;ENSP00000272845:L2152P	ENSP00000272845:L2152P	L	+	2	0	UNC80	210514211	1.000000	0.71417	0.965000	0.40720	0.980000	0.70556	7.805000	0.86005	1.968000	0.57251	0.533000	0.62120	CTC	.	.		0.507	UNC80-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_182587	
ABCA12	26154	hgsc.bcm.edu	37	2	215833480	215833480	+	Silent	SNP	A	A	G			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr2:215833480A>G	ENST00000272895.7	-	38	5961	c.5742T>C	c.(5740-5742)gaT>gaC	p.D1914D	ABCA12_ENST00000389661.4_Silent_p.D1596D	NM_173076.2	NP_775099.2	Q86UK0	ABCAC_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 12	1914					cellular homeostasis (GO:0019725)|ceramide transport (GO:0035627)|establishment of skin barrier (GO:0061436)|keratinization (GO:0031424)|lipid homeostasis (GO:0055088)|lipid transport (GO:0006869)|lung alveolus development (GO:0048286)|phospholipid efflux (GO:0033700)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of protein localization to cell surface (GO:2000010)|protein localization to plasma membrane (GO:0072659)|regulated secretory pathway (GO:0045055)|secretion by cell (GO:0032940)|surfactant homeostasis (GO:0043129)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|epidermal lamellar body (GO:0097209)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|plasma membrane (GO:0005886)	apolipoprotein A-I receptor binding (GO:0034191)|ATP binding (GO:0005524)|lipid transporter activity (GO:0005319)|lipid-transporting ATPase activity (GO:0034040)|receptor binding (GO:0005102)			NS(3)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(45)|lung(44)|ovary(8)|pancreas(2)|prostate(4)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	139		Renal(323;0.127)		Epithelial(149;1.01e-05)|all cancers(144;0.00112)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.011)		CTCCTGTTATATCAAAACGAA	0.343																																					p.D1914D	Ovarian(66;664 1488 5121 34295)	Atlas-SNP	.											.	ABCA12	368	.	0			c.T5742C						.						90.0	102.0	98.0					2																	215833480		2203	4300	6503	SO:0001819	synonymous_variant	26154	exon38			TGTTATATCAAAA	AF418105	CCDS33372.1, CCDS33373.1	2q34	2012-03-14			ENSG00000144452	ENSG00000144452		"""ATP binding cassette transporters / subfamily A"""	14637	protein-coding gene	gene with protein product		607800	"""ichthyosis congenita II, lamellar ichthyosis B"""	ICR2B		11435397, 12915478, 8845852, 10094194	Standard	NM_015657		Approved	DKFZP434G232, LI2	uc002vew.3	Q86UK0	OTTHUMG00000154801	ENST00000272895.7:c.5742T>C	chr2.hg19:g.215833480A>G		109.0	0.0		122.0	44.0	NM_173076	Q53QE2|Q53S55|Q8IZW6|Q96JT3|Q9Y4M5	Silent	SNP	ENST00000272895.7	hg19	CCDS33372.1																																																																																			.	.		0.343	ABCA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337111.1	NM_173076	
ABCA12	26154	hgsc.bcm.edu	37	2	215914355	215914355	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr2:215914355A>T	ENST00000272895.7	-	6	907	c.688T>A	c.(688-690)Tcc>Acc	p.S230T		NM_173076.2	NP_775099.2	Q86UK0	ABCAC_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 12	230					cellular homeostasis (GO:0019725)|ceramide transport (GO:0035627)|establishment of skin barrier (GO:0061436)|keratinization (GO:0031424)|lipid homeostasis (GO:0055088)|lipid transport (GO:0006869)|lung alveolus development (GO:0048286)|phospholipid efflux (GO:0033700)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of protein localization to cell surface (GO:2000010)|protein localization to plasma membrane (GO:0072659)|regulated secretory pathway (GO:0045055)|secretion by cell (GO:0032940)|surfactant homeostasis (GO:0043129)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|epidermal lamellar body (GO:0097209)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|plasma membrane (GO:0005886)	apolipoprotein A-I receptor binding (GO:0034191)|ATP binding (GO:0005524)|lipid transporter activity (GO:0005319)|lipid-transporting ATPase activity (GO:0034040)|receptor binding (GO:0005102)			NS(3)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(45)|lung(44)|ovary(8)|pancreas(2)|prostate(4)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	139		Renal(323;0.127)		Epithelial(149;1.01e-05)|all cancers(144;0.00112)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.011)		CTCACCTGGGAGAACTGTTTG	0.383																																					p.S230T	Ovarian(66;664 1488 5121 34295)	Atlas-SNP	.											.	ABCA12	368	.	0			c.T688A						.						76.0	74.0	74.0					2																	215914355		2203	4300	6503	SO:0001583	missense	26154	exon6			CCTGGGAGAACTG	AF418105	CCDS33372.1, CCDS33373.1	2q34	2012-03-14			ENSG00000144452	ENSG00000144452		"""ATP binding cassette transporters / subfamily A"""	14637	protein-coding gene	gene with protein product		607800	"""ichthyosis congenita II, lamellar ichthyosis B"""	ICR2B		11435397, 12915478, 8845852, 10094194	Standard	NM_015657		Approved	DKFZP434G232, LI2	uc002vew.3	Q86UK0	OTTHUMG00000154801	ENST00000272895.7:c.688T>A	chr2.hg19:g.215914355A>T	ENSP00000272895:p.Ser230Thr	111.0	0.0		95.0	43.0	NM_173076	Q53QE2|Q53S55|Q8IZW6|Q96JT3|Q9Y4M5	Missense_Mutation	SNP	ENST00000272895.7	hg19	CCDS33372.1	.	.	.	.	.	.	.	.	.	.	A	16.84	3.235285	0.58886	.	.	ENSG00000144452	ENST00000272895	D	0.88664	-2.41	5.75	5.75	0.90469	.	0.196800	0.37219	N	0.002182	D	0.82884	0.5134	L	0.27053	0.805	0.80722	D	1	P	0.34562	0.457	B	0.36378	0.223	T	0.81317	-0.0987	10	0.30854	T	0.27	.	13.874	0.63643	1.0:0.0:0.0:0.0	.	230	Q86UK0	ABCAC_HUMAN	T	230	ENSP00000272895:S230T	ENSP00000272895:S230T	S	-	1	0	ABCA12	215622600	1.000000	0.71417	0.998000	0.56505	0.848000	0.48234	2.448000	0.44926	2.323000	0.78572	0.533000	0.62120	TCC	.	.		0.383	ABCA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337111.1	NM_173076	
TNS1	7145	hgsc.bcm.edu	37	2	218750502	218750502	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr2:218750502T>C	ENST00000171887.4	-	13	1158	c.706A>G	c.(706-708)Atc>Gtc	p.I236V	TNS1_ENST00000419504.1_Missense_Mutation_p.I236V|TNS1_ENST00000430930.1_Missense_Mutation_p.I236V|TNS1_ENST00000310858.6_Missense_Mutation_p.I267V	NM_022648.4	NP_072174.3	Q9HBL0	TENS1_HUMAN	tensin 1	236	C2 tensin-type. {ECO:0000255|PROSITE- ProRule:PRU00589}.				cell-substrate junction assembly (GO:0007044)|fibroblast migration (GO:0010761)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|focal adhesion (GO:0005925)	poly(A) RNA binding (GO:0044822)			breast(2)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(23)|liver(1)|lung(24)|ovary(3)|pancreas(1)|prostate(3)|skin(5)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	79		Renal(207;0.0483)|Lung NSC(271;0.213)		Epithelial(149;4.43e-06)|all cancers(144;0.000653)|LUSC - Lung squamous cell carcinoma(224;0.0091)|Lung(261;0.013)		CCTGGCTCGATGGTGATGCAG	0.542																																					p.I236V		Atlas-SNP	.											.	TNS1	251	.	0			c.A706G						.						146.0	127.0	133.0					2																	218750502		2203	4300	6503	SO:0001583	missense	7145	exon13			GCTCGATGGTGAT	AB209238	CCDS2407.1	2q35-q36	2014-06-13	2005-05-13	2005-05-13	ENSG00000079308	ENSG00000079308		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"", ""SH2 domain containing"""	11973	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 155"""	600076	"""tensin"", ""matrix-remodelling associated 6"""	TNS, MXRA6			Standard	NM_022648		Approved	DKFZp586K0617, PPP1R155	uc002vgt.2	Q9HBL0	OTTHUMG00000133056	ENST00000171887.4:c.706A>G	chr2.hg19:g.218750502T>C	ENSP00000171887:p.Ile236Val	72.0	0.0		74.0	29.0	NM_022648	Q4ZG71|Q6IPI5	Missense_Mutation	SNP	ENST00000171887.4	hg19	CCDS2407.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	15.22|15.22	2.769777|2.769777	0.49680|0.49680	.|.	.|.	ENSG00000079308|ENSG00000079308	ENST00000453356|ENST00000171887;ENST00000419504;ENST00000430930;ENST00000446903;ENST00000413554;ENST00000310858	.|D;D;D;D;D;D	.|0.86497	.|-2.13;-2.13;-2.13;-2.13;-2.13;-2.13	4.77|4.77	4.77|4.77	0.60923|0.60923	.|Tensin phosphatase, C2 domain (2);C2 calcium/lipid-binding domain, CaLB (1);	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.91610|0.91610	0.7349|0.7349	M|M	0.61703|0.61703	1.905|1.905	0.58432|0.58432	D|D	0.999999|0.999999	.|D;B;B;D;D;D	.|0.69078	.|0.997;0.115;0.363;0.996;0.958;0.993	.|D;B;B;D;D;D	.|0.80764	.|0.994;0.345;0.336;0.994;0.97;0.987	D|D	0.91191|0.91191	0.4984|0.4984	5|10	.|0.41790	.|T	.|0.15	.|.	14.118|14.118	0.65167|0.65167	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|236;290;267;236;236;236	.|B2RU35;A1L0S7;Q6IPI5;Q9HBL0;E9PGF5;E9PF55	.|.;.;.;TENS1_HUMAN;.;.	R|V	11|236;236;236;361;304;267	.|ENSP00000171887:I236V;ENSP00000408724:I236V;ENSP00000406016:I236V;ENSP00000405460:I361V;ENSP00000400383:I304V;ENSP00000308321:I267V	.|ENSP00000171887:I236V	H|I	-|-	2|1	0|0	TNS1|TNS1	218458747|218458747	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.912000|0.912000	0.54170|0.54170	3.976000|3.976000	0.56867|0.56867	1.992000|1.992000	0.58205|0.58205	0.379000|0.379000	0.24179|0.24179	CAT|ATC	.	.		0.542	TNS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256672.2	NM_022648	
ASIC4	55515	hgsc.bcm.edu	37	2	220396495	220396495	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr2:220396495G>T	ENST00000347842.3	+	2	993	c.979G>T	c.(979-981)Ggg>Tgg	p.G327W	ASIC4_ENST00000358078.4_Missense_Mutation_p.G327W|ASIC4_ENST00000473709.1_3'UTR	NM_182847.2	NP_878267.2	Q96FT7	ASIC4_HUMAN	acid-sensing (proton-gated) ion channel family member 4	327					ion transmembrane transport (GO:0034220)|sodium ion transmembrane transport (GO:0035725)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)	ion channel activity (GO:0005216)|sodium channel activity (GO:0005272)|sodium ion transmembrane transporter activity (GO:0015081)										TACTCGCTATGGGAAGTGTTA	0.632																																					p.G327W		Atlas-SNP	.											.	.	.	.	0			c.G979T						.						64.0	68.0	66.0					2																	220396495		2203	4300	6503	SO:0001583	missense	55515	exon2			CGCTATGGGAAGT	AJ271643	CCDS2442.1	2q36.1	2012-02-22	2012-02-22	2012-02-22	ENSG00000072182	ENSG00000072182		"""Ion channels / Acid-sensing (proton-gated) ion channels"""	21263	protein-coding gene	gene with protein product		606715	"""amiloride-sensitive cation channel 4, pituitary"", ""amiloride-sensitive cation channel family member 4, pituitary"""	ACCN4		10852210	Standard	NM_182847		Approved	BNAC4	uc002vma.3	Q96FT7	OTTHUMG00000058928	ENST00000347842.3:c.979G>T	chr2.hg19:g.220396495G>T	ENSP00000326627:p.Gly327Trp	409.0	1.0		292.0	113.0	NM_182847	Q53SB7|Q6GMS1|Q6PIN9|Q9NQA4	Missense_Mutation	SNP	ENST00000347842.3	hg19	CCDS2442.1	.	.	.	.	.	.	.	.	.	.	G	20.2	3.953766	0.73902	.	.	ENSG00000072182	ENST00000347842;ENST00000358078	D;D	0.88046	-2.33;-2.33	3.16	3.16	0.36331	.	0.000000	0.85682	D	0.000000	D	0.94761	0.8309	M	0.93283	3.4	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.998;1.0;1.0	D	0.96142	0.9101	10	0.87932	D	0	-14.9041	15.1743	0.72899	0.0:0.0:1.0:0.0	.	327;327;327	Q96FT7;Q96FT7-4;Q96FT7-2	ACCN4_HUMAN;.;.	W	327	ENSP00000326627:G327W;ENSP00000350786:G327W	ENSP00000326627:G327W	G	+	1	0	ACCN4	220104739	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.551000	0.98112	2.079000	0.62486	0.561000	0.74099	GGG	.	.		0.632	ASIC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000130263.1	NM_018674	
SERPINE2	5270	hgsc.bcm.edu	37	2	224866418	224866418	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr2:224866418A>T	ENST00000258405.4	-	2	442	c.200T>A	c.(199-201)cTg>cAg	p.L67Q	SERPINE2_ENST00000409840.3_Missense_Mutation_p.L67Q|SERPINE2_ENST00000409304.1_Missense_Mutation_p.L67Q|SERPINE2_ENST00000447280.2_Missense_Mutation_p.L79Q	NM_001136528.1|NM_006216.3	NP_001130000.1|NP_006207.1	P07093	GDN_HUMAN	serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 2	67					blood coagulation (GO:0007596)|cerebellar granular layer morphogenesis (GO:0021683)|detection of mechanical stimulus involved in sensory perception (GO:0050974)|innervation (GO:0060384)|long-term synaptic potentiation (GO:0060291)|mating plug formation (GO:0042628)|negative regulation of blood coagulation (GO:0030195)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of plasminogen activation (GO:0010757)|negative regulation of platelet activation (GO:0010544)|negative regulation of platelet aggregation (GO:0090331)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of protein processing (GO:0010955)|negative regulation of proteolysis (GO:0045861)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of sodium ion transport (GO:0010766)|positive regulation of astrocyte differentiation (GO:0048711)|regulation of cell migration (GO:0030334)|regulation of synaptic transmission, glutamatergic (GO:0051966)|regulation of timing of cell differentiation (GO:0048505)|secretion by cell (GO:0032940)|secretory granule organization (GO:0033363)|seminal vesicle epithelium development (GO:0061108)	cytosol (GO:0005829)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extrinsic component of external side of plasma membrane (GO:0031232)|neuromuscular junction (GO:0031594)|platelet alpha granule (GO:0031091)|vesicle (GO:0031982)	glycosaminoglycan binding (GO:0005539)|heparin binding (GO:0008201)|receptor binding (GO:0005102)|serine-type endopeptidase inhibitor activity (GO:0004867)			breast(2)|central_nervous_system(1)|cervix(1)|kidney(1)|large_intestine(7)|lung(4)|ovary(1)	17		Renal(207;0.025)|all_lung(227;0.0586)|Lung NSC(271;0.0682)|all_hematologic(139;0.0797)		Epithelial(121;5.68e-10)|all cancers(144;1.9e-07)|Lung(261;0.0088)|LUSC - Lung squamous cell carcinoma(224;0.00902)		GTCCGCCCCCAGCTGAAGCAT	0.567																																					p.L79Q		Atlas-SNP	.											.	SERPINE2	103	.	0			c.T236A						.						87.0	78.0	81.0					2																	224866418		2203	4300	6503	SO:0001583	missense	5270	exon2			GCCCCCAGCTGAA	M17783	CCDS2460.1, CCDS46525.1, CCDS46526.1	2q36.1	2014-02-18	2005-08-18		ENSG00000135919	ENSG00000135919		"""Serine (or cysteine) peptidase inhibitors"""	8951	protein-coding gene	gene with protein product	"""glial-derived nexin 1"""	177010	"""serine (or cysteine) proteinase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 2"""	PI7		7665170, 24172014	Standard	NM_006216		Approved	PN1, GDN, PNI, nexin	uc002vnu.2	P07093	OTTHUMG00000133163	ENST00000258405.4:c.200T>A	chr2.hg19:g.224866418A>T	ENSP00000258405:p.Leu67Gln	63.0	0.0		63.0	27.0	NM_001136530	B2R6A4|B4DIF2|Q53S15|Q5D0C4	Missense_Mutation	SNP	ENST00000258405.4	hg19	CCDS2460.1	.	.	.	.	.	.	.	.	.	.	A	23.9	4.467241	0.84533	.	.	ENSG00000135919	ENST00000409304;ENST00000258405;ENST00000409840;ENST00000447280;ENST00000432738;ENST00000454956	D;D;D;D;D;D	0.86865	-2.18;-2.18;-2.18;-2.18;-2.18;-2.03	5.67	5.67	0.87782	Serpin domain (3);	0.135608	0.50627	D	0.000109	D	0.93874	0.8040	M	0.84585	2.705	0.52099	D	0.999947	D;D	0.71674	0.998;0.998	D;D	0.73380	0.98;0.98	D	0.94676	0.7861	10	0.72032	D	0.01	.	15.9132	0.79488	1.0:0.0:0.0:0.0	.	79;67	B4DIF2;P07093	.;GDN_HUMAN	Q	67;67;67;79;67;67	ENSP00000386412:L67Q;ENSP00000258405:L67Q;ENSP00000386969:L67Q;ENSP00000415786:L79Q;ENSP00000408452:L67Q;ENSP00000399655:L67Q	ENSP00000258405:L67Q	L	-	2	0	SERPINE2	224574662	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	6.387000	0.73191	2.148000	0.66965	0.533000	0.62120	CTG	.	.		0.567	SERPINE2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256865.2	NM_006216	
COL4A4	1286	hgsc.bcm.edu	37	2	227886777	227886777	+	Silent	SNP	G	G	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr2:227886777G>A	ENST00000396625.3	-	44	4410	c.4203C>T	c.(4201-4203)ggC>ggT	p.G1401G	COL4A4_ENST00000329662.7_Silent_p.G1398G	NM_000092.4	NP_000083.3	P53420	CO4A4_HUMAN	collagen, type IV, alpha 4	1401	Triple-helical region.				axon guidance (GO:0007411)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glomerular basement membrane development (GO:0032836)	basal lamina (GO:0005605)|collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(15)|lung(35)|ovary(5)|pancreas(3)|prostate(2)|skin(12)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	98		Renal(207;0.00844)|all_lung(227;0.0187)|Lung NSC(271;0.0879)|all_hematologic(139;0.21)|Esophageal squamous(248;0.242)		Epithelial(121;6.7e-11)|all cancers(144;5.39e-08)|Lung(261;0.0132)|LUSC - Lung squamous cell carcinoma(224;0.0181)		GTCCTGAGGGGCCTCTCATTC	0.483																																					p.G1401G		Atlas-SNP	.											.	COL4A4	215	.	0			c.C4203T						.						110.0	118.0	115.0					2																	227886777		1883	4105	5988	SO:0001819	synonymous_variant	1286	exon44			TGAGGGGCCTCTC		CCDS42828.1	2q35-q37	2014-09-17			ENSG00000081052	ENSG00000081052		"""Collagens"""	2206	protein-coding gene	gene with protein product	"""collagen of basement membrane, alpha-4 chain"""	120131				1639407	Standard	NM_000092		Approved	CA44	uc021vxs.1	P53420	OTTHUMG00000149892	ENST00000396625.3:c.4203C>T	chr2.hg19:g.227886777G>A		240.0	1.0		247.0	105.0	NM_000092	A8MTZ1|Q53RW9|Q53S42|Q53WR1	Silent	SNP	ENST00000396625.3	hg19	CCDS42828.1																																																																																			.	.		0.483	COL4A4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000313770.1	NM_000092	
FARP2	9855	hgsc.bcm.edu	37	2	242380941	242380941	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr2:242380941C>T	ENST00000264042.3	+	13	1551	c.1381C>T	c.(1381-1383)Ctc>Ttc	p.L461F	FARP2_ENST00000373287.4_Missense_Mutation_p.L461F|FARP2_ENST00000545004.1_Missense_Mutation_p.L461F	NM_014808.2	NP_055623.1	O94887	FARP2_HUMAN	FERM, RhoGEF and pleckstrin domain protein 2	461	Pro-rich.				actin cytoskeleton reorganization (GO:0031532)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|neuron remodeling (GO:0016322)|osteoclast differentiation (GO:0030316)|podosome assembly (GO:0071800)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rho GTPase activity (GO:0032321)|Rac protein signal transduction (GO:0016601)|regulation of integrin activation (GO:0033623)|regulation of Rac GTPase activity (GO:0032314)|semaphorin-plexin signaling pathway (GO:0071526)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extrinsic component of membrane (GO:0019898)	Rac guanyl-nucleotide exchange factor activity (GO:0030676)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(8)|lung(18)|ovary(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	43		all_cancers(19;4.88e-34)|all_epithelial(40;4.81e-14)|Breast(86;0.000141)|Renal(207;0.0143)|all_lung(227;0.0344)|Lung NSC(271;0.0886)|Ovarian(221;0.0905)|Esophageal squamous(248;0.131)|all_hematologic(139;0.182)|Melanoma(123;0.238)		Epithelial(32;1.81e-33)|all cancers(36;1.61e-30)|OV - Ovarian serous cystadenocarcinoma(60;6.83e-15)|Kidney(56;1.19e-08)|KIRC - Kidney renal clear cell carcinoma(57;8.98e-08)|BRCA - Breast invasive adenocarcinoma(100;1.49e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00125)|Colorectal(34;0.0199)|COAD - Colon adenocarcinoma(134;0.121)		GGCCCAGCCCCTCGGGCCCCC	0.637																																					p.L461F		Atlas-SNP	.											.	FARP2	92	.	0			c.C1381T						.						27.0	31.0	29.0					2																	242380941		2203	4298	6501	SO:0001583	missense	9855	exon13			CAGCCCCTCGGGC	AB018336	CCDS33424.1, CCDS63197.1	2q37.3	2013-01-10			ENSG00000006607	ENSG00000006607		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	16460	protein-coding gene	gene with protein product						9872452, 12351724	Standard	NM_001282984		Approved	KIAA0793, FIR, PLEKHC3, FRG	uc002wbi.2	O94887	OTTHUMG00000151574	ENST00000264042.3:c.1381C>T	chr2.hg19:g.242380941C>T	ENSP00000264042:p.Leu461Phe	96.0	0.0		89.0	40.0	NM_014808	B7Z6J8|F5GZ84|Q53QM5|Q8WU27|Q9UFE7	Missense_Mutation	SNP	ENST00000264042.3	hg19	CCDS33424.1	.	.	.	.	.	.	.	.	.	.	C	2.836	-0.241528	0.05906	.	.	ENSG00000006607	ENST00000264042;ENST00000545004;ENST00000373287;ENST00000413432	T;D;D;T	0.81579	-0.92;-1.51;-1.51;-1.45	5.08	3.21	0.36854	.	4.117010	0.00357	N	0.000034	T	0.72112	0.3420	N	0.14661	0.345	0.09310	N	1	B;B;P	0.35600	0.259;0.259;0.511	B;B;B	0.29524	0.103;0.064;0.101	T	0.64896	-0.6299	10	0.56958	D	0.05	.	16.4196	0.83754	0.0:0.7516:0.2484:0.0	.	461;461;461	O94887-2;F5GZ84;O94887	.;.;FARP2_HUMAN	F	461;461;461;148	ENSP00000264042:L461F;ENSP00000443876:L461F;ENSP00000362384:L461F;ENSP00000412772:L148F	ENSP00000264042:L461F	L	+	1	0	FARP2	242029614	0.001000	0.12720	0.000000	0.03702	0.001000	0.01503	1.336000	0.33850	0.552000	0.29026	-0.795000	0.03280	CTC	.	.		0.637	FARP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323153.1		
CAND2	23066	hgsc.bcm.edu	37	3	12858225	12858225	+	Silent	SNP	T	T	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr3:12858225T>A	ENST00000456430.2	+	10	1835	c.1794T>A	c.(1792-1794)ctT>ctA	p.L598L	CAND2_ENST00000295989.5_Silent_p.L505L	NM_001162499.1	NP_001155971.1	O75155	CAND2_HUMAN	cullin-associated and neddylation-dissociated 2 (putative)	598					positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	intracellular (GO:0005622)|nucleus (GO:0005634)				breast(3)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(8)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	37						TGGGCCACCTTGTAGGCCACC	0.627																																					p.L598L	GBM(43;676 868 1633 6395 37496)	Atlas-SNP	.											.	CAND2	138	.	0			c.T1794A						.						72.0	83.0	80.0					3																	12858225		2128	4227	6355	SO:0001819	synonymous_variant	23066	exon10			CCACCTTGTAGGC		CCDS43053.1, CCDS54554.1	3p25.2	2008-02-05			ENSG00000144712	ENSG00000144712			30689	protein-coding gene	gene with protein product	"""TBP interacting protein"""	610403				9734811, 10441524	Standard	NM_012298		Approved	TIP120B, KIAA0667, Tp120b	uc003bxk.2	O75155	OTTHUMG00000155397	ENST00000456430.2:c.1794T>A	chr3.hg19:g.12858225T>A		149.0	1.0		124.0	105.0	NM_001162499	B9EGM9|E9KL24	Silent	SNP	ENST00000456430.2	hg19	CCDS54554.1																																																																																			.	.		0.627	CAND2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339856.4	XM_371617	
NUP210	23225	hgsc.bcm.edu	37	3	13401819	13401819	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr3:13401819T>C	ENST00000254508.5	-	15	2187	c.2105A>G	c.(2104-2106)aAt>aGt	p.N702S		NM_024923.2	NP_079199.2	Q8TEM1	PO210_HUMAN	nucleoporin 210kDa	702					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)				NS(1)|biliary_tract(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(10)|liver(1)|lung(16)|ovary(7)|pancreas(1)|prostate(1)|skin(8)|upper_aerodigestive_tract(3)|urinary_tract(2)	66	all_neural(104;0.187)					TTGCTGATAATTCCGGGAGGA	0.582																																					p.N702S		Atlas-SNP	.											.	NUP210	182	.	0			c.A2105G						.						84.0	76.0	79.0					3																	13401819		2203	4300	6503	SO:0001583	missense	23225	exon15			TGATAATTCCGGG	AB020713	CCDS33704.1	3p25	2008-02-05			ENSG00000132182	ENSG00000132182			30052	protein-coding gene	gene with protein product		607703				2184032, 7504063	Standard	NM_024923		Approved	GP210, POM210, FLJ22389, KIAA0906	uc003bxv.1	Q8TEM1	OTTHUMG00000157268	ENST00000254508.5:c.2105A>G	chr3.hg19:g.13401819T>C	ENSP00000254508:p.Asn702Ser	161.0	0.0		115.0	101.0	NM_024923	A6NN56|O94980|Q6NXG6|Q8NBJ1|Q9H6C8|Q9UFP3	Missense_Mutation	SNP	ENST00000254508.5	hg19	CCDS33704.1	.	.	.	.	.	.	.	.	.	.	T	11.31	1.600159	0.28534	.	.	ENSG00000132182	ENST00000254508	T	0.23950	1.88	5.66	4.5	0.54988	.	0.097784	0.64402	D	0.000002	T	0.15869	0.0382	L	0.35288	1.05	0.34934	D	0.749603	B;B	0.20887	0.049;0.029	B;B	0.17722	0.019;0.015	T	0.17745	-1.0359	10	0.09084	T	0.74	-13.2169	7.8484	0.29440	0.0:0.2213:0.0:0.7787	.	702;702	Q8TEM1-2;Q8TEM1	.;PO210_HUMAN	S	702	ENSP00000254508:N702S	ENSP00000254508:N702S	N	-	2	0	NUP210	13376819	1.000000	0.71417	1.000000	0.80357	0.794000	0.44872	1.605000	0.36815	0.984000	0.38629	0.533000	0.62120	AAT	.	.		0.582	NUP210-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340085.1	NM_024923	
FGD5	152273	hgsc.bcm.edu	37	3	14860937	14860937	+	Nonsense_Mutation	SNP	C	C	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr3:14860937C>A	ENST00000285046.5	+	1	469	c.359C>A	c.(358-360)tCa>tAa	p.S120*	FGD5_ENST00000543601.1_5'UTR	NM_152536.3	NP_689749.3	Q6ZNL6	FGD5_HUMAN	FYVE, RhoGEF and PH domain containing 5	120	Glu-rich.				actin cytoskeleton organization (GO:0030036)|cytoskeleton organization (GO:0007010)|filopodium assembly (GO:0046847)|positive regulation of GTPase activity (GO:0043547)|regulation of Cdc42 GTPase activity (GO:0043088)|regulation of cell shape (GO:0008360)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|small GTPase binding (GO:0031267)			NS(2)|breast(2)|endometrium(3)|kidney(5)|large_intestine(10)|lung(25)|ovary(3)|pancreas(1)|prostate(2)|urinary_tract(1)	54						GGTGAGGATTCAGTGGCCCCT	0.632																																					p.S120X		Atlas-SNP	.											.	FGD5	248	.	0			c.C359A						.						18.0	22.0	20.0					3																	14860937		692	1590	2282	SO:0001587	stop_gained	152273	exon1			AGGATTCAGTGGC	AK097276	CCDS46767.1	3p25.1	2013-01-10			ENSG00000154783	ENSG00000154783		"""Zinc fingers, FYVE domain containing"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	19117	protein-coding gene	gene with protein product		614788					Standard	NM_152536		Approved	ZFYVE23, FLJ39957, FLJ00274	uc003bzc.3	Q6ZNL6	OTTHUMG00000155556	ENST00000285046.5:c.359C>A	chr3.hg19:g.14860937C>A	ENSP00000285046:p.Ser120*	204.0	1.0		187.0	158.0	NM_152536	B3KVQ3|Q6MZY1|Q7Z303|Q8IYP3|Q8N861|Q8N8G4	Nonsense_Mutation	SNP	ENST00000285046.5	hg19	CCDS46767.1	.	.	.	.	.	.	.	.	.	.	C	27.2	4.812810	0.90707	.	.	ENSG00000154783	ENST00000285046	.	.	.	5.66	-8.22	0.01037	.	2.531350	0.01468	N	0.016155	.	.	.	.	.	.	0.09310	N	0.999997	.	.	.	.	.	.	.	.	.	.	0.05351	T	0.99	2.683	10.449	0.44511	0.0:0.5465:0.2488:0.2047	.	.	.	.	X	120	.	ENSP00000285046:S120X	S	+	2	0	FGD5	14835941	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-0.686000	0.05161	-2.428000	0.00559	-1.094000	0.02160	TCA	.	.		0.632	FGD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340628.1	NM_152536	
ITGA9	3680	hgsc.bcm.edu	37	3	37774280	37774280	+	Silent	SNP	A	A	C			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr3:37774280A>C	ENST00000264741.5	+	19	2401	c.2145A>C	c.(2143-2145)tcA>tcC	p.S715S		NM_002207.2	NP_002198.2	Q13797	ITA9_HUMAN	integrin, alpha 9	715					axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)|neutrophil chemotaxis (GO:0030593)|wound healing (GO:0042060)	basal plasma membrane (GO:0009925)|integrin alpha9-beta1 complex (GO:0034679)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)			breast(3)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(17)|pancreas(1)|prostate(2)|skin(6)|stomach(1)|urinary_tract(1)	44				KIRC - Kidney renal clear cell carcinoma(284;0.165)|Kidney(284;0.197)		TCATGAGGTCAAAGTCAAAGG	0.562																																					p.S715S		Atlas-SNP	.											.	ITGA9	98	.	0			c.A2145C						.						81.0	74.0	76.0					3																	37774280		2203	4299	6502	SO:0001819	synonymous_variant	3680	exon19			GAGGTCAAAGTCA	L24158	CCDS2669.1	3p21.3	2010-03-23			ENSG00000144668	ENSG00000144668		"""Integrins"""	6145	protein-coding gene	gene with protein product	"""integrin, alpha 4-like"""	603963				8245132, 8290272	Standard	NM_002207		Approved	RLC, ITGA4L, ALPHA-RLC	uc003chd.3	Q13797	OTTHUMG00000130815	ENST00000264741.5:c.2145A>C	chr3.hg19:g.37774280A>C		92.0	0.0		74.0	63.0	NM_002207	Q14638	Silent	SNP	ENST00000264741.5	hg19	CCDS2669.1																																																																																			.	.		0.562	ITGA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253361.1	NM_002207	
SCN10A	6336	hgsc.bcm.edu	37	3	38766700	38766700	+	Missense_Mutation	SNP	A	A	C			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr3:38766700A>C	ENST00000449082.2	-	17	3192	c.3193T>G	c.(3193-3195)Tgg>Ggg	p.W1065G		NM_006514.2	NP_006505.2	Q9Y5Y9	SCNAA_HUMAN	sodium channel, voltage-gated, type X, alpha subunit	1065					AV node cell to bundle of His cell communication (GO:0086067)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of cardiac muscle contraction (GO:0055117)|regulation of heart rate (GO:0002027)|regulation of ion transmembrane transport (GO:0034765)|sensory perception (GO:0007600)|sensory perception of pain (GO:0019233)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	C-fiber (GO:0044299)|extracellular vesicular exosome (GO:0070062)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(5)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(14)|kidney(5)|large_intestine(33)|lung(54)|ovary(5)|pancreas(1)|prostate(5)|skin(13)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	150				KIRC - Kidney renal clear cell carcinoma(284;0.0769)|Kidney(284;0.0945)	Benzocaine(DB01086)|Bupivacaine(DB00297)|Chloroprocaine(DB01161)|Cinchocaine(DB00527)|Cocaine(DB00907)|Dyclonine(DB00645)|Hexylcaine(DB00473)|Lacosamide(DB06218)|Levobupivacaine(DB01002)|Lidocaine(DB00281)|Mepivacaine(DB00961)|Orphenadrine(DB01173)|Oxybuprocaine(DB00892)|Procaine(DB00721)|Proparacaine(DB00807)|Ropivacaine(DB00296)|Valproic Acid(DB00313)	TCATCTTTCCACGTCTCACCC	0.592																																					p.W1065G		Atlas-SNP	.											.	SCN10A	359	.	0			c.T3193G						.						79.0	77.0	78.0					3																	38766700		2203	4300	6503	SO:0001583	missense	6336	exon17			CTTTCCACGTCTC	AF117907	CCDS33736.1	3p22.2	2012-02-26	2007-01-23		ENSG00000185313	ENSG00000185313		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10582	protein-coding gene	gene with protein product		604427	"""sodium channel, voltage-gated, type X, alpha polypeptide"""			9839820, 10198179, 16382098	Standard	NM_006514		Approved	Nav1.8, hPN3, SNS, PN3	uc003ciq.3	Q9Y5Y9	OTTHUMG00000048245	ENST00000449082.2:c.3193T>G	chr3.hg19:g.38766700A>C	ENSP00000390600:p.Trp1065Gly	140.0	1.0		60.0	45.0	NM_006514	A6NDQ1	Missense_Mutation	SNP	ENST00000449082.2	hg19	CCDS33736.1	.	.	.	.	.	.	.	.	.	.	A	5.985	0.365674	0.11352	.	.	ENSG00000185313	ENST00000449082	D	0.83755	-1.76	4.8	-4.2	0.03823	Sodium ion transport-associated (1);	12.276300	0.00166	N	0.000000	T	0.74959	0.3785	L	0.42245	1.32	0.09310	N	1	B	0.06786	0.001	B	0.08055	0.003	T	0.57207	-0.7851	10	0.40728	T	0.16	.	5.8169	0.18497	0.381:0.2791:0.3399:0.0	.	1065	Q9Y5Y9	SCNAA_HUMAN	G	1065	ENSP00000390600:W1065G	ENSP00000390600:W1065G	W	-	1	0	SCN10A	38741704	0.000000	0.05858	0.000000	0.03702	0.052000	0.14988	-0.416000	0.07097	-0.625000	0.05604	-0.369000	0.07265	TGG	.	.		0.592	SCN10A-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109745.3	NM_006514	
SCN11A	11280	hgsc.bcm.edu	37	3	38926834	38926834	+	Silent	SNP	A	A	G			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr3:38926834A>G	ENST00000302328.3	-	17	3207	c.3009T>C	c.(3007-3009)ttT>ttC	p.F1003F	SCN11A_ENST00000444237.2_Silent_p.F1003F|SCN11A_ENST00000450244.1_Silent_p.F1003F|SCN11A_ENST00000456224.3_Silent_p.F965F	NM_014139.2	NP_054858.2	Q9UI33	SCNBA_HUMAN	sodium channel, voltage-gated, type XI, alpha subunit	1003					cell death (GO:0008219)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|regulation of sensory perception of pain (GO:0051930)|response to drug (GO:0042493)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	C-fiber (GO:0044299)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(3)|biliary_tract(1)|breast(4)|cervix(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(29)|lung(29)|ovary(3)|pancreas(2)|prostate(12)|skin(14)|upper_aerodigestive_tract(5)|urinary_tract(3)	119				Kidney(284;0.00202)|KIRC - Kidney renal clear cell carcinoma(284;0.00226)	Cocaine(DB00907)|Valproic Acid(DB00313)|Zonisamide(DB00909)	GTAACCATCCAAAGCCATCCT	0.433																																					p.F1003F		Atlas-SNP	.											.	SCN11A	296	.	0			c.T3009C						.						158.0	145.0	149.0					3																	38926834		2203	4300	6503	SO:0001819	synonymous_variant	11280	exon17			CCATCCAAAGCCA	AF126739	CCDS33737.1	3p22.2	2012-02-26	2007-01-23		ENSG00000168356	ENSG00000168356		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10583	protein-coding gene	gene with protein product		604385	"""sodium channel, voltage-gated, type XI, alpha polypeptide"", ""sodium channel, voltage-gated, type XII, alpha"""	SCN12A		10444332, 16382098	Standard	NM_014139		Approved	Nav1.9, NaN, SNS-2	uc021wvy.1	Q9UI33	OTTHUMG00000048246	ENST00000302328.3:c.3009T>C	chr3.hg19:g.38926834A>G		144.0	1.0		118.0	102.0	NM_014139	A6NN05|C9JD48|C9JR31|Q68K15|Q8NDX3|Q9UHE0|Q9UHM0	Silent	SNP	ENST00000302328.3	hg19	CCDS33737.1																																																																																			.	.		0.433	SCN11A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109746.4	NM_014139	
PTH1R	5745	hgsc.bcm.edu	37	3	46937344	46937344	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr3:46937344G>T	ENST00000313049.5	+	3	501	c.298G>T	c.(298-300)Ggc>Tgc	p.G100C	PTH1R_ENST00000490109.1_3'UTR|PTH1R_ENST00000430002.2_Missense_Mutation_p.G100C|PTH1R_ENST00000418619.1_Missense_Mutation_p.G100C|PTH1R_ENST00000449590.1_Missense_Mutation_p.G100C			Q03431	PTH1R_HUMAN	parathyroid hormone 1 receptor	100					adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|aging (GO:0007568)|bone mineralization (GO:0030282)|bone resorption (GO:0045453)|cell maturation (GO:0048469)|chondrocyte differentiation (GO:0002062)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|negative regulation of cell proliferation (GO:0008285)|osteoblast development (GO:0002076)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of inositol phosphate biosynthetic process (GO:0060732)|skeletal system development (GO:0001501)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|brush border membrane (GO:0031526)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	parathyroid hormone receptor activity (GO:0004991)|peptide hormone binding (GO:0017046)|protein self-association (GO:0043621)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(3)|liver(1)|lung(5)|skin(2)|stomach(1)|urinary_tract(2)	19					Preotact(DB05829)|Teriparatide(DB06285)	GGCACCCACTGGCAGCAGGTA	0.577											OREG0015543	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.G100C		Atlas-SNP	.											.	PTH1R	49	.	0			c.G298T						.						122.0	86.0	98.0					3																	46937344		2203	4300	6503	SO:0001583	missense	5745	exon4			CCCACTGGCAGCA		CCDS2747.1	3p22-p21.1	2012-08-10	2008-11-18	2008-11-18	ENSG00000160801	ENSG00000160801		"""GPCR / Class B : Parathyroid hormone receptors"""	9608	protein-coding gene	gene with protein product		168468	"""parathyroid hormone receptor 1"""	PTHR, PTHR1		8020952	Standard	NM_001184744		Approved		uc021wxg.1	Q03431	OTTHUMG00000133515	ENST00000313049.5:c.298G>T	chr3.hg19:g.46937344G>T	ENSP00000321999:p.Gly100Cys	132.0	1.0	943	100.0	90.0	NM_001184744	Q2M1U3	Missense_Mutation	SNP	ENST00000313049.5	hg19	CCDS2747.1	.	.	.	.	.	.	.	.	.	.	G	15.88	2.964705	0.53507	.	.	ENSG00000160801	ENST00000449590;ENST00000418619;ENST00000427125;ENST00000430002;ENST00000313049;ENST00000313063	T;T;T;T;T	0.52295	0.67;0.67;0.68;0.67;0.67	4.65	2.67	0.31697	GPCR, family 2, extracellular hormone receptor domain (1);	.	.	.	.	T	0.31670	0.0804	N	0.22421	0.69	0.42978	D	0.99445	D	0.54047	0.964	B	0.43754	0.43	T	0.10683	-1.0619	9	0.56958	D	0.05	.	5.6545	0.17635	0.2508:0.0:0.7492:0.0	.	100	Q03431	PTH1R_HUMAN	C	100;100;100;100;100;272	ENSP00000402723:G100C;ENSP00000411424:G100C;ENSP00000400977:G100C;ENSP00000413774:G100C;ENSP00000321999:G100C	ENSP00000321999:G100C	G	+	1	0	PTH1R	46912348	0.889000	0.30405	0.837000	0.33122	0.861000	0.49209	1.774000	0.38573	1.185000	0.42971	0.561000	0.74099	GGC	.	.		0.577	PTH1R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257481.1	NM_000316	
NBEAL2	23218	hgsc.bcm.edu	37	3	47042832	47042832	+	Silent	SNP	G	G	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr3:47042832G>T	ENST00000450053.3	+	29	4727	c.4548G>T	c.(4546-4548)ctG>ctT	p.L1516L	NBEAL2_ENST00000383740.2_5'UTR|NBEAL2_ENST00000292309.5_Silent_p.L1332L	NM_015175.2	NP_055990.1	Q6ZNJ1	NBEL2_HUMAN	neurobeachin-like 2	1516					blood coagulation (GO:0007596)|megakaryocyte development (GO:0035855)|platelet alpha granule organization (GO:0070889)|platelet formation (GO:0030220)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)				NS(1)|breast(1)|central_nervous_system(3)|cervix(2)|endometrium(8)|kidney(5)|large_intestine(9)|lung(9)|ovary(4)|pancreas(1)|prostate(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	51		Acute lymphoblastic leukemia(5;0.0534)		BRCA - Breast invasive adenocarcinoma(193;0.0012)|KIRC - Kidney renal clear cell carcinoma(197;0.00575)|Kidney(197;0.00656)		TGGGGGTCCTGGCCAGCCTCA	0.617																																					p.L1516L		Atlas-SNP	.											.	NBEAL2	267	.	0			c.G4548T						.						40.0	49.0	46.0					3																	47042832		2088	4232	6320	SO:0001819	synonymous_variant	23218	exon29			GGTCCTGGCCAGC	AB011112	CCDS46817.1	3p21.31	2014-09-17			ENSG00000160796	ENSG00000160796		"""WD repeat domain containing"""	31928	protein-coding gene	gene with protein product		614169					Standard	NM_015175		Approved	KIAA0540	uc003cqp.3	Q6ZNJ1	OTTHUMG00000156497	ENST00000450053.3:c.4548G>T	chr3.hg19:g.47042832G>T		56.0	0.0		41.0	36.0	NM_015175	O60288|Q6P994|Q6UX91|Q8NAC9	Silent	SNP	ENST00000450053.3	hg19	CCDS46817.1	.	.	.	.	.	.	.	.	.	.	G	6.564	0.472368	0.12461	.	.	ENSG00000160796	ENST00000416683	.	.	.	5.13	1.09	0.20402	.	.	.	.	.	T	0.44414	0.1292	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.23297	-1.0192	4	.	.	.	.	3.4722	0.07571	0.1567:0.1332:0.573:0.1372	.	.	.	.	L	804	.	.	W	+	2	0	NBEAL2	47017836	1.000000	0.71417	0.999000	0.59377	0.758000	0.43043	3.318000	0.51975	0.323000	0.23307	-0.251000	0.11542	TGG	.	.		0.617	NBEAL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344363.3	XM_291064	
STAB1	23166	hgsc.bcm.edu	37	3	52554842	52554842	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr3:52554842G>T	ENST00000321725.6	+	55	5805	c.5729G>T	c.(5728-5730)cGc>cTc	p.R1910L		NM_015136.2	NP_055951.2	Q9NY15	STAB1_HUMAN	stabilin 1	1910					cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|defense response to bacterium (GO:0042742)|inflammatory response (GO:0006954)|negative regulation of angiogenesis (GO:0016525)|oxidation-reduction process (GO:0055114)|receptor-mediated endocytosis (GO:0006898)	endocytic vesicle membrane (GO:0030666)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	hyaluronic acid binding (GO:0005540)|low-density lipoprotein particle binding (GO:0030169)|low-density lipoprotein receptor activity (GO:0005041)|protein disulfide oxidoreductase activity (GO:0015035)|scavenger receptor activity (GO:0005044)			breast(4)|central_nervous_system(3)|endometrium(7)|kidney(2)|large_intestine(13)|liver(1)|lung(27)|ovary(1)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(3)	76				BRCA - Breast invasive adenocarcinoma(193;1.73e-05)|Kidney(197;0.00182)|KIRC - Kidney renal clear cell carcinoma(197;0.00205)|OV - Ovarian serous cystadenocarcinoma(275;0.0482)		GCCTGCTGGCGCTTCTACCCG	0.662																																					p.R1910L		Atlas-SNP	.											.	STAB1	178	.	0			c.G5729T						.						126.0	149.0	141.0					3																	52554842		2203	4300	6503	SO:0001583	missense	23166	exon55			GCTGGCGCTTCTA	AJ275213	CCDS33768.1	3p21.31	2008-07-18			ENSG00000010327	ENSG00000010327			18628	protein-coding gene	gene with protein product	"""MS-1 antigen"", ""fasciclin egf-like, laminin-type egf-like, and link domain-containing scavenger receptor-1"", ""common lymphatic endothelial and vascular endothelial receptor-1"""	608560				11829752, 12077138	Standard	XM_005264973		Approved	KIAA0246, STAB-1, FEEL-1, CLEVER-1, FELE-1, FEX1	uc003dej.3	Q9NY15	OTTHUMG00000158574	ENST00000321725.6:c.5729G>T	chr3.hg19:g.52554842G>T	ENSP00000312946:p.Arg1910Leu	54.0	0.0		42.0	32.0	NM_015136	A7E297|Q8IUH0|Q8IUH1|Q93072	Missense_Mutation	SNP	ENST00000321725.6	hg19	CCDS33768.1	.	.	.	.	.	.	.	.	.	.	G	11.84	1.759652	0.31137	.	.	ENSG00000010327	ENST00000321725	D	0.85339	-1.97	5.49	2.16	0.27623	.	0.860267	0.10448	N	0.673413	T	0.74741	0.3756	L	0.44542	1.39	0.26403	N	0.976389	B	0.21905	0.062	B	0.19391	0.025	T	0.56998	-0.7886	10	0.11485	T	0.65	.	3.6654	0.08254	0.4212:0.1887:0.3901:0.0	.	1910	Q9NY15	STAB1_HUMAN	L	1910	ENSP00000312946:R1910L	ENSP00000312946:R1910L	R	+	2	0	STAB1	52529882	0.029000	0.19370	0.877000	0.34402	0.438000	0.31896	0.545000	0.23268	0.720000	0.32209	-0.137000	0.14449	CGC	.	.		0.662	STAB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351380.2	NM_015136	
CACNA1D	776	hgsc.bcm.edu	37	3	53700544	53700544	+	Nonsense_Mutation	SNP	G	G	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr3:53700544G>A	ENST00000350061.5	+	7	1609	c.1098G>A	c.(1096-1098)tgG>tgA	p.W366*	CACNA1D_ENST00000288139.4_Nonsense_Mutation_p.W366*|CACNA1D_ENST00000422281.2_Nonsense_Mutation_p.W366*	NM_001128840.1	NP_001122312.1	Q01668	CAC1D_HUMAN	calcium channel, voltage-dependent, L type, alpha 1D subunit	366					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|energy reserve metabolic process (GO:0006112)|membrane depolarization during action potential (GO:0086010)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|membrane repolarization during SA node cell action potential (GO:0086052)|positive regulation of calcium ion transport (GO:0051928)|regulation of atrial cardiac muscle cell membrane repolarization (GO:0060372)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of insulin secretion (GO:0050796)|regulation of potassium ion transmembrane transport (GO:1901379)|regulation of potassium ion transmembrane transporter activity (GO:1901016)|sensory perception of sound (GO:0007605)|small molecule metabolic process (GO:0044281)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|ankyrin binding (GO:0030506)|high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)|voltage-gated calcium channel activity involved in cardiac muscle cell action potential (GO:0086007)|voltage-gated calcium channel activity involved SA node cell action potential (GO:0086059)			breast(3)|central_nervous_system(9)|cervix(2)|endometrium(11)|kidney(7)|large_intestine(13)|liver(1)|lung(29)|ovary(6)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	90				BRCA - Breast invasive adenocarcinoma(193;0.00029)|KIRC - Kidney renal clear cell carcinoma(284;0.0145)|Kidney(284;0.0175)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)	Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Felodipine(DB01023)|Isradipine(DB00270)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	TGGAGGGCTGGACAGATGTGC	0.512																																					p.W366X		Atlas-SNP	.											.	CACNA1D	324	.	0			c.G1098A						.						160.0	161.0	161.0					3																	53700544		2203	4300	6503	SO:0001587	stop_gained	776	exon7			GGGCTGGACAGAT	AB209171	CCDS2872.1, CCDS46848.1, CCDS46849.1	3p14.3	2012-03-07			ENSG00000157388	ENSG00000157388		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1391	protein-coding gene	gene with protein product		114206		CCHL1A2, CACNL1A2		1664412	Standard	NM_000720		Approved	Cav1.3, CACH3, CACN4	uc003dgu.5	Q01668	OTTHUMG00000158278	ENST00000350061.5:c.1098G>A	chr3.hg19:g.53700544G>A	ENSP00000288133:p.Trp366*	123.0	0.0		128.0	6.0	NM_001128840	B0FYA3|Q13916|Q13931|Q71UT1|Q9UDC3	Nonsense_Mutation	SNP	ENST00000350061.5	hg19	CCDS46848.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	36|36	5.754693|5.754693	0.96890|0.96890	.|.	.|.	ENSG00000157388|ENSG00000157388	ENST00000481085|ENST00000350061;ENST00000288139;ENST00000422281;ENST00000481478	.|.	.|.	.|.	5.15|5.15	5.15|5.15	0.70609|0.70609	.|.	.|0.000000	.|0.64402	.|D	.|0.000001	T|.	0.46756|.	0.1409|.	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.34650|.	-0.9820|.	4|.	.|0.02654	.|T	.|1	.|.	18.8081|18.8081	0.92047|0.92047	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|.	.|.	.|.	E|X	52|366;366;366;39	.|.	.|ENSP00000288139:W366X	G|W	+|+	2|3	0|0	CACNA1D|CACNA1D	53675584|53675584	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.907000|0.907000	0.53573|0.53573	9.601000|9.601000	0.98297|0.98297	2.676000|2.676000	0.91093|0.91093	0.561000|0.561000	0.74099|0.74099	GGA|TGG	.	.		0.512	CACNA1D-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350557.1	NM_000720	
LRTM1	57408	hgsc.bcm.edu	37	3	54958771	54958771	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr3:54958771T>A	ENST00000273286.5	-	2	641	c.479A>T	c.(478-480)cAg>cTg	p.Q160L	CACNA2D3_ENST00000474759.1_Intron|CACNA2D3_ENST00000415676.2_Intron|LRTM1_ENST00000493075.1_Missense_Mutation_p.Q84L|CACNA2D3_ENST00000288197.5_Intron|CACNA2D3_ENST00000490478.1_Intron	NM_020678.2	NP_065729.1	Q9HBL6	LRTM1_HUMAN	leucine-rich repeats and transmembrane domains 1	160						integral component of membrane (GO:0016021)				breast(1)|endometrium(2)|large_intestine(7)|lung(6)|prostate(1)|skin(4)	21				KIRC - Kidney renal clear cell carcinoma(284;0.00975)|Kidney(284;0.0112)|OV - Ovarian serous cystadenocarcinoma(275;0.0502)		TCGATCAAGCTGCTGAAGCTG	0.473																																					p.Q160L		Atlas-SNP	.											.	LRTM1	52	.	0			c.A479T						.						101.0	100.0	101.0					3																	54958771		2203	4300	6503	SO:0001583	missense	57408	exon2			TCAAGCTGCTGAA	AF225421	CCDS2876.1	3p14.3	2006-01-02			ENSG00000144771	ENSG00000144771			25023	protein-coding gene	gene with protein product						12477932	Standard	NM_020678		Approved	HT017	uc003dhl.3	Q9HBL6	OTTHUMG00000158578	ENST00000273286.5:c.479A>T	chr3.hg19:g.54958771T>A	ENSP00000273286:p.Gln160Leu	187.0	0.0		140.0	123.0	NM_020678	Q8IUU2	Missense_Mutation	SNP	ENST00000273286.5	hg19	CCDS2876.1	.	.	.	.	.	.	.	.	.	.	T	12.75	2.030178	0.35797	.	.	ENSG00000144771	ENST00000273286;ENST00000493075	T;D	0.89681	4.32;-2.55	5.96	4.79	0.61399	.	0.482604	0.24206	N	0.040575	T	0.77805	0.4185	N	0.13198	0.31	0.28999	N	0.887578	B	0.15473	0.013	B	0.12837	0.008	T	0.67833	-0.5568	10	0.39692	T	0.17	.	6.9224	0.24395	0.1339:0.0691:0.0:0.797	.	160	Q9HBL6	LRTM1_HUMAN	L	160;84	ENSP00000273286:Q160L;ENSP00000419772:Q84L	ENSP00000273286:Q160L	Q	-	2	0	LRTM1	54933811	1.000000	0.71417	0.962000	0.40283	0.660000	0.38997	2.717000	0.47227	1.041000	0.40125	0.533000	0.62120	CAG	.	.		0.473	LRTM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351399.1	NM_020678	
KBTBD8	84541	hgsc.bcm.edu	37	3	67049479	67049479	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr3:67049479C>T	ENST00000417314.2	+	2	140	c.91C>T	c.(91-93)Cat>Tat	p.H31Y	KBTBD8_ENST00000460576.1_Intron|KBTBD8_ENST00000469661.1_3'UTR|KBTBD8_ENST00000295568.4_Missense_Mutation_p.H5Y			Q8NFY9	KBTB8_HUMAN	kelch repeat and BTB (POZ) domain containing 8	31						cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)				breast(1)|endometrium(1)|kidney(4)|large_intestine(7)|lung(4)|ovary(2)|prostate(1)	20		Lung NSC(201;0.0765)		BRCA - Breast invasive adenocarcinoma(55;6.02e-06)|KIRC - Kidney renal clear cell carcinoma(39;0.105)|Kidney(39;0.125)		GGACCCCTTCCATGCTTGCAG	0.443																																					p.H31Y		Atlas-SNP	.											.	KBTBD8	101	.	0			c.C91T						.						110.0	99.0	103.0					3																	67049479		2203	4300	6503	SO:0001583	missense	84541	exon2			CCCTTCCATGCTT	AF385438	CCDS2906.1, CCDS2906.2	3p14	2013-01-08			ENSG00000163376	ENSG00000163376		"""BTB/POZ domain containing"""	30691	protein-coding gene	gene with protein product	"""T-cell activation kelch repeat protein"""					11347906	Standard	NM_032505		Approved	TA-KRP, KIAA1842	uc003dmy.3	Q8NFY9	OTTHUMG00000158779	ENST00000417314.2:c.91C>T	chr3.hg19:g.67049479C>T	ENSP00000401878:p.His31Tyr	208.0	0.0		271.0	93.0	NM_032505	B4DTW6|Q96JI5	Missense_Mutation	SNP	ENST00000417314.2	hg19	CCDS2906.2	.	.	.	.	.	.	.	.	.	.	C	16.05	3.013483	0.54468	.	.	ENSG00000163376	ENST00000295568;ENST00000417314;ENST00000460784	T;T;T	0.71817	-0.6;-0.6;-0.6	5.52	5.52	0.82312	BTB/POZ fold (2);	0.048699	0.85682	D	0.000000	T	0.76630	0.4014	L	0.29908	0.895	0.80722	D	1	D	0.57899	0.981	D	0.67900	0.954	T	0.73069	-0.4099	10	0.30854	T	0.27	.	19.7984	0.96495	0.0:1.0:0.0:0.0	.	31	Q8NFY9	KBTB8_HUMAN	Y	5;31;5	ENSP00000295568:H5Y;ENSP00000401878:H31Y;ENSP00000418075:H5Y	ENSP00000295568:H5Y	H	+	1	0	KBTBD8	67132169	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.666000	0.83877	2.753000	0.94483	0.467000	0.42956	CAT	.	.		0.443	KBTBD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352189.1	NM_032505	
TMF1	7110	hgsc.bcm.edu	37	3	69097054	69097054	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr3:69097054T>C	ENST00000398559.2	-	2	1018	c.802A>G	c.(802-804)Ata>Gta	p.I268V	MIR3136_ENST00000583498.1_RNA|CTD-2013N24.2_ENST00000482368.2_RNA|TMF1_ENST00000543976.1_Missense_Mutation_p.I268V|CTD-2013N24.2_ENST00000595925.1_RNA|CTD-2013N24.2_ENST00000596274.1_RNA|CTD-2013N24.2_ENST00000596523.1_RNA|CTD-2013N24.2_ENST00000596732.1_RNA|CTD-2013N24.2_ENST00000601735.1_RNA|CTD-2013N24.2_ENST00000597950.1_RNA|CTD-2013N24.2_ENST00000598783.1_RNA			P82094	TMF1_HUMAN	TATA element modulatory factor 1	268					acrosome assembly (GO:0001675)|cellular response to organic cyclic compound (GO:0071407)|defense response to bacterium (GO:0042742)|Leydig cell differentiation (GO:0033327)|luteinizing hormone secretion (GO:0032275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of gene expression (GO:0010629)|positive regulation of cytokine production (GO:0001819)|positive regulation of testosterone secretion (GO:2000845)|regulation of proteasomal protein catabolic process (GO:0061136)|regulation of transcription, DNA-templated (GO:0006355)|sperm motility (GO:0030317)|spermatid nucleus differentiation (GO:0007289)|transcription from RNA polymerase II promoter (GO:0006366)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|transcription cofactor activity (GO:0003712)			cervix(1)|kidney(1)|large_intestine(4)|lung(13)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	22		Lung NSC(201;0.0193)|Prostate(884;0.174)		BRCA - Breast invasive adenocarcinoma(55;4.48e-05)|Epithelial(33;0.000274)|LUSC - Lung squamous cell carcinoma(21;0.0123)|KIRC - Kidney renal clear cell carcinoma(39;0.211)|Kidney(39;0.247)		CTCTCACTTATTACACTTTCA	0.418																																					p.I268V		Atlas-SNP	.											.	TMF1	77	.	0			c.A802G						.						55.0	54.0	54.0					3																	69097054		1882	4112	5994	SO:0001583	missense	7110	exon2			CACTTATTACACT		CCDS43105.1	3p21-p12	2009-02-11			ENSG00000144747	ENSG00000144747			11870	protein-coding gene	gene with protein product		601126				1409643	Standard	NM_007114		Approved	ARA160, TMF	uc003dnn.3	P82094	OTTHUMG00000158771	ENST00000398559.2:c.802A>G	chr3.hg19:g.69097054T>C	ENSP00000381567:p.Ile268Val	58.0	0.0		68.0	30.0	NM_007114	B7ZLJ2|Q17R87|Q59GK0	Missense_Mutation	SNP	ENST00000398559.2	hg19	CCDS43105.1	.	.	.	.	.	.	.	.	.	.	T	9.431	1.085664	0.20390	.	.	ENSG00000144747	ENST00000398559;ENST00000543976;ENST00000356248;ENST00000438636	T;T	0.77229	-1.08;-1.08	5.76	5.76	0.90799	.	0.184375	0.64402	D	0.000017	T	0.74092	0.3671	M	0.62723	1.935	0.38013	D	0.934615	P;B	0.40000	0.698;0.319	B;B	0.36030	0.216;0.107	T	0.75777	-0.3198	10	0.24483	T	0.36	-15.3798	16.0796	0.80995	0.0:0.0:0.0:1.0	.	268;268	P82094-2;P82094	.;TMF1_HUMAN	V	268;268;181;268	ENSP00000381567:I268V;ENSP00000438706:I268V	ENSP00000348582:I181V	I	-	1	0	TMF1	69179744	1.000000	0.71417	0.997000	0.53966	0.209000	0.24338	2.250000	0.43178	2.195000	0.70347	0.528000	0.53228	ATA	.	.		0.418	TMF1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000352106.1	NM_007114	
ROBO1	6091	hgsc.bcm.edu	37	3	78684981	78684981	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr3:78684981C>A	ENST00000464233.1	-	23	3428	c.3315G>T	c.(3313-3315)caG>caT	p.Q1105H	ROBO1_ENST00000495273.1_Missense_Mutation_p.Q1060H|ROBO1_ENST00000436010.2_Missense_Mutation_p.Q1066H|ROBO1_ENST00000467549.1_Missense_Mutation_p.Q1005H	NM_002941.3	NP_002932.1	Q9Y6N7	ROBO1_HUMAN	roundabout, axon guidance receptor, homolog 1 (Drosophila)	1105					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|axon guidance (GO:0007411)|axon midline choice point recognition (GO:0016199)|cell adhesion (GO:0007155)|cell migration involved in sprouting angiogenesis (GO:0002042)|chemorepulsion involved in postnatal olfactory bulb interneuron migration (GO:0021836)|homophilic cell adhesion (GO:0007156)|mammary duct terminal end bud growth (GO:0060763)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|negative regulation of negative chemotaxis (GO:0050925)|nervous system development (GO:0007399)|positive regulation of axonogenesis (GO:0050772)|Roundabout signaling pathway (GO:0035385)	axolemma (GO:0030673)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	axon guidance receptor activity (GO:0008046)|identical protein binding (GO:0042802)|LRR domain binding (GO:0030275)			breast(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(2)|lung(25)|urinary_tract(1)	44		Lung SC(41;0.0257)|Lung NSC(201;0.0439)		LUSC - Lung squamous cell carcinoma(21;0.008)|Epithelial(33;0.00999)|Lung(72;0.0177)|BRCA - Breast invasive adenocarcinoma(55;0.0274)		CTTCTTGTTTCTGCTGTCCCA	0.488																																					p.Q1105H		Atlas-SNP	.											.	ROBO1	833	.	0			c.G3315T						.						190.0	184.0	186.0					3																	78684981		2114	4246	6360	SO:0001583	missense	6091	exon23			TTGTTTCTGCTGT	AF040990	CCDS46872.1, CCDS46872.2, CCDS54610.1, CCDS54611.1	3p12.3	2013-02-11	2001-11-28		ENSG00000169855	ENSG00000169855		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	10249	protein-coding gene	gene with protein product		602430	"""roundabout (axon guidance receptor, Drosophila) homolog 1"""			9458045, 9608531	Standard	NM_002941		Approved	DUTT1, FLJ21882, SAX3	uc003dqe.2	Q9Y6N7	OTTHUMG00000158843	ENST00000464233.1:c.3315G>T	chr3.hg19:g.78684981C>A	ENSP00000420321:p.Gln1105His	275.0	0.0		326.0	95.0	NM_002941	B2RXI1|D3DU36|E9PD49|Q1RMC7|Q7Z300|Q9BUS7	Missense_Mutation	SNP	ENST00000464233.1	hg19	CCDS54611.1	.	.	.	.	.	.	.	.	.	.	C	10.71	1.427330	0.25726	.	.	ENSG00000169855	ENST00000436010;ENST00000398412;ENST00000464233;ENST00000495273;ENST00000467549;ENST00000398414	D;D;D;D	0.83506	-1.73;-1.73;-1.73;-1.73	6.05	2.72	0.32119	.	0.228402	0.47455	D	0.000235	T	0.76933	0.4057	L	0.50333	1.59	0.42234	D	0.991909	P;B;P;B;B	0.41848	0.763;0.228;0.731;0.343;0.346	B;B;B;B;B	0.44224	0.444;0.322;0.342;0.126;0.382	T	0.73477	-0.3970	9	.	.	.	.	5.0071	0.14293	0.0:0.5705:0.1767:0.2528	.	1069;1105;1060;1005;1066	Q9Y6N7-3;Q9Y6N7;B2RXI1;E9PD49;Q9Y6N7-4	.;ROBO1_HUMAN;.;.;.	H	1066;1060;1105;1060;1005;1109	ENSP00000406043:Q1066H;ENSP00000420321:Q1105H;ENSP00000420637:Q1060H;ENSP00000417992:Q1005H	.	Q	-	3	2	ROBO1	78767671	1.000000	0.71417	1.000000	0.80357	0.157000	0.22087	2.333000	0.43912	1.562000	0.49601	0.650000	0.86243	CAG	.	.		0.488	ROBO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352610.1	NM_002941	
ROBO1	6091	hgsc.bcm.edu	37	3	78711213	78711213	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr3:78711213A>T	ENST00000464233.1	-	15	2131	c.2018T>A	c.(2017-2019)cTg>cAg	p.L673Q	ROBO1_ENST00000495273.1_Missense_Mutation_p.L637Q|ROBO1_ENST00000436010.2_Missense_Mutation_p.L634Q|ROBO1_ENST00000467549.1_Missense_Mutation_p.L637Q	NM_002941.3	NP_002932.1	Q9Y6N7	ROBO1_HUMAN	roundabout, axon guidance receptor, homolog 1 (Drosophila)	673					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|axon guidance (GO:0007411)|axon midline choice point recognition (GO:0016199)|cell adhesion (GO:0007155)|cell migration involved in sprouting angiogenesis (GO:0002042)|chemorepulsion involved in postnatal olfactory bulb interneuron migration (GO:0021836)|homophilic cell adhesion (GO:0007156)|mammary duct terminal end bud growth (GO:0060763)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|negative regulation of negative chemotaxis (GO:0050925)|nervous system development (GO:0007399)|positive regulation of axonogenesis (GO:0050772)|Roundabout signaling pathway (GO:0035385)	axolemma (GO:0030673)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	axon guidance receptor activity (GO:0008046)|identical protein binding (GO:0042802)|LRR domain binding (GO:0030275)			breast(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(2)|lung(25)|urinary_tract(1)	44		Lung SC(41;0.0257)|Lung NSC(201;0.0439)		LUSC - Lung squamous cell carcinoma(21;0.008)|Epithelial(33;0.00999)|Lung(72;0.0177)|BRCA - Breast invasive adenocarcinoma(55;0.0274)		AGCATTTCCCAGCTCTCTCTG	0.483																																					p.L673Q		Atlas-SNP	.											.	ROBO1	833	.	0			c.T2018A						.						77.0	86.0	83.0					3																	78711213		1971	4153	6124	SO:0001583	missense	6091	exon15			TTTCCCAGCTCTC	AF040990	CCDS46872.1, CCDS46872.2, CCDS54610.1, CCDS54611.1	3p12.3	2013-02-11	2001-11-28		ENSG00000169855	ENSG00000169855		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	10249	protein-coding gene	gene with protein product		602430	"""roundabout (axon guidance receptor, Drosophila) homolog 1"""			9458045, 9608531	Standard	NM_002941		Approved	DUTT1, FLJ21882, SAX3	uc003dqe.2	Q9Y6N7	OTTHUMG00000158843	ENST00000464233.1:c.2018T>A	chr3.hg19:g.78711213A>T	ENSP00000420321:p.Leu673Gln	232.0	0.0		291.0	86.0	NM_002941	B2RXI1|D3DU36|E9PD49|Q1RMC7|Q7Z300|Q9BUS7	Missense_Mutation	SNP	ENST00000464233.1	hg19	CCDS54611.1	.	.	.	.	.	.	.	.	.	.	A	25.8	4.677084	0.88445	.	.	ENSG00000169855	ENST00000436010;ENST00000398412;ENST00000464233;ENST00000495273;ENST00000467549;ENST00000398414	T;T;T;T	0.66815	-0.19;-0.21;-0.23;-0.15	5.48	5.48	0.80851	Fibronectin, type III (2);	0.000000	0.85682	D	0.000000	T	0.81226	0.4778	M	0.73962	2.25	0.58432	D	0.999998	D;D;D;D;D;D	0.89917	0.997;1.0;1.0;1.0;1.0;0.987	D;D;D;D;D;D	0.91635	0.994;0.997;0.999;0.999;0.997;0.972	T	0.82014	-0.0667	9	.	.	.	.	15.5603	0.76240	1.0:0.0:0.0:0.0	.	637;637;673;637;637;634	Q9Y6N7-3;Q1RMC7;Q9Y6N7;B2RXI1;E9PD49;Q9Y6N7-4	.;.;ROBO1_HUMAN;.;.;.	Q	634;637;673;637;637;677	ENSP00000406043:L634Q;ENSP00000420321:L673Q;ENSP00000420637:L637Q;ENSP00000417992:L637Q	.	L	-	2	0	ROBO1	78793903	1.000000	0.71417	1.000000	0.80357	0.886000	0.51366	9.322000	0.96357	2.072000	0.62099	0.454000	0.30748	CTG	.	.		0.483	ROBO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352610.1	NM_002941	
ZBED2	79413	hgsc.bcm.edu	37	3	111312691	111312691	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr3:111312691G>T	ENST00000317012.4	-	2	1366	c.358C>A	c.(358-360)Cag>Aag	p.Q120K	CD96_ENST00000352690.4_Intron|CD96_ENST00000283285.5_Intron|CD96_ENST00000438817.2_Intron	NM_024508.4	NP_078784.2	Q9BTP6	ZBED2_HUMAN	zinc finger, BED-type containing 2	120							DNA binding (GO:0003677)|metal ion binding (GO:0046872)			large_intestine(3)|lung(1)|skin(2)	6						TCCTGGCGCTGCCCAGCCTGA	0.642																																					p.Q120K		Atlas-SNP	.											.	ZBED2	22	.	0			c.C358A						.						37.0	37.0	37.0					3																	111312691		2203	4300	6503	SO:0001583	missense	79413	exon2			GGCGCTGCCCAGC	BC003536	CCDS2960.2	3p13-q13.2	2013-05-03			ENSG00000177494	ENSG00000177494		"""Zinc fingers, BED-type"""	20710	protein-coding gene	gene with protein product		615246				23533661	Standard	NM_024508		Approved	MGC10796	uc003dxy.3	Q9BTP6	OTTHUMG00000074061	ENST00000317012.4:c.358C>A	chr3.hg19:g.111312691G>T	ENSP00000321370:p.Gln120Lys	70.0	0.0		67.0	30.0	NM_024508	D3DN62	Missense_Mutation	SNP	ENST00000317012.4	hg19	CCDS2960.2	.	.	.	.	.	.	.	.	.	.	G	0.076	-1.192517	0.01607	.	.	ENSG00000177494	ENST00000317012	.	.	.	4.34	2.47	0.30058	.	0.389775	0.18529	U	0.138555	T	0.27419	0.0673	L	0.44542	1.39	0.09310	N	1	B	0.18310	0.027	B	0.09377	0.004	T	0.20371	-1.0277	9	0.12766	T	0.61	.	5.1522	0.15015	0.1076:0.0:0.6884:0.204	.	120	Q9BTP6	ZBED2_HUMAN	K	120	.	ENSP00000321370:Q120K	Q	-	1	0	ZBED2	112795381	0.120000	0.22244	0.084000	0.20598	0.231000	0.25187	1.955000	0.40372	0.535000	0.28714	0.467000	0.42956	CAG	.	.		0.642	ZBED2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157228.2	NM_024508	
PLCXD2	257068	hgsc.bcm.edu	37	3	111394182	111394182	+	Silent	SNP	C	C	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr3:111394182C>A	ENST00000477665.1	+	1	414	c.90C>A	c.(88-90)gtC>gtA	p.V30V	PLCXD2_ENST00000393934.3_Silent_p.V30V|PLCXD2-AS1_ENST00000493131.1_RNA	NM_001185106.1	NP_001172035.1	Q0VAA5	PLCX2_HUMAN	phosphatidylinositol-specific phospholipase C, X domain containing 2	30					lipid catabolic process (GO:0016042)		phosphoric diester hydrolase activity (GO:0008081)|signal transducer activity (GO:0004871)			endometrium(1)|large_intestine(5)|lung(9)|prostate(1)|skin(1)	17						CATCGGAGGTCTGCAATGCCG	0.562																																					p.V30V		Atlas-SNP	.											.	PLCXD2	36	.	0			c.C90A						.						160.0	142.0	148.0					3																	111394182		2203	4300	6503	SO:0001819	synonymous_variant	257068	exon1			GGAGGTCTGCAAT	AK056141	CCDS2961.1, CCDS54619.1	3q13.2	2004-09-09			ENSG00000240891	ENSG00000240891			26462	protein-coding gene	gene with protein product							Standard	NM_001185106		Approved	FLJ31579	uc003dxz.3	Q0VAA5	OTTHUMG00000159279	ENST00000477665.1:c.90C>A	chr3.hg19:g.111394182C>A		266.0	0.0		213.0	91.0	NM_001185106	Q96N12	Silent	SNP	ENST00000477665.1	hg19	CCDS54619.1																																																																																			.	.		0.562	PLCXD2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000354322.1	NM_153268	
CCDC80	151887	hgsc.bcm.edu	37	3	112358178	112358178	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr3:112358178T>C	ENST00000206423.3	-	2	1528	c.575A>G	c.(574-576)cAg>cGg	p.Q192R	CCDC80_ENST00000439685.2_Missense_Mutation_p.Q192R|CCDC80_ENST00000475181.1_5'Flank	NM_199511.1|NM_199512.1	NP_955805.1|NP_955806.1	Q76M96	CCD80_HUMAN	coiled-coil domain containing 80	192					extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)	basement membrane (GO:0005604)|interstitial matrix (GO:0005614)	heparin binding (GO:0008201)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|liver(1)|lung(21)|ovary(3)|pancreas(2)|prostate(4)	51						CTCACCTGCCTGGTGGAAGAG	0.587																																					p.Q192R		Atlas-SNP	.											.	CCDC80	100	.	0			c.A575G						.						86.0	66.0	73.0					3																	112358178		2203	4300	6503	SO:0001583	missense	151887	exon2			CCTGCCTGGTGGA	AY333429	CCDS2968.1	3q13.2	2010-12-24			ENSG00000091986	ENSG00000091986			30649	protein-coding gene	gene with protein product	"""steroid sensitive gene 1"""	608298				15325258, 18178152	Standard	XM_005247135		Approved	URB, SSG1, DRO1	uc003dzf.3	Q76M96	OTTHUMG00000159265	ENST00000206423.3:c.575A>G	chr3.hg19:g.112358178T>C	ENSP00000206423:p.Gln192Arg	126.0	0.0		130.0	63.0	NM_199511	D3DN67|Q5PR20|Q6GPG9|Q8IVT6|Q8NBV1|Q8NHY8	Missense_Mutation	SNP	ENST00000206423.3	hg19	CCDS2968.1	.	.	.	.	.	.	.	.	.	.	T	17.78	3.473089	0.63737	.	.	ENSG00000091986	ENST00000206423;ENST00000439685	T;T	0.42513	0.97;0.97	5.55	3.02	0.34903	.	0.266613	0.38111	N	0.001816	T	0.24967	0.0606	N	0.21097	0.63	0.80722	D	1	B;B;B	0.15141	0.005;0.0;0.012	B;B;B	0.14578	0.004;0.003;0.011	T	0.05022	-1.0911	10	0.21014	T	0.42	-14.0638	8.0814	0.30748	0.0:0.0706:0.1354:0.794	.	203;192;192	Q76M96-2;A3KC71;Q76M96	.;.;CCD80_HUMAN	R	192	ENSP00000206423:Q192R;ENSP00000411814:Q192R	ENSP00000206423:Q192R	Q	-	2	0	CCDC80	113840868	1.000000	0.71417	0.999000	0.59377	0.838000	0.47535	4.113000	0.57851	0.932000	0.37266	0.528000	0.53228	CAG	.	.		0.587	CCDC80-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354219.1	NM_199511	
BOC	91653	hgsc.bcm.edu	37	3	112993376	112993376	+	Silent	SNP	A	A	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr3:112993376A>T	ENST00000495514.1	+	9	2093	c.1389A>T	c.(1387-1389)ccA>ccT	p.P463P	BOC_ENST00000273395.4_Silent_p.P463P|BOC_ENST00000497495.1_3'UTR|BOC_ENST00000355385.3_Silent_p.P463P			Q9BWV1	BOC_HUMAN	BOC cell adhesion associated, oncogene regulated	463					axon guidance (GO:0007411)|cell adhesion (GO:0007155)|muscle cell differentiation (GO:0042692)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of myoblast differentiation (GO:0045663)|smoothened signaling pathway (GO:0007224)	axonal growth cone (GO:0044295)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)				NS(1)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(17)|lung(18)|ovary(4)|pancreas(1)|prostate(2)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	68			Epithelial(53;0.227)			CGCAGTGTCCAGGAGAGAAGG	0.662																																					p.P463P		Atlas-SNP	.											.	BOC	139	.	0			c.A1389T						.						24.0	28.0	26.0					3																	112993376		2203	4298	6501	SO:0001819	synonymous_variant	91653	exon9			GTGTCCAGGAGAG	AY027658	CCDS2971.1	3q13.2	2013-02-11	2012-12-07		ENSG00000144857	ENSG00000144857		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	17173	protein-coding gene	gene with protein product	"""brother of CDO"", ""brother of CDON"", ""cell adhesion associated, oncogene regulated 2"""	608708	"""Boc homolog (mouse)"""			11782431	Standard	NM_033254		Approved	CDON2	uc003dzy.3	Q9BWV1	OTTHUMG00000159305	ENST00000495514.1:c.1389A>T	chr3.hg19:g.112993376A>T		182.0	0.0		129.0	61.0	NM_033254	A6NJ30|B2RMS8|D3DN70|Q6UXJ5|Q8N2P7|Q8NF26	Silent	SNP	ENST00000495514.1	hg19	CCDS2971.1																																																																																			.	.		0.662	BOC-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000354485.3	NM_033254	
C3orf30	152405	hgsc.bcm.edu	37	3	118865983	118865983	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr3:118865983A>G	ENST00000295622.1	+	1	987	c.947A>G	c.(946-948)gAa>gGa	p.E316G	IGSF11_ENST00000441144.2_5'Flank|RP11-484M3.5_ENST00000490594.1_5'Flank|IGSF11_ENST00000354673.2_5'Flank|IGSF11_ENST00000425327.2_5'Flank	NM_152539.2	NP_689752.2	Q96M34	CC030_HUMAN	chromosome 3 open reading frame 30	316										NS(1)|breast(1)|cervix(1)|endometrium(1)|large_intestine(6)|lung(20)|ovary(2)|prostate(1)|urinary_tract(1)	34				GBM - Glioblastoma multiforme(114;0.222)		CAAGCCACTGAACTAGCTGAA	0.478																																					p.E316G		Atlas-SNP	.											.	C3orf30	64	.	0			c.A947G						.						94.0	80.0	84.0					3																	118865983		2203	4300	6503	SO:0001583	missense	152405	exon1			CCACTGAACTAGC	AK057421	CCDS2984.1	3q13.32	2011-08-09			ENSG00000163424	ENSG00000163424			26553	protein-coding gene	gene with protein product							Standard	NM_152539		Approved	FLJ32859	uc003ecb.1	Q96M34	OTTHUMG00000159349	ENST00000295622.1:c.947A>G	chr3.hg19:g.118865983A>G	ENSP00000295622:p.Glu316Gly	130.0	0.0		136.0	57.0	NM_152539	A1L4B7	Missense_Mutation	SNP	ENST00000295622.1	hg19	CCDS2984.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	9.659|9.659	1.143729|1.143729	0.21205|0.21205	.|.	.|.	ENSG00000163424|ENSG00000163424	ENST00000295622;ENST00000470341|ENST00000460150;ENST00000473121;ENST00000492792	T|.	0.13307|.	2.6|.	4.6|4.6	-5.02|-5.02	0.02982|0.02982	.|.	1.587660|.	0.03610|.	N|.	0.234734|.	T|.	0.17916|.	0.0430|.	N|N	0.25647|0.25647	0.755|0.755	0.09310|0.09310	N|N	1|1	B;B|.	0.16802|.	0.017;0.019|.	B;B|.	0.14578|.	0.007;0.011|.	T|.	0.26744|.	-1.0094|.	10|.	0.22109|.	T|.	0.4|.	-0.2957|-0.2957	0.9074|0.9074	0.01287|0.01287	0.2442:0.1393:0.344:0.2725|0.2442:0.1393:0.344:0.2725	.|.	316;316|.	E9PFE5;Q96M34|.	.;CC030_HUMAN|.	G|W	316|279;108;50	ENSP00000295622:E316G|.	ENSP00000295622:E316G|.	E|X	+|+	2|3	0|0	C3orf30|C3orf30	120348673|120348673	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.000000|0.000000	0.00434|0.00434	0.727000|0.727000	0.25999|0.25999	-0.902000|-0.902000	0.03886|0.03886	-0.468000|-0.468000	0.05107|0.05107	GAA|TGA	.	.		0.478	C3orf30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354838.1	NM_152539	
POLQ	10721	hgsc.bcm.edu	37	3	121208148	121208148	+	Silent	SNP	C	C	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr3:121208148C>T	ENST00000264233.5	-	16	3758	c.3630G>A	c.(3628-3630)caG>caA	p.Q1210Q		NM_199420.3	NP_955452.3	O75417	DPOLQ_HUMAN	polymerase (DNA directed), theta	1210					ATP catabolic process (GO:0006200)|DNA repair (GO:0006281)	nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|damaged DNA binding (GO:0003684)|DNA-directed DNA polymerase activity (GO:0003887)|single-stranded DNA-dependent ATPase activity (GO:0043142)			NS(2)|breast(7)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|lung(55)|ovary(5)|prostate(3)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(2)	120				GBM - Glioblastoma multiforme(114;0.0915)		TTATATTTTTCTGTTTGGTAA	0.338								DNA polymerases (catalytic subunits)																													p.Q1210Q	Pancreas(152;907 1925 26081 31236 36904)	Atlas-SNP	.											.	POLQ	273	.	0			c.G3630A						.						176.0	183.0	181.0					3																	121208148		2203	4300	6503	SO:0001819	synonymous_variant	10721	exon16			ATTTTTCTGTTTG	AF052573	CCDS33833.1	3q13.3	2012-05-18			ENSG00000051341	ENSG00000051341	2.7.7.7	"""DNA polymerases"""	9186	protein-coding gene	gene with protein product		604419				10395804	Standard	NM_199420		Approved	POLH	uc003eee.4	O75417	OTTHUMG00000159396	ENST00000264233.5:c.3630G>A	chr3.hg19:g.121208148C>T		109.0	0.0		121.0	53.0	NM_199420	O95160|Q6VMB5	Silent	SNP	ENST00000264233.5	hg19	CCDS33833.1																																																																																			.	.		0.338	POLQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355097.1	NM_199420	
KBTBD12	166348	hgsc.bcm.edu	37	3	127642796	127642796	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr3:127642796A>T	ENST00000405109.1	+	2	1359	c.892A>T	c.(892-894)Agt>Tgt	p.S298C	KBTBD12_ENST00000405256.1_Missense_Mutation_p.S298C|KBTBD12_ENST00000343941.4_Intron|KBTBD12_ENST00000407609.3_Intron			Q3ZCT8	KBTBC_HUMAN	kelch repeat and BTB (POZ) domain containing 12	298										endometrium(1)|large_intestine(6)|lung(5)|ovary(1)	13						TGGGGATGCCAGTTTTTGTTA	0.428																																					p.S298C		Atlas-SNP	.											.	KBTBD12	41	.	0			c.A892T						.						132.0	126.0	128.0					3																	127642796		1923	4118	6041	SO:0001583	missense	166348	exon1			GATGCCAGTTTTT		CCDS33848.2	3q21.3	2013-01-08	2009-10-01	2009-10-01	ENSG00000187715	ENSG00000187715		"""BTB/POZ domain containing"""	25731	protein-coding gene	gene with protein product			"""kelch domain containing 6"""	KLHDC6			Standard	NM_207335		Approved	FLJ46299	uc010hsr.3	Q3ZCT8	OTTHUMG00000150508	ENST00000405109.1:c.892A>T	chr3.hg19:g.127642796A>T	ENSP00000385957:p.Ser298Cys	162.0	0.0		131.0	60.0	NM_207335	B5MCC6|Q6ZRK1	Missense_Mutation	SNP	ENST00000405109.1	hg19	CCDS33848.2	.	.	.	.	.	.	.	.	.	.	A	22.1	4.244133	0.79912	.	.	ENSG00000187715	ENST00000405109;ENST00000405256	T;T	0.66638	-0.22;-0.22	5.47	5.47	0.80525	Kelch-type beta propeller (1);	.	.	.	.	T	0.79435	0.4445	M	0.63843	1.955	0.58432	D	0.999996	D	0.89917	1.0	D	0.85130	0.997	T	0.78770	-0.2074	9	0.40728	T	0.16	.	15.8475	0.78903	1.0:0.0:0.0:0.0	.	298	Q3ZCT8	KBTBC_HUMAN	C	298	ENSP00000385957:S298C;ENSP00000385879:S298C	ENSP00000385957:S298C	S	+	1	0	KBTBD12	129125486	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.910000	0.92685	2.207000	0.71202	0.477000	0.44152	AGT	.	.		0.428	KBTBD12-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318682.1	NM_207335	
COL6A6	131873	hgsc.bcm.edu	37	3	130290136	130290136	+	Missense_Mutation	SNP	T	T	G			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr3:130290136T>G	ENST00000358511.6	+	6	2907	c.2876T>G	c.(2875-2877)aTg>aGg	p.M959R	COL6A6_ENST00000453409.2_Missense_Mutation_p.M959R	NM_001102608.1	NP_001096078.1	A6NMZ7	CO6A6_HUMAN	collagen, type VI, alpha 6	959	Nonhelical region.|VWFA 5. {ECO:0000255|PROSITE- ProRule:PRU00219}.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				NS(2)|breast(5)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(30)|lung(57)|ovary(8)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	134						CTGTTAGCCATGGCAGGATCA	0.498																																					p.M959R		Atlas-SNP	.											.	COL6A6	497	.	0			c.T2876G						.						54.0	53.0	53.0					3																	130290136		1978	4172	6150	SO:0001583	missense	131873	exon6			TAGCCATGGCAGG	AL713792	CCDS46911.1	3q22.1	2013-01-16			ENSG00000206384	ENSG00000206384		"""Collagens"""	27023	protein-coding gene	gene with protein product							Standard	NM_001102608		Approved		uc010htl.3	A6NMZ7	OTTHUMG00000159653	ENST00000358511.6:c.2876T>G	chr3.hg19:g.130290136T>G	ENSP00000351310:p.Met959Arg	240.0	0.0		193.0	80.0	NM_001102608	A7DZQ0|A7DZQ1|A7DZQ2|Q69YT0	Missense_Mutation	SNP	ENST00000358511.6	hg19	CCDS46911.1	.	.	.	.	.	.	.	.	.	.	T	20.3	3.974784	0.74360	.	.	ENSG00000206384	ENST00000358511;ENST00000453409	T;T	0.79033	-1.23;-1.23	4.82	4.82	0.62117	von Willebrand factor, type A (3);	0.000000	0.64402	D	0.000002	D	0.85452	0.5700	M	0.78049	2.395	0.45272	D	0.998278	D	0.61080	0.989	P	0.58172	0.834	D	0.87838	0.2649	10	0.87932	D	0	.	14.3361	0.66592	0.0:0.0:0.0:1.0	.	959	A6NMZ7	CO6A6_HUMAN	R	959	ENSP00000351310:M959R;ENSP00000399236:M959R	ENSP00000351310:M959R	M	+	2	0	COL6A6	131772826	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	7.455000	0.80726	1.946000	0.56461	0.459000	0.35465	ATG	.	.		0.498	COL6A6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000356705.5	NM_001102608	
ACPP	55	hgsc.bcm.edu	37	3	132075574	132075574	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr3:132075574A>T	ENST00000336375.5	+	10	1103	c.1013A>T	c.(1012-1014)gAg>gTg	p.E338V	ACPP_ENST00000475741.1_Missense_Mutation_p.E305V|ACPP_ENST00000351273.7_Missense_Mutation_p.E338V	NM_001099.4	NP_001090.2	P15309	PPAP_HUMAN	acid phosphatase, prostate	338					adenosine metabolic process (GO:0046085)|dephosphorylation (GO:0016311)|nucleotide metabolic process (GO:0009117)|positive regulation of adenosine receptor signaling pathway (GO:0060168)|purine nucleobase metabolic process (GO:0006144)|regulation of sensory perception of pain (GO:0051930)|thiamine metabolic process (GO:0006772)	apical part of cell (GO:0045177)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|Golgi cisterna (GO:0031985)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|lysosomal membrane (GO:0005765)|multivesicular body (GO:0005771)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|secretory granule (GO:0030141)|vesicle membrane (GO:0012506)	5'-nucleotidase activity (GO:0008253)|acid phosphatase activity (GO:0003993)|choline binding (GO:0033265)|identical protein binding (GO:0042802)|lysophosphatidic acid phosphatase activity (GO:0052642)|phosphatase activity (GO:0016791)|thiamine phosphate phosphatase activity (GO:0042131)	p.E334_Y340delETQHEPY(1)		NS(1)|breast(1)|endometrium(2)|large_intestine(5)|lung(13)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	27						ACGCAGCACGAGCCGTATCCC	0.557																																					p.E338V		Atlas-SNP	.											.	ACPP	118	.	1	Deletion - In frame(1)	ovary(1)	c.A1013T						.						163.0	146.0	151.0					3																	132075574		2203	4300	6503	SO:0001583	missense	55	exon10			AGCACGAGCCGTA		CCDS3073.1, CCDS46916.1	3q22.1	2012-05-16			ENSG00000014257	ENSG00000014257	3.1.3.2		125	protein-coding gene	gene with protein product		171790					Standard	NM_001099		Approved	ACP3, ACP-3	uc003eop.4	P15309	OTTHUMG00000159650	ENST00000336375.5:c.1013A>T	chr3.hg19:g.132075574A>T	ENSP00000337471:p.Glu338Val	158.0	0.0		99.0	26.0	NM_001099	D3DNC6|Q5FBY0|Q96KY0|Q96QK9|Q96QM0	Missense_Mutation	SNP	ENST00000336375.5	hg19	CCDS3073.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	13.21|13.21	2.170431|2.170431	0.38315|0.38315	.|.	.|.	ENSG00000014257|ENSG00000014257	ENST00000336375;ENST00000475741;ENST00000351273|ENST00000507647	T;T;T|.	0.17213|.	2.29;2.29;2.29|.	5.67|5.67	4.52|4.52	0.55395|0.55395	.|.	0.166448|.	0.41605|.	D|.	0.000857|.	T|T	0.61098|0.61098	0.2320|0.2320	M|M	0.84948|0.84948	2.725|2.725	0.25774|0.25774	N|N	0.9848|0.9848	P;P;D|.	0.56287|.	0.785;0.863;0.975|.	B;B;P|.	0.45660|.	0.197;0.359;0.489|.	T|T	0.57039|0.57039	-0.7879|-0.7879	10|5	0.72032|.	D|.	0.01|.	.|.	8.2264|8.2264	0.31570|0.31570	0.911:0.0:0.089:0.0|0.911:0.0:0.089:0.0	.|.	338;338;305|.	P15309;P15309-2;Q5FBY0|.	PPAP_HUMAN;.;.|.	V|C	338;305;338|23	ENSP00000337471:E338V;ENSP00000417744:E305V;ENSP00000323036:E338V|.	ENSP00000337471:E338V|.	E|S	+|+	2|1	0|0	ACPP|ACPP	133558264|133558264	0.999000|0.999000	0.42202|0.42202	0.081000|0.081000	0.20488|0.20488	0.121000|0.121000	0.20230|0.20230	2.867000|2.867000	0.48428|0.48428	0.997000|0.997000	0.38969|0.38969	0.533000|0.533000	0.62120|0.62120	GAG|AGC	.	.		0.557	ACPP-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000356699.2	NM_001099	
C3orf36	80111	hgsc.bcm.edu	37	3	133647332	133647332	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr3:133647332A>G	ENST00000408895.2	-	1	1324	c.316T>C	c.(316-318)Tgc>Cgc	p.C106R		NM_025041.2	NP_079317.2	Q3SXR2	CC036_HUMAN	chromosome 3 open reading frame 36	106										breast(1)|endometrium(1)|large_intestine(2)|lung(1)|ovary(1)	6						CCAGGTGAGCAAGGTGGGGGC	0.677																																					p.C106R		Atlas-SNP	.											.	C3orf36	13	.	0			c.T316C						.						29.0	32.0	31.0					3																	133647332		2203	4299	6502	SO:0001583	missense	80111	exon1			GTGAGCAAGGTGG	AK025826	CCDS3083.1	3q22.1	2011-09-30			ENSG00000221972	ENSG00000221972			26170	protein-coding gene	gene with protein product						12477932	Standard	NM_025041		Approved	FLJ22173	uc003epz.1	Q3SXR2		ENST00000408895.2:c.316T>C	chr3.hg19:g.133647332A>G	ENSP00000386219:p.Cys106Arg	175.0	0.0		134.0	45.0	NM_025041	Q3SXR3|Q9H6K8	Missense_Mutation	SNP	ENST00000408895.2	hg19	CCDS3083.1	.	.	.	.	.	.	.	.	.	.	A	9.875	1.199951	0.22121	.	.	ENSG00000221972	ENST00000408895	.	.	.	1.96	-3.92	0.04155	.	.	.	.	.	T	0.15349	0.0370	N	0.08118	0	0.09310	N	1	B	0.15719	0.014	B	0.09377	0.004	T	0.16571	-1.0398	8	0.87932	D	0	.	4.0832	0.09935	0.4949:0.185:0.3201:0.0	.	106	Q3SXR2	CC036_HUMAN	R	106	.	ENSP00000386219:C106R	C	-	1	0	C3orf36	135130022	0.000000	0.05858	0.000000	0.03702	0.329000	0.28539	-1.058000	0.03482	-1.328000	0.02261	0.260000	0.18958	TGC	.	.		0.677	C3orf36-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_025041	
XRN1	54464	hgsc.bcm.edu	37	3	142145680	142145680	+	Silent	SNP	T	T	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr3:142145680T>A	ENST00000264951.4	-	3	429	c.312A>T	c.(310-312)tcA>tcT	p.S104S	XRN1_ENST00000463916.1_Silent_p.S104S|XRN1_ENST00000392981.2_Silent_p.S104S|XRN1_ENST00000544157.1_Intron	NM_019001.3	NP_061874.3	Q8IZH2	XRN1_HUMAN	5'-3' exoribonuclease 1	104					exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|histone mRNA catabolic process (GO:0071044)|mRNA metabolic process (GO:0016071)|nuclear mRNA surveillance (GO:0071028)|nuclear-transcribed mRNA catabolic process (GO:0000956)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|RNA metabolic process (GO:0016070)|rRNA catabolic process (GO:0016075)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|membrane (GO:0016020)	5'-3' exonuclease activity (GO:0008409)|DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(3)|endometrium(6)|kidney(12)|large_intestine(11)|liver(1)|lung(17)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	61						CCTCCTTTGCTGACCTTAAAG	0.348																																					p.S104S		Atlas-SNP	.											.	XRN1	138	.	0			c.A312T						.						129.0	122.0	125.0					3																	142145680		2203	4300	6503	SO:0001819	synonymous_variant	54464	exon3			CTTTGCTGACCTT	AY137776	CCDS3123.1, CCDS63801.1, CCDS75028.1	3q23	2008-02-05			ENSG00000114127	ENSG00000114127			30654	protein-coding gene	gene with protein product		607994				12515382	Standard	XM_005247544		Approved	SEP1	uc003eus.3	Q8IZH2	OTTHUMG00000159251	ENST00000264951.4:c.312A>T	chr3.hg19:g.142145680T>A		94.0	0.0		68.0	40.0	NM_001042604	Q4G0S3|Q68D88|Q6AI24|Q6MZS8|Q86WS7|Q8N8U4|Q9UF39	Silent	SNP	ENST00000264951.4	hg19	CCDS3123.1																																																																																			.	.		0.348	XRN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000354087.2	NM_019001	
IGSF10	285313	hgsc.bcm.edu	37	3	151160801	151160801	+	Silent	SNP	T	T	C			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr3:151160801T>C	ENST00000282466.3	-	5	5933	c.5934A>G	c.(5932-5934)ccA>ccG	p.P1978P	IGSF10_ENST00000495443.1_5'Flank	NM_001178145.1|NM_001178146.1|NM_178822.4	NP_001171616.1|NP_001171617.1|NP_849144.2	Q6WRI0	IGS10_HUMAN	immunoglobulin superfamily, member 10	1978	Ig-like C2-type 6.				cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)	extracellular region (GO:0005576)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(24)|liver(4)|lung(43)|ovary(8)|prostate(4)|skin(9)|stomach(1)|urinary_tract(3)	116			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			CAGCCTTGGATGGTAACCTCC	0.438																																					p.P1978P		Atlas-SNP	.											.	IGSF10	279	.	0			c.A5934G						.						107.0	103.0	104.0					3																	151160801		2203	4300	6503	SO:0001819	synonymous_variant	285313	exon5			CTTGGATGGTAAC	AY273815	CCDS3160.1	3q25.1	2013-01-11			ENSG00000152580	ENSG00000152580		"""Immunoglobulin superfamily / I-set domain containing"""	26384	protein-coding gene	gene with protein product						12477932	Standard	NM_178822		Approved	FLJ25972, CMF608	uc011bod.2	Q6WRI0	OTTHUMG00000159856	ENST00000282466.3:c.5934A>G	chr3.hg19:g.151160801T>C		108.0	0.0		94.0	38.0	NM_178822	Q86YJ9|Q8N772|Q8NA84	Silent	SNP	ENST00000282466.3	hg19	CCDS3160.1																																																																																			.	.		0.438	IGSF10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357782.1	NM_178822	
VEPH1	79674	hgsc.bcm.edu	37	3	157031464	157031464	+	Silent	SNP	C	C	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr3:157031464C>A	ENST00000362010.2	-	11	2263	c.1956G>T	c.(1954-1956)ggG>ggT	p.G652G	RP11-550I24.2_ENST00000475102.1_RNA|RP11-550I24.2_ENST00000487238.1_RNA|RP11-550I24.2_ENST00000494885.1_RNA|VEPH1_ENST00000543418.1_Intron|VEPH1_ENST00000392832.2_Silent_p.G652G|VEPH1_ENST00000392833.2_Intron	NM_001167912.1	NP_001161384.1	Q14D04	MELT_HUMAN	ventricular zone expressed PH domain-containing 1	652						plasma membrane (GO:0005886)				autonomic_ganglia(1)|breast(5)|cervix(1)|kidney(3)|large_intestine(9)|lung(22)|ovary(1)|pancreas(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	48			Lung(72;0.0272)|LUSC - Lung squamous cell carcinoma(72;0.0461)			TGTGAGCACCCCCTGCCTGGG	0.483																																					p.G652G		Atlas-SNP	.											.	VEPH1	129	.	0			c.G1956T						.						73.0	75.0	74.0					3																	157031464		2203	4300	6503	SO:0001819	synonymous_variant	79674	exon11			AGCACCCCCTGCC	AL713656	CCDS3179.1, CCDS54661.1, CCDS54662.1, CCDS54663.1	3q24-q25	2013-01-10	2012-12-10		ENSG00000197415	ENSG00000197415		"""Pleckstrin homology (PH) domain containing"""	25735	protein-coding gene	gene with protein product		609594	"""ventricular zone expressed PH domain homolog 1 (zebrafish)"""			11214970, 15388229	Standard	NM_024621		Approved	FLJ12604, KIAA1692	uc003fbk.2	Q14D04	OTTHUMG00000158711	ENST00000362010.2:c.1956G>T	chr3.hg19:g.157031464C>A		103.0	0.0		91.0	33.0	NM_001167912	D3DNL0|F5GZ91|Q2TAA9|Q3MIX2|Q6PEL3|Q86TL5|Q8TCR3|Q96SP7|Q9C0H1|Q9H9Q7	Silent	SNP	ENST00000362010.2	hg19	CCDS3179.1																																																																																			.	.		0.483	VEPH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351845.3	NM_024621	
B3GALNT1	8706	hgsc.bcm.edu	37	3	160803874	160803874	+	Silent	SNP	A	A	G			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr3:160803874A>G	ENST00000392781.2	-	8	1416	c.669T>C	c.(667-669)caT>caC	p.H223H	B3GALNT1_ENST00000320474.4_Silent_p.H223H|B3GALNT1_ENST00000392780.1_Silent_p.H223H|B3GALNT1_ENST00000392779.2_Silent_p.H223H|B3GALNT1_ENST00000417187.1_Intron|B3GALNT1_ENST00000473285.1_Silent_p.H223H|B3GALNT1_ENST00000488170.1_Silent_p.H223H	NM_001038628.1	NP_001033717.1	O75752	B3GL1_HUMAN	beta-1,3-N-acetylgalactosaminyltransferase 1 (globoside blood group)	223					oligosaccharide biosynthetic process (GO:0009312)|protein glycosylation (GO:0006486)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	galactosylgalactosylglucosylceramide beta-D-acetylgalactosaminyltransferase activity (GO:0047273)|UDP-galactose:beta-N-acetylglucosamine beta-1,3-galactosyltransferase activity (GO:0008499)			breast(1)|large_intestine(4)|lung(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	13			LUSC - Lung squamous cell carcinoma(72;4.41e-05)|Lung(72;4.61e-05)			GGTAAGAAATATGGGTTTTTT	0.363																																					p.H223H		Atlas-SNP	.											.	B3GALNT1	34	.	0			c.T669C						.						37.0	39.0	38.0					3																	160803874		2202	4295	6497	SO:0001819	synonymous_variant	8706	exon8			AGAAATATGGGTT	Y15062	CCDS3193.1	3q25	2014-07-18	2006-06-14	2006-05-09	ENSG00000169255	ENSG00000169255	2.4.1.79	"""Blood group antigens"", ""Beta 3-glycosyltransferases"""	918	protein-coding gene	gene with protein product	"""globoside synthase"", ""P antigen synthase"""	603094	"""UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 3 (Globoside blood group)"", ""UDP-GalNAc:betaGlcNAc beta 1,3-galactosaminyltransferase, polypeptide 1 (Globoside blood group)"""	B3GALT3		9582303, 10993897	Standard	XM_005247861		Approved	beta3Gal-T3, galT3, P1, GLOB	uc003fdv.3	O75752	OTTHUMG00000159064	ENST00000392781.2:c.669T>C	chr3.hg19:g.160803874A>G		84.0	0.0		69.0	25.0	NM_001038628	D3DNM4|Q3Y531|Q6IAI5|Q8NFM8|Q8NFM9|Q9HA06	Silent	SNP	ENST00000392781.2	hg19	CCDS3193.1																																																																																			.	.		0.363	B3GALNT1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353125.1	NM_033167	
SERPINI2	5276	hgsc.bcm.edu	37	3	167183368	167183368	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr3:167183368T>A	ENST00000476257.1	-	5	870	c.572A>T	c.(571-573)cAg>cTg	p.Q191L	SERPINI2_ENST00000264677.4_Missense_Mutation_p.Q191L|SERPINI2_ENST00000461846.1_Missense_Mutation_p.Q191L|SERPINI2_ENST00000471111.1_Missense_Mutation_p.Q191L			O75830	SPI2_HUMAN	serpin peptidase inhibitor, clade I (pancpin), member 2	191					cellular component movement (GO:0006928)|negative regulation of endopeptidase activity (GO:0010951)|regulation of cell adhesion (GO:0030155)|regulation of proteolysis (GO:0030162)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	serine-type endopeptidase inhibitor activity (GO:0004867)			NS(1)|breast(1)|endometrium(2)|kidney(4)|large_intestine(6)|lung(20)|prostate(1)|skin(5)|urinary_tract(1)	41						TCTGAATTTCTGTTTCCAATC	0.358																																					p.Q201L		Atlas-SNP	.											.	SERPINI2	85	.	0			c.A602T						.						74.0	72.0	72.0					3																	167183368		2203	4300	6503	SO:0001583	missense	5276	exon5			AATTTCTGTTTCC	AB006423	CCDS3200.1, CCDS75047.1	3q26.1	2014-02-18	2005-08-18		ENSG00000114204	ENSG00000114204		"""Serine (or cysteine) peptidase inhibitors"""	8945	protein-coding gene	gene with protein product		605587	"""serine (or cysteine) proteinase inhibitor, clade I (neuroserpin), member 2"", ""serine (or cysteine) proteinase inhibitor, clade I (pancpin), member 2"""	PI14		9624529, 24172014	Standard	NM_006217		Approved	PANCPIN, TSA2004, MEPI, pancpin	uc003fes.2	O75830	OTTHUMG00000158231	ENST00000476257.1:c.572A>T	chr3.hg19:g.167183368T>A	ENSP00000420621:p.Gln191Leu	106.0	0.0		102.0	43.0	NM_001012303		Missense_Mutation	SNP	ENST00000476257.1	hg19	CCDS3200.1	.	.	.	.	.	.	.	.	.	.	T	18.69	3.678571	0.68042	.	.	ENSG00000114204	ENST00000476257;ENST00000461846;ENST00000264677;ENST00000471111;ENST00000466903	D;D;D;D;D	0.84516	-1.86;-1.86;-1.86;-1.86;-1.86	5.74	5.74	0.90152	Serpin domain (3);	0.219004	0.46145	D	0.000310	D	0.85102	0.5620	L	0.28274	0.84	0.35423	D	0.793384	D;D	0.53619	0.961;0.961	P;P	0.57371	0.819;0.721	D	0.88946	0.3383	10	0.48119	T	0.1	.	14.0054	0.64461	0.0:0.0:0.0:1.0	.	191;191	B4DDY9;O75830	.;SPI2_HUMAN	L	191	ENSP00000420621:Q191L;ENSP00000417692:Q191L;ENSP00000264677:Q191L;ENSP00000419407:Q191L;ENSP00000417752:Q191L	ENSP00000264677:Q191L	Q	-	2	0	SERPINI2	168666062	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.413000	0.52686	2.196000	0.70406	0.533000	0.62120	CAG	.	.		0.358	SERPINI2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350450.1	NM_006217	
PLD1	5337	hgsc.bcm.edu	37	3	171395376	171395376	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr3:171395376T>C	ENST00000351298.4	-	17	2102	c.1976A>G	c.(1975-1977)cAa>cGa	p.Q659R	PLD1_ENST00000340989.4_Missense_Mutation_p.Q659R|PLD1_ENST00000342215.6_Missense_Mutation_p.N550D|PLD1_ENST00000356327.5_Missense_Mutation_p.Q621R	NM_002662.4	NP_002653.1	Q13393	PLD1_HUMAN	phospholipase D1, phosphatidylcholine-specific	659	Catalytic.				chemotaxis (GO:0006935)|defense response to Gram-positive bacterium (GO:0050830)|glycerophospholipid biosynthetic process (GO:0046474)|lipid catabolic process (GO:0016042)|phosphatidic acid biosynthetic process (GO:0006654)|phosphatidylglycerol biosynthetic process (GO:0006655)|phospholipid metabolic process (GO:0006644)|Ras protein signal transduction (GO:0007265)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)	N-acylphosphatidylethanolamine-specific phospholipase D activity (GO:0070290)|phosphatidylinositol binding (GO:0035091)|phospholipase D activity (GO:0004630)			breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(15)|lung(27)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	63	all_cancers(22;4.53e-19)|Ovarian(172;0.00197)|Breast(254;0.186)		LUSC - Lung squamous cell carcinoma(14;3.57e-14)|Lung(28;9.39e-14)		Choline(DB00122)	TTTATCAAGTTGAACCCAGTC	0.428																																					p.Q659R	NSCLC(149;2174 3517 34058)	Atlas-SNP	.											.	PLD1	134	.	0			c.A1976G						.						195.0	171.0	179.0					3																	171395376		2203	4300	6503	SO:0001583	missense	5337	exon17			TCAAGTTGAACCC	U38545	CCDS3216.1, CCDS46957.1	3q26	2013-01-10	2006-02-17		ENSG00000075651	ENSG00000075651	3.1.4.4	"""Pleckstrin homology (PH) domain containing"""	9067	protein-coding gene	gene with protein product	"""choline phosphatase 1"""	602382				9858822, 8530346	Standard	NM_002662		Approved		uc003fhs.3	Q13393	OTTHUMG00000156947	ENST00000351298.4:c.1976A>G	chr3.hg19:g.171395376T>C	ENSP00000342793:p.Gln659Arg	147.0	0.0		113.0	56.0	NM_002662		Missense_Mutation	SNP	ENST00000351298.4	hg19	CCDS3216.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	27.7|27.7	4.859087|4.859087	0.91433|0.91433	.|.	.|.	ENSG00000075651|ENSG00000075651	ENST00000342215|ENST00000356327;ENST00000351298;ENST00000340989	T|T;T;T	0.29655|0.06849	1.56|3.4;3.4;3.25	6.16|6.16	6.16|6.16	0.99307|0.99307	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.12774|0.12774	0.0310|0.0310	L|L	0.35414|0.35414	1.06|1.06	0.35158|0.35158	D|D	0.770378|0.770378	.|P;P	.|0.45283	.|0.822;0.855	.|P;P	.|0.48334	.|0.542;0.574	T|T	0.10291|0.10291	-1.0636|-1.0636	7|10	0.07325|0.39692	T|T	0.83|0.17	-21.8443|-21.8443	16.8061|16.8061	0.85666|0.85666	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|644;659	.|Q59EA4;Q13393	.|.;PLD1_HUMAN	D|R	550|621;659;659	ENSP00000339936:N550D|ENSP00000348681:Q621R;ENSP00000342793:Q659R;ENSP00000340326:Q659R	ENSP00000339936:N550D|ENSP00000340326:Q659R	N|Q	-|-	1|2	0|0	PLD1|PLD1	172878070|172878070	1.000000|1.000000	0.71417|0.71417	0.967000|0.967000	0.41034|0.41034	0.978000|0.978000	0.69477|0.69477	7.698000|7.698000	0.84413|0.84413	2.367000|2.367000	0.80283|0.80283	0.528000|0.528000	0.53228|0.53228	AAC|CAA	.	.		0.428	PLD1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000346730.2	NM_002662	
ABCC5	10057	hgsc.bcm.edu	37	3	183689367	183689367	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr3:183689367T>A	ENST00000334444.6	-	11	1985	c.1745A>T	c.(1744-1746)gAt>gTt	p.D582V	ABCC5_ENST00000265586.6_Missense_Mutation_p.D582V	NM_005688.2	NP_005679.2	O15440	MRP5_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 5	582	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|hyaluronan biosynthetic process (GO:0030213)|hyaluronan metabolic process (GO:0030212)|organic anion transport (GO:0015711)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|organic anion transmembrane transporter activity (GO:0008514)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(32)|ovary(3)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	62	all_cancers(143;1.85e-10)|Ovarian(172;0.0303)		Epithelial(37;1.74e-35)|OV - Ovarian serous cystadenocarcinoma(80;6.48e-22)		Adefovir Dipivoxil(DB00718)|Alprostadil(DB00770)|Atorvastatin(DB01076)|Cisplatin(DB00515)|Dinoprostone(DB00917)|Dipyridamole(DB00975)|Fluorouracil(DB00544)|Glutathione(DB00143)|Mercaptopurine(DB01033)|Probenecid(DB01032)|Rifampicin(DB01045)|Sildenafil(DB00203)|Sulfinpyrazone(DB01138)|Zidovudine(DB00495)	GATCTCCAGATCGATGCTGTG	0.617																																					p.D582V		Atlas-SNP	.											.	ABCC5	142	.	0			c.A1745T						.						80.0	90.0	87.0					3																	183689367		2123	4219	6342	SO:0001583	missense	10057	exon11			TCCAGATCGATGC	AF104942	CCDS33898.1, CCDS43176.1	3q27	2012-03-14			ENSG00000114770	ENSG00000114770		"""ATP binding cassette transporters / subfamily C"""	56	protein-coding gene	gene with protein product		605251				8894702, 9827529	Standard	XM_005247058		Approved	MRP5, SMRP, EST277145, MOAT-C	uc003fmg.3	O15440	OTTHUMG00000156871	ENST00000334444.6:c.1745A>T	chr3.hg19:g.183689367T>A	ENSP00000333926:p.Asp582Val	108.0	0.0		52.0	21.0	NM_005688	B9EIQ2|O14517|Q29ZA9|Q29ZB1|Q86UX3|Q86W30|Q9UN85|Q9UNP5|Q9UQC3	Missense_Mutation	SNP	ENST00000334444.6	hg19	CCDS43176.1	.	.	.	.	.	.	.	.	.	.	T	15.42	2.827194	0.50739	.	.	ENSG00000114770	ENST00000334444;ENST00000382495;ENST00000265586	D;D	0.94046	-3.34;-3.34	5.66	5.66	0.87406	ABC transporter, transmembrane domain, type 1 (1);ABC transporter-like (1);	0.050102	0.85682	D	0.000000	D	0.94588	0.8256	M	0.76002	2.32	0.80722	D	1	P;P	0.48589	0.786;0.912	P;P	0.49226	0.603;0.501	D	0.95122	0.8247	10	0.87932	D	0	-13.751	15.8935	0.79318	0.0:0.0:0.0:1.0	.	582;582	Q86UX3;O15440	.;MRP5_HUMAN	V	582;518;582	ENSP00000333926:D582V;ENSP00000265586:D582V	ENSP00000265586:D582V	D	-	2	0	ABCC5	185172061	1.000000	0.71417	1.000000	0.80357	0.128000	0.20619	6.889000	0.75627	2.155000	0.67459	0.533000	0.62120	GAT	.	.		0.617	ABCC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346350.1	NM_005688	
LEPREL1	55214	hgsc.bcm.edu	37	3	189690681	189690681	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr3:189690681A>G	ENST00000319332.5	-	11	1878	c.1681T>C	c.(1681-1683)Tgc>Cgc	p.C561R	LEPREL1_ENST00000427335.2_Missense_Mutation_p.C380R	NM_018192.3	NP_060662.2	Q8IVL5	P3H2_HUMAN	leprecan-like 1	561	Fe2OG dioxygenase. {ECO:0000255|PROSITE- ProRule:PRU00805}.				collagen metabolic process (GO:0032963)|extracellular matrix organization (GO:0030198)|negative regulation of cell proliferation (GO:0008285)|peptidyl-proline hydroxylation (GO:0019511)	basement membrane (GO:0005604)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|Golgi apparatus (GO:0005794)	iron ion binding (GO:0005506)|L-ascorbic acid binding (GO:0031418)|procollagen-proline 3-dioxygenase activity (GO:0019797)			NS(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(10)|liver(1)|lung(8)|ovary(2)|prostate(2)|skin(5)	41	all_cancers(143;4.01e-10)|Ovarian(172;0.0925)		Lung(62;4.35e-05)	GBM - Glioblastoma multiforme(93;0.02)	L-Proline(DB00172)|Succinic acid(DB00139)|Vitamin C(DB00126)	GCTGTTCGGCAGACCATGTGT	0.418																																					p.C561R		Atlas-SNP	.											.	LEPREL1	95	.	0			c.T1681C						.						108.0	104.0	105.0					3																	189690681		2203	4300	6503	SO:0001583	missense	55214	exon11			TTCGGCAGACCAT		CCDS3294.1, CCDS46981.1	3q29	2014-01-28			ENSG00000090530	ENSG00000090530	1.14.11.7		19317	protein-coding gene	gene with protein product	"""prolyl 3-hydroxylase 2"""	610341				15063763, 21885030	Standard	NM_018192		Approved	FLJ10718, MLAT4, P3H2	uc011bsk.2	Q8IVL5	OTTHUMG00000156312	ENST00000319332.5:c.1681T>C	chr3.hg19:g.189690681A>G	ENSP00000316881:p.Cys561Arg	268.0	0.0		250.0	106.0	NM_018192	B3KPK0|B3KWI9|D3DNV8|Q9NVI2	Missense_Mutation	SNP	ENST00000319332.5	hg19	CCDS3294.1	.	.	.	.	.	.	.	.	.	.	A	21.4	4.144373	0.77888	.	.	ENSG00000090530	ENST00000319332;ENST00000427335	T;T	0.72051	-0.62;-0.62	5.71	5.71	0.89125	Oxoglutarate/iron-dependent oxygenase (1);Prolyl 4-hydroxylase, alpha subunit (1);	0.000000	0.85682	D	0.000000	T	0.81903	0.4921	M	0.88377	2.95	0.80722	D	1	P	0.50943	0.94	P	0.51297	0.665	D	0.85075	0.0942	9	.	.	.	-21.8233	15.1853	0.72996	1.0:0.0:0.0:0.0	.	561	Q8IVL5	P3H2_HUMAN	R	561;380	ENSP00000316881:C561R;ENSP00000408947:C380R	.	C	-	1	0	LEPREL1	191173375	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.941000	0.92964	2.171000	0.68590	0.528000	0.53228	TGC	.	.		0.418	LEPREL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343855.1	NM_018192	
OPA1	4976	hgsc.bcm.edu	37	3	193332727	193332727	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr3:193332727A>T	ENST00000392438.3	+	2	482	c.248A>T	c.(247-249)cAg>cTg	p.Q83L	OPA1_ENST00000487986.1_3'UTR|OPA1_ENST00000361908.3_Missense_Mutation_p.Q83L|OPA1_ENST00000361150.2_Missense_Mutation_p.Q83L|OPA1_ENST00000361510.2_Missense_Mutation_p.Q83L|OPA1_ENST00000361715.2_Missense_Mutation_p.Q83L|OPA1_ENST00000361828.2_Missense_Mutation_p.Q83L	NM_015560.2	NP_056375.2	O60313	OPA1_HUMAN	optic atrophy 1 (autosomal dominant)	83					apoptotic process (GO:0006915)|axon transport of mitochondrion (GO:0019896)|cellular senescence (GO:0090398)|GTP catabolic process (GO:0006184)|inner mitochondrial membrane organization (GO:0007007)|mitochondrial fission (GO:0000266)|mitochondrial fusion (GO:0008053)|mitochondrion organization (GO:0007005)|negative regulation of endoplasmic reticulum stress-induced intrinsic apoptotic signaling pathway (GO:1902236)|negative regulation of release of cytochrome c from mitochondria (GO:0090201)|neural tube closure (GO:0001843)|visual perception (GO:0007601)	dendrite (GO:0030425)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial crista (GO:0030061)|mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|magnesium ion binding (GO:0000287)			breast(1)|cervix(2)|endometrium(3)|kidney(3)|large_intestine(4)|lung(15)|upper_aerodigestive_tract(1)|urinary_tract(2)	31	all_cancers(143;9.56e-09)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(49;9.19e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;0.000162)		TATGGCTACCAGCCTCGCAGG	0.443																																					p.Q83L		Atlas-SNP	.											.	OPA1	79	.	0			c.A248T						.						47.0	45.0	46.0					3																	193332727		2203	4300	6503	SO:0001583	missense	4976	exon2			GCTACCAGCCTCG	AB011139	CCDS33917.1, CCDS43186.1	3q29	2014-09-17			ENSG00000198836	ENSG00000198836			8140	protein-coding gene	gene with protein product	"""mitochondrial dynamin-like GTPase"", ""dynamin-like guanosine triphosphatase"", ""Dynamin-like 120 kDa protein, mitochondrial"""	605290				9490303	Standard	NM_015560		Approved	NTG, KIAA0567, FLJ12460, NPG, MGM1	uc003ftg.3	O60313	OTTHUMG00000149897	ENST00000392438.3:c.248A>T	chr3.hg19:g.193332727A>T	ENSP00000376233:p.Gln83Leu	280.0	0.0		246.0	17.0	NM_130832	D3DNW4	Missense_Mutation	SNP	ENST00000392438.3	hg19	CCDS43186.1	.	.	.	.	.	.	.	.	.	.	A	27.9	4.872623	0.91587	.	.	ENSG00000198836	ENST00000361908;ENST00000392438;ENST00000361510;ENST00000361715;ENST00000361828;ENST00000361150;ENST00000392437;ENST00000392436	D;D;D;D;D;D;D;T	0.95307	-3.25;-3.26;-3.3;-3.28;-3.21;-3.67;-2.02;-1.09	5.97	5.97	0.96955	.	0.287098	0.40144	N	0.001180	D	0.91868	0.7426	L	0.49350	1.555	0.58432	D	0.999999	B;B;B;B;B;B;B;B	0.33694	0.116;0.421;0.204;0.051;0.156;0.218;0.421;0.323	B;B;B;B;B;B;B;B	0.27380	0.073;0.073;0.055;0.016;0.073;0.035;0.05;0.079	D	0.91377	0.5124	10	0.66056	D	0.02	-13.7137	15.642	0.77012	1.0:0.0:0.0:0.0	.	83;83;83;83;83;83;83;83	E5KLK2;O60313;E5KLK0;E5KLK1;E5KLJ6;E5KLJ7;E5KLJ9;E5KLJ5	.;OPA1_HUMAN;.;.;.;.;.;.	L	83	ENSP00000354681:Q83L;ENSP00000376233:Q83L;ENSP00000355324:Q83L;ENSP00000355311:Q83L;ENSP00000354429:Q83L;ENSP00000354781:Q83L;ENSP00000376232:Q83L;ENSP00000376231:Q83L	ENSP00000354781:Q83L	Q	+	2	0	OPA1	194815421	1.000000	0.71417	1.000000	0.80357	0.921000	0.55340	4.383000	0.59600	2.288000	0.76882	0.533000	0.62120	CAG	.	.		0.443	OPA1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000313812.2	NM_130837	
OPA1	4976	hgsc.bcm.edu	37	3	193374929	193374929	+	Nonsense_Mutation	SNP	G	G	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr3:193374929G>T	ENST00000392438.3	+	21	2308	c.2074G>T	c.(2074-2076)Gag>Tag	p.E692*	OPA1_ENST00000361510.2_Nonsense_Mutation_p.E747*|OPA1_ENST00000361715.2_Nonsense_Mutation_p.E711*|OPA1_ENST00000361828.2_Nonsense_Mutation_p.E710*|OPA1_ENST00000361150.2_Nonsense_Mutation_p.E693*|OPA1_ENST00000361908.3_Nonsense_Mutation_p.E729*	NM_015560.2	NP_056375.2	O60313	OPA1_HUMAN	optic atrophy 1 (autosomal dominant)	692					apoptotic process (GO:0006915)|axon transport of mitochondrion (GO:0019896)|cellular senescence (GO:0090398)|GTP catabolic process (GO:0006184)|inner mitochondrial membrane organization (GO:0007007)|mitochondrial fission (GO:0000266)|mitochondrial fusion (GO:0008053)|mitochondrion organization (GO:0007005)|negative regulation of endoplasmic reticulum stress-induced intrinsic apoptotic signaling pathway (GO:1902236)|negative regulation of release of cytochrome c from mitochondria (GO:0090201)|neural tube closure (GO:0001843)|visual perception (GO:0007601)	dendrite (GO:0030425)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial crista (GO:0030061)|mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|magnesium ion binding (GO:0000287)			breast(1)|cervix(2)|endometrium(3)|kidney(3)|large_intestine(4)|lung(15)|upper_aerodigestive_tract(1)|urinary_tract(2)	31	all_cancers(143;9.56e-09)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(49;9.19e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;0.000162)		GAAAGGGAAAGAGCATGATGA	0.368																																					p.E747X		Atlas-SNP	.											.	OPA1	79	.	0			c.G2239T						.						88.0	92.0	91.0					3																	193374929		2203	4300	6503	SO:0001587	stop_gained	4976	exon23			GGGAAAGAGCATG	AB011139	CCDS33917.1, CCDS43186.1	3q29	2014-09-17			ENSG00000198836	ENSG00000198836			8140	protein-coding gene	gene with protein product	"""mitochondrial dynamin-like GTPase"", ""dynamin-like guanosine triphosphatase"", ""Dynamin-like 120 kDa protein, mitochondrial"""	605290				9490303	Standard	NM_015560		Approved	NTG, KIAA0567, FLJ12460, NPG, MGM1	uc003ftg.3	O60313	OTTHUMG00000149897	ENST00000392438.3:c.2074G>T	chr3.hg19:g.193374929G>T	ENSP00000376233:p.Glu692*	191.0	0.0		131.0	64.0	NM_130837	D3DNW4	Nonsense_Mutation	SNP	ENST00000392438.3	hg19	CCDS43186.1	.	.	.	.	.	.	.	.	.	.	G	42	9.437445	0.99171	.	.	ENSG00000198836	ENST00000361908;ENST00000392438;ENST00000361510;ENST00000361715;ENST00000361828;ENST00000361150	.	.	.	5.78	5.78	0.91487	.	0.043555	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.15499	T	0.54	-20.6863	18.996	0.92813	0.0:0.0:1.0:0.0	.	.	.	.	X	729;692;747;711;710;693	.	ENSP00000354781:E693X	E	+	1	0	OPA1	194857623	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.751000	0.98889	2.722000	0.93159	0.655000	0.94253	GAG	.	.		0.368	OPA1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000313812.2	NM_130837	
ACAP2	23527	hgsc.bcm.edu	37	3	195112843	195112843	+	Silent	SNP	T	T	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr3:195112843T>A	ENST00000326793.6	-	2	317	c.87A>T	c.(85-87)gcA>gcT	p.A29A		NM_012287.5	NP_036419.3	Q15057	ACAP2_HUMAN	ArfGAP with coiled-coil, ankyrin repeat and PH domains 2	29	BAR.				cellular response to nerve growth factor stimulus (GO:1990090)|protein localization to endosome (GO:0036010)|regulation of ARF GTPase activity (GO:0032312)	endosome membrane (GO:0010008)|membrane (GO:0016020)	ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)			cervix(2)|endometrium(2)|kidney(4)|large_intestine(5)|lung(10)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(2)	27						GTTCCAATTCTGCCACATCAC	0.294																																					p.A29A		Atlas-SNP	.											.	ACAP2	72	.	0			c.A87T						.						81.0	84.0	83.0					3																	195112843		2201	4299	6500	SO:0001819	synonymous_variant	23527	exon2			CAATTCTGCCACA		CCDS33924.1	3q29	2013-01-10	2008-09-22	2008-09-22	ENSG00000114331	ENSG00000114331		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	16469	protein-coding gene	gene with protein product		607766	"""centaurin, beta 2"""	CENTB2		11050434, 11062263	Standard	NM_012287		Approved	KIAA0041, CNT-B2	uc003fun.4	Q15057	OTTHUMG00000155885	ENST00000326793.6:c.87A>T	chr3.hg19:g.195112843T>A		806.0	1.0		775.0	294.0	NM_012287	A8K2V4|Q8N5Z8|Q9UQR3	Silent	SNP	ENST00000326793.6	hg19	CCDS33924.1																																																																																			.	.		0.294	ACAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342126.2	NM_012287	
EVC2	132884	hgsc.bcm.edu	37	4	5578129	5578129	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr4:5578129G>A	ENST00000344408.5	-	18	3163	c.3110C>T	c.(3109-3111)gCa>gTa	p.A1037V	EVC2_ENST00000310917.2_Missense_Mutation_p.A957V|EVC2_ENST00000344938.1_Missense_Mutation_p.A1037V	NM_147127.4	NP_667338.3	Q86UK5	LBN_HUMAN	Ellis van Creveld syndrome 2	1037					smoothened signaling pathway (GO:0007224)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(2)|breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(32)|lung(28)|ovary(4)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(2)	81						CTGCTGGGCTGCCTCCTGCTG	0.642																																					p.A1037V		Atlas-SNP	.											.	EVC2	202	.	0			c.C3110T						.						27.0	25.0	26.0					4																	5578129		2203	4300	6503	SO:0001583	missense	132884	exon18			TGGGCTGCCTCCT	AB083067	CCDS3382.2, CCDS54718.1	4p16.2-p16.1	2008-08-01	2008-08-01		ENSG00000173040	ENSG00000173040			19747	protein-coding gene	gene with protein product		607261				12136126, 12571802	Standard	NM_147127		Approved	LBN	uc003gij.3	Q86UK5	OTTHUMG00000125493	ENST00000344408.5:c.3110C>T	chr4.hg19:g.5578129G>A	ENSP00000342144:p.Ala1037Val	62.0	0.0		72.0	37.0	NM_147127	Q86YT3|Q86YT4|Q8NG49	Missense_Mutation	SNP	ENST00000344408.5	hg19	CCDS3382.2	.	.	.	.	.	.	.	.	.	.	G	7.049	0.564160	0.13498	.	.	ENSG00000173040	ENST00000344938;ENST00000310917;ENST00000344408	T;T;T	0.74842	-0.88;-0.87;-0.88	5.38	1.31	0.21738	.	0.716774	0.13601	N	0.375878	T	0.53932	0.1827	N	0.24115	0.695	0.09310	N	1	B	0.14805	0.011	B	0.10450	0.005	T	0.34675	-0.9819	10	0.30078	T	0.28	-5.7468	3.1914	0.06618	0.0869:0.1381:0.3893:0.3857	.	1037	Q86UK5	LBN_HUMAN	V	1037;957;1037	ENSP00000339954:A1037V;ENSP00000311683:A957V;ENSP00000342144:A1037V	ENSP00000311683:A957V	A	-	2	0	EVC2	5629030	0.013000	0.17824	0.059000	0.19551	0.258000	0.26162	1.232000	0.32636	-0.084000	0.12595	0.491000	0.48974	GCA	.	.		0.642	EVC2-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000289822.2	NM_147127	
ABLIM2	84448	hgsc.bcm.edu	37	4	8029484	8029484	+	Intron	SNP	A	A	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr4:8029484A>T	ENST00000341937.5	-	11	1233				ABLIM2_ENST00000361581.5_Intron|ABLIM2_ENST00000546334.1_Intron|ABLIM2_ENST00000447017.2_Splice_Site|ABLIM2_ENST00000407564.3_Intron|ABLIM2_ENST00000428004.2_Intron|ABLIM2_ENST00000296372.8_Intron|ABLIM2_ENST00000318888.4_Intron|ABLIM2_ENST00000515079.1_Splice_Site|ABLIM2_ENST00000505872.1_Intron|ABLIM2_ENST00000545242.1_Intron|ABLIM2_ENST00000514025.1_Intron|ABLIM2_ENST00000361737.5_Intron	NM_001130084.1	NP_001123556.1	Q6H8Q1	ABLM2_HUMAN	actin binding LIM protein family, member 2						actin cytoskeleton organization (GO:0030036)|axon guidance (GO:0007411)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	actin cytoskeleton (GO:0015629)|myofibril (GO:0030016)	zinc ion binding (GO:0008270)			NS(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(6)|pancreas(3)|prostate(2)|urinary_tract(1)	25						TGCGTGCCTTACCTCGGAAGT	0.602																																					.		Atlas-SNP	.											.	ABLIM2	59	.	0			c.1267+2T>A						.						112.0	96.0	101.0					4																	8029484		1567	3582	5149	SO:0001627	intron_variant	84448	exon13			TGCCTTACCTCGG	AB058711	CCDS47011.1, CCDS47012.1, CCDS47013.1, CCDS47014.1, CCDS47015.1, CCDS47016.1, CCDS54719.1, CCDS68669.1	4p16.1	2012-05-16			ENSG00000163995	ENSG00000163995			19195	protein-coding gene	gene with protein product		612544	"""actin binding LIM protein 2"""				Standard	NM_001130083		Approved	KIAA1808	uc003gkj.4	Q6H8Q1	OTTHUMG00000057427	ENST00000341937.5:c.1168+1898T>A	chr4.hg19:g.8029484A>T		106.0	0.0		121.0	43.0	NM_001130083	E9PF39|Q08E71|Q19VH0|Q6H8Q0|Q6NX73|Q8N3C5|Q8N9E9|Q8N9G2|Q96JL7	Splice_Site	SNP	ENST00000341937.5	hg19	CCDS47013.1	.	.	.	.	.	.	.	.	.	.	A	22.0	4.234720	0.79800	.	.	ENSG00000163995	ENST00000400045;ENST00000447017;ENST00000510277	.	.	.	4.75	4.75	0.60458	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.2676	0.66129	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	ABLIM2	8080384	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	4.578000	0.60929	1.783000	0.52377	0.528000	0.53228	.	.	.		0.602	ABLIM2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000358862.2	NM_001130083	
FGFBP1	9982	hgsc.bcm.edu	37	4	15938116	15938116	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr4:15938116T>A	ENST00000382333.1	-	3	434	c.140A>T	c.(139-141)cAg>cTg	p.Q47L	FGFBP1_ENST00000259988.2_Missense_Mutation_p.Q47L	NM_005130.4	NP_005121.1	Q14512	FGFP1_HUMAN	fibroblast growth factor binding protein 1	47					cell-cell signaling (GO:0007267)|negative regulation of cell proliferation (GO:0008285)|positive regulation of cell proliferation (GO:0008284)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|signal transduction (GO:0007165)	cell surface (GO:0009986)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)	heparin binding (GO:0008201)			NS(1)|kidney(1)|large_intestine(2)|liver(1)|lung(2)|prostate(2)|skin(1)	10						CTGCTTAATCTGGGTGTTGCC	0.517																																					p.Q47L		Atlas-SNP	.											.	FGFBP1	26	.	0			c.A140T						.						121.0	117.0	118.0					4																	15938116		2203	4300	6503	SO:0001583	missense	9982	exon3			TTAATCTGGGTGT	M60047	CCDS3418.1	4p15.32	2008-02-05			ENSG00000137440	ENSG00000137440			19695	protein-coding gene	gene with protein product		607737				11148217, 1885605	Standard	NM_005130		Approved	HBP17, FGFBP	uc003gom.3	Q14512	OTTHUMG00000097745	ENST00000382333.1:c.140A>T	chr4.hg19:g.15938116T>A	ENSP00000371770:p.Gln47Leu	149.0	0.0		219.0	128.0	NM_005130	A8K5J2	Missense_Mutation	SNP	ENST00000382333.1	hg19	CCDS3418.1	.	.	.	.	.	.	.	.	.	.	T	10.41	1.342527	0.24339	.	.	ENSG00000137440	ENST00000382333;ENST00000259988	T;T	0.14391	2.51;2.51	4.83	-3.36	0.04913	.	2.710420	0.01282	N	0.009760	T	0.11537	0.0281	L	0.47716	1.5	0.09310	N	1	B	0.14805	0.011	B	0.15052	0.012	T	0.28073	-1.0055	10	0.49607	T	0.09	-1.0224	0.798	0.01069	0.2522:0.1535:0.1303:0.4641	.	47	Q14512	FGFP1_HUMAN	L	47	ENSP00000371770:Q47L;ENSP00000259988:Q47L	ENSP00000259988:Q47L	Q	-	2	0	FGFBP1	15547214	0.000000	0.05858	0.000000	0.03702	0.023000	0.10783	-0.931000	0.03967	-0.725000	0.04901	-0.462000	0.05337	CAG	.	.		0.517	FGFBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214974.1	NM_005130	
SLIT2	9353	hgsc.bcm.edu	37	4	20255500	20255500	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr4:20255500A>G	ENST00000504154.1	+	1	314	c.62A>G	c.(61-63)aAc>aGc	p.N21S	SLIT2_ENST00000503823.1_Missense_Mutation_p.N21S|SLIT2_ENST00000503837.1_Missense_Mutation_p.N21S|SLIT2_ENST00000273739.5_Missense_Mutation_p.N21S	NM_004787.1	NP_004778.1	O94813	SLIT2_HUMAN	slit homolog 2 (Drosophila)	21					apoptotic process involved in luteolysis (GO:0061364)|axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|branching morphogenesis of an epithelial tube (GO:0048754)|cell migration involved in sprouting angiogenesis (GO:0002042)|cellular response to heparin (GO:0071504)|cellular response to hormone stimulus (GO:0032870)|chemorepulsion involved in postnatal olfactory bulb interneuron migration (GO:0021836)|corticospinal neuron axon guidance through spinal cord (GO:0021972)|dorsal/ventral axon guidance (GO:0033563)|in utero embryonic development (GO:0001701)|induction of negative chemotaxis (GO:0050929)|mammary duct terminal end bud growth (GO:0060763)|metanephros development (GO:0001656)|motor neuron axon guidance (GO:0008045)|negative chemotaxis (GO:0050919)|negative regulation of actin filament polymerization (GO:0030837)|negative regulation of axon extension (GO:0030517)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cellular response to growth factor stimulus (GO:0090288)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of gene expression (GO:0010629)|negative regulation of lamellipodium assembly (GO:0010593)|negative regulation of leukocyte chemotaxis (GO:0002689)|negative regulation of monocyte chemotaxis (GO:0090027)|negative regulation of mononuclear cell migration (GO:0071676)|negative regulation of neutrophil chemotaxis (GO:0090024)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of retinal ganglion cell axon guidance (GO:0090260)|negative regulation of small GTPase mediated signal transduction (GO:0051058)|negative regulation of smooth muscle cell chemotaxis (GO:0071672)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of vascular permeability (GO:0043116)|positive regulation of apoptotic process (GO:0043065)|positive regulation of axonogenesis (GO:0050772)|response to cortisol (GO:0051414)|retinal ganglion cell axon guidance (GO:0031290)|Roundabout signaling pathway (GO:0035385)|single organismal cell-cell adhesion (GO:0016337)|ureteric bud development (GO:0001657)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|chemorepellent activity (GO:0045499)|GTPase inhibitor activity (GO:0005095)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|laminin-1 binding (GO:0043237)|protein homodimerization activity (GO:0042803)|proteoglycan binding (GO:0043394)|Roundabout binding (GO:0048495)			NS(1)|breast(4)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(7)|large_intestine(17)|lung(60)|ovary(3)|pancreas(1)|prostate(2)|skin(10)|upper_aerodigestive_tract(1)	116						GCGATCCTGAACAAGGTGGCA	0.687																																					p.N21S		Atlas-SNP	.											.	SLIT2	290	.	0			c.A62G						.						95.0	75.0	82.0					4																	20255500		2203	4299	6502	SO:0001583	missense	9353	exon1			TCCTGAACAAGGT	AF055585	CCDS3426.1, CCDS75110.1, CCDS75111.1	4p15.2	2008-08-01	2001-11-28		ENSG00000145147	ENSG00000145147			11086	protein-coding gene	gene with protein product		603746	"""slit (Drosophila) homolog 2"""	SLIL3		9813312, 18269211	Standard	XM_005248211		Approved	Slit-2	uc003gpr.1	O94813	OTTHUMG00000128551	ENST00000504154.1:c.62A>G	chr4.hg19:g.20255500A>G	ENSP00000422591:p.Asn21Ser	17.0	0.0		42.0	11.0	NM_004787	B7ZLR5|O95710|Q17RU3|Q9Y5Q7	Missense_Mutation	SNP	ENST00000504154.1	hg19	CCDS3426.1	.	.	.	.	.	.	.	.	.	.	A	2.048	-0.418427	0.04766	.	.	ENSG00000145147	ENST00000503823;ENST00000504154;ENST00000273739;ENST00000382173;ENST00000503837	T;T;T;T	0.79845	-1.3;-1.31;-1.23;-1.28	3.99	-0.995	0.10222	.	0.279438	0.37095	N	0.002258	T	0.58595	0.2133	N	0.11756	0.17	0.21967	N	0.99945	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.43669	-0.9377	10	0.18710	T	0.47	.	9.9968	0.41905	0.2806:0.0:0.7194:0.0	.	21;21	O94813-3;O94813	.;SLIT2_HUMAN	S	21	ENSP00000427548:N21S;ENSP00000422591:N21S;ENSP00000273739:N21S;ENSP00000422261:N21S	ENSP00000273739:N21S	N	+	2	0	SLIT2	19864598	0.669000	0.27502	0.274000	0.24659	0.538000	0.34931	1.255000	0.32909	-0.043000	0.13513	0.260000	0.18958	AAC	.	.		0.687	SLIT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250396.2		
SLIT2	9353	hgsc.bcm.edu	37	4	20525440	20525440	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr4:20525440C>A	ENST00000504154.1	+	13	1440	c.1188C>A	c.(1186-1188)caC>caA	p.H396Q	SLIT2_ENST00000503823.1_Missense_Mutation_p.H396Q|SLIT2_ENST00000503837.1_Missense_Mutation_p.H400Q|SLIT2_ENST00000273739.5_Missense_Mutation_p.H400Q	NM_004787.1	NP_004778.1	O94813	SLIT2_HUMAN	slit homolog 2 (Drosophila)	396					apoptotic process involved in luteolysis (GO:0061364)|axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|branching morphogenesis of an epithelial tube (GO:0048754)|cell migration involved in sprouting angiogenesis (GO:0002042)|cellular response to heparin (GO:0071504)|cellular response to hormone stimulus (GO:0032870)|chemorepulsion involved in postnatal olfactory bulb interneuron migration (GO:0021836)|corticospinal neuron axon guidance through spinal cord (GO:0021972)|dorsal/ventral axon guidance (GO:0033563)|in utero embryonic development (GO:0001701)|induction of negative chemotaxis (GO:0050929)|mammary duct terminal end bud growth (GO:0060763)|metanephros development (GO:0001656)|motor neuron axon guidance (GO:0008045)|negative chemotaxis (GO:0050919)|negative regulation of actin filament polymerization (GO:0030837)|negative regulation of axon extension (GO:0030517)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cellular response to growth factor stimulus (GO:0090288)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of gene expression (GO:0010629)|negative regulation of lamellipodium assembly (GO:0010593)|negative regulation of leukocyte chemotaxis (GO:0002689)|negative regulation of monocyte chemotaxis (GO:0090027)|negative regulation of mononuclear cell migration (GO:0071676)|negative regulation of neutrophil chemotaxis (GO:0090024)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of retinal ganglion cell axon guidance (GO:0090260)|negative regulation of small GTPase mediated signal transduction (GO:0051058)|negative regulation of smooth muscle cell chemotaxis (GO:0071672)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of vascular permeability (GO:0043116)|positive regulation of apoptotic process (GO:0043065)|positive regulation of axonogenesis (GO:0050772)|response to cortisol (GO:0051414)|retinal ganglion cell axon guidance (GO:0031290)|Roundabout signaling pathway (GO:0035385)|single organismal cell-cell adhesion (GO:0016337)|ureteric bud development (GO:0001657)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|chemorepellent activity (GO:0045499)|GTPase inhibitor activity (GO:0005095)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|laminin-1 binding (GO:0043237)|protein homodimerization activity (GO:0042803)|proteoglycan binding (GO:0043394)|Roundabout binding (GO:0048495)			NS(1)|breast(4)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(7)|large_intestine(17)|lung(60)|ovary(3)|pancreas(1)|prostate(2)|skin(10)|upper_aerodigestive_tract(1)	116						AGGATCTCCACAACTTGAACC	0.393																																					p.H396Q		Atlas-SNP	.											.	SLIT2	290	.	0			c.C1188A						.						165.0	156.0	159.0					4																	20525440		2203	4300	6503	SO:0001583	missense	9353	exon13			TCTCCACAACTTG	AF055585	CCDS3426.1, CCDS75110.1, CCDS75111.1	4p15.2	2008-08-01	2001-11-28		ENSG00000145147	ENSG00000145147			11086	protein-coding gene	gene with protein product		603746	"""slit (Drosophila) homolog 2"""	SLIL3		9813312, 18269211	Standard	XM_005248211		Approved	Slit-2	uc003gpr.1	O94813	OTTHUMG00000128551	ENST00000504154.1:c.1188C>A	chr4.hg19:g.20525440C>A	ENSP00000422591:p.His396Gln	208.0	0.0		251.0	15.0	NM_004787	B7ZLR5|O95710|Q17RU3|Q9Y5Q7	Missense_Mutation	SNP	ENST00000504154.1	hg19	CCDS3426.1	.	.	.	.	.	.	.	.	.	.	C	2.785	-0.252590	0.05829	.	.	ENSG00000145147	ENST00000503823;ENST00000504154;ENST00000273739;ENST00000382173;ENST00000503837	T;T;T;T	0.57273	0.41;0.41;0.41;0.41	5.08	5.08	0.68730	.	0.099294	0.64402	D	0.000002	T	0.33352	0.0860	N	0.11818	0.18	0.54753	D	0.999988	B;B	0.02656	0.0;0.0	B;B	0.06405	0.002;0.001	T	0.27773	-1.0064	10	0.02654	T	1	.	18.8999	0.92439	0.0:1.0:0.0:0.0	.	396;396	O94813-3;O94813	.;SLIT2_HUMAN	Q	396;396;400;400;400	ENSP00000427548:H396Q;ENSP00000422591:H396Q;ENSP00000273739:H400Q;ENSP00000422261:H400Q	ENSP00000273739:H400Q	H	+	3	2	SLIT2	20134538	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	1.953000	0.40352	2.529000	0.85273	0.644000	0.83932	CAC	.	.		0.393	SLIT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250396.2		
SEPSECS	51091	hgsc.bcm.edu	37	4	25160667	25160667	+	Silent	SNP	T	T	G			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr4:25160667T>G	ENST00000382103.2	-	2	249	c.177A>C	c.(175-177)gcA>gcC	p.A59A	SEPSECS_ENST00000302922.3_Intron|PI4K2B_ENST00000512921.1_5'Flank	NM_016955.3	NP_058651.3	Q9HD40	SPCS_HUMAN	Sep (O-phosphoserine) tRNA:Sec (selenocysteine) tRNA synthase	59					selenocysteine incorporation (GO:0001514)|selenocysteinyl-tRNA(Sec) biosynthetic process (GO:0097056)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	pyridoxal phosphate binding (GO:0030170)|transferase activity, transferring selenium-containing groups (GO:0016785)|tRNA binding (GO:0000049)			endometrium(1)|large_intestine(4)|lung(2)|stomach(1)	8		Breast(46;0.173)				TGTCCATGATTGCAAGTTCAT	0.388																																					p.A59A		Atlas-SNP	.											.	SEPSECS	55	.	0			c.A177C						.						147.0	147.0	147.0					4																	25160667		1899	4129	6028	SO:0001819	synonymous_variant	51091	exon2			CATGATTGCAAGT	AJ238617	CCDS3432.1, CCDS3432.2	4p15.2	2008-10-27			ENSG00000109618	ENSG00000109618			30605	protein-coding gene	gene with protein product	"""soluble liver antigen/liver pancreas antigen"""	613009				16230358, 10931155, 17142313, 17194211	Standard	NM_016955		Approved	SLA/LP, SLA	uc003grg.3	Q9HD40	OTTHUMG00000128563	ENST00000382103.2:c.177A>C	chr4.hg19:g.25160667T>G		199.0	0.0		265.0	154.0	NM_016955	A8K8W1|Q0D2P3|Q17RT1|Q9NXZ5|Q9UGM9|Q9Y353	Silent	SNP	ENST00000382103.2	hg19	CCDS3432.2																																																																																			.	.		0.388	SEPSECS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250414.2	NM_016955	
KIT	3815	hgsc.bcm.edu	37	4	55564702	55564702	+	Nonsense_Mutation	SNP	C	C	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr4:55564702C>A	ENST00000288135.5	+	3	687	c.590C>A	c.(589-591)tCg>tAg	p.S197*		NM_000222.2|NM_001093772.1	NP_000213.1|NP_001087241.1	P10721	KIT_HUMAN	v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog	197	Ig-like C2-type 2.				actin cytoskeleton reorganization (GO:0031532)|activation of MAPK activity (GO:0000187)|cell chemotaxis (GO:0060326)|cellular response to thyroid hormone stimulus (GO:0097067)|cytokine-mediated signaling pathway (GO:0019221)|dendritic cell cytokine production (GO:0002371)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|digestive tract development (GO:0048565)|ectopic germ cell programmed cell death (GO:0035234)|embryonic hemopoiesis (GO:0035162)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial cell proliferation (GO:0050673)|erythrocyte differentiation (GO:0030218)|erythropoietin-mediated signaling pathway (GO:0038162)|Fc receptor signaling pathway (GO:0038093)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|germ cell migration (GO:0008354)|glycosphingolipid metabolic process (GO:0006687)|hemopoiesis (GO:0030097)|immature B cell differentiation (GO:0002327)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|Kit signaling pathway (GO:0038109)|lamellipodium assembly (GO:0030032)|lymphoid progenitor cell differentiation (GO:0002320)|male gonad development (GO:0008584)|mast cell chemotaxis (GO:0002551)|mast cell cytokine production (GO:0032762)|mast cell degranulation (GO:0043303)|mast cell differentiation (GO:0060374)|mast cell proliferation (GO:0070662)|megakaryocyte development (GO:0035855)|melanocyte adhesion (GO:0097326)|melanocyte differentiation (GO:0030318)|melanocyte migration (GO:0097324)|myeloid progenitor cell differentiation (GO:0002318)|negative regulation of programmed cell death (GO:0043069)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ovarian follicle development (GO:0001541)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|pigmentation (GO:0043473)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase C activity (GO:0010863)|positive regulation of pseudopodium assembly (GO:0031274)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of tyrosine phosphorylation of Stat1 protein (GO:0042511)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|protein autophosphorylation (GO:0046777)|regulation of cell proliferation (GO:0042127)|regulation of cell shape (GO:0008360)|regulation of developmental pigmentation (GO:0048070)|signal transduction (GO:0007165)|signal transduction by phosphorylation (GO:0023014)|somatic stem cell division (GO:0048103)|somatic stem cell maintenance (GO:0035019)|spermatid development (GO:0007286)|spermatogenesis (GO:0007283)|stem cell differentiation (GO:0048863)|stem cell maintenance (GO:0019827)|T cell differentiation (GO:0030217)|visual learning (GO:0008542)	acrosomal vesicle (GO:0001669)|cell-cell junction (GO:0005911)|cytoplasmic side of plasma membrane (GO:0009898)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|mast cell granule (GO:0042629)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cytokine binding (GO:0019955)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|stem cell factor receptor activity (GO:0005020)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			NS(8)|autonomic_ganglia(1)|bone(21)|breast(2)|central_nervous_system(4)|endometrium(10)|eye(12)|genital_tract(18)|haematopoietic_and_lymphoid_tissue(1820)|kidney(17)|large_intestine(17)|lung(27)|ovary(23)|pancreas(4)|prostate(1)|salivary_gland(15)|skin(228)|soft_tissue(4117)|stomach(3)|testis(55)|thymus(7)|upper_aerodigestive_tract(1)	6411	all_cancers(7;0.00453)|all_lung(4;0.000565)|Lung NSC(11;0.00129)|all_epithelial(27;0.0104)|Glioma(25;0.08)|all_neural(26;0.101)		LUSC - Lung squamous cell carcinoma(32;0.000276)|Epithelial(7;0.209)	Colorectal(1;0.0276)|COAD - Colon adenocarcinoma(1;0.171)	Dasatinib(DB01254)|Imatinib(DB00619)|Nilotinib(DB04868)|Pazopanib(DB06589)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	TCAGTGCTGTCGGAAAAATTC	0.498		1	"""Mis, O"""		"""GIST, AML, TGCT, mastocytosis, mucosal melanoma"""	"""GIST, epithelioma"""	Piebald trait		Piebaldism;Mast Cell disease, Familial Clustering of;Gastrointestinal Stromal Tumors, Sporadic Multiple Primary;Familial Gastrointestinal Stromal Tumors																												p.S197X		Atlas-SNP	.	yes	Dom	yes	Familial gastrointestinal stromal tumour	4	4q12	3815	v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog	yes	"""L, M, O, E"""	KIT,NS,haematopoietic_neoplasm,0,1	KIT	7396	.	0			c.C590A						.						104.0	94.0	98.0					4																	55564702		2203	4300	6503	SO:0001587	stop_gained	3815	exon3	Familial Cancer Database	Piebald trait;incl.: Familial Cutaneous Mastocytosis (Urticaria Pigmentosum);Sporadic Multiple GIST;Familial GIST, incl. Multiple Familial Gastrointestinal Autonomic Nerve Tumors (GANT)	TGCTGTCGGAAAA	S67773	CCDS3496.1, CCDS47058.1	4q12	2014-09-17			ENSG00000157404	ENSG00000157404		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6342	protein-coding gene	gene with protein product		164920	"""piebald trait"""	PBT		9027509	Standard	NM_001093772		Approved	CD117, SCFR, C-Kit	uc010igr.3	P10721	OTTHUMG00000128713	ENST00000288135.5:c.590C>A	chr4.hg19:g.55564702C>A	ENSP00000288135:p.Ser197*	100.0	0.0		75.0	34.0	NM_000222	B5A956|D5LXN2|D5M931|F5H8F8|Q6IQ28|Q99662|Q9UM99	Nonsense_Mutation	SNP	ENST00000288135.5	hg19	CCDS3496.1	.	.	.	.	.	.	.	.	.	.	C	18.46	3.628715	0.67015	.	.	ENSG00000157404	ENST00000288135;ENST00000412167;ENST00000536403	.	.	.	5.75	4.91	0.64330	.	0.113900	0.39834	N	0.001251	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	12.9428	0.58354	0.0:0.9253:0.0:0.0747	.	.	.	.	X	197	.	ENSP00000288135:S197X	S	+	2	0	KIT	55259459	0.999000	0.42202	0.062000	0.19696	0.022000	0.10575	5.295000	0.65692	1.440000	0.47531	0.643000	0.83706	TCG	.	.		0.498	KIT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000250618.1		
KDR	3791	hgsc.bcm.edu	37	4	55973948	55973948	+	Missense_Mutation	SNP	G	G	C			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr4:55973948G>C	ENST00000263923.4	-	10	1663	c.1368C>G	c.(1366-1368)atC>atG	p.I456M		NM_002253.2	NP_002244.1	P35968	VGFR2_HUMAN	kinase insert domain receptor (a type III receptor tyrosine kinase)	456	Ig-like C2-type 5.				angiogenesis (GO:0001525)|branching morphogenesis of an epithelial tube (GO:0048754)|calcium ion homeostasis (GO:0055074)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|cell fate commitment (GO:0045165)|cell maturation (GO:0048469)|cell migration involved in sprouting angiogenesis (GO:0002042)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|embryonic hemopoiesis (GO:0035162)|endothelial cell differentiation (GO:0045446)|endothelium development (GO:0003158)|extracellular matrix organization (GO:0030198)|lung alveolus development (GO:0048286)|lymph vessel development (GO:0001945)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endothelial cell apoptotic process (GO:2000352)|ovarian follicle development (GO:0001541)|peptidyl-tyrosine autophosphorylation (GO:0038083)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of positive chemotaxis (GO:0050927)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of vasculogenesis (GO:2001214)|protein autophosphorylation (GO:0046777)|regulation of cell shape (GO:0008360)|signal transduction by phosphorylation (GO:0023014)|surfactant homeostasis (GO:0043129)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|vascular endothelial growth factor signaling pathway (GO:0038084)|vasculogenesis (GO:0001570)|viral process (GO:0016032)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sorting endosome (GO:0097443)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|Hsp90 protein binding (GO:0051879)|integrin binding (GO:0005178)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor binding (GO:0038085)|vascular endothelial growth factor-activated receptor activity (GO:0005021)			NS(1)|breast(3)|central_nervous_system(4)|endometrium(2)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(16)|lung(71)|ovary(2)|prostate(2)|skin(10)|soft_tissue(4)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	135	all_cancers(7;0.0255)|all_lung(4;0.00175)|Lung NSC(11;0.00384)|all_epithelial(27;0.034)|Glioma(25;0.08)|all_neural(26;0.101)		Epithelial(7;0.189)		Axitinib(DB06626)|Cabozantinib(DB08875)|Pazopanib(DB06589)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	AATACCAGTGGATGTGATGCG	0.512			Mis		"""NSCLC, angiosarcoma"""					TSP Lung(20;0.16)																											p.I456M		Atlas-SNP	.		Dom	yes		4	4q11-q12	3791	vascular endothelial growth factor receptor 2		E	.	KDR	307	.	0			c.C1368G						.						201.0	171.0	181.0					4																	55973948		2203	4300	6503	SO:0001583	missense	3791	exon10			CCAGTGGATGTGA	AF035121	CCDS3497.1	4q11-q12	2013-01-29			ENSG00000128052	ENSG00000128052	2.7.10.1	"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6307	protein-coding gene	gene with protein product		191306				1417831	Standard	NM_002253		Approved	FLK1, VEGFR, VEGFR2, CD309	uc003has.3	P35968	OTTHUMG00000128734	ENST00000263923.4:c.1368C>G	chr4.hg19:g.55973948G>C	ENSP00000263923:p.Ile456Met	154.0	0.0		115.0	43.0	NM_002253	A2RRS0|B5A925|C5IFA0|O60723|Q14178	Missense_Mutation	SNP	ENST00000263923.4	hg19	CCDS3497.1	.	.	.	.	.	.	.	.	.	.	G	11.65	1.702795	0.30232	.	.	ENSG00000128052	ENST00000263923	T	0.12361	2.69	5.29	4.45	0.53987	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.530991	0.21343	N	0.076095	T	0.29158	0.0725	M	0.74467	2.265	0.21915	N	0.999475	D;D	0.59357	0.985;0.978	P;D	0.63703	0.838;0.917	T	0.25710	-1.0124	10	0.87932	D	0	.	3.548	0.07836	0.1491:0.1337:0.5792:0.138	.	456;456	P35968-2;P35968	.;VGFR2_HUMAN	M	456	ENSP00000263923:I456M	ENSP00000263923:I456M	I	-	3	3	KDR	55668705	0.956000	0.32656	0.051000	0.19133	0.274000	0.26718	1.215000	0.32431	1.235000	0.43724	0.313000	0.20887	ATC	.	.		0.512	KDR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250645.1		
AASDH	132949	hgsc.bcm.edu	37	4	57250311	57250311	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr4:57250311T>A	ENST00000205214.6	-	2	335	c.155A>T	c.(154-156)cAc>cTc	p.H52L	AASDH_ENST00000451613.1_Missense_Mutation_p.H52L|AASDH_ENST00000510762.1_Intron|AASDH_ENST00000513376.1_Intron|AASDH_ENST00000602986.1_5'UTR|AASDH_ENST00000434343.2_5'UTR|AASDH_ENST00000502617.1_Missense_Mutation_p.H52L	NM_181806.2	NP_861522.2	Q4L235	ACSF4_HUMAN	aminoadipate-semialdehyde dehydrogenase	52					fatty acid metabolic process (GO:0006631)		acid-thiol ligase activity (GO:0016878)|ATP binding (GO:0005524)			endometrium(2)|kidney(2)|large_intestine(8)|lung(17)|ovary(4)|prostate(3)|skin(2)|stomach(1)|urinary_tract(1)	40	Glioma(25;0.08)|all_neural(26;0.101)	all_hematologic(202;0.0017)				AAAGTCACAGTGTAACAGCAG	0.378																																					p.H52L		Atlas-SNP	.											.	AASDH	101	.	0			c.A155T						.						103.0	99.0	101.0					4																	57250311		2203	4300	6503	SO:0001583	missense	132949	exon2			TCACAGTGTAACA	AF516672	CCDS3504.1, CCDS68705.1, CCDS68706.1, CCDS75126.1, CCDS75127.1	4q12	2010-12-14			ENSG00000157426	ENSG00000157426	1.2.1.31	"""Acyl-CoA synthetase family"""	23993	protein-coding gene	gene with protein product	"""acyl-CoA synthetase family member 4"""	614365				15865210, 12712191, 17762044	Standard	XM_005265721		Approved	NRPS998, LYS2, ACSF4	uc003hbn.3	Q4L235	OTTHUMG00000128841	ENST00000205214.6:c.155A>T	chr4.hg19:g.57250311T>A	ENSP00000205214:p.His52Leu	253.0	0.0		235.0	92.0	NM_181806	A5D8V3|A5PL22|Q63HK2|Q63HR7|Q6IPP8|Q6TFZ6|Q7Z5Y3|Q96BW4|Q9P064	Missense_Mutation	SNP	ENST00000205214.6	hg19	CCDS3504.1	.	.	.	.	.	.	.	.	.	.	T	16.19	3.053740	0.55218	.	.	ENSG00000157426	ENST00000205214;ENST00000451613;ENST00000502617	T;T;T	0.49139	0.79;1.1;0.79	5.92	4.74	0.60224	AMP-dependent synthetase/ligase (1);	0.287343	0.44097	D	0.000488	T	0.49338	0.1551	L	0.38953	1.18	0.28835	N	0.896912	P;P;P;D	0.57899	0.855;0.766;0.855;0.981	B;P;B;P	0.54590	0.359;0.468;0.359;0.756	T	0.44832	-0.9302	10	0.35671	T	0.21	-2.8613	11.8177	0.52220	0.0:0.0689:0.0:0.9311	.	52;52;52;52	Q4L235-4;B4E2K0;Q4L235-3;Q4L235	.;.;.;ACSF4_HUMAN	L	52	ENSP00000205214:H52L;ENSP00000409656:H52L;ENSP00000421171:H52L	ENSP00000205214:H52L	H	-	2	0	AASDH	56945068	1.000000	0.71417	0.989000	0.46669	0.569000	0.35902	3.169000	0.50809	1.067000	0.40740	0.528000	0.53228	CAC	.	.		0.378	AASDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250780.1	NM_181806	
EPHA5	2044	hgsc.bcm.edu	37	4	66467379	66467379	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr4:66467379T>A	ENST00000273854.3	-	3	1490	c.890A>T	c.(889-891)gAg>gTg	p.E297V	EPHA5_ENST00000432638.2_Missense_Mutation_p.E297V|EPHA5_ENST00000354839.4_Missense_Mutation_p.E297V|EPHA5_ENST00000511294.1_Missense_Mutation_p.E297V	NM_001281765.1|NM_004439.5	NP_001268694.1|NP_004430.4	P54756	EPHA5_HUMAN	EPH receptor A5	297	Cys-rich.				axon guidance (GO:0007411)|cAMP-mediated signaling (GO:0019933)|ephrin receptor signaling pathway (GO:0048013)|hippocampus development (GO:0021766)|negative regulation of synapse assembly (GO:0051964)|neuron development (GO:0048666)|positive regulation of CREB transcription factor activity (GO:0032793)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|regulation of Rac GTPase activity (GO:0032314)	dendrite (GO:0030425)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|rough endoplasmic reticulum (GO:0005791)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)|GPI-linked ephrin receptor activity (GO:0005004)|transmembrane-ephrin receptor activity (GO:0005005)			autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(25)|liver(1)|lung(76)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	142						GCCATTTTTCTCTTCATATCC	0.493										TSP Lung(17;0.13)																											p.E297V		Atlas-SNP	.											.	EPHA5	315	.	0			c.A890T						.						99.0	106.0	104.0					4																	66467379		2203	4300	6503	SO:0001583	missense	2044	exon3			TTTTTCTCTTCAT	L36644	CCDS3513.1, CCDS3514.1, CCDS75131.1, CCDS75132.1, CCDS75133.1	4q13.1	2013-02-11	2004-10-28		ENSG00000145242	ENSG00000145242		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3389	protein-coding gene	gene with protein product		600004	"""EphA5"""			9267020, 7528718	Standard	NM_004439		Approved	Hek7, TYRO4, CEK7, EHK1	uc003hcy.3	P54756	OTTHUMG00000129273	ENST00000273854.3:c.890A>T	chr4.hg19:g.66467379T>A	ENSP00000273854:p.Glu297Val	58.0	0.0		55.0	23.0	NM_004439	Q7Z3F2	Missense_Mutation	SNP	ENST00000273854.3	hg19	CCDS3513.1	.	.	.	.	.	.	.	.	.	.	T	19.99	3.929328	0.73327	.	.	ENSG00000145242	ENST00000273854;ENST00000432638;ENST00000354839;ENST00000511294	T;T;T;D	0.97161	1.59;-0.89;1.59;-4.27	6.08	6.08	0.98989	.	0.186939	0.37393	N	0.002116	D	0.98115	0.9378	M	0.70787	2.145	0.58432	D	0.999997	D;D;D;D	0.76494	0.997;0.982;0.998;0.999	D;P;D;D	0.68621	0.911;0.898;0.959;0.931	D	0.99050	1.0827	10	0.87932	D	0	.	16.6438	0.85155	0.0:0.0:0.0:1.0	.	297;297;297;297	B7ZKW7;B7ZKJ3;P54756-2;P54756	.;.;.;EPHA5_HUMAN	V	297	ENSP00000273854:E297V;ENSP00000389208:E297V;ENSP00000346899:E297V;ENSP00000427638:E297V	ENSP00000273854:E297V	E	-	2	0	EPHA5	66149974	1.000000	0.71417	1.000000	0.80357	0.635000	0.38103	6.275000	0.72594	2.333000	0.79357	0.533000	0.62120	GAG	.	.		0.493	EPHA5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251388.2	NM_004439	
EPHA5	2044	hgsc.bcm.edu	37	4	66467935	66467935	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr4:66467935A>T	ENST00000273854.3	-	3	934	c.334T>A	c.(334-336)Tgg>Agg	p.W112R	EPHA5_ENST00000432638.2_Missense_Mutation_p.W112R|EPHA5_ENST00000354839.4_Missense_Mutation_p.W112R|EPHA5_ENST00000511294.1_Missense_Mutation_p.W112R	NM_001281765.1|NM_004439.5	NP_001268694.1|NP_004430.4	P54756	EPHA5_HUMAN	EPH receptor A5	112	Eph LBD. {ECO:0000255|PROSITE- ProRule:PRU00883}.				axon guidance (GO:0007411)|cAMP-mediated signaling (GO:0019933)|ephrin receptor signaling pathway (GO:0048013)|hippocampus development (GO:0021766)|negative regulation of synapse assembly (GO:0051964)|neuron development (GO:0048666)|positive regulation of CREB transcription factor activity (GO:0032793)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|regulation of Rac GTPase activity (GO:0032314)	dendrite (GO:0030425)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|rough endoplasmic reticulum (GO:0005791)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)|GPI-linked ephrin receptor activity (GO:0005004)|transmembrane-ephrin receptor activity (GO:0005005)			autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(25)|liver(1)|lung(76)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	142						GTCAAAAGCCAGTTATTCTGA	0.438										TSP Lung(17;0.13)																											p.W112R		Atlas-SNP	.											.	EPHA5	315	.	0			c.T334A						.						123.0	129.0	127.0					4																	66467935		2203	4300	6503	SO:0001583	missense	2044	exon3			AAAGCCAGTTATT	L36644	CCDS3513.1, CCDS3514.1, CCDS75131.1, CCDS75132.1, CCDS75133.1	4q13.1	2013-02-11	2004-10-28		ENSG00000145242	ENSG00000145242		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3389	protein-coding gene	gene with protein product		600004	"""EphA5"""			9267020, 7528718	Standard	NM_004439		Approved	Hek7, TYRO4, CEK7, EHK1	uc003hcy.3	P54756	OTTHUMG00000129273	ENST00000273854.3:c.334T>A	chr4.hg19:g.66467935A>T	ENSP00000273854:p.Trp112Arg	63.0	0.0		50.0	22.0	NM_004439	Q7Z3F2	Missense_Mutation	SNP	ENST00000273854.3	hg19	CCDS3513.1	.	.	.	.	.	.	.	.	.	.	A	20.4	3.979272	0.74360	.	.	ENSG00000145242	ENST00000273854;ENST00000432638;ENST00000354839;ENST00000511294	T;T;T;T	0.59638	0.25;0.25;0.25;0.25	5.68	5.68	0.88126	Ephrin receptor, ligand binding (2);Galactose-binding domain-like (1);	0.000000	0.64402	D	0.000020	D	0.82737	0.5102	H	0.94183	3.505	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;0.999;0.999	D;D;D;D	0.97110	1.0;0.997;1.0;0.989	D	0.87809	0.2630	10	0.87932	D	0	.	15.9206	0.79562	1.0:0.0:0.0:0.0	.	112;112;112;112	B7ZKW7;B7ZKJ3;P54756-2;P54756	.;.;.;EPHA5_HUMAN	R	112	ENSP00000273854:W112R;ENSP00000389208:W112R;ENSP00000346899:W112R;ENSP00000427638:W112R	ENSP00000273854:W112R	W	-	1	0	EPHA5	66150530	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.339000	0.96797	2.166000	0.68216	0.533000	0.62120	TGG	.	.		0.438	EPHA5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251388.2	NM_004439	
TMPRSS11A	339967	hgsc.bcm.edu	37	4	68780363	68780363	+	Silent	SNP	A	A	G			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr4:68780363A>G	ENST00000334830.7	-	9	1793	c.1047T>C	c.(1045-1047)gaT>gaC	p.D349D	TMPRSS11A_ENST00000396188.2_Silent_p.D346D|UBA6-AS1_ENST00000500538.2_RNA|TMPRSS11A_ENST00000508048.1_Silent_p.D345D			Q6ZMR5	TM11A_HUMAN	transmembrane protease, serine 11A	349	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				cell cycle (GO:0007049)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	serine-type endopeptidase activity (GO:0004252)			breast(1)|cervix(2)|kidney(1)|large_intestine(8)|lung(11)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)	29						CAGGTTTTATATCATTGCCAT	0.383																																					p.D349D	NSCLC(26;2 894 10941 14480 22546)	Atlas-SNP	.											.	TMPRSS11A	74	.	0			c.T1047C						.						139.0	131.0	134.0					4																	68780363		2203	4300	6503	SO:0001819	synonymous_variant	339967	exon9			TTTTATATCATTG	AF071882	CCDS3519.1	4q13.2	2010-04-13			ENSG00000187054	ENSG00000187054		"""Serine peptidases / Transmembrane"""	27954	protein-coding gene	gene with protein product		611704				15328353	Standard	NM_182606		Approved	ECRG1	uc003hdr.1	Q6ZMR5	OTTHUMG00000129303	ENST00000334830.7:c.1047T>C	chr4.hg19:g.68780363A>G		251.0	0.0		235.0	30.0	NM_182606	J3KNQ8|Q2NKI9|Q6JE90|Q7RTY4|Q86TK8	Silent	SNP	ENST00000334830.7	hg19	CCDS3519.1																																																																																			.	.		0.383	TMPRSS11A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251433.3	NM_182606	
TMPRSS11A	339967	hgsc.bcm.edu	37	4	68795630	68795630	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr4:68795630A>G	ENST00000334830.7	-	5	1204	c.458T>C	c.(457-459)tTg>tCg	p.L153S	TMPRSS11A_ENST00000396188.2_Missense_Mutation_p.L150S|UBA6-AS1_ENST00000500538.2_RNA|TMPRSS11A_ENST00000508048.1_Missense_Mutation_p.L149S			Q6ZMR5	TM11A_HUMAN	transmembrane protease, serine 11A	153	SEA. {ECO:0000255|PROSITE- ProRule:PRU00188}.				cell cycle (GO:0007049)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	serine-type endopeptidase activity (GO:0004252)			breast(1)|cervix(2)|kidney(1)|large_intestine(8)|lung(11)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)	29						ATTTATTGGCAAGGCTCTTAA	0.383																																					p.L153S	NSCLC(26;2 894 10941 14480 22546)	Atlas-SNP	.											.	TMPRSS11A	74	.	0			c.T458C						.						176.0	164.0	168.0					4																	68795630		2203	4300	6503	SO:0001583	missense	339967	exon5			ATTGGCAAGGCTC	AF071882	CCDS3519.1	4q13.2	2010-04-13			ENSG00000187054	ENSG00000187054		"""Serine peptidases / Transmembrane"""	27954	protein-coding gene	gene with protein product		611704				15328353	Standard	NM_182606		Approved	ECRG1	uc003hdr.1	Q6ZMR5	OTTHUMG00000129303	ENST00000334830.7:c.458T>C	chr4.hg19:g.68795630A>G	ENSP00000334611:p.Leu153Ser	213.0	0.0		165.0	80.0	NM_182606	J3KNQ8|Q2NKI9|Q6JE90|Q7RTY4|Q86TK8	Missense_Mutation	SNP	ENST00000334830.7	hg19	CCDS3519.1	.	.	.	.	.	.	.	.	.	.	A	17.48	3.400682	0.62177	.	.	ENSG00000187054	ENST00000508048;ENST00000334830;ENST00000396188;ENST00000513536	T;T;T;T	0.51574	0.7;0.7;0.7;0.7	5.98	4.8	0.61643	SEA (1);	0.000000	0.43747	D	0.000527	T	0.67933	0.2946	M	0.83012	2.62	0.27428	N	0.954094	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.64287	-0.6443	10	0.72032	D	0.01	.	8.94	0.35725	0.916:0.0:0.084:0.0	.	150;153	B5MDI9;Q6ZMR5	.;TM11A_HUMAN	S	149;153;150;130	ENSP00000426911:L149S;ENSP00000334611:L153S;ENSP00000379491:L150S;ENSP00000427621:L130S	ENSP00000334611:L153S	L	-	2	0	TMPRSS11A	68478225	0.572000	0.26668	0.549000	0.28204	0.921000	0.55340	2.736000	0.47385	1.076000	0.40961	0.533000	0.62120	TTG	.	.		0.383	TMPRSS11A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251433.3	NM_182606	
PTPN13	5783	hgsc.bcm.edu	37	4	87732253	87732253	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr4:87732253C>A	ENST00000411767.2	+	47	7417	c.7354C>A	c.(7354-7356)Cag>Aag	p.Q2452K	PTPN13_ENST00000427191.2_Missense_Mutation_p.Q2433K|PTPN13_ENST00000511467.1_Missense_Mutation_p.Q2457K|PTPN13_ENST00000316707.6_Missense_Mutation_p.Q2261K|PTPN13_ENST00000436978.1_Missense_Mutation_p.Q2457K			Q12923	PTN13_HUMAN	protein tyrosine phosphatase, non-receptor type 13 (APO-1/CD95 (Fas)-associated phosphatase)	2452	Tyrosine-protein phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00160}.				peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cell body (GO:0044297)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|lamellipodium (GO:0030027)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein tyrosine phosphatase activity (GO:0004725)			NS(4)|breast(3)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(12)|large_intestine(23)|lung(24)|ovary(4)|prostate(3)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(2)	93		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.242)		OV - Ovarian serous cystadenocarcinoma(123;0.00082)		CGGAATGGTTCAGACAGAGGT	0.373																																					p.Q2457K		Atlas-SNP	.											.	PTPN13	203	.	0			c.C7369A						.						104.0	97.0	99.0					4																	87732253		1894	4122	6016	SO:0001583	missense	5783	exon47			ATGGTTCAGACAG		CCDS47093.1, CCDS47094.1, CCDS47095.1, CCDS47096.1	4q21.3	2011-06-09			ENSG00000163629	ENSG00000163629		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9646	protein-coding gene	gene with protein product		600267				8287977	Standard	NM_006264		Approved	PTP1E, PTP-BAS, PTPL1, PTP-BL	uc003hpy.3	Q12923	OTTHUMG00000160968	ENST00000411767.2:c.7354C>A	chr4.hg19:g.87732253C>A	ENSP00000407249:p.Gln2452Lys	46.0	0.0		42.0	12.0	NM_080685	B2RTR0|Q15159|Q15263|Q15264|Q15265|Q15674|Q16826|Q8IWH7|Q9NYN9|Q9UDA8	Missense_Mutation	SNP	ENST00000411767.2	hg19	CCDS47094.1	.	.	.	.	.	.	.	.	.	.	C	28.4	4.918890	0.92249	.	.	ENSG00000163629	ENST00000427191;ENST00000436978;ENST00000316707;ENST00000411767;ENST00000511467;ENST00000357349	D;D;D;D;D	0.85629	-2.01;-2.01;-2.01;-2.01;-2.01	5.1	5.1	0.69264	Protein-tyrosine phosphatase, receptor/non-receptor type (4);Protein-tyrosine/Dual-specificity phosphatase (1);	0.000000	0.46442	D	0.000300	D	0.94735	0.8301	H	0.94964	3.605	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.81914	0.983;0.973;0.995;0.992	D	0.96020	0.9008	10	0.87932	D	0	.	18.8679	0.92300	0.0:1.0:0.0:0.0	.	2261;2433;2452;2457	Q12923-2;Q12923-3;Q12923;Q12923-4	.;.;PTN13_HUMAN;.	K	2433;2457;2261;2452;2457;2401	ENSP00000408368:Q2433K;ENSP00000394794:Q2457K;ENSP00000322675:Q2261K;ENSP00000407249:Q2452K;ENSP00000426626:Q2457K	ENSP00000322675:Q2261K	Q	+	1	0	PTPN13	87951277	1.000000	0.71417	0.995000	0.50966	0.974000	0.67602	7.445000	0.80570	2.516000	0.84829	0.467000	0.42956	CAG	.	.		0.373	PTPN13-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000363191.1		
CCSER1	401145	hgsc.bcm.edu	37	4	91229854	91229854	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr4:91229854A>G	ENST00000509176.1	+	2	707	c.419A>G	c.(418-420)gAg>gGg	p.E140G	CCSER1_ENST00000333691.8_Missense_Mutation_p.E140G|CCSER1_ENST00000432775.2_Missense_Mutation_p.E140G	NM_001145065.1	NP_001138537.1	Q9C0I3	CCSE1_HUMAN	coiled-coil serine-rich protein 1	140																	AGGGAAAAAGAGCACTCAACT	0.368																																					p.E140G		Atlas-SNP	.											.	.	.	.	0			c.A419G						.						53.0	53.0	53.0					4																	91229854		1825	4083	5908	SO:0001583	missense	401145	exon2			AAAAAGAGCACTC		CCDS47099.1, CCDS47100.1	4q22.1	2012-12-03	2012-12-03	2012-12-03	ENSG00000184305	ENSG00000184305			29349	protein-coding gene	gene with protein product			"""family with sequence similarity 190, member A"""	FAM190A		11214970	Standard	NM_001145065		Approved	KIAA1680	uc003hsv.4	Q9C0I3	OTTHUMG00000160950	ENST00000509176.1:c.419A>G	chr4.hg19:g.91229854A>G	ENSP00000425040:p.Glu140Gly	131.0	0.0		126.0	56.0	NM_001145065	Q4W5M0|Q86V57	Missense_Mutation	SNP	ENST00000509176.1	hg19	CCDS47099.1	.	.	.	.	.	.	.	.	.	.	A	16.60	3.168134	0.57476	.	.	ENSG00000184305	ENST00000509176;ENST00000432775;ENST00000333691;ENST00000458365	T;T;T	0.53423	1.14;0.62;1.14	5.18	2.64	0.31445	.	0.189801	0.46442	D	0.000297	T	0.51568	0.1682	L	0.43152	1.355	0.28186	N	0.927964	D;P;P	0.56287	0.975;0.51;0.649	P;B;B	0.58454	0.839;0.23;0.322	T	0.46091	-0.9216	10	0.72032	D	0.01	-20.7715	8.5104	0.33213	0.8002:0.1308:0.069:0.0	.	140;140;140	Q9C0I3-2;Q9C0I3;E7EUW0	.;F190A_HUMAN;.	G	140	ENSP00000425040:E140G;ENSP00000389283:E140G;ENSP00000329482:E140G	ENSP00000329482:E140G	E	+	2	0	FAM190A	91448877	1.000000	0.71417	0.964000	0.40570	0.989000	0.77384	5.517000	0.67061	0.458000	0.26988	0.533000	0.62120	GAG	.	.		0.368	CCSER1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363109.3	NM_001145065	
BANK1	55024	hgsc.bcm.edu	37	4	102783820	102783820	+	Splice_Site	SNP	A	A	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr4:102783820A>T	ENST00000322953.4	+	4	1036	c.762A>T	c.(760-762)ttA>ttT	p.L254F	BANK1_ENST00000428908.1_Splice_Site_p.L121F|BANK1_ENST00000444316.2_Splice_Site_p.L224F|BANK1_ENST00000504592.1_Splice_Site_p.L239F|BANK1_ENST00000508653.1_Splice_Site_p.L121F	NM_017935.4	NP_060405	Q8NDB2	BANK1_HUMAN	B-cell scaffold protein with ankyrin repeats 1	254	DBB. {ECO:0000255|PROSITE- ProRule:PRU00707}.				B cell activation (GO:0042113)					NS(1)|breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|liver(2)|lung(16)|ovary(2)|skin(2)|urinary_tract(1)	44		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;2.7e-07)		TGAAAGCTTTAGGTAAGAATG	0.313																																					p.L254F		Atlas-SNP	.											.	BANK1	95	.	0			c.A762T						.						55.0	55.0	55.0					4																	102783820		2203	4297	6500	SO:0001630	splice_region_variant	55024	exon4			AGCTTTAGGTAAG	AB063170	CCDS34038.1, CCDS47115.1, CCDS47116.1	4q23	2013-01-11						"""Ankyrin repeat domain containing"""	18233	protein-coding gene	gene with protein product		610292				11782428, 21208380, 21480188	Standard	NM_017935		Approved	BANK, FLJ20706	uc003hvy.4	Q8NDB2		ENST00000322953.4:c.763+1A>T	chr4.hg19:g.102783820A>T		192.0	0.0		157.0	64.0	NM_017935	A8K7W8|B0F3S2|Q8N5K8|Q8NB56|Q8WYN5|Q9NWP2	Missense_Mutation	SNP	ENST00000322953.4	hg19	CCDS34038.1	.	.	.	.	.	.	.	.	.	.	A	17.16	3.318220	0.60524	.	.	ENSG00000153064	ENST00000504592;ENST00000322953;ENST00000428908;ENST00000508653;ENST00000444316	T;T;T;T;T	0.20463	2.79;2.79;2.07;2.07;2.79	5.29	2.81	0.32909	DBB domain (1);	0.785218	0.10542	N	0.662562	T	0.31949	0.0813	L	0.50333	1.59	0.27041	N	0.964014	B;D;D	0.63880	0.385;0.993;0.993	B;P;P	0.61132	0.099;0.884;0.884	T	0.12066	-1.0562	10	0.39692	T	0.17	.	5.265	0.15593	0.751:0.0:0.0834:0.1656	.	121;254;239	Q8NDB2-4;Q8NDB2;Q8NDB2-2	.;BANK1_HUMAN;.	F	239;254;121;121;224	ENSP00000421443:L239F;ENSP00000320509:L254F;ENSP00000412748:L121F;ENSP00000422314:L121F;ENSP00000388817:L224F	ENSP00000320509:L254F	L	+	3	2	BANK1	103002843	1.000000	0.71417	0.977000	0.42913	0.982000	0.71751	4.214000	0.58527	0.307000	0.22880	0.477000	0.44152	TTA	.	.		0.313	BANK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363161.1	NM_017935	Missense_Mutation
EGF	1950	hgsc.bcm.edu	37	4	110904598	110904598	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr4:110904598A>G	ENST00000265171.5	+	16	2837	c.2392A>G	c.(2392-2394)Aac>Gac	p.N798D	EGF_ENST00000509793.1_Missense_Mutation_p.N756D|EGF_ENST00000503392.1_Missense_Mutation_p.N798D	NM_001178130.1|NM_001963.4	NP_001171601.1|NP_001954.2	P01133	EGF_HUMAN	epidermal growth factor	798					activation of MAPKK activity (GO:0000186)|activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|branching morphogenesis of an epithelial tube (GO:0048754)|DNA replication (GO:0006260)|epidermal growth factor receptor signaling pathway (GO:0007173)|ERK1 and ERK2 cascade (GO:0070371)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|mammary gland alveolus development (GO:0060749)|negative regulation of cholesterol efflux (GO:0090370)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of secretion (GO:0051048)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cerebellar granule cell precursor proliferation (GO:0021940)|positive regulation of DNA binding (GO:0043388)|positive regulation of epidermal growth factor-activated receptor activity (GO:0045741)|positive regulation of hyaluronan biosynthetic process (GO:1900127)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of mitosis (GO:0045840)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of phosphorylation (GO:0042327)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of calcium ion import (GO:0090279)|regulation of protein localization to cell surface (GO:2000008)|signal transduction (GO:0007165)|STAT protein import into nucleus (GO:0007262)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)	calcium ion binding (GO:0005509)|epidermal growth factor receptor binding (GO:0005154)|growth factor activity (GO:0008083)|transmembrane receptor protein tyrosine kinase activator activity (GO:0030297)			breast(1)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(19)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	50		Hepatocellular(203;0.0893)		OV - Ovarian serous cystadenocarcinoma(123;9.87e-06)	Sucralfate(DB00364)	TGATCTAAAGAACCAAGTAAC	0.348																																					p.N798D		Atlas-SNP	.											.	EGF	113	.	0			c.A2392G						.						100.0	92.0	95.0					4																	110904598		2203	4300	6503	SO:0001583	missense	1950	exon16			CTAAAGAACCAAG	X04571	CCDS3689.1, CCDS54794.1, CCDS54795.1	4q25	2012-10-02	2010-05-11		ENSG00000138798	ENSG00000138798			3229	protein-coding gene	gene with protein product		131530	"""epidermal growth factor (beta-urogastrone)"""				Standard	NM_001963		Approved		uc003hzy.4	P01133	OTTHUMG00000132044	ENST00000265171.5:c.2392A>G	chr4.hg19:g.110904598A>G	ENSP00000265171:p.Asn798Asp	121.0	0.0		111.0	56.0	NM_001963	B4DRK7|E7EVD2|E9PBF0|Q52LZ6	Missense_Mutation	SNP	ENST00000265171.5	hg19	CCDS3689.1	.	.	.	.	.	.	.	.	.	.	A	2.085	-0.409725	0.04799	.	.	ENSG00000138798	ENST00000509793;ENST00000265171;ENST00000503392	D;D;D	0.88277	-2.36;-2.27;-1.94	5.31	-0.0968	0.13635	.	0.928471	0.09419	N	0.804668	T	0.69628	0.3132	N	0.04880	-0.145	0.09310	N	1	B;B;B	0.06786	0.001;0.001;0.0	B;B;B	0.09377	0.004;0.004;0.004	T	0.57659	-0.7773	10	0.02654	T	1	.	4.878	0.13665	0.6186:0.1482:0.2332:0.0	.	798;756;798	E7EVD2;P01133-2;P01133	.;.;EGF_HUMAN	D	756;798;798	ENSP00000424316:N756D;ENSP00000265171:N798D;ENSP00000421384:N798D	ENSP00000265171:N798D	N	+	1	0	EGF	111124047	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	0.675000	0.25232	-0.221000	0.09973	-1.098000	0.02139	AAC	.	.		0.348	EGF-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255065.1		
PABPC4L	132430	hgsc.bcm.edu	37	4	135121999	135121999	+	Nonsense_Mutation	SNP	A	A	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr4:135121999A>T	ENST00000421491.3	-	2	432	c.176T>A	c.(175-177)tTg>tAg	p.L59*	PABPC4L_ENST00000529122.2_Nonsense_Mutation_p.L117*			P0CB38	PAB4L_HUMAN	poly(A) binding protein, cytoplasmic 4-like	59	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.						nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			breast(1)|endometrium(2)	3						AGCCAGCTGCAAGAAGTTCAC	0.552																																					p.L117X		Atlas-SNP	.											.	PABPC4L	60	.	0			c.T350A						.						69.0	64.0	66.0					4																	135121999		692	1591	2283	SO:0001587	stop_gained	132430	exon2			AGCTGCAAGAAGT	AY672099		4q28.3	2013-02-12				ENSG00000254535		"""RNA binding motif (RRM) containing"""	31955	protein-coding gene	gene with protein product							Standard	NM_001114734		Approved		uc010ioe.3	P0CB38		ENST00000421491.3:c.176T>A	chr4.hg19:g.135121999A>T	ENSP00000463233:p.Leu59*	78.0	0.0		71.0	31.0	NM_001114734		Nonsense_Mutation	SNP	ENST00000421491.3	hg19																																																																																				.	.		0.552	PABPC4L-001	KNOWN	upstream_ATG|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000364399.2	NM_001114734	
MAML3	55534	hgsc.bcm.edu	37	4	140651774	140651774	+	Silent	SNP	G	G	T	rs372122289		TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr4:140651774G>T	ENST00000509479.2	-	3	2983	c.2127C>A	c.(2125-2127)tcC>tcA	p.S709S	MGST2_ENST00000515137.1_Intron	NM_018717.4	NP_061187			mastermind-like 3 (Drosophila)											breast(1)|endometrium(7)|kidney(2)|large_intestine(1)|lung(9)|ovary(1)|prostate(2)|urinary_tract(2)	25	all_hematologic(180;0.162)					GGGGCACGGAGGACTGCATGG	0.632																																					p.S705S		Atlas-SNP	.											.	MAML3	192	.	0			c.C2115A						.						28.0	31.0	30.0					4																	140651774		2018	4174	6192	SO:0001819	synonymous_variant	55534	exon4			CACGGAGGACTGC	AB058719	CCDS54805.1	4q31.1	2014-08-12	2003-09-24		ENSG00000196782	ENSG00000196782			16272	protein-coding gene	gene with protein product	"""mastermind (drosophila)-like 3"""	608991	"""trinucleotide repeat containing 3"""	TNRC3		12370315, 12386158	Standard	NM_018717		Approved	KIAA1816, MAM2, CAGH3, GDN	uc021xsg.1	Q96JK9	OTTHUMG00000161441	ENST00000509479.2:c.2127C>A	chr4.hg19:g.140651774G>T		97.0	0.0		112.0	65.0	NM_018717		Silent	SNP	ENST00000509479.2	hg19	CCDS54805.1	.	.	.	.	.	.	.	.	.	.	G	7.082	0.570365	0.13560	.	.	ENSG00000196782	ENST00000502696	.	.	.	5.74	-2.82	0.05787	.	.	.	.	.	T	0.18130	0.0435	.	.	.	0.28955	N	0.890201	.	.	.	.	.	.	T	0.27971	-1.0058	4	.	.	.	.	0.7201	0.00939	0.3438:0.1837:0.2852:0.1873	.	.	.	.	H	53	.	.	P	-	2	0	MAML3	140871224	0.128000	0.22383	0.001000	0.08648	0.812000	0.45895	-0.432000	0.06956	-0.735000	0.04837	-0.150000	0.13652	CCT	.	.		0.632	MAML3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364934.2		
ZNF330	27309	hgsc.bcm.edu	37	4	142145639	142145639	+	Splice_Site	SNP	A	A	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr4:142145639A>T	ENST00000262990.4	+	3	348		c.e3-1		ZNF330_ENST00000421169.2_Splice_Site	NM_014487.4	NP_055302.1	Q9Y3S2	ZN330_HUMAN	zinc finger protein 330							chromosome, centromeric region (GO:0000775)|midbody (GO:0030496)|nucleolus (GO:0005730)	metal ion binding (GO:0046872)|zinc ion binding (GO:0008270)			kidney(1)|large_intestine(4)|lung(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	14	all_hematologic(180;0.162)					TATATGTTACAGGAATGTGAC	0.269																																					.		Atlas-SNP	.											.	ZNF330	31	.	0			c.121-2A>T						.						77.0	84.0	82.0					4																	142145639		2199	4295	6494	SO:0001630	splice_region_variant	27309	exon3			TGTTACAGGAATG	AJ006591	CCDS3754.1	4q31.21	2008-05-15			ENSG00000109445	ENSG00000109445		"""Zinc fingers, C2H2-type"""	15462	protein-coding gene	gene with protein product		609550				11528117, 10593942	Standard	NM_001292002		Approved	NOA36, HSA6591	uc003iiq.4	Q9Y3S2	OTTHUMG00000133413	ENST00000262990.4:c.121-1A>T	chr4.hg19:g.142145639A>T		349.0	0.0		354.0	156.0	NM_014487	B2RDA3	Splice_Site	SNP	ENST00000262990.4	hg19	CCDS3754.1	.	.	.	.	.	.	.	.	.	.	A	23.7	4.453161	0.84209	.	.	ENSG00000109445	ENST00000262990;ENST00000512809;ENST00000503649;ENST00000512738;ENST00000421169	.	.	.	6.16	6.16	0.99307	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.8061	0.85666	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ZNF330	142365089	1.000000	0.71417	1.000000	0.80357	0.929000	0.56500	8.613000	0.90913	2.367000	0.80283	0.528000	0.53228	.	.	.		0.269	ZNF330-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257271.2	NM_014487	Intron
INPP4B	8821	hgsc.bcm.edu	37	4	142949992	142949992	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr4:142949992C>A	ENST00000513000.1	-	27	3151	c.2718G>T	c.(2716-2718)atG>atT	p.M906I	INPP4B_ENST00000308502.4_Missense_Mutation_p.M906I|INPP4B_ENST00000508116.1_Missense_Mutation_p.M906I|INPP4B_ENST00000262992.4_Missense_Mutation_p.M906I	NM_003866.2	NP_003857.2	O15327	INP4B_HUMAN	inositol polyphosphate-4-phosphatase, type II, 105kDa	906					cellular calcium ion homeostasis (GO:0006874)|inositol phosphate metabolic process (GO:0043647)|negative regulation of osteoclast differentiation (GO:0045671)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|regulation of bone remodeling (GO:0046850)|regulation of nucleocytoplasmic transport (GO:0046822)|regulation of protein kinase B signaling (GO:0051896)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|Golgi apparatus (GO:0005794)	lipid binding (GO:0008289)|phosphatidylinositol trisphosphate phosphatase activity (GO:0034594)|phosphatidylinositol-3,4-bisphosphate 4-phosphatase activity (GO:0016316)|phosphatidylinositol-4,5-bisphosphate 4-phosphatase activity (GO:0034597)			breast(3)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(8)|lung(29)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	58	all_hematologic(180;0.158)					TGGGGAAAGCCATCAGCTGTA	0.408																																					p.M906I		Atlas-SNP	.											.	INPP4B	132	.	0			c.G2718T						.						167.0	150.0	156.0					4																	142949992		2203	4300	6503	SO:0001583	missense	8821	exon27			GAAAGCCATCAGC	U96922	CCDS3757.1	4q31.1	2008-02-05	2002-08-29			ENSG00000109452			6075	protein-coding gene	gene with protein product		607494	"""inositol polyphosphate-4-phosphatase, type II, 105kD"""			9295334	Standard	NM_003866		Approved		uc003iiw.4	O15327		ENST00000513000.1:c.2718G>T	chr4.hg19:g.142949992C>A	ENSP00000425487:p.Met906Ile	115.0	0.0		89.0	47.0	NM_003866	Q2TAI2|Q5XLE7|Q6IN59|Q6PJB4	Missense_Mutation	SNP	ENST00000513000.1	hg19	CCDS3757.1	.	.	.	.	.	.	.	.	.	.	C	15.38	2.816722	0.50633	.	.	ENSG00000109452	ENST00000513000;ENST00000262992;ENST00000308502;ENST00000508116	T;T;T;T	0.22743	1.94;1.94;1.94;1.94	5.58	5.58	0.84498	.	0.520991	0.21011	N	0.081687	T	0.22704	0.0548	L	0.42686	1.345	0.80722	D	1	P	0.39022	0.655	B	0.38264	0.269	T	0.02070	-1.1219	10	0.22706	T	0.39	.	19.5654	0.95390	0.0:1.0:0.0:0.0	.	906	O15327	INP4B_HUMAN	I	906	ENSP00000425487:M906I;ENSP00000262992:M906I;ENSP00000308441:M906I;ENSP00000423954:M906I	ENSP00000262992:M906I	M	-	3	0	INPP4B	143169442	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.956000	0.70315	2.641000	0.89580	0.585000	0.79938	ATG	.	.		0.408	INPP4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364587.1	NM_003866	
MAB21L2	10586	hgsc.bcm.edu	37	4	151504564	151504564	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr4:151504564T>C	ENST00000317605.4	+	1	1488	c.383T>C	c.(382-384)aTc>aCc	p.I128T	LRBA_ENST00000357115.3_Intron|LRBA_ENST00000503716.1_5'Flank|LRBA_ENST00000510413.1_Intron|RP11-1336O20.2_ENST00000507934.1_RNA|LRBA_ENST00000507224.1_Intron|LRBA_ENST00000535741.1_Intron	NM_006439.4	NP_006430.1	Q9Y586	MB212_HUMAN	mab-21-like 2 (C. elegans)	128					camera-type eye development (GO:0043010)|embryonic body morphogenesis (GO:0010172)|eye development (GO:0001654)|nervous system development (GO:0007399)|positive regulation of cell proliferation (GO:0008284)	nucleus (GO:0005634)				breast(2)|endometrium(6)|kidney(1)|large_intestine(4)|lung(5)|ovary(1)|skin(2)	21	all_hematologic(180;0.151)			GBM - Glioblastoma multiforme(119;0.159)		GCGCGTAAGATCCGCTCGCGT	0.622																																					p.I128T		Atlas-SNP	.											.	MAB21L2	53	.	0			c.T383C						.						104.0	102.0	103.0					4																	151504564		2203	4300	6503	SO:0001583	missense	10586	exon1			GTAAGATCCGCTC	AF155219	CCDS3774.1	4q31.3	2013-10-22	2001-11-28		ENSG00000181541	ENSG00000181541			6758	protein-coding gene	gene with protein product		604357	"""mab-21 (C. elegans)-like 2"""				Standard	NM_006439		Approved		uc003ilw.3	Q9Y586	OTTHUMG00000161442	ENST00000317605.4:c.383T>C	chr4.hg19:g.151504564T>C	ENSP00000324701:p.Ile128Thr	55.0	0.0		58.0	20.0	NM_006439	B3KP37|Q9HBA7	Missense_Mutation	SNP	ENST00000317605.4	hg19	CCDS3774.1	.	.	.	.	.	.	.	.	.	.	T	19.96	3.923465	0.73213	.	.	ENSG00000181541	ENST00000317605	T	0.10005	2.92	5.63	5.63	0.86233	.	0.000000	0.85682	D	0.000000	T	0.31513	0.0799	M	0.80028	2.48	0.80722	D	1	D	0.57257	0.979	P	0.57425	0.82	T	0.08289	-1.0729	10	0.87932	D	0	-17.5434	15.8457	0.78887	0.0:0.0:0.0:1.0	.	128	Q9Y586	MB212_HUMAN	T	128	ENSP00000324701:I128T	ENSP00000324701:I128T	I	+	2	0	MAB21L2	151724014	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	8.040000	0.89188	2.131000	0.65755	0.459000	0.35465	ATC	.	.		0.622	MAB21L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364937.1	NM_006439	
DCHS2	54798	hgsc.bcm.edu	37	4	155156385	155156385	+	Missense_Mutation	SNP	T	T	A	rs147174513		TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr4:155156385T>A	ENST00000357232.4	-	25	8053	c.8054A>T	c.(8053-8055)gAc>gTc	p.D2685V		NM_017639.3	NP_060109.2	Q6V1P9	PCD23_HUMAN	dachsous cadherin-related 2	2685					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(1)|cervix(3)|endometrium(8)|kidney(5)|large_intestine(54)|lung(63)|ovary(4)|pancreas(1)|prostate(14)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	176	all_hematologic(180;0.208)	Renal(120;0.0854)		LUSC - Lung squamous cell carcinoma(193;0.107)		GGAGAGCTGGTCTGAGTCCCT	0.547																																					p.D2685V		Atlas-SNP	.											.	DCHS2	594	.	0			c.A8054T						.	T	VAL/ASP	0,4406		0,0,2203	82.0	74.0	77.0		8054	5.5	1.0	4	dbSNP_134	77	1,8599	1.2+/-3.3	0,1,4299	no	missense	DCHS2	NM_017639.3	152	0,1,6502	AA,AT,TT		0.0116,0.0,0.0077	probably-damaging	2685/2917	155156385	1,13005	2203	4300	6503	SO:0001583	missense	54798	exon25			AGCTGGTCTGAGT	BC140919	CCDS3785.1, CCDS47150.1	4q32.1	2014-06-04	2013-10-04	2004-09-03		ENSG00000197410		"""Cadherins / Cadherin-related"""	23111	protein-coding gene	gene with protein product	"""cadherin-related family member 7"""	612486	"""cadherin-like 27"", ""dachsous 2 (Drosophila)"""	CDH27, PCDH23		15003449	Standard	NM_017639		Approved	CDHJ, FLJ20047, PCDHJ, CDHR7	uc003inw.2	Q6V1P9		ENST00000357232.4:c.8054A>T	chr4.hg19:g.155156385T>A	ENSP00000349768:p.Asp2685Val	94.0	0.0		101.0	44.0	NM_017639	B2RU14|E9PC11|Q4W5P9|Q6ZS61|Q9NXU8	Missense_Mutation	SNP	ENST00000357232.4	hg19	CCDS3785.1	.	.	.	.	.	.	.	.	.	.	T	21.7	4.185197	0.78677	0.0	1.16E-4	ENSG00000197410	ENST00000357232	T	0.62788	0.0	5.54	5.54	0.83059	.	0.000000	0.64402	D	0.000001	T	0.76800	0.4038	M	0.80982	2.52	0.80722	D	1	D	0.65815	0.995	P	0.59424	0.857	T	0.77148	-0.2694	10	0.34782	T	0.22	.	15.6877	0.77424	0.0:0.0:0.0:1.0	.	2685	Q6V1P9	PCD23_HUMAN	V	2685	ENSP00000349768:D2685V	ENSP00000349768:D2685V	D	-	2	0	DCHS2	155375835	1.000000	0.71417	0.999000	0.59377	0.956000	0.61745	5.906000	0.69900	2.101000	0.63845	0.377000	0.23210	GAC	.	T|1.000;A|0.000		0.547	DCHS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365281.2	NM_001142552	
DCHS2	54798	hgsc.bcm.edu	37	4	155226268	155226268	+	Silent	SNP	T	T	C			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr4:155226268T>C	ENST00000357232.4	-	16	4010	c.4011A>G	c.(4009-4011)caA>caG	p.Q1337Q		NM_017639.3	NP_060109.2	Q6V1P9	PCD23_HUMAN	dachsous cadherin-related 2	1337	Cadherin 11. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(1)|cervix(3)|endometrium(8)|kidney(5)|large_intestine(54)|lung(63)|ovary(4)|pancreas(1)|prostate(14)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	176	all_hematologic(180;0.208)	Renal(120;0.0854)		LUSC - Lung squamous cell carcinoma(193;0.107)		TGAAGACTTCTTGAATTTCTC	0.328																																					p.Q1337Q		Atlas-SNP	.											.	DCHS2	594	.	0			c.A4011G						.						44.0	43.0	44.0					4																	155226268		2203	4299	6502	SO:0001819	synonymous_variant	54798	exon16			GACTTCTTGAATT	BC140919	CCDS3785.1, CCDS47150.1	4q32.1	2014-06-04	2013-10-04	2004-09-03		ENSG00000197410		"""Cadherins / Cadherin-related"""	23111	protein-coding gene	gene with protein product	"""cadherin-related family member 7"""	612486	"""cadherin-like 27"", ""dachsous 2 (Drosophila)"""	CDH27, PCDH23		15003449	Standard	NM_017639		Approved	CDHJ, FLJ20047, PCDHJ, CDHR7	uc003inw.2	Q6V1P9		ENST00000357232.4:c.4011A>G	chr4.hg19:g.155226268T>C		99.0	0.0		95.0	37.0	NM_017639	B2RU14|E9PC11|Q4W5P9|Q6ZS61|Q9NXU8	Silent	SNP	ENST00000357232.4	hg19	CCDS3785.1																																																																																			.	.		0.328	DCHS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365281.2	NM_001142552	
TENM3	55714	hgsc.bcm.edu	37	4	183659668	183659668	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr4:183659668A>G	ENST00000511685.1	+	18	3473	c.3350A>G	c.(3349-3351)gAt>gGt	p.D1117G	TENM3_ENST00000502950.1_3'UTR|TENM3_ENST00000406950.2_Missense_Mutation_p.D1117G			Q9P273	TEN3_HUMAN	teneurin transmembrane protein 3	1117					camera-type eye morphogenesis (GO:0048593)|homophilic cell adhesion (GO:0007156)|positive regulation of neuron projection development (GO:0010976)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)	cell projection (GO:0042995)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)										TGGACATTAGATAAACATCAC	0.448																																					p.D1117G		Atlas-SNP	.											.	.	.	.	0			c.A3350G						.						203.0	196.0	198.0					4																	183659668		1987	4158	6145	SO:0001583	missense	55714	exon17			CATTAGATAAACA	AF195420	CCDS47165.1	4q35	2012-10-02	2012-10-02	2012-10-02	ENSG00000218336	ENSG00000218336			29944	protein-coding gene	gene with protein product		610083	"""odz, odd Oz/ten-m homolog 3 (Drosophila)"""	ODZ3		10331952, 10625539	Standard	NM_001080477		Approved	Ten-M3, KIAA1455	uc003ivd.1	Q9P273	OTTHUMG00000160682	ENST00000511685.1:c.3350A>G	chr4.hg19:g.183659668A>G	ENSP00000424226:p.Asp1117Gly	88.0	0.0		86.0	41.0	NM_001080477	Q5XUL9|Q96SY2|Q9NV77|Q9NVW1|Q9NZJ2	Missense_Mutation	SNP	ENST00000511685.1	hg19	CCDS47165.1	.	.	.	.	.	.	.	.	.	.	A	17.53	3.413584	0.62511	.	.	ENSG00000218336	ENST00000511685;ENST00000406950	D;D	0.91351	-2.83;-2.83	5.35	5.35	0.76521	.	.	.	.	.	D	0.91862	0.7424	M	0.86740	2.835	0.51767	D	0.999939	B	0.16603	0.018	B	0.17098	0.017	D	0.90245	0.4289	9	0.87932	D	0	.	15.5001	0.75691	1.0:0.0:0.0:0.0	.	1117	Q9P273	TEN3_HUMAN	G	1117	ENSP00000424226:D1117G;ENSP00000385276:D1117G	ENSP00000385276:D1117G	D	+	2	0	ODZ3	183896662	1.000000	0.71417	0.880000	0.34516	0.364000	0.29643	7.385000	0.79763	2.250000	0.74265	0.533000	0.62120	GAT	.	.		0.448	TENM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361734.1		
TLR3	7098	hgsc.bcm.edu	37	4	186997908	186997908	+	Silent	SNP	A	A	C			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr4:186997908A>C	ENST00000296795.3	+	2	239	c.135A>C	c.(133-135)gtA>gtC	p.V45V		NM_003265.2	NP_003256.1	O15455	TLR3_HUMAN	toll-like receptor 3	45	LRRNT.				activation of NF-kappaB-inducing kinase activity (GO:0007250)|cellular response to drug (GO:0035690)|cellular response to exogenous dsRNA (GO:0071360)|cellular response to interferon-beta (GO:0035458)|cellular response to interferon-gamma (GO:0071346)|cellular response to mechanical stimulus (GO:0071260)|defense response to bacterium (GO:0042742)|defense response to virus (GO:0051607)|detection of virus (GO:0009597)|extrinsic apoptotic signaling pathway (GO:0097191)|hyperosmotic response (GO:0006972)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|I-kappaB phosphorylation (GO:0007252)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|male gonad development (GO:0008584)|microglial cell activation involved in immune response (GO:0002282)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|necroptotic signaling pathway (GO:0097527)|negative regulation of osteoclast differentiation (GO:0045671)|pathogen-associated molecular pattern dependent induction by symbiont of host innate immune response (GO:0052033)|positive regulation of apoptotic process (GO:0043065)|positive regulation of chemokine biosynthetic process (GO:0045080)|positive regulation of chemokine production (GO:0032722)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-alpha biosynthetic process (GO:0045356)|positive regulation of interferon-beta biosynthetic process (GO:0045359)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of JNK cascade (GO:0046330)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of toll-like receptor signaling pathway (GO:0034123)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of type III interferon production (GO:0034346)|response to exogenous dsRNA (GO:0043330)|signal transduction (GO:0007165)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|endolysosome membrane (GO:0036020)|endoplasmic reticulum membrane (GO:0005789)|endosome membrane (GO:0010008)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)	double-stranded RNA binding (GO:0003725)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)			breast(1)|endometrium(5)|large_intestine(8)|lung(8)|ovary(2)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	29		all_cancers(14;4.27e-52)|all_epithelial(14;7.69e-39)|all_lung(41;1.34e-13)|Lung NSC(41;3.58e-13)|Melanoma(20;1.91e-06)|Colorectal(36;0.0066)|Hepatocellular(41;0.00886)|Renal(120;0.00988)|Prostate(90;0.00996)|all_hematologic(60;0.014)|all_neural(102;0.243)		OV - Ovarian serous cystadenocarcinoma(60;1.47e-11)|BRCA - Breast invasive adenocarcinoma(30;1.14e-05)|GBM - Glioblastoma multiforme(59;0.000107)|STAD - Stomach adenocarcinoma(60;0.000279)|LUSC - Lung squamous cell carcinoma(40;0.00902)|READ - Rectum adenocarcinoma(43;0.16)		TGACTCAGGTACCCGATGATC	0.493																																					p.V45V		Atlas-SNP	.											.	TLR3	83	.	0			c.A135C						.						121.0	109.0	113.0					4																	186997908		2203	4300	6503	SO:0001819	synonymous_variant	7098	exon2			TCAGGTACCCGAT	U88879	CCDS3846.1	4q35	2014-09-17				ENSG00000164342		"""CD molecules"""	11849	protein-coding gene	gene with protein product		603029				9435236	Standard	NM_003265		Approved	CD283	uc003iyq.3	O15455		ENST00000296795.3:c.135A>C	chr4.hg19:g.186997908A>C		136.0	0.0		105.0	41.0	NM_003265	B2RAI7|B7Z7K0|E6Y0F0|E6Y0F1|E9PGH4|Q4VAL2|Q504W0	Silent	SNP	ENST00000296795.3	hg19	CCDS3846.1																																																																																			.	.		0.493	TLR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360313.4		
SLC6A3	6531	hgsc.bcm.edu	37	5	1409895	1409895	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr5:1409895G>T	ENST00000270349.9	-	10	1466	c.1339C>A	c.(1339-1341)Ctc>Atc	p.L447I	SLC6A3_ENST00000453492.2_Missense_Mutation_p.L447I	NM_001044.4	NP_001035.1	Q01959	SC6A3_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 3	447					adenohypophysis development (GO:0021984)|aging (GO:0007568)|cation transmembrane transport (GO:0098655)|cell death (GO:0008219)|dopamine biosynthetic process (GO:0042416)|dopamine catabolic process (GO:0042420)|dopamine transport (GO:0015872)|lactation (GO:0007595)|locomotory behavior (GO:0007626)|monoamine transport (GO:0015844)|neurotransmitter biosynthetic process (GO:0042136)|positive regulation of multicellular organism growth (GO:0040018)|prepulse inhibition (GO:0060134)|regulation of dopamine metabolic process (GO:0042053)|response to cAMP (GO:0051591)|response to cocaine (GO:0042220)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to iron ion (GO:0010039)|response to nicotine (GO:0035094)|sensory perception of smell (GO:0007608)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	axon (GO:0030424)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	dopamine binding (GO:0035240)|dopamine transmembrane transporter activity (GO:0005329)|dopamine:sodium symporter activity (GO:0005330)|drug binding (GO:0008144)|monoamine transmembrane transporter activity (GO:0008504)			breast(2)|endometrium(4)|kidney(1)|large_intestine(3)|lung(19)|ovary(4)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	38			OV - Ovarian serous cystadenocarcinoma(19;0.00928)|all cancers(22;0.0262)		Amoxapine(DB00543)|Amphetamine(DB00182)|Atomoxetine(DB00289)|Benzatropine(DB00245)|Benzphetamine(DB00865)|Bupropion(DB01156)|Chloroprocaine(DB01161)|Chlorphenamine(DB01114)|Citalopram(DB00215)|Cocaine(DB00907)|Dexmethylphenidate(DB06701)|Dextroamphetamine(DB01576)|Diethylpropion(DB00937)|Diphenylpyraline(DB01146)|Dopamine(DB00988)|Duloxetine(DB00476)|Ephedra(DB01363)|Escitalopram(DB01175)|Fencamfamine(DB01463)|Imipramine(DB00458)|Ioflupane I 123(DB08824)|Lisdexamfetamine(DB01255)|Loxapine(DB00408)|Mazindol(DB00579)|Methamphetamine(DB01577)|Methylphenidate(DB00422)|Mianserin(DB06148)|Mirtazapine(DB00370)|Modafinil(DB00745)|Nefazodone(DB01149)|Pethidine(DB00454)|Phenmetrazine(DB00830)|Phentermine(DB00191)|Procaine(DB00721)|Pseudoephedrine(DB00852)|Sertraline(DB01104)|Sibutramine(DB01105)|Trimipramine(DB00726)|Venlafaxine(DB00285)	AGCGTGAAGAGCTCACGGTGT	0.592																																					p.L447I		Atlas-SNP	.											.	SLC6A3	102	.	0			c.C1339A						.						210.0	152.0	172.0					5																	1409895		2203	4300	6503	SO:0001583	missense	6531	exon10			TGAAGAGCTCACG		CCDS3863.1	5p15.3	2013-07-19	2013-07-19		ENSG00000142319	ENSG00000142319		"""Solute carriers"""	11049	protein-coding gene	gene with protein product	"""dopamine transporter"""	126455	"""solute carrier family 6 (neurotransmitter transporter, dopamine), member 3"", ""dopamine transporter 1"""	DAT1		1406597	Standard	NM_001044		Approved	DAT	uc003jck.3	Q01959	OTTHUMG00000131016	ENST00000270349.9:c.1339C>A	chr5.hg19:g.1409895G>T	ENSP00000270349:p.Leu447Ile	74.0	0.0		51.0	29.0	NM_001044	A2RUN4|Q14996	Missense_Mutation	SNP	ENST00000270349.9	hg19	CCDS3863.1	.	.	.	.	.	.	.	.	.	.	G	12.83	2.055077	0.36277	.	.	ENSG00000142319	ENST00000270349;ENST00000453492	T;T	0.74842	-0.88;-0.88	4.19	4.19	0.49359	.	0.071928	0.56097	D	0.000028	T	0.68659	0.3025	L	0.28115	0.83	0.45502	D	0.998466	B	0.31227	0.314	B	0.42163	0.378	T	0.66874	-0.5813	10	0.31617	T	0.26	.	14.0096	0.64488	0.0:0.0:1.0:0.0	.	447	Q01959	SC6A3_HUMAN	I	447	ENSP00000270349:L447I;ENSP00000399806:L447I	ENSP00000270349:L447I	L	-	1	0	SLC6A3	1462895	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	4.738000	0.62073	1.880000	0.54463	0.478000	0.44815	CTC	.	.		0.592	SLC6A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253650.3	NM_001044	
IRX1	79192	hgsc.bcm.edu	37	5	3600372	3600372	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr5:3600372C>A	ENST00000302006.3	+	2	1362	c.1310C>A	c.(1309-1311)cCa>cAa	p.P437Q	CTD-2012M11.3_ENST00000559410.1_RNA	NM_024337.3	NP_077313.3	P78414	IRX1_HUMAN	iroquois homeobox 1	437					proximal/distal pattern formation involved in metanephric nephron development (GO:0072272)|regulation of transcription, DNA-templated (GO:0006355)|specification of loop of Henle identity (GO:0072086)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			biliary_tract(1)|endometrium(5)|kidney(2)|large_intestine(5)|lung(18)|ovary(2)|pancreas(1)|prostate(5)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	43						CCCACGCTCCCAGGTACAGCT	0.682																																					p.P437Q		Atlas-SNP	.											.	IRX1	106	.	0			c.C1310A						.						11.0	13.0	13.0					5																	3600372		2200	4295	6495	SO:0001583	missense	79192	exon2			CGCTCCCAGGTAC	U90307	CCDS34132.1	5p15.33	2011-12-16	2007-07-13		ENSG00000170549	ENSG00000170549		"""Homeoboxes / TALE class"""	14358	protein-coding gene	gene with protein product		606197					Standard	NM_024337		Approved	IRX-5	uc003jde.3	P78414	OTTHUMG00000161632	ENST00000302006.3:c.1310C>A	chr5.hg19:g.3600372C>A	ENSP00000305244:p.Pro437Gln	37.0	0.0		37.0	17.0	NM_024337	Q7Z2F8|Q8N312	Missense_Mutation	SNP	ENST00000302006.3	hg19	CCDS34132.1	.	.	.	.	.	.	.	.	.	.	C	6.098	0.386366	0.11524	.	.	ENSG00000170549	ENST00000302006	T	0.57436	0.4	4.24	4.24	0.50183	.	1.389510	0.04033	N	0.301846	T	0.32496	0.0831	N	0.08118	0	0.34832	D	0.739757	B	0.29432	0.244	B	0.21546	0.035	T	0.26815	-1.0092	10	0.17369	T	0.5	.	8.4347	0.32780	0.0:0.8452:0.0:0.1548	.	437	P78414	IRX1_HUMAN	Q	437	ENSP00000305244:P437Q	ENSP00000305244:P437Q	P	+	2	0	IRX1	3653372	1.000000	0.71417	0.980000	0.43619	0.071000	0.16799	3.096000	0.50243	1.863000	0.54032	0.467000	0.42956	CCA	.	.		0.682	IRX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365546.1	NM_024337	
C5orf22	55322	hgsc.bcm.edu	37	5	31534522	31534522	+	Silent	SNP	T	T	C			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr5:31534522T>C	ENST00000325366.9	+	2	352	c.225T>C	c.(223-225)ttT>ttC	p.F75F	DROSHA_ENST00000511367.2_5'Flank|C5orf22_ENST00000355907.3_5'UTR|DROSHA_ENST00000504361.1_5'Flank|DROSHA_ENST00000513349.1_5'Flank	NM_018356.2	NP_060826.2	Q49AR2	CE022_HUMAN	chromosome 5 open reading frame 22	75										kidney(3)|large_intestine(2)|lung(10)|ovary(2)|skin(1)	18						AAACACTCTTTGGGTAATATG	0.353																																					p.F75F		Atlas-SNP	.											.	C5orf22	48	.	0			c.T225C						.						119.0	112.0	114.0					5																	31534522		2203	4300	6503	SO:0001819	synonymous_variant	55322	exon2			ACTCTTTGGGTAA	AK002055	CCDS3895.1	5p13.3	2012-02-22			ENSG00000082213	ENSG00000082213			25639	protein-coding gene	gene with protein product							Standard	NM_018356		Approved	FLJ11193	uc003jhj.4	Q49AR2	OTTHUMG00000131067	ENST00000325366.9:c.225T>C	chr5.hg19:g.31534522T>C		111.0	0.0		92.0	23.0	NM_018356	Q8ND28|Q8WU61|Q9NUR1	Silent	SNP	ENST00000325366.9	hg19	CCDS3895.1																																																																																			.	.		0.353	C5orf22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253726.2	NM_018356	
BRIX1	55299	hgsc.bcm.edu	37	5	34922851	34922851	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr5:34922851G>A	ENST00000336767.5	+	6	851	c.488G>A	c.(487-489)cGg>cAg	p.R163Q	BRIX1_ENST00000506023.1_3'UTR	NM_018321.3	NP_060791.3	Q8TDN6	BRX1_HUMAN	BRX1, biogenesis of ribosomes, homolog (S. cerevisiae)	163	Brix. {ECO:0000255|PROSITE- ProRule:PRU00034}.				ribosome biogenesis (GO:0042254)	nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|large_intestine(2)|lung(1)	4						AAAGGTTCTCGGCCCCTTTTG	0.348																																					p.R163Q		Atlas-SNP	.											.	BRIX1	21	.	0			c.G488A						.						107.0	113.0	111.0					5																	34922851		2203	4300	6503	SO:0001583	missense	55299	exon6			GTTCTCGGCCCCT		CCDS34143.1	5p13.2	2009-09-25	2009-09-25	2009-09-25	ENSG00000113460	ENSG00000113460			24170	protein-coding gene	gene with protein product			"""brix domain containing 2"""	BXDC2		12477932	Standard	NM_018321		Approved	BRIX, FLJ11100	uc003jja.3	Q8TDN6	OTTHUMG00000162021	ENST00000336767.5:c.488G>A	chr5.hg19:g.34922851G>A	ENSP00000338862:p.Arg163Gln	419.0	0.0		381.0	136.0	NM_018321	A8K0P5|Q3ZTT4|Q8N453|Q96DH1	Missense_Mutation	SNP	ENST00000336767.5	hg19	CCDS34143.1	.	.	.	.	.	.	.	.	.	.	G	36	5.846422	0.97016	.	.	ENSG00000113460	ENST00000336767	T	0.23754	1.89	6.16	6.16	0.99307	Brix domain (3);Anticodon-binding (1);	0.000000	0.85682	D	0.000000	T	0.67107	0.2858	H	0.95043	3.615	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.985	T	0.75175	-0.3410	10	0.72032	D	0.01	-3.4443	20.8598	0.99761	0.0:0.0:1.0:0.0	.	163;163	B4E0B8;Q8TDN6	.;BRX1_HUMAN	Q	163	ENSP00000338862:R163Q	ENSP00000338862:R163Q	R	+	2	0	BRIX1	34958608	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.291000	0.96070	2.937000	0.99478	0.650000	0.86243	CGG	.	.		0.348	BRIX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366826.2	NM_018321	
C5orf42	65250	hgsc.bcm.edu	37	5	37206332	37206332	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr5:37206332T>A	ENST00000508244.1	-	16	3209	c.3116A>T	c.(3115-3117)cAg>cTg	p.Q1039L	C5orf42_ENST00000425232.2_Missense_Mutation_p.Q1039L|C5orf42_ENST00000274258.7_5'UTR			Q9H799	CE042_HUMAN	chromosome 5 open reading frame 42	1039						integral component of membrane (GO:0016021)				breast(5)|endometrium(3)|kidney(8)|large_intestine(24)|lung(28)|ovary(4)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	79	all_lung(31;0.000616)		COAD - Colon adenocarcinoma(61;0.14)|Epithelial(62;0.177)|Colorectal(62;0.202)			ACAGAACAGCTGGAAAGCCAC	0.363																																					p.Q1039L		Atlas-SNP	.											.	C5orf42	422	.	0			c.A3116T						.						117.0	99.0	104.0					5																	37206332		692	1591	2283	SO:0001583	missense	65250	exon17			AACAGCTGGAAAG		CCDS34146.1, CCDS34146.2	5p13.2	2014-01-28			ENSG00000197603	ENSG00000197603			25801	protein-coding gene	gene with protein product		614571				22264561	Standard	NM_023073		Approved	FLJ13231, JBTS17	uc011cpa.1	Q9H799	OTTHUMG00000160492	ENST00000508244.1:c.3116A>T	chr5.hg19:g.37206332T>A	ENSP00000421690:p.Gln1039Leu	343.0	0.0		306.0	30.0	NM_023073	A8MUB7|B7ZLV7|Q4G174|Q6DK46|Q8N8L4|Q9H5T1|Q9H8T9	Missense_Mutation	SNP	ENST00000508244.1	hg19	CCDS34146.2	.	.	.	.	.	.	.	.	.	.	T	12.63	1.996710	0.35226	.	.	ENSG00000197603	ENST00000508244;ENST00000425232;ENST00000514429	T;T;T	0.23754	1.9;1.9;1.89	4.96	3.81	0.43845	.	0.377537	0.20789	U	0.085641	T	0.21427	0.0516	L	0.50919	1.6	0.21822	N	0.999521	P	0.51933	0.949	B	0.43301	0.415	T	0.08889	-1.0700	10	0.16896	T	0.51	-0.6645	7.6902	0.28563	0.0:0.0748:0.1402:0.7851	.	1039	E9PH94	.	L	1039;1039;87	ENSP00000421690:Q1039L;ENSP00000389014:Q1039L;ENSP00000424223:Q87L	ENSP00000389014:Q1039L	Q	-	2	0	C5orf42	37242089	0.795000	0.28851	0.244000	0.24202	0.625000	0.37756	1.122000	0.31295	0.844000	0.35094	0.383000	0.25322	CAG	.	.		0.363	C5orf42-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360806.1	NM_023073	
WDR70	55100	hgsc.bcm.edu	37	5	37721261	37721261	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr5:37721261G>A	ENST00000265107.4	+	14	1617	c.1461G>A	c.(1459-1461)atG>atA	p.M487I		NM_018034.2	NP_060504.1	Q9NW82	WDR70_HUMAN	WD repeat domain 70	487							enzyme binding (GO:0019899)			central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(5)|lung(18)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	37	all_lung(31;0.000285)		COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			ACCAGATCATGGTTGGAACTG	0.428																																					p.M487I		Atlas-SNP	.											.	WDR70	76	.	0			c.G1461A						.						153.0	146.0	149.0					5																	37721261		2203	4300	6503	SO:0001583	missense	55100	exon14			GATCATGGTTGGA	BC009648	CCDS34147.1	5p13.2	2013-01-09			ENSG00000082068	ENSG00000082068		"""WD repeat domain containing"""	25495	protein-coding gene	gene with protein product						12477932	Standard	NM_018034		Approved	FLJ10233	uc003jkv.3	Q9NW82	OTTHUMG00000162263	ENST00000265107.4:c.1461G>A	chr5.hg19:g.37721261G>A	ENSP00000265107:p.Met487Ile	176.0	0.0		153.0	63.0	NM_018034	Q9H053	Missense_Mutation	SNP	ENST00000265107.4	hg19	CCDS34147.1	.	.	.	.	.	.	.	.	.	.	G	18.04	3.533685	0.64972	.	.	ENSG00000082068	ENST00000265107	T	0.01197	5.19	6.17	6.17	0.99709	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.01029	0.0034	N	0.10809	0.05	0.80722	D	1	B	0.14012	0.009	B	0.12837	0.008	T	0.58691	-0.7592	10	0.06236	T	0.91	-11.8932	20.8794	0.99867	0.0:0.0:1.0:0.0	.	487	Q9NW82	WDR70_HUMAN	I	487	ENSP00000265107:M487I	ENSP00000265107:M487I	M	+	3	0	WDR70	37757018	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.444000	0.97578	2.941000	0.99782	0.655000	0.94253	ATG	.	.		0.428	WDR70-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368294.1	NM_018034	
DEPDC1B	55789	hgsc.bcm.edu	37	5	59899225	59899225	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr5:59899225C>A	ENST00000265036.5	-	9	1302	c.1235G>T	c.(1234-1236)aGa>aTa	p.R412I	DEPDC1B_ENST00000453022.2_Missense_Mutation_p.R412I|DEPDC1B_ENST00000545085.1_Missense_Mutation_p.R385I|DEPDC1B_ENST00000509006.1_5'Flank	NM_018369.2	NP_060839.2	Q8WUY9	DEP1B_HUMAN	DEP domain containing 1B	412					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(6)|ovary(1)|pancreas(2)|skin(2)	17		Lung NSC(810;0.000214)|Prostate(74;0.0147)|Breast(144;0.0991)|Ovarian(174;0.17)				TACCTGGACTCTTCGTAGATG	0.418																																					p.R412I		Atlas-SNP	.											.	DEPDC1B	56	.	0			c.G1235T						.						68.0	68.0	68.0					5																	59899225		2203	4300	6503	SO:0001583	missense	55789	exon9			TGGACTCTTCGTA	AF303178	CCDS3977.1, CCDS47214.1	5q12	2008-02-05			ENSG00000035499	ENSG00000035499			24902	protein-coding gene	gene with protein product	"""breast cancer cell 3"""					12477932	Standard	NM_001145208		Approved	XTP1, BRCC3	uc003jsh.3	Q8WUY9	OTTHUMG00000097083	ENST00000265036.5:c.1235G>T	chr5.hg19:g.59899225C>A	ENSP00000265036:p.Arg412Ile	81.0	0.0		69.0	22.0	NM_001145208	A8K3R9|B4DUT4|Q86WJ3|Q8IZY6|Q9NUN3|Q9NW57	Missense_Mutation	SNP	ENST00000265036.5	hg19	CCDS3977.1	.	.	.	.	.	.	.	.	.	.	C	20.2	3.946313	0.73672	.	.	ENSG00000035499	ENST00000265036;ENST00000453022;ENST00000545085	T;T;T	0.31510	1.49;1.49;1.49	5.03	5.03	0.67393	.	0.061085	0.85682	D	0.000000	T	0.42517	0.1206	M	0.63843	1.955	0.80722	D	1	P;P	0.42908	0.673;0.793	P;B	0.47251	0.542;0.439	T	0.19063	-1.0317	9	.	.	.	-21.5609	18.5461	0.91047	0.0:1.0:0.0:0.0	.	412;412	B4DUT4;Q8WUY9	.;DEP1B_HUMAN	I	412;412;385	ENSP00000265036:R412I;ENSP00000389101:R412I;ENSP00000438320:R385I	.	R	-	2	0	DEPDC1B	59934982	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	4.307000	0.59123	2.612000	0.88384	0.591000	0.81541	AGA	.	.		0.418	DEPDC1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214207.1	NM_018369	
CARTPT	9607	hgsc.bcm.edu	37	5	71016426	71016426	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr5:71016426T>C	ENST00000296777.4	+	3	466	c.335T>C	c.(334-336)cTc>cCc	p.L112P	CARTPT_ENST00000513096.1_3'UTR	NM_004291.3	NP_004282.1	Q16568	CART_HUMAN	CART prepropeptide	112					activation of MAPKK activity (GO:0000186)|adult feeding behavior (GO:0008343)|cell-cell signaling (GO:0007267)|cellular glucose homeostasis (GO:0001678)|cellular response to starvation (GO:0009267)|circadian regulation of gene expression (GO:0032922)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of appetite (GO:0032099)|negative regulation of bone resorption (GO:0045779)|negative regulation of glucagon secretion (GO:0070093)|negative regulation of osteoclast differentiation (GO:0045671)|neuropeptide signaling pathway (GO:0007218)|positive regulation of blood pressure (GO:0045777)|positive regulation of epinephrine secretion (GO:0032812)|positive regulation of transmission of nerve impulse (GO:0051971)|regulation of insulin secretion (GO:0050796)|signal transduction (GO:0007165)|somatostatin secretion (GO:0070253)|synaptic transmission (GO:0007268)	extracellular space (GO:0005615)|secretory granule (GO:0030141)				large_intestine(1)|lung(2)|ovary(1)	4		Lung NSC(167;0.00153)|Ovarian(174;0.0175)|Prostate(74;0.11)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;8.4e-56)	Amphetamine(DB00182)	AATTCCTTCCTCCTGAAGTGC	0.552																																					p.L112P		Atlas-SNP	.											.	CARTPT	10	.	0			c.T335C						.						148.0	116.0	127.0					5																	71016426		2203	4300	6503	SO:0001583	missense	9607	exon3			CCTTCCTCCTGAA	U16826	CCDS4011.1	5q13.2	2008-02-05			ENSG00000164326	ENSG00000164326			24323	protein-coding gene	gene with protein product	"""cocaine and amphetamine regulated transcript"""	602606				9590691, 8647455	Standard	NM_004291		Approved	CART	uc003kbv.2	Q16568	OTTHUMG00000131261	ENST00000296777.4:c.335T>C	chr5.hg19:g.71016426T>C	ENSP00000296777:p.Leu112Pro	114.0	0.0		88.0	42.0	NM_004291	Q6FG92	Missense_Mutation	SNP	ENST00000296777.4	hg19	CCDS4011.1	.	.	.	.	.	.	.	.	.	.	T	21.7	4.185078	0.78677	.	.	ENSG00000164326	ENST00000296777	T	0.64085	-0.08	5.61	5.61	0.85477	.	0.152170	0.43579	D	0.000543	T	0.74092	0.3671	L	0.49126	1.545	0.80722	D	1	D	0.76494	0.999	D	0.72338	0.977	T	0.76753	-0.2843	10	0.87932	D	0	.	14.7866	0.69808	0.0:0.0:0.0:1.0	.	112	Q16568	CART_HUMAN	P	112	ENSP00000296777:L112P	ENSP00000296777:L112P	L	+	2	0	CARTPT	71052182	1.000000	0.71417	0.986000	0.45419	0.905000	0.53344	7.338000	0.79269	2.130000	0.65690	0.533000	0.62120	CTC	.	.		0.552	CARTPT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254029.2	NM_004291	
MRPS27	23107	hgsc.bcm.edu	37	5	71519592	71519592	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr5:71519592T>A	ENST00000261413.5	-	10	962	c.923A>T	c.(922-924)cAg>cTg	p.Q308L	MRPS27_ENST00000522562.1_5'Flank|MRPS27_ENST00000457646.4_Missense_Mutation_p.Q252L|MRPS27_ENST00000513900.1_Missense_Mutation_p.Q322L	NM_015084.2	NP_055899.2	Q92552	RT27_HUMAN	mitochondrial ribosomal protein S27	308						mitochondrion (GO:0005739)|ribosome (GO:0005840)				breast(1)|endometrium(1)|large_intestine(2)|lung(2)	6		Lung NSC(167;0.00237)|Ovarian(174;0.0175)|Prostate(461;0.141)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;1.46e-53)		TTCTGACCCCTGGTTGTCTTC	0.502																																					p.Q308L		Atlas-SNP	.											.	MRPS27	23	.	0			c.A923T						.						153.0	145.0	148.0					5																	71519592		2203	4300	6503	SO:0001583	missense	23107	exon10			GACCCCTGGTTGT	D87453	CCDS4013.1, CCDS68890.1, CCDS75257.1	5q13.2	2012-09-13			ENSG00000113048	ENSG00000113048		"""Mitochondrial ribosomal proteins / small subunits"""	14512	protein-coding gene	gene with protein product		611989					Standard	NM_015084		Approved	KIAA0264	uc003kbz.4	Q92552	OTTHUMG00000100951	ENST00000261413.5:c.923A>T	chr5.hg19:g.71519592T>A	ENSP00000261413:p.Gln308Leu	121.0	0.0		97.0	48.0	NM_015084	B4DRT2|Q6P1S1	Missense_Mutation	SNP	ENST00000261413.5	hg19	CCDS4013.1	.	.	.	.	.	.	.	.	.	.	T	3.013	-0.203487	0.06180	.	.	ENSG00000113048	ENST00000261413;ENST00000457646;ENST00000513900;ENST00000508863	T;T;T;T	0.39787	1.06;1.06;1.06;1.06	6.16	2.26	0.28386	.	0.516315	0.22348	N	0.061242	T	0.21962	0.0529	N	0.15975	0.35	0.27422	N	0.954276	B;B;B	0.15141	0.002;0.012;0.001	B;B;B	0.14578	0.002;0.011;0.007	T	0.16482	-1.0401	10	0.24483	T	0.36	-26.4815	7.0325	0.24975	0.2859:0.0:0.1263:0.5879	.	322;89;308	B4DRT2;E7ETN4;Q92552	.;.;RT27_HUMAN	L	308;252;322;252	ENSP00000261413:Q308L;ENSP00000428120:Q252L;ENSP00000426941:Q322L;ENSP00000426176:Q252L	ENSP00000261413:Q308L	Q	-	2	0	MRPS27	71555348	0.001000	0.12720	0.023000	0.16930	0.055000	0.15305	-0.226000	0.09139	0.137000	0.18759	0.528000	0.53228	CAG	.	.		0.502	MRPS27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000218560.2	NM_015084	
TNPO1	3842	hgsc.bcm.edu	37	5	72188978	72188978	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr5:72188978G>T	ENST00000337273.5	+	16	2227	c.1801G>T	c.(1801-1803)Gtt>Ttt	p.V601F	TNPO1_ENST00000523768.1_Missense_Mutation_p.V551F|TNPO1_ENST00000506351.2_Missense_Mutation_p.V593F|TNPO1_ENST00000454282.1_Missense_Mutation_p.V551F	NM_002270.3	NP_002261.3	Q92973	TNPO1_HUMAN	transportin 1	601					gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|protein import into nucleus, translocation (GO:0000060)|RNA metabolic process (GO:0016070)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	nuclear localization sequence binding (GO:0008139)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(4)|large_intestine(10)|lung(6)|ovary(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	36		Lung NSC(167;0.0053)|Ovarian(174;0.0175)		OV - Ovarian serous cystadenocarcinoma(47;6.14e-54)		CCTATCTTCAGTTGCCACAGC	0.433																																					p.V601F		Atlas-SNP	.											.	TNPO1	90	.	0			c.G1801T						.						173.0	160.0	164.0					5																	72188978		2203	4300	6503	SO:0001583	missense	3842	exon16			TCTTCAGTTGCCA	U70322	CCDS4016.1, CCDS43329.1	5q13.1	2009-01-12	2004-01-29	2004-01-30	ENSG00000083312	ENSG00000083312		"""Importins"""	6401	protein-coding gene	gene with protein product	"""importin 2"""	602901	"""karyopherin (importin) beta 2"""	KPNB2		8808633, 9144189	Standard	NM_153188		Approved	MIP, TRN, IPO2, MIP1	uc003kci.4	Q92973	OTTHUMG00000100967	ENST00000337273.5:c.1801G>T	chr5.hg19:g.72188978G>T	ENSP00000336712:p.Val601Phe	80.0	0.0		104.0	45.0	NM_002270	B4DVC6|Q92957|Q92975	Missense_Mutation	SNP	ENST00000337273.5	hg19	CCDS43329.1	.	.	.	.	.	.	.	.	.	.	G	27.8	4.866800	0.91511	.	.	ENSG00000083312	ENST00000337273;ENST00000454282;ENST00000523768;ENST00000506351;ENST00000519220	T;T;T;T	0.67171	-0.25;-0.25;-0.25;-0.25	5.62	5.62	0.85841	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	D	0.86112	0.5855	M	0.92880	3.355	0.80722	D	1	D;D	0.54207	0.965;0.962	D;P	0.64237	0.923;0.841	D	0.88570	0.3129	10	0.87932	D	0	-25.0757	20.0205	0.97499	0.0:0.0:1.0:0.0	.	551;601	Q92973-3;Q92973	.;TNPO1_HUMAN	F	601;551;551;593;112	ENSP00000336712:V601F;ENSP00000398524:V551F;ENSP00000428899:V551F;ENSP00000425118:V593F	ENSP00000336712:V601F	V	+	1	0	TNPO1	72224734	1.000000	0.71417	0.999000	0.59377	0.894000	0.52154	9.439000	0.97543	2.801000	0.96364	0.650000	0.86243	GTT	.	.		0.433	TNPO1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000218577.3	NM_002270	
TNPO1	3842	hgsc.bcm.edu	37	5	72201205	72201205	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr5:72201205A>G	ENST00000337273.5	+	24	3091	c.2665A>G	c.(2665-2667)Aaa>Gaa	p.K889E	TNPO1_ENST00000523768.1_Missense_Mutation_p.K839E|TNPO1_ENST00000506351.2_Missense_Mutation_p.K881E|TNPO1_ENST00000454282.1_Missense_Mutation_p.K839E	NM_002270.3	NP_002261.3	Q92973	TNPO1_HUMAN	transportin 1	889					gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|protein import into nucleus, translocation (GO:0000060)|RNA metabolic process (GO:0016070)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	nuclear localization sequence binding (GO:0008139)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(4)|large_intestine(10)|lung(6)|ovary(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	36		Lung NSC(167;0.0053)|Ovarian(174;0.0175)		OV - Ovarian serous cystadenocarcinoma(47;6.14e-54)		TCTTCCCTTAAAAGAGCGTCT	0.358																																					p.K889E		Atlas-SNP	.											.	TNPO1	90	.	0			c.A2665G						.						103.0	109.0	107.0					5																	72201205		2203	4300	6503	SO:0001583	missense	3842	exon24			CCCTTAAAAGAGC	U70322	CCDS4016.1, CCDS43329.1	5q13.1	2009-01-12	2004-01-29	2004-01-30	ENSG00000083312	ENSG00000083312		"""Importins"""	6401	protein-coding gene	gene with protein product	"""importin 2"""	602901	"""karyopherin (importin) beta 2"""	KPNB2		8808633, 9144189	Standard	NM_153188		Approved	MIP, TRN, IPO2, MIP1	uc003kci.4	Q92973	OTTHUMG00000100967	ENST00000337273.5:c.2665A>G	chr5.hg19:g.72201205A>G	ENSP00000336712:p.Lys889Glu	77.0	0.0		75.0	26.0	NM_002270	B4DVC6|Q92957|Q92975	Missense_Mutation	SNP	ENST00000337273.5	hg19	CCDS43329.1	.	.	.	.	.	.	.	.	.	.	A	18.84	3.709181	0.68615	.	.	ENSG00000083312	ENST00000337273;ENST00000454282;ENST00000523768;ENST00000506351	T;T;T;T	0.32753	1.44;1.44;1.44;1.44	5.52	5.52	0.82312	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.38401	0.1039	M	0.79475	2.455	0.80722	D	1	P;P	0.36048	0.534;0.465	B;B	0.35550	0.205;0.059	T	0.33317	-0.9873	10	0.46703	T	0.11	-18.8819	15.7014	0.77544	1.0:0.0:0.0:0.0	.	839;889	Q92973-3;Q92973	.;TNPO1_HUMAN	E	889;839;839;881	ENSP00000336712:K889E;ENSP00000398524:K839E;ENSP00000428899:K839E;ENSP00000425118:K881E	ENSP00000336712:K889E	K	+	1	0	TNPO1	72236961	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	8.958000	0.93099	2.127000	0.65507	0.524000	0.50904	AAA	.	.		0.358	TNPO1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000218577.3	NM_002270	
BTF3	689	hgsc.bcm.edu	37	5	72798773	72798773	+	Silent	SNP	C	C	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr5:72798773C>A	ENST00000335895.8	+	4	367	c.216C>A	c.(214-216)atC>atA	p.I72I	BTF3_ENST00000380591.3_Silent_p.I116I|BTF3_ENST00000514505.2_3'UTR	NM_001207.4	NP_001198.2	O00478	BT3A3_HUMAN	basic transcription factor 3	0	Ig-like V-type 1.				T cell mediated immunity (GO:0002456)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)				endometrium(1)|large_intestine(2)|lung(2)	5		Lung NSC(167;0.00405)|Ovarian(174;0.0175)		OV - Ovarian serous cystadenocarcinoma(47;2.73e-54)		GAACAGTGATCCACTTTAACA	0.373																																					p.I116I		Atlas-SNP	.											.	BTF3	10	.	0			c.C348A						.						58.0	62.0	61.0					5																	72798773		2203	4300	6503	SO:0001819	synonymous_variant	689	exon4			AGTGATCCACTTT	M90352	CCDS4019.1, CCDS34185.1	5q13.3	2010-06-17			ENSG00000145741	ENSG00000145741			1125	protein-coding gene	gene with protein product		602542	"""nascent-polypeptide-associated complex beta polypeptide"""	NACB		2320128, 1386332, 15716105	Standard	NM_001207		Approved	BTF3a, BTF3b	uc003kcr.1	P20290	OTTHUMG00000102031	ENST00000335895.8:c.216C>A	chr5.hg19:g.72798773C>A		42.0	0.0		36.0	15.0	NM_001037637	B4DWI7|E9PCP5	Silent	SNP	ENST00000335895.8	hg19	CCDS4019.1																																																																																			.	.		0.373	BTF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219815.2	NM_001207	
UTP15	84135	hgsc.bcm.edu	37	5	72868323	72868323	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr5:72868323A>G	ENST00000296792.4	+	7	938	c.683A>G	c.(682-684)tAt>tGt	p.Y228C	UTP15_ENST00000508491.1_Missense_Mutation_p.Y209C|UTP15_ENST00000543251.1_Missense_Mutation_p.Y38C	NM_001284431.1|NM_032175.2	NP_001271360.1|NP_115551.2	Q8TED0	UTP15_HUMAN	UTP15, U3 small nucleolar ribonucleoprotein, homolog (S. cerevisiae)	228			Y -> H (in dbSNP:rs16870608).		rRNA processing (GO:0006364)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)			endometrium(1)|kidney(1)|large_intestine(3)|lung(7)|ovary(1)|skin(2)	15		Lung NSC(167;0.00405)|Ovarian(174;0.0129)		OV - Ovarian serous cystadenocarcinoma(47;7.76e-55)		GGAGGTCGTTATGTTAAAGTC	0.373																																					p.Y228C		Atlas-SNP	.											.	UTP15	30	.	0			c.A683G						.						189.0	194.0	192.0					5																	72868323		2203	4300	6503	SO:0001583	missense	84135	exon7			GTCGTTATGTTAA	AL831972	CCDS34186.1, CCDS68893.1, CCDS68894.1	5q13.2	2013-01-10	2006-04-20		ENSG00000164338	ENSG00000164338		"""WD repeat domain containing"""	25758	protein-coding gene	gene with protein product			"""UTP15, U3 small nucleolar ribonucleoprotein, homolog (yeast)"""			12477932	Standard	NM_032175		Approved	FLJ12787, NET21, FLJ23637	uc003kcw.1	Q8TED0	OTTHUMG00000162453	ENST00000296792.4:c.683A>G	chr5.hg19:g.72868323A>G	ENSP00000296792:p.Tyr228Cys	173.0	0.0		143.0	56.0	NM_032175	B4DU75|B4DXK8|Q6IA60|Q96E08|Q9H9F8	Missense_Mutation	SNP	ENST00000296792.4	hg19	CCDS34186.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	18.01|18.01	3.528096|3.528096	0.64860|0.64860	.|.	.|.	ENSG00000164338|ENSG00000164338	ENST00000509005|ENST00000296792;ENST00000543251;ENST00000508491	.|T;T;T	.|0.59906	.|2.24;0.23;0.23	5.79|5.79	4.6|4.6	0.57074|0.57074	.|WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	.|0.108667	.|0.64402	.|D	.|0.000004	T|T	0.67297|0.67297	0.2878|0.2878	L|L	0.47016|0.47016	1.485|1.485	0.58432|0.58432	D|D	0.999991|0.999991	.|B;D	.|0.76494	.|0.29;0.999	.|B;D	.|0.68943	.|0.261;0.961	T|T	0.66744|0.66744	-0.5846|-0.5846	5|10	.|0.49607	.|T	.|0.09	.|.	12.1613|12.1613	0.54105|0.54105	0.8717:0.0:0.0:0.1283|0.8717:0.0:0.0:0.1283	.|.	.|209;228	.|B4DXK8;Q8TED0	.|.;UTP15_HUMAN	V|C	255|228;38;209	.|ENSP00000296792:Y228C;ENSP00000440796:Y38C;ENSP00000424609:Y209C	.|ENSP00000296792:Y228C	M|Y	+|+	1|2	0|0	UTP15|UTP15	72904079|72904079	1.000000|1.000000	0.71417|0.71417	0.909000|0.909000	0.35828|0.35828	0.993000|0.993000	0.82548|0.82548	8.957000|8.957000	0.93082|0.93082	0.961000|0.961000	0.38030|0.38030	0.533000|0.533000	0.62120|0.62120	ATG|TAT	.	.		0.373	UTP15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368965.1	NM_032175	
ANKRD32	84250	hgsc.bcm.edu	37	5	93989111	93989111	+	Silent	SNP	A	A	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr5:93989111A>T	ENST00000265140.5	+	8	1436	c.1017A>T	c.(1015-1017)atA>atT	p.I339I		NM_032290.3	NP_115666.2	Q9BQI6	ANR32_HUMAN	ankyrin repeat domain 32	339						centrosome (GO:0005813)|nucleus (GO:0005634)				NS(1)|breast(2)|endometrium(2)|large_intestine(1)|lung(3)|ovary(2)|prostate(1)|skin(1)	13		all_cancers(142;1.51e-09)|all_epithelial(76;4.68e-12)|all_lung(232;5.94e-05)|Ovarian(174;0.000953)|Lung NSC(167;0.00105)|Colorectal(57;0.122)|Lung SC(612;0.152)		all cancers(79;3.88e-18)		GAAGGCACATATATAATAGAG	0.308																																					p.I339I		Atlas-SNP	.											.	ANKRD32	117	.	0			c.A1017T						.						123.0	107.0	112.0					5																	93989111		692	1589	2281	SO:0001819	synonymous_variant	84250	exon8			GCACATATATAAT	AL136560	CCDS4071.2	5q15	2013-01-10			ENSG00000133302	ENSG00000133302		"""Ankyrin repeat domain containing"""	25408	protein-coding gene	gene with protein product			"""BRCT domain containing 1"""	BRCTD1			Standard	NM_032290		Approved	DKFZp761C121, DKFZp564C0469	uc003kkr.4	Q9BQI6	OTTHUMG00000121133	ENST00000265140.5:c.1017A>T	chr5.hg19:g.93989111A>T		488.0	0.0		449.0	201.0	NM_032290	B4DMG4|Q3B7K4|Q6NSA5|Q6PHW9|Q9Y402	Silent	SNP	ENST00000265140.5	hg19	CCDS4071.2																																																																																			.	.		0.308	ANKRD32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241610.1	NM_032290	
ADAMTS19	171019	hgsc.bcm.edu	37	5	128863439	128863439	+	Splice_Site	SNP	A	A	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr5:128863439A>T	ENST00000274487.4	+	5	1213		c.e5-1		CTC-575N7.1_ENST00000503616.1_RNA	NM_133638.3	NP_598377.3	Q8TE59	ATS19_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 19							proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(4)|endometrium(10)|kidney(9)|large_intestine(14)|lung(34)|ovary(6)|pancreas(1)|prostate(6)|skin(6)	91		all_cancers(142;0.0148)|Prostate(80;0.0494)|Breast(839;0.238)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	OV - Ovarian serous cystadenocarcinoma(64;0.222)		ATTTGTTTTTAGGTATTTAAC	0.328																																					.		Atlas-SNP	.											.	ADAMTS19	216	.	0			c.1069-2A>T						.						51.0	54.0	53.0					5																	128863439		2202	4299	6501	SO:0001630	splice_region_variant	171019	exon5			GTTTTTAGGTATT	AJ311904	CCDS4146.1	5q23.3	2009-04-27	2005-08-19		ENSG00000145808	ENSG00000145808		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17111	protein-coding gene	gene with protein product		607513	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 19"""			11867212	Standard	NM_133638		Approved		uc003kvb.1	Q8TE59	OTTHUMG00000128990	ENST00000274487.4:c.1069-1A>T	chr5.hg19:g.128863439A>T		315.0	1.0		247.0	104.0	NM_133638		Splice_Site	SNP	ENST00000274487.4	hg19	CCDS4146.1	.	.	.	.	.	.	.	.	.	.	A	15.85	2.954233	0.53293	.	.	ENSG00000145808	ENST00000274487	.	.	.	4.41	4.41	0.53225	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	10.8637	0.46842	0.9217:0.0:0.0783:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ADAMTS19	128891338	1.000000	0.71417	0.998000	0.56505	0.833000	0.47200	4.950000	0.63603	2.209000	0.71365	0.460000	0.39030	.	.	.		0.328	ADAMTS19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250979.2	NM_133638	Intron
FAM13B	51306	hgsc.bcm.edu	37	5	137284750	137284750	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr5:137284750T>C	ENST00000033079.3	-	17	2439	c.1988A>G	c.(1987-1989)aAg>aGg	p.K663R	FAM13B_ENST00000425075.2_Missense_Mutation_p.K567R|FAM13B_ENST00000420893.2_Missense_Mutation_p.K663R	NM_016603.2	NP_057687.2	Q9NYF5	FA13B_HUMAN	family with sequence similarity 13, member B	663					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)			endometrium(4)|kidney(2)|lung(5)	11						CTGAATGACCTTGGGTTCATC	0.393																																					p.K663R		Atlas-SNP	.											.	FAM13B	46	.	0			c.A1988G						.						178.0	169.0	172.0					5																	137284750		2203	4300	6503	SO:0001583	missense	51306	exon17			ATGACCTTGGGTT	AF251038	CCDS4195.1, CCDS47269.1, CCDS47270.1	5q31	2011-09-07	2009-01-20	2009-01-20	ENSG00000031003	ENSG00000031003		"""Rho GTPase activating proteins"""	1335	protein-coding gene	gene with protein product		609371	"""chromosome 5 open reading frame 5"", ""family with sequence similarity 13, member B1"""	C5orf5, FAM13B1		11087669, 11161817	Standard	NM_016603		Approved	N61, KHCHP, ARHGAP49	uc003lbz.2	Q9NYF5	OTTHUMG00000129202	ENST00000033079.3:c.1988A>G	chr5.hg19:g.137284750T>C	ENSP00000033079:p.Lys663Arg	63.0	0.0		77.0	35.0	NM_001101800	D3DQB5|G3V0H9|Q3ZCR0|Q6PGQ2|Q9P0I7	Missense_Mutation	SNP	ENST00000033079.3	hg19	CCDS4195.1	.	.	.	.	.	.	.	.	.	.	T	0.005	-2.122786	0.00346	.	.	ENSG00000031003	ENST00000033079;ENST00000425075;ENST00000420893	T;T;T	0.21932	3.05;1.98;3.09	5.06	3.21	0.36854	.	0.563214	0.18856	N	0.129261	T	0.05410	0.0143	N	0.00621	-1.32	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.0;0.001;0.0	T	0.39522	-0.9610	10	0.11182	T	0.66	-2.5308	8.8104	0.34963	0.0:0.7637:0.0:0.2363	.	567;663;663	G3V0H9;Q9NYF5-2;Q9NYF5	.;.;FA13B_HUMAN	R	663;567;663	ENSP00000033079:K663R;ENSP00000394669:K567R;ENSP00000388521:K663R	ENSP00000033079:K663R	K	-	2	0	FAM13B	137312649	0.007000	0.16637	0.167000	0.22817	0.007000	0.05969	0.283000	0.18846	0.639000	0.30564	-0.182000	0.12963	AAG	.	.		0.393	FAM13B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251279.1		
PCDHAC1	56135	hgsc.bcm.edu	37	5	140308412	140308412	+	Silent	SNP	A	A	G			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr5:140308412A>G	ENST00000253807.2	+	1	1935	c.1935A>G	c.(1933-1935)ccA>ccG	p.P645P	PCDHA1_ENST00000504120.2_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHAC1_ENST00000409700.3_Silent_p.P645P|PCDHA13_ENST00000289272.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA10_ENST00000506939.2_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA9_ENST00000532602.1_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA12_ENST00000398631.2_Intron|PCDHA11_ENST00000398640.2_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA13_ENST00000409494.1_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA10_ENST00000307360.5_Intron	NM_018898.3	NP_061721.2	Q9H158	PCDC1_HUMAN	protocadherin alpha subfamily C, 1	645	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(2)|breast(3)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(13)|liver(2)|lung(13)|ovary(3)|prostate(2)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(4)	65			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GAGACCCACCACTTTCCTCCT	0.532																																					p.P645P		Atlas-SNP	.											.	PCDHAC1	141	.	0			c.A1935G						.						99.0	95.0	97.0					5																	140308412		2203	4300	6503	SO:0001819	synonymous_variant	56135	exon1			CCCACCACTTTCC	AF152473	CCDS4241.1	5q31	2010-11-26			ENSG00000248383	ENSG00000248383		"""Cadherins / Protocadherins : Clustered"""	8676	other	complex locus constituent	"""PCDH-ALPHA-C1"""	606320				10380929	Standard	NM_018898		Approved			Q9H158	OTTHUMG00000129603	ENST00000253807.2:c.1935A>G	chr5.hg19:g.140308412A>G		74.0	0.0		74.0	23.0	NM_031882	Q9Y5F5|Q9Y5I5	Silent	SNP	ENST00000253807.2	hg19	CCDS4241.1																																																																																			.	.		0.532	PCDHAC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251798.1	NM_018898	
PCDHB6	56130	hgsc.bcm.edu	37	5	140531986	140531986	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr5:140531986G>T	ENST00000231136.1	+	1	2148	c.2148G>T	c.(2146-2148)agG>agT	p.R716S	PCDHB6_ENST00000543635.1_Missense_Mutation_p.R580S	NM_018939.2	NP_061762.1	Q9Y5E3	PCDB6_HUMAN	protocadherin beta 6	716					calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			cervix(1)|endometrium(14)|kidney(6)|large_intestine(16)|liver(1)|lung(33)|ovary(1)|pancreas(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	84			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GGAGGAGCAGGGCGGCCTCGG	0.652																																					p.R716S		Atlas-SNP	.											.	PCDHB6	161	.	0			c.G2148T						.						77.0	91.0	86.0					5																	140531986		2202	4300	6502	SO:0001583	missense	56130	exon1			GAGCAGGGCGGCC	AF152499	CCDS4248.1	5q31	2010-01-26			ENSG00000113211	ENSG00000113211		"""Cadherins / Protocadherins : Clustered"""	8691	other	protocadherin		606332				10380929	Standard	NM_018939		Approved	PCDH-BETA6	uc003lir.3	Q9Y5E3	OTTHUMG00000129623	ENST00000231136.1:c.2148G>T	chr5.hg19:g.140531986G>T	ENSP00000231136:p.Arg716Ser	57.0	0.0		45.0	22.0	NM_018939	B2R8R9	Missense_Mutation	SNP	ENST00000231136.1	hg19	CCDS4248.1	.	.	.	.	.	.	.	.	.	.	G	13.65	2.301964	0.40694	.	.	ENSG00000113211	ENST00000543635;ENST00000231136	T;T	0.11495	2.77;2.77	4.45	0.241	0.15494	.	.	.	.	.	T	0.10337	0.0253	L	0.56340	1.77	0.09310	N	1	B	0.15141	0.012	B	0.18871	0.023	T	0.33111	-0.9881	9	0.72032	D	0.01	.	4.1725	0.10336	0.477:0.1746:0.3484:0.0	.	716	Q9Y5E3	PCDB6_HUMAN	S	580;716	ENSP00000438466:R580S;ENSP00000231136:R716S	ENSP00000231136:R716S	R	+	3	2	PCDHB6	140512170	0.054000	0.20591	0.001000	0.08648	0.209000	0.24338	1.689000	0.37700	0.046000	0.15833	0.556000	0.70494	AGG	.	.		0.652	PCDHB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251818.2	NM_018939	
PCDHB10	56126	hgsc.bcm.edu	37	5	140572771	140572771	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr5:140572771G>T	ENST00000239446.4	+	1	830	c.646G>T	c.(646-648)Gat>Tat	p.D216Y		NM_018930.3	NP_061753.1	Q9UN67	PCDBA_HUMAN	protocadherin beta 10	216	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(14)|lung(30)|ovary(4)|prostate(5)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	76			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CACAGCGCTGGATGGTGGGTC	0.542																																					p.D216Y		Atlas-SNP	.											.	PCDHB10	177	.	0			c.G646T						.						89.0	97.0	95.0					5																	140572771		2203	4300	6503	SO:0001583	missense	56126	exon1			GCGCTGGATGGTG	AF152489	CCDS4252.1	5q31.3	2010-06-15			ENSG00000120324	ENSG00000120324		"""Cadherins / Protocadherins : Clustered"""	8681	other	protocadherin		606336				10380929	Standard	NM_018930		Approved		uc003lix.3	Q9UN67	OTTHUMG00000129626	ENST00000239446.4:c.646G>T	chr5.hg19:g.140572771G>T	ENSP00000239446:p.Asp216Tyr	147.0	0.0		133.0	51.0	NM_018930	Q96T99	Missense_Mutation	SNP	ENST00000239446.4	hg19	CCDS4252.1	.	.	.	.	.	.	.	.	.	.	G	17.93	3.509299	0.64522	.	.	ENSG00000120324	ENST00000239446	T	0.68903	-0.36	3.41	3.41	0.39046	Cadherin (4);Cadherin-like (1);	.	.	.	.	D	0.89983	0.6873	H	0.99834	4.825	0.50813	D	0.99989	D	0.89917	1.0	D	0.97110	1.0	D	0.94526	0.7731	9	0.87932	D	0	.	15.0394	0.71777	0.0:0.0:1.0:0.0	.	216	Q9UN67	PCDBA_HUMAN	Y	216	ENSP00000239446:D216Y	ENSP00000239446:D216Y	D	+	1	0	PCDHB10	140552955	1.000000	0.71417	0.999000	0.59377	0.785000	0.44390	9.466000	0.97665	1.930000	0.55929	0.556000	0.70494	GAT	.	.		0.542	PCDHB10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251821.1	NM_018930	
GRXCR2	643226	hgsc.bcm.edu	37	5	145239349	145239349	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr5:145239349A>T	ENST00000377976.1	-	3	693	c.694T>A	c.(694-696)Tgc>Agc	p.C232S		NM_001080516.1	NP_001073985.1	A6NFK2	GRCR2_HUMAN	glutaredoxin, cysteine rich 2	232						cell projection (GO:0042995)				breast(1)|endometrium(1)|large_intestine(2)|lung(1)|urinary_tract(2)	7						CAGGCAGGGCACCTCAGGGCC	0.547																																					p.C232S		Atlas-SNP	.											.	GRXCR2	32	.	0			c.T694A						.						78.0	78.0	78.0					5																	145239349		2203	4300	6503	SO:0001583	missense	643226	exon3			CAGGGCACCTCAG		CCDS34263.1	5q32	2014-03-14			ENSG00000204928	ENSG00000204928			33862	protein-coding gene	gene with protein product		615762				24619944	Standard	NM_001080516		Approved	DFNB101	uc003lns.1	A6NFK2	OTTHUMG00000163417	ENST00000377976.1:c.694T>A	chr5.hg19:g.145239349A>T	ENSP00000367214:p.Cys232Ser	258.0	0.0		213.0	11.0	NM_001080516		Missense_Mutation	SNP	ENST00000377976.1	hg19	CCDS34263.1	.	.	.	.	.	.	.	.	.	.	A	26.9	4.779480	0.90195	.	.	ENSG00000204928	ENST00000377976	T	0.18338	2.22	5.84	5.84	0.93424	.	0.088546	0.85682	D	0.000000	T	0.52008	0.1708	M	0.91354	3.2	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.63301	-0.6668	10	0.87932	D	0	-44.7267	16.2045	0.82114	1.0:0.0:0.0:0.0	.	232	A6NFK2	GRCR2_HUMAN	S	232	ENSP00000367214:C232S	ENSP00000367214:C232S	C	-	1	0	GRXCR2	145219542	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.764000	0.91719	2.234000	0.73211	0.459000	0.35465	TGC	.	.		0.547	GRXCR2-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373289.2		
FAT2	2196	hgsc.bcm.edu	37	5	150930189	150930189	+	Missense_Mutation	SNP	G	G	A	rs556459301		TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr5:150930189G>A	ENST00000261800.5	-	7	4552	c.4540C>T	c.(4540-4542)Ctc>Ttc	p.L1514F		NM_001447.2	NP_001438.1	Q9NYQ8	FAT2_HUMAN	FAT atypical cadherin 2	1514	Cadherin 13. {ECO:0000255|PROSITE- ProRule:PRU00043}.				epithelial cell migration (GO:0010631)|homophilic cell adhesion (GO:0007156)	cell-cell adherens junction (GO:0005913)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.L1514F(1)		NS(6)|breast(3)|central_nervous_system(3)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(61)|liver(1)|lung(60)|ovary(6)|prostate(5)|skin(5)|stomach(2)|upper_aerodigestive_tract(11)|urinary_tract(1)	196		Medulloblastoma(196;0.0912)|all_hematologic(541;0.104)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			CCCGAGCCGAGGTCCAATTTT	0.532													G|||	1	0.000199681	0.0	0.0	5008	,	,		21382	0.0		0.0	False		,,,				2504	0.001				p.L1514F		Atlas-SNP	.											FAT2,colon,carcinoma,0,1	FAT2	465	.	1	Substitution - Missense(1)	large_intestine(1)	c.C4540T						.						94.0	87.0	89.0					5																	150930189		2203	4300	6503	SO:0001583	missense	2196	exon7			AGCCGAGGTCCAA	AF231022	CCDS4317.1	5q33.1	2014-07-21	2013-05-31		ENSG00000086570	ENSG00000086570		"""Cadherins / Cadherin-related"""	3596	protein-coding gene	gene with protein product	"""cadherin-related family member 9"""	604269	"""FAT tumor suppressor (Drosophila) homolog 2"", ""FAT tumor suppressor homolog 2 (Drosophila)"""			9693030	Standard	NM_001447		Approved	MEGF1, CDHF8, HFAT2, CDHR9	uc003lue.4	Q9NYQ8	OTTHUMG00000130126	ENST00000261800.5:c.4540C>T	chr5.hg19:g.150930189G>A	ENSP00000261800:p.Leu1514Phe	79.0	0.0		68.0	29.0	NM_001447	O75091|Q9NSR7	Missense_Mutation	SNP	ENST00000261800.5	hg19	CCDS4317.1	.	.	.	.	.	.	.	.	.	.	G	0.597	-0.830506	0.02734	.	.	ENSG00000086570	ENST00000261800	T	0.51071	0.72	5.23	3.26	0.37387	Cadherin (4);Cadherin-like (1);	0.362916	0.20546	N	0.090206	T	0.29914	0.0748	L	0.29908	0.895	0.29506	N	0.854592	B	0.22080	0.064	B	0.22880	0.042	T	0.11155	-1.0599	10	0.13470	T	0.59	.	7.5438	0.27755	0.1373:0.0:0.6924:0.1703	.	1514	Q9NYQ8	FAT2_HUMAN	F	1514	ENSP00000261800:L1514F	ENSP00000261800:L1514F	L	-	1	0	FAT2	150910382	1.000000	0.71417	0.980000	0.43619	0.021000	0.10359	3.138000	0.50570	2.425000	0.82216	0.650000	0.86243	CTC	.	.		0.532	FAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252434.1	NM_001447	
GEMIN5	25929	hgsc.bcm.edu	37	5	154311783	154311783	+	Silent	SNP	A	A	G			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr5:154311783A>G	ENST00000285873.7	-	4	612	c.537T>C	c.(535-537)atT>atC	p.I179I		NM_001252156.1|NM_015465.4	NP_001239085.1|NP_056280.2	Q8TEQ6	GEMI5_HUMAN	gem (nuclear organelle) associated protein 5	179					gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|ncRNA metabolic process (GO:0034660)|protein complex assembly (GO:0006461)|RNA metabolic process (GO:0016070)|spliceosomal snRNP assembly (GO:0000387)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMN complex (GO:0032797)|SMN-Sm protein complex (GO:0034719)	poly(A) RNA binding (GO:0044822)|snRNA binding (GO:0017069)			breast(1)|central_nervous_system(2)|endometrium(5)|kidney(3)|large_intestine(10)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	38	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.147)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)			TACTGATGTCAATTATCACCA	0.378																																					p.I179I		Atlas-SNP	.											.	GEMIN5	120	.	0			c.T537C						.						135.0	136.0	136.0					5																	154311783		2203	4300	6503	SO:0001819	synonymous_variant	25929	exon4			GATGTCAATTATC	AK022748	CCDS4330.1	5q34	2013-01-10			ENSG00000082516	ENSG00000082516		"""WD repeat domain containing"""	20043	protein-coding gene	gene with protein product		607005				11714716	Standard	NM_015465		Approved		uc003lvx.3	Q8TEQ6	OTTHUMG00000130189	ENST00000285873.7:c.537T>C	chr5.hg19:g.154311783A>G		155.0	0.0		158.0	70.0	NM_015465	Q14CV0|Q8WWV4|Q969W4|Q9H9K3|Q9UFI5	Silent	SNP	ENST00000285873.7	hg19	CCDS4330.1																																																																																			.	.		0.378	GEMIN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252507.1		
FAM71B	153745	hgsc.bcm.edu	37	5	156590341	156590341	+	Missense_Mutation	SNP	G	G	T	rs200982218		TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr5:156590341G>T	ENST00000302938.4	-	2	1030	c.935C>A	c.(934-936)gCg>gAg	p.A312E		NM_130899.2	NP_570969.2	Q8TC56	FA71B_HUMAN	family with sequence similarity 71, member B	312	Ala-rich.					nucleus (GO:0005634)		p.A312G(1)		NS(3)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(2)|kidney(5)|large_intestine(10)|lung(32)|ovary(4)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	68	Renal(175;0.00212)	Medulloblastoma(196;0.0523)|all_neural(177;0.21)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			TCCCGCCAGCGCTGTGGTCAC	0.517																																					p.A312E		Atlas-SNP	.											FAM71B,NS,carcinoma,0,1	FAM71B	145	.	1	Substitution - Missense(1)	lung(1)	c.C935A						.						114.0	111.0	112.0					5																	156590341		2203	4300	6503	SO:0001583	missense	153745	exon2			GCCAGCGCTGTGG		CCDS4335.1	5q33.3	2005-08-09			ENSG00000170613	ENSG00000170613			28397	protein-coding gene	gene with protein product						12477932	Standard	NM_130899		Approved	MGC26988	uc003lwn.3	Q8TC56	OTTHUMG00000130246	ENST00000302938.4:c.935C>A	chr5.hg19:g.156590341G>T	ENSP00000305596:p.Ala312Glu	52.0	0.0		53.0	29.0	NM_130899	Q1EDD9|Q8TC64|Q96LY8	Missense_Mutation	SNP	ENST00000302938.4	hg19	CCDS4335.1	.	.	.	.	.	.	.	.	.	.	G	14.78	2.636256	0.47049	.	.	ENSG00000170613	ENST00000302938	T	0.05319	3.46	3.85	2.96	0.34315	.	0.724337	0.11932	N	0.515623	T	0.15478	0.0373	L	0.57536	1.79	0.09310	N	1	D	0.71674	0.998	P	0.57152	0.814	T	0.07654	-1.0761	10	0.72032	D	0.01	-4.6405	9.7121	0.40251	0.0:0.2098:0.7902:0.0	.	312	Q8TC56	FA71B_HUMAN	E	312	ENSP00000305596:A312E	ENSP00000305596:A312E	A	-	2	0	FAM71B	156522919	0.020000	0.18652	0.002000	0.10522	0.003000	0.03518	2.432000	0.44784	1.154000	0.42482	0.655000	0.94253	GCG	.	G|1.000;A|0.000		0.517	FAM71B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252570.2	NM_130899	
ADRA1B	147	hgsc.bcm.edu	37	5	159344340	159344340	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr5:159344340G>A	ENST00000306675.3	+	1	551	c.428G>A	c.(427-429)cGc>cAc	p.R143H		NM_000679.3	NP_000670.1	P35368	ADA1B_HUMAN	adrenoceptor alpha 1B	143					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|adrenergic receptor signaling pathway (GO:0071875)|adult heart development (GO:0007512)|behavioral response to cocaine (GO:0048148)|blood vessel remodeling (GO:0001974)|cell growth (GO:0016049)|cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|G-protein coupled receptor signaling pathway (GO:0007186)|glucose homeostasis (GO:0042593)|intracellular signal transduction (GO:0035556)|locomotory behavior (GO:0007626)|multicellular organismal development (GO:0007275)|negative regulation of glycogen catabolic process (GO:0045818)|organ growth (GO:0035265)|positive regulation of glycogen catabolic process (GO:0045819)|positive regulation of heart rate by epinephrine-norepinephrine (GO:0001996)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of the force of heart contraction by epinephrine-norepinephrine (GO:0001997)|regulation of cardiac muscle contraction (GO:0055117)|regulation of vasoconstriction (GO:0019229)|response to amphetamine (GO:0001975)|response to morphine (GO:0043278)|vasoconstriction of artery involved in baroreceptor response to lowering of systemic arterial blood pressure (GO:0001987)|visual learning (GO:0008542)	integral component of plasma membrane (GO:0005887)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	alpha1-adrenergic receptor activity (GO:0004937)|protein heterodimerization activity (GO:0046982)			endometrium(3)|large_intestine(6)|lung(7)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19	Renal(175;0.00196)	Medulloblastoma(196;0.0354)|all_neural(177;0.138)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)		Acepromazine(DB01614)|Alfuzosin(DB00346)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Amphetamine(DB00182)|Aripiprazole(DB01238)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Carvedilol(DB01136)|Chlorpromazine(DB00477)|Clonidine(DB00575)|Clozapine(DB00363)|Dapiprazole(DB00298)|Desipramine(DB01151)|Dextroamphetamine(DB01576)|Doxazosin(DB00590)|Doxepin(DB01142)|Dronedarone(DB04855)|Droxidopa(DB06262)|Epinephrine(DB00668)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Fenoldopam(DB00800)|Imipramine(DB00458)|Labetalol(DB00598)|Lisdexamfetamine(DB01255)|Loxapine(DB00408)|Maprotiline(DB00934)|Mephentermine(DB01365)|Methotrimeprazine(DB01403)|Methoxamine(DB00723)|Mianserin(DB06148)|Midodrine(DB00211)|Mirtazapine(DB00370)|Modafinil(DB00745)|Nefazodone(DB01149)|Nicardipine(DB00622)|Norepinephrine(DB00368)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Oxymetazoline(DB00935)|Paliperidone(DB01267)|Pergolide(DB01186)|Phendimetrazine(DB01579)|Phenoxybenzamine(DB00925)|Phenylephrine(DB00388)|Prazosin(DB00457)|Promazine(DB00420)|Propericiazine(DB01608)|Propiomazine(DB00777)|Quetiapine(DB01224)|Risperidone(DB00734)|Sertindole(DB06144)|Silodosin(DB06207)|Tamsulosin(DB00706)|Terazosin(DB01162)|Thioproperazine(DB01622)|Thioridazine(DB00679)|Trimipramine(DB00726)|Xylometazoline(DB06694)|Ziprasidone(DB00246)	TCCATCGATCGCTACATCGGG	0.607																																					p.R143H		Atlas-SNP	.											.	ADRA1B	39	.	0			c.G428A						.						107.0	90.0	96.0					5																	159344340		2203	4300	6503	SO:0001583	missense	147	exon1			TCGATCGCTACAT	L31773	CCDS4347.1	5q33.3	2012-08-08	2012-05-09		ENSG00000170214	ENSG00000170214		"""GPCR / Class A : Adrenoceptors : alpha"""	278	protein-coding gene	gene with protein product		104220	"""adrenergic, alpha-1B-, receptor"""				Standard	XM_005265818		Approved		uc003lxt.1	P35368	OTTHUMG00000130327	ENST00000306675.3:c.428G>A	chr5.hg19:g.159344340G>A	ENSP00000306662:p.Arg143His	60.0	0.0		56.0	25.0	NM_000679	B0LPE1	Missense_Mutation	SNP	ENST00000306675.3	hg19	CCDS4347.1	.	.	.	.	.	.	.	.	.	.	G	22.5	4.295953	0.81025	.	.	ENSG00000170214	ENST00000306675	D	0.97161	-4.27	5.25	5.25	0.73442	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	D	0.99272	0.9746	H	0.99545	4.62	0.58432	D	0.999997	D	0.89917	1.0	D	0.97110	1.0	D	0.98479	1.0604	10	0.87932	D	0	.	17.7769	0.88511	0.0:0.0:1.0:0.0	rs61759420	143	P35368	ADA1B_HUMAN	H	143	ENSP00000306662:R143H	ENSP00000306662:R143H	R	+	2	0	ADRA1B	159276918	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.813000	0.99286	2.629000	0.89072	0.462000	0.41574	CGC	.	.		0.607	ADRA1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252676.1		
STK10	6793	hgsc.bcm.edu	37	5	171509351	171509351	+	Silent	SNP	C	C	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr5:171509351C>T	ENST00000176763.5	-	12	2311	c.1968G>A	c.(1966-1968)caG>caA	p.Q656Q	AC113342.1_ENST00000579783.1_RNA	NM_005990.3	NP_005981.3	O94804	STK10_HUMAN	serine/threonine kinase 10	656					cell cycle (GO:0007049)|lymphocyte aggregation (GO:0071593)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of lymphocyte migration (GO:2000401)|signal transduction by phosphorylation (GO:0023014)	extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|polo kinase kinase activity (GO:0042801)|protein homodimerization activity (GO:0042803)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(15)|ovary(6)|pancreas(1)|prostate(1)|testis(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	47	Renal(175;0.000159)|Lung NSC(126;0.0056)|all_lung(126;0.0094)	Medulloblastoma(196;0.00868)|all_neural(177;0.026)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			TCAGTTTGAGCTGCTCTTGGA	0.587																																					p.Q656Q		Atlas-SNP	.											.	STK10	100	.	0			c.G1968A						.						129.0	122.0	124.0					5																	171509351		2203	4300	6503	SO:0001819	synonymous_variant	6793	exon12			TTTGAGCTGCTCT	AB015718	CCDS34290.1	5q35.1	2008-07-18			ENSG00000072786	ENSG00000072786			11388	protein-coding gene	gene with protein product		603919				10199912	Standard	NM_005990		Approved	LOK, PRO2729	uc003mbo.1	O94804	OTTHUMG00000163265	ENST00000176763.5:c.1968G>A	chr5.hg19:g.171509351C>T		100.0	0.0		67.0	27.0	NM_005990	A6ND35|B2R8F5|B3KMY1|Q6NSK0|Q9UIW4	Silent	SNP	ENST00000176763.5	hg19	CCDS34290.1																																																																																			.	.		0.587	STK10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372374.2	NM_005990	
HRH2	3274	hgsc.bcm.edu	37	5	175112498	175112498	+	IGR	SNP	A	A	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr5:175112498A>T	ENST00000231683.2	+	0	3095				HRH2_ENST00000377291.2_Missense_Mutation_p.H388L	NM_022304.2	NP_071640.1	P25021	HRH2_HUMAN	histamine receptor H2						digestive tract development (GO:0048565)|epithelial cell morphogenesis (GO:0003382)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|gastrin-induced gastric acid secretion (GO:0001698)|gland development (GO:0048732)|histamine-induced gastric acid secretion (GO:0001697)|immune response (GO:0006955)|memory (GO:0007613)|positive regulation of vasoconstriction (GO:0045907)|regulation of synaptic plasticity (GO:0048167)|visual learning (GO:0008542)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	histamine receptor activity (GO:0004969)			breast(1)|cervix(1)|endometrium(3)|large_intestine(6)|lung(10)|ovary(1)	22	all_cancers(89;0.00805)|Renal(175;0.000269)|Lung NSC(126;0.00419)|all_lung(126;0.00711)	Medulloblastoma(196;0.0208)|all_neural(177;0.0277)|all_hematologic(541;0.214)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)	Colorectal(1;0.0154)|COAD - Colon adenocarcinoma(1;0.149)	Amitriptyline(DB00321)|Asenapine(DB06216)|Betazole(DB00272)|Cimetidine(DB00501)|Doxepin(DB01142)|Epinastine(DB00751)|Famotidine(DB00927)|Histamine Phosphate(DB00667)|Loxapine(DB00408)|Methantheline(DB00940)|Nizatidine(DB00585)|Olanzapine(DB00334)|Ranitidine(DB00863)|Roxatidine acetate(DB08806)|Tolazoline(DB00797)	Gcaaacattcatccaattccc	0.398																																					p.H388L		Atlas-SNP	.											.	HRH2	108	.	0			c.A1163T						.						102.0	86.0	91.0					5																	175112498		692	1591	2283	SO:0001628	intergenic_variant	3274	exon3			ACATTCATCCAAT		CCDS4395.1, CCDS47344.1	5q35	2012-08-08			ENSG00000113749	ENSG00000113749		"""GPCR / Class A : Histamine receptors"""	5183	protein-coding gene	gene with protein product		142703				1714721	Standard	NM_022304		Approved		uc003mdc.4	P25021	OTTHUMG00000130660		chr5.hg19:g.175112498A>T		284.0	1.0		207.0	87.0	NM_001131055	B5BUP7|Q14464|Q7Z5R9	Missense_Mutation	SNP	ENST00000231683.2	hg19	CCDS4395.1	.	.	.	.	.	.	.	.	.	.	A	9.111	1.006671	0.19199	.	.	ENSG00000113749	ENST00000377291	T	0.62639	0.01	2.87	-4.6	0.03390	.	3.128170	0.01552	N	0.019706	T	0.48978	0.1530	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.42258	-0.9462	9	0.87932	D	0	.	6.1699	0.20410	0.273:0.201:0.526:0.0	.	388	Q7Z5R9	.	L	388	ENSP00000366506:H388L	ENSP00000366506:H388L	H	+	2	0	HRH2	175045104	0.000000	0.05858	0.000000	0.03702	0.149000	0.21700	-1.347000	0.02632	-1.074000	0.03132	-0.589000	0.04120	CAT	.	.		0.398	HRH2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253151.1		
ADAMTS2	9509	hgsc.bcm.edu	37	5	178548746	178548746	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr5:178548746T>A	ENST00000251582.7	-	21	3195	c.3094A>T	c.(3094-3096)Atc>Ttc	p.I1032F		NM_014244.4	NP_055059.2	O95450	ATS2_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 2	1032					collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|lung development (GO:0030324)|protein processing (GO:0016485)|skin development (GO:0043588)|spermatogenesis (GO:0007283)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(31)|ovary(1)|pancreas(3)|prostate(2)|skin(7)	72	all_cancers(89;0.000456)|all_epithelial(37;0.000138)|Renal(175;0.000159)|Lung NSC(126;0.00184)|all_lung(126;0.00326)	all_cancers(40;0.00604)|all_neural(177;0.00411)|Medulloblastoma(196;0.00508)|Lung NSC(249;0.0569)|all_lung(500;0.129)|all_hematologic(541;0.211)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	GBM - Glioblastoma multiforme(465;0.0473)		GGATCTGAGATGTTTCCTAGA	0.652																																					p.I1032F		Atlas-SNP	.											.	ADAMTS2	190	.	0			c.A3094T						.						137.0	144.0	141.0					5																	178548746		2203	4300	6503	SO:0001583	missense	9509	exon21			CTGAGATGTTTCC	AJ003125	CCDS4444.1, CCDS34311.1	5q23-q24	2008-07-18	2005-08-19		ENSG00000087116	ENSG00000087116		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	218	protein-coding gene	gene with protein product	"""procollagen I N-proteinase"", ""procollagen N-endopeptidase"""	604539	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 2"""			10094461, 15373769	Standard	NM_014244		Approved	ADAMTS-3, hPCPNI, PCINP, ADAM-TS2, NPI	uc003mjw.3	O95450	OTTHUMG00000130915	ENST00000251582.7:c.3094A>T	chr5.hg19:g.178548746T>A	ENSP00000251582:p.Ile1032Phe	84.0	0.0		67.0	23.0	NM_014244		Missense_Mutation	SNP	ENST00000251582.7	hg19	CCDS4444.1	.	.	.	.	.	.	.	.	.	.	T	7.766	0.706390	0.15239	.	.	ENSG00000087116	ENST00000251582	T	0.60040	0.22	5.74	-9.42	0.00610	.	1.619860	0.03460	N	0.212036	T	0.37999	0.1024	L	0.36672	1.1	0.31007	N	0.719683	B	0.23735	0.09	B	0.22601	0.04	T	0.06197	-1.0840	10	0.11794	T	0.64	.	6.8422	0.23969	0.1009:0.492:0.1038:0.3034	.	1032	O95450	ATS2_HUMAN	F	1032	ENSP00000251582:I1032F	ENSP00000251582:I1032F	I	-	1	0	ADAMTS2	178481352	0.000000	0.05858	0.001000	0.08648	0.298000	0.27526	-1.217000	0.02979	-1.798000	0.01250	-0.377000	0.06932	ATC	.	.		0.652	ADAMTS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253507.1	NM_014244	
TUBB2B	347733	hgsc.bcm.edu	37	6	3227741	3227741	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr6:3227741C>A	ENST00000259818.7	-	1	228	c.37G>T	c.(37-39)Ggc>Tgc	p.G13C	TUBB2B_ENST00000473006.1_Intron	NM_178012.4	NP_821080.1	Q9BVA1	TBB2B_HUMAN	tubulin, beta 2B class IIb	13					'de novo' posttranslational protein folding (GO:0051084)|cellular protein metabolic process (GO:0044267)|microtubule-based process (GO:0007017)|neuron migration (GO:0001764)|protein folding (GO:0006457)|protein polymerization (GO:0051258)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)			kidney(2)|large_intestine(5)|lung(1)|prostate(1)|skin(1)	10	Ovarian(93;0.0386)	all_hematologic(90;0.108)				ATCTGGTTGCCGCACTGGCCC	0.726																																					p.G13C		Atlas-SNP	.											.	TUBB2B	25	.	0			c.G37T						.						40.0	41.0	41.0					6																	3227741		2200	4299	6499	SO:0001583	missense	347733	exon1			GGTTGCCGCACTG	BC001352	CCDS4485.1	6p25.2	2011-10-10	2011-10-10		ENSG00000137285	ENSG00000137285		"""Tubulins"""	30829	protein-coding gene	gene with protein product	"""class IIb beta-tubulin"""	612850	"""tubulin, beta 2B"""			8619474, 9110174	Standard	NM_178012		Approved	MGC8685, DKFZp566F223, bA506K6.1	uc003mvg.3	Q9BVA1	OTTHUMG00000014143	ENST00000259818.7:c.37G>T	chr6.hg19:g.3227741C>A	ENSP00000259818:p.Gly13Cys	21.0	0.0		37.0	11.0	NM_178012	A8K068	Missense_Mutation	SNP	ENST00000259818.7	hg19	CCDS4485.1	.	.	.	.	.	.	.	.	.	.	C	23.1	4.379008	0.82682	.	.	ENSG00000137285	ENST00000259818	D	0.90133	-2.62	4.34	4.34	0.51931	Tubulin/FtsZ, GTPase domain (3);	0.000000	0.64402	D	0.000015	D	0.98108	0.9376	H	0.99977	5.165	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	D	0.99640	1.0988	10	0.87932	D	0	.	17.4008	0.87459	0.0:1.0:0.0:0.0	.	13;13	Q8IZ29;Q9BVA1	.;TBB2B_HUMAN	C	13	ENSP00000259818:G13C	ENSP00000259818:G13C	G	-	1	0	TUBB2B	3172740	1.000000	0.71417	1.000000	0.80357	0.892000	0.51952	7.388000	0.79795	2.403000	0.81681	0.561000	0.74099	GGC	.	.		0.726	TUBB2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039680.2	NM_178012	
PRPF4B	8899	hgsc.bcm.edu	37	6	4057278	4057278	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr6:4057278A>G	ENST00000337659.6	+	13	2690	c.2590A>G	c.(2590-2592)Aaa>Gaa	p.K864E	PRPF4B_ENST00000538861.1_Missense_Mutation_p.K850E	NM_003913.4	NP_003904.3	Q13523	PRP4B_HUMAN	pre-mRNA processing factor 4B	864	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				mRNA splicing, via spliceosome (GO:0000398)|protein phosphorylation (GO:0006468)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|chromosome (GO:0005694)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(6)|endometrium(3)|large_intestine(5)|lung(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	22	Ovarian(93;0.0925)	all_hematologic(90;0.0895)				AGTTATAGGTAAAAGCTATGA	0.328																																					p.K864E		Atlas-SNP	.											.	PRPF4B	140	.	0			c.A2590G						.						88.0	90.0	90.0					6																	4057278		2203	4300	6503	SO:0001583	missense	8899	exon13			ATAGGTAAAAGCT	U48736	CCDS4488.1	6p24.2	2013-10-03	2013-10-03		ENSG00000112739	ENSG00000112739			17346	protein-coding gene	gene with protein product		602338	"""PRP4 pre-mRNA processing factor 4 homolog B (yeast)"""			9628581, 11418604	Standard	XR_241936		Approved	Prp4, PR4H, KIAA0536	uc003mvv.3	Q13523	OTTHUMG00000014157	ENST00000337659.6:c.2590A>G	chr6.hg19:g.4057278A>G	ENSP00000337194:p.Lys864Glu	64.0	0.0		122.0	25.0	NM_003913	A8K5C9|Q5D0F6|Q5TAY8|Q8IVC3|Q8TDP2|Q96QT7|Q9UEE6	Missense_Mutation	SNP	ENST00000337659.6	hg19	CCDS4488.1	.	.	.	.	.	.	.	.	.	.	A	16.81	3.224850	0.58668	.	.	ENSG00000112739	ENST00000337659;ENST00000538861	T;T	0.65364	-0.15;-0.15	6.17	6.17	0.99709	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.56277	0.1974	N	0.12611	0.24	0.80722	D	1	D	0.69078	0.997	D	0.79108	0.992	T	0.64045	-0.6499	10	0.40728	T	0.16	.	16.8222	0.85835	1.0:0.0:0.0:0.0	.	864	Q13523	PRP4B_HUMAN	E	864;850	ENSP00000337194:K864E;ENSP00000439331:K850E	ENSP00000337194:K864E	K	+	1	0	PRPF4B	4002277	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.823000	0.92018	2.371000	0.80710	0.533000	0.62120	AAA	.	.		0.328	PRPF4B-011	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000314018.2		
EEF1E1	9521	hgsc.bcm.edu	37	6	8097609	8097609	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr6:8097609A>G	ENST00000379715.5	-	2	235	c.179T>C	c.(178-180)tTg>tCg	p.L60S	EEF1E1_ENST00000429723.2_Missense_Mutation_p.L60S|EEF1E1-BLOC1S5_ENST00000397456.2_Missense_Mutation_p.L60S|EEF1E1_ENST00000507463.1_Missense_Mutation_p.L60S	NM_004280.4	NP_004271.1	O43324	MCA3_HUMAN	eukaryotic translation elongation factor 1 epsilon 1	60	GST C-terminal.|Linker.				gene expression (GO:0010467)|negative regulation of cell proliferation (GO:0008285)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)				endometrium(1)|prostate(1)	2	Ovarian(93;0.0398)					ACTCCCCAGCAAATATTCTTT	0.413																																					p.L60S		Atlas-SNP	.											.	EEF1E1	11	.	0			c.T179C						.						162.0	149.0	154.0					6																	8097609		2203	4300	6503	SO:0001583	missense	9521	exon2			CCCAGCAAATATT	AF054186	CCDS4507.1, CCDS47370.1	6p24.3	2009-05-20			ENSG00000124802	ENSG00000124802			3212	protein-coding gene	gene with protein product	"""aminoacyl tRNA synthetase complex-interacting multifunctional protein 3"""	609206		P18		9653160	Standard	NM_004280		Approved	AIMP3	uc003mxz.3	O43324	OTTHUMG00000014221	ENST00000379715.5:c.179T>C	chr6.hg19:g.8097609A>G	ENSP00000369038:p.Leu60Ser	150.0	0.0		227.0	60.0	NM_001135650	C9JLK5|Q5THS2	Missense_Mutation	SNP	ENST00000379715.5	hg19	CCDS4507.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	25.3|25.3	4.620200|4.620200	0.87460|0.87460	.|.	.|.	ENSG00000124802|ENSG00000124802	ENST00000502429|ENST00000429723;ENST00000379715;ENST00000507463;ENST00000488226	.|T;T;T	.|0.20598	.|3.29;3.29;2.06	5.62|5.62	5.62|5.62	0.85841|0.85841	.|Glutathione S-transferase, C-terminal-like (1);Glutathione S-transferase/chloride channel, C-terminal (1);Thioredoxin-like fold (1);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.44808|0.44808	0.1311|0.1311	M|M	0.87827|0.87827	2.91|2.91	0.80722|0.80722	D|D	1|1	.|D;D	.|0.89917	.|1.0;1.0	.|D;D	.|0.97110	.|1.0;0.999	T|T	0.53099|0.53099	-0.8486|-0.8486	5|9	.|.	.|.	.|.	-7.0642|-7.0642	15.827|15.827	0.78718|0.78718	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|60;60	.|C9JLK5;O43324	.|.;MCA3_HUMAN	R|S	47|60;60;60;72	.|ENSP00000414363:L60S;ENSP00000369038:L60S;ENSP00000425577:L72S	.|.	C|L	-|-	1|2	0|0	EEF1E1|EEF1E1	8042608|8042608	1.000000|1.000000	0.71417|0.71417	0.992000|0.992000	0.48379|0.48379	0.972000|0.972000	0.66771|0.66771	7.928000|7.928000	0.87587|0.87587	2.129000|2.129000	0.65627|0.65627	0.533000|0.533000	0.62120|0.62120	TGC|TTG	.	.		0.413	EEF1E1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039799.2	NM_004280	
SIRT5	23408	hgsc.bcm.edu	37	6	13588600	13588600	+	Silent	SNP	G	G	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr6:13588600G>A	ENST00000606117.1	+	4	449	c.153G>A	c.(151-153)aaG>aaA	p.K51K	SIRT5_ENST00000359782.3_Silent_p.K51K|SIRT5_ENST00000379262.4_Silent_p.K51K|SIRT5_ENST00000397350.2_Intron	NM_012241.4	NP_036373.1			sirtuin 5											breast(1)|endometrium(1)|large_intestine(3)|lung(1)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)	11	Breast(50;0.00669)|Ovarian(93;0.0634)	all_hematologic(90;0.117)	Epithelial(50;0.176)			CAAAAGCAAAGCACATAGTCA	0.413																																					p.K51K		Atlas-SNP	.											.	SIRT5	45	.	0			c.G153A						.						114.0	106.0	109.0					6																	13588600		2203	4300	6503	SO:0001819	synonymous_variant	23408	exon4			AGCAAAGCACATA	AF083110	CCDS4526.1, CCDS4527.1, CCDS54966.1, CCDS56398.1	6p23	2010-08-05	2010-06-25		ENSG00000124523	ENSG00000124523			14933	protein-coding gene	gene with protein product		604483	"""sirtuin (silent mating type information regulation 2, S.cerevisiae, homolog) 5"", ""sirtuin (silent mating type information regulation 2 homolog) 5 (S. cerevisiae)"""			10381378	Standard	NM_012241		Approved		uc003nay.3	Q9NXA8	OTTHUMG00000014278	ENST00000606117.1:c.153G>A	chr6.hg19:g.13588600G>A		173.0	0.0		367.0	86.0	NM_012241		Silent	SNP	ENST00000606117.1	hg19	CCDS4526.1																																																																																			.	.		0.413	SIRT5-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039908.2		
NUP153	9972	hgsc.bcm.edu	37	6	17706588	17706588	+	Missense_Mutation	SNP	C	C	A	rs373196566		TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr6:17706588C>A	ENST00000262077.2	-	1	30	c.31G>T	c.(31-33)Ggc>Tgc	p.G11C	NUP153_ENST00000537253.1_Missense_Mutation_p.G11C|RP11-500C11.3_ENST00000606771.1_RNA	NM_005124.2	NP_005115.2	P49790	NU153_HUMAN	nucleoporin 153kDa	11	Gly-rich.				carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|negative regulation of RNA export from nucleus (GO:0046832)|nuclear pore complex assembly (GO:0051292)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral entry into host cell (GO:0046718)|viral penetration into host nucleus (GO:0075732)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nuclear inclusion body (GO:0042405)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)|nuclear pore nuclear basket (GO:0044615)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|nucleocytoplasmic transporter activity (GO:0005487)|protein anchor (GO:0043495)|structural constituent of nuclear pore (GO:0017056)|transporter activity (GO:0005215)|zinc ion binding (GO:0008270)			NS(2)|breast(6)|endometrium(4)|kidney(3)|large_intestine(7)|lung(23)|ovary(3)|skin(3)|urinary_tract(2)	53	Breast(50;0.0259)|Ovarian(93;0.0584)	all_hematologic(90;0.125)	all cancers(50;0.0981)|Epithelial(50;0.112)			CCGCCACCGCCCCCTCCGACT	0.716																																					p.G11C		Atlas-SNP	.											.	NUP153	116	.	0			c.G31T						.						46.0	40.0	42.0					6																	17706588		2201	4299	6500	SO:0001583	missense	9972	exon1			CACCGCCCCCTCC	Z25535	CCDS4541.1, CCDS64359.1, CCDS75407.1	6p22.3	2008-07-29	2002-08-29		ENSG00000124789	ENSG00000124789			8062	protein-coding gene	gene with protein product		603948	"""nucleoporin 153kD"""			8110839	Standard	NM_001278209		Approved	HNUP153	uc003ncd.2	P49790	OTTHUMG00000014312	ENST00000262077.2:c.31G>T	chr6.hg19:g.17706588C>A	ENSP00000262077:p.Gly11Cys	57.0	0.0		87.0	9.0	NM_005124	B4DIK2|E7EPX5|F6QR24|Q4LE47|Q5T9I7|Q7Z743	Missense_Mutation	SNP	ENST00000262077.2	hg19	CCDS4541.1	.	.	.	.	.	.	.	.	.	.	C	19.63	3.864298	0.71949	.	.	ENSG00000124789	ENST00000262077;ENST00000430136;ENST00000537253	T;T	0.08546	3.12;3.08	3.97	3.97	0.46021	.	0.000000	0.35525	N	0.003147	T	0.11452	0.0279	L	0.46157	1.445	0.32481	N	0.541469	D;D;D	0.71674	0.998;0.995;0.995	D;P;P	0.65874	0.939;0.871;0.871	T	0.00376	-1.1779	10	0.62326	D	0.03	-2.5652	11.8695	0.52513	0.0:1.0:0.0:0.0	.	11;33;11	F6QR24;Q4LE47;P49790	.;.;NU153_HUMAN	C	11;33;11	ENSP00000262077:G11C;ENSP00000444029:G11C	ENSP00000262077:G11C	G	-	1	0	NUP153	17814567	0.997000	0.39634	1.000000	0.80357	0.808000	0.45660	1.803000	0.38863	2.503000	0.84419	0.591000	0.81541	GGC	.	.		0.716	NUP153-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039953.1		
PRL	5617	hgsc.bcm.edu	37	6	22287693	22287693	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr6:22287693G>T	ENST00000306482.1	-	5	1140	c.622C>A	c.(622-624)Cat>Aat	p.H208N	RP3-404K8.2_ENST00000561912.1_RNA	NM_000948.5|NM_001163558.2	NP_000939.1|NP_001157030.1	P01236	PRL_HUMAN	prolactin	208					cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|circadian rhythm (GO:0007623)|female pregnancy (GO:0007565)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|lactation (GO:0007595)|multicellular organismal response to stress (GO:0033555)|ovulation cycle (GO:0042698)|parturition (GO:0007567)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of JAK-STAT cascade (GO:0046427)|regulation of multicellular organism growth (GO:0040014)|regulation of ossification (GO:0030278)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|response to lipopolysaccharide (GO:0032496)|response to nutrient (GO:0007584)|STAT protein import into nucleus (GO:0007262)	extracellular region (GO:0005576)|secretory granule (GO:0030141)	prolactin receptor binding (GO:0005148)			NS(1)|endometrium(2)|large_intestine(6)|lung(6)|prostate(1)	16	Ovarian(93;0.163)					TCGATTTTATGTGAATCCCTG	0.468																																					p.H208N		Atlas-SNP	.											.	PRL	41	.	0			c.C622A						.						249.0	220.0	230.0					6																	22287693		2203	4300	6503	SO:0001583	missense	5617	exon5			TTTTATGTGAATC	D00411	CCDS4548.1	6p22.3	2013-09-16			ENSG00000172179	ENSG00000172179			9445	protein-coding gene	gene with protein product		176760					Standard	NM_000948		Approved		uc003ndq.3	P01236	OTTHUMG00000016111	ENST00000306482.1:c.622C>A	chr6.hg19:g.22287693G>T	ENSP00000302150:p.His208Asn	63.0	0.0		143.0	43.0	NM_000948	Q15199|Q92996	Missense_Mutation	SNP	ENST00000306482.1	hg19	CCDS4548.1	.	.	.	.	.	.	.	.	.	.	G	12.46	1.944977	0.34283	.	.	ENSG00000172179	ENST00000306482;ENST00000438606	D	0.89123	-2.47	5.66	3.84	0.44239	Somatotropin hormone, conserved site (1);Four-helical cytokine-like, core (1);Four-helical cytokine, core (1);	0.128807	0.64402	N	0.000001	D	0.82282	0.5003	L	0.60012	1.86	0.53688	D	0.999979	B;B	0.15473	0.0;0.013	B;B	0.30401	0.014;0.115	T	0.77739	-0.2475	10	0.38643	T	0.18	0.0015	14.5109	0.67787	0.0:0.0:0.6167:0.3833	.	208;209	P01236;Q5I0G2	PRL_HUMAN;.	N	208;177	ENSP00000302150:H208N	ENSP00000302150:H208N	H	-	1	0	PRL	22395672	0.999000	0.42202	0.451000	0.26982	0.998000	0.95712	3.026000	0.49689	0.815000	0.34398	0.655000	0.94253	CAT	.	.		0.468	PRL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043327.1	NM_000948	
HIST1H2BJ	8970	hgsc.bcm.edu	37	6	27100194	27100194	+	Silent	SNP	C	C	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr6:27100194C>A	ENST00000607124.1	-	1	335	c.336G>T	c.(334-336)gtG>gtT	p.V112V	HIST1H2BJ_ENST00000339812.2_Silent_p.V112V|HIST1H2AG_ENST00000359193.2_5'Flank|HIST1H2BJ_ENST00000541790.1_Silent_p.V112V			P06899	H2B1J_HUMAN	histone cluster 1, H2bj	112					antibacterial humoral response (GO:0019731)|chromatin organization (GO:0006325)|defense response to Gram-positive bacterium (GO:0050830)|innate immune response in mucosa (GO:0002227)|nucleosome assembly (GO:0006334)	extracellular space (GO:0005615)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|kidney(2)|lung(5)|ovary(1)|prostate(1)	10						TACCCTCGGACACGGCGTGCT	0.587																																					p.V112V		Atlas-SNP	.											HIST1H2BJ,NS,carcinoma,0,1	HIST1H2BJ	21	.	0			c.G336T						.						82.0	82.0	82.0					6																	27100194		2203	4300	6503	SO:0001819	synonymous_variant	8970	exon1			CTCGGACACGGCG	X00088	CCDS4618.1	6p22.1	2011-01-27	2006-10-11	2003-02-21	ENSG00000124635	ENSG00000124635		"""Histones / Replication-dependent"""	4761	protein-coding gene	gene with protein product		615044	"""H2B histone family, member R"", ""histone 1, H2bj"""	H2BFR		6647026, 12408966	Standard	NM_021058		Approved	H2B/r	uc003niv.3	P06899	OTTHUMG00000014470	ENST00000607124.1:c.336G>T	chr6.hg19:g.27100194C>A		93.0	0.0		174.0	34.0	NM_021058	B2R4J4|O60816	Silent	SNP	ENST00000607124.1	hg19	CCDS4618.1																																																																																			.	.		0.587	HIST1H2BJ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040138.2	NM_021058	
POM121L2	94026	hgsc.bcm.edu	37	6	27279131	27279131	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr6:27279131A>T	ENST00000444565.1	-	1	818	c.819T>A	c.(817-819)agT>agA	p.S273R	POM121L2_ENST00000377451.2_Missense_Mutation_p.S273R	NM_033482.3	NP_258443.2	Q96KW2	P12L2_HUMAN	POM121 transmembrane nucleoporin-like 2	273										breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|skin(1)	7						CACTGGGAACACTTCTCTTCC	0.468																																					p.S273R		Atlas-SNP	.											.	POM121L2	61	.	0			c.T819A						.						26.0	24.0	25.0					6																	27279131		692	1591	2283	SO:0001583	missense	94026	exon1			GGGAACACTTCTC	AL021808	CCDS59497.1	6p21.3	2012-03-13	2012-03-13		ENSG00000158553	ENSG00000158553			13973	protein-coding gene	gene with protein product			"""POM121 membrane glycoprotein-like 2 (rat)"", ""POM121 membrane glycoprotein-like 2"""				Standard	NM_033482		Approved	POM121-L	uc011dku.1	Q96KW2	OTTHUMG00000014475	ENST00000444565.1:c.819T>A	chr6.hg19:g.27279131A>T	ENSP00000392726:p.Ser273Arg	101.0	0.0		152.0	30.0	NM_033482	C9J1I7	Missense_Mutation	SNP	ENST00000444565.1	hg19	CCDS59497.1	.	.	.	.	.	.	.	.	.	.	A	10.29	1.309100	0.23821	.	.	ENSG00000158553	ENST00000377451;ENST00000444565	T;T	0.12569	2.67;2.67	3.97	-2.79	0.05841	.	1.984130	0.02861	N	0.130280	T	0.04182	0.0116	L	0.46157	1.445	0.09310	N	1	B	0.09022	0.002	B	0.12156	0.007	T	0.43491	-0.9388	10	0.41790	T	0.15	.	6.8201	0.23852	0.2055:0.5337:0.2607:0.0	.	273	C9J1I7	.	R	273	ENSP00000366671:S273R;ENSP00000392726:S273R	ENSP00000366671:S273R	S	-	3	2	POM121L2	27387110	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.037000	0.03557	-0.527000	0.06374	-0.365000	0.07479	AGT	.	.		0.468	POM121L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040143.2	NM_033482	
ZSCAN23	222696	hgsc.bcm.edu	37	6	28402633	28402633	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr6:28402633T>C	ENST00000289788.4	-	4	924	c.779A>G	c.(778-780)cAg>cGg	p.Q260R	ZSCAN23_ENST00000486481.1_5'Flank	NM_001012455.1	NP_001012458.1	Q3MJ62	ZSC23_HUMAN	zinc finger and SCAN domain containing 23	260					transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|prostate(1)|stomach(2)	4						GATGGAATTCTGGGTGAAGCT	0.502																																					p.Q260R		Atlas-SNP	.											.	ZSCAN23	18	.	0			c.A779G						.						87.0	76.0	79.0					6																	28402633		692	1591	2283	SO:0001583	missense	222696	exon4			GAATTCTGGGTGA	AK092117	CCDS47393.1	6p21.33	2013-01-08	2007-02-20	2007-02-20	ENSG00000187987	ENSG00000187987		"""-"", ""Zinc fingers, C2H2-type"""	21193	protein-coding gene	gene with protein product			"""zinc finger protein 453"", ""zinc finger protein 390"""	ZNF453, ZNF390			Standard	NM_001012455		Approved	dJ29K1.3.1	uc003nli.4	Q3MJ62	OTTHUMG00000016346	ENST00000289788.4:c.779A>G	chr6.hg19:g.28402633T>C	ENSP00000289788:p.Gln260Arg	148.0	0.0		275.0	66.0	NM_001012455	Q96KV9	Missense_Mutation	SNP	ENST00000289788.4	hg19	CCDS47393.1	.	.	.	.	.	.	.	.	.	.	T	16.44	3.123891	0.56613	.	.	ENSG00000187987	ENST00000289788	T	0.07444	3.19	4.56	4.56	0.56223	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.47852	D	0.000207	T	0.01835	0.0058	N	0.16066	0.365	0.21473	N	0.999679	B	0.33807	0.426	B	0.37550	0.253	T	0.43798	-0.9369	10	0.27082	T	0.32	.	7.4644	0.27314	0.1924:0.0:0.0:0.8076	.	260	Q3MJ62	ZSC23_HUMAN	R	260	ENSP00000289788:Q260R	ENSP00000289788:Q260R	Q	-	2	0	ZSCAN23	28510612	0.000000	0.05858	1.000000	0.80357	0.996000	0.88848	-0.032000	0.12266	1.894000	0.54839	0.528000	0.53228	CAG	.	.		0.502	ZSCAN23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043751.2	XM_167147	
ZNF311	282890	hgsc.bcm.edu	37	6	28962885	28962885	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr6:28962885T>C	ENST00000377179.3	-	7	2406	c.1894A>G	c.(1894-1896)Aga>Gga	p.R632G	ZNF311_ENST00000483450.1_5'UTR	NM_001010877.2	NP_001010877.2	Q5JNZ3	ZN311_HUMAN	zinc finger protein 311	632					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(11)|skin(3)|upper_aerodigestive_tract(2)	28						TGATGTTTTCTTTTCTTATGT	0.413																																					p.R632G		Atlas-SNP	.											.	ZNF311	59	.	0			c.A1894G						.						117.0	97.0	104.0					6																	28962885		1511	2709	4220	SO:0001583	missense	282890	exon7			GTTTTCTTTTCTT	AL833166	CCDS34357.1	6p21.33	2013-01-08			ENSG00000197935	ENSG00000197935		"""Zinc fingers, C2H2-type"", ""-"""	13847	protein-coding gene	gene with protein product							Standard	XM_006715067		Approved		uc003nlu.2	Q5JNZ3	OTTHUMG00000031292	ENST00000377179.3:c.1894A>G	chr6.hg19:g.28962885T>C	ENSP00000366384:p.Arg632Gly	130.0	0.0		208.0	38.0	NM_001010877	A2BFK5|B0S7Y4|Q92971	Missense_Mutation	SNP	ENST00000377179.3	hg19	CCDS34357.1	.	.	.	.	.	.	.	.	.	.	T	17.29	3.352261	0.61183	.	.	ENSG00000197935	ENST00000377179;ENST00000535083	T	0.07688	3.17	3.13	3.13	0.36017	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);	.	.	.	.	T	0.01387	0.0045	N	0.08118	0	0.27471	N	0.952865	P	0.47762	0.9	B	0.38954	0.286	T	0.45512	-0.9256	9	0.31617	T	0.26	-2.5445	8.0448	0.30542	0.0:0.0:0.0:1.0	.	632	Q5JNZ3	ZN311_HUMAN	G	632;540	ENSP00000366384:R632G	ENSP00000366384:R632G	R	-	1	2	ZNF311	29070864	0.040000	0.19996	0.995000	0.50966	0.930000	0.56654	0.913000	0.28611	1.666000	0.50821	0.477000	0.44152	AGA	.	.		0.413	ZNF311-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076631.3	XM_212581	
GABBR1	2550	hgsc.bcm.edu	37	6	29591692	29591692	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr6:29591692G>T	ENST00000377034.4	-	7	1102	c.767C>A	c.(766-768)gCt>gAt	p.A256D	GABBR1_ENST00000377012.4_Missense_Mutation_p.A139D|GABBR1_ENST00000355973.3_Missense_Mutation_p.A139D|GABBR1_ENST00000376977.3_Missense_Mutation_p.A256D|GABBR1_ENST00000377016.4_Missense_Mutation_p.A194D	NM_001470.2	NP_001461.1	Q9UBS5	GABR1_HUMAN	gamma-aminobutyric acid (GABA) B receptor, 1	256					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|gamma-aminobutyric acid signaling pathway (GO:0007214)|negative regulation of adenylate cyclase activity (GO:0007194)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|G-protein coupled receptor heterodimeric complex (GO:0038039)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	G-protein coupled GABA receptor activity (GO:0004965)			endometrium(3)|kidney(1)|large_intestine(13)|liver(1)|lung(16)|ovary(5)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	47					Baclofen(DB00181)|Progabide(DB00837)|Vigabatrin(DB01080)	CATCCTAGCAGCCTCAGCCAC	0.537																																					p.A256D		Atlas-SNP	.											.	GABBR1	95	.	0			c.C767A						.						123.0	94.0	104.0					6																	29591692		1511	2709	4220	SO:0001583	missense	2550	exon7			CTAGCAGCCTCAG	Y11044	CCDS4663.1, CCDS4664.1, CCDS4665.1	6p21.3	2012-08-29			ENSG00000204681	ENSG00000204681		"""GABA receptors"", ""GPCR / Class C : GABA(B) receptors"""	4070	protein-coding gene	gene with protein product	"""GABA-B receptor"""	603540				9753614, 9798068	Standard	NM_001470		Approved	hGB1a, GPRC3A	uc003nmt.4	Q9UBS5	OTTHUMG00000031095	ENST00000377034.4:c.767C>A	chr6.hg19:g.29591692G>T	ENSP00000366233:p.Ala256Asp	215.0	0.0		278.0	57.0	NM_001470	B0UXY7|O95375|O95468|O95975|O96022|Q5STL4|Q5SUJ8|Q5SUL3|Q71SG6|Q86W60|Q9UQQ0	Missense_Mutation	SNP	ENST00000377034.4	hg19	CCDS4663.1	.	.	.	.	.	.	.	.	.	.	-	15.38	2.815807	0.50527	.	.	ENSG00000204681	ENST00000355973;ENST00000376977;ENST00000377016;ENST00000377012;ENST00000377034	D;D;D;D;D	0.82984	-1.67;-1.67;-1.67;-1.67;-1.67	4.31	3.44	0.39384	Extracellular ligand-binding receptor (1);	0.061993	0.64402	D	0.000006	D	0.88742	0.6519	M	0.86343	2.81	0.80722	D	1	P;D;D;D	0.89917	0.86;1.0;1.0;1.0	P;D;D;D	0.91635	0.561;0.999;0.999;0.999	D	0.89744	0.3935	10	0.87932	D	0	-16.218	9.9893	0.41860	0.1005:0.0:0.8995:0.0	.	256;194;256;139	Q9UBS5-5;Q9UBS5-3;Q9UBS5;Q5SUJ9	.;.;GABR1_HUMAN;.	D	139;256;194;139;256	ENSP00000348248:A139D;ENSP00000366176:A256D;ENSP00000366215:A194D;ENSP00000366211:A139D;ENSP00000366233:A256D	ENSP00000348248:A139D	A	-	2	0	GABBR1	29699671	1.000000	0.71417	1.000000	0.80357	0.144000	0.21451	8.942000	0.92970	1.060000	0.40578	-0.293000	0.09583	GCT	.	.		0.537	GABBR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076141.3		
MUC21	394263	hgsc.bcm.edu	37	6	30955854	30955854	+	Silent	SNP	A	A	C			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr6:30955854A>C	ENST00000376296.3	+	3	1825	c.1584A>C	c.(1582-1584)ccA>ccC	p.P528P	MUC21_ENST00000486149.2_Silent_p.P74P	NM_001010909.2	NP_001010909.2	Q5SSG8	MUC21_HUMAN	mucin 21, cell surface associated	528	Cytoplasmic tail.				cellular protein metabolic process (GO:0044267)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of cell-substrate adhesion (GO:0010812)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(4)|breast(1)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(7)|lung(11)|ovary(3)|prostate(4)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	42						GCCTTGGTCCAGGCCCTGGAG	0.537																																					p.P528P		Atlas-SNP	.											.	MUC21	98	.	0			c.A1584C						.						73.0	73.0	73.0					6																	30955854		1511	2708	4219	SO:0001819	synonymous_variant	394263	exon3			TGGTCCAGGCCCT	AK056612	CCDS34388.1	6p21.33	2008-05-14	2008-05-14	2008-05-14	ENSG00000204544	ENSG00000204544		"""Mucins"""	21661	protein-coding gene	gene with protein product	"""epiglycanin"""		"""chromosome 6 open reading frame 205"""	C6orf205		17977904	Standard	NM_001010909		Approved	bCX31G15.2	uc003nsh.2	Q5SSG8	OTTHUMG00000031216	ENST00000376296.3:c.1584A>C	chr6.hg19:g.30955854A>C		189.0	0.0		255.0	42.0	NM_001010909	B0UZT7|B4DQ55|C9JMK2|D9N007|Q0VGF1|Q3B7T2|Q5SS94|Q6UXC5	Silent	SNP	ENST00000376296.3	hg19	CCDS34388.1																																																																																			.	.		0.537	MUC21-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000128579.3	NM_001010909	
C6orf47	57827	hgsc.bcm.edu	37	6	31627616	31627616	+	Nonsense_Mutation	SNP	C	C	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr6:31627616C>A	ENST00000375911.1	-	1	933	c.109G>T	c.(109-111)Gag>Tag	p.E37*	C6orf47-AS1_ENST00000422049.1_RNA	NM_021184.3	NP_067007.3	O95873	CF047_HUMAN	chromosome 6 open reading frame 47	37						cytoplasm (GO:0005737)				NS(1)|endometrium(1)|kidney(3)|large_intestine(1)|lung(1)|ovary(1)|skin(1)	9						CCTGAATTCTCCGAGGAGCTG	0.617																																					p.E37X		Atlas-SNP	.											.	C6orf47	15	.	0			c.G109T						.						38.0	36.0	37.0					6																	31627616		1511	2708	4219	SO:0001587	stop_gained	57827	exon1			AATTCTCCGAGGA	AF129756	CCDS34399.1	6p21.3	2011-12-13			ENSG00000204439	ENSG00000204439			19076	protein-coding gene	gene with protein product						2477242	Standard	NM_021184		Approved	D6S53E, G4	uc003nvm.1	O95873	OTTHUMG00000031172	ENST00000375911.1:c.109G>T	chr6.hg19:g.31627616C>A	ENSP00000365076:p.Glu37*	163.0	0.0		247.0	47.0	NM_021184	B0UXA1|B0UZ50|Q5SSS6|Q95IG0	Nonsense_Mutation	SNP	ENST00000375911.1	hg19	CCDS34399.1	.	.	.	.	.	.	.	.	.	.	C	44	10.893822	0.99484	.	.	ENSG00000204439	ENST00000375911;ENST00000538106	.	.	.	5.44	5.44	0.79542	.	0.000000	0.47093	D	0.000242	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-19.7986	14.6416	0.68729	0.0:1.0:0.0:0.0	.	.	.	.	X	37	.	ENSP00000365076:E37X	E	-	1	0	C6orf47	31735595	0.997000	0.39634	0.991000	0.47740	0.851000	0.48451	3.342000	0.52159	2.837000	0.97791	0.655000	0.94253	GAG	.	.		0.617	C6orf47-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076324.1	NM_021184	
VWA7	80737	hgsc.bcm.edu	37	6	31735467	31735467	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr6:31735467C>A	ENST00000375688.4	-	11	1768	c.1568G>T	c.(1567-1569)gGg>gTg	p.G523V	VWA7_ENST00000467576.1_5'UTR|VWA7_ENST00000375686.3_Missense_Mutation_p.G523V|SAPCD1-AS1_ENST00000419679.1_RNA|VWA7_ENST00000447450.1_Missense_Mutation_p.G523V			Q9Y334	VWA7_HUMAN	von Willebrand factor A domain containing 7	523						extracellular region (GO:0005576)											CTGGAGCAGCCCATCCACGCT	0.567																																					p.G523V		Atlas-SNP	.											.	.	.	.	0			c.G1568T						.						108.0	107.0	107.0					6																	31735467		2203	4300	6503	SO:0001583	missense	80737	exon11			AGCAGCCCATCCA		CCDS4721.2	6p21	2011-12-13	2011-12-13	2011-12-13	ENSG00000204396	ENSG00000204396			13939	protein-coding gene	gene with protein product		609693	"""chromosome 6 open reading frame 27"""	C6orf27			Standard	NM_025258		Approved	G7c, NG37	uc011dog.2	Q9Y334	OTTHUMG00000031132	ENST00000375688.4:c.1568G>T	chr6.hg19:g.31735467C>A	ENSP00000364840:p.Gly523Val	108.0	0.0		190.0	42.0	NM_025258	A2BEX8|A6NHR6|B0V041|Q5SSR5|Q96QC8|Q9UMP9	Missense_Mutation	SNP	ENST00000375688.4	hg19	CCDS4721.2	.	.	.	.	.	.	.	.	.	.	C	9.767	1.171577	0.21704	.	.	ENSG00000204396	ENST00000375688;ENST00000375686;ENST00000447450	T;T;T	0.29397	2.8;2.58;1.57	4.95	1.57	0.23409	.	0.920838	0.09417	N	0.804983	T	0.10981	0.0268	L	0.51422	1.61	0.39262	D	0.96422	B	0.22983	0.078	B	0.21917	0.037	T	0.23726	-1.0180	10	0.34782	T	0.22	-2.5619	3.6196	0.08090	0.0:0.4939:0.1933:0.3128	.	523	Q9Y334	G7C_HUMAN	V	523	ENSP00000364840:G523V;ENSP00000364838:G523V;ENSP00000390554:G523V	ENSP00000364838:G523V	G	-	2	0	C6orf27	31843446	0.254000	0.23992	0.993000	0.49108	0.535000	0.34838	0.647000	0.24812	0.531000	0.28639	0.561000	0.74099	GGG	.	.		0.567	VWA7-001	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076233.2	NM_025258	
SLC44A4	80736	hgsc.bcm.edu	37	6	31839119	31839119	+	Missense_Mutation	SNP	A	A	C			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr6:31839119A>C	ENST00000229729.6	-	9	693	c.673T>G	c.(673-675)Ttt>Gtt	p.F225V	SLC44A4_ENST00000544672.1_Missense_Mutation_p.F149V|SLC44A4_ENST00000375562.4_Missense_Mutation_p.F183V	NM_025257.2	NP_079533.2	Q53GD3	CTL4_HUMAN	solute carrier family 44, member 4	225					acetylcholine biosynthetic process (GO:0008292)|acetylcholine secretion (GO:0061526)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|positive regulation of cell growth (GO:0030307)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(11)|ovary(2)|prostate(3)|skin(1)|urinary_tract(2)	35					Choline(DB00122)	GACTGGGCAAAATCTTCAAAG	0.527																																					p.F225V		Atlas-SNP	.											SLC44A4,NS,carcinoma,0,1	SLC44A4	67	.	0			c.T673G						.						134.0	122.0	126.0					6																	31839119		2203	4300	6503	SO:0001583	missense	80736	exon9			GGGCAAAATCTTC	AF134726	CCDS4724.2, CCDS54989.1, CCDS54990.1	6p21.3	2014-02-17	2005-09-06	2005-09-06	ENSG00000204385	ENSG00000204385		"""Solute carriers"""	13941	protein-coding gene	gene with protein product		606107	"""chromosome 6 open reading frame 29"""	C6orf29		10677542, 15715662, 24379411	Standard	NM_025257		Approved	NG22, CTL4, FLJ14491, TPPT	uc010jti.3	Q53GD3	OTTHUMG00000031133	ENST00000229729.6:c.673T>G	chr6.hg19:g.31839119A>C	ENSP00000229729:p.Phe225Val	117.0	0.0		168.0	7.0	NM_025257	A2BED3|B0UXX8|B0UZY8|B4DU94|B4DWM2|E9PEK7|Q5JP84|Q5JQ93|Q658S8|Q6UX89|Q8TEW4|Q96C58|Q96K59|Q9Y332	Missense_Mutation	SNP	ENST00000229729.6	hg19	CCDS4724.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	17.45|17.45	3.392108|3.392108	0.62066|0.62066	.|.	.|.	ENSG00000204385|ENSG00000204385	ENST00000229729;ENST00000375562;ENST00000544672|ENST00000414427	T;T;T|.	0.10860|.	3.22;2.83;3.0|.	4.57|4.57	3.33|3.33	0.38152|0.38152	.|.	0.112173|.	0.64402|.	D|.	0.000010|.	T|T	0.47173|0.47173	0.1431|0.1431	L|L	0.54323|0.54323	1.7|1.7	0.45161|0.45161	D|D	0.998173|0.998173	B;B|.	0.09022|.	0.002;0.001|.	B;B|.	0.12156|.	0.007;0.003|.	T|T	0.46261|0.46261	-0.9204|-0.9204	10|5	0.28530|.	T|.	0.3|.	-17.2626|-17.2626	8.6008|8.6008	0.33742|0.33742	0.8169:0.0:0.0:0.1831|0.8169:0.0:0.0:0.1831	.|.	183;225|.	E9PEK7;Q53GD3|.	.;CTL4_HUMAN|.	V|M	225;183;149|220	ENSP00000229729:F225V;ENSP00000364712:F183V;ENSP00000444109:F149V|.	ENSP00000229729:F225V|.	F|I	-|-	1|3	0|3	SLC44A4|SLC44A4	31947098|31947098	0.996000|0.996000	0.38824|0.38824	0.999000|0.999000	0.59377|0.59377	0.982000|0.982000	0.71751|0.71751	3.844000|3.844000	0.55873|0.55873	1.934000|1.934000	0.56057|0.56057	0.459000|0.459000	0.35465|0.35465	TTT|ATT	.	.		0.527	SLC44A4-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076234.3		
GRM4	2914	hgsc.bcm.edu	37	6	34003458	34003458	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr6:34003458T>A	ENST00000538487.2	-	9	2872	c.2429A>T	c.(2428-2430)cAg>cTg	p.Q810L	GRM4_ENST00000544773.2_Missense_Mutation_p.Q641L|GRM4_ENST00000535756.1_Missense_Mutation_p.Q677L|GRM4_ENST00000455714.2_Missense_Mutation_p.Q670L|GRM4_ENST00000545715.1_5'UTR|GRM4_ENST00000374181.4_Missense_Mutation_p.Q810L|GRM4_ENST00000374177.3_Missense_Mutation_p.Q694L|GRM4_ENST00000609222.1_Missense_Mutation_p.Q677L	NM_000841.2|NM_001256811.1	NP_000832.1|NP_001243740.1	Q14833	GRM4_HUMAN	glutamate receptor, metabotropic 4	810					activation of MAPK activity (GO:0000187)|adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|learning (GO:0007612)|neurotransmitter secretion (GO:0007269)|positive regulation of MAPK cascade (GO:0043410)|regulation of neuron apoptotic process (GO:0043523)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission (GO:0007268)	cytoplasmic vesicle (GO:0031410)|dendritic shaft (GO:0043198)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|presynaptic active zone membrane (GO:0048787)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)|group III metabotropic glutamate receptor activity (GO:0001642)			NS(1)|breast(1)|endometrium(4)|kidney(4)|large_intestine(9)|liver(1)|lung(19)|ovary(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	48						GTCGGCCGACTGCGAGGTGCC	0.642																																					p.Q810L		Atlas-SNP	.											.	GRM4	317	.	0			c.A2429T						.						50.0	40.0	44.0					6																	34003458		2203	4300	6503	SO:0001583	missense	2914	exon9			GCCGACTGCGAGG	U92457	CCDS4787.1, CCDS59010.1, CCDS59011.1, CCDS59012.1, CCDS75432.1	6p21.3	2012-08-29			ENSG00000124493	ENSG00000124493		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4596	protein-coding gene	gene with protein product		604100				8738157, 9473604	Standard	NM_000841		Approved	GPRC1D, mGlu4, MGLUR4	uc010jvh.4	Q14833	OTTHUMG00000014538	ENST00000538487.2:c.2429A>T	chr6.hg19:g.34003458T>A	ENSP00000440556:p.Gln810Leu	228.0	0.0		377.0	69.0	NM_000841	B3KVL9|B7Z1T9|B7Z1U6|F5GXM5|Q5SZ84|Q6ZMQ2	Missense_Mutation	SNP	ENST00000538487.2	hg19	CCDS4787.1	.	.	.	.	.	.	.	.	.	.	.	15.63	2.889505	0.52014	.	.	ENSG00000124493	ENST00000374181;ENST00000374177;ENST00000545715;ENST00000535756;ENST00000544773;ENST00000538487;ENST00000455714	D;D;D;D;D;D;D	0.88818	-2.43;-2.43;-2.43;-2.43;-2.43;-2.43;-2.43	4.37	4.37	0.52481	GPCR, family 3, C-terminal (2);	0.000000	0.85682	D	0.000000	D	0.92665	0.7669	M	0.78916	2.43	0.80722	D	1	P;B;D;D;B	0.63046	0.797;0.02;0.992;0.959;0.045	B;B;D;P;B	0.72982	0.425;0.03;0.979;0.629;0.048	D	0.93788	0.7090	10	0.87932	D	0	.	13.7265	0.62761	0.0:0.0:0.0:1.0	.	763;641;670;810;677	B7ZLU9;B7Z1T9;F5GXM5;Q14833;B3KVL9	.;.;.;GRM4_HUMAN;.	L	810;694;502;677;641;810;670	ENSP00000363296:Q810L;ENSP00000363292:Q694L;ENSP00000445533:Q502L;ENSP00000437925:Q677L;ENSP00000437730:Q641L;ENSP00000440556:Q810L;ENSP00000398456:Q670L	ENSP00000363292:Q694L	Q	-	2	0	GRM4	34111436	1.000000	0.71417	0.991000	0.47740	0.503000	0.33858	7.795000	0.85887	1.823000	0.53134	0.379000	0.24179	CAG	.	.		0.642	GRM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040213.2		
ZNF76	7629	hgsc.bcm.edu	37	6	35260758	35260758	+	Silent	SNP	G	G	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr6:35260758G>T	ENST00000373953.3	+	11	1532	c.1266G>T	c.(1264-1266)gcG>gcT	p.A422A	ZNF76_ENST00000440666.2_Silent_p.A396A|ZNF76_ENST00000339411.5_Silent_p.A422A	NM_003427.3	NP_003418.2	P36508	ZNF76_HUMAN	zinc finger protein 76	422					regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|cervix(1)|kidney(1)|large_intestine(4)|lung(5)|ovary(1)|prostate(1)|skin(1)|stomach(1)	16						CCCAGGTGGCGATGGTGACTG	0.617																																					p.A422A	Esophageal Squamous(52;92 1039 20612 23956 34676)	Atlas-SNP	.											.	ZNF76	37	.	0			c.G1266T						.						74.0	86.0	82.0					6																	35260758		2203	4300	6503	SO:0001819	synonymous_variant	7629	exon11			GGTGGCGATGGTG	M91592	CCDS4801.1, CCDS75435.1	6p21.31	2013-01-08	2011-02-25		ENSG00000065029	ENSG00000065029		"""Zinc fingers, C2H2-type"""	13149	protein-coding gene	gene with protein product		194549	"""zinc finger protein 76 (expressed in testis)"""	D6S229E		1427894	Standard	XM_005249364		Approved	Zfp523, ZNF523	uc003oki.1	P36508	OTTHUMG00000014564	ENST00000373953.3:c.1266G>T	chr6.hg19:g.35260758G>T		160.0	0.0		239.0	58.0	NM_003427	Q9BQB2	Silent	SNP	ENST00000373953.3	hg19	CCDS4801.1																																																																																			.	.		0.617	ZNF76-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040279.2	NM_003427	
BRPF3	27154	hgsc.bcm.edu	37	6	36169160	36169160	+	Missense_Mutation	SNP	A	A	C			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr6:36169160A>C	ENST00000357641.6	+	2	1314	c.1061A>C	c.(1060-1062)cAg>cCg	p.Q354P	BRPF3_ENST00000443324.2_Missense_Mutation_p.Q354P|BRPF3_ENST00000339717.7_Missense_Mutation_p.Q354P|BRPF3_ENST00000534694.1_Missense_Mutation_p.Q354P|BRPF3_ENST00000534400.1_Missense_Mutation_p.Q354P|BRPF3_ENST00000543502.1_Missense_Mutation_p.Q354P	NM_015695.2	NP_056510.2	Q9ULD4	BRPF3_HUMAN	bromodomain and PHD finger containing, 3	354					blood coagulation (GO:0007596)|histone H3 acetylation (GO:0043966)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	cytosol (GO:0005829)|extracellular region (GO:0005576)|MOZ/MORF histone acetyltransferase complex (GO:0070776)	zinc ion binding (GO:0008270)			breast(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(8)|lung(15)|ovary(1)|prostate(1)|skin(4)|urinary_tract(2)	40						ACATGTGCACAGCGGGCTGGG	0.532																																					p.Q354P		Atlas-SNP	.											.	BRPF3	93	.	0			c.A1061C						.						60.0	53.0	55.0					6																	36169160		2203	4300	6503	SO:0001583	missense	27154	exon2			GTGCACAGCGGGC	AB033112	CCDS34437.1	6p21.31	2008-02-05			ENSG00000096070	ENSG00000096070			14256	protein-coding gene	gene with protein product						10574462	Standard	NM_015695		Approved	KIAA1286	uc003olv.4	Q9ULD4	OTTHUMG00000014589	ENST00000357641.6:c.1061A>C	chr6.hg19:g.36169160A>C	ENSP00000350267:p.Gln354Pro	89.0	0.0		131.0	21.0	NM_015695	A6ND56|A6NJE2|B7ZLN5|E7EX85|Q17RB6|Q5R3K8	Missense_Mutation	SNP	ENST00000357641.6	hg19	CCDS34437.1	.	.	.	.	.	.	.	.	.	.	A	18.03	3.532647	0.64972	.	.	ENSG00000096070	ENST00000357641;ENST00000339717;ENST00000534694;ENST00000543502;ENST00000443324;ENST00000534400	D;T;T;T;T;D	0.84589	-1.87;0.98;0.98;0.98;0.98;-1.87	5.62	5.62	0.85841	Zinc finger, PHD-type (1);	0.000000	0.85682	D	0.000000	D	0.94407	0.8201	H	0.96239	3.79	0.80722	D	1	D;D;D	0.89917	0.999;0.999;1.0	D;D;D	0.91635	0.996;0.996;0.999	D	0.96053	0.9033	10	0.87932	D	0	.	16.1189	0.81329	1.0:0.0:0.0:0.0	.	354;354;354	B7ZLN5;Q17RB6;Q9ULD4	.;.;BRPF3_HUMAN	P	354	ENSP00000350267:Q354P;ENSP00000345419:Q354P;ENSP00000434501:Q354P;ENSP00000445352:Q354P;ENSP00000387368:Q354P;ENSP00000436504:Q354P	ENSP00000345419:Q354P	Q	+	2	0	BRPF3	36277138	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	8.851000	0.92205	2.263000	0.75096	0.533000	0.62120	CAG	.	.		0.532	BRPF3-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000040335.3	NM_015695	
DNAH8	1769	hgsc.bcm.edu	37	6	38994404	38994404	+	Silent	SNP	T	T	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr6:38994404T>A	ENST00000359357.3	+	90	13400	c.13146T>A	c.(13144-13146)gtT>gtA	p.V4382V	DNAH8_ENST00000441566.1_Silent_p.V4346V			Q96JB1	DYH8_HUMAN	dynein, axonemal, heavy chain 8	4382					cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(7)|breast(9)|central_nervous_system(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(3)|kidney(16)|large_intestine(44)|liver(4)|lung(101)|ovary(7)|pancreas(2)|prostate(8)|skin(28)|stomach(4)|upper_aerodigestive_tract(6)|urinary_tract(4)	260						ACAATGAAGTTCTGAGACAGA	0.517																																					p.V4599V		Atlas-SNP	.											.	DNAH8	1239	.	0			c.T13797A						.						111.0	84.0	94.0					6																	38994404		2203	4300	6503	SO:0001819	synonymous_variant	1769	exon92			TGAAGTTCTGAGA	Z83806	CCDS75447.1	6p21.2	2012-04-19	2006-09-04		ENSG00000124721	ENSG00000124721		"""Axonemal dyneins"""	2952	protein-coding gene	gene with protein product		603337	"""dynein, axonemal, heavy polypeptide 8"""			9373155	Standard	NM_001206927		Approved	hdhc9	uc021yzh.1	Q96JB1	OTTHUMG00000016253	ENST00000359357.3:c.13146T>A	chr6.hg19:g.38994404T>A		61.0	0.0		81.0	20.0	NM_001206927	O00438|Q5JYI2|Q5T2M3|Q5T2M4|Q5TG00|Q9UEM4	Silent	SNP	ENST00000359357.3	hg19																																																																																				.	.		0.517	DNAH8-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000043574.1	NM_001206927	
GLP1R	2740	hgsc.bcm.edu	37	6	39040691	39040691	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr6:39040691T>A	ENST00000373256.4	+	6	606	c.563T>A	c.(562-564)aTc>aAc	p.I188N		NM_002062.3	NP_002053.3	P43220	GLP1R_HUMAN	glucagon-like peptide 1 receptor	188					activation of adenylate cyclase activity (GO:0007190)|cAMP-mediated signaling (GO:0019933)|energy reserve metabolic process (GO:0006112)|learning or memory (GO:0007611)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of heart contraction (GO:0008016)|regulation of insulin secretion (GO:0050796)|response to stress (GO:0006950)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	glucagon receptor activity (GO:0004967)|transmembrane signaling receptor activity (GO:0004888)			breast(5)|endometrium(3)|kidney(1)|large_intestine(8)|lung(9)|pancreas(1)|prostate(1)|skin(1)|stomach(2)	31					Exenatide(DB01276)|Glucagon recombinant(DB00040)|Liraglutide(DB06655)	GCATCCTTCATCCTGCGAGCA	0.572																																					p.I188N		Atlas-SNP	.											.	GLP1R	64	.	0			c.T563A						.						224.0	179.0	194.0					6																	39040691		2203	4300	6503	SO:0001583	missense	2740	exon6			CCTTCATCCTGCG		CCDS4839.1	6p21	2012-08-10			ENSG00000112164	ENSG00000112164		"""GPCR / Class B : Glucagon receptors"""	4324	protein-coding gene	gene with protein product		138032					Standard	NM_002062		Approved		uc003ooj.4	P43220	OTTHUMG00000014638	ENST00000373256.4:c.563T>A	chr6.hg19:g.39040691T>A	ENSP00000362353:p.Ile188Asn	92.0	0.0		146.0	42.0	NM_002062	Q2M229|Q99669	Missense_Mutation	SNP	ENST00000373256.4	hg19	CCDS4839.1	.	.	.	.	.	.	.	.	.	.	T	27.2	4.811467	0.90707	.	.	ENSG00000112164	ENST00000373256	T	0.42900	0.96	5.71	5.71	0.89125	GPCR, family 2-like (1);	0.000000	0.64402	D	0.000003	T	0.67692	0.2920	M	0.92923	3.36	0.80722	D	1	D	0.71674	0.998	D	0.80764	0.994	T	0.77419	-0.2595	10	0.87932	D	0	.	15.988	0.80176	0.0:0.0:0.0:1.0	.	188	P43220	GLP1R_HUMAN	N	188	ENSP00000362353:I188N	ENSP00000362353:I188N	I	+	2	0	GLP1R	39148669	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	8.015000	0.88690	2.188000	0.69820	0.533000	0.62120	ATC	.	.		0.572	GLP1R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040443.1		
FRS3	10817	hgsc.bcm.edu	37	6	41739273	41739273	+	Splice_Site	SNP	T	T	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr6:41739273T>A	ENST00000373018.3	-	7	816		c.e7-2		FRS3_ENST00000259748.2_Splice_Site	NM_006653.3	NP_006644.1	O43559	FRS3_HUMAN	fibroblast growth factor receptor substrate 3						fibroblast growth factor receptor signaling pathway (GO:0008543)|signal transduction (GO:0007165)	plasma membrane (GO:0005886)	fibroblast growth factor receptor binding (GO:0005104)			breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(4)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	14	Ovarian(28;0.0355)|Colorectal(47;0.121)		Epithelial(12;8.38e-05)|STAD - Stomach adenocarcinoma(11;0.000204)|Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)			GGTGTGGGACTGGGGAAAGAG	0.592																																					.		Atlas-SNP	.											.	FRS3	53	.	0			c.565-2A>T						.						51.0	50.0	50.0					6																	41739273		2197	4269	6466	SO:0001630	splice_region_variant	10817	exon8			TGGGACTGGGGAA	AF036718	CCDS4860.1	6p21.1	2010-08-05			ENSG00000137218	ENSG00000137218			16970	protein-coding gene	gene with protein product		607744				8761293, 9660748	Standard	NM_006653		Approved	SNT-2, FRS2beta, FRS2B	uc003orc.1	O43559	OTTHUMG00000014686	ENST00000373018.3:c.565-2A>T	chr6.hg19:g.41739273T>A		16.0	0.0		37.0	11.0	NM_006653	Q5T3D5	Splice_Site	SNP	ENST00000373018.3	hg19	CCDS4860.1	.	.	.	.	.	.	.	.	.	.	T	17.13	3.310789	0.60414	.	.	ENSG00000137218	ENST00000373018;ENST00000259748	.	.	.	5.43	5.43	0.79202	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.1394	0.72599	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	FRS3	41847251	1.000000	0.71417	0.998000	0.56505	0.919000	0.55068	7.400000	0.79949	2.073000	0.62155	0.533000	0.62120	.	.	.		0.592	FRS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040532.2	NM_006653	Intron
PTK7	5754	hgsc.bcm.edu	37	6	43109672	43109672	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr6:43109672T>A	ENST00000230419.4	+	12	1993	c.1772T>A	c.(1771-1773)tTt>tAt	p.F591Y	PTK7_ENST00000352931.2_Missense_Mutation_p.F591Y|PTK7_ENST00000481273.1_Missense_Mutation_p.F599Y|PTK7_ENST00000345201.2_Missense_Mutation_p.F551Y|PTK7_ENST00000349241.2_Missense_Mutation_p.F461Y	NM_002821.4	NP_002812.2	Q13308	PTK7_HUMAN	protein tyrosine kinase 7	591	Ig-like C2-type 7.				actin cytoskeleton reorganization (GO:0031532)|axis elongation (GO:0003401)|canonical Wnt signaling pathway (GO:0060070)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|cellular response to retinoic acid (GO:0071300)|cochlea morphogenesis (GO:0090103)|convergent extension (GO:0060026)|establishment of epithelial cell apical/basal polarity (GO:0045198)|establishment of planar polarity (GO:0001736)|lung-associated mesenchyme development (GO:0060484)|neural tube closure (GO:0001843)|peptidyl-tyrosine phosphorylation (GO:0018108)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|positive regulation of neuron projection development (GO:0010976)|signal transduction (GO:0007165)|wound healing (GO:0042060)	cell-cell junction (GO:0005911)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(12)|ovary(2)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	46			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.00784)|OV - Ovarian serous cystadenocarcinoma(102;0.0423)			CTTCCAGTTTTTATCACCTTC	0.627																																					p.F599Y		Atlas-SNP	.											.	PTK7	101	.	0			c.T1796A						.						53.0	60.0	57.0					6																	43109672		2203	4300	6503	SO:0001583	missense	5754	exon12			CAGTTTTTATCAC	AF447176	CCDS4884.1, CCDS4885.1, CCDS4886.1, CCDS4887.1, CCDS59021.1	6p21.1-p12.2	2013-02-18	2013-02-18		ENSG00000112655	ENSG00000112655	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9618	protein-coding gene	gene with protein product		601890	"""PTK7 protein tyrosine kinase 7"""			7478540	Standard	NM_002821		Approved	CCK4	uc011dve.2	Q13308	OTTHUMG00000014721	ENST00000230419.4:c.1772T>A	chr6.hg19:g.43109672T>A	ENSP00000230419:p.Phe591Tyr	49.0	0.0		88.0	27.0	NM_001270398	A8K974|B7Z477|E9PFZ5|Q13417|Q5T650|Q6IQ54|Q8NFA5|Q8NFA6|Q8NFA7|Q8NFA8	Missense_Mutation	SNP	ENST00000230419.4	hg19	CCDS4884.1	.	.	.	.	.	.	.	.	.	.	T	7.162	0.585833	0.13749	.	.	ENSG00000112655	ENST00000230419;ENST00000349241;ENST00000352931;ENST00000345201;ENST00000481273	T;T;T;T;T	0.73469	-0.67;-0.75;1.58;-0.68;-0.7	4.96	4.96	0.65561	Immunoglobulin-like (1);	0.163195	0.56097	D	0.000030	T	0.28599	0.0708	N	0.05441	-0.05	0.35271	D	0.780454	B;B;B;B;B	0.10296	0.0;0.003;0.001;0.003;0.0	B;B;B;B;B	0.13407	0.001;0.009;0.005;0.009;0.002	T	0.10177	-1.0641	10	0.02654	T	1	.	10.5783	0.45240	0.1532:0.0:0.0:0.8468	.	599;461;551;591;591	E9PFZ5;Q13308-3;Q13308-2;Q13308-4;Q13308	.;.;.;.;PTK7_HUMAN	Y	591;461;591;551;599	ENSP00000230419:F591Y;ENSP00000325462:F461Y;ENSP00000326029:F591Y;ENSP00000325992:F551Y;ENSP00000418754:F599Y	ENSP00000230418:F591Y	F	+	2	0	PTK7	43217650	1.000000	0.71417	1.000000	0.80357	0.926000	0.56050	2.778000	0.47726	1.859000	0.53934	0.459000	0.35465	TTT	.	.		0.627	PTK7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040580.2		
CUL9	23113	hgsc.bcm.edu	37	6	43155101	43155101	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr6:43155101T>C	ENST00000252050.4	+	6	1589	c.1505T>C	c.(1504-1506)cTg>cCg	p.L502P	CUL9_ENST00000354495.3_Intron|CUL9_ENST00000372647.2_Missense_Mutation_p.L502P	NM_015089.2	NP_055904.1	Q8IWT3	CUL9_HUMAN	cullin 9	502					microtubule cytoskeleton organization (GO:0000226)|protein ubiquitination (GO:0016567)|regulation of mitosis (GO:0007088)|ubiquitin-dependent protein catabolic process (GO:0006511)	cullin-RING ubiquitin ligase complex (GO:0031461)|cytoplasm (GO:0005737)	ATP binding (GO:0005524)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|liver(1)|lung(30)|ovary(5)|prostate(3)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(4)	92						TGGTGGGAGCTGCTTTTCTTT	0.478																																					p.L502P		Atlas-SNP	.											.	CUL9	248	.	0			c.T1505C						.						139.0	145.0	143.0					6																	43155101		2203	4300	6503	SO:0001583	missense	23113	exon6			GGGAGCTGCTTTT	AB014608	CCDS4890.1	6p21.1	2011-05-24			ENSG00000112659	ENSG00000112659			15982	protein-coding gene	gene with protein product	"""parkin-like cytoplasmic p53 binding protein"", ""p53-associated parkin-like cytoplasmic protein"""	607489				17332328, 10521492, 12526791	Standard	NM_015089		Approved	H7AP1, KIAA0708, PARC	uc003ouk.3	Q8IWT3	OTTHUMG00000014723	ENST00000252050.4:c.1505T>C	chr6.hg19:g.43155101T>C	ENSP00000252050:p.Leu502Pro	110.0	0.0		187.0	25.0	NM_015089	O75188|Q5TCY3|Q68CP2|Q68D92|Q8N3W9|Q9BU56	Missense_Mutation	SNP	ENST00000252050.4	hg19	CCDS4890.1	.	.	.	.	.	.	.	.	.	.	T	21.1	4.091403	0.76756	.	.	ENSG00000112659	ENST00000252050;ENST00000372647	T;T	0.80653	-1.4;-1.3	5.01	5.01	0.66863	.	0.143295	0.47852	D	0.000217	D	0.83876	0.5349	L	0.60455	1.87	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.66196	0.942;0.942	D	0.86533	0.1823	10	0.87932	D	0	-10.7577	14.7211	0.69308	0.0:0.0:0.0:1.0	.	502;502	E9PEZ1;Q8IWT3	.;CUL9_HUMAN	P	502	ENSP00000252050:L502P;ENSP00000361730:L502P	ENSP00000252050:L502P	L	+	2	0	CUL9	43263079	1.000000	0.71417	0.998000	0.56505	0.984000	0.73092	7.132000	0.77251	1.883000	0.54544	0.383000	0.25322	CTG	.	.		0.478	CUL9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040582.2	NM_015089	
TMEM151B	441151	hgsc.bcm.edu	37	6	44243711	44243711	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr6:44243711T>A	ENST00000451188.2	+	3	1425	c.1148T>A	c.(1147-1149)cTg>cAg	p.L383Q	RP11-444E17.6_ENST00000505802.1_Intron|TMEM151B_ENST00000438774.2_Intron	NM_001137560.1	NP_001131032.1	Q8IW70	T151B_HUMAN	transmembrane protein 151B	383						integral component of membrane (GO:0016021)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)	6						AACCAGCAGCTGGTGCCCAGC	0.716																																					p.L383Q		Atlas-SNP	.											.	TMEM151B	13	.	0			c.T1148A						.						13.0	16.0	15.0					6																	44243711		688	1588	2276	SO:0001583	missense	441151	exon3			AGCAGCTGGTGCC	AK126839	CCDS47437.1	6p21.1	2009-04-17	2007-10-25	2007-10-25	ENSG00000178233	ENSG00000178233			21315	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 137"", ""transmembrane protein 193"""	C6orf137, TMEM193			Standard	NM_001137560		Approved	bA444E17.5	uc003oxh.2	Q8IW70	OTTHUMG00000014765	ENST00000451188.2:c.1148T>A	chr6.hg19:g.44243711T>A	ENSP00000393161:p.Leu383Gln	36.0	0.0		59.0	18.0	NM_001137560	Q5T9V7	Missense_Mutation	SNP	ENST00000451188.2	hg19	CCDS47437.1	.	.	.	.	.	.	.	.	.	.	T	22.1	4.247836	0.80024	.	.	ENSG00000178233	ENST00000451188	.	.	.	4.38	4.38	0.52667	.	0.000000	0.64402	D	0.000001	T	0.72463	0.3463	M	0.76574	2.34	0.80722	D	1	D	0.76494	0.999	D	0.73380	0.98	T	0.77534	-0.2552	9	0.87932	D	0	.	14.0675	0.64839	0.0:0.0:0.0:1.0	.	383	Q8IW70	T151B_HUMAN	Q	383	.	ENSP00000393161:L383Q	L	+	2	0	TMEM151B	44351689	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.629000	0.83207	1.973000	0.57446	0.374000	0.22700	CTG	.	.		0.716	TMEM151B-001	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040740.2	NM_001039704	
ANKRD66	100287718	hgsc.bcm.edu	37	6	46721651	46721651	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr6:46721651T>A	ENST00000565422.1	+	4	526	c.521T>A	c.(520-522)aTc>aAc	p.I174N	ANKRD66_ENST00000536046.1_Missense_Mutation_p.I145N	NM_001162435.2	NP_001155907.2	B4E2M5	ANR66_HUMAN	ankyrin repeat domain 66	174																	ATTGCACAGATCTATGGACAG	0.453																																					p.I174N		Atlas-SNP	.											.	.	.	.	0			c.T521A						.						58.0	51.0	53.0					6																	46721651		692	1591	2283	SO:0001583	missense	100287718	exon4			CACAGATCTATGG	AK304342	CCDS59024.1	6p12.3	2013-01-11			ENSG00000230062	ENSG00000230062		"""Ankyrin repeat domain containing"""	44669	protein-coding gene	gene with protein product							Standard	NM_001162435		Approved		uc011dwf.2	B4E2M5	OTTHUMG00000014791	ENST00000565422.1:c.521T>A	chr6.hg19:g.46721651T>A	ENSP00000454770:p.Ile174Asn	95.0	0.0		190.0	101.0	NM_001162435		Missense_Mutation	SNP	ENST00000565422.1	hg19	CCDS59024.1																																																																																			.	.		0.453	ANKRD66-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000432045.1	NM_001162435	
GPR116	221395	hgsc.bcm.edu	37	6	46826559	46826559	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr6:46826559C>A	ENST00000283296.7	-	17	3369	c.3081G>T	c.(3079-3081)ttG>ttT	p.L1027F	GPR116_ENST00000545669.1_Missense_Mutation_p.L456F|GPR116_ENST00000362015.4_Missense_Mutation_p.L1027F|GPR116_ENST00000456426.2_Missense_Mutation_p.L885F|GPR116_ENST00000265417.7_Missense_Mutation_p.L1027F	NM_001098518.1	NP_001091988.1	Q8IZF2	GP116_HUMAN	G protein-coupled receptor 116	1027					energy reserve metabolic process (GO:0006112)|fat cell differentiation (GO:0045444)|G-protein coupled receptor signaling pathway (GO:0007186)|glucose homeostasis (GO:0042593)|neuropeptide signaling pathway (GO:0007218)|regulation of lipid metabolic process (GO:0019216)|surfactant homeostasis (GO:0043129)	cell surface (GO:0009986)|cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(2)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|lung(21)|ovary(1)|pancreas(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	59			Lung(136;0.192)			GACAGGCTGCCAAGCTCAAGA	0.507																																					p.L1027F	NSCLC(59;410 1274 8751 36715 50546)	Atlas-SNP	.											GPR116,right_lower_lobe,carcinoma,0,1	GPR116	133	.	0			c.G3081T						.						46.0	48.0	47.0					6																	46826559		2203	4300	6503	SO:0001583	missense	221395	exon17			GGCTGCCAAGCTC	AB018301	CCDS4919.1	6p12.3	2014-08-08			ENSG00000069122	ENSG00000069122		"""-"", ""GPCR / Class B : Orphans"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	19030	protein-coding gene	gene with protein product						12435584	Standard	NM_001098518		Approved	DKFZp564O1923, KIAA0758	uc003oyo.3	Q8IZF2	OTTHUMG00000014793	ENST00000283296.7:c.3081G>T	chr6.hg19:g.46826559C>A	ENSP00000283296:p.Leu1027Phe	100.0	1.0		148.0	42.0	NM_015234	O94858|Q5TF06|Q6RGN2|Q86SP0|Q9Y3Z2	Missense_Mutation	SNP	ENST00000283296.7	hg19	CCDS4919.1	.	.	.	.	.	.	.	.	.	.	C	16.59	3.164409	0.57476	.	.	ENSG00000069122	ENST00000452370;ENST00000283296;ENST00000362015;ENST00000456426;ENST00000545557;ENST00000265417;ENST00000545669	T;T;T;T;T	0.70631	-0.5;-0.5;-0.5;-0.5;-0.5	5.61	-0.631	0.11526	GPCR, family 2-like (1);	0.000000	0.47093	D	0.000246	T	0.80773	0.4687	M	0.90483	3.12	0.46927	D	0.999251	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;1.0;1.0;0.999;1.0	D	0.84268	0.0487	10	0.87932	D	0	-15.4006	12.83	0.57740	0.0:0.6171:0.0:0.3829	.	456;582;1027;885;1027	F5GWK9;B4DTV3;E9PBS6;Q8IZF2-3;Q8IZF2	.;.;.;.;GP116_HUMAN	F	1027;1027;1027;885;398;1027;456	ENSP00000283296:L1027F;ENSP00000354563:L1027F;ENSP00000412866:L885F;ENSP00000265417:L1027F;ENSP00000441581:L456F	ENSP00000265417:L1027F	L	-	3	2	GPR116	46934518	1.000000	0.71417	0.995000	0.50966	0.883000	0.51084	0.715000	0.25822	-0.102000	0.12197	0.650000	0.86243	TTG	.	.		0.507	GPR116-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040806.2	NM_015234	
GPR110	266977	hgsc.bcm.edu	37	6	46976727	46976727	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr6:46976727T>A	ENST00000371253.2	-	11	2659	c.2444A>T	c.(2443-2445)cAg>cTg	p.Q815L	GPR110_ENST00000449332.2_5'UTR|GPR110_ENST00000283297.5_Missense_Mutation_p.Q618L	NM_153840.2	NP_722582.2	Q5T601	GP110_HUMAN	G protein-coupled receptor 110	815					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|liver(2)|lung(6)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	29						AGCCAGATTCTGGCTGTCCAC	0.468																																					p.Q815L		Atlas-SNP	.											.	GPR110	102	.	0			c.A2444T						.						57.0	60.0	59.0					6																	46976727		2203	4300	6503	SO:0001583	missense	266977	exon11			AGATTCTGGCTGT	AB083618	CCDS4920.1, CCDS34471.1	6p21.1	2014-08-08			ENSG00000153292	ENSG00000153292		"""-"", ""GPCR / Class B : Orphans"""	18990	protein-coding gene	gene with protein product						12435584, 14623098	Standard	XM_005249006		Approved	hGPCR36, PGR19	uc003oyt.3	Q5T601	OTTHUMG00000014795	ENST00000371253.2:c.2444A>T	chr6.hg19:g.46976727T>A	ENSP00000360299:p.Gln815Leu	275.0	0.0		457.0	122.0	NM_153840	Q5KU15|Q5T5Z9|Q5T600|Q86SM1|Q8IXE3|Q8IZF8|Q96DQ1|Q9H615	Missense_Mutation	SNP	ENST00000371253.2	hg19	CCDS34471.1	.	.	.	.	.	.	.	.	.	.	T	12.70	2.015521	0.35511	.	.	ENSG00000153292	ENST00000371253;ENST00000283297	T;T	0.41065	1.01;1.01	5.9	3.48	0.39840	GPCR, family 2-like (1);	0.345458	0.25247	N	0.032044	T	0.15046	0.0363	L	0.49778	1.585	0.09310	N	1	B	0.17667	0.023	B	0.17979	0.02	T	0.22243	-1.0222	10	0.35671	T	0.21	0.0443	5.8397	0.18627	0.1192:0.1788:0.0:0.702	.	815	Q5T601	GP110_HUMAN	L	815;618	ENSP00000360299:Q815L;ENSP00000283297:Q618L	ENSP00000283297:Q618L	Q	-	2	0	GPR110	47084686	0.001000	0.12720	0.271000	0.24616	0.773000	0.43773	0.199000	0.17237	0.468000	0.27243	0.528000	0.53228	CAG	.	.		0.468	GPR110-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040810.2	NM_153840	
FAM83B	222584	hgsc.bcm.edu	37	6	54804890	54804890	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr6:54804890A>T	ENST00000306858.7	+	5	1237	c.1121A>T	c.(1120-1122)cAg>cTg	p.Q374L		NM_001010872.1	NP_001010872.1	Q5T0W9	FA83B_HUMAN	family with sequence similarity 83, member B	374										autonomic_ganglia(1)|breast(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(6)|lung(28)|ovary(6)|prostate(6)|skin(6)|upper_aerodigestive_tract(1)	71	Lung NSC(77;0.0178)|Renal(3;0.122)					GCAATACGTCAGTTTCAACCC	0.373																																					p.Q374L		Atlas-SNP	.											.	FAM83B	186	.	0			c.A1121T						.						68.0	67.0	67.0					6																	54804890		2203	4300	6503	SO:0001583	missense	222584	exon5			TACGTCAGTTTCA	AK055204	CCDS34479.1	6p12.1	2014-03-13	2006-03-23	2006-03-23	ENSG00000168143	ENSG00000168143			21357	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 143"""	C6orf143		22886302	Standard	NM_001010872		Approved	FLJ30642	uc003pck.4	Q5T0W9	OTTHUMG00000014899	ENST00000306858.7:c.1121A>T	chr6.hg19:g.54804890A>T	ENSP00000304078:p.Gln374Leu	239.0	0.0		409.0	95.0	NM_001010872	Q2M1P3|Q96DQ2	Missense_Mutation	SNP	ENST00000306858.7	hg19	CCDS34479.1	.	.	.	.	.	.	.	.	.	.	A	1.169	-0.641448	0.03531	.	.	ENSG00000168143	ENST00000306858	T	0.07800	3.16	5.33	2.84	0.33178	.	0.307924	0.32608	N	0.005862	T	0.03564	0.0102	M	0.62723	1.935	0.30000	N	0.816145	B	0.27498	0.18	B	0.26614	0.071	T	0.34304	-0.9834	10	0.26408	T	0.33	-0.2789	12.3569	0.55180	0.7329:0.2671:0.0:0.0	.	374	Q5T0W9	FA83B_HUMAN	L	374	ENSP00000304078:Q374L	ENSP00000304078:Q374L	Q	+	2	0	FAM83B	54912849	0.994000	0.37717	0.939000	0.37840	0.071000	0.16799	1.942000	0.40243	0.379000	0.24794	0.402000	0.26972	CAG	.	.		0.373	FAM83B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040994.1	XM_294139	
DST	667	hgsc.bcm.edu	37	6	56328485	56328485	+	Nonsense_Mutation	SNP	G	G	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr6:56328485G>A	ENST00000361203.3	-	96	21884	c.21877C>T	c.(21877-21879)Cga>Tga	p.R7293*	DST_ENST00000312431.6_3'UTR|DST_ENST00000370754.5_Nonsense_Mutation_p.R7582*|DST_ENST00000370769.4_Nonsense_Mutation_p.R7404*|DST_ENST00000421834.2_Nonsense_Mutation_p.R5289*|DST_ENST00000370788.2_Nonsense_Mutation_p.R5207*|DST_ENST00000244364.6_Nonsense_Mutation_p.R4966*|DST_ENST00000446842.2_Nonsense_Mutation_p.R7078*			Q03001	DYST_HUMAN	dystonin	7402	GAR. {ECO:0000255|PROSITE- ProRule:PRU00792}.				axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cytoplasmic microtubule organization (GO:0031122)|cytoskeleton organization (GO:0007010)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|maintenance of cell polarity (GO:0030011)|microtubule cytoskeleton organization (GO:0000226)|regulation of microtubule polymerization or depolymerization (GO:0031110)|response to wounding (GO:0009611)|retrograde axon cargo transport (GO:0008090)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integral component of membrane (GO:0016021)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|neurofilament cytoskeleton (GO:0060053)|nucleus (GO:0005634)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|microtubule plus-end binding (GO:0051010)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)			NS(1)|breast(5)|central_nervous_system(8)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(43)|ovary(7)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	105	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			CCTCGGGGTCGGAAAGCAGCC	0.562																																					p.R4966X		Atlas-SNP	.											.	DST	1427	.	0			c.C14896T						.						132.0	140.0	137.0					6																	56328485		2006	4153	6159	SO:0001587	stop_gained	667	exon81			GGGGTCGGAAAGC	M22942, M69225	CCDS4959.1, CCDS47443.1, CCDS75474.1	6p12.1	2013-01-10	2004-06-25	2004-07-01	ENSG00000151914	ENSG00000151914		"""EF-hand domain containing"""	1090	protein-coding gene	gene with protein product		113810	"""bullous pemphigoid antigen 1, 230/240kDa"""	BPAG1		2461961, 2276744	Standard	NM_001144770		Approved	BP240, KIAA0728, FLJ21489, FLJ13425, FLJ32235, FLJ30627, CATX-15, BPA, MACF2	uc021zba.2	Q03001	OTTHUMG00000014913	ENST00000361203.3:c.21877C>T	chr6.hg19:g.56328485G>A	ENSP00000354508:p.Arg7293*	83.0	0.0		168.0	30.0	NM_015548	B7Z3H1|O94833|Q12825|Q13266|Q13267|Q13775|Q5TBT0|Q5TBT2|Q5TF23|Q5TF24|Q8N1T8|Q8N8J3|Q8WXK8|Q8WXK9|Q96AK9|Q96DQ5|Q96J76|Q96QT5|Q9H555|Q9UGD7|Q9UGD8|Q9UN10	Nonsense_Mutation	SNP	ENST00000361203.3	hg19		.	.	.	.	.	.	.	.	.	.	G	59	34.662893	0.99982	.	.	ENSG00000151914	ENST00000244364;ENST00000370754;ENST00000370769;ENST00000421834;ENST00000446842;ENST00000370788;ENST00000361203	.	.	.	5.82	5.82	0.92795	.	0.000000	0.45606	D	0.000354	.	.	.	.	.	.	0.80722	A	1.000000	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	16.3941	0.83550	0.0:0.0:0.8679:0.1321	.	.	.	.	X	4966;7582;7404;5289;7078;5207;7293	.	ENSP00000244364:R4966X	R	-	1	2	DST	56436444	1.000000	0.71417	1.000000	0.80357	0.953000	0.61014	5.531000	0.67148	2.748000	0.94277	0.655000	0.94253	CGA	.	.		0.562	DST-004	NOVEL	not_organism_supported|basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000041021.3	NM_001723	
DST	667	hgsc.bcm.edu	37	6	56497806	56497806	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr6:56497806C>A	ENST00000361203.3	-	24	3025	c.3018G>T	c.(3016-3018)caG>caT	p.Q1006H	DST_ENST00000312431.6_Missense_Mutation_p.Q1006H|DST_ENST00000370765.6_Missense_Mutation_p.Q680H|DST_ENST00000518935.1_Missense_Mutation_p.Q680H|DST_ENST00000370754.5_Missense_Mutation_p.Q1184H|DST_ENST00000370769.4_Missense_Mutation_p.Q1006H|DST_ENST00000421834.2_Missense_Mutation_p.Q1006H|DST_ENST00000370788.2_Missense_Mutation_p.Q1006H|DST_ENST00000244364.6_Missense_Mutation_p.Q680H|DST_ENST00000446842.2_Missense_Mutation_p.Q680H			Q03001	DYST_HUMAN	dystonin	1006					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cytoplasmic microtubule organization (GO:0031122)|cytoskeleton organization (GO:0007010)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|maintenance of cell polarity (GO:0030011)|microtubule cytoskeleton organization (GO:0000226)|regulation of microtubule polymerization or depolymerization (GO:0031110)|response to wounding (GO:0009611)|retrograde axon cargo transport (GO:0008090)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integral component of membrane (GO:0016021)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|neurofilament cytoskeleton (GO:0060053)|nucleus (GO:0005634)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|microtubule plus-end binding (GO:0051010)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)			NS(1)|breast(5)|central_nervous_system(8)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(43)|ovary(7)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	105	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			TTAGAACTTGCTGATGTTCAC	0.373																																					p.Q680H		Atlas-SNP	.											.	DST	1427	.	0			c.G2040T						.						101.0	99.0	100.0					6																	56497806		2203	4300	6503	SO:0001583	missense	667	exon14			AACTTGCTGATGT	M22942, M69225	CCDS4959.1, CCDS47443.1, CCDS75474.1	6p12.1	2013-01-10	2004-06-25	2004-07-01	ENSG00000151914	ENSG00000151914		"""EF-hand domain containing"""	1090	protein-coding gene	gene with protein product		113810	"""bullous pemphigoid antigen 1, 230/240kDa"""	BPAG1		2461961, 2276744	Standard	NM_001144770		Approved	BP240, KIAA0728, FLJ21489, FLJ13425, FLJ32235, FLJ30627, CATX-15, BPA, MACF2	uc021zba.2	Q03001	OTTHUMG00000014913	ENST00000361203.3:c.3018G>T	chr6.hg19:g.56497806C>A	ENSP00000354508:p.Gln1006His	94.0	0.0		136.0	26.0	NM_001723	B7Z3H1|O94833|Q12825|Q13266|Q13267|Q13775|Q5TBT0|Q5TBT2|Q5TF23|Q5TF24|Q8N1T8|Q8N8J3|Q8WXK8|Q8WXK9|Q96AK9|Q96DQ5|Q96J76|Q96QT5|Q9H555|Q9UGD7|Q9UGD8|Q9UN10	Missense_Mutation	SNP	ENST00000361203.3	hg19		.	.	.	.	.	.	.	.	.	.	C	17.12	3.309168	0.60414	.	.	ENSG00000151914	ENST00000244364;ENST00000370754;ENST00000370769;ENST00000421834;ENST00000446842;ENST00000312431;ENST00000370788;ENST00000361203;ENST00000439203;ENST00000520645;ENST00000370765;ENST00000518935	T;T;T;T;T;T;T;T;T;T;T;T	0.37584	1.19;1.19;1.19;1.19;1.19;1.19;1.19;1.19;1.19;1.19;1.19;1.19	5.69	0.844	0.18943	.	0.000000	0.51477	D	0.000086	T	0.25082	0.0609	N	0.21617	0.685	0.32732	N	0.508842	D;D;D;B;B;D;D;D	0.89917	0.998;0.996;0.998;0.093;0.178;0.997;0.998;1.0	D;D;D;B;B;D;D;D	0.91635	0.993;0.986;0.993;0.028;0.234;0.991;0.993;0.999	T	0.05971	-1.0853	9	0.25106	T	0.35	.	10.9933	0.47561	0.0:0.6812:0.0:0.3188	.	1006;1006;1184;680;680;680;1006;680	Q5TBT1;E7ERU2;E9PEB9;Q6P0N6;Q03001-3;Q03001-9;Q03001;Q03001-8	.;.;.;.;.;.;DYST_HUMAN;.	H	680;1184;1006;1006;680;1006;1006;1006;680;1046;680;680	ENSP00000244364:Q680H;ENSP00000359790:Q1184H;ENSP00000359805:Q1006H;ENSP00000400883:Q1006H;ENSP00000393645:Q680H;ENSP00000307959:Q1006H;ENSP00000359824:Q1006H;ENSP00000354508:Q1006H;ENSP00000404924:Q680H;ENSP00000431030:Q1046H;ENSP00000359801:Q680H;ENSP00000431003:Q680H	ENSP00000244364:Q680H	Q	-	3	2	DST	56605765	1.000000	0.71417	0.996000	0.52242	0.991000	0.79684	1.341000	0.33907	0.154000	0.19237	-0.141000	0.14075	CAG	.	.		0.373	DST-004	NOVEL	not_organism_supported|basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000041021.3	NM_001723	
KIAA1586	57691	hgsc.bcm.edu	37	6	56917944	56917944	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr6:56917944A>G	ENST00000370733.4	+	4	854	c.647A>G	c.(646-648)cAt>cGt	p.H216R	KIAA1586_ENST00000545356.1_Missense_Mutation_p.H189R	NM_020931.2	NP_065982.1	Q9HCI6	K1586_HUMAN	KIAA1586	216							nucleic acid binding (GO:0003676)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(9)|skin(1)	18	Lung NSC(77;0.0969)		LUSC - Lung squamous cell carcinoma(124;0.0785)|Lung(124;0.13)			TCTAAAGCCCATGGTAAAATT	0.294																																					p.H216R		Atlas-SNP	.											.	KIAA1586	59	.	0			c.A647G						.						45.0	48.0	47.0					6																	56917944		2201	4298	6499	SO:0001583	missense	57691	exon4			AAGCCCATGGTAA	AB046806	CCDS34480.1, CCDS69138.1	6p12.1	2014-03-27			ENSG00000168116	ENSG00000168116			21360	protein-coding gene	gene with protein product						10997877	Standard	NM_001286274		Approved		uc003pdj.3	Q9HCI6	OTTHUMG00000014915	ENST00000370733.4:c.647A>G	chr6.hg19:g.56917944A>G	ENSP00000359768:p.His216Arg	128.0	0.0		260.0	61.0	NM_020931	A8K4M3|Q8IW25	Missense_Mutation	SNP	ENST00000370733.4	hg19	CCDS34480.1	.	.	.	.	.	.	.	.	.	.	a	7.582	0.668909	0.14776	.	.	ENSG00000168116	ENST00000370733;ENST00000545356	T;T	0.45276	0.93;0.9	4.02	1.49	0.22878	.	.	.	.	.	T	0.10723	0.0262	N	0.08118	0	0.21290	N	0.999735	P;P	0.51537	0.946;0.946	P;P	0.47603	0.551;0.551	T	0.04752	-1.0929	9	0.52906	T	0.07	.	3.2528	0.06820	0.6829:0.0:0.1135:0.2036	.	189;216	F5H2N6;Q9HCI6	.;K1586_HUMAN	R	216;189	ENSP00000359768:H216R;ENSP00000445507:H189R	ENSP00000359768:H216R	H	+	2	0	KIAA1586	57025903	0.999000	0.42202	0.956000	0.39512	0.007000	0.05969	2.587000	0.46128	0.195000	0.20347	-0.456000	0.05471	CAT	.	.		0.294	KIAA1586-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000041033.1	NM_020931	
PHF3	23469	hgsc.bcm.edu	37	6	64389990	64389990	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr6:64389990A>T	ENST00000262043.3	+	3	674	c.334A>T	c.(334-336)Agg>Tgg	p.R112W	PHF3_ENST00000393387.1_Missense_Mutation_p.R112W|PHF3_ENST00000509330.1_Missense_Mutation_p.R112W			Q92576	PHF3_HUMAN	PHD finger protein 3	112					multicellular organismal development (GO:0007275)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	zinc ion binding (GO:0008270)			breast(7)|cervix(2)|endometrium(8)|kidney(7)|large_intestine(18)|lung(21)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(6)	75	all_cancers(3;0.0241)|all_epithelial(2;0.00306)|Lung NSC(77;0.121)		LUSC - Lung squamous cell carcinoma(74;0.0644)|Lung(124;0.148)			TTTACCTAACAGGAACTTAAG	0.368																																					p.R112W	GBM(135;136 1820 29512 34071 46235)	Atlas-SNP	.											.	PHF3	191	.	0			c.A334T						.						148.0	147.0	147.0					6																	64389990		2203	4300	6503	SO:0001583	missense	23469	exon2			CCTAACAGGAACT	AF091622	CCDS4966.1	6q12	2013-09-24			ENSG00000118482	ENSG00000118482		"""Zinc fingers, PHD-type"""	8921	protein-coding gene	gene with protein product		607789				11856869	Standard	XM_005248701		Approved		uc003pep.1	Q92576	OTTHUMG00000014952	ENST00000262043.3:c.334A>T	chr6.hg19:g.64389990A>T	ENSP00000262043:p.Arg112Trp	149.0	0.0		124.0	60.0	NM_015153	A3KFI8|Q14CR5|Q5CZI1|Q5T1T6|Q9NQ16|Q9UI45	Missense_Mutation	SNP	ENST00000262043.3	hg19	CCDS4966.1	.	.	.	.	.	.	.	.	.	.	A	16.01	3.001226	0.54254	.	.	ENSG00000118482	ENST00000481385;ENST00000262043;ENST00000494284;ENST00000509330;ENST00000393387;ENST00000514822	T;T;T;T;T	0.60424	1.17;1.55;1.22;0.19;1.55	5.34	5.34	0.76211	.	0.000000	0.44285	D	0.000464	T	0.66147	0.2760	M	0.62723	1.935	0.39866	D	0.973446	D;D	0.89917	1.0;1.0	D;D	0.87578	0.995;0.998	T	0.71474	-0.4582	10	0.87932	D	0	-16.0157	12.6212	0.56603	0.8624:0.1376:0.0:0.0	.	112;112	Q92576;D6R9X2	PHF3_HUMAN;.	W	24;112;65;112;112;42	ENSP00000425227:R24W;ENSP00000262043:R112W;ENSP00000424078:R65W;ENSP00000422841:R112W;ENSP00000377048:R112W	ENSP00000262043:R112W	R	+	1	2	PHF3	64447949	1.000000	0.71417	1.000000	0.80357	0.950000	0.60333	4.818000	0.62657	2.242000	0.73789	0.482000	0.46254	AGG	.	.		0.368	PHF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041086.2		
RIMS1	22999	hgsc.bcm.edu	37	6	72892030	72892030	+	Missense_Mutation	SNP	C	C	G			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr6:72892030C>G	ENST00000521978.1	+	6	856	c.856C>G	c.(856-858)Ctg>Gtg	p.L286V	RIMS1_ENST00000520567.1_Missense_Mutation_p.L286V|RIMS1_ENST00000518273.1_Missense_Mutation_p.L286V|RIMS1_ENST00000491071.2_Missense_Mutation_p.L286V|RIMS1_ENST00000522291.1_Missense_Mutation_p.L286V|RIMS1_ENST00000517960.1_Missense_Mutation_p.L286V|RIMS1_ENST00000348717.5_Missense_Mutation_p.L286V|RIMS1_ENST00000264839.7_Missense_Mutation_p.L286V	NM_014989.5	NP_055804.2	Q86UR5	RIMS1_HUMAN	regulating synaptic membrane exocytosis 1	286					calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|glutamate secretion (GO:0014047)|intracellular protein transport (GO:0006886)|membrane fusion (GO:0061025)|neurotransmitter secretion (GO:0007269)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of gene expression (GO:0010628)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|protein complex assembly (GO:0006461)|regulated secretory pathway (GO:0045055)|regulation of catalytic activity (GO:0050790)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of neurotransmitter secretion (GO:0046928)|response to stimulus (GO:0050896)|secretion (GO:0046903)|synaptic transmission (GO:0007268)|synaptic vesicle exocytosis (GO:0016079)|visual perception (GO:0007601)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|Rab GTPase binding (GO:0017137)|small GTPase regulator activity (GO:0005083)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(25)|liver(4)|lung(35)|ovary(9)|pancreas(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	102		all_epithelial(107;0.179)|all_hematologic(105;0.212)				CAAAGGAGCCCTGAAGAGCGA	0.527																																					p.L286V		Atlas-SNP	.											.	RIMS1	278	.	0			c.C856G						.						34.0	39.0	38.0					6																	72892030		1860	4105	5965	SO:0001583	missense	22999	exon6			GGAGCCCTGAAGA	AB002338	CCDS47449.1, CCDS55029.1, CCDS55030.1, CCDS55031.1, CCDS55032.1, CCDS55033.1	6q12-q13	2008-10-16	2002-06-12	2002-06-14	ENSG00000079841	ENSG00000079841			17282	protein-coding gene	gene with protein product	"""Rab3-interacting molecule"""	606629	"""RAB3 interacting protein 2"""	RAB3IP2, CORD7		9205841, 11438518	Standard	NM_001168407		Approved	RIM, KIAA0340, RIM1	uc003pga.4	Q86UR5	OTTHUMG00000015009	ENST00000521978.1:c.856C>G	chr6.hg19:g.72892030C>G	ENSP00000428417:p.Leu286Val	295.0	0.0		279.0	128.0	NM_014989	A7MBN6|B7Z2M0|B7Z2Q9|B7Z3S3|B7Z6S2|E7EX08|E9PCB7|E9PCZ1|E9PF48|E9PHF5|E9PHR1|O15048|Q5JY21|Q5JY25|Q5SZK1|Q8TDY9|Q8TDZ5|Q9HBA1|Q9HBA2|Q9HBA3|Q9HBA4|Q9HBA5|Q9HBA6	Missense_Mutation	SNP	ENST00000521978.1	hg19	CCDS47449.1	.	.	.	.	.	.	.	.	.	.	C	3.492	-0.103609	0.06967	.	.	ENSG00000079841	ENST00000491071;ENST00000350827;ENST00000352008;ENST00000348717;ENST00000349908;ENST00000346609;ENST00000264839;ENST00000517960;ENST00000518273;ENST00000520567;ENST00000522291;ENST00000521978	T;T;T;T;T;T;T;T	0.13778	2.56;2.71;2.64;2.71;2.71;2.71;2.71;2.63	5.28	3.48	0.39840	.	0.839746	0.10019	N	0.726184	T	0.03915	0.0110	L	0.36672	1.1	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.38499	-0.9658	10	0.31617	T	0.26	3.3874	8.7095	0.34376	0.0:0.7562:0.0:0.2438	.	286	Q86UR5	RIMS1_HUMAN	V	286	ENSP00000430101:L286V;ENSP00000275037:L286V;ENSP00000264839:L286V;ENSP00000429959:L286V;ENSP00000430408:L286V;ENSP00000430502:L286V;ENSP00000430932:L286V;ENSP00000428417:L286V	ENSP00000264839:L286V	L	+	1	2	RIMS1	72948751	0.000000	0.05858	0.004000	0.12327	0.340000	0.28889	-0.160000	0.10041	1.238000	0.43771	0.462000	0.41574	CTG	.	.		0.527	RIMS1-011	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374968.1		
TTK	7272	hgsc.bcm.edu	37	6	80746315	80746315	+	Splice_Site	SNP	A	A	G			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr6:80746315A>G	ENST00000369798.2	+	17	2159	c.2048A>G	c.(2047-2049)cAg>cGg	p.Q683R	TTK_ENST00000509894.1_Splice_Site_p.Q682R|TTK_ENST00000230510.3_Splice_Site_p.Q682R	NM_001166691.1|NM_003318.4	NP_001160163.1|NP_003309.2	P33981	TTK_HUMAN	TTK protein kinase	683	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				chromosome separation (GO:0051304)|mitotic spindle assembly checkpoint (GO:0007094)|mitotic spindle organization (GO:0007052)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell proliferation (GO:0008284)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|spindle organization (GO:0007051)	membrane (GO:0016020)|spindle (GO:0005819)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)			endometrium(4)|kidney(2)|large_intestine(12)|lung(22)|ovary(7)|pancreas(1)|prostate(1)|stomach(3)|urinary_tract(1)	53		all_cancers(76;0.00177)|Acute lymphoblastic leukemia(125;1.24e-05)|all_hematologic(105;0.00223)|all_epithelial(107;0.2)		BRCA - Breast invasive adenocarcinoma(397;0.0321)		AAAGATTCTCAGGTAAGACTT	0.328																																					p.Q683R		Atlas-SNP	.											.	TTK	199	.	0			c.A2048G						.						109.0	104.0	106.0					6																	80746315		2202	4299	6501	SO:0001630	splice_region_variant	7272	exon17			ATTCTCAGGTAAG		CCDS4993.1, CCDS55040.1	6q14.1	2014-04-07			ENSG00000112742	ENSG00000112742			12401	protein-coding gene	gene with protein product	"""cancer/testis antigen 96"", ""monopolar spindle 1 kinase"""	604092				1639825	Standard	NM_003318		Approved	MPS1, MPS1L1, CT96, MPH1	uc003pjc.3	P33981	OTTHUMG00000015088	ENST00000369798.2:c.2049+1A>G	chr6.hg19:g.80746315A>G		87.0	0.0		104.0	39.0	NM_003318	A8K8U5|B2RDW2|E1P543|Q15272|Q5TCS0|Q9BW51|Q9NTM0	Missense_Mutation	SNP	ENST00000369798.2	hg19	CCDS4993.1	.	.	.	.	.	.	.	.	.	.	A	18.50	3.638097	0.67130	.	.	ENSG00000112742	ENST00000509894;ENST00000230510;ENST00000369798	T;T;T	0.64260	-0.09;-0.09;-0.09	6.08	6.08	0.98989	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.41949	0.1181	N	0.11789	0.175	0.80722	D	1	B;B	0.30211	0.273;0.269	B;B	0.41619	0.361;0.224	T	0.53236	-0.8467	10	0.49607	T	0.09	.	15.8323	0.78764	1.0:0.0:0.0:0.0	.	683;682	P33981;A8K8U5	TTK_HUMAN;.	R	682;682;683	ENSP00000422936:Q682R;ENSP00000230510:Q682R;ENSP00000358813:Q683R	ENSP00000230510:Q682R	Q	+	2	0	TTK	80803034	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.813000	0.69201	2.333000	0.79357	0.482000	0.46254	CAG	.	.		0.328	TTK-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000041316.2		Missense_Mutation
SPACA1	81833	hgsc.bcm.edu	37	6	88757710	88757710	+	Silent	SNP	G	G	A	rs376457887		TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr6:88757710G>A	ENST00000237201.1	+	1	204	c.87G>A	c.(85-87)ggG>ggA	p.G29G		NM_030960.2	NP_112222.1	Q9HBV2	SACA1_HUMAN	sperm acrosome associated 1	29					acrosome assembly (GO:0001675)	acrosomal membrane (GO:0002080)|integral component of membrane (GO:0016021)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(12)|skin(1)|upper_aerodigestive_tract(2)	20		all_cancers(76;8.24e-09)|Acute lymphoblastic leukemia(125;2.15e-10)|Prostate(29;4.11e-10)|all_hematologic(105;1.08e-06)|all_epithelial(107;0.00011)		BRCA - Breast invasive adenocarcinoma(108;0.11)		CCGCGCGCGGGACCAACGTCA	0.706																																					p.G29G		Atlas-SNP	.											.	SPACA1	49	.	0			c.G87A						.	G		0,4334		0,0,2167	24.0	18.0	20.0		87	0.8	0.0	6		20	1,8505		0,1,4252	no	coding-synonymous	SPACA1	NM_030960.2		0,1,6419	AA,AG,GG		0.0118,0.0,0.0078		29/295	88757710	1,12839	2167	4253	6420	SO:0001819	synonymous_variant	81833	exon1			GCGCGGGACCAAC	AF203447	CCDS5014.1	6q15	2012-09-20			ENSG00000118434	ENSG00000118434			14967	protein-coding gene	gene with protein product		612739					Standard	NM_030960		Approved	SAMP32	uc003pmn.3	Q9HBV2	OTTHUMG00000015183	ENST00000237201.1:c.87G>A	chr6.hg19:g.88757710G>A		114.0	0.0		119.0	51.0	NM_030960		Silent	SNP	ENST00000237201.1	hg19	CCDS5014.1																																																																																			.	.		0.706	SPACA1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041459.1		
RTN4IP1	84816	hgsc.bcm.edu	37	6	107076839	107076839	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr6:107076839A>G	ENST00000369063.3	-	1	523	c.58T>C	c.(58-60)Tgg>Cgg	p.W20R	QRSL1_ENST00000369046.4_5'Flank|RTN4IP1_ENST00000539449.1_Missense_Mutation_p.W20R|QRSL1_ENST00000369044.1_5'Flank	NM_032730.4	NP_116119.2	Q8WWV3	RT4I1_HUMAN	reticulon 4 interacting protein 1	20						mitochondrion (GO:0005739)	oxidoreductase activity (GO:0016491)|zinc ion binding (GO:0008270)			breast(1)|kidney(3)|large_intestine(2)|lung(6)|urinary_tract(1)	13	Breast(9;0.0107)|all_epithelial(6;0.14)	all_cancers(87;9.45e-05)|Acute lymphoblastic leukemia(125;2.13e-07)|all_hematologic(75;5.28e-06)|all_epithelial(87;0.0144)	Epithelial(6;0.000873)|all cancers(7;0.00363)|BRCA - Breast invasive adenocarcinoma(8;0.00721)|OV - Ovarian serous cystadenocarcinoma(5;0.0394)	all cancers(137;0.113)|BRCA - Breast invasive adenocarcinoma(108;0.127)|Epithelial(106;0.144)		TTGCTTCTCCAGAAGCAAACC	0.413																																					p.W20R		Atlas-SNP	.											.	RTN4IP1	31	.	0			c.T58C						.						87.0	84.0	85.0					6																	107076839		2203	4300	6503	SO:0001583	missense	84816	exon1			TTCTCCAGAAGCA	AF336861	CCDS5056.1	6q21	2008-02-05			ENSG00000130347	ENSG00000130347			18647	protein-coding gene	gene with protein product		610502					Standard	NM_032730		Approved	NIMP	uc003prj.3	Q8WWV3	OTTHUMG00000015304	ENST00000369063.3:c.58T>C	chr6.hg19:g.107076839A>G	ENSP00000358059:p.Trp20Arg	78.0	0.0		76.0	36.0	NM_032730	Q8N9B3|Q8WZ66|Q9BRA4	Missense_Mutation	SNP	ENST00000369063.3	hg19	CCDS5056.1	.	.	.	.	.	.	.	.	.	.	A	12.97	2.096137	0.36952	.	.	ENSG00000130347	ENST00000539449;ENST00000369063	T;T	0.44083	0.93;2.0	5.85	-0.778	0.10977	.	0.785180	0.12360	N	0.475779	T	0.10208	0.0250	L	0.36672	1.1	0.23192	N	0.998141	B;B	0.06786	0.001;0.0	B;B	0.06405	0.002;0.0	T	0.23511	-1.0186	10	0.30078	T	0.28	-0.9045	2.7538	0.05288	0.3685:0.4048:0.085:0.1417	.	20;20	G3V1R2;Q8WWV3	.;RT4I1_HUMAN	R	20	ENSP00000444261:W20R;ENSP00000358059:W20R	ENSP00000358059:W20R	W	-	1	0	RTN4IP1	107183532	0.997000	0.39634	0.989000	0.46669	0.961000	0.63080	0.417000	0.21214	0.427000	0.26145	0.533000	0.62120	TGG	.	.		0.413	RTN4IP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041673.1		
DSE	29940	hgsc.bcm.edu	37	6	116757673	116757673	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr6:116757673A>T	ENST00000331677.3	+	7	2486	c.2042A>T	c.(2041-2043)cAg>cTg	p.Q681L	DSE_ENST00000537543.1_Missense_Mutation_p.Q700L|DSE_ENST00000452085.3_Missense_Mutation_p.Q681L|DSE_ENST00000359564.2_Missense_Mutation_p.Q681L			Q9UL01	DSE_HUMAN	dermatan sulfate epimerase	681					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	chondroitin-glucuronate 5-epimerase activity (GO:0047757)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|liver(2)|lung(12)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	35		all_cancers(87;0.00019)|all_epithelial(87;0.000416)|Ovarian(999;0.133)|Colorectal(196;0.234)		Epithelial(106;0.00915)|OV - Ovarian serous cystadenocarcinoma(136;0.0149)|GBM - Glioblastoma multiforme(226;0.0189)|all cancers(137;0.0262)		GGAGACTCTCAGCAACTGGAT	0.527																																					p.Q681L		Atlas-SNP	.											.	DSE	98	.	0			c.A2042T						.						102.0	98.0	99.0					6																	116757673		2203	4300	6503	SO:0001583	missense	29940	exon6			ACTCTCAGCAACT	AF098066	CCDS5107.1	6q22	2008-02-05	2007-01-29	2007-01-29	ENSG00000111817	ENSG00000111817	5.1.3.19		21144	protein-coding gene	gene with protein product		605942	"""squamous cell carcinoma antigen recognized by T cells 2"""	SART2		11920522, 16505484	Standard	NM_001080976		Approved	DSEPI	uc003pws.3	Q9UL01	OTTHUMG00000015434	ENST00000331677.3:c.2042A>T	chr6.hg19:g.116757673A>T	ENSP00000332151:p.Gln681Leu	110.0	0.0		118.0	55.0	NM_001080976	Q5R3K6	Missense_Mutation	SNP	ENST00000331677.3	hg19	CCDS5107.1	.	.	.	.	.	.	.	.	.	.	A	9.041	0.989636	0.18966	.	.	ENSG00000111817	ENST00000452085;ENST00000537543;ENST00000331677;ENST00000359564	T;T;T;T	0.62498	0.02;0.02;0.02;0.02	6.01	3.66	0.41972	.	0.287773	0.40469	N	0.001099	T	0.30541	0.0768	L	0.29908	0.895	0.46542	D	0.999093	B;B	0.21905	0.062;0.062	B;B	0.24701	0.055;0.037	T	0.28839	-1.0031	10	0.59425	D	0.04	-5.6812	6.2129	0.20640	0.6777:0.1293:0.193:0.0	.	700;681	B7Z765;Q9UL01	.;DSE_HUMAN	L	681;700;681;681	ENSP00000404049:Q681L;ENSP00000441152:Q700L;ENSP00000332151:Q681L;ENSP00000352567:Q681L	ENSP00000332151:Q681L	Q	+	2	0	DSE	116864366	1.000000	0.71417	0.546000	0.28166	0.558000	0.35554	4.160000	0.58164	1.098000	0.41479	0.528000	0.53228	CAG	.	.		0.527	DSE-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041940.2	NM_013352	
MCM9	254394	hgsc.bcm.edu	37	6	119136767	119136767	+	Silent	SNP	T	T	C			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr6:119136767T>C	ENST00000316316.6	-	13	2938	c.2652A>G	c.(2650-2652)ccA>ccG	p.P884P		NM_017696.2	NP_060166.2	Q9NXL9	MCM9_HUMAN	minichromosome maintenance complex component 9	884					cellular response to DNA damage stimulus (GO:0006974)|DNA replication (GO:0006260)|double-strand break repair via homologous recombination (GO:0000724)|female gamete generation (GO:0007292)	MCM8-MCM9 complex (GO:0097362)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18		all_cancers(87;0.122)|all_epithelial(87;0.179)		GBM - Glioblastoma multiforme(226;0.0676)|OV - Ovarian serous cystadenocarcinoma(136;0.194)		GCATTCTGTCTGGGCTATGTA	0.527																																					p.P884P		Atlas-SNP	.											.	MCM9	73	.	0			c.A2652G						.																																			SO:0001819	synonymous_variant	254394	exon12			TCTGTCTGGGCTA	BC031658	CCDS5121.1, CCDS56447.1	6q22.31	2009-11-16	2007-04-04	2007-04-04	ENSG00000111877	ENSG00000111877			21484	protein-coding gene	gene with protein product		610098	"""minichromosome maintenance deficient domain containing 1"", ""chromosome 6 open reading frame 61"""	MCMDC1, C6orf61		16226853, 15850810, 16495042	Standard	NM_153255		Approved	MGC35304, dJ329L24.3, FLJ20170	uc021zeh.1	Q9NXL9	OTTHUMG00000015468	ENST00000316316.6:c.2652A>G	chr6.hg19:g.119136767T>C		84.0	0.0		47.0	17.0	NM_017696	B4DR30|B9DI77|Q2KHJ0|Q8N5S5|Q9HCV5	Silent	SNP	ENST00000316316.6	hg19	CCDS56447.1																																																																																			.	.		0.527	MCM9-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042005.4	NM_153255	
CLVS2	134829	hgsc.bcm.edu	37	6	123319264	123319264	+	Silent	SNP	T	T	C			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr6:123319264T>C	ENST00000275162.5	+	2	1677	c.342T>C	c.(340-342)taT>taC	p.Y114Y	CLVS2_ENST00000368438.1_Intron	NM_001010852.3	NP_001010852.2	Q5SYC1	CLVS2_HUMAN	clavesin 2	114	CRAL-TRIO. {ECO:0000255|PROSITE- ProRule:PRU00056}.				lysosome organization (GO:0007040)	clathrin-coated vesicle (GO:0030136)|endosome (GO:0005768)|membrane (GO:0016020)|trans-Golgi network (GO:0005802)	phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|transporter activity (GO:0005215)			breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(24)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(2)	40						TGGACCACTATGGCAGGAAGA	0.483																																					p.Y114Y		Atlas-SNP	.											.	CLVS2	79	.	0			c.T342C						.						60.0	57.0	58.0					6																	123319264		2203	4300	6503	SO:0001819	synonymous_variant	134829	exon2			CCACTATGGCAGG	AK095527	CCDS34525.1	6q22.31	2009-10-14	2009-10-14	2009-10-14	ENSG00000146352	ENSG00000146352			23046	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 212"", ""chromosome 6 open reading frame 213"", ""retinaldehyde binding protein 1-like 2"""	C6orf212, C6orf213, RLBP1L2		19651769	Standard	NM_001010852		Approved	bA160A10.4	uc003pzi.1	Q5SYC1	OTTHUMG00000015495	ENST00000275162.5:c.342T>C	chr6.hg19:g.123319264T>C		95.0	0.0		76.0	28.0	NM_001010852	B3KTG5|B4DHL0|C8UZT4|Q5SYC0	Silent	SNP	ENST00000275162.5	hg19	CCDS34525.1																																																																																			.	.		0.483	CLVS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042042.2	NM_001010852	
ENPP3	5169	hgsc.bcm.edu	37	6	132006562	132006562	+	Silent	SNP	A	A	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr6:132006562A>T	ENST00000414305.1	+	14	1507	c.1179A>T	c.(1177-1179)atA>atT	p.I393I	ENPP3_ENST00000357639.3_Silent_p.I393I|ENPP3_ENST00000358229.5_Silent_p.I393I			O14638	ENPP3_HUMAN	ectonucleotide pyrophosphatase/phosphodiesterase 3	393	Phosphodiesterase.				immune response (GO:0006955)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleoside triphosphate catabolic process (GO:0009143)|phosphate-containing compound metabolic process (GO:0006796)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|perinuclear region of cytoplasm (GO:0048471)	metal ion binding (GO:0046872)|NADH pyrophosphatase activity (GO:0035529)|nucleic acid binding (GO:0003676)|nucleoside-triphosphate diphosphatase activity (GO:0047429)|nucleotide diphosphatase activity (GO:0004551)|phosphodiesterase I activity (GO:0004528)|polysaccharide binding (GO:0030247)|scavenger receptor activity (GO:0005044)			NS(1)|breast(2)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(5)|lung(24)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	53	Breast(56;0.0753)			GBM - Glioblastoma multiforme(226;0.0252)|OV - Ovarian serous cystadenocarcinoma(155;0.0511)		TTCCCAGAATAAACTTCTTCT	0.348																																					p.I393I		Atlas-SNP	.											.	ENPP3	117	.	0			c.A1179T						.						132.0	147.0	142.0					6																	132006562		2203	4300	6503	SO:0001819	synonymous_variant	5169	exon13			CAGAATAAACTTC	AF005632	CCDS5148.1	6q22	2010-06-23			ENSG00000154269	ENSG00000154269	3.1.4.1, 3.6.1.9	"""CD molecules"""	3358	protein-coding gene	gene with protein product		602182		PDNP3		9344668	Standard	NM_005021		Approved	PD-IBETA, gp130RB13-6, B10, CD203c	uc003qcv.3	O14638	OTTHUMG00000016292	ENST00000414305.1:c.1179A>T	chr6.hg19:g.132006562A>T		211.0	0.0		186.0	88.0	NM_005021	Q5JTL3	Silent	SNP	ENST00000414305.1	hg19	CCDS5148.1																																																																																			.	.		0.348	ENPP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043627.2		
SYNE1	23345	hgsc.bcm.edu	37	6	152765648	152765648	+	Silent	SNP	G	G	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr6:152765648G>T	ENST00000367255.5	-	30	4336	c.3735C>A	c.(3733-3735)ctC>ctA	p.L1245L	SYNE1_ENST00000413186.2_Silent_p.L1245L|SYNE1_ENST00000448038.1_Silent_p.L1252L|SYNE1_ENST00000367248.3_Silent_p.L1235L|SYNE1_ENST00000341594.5_Silent_p.L1311L|SYNE1_ENST00000367253.4_Silent_p.L1245L|SYNE1_ENST00000423061.1_Silent_p.L1252L|SYNE1_ENST00000265368.4_Silent_p.L1245L	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	1245					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)	p.L1245L(2)|p.L1252L(1)		NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		TTAATTCTTCGAGAGAATTTT	0.348										HNSCC(10;0.0054)																											p.L1252L		Atlas-SNP	.											SYNE1_ENST00000423061,NS,carcinoma,0,3	SYNE1	3227	.	3	Substitution - coding silent(3)	lung(3)	c.C3756A						.						77.0	77.0	77.0					6																	152765648		2203	4300	6503	SO:0001819	synonymous_variant	23345	exon30			TTCTTCGAGAGAA	AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.3735C>A	chr6.hg19:g.152765648G>T		101.0	0.0		60.0	33.0	NM_033071	E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Silent	SNP	ENST00000367255.5	hg19	CCDS5236.2																																																																																			.	.		0.348	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000334755.2	NM_182961	
FNDC1	84624	hgsc.bcm.edu	37	6	159654905	159654905	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr6:159654905G>T	ENST00000297267.9	+	11	3561	c.3361G>T	c.(3361-3363)Gca>Tca	p.A1121S	FNDC1_ENST00000340366.6_Missense_Mutation_p.A1058S	NM_032532.2	NP_115921.2	Q4ZHG4	FNDC1_HUMAN	fibronectin type III domain containing 1	1121					cellular response to hypoxia (GO:0071456)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of protein phosphorylation (GO:0001934)|regulation of protein transport (GO:0051223)	cell-cell junction (GO:0005911)|extracellular region (GO:0005576)|mitochondrial membrane (GO:0031966)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(29)|liver(2)|lung(23)|ovary(3)|pancreas(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(3)	93		Breast(66;0.000781)|Ovarian(120;0.0308)|Prostate(117;0.195)		OV - Ovarian serous cystadenocarcinoma(65;2.6e-16)|BRCA - Breast invasive adenocarcinoma(81;1.06e-05)		AGGCGCAGGGGCAGGTGGCGA	0.776																																					p.A1121S		Atlas-SNP	.											.	FNDC1	250	.	0			c.G3361T						.						5.0	8.0	7.0					6																	159654905		1714	3287	5001	SO:0001583	missense	84624	exon11			GCAGGGGCAGGTG	AB058769	CCDS47512.1	6q25	2013-02-11			ENSG00000164694	ENSG00000164694		"""Fibronectin type III domain containing"""	21184	protein-coding gene	gene with protein product		609991	"""fibronectin type III domain containing 2"""	FNDC2		11347906	Standard	NM_032532		Approved	bA243O10.1, KIAA1866, dJ322A24.1	uc010kjv.3	Q4ZHG4	OTTHUMG00000015927	ENST00000297267.9:c.3361G>T	chr6.hg19:g.159654905G>T	ENSP00000297267:p.Ala1121Ser	44.0	0.0		53.0	32.0	NM_032532	A6H8X2|B7ZBR4|B7ZBR5|B9EK49|Q5JPI0|Q5VU31|Q5VU32|Q5VXX4|Q70CQ6|Q96JG1	Missense_Mutation	SNP	ENST00000297267.9	hg19	CCDS47512.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	3.612|3.612	-0.079315|-0.079315	0.07141|0.07141	.|.	.|.	ENSG00000164694|ENSG00000164694	ENST00000297267;ENST00000340366|ENST00000329629	T;T|T	0.06449|0.03065	3.3;4.13|4.06	0.235|0.235	0.235|0.235	0.15431|0.15431	.|.	1.560190|.	0.03980|.	N|.	0.293108|.	T|T	0.00967|0.00967	0.0032|0.0032	N|N	0.14661|0.14661	0.345|0.345	0.09310|0.09310	N|N	1|1	P;P|.	0.41597|.	0.756;0.643|.	P;B|.	0.48114|.	0.567;0.364|.	T|T	0.48210|0.48210	-0.9055|-0.9055	9|6	0.09338|0.62326	T|D	0.73|0.03	.|.	.|.	.|.	.|.	.|.	1058;1121|.	Q4ZHG4-2;Q4ZHG4|.	.;FNDC1_HUMAN|.	S|V	1121;1058|1016	ENSP00000297267:A1121S;ENSP00000342460:A1058S|ENSP00000333297:G1016V	ENSP00000297267:A1121S|ENSP00000333297:G1016V	A|G	+|+	1|2	0|0	FNDC1|FNDC1	159574895|159574895	0.022000|0.022000	0.18835|0.18835	0.002000|0.002000	0.10522|0.10522	0.002000|0.002000	0.02628|0.02628	0.364000|0.364000	0.20325|0.20325	0.308000|0.308000	0.22923|0.22923	0.313000|0.313000	0.20887|0.20887	GCA|GGC	.	.		0.776	FNDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042897.3	NM_032532	
DACT2	168002	hgsc.bcm.edu	37	6	168709146	168709146	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr6:168709146A>T	ENST00000366795.3	-	4	1379	c.1291T>A	c.(1291-1293)Tgt>Agt	p.C431S	DACT2_ENST00000607983.1_Missense_Mutation_p.C23S|DACT2_ENST00000610183.1_Missense_Mutation_p.C261S|DACT2_ENST00000366796.3_Intron	NM_214462.3	NP_999627.2	Q5SW24	DACT2_HUMAN	dishevelled-binding antagonist of beta-catenin 2	431					epithelial cell morphogenesis (GO:0003382)|hematopoietic progenitor cell differentiation (GO:0002244)|inner medullary collecting duct development (GO:0072061)|negative regulation of cell adhesion (GO:0007162)|negative regulation of nodal signaling pathway (GO:1900108)|skin development (GO:0043588)	mitochondrion (GO:0005739)	beta-catenin binding (GO:0008013)|delta-catenin binding (GO:0070097)|protein kinase A binding (GO:0051018)|protein kinase C binding (GO:0005080)|transcription factor binding (GO:0008134)			endometrium(1)	1		Breast(66;1.46e-05)|Ovarian(120;0.0728)		OV - Ovarian serous cystadenocarcinoma(33;5.33e-21)|BRCA - Breast invasive adenocarcinoma(81;1.18e-06)|GBM - Glioblastoma multiforme(31;0.000957)		CTGAGGACACAGCTGTTTGAG	0.627																																					p.C431S		Atlas-SNP	.											.	DACT2	46	.	0			c.T1291A						.						93.0	84.0	86.0					6																	168709146		692	1591	2283	SO:0001583	missense	168002	exon4			GGACACAGCTGTT	AF318336	CCDS47519.1, CCDS69241.1, CCDS75554.1	6q27	2013-05-15	2013-05-15	2003-09-17	ENSG00000164488	ENSG00000164488			21231	protein-coding gene	gene with protein product		608966	"""chromosome 6 open reading frame 116"", ""dapper homolog 2, antagonist of beta-catenin (xenopus)"", ""dapper, antagonist of beta-catenin, homolog 2 (Xenopus laevis)"""	C6orf116			Standard	NM_001286351		Approved	bA503C24.7, DAPPER2	uc003qwq.3	Q5SW24	OTTHUMG00000016046	ENST00000366795.3:c.1291T>A	chr6.hg19:g.168709146A>T	ENSP00000355760:p.Cys431Ser	112.0	0.0		123.0	55.0	NM_214462	Q2NKJ2|Q569G0|Q8WYW2	Missense_Mutation	SNP	ENST00000366795.3	hg19	CCDS47519.1	.	.	.	.	.	.	.	.	.	.	A	6.213	0.407449	0.11754	.	.	ENSG00000164488	ENST00000366795	T	0.42513	0.97	4.2	-5.43	0.02632	.	4.186540	0.00871	U	0.002034	T	0.11452	0.0279	L	0.48986	1.54	0.09310	N	1	B	0.33637	0.42	B	0.25506	0.061	T	0.08371	-1.0725	10	0.27785	T	0.31	-0.7679	3.7688	0.08633	0.3986:0.0:0.3308:0.2706	.	431	Q5SW24	DACT2_HUMAN	S	431	ENSP00000355760:C431S	ENSP00000355760:C431S	C	-	1	0	DACT2	168451995	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.198000	0.09505	-0.761000	0.04670	-0.297000	0.09499	TGT	.	.		0.627	DACT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043193.1		
INTS1	26173	hgsc.bcm.edu	37	7	1513873	1513873	+	Silent	SNP	C	C	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr7:1513873C>A	ENST00000404767.3	-	41	5845	c.5760G>T	c.(5758-5760)ccG>ccT	p.P1920P	INTS1_ENST00000389470.4_Silent_p.P2124P	NM_001080453.2	NP_001073922.2	Q8N201	INT1_HUMAN	integrator complex subunit 1	1920					inner cell mass cell proliferation (GO:0001833)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|snRNA processing (GO:0016180)|U2 snRNA 3'-end processing (GO:0034474)	integral component of membrane (GO:0016021)|integrator complex (GO:0032039)|membrane (GO:0016020)				autonomic_ganglia(1)|cervix(1)|endometrium(14)|kidney(3)|large_intestine(7)|lung(24)|ovary(1)|prostate(4)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	62		Ovarian(82;0.0253)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0181)|OV - Ovarian serous cystadenocarcinoma(56;6.99e-15)		GGAACACGTGCGGCTGCAGCA	0.687											OREG0017827	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.P1920P		Atlas-SNP	.											.	INTS1	145	.	0			c.G5760T						.						19.0	27.0	24.0					7																	1513873		2110	4215	6325	SO:0001819	synonymous_variant	26173	exon41			CACGTGCGGCTGC	AB037861	CCDS47526.1	7p22.3	2009-11-06			ENSG00000164880	ENSG00000164880			24555	protein-coding gene	gene with protein product		611345				16239144	Standard	NM_001080453		Approved	DKFZp586J0619, KIAA1440, INT1, NET28	uc003skn.2	Q8N201	OTTHUMG00000151449	ENST00000404767.3:c.5760G>T	chr7.hg19:g.1513873C>A		19.0	0.0	596	21.0	11.0	NM_001080453	A6NJ44|Q6NT70|Q6UX74|Q8WV40|Q96D36|Q9NTD1|Q9P2A8|Q9Y3W8	Silent	SNP	ENST00000404767.3	hg19	CCDS47526.1																																																																																			.	.		0.687	INTS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323683.1		
CARD11	84433	hgsc.bcm.edu	37	7	2968233	2968233	+	Splice_Site	SNP	T	T	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr7:2968233T>A	ENST00000396946.4	-	13	2156	c.1753A>T	c.(1753-1755)Agc>Tgc	p.S585C		NM_032415.4	NP_115791.3	Q9BXL7	CAR11_HUMAN	caspase recruitment domain family, member 11	585					Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|nucleotide phosphorylation (GO:0046939)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of cytokine production (GO:0001819)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-2 biosynthetic process (GO:0045086)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of T cell proliferation (GO:0042102)|regulation of apoptotic process (GO:0042981)|regulation of B cell differentiation (GO:0045577)|regulation of T cell differentiation (GO:0045580)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|thymic T cell selection (GO:0045061)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|immunological synapse (GO:0001772)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	CARD domain binding (GO:0050700)|guanylate kinase activity (GO:0004385)			NS(1)|breast(3)|central_nervous_system(1)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(62)|kidney(11)|large_intestine(13)|lung(31)|ovary(4)|prostate(5)|skin(7)|upper_aerodigestive_tract(2)	150		Ovarian(82;0.0115)		OV - Ovarian serous cystadenocarcinoma(56;8.44e-14)		GCCACCCACCTGCGATGGGGC	0.667			Mis		DLBCL																																p.S585C		Atlas-SNP	.		Dom	yes		7	7p22	84433	"""caspase recruitment domain family, member 11"""		L	.	CARD11	339	.	0			c.A1753T						.						78.0	64.0	69.0					7																	2968233		2203	4300	6503	SO:0001630	splice_region_variant	84433	exon13			CCCACCTGCGATG	AF322641	CCDS5336.2	7p22	2014-09-17			ENSG00000198286	ENSG00000198286			16393	protein-coding gene	gene with protein product	"""card-maguk protein 1"", ""bcl10-interacting maguk protein 3"""	607210				11278692, 11356195	Standard	NM_032415		Approved	CARMA1, BIMP3	uc003smv.3	Q9BXL7	OTTHUMG00000023023	ENST00000396946.4:c.1754+1A>T	chr7.hg19:g.2968233T>A		30.0	0.0		28.0	9.0	NM_032415	A4D1Z7|Q2NKN7|Q548H3	Missense_Mutation	SNP	ENST00000396946.4	hg19	CCDS5336.2	.	.	.	.	.	.	.	.	.	.	t	15.60	2.880610	0.51801	.	.	ENSG00000198286	ENST00000396946;ENST00000355508	T;T	0.53423	0.62;0.62	4.96	4.96	0.65561	.	0.000000	0.85682	D	0.000000	T	0.29716	0.0742	N	0.08118	0	0.54753	D	0.999985	B	0.17852	0.024	B	0.14578	0.011	T	0.12682	-1.0538	10	0.72032	D	0.01	-41.2281	13.2116	0.59828	0.0:0.0:0.0:1.0	.	585	Q9BXL7	CAR11_HUMAN	C	585;56	ENSP00000380150:S585C;ENSP00000347695:S56C	ENSP00000347695:S56C	S	-	1	0	CARD11	2934759	1.000000	0.71417	0.999000	0.59377	0.930000	0.56654	2.869000	0.48444	1.874000	0.54306	0.454000	0.30748	AGC	.	.		0.667	CARD11-011	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059344.4	NM_032415	Missense_Mutation
GRID2IP	392862	hgsc.bcm.edu	37	7	6550307	6550307	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr7:6550307G>T	ENST00000457091.2	-	10	1585	c.1586C>A	c.(1585-1587)cCc>cAc	p.P529H	GRID2IP_ENST00000452113.1_Missense_Mutation_p.P338H|GRID2IP_ENST00000435185.1_Missense_Mutation_p.P345H	NM_001145118.1	NP_001138590.1	A4D2P6	GRD2I_HUMAN	glutamate receptor, ionotropic, delta 2 (Grid2) interacting protein	529					long term synaptic depression (GO:0060292)	cell junction (GO:0030054)|postsynaptic membrane (GO:0045211)				endometrium(4)	4						TGGGATCAGGGGAAGAGGCAT	0.637																																					p.P529H		Atlas-SNP	.											.	GRID2IP	82	.	0			c.C1586A						.						91.0	105.0	100.0					7																	6550307		692	1591	2283	SO:0001583	missense	392862	exon10			ATCAGGGGAAGAG		CCDS47537.1	7p22	2007-10-05	2006-03-01		ENSG00000215045	ENSG00000215045			18464	protein-coding gene	gene with protein product		610639	"""glutamate receptor, ionotropic, delta 2 (Grid2) interacting protein 1"""			14612983	Standard	NM_001145118		Approved		uc011jwx.2	A4D2P6	OTTHUMG00000155531	ENST00000457091.2:c.1586C>A	chr7.hg19:g.6550307G>T	ENSP00000397351:p.Pro529His	64.0	0.0		60.0	29.0	NM_001145118		Missense_Mutation	SNP	ENST00000457091.2	hg19	CCDS47537.1	.	.	.	.	.	.	.	.	.	.	G	16.24	3.066882	0.55539	.	.	ENSG00000215045	ENST00000452113;ENST00000435185;ENST00000457091	T;T;T	0.39229	1.09;1.09;1.09	4.68	3.72	0.42706	.	0.843053	0.09960	U	0.733576	T	0.29588	0.0738	N	0.08118	0	0.27547	N	0.950608	P	0.37864	0.61	B	0.44163	0.443	T	0.14448	-1.0472	10	0.72032	D	0.01	.	7.5155	0.27598	0.0:0.1802:0.6341:0.1858	.	529	A4D2P6	GRD2I_HUMAN	H	338;345;529	ENSP00000397887:P338H;ENSP00000408364:P345H;ENSP00000397351:P529H	ENSP00000408364:P345H	P	-	2	0	GRID2IP	6516832	1.000000	0.71417	1.000000	0.80357	0.918000	0.54935	3.698000	0.54771	2.311000	0.77944	0.462000	0.41574	CCC	.	.		0.637	GRID2IP-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340534.1	XM_294249	
DBNL	28988	hgsc.bcm.edu	37	7	44096470	44096470	+	Missense_Mutation	SNP	C	C	A	rs145524590		TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr7:44096470C>A	ENST00000448521.1	+	5	540	c.442C>A	c.(442-444)Cgc>Agc	p.R148S	DBNL_ENST00000497184.1_3'UTR|DBNL_ENST00000452943.1_Missense_Mutation_p.R123S|DBNL_ENST00000440166.1_Missense_Mutation_p.R45S|DBNL_ENST00000494774.1_Missense_Mutation_p.R148S|DBNL_ENST00000490734.2_Missense_Mutation_p.R53S|DBNL_ENST00000468694.1_Missense_Mutation_p.R148S|DBNL_ENST00000456905.1_Intron	NM_001014436.2	NP_001014436.1	Q9UJU6	DBNL_HUMAN	drebrin-like	148					activation of JUN kinase activity (GO:0007257)|apoptotic process (GO:0006915)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|endocytosis (GO:0006897)|immune system process (GO:0002376)|neuron projection morphogenesis (GO:0048812)|podosome assembly (GO:0071800)|Rac protein signal transduction (GO:0016601)|synapse assembly (GO:0007416)	cell cortex (GO:0005938)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendrite (GO:0030425)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|podosome (GO:0002102)|postsynaptic density (GO:0014069)|ruffle (GO:0001726)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|enzyme activator activity (GO:0008047)			breast(1)|large_intestine(3)|lung(5)|ovary(1)|skin(1)|stomach(1)	12						GGAGAGTGGCCGCTTCCAGGA	0.617																																					p.R148S	NSCLC(68;573 1327 18604 34760 37992)	Atlas-SNP	.											.	DBNL	26	.	0			c.C442A						.						109.0	98.0	101.0					7																	44096470		2203	4300	6503	SO:0001583	missense	28988	exon5			AGTGGCCGCTTCC	AF151364	CCDS34622.1, CCDS34623.1, CCDS47579.1, CCDS64633.1, CCDS64634.1	7p13	2004-07-22			ENSG00000136279	ENSG00000136279			2696	protein-coding gene	gene with protein product		610106				10087302	Standard	NM_014063		Approved	SH3P7, HIP-55	uc003tjq.4	Q9UJU6	OTTHUMG00000155350	ENST00000448521.1:c.442C>A	chr7.hg19:g.44096470C>A	ENSP00000411701:p.Arg148Ser	81.0	0.0		90.0	13.0	NM_001122956	A4D2I9|B4DEM2|C9J7P1|P84070|Q6IAI8|Q96F30|Q96K74|Q9HBN8|Q9NR72	Missense_Mutation	SNP	ENST00000448521.1	hg19	CCDS34623.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	14.08|14.08	2.427840|2.427840	0.43122|0.43122	.|.	.|.	ENSG00000136279|ENSG00000136279	ENST00000432854|ENST00000448521;ENST00000440166;ENST00000452943;ENST00000468694;ENST00000494774;ENST00000490734;ENST00000539475	.|T;T;T;T;T;T	.|0.32272	.|1.9;2.16;2.18;1.46;1.92;2.16	4.9|4.9	1.93|1.93	0.25924|0.25924	.|.	.|0.240750	.|0.41605	.|N	.|0.000848	T|T	0.19446|0.19446	0.0467|0.0467	L|L	0.50333|0.50333	1.59|1.59	0.48571|0.48571	D|D	0.999675|0.999675	.|B;B;B;B;B;B;B;B	.|0.28378	.|0.209;0.065;0.063;0.147;0.051;0.107;0.013;0.015	.|B;B;B;B;B;B;B;B	.|0.26416	.|0.043;0.032;0.04;0.028;0.019;0.069;0.008;0.043	T|T	0.08411|0.08411	-1.0723|-1.0723	5|10	.|0.10636	.|T	.|0.68	-11.8848|-11.8848	3.1894|3.1894	0.06612|0.06612	0.4227:0.3492:0.1405:0.0876|0.4227:0.3492:0.1405:0.0876	.|.	.|45;96;78;53;123;148;148;148	.|B4DEM2;B4DXL9;B4DDU5;C9J7P1;B4DDD6;Q9UJU6-3;Q9UJU6;Q9UJU6-2	.|.;.;.;.;.;.;DBNL_HUMAN;.	Q|S	76|148;45;123;148;148;53;78	.|ENSP00000411701:R148S;ENSP00000415173:R45S;ENSP00000405343:R123S;ENSP00000417653:R148S;ENSP00000419992:R148S;ENSP00000417749:R53S	.|ENSP00000415173:R45S	P|R	+|+	2|1	0|0	DBNL|DBNL	44062995|44062995	1.000000|1.000000	0.71417|0.71417	0.724000|0.724000	0.30704|0.30704	0.873000|0.873000	0.50193|0.50193	2.321000|2.321000	0.43805|0.43805	0.090000|0.090000	0.17273|0.17273	0.456000|0.456000	0.33151|0.33151	CCG|CGC	.	C|1.000;T|0.000		0.617	DBNL-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000339572.2	NM_014063	
TNS3	64759	hgsc.bcm.edu	37	7	47342734	47342734	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr7:47342734T>A	ENST00000398879.1	-	22	3637	c.3271A>T	c.(3271-3273)Acc>Tcc	p.T1091S	TNS3_ENST00000355730.3_Missense_Mutation_p.T851S|TNS3_ENST00000311160.9_Missense_Mutation_p.T1091S			Q68CZ2	TENS3_HUMAN	tensin 3	1091					cell migration (GO:0016477)|lung alveolus development (GO:0048286)|positive regulation of cell proliferation (GO:0008284)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)				NS(1)|autonomic_ganglia(1)|breast(17)|endometrium(5)|kidney(4)|large_intestine(7)|liver(1)|lung(16)|ovary(4)|prostate(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	64						CCGGGCAGGGTCACACCCTGG	0.662																																					p.T1091S		Atlas-SNP	.											.	TNS3	140	.	0			c.A3271T						.						21.0	26.0	24.0					7																	47342734		1978	4133	6111	SO:0001583	missense	64759	exon22			GCAGGGTCACACC	AF378756	CCDS5506.2	7p12.3	2013-02-14	2005-05-13	2005-05-13	ENSG00000136205	ENSG00000136205		"""SH2 domain containing"""	21616	protein-coding gene	gene with protein product	"""tumor endothelial marker 6"""	606825	"""tensin-like SH2 domain-containing 1"""	TENS1		11559528	Standard	NM_022748		Approved	TEM6, H_NH0549I23.2, FLJ13732	uc003tnw.3	Q68CZ2	OTTHUMG00000074075	ENST00000398879.1:c.3271A>T	chr7.hg19:g.47342734T>A	ENSP00000381854:p.Thr1091Ser	112.0	0.0		100.0	11.0	NM_022748	B2RNV1|Q6IPQ2|Q8IZW7|Q8NAD0|Q96PE0|Q96S48	Missense_Mutation	SNP	ENST00000398879.1	hg19	CCDS5506.2	.	.	.	.	.	.	.	.	.	.	T	0.102	-1.150754	0.01700	.	.	ENSG00000136205	ENST00000311160;ENST00000538633;ENST00000398879;ENST00000355730;ENST00000545849;ENST00000457718	D;D;D;D	0.93307	-2.78;-2.78;-3.2;-2.82	5.37	-2.45	0.06481	.	0.958022	0.08682	N	0.909361	T	0.78679	0.4321	N	0.04880	-0.145	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.69277	-0.5187	10	0.02654	T	1	-11.6978	5.192	0.15214	0.1412:0.3423:0.0:0.5166	.	1091	Q68CZ2	TENS3_HUMAN	S	1091;1201;1091;851;547;1194	ENSP00000312143:T1091S;ENSP00000381854:T1091S;ENSP00000347968:T851S;ENSP00000414358:T1194S	ENSP00000312143:T1091S	T	-	1	0	TNS3	47309259	0.005000	0.15991	0.001000	0.08648	0.309000	0.27889	1.062000	0.30555	-0.192000	0.10432	0.454000	0.30748	ACC	.	.		0.662	TNS3-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157253.1	NM_022748	
IKZF1	10320	hgsc.bcm.edu	37	7	50467947	50467947	+	Silent	SNP	C	C	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr7:50467947C>T	ENST00000331340.3	+	8	1337	c.1182C>T	c.(1180-1182)tgC>tgT	p.C394C	IKZF1_ENST00000343574.5_Silent_p.C307C|IKZF1_ENST00000357364.4_Silent_p.C307C|IKZF1_ENST00000440768.2_3'UTR|IKZF1_ENST00000346667.4_Silent_p.C164C|IKZF1_ENST00000439701.1_Silent_p.C352C|IKZF1_ENST00000349824.4_Silent_p.C251C|IKZF1_ENST00000438033.1_Silent_p.C307C|IKZF1_ENST00000359197.5_Silent_p.C352C	NM_001220769.1|NM_001220772.1|NM_001220773.1|NM_001220775.1|NM_006060.4	NP_001207698.1|NP_001207701.1|NP_001207702.1|NP_001207704.1|NP_006051.1	Q13422	IKZF1_HUMAN	IKAROS family zinc finger 1 (Ikaros)	394					B cell differentiation (GO:0030183)|cell cycle (GO:0007049)|chromatin modification (GO:0016568)|forebrain development (GO:0030900)|lymph node development (GO:0048535)|mesoderm development (GO:0007498)|natural killer cell differentiation (GO:0001779)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Peyer's patch development (GO:0048541)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of neutrophil differentiation (GO:0045660)|positive regulation of NK T cell differentiation (GO:0051138)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|retina development in camera-type eye (GO:0060041)|T cell differentiation (GO:0030217)|thymus development (GO:0048538)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|pericentric heterochromatin (GO:0005721)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.?(28)		haematopoietic_and_lymphoid_tissue(275)|lung(1)	276	Glioma(55;0.08)|all_neural(89;0.245)	Acute lymphoblastic leukemia(4;7.29e-10)|all_hematologic(4;4.8e-07)				GCAACAGCTGCCAAGACTCCA	0.667			"""D,T"""	BCL6	"""ALL, DLBCL"""																																p.C394C		Atlas-SNP	.		"""Rec,Dom"""	yes		7	7p12.2	10320	IKAROS family zinc finger 1		L	.	IKZF1	613	.	28	Unknown(28)	haematopoietic_and_lymphoid_tissue(28)	c.C1182T						.						24.0	31.0	28.0					7																	50467947		2159	4242	6401	SO:0001819	synonymous_variant	10320	exon8			CAGCTGCCAAGAC	U40462	CCDS59055.1, CCDS69299.1, CCDS75596.1, CCDS75597.1	7p12.2	2014-06-12	2006-08-25	2006-08-25	ENSG00000185811	ENSG00000185811		"""Zinc fingers, C2H2-type"", ""IKAROS zinc fingers"""	13176	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 92"""	603023	"""zinc finger protein, subfamily 1A, 1 (Ikaros)"""	ZNFN1A1		1439790, 7935426	Standard	NM_006060		Approved	hIk-1, LyF-1, Hs.54452, IKAROS, PPP1R92	uc003tow.4	Q13422	OTTHUMG00000155907	ENST00000331340.3:c.1182C>T	chr7.hg19:g.50467947C>T		115.0	0.0		87.0	43.0	NM_006060	A4D260|B4E0Z1|D3DVM5|O00598|Q53XL2|Q69BM4|Q8WVA3	Silent	SNP	ENST00000331340.3	hg19																																																																																				.	.		0.667	IKZF1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000342242.1	NM_006060	
ZNF479	90827	hgsc.bcm.edu	37	7	57188114	57188115	+	Missense_Mutation	DNP	CC	CC	AA	rs373275999		TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr7:57188114_57188115CC>AA	ENST00000331162.4	-	5	1277_1278	c.1007_1008GG>TT	c.(1006-1008)tGG>tTT	p.W336F		NM_033273.1	NP_150376.1	Q96JC4	ZN479_HUMAN	zinc finger protein 479	336					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(14)|lung(53)|ovary(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	84			GBM - Glioblastoma multiforme(1;9.18e-12)			GGTTTGAGGACCAGCTAAAGGC	0.455																																					p.W336C|p.W336L		Atlas-SNP	.											.	ZNF479	193	.	0			c.G1008T|c.G1007T						.																																			SO:0001583	missense	90827	exon5			TGAGGACCAGCTA|GAGGACCAGCTAA	AF277624	CCDS43590.1	7p11.2	2013-01-08			ENSG00000185177	ENSG00000185177		"""Zinc fingers, C2H2-type"", ""-"""	23258	protein-coding gene	gene with protein product						11410164	Standard	NM_033273		Approved	KR19	uc010kzo.3	Q96JC4	OTTHUMG00000156682	ENST00000331162.4:c.1007_1008delinsAA	chr7.hg19:g.57188114_57188115delinsAA	ENSP00000333776:p.Trp336Phe	202.0	0.0		188.0|187.0	67.0|68.0	NM_033273		Missense_Mutation	SNP	ENST00000331162.4	hg19	CCDS43590.1																																																																																			.	.		0.455	ZNF479-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345302.1	XM_291202	
DTX2	113878	hgsc.bcm.edu	37	7	76112438	76112438	+	Silent	SNP	A	A	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr7:76112438A>T	ENST00000324432.5	+	5	1392	c.882A>T	c.(880-882)ccA>ccT	p.P294P	DTX2_ENST00000446820.2_Silent_p.P294P|DTX2_ENST00000307569.8_Silent_p.P294P|DTX2_ENST00000446600.1_Silent_p.P203P|DTX2_ENST00000413936.2_Silent_p.P294P|DTX2_ENST00000430490.2_Silent_p.P294P	NM_020892.2	NP_065943.2	Q86UW9	DTX2_HUMAN	deltex 2, E3 ubiquitin ligase	294					Notch signaling pathway (GO:0007219)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(14)|ovary(1)|skin(1)|stomach(2)	27						ACCTGCCCCCAGGATCCTCCA	0.652																																					p.P294P		Atlas-SNP	.											.	DTX2	64	.	0			c.A882T						.						21.0	23.0	22.0					7																	76112438		2196	4259	6455	SO:0001819	synonymous_variant	113878	exon2			GCCCCCAGGATCC		CCDS5587.1, CCDS43605.1	7q11.23	2014-01-28	2014-01-28		ENSG00000091073	ENSG00000091073		"""RING-type (C3HC4) zinc fingers"""	15973	protein-coding gene	gene with protein product		613141	"""deltex (Drosophila) homolog 2"", ""deltex homolog 2 (Drosophila)"""			12670957	Standard	NM_020892		Approved	RNF58, KIAA1528	uc003ufh.4	Q86UW9	OTTHUMG00000162594	ENST00000324432.5:c.882A>T	chr7.hg19:g.76112438A>T		154.0	0.0		143.0	55.0	NM_001102596	Q6XM87|Q6XM88|Q96H69|Q9H890|Q9P200	Silent	SNP	ENST00000324432.5	hg19	CCDS5587.1																																																																																			.	.		0.652	DTX2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000253104.2		
CACNA2D1	781	hgsc.bcm.edu	37	7	81714106	81714106	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr7:81714106C>A	ENST00000356253.5	-	7	892	c.637G>T	c.(637-639)Ggc>Tgc	p.G213C	CACNA2D1_ENST00000356860.3_Missense_Mutation_p.G213C|CACNA2D1_ENST00000423588.1_Missense_Mutation_p.G213C			P54289	CA2D1_HUMAN	calcium channel, voltage-dependent, alpha 2/delta subunit 1	213					calcium ion transport (GO:0006816)|regulation of calcium ion transport (GO:0051924)	extracellular vesicular exosome (GO:0070062)|sarcoplasmic reticulum (GO:0016529)|T-tubule (GO:0030315)|voltage-gated calcium channel complex (GO:0005891)	metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			breast(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(15)|liver(1)|lung(42)|ovary(6)|pancreas(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	81					Amlodipine(DB00381)|Cyclandelate(DB04838)|Felodipine(DB01023)|Gabapentin(DB00996)|Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)	CGAGCTAGGCCAGTGGCACTG	0.423																																					p.G213C		Atlas-SNP	.											.	CACNA2D1	191	.	0			c.G637T						.						100.0	98.0	99.0					7																	81714106		2203	4300	6503	SO:0001583	missense	781	exon7			CTAGGCCAGTGGC	M76559	CCDS5598.1	7q21-q22	2014-09-17			ENSG00000153956	ENSG00000153956		"""Calcium channel subunits"""	1399	protein-coding gene	gene with protein product		114204	"""long intergenic non-protein coding RNA 1112"""	CACNL2A, CACNA2, MHS3, LINC01112		8188232	Standard	XM_005250570		Approved	lncRNA-N3	uc003uhr.1	P54289	OTTHUMG00000023622	ENST00000356253.5:c.637G>T	chr7.hg19:g.81714106C>A	ENSP00000348589:p.Gly213Cys	302.0	0.0		263.0	114.0	NM_000722	Q17R45|Q9UD80|Q9UD81|Q9UD82	Missense_Mutation	SNP	ENST00000356253.5	hg19		.	.	.	.	.	.	.	.	.	.	C	31	5.075395	0.94000	.	.	ENSG00000153956	ENST00000356860;ENST00000284088;ENST00000356253;ENST00000423588	T;T;T	0.71103	0.71;0.67;-0.54	5.96	5.96	0.96718	.	0.000000	0.85682	D	0.000000	D	0.88016	0.6324	M	0.89601	3.045	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.89273	0.3606	10	0.87932	D	0	-13.2343	20.0143	0.97474	0.0:1.0:0.0:0.0	.	213	P54289-2	.	C	213	ENSP00000349320:G213C;ENSP00000348589:G213C;ENSP00000405395:G213C	ENSP00000284088:G213C	G	-	1	0	CACNA2D1	81552042	1.000000	0.71417	0.974000	0.42286	0.995000	0.86356	7.673000	0.83973	2.831000	0.97527	0.650000	0.86243	GGC	.	.		0.423	CACNA2D1-201	KNOWN	basic	protein_coding	protein_coding			
PCLO	27445	hgsc.bcm.edu	37	7	82467649	82467649	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr7:82467649T>C	ENST00000333891.9	-	15	14444	c.14107A>G	c.(14107-14109)Aac>Gac	p.N4703D	PCLO_ENST00000426442.2_5'UTR|PCLO_ENST00000423517.2_Missense_Mutation_p.N4703D	NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein											breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						AGATCATAGTTAATTTGAAGC	0.284																																					p.N4703D		Atlas-SNP	.											.	PCLO	1506	.	0			c.A14107G						.						41.0	39.0	40.0					7																	82467649		1796	4052	5848	SO:0001583	missense	27445	exon15			CATAGTTAATTTG	AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.14107A>G	chr7.hg19:g.82467649T>C	ENSP00000334319:p.Asn4703Asp	72.0	0.0		66.0	22.0	NM_014510		Missense_Mutation	SNP	ENST00000333891.9	hg19	CCDS47630.1	.	.	.	.	.	.	.	.	.	.	T	15.98	2.992135	0.54041	.	.	ENSG00000186472	ENST00000333891;ENST00000423517;ENST00000380195	T;T	0.41065	1.01;1.01	5.48	5.48	0.80851	.	.	.	.	.	T	0.51126	0.1656	N	0.21282	0.65	0.80722	D	1	D;D;P;P	0.69078	0.997;0.997;0.952;0.911	D;D;P;P	0.74348	0.983;0.983;0.817;0.662	T	0.56908	-0.7901	9	0.87932	D	0	.	15.5702	0.76330	0.0:0.0:0.0:1.0	.	4703;4703;133;200	Q9Y6V0-5;Q9Y6V0-6;Q9Y6V0-3;Q32P40	.;.;.;.	D	4703;4703;199	ENSP00000334319:N4703D;ENSP00000388393:N4703D	ENSP00000334319:N4703D	N	-	1	0	PCLO	82305585	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	4.579000	0.60936	2.060000	0.61445	0.533000	0.62120	AAC	.	.		0.284	PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337368.5	NM_014510	
PCLO	27445	hgsc.bcm.edu	37	7	82581285	82581285	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr7:82581285G>T	ENST00000333891.9	-	5	9321	c.8984C>A	c.(8983-8985)tCt>tAt	p.S2995Y	PCLO_ENST00000437081.1_5'Flank|PCLO_ENST00000423517.2_Missense_Mutation_p.S2995Y	NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein											breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						ATTTGTGTCAGACATGGAAGG	0.413																																					p.S2995Y		Atlas-SNP	.											.	PCLO	1506	.	0			c.C8984A						.						183.0	176.0	178.0					7																	82581285		1862	4108	5970	SO:0001583	missense	27445	exon5			GTGTCAGACATGG	AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.8984C>A	chr7.hg19:g.82581285G>T	ENSP00000334319:p.Ser2995Tyr	161.0	0.0		168.0	85.0	NM_014510		Missense_Mutation	SNP	ENST00000333891.9	hg19	CCDS47630.1	.	.	.	.	.	.	.	.	.	.	G	9.990	1.230500	0.22542	.	.	ENSG00000186472	ENST00000431819;ENST00000333891;ENST00000423517	T;T	0.55760	0.5;0.51	5.73	4.84	0.62591	.	.	.	.	.	T	0.71108	0.3301	M	0.68593	2.085	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.75172	-0.3411	9	0.87932	D	0	.	16.0098	0.80391	0.0:0.0:0.8644:0.1356	.	2995;2995	Q9Y6V0-5;Q9Y6V0-6	.;.	Y	2926;2995;2995	ENSP00000334319:S2995Y;ENSP00000388393:S2995Y	ENSP00000334319:S2995Y	S	-	2	0	PCLO	82419221	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.867000	0.87062	1.375000	0.46248	0.557000	0.71058	TCT	.	.		0.413	PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337368.5	NM_014510	
PCLO	27445	hgsc.bcm.edu	37	7	82764725	82764725	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr7:82764725C>A	ENST00000333891.9	-	3	2478	c.2141G>T	c.(2140-2142)gGc>gTc	p.G714V	PCLO_ENST00000423517.2_Missense_Mutation_p.G714V	NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein											breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						TGAAGGAGAGCCATGAAGGGT	0.547																																					p.G714V		Atlas-SNP	.											.	PCLO	1506	.	0			c.G2141T						.						160.0	157.0	158.0					7																	82764725		1970	4157	6127	SO:0001583	missense	27445	exon3			GGAGAGCCATGAA	AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.2141G>T	chr7.hg19:g.82764725C>A	ENSP00000334319:p.Gly714Val	167.0	0.0		151.0	71.0	NM_014510		Missense_Mutation	SNP	ENST00000333891.9	hg19	CCDS47630.1	.	.	.	.	.	.	.	.	.	.	C	1.279	-0.610808	0.03690	.	.	ENSG00000186472	ENST00000431819;ENST00000333891;ENST00000423517	T;T	0.16897	2.31;2.31	5.79	4.91	0.64330	.	.	.	.	.	T	0.15955	0.0384	L	0.36672	1.1	0.42244	D	0.991943	P;P	0.42203	0.773;0.773	B;B	0.39465	0.3;0.3	T	0.02087	-1.1216	9	0.87932	D	0	.	13.0866	0.59144	0.0:0.9258:0.0:0.0742	.	714;714	Q9Y6V0-5;Q9Y6V0-6	.;.	V	660;714;714	ENSP00000334319:G714V;ENSP00000388393:G714V	ENSP00000334319:G714V	G	-	2	0	PCLO	82602661	0.004000	0.15560	0.124000	0.21820	0.150000	0.21749	1.702000	0.37836	1.444000	0.47605	0.591000	0.81541	GGC	.	.		0.547	PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337368.5	NM_014510	
GRM3	2913	hgsc.bcm.edu	37	7	86416372	86416372	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr7:86416372A>G	ENST00000361669.2	+	3	2363	c.1264A>G	c.(1264-1266)Atg>Gtg	p.M422V	AC005009.2_ENST00000452471.1_RNA|GRM3_ENST00000394720.2_Missense_Mutation_p.M420V|AC005009.2_ENST00000418031.1_RNA|GRM3_ENST00000536043.1_Missense_Mutation_p.M294V|GRM3_ENST00000546348.1_Intron|GRM3_ENST00000439827.1_Missense_Mutation_p.M422V	NM_000840.2	NP_000831.2	Q14832	GRM3_HUMAN	glutamate receptor, metabotropic 3	422					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|negative regulation of adenylate cyclase activity (GO:0007194)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission (GO:0007268)	astrocyte projection (GO:0097449)|axon (GO:0030424)|dendritic spine (GO:0043197)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	calcium channel regulator activity (GO:0005246)|G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)|group II metabotropic glutamate receptor activity (GO:0001641)			NS(2)|breast(6)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(43)|ovary(3)|pancreas(2)|prostate(4)|skin(25)|upper_aerodigestive_tract(5)	109	Esophageal squamous(14;0.0058)|all_lung(186;0.132)|Lung NSC(181;0.142)					TTGTGATGCTATGAAGATCCT	0.463																																					p.M422V	GBM(52;969 1098 3139 52280)	Atlas-SNP	.											.	GRM3	237	.	0			c.A1264G						.						161.0	151.0	154.0					7																	86416372		2203	4300	6503	SO:0001583	missense	2913	exon3			GATGCTATGAAGA		CCDS5600.1	7q21.1-q21.2	2012-08-29			ENSG00000198822	ENSG00000198822		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4595	protein-coding gene	gene with protein product		601115				8824806	Standard	NM_000840		Approved	GPRC1C, mGlu3, MGLUR3	uc003uid.3	Q14832	OTTHUMG00000022884	ENST00000361669.2:c.1264A>G	chr7.hg19:g.86416372A>G	ENSP00000355316:p.Met422Val	135.0	0.0		89.0	9.0	NM_000840	Q2PNZ6|Q75MV4|Q75N17|Q86YG6|Q8TBH9	Missense_Mutation	SNP	ENST00000361669.2	hg19	CCDS5600.1	.	.	.	.	.	.	.	.	.	.	A	18.69	3.677778	0.68042	.	.	ENSG00000198822	ENST00000361669;ENST00000536043;ENST00000439827;ENST00000394720	D;D;D;D	0.83673	-1.75;-1.75;-1.75;-1.75	5.78	5.78	0.91487	Extracellular ligand-binding receptor (1);	0.037289	0.85682	D	0.000000	D	0.89543	0.6745	M	0.71581	2.175	0.80722	D	1	P;D;P	0.63880	0.669;0.993;0.717	B;D;P	0.63113	0.443;0.911;0.578	D	0.90671	0.4598	10	0.87932	D	0	.	15.287	0.73835	1.0:0.0:0.0:0.0	.	294;422;422	F5GYZ2;G5E9K2;Q14832	.;.;GRM3_HUMAN	V	422;294;422;420	ENSP00000355316:M422V;ENSP00000441407:M294V;ENSP00000398767:M422V;ENSP00000378209:M420V	ENSP00000355316:M422V	M	+	1	0	GRM3	86254308	1.000000	0.71417	0.997000	0.53966	0.964000	0.63967	5.896000	0.69822	2.196000	0.70406	0.533000	0.62120	ATG	.	.		0.463	GRM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253362.2		
FZD1	8321	hgsc.bcm.edu	37	7	90895564	90895564	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr7:90895564A>G	ENST00000287934.2	+	1	1782	c.1369A>G	c.(1369-1371)Atc>Gtc	p.I457V		NM_003505.1	NP_003496.1	Q9UP38	FZD1_HUMAN	frizzled class receptor 1	457					autocrine signaling (GO:0035425)|axonogenesis (GO:0007409)|brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in mesenchymal stem cell differentiation (GO:0044338)|canonical Wnt signaling pathway involved in osteoblast differentiation (GO:0044339)|cell-cell signaling (GO:0007267)|epithelial cell differentiation (GO:0030855)|G-protein coupled receptor signaling pathway coupled to cGMP nucleotide second messenger (GO:0007199)|gonad development (GO:0008406)|hard palate development (GO:0060022)|lung alveolus development (GO:0048286)|membranous septum morphogenesis (GO:0003149)|muscular septum morphogenesis (GO:0003150)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of catenin import into nucleus (GO:0035414)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron differentiation (GO:0030182)|outflow tract morphogenesis (GO:0003151)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription, DNA-templated (GO:0045893)|response to drug (GO:0042493)|vasculature development (GO:0001944)|Wnt signaling pathway, calcium modulating pathway (GO:0007223)	apical part of cell (GO:0045177)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|neuron projection membrane (GO:0032589)|plasma membrane (GO:0005886)	frizzled binding (GO:0005109)|G-protein coupled receptor activity (GO:0004930)|PDZ domain binding (GO:0030165)|receptor binding (GO:0005102)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(4)|liver(1)|lung(7)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	24	all_cancers(62;3.1e-10)|all_epithelial(64;1.66e-08)|Breast(17;0.000635)|Lung NSC(181;0.153)|all_lung(186;0.154)|all_hematologic(106;0.215)		STAD - Stomach adenocarcinoma(171;0.0134)			TGTGCCGGCCATCAAGACCAT	0.637																																					p.I457V		Atlas-SNP	.											.	FZD1	64	.	0			c.A1369G						.						103.0	96.0	98.0					7																	90895564		2203	4300	6503	SO:0001583	missense	8321	exon1			CCGGCCATCAAGA	AB017363	CCDS5620.1	7q21	2014-01-29	2014-01-29		ENSG00000157240	ENSG00000157240		"""GPCR / Class F : Frizzled receptors"""	4038	protein-coding gene	gene with protein product	"""Wnt receptor"", ""frizzled, Drosophila, homolog of, 1"""	603408	"""frizzled (Drosophila) homolog 1"", ""frizzled homolog 1 (Drosophila)"", ""frizzled 1, seven transmembrane spanning receptor"", ""frizzled family receptor 1"""			9813155	Standard	NM_003505		Approved	DKFZp564G072	uc003ula.3	Q9UP38	OTTHUMG00000023046	ENST00000287934.2:c.1369A>G	chr7.hg19:g.90895564A>G	ENSP00000287934:p.Ile457Val	57.0	0.0		56.0	20.0	NM_003505	A4D1E8|O94815|Q549T8	Missense_Mutation	SNP	ENST00000287934.2	hg19	CCDS5620.1	.	.	.	.	.	.	.	.	.	.	A	1.686	-0.505207	0.04261	.	.	ENSG00000157240	ENST00000287934	T	0.79454	-1.27	4.52	3.36	0.38483	GPCR, family 2-like (1);	0.000000	0.64402	D	0.000004	T	0.43277	0.1240	N	0.01109	-1.01	0.47905	D	0.99954	B	0.12013	0.005	B	0.16289	0.015	T	0.47315	-0.9127	10	0.02654	T	1	.	9.8643	0.41134	0.9187:0.0:0.0813:0.0	.	457	Q9UP38	FZD1_HUMAN	V	457	ENSP00000287934:I457V	ENSP00000287934:I457V	I	+	1	0	FZD1	90733500	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.577000	0.53885	0.772000	0.33382	0.379000	0.24179	ATC	.	.		0.637	FZD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059367.2	NM_003505	
COL1A2	1278	hgsc.bcm.edu	37	7	94040245	94040245	+	Silent	SNP	T	T	C			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr7:94040245T>C	ENST00000297268.6	+	22	1713	c.1242T>C	c.(1240-1242)gcT>gcC	p.A414A		NM_000089.3	NP_000080.2	P08123	CO1A2_HUMAN	collagen, type I, alpha 2	414					blood coagulation (GO:0007596)|blood vessel development (GO:0001568)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|leukocyte migration (GO:0050900)|odontogenesis (GO:0042476)|platelet activation (GO:0030168)|protein heterotrimerization (GO:0070208)|regulation of blood pressure (GO:0008217)|Rho protein signal transduction (GO:0007266)|skeletal system development (GO:0001501)|skin morphogenesis (GO:0043589)|transforming growth factor beta receptor signaling pathway (GO:0007179)	collagen type I trimer (GO:0005584)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	extracellular matrix structural constituent (GO:0005201)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)|protein binding, bridging (GO:0030674)		COL1A2/PLAG1(3)	NS(2)|breast(2)|central_nervous_system(4)|cervix(1)|endometrium(6)|kidney(8)|large_intestine(21)|lung(51)|ovary(2)|prostate(1)|skin(7)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(1)	115	all_cancers(62;2.46e-09)|all_epithelial(64;2.7e-08)		STAD - Stomach adenocarcinoma(171;0.0031)		Collagenase(DB00048)	ATGGCAGAGCTGGCGTCATGG	0.468										HNSCC(75;0.22)																											p.A414A		Atlas-SNP	.											.	COL1A2	240	.	0			c.T1242C						.						152.0	147.0	149.0					7																	94040245		2203	4300	6503	SO:0001819	synonymous_variant	1278	exon22			CAGAGCTGGCGTC	Z74616	CCDS34682.1	7q21.3	2014-09-17	2002-02-13		ENSG00000164692	ENSG00000164692		"""Collagens"""	2198	protein-coding gene	gene with protein product	"""alpha 2(I)-collagen"", ""alpha-2 collagen type I"", ""type I procollagen"", ""collagen I, alpha-2 polypeptide"", ""collagen of skin, tendon and bone, alpha-2 chain"""	120160	"""osteogenesis imperfecta type IV"""	OI4		3857213, 2897363	Standard	NM_000089		Approved		uc003ung.1	P08123	OTTHUMG00000148675	ENST00000297268.6:c.1242T>C	chr7.hg19:g.94040245T>C		113.0	0.0		66.0	25.0	NM_000089	P02464|Q13897|Q13997|Q13998|Q14038|Q14057|Q15177|Q15947|Q16480|Q16511|Q7Z5S6|Q9UEB6|Q9UEF9|Q9UM83|Q9UMI1|Q9UML5|Q9UMM6|Q9UPH0	Silent	SNP	ENST00000297268.6	hg19	CCDS34682.1																																																																																			.	.		0.468	COL1A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000309045.2	NM_000089	
GPR22	2845	hgsc.bcm.edu	37	7	107114661	107114661	+	Silent	SNP	T	T	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr7:107114661T>A	ENST00000304402.4	+	3	1499	c.156T>A	c.(154-156)atT>atA	p.I52I	COG5_ENST00000475638.2_Intron|COG5_ENST00000393603.2_Intron|COG5_ENST00000347053.3_Intron|COG5_ENST00000297135.3_Intron	NM_005295.2	NP_005286.2	Q99680	GPR22_HUMAN	G protein-coupled receptor 22	52					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)			large_intestine(3)|lung(6)|ovary(2)|stomach(1)	12						TGTTAGAAATTGTGTTGGGAC	0.378																																					p.I52I		Atlas-SNP	.											.	GPR22	43	.	0			c.T156A						.						195.0	179.0	184.0					7																	107114661		2203	4300	6503	SO:0001819	synonymous_variant	2845	exon3			AGAAATTGTGTTG	U66581	CCDS5744.1	7q22-q31.1	2012-08-21			ENSG00000172209	ENSG00000172209		"""GPCR / Class A : Orphans"""	4477	protein-coding gene	gene with protein product		601910				9073069	Standard	NM_005295		Approved		uc003vef.3	Q99680	OTTHUMG00000154902	ENST00000304402.4:c.156T>A	chr7.hg19:g.107114661T>A		174.0	0.0		195.0	83.0	NM_005295	O14554	Silent	SNP	ENST00000304402.4	hg19	CCDS5744.1																																																																																			.	.		0.378	GPR22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337598.1		
LAMB4	22798	hgsc.bcm.edu	37	7	107706917	107706917	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr7:107706917T>A	ENST00000388781.3	-	20	2658	c.2575A>T	c.(2575-2577)Agc>Tgc	p.S859C	LAMB4_ENST00000205386.4_Missense_Mutation_p.S859C|LAMB4_ENST00000388780.3_Missense_Mutation_p.S859C	NM_007356.2	NP_031382.2	A4D0S4	LAMB4_HUMAN	laminin, beta 4	859	Laminin EGF-like 7. {ECO:0000255|PROSITE- ProRule:PRU00460}.				cell adhesion (GO:0007155)	basement membrane (GO:0005604)				NS(1)|breast(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(22)|lung(40)|ovary(4)|prostate(5)|skin(4)	97						GGGTGGCAGCTGGGAAATCCA	0.532																																					p.S859C		Atlas-SNP	.											.	LAMB4	253	.	0			c.A2575T						.						65.0	58.0	60.0					7																	107706917		2203	4300	6503	SO:0001583	missense	22798	exon20			GGCAGCTGGGAAA	AF028816	CCDS34732.1	7q31	2013-03-01			ENSG00000091128	ENSG00000091128		"""Laminins"""	6491	protein-coding gene	gene with protein product							Standard	NM_007356		Approved		uc010ljo.1	A4D0S4	OTTHUMG00000154874	ENST00000388781.3:c.2575A>T	chr7.hg19:g.107706917T>A	ENSP00000373433:p.Ser859Cys	125.0	0.0		117.0	48.0	NM_007356	A5PKU6|B2RTT3|B5MEB9|Q86TP7|Q86XN2|Q8NBX5	Missense_Mutation	SNP	ENST00000388781.3	hg19	CCDS34732.1	.	.	.	.	.	.	.	.	.	.	T	16.68	3.191302	0.58017	.	.	ENSG00000091128	ENST00000205386;ENST00000388781;ENST00000388780	T;T;T	0.63255	-0.03;-0.03;-0.03	4.98	3.84	0.44239	EGF-like, laminin (4);	0.644454	0.14226	N	0.333070	T	0.71065	0.3296	M	0.87827	2.91	0.54753	D	0.999984	P	0.51537	0.946	P	0.49752	0.621	T	0.71761	-0.4495	10	0.62326	D	0.03	.	7.0636	0.25139	0.0:0.0837:0.193:0.7233	.	859	A4D0S4	LAMB4_HUMAN	C	859	ENSP00000205386:S859C;ENSP00000373433:S859C;ENSP00000373432:S859C	ENSP00000205386:S859C	S	-	1	0	LAMB4	107494153	0.000000	0.05858	0.673000	0.29887	0.806000	0.45545	-0.492000	0.06467	0.937000	0.37394	0.460000	0.39030	AGC	.	.		0.532	LAMB4-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337442.1	XM_209857	
NRCAM	4897	hgsc.bcm.edu	37	7	107820770	107820770	+	Silent	SNP	C	C	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr7:107820770C>T	ENST00000425651.2	-	22	2747	c.2748G>A	c.(2746-2748)ccG>ccA	p.P916P	NRCAM_ENST00000413765.2_Silent_p.P897P|NRCAM_ENST00000379028.3_Silent_p.P916P|NRCAM_ENST00000379024.4_Silent_p.P897P|NRCAM_ENST00000351718.4_Silent_p.P900P|NRCAM_ENST00000379022.4_Silent_p.P916P	NM_001037132.2	NP_001032209.1	Q92823	NRCAM_HUMAN	neuronal cell adhesion molecule	916	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				angiogenesis (GO:0001525)|axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|axonogenesis (GO:0007409)|central nervous system development (GO:0007417)|clustering of voltage-gated sodium channels (GO:0045162)|heterotypic cell-cell adhesion (GO:0034113)|neuron migration (GO:0001764)|neuronal action potential propagation (GO:0019227)|positive regulation of neuron differentiation (GO:0045666)|protein localization (GO:0008104)|regulation of axon extension (GO:0030516)|retinal ganglion cell axon guidance (GO:0031290)|single organismal cell-cell adhesion (GO:0016337)|synapse assembly (GO:0007416)	axon initial segment (GO:0043194)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|synapse (GO:0045202)	ankyrin binding (GO:0030506)			breast(4)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(8)|liver(1)|lung(36)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(4)	65						GCTCTAGCCCCGGCAACATGC	0.493																																					p.P916P		Atlas-SNP	.											NRCAM_ENST00000379028,NS,carcinoma,0,2	NRCAM	267	.	0			c.G2748A						.						99.0	86.0	90.0					7																	107820770		2203	4300	6503	SO:0001819	synonymous_variant	4897	exon22			TAGCCCCGGCAAC		CCDS5751.1, CCDS47686.1, CCDS55153.1, CCDS75652.1	7q31	2013-02-11			ENSG00000091129	ENSG00000091129		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	7994	protein-coding gene	gene with protein product	"""NgCAM-related cell adhesion molecule"""	601581				8812479	Standard	NM_001037132		Approved	KIAA0343, Bravo	uc022aka.1	Q92823	OTTHUMG00000154973	ENST00000425651.2:c.2748G>A	chr7.hg19:g.107820770C>T		105.0	0.0		104.0	62.0	NM_001037132	A4D0S3|E9PDA4|O15051|O15179|Q14BM2|Q9UHI3|Q9UHI4	Silent	SNP	ENST00000425651.2	hg19	CCDS47686.1																																																																																			.	.		0.493	NRCAM-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337942.2	NM_001037132	
ASZ1	136991	hgsc.bcm.edu	37	7	117003770	117003770	+	Silent	SNP	A	A	G			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr7:117003770A>G	ENST00000284629.2	-	13	1370	c.1308T>C	c.(1306-1308)caT>caC	p.H436H		NM_130768.2	NP_570124.1			ankyrin repeat, SAM and basic leucine zipper domain containing 1											breast(1)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(10)|ovary(1)|prostate(3)|skin(1)	24	Lung NSC(10;0.00156)|all_lung(10;0.00175)		STAD - Stomach adenocarcinoma(10;0.000512)			TTAATTGTATATGAGTTGGAT	0.308																																					p.H436H		Atlas-SNP	.											.	ASZ1	56	.	0			c.T1308C						.						88.0	85.0	86.0					7																	117003770		2202	4298	6500	SO:0001819	synonymous_variant	136991	exon13			TTGTATATGAGTT	AF461259	CCDS5772.1	7q31.2	2013-01-10	2005-03-15	2004-07-16	ENSG00000154438	ENSG00000154438		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	1350	protein-coding gene	gene with protein product		605797	"""ankyrin-like 1"""	C7orf7, ANKL1		12040005, 11279520	Standard	NM_130768		Approved	Orf3, GASZ, ALP1, CT1.19	uc003vjb.2	Q8WWH4	OTTHUMG00000064565	ENST00000284629.2:c.1308T>C	chr7.hg19:g.117003770A>G		73.0	0.0		85.0	26.0	NM_130768		Silent	SNP	ENST00000284629.2	hg19	CCDS5772.1																																																																																			.	.		0.308	ASZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000138907.7	NM_130768	
CTTNBP2	83992	hgsc.bcm.edu	37	7	117407202	117407202	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr7:117407202C>A	ENST00000160373.3	-	9	2898	c.2807G>T	c.(2806-2808)gGa>gTa	p.G936V		NM_033427.2	NP_219499.1	Q8WZ74	CTTB2_HUMAN	cortactin binding protein 2	936					brain development (GO:0007420)	cell projection (GO:0042995)|synaptic vesicle (GO:0008021)				breast(3)|central_nervous_system(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(36)|ovary(4)|prostate(5)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	83	Lung NSC(10;0.0018)|all_lung(10;0.002)			LUSC - Lung squamous cell carcinoma(290;0.133)		CTCAAGCCCTCCGTGCCTACA	0.443																																					p.G936V		Atlas-SNP	.											.	CTTNBP2	200	.	0			c.G2807T						.						159.0	135.0	143.0					7																	117407202		2203	4300	6503	SO:0001583	missense	83992	exon9			AGCCCTCCGTGCC		CCDS5774.1	7q31	2013-01-10	2004-06-08	2004-06-09	ENSG00000077063	ENSG00000077063		"""Ankyrin repeat domain containing"""	15679	protein-coding gene	gene with protein product		609772	"""cortactin binding protein 2"""	CORTBP2, C7orf8		11707066	Standard	XM_005250635		Approved	KIAA1758, Orf4	uc003vjf.3	Q8WZ74	OTTHUMG00000022880	ENST00000160373.3:c.2807G>T	chr7.hg19:g.117407202C>A	ENSP00000160373:p.Gly936Val	72.0	0.0		76.0	32.0	NM_033427	O43389|Q7LG11|Q9C0A5	Missense_Mutation	SNP	ENST00000160373.3	hg19	CCDS5774.1	.	.	.	.	.	.	.	.	.	.	C	14.64	2.596853	0.46318	.	.	ENSG00000077063	ENST00000160373	T	0.68479	-0.33	5.64	2.85	0.33270	Ankyrin repeat-containing domain (2);	0.482216	0.27946	N	0.017217	T	0.74696	0.3750	H	0.96080	3.765	0.51482	D	0.999928	P	0.40000	0.698	B	0.38803	0.282	T	0.76623	-0.2891	10	0.72032	D	0.01	-1.6332	9.2559	0.37584	0.0:0.7483:0.1205:0.1312	.	936	Q8WZ74	CTTB2_HUMAN	V	936	ENSP00000160373:G936V	ENSP00000160373:G936V	G	-	2	0	CTTNBP2	117194438	0.990000	0.36364	0.236000	0.24074	0.657000	0.38888	2.282000	0.43461	0.412000	0.25729	0.561000	0.74099	GGA	.	.		0.443	CTTNBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059201.4	NM_033427	
PTPRZ1	5803	hgsc.bcm.edu	37	7	121653036	121653036	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr7:121653036T>A	ENST00000393386.2	+	12	4347	c.3936T>A	c.(3934-3936)ttT>ttA	p.F1312L	PTPRZ1_ENST00000449182.1_Intron|PTPRZ1_ENST00000483028.1_3'UTR	NM_001206838.1|NM_002851.2	NP_001193767.1|NP_002842.2	P23471	PTPRZ_HUMAN	protein tyrosine phosphatase, receptor-type, Z polypeptide 1	1312					axonogenesis (GO:0007409)|central nervous system development (GO:0007417)|hematopoietic progenitor cell differentiation (GO:0002244)|learning or memory (GO:0007611)|oligodendrocyte differentiation (GO:0048709)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of oligodendrocyte progenitor proliferation (GO:0070445)	integral component of plasma membrane (GO:0005887)|perineuronal net (GO:0072534)|proteinaceous extracellular matrix (GO:0005578)	protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|breast(3)|central_nervous_system(4)|cervix(1)|endometrium(4)|kidney(12)|large_intestine(17)|liver(1)|lung(42)|ovary(4)|prostate(5)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(2)	106						GGCATGTATTTGCTACACCTG	0.383																																					p.F1312L		Atlas-SNP	.											.	PTPRZ1	605	.	0			c.T3936A						.						79.0	71.0	73.0					7																	121653036		2203	4300	6503	SO:0001583	missense	5803	exon12			TGTATTTGCTACA	M93426	CCDS34740.1, CCDS56505.1	7q31.3	2013-02-11			ENSG00000106278	ENSG00000106278		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9685	protein-coding gene	gene with protein product		176891		PTPZ, PTPRZ		7736789, 8387522	Standard	NM_001206838		Approved	PTP18, RPTPB, phosphacan	uc003vjy.3	P23471	OTTHUMG00000157057	ENST00000393386.2:c.3936T>A	chr7.hg19:g.121653036T>A	ENSP00000377047:p.Phe1312Leu	157.0	0.0		146.0	57.0	NM_002851	A4D0W5|C9JFM0|O76043|Q9UDR6	Missense_Mutation	SNP	ENST00000393386.2	hg19	CCDS34740.1	.	.	.	.	.	.	.	.	.	.	T	9.781	1.175386	0.21704	.	.	ENSG00000106278	ENST00000393386	T	0.39592	1.07	5.79	3.31	0.37934	.	0.597034	0.16565	N	0.208877	T	0.31670	0.0804	L	0.45137	1.4	0.30930	N	0.726991	B	0.22480	0.07	B	0.15870	0.014	T	0.25328	-1.0135	10	0.25751	T	0.34	.	8.5541	0.33469	0.1235:0.0:0.4066:0.4699	.	1312	P23471	PTPRZ_HUMAN	L	1312	ENSP00000377047:F1312L	ENSP00000377047:F1312L	F	+	3	2	PTPRZ1	121440272	0.170000	0.23016	0.799000	0.32177	0.059000	0.15707	0.637000	0.24659	0.377000	0.24735	0.454000	0.30748	TTT	.	.		0.383	PTPRZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347288.1	NM_002851	
FAM71F2	346653	hgsc.bcm.edu	37	7	128323061	128323061	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr7:128323061A>G	ENST00000480462.1	+	5	884	c.778A>G	c.(778-780)Aag>Gag	p.K260E	FAM71F2_ENST00000378704.3_Missense_Mutation_p.K251E|FAM71F2_ENST00000477515.1_3'UTR			Q6NXP2	F71F2_HUMAN	family with sequence similarity 71, member F2	260										NS(1)|cervix(1)|kidney(1)|large_intestine(2)|lung(2)	7						CAGCAGCTACAAGATACCCTC	0.453																																					p.K260E		Atlas-SNP	.											.	FAM71F2	19	.	0			c.A778G						.						52.0	50.0	51.0					7																	128323061		1889	4116	6005	SO:0001583	missense	346653	exon5			AGCTACAAGATAC	BC047310	CCDS47701.1, CCDS47702.1	7q32.1	2009-04-17	2007-11-20	2007-11-20	ENSG00000205085	ENSG00000205085			27998	protein-coding gene	gene with protein product			"""family with sequence similarity 137, member B"""	FAM137B		12477932	Standard	XM_006715964		Approved		uc003vnk.4	Q6NXP2	OTTHUMG00000158275	ENST00000480462.1:c.778A>G	chr7.hg19:g.128323061A>G	ENSP00000420140:p.Lys260Glu	111.0	0.0		77.0	39.0	NM_001012454	Q0VGF6|Q0VGF7|Q86X39	Missense_Mutation	SNP	ENST00000480462.1	hg19	CCDS47701.1	.	.	.	.	.	.	.	.	.	.	A	10.87	1.473311	0.26423	.	.	ENSG00000205085	ENST00000474069;ENST00000480462;ENST00000378704;ENST00000434001	T;T;T;T	0.07444	3.19;3.19;3.19;3.19	3.41	-0.587	0.11690	.	3.223590	0.00866	N	0.001961	T	0.06962	0.0177	L	0.29908	0.895	0.09310	N	1	B;B	0.21606	0.058;0.035	B;B	0.22601	0.04;0.018	T	0.39057	-0.9632	10	0.72032	D	0.01	-12.1893	0.6937	0.00896	0.4624:0.2118:0.1208:0.2051	.	251;260	Q6NXP2-2;Q6NXP2	.;F71F2_HUMAN	E	251;260;251;251	ENSP00000418907:K251E;ENSP00000420140:K260E;ENSP00000367976:K251E;ENSP00000401654:K251E	ENSP00000367976:K251E	K	+	1	0	FAM71F2	128110297	0.021000	0.18746	0.000000	0.03702	0.160000	0.22226	0.739000	0.26173	-0.090000	0.12462	0.456000	0.33151	AAG	.	.		0.453	FAM71F2-001	KNOWN	non_canonical_conserved|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000350537.1		
CCDC136	64753	hgsc.bcm.edu	37	7	128434789	128434789	+	Nonsense_Mutation	SNP	G	G	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr7:128434789G>T	ENST00000297788.4	+	3	680	c.313G>T	c.(313-315)Gag>Tag	p.E105*	CCDC136_ENST00000378685.4_Nonsense_Mutation_p.E155*|CCDC136_ENST00000487361.1_Nonsense_Mutation_p.E105*|CCDC136_ENST00000464832.1_Nonsense_Mutation_p.E155*	NM_022742.4	NP_073579	Q96JN2	CC136_HUMAN	coiled-coil domain containing 136	105	Glu-rich.					integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)				breast(2)|endometrium(3)|kidney(1)|large_intestine(4)|lung(11)|ovary(3)	24						CCAGCAGGCAGAGGTGTTCAC	0.597																																					p.E155X		Atlas-SNP	.											.	CCDC136	170	.	0			c.G463T						.						23.0	27.0	25.0					7																	128434789		1748	3622	5370	SO:0001587	stop_gained	64753	exon4			CAGGCAGAGGTGT		CCDS47704.1, CCDS56510.1	7q33	2007-08-01			ENSG00000128596	ENSG00000128596			22225	protein-coding gene	gene with protein product		611902				15112360	Standard	NM_022742		Approved	KIAA1793, NAG6, DKFZP434G156	uc003vnv.2	Q96JN2	OTTHUMG00000158310	ENST00000297788.4:c.313G>T	chr7.hg19:g.128434789G>T	ENSP00000297788:p.Glu105*	314.0	1.0		222.0	83.0	NM_001201372	A4D1K1|A7MCY7|A8MYA7|Q6ZVK7|Q9H8M3|Q9UFE1	Nonsense_Mutation	SNP	ENST00000297788.4	hg19	CCDS47704.1	.	.	.	.	.	.	.	.	.	.	g	37	6.335248	0.97485	.	.	ENSG00000128596	ENST00000485998;ENST00000378685;ENST00000464832;ENST00000487361;ENST00000297788;ENST00000397697;ENST00000320524	.	.	.	4.45	4.45	0.53987	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.52906	T	0.07	-17.3837	14.6123	0.68524	0.0:0.0:1.0:0.0	.	.	.	.	X	105;155;155;105;105;105;105	.	ENSP00000297788:E105X	E	+	1	0	CCDC136	128222025	1.000000	0.71417	1.000000	0.80357	0.919000	0.55068	8.160000	0.89653	2.017000	0.59298	0.586000	0.80456	GAG	.	.		0.597	CCDC136-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000350641.1	NM_022742	
CCDC136	64753	hgsc.bcm.edu	37	7	128450365	128450365	+	Missense_Mutation	SNP	T	T	G			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr7:128450365T>G	ENST00000297788.4	+	12	2340	c.1973T>G	c.(1972-1974)tTg>tGg	p.L658W	CCDC136_ENST00000378685.4_Intron|CCDC136_ENST00000487361.1_Intron|CCDC136_ENST00000464832.1_Intron	NM_022742.4	NP_073579	Q96JN2	CC136_HUMAN	coiled-coil domain containing 136	658						integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)				breast(2)|endometrium(3)|kidney(1)|large_intestine(4)|lung(11)|ovary(3)	24						CAGGAAGTGTTGGAGAATCCC	0.428																																					p.L658W		Atlas-SNP	.											.	CCDC136	170	.	0			c.T1973G						.						66.0	63.0	64.0					7																	128450365		1952	4151	6103	SO:0001583	missense	64753	exon12			AAGTGTTGGAGAA		CCDS47704.1, CCDS56510.1	7q33	2007-08-01			ENSG00000128596	ENSG00000128596			22225	protein-coding gene	gene with protein product		611902				15112360	Standard	NM_022742		Approved	KIAA1793, NAG6, DKFZP434G156	uc003vnv.2	Q96JN2	OTTHUMG00000158310	ENST00000297788.4:c.1973T>G	chr7.hg19:g.128450365T>G	ENSP00000297788:p.Leu658Trp	149.0	0.0		158.0	69.0	NM_022742	A4D1K1|A7MCY7|A8MYA7|Q6ZVK7|Q9H8M3|Q9UFE1	Missense_Mutation	SNP	ENST00000297788.4	hg19	CCDS47704.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	19.15|19.15	3.771022|3.771022	0.69992|0.69992	.|.	.|.	ENSG00000128596|ENSG00000128596	ENST00000297788;ENST00000397697;ENST00000320524;ENST00000464672|ENST00000494552	T;T|.	0.45668|.	0.89;0.89|.	5.96|5.96	4.81|4.81	0.61882|0.61882	.|.	0.834039|.	0.10426|.	N|.	0.676027|.	T|T	0.47135|0.47135	0.1429|0.1429	M|M	0.62723|0.62723	1.935|1.935	0.19775|0.19775	N|N	0.999954|0.999954	D;D|.	0.76494|.	0.997;0.999|.	D;D|.	0.70935|.	0.958;0.971|.	T|T	0.38478|0.38478	-0.9659|-0.9659	10|5	0.66056|.	D|.	0.02|.	-1.4696|-1.4696	8.769|8.769	0.34719|0.34719	0.0:0.0847:0.0:0.9153|0.0:0.0847:0.0:0.9153	.|.	658;658|.	Q96JN2-2;Q96JN2|.	.;CC136_HUMAN|.	W|G	658;658;658;249|535	ENSP00000297788:L658W;ENSP00000417991:L249W|.	ENSP00000297788:L658W|.	L|W	+|+	2|1	0|0	CCDC136|CCDC136	128237601|128237601	1.000000|1.000000	0.71417|0.71417	0.959000|0.959000	0.39883|0.39883	0.031000|0.031000	0.12232|0.12232	2.138000|2.138000	0.42140|0.42140	1.080000|1.080000	0.41073|0.41073	0.533000|0.533000	0.62120|0.62120	TTG|TGG	.	.		0.428	CCDC136-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000350641.1	NM_022742	
ATP6V1F	9296	hgsc.bcm.edu	37	7	128505618	128505618	+	Nonsense_Mutation	SNP	G	G	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr7:128505618G>T	ENST00000249289.4	+	2	425	c.346G>T	c.(346-348)Gaa>Taa	p.E116*	RP11-309L24.2_ENST00000469965.1_RNA|RP11-309L24.4_ENST00000461420.1_lincRNA|ATP6V1F_ENST00000492758.1_Nonsense_Mutation_p.E144*	NM_004231.3	NP_004222.2	Q16864	VATF_HUMAN	ATPase, H+ transporting, lysosomal 14kDa, V1 subunit F	116					ATP catabolic process (GO:0006200)|ATP hydrolysis coupled proton transport (GO:0015991)|cellular iron ion homeostasis (GO:0006879)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|proton transport (GO:0015992)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|proton-transporting two-sector ATPase complex (GO:0016469)|proton-transporting V-type ATPase, V1 domain (GO:0033180)|vacuolar proton-transporting V-type ATPase complex (GO:0016471)	ATPase activity, uncoupled (GO:0042624)|hydrogen ion transmembrane transporter activity (GO:0015078)|proton-transporting ATPase activity, rotational mechanism (GO:0046961)			lung(1)|ovary(1)|prostate(1)	3						GTTCACTGCCGAAGACCTGCG	0.612																																					p.E144X		Atlas-SNP	.											.	ATP6V1F	12	.	0			c.G430T						.						34.0	36.0	35.0					7																	128505618		2203	4300	6503	SO:0001587	stop_gained	9296	exon3			ACTGCCGAAGACC	D49400	CCDS5807.1, CCDS56511.1	7q32.1	2010-04-21	2002-08-29		ENSG00000128524	ENSG00000128524	3.6.3.14	"""ATPases / V-type"""	16832	protein-coding gene	gene with protein product		607160				8581736, 8621738	Standard	NM_004231		Approved	ATP6S14, VATF, Vma7	uc022all.1	Q16864	OTTHUMG00000158365	ENST00000249289.4:c.346G>T	chr7.hg19:g.128505618G>T	ENSP00000249289:p.Glu116*	79.0	0.0		64.0	27.0	NM_001198909	C9J2K4|Q6IBA8	Nonsense_Mutation	SNP	ENST00000249289.4	hg19	CCDS5807.1	.	.	.	.	.	.	.	.	.	.	G	18.38	3.611828	0.66558	.	.	ENSG00000128524	ENST00000249289;ENST00000492758	.	.	.	4.84	4.84	0.62591	.	0.103516	0.64402	D	0.000005	.	.	.	.	.	.	0.58432	D	0.999999	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	-17.0803	16.713	0.85389	0.0:0.0:1.0:0.0	.	.	.	.	X	116;144	.	ENSP00000249289:E116X	E	+	1	0	ATP6V1F	128292854	1.000000	0.71417	0.940000	0.37924	0.702000	0.40608	8.976000	0.93442	2.227000	0.72691	0.591000	0.81541	GAA	.	.		0.612	ATP6V1F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350800.1	NM_004231	
PLXNA4	91584	hgsc.bcm.edu	37	7	131908376	131908376	+	Silent	SNP	T	T	C			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr7:131908376T>C	ENST00000359827.3	-	9	2969	c.2007A>G	c.(2005-2007)ccA>ccG	p.P669P	PLXNA4_ENST00000321063.4_Silent_p.P669P			Q9HCM2	PLXA4_HUMAN	plexin A4	669	PSI 2.				anterior commissure morphogenesis (GO:0021960)|axon guidance (GO:0007411)|chemorepulsion of branchiomotor axon (GO:0021793)|facial nerve structural organization (GO:0021612)|glossopharyngeal nerve morphogenesis (GO:0021615)|postganglionic parasympathetic nervous system development (GO:0021784)|regulation of axon extension involved in axon guidance (GO:0048841)|regulation of negative chemotaxis (GO:0050923)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|sympathetic nervous system development (GO:0048485)|trigeminal nerve structural organization (GO:0021637)|vagus nerve morphogenesis (GO:0021644)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	semaphorin receptor activity (GO:0017154)			NS(1)|breast(1)|endometrium(3)|kidney(4)|large_intestine(14)|lung(17)|ovary(1)|prostate(2)|skin(1)|stomach(1)	45						GGCAGCGGTATGGACTCTCCA	0.587																																					p.P669P		Atlas-SNP	.											.	PLXNA4	873	.	0			c.A2007G						.						38.0	41.0	40.0					7																	131908376		2105	4254	6359	SO:0001819	synonymous_variant	91584	exon9			GCGGTATGGACTC	AB046770, AK123428	CCDS5826.1, CCDS43646.1, CCDS43647.1	7q32.3	2007-09-26	2007-09-26	2007-09-26	ENSG00000221866	ENSG00000221866		"""Plexins"""	9102	protein-coding gene	gene with protein product		604280	"""plexin A4, A"", ""plexin A4, B"""	PLXNA4A, PLXNA4B			Standard	NM_181775		Approved	KIAA1550, DKFZp434G0625PRO34003, FAYV2820	uc003vra.4	Q9HCM2	OTTHUMG00000155108	ENST00000359827.3:c.2007A>G	chr7.hg19:g.131908376T>C		135.0	0.0		84.0	50.0	NM_020911	A4D1N6|E9PAM2|Q6UWC6|Q6ZW89|Q8N969|Q8ND00|Q8NEN3|Q9NTD4	Silent	SNP	ENST00000359827.3	hg19	CCDS43646.1																																																																																			.	.		0.587	PLXNA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338422.2	NM_181775	
SLC37A3	84255	hgsc.bcm.edu	37	7	140048534	140048534	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr7:140048534T>C	ENST00000326232.9	-	10	1119	c.916A>G	c.(916-918)Aat>Gat	p.N306D	SLC37A3_ENST00000340308.3_Missense_Mutation_p.N306D|SLC37A3_ENST00000429996.2_3'UTR|SLC37A3_ENST00000447932.2_Missense_Mutation_p.N306D	NM_207113.1	NP_996996.1	Q8NCC5	SPX3_HUMAN	solute carrier family 37, member 3	306					carbohydrate transport (GO:0008643)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)	transporter activity (GO:0005215)			endometrium(4)|kidney(1)|large_intestine(5)|lung(7)|ovary(3)|prostate(1)|stomach(3)	24	Melanoma(164;0.0142)					AAGGAGTAATTCACTAACTTC	0.473																																					p.N306D	Esophageal Squamous(133;211 1716 4665 11387 37873)	Atlas-SNP	.											.	SLC37A3	80	.	0			c.A916G						.						103.0	95.0	97.0					7																	140048534		2203	4300	6503	SO:0001583	missense	84255	exon10			AGTAATTCACTAA	AK074823	CCDS5858.1, CCDS5859.1, CCDS75669.1	7q34	2013-07-17	2013-07-17		ENSG00000157800	ENSG00000157800		"""Solute carriers"""	20651	protein-coding gene	gene with protein product							Standard	NM_001287498		Approved	DKFZp761N0624	uc003vvo.3	Q8NCC5	OTTHUMG00000157343	ENST00000326232.9:c.916A>G	chr7.hg19:g.140048534T>C	ENSP00000321498:p.Asn306Asp	120.0	0.0		90.0	44.0	NM_207113	Q6PIU7|Q86SS4|Q9BQG7	Missense_Mutation	SNP	ENST00000326232.9	hg19	CCDS5859.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	29.1|29.1	4.980061|4.980061	0.92982|0.92982	.|.	.|.	ENSG00000157800|ENSG00000157800	ENST00000340308;ENST00000447932;ENST00000326232|ENST00000485734;ENST00000485861	T;T;T|.	0.58210|.	0.35;0.35;0.35|.	5.02|5.02	5.02|5.02	0.67125|0.67125	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);|.	0.098057|.	0.64402|.	D|.	0.000002|.	T|.	0.79358|.	0.4432|.	M|M	0.87900|0.87900	2.915|2.915	0.80722|0.80722	D|D	1|1	D;D;D|.	0.76494|.	0.994;0.972;0.999|.	D;P;D|.	0.67382|.	0.919;0.907;0.951|.	T|.	0.82772|.	-0.0292|.	10|.	0.62326|.	D|.	0.03|.	-30.227|-30.227	14.769|14.769	0.69662|0.69662	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	306;306;306|.	Q8NCC5-2;Q8NCC5-3;Q8NCC5|.	.;.;SPX3_HUMAN|.	D|W	306|84;142	ENSP00000343358:N306D;ENSP00000397481:N306D;ENSP00000321498:N306D|.	ENSP00000321498:N306D|.	N|X	-|-	1|3	0|0	SLC37A3|SLC37A3	139695003|139695003	1.000000|1.000000	0.71417|0.71417	0.945000|0.945000	0.38365|0.38365	0.917000|0.917000	0.54804|0.54804	7.897000|7.897000	0.87356|0.87356	1.898000|1.898000	0.54952|0.54952	0.379000|0.379000	0.24179|0.24179	AAT|TGA	.	.		0.473	SLC37A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348492.1	NM_032295	
DENND2A	27147	hgsc.bcm.edu	37	7	140285439	140285439	+	Silent	SNP	A	A	G			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr7:140285439A>G	ENST00000275884.6	-	4	1612	c.1195T>C	c.(1195-1197)Ttg>Ctg	p.L399L	DENND2A_ENST00000537639.1_Silent_p.L399L|DENND2A_ENST00000496613.1_Silent_p.L399L|DENND2A_ENST00000492720.1_Silent_p.L399L			Q9ULE3	DEN2A_HUMAN	DENN/MADD domain containing 2A	399					positive regulation of Rab GTPase activity (GO:0032851)|protein transport (GO:0015031)|retrograde transport, endosome to Golgi (GO:0042147)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)			breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(22)|ovary(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	49	Melanoma(164;0.00956)					GGAAAATTCAAGACACACTTC	0.527																																					p.L399L		Atlas-SNP	.											.	DENND2A	132	.	0			c.T1195C						.						173.0	174.0	174.0					7																	140285439		1988	4167	6155	SO:0001819	synonymous_variant	27147	exon3			AATTCAAGACACA	AB033103	CCDS43659.1	7q34	2012-10-03	2005-08-17	2005-08-17	ENSG00000146966	ENSG00000146966		"""DENN/MADD domain containing"""	22212	protein-coding gene	gene with protein product			"""KIAA1277"""	KIAA1277			Standard	NM_015689		Approved	FAM31D	uc010lnj.3	Q9ULE3	OTTHUMG00000157411	ENST00000275884.6:c.1195T>C	chr7.hg19:g.140285439A>G		144.0	0.0		134.0	51.0	NM_015689	C9JUI3|Q1RMD5|Q86XY0	Silent	SNP	ENST00000275884.6	hg19	CCDS43659.1																																																																																			.	.		0.527	DENND2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348742.1	NM_015689	
MGAM	8972	hgsc.bcm.edu	37	7	141755835	141755835	+	Silent	SNP	C	C	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr7:141755835C>T	ENST00000549489.2	+	29	3614	c.3519C>T	c.(3517-3519)taC>taT	p.Y1173Y	MGAM_ENST00000475668.2_Silent_p.Y1173Y	NM_004668.2	NP_004659.2	O43451	MGA_HUMAN	maltase-glucoamylase (alpha-glucosidase)	1173	Glucoamylase.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)|starch catabolic process (GO:0005983)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|amylase activity (GO:0016160)|carbohydrate binding (GO:0030246)|catalytic activity (GO:0003824)|glucan 1,4-alpha-glucosidase activity (GO:0004339)|maltose alpha-glucosidase activity (GO:0032450)			cervix(1)|endometrium(1)|large_intestine(4)|lung(3)|ovary(2)|skin(2)	13	Melanoma(164;0.0272)				Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)	ACCCCTACTACATGGGGCTGG	0.512																																					p.Y1173Y		Atlas-SNP	.											.	MGAM	767	.	0			c.C3519T						.						35.0	33.0	34.0					7																	141755835		1924	4129	6053	SO:0001819	synonymous_variant	8972	exon29			CTACTACATGGGG	AF016833	CCDS47727.1	7q34	2012-10-03			ENSG00000257335	ENSG00000257335			7043	protein-coding gene	gene with protein product		154360				9446624	Standard	NM_004668		Approved	MGA	uc003vwy.3	O43451	OTTHUMG00000158395	ENST00000549489.2:c.3519C>T	chr7.hg19:g.141755835C>T		70.0	0.0		54.0	19.0	NM_004668	Q0VAX6|Q75ME7|Q86UM5	Silent	SNP	ENST00000549489.2	hg19	CCDS47727.1																																																																																			.	.		0.512	MGAM-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000351244.3		
MGAM	8972	hgsc.bcm.edu	37	7	141764190	141764190	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr7:141764190A>G	ENST00000549489.2	+	37	4447	c.4352A>G	c.(4351-4353)gAg>gGg	p.E1451G	MGAM_ENST00000475668.2_Missense_Mutation_p.E1451G	NM_004668.2	NP_004659.2	O43451	MGA_HUMAN	maltase-glucoamylase (alpha-glucosidase)	1451	Glucoamylase.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)|starch catabolic process (GO:0005983)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|amylase activity (GO:0016160)|carbohydrate binding (GO:0030246)|catalytic activity (GO:0003824)|glucan 1,4-alpha-glucosidase activity (GO:0004339)|maltose alpha-glucosidase activity (GO:0032450)			cervix(1)|endometrium(1)|large_intestine(4)|lung(3)|ovary(2)|skin(2)	13	Melanoma(164;0.0272)				Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)	TCAGATTTGGAGTCCAGGGAC	0.552																																					p.E1451G		Atlas-SNP	.											.	MGAM	767	.	0			c.A4352G						.						27.0	29.0	28.0					7																	141764190		1941	4144	6085	SO:0001583	missense	8972	exon37			ATTTGGAGTCCAG	AF016833	CCDS47727.1	7q34	2012-10-03			ENSG00000257335	ENSG00000257335			7043	protein-coding gene	gene with protein product		154360				9446624	Standard	NM_004668		Approved	MGA	uc003vwy.3	O43451	OTTHUMG00000158395	ENST00000549489.2:c.4352A>G	chr7.hg19:g.141764190A>G	ENSP00000447378:p.Glu1451Gly	100.0	0.0		70.0	29.0	NM_004668	Q0VAX6|Q75ME7|Q86UM5	Missense_Mutation	SNP	ENST00000549489.2	hg19	CCDS47727.1	.	.	.	.	.	.	.	.	.	.	A	1.803	-0.476478	0.04414	.	.	ENSG00000257335	ENST00000549489;ENST00000475668;ENST00000548812	D	0.90004	-2.6	4.26	1.56	0.23342	Glycoside hydrolase, superfamily (1);	.	.	.	.	T	0.76535	0.4001	N	0.05554	-0.025	0.32055	N	0.596443	B	0.26363	0.147	B	0.31751	0.135	T	0.70400	-0.4882	9	0.23302	T	0.38	.	8.6294	0.33911	0.6233:0.3767:0.0:0.0	.	1451	O43451	MGA_HUMAN	G	1451;1451;1328	ENSP00000447378:E1451G	ENSP00000316431:E1328G	E	+	2	0	MGAM	141410659	0.846000	0.29590	0.076000	0.20297	0.153000	0.21895	1.801000	0.38843	0.460000	0.27045	0.260000	0.18958	GAG	.	.		0.552	MGAM-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000351244.3		
EPHB6	2051	hgsc.bcm.edu	37	7	142563375	142563375	+	Silent	SNP	C	C	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr7:142563375C>T	ENST00000392957.2	+	8	1879	c.1092C>T	c.(1090-1092)gcC>gcT	p.A364A	EPHB6_ENST00000442129.1_Silent_p.A364A|EPHB6_ENST00000411471.2_Silent_p.A87A	NM_004445.3	NP_004436.3	O15197	EPHB6_HUMAN	EPH receptor B6	364	Cys-rich.					extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)|receptor activity (GO:0004872)			NS(1)|breast(1)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(9)|lung(46)|ovary(2)|pancreas(2)|prostate(1)|skin(9)|stomach(1)|upper_aerodigestive_tract(1)	87	Melanoma(164;0.059)					CACCAGAGGCCCCCTGCACTG	0.652																																					p.A364A		Atlas-SNP	.											.	EPHB6	168	.	0			c.C1092T						.						25.0	26.0	25.0					7																	142563375		2203	4300	6503	SO:0001819	synonymous_variant	2051	exon8			AGAGGCCCCCTGC	D83492	CCDS5873.2, CCDS75672.1	7q33-q35	2013-02-11	2004-10-28		ENSG00000106123	ENSG00000106123		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3396	protein-coding gene	gene with protein product		602757	"""EphB6"""				Standard	XM_006715881		Approved	HEP	uc011kst.2	O15197	OTTHUMG00000155707	ENST00000392957.2:c.1092C>T	chr7.hg19:g.142563375C>T		97.0	0.0		44.0	13.0	NM_004445	A4D2I7|A8CDT5|D3DXD3|Q2TB23|Q2TB24	Silent	SNP	ENST00000392957.2	hg19	CCDS5873.2																																																																																			.	.		0.652	EPHB6-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341329.1		
CLCN1	1180	hgsc.bcm.edu	37	7	143044041	143044041	+	Splice_Site	SNP	A	A	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr7:143044041A>T	ENST00000343257.2	+	20	2489	c.2402A>T	c.(2401-2403)gAg>gTg	p.E801V		NM_000083.2	NP_000074	P35523	CLCN1_HUMAN	chloride channel, voltage-sensitive 1	801					chloride transmembrane transport (GO:1902476)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|neuronal action potential propagation (GO:0019227)|regulation of anion transport (GO:0044070)|transmembrane transport (GO:0055085)|transport (GO:0006810)	chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)	adenyl nucleotide binding (GO:0030554)|chloride channel activity (GO:0005254)|voltage-gated chloride channel activity (GO:0005247)			breast(4)|central_nervous_system(1)|endometrium(1)|large_intestine(11)|lung(26)|ovary(3)|prostate(2)|skin(7)|stomach(1)|upper_aerodigestive_tract(2)	58	Melanoma(164;0.205)					TCACCTGAAGAGGTGAGTAAG	0.393																																					p.E801V		Atlas-SNP	.											.	CLCN1	141	.	0			c.A2402T						.						144.0	146.0	145.0					7																	143044041		2203	4300	6503	SO:0001630	splice_region_variant	1180	exon20			CTGAAGAGGTGAG	Z25884	CCDS5881.1	7q12	2012-09-26	2012-02-23		ENSG00000188037	ENSG00000188037		"""Ion channels / Chloride channels : Voltage-sensitive"""	2019	protein-coding gene	gene with protein product	"""Thomsen disease, autosomal dominant"""	118425	"""chloride channel 1, skeletal muscle"""			1379744	Standard	NM_000083		Approved	CLC1, ClC-1	uc003wcr.1	P35523	OTTHUMG00000152695	ENST00000343257.2:c.2403+1A>T	chr7.hg19:g.143044041A>T		118.0	0.0		64.0	30.0	NM_000083	A4D2H5|Q2M202	Missense_Mutation	SNP	ENST00000343257.2	hg19	CCDS5881.1	.	.	.	.	.	.	.	.	.	.	A	22.6	4.315402	0.81358	.	.	ENSG00000188037	ENST00000343257	D	0.90900	-2.75	4.81	4.81	0.61882	.	0.058336	0.64402	D	0.000002	D	0.92658	0.7667	M	0.79805	2.47	0.52099	D	0.999947	D	0.56746	0.977	P	0.51266	0.664	D	0.93479	0.6826	10	0.87932	D	0	.	12.3956	0.55382	1.0:0.0:0.0:0.0	.	801	P35523	CLCN1_HUMAN	V	801	ENSP00000339867:E801V	ENSP00000339867:E801V	E	+	2	0	CLCN1	142754163	1.000000	0.71417	1.000000	0.80357	0.945000	0.59286	6.135000	0.71696	1.934000	0.56057	0.459000	0.35465	GAG	.	.		0.393	CLCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327420.1	NM_000083	Missense_Mutation
OR2F1	26211	hgsc.bcm.edu	37	7	143657623	143657623	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr7:143657623T>A	ENST00000392899.1	+	1	597	c.560T>A	c.(559-561)cTg>cAg	p.L187Q	RP4-669B10.3_ENST00000466281.1_lincRNA	NM_012369.2	NP_036501.2	Q13607	OR2F1_HUMAN	olfactory receptor, family 2, subfamily F, member 1 (gene/pseudogene)	187					signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(18)|ovary(1)|skin(4)	34	Melanoma(164;0.0903)					GTGGTCAGGCTGGCTTGTGTG	0.488																																					p.L187Q		Atlas-SNP	.											.	OR2F1	71	.	0			c.T560A						.						169.0	151.0	157.0					7																	143657623		2203	4300	6503	SO:0001583	missense	26211	exon1			TCAGGCTGGCTTG	U56421	CCDS5887.1	7q35	2013-06-03	2013-06-03		ENSG00000213215	ENSG00000213215		"""GPCR / Class A : Olfactory receptors"""	8246	protein-coding gene	gene with protein product		608497	"""olfactory receptor, family 2, subfamily F, member 1"""	OR2F4, OR2F5, OR2F3, OR2F3P		9500546	Standard	NM_012369		Approved	OLF3, OR7-140, OR7-139, OR14-60	uc003wds.1	Q13607	OTTHUMG00000157771	ENST00000392899.1:c.560T>A	chr7.hg19:g.143657623T>A	ENSP00000376633:p.Leu187Gln	172.0	0.0		161.0	56.0	NM_012369	A4D2G1|Q6IFP7|Q96R49|Q9UDX1	Missense_Mutation	SNP	ENST00000392899.1	hg19	CCDS5887.1	.	.	.	.	.	.	.	.	.	.	T	18.43	3.621801	0.66787	.	.	ENSG00000213215	ENST00000392899	T	0.00411	7.53	5.53	5.53	0.82687	GPCR, rhodopsin-like superfamily (1);	0.000000	0.41396	D	0.000881	T	0.02012	0.0063	H	0.95224	3.64	0.47407	D	0.99941	D	0.89917	1.0	D	0.97110	1.0	T	0.12218	-1.0556	10	0.87932	D	0	-16.5054	13.667	0.62401	0.0:0.0:0.0:1.0	.	187	Q13607	OR2F1_HUMAN	Q	187	ENSP00000376633:L187Q	ENSP00000376633:L187Q	L	+	2	0	OR2F1	143288556	0.389000	0.25205	0.986000	0.45419	0.604000	0.37047	3.867000	0.56047	2.315000	0.78130	0.533000	0.62120	CTG	.	.		0.488	OR2F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349581.1		
OR6B1	135946	hgsc.bcm.edu	37	7	143701238	143701238	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr7:143701238T>A	ENST00000408922.2	+	1	217	c.149T>A	c.(148-150)cTg>cAg	p.L50Q		NM_001005281.1	NP_001005281.1	O95007	OR6B1_HUMAN	olfactory receptor, family 6, subfamily B, member 1	50						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(3)|large_intestine(3)|lung(15)|ovary(2)|skin(2)|urinary_tract(1)	27	Melanoma(164;0.0783)					CTATTGGTGCTGCAAAATCGG	0.488																																					p.L50Q		Atlas-SNP	.											.	OR6B1	60	.	0			c.T149A						.						108.0	106.0	107.0					7																	143701238		2075	4246	6321	SO:0001583	missense	135946	exon1			TGGTGCTGCAAAA		CCDS43667.1	7q33-q35	2012-08-09			ENSG00000221813	ENSG00000221813		"""GPCR / Class A : Olfactory receptors"""	8354	protein-coding gene	gene with protein product							Standard	NM_001005281		Approved	OR7-3	uc003wdt.1	O95007	OTTHUMG00000157765	ENST00000408922.2:c.149T>A	chr7.hg19:g.143701238T>A	ENSP00000386151:p.Leu50Gln	204.0	0.0		165.0	64.0	NM_001005281	A4D2G2|B9EH47|Q6IFP6|Q96R38	Missense_Mutation	SNP	ENST00000408922.2	hg19	CCDS43667.1	.	.	.	.	.	.	.	.	.	.	T	1.959	-0.439292	0.04636	.	.	ENSG00000221813	ENST00000408922	T	0.01106	5.33	5.37	0.277	0.15668	GPCR, rhodopsin-like superfamily (1);	0.481200	0.15043	N	0.283733	T	0.00608	0.0020	N	0.10629	0.01	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.47661	-0.9100	10	0.24483	T	0.36	.	1.1512	0.01786	0.4727:0.1444:0.2415:0.1414	.	50	O95007	OR6B1_HUMAN	Q	50	ENSP00000386151:L50Q	ENSP00000386151:L50Q	L	+	2	0	OR6B1	143332171	0.000000	0.05858	0.732000	0.30844	0.426000	0.31534	0.284000	0.18864	0.144000	0.18951	-0.399000	0.06403	CTG	.	.		0.488	OR6B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349566.1		
OR2A12	346525	hgsc.bcm.edu	37	7	143792917	143792917	+	Silent	SNP	C	C	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr7:143792917C>A	ENST00000408949.2	+	1	777	c.717C>A	c.(715-717)acC>acA	p.T239T		NM_001004135.1	NP_001004135.1	Q8NGT7	O2A12_HUMAN	olfactory receptor, family 2, subfamily A, member 12	239						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(4)|lung(14)|ovary(2)	25	Melanoma(164;0.0783)					CCTTCTCTACCTGCTCCTCCC	0.587																																					p.T239T		Atlas-SNP	.											.	OR2A12	56	.	0			c.C717A						.						145.0	140.0	142.0					7																	143792917		1957	4149	6106	SO:0001819	synonymous_variant	346525	exon1			CTCTACCTGCTCC		CCDS43670.1	7q35	2013-09-20	2002-11-13	2002-11-13	ENSG00000221858	ENSG00000221858		"""GPCR / Class A : Olfactory receptors"""	15082	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily A, member 12 pseudogene"""	OR2A12P			Standard	NM_001004135		Approved		uc011kty.2	Q8NGT7	OTTHUMG00000157996	ENST00000408949.2:c.717C>A	chr7.hg19:g.143792917C>A		173.0	0.0		136.0	44.0	NM_001004135	Q6IF43	Silent	SNP	ENST00000408949.2	hg19	CCDS43670.1																																																																																			.	.		0.587	OR2A12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349969.1		
ZNF786	136051	hgsc.bcm.edu	37	7	148767562	148767562	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr7:148767562T>C	ENST00000491431.1	-	4	2366	c.2302A>G	c.(2302-2304)Aaa>Gaa	p.K768E	ZNF786_ENST00000451334.3_Missense_Mutation_p.K731E|ZNF786_ENST00000316286.9_Missense_Mutation_p.K682E	NM_152411.3	NP_689624.2	Q8N393	ZN786_HUMAN	zinc finger protein 786	768					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|cervix(1)|kidney(1)|large_intestine(3)|lung(10)|prostate(2)|skin(2)|soft_tissue(1)|urinary_tract(2)	26	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00463)			CTGAGCCTTTTCTTAATGTCC	0.483																																					p.K768E		Atlas-SNP	.											.	ZNF786	69	.	0			c.A2302G						.						265.0	254.0	257.0					7																	148767562		1977	4180	6157	SO:0001583	missense	136051	exon4			GCCTTTTCTTAAT	AK095701, AL834510	CCDS47738.1	7q36.1	2013-01-08			ENSG00000197362	ENSG00000197362		"""Zinc fingers, C2H2-type"", ""-"""	21806	protein-coding gene	gene with protein product							Standard	NM_152411		Approved	DKFZp762I137	uc003wfh.2	Q8N393	OTTHUMG00000158975	ENST00000491431.1:c.2302A>G	chr7.hg19:g.148767562T>C	ENSP00000417470:p.Lys768Glu	111.0	0.0		138.0	58.0	NM_152411	A1A568|B4DMI1	Missense_Mutation	SNP	ENST00000491431.1	hg19	CCDS47738.1	.	.	.	.	.	.	.	.	.	.	T	15.96	2.986190	0.53934	.	.	ENSG00000197362	ENST00000316286;ENST00000491431;ENST00000451334	T;T;T	0.08807	3.05;3.2;3.1	4.62	0.63	0.17693	.	0.215648	0.23585	N	0.046607	T	0.04998	0.0134	N	0.22421	0.69	0.20074	N	0.999931	B	0.21821	0.061	B	0.18263	0.021	T	0.32375	-0.9909	10	0.66056	D	0.02	-4.7659	5.1927	0.15218	0.0:0.0962:0.3522:0.5515	.	768	Q8N393	ZN786_HUMAN	E	682;768;731	ENSP00000313516:K682E;ENSP00000417470:K768E;ENSP00000404984:K731E	ENSP00000313516:K682E	K	-	1	0	ZNF786	148398495	0.000000	0.05858	0.830000	0.32933	0.644000	0.38419	0.019000	0.13444	0.295000	0.22570	0.482000	0.46254	AAA	.	.		0.483	ZNF786-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352751.1	NM_152411	
FASTK	10922	hgsc.bcm.edu	37	7	150774867	150774867	+	Splice_Site	SNP	C	C	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr7:150774867C>T	ENST00000297532.6	-	6	1117	c.1040G>A	c.(1039-1041)gGc>gAc	p.G347D	FASTK_ENST00000489884.1_5'UTR|RP11-148K1.12_ENST00000485974.1_RNA|FASTK_ENST00000482571.1_Splice_Site_p.G320D|FASTK_ENST00000540185.1_3'UTR|FASTK_ENST00000353841.2_Splice_Site_p.G206D	NM_006712.4	NP_006703.1	Q14296	FASTK_HUMAN	Fas-activated serine/threonine kinase	347					apoptotic signaling pathway (GO:0097190)|protein phosphorylation (GO:0006468)|regulation of RNA splicing (GO:0043484)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|Fas-activated serine/threonine kinase activity (GO:0033867)|protein serine/threonine kinase activity (GO:0004674)			lung(4)|stomach(2)	6			OV - Ovarian serous cystadenocarcinoma(82;0.00989)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)|LUSC - Lung squamous cell carcinoma(290;0.0718)|Lung(243;0.138)		ATGAGGGGTGCCTGTGGGGAG	0.701																																					p.G347D		Atlas-SNP	.											.	FASTK	29	.	0			c.G1040A						.						31.0	38.0	36.0					7																	150774867		2202	4300	6502	SO:0001630	splice_region_variant	10922	exon6			GGGGTGCCTGTGG		CCDS5918.1, CCDS5919.1, CCDS59088.1	7q35	2006-07-06			ENSG00000164896	ENSG00000164896			24676	protein-coding gene	gene with protein product		606965				7544399, 15572676	Standard	NM_006712		Approved	FAST	uc003wix.2	Q14296	OTTHUMG00000158694	ENST00000297532.6:c.1040-1G>A	chr7.hg19:g.150774867C>T		101.0	0.0		88.0	36.0	NM_006712	A8K867|F8VTW9|Q59EM8|Q8IVA0	Missense_Mutation	SNP	ENST00000297532.6	hg19	CCDS5918.1	.	.	.	.	.	.	.	.	.	.	C	14.30	2.494606	0.44352	.	.	ENSG00000164896	ENST00000483105;ENST00000297530;ENST00000353841;ENST00000297532;ENST00000482571	T;T;T	0.30981	1.9;1.89;1.51	4.88	3.99	0.46301	.	0.240441	0.34700	N	0.003741	T	0.18257	0.0438	N	0.14661	0.345	0.80722	D	1	B;B;B	0.09022	0.002;0.001;0.001	B;B;B	0.09377	0.004;0.002;0.002	T	0.04103	-1.0977	10	0.66056	D	0.02	.	9.5801	0.39481	0.0:0.8284:0.0:0.1716	.	320;206;347	F8VTW9;Q8IVA0;Q14296	.;.;FASTK_HUMAN	D	347;347;206;347;320	ENSP00000324817:G206D;ENSP00000297532:G347D;ENSP00000418516:G320D	ENSP00000297530:G347D	G	-	2	0	FASTK	150405800	1.000000	0.71417	1.000000	0.80357	0.947000	0.59692	4.023000	0.57211	1.184000	0.42957	0.655000	0.94253	GGC	.	.		0.701	FASTK-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351832.2	NM_006712	Missense_Mutation
AGAP3	116988	hgsc.bcm.edu	37	7	150839513	150839513	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr7:150839513A>T	ENST00000463381.1	+	14	1568	c.1072A>T	c.(1072-1074)Agc>Tgc	p.S358C	AGAP3_ENST00000397238.2_Missense_Mutation_p.S689C	NM_001281300.1	NP_001268229.1	Q96P47	AGAP3_HUMAN	ArfGAP with GTPase domain, ankyrin repeat and PH domain 3	653	Small GTPase-like.				cellular response to reactive oxygen species (GO:0034614)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein import into nucleus, translocation (GO:0000060)|regulation of ARF GTPase activity (GO:0032312)|small GTPase mediated signal transduction (GO:0007264)	cell periphery (GO:0071944)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	ARF GTPase activator activity (GO:0008060)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|zinc ion binding (GO:0008270)			central_nervous_system(2)|endometrium(3)|kidney(3)|large_intestine(3)|liver(2)|lung(9)|ovary(2)|prostate(3)|urinary_tract(1)	28						AGACTGGGCCAGCCTGAACCT	0.622																																					p.S689C		Atlas-SNP	.											.	AGAP3	121	.	0			c.A2065T						.						36.0	41.0	39.0					7																	150839513		2164	4284	6448	SO:0001583	missense	116988	exon16			TGGGCCAGCCTGA	AF413079	CCDS43681.1, CCDS55185.1, CCDS64802.1	7q36.1	2013-01-11	2008-09-22	2008-09-22	ENSG00000133612	ENSG00000133612		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	16923	protein-coding gene	gene with protein product			"""centaurin, gamma 3"""	CENTG3			Standard	NM_001042535		Approved		uc003wjg.1	Q96P47	OTTHUMG00000158724	ENST00000463381.1:c.1072A>T	chr7.hg19:g.150839513A>T	ENSP00000418016:p.Ser358Cys	110.0	0.0		76.0	9.0	NM_031946	B3KNZ8|E9PAL8|Q59EN0|Q96RK3	Missense_Mutation	SNP	ENST00000463381.1	hg19		.	.	.	.	.	.	.	.	.	.	A	26.5	4.748242	0.89663	.	.	ENSG00000133612	ENST00000463381;ENST00000397232;ENST00000397238;ENST00000335355	T;T	0.55930	0.49;0.49	5.17	5.17	0.71159	.	0.000000	0.85682	D	0.000000	T	0.80829	0.4698	H	0.96398	3.815	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;0.999	D;D;D;D	0.97110	1.0;1.0;1.0;0.997	D	0.87022	0.2129	10	0.87932	D	0	.	14.2194	0.65815	1.0:0.0:0.0:0.0	.	653;188;689;358	Q96P47;E7ETI2;Q96P47-4;B3KNZ8	AGAP3_HUMAN;.;.;.	C	358;188;689;653	ENSP00000418016:S358C;ENSP00000380413:S689C	ENSP00000334157:S653C	S	+	1	0	AGAP3	150470446	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.207000	0.95064	1.948000	0.56530	0.533000	0.62120	AGC	.	.		0.622	AGAP3-002	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000351909.2	NM_031946	
CSMD1	64478	hgsc.bcm.edu	37	8	3889582	3889582	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr8:3889582A>T	ENST00000520002.1	-	4	1010	c.455T>A	c.(454-456)cTg>cAg	p.L152Q	CSMD1_ENST00000602557.1_Missense_Mutation_p.L152Q|CSMD1_ENST00000537824.1_Missense_Mutation_p.L152Q|CSMD1_ENST00000602723.1_Missense_Mutation_p.L152Q|CSMD1_ENST00000539096.1_Missense_Mutation_p.L152Q|CSMD1_ENST00000400186.3_Missense_Mutation_p.L152Q|CSMD1_ENST00000542608.1_Missense_Mutation_p.L152Q			Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1	152	Sushi 1. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		AACTCCTTTCAGGATTTCTCC	0.443																																					p.L152Q		Atlas-SNP	.											.	CSMD1	1469	.	0			c.T455A						.						89.0	94.0	92.0					8																	3889582		1999	4186	6185	SO:0001583	missense	64478	exon4			CCTTTCAGGATTT			8p23.2	2012-04-17			ENSG00000183117	ENSG00000183117		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14026	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 24"""	608397					Standard	NM_033225		Approved	KIAA1890, PPP1R24	uc022aqr.1	Q96PZ7	OTTHUMG00000163605	ENST00000520002.1:c.455T>A	chr8.hg19:g.3889582A>T	ENSP00000430733:p.Leu152Gln	117.0	0.0		50.0	41.0	NM_033225	Q0H0J5|Q96QU9|Q96RM4	Missense_Mutation	SNP	ENST00000520002.1	hg19		.	.	.	.	.	.	.	.	.	.	A	0.197	-1.048257	0.01981	.	.	ENSG00000183117	ENST00000400186;ENST00000520002;ENST00000318252;ENST00000537824;ENST00000542608;ENST00000539096	T;T;T;T;T	0.63417	-0.04;-0.04;-0.04;-0.04;-0.04	5.52	5.52	0.82312	.	0.141721	0.27336	U	0.019829	T	0.44393	0.1291	N	0.16130	0.375	0.18873	N	0.999988	P	0.46784	0.884	P	0.46629	0.522	T	0.32693	-0.9897	10	0.13108	T	0.6	.	6.5804	0.22591	0.8285:0.0:0.1715:0.0	.	152	E5RIG2	.	Q	152;152;14;152;152;152	ENSP00000383047:L152Q;ENSP00000430733:L152Q;ENSP00000441462:L152Q;ENSP00000446243:L152Q;ENSP00000441675:L152Q	ENSP00000320445:L14Q	L	-	2	0	CSMD1	3876990	1.000000	0.71417	0.882000	0.34594	0.037000	0.13140	3.473000	0.53122	2.111000	0.64477	0.533000	0.62120	CTG	.	.		0.443	CSMD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000374500.2	NM_033225	
AGPAT5	55326	hgsc.bcm.edu	37	8	6612657	6612657	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr8:6612657G>A	ENST00000285518.6	+	7	1143	c.831G>A	c.(829-831)atG>atA	p.M277I	AGPAT5_ENST00000530716.1_3'UTR	NM_018361.3	NP_060831.2	Q9NUQ2	PLCE_HUMAN	1-acylglycerol-3-phosphate O-acyltransferase 5	277					CDP-diacylglycerol biosynthetic process (GO:0016024)|cellular lipid metabolic process (GO:0044255)|glycerophospholipid biosynthetic process (GO:0046474)|hematopoietic progenitor cell differentiation (GO:0002244)|phosphatidic acid biosynthetic process (GO:0006654)|phospholipid biosynthetic process (GO:0008654)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	1-acylglycerol-3-phosphate O-acyltransferase activity (GO:0003841)		AGPAT5/MCPH1(2)	endometrium(2)|kidney(2)|large_intestine(4)|lung(3)	11			STAD - Stomach adenocarcinoma(24;0.0578)	READ - Rectum adenocarcinoma(644;0.156)|COAD - Colon adenocarcinoma(149;0.191)		AAGAACATATGAGAAGATGGC	0.358																																					p.M277I		Atlas-SNP	.											.	AGPAT5	31	.	0			c.G831A						.						91.0	76.0	81.0					8																	6612657		2203	4300	6503	SO:0001583	missense	55326	exon7			ACATATGAGAAGA	AF375789	CCDS34796.1	8p23.1	2013-02-05	2013-02-05		ENSG00000155189	ENSG00000155189	2.3.1.51	"""1-acylglycerol-3-phosphate O-acyltransferases"""	20886	protein-coding gene	gene with protein product	"""lysophosphatidic acid acyltransferase, epsilon"""	614796	"""1-acylglycerol-3-phosphate O-acyltransferase 5 (lysophosphatidic acid acyltransferase, epsilon)"""				Standard	NM_018361		Approved	FLJ11210, LPAAT-e, LPAAT-epsilon	uc003wqo.3	Q9NUQ2	OTTHUMG00000163656	ENST00000285518.6:c.831G>A	chr8.hg19:g.6612657G>A	ENSP00000285518:p.Met277Ile	539.0	0.0		294.0	20.0	NM_018361	Q8IZ47|Q9BQG4	Missense_Mutation	SNP	ENST00000285518.6	hg19	CCDS34796.1	.	.	.	.	.	.	.	.	.	.	G	20.5	3.998007	0.74818	.	.	ENSG00000155189	ENST00000285518	T	0.39787	1.06	5.81	5.81	0.92471	.	0.168371	0.64402	D	0.000004	T	0.36496	0.0969	L	0.41124	1.26	0.52099	D	0.99994	B	0.09022	0.002	B	0.11329	0.006	T	0.11203	-1.0597	10	0.17832	T	0.49	-21.4045	17.585	0.87979	0.0:0.0:1.0:0.0	.	277	Q9NUQ2	PLCE_HUMAN	I	277	ENSP00000285518:M277I	ENSP00000285518:M277I	M	+	3	0	AGPAT5	6600065	1.000000	0.71417	0.880000	0.34516	0.794000	0.44872	5.574000	0.67424	2.746000	0.94184	0.591000	0.81541	ATG	.	.		0.358	AGPAT5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374684.1	NM_018361	
RP1L1	94137	hgsc.bcm.edu	37	8	10465648	10465648	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr8:10465648T>A	ENST00000382483.3	-	4	6183	c.5960A>T	c.(5959-5961)cAg>cTg	p.Q1987L		NM_178857.5	NP_849188.4	Q8IWN7	RP1L1_HUMAN	retinitis pigmentosa 1-like 1	2067	25 X 16 AA approximate tandem repeats of [ED]-[AT]-[PQ]-[ED]-[AVT]-E-[GKE]-[ED]- [AMT]-Q-[EPK]-[EAT]-[TSELP]-[EG]- [EGSQDI]-[AVIE].				cell projection organization (GO:0030030)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|visual perception (GO:0007601)	axoneme (GO:0005930)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|photoreceptor connecting cilium (GO:0032391)|photoreceptor outer segment (GO:0001750)				breast(5)|central_nervous_system(2)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(16)|lung(82)|ovary(8)|prostate(5)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(3)	148				COAD - Colon adenocarcinoma(149;0.0811)		TTCTGCCTCCTGGGTCTCCAC	0.587																																					p.Q1987L		Atlas-SNP	.											.	RP1L1	453	.	0			c.A5960T						.						169.0	184.0	179.0					8																	10465648		1978	4162	6140	SO:0001583	missense	94137	exon4			GCCTCCTGGGTCT	AY168346	CCDS43708.1	8p23.1	2011-12-06			ENSG00000183638	ENSG00000183638			15946	protein-coding gene	gene with protein product		608581				12634863	Standard	NM_178857		Approved	DCDC4B	uc003wtc.3	Q8IWN7	OTTHUMG00000163806	ENST00000382483.3:c.5960A>T	chr8.hg19:g.10465648T>A	ENSP00000371923:p.Gln1987Leu	80.0	0.0		38.0	21.0	NM_178857	Q86SQ1|Q8IWN8|Q8IWN9|Q8IWP0|Q8IWP1|Q8IWP2	Missense_Mutation	SNP	ENST00000382483.3	hg19	CCDS43708.1	.	.	.	.	.	.	.	.	.	.	T	7.489	0.650263	0.14516	.	.	ENSG00000183638	ENST00000382483	T	0.05447	3.44	1.24	-0.879	0.10613	.	.	.	.	.	T	0.02970	0.0088	N	0.08118	0	0.09310	N	1	B	0.14438	0.01	B	0.18263	0.021	T	0.44982	-0.9292	9	0.34782	T	0.22	.	4.8508	0.13537	0.2708:0.0:0.0:0.7292	.	1987	A6NKC6	.	L	1987	ENSP00000371923:Q1987L	ENSP00000371923:Q1987L	Q	-	2	0	RP1L1	10503058	0.000000	0.05858	0.041000	0.18516	0.028000	0.11728	0.052000	0.14163	0.450000	0.26774	0.254000	0.18369	CAG	.	.		0.587	RP1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375673.1		
ASAH1	427	hgsc.bcm.edu	37	8	17933073	17933073	+	Silent	SNP	T	T	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr8:17933073T>A	ENST00000262097.6	-	2	413	c.102A>T	c.(100-102)tcA>tcT	p.S34S	ASAH1_ENST00000520051.1_5'UTR|ASAH1_ENST00000520781.1_Silent_p.S34S|ASAH1_ENST00000381733.4_Silent_p.S50S|ASAH1_ENST00000417108.2_5'UTR|ASAH1_ENST00000314146.10_Silent_p.S50S	NM_177924.3	NP_808592.2	Q13510	ASAH1_HUMAN	N-acylsphingosine amidohydrolase (acid ceramidase) 1	34					cell death (GO:0008219)|ceramide metabolic process (GO:0006672)|glycosphingolipid metabolic process (GO:0006687)|lung development (GO:0030324)|response to organic substance (GO:0010033)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)	catalytic activity (GO:0003824)|ceramidase activity (GO:0017040)			breast(1)|endometrium(2)|large_intestine(4)|lung(2)	9				Colorectal(111;0.0646)|COAD - Colon adenocarcinoma(73;0.228)		GAGGATAGGTTGATTTTCTGC	0.348																																					p.S50S		Atlas-SNP	.											.	ASAH1	71	.	0			c.A150T						.						177.0	173.0	175.0					8																	17933073		2203	4300	6503	SO:0001819	synonymous_variant	427	exon2			ATAGGTTGATTTT	U70063	CCDS6005.1, CCDS6006.1, CCDS47813.1	8p22	2007-03-27	2002-09-11	2002-09-13	ENSG00000104763	ENSG00000104763			735	protein-coding gene	gene with protein product		613468	"""N-acylsphingosine amidohydrolase (acid ceramidase)"""	ASAH		8955159, 10610716	Standard	NM_004315		Approved	AC, PHP32, FLJ21558	uc003wyn.2	Q13510	OTTHUMG00000096997	ENST00000262097.6:c.102A>T	chr8.hg19:g.17933073T>A		141.0	0.0		65.0	55.0	NM_001127505	E9PDS0|Q6W898|Q96AS2	Silent	SNP	ENST00000262097.6	hg19	CCDS6006.1																																																																																			.	.		0.348	ASAH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214077.2	NM_004315	
CDCA2	157313	hgsc.bcm.edu	37	8	25319603	25319603	+	Missense_Mutation	SNP	G	G	T	rs149260399		TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr8:25319603G>T	ENST00000330560.3	+	4	743	c.266G>T	c.(265-267)cGa>cTa	p.R89L	CDCA2_ENST00000380665.3_Missense_Mutation_p.R74L	NM_152562.2	NP_689775.2	Q69YH5	CDCA2_HUMAN	cell division cycle associated 2	89					mitotic nuclear division (GO:0007067)|positive regulation of protein dephosphorylation (GO:0035307)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.R89Q(1)		breast(3)|cervix(1)|endometrium(3)|kidney(7)|large_intestine(7)|lung(10)|ovary(1)|prostate(3)	35		all_cancers(63;0.0378)|Ovarian(32;0.000878)|all_epithelial(46;0.0162)|Breast(100;0.0164)|Prostate(55;0.191)		UCEC - Uterine corpus endometrioid carcinoma (27;0.022)|Epithelial(17;1.37e-11)|Colorectal(74;0.0129)|COAD - Colon adenocarcinoma(73;0.0443)		AAATGTAGACGACGTTCTGCA	0.403																																					p.R89L		Atlas-SNP	.											CDCA2,NS,carcinoma,0,1	CDCA2	78	.	1	Substitution - Missense(1)	cervix(1)	c.G266T						.						103.0	102.0	102.0					8																	25319603		2203	4300	6503	SO:0001583	missense	157313	exon4			GTAGACGACGTTC	BG354575	CCDS6049.1	8p21.2	2014-06-12			ENSG00000184661	ENSG00000184661			14623	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 81"""					12188893, 16492807	Standard	NM_152562		Approved	Repo-Man, PPP1R81	uc003xep.1	Q69YH5	OTTHUMG00000099429	ENST00000330560.3:c.266G>T	chr8.hg19:g.25319603G>T	ENSP00000328228:p.Arg89Leu	120.0	1.0		53.0	40.0	NM_152562	Q3SX74|Q4G0W0|Q5RKN0|Q69YI4|Q6P464|Q8N7C1	Missense_Mutation	SNP	ENST00000330560.3	hg19	CCDS6049.1	.	.	.	.	.	.	.	.	.	.	G	14.05	2.421180	0.42918	.	.	ENSG00000184661	ENST00000330560;ENST00000380665	T;T	0.66815	-0.23;-0.23	5.45	5.45	0.79879	.	0.000000	0.47455	D	0.000229	T	0.81211	0.4775	M	0.76002	2.32	0.42026	D	0.991006	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.999	D	0.83488	0.0068	10	0.87932	D	0	-11.0538	14.7814	0.69769	0.0:0.0:1.0:0.0	.	89;74;89	B7Z5Q5;E9PEI0;Q69YH5	.;.;CDCA2_HUMAN	L	89;74	ENSP00000328228:R89L;ENSP00000370040:R74L	ENSP00000328228:R89L	R	+	2	0	CDCA2	25375520	0.908000	0.30866	0.564000	0.28396	0.054000	0.15201	4.883000	0.63128	2.546000	0.85860	0.491000	0.48974	CGA	.	G|1.000;A|0.000		0.403	CDCA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216891.3	NM_152562	
FZD3	7976	hgsc.bcm.edu	37	8	28385435	28385435	+	Silent	SNP	G	G	C			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr8:28385435G>C	ENST00000240093.3	+	5	1636	c.1158G>C	c.(1156-1158)ggG>ggC	p.G386G	FZD3_ENST00000537916.1_Silent_p.G386G|RNA5SP259_ENST00000365541.1_RNA	NM_017412.3	NP_059108.1	Q9NPG1	FZD3_HUMAN	frizzled class receptor 3	386					canonical Wnt signaling pathway (GO:0060070)|cell proliferation in midbrain (GO:0033278)|commissural neuron axon guidance (GO:0071679)|establishment of planar polarity (GO:0001736)|facial nucleus development (GO:0021754)|G-protein coupled receptor signaling pathway coupled to cGMP nucleotide second messenger (GO:0007199)|gonad development (GO:0008406)|hair follicle development (GO:0001942)|inner ear morphogenesis (GO:0042472)|neural tube closure (GO:0001843)|neuron differentiation (GO:0030182)|neuron migration (GO:0001764)|post-anal tail morphogenesis (GO:0036342)|vasculature development (GO:0001944)	apical part of cell (GO:0045177)|apical plasma membrane (GO:0016324)|axon (GO:0030424)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|lateral plasma membrane (GO:0016328)|neuron projection membrane (GO:0032589)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	G-protein coupled receptor activity (GO:0004930)|PDZ domain binding (GO:0030165)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(14)|lung(15)|ovary(1)|prostate(1)|skin(1)	41		Ovarian(32;2.06e-05)		KIRC - Kidney renal clear cell carcinoma(542;0.109)|Kidney(114;0.13)|Colorectal(74;0.23)		TGGTAGTTGGGGTTTCTCTCC	0.403																																					p.G386G		Atlas-SNP	.											.	FZD3	65	.	0			c.G1158C						.						129.0	127.0	127.0					8																	28385435		2203	4300	6503	SO:0001819	synonymous_variant	7976	exon5			AGTTGGGGTTTCT	AJ272427	CCDS6069.1	8p21	2014-06-27	2014-01-29		ENSG00000104290	ENSG00000104290		"""GPCR / Class F : Frizzled receptors"""	4041	protein-coding gene	gene with protein product		606143	"""frizzled (Drosophila) homolog 3"", ""frizzled homolog 3 (Drosophila)"", ""frizzled 3, seven transmembrane spanning receptor"", ""frizzled family receptor 3"""			10777673, 10873558	Standard	NM_145866		Approved		uc010lvb.3	Q9NPG1	OTTHUMG00000102145	ENST00000240093.3:c.1158G>C	chr8.hg19:g.28385435G>C		142.0	0.0		69.0	50.0	NM_017412	A8K615	Silent	SNP	ENST00000240093.3	hg19	CCDS6069.1																																																																																			.	.		0.403	FZD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219986.2	NM_145866	
IKBKB	3551	hgsc.bcm.edu	37	8	42171857	42171857	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr8:42171857A>G	ENST00000520810.1	+	9	896	c.710A>G	c.(709-711)cAg>cGg	p.Q237R	IKBKB_ENST00000416505.2_Missense_Mutation_p.Q178R|IKBKB_ENST00000520835.1_Missense_Mutation_p.Q235R|IKBKB_ENST00000522147.1_Intron|IKBKB_ENST00000379708.3_Missense_Mutation_p.Q14R	NM_001556.2	NP_001547.1	O14920	IKKB_HUMAN	inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase beta	237	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				B cell homeostasis (GO:0001782)|cellular response to tumor necrosis factor (GO:0071356)|Fc-epsilon receptor signaling pathway (GO:0038095)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|I-kappaB phosphorylation (GO:0007252)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of cation channel activity (GO:2001259)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of sodium ion transport (GO:0010765)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein phosphorylation (GO:0006468)|response to virus (GO:0009615)|serine phosphorylation of STAT protein (GO:0042501)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	CD40 receptor complex (GO:0035631)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|IkappaB kinase complex (GO:0008385)|nucleus (GO:0005634)	ATP binding (GO:0005524)|IkappaB kinase activity (GO:0008384)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)|scaffold protein binding (GO:0097110)			breast(4)|lung(1)|ovary(2)|skin(1)	8	all_cancers(6;1.42e-24)|all_epithelial(6;1.02e-25)|all_lung(13;6.21e-12)|Lung NSC(13;1.04e-10)|Ovarian(28;0.00769)|Prostate(17;0.0119)|Colorectal(14;0.0468)|Lung SC(25;0.211)	all_lung(54;0.000434)|Lung NSC(58;0.00161)|Hepatocellular(245;0.0524)|Renal(179;0.0822)|Esophageal squamous(32;0.0954)	BRCA - Breast invasive adenocarcinoma(8;1.37e-10)|Colorectal(10;0.00102)|OV - Ovarian serous cystadenocarcinoma(14;0.00168)|Lung(22;0.00467)|LUSC - Lung squamous cell carcinoma(45;0.024)|COAD - Colon adenocarcinoma(11;0.0264)		Acetylcysteine(DB06151)|Acetylsalicylic acid(DB00945)|Arsenic trioxide(DB01169)|Auranofin(DB00995)|Mesalazine(DB00244)|Sulfasalazine(DB00795)	AAAGTGCGGCAGAAGAGTGAG	0.423																																					p.Q237R		Atlas-SNP	.											.	IKBKB	88	.	0			c.A710G						.						244.0	215.0	225.0					8																	42171857		2203	4300	6503	SO:0001583	missense	3551	exon9			TGCGGCAGAAGAG	AF029684	CCDS6128.1, CCDS55228.1, CCDS56535.1	8p11.2	2008-08-18			ENSG00000104365	ENSG00000104365			5960	protein-coding gene	gene with protein product		603258				9878263, 9763654	Standard	NM_001556		Approved	IKK2, NFKBIKB, IKK-beta, IKKB	uc003xow.2	O14920	OTTHUMG00000164092	ENST00000520810.1:c.710A>G	chr8.hg19:g.42171857A>G	ENSP00000430684:p.Gln237Arg	165.0	0.0		95.0	61.0	NM_001556	B4DZ30|B4E0U4|O75327	Missense_Mutation	SNP	ENST00000520810.1	hg19	CCDS6128.1	.	.	.	.	.	.	.	.	.	.	A	12.62	1.993766	0.35131	.	.	ENSG00000104365	ENST00000520810;ENST00000416505;ENST00000520835;ENST00000379708	T;T;T;T	0.40225	1.04;1.04;1.04;2.94	5.95	5.95	0.96441	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.243392	0.43919	D	0.000519	T	0.28333	0.0700	N	0.12502	0.225	0.39360	D	0.965906	B;B;P;B;B;B	0.49090	0.006;0.007;0.919;0.004;0.009;0.016	B;B;B;B;B;B	0.40256	0.007;0.011;0.324;0.02;0.02;0.021	T	0.16660	-1.0395	10	0.45353	T	0.12	.	16.4159	0.83738	1.0:0.0:0.0:0.0	.	178;235;14;188;237;237	B4E0U4;O14920-2;B3KRB7;Q59GL9;O14920;Q32ND9	.;.;.;.;IKKB_HUMAN;.	R	237;178;235;14	ENSP00000430684:Q237R;ENSP00000404920:Q178R;ENSP00000430868:Q235R;ENSP00000369030:Q14R	ENSP00000369030:Q14R	Q	+	2	0	IKBKB	42291014	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	4.520000	0.60524	2.279000	0.76181	0.533000	0.62120	CAG	.	.		0.423	IKBKB-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377214.1		
PXDNL	137902	hgsc.bcm.edu	37	8	52320842	52320842	+	Silent	SNP	G	G	C			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr8:52320842G>C	ENST00000356297.4	-	17	3442	c.3342C>G	c.(3340-3342)ccC>ccG	p.P1114P	PXDNL_ENST00000543296.1_Silent_p.P1114P	NM_144651.4	NP_653252	A1KZ92	PXDNL_HUMAN	peroxidasin homolog (Drosophila)-like	1114					hydrogen peroxide catabolic process (GO:0042744)|oxidation-reduction process (GO:0055114)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	endonuclease activity (GO:0004519)|heme binding (GO:0020037)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)			NS(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(6)|lung(25)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	48		all_cancers(86;0.107)|Lung NSC(129;0.00641)|all_epithelial(80;0.00716)|all_lung(136;0.015)				GAAGGTAGGAGGGTGCCCGCC	0.572																																					p.P1114P		Atlas-SNP	.											PXDNL_ENST00000356297,right_upper_lobe,carcinoma,-2,2	PXDNL	414	.	0			c.C3342G						.						53.0	59.0	57.0					8																	52320842		1913	4119	6032	SO:0001819	synonymous_variant	137902	exon17			GTAGGAGGGTGCC		CCDS47855.1	8q11.21-q11.22	2013-02-18	2007-01-12		ENSG00000147485	ENSG00000147485		"""Immunoglobulin superfamily / I-set domain containing"""	26359	protein-coding gene	gene with protein product	"""polysomal ribonuclease 1 homolog (Xenopus)"""	615904	"""peroxidasin homolog-like (Drosophila)"""			22543864	Standard	NM_144651		Approved	FLJ25471, PMR1	uc003xqu.4	A1KZ92	OTTHUMG00000164244	ENST00000356297.4:c.3342C>G	chr8.hg19:g.52320842G>C		145.0	0.0		193.0	74.0	NM_144651	B5ME43|B6CGZ3|H0YBM9|Q6ZMR2|Q96LH9	Silent	SNP	ENST00000356297.4	hg19	CCDS47855.1	.	.	.	.	.	.	.	.	.	.	G	0.016	-1.516802	0.00975	.	.	ENSG00000147485	ENST00000522933	T	0.68025	-0.3	3.82	-1.31	0.09230	.	0.136128	0.33515	N	0.004836	T	0.52629	0.1746	.	.	.	0.25024	N	0.991312	.	.	.	.	.	.	T	0.46978	-0.9152	7	0.51188	T	0.08	.	1.3668	0.02202	0.3297:0.1462:0.3762:0.1479	.	.	.	.	R	233	ENSP00000428114:P233R	ENSP00000428114:P233R	P	-	2	0	PXDNL	52483395	0.000000	0.05858	0.001000	0.08648	0.004000	0.04260	-2.714000	0.00815	-0.192000	0.10432	0.655000	0.94253	CCT	.	.		0.572	PXDNL-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377905.1	NM_144651	
PXDNL	137902	hgsc.bcm.edu	37	8	52321428	52321428	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr8:52321428A>T	ENST00000356297.4	-	17	2856	c.2756T>A	c.(2755-2757)cTc>cAc	p.L919H	PXDNL_ENST00000543296.1_Missense_Mutation_p.L919H	NM_144651.4	NP_653252	A1KZ92	PXDNL_HUMAN	peroxidasin homolog (Drosophila)-like	919					hydrogen peroxide catabolic process (GO:0042744)|oxidation-reduction process (GO:0055114)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	endonuclease activity (GO:0004519)|heme binding (GO:0020037)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)			NS(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(6)|lung(25)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	48		all_cancers(86;0.107)|Lung NSC(129;0.00641)|all_epithelial(80;0.00716)|all_lung(136;0.015)				TGTCTTCAGGAGACCCCGAGG	0.612																																					p.L919H		Atlas-SNP	.											.	PXDNL	414	.	0			c.T2756A						.						28.0	32.0	30.0					8																	52321428		1949	4133	6082	SO:0001583	missense	137902	exon17			TTCAGGAGACCCC		CCDS47855.1	8q11.21-q11.22	2013-02-18	2007-01-12		ENSG00000147485	ENSG00000147485		"""Immunoglobulin superfamily / I-set domain containing"""	26359	protein-coding gene	gene with protein product	"""polysomal ribonuclease 1 homolog (Xenopus)"""	615904	"""peroxidasin homolog-like (Drosophila)"""			22543864	Standard	NM_144651		Approved	FLJ25471, PMR1	uc003xqu.4	A1KZ92	OTTHUMG00000164244	ENST00000356297.4:c.2756T>A	chr8.hg19:g.52321428A>T	ENSP00000348645:p.Leu919His	178.0	0.0		201.0	67.0	NM_144651	B5ME43|B6CGZ3|H0YBM9|Q6ZMR2|Q96LH9	Missense_Mutation	SNP	ENST00000356297.4	hg19	CCDS47855.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	12.21|12.21	1.870622|1.870622	0.33069|0.33069	.|.	.|.	ENSG00000147485|ENSG00000147485	ENST00000356297;ENST00000543296|ENST00000522933	T;T|.	0.70986|.	-0.53;-0.53|.	4.02|4.02	4.02|4.02	0.46733|0.46733	.|.	0.000000|.	0.39909|.	N|.	0.001226|.	T|T	0.62853|0.62853	0.2462|0.2462	M|M	0.82323|0.82323	2.585|2.585	0.32991|0.32991	D|D	0.52495|0.52495	D|.	0.67145|.	0.996|.	D|.	0.66979|.	0.948|.	T|T	0.71876|0.71876	-0.4460|-0.4460	10|5	0.66056|.	D|.	0.02|.	.|.	6.1019|6.1019	0.20051|0.20051	0.88:0.0:0.12:0.0|0.88:0.0:0.12:0.0	.|.	919|.	A1KZ92|.	PXDNL_HUMAN|.	H|T	919|38	ENSP00000348645:L919H;ENSP00000444865:L919H|.	ENSP00000348645:L919H|.	L|S	-|-	2|1	0|0	PXDNL|PXDNL	52483981|52483981	0.986000|0.986000	0.35501|0.35501	0.073000|0.073000	0.20177|0.20177	0.072000|0.072000	0.16883|0.16883	3.951000|3.951000	0.56684|0.56684	1.447000|1.447000	0.47661|0.47661	0.533000|0.533000	0.62120|0.62120	CTC|TCC	.	.		0.612	PXDNL-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377905.1	NM_144651	
FAM150A	389658	hgsc.bcm.edu	37	8	53451056	53451056	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr8:53451056A>G	ENST00000358543.4	-	4	587	c.337T>C	c.(337-339)Tgt>Cgt	p.C113R	FAM150A_ENST00000523939.1_Intron	NM_207413.3	NP_997296.1	Q6UXT8	F150A_HUMAN	family with sequence similarity 150, member A	113						extracellular region (GO:0005576)				lung(1)	1		Lung NSC(129;0.0919)|all_epithelial(80;0.125)|all_lung(136;0.17)				AATCTAGCACATCTTTTGTAA	0.308																																					p.C113R		Atlas-SNP	.											.	FAM150A	6	.	0			c.T337C						.						67.0	68.0	68.0					8																	53451056		2203	4299	6502	SO:0001583	missense	389658	exon4			TAGCACATCTTTT		CCDS6150.1	8q11.23	2007-12-18			ENSG00000196711	ENSG00000196711			33775	protein-coding gene	gene with protein product							Standard	NM_207413		Approved	UNQ9433	uc003xrd.3	Q6UXT8	OTTHUMG00000164256	ENST00000358543.4:c.337T>C	chr8.hg19:g.53451056A>G	ENSP00000351345:p.Cys113Arg	521.0	0.0		701.0	160.0	NM_207413	B7ZMG9	Missense_Mutation	SNP	ENST00000358543.4	hg19	CCDS6150.1	.	.	.	.	.	.	.	.	.	.	A	19.13	3.767787	0.69878	.	.	ENSG00000196711	ENST00000358543	.	.	.	5.3	5.3	0.74995	.	0.000000	0.85682	D	0.000000	T	0.77177	0.4092	M	0.65975	2.015	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.79916	-0.1601	9	0.87932	D	0	.	14.5285	0.67905	1.0:0.0:0.0:0.0	.	113	Q6UXT8	F150A_HUMAN	R	113	.	ENSP00000351345:C113R	C	-	1	0	FAM150A	53613609	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.772000	0.75001	2.128000	0.65567	0.528000	0.53228	TGT	.	.		0.308	FAM150A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000377959.1	NM_207413	
RGS20	8601	hgsc.bcm.edu	37	8	54764467	54764467	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr8:54764467A>T	ENST00000297313.3	+	1	100	c.8A>T	c.(7-9)cAg>cTg	p.Q3L	RGS20_ENST00000344277.6_Missense_Mutation_p.Q3L	NM_170587.2	NP_733466.1	O76081	RGS20_HUMAN	regulator of G-protein signaling 20	3					positive regulation of GTPase activity (GO:0043547)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)			breast(2)|endometrium(1)|large_intestine(6)|lung(9)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	21			OV - Ovarian serous cystadenocarcinoma(7;1.37e-06)|Epithelial(17;0.000126)|all cancers(17;0.0009)			AACATGCCCCAGCTTTCCCAA	0.458																																					p.Q3L		Atlas-SNP	.											.	RGS20	51	.	0			c.A8T						.						112.0	117.0	115.0					8																	54764467		2203	4300	6503	SO:0001583	missense	8601	exon1			TGCCCCAGCTTTC	AF074979	CCDS6155.1, CCDS6156.1, CCDS69482.1	8q11.23	2008-07-25	2007-08-14		ENSG00000147509	ENSG00000147509		"""Regulators of G-protein signaling"""	14600	protein-coding gene	gene with protein product		607193	"""regulator of G-protein signalling 20"""			9748279, 9748280	Standard	NM_003702		Approved	RGSZ1, ZGAP1	uc003xrp.3	O76081	OTTHUMG00000164750	ENST00000297313.3:c.8A>T	chr8.hg19:g.54764467A>T	ENSP00000297313:p.Gln3Leu	95.0	0.0		124.0	32.0	NM_170587	Q96BG9	Missense_Mutation	SNP	ENST00000297313.3	hg19	CCDS6155.1	.	.	.	.	.	.	.	.	.	.	A	9.494	1.101437	0.20632	.	.	ENSG00000147509	ENST00000297313;ENST00000344277	T;T	0.40225	1.07;1.04	4.84	-0.964	0.10326	.	.	.	.	.	T	0.25568	0.0622	L	0.29908	0.895	0.09310	N	1	B;B	0.10296	0.001;0.003	B;B	0.08055	0.002;0.003	T	0.25398	-1.0133	9	0.62326	D	0.03	.	2.9029	0.05712	0.3208:0.0:0.3564:0.3228	.	3;3	O76081-2;O76081	.;RGS20_HUMAN	L	3	ENSP00000297313:Q3L;ENSP00000344630:Q3L	ENSP00000297313:Q3L	Q	+	2	0	RGS20	54927020	0.000000	0.05858	0.000000	0.03702	0.613000	0.37349	0.202000	0.17295	-0.010000	0.14271	-1.093000	0.02169	CAG	.	.		0.458	RGS20-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000380058.1		
PPP1R42	286187	hgsc.bcm.edu	37	8	67930067	67930067	+	Splice_Site	SNP	C	C	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr8:67930067C>A	ENST00000324682.5	-	2	61		c.e2-1		PPP1R42_ENST00000517834.1_Splice_Site|PPP1R42_ENST00000522909.1_Splice_Site	NM_001013626.2	NP_001013648.1	Q7Z4L9	PPR42_HUMAN	protein phosphatase 1, regulatory subunit 42						regulation of phosphatase activity (GO:0010921)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|manchette (GO:0002177)|microtubule cytoskeleton (GO:0015630)|microtubule organizing center (GO:0005815)	actin binding (GO:0003779)|dynein binding (GO:0045502)|tubulin binding (GO:0015631)										TTCCAACTTTCTGAAGATTAA	0.299																																					.		Atlas-SNP	.											.	PPP1R42	2	.	0			.						.																																			SO:0001630	splice_region_variant	286187	.			AACTTTCTGAAGA	BC055413	CCDS34902.1	8q13.1-q13.2	2012-04-17	2011-10-11	2011-10-11	ENSG00000178125	ENSG00000178125		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	33732	protein-coding gene	gene with protein product	"""testis leucine-rich repeat"""		"""leucine rich repeat containing 67"""	LRRC67			Standard	NM_001013626		Approved	dtr, TLLR	uc003xxc.3	Q7Z4L9	OTTHUMG00000164745	ENST00000324682.5:c.84-1G>T	chr8.hg19:g.67930067C>A		36.0	0.0		48.0	29.0	.		Splice_Site	SNP	ENST00000324682.5	hg19	CCDS34902.1																																																																																			.	.		0.299	PPP1R42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380034.2	NM_001013626	Intron
COPS5	10987	hgsc.bcm.edu	37	8	67976717	67976717	+	5'Flank	SNP	A	A	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr8:67976717A>T	ENST00000357849.4	-	0	0				CSPP1_ENST00000262210.5_Silent_p.R28R|COPS5_ENST00000519963.1_Intron|COPS5_ENST00000517736.1_5'UTR|CSPP1_ENST00000412460.1_5'UTR	NM_006837.2	NP_006828.2	Q92905	CSN5_HUMAN	COP9 signalosome subunit 5						cullin deneddylation (GO:0010388)|exosomal secretion (GO:1990182)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein deneddylation (GO:0000338)|protein deubiquitination (GO:0016579)|regulation of cell cycle (GO:0051726)|regulation of JNK cascade (GO:0046328)|transcription from RNA polymerase II promoter (GO:0006366)|translation (GO:0006412)|translational initiation (GO:0006413)	cell junction (GO:0030054)|COP9 signalosome (GO:0008180)|cytoplasm (GO:0005737)|eukaryotic translation initiation factor 3 complex (GO:0005852)|nucleus (GO:0005634)|synaptic vesicle (GO:0008021)	metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)|transcription coactivator activity (GO:0003713)|translation initiation factor activity (GO:0003743)|ubiquitin-specific protease activity (GO:0004843)			endometrium(2)|kidney(1)|large_intestine(1)|lung(6)|ovary(1)|skin(3)	14	Breast(64;0.214)	Lung NSC(129;0.0908)|all_lung(136;0.152)	Epithelial(68;0.00389)|OV - Ovarian serous cystadenocarcinoma(28;0.00691)|all cancers(69;0.0205)|BRCA - Breast invasive adenocarcinoma(89;0.153)			CCCGGACGCGAGCCCGCTCCC	0.672											OREG0018811	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.R28R		Atlas-SNP	.											.	CSPP1	129	.	0			c.A84T						.						28.0	33.0	32.0					8																	67976717		2049	4189	6238	SO:0001631	upstream_gene_variant	79848	exon1			GACGCGAGCCCGC	U65928	CCDS6198.1	8q13.1	2013-03-14	2013-03-14		ENSG00000121022	ENSG00000121022			2240	protein-coding gene	gene with protein product		604850	"""COP9 (constitutive photomorphogenic, Arabidopsis, homolog) subunit 5"", ""COP9 constitutive photomorphogenic homolog subunit 5 (Arabidopsis)"""			8837781, 9341143	Standard	NM_006837		Approved	JAB1, SGN5, MOV-34, CSN5	uc003xxe.3	Q92905	OTTHUMG00000164563		chr8.hg19:g.67976717A>T	Exception_encountered	85.0	0.0	1103	123.0	73.0	NM_024790	O15386|Q6AW95|Q86WQ4|Q9BQ17	Silent	SNP	ENST00000357849.4	hg19	CCDS6198.1																																																																																			.	.		0.672	COPS5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379245.2		
PREX2	80243	hgsc.bcm.edu	37	8	68965436	68965436	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr8:68965436C>A	ENST00000288368.4	+	9	1325	c.1048C>A	c.(1048-1050)Cat>Aat	p.H350N	PREX2_ENST00000529398.1_3'UTR	NM_024870.2|NM_025170.4	NP_079146.2|NP_079446.3	Q70Z35	PREX2_HUMAN	phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 2	350	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				adult locomotory behavior (GO:0008344)|dendrite morphogenesis (GO:0048813)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|positive regulation of Rac GTPase activity (GO:0032855)		Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)			NS(6)|biliary_tract(1)|breast(4)|endometrium(11)|kidney(16)|large_intestine(25)|liver(4)|lung(57)|ovary(2)|pancreas(4)|prostate(3)|skin(42)|upper_aerodigestive_tract(1)|urinary_tract(2)	178						TGAAGAGAAGCATGAATGGTT	0.383																																					p.H350N		Atlas-SNP	.											.	PREX2	614	.	0			c.C1048A						.						123.0	114.0	117.0					8																	68965436		2203	4300	6503	SO:0001583	missense	80243	exon9			GAGAAGCATGAAT	AK024079	CCDS6201.1	8q13.1	2014-06-13	2008-09-15	2008-09-15	ENSG00000046889	ENSG00000046889		"""Rho guanine nucleotide exchange factors"""	22950	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 129"""	612139	"""DEP domain containing 2"""	DEPDC2		15304342, 15304343	Standard	NM_024870		Approved	DEP.2, FLJ12987, P-REX2, PPP1R129	uc003xxv.1	Q70Z35	OTTHUMG00000164402	ENST00000288368.4:c.1048C>A	chr8.hg19:g.68965436C>A	ENSP00000288368:p.His350Asn	142.0	0.0		192.0	130.0	NM_025170	B4DFX0|Q32KL0|Q32KL1|Q6R7Q3|Q6R7Q4|Q9H805|Q9H961	Missense_Mutation	SNP	ENST00000288368.4	hg19	CCDS6201.1	.	.	.	.	.	.	.	.	.	.	C	18.13	3.555438	0.65425	.	.	ENSG00000046889	ENST00000288368;ENST00000396539;ENST00000354677	D	0.86694	-2.16	5.42	5.42	0.78866	Pleckstrin homology-type (1);Pleckstrin homology domain (2);	0.063303	0.64402	D	0.000002	T	0.79924	0.4530	N	0.11064	0.09	0.54753	D	0.999986	B;B;B	0.24920	0.114;0.009;0.018	B;B;B	0.30943	0.122;0.012;0.043	T	0.75590	-0.3265	10	0.41790	T	0.15	.	19.2197	0.93791	0.0:1.0:0.0:0.0	.	350;350;350	Q70Z35-2;Q70Z35;Q70Z35-3	.;PREX2_HUMAN;.	N	350	ENSP00000288368:H350N	ENSP00000288368:H350N	H	+	1	0	PREX2	69127990	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.818000	0.86416	2.542000	0.85734	0.655000	0.94253	CAT	.	.		0.383	PREX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378620.1	NM_025170	
STMN2	11075	hgsc.bcm.edu	37	8	80553736	80553736	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr8:80553736C>T	ENST00000220876.7	+	3	621	c.239C>T	c.(238-240)tCc>tTc	p.S80F	STMN2_ENST00000518491.1_Missense_Mutation_p.S69F|STMN2_ENST00000518111.1_Missense_Mutation_p.S80F	NM_001199214.1|NM_007029.3	NP_001186143.1|NP_008960.2	Q93045	STMN2_HUMAN	stathmin 2	80	Regulatory/phosphorylation domain. {ECO:0000255}.|SLD. {ECO:0000255|PROSITE- ProRule:PRU00998}.				cellular response to nerve growth factor stimulus (GO:1990090)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of microtubule polymerization (GO:0031115)|negative regulation of neuron projection development (GO:0010977)|positive regulation of microtubule depolymerization (GO:0031117)|positive regulation of neuron projection development (GO:0010976)	cytoplasm (GO:0005737)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|lamellipodium (GO:0030027)|membrane (GO:0016020)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|vesicle (GO:0031982)	calcium-dependent protein binding (GO:0048306)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(4)|ovary(1)|skin(1)	11	all_lung(9;8.34e-05)		Epithelial(68;0.0229)|all cancers(69;0.0874)			AAAGACCTGTCCCTGGAGGAG	0.502																																					p.S80F		Atlas-SNP	.											.	STMN2	23	.	0			c.C239T						.						55.0	54.0	54.0					8																	80553736		1886	4125	6011	SO:0001583	missense	11075	exon3			ACCTGTCCCTGGA		CCDS43748.1, CCDS56542.1	8q21.13	2014-04-01	2014-04-01	2001-07-13	ENSG00000104435	ENSG00000104435			10577	protein-coding gene	gene with protein product		600621	"""stathmin-like 2"""	SCGN10		8622778, 12140291	Standard	NM_007029		Approved	SCG10	uc022awk.1	Q93045	OTTHUMG00000164610	ENST00000220876.7:c.239C>T	chr8.hg19:g.80553736C>T	ENSP00000220876:p.Ser80Phe	266.0	0.0		300.0	20.0	NM_007029	A8K9M2|G3V110|O14952|Q6PK68	Missense_Mutation	SNP	ENST00000220876.7	hg19	CCDS43748.1	.	.	.	.	.	.	.	.	.	.	C	26.0	4.696868	0.88830	.	.	ENSG00000104435	ENST00000220876;ENST00000414622;ENST00000518111;ENST00000518491	.	.	.	5.49	5.49	0.81192	.	0.095316	0.85682	D	0.000000	D	0.85923	0.5810	M	0.90145	3.09	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.87578	0.998;0.997	D	0.88514	0.3091	9	0.87932	D	0	-6.5853	19.3806	0.94532	0.0:1.0:0.0:0.0	.	80;80	B7Z4K3;Q93045	.;STMN2_HUMAN	F	80;69;80;69	.	ENSP00000220876:S80F	S	+	2	0	STMN2	80716291	1.000000	0.71417	1.000000	0.80357	0.949000	0.60115	7.818000	0.86416	2.564000	0.86499	0.467000	0.42956	TCC	.	.		0.502	STMN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379261.2	NM_007029	
ZFPM2	23414	hgsc.bcm.edu	37	8	106813578	106813578	+	Missense_Mutation	SNP	G	G	A	rs377466426		TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr8:106813578G>A	ENST00000407775.2	+	8	1518	c.1268G>A	c.(1267-1269)aGc>aAc	p.S423N	RP11-152P17.2_ENST00000509144.2_RNA|ZFPM2_ENST00000517361.1_Missense_Mutation_p.S291N|RP11-152P17.2_ENST00000518932.1_RNA|RP11-152P17.2_ENST00000521622.1_RNA|ZFPM2_ENST00000520492.1_Missense_Mutation_p.S291N|ZFPM2_ENST00000378472.4_Missense_Mutation_p.S154N|RP11-152P17.2_ENST00000520594.1_RNA|ZFPM2_ENST00000522296.1_3'UTR|RP11-152P17.2_ENST00000520433.1_RNA|RP11-152P17.2_ENST00000524045.2_RNA	NM_012082.3	NP_036214.2	Q8WW38	FOG2_HUMAN	zinc finger protein, FOG family member 2	423					blood coagulation (GO:0007596)|embryonic organ development (GO:0048568)|gonadal mesoderm development (GO:0007506)|in utero embryonic development (GO:0001701)|lung development (GO:0030324)|negative regulation of cell death (GO:0060548)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of female gonad development (GO:2000195)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|outflow tract septum morphogenesis (GO:0003148)|positive regulation of male gonad development (GO:2000020)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|right ventricular cardiac muscle tissue morphogenesis (GO:0003221)|vasculogenesis (GO:0001570)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|nucleic acid binding transcription factor activity (GO:0001071)|RNA polymerase II transcription coactivator activity (GO:0001105)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			NS(4)|breast(6)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(11)|liver(2)|lung(48)|ovary(4)|prostate(5)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	99			OV - Ovarian serous cystadenocarcinoma(57;8.28e-08)			CTTCCCCAGAGCCAAAAGGCC	0.483																																					p.S423N		Atlas-SNP	.											.	ZFPM2	219	.	0			c.G1268A						.	G	ASN/SER	1,3929		0,1,1964	64.0	64.0	64.0		1268	4.1	1.0	8		64	0,8338		0,0,4169	no	missense	ZFPM2	NM_012082.3	46	0,1,6133	AA,AG,GG		0.0,0.0254,0.0082	benign	423/1152	106813578	1,12267	1965	4169	6134	SO:0001583	missense	23414	exon8			CCCAGAGCCAAAA	AF119334	CCDS47908.1	8q23	2013-01-10	2012-11-27		ENSG00000169946	ENSG00000169946		"""Zinc fingers, C2H2-type"", ""Zinc fingers, C2HC-type containing"""	16700	protein-coding gene	gene with protein product		603693	"""zinc finger protein, multitype 2"""			9927675, 10438528	Standard	NM_012082		Approved	FOG2, hFOG-2, ZNF89B, ZC2HC11B	uc003ymd.3	Q8WW38	OTTHUMG00000164818	ENST00000407775.2:c.1268G>A	chr8.hg19:g.106813578G>A	ENSP00000384179:p.Ser423Asn	149.0	0.0		299.0	134.0	NM_012082	Q32MA6|Q9NPL7|Q9NPS4|Q9UNI5	Missense_Mutation	SNP	ENST00000407775.2	hg19	CCDS47908.1	.	.	.	.	.	.	.	.	.	.	G	12.45	1.941878	0.34283	2.54E-4	0.0	ENSG00000169946	ENST00000407775;ENST00000520492;ENST00000517361;ENST00000378472	T;T;T;T	0.20881	2.04;2.51;2.51;3.71	5.91	4.1	0.47936	.	0.168138	0.64402	D	0.000003	T	0.22003	0.0530	L	0.43152	1.355	0.45852	D	0.998716	P	0.46395	0.877	P	0.45829	0.494	T	0.01800	-1.1271	10	0.30078	T	0.28	.	12.0684	0.53601	0.0663:0.1267:0.807:0.0	.	423	Q8WW38	FOG2_HUMAN	N	423;291;291;154	ENSP00000384179:S423N;ENSP00000430757:S291N;ENSP00000428720:S291N;ENSP00000367733:S154N	ENSP00000367733:S154N	S	+	2	0	ZFPM2	106882754	1.000000	0.71417	0.986000	0.45419	0.722000	0.41435	2.503000	0.45407	1.492000	0.48499	0.655000	0.94253	AGC	.	.		0.483	ZFPM2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380614.1		
TRHR	7201	hgsc.bcm.edu	37	8	110100121	110100121	+	Missense_Mutation	SNP	T	T	G			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr8:110100121T>G	ENST00000518632.1	+	2	731	c.380T>G	c.(379-381)aTc>aGc	p.I127S	TRHR_ENST00000311762.2_Missense_Mutation_p.I127S			P34981	TRFR_HUMAN	thyrotropin-releasing hormone receptor	127					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	thyrotropin-releasing hormone receptor activity (GO:0004997)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(12)|prostate(4)|skin(4)|urinary_tract(1)	37			OV - Ovarian serous cystadenocarcinoma(57;2.3e-11)			TACATAGCAATCTGTCACCCC	0.423																																					p.I127S		Atlas-SNP	.											.	TRHR	74	.	0			c.T380G						.						135.0	116.0	122.0					8																	110100121		2203	4300	6503	SO:0001583	missense	7201	exon1			TAGCAATCTGTCA		CCDS6311.1	8q23.1	2013-09-20			ENSG00000174417	ENSG00000174417			12299	protein-coding gene	gene with protein product		188545				8128317	Standard	NM_003301		Approved		uc003ymz.4	P34981	OTTHUMG00000164910	ENST00000518632.1:c.380T>G	chr8.hg19:g.110100121T>G	ENSP00000430711:p.Ile127Ser	237.0	0.0		416.0	77.0	NM_003301	Q2M339	Missense_Mutation	SNP	ENST00000518632.1	hg19	CCDS6311.1	.	.	.	.	.	.	.	.	.	.	T	20.2	3.945878	0.73672	.	.	ENSG00000174417	ENST00000518632;ENST00000311762	D;D	0.82167	-1.58;-1.58	6.06	6.06	0.98353	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	D	0.95245	0.8458	H	0.99312	4.51	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.97228	0.9882	10	0.87932	D	0	-46.8178	15.7905	0.78357	0.0:0.0:0.0:1.0	.	127	P34981	TRFR_HUMAN	S	127	ENSP00000430711:I127S;ENSP00000309818:I127S	ENSP00000309818:I127S	I	+	2	0	TRHR	110169297	1.000000	0.71417	0.991000	0.47740	0.990000	0.78478	8.033000	0.88852	2.324000	0.78689	0.533000	0.62120	ATC	.	.		0.423	TRHR-002	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380892.1		
PKHD1L1	93035	hgsc.bcm.edu	37	8	110509272	110509272	+	Missense_Mutation	SNP	C	C	G			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr8:110509272C>G	ENST00000378402.5	+	64	10556	c.10452C>G	c.(10450-10452)tgC>tgG	p.C3484W		NM_177531.4	NP_803875.2	Q86WI1	PKHL1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)-like 1	3484					immune response (GO:0006955)	cytosol (GO:0005829)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			NS(4)|breast(13)|central_nervous_system(6)|cervix(1)|endometrium(19)|kidney(17)|large_intestine(34)|lung(122)|ovary(11)|pancreas(3)|prostate(9)|skin(3)|stomach(4)|upper_aerodigestive_tract(13)|urinary_tract(4)	263			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			TTTGGACATGCTGGGATTATG	0.338										HNSCC(38;0.096)																											p.C3484W		Atlas-SNP	.											.	PKHD1L1	522	.	0			c.C10452G						.						130.0	123.0	125.0					8																	110509272		1830	4087	5917	SO:0001583	missense	93035	exon64			GACATGCTGGGAT	AY219181	CCDS47911.1	8q23	2003-03-28			ENSG00000205038	ENSG00000205038			20313	protein-coding gene	gene with protein product		607843				12620974	Standard	NM_177531		Approved		uc003yne.3	Q86WI1	OTTHUMG00000164934	ENST00000378402.5:c.10452C>G	chr8.hg19:g.110509272C>G	ENSP00000367655:p.Cys3484Trp	140.0	0.0		318.0	68.0	NM_177531	Q567P2|Q9UF27	Missense_Mutation	SNP	ENST00000378402.5	hg19	CCDS47911.1	.	.	.	.	.	.	.	.	.	.	C	16.26	3.071804	0.55646	.	.	ENSG00000205038	ENST00000378402;ENST00000526472	T;T	0.80393	-1.37;-1.35	5.8	3.95	0.45737	Pectin lyase fold/virulence factor (1);	0.054481	0.64402	D	0.000001	D	0.85539	0.5720	M	0.62723	1.935	0.45378	D	0.998369	D	0.71674	0.998	D	0.74023	0.982	D	0.84274	0.0490	10	0.66056	D	0.02	.	7.3049	0.26443	0.0:0.7208:0.0:0.2792	.	3484	Q86WI1	PKHL1_HUMAN	W	3484;412	ENSP00000367655:C3484W;ENSP00000437376:C412W	ENSP00000367655:C3484W	C	+	3	2	PKHD1L1	110578448	0.998000	0.40836	1.000000	0.80357	0.998000	0.95712	0.451000	0.21779	0.741000	0.32674	0.650000	0.86243	TGC	.	.		0.338	PKHD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381017.1	NM_177531	
CSMD3	114788	hgsc.bcm.edu	37	8	113326785	113326785	+	Nonsense_Mutation	SNP	A	A	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr8:113326785A>T	ENST00000297405.5	-	48	7666	c.7422T>A	c.(7420-7422)taT>taA	p.Y2474*	CSMD3_ENST00000352409.3_Nonsense_Mutation_p.Y2404*|CSMD3_ENST00000343508.3_Nonsense_Mutation_p.Y2434*|CSMD3_ENST00000455883.2_Nonsense_Mutation_p.Y2370*	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	2474	CUB 14. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						AACTGTCAGGATATCCAGGGC	0.388										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																											p.Y2474X		Atlas-SNP	.											.	CSMD3	2325	.	0			c.T7422A						.						99.0	95.0	96.0					8																	113326785		2203	4300	6503	SO:0001587	stop_gained	114788	exon48			GTCAGGATATCCA	AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.7422T>A	chr8.hg19:g.113326785A>T	ENSP00000297405:p.Tyr2474*	184.0	0.0		354.0	83.0	NM_198123	Q96PZ3	Nonsense_Mutation	SNP	ENST00000297405.5	hg19	CCDS6315.1	.	.	.	.	.	.	.	.	.	.	A	48	14.907339	0.99815	.	.	ENSG00000164796	ENST00000343508;ENST00000297405;ENST00000339701;ENST00000455883;ENST00000352409	.	.	.	4.98	2.6	0.31112	.	0.316121	0.28166	N	0.016342	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	9.6361	0.39809	0.8349:0.0:0.1651:0.0	.	.	.	.	X	2434;2474;1744;2370;2404	.	ENSP00000297405:Y2474X	Y	-	3	2	CSMD3	113395961	0.997000	0.39634	1.000000	0.80357	0.998000	0.95712	0.619000	0.24388	0.923000	0.37045	0.472000	0.43445	TAT	.	.		0.388	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347141.1	NM_052900	
CSMD3	114788	hgsc.bcm.edu	37	8	113988150	113988150	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr8:113988150C>A	ENST00000297405.5	-	7	1502	c.1258G>T	c.(1258-1260)Gca>Tca	p.A420S	CSMD3_ENST00000352409.3_Missense_Mutation_p.A420S|CSMD3_ENST00000343508.3_Missense_Mutation_p.A380S|CSMD3_ENST00000455883.2_Intron	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	420						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						TGTGTATCTGCTGGATGAGGA	0.458										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																											p.A420S		Atlas-SNP	.											.	CSMD3	2325	.	0			c.G1258T						.						202.0	178.0	186.0					8																	113988150		2203	4300	6503	SO:0001583	missense	114788	exon7			TATCTGCTGGATG	AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.1258G>T	chr8.hg19:g.113988150C>A	ENSP00000297405:p.Ala420Ser	150.0	0.0		316.0	145.0	NM_198123	Q96PZ3	Missense_Mutation	SNP	ENST00000297405.5	hg19	CCDS6315.1	.	.	.	.	.	.	.	.	.	.	C	17.66	3.445554	0.63178	.	.	ENSG00000164796	ENST00000343508;ENST00000297405;ENST00000352409	T;T;T	0.19250	2.16;2.16;2.17	6.17	6.17	0.99709	.	0.277746	0.21304	N	0.076748	T	0.23532	0.0569	N	0.22421	0.69	0.32113	N	0.589046	P;P	0.45715	0.787;0.865	B;P	0.49361	0.404;0.608	T	0.02837	-1.1104	10	0.08837	T	0.75	.	20.8794	0.99867	0.0:1.0:0.0:0.0	.	420;380	Q7Z407;Q7Z407-2	CSMD3_HUMAN;.	S	380;420;420	ENSP00000345799:A380S;ENSP00000297405:A420S;ENSP00000343124:A420S	ENSP00000297405:A420S	A	-	1	0	CSMD3	114057326	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.335000	0.65929	2.941000	0.99782	0.655000	0.94253	GCA	.	.		0.458	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347141.1	NM_052900	
ENPP2	5168	hgsc.bcm.edu	37	8	120628551	120628551	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr8:120628551A>T	ENST00000075322.6	-	8	789	c.731T>A	c.(730-732)cTg>cAg	p.L244Q	ENPP2_ENST00000522826.1_Missense_Mutation_p.L244Q|ENPP2_ENST00000259486.6_Missense_Mutation_p.L244Q|ENPP2_ENST00000427067.2_Missense_Mutation_p.L240Q	NM_001040092.2	NP_001035181.1	Q13822	ENPP2_HUMAN	ectonucleotide pyrophosphatase/phosphodiesterase 2	244	Substrate binding. {ECO:0000250}.				cellular component movement (GO:0006928)|chemotaxis (GO:0006935)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|phosphate-containing compound metabolic process (GO:0006796)|phosphatidylcholine catabolic process (GO:0034638)|phospholipid catabolic process (GO:0009395)|regulation of cell migration (GO:0030334)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	alkylglycerophosphoethanolamine phosphodiesterase activity (GO:0047391)|calcium ion binding (GO:0005509)|hydrolase activity (GO:0016787)|lysophospholipase activity (GO:0004622)|nucleic acid binding (GO:0003676)|nucleotide diphosphatase activity (GO:0004551)|phosphodiesterase I activity (GO:0004528)|polysaccharide binding (GO:0030247)|scavenger receptor activity (GO:0005044)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(15)|lung(30)|ovary(2)|prostate(2)|skin(4)|upper_aerodigestive_tract(4)	69	Lung NSC(37;5.03e-06)|Ovarian(258;0.0249)|Hepatocellular(40;0.161)		STAD - Stomach adenocarcinoma(47;0.00185)			TCGCCCTCGCAGATGAAAAGT	0.373																																					p.L244Q	Melanoma(20;305 879 2501 4818 31020)	Atlas-SNP	.											.	ENPP2	254	.	0			c.T731A						.						123.0	110.0	114.0					8																	120628551		2203	4300	6503	SO:0001583	missense	5168	exon8			CCTCGCAGATGAA	D45421	CCDS6329.1, CCDS34936.1, CCDS47914.1	8q24.12	2014-04-09	2008-08-01		ENSG00000136960	ENSG00000136960	3.1.4.1, 3.6.1.9		3357	protein-coding gene	gene with protein product	"""autotaxin"""	601060		PDNP2		8586446	Standard	NM_001040092		Approved	ATX, PD-IALPHA	uc003yos.2	Q13822	OTTHUMG00000164995	ENST00000075322.6:c.731T>A	chr8.hg19:g.120628551A>T	ENSP00000075322:p.Leu244Gln	71.0	0.0		195.0	93.0	NM_001130863	A8UHA1|E9PHP7|Q13827|Q14555|Q15117|Q9UCQ8|Q9UCR0|Q9UCR1|Q9UCR2|Q9UCR3|Q9UCR4	Missense_Mutation	SNP	ENST00000075322.6	hg19	CCDS34936.1	.	.	.	.	.	.	.	.	.	.	A	23.6	4.436096	0.83885	.	.	ENSG00000136960	ENST00000259486;ENST00000427067;ENST00000522826;ENST00000075322;ENST00000520066	T;T;T;T;T	0.75589	-0.95;-0.95;-0.95;-0.95;-0.95	5.55	5.55	0.83447	Alkaline phosphatase-like, alpha/beta/alpha (1);Alkaline-phosphatase-like, core domain (1);	0.129957	0.53938	D	0.000042	D	0.82903	0.5138	L	0.49350	1.555	0.58432	D	0.999998	D;D;D	0.89917	0.999;1.0;0.998	D;D;D	0.76071	0.987;0.97;0.977	D	0.84756	0.0759	10	0.87932	D	0	.	15.7051	0.77573	1.0:0.0:0.0:0.0	.	244;244;244	E9PHP7;Q13822;Q13822-2	.;ENPP2_HUMAN;.	Q	244;240;244;244;226	ENSP00000259486:L244Q;ENSP00000403315:L240Q;ENSP00000428291:L244Q;ENSP00000075322:L244Q;ENSP00000428304:L226Q	ENSP00000075322:L244Q	L	-	2	0	ENPP2	120697732	1.000000	0.71417	0.997000	0.53966	0.694000	0.40290	9.339000	0.96797	2.106000	0.64143	0.460000	0.39030	CTG	.	.		0.373	ENPP2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000381390.1		
GSDMC	56169	hgsc.bcm.edu	37	8	130778031	130778031	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr8:130778031A>G	ENST00000276708.4	-	4	1294	c.413T>C	c.(412-414)tTg>tCg	p.L138S		NM_031415.2	NP_113603.1	Q9BYG8	GSDMC_HUMAN	gasdermin C	138						cytoplasm (GO:0005737)|microtubule organizing center (GO:0005815)|mitochondrion (GO:0005739)				autonomic_ganglia(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(5)|ovary(2)|pancreas(1)|skin(5)|stomach(2)|upper_aerodigestive_tract(1)	26						CTCTGGATCCAACAGTTTCCT	0.517																																					p.L138S		Atlas-SNP	.											.	GSDMC	71	.	0			c.T413C						.						62.0	57.0	59.0					8																	130778031		2203	4300	6503	SO:0001583	missense	56169	exon4			GGATCCAACAGTT	AB042405	CCDS6360.1	8q24.21	2014-05-14	2008-07-31	2008-07-31	ENSG00000147697	ENSG00000147697			7151	protein-coding gene	gene with protein product		608384	"""melanoma-derived leucine zipper, extra-nuclear factor"""	MLZE		17350798	Standard	NM_031415		Approved		uc003ysr.3	Q9BYG8	OTTHUMG00000164851	ENST00000276708.4:c.413T>C	chr8.hg19:g.130778031A>G	ENSP00000276708:p.Leu138Ser	73.0	0.0		117.0	29.0	NM_031415	Q5XKF3|Q6P494	Missense_Mutation	SNP	ENST00000276708.4	hg19	CCDS6360.1	.	.	.	.	.	.	.	.	.	.	A	14.08	2.428422	0.43122	.	.	ENSG00000147697	ENST00000276708	T	0.25579	1.79	4.51	2.07	0.26955	.	0.981729	0.08288	N	0.968837	T	0.45054	0.1323	M	0.72118	2.19	0.09310	N	1	D	0.76494	0.999	D	0.73708	0.981	T	0.17440	-1.0369	10	0.62326	D	0.03	.	3.7426	0.08536	0.7084:0.0:0.1033:0.1883	.	138	Q9BYG8	GSDMC_HUMAN	S	138	ENSP00000276708:L138S	ENSP00000276708:L138S	L	-	2	0	GSDMC	130847213	0.001000	0.12720	0.000000	0.03702	0.101000	0.19017	0.884000	0.28214	0.255000	0.21593	0.482000	0.46254	TTG	.	.		0.517	GSDMC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380586.1		
ADCY8	114	hgsc.bcm.edu	37	8	131955635	131955635	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr8:131955635G>A	ENST00000286355.5	-	4	3407	c.1315C>T	c.(1315-1317)Ctc>Ttc	p.L439F	RP11-737F9.1_ENST00000523318.1_RNA|ADCY8_ENST00000377928.3_Missense_Mutation_p.L439F	NM_001115.2	NP_001106.1	P40145	ADCY8_HUMAN	adenylate cyclase 8 (brain)	439					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|learning or memory (GO:0007611)|long-term memory (GO:0007616)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|calcium- and calmodulin-responsive adenylate cyclase activity (GO:0008294)|metal ion binding (GO:0046872)			NS(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(10)|kidney(5)|large_intestine(21)|lung(67)|pancreas(1)|prostate(3)|skin(12)|upper_aerodigestive_tract(5)|urinary_tract(2)	134	Esophageal squamous(12;0.00693)|Ovarian(258;0.00707)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000538)			AGCTCGTTGAGCATCCTGACC	0.473										HNSCC(32;0.087)																											p.L439F		Atlas-SNP	.											.	ADCY8	291	.	0			c.C1315T						.						61.0	57.0	58.0					8																	131955635		2203	4300	6503	SO:0001583	missense	114	exon4			CGTTGAGCATCCT	Z35309	CCDS6363.1	8q24	2013-02-04			ENSG00000155897	ENSG00000155897	4.6.1.1	"""Adenylate cyclases"""	239	protein-coding gene	gene with protein product		103070		ADCY3		8076676	Standard	NM_001115		Approved	HBAC1, AC8	uc003ytd.4	P40145	OTTHUMG00000164756	ENST00000286355.5:c.1315C>T	chr8.hg19:g.131955635G>A	ENSP00000286355:p.Leu439Phe	116.0	0.0		175.0	77.0	NM_001115		Missense_Mutation	SNP	ENST00000286355.5	hg19	CCDS6363.1	.	.	.	.	.	.	.	.	.	.	G	23.2	4.385362	0.82792	.	.	ENSG00000155897	ENST00000286355;ENST00000377928;ENST00000522949	D;D;D	0.88277	-2.36;-2.36;-2.36	5.65	4.55	0.56014	Adenylyl cyclase class-3/4/guanylyl cyclase (5);	0.000000	0.85682	D	0.000000	D	0.96562	0.8878	H	0.99415	4.555	0.36593	D	0.874223	D;D	0.89917	1.0;1.0	D;D	0.97110	0.998;1.0	D	0.97262	0.9905	10	0.87932	D	0	.	8.863	0.35269	0.1918:0.0:0.8082:0.0	.	439;439	E7EVL1;P40145	.;ADCY8_HUMAN	F	439;439;54	ENSP00000286355:L439F;ENSP00000367161:L439F;ENSP00000428010:L54F	ENSP00000286355:L439F	L	-	1	0	ADCY8	132024817	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.278000	0.43426	2.825000	0.97269	0.655000	0.94253	CTC	.	.		0.473	ADCY8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380080.1		
COL22A1	169044	hgsc.bcm.edu	37	8	139705929	139705929	+	Missense_Mutation	SNP	T	T	G			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr8:139705929T>G	ENST00000303045.6	-	35	3160	c.2714A>C	c.(2713-2715)cAg>cCg	p.Q905P	COL22A1_ENST00000435777.1_Missense_Mutation_p.Q905P|COL22A1_ENST00000341807.4_5'UTR	NM_152888.1	NP_690848.1	Q8NFW1	COMA1_HUMAN	collagen, type XXII, alpha 1	905	Collagen-like 7.|Gly-rich.|Pro-rich.				extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(14)|large_intestine(29)|lung(107)|ovary(13)|pancreas(1)|prostate(3)|skin(12)|upper_aerodigestive_tract(15)|urinary_tract(4)	211	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0517)			TGCACCTTCCTGTCCCTTGGC	0.637										HNSCC(7;0.00092)																											p.Q905P		Atlas-SNP	.											.	COL22A1	390	.	0			c.A2714C						.						37.0	32.0	34.0					8																	139705929		2198	4297	6495	SO:0001583	missense	169044	exon35			CCTTCCTGTCCCT	AF406780	CCDS6376.1	8q24.3	2013-01-16			ENSG00000169436	ENSG00000169436		"""Collagens"""	22989	protein-coding gene	gene with protein product		610026					Standard	NM_152888		Approved		uc003yvd.3	Q8NFW1	OTTHUMG00000150035	ENST00000303045.6:c.2714A>C	chr8.hg19:g.139705929T>G	ENSP00000303153:p.Gln905Pro	73.0	0.0		133.0	32.0	NM_152888	B7ZMH0|C9K0G4|Q8IVT9	Missense_Mutation	SNP	ENST00000303045.6	hg19	CCDS6376.1	.	.	.	.	.	.	.	.	.	.	T	7.307	0.614116	0.14129	.	.	ENSG00000169436	ENST00000303045;ENST00000435777;ENST00000545577	D;D	0.93307	-3.2;-3.2	3.71	3.71	0.42584	.	0.465293	0.17680	U	0.165657	T	0.82089	0.4961	N	0.02865	-0.47	0.24878	N	0.992246	P;B	0.40066	0.701;0.389	B;B	0.39738	0.126;0.308	T	0.74788	-0.3546	10	0.29301	T	0.29	.	9.0677	0.36473	0.0:0.0:0.0:1.0	.	905;905	Q8NFW1-2;Q8NFW1	.;COMA1_HUMAN	P	905;905;618	ENSP00000303153:Q905P;ENSP00000387655:Q905P	ENSP00000303153:Q905P	Q	-	2	0	COL22A1	139775111	0.961000	0.32948	0.983000	0.44433	0.321000	0.28281	1.180000	0.32005	1.921000	0.55644	0.519000	0.50382	CAG	.	.		0.637	COL22A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000315905.2	XM_291257	
BAI1	575	hgsc.bcm.edu	37	8	143558633	143558633	+	Missense_Mutation	SNP	T	T	G			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr8:143558633T>G	ENST00000517894.1	+	5	2110	c.1216T>G	c.(1216-1218)Tgc>Ggc	p.C406G	BAI1_ENST00000323289.5_Missense_Mutation_p.C406G			O14514	BAI1_HUMAN	brain-specific angiogenesis inhibitor 1	406	TSP type-1 2. {ECO:0000255|PROSITE- ProRule:PRU00210}.				axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell proliferation (GO:0008285)|neuropeptide signaling pathway (GO:0007218)|peripheral nervous system development (GO:0007422)|signal transduction (GO:0007165)	cell-cell junction (GO:0005911)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(2)|lung(28)|ovary(4)|pancreas(1)|prostate(7)	57	all_cancers(97;2.84e-12)|all_epithelial(106;5.91e-09)|Lung NSC(106;0.000322)|all_lung(105;0.000616)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0315)|Acute lymphoblastic leukemia(118;0.155)					CTCTGCCGTGTGCCCAGGTGG	0.731																																					p.C406G		Atlas-SNP	.											.	BAI1	146	.	0			c.T1216G						.						15.0	19.0	18.0					8																	143558633		2048	4147	6195	SO:0001583	missense	575	exon4			GCCGTGTGCCCAG	AB005297	CCDS64985.1	8q24.3	2014-08-08			ENSG00000181790	ENSG00000181790		"""-"", ""GPCR / Class B : Orphans"""	943	protein-coding gene	gene with protein product		602682				9533023	Standard	NM_001702		Approved		uc003ywm.3	O14514	OTTHUMG00000164732	ENST00000517894.1:c.1216T>G	chr8.hg19:g.143558633T>G	ENSP00000430945:p.Cys406Gly	42.0	0.0		54.0	10.0	NM_001702		Missense_Mutation	SNP	ENST00000517894.1	hg19		.	.	.	.	.	.	.	.	.	.	T	23.1	4.380670	0.82792	.	.	ENSG00000181790	ENST00000517894;ENST00000323289	D;D	0.96459	-4.02;-4.02	4.44	4.44	0.53790	.	0.000000	0.85682	U	0.000000	D	0.98131	0.9383	M	0.89095	3.005	0.80722	D	1	D	0.89917	1.0	D	0.77004	0.989	D	0.99023	1.0818	10	0.87932	D	0	.	13.1646	0.59562	0.0:0.0:0.0:1.0	.	406	E9PBK0	.	G	406	ENSP00000430945:C406G;ENSP00000313046:C406G	ENSP00000313046:C406G	C	+	1	0	BAI1	143555635	1.000000	0.71417	1.000000	0.80357	0.928000	0.56348	7.716000	0.84723	1.747000	0.51819	0.459000	0.35465	TGC	.	.		0.731	BAI1-001	KNOWN	non_canonical_conserved|not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000379963.3	NM_001702	
ARC	23237	hgsc.bcm.edu	37	8	143694546	143694546	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr8:143694546C>A	ENST00000356613.2	-	1	2287	c.1087G>T	c.(1087-1089)Gcc>Tcc	p.A363S	ARC_ENST00000581404.1_5'Flank	NM_015193.4	NP_056008.1	O60936	NOL3_HUMAN	activity-regulated cytoskeleton-associated protein	0					apoptotic process (GO:0006915)|mRNA processing (GO:0006397)|negative regulation of apoptotic process (GO:0043066)|regulation of gene expression (GO:0010468)|response to hypoxia (GO:0001666)|response to injury involved in regulation of muscle adaptation (GO:0014876)|RNA splicing (GO:0008380)	cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|sarcoplasm (GO:0016528)	identical protein binding (GO:0042802)|RNA binding (GO:0003723)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(4)|lung(3)|upper_aerodigestive_tract(1)	13	all_cancers(97;3.55e-12)|all_epithelial(106;1.03e-08)|Lung NSC(106;0.000353)|all_lung(105;0.00092)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)	Acute lymphoblastic leukemia(644;0.0279)				GCCGGCTCGGCCGCCTGCTCC	0.711																																					p.A363S		Atlas-SNP	.											.	ARC	34	.	0			c.G1087T						.						14.0	17.0	16.0					8																	143694546		2196	4298	6494	SO:0001583	missense	23237	exon1			GCTCGGCCGCCTG	AF193421	CCDS34950.1	8q24.3	2008-08-01			ENSG00000198576	ENSG00000198576			648	protein-coding gene	gene with protein product		612461				10970730, 17466953	Standard	NM_015193		Approved	KIAA0278, Arg3.1	uc003ywn.2	Q7LC44	OTTHUMG00000134310	ENST00000356613.2:c.1087G>T	chr8.hg19:g.143694546C>A	ENSP00000349022:p.Ala363Ser	53.0	0.0		86.0	36.0	NM_015193	B4DFL0|O60937	Missense_Mutation	SNP	ENST00000356613.2	hg19	CCDS34950.1	.	.	.	.	.	.	.	.	.	.	C	4.022	0.001569	0.07819	.	.	ENSG00000198576	ENST00000356613	T	0.30182	1.54	4.61	-1.03	0.10102	.	0.294619	0.23476	U	0.047770	T	0.12305	0.0299	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.32455	-0.9906	10	0.12103	T	0.63	.	10.164	0.42868	0.5094:0.3669:0.1237:0.0	.	363	Q7LC44	ARC_HUMAN	S	363	ENSP00000349022:A363S	ENSP00000349022:A363S	A	-	1	0	ARC	143691548	0.000000	0.05858	0.000000	0.03702	0.028000	0.11728	-0.058000	0.11750	-0.652000	0.05408	-0.311000	0.09066	GCC	.	.		0.711	ARC-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259274.2		
GLI4	2738	hgsc.bcm.edu	37	8	144351615	144351615	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr8:144351615G>T	ENST00000523522.1	+	1	88	c.49G>T	c.(49-51)Gtc>Ttc	p.V17F	GLI4_ENST00000517468.1_Missense_Mutation_p.V17F|GLI4_ENST00000344692.3_Missense_Mutation_p.V17F|GLI4_ENST00000521682.1_Missense_Mutation_p.V17F|GLI4_ENST00000340042.1_Missense_Mutation_p.V17F|ZFP41_ENST00000522452.1_Intron			P10075	GLI4_HUMAN	GLI family zinc finger 4	17					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|large_intestine(1)|lung(5)	9	all_cancers(97;1.01e-10)|all_epithelial(106;4.86e-09)|Lung NSC(106;0.000167)|all_lung(105;0.000459)|Ovarian(258;0.0212)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.156)|Colorectal(110;0.173)			CCCGTCCCCTGTCAGTCTCTC	0.597																																					p.V17F		Atlas-SNP	.											.	GLI4	28	.	0			c.G49T						.						187.0	184.0	185.0					8																	144351615		2203	4300	6503	SO:0001583	missense	2738	exon2			TCCCCTGTCAGTC		CCDS6398.1	8q24.3	2013-01-08	2009-03-05		ENSG00000250571	ENSG00000250571		"""Zinc fingers, C2H2-type"""	4320	protein-coding gene	gene with protein product		165280	"""GLI-Kruppel family member GLI4"", ""glioma-associated oncogene family zinc finger 4"""			2850480	Standard	NM_138465		Approved	HKR4, ZNF928	uc003yxx.3	P10075	OTTHUMG00000164952	ENST00000523522.1:c.49G>T	chr8.hg19:g.144351615G>T	ENSP00000430987:p.Val17Phe	98.0	0.0		151.0	68.0	NM_138465	Q96CK9	Missense_Mutation	SNP	ENST00000523522.1	hg19	CCDS6398.1	.	.	.	.	.	.	.	.	.	.	G	10.41	1.342739	0.24339	.	.	ENSG00000250571	ENST00000521682;ENST00000340042;ENST00000344692;ENST00000517468;ENST00000523522;ENST00000520021	T;T	0.06528	3.29;3.29	4.1	0.876	0.19138	.	.	.	.	.	T	0.03477	0.0100	N	0.24115	0.695	0.09310	N	1	B	0.29085	0.232	B	0.24701	0.055	T	0.46190	-0.9209	9	0.09843	T	0.71	.	5.4408	0.16507	0.5044:0.0:0.4956:0.0	.	17	P10075	GLI4_HUMAN	F	17	ENSP00000345024:V17F;ENSP00000430987:V17F	ENSP00000345024:V17F	V	+	1	0	GLI4	144422990	0.000000	0.05858	0.002000	0.10522	0.253000	0.25986	-0.112000	0.10791	0.347000	0.23924	-0.244000	0.11960	GTC	.	.		0.597	GLI4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381128.2		
ZNF707	286075	hgsc.bcm.edu	37	8	144776308	144776308	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr8:144776308A>G	ENST00000532205.1	+	8	1623	c.724A>G	c.(724-726)Agc>Ggc	p.S242G	ZNF707_ENST00000454097.1_Missense_Mutation_p.S242G|ZNF707_ENST00000532158.1_Missense_Mutation_p.S242G|ZNF707_ENST00000358656.4_Missense_Mutation_p.S242G|RP11-429J17.2_ENST00000531565.1_RNA|ZNF707_ENST00000418203.2_Missense_Mutation_p.S242G			Q96C28	ZN707_HUMAN	zinc finger protein 707	242					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)	1	all_cancers(97;3.74e-11)|all_epithelial(106;2.62e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;5.6e-41)|Epithelial(56;1.02e-39)|all cancers(56;9.65e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.146)			GCAGGCGTTCAGCCTGAAGGA	0.642																																					p.S242G		Atlas-SNP	.											.	ZNF707	21	.	0			c.A724G						.						17.0	20.0	19.0					8																	144776308		2147	4246	6393	SO:0001583	missense	286075	exon6			GCGTTCAGCCTGA	AK001126	CCDS47932.1	8q24.3	2013-01-08				ENSG00000181135		"""Zinc fingers, C2H2-type"", ""-"""	27815	protein-coding gene	gene with protein product						12477932	Standard	NM_173831		Approved		uc010mfi.3	Q96C28		ENST00000532205.1:c.724A>G	chr8.hg19:g.144776308A>G	ENSP00000436212:p.Ser242Gly	49.0	0.0		89.0	10.0	NM_001100598	A8K317|B3KNY1|D3DWK7	Missense_Mutation	SNP	ENST00000532205.1	hg19	CCDS47932.1	.	.	.	.	.	.	.	.	.	.	A	12.96	2.094002	0.36952	.	.	ENSG00000181135	ENST00000454097;ENST00000358656;ENST00000532158;ENST00000532205;ENST00000418203	T;T;T;T;T	0.07688	3.17;3.17;3.17;3.17;3.17	2.99	0.242	0.15498	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.05823	0.0152	N	0.20574	0.59	0.23632	N	0.997245	B;B	0.27997	0.197;0.108	B;B	0.36464	0.225;0.026	T	0.47661	-0.9100	8	.	.	.	-13.024	4.2736	0.10797	0.67:0.2033:0.1267:0.0	.	167;242	B4DV46;Q96C28	.;ZN707_HUMAN	G	242	ENSP00000409029:S242G;ENSP00000351482:S242G;ENSP00000436250:S242G;ENSP00000436212:S242G;ENSP00000413215:S242G	.	S	+	1	0	ZNF707	144848296	0.000000	0.05858	0.789000	0.31954	0.081000	0.17604	-1.674000	0.01949	0.217000	0.20800	0.460000	0.39030	AGC	.	.		0.642	ZNF707-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382197.1	NM_173831	
FREM1	158326	hgsc.bcm.edu	37	9	14859459	14859459	+	Missense_Mutation	SNP	A	A	C	rs375644504		TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr9:14859459A>C	ENST00000380880.3	-	4	1136	c.353T>G	c.(352-354)aTa>aGa	p.I118R	FREM1_ENST00000422223.2_Missense_Mutation_p.I118R|FREM1_ENST00000380881.4_Missense_Mutation_p.I118R			Q5H8C1	FREM1_HUMAN	FRAS1 related extracellular matrix 1	118					cell communication (GO:0007154)|cell-matrix adhesion (GO:0007160)|craniofacial suture morphogenesis (GO:0097094)	basement membrane (GO:0005604)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)			breast(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(40)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	100				GBM - Glioblastoma multiforme(50;3.53e-06)		AAAAGTTTCTATGAAGGTATC	0.423																																					p.I118R		Atlas-SNP	.											.	FREM1	261	.	0			c.T353G						.	A	ARG/ILE	1,3703		0,1,1851	105.0	102.0	103.0		353	-1.0	0.8	9		103	0,8184		0,0,4092	no	missense	FREM1	NM_144966.5	97	0,1,5943	CC,CA,AA		0.0,0.027,0.0084	benign	118/2180	14859459	1,11887	1852	4092	5944	SO:0001583	missense	158326	exon5			GTTTCTATGAAGG	AK058190	CCDS47952.1, CCDS55293.1	9p22.3	2010-06-04	2004-12-15	2004-12-15	ENSG00000164946	ENSG00000164946			23399	protein-coding gene	gene with protein product		608944	"""chromosome 9 open reading frame 154"""	C9orf154		12838346, 15345741	Standard	NM_144966		Approved	FLJ25461, C9orf145, C9orf143, DKFZp686M16108, TILRR	uc003zlm.3	Q5H8C1	OTTHUMG00000019575	ENST00000380880.3:c.353T>G	chr9.hg19:g.14859459A>C	ENSP00000370262:p.Ile118Arg	178.0	0.0		119.0	49.0	NM_144966	B7ZBX4|Q5VV00|Q5VV01|Q6MZI4|Q8NEG9|Q96LI3	Missense_Mutation	SNP	ENST00000380880.3	hg19	CCDS47952.1	.	.	.	.	.	.	.	.	.	.	A	12.67	2.008270	0.35415	2.7E-4	0.0	ENSG00000164946	ENST00000380881;ENST00000422223;ENST00000380880	T;T;T	0.11821	2.74;2.75;2.75	5.95	-1.02	0.10135	.	0.572649	0.21108	N	0.080025	T	0.11067	0.0270	L	0.36672	1.1	0.23515	N	0.997518	B	0.20164	0.042	B	0.22601	0.04	T	0.26224	-1.0109	10	0.66056	D	0.02	-0.0025	11.8127	0.52192	0.5406:0.0:0.4594:0.0	.	118	Q5H8C1	FREM1_HUMAN	R	118	ENSP00000370263:I118R;ENSP00000412940:I118R;ENSP00000370262:I118R	ENSP00000370257:I118R	I	-	2	0	FREM1	14849459	0.010000	0.17322	0.773000	0.31616	0.937000	0.57800	0.037000	0.13840	-0.223000	0.09943	-0.242000	0.12053	ATA	.	.		0.423	FREM1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000339474.2	NM_144966	
PTPLAD2	401494	hgsc.bcm.edu	37	9	21008034	21008034	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr9:21008034A>G	ENST00000495827.2	-	6	647	c.602T>C	c.(601-603)aTg>aCg	p.M201T	PTPLAD2_ENST00000513293.2_Missense_Mutation_p.M201T	NM_001010915.3	NP_001010915.2	Q5VWC8	HACD4_HUMAN	protein tyrosine phosphatase-like A domain containing 2	201					fatty acid biosynthetic process (GO:0006633)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	lyase activity (GO:0016829)			breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(3)|prostate(1)|skin(1)	10				Lung(24;6.02e-14)|LUSC - Lung squamous cell carcinoma(38;1.29e-10)		AAAGAGCATCATGAGATATAT	0.368																																					p.M201T		Atlas-SNP	.											.	PTPLAD2	26	.	0			c.T602C						.						107.0	101.0	103.0					9																	21008034		1865	4097	5962	SO:0001583	missense	401494	exon6			AGCATCATGAGAT		CCDS43791.1	9p21.3	2008-02-05			ENSG00000188921	ENSG00000188921			20920	protein-coding gene	gene with protein product		615941					Standard	NM_001010915		Approved	Em:AL662879.1, OTTHUMG00000021016	uc010mir.1	Q5VWC8	OTTHUMG00000021016	ENST00000495827.2:c.602T>C	chr9.hg19:g.21008034A>G	ENSP00000419503:p.Met201Thr	98.0	0.0		98.0	43.0	NM_001010915	Q7Z385	Missense_Mutation	SNP	ENST00000495827.2	hg19	CCDS43791.1	.	.	.	.	.	.	.	.	.	.	A	11.85	1.760240	0.31137	.	.	ENSG00000188921	ENST00000513293;ENST00000495827	T;T	0.28255	1.62;1.62	5.12	3.98	0.46160	.	0.330046	0.32918	N	0.005500	T	0.22126	0.0533	L	0.33485	1.01	0.36944	D	0.892527	B	0.09022	0.002	B	0.08055	0.003	T	0.09292	-1.0681	10	0.42905	T	0.14	-7.5059	8.8379	0.35123	0.8452:0.0:0.1548:0.0	.	201	Q5VWC8	HACD4_HUMAN	T	201	ENSP00000426475:M201T;ENSP00000419503:M201T	ENSP00000419503:M201T	M	-	2	0	PTPLAD2	20998034	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.076000	0.50081	0.902000	0.36520	0.528000	0.53228	ATG	.	.		0.368	PTPLAD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055434.3	NM_001010915	
TEK	7010	hgsc.bcm.edu	37	9	27203079	27203079	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr9:27203079C>A	ENST00000380036.4	+	13	2613	c.2171C>A	c.(2170-2172)gCc>gAc	p.A724D	TEK_ENST00000519097.1_Missense_Mutation_p.A577D|TEK_ENST00000406359.4_Missense_Mutation_p.A681D	NM_000459.3	NP_000450	Q02763	TIE2_HUMAN	TEK tyrosine kinase, endothelial	724	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.		A -> T (in dbSNP:rs4631561). {ECO:0000269|PubMed:17344846}.		angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cell-cell signaling (GO:0007267)|cell-matrix adhesion (GO:0007160)|definitive hemopoiesis (GO:0060216)|endochondral ossification (GO:0001958)|endothelial cell proliferation (GO:0001935)|glomerulus vasculature development (GO:0072012)|heart development (GO:0007507)|heart trabecula formation (GO:0060347)|intracellular signal transduction (GO:0035556)|leukocyte migration (GO:0050900)|negative regulation of angiogenesis (GO:0016525)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of inflammatory response (GO:0050728)|organ regeneration (GO:0031100)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of actin cytoskeleton reorganization (GO:2000251)|positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of intracellular signal transduction (GO:1902533)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|protein autophosphorylation (GO:0046777)|protein oligomerization (GO:0051259)|regulation of endothelial cell apoptotic process (GO:2000351)|regulation of establishment or maintenance of cell polarity (GO:0032878)|regulation of vascular permeability (GO:0043114)|response to cAMP (GO:0051591)|response to estrogen (GO:0043627)|response to hypoxia (GO:0001666)|response to peptide hormone (GO:0043434)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|sprouting angiogenesis (GO:0002040)|substrate adhesion-dependent cell spreading (GO:0034446)|Tie signaling pathway (GO:0048014)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	apical plasma membrane (GO:0016324)|basal plasma membrane (GO:0009925)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|microvillus (GO:0005902)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein tyrosine kinase activity (GO:0004713)|receptor activity (GO:0004872)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			breast(3)|central_nervous_system(3)|kidney(1)|lung(2)|ovary(3)|skin(3)	15		all_neural(11;7.57e-10)|Myeloproliferative disorder(762;0.0255)		Lung(218;4.08e-05)|LUSC - Lung squamous cell carcinoma(38;0.00027)	Ponatinib(DB08901)|Regorafenib(DB08896)|Vandetanib(DB05294)	AGCAACCCAGCCTTTTCTCAT	0.473																																					p.A724D		Atlas-SNP	.											.	TEK	250	.	0			c.C2171A						.						79.0	76.0	77.0					9																	27203079		2203	4300	6503	SO:0001583	missense	7010	exon13			ACCCAGCCTTTTC	L06139	CCDS6519.1, CCDS75825.1	9p21	2013-02-11	2008-07-31		ENSG00000120156	ENSG00000120156		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	11724	protein-coding gene	gene with protein product		600221	"""venous malformations, multiple cutaneous and mucosal"""	VMCM		1312667, 7833915	Standard	XM_005251561		Approved	TIE2, TIE-2, VMCM1, CD202b	uc003zqi.4	Q02763	OTTHUMG00000019712	ENST00000380036.4:c.2171C>A	chr9.hg19:g.27203079C>A	ENSP00000369375:p.Ala724Asp	185.0	0.0		134.0	56.0	NM_000459	A8K6W0|B4DH20|B4DHD3|D3DRK5|E7EWI2|Q5TCU2|Q8IV34	Missense_Mutation	SNP	ENST00000380036.4	hg19	CCDS6519.1	.	.	.	.	.	.	.	.	.	.	C	6.709	0.499475	0.12762	.	.	ENSG00000120156	ENST00000519097;ENST00000380036;ENST00000406359	T;T;T	0.17691	2.26;2.26;2.26	5.58	3.62	0.41486	Fibronectin, type III (2);Immunoglobulin-like fold (1);	1.503030	0.04318	N	0.350123	T	0.15176	0.0366	N	0.08118	0	0.09310	N	1	B;B;B;B	0.23540	0.017;0.087;0.005;0.042	B;B;B;B	0.32928	0.062;0.155;0.016;0.089	T	0.42682	-0.9437	10	0.72032	D	0.01	.	13.6662	0.62396	0.4323:0.5677:0.0:0.0	.	577;757;681;724	E7EWI2;Q59HG2;B4DHD3;Q02763	.;.;.;TIE2_HUMAN	D	577;724;681	ENSP00000430686:A577D;ENSP00000369375:A724D;ENSP00000383977:A681D	ENSP00000369375:A724D	A	+	2	0	TEK	27193079	0.005000	0.15991	0.401000	0.26359	0.955000	0.61496	1.573000	0.36472	1.476000	0.48215	0.637000	0.83480	GCC	.	.		0.473	TEK-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051965.3		
TAF1L	138474	hgsc.bcm.edu	37	9	32632432	32632432	+	Missense_Mutation	SNP	C	C	G			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr9:32632432C>G	ENST00000242310.4	-	1	3235	c.3146G>C	c.(3145-3147)cGc>cCc	p.R1049P	RP11-555J4.4_ENST00000430787.1_RNA	NM_153809.2	NP_722516.1	Q8IZX4	TAF1L_HUMAN	TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 210kDa-like	1049					DNA-templated transcription, initiation (GO:0006352)|histone acetylation (GO:0016573)|male meiosis (GO:0007140)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	transcription factor TFIID complex (GO:0005669)	DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|lysine-acetylated histone binding (GO:0070577)|protein serine/threonine kinase activity (GO:0004674)|TBP-class protein binding (GO:0017025)			breast(6)|central_nervous_system(4)|endometrium(14)|kidney(11)|large_intestine(32)|liver(2)|lung(68)|ovary(2)|pancreas(2)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(1)	159			LUSC - Lung squamous cell carcinoma(29;0.0181)	GBM - Glioblastoma multiforme(74;0.00301)		TGACATTGTGCGCACCACATC	0.473																																					p.R1049P		Atlas-SNP	.											.	TAF1L	382	.	0			c.G3146C						.						224.0	222.0	223.0					9																	32632432		2203	4300	6503	SO:0001583	missense	138474	exon1			ATTGTGCGCACCA	AF390562	CCDS35003.1	9p12	2007-07-27	2007-07-27		ENSG00000122728	ENSG00000122728			18056	protein-coding gene	gene with protein product		607798	"""TAF1-like RNA polymerase II, TATA box binding protein (TBP)-associated factor, 210kDa"""			12217962	Standard	NM_153809		Approved		uc003zrg.1	Q8IZX4	OTTHUMG00000019747	ENST00000242310.4:c.3146G>C	chr9.hg19:g.32632432C>G	ENSP00000418379:p.Arg1049Pro	215.0	0.0		217.0	81.0	NM_153809	Q0VG57	Missense_Mutation	SNP	ENST00000242310.4	hg19	CCDS35003.1	.	.	.	.	.	.	.	.	.	.	C	22.1	4.240544	0.79912	.	.	ENSG00000122728	ENST00000242310	T	0.17370	2.28	0.479	0.479	0.16796	.	0.000000	0.85682	D	0.000000	T	0.38639	0.1048	M	0.84511	2.7	0.58432	D	0.999999	D	0.89917	1.0	D	0.97110	1.0	T	0.23048	-1.0199	10	0.87932	D	0	.	6.6915	0.23174	0.0:0.9998:0.0:2.0E-4	.	1049	Q8IZX4	TAF1L_HUMAN	P	1049	ENSP00000418379:R1049P	ENSP00000418379:R1049P	R	-	2	0	TAF1L	32622432	1.000000	0.71417	0.998000	0.56505	0.882000	0.50991	4.928000	0.63447	0.507000	0.28148	0.195000	0.17529	CGC	.	.		0.473	TAF1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052012.2		
NOL6	65083	hgsc.bcm.edu	37	9	33469275	33469275	+	Silent	SNP	C	C	G	rs370042879		TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr9:33469275C>G	ENST00000379471.2	-	6	879	c.792G>C	c.(790-792)ccG>ccC	p.P264P	NOL6_ENST00000455041.2_Silent_p.P204P|NOL6_ENST00000464829.1_5'UTR			Q9H6R4	NOL6_HUMAN	nucleolar protein 6 (RNA-associated)	264					rRNA processing (GO:0006364)	condensed nuclear chromosome (GO:0000794)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			endometrium(4)|kidney(4)|large_intestine(5)|lung(8)|ovary(2)|prostate(2)|skin(2)	27			LUSC - Lung squamous cell carcinoma(29;0.00788)	GBM - Glioblastoma multiforme(74;0.152)		GCAAGCGGCACGGGCGGAAGA	0.612																																					p.P264P		Atlas-SNP	.											.	NOL6	85	.	0			c.G792C						.						130.0	125.0	126.0					9																	33469275		2203	4300	6503	SO:0001819	synonymous_variant	65083	exon6			GCGGCACGGGCGG	AF361079	CCDS6543.1, CCDS6544.1	9p12	2013-02-22	2013-02-22		ENSG00000165271	ENSG00000165271			19910	protein-coding gene	gene with protein product		611532	"""nucleolar protein family 6 (RNA-associated)"""			11895476, 15590835	Standard	NM_022917		Approved	bA311H10.1, Nrap, FLJ21959, MGC14896, MGC14921, MGC20838, UTP22	uc003zsz.3	Q9H6R4	OTTHUMG00000000394	ENST00000379471.2:c.792G>C	chr9.hg19:g.33469275C>G		116.0	0.0		98.0	45.0	NM_022917	Q5T5M3|Q5T5M4|Q7L4G6|Q8N6I0|Q8TEY9|Q8TEZ0|Q8TEZ1|Q9H675	Silent	SNP	ENST00000379471.2	hg19																																																																																				.	.		0.612	NOL6-005	NOVEL	non_canonical_TEC|basic	protein_coding	protein_coding	OTTHUMT00000001019.2	NM_022917	
KIF24	347240	hgsc.bcm.edu	37	9	34263160	34263160	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr9:34263160C>A	ENST00000402558.2	-	8	1478	c.1454G>T	c.(1453-1455)tGt>tTt	p.C485F	KIF24_ENST00000345050.2_Missense_Mutation_p.C351F|KIF24_ENST00000379174.3_Missense_Mutation_p.C351F|KIF24_ENST00000379166.2_Missense_Mutation_p.C485F			Q5T7B8	KIF24_HUMAN	kinesin family member 24	485	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				ATP catabolic process (GO:0006200)|cilium assembly (GO:0042384)|metabolic process (GO:0008152)|microtubule depolymerization (GO:0007019)|microtubule-based movement (GO:0007018)	centriole (GO:0005814)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|protein complex (GO:0043234)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(1)|endometrium(5)|large_intestine(4)|liver(1)|lung(13)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	32			LUSC - Lung squamous cell carcinoma(29;0.0107)			TGCTCGGATACATTCCTTCAG	0.453																																					p.C485F		Atlas-SNP	.											.	KIF24	64	.	0			c.G1454T						.						180.0	167.0	171.0					9																	34263160		1991	4168	6159	SO:0001583	missense	347240	exon9			CGGATACATTCCT	AK001795	CCDS6551.2	9p13.3	2013-01-10			ENSG00000186638	ENSG00000186638		"""Kinesins"", ""Sterile alpha motif (SAM) domain containing"""	19916	protein-coding gene	gene with protein product		613747	"""chromosome 9 open reading frame 48"""	C9orf48		12477932	Standard	NM_194313		Approved	bA571F15.4, FLJ10933, FLJ43884	uc003zua.4	Q5T7B8	OTTHUMG00000019810	ENST00000402558.2:c.1454G>T	chr9.hg19:g.34263160C>A	ENSP00000384433:p.Cys485Phe	157.0	0.0		121.0	46.0	NM_194313	Q2TB93|Q5T7B5|Q5T7B7|Q6ZU97|Q6ZUZ2|Q86XZ0|Q9NV43	Missense_Mutation	SNP	ENST00000402558.2	hg19	CCDS6551.2	.	.	.	.	.	.	.	.	.	.	C	18.88	3.716764	0.68844	.	.	ENSG00000186638	ENST00000402558;ENST00000379174;ENST00000379166;ENST00000345050;ENST00000420188	T;T;T;T	0.19938	2.11;2.11;2.11;2.11	5.97	5.97	0.96955	Kinesin, motor domain (3);	0.000000	0.42172	D	0.000747	T	0.59649	0.2209	H	0.98111	4.15	0.58432	D	0.999999	P;P	0.49559	0.925;0.884	P;P	0.53490	0.727;0.712	T	0.75071	-0.3447	10	0.87932	D	0	.	20.4135	0.99023	0.0:1.0:0.0:0.0	.	485;485	Q5T7B8-4;Q5T7B8	.;KIF24_HUMAN	F	485;351;485;351;485	ENSP00000384433:C485F;ENSP00000368472:C351F;ENSP00000368464:C485F;ENSP00000340179:C351F	ENSP00000340179:C351F	C	-	2	0	KIF24	34253160	1.000000	0.71417	1.000000	0.80357	0.936000	0.57629	6.563000	0.73964	2.835000	0.97688	0.591000	0.81541	TGT	.	.		0.453	KIF24-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052150.5		
DCAF10	79269	hgsc.bcm.edu	37	9	37861138	37861138	+	Splice_Site	SNP	G	G	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr9:37861138G>T	ENST00000377724.3	+	7	1678	c.1313G>T	c.(1312-1314)tGt>tTt	p.C438F	DCAF10_ENST00000242323.7_Splice_Site_p.C401F|DCAF10_ENST00000483167.1_3'UTR|RP11-613M10.9_ENST00000540557.1_Intron	NM_024345.3	NP_077321.3	Q5QP82	DCA10_HUMAN	DDB1 and CUL4 associated factor 10	438					protein ubiquitination (GO:0016567)	Cul4-RING E3 ubiquitin ligase complex (GO:0080008)				central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(4)|skin(1)	12						TCCCCCTAGTGTACTTGTGTC	0.448																																					p.C438F		Atlas-SNP	.											.	DCAF10	31	.	0			c.G1313T						.						129.0	124.0	125.0					9																	37861138		2203	4300	6503	SO:0001630	splice_region_variant	79269	exon7			CCTAGTGTACTTG	BC003520	CCDS6613.2, CCDS75835.1	9p13.2	2013-01-09	2009-07-17	2009-07-17	ENSG00000122741	ENSG00000122741		"""WD repeat domain containing"", ""DDB1 and CUL4 associated factors"""	23686	protein-coding gene	gene with protein product			"""WD repeat domain 32"""	WDR32			Standard	NM_001286810		Approved	MGC10765, FLJ23201	uc004aao.3	Q5QP82	OTTHUMG00000019934	ENST00000377724.3:c.1312-1G>T	chr9.hg19:g.37861138G>T		48.0	0.0		34.0	8.0	NM_024345	A4VCJ5|Q32NE2|Q8N2Q5|Q96ET5|Q9BTQ5|Q9H5P6	Missense_Mutation	SNP	ENST00000377724.3	hg19	CCDS6613.2	.	.	.	.	.	.	.	.	.	.	G	15.55	2.867707	0.51588	.	.	ENSG00000122741	ENST00000377724;ENST00000242323	T;T	0.72051	-0.27;-0.62	5.66	5.66	0.87406	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.052721	0.85682	D	0.000000	T	0.50752	0.1634	N	0.08118	0	0.43830	D	0.996405	B;B	0.10296	0.0;0.003	B;B	0.11329	0.0;0.006	T	0.49263	-0.8958	10	0.10111	T	0.7	.	17.2476	0.87032	0.0:0.0:1.0:0.0	.	401;438	Q5QP82-2;Q5QP82	.;DCA10_HUMAN	F	438;401	ENSP00000366953:C438F;ENSP00000242323:C401F	ENSP00000242323:C401F	C	+	2	0	DCAF10	37851138	1.000000	0.71417	1.000000	0.80357	0.944000	0.59088	9.441000	0.97557	2.690000	0.91761	0.655000	0.94253	TGT	.	.		0.448	DCAF10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052485.2	NM_024345	Missense_Mutation
PIP5K1B	8395	hgsc.bcm.edu	37	9	71555562	71555562	+	Splice_Site	SNP	C	C	A	rs201702261		TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr9:71555562C>A	ENST00000265382.3	+	14	1663	c.1358C>A	c.(1357-1359)gCc>gAc	p.A453D	PIP5K1B_ENST00000541509.1_Splice_Site_p.A453D	NM_003558.2	NP_003549.1	O14986	PI51B_HUMAN	phosphatidylinositol-4-phosphate 5-kinase, type I, beta	453					phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|membrane (GO:0016020)|uropod (GO:0001931)	1-phosphatidylinositol-4-phosphate 5-kinase activity (GO:0016308)|ATP binding (GO:0005524)			breast(1)|large_intestine(2)|stomach(1)	4				Lung(182;0.133)		TCGTTCCTAGCCCTGGGATCC	0.423																																					p.A453D		Atlas-SNP	.											.	PIP5K1B	40	.	0			c.C1358A						.						230.0	189.0	203.0					9																	71555562		2203	4300	6503	SO:0001630	splice_region_variant	8395	exon14			TCCTAGCCCTGGG	U78579	CCDS6624.1, CCDS65063.1	9q13	2008-02-05			ENSG00000107242	ENSG00000107242			8995	protein-coding gene	gene with protein product		602745				9177790, 8841185	Standard	NM_003558		Approved	STM7, MSS4	uc004agu.4	O14986	OTTHUMG00000019976	ENST00000265382.3:c.1358-1C>A	chr9.hg19:g.71555562C>A		146.0	0.0		147.0	64.0	NM_003558	A8K9L9|B4DIG7|P78518|P78519|Q5T5K6|Q5T5K8|Q5T5K9|Q5VZ00|Q7KYT5|Q8NHQ5|Q92749	Missense_Mutation	SNP	ENST00000265382.3	hg19	CCDS6624.1	.	.	.	.	.	.	.	.	.	.	C	14.40	2.525293	0.44969	.	.	ENSG00000107242	ENST00000541509;ENST00000377290;ENST00000265382;ENST00000419747	T;T	0.27256	1.7;1.68	5.78	5.78	0.91487	.	0.170855	0.51477	D	0.000083	T	0.17662	0.0424	L	0.29908	0.895	0.39940	D	0.974398	B	0.27068	0.167	B	0.22880	0.042	T	0.09378	-1.0677	9	.	.	.	.	11.0024	0.47614	0.0:0.8879:0.0:0.1121	.	453	O14986	PI51B_HUMAN	D	453;453;453;400	ENSP00000438082:A453D;ENSP00000265382:A453D	.	A	+	2	0	PIP5K1B	70745382	0.990000	0.36364	0.970000	0.41538	0.811000	0.45836	2.811000	0.47986	2.731000	0.93534	0.655000	0.94253	GCC	.	.		0.423	PIP5K1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052561.2	NM_003558	Missense_Mutation
TMC1	117531	hgsc.bcm.edu	37	9	75404071	75404071	+	Silent	SNP	A	A	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr9:75404071A>T	ENST00000297784.5	+	15	1602	c.1062A>T	c.(1060-1062)gtA>gtT	p.V354V	TMC1_ENST00000340019.3_Silent_p.V354V|TMC1_ENST00000396237.3_Silent_p.V354V	NM_138691.2	NP_619636.2	Q8TDI8	TMC1_HUMAN	transmembrane channel-like 1	354					auditory receptor cell development (GO:0060117)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|vestibular reflex (GO:0060005)	external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|stereocilium bundle tip (GO:0032426)	voltage-gated calcium channel activity (GO:0005245)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(4)|lung(21)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	36						CAGCCCAAGTAGAAGAAAACG	0.383																																					p.V354V	Pancreas(75;173 1345 14232 34245 43413)	Atlas-SNP	.											.	TMC1	87	.	0			c.A1062T						.						109.0	101.0	103.0					9																	75404071		2203	4300	6503	SO:0001819	synonymous_variant	117531	exon15			CCAAGTAGAAGAA	AF417578	CCDS6643.1	9q21	2014-01-28			ENSG00000165091	ENSG00000165091			16513	protein-coding gene	gene with protein product		606706	"""transmembrane, cochlear expressed, 1"""	DFNA36, DFNB7, DFNB11		11850618, 11850623	Standard	NM_138691		Approved		uc004aiz.1	Q8TDI8	OTTHUMG00000020014	ENST00000297784.5:c.1062A>T	chr9.hg19:g.75404071A>T		130.0	0.0		139.0	8.0	NM_138691	A8MVZ2|B1AM91	Silent	SNP	ENST00000297784.5	hg19	CCDS6643.1																																																																																			.	.		0.383	TMC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052655.1		
PRUNE2	158471	hgsc.bcm.edu	37	9	79325463	79325463	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr9:79325463C>A	ENST00000376718.3	-	8	1850	c.1727G>T	c.(1726-1728)aGt>aTt	p.S576I	PRUNE2_ENST00000428286.1_Missense_Mutation_p.S217I	NM_015225.2	NP_056040.2	Q8WUY3	PRUN2_HUMAN	prune homolog 2 (Drosophila)	576					apoptotic process (GO:0006915)	cytoplasm (GO:0005737)	metal ion binding (GO:0046872)|pyrophosphatase activity (GO:0016462)	p.S576N(1)		endometrium(1)|kidney(4)|large_intestine(3)|lung(7)|prostate(1)	16						ATCTCTGGGACTGTCTTGTCT	0.438																																					p.S576I		Atlas-SNP	.											PRUNE2_ENST00000376718,NS,carcinoma,0,1	PRUNE2	331	.	1	Substitution - Missense(1)	breast(1)	c.G1727T						.						54.0	48.0	50.0					9																	79325463		1568	3582	5150	SO:0001583	missense	158471	exon8			CTGGGACTGTCTT	BC019095	CCDS47982.1	9q21.32	2013-04-29	2006-11-24	2006-11-24	ENSG00000106772	ENSG00000106772			25209	protein-coding gene	gene with protein product	"""olfaxin"""	610691	"""chromosome 9 open reading frame 65"", ""KIAA0367"""	C9orf65, KIAA0367		16288218	Standard	NM_015225		Approved	BMCC1, BNIPXL, A214N16.3, bA214N16.3	uc010mpk.3	Q8WUY3	OTTHUMG00000020047	ENST00000376718.3:c.1727G>T	chr9.hg19:g.79325463C>A	ENSP00000365908:p.Ser576Ile	83.0	0.0		74.0	27.0	NM_015225	B3KYC4|B4DQH8|O15073|Q58A63|Q5JUB6|Q5T304|Q5T476|Q6T2V6|Q6T2V7|Q8N665	Missense_Mutation	SNP	ENST00000376718.3	hg19	CCDS47982.1	.	.	.	.	.	.	.	.	.	.	C	13.04	2.118210	0.37339	.	.	ENSG00000106772	ENST00000376718;ENST00000428286;ENST00000422033	T;T	0.55234	0.53;0.55	5.71	5.71	0.89125	.	0.000000	0.64402	D	0.000010	T	0.62441	0.2428	M	0.67953	2.075	0.80722	D	1	D	0.64830	0.994	P	0.58077	0.832	T	0.66356	-0.5944	10	0.87932	D	0	-6.854	7.4756	0.27374	0.0:0.8025:0.0:0.1975	.	576	Q8WUY3	PRUN2_HUMAN	I	576;217;575	ENSP00000365908:S576I;ENSP00000397425:S217I	ENSP00000365908:S576I	S	-	2	0	PRUNE2	78515283	1.000000	0.71417	0.941000	0.38009	0.381000	0.30169	2.181000	0.42547	2.707000	0.92482	0.655000	0.94253	AGT	.	.		0.438	PRUNE2-003	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052730.2	NM_138818	
FOXB2	442425	hgsc.bcm.edu	37	9	79635447	79635447	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr9:79635447T>A	ENST00000376708.1	+	1	877	c.877T>A	c.(877-879)Tcc>Acc	p.S293T		NM_001013735.1	NP_001013757.1	Q5VYV0	FOXB2_HUMAN	forkhead box B2	293					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|lung(8)|ovary(1)	10						GCCCTTGGCGTCCGTCATGCA	0.662																																					p.S293T		Atlas-SNP	.											.	FOXB2	71	.	0			c.T877A						.						38.0	37.0	38.0					9																	79635447		2203	4300	6503	SO:0001583	missense	442425	exon1			TTGGCGTCCGTCA		CCDS35045.1	9q21.2	2008-02-05			ENSG00000204612	ENSG00000204612		"""Forkhead boxes"""	23315	protein-coding gene	gene with protein product							Standard	NM_001013735		Approved	bA159H20.4	uc004ako.1	Q5VYV0	OTTHUMG00000020051	ENST00000376708.1:c.877T>A	chr9.hg19:g.79635447T>A	ENSP00000365898:p.Ser293Thr	43.0	0.0		40.0	20.0	NM_001013735		Missense_Mutation	SNP	ENST00000376708.1	hg19	CCDS35045.1	.	.	.	.	.	.	.	.	.	.	T	15.00	2.704253	0.48412	.	.	ENSG00000204612	ENST00000376708	D	0.96685	-4.09	3.41	3.41	0.39046	.	0.081596	0.51477	D	0.000086	D	0.95098	0.8412	L	0.28192	0.835	0.37325	D	0.909726	P	0.52842	0.956	D	0.65010	0.931	D	0.93350	0.6717	10	0.20046	T	0.44	.	10.9795	0.47486	0.0:0.0:0.0:1.0	.	293	Q5VYV0	FOXB2_HUMAN	T	293	ENSP00000365898:S293T	ENSP00000365898:S293T	S	+	1	0	FOXB2	78825267	0.946000	0.32159	0.976000	0.42696	0.844000	0.47949	1.728000	0.38105	1.400000	0.46741	0.379000	0.24179	TCC	.	.		0.662	FOXB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052745.1	NM_001013735	
AGTPBP1	23287	hgsc.bcm.edu	37	9	88292376	88292376	+	Silent	SNP	A	A	C			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr9:88292376A>C	ENST00000357081.3	-	6	555	c.411T>G	c.(409-411)tcT>tcG	p.S137S	AGTPBP1_ENST00000432218.1_Silent_p.S19S|AGTPBP1_ENST00000376109.3_Silent_p.S189S|AGTPBP1_ENST00000337006.4_Silent_p.S79S|AGTPBP1_ENST00000376083.3_Silent_p.S137S|AGTPBP1_ENST00000491784.1_5'UTR|AGTPBP1_ENST00000376081.4_Silent_p.S137S|AGTPBP1_ENST00000376080.1_Silent_p.S79S			Q9UPW5	CBPC1_HUMAN	ATP/GTP binding protein 1	137					adult walking behavior (GO:0007628)|C-terminal protein deglutamylation (GO:0035609)|cerebellar Purkinje cell differentiation (GO:0021702)|eye photoreceptor cell differentiation (GO:0001754)|mitochondrion organization (GO:0007005)|neuromuscular process (GO:0050905)|neurotransmitter metabolic process (GO:0042133)|olfactory bulb development (GO:0021772)|protein side chain deglutamylation (GO:0035610)|retina development in camera-type eye (GO:0060041)	cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	metallocarboxypeptidase activity (GO:0004181)|tubulin binding (GO:0015631)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(12)|lung(12)|ovary(5)|skin(2)|urinary_tract(3)	44						TTGCAAGAATAGAATGAATCT	0.358																																					p.S137S		Atlas-SNP	.											.	AGTPBP1	128	.	0			c.T411G						.						130.0	129.0	129.0					9																	88292376		2203	4300	6503	SO:0001819	synonymous_variant	23287	exon6			AAGAATAGAATGA	AB028958	CCDS6672.1, CCDS75854.1	9q21.33	2014-06-23			ENSG00000135049	ENSG00000135049			17258	protein-coding gene	gene with protein product	"""cytosolic carboxypeptidase 1"", ""tubulinyl-Tyr carboxypeptidase"", ""carboxypeptidase-tubulin"", ""tyrosine carboxypeptidase"", ""soluble carboxypeptidase"""	606830				11083920	Standard	NM_015239		Approved	KIAA1035, Nna1, CCP1	uc010mqc.3	Q9UPW5	OTTHUMG00000020124	ENST00000357081.3:c.411T>G	chr9.hg19:g.88292376A>C		110.0	0.0		122.0	6.0	NM_015239	B4DIT6|B4DRZ8|Q5VV80|Q63HM7|Q658P5|Q6P9D6|Q9H8U6|Q9H9W8|Q9NVK1	Silent	SNP	ENST00000357081.3	hg19																																																																																				.	.		0.358	AGTPBP1-004	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000052893.1	NM_015239	
ZCCHC6	79670	hgsc.bcm.edu	37	9	88961390	88961390	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr9:88961390T>C	ENST00000375963.3	-	3	698	c.526A>G	c.(526-528)Aag>Gag	p.K176E	ZCCHC6_ENST00000375947.1_Missense_Mutation_p.K9E|ZCCHC6_ENST00000375961.2_Missense_Mutation_p.K176E|ZCCHC6_ENST00000277141.6_5'UTR|ZCCHC6_ENST00000375960.2_Missense_Mutation_p.K176E	NM_001185059.1|NM_024617.3	NP_001171988.1|NP_078893.2	Q5VYS8	TUT7_HUMAN	zinc finger, CCHC domain containing 6	176					RNA 3'-end processing (GO:0031123)		poly(A) RNA binding (GO:0044822)|RNA uridylyltransferase activity (GO:0050265)|zinc ion binding (GO:0008270)			breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|liver(1)|lung(14)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	46						CTCTGCTTCTTGTTTTCTTAA	0.408																																					p.K176E		Atlas-SNP	.											.	ZCCHC6	105	.	0			c.A526G						.						153.0	145.0	148.0					9																	88961390		2203	4300	6503	SO:0001583	missense	79670	exon3			GCTTCTTGTTTTC	AL832026	CCDS35057.1, CCDS55323.1	9q21	2014-03-05			ENSG00000083223	ENSG00000083223		"""Zinc fingers, CCHC domain containing"""	25817	protein-coding gene	gene with protein product	"""TUTase7"""					11214970	Standard	NM_001185059		Approved	KIAA1711, FLJ13409, PAPD6, TUT7	uc004aoq.3	Q5VYS8	OTTHUMG00000020137	ENST00000375963.3:c.526A>G	chr9.hg19:g.88961390T>C	ENSP00000365130:p.Lys176Glu	118.0	0.0		90.0	28.0	NM_024617	Q5H9T0|Q5VYS5|Q5VYS7|Q658Z9|Q659A2|Q6MZJ3|Q8N5F0|Q96N57|Q96NE8|Q9C0F2|Q9H8M6	Missense_Mutation	SNP	ENST00000375963.3	hg19	CCDS35057.1	.	.	.	.	.	.	.	.	.	.	T	15.29	2.788886	0.49997	.	.	ENSG00000083223	ENST00000375960;ENST00000375961;ENST00000375963;ENST00000427388;ENST00000375947	T;T;T;T	0.48522	1.14;1.14;1.14;0.81	5.29	5.29	0.74685	.	0.287586	0.34750	N	0.003718	T	0.30135	0.0755	L	0.27053	0.805	0.31182	N	0.701996	B;B;P;B	0.45474	0.037;0.023;0.859;0.227	B;B;B;B	0.38458	0.02;0.013;0.274;0.056	T	0.25916	-1.0118	10	0.19147	T	0.46	-15.7904	9.8269	0.40916	0.0:0.0762:0.0:0.9238	.	176;176;176;176	Q5VYS8-5;Q5VYS8-2;Q5VYS8-4;Q5VYS8	.;.;.;TUT7_HUMAN	E	176;176;176;9;9	ENSP00000365127:K176E;ENSP00000365128:K176E;ENSP00000365130:K176E;ENSP00000365114:K9E	ENSP00000365114:K9E	K	-	1	0	ZCCHC6	88151210	1.000000	0.71417	1.000000	0.80357	0.849000	0.48306	3.371000	0.52379	2.229000	0.72834	0.397000	0.26171	AAG	.	.		0.408	ZCCHC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052918.1	NM_024617	
SYK	6850	hgsc.bcm.edu	37	9	93650165	93650165	+	Silent	SNP	A	A	G			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr9:93650165A>G	ENST00000375754.4	+	12	1864	c.1716A>G	c.(1714-1716)ccA>ccG	p.P572P	SYK_ENST00000375751.4_Silent_p.P549P|SYK_ENST00000375747.1_Silent_p.P549P|SYK_ENST00000375746.1_Silent_p.P572P	NM_003177.5	NP_003168.2	P43405	KSYK_HUMAN	spleen tyrosine kinase	572	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of JUN kinase activity (GO:0007257)|adaptive immune response (GO:0002250)|angiogenesis (GO:0001525)|B cell receptor signaling pathway (GO:0050853)|beta selection (GO:0043366)|blood coagulation (GO:0007596)|blood vessel morphogenesis (GO:0048514)|cell proliferation (GO:0008283)|cellular response to molecule of fungal origin (GO:0071226)|defense response to bacterium (GO:0042742)|enzyme linked receptor protein signaling pathway (GO:0007167)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|leukocyte activation involved in immune response (GO:0002366)|leukocyte cell-cell adhesion (GO:0007159)|leukotriene biosynthetic process (GO:0019370)|lymph vessel development (GO:0001945)|macrophage activation involved in immune response (GO:0002281)|neutrophil activation involved in immune response (GO:0002283)|neutrophil chemotaxis (GO:0030593)|organ morphogenesis (GO:0009887)|platelet activation (GO:0030168)|positive regulation of alpha-beta T cell differentiation (GO:0046638)|positive regulation of alpha-beta T cell proliferation (GO:0046641)|positive regulation of B cell differentiation (GO:0045579)|positive regulation of bone resorption (GO:0045780)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of cell adhesion mediated by integrin (GO:0033630)|positive regulation of cytokine secretion (GO:0050715)|positive regulation of gamma-delta T cell differentiation (GO:0045588)|positive regulation of granulocyte macrophage colony-stimulating factor biosynthetic process (GO:0045425)|positive regulation of interleukin-3 biosynthetic process (GO:0045401)|positive regulation of mast cell degranulation (GO:0043306)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of arachidonic acid secretion (GO:0090237)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of neutrophil degranulation (GO:0043313)|regulation of phagocytosis (GO:0050764)|regulation of platelet activation (GO:0010543)|regulation of platelet aggregation (GO:0090330)|regulation of superoxide anion generation (GO:0032928)|serotonin secretion by platelet (GO:0002554)|viral process (GO:0016032)	B cell receptor complex (GO:0019815)|cytosol (GO:0005829)|early phagosome (GO:0032009)|plasma membrane (GO:0005886)|T cell receptor complex (GO:0042101)	ATP binding (GO:0005524)|integrin binding (GO:0005178)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein kinase activity (GO:0004672)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)			breast(2)|endometrium(1)|kidney(3)|large_intestine(3)|lung(9)|ovary(1)|prostate(3)|skin(2)|stomach(2)	26						GGCAGAAGCCATATCGAGTGA	0.463			T	"""ETV6, ITK"""	"""MDS, peripheral T-cell lymphoma"""																																p.P572P		Atlas-SNP	.		Dom	yes		9	9q22	6850	spleen tyrosine kinase		L	.	SYK	132	.	0			c.A1716G						.						127.0	122.0	124.0					9																	93650165		2203	4300	6503	SO:0001819	synonymous_variant	6850	exon12			GAAGCCATATCGA	L28824	CCDS6688.1, CCDS47992.1	9q22	2013-02-14			ENSG00000165025	ENSG00000165025		"""SH2 domain containing"""	11491	protein-coding gene	gene with protein product		600085				8082894, 1423621	Standard	XM_005252147		Approved		uc004aqz.3	P43405	OTTHUMG00000020200	ENST00000375754.4:c.1716A>G	chr9.hg19:g.93650165A>G		111.0	0.0		97.0	40.0	NM_003177		Silent	SNP	ENST00000375754.4	hg19	CCDS6688.1																																																																																			.	.		0.463	SYK-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000053018.1		
ROR2	4920	hgsc.bcm.edu	37	9	94486208	94486208	+	Silent	SNP	G	G	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr9:94486208G>T	ENST00000375708.3	-	9	2766	c.2568C>A	c.(2566-2568)gtC>gtA	p.V856V	ROR2_ENST00000375715.1_Intron|ROR2_ENST00000550066.1_5'UTR	NM_004560.3	NP_004551.2	Q01974	ROR2_HUMAN	receptor tyrosine kinase-like orphan receptor 2	856	Pro-rich.				cartilage condensation (GO:0001502)|cell differentiation (GO:0030154)|embryonic genitalia morphogenesis (GO:0030538)|inner ear morphogenesis (GO:0042472)|JNK cascade (GO:0007254)|multicellular organismal development (GO:0007275)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell migration (GO:0030335)|positive regulation of transcription, DNA-templated (GO:0045893)|signal transduction (GO:0007165)|somitogenesis (GO:0001756)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|Wnt signaling pathway, calcium modulating pathway (GO:0007223)|Wnt signaling pathway, planar cell polarity pathway (GO:0060071)	clathrin-coated endocytic vesicle membrane (GO:0030669)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|Wnt-protein binding (GO:0017147)			autonomic_ganglia(1)|breast(1)|central_nervous_system(5)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(31)|ovary(3)|prostate(6)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	71						TGGGCTTGGGGACCATCTGAG	0.657																																					p.V856V		Atlas-SNP	.											.	ROR2	167	.	0			c.C2568A						.						90.0	90.0	90.0					9																	94486208		2203	4300	6503	SO:0001819	synonymous_variant	4920	exon9			CTTGGGGACCATC	M97639	CCDS6691.1	9q22	2013-01-11			ENSG00000169071	ENSG00000169071		"""Immunoglobulin superfamily / I-set domain containing"""	10257	protein-coding gene	gene with protein product		602337		NTRKR2, BDB, BDB1		1334494, 10700182	Standard	NM_004560		Approved		uc004arj.2	Q01974	OTTHUMG00000020211	ENST00000375708.3:c.2568C>A	chr9.hg19:g.94486208G>T		73.0	0.0		39.0	16.0	NM_004560	Q59GF5|Q5SPI5|Q9HAY7|Q9HB61	Silent	SNP	ENST00000375708.3	hg19	CCDS6691.1																																																																																			.	.		0.657	ROR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053040.1		
BICD2	23299	hgsc.bcm.edu	37	9	95477644	95477644	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr9:95477644T>A	ENST00000375512.3	-	7	2427	c.2360A>T	c.(2359-2361)cAg>cTg	p.Q787L	BICD2_ENST00000356884.6_Missense_Mutation_p.Q787L	NM_015250.3	NP_056065.1	Q8TD16	BICD2_HUMAN	bicaudal D homolog 2 (Drosophila)	787	Interacts with RAB6A. {ECO:0000250}.				cell death (GO:0008219)|microtubule anchoring at microtubule organizing center (GO:0072393)|minus-end-directed organelle transport along microtubule (GO:0072385)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	Rab GTPase binding (GO:0017137)			cervix(3)|endometrium(4)|kidney(1)|large_intestine(6)|lung(5)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	23						CAGCTTCTGCTGGATGGCCAT	0.642																																					p.Q787L		Atlas-SNP	.											.	BICD2	68	.	0			c.A2360T						.						32.0	31.0	31.0					9																	95477644		2203	4298	6501	SO:0001583	missense	23299	exon7			TTCTGCTGGATGG	AB014599	CCDS6700.1, CCDS35064.1	9q22.32	2008-02-05			ENSG00000185963	ENSG00000185963			17208	protein-coding gene	gene with protein product		609797				9734811	Standard	NM_001003800		Approved	KIAA0699	uc004asp.1	Q8TD16	OTTHUMG00000021036	ENST00000375512.3:c.2360A>T	chr9.hg19:g.95477644T>A	ENSP00000364662:p.Gln787Leu	85.0	0.0		81.0	35.0	NM_001003800	O75181|Q5TBQ2|Q5TBQ3|Q96LH2|Q9BT84|Q9H561	Missense_Mutation	SNP	ENST00000375512.3	hg19	CCDS6700.1	.	.	.	.	.	.	.	.	.	.	T	28.9	4.957566	0.92726	.	.	ENSG00000185963	ENST00000356884;ENST00000375512	T;T	0.62639	0.01;0.01	5.18	5.18	0.71444	.	0.000000	0.85682	D	0.000000	T	0.80210	0.4581	M	0.84948	2.725	0.80722	D	1	D;D	0.69078	0.996;0.997	D;D	0.80764	0.99;0.994	T	0.83346	-0.0005	10	0.66056	D	0.02	-41.7761	13.2901	0.60267	0.0:0.0:0.0:1.0	.	787;787	Q8TD16-2;Q8TD16	.;BICD2_HUMAN	L	787	ENSP00000349351:Q787L;ENSP00000364662:Q787L	ENSP00000349351:Q787L	Q	-	2	0	BICD2	94517465	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.085000	0.71343	2.092000	0.63282	0.528000	0.53228	CAG	.	.		0.642	BICD2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000055508.1	NM_015250	
SVEP1	79987	hgsc.bcm.edu	37	9	113168473	113168473	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr9:113168473T>A	ENST00000401783.2	-	38	9743	c.9407A>T	c.(9406-9408)gAg>gTg	p.E3136V	SVEP1_ENST00000374469.1_Missense_Mutation_p.E3113V|SVEP1_ENST00000297826.5_Missense_Mutation_p.E1062V	NM_153366.3	NP_699197.3	Q4LDE5	SVEP1_HUMAN	sushi, von Willebrand factor type A, EGF and pentraxin domain containing 1	3136	Sushi 29. {ECO:0000255|PROSITE- ProRule:PRU00302}.				cell adhesion (GO:0007155)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|chromatin binding (GO:0003682)			NS(1)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|cervix(2)|endometrium(19)|kidney(8)|large_intestine(24)|lung(58)|ovary(7)|prostate(7)|skin(1)|stomach(4)|upper_aerodigestive_tract(5)|urinary_tract(4)	147						GGTGTGTGCCTCTCCAGTTGC	0.512																																					p.E3136V		Atlas-SNP	.											.	SVEP1	326	.	0			c.A9407T						.						95.0	99.0	98.0					9																	113168473		1978	4167	6145	SO:0001583	missense	79987	exon38			TGTGCCTCTCCAG	AK027870		9q31-q32	2008-02-05	2005-03-15	2005-03-17	ENSG00000165124	ENSG00000165124			15985	protein-coding gene	gene with protein product		611691	"""chromosome 9 open reading frame 13"""	C9orf13			Standard	NM_153366		Approved	bA427L11.3, POLYDOM, FLJ13529	uc010mtz.3	Q4LDE5	OTTHUMG00000020482	ENST00000401783.2:c.9407A>T	chr9.hg19:g.113168473T>A	ENSP00000384917:p.Glu3136Val	145.0	0.0		153.0	62.0	NM_153366	Q0P675|Q5D213|Q5T938|Q5VTE4|Q5VTE5|Q7Z387|Q7Z3G3|Q8NBT9|Q96JU7|Q9H284|Q9H8J9	Missense_Mutation	SNP	ENST00000401783.2	hg19	CCDS48004.1	.	.	.	.	.	.	.	.	.	.	T	8.636	0.894774	0.17613	.	.	ENSG00000165124	ENST00000401783;ENST00000374469;ENST00000297826	T;T;T	0.66995	-0.24;-0.24;-0.24	5.69	5.69	0.88448	Complement control module (2);Sushi/SCR/CCP (3);	0.368162	0.30003	N	0.010650	T	0.63498	0.2516	L	0.56199	1.76	0.80722	D	1	P	0.38677	0.642	B	0.40741	0.339	T	0.65216	-0.6222	10	0.46703	T	0.11	.	10.6138	0.45439	0.0:0.0806:0.0:0.9194	.	3136	Q4LDE5	SVEP1_HUMAN	V	3136;3113;1062	ENSP00000384917:E3136V;ENSP00000363593:E3113V;ENSP00000297826:E1062V	ENSP00000297826:E1062V	E	-	2	0	SVEP1	112208294	0.996000	0.38824	0.924000	0.36721	0.204000	0.24138	2.650000	0.46665	2.169000	0.68431	0.533000	0.62120	GAG	.	.		0.512	SVEP1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			
SVEP1	79987	hgsc.bcm.edu	37	9	113341549	113341549	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr9:113341549G>A	ENST00000401783.2	-	1	611	c.275C>T	c.(274-276)tCc>tTc	p.S92F	SVEP1_ENST00000374469.1_Missense_Mutation_p.S69F|SVEP1_ENST00000302728.8_Missense_Mutation_p.S92F|SVEP1_ENST00000374461.1_Missense_Mutation_p.S69F	NM_153366.3	NP_699197.3	Q4LDE5	SVEP1_HUMAN	sushi, von Willebrand factor type A, EGF and pentraxin domain containing 1	92	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				cell adhesion (GO:0007155)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|chromatin binding (GO:0003682)			NS(1)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|cervix(2)|endometrium(19)|kidney(8)|large_intestine(24)|lung(58)|ovary(7)|prostate(7)|skin(1)|stomach(4)|upper_aerodigestive_tract(5)|urinary_tract(4)	147						GCCCACGCTGGACGAATCATC	0.677																																					p.S92F		Atlas-SNP	.											.	SVEP1	326	.	0			c.C275T						.						11.0	14.0	13.0					9																	113341549		2031	4138	6169	SO:0001583	missense	79987	exon1			ACGCTGGACGAAT	AK027870		9q31-q32	2008-02-05	2005-03-15	2005-03-17	ENSG00000165124	ENSG00000165124			15985	protein-coding gene	gene with protein product		611691	"""chromosome 9 open reading frame 13"""	C9orf13			Standard	NM_153366		Approved	bA427L11.3, POLYDOM, FLJ13529	uc010mtz.3	Q4LDE5	OTTHUMG00000020482	ENST00000401783.2:c.275C>T	chr9.hg19:g.113341549G>A	ENSP00000384917:p.Ser92Phe	60.0	0.0		51.0	21.0	NM_153366	Q0P675|Q5D213|Q5T938|Q5VTE4|Q5VTE5|Q7Z387|Q7Z3G3|Q8NBT9|Q96JU7|Q9H284|Q9H8J9	Missense_Mutation	SNP	ENST00000401783.2	hg19	CCDS48004.1	.	.	.	.	.	.	.	.	.	.	G	20.0	3.930214	0.73327	.	.	ENSG00000165124	ENST00000401783;ENST00000374469;ENST00000302728;ENST00000374461	T;T;T;T	0.79352	-1.26;-1.26;-1.26;-1.26	3.7	2.78	0.32641	von Willebrand factor, type A (3);	0.064576	0.64402	N	0.000005	D	0.87865	0.6285	M	0.87617	2.895	0.41978	D	0.990789	D;D;B	0.89917	0.999;1.0;0.09	D;D;B	0.91635	0.998;0.999;0.046	D	0.88326	0.2965	10	0.87932	D	0	.	10.8474	0.46751	0.0969:0.0:0.9031:0.0	.	92;92;92	E9PBN8;Q4LDE5;Q4LDE5-2	.;SVEP1_HUMAN;.	F	92;69;92;69	ENSP00000384917:S92F;ENSP00000363593:S69F;ENSP00000304118:S92F;ENSP00000363585:S69F	ENSP00000304118:S92F	S	-	2	0	SVEP1	112381370	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	9.337000	0.96545	0.655000	0.30866	0.591000	0.81541	TCC	.	.		0.677	SVEP1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			
ZNF483	158399	hgsc.bcm.edu	37	9	114289679	114289679	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr9:114289679C>A	ENST00000309235.5	+	2	162	c.4C>A	c.(4-6)Caa>Aaa	p.Q2K	ZNF483_ENST00000355824.3_Missense_Mutation_p.Q2K|ZNF483_ENST00000374374.3_Missense_Mutation_p.Q2K|ZNF483_ENST00000358151.4_Missense_Mutation_p.Q2K	NM_133464.2	NP_597721.2	Q8TF39	ZN483_HUMAN	zinc finger protein 483	2					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(1)|kidney(1)|large_intestine(11)|lung(11)|ovary(1)|skin(5)	31						AGACACAATGCAAGCTGTAGT	0.488																																					p.Q2K		Atlas-SNP	.											.	ZNF483	78	.	0			c.C4A						.						93.0	89.0	90.0					9																	114289679		2203	4300	6503	SO:0001583	missense	158399	exon2			ACAATGCAAGCTG	AB075842	CCDS35105.1, CCDS35106.1	9q32	2013-01-09			ENSG00000173258	ENSG00000173258		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	23384	protein-coding gene	gene with protein product							Standard	NM_001007169		Approved	ZKSCAN16, KIAA1962, ZSCAN48	uc004bff.2	Q8TF39	OTTHUMG00000020490	ENST00000309235.5:c.4C>A	chr9.hg19:g.114289679C>A	ENSP00000311679:p.Gln2Lys	104.0	0.0		117.0	9.0	NM_133464	Q5VZN2|Q8NAE1	Missense_Mutation	SNP	ENST00000309235.5	hg19	CCDS35106.1	.	.	.	.	.	.	.	.	.	.	C	11.86	1.763479	0.31228	.	.	ENSG00000173258	ENST00000358151;ENST00000355824;ENST00000374374;ENST00000309235	T;T;T;T	0.05925	5.74;5.7;3.37;3.61	5.55	0.126	0.14722	.	0.946056	0.08712	N	0.904800	T	0.02610	0.0079	N	0.14661	0.345	0.09310	N	1	B;B;B;B	0.14438	0.01;0.01;0.01;0.008	B;B;B;B	0.11329	0.002;0.006;0.003;0.004	T	0.45848	-0.9233	10	0.02654	T	1	-6.4721	1.2256	0.01932	0.3079:0.3728:0.1493:0.1699	.	2;2;2;2	Q6P088;Q5VZN3;Q8NAE1;Q8TF39	.;.;.;ZN483_HUMAN	K	2	ENSP00000350871:Q2K;ENSP00000438048:Q2K;ENSP00000363494:Q2K;ENSP00000311679:Q2K	ENSP00000311679:Q2K	Q	+	1	0	ZNF483	113329500	0.000000	0.05858	0.008000	0.14137	0.125000	0.20455	-0.209000	0.09358	0.363000	0.24346	-0.222000	0.12452	CAA	.	.		0.488	ZNF483-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053641.1	XM_088567	
OLFML2A	169611	hgsc.bcm.edu	37	9	127549471	127549471	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr9:127549471A>G	ENST00000373580.3	+	2	308	c.308A>G	c.(307-309)gAg>gGg	p.E103G		NM_182487.2	NP_872293.2	Q68BL7	OLM2A_HUMAN	olfactomedin-like 2A	103					extracellular matrix organization (GO:0030198)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)	extracellular matrix binding (GO:0050840)			endometrium(5)|kidney(1)|large_intestine(8)|lung(8)|ovary(2)|upper_aerodigestive_tract(1)	25						TGTGAGAACGAGTGGAAGATG	0.592																																					p.E103G		Atlas-SNP	.											.	OLFML2A	61	.	0			c.A308G						.						53.0	61.0	58.0					9																	127549471		2065	4203	6268	SO:0001583	missense	169611	exon2			AGAACGAGTGGAA	AK092255	CCDS6857.2, CCDS65129.1	9q34.11	2008-02-05			ENSG00000185585	ENSG00000185585			27270	protein-coding gene	gene with protein product		615899				12477932	Standard	NM_001282715		Approved	FLJ00237	uc004bov.3	Q68BL7	OTTHUMG00000020663	ENST00000373580.3:c.308A>G	chr9.hg19:g.127549471A>G	ENSP00000362682:p.Glu103Gly	76.0	0.0		70.0	35.0	NM_182487	Q5JTM5|Q5JTM6|Q6UXW1|Q7Z5V3	Missense_Mutation	SNP	ENST00000373580.3	hg19	CCDS6857.2	.	.	.	.	.	.	.	.	.	.	A	23.3	4.397688	0.83120	.	.	ENSG00000185585	ENST00000331715;ENST00000425732;ENST00000373580	T;T	0.46063	0.88;0.88	5.84	4.68	0.58851	.	0.115998	0.56097	D	0.000021	T	0.61123	0.2322	M	0.72894	2.215	0.80722	D	1	D;D	0.76494	0.999;0.995	D;P	0.73708	0.981;0.791	T	0.63386	-0.6649	10	0.72032	D	0.01	.	11.1721	0.48577	0.862:0.0:0.0:0.138	.	103;103	Q5JTM7;Q68BL7	.;OLM2A_HUMAN	G	103	ENSP00000336425:E103G;ENSP00000362682:E103G	ENSP00000336425:E103G	E	+	2	0	OLFML2A	126589292	1.000000	0.71417	1.000000	0.80357	0.950000	0.60333	7.063000	0.76714	0.995000	0.38917	0.533000	0.62120	GAG	.	.		0.592	OLFML2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054046.2	NM_182487	
LMX1B	4010	hgsc.bcm.edu	37	9	129455877	129455877	+	Silent	SNP	A	A	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr9:129455877A>T	ENST00000373474.4	+	5	823	c.816A>T	c.(814-816)gcA>gcT	p.A272A	LMX1B_ENST00000561065.1_Silent_p.A249A|LMX1B_ENST00000355497.5_Silent_p.A272A|LMX1B_ENST00000425646.2_Silent_p.A249A|LMX1B_ENST00000526117.1_Silent_p.A272A			O60663	LMX1B_HUMAN	LIM homeobox transcription factor 1, beta	272					cell proliferation (GO:0008283)|central nervous system neuron development (GO:0021954)|cerebellum morphogenesis (GO:0021587)|collagen fibril organization (GO:0030199)|dopaminergic neuron differentiation (GO:0071542)|dorsal/ventral pattern formation (GO:0009953)|in utero embryonic development (GO:0001701)|limb morphogenesis (GO:0035108)|midbrain development (GO:0030901)|multicellular organismal development (GO:0007275)|neuron differentiation (GO:0030182)|neuron migration (GO:0001764)|organ growth (GO:0035265)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|trabecular meshwork development (GO:0002930)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(3)|lung(9)|ovary(1)|skin(1)	15						ACCAAAGAGCAAAGGTAAGAG	0.647									Nail-Patella Syndrome																												p.A272A	Pancreas(110;1796 2278 18357 20466)	Atlas-SNP	.											.	LMX1B	86	.	0			c.A816T						.						43.0	47.0	46.0					9																	129455877		2203	4299	6502	SO:0001819	synonymous_variant	4010	exon5	Familial Cancer Database	Osteo-Onychodysplasia, Turner-Kieser syndrome, Fong disease	AAGAGCAAAGGTA	U77457	CCDS6866.1, CCDS6866.2, CCDS55342.1, CCDS55343.1	9q33.3	2011-06-20			ENSG00000136944	ENSG00000136944		"""Homeoboxes / LIM class"""	6654	protein-coding gene	gene with protein product		602575		NPS1		9441763, 9590287	Standard	NM_002316		Approved		uc004bqj.3	O60663	OTTHUMG00000020692	ENST00000373474.4:c.816A>T	chr9.hg19:g.129455877A>T		145.0	0.0		88.0	37.0	NM_001174146	F8W7W6|O75463|Q5JU95|Q6ISC9	Silent	SNP	ENST00000373474.4	hg19	CCDS55342.1																																																																																			.	.		0.647	LMX1B-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000054123.2		
FAM129B	64855	hgsc.bcm.edu	37	9	130279260	130279260	+	Silent	SNP	G	G	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr9:130279260G>T	ENST00000373312.3	-	8	1062	c.849C>A	c.(847-849)gcC>gcA	p.A283A	FAM129B_ENST00000468379.1_Intron|FAM129B_ENST00000373314.3_Silent_p.A270A	NM_022833.2	NP_073744.2	Q96TA1	NIBL1_HUMAN	family with sequence similarity 129, member B	283					negative regulation of apoptotic process (GO:0043066)	actin cytoskeleton (GO:0015629)|adherens junction (GO:0005912)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(2)|endometrium(4)|kidney(1)|large_intestine(5)|liver(1)|lung(7)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	25						AGCGCGCCTTGGCCTGCTCGT	0.627																																					p.A283A		Atlas-SNP	.											.	FAM129B	84	.	0			c.C849A						.						146.0	132.0	136.0					9																	130279260		2203	4300	6503	SO:0001819	synonymous_variant	64855	exon8			CGCCTTGGCCTGC	AF151783	CCDS35144.1, CCDS35145.1	9q34.13	2010-02-01	2006-11-23	2006-11-23	ENSG00000136830	ENSG00000136830			25282	protein-coding gene	gene with protein product		614045	"""chromosome 9 open reading frame 88"""	C9orf88		14702039, 19362540	Standard	XM_005252135		Approved	DKFZP434H0820, FLJ13518, FLJ22151, FLJ22298, bA356B19.6, MINERVA	uc004brh.3	Q96TA1	OTTHUMG00000020705	ENST00000373312.3:c.849C>A	chr9.hg19:g.130279260G>T		81.0	0.0		57.0	21.0	NM_022833	Q4LE55|Q5VVW6|Q5VVW7|Q9BUS2|Q9NT35	Silent	SNP	ENST00000373312.3	hg19	CCDS35145.1																																																																																			.	.		0.627	FAM129B-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054196.1	NM_022833	
RAPGEF1	2889	hgsc.bcm.edu	37	9	134526250	134526250	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr9:134526250T>C	ENST00000372189.3	-	2	220	c.97A>G	c.(97-99)Aag>Gag	p.K33E	RAPGEF1_ENST00000372190.3_Missense_Mutation_p.K51E|RAPGEF1_ENST00000372195.1_Missense_Mutation_p.K50E	NM_005312.2	NP_005303.2	Q13905	RPGF1_HUMAN	Rap guanine nucleotide exchange factor (GEF) 1	33					activation of MAPKK activity (GO:0000186)|blood vessel development (GO:0001568)|cellular response to cAMP (GO:0071320)|cellular response to nerve growth factor stimulus (GO:1990090)|establishment of endothelial barrier (GO:0061028)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of neural precursor cell proliferation (GO:2000178)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of Ras protein signal transduction (GO:0046580)|nerve growth factor signaling pathway (GO:0038180)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of neuron projection development (GO:0010976)|positive regulation of Rap GTPase activity (GO:0032854)|Rap protein signal transduction (GO:0032486)|regulation of cell junction assembly (GO:1901888)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytosol (GO:0005829)|early endosome (GO:0005769)|endosome (GO:0005768)	Rap guanyl-nucleotide exchange factor activity (GO:0017034)			NS(2)|breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|large_intestine(8)|lung(9)|ovary(2)|prostate(4)|skin(1)|urinary_tract(1)	39		Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;2.19e-05)|Epithelial(140;0.000364)		GGTTTTCCCTTCTTTGATGGC	0.468																																					p.K51E		Atlas-SNP	.											.	RAPGEF1	126	.	0			c.A151G						.						267.0	248.0	254.0					9																	134526250		1936	4140	6076	SO:0001583	missense	2889	exon2			TTCCCTTCTTTGA	BC041710	CCDS48047.1	9q34.3	2008-02-05	2004-03-01	2004-03-02	ENSG00000107263	ENSG00000107263			4568	protein-coding gene	gene with protein product		600303	"""guanine nucleotide-releasing factor 2 (specific for crk proto-oncogene)"""	GRF2		7959692, 7512734	Standard	NM_005312		Approved	C3G	uc022bos.1	Q13905	OTTHUMG00000020829	ENST00000372189.3:c.97A>G	chr9.hg19:g.134526250T>C	ENSP00000361263:p.Lys33Glu	172.0	0.0		169.0	68.0	NM_198679	Q5JUE4|Q8IV73	Missense_Mutation	SNP	ENST00000372189.3	hg19	CCDS48047.1	.	.	.	.	.	.	.	.	.	.	T	26.2	4.718762	0.89205	.	.	ENSG00000107263	ENST00000266110;ENST00000372195;ENST00000372189;ENST00000372190;ENST00000411834;ENST00000357686;ENST00000438647;ENST00000427994	T;T;T;T	0.50548	0.84;0.9;0.74;1.15	5.61	5.61	0.85477	.	0.265176	0.37393	N	0.002106	T	0.64778	0.2629	M	0.64997	1.995	0.58432	D	0.999991	D;D;D	0.67145	0.992;0.992;0.996	P;P;D	0.65987	0.872;0.872;0.94	T	0.67964	-0.5534	10	0.72032	D	0.01	.	14.9886	0.71368	0.0:0.0:0.0:1.0	.	50;33;51	Q68DL3;Q13905;Q13905-3	.;RPGF1_HUMAN;.	E	33;50;33;51;51;50;50;51	ENSP00000361269:K50E;ENSP00000361263:K33E;ENSP00000361264:K51E;ENSP00000410640:K50E	ENSP00000266110:K33E	K	-	1	0	RAPGEF1	133516071	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	7.694000	0.84235	2.127000	0.65507	0.533000	0.62120	AAG	.	.		0.468	RAPGEF1-001	KNOWN	non_canonical_U12|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000054759.2	NM_005312	
GBGT1	26301	hgsc.bcm.edu	37	9	136029632	136029632	+	Missense_Mutation	SNP	G	G	C			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr9:136029632G>C	ENST00000372040.3	-	7	687	c.376C>G	c.(376-378)Cag>Gag	p.Q126E	GBGT1_ENST00000372043.3_Intron|GBGT1_ENST00000372038.3_Missense_Mutation_p.P138R|RALGDS_ENST00000542690.1_Intron|GBGT1_ENST00000472281.1_5'UTR|GBGT1_ENST00000540636.1_Missense_Mutation_p.Q109E	NM_001282629.1	NP_001269558.1	Q8N5D6	GBGT1_HUMAN	globoside alpha-1,3-N-acetylgalactosaminyltransferase 1	126					glycolipid biosynthetic process (GO:0009247)|protein glycosylation (GO:0006486)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	globoside alpha-N-acetylgalactosaminyltransferase activity (GO:0047277)|metal ion binding (GO:0046872)			breast(2)|endometrium(1)|kidney(4)|lung(2)|skin(1)	10				OV - Ovarian serous cystadenocarcinoma(145;3.49e-06)|Epithelial(140;2.59e-05)		AGGAAGGACTGGATGAAATGA	0.607																																					p.Q126E		Atlas-SNP	.											.	GBGT1	25	.	0			c.C376G						.						42.0	44.0	43.0					9																	136029632		2203	4299	6502	SO:0001583	missense	26301	exon7			AGGACTGGATGAA	AY358175	CCDS6960.1, CCDS65175.1, CCDS65176.1	9q34.13-q34.3	2014-07-18			ENSG00000148288	ENSG00000148288		"""Glycosyltransferase family 6 domain containing"""	20460	protein-coding gene	gene with protein product	"""Forssman glycolipid synthetase (FS)"", ""Forssman synthetase"""	606074				10506200, 8855242	Standard	NM_021996		Approved	UDP-GalNAc, A3GALNT, MGC44848, FS		Q8N5D6	OTTHUMG00000020853	ENST00000372040.3:c.376C>G	chr9.hg19:g.136029632G>C	ENSP00000361110:p.Gln126Glu	37.0	0.0		33.0	11.0	NM_021996	A8K633|B2RA95|B7Z8S5|Q45F07|Q5T7U9|Q5T7V1|Q8N2K4|Q9UKI5	Missense_Mutation	SNP	ENST00000372040.3	hg19	CCDS6960.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	7.620|7.620	0.676642|0.676642	0.14841|0.14841	.|.	.|.	ENSG00000148288|ENSG00000148288	ENST00000372038|ENST00000372040;ENST00000540636	T|T;T	0.39406|0.01139	1.08|5.28;5.28	5.38|5.38	5.38|5.38	0.77491|0.77491	.|.	.|0.220119	.|0.38778	.|N	.|0.001577	T|T	0.01029|0.01029	0.0034|0.0034	N|N	0.16368|0.16368	0.405|0.405	0.09310|0.09310	N|N	1|1	.|B;B	.|0.33777	.|0.244;0.425	.|B;B	.|0.34418	.|0.12;0.182	T|T	0.57636|0.57636	-0.7777|-0.7777	7|10	0.54805|0.17369	T|T	0.06|0.5	-16.1453|-16.1453	12.6992|12.6992	0.57022|0.57022	0.0:0.0:0.7217:0.2783|0.0:0.0:0.7217:0.2783	.|.	.|109;126	.|B7Z8S5;Q8N5D6	.|.;GBGT1_HUMAN	R|E	138|126;109	ENSP00000361108:P138R|ENSP00000361110:Q126E;ENSP00000437663:Q109E	ENSP00000361108:P138R|ENSP00000361110:Q126E	P|Q	-|-	2|1	0|0	GBGT1|GBGT1	135019453|135019453	0.000000|0.000000	0.05858|0.05858	0.840000|0.840000	0.33206|0.33206	0.328000|0.328000	0.28507|0.28507	-0.039000|-0.039000	0.12124|0.12124	2.513000|2.513000	0.84729|0.84729	0.491000|0.491000	0.48974|0.48974	CCA|CAG	.	.		0.607	GBGT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054815.1	NM_021996	
SOHLH1	402381	hgsc.bcm.edu	37	9	138589403	138589403	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr9:138589403T>A	ENST00000298466.5	-	4	476	c.416A>T	c.(415-417)cAg>cTg	p.Q139L	SOHLH1_ENST00000425225.1_Missense_Mutation_p.Q139L	NM_001012415.2	NP_001012415	Q5JUK2	SOLH1_HUMAN	spermatogenesis and oogenesis specific basic helix-loop-helix 1	139					oogenesis (GO:0048477)|ovarian follicle development (GO:0001541)|positive regulation of transcription, DNA-templated (GO:0045893)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(1)|lung(5)|prostate(1)	12		Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;1.66e-07)|Epithelial(140;1.11e-06)|all cancers(34;6.45e-05)		TGCTTGAATCTGACTCGACAA	0.537																																					p.Q139L		Atlas-SNP	.											.	SOHLH1	70	.	0			c.A416T						.						77.0	64.0	69.0					9																	138589403		2202	4300	6502	SO:0001583	missense	402381	exon4			TGAATCTGACTCG	BC031861	CCDS35174.1, CCDS48054.1	9q34.3	2013-05-21	2006-03-16	2006-03-16	ENSG00000165643	ENSG00000165643		"""Basic helix-loop-helix proteins"""	27845	protein-coding gene	gene with protein product	"""spermatogenesis associated 27"""	610224	"""chromosome 9 open reading frame 157"""	C9orf157		12477932	Standard	NM_001012415		Approved	NOHLH, TEB2, bA100C15.3, bHLHe80, SPATA27	uc010nbe.3	Q5JUK2	OTTHUMG00000020915	ENST00000298466.5:c.416A>T	chr9.hg19:g.138589403T>A	ENSP00000298466:p.Gln139Leu	98.0	0.0		67.0	30.0	NM_001012415	C9JG81|Q5EE14|Q5EGC2|Q8NEE3	Missense_Mutation	SNP	ENST00000298466.5	hg19	CCDS35174.1	.	.	.	.	.	.	.	.	.	.	T	14.38	2.518717	0.44763	.	.	ENSG00000165643	ENST00000298466;ENST00000425225	T;T	0.36520	1.25;1.26	4.24	1.86	0.25419	.	0.283495	0.19157	N	0.121285	T	0.42337	0.1198	L	0.50333	1.59	0.09310	N	0.999999	D;D	0.65815	0.991;0.995	P;P	0.61070	0.883;0.763	T	0.14896	-1.0456	10	0.51188	T	0.08	-20.5323	3.9756	0.09473	0.0:0.1163:0.2406:0.6431	.	139;139	Q5JUK2-2;Q5JUK2	.;SOLH1_HUMAN	L	139	ENSP00000298466:Q139L;ENSP00000404438:Q139L	ENSP00000298466:Q139L	Q	-	2	0	SOHLH1	137729224	0.005000	0.15991	0.012000	0.15200	0.009000	0.06853	0.125000	0.15749	0.615000	0.30124	0.459000	0.35465	CAG	.	.		0.537	SOHLH1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000055018.2	NM_001012415	
FAM208B	54906	hgsc.bcm.edu	37	10	5789185	5789185	+	Silent	SNP	G	G	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr10:5789185G>T	ENST00000328090.5	+	15	4426	c.3801G>T	c.(3799-3801)gtG>gtT	p.V1267V		NM_017782.4	NP_060252	Q5VWN6	F208B_HUMAN	family with sequence similarity 208, member B	1267																	GCCTGTCTGTGAGTAGAGAGG	0.393																																					p.V1267V		Atlas-SNP	.											.	.	.	.	0			c.G3801T						.						83.0	86.0	85.0					10																	5789185		1875	4118	5993	SO:0001819	synonymous_variant	54906	exon15			GTCTGTGAGTAGA	BX649177	CCDS41485.1	10p15.1	2011-09-14	2011-09-14	2011-09-14	ENSG00000108021	ENSG00000108021			23484	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 18"""	C10orf18		12477932	Standard	NM_017782		Approved	FLJ20360, bA318E3.2, KIAA2006	uc001iij.3	Q5VWN6	OTTHUMG00000017605	ENST00000328090.5:c.3801G>T	chr10.hg19:g.5789185G>T		90.0	0.0		132.0	13.0	NM_017782	Q2YD91|Q5VWN5|Q6ZRQ8|Q8IVG4|Q9BUZ7|Q9H5J9|Q9H7A4|Q9H996|Q9NXA1	Silent	SNP	ENST00000328090.5	hg19	CCDS41485.1																																																																																			.	.		0.393	FAM208B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046571.2	NM_017782	
CELF2	10659	hgsc.bcm.edu	37	10	11207586	11207586	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr10:11207586G>A	ENST00000379261.4	+	2	283	c.191G>A	c.(190-192)gGa>gAa	p.G64E	CELF2_ENST00000417956.2_Missense_Mutation_p.G40E|CELF2_ENST00000609692.1_Missense_Mutation_p.G40E|CELF2_ENST00000450189.1_Missense_Mutation_p.G71E|CELF2_ENST00000354440.2_Missense_Mutation_p.G40E|CELF2_ENST00000399850.3_Missense_Mutation_p.G40E|CELF2_ENST00000416382.2_Missense_Mutation_p.G64E|CELF2_ENST00000315874.4_Missense_Mutation_p.G40E|CELF2_ENST00000537122.1_5'UTR|CELF2_ENST00000427450.1_Missense_Mutation_p.G40E|CELF2_ENST00000608830.1_Missense_Mutation_p.G40E|CELF2_ENST00000354897.3_Missense_Mutation_p.G40E|CELF2_ENST00000542579.1_Missense_Mutation_p.G71E	NM_001025077.2	NP_001020248.1	O95319	CELF2_HUMAN	CUGBP, Elav-like family member 2	64	Necessary for RNA-binding, TNNT2 exon 5 and NMDA R1 exon 21 inclusion.|RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.				mRNA processing (GO:0006397)|regulation of heart contraction (GO:0008016)|RNA processing (GO:0006396)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(2)|central_nervous_system(1)|endometrium(4)|large_intestine(2)|lung(5)|prostate(1)|skin(1)	16						GAGCCTTACGGAGCCGTCTAC	0.587																																					p.G71E		Atlas-SNP	.											.	CELF2	78	.	0			c.G212A						.						61.0	64.0	63.0					10																	11207586		1934	4150	6084	SO:0001583	missense	10659	exon2			CTTACGGAGCCGT	U69546	CCDS41488.1, CCDS44354.1, CCDS44355.1, CCDS44356.1	10p13	2013-02-12	2010-02-19	2010-02-19	ENSG00000048740	ENSG00000048740		"""RNA binding motif (RRM) containing"""	2550	protein-coding gene	gene with protein product		602538	"""CUG triplet repeat, RNA-binding protein 2"", ""CUG triplet repeat, RNA binding protein 2"""	CUGBP2		7869393, 9887331	Standard	NM_006561		Approved	Etr-3, NAPOR-2, BRUNOL3	uc001ikl.4	O95319	OTTHUMG00000017668	ENST00000379261.4:c.191G>A	chr10.hg19:g.11207586G>A	ENSP00000368563:p.Gly64Glu	91.0	0.0		115.0	69.0	NM_006561	B7ZAN9|Q7KYU4|Q8N499|Q92950|Q96NW9|Q96RQ5|Q96RQ6|Q9UL67	Missense_Mutation	SNP	ENST00000379261.4	hg19	CCDS44354.1	.	.	.	.	.	.	.	.	.	.	G	28.7	4.939129	0.92526	.	.	ENSG00000048740	ENST00000379261;ENST00000416382;ENST00000450189;ENST00000542579;ENST00000399850;ENST00000417956;ENST00000315874;ENST00000354440;ENST00000354897;ENST00000427450	T;T;T;T;T;T;T;T;T	0.77098	-1.07;-1.07;0.96;0.96;-1.07;-1.07;-1.07;-1.07;-1.07	5.51	5.51	0.81932	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.000000	0.85682	D	0.000000	D	0.91928	0.7444	H	0.94925	3.6	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D	0.93522	0.6862	10	0.87932	D	0	-6.4706	19.807	0.96535	0.0:0.0:1.0:0.0	.	48;64;40;59;71;59;64	B4DDE7;B4DS31;B4DSZ2;B2RA86;E9PC62;O95319-3;O95319	.;.;.;.;.;.;CELF2_HUMAN	E	64;64;71;71;40;40;40;40;40;40	ENSP00000368563:G64E;ENSP00000406451:G64E;ENSP00000389951:G71E;ENSP00000443926:G71E;ENSP00000382743:G40E;ENSP00000404834:G40E;ENSP00000315328:G40E;ENSP00000346426:G40E;ENSP00000388530:G40E	ENSP00000315328:G40E	G	+	2	0	CELF2	11247592	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	9.658000	0.98594	2.759000	0.94783	0.563000	0.77884	GGA	.	.		0.587	CELF2-201	KNOWN	basic|CCDS	protein_coding	protein_coding			
PTER	9317	hgsc.bcm.edu	37	10	16553155	16553155	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr10:16553155T>C	ENST00000378000.1	+	6	1196	c.950T>C	c.(949-951)cTc>cCc	p.L317P	PTER_ENST00000298942.3_Missense_Mutation_p.L317P|PTER_ENST00000423462.2_Missense_Mutation_p.L270P|PTER_ENST00000535784.2_Missense_Mutation_p.L317P	NM_001001484.2|NM_001261838.1|NM_030664.4	NP_001001484.1|NP_001248767.1|NP_109589.2	Q96BW5	PTER_HUMAN	phosphotriesterase related	317					catabolic process (GO:0009056)|epithelial cell differentiation (GO:0030855)	extracellular vesicular exosome (GO:0070062)	hydrolase activity, acting on ester bonds (GO:0016788)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(1)|large_intestine(7)|lung(4)|ovary(2)	15						TCTCATATACTCACCAATGTT	0.413																																					p.L317P	Ovarian(2;46 150 15648 38137 47908)	Atlas-SNP	.											.	PTER	40	.	0			c.T950C						.						159.0	148.0	151.0					10																	16553155		2203	4300	6503	SO:0001583	missense	9317	exon6			ATATACTCACCAA	BC015092	CCDS7111.1, CCDS58070.1, CCDS73070.1	10p12	2003-11-05			ENSG00000165983	ENSG00000165983			9590	protein-coding gene	gene with protein product		604446				9925913	Standard	NM_001001484		Approved		uc001ioi.2	Q96BW5	OTTHUMG00000017737	ENST00000378000.1:c.950T>C	chr10.hg19:g.16553155T>C	ENSP00000367239:p.Leu317Pro	123.0	0.0		156.0	31.0	NM_030664	B0YJ77|B3KTF5|D3DRU0|Q9BY46	Missense_Mutation	SNP	ENST00000378000.1	hg19	CCDS7111.1	.	.	.	.	.	.	.	.	.	.	T	16.97	3.268659	0.59540	.	.	ENSG00000165983	ENST00000343656;ENST00000535784;ENST00000423462;ENST00000378000;ENST00000298942	T;T;T;T	0.50548	0.74;0.88;0.74;0.74	5.86	4.72	0.59763	.	0.000000	0.85682	D	0.000000	T	0.67730	0.2924	M	0.82716	2.605	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.79108	0.99;0.992	T	0.67169	-0.5738	10	0.26408	T	0.33	-4.0769	12.0599	0.53557	0.0:0.0672:0.0:0.9328	.	270;317	Q96BW5-2;Q96BW5	.;PTER_HUMAN	P	317;317;270;317;317	ENSP00000439485:L317P;ENSP00000389535:L270P;ENSP00000367239:L317P;ENSP00000298942:L317P	ENSP00000298942:L317P	L	+	2	0	PTER	16593161	1.000000	0.71417	1.000000	0.80357	0.757000	0.42996	4.661000	0.61518	1.046000	0.40249	0.491000	0.48974	CTC	.	.		0.413	PTER-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047001.2	NM_030664	
NEBL	10529	hgsc.bcm.edu	37	10	21178773	21178773	+	Splice_Site	SNP	C	C	A	rs139581346		TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr10:21178773C>A	ENST00000377122.4	-	3	655		c.e3+1		NEBL_ENST00000377159.4_Intron|NEBL_ENST00000377119.1_Splice_Site|NEBL_ENST00000417816.2_Intron	NM_006393.2	NP_006384.1	O76041	NEBL_HUMAN	nebulette						cardiac muscle thin filament assembly (GO:0071691)	extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|cytoskeletal protein binding (GO:0008092)|filamin binding (GO:0031005)|structural constituent of muscle (GO:0008307)|tropomyosin binding (GO:0005523)			NS(2)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(14)|lung(22)|ovary(2)|pancreas(1)|prostate(2)|skin(8)|stomach(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	70						TGATACCTTACCTCAGAAATA	0.299																																					.		Atlas-SNP	.											.	NEBL	199	.	0			c.258+1G>T						.						83.0	84.0	84.0					10																	21178773		2203	4298	6501	SO:0001630	splice_region_variant	10529	exon4			ACCTTACCTCAGA	Y16241	CCDS7133.1, CCDS7134.1	10p12	2014-09-17			ENSG00000078114	ENSG00000078114			16932	protein-coding gene	gene with protein product		605491				9733644, 10470015	Standard	NM_213569		Approved		uc001iqi.3	O76041	OTTHUMG00000017788	ENST00000377122.4:c.258+1G>T	chr10.hg19:g.21178773C>A		208.0	0.0		299.0	170.0	NM_006393	B0YJ45|Q2TBD0|Q70I54|Q9UIC4	Splice_Site	SNP	ENST00000377122.4	hg19	CCDS7134.1	.	.	.	.	.	.	.	.	.	.	C	21.6	4.180208	0.78564	.	.	ENSG00000078114	ENST00000377122;ENST00000377119;ENST00000434381	.	.	.	6.17	6.17	0.99709	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.8794	0.99867	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	NEBL	21218779	1.000000	0.71417	1.000000	0.80357	0.903000	0.53119	5.471000	0.66762	2.941000	0.99782	0.655000	0.94253	.	.	C|0.999;T|0.001		0.299	NEBL-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000047113.1	NM_006393	Intron
KIAA1217	56243	hgsc.bcm.edu	37	10	24833078	24833078	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr10:24833078A>T	ENST00000376454.3	+	19	4909	c.4879A>T	c.(4879-4881)Agg>Tgg	p.R1627W	KIAA1217_ENST00000396446.1_Intron|KIAA1217_ENST00000396445.1_Intron|KIAA1217_ENST00000307544.6_Intron|KIAA1217_ENST00000376451.2_Missense_Mutation_p.R1310W|KIAA1217_ENST00000376452.3_Intron|KIAA1217_ENST00000458595.1_Intron|KIAA1217_ENST00000376462.1_Intron	NM_019590.3	NP_062536.2	Q5T5P2	SKT_HUMAN	KIAA1217	1627					embryonic skeletal system development (GO:0048706)	cytoplasm (GO:0005737)				breast(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(19)|lung(19)|ovary(5)|prostate(3)|skin(3)|urinary_tract(1)	70						CGAAATCGCTAGGTCTCAACC	0.463																																					p.R1627W		Atlas-SNP	.											.	KIAA1217	235	.	0			c.A4879T						.						98.0	98.0	98.0					10																	24833078		2203	4300	6503	SO:0001583	missense	56243	exon19			ATCGCTAGGTCTC	BX640796	CCDS31165.1, CCDS41496.1, CCDS60501.1, CCDS60502.1, CCDS60504.1, CCDS60505.1	10p12.31	2009-09-16			ENSG00000120549	ENSG00000120549			25428	protein-coding gene	gene with protein product	"""sickle tail"""					10574462	Standard	XM_005252500		Approved	DKFZP761L0424, SKT	uc001iru.4	Q5T5P2	OTTHUMG00000017824	ENST00000376454.3:c.4879A>T	chr10.hg19:g.24833078A>T	ENSP00000365637:p.Arg1627Trp	84.0	0.0		119.0	64.0	NM_019590	A5LHW9|A6NLF3|A6PVQ5|A6PVQ6|A6PVQ7|B9EGK4|Q4KMG4|Q5T5P3|Q5T7H3|Q6MZZ6|Q6ZUI4|Q8WV45|Q9NSR2|Q9ULK3	Missense_Mutation	SNP	ENST00000376454.3	hg19	CCDS31165.1	.	.	.	.	.	.	.	.	.	.	A	9.895	1.205285	0.22205	.	.	ENSG00000120549	ENST00000442879;ENST00000376454;ENST00000450158;ENST00000376451	T;T	0.36520	1.65;1.25	5.25	-0.304	0.12788	.	0.323538	0.27447	N	0.019329	T	0.45316	0.1336	M	0.62723	1.935	0.19300	N	0.999978	P;P;P	0.47484	0.896;0.896;0.896	P;P;P	0.51355	0.667;0.667;0.487	T	0.50717	-0.8795	10	0.87932	D	0	.	14.4529	0.67397	0.475:0.525:0.0:0.0	.	1310;1310;1627	C9JRK3;Q5T5P2-3;Q5T5P2	.;.;SKT_HUMAN	W	1310;1627;1310;1310	ENSP00000365637:R1627W;ENSP00000365634:R1310W	ENSP00000365634:R1310W	R	+	1	2	KIAA1217	24873084	0.000000	0.05858	0.001000	0.08648	0.072000	0.16883	-0.554000	0.06006	-0.320000	0.08640	-0.396000	0.06452	AGG	.	.		0.463	KIAA1217-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047223.2	NM_019590	
PRTFDC1	56952	hgsc.bcm.edu	37	10	25145922	25145922	+	Missense_Mutation	SNP	A	A	T	rs148662493		TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr10:25145922A>T	ENST00000320152.6	-	6	454	c.426T>A	c.(424-426)gaT>gaA	p.D142E	PRTFDC1_ENST00000376378.1_Missense_Mutation_p.D142E	NM_020200.5	NP_064585.1	Q9NRG1	PRDC1_HUMAN	phosphoribosyl transferase domain containing 1	142					nucleoside metabolic process (GO:0009116)	cytosol (GO:0005829)	magnesium ion binding (GO:0000287)|nucleotide binding (GO:0000166)|protein homodimerization activity (GO:0042803)			breast(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(2)|ovary(1)|skin(1)	9						TTCCGACAACATCCTTTGCAA	0.403																																					p.D142E		Atlas-SNP	.											.	PRTFDC1	29	.	0			c.T426A						.	A	GLU/ASP	1,4405	2.1+/-5.4	0,1,2202	230.0	188.0	203.0		426	3.1	0.9	10	dbSNP_134	203	0,8600		0,0,4300	no	missense	PRTFDC1	NM_020200.5	45	0,1,6502	TT,TA,AA		0.0,0.0227,0.0077	probably-damaging	142/226	25145922	1,13005	2203	4300	6503	SO:0001583	missense	56952	exon6			GACAACATCCTTT	AF226056	CCDS7145.1, CCDS60506.1	10p12.31	2003-11-10			ENSG00000099256	ENSG00000099256			23333	protein-coding gene	gene with protein product		610751					Standard	XM_005252537		Approved	HHGP	uc001ise.1	Q9NRG1	OTTHUMG00000017829	ENST00000320152.6:c.426T>A	chr10.hg19:g.25145922A>T	ENSP00000318602:p.Asp142Glu	136.0	0.0		164.0	12.0	NM_020200	B7Z1Z3|Q53HA7|Q59EL9|Q5VV18|Q5VV20	Missense_Mutation	SNP	ENST00000320152.6	hg19	CCDS7145.1	.	.	.	.	.	.	.	.	.	.	A	11.17	1.560524	0.27827	2.27E-4	0.0	ENSG00000099256	ENST00000320152;ENST00000358336;ENST00000376378	D;D	0.99928	-8.07;-8.07	5.59	3.14	0.36123	Phosphoribosyltransferase (1);	0.210015	0.48767	D	0.000176	D	0.99924	0.9965	H	0.94385	3.53	0.80722	D	1	D;D	0.89917	0.992;1.0	P;D	0.80764	0.768;0.994	D	0.96886	0.9649	10	0.87932	D	0	.	10.3543	0.43954	0.8633:0.0:0.1367:0.0	.	142;142	Q9NRG1-2;Q9NRG1	.;PRDC1_HUMAN	E	142	ENSP00000318602:D142E;ENSP00000365558:D142E	ENSP00000318602:D142E	D	-	3	2	PRTFDC1	25185928	1.000000	0.71417	0.874000	0.34290	0.080000	0.17528	1.140000	0.31516	0.356000	0.24157	0.454000	0.30748	GAT	.	A|1.000;T|0.000		0.403	PRTFDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047243.2	NM_020200	
PRTFDC1	56952	hgsc.bcm.edu	37	10	25226147	25226147	+	Missense_Mutation	SNP	A	A	G	rs368309249		TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr10:25226147A>G	ENST00000320152.6	-	3	333	c.305T>C	c.(304-306)aTg>aCg	p.M102T	PRTFDC1_ENST00000376378.1_Missense_Mutation_p.M102T|PRTFDC1_ENST00000376376.3_Missense_Mutation_p.M102T	NM_020200.5	NP_064585.1	Q9NRG1	PRDC1_HUMAN	phosphoribosyl transferase domain containing 1	102					nucleoside metabolic process (GO:0009116)	cytosol (GO:0005829)	magnesium ion binding (GO:0000287)|nucleotide binding (GO:0000166)|protein homodimerization activity (GO:0042803)			breast(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(2)|ovary(1)|skin(1)	9						ATCAACCTTCATTGAGACAAA	0.353													A|||	1	0.000199681	0.0	0.0014	5008	,	,		18668	0.0		0.0	False		,,,				2504	0.0				p.M102T		Atlas-SNP	.											.	PRTFDC1	29	.	0			c.T305C						.	A	THR/MET	1,4405	2.1+/-5.4	0,1,2202	102.0	98.0	100.0		305	5.6	1.0	10		100	0,8600		0,0,4300	no	missense	PRTFDC1	NM_020200.5	81	0,1,6502	GG,GA,AA		0.0,0.0227,0.0077	benign	102/226	25226147	1,13005	2203	4300	6503	SO:0001583	missense	56952	exon3			ACCTTCATTGAGA	AF226056	CCDS7145.1, CCDS60506.1	10p12.31	2003-11-10			ENSG00000099256	ENSG00000099256			23333	protein-coding gene	gene with protein product		610751					Standard	XM_005252537		Approved	HHGP	uc001ise.1	Q9NRG1	OTTHUMG00000017829	ENST00000320152.6:c.305T>C	chr10.hg19:g.25226147A>G	ENSP00000318602:p.Met102Thr	79.0	0.0		86.0	22.0	NM_020200	B7Z1Z3|Q53HA7|Q59EL9|Q5VV18|Q5VV20	Missense_Mutation	SNP	ENST00000320152.6	hg19	CCDS7145.1	.	.	.	.	.	.	.	.	.	.	A	14.09	2.430588	0.43122	2.27E-4	0.0	ENSG00000099256	ENST00000320152;ENST00000358336;ENST00000376378;ENST00000376376	D;D;D	0.99695	-5.67;-5.67;-6.43	5.63	5.63	0.86233	Phosphoribosyltransferase (1);	0.116803	0.85682	D	0.000000	D	0.98438	0.9480	N	0.21617	0.685	0.54753	D	0.999986	B;B	0.28900	0.054;0.227	B;B	0.29862	0.007;0.108	D	0.99029	1.0820	10	0.49607	T	0.09	.	15.87	0.79108	1.0:0.0:0.0:0.0	.	102;102	Q9NRG1-2;Q9NRG1	.;PRDC1_HUMAN	T	102	ENSP00000318602:M102T;ENSP00000365558:M102T;ENSP00000365556:M102T	ENSP00000318602:M102T	M	-	2	0	PRTFDC1	25266153	1.000000	0.71417	0.997000	0.53966	0.944000	0.59088	4.803000	0.62546	2.145000	0.66743	0.533000	0.62120	ATG	.	.		0.353	PRTFDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047243.2	NM_020200	
MYO3A	53904	hgsc.bcm.edu	37	10	26377316	26377316	+	Missense_Mutation	SNP	G	G	T	rs200209381		TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr10:26377316G>T	ENST00000265944.5	+	15	1710	c.1544G>T	c.(1543-1545)cGa>cTa	p.R515L	MYO3A_ENST00000543632.1_Missense_Mutation_p.R515L	NM_017433.4	NP_059129.3	Q8NEV4	MYO3A_HUMAN	myosin IIIA	515	Myosin motor.				ATP catabolic process (GO:0006200)|inner ear development (GO:0048839)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of filopodium assembly (GO:0051491)|protein autophosphorylation (GO:0046777)|response to stimulus (GO:0050896)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|filamentous actin (GO:0031941)|filopodium (GO:0030175)|filopodium tip (GO:0032433)|myosin complex (GO:0016459)|photoreceptor inner segment (GO:0001917)|stereocilium bundle tip (GO:0032426)	actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|plus-end directed microfilament motor activity (GO:0060002)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(9)|central_nervous_system(3)|endometrium(9)|kidney(10)|large_intestine(28)|liver(1)|lung(46)|ovary(11)|pancreas(1)|prostate(6)|skin(11)|stomach(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	146						GAAAAATCCCGAGTTATCCAC	0.358																																					p.R515L		Atlas-SNP	.											MYO3A,bladder,carcinoma,0,1	MYO3A	371	.	0			c.G1544T						.						59.0	61.0	60.0					10																	26377316		2203	4300	6503	SO:0001583	missense	53904	exon15			AATCCCGAGTTAT	AF229172	CCDS7148.1	10p11.1	2011-09-27	2004-05-19		ENSG00000095777	ENSG00000095777		"""Myosins / Myosin superfamily : Class III"""	7601	protein-coding gene	gene with protein product		606808	"""deafness, autosomal recessive 30"""	DFNB30		10936054	Standard	NM_017433		Approved		uc001isn.2	Q8NEV4	OTTHUMG00000017837	ENST00000265944.5:c.1544G>T	chr10.hg19:g.26377316G>T	ENSP00000265944:p.Arg515Leu	106.0	0.0		166.0	42.0	NM_017433	Q4G0X2|Q5VZ28|Q8WX17|Q9NYS8	Missense_Mutation	SNP	ENST00000265944.5	hg19	CCDS7148.1	.	.	.	.	.	.	.	.	.	.	G	32	5.180708	0.94846	.	.	ENSG00000095777	ENST00000265944;ENST00000543632	D;D	0.96885	-4.16;-4.16	5.78	5.78	0.91487	Myosin head, motor domain (2);	0.000000	0.85682	D	0.000000	D	0.99070	0.9681	H	0.98446	4.235	0.80722	D	1	D;D;D	0.89917	0.999;0.999;1.0	D;D;D	0.97110	0.996;0.998;1.0	D	0.98869	1.0765	10	0.87932	D	0	.	20.3668	0.98882	0.0:0.0:1.0:0.0	.	515;515;515	F5H0U9;Q0VD65;Q8NEV4	.;.;MYO3A_HUMAN	L	515	ENSP00000265944:R515L;ENSP00000445909:R515L	ENSP00000265944:R515L	R	+	2	0	MYO3A	26417322	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	9.813000	0.99286	2.894000	0.99253	0.655000	0.94253	CGA	.	G|1.000;A|0.000		0.358	MYO3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047259.1	NM_017433	
MYO3A	53904	hgsc.bcm.edu	37	10	26465717	26465717	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr10:26465717G>T	ENST00000265944.5	+	31	4547	c.4381G>T	c.(4381-4383)Ggt>Tgt	p.G1461C	MYO3A_ENST00000543632.1_Intron	NM_017433.4	NP_059129.3	Q8NEV4	MYO3A_HUMAN	myosin IIIA	1461					ATP catabolic process (GO:0006200)|inner ear development (GO:0048839)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of filopodium assembly (GO:0051491)|protein autophosphorylation (GO:0046777)|response to stimulus (GO:0050896)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|filamentous actin (GO:0031941)|filopodium (GO:0030175)|filopodium tip (GO:0032433)|myosin complex (GO:0016459)|photoreceptor inner segment (GO:0001917)|stereocilium bundle tip (GO:0032426)	actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|plus-end directed microfilament motor activity (GO:0060002)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(9)|central_nervous_system(3)|endometrium(9)|kidney(10)|large_intestine(28)|liver(1)|lung(46)|ovary(11)|pancreas(1)|prostate(6)|skin(11)|stomach(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	146						ACTTTATCTGGGTGTCTCGCA	0.358																																					p.G1461C		Atlas-SNP	.											.	MYO3A	371	.	0			c.G4381T						.						91.0	86.0	88.0					10																	26465717		2203	4300	6503	SO:0001583	missense	53904	exon31			TATCTGGGTGTCT	AF229172	CCDS7148.1	10p11.1	2011-09-27	2004-05-19		ENSG00000095777	ENSG00000095777		"""Myosins / Myosin superfamily : Class III"""	7601	protein-coding gene	gene with protein product		606808	"""deafness, autosomal recessive 30"""	DFNB30		10936054	Standard	NM_017433		Approved		uc001isn.2	Q8NEV4	OTTHUMG00000017837	ENST00000265944.5:c.4381G>T	chr10.hg19:g.26465717G>T	ENSP00000265944:p.Gly1461Cys	87.0	0.0		98.0	5.0	NM_017433	Q4G0X2|Q5VZ28|Q8WX17|Q9NYS8	Missense_Mutation	SNP	ENST00000265944.5	hg19	CCDS7148.1	.	.	.	.	.	.	.	.	.	.	G	15.84	2.951157	0.53186	.	.	ENSG00000095777	ENST00000265944	D	0.81659	-1.52	5.91	3.85	0.44370	.	0.317210	0.37304	N	0.002160	T	0.77075	0.4077	L	0.46157	1.445	0.09310	N	0.999997	D	0.61697	0.99	P	0.47673	0.554	T	0.70799	-0.4774	10	0.72032	D	0.01	.	9.8688	0.41162	0.2029:0.0:0.7971:0.0	.	1461	Q8NEV4	MYO3A_HUMAN	C	1461	ENSP00000265944:G1461C	ENSP00000265944:G1461C	G	+	1	0	MYO3A	26505723	0.108000	0.22018	0.415000	0.26534	0.928000	0.56348	0.681000	0.25320	1.508000	0.48769	0.650000	0.86243	GGT	.	.		0.358	MYO3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047259.1	NM_017433	
PARD3	56288	hgsc.bcm.edu	37	10	34759158	34759158	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr10:34759158G>A	ENST00000374789.3	-	4	762	c.437C>T	c.(436-438)cCa>cTa	p.P146L	PARD3_ENST00000374776.1_Missense_Mutation_p.P146L|PARD3_ENST00000340077.5_Missense_Mutation_p.P146L|PARD3_ENST00000545693.1_Missense_Mutation_p.P146L|PARD3_ENST00000350537.4_Missense_Mutation_p.P146L|PARD3_ENST00000374773.1_Missense_Mutation_p.P146L|PARD3_ENST00000374794.3_Missense_Mutation_p.P146L|PARD3_ENST00000545260.1_Missense_Mutation_p.P146L|PARD3_ENST00000374790.3_Missense_Mutation_p.P146L|PARD3_ENST00000346874.4_Missense_Mutation_p.P146L|PARD3_ENST00000374788.3_Missense_Mutation_p.P146L	NM_019619.3	NP_062565.2	Q8TEW0	PARD3_HUMAN	par-3 family cell polarity regulator	146					apical constriction (GO:0003383)|asymmetric cell division (GO:0008356)|axonogenesis (GO:0007409)|cell cycle (GO:0007049)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|centrosome localization (GO:0051642)|establishment of epithelial cell polarity (GO:0090162)|establishment or maintenance of cell polarity (GO:0007163)|microtubule cytoskeleton organization (GO:0000226)|myelination in peripheral nervous system (GO:0022011)|negative regulation of peptidyl-threonine phosphorylation (GO:0010801)|positive regulation of myelination (GO:0031643)|protein complex assembly (GO:0006461)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|protein targeting to membrane (GO:0006612)|regulation of actin filament-based process (GO:0032970)|regulation of cellular localization (GO:0060341)|tight junction assembly (GO:0070830)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing, spreading of cells (GO:0044319)	apical part of cell (GO:0045177)|axonal growth cone (GO:0044295)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|internode region of axon (GO:0033269)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|spindle (GO:0005819)|tight junction (GO:0005923)	phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3-phosphate binding (GO:0032266)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(11)|lung(21)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	63		Breast(68;0.0707)				AATTAGAGCTGGGTCACTACT	0.418																																					p.P146L		Atlas-SNP	.											.	PARD3	131	.	0			c.C437T						.						121.0	120.0	120.0					10																	34759158		2203	4300	6503	SO:0001583	missense	56288	exon4			AGAGCTGGGTCAC	AF252293	CCDS7178.1, CCDS53509.1, CCDS53510.1, CCDS53511.1, CCDS53512.1, CCDS53513.1, CCDS53514.1, CCDS53515.1, CCDS53516.1	10p11.22	2014-06-13	2013-08-28		ENSG00000148498	ENSG00000148498			16051	protein-coding gene	gene with protein product	"""atypical PKC isotype-specific interacting protein"", ""par-3 family cell polarity regulator alpha"", ""protein phosphatase 1, regulatory subunit 118"""	606745	"""par-3 (partitioning defective 3, C.elegans) homolog"", ""par-3 partitioning defective 3 homolog (C. elegans)"""			10934474	Standard	NM_001184790		Approved	PAR3, PARD3A, Bazooka, Baz, ASIP, PPP1R118	uc010qej.2	Q8TEW0	OTTHUMG00000017948	ENST00000374789.3:c.437C>T	chr10.hg19:g.34759158G>A	ENSP00000363921:p.Pro146Leu	117.0	0.0		130.0	34.0	NM_001184788	F5H5T0|Q5T2U1|Q5VUA2|Q5VUA3|Q5VWV0|Q5VWV1|Q5VWV3|Q5VWV4|Q5VWV5|Q6IQ47|Q8TCZ9|Q8TEW1|Q8TEW2|Q8TEW3|Q96K28|Q96RM6|Q96RM7|Q9BY57|Q9BY58|Q9HC48|Q9NWL4|Q9NYE6	Missense_Mutation	SNP	ENST00000374789.3	hg19	CCDS7178.1	.	.	.	.	.	.	.	.	.	.	G	31	5.096345	0.94197	.	.	ENSG00000148498	ENST00000545693;ENST00000545260;ENST00000374789;ENST00000374788;ENST00000346874;ENST00000374794;ENST00000350537;ENST00000374790;ENST00000374776;ENST00000340077;ENST00000374773	T;T;T;T;T;T;T;T;T;T;T	0.55588	0.51;0.51;0.51;0.51;0.51;0.51;0.51;0.51;0.51;0.51;0.51	6.03	6.03	0.97812	.	0.000000	0.85682	D	0.000000	T	0.74891	0.3776	M	0.75777	2.31	0.80722	D	1	D;D;D;D;D;D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;0.963;1.0	D;D;D;D;D;D;D;D;D;D;D;P;D	0.97110	1.0;0.997;1.0;1.0;1.0;1.0;1.0;0.998;1.0;1.0;1.0;0.827;0.999	T	0.75587	-0.3266	10	0.87932	D	0	.	20.1617	0.98138	0.0:0.0:1.0:0.0	.	146;146;146;146;146;146;146;146;146;146;146;146;146	Q8TEW0-5;Q8TEW0-3;Q8TEW0-7;Q8TEW0-6;F5H5T0;Q8TEW0-4;Q8TEW0-2;Q8TEW0;Q5VWV2;Q6IQ47;Q8TEW0-8;Q8TEW0-9;Q8TEW0-10	.;.;.;.;.;.;.;PARD3_HUMAN;.;.;.;.;.	L	146	ENSP00000443147:P146L;ENSP00000440857:P146L;ENSP00000363921:P146L;ENSP00000363920:P146L;ENSP00000340591:P146L;ENSP00000363926:P146L;ENSP00000311986:P146L;ENSP00000363922:P146L;ENSP00000363908:P146L;ENSP00000341844:P146L;ENSP00000363905:P146L	ENSP00000341844:P146L	P	-	2	0	PARD3	34799164	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	8.839000	0.92120	2.854000	0.98071	0.655000	0.94253	CCA	.	.		0.418	PARD3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047527.1	NM_019619	
WDFY4	57705	hgsc.bcm.edu	37	10	49982657	49982657	+	Nonsense_Mutation	SNP	C	C	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr10:49982657C>A	ENST00000325239.5	+	13	2735	c.2708C>A	c.(2707-2709)tCa>tAa	p.S903*	WDFY4_ENST00000413659.2_Nonsense_Mutation_p.S903*	NM_020945.1	NP_065996.1	Q6ZS81	WDFY4_HUMAN	WDFY family member 4	903						integral component of membrane (GO:0016021)				NS(2)|breast(5)|central_nervous_system(4)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|lung(3)|pancreas(2)|prostate(5)|skin(6)|stomach(1)	48						CCCCTCCACTCACGCCTCATC	0.602																																					p.S903X		Atlas-SNP	.											.	WDFY4	205	.	0			c.C2708A						.						37.0	45.0	43.0					10																	49982657		692	1591	2283	SO:0001587	stop_gained	57705	exon14			TCCACTCACGCCT	AK074085	CCDS44385.1	10q11.23	2013-01-10			ENSG00000128815	ENSG00000128815		"""WD repeat domain containing"""	29323	protein-coding gene	gene with protein product		613316	"""chromosome 10 open reading frame 64"""	C10orf64		10997877	Standard	NM_020945		Approved	KIAA1607, Em:AC060234.3, FLJ45748	uc001jha.4	Q6ZS81	OTTHUMG00000018180	ENST00000325239.5:c.2708C>A	chr10.hg19:g.49982657C>A	ENSP00000320563:p.Ser903*	87.0	0.0		137.0	43.0	NM_020945	B9ZVP2|Q86WZ4|Q8N4A3|Q8TEN7|Q96BE1|Q9H7H8|Q9HCG5	Nonsense_Mutation	SNP	ENST00000325239.5	hg19	CCDS44385.1	.	.	.	.	.	.	.	.	.	.	C	42	9.621917	0.99221	.	.	ENSG00000128815	ENST00000454161;ENST00000426033;ENST00000325239;ENST00000413659	.	.	.	5.42	3.39	0.38822	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	4.8095	0.13337	0.0:0.3423:0.0:0.6577	.	.	.	.	X	912;903;903;903	.	.	S	+	2	0	WDFY4	49652663	0.008000	0.16893	0.085000	0.20634	0.936000	0.57629	1.657000	0.37366	0.542000	0.28846	0.655000	0.94253	TCA	.	.		0.602	WDFY4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		XM_033379	
MBL2	4153	hgsc.bcm.edu	37	10	54528161	54528161	+	Silent	SNP	A	A	C			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr10:54528161A>C	ENST00000373968.3	-	4	547	c.483T>G	c.(481-483)tcT>tcG	p.S161S		NM_000242.2	NP_000233.1	P11226	MBL2_HUMAN	mannose-binding lectin (protein C) 2, soluble	161	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				acute-phase response (GO:0006953)|complement activation (GO:0006956)|complement activation, classical pathway (GO:0006958)|complement activation, lectin pathway (GO:0001867)|defense response to bacterium (GO:0042742)|defense response to Gram-positive bacterium (GO:0050830)|innate immune response (GO:0045087)|killing by host of symbiont cells (GO:0051873)|negative regulation of growth of symbiont in host (GO:0044130)|negative regulation of viral process (GO:0048525)|opsonization (GO:0008228)|positive regulation of phagocytosis (GO:0050766)|response to oxidative stress (GO:0006979)	cell surface (GO:0009986)|collagen trimer (GO:0005581)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	calcium-dependent protein binding (GO:0048306)|mannose binding (GO:0005537)|receptor binding (GO:0005102)			breast(1)|endometrium(2)|lung(12)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	21						GGGTGGCCACAGAGGCCTGGA	0.493																																					p.S161S		Atlas-SNP	.											.	MBL2	55	.	0			c.T483G						.						137.0	140.0	139.0					10																	54528161		2202	4300	6502	SO:0001819	synonymous_variant	4153	exon4			GGCCACAGAGGCC	AF360991	CCDS7247.1	10q11.2	2014-09-17	2011-02-02		ENSG00000165471	ENSG00000165471		"""Collectins"""	6922	protein-coding gene	gene with protein product		154545	"""mannose-binding lectin (protein C) 2, soluble (opsonic defect)"""	MBL		1675710, 1672848	Standard	NM_000242		Approved	COLEC1	uc001jjt.3	P11226	OTTHUMG00000150270	ENST00000373968.3:c.483T>G	chr10.hg19:g.54528161A>C		144.0	0.0		153.0	46.0	NM_000242	Q4VB12|Q4VB13|Q4VB14|Q5SQS3|Q86SI4|Q96KE4|Q96TF7|Q96TF8|Q96TF9	Silent	SNP	ENST00000373968.3	hg19	CCDS7247.1																																																																																			.	.		0.493	MBL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048115.1	NM_000242	
SLC16A9	220963	hgsc.bcm.edu	37	10	61443920	61443920	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr10:61443920A>G	ENST00000395348.3	-	2	766	c.130T>C	c.(130-132)Ttt>Ctt	p.F44L	SLC16A9_ENST00000490066.1_5'UTR|SLC16A9_ENST00000395347.1_Missense_Mutation_p.F44L	NM_194298.2	NP_919274.1	Q7RTY1	MOT9_HUMAN	solute carrier family 16, member 9	44					urate metabolic process (GO:0046415)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	symporter activity (GO:0015293)			kidney(3)|large_intestine(5)|lung(5)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	23						CCTTCACCAAAGGCATCCAGC	0.463																																					p.F44L		Atlas-SNP	.											.	SLC16A9	58	.	0			c.T130C						.						130.0	127.0	128.0					10																	61443920		2203	4300	6503	SO:0001583	missense	220963	exon2			CACCAAAGGCATC	AK125791	CCDS7256.1	10q21.3	2013-07-18	2013-07-18	2004-01-21	ENSG00000165449	ENSG00000165449		"""Solute carriers"""	23520	protein-coding gene	gene with protein product	"""monocarboxylic acid transporter 9"""	614242	"""chromosome 10 open reading frame 36"", ""solute carrier family 16 (monocarboxylic acid transporters), member 9"", ""solute carrier family 16, member 9 (monocarboxylic acid transporter 9)"""	C10orf36			Standard	NM_194298		Approved	FLJ43803, MCT9	uc010qig.1	Q7RTY1	OTTHUMG00000018283	ENST00000395348.3:c.130T>C	chr10.hg19:g.61443920A>G	ENSP00000378757:p.Phe44Leu	213.0	0.0		243.0	12.0	NM_194298	Q6ZMI2|Q9UFH8	Missense_Mutation	SNP	ENST00000395348.3	hg19	CCDS7256.1	.	.	.	.	.	.	.	.	.	.	A	33	5.229247	0.95173	.	.	ENSG00000165449	ENST00000395348;ENST00000395347;ENST00000490066	T;T	0.55588	0.51;0.51	5.33	5.33	0.75918	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.100645	0.64402	D	0.000002	T	0.58366	0.2117	L	0.60067	1.865	0.80722	D	1	P	0.52692	0.955	P	0.48770	0.589	T	0.63001	-0.6734	10	0.59425	D	0.04	.	15.2955	0.73902	1.0:0.0:0.0:0.0	.	44	Q7RTY1	MOT9_HUMAN	L	44	ENSP00000378757:F44L;ENSP00000378756:F44L	ENSP00000378756:F44L	F	-	1	0	SLC16A9	61113926	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.320000	0.89995	2.014000	0.59158	0.533000	0.62120	TTT	.	.		0.463	SLC16A9-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048174.2	NM_194298	
ANK3	288	hgsc.bcm.edu	37	10	61829030	61829030	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr10:61829030G>T	ENST00000280772.2	-	37	11800	c.11609C>A	c.(11608-11610)aCt>aAt	p.T3870N	ANK3_ENST00000355288.2_Intron|ANK3_ENST00000373827.2_Intron|ANK3_ENST00000503366.1_Intron	NM_020987.3	NP_066267.2	Q12955	ANK3_HUMAN	ankyrin 3, node of Ranvier (ankyrin G)	3870					axon guidance (GO:0007411)|axonogenesis (GO:0007409)|cytoskeletal anchoring at plasma membrane (GO:0007016)|establishment of protein localization (GO:0045184)|Golgi to plasma membrane protein transport (GO:0043001)|maintenance of protein location in plasma membrane (GO:0072660)|membrane assembly (GO:0071709)|mitotic cytokinesis (GO:0000281)|neuromuscular junction development (GO:0007528)|neuronal action potential (GO:0019228)|plasma membrane organization (GO:0007009)|positive regulation of cell communication by electrical coupling (GO:0010650)|positive regulation of gene expression (GO:0010628)|positive regulation of homotypic cell-cell adhesion (GO:0034112)|positive regulation of membrane depolarization during cardiac muscle cell action potential (GO:1900827)|positive regulation of membrane potential (GO:0045838)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|positive regulation of sodium ion transport (GO:0010765)|protein localization to plasma membrane (GO:0072659)|protein targeting to plasma membrane (GO:0072661)|regulation of potassium ion transport (GO:0043266)|signal transduction (GO:0007165)	axon initial segment (GO:0043194)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|costamere (GO:0043034)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|intercalated disc (GO:0014704)|lateral plasma membrane (GO:0016328)|lysosome (GO:0005764)|neuromuscular junction (GO:0031594)|node of Ranvier (GO:0033268)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|sarcoplasmic reticulum (GO:0016529)|spectrin-associated cytoskeleton (GO:0014731)|T-tubule (GO:0030315)|Z disc (GO:0030018)	cadherin binding (GO:0045296)|cytoskeletal protein binding (GO:0008092)|ion channel binding (GO:0044325)|protein binding, bridging (GO:0030674)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			NS(4)|breast(7)|central_nervous_system(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(5)|kidney(14)|large_intestine(30)|liver(2)|lung(59)|ovary(8)|pancreas(2)|prostate(5)|skin(26)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(7)	196						TTTTGGTGAAGTGGCCTTTAT	0.398																																					p.T3870N		Atlas-SNP	.											.	ANK3	703	.	0			c.C11609A						.						303.0	298.0	300.0					10																	61829030		2203	4300	6503	SO:0001583	missense	288	exon37			GGTGAAGTGGCCT	U13616	CCDS7258.1, CCDS7259.1, CCDS55711.1, CCDS55712.1	10q21	2013-01-10			ENSG00000151150	ENSG00000151150		"""Ankyrin repeat domain containing"""	494	protein-coding gene	gene with protein product	"""ankyrin-3, node of Ranvier"", ""ankyrin-G"""	600465				7665168	Standard	NM_020987		Approved		uc001jky.3	Q12955	OTTHUMG00000018288	ENST00000280772.2:c.11609C>A	chr10.hg19:g.61829030G>T	ENSP00000280772:p.Thr3870Asn	252.0	0.0		354.0	202.0	NM_020987	B1AQT2|B4DIL1|E9PE32|Q13484|Q5CZH9|Q5VXD5|Q7Z3G4|Q9H0P5	Missense_Mutation	SNP	ENST00000280772.2	hg19	CCDS7258.1	.	.	.	.	.	.	.	.	.	.	G	7.952	0.745070	0.15710	.	.	ENSG00000151150	ENST00000280772	T	0.16897	2.31	5.07	5.07	0.68467	.	0.000000	0.43416	D	0.000571	T	0.08223	0.0205	N	0.14661	0.345	0.80722	D	1	P	0.37015	0.578	B	0.24701	0.055	T	0.14008	-1.0488	10	0.52906	T	0.07	.	9.1159	0.36758	0.0812:0.1602:0.7586:0.0	.	3870	Q12955	ANK3_HUMAN	N	3870	ENSP00000280772:T3870N	ENSP00000280772:T3870N	T	-	2	0	ANK3	61499036	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	3.154000	0.50693	2.511000	0.84671	0.650000	0.86243	ACT	.	.		0.398	ANK3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048201.4	NM_020987	
RUFY2	55680	hgsc.bcm.edu	37	10	70141014	70141014	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr10:70141014T>A	ENST00000602465.1	-	11	1182	c.1082A>T	c.(1081-1083)aAc>aTc	p.N361I	RUFY2_ENST00000454950.2_Missense_Mutation_p.N303I|RUFY2_ENST00000472394.2_5'UTR|RUFY2_ENST00000388768.2_Missense_Mutation_p.N396I|RUFY2_ENST00000399200.2_Missense_Mutation_p.N327I			Q8WXA3	RUFY2_HUMAN	RUN and FYVE domain containing 2	410						nucleus (GO:0005634)	metal ion binding (GO:0046872)			NS(1)|endometrium(2)|kidney(3)|large_intestine(1)|lung(10)|ovary(1)|upper_aerodigestive_tract(2)	20						CATCTCTATGTTAATTGCTTT	0.328																																					p.N396I		Atlas-SNP	.											.	RUFY2	58	.	0			c.A1187T						.						159.0	144.0	149.0					10																	70141014		1835	4095	5930	SO:0001583	missense	55680	exon11			TCTATGTTAATTG	AF461266	CCDS41534.1, CCDS44414.1, CCDS60544.1	10q22.2	2007-01-29			ENSG00000204130	ENSG00000204130		"""Zinc fingers, FYVE domain containing"""	19761	protein-coding gene	gene with protein product		610328				11877430	Standard	NM_001042417		Approved	RABIP4R, FLJ10063, KIAA1537, ZFYVE13	uc001job.3	Q8WXA3	OTTHUMG00000018353	ENST00000602465.1:c.1082A>T	chr10.hg19:g.70141014T>A	ENSP00000473462:p.Asn361Ile	81.0	0.0		116.0	37.0	NM_017987	B3KXB2|B4DFR0|Q5TC48|Q8IW33|Q96P51|Q9P1Z1	Missense_Mutation	SNP	ENST00000602465.1	hg19		.	.	.	.	.	.	.	.	.	.	T	25.0	4.597404	0.87055	.	.	ENSG00000204130	ENST00000388768;ENST00000399200;ENST00000454950	T;T;T	0.57436	0.4;1.31;0.87	5.29	5.29	0.74685	.	0.089619	0.85682	D	0.000000	T	0.72170	0.3427	M	0.76170	2.325	0.80722	D	1	D;D;D;D	0.89917	0.998;0.999;0.999;1.0	D;D;D;D	0.85130	0.991;0.996;0.996;0.997	T	0.74942	-0.3492	10	0.56958	D	0.05	.	15.3935	0.74767	0.0:0.0:0.0:1.0	.	303;361;327;396	B4DFR0;Q8WXA3-2;Q8WXA3-4;Q8WXA3-3	.;.;.;.	I	396;327;303	ENSP00000373420:N396I;ENSP00000382151:N327I;ENSP00000404986:N303I	ENSP00000373420:N396I	N	-	2	0	RUFY2	69811020	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.674000	0.68117	2.225000	0.72522	0.477000	0.44152	AAC	.	.		0.328	RUFY2-010	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000467567.1	NM_017987	
SAR1A	56681	hgsc.bcm.edu	37	10	71917592	71917592	+	Silent	SNP	T	T	G			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr10:71917592T>G	ENST00000373242.2	-	6	472	c.276A>C	c.(274-276)gcA>gcC	p.A92A	SAR1A_ENST00000431664.2_Silent_p.A92A|SAR1A_ENST00000373236.1_Silent_p.A92A|SAR1A_ENST00000373241.4_Silent_p.A92A|SAR1A_ENST00000373238.1_Silent_p.A92A|SAR1A_ENST00000458634.2_Silent_p.A49A	NM_001142648.1	NP_001136120.1	Q9NR31	SAR1A_HUMAN	secretion associated, Ras related GTPase 1A	92					intracellular protein transport (GO:0006886)|negative regulation of cargo loading into COPII-coated vesicle (GO:1901303)|vesicle-mediated transport (GO:0016192)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|sarcoplasmic reticulum (GO:0016529)	GTP binding (GO:0005525)			NS(1)|endometrium(1)|large_intestine(1)|lung(3)	6						TCCCATTAATTGCTGGGAGAT	0.353																																					p.A92A		Atlas-SNP	.											.	SAR1A	19	.	0			c.A276C						.						81.0	72.0	75.0					10																	71917592		2203	4300	6503	SO:0001819	synonymous_variant	56681	exon5			ATTAATTGCTGGG		CCDS7298.1	10q22.1	2014-03-07	2014-03-07	2005-10-21	ENSG00000079332	ENSG00000079332			10534	protein-coding gene	gene with protein product		607691	"""SAR1a gene homolog (S. cerevisiae) 1"", ""SAR1a gene homolog 1 (S. cerevisiae)"", ""SAR1 homolog A (S. cerevisiae)"""	SARA1		10871277	Standard	NM_020150		Approved	SAR1, Sara	uc010qji.2	Q9NR31	OTTHUMG00000018400	ENST00000373242.2:c.276A>C	chr10.hg19:g.71917592T>G		92.0	0.0		127.0	43.0	NM_020150	B4DQ19	Silent	SNP	ENST00000373242.2	hg19	CCDS7298.1																																																																																			.	.		0.353	SAR1A-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048500.2		
PSAP	5660	hgsc.bcm.edu	37	10	73591653	73591653	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr10:73591653T>C	ENST00000394936.3	-	3	346	c.199A>G	c.(199-201)Aaa>Gaa	p.K67E	PSAP_ENST00000394934.1_Missense_Mutation_p.K67E			P07602	SAP_HUMAN	prosaposin	67	Saposin B-type 1. {ECO:0000255|PROSITE- ProRule:PRU00415}.				blood coagulation (GO:0007596)|cellular response to organic substance (GO:0071310)|epithelial cell differentiation involved in prostate gland development (GO:0060742)|glycosphingolipid metabolic process (GO:0006687)|lipid transport (GO:0006869)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of catalytic activity (GO:0043085)|prostate gland growth (GO:0060736)|regulation of lipid metabolic process (GO:0019216)|regulation of MAPK cascade (GO:0043408)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosomal lumen (GO:0043202)|lysosomal membrane (GO:0005765)|mitochondrion (GO:0005739)	enzyme activator activity (GO:0008047)|lipid binding (GO:0008289)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(3)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	13						ACAACGTCTTTGCATATGTCG	0.527																																					p.K67E		Atlas-SNP	.											.	PSAP	43	.	0			c.A199G						.						180.0	166.0	171.0					10																	73591653		2203	4300	6503	SO:0001583	missense	5660	exon3			CGTCTTTGCATAT	BC004275	CCDS7311.1	10q21-q22	2014-01-30	2008-07-31		ENSG00000197746	ENSG00000197746		"""Endogenous ligands"""	9498	protein-coding gene	gene with protein product	"""variant Gaucher disease and variant metachromatic leukodystrophy"""	176801	"""sphingolipid activator protein-1"""	SAP1, GLBA		2717620	Standard	NM_001042465		Approved		uc001jsm.3	P07602	OTTHUMG00000018429	ENST00000394936.3:c.199A>G	chr10.hg19:g.73591653T>C	ENSP00000378394:p.Lys67Glu	85.0	0.0		116.0	19.0	NM_001042466	P07292|P15793|P78538|P78541|P78546|P78547|P78558|Q53Y86|Q6IBQ6|Q92739|Q92740|Q92741|Q92742	Missense_Mutation	SNP	ENST00000394936.3	hg19	CCDS7311.1	.	.	.	.	.	.	.	.	.	.	T	18.51	3.639215	0.67244	.	.	ENSG00000197746	ENST00000394936;ENST00000373120;ENST00000357471;ENST00000394934;ENST00000394929;ENST00000404083	D;D	0.82803	-1.65;-1.65	5.2	4.05	0.47172	Saposin-like (2);Saposin-like type B, 1 (1);Saposin B (2);	0.044717	0.85682	D	0.000000	T	0.82107	0.4965	L	0.51914	1.62	0.58432	D	0.999999	P	0.36125	0.538	P	0.44811	0.461	T	0.78388	-0.2223	10	0.33940	T	0.23	-10.186	12.1935	0.54284	0.0:0.0:0.143:0.857	.	67	P07602	SAP_HUMAN	E	67;67;67;67;67;70	ENSP00000378394:K67E;ENSP00000378392:K67E	ENSP00000350063:K67E	K	-	1	0	PSAP	73261659	1.000000	0.71417	0.810000	0.32431	0.508000	0.34012	4.184000	0.58323	0.909000	0.36697	0.460000	0.39030	AAA	.	.		0.527	PSAP-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000048553.1	NM_002778	
SEC24C	9632	hgsc.bcm.edu	37	10	75525661	75525661	+	Silent	SNP	A	A	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr10:75525661A>T	ENST00000339365.2	+	11	1632	c.1470A>T	c.(1468-1470)gtA>gtT	p.V490V	SEC24C_ENST00000540668.1_Intron|SEC24C_ENST00000411652.2_Silent_p.V371V|SEC24C_ENST00000345254.4_Silent_p.V490V|SEC24C_ENST00000535742.1_Intron|SEC24C_ENST00000546025.1_Intron	NM_004922.3	NP_004913.2	P53992	SC24C_HUMAN	SEC24 family member C	490					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular protein metabolic process (GO:0044267)|COPII vesicle coating (GO:0048208)|ER to Golgi vesicle-mediated transport (GO:0006888)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|small molecule metabolic process (GO:0044281)	COPII vesicle coat (GO:0030127)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)	zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(3)|lung(12)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	32	Prostate(51;0.0112)					TGGCCACTGTAGATTACTGCA	0.502																																					p.V490V		Atlas-SNP	.											.	SEC24C	86	.	0			c.A1470T						.						160.0	147.0	151.0					10																	75525661		2203	4300	6503	SO:0001819	synonymous_variant	9632	exon10			CACTGTAGATTAC	D38555	CCDS7332.1	10q22	2013-10-21	2013-10-21		ENSG00000176986	ENSG00000176986			10705	protein-coding gene	gene with protein product		607185	"""SEC24 (S. cerevisiae) related gene family, member C"", ""SEC24 family, member C (S. cerevisiae)"""			10214955, 7584044	Standard	NM_004922		Approved	KIAA0079	uc001jux.3	P53992	OTTHUMG00000018476	ENST00000339365.2:c.1470A>T	chr10.hg19:g.75525661A>T		123.0	0.0		108.0	34.0	NM_198597	B4DZT4|Q8WV25	Silent	SNP	ENST00000339365.2	hg19	CCDS7332.1																																																																																			.	.		0.502	SEC24C-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048679.1		
SFTPA1	653509	hgsc.bcm.edu	37	10	81371581	81371581	+	De_novo_Start_InFrame	SNP	C	C	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr10:81371581C>A	ENST00000398636.3	+	0	138				SFTPA1_ENST00000372308.3_De_novo_Start_InFrame|SFTPA1_ENST00000419470.2_Silent_p.A15A|SFTPA1_ENST00000372313.5_Intron|SFTPA1_ENST00000428376.2_De_novo_Start_InFrame	NM_001164644.1|NM_001164646.1|NM_005411.4	NP_001158116.1|NP_001158118.1|NP_005402.3	Q8IWL2	SFTA1_HUMAN	surfactant protein A1						lipid transport (GO:0006869)|respiratory gaseous exchange (GO:0007585)	collagen trimer (GO:0005581)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	carbohydrate binding (GO:0030246)|lipid transporter activity (GO:0005319)			endometrium(1)|lung(8)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	12	all_cancers(46;0.197)|Breast(12;0.000326)|Prostate(51;0.00985)|all_epithelial(25;0.0149)		Epithelial(14;0.00957)|all cancers(16;0.0179)|Colorectal(32;0.229)			GACCCAGAGCCATGTGGCTGT	0.607																																					p.A15A		Atlas-SNP	.											.	SFTPA1	23	.	0			c.C45A						.						189.0	184.0	186.0					10																	81371581		2203	4296	6499			653509	exon3			CAGAGCCATGTGG	BC026229	CCDS44444.1, CCDS44445.1, CCDS44444.2	10q22.3	2012-11-02	2008-08-26			ENSG00000122852		"""Collectins"""	10798	protein-coding gene	gene with protein product	"""surfactant, pulmonary-associated protein A1A"""	178630	"""surfactant, pulmonary-associated protein A1"""	SFTP1			Standard	NM_001093770		Approved	SP-A, SP-A1, COLEC4	uc009xry.3	Q8IWL2			chr10.hg19:g.81371581C>A		332.0	1.0		421.0	152.0	NM_001093770	A8K3T8|B7ZW50|E3VLD8|E3VLD9|E3VLE0|E3VLE1|G5E9J3|P07714|Q14DV4|Q5RIR5|Q5RIR7|Q6PIT0|Q8TC19	Silent	SNP	ENST00000398636.3	hg19	CCDS44445.1																																																																																			.	.		0.607	SFTPA1-203	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_005411	
LDB3	11155	hgsc.bcm.edu	37	10	88441277	88441277	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr10:88441277C>A	ENST00000361373.4	+	4	427	c.406C>A	c.(406-408)Ccg>Acg	p.P136T	LDB3_ENST00000372056.4_Missense_Mutation_p.P136T|LDB3_ENST00000352360.5_Intron|LDB3_ENST00000458213.2_Intron|LDB3_ENST00000310944.6_Missense_Mutation_p.P136T|LDB3_ENST00000372066.3_Intron|LDB3_ENST00000263066.6_Intron|LDB3_ENST00000429277.2_Missense_Mutation_p.P136T|LDB3_ENST00000542786.1_Missense_Mutation_p.P136T	NM_007078.2	NP_009009.1			LIM domain binding 3											breast(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(9)|ovary(3)|prostate(1)|soft_tissue(1)	25						CCCAGGCACCCCGGAGCTCAG	0.736																																					p.P136T		Atlas-SNP	.											.	LDB3	164	.	0			c.C406A						.						33.0	33.0	33.0					10																	88441277		2200	4295	6495	SO:0001583	missense	11155	exon4			GGCACCCCGGAGC	AB014513	CCDS7377.1, CCDS41544.1, CCDS41545.1, CCDS53549.1, CCDS53550.1	10q22.3-q23.2	2014-09-17			ENSG00000122367	ENSG00000122367			15710	protein-coding gene	gene with protein product	"""cypher"", ""oracle"", ""Z-band alternatively spliced PDZ motif protein"""	605906	"""cardiomyopathy, dilated 1C (autosomal dominant)"""	CMD1C		10427098, 23271734, 23996002, 14662268	Standard	NM_001080114		Approved	PDLIM6, KIAA0613, ZASP	uc001kdv.3	O75112	OTTHUMG00000018655	ENST00000361373.4:c.406C>A	chr10.hg19:g.88441277C>A	ENSP00000355296:p.Pro136Thr	35.0	0.0		63.0	19.0	NM_007078		Missense_Mutation	SNP	ENST00000361373.4	hg19	CCDS7377.1	.	.	.	.	.	.	.	.	.	.	C	0.039	-1.292907	0.01375	.	.	ENSG00000122367	ENST00000539402;ENST00000429277;ENST00000372056;ENST00000310944;ENST00000361373;ENST00000542786	T;T;T;T;T	0.56611	0.78;0.93;1.04;0.45;1.0	4.82	1.84	0.25277	.	0.712444	0.10992	N	0.611475	T	0.35595	0.0937	L	0.27053	0.805	0.21802	N	0.999533	B;B;B;B;B	0.15719	0.0;0.003;0.007;0.0;0.014	B;B;B;B;B	0.16722	0.001;0.016;0.006;0.001;0.007	T	0.25676	-1.0125	10	0.41790	T	0.15	.	4.3292	0.11055	0.1384:0.6151:0.1144:0.132	.	136;136;136;136;136	B4E3K3;F5H0C2;O75112-4;O75112;O75112-5	.;.;.;LDB3_HUMAN;.	T	136	ENSP00000401437:P136T;ENSP00000361126:P136T;ENSP00000311913:P136T;ENSP00000355296:P136T;ENSP00000438866:P136T	ENSP00000311913:P136T	P	+	1	0	LDB3	88431257	1.000000	0.71417	0.202000	0.23494	0.035000	0.12851	1.071000	0.30666	0.156000	0.19299	-0.471000	0.05019	CCG	.	.		0.736	LDB3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000049160.2		
SUFU	51684	hgsc.bcm.edu	37	10	104268957	104268957	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr10:104268957A>T	ENST00000369902.3	+	2	380	c.214A>T	c.(214-216)Agc>Tgc	p.S72C	SUFU_ENST00000369899.2_Missense_Mutation_p.S72C|SUFU_ENST00000423559.2_Missense_Mutation_p.S72C	NM_016169.3	NP_057253.2	Q9UMX1	SUFU_HUMAN	suppressor of fused homolog (Drosophila)	72					cytoplasmic sequestering of transcription factor (GO:0042994)|heart looping (GO:0001947)|multicellular organismal development (GO:0007275)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000059)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:1901621)|negative regulation of transcription factor import into nucleus (GO:0042992)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|proteolysis (GO:0006508)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|skeletal system development (GO:0001501)|skin development (GO:0043588)|smoothened signaling pathway involved in spinal cord motor neuron cell fate specification (GO:0021776)|smoothened signaling pathway involved in ventral spinal cord interneuron specification (GO:0021775)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|primary cilium (GO:0072372)	protein kinase binding (GO:0019901)|signal transducer activity (GO:0004871)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)			breast(2)|central_nervous_system(7)|endometrium(4)|kidney(1)|large_intestine(3)|lung(4)|prostate(1)|skin(2)	24		Colorectal(252;0.207)		Epithelial(162;1.36e-08)|all cancers(201;3.81e-07)|BRCA - Breast invasive adenocarcinoma(275;0.242)		GGACTATGTTAGCATGTACAG	0.512			"""D, F, S"""		medulloblastoma	medulloblastoma			Medulloblastoma, associated with Germline SUFU Mutation																												p.S72C		Atlas-SNP	.	yes	Rec	yes	Medulloblastoma predisposition	10	10q24.32	51684	suppressor of fused homolog (Drosophila)		O	.	SUFU	44	.	0			c.A214T						.						158.0	137.0	145.0					10																	104268957		2203	4300	6503	SO:0001583	missense	51684	exon2	Familial Cancer Database		TATGTTAGCATGT	AF175770	CCDS7537.1, CCDS53571.1	10q24.32	2014-09-17			ENSG00000107882	ENSG00000107882			16466	protein-coding gene	gene with protein product		607035				15367681	Standard	NM_016169		Approved	SUFUH, SUFUXL, PRO1280	uc001kvy.2	Q9UMX1	OTTHUMG00000018966	ENST00000369902.3:c.214A>T	chr10.hg19:g.104268957A>T	ENSP00000358918:p.Ser72Cys	150.0	0.0		130.0	89.0	NM_001178133	Q7LCP7|Q9NT90|Q9NZ07|Q9UHK2|Q9UHM8|Q9UMY0	Missense_Mutation	SNP	ENST00000369902.3	hg19	CCDS7537.1	.	.	.	.	.	.	.	.	.	.	A	24.6	4.552887	0.86127	.	.	ENSG00000107882	ENST00000369902;ENST00000369899;ENST00000423559	D;D;D	0.83837	-1.77;-1.77;-1.77	5.44	5.44	0.79542	Suppressor of fused domain (1);	0.000000	0.85682	D	0.000000	D	0.93501	0.7926	H	0.94462	3.54	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.83275	0.993;0.988;0.996	D	0.95223	0.8335	10	0.87932	D	0	-23.4494	15.4866	0.75573	1.0:0.0:0.0:0.0	.	72;72;72	Q9UMX1;Q9UMX1-2;Q9UMX1-3	SUFU_HUMAN;.;.	C	72	ENSP00000358918:S72C;ENSP00000358915:S72C;ENSP00000411597:S72C	ENSP00000358915:S72C	S	+	1	0	SUFU	104258947	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	8.474000	0.90413	2.056000	0.61249	0.459000	0.35465	AGC	.	.		0.512	SUFU-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050089.1	NM_016169	
KCNK18	338567	hgsc.bcm.edu	37	10	118969679	118969679	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr10:118969679A>G	ENST00000334549.1	+	3	1024	c.1024A>G	c.(1024-1026)Att>Gtt	p.I342V		NM_181840.1	NP_862823.1	Q7Z418	KCNKI_HUMAN	potassium channel, subfamily K, member 18	342					cellular response to pH (GO:0071467)|potassium ion export (GO:0071435)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium-activated potassium channel activity (GO:0015269)|outward rectifier potassium channel activity (GO:0015271)|potassium channel activity (GO:0005267)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(24)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	41		Colorectal(252;0.19)		all cancers(201;0.0211)		GTTCTTCTCCATTTATATCAT	0.383																																					p.I342V		Atlas-SNP	.											.	KCNK18	70	.	0			c.A1024G						.						275.0	244.0	254.0					10																	118969679		2203	4300	6503	SO:0001583	missense	338567	exon3			TTCTCCATTTATA	AB087138	CCDS7598.1	10q26.11	2012-03-07			ENSG00000186795	ENSG00000186795		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	19439	protein-coding gene	gene with protein product	"""TWIK related spinal cord K+ channel"""	613655				16382106	Standard	NM_181840		Approved	K2p18.1, TRESK-2, TRESK2, TRESK, TRIK	uc010qsr.2	Q7Z418	OTTHUMG00000019120	ENST00000334549.1:c.1024A>G	chr10.hg19:g.118969679A>G	ENSP00000334650:p.Ile342Val	107.0	0.0		132.0	36.0	NM_181840	Q5SQQ8	Missense_Mutation	SNP	ENST00000334549.1	hg19	CCDS7598.1	.	.	.	.	.	.	.	.	.	.	A	11.64	1.697672	0.30142	.	.	ENSG00000186795	ENST00000334549	T	0.28255	1.62	5.4	-1.39	0.08997	Ion transport 2 (1);	0.566111	0.18791	N	0.131041	T	0.15132	0.0365	N	0.16602	0.42	0.19575	N	0.999968	B	0.17465	0.022	B	0.32149	0.141	T	0.37776	-0.9691	10	0.02654	T	1	.	8.7547	0.34639	0.2775:0.5242:0.1983:0.0	.	342	Q7Z418	KCNKI_HUMAN	V	342	ENSP00000334650:I342V	ENSP00000334650:I342V	I	+	1	0	KCNK18	118959669	0.558000	0.26554	0.174000	0.22961	0.995000	0.86356	0.342000	0.19926	-0.415000	0.07484	0.533000	0.62120	ATT	.	.		0.383	KCNK18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050562.2	NM_181840	
GPR123	84435	hgsc.bcm.edu	37	10	134910562	134910562	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr10:134910562C>A	ENST00000392607.3	+	3	524	c.88C>A	c.(88-90)Ctc>Atc	p.L30I	GPR123_ENST00000607359.1_Missense_Mutation_p.L750I	NM_001083909.1	NP_001077378.1	Q86SQ6	GP123_HUMAN	G protein-coupled receptor 123	30					G-protein coupled receptor signaling pathway (GO:0007186)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.L30F(1)|p.L750F(1)		endometrium(2)|kidney(2)|large_intestine(1)|lung(6)|prostate(3)	14		all_cancers(35;1.8e-10)|all_epithelial(44;8.95e-09)|Lung NSC(174;0.000845)|all_lung(145;0.00144)|all_neural(114;0.0299)|Colorectal(31;0.0585)|Melanoma(40;0.123)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;9.16e-06)|Epithelial(32;1.21e-05)|all cancers(32;1.63e-05)		CGTCATGCTGCTCTGCCTCCT	0.612																																					p.L30I		Atlas-SNP	.											GPR123,NS,carcinoma,0,1	GPR123	118	.	2	Substitution - Missense(2)	kidney(2)	c.C88A						.						151.0	116.0	128.0					10																	134910562		2203	4300	6503	SO:0001583	missense	84435	exon3			ATGCTGCTCTGCC	AB058731	CCDS41580.1	10q26	2014-08-08			ENSG00000197177	ENSG00000197177		"""-"", ""GPCR / Class B : Orphans"""	13838	protein-coding gene	gene with protein product		612302				12565841	Standard	XM_005252695		Approved	KIAA1828	uc001llw.3	Q86SQ6	OTTHUMG00000019304	ENST00000392607.3:c.88C>A	chr10.hg19:g.134910562C>A	ENSP00000376384:p.Leu30Ile	44.0	0.0		54.0	32.0	NM_001083909	A5HL16|A6NG50|Q5T234|Q86SN7|Q96JJ9	Missense_Mutation	SNP	ENST00000392607.3	hg19	CCDS41580.1	.	.	.	.	.	.	.	.	.	.	C	17.21	3.330859	0.60853	.	.	ENSG00000197177	ENST00000368577;ENST00000392609;ENST00000392607	T	0.38077	1.16	3.85	3.85	0.44370	GPCR, family 2-like (1);	0.330102	0.20831	N	0.084884	T	0.43322	0.1242	M	0.74881	2.28	0.80722	D	1	B;P	0.36633	0.242;0.562	B;B	0.44224	0.259;0.444	T	0.43893	-0.9363	10	0.52906	T	0.07	-21.8247	7.7121	0.28684	0.0:0.8809:0.0:0.1191	.	30;750	Q86SQ6;Q86SQ6-1	GP123_HUMAN;.	I	750;750;30	ENSP00000376384:L30I	ENSP00000357566:L750I	L	+	1	0	GPR123	134760552	1.000000	0.71417	0.994000	0.49952	0.894000	0.52154	2.077000	0.41557	1.892000	0.54788	0.436000	0.28706	CTC	.	.		0.612	GPR123-003	NOVEL	basic|appris_candidate|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000051113.2		
MUC6	4588	hgsc.bcm.edu	37	11	1031239	1031239	+	Nonsense_Mutation	SNP	G	G	C			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr11:1031239G>C	ENST00000421673.2	-	5	554	c.504C>G	c.(502-504)taC>taG	p.Y168*		NM_005961.2	NP_005952.2	Q6W4X9	MUC6_HUMAN	mucin 6, oligomeric mucus/gel-forming	168	VWFD 1. {ECO:0000255|PROSITE- ProRule:PRU00580}.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)	extracellular matrix structural constituent (GO:0005201)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(8)|kidney(10)|large_intestine(6)|lung(43)|ovary(4)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	80		all_cancers(49;3.3e-08)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		all cancers(45;1.24e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00031)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		TCTGACCCATGTACTTCCGCT	0.662																																					p.Y168X		Atlas-SNP	.											.	MUC6	408	.	0			c.C504G						.						17.0	16.0	16.0					11																	1031239		1823	4050	5873	SO:0001587	stop_gained	4588	exon5			ACCCATGTACTTC	U97698, AY312160	CCDS44513.1	11p15.5	2008-02-05	2006-03-14		ENSG00000184956	ENSG00000184956		"""Mucins"""	7517	protein-coding gene	gene with protein product		158374	"""mucin 6, gastric"""			7680650	Standard	NM_005961		Approved		uc001lsw.2	Q6W4X9	OTTHUMG00000165140	ENST00000421673.2:c.504C>G	chr11.hg19:g.1031239G>C	ENSP00000406861:p.Tyr168*	121.0	0.0		124.0	51.0	NM_005961	O15329|Q14394|Q2TUQ5|Q4L207|Q8N8I1|Q8NAK1	Nonsense_Mutation	SNP	ENST00000421673.2	hg19	CCDS44513.1	.	.	.	.	.	.	.	.	.	.	g	16.82	3.228453	0.58777	.	.	ENSG00000184956	ENST00000421673	.	.	.	3.66	3.66	0.41972	.	0.725673	0.10516	U	0.665538	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	11.7734	0.51972	0.0:0.1782:0.8218:0.0	.	.	.	.	X	168	.	ENSP00000406861:Y168X	Y	-	3	2	MUC6	1021239	1.000000	0.71417	0.983000	0.44433	0.256000	0.26092	2.098000	0.41757	1.778000	0.52293	0.197000	0.17608	TAC	.	.		0.662	MUC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382120.2	XM_290540	
MUC2	4583	hgsc.bcm.edu	37	11	1087958	1087958	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr11:1087958T>C	ENST00000441003.2	+	25	3460	c.3433T>C	c.(3433-3435)Tgc>Cgc	p.C1145R	MUC2_ENST00000359061.5_Missense_Mutation_p.C1145R	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	1145					cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)				NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	CTTCGAGACCTGCAGGACCAT	0.622																																					p.C1145R		Atlas-SNP	.											.	MUC2	614	.	0			c.T3433C						.						64.0	69.0	68.0					11																	1087958		2145	4251	6396	SO:0001583	missense	4583	exon25			GAGACCTGCAGGA	L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.3433T>C	chr11.hg19:g.1087958T>C	ENSP00000415183:p.Cys1145Arg	94.0	0.0		61.0	25.0	NM_002457	Q14878	Missense_Mutation	SNP	ENST00000441003.2	hg19		.	.	.	.	.	.	.	.	.	.	t	11.51	1.660052	0.29515	.	.	ENSG00000198788	ENST00000441003;ENST00000359061	D;D	0.92397	-3.03;-3.03	3.98	3.98	0.46160	.	0.158163	0.40818	N	0.001003	D	0.96334	0.8804	M	0.89715	3.055	0.80722	D	1	D	0.89917	1.0	D	0.77557	0.99	D	0.96973	0.9710	10	0.87932	D	0	.	13.0893	0.59158	0.0:0.0:0.0:1.0	.	1145	E7EUV1	.	R	1145	ENSP00000415183:C1145R;ENSP00000351956:C1145R	ENSP00000351956:C1145R	C	+	1	0	MUC2	1077958	1.000000	0.71417	0.091000	0.20842	0.339000	0.28857	5.925000	0.70062	1.688000	0.51068	0.450000	0.29827	TGC	.	.		0.622	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000345894.2	NM_002457	
KRTAP5-3	387266	hgsc.bcm.edu	37	11	1629498	1629498	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr11:1629498A>T	ENST00000399685.1	-	1	195	c.118T>A	c.(118-120)Tgc>Agc	p.C40S		NM_001012708.2	NP_001012726.1	Q6L8H2	KRA53_HUMAN	keratin associated protein 5-3	40	11 X 4 AA repeats of C-C-X-P.					keratin filament (GO:0045095)				endometrium(1)|large_intestine(2)|lung(3)|ovary(2)	8		all_epithelial(84;0.00018)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.000618)|Lung(200;0.0684)|LUSC - Lung squamous cell carcinoma(625;0.0822)		TTGCAGCAGCAGACAGGTACA	0.677																																					p.C40S		Atlas-SNP	.											.	KRTAP5-3	33	.	0			c.T118A						.						65.0	83.0	77.0					11																	1629498		2201	4298	6499	SO:0001583	missense	387266	exon1			AGCAGCAGACAGG	AB126072	CCDS41591.1	11p15.5	2008-02-05			ENSG00000196224	ENSG00000196224		"""Keratin associated proteins"""	23598	protein-coding gene	gene with protein product						15144888	Standard	NM_001012708		Approved	KRTAP5.3, KRTAP5-9	uc001ltw.1	Q6L8H2	OTTHUMG00000057559	ENST00000399685.1:c.118T>A	chr11.hg19:g.1629498A>T	ENSP00000382592:p.Cys40Ser	126.0	0.0		93.0	39.0	NM_001012708	Q6PL44|Q701N3	Missense_Mutation	SNP	ENST00000399685.1	hg19	CCDS41591.1	.	.	.	.	.	.	.	.	.	.	A	0.150	-1.092695	0.01858	.	.	ENSG00000196224	ENST00000399685	T	0.01113	5.32	2.19	2.19	0.27852	.	.	.	.	.	T	0.01454	0.0047	L	0.51853	1.615	0.22996	N	0.998458	P	0.34684	0.463	B	0.38683	0.279	T	0.43097	-0.9412	9	0.12430	T	0.62	.	6.3642	0.21445	1.0:0.0:0.0:0.0	.	40	Q6L8H2	KRA53_HUMAN	S	40	ENSP00000382592:C40S	ENSP00000382592:C40S	C	-	1	0	KRTAP5-3	1586074	0.011000	0.17503	0.985000	0.45067	0.092000	0.18411	-0.602000	0.05680	1.259000	0.44117	0.248000	0.18094	TGC	.	.		0.677	KRTAP5-3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000127924.1		
Unknown	0	hgsc.bcm.edu	37	11	5988980	5988980	+	IGR	SNP	T	T	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr11:5988980T>A								OR56A3 (19389 upstream) : OR52L1 (18141 downstream)																							AGGATGAGGATGAAGTGGGAA	0.468																																					p.I249F		Atlas-SNP	.											.	.	.	.	0			c.A745T						.						169.0	164.0	166.0					11																	5988980		692	1591	2283	SO:0001628	intergenic_variant	390084	exon1			TGAGGATGAAGTG																													chr11.hg19:g.5988980T>A		195.0	0.0		157.0	63.0	NM_001146033		Missense_Mutation	SNP		hg19																																																																																				.	.	0	0.468								
CCKBR	887	hgsc.bcm.edu	37	11	6292239	6292239	+	Splice_Site	SNP	A	A	G			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr11:6292239A>G	ENST00000334619.2	+	5	1004		c.e5-1		CCKBR_ENST00000525462.1_Silent_p.S339S|CCKBR_ENST00000532715.1_Splice_Site|CCKBR_ENST00000532396.1_Splice_Site	NM_176875.3	NP_795344.1	P32239	GASR_HUMAN	cholecystokinin B receptor						cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|cholecystokinin signaling pathway (GO:0038188)|digestion (GO:0007586)|digestive tract development (GO:0048565)|feeding behavior (GO:0007631)|gastric acid secretion (GO:0001696)|gland development (GO:0048732)|metabolic process (GO:0008152)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of phosphatidylinositol 3-kinase activity (GO:0043551)|sensory perception (GO:0007600)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase regulator activity (GO:0046935)|cholecystokinin receptor activity (GO:0004951)|gastrin receptor activity (GO:0015054)|phosphatidylinositol phospholipase C activity (GO:0004435)|type B gastrin/cholecystokinin receptor binding (GO:0031741)			NS(2)|breast(2)|endometrium(4)|kidney(13)|large_intestine(10)|lung(22)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	61		Medulloblastoma(188;0.00263)|all_neural(188;0.026)|Breast(177;0.029)		Epithelial(150;2.62e-08)|BRCA - Breast invasive adenocarcinoma(625;0.139)	Pentagastrin(DB00183)	CTTTGTGCTCAGGGGCTGTTC	0.642																																					.		Atlas-SNP	.											.	CCKBR	232	.	0			c.812-2A>G						.						40.0	42.0	42.0					11																	6292239		2201	4296	6497	SO:0001630	splice_region_variant	887	exon5			GTGCTCAGGGGCT	D13305	CCDS7761.1	11p15.4	2012-08-10			ENSG00000110148	ENSG00000110148		"""GPCR / Class A : Cholecystokinin receptors"""	1571	protein-coding gene	gene with protein product		118445				1280419	Standard	NM_176875		Approved		uc001mcp.3	P32239	OTTHUMG00000133380	ENST00000334619.2:c.812-1A>G	chr11.hg19:g.6292239A>G		50.0	0.0		40.0	25.0	NM_176875	A8K7P9|O75824|Q16144|Q92492|Q96LC6|Q9NYK7|Q9UBV1	Splice_Site	SNP	ENST00000334619.2	hg19	CCDS7761.1	.	.	.	.	.	.	.	.	.	.	A	0.329	-0.957110	0.02267	.	.	ENSG00000110148	ENST00000334619;ENST00000532715	.	.	.	4.69	3.58	0.41010	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	0.999998	.	.	.	.	.	.	.	.	.	.	.	.	.	.	6.426	0.21770	0.8932:0.0:0.1068:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	CCKBR	6248815	0.181000	0.23161	0.216000	0.23742	0.014000	0.08584	1.964000	0.40462	2.091000	0.63221	0.533000	0.62120	.	.	.		0.642	CCKBR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257230.2	NM_176875	Intron
OR2AG1	144125	hgsc.bcm.edu	37	11	6806883	6806883	+	Silent	SNP	C	C	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr11:6806883C>T	ENST00000307401.4	+	1	636	c.615C>T	c.(613-615)acC>acT	p.T205T		NM_001004489.2	NP_001004489.1	Q9H205	O2AG1_HUMAN	olfactory receptor, family 2, subfamily AG, member 1	205						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(2)|lung(13)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	26		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)		Epithelial(150;2.19e-08)|BRCA - Breast invasive adenocarcinoma(625;0.129)		TGGGTGTGACCTTCCTGATTC	0.488																																					p.T205T		Atlas-SNP	.											.	OR2AG1	57	.	0			c.C615T						.						243.0	204.0	217.0					11																	6806883		2201	4296	6497	SO:0001819	synonymous_variant	144125	exon1			TGTGACCTTCCTG	AB065823	CCDS31414.1	11p15.4	2012-08-09			ENSG00000170803	ENSG00000170803		"""GPCR / Class A : Olfactory receptors"""	15142	protein-coding gene	gene with protein product				OR2AG3			Standard	NM_001004489		Approved		uc001mer.2	Q9H205	OTTHUMG00000165735	ENST00000307401.4:c.615C>T	chr11.hg19:g.6806883C>T		83.0	0.0		104.0	43.0	NM_001004489	B9EKV7|Q6IFG7|Q96R26	Silent	SNP	ENST00000307401.4	hg19	CCDS31414.1																																																																																			.	.		0.488	OR2AG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385980.1	NM_001004489	
OR10A5	144124	hgsc.bcm.edu	37	11	6867208	6867208	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr11:6867208G>T	ENST00000299454.4	+	1	326	c.295G>T	c.(295-297)Gcc>Tcc	p.A99S	OR10A5_ENST00000379831.2_Missense_Mutation_p.A103S			Q9H207	O10A5_HUMAN	olfactory receptor, family 10, subfamily A, member 5	99					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|kidney(2)|large_intestine(1)|lung(12)|ovary(1)|skin(2)|urinary_tract(2)	21		Medulloblastoma(188;0.0523)|all_neural(188;0.236)		Epithelial(150;4.68e-08)|BRCA - Breast invasive adenocarcinoma(625;0.129)		CCTTGGCTGTGCCACTCAGAT	0.502																																					p.A99S	Pancreas(44;21 1072 25662 28041 45559)	Atlas-SNP	.											.	OR10A5	48	.	0			c.G295T						.						91.0	93.0	93.0					11																	6867208		2201	4296	6497	SO:0001583	missense	144124	exon1			GGCTGTGCCACTC	AF324499	CCDS7773.1	11p15.4	2012-08-09			ENSG00000166363	ENSG00000166363		"""GPCR / Class A : Olfactory receptors"""	15131	protein-coding gene	gene with protein product		608493		OR10A1			Standard	NM_178168		Approved	OR11-403, JCG6	uc001met.1	Q9H207	OTTHUMG00000165738	ENST00000299454.4:c.295G>T	chr11.hg19:g.6867208G>T	ENSP00000299454:p.Ala99Ser	237.0	0.0		222.0	92.0	NM_178168	O95223|Q52M66|Q96R21|Q96R22	Missense_Mutation	SNP	ENST00000299454.4	hg19	CCDS7773.1	.	.	.	.	.	.	.	.	.	.	.	15.71	2.914575	0.52546	.	.	ENSG00000166363	ENST00000299454;ENST00000379831	T;T	0.00402	7.56;7.56	3.42	3.42	0.39159	GPCR, rhodopsin-like superfamily (1);	0.215458	0.32640	N	0.005838	T	0.00666	0.0022	M	0.81942	2.565	0.29091	N	0.882099	P	0.48089	0.905	P	0.46975	0.533	T	0.31641	-0.9936	10	0.66056	D	0.02	.	13.1066	0.59252	0.0:0.0:1.0:0.0	.	99	Q9H207	O10A5_HUMAN	S	99;103	ENSP00000299454:A99S;ENSP00000369159:A103S	ENSP00000299454:A99S	A	+	1	0	OR10A5	6823784	0.506000	0.26139	1.000000	0.80357	0.989000	0.77384	1.120000	0.31271	2.176000	0.68965	0.591000	0.81541	GCC	.	.		0.502	OR10A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385983.1	NM_178168	
NLRP10	338322	hgsc.bcm.edu	37	11	7981937	7981937	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr11:7981937T>A	ENST00000328600.2	-	2	1383	c.1222A>T	c.(1222-1224)Agg>Tgg	p.R408W		NM_176821.3	NP_789791.1	Q86W26	NAL10_HUMAN	NLR family, pyrin domain containing 10	408	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.				defense response to fungus (GO:0050832)|defense response to Gram-negative bacterium (GO:0050829)|dendritic cell migration (GO:0036336)|helper T cell enhancement of adaptive immune response (GO:0035397)|innate immune response (GO:0045087)|positive regulation of interleukin-6 secretion (GO:2000778)|positive regulation of interleukin-8 secretion (GO:2000484)|positive regulation of T-helper 1 type immune response (GO:0002827)|positive regulation of T-helper 17 type immune response (GO:2000318)	cytoplasm (GO:0005737)|extrinsic component of plasma membrane (GO:0019897)	ATP binding (GO:0005524)			breast(1)|endometrium(2)|kidney(2)|large_intestine(8)|liver(1)|lung(28)|ovary(2)|pancreas(1)|prostate(2)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	58				Epithelial(150;1.47e-07)|BRCA - Breast invasive adenocarcinoma(625;0.189)		CTCAGGACCCTGTGCCGGGAA	0.532																																					p.R408W		Atlas-SNP	.											.	NLRP10	146	.	0			c.A1222T						.						49.0	49.0	49.0					11																	7981937		2201	4296	6497	SO:0001583	missense	338322	exon2			GGACCCTGTGCCG	AY154465	CCDS7784.1	11p15.4	2006-12-08	2006-12-08	2006-12-08		ENSG00000182261		"""Nucleotide-binding domain and leucine rich repeat containing"""	21464	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 10"""	609662	"""NACHT, leucine rich repeat and PYD containing 10"""	NALP10		12563287	Standard	NM_176821		Approved	NOD8, PAN5, Pynod, CLR11.1	uc001mfv.1	Q86W26		ENST00000328600.2:c.1222A>T	chr11.hg19:g.7981937T>A	ENSP00000327763:p.Arg408Trp	57.0	0.0		57.0	23.0	NM_176821	Q2M3C4|Q6JGT0	Missense_Mutation	SNP	ENST00000328600.2	hg19	CCDS7784.1	.	.	.	.	.	.	.	.	.	.	T	12.04	1.819281	0.32145	.	.	ENSG00000182261	ENST00000328600	D	0.88124	-2.34	4.93	1.09	0.20402	.	0.532689	0.15896	N	0.239292	D	0.86201	0.5876	L	0.40543	1.245	0.09310	N	0.999997	D	0.65815	0.995	P	0.61070	0.883	T	0.75028	-0.3462	10	0.66056	D	0.02	.	4.8344	0.13456	0.0:0.1011:0.3839:0.515	.	408	Q86W26	NAL10_HUMAN	W	408	ENSP00000327763:R408W	ENSP00000327763:R408W	R	-	1	2	NLRP10	7938513	0.201000	0.23410	0.269000	0.24586	0.031000	0.12232	0.564000	0.23563	0.825000	0.34637	-0.316000	0.08728	AGG	.	.		0.532	NLRP10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385705.1	NM_176821	
ZNF143	7702	hgsc.bcm.edu	37	11	9499989	9499989	+	Silent	SNP	A	A	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr11:9499989A>T	ENST00000396602.2	+	6	545	c.426A>T	c.(424-426)acA>acT	p.T142T	ZNF143_ENST00000299606.2_Silent_p.T114T|ZNF143_ENST00000396597.3_Silent_p.T111T|ZNF143_ENST00000530463.1_Silent_p.T141T|ZNF143_ENST00000396604.1_Silent_p.T141T	NM_001282656.1|NM_001282657.1|NM_003442.5	NP_001269585.1|NP_001269586.1|NP_003433.3	P52747	ZN143_HUMAN	zinc finger protein 143	142					gene expression (GO:0010467)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|transcription from RNA polymerase II promoter (GO:0006366)|transcription from RNA polymerase III promoter (GO:0006383)	nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|large_intestine(5)|lung(4)|skin(2)|upper_aerodigestive_tract(1)	13				all cancers(16;4.12e-09)|Epithelial(150;2.29e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0212)		ATGGTACCACAGCTTATATCC	0.478																																					p.T142T		Atlas-SNP	.											.	ZNF143	38	.	0			c.A426T						.						154.0	128.0	137.0					11																	9499989		2201	4294	6495	SO:0001819	synonymous_variant	7702	exon6			TACCACAGCTTAT	U09850	CCDS7799.2, CCDS60720.1, CCDS60721.1	11p15.4	2013-01-08	2006-06-13		ENSG00000166478	ENSG00000166478		"""Zinc fingers, C2H2-type"""	12928	protein-coding gene	gene with protein product		603433	"""zinc finger protein 143 (clone pHZ-1)"""				Standard	NM_003442		Approved	SBF, pHZ-1, STAF	uc001mhr.3	P52747	OTTHUMG00000149922	ENST00000396602.2:c.426A>T	chr11.hg19:g.9499989A>T		98.0	0.0		75.0	22.0	NM_003442	A8K518|B4DLY5|E7ER34|O75559|Q8WUK9	Silent	SNP	ENST00000396602.2	hg19	CCDS7799.2	.	.	.	.	.	.	.	.	.	.	A	11.66	1.703887	0.30232	.	.	ENSG00000166478	ENST00000526657	T	0.48522	0.81	5.04	-4.05	0.03998	.	.	.	.	.	T	0.47377	0.1442	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.57051	-0.7877	6	0.87932	D	0	.	6.18	0.20465	0.2293:0.0:0.4313:0.3394	.	.	.	.	L	141	ENSP00000435881:Q141L	ENSP00000435881:Q141L	Q	+	2	0	ZNF143	9456565	0.023000	0.18921	0.987000	0.45799	0.976000	0.68499	-0.726000	0.04936	-0.291000	0.09012	-0.468000	0.05107	CAG	.	.		0.478	ZNF143-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000313921.2	NM_003442	
ZDHHC13	54503	hgsc.bcm.edu	37	11	19170802	19170802	+	Missense_Mutation	SNP	A	A	C			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr11:19170802A>C	ENST00000446113.2	+	5	564	c.443A>C	c.(442-444)gAg>gCg	p.E148A	ZDHHC13_ENST00000399351.3_Missense_Mutation_p.E18A|ZDHHC13_ENST00000532812.1_3'UTR	NM_019028.2	NP_061901.2	Q8IUH4	ZDH13_HUMAN	zinc finger, DHHC-type containing 13	148					metabolic process (GO:0008152)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|signal transduction (GO:0007165)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi-associated vesicle membrane (GO:0030660)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)	magnesium ion transmembrane transporter activity (GO:0015095)|palmitoyltransferase activity (GO:0016409)|protein-cysteine S-palmitoyltransferase activity (GO:0019706)|signal transducer activity (GO:0004871)|zinc ion binding (GO:0008270)			NS(1)|kidney(1)|lung(2)|skin(1)|upper_aerodigestive_tract(1)	6						ATTGATGGAGAGGGATTCAGC	0.408																																					p.E148A		Atlas-SNP	.											.	ZDHHC13	40	.	0			c.A443C						.						93.0	82.0	85.0					11																	19170802		1893	4110	6003	SO:0001583	missense	54503	exon5			ATGGAGAGGGATT	AB024495	CCDS44550.1, CCDS44551.1	11p15.1	2013-01-10			ENSG00000177054	ENSG00000177054		"""Zinc fingers, DHHC-type"", ""Ankyrin repeat domain containing"""	18413	protein-coding gene	gene with protein product		612815				18794299	Standard	NM_001001483		Approved	FLJ10852, FLJ10941, HIP14L	uc001mpi.3	Q8IUH4	OTTHUMG00000166099	ENST00000446113.2:c.443A>C	chr11.hg19:g.19170802A>C	ENSP00000400113:p.Glu148Ala	135.0	0.0		134.0	51.0	NM_019028	Q7Z2D3|Q86VK2|Q9NV30|Q9NV99	Missense_Mutation	SNP	ENST00000446113.2	hg19	CCDS44550.1	.	.	.	.	.	.	.	.	.	.	A	26.9	4.785333	0.90282	.	.	ENSG00000177054	ENST00000446113;ENST00000399351	T;T	0.65732	-0.17;0.62	5.79	5.79	0.91817	Ankyrin repeat-containing domain (4);	0.000000	0.85682	D	0.000000	T	0.69620	0.3131	N	0.26092	0.79	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.73474	-0.3971	10	0.72032	D	0.01	-2.3789	15.7882	0.78326	1.0:0.0:0.0:0.0	.	148	Q8IUH4	ZDH13_HUMAN	A	148;18	ENSP00000400113:E148A;ENSP00000382288:E18A	ENSP00000382288:E18A	E	+	2	0	ZDHHC13	19127378	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.962000	0.93254	2.205000	0.71048	0.455000	0.32223	GAG	.	.		0.408	ZDHHC13-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387821.1	NM_019028	
SLC6A5	9152	hgsc.bcm.edu	37	11	20652295	20652295	+	Missense_Mutation	SNP	A	A	C			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr11:20652295A>C	ENST00000525748.1	+	10	1831	c.1558A>C	c.(1558-1560)Atc>Ctc	p.I520L	SLC6A5_ENST00000528440.1_3'UTR	NM_004211.3	NP_004202.2	Q9Y345	SC6A5_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 5	520					glycine import (GO:0036233)|synaptic transmission (GO:0007268)|synaptic transmission, glycinergic (GO:0060012)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	glycine:sodium symporter activity (GO:0015375)|neurotransmitter:sodium symporter activity (GO:0005328)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(34)|ovary(2)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	63					Glycine(DB00145)	CGGCTTCGTCATCTTCTCCGT	0.502																																					p.I520L		Atlas-SNP	.											.	SLC6A5	151	.	0			c.A1558C						.						201.0	169.0	180.0					11																	20652295		2203	4300	6503	SO:0001583	missense	9152	exon10			TTCGTCATCTTCT	AF085412	CCDS7854.1	11p15.1	2013-07-19	2013-07-19		ENSG00000165970	ENSG00000165970		"""Solute carriers"""	11051	protein-coding gene	gene with protein product	"""glycine transporter 2"""	604159	"""solute carrier family 6 (neurotransmitter transporter, glycine), member 5"""	NET1		9845349	Standard	NM_004211		Approved	GLYT2	uc001mqd.3	Q9Y345	OTTHUMG00000166024	ENST00000525748.1:c.1558A>C	chr11.hg19:g.20652295A>C	ENSP00000434364:p.Ile520Leu	151.0	0.0		134.0	52.0	NM_004211	O95288|Q4VAM7|Q9BX77	Missense_Mutation	SNP	ENST00000525748.1	hg19	CCDS7854.1	.	.	.	.	.	.	.	.	.	.	A	22.7	4.330292	0.81690	.	.	ENSG00000165970	ENST00000525748	T	0.78003	-1.14	5.57	5.57	0.84162	.	0.044671	0.85682	D	0.000000	D	0.90655	0.7069	M	0.93283	3.4	0.80722	D	1	D	0.71674	0.998	D	0.69479	0.964	D	0.93083	0.6493	10	0.87932	D	0	.	15.7239	0.77736	1.0:0.0:0.0:0.0	.	520	Q9Y345	SC6A5_HUMAN	L	520	ENSP00000434364:I520L	ENSP00000434364:I520L	I	+	1	0	SLC6A5	20608871	1.000000	0.71417	1.000000	0.80357	0.683000	0.39861	7.576000	0.82467	2.116000	0.64780	0.533000	0.62120	ATC	.	.		0.502	SLC6A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387497.2	NM_004211	
HIPK3	10114	hgsc.bcm.edu	37	11	33358716	33358716	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr11:33358716G>T	ENST00000303296.4	+	4	1622	c.1317G>T	c.(1315-1317)atG>atT	p.M439I	HIPK3_ENST00000379016.3_Missense_Mutation_p.M439I|HIPK3_ENST00000534262.1_3'UTR|HIPK3_ENST00000456517.1_Missense_Mutation_p.M439I|HIPK3_ENST00000525975.1_Missense_Mutation_p.M439I	NM_005734.3	NP_005725.3	Q9H422	HIPK3_HUMAN	homeodomain interacting protein kinase 3	439	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic process (GO:0006915)|mRNA transcription (GO:0009299)|negative regulation of apoptotic process (GO:0043066)|negative regulation of JUN kinase activity (GO:0043508)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|protein phosphorylation (GO:0006468)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|PML body (GO:0016605)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			endometrium(3)|kidney(3)|large_intestine(9)|liver(4)|lung(10)|ovary(2)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	39						AAACAGATATGTCTCATTCTG	0.328																																					p.M439I		Atlas-SNP	.											.	HIPK3	92	.	0			c.G1317T						.						57.0	58.0	58.0					11																	33358716		2201	4294	6495	SO:0001583	missense	10114	exon4			AGATATGTCTCAT	AF004849	CCDS7884.1, CCDS41634.1	11p13	2008-07-18	2001-11-29		ENSG00000110422	ENSG00000110422			4915	protein-coding gene	gene with protein product		604424	"""homeodomain-interacting protein kinase 3"""			9373137, 9748262	Standard	NM_005734		Approved	PKY, DYRK6, YAK1, FIST3	uc031pzm.1	Q9H422	OTTHUMG00000132269	ENST00000303296.4:c.1317G>T	chr11.hg19:g.33358716G>T	ENSP00000304226:p.Met439Ile	91.0	0.0		60.0	27.0	NM_001048200	O14632|Q2PBG4|Q2PBG5|Q92632|Q9HAS2	Missense_Mutation	SNP	ENST00000303296.4	hg19	CCDS7884.1	.	.	.	.	.	.	.	.	.	.	G	8.226	0.803583	0.16467	.	.	ENSG00000110422	ENST00000525975;ENST00000303296;ENST00000379016;ENST00000456517	T;T;T;T	0.19250	2.16;2.16;2.16;2.16	4.88	0.0826	0.14429	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.477607	0.19356	N	0.116264	T	0.06735	0.0172	N	0.04686	-0.185	0.28635	N	0.907454	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.21930	-1.0231	10	0.25106	T	0.35	.	0.2865	0.00252	0.3784:0.2143:0.1758:0.2316	.	439;439	Q9H422-2;Q9H422	.;HIPK3_HUMAN	I	439	ENSP00000431710:M439I;ENSP00000304226:M439I;ENSP00000368301:M439I;ENSP00000398241:M439I	ENSP00000304226:M439I	M	+	3	0	HIPK3	33315292	0.962000	0.33011	0.993000	0.49108	0.916000	0.54674	0.096000	0.15147	-0.163000	0.10946	0.563000	0.77884	ATG	.	.		0.328	HIPK3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000255358.1	NM_005734	
KIAA1549L	25758	hgsc.bcm.edu	37	11	33628353	33628353	+	Silent	SNP	A	A	T	rs557858789		TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr11:33628353A>T	ENST00000321505.4	+	13	4335	c.4155A>T	c.(4153-4155)gcA>gcT	p.A1385A	KIAA1549L_ENST00000389726.3_Silent_p.A1391A			Q6ZVL6	K154L_HUMAN	KIAA1549-like	1385						integral component of membrane (GO:0016021)											AGTCATCGGCAGTCCTCAACG	0.587																																					p.A1385A		Atlas-SNP	.											.	.	.	.	0			c.A4155T						.						22.0	24.0	23.0					11																	33628353		2040	4202	6242	SO:0001819	synonymous_variant	25758	exon13			ATCGGCAGTCCTC	U10991	CCDS44565.1, CCDS44565.2	11p13	2012-08-09	2012-08-09	2012-08-09	ENSG00000110427	ENSG00000110427			24836	protein-coding gene	gene with protein product		612297	"""chromosome 11 open reading frame 69"", ""chromosome 11 open reading frame 41"""	C11orf69, C11orf41			Standard	NM_012194		Approved	G2, MGC34830	uc021qfs.1	Q6ZVL6	OTTHUMG00000150410	ENST00000321505.4:c.4155A>T	chr11.hg19:g.33628353A>T		119.0	0.0		118.0	47.0	NM_012194	B0QYU0	Silent	SNP	ENST00000321505.4	hg19	CCDS44565.2	.	.	.	.	.	.	.	.	.	.	A	2.326	-0.354567	0.05138	.	.	ENSG00000110427	ENST00000526400	.	.	.	5.43	-10.9	0.00192	.	.	.	.	.	T	0.16041	0.0386	.	.	.	0.24382	N	0.994786	.	.	.	.	.	.	T	0.06162	-1.0842	4	.	.	.	-2.331	3.9237	0.09254	0.0963:0.3948:0.2214:0.2876	.	.	.	.	L	783	.	.	Q	+	2	0	C11orf41	33584929	0.000000	0.05858	0.000000	0.03702	0.210000	0.24377	-2.036000	0.01421	-3.562000	0.00141	-1.560000	0.00886	CAG	.	.		0.587	KIAA1549L-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000317998.1	NM_012194	
ELF5	2001	hgsc.bcm.edu	37	11	34515128	34515128	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr11:34515128T>A	ENST00000312319.2	-	3	512	c.283A>T	c.(283-285)Agt>Tgt	p.S95C	ELF5_ENST00000429939.2_Intron|ELF5_ENST00000532417.1_Missense_Mutation_p.S85C|ELF5_ENST00000528709.1_Intron|ELF5_ENST00000257832.2_Missense_Mutation_p.S85C	NM_001243081.1|NM_198381.1	NP_001230010.1|NP_938195.1	Q9UKW6	ELF5_HUMAN	E74-like factor 5 (ets domain transcription factor)	95	PNT. {ECO:0000255|PROSITE- ProRule:PRU00762}.				cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|ectoderm development (GO:0007398)|mammary gland epithelial cell differentiation (GO:0060644)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			large_intestine(4)|skin(1)	5		Acute lymphoblastic leukemia(5;0.0087)|all_hematologic(20;0.0384)				TGCAGGCCACTGATGTTGAAG	0.547											OREG0020879	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.S95C	Melanoma(61;202 1660 4348 21594)	Atlas-SNP	.											.	ELF5	21	.	0			c.A283T						.						88.0	73.0	78.0					11																	34515128		2202	4298	6500	SO:0001583	missense	2001	exon3			GGCCACTGATGTT	AF049703	CCDS7892.1, CCDS7893.1, CCDS58129.1, CCDS73273.1	11p13-p12	2008-05-14			ENSG00000135374	ENSG00000135374			3320	protein-coding gene	gene with protein product		605169				9840936	Standard	NM_001422		Approved		uc001mvp.2	Q9UKW6	OTTHUMG00000166451	ENST00000312319.2:c.283A>T	chr11.hg19:g.34515128T>A	ENSP00000311010:p.Ser95Cys	117.0	0.0	848	95.0	45.0	NM_198381	A6XAE6|A8K452|O95175|Q8N2K9|Q96QY3|Q9UKW5	Missense_Mutation	SNP	ENST00000312319.2	hg19	CCDS7892.1	.	.	.	.	.	.	.	.	.	.	T	20.7	4.027915	0.75390	.	.	ENSG00000135374	ENST00000257832;ENST00000312319;ENST00000532417	T;T;T	0.33438	1.41;1.41;1.41	4.66	4.66	0.58398	Sterile alpha motif/pointed domain (2);Pointed domain (3);	0.321577	0.30714	N	0.009030	T	0.40522	0.1120	L	0.50333	1.59	0.39319	D	0.965214	D;D	0.59357	0.985;0.975	P;P	0.55999	0.789;0.756	T	0.40001	-0.9586	10	0.87932	D	0	.	9.5285	0.39180	0.157:0.0:0.0:0.843	.	85;95	Q9UKW6-3;Q9UKW6	.;ELF5_HUMAN	C	85;95;85	ENSP00000257832:S85C;ENSP00000311010:S95C;ENSP00000436386:S85C	ENSP00000257832:S85C	S	-	1	0	ELF5	34471704	0.993000	0.37304	1.000000	0.80357	0.985000	0.73830	1.801000	0.38843	1.745000	0.51790	0.459000	0.35465	AGT	.	.		0.547	ELF5-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000389845.1	NM_198381	
OR8H2	390151	hgsc.bcm.edu	37	11	55873220	55873220	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr11:55873220G>T	ENST00000313503.1	+	1	702	c.702G>T	c.(700-702)aaG>aaT	p.K234N		NM_001005200.1	NP_001005200.1	Q8N162	OR8H2_HUMAN	olfactory receptor, family 8, subfamily H, member 2	234						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(38)|ovary(1)|skin(3)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	61	Esophageal squamous(21;0.00693)					CTTCAGGAAAGCAGAAAGCTT	0.373										HNSCC(53;0.14)																											p.K234N		Atlas-SNP	.											OR8H2,NS,carcinoma,0,1	OR8H2	117	.	0			c.G702T						.						113.0	110.0	111.0					11																	55873220		2201	4296	6497	SO:0001583	missense	390151	exon1			AGGAAAGCAGAAA	AB065657	CCDS31518.1	11q11	2012-08-09			ENSG00000181767	ENSG00000181767		"""GPCR / Class A : Olfactory receptors"""	15308	protein-coding gene	gene with protein product							Standard	NM_001005200		Approved		uc010riy.2	Q8N162	OTTHUMG00000166832	ENST00000313503.1:c.702G>T	chr11.hg19:g.55873220G>T	ENSP00000323982:p.Lys234Asn	157.0	1.0		182.0	73.0	NM_001005200	Q6IFC1	Missense_Mutation	SNP	ENST00000313503.1	hg19	CCDS31518.1	.	.	.	.	.	.	.	.	.	.	g	12.26	1.885103	0.33255	.	.	ENSG00000181767	ENST00000313503	T	0.00169	8.63	3.58	2.65	0.31530	GPCR, rhodopsin-like superfamily (1);	0.111644	0.40728	N	0.001028	T	0.00356	0.0011	M	0.87038	2.855	0.09310	N	1	P	0.44195	0.828	P	0.50934	0.654	T	0.21793	-1.0235	10	0.87932	D	0	.	5.4631	0.16627	0.1892:0.2773:0.5335:0.0	.	234	Q8N162	OR8H2_HUMAN	N	234	ENSP00000323982:K234N	ENSP00000323982:K234N	K	+	3	2	OR8H2	55629796	0.019000	0.18553	0.850000	0.33497	0.662000	0.39071	1.254000	0.32897	1.952000	0.56665	0.440000	0.28878	AAG	.	.		0.373	OR8H2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391540.1	NM_001005200	
OR8J3	81168	hgsc.bcm.edu	37	11	55904587	55904587	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr11:55904587G>T	ENST00000301529.1	-	1	607	c.608C>A	c.(607-609)gCa>gAa	p.A203E		NM_001004064.1	NP_001004064.1	Q8NGG0	OR8J3_HUMAN	olfactory receptor, family 8, subfamily J, member 3	203						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(1)|lung(38)|pancreas(1)|prostate(1)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)	59	Esophageal squamous(21;0.00693)					ATTTGTTGCTGCAGATATAAA	0.308																																					p.A203E		Atlas-SNP	.											.	OR8J3	112	.	0			c.C608A						.						105.0	108.0	107.0					11																	55904587		2201	4296	6497	SO:0001583	missense	81168	exon1			GTTGCTGCAGATA		CCDS31520.1	11q12.2	2012-08-09			ENSG00000167822	ENSG00000167822		"""GPCR / Class A : Olfactory receptors"""	15312	protein-coding gene	gene with protein product							Standard	NM_001004064		Approved		uc010riz.2	Q8NGG0	OTTHUMG00000166834	ENST00000301529.1:c.608C>A	chr11.hg19:g.55904587G>T	ENSP00000301529:p.Ala203Glu	53.0	0.0		76.0	33.0	NM_001004064	Q6IFB6|Q96RC2	Missense_Mutation	SNP	ENST00000301529.1	hg19	CCDS31520.1	.	.	.	.	.	.	.	.	.	.	G	11.05	1.524384	0.27299	.	.	ENSG00000167822	ENST00000301529	T	0.39229	1.09	3.27	2.31	0.28768	GPCR, rhodopsin-like superfamily (1);	0.430233	0.22264	N	0.062364	T	0.64616	0.2614	M	0.91818	3.245	0.09310	N	1	D	0.53619	0.961	P	0.59825	0.864	T	0.58177	-0.7682	10	0.87932	D	0	.	10.7899	0.46426	0.1057:0.0:0.8943:0.0	.	203	Q8NGG0	OR8J3_HUMAN	E	203	ENSP00000301529:A203E	ENSP00000301529:A203E	A	-	2	0	OR8J3	55661163	0.000000	0.05858	0.021000	0.16686	0.253000	0.25986	0.141000	0.16076	1.553000	0.49476	0.297000	0.19635	GCA	.	.		0.308	OR8J3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391542.1	NM_001004064	
OR8K1	390157	hgsc.bcm.edu	37	11	56113774	56113774	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr11:56113774T>A	ENST00000279783.2	+	1	354	c.260T>A	c.(259-261)aTg>aAg	p.M87K		NM_001002907.1	NP_001002907.1	Q8NGG5	OR8K1_HUMAN	olfactory receptor, family 8, subfamily K, member 1	87						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			large_intestine(8)|liver(2)|lung(13)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	33	Esophageal squamous(21;0.00448)					GCCCCGAAGATGTTAGTAAAC	0.393										HNSCC(65;0.19)																											p.M87K		Atlas-SNP	.											.	OR8K1	93	.	0			c.T260A						.						171.0	164.0	167.0					11																	56113774		2201	4296	6497	SO:0001583	missense	390157	exon1			CGAAGATGTTAGT	AB065835	CCDS31528.1	11q11	2012-08-09			ENSG00000150261	ENSG00000150261		"""GPCR / Class A : Olfactory receptors"""	14831	protein-coding gene	gene with protein product							Standard	NM_001002907		Approved		uc010rjg.2	Q8NGG5	OTTHUMG00000166858	ENST00000279783.2:c.260T>A	chr11.hg19:g.56113774T>A	ENSP00000279783:p.Met87Lys	145.0	0.0		149.0	53.0	NM_001002907	B9EJB1|Q6IFC3|Q96RC1	Missense_Mutation	SNP	ENST00000279783.2	hg19	CCDS31528.1	.	.	.	.	.	.	.	.	.	.	T	9.680	1.148943	0.21288	.	.	ENSG00000150261	ENST00000279783	T	0.06068	3.35	5.0	5.0	0.66597	GPCR, rhodopsin-like superfamily (1);	0.093959	0.46758	D	0.000278	T	0.14485	0.0350	M	0.90595	3.13	0.09310	N	0.999999	P	0.50710	0.938	B	0.41764	0.366	T	0.35276	-0.9795	10	0.87932	D	0	-19.0734	10.8159	0.46575	0.0:0.0773:0.0:0.9227	.	87	Q8NGG5	OR8K1_HUMAN	K	87	ENSP00000279783:M87K	ENSP00000279783:M87K	M	+	2	0	OR8K1	55870350	0.127000	0.22367	0.428000	0.26697	0.046000	0.14306	2.552000	0.45828	1.862000	0.54008	0.448000	0.29417	ATG	.	.		0.393	OR8K1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391605.1	NM_001002907	
RAB3IL1	5866	hgsc.bcm.edu	37	11	61675695	61675695	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr11:61675695T>C	ENST00000394836.2	-	2	252	c.95A>G	c.(94-96)cAc>cGc	p.H32R	RAB3IL1_ENST00000301773.5_Missense_Mutation_p.H79R	NM_013401.2	NP_037533.2	Q8TBN0	R3GEF_HUMAN	RAB3A interacting protein (rabin3)-like 1	32					positive regulation of Rab GTPase activity (GO:0032851)|protein transport (GO:0015031)		Rab guanyl-nucleotide exchange factor activity (GO:0017112)			central_nervous_system(1)|endometrium(2)|large_intestine(2)|liver(1)|lung(4)|skin(3)|urinary_tract(1)	14						GGACTCCCTGTGGCCTTGGCA	0.721																																					p.H79R		Atlas-SNP	.											.	RAB3IL1	39	.	0			c.A236G						.						6.0	7.0	7.0					11																	61675695		2159	4244	6403	SO:0001583	missense	5866	exon2			TCCCTGTGGCCTT	AF084557	CCDS8014.1, CCDS60809.1	11q12.2	2008-02-01			ENSG00000167994	ENSG00000167994			9780	protein-coding gene	gene with protein product							Standard	NM_013401		Approved		uc001nso.4	Q8TBN0	OTTHUMG00000167524	ENST00000394836.2:c.95A>G	chr11.hg19:g.61675695T>C	ENSP00000378313:p.His32Arg	47.0	0.0		19.0	14.0	NM_001271686	Q86V32|Q9P1Q8	Missense_Mutation	SNP	ENST00000394836.2	hg19	CCDS8014.1	.	.	.	.	.	.	.	.	.	.	T	4.930	0.172721	0.09391	.	.	ENSG00000167994	ENST00000394836;ENST00000301773;ENST00000531922	T;T;T	0.42900	1.58;1.52;0.96	4.87	-6.26	0.02033	.	1.632430	0.02955	N	0.142221	T	0.23532	0.0569	N	0.14661	0.345	0.09310	N	1	B;B	0.11235	0.004;0.0	B;B	0.10450	0.005;0.0	T	0.15607	-1.0431	10	0.19590	T	0.45	-15.0784	9.0866	0.36586	0.1117:0.1832:0.0:0.7051	.	79;32	Q8TBN0-2;Q8TBN0	.;R3GEF_HUMAN	R	32;79;79	ENSP00000378313:H32R;ENSP00000301773:H79R;ENSP00000435444:H79R	ENSP00000301773:H79R	H	-	2	0	RAB3IL1	61432271	0.000000	0.05858	0.008000	0.14137	0.629000	0.37895	-1.854000	0.01664	-1.506000	0.01805	-0.441000	0.05720	CAC	.	.		0.721	RAB3IL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394917.1	NM_013401	
SLC22A24	283238	hgsc.bcm.edu	37	11	62886696	62886696	+	Silent	SNP	T	T	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr11:62886696T>A	ENST00000417740.1	-	3	1059	c.618A>T	c.(616-618)gcA>gcT	p.A206A	SLC22A24_ENST00000326192.5_Silent_p.A206A	NM_001136506.2	NP_001129978.2	Q8N4F4	S22AO_HUMAN	solute carrier family 22, member 24	206					ion transport (GO:0006811)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)				kidney(1)|stomach(1)	2						TGGAGAACCCTGCCAAGAAGC	0.423																																					p.A206A		Atlas-SNP	.											.	SLC22A24	31	.	0			c.A618T						.						131.0	115.0	120.0					11																	62886696		692	1591	2283	SO:0001819	synonymous_variant	283238	exon3			GAACCCTGCCAAG		CCDS73308.1	11q12.3	2013-05-22			ENSG00000197658	ENSG00000197658		"""Solute carriers"""	28542	protein-coding gene	gene with protein product		611698				17714910	Standard	NM_001136506		Approved	MGC34821, NET46	uc021qkp.1	Q8N4F4	OTTHUMG00000165372	ENST00000417740.1:c.618A>T	chr11.hg19:g.62886696T>A		205.0	0.0		213.0	76.0	NM_001136506		Silent	SNP	ENST00000417740.1	hg19																																																																																				.	.		0.423	SLC22A24-003	PUTATIVE	non_canonical_polymorphism|basic|appris_principal|exp_conf	protein_coding	protein_coding	OTTHUMT00000383747.1	NM_173586	
PYGM	5837	hgsc.bcm.edu	37	11	64527129	64527129	+	Splice_Site	SNP	T	T	C			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr11:64527129T>C	ENST00000164139.3	-	1	640	c.242A>G	c.(241-243)aAg>aGg	p.K81R	PYGM_ENST00000377432.3_Splice_Site_p.K81R	NM_005609.2	NP_005600.1	P11217	PYGM_HUMAN	phosphorylase, glycogen, muscle	81					carbohydrate metabolic process (GO:0005975)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|glycogen metabolic process (GO:0005977)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	glycogen phosphorylase activity (GO:0008184)|nucleotide binding (GO:0000166)|pyridoxal phosphate binding (GO:0030170)			cervix(1)|endometrium(2)|kidney(3)|large_intestine(4)|lung(21)|ovary(3)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	38						CAGCAGCACCTTGGGGTCCTT	0.627																																					p.K81R		Atlas-SNP	.											.	PYGM	77	.	0			c.A242G						.						81.0	92.0	88.0					11																	64527129		2201	4297	6498	SO:0001630	splice_region_variant	5837	exon1			AGCACCTTGGGGT		CCDS8079.1, CCDS53659.1	11q12-q13.2	2013-03-01	2008-07-31		ENSG00000068976	ENSG00000068976	2.4.1.1	"""Glycogen phosphorylases"""	9726	protein-coding gene	gene with protein product	"""McArdle syndrome"", ""glycogen storage disease type V"", ""glycogen phosphorylase, muscle form"""	608455	"""phosphorylase, glycogen; muscle"""				Standard	NM_005609		Approved		uc001oax.4	P11217	OTTHUMG00000066835	ENST00000164139.3:c.243+1A>G	chr11.hg19:g.64527129T>C		51.0	0.0		26.0	20.0	NM_001164716	A0AVK1|A6NDY6	Missense_Mutation	SNP	ENST00000164139.3	hg19	CCDS8079.1	.	.	.	.	.	.	.	.	.	.	T	22.2	4.264669	0.80358	.	.	ENSG00000068976	ENST00000377432;ENST00000164139;ENST00000540450	D;D	0.92752	-3.1;-2.15	5.42	5.42	0.78866	.	0.071781	0.56097	D	0.000040	D	0.92364	0.7577	M	0.77820	2.39	0.80722	D	1	B;B	0.30179	0.079;0.271	B;B	0.37091	0.232;0.241	D	0.90777	0.4676	10	0.37606	T	0.19	-38.0183	13.41	0.60938	0.0:0.0:0.0:1.0	.	81;81	A6NDY6;P11217	.;PYGM_HUMAN	R	81	ENSP00000366650:K81R;ENSP00000164139:K81R	ENSP00000164139:K81R	K	-	2	0	PYGM	64283705	1.000000	0.71417	1.000000	0.80357	0.929000	0.56500	7.781000	0.85668	2.069000	0.61940	0.533000	0.62120	AAG	.	.		0.627	PYGM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000143254.2	NM_005609	Missense_Mutation
MEN1	4221	hgsc.bcm.edu	37	11	64575092	64575092	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr11:64575092T>C	ENST00000337652.1	-	4	1233	c.730A>G	c.(730-732)Atg>Gtg	p.M244V	MEN1_ENST00000315422.4_Missense_Mutation_p.M239V|MEN1_ENST00000377313.1_Missense_Mutation_p.M244V|MEN1_ENST00000394376.1_Missense_Mutation_p.M244V|MEN1_ENST00000478548.1_5'Flank|MEN1_ENST00000377321.1_Missense_Mutation_p.M204V|MEN1_ENST00000377316.2_Missense_Mutation_p.M239V|MEN1_ENST00000394374.2_Missense_Mutation_p.M244V|MEN1_ENST00000312049.6_Missense_Mutation_p.M239V|MEN1_ENST00000377326.3_Missense_Mutation_p.M239V|MEN1_ENST00000443283.1_Missense_Mutation_p.M244V	NM_130803.2	NP_570715	O00255	MEN1_HUMAN	multiple endocrine neoplasia I	244	Interaction with FANCD2.				brain development (GO:0007420)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|chromatin remodeling (GO:0006338)|DNA repair (GO:0006281)|embryonic skeletal system morphogenesis (GO:0048704)|gene expression (GO:0010467)|hemopoiesis (GO:0030097)|histone lysine methylation (GO:0034968)|leukocyte homeostasis (GO:0001776)|MAPK cascade (GO:0000165)|maternal process involved in female pregnancy (GO:0060135)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of JNK cascade (GO:0046329)|negative regulation of organ growth (GO:0046621)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of telomerase activity (GO:0051974)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|osteoblast development (GO:0002076)|osteoblast fate commitment (GO:0002051)|palate development (GO:0060021)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell division (GO:0051781)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of histone methylation (GO:0031062)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of protein binding (GO:0032092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|regulation of activin receptor signaling pathway (GO:0032925)|response to gamma radiation (GO:0010332)|response to UV (GO:0009411)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	chromatin (GO:0000785)|cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|histone methyltransferase complex (GO:0035097)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|four-way junction DNA binding (GO:0000400)|protein binding, bridging (GO:0030674)|protein N-terminus binding (GO:0047485)|R-SMAD binding (GO:0070412)|sequence-specific DNA binding (GO:0043565)|transcription regulatory region DNA binding (GO:0044212)|Y-form DNA binding (GO:0000403)			NS(7)|adrenal_gland(5)|breast(2)|central_nervous_system(5)|endometrium(1)|gastrointestinal_tract_(site_indeterminate)(15)|large_intestine(2)|lung(21)|ovary(1)|pancreas(64)|parathyroid(181)|pituitary(7)|prostate(4)|retroperitoneum(1)|skin(1)|small_intestine(13)|soft_tissue(4)|stomach(1)|thymus(2)	337						GCACACACCATGAACGCCACC	0.572			"""D, Mis, N, F, S"""		"""parathyroid tumors, Pancreatic neuroendocrine tumors"""	"""parathyroid adenoma, pituitary adenoma, pancreatic islet cell, carcinoid"""			Multiple Endocrine Neoplasia, type 1;Hyperparathyroidism, Familial Isolated																												p.M244V	Esophageal Squamous(1;83 158 15500 18603 18803 29295)	Atlas-SNP	.	yes	Rec	yes	Multiple Endocrine Neoplasia Type 1	11	11q13	4221	multiple endocrine neoplasia type 1 gene		E	.	MEN1	442	.	0			c.A730G						.						134.0	115.0	122.0					11																	64575092		2201	4297	6498	SO:0001583	missense	4221	exon4	Familial Cancer Database	MEN1, Wermer disease;FIHP, FIHPT, HRPT1, Familial Isolated Primary Hyperparathyroidism	ACACCATGAACGC	U93236	CCDS8083.1, CCDS31600.1	11q13	2014-09-17			ENSG00000133895	ENSG00000133895			7010	protein-coding gene	gene with protein product	"""menin"""	613733					Standard	NM_130799		Approved		uc001obn.3	O00255	OTTHUMG00000045366	ENST00000337652.1:c.730A>G	chr11.hg19:g.64575092T>C	ENSP00000337088:p.Met244Val	99.0	0.0		42.0	31.0	NM_130800	A5HBC6|A5HBC7|A5HBC8|A5HBC9|A5HBD0|A5HBD1|A5HBD2|O00632|Q9BUF0|Q9BUK2	Missense_Mutation	SNP	ENST00000337652.1	hg19	CCDS8083.1	.	.	.	.	.	.	.	.	.	.	T	17.00	3.277464	0.59758	.	.	ENSG00000133895	ENST00000377316;ENST00000377321;ENST00000377326;ENST00000312049;ENST00000315422;ENST00000337652;ENST00000394376;ENST00000394374;ENST00000443283;ENST00000377313;ENST00000440873;ENST00000450708;ENST00000413626	D;D;D;D;D;D;D;D;D;D;D;D;D	0.99292	-5.7;-5.7;-5.7;-5.7;-5.7;-5.7;-5.7;-5.7;-5.7;-5.7;-5.7;-5.7;-5.7	4.8	4.8	0.61643	.	0.000000	0.85682	D	0.000000	D	0.98817	0.9601	L	0.47716	1.5	0.58432	D	0.999999	B;P;B	0.43578	0.291;0.811;0.339	B;P;B	0.57846	0.064;0.828;0.105	D	0.99353	1.0915	10	0.66056	D	0.02	-40.1896	12.62	0.56597	0.0:0.0:0.0:1.0	.	239;204;244	O00255-2;O00255-3;O00255	.;.;MEN1_HUMAN	V	239;204;239;239;239;244;244;244;244;244;239;239;239	ENSP00000366533:M239V;ENSP00000366538:M204V;ENSP00000366543:M239V;ENSP00000308975:M239V;ENSP00000323747:M239V;ENSP00000337088:M244V;ENSP00000377901:M244V;ENSP00000377899:M244V;ENSP00000396940:M244V;ENSP00000366530:M244V;ENSP00000413944:M239V;ENSP00000394933:M239V;ENSP00000411218:M239V	ENSP00000308975:M239V	M	-	1	0	MEN1	64331668	1.000000	0.71417	0.969000	0.41365	0.941000	0.58515	6.984000	0.76186	1.934000	0.56057	0.379000	0.24179	ATG	.	.		0.572	MEN1-201	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000143881.1		
KLC2	64837	hgsc.bcm.edu	37	11	66029592	66029592	+	Splice_Site	SNP	A	A	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr11:66029592A>T	ENST00000417856.1	+	4	702		c.e4-1		KLC2_ENST00000421552.1_Splice_Site|KLC2_ENST00000394067.2_Splice_Site|KLC2_ENST00000394066.2_Splice_Site|KLC2_ENST00000394078.1_Splice_Site|KLC2_ENST00000394065.2_Splice_Site|KLC2_ENST00000316924.5_Splice_Site|RP11-867G23.1_ENST00000530805.1_RNA|RP11-755F10.3_ENST00000533576.1_RNA	NM_001134775.1	NP_001128247.1	Q9H0B6	KLC2_HUMAN	kinesin light chain 2						antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|axon cargo transport (GO:0008088)|blood coagulation (GO:0007596)|microtubule-based movement (GO:0007018)	ciliary rootlet (GO:0035253)|cytosol (GO:0005829)|kinesin complex (GO:0005871)|kinesin I complex (GO:0016938)|membrane (GO:0016020)|microtubule (GO:0005874)|neuron projection (GO:0043005)|protein complex (GO:0043234)	kinesin binding (GO:0019894)|microtubule motor activity (GO:0003777)			breast(2)|endometrium(1)|kidney(1)|large_intestine(7)|lung(3)|prostate(5)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	24						CTTCCTTCCCAGGAGGAGAAG	0.627																																					.		Atlas-SNP	.											.	KLC2	50	.	0			c.460-2A>T						.						84.0	69.0	74.0					11																	66029592		2200	4295	6495	SO:0001630	splice_region_variant	64837	exon4			CTTCCCAGGAGGA	AK022449	CCDS8130.1, CCDS44653.1	11q13.1	2013-01-10			ENSG00000174996	ENSG00000174996		"""Tetratricopeptide (TTC) repeat domain containing"""	20716	protein-coding gene	gene with protein product		611729				9624122	Standard	NM_022822		Approved	FLJ12387	uc001ohb.2	Q9H0B6	OTTHUMG00000133757	ENST00000417856.1:c.460-1A>T	chr11.hg19:g.66029592A>T		115.0	0.0		109.0	45.0	NM_001134775	A8MXL7|B2RDY4|Q9H9C8|Q9HA20	Splice_Site	SNP	ENST00000417856.1	hg19	CCDS8130.1	.	.	.	.	.	.	.	.	.	.	A	15.40	2.823039	0.50739	.	.	ENSG00000174996	ENST00000417856;ENST00000440228;ENST00000394067;ENST00000316924;ENST00000421552;ENST00000394078;ENST00000461611;ENST00000475757;ENST00000394066;ENST00000394065	.	.	.	4.04	4.04	0.47022	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.1024	0.53792	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	KLC2	65786168	1.000000	0.71417	0.960000	0.40013	0.609000	0.37215	6.812000	0.75226	1.691000	0.51100	0.459000	0.35465	.	.	.		0.627	KLC2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258200.1	NM_022822	Intron
ADRBK1	156	hgsc.bcm.edu	37	11	67047308	67047308	+	Splice_Site	SNP	A	A	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr11:67047308A>T	ENST00000308595.5	+	6	731		c.e6-1		ADRBK1_ENST00000526285.1_Splice_Site	NM_001619.3	NP_001610.2	P25098	ARBK1_HUMAN	adrenergic, beta, receptor kinase 1						activation of phospholipase C activity (GO:0007202)|cardiac muscle contraction (GO:0060048)|desensitization of G-protein coupled receptor protein signaling pathway (GO:0002029)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|heart development (GO:0007507)|innate immune response (GO:0045087)|negative regulation of striated muscle contraction (GO:0045988)|negative regulation of the force of heart contraction by chemical signal (GO:0003108)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of catecholamine secretion (GO:0033605)|receptor internalization (GO:0031623)|signal transduction (GO:0007165)|tachykinin receptor signaling pathway (GO:0007217)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|plasma membrane (GO:0005886)	alpha-2A adrenergic receptor binding (GO:0031694)|ATP binding (GO:0005524)|beta-adrenergic receptor kinase activity (GO:0047696)|Edg-2 lysophosphatidic acid receptor binding (GO:0031755)|G-protein coupled receptor kinase activity (GO:0004703)|protein kinase activity (GO:0004672)			cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(2)|liver(2)|lung(8)|prostate(2)	22			BRCA - Breast invasive adenocarcinoma(15;2.26e-06)		Adenosine triphosphate(DB00171)	TTCCTCCCTTAGCCATACATC	0.582																																					.		Atlas-SNP	.											.	ADRBK1	51	.	0			c.442-2A>T						.						85.0	87.0	86.0					11																	67047308		2200	4295	6495	SO:0001630	splice_region_variant	156	exon6			TCCCTTAGCCATA	X61157	CCDS8156.1	11q13	2013-01-10			ENSG00000173020	ENSG00000173020		"""Pleckstrin homology (PH) domain containing"""	289	protein-coding gene	gene with protein product		109635				2037065	Standard	NM_001619		Approved	GRK2, BARK1	uc009yrn.1	P25098	OTTHUMG00000167104	ENST00000308595.5:c.442-1A>T	chr11.hg19:g.67047308A>T		94.0	0.0		176.0	80.0	NM_001619	B0ZBE1|Q13837|Q6GTT3	Splice_Site	SNP	ENST00000308595.5	hg19	CCDS8156.1	.	.	.	.	.	.	.	.	.	.	A	20.2	3.947167	0.73672	.	.	ENSG00000173020	ENST00000308595;ENST00000526285	.	.	.	5.13	5.13	0.70059	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.2535	0.73568	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ADRBK1	66803884	0.998000	0.40836	0.968000	0.41197	0.842000	0.47809	4.034000	0.57289	2.073000	0.62155	0.482000	0.46254	.	.	.		0.582	ADRBK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393153.1	NM_001619	Intron
P2RY6	5031	hgsc.bcm.edu	37	11	73007940	73007940	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr11:73007940T>A	ENST00000393590.2	+	2	676	c.377T>A	c.(376-378)cTg>cAg	p.L126Q	P2RY6_ENST00000349767.2_Missense_Mutation_p.L126Q|P2RY6_ENST00000542092.1_Missense_Mutation_p.L126Q|P2RY6_ENST00000540124.1_Missense_Mutation_p.L126Q|P2RY6_ENST00000393592.2_Missense_Mutation_p.L126Q|P2RY6_ENST00000540342.1_Missense_Mutation_p.L126Q|P2RY6_ENST00000393591.1_Missense_Mutation_p.L126Q|P2RY6_ENST00000538328.1_Missense_Mutation_p.L126Q	NM_001277207.1|NM_001277208.1	NP_001264136.1|NP_001264137.1	Q15077	P2RY6_HUMAN	pyrimidinergic receptor P2Y, G-protein coupled, 6	126					phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled purinergic nucleotide receptor activity (GO:0045028)|G-protein coupled receptor activity (GO:0004930)			endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|ovary(1)|prostate(2)|skin(2)	14						CAGCGCTACCTGGGCATCTGC	0.662																																					p.L126Q		Atlas-SNP	.											.	P2RY6	45	.	0			c.T377A						.						68.0	67.0	68.0					11																	73007940		2200	4293	6493	SO:0001583	missense	5031	exon4			GCTACCTGGGCAT		CCDS8220.1	11q13.5	2012-08-08				ENSG00000171631		"""Purinergic receptors"", ""GPCR / Class A : Purinergic receptors, P2Y"""	8543	protein-coding gene	gene with protein product		602451				8670200	Standard	NM_176797		Approved	P2Y6	uc001otr.4	Q15077		ENST00000393590.2:c.377T>A	chr11.hg19:g.73007940T>A	ENSP00000377215:p.Leu126Gln	25.0	0.0		38.0	8.0	NM_176796	Q15754	Missense_Mutation	SNP	ENST00000393590.2	hg19	CCDS8220.1	.	.	.	.	.	.	.	.	.	.	T	22.7	4.325702	0.81580	.	.	ENSG00000171631	ENST00000540342;ENST00000542092;ENST00000349767;ENST00000393592;ENST00000544437;ENST00000393591;ENST00000540124;ENST00000393590;ENST00000535931;ENST00000538328	T;T;T;T;T;T;T;T;T;T	0.47177	0.85;0.85;0.85;0.85;0.85;0.85;0.85;0.85;0.85;0.85	4.18	4.18	0.49190	GPCR, rhodopsin-like superfamily (1);	0.185989	0.42682	D	0.000675	T	0.66107	0.2756	M	0.79258	2.445	0.41722	D	0.989516	D	0.64830	0.994	D	0.64410	0.925	T	0.72214	-0.4358	10	0.87932	D	0	.	12.8465	0.57833	0.0:0.0:0.0:1.0	.	126	Q15077	P2RY6_HUMAN	Q	126	ENSP00000443427:L126Q;ENSP00000445652:L126Q;ENSP00000309771:L126Q;ENSP00000377217:L126Q;ENSP00000441079:L126Q;ENSP00000377216:L126Q;ENSP00000442551:L126Q;ENSP00000377215:L126Q;ENSP00000440770:L126Q;ENSP00000442990:L126Q	ENSP00000309771:L126Q	L	+	2	0	P2RY6	72685588	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.984000	0.70548	1.865000	0.54081	0.402000	0.26972	CTG	.	.		0.662	P2RY6-007	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397349.1		
PRKRIR	5612	hgsc.bcm.edu	37	11	76063253	76063253	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr11:76063253A>T	ENST00000260045.3	-	5	1046	c.941T>A	c.(940-942)aTa>aAa	p.I314K	PRKRIR_ENST00000531878.1_5'Flank	NM_004705.2	NP_004696.2	O43422	P52K_HUMAN	protein-kinase, interferon-inducible double stranded RNA dependent inhibitor, repressor of (P58 repressor)	314					negative regulation of cell proliferation (GO:0008285)|response to stress (GO:0006950)|signal transduction (GO:0007165)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			cervix(1)|endometrium(3)|large_intestine(4)|lung(12)|ovary(2)|pancreas(1)|prostate(1)|skin(1)	25						CTTCTCAGTTATCATAGTGTG	0.383																																					p.I314K		Atlas-SNP	.											.	PRKRIR	65	.	0			c.T941A						.						47.0	49.0	48.0					11																	76063253		2187	4275	6462	SO:0001583	missense	5612	exon5			TCAGTTATCATAG	AF007393	CCDS8243.1	11q13.5	2013-01-25			ENSG00000137492	ENSG00000137492		"""THAP (C2CH-type zinc finger) domain containing"""	9440	protein-coding gene	gene with protein product	"""THAP domain containing 12"""	607374				9447982	Standard	NM_004705		Approved	P52rIPK, DAP4, THAP12	uc001oxh.1	O43422	OTTHUMG00000165280	ENST00000260045.3:c.941T>A	chr11.hg19:g.76063253A>T	ENSP00000260045:p.Ile314Lys	401.0	1.0		387.0	135.0	NM_004705	A8K728|Q17RY9|Q8WTW1|Q9Y3Z4	Missense_Mutation	SNP	ENST00000260045.3	hg19	CCDS8243.1	.	.	.	.	.	.	.	.	.	.	A	16.33	3.094067	0.56075	.	.	ENSG00000137492	ENST00000529901;ENST00000260045	T;T	0.26518	1.73;1.73	4.99	4.99	0.66335	Ribonuclease H-like (1);	0.144523	0.64402	D	0.000006	T	0.24044	0.0582	L	0.43152	1.355	0.80722	D	1	B	0.31153	0.31	B	0.29942	0.109	T	0.03354	-1.1045	10	0.36615	T	0.2	.	15.1171	0.72410	1.0:0.0:0.0:0.0	.	314	O43422	P52K_HUMAN	K	139;314	ENSP00000436249:I139K;ENSP00000260045:I314K	ENSP00000260045:I314K	I	-	2	0	PRKRIR	75740901	1.000000	0.71417	0.983000	0.44433	0.923000	0.55619	8.521000	0.90569	2.043000	0.60533	0.524000	0.50904	ATA	.	.		0.383	PRKRIR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383188.1	NM_004705	
THRSP	7069	hgsc.bcm.edu	37	11	77775013	77775013	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr11:77775013A>G	ENST00000281030.2	+	1	107	c.86A>G	c.(85-87)cAg>cGg	p.Q29R	NDUFC2-KCTD14_ENST00000528251.1_Intron|NDUFC2-KCTD14_ENST00000530054.1_Intron	NM_003251.3	NP_003242.1	Q92748	THRSP_HUMAN	thyroid hormone responsive	29					lipid metabolic process (GO:0006629)|regulation of lipid biosynthetic process (GO:0046890)|regulation of transcription, DNA-templated (GO:0006355)|regulation of triglyceride biosynthetic process (GO:0010866)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|nucleus (GO:0005634)				breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(2)	7	all_cancers(14;2.23e-19)|all_epithelial(13;7.49e-22)|Breast(9;6.38e-17)|Ovarian(111;0.152)		OV - Ovarian serous cystadenocarcinoma(8;2.15e-25)			AACATGGAGCAGGTGGTGATG	0.607																																					p.Q29R		Atlas-SNP	.											.	THRSP	18	.	0			c.A86G						.						98.0	85.0	90.0					11																	77775013		2200	4292	6492	SO:0001583	missense	7069	exon1			TGGAGCAGGTGGT	Y08409	CCDS8256.1	11q14.1	2012-06-19	2010-06-25		ENSG00000151365	ENSG00000151365			11800	protein-coding gene	gene with protein product	"""SPOT14 homolog (rat)"""	601926	"""thyroid hormone responsive SPOT14 (rat) homolog"", ""lipogenic protein 1"""	LPGP1		9003802	Standard	NM_003251		Approved	SPOT14, Lpgp, S14, THRP	uc001oyx.3	Q92748	OTTHUMG00000166632	ENST00000281030.2:c.86A>G	chr11.hg19:g.77775013A>G	ENSP00000281030:p.Gln29Arg	63.0	0.0		70.0	32.0	NM_003251	B2R4W7	Missense_Mutation	SNP	ENST00000281030.2	hg19	CCDS8256.1	.	.	.	.	.	.	.	.	.	.	A	21.9	4.214524	0.79352	.	.	ENSG00000151365	ENST00000281030	.	.	.	5.21	5.21	0.72293	.	0.591520	0.16932	N	0.193637	T	0.79275	0.4418	.	.	.	0.40981	D	0.984774	D	0.89917	1.0	D	0.77557	0.99	T	0.81831	-0.0752	8	0.87932	D	0	-15.4818	14.1992	0.65690	1.0:0.0:0.0:0.0	.	29	Q92748	THRSP_HUMAN	R	29	.	ENSP00000281030:Q29R	Q	+	2	0	THRSP	77452661	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.945000	0.63568	2.199000	0.70637	0.459000	0.35465	CAG	.	.		0.607	THRSP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390939.1	NM_003251	
GRM5	2915	hgsc.bcm.edu	37	11	88338049	88338049	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr11:88338049G>T	ENST00000305447.4	-	4	1380	c.1231C>A	c.(1231-1233)Ctc>Atc	p.L411I	GRM5_ENST00000455756.2_Missense_Mutation_p.L411I|GRM5_ENST00000305432.5_Missense_Mutation_p.L411I|GRM5_ENST00000418177.2_Missense_Mutation_p.L411I|GRM5_ENST00000393297.1_Missense_Mutation_p.L411I	NM_001143831.2	NP_001137303.1	P41594	GRM5_HUMAN	glutamate receptor, metabotropic 5	411					activation of MAPKKK activity (GO:0000185)|cognition (GO:0050890)|desensitization of G-protein coupled receptor protein signaling pathway (GO:0002029)|G-protein coupled glutamate receptor signaling pathway (GO:0007216)|learning (GO:0007612)|locomotory behavior (GO:0007626)|negative regulation of locomotion (GO:0040013)|phospholipase C-activating G-protein coupled glutamate receptor signaling pathway (GO:0007206)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|protein phosphorylation (GO:0006468)|regulation of synaptic transmission, glutamatergic (GO:0051966)|regulation of transcription, DNA-templated (GO:0006355)|synaptic transmission (GO:0007268)	astrocyte projection (GO:0097449)|cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|dendritic spine (GO:0043197)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)			NS(1)|breast(5)|central_nervous_system(4)|endometrium(5)|kidney(3)|large_intestine(18)|lung(40)|ovary(3)|pancreas(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	90		Acute lymphoblastic leukemia(157;2.54e-05)|all_hematologic(158;0.00834)			Acamprosate(DB00659)|Rufinamide(DB06201)	ATGTTGTGGAGCCCATAGGCC	0.463																																					p.L411I		Atlas-SNP	.											.	GRM5	414	.	0			c.C1231A						.						97.0	84.0	88.0					11																	88338049		2201	4299	6500	SO:0001583	missense	2915	exon5			TGTGGAGCCCATA	D28538	CCDS8283.1, CCDS44694.1	11q14.3	2014-06-12			ENSG00000168959	ENSG00000168959		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4597	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 86"""	604102				7908515	Standard	NM_001143831		Approved	MGLUR5, GPRC1E, mGlu5, PPP1R86	uc001pcq.3	P41594	OTTHUMG00000134306	ENST00000305447.4:c.1231C>A	chr11.hg19:g.88338049G>T	ENSP00000306138:p.Leu411Ile	140.0	0.0		117.0	52.0	NM_000842	Q6J164	Missense_Mutation	SNP	ENST00000305447.4	hg19	CCDS44694.1	.	.	.	.	.	.	.	.	.	.	G	22.5	4.303319	0.81136	.	.	ENSG00000168959	ENST00000418177;ENST00000455756;ENST00000305432;ENST00000305447;ENST00000393297	D;D;D;D;D	0.88509	-2.39;-2.39;-2.39;-2.39;-2.39	5.89	4.98	0.66077	Extracellular ligand-binding receptor (1);	0.000000	0.85682	D	0.000000	D	0.94006	0.8080	M	0.78285	2.405	0.58432	D	0.99999	D;D	0.69078	0.996;0.997	D;D	0.87578	0.998;0.997	D	0.94006	0.7280	9	.	.	.	.	14.7898	0.69830	0.0689:0.0:0.9311:0.0	.	411;411	P41594-2;P41594	.;GRM5_HUMAN	I	411	ENSP00000402912:L411I;ENSP00000405690:L411I;ENSP00000305905:L411I;ENSP00000306138:L411I;ENSP00000376975:L411I	.	L	-	1	0	GRM5	87977697	1.000000	0.71417	0.631000	0.29282	0.990000	0.78478	4.875000	0.63072	1.497000	0.48584	0.544000	0.68410	CTC	.	.		0.463	GRM5-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000259226.1	NM_000842	
TYR	7299	hgsc.bcm.edu	37	11	88911129	88911129	+	Missense_Mutation	SNP	T	T	A	rs375229194		TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr11:88911129T>A	ENST00000263321.5	+	1	510	c.8T>A	c.(7-9)cTg>cAg	p.L3Q	TYR_ENST00000526139.1_3'UTR	NM_000372.4	NP_000363.1	P14679	TYRO_HUMAN	tyrosinase	3					cell proliferation (GO:0008283)|eye pigment biosynthetic process (GO:0006726)|melanin biosynthetic process from tyrosine (GO:0006583)|thymus development (GO:0048538)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|Golgi-associated vesicle (GO:0005798)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|melanosome (GO:0042470)|perinuclear region of cytoplasm (GO:0048471)	copper ion binding (GO:0005507)|monophenol monooxygenase activity (GO:0004503)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(25)|ovary(2)|pancreas(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	48		Acute lymphoblastic leukemia(157;2.33e-05)|all_hematologic(158;0.0033)			Azelaic Acid(DB00548)|Mimosine(DB01055)|Monobenzone(DB00600)	AGAATGCTCCTGGCTGTTTTG	0.488																																					p.L3Q		Atlas-SNP	.											.	TYR	130	.	0			c.T8A						.						92.0	91.0	92.0					11																	88911129		2201	4299	6500	SO:0001583	missense	7299	exon1			TGCTCCTGGCTGT	M27160	CCDS8284.1	11q14.3	2013-09-27	2012-09-28		ENSG00000077498	ENSG00000077498	1.14.18.1		12442	protein-coding gene	gene with protein product	"""oculocutaneous albinism IA"""	606933					Standard	NM_000372		Approved	OCAIA, OCA1A, OCA1	uc001pcs.3	P14679	OTTHUMG00000167294	ENST00000263321.5:c.8T>A	chr11.hg19:g.88911129T>A	ENSP00000263321:p.Leu3Gln	103.0	0.0		57.0	28.0	NM_000372	Q15675|Q15676|Q15680|Q8TAK4|Q9BYY0|Q9BZX1	Missense_Mutation	SNP	ENST00000263321.5	hg19	CCDS8284.1	.	.	.	.	.	.	.	.	.	.	T	13.65	2.299275	0.40694	.	.	ENSG00000077498	ENST00000263321	D	0.99329	-5.75	6.07	3.78	0.43462	.	0.222277	0.39274	N	0.001404	D	0.98582	0.9526	L	0.60455	1.87	0.09310	N	1	P	0.52170	0.951	P	0.54706	0.759	D	0.95751	0.8792	9	.	.	.	.	8.2322	0.31605	0.0:0.2143:0.0:0.7857	.	3	P14679	TYRO_HUMAN	Q	3	ENSP00000263321:L3Q	.	L	+	2	0	TYR	88550777	0.922000	0.31269	0.013000	0.15412	0.645000	0.38454	1.761000	0.38440	0.541000	0.28827	0.533000	0.62120	CTG	.	.		0.488	TYR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394045.2	NM_000372	
FAT3	120114	hgsc.bcm.edu	37	11	92498202	92498202	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr11:92498202T>C	ENST00000298047.6	+	5	4159	c.4142T>C	c.(4141-4143)gTa>gCa	p.V1381A	RP11-203F8.1_ENST00000529884.1_RNA|FAT3_ENST00000409404.2_Missense_Mutation_p.V1381A|FAT3_ENST00000525166.1_Missense_Mutation_p.V1231A			Q8TDW7	FAT3_HUMAN	FAT atypical cadherin 3	1381	Cadherin 13. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(10)|kidney(4)|large_intestine(11)|liver(2)|lung(37)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	85		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				ACTGAAATTGTAGGGGTGGTG	0.433										TCGA Ovarian(4;0.039)																											p.V1381A		Atlas-SNP	.											.	FAT3	1822	.	0			c.T4142C						.						105.0	106.0	106.0					11																	92498202		1922	4111	6033	SO:0001583	missense	120114	exon5			AAATTGTAGGGGT	AB076400		11q14.3	2013-05-31	2013-05-31		ENSG00000165323	ENSG00000165323		"""Cadherins / Cadherin-related"""	23112	protein-coding gene	gene with protein product	"""cadherin-related family member 10"""	612483	"""FAT tumor suppressor homolog 3 (Drosophila)"""			11811999	Standard	NM_001008781		Approved	KIAA1989, CDHF15, CDHR10	uc001pdj.4	Q8TDW7	OTTHUMG00000154468	ENST00000298047.6:c.4142T>C	chr11.hg19:g.92498202T>C	ENSP00000298047:p.Val1381Ala	143.0	0.0		115.0	46.0	NM_001008781	B5MDB0|Q96AU6	Missense_Mutation	SNP	ENST00000298047.6	hg19		.	.	.	.	.	.	.	.	.	.	T	22.0	4.223651	0.79576	.	.	ENSG00000165323	ENST00000298047;ENST00000409404;ENST00000525166	T;T;T	0.65916	-0.18;-0.18;-0.18	5.97	5.97	0.96955	.	.	.	.	.	T	0.76601	0.4010	M	0.89785	3.06	0.80722	D	1	P	0.46859	0.885	P	0.48524	0.58	T	0.82301	-0.0525	9	0.87932	D	0	.	16.4608	0.84044	0.0:0.0:0.0:1.0	.	1381	Q8TDW7-3	.	A	1381;1381;1231	ENSP00000298047:V1381A;ENSP00000387040:V1381A;ENSP00000432586:V1231A	ENSP00000298047:V1381A	V	+	2	0	FAT3	92137850	1.000000	0.71417	0.995000	0.50966	0.995000	0.86356	7.633000	0.83260	2.288000	0.76882	0.533000	0.62120	GTA	.	.		0.433	FAT3-201	KNOWN	basic	protein_coding	protein_coding		NM_001008781	
TRPC6	7225	hgsc.bcm.edu	37	11	101375282	101375282	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr11:101375282C>A	ENST00000344327.3	-	2	842	c.418G>T	c.(418-420)Gca>Tca	p.A140S	TRPC6_ENST00000532133.1_Missense_Mutation_p.A140S|TRPC6_ENST00000348423.4_Missense_Mutation_p.A140S|TRPC6_ENST00000526713.1_5'Flank|TRPC6_ENST00000360497.4_Missense_Mutation_p.A140S	NM_004621.5	NP_004612.2	Q9Y210	TRPC6_HUMAN	transient receptor potential cation channel, subfamily C, member 6	140					aging (GO:0007568)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|cation transport (GO:0006812)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to hypoxia (GO:0071456)|ion transmembrane transport (GO:0034220)|platelet activation (GO:0030168)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of ion transmembrane transporter activity (GO:0032414)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|slit diaphragm (GO:0036057)	inositol 1,4,5 trisphosphate binding (GO:0070679)|store-operated calcium channel activity (GO:0015279)			autonomic_ganglia(1)|breast(3)|central_nervous_system(2)|endometrium(3)|kidney(3)|large_intestine(14)|lung(17)|ovary(2)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	55		Acute lymphoblastic leukemia(157;0.000918)|all_hematologic(158;0.0162)		BRCA - Breast invasive adenocarcinoma(274;0.0442)		TTGGCCACTGCCAACTGTAGG	0.438																																					p.A140S	Colon(166;1315 1927 11094 12848 34731)	Atlas-SNP	.											.	TRPC6	132	.	0			c.G418T						.						103.0	89.0	94.0					11																	101375282		2203	4299	6502	SO:0001583	missense	7225	exon2			CCACTGCCAACTG	AJ006276	CCDS8311.1	11q22.1	2014-02-04				ENSG00000137672		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	12338	protein-coding gene	gene with protein product		603652	"""focal segmental glomerulosclerosis 2"""	FSGS2		9925922, 16382100, 15879175	Standard	NM_004621		Approved	TRP6	uc001pgk.4	Q9Y210		ENST00000344327.3:c.418G>T	chr11.hg19:g.101375282C>A	ENSP00000340913:p.Ala140Ser	120.0	0.0		97.0	40.0	NM_004621	Q52M59|Q9HCW3|Q9NQA8|Q9NQA9	Missense_Mutation	SNP	ENST00000344327.3	hg19	CCDS8311.1	.	.	.	.	.	.	.	.	.	.	C	31	5.087510	0.94100	.	.	ENSG00000137672	ENST00000344327;ENST00000532133;ENST00000348423;ENST00000360497	T;T;T;T	0.80824	-1.42;-1.42;-1.42;-1.42	5.96	5.96	0.96718	Ankyrin repeat-containing domain (4);	0.000000	0.85682	D	0.000000	D	0.91287	0.7253	M	0.85630	2.765	0.80722	D	1	D;D;D	0.89917	1.0;0.998;1.0	D;D;D	0.91635	0.999;0.998;0.999	D	0.90630	0.4566	10	0.51188	T	0.08	-16.3923	20.422	0.99049	0.0:1.0:0.0:0.0	.	140;140;140	Q9Y210-3;Q9Y210-2;Q9Y210	.;.;TRPC6_HUMAN	S	140	ENSP00000340913:A140S;ENSP00000435574:A140S;ENSP00000343672:A140S;ENSP00000353687:A140S	ENSP00000340913:A140S	A	-	1	0	TRPC6	100880492	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	7.818000	0.86416	2.832000	0.97577	0.655000	0.94253	GCA	.	.		0.438	TRPC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394770.1	NM_004621	
DYNC2H1	79659	hgsc.bcm.edu	37	11	103026215	103026215	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr11:103026215A>T	ENST00000375735.2	+	25	3873	c.3729A>T	c.(3727-3729)aaA>aaT	p.K1243N	DYNC2H1_ENST00000398093.3_Missense_Mutation_p.K1243N|DYNC2H1_ENST00000334267.7_Intron	NM_001080463.1|NM_001377.2	NP_001073932.1|NP_001368.2	Q8NCM8	DYHC2_HUMAN	dynein, cytoplasmic 2, heavy chain 1	1243	Stem. {ECO:0000250}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|asymmetric protein localization (GO:0008105)|cilium assembly (GO:0042384)|determination of left/right symmetry (GO:0007368)|dorsal/ventral pattern formation (GO:0009953)|embryonic limb morphogenesis (GO:0030326)|forebrain development (GO:0030900)|Golgi organization (GO:0007030)|intraciliary retrograde transport (GO:0035721)|positive regulation of smoothened signaling pathway (GO:0045880)|protein processing (GO:0016485)|spinal cord motor neuron differentiation (GO:0021522)	apical part of cell (GO:0045177)|axoneme (GO:0005930)|cytosol (GO:0005829)|dynein complex (GO:0030286)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|motile primary cilium (GO:0031512)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			NS(1)|endometrium(4)|kidney(5)|large_intestine(9)|lung(9)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)	33		Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.00348)		BRCA - Breast invasive adenocarcinoma(274;0.000177)|Epithelial(105;0.0785)		TTGTAGCCAAAGCTGCCGACC	0.358																																					p.K1243N		Atlas-SNP	.											.	DYNC2H1	246	.	0			c.A3729T						.						57.0	56.0	56.0					11																	103026215		1815	4075	5890	SO:0001583	missense	79659	exon25			AGCCAAAGCTGCC	AB082528	CCDS44717.1, CCDS53701.1	11q21-q22.1	2011-06-02	2005-11-24	2005-11-24	ENSG00000187240	ENSG00000187240		"""Cytoplasmic dyneins"""	2962	protein-coding gene	gene with protein product		603297	"""dynein, cytoplasmic, heavy polypeptide 2"""	DNCH2		9763680, 9373155	Standard	NM_001080463		Approved	hdhc11, DHC2, DHC1b, DYH1B	uc001phn.1	Q8NCM8	OTTHUMG00000165941	ENST00000375735.2:c.3729A>T	chr11.hg19:g.103026215A>T	ENSP00000364887:p.Lys1243Asn	139.0	0.0		125.0	49.0	NM_001377	O00432|Q16693|Q3C1U8|Q4AC93|Q6ZMX7|Q6ZUM6|Q7Z363|Q8N977|Q92815|Q9HAE4	Missense_Mutation	SNP	ENST00000375735.2	hg19	CCDS53701.1	.	.	.	.	.	.	.	.	.	.	A	10.43	1.348687	0.24426	.	.	ENSG00000187240	ENST00000375735;ENST00000398093	T;T	0.60672	0.17;0.17	5.48	5.48	0.80851	Dynein heavy chain, domain-2 (1);	0.182320	0.26275	U	0.025310	T	0.36386	0.0965	N	0.11000	0.08	0.40058	D	0.975862	B;B	0.16802	0.004;0.019	B;B	0.24155	0.04;0.051	T	0.27640	-1.0068	10	0.19147	T	0.46	.	10.0007	0.41927	0.9246:0.0:0.0754:0.0	.	1243;1243	Q8NCM8;Q8NCM8-2	DYHC2_HUMAN;.	N	1243	ENSP00000364887:K1243N;ENSP00000381167:K1243N	ENSP00000364887:K1243N	K	+	3	2	DYNC2H1	102531425	1.000000	0.71417	1.000000	0.80357	0.425000	0.31504	1.484000	0.35508	2.084000	0.62774	0.528000	0.53228	AAA	.	.		0.358	DYNC2H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387196.1	XM_370652	
ELMOD1	55531	hgsc.bcm.edu	37	11	107526788	107526788	+	Silent	SNP	A	A	G			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr11:107526788A>G	ENST00000265840.7	+	11	1093	c.828A>G	c.(826-828)acA>acG	p.T276T	ELMOD1_ENST00000531234.1_Silent_p.T270T|ELMOD1_ENST00000443271.2_Silent_p.T268T	NM_018712.3	NP_061182.3	Q8N336	ELMD1_HUMAN	ELMO/CED-12 domain containing 1	276	ELMO. {ECO:0000255|PROSITE- ProRule:PRU00664}.				phagocytosis (GO:0006909)|positive regulation of GTPase activity (GO:0043547)	cytoskeleton (GO:0005856)	GTPase activator activity (GO:0005096)			endometrium(2)|large_intestine(5)|liver(2)|lung(7)|pancreas(2)|prostate(1)	19		Melanoma(852;0.000288)|Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.00301)|all_epithelial(67;0.00304)|Breast(348;0.104)		BRCA - Breast invasive adenocarcinoma(274;3.4e-05)|Epithelial(105;0.00027)|all cancers(92;0.00481)		TTCAGCAAACATTCTGTAAGT	0.458																																					p.T276T		Atlas-SNP	.											.	ELMOD1	40	.	0			c.A828G						.						75.0	68.0	70.0					11																	107526788		1849	4051	5900	SO:0001819	synonymous_variant	55531	exon11			GCAAACATTCTGT	AL359601	CCDS44723.1, CCDS44724.1	11q23.1	2012-10-15	2006-01-20		ENSG00000110675	ENSG00000110675			25334	protein-coding gene	gene with protein product		615456	"""ELMO domain containing 1"""			12477932	Standard	NM_018712		Approved	DKFZp547C176	uc010rvs.2	Q8N336	OTTHUMG00000166361	ENST00000265840.7:c.828A>G	chr11.hg19:g.107526788A>G		84.0	0.0		59.0	30.0	NM_018712	B4E167|G5E9S5|Q9NPW3	Silent	SNP	ENST00000265840.7	hg19	CCDS44723.1																																																																																			.	.		0.458	ELMOD1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000389406.1	NM_018712	
DDX10	1662	hgsc.bcm.edu	37	11	108709284	108709284	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr11:108709284G>A	ENST00000322536.3	+	14	2206	c.2077G>A	c.(2077-2079)Gaa>Aaa	p.E693K	DDX10_ENST00000526794.1_Missense_Mutation_p.E693K	NM_004398.2	NP_004389.2	Q13206	DDX10_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 10	693					metabolic process (GO:0008152)		ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)|RNA helicase activity (GO:0003724)			breast(2)|endometrium(5)|kidney(2)|large_intestine(4)|lung(11)|pancreas(1)|prostate(2)	27		all_cancers(61;1.29e-11)|all_epithelial(67;2.96e-07)|Melanoma(852;1.54e-05)|Acute lymphoblastic leukemia(157;4.24e-05)|all_hematologic(158;0.000141)|Breast(348;0.026)|all_neural(223;0.0729)		BRCA - Breast invasive adenocarcinoma(274;2.48e-05)|Epithelial(105;4.35e-05)|all cancers(92;0.000609)|OV - Ovarian serous cystadenocarcinoma(223;0.133)		ATTTACTGATGAAGGGGAGGT	0.328			T	NUP98	AML*																																p.E693K		Atlas-SNP	.		Dom	yes		11	11q22-q23	1662	DEAD (Asp-Glu-Ala-Asp) box polypeptide 10		L	.	DDX10	70	.	0			c.G2077A						.						105.0	118.0	113.0					11																	108709284		2201	4297	6498	SO:0001583	missense	1662	exon14			ACTGATGAAGGGG	U28042	CCDS8342.1	11q22-q23	2005-10-11	2003-06-13		ENSG00000178105	ENSG00000178105		"""DEAD-boxes"""	2735	protein-coding gene	gene with protein product		601235	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 10 (RNA helicase)"""			8660968	Standard	NM_004398		Approved	HRH-J8	uc001pkm.3	Q13206	OTTHUMG00000166540	ENST00000322536.3:c.2077G>A	chr11.hg19:g.108709284G>A	ENSP00000314348:p.Glu693Lys	236.0	0.0		186.0	62.0	NM_004398	B2RCQ3|Q5BJD8	Missense_Mutation	SNP	ENST00000322536.3	hg19	CCDS8342.1	.	.	.	.	.	.	.	.	.	.	G	18.61	3.661182	0.67700	.	.	ENSG00000178105	ENST00000322536;ENST00000456020;ENST00000526794	T;T	0.55234	0.54;0.53	5.87	5.87	0.94306	.	0.202030	0.42172	D	0.000743	T	0.52306	0.1726	M	0.64404	1.975	0.48901	D	0.999728	P;P	0.34562	0.457;0.457	B;B	0.31390	0.129;0.129	T	0.56607	-0.7951	10	0.72032	D	0.01	-12.6355	16.9184	0.86157	0.0:0.0:1.0:0.0	.	693;693	Q13206;E9PIF2	DDX10_HUMAN;.	K	693;599;693	ENSP00000314348:E693K;ENSP00000432032:E693K	ENSP00000314348:E693K	E	+	1	0	DDX10	108214494	1.000000	0.71417	1.000000	0.80357	0.891000	0.51852	6.104000	0.71498	2.775000	0.95449	0.650000	0.86243	GAA	.	.		0.328	DDX10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390343.1	NM_004398	
RNF214	257160	hgsc.bcm.edu	37	11	117109396	117109396	+	Nonsense_Mutation	SNP	A	A	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr11:117109396A>T	ENST00000531452.1	+	3	233	c.187A>T	c.(187-189)Aga>Tga	p.R63*	RNF214_ENST00000530849.1_Intron|RNF214_ENST00000531287.1_Intron|RNF214_ENST00000300650.4_Nonsense_Mutation_p.R63*	NM_001077239.1|NM_001278249.1	NP_001070707.1|NP_001265178.1	Q8ND24	RN214_HUMAN	ring finger protein 214	63							zinc ion binding (GO:0008270)			cervix(1)|endometrium(5)|kidney(1)|large_intestine(6)|lung(6)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	23	all_hematologic(175;0.0487)	Breast(348;0.00908)|Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;1.88e-05)|Epithelial(105;0.000397)|all cancers(92;0.00258)		GGAGAATAACAGAAATGTCCA	0.453																																					p.R63X		Atlas-SNP	.											.	RNF214	54	.	0			c.A187T						.						187.0	196.0	193.0					11																	117109396		1944	4140	6084	SO:0001587	stop_gained	257160	exon3			AATAACAGAAATG	AL834448	CCDS41720.1, CCDS60976.1	11q23.3	2014-02-12	2007-02-16		ENSG00000167257	ENSG00000167257		"""RING-type (C3HC4) zinc fingers"""	25335	protein-coding gene	gene with protein product							Standard	NM_001077239		Approved	DKFZp547C195	uc001pqt.4	Q8ND24	OTTHUMG00000167069	ENST00000531452.1:c.187A>T	chr11.hg19:g.117109396A>T	ENSP00000431643:p.Arg63*	150.0	0.0		137.0	58.0	NM_207343	B2RUW0|B4DTD1	Nonsense_Mutation	SNP	ENST00000531452.1	hg19	CCDS41720.1	.	.	.	.	.	.	.	.	.	.	A	24.8	4.566449	0.86439	.	.	ENSG00000167257	ENST00000534428;ENST00000531452;ENST00000300650	.	.	.	5.5	4.31	0.51392	.	2.214490	0.02025	N	0.048065	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-5.6742	8.8752	0.35340	0.8111:0.1889:0.0:0.0	.	.	.	.	X	63	.	ENSP00000300650:R63X	R	+	1	2	RNF214	116614606	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	2.142000	0.42177	2.091000	0.63221	0.482000	0.46254	AGA	.	.		0.453	RNF214-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392884.1	NM_001077239	
Unknown	0	hgsc.bcm.edu	37	11	124095466	124095466	+	IGR	SNP	T	T	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr11:124095466T>A								OR10D3 (38514 upstream) : OR8G1 (24956 downstream)																							CCTCAGTGACTGAGTTCATTC	0.478																																					p.T23T		Atlas-SNP	.											.	.	.	.	0			c.T69A						.						82.0	82.0	82.0					11																	124095466		2017	4203	6220	SO:0001628	intergenic_variant	26492	exon1			AGTGACTGAGTTC																													chr11.hg19:g.124095466T>A		168.0	0.0		127.0	54.0	NM_001007249		Silent	SNP		hg19																																																																																				.	.	0	0.478								
CDON	50937	hgsc.bcm.edu	37	11	125891234	125891234	+	Silent	SNP	A	A	G			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr11:125891234A>G	ENST00000392693.3	-	3	385	c.258T>C	c.(256-258)tcT>tcC	p.S86S	CDON_ENST00000263577.7_Silent_p.S86S	NM_001243597.1|NM_016952.4	NP_001230526.1|NP_058648.4	Q4KMG0	CDON_HUMAN	cell adhesion associated, oncogene regulated	86	Ig-like C2-type 1.				anterior/posterior pattern specification (GO:0009952)|cell adhesion (GO:0007155)|cell fate specification (GO:0001708)|cerebral cortex development (GO:0021987)|embryonic body morphogenesis (GO:0010172)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|lens development in camera-type eye (GO:0002088)|muscle cell differentiation (GO:0042692)|myoblast fusion (GO:0007520)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neural precursor cell proliferation (GO:2000179)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of skeletal muscle tissue development (GO:0048643)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of protein heterodimerization activity (GO:0043497)|skeletal muscle satellite cell differentiation (GO:0014816)|smoothened signaling pathway (GO:0007224)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(22)|lung(9)|ovary(3)|prostate(2)|skin(4)|stomach(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	61	all_hematologic(175;0.177)	Breast(109;0.00157)|Lung NSC(97;0.0127)|all_lung(97;0.0133)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.51e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0604)		AGGAGTTGAGAGAAAGAATTG	0.468																																					p.S86S		Atlas-SNP	.											.	CDON	137	.	0			c.T258C						.						86.0	84.0	85.0					11																	125891234		2201	4299	6500	SO:0001819	synonymous_variant	50937	exon3			GTTGAGAGAAAGA	AF004841	CCDS8468.1, CCDS58192.1	11q24.2	2013-02-11	2012-12-07		ENSG00000064309	ENSG00000064309		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	17104	protein-coding gene	gene with protein product	"""cell adhesion molecule-related/down-regulated by oncogenes"""	608707	"""Cdon homolog (mouse)"""			9214393	Standard	NM_016952		Approved	ORCAM, CDO, CDON1	uc009zbw.3	Q4KMG0	OTTHUMG00000165862	ENST00000392693.3:c.258T>C	chr11.hg19:g.125891234A>G		82.0	0.0		58.0	17.0	NM_016952	O14631	Silent	SNP	ENST00000392693.3	hg19	CCDS58192.1	.	.	.	.	.	.	.	.	.	.	A	1.213	-0.628996	0.03610	.	.	ENSG00000064309	ENST00000534661	T	0.40476	1.03	5.4	3.09	0.35607	.	0.000000	0.48767	D	0.000171	T	0.50292	0.1607	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.47355	-0.9124	7	0.72032	D	0.01	-23.5902	8.1026	0.30865	0.6793:0.0:0.3207:0.0	.	.	.	.	P	62	ENSP00000436755:S62P	ENSP00000436755:S62P	S	-	1	0	CDON	125396444	1.000000	0.71417	0.988000	0.46212	0.060000	0.15804	0.965000	0.29319	0.369000	0.24510	0.450000	0.29827	TCT	.	.		0.468	CDON-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000386749.2	NM_016952	
IGSF9B	22997	hgsc.bcm.edu	37	11	133807314	133807314	+	Silent	SNP	G	G	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr11:133807314G>A	ENST00000321016.8	-	5	866	c.636C>T	c.(634-636)agC>agT	p.S212S	IGSF9B_ENST00000533871.2_Silent_p.S212S			Q9UPX0	TUTLB_HUMAN	immunoglobulin superfamily, member 9B	212	Ig-like 2.				homophilic cell adhesion (GO:0007156)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)	dendrite (GO:0030425)|inhibitory synapse (GO:0060077)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)				breast(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(18)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	44	all_hematologic(175;0.127)	all_cancers(12;1.58e-21)|all_epithelial(12;5.17e-16)|all_lung(97;1.6e-05)|Lung NSC(97;3.86e-05)|Breast(109;0.000126)|Medulloblastoma(222;0.0245)|all_neural(223;0.0505)|Esophageal squamous(93;0.0559)		Epithelial(10;7.19e-10)|BRCA - Breast invasive adenocarcinoma(10;9.69e-09)|all cancers(11;1.23e-08)|OV - Ovarian serous cystadenocarcinoma(99;0.00328)|Lung(977;0.221)		CCCCCTGAATGCTGTACGCTC	0.617																																					p.S212S		Atlas-SNP	.											.	IGSF9B	290	.	0			c.C636T						.						84.0	96.0	92.0					11																	133807314		2108	4214	6322	SO:0001819	synonymous_variant	22997	exon5			CTGAATGCTGTAC	AK097578	CCDS61010.1	11q25	2013-02-11	2005-10-12	2005-11-20				"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	32326	protein-coding gene	gene with protein product		613773					Standard	NM_001277285		Approved	KIAA1030	uc031qfh.1	Q9UPX0		ENST00000321016.8:c.636C>T	chr11.hg19:g.133807314G>A		104.0	0.0		83.0	28.0	NM_014987	G5EA26	Silent	SNP	ENST00000321016.8	hg19																																																																																				.	.		0.617	IGSF9B-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		XM_290502	
B4GALNT3	283358	hgsc.bcm.edu	37	12	666812	666812	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr12:666812G>T	ENST00000266383.5	+	16	2432	c.2419G>T	c.(2419-2421)Gac>Tac	p.D807Y		NM_173593.3	NP_775864.3	Q6L9W6	B4GN3_HUMAN	beta-1,4-N-acetyl-galactosaminyl transferase 3	807					metabolic process (GO:0008152)	Golgi cisterna membrane (GO:0032580)|integral component of membrane (GO:0016021)	acetylgalactosaminyltransferase activity (GO:0008376)|N-acetyl-beta-glucosaminyl-glycoprotein 4-beta-N-acetylgalactosaminyltransferase activity (GO:0033842)			breast(1)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(1)|lung(10)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	26	all_cancers(10;0.0158)|all_epithelial(11;0.0274)|Ovarian(42;0.0512)|all_lung(10;0.154)|Lung NSC(10;0.215)		OV - Ovarian serous cystadenocarcinoma(31;0.00018)|BRCA - Breast invasive adenocarcinoma(9;0.0262)			ATTCATCAAAGACATGGAAAA	0.517																																					p.D807Y		Atlas-SNP	.											.	B4GALNT3	64	.	0			c.G2419T						.						84.0	76.0	79.0					12																	666812		2203	4300	6503	SO:0001583	missense	283358	exon16			ATCAAAGACATGG	AB089940	CCDS8504.1	12p13.33	2013-02-19			ENSG00000139044	ENSG00000139044	2.4.1.-	"""Beta 4-glycosyltransferases"""	24137	protein-coding gene	gene with protein product		612220				12966086	Standard	NM_173593		Approved	B4GalNac-T3, FLJ16224, FLJ40362	uc001qii.1	Q6L9W6	OTTHUMG00000129283	ENST00000266383.5:c.2419G>T	chr12.hg19:g.666812G>T	ENSP00000266383:p.Asp807Tyr	165.0	0.0		147.0	54.0	NM_173593	Q6ZNC1|Q8N7T6	Missense_Mutation	SNP	ENST00000266383.5	hg19	CCDS8504.1	.	.	.	.	.	.	.	.	.	.	G	25.6	4.656311	0.88056	.	.	ENSG00000139044	ENST00000266383	T	0.34472	1.36	4.97	4.97	0.65823	.	0.085141	0.85682	D	0.000000	T	0.61060	0.2317	M	0.70842	2.15	0.80722	D	1	D	0.76494	0.999	D	0.78314	0.991	T	0.65425	-0.6171	10	0.87932	D	0	-19.6504	18.199	0.89832	0.0:0.0:1.0:0.0	.	807	Q6L9W6	B4GN3_HUMAN	Y	807	ENSP00000266383:D807Y	ENSP00000266383:D807Y	D	+	1	0	B4GALNT3	537073	1.000000	0.71417	0.982000	0.44146	0.919000	0.55068	9.368000	0.97152	2.462000	0.83206	0.555000	0.69702	GAC	.	.		0.517	B4GALNT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251406.2	NM_173593	
ENO2	2026	hgsc.bcm.edu	37	12	7026812	7026812	+	Silent	SNP	G	G	C			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr12:7026812G>C	ENST00000535366.1	+	5	1004	c.378G>C	c.(376-378)cgG>cgC	p.R126R	ENO2_ENST00000544774.1_Silent_p.R83R|ENO2_ENST00000538763.1_Silent_p.R83R|ENO2_ENST00000545045.2_Intron|ENO2_ENST00000229277.1_Silent_p.R126R|ENO2_ENST00000541477.1_Silent_p.R126R			P09104	ENOG_HUMAN	enolase 2 (gamma, neuronal)	126					carbohydrate metabolic process (GO:0005975)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|perikaryon (GO:0043204)|phosphopyruvate hydratase complex (GO:0000015)|photoreceptor inner segment (GO:0001917)|plasma membrane (GO:0005886)	magnesium ion binding (GO:0000287)|phosphopyruvate hydratase activity (GO:0004634)			endometrium(3)|large_intestine(2)|lung(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	10						CAGCTGAGCGGGAACTGCCCC	0.602																																					p.R126R		Atlas-SNP	.											.	ENO2	20	.	0			c.G378C						.						81.0	68.0	72.0					12																	7026812		2203	4300	6503	SO:0001819	synonymous_variant	2026	exon6			TGAGCGGGAACTG	M22349	CCDS8570.1	12p13	2012-10-02				ENSG00000111674	4.2.1.11		3353	protein-coding gene	gene with protein product		131360					Standard	NM_001975		Approved		uc001qru.1	P09104		ENST00000535366.1:c.378G>C	chr12.hg19:g.7026812G>C		50.0	0.0		42.0	16.0	NM_001975	B7Z2X9|Q96J33	Silent	SNP	ENST00000535366.1	hg19	CCDS8570.1																																																																																			.	.		0.602	ENO2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401786.1		
A2ML1	144568	hgsc.bcm.edu	37	12	8990976	8990976	+	Silent	SNP	C	C	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr12:8990976C>T	ENST00000299698.7	+	9	1080	c.900C>T	c.(898-900)acC>acT	p.T300T		NM_001282424.1|NM_144670.4	NP_001269353.1|NP_653271			alpha-2-macroglobulin-like 1									p.T300T(1)		NS(2)|breast(5)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|liver(2)|lung(36)|ovary(2)|skin(4)|stomach(1)|urinary_tract(1)	80						ACATGGCCACCTTTGACCTCA	0.458																																					p.T300T		Atlas-SNP	.											A2ML1,caecum,carcinoma,0,1	A2ML1	199	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C900T						.						180.0	169.0	172.0					12																	8990976		1965	4166	6131	SO:0001819	synonymous_variant	144568	exon9			GGCCACCTTTGAC	AK057908	CCDS8596.2, CCDS73439.1	12p13	2010-12-14	2005-09-01	2005-09-01	ENSG00000166535	ENSG00000166535			23336	protein-coding gene	gene with protein product		610627	"""C3 and PZP-like, alpha-2-macroglobulin domain containing 9"""	CPAMD9		16298998	Standard	NM_144670		Approved	FLJ25179	uc001quz.5	A8K2U0	OTTHUMG00000128499	ENST00000299698.7:c.900C>T	chr12.hg19:g.8990976C>T		197.0	1.0		111.0	50.0	NM_144670		Silent	SNP	ENST00000299698.7	hg19	CCDS8596.2																																																																																			.	.		0.458	A2ML1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250304.3	NM_144670	
PHC1	1911	hgsc.bcm.edu	37	12	9083485	9083485	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr12:9083485C>A	ENST00000543824.1	+	8	1399	c.1067C>A	c.(1066-1068)aCa>aAa	p.T356K	PHC1_ENST00000433847.2_3'UTR|PHC1_ENST00000433083.2_Missense_Mutation_p.T311K|PHC1_ENST00000536844.1_Missense_Mutation_p.T135K|PHC1_ENST00000544916.1_Missense_Mutation_p.T356K			P78364	PHC1_HUMAN	polyhomeotic homolog 1 (Drosophila)	356					cellular response to retinoic acid (GO:0071300)|histone ubiquitination (GO:0016574)|multicellular organismal development (GO:0007275)	nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)|sex chromatin (GO:0001739)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|endometrium(5)|large_intestine(8)|liver(2)|lung(3)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	27						CTGACACGGACAGCCACACCT	0.498																																					p.T356K		Atlas-SNP	.											.	PHC1	67	.	0			c.C1067A						.						21.0	23.0	23.0					12																	9083485		2198	4291	6489	SO:0001583	missense	1911	exon7			CACGGACAGCCAC	U89277	CCDS8597.1	12p13	2013-01-10	2006-09-12	2002-11-15	ENSG00000111752	ENSG00000111752		"""Sterile alpha motif (SAM) domain containing"""	3182	protein-coding gene	gene with protein product		602978	"""early development regulator 1 (homolog of polyhomeotic 1)"", ""polyhomeotic-like 1 (Drosophila)"""	EDR1		9121482	Standard	XM_005253334		Approved	HPH1, RAE28	uc001qvd.3	P78364	OTTHUMG00000168275	ENST00000543824.1:c.1067C>A	chr12.hg19:g.9083485C>A	ENSP00000440674:p.Thr356Lys	79.0	0.0		121.0	36.0	NM_004426	D3DUV4|Q8WVM3|Q9BU63	Missense_Mutation	SNP	ENST00000543824.1	hg19	CCDS8597.1	.	.	.	.	.	.	.	.	.	.	C	23.8	4.453440	0.84209	.	.	ENSG00000111752	ENST00000543824;ENST00000251757;ENST00000433083;ENST00000544916;ENST00000536844	T;T;T;T;D	0.83673	1.66;1.66;1.64;1.66;-1.75	5.38	5.38	0.77491	.	0.072582	0.64402	D	0.000019	D	0.88280	0.6394	L	0.47190	1.495	0.34457	D	0.701358	D;D;D	0.61697	0.99;0.981;0.981	D;D;D	0.69824	0.962;0.966;0.966	D	0.91388	0.5133	10	0.72032	D	0.01	-13.8727	17.0895	0.86618	0.0:1.0:0.0:0.0	.	356;356;356	B4DF21;P78364;B2RXH1	.;PHC1_HUMAN;.	K	356;356;311;356;135	ENSP00000440674:T356K;ENSP00000251757:T356K;ENSP00000399194:T311K;ENSP00000437659:T356K;ENSP00000440488:T135K	ENSP00000251757:T356K	T	+	2	0	PHC1	8974752	0.998000	0.40836	1.000000	0.80357	0.998000	0.95712	4.825000	0.62708	2.802000	0.96397	0.655000	0.94253	ACA	.	.		0.498	PHC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399115.1	NM_004426	
CD69	969	hgsc.bcm.edu	37	12	9907785	9907785	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr12:9907785T>C	ENST00000228434.3	-	3	340	c.260A>G	c.(259-261)gAg>gGg	p.E87G	CD69_ENST00000536709.1_Missense_Mutation_p.E87G	NM_001781.2	NP_001772.1	Q07108	CD69_HUMAN	CD69 molecule	87					cellular response to drug (GO:0035690)|signal transduction (GO:0007165)	external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|transmembrane signaling receptor activity (GO:0004888)			endometrium(1)|large_intestine(3)|lung(4)|pancreas(1)|upper_aerodigestive_tract(1)	10						AACCCAGTCCTCAGAGCATGA	0.438																																					p.E87G		Atlas-SNP	.											.	CD69	23	.	0			c.A260G						.						117.0	123.0	121.0					12																	9907785		2203	4300	6503	SO:0001583	missense	969	exon3			CAGTCCTCAGAGC	Z22576	CCDS8604.1	12p13	2011-08-30	2006-03-28		ENSG00000110848	ENSG00000110848		"""C-type lectin domain containing"", ""CD molecules"""	1694	protein-coding gene	gene with protein product		107273	"""CD69 antigen (p60, early T-cell activation antigen)"""			1612643	Standard	NM_001781		Approved	CLEC2C	uc001qwk.3	Q07108	OTTHUMG00000168481	ENST00000228434.3:c.260A>G	chr12.hg19:g.9907785T>C	ENSP00000228434:p.Glu87Gly	131.0	0.0		103.0	42.0	NM_001781		Missense_Mutation	SNP	ENST00000228434.3	hg19	CCDS8604.1	.	.	.	.	.	.	.	.	.	.	T	3.200	-0.163832	0.06502	.	.	ENSG00000110848	ENST00000228434;ENST00000536709	T;T	0.62788	0.0;0.0	5.22	-0.15	0.13416	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (1);	0.893166	0.09789	N	0.755588	T	0.35799	0.0944	N	0.08118	0	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.18808	-1.0325	9	.	.	.	-3.5921	6.7106	0.23274	0.0:0.0863:0.4784:0.4352	.	87;87	B4E0H7;Q07108	.;CD69_HUMAN	G	87	ENSP00000228434:E87G;ENSP00000442597:E87G	.	E	-	2	0	CD69	9799052	0.003000	0.15002	0.009000	0.14445	0.059000	0.15707	0.571000	0.23669	-0.155000	0.11098	-0.435000	0.05868	GAG	.	.		0.438	CD69-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399876.1		
CLEC1B	51266	hgsc.bcm.edu	37	12	10147839	10147839	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr12:10147839T>A	ENST00000298527.6	-	5	624	c.445A>T	c.(445-447)Atc>Ttc	p.I149F	CLEC1B_ENST00000348658.4_Missense_Mutation_p.I116F|CLEC1B_ENST00000428126.2_Missense_Mutation_p.I116F	NM_016509.3	NP_057593.3	Q9P126	CLC1B_HUMAN	C-type lectin domain family 1, member B	149	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				cell surface receptor signaling pathway (GO:0007166)|defense response (GO:0006952)|platelet formation (GO:0030220)	integral component of plasma membrane (GO:0005887)	carbohydrate binding (GO:0030246)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(1)|central_nervous_system(1)|large_intestine(2)|lung(12)|stomach(1)|urinary_tract(1)	19						CTGGCTTTGATGTACTCCTAT	0.408																																					p.I149F		Atlas-SNP	.											.	CLEC1B	39	.	0			c.A445T						.						211.0	202.0	205.0					12																	10147839		1859	4091	5950	SO:0001583	missense	51266	exon5			CTTTGATGTACTC	AF124841	CCDS41751.1, CCDS41752.1	12p13.31	2006-04-12				ENSG00000165682		"""C-type lectin domain containing"""	24356	protein-coding gene	gene with protein product		606783				10671229, 11745369	Standard	NM_016509		Approved	CLEC2	uc001qwu.3	Q9P126		ENST00000298527.6:c.445A>T	chr12.hg19:g.10147839T>A	ENSP00000298527:p.Ile149Phe	55.0	0.0		40.0	13.0	NM_016509	Q6UWX7|Q8NHR6	Missense_Mutation	SNP	ENST00000298527.6	hg19	CCDS41752.1	.	.	.	.	.	.	.	.	.	.	T	13.29	2.192446	0.38707	.	.	ENSG00000165682	ENST00000398937;ENST00000428126;ENST00000298527;ENST00000348658	T;T;T;T	0.21361	2.01;2.01;2.01;2.01	3.83	-5.6	0.02497	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (3);	0.633406	0.13753	N	0.365175	T	0.10423	0.0255	L	0.38531	1.155	0.09310	N	1	B;B	0.28055	0.166;0.199	B;B	0.25140	0.031;0.058	T	0.17684	-1.0361	10	0.52906	T	0.07	.	1.2104	0.01903	0.2781:0.1023:0.3606:0.259	.	116;149	Q9P126-2;Q9P126	.;CLC1B_HUMAN	F	56;116;149;116	ENSP00000381910:I56F;ENSP00000406338:I116F;ENSP00000298527:I149F;ENSP00000327169:I116F	ENSP00000298527:I149F	I	-	1	0	CLEC1B	10039106	0.001000	0.12720	0.000000	0.03702	0.561000	0.35649	-0.998000	0.03701	-0.869000	0.04052	0.248000	0.18094	ATC	.	.		0.408	CLEC1B-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399922.1	NM_016509	
PRB2	653247	hgsc.bcm.edu	37	12	11546400	11546400	+	Silent	SNP	T	T	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr12:11546400T>A	ENST00000389362.4	-	3	647	c.612A>T	c.(610-612)ccA>ccT	p.P204P	PRB2_ENST00000545829.1_5'Flank|PRB1_ENST00000546254.1_Intron	NM_006248.3	NP_006239.3	P02812	PRB2_HUMAN	proline-rich protein BstNI subfamily 2	204	15 X 20 AA approximate tandem repeats of P-P-G-K-P-Q-G-P-P-P-Q-G-[GD]-[NKS]-[KSQ]- [PRS]-[QRS] [GPS]-[PSAR]-[PSR].					extracellular region (GO:0005576)				NS(1)|breast(1)|endometrium(2)|kidney(3)|large_intestine(3)|lung(14)|pancreas(1)|prostate(5)|skin(4)|stomach(2)|urinary_tract(1)	37		all_cancers(2;0.00558)|Acute lymphoblastic leukemia(2;3.94e-11)|all_hematologic(2;3.6e-09)	OV - Ovarian serous cystadenocarcinoma(49;0.185)			CTTGTGGGGGTGGTCCTTGTG	0.597																																					p.P204P		Atlas-SNP	.											.	PRB2	168	.	0			c.A612T						.						71.0	79.0	77.0					12																	11546400		2085	4138	6223	SO:0001819	synonymous_variant	653247	exon3			TGGGGGTGGTCCT	K03208	CCDS41757.2	12p13.2	2012-10-02			ENSG00000121335	ENSG00000121335			9338	protein-coding gene	gene with protein product		168810				8554050	Standard	NM_006248		Approved	PRPPRB1, Ps, cP7	uc010shk.1	P02812	OTTHUMG00000156975	ENST00000389362.4:c.612A>T	chr12.hg19:g.11546400T>A		369.0	0.0		322.0	46.0	NM_006248	O00599|P02811|P04281	Silent	SNP	ENST00000389362.4	hg19	CCDS41757.2																																																																																			.	.		0.597	PRB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346925.2	NM_006248	
CASC1	55259	hgsc.bcm.edu	37	12	25267703	25267703	+	Nonsense_Mutation	SNP	G	G	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr12:25267703G>A	ENST00000320267.9	-	12	1561	c.1480C>T	c.(1480-1482)Caa>Taa	p.Q494*	CASC1_ENST00000395987.3_Nonsense_Mutation_p.Q500*|CASC1_ENST00000537577.1_Nonsense_Mutation_p.Q382*|CASC1_ENST00000557684.1_5'UTR|CASC1_ENST00000395990.2_Nonsense_Mutation_p.Q454*|CASC1_ENST00000354189.5_Nonsense_Mutation_p.Q558*|CASC1_ENST00000545133.1_Nonsense_Mutation_p.Q435*	NM_001082973.1	NP_001076442	Q6TDU7	CASC1_HUMAN	cancer susceptibility candidate 1	494										breast(3)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|liver(1)|lung(3)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	31	Acute lymphoblastic leukemia(6;0.00112)|all_hematologic(7;0.00152)|Melanoma(3;0.0301)|Colorectal(261;0.11)		OV - Ovarian serous cystadenocarcinoma(3;7.42e-20)|Epithelial(3;7.58e-16)|all cancers(3;1.07e-13)			TGAGCATCTTGAATCAAGGTA	0.383																																					p.Q558X		Atlas-SNP	.											.	CASC1	146	.	0			c.C1672T						.						149.0	127.0	134.0					12																	25267703		2203	4300	6503	SO:0001587	stop_gained	55259	exon13			CATCTTGAATCAA	AK093102	CCDS31759.2, CCDS41762.1, CCDS41763.1, CCDS55810.1, CCDS55811.1	12p12.1	2012-04-17			ENSG00000118307	ENSG00000118307		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	29599	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 54"""					14583591	Standard	NM_018272		Approved	LAS1, FLJ10921, PPP1R54	uc001rgk.3	Q6TDU7	OTTHUMG00000150195	ENST00000320267.9:c.1480C>T	chr12.hg19:g.25267703G>A	ENSP00000313141:p.Gln494*	165.0	0.0		113.0	45.0	NM_001082972	B4DNP2|F5H6T6|Q17RL2|Q4G171|Q5U5K5|Q9NV50	Nonsense_Mutation	SNP	ENST00000320267.9	hg19	CCDS41762.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	35|35	5.497693|5.497693	0.96355|0.96355	.|.	.|.	ENSG00000118307|ENSG00000118307	ENST00000354189;ENST00000395987;ENST00000320267;ENST00000395990;ENST00000537577;ENST00000545133;ENST00000389246|ENST00000556006	.|.	.|.	.|.	5.62|5.62	4.73|4.73	0.59995|0.59995	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	.|T	.|0.61837	.|0.2379	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.69892	.|-0.5022	.|3	0.30078|.	T|.	0.28|.	-27.8804|-27.8804	12.1148|12.1148	0.53860|0.53860	0.0791:0.0:0.9209:0.0|0.0791:0.0:0.9209:0.0	.|.	.|.	.|.	.|.	X|L	558;500;494;454;382;435;304|330	.|.	ENSP00000313141:Q494X|.	Q|S	-|-	1|2	0|0	CASC1|CASC1	25158970|25158970	1.000000|1.000000	0.71417|0.71417	0.997000|0.997000	0.53966|0.53966	0.992000|0.992000	0.81027|0.81027	6.627000|6.627000	0.74258|0.74258	1.519000|1.519000	0.48950|0.48950	0.655000|0.655000	0.94253|0.94253	CAA|TCA	.	.		0.383	CASC1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000316761.1	NM_018272	
RASSF8	11228	hgsc.bcm.edu	37	12	26217535	26217535	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr12:26217535G>T	ENST00000405154.2	+	3	407	c.208G>T	c.(208-210)Gct>Tct	p.A70S	RASSF8_ENST00000381352.3_Missense_Mutation_p.A70S|RASSF8_ENST00000282884.9_Missense_Mutation_p.A70S|RASSF8_ENST00000541490.1_Missense_Mutation_p.A70S|RASSF8_ENST00000542865.1_Missense_Mutation_p.A70S	NM_001164748.1	NP_001158220.1	Q8NHQ8	RASF8_HUMAN	Ras association (RalGDS/AF-6) domain family (N-terminal) member 8	70	Ras-associating. {ECO:0000255|PROSITE- ProRule:PRU00166}.				signal transduction (GO:0007165)					cervix(2)|endometrium(1)|large_intestine(6)|lung(15)|urinary_tract(1)	25	Colorectal(261;0.0847)					GGGGCAGTATGCTAGTGATGT	0.448																																					p.A70S		Atlas-SNP	.											.	RASSF8	56	.	0			c.G208T						.						127.0	126.0	126.0					12																	26217535		2203	4300	6503	SO:0001583	missense	11228	exon4			CAGTATGCTAGTG	U82396	CCDS8705.1, CCDS53765.1	12p12.3	2013-05-30	2008-02-22	2005-09-14	ENSG00000123094	ENSG00000123094			13232	protein-coding gene	gene with protein product		608231	"""chromosome 12 open reading frame 2"""	C12orf2			Standard	NM_007211		Approved	HoJ-1	uc001rgx.3	Q8NHQ8	OTTHUMG00000169087	ENST00000405154.2:c.208G>T	chr12.hg19:g.26217535G>T	ENSP00000384491:p.Ala70Ser	119.0	0.0		100.0	42.0	NM_007211	A8K1Z0|O95647|Q5SCI2|Q76KB6	Missense_Mutation	SNP	ENST00000405154.2	hg19	CCDS53765.1	.	.	.	.	.	.	.	.	.	.	G	18.59	3.656559	0.67586	.	.	ENSG00000123094	ENST00000381352;ENST00000535907;ENST00000405154;ENST00000542865;ENST00000541490;ENST00000542004;ENST00000542315;ENST00000541218;ENST00000282884;ENST00000545413;ENST00000541934	T;T;T;T;T;T;T;T;T;T	0.18174	2.23;2.23;2.23;2.23;2.23;2.23;2.23;2.23;2.23;2.23	5.39	5.39	0.77823	Ras-association (3);	0.000000	0.85682	D	0.000000	T	0.24122	0.0584	N	0.17594	0.5	0.80722	D	1	P;D	0.54397	0.867;0.966	P;P	0.62813	0.79;0.907	T	0.05178	-1.0901	10	0.17369	T	0.5	-31.9131	18.5154	0.90934	0.0:0.0:1.0:0.0	.	70;70	Q8NHQ8-2;Q8NHQ8	.;RASF8_HUMAN	S	70	ENSP00000370756:A70S;ENSP00000442036:A70S;ENSP00000384491:A70S;ENSP00000439839:A70S;ENSP00000443096:A70S;ENSP00000442485:A70S;ENSP00000441294:A70S;ENSP00000445970:A70S;ENSP00000282884:A70S;ENSP00000443696:A70S	ENSP00000282884:A70S	A	+	1	0	RASSF8	26108802	1.000000	0.71417	0.997000	0.53966	0.594000	0.36715	9.403000	0.97302	2.710000	0.92621	0.655000	0.94253	GCT	.	.		0.448	RASSF8-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402209.2	NM_007211	
PPFIBP1	8496	hgsc.bcm.edu	37	12	27832961	27832961	+	Nonsense_Mutation	SNP	T	T	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr12:27832961T>A	ENST00000318304.8	+	20	2163	c.1880T>A	c.(1879-1881)tTa>tAa	p.L627*	PPFIBP1_ENST00000542629.1_Nonsense_Mutation_p.L596*|PPFIBP1_ENST00000228425.6_Nonsense_Mutation_p.L621*|PPFIBP1_ENST00000537927.1_Nonsense_Mutation_p.L474*	NM_001198916.1|NM_177444.2	NP_001185845.1|NP_803193	Q86W92	LIPB1_HUMAN	PTPRF interacting protein, binding protein 1 (liprin beta 1)	627					cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|signal transduction (GO:0007165)	focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)			PPFIBP1/ALK(3)	central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(6)|lung(13)|prostate(2)|skin(1)	32	Lung SC(9;0.0873)					GGGCCCCGATTAGGTTGGTCT	0.478																																					p.L627X		Atlas-SNP	.											.	PPFIBP1	153	.	0			c.T1880A						.						76.0	83.0	81.0					12																	27832961		2203	4300	6503	SO:0001587	stop_gained	8496	exon20			CCCGATTAGGTTG	AF034802	CCDS8713.1, CCDS55812.1, CCDS55813.1, CCDS55814.1	12p12.1	2013-01-10						"""Sterile alpha motif (SAM) domain containing"""	9249	protein-coding gene	gene with protein product		603141				9624153, 11836260	Standard	NM_003622		Approved	L2, hSGT2, hSgt2p, SGT2	uc001ric.2	Q86W92		ENST00000318304.8:c.1880T>A	chr12.hg19:g.27832961T>A	ENSP00000314724:p.Leu627*	90.0	0.0		74.0	39.0	NM_177444	O75336|Q86X70|Q9NY03|Q9ULJ0	Nonsense_Mutation	SNP	ENST00000318304.8	hg19	CCDS55812.1	.	.	.	.	.	.	.	.	.	.	T	43	9.894552	0.99289	.	.	ENSG00000110841	ENST00000540114;ENST00000537927;ENST00000318304;ENST00000542629;ENST00000228425	.	.	.	5.91	5.91	0.95273	.	0.000000	0.28290	U	0.015888	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-10.8816	16.0127	0.80413	0.0:0.0:0.0:1.0	.	.	.	.	X	458;474;627;596;621	.	ENSP00000228425:L621X	L	+	2	0	PPFIBP1	27724228	1.000000	0.71417	0.710000	0.30468	0.832000	0.47134	7.593000	0.82686	2.266000	0.75297	0.533000	0.62120	TTA	.	.		0.478	PPFIBP1-007	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000402877.1	NM_003622	
KIAA1551	55196	hgsc.bcm.edu	37	12	32137297	32137297	+	Silent	SNP	A	A	G			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr12:32137297A>G	ENST00000312561.4	+	4	3822	c.3408A>G	c.(3406-3408)aaA>aaG	p.K1136K	KIAA1551_ENST00000535596.1_Intron	NM_018169.3	NP_060639	Q9HCM1	K1551_HUMAN	KIAA1551	1136																	AACCTCAGAAAGAAGAGCCCA	0.413																																					p.K1136K		Atlas-SNP	.											.	.	.	.	0			c.A3408G						.						101.0	105.0	104.0					12																	32137297		2203	4300	6503	SO:0001819	synonymous_variant	55196	exon4			TCAGAAAGAAGAG	AK001514	CCDS8725.2	12p11.21	2012-08-14	2012-08-14	2012-08-14	ENSG00000174718	ENSG00000174718			25559	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 35"""	C12orf35		10997877	Standard	NM_018169		Approved	FLJ20696, FLJ10652	uc001rks.3	Q9HCM1	OTTHUMG00000128501	ENST00000312561.4:c.3408A>G	chr12.hg19:g.32137297A>G		101.0	0.0		90.0	35.0	NM_018169	B2RTU5|Q4KN17|Q9NVL6|Q9NWP9	Silent	SNP	ENST00000312561.4	hg19	CCDS8725.2																																																																																			.	.		0.413	KIAA1551-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250307.2	NM_018169	
BICD1	636	hgsc.bcm.edu	37	12	32369200	32369200	+	Missense_Mutation	SNP	C	C	G			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr12:32369200C>G	ENST00000281474.5	+	2	336	c.233C>G	c.(232-234)tCc>tGc	p.S78C	BICD1_ENST00000548411.1_Missense_Mutation_p.S78C	NM_001714.2	NP_001705.2	Q96G01	BICD1_HUMAN	bicaudal D homolog 1 (Drosophila)	78					anatomical structure morphogenesis (GO:0009653)|intracellular mRNA localization (GO:0008298)|microtubule anchoring at microtubule organizing center (GO:0072393)|minus-end-directed organelle transport along microtubule (GO:0072385)|negative regulation of phospholipase C activity (GO:1900275)|negative regulation of phospholipase C-activating G-protein coupled receptor signaling pathway (GO:1900737)|positive regulation of receptor-mediated endocytosis (GO:0048260)|protein localization to organelle (GO:0033365)|regulation of proteinase activated receptor activity (GO:1900276)|RNA processing (GO:0006396)|stress granule assembly (GO:0034063)|viral process (GO:0016032)	cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|host cell viral assembly compartment (GO:0072517)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|trans-Golgi network (GO:0005802)	cytoskeletal adaptor activity (GO:0008093)|dynactin binding (GO:0034452)|dynein binding (GO:0045502)|proteinase activated receptor binding (GO:0031871)|Rab GTPase binding (GO:0017137)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|breast(2)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(9)|lung(14)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	46	all_cancers(9;5.13e-11)|all_epithelial(9;2.71e-11)|all_lung(12;6.66e-10)|Acute lymphoblastic leukemia(23;0.0122)|Lung SC(12;0.0213)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.204)		OV - Ovarian serous cystadenocarcinoma(6;0.0201)			CAGTCCTTCTCCATCCACCGG	0.463																																					p.S78C		Atlas-SNP	.											.	BICD1	89	.	0			c.C233G						.						72.0	74.0	73.0					12																	32369200		2203	4300	6503	SO:0001583	missense	636	exon2			CCTTCTCCATCCA	U90028	CCDS8726.1, CCDS44859.1	12p11.2-p11.1	2005-01-13	2001-11-28			ENSG00000151746			1049	protein-coding gene	gene with protein product		602204	"""Bicaudal D (Drosophila) homolog 1"""			9367685	Standard	NM_001714		Approved		uc001rku.3	Q96G01	OTTHUMG00000169307	ENST00000281474.5:c.233C>G	chr12.hg19:g.32369200C>G	ENSP00000281474:p.Ser78Cys	163.0	0.0		150.0	58.0	NM_001714	A8K2C3|F8W113|O43892|O43893	Missense_Mutation	SNP	ENST00000281474.5	hg19	CCDS8726.1	.	.	.	.	.	.	.	.	.	.	C	19.25	3.791503	0.70452	.	.	ENSG00000151746	ENST00000548411;ENST00000281474	T;T	0.53857	0.6;0.6	5.45	5.45	0.79879	.	0.147996	0.48286	D	0.000188	T	0.72795	0.3505	M	0.77103	2.36	0.80722	D	1	D;D	0.67145	0.992;0.996	P;P	0.62649	0.789;0.905	T	0.75657	-0.3242	10	0.62326	D	0.03	.	19.2981	0.94131	0.0:1.0:0.0:0.0	.	78;78	F8W113;Q96G01	.;BICD1_HUMAN	C	78	ENSP00000446793:S78C;ENSP00000281474:S78C	ENSP00000281474:S78C	S	+	2	0	BICD1	32260467	0.998000	0.40836	1.000000	0.80357	0.997000	0.91878	3.771000	0.55318	2.546000	0.85860	0.655000	0.94253	TCC	.	.		0.463	BICD1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403380.1	NM_001714	
BICD1	636	hgsc.bcm.edu	37	12	32490444	32490444	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr12:32490444A>G	ENST00000281474.5	+	7	2367	c.2264A>G	c.(2263-2265)tAt>tGt	p.Y755C	BICD1_ENST00000548411.1_Missense_Mutation_p.Y755C	NM_001714.2	NP_001705.2	Q96G01	BICD1_HUMAN	bicaudal D homolog 1 (Drosophila)	755	Interacts with RAB6A.				anatomical structure morphogenesis (GO:0009653)|intracellular mRNA localization (GO:0008298)|microtubule anchoring at microtubule organizing center (GO:0072393)|minus-end-directed organelle transport along microtubule (GO:0072385)|negative regulation of phospholipase C activity (GO:1900275)|negative regulation of phospholipase C-activating G-protein coupled receptor signaling pathway (GO:1900737)|positive regulation of receptor-mediated endocytosis (GO:0048260)|protein localization to organelle (GO:0033365)|regulation of proteinase activated receptor activity (GO:1900276)|RNA processing (GO:0006396)|stress granule assembly (GO:0034063)|viral process (GO:0016032)	cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|host cell viral assembly compartment (GO:0072517)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|trans-Golgi network (GO:0005802)	cytoskeletal adaptor activity (GO:0008093)|dynactin binding (GO:0034452)|dynein binding (GO:0045502)|proteinase activated receptor binding (GO:0031871)|Rab GTPase binding (GO:0017137)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|breast(2)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(9)|lung(14)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	46	all_cancers(9;5.13e-11)|all_epithelial(9;2.71e-11)|all_lung(12;6.66e-10)|Acute lymphoblastic leukemia(23;0.0122)|Lung SC(12;0.0213)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.204)		OV - Ovarian serous cystadenocarcinoma(6;0.0201)			TGTGATGAATATGTCACCCAG	0.408																																					p.Y755C		Atlas-SNP	.											.	BICD1	89	.	0			c.A2264G						.						92.0	87.0	89.0					12																	32490444		2203	4300	6503	SO:0001583	missense	636	exon7			ATGAATATGTCAC	U90028	CCDS8726.1, CCDS44859.1	12p11.2-p11.1	2005-01-13	2001-11-28			ENSG00000151746			1049	protein-coding gene	gene with protein product		602204	"""Bicaudal D (Drosophila) homolog 1"""			9367685	Standard	NM_001714		Approved		uc001rku.3	Q96G01	OTTHUMG00000169307	ENST00000281474.5:c.2264A>G	chr12.hg19:g.32490444A>G	ENSP00000281474:p.Tyr755Cys	130.0	0.0		114.0	50.0	NM_001714	A8K2C3|F8W113|O43892|O43893	Missense_Mutation	SNP	ENST00000281474.5	hg19	CCDS8726.1	.	.	.	.	.	.	.	.	.	.	A	17.20	3.329189	0.60743	.	.	ENSG00000151746	ENST00000548411;ENST00000281474	T;T	0.60171	0.21;0.21	4.66	4.66	0.58398	.	0.000000	0.64402	D	0.000001	T	0.78830	0.4345	M	0.89214	3.015	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	T	0.82354	-0.0499	10	0.51188	T	0.08	.	14.2757	0.66179	1.0:0.0:0.0:0.0	.	755;755	F8W113;Q96G01	.;BICD1_HUMAN	C	755	ENSP00000446793:Y755C;ENSP00000281474:Y755C	ENSP00000281474:Y755C	Y	+	2	0	BICD1	32381711	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	8.822000	0.92013	1.968000	0.57251	0.482000	0.46254	TAT	.	.		0.408	BICD1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403380.1	NM_001714	
KMT2D	8085	hgsc.bcm.edu	37	12	49432023	49432023	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr12:49432023T>C	ENST00000301067.7	-	34	9115	c.9116A>G	c.(9115-9117)gAt>gGt	p.D3039G	KMT2D_ENST00000549743.1_5'Flank	NM_003482.3	NP_003473.3	O14686	KMT2D_HUMAN	lysine (K)-specific methyltransferase 2D	3039					chromatin silencing (GO:0006342)|histone H3-K4 methylation (GO:0051568)|oocyte growth (GO:0001555)|oogenesis (GO:0048477)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to estrogen (GO:0043627)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)										GAGCAGGTCATCCAAGTGGGG	0.522																																					p.D3039G		Atlas-SNP	.											.	MLL2	1173	.	0			c.A9116G						.						101.0	101.0	101.0					12																	49432023		2024	4190	6214	SO:0001583	missense	8085	exon34			AGGTCATCCAAGT	AF010403	CCDS44873.1	12q13.12	2013-05-09	2013-05-09	2013-05-09	ENSG00000167548	ENSG00000167548		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7133	protein-coding gene	gene with protein product		602113	"""trinucleotide repeat containing 21"", ""myeloid/lymphoid or mixed-lineage leukemia 2"""	TNRC21, MLL2		9247308	Standard	NM_003482		Approved	ALR, MLL4, CAGL114		O14686	OTTHUMG00000166524	ENST00000301067.7:c.9116A>G	chr12.hg19:g.49432023T>C	ENSP00000301067:p.Asp3039Gly	143.0	0.0		138.0	59.0	NM_003482	O14687	Missense_Mutation	SNP	ENST00000301067.7	hg19	CCDS44873.1	.	.	.	.	.	.	.	.	.	.	T	11.92	1.783706	0.31593	.	.	ENSG00000167548	ENST00000301067	D	0.95622	-3.76	5.11	5.11	0.69529	.	0.000000	0.39834	N	0.001253	D	0.96614	0.8895	L	0.49126	1.545	0.58432	D	0.999997	D	0.89917	1.0	D	0.83275	0.996	D	0.97199	0.9863	10	0.87932	D	0	.	14.2014	0.65707	0.0:0.0:0.0:1.0	.	3039	O14686	MLL2_HUMAN	G	3039	ENSP00000301067:D3039G	ENSP00000301067:D3039G	D	-	2	0	MLL2	47718290	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.926000	0.87569	2.062000	0.61559	0.533000	0.62120	GAT	.	.		0.522	KMT2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390183.2		
FAM186A	121006	hgsc.bcm.edu	37	12	50749396	50749396	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr12:50749396A>G	ENST00000327337.5	-	4	1218	c.1219T>C	c.(1219-1221)Tat>Cat	p.Y407H	FAM186A_ENST00000543111.1_Missense_Mutation_p.Y407H	NM_001145475.1	NP_001138947.1	A6NE01	F186A_HUMAN	family with sequence similarity 186, member A	407																	TGGGCTGTATATGAAATAGTG	0.378																																					p.Y407H	NSCLC(138;1796 1887 12511 19463 37884)	Atlas-SNP	.											.	FAM186A	181	.	0			c.T1219C						.						58.0	42.0	47.0					12																	50749396		692	1591	2283	SO:0001583	missense	121006	exon4			CTGTATATGAAAT		CCDS44878.1	12q13.13	2009-04-22			ENSG00000185958	ENSG00000185958			26980	protein-coding gene	gene with protein product							Standard	NM_001145475		Approved	LOC121006	uc001rwl.2	A6NE01	OTTHUMG00000167889	ENST00000327337.5:c.1219T>C	chr12.hg19:g.50749396A>G	ENSP00000329995:p.Tyr407His	75.0	0.0		69.0	33.0	NM_001145475		Missense_Mutation	SNP	ENST00000327337.5	hg19	CCDS44878.1	.	.	.	.	.	.	.	.	.	.	A	10.39	1.335874	0.24253	.	.	ENSG00000185958	ENST00000543111;ENST00000327337	T;T	0.10099	2.91;2.91	3.43	-5.55	0.02536	.	.	.	.	.	T	0.05547	0.0146	N	0.14661	0.345	0.09310	N	1	B;B	0.12013	0.005;0.005	B;B	0.06405	0.002;0.002	T	0.39901	-0.9591	9	0.32370	T	0.25	.	10.2373	0.43290	0.6633:0.0:0.3367:0.0	.	407;407	F5GYN0;A6NE01	.;F186A_HUMAN	H	407	ENSP00000441337:Y407H;ENSP00000329995:Y407H	ENSP00000329995:Y407H	Y	-	1	0	FAM186A	49035663	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-2.392000	0.01056	-1.229000	0.02564	-0.256000	0.11100	TAT	.	.		0.378	FAM186A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000396838.1	XM_001718353	
KRT5	3852	hgsc.bcm.edu	37	12	52913903	52913903	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr12:52913903A>T	ENST00000252242.4	-	1	568	c.178T>A	c.(178-180)Tat>Aat	p.Y60N		NM_000424.3	NP_000415.2	P13647	K2C5_HUMAN	keratin 5	60	Gly-rich.|Head.				cell junction assembly (GO:0034329)|epidermis development (GO:0008544)|hemidesmosome assembly (GO:0031581)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|keratin filament (GO:0045095)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	scaffold protein binding (GO:0097110)|structural constituent of cytoskeleton (GO:0005200)			endometrium(5)|kidney(1)|large_intestine(8)|lung(15)|prostate(4)|skin(2)	35				BRCA - Breast invasive adenocarcinoma(357;0.189)		CGGCTGCCATAGCCACCCACT	0.647																																					p.Y60N		Atlas-SNP	.											.	KRT5	88	.	0			c.T178A						.						45.0	60.0	55.0					12																	52913903		2201	4293	6494	SO:0001583	missense	3852	exon1			TGCCATAGCCACC		CCDS8830.1	12q13.13	2013-01-16	2008-08-01		ENSG00000186081	ENSG00000186081		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6442	protein-coding gene	gene with protein product		148040	"""epidermolysis bullosa simplex 2 Dowling-Meara/Kobner/Weber-Cockayne types"", ""keratin 5 (epidermolysis bullosa simplex, Dowling-Meara/Kobner/Weber-Cockayne types)"""	EBS2		1713141, 16831889	Standard	NM_000424		Approved	KRT5A	uc001san.3	P13647	OTTHUMG00000169657	ENST00000252242.4:c.178T>A	chr12.hg19:g.52913903A>T	ENSP00000252242:p.Tyr60Asn	81.0	0.0		68.0	26.0	NM_000424	Q6PI71|Q6UBJ0|Q8TA91	Missense_Mutation	SNP	ENST00000252242.4	hg19	CCDS8830.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	11.27|11.27	1.589772|1.589772	0.28357|0.28357	.|.	.|.	ENSG00000186081|ENSG00000186081	ENST00000456000|ENST00000252242;ENST00000546577	.|D;T	.|0.85411	.|-1.98;2.09	5.93|5.93	5.93|5.93	0.95920|0.95920	.|.	.|0.759830	.|0.11612	.|N	.|0.546660	.|T	.|0.81475	.|0.4830	L|L	0.32530|0.32530	0.975|0.975	0.34396|0.34396	D|D	0.694722|0.694722	.|B	.|0.06786	.|0.001	.|B	.|0.09377	.|0.004	.|T	.|0.79867	.|-0.1622	.|10	.|0.87932	.|D	.|0	.|.	16.3797|16.3797	0.83452|0.83452	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|60	.|P13647	.|K2C5_HUMAN	.|N	-1|60	.|ENSP00000252242:Y60N;ENSP00000449651:Y60N	.|ENSP00000252242:Y60N	.|Y	-|-	.|1	.|0	KRT5|KRT5	51200170|51200170	0.991000|0.991000	0.36638|0.36638	0.765000|0.765000	0.31456|0.31456	0.087000|0.087000	0.18053|0.18053	4.226000|4.226000	0.58606|0.58606	2.271000|2.271000	0.75665|0.75665	0.533000|0.533000	0.62120|0.62120	.|TAT	.	.		0.647	KRT5-001	KNOWN	overlapping_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405312.1		
MAP3K12	7786	hgsc.bcm.edu	37	12	53878895	53878895	+	Silent	SNP	G	G	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr12:53878895G>A	ENST00000267079.2	-	7	1210	c.985C>T	c.(985-987)Ctg>Ttg	p.L329L	MAP3K12_ENST00000547151.1_5'Flank|MAP3K12_ENST00000547488.1_Silent_p.L362L|MAP3K12_ENST00000547035.1_Silent_p.L362L	NM_001193511.1|NM_006301.3	NP_001180440.1|NP_006292.3	Q12852	M3K12_HUMAN	mitogen-activated protein kinase kinase kinase 12	329	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				histone phosphorylation (GO:0016572)|intracellular signal transduction (GO:0035556)|JNK cascade (GO:0007254)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|growth cone (GO:0030426)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|MAP kinase kinase kinase activity (GO:0004709)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(2)|endometrium(1)|kidney(1)|large_intestine(7)|liver(1)|lung(16)|ovary(2)|pancreas(1)|prostate(1)|skin(3)	37						GGCACGGGCAGATGGAGACTG	0.552																																					p.L362L		Atlas-SNP	.											.	MAP3K12	160	.	0			c.C1084T						.						122.0	102.0	108.0					12																	53878895		2203	4300	6503	SO:0001819	synonymous_variant	7786	exon6			CGGGCAGATGGAG	U07358	CCDS8860.1, CCDS55831.1	12q13.13	2013-10-30			ENSG00000139625	ENSG00000139625		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6851	protein-coding gene	gene with protein product	"""dual leucine zipper kinase DLK"""	600447		ZPK		8037767	Standard	NM_006301		Approved	MUK, DLK, ZPKP1, MEKK12	uc001sdn.2	Q12852	OTTHUMG00000169854	ENST00000267079.2:c.985C>T	chr12.hg19:g.53878895G>A		126.0	0.0		123.0	52.0	NM_001193511	B3KSS9|G3V1Y2|Q86VQ5|Q8WY25	Silent	SNP	ENST00000267079.2	hg19	CCDS8860.1																																																																																			.	.		0.552	MAP3K12-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000406267.1	NM_006301	
NABP2	79035	hgsc.bcm.edu	37	12	56619991	56619991	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr12:56619991A>G	ENST00000380198.2	+	4	817	c.319A>G	c.(319-321)Aac>Gac	p.N107D	NABP2_ENST00000341463.5_Missense_Mutation_p.N107D|NABP2_ENST00000267023.4_Missense_Mutation_p.N107D			Q9BQ15	SOSB1_HUMAN	nucleic acid binding protein 2	107					cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|double-strand break repair via homologous recombination (GO:0000724)|mitotic cell cycle checkpoint (GO:0007093)|response to ionizing radiation (GO:0010212)	nucleus (GO:0005634)|SOSS complex (GO:0070876)	single-stranded DNA binding (GO:0003697)										TGAGGTTCCTAACTTCAGTGA	0.517																																					p.N107D		Atlas-SNP	.											.	.	.	.	0			c.A319G						.						111.0	107.0	109.0					12																	56619991		2203	4300	6503	SO:0001583	missense	79035	exon5			GTTCCTAACTTCA	BC006171	CCDS8911.1	12q13.3	2012-06-19	2012-06-19	2012-06-19	ENSG00000139579	ENSG00000139579			28412	protein-coding gene	gene with protein product	"""single strand DNA-binding protein 1"", ""sensor of single-strand DNA complex subunit B1"""	612104	"""oligonucleotide/oligosaccharide-binding fold containing 2B"""	OBFC2B			Standard	NM_024068		Approved	MGC2731, SSB1, hSSB1, SOSS-B1	uc001ski.3	Q9BQ15	OTTHUMG00000152527	ENST00000380198.2:c.319A>G	chr12.hg19:g.56619991A>G	ENSP00000369545:p.Asn107Asp	188.0	0.0		165.0	65.0	NM_024068	A6NDF8|Q6XYC8	Missense_Mutation	SNP	ENST00000380198.2	hg19	CCDS8911.1	.	.	.	.	.	.	.	.	.	.	A	18.41	3.618898	0.66787	.	.	ENSG00000139579	ENST00000447747;ENST00000399713;ENST00000267023;ENST00000380198;ENST00000341463	D;D;D;D;D	0.90676	-2.71;-2.71;-2.71;-2.71;-2.71	4.32	4.32	0.51571	Nucleic acid-binding, OB-fold-like (1);Nucleic acid-binding, OB-fold (1);	0.000000	0.85682	D	0.000000	D	0.89217	0.6652	M	0.65498	2.005	0.51482	D	0.999927	B;P;B	0.36683	0.233;0.565;0.165	B;B;B	0.37091	0.174;0.217;0.241	D	0.90098	0.4182	10	0.87932	D	0	-16.7133	12.834	0.57763	1.0:0.0:0.0:0.0	.	107;107;107	C9JT95;C9JMP5;Q9BQ15	.;.;SOSB1_HUMAN	D	107	ENSP00000413902:N107D;ENSP00000408616:N107D;ENSP00000267023:N107D;ENSP00000369545:N107D;ENSP00000368862:N107D	ENSP00000267023:N107D	N	+	1	0	OBFC2B	54906258	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	8.970000	0.93415	1.741000	0.51731	0.370000	0.22315	AAC	.	.		0.517	NABP2-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326610.1	NM_024068	
ZBTB39	9880	hgsc.bcm.edu	37	12	57397645	57397645	+	Missense_Mutation	SNP	C	C	G			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr12:57397645C>G	ENST00000300101.2	-	2	1142	c.1057G>C	c.(1057-1059)Gag>Cag	p.E353Q		NM_014830.2	NP_055645.1	O15060	ZBT39_HUMAN	zinc finger and BTB domain containing 39	353					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(3)|liver(1)|lung(3)|prostate(1)	16						ATGTTGGGCTCTAGAACTTTC	0.537																																					p.E353Q		Atlas-SNP	.											.	ZBTB39	58	.	0			c.G1057C						.						164.0	148.0	154.0					12																	57397645		2203	4300	6503	SO:0001583	missense	9880	exon2			TGGGCTCTAGAAC	AB002350	CCDS31839.1	12q13.3	2013-01-09				ENSG00000166860		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	29014	protein-coding gene	gene with protein product						9205841	Standard	NM_014830		Approved	KIAA0352, ZNF922	uc001sml.2	O15060		ENST00000300101.2:c.1057G>C	chr12.hg19:g.57397645C>G	ENSP00000300101:p.Glu353Gln	128.0	0.0		117.0	48.0	NM_014830	A7MD38|Q9UD98	Missense_Mutation	SNP	ENST00000300101.2	hg19	CCDS31839.1	.	.	.	.	.	.	.	.	.	.	C	9.439	1.087549	0.20390	.	.	ENSG00000166860	ENST00000300101	T	0.08193	3.12	5.22	5.22	0.72569	.	0.348186	0.29172	N	0.012923	T	0.05868	0.0153	N	0.16903	0.455	0.33269	D	0.560731	P	0.35272	0.493	B	0.29942	0.109	T	0.33007	-0.9885	10	0.23302	T	0.38	-22.7362	16.3249	0.82975	0.0:1.0:0.0:0.0	.	353	O15060	ZBT39_HUMAN	Q	353	ENSP00000300101:E353Q	ENSP00000300101:E353Q	E	-	1	0	ZBTB39	55683912	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	3.921000	0.56454	2.720000	0.93068	0.655000	0.94253	GAG	.	.		0.537	ZBTB39-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411214.1	NM_014830	
IRAK3	11213	hgsc.bcm.edu	37	12	66638446	66638446	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr12:66638446T>A	ENST00000261233.4	+	9	1489	c.1068T>A	c.(1066-1068)gaT>gaA	p.D356E	IRAK3_ENST00000457197.2_Missense_Mutation_p.D295E	NM_007199.2	NP_009130.2			interleukin-1 receptor-associated kinase 3											breast(3)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(17)|ovary(2)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	36				GBM - Glioblastoma multiforme(28;0.0203)		TTAAAACAGATGTCTACAGCT	0.368																																					p.D356E		Atlas-SNP	.											.	IRAK3	75	.	0			c.T1068A						.						95.0	87.0	90.0					12																	66638446		2203	4300	6503	SO:0001583	missense	11213	exon9			AACAGATGTCTAC	AF113136	CCDS8975.1, CCDS44937.1	12q13.13	2008-05-02			ENSG00000090376	ENSG00000090376			17020	protein-coding gene	gene with protein product		604459				10383454	Standard	NM_001142523		Approved	IRAK-M	uc001sth.3	Q9Y616	OTTHUMG00000169002	ENST00000261233.4:c.1068T>A	chr12.hg19:g.66638446T>A	ENSP00000261233:p.Asp356Glu	117.0	0.0		101.0	35.0	NM_007199		Missense_Mutation	SNP	ENST00000261233.4	hg19	CCDS8975.1	.	.	.	.	.	.	.	.	.	.	C	16.02	3.004124	0.54254	.	.	ENSG00000090376	ENST00000261233;ENST00000457197	T;T	0.74526	-0.85;-0.85	5.84	-4.29	0.03721	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.88629	0.6488	H	0.96861	3.895	0.32145	N	0.585008	D;D	0.89917	1.0;1.0	D;D	0.87578	0.996;0.998	D	0.88317	0.2960	9	.	.	.	-26.1063	14.6965	0.69126	0.0:0.3232:0.0:0.6768	.	295;356	Q9Y616-2;Q9Y616	.;IRAK3_HUMAN	E	356;295	ENSP00000261233:D356E;ENSP00000409852:D295E	.	D	+	3	2	IRAK3	64924713	0.001000	0.12720	0.030000	0.17652	0.541000	0.35023	-2.325000	0.01115	-1.109000	0.02996	-0.733000	0.03571	GAT	.	.		0.368	IRAK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401908.1		
TPH2	121278	hgsc.bcm.edu	37	12	72425319	72425319	+	Silent	SNP	T	T	C			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr12:72425319T>C	ENST00000333850.3	+	11	1458	c.1317T>C	c.(1315-1317)atT>atC	p.I439I		NM_173353.3	NP_775489.2	Q8IWU9	TPH2_HUMAN	tryptophan hydroxylase 2	439					aromatic amino acid family metabolic process (GO:0009072)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to lithium ion (GO:0071285)|circadian rhythm (GO:0007623)|indolalkylamine biosynthetic process (GO:0046219)|response to activity (GO:0014823)|response to calcium ion (GO:0051592)|response to estrogen (GO:0043627)|response to glucocorticoid (GO:0051384)|response to nutrient levels (GO:0031667)|serotonin biosynthetic process (GO:0042427)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|neuron projection (GO:0043005)	amino acid binding (GO:0016597)|iron ion binding (GO:0005506)|tryptophan 5-monooxygenase activity (GO:0004510)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(9)|lung(20)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	41					L-Tryptophan(DB00150)	CAAAGTCAATTACCCGTCCCT	0.423																																					p.I439I		Atlas-SNP	.											.	TPH2	81	.	0			c.T1317C						.						95.0	81.0	86.0					12																	72425319		2203	4300	6503	SO:0001819	synonymous_variant	121278	exon11			GTCAATTACCCGT	AY098914	CCDS31859.1	12q15	2008-02-07				ENSG00000139287	1.14.16.4		20692	protein-coding gene	gene with protein product		607478				12511643	Standard	NM_173353		Approved	NTPH, FLJ37295	uc009zrw.1	Q8IWU9		ENST00000333850.3:c.1317T>C	chr12.hg19:g.72425319T>C		156.0	0.0		141.0	60.0	NM_173353	A6NGA4|Q14CB0	Silent	SNP	ENST00000333850.3	hg19	CCDS31859.1																																																																																			.	.		0.423	TPH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405234.1	NM_173353	
NAV3	89795	hgsc.bcm.edu	37	12	78513452	78513452	+	Missense_Mutation	SNP	C	C	G			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr12:78513452C>G	ENST00000397909.2	+	15	3649	c.3476C>G	c.(3475-3477)aCc>aGc	p.T1159S	NAV3_ENST00000536525.2_Missense_Mutation_p.T1159S|NAV3_ENST00000266692.7_Missense_Mutation_p.T1159S|NAV3_ENST00000228327.6_Missense_Mutation_p.T1159S			Q8IVL0	NAV3_HUMAN	neuron navigator 3	1159	Ser-rich.					membrane (GO:0016020)|nuclear envelope (GO:0005635)				NS(2)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(13)|kidney(16)|large_intestine(39)|liver(2)|lung(126)|ovary(5)|pancreas(3)|prostate(6)|skin(5)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(1)	236						AGATCCAGTACCAGCAGTATT	0.542										HNSCC(70;0.22)																											p.T1159S		Atlas-SNP	.											.	NAV3	506	.	0			c.C3476G						.						70.0	72.0	72.0					12																	78513452		1981	4158	6139	SO:0001583	missense	89795	exon15			CCAGTACCAGCAG	AB023155	CCDS41815.1, CCDS66432.1	12q14.3	2008-08-05				ENSG00000067798			15998	protein-coding gene	gene with protein product	"""pore membrane and/or filament interacting like protein 1"", ""steerin 3"""	611629				12079279, 12062803	Standard	XM_005269215		Approved	KIAA0938, POMFIL1	uc001syo.3	Q8IVL0	OTTHUMG00000170001	ENST00000397909.2:c.3476C>G	chr12.hg19:g.78513452C>G	ENSP00000381007:p.Thr1159Ser	169.0	0.0		132.0	56.0	NM_014903	Q8NFW7|Q9Y2E7	Missense_Mutation	SNP	ENST00000397909.2	hg19		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	16.16|16.16	3.043916|3.043916	0.55110|0.55110	.|.	.|.	ENSG00000067798|ENSG00000067798	ENST00000536525;ENST00000397909;ENST00000228327;ENST00000266692|ENST00000552895	T;T;T;T|.	0.18657|.	2.2;2.2;2.2;2.2|.	5.75|5.75	5.75|5.75	0.90469|0.90469	.|.	0.000000|.	0.41294|.	U|.	0.000913|.	T|.	0.46639|.	0.1403|.	N|N	0.04880|0.04880	-0.145|-0.145	0.80722|0.80722	D|D	1|1	B;P;B;B|.	0.34412|.	0.347;0.453;0.077;0.1|.	B;B;B;B|.	0.42062|.	0.145;0.374;0.03;0.084|.	T|.	0.42258|.	-0.9462|.	10|.	0.09338|.	T|.	0.73|.	-19.8387|-19.8387	19.949|19.949	0.97192|0.97192	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	1159;1159;1159;1159|.	E7EUC6;Q8IVL0-3;Q8IVL0;Q8IVL0-2|.	.;.;NAV3_HUMAN;.|.	S|X	1159|230	ENSP00000446132:T1159S;ENSP00000381007:T1159S;ENSP00000228327:T1159S;ENSP00000266692:T1159S|.	ENSP00000228327:T1159S|.	T|Y	+|+	2|3	0|2	NAV3|NAV3	77037583|77037583	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.960000|0.960000	0.62799|0.62799	7.594000|7.594000	0.82698|0.82698	2.706000|2.706000	0.92434|0.92434	0.655000|0.655000	0.94253|0.94253	ACC|TAC	.	.		0.542	NAV3-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000406812.1	NM_001024383	
OTOGL	283310	hgsc.bcm.edu	37	12	80750668	80750668	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr12:80750668A>T	ENST00000547103.1	+	48	5936	c.5930A>T	c.(5929-5931)gAa>gTa	p.E1977V	OTOGL_ENST00000546620.1_Missense_Mutation_p.E8V|OTOGL_ENST00000458043.2_Missense_Mutation_p.E1989V			Q3ZCN5	OTOGL_HUMAN	otogelin-like	1977	Cys-rich.				L-arabinose metabolic process (GO:0046373)	extracellular region (GO:0005576)	alpha-L-arabinofuranosidase activity (GO:0046556)			breast(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(14)|prostate(1)	23						CGACAGGAAGAACCTTGTTGT	0.353																																					p.E1989V		Atlas-SNP	.											.	OTOGL	235	.	0			c.A5966T						.						109.0	97.0	101.0					12																	80750668		2203	4300	6503	SO:0001583	missense	283310	exon48			AGGAAGAACCTTG	AK096852		12q21.31	2011-02-11	2011-02-11	2011-02-11	ENSG00000165899	ENSG00000165899			26901	protein-coding gene	gene with protein product		614925	"""chromosome 12 open reading frame 64"""	C12orf64			Standard	NM_173591		Approved	FLJ90579	uc001szd.3	Q3ZCN5	OTTHUMG00000150509	ENST00000547103.1:c.5930A>T	chr12.hg19:g.80750668A>T	ENSP00000447211:p.Glu1977Val	247.0	1.0		269.0	120.0	NM_173591	F8W0C3|Q495U8|Q8N8G5|Q8NC28	Missense_Mutation	SNP	ENST00000547103.1	hg19		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	22.5|22.5	4.299202|4.299202	0.81025|0.81025	.|.	.|.	ENSG00000165899|ENSG00000165899	ENST00000547103;ENST00000458043;ENST00000546620;ENST00000550182|ENST00000298820	T;T;T;T|.	0.33654|.	1.4;1.4;1.4;1.4|.	5.36|5.36	4.18|4.18	0.49190|0.49190	.|.	0.424311|.	0.21815|.	N|.	0.068713|.	T|T	0.59252|0.59252	0.2180|0.2180	M|M	0.62723|0.62723	1.935|1.935	0.31953|0.31953	N|N	0.609369|0.609369	D|.	0.54601|.	0.967|.	P|.	0.53689|.	0.732|.	T|T	0.64719|0.64719	-0.6341|-0.6341	10|5	0.37606|.	T|.	0.19|.	.|.	12.2377|12.2377	0.54524|0.54524	0.8576:0.1424:0.0:0.0|0.8576:0.1424:0.0:0.0	.|.	354|.	Q3ZCN5|.	OTOGL_HUMAN|.	V|Y	1977;1989;8;6|432	ENSP00000447211:E1977V;ENSP00000400895:E1989V;ENSP00000449094:E8V;ENSP00000449641:E6V|.	ENSP00000400895:E1989V|.	E|N	+|+	2|1	0|0	OTOGL|OTOGL	79274799|79274799	1.000000|1.000000	0.71417|0.71417	0.890000|0.890000	0.34922|0.34922	0.987000|0.987000	0.75469|0.75469	5.491000|5.491000	0.66887|0.66887	0.831000|0.831000	0.34780|0.34780	0.455000|0.455000	0.32223|0.32223	GAA|AAC	.	.		0.353	OTOGL-001	NOVEL	not_organism_supported|basic	protein_coding	protein_coding	OTTHUMT00000407438.1	NM_173591	
PPFIA2	8499	hgsc.bcm.edu	37	12	82147865	82147865	+	Missense_Mutation	SNP	G	G	C			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr12:82147865G>C	ENST00000549396.1	-	3	296	c.136C>G	c.(136-138)Cta>Gta	p.L46V	PPFIA2_ENST00000550584.2_Missense_Mutation_p.L46V|PPFIA2_ENST00000548586.1_Missense_Mutation_p.L46V|PPFIA2_ENST00000549325.1_Missense_Mutation_p.L46V|PPFIA2_ENST00000552948.1_Missense_Mutation_p.L46V|PPFIA2_ENST00000333447.7_Missense_Mutation_p.L46V	NM_001220476.1|NM_001282536.1|NM_003625.3	NP_001207405.1|NP_001269465.1|NP_003616.2	O75334	LIPA2_HUMAN	protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 2	46					cell-matrix adhesion (GO:0007160)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|presynaptic active zone (GO:0048786)				NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(15)|lung(37)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(5)	85						AGGGTGTCTAGAAGACGATCC	0.522																																					p.L46V		Atlas-SNP	.											.	PPFIA2	207	.	0			c.C136G						.						65.0	67.0	67.0					12																	82147865		1935	4146	6081	SO:0001583	missense	8499	exon2			TGTCTAGAAGACG	AF034799	CCDS55850.1, CCDS55851.1, CCDS55852.1, CCDS55853.1, CCDS55854.1, CCDS55855.1, CCDS55856.1, CCDS55857.1, CCDS59236.1, CCDS73503.1	12q21.31	2013-01-10						"""Sterile alpha motif (SAM) domain containing"""	9246	protein-coding gene	gene with protein product	"""Liprin-alpha2"""	603143				9624153	Standard	NM_003625		Approved		uc031qis.1	O75334		ENST00000549396.1:c.136C>G	chr12.hg19:g.82147865G>C	ENSP00000450337:p.Leu46Val	138.0	0.0		120.0	49.0	NM_001220476	B3KVT5|B3KXA0|B7Z2A6|B7Z3U9|B7Z663|B7ZKZ5|E7ERB8|E7ETG6|F8VP68|Q2M3G8	Missense_Mutation	SNP	ENST00000549396.1	hg19	CCDS55857.1	.	.	.	.	.	.	.	.	.	.	G	27.0	4.792964	0.90453	.	.	ENSG00000139220	ENST00000549396;ENST00000549325;ENST00000541501;ENST00000333447;ENST00000548586;ENST00000552948;ENST00000551442;ENST00000547623	T;T;T;T;T;T;T	0.58652	0.32;0.32;0.32;0.32;0.32;0.32;0.32	5.95	5.95	0.96441	.	0.189534	0.35466	N	0.003196	T	0.73521	0.3597	L	0.58969	1.84	0.80722	D	1	P	0.52842	0.956	D	0.65010	0.931	T	0.70178	-0.4943	10	0.45353	T	0.12	.	20.3812	0.98933	0.0:0.0:1.0:0.0	.	46	O75334	LIPA2_HUMAN	V	46;46;57;46;46;46;46;46	ENSP00000450337:L46V;ENSP00000450298:L46V;ENSP00000327416:L46V;ENSP00000449338:L46V;ENSP00000447868:L46V;ENSP00000449469:L46V;ENSP00000447918:L46V	ENSP00000327416:L46V	L	-	1	2	PPFIA2	80671996	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.931000	0.63469	2.821000	0.97095	0.650000	0.86243	CTA	.	.		0.522	PPFIA2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000408030.1		
LRRIQ1	84125	hgsc.bcm.edu	37	12	85518207	85518207	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr12:85518207G>T	ENST00000393217.2	+	17	3978	c.3917G>T	c.(3916-3918)aGt>aTt	p.S1306I		NM_001079910.1	NP_001073379.1	Q96JM4	LRIQ1_HUMAN	leucine-rich repeats and IQ motif containing 1	1306										breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(21)|liver(1)|lung(28)|ovary(5)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)	83				GBM - Glioblastoma multiforme(134;0.212)		AAGGCAAGCAGTATTCCCACC	0.378																																					p.S1306I		Atlas-SNP	.											.	LRRIQ1	512	.	0			c.G3917T						.						167.0	183.0	178.0					12																	85518207		2203	4300	6503	SO:0001583	missense	84125	exon17			CAAGCAGTATTCC	AK022365	CCDS41816.1	12q21	2008-02-05			ENSG00000133640	ENSG00000133640			25708	protein-coding gene	gene with protein product						11347906	Standard	NM_001079910		Approved	FLJ12303, KIAA1801	uc001tac.3	Q96JM4	OTTHUMG00000166185	ENST00000393217.2:c.3917G>T	chr12.hg19:g.85518207G>T	ENSP00000376910:p.Ser1306Ile	70.0	0.0		76.0	32.0	NM_001079910	Q567P4|Q9BS17|Q9HA36	Missense_Mutation	SNP	ENST00000393217.2	hg19	CCDS41816.1	.	.	.	.	.	.	.	.	.	.	G	13.29	2.194009	0.38707	.	.	ENSG00000133640	ENST00000256007;ENST00000378580;ENST00000393217	T	0.55052	0.54	5.33	1.98	0.26296	.	1.848560	0.02908	N	0.136304	T	0.35508	0.0934	N	0.14661	0.345	0.09310	N	1	B;B	0.21905	0.028;0.062	B;B	0.19148	0.01;0.024	T	0.29274	-1.0017	10	0.66056	D	0.02	.	2.384	0.04361	0.3696:0.0:0.2409:0.3895	.	1306;1281	Q96JM4;C9JI57	LRIQ1_HUMAN;.	I	1306;1281;1306	ENSP00000376910:S1306I	ENSP00000256007:S1306I	S	+	2	0	LRRIQ1	84042338	0.000000	0.05858	0.000000	0.03702	0.462000	0.32619	-0.065000	0.11617	0.178000	0.19917	0.591000	0.81541	AGT	.	.		0.378	LRRIQ1-004	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000388249.2	NM_032165	
KITLG	4254	hgsc.bcm.edu	37	12	88910260	88910260	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr12:88910260T>C	ENST00000228280.5	-	5	553	c.371A>G	c.(370-372)aAa>aGa	p.K124R	KITLG_ENST00000347404.5_Missense_Mutation_p.K124R|KITLG_ENST00000378535.4_5'UTR|KITLG_ENST00000357116.4_Intron	NM_000899.4	NP_000890.1	P21583	SCF_HUMAN	KIT ligand	124					cell adhesion (GO:0007155)|cell proliferation (GO:0008283)|ectopic germ cell programmed cell death (GO:0035234)|embryonic hemopoiesis (GO:0035162)|epidermal growth factor receptor signaling pathway (GO:0007173)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|male gonad development (GO:0008584)|negative regulation of mast cell apoptotic process (GO:0033026)|neural crest cell migration (GO:0001755)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of DNA replication (GO:0045740)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of mast cell proliferation (GO:0070668)|positive regulation of melanocyte differentiation (GO:0045636)|positive regulation of myeloid leukocyte differentiation (GO:0002763)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of Ras protein signal transduction (GO:0046579)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	stem cell factor receptor binding (GO:0005173)			kidney(2)|large_intestine(3)|lung(1)|ovary(1)|prostate(1)|stomach(1)	9						GAATGATTTTTTTAGATCCTA	0.333									Testicular Cancer, Familial Clustering of																												p.K124R		Atlas-SNP	.											.	KITLG	26	.	0			c.A371G						.						28.0	31.0	30.0					12																	88910260		2187	4288	6475	SO:0001583	missense	4254	exon5	Familial Cancer Database		GATTTTTTTAGAT	M59964	CCDS31867.1, CCDS31868.1	12q22	2010-11-23			ENSG00000049130	ENSG00000049130			6343	protein-coding gene	gene with protein product	"""mast cell growth factor"", ""stem cell factor"", ""steel factor"", ""familial progressive hyperpigmentation 2"""	184745		MGF		2208279, 1707188, 19375057	Standard	NM_003994		Approved	SCF, SF, Kitl, KL-1, FPH2	uc001tav.3	P21583	OTTHUMG00000169888	ENST00000228280.5:c.371A>G	chr12.hg19:g.88910260T>C	ENSP00000228280:p.Lys124Arg	69.0	0.0		44.0	22.0	NM_003994	A0AV09|A8K2Q4|B7ZLM4|Q16487|Q68DZ2|Q7M4N8|Q9UQK7	Missense_Mutation	SNP	ENST00000228280.5	hg19	CCDS31868.1	.	.	.	.	.	.	.	.	.	.	T	10.89	1.479636	0.26511	.	.	ENSG00000049130	ENST00000378535;ENST00000228280;ENST00000347404	T;T	0.70749	-0.51;-0.51	4.96	2.16	0.27623	Four-helical cytokine-like, core (1);Four-helical cytokine, core (1);	0.581480	0.19732	N	0.107326	T	0.56062	0.1960	L	0.45581	1.43	0.19300	N	0.999971	B;B	0.14012	0.007;0.009	B;B	0.12156	0.002;0.007	T	0.40794	-0.9544	10	0.32370	T	0.25	-3.6834	3.2753	0.06896	0.3762:0.1519:0.0:0.4719	.	124;124	P21583-2;P21583	.;SCF_HUMAN	R	89;124;124	ENSP00000228280:K124R;ENSP00000054216:K124R	ENSP00000228280:K124R	K	-	2	0	KITLG	87434391	0.994000	0.37717	0.928000	0.36995	0.291000	0.27294	0.230000	0.17852	0.701000	0.31803	0.482000	0.46254	AAA	.	.		0.333	KITLG-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406424.2	NM_003994	
DCN	1634	hgsc.bcm.edu	37	12	91546950	91546950	+	Silent	SNP	A	A	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr12:91546950A>T	ENST00000052754.5	-	6	1170	c.669T>A	c.(667-669)ctT>ctA	p.L223L	DCN_ENST00000456569.2_Intron|DCN_ENST00000425043.1_Silent_p.L76L|DCN_ENST00000547568.2_Silent_p.L76L|DCN_ENST00000393155.1_Silent_p.L223L|DCN_ENST00000441303.2_Intron|DCN_ENST00000228329.5_Silent_p.L114L|DCN_ENST00000420120.2_Silent_p.L114L|DCN_ENST00000303320.3_Intron|DCN_ENST00000552962.1_Silent_p.L223L	NM_001920.3	NP_001911.1	P07585	PGS2_HUMAN	decorin	223					aging (GO:0007568)|carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan metabolic process (GO:0030203)|kidney development (GO:0001822)|organ morphogenesis (GO:0009887)|peptide cross-linking via chondroitin 4-sulfate glycosaminoglycan (GO:0019800)|placenta development (GO:0001890)|response to lipopolysaccharide (GO:0032496)|response to mechanical stimulus (GO:0009612)|skeletal muscle tissue development (GO:0007519)|small molecule metabolic process (GO:0044281)|wound healing (GO:0042060)	collagen type VI trimer (GO:0005589)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix binding (GO:0050840)|glycosaminoglycan binding (GO:0005539)|poly(A) RNA binding (GO:0044822)			central_nervous_system(2)|cervix(1)|kidney(2)|large_intestine(4)|liver(1)|lung(8)|ovary(1)|skin(1)	20						GTAATTCCGTAAGGGAAGGAG	0.353																																					p.L223L		Atlas-SNP	.											.	DCN	61	.	0			c.T669A						.						123.0	117.0	119.0					12																	91546950		2203	4300	6503	SO:0001819	synonymous_variant	1634	exon6			TTCCGTAAGGGAA	AF138300	CCDS9039.1, CCDS9040.1, CCDS9041.1, CCDS9042.1, CCDS44951.1	12q21.33	2014-04-16			ENSG00000011465	ENSG00000011465		"""Proteoglycans / Extracellular Matrix : Small leucine-rich repeats"""	2705	protein-coding gene	gene with protein product	"""decorin proteoglycan"""	125255				8432526	Standard	NM_133507		Approved	DSPG2, SLRR1B	uc001tbt.3	P07585	OTTHUMG00000169998	ENST00000052754.5:c.669T>A	chr12.hg19:g.91546950A>T		100.0	0.0		82.0	37.0	NM_001920	Q9P0Z0|Q9P0Z1|Q9Y5N8|Q9Y5N9	Silent	SNP	ENST00000052754.5	hg19	CCDS9039.1																																																																																			.	.		0.353	DCN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406799.3	NM_133507	
IFT81	28981	hgsc.bcm.edu	37	12	110565247	110565247	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr12:110565247A>G	ENST00000242591.5	+	2	568	c.62A>G	c.(61-63)tAt>tGt	p.Y21C	IFT81_ENST00000361948.4_Missense_Mutation_p.Y21C|IFT81_ENST00000552912.1_Missense_Mutation_p.Y21C	NM_014055.3	NP_054774.2	Q8WYA0	IFT81_HUMAN	intraflagellar transport 81	21	CH (calponin-homology)-like region.				cilium assembly (GO:0042384)|intraciliary transport involved in cilium morphogenesis (GO:0035735)|spermatogenesis (GO:0007283)	centrosome (GO:0005813)|cilium (GO:0005929)|intraciliary transport particle B (GO:0030992)|motile cilium (GO:0031514)|sperm midpiece (GO:0097225)|sperm principal piece (GO:0097228)	tubulin binding (GO:0015631)			endometrium(1)|large_intestine(2)|lung(5)|ovary(1)|stomach(1)	10						AGGAAGAACTATAATTTAATC	0.328																																					p.Y21C		Atlas-SNP	.											.	IFT81	86	.	0			c.A62G						.						51.0	49.0	50.0					12																	110565247		2203	4300	6503	SO:0001583	missense	28981	exon2			AGAACTATAATTT	AF139540	CCDS9142.1, CCDS41831.1	12q24.13	2014-07-03	2014-07-03	2005-11-02		ENSG00000122970		"""Intraflagellar transport homologs"""	14313	protein-coding gene	gene with protein product		605489	"""carnitine deficiency-associated, expressed in ventricle 1"", ""intraflagellar transport 81 homolog (Chlamydomonas)"""	CDV1		11130971	Standard	NM_014055		Approved	CDV-1R, MGC4027	uc001tqi.3	Q8WYA0	OTTHUMG00000169326	ENST00000242591.5:c.62A>G	chr12.hg19:g.110565247A>G	ENSP00000242591:p.Tyr21Cys	249.0	0.0		249.0	83.0	NM_014055	Q2YDY1|Q8NB51|Q9BSV2|Q9UNY8	Missense_Mutation	SNP	ENST00000242591.5	hg19	CCDS41831.1	.	.	.	.	.	.	.	.	.	.	A	18.46	3.628421	0.67015	.	.	ENSG00000122970	ENST00000361948;ENST00000552912;ENST00000242591;ENST00000546374	T;T;T;T	0.78707	-1.2;-1.2;-1.2;-1.2	6.11	6.11	0.99139	.	0.051364	0.85682	D	0.000000	D	0.85410	0.5690	M	0.71036	2.16	0.80722	D	1	D;D	0.71674	0.995;0.998	P;D	0.63113	0.893;0.911	D	0.86884	0.2044	10	0.87932	D	0	-13.764	12.3276	0.55020	0.8735:0.0:0.0:0.1265	.	21;21	Q8WYA0;Q8WYA0-3	IFT81_HUMAN;.	C	21	ENSP00000355372:Y21C;ENSP00000449718:Y21C;ENSP00000242591:Y21C;ENSP00000446950:Y21C	ENSP00000242591:Y21C	Y	+	2	0	IFT81	109049630	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.063000	0.64332	2.343000	0.79666	0.533000	0.62120	TAT	.	.		0.328	IFT81-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403529.1	NM_014055	
HECTD4	283450	hgsc.bcm.edu	37	12	112688787	112688787	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr12:112688787T>A	ENST00000430131.2	-	23	3583	c.2438A>T	c.(2437-2439)aAa>aTa	p.K813I	HECTD4_ENST00000550722.1_Missense_Mutation_p.K1089I|HECTD4_ENST00000377560.5_Missense_Mutation_p.K1063I			Q9Y4D8	HECD4_HUMAN	HECT domain containing E3 ubiquitin protein ligase 4	813					glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)										TTGTAAAAGTTTGGACCGCAA	0.393																																					p.K1101I		Atlas-SNP	.											.	.	.	.	0			c.A3302T						.						84.0	77.0	79.0					12																	112688787		2203	4300	6503	SO:0001583	missense	283450	exon24			AAAAGTTTGGACC	AK091473		12q24.13	2013-07-17	2012-08-14	2012-08-14	ENSG00000173064	ENSG00000173064			26611	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 51"""	C12orf51		21270382	Standard	NM_001109662		Approved	FLJ34154, KIAA0614	uc021reb.1	Q9Y4D8	OTTHUMG00000150719	ENST00000430131.2:c.2438A>T	chr12.hg19:g.112688787T>A	ENSP00000404379:p.Lys813Ile	158.0	0.0		127.0	58.0	NM_001109662	L8B0P6|Q3MJD5|Q6P0A0|Q7L530|Q8NB70|Q8WU73|Q96NT9|Q9NZS4|Q9UFT6	Missense_Mutation	SNP	ENST00000430131.2	hg19		.	.	.	.	.	.	.	.	.	.	T	21.1	4.096356	0.76870	.	.	ENSG00000173064	ENST00000377560;ENST00000430131;ENST00000550722	T;T;T	0.57107	0.42;0.42;0.59	5.82	5.82	0.92795	.	0.000000	0.85682	D	0.000000	T	0.59487	0.2197	N	0.19112	0.55	0.53005	D	0.999964	D;P;D	0.69078	0.997;0.769;0.997	D;P;D	0.78314	0.991;0.451;0.991	T	0.65195	-0.6227	10	0.87932	D	0	.	15.3625	0.74492	0.0:0.0:0.0:1.0	.	813;813;803	Q9Y4D8-2;Q9Y4D8;Q9Y4D8-3	.;K0614_HUMAN;.	I	1063;813;1089	ENSP00000366783:K1063I;ENSP00000404379:K813I;ENSP00000449784:K1089I	ENSP00000366783:K1063I	K	-	2	0	C12orf51	111173170	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.671000	0.83941	2.234000	0.73211	0.533000	0.62120	AAA	.	.		0.393	HECTD4-202	KNOWN	basic	protein_coding	protein_coding		NM_173813	
MED13L	23389	hgsc.bcm.edu	37	12	116446847	116446847	+	Silent	SNP	T	T	C			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr12:116446847T>C	ENST00000281928.3	-	10	1577	c.1371A>G	c.(1369-1371)tcA>tcG	p.S457S		NM_015335.4	NP_056150.1	Q71F56	MD13L_HUMAN	mediator complex subunit 13-like	457						mediator complex (GO:0016592)	RNA polymerase II transcription cofactor activity (GO:0001104)			NS(2)|breast(1)|endometrium(9)|kidney(3)|large_intestine(18)|lung(34)|ovary(4)|prostate(4)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	85	all_neural(191;0.117)|Medulloblastoma(191;0.163)			BRCA - Breast invasive adenocarcinoma(302;0.0407)		GTGGTAAAGATGAAGATGATG	0.453																																					p.S457S		Atlas-SNP	.											.	MED13L	193	.	0			c.A1371G						.						209.0	202.0	205.0					12																	116446847		2203	4300	6503	SO:0001819	synonymous_variant	23389	exon10			TAAAGATGAAGAT	AB028948	CCDS9177.1	12q24.22	2010-07-29	2007-07-30	2007-07-30	ENSG00000123066	ENSG00000123066			22962	protein-coding gene	gene with protein product		608771	"""thyroid hormone receptor associated protein 2"""	THRAP2			Standard	NM_015335		Approved	KIAA1025, TRAP240L	uc001tvw.3	Q71F56	OTTHUMG00000169404	ENST00000281928.3:c.1371A>G	chr12.hg19:g.116446847T>C		123.0	0.0		123.0	41.0	NM_015335	A1L469|Q68DN4|Q9H8C0|Q9NSY9|Q9UFD8|Q9UPX5	Silent	SNP	ENST00000281928.3	hg19	CCDS9177.1																																																																																			.	.		0.453	MED13L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403879.3		
SRRM4	84530	hgsc.bcm.edu	37	12	119554788	119554788	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr12:119554788A>T	ENST00000267260.4	+	4	800	c.412A>T	c.(412-414)Agt>Tgt	p.S138C	RP11-364C11.2_ENST00000537730.1_RNA	NM_194286.3	NP_919262.2	A7MD48	SRRM4_HUMAN	serine/arginine repetitive matrix 4	138	Lys-rich.|Ser-rich.				cell differentiation (GO:0030154)|mRNA processing (GO:0006397)|nervous system development (GO:0007399)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)|sensory perception of sound (GO:0007605)	nucleus (GO:0005634)	mRNA binding (GO:0003729)			breast(2)|central_nervous_system(2)|endometrium(5)|kidney(1)|large_intestine(2)|lung(8)|ovary(3)|upper_aerodigestive_tract(1)	24						GAAGAAGAAAAGTTCCAAGAA	0.493																																					p.S138C		Atlas-SNP	.											.	SRRM4	131	.	0			c.A412T						.						76.0	71.0	72.0					12																	119554788		1851	4093	5944	SO:0001583	missense	84530	exon4			AAGAAAAGTTCCA	AB058756	CCDS44994.1	12q24.23	2009-09-22	2009-09-21	2009-09-21	ENSG00000139767	ENSG00000139767			29389	protein-coding gene	gene with protein product	"""neural-specific SR-related protein of 100 kDa"""	613103	"""KIAA1853"""	KIAA1853		19737518	Standard	NM_194286		Approved	nSR100	uc001txa.2	A7MD48	OTTHUMG00000168928	ENST00000267260.4:c.412A>T	chr12.hg19:g.119554788A>T	ENSP00000267260:p.Ser138Cys	70.0	0.0		60.0	25.0	NM_194286	A8K5P6|B2RZH7|Q7Z5F0|Q96JH4	Missense_Mutation	SNP	ENST00000267260.4	hg19	CCDS44994.1	.	.	.	.	.	.	.	.	.	.	A	15.48	2.844623	0.51164	.	.	ENSG00000139767	ENST00000267260	T	0.32988	1.43	5.46	1.8	0.24995	.	0.251456	0.44285	D	0.000475	T	0.38852	0.1056	L	0.61218	1.895	0.28639	N	0.907261	D	0.53885	0.963	P	0.54026	0.74	T	0.25916	-1.0118	10	0.54805	T	0.06	-2.6946	7.5081	0.27558	0.7401:0.0:0.2599:0.0	.	138	A7MD48	SRRM4_HUMAN	C	138	ENSP00000267260:S138C	ENSP00000267260:S138C	S	+	1	0	SRRM4	118039171	1.000000	0.71417	0.994000	0.49952	0.995000	0.86356	1.570000	0.36439	0.115000	0.18071	-0.264000	0.10439	AGT	.	.		0.493	SRRM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401640.2	NM_194286	
CIT	11113	hgsc.bcm.edu	37	12	120271925	120271925	+	Silent	SNP	A	A	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr12:120271925A>T	ENST00000261833.7	-	6	676	c.624T>A	c.(622-624)gcT>gcA	p.A208A	CIT_ENST00000392521.2_Silent_p.A208A	NM_007174.2	NP_009105.1	O14578	CTRO_HUMAN	citron rho-interacting serine/threonine kinase	208	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cytokinesis (GO:0000910)|dendrite development (GO:0016358)|G2/M transition of mitotic cell cycle (GO:0000086)|generation of neurons (GO:0048699)|Golgi organization (GO:0007030)|intracellular signal transduction (GO:0035556)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic nuclear division (GO:0007067)|mitotic sister chromatid segregation (GO:0000070)|negative regulation of dendrite morphogenesis (GO:0050774)|regulation of actin polymerization or depolymerization (GO:0008064)|spermatogenesis (GO:0007283)	actin cytoskeleton (GO:0015629)|Golgi cisterna (GO:0031985)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|vacuole (GO:0005773)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|PDZ domain binding (GO:0030165)|protein serine/threonine kinase activity (GO:0004674)|small GTPase regulator activity (GO:0005083)			breast(6)|endometrium(9)|kidney(4)|large_intestine(15)|liver(1)|lung(29)|ovary(7)|prostate(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(6)	86	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)	Myeloproliferative disorder(1001;0.0255)		BRCA - Breast invasive adenocarcinoma(302;0.211)		CGCTGTGAACAGCCAAAATCA	0.438																																					p.A208A		Atlas-SNP	.											.	CIT	535	.	0			c.T624A						.						129.0	111.0	117.0					12																	120271925		2203	4300	6503	SO:0001819	synonymous_variant	11113	exon6			GTGAACAGCCAAA	AB023166	CCDS9192.1, CCDS55891.1	12q24.23	2014-04-23	2014-04-23		ENSG00000122966	ENSG00000122966			1985	protein-coding gene	gene with protein product	"""serine/threonine kinase 21"""	605629	"""citron (rho-interacting, serine/threonine kinase 21)"""			9792683	Standard	NM_001206999		Approved	KIAA0949, STK21, CRIK	uc001txj.2	O14578	OTTHUMG00000134325	ENST00000261833.7:c.624T>A	chr12.hg19:g.120271925A>T		147.0	0.0		122.0	45.0	NM_001206999	Q2M5E1|Q6XUH8|Q86UQ9|Q9UPZ7	Silent	SNP	ENST00000261833.7	hg19	CCDS9192.1																																																																																			.	.		0.438	CIT-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000259410.4	NM_007174	
WDR66	144406	hgsc.bcm.edu	37	12	122413230	122413230	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr12:122413230A>G	ENST00000288912.4	+	18	3706	c.2852A>G	c.(2851-2853)aAa>aGa	p.K951R		NM_144668.5	NP_653269.3	Q8TBY9	WDR66_HUMAN	WD repeat domain 66	951							calcium ion binding (GO:0005509)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(11)|liver(2)|lung(13)|ovary(2)|prostate(2)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	43	all_neural(191;0.0496)|Medulloblastoma(191;0.0922)			OV - Ovarian serous cystadenocarcinoma(86;0.000155)|Epithelial(86;0.000634)|BRCA - Breast invasive adenocarcinoma(302;0.248)		CGGGAAGGAAAATTCTACAGG	0.463																																					p.K951R	Esophageal Squamous(85;849 1794 49757 52143)	Atlas-SNP	.											.	WDR66	143	.	0			c.A2852G						.						81.0	83.0	83.0					12																	122413230		2021	4185	6206	SO:0001583	missense	144406	exon18			AAGGAAAATTCTA	AL833930	CCDS41853.1, CCDS53840.1	12q24.31	2014-07-31			ENSG00000158023	ENSG00000158023		"""WD repeat domain containing"""	28506	protein-coding gene	gene with protein product						17967944	Standard	NM_001178003		Approved	MGC33630, CaM-IP4	uc009zxk.3	Q8TBY9	OTTHUMG00000168948	ENST00000288912.4:c.2852A>G	chr12.hg19:g.122413230A>G	ENSP00000288912:p.Lys951Arg	200.0	0.0		156.0	55.0	NM_144668	C9J1W2|Q8IYA3|Q8N898|Q8NDE7	Missense_Mutation	SNP	ENST00000288912.4	hg19	CCDS41853.1	.	.	.	.	.	.	.	.	.	.	A	13.65	2.299165	0.40694	.	.	ENSG00000158023	ENST00000288912	T	0.05139	3.49	5.41	4.26	0.50523	.	0.643093	0.16036	N	0.232659	T	0.04182	0.0116	N	0.22421	0.69	0.80722	D	1	B	0.22211	0.066	B	0.17098	0.017	T	0.38908	-0.9639	10	0.13108	T	0.6	.	6.9235	0.24401	0.7937:0.0:0.0729:0.1334	.	951	Q8TBY9	WDR66_HUMAN	R	951	ENSP00000288912:K951R	ENSP00000288912:K951R	K	+	2	0	WDR66	120897613	0.997000	0.39634	0.999000	0.59377	0.981000	0.71138	2.124000	0.42006	0.892000	0.36259	0.460000	0.39030	AAA	.	.		0.463	WDR66-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401700.1	NM_144668	
TMEM132B	114795	hgsc.bcm.edu	37	12	126138603	126138603	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr12:126138603A>G	ENST00000299308.3	+	9	2592	c.2584A>G	c.(2584-2586)Aaa>Gaa	p.K862E	TMEM132B_ENST00000535886.1_Missense_Mutation_p.K374E	NM_052907.2	NP_443139.2	Q14DG7	T132B_HUMAN	transmembrane protein 132B	862						integral component of membrane (GO:0016021)				NS(1)|breast(9)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(11)|liver(1)|lung(45)|ovary(5)|pancreas(1)|prostate(4)|skin(15)|upper_aerodigestive_tract(3)|urinary_tract(1)	107	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000423)|Epithelial(86;0.00394)|all cancers(50;0.0362)		TAAGTTACTCAAAAGTGGTGG	0.522																																					p.K862E		Atlas-SNP	.											.	TMEM132B	207	.	0			c.A2584G						.						62.0	61.0	61.0					12																	126138603		1937	4125	6062	SO:0001583	missense	114795	exon9			TTACTCAAAAGTG	AB067493	CCDS41859.1, CCDS66501.1	12q24.31	2006-03-02							29397	protein-coding gene	gene with protein product						11572484	Standard	NM_001286219		Approved	KIAA1906, KIAA1786	uc001uhe.1	Q14DG7		ENST00000299308.3:c.2584A>G	chr12.hg19:g.126138603A>G	ENSP00000299308:p.Lys862Glu	132.0	0.0		91.0	44.0	NM_052907	A2RRG8|Q8NA73|Q96JN9|Q96PY1	Missense_Mutation	SNP	ENST00000299308.3	hg19	CCDS41859.1	.	.	.	.	.	.	.	.	.	.	A	2.696	-0.271980	0.05716	.	.	ENSG00000139364	ENST00000299308;ENST00000535886	T;T	0.13657	2.57;2.57	5.15	2.78	0.32641	.	1.853410	0.02513	N	0.091793	T	0.07188	0.0182	N	0.17082	0.46	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.35001	-0.9806	10	0.06365	T	0.9	.	0.2151	0.00161	0.2959:0.2961:0.1783:0.2297	.	862	Q14DG7	T132B_HUMAN	E	862;374	ENSP00000299308:K862E;ENSP00000440436:K374E	ENSP00000299308:K862E	K	+	1	0	TMEM132B	124704556	0.975000	0.34042	0.007000	0.13788	0.718000	0.41266	3.214000	0.51161	0.777000	0.33496	0.533000	0.62120	AAA	.	.		0.522	TMEM132B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000400043.1	NM_052907	
GPR133	283383	hgsc.bcm.edu	37	12	131456098	131456098	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr12:131456098A>G	ENST00000261654.5	+	4	842	c.283A>G	c.(283-285)Agc>Ggc	p.S95G	GPR133_ENST00000535015.1_Missense_Mutation_p.S127G	NM_198827.3	NP_942122.2	Q6QNK2	GP133_HUMAN	G protein-coupled receptor 133	95					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(2)|breast(2)|endometrium(6)|kidney(1)|large_intestine(12)|lung(20)|ovary(3)|pancreas(6)|prostate(6)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(4)	67	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.68e-06)|all cancers(50;2.71e-06)|Epithelial(86;6.75e-06)		CTCCTGCATCAGCAAGCCAGA	0.512																																					p.S95G		Atlas-SNP	.											.	GPR133	136	.	0			c.A283G						.						73.0	60.0	64.0					12																	131456098		2203	4300	6503	SO:0001583	missense	283383	exon4			TGCATCAGCAAGC	AY278561	CCDS9272.1	12q24.33	2014-08-08			ENSG00000111452	ENSG00000111452		"""-"", ""GPCR / Class B : Orphans"""	19893	protein-coding gene	gene with protein product		613639					Standard	NM_198827		Approved	DKFZp434B1272, PGR25	uc001uit.4	Q6QNK2	OTTHUMG00000168339	ENST00000261654.5:c.283A>G	chr12.hg19:g.131456098A>G	ENSP00000261654:p.Ser95Gly	85.0	0.0		77.0	34.0	NM_198827	B2CKK9|B7ZLF7|Q2M1L3|Q6ZMQ1|Q7Z7M2|Q86SM4	Missense_Mutation	SNP	ENST00000261654.5	hg19	CCDS9272.1	.	.	.	.	.	.	.	.	.	.	A	15.50	2.852193	0.51270	.	.	ENSG00000111452	ENST00000261654;ENST00000542091;ENST00000535015	T;T;T	0.60040	0.5;0.22;0.52	4.73	4.73	0.59995	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);	0.100619	0.64402	D	0.000003	T	0.69762	0.3147	M	0.70595	2.14	0.80722	D	1	D;D	0.58620	0.983;0.979	P;P	0.59171	0.853;0.807	T	0.73783	-0.3874	10	0.72032	D	0.01	.	11.9648	0.53029	1.0:0.0:0.0:0.0	.	127;95	B7ZLF7;Q6QNK2	.;GP133_HUMAN	G	95;95;127	ENSP00000261654:S95G;ENSP00000442501:S95G;ENSP00000444425:S127G	ENSP00000261654:S95G	S	+	1	0	GPR133	130022051	1.000000	0.71417	0.018000	0.16275	0.002000	0.02628	6.032000	0.70918	1.775000	0.52247	0.533000	0.62120	AGC	.	.		0.512	GPR133-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399356.1	NM_198827	
ULK1	8408	hgsc.bcm.edu	37	12	132393332	132393332	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr12:132393332G>T	ENST00000321867.4	+	6	811	c.460G>T	c.(460-462)Gcc>Tcc	p.A154S		NM_003565.2	NP_003556	O75385	ULK1_HUMAN	unc-51 like autophagy activating kinase 1	154	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				autophagic vacuole assembly (GO:0000045)|axon extension (GO:0048675)|cellular response to nutrient levels (GO:0031669)|cerebellar granule cell differentiation (GO:0021707)|negative regulation of collateral sprouting (GO:0048671)|neuron projection development (GO:0031175)|neuron projection regeneration (GO:0031102)|positive regulation of autophagy (GO:0010508)|positive regulation of macroautophagy (GO:0016239)|protein autophosphorylation (GO:0046777)|protein localization (GO:0008104)|protein phosphorylation (GO:0006468)|radial glia guided migration of cerebellar granule cell (GO:0021933)|Ras protein signal transduction (GO:0007265)|receptor internalization (GO:0031623)|regulation of autophagy (GO:0010506)|regulation of neurotrophin TRK receptor signaling pathway (GO:0051386)|response to starvation (GO:0042594)	ATG1/UKL1 signaling complex (GO:0034273)|autophagic vacuole (GO:0005776)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|extrinsic component of autophagic vacuole membrane (GO:0097635)|extrinsic component of omegasome membrane (GO:0097629)|extrinsic component of pre-autophagosomal structure membrane (GO:0097632)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|pre-autophagosomal structure membrane (GO:0034045)|ULK1-ATG13-FIP200 complex (GO:0070969)	ATP binding (GO:0005524)|protein complex binding (GO:0032403)|protein serine/threonine kinase activity (GO:0004674)|Rab GTPase binding (GO:0017137)			breast(1)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(11)|ovary(1)|prostate(2)|skin(2)|urinary_tract(2)	29	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;2.07e-08)|Epithelial(86;2.56e-07)|all cancers(50;3.01e-07)		CGGCCGCCGCGCCAACCCCAA	0.721																																					p.A154S		Atlas-SNP	.											.	ULK1	92	.	0			c.G460T						.						19.0	23.0	21.0					12																	132393332		2197	4290	6487	SO:0001583	missense	8408	exon6			CGCCGCGCCAACC	AF045458	CCDS9274.1	12q24.3	2014-02-12	2013-07-02		ENSG00000177169	ENSG00000177169			12558	protein-coding gene	gene with protein product	"""ATG1 autophagy related 1 homolog (S. cerevisiae)"""	603168	"""unc-51 (C. elegans)-like kinase 1"", ""unc-51-like kinase 1 (C. elegans)"""			9693035	Standard	NM_003565		Approved	ATG1, ATG1A	uc001uje.3	O75385	OTTHUMG00000168052	ENST00000321867.4:c.460G>T	chr12.hg19:g.132393332G>T	ENSP00000324560:p.Ala154Ser	44.0	0.0		37.0	19.0	NM_003565	Q9UQ28	Missense_Mutation	SNP	ENST00000321867.4	hg19	CCDS9274.1	.	.	.	.	.	.	.	.	.	.	G	8.845	0.943181	0.18281	.	.	ENSG00000177169	ENST00000321867;ENST00000537421;ENST00000542313	T;T;T	0.72942	-0.29;-0.7;-0.27	5.51	2.36	0.29203	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.067840	0.64402	D	0.000011	T	0.43188	0.1236	N	0.10874	0.06	0.80722	D	1	B	0.13145	0.007	B	0.15052	0.012	T	0.18178	-1.0345	10	0.07482	T	0.82	-30.3342	7.4252	0.27094	0.0878:0.0:0.3662:0.546	.	154	O75385	ULK1_HUMAN	S	154;71;48	ENSP00000324560:A154S;ENSP00000438953:A71S;ENSP00000444983:A48S	ENSP00000324560:A154S	A	+	1	0	ULK1	130959285	0.998000	0.40836	0.902000	0.35471	0.960000	0.62799	2.453000	0.44970	0.676000	0.31285	0.455000	0.32223	GCC	.	.		0.721	ULK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397769.3		
PUS1	80324	hgsc.bcm.edu	37	12	132423731	132423731	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr12:132423731C>A	ENST00000376649.3	+	4	955	c.455C>A	c.(454-456)gCc>gAc	p.A152D	PUS1_ENST00000440818.2_Missense_Mutation_p.A124D|PUS1_ENST00000542167.2_Missense_Mutation_p.A99D|PUS1_ENST00000443358.2_Missense_Mutation_p.A124D|PUS1_ENST00000535067.1_Intron	NM_025215.5	NP_079491.2	Q9Y606	TRUA_HUMAN	pseudouridylate synthase 1	152					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|tRNA pseudouridine synthesis (GO:0031119)	mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|transcription factor complex (GO:0005667)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|poly(A) RNA binding (GO:0044822)|pseudouridine synthase activity (GO:0009982)|pseudouridylate synthase activity (GO:0004730)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(3)|ovary(1)|skin(1)	11	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;2.05e-08)|Epithelial(86;2.51e-07)|all cancers(50;2.94e-07)		GTGTCCGCAGCCGGCCAGGTG	0.557																																					p.A152D	Esophageal Squamous(102;671 2009 17384 45666)	Atlas-SNP	.											.	PUS1	47	.	0			c.C455A						.						78.0	53.0	62.0					12																	132423731		2192	4274	6466	SO:0001583	missense	80324	exon4			CCGCAGCCGGCCA	AF116238	CCDS9275.2, CCDS31928.1	12q24	2004-05-17			ENSG00000177192	ENSG00000177192			15508	protein-coding gene	gene with protein product		608109				10094309	Standard	NM_001002019		Approved		uc001ujf.3	Q9Y606	OTTHUMG00000128507	ENST00000376649.3:c.455C>A	chr12.hg19:g.132423731C>A	ENSP00000365837:p.Ala152Asp	100.0	0.0		88.0	42.0	NM_025215	A8K877|B3KQC1|Q8WYT2|Q9BU44	Missense_Mutation	SNP	ENST00000376649.3	hg19	CCDS9275.2	.	.	.	.	.	.	.	.	.	.	C	18.22	3.575321	0.65878	.	.	ENSG00000177192	ENST00000443358;ENST00000376649;ENST00000322060;ENST00000440818;ENST00000542167;ENST00000538037	T;T;T;T;T;T	0.57752	0.38;0.38;0.38;0.38;0.38;0.38	4.83	3.94	0.45596	Pseudouridine synthase I, TruA, N-terminal (1);Pseudouridine synthase, catalytic domain (1);Pseudouridine synthase I, TruA, alpha/beta domain (1);	0.052313	0.85682	D	0.000000	T	0.74816	0.3766	M	0.89478	3.035	0.58432	D	0.999996	D;D	0.67145	0.996;0.994	D;D	0.71656	0.956;0.974	T	0.79964	-0.1581	10	0.62326	D	0.03	-22.042	13.6514	0.62312	0.0:0.9242:0.0:0.0758	.	99;152	F5H1S9;Q9Y606	.;TRUA_HUMAN	D	124;152;124;124;99;124	ENSP00000392451:A124D;ENSP00000365837:A152D;ENSP00000324726:A124D;ENSP00000400032:A124D;ENSP00000438948:A99D;ENSP00000440326:A124D	ENSP00000324726:A124D	A	+	2	0	PUS1	130989684	0.999000	0.42202	0.124000	0.21820	0.764000	0.43329	4.009000	0.57110	1.167000	0.42706	0.305000	0.20034	GCC	.	.		0.557	PUS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000250313.2	NM_025215	
MTUS2	23281	hgsc.bcm.edu	37	13	30066785	30066785	+	Silent	SNP	T	T	C			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr13:30066785T>C	ENST00000380808.2	+	5	661	c.445T>C	c.(445-447)Ttg>Ctg	p.L149L	MTUS2-AS1_ENST00000323380.5_RNA|MTUS2_ENST00000431530.3_Silent_p.L1180L|MTUS2_ENST00000542829.1_Silent_p.L59L	NM_015233.5	NP_056048.1	Q5JR59	MTUS2_HUMAN	microtubule associated tumor suppressor candidate 2	1170						cytoplasm (GO:0005737)|microtubule (GO:0005874)	microtubule binding (GO:0008017)|protein homodimerization activity (GO:0042803)			NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(3)|prostate(1)|skin(1)	20						CTTTCCAGAATTGATGTCCAC	0.348																																					p.L1180L		Atlas-SNP	.											.	MTUS2	279	.	0			c.T3538C						.						88.0	80.0	82.0					13																	30066785		1812	4075	5887	SO:0001819	synonymous_variant	23281	exon10			CCAGAATTGATGT	AB018317	CCDS41874.1, CCDS45022.1	13q12.3	2013-01-17	2009-10-20	2009-10-20	ENSG00000132938	ENSG00000132938			20595	protein-coding gene	gene with protein product	"""+TIP of 150 kDa"", ""cardiac zipper protein"""		"""KIAA0774"""	KIAA0774		19543227	Standard	NM_001033602		Approved	TIP150, CAZIP, ICIS	uc001usl.4	Q5JR59	OTTHUMG00000016657	ENST00000380808.2:c.445T>C	chr13.hg19:g.30066785T>C		99.0	0.0		98.0	35.0	NM_001033602	A7E292|B4DF81|O94872|Q08E97|Q5JQR3|Q8N5E2	Silent	SNP	ENST00000380808.2	hg19	CCDS41874.1																																																																																			.	.		0.348	MTUS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044335.2	XM_166270	
NBEA	26960	hgsc.bcm.edu	37	13	35729982	35729982	+	Silent	SNP	T	T	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr13:35729982T>A	ENST00000400445.3	+	19	3051	c.2517T>A	c.(2515-2517)atT>atA	p.I839I	NBEA_ENST00000379939.2_Silent_p.I839I|NBEA_ENST00000310336.4_Silent_p.I839I|NBEA_ENST00000540320.1_Silent_p.I839I	NM_015678.4	NP_056493.3	Q8NFP9	NBEA_HUMAN	neurobeachin	839					protein localization (GO:0008104)	cytosol (GO:0005829)|endomembrane system (GO:0012505)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)				NS(1)|breast(1)|endometrium(14)|kidney(4)|large_intestine(29)|lung(40)|ovary(9)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	108		Breast(139;0.0141)|Lung SC(185;0.0548)|Prostate(109;0.207)		all cancers(112;1.93e-08)|Epithelial(112;1.62e-07)|BRCA - Breast invasive adenocarcinoma(63;0.00033)|OV - Ovarian serous cystadenocarcinoma(117;0.00109)|KIRC - Kidney renal clear cell carcinoma(186;0.00575)|Kidney(163;0.00656)|GBM - Glioblastoma multiforme(144;0.191)|Lung(94;0.199)		CAGTGAAAATTCAGAATCCAA	0.373																																					p.I839I		Atlas-SNP	.											.	NBEA	340	.	0			c.T2517A						.						110.0	105.0	107.0					13																	35729982		1897	4124	6021	SO:0001819	synonymous_variant	26960	exon19			GAAAATTCAGAAT	AF467288	CCDS45026.1, CCDS55894.1	13q13	2014-09-17			ENSG00000172915	ENSG00000172915		"""A-kinase anchor proteins"", ""WD repeat domain containing"""	7648	protein-coding gene	gene with protein product		604889				10501977	Standard	NM_015678		Approved	KIAA1544, BCL8B, FLJ10197	uc021ric.1	Q8NFP9	OTTHUMG00000016724	ENST00000400445.3:c.2517T>A	chr13.hg19:g.35729982T>A		62.0	0.0		90.0	18.0	NM_015678	B7Z2H9|Q5T320|Q9HCM8|Q9NSU1|Q9NW98|Q9Y6J1	Silent	SNP	ENST00000400445.3	hg19	CCDS45026.1																																																																																			.	.		0.373	NBEA-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_015678	
MAB21L1	4081	hgsc.bcm.edu	37	13	36049699	36049699	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr13:36049699G>T	ENST00000379919.4	-	1	1133	c.577C>A	c.(577-579)Ccc>Acc	p.P193T	NBEA_ENST00000400445.3_Intron|NBEA_ENST00000379939.2_Intron|NBEA_ENST00000310336.4_Intron|NBEA_ENST00000537702.1_5'Flank|NBEA_ENST00000540320.1_Intron	NM_005584.4	NP_005575.1	Q13394	MB211_HUMAN	mab-21-like 1 (C. elegans)	193					anatomical structure morphogenesis (GO:0009653)|camera-type eye development (GO:0043010)|positive regulation of cell proliferation (GO:0008284)	nucleus (GO:0005634)				breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(7)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	20		Breast(139;0.014)|Lung SC(185;0.051)|Prostate(109;0.202)		all cancers(112;9.63e-08)|Epithelial(112;1.37e-06)|BRCA - Breast invasive adenocarcinoma(63;0.000659)|OV - Ovarian serous cystadenocarcinoma(117;0.00372)|GBM - Glioblastoma multiforme(144;0.115)		CCCGGCCAGGGGATGTGGGGA	0.622																																					p.P193T		Atlas-SNP	.											.	MAB21L1	52	.	0			c.C577A						.						44.0	51.0	48.0					13																	36049699		2203	4299	6502	SO:0001583	missense	4081	exon1			GCCAGGGGATGTG	BC028170	CCDS9353.1	13q13.3	2008-02-05	2001-11-28		ENSG00000180660	ENSG00000180660			6757	protein-coding gene	gene with protein product		601280	"""mab-21 (C. elegans)-like 1"""			8733127	Standard	NM_005584		Approved	CAGR1		Q13394	OTTHUMG00000016723	ENST00000379919.4:c.577C>A	chr13.hg19:g.36049699G>T	ENSP00000369251:p.Pro193Thr	55.0	0.0		34.0	12.0	NM_005584	Q6I9T5	Missense_Mutation	SNP	ENST00000379919.4	hg19	CCDS9353.1	.	.	.	.	.	.	.	.	.	.	G	14.12	2.440279	0.43326	.	.	ENSG00000180660	ENST00000379919	T	0.07688	3.17	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	T	0.08846	0.0219	L	0.35414	1.06	0.80722	D	1	B	0.18013	0.025	B	0.22601	0.04	T	0.26360	-1.0105	10	0.09338	T	0.73	-14.4518	19.9576	0.97228	0.0:0.0:1.0:0.0	.	193	Q13394	MB211_HUMAN	T	193	ENSP00000369251:P193T	ENSP00000369251:P193T	P	-	1	0	MAB21L1	34947699	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.869000	0.99810	2.736000	0.93811	0.655000	0.94253	CCC	.	.		0.622	MAB21L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044459.3	NM_005584	
SLITRK6	84189	hgsc.bcm.edu	37	13	86368800	86368800	+	Missense_Mutation	SNP	A	A	C			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr13:86368800A>C	ENST00000400286.2	-	2	2442	c.1844T>G	c.(1843-1845)cTg>cGg	p.L615R		NM_032229.2	NP_115605.2	Q9H5Y7	SLIK6_HUMAN	SLIT and NTRK-like family, member 6	615					adult locomotory behavior (GO:0008344)|auditory behavior (GO:0031223)|auditory receptor cell morphogenesis (GO:0002093)|axonogenesis (GO:0007409)|cochlea development (GO:0090102)|innervation (GO:0060384)|lens development in camera-type eye (GO:0002088)|linear vestibuloocular reflex (GO:0060007)|multicellular organism growth (GO:0035264)|sensory perception of sound (GO:0007605)|startle response (GO:0001964)|synapse assembly (GO:0007416)|vestibulocochlear nerve development (GO:0021562)|visual perception (GO:0007601)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)				breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(13)|lung(18)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_neural(89;0.117)|Medulloblastoma(90;0.163)			GBM - Glioblastoma multiforme(99;0.0456)		GAACATAATCAGAAGTCCCAA	0.413																																					p.L615R		Atlas-SNP	.											.	SLITRK6	150	.	0			c.T1844G						.						131.0	125.0	127.0					13																	86368800		1975	4162	6137	SO:0001583	missense	84189	exon2			ATAATCAGAAGTC	AK026427	CCDS41903.1	13q31.1	2006-04-12			ENSG00000184564	ENSG00000184564			23503	protein-coding gene	gene with protein product		609681				14557068	Standard	NM_032229		Approved	FLJ22774	uc001vll.1	Q9H5Y7	OTTHUMG00000017157	ENST00000400286.2:c.1844T>G	chr13.hg19:g.86368800A>C	ENSP00000383143:p.Leu615Arg	194.0	0.0		173.0	69.0	NM_032229	A8K9S8|Q495Q0|Q6AW93|Q9HAA8|Q9NT60	Missense_Mutation	SNP	ENST00000400286.2	hg19	CCDS41903.1	.	.	.	.	.	.	.	.	.	.	A	16.65	3.183236	0.57800	.	.	ENSG00000184564	ENST00000400286	T	0.66460	-0.21	5.65	5.65	0.86999	.	0.000000	0.56097	U	0.000022	T	0.81749	0.4888	M	0.76838	2.35	0.58432	D	0.999999	D	0.89917	1.0	D	0.87578	0.998	D	0.83790	0.0230	10	0.62326	D	0.03	-3.8014	14.6942	0.69110	1.0:0.0:0.0:0.0	.	615	Q9H5Y7	SLIK6_HUMAN	R	615	ENSP00000383143:L615R	ENSP00000383143:L615R	L	-	2	0	SLITRK6	85266801	1.000000	0.71417	1.000000	0.80357	0.844000	0.47949	9.339000	0.96797	2.146000	0.66826	0.533000	0.62120	CTG	.	.		0.413	SLITRK6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045404.2	NM_032229	
ABCC4	10257	hgsc.bcm.edu	37	13	95858957	95858957	+	Silent	SNP	G	G	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr13:95858957G>T	ENST00000376887.4	-	8	1104	c.990C>A	c.(988-990)atC>atA	p.I330I	ABCC4_ENST00000431522.1_Silent_p.I330I|ABCC4_ENST00000538287.1_3'UTR|ABCC4_ENST00000536256.1_Silent_p.I255I|ABCC4_ENST00000412704.1_Silent_p.I330I	NM_005845.3	NP_005836.2	O15439	MRP4_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 4	330	ABC transmembrane type-1 1. {ECO:0000255|PROSITE-ProRule:PRU00441}.				blood coagulation (GO:0007596)|oxidation-reduction process (GO:0055114)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of smooth muscle cell proliferation (GO:0048661)|response to drug (GO:0042493)|response to organic cyclic compound (GO:0014070)|response to organonitrogen compound (GO:0010243)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|platelet dense granule membrane (GO:0031088)	15-hydroxyprostaglandin dehydrogenase (NAD+) activity (GO:0016404)|ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)			breast(1)|central_nervous_system(4)|endometrium(5)|kidney(4)|large_intestine(9)|lung(13)|ovary(1)|prostate(1)|skin(4)|urinary_tract(1)	43	all_neural(89;0.0878)|Medulloblastoma(90;0.163)				Adefovir Dipivoxil(DB00718)|Alprostadil(DB00770)|Atorvastatin(DB01076)|Cefazolin(DB01327)|Celecoxib(DB00482)|Conjugated Estrogens(DB00286)|Diclofenac(DB00586)|Dinoprostone(DB00917)|Dipyridamole(DB00975)|Fluorouracil(DB00544)|Flurbiprofen(DB00712)|Folic Acid(DB00158)|Gadoxetate(DB08884)|Glutathione(DB00143)|Ibuprofen(DB01050)|Indomethacin(DB00328)|Ketoprofen(DB01009)|Lamivudine(DB00709)|Leucovorin(DB00650)|Meloxicam(DB00814)|Mercaptopurine(DB01033)|Methotrexate(DB00563)|Nateglinide(DB00731)|Oseltamivir(DB00198)|Probenecid(DB01032)|Rosuvastatin(DB01098)|Sildenafil(DB00203)|Sorafenib(DB00398)|Sulfinpyrazone(DB01138)|Sunitinib(DB01268)|Tenofovir(DB00300)|Tioguanine(DB00352)|Ursodeoxycholic acid(DB01586)|Verapamil(DB00661)|Zidovudine(DB00495)	CAAACACGATGATTTTGCTTG	0.502																																					p.I330I		Atlas-SNP	.											.	ABCC4	248	.	0			c.C990A						.						166.0	152.0	157.0					13																	95858957		2203	4300	6503	SO:0001819	synonymous_variant	10257	exon8			CACGATGATTTTG	U66682	CCDS9474.1	13q31	2012-03-14			ENSG00000125257	ENSG00000125257		"""ATP binding cassette transporters / subfamily C"""	55	protein-coding gene	gene with protein product	"""canalicular multispecific organic anion transporter (ABC superfamily)"", ""bA464I2.1 (ATP-binding cassette, sub-family C (CFTR/MRP), member 4)"", ""multidrug resistance-associated protein 4"", ""multispecific organic anion transporter B"""	605250				8894702, 9661885	Standard	NM_005845		Approved	MRP4, EST170205, MOAT-B, MOATB	uc001vmd.4	O15439	OTTHUMG00000017216	ENST00000376887.4:c.990C>A	chr13.hg19:g.95858957G>T		168.0	0.0		120.0	58.0	NM_005845	A9Z1Z7|Q8IVZ4|Q8IZN6|Q8NEW8|Q9Y6J2	Silent	SNP	ENST00000376887.4	hg19	CCDS9474.1																																																																																			.	.		0.502	ABCC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045478.2	NM_005845	
DZIP1	22873	hgsc.bcm.edu	37	13	96237036	96237036	+	Silent	SNP	C	C	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr13:96237036C>A	ENST00000376829.2	-	22	3329	c.2478G>T	c.(2476-2478)gtG>gtT	p.V826V	DZIP1_ENST00000347108.3_Silent_p.V826V|DZIP1_ENST00000361396.2_Silent_p.V807V|DZIP1_ENST00000361156.3_Silent_p.V807V	NM_198968.3	NP_945319.1	Q86YF9	DZIP1_HUMAN	DAZ interacting zinc finger protein 1	826					cilium assembly (GO:0042384)|germ cell development (GO:0007281)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)			endometrium(1)|kidney(1)|large_intestine(20)|lung(11)|ovary(2)|pancreas(1)|skin(1)|stomach(1)	38	all_neural(89;0.0878)|Breast(111;0.148)|Medulloblastoma(90;0.163)		BRCA - Breast invasive adenocarcinoma(86;0.141)			AGGCATTTAGCACATGAGCAA	0.428																																					p.V826V		Atlas-SNP	.											.	DZIP1	195	.	0			c.G2478T						.						119.0	119.0	119.0					13																	96237036		2203	4300	6503	SO:0001819	synonymous_variant	22873	exon22			ATTTAGCACATGA	AB023213	CCDS9477.1, CCDS9478.1	13q32.1	2013-05-22	2013-05-22		ENSG00000134874	ENSG00000134874		"""Zinc fingers, C2H2-type"""	20908	protein-coding gene	gene with protein product		608671	"""DAZ interacting protein 1"""				Standard	NM_014934		Approved	KIAA0996, DZIP	uc001vmk.4	Q86YF9	OTTHUMG00000017224	ENST00000376829.2:c.2478G>T	chr13.hg19:g.96237036C>A		181.0	0.0		123.0	50.0	NM_198968	Q5W078|Q5W079|Q8WY45|Q8WY46|Q9UGA5|Q9Y2K0	Silent	SNP	ENST00000376829.2	hg19	CCDS9478.1																																																																																			.	.		0.428	DZIP1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000045496.3	NM_014934	
EFNB2	1948	hgsc.bcm.edu	37	13	107145427	107145427	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr13:107145427C>T	ENST00000245323.4	-	5	1112	c.963G>A	c.(961-963)atG>atA	p.M321I		NM_004093.3	NP_004084.1	P52799	EFNB2_HUMAN	ephrin-B2	321					anatomical structure morphogenesis (GO:0009653)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cell migration involved in sprouting angiogenesis (GO:0002042)|cell-cell signaling (GO:0007267)|ephrin receptor signaling pathway (GO:0048013)|lymph vessel development (GO:0001945)|negative regulation of keratinocyte proliferation (GO:0010839)|organ morphogenesis (GO:0009887)|positive regulation of cardiac muscle cell differentiation (GO:2000727)|regulation of chemotaxis (GO:0050920)|viral process (GO:0016032)	focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ephrin receptor binding (GO:0046875)	p.M321I(1)		haematopoietic_and_lymphoid_tissue(2)|large_intestine(2)|lung(7)|ovary(1)|skin(1)	13	Lung NSC(43;0.015)|all_neural(89;0.0741)|Lung SC(71;0.14)|Medulloblastoma(90;0.169)					TCTGCGGGGGCATCTCCTGGA	0.587																																					p.M321I		Atlas-SNP	.											EFNB2,NS,carcinoma,0,1	EFNB2	39	.	1	Substitution - Missense(1)	lung(1)	c.G963A						.						68.0	64.0	65.0					13																	107145427		2203	4300	6503	SO:0001583	missense	1948	exon5			CGGGGGCATCTCC	L38734	CCDS9507.1	13q33	2011-03-09			ENSG00000125266	ENSG00000125266		"""Ephrins"""	3227	protein-coding gene	gene with protein product	"""HTK ligand"", ""ligand of eph-related kinase 5"", ""eph-related receptor tyrosine kinase ligand 5"""	600527		EPLG5		7833926	Standard	NM_004093		Approved	LERK5, Htk-L, HTKL, MGC126226, MGC126227, MGC126228	uc001vqi.3	P52799	OTTHUMG00000017324	ENST00000245323.4:c.963G>A	chr13.hg19:g.107145427C>T	ENSP00000245323:p.Met321Ile	32.0	0.0		32.0	9.0	NM_004093	Q5JV56	Missense_Mutation	SNP	ENST00000245323.4	hg19	CCDS9507.1	.	.	.	.	.	.	.	.	.	.	C	19.69	3.874887	0.72180	.	.	ENSG00000125266	ENST00000245323	D	0.91124	-2.79	5.6	5.6	0.85130	.	0.142496	0.85682	D	0.000000	D	0.87188	0.6115	L	0.54323	1.7	0.80722	D	1	P	0.37276	0.589	B	0.32393	0.145	D	0.85115	0.0965	10	0.10902	T	0.67	.	19.6251	0.95674	0.0:1.0:0.0:0.0	.	321	P52799	EFNB2_HUMAN	I	321	ENSP00000245323:M321I	ENSP00000245323:M321I	M	-	3	0	EFNB2	105943428	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.020000	0.70826	2.636000	0.89361	0.655000	0.94253	ATG	.	.		0.587	EFNB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045733.4	NM_004093	
ARHGEF7	8874	hgsc.bcm.edu	37	13	111938504	111938504	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr13:111938504A>G	ENST00000375741.2	+	18	2274	c.2024A>G	c.(2023-2025)aAg>aGg	p.K675R	ARHGEF7_ENST00000317133.5_Missense_Mutation_p.K654R|ARHGEF7_ENST00000375739.2_Missense_Mutation_p.K625R|ARHGEF7_ENST00000375736.4_Missense_Mutation_p.K497R|ARHGEF7_ENST00000478679.1_Missense_Mutation_p.K419R|ARHGEF7_ENST00000375723.1_Missense_Mutation_p.K497R|ARHGEF7_ENST00000426073.2_Missense_Mutation_p.K497R|ARHGEF7_ENST00000218789.5_Missense_Mutation_p.K497R|ARHGEF7_ENST00000375737.5_Missense_Mutation_p.K572R|ARHGEF7_ENST00000370623.3_Missense_Mutation_p.K582R	NM_001113511.1|NM_145735.2	NP_001106983.1|NP_663788.1	Q14155	ARHG7_HUMAN	Rho guanine nucleotide exchange factor (GEF) 7	675					apoptotic signaling pathway (GO:0097190)|epidermal growth factor receptor signaling pathway (GO:0007173)|focal adhesion assembly (GO:0048041)|hematopoietic progenitor cell differentiation (GO:0002244)|lamellipodium assembly (GO:0030032)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|nervous system development (GO:0007399)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of fibroblast migration (GO:0010763)|positive regulation of GTPase activity (GO:0043547)|positive regulation of lamellipodium morphogenesis (GO:2000394)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|protein complex (GO:0043234)	guanyl-nucleotide exchange factor activity (GO:0005085)|protein kinase binding (GO:0019901)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(9)|lung(16)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|soft_tissue(1)	41	all_lung(23;3.96e-05)|Lung NSC(43;0.00156)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Medulloblastoma(90;0.163)		BRCA - Breast invasive adenocarcinoma(86;0.188)			GATCTTAGTAAGAGCCCTAAG	0.458																																					p.K675R		Atlas-SNP	.											.	ARHGEF7	157	.	0			c.A2024G						.						78.0	76.0	76.0					13																	111938504		2203	4300	6503	SO:0001583	missense	8874	exon18			TTAGTAAGAGCCC	D63476	CCDS9521.1, CCDS32009.1, CCDS45068.1, CCDS45069.1	13q33.3	2013-01-10			ENSG00000102606	ENSG00000102606		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	15607	protein-coding gene	gene with protein product	"""SH3 domain-containing proline-rich protein"", ""PAK-interacting exchange factor beta"", ""rho"", ""guanine nucleotide exchange factor 7"""	605477				9207241, 9726964	Standard	NM_003899		Approved	KIAA0142, PIXB, DKFZp761K1021, Nbla10314, DKFZp686C12170, BETA-PIX, COOL1, P85SPR, P85, P85COOL1, P50BP, PAK3, P50	uc001vrs.2	Q14155	OTTHUMG00000017357	ENST00000375741.2:c.2024A>G	chr13.hg19:g.111938504A>G	ENSP00000364893:p.Lys675Arg	80.0	0.0		78.0	8.0	NM_001113511	B1ALK6|B1ALK8|Q3LIA4|Q5W9H0|Q6P9G3|Q6PII2|Q86W63|Q8N3M1	Missense_Mutation	SNP	ENST00000375741.2	hg19	CCDS45068.1	.	.	.	.	.	.	.	.	.	.	A	13.62	2.290528	0.40494	.	.	ENSG00000102606	ENST00000317133;ENST00000375741;ENST00000375739;ENST00000370623;ENST00000545635;ENST00000218789;ENST00000375736;ENST00000426073;ENST00000375737;ENST00000375723;ENST00000478679	T;T;T;T;T;T;T;T;T;T	0.65178	0.43;0.41;0.42;0.44;0.42;0.45;0.45;0.47;0.38;-0.14	4.6	3.36	0.38483	.	0.050134	0.85682	N	0.000000	T	0.58293	0.2112	M	0.65498	2.005	0.80722	D	1	B;B;B;B;B;B	0.32620	0.058;0.378;0.006;0.012;0.058;0.029	B;B;B;B;B;B	0.35727	0.102;0.115;0.033;0.034;0.162;0.209	T	0.50915	-0.8771	10	0.24483	T	0.36	.	10.241	0.43312	0.9198:0.0:0.0802:0.0	.	419;572;497;625;675;654	E9PDQ5;B7Z6G2;Q14155-6;Q14155-2;Q14155;Q14155-3	.;.;.;.;ARHG7_HUMAN;.	R	654;675;625;582;652;497;497;497;572;497;419	ENSP00000325994:K654R;ENSP00000364893:K675R;ENSP00000364891:K625R;ENSP00000359657:K582R;ENSP00000218789:K497R;ENSP00000364888:K497R;ENSP00000397068:K497R;ENSP00000364889:K572R;ENSP00000364875:K497R;ENSP00000417596:K419R	ENSP00000218789:K497R	K	+	2	0	ARHGEF7	110736505	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	6.646000	0.74348	0.578000	0.29487	0.459000	0.35465	AAG	.	.		0.458	ARHGEF7-204	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_001113511	
MYH6	4624	hgsc.bcm.edu	37	14	23865974	23865974	+	Silent	SNP	T	T	G			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr14:23865974T>G	ENST00000356287.3	-	18	2250	c.2221A>C	c.(2221-2223)Agg>Cgg	p.R741R	MYH6_ENST00000405093.3_Silent_p.R741R			P13533	MYH6_HUMAN	myosin, heavy chain 6, cardiac muscle, alpha	741	Myosin motor.				adult heart development (GO:0007512)|ATP catabolic process (GO:0006200)|atrial cardiac muscle tissue morphogenesis (GO:0055009)|BMP signaling pathway (GO:0030509)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle fiber development (GO:0048739)|in utero embryonic development (GO:0001701)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|myofibril assembly (GO:0030239)|regulation of ATPase activity (GO:0043462)|regulation of blood pressure (GO:0008217)|regulation of heart contraction (GO:0008016)|regulation of heart growth (GO:0060420)|regulation of heart rate (GO:0002027)|regulation of the force of heart contraction (GO:0002026)|sarcomere organization (GO:0045214)|striated muscle contraction (GO:0006941)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|visceral muscle development (GO:0007522)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin complex (GO:0016459)|myosin filament (GO:0032982)|nucleus (GO:0005634)|sarcomere (GO:0030017)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)|protein kinase binding (GO:0019901)			breast(4)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(16)|liver(1)|lung(60)|ovary(2)|pancreas(3)|prostate(6)|skin(6)|stomach(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	119	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00764)|READ - Rectum adenocarcinoma(4;0.0289)|Colorectal(4;0.0441)		GTCCCCTTCCTGCTATCAATG	0.547																																					p.R741R		Atlas-SNP	.											.	MYH6	274	.	0			c.A2221C						.						118.0	94.0	102.0					14																	23865974		2203	4300	6503	SO:0001819	synonymous_variant	4624	exon19			CCTTCCTGCTATC	D00943	CCDS9600.1	14q11.2-q13	2014-09-17	2008-08-01		ENSG00000197616	ENSG00000197616		"""Myosins / Myosin superfamily : Class II"""	7576	protein-coding gene	gene with protein product	"""cardiomyopathy, hypertrophic 1"""	160710	"""myosin, heavy polypeptide 6, cardiac muscle, alpha (cardiomyopathy, hypertrophic 1)"""			2144212	Standard	NM_002471		Approved		uc001wjv.3	P13533	OTTHUMG00000028753	ENST00000356287.3:c.2221A>C	chr14.hg19:g.23865974T>G		124.0	0.0		110.0	40.0	NM_002471	A2RTX1|D9YZU2|Q13943|Q14906|Q14907	Silent	SNP	ENST00000356287.3	hg19	CCDS9600.1																																																																																			.	.		0.547	MYH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071796.3		
MYH7	4625	hgsc.bcm.edu	37	14	23901694	23901694	+	Missense_Mutation	SNP	A	A	C			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr14:23901694A>C	ENST00000355349.3	-	6	686	c.524T>G	c.(523-525)cTg>cGg	p.L175R		NM_000257.2	NP_000248.2	P12883	MYH7_HUMAN	myosin, heavy chain 7, cardiac muscle, beta	175	Myosin motor.				adult heart development (GO:0007512)|ATP catabolic process (GO:0006200)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|regulation of heart rate (GO:0002027)|regulation of the force of heart contraction (GO:0002026)|striated muscle contraction (GO:0006941)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|muscle myosin complex (GO:0005859)|myosin complex (GO:0016459)|myosin filament (GO:0032982)|nucleus (GO:0005634)|sarcomere (GO:0030017)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)			NS(3)|breast(4)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(19)|lung(57)|ovary(5)|prostate(9)|skin(5)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	137	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00725)		TCACGTGATCAGGATGGACTG	0.577																																					p.L175R		Atlas-SNP	.											MYH7,NS,carcinoma,0,1	MYH7	349	.	0			c.T524G						.						211.0	183.0	193.0					14																	23901694		2203	4300	6503	SO:0001583	missense	4625	exon6			GTGATCAGGATGG	M58018	CCDS9601.1	14q11.2-q13	2014-09-17	2006-09-29		ENSG00000092054	ENSG00000092054		"""Myosins / Myosin superfamily : Class II"""	7577	protein-coding gene	gene with protein product		160760	"""myopathy, distal 1"", ""myosin, heavy polypeptide 7, cardiac muscle, beta"""	CMH1, MPD1		2494889, 8483915, 15322983	Standard	XM_005267696		Approved	CMD1S	uc001wjx.3	P12883	OTTHUMG00000028755	ENST00000355349.3:c.524T>G	chr14.hg19:g.23901694A>C	ENSP00000347507:p.Leu175Arg	148.0	2.0		121.0	52.0	NM_000257	A2TDB6|B6D424|Q14836|Q14837|Q14904|Q16579|Q2M1Y6|Q92679|Q9H1D5|Q9UDA2|Q9UMM8	Missense_Mutation	SNP	ENST00000355349.3	hg19	CCDS9601.1	.	.	.	.	.	.	.	.	.	.	A	19.62	3.862269	0.71949	.	.	ENSG00000092054	ENST00000355349;ENST00000544444	D	0.90004	-2.6	3.81	2.65	0.31530	Myosin head, motor domain (3);	.	.	.	.	D	0.96697	0.8922	H	0.99863	4.86	0.58432	D	0.999998	D	0.89917	1.0	D	0.97110	1.0	D	0.95429	0.8514	9	0.87932	D	0	.	8.6083	0.33786	0.9058:0.0:0.0942:0.0	.	175	P12883	MYH7_HUMAN	R	175	ENSP00000347507:L175R	ENSP00000347507:L175R	L	-	2	0	MYH7	22971534	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	6.043000	0.71004	1.503000	0.48686	0.379000	0.24179	CTG	.	.		0.577	MYH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071798.3	NM_000257	
RIPK3	11035	hgsc.bcm.edu	37	14	24806550	24806550	+	Silent	SNP	A	A	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr14:24806550A>T	ENST00000216274.5	-	8	1235	c.1017T>A	c.(1015-1017)tcT>tcA	p.S339S	ADCY4_ENST00000396747.3_5'Flank|RP11-934B9.3_ENST00000555591.1_Silent_p.S13S|ADCY4_ENST00000310677.4_5'Flank|ADCY4_ENST00000558563.1_5'Flank|ADCY4_ENST00000418030.2_5'Flank|ADCY4_ENST00000554068.2_5'Flank|RIPK3_ENST00000554338.1_5'Flank	NM_006871.3	NP_006862.2	Q9Y572	RIPK3_HUMAN	receptor-interacting serine-threonine kinase 3	339					activation of protein kinase activity (GO:0032147)|amyloid fibril formation (GO:1990000)|apoptotic signaling pathway (GO:0097190)|cellular protein modification process (GO:0006464)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|innate immune response (GO:0045087)|lymph node development (GO:0048535)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|necroptotic process (GO:0070266)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of ligase activity (GO:0051351)|positive regulation of necroptotic process (GO:0060545)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of oxidoreductase activity (GO:0051353)|positive regulation of phosphatase activity (GO:0010922)|positive regulation of protein deacetylation (GO:0090312)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of type I interferon production (GO:0032481)|protein autophosphorylation (GO:0046777)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|regulation of activated T cell proliferation (GO:0046006)|regulation of activation-induced cell death of T cells (GO:0070235)|regulation of adaptive immune response (GO:0002819)|regulation of CD8-positive, alpha-beta cytotoxic T cell extravasation (GO:2000452)|regulation of interferon-gamma production (GO:0032649)|regulation of T cell mediated cytotoxicity (GO:0001914)|signal transduction (GO:0007165)|spleen development (GO:0048536)|T cell differentiation in thymus (GO:0033077)|T cell homeostasis (GO:0043029)|thymus development (GO:0048538)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|ripoptosome (GO:0097342)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|NF-kappaB-inducing kinase activity (GO:0004704)|protein complex binding (GO:0032403)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|transcription coactivator activity (GO:0003713)			NS(1)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(7)|lung(4)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	23				GBM - Glioblastoma multiforme(265;0.0181)		CATCATTACGAGAGTGCTGGT	0.478																																					p.S339S	Pancreas(58;918 1191 4668 13304 15331)	Atlas-SNP	.											.	RIPK3	43	.	0			c.T1017A						.						145.0	152.0	150.0					14																	24806550		2203	4300	6503	SO:0001819	synonymous_variant	11035	exon8			ATTACGAGAGTGC	AF156884	CCDS9628.1	14q12	2006-05-15			ENSG00000129465	ENSG00000129465			10021	protein-coding gene	gene with protein product		605817				10339433, 10358032	Standard	NM_006871		Approved	RIP3	uc001wpb.3	Q9Y572	OTTHUMG00000029349	ENST00000216274.5:c.1017T>A	chr14.hg19:g.24806550A>T		52.0	0.0		28.0	13.0	NM_006871	B4DJL9|C4AM87|Q5J795|Q5J796|Q6P5Y1	Silent	SNP	ENST00000216274.5	hg19	CCDS9628.1	.	.	.	.	.	.	.	.	.	.	A	3.581	-0.085654	0.07097	.	.	ENSG00000129465	ENST00000554569	.	.	.	2.42	1.19	0.21007	.	.	.	.	.	T	0.25382	0.0617	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.23976	-1.0173	4	.	.	.	-2.5216	5.3014	0.15780	0.6998:0.3002:0.0:0.0	.	.	.	.	H	20	.	.	L	-	2	0	RIPK3	23876390	0.000000	0.05858	0.003000	0.11579	0.001000	0.01503	-0.381000	0.07417	0.308000	0.22923	0.533000	0.62120	CTC	.	.		0.478	RIPK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000073203.4	NM_006871	
HECTD1	25831	hgsc.bcm.edu	37	14	31641123	31641123	+	Nonsense_Mutation	SNP	G	G	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr14:31641123G>A	ENST00000399332.1	-	8	1764	c.1276C>T	c.(1276-1278)Caa>Taa	p.Q426*	HECTD1_ENST00000553700.1_Nonsense_Mutation_p.Q426*	NM_015382.2	NP_056197.2	Q9ULT8	HECD1_HUMAN	HECT domain containing E3 ubiquitin protein ligase 1	426					neural tube closure (GO:0001843)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|metal ion binding (GO:0046872)|ubiquitin-protein transferase activity (GO:0004842)			breast(10)|endometrium(7)|kidney(5)|large_intestine(12)|lung(23)|ovary(4)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	70	Hepatocellular(127;0.0877)|Breast(36;0.176)		LUAD - Lung adenocarcinoma(48;0.00292)|Lung(238;0.0164)|BRCA - Breast invasive adenocarcinoma(188;0.111)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.00617)		GATGACCTTTGACCTCTATTA	0.299																																					p.Q426X		Atlas-SNP	.											.	HECTD1	159	.	0			c.C1276T						.						96.0	91.0	92.0					14																	31641123		1833	4088	5921	SO:0001587	stop_gained	25831	exon8			ACCTTTGACCTCT	AB032957	CCDS41939.1	14q12	2013-01-10	2012-02-23		ENSG00000092148	ENSG00000092148		"""Ankyrin repeat domain containing"""	20157	protein-coding gene	gene with protein product			"""HECT domain containing 1"""			10574461	Standard	XM_005267502		Approved	KIAA1131	uc001wrc.1	Q9ULT8	OTTHUMG00000170670	ENST00000399332.1:c.1276C>T	chr14.hg19:g.31641123G>A	ENSP00000382269:p.Gln426*	352.0	1.0		312.0	121.0	NM_015382	D3DS86|Q6P445|Q86VJ1|Q96F34|Q9UFZ7	Nonsense_Mutation	SNP	ENST00000399332.1	hg19	CCDS41939.1	.	.	.	.	.	.	.	.	.	.	G	43	10.057843	0.99327	.	.	ENSG00000092148	ENST00000553700;ENST00000261312;ENST00000399332;ENST00000556224	.	.	.	5.47	5.47	0.80525	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	-2.0412	19.328	0.94270	0.0:0.0:1.0:0.0	.	.	.	.	X	426	.	ENSP00000261312:Q426X	Q	-	1	0	HECTD1	30710874	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.840000	0.99478	2.570000	0.86706	0.585000	0.79938	CAA	.	.		0.299	HECTD1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409942.1		
NPAS3	64067	hgsc.bcm.edu	37	14	34269082	34269082	+	Silent	SNP	G	G	C			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr14:34269082G>C	ENST00000356141.4	+	12	1569	c.1569G>C	c.(1567-1569)ccG>ccC	p.P523P	NPAS3_ENST00000551492.1_Silent_p.P528P|NPAS3_ENST00000346562.2_Silent_p.P491P|NPAS3_ENST00000548645.1_Silent_p.P493P|NPAS3_ENST00000357798.5_Silent_p.P510P			Q8IXF0	NPAS3_HUMAN	neuronal PAS domain protein 3	523					locomotory behavior (GO:0007626)|maternal behavior (GO:0042711)|positive regulation of transcription, DNA-templated (GO:0045893)|startle response (GO:0001964)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|signal transducer activity (GO:0004871)			breast(4)|endometrium(3)|kidney(1)|large_intestine(6)|liver(2)|lung(14)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	40	Breast(36;0.0102)|Hepatocellular(127;0.133)		LUAD - Lung adenocarcinoma(48;0.00169)|Lung(238;0.00968)	GBM - Glioblastoma multiforme(1;1.31e-09)|all cancers(1;0.000112)|OV - Ovarian serous cystadenocarcinoma(311;0.115)		CCAGTAACCCGGACAGCCGCG	0.637																																					p.P523P		Atlas-SNP	.											.	NPAS3	266	.	0			c.G1569C						.						51.0	54.0	53.0					14																	34269082		2203	4300	6503	SO:0001819	synonymous_variant	64067	exon12			TAACCCGGACAGC	AF164438	CCDS9645.1, CCDS53891.1, CCDS53892.1, CCDS55912.1	14q13.1	2013-08-23			ENSG00000151322	ENSG00000151322		"""Basic helix-loop-helix proteins"""	19311	protein-coding gene	gene with protein product		609430					Standard	NM_022123		Approved	MOP6, PASD6, bHLHe12	uc001wru.3	Q8IXF0	OTTHUMG00000140215	ENST00000356141.4:c.1569G>C	chr14.hg19:g.34269082G>C		152.0	0.0		121.0	54.0	NM_001164749	Q86US6|Q86US7|Q8IXF2|Q9BY81|Q9H323|Q9Y4L8	Silent	SNP	ENST00000356141.4	hg19	CCDS53891.1																																																																																			.	.		0.637	NPAS3-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000276645.1		
CLEC14A	161198	hgsc.bcm.edu	37	14	38724410	38724410	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr14:38724410C>T	ENST00000342213.2	-	1	1164	c.818G>A	c.(817-819)tGt>tAt	p.C273Y		NM_175060.2	NP_778230.1	Q86T13	CLC14_HUMAN	C-type lectin domain family 14, member A	273	EGF-like.					extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)			breast(1)|cervix(2)|endometrium(2)|large_intestine(7)|lung(9)|ovary(4)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	33	Hepatocellular(127;0.213)|Esophageal squamous(585;0.22)		Lung(238;3.93e-06)|LUAD - Lung adenocarcinoma(48;2.62e-05)|Epithelial(34;0.187)	GBM - Glioblastoma multiforme(112;0.00439)		GCCCGTAGCACATTCGCAGGC	0.662																																					p.C273Y		Atlas-SNP	.											.	CLEC14A	83	.	0			c.G818A						.						65.0	71.0	69.0					14																	38724410		2203	4300	6503	SO:0001583	missense	161198	exon1			GTAGCACATTCGC		CCDS9667.1	14q21.1	2010-04-27	2005-02-11	2005-02-11	ENSG00000176435	ENSG00000176435		"""C-type lectin domain containing"""	19832	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 27"""	C14orf27			Standard	NM_175060		Approved		uc001wum.2	Q86T13	OTTHUMG00000140248	ENST00000342213.2:c.818G>A	chr14.hg19:g.38724410C>T	ENSP00000353013:p.Cys273Tyr	77.0	0.0		59.0	30.0	NM_175060	Q695G9|Q6PWT6|Q8N5V5	Missense_Mutation	SNP	ENST00000342213.2	hg19	CCDS9667.1	.	.	.	.	.	.	.	.	.	.	C	16.38	3.106350	0.56291	.	.	ENSG00000176435	ENST00000342213;ENST00000546356	D	0.99942	-8.46	3.91	3.91	0.45181	Epidermal growth factor-like (1);	0.000000	0.51477	D	0.000085	D	0.99851	0.9931	L	0.32530	0.975	0.39636	D	0.970256	D	0.89917	1.0	D	0.85130	0.997	D	0.94571	0.7771	10	0.87932	D	0	-7.9173	11.7127	0.51635	0.0:1.0:0.0:0.0	.	273	Q86T13	CLC14_HUMAN	Y	273;38	ENSP00000353013:C273Y	ENSP00000353013:C273Y	C	-	2	0	CLEC14A	37794161	0.997000	0.39634	0.985000	0.45067	0.740000	0.42216	2.690000	0.47001	2.498000	0.84270	0.591000	0.81541	TGT	.	.		0.662	CLEC14A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276729.1	NM_175060	
LRFN5	145581	hgsc.bcm.edu	37	14	42356398	42356398	+	Silent	SNP	C	C	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr14:42356398C>A	ENST00000298119.4	+	3	1759	c.570C>A	c.(568-570)acC>acA	p.T190T	LRFN5_ENST00000554171.1_Silent_p.T190T|LRFN5_ENST00000554120.1_Silent_p.T190T	NM_152447.3	NP_689660.2	Q96NI6	LRFN5_HUMAN	leucine rich repeat and fibronectin type III domain containing 5	190						integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(12)|liver(1)|lung(67)|ovary(5)|pancreas(3)|prostate(1)|skin(9)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(2)	120			LUAD - Lung adenocarcinoma(50;0.0223)|Lung(238;0.0728)	GBM - Glioblastoma multiforme(112;0.00847)		CTAAGGGGACCTTCTCCCATT	0.423										HNSCC(30;0.082)																											p.T190T		Atlas-SNP	.											.	LRFN5	269	.	0			c.C570A						.						73.0	64.0	67.0					14																	42356398		2203	4300	6503	SO:0001819	synonymous_variant	145581	exon3			GGGGACCTTCTCC	AK055365	CCDS9678.1	14q21.1	2013-02-11	2004-02-02	2004-02-04	ENSG00000165379	ENSG00000165379		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	20360	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 8"""	612811	"""chromosome 14 open reading frame 146"""	C14orf146		16828986	Standard	NM_152447		Approved	FIGLER8, SALM5	uc001wvm.3	Q96NI6	OTTHUMG00000140261	ENST00000298119.4:c.570C>A	chr14.hg19:g.42356398C>A		86.0	0.0		91.0	38.0	NM_152447	B3KU78|Q86XL2	Silent	SNP	ENST00000298119.4	hg19	CCDS9678.1																																																																																			.	.		0.423	LRFN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276786.1	NM_152447	
DLGAP5	9787	hgsc.bcm.edu	37	14	55629758	55629758	+	Missense_Mutation	SNP	G	G	C			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr14:55629758G>C	ENST00000247191.2	-	13	1800	c.1584C>G	c.(1582-1584)atC>atG	p.I528M	DLGAP5_ENST00000395425.2_Missense_Mutation_p.I528M	NM_014750.4	NP_055565.3	Q15398	DLGP5_HUMAN	discs, large (Drosophila) homolog-associated protein 5	528					cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|dephosphorylation (GO:0016311)|mitotic chromosome movement towards spindle pole (GO:0007079)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)	cytoplasm (GO:0005737)|microtubule organizing center (GO:0005815)|nucleus (GO:0005634)|spindle pole centrosome (GO:0031616)	phosphoprotein phosphatase activity (GO:0004721)			biliary_tract(1)|breast(2)|cervix(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(8)|lung(10)|ovary(2)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	44						CCTCAAGTTTGATCAGATTGT	0.299																																					p.I528M		Atlas-SNP	.											.	DLGAP5	84	.	0			c.C1584G						.						93.0	91.0	92.0					14																	55629758		2203	4291	6494	SO:0001583	missense	9787	exon13			AAGTTTGATCAGA	D13633	CCDS9723.1, CCDS53897.1	14q22.3	2008-05-30	2008-05-30	2008-05-30	ENSG00000126787	ENSG00000126787			16864	protein-coding gene	gene with protein product			"""discs, large homolog 7 (Drosophila)"""	DLG7		7584026, 7584028	Standard	NM_014750		Approved	KIAA0008, DLG1, HURP	uc001xbs.3	Q15398	OTTHUMG00000140310	ENST00000247191.2:c.1584C>G	chr14.hg19:g.55629758G>C	ENSP00000247191:p.Ile528Met	72.0	0.0		47.0	14.0	NM_014750	A8MTM6|B4DRM8|Q86T11|Q8NG58	Missense_Mutation	SNP	ENST00000247191.2	hg19	CCDS9723.1	.	.	.	.	.	.	.	.	.	.	G	1.553	-0.538824	0.04053	.	.	ENSG00000126787	ENST00000395425;ENST00000247191	T;T	0.17054	2.3;2.3	4.83	-0.549	0.11829	.	0.981615	0.08346	N	0.960066	T	0.09774	0.0240	N	0.19112	0.55	0.09310	N	0.999995	B;B	0.14012	0.009;0.009	B;B	0.19666	0.026;0.016	T	0.38090	-0.9677	10	0.40728	T	0.16	.	3.2593	0.06843	0.221:0.3681:0.3117:0.0992	.	528;528	A8MTM6;Q15398	.;DLGP5_HUMAN	M	528	ENSP00000378815:I528M;ENSP00000247191:I528M	ENSP00000247191:I528M	I	-	3	3	DLGAP5	54699511	0.653000	0.27358	0.629000	0.29254	0.040000	0.13550	-0.031000	0.12287	-0.058000	0.13177	-0.237000	0.12165	ATC	.	.		0.299	DLGAP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276908.2	NM_014750	
ZFP36L1	677	hgsc.bcm.edu	37	14	69256435	69256435	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr14:69256435G>T	ENST00000439696.2	-	2	1133	c.832C>A	c.(832-834)Ctc>Atc	p.L278I	ZFP36L1_ENST00000336440.3_Missense_Mutation_p.L278I|ZFP36L1_ENST00000555997.1_3'UTR	NM_001244701.1|NM_004926.3	NP_001231630.1|NP_004917.2	Q07352	TISB_HUMAN	ZFP36 ring finger protein-like 1	278					gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|regulation of mRNA stability (GO:0043488)|regulation of transcription, DNA-templated (GO:0006355)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|T cell differentiation in thymus (GO:0033077)|vasculogenesis (GO:0001570)	cytosol (GO:0005829)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(4)|kidney(1)|large_intestine(1)|liver(2)|lung(9)|ovary(1)|prostate(2)|urinary_tract(1)	21				all cancers(60;0.00203)|BRCA - Breast invasive adenocarcinoma(234;0.00205)|OV - Ovarian serous cystadenocarcinoma(108;0.0401)		GGCCGGAAGAGGAAGGTGGTC	0.632											OREG0022753	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.L347I		Atlas-SNP	.											.	ZFP36L1	47	.	0			c.C1039A						.						54.0	65.0	61.0					14																	69256435		2203	4300	6503	SO:0001583	missense	677	exon3			GGAAGAGGAAGGT	X79066	CCDS9791.1	14q22-q24	2012-11-27	2012-11-27	2001-11-23		ENSG00000185650		"""RING-type (C3HC4) zinc fingers"""	1107	protein-coding gene	gene with protein product		601064	"""zinc finger protein, C3H type, 36-like 1"", ""zinc finger protein 36, C3H type-like 1"""	BRF1		8024689	Standard	NM_004926		Approved	RNF162B, Berg36, ERF1, TIS11B, cMG1	uc021rve.1	Q07352		ENST00000439696.2:c.832C>A	chr14.hg19:g.69256435G>T	ENSP00000388402:p.Leu278Ile	96.0	0.0	1113	63.0	34.0	NM_001244701	Q13851	Missense_Mutation	SNP	ENST00000439696.2	hg19	CCDS9791.1	.	.	.	.	.	.	.	.	.	.	G	15.19	2.759275	0.49468	.	.	ENSG00000185650	ENST00000439696;ENST00000336440;ENST00000435246	T;T	0.31247	1.5;1.5	4.38	4.38	0.52667	.	0.262799	0.32287	N	0.006310	T	0.21227	0.0511	L	0.33485	1.01	0.80722	D	1	P	0.37688	0.605	B	0.35039	0.194	T	0.03807	-1.1002	10	0.18276	T	0.48	-8.0209	12.6439	0.56723	0.0825:0.0:0.9175:0.0	.	278	Q07352	TISB_HUMAN	I	278;278;261	ENSP00000388402:L278I;ENSP00000337386:L278I	ENSP00000337386:L278I	L	-	1	0	ZFP36L1	68326188	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	2.780000	0.47742	2.271000	0.75665	0.591000	0.81541	CTC	.	.		0.632	ZFP36L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413227.1		
VRTN	55237	hgsc.bcm.edu	37	14	74825421	74825421	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr14:74825421G>T	ENST00000256362.4	+	2	2176	c.1935G>T	c.(1933-1935)atG>atT	p.M645I		NM_018228.2	NP_060698.2	Q9H8Y1	VRTN_HUMAN	vertebrae development associated	645					transposition, DNA-mediated (GO:0006313)		sequence-specific DNA binding (GO:0043565)|transposase activity (GO:0004803)			NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(15)|ovary(5)|prostate(2)|skin(1)|urinary_tract(1)	41						TGATGGACATGATCGCTACCA	0.617																																					p.M645I		Atlas-SNP	.											.	VRTN	79	.	0			c.G1935T						.						69.0	53.0	58.0					14																	74825421		2203	4300	6503	SO:0001583	missense	55237	exon2			GGACATGATCGCT	AK001673	CCDS9830.1	14q24.2	2012-12-07	2012-12-07	2010-10-20	ENSG00000133980	ENSG00000133980			20223	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 115"", ""vertebrae development homolog (pig)"""	C14orf115		21232157	Standard	NM_018228		Approved	FLJ10811, vertnin	uc001xpw.4	Q9H8Y1	OTTHUMG00000171208	ENST00000256362.4:c.1935G>T	chr14.hg19:g.74825421G>T	ENSP00000256362:p.Met645Ile	125.0	0.0		126.0	49.0	NM_018228	Q9NVC7	Missense_Mutation	SNP	ENST00000256362.4	hg19	CCDS9830.1	.	.	.	.	.	.	.	.	.	.	G	6.672	0.492606	0.12702	.	.	ENSG00000133980	ENST00000256362	T	0.40476	1.03	4.28	2.39	0.29439	.	0.075039	0.53938	U	0.000043	T	0.26557	0.0649	N	0.24115	0.695	0.28102	N	0.931388	B	0.10296	0.003	B	0.08055	0.003	T	0.18304	-1.0341	10	0.48119	T	0.1	-18.2477	9.1098	0.36720	0.1763:0.0:0.8237:0.0	.	645	Q9H8Y1	VRTN_HUMAN	I	645	ENSP00000256362:M645I	ENSP00000256362:M645I	M	+	3	0	VRTN	73895174	1.000000	0.71417	0.670000	0.29842	0.099000	0.18886	1.133000	0.31430	1.036000	0.39998	0.485000	0.47835	ATG	.	.		0.617	VRTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412339.1	NM_018228	
SAMD15	161394	hgsc.bcm.edu	37	14	77843998	77843998	+	Silent	SNP	T	T	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr14:77843998T>A	ENST00000216471.4	+	1	523	c.237T>A	c.(235-237)ccT>ccA	p.P79P	SAMD15_ENST00000533095.2_Intron|TMED8_ENST00000216468.7_5'Flank	NM_001010860.1	NP_001010860.1	Q9P1V8	SAM15_HUMAN	sterile alpha motif domain containing 15	79										breast(2)|endometrium(3)|kidney(2)|large_intestine(4)|lung(10)|pancreas(1)|skin(1)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	28						AGCTGAAACCTGGCGGGACGT	0.532																																					p.P79P		Atlas-SNP	.											.	SAMD15	60	.	0			c.T237A						.						107.0	105.0	105.0					14																	77843998		2203	4300	6503	SO:0001819	synonymous_variant	161394	exon1			GAAACCTGGCGGG	AK093282	CCDS32126.1	14q24.3	2013-01-10	2010-10-20	2010-10-20	ENSG00000100583	ENSG00000100583		"""Sterile alpha motif (SAM) domain containing"""	18631	protein-coding gene	gene with protein product			"""family with sequence similarity 15, member A"", ""chromosome 14 open reading frame 174"""	FAM15A, C14orf174			Standard	XM_006720069		Approved	FLJ35963	uc001xtq.1	Q9P1V8		ENST00000216471.4:c.237T>A	chr14.hg19:g.77843998T>A		129.0	0.0		127.0	53.0	NM_001010860	Q2M3P3	Silent	SNP	ENST00000216471.4	hg19	CCDS32126.1																																																																																			.	.		0.532	SAMD15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394587.2	NM_001010860	
CATSPERB	79820	hgsc.bcm.edu	37	14	92126218	92126218	+	Silent	SNP	A	A	G			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr14:92126218A>G	ENST00000256343.3	-	15	1551	c.1395T>C	c.(1393-1395)ttT>ttC	p.F465F		NM_024764.2	NP_079040.2	Q9H7T0	CTSRB_HUMAN	catsper channel auxiliary subunit beta	465					cell differentiation (GO:0030154)|multicellular organism reproduction (GO:0032504)|multicellular organismal development (GO:0007275)|single fertilization (GO:0007338)|sperm-egg recognition (GO:0035036)|spermatogenesis (GO:0007283)	CatSper complex (GO:0036128)|cilium (GO:0005929)|plasma membrane (GO:0005886)				NS(1)|breast(4)|central_nervous_system(1)|kidney(3)|large_intestine(15)|liver(1)|lung(12)|ovary(2)|pancreas(1)|prostate(3)|skin(9)|urinary_tract(2)	54		all_cancers(154;0.0663)|all_epithelial(191;0.236)				GTTGAGAAACAAAAGTAATAG	0.348																																					p.F465F		Atlas-SNP	.											.	CATSPERB	114	.	0			c.T1395C						.						72.0	71.0	72.0					14																	92126218		2203	4300	6503	SO:0001819	synonymous_variant	79820	exon15			AGAAACAAAAGTA	AK024360	CCDS32142.1	14q32.12	2012-02-22	2012-02-22	2007-10-18	ENSG00000133962	ENSG00000133962			20500	protein-coding gene	gene with protein product		611169	"""chromosome 14 open reading frame 161"", ""cation channel, sperm-associated, beta"""	C14orf161		17478420	Standard	NM_024764		Approved	FLJ14298	uc001xzs.1	Q9H7T0	OTTHUMG00000171118	ENST00000256343.3:c.1395T>C	chr14.hg19:g.92126218A>G		52.0	0.0		34.0	13.0	NM_024764	A0AV51	Silent	SNP	ENST00000256343.3	hg19	CCDS32142.1																																																																																			.	.		0.348	CATSPERB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411769.1	NM_024764	
UNC79	57578	hgsc.bcm.edu	37	14	94046694	94046694	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr14:94046694T>A	ENST00000393151.2	+	19	2633	c.2633T>A	c.(2632-2634)cTa>cAa	p.L878Q	UNC79_ENST00000256339.4_Missense_Mutation_p.L701Q|UNC79_ENST00000553484.1_Missense_Mutation_p.L878Q|UNC79_ENST00000555664.1_Missense_Mutation_p.L878Q			Q9P2D8	UNC79_HUMAN	unc-79 homolog (C. elegans)	878					behavioral response to ethanol (GO:0048149)|ion transmembrane transport (GO:0034220)|multicellular organism growth (GO:0035264)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(3)|cervix(2)|endometrium(10)|kidney(7)|large_intestine(18)|liver(1)|lung(64)|ovary(1)|prostate(5)|skin(3)|urinary_tract(4)	118						CTGGAGAGACTAGCTCCTAAA	0.458																																					p.L701Q		Atlas-SNP	.											.	UNC79	366	.	0			c.T2102A						.						75.0	80.0	78.0					14																	94046694		2203	4300	6503	SO:0001583	missense	57578	exon19			AGAGACTAGCTCC	AB037830	CCDS9911.2	14q32.13	2011-08-18	2011-08-18	2011-08-18	ENSG00000133958	ENSG00000133958			19966	protein-coding gene	gene with protein product			"""KIAA1409"""	KIAA1409		20714347, 21040849	Standard	NM_020818		Approved		uc001ybs.1	Q9P2D8	OTTHUMG00000029783	ENST00000393151.2:c.2633T>A	chr14.hg19:g.94046694T>A	ENSP00000376858:p.Leu878Gln	102.0	0.0		104.0	53.0	NM_020818	B5MDL6|Q6ZUT7	Missense_Mutation	SNP	ENST00000393151.2	hg19		.	.	.	.	.	.	.	.	.	.	T	23.0	4.366899	0.82463	.	.	ENSG00000133958	ENST00000256339;ENST00000555664;ENST00000553484;ENST00000393151;ENST00000393153	T;T;T;T	0.25250	1.81;1.81;1.81;1.81	5.11	5.11	0.69529	.	0.000000	0.64402	D	0.000001	T	0.45856	0.1363	L	0.50333	1.59	0.49483	D	0.999797	D	0.76494	0.999	D	0.83275	0.996	T	0.44667	-0.9313	10	0.87932	D	0	-8.628	14.9032	0.70696	0.0:0.0:0.0:1.0	.	878	C9JQL1	.	Q	701;878;878;878;878	ENSP00000256339:L701Q;ENSP00000450868:L878Q;ENSP00000451360:L878Q;ENSP00000376858:L878Q	ENSP00000256339:L701Q	L	+	2	0	KIAA1409	93116447	1.000000	0.71417	0.998000	0.56505	0.993000	0.82548	7.817000	0.86213	1.938000	0.56188	0.459000	0.35465	CTA	.	.		0.458	UNC79-006	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000412766.1	XM_028395	
DICER1	23405	hgsc.bcm.edu	37	14	95560494	95560494	+	Splice_Site	SNP	C	C	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr14:95560494C>A	ENST00000526495.1	-	26	5387		c.e26-1		DICER1_ENST00000527414.1_Splice_Site|DICER1_ENST00000343455.3_Splice_Site|DICER1_ENST00000527416.2_5'Flank|DICER1_ENST00000556045.1_Splice_Site|DICER1_ENST00000393063.1_Splice_Site|DICER1_ENST00000541352.1_Splice_Site			Q9UPY3	DICER_HUMAN	dicer 1, ribonuclease type III						angiogenesis (GO:0001525)|branching morphogenesis of an epithelial tube (GO:0048754)|cardiac muscle cell development (GO:0055013)|cerebral cortex development (GO:0021987)|defense response to virus (GO:0051607)|embryonic hindlimb morphogenesis (GO:0035116)|gene expression (GO:0010467)|hair follicle cell proliferation (GO:0071335)|hair follicle morphogenesis (GO:0031069)|inner ear receptor cell development (GO:0060119)|intestinal epithelial cell development (GO:0060576)|lung development (GO:0030324)|mRNA stabilization (GO:0048255)|multicellular organism growth (GO:0035264)|negative regulation of Schwann cell proliferation (GO:0010626)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nerve development (GO:0021675)|neuron projection morphogenesis (GO:0048812)|olfactory bulb interneuron differentiation (GO:0021889)|peripheral nervous system myelin formation (GO:0032290)|positive regulation of gene expression (GO:0010628)|positive regulation of miRNA metabolic process (GO:2000630)|positive regulation of myelination (GO:0031643)|positive regulation of Schwann cell differentiation (GO:0014040)|post-embryonic development (GO:0009791)|pre-miRNA processing (GO:0031054)|production of miRNAs involved in gene silencing by miRNA (GO:0035196)|production of siRNA involved in RNA interference (GO:0030422)|regulation of cell cycle (GO:0051726)|regulation of enamel mineralization (GO:0070173)|regulation of neuron differentiation (GO:0045664)|regulation of oligodendrocyte differentiation (GO:0048713)|regulation of viral genome replication (GO:0045069)|reproductive structure development (GO:0048608)|RNA phosphodiester bond hydrolysis (GO:0090501)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|spinal cord motor neuron differentiation (GO:0021522)|spindle assembly (GO:0051225)|spleen development (GO:0048536)|stem cell maintenance (GO:0019827)|targeting of mRNA for destruction involved in RNA interference (GO:0030423)|zygote asymmetric cell division (GO:0010070)	axon (GO:0030424)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|growth cone (GO:0030426)|RISC complex (GO:0016442)	ATP binding (GO:0005524)|double-stranded RNA binding (GO:0003725)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|miRNA binding (GO:0035198)|ribonuclease III activity (GO:0004525)			NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(1)|central_nervous_system(1)|endometrium(13)|kidney(3)|large_intestine(10)|lung(33)|ovary(1)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(3)	75		all_cancers(154;0.0621)|all_epithelial(191;0.223)		Epithelial(152;0.211)|COAD - Colon adenocarcinoma(157;0.215)		TGGTAACAATCTGAGGGGATC	0.488			"""Mis F, N"""		"""sex cord-stromal tumour, TGCT, embryonal rhadomyosarcoma"""	pleuropulmonary blastoma			Familial Multinodular Goiter ;DICER 1 syndrome																												.		Atlas-SNP	.	yes	Rec	yes	Familial Pleuropulmonary Blastoma	14	14q32.13	23405	"""dicer 1, ribonuclease type III """		"""E, M, O"""	.	DICER1	181	.	0			c.5096-1G>T						.						55.0	59.0	57.0					14																	95560494		2203	4300	6503	SO:0001630	splice_region_variant	23405	exon25	Familial Cancer Database	Adolescent Multinodular Goiter, incl. Multinodular Euthyroid Goiter & Non-Medullary Thyroid Cancer;incl. Pleuropulmonary Blastoma, Familial ; Cystic Nephroma, Familial	AACAATCTGAGGG	AB028449	CCDS9931.1, CCDS55941.1	14q32.13	2014-09-17	2008-02-20		ENSG00000100697	ENSG00000100697			17098	protein-coding gene	gene with protein product	"""dicer 1, double-stranded RNA-specific endoribonuclease"""	606241	"""Dicer1, Dcr-1 homolog (Drosophila)"", ""multinodular goitre 1"""	MNG1		10051563, 10786632, 21205968	Standard	NM_177438		Approved	Dicer, KIAA0928, K12H4.8-LIKE, HERNA	uc001ydw.2	Q9UPY3	OTTHUMG00000166134	ENST00000526495.1:c.5096-1G>T	chr14.hg19:g.95560494C>A		60.0	0.0		47.0	17.0	NM_177438	A7E2D3|B3KRG4|E0AD28|O95943|Q9UQ02	Splice_Site	SNP	ENST00000526495.1	hg19	CCDS9931.1	.	.	.	.	.	.	.	.	.	.	C	20.5	4.008776	0.75046	.	.	ENSG00000100697	ENST00000343455;ENST00000526495;ENST00000393063;ENST00000527414;ENST00000556045;ENST00000541352	.	.	.	5.43	5.43	0.79202	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.2735	0.94021	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	DICER1	94630247	1.000000	0.71417	1.000000	0.80357	0.947000	0.59692	7.421000	0.80204	2.549000	0.85964	0.655000	0.94253	.	.	.		0.488	DICER1-004	KNOWN	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000387997.1		Intron
BDKRB2	624	hgsc.bcm.edu	37	14	96707662	96707662	+	Missense_Mutation	SNP	G	G	T	rs201791629		TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr14:96707662G>T	ENST00000306005.3	+	3	1193	c.997G>T	c.(997-999)Gtg>Ttg	p.V333L	RP11-404P21.8_ENST00000553811.1_Intron|BDKRB2_ENST00000539359.1_Missense_Mutation_p.V306L|BDKRB2_ENST00000542454.2_Missense_Mutation_p.V306L|BDKRB2_ENST00000554311.1_Missense_Mutation_p.V333L	NM_000623.3	NP_000614.1	P30411	BKRB2_HUMAN	bradykinin receptor B2	333					arachidonic acid secretion (GO:0050482)|blood circulation (GO:0008015)|cell surface receptor signaling pathway (GO:0007166)|G-protein coupled receptor signaling pathway (GO:0007186)|inflammatory response (GO:0006954)|metabolic process (GO:0008152)|negative regulation of intrinsic apoptotic signaling pathway in response to osmotic stress by p53 class mediator (GO:1902239)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of vascular permeability (GO:0043114)|regulation of vasoconstriction (GO:0019229)|response to salt stress (GO:0009651)|smooth muscle contraction (GO:0006939)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vasoconstriction (GO:0042310)|vasodilation (GO:0042311)	endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	bradykinin receptor activity (GO:0004947)|phosphatidylinositol phospholipase C activity (GO:0004435)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|type 1 angiotensin receptor binding (GO:0031702)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(5)|lung(7)|ovary(3)|skin(1)	24		all_cancers(154;0.0678)|Melanoma(154;0.155)|all_epithelial(191;0.179)		COAD - Colon adenocarcinoma(157;0.226)	Icatibant(DB06196)	ACTGGTGTACGTGATCGTGGG	0.562																																					p.V333L		Atlas-SNP	.											.	BDKRB2	56	.	0			c.G997T						.						77.0	67.0	71.0					14																	96707662		2203	4300	6503	SO:0001583	missense	624	exon3			GTGTACGTGATCG	S56772	CCDS9942.1	14q32.1-q32.2	2012-08-08				ENSG00000168398		"""GPCR / Class A : Bradykinin receptors"""	1030	protein-coding gene	gene with protein product		113503				7916737	Standard	NM_000623		Approved	BK-2	uc010avm.1	P30411		ENST00000306005.3:c.997G>T	chr14.hg19:g.96707662G>T	ENSP00000307713:p.Val333Leu	117.0	0.0		99.0	44.0	NM_000623		Missense_Mutation	SNP	ENST00000306005.3	hg19	CCDS9942.1	.	.	.	.	.	.	.	.	.	.	G	25.4	4.637872	0.87760	.	.	ENSG00000168398	ENST00000542454;ENST00000554311;ENST00000306005;ENST00000539359	T;T;T;T	0.19532	2.14;2.14;2.14;2.14	4.77	4.77	0.60923	.	0.000000	0.85682	D	0.000000	T	0.35480	0.0933	M	0.68952	2.095	0.58432	D	0.999994	D	0.56521	0.976	P	0.49999	0.628	T	0.30504	-0.9976	10	0.66056	D	0.02	-28.6288	17.779	0.88518	0.0:0.0:1.0:0.0	.	333	P30411	BKRB2_HUMAN	L	306;333;333;306	ENSP00000439459:V306L;ENSP00000450482:V333L;ENSP00000307713:V333L;ENSP00000438376:V306L	ENSP00000307713:V333L	V	+	1	0	BDKRB2	95777415	1.000000	0.71417	0.767000	0.31495	0.896000	0.52359	7.904000	0.87408	2.196000	0.70406	0.561000	0.74099	GTG	.	.		0.562	BDKRB2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413294.1		
SETD3	84193	hgsc.bcm.edu	37	14	99865385	99865385	+	Silent	SNP	T	T	C			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr14:99865385T>C	ENST00000331768.5	-	13	1575	c.1416A>G	c.(1414-1416)aaA>aaG	p.K472K		NM_032233.2	NP_115609.2	Q86TU7	SETD3_HUMAN	SET domain containing 3	472					histone H3-K36 methylation (GO:0010452)|peptidyl-lysine dimethylation (GO:0018027)|peptidyl-lysine monomethylation (GO:0018026)|peptidyl-lysine trimethylation (GO:0018023)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)	histone methyltransferase activity (H3-K36 specific) (GO:0046975)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|transcription coactivator activity (GO:0003713)			NS(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(8)|lung(8)|ovary(1)|skin(1)	25		all_cancers(154;0.224)|all_epithelial(191;0.0644)|Melanoma(154;0.0866)				CCAAAATCTCTTTCTCACCTA	0.413																																					p.K472K		Atlas-SNP	.											.	SETD3	56	.	0			c.A1416G						.						96.0	97.0	96.0					14																	99865385		2203	4300	6503	SO:0001819	synonymous_variant	84193	exon13			AATCTCTTTCTCA	AK026680	CCDS9951.1, CCDS9952.1	14q32.2	2006-02-15	2006-02-15	2006-02-15	ENSG00000183576	ENSG00000183576			20493	protein-coding gene	gene with protein product		615671	"""chromosome 14 open reading frame 154"""	C14orf154			Standard	NM_032233		Approved	FLJ23027	uc001ygc.3	Q86TU7	OTTHUMG00000028970	ENST00000331768.5:c.1416A>G	chr14.hg19:g.99865385T>C		148.0	0.0		142.0	57.0	NM_032233	A0PJU3|A5PLP0|B4DZE8|Q0VAQ2|Q659C0|Q86TU8|Q96GY9|Q9H5U5	Silent	SNP	ENST00000331768.5	hg19	CCDS9951.1																																																																																			.	.		0.413	SETD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000072339.3	NM_032233	
TDRD9	122402	hgsc.bcm.edu	37	14	104460669	104460669	+	Splice_Site	SNP	G	G	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr14:104460669G>T	ENST00000409874.4	+	10	1229	c.1181G>T	c.(1180-1182)gGt>gTt	p.G394V	TDRD9_ENST00000339063.5_Splice_Site_p.G394V	NM_153046.2	NP_694591.2	Q8NDG6	TDRD9_HUMAN	tudor domain containing 9	394	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				cell differentiation (GO:0030154)|DNA methylation involved in gamete generation (GO:0043046)|fertilization (GO:0009566)|gene silencing by RNA (GO:0031047)|male meiosis (GO:0007140)|multicellular organismal development (GO:0007275)|piRNA metabolic process (GO:0034587)|spermatogenesis (GO:0007283)	nucleus (GO:0005634)|piP-body (GO:0071547)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|nucleic acid binding (GO:0003676)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(10)|ovary(2)|pancreas(1)|prostate(2)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)	33		all_cancers(154;0.109)|Melanoma(154;0.0525)|all_epithelial(191;0.0768)				TCTTCCCTAGGTCTGGGTGAA	0.353																																					p.G394V		Atlas-SNP	.											.	TDRD9	175	.	0			c.G1181T						.						166.0	173.0	171.0					14																	104460669		2203	4300	6503	SO:0001630	splice_region_variant	122402	exon10			CCCTAGGTCTGGG	AK093483	CCDS9987.2	14q32.33	2013-01-23	2004-04-01	2004-04-02	ENSG00000156414	ENSG00000156414		"""Tudor domain containing"""	20122	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 75"""	C14orf75			Standard	NM_153046		Approved	DKFZp434N0820, FLJ36164, NET54	uc001yom.4	Q8NDG6	OTTHUMG00000152876	ENST00000409874.4:c.1181-1G>T	chr14.hg19:g.104460669G>T		63.0	0.0		77.0	29.0	NM_153046	A1A4S7|Q6ZU54|Q8N7T3|Q8N827|Q8N9V5|Q96AS9	Missense_Mutation	SNP	ENST00000409874.4	hg19	CCDS9987.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	23.2|23.2	4.384969|4.384969	0.82792|0.82792	.|.	.|.	ENSG00000156414|ENSG00000156414	ENST00000409874;ENST00000339063|ENST00000557332	T;T|.	0.06608|.	3.28;3.28|.	5.72|5.72	5.72|5.72	0.89469|0.89469	Helicase, C-terminal (1);|.	0.000000|.	0.64402|.	D|.	0.000011|.	D|D	0.91670|0.91670	0.7367|0.7367	H|H	0.99104|0.99104	4.43|4.43	0.80722|0.80722	D|D	1|1	D;D|.	0.89917|.	1.0;1.0|.	D;D|.	0.91635|.	0.999;0.998|.	D|D	0.94776|0.94776	0.7949|0.7949	9|5	.|.	.|.	.|.	.|.	19.4897|19.4897	0.95046|0.95046	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	394;394|.	Q8NDG6-2;Q8NDG6|.	.;TDRD9_HUMAN|.	V|S	394|120	ENSP00000387303:G394V;ENSP00000343545:G394V|.	.|.	G|R	+|+	2|3	0|2	TDRD9|TDRD9	103530422|103530422	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.943000|0.943000	0.58893|0.58893	7.849000|7.849000	0.86908|0.86908	2.711000|2.711000	0.92665|0.92665	0.655000|0.655000	0.94253|0.94253	GGT|AGG	.	.		0.353	TDRD9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328325.3	NM_153046	Missense_Mutation
TMEM179	388021	hgsc.bcm.edu	37	14	105070865	105070865	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr14:105070865G>A	ENST00000556573.1	-	1	455	c.214C>T	c.(214-216)Cgc>Tgc	p.R72C	TMEM179_ENST00000341595.3_Missense_Mutation_p.R72C			Q6ZVK1	T179A_HUMAN	transmembrane protein 179	72						integral component of membrane (GO:0016021)				endometrium(1)|lung(2)|skin(1)	4			all cancers(16;0.00276)|OV - Ovarian serous cystadenocarcinoma(23;0.0262)|Epithelial(46;0.058)|GBM - Glioblastoma multiforme(11;0.116)	Epithelial(152;0.129)		AGGCTGAAGCGGCAGGCGGCC	0.701																																					p.R72C		Atlas-SNP	.											.	TMEM179	9	.	0			c.C214T						.						4.0	6.0	6.0					14																	105070865		1999	3949	5948	SO:0001583	missense	388021	exon1			TGAAGCGGCAGGC	AK124477	CCDS66723.1, CCDS73688.1	14q32.33	2012-04-11	2006-10-16	2006-10-16	ENSG00000258986	ENSG00000258986			20137	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 90"""	C14orf90			Standard	NM_001286390		Approved	FLJ42486, TMEM179A	uc001yox.1	Q6ZVK1	OTTHUMG00000170829	ENST00000556573.1:c.214C>T	chr14.hg19:g.105070865G>A	ENSP00000450958:p.Arg72Cys	63.0	0.0		43.0	19.0	NM_207379		Missense_Mutation	SNP	ENST00000556573.1	hg19		.	.	.	.	.	.	.	.	.	.	G	19.06	3.754837	0.69648	.	.	ENSG00000189203;ENSG00000258986;ENSG00000258986	ENST00000415614;ENST00000556573;ENST00000341595	T;T;T	0.19394	2.15;2.15;2.15	2.75	2.75	0.32379	.	0.246648	0.40144	N	0.001175	T	0.32436	0.0829	L	0.47716	1.5	0.54753	D	0.99998	D	0.89917	1.0	D	0.63703	0.917	T	0.04767	-1.0928	10	0.62326	D	0.03	.	9.233	0.37448	0.0:0.0:0.7836:0.2164	.	72	Q6ZVK1-2	.	C	72	ENSP00000397763:R72C;ENSP00000450958:R72C;ENSP00000340477:R72C	ENSP00000340477:R72C	R	-	1	0	RP11-614O9.3;TMEM179	104141910	1.000000	0.71417	0.999000	0.59377	0.945000	0.59286	4.372000	0.59530	1.352000	0.45808	0.462000	0.41574	CGC	.	.		0.701	TMEM179-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000410585.1	NM_207379	
NPAP1	23742	hgsc.bcm.edu	37	15	24921224	24921224	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr15:24921224G>T	ENST00000329468.2	+	1	684	c.210G>T	c.(208-210)agG>agT	p.R70S		NM_018958.2	NP_061831.2	Q9NZP6	NPAP1_HUMAN	nuclear pore associated protein 1	70					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)											CCCCTAAGAGGCCGTGTCCTC	0.706																																					p.R70S		Atlas-SNP	.											.	.	.	.	0			c.G210T						.						17.0	21.0	20.0					15																	24921224		2189	4273	6462	SO:0001583	missense	23742	exon1			TAAGAGGCCGTGT	AF179681	CCDS10015.1	15q11-q13	2012-07-19	2012-06-14	2012-06-14	ENSG00000185823	ENSG00000185823			1190	protein-coding gene	gene with protein product		610922	"""chromosome 15 open reading frame 2"""	C15orf2		10783265, 22694955	Standard	NM_018958		Approved		uc001ywo.3	Q9NZP6	OTTHUMG00000129179	ENST00000329468.2:c.210G>T	chr15.hg19:g.24921224G>T	ENSP00000333735:p.Arg70Ser	39.0	0.0		46.0	21.0	NM_018958		Missense_Mutation	SNP	ENST00000329468.2	hg19	CCDS10015.1	.	.	.	.	.	.	.	.	.	.	.	13.47	2.248089	0.39697	.	.	ENSG00000185823	ENST00000329468	T	0.29917	1.55	2.45	1.51	0.23008	.	0.209142	0.24238	N	0.040283	T	0.36026	0.0952	L	0.34521	1.04	0.09310	N	1	D	0.76494	0.999	D	0.74023	0.982	T	0.05225	-1.0898	10	0.59425	D	0.04	.	5.2401	0.15467	0.1721:0.0:0.8279:0.0	.	70	Q9NZP6	CO002_HUMAN	S	70	ENSP00000333735:R70S	ENSP00000333735:R70S	R	+	3	2	C15orf2	22472317	0.001000	0.12720	0.004000	0.12327	0.003000	0.03518	0.422000	0.21296	0.594000	0.29761	0.484000	0.47621	AGG	.	.		0.706	NPAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251253.1	NM_018958	
NPAP1	23742	hgsc.bcm.edu	37	15	24921716	24921716	+	Silent	SNP	G	G	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr15:24921716G>A	ENST00000329468.2	+	1	1176	c.702G>A	c.(700-702)ttG>ttA	p.L234L		NM_018958.2	NP_061831.2	Q9NZP6	NPAP1_HUMAN	nuclear pore associated protein 1	234					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)											GCTCCTGCTTGGAAGGCCCTG	0.612																																					p.L234L		Atlas-SNP	.											.	.	.	.	0			c.G702A						.						30.0	32.0	31.0					15																	24921716		2203	4300	6503	SO:0001819	synonymous_variant	23742	exon1			CTGCTTGGAAGGC	AF179681	CCDS10015.1	15q11-q13	2012-07-19	2012-06-14	2012-06-14	ENSG00000185823	ENSG00000185823			1190	protein-coding gene	gene with protein product		610922	"""chromosome 15 open reading frame 2"""	C15orf2		10783265, 22694955	Standard	NM_018958		Approved		uc001ywo.3	Q9NZP6	OTTHUMG00000129179	ENST00000329468.2:c.702G>A	chr15.hg19:g.24921716G>A		57.0	0.0		61.0	32.0	NM_018958		Silent	SNP	ENST00000329468.2	hg19	CCDS10015.1																																																																																			.	.		0.612	NPAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251253.1	NM_018958	
GABRA5	2558	hgsc.bcm.edu	37	15	27114454	27114454	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr15:27114454T>A	ENST00000335625.5	+	3	947	c.59T>A	c.(58-60)aTt>aAt	p.I20N	GABRB3_ENST00000541819.2_Intron|GABRA5_ENST00000400081.3_Missense_Mutation_p.I20N|GABRA5_ENST00000355395.5_Missense_Mutation_p.I20N|GABRA5_ENST00000557449.1_3'UTR	NM_000810.3	NP_000801.1	P31644	GBRA5_HUMAN	gamma-aminobutyric acid (GABA) A receptor, alpha 5	20					associative learning (GO:0008306)|behavioral fear response (GO:0001662)|brain development (GO:0007420)|cochlea development (GO:0090102)|gamma-aminobutyric acid signaling pathway (GO:0007214)|inner ear receptor cell development (GO:0060119)|innervation (GO:0060384)|ion transmembrane transport (GO:0034220)|negative regulation of neuron apoptotic process (GO:0043524)|sensory perception of sound (GO:0007605)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|neuronal cell body membrane (GO:0032809)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|receptor complex (GO:0043235)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)|receptor activity (GO:0004872)|transporter activity (GO:0005215)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(26)|ovary(1)|upper_aerodigestive_tract(1)	49		all_lung(180;4.59e-13)|Breast(32;0.000563)|Colorectal(260;0.227)		all cancers(64;1.45e-08)|Epithelial(43;4.96e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0232)|Lung(196;0.182)	Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amobarbital(DB01351)|Amoxapine(DB00543)|Aprobarbital(DB01352)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methylphenobarbital(DB00849)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Secobarbital(DB00418)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Thiopental(DB00599)|Topiramate(DB00273)|Triazolam(DB00897)|Zopiclone(DB01198)	CTCTTTTGTATTTCCATGAAC	0.388																																					p.I20N		Atlas-SNP	.											.	GABRA5	127	.	0			c.T59A						.						205.0	198.0	200.0					15																	27114454		1901	4127	6028	SO:0001583	missense	2558	exon3			TTTGTATTTCCAT		CCDS45194.1	15q12	2012-06-22			ENSG00000186297	ENSG00000186297		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4079	protein-coding gene	gene with protein product	"""GABA(A) receptor, alpha 5"""	137142				1321750	Standard	NM_000810		Approved		uc021sgi.1	P31644	OTTHUMG00000171824	ENST00000335625.5:c.59T>A	chr15.hg19:g.27114454T>A	ENSP00000335592:p.Ile20Asn	139.0	0.0		132.0	45.0	NM_001165037	A8K338|Q14DC2|Q53XL6|Q9NYT3|Q9NYT4|Q9NYT5	Missense_Mutation	SNP	ENST00000335625.5	hg19	CCDS45194.1	.	.	.	.	.	.	.	.	.	.	T	14.46	2.540737	0.45280	.	.	ENSG00000186297	ENST00000335625;ENST00000355395;ENST00000557484;ENST00000400081;ENST00000554038;ENST00000554596;ENST00000554599	T;T;T;T;T;T	0.81247	-0.62;-0.62;-0.62;-1.21;-1.15;-1.47	5.82	2.31	0.28768	.	0.502130	0.20995	N	0.081974	T	0.59770	0.2218	N	0.08118	0	0.24078	N	0.995958	B	0.15473	0.013	B	0.11329	0.006	T	0.51702	-0.8672	10	0.49607	T	0.09	.	6.8613	0.24067	0.0:0.2596:0.0:0.7404	.	20	P31644	GBRA5_HUMAN	N	20	ENSP00000335592:I20N;ENSP00000347557:I20N;ENSP00000382953:I20N;ENSP00000451527:I20N;ENSP00000450806:I20N;ENSP00000450717:I20N	ENSP00000335592:I20N	I	+	2	0	GABRA5	24665547	1.000000	0.71417	0.972000	0.41901	0.985000	0.73830	2.894000	0.48640	0.461000	0.27071	0.533000	0.62120	ATT	.	.		0.388	GABRA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415234.1		
CHRM5	1133	hgsc.bcm.edu	37	15	34355220	34355220	+	Missense_Mutation	SNP	T	T	G			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr15:34355220T>G	ENST00000383263.5	+	3	972	c.302T>G	c.(301-303)cTg>cGg	p.L101R	CHRM5_ENST00000557872.1_Missense_Mutation_p.L101R	NM_012125.3	NP_036257.1	P08912	ACM5_HUMAN	cholinergic receptor, muscarinic 5	101					adenylate cyclase-inhibiting G-protein coupled acetylcholine receptor signaling pathway (GO:0007197)|cell proliferation (GO:0008283)|dopamine transport (GO:0015872)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|gastric acid secretion (GO:0001696)|metabolic process (GO:0008152)|regulation of phosphatidylinositol dephosphorylation (GO:0060304)|transmission of nerve impulse (GO:0019226)	cell junction (GO:0030054)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	G-protein coupled acetylcholine receptor activity (GO:0016907)|phosphatidylinositol phospholipase C activity (GO:0004435)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(10)|ovary(1)|skin(1)	20		all_lung(180;1.76e-08)		all cancers(64;4.82e-17)|GBM - Glioblastoma multiforme(113;2.58e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0262)	Aclidinium(DB08897)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Aripiprazole(DB01238)|Atropine(DB00572)|Brompheniramine(DB00835)|Chlorprothixene(DB01239)|Cinnarizine(DB00568)|Clozapine(DB00363)|Cryptenamine(DB00785)|Darifenacin(DB00496)|Desipramine(DB01151)|Doxepin(DB01142)|Fesoterodine(DB06702)|Homatropine Methylbromide(DB00725)|Imipramine(DB00458)|Ketamine(DB01221)|Loxapine(DB00408)|Maprotiline(DB00934)|Methotrimeprazine(DB01403)|Metixene(DB00340)|Nicardipine(DB00622)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Paroxetine(DB00715)|Pethidine(DB00454)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Quetiapine(DB01224)|Scopolamine(DB00747)|Solifenacin(DB01591)|Tolterodine(DB01036)|Trihexyphenidyl(DB00376)|Trimipramine(DB00726)|Ziprasidone(DB00246)	CTCGGGAGTCTGGCTTGTGAC	0.507																																					p.L101R		Atlas-SNP	.											.	CHRM5	59	.	0			c.T302G						.						83.0	71.0	75.0					15																	34355220		2201	4298	6499	SO:0001583	missense	1133	exon3			GGAGTCTGGCTTG		CCDS10031.1	15q26	2012-08-08			ENSG00000184984	ENSG00000184984		"""Cholinergic receptors"", ""GPCR / Class A : Cholinergic receptors, muscarinic"""	1954	protein-coding gene	gene with protein product	"""acetylcholine receptor, muscarinic 5"""	118496					Standard	NM_012125		Approved		uc001zhk.1	P08912	OTTHUMG00000129369	ENST00000383263.5:c.302T>G	chr15.hg19:g.34355220T>G	ENSP00000372750:p.Leu101Arg	172.0	0.0		138.0	54.0	NM_012125	Q96RG7	Missense_Mutation	SNP	ENST00000383263.5	hg19	CCDS10031.1	.	.	.	.	.	.	.	.	.	.	T	17.05	3.289524	0.59976	.	.	ENSG00000184984	ENST00000383263	T	0.73363	-0.74	5.64	5.64	0.86602	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	D	0.83862	0.5346	L	0.60067	1.865	0.51012	D	0.999904	D	0.63880	0.993	D	0.72982	0.979	D	0.85389	0.1124	10	0.87932	D	0	-8.7407	16.0238	0.80522	0.0:0.0:0.0:1.0	.	101	P08912	ACM5_HUMAN	R	101	ENSP00000372750:L101R	ENSP00000372750:L101R	L	+	2	0	CHRM5	32142512	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	4.975000	0.63777	2.367000	0.80283	0.528000	0.53228	CTG	.	.		0.507	CHRM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251521.2		
DPH6	89978	hgsc.bcm.edu	37	15	35830633	35830633	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr15:35830633T>A	ENST00000256538.4	-	3	180	c.154A>T	c.(154-156)Aca>Tca	p.T52S	DPH6_ENST00000440392.2_Missense_Mutation_p.T52S	NM_080650.3	NP_542381.1	Q7L8W6	DPH6_HUMAN	diphthamine biosynthesis 6	52					peptidyl-diphthamide biosynthetic process from peptidyl-histidine (GO:0017183)		ATP binding (GO:0005524)|diphthine-ammonia ligase activity (GO:0017178)										TGCCCCACTGTCTGATACATG	0.438																																					p.T52S		Atlas-SNP	.											.	ATPBD4	30	.	0			c.A154T						.						122.0	100.0	107.0					15																	35830633		2201	4298	6499	SO:0001583	missense	89978	exon3			CCACTGTCTGATA		CCDS10043.1, CCDS45213.1	15q14	2013-06-19	2013-06-19	2013-05-02	ENSG00000134146	ENSG00000134146	6.3.1.14		30543	protein-coding gene	gene with protein product	"""diphthine--ammonia ligase"""		"""ATP binding domain 4"", ""DPH6 homolog (S. cerevisiae)"""	ATPBD4		23169644, 23468660	Standard	NM_080650		Approved	MGC14798		Q7L8W6	OTTHUMG00000129759	ENST00000256538.4:c.154A>T	chr15.hg19:g.35830633T>A	ENSP00000256538:p.Thr52Ser	151.0	0.0		157.0	70.0	NM_001141972	B3KWG1|Q96HJ6	Missense_Mutation	SNP	ENST00000256538.4	hg19	CCDS10043.1	.	.	.	.	.	.	.	.	.	.	T	24.7	4.554891	0.86231	.	.	ENSG00000134146	ENST00000256538;ENST00000440392	T;T	0.40756	1.54;1.02	5.8	5.8	0.92144	Domain of unknown function DUF71, ATP-binding domain (2);Rossmann-like alpha/beta/alpha sandwich fold (1);	0.000000	0.85682	D	0.000000	T	0.48409	0.1498	L	0.33245	0.995	0.58432	D	0.999999	P;P	0.47191	0.891;0.881	P;P	0.55303	0.773;0.598	T	0.36286	-0.9754	10	0.35671	T	0.21	-20.2853	16.1559	0.81666	0.0:0.0:0.0:1.0	.	52;52	B3KWG1;Q7L8W6	.;ATBD4_HUMAN	S	52	ENSP00000256538:T52S;ENSP00000406976:T52S	ENSP00000256538:T52S	T	-	1	0	ATPBD4	33617925	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.991000	0.88244	2.229000	0.72834	0.528000	0.53228	ACA	.	.		0.438	DPH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251973.1	NM_080650	
FAM98B	283742	hgsc.bcm.edu	37	15	38773693	38773693	+	Missense_Mutation	SNP	A	A	C			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr15:38773693A>C	ENST00000491535.1	+	7	938	c.930A>C	c.(928-930)gaA>gaC	p.E310D	FAM98B_ENST00000397609.2_Intron	NM_001042429.1	NP_001035894.1	Q52LJ0	FA98B_HUMAN	family with sequence similarity 98, member B	310						cytoplasm (GO:0005737)|nucleus (GO:0005634)|tRNA-splicing ligase complex (GO:0072669)	poly(A) RNA binding (GO:0044822)			endometrium(2)|large_intestine(3)|lung(1)|ovary(1)|skin(1)	8		all_cancers(109;3.11e-17)|all_epithelial(112;2.64e-15)|Lung NSC(122;2.11e-11)|all_lung(180;5.61e-10)|Melanoma(134;0.0574)		GBM - Glioblastoma multiforme(113;9e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0209)		TGGAAAATGAATTGATGATAT	0.378																																					p.E310D		Atlas-SNP	.											.	FAM98B	53	.	0			c.A930C						.						143.0	136.0	139.0					15																	38773693		2200	4297	6497	SO:0001583	missense	283742	exon7			AAATGAATTGATG		CCDS10047.2	15q14	2006-11-29		2005-11-20	ENSG00000171262	ENSG00000171262			26773	protein-coding gene	gene with protein product						12477932	Standard	NM_173611		Approved	FLJ38426	uc001zkc.3	Q52LJ0	OTTHUMG00000129831	ENST00000491535.1:c.930A>C	chr15.hg19:g.38773693A>C	ENSP00000453166:p.Glu310Asp	149.0	0.0		150.0	60.0	NM_001042429	A8MUW5|Q8N935	Missense_Mutation	SNP	ENST00000491535.1	hg19	CCDS42015.1	.	.	.	.	.	.	.	.	.	.	A	11.40	1.627715	0.28978	.	.	ENSG00000171262	ENST00000305752	.	.	.	4.38	2.07	0.26955	.	.	.	.	.	T	0.15089	0.0364	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.26815	-1.0092	7	.	.	.	.	2.9128	0.05743	0.613:0.0:0.2031:0.1839	.	310	Q52LJ0	FA98B_HUMAN	D	310	.	.	E	+	3	2	FAM98B	36560985	0.017000	0.18338	0.006000	0.13384	0.029000	0.11900	0.720000	0.25896	0.323000	0.23307	0.383000	0.25322	GAA	.	.		0.378	FAM98B-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000252071.2	NM_173611	
GATM	2628	hgsc.bcm.edu	37	15	45668899	45668899	+	Missense_Mutation	SNP	T	T	G			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr15:45668899T>G	ENST00000396659.3	-	2	527	c.188A>C	c.(187-189)gAc>gCc	p.D63A	GATM_ENST00000558336.1_Missense_Mutation_p.D63A|GATM_ENST00000458245.5_5'Flank	NM_001482.2	NP_001473.1	P50440	GATM_HUMAN	glycine amidinotransferase (L-arginine:glycine amidinotransferase)	63					cellular nitrogen compound metabolic process (GO:0034641)|creatine biosynthetic process (GO:0006601)|creatine metabolic process (GO:0006600)|embryo development (GO:0009790)|response to mercury ion (GO:0046689)|response to nutrient (GO:0007584)|response to oxidative stress (GO:0006979)|response to peptide hormone (GO:0043434)|small molecule metabolic process (GO:0044281)|tissue regeneration (GO:0042246)	extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)	glycine amidinotransferase activity (GO:0015068)|hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in linear amidines (GO:0016813)			biliary_tract(1)|breast(1)|endometrium(1)|large_intestine(2)|lung(6)|prostate(2)|skin(1)|urinary_tract(1)	15		all_cancers(109;1.25e-09)|all_epithelial(112;5.56e-08)|Lung NSC(122;3.55e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)		all cancers(107;4.87e-16)|GBM - Glioblastoma multiforme(94;1.97e-06)	Glycine(DB00145)|L-Ornithine(DB00129)	GACAGGGCAGTCCTTGGGCAG	0.572																																					p.D63A		Atlas-SNP	.											.	GATM	34	.	0			c.A188C						.						115.0	104.0	108.0					15																	45668899		2198	4298	6496	SO:0001583	missense	2628	exon2			GGGCAGTCCTTGG	S68805	CCDS10122.1	15q15.1	2007-12-06			ENSG00000171766	ENSG00000171766	2.1.4.1		4175	protein-coding gene	gene with protein product		602360				8313955	Standard	NM_001482		Approved	AGAT	uc001zvc.3	P50440	OTTHUMG00000131427	ENST00000396659.3:c.188A>C	chr15.hg19:g.45668899T>G	ENSP00000379895:p.Asp63Ala	99.0	0.0		100.0	37.0	NM_001482	B4DH99|B4DPI3|Q53EQ4	Missense_Mutation	SNP	ENST00000396659.3	hg19	CCDS10122.1	.	.	.	.	.	.	.	.	.	.	T	16.31	3.087547	0.55968	.	.	ENSG00000171766	ENST00000396659	T	0.50813	0.73	5.81	4.65	0.58169	.	0.047245	0.85682	D	0.000000	T	0.21761	0.0524	N	0.03154	-0.405	0.39540	D	0.968802	B;B	0.19706	0.038;0.022	B;B	0.18561	0.022;0.01	T	0.14364	-1.0475	10	0.11182	T	0.66	-20.0193	10.6538	0.45663	0.1426:0.0:0.0:0.8574	.	63;63	P50440-3;P50440	.;GATM_HUMAN	A	63	ENSP00000379895:D63A	ENSP00000379895:D63A	D	-	2	0	GATM	43456191	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.930000	0.56522	2.210000	0.71456	0.533000	0.62120	GAC	.	.		0.572	GATM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254220.2	NM_001482	
SPATA5L1	79029	hgsc.bcm.edu	37	15	45694903	45694903	+	Missense_Mutation	SNP	G	G	C			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr15:45694903G>C	ENST00000305560.6	+	1	375	c.276G>C	c.(274-276)agG>agC	p.R92S	SPATA5L1_ENST00000559860.1_Missense_Mutation_p.R92S|GATM_ENST00000458245.5_5'Flank	NM_024063.2	NP_076968.2	Q9BVQ7	SPA5L_HUMAN	spermatogenesis associated 5-like 1	92						cytoplasm (GO:0005737)	ATP binding (GO:0005524)			kidney(2)|large_intestine(3)|lung(1)|ovary(3)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	14		Lung NSC(122;8.3e-05)|all_lung(180;0.000547)|Melanoma(134;0.0417)		all cancers(107;7.31e-17)|GBM - Glioblastoma multiforme(94;6.28e-07)		GATCCCGGAGGAGTCTCAGCC	0.756																																					p.R92S		Atlas-SNP	.											.	SPATA5L1	40	.	0			c.G276C						.						4.0	6.0	6.0					15																	45694903		2002	4026	6028	SO:0001583	missense	79029	exon1			CCGGAGGAGTCTC	AK023232	CCDS10123.1	15q15.1	2010-04-21			ENSG00000171763	ENSG00000171763		"""ATPases / AAA-type"""	28762	protein-coding gene	gene with protein product						12477932	Standard	NM_024063		Approved	MGC5347, FLJ12286	uc001zve.3	Q9BVQ7	OTTHUMG00000131425	ENST00000305560.6:c.276G>C	chr15.hg19:g.45694903G>C	ENSP00000305494:p.Arg92Ser	10.0	0.0		14.0	8.0	NM_024063	C9JHR5|Q9H8W7|Q9HA41	Missense_Mutation	SNP	ENST00000305560.6	hg19	CCDS10123.1	.	.	.	.	.	.	.	.	.	.	G	3.572	-0.087476	0.07097	.	.	ENSG00000171763	ENST00000305560	D	0.93488	-3.23	4.98	-1.74	0.08056	.	1.021240	0.07819	N	0.959485	D	0.82674	0.5088	N	0.08118	0	0.09310	N	1	B	0.15473	0.013	B	0.11329	0.006	T	0.70059	-0.4976	10	0.42905	T	0.14	-11.0034	4.9695	0.14108	0.414:0.0:0.4521:0.1339	.	92	Q9BVQ7	SPA5L_HUMAN	S	92	ENSP00000305494:R92S	ENSP00000305494:R92S	R	+	3	2	SPATA5L1	43482195	0.000000	0.05858	0.000000	0.03702	0.106000	0.19336	-0.390000	0.07332	-0.208000	0.10171	0.645000	0.84053	AGG	.	.		0.756	SPATA5L1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000254218.1	NM_024063	
FBN1	2200	hgsc.bcm.edu	37	15	48741033	48741033	+	Missense_Mutation	SNP	G	G	T	rs145082616		TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr15:48741033G>T	ENST00000316623.5	-	46	6058	c.5603C>A	c.(5602-5604)aCa>aAa	p.T1868K		NM_000138.4	NP_000129	P35555	FBN1_HUMAN	fibrillin 1	1868	EGF-like 31; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|heart development (GO:0007507)|kidney development (GO:0001822)|sequestering of BMP in extracellular matrix (GO:0035582)|sequestering of TGFbeta in extracellular matrix (GO:0035583)|skeletal system development (GO:0001501)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(5)|cervix(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|liver(1)|lung(49)|ovary(4)|pancreas(1)|prostate(9)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	139		all_lung(180;0.00279)		all cancers(107;4.24e-07)|GBM - Glioblastoma multiforme(94;1.41e-05)		GCTTCCAACTGTGTCAATGCA	0.343																																					p.T1868K		Atlas-SNP	.											.	FBN1	310	.	0			c.C5603A						.						102.0	96.0	98.0					15																	48741033		2197	4296	6493	SO:0001583	missense	2200	exon46			CCAACTGTGTCAA	X63556	CCDS32232.1	15q21.1	2014-09-17	2006-04-25			ENSG00000166147			3603	protein-coding gene	gene with protein product	"""Marfan syndrome"""	134797	"""fibrillin 1 (Marfan syndrome)"""	FBN, MFS1, WMS		10036187, 12525539	Standard	NM_000138		Approved	MASS, OCTD, SGS	uc001zwx.2	P35555		ENST00000316623.5:c.5603C>A	chr15.hg19:g.48741033G>T	ENSP00000325527:p.Thr1868Lys	60.0	0.0		69.0	7.0	NM_000138	B2RUU0|D2JYH6|Q15972|Q75N87	Missense_Mutation	SNP	ENST00000316623.5	hg19	CCDS32232.1	.	.	.	.	.	.	.	.	.	.	G	17.11	3.305187	0.60305	.	.	ENSG00000166147	ENST00000316623;ENST00000389087;ENST00000544030	D	0.92495	-3.05	6.16	5.25	0.73442	EGF-like calcium-binding, conserved site (1);EGF-like calcium-binding (2);Epidermal growth factor-like, type 3 (1);	0.210306	0.53938	D	0.000052	D	0.90601	0.7053	M	0.68593	2.085	0.80722	D	1	P	0.38617	0.64	B	0.40602	0.334	D	0.88397	0.3012	10	0.29301	T	0.29	.	11.403	0.49880	0.0683:0.1269:0.8049:0.0	.	1868	P35555	FBN1_HUMAN	K	1868;436;758	ENSP00000325527:T1868K	ENSP00000325527:T1868K	T	-	2	0	FBN1	46528325	0.998000	0.40836	0.999000	0.59377	0.996000	0.88848	2.632000	0.46511	1.612000	0.50221	0.650000	0.86243	ACA	.	G|1.000;A|0.000		0.343	FBN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417355.1		
GABPB1	2553	hgsc.bcm.edu	37	15	50578223	50578223	+	Intron	SNP	T	T	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr15:50578223T>A	ENST00000220429.8	-	8	1204				GABPB1_ENST00000560825.1_Silent_p.P346P|GABPB1_ENST00000429662.2_Silent_p.P359P|GABPB1_ENST00000543881.1_Intron|GABPB1_ENST00000380877.3_Intron|GABPB1_ENST00000359031.4_Silent_p.P347P|GABPB1_ENST00000396464.3_Silent_p.P347P			Q06547	GABP1_HUMAN	GA binding protein transcription factor, beta subunit 1						positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	protein heterodimerization activity (GO:0046982)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			cervix(1)|endometrium(1)|large_intestine(7)|lung(5)	14						GAATTTATTTTGGATGACTGC	0.328																																					p.P359P		Atlas-SNP	.											.	GABPB1	33	.	0			c.A1077T						.						87.0	92.0	90.0					15																	50578223		2196	4294	6490	SO:0001627	intron_variant	2553	exon8			TTATTTTGGATGA	D13316	CCDS10135.1, CCDS10136.1, CCDS32239.1, CCDS45258.1	15q21.2	2013-01-10	2008-02-25	2008-02-25	ENSG00000104064	ENSG00000104064		"""Ankyrin repeat domain containing"""	4074	protein-coding gene	gene with protein product		600610	"""GA binding protein transcription factor, beta subunit 2"""	GABPB2		7958862	Standard	NM_016655		Approved	E4TF1-47, GABPB	uc001zyb.3	Q06547	OTTHUMG00000131642	ENST00000220429.8:c.1035+41A>T	chr15.hg19:g.50578223T>A		130.0	0.0		104.0	45.0	NM_002041	A8IE52|Q06545|Q12940|Q12941|Q12942|Q8IYD0	Silent	SNP	ENST00000220429.8	hg19	CCDS32239.1																																																																																			.	.		0.328	GABPB1-005	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000418294.1		
PRTG	283659	hgsc.bcm.edu	37	15	55971629	55971629	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr15:55971629C>A	ENST00000389286.4	-	7	1035	c.988G>T	c.(988-990)Gtt>Ttt	p.V330F	RP11-420M1.2_ENST00000561155.1_RNA	NM_173814.4	NP_776175.2			protogenin											breast(1)|endometrium(6)|kidney(4)|large_intestine(7)|liver(1)|lung(18)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	41				all cancers(107;0.00891)|GBM - Glioblastoma multiforme(80;0.135)		GGCCATTCAACAAATGAAGGA	0.393																																					p.V330F		Atlas-SNP	.											.	PRTG	110	.	0			c.G988T						.						67.0	59.0	61.0					15																	55971629		1817	4079	5896	SO:0001583	missense	283659	exon7			ATTCAACAAATGA	AK098622	CCDS42040.1	15q21.3	2013-02-11	2010-06-24		ENSG00000166450	ENSG00000166450		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	26373	protein-coding gene	gene with protein product	"""immunoglobulin superfamily, DCC subclass, member 5"""	613261	"""protogenin homolog (Gallus gallus)"""				Standard	NM_173814		Approved	FLJ25756, IGDCC5	uc002adg.3	Q2VWP7		ENST00000389286.4:c.988G>T	chr15.hg19:g.55971629C>A	ENSP00000373937:p.Val330Phe	88.0	0.0		104.0	44.0	NM_173814		Missense_Mutation	SNP	ENST00000389286.4	hg19	CCDS42040.1	.	.	.	.	.	.	.	.	.	.	C	20.7	4.032989	0.75504	.	.	ENSG00000166450	ENST00000389286	T	0.28255	1.62	5.72	4.81	0.61882	Immunoglobulin I-set (1);Immunoglobulin-like (1);	0.065857	0.64402	D	0.000010	T	0.51058	0.1652	M	0.77103	2.36	0.80722	D	1	D	0.67145	0.996	D	0.63113	0.911	T	0.54721	-0.8251	10	0.62326	D	0.03	-14.4704	9.8531	0.41068	0.0:0.846:0.0:0.154	.	330	Q2VWP7	PRTG_HUMAN	F	330	ENSP00000373937:V330F	ENSP00000373937:V330F	V	-	1	0	PRTG	53758921	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.747000	0.55134	1.416000	0.47057	0.591000	0.81541	GTT	.	.		0.393	PRTG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419357.1	NM_173814	
CLN6	54982	hgsc.bcm.edu	37	15	68504126	68504126	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr15:68504126T>A	ENST00000249806.5	-	4	530	c.373A>T	c.(373-375)Agc>Tgc	p.S125C	CLN6_ENST00000564752.1_Missense_Mutation_p.S125C|CLN6_ENST00000566347.1_Intron|CLN6_ENST00000565471.1_Intron|RP11-315D16.2_ENST00000562767.1_Intron|CLN6_ENST00000418702.2_Intron|CLN6_ENST00000538696.1_Missense_Mutation_p.S157C	NM_017882.2	NP_060352.1	Q9NWW5	CLN6_HUMAN	ceroid-lipofuscinosis, neuronal 6, late infantile, variant	125					cell death (GO:0008219)|cellular macromolecule catabolic process (GO:0044265)|cholesterol metabolic process (GO:0008203)|ganglioside metabolic process (GO:0001573)|glycosaminoglycan metabolic process (GO:0030203)|locomotion involved in locomotory behavior (GO:0031987)|lysosomal lumen acidification (GO:0007042)|positive regulation of proteolysis (GO:0045862)|protein catabolic process (GO:0030163)|visual perception (GO:0007601)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)	protein homodimerization activity (GO:0042803)			large_intestine(1)|lung(3)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	7						AGGTGGATGCTGGCACCCATG	0.587																																					p.S125C		Atlas-SNP	.											.	CLN6	16	.	0			c.A373T						.						127.0	119.0	121.0					15																	68504126		2200	4298	6498	SO:0001583	missense	54982	exon4			GGATGCTGGCACC	AK000568	CCDS10227.1	15q23	2014-09-17			ENSG00000128973	ENSG00000128973			2077	protein-coding gene	gene with protein product		606725				9097964, 11727201	Standard	NM_017882		Approved	FLJ20561, HsT18960, nclf	uc002arf.3	Q9NWW5	OTTHUMG00000133286	ENST00000249806.5:c.373A>T	chr15.hg19:g.68504126T>A	ENSP00000249806:p.Ser125Cys	105.0	0.0		57.0	30.0	NM_017882	A8K560|B4DDH6|Q6IAB1|Q96SR0	Missense_Mutation	SNP	ENST00000249806.5	hg19	CCDS10227.1	.	.	.	.	.	.	.	.	.	.	T	26.7	4.760773	0.89932	.	.	ENSG00000128973	ENST00000249806;ENST00000538696	D;D	0.96011	-3.88;-3.88	5.14	5.14	0.70334	.	0.000000	0.85682	D	0.000000	D	0.96706	0.8925	L	0.59436	1.845	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.66497	0.939;0.944	D	0.97317	0.9941	10	0.87932	D	0	-40.8627	14.9797	0.71303	0.0:0.0:0.0:1.0	.	157;125	B4DDH6;Q9NWW5	.;CLN6_HUMAN	C	125;157	ENSP00000249806:S125C;ENSP00000445770:S157C	ENSP00000249806:S125C	S	-	1	0	CLN6	66291180	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.576000	0.82467	1.935000	0.56089	0.418000	0.28097	AGC	.	.		0.587	CLN6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257066.1	NM_017882	
ITGA11	22801	hgsc.bcm.edu	37	15	68609680	68609680	+	Nonsense_Mutation	SNP	C	C	A	rs546078018		TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr15:68609680C>A	ENST00000315757.7	-	21	2724	c.2638G>T	c.(2638-2640)Gag>Tag	p.E880*	ITGA11_ENST00000423218.2_Nonsense_Mutation_p.E880*	NM_001004439.1	NP_001004439.1	Q9UKX5	ITA11_HUMAN	integrin, alpha 11	880					cell adhesion (GO:0007155)|cell adhesion mediated by integrin (GO:0033627)|cell-matrix adhesion (GO:0007160)|collagen-activated signaling pathway (GO:0038065)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)|muscle organ development (GO:0007517)|osteoblast differentiation (GO:0001649)|substrate-dependent cell migration (GO:0006929)	focal adhesion (GO:0005925)|integrin alpha11-beta1 complex (GO:0034681)|integrin complex (GO:0008305)|membrane (GO:0016020)|plasma membrane (GO:0005886)	collagen binding (GO:0005518)|collagen binding involved in cell-matrix adhesion (GO:0098639)|collagen receptor activity (GO:0038064)|metal ion binding (GO:0046872)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(7)|kidney(6)|large_intestine(6)|lung(22)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	52						TTCACACACTCAATGCTACCG	0.607																																					p.E880X		Atlas-SNP	.											.	ITGA11	110	.	0			c.G2638T						.						123.0	135.0	131.0					15																	68609680		2083	4207	6290	SO:0001587	stop_gained	22801	exon21			CACACTCAATGCT	AF109681	CCDS45291.1	15q22.3-q23	2010-03-23				ENSG00000137809		"""Integrins"""	6136	protein-coding gene	gene with protein product		604789				10486209	Standard	NM_001004439		Approved	HsT18964	uc002ari.3	Q9UKX5		ENST00000315757.7:c.2638G>T	chr15.hg19:g.68609680C>A	ENSP00000327290:p.Glu880*	130.0	0.0		101.0	39.0	NM_001004439	J3KQM2|Q8WYI8|Q9UKQ1	Nonsense_Mutation	SNP	ENST00000315757.7	hg19	CCDS45291.1	.	.	.	.	.	.	.	.	.	.	C	37	6.039429	0.97226	.	.	ENSG00000137809	ENST00000315757;ENST00000423218;ENST00000535491	.	.	.	4.79	4.79	0.61399	.	0.152015	0.64402	D	0.000018	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.30854	T	0.27	.	16.8386	0.85962	0.0:1.0:0.0:0.0	.	.	.	.	X	880;880;515	.	ENSP00000327290:E880X	E	-	1	0	ITGA11	66396734	1.000000	0.71417	1.000000	0.80357	0.021000	0.10359	6.039000	0.70972	2.214000	0.71695	0.561000	0.74099	GAG	.	.		0.607	ITGA11-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		NM_012211	
NEO1	4756	hgsc.bcm.edu	37	15	73564819	73564819	+	Missense_Mutation	SNP	G	G	C			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr15:73564819G>C	ENST00000339362.5	+	20	3328	c.2881G>C	c.(2881-2883)Gtg>Ctg	p.V961L	NEO1_ENST00000558964.1_Missense_Mutation_p.V961L|NEO1_ENST00000560262.1_Missense_Mutation_p.V961L|NEO1_ENST00000261908.6_Missense_Mutation_p.V961L			Q92859	NEO1_HUMAN	neogenin 1	961	Fibronectin type-III 6. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|iron ion homeostasis (GO:0055072)|muscle cell differentiation (GO:0042692)|myoblast fusion (GO:0007520)|positive regulation of muscle cell differentiation (GO:0051149)|regulation of transcription, DNA-templated (GO:0006355)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			NS(1)|breast(2)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(3)|large_intestine(9)|lung(26)|pancreas(2)|prostate(1)|skin(3)|urinary_tract(2)	57						ACCCAAGGATGTGACTGTTGT	0.373																																					p.V961L		Atlas-SNP	.											.	NEO1	102	.	0			c.G2881C						.						91.0	86.0	88.0					15																	73564819		2198	4297	6495	SO:0001583	missense	4756	exon19			AAGGATGTGACTG	U61262	CCDS10247.1, CCDS53957.1, CCDS58378.1	15q22.3-q23	2014-06-20	2010-06-24		ENSG00000067141	ENSG00000067141		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	7754	protein-coding gene	gene with protein product	"""immunoglobulin superfamily, DCC subclass, member 2"""	601907	"""neogenin (chicken) homolog 1"""			9121761	Standard	NM_002499		Approved	NGN, HsT17534, IGDCC2, NTN1R2	uc002avm.4	Q92859	OTTHUMG00000133509	ENST00000339362.5:c.2881G>C	chr15.hg19:g.73564819G>C	ENSP00000341198:p.Val961Leu	123.0	0.0		91.0	35.0	NM_001172623	B7ZKM9|B7ZKN0|O00340|Q17RX1	Missense_Mutation	SNP	ENST00000339362.5	hg19	CCDS10247.1	.	.	.	.	.	.	.	.	.	.	G	9.741	1.164897	0.21538	.	.	ENSG00000067141	ENST00000339362;ENST00000379842;ENST00000261908	T;T	0.50548	0.74;0.74	6.02	6.02	0.97574	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.18676	0.0448	N	0.01410	-0.885	0.80722	D	1	P;B;B;B	0.37015	0.578;0.043;0.087;0.087	B;B;B;B	0.29598	0.104;0.018;0.06;0.06	T	0.40683	-0.9550	10	0.02654	T	1	-14.7626	20.5407	0.99260	0.0:0.0:1.0:0.0	.	961;961;683;961	B7ZKM9;B7ZKN0;E7EUX3;Q92859	.;.;.;NEO1_HUMAN	L	961;683;961	ENSP00000341198:V961L;ENSP00000261908:V961L	ENSP00000261908:V961L	V	+	1	0	NEO1	71351872	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.876000	0.87215	2.865000	0.98341	0.655000	0.94253	GTG	.	.		0.373	NEO1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257472.2	NM_002499	
ISLR2	57611	hgsc.bcm.edu	37	15	74426996	74426996	+	Missense_Mutation	SNP	C	C	G			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr15:74426996C>G	ENST00000361742.3	+	4	2670	c.1901C>G	c.(1900-1902)cCt>cGt	p.P634R	ISLR2_ENST00000435464.1_Missense_Mutation_p.P634R|ISLR2_ENST00000565159.1_Missense_Mutation_p.P634R|ISLR2_ENST00000453268.2_Missense_Mutation_p.P634R|ISLR2_ENST00000419208.1_Missense_Mutation_p.P634R|ISLR2_ENST00000561975.1_Intron|ISLR2_ENST00000445793.1_Missense_Mutation_p.P634R|ISLR2_ENST00000565540.1_Missense_Mutation_p.P634R	NM_001130136.1|NM_020851.2	NP_001123608.1|NP_065902.1	Q6UXK2	ISLR2_HUMAN	immunoglobulin superfamily containing leucine-rich repeat 2	634					positive regulation of axon extension (GO:0045773)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(3)|endometrium(6)|large_intestine(7)|lung(17)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	36						CCTCAGGCCCCTGACCCTATG	0.682											OREG0023277	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.P634R		Atlas-SNP	.											.	ISLR2	78	.	0			c.C1901G						.						35.0	35.0	35.0					15																	74426996		2198	4297	6495	SO:0001583	missense	57611	exon4			AGGCCCCTGACCC		CCDS10259.1	15q24.1	2013-01-11			ENSG00000167178	ENSG00000167178		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	29286	protein-coding gene	gene with protein product		614179				10819331, 12975309	Standard	NM_001130136		Approved	KIAA1465	uc010bjf.3	Q6UXK2	OTTHUMG00000137624	ENST00000361742.3:c.1901C>G	chr15.hg19:g.74426996C>G	ENSP00000355402:p.Pro634Arg	112.0	0.0	1152	89.0	40.0	NM_001130138	A8K352|Q9P263	Missense_Mutation	SNP	ENST00000361742.3	hg19	CCDS10259.1	.	.	.	.	.	.	.	.	.	.	C	12.73	2.026369	0.35701	.	.	ENSG00000167178	ENST00000445793;ENST00000361742;ENST00000435464;ENST00000453268;ENST00000395121;ENST00000419208	T;T;T;T;T	0.58210	0.35;0.35;0.35;0.35;0.35	4.84	3.92	0.45320	.	0.132655	0.51477	D	0.000094	T	0.38904	0.1058	L	0.29908	0.895	0.48696	D	0.99969	B	0.34103	0.437	B	0.29267	0.1	T	0.37478	-0.9704	10	0.87932	D	0	.	12.1086	0.53825	0.0:0.9126:0.0:0.0874	.	634	Q6UXK2	ISLR2_HUMAN	R	634;634;634;634;223;634	ENSP00000403244:P634R;ENSP00000355402:P634R;ENSP00000411443:P634R;ENSP00000411834:P634R;ENSP00000408872:P634R	ENSP00000355402:P634R	P	+	2	0	ISLR2	72214049	0.998000	0.40836	0.950000	0.38849	0.850000	0.48378	3.993000	0.56987	1.024000	0.39682	0.313000	0.20887	CCT	.	.		0.682	ISLR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269046.1	NM_020851	
PSMA4	5685	hgsc.bcm.edu	37	15	78837269	78837269	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr15:78837269G>A	ENST00000044462.7	+	6	496	c.346G>A	c.(346-348)Gat>Aat	p.D116N	PSMA4_ENST00000413382.2_Missense_Mutation_p.D45N|PSMA4_ENST00000557929.1_3'UTR|PSMA4_ENST00000559082.1_Missense_Mutation_p.D116N|PSMA4_ENST00000558341.1_Intron|PSMA4_ENST00000558281.1_Missense_Mutation_p.D116N|PSMA4_ENST00000560217.1_Missense_Mutation_p.D85N|PSMA4_ENST00000558094.1_Missense_Mutation_p.D28N	NM_002789.4	NP_002780.1	P25789	PSA4_HUMAN	proteasome (prosome, macropain) subunit, alpha type, 4	116					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome complex (GO:0000502)|proteasome core complex (GO:0005839)|proteasome core complex, alpha-subunit complex (GO:0019773)	threonine-type endopeptidase activity (GO:0004298)			kidney(2)|large_intestine(2)|lung(2)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	9						AGCGCTGTGTGATATCAAACA	0.323																																					p.D116N		Atlas-SNP	.											.	PSMA4	17	.	0			c.G346A						.						96.0	92.0	93.0					15																	78837269		2196	4293	6489	SO:0001583	missense	5685	exon6			CTGTGTGATATCA	BC005361	CCDS10303.1, CCDS45319.1	15q24.1	2004-01-19			ENSG00000041357	ENSG00000041357		"""Proteasome (prosome, macropain) subunits"""	9533	protein-coding gene	gene with protein product		176846				2025653	Standard	NM_002789		Approved	HC9, HsT17706	uc010blf.3	P25789	OTTHUMG00000143859	ENST00000044462.7:c.346G>A	chr15.hg19:g.78837269G>A	ENSP00000044462:p.Asp116Asn	129.0	0.0		99.0	39.0	NM_001102667	D3DW86|Q53XP2|Q567Q5|Q8TBD1	Missense_Mutation	SNP	ENST00000044462.7	hg19	CCDS10303.1	.	.	.	.	.	.	.	.	.	.	G	22.5	4.302273	0.81136	.	.	ENSG00000041357	ENST00000413382;ENST00000044462	T;T	0.22743	1.94;1.94	5.81	5.81	0.92471	.	0.000000	0.85682	D	0.000000	T	0.34193	0.0889	L	0.53617	1.68	0.80722	D	1	B	0.33748	0.423	B	0.43889	0.435	T	0.02015	-1.1229	10	0.44086	T	0.13	-37.7379	20.0825	0.97783	0.0:0.0:1.0:0.0	.	116	P25789	PSA4_HUMAN	N	45;116	ENSP00000402118:D45N;ENSP00000044462:D116N	ENSP00000044462:D116N	D	+	1	0	PSMA4	76624324	1.000000	0.71417	1.000000	0.80357	0.643000	0.38383	9.586000	0.98226	2.746000	0.94184	0.655000	0.94253	GAT	.	.		0.323	PSMA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000290107.5	NM_002789	
ADAMTS7	11173	hgsc.bcm.edu	37	15	79080627	79080627	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr15:79080627G>A	ENST00000388820.4	-	8	1478	c.1268C>T	c.(1267-1269)gCc>gTc	p.A423V	ADAMTS7_ENST00000566303.1_5'UTR	NM_014272.3	NP_055087.2	Q9UKP4	ATS7_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 7	423	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.				cellular response to BMP stimulus (GO:0071773)|cellular response to interleukin-1 (GO:0071347)|cellular response to tumor necrosis factor (GO:0071356)|negative regulation of chondrocyte differentiation (GO:0032331)|proteolysis involved in cellular protein catabolic process (GO:0051603)	cell surface (GO:0009986)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(2)|lung(23)|ovary(1)|prostate(8)|skin(9)	54						GAGGGGAGCGGCGTCGTACAG	0.572																																					p.A423V		Atlas-SNP	.											ADAMTS7,neck,malignant_melanoma,0,1	ADAMTS7	142	.	0			c.C1268T						.						130.0	114.0	119.0					15																	79080627		2196	4293	6489	SO:0001583	missense	11173	exon8			GGAGCGGCGTCGT	AF140675	CCDS32303.1	15q25.1	2012-05-16	2005-08-19		ENSG00000136378	ENSG00000136378		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	223	protein-coding gene	gene with protein product	"""COMPase"", ""a disintegrin and metalloprotease with thrombospondin motifs-7 preproprotein"""	605009	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 7"""			10464288	Standard	NM_014272		Approved	ADAM-TS7, DKFZp434H204	uc002bej.4	Q9UKP4	OTTHUMG00000172907	ENST00000388820.4:c.1268C>T	chr15.hg19:g.79080627G>A	ENSP00000373472:p.Ala423Val	121.0	1.0		84.0	41.0	NM_014272	Q14F51|Q6P7J9	Missense_Mutation	SNP	ENST00000388820.4	hg19	CCDS32303.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	17.93|17.93	3.508621|3.508621	0.64410|0.64410	.|.	.|.	ENSG00000136378|ENSG00000136378	ENST00000388820|ENST00000456326	T|.	0.03635|.	3.86|.	5.37|5.37	4.44|4.44	0.53790|0.53790	Metallopeptidase, catalytic domain (1);Peptidase M12B, ADAM/reprolysin (2);|.	0.273612|.	0.33916|.	N|.	0.004437|.	T|T	0.31544|0.31544	0.0800|0.0800	L|L	0.27053|0.27053	0.805|0.805	0.26492|0.26492	N|N	0.974925|0.974925	B;B|B	0.32467|0.24258	0.372;0.367|0.1	B;B|B	0.39771|0.18561	0.309;0.253|0.022	T|T	0.15093|0.15093	-1.0449|-1.0449	10|8	0.42905|0.35671	T|T	0.14|0.21	.|.	13.4868|13.4868	0.61371|0.61371	0.0:0.1645:0.8355:0.0|0.0:0.1645:0.8355:0.0	.|.	423;423|398	A8MQ00;Q9UKP4|E7EP58	.;ATS7_HUMAN|.	V|S	423|398	ENSP00000373472:A423V|.	ENSP00000373472:A423V|ENSP00000396177:P398S	A|P	-|-	2|1	0|0	ADAMTS7|ADAMTS7	76867682|76867682	1.000000|1.000000	0.71417|0.71417	0.060000|0.060000	0.19600|0.19600	0.903000|0.903000	0.53119|0.53119	4.457000|4.457000	0.60088|0.60088	1.238000|1.238000	0.43771|0.43771	0.491000|0.491000	0.48974|0.48974	GCC|CCG	.	.		0.572	ADAMTS7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000421331.1	NM_014272	
NTRK3	4916	hgsc.bcm.edu	37	15	88472454	88472454	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr15:88472454A>T	ENST00000360948.2	-	16	2262	c.2101T>A	c.(2101-2103)Tcc>Acc	p.S701T	NTRK3_ENST00000355254.2_Missense_Mutation_p.S701T|NTRK3_ENST00000557856.1_Missense_Mutation_p.S693T|NTRK3_ENST00000357724.2_Missense_Mutation_p.S693T|NTRK3_ENST00000542733.2_Missense_Mutation_p.S603T|NTRK3_ENST00000394480.2_Missense_Mutation_p.S701T|NTRK3_ENST00000558676.1_Missense_Mutation_p.S693T	NM_001012338.2	NP_001012338.1	Q16288	NTRK3_HUMAN	neurotrophic tyrosine kinase, receptor, type 3	701	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPK activity (GO:0000187)|activation of protein kinase B activity (GO:0032148)|activation of Ras GTPase activity (GO:0032856)|cellular response to retinoic acid (GO:0071300)|circadian rhythm (GO:0007623)|cochlea development (GO:0090102)|lens fiber cell differentiation (GO:0070306)|mechanoreceptor differentiation (GO:0042490)|modulation by virus of host transcription (GO:0019056)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of cell death (GO:0060548)|negative regulation of protein phosphorylation (GO:0001933)|neuron fate specification (GO:0048665)|neuron migration (GO:0001764)|neurotrophin signaling pathway (GO:0038179)|positive regulation of actin cytoskeleton reorganization (GO:2000251)|positive regulation of axon extension involved in regeneration (GO:0048691)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of positive chemotaxis (GO:0050927)|protein autophosphorylation (GO:0046777)|response to axon injury (GO:0048678)|response to corticosterone (GO:0051412)|response to ethanol (GO:0045471)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|neurotrophin binding (GO:0043121)|neurotrophin receptor activity (GO:0005030)|p53 binding (GO:0002039)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)		ETV6/NTRK3(238)	breast(3)|central_nervous_system(3)|endometrium(6)|kidney(1)|large_intestine(22)|lung(63)|ovary(6)|pancreas(3)|prostate(1)|skin(4)|stomach(5)|upper_aerodigestive_tract(2)	119			BRCA - Breast invasive adenocarcinoma(143;0.211)			ACATCTCTGGACATGCCGAAG	0.532			T	ETV6	"""congenital fibrosarcoma, Secretory breast """					TSP Lung(13;0.10)																											p.S701T		Atlas-SNP	.		Dom	yes		15	15q25	4916	"""neurotrophic tyrosine kinase, receptor, type 3"""		"""E, M"""	.	NTRK3	587	.	0			c.T2101A						.						112.0	104.0	107.0					15																	88472454		2201	4299	6500	SO:0001583	missense	4916	exon17			CTCTGGACATGCC	U05012	CCDS10340.1, CCDS32322.1, CCDS32323.1, CCDS58399.1	15q24-q25	2013-01-11			ENSG00000140538	ENSG00000140538	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"""	8033	protein-coding gene	gene with protein product		191316				7806211	Standard	NM_001012338		Approved	TRKC	uc002bme.2	Q16288	OTTHUMG00000148677	ENST00000360948.2:c.2101T>A	chr15.hg19:g.88472454A>T	ENSP00000354207:p.Ser701Thr	197.0	0.0		162.0	70.0	NM_001012338	B7Z4C5|E9PG56|H0YND1|O75682|Q12827|Q16289	Missense_Mutation	SNP	ENST00000360948.2	hg19	CCDS32322.1	.	.	.	.	.	.	.	.	.	.	A	26.7	4.758218	0.89843	.	.	ENSG00000140538	ENST00000394480;ENST00000360948;ENST00000357724;ENST00000355254;ENST00000542733	D;D;D;D;D	0.90563	-2.69;-2.69;-2.69;-2.69;-2.69	5.16	5.16	0.70880	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.93475	0.7918	L	0.52266	1.64	0.80722	D	1	D;D;D;D;D	0.89917	0.999;0.992;1.0;0.99;1.0	D;D;D;D;D	0.85130	0.995;0.987;0.997;0.979;0.997	D	0.94155	0.7409	10	0.87932	D	0	.	14.1992	0.65690	1.0:0.0:0.0:0.0	.	603;693;693;701;701	B7Z7U4;E9PG56;B7Z4C5;Q16288-3;Q16288	.;.;.;.;NTRK3_HUMAN	T	701;701;693;701;603	ENSP00000377990:S701T;ENSP00000354207:S701T;ENSP00000350356:S693T;ENSP00000347397:S701T;ENSP00000437773:S603T	ENSP00000347397:S701T	S	-	1	0	NTRK3	86273458	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.118000	0.94355	1.952000	0.56665	0.533000	0.62120	TCC	.	.		0.532	NTRK3-204	KNOWN	basic|CCDS	protein_coding	protein_coding			
WDR93	56964	hgsc.bcm.edu	37	15	90272996	90272996	+	Silent	SNP	A	A	G			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr15:90272996A>G	ENST00000268130.7	+	11	1307	c.1206A>G	c.(1204-1206)aaA>aaG	p.K402K	WDR93_ENST00000560294.1_Silent_p.K402K|WDR93_ENST00000444934.2_Silent_p.K119K	NM_020212.1	NP_064597.1	Q6P2C0	WDR93_HUMAN	WD repeat domain 93	402					electron transport chain (GO:0022900)		oxidoreductase activity, acting on NAD(P)H (GO:0016651)			NS(1)|breast(3)|endometrium(2)|kidney(4)|large_intestine(5)|liver(2)|lung(8)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	33	Lung NSC(78;0.0237)|all_lung(78;0.0478)		KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)|BRCA - Breast invasive adenocarcinoma(143;0.128)			TAAAGGATAAAGCTGGTACTT	0.493																																					p.K402K		Atlas-SNP	.											.	WDR93	63	.	0			c.A1206G						.						74.0	66.0	69.0					15																	90272996		2200	4299	6499	SO:0001819	synonymous_variant	56964	exon11			GGATAAAGCTGGT		CCDS32326.1, CCDS66862.1, CCDS73779.1	15q26.1	2012-11-02						"""WD repeat domain containing"""	26924	protein-coding gene	gene with protein product							Standard	NM_020212		Approved		uc002boj.3	Q6P2C0		ENST00000268130.7:c.1206A>G	chr15.hg19:g.90272996A>G		135.0	0.0		93.0	5.0	NM_020212	Q8N7Y8|Q9NP89	Silent	SNP	ENST00000268130.7	hg19	CCDS32326.1																																																																																			.	.		0.493	WDR93-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000416369.1	NM_020212	
FURIN	5045	hgsc.bcm.edu	37	15	91423153	91423153	+	Nonsense_Mutation	SNP	C	C	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr15:91423153C>T	ENST00000268171.3	+	12	1594	c.1315C>T	c.(1315-1317)Cag>Tag	p.Q439*		NM_002569.2	NP_002560.1	P09958	FURIN_HUMAN	furin (paired basic amino acid cleaving enzyme)	439					cell proliferation (GO:0008283)|cellular protein metabolic process (GO:0044267)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of low-density lipoprotein particle receptor catabolic process (GO:0032804)|negative regulation of transforming growth factor beta1 production (GO:0032911)|nerve growth factor processing (GO:0032455)|nerve growth factor production (GO:0032902)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|peptide biosynthetic process (GO:0043043)|peptide hormone processing (GO:0016486)|peptidyl-glutamic acid carboxylation (GO:0017187)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)|post-translational protein modification (GO:0043687)|protein processing (GO:0016485)|proteolysis (GO:0006508)|regulation of endopeptidase activity (GO:0052548)|regulation of protein catabolic process (GO:0042176)|secretion by cell (GO:0032940)|signal peptide processing (GO:0006465)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral protein processing (GO:0019082)|virion assembly (GO:0019068)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)|trans-Golgi network transport vesicle (GO:0030140)	endopeptidase activity (GO:0004175)|metal ion binding (GO:0046872)|nerve growth factor binding (GO:0048406)|peptidase activity (GO:0008233)|peptide binding (GO:0042277)|protease binding (GO:0002020)|serine-type endopeptidase activity (GO:0004252)|serine-type endopeptidase inhibitor activity (GO:0004867)			breast(1)|central_nervous_system(4)|endometrium(4)|large_intestine(3)|liver(2)|lung(13)|ovary(2)|prostate(3)|skin(1)|urinary_tract(3)	36	Lung NSC(78;0.0771)|all_lung(78;0.137)		Lung(145;0.189)			GGCCCTGGCCCAGAATTGGAC	0.642																																					p.Q439X		Atlas-SNP	.											.	FURIN	85	.	0			c.C1315T						.						33.0	36.0	35.0					15																	91423153		2198	4298	6496	SO:0001587	stop_gained	5045	exon12			CTGGCCCAGAATT	X17094	CCDS10364.1	15q26.1	2007-01-24	2002-12-04	2002-12-06	ENSG00000140564	ENSG00000140564			8568	protein-coding gene	gene with protein product		136950	"""paired basic amino acid cleaving enzyme (furin, membrane associated receptor protein)"""	PCSK3, FUR, PACE		2251280, 1741956	Standard	NM_002569		Approved	SPC1	uc002bpu.1	P09958	OTTHUMG00000149831	ENST00000268171.3:c.1315C>T	chr15.hg19:g.91423153C>T	ENSP00000268171:p.Gln439*	174.0	0.0		122.0	56.0	NM_002569	Q14336|Q6LBS3|Q9UCZ5	Nonsense_Mutation	SNP	ENST00000268171.3	hg19	CCDS10364.1	.	.	.	.	.	.	.	.	.	.	C	16.42	3.117177	0.56505	.	.	ENSG00000140564	ENST00000268171	.	.	.	4.65	3.68	0.42216	.	0.270928	0.40064	N	0.001185	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.09590	T	0.72	-11.2263	13.4155	0.60966	0.3159:0.6841:0.0:0.0	.	.	.	.	X	439	.	ENSP00000268171:Q439X	Q	+	1	0	FURIN	89224157	1.000000	0.71417	1.000000	0.80357	0.734000	0.41952	1.703000	0.37846	2.410000	0.81850	0.485000	0.47835	CAG	.	.		0.642	FURIN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313492.1	NM_002569	
LRRK1	79705	hgsc.bcm.edu	37	15	101523888	101523888	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr15:101523888G>T	ENST00000388948.3	+	4	776	c.417G>T	c.(415-417)ttG>ttT	p.L139F	LRRK1_ENST00000532029.2_Missense_Mutation_p.L139F|LRRK1_ENST00000284395.5_Missense_Mutation_p.L112F	NM_024652.3	NP_078928.3			leucine-rich repeat kinase 1											breast(2)|central_nervous_system(6)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(14)|lung(25)|ovary(4)|prostate(1)|skin(1)	72	Melanoma(26;0.00505)|Lung NSC(78;0.00793)|all_lung(78;0.0094)		OV - Ovarian serous cystadenocarcinoma(32;0.000932)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)			TGCAGGAATTGCTTGAGTCCT	0.532																																					p.L139F		Atlas-SNP	.											.	LRRK1	310	.	0			c.G417T						.						88.0	88.0	88.0					15																	101523888		2043	4179	6222	SO:0001583	missense	79705	exon4			GGAATTGCTTGAG	AB058693	CCDS42086.1	15q26.3	2007-01-29			ENSG00000154237	ENSG00000154237			18608	protein-coding gene	gene with protein product		610986				11347906, 14654223	Standard	XM_005254979		Approved	FLJ23119, KIAA1790, Roco1, RIPK6	uc002bwr.3	Q38SD2	OTTHUMG00000165514	ENST00000388948.3:c.417G>T	chr15.hg19:g.101523888G>T	ENSP00000373600:p.Leu139Phe	89.0	0.0		65.0	24.0	NM_024652		Missense_Mutation	SNP	ENST00000388948.3	hg19	CCDS42086.1	.	.	.	.	.	.	.	.	.	.	G	16.35	3.099661	0.56183	.	.	ENSG00000154237	ENST00000388948;ENST00000284395;ENST00000532029	D;T;D	0.84070	-1.8;-0.88;-1.8	5.71	-3.15	0.05233	Ankyrin repeat-containing domain (4);	0.000000	0.64402	D	0.000017	D	0.88890	0.6560	M	0.86651	2.83	0.34026	D	0.653296	D;D	0.89917	0.995;1.0	D;D	0.91635	0.982;0.999	D	0.87677	0.2545	10	0.72032	D	0.01	.	7.9177	0.29827	0.4544:0.0:0.4448:0.1008	.	139;139	Q38SD2;Q38SD2-2	LRRK1_HUMAN;.	F	139;112;139	ENSP00000373600:L139F;ENSP00000284395:L112F;ENSP00000433268:L139F	ENSP00000284395:L112F	L	+	3	2	LRRK1	99341411	0.970000	0.33590	0.025000	0.17156	0.625000	0.37756	0.047000	0.14056	-0.435000	0.07264	0.591000	0.81541	TTG	.	.		0.532	LRRK1-003	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384567.2	NM_024652	
LRRK1	79705	hgsc.bcm.edu	37	15	101595197	101595197	+	Silent	SNP	C	C	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr15:101595197C>A	ENST00000388948.3	+	27	4460	c.4101C>A	c.(4099-4101)gcC>gcA	p.A1367A	RP11-505E24.2_ENST00000559857.1_RNA|LRRK1_ENST00000284395.5_Silent_p.A1364A	NM_024652.3	NP_078928.3			leucine-rich repeat kinase 1											breast(2)|central_nervous_system(6)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(14)|lung(25)|ovary(4)|prostate(1)|skin(1)	72	Melanoma(26;0.00505)|Lung NSC(78;0.00793)|all_lung(78;0.0094)		OV - Ovarian serous cystadenocarcinoma(32;0.000932)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)			AAAAAATAGCCTACCAGATCG	0.433																																					p.A1367A		Atlas-SNP	.											.	LRRK1	310	.	0			c.C4101A						.						120.0	116.0	117.0					15																	101595197		1947	4126	6073	SO:0001819	synonymous_variant	79705	exon27			AATAGCCTACCAG	AB058693	CCDS42086.1	15q26.3	2007-01-29			ENSG00000154237	ENSG00000154237			18608	protein-coding gene	gene with protein product		610986				11347906, 14654223	Standard	XM_005254979		Approved	FLJ23119, KIAA1790, Roco1, RIPK6	uc002bwr.3	Q38SD2	OTTHUMG00000165514	ENST00000388948.3:c.4101C>A	chr15.hg19:g.101595197C>A		156.0	0.0		125.0	57.0	NM_024652		Silent	SNP	ENST00000388948.3	hg19	CCDS42086.1																																																																																			.	.		0.433	LRRK1-003	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384567.2	NM_024652	
CCNF	899	hgsc.bcm.edu	37	16	2499281	2499281	+	Splice_Site	SNP	A	A	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr16:2499281A>T	ENST00000397066.4	+	12	1306		c.e12-1			NM_001761.2	NP_001752.2	P41002	CCNF_HUMAN	cyclin F						mitotic nuclear division (GO:0007067)|negative regulation of centrosome duplication (GO:0010826)|placenta development (GO:0001890)|protein ubiquitination (GO:0016567)|re-entry into mitotic cell cycle (GO:0000320)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)	centriole (GO:0005814)|nucleus (GO:0005634)|SCF ubiquitin ligase complex (GO:0019005)				breast(3)|central_nervous_system(1)|kidney(4)|large_intestine(2)|lung(5)|prostate(4)|skin(1)	20		Ovarian(90;0.17)				CCGGCTGTCTAGGTCCCCACT	0.652																																					.		Atlas-SNP	.											.	CCNF	110	.	0			c.1219-2A>T						.						54.0	56.0	55.0					16																	2499281		2198	4300	6498	SO:0001630	splice_region_variant	899	exon12			CTGTCTAGGTCCC	Z36714	CCDS10467.1	16p13.3	2008-02-05			ENSG00000162063	ENSG00000162063		"""F-boxes /  ""other"""""	1591	protein-coding gene	gene with protein product		600227				7896286	Standard	NM_001761		Approved	FBX1, FBXO1	uc002cqd.1	P41002	OTTHUMG00000128858	ENST00000397066.4:c.1219-1A>T	chr16.hg19:g.2499281A>T		82.0	0.0		60.0	25.0	NM_001761	B2R8H3|Q96EG9	Splice_Site	SNP	ENST00000397066.4	hg19	CCDS10467.1	.	.	.	.	.	.	.	.	.	.	A	16.85	3.236391	0.58886	.	.	ENSG00000162063	ENST00000397066;ENST00000293968	.	.	.	5.43	5.43	0.79202	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.312	0.66422	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	CCNF	2439282	1.000000	0.71417	0.906000	0.35671	0.602000	0.36980	8.232000	0.89796	2.057000	0.61298	0.460000	0.39030	.	.	.		0.652	CCNF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250801.1	NM_001761	Intron
C16orf96	342346	hgsc.bcm.edu	37	16	4625242	4625242	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr16:4625242A>T	ENST00000444310.4	+	5	761	c.761A>T	c.(760-762)cAg>cTg	p.Q254L		NM_001145011.1	NP_001138483.1			chromosome 16 open reading frame 96											NS(1)|breast(1)|endometrium(6)|kidney(1)|skin(3)	12						GCCCTGGCCCAGACCACCAAG	0.597																																					p.Q254L		Atlas-SNP	.											.	C16orf96	28	.	0			c.A761T						.						31.0	32.0	32.0					16																	4625242		692	1591	2283	SO:0001583	missense	342346	exon5			TGGCCCAGACCAC		CCDS53986.1	16p13.3	2012-10-10			ENSG00000205832	ENSG00000205832			40031	protein-coding gene	gene with protein product							Standard	NM_001145011		Approved		uc010uxn.2	A6NNT2	OTTHUMG00000176519	ENST00000444310.4:c.761A>T	chr16.hg19:g.4625242A>T	ENSP00000415027:p.Gln254Leu	31.0	0.0		26.0	6.0	NM_001145011		Missense_Mutation	SNP	ENST00000444310.4	hg19	CCDS53986.1	.	.	.	.	.	.	.	.	.	.	A	14.09	2.430408	0.43122	.	.	ENSG00000205832	ENST00000444310	.	.	.	3.63	3.63	0.41609	.	.	.	.	.	T	0.40040	0.1101	L	0.27053	0.805	0.26642	N	0.972268	D	0.65815	0.995	P	0.61003	0.882	T	0.11084	-1.0602	8	0.45353	T	0.12	.	8.9501	0.35783	1.0:0.0:0.0:0.0	.	254	A6NNT2	CP096_HUMAN	L	254	.	ENSP00000415027:Q254L	Q	+	2	0	C16orf96	4565243	0.242000	0.23868	0.433000	0.26760	0.022000	0.10575	1.220000	0.32491	1.887000	0.54652	0.379000	0.24179	CAG	.	.		0.597	C16orf96-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000432384.1	NM_001145011	
USP7	7874	hgsc.bcm.edu	37	16	8988707	8988707	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr16:8988707C>A	ENST00000344836.4	-	29	3243	c.3045G>T	c.(3043-3045)gaG>gaT	p.E1015D	USP7_ENST00000535863.1_Missense_Mutation_p.E916D|USP7_ENST00000381886.4_Missense_Mutation_p.E999D	NM_003470.2	NP_003461.2	Q93009	UBP7_HUMAN	ubiquitin specific peptidase 7 (herpes virus-associated)	1015					maintenance of DNA methylation (GO:0010216)|multicellular organismal development (GO:0007275)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|protein deubiquitination (GO:0016579)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|transcription-coupled nucleotide-excision repair (GO:0006283)|ubiquitin-dependent protein catabolic process (GO:0006511)|viral process (GO:0016032)	cytosol (GO:0005829)|nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|p53 binding (GO:0002039)|protein C-terminus binding (GO:0008022)|transcription factor binding (GO:0008134)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(13)|lung(20)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)	48						CTCGAAAATGCTCGCCCTAGA	0.597																																					p.E1015D		Atlas-SNP	.											.	USP7	116	.	0			c.G3045T						.						95.0	90.0	92.0					16																	8988707		2197	4300	6497	SO:0001583	missense	7874	exon29			AAAATGCTCGCCC	Z72499	CCDS32385.1, CCDS66941.1	16p13.3	2008-04-11	2005-08-08			ENSG00000187555		"""Ubiquitin-specific peptidases"""	12630	protein-coding gene	gene with protein product		602519	"""ubiquitin specific protease 7 (herpes virus-associated)"""	HAUSP		12838346, 9925944	Standard	NM_003470		Approved		uc002czl.2	Q93009		ENST00000344836.4:c.3045G>T	chr16.hg19:g.8988707C>A	ENSP00000343535:p.Glu1015Asp	104.0	0.0		88.0	33.0	NM_003470	A6NMY8|B7Z815|H0Y3G8	Missense_Mutation	SNP	ENST00000344836.4	hg19	CCDS32385.1	.	.	.	.	.	.	.	.	.	.	C	15.56	2.869092	0.51588	.	.	ENSG00000187555	ENST00000344836;ENST00000381886;ENST00000535863	T;T	0.20200	2.09;2.17	5.35	1.86	0.25419	.	0.052181	0.85682	D	0.000000	T	0.23451	0.0567	M	0.84156	2.68	0.58432	D	0.999999	P;P	0.46064	0.872;0.872	B;B	0.39185	0.293;0.293	T	0.05632	-1.0873	10	0.52906	T	0.07	.	6.9685	0.24637	0.0:0.5238:0.0:0.4762	.	1015;999	Q93009;B7Z815	UBP7_HUMAN;.	D	1015;1023;916	ENSP00000343535:E1015D;ENSP00000443646:E916D	ENSP00000343535:E1015D	E	-	3	2	USP7	8896208	1.000000	0.71417	1.000000	0.80357	0.852000	0.48524	1.413000	0.34725	0.647000	0.30713	0.305000	0.20034	GAG	.	.		0.597	USP7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000434268.2		
ERCC4	2072	hgsc.bcm.edu	37	16	14020498	14020498	+	Nonsense_Mutation	SNP	A	A	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr16:14020498A>T	ENST00000311895.7	+	3	478	c.469A>T	c.(469-471)Aaa>Taa	p.K157*	ERCC4_ENST00000575156.1_Nonsense_Mutation_p.K157*	NM_005236.2	NP_005227.1	Q92889	XPF_HUMAN	excision repair cross-complementation group 4	157	Helicase-like.				DNA catabolic process, endonucleolytic (GO:0000737)|DNA repair (GO:0006281)|double-strand break repair via homologous recombination (GO:0000724)|negative regulation of telomere maintenance (GO:0032205)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair involved in interstrand cross-link repair (GO:1901255)|nucleotide-excision repair, DNA damage removal (GO:0000718)|nucleotide-excision repair, DNA incision (GO:0033683)|nucleotide-excision repair, DNA incision, 3'-to lesion (GO:0006295)|nucleotide-excision repair, DNA incision, 5'-to lesion (GO:0006296)|resolution of meiotic recombination intermediates (GO:0000712)|response to UV (GO:0009411)|telomere maintenance (GO:0000723)|telomere maintenance via telomere shortening (GO:0010834)|transcription-coupled nucleotide-excision repair (GO:0006283)|UV protection (GO:0009650)	chromosome, telomeric region (GO:0000781)|nuclear chromosome, telomeric region (GO:0000784)|nucleoplasm (GO:0005654)|nucleotide-excision repair complex (GO:0000109)|nucleotide-excision repair factor 1 complex (GO:0000110)|nucleus (GO:0005634)|transcription factor TFIID complex (GO:0005669)	damaged DNA binding (GO:0003684)|endodeoxyribonuclease activity (GO:0004520)|protein C-terminus binding (GO:0008022)|protein N-terminus binding (GO:0047485)|single-stranded DNA binding (GO:0003697)|single-stranded DNA endodeoxyribonuclease activity (GO:0000014)			NS(1)|breast(1)|endometrium(7)|kidney(3)|large_intestine(5)|lung(12)|ovary(4)|pancreas(1)|prostate(1)|skin(3)	38						CCAGAAAAACAAACGTGGTTT	0.403			"""Mis, N, F"""			"""skin basal cell, skin squamous cell, melanoma"""		Nucleotide excision repair (NER)	Xeroderma Pigmentosum																												p.K157X		Atlas-SNP	.	yes	Rec		Xeroderma pigmentosum (F)	16	16p13.3-p13.13	2072	"""excision repair cross-complementing rodent repair deficiency, complementation group 4"""		E	.	ERCC4	100	.	0			c.A469T						.						160.0	151.0	154.0					16																	14020498		2197	4300	6497	SO:0001587	stop_gained	2072	exon3	Familial Cancer Database	incl. XPA, XPB, XPC, XPD, XPE, XPF, XPG, XP Variant, XPV	AAAAACAAACGTG	L76568	CCDS32390.1	16p13.3	2014-09-17	2014-03-07		ENSG00000175595	ENSG00000175595			3436	protein-coding gene	gene with protein product	"""xeroderma pigmentosum, complementation group F"""	133520	"""excision repair cross-complementing rodent repair deficiency, complementation group 4"""	XPF		9579555, 8887684	Standard	NM_005236		Approved	RAD1, FANCQ	uc002dce.2	Q92889	OTTHUMG00000048194	ENST00000311895.7:c.469A>T	chr16.hg19:g.14020498A>T	ENSP00000310520:p.Lys157*	87.0	0.0		80.0	31.0	NM_005236	A5PKV6|A8K111|O00140|Q8TD83	Nonsense_Mutation	SNP	ENST00000311895.7	hg19	CCDS32390.1	.	.	.	.	.	.	.	.	.	.	A	37	6.025265	0.97211	.	.	ENSG00000175595	ENST00000311895;ENST00000439007;ENST00000389138	.	.	.	5.34	4.24	0.50183	.	0.045329	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-35.9587	11.7328	0.51748	0.8521:0.1478:0.0:0.0	.	.	.	.	X	157;146;146	.	ENSP00000310520:K157X	K	+	1	0	ERCC4	13927999	1.000000	0.71417	0.985000	0.45067	0.991000	0.79684	8.962000	0.93254	0.846000	0.35142	0.533000	0.62120	AAA	.	.		0.403	ERCC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109634.2	NM_005236	
MKL2	57496	hgsc.bcm.edu	37	16	14341108	14341108	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr16:14341108C>T	ENST00000341243.5	+	10	1958	c.1958C>T	c.(1957-1959)cCc>cTc	p.P653L	MKL2_ENST00000318282.5_Missense_Mutation_p.P664L|MKL2_ENST00000571589.1_Missense_Mutation_p.P664L|MKL2_ENST00000574045.1_Missense_Mutation_p.P664L			Q9ULH7	MKL2_HUMAN	MKL/myocardin-like 2	653					blood vessel morphogenesis (GO:0048514)|cardiac muscle tissue development (GO:0048738)|embryonic organ development (GO:0048568)|heart morphogenesis (GO:0003007)|in utero embryonic development (GO:0001701)|liver development (GO:0001889)|muscle organ development (GO:0007517)|positive regulation of striated muscle tissue development (GO:0045844)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|smooth muscle cell differentiation (GO:0051145)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			breast(3)|central_nervous_system(1)|endometrium(5)|kidney(6)|large_intestine(6)|liver(2)|lung(7)|ovary(4)|pancreas(1)|prostate(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	42						GTAGGCCAGCCCGTCTCTACA	0.607																																					p.P664L		Atlas-SNP	.											.	MKL2	103	.	0			c.C1991T						.						47.0	49.0	48.0					16																	14341108		2197	4300	6497	SO:0001583	missense	57496	exon12			GCCAGCCCGTCTC	AB033069	CCDS32391.1	16p13.12	2012-11-29			ENSG00000186260	ENSG00000186260			29819	protein-coding gene	gene with protein product		609463				10574462	Standard	NM_014048		Approved	MRTF-B, FLJ31823	uc002dcg.3	Q9ULH7	OTTHUMG00000177379	ENST00000341243.5:c.1958C>T	chr16.hg19:g.14341108C>T	ENSP00000345841:p.Pro653Leu	99.0	0.0		72.0	26.0	NM_014048	A6ND53|B4DGT8|Q68CT1|Q6UB16|Q86WW2|Q8N226	Missense_Mutation	SNP	ENST00000341243.5	hg19		.	.	.	.	.	.	.	.	.	.	C	16.22	3.062940	0.55432	.	.	ENSG00000186260	ENST00000318282;ENST00000341243	.	.	.	4.98	4.98	0.66077	.	0.237331	0.42548	D	0.000686	T	0.72645	0.3486	M	0.62723	1.935	0.45515	D	0.998473	B;D	0.56746	0.003;0.977	B;P	0.55923	0.004;0.787	T	0.74559	-0.3625	9	0.51188	T	0.08	-11.2743	17.5646	0.87916	0.0:1.0:0.0:0.0	.	664;664	B4DGT8;Q9ULH7-4	.;.	L	664;653	.	ENSP00000339086:P664L	P	+	2	0	MKL2	14248609	0.993000	0.37304	0.989000	0.46669	0.484000	0.33280	4.074000	0.57577	2.466000	0.83321	0.655000	0.94253	CCC	.	.		0.607	MKL2-202	KNOWN	basic	protein_coding	protein_coding		NM_014048	
ARL6IP1	23204	hgsc.bcm.edu	37	16	18810100	18810100	+	Silent	SNP	C	C	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr16:18810100C>T	ENST00000304414.7	-	2	304	c.93G>A	c.(91-93)ctG>ctA	p.L31L	ARL6IP1_ENST00000562819.1_Silent_p.L31L|ARL6IP1_ENST00000546206.2_Silent_p.L2L|RP11-1035H13.3_ENST00000567078.2_Silent_p.L31L	NM_015161.1	NP_055976.1	Q15041	AR6P1_HUMAN	ADP-ribosylation factor-like 6 interacting protein 1	31					cell death (GO:0008219)|cotranslational protein targeting to membrane (GO:0006613)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|Sec61 translocon complex (GO:0005784)				breast(1)|large_intestine(2)|lung(6)|pancreas(1)|prostate(1)	11						TATCAGCCATCAGCATCACTT	0.453																																					p.L31L		Atlas-SNP	.											.	ARL6IP1	23	.	0			c.G93A						.						231.0	200.0	211.0					16																	18810100		2197	4300	6497	SO:0001819	synonymous_variant	23204	exon2			AGCCATCAGCATC	BC010281	CCDS10572.1	16p12-p11.2	2014-03-12	2006-09-26	2006-09-26	ENSG00000170540	ENSG00000170540			697	protein-coding gene	gene with protein product		607669	"""ADP-ribosylation factor-like 6 interacting protein"""	ARL6IP		24482476	Standard	NM_015161		Approved	AIP1, ARMER, KIAA0069, SPG61	uc002dfl.1	Q15041	OTTHUMG00000131367	ENST00000304414.7:c.93G>A	chr16.hg19:g.18810100C>T		132.0	0.0		120.0	48.0	NM_015161		Silent	SNP	ENST00000304414.7	hg19	CCDS10572.1																																																																																			.	.		0.453	ARL6IP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254156.2	NM_015161	
C16orf62	57020	hgsc.bcm.edu	37	16	19640035	19640035	+	Missense_Mutation	SNP	A	A	C	rs370460906		TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr16:19640035A>C	ENST00000251143.5	+	17	1472	c.1460A>C	c.(1459-1461)aAc>aCc	p.N487T	C16orf62_ENST00000543152.1_Missense_Mutation_p.N236T|C16orf62_ENST00000417362.2_Missense_Mutation_p.N420T|C16orf62_ENST00000448695.1_Missense_Mutation_p.N337T|C16orf62_ENST00000438132.3_Missense_Mutation_p.N576T|C16orf62_ENST00000542263.1_Missense_Mutation_p.N509T			Q7Z3J2	CP062_HUMAN	chromosome 16 open reading frame 62	487						integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(3)|kidney(5)|large_intestine(7)|liver(1)|lung(11)|ovary(1)|prostate(2)|skin(1)|urinary_tract(2)	36						CAGATTCTCAACGAAGCTTGG	0.353																																					p.N576T		Atlas-SNP	.											.	C16orf62	164	.	0			c.A1727C						.						118.0	113.0	115.0					16																	19640035		2197	4300	6497	SO:0001583	missense	57020	exon17			TTCTCAACGAAGC		CCDS32397.1, CCDS32397.2, CCDS73840.1	16p12.3	2012-05-30			ENSG00000103544	ENSG00000103544			24641	protein-coding gene	gene with protein product						10493829	Standard	NM_020314		Approved	MGC16824	uc002dgn.3	Q7Z3J2	OTTHUMG00000167925	ENST00000251143.5:c.1460A>C	chr16.hg19:g.19640035A>C	ENSP00000251143:p.Asn487Thr	107.0	0.0		82.0	26.0	NM_020314	A8K2M1|O43329|Q69YI1|Q6PDA0|Q7L371|Q86W66|Q8WXA5|Q9H0L7|Q9H7C8	Missense_Mutation	SNP	ENST00000251143.5	hg19		.	.	.	.	.	.	.	.	.	.	A	20.7	4.036077	0.75617	.	.	ENSG00000103544	ENST00000438132;ENST00000542263;ENST00000251143;ENST00000417362;ENST00000448695	T;T;T;T;T	0.57595	0.39;0.39;0.39;0.39;0.39	5.96	3.67	0.42095	.	0.000000	0.85682	D	0.000000	T	0.67804	0.2932	M	0.74258	2.255	0.58432	D	0.999999	B;D	0.71674	0.031;0.998	B;D	0.78314	0.017;0.991	T	0.65348	-0.6190	9	.	.	.	-20.4469	8.5778	0.33609	0.8018:0.1306:0.0677:0.0	.	509;487	F5H7K1;Q7Z3J2	.;CP062_HUMAN	T	576;509;487;420;337	ENSP00000400815:N576T;ENSP00000442468:N509T;ENSP00000251143:N487T;ENSP00000395973:N420T;ENSP00000398009:N337T	.	N	+	2	0	C16orf62	19547536	1.000000	0.71417	0.994000	0.49952	0.990000	0.78478	6.750000	0.74888	0.468000	0.27243	0.533000	0.62120	AAC	.	.		0.353	C16orf62-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_020314	
NSMCE1	197370	hgsc.bcm.edu	37	16	27268833	27268833	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr16:27268833T>C	ENST00000361439.4	-	2	158	c.59A>G	c.(58-60)cAg>cGg	p.Q20R		NM_145080.3	NP_659547.2	Q8WV22	NSE1_HUMAN	non-SMC element 1 homolog (S. cerevisiae)	20	Interaction with NDNL2.				DNA recombination (GO:0006310)|DNA repair (GO:0006281)|intracellular signal transduction (GO:0035556)|positive regulation of response to DNA damage stimulus (GO:2001022)|protein ubiquitination (GO:0016567)	chromosome, telomeric region (GO:0000781)|cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|Smc5-Smc6 complex (GO:0030915)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(2)|lung(3)	7						CATCAGCAACTGGAGGAAGCG	0.547																																					p.Q20R		Atlas-SNP	.											.	NSMCE1	28	.	0			c.A59G						.						97.0	103.0	101.0					16																	27268833		2117	4226	6343	SO:0001583	missense	197370	exon2			AGCAACTGGAGGA	AF161451	CCDS10628.2	16p12.1	2010-03-23	2006-07-05		ENSG00000169189	ENSG00000169189			29897	protein-coding gene	gene with protein product						11927594	Standard	XM_005255163		Approved	NSE1	uc002doi.1	Q8WV22	OTTHUMG00000131674	ENST00000361439.4:c.59A>G	chr16.hg19:g.27268833T>C	ENSP00000355077:p.Gln20Arg	146.0	0.0		106.0	49.0	NM_145080	D3DWF6|Q9P045|Q9P049	Missense_Mutation	SNP	ENST00000361439.4	hg19	CCDS10628.2	.	.	.	.	.	.	.	.	.	.	T	20.6	4.013620	0.75161	.	.	ENSG00000169189	ENST00000361439	T	0.41065	1.01	4.85	4.85	0.62838	.	0.000000	0.85682	D	0.000000	T	0.57710	0.2072	L	0.58510	1.815	0.48040	D	0.999576	D	0.67145	0.996	D	0.83275	0.996	T	0.57985	-0.7716	10	0.48119	T	0.1	.	10.7581	0.46249	0.0:0.0:0.0:1.0	.	20	Q8WV22	NSE1_HUMAN	R	20	ENSP00000355077:Q20R	ENSP00000355077:Q20R	Q	-	2	0	NSMCE1	27176334	1.000000	0.71417	0.993000	0.49108	0.970000	0.65996	3.278000	0.51662	2.024000	0.59613	0.460000	0.39030	CAG	.	.		0.547	NSMCE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254577.3	NM_145080	
GTF3C1	2975	hgsc.bcm.edu	37	16	27472839	27472839	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr16:27472839C>A	ENST00000356183.4	-	37	6177	c.6162G>T	c.(6160-6162)aaG>aaT	p.K2054N	GTF3C1_ENST00000561623.1_Missense_Mutation_p.K2029N|GTF3C1_ENST00000567806.1_5'Flank	NM_001520.3	NP_001511.2	Q12789	TF3C1_HUMAN	general transcription factor IIIC, polypeptide 1, alpha 220kDa	2054					5S class rRNA transcription from RNA polymerase III type 1 promoter (GO:0042791)|gene expression (GO:0010467)|rRNA transcription (GO:0009303)|transcription from RNA polymerase III promoter (GO:0006383)|transcription, DNA-templated (GO:0006351)|tRNA transcription (GO:0009304)|tRNA transcription from RNA polymerase III promoter (GO:0042797)	membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|transcription factor TFIIIC complex (GO:0000127)	DNA binding (GO:0003677)			breast(2)|central_nervous_system(4)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(14)|liver(3)|lung(28)|ovary(2)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)	80						CAGGCCTTGGCTTTCTCAGCC	0.612																																					p.K2054N		Atlas-SNP	.											.	GTF3C1	210	.	0			c.G6162T						.						87.0	75.0	79.0					16																	27472839		2197	4300	6497	SO:0001583	missense	2975	exon37			CCTTGGCTTTCTC	U06485	CCDS32414.1, CCDS66988.1	16p12	2010-03-23	2002-08-29			ENSG00000077235		"""General transcription factors"""	4664	protein-coding gene	gene with protein product		603246	"""general transcription factor IIIC, polypeptide 1 (alpha subunit, 220kD )"""			8164661, 8127861	Standard	NM_001520		Approved	TFIIIC220	uc002dov.2	Q12789		ENST00000356183.4:c.6162G>T	chr16.hg19:g.27472839C>A	ENSP00000348510:p.Lys2054Asn	68.0	0.0		45.0	18.0	NM_001520	B2RP21|Q12838|Q6DKN9|Q9Y4W9	Missense_Mutation	SNP	ENST00000356183.4	hg19	CCDS32414.1	.	.	.	.	.	.	.	.	.	.	C	16.52	3.146558	0.57044	.	.	ENSG00000077235	ENST00000356183	T	0.26518	1.73	5.12	5.12	0.69794	.	0.345333	0.29900	N	0.010906	T	0.45074	0.1324	M	0.70595	2.14	0.36818	D	0.886269	P;D	0.59357	0.907;0.985	B;P	0.56563	0.372;0.801	T	0.56001	-0.8051	10	0.66056	D	0.02	-7.4463	15.3242	0.74147	0.0:1.0:0.0:0.0	.	2054;2029	Q12789;Q12789-3	TF3C1_HUMAN;.	N	2054	ENSP00000348510:K2054N	ENSP00000348510:K2054N	K	-	3	2	GTF3C1	27380340	0.997000	0.39634	0.833000	0.33012	0.125000	0.20455	0.989000	0.29629	2.393000	0.81446	0.556000	0.70494	AAG	.	.		0.612	GTF3C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433856.1	NM_001520	
SRCAP	10847	hgsc.bcm.edu	37	16	30749727	30749727	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr16:30749727G>A	ENST00000262518.4	+	34	8751	c.8366G>A	c.(8365-8367)gGa>gAa	p.G2789E	RP11-2C24.4_ENST00000483578.1_lincRNA|SRCAP_ENST00000395059.2_Missense_Mutation_p.G2727E|SRCAP_ENST00000344771.4_Missense_Mutation_p.G2631E	NM_006662.2	NP_006653.2	Q6ZRS2	SRCAP_HUMAN	Snf2-related CREBBP activator protein	2789	Pro-rich.				histone acetylation (GO:0016573)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|histone acetyltransferase activity (GO:0004402)|transcription coactivator activity (GO:0003713)			NS(1)|breast(3)|cervix(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(22)|liver(3)|lung(62)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(5)	136			Colorectal(24;0.198)			GCCAGCCCGGGAAGCCCGTCT	0.652																																					p.G2789E		Atlas-SNP	.											.	SRCAP	298	.	0			c.G8366A						.						53.0	61.0	58.0					16																	30749727		2197	4300	6497	SO:0001583	missense	10847	exon34			GCCCGGGAAGCCC	AB002307	CCDS10689.2	16p11.2	2009-08-06			ENSG00000080603	ENSG00000080603			16974	protein-coding gene	gene with protein product	"""Swi2/Snf2-related ATPase homolog (S. cerevisiae)"", ""domino homolog 1 (Drosophila)"""	611421				10347196, 9205841	Standard	NM_006662		Approved	KIAA0309, EAF1, SWR1, DOMO1	uc002dze.1	Q6ZRS2	OTTHUMG00000132393	ENST00000262518.4:c.8366G>A	chr16.hg19:g.30749727G>A	ENSP00000262518:p.Gly2789Glu	79.0	0.0		66.0	9.0	NM_006662	B0JZA6|O15026|Q7Z744|Q9Y5L9	Missense_Mutation	SNP	ENST00000262518.4	hg19	CCDS10689.2	.	.	.	.	.	.	.	.	.	.	G	5.004	0.186388	0.09495	.	.	ENSG00000080603	ENST00000262518;ENST00000395059;ENST00000344771	D;D;D	0.95272	-3.63;-3.66;-3.66	5.04	5.04	0.67666	.	0.129031	0.35585	N	0.003102	D	0.88621	0.6486	N	0.08118	0	0.33117	D	0.541292	P;P	0.50272	0.933;0.802	P;B	0.44811	0.461;0.272	D	0.91772	0.5428	10	0.56958	D	0.05	-2.9378	13.7558	0.62935	0.0:0.0:1.0:0.0	.	2727;2789	Q6ZRS2-2;Q6ZRS2	.;SRCAP_HUMAN	E	2789;2727;2631	ENSP00000262518:G2789E;ENSP00000378499:G2727E;ENSP00000343042:G2631E	ENSP00000262518:G2789E	G	+	2	0	SRCAP	30657228	1.000000	0.71417	0.994000	0.49952	0.064000	0.16182	4.661000	0.61518	2.629000	0.89072	0.591000	0.81541	GGA	.	.		0.652	SRCAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255523.1	NM_006662	
C16orf93	90835	hgsc.bcm.edu	37	16	30771751	30771751	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr16:30771751A>T	ENST00000543610.1	-	4	1284	c.323T>A	c.(322-324)cTa>cAa	p.L108Q	RNF40_ENST00000357890.5_5'Flank|C16orf93_ENST00000541260.1_Missense_Mutation_p.L108Q|RNF40_ENST00000563683.1_5'Flank|RNF40_ENST00000402121.3_5'Flank|PHKG2_ENST00000563588.1_3'UTR|C16orf93_ENST00000545825.1_Missense_Mutation_p.L108Q|RNF40_ENST00000324685.6_5'Flank	NM_001014979.2	NP_001014979.2	A1A4V9	CP093_HUMAN	chromosome 16 open reading frame 93	108										breast(2)|central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(6)	11						AGGACACCCTAGCTCCAGCAG	0.607																																					p.L108Q		Atlas-SNP	.											.	C16orf93	33	.	0			c.T323A						.						63.0	68.0	66.0					16																	30771751		2197	4300	6497	SO:0001583	missense	90835	exon4			CACCCTAGCTCCA	BC042548	CCDS32434.1, CCDS32434.2, CCDS55993.1	16p11.2	2012-10-10			ENSG00000196118	ENSG00000196118			28078	protein-coding gene	gene with protein product							Standard	NM_001195620		Approved	MGC104706	uc002dzm.3	A1A4V9	OTTHUMG00000167926	ENST00000543610.1:c.323T>A	chr16.hg19:g.30771751A>T	ENSP00000437532:p.Leu108Gln	115.0	0.0		98.0	35.0	NM_001195620	A1A4V8|F5GX13|Q569G2	Missense_Mutation	SNP	ENST00000543610.1	hg19	CCDS32434.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	16.68|16.68	3.191227|3.191227	0.58017|0.58017	.|.	.|.	ENSG00000196118|ENSG00000196118	ENST00000354963;ENST00000543610;ENST00000545825|ENST00000535476	.|.	.|.	.|.	4.48|4.48	4.48|4.48	0.54585|0.54585	.|.	0.219797|.	0.30201|.	N|.	0.010173|.	T|.	0.54983|.	0.1892|.	L|L	0.46157|0.46157	1.445|1.445	0.34591|0.34591	D|D	0.715468|0.715468	D;D;D|.	0.89917|.	1.0;0.999;0.999|.	D;D;D|.	0.70016|.	0.967;0.943;0.943|.	T|.	0.64659|.	-0.6355|.	9|.	0.62326|.	D|.	0.03|.	-5.0472|-5.0472	12.9117|12.9117	0.58182|0.58182	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	108;71;108|.	F5GX13;A1A4V9-2;A1A4V9|.	.;.;CP093_HUMAN|.	Q|K	71;108;108|5	.|.	ENSP00000347050:L71Q|.	L|X	-|-	2|1	0|0	C16orf93|C16orf93	30679252|30679252	0.879000|0.879000	0.30193|0.30193	0.834000|0.834000	0.33040|0.33040	0.354000|0.354000	0.29330|0.29330	5.885000|5.885000	0.69736|0.69736	1.890000|1.890000	0.54733|0.54733	0.379000|0.379000	0.24179|0.24179	CTA|TAG	.	.		0.607	C16orf93-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397089.1	NM_001014979	
PHKB	5257	hgsc.bcm.edu	37	16	47622887	47622887	+	Missense_Mutation	SNP	C	C	G			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr16:47622887C>G	ENST00000323584.5	+	10	966	c.942C>G	c.(940-942)agC>agG	p.S314R	PHKB_ENST00000455779.1_Missense_Mutation_p.S307R|PHKB_ENST00000567402.1_3'UTR|PHKB_ENST00000566044.1_Missense_Mutation_p.S307R|PHKB_ENST00000299167.8_Missense_Mutation_p.S314R	NM_000293.2	NP_000284.1	Q93100	KPBB_HUMAN	phosphorylase kinase, beta	314					carbohydrate metabolic process (GO:0005975)|generation of precursor metabolites and energy (GO:0006091)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|glycogen metabolic process (GO:0005977)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|phosphorylase kinase complex (GO:0005964)|plasma membrane (GO:0005886)	hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)|phosphorylase kinase activity (GO:0004689)			breast(2)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(10)|liver(1)|lung(18)|ovary(1)|skin(1)	41		all_cancers(37;0.00447)|all_lung(18;0.00616)|Lung NSC(13;0.0418)|Breast(268;0.203)				TTCTTTTTAGCCAGACACTTG	0.403																																					p.S314R		Atlas-SNP	.											.	PHKB	298	.	0			c.C942G						.						89.0	88.0	88.0					16																	47622887		2201	4300	6501	SO:0001583	missense	5257	exon10			TTTTAGCCAGACA		CCDS10729.1, CCDS42161.1	16q12-q13	2009-07-10			ENSG00000102893	ENSG00000102893	2.7.11.19		8927	protein-coding gene	gene with protein product		172490					Standard	NM_000293		Approved		uc002eev.4	Q93100	OTTHUMG00000133102	ENST00000323584.5:c.942C>G	chr16.hg19:g.47622887C>G	ENSP00000313504:p.Ser314Arg	68.0	0.0		73.0	26.0	NM_000293	Q8N4T5	Missense_Mutation	SNP	ENST00000323584.5	hg19	CCDS10729.1	.	.	.	.	.	.	.	.	.	.	C	9.856	1.194993	0.22037	.	.	ENSG00000102893	ENST00000299167;ENST00000455779;ENST00000323584	D;D	0.93659	-3.26;-3.26	6.07	1.49	0.22878	Six-hairpin glycosidase-like (1);Glycoside hydrolase 15-related (1);	0.253140	0.51477	D	0.000087	D	0.85622	0.5739	L	0.28192	0.835	0.49389	D	0.999789	B;B	0.18610	0.005;0.029	B;B	0.25759	0.063;0.049	T	0.74512	-0.3641	10	0.29301	T	0.29	-0.7234	5.8152	0.18488	0.1413:0.5562:0.0:0.3025	.	314;307	Q93100;Q93100-4	KPBB_HUMAN;.	R	307;307;314	ENSP00000414345:S307R;ENSP00000313504:S314R	ENSP00000299167:S307R	S	+	3	2	PHKB	46180388	0.258000	0.24033	0.550000	0.28217	0.986000	0.74619	0.702000	0.25631	0.441000	0.26529	-0.237000	0.12165	AGC	.	.		0.403	PHKB-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000430413.1		
RBL2	5934	hgsc.bcm.edu	37	16	53515713	53515713	+	Missense_Mutation	SNP	A	A	C			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr16:53515713A>C	ENST00000262133.6	+	21	3352	c.3215A>C	c.(3214-3216)aAg>aCg	p.K1072T	RBL2_ENST00000379935.4_3'UTR|RBL2_ENST00000544545.1_Missense_Mutation_p.K451T	NM_005611.3	NP_005602.3	Q08999	RBL2_HUMAN	retinoblastoma-like 2	1072					chromatin modification (GO:0016568)|mitotic cell cycle (GO:0000278)|regulation of cell cycle (GO:0051726)|regulation of lipid kinase activity (GO:0043550)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)			breast(3)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(8)|lung(17)|ovary(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	45						CCTCGAGAAAAGATTTTCTAT	0.398																																					p.K1072T		Atlas-SNP	.											.	RBL2	115	.	0			c.A3215C						.						103.0	101.0	101.0					16																	53515713		2198	4300	6498	SO:0001583	missense	5934	exon21			GAGAAAAGATTTT	X74594	CCDS10748.1	16q12.2	2014-03-11	2014-03-11		ENSG00000103479	ENSG00000103479			9894	protein-coding gene	gene with protein product		180203				8361765, 8643454	Standard	NM_005611		Approved	Rb2, p130	uc002ehi.4	Q08999	OTTHUMG00000133198	ENST00000262133.6:c.3215A>C	chr16.hg19:g.53515713A>C	ENSP00000262133:p.Lys1072Thr	121.0	0.0		111.0	57.0	NM_005611	B7Z913|Q15073|Q16084|Q8NE70|Q92812	Missense_Mutation	SNP	ENST00000262133.6	hg19	CCDS10748.1	.	.	.	.	.	.	.	.	.	.	A	15.79	2.938204	0.52972	.	.	ENSG00000103479	ENST00000262133;ENST00000379935;ENST00000544545	T;T	0.58060	0.36;0.36	5.46	5.46	0.80206	.	0.000000	0.85682	D	0.000000	T	0.72724	0.3496	M	0.78049	2.395	0.33951	D	0.644424	D;B;D	0.76494	0.998;0.409;0.999	D;B;D	0.78314	0.991;0.082;0.986	T	0.81276	-0.1006	10	0.46703	T	0.11	-16.0336	15.8276	0.78727	1.0:0.0:0.0:0.0	.	451;782;1072	B7Z913;E9PG04;Q08999	.;.;RBL2_HUMAN	T	1072;782;451	ENSP00000262133:K1072T;ENSP00000444685:K451T	ENSP00000262133:K1072T	K	+	2	0	RBL2	52073214	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.525000	0.67110	2.195000	0.70347	0.533000	0.62120	AAG	.	.		0.398	RBL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256908.3	NM_005611	
DRC7	84229	hgsc.bcm.edu	37	16	57760018	57760018	+	Silent	SNP	C	C	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr16:57760018C>A	ENST00000360716.3	+	14	2018	c.1797C>A	c.(1795-1797)ccC>ccA	p.P599P	CCDC135_ENST00000336825.8_Silent_p.P534P|CCDC135_ENST00000394337.4_Silent_p.P599P			Q8IY82	CC135_HUMAN		599					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|motile cilium (GO:0031514)				breast(1)|central_nervous_system(2)|cervix(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(12)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	30						CAGCGAAGCCCGCGGAGGAGG	0.607																																					p.P599P		Atlas-SNP	.											.	CCDC135	97	.	0			c.C1797A						.						43.0	38.0	40.0					16																	57760018		2198	4298	6496	SO:0001819	synonymous_variant	84229	exon13			GAAGCCCGCGGAG																												ENST00000360716.3:c.1797C>A	chr16.hg19:g.57760018C>A		294.0	0.0		239.0	116.0	NM_032269	A8K943|Q8NAA0|Q9H080	Silent	SNP	ENST00000360716.3	hg19	CCDS10787.1																																																																																			.	.		0.607	CCDC135-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433323.2		
CNTNAP4	85445	hgsc.bcm.edu	37	16	76509861	76509861	+	Missense_Mutation	SNP	G	G	A	rs150806968		TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr16:76509861G>A	ENST00000476707.1	+	10	1829	c.1690G>A	c.(1690-1692)Ggt>Agt	p.G564S	CNTNAP4_ENST00000377504.4_Missense_Mutation_p.G512S|CNTNAP4_ENST00000307431.8_Missense_Mutation_p.G560S|CNTNAP4_ENST00000469589.1_3'UTR|CNTNAP4_ENST00000478060.1_Missense_Mutation_p.G488S			Q9C0A0	CNTP4_HUMAN	contactin associated protein-like 4	561	EGF-like 1. {ECO:0000255|PROSITE- ProRule:PRU00076}.				cell adhesion (GO:0007155)|regulation of grooming behavior (GO:2000821)|regulation of synaptic transmission, dopaminergic (GO:0032225)|regulation of synaptic transmission, GABAergic (GO:0032228)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|presynaptic membrane (GO:0042734)		p.G488R(1)|p.G560R(1)|p.G536R(1)		breast(4)|central_nervous_system(1)|cervix(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(6)|lung(33)|ovary(2)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(1)	64						TTGTGAACACGGTGGGGAGTG	0.428													G|||	1	0.000199681	0.0008	0.0	5008	,	,		21415	0.0		0.0	False		,,,				2504	0.0				p.G488S		Atlas-SNP	.											CNTNAP4_ENST00000478060,neck,malignant_melanoma,0,6	CNTNAP4	600	.	3	Substitution - Missense(3)	lung(3)	c.G1462A						.	G	SER/GLY,SER/GLY	0,4396		0,0,2198	159.0	140.0	147.0		1680,1462	5.3	0.2	16	dbSNP_134	147	2,8598	2.2+/-6.3	0,2,4298	no	missense,missense	CNTNAP4	NM_033401.3,NM_138994.3	56,56	0,2,6496	AA,AG,GG		0.0233,0.0,0.0154	probably-damaging,probably-damaging	561/1309,488/1236	76509861	2,12994	2198	4300	6498	SO:0001583	missense	85445	exon10			GAACACGGTGGGG	AB051550	CCDS10924.1, CCDS10924.2, CCDS73915.1	16q23.1	2008-02-05			ENSG00000152910	ENSG00000152910			18747	protein-coding gene	gene with protein product		610518				12093160	Standard	NM_033401		Approved	CASPR4, KIAA1763	uc010chb.1	Q9C0A0	OTTHUMG00000137617	ENST00000476707.1:c.1690G>A	chr16.hg19:g.76509861G>A	ENSP00000417628:p.Gly564Ser	112.0	0.0		75.0	29.0	NM_138994	E9PFZ6|Q86YZ7	Missense_Mutation	SNP	ENST00000476707.1	hg19		.	.	.	.	.	.	.	.	.	.	G	18.15	3.560997	0.65538	0.0	2.33E-4	ENSG00000152910	ENST00000307431;ENST00000377504;ENST00000478060;ENST00000476707	T;T;T;T	0.57107	0.42;0.42;0.42;0.42	5.32	5.32	0.75619	Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);	0.000000	0.40469	N	0.001099	T	0.70046	0.3179	.	.	.	0.51012	D	0.9999	D;D;D;D	0.89917	1.0;1.0;0.999;0.999	D;D;D;D	0.71414	0.953;0.973;0.953;0.911	T	0.72487	-0.4278	9	0.72032	D	0.01	.	12.5047	0.55975	0.0756:0.0:0.9244:0.0	.	488;564;536;561	E9PFZ6;E9PDN6;Q96M80;Q9C0A0	.;.;.;CNTP4_HUMAN	S	560;512;488;564	ENSP00000306893:G560S;ENSP00000439733:G512S;ENSP00000418741:G488S;ENSP00000417628:G564S	ENSP00000306893:G560S	G	+	1	0	CNTNAP4	75067362	1.000000	0.71417	0.239000	0.24122	0.130000	0.20726	5.579000	0.67457	2.773000	0.95371	0.655000	0.94253	GGT	.	G|1.000;A|0.000		0.428	CNTNAP4-005	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000348216.1	NM_033401	
OSGIN1	29948	hgsc.bcm.edu	37	16	83998905	83998905	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr16:83998905G>A	ENST00000343939.2	+	7	1359	c.976G>A	c.(976-978)Gtc>Atc	p.V326I	OSGIN1_ENST00000361711.3_Missense_Mutation_p.V243I|OSGIN1_ENST00000393306.1_Missense_Mutation_p.V243I			Q9UJX0	OSGI1_HUMAN	oxidative stress induced growth inhibitor 1	326					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|negative regulation of cell growth (GO:0030308)|positive regulation of apoptotic process (GO:0043065)		growth factor activity (GO:0008083)			autonomic_ganglia(1)|large_intestine(1)|lung(7)|prostate(2)|upper_aerodigestive_tract(1)	12						CCGCAACGTGGTCCTCGCCAC	0.706																																					p.V243I		Atlas-SNP	.											.	OSGIN1	33	.	0			c.G727A						.						29.0	34.0	32.0					16																	83998905		2199	4298	6497	SO:0001583	missense	29948	exon6			AACGTGGTCCTCG	AY258066	CCDS10939.1	16q23.3	2010-11-23			ENSG00000140961	ENSG00000140961			30093	protein-coding gene	gene with protein product	"""bone marrow stromal cell-derived growth inhibitor"", ""pregnancy induced growth inhibitor"""	607975				11459809, 14570898	Standard	NM_182981		Approved	BDGI, OKL38	uc002fhc.3	Q9UJX0	OTTHUMG00000137640	ENST00000343939.2:c.976G>A	chr16.hg19:g.83998905G>A	ENSP00000343376:p.Val326Ile	42.0	0.0		35.0	15.0	NM_182981	Q52M33|Q86UQ1|Q96S88|Q9BZ70	Missense_Mutation	SNP	ENST00000343939.2	hg19		.	.	.	.	.	.	.	.	.	.	G	28.2	4.900108	0.92035	.	.	ENSG00000140961	ENST00000343939;ENST00000361711;ENST00000393306	T;T;T	0.42900	0.96;0.96;0.96	4.8	4.8	0.61643	.	0.000000	0.85682	D	0.000000	T	0.55305	0.1912	L	0.38838	1.175	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.55872	-0.8072	10	0.46703	T	0.11	-7.2067	16.8408	0.85968	0.0:0.0:1.0:0.0	.	326	Q9UJX0	OSGI1_HUMAN	I	326;243;243	ENSP00000343376:V326I;ENSP00000355374:V243I;ENSP00000376983:V243I	ENSP00000343376:V326I	V	+	1	0	OSGIN1	82556406	1.000000	0.71417	1.000000	0.80357	0.929000	0.56500	9.713000	0.98740	2.211000	0.71520	0.467000	0.42956	GTC	.	.		0.706	OSGIN1-001	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000269081.1	NM_013370	
ATP2C2	9914	hgsc.bcm.edu	37	16	84459339	84459339	+	Splice_Site	SNP	A	A	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr16:84459339A>T	ENST00000262429.4	+	11	1008		c.e11-1		ATP2C2_ENST00000420010.2_Splice_Site|ATP2C2_ENST00000416219.2_Splice_Site	NM_014861.2	NP_055676.2	O75185	AT2C2_HUMAN	ATPase, Ca++ transporting, type 2C, member 2						ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|calcium-transporting ATPase activity (GO:0005388)|metal ion binding (GO:0046872)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(10)|ovary(1)|prostate(3)|skin(5)|urinary_tract(1)	33						TCTCTTCCCCAGGTCTCATCA	0.498																																					.		Atlas-SNP	.											.	ATP2C2	75	.	0			c.920-2A>T						.						254.0	249.0	251.0					16																	84459339		2010	4185	6195	SO:0001630	splice_region_variant	9914	exon11			TTCCCCAGGTCTC	AK091051	CCDS42207.1, CCDS67088.1	16q24.1	2010-04-20			ENSG00000064270	ENSG00000064270	3.6.3.8	"""ATPases / P-type"""	29103	protein-coding gene	gene with protein product	"""secretory pathway calcium ATPase 2"""	613082				9734811	Standard	XM_006721355		Approved	KIAA0703, SPCA2	uc002fhx.3	O75185		ENST00000262429.4:c.920-1A>T	chr16.hg19:g.84459339A>T		152.0	0.0		168.0	64.0	NM_014861	B4DU76|E7ES94|Q5HYC3|Q5S053|Q68CQ2	Splice_Site	SNP	ENST00000262429.4	hg19	CCDS42207.1	.	.	.	.	.	.	.	.	.	.	A	12.01	1.809797	0.31961	.	.	ENSG00000064270	ENST00000416219;ENST00000262429;ENST00000420010	.	.	.	5.0	5.0	0.66597	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.5089	0.61499	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ATP2C2	83016840	1.000000	0.71417	0.949000	0.38748	0.127000	0.20565	8.213000	0.89758	1.883000	0.54544	0.533000	0.62120	.	.	.		0.498	ATP2C2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433404.1	NM_014861	Intron
FOXF1	2294	hgsc.bcm.edu	37	16	86544400	86544400	+	Nonsense_Mutation	SNP	C	C	A	rs121909336		TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr16:86544400C>A	ENST00000262426.4	+	1	268	c.225C>A	c.(223-225)taC>taA	p.Y75*	FENDRR_ENST00000595886.1_lincRNA	NM_001451.2	NP_001442.2	Q12946	FOXF1_HUMAN	forkhead box F1	75					blood vessel development (GO:0001568)|branching involved in open tracheal system development (GO:0060446)|cardiac left ventricle morphogenesis (GO:0003214)|cellular response to cytokine stimulus (GO:0071345)|cellular response to organic cyclic compound (GO:0071407)|detection of wounding (GO:0014822)|determination of left/right symmetry (GO:0007368)|digestive tract development (GO:0048565)|ductus arteriosus closure (GO:0097070)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic ectodermal digestive tract morphogenesis (GO:0048613)|embryonic foregut morphogenesis (GO:0048617)|endocardial cushion development (GO:0003197)|epithelial cell differentiation involved in mammary gland alveolus development (GO:0061030)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|establishment of epithelial cell apical/basal polarity (GO:0045198)|extracellular matrix organization (GO:0030198)|heart development (GO:0007507)|in utero embryonic development (GO:0001701)|lateral mesodermal cell differentiation (GO:0048371)|lung alveolus development (GO:0048286)|lung development (GO:0030324)|lung lobe morphogenesis (GO:0060463)|lung vasculature development (GO:0060426)|mesenchyme migration (GO:0090131)|midgut development (GO:0007494)|morphogenesis of a branching structure (GO:0001763)|negative regulation of inflammatory response (GO:0050728)|negative regulation of mast cell degranulation (GO:0043305)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|pancreas development (GO:0031016)|positive regulation of cell migration (GO:0030335)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of smooth muscle cell differentiation (GO:0051150)|renal system development (GO:0072001)|respiratory tube development (GO:0030323)|right lung morphogenesis (GO:0060461)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle cell differentiation (GO:0051145)|smoothened signaling pathway (GO:0007224)|somitogenesis (GO:0001756)|trachea development (GO:0060438)|ureter development (GO:0072189)|vasculogenesis (GO:0001570)|venous blood vessel development (GO:0060841)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding (GO:0043565)			autonomic_ganglia(1)|breast(1)|endometrium(1)|large_intestine(3)|lung(4)|ovary(1)|urinary_tract(1)	12						GCGAGATCTACCAGTTCCTGC	0.617																																					p.Y75X		Atlas-SNP	.											.	FOXF1	59	.	0			c.C225A						.						60.0	64.0	63.0					16																	86544400		2198	4300	6498	SO:0001587	stop_gained	2294	exon1			GATCTACCAGTTC	U13219	CCDS10957.2	16q24	2008-02-05			ENSG00000103241	ENSG00000103241		"""Forkhead boxes"""	3809	protein-coding gene	gene with protein product		601089		FKHL5		8825632, 7957066	Standard	NM_001451		Approved	FREAC1	uc002fjl.3	Q12946	OTTHUMG00000137651	ENST00000262426.4:c.225C>A	chr16.hg19:g.86544400C>A	ENSP00000262426:p.Tyr75*	136.0	0.0		121.0	43.0	NM_001451	B2RAF4|Q5FWE5	Nonsense_Mutation	SNP	ENST00000262426.4	hg19	CCDS10957.2	.	.	.	.	.	.	.	.	.	.	C	37	6.200035	0.97371	.	.	ENSG00000103241	ENST00000262426	.	.	.	4.21	4.21	0.49690	.	0.000000	0.64402	D	0.000004	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	15.8897	0.79286	0.0:1.0:0.0:0.0	.	.	.	.	X	75	.	ENSP00000262426:Y75X	Y	+	3	2	FOXF1	85101901	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.392000	0.44433	2.052000	0.61016	0.650000	0.86243	TAC	.	.		0.617	FOXF1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000269103.2	NM_001451	
IL17C	27189	hgsc.bcm.edu	37	16	88705453	88705453	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr16:88705453T>A	ENST00000244241.4	+	2	120	c.71T>A	c.(70-72)cTc>cAc	p.L24H		NM_013278.3	NP_037410.1	Q9P0M4	IL17C_HUMAN	interleukin 17C	24					cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|inflammatory response (GO:0006954)|neutrophil differentiation (GO:0030223)|positive regulation of cytokine production involved in inflammatory response (GO:1900017)	extracellular space (GO:0005615)	cytokine activity (GO:0005125)			large_intestine(1)|lung(1)	2				BRCA - Breast invasive adenocarcinoma(80;0.0477)		GACCCCTCCCTCAGGGGGCAC	0.672																																					p.L24H		Atlas-SNP	.											.	IL17C	6	.	0			c.T71A						.						85.0	95.0	92.0					16																	88705453		1973	4163	6136	SO:0001583	missense	27189	exon2			CCTCCCTCAGGGG	AF152099	CCDS42217.1	16q24	2011-07-14			ENSG00000124391	ENSG00000124391		"""Interleukins and interleukin receptors"""	5983	protein-coding gene	gene with protein product		604628				10639155	Standard	NM_013278		Approved	IL-17C, CX2, IL-21, MGC126884, MGC138401	uc002fla.3	Q9P0M4		ENST00000244241.4:c.71T>A	chr16.hg19:g.88705453T>A	ENSP00000244241:p.Leu24His	79.0	0.0		71.0	8.0	NM_013278	Q3MIG8|Q9HC75	Missense_Mutation	SNP	ENST00000244241.4	hg19	CCDS42217.1	.	.	.	.	.	.	.	.	.	.	T	16.51	3.142756	0.57044	.	.	ENSG00000124391	ENST00000244241	T	0.49432	0.78	4.74	-0.698	0.11280	.	1.476710	0.04236	N	0.336041	T	0.34571	0.0902	L	0.29908	0.895	0.09310	N	1	D	0.58620	0.983	B	0.43783	0.431	T	0.26087	-1.0113	10	0.72032	D	0.01	-5.876	1.436	0.02343	0.1416:0.165:0.1467:0.5467	.	24	Q9P0M4	IL17C_HUMAN	H	24	ENSP00000244241:L24H	ENSP00000244241:L24H	L	+	2	0	IL17C	87232954	0.000000	0.05858	0.000000	0.03702	0.012000	0.07955	-0.519000	0.06260	-0.090000	0.12462	0.454000	0.30748	CTC	.	.		0.672	IL17C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000422575.1	NM_013278	
OR1A1	8383	hgsc.bcm.edu	37	17	3119514	3119514	+	Nonsense_Mutation	SNP	C	C	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr17:3119514C>A	ENST00000304094.1	+	1	600	c.600C>A	c.(598-600)taC>taA	p.Y200*		NM_014565.2	NP_055380.2	Q9P1Q5	OR1A1_HUMAN	olfactory receptor, family 1, subfamily A, member 1	200						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(7)|ovary(1)|pancreas(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	23						AGATGATGTACCTAGGGGTTG	0.478																																					p.Y200X		Atlas-SNP	.											OR1A1,NS,neuroblastoma,0,1	OR1A1	54	.	0			c.C600A						.						276.0	237.0	250.0					17																	3119514		2203	4300	6503	SO:0001587	stop_gained	8383	exon1			GATGTACCTAGGG	AF087918	CCDS11022.1	17p13.3	2012-08-09			ENSG00000172146	ENSG00000172146		"""GPCR / Class A : Olfactory receptors"""	8179	protein-coding gene	gene with protein product						10673334	Standard	NM_014565		Approved	OR17-7	uc010vrc.2	Q9P1Q5	OTTHUMG00000090637	ENST00000304094.1:c.600C>A	chr17.hg19:g.3119514C>A	ENSP00000305207:p.Tyr200*	99.0	0.0		85.0	36.0	NM_014565	A5D914|Q6IFM1|Q6NTA9|Q96R87	Nonsense_Mutation	SNP	ENST00000304094.1	hg19	CCDS11022.1	.	.	.	.	.	.	.	.	.	.	C	3.660	-0.069746	0.07228	.	.	ENSG00000172146	ENST00000304094	.	.	.	4.96	-5.26	0.02772	.	0.148494	0.31897	N	0.006899	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	14.4587	0.67433	0.0:0.2699:0.0:0.7301	.	.	.	.	X	200	.	ENSP00000305207:Y200X	Y	+	3	2	OR1A1	3066264	0.000000	0.05858	0.069000	0.20011	0.038000	0.13279	-1.588000	0.02106	-0.827000	0.04278	-2.560000	0.00174	TAC	.	.		0.478	OR1A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207292.1	NM_014565	
SPATA22	84690	hgsc.bcm.edu	37	17	3349813	3349813	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr17:3349813T>C	ENST00000573128.1	-	7	1238	c.755A>G	c.(754-756)tAt>tGt	p.Y252C	SPATA22_ENST00000268981.5_Missense_Mutation_p.Y252C|SPATA22_ENST00000397168.3_Missense_Mutation_p.Y252C|SPATA22_ENST00000355380.4_Missense_Mutation_p.Y209C|SPATA22_ENST00000575375.1_Missense_Mutation_p.Y252C|SPATA22_ENST00000541913.1_Missense_Mutation_p.Y236C|SPATA22_ENST00000572969.1_Missense_Mutation_p.Y252C			Q8NHS9	SPT22_HUMAN	spermatogenesis associated 22	252					fertilization (GO:0009566)|gamete generation (GO:0007276)|meiotic DNA repair synthesis (GO:0000711)|regulation of meiotic cell cycle (GO:0051445)|reproductive system development (GO:0061458)|synapsis (GO:0007129)	chromosome (GO:0005694)				breast(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(8)|skin(2)	19						TTCACGCCAATACTTCATGCT	0.308																																					p.Y252C		Atlas-SNP	.											.	SPATA22	49	.	0			c.A755G						.						82.0	80.0	81.0					17																	3349813		2202	4295	6497	SO:0001583	missense	84690	exon7			CGCCAATACTTCA	AY035868	CCDS11027.1, CCDS54066.1, CCDS54067.1	17p13.3	2005-12-19							30705	protein-coding gene	gene with protein product						12477932	Standard	NM_001170696		Approved	NYD-SP20	uc002fvn.3	Q8NHS9		ENST00000573128.1:c.755A>G	chr17.hg19:g.3349813T>C	ENSP00000459580:p.Tyr252Cys	423.0	0.0		409.0	155.0	NM_032598	B4DXB1|D3DTI9|J3KN63|Q969H3|Q96JT4	Missense_Mutation	SNP	ENST00000573128.1	hg19	CCDS11027.1	.	.	.	.	.	.	.	.	.	.	T	18.26	3.584582	0.65992	.	.	ENSG00000141255	ENST00000355380;ENST00000397168;ENST00000268981;ENST00000541913	T;T;T;T	0.80738	-1.41;-1.41;1.83;-1.41	5.26	5.26	0.73747	.	0.089874	0.44285	D	0.000462	D	0.83524	0.5273	L	0.27053	0.805	0.36068	D	0.841956	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.992;0.997;0.992;0.999	D	0.88270	0.2929	10	0.72032	D	0.01	-20.0111	14.6709	0.68942	0.0:0.0:0.0:1.0	.	236;252;209;252	F5GWB9;B4DXB1;Q8NHS9-2;Q8NHS9	.;.;.;SPT22_HUMAN	C	209;252;252;236	ENSP00000347541:Y209C;ENSP00000380354:Y252C;ENSP00000268981:Y252C;ENSP00000441920:Y236C	ENSP00000268981:Y252C	Y	-	2	0	SPATA22	3296563	1.000000	0.71417	1.000000	0.80357	0.924000	0.55760	4.567000	0.60850	2.128000	0.65567	0.533000	0.62120	TAT	.	.		0.308	SPATA22-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438067.2	NM_032598	
ZZEF1	23140	hgsc.bcm.edu	37	17	3937451	3937451	+	Silent	SNP	A	A	G			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr17:3937451A>G	ENST00000381638.2	-	40	6566	c.6442T>C	c.(6442-6444)Ttg>Ctg	p.L2148L		NM_015113.3	NP_055928.3	O43149	ZZEF1_HUMAN	zinc finger, ZZ-type with EF-hand domain 1	2148							calcium ion binding (GO:0005509)|zinc ion binding (GO:0008270)			central_nervous_system(1)|cervix(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(17)|lung(19)|ovary(3)|pancreas(1)|prostate(3)|skin(8)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(3)	84						TCTGCTGGCAAAAGACGGATA	0.512																																					p.L2148L		Atlas-SNP	.											.	ZZEF1	195	.	0			c.T6442C						.						153.0	143.0	147.0					17																	3937451		2203	4300	6503	SO:0001819	synonymous_variant	23140	exon40			CTGGCAAAAGACG	BC035319	CCDS11043.1	17p13.3	2013-01-10	2004-11-03		ENSG00000074755	ENSG00000074755		"""Zinc fingers, ZZ-type"", ""EF-hand domain containing"""	29027	protein-coding gene	gene with protein product			"""zinc finger, ZZ-type with EF hand domain 1"""			9455477	Standard	XM_005256560		Approved	KIAA0399, ZZZ4, FLJ10821	uc002fxe.3	O43149	OTTHUMG00000090741	ENST00000381638.2:c.6442T>C	chr17.hg19:g.3937451A>G		199.0	0.0		202.0	78.0	NM_015113	A7MBM5|Q6NXG0|Q6ZRA1|Q6ZSF4|Q9NVB9	Silent	SNP	ENST00000381638.2	hg19	CCDS11043.1																																																																																			.	.		0.512	ZZEF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207480.1	NM_015113	
ZMYND15	84225	hgsc.bcm.edu	37	17	4649179	4649179	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr17:4649179C>A	ENST00000433935.1	+	14	2180	c.2123C>A	c.(2122-2124)gCg>gAg	p.A708E	ZMYND15_ENST00000269289.6_Missense_Mutation_p.A669E|ZMYND15_ENST00000592813.1_Missense_Mutation_p.A669E|ZMYND15_ENST00000573751.2_Missense_Mutation_p.A716E	NM_001136046.2|NM_001267822.1	NP_001129518.1|NP_001254751.1	Q9H091	ZMY15_HUMAN	zinc finger, MYND-type containing 15	708	Pro-rich.				negative regulation of transcription, DNA-templated (GO:0045892)|spermatid development (GO:0007286)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)			endometrium(5)|large_intestine(3)|lung(6)|ovary(1)|prostate(1)|skin(2)	18						gcccgcccggcgcccgggccc	0.726																																					p.A716E		Atlas-SNP	.											.	ZMYND15	87	.	0			c.C2147A						.						4.0	5.0	5.0					17																	4649179		1979	3967	5946	SO:0001583	missense	84225	exon14			GCCCGGCGCCCGG	AL136893	CCDS11053.1, CCDS45584.1, CCDS58506.1	17p13.3	2008-05-02			ENSG00000141497	ENSG00000141497		"""Zinc fingers, MYND-type"""	20997	protein-coding gene	gene with protein product		614312				11230166	Standard	NM_001136046		Approved	DKFZp434N127	uc002fyu.3	Q9H091	OTTHUMG00000090760	ENST00000433935.1:c.2123C>A	chr17.hg19:g.4649179C>A	ENSP00000391742:p.Ala708Glu	315.0	0.0		245.0	129.0	NM_001267822	B4DXY5|I3L296	Missense_Mutation	SNP	ENST00000433935.1	hg19	CCDS45584.1	.	.	.	.	.	.	.	.	.	.	C	13.28	2.188734	0.38609	.	.	ENSG00000141497	ENST00000433935;ENST00000269289	T;T	0.55930	0.49;0.58	4.37	1.2	0.21068	.	0.163809	0.28834	N	0.013983	T	0.41119	0.1145	L	0.29908	0.895	0.09310	N	1	P;P	0.43431	0.807;0.807	P;P	0.45377	0.478;0.478	T	0.29671	-1.0004	10	0.87932	D	0	-1.7672	6.7105	0.23274	0.0:0.6913:0.0:0.3087	.	708;669	B4DXY5;Q9H091	.;ZMY15_HUMAN	E	708;669	ENSP00000391742:A708E;ENSP00000269289:A669E	ENSP00000269289:A669E	A	+	2	0	ZMYND15	4595928	0.119000	0.22226	0.001000	0.08648	0.003000	0.03518	1.854000	0.39368	0.199000	0.20427	0.655000	0.94253	GCG	.	.		0.726	ZMYND15-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000439580.1	NM_032265	
SAT2	112483	hgsc.bcm.edu	37	17	7530941	7530941	+	Silent	SNP	G	G	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr17:7530941G>T	ENST00000269298.5	-	1	232	c.13C>A	c.(13-15)Cgg>Agg	p.R5R	SHBG_ENST00000340624.5_5'Flank|SHBG_ENST00000574539.1_Intron|SAT2_ENST00000380466.2_5'UTR|SHBG_ENST00000441599.2_5'Flank|SHBG_ENST00000572182.1_Intron|SHBG_ENST00000575903.1_5'Flank|SAT2_ENST00000573566.1_Silent_p.R5R|SHBG_ENST00000576728.1_Intron|SHBG_ENST00000572262.1_Intron|SHBG_ENST00000380450.4_5'Flank|SHBG_ENST00000416273.3_5'Flank|SHBG_ENST00000570547.1_Intron|SHBG_ENST00000575314.1_Intron|SHBG_ENST00000576478.1_Intron	NM_133491.3	NP_597998.1	Q96F10	SAT2_HUMAN	spermidine/spermine N1-acetyltransferase family member 2	5	N-acetyltransferase. {ECO:0000255|PROSITE-ProRule:PRU00532}.				nor-spermidine metabolic process (GO:0046204)|putrescine acetylation (GO:0032920)|putrescine catabolic process (GO:0009447)|spermidine acetylation (GO:0032918)|spermine acetylation (GO:0032919)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	diamine N-acetyltransferase activity (GO:0004145)	p.?(1)		kidney(1)|large_intestine(2)	3				READ - Rectum adenocarcinoma(115;0.166)	Spermine(DB00127)	TCTCGGATCCGCACGGAAGCC	0.622																																					p.R5R		Atlas-SNP	.											.	SAT2	8	.	1	Unknown(1)	haematopoietic_and_lymphoid_tissue(1)	c.C13A						.						48.0	44.0	45.0					17																	7530941		2203	4300	6503	SO:0001819	synonymous_variant	112483	exon1			GGATCCGCACGGA	AF348524	CCDS11116.1	17p13.2	2011-11-16	2008-01-07		ENSG00000141504	ENSG00000141504	2.3.1.57		23160	protein-coding gene	gene with protein product	"""diamine N-acetyltransferase 2"""	611463	"""spermidine/spermine N1-acetyltransferase 2"""			15283699, 17558023	Standard	NM_133491		Approved	SSAT2	uc002gic.2	Q96F10	OTTHUMG00000108152	ENST00000269298.5:c.13C>A	chr17.hg19:g.7530941G>T		101.0	0.0		89.0	31.0	NM_133491		Silent	SNP	ENST00000269298.5	hg19	CCDS11116.1	.	.	.	.	.	.	.	.	.	.	G	9.451	1.090525	0.20471	.	.	ENSG00000141504	ENST00000380466	.	.	.	4.71	1.28	0.21552	.	0.297139	0.18269	N	0.146396	T	0.52175	0.1718	.	.	.	0.54753	D	0.999983	.	.	.	.	.	.	T	0.31336	-0.9947	6	0.19147	T	0.46	-33.8505	10.6193	0.45470	0.0:0.0:0.4035:0.5965	.	.	.	.	E	78	.	ENSP00000369833:A78E	A	-	2	0	SAT2	7471666	0.764000	0.28473	0.857000	0.33713	0.626000	0.37791	0.542000	0.23222	0.094000	0.17404	0.655000	0.94253	GCG	.	.		0.622	SAT2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440078.1	NM_133491	
DNAH2	146754	hgsc.bcm.edu	37	17	7644139	7644139	+	Silent	SNP	G	G	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr17:7644139G>A	ENST00000572933.1	+	11	2978	c.1518G>A	c.(1516-1518)cgG>cgA	p.R506R	DNAH2_ENST00000082259.3_Silent_p.R588R|DNAH2_ENST00000570791.1_Silent_p.R588R|DNAH2_ENST00000389173.2_Silent_p.R506R			Q9P225	DYH2_HUMAN	dynein, axonemal, heavy chain 2	506	Stem. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(3)|breast(11)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(16)|large_intestine(53)|liver(2)|lung(49)|ovary(7)|prostate(7)|skin(15)|upper_aerodigestive_tract(1)|urinary_tract(1)	189		all_cancers(10;4.66e-07)|Prostate(122;0.081)				CTATCAAGCGGACTTATGACA	0.587																																					p.R506R		Atlas-SNP	.											.	DNAH2	498	.	0			c.G1518A						.						110.0	103.0	105.0					17																	7644139		2203	4300	6503	SO:0001819	synonymous_variant	146754	exon10			CAAGCGGACTTAT	U83570, AK128517	CCDS32551.1	17p13.1	2007-10-05	2006-09-04			ENSG00000183914		"""Axonemal dyneins"""	2948	protein-coding gene	gene with protein product		603333	"""dynein, axonemal, heavy polypeptide 2"", ""dynein heavy chain domain 3"""	DNHD3		9256245	Standard	XM_005256470		Approved	KIAA1503, FLJ46675	uc002giu.1	Q9P225		ENST00000572933.1:c.1518G>A	chr17.hg19:g.7644139G>A		51.0	0.0		52.0	18.0	NM_020877	A8K992|B5MDX5|O15434|Q6PIH3|Q6ZR42	Silent	SNP	ENST00000572933.1	hg19	CCDS32551.1																																																																																			.	.		0.587	DNAH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440241.1	NM_020877	
DNAH2	146754	hgsc.bcm.edu	37	17	7660453	7660453	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr17:7660453T>A	ENST00000572933.1	+	13	3409	c.1949T>A	c.(1948-1950)cTg>cAg	p.L650Q	RPL29P2_ENST00000498671.1_RNA|DNAH2_ENST00000389173.2_Missense_Mutation_p.L650Q			Q9P225	DYH2_HUMAN	dynein, axonemal, heavy chain 2	650	Stem. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(3)|breast(11)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(16)|large_intestine(53)|liver(2)|lung(49)|ovary(7)|prostate(7)|skin(15)|upper_aerodigestive_tract(1)|urinary_tract(1)	189		all_cancers(10;4.66e-07)|Prostate(122;0.081)				TGGGAGCGGCTGCTGTTTGAG	0.542																																					p.L650Q		Atlas-SNP	.											.	DNAH2	498	.	0			c.T1949A						.						186.0	181.0	183.0					17																	7660453		2203	4300	6503	SO:0001583	missense	146754	exon12			AGCGGCTGCTGTT	U83570, AK128517	CCDS32551.1	17p13.1	2007-10-05	2006-09-04			ENSG00000183914		"""Axonemal dyneins"""	2948	protein-coding gene	gene with protein product		603333	"""dynein, axonemal, heavy polypeptide 2"", ""dynein heavy chain domain 3"""	DNHD3		9256245	Standard	XM_005256470		Approved	KIAA1503, FLJ46675	uc002giu.1	Q9P225		ENST00000572933.1:c.1949T>A	chr17.hg19:g.7660453T>A	ENSP00000458355:p.Leu650Gln	146.0	0.0		73.0	29.0	NM_020877	A8K992|B5MDX5|O15434|Q6PIH3|Q6ZR42	Missense_Mutation	SNP	ENST00000572933.1	hg19	CCDS32551.1	.	.	.	.	.	.	.	.	.	.	T	21.2	4.118057	0.77323	.	.	ENSG00000183914	ENST00000360606;ENST00000389173	T	0.62498	0.02	4.96	4.96	0.65561	Dynein heavy chain, domain-1 (1);	0.084157	0.48767	D	0.000171	T	0.80276	0.4593	M	0.85299	2.745	0.80722	D	1	D	0.89917	1.0	D	0.79108	0.992	D	0.83547	0.0099	10	0.66056	D	0.02	.	13.7444	0.62865	0.0:0.0:0.0:1.0	.	650	Q9P225	DYH2_HUMAN	Q	650	ENSP00000373825:L650Q	ENSP00000353818:L650Q	L	+	2	0	DNAH2	7601178	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	5.044000	0.64214	2.084000	0.62774	0.402000	0.26972	CTG	.	.		0.542	DNAH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440241.1	NM_020877	
ALOX12B	242	hgsc.bcm.edu	37	17	7989531	7989531	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr17:7989531T>A	ENST00000319144.4	-	2	415	c.155A>T	c.(154-156)cAg>cTg	p.Q52L	MIR4314_ENST00000583321.1_RNA	NM_001139.2	NP_001130.1	O75342	LX12B_HUMAN	arachidonate 12-lipoxygenase, 12R type	52	PLAT. {ECO:0000255|PROSITE- ProRule:PRU00152}.				arachidonic acid metabolic process (GO:0019369)|ceramide biosynthetic process (GO:0046513)|establishment of skin barrier (GO:0061436)|hepoxilin biosynthetic process (GO:0051122)|linoleic acid metabolic process (GO:0043651)|lipoxygenase pathway (GO:0019372)|oxidation-reduction process (GO:0055114)|positive regulation of gene expression (GO:0010628)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mucus secretion (GO:0070257)|protein lipidation (GO:0006497)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	cytosol (GO:0005829)	arachidonate 12-lipoxygenase activity (GO:0004052)|iron ion binding (GO:0005506)|linoleate 9S-lipoxygenase activity (GO:1990136)|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen (GO:0016702)			endometrium(5)|kidney(1)|large_intestine(3)|lung(5)|prostate(1)|stomach(1)	16						CACGGTGTACTGGCCCACCTA	0.642										Multiple Myeloma(8;0.094)																											p.Q52L		Atlas-SNP	.											.	ALOX12B	61	.	0			c.A155T						.						69.0	58.0	62.0					17																	7989531		2203	4300	6503	SO:0001583	missense	242	exon2			GTGTACTGGCCCA	AF038461	CCDS11129.1	17p13.1	2008-03-18			ENSG00000179477	ENSG00000179477	1.13.11.-	"""Arachidonate lipoxygenases"""	430	protein-coding gene	gene with protein product		603741				9618483	Standard	NM_001139		Approved	12R-LOX	uc002gjy.1	O75342	OTTHUMG00000108180	ENST00000319144.4:c.155A>T	chr17.hg19:g.7989531T>A	ENSP00000315167:p.Gln52Leu	102.0	0.0		74.0	33.0	NM_001139		Missense_Mutation	SNP	ENST00000319144.4	hg19	CCDS11129.1	.	.	.	.	.	.	.	.	.	.	T	8.070	0.770089	0.15983	.	.	ENSG00000179477	ENST00000319144	T	0.63744	-0.06	4.58	3.47	0.39725	Lipoxygenase, LH2 (4);Lipase/lipooxygenase, PLAT/LH2 (1);	0.806849	0.11961	N	0.512771	T	0.43188	0.1236	N	0.12182	0.205	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.31447	-0.9943	10	0.52906	T	0.07	-7.375	9.5306	0.39191	0.0:0.0881:0.0:0.9119	.	52	O75342	LX12B_HUMAN	L	52	ENSP00000315167:Q52L	ENSP00000315167:Q52L	Q	-	2	0	ALOX12B	7930256	0.001000	0.12720	0.038000	0.18304	0.310000	0.27922	0.867000	0.27968	1.930000	0.55929	0.529000	0.55759	CAG	.	.		0.642	ALOX12B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226984.3		
ARHGEF15	22899	hgsc.bcm.edu	37	17	8215862	8215862	+	Missense_Mutation	SNP	G	G	C	rs536515839		TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr17:8215862G>C	ENST00000361926.3	+	2	615	c.505G>C	c.(505-507)Gat>Cat	p.D169H	ARHGEF15_ENST00000421050.1_Missense_Mutation_p.D169H	NM_173728.3	NP_776089.2	O94989	ARHGF_HUMAN	Rho guanine nucleotide exchange factor (GEF) 15	169					negative regulation of synapse maturation (GO:2000297)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of stress fiber assembly (GO:0051496)|regulation of catalytic activity (GO:0050790)|retina vasculature morphogenesis in camera-type eye (GO:0061299)	cytoplasm (GO:0005737)|dendrite (GO:0030425)	GTPase activator activity (GO:0005096)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(1)|endometrium(9)|large_intestine(5)|lung(11)|ovary(5)|prostate(3)|skin(2)|urinary_tract(1)	37						TCAGGATGCAGATGCCCCGGA	0.637																																					p.D169H		Atlas-SNP	.											.	ARHGEF15	97	.	0			c.G505C						.						36.0	39.0	38.0					17																	8215862		2203	4299	6502	SO:0001583	missense	22899	exon2			GATGCAGATGCCC	AB020722	CCDS11139.1	17p13.1	2011-11-16			ENSG00000198844	ENSG00000198844		"""Rho guanine nucleotide exchange factors"""	15590	protein-coding gene	gene with protein product	"""Rho guanine exchange factor (GEF) 15"""	608504				10048485	Standard	NM_173728		Approved	KIAA0915, Vsm-RhoGEF, ARGEF15, FLJ13791, MGC44868	uc002glc.3	O94989	OTTHUMG00000108187	ENST00000361926.3:c.505G>C	chr17.hg19:g.8215862G>C	ENSP00000355026:p.Asp169His	39.0	0.0		38.0	14.0	NM_025014	A8K6G1|Q8N449|Q9H8B4	Missense_Mutation	SNP	ENST00000361926.3	hg19	CCDS11139.1	.	.	.	.	.	.	.	.	.	.	G	3.434	-0.115403	0.06881	.	.	ENSG00000198844	ENST00000361926;ENST00000455564;ENST00000421050	T;T	0.75367	-0.93;-0.93	5.51	5.51	0.81932	.	0.586739	0.16625	N	0.206297	T	0.68550	0.3013	L	0.27053	0.805	0.09310	N	1	P;P;D	0.56746	0.612;0.612;0.977	B;B;P	0.46718	0.259;0.259;0.525	T	0.64275	-0.6446	10	0.49607	T	0.09	-3.8974	14.9567	0.71120	0.0:0.0:1.0:0.0	.	169;169;70	D3DTR7;O94989;B4DTR5	.;ARHGF_HUMAN;.	H	169;70;169	ENSP00000355026:D169H;ENSP00000412505:D169H	ENSP00000355026:D169H	D	+	1	0	ARHGEF15	8156587	0.024000	0.19004	0.007000	0.13788	0.012000	0.07955	2.249000	0.43169	2.600000	0.87896	0.555000	0.69702	GAT	.	.		0.637	ARHGEF15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226993.2	NM_173728	
RCVRN	5957	hgsc.bcm.edu	37	17	9804355	9804355	+	Silent	SNP	C	C	T	rs144667256		TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr17:9804355C>T	ENST00000226193.5	-	2	884	c.444G>A	c.(442-444)ccG>ccA	p.P148P	RCVRN_ENST00000570909.3_5'UTR	NM_002903.2	NP_002894.1	P35243	RECO_HUMAN	recoverin	148	EF-hand 4. {ECO:0000255|PROSITE- ProRule:PRU00448}.				phototransduction, visible light (GO:0007603)|positive regulation of guanylate cyclase activity (GO:0031284)|regulation of calcium ion transport (GO:0051924)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)|signal transduction (GO:0007165)|visual perception (GO:0007601)	dendrite (GO:0030425)	calcium ion binding (GO:0005509)|calcium sensitive guanylate cyclase activator activity (GO:0008048)			endometrium(1)|kidney(1)|large_intestine(6)|lung(3)|upper_aerodigestive_tract(1)	12						CTCGCTTTTCCGGCGTGTTTT	0.438																																					p.P148P		Atlas-SNP	.											.	RCVRN	34	.	0			c.G444A						.	C		0,4406		0,0,2203	109.0	101.0	104.0		444	-11.8	0.3	17	dbSNP_134	104	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	RCVRN	NM_002903.2		0,1,6502	TT,TC,CC		0.0116,0.0,0.0077		148/201	9804355	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	5957	exon2			CTTTTCCGGCGTG	BC001720	CCDS11151.1	17p13.1	2013-01-10		2006-09-26	ENSG00000109047	ENSG00000109047		"""EF-hand domain containing"""	9937	protein-coding gene	gene with protein product		179618		RCV1		1387789, 12507501, 1467959, 12789533	Standard	NM_002903		Approved		uc002gme.1	P35243	OTTHUMG00000130268	ENST00000226193.5:c.444G>A	chr17.hg19:g.9804355C>T		101.0	0.0		99.0	49.0	NM_002903	Q53XL0	Silent	SNP	ENST00000226193.5	hg19	CCDS11151.1																																																																																			.	C|1.000;T|0.000		0.438	RCVRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252600.2	NM_002903	
MYH13	8735	hgsc.bcm.edu	37	17	10212854	10212854	+	Silent	SNP	G	G	C	rs371037408		TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr17:10212854G>C	ENST00000418404.3	-	33	5113	c.4950C>G	c.(4948-4950)gtC>gtG	p.V1650V	RP11-401O9.4_ENST00000609088.1_RNA|MYH13_ENST00000252172.4_Silent_p.V1650V			Q9UKX3	MYH13_HUMAN	myosin, heavy chain 13, skeletal muscle	1650					cellular response to starvation (GO:0009267)|metabolic process (GO:0008152)|muscle contraction (GO:0006936)	extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			breast(3)|cervix(2)|endometrium(11)|kidney(7)|large_intestine(21)|lung(48)|ovary(7)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(2)	108						GCTGGCCCTGGACCGTGCGCA	0.637																																					p.V1650V		Atlas-SNP	.											.	MYH13	533	.	0			c.C4950G						.						32.0	33.0	33.0					17																	10212854		2154	4274	6428	SO:0001819	synonymous_variant	8735	exon34			GCCCTGGACCGTG	AF075248	CCDS45613.1	17p13	2011-09-27	2006-09-29			ENSG00000006788		"""Myosins / Myosin superfamily : Class II"""	7571	protein-coding gene	gene with protein product	"""extraocular muscle myosin heavy chain"", ""extraocular myosin heavy chain"""	603487	"""myosin, heavy polypeptide 13, skeletal muscle"""			9806854	Standard	NM_003802		Approved	MyHC-eo	uc002gmk.1	Q9UKX3		ENST00000418404.3:c.4950C>G	chr17.hg19:g.10212854G>C		49.0	0.0		47.0	21.0	NM_003802	O95252|Q9P0U8	Silent	SNP	ENST00000418404.3	hg19	CCDS45613.1																																																																																			.	.		0.637	MYH13-003	KNOWN	alternative_3_UTR|alternative_5_UTR|NMD_exception|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442255.1	NM_003802	
DNAH9	1770	hgsc.bcm.edu	37	17	11696953	11696953	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr17:11696953A>G	ENST00000262442.4	+	42	8263	c.8195A>G	c.(8194-8196)cAg>cGg	p.Q2732R	DNAH9_ENST00000454412.2_Missense_Mutation_p.Q2732R	NM_001372.3	NP_001363.2	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9	2732					cell projection organization (GO:0030030)|cellular component movement (GO:0006928)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|spermatogenesis (GO:0007283)	axoneme (GO:0005930)|cytoskeleton (GO:0005856)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			NS(2)|autonomic_ganglia(1)|breast(15)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(6)|kidney(17)|large_intestine(49)|liver(2)|lung(123)|ovary(6)|pancreas(1)|prostate(6)|skin(21)|stomach(2)|upper_aerodigestive_tract(13)|urinary_tract(4)	290		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)		GATAAAATCCAGACAGAAGTG	0.333																																					p.Q2732R		Atlas-SNP	.											.	DNAH9	695	.	0			c.A8195G						.						100.0	106.0	104.0					17																	11696953		2203	4300	6503	SO:0001583	missense	1770	exon42			AAATCCAGACAGA	U61740	CCDS11160.1, CCDS11161.1	17p12	2009-05-07	2006-09-04		ENSG00000007174	ENSG00000007174		"""Axonemal dyneins"""	2953	protein-coding gene	gene with protein product		603330	"""dynein, axonemal, heavy polypeptide 17-like"", ""dynein, axonemal, heavy polypeptide 9"""	DNAH17L		8812413, 11247663	Standard	NM_001372		Approved	Dnahc9, KIAA0357, HL20, HL-20, DNAL1, DYH9	uc002gne.3	Q9NYC9	OTTHUMG00000130383	ENST00000262442.4:c.8195A>G	chr17.hg19:g.11696953A>G	ENSP00000262442:p.Gln2732Arg	111.0	0.0		102.0	40.0	NM_001372	A2VCQ8|O15064|O95494|Q9NQ28	Missense_Mutation	SNP	ENST00000262442.4	hg19	CCDS11160.1	.	.	.	.	.	.	.	.	.	.	A	5.283	0.237578	0.10023	.	.	ENSG00000007174	ENST00000262442;ENST00000454412;ENST00000413703	T;T	0.25912	1.81;1.77	5.76	5.76	0.90799	.	0.198640	0.44902	D	0.000406	T	0.24198	0.0586	L	0.53249	1.67	0.80722	D	1	B	0.12013	0.005	B	0.15870	0.014	T	0.05971	-1.0853	10	0.21014	T	0.42	.	11.204	0.48758	0.8632:0.0:0.0:0.1368	.	2732	Q9NYC9	DYH9_HUMAN	R	2732;2732;1314	ENSP00000262442:Q2732R;ENSP00000414874:Q2732R	ENSP00000262442:Q2732R	Q	+	2	0	DNAH9	11637678	1.000000	0.71417	1.000000	0.80357	0.555000	0.35460	7.130000	0.77235	2.191000	0.70037	0.533000	0.62120	CAG	.	.		0.333	DNAH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252756.2	NM_001372	
RAI1	10743	hgsc.bcm.edu	37	17	17698925	17698925	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr17:17698925A>T	ENST00000353383.1	+	3	3132	c.2663A>T	c.(2662-2664)cAg>cTg	p.Q888L	RAI1_ENST00000261641.6_Missense_Mutation_p.Q888L	NM_030665.3	NP_109590.3	Q7Z5J4	RAI1_HUMAN	retinoic acid induced 1	888					circadian regulation of gene expression (GO:0032922)|negative regulation of multicellular organism growth (GO:0040015)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	enhancer binding (GO:0035326)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(14)|ovary(1)|prostate(1)|skin(5)|urinary_tract(7)	48				READ - Rectum adenocarcinoma(1115;0.0276)		CCTGGCATGCAGGACCCGCTG	0.657																																					p.Q888L		Atlas-SNP	.											.	RAI1	121	.	0			c.A2663T						.						30.0	28.0	29.0					17																	17698925		2203	4300	6503	SO:0001583	missense	10743	exon3			GCATGCAGGACCC	AJ230819	CCDS11188.1	17p11.2	2011-02-08			ENSG00000108557	ENSG00000108557			9834	protein-coding gene	gene with protein product		607642	"""Smith-Magenis syndrome chromosome region"""	SMCR		10036180	Standard	NM_030665		Approved	DKFZP434A139, SMS, KIAA1820, MGC12824	uc002grm.3	Q7Z5J4	OTTHUMG00000059314	ENST00000353383.1:c.2663A>T	chr17.hg19:g.17698925A>T	ENSP00000323074:p.Gln888Leu	80.0	0.0		66.0	33.0	NM_030665	Q8N3B4|Q8ND08|Q8WU64|Q96JK5|Q9H1C1|Q9H1C2|Q9UF69	Missense_Mutation	SNP	ENST00000353383.1	hg19	CCDS11188.1	.	.	.	.	.	.	.	.	.	.	A	15.42	2.829464	0.50845	.	.	ENSG00000108557	ENST00000353383;ENST00000395774;ENST00000395776;ENST00000355970;ENST00000261641;ENST00000315321	T;T;T	0.67345	-0.26;2.47;0.34	5.03	5.03	0.67393	.	0.290760	0.28382	N	0.015559	T	0.63438	0.2511	L	0.54323	1.7	0.37563	D	0.919154	B	0.19817	0.039	B	0.21360	0.034	T	0.65948	-0.6044	10	0.52906	T	0.07	.	14.772	0.69688	1.0:0.0:0.0:0.0	.	888	Q7Z5J4	RAI1_HUMAN	L	888;888;888;888;888;840	ENSP00000323074:Q888L;ENSP00000379120:Q888L;ENSP00000261641:Q888L	ENSP00000261641:Q888L	Q	+	2	0	RAI1	17639650	0.996000	0.38824	1.000000	0.80357	0.982000	0.71751	1.680000	0.37607	1.909000	0.55274	0.459000	0.35465	CAG	.	.		0.657	RAI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131775.1	NM_030665	
MFAP4	4239	hgsc.bcm.edu	37	17	19289686	19289686	+	Silent	SNP	G	G	C			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr17:19289686G>C	ENST00000299610.4	-	3	261	c.177C>G	c.(175-177)ccC>ccG	p.P59P	MFAP4_ENST00000574313.2_5'Flank|MFAP4_ENST00000395592.2_Silent_p.P83P|MFAP4_ENST00000497081.2_Silent_p.P84P	NM_002404.2	NP_002395.1	P55083	MFAP4_HUMAN	microfibrillar-associated protein 4	59	Fibrinogen C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00739}.				cell adhesion (GO:0007155)|cellular response to UV-B (GO:0071493)|elastic fiber assembly (GO:0048251)|extracellular fibril organization (GO:0043206)|extracellular matrix organization (GO:0030198)|regulation of collagen metabolic process (GO:0010712)|UV protection (GO:0009650)	elastic fiber (GO:0071953)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|microfibril (GO:0001527)				large_intestine(1)|lung(6)|prostate(2)|upper_aerodigestive_tract(1)	10	all_cancers(12;2.87e-05)|all_epithelial(12;0.00114)|Hepatocellular(7;0.00345)|Breast(13;0.206)					TGGGGCCCGAGGGGTAGATGA	0.617																																					p.P83P		Atlas-SNP	.											.	MFAP4	33	.	0			c.C249G						.						79.0	59.0	66.0					17																	19289686		2203	4300	6503	SO:0001819	synonymous_variant	4239	exon3			GCCCGAGGGGTAG	L38486	CCDS11208.1, CCDS56023.1	17p11.2	2013-02-06			ENSG00000166482	ENSG00000166482		"""Fibrinogen C domain containing"""	7035	protein-coding gene	gene with protein product	"""microfibril-associated glycoprotein 4"""	600596				7633408	Standard	NM_001198695		Approved		uc002gvs.3	P55083	OTTHUMG00000059585	ENST00000299610.4:c.177C>G	chr17.hg19:g.19289686G>C		137.0	0.0		137.0	59.0	NM_001198695	A8KAJ1|A8MVM2|B4E317|Q6P680	Silent	SNP	ENST00000299610.4	hg19	CCDS11208.1																																																																																			.	.		0.617	MFAP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132493.2	NM_002404	
SLC6A4	6532	hgsc.bcm.edu	37	17	28534791	28534791	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr17:28534791A>T	ENST00000401766.2	-	12	2121	c.1609T>A	c.(1609-1611)Tgg>Agg	p.W537R	SLC6A4_ENST00000261707.3_Missense_Mutation_p.W537R|RP11-354P11.4_ENST00000581633.1_RNA			P31645	SC6A4_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 4	537					brain morphogenesis (GO:0048854)|cellular response to cGMP (GO:0071321)|cellular response to retinoic acid (GO:0071300)|circadian rhythm (GO:0007623)|memory (GO:0007613)|monoamine transport (GO:0015844)|negative regulation of cerebellar granule cell precursor proliferation (GO:0021941)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of organ growth (GO:0046621)|negative regulation of synaptic transmission, dopaminergic (GO:0032227)|positive regulation of cell cycle (GO:0045787)|positive regulation of gene expression (GO:0010628)|protein homooligomerization (GO:0051260)|protein oligomerization (GO:0051259)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to hypoxia (GO:0001666)|response to nutrient (GO:0007584)|response to toxic substance (GO:0009636)|serotonin transport (GO:0006837)|serotonin uptake (GO:0051610)|social behavior (GO:0035176)|sperm ejaculation (GO:0042713)|thalamus development (GO:0021794)|vasoconstriction (GO:0042310)	cytosol (GO:0005829)|endomembrane system (GO:0012505)|endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	actin filament binding (GO:0051015)|cocaine binding (GO:0019811)|monoamine transmembrane transporter activity (GO:0008504)|Rab GTPase binding (GO:0017137)|serotonin transmembrane transporter activity (GO:0015222)|serotonin:sodium symporter activity (GO:0005335)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(8)|ovary(1)|prostate(1)|skin(4)	25					Amitriptyline(DB00321)|Amoxapine(DB00543)|Amphetamine(DB00182)|Atomoxetine(DB00289)|Chlorphenamine(DB01114)|Citalopram(DB00215)|Clomipramine(DB01242)|Cocaine(DB00907)|Desipramine(DB01151)|Desvenlafaxine(DB06700)|Dexfenfluramine(DB01191)|Dexmethylphenidate(DB06701)|Dextromethorphan(DB00514)|Dopamine(DB00988)|Doxepin(DB01142)|Duloxetine(DB00476)|Ephedra(DB01363)|Escitalopram(DB01175)|Fluoxetine(DB00472)|Fluvoxamine(DB00176)|Imipramine(DB00458)|Levomilnacipran(DB08918)|Loxapine(DB00408)|Mazindol(DB00579)|Methamphetamine(DB01577)|Methylphenidate(DB00422)|Mianserin(DB06148)|Milnacipran(DB04896)|Minaprine(DB00805)|Mirtazapine(DB00370)|Nefazodone(DB01149)|Nortriptyline(DB00540)|Paroxetine(DB00715)|Pethidine(DB00454)|Phentermine(DB00191)|Protriptyline(DB00344)|Pseudoephedrine(DB00852)|Sertraline(DB01104)|Sibutramine(DB01105)|Tapentadol(DB06204)|Tramadol(DB00193)|Trazodone(DB00656)|Trimipramine(DB00726)|Venlafaxine(DB00285)|Verapamil(DB00661)|Vilazodone(DB06684)	CAGATCCTCCAGAACCACCCC	0.572																																					p.W537R		Atlas-SNP	.											.	SLC6A4	60	.	0			c.T1609A						.						83.0	70.0	74.0					17																	28534791		2203	4300	6503	SO:0001583	missense	6532	exon13			TCCTCCAGAACCA	L05568	CCDS11256.1	17q11.2	2014-01-30	2013-07-19		ENSG00000108576	ENSG00000108576		"""Solute carriers"""	11050	protein-coding gene	gene with protein product	"""serotonin transporter 1"""	182138	"""solute carrier family 6 (neurotransmitter transporter, serotonin), member 4"", ""5-hydroxytryptamine (serotonin) transporter"", ""obsessive-compulsive disorder 1"""	HTT, OCD1		7681602, 19806148	Standard	NM_001045		Approved	5-HTT, SERT1	uc002hey.5	P31645	OTTHUMG00000132751	ENST00000401766.2:c.1609T>A	chr17.hg19:g.28534791A>T	ENSP00000385822:p.Trp537Arg	205.0	0.0		117.0	43.0	NM_001045	Q5EE02	Missense_Mutation	SNP	ENST00000401766.2	hg19	CCDS11256.1	.	.	.	.	.	.	.	.	.	.	A	26.4	4.736301	0.89482	.	.	ENSG00000108576	ENST00000394821;ENST00000401766;ENST00000261707	T;T	0.78816	-1.21;-1.21	5.64	5.64	0.86602	.	0.114577	0.64402	D	0.000004	D	0.92024	0.7473	H	0.97158	3.95	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.94492	0.7702	10	0.87932	D	0	.	15.0294	0.71694	1.0:0.0:0.0:0.0	.	537	P31645	SC6A4_HUMAN	R	579;537;537	ENSP00000385822:W537R;ENSP00000261707:W537R	ENSP00000261707:W537R	W	-	1	0	SLC6A4	25558917	1.000000	0.71417	0.993000	0.49108	0.874000	0.50279	9.339000	0.96797	2.153000	0.67306	0.482000	0.46254	TGG	.	.		0.572	SLC6A4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256115.3	NM_001045	
MYO1D	4642	hgsc.bcm.edu	37	17	31048069	31048069	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr17:31048069G>A	ENST00000318217.5	-	15	2189	c.1885C>T	c.(1885-1887)Cgc>Tgc	p.R629C	MYO1D_ENST00000579584.1_Missense_Mutation_p.R629C|MYO1D_ENST00000394649.4_Missense_Mutation_p.R541C	NM_015194.1	NP_056009.1	O94832	MYO1D_HUMAN	myosin ID	629	Myosin motor.				early endosome to recycling endosome transport (GO:0061502)|negative regulation of phosphatase activity (GO:0010923)	axolemma (GO:0030673)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)|smooth endoplasmic reticulum (GO:0005790)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			breast(1)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(8)|lung(14)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	39			BRCA - Breast invasive adenocarcinoma(9;0.0362)			TATGTCTGGCGGAAGGCAAAT	0.478																																					p.R629C		Atlas-SNP	.											.	MYO1D	93	.	0			c.C1885T						.						140.0	139.0	139.0					17																	31048069		2203	4300	6503	SO:0001583	missense	4642	exon15			TCTGGCGGAAGGC	AB018270	CCDS32615.1	17q11-q12	2014-06-12				ENSG00000176658		"""Myosins / Myosin superfamily : Class I"""	7598	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 108"""	606539				8884266	Standard	NM_015194		Approved	KIAA0727, myr4, PPP1R108	uc002hho.1	O94832		ENST00000318217.5:c.1885C>T	chr17.hg19:g.31048069G>A	ENSP00000324527:p.Arg629Cys	155.0	0.0		125.0	10.0	NM_015194	A6H8V3|Q8NHP9	Missense_Mutation	SNP	ENST00000318217.5	hg19	CCDS32615.1	.	.	.	.	.	.	.	.	.	.	G	25.6	4.651361	0.88056	.	.	ENSG00000176658	ENST00000318217	D	0.92699	-3.09	5.21	5.21	0.72293	Myosin head, motor domain (2);	0.000000	0.38381	U	0.001715	D	0.98178	0.9398	H	0.99800	4.79	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.99198	1.0872	10	0.87932	D	0	.	16.289	0.82738	0.0:0.0:1.0:0.0	.	540;629	Q7Z3N6;O94832	.;MYO1D_HUMAN	C	629	ENSP00000324527:R629C	ENSP00000324527:R629C	R	-	1	0	MYO1D	28072182	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	6.028000	0.70889	2.716000	0.92895	0.561000	0.74099	CGC	.	.		0.478	MYO1D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000447457.1		
SLFN13	146857	hgsc.bcm.edu	37	17	33767910	33767910	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr17:33767910A>T	ENST00000285013.6	-	6	2673	c.2398T>A	c.(2398-2400)Ttt>Att	p.F800I	SLFN13_ENST00000526861.1_Missense_Mutation_p.F800I|SLFN13_ENST00000534689.1_Missense_Mutation_p.F482I|SLFN13_ENST00000542635.1_Missense_Mutation_p.F800I|SLFN13_ENST00000533791.1_Missense_Mutation_p.F800I|SLFN13_ENST00000360502.2_Missense_Mutation_p.F482I	NM_144682.5	NP_653283.3	Q68D06	SLN13_HUMAN	schlafen family member 13	800						intracellular (GO:0005622)	ATP binding (GO:0005524)			NS(1)|breast(1)|endometrium(1)|large_intestine(10)|lung(8)|ovary(3)|pancreas(1)|prostate(5)|stomach(1)	31				UCEC - Uterine corpus endometrioid carcinoma (308;0.0185)		CCCCTTTCAAAGAAGCACCTG	0.443																																					p.F800I		Atlas-SNP	.											.	SLFN13	79	.	0			c.T2398A						.						98.0	92.0	94.0					17																	33767910		2203	4300	6503	SO:0001583	missense	146857	exon6			TTTCAAAGAAGCA	AL832726	CCDS32620.1	17q12	2006-04-05				ENSG00000154760			26481	protein-coding gene	gene with protein product		614957				9846487	Standard	NM_144682		Approved	FLJ31952	uc002hjl.2	Q68D06		ENST00000285013.6:c.2398T>A	chr17.hg19:g.33767910A>T	ENSP00000285013:p.Phe800Ile	92.0	0.0		114.0	52.0	NM_144682	E1P645|Q658M1|Q6ZS51|Q96A81	Missense_Mutation	SNP	ENST00000285013.6	hg19	CCDS32620.1	.	.	.	.	.	.	.	.	.	.	a	12.47	1.949071	0.34377	.	.	ENSG00000154760	ENST00000285013;ENST00000360502;ENST00000526861;ENST00000542635;ENST00000534689	T;T;T;T;T	0.80824	-1.42;-1.42;-1.42;-1.42;-1.42	3.26	3.26	0.37387	.	0.455607	0.18595	N	0.136640	D	0.82440	0.5037	M	0.80183	2.485	0.09310	N	1	P;P	0.46457	0.878;0.689	P;B	0.47402	0.546;0.091	T	0.75317	-0.3360	10	0.66056	D	0.02	.	8.1098	0.30907	1.0:0.0:0.0:0.0	.	482;800	Q68D06-2;Q68D06	.;SLN13_HUMAN	I	800;482;800;800;482	ENSP00000285013:F800I;ENSP00000353692:F482I;ENSP00000434439:F800I;ENSP00000444016:F800I;ENSP00000435442:F482I	ENSP00000285013:F800I	F	-	1	0	SLFN13	30792023	0.000000	0.05858	0.013000	0.15412	0.002000	0.02628	0.396000	0.20867	1.472000	0.48140	0.329000	0.21502	TTT	.	.		0.443	SLFN13-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381883.1	NM_144682	
CCL14	6358	hgsc.bcm.edu	37	17	34311402	34311402	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr17:34311402T>C	ENST00000394509.4	-	2	274	c.166A>G	c.(166-168)Aac>Gac	p.N56D	CCL14_ENST00000586216.1_Missense_Mutation_p.N56D|CTB-186H2.3_ENST00000593057.1_Intron|CCL14_ENST00000435911.2_Missense_Mutation_p.N72D|CCL14_ENST00000536149.1_Missense_Mutation_p.N72D|CTB-186H2.3_ENST00000591669.1_5'Flank|CCL14_ENST00000480944.2_Missense_Mutation_p.N78D|CCL16_ENST00000293275.3_5'Flank|CCL15-CCL14_ENST00000481427.2_3'UTR			Q16627	CCL14_HUMAN	chemokine (C-C motif) ligand 14	56					cell chemotaxis (GO:0060326)|cellular calcium ion homeostasis (GO:0006874)|immune response (GO:0006955)|positive regulation of cell proliferation (GO:0008284)	extracellular space (GO:0005615)				large_intestine(1)|lung(6)	7		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		CACTGGCTGTTGGTCTCATAG	0.577																																					p.N72D		Atlas-SNP	.											.	CCL14	22	.	0			c.A214G						.						108.0	92.0	97.0					17																	34311402		2203	4300	6503	SO:0001583	missense	6358	exon3			GGCTGTTGGTCTC	Z49270	CCDS32624.1, CCDS45652.1	17q11.2	2014-04-10	2002-08-22	2002-08-23	ENSG00000213494	ENSG00000276409		"""Chemokine ligands"", ""Endogenous ligands"""	10612	protein-coding gene	gene with protein product		601392	"""small inducible cytokine subfamily A (Cys-Cys), member 14"""	SCYA14		8661057	Standard	NM_032963		Approved	HCC-1, HCC-3, NCC-2, SCYL2, CKb1, MCIF	uc010wcq.1	Q16627	OTTHUMG00000188403	ENST00000394509.4:c.166A>G	chr17.hg19:g.34311402T>C	ENSP00000378017:p.Asn56Asp	111.0	0.0		98.0	38.0	NM_032962	E1P649|E1P650|Q13954	Missense_Mutation	SNP	ENST00000394509.4	hg19	CCDS32624.1	.	.	.	.	.	.	.	.	.	.	T	16.51	3.143852	0.57044	.	.	ENSG00000213494	ENST00000394509;ENST00000536149;ENST00000435911	T;T;T	0.13657	2.57;2.57;2.57	5.14	4.06	0.47325	CC chemokine, conserved site (1);Chemokine interleukin-8-like domain (3);	0.326818	0.21475	U	0.073932	T	0.11836	0.0288	.	.	.	0.19945	N	0.999942	B;B	0.28820	0.224;0.187	B;B	0.31495	0.131;0.08	T	0.19844	-1.0293	9	0.52906	T	0.07	.	8.1132	0.30926	0.0:0.0936:0.0:0.9064	.	56;72	Q16627;Q16627-2	CCL14_HUMAN;.	D	56;72;72	ENSP00000378017:N56D;ENSP00000441771:N72D;ENSP00000409197:N72D	ENSP00000378017:N56D	N	-	1	0	CCL14	31335515	1.000000	0.71417	0.952000	0.39060	0.509000	0.34042	2.749000	0.47492	0.894000	0.36317	0.460000	0.39030	AAC	.	.		0.577	CCL14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000272892.2	NM_032962	
ARHGAP23	57636	hgsc.bcm.edu	37	17	36619393	36619393	+	Silent	SNP	C	C	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr17:36619393C>A	ENST00000431231.2	+	5	452	c.384C>A	c.(382-384)gtC>gtA	p.V128V	ARHGAP23_ENST00000443378.1_Silent_p.V34V|ARHGAP23_ENST00000437668.3_Silent_p.V128V	NM_001199417.1	NP_001186346.1	Q9P227	RHG23_HUMAN	Rho GTPase activating protein 23	128	PDZ. {ECO:0000255|PROSITE- ProRule:PRU00143}.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	GTPase activator activity (GO:0005096)			breast(2)|endometrium(8)|kidney(6)|lung(1)|skin(1)|stomach(2)	20						GGGAAAGCGTCATTGGGAAGA	0.557																																					p.V128V		Atlas-SNP	.											.	ARHGAP23	48	.	0			c.C384A						.						75.0	81.0	80.0					17																	36619393		692	1591	2283	SO:0001819	synonymous_variant	57636	exon5			AAGCGTCATTGGG	AB040934	CCDS56027.1	17q12	2014-05-06			ENSG00000225485	ENSG00000275832		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	29293	protein-coding gene	gene with protein product		610590				10819331, 15254754	Standard	NM_001199417		Approved	KIAA1501	uc021twd.1	Q9P227	OTTHUMG00000188547	ENST00000431231.2:c.384C>A	chr17.hg19:g.36619393C>A		136.0	0.0		107.0	39.0	NM_001199417		Silent	SNP	ENST00000431231.2	hg19	CCDS56027.1																																																																																			.	.		0.557	ARHGAP23-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000441789.1	XM_290799	
KRT23	25984	hgsc.bcm.edu	37	17	39084545	39084545	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr17:39084545T>C	ENST00000209718.3	-	6	1290	c.866A>G	c.(865-867)gAa>gGa	p.E289G	KRT23_ENST00000436344.3_Missense_Mutation_p.E152G|AC004231.2_ENST00000418393.1_RNA	NM_015515.3	NP_056330.3	Q9C075	K1C23_HUMAN	keratin 23 (histone deacetylase inducible)	289	Coil 2.|Rod.					intermediate filament (GO:0005882)	structural molecule activity (GO:0005198)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(10)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	21		Breast(137;0.000301)|Ovarian(249;0.15)				GCGCTTCAGTTCGTGGATGTC	0.572																																					p.E289G		Atlas-SNP	.											KRT23,NS,malignant_melanoma,-1,1	KRT23	59	.	0			c.A866G						.						267.0	215.0	233.0					17																	39084545		2203	4300	6503	SO:0001583	missense	25984	exon6			TTCAGTTCGTGGA	AF102848	CCDS11380.1, CCDS62182.1	17q21.2	2013-01-16			ENSG00000108244	ENSG00000108244		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6438	protein-coding gene	gene with protein product		606194				11135429, 16831889	Standard	NM_015515		Approved	K23, DKFZP434G032, HAIK1, CK23, MGC26158	uc002hvm.1	Q9C075	OTTHUMG00000133376	ENST00000209718.3:c.866A>G	chr17.hg19:g.39084545T>C	ENSP00000209718:p.Glu289Gly	89.0	0.0		57.0	28.0	NM_015515	A8K084|B7Z7J2|I3L3Q6|Q9NUR6	Missense_Mutation	SNP	ENST00000209718.3	hg19	CCDS11380.1	.	.	.	.	.	.	.	.	.	.	T	20.2	3.958305	0.73902	.	.	ENSG00000108244	ENST00000209718;ENST00000436344	D;D	0.91237	-2.81;-2.81	5.79	5.79	0.91817	Filament (1);	0.000000	0.52532	D	0.000073	D	0.95793	0.8631	M	0.86864	2.845	0.58432	D	0.999998	D	0.76494	0.999	D	0.75020	0.985	D	0.96418	0.9309	10	0.87932	D	0	.	16.1252	0.81386	0.0:0.0:0.0:1.0	.	289	Q9C075	K1C23_HUMAN	G	289;152	ENSP00000209718:E289G;ENSP00000414056:E152G	ENSP00000209718:E289G	E	-	2	0	KRT23	36338071	1.000000	0.71417	1.000000	0.80357	0.226000	0.24999	5.970000	0.70431	2.214000	0.71695	0.533000	0.62120	GAA	.	.		0.572	KRT23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257223.1		
KRTAP4-6	81871	hgsc.bcm.edu	37	17	39296524	39296524	+	Silent	SNP	G	G	C			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr17:39296524G>C	ENST00000345847.4	-	1	215	c.216C>G	c.(214-216)acC>acG	p.T72T		NM_030976.1	NP_112238.1	Q9BYQ5	KRA46_HUMAN	keratin associated protein 4-6	72	30 X 5 AA repeats of C-C-[IRQVEL]-[SPTR]- [STVQRCP].					keratin filament (GO:0045095)				endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|lung(1)|prostate(1)|urinary_tract(1)	9						TGCAGCAGGTGGTCTgacagc	0.657																																					p.T72T		Atlas-SNP	.											.	KRTAP4-6	46	.	0			c.C216G						.																																			SO:0001819	synonymous_variant	81871	exon1			GCAGGTGGTCTGA	AJ406938	CCDS54125.1	17q21.2	2013-06-25			ENSG00000198090	ENSG00000198090		"""Keratin associated proteins"""	18909	protein-coding gene	gene with protein product			"""keratin associated protein 4-15"""	KRTAP4-15			Standard	NM_030976		Approved	KAP4.6, KAP4.15	uc010cxk.2	Q9BYQ5	OTTHUMG00000133634	ENST00000345847.4:c.216C>G	chr17.hg19:g.39296524G>C		47.0	0.0		45.0	19.0	NM_030976	Q9BYR1	Silent	SNP	ENST00000345847.4	hg19	CCDS54125.1																																																																																			.	.		0.657	KRTAP4-6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257779.1		
KRTAP29-1	100533177	hgsc.bcm.edu	37	17	39459055	39459055	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr17:39459055G>A	ENST00000391353.1	-	1	48	c.49C>T	c.(49-51)Ccc>Tcc	p.P17S		NM_001257309.1	NP_001244238.1	A8MX34	KR291_HUMAN	keratin associated protein 29-1	17	7 X 5 AA repeats of C-C-X(3).					keratin filament (GO:0045095)											GTGATGGTGGGCACAGCTGGA	0.527																																					p.P17S		Atlas-SNP	.											.	KRTAP29-1	2	.	0			c.C49T						.																																			SO:0001583	missense	100533177	exon1			TGGTGGGCACAGC		CCDS62183.1	17q21.2	2013-06-20			ENSG00000212658	ENSG00000212658		"""Keratin associated proteins"""	34211	protein-coding gene	gene with protein product							Standard	NM_001257309		Approved	KAP29.2	uc031rai.1	A8MX34	OTTHUMG00000133662	ENST00000391353.1:c.49C>T	chr17.hg19:g.39459055G>A	ENSP00000375148:p.Pro17Ser	94.0	0.0		102.0	36.0	NM_001257309		Missense_Mutation	SNP	ENST00000391353.1	hg19		.	.	.	.	.	.	.	.	.	.	G	2.112	-0.403403	0.04832	.	.	ENSG00000212658	ENST00000391353	.	.	.	5.14	0.927	0.19437	.	.	.	.	.	T	0.16342	0.0393	.	.	.	.	.	.	.	.	.	.	.	.	T	0.39722	-0.9600	4	0.02654	T	1	.	7.8811	0.29623	0.4236:0.0:0.5764:0.0	.	.	.	.	S	17	.	ENSP00000375148:P17S	P	-	1	0	KRTAP29-1	36712581	0.027000	0.19231	0.295000	0.24960	0.017000	0.09413	0.015000	0.13355	-0.023000	0.13963	-0.234000	0.12200	CCC	.	.		0.527	KRTAP29-1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000257828.2		
KRTAP16-1	100505753	hgsc.bcm.edu	37	17	39464117	39464117	+	Silent	SNP	G	G	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr17:39464117G>A	ENST00000391352.1	-	1	1388	c.1389C>T	c.(1387-1389)tgC>tgT	p.C463C		NM_001146182.1	NP_001139654.1	A8MUX0	KR161_HUMAN	keratin associated protein 16-1	463						keratin filament (GO:0045095)				haematopoietic_and_lymphoid_tissue(1)	1						TGGATTTTTTGCAATCCCGTT	0.557																																					p.C463C		Atlas-SNP	.											.	KRTAP16-1	12	.	0			c.C1389T						.																																			SO:0001819	synonymous_variant	100505753	exon1			TTTTTTGCAATCC	AP001708	CCDS56032.1	17q21.2	2012-07-04			ENSG00000212657	ENSG00000212657		"""Keratin associated proteins"""	18916	protein-coding gene	gene with protein product							Standard	NM_001146182		Approved	KAP16.1	uc021txi.1	A8MUX0	OTTHUMG00000133640	ENST00000391352.1:c.1389C>T	chr17.hg19:g.39464117G>A		124.0	0.0		103.0	32.0	NM_001146182		Silent	SNP	ENST00000391352.1	hg19	CCDS56032.1																																																																																			.	.		0.557	KRTAP16-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257785.1	NM_001146182	
KRT34	3885	hgsc.bcm.edu	37	17	39538297	39538297	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr17:39538297C>T	ENST00000394001.1	-	1	358	c.328G>A	c.(328-330)Gcc>Acc	p.A110T		NM_021013.3	NP_066293.2	O76011	KRT34_HUMAN	keratin 34	110	Coil 1A.|Rod.				epidermis development (GO:0008544)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)	structural molecule activity (GO:0005198)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(4)|lung(9)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25		Breast(137;0.000496)				AGGTAGCTGGCCAGGCGGTCG	0.607																																					p.A110T		Atlas-SNP	.											.	KRT34	71	.	0			c.G328A						.						91.0	86.0	88.0					17																	39538297		2203	4297	6500	SO:0001583	missense	3885	exon1			AGCTGGCCAGGCG	Y16790	CCDS11390.1	17q21.2	2013-01-16	2006-07-17	2006-07-17	ENSG00000131737	ENSG00000131737		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6452	protein-coding gene	gene with protein product	"""hard keratin type I 4"""	602763	"""keratin, hair, acidic, 4"""	KRTHA4		2431943, 9756910, 16831889	Standard	NM_021013		Approved	Ha-4	uc002hwm.3	O76011	OTTHUMG00000133436	ENST00000394001.1:c.328G>A	chr17.hg19:g.39538297C>T	ENSP00000377570:p.Ala110Thr	175.0	0.0		179.0	69.0	NM_021013	Q8IUT8|Q8N4W2	Missense_Mutation	SNP	ENST00000394001.1	hg19	CCDS11390.1	.	.	.	.	.	.	.	.	.	.	c	35	5.525983	0.96431	.	.	ENSG00000131737	ENST00000394001;ENST00000251648	.	.	.	5.82	5.82	0.92795	Filament (1);	0.000000	0.64402	D	0.000005	D	0.86142	0.5862	M	0.93106	3.38	0.50632	D	0.999885	D	0.76494	0.999	D	0.67382	0.951	D	0.88794	0.3280	9	0.87932	D	0	.	19.141	0.93446	0.0:1.0:0.0:0.0	.	110	O76011	KRT34_HUMAN	T	68;110	.	ENSP00000251648:A110T	A	-	1	0	KRT34	36791823	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.986000	0.70563	2.764000	0.94973	0.650000	0.86243	GCC	.	.		0.607	KRT34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257304.3	NM_021013	
MLX	6945	hgsc.bcm.edu	37	17	40721541	40721541	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr17:40721541G>T	ENST00000246912.4	+	6	608	c.555G>T	c.(553-555)caG>caT	p.Q185H	MLX_ENST00000346833.4_Missense_Mutation_p.Q101H|MLX_ENST00000435881.2_Missense_Mutation_p.Q131H	NM_170607.2	NP_733752.1	Q9UH92	MLX_HUMAN	MLX, MAX dimerization protein	185	bHLH. {ECO:0000255|PROSITE- ProRule:PRU00981}.				energy reserve metabolic process (GO:0006112)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleocytoplasmic transport (GO:0006913)|positive regulation of cellular metabolic process (GO:0031325)|regulation of transcription, DNA-templated (GO:0006355)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			kidney(3)|large_intestine(4)|lung(1)|ovary(1)|urinary_tract(1)	10		all_cancers(22;4.26e-05)|Breast(137;0.000153)|all_epithelial(22;0.00148)		BRCA - Breast invasive adenocarcinoma(366;0.129)		ACTACATTCAGTTTTTGCACA	0.468																																					p.Q185H	GBM(121;657 1601 4665 24731 34640)	Atlas-SNP	.											.	MLX	17	.	0			c.G555T						.						104.0	98.0	100.0					17																	40721541		2203	4300	6503	SO:0001583	missense	6945	exon6			CATTCAGTTTTTG	AF213668	CCDS11430.1, CCDS42341.1, CCDS45687.1	17q21.1	2013-05-21	2012-11-15	2005-02-11		ENSG00000108788		"""MAX dimerization proteins"", ""Basic helix-loop-helix proteins"""	11645	protein-coding gene	gene with protein product		602976	"""transcription factor-like 4"", ""MAX-like protein X"""	TCFL4		8973301	Standard	NM_170607		Approved	MAD7, MXD7, bHLHd13	uc002iag.3	Q9UH92		ENST00000246912.4:c.555G>T	chr17.hg19:g.40721541G>T	ENSP00000246912:p.Gln185His	83.0	0.0		79.0	32.0	NM_170607	A8K2J3|B2RAV8|B2RD73|Q53XM6|Q96FL2|Q9H2V0|Q9H2V1|Q9H2V2|Q9NXN3	Missense_Mutation	SNP	ENST00000246912.4	hg19	CCDS11430.1	.	.	.	.	.	.	.	.	.	.	G	13.72	2.320597	0.41096	.	.	ENSG00000108788	ENST00000346833;ENST00000246912;ENST00000435881	D;D;D	0.98028	-4.67;-4.67;-4.67	5.69	5.69	0.88448	Helix-loop-helix DNA-binding (5);	0.051071	0.85682	D	0.000000	D	0.95223	0.8451	L	0.39020	1.185	0.58432	D	0.999991	B;B;B	0.19445	0.036;0.012;0.016	B;B;B	0.24269	0.052;0.03;0.028	D	0.92081	0.5672	10	0.40728	T	0.16	-16.8961	14.0233	0.64571	0.0721:0.0:0.9279:0.0	.	101;185;131	Q9UH92-2;Q9UH92;Q9UH92-3	.;MLX_HUMAN;.	H	101;185;131	ENSP00000320913:Q101H;ENSP00000246912:Q185H;ENSP00000416627:Q131H	ENSP00000246912:Q185H	Q	+	3	2	MLX	37975067	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.922000	0.48860	2.696000	0.92011	0.655000	0.94253	CAG	.	.		0.468	MLX-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000450415.1	NM_170607	
RPL27	6155	hgsc.bcm.edu	37	17	41150829	41150829	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr17:41150829G>A	ENST00000589913.1	+	1	336	c.62G>A	c.(61-63)cGc>cAc	p.R21H	RPL27_ENST00000253788.5_Missense_Mutation_p.R21H|Y_RNA_ENST00000363257.1_RNA|RPL27_ENST00000590864.1_5'Flank|RPL27_ENST00000589037.1_Missense_Mutation_p.R21H			P61353	RL27_HUMAN	ribosomal protein L27	21	KOW.				cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			cervix(1)|endometrium(1)|kidney(1)	3		Breast(137;0.000717)|Ovarian(249;0.0776)		BRCA - Breast invasive adenocarcinoma(366;0.157)		TACTCCGGACGCAAAGCTGTC	0.587																																					p.R21H		Atlas-SNP	.											.	RPL27	6	.	0			c.G62A						.						89.0	83.0	85.0					17																	41150829		2203	4300	6503	SO:0001583	missense	6155	exon2			CCGGACGCAAAGC		CCDS11449.1	17q21	2011-04-06				ENSG00000131469		"""L ribosomal proteins"""	10328	protein-coding gene	gene with protein product	"""60S ribosomal protein L27"""	607526				1302024	Standard	NM_000988		Approved	L27	uc002icj.3	P61353		ENST00000589913.1:c.62G>A	chr17.hg19:g.41150829G>A	ENSP00000464813:p.Arg21His	50.0	0.0		42.0	19.0	NM_000988	P08526|Q4G0A9	Missense_Mutation	SNP	ENST00000589913.1	hg19	CCDS11449.1	.	.	.	.	.	.	.	.	.	.	G	15.74	2.921541	0.52653	.	.	ENSG00000131469	ENST00000253788	.	.	.	4.54	3.57	0.40892	KOW (2);Translation protein SH3-like, subgroup (1);	0.000000	0.85682	D	0.000000	T	0.53465	0.1798	L	0.42744	1.35	0.80722	D	1	B	0.18968	0.032	B	0.19391	0.025	T	0.52990	-0.8501	9	0.44086	T	0.13	.	12.5238	0.56075	0.0822:0.0:0.9178:0.0	.	21	P61353	RL27_HUMAN	H	21	.	ENSP00000253788:R21H	R	+	2	0	RPL27	38404355	1.000000	0.71417	1.000000	0.80357	0.705000	0.40729	9.283000	0.95860	1.276000	0.44395	-0.350000	0.07774	CGC	.	.		0.587	RPL27-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452472.1	NM_000988	
IFI35	3430	hgsc.bcm.edu	37	17	41166312	41166312	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr17:41166312G>T	ENST00000415816.2	+	7	1080	c.857G>T	c.(856-858)gGc>gTc	p.G286V	IFI35_ENST00000438323.2_Missense_Mutation_p.G288V	NM_005533.4	NP_005524.2	P80217	IN35_HUMAN	interferon-induced protein 35	286				EVEALTVVPQGQQGLAVFTSESG -> GRGPDSRTPRTAGP SSLHL (in Ref. 1; no nucleotide entry). {ECO:0000305}.	cytokine-mediated signaling pathway (GO:0019221)|type I interferon signaling pathway (GO:0060337)	cytosol (GO:0005829)|nucleus (GO:0005634)				central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(2)|ovary(1)	8		Breast(137;0.00499)		BRCA - Breast invasive adenocarcinoma(366;0.157)		TCTGAGTCAGGCTAGGGGCCT	0.627																																					p.G288V		Atlas-SNP	.											.	IFI35	23	.	0			c.G863T						.						48.0	41.0	44.0					17																	41166312		2203	4300	6503	SO:0001583	missense	3430	exon7			AGTCAGGCTAGGG	BC001356	CCDS11450.1	17q21	2006-04-05			ENSG00000068079	ENSG00000068079			5399	protein-coding gene	gene with protein product		600735					Standard	NM_005533		Approved	IFP35	uc021txx.1	P80217	OTTHUMG00000167720	ENST00000415816.2:c.857G>T	chr17.hg19:g.41166312G>T	ENSP00000394579:p.Gly286Val	80.0	0.0		52.0	29.0	NM_005533	C9JGX1|Q92984|Q99537|Q9BV98	Missense_Mutation	SNP	ENST00000415816.2	hg19		.	.	.	.	.	.	.	.	.	.	G	16.87	3.241189	0.58995	.	.	ENSG00000068079	ENST00000415816;ENST00000438323	T;T	0.54479	0.57;0.58	5.8	-1.38	0.09027	.	1.557740	0.03200	N	0.174660	T	0.37972	0.1023	L	0.36672	1.1	0.09310	N	0.999999	B	0.30406	0.278	B	0.24155	0.051	T	0.32693	-0.9897	10	0.72032	D	0.01	0.1825	1.8675	0.03201	0.2172:0.2493:0.4054:0.1281	.	286	P80217	IN35_HUMAN	V	286;288	ENSP00000394579:G286V;ENSP00000395590:G288V	ENSP00000394579:G286V	G	+	2	0	IFI35	38419838	0.002000	0.14202	0.005000	0.12908	0.002000	0.02628	0.060000	0.14342	0.075000	0.16796	0.462000	0.41574	GGC	.	.		0.627	IFI35-002	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000395851.1	NM_005533	
NBR1	4077	hgsc.bcm.edu	37	17	41349033	41349033	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr17:41349033A>G	ENST00000422280.1	+	16	2395	c.1936A>G	c.(1936-1938)Acc>Gcc	p.T646A	NBR1_ENST00000590996.1_Missense_Mutation_p.T646A|NBR1_ENST00000589872.1_Missense_Mutation_p.T646A|NBR1_ENST00000542611.1_Missense_Mutation_p.T625A|NBR1_ENST00000341165.6_Missense_Mutation_p.T646A|NBR1_ENST00000389312.4_Missense_Mutation_p.T646A	NM_031858.2	NP_114064.1	Q14596	NBR1_HUMAN	neighbor of BRCA1 gene 1	646					macroautophagy (GO:0016236)|negative regulation of osteoblast differentiation (GO:0045668)|protein oligomerization (GO:0051259)|regulation of bone mineralization (GO:0030500)|regulation of stress-activated MAPK cascade (GO:0032872)	autophagic vacuole (GO:0005776)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|late endosome (GO:0005770)|lysosome (GO:0005764)|membrane (GO:0016020)|pre-autophagosomal structure (GO:0000407)	mitogen-activated protein kinase binding (GO:0051019)|ubiquitin binding (GO:0043130)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|cervix(1)|kidney(4)|large_intestine(1)|lung(7)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	24		Breast(137;0.00086)		BRCA - Breast invasive adenocarcinoma(366;0.0934)		CCTGAGTGGGACCCAGTTTGT	0.502																																					p.T646A		Atlas-SNP	.											.	NBR1	55	.	0			c.A1936G						.						149.0	130.0	136.0					17																	41349033		1568	3582	5150	SO:0001583	missense	4077	exon16			AGTGGGACCCAGT	X76952	CCDS45694.1	17q21.31	2008-02-01	2005-02-15	2005-02-16		ENSG00000188554			6746	protein-coding gene	gene with protein product		166945	"""membrane component, chromosome 17, surface marker 2 (ovarian carcinoma antigen CA125)"""	M17S2		8069304	Standard	XM_006721903		Approved	CA125, KIAA0049, 1A1-3B	uc010whv.2	Q14596		ENST00000422280.1:c.1936A>G	chr17.hg19:g.41349033A>G	ENSP00000411250:p.Thr646Ala	201.0	0.0		187.0	11.0	NM_031862	Q13173|Q15026|Q5J7Q8|Q96GB6|Q9NRF7	Missense_Mutation	SNP	ENST00000422280.1	hg19	CCDS45694.1	.	.	.	.	.	.	.	.	.	.	A	16.19	3.053575	0.55218	.	.	ENSG00000188554	ENST00000422280;ENST00000542611;ENST00000341165;ENST00000389312;ENST00000389311	T;T;T;T	0.17691	2.26;2.26;2.26;2.26	5.77	5.77	0.91146	.	.	.	.	.	T	0.25827	0.0629	L	0.49126	1.545	0.45747	D	0.998642	D;P;D	0.58620	0.983;0.569;0.983	P;B;P	0.49887	0.625;0.269;0.625	T	0.00735	-1.1588	9	0.36615	T	0.2	-10.8015	16.084	0.81025	1.0:0.0:0.0:0.0	.	625;646;646	B7Z5R6;Q14596-2;Q14596	.;.;NBR1_HUMAN	A	646;625;646;646;646	ENSP00000411250:T646A;ENSP00000437545:T625A;ENSP00000343479:T646A;ENSP00000373963:T646A	ENSP00000343479:T646A	T	+	1	0	NBR1	38704559	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.192000	0.58378	2.202000	0.70862	0.482000	0.46254	ACC	.	.		0.502	NBR1-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000453461.1	NM_005899	
SLC4A1	6521	hgsc.bcm.edu	37	17	42328926	42328926	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr17:42328926G>A	ENST00000262418.6	-	18	2497	c.2342C>T	c.(2341-2343)tCc>tTc	p.S781F	AC003102.1_ENST00000399246.2_5'Flank	NM_000342.3	NP_000333.1	P02730	B3AT_HUMAN	solute carrier family 4 (anion exchanger), member 1 (Diego blood group)	781	Membrane (anion exchange).				anion transport (GO:0006820)|bicarbonate transport (GO:0015701)|cellular ion homeostasis (GO:0006873)|chloride transport (GO:0006821)|ion transport (GO:0006811)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|blood microparticle (GO:0072562)|cortical cytoskeleton (GO:0030863)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|Z disc (GO:0030018)	anion transmembrane transporter activity (GO:0008509)|anion:anion antiporter activity (GO:0015301)|ankyrin binding (GO:0030506)|bicarbonate transmembrane transporter activity (GO:0015106)|chloride transmembrane transporter activity (GO:0015108)|inorganic anion exchanger activity (GO:0005452)|protein anchor (GO:0043495)|protein homodimerization activity (GO:0042803)			central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(9)|lung(16)|ovary(2)|prostate(3)|skin(1)|urinary_tract(1)	40		Breast(137;0.014)|Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.115)		GGGGATGCGGGACAGGATGGG	0.627																																					p.S781F		Atlas-SNP	.											.	SLC4A1	104	.	0			c.C2342T						.						81.0	76.0	78.0					17																	42328926		2203	4300	6503	SO:0001583	missense	6521	exon18			ATGCGGGACAGGA		CCDS11481.1	17q21.31	2014-07-19	2014-01-02		ENSG00000004939	ENSG00000004939		"""CD molecules"", ""Blood group antigens"", ""Solute carriers"""	11027	protein-coding gene	gene with protein product	"""Froese blood group"", ""Swann blood group"", ""Wright blood group"""	109270	"""Waldner blood group"", ""erythrocyte membrane protein band 3"", ""Diego blood group"", ""solute carrier family 4, anion exchanger, member 1 (erythrocyte membrane protein band 3, Diego blood group)"", ""solute carrier family 4 (anion exchanger), member 1"""	EPB3, AE1, DI, WD		8434259	Standard	NM_000342		Approved	RTA1A, CD233, FR, SW, WR	uc002igf.4	P02730	OTTHUMG00000156843	ENST00000262418.6:c.2342C>T	chr17.hg19:g.42328926G>A	ENSP00000262418:p.Ser781Phe	153.0	0.0		135.0	47.0	NM_000342	G4V2I6|P78487|Q1ZZ45|Q4KKW9|Q4VB84|Q9UCY7|Q9UDJ1	Missense_Mutation	SNP	ENST00000262418.6	hg19	CCDS11481.1	.	.	.	.	.	.	.	.	.	.	G	19.60	3.858482	0.71834	.	.	ENSG00000004939	ENST00000262418	T	0.79352	-1.26	5.22	0.579	0.17397	Bicarbonate transporter, C-terminal (1);	0.557954	0.18498	N	0.139441	T	0.79563	0.4467	M	0.68317	2.08	0.31234	N	0.69596	D	0.58970	0.984	P	0.57009	0.811	T	0.76364	-0.2986	10	0.87932	D	0	.	4.5335	0.12017	0.0754:0.2345:0.4791:0.211	.	781	P02730	B3AT_HUMAN	F	781	ENSP00000262418:S781F	ENSP00000262418:S781F	S	-	2	0	SLC4A1	39684452	0.615000	0.27026	0.985000	0.45067	0.983000	0.72400	0.431000	0.21444	0.277000	0.22141	0.561000	0.74099	TCC	.	.		0.627	SLC4A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346194.1	NM_000342	
FMNL1	752	hgsc.bcm.edu	37	17	43311537	43311537	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr17:43311537C>A	ENST00000331495.3	+	6	920	c.584C>A	c.(583-585)tCc>tAc	p.S195Y	FMNL1_ENST00000328118.3_Missense_Mutation_p.S195Y|FMNL1_ENST00000592006.1_3'UTR	NM_005892.3	NP_005883	O95466	FMNL_HUMAN	formin-like 1	195	GBD/FH3. {ECO:0000255|PROSITE- ProRule:PRU00579}.				actin filament severing (GO:0051014)|cortical actin cytoskeleton organization (GO:0030866)|regulation of cell shape (GO:0008360)|substrate-dependent cell migration (GO:0006929)	cell projection (GO:0042995)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)	actin filament binding (GO:0051015)|GTPase activating protein binding (GO:0032794)|Rac GTPase binding (GO:0048365)			biliary_tract(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(12)|pancreas(1)|skin(1)|urinary_tract(2)	33						CCACCCTCCTCCGTGCCCAAA	0.567																																					p.S195Y	GBM(164;1247 1997 8702 11086 51972)	Atlas-SNP	.											.	FMNL1	78	.	0			c.C584A						.						66.0	70.0	69.0					17																	43311537		2203	4300	6503	SO:0001583	missense	752	exon6			CCTCCTCCGTGCC	AJ008112	CCDS11497.1	17q21.31	2008-05-14	2003-12-02	2003-12-03		ENSG00000184922			1212	protein-coding gene	gene with protein product		604656	"""formin-like"""	C17orf1B, FMNL		9799091	Standard	NM_005892		Approved	C17orf1	uc002iin.3	O95466		ENST00000331495.3:c.584C>A	chr17.hg19:g.43311537C>A	ENSP00000329219:p.Ser195Tyr	89.0	0.0		63.0	11.0	NM_005892	D2DGW2|Q6DKG5|Q6IBP3|Q86UH1|Q8N671|Q8TDH1|Q96H10	Missense_Mutation	SNP	ENST00000331495.3	hg19	CCDS11497.1	.	.	.	.	.	.	.	.	.	.	C	9.570	1.120749	0.20877	.	.	ENSG00000184922	ENST00000328118;ENST00000331495	T;T	0.81078	-1.45;-1.45	5.03	5.03	0.67393	GTPase-binding/formin homology 3 (1);Armadillo-type fold (1);	0.777035	0.12224	N	0.488034	D	0.85835	0.5789	M	0.62723	1.935	0.09310	N	1	P;B	0.51537	0.946;0.145	P;B	0.54026	0.74;0.123	T	0.78293	-0.2260	10	0.45353	T	0.12	.	17.1037	0.86656	0.0:1.0:0.0:0.0	.	195;195	O95466-2;O95466	.;FMNL_HUMAN	Y	195	ENSP00000327442:S195Y;ENSP00000329219:S195Y	ENSP00000327442:S195Y	S	+	2	0	FMNL1	40667320	0.241000	0.23857	0.008000	0.14137	0.088000	0.18126	4.175000	0.58263	2.615000	0.88500	0.555000	0.69702	TCC	.	.		0.567	FMNL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450198.1	NM_005892	
NME1	4830	hgsc.bcm.edu	37	17	49239133	49239133	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr17:49239133A>T	ENST00000393196.3	+	5	517	c.386A>T	c.(385-387)gAg>gTg	p.E129V	NME2_ENST00000393193.2_Intron|NME1_ENST00000336097.3_Missense_Mutation_p.E154V|NME1_ENST00000013034.3_Missense_Mutation_p.E154V|NME1-NME2_ENST00000393198.3_Intron|NME1_ENST00000511355.1_3'UTR|NME2_ENST00000376392.6_Intron|NME2_ENST00000555572.1_Intron|NME1-NME2_ENST00000608447.1_Intron	NM_000269.2	NP_000260.1	P15531	NDKA_HUMAN	NME/NM23 nucleoside diphosphate kinase 1	129					cellular response to drug (GO:0035690)|cellular response to fatty acid (GO:0071398)|cellular response to glucose stimulus (GO:0071333)|CTP biosynthetic process (GO:0006241)|DNA catabolic process (GO:0006308)|endocytosis (GO:0006897)|GTP biosynthetic process (GO:0006183)|hippocampus development (GO:0021766)|lactation (GO:0007595)|negative regulation of cell proliferation (GO:0008285)|negative regulation of gene expression (GO:0010629)|negative regulation of myeloid leukocyte differentiation (GO:0002762)|nucleobase-containing small molecule interconversion (GO:0015949)|nucleobase-containing small molecule metabolic process (GO:0055086)|positive regulation of DNA binding (GO:0043388)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of neuron projection development (GO:0010976)|regulation of apoptotic process (GO:0042981)|response to amine (GO:0014075)|response to cAMP (GO:0051591)|response to testosterone (GO:0033574)|small molecule metabolic process (GO:0044281)|UTP biosynthetic process (GO:0006228)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|ruffle membrane (GO:0032587)	ATP binding (GO:0005524)|deoxyribonuclease activity (GO:0004536)|GTP binding (GO:0005525)|identical protein binding (GO:0042802)|magnesium ion binding (GO:0000287)|nucleoside diphosphate kinase activity (GO:0004550)|poly(A) RNA binding (GO:0044822)|ribosomal small subunit binding (GO:0043024)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|single-stranded DNA binding (GO:0003697)			endometrium(1)|large_intestine(1)|lung(1)	3			BRCA - Breast invasive adenocarcinoma(22;1.54e-08)		Adefovir Dipivoxil(DB00718)|Lamivudine(DB00709)|Tenofovir(DB00300)	GCAGAGAAGGAGATCGGCTTG	0.478																																					p.E154V	GBM(176;1298 2890 6639 30062)	Atlas-SNP	.											.	NME1	12	.	0			c.A461T						.						128.0	116.0	120.0					17																	49239133		2203	4300	6503	SO:0001583	missense	4830	exon6			AGAAGGAGATCGG	AL360191, X17620	CCDS11578.1, CCDS11579.1	17q21.33	2013-04-29	2012-05-18		ENSG00000239672	ENSG00000239672			7849	protein-coding gene	gene with protein product		156490	"""non-metastatic cells 1, protein (NM23A) expressed in"""			8270257, 19852809	Standard	NM_000269		Approved	NM23, NM23-H1, NDPKA		P15531	OTTHUMG00000137474	ENST00000393196.3:c.386A>T	chr17.hg19:g.49239133A>T	ENSP00000376892:p.Glu129Val	131.0	0.0		104.0	53.0	NM_198175	Q6FGK3|Q86XQ2|Q9UDJ6	Missense_Mutation	SNP	ENST00000393196.3	hg19	CCDS11579.1	.	.	.	.	.	.	.	.	.	.	A	23.4	4.413568	0.83449	.	.	ENSG00000239672	ENST00000393196;ENST00000336097;ENST00000013034	T;T;T	0.67698	-0.28;-0.28;-0.28	5.81	5.81	0.92471	.	.	.	.	.	D	0.91355	0.7273	H	0.99958	5.055	0.58432	D	0.99999	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.95534	0.8606	9	0.87932	D	0	-12.0086	16.4563	0.84015	1.0:0.0:0.0:0.0	.	129;154	P15531;P15531-2	NDKA_HUMAN;.	V	129;154;154	ENSP00000376892:E129V;ENSP00000337060:E154V;ENSP00000013034:E154V	ENSP00000013034:E154V	E	+	2	0	NME1	46594132	1.000000	0.71417	1.000000	0.80357	0.477000	0.33069	8.823000	0.92018	2.343000	0.79666	0.533000	0.62120	GAG	.	.		0.478	NME1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268662.2	NM_000269	
OR4D2	124538	hgsc.bcm.edu	37	17	56247411	56247411	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr17:56247411A>G	ENST00000545221.1	+	1	395	c.395A>G	c.(394-396)tAt>tGt	p.Y132C		NM_001004707.3	NP_001004707.1	P58180	OR4D2_HUMAN	olfactory receptor, family 4, subfamily D, member 2	132						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|kidney(1)|large_intestine(1)|lung(19)|ovary(1)|skin(2)|stomach(1)	26						CCCCTCCGCTATGTCACCGTC	0.572																																					p.Y132C		Atlas-SNP	.											.	OR4D2	48	.	0			c.A395G						.						88.0	88.0	88.0					17																	56247411		2203	4300	6503	SO:0001583	missense	124538	exon1			TCCGCTATGTCAC		CCDS32688.1	17q22	2013-09-23			ENSG00000255713	ENSG00000255713		"""GPCR / Class A : Olfactory receptors"""	8294	protein-coding gene	gene with protein product							Standard	NM_001004707		Approved		uc010wnp.2	P58180	OTTHUMG00000178801	ENST00000545221.1:c.395A>G	chr17.hg19:g.56247411A>G	ENSP00000441354:p.Tyr132Cys	74.0	0.0		73.0	28.0	NM_001004707	Q6IFN8|Q96R75	Missense_Mutation	SNP	ENST00000545221.1	hg19	CCDS32688.1	.	.	.	.	.	.	.	.	.	.	A	16.19	3.053735	0.55218	.	.	ENSG00000255713	ENST00000545221	T	0.33865	1.39	5.5	5.5	0.81552	GPCR, rhodopsin-like superfamily (1);	0.000000	0.49916	D	0.000140	T	0.51584	0.1683	M	0.92784	3.345	0.45205	D	0.998213	B	0.31859	0.343	B	0.33620	0.167	T	0.61267	-0.7097	10	0.87932	D	0	-15.1891	13.8478	0.63479	1.0:0.0:0.0:0.0	.	132	P58180	OR4D2_HUMAN	C	132	ENSP00000441354:Y132C	ENSP00000441354:Y132C	Y	+	2	0	OR4D2	53602410	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	9.283000	0.95860	2.220000	0.72140	0.496000	0.49642	TAT	.	.		0.572	OR4D2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443366.1		
BZRAP1	9256	hgsc.bcm.edu	37	17	56384317	56384317	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr17:56384317T>C	ENST00000343736.4	-	25	5159	c.4996A>G	c.(4996-4998)Aag>Gag	p.K1666E	BZRAP1_ENST00000268893.6_Missense_Mutation_p.K1606E|BZRAP1_ENST00000355701.3_Missense_Mutation_p.K1666E			O95153	RIMB1_HUMAN	benzodiazepine receptor (peripheral) associated protein 1	1666	SH3 2. {ECO:0000255|PROSITE- ProRule:PRU00192}.					cytoplasm (GO:0005737)|mitochondrion (GO:0005739)	benzodiazepine receptor binding (GO:0030156)			cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|liver(2)|lung(16)|ovary(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	54	Medulloblastoma(34;0.127)|all_neural(34;0.237)					TCGGCATCCTTGTCCCCAAAC	0.612																																					p.K1666E		Atlas-SNP	.											.	BZRAP1	287	.	0			c.A4996G						.						57.0	49.0	52.0					17																	56384317		2203	4300	6503	SO:0001583	missense	9256	exon25			CATCCTTGTCCCC	AB014512	CCDS11605.1, CCDS45742.1	17q22-q23	2014-01-09	2014-01-09						16831	protein-coding gene	gene with protein product		610764				9734811, 9915832	Standard	NM_004758		Approved	PRAX-1, KIAA0612, RIM-BP1, RIMBP1	uc002ivx.5	O95153		ENST00000343736.4:c.4996A>G	chr17.hg19:g.56384317T>C	ENSP00000345824:p.Lys1666Glu	48.0	0.0		43.0	17.0	NM_004758	O75111|Q8N5W3	Missense_Mutation	SNP	ENST00000343736.4	hg19	CCDS11605.1	.	.	.	.	.	.	.	.	.	.	T	29.8	5.040915	0.93685	.	.	ENSG00000005379	ENST00000355701;ENST00000343736;ENST00000268893	T;T;T	0.09073	3.02;3.02;3.02	5.64	5.64	0.86602	Src homology-3 domain (3);Variant SH3 (1);	0.047833	0.85682	D	0.000000	T	0.17023	0.0409	N	0.20304	0.555	0.51482	D	0.999921	D;D;D	0.89917	1.0;0.999;0.999	D;D;D	0.87578	0.998;0.996;0.996	T	0.04115	-1.0976	10	0.66056	D	0.02	.	15.0407	0.71788	0.0:0.0:0.0:1.0	.	1666;1606;1666	B7ZVZ7;O95153-2;O95153	.;.;RIMB1_HUMAN	E	1666;1666;1606	ENSP00000347929:K1666E;ENSP00000345824:K1666E;ENSP00000268893:K1606E	ENSP00000268893:K1606E	K	-	1	0	BZRAP1	53739316	1.000000	0.71417	1.000000	0.80357	0.939000	0.58152	6.051000	0.71072	2.162000	0.67917	0.421000	0.28195	AAG	.	.		0.612	BZRAP1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000443980.1	NM_004758	
GDPD1	284161	hgsc.bcm.edu	37	17	57351120	57351120	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr17:57351120A>T	ENST00000284116.4	+	10	1068	c.931A>T	c.(931-933)Aac>Tac	p.N311Y	GDPD1_ENST00000581140.1_Intron	NM_182569.3	NP_872375.2	Q8N9F7	GDPD1_HUMAN	glycerophosphodiester phosphodiesterase domain containing 1	311					glycerol metabolic process (GO:0006071)|lipid metabolic process (GO:0006629)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	glycerophosphodiester phosphodiesterase activity (GO:0008889)|metal ion binding (GO:0046872)			endometrium(1)|kidney(1)|liver(1)|lung(2)|upper_aerodigestive_tract(1)	6	all_neural(34;0.0837)|Medulloblastoma(34;0.0922)					TTTTTTACATAACTTTTCAGC	0.333																																					p.N311Y		Atlas-SNP	.											.	GDPD1	39	.	0			c.A931T						.						47.0	52.0	50.0					17																	57351120		2203	4295	6498	SO:0001583	missense	284161	exon10			TTACATAACTTTT	AK094770	CCDS11616.1, CCDS58583.1, CCDS58584.1	17q23.2	2011-01-25				ENSG00000153982			20883	protein-coding gene	gene with protein product						14612981	Standard	NM_182569		Approved	FLJ37451, GDE4	uc002ixk.2	Q8N9F7		ENST00000284116.4:c.931A>T	chr17.hg19:g.57351120A>T	ENSP00000284116:p.Asn311Tyr	44.0	0.0		65.0	25.0	NM_182569	A8W735|Q56VR1|Q8N4E3	Missense_Mutation	SNP	ENST00000284116.4	hg19	CCDS11616.1	.	.	.	.	.	.	.	.	.	.	A	11.71	1.719723	0.30503	.	.	ENSG00000153982	ENST00000284116	T	0.33654	1.4	5.81	4.71	0.59529	PLC-like phosphodiesterase, TIM beta/alpha-barrel domain (1);	0.397035	0.33023	N	0.005364	T	0.43722	0.1260	M	0.78456	2.415	0.80722	D	1	B	0.22480	0.07	B	0.31016	0.123	T	0.40459	-0.9562	10	0.72032	D	0.01	.	11.5207	0.50549	0.8658:0.0:0.0:0.1342	.	311	Q8N9F7	GDPD1_HUMAN	Y	311	ENSP00000284116:N311Y	ENSP00000284116:N311Y	N	+	1	0	GDPD1	54705902	0.999000	0.42202	0.592000	0.28758	0.267000	0.26476	2.089000	0.41672	0.978000	0.38470	0.477000	0.44152	AAC	.	.		0.333	GDPD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446024.1	NM_182569	
NACA2	342538	hgsc.bcm.edu	37	17	59667968	59667968	+	Nonsense_Mutation	SNP	T	T	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr17:59667968T>A	ENST00000521764.1	-	1	595	c.574A>T	c.(574-576)Aga>Tga	p.R192*		NM_199290.3	NP_954984.1	Q9H009	NACA2_HUMAN	nascent polypeptide-associated complex alpha subunit 2	192	UBA.				myoblast migration (GO:0051451)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)			large_intestine(1)|lung(5)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	12	all_epithelial(1;3.12e-14)					GCCTTTGCTCTCGACACATTT	0.408																																					p.R192X		Atlas-SNP	.											.	NACA2	33	.	0			c.A574T						.						267.0	237.0	247.0					17																	59667968		2203	4300	6503	SO:0001587	stop_gained	342538	exon1			TTGCTCTCGACAC	BC062710	CCDS11630.1	17q23.3	2014-01-28	2007-04-20	2007-04-20		ENSG00000253506			23290	protein-coding gene	gene with protein product	"""alpha-NAC protein"""	609274	"""nascent-polypeptide-associated complex alpha polypeptide-like"""	NACAL		12406326	Standard	NM_199290		Approved	MGC71999	uc002izj.2	Q9H009		ENST00000521764.1:c.574A>T	chr17.hg19:g.59667968T>A	ENSP00000427802:p.Arg192*	109.0	0.0		110.0	43.0	NM_199290	Q2VIR9	Nonsense_Mutation	SNP	ENST00000521764.1	hg19	CCDS11630.1	.	.	.	.	.	.	.	.	.	.	T	19.92	3.916270	0.73098	.	.	ENSG00000253506	ENST00000521764	.	.	.	0.753	0.753	0.18404	.	0.000000	0.64402	U	0.000002	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	5.7201	0.17982	0.0:0.0:0.0:1.0	.	.	.	.	X	192	.	.	R	-	1	2	NACA2	57022750	1.000000	0.71417	0.992000	0.48379	0.878000	0.50629	1.591000	0.36665	0.588000	0.29660	0.338000	0.21704	AGA	.	.		0.408	NACA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255437.2	NM_199290	
ACE	1636	hgsc.bcm.edu	37	17	61566056	61566056	+	Missense_Mutation	SNP	T	T	G			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr17:61566056T>G	ENST00000290866.4	+	16	2377	c.2353T>G	c.(2353-2355)Tgg>Ggg	p.W785G	ACE_ENST00000577647.1_Missense_Mutation_p.W211G|ACE_ENST00000490216.2_Missense_Mutation_p.W211G|ACE_ENST00000413513.3_Missense_Mutation_p.W211G|ACE_ENST00000290863.6_Missense_Mutation_p.W211G|ACE_ENST00000428043.1_Missense_Mutation_p.W785G|ACE_ENST00000421982.2_Missense_Mutation_p.W95G	NM_000789.3	NP_000780.1	P12821	ACE_HUMAN	angiotensin I converting enzyme	785	Peptidase M2 2.				angiotensin catabolic process in blood (GO:0002005)|angiotensin maturation (GO:0002003)|arachidonic acid secretion (GO:0050482)|blood vessel remodeling (GO:0001974)|cellular protein metabolic process (GO:0044267)|hematopoietic stem cell differentiation (GO:0060218)|hormone catabolic process (GO:0042447)|kidney development (GO:0001822)|mononuclear cell proliferation (GO:0032943)|peptide catabolic process (GO:0043171)|regulation of blood pressure (GO:0008217)|regulation of renal output by angiotensin (GO:0002019)|regulation of smooth muscle cell migration (GO:0014910)|regulation of systemic arterial blood pressure by renin-angiotensin (GO:0003081)|regulation of vasoconstriction (GO:0019229)|regulation of vasodilation (GO:0042312)	endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|bradykinin receptor binding (GO:0031711)|carboxypeptidase activity (GO:0004180)|chloride ion binding (GO:0031404)|drug binding (GO:0008144)|endopeptidase activity (GO:0004175)|metallopeptidase activity (GO:0008237)|peptidyl-dipeptidase activity (GO:0008241)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(2)|endometrium(5)|kidney(3)|large_intestine(3)|lung(22)|ovary(6)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	51					Benazepril(DB00542)|Candoxatril(DB00616)|Captopril(DB01197)|Cilazapril(DB01340)|Enalapril(DB00584)|Fosinopril(DB00492)|Lisinopril(DB00722)|Moexipril(DB00691)|Perindopril(DB00790)|Quinapril(DB00881)|Ramipril(DB00178)|Rescinnamine(DB01180)|Spirapril(DB01348)|Trandolapril(DB00519)	AGACCTGTTATGGGCATGGGA	0.552																																					p.W785G		Atlas-SNP	.											.	ACE	187	.	0			c.T2353G						.						119.0	112.0	114.0					17																	61566056		2203	4300	6503	SO:0001583	missense	1636	exon16			CTGTTATGGGCAT	J04144	CCDS11637.1, CCDS45755.1, CCDS54155.1	17q23.3	2013-06-12	2013-06-12		ENSG00000159640	ENSG00000159640	3.4.15.1	"""CD molecules"""	2707	protein-coding gene	gene with protein product	"""peptidyl-dipeptidase A"""	106180	"""angiotensin I converting enzyme (peptidyl-dipeptidase A) 1"""	DCP1		2554286, 10319862	Standard	NM_001178057		Approved	ACE1, CD143	uc002jau.2	P12821	OTTHUMG00000154927	ENST00000290866.4:c.2353T>G	chr17.hg19:g.61566056T>G	ENSP00000290866:p.Trp785Gly	68.0	0.0		70.0	29.0	NM_000789	B0LPF0|B4DXI3|E7EU16|P22966|Q53YX9|Q59GY8|Q7M4L4	Missense_Mutation	SNP	ENST00000290866.4	hg19	CCDS11637.1	.	.	.	.	.	.	.	.	.	.	T	7.029	0.560216	0.13498	.	.	ENSG00000159640	ENST00000290866;ENST00000428043;ENST00000290863;ENST00000413513;ENST00000421982	T;T;T;T;T	0.36340	1.26;1.26;1.26;1.26;1.37	5.93	5.93	0.95920	.	0.101295	0.64402	D	0.000002	T	0.62648	0.2445	M	0.91972	3.26	0.23331	N	0.997899	D;P;D;D	0.59767	0.976;0.941;0.986;0.984	P;P;P;P	0.59424	0.649;0.857;0.745;0.666	T	0.65417	-0.6173	10	0.66056	D	0.02	-23.2778	11.5969	0.50979	0.0:0.0:0.1484:0.8516	.	95;211;211;785	F6X3S4;B4DXI3;P12821-3;P12821	.;.;.;ACE_HUMAN	G	785;785;211;211;95	ENSP00000290866:W785G;ENSP00000397593:W785G;ENSP00000290863:W211G;ENSP00000392247:W211G;ENSP00000387760:W95G	ENSP00000290863:W211G	W	+	1	0	ACE	58919788	1.000000	0.71417	0.926000	0.36857	0.035000	0.12851	4.956000	0.63645	2.271000	0.75665	0.459000	0.35465	TGG	.	.		0.552	ACE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337675.2		
GH2	2689	hgsc.bcm.edu	37	17	61957713	61957713	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr17:61957713A>G	ENST00000423893.2	-	5	683	c.622T>C	c.(622-624)Tgc>Cgc	p.C208R	GH2_ENST00000332800.7_3'UTR|GH2_ENST00000449787.2_Missense_Mutation_p.C193R|GH2_ENST00000456543.2_Silent_p.S206S			P01242	SOM2_HUMAN	growth hormone 2	208					JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)	extracellular region (GO:0005576)	hormone activity (GO:0005179)			breast(3)|large_intestine(3)|lung(14)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(2)	24						ACAGAGCGGCACTGCACGATG	0.592																																					p.C208R		Atlas-SNP	.											.	GH2	73	.	0			c.T622C						.						107.0	89.0	95.0					17																	61957713		2202	4279	6481	SO:0001583	missense	2689	exon5			AGCGGCACTGCAC	J03756	CCDS11647.1, CCDS11648.1, CCDS45757.1, CCDS45758.1	17q22-q24	2014-01-30						"""Endogenous ligands"""	4262	protein-coding gene	gene with protein product	"""placental-specific growth hormone"", ""placenta-specific growth hormone"""	139240				6306568	Standard	NM_002059		Approved	GH-V, GHV, GHL, hGH-V	uc002jcl.2	P01242		ENST00000423893.2:c.622T>C	chr17.hg19:g.61957713A>G	ENSP00000409294:p.Cys208Arg	114.0	0.0		91.0	11.0	NM_002059	B1A4H5|B1A4H7|O14643|O14644|P09587	Missense_Mutation	SNP	ENST00000423893.2	hg19	CCDS11647.1	.	.	.	.	.	.	.	.	.	.	a	11.37	1.618543	0.28801	.	.	ENSG00000136487	ENST00000423893;ENST00000449787	D;D	0.99194	-5.54;-5.54	2.74	2.74	0.32292	Somatotropin hormone, conserved site (1);Four-helical cytokine-like, core (1);Four-helical cytokine, core (1);	.	.	.	.	D	0.99086	0.9686	.	.	.	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	D	0.99364	1.0918	8	0.87932	D	0	.	9.9433	0.41593	1.0:0.0:0.0:0.0	.	208;193	P01242;O14643	SOM2_HUMAN;.	R	208;193	ENSP00000409294:C208R;ENSP00000410618:C193R	ENSP00000409294:C208R	C	-	1	0	GH2	59311445	1.000000	0.71417	1.000000	0.80357	0.078000	0.17371	2.950000	0.49081	1.255000	0.44051	0.254000	0.18369	TGC	.	.		0.592	GH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417665.1	NM_002059	
CSHL1	1444	hgsc.bcm.edu	37	17	61987231	61987231	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr17:61987231A>T	ENST00000309894.5	-	5	508	c.509T>A	c.(508-510)cTc>cAc	p.L170H	CSHL1_ENST00000259003.10_Missense_Mutation_p.L108H|CSHL1_ENST00000346606.6_Missense_Mutation_p.L76H|CSHL1_ENST00000558099.1_5'UTR|CSHL1_ENST00000561003.1_Silent_p.P171P|CSHL1_ENST00000450719.3_Silent_p.P160P|CSHL1_ENST00000438387.2_Missense_Mutation_p.L87H	NM_022579.1	NP_072101.1	Q14406	CSHL_HUMAN	chorionic somatomammotropin hormone-like 1	170						extracellular region (GO:0005576)	hormone activity (GO:0005179)|metal ion binding (GO:0046872)			endometrium(3)|lung(6)	9						GGTCTGCTTGAGGGTCTGCCC	0.552																																					p.L170H		Atlas-SNP	.											.	CSHL1	42	.	0			c.T509A						.						194.0	172.0	179.0					17																	61987231		2203	4300	6503	SO:0001583	missense	1444	exon5			TGCTTGAGGGTCT	BC029365	CCDS11652.1, CCDS42370.1, CCDS45759.1	17q22-q24	2012-10-02							2442	protein-coding gene	gene with protein product	"""chorionic somatomammotropin CS-5"""	603515		CSHP1		8083227	Standard	NM_001318		Approved	hCS-L, CSL, CS-5, MGC149868	uc002jda.1	Q14406		ENST00000309894.5:c.509T>A	chr17.hg19:g.61987231A>T	ENSP00000309524:p.Leu170His	137.0	0.0		150.0	71.0	NM_022579	D3DU26|D3DU27|Q0VDB2	Missense_Mutation	SNP	ENST00000309894.5	hg19	CCDS11652.1	.	.	.	.	.	.	.	.	.	.	a	13.04	2.119610	0.37436	.	.	ENSG00000204414	ENST00000309894;ENST00000438387;ENST00000259003;ENST00000346606	D;D;D	0.91124	-2.79;-2.79;-2.79	3.6	3.6	0.41247	Four-helical cytokine-like, core (1);Four-helical cytokine, core (1);	1.454500	0.04305	N	0.347916	D	0.94843	0.8334	M	0.70275	2.135	0.80722	D	1	D;D;D;D	0.67145	0.983;0.996;0.996;0.996	P;P;D;P	0.64687	0.796;0.882;0.928;0.882	D	0.87053	0.2148	10	0.87932	D	0	.	11.3009	0.49304	1.0:0.0:0.0:0.0	.	76;87;170;147	Q14406-4;Q14406-3;Q14406;Q14406-2	.;.;CSHL_HUMAN;.	H	170;87;165;76	ENSP00000309524:L170H;ENSP00000402632:L87H;ENSP00000316360:L76H	ENSP00000259003:L165H	L	-	2	0	GH1	59340963	1.000000	0.71417	0.982000	0.44146	0.017000	0.09413	5.526000	0.67116	1.412000	0.46977	0.254000	0.18369	CTC	.	.		0.552	CSHL1-009	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444557.1	NM_022579	
MGAT5B	146664	hgsc.bcm.edu	37	17	74921070	74921070	+	Silent	SNP	C	C	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr17:74921070C>A	ENST00000569840.2	+	9	1622	c.1048C>A	c.(1048-1050)Cgg>Agg	p.R350R	MGAT5B_ENST00000301618.4_Silent_p.R350R|MGAT5B_ENST00000428789.2_Silent_p.R361R	NM_001199172.1	NP_001186101.1	Q3V5L5	MGT5B_HUMAN	mannosyl (alpha-1,6-)-glycoprotein beta-1,6-N-acetyl-glucosaminyltransferase, isozyme B	350					protein N-linked glycosylation (GO:0006487)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	alpha-1,6-mannosylglycoprotein 6-beta-N-acetylglucosaminyltransferase activity (GO:0030144)|metal ion binding (GO:0046872)			breast(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(15)|ovary(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						ACCGCCAGGCCGGGGAAGCTG	0.612																																					p.R361R		Atlas-SNP	.											.	MGAT5B	98	.	0			c.C1081A						.						80.0	85.0	83.0					17																	74921070		2203	4300	6503	SO:0001819	synonymous_variant	146664	exon8			CCAGGCCGGGGAA	AB109185	CCDS11751.1, CCDS45788.1, CCDS59299.1	17q25.3	2013-02-25	2005-11-16		ENSG00000167889	ENSG00000167889		"""Mannosyl-glycoprotein beta N-acetylglucosaminyltransferases"""	24140	protein-coding gene	gene with protein product		612441	"""mannosyl (alpha-1,6-)-glycoprotein beta-1,6-N-acetyl-glucosaminyltransferase, isoenzyme B"""			14617637, 14623122	Standard	NM_001199172		Approved	GnT-IX, FLJ25132, GnT-VB	uc002jth.3	Q3V5L5	OTTHUMG00000177278	ENST00000569840.2:c.1048C>A	chr17.hg19:g.74921070C>A		78.0	0.0		54.0	20.0	NM_198955	Q6P3S8|Q6P6B3|Q766X5|Q76D04|Q96LS2	Silent	SNP	ENST00000569840.2	hg19	CCDS59299.1																																																																																			.	.		0.612	MGAT5B-010	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000460624.2	NM_144677	
CEP131	22994	hgsc.bcm.edu	37	17	79170793	79170793	+	Silent	SNP	C	C	G			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr17:79170793C>G	ENST00000269392.4	-	14	1966	c.1719G>C	c.(1717-1719)gtG>gtC	p.V573V	AZI1_ENST00000374782.3_Silent_p.V570V|AZI1_ENST00000450824.2_Silent_p.V570V|AZI1_ENST00000575907.1_Silent_p.V573V|RP11-455O6.2_ENST00000571085.1_RNA|AZI1_ENST00000570482.2_5'Flank	NM_014984.2	NP_055799.2	Q9UPN4	CP131_HUMAN		573					cell differentiation (GO:0030154)|G2/M transition of mitotic cell cycle (GO:0000086)|intraciliary transport involved in cilium morphogenesis (GO:0035735)|mitotic cell cycle (GO:0000278)|multicellular organismal development (GO:0007275)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular protein transport (GO:0090316)|regulation of centrosome duplication (GO:0010824)|spermatogenesis (GO:0007283)	BBSome (GO:0034464)|cell projection (GO:0042995)|centriolar satellite (GO:0034451)|centriole (GO:0005814)|centrosome (GO:0005813)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)	protein homodimerization activity (GO:0042803)			breast(1)|central_nervous_system(3)|endometrium(6)|kidney(3)|large_intestine(1)|lung(12)|ovary(2)|prostate(3)|urinary_tract(5)	36	all_neural(118;0.0804)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0272)|OV - Ovarian serous cystadenocarcinoma(97;0.117)			TCAGCCGCATCACAGACGTGC	0.682																																					p.V570V		Atlas-SNP	.											.	AZI1	145	.	0			c.G1710C						.						63.0	48.0	53.0					17																	79170793		2189	4292	6481	SO:0001819	synonymous_variant	22994	exon14			CCGCATCACAGAC																												ENST00000269392.4:c.1719G>C	chr17.hg19:g.79170793C>G		240.0	0.0		240.0	109.0	NM_014984	A6NHI8|B2RN11|Q96F50	Silent	SNP	ENST00000269392.4	hg19																																																																																				.	.		0.682	AZI1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000256070.1		
FN3KRP	79672	hgsc.bcm.edu	37	17	80674715	80674715	+	Silent	SNP	C	C	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr17:80674715C>T	ENST00000269373.6	+	1	157	c.84C>T	c.(82-84)ggC>ggT	p.G28G	FN3KRP_ENST00000535965.1_5'UTR|RP11-388C12.1_ENST00000574471.1_lincRNA	NM_024619.3	NP_078895.2	Q9HA64	KT3K_HUMAN	fructosamine 3 kinase related protein	28							kinase activity (GO:0016301)			breast(1)|large_intestine(2)|lung(1)|ovary(2)|upper_aerodigestive_tract(1)	7	Breast(20;0.000523)|all_neural(118;0.0952)		BRCA - Breast invasive adenocarcinoma(99;0.0344)|OV - Ovarian serous cystadenocarcinoma(97;0.061)			TCAGCCAGGGCCGGAGCTACG	0.701																																					p.G28G		Atlas-SNP	.											.	FN3KRP	31	.	0			c.C84T						.						28.0	30.0	29.0					17																	80674715		2199	4295	6494	SO:0001819	synonymous_variant	79672	exon1			CCAGGGCCGGAGC	AY360465	CCDS11817.1	17q25.3	2014-08-12			ENSG00000141560	ENSG00000141560			25700	protein-coding gene	gene with protein product		611683				14633848	Standard	NM_024619		Approved	FLJ12171, FN3KL	uc002kfu.3	Q9HA64	OTTHUMG00000177846	ENST00000269373.6:c.84C>T	chr17.hg19:g.80674715C>T		586.0	2.0		449.0	206.0	NM_024619	Q969F4|Q9H0U7	Silent	SNP	ENST00000269373.6	hg19	CCDS11817.1																																																																																			.	.		0.701	FN3KRP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000439219.1	NM_024619	
EPB41L3	23136	hgsc.bcm.edu	37	18	5397253	5397253	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr18:5397253G>T	ENST00000341928.2	-	18	2985	c.2645C>A	c.(2644-2646)gCa>gAa	p.A882E	EPB41L3_ENST00000544123.1_Missense_Mutation_p.A713E|EPB41L3_ENST00000542146.1_Missense_Mutation_p.A187E|EPB41L3_ENST00000427684.2_Missense_Mutation_p.A179E|EPB41L3_ENST00000400111.3_Missense_Mutation_p.A660E|EPB41L3_ENST00000542652.2_5'UTR|EPB41L3_ENST00000342933.3_Missense_Mutation_p.A882E|EPB41L3_ENST00000540638.2_Missense_Mutation_p.A660E	NM_012307.2	NP_036439.2	Q9Y2J2	E41L3_HUMAN	erythrocyte membrane protein band 4.1-like 3	882	C-terminal (CTD).				apoptotic process (GO:0006915)|cortical actin cytoskeleton organization (GO:0030866)|cortical cytoskeleton organization (GO:0030865)|cytoskeletal anchoring at plasma membrane (GO:0007016)|myelin maintenance (GO:0043217)|neuron projection morphogenesis (GO:0048812)|paranodal junction assembly (GO:0030913)|protein localization to juxtaparanode region of axon (GO:0071205)|protein localization to paranode region of axon (GO:0002175)|protein localization to plasma membrane (GO:0072659)|regulation of cell shape (GO:0008360)	axolemma (GO:0030673)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extrinsic component of membrane (GO:0019898)|juxtaparanode region of axon (GO:0044224)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)	structural constituent of cytoskeleton (GO:0005200)	p.A882E(1)		breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(24)|lung(52)|ovary(5)|prostate(4)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	105						TGCGGGCTGTGCTGCAGCATC	0.612																																					p.A882E		Atlas-SNP	.											EPB41L3,NS,carcinoma,0,1	EPB41L3	222	.	1	Substitution - Missense(1)	lung(1)	c.C2645A						.						89.0	77.0	81.0					18																	5397253		2203	4300	6503	SO:0001583	missense	23136	exon18			GGCTGTGCTGCAG	AB023204	CCDS11838.1, CCDS62381.1, CCDS62382.1	18p11.32	2006-06-28			ENSG00000082397	ENSG00000082397			3380	protein-coding gene	gene with protein product		605331				9828140, 9892180	Standard	NM_012307		Approved	DAL1, KIAA0987, 4.1B	uc002kmt.1	Q9Y2J2	OTTHUMG00000131562	ENST00000341928.2:c.2645C>A	chr18.hg19:g.5397253G>T	ENSP00000343158:p.Ala882Glu	90.0	0.0		81.0	24.0	NM_012307	B7Z4I5|F5GX05|O95713|Q9BRP5	Missense_Mutation	SNP	ENST00000341928.2	hg19	CCDS11838.1	.	.	.	.	.	.	.	.	.	.	G	3.284	-0.146491	0.06627	.	.	ENSG00000082397	ENST00000341928;ENST00000540638;ENST00000544123;ENST00000545076;ENST00000427684;ENST00000542146;ENST00000342933;ENST00000400111	T;T;T;T;T;T	0.45668	0.89;0.89;0.89;0.89;0.89;0.89	5.73	1.82	0.25136	.	2.044370	0.01726	N	0.028594	T	0.28267	0.0698	N	0.17474	0.49	0.09310	N	1	B;P;B;B;B;B;B;B	0.35433	0.0;0.501;0.0;0.001;0.0;0.001;0.0;0.002	B;B;B;B;B;B;B;B	0.35550	0.003;0.205;0.007;0.003;0.001;0.005;0.003;0.002	T	0.16247	-1.0409	10	0.19147	T	0.46	.	6.0818	0.19944	0.0927:0.1145:0.6684:0.1245	.	713;179;187;274;551;660;882;117	F5GX05;E7EUF8;F5H7W5;B7Z8M8;A8K968;Q9Y2J2-2;Q9Y2J2;B3KT50	.;.;.;.;.;.;E41L3_HUMAN;.	E	882;551;713;551;179;187;882;660	ENSP00000343158:A882E;ENSP00000441174:A713E;ENSP00000392195:A179E;ENSP00000442233:A187E;ENSP00000341138:A882E;ENSP00000382981:A660E	ENSP00000343158:A882E	A	-	2	0	EPB41L3	5387253	0.010000	0.17322	0.000000	0.03702	0.044000	0.14063	1.103000	0.31062	0.040000	0.15660	0.591000	0.81541	GCA	.	.		0.612	EPB41L3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254424.1	NM_012307	
IMPA2	3613	hgsc.bcm.edu	37	18	12009936	12009936	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr18:12009936C>A	ENST00000269159.3	+	3	527	c.285C>A	c.(283-285)agC>agA	p.S95R	IMPA2_ENST00000588752.1_3'UTR|IMPA2_ENST00000589238.1_5'UTR|IMPA2_ENST00000588927.1_5'UTR	NM_014214.2	NP_055029.1	O14732	IMPA2_HUMAN	inositol(myo)-1(or 4)-monophosphatase 2	95					inositol biosynthetic process (GO:0006021)|inositol phosphate dephosphorylation (GO:0046855)|inositol phosphate metabolic process (GO:0043647)|phosphate-containing compound metabolic process (GO:0006796)|phosphatidylinositol phosphorylation (GO:0046854)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	inositol monophosphate 1-phosphatase activity (GO:0008934)|inositol monophosphate 3-phosphatase activity (GO:0052832)|inositol monophosphate 4-phosphatase activity (GO:0052833)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)			NS(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(1)|skin(2)|stomach(2)|urinary_tract(1)	12					Lithium(DB01356)	TCACCCACAGCCCGACGTGGA	0.572																																					p.S95R		Atlas-SNP	.											.	IMPA2	27	.	0			c.C285A						.						120.0	117.0	118.0					18																	12009936		2203	4300	6503	SO:0001583	missense	3613	exon3			CCACAGCCCGACG	AF014398	CCDS11855.1	18p11.2	2008-03-18			ENSG00000141401	ENSG00000141401	3.1.3.25		6051	protein-coding gene	gene with protein product		605922				9322233	Standard	NM_014214		Approved		uc002kqp.2	O14732	OTTHUMG00000131693	ENST00000269159.3:c.285C>A	chr18.hg19:g.12009936C>A	ENSP00000269159:p.Ser95Arg	101.0	0.0		92.0	42.0	NM_014214	B0YJ29|Q9UJT3	Missense_Mutation	SNP	ENST00000269159.3	hg19	CCDS11855.1	.	.	.	.	.	.	.	.	.	.	C	12.99	2.102921	0.37145	.	.	ENSG00000141401	ENST00000269159	T	0.42513	0.97	5.48	4.61	0.57282	.	0.240021	0.47093	D	0.000245	T	0.30665	0.0772	N	0.25825	0.765	0.80722	D	1	B	0.21225	0.053	B	0.21546	0.035	T	0.10800	-1.0614	10	0.62326	D	0.03	-8.4541	10.1515	0.42796	0.0:0.8377:0.0:0.1623	.	95	O14732	IMPA2_HUMAN	R	95	ENSP00000269159:S95R	ENSP00000269159:S95R	S	+	3	2	IMPA2	11999936	0.997000	0.39634	0.996000	0.52242	0.733000	0.41908	0.309000	0.19332	1.314000	0.45095	0.491000	0.48974	AGC	.	.		0.572	IMPA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254601.1		
CEP192	55125	hgsc.bcm.edu	37	18	13113583	13113583	+	Splice_Site	SNP	A	A	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr18:13113583A>T	ENST00000325971.8	+	39	6852		c.e39-1		CEP192_ENST00000506447.1_Splice_Site|CEP192_ENST00000430049.2_Splice_Site|CEP192_ENST00000540847.2_Splice_Site			Q8TEP8	CE192_HUMAN	centrosomal protein 192kDa						centrosome duplication (GO:0051298)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|negative regulation of phosphatase activity (GO:0010923)|spindle assembly (GO:0051225)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)	phosphatase binding (GO:0019902)			NS(1)|breast(4)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(12)|lung(36)|ovary(4)|pancreas(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	71						TGTATTTCGTAGGTCTCCATC	0.398																																					.		Atlas-SNP	.											.	CEP192	340	.	0			c.7048-2A>T						.						112.0	112.0	112.0					18																	13113583		2203	4300	6503	SO:0001630	splice_region_variant	55125	exon41			TTTCGTAGGTCTC	AK074074	CCDS32792.1, CCDS32792.2	18p11.21	2014-02-20				ENSG00000101639		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	25515	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 62"""					11230166, 14654843	Standard	NM_032142		Approved	KIAA1569, FLJ10352, PPP1R62	uc010xac.2	Q8TEP8		ENST00000325971.8:c.5260-1A>T	chr18.hg19:g.13113583A>T		62.0	0.0		70.0	32.0	NM_032142	A0A060A9S4|E9PF99|Q8WYT8|Q9H0F4|Q9NW27	Splice_Site	SNP	ENST00000325971.8	hg19		.	.	.	.	.	.	.	.	.	.	A	19.81	3.897005	0.72639	.	.	ENSG00000101639	ENST00000506447;ENST00000325971;ENST00000399863;ENST00000430049;ENST00000540847	.	.	.	5.52	5.52	0.82312	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.3039	0.73976	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	CEP192	13103583	1.000000	0.71417	0.994000	0.49952	0.868000	0.49771	7.407000	0.80029	2.084000	0.62774	0.460000	0.39030	.	.	.		0.398	CEP192-201	KNOWN	basic	protein_coding	protein_coding		NM_032142	Intron
MC5R	4161	hgsc.bcm.edu	37	18	13826194	13826194	+	Missense_Mutation	SNP	A	A	C			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr18:13826194A>C	ENST00000324750.3	+	1	652	c.430A>C	c.(430-432)Atc>Ctc	p.I144L	AP001525.1_ENST00000390194.2_RNA	NM_005913.2	NP_005904.1	P33032	MC5R_HUMAN	melanocortin 5 receptor	144					G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|positive regulation of cAMP biosynthetic process (GO:0030819)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	hormone binding (GO:0042562)|melanocortin receptor activity (GO:0004977)			NS(1)|breast(2)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(23)|ovary(4)|upper_aerodigestive_tract(1)	41						GTACGTCACCATCTTCTACGC	0.567																																					p.I144L		Atlas-SNP	.											.	MC5R	83	.	0			c.A430C						.						149.0	129.0	136.0					18																	13826194		2203	4300	6503	SO:0001583	missense	4161	exon1			GTCACCATCTTCT	AY268429	CCDS11868.1	18p11.2	2012-08-10			ENSG00000176136	ENSG00000176136		"""GPCR / Class A : Melanocortin receptors"""	6933	protein-coding gene	gene with protein product		600042				8396929	Standard	NM_005913		Approved		uc010xaf.2	P33032	OTTHUMG00000131720	ENST00000324750.3:c.430A>C	chr18.hg19:g.13826194A>C	ENSP00000318077:p.Ile144Leu	105.0	0.0		84.0	32.0	NM_005913	B0YJ34|Q502V1	Missense_Mutation	SNP	ENST00000324750.3	hg19	CCDS11868.1	.	.	.	.	.	.	.	.	.	.	A	16.04	3.009062	0.54361	.	.	ENSG00000176136	ENST00000324750	T	0.81078	-1.45	5.01	5.01	0.66863	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	D	0.91499	0.7316	M	0.92833	3.35	0.80722	D	1	D	0.71674	0.998	D	0.80764	0.994	D	0.93422	0.6778	10	0.87932	D	0	.	13.8852	0.63704	1.0:0.0:0.0:0.0	.	144	P33032	MC5R_HUMAN	L	144	ENSP00000318077:I144L	ENSP00000318077:I144L	I	+	1	0	MC5R	13816194	1.000000	0.71417	1.000000	0.80357	0.369000	0.29798	7.068000	0.76748	1.873000	0.54277	0.374000	0.22700	ATC	.	.		0.567	MC5R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254638.1	NM_005913	
HRH4	59340	hgsc.bcm.edu	37	18	22057255	22057255	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr18:22057255T>C	ENST00000256906.4	+	3	1002	c.902T>C	c.(901-903)tTa>tCa	p.L301S	HRH4_ENST00000426880.2_Missense_Mutation_p.L213S	NM_001160166.1|NM_021624.3	NP_001153638.1|NP_067637.2	Q9H3N8	HRH4_HUMAN	histamine receptor H4	301					inflammatory response (GO:0006954)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of MAPK cascade (GO:0043408)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	histamine receptor activity (GO:0004969)			endometrium(2)|kidney(1)|large_intestine(4)|lung(10)|ovary(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22	all_cancers(21;0.000545)|all_epithelial(16;6.56e-06)|Lung NSC(20;0.0027)|all_lung(20;0.0085)|Colorectal(14;0.0361)|Ovarian(20;0.0991)				Amitriptyline(DB00321)|Amoxapine(DB00543)|Chlorpromazine(DB00477)|Clozapine(DB00363)|Doxepin(DB01142)|Histamine Phosphate(DB00667)|Loxapine(DB00408)|Mianserin(DB06148)|Olanzapine(DB00334)	GCCAGGAGATTAGCCAAGTCA	0.428																																					p.L301S		Atlas-SNP	.											.	HRH4	46	.	0			c.T902C						.						199.0	197.0	198.0					18																	22057255		2203	4300	6503	SO:0001583	missense	59340	exon3			GGAGATTAGCCAA	AF312230	CCDS11887.1, CCDS45841.1	18q11.2	2012-08-08			ENSG00000134489	ENSG00000134489		"""GPCR / Class A : Histamine receptors"""	17383	protein-coding gene	gene with protein product		606792				11118334, 10973974	Standard	NM_021624		Approved	H4R, HH4R, AXOR35, GPCR105, GPRv53	uc002kvi.3	Q9H3N8	OTTHUMG00000131945	ENST00000256906.4:c.902T>C	chr18.hg19:g.22057255T>C	ENSP00000256906:p.Leu301Ser	172.0	0.0		142.0	55.0	NM_021624	B0YJ19|B2KJ48|Q4G0I6|Q9GZQ0	Missense_Mutation	SNP	ENST00000256906.4	hg19	CCDS11887.1	.	.	.	.	.	.	.	.	.	.	T	24.7	4.557582	0.86231	.	.	ENSG00000134489	ENST00000256906;ENST00000426880	T;T	0.39406	1.08;1.08	5.78	5.78	0.91487	GPCR, rhodopsin-like superfamily (1);	0.316936	0.29205	N	0.012837	T	0.60130	0.2245	L	0.53617	1.68	0.42626	D	0.993365	D;P	0.76494	0.999;0.943	D;P	0.75020	0.985;0.867	T	0.62651	-0.6809	10	0.66056	D	0.02	-18.0601	15.3026	0.73966	0.0:0.0:0.0:1.0	.	213;301	B2KJ48;Q9H3N8	.;HRH4_HUMAN	S	301;213	ENSP00000256906:L301S;ENSP00000402526:L213S	ENSP00000256906:L301S	L	+	2	0	HRH4	20311253	0.996000	0.38824	0.984000	0.44739	0.842000	0.47809	6.176000	0.71955	2.208000	0.71279	0.528000	0.53228	TTA	.	.		0.428	HRH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254904.1		
KCTD1	284252	hgsc.bcm.edu	37	18	24126984	24126984	+	5'UTR	SNP	T	T	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr18:24126984T>A	ENST00000580059.1	-	0	98				KCTD1_ENST00000417602.1_Missense_Mutation_p.Q506L|KCTD1_ENST00000317932.7_Intron|KCTD1_ENST00000408011.3_Intron|KCTD1_ENST00000579973.1_Intron			Q719H9	KCTD1_HUMAN	potassium channel tetramerization domain containing 1						negative regulation of transcription, DNA-templated (GO:0045892)|protein homooligomerization (GO:0051260)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)			endometrium(2)|large_intestine(3)|lung(3)|ovary(1)|prostate(3)	12	all_cancers(21;0.00191)|Lung NSC(5;0.000698)|all_lung(6;0.0019)|Ovarian(20;0.0848)		Epithelial(2;7.8e-06)|OV - Ovarian serous cystadenocarcinoma(3;9.02e-06)|all cancers(3;3.37e-05)			CGAGGGCGGCTGGGGGCGGTG	0.711																																					p.Q506L		Atlas-SNP	.											.	KCTD1	76	.	0			c.A1517T						.						3.0	3.0	3.0					18																	24126984		625	1460	2085	SO:0001623	5_prime_UTR_variant	284252	exon1			GGCGGCTGGGGGC	AF542549	CCDS11888.1	18q11.2	2013-09-20	2013-06-20		ENSG00000134504	ENSG00000134504			18249	protein-coding gene	gene with protein product		613420	"""potassium channel tetramerisation domain containing 1"""	C18orf5			Standard	NM_001142730		Approved		uc010xbj.3	Q719H9	OTTHUMG00000131947	ENST00000580059.1:c.-308A>T	chr18.hg19:g.24126984T>A		26.0	0.0		26.0	15.0	NM_001142730	A8K1F5	Missense_Mutation	SNP	ENST00000580059.1	hg19	CCDS11888.1	.	.	.	.	.	.	.	.	.	.	T	10.74	1.436339	0.25813	.	.	ENSG00000134504	ENST00000417602	T	0.78924	-1.22	5.13	2.66	0.31614	.	.	.	.	.	T	0.78342	0.4268	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.75918	-0.3148	6	0.62326	D	0.03	.	5.4448	0.16529	0.0:0.0948:0.3863:0.5189	.	.	.	.	L	506	ENSP00000408405:Q506L	ENSP00000408405:Q506L	Q	-	2	0	KCTD1	22380982	0.170000	0.23016	1.000000	0.80357	0.996000	0.88848	0.893000	0.28336	0.735000	0.32537	0.374000	0.22700	CAG	.	.		0.711	KCTD1-005	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000446266.1	XM_209091	
MEP1B	4225	hgsc.bcm.edu	37	18	29793483	29793483	+	Missense_Mutation	SNP	A	A	C			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr18:29793483A>C	ENST00000269202.6	+	11	1587	c.1540A>C	c.(1540-1542)Aat>Cat	p.N514H	MEP1B_ENST00000581447.1_Missense_Mutation_p.N514H	NM_005925.2	NP_005916.2	Q16820	MEP1B_HUMAN	meprin A, beta	514	MATH. {ECO:0000255|PROSITE- ProRule:PRU00129}.				digestion (GO:0007586)|inflammatory response (GO:0006954)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			cervix(1)|endometrium(1)|kidney(2)|large_intestine(6)|lung(9)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	23						GCGTATGTCCAATCAGCGGAG	0.418																																					p.N514H		Atlas-SNP	.											.	MEP1B	54	.	0			c.A1540C						.						78.0	73.0	74.0					18																	29793483		1920	4130	6050	SO:0001583	missense	4225	exon11			ATGTCCAATCAGC	X81333	CCDS45846.1	18q12.2-q12.3	2003-12-17				ENSG00000141434	3.4.24.18		7020	protein-coding gene	gene with protein product		600389				7774936	Standard	NM_005925		Approved		uc002kxj.4	Q16820		ENST00000269202.6:c.1540A>C	chr18.hg19:g.29793483A>C	ENSP00000269202:p.Asn514His	89.0	0.0		89.0	35.0	NM_005925	B7ZM35|B9EGL6|Q670J1	Missense_Mutation	SNP	ENST00000269202.6	hg19	CCDS45846.1	.	.	.	.	.	.	.	.	.	.	A	15.13	2.740691	0.49045	.	.	ENSG00000141434	ENST00000269202	T	0.20463	2.07	5.53	5.53	0.82687	TRAF-type (1);TRAF-like (1);MATH (3);	0.040424	0.85682	D	0.000000	T	0.36744	0.0978	M	0.74881	2.28	0.47009	D	0.999282	B	0.30563	0.285	B	0.42625	0.393	T	0.14254	-1.0479	10	0.40728	T	0.16	-11.6089	15.6384	0.76973	1.0:0.0:0.0:0.0	.	514	Q16820	MEP1B_HUMAN	H	514	ENSP00000269202:N514H	ENSP00000269202:N514H	N	+	1	0	MEP1B	28047481	1.000000	0.71417	1.000000	0.80357	0.938000	0.57974	6.999000	0.76283	2.102000	0.63906	0.383000	0.25322	AAT	.	.		0.418	MEP1B-001	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000447755.1	NM_005925	
CCDC178	374864	hgsc.bcm.edu	37	18	30554635	30554635	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr18:30554635A>T	ENST00000383096.3	-	22	2581	c.2399T>A	c.(2398-2400)cTg>cAg	p.L800Q	CCDC178_ENST00000406524.2_Missense_Mutation_p.L824Q|CCDC178_ENST00000583930.1_Missense_Mutation_p.L824Q|CCDC178_ENST00000403303.1_Missense_Mutation_p.L800Q|CCDC178_ENST00000402325.1_Missense_Mutation_p.L750Q|CCDC178_ENST00000579947.1_Missense_Mutation_p.L800Q|CCDC178_ENST00000300227.8_Missense_Mutation_p.L762Q|CCDC178_ENST00000579916.1_Missense_Mutation_p.L120Q|CCDC178_ENST00000581852.1_Missense_Mutation_p.L5Q			Q5BJE1	CC178_HUMAN	coiled-coil domain containing 178	800																	CCTTCTCTGCAGCTGACAGAG	0.498																																					p.L800Q		Atlas-SNP	.											.	.	.	.	0			c.T2399A						.						48.0	43.0	45.0					18																	30554635		2203	4300	6503	SO:0001583	missense	374864	exon21			CTCTGCAGCTGAC	AK126038	CCDS11906.1, CCDS42424.1	18q12.1	2012-10-15	2012-10-15	2012-10-15	ENSG00000166960	ENSG00000166960			29588	protein-coding gene	gene with protein product			"""chromosome 18 open reading frame 34"""	C18orf34			Standard	NM_198995		Approved	FLJ44050	uc002kxn.2	Q5BJE1	OTTHUMG00000132279	ENST00000383096.3:c.2399T>A	chr18.hg19:g.30554635A>T	ENSP00000372576:p.Leu800Gln	48.0	0.0		43.0	15.0	NM_001105528	A6NDC6|J3KS92|Q6ZP67|Q6ZU20	Missense_Mutation	SNP	ENST00000383096.3	hg19	CCDS42424.1	.	.	.	.	.	.	.	.	.	.	A	9.820	1.185447	0.21870	.	.	ENSG00000166960	ENST00000403303;ENST00000383096;ENST00000300227;ENST00000406524;ENST00000402325	T;T;T;T;T	0.51817	0.69;0.69;0.83;0.91;1.78	5.59	5.59	0.84812	.	.	.	.	.	T	0.62258	0.2413	L	0.43152	1.355	0.47308	D	0.999388	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	1.0;0.999;1.0;0.999;0.999;0.999	T	0.64943	-0.6288	9	0.72032	D	0.01	-7.2632	15.7575	0.78046	1.0:0.0:0.0:0.0	.	824;800;750;800;762;800	F8W7A7;A1L4G8;Q5BJE1-3;B5MD75;Q5BJE1-2;Q5BJE1	.;.;.;.;.;CR034_HUMAN	Q	800;800;762;824;750	ENSP00000385591:L800Q;ENSP00000372576:L800Q;ENSP00000300227:L762Q;ENSP00000385867:L824Q;ENSP00000385234:L750Q	ENSP00000300227:L762Q	L	-	2	0	C18orf34	28808633	1.000000	0.71417	1.000000	0.80357	0.684000	0.39900	5.639000	0.67868	2.118000	0.64928	0.460000	0.39030	CTG	.	.		0.498	CCDC178-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255373.2	NM_198995	
DCC	1630	hgsc.bcm.edu	37	18	50923756	50923756	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr18:50923756A>T	ENST00000442544.2	+	18	3383	c.2767A>T	c.(2767-2769)Aca>Tca	p.T923S	DCC_ENST00000581580.1_Missense_Mutation_p.T558S|DCC_ENST00000412726.1_Missense_Mutation_p.T751S	NM_005215.3	NP_005206.2	P43146	DCC_HUMAN	DCC netrin 1 receptor	923	Fibronectin type-III 5. {ECO:0000255|PROSITE-ProRule:PRU00316}.				anterior/posterior axon guidance (GO:0033564)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|axonogenesis (GO:0007409)|dorsal/ventral axon guidance (GO:0033563)|negative regulation of collateral sprouting (GO:0048671)|negative regulation of dendrite development (GO:2000171)|negative regulation of neuron projection development (GO:0010977)|neuron migration (GO:0001764)|positive regulation of apoptotic process (GO:0043065)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of neuron projection development (GO:0010976)|regulation of apoptotic process (GO:0042981)|response to amphetamine (GO:0001975)|spinal cord ventral commissure morphogenesis (GO:0021965)	axon (GO:0030424)|cytosol (GO:0005829)|growth cone membrane (GO:0032584)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	netrin receptor activity (GO:0005042)|transcription coactivator activity (GO:0003713)|transmembrane signaling receptor activity (GO:0004888)			NS(3)|breast(2)|central_nervous_system(1)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(23)|liver(1)|lung(56)|ovary(7)|pancreas(3)|prostate(2)|skin(16)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(6)	148		all_cancers(7;0.11)|all_epithelial(6;0.00126)		Colorectal(16;0.0251)|COAD - Colon adenocarcinoma(17;0.0942)		GGTCATGGTAACAAAAAACAG	0.418																																					p.T923S		Atlas-SNP	.											.	DCC	360	.	0			c.A2767T						.						123.0	105.0	111.0					18																	50923756		2203	4300	6503	SO:0001583	missense	1630	exon18			ATGGTAACAAAAA	X76132	CCDS11952.1	18q21.1	2014-06-20	2014-06-20		ENSG00000187323	ENSG00000187323		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2701	protein-coding gene	gene with protein product	"""immunoglobulin superfamily, DCC subclass, member 1"""	120470	"""deleted in colorectal carcinoma"""			2294591, 24400119	Standard	NM_005215		Approved	IGDCC1, NTN1R1	uc002lfe.2	P43146	OTTHUMG00000132698	ENST00000442544.2:c.2767A>T	chr18.hg19:g.50923756A>T	ENSP00000389140:p.Thr923Ser	184.0	0.0		145.0	60.0	NM_005215		Missense_Mutation	SNP	ENST00000442544.2	hg19	CCDS11952.1	.	.	.	.	.	.	.	.	.	.	A	15.23	2.772607	0.49680	.	.	ENSG00000187323	ENST00000442544;ENST00000412726	T;T	0.56941	0.43;0.43	5.8	5.8	0.92144	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.63212	0.2492	L	0.49778	1.585	0.47862	D	0.999539	P;P;D	0.64830	0.462;0.462;0.994	P;P;D	0.67900	0.464;0.464;0.954	T	0.57608	-0.7782	10	0.11794	T	0.64	.	15.1301	0.72517	1.0:0.0:0.0:0.0	.	751;751;923	E7EQM8;B4DYX2;P43146	.;.;DCC_HUMAN	S	923;751	ENSP00000389140:T923S;ENSP00000397322:T751S	ENSP00000397322:T751S	T	+	1	0	DCC	49177754	1.000000	0.71417	0.458000	0.27068	0.877000	0.50540	9.220000	0.95180	2.213000	0.71641	0.528000	0.53228	ACA	.	.		0.418	DCC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255996.3	NM_005215	
TCF4	6925	hgsc.bcm.edu	37	18	53303052	53303052	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr18:53303052T>A	ENST00000398339.1	-	1	133	c.77A>T	c.(76-78)tAc>tTc	p.Y26F		NM_001243226.1	NP_001230155.1	P15884	ITF2_HUMAN	transcription factor 4	0	Essential for MYOD1 inhibition. {ECO:0000250}.				DNA-templated transcription, initiation (GO:0006352)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein-DNA complex assembly (GO:0065004)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|E-box binding (GO:0070888)|protein C-terminus binding (GO:0008022)|protein heterodimerization activity (GO:0046982)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding RNA polymerase recruiting transcription factor activity (GO:0001011)|sequence-specific DNA binding transcription factor activity (GO:0003700)|TFIIB-class binding transcription factor activity (GO:0001087)|TFIIB-class transcription factor binding (GO:0001093)			breast(1)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(15)|ovary(1)|prostate(1)|skin(5)|urinary_tract(1)	41				Colorectal(16;0.00108)|READ - Rectum adenocarcinoma(59;0.0649)|COAD - Colon adenocarcinoma(17;0.0718)		CATCTTTGAGTAATTTGTCAA	0.423																																					p.Y26F		Atlas-SNP	.											.	TCF4	178	.	0			c.A77T						.						9.0	7.0	7.0					18																	53303052		864	1972	2836	SO:0001583	missense	6925	exon1			TTTGAGTAATTTG	M74719	CCDS11960.1, CCDS42438.1, CCDS58623.1, CCDS58624.1, CCDS58625.1, CCDS58626.1, CCDS58627.1, CCDS58628.1, CCDS58629.1, CCDS58630.1, CCDS58631.1, CCDS59321.1	18q21.1	2013-05-21			ENSG00000196628	ENSG00000196628		"""Basic helix-loop-helix proteins"""	11634	protein-coding gene	gene with protein product		602272				9302263, 2308860	Standard	NM_001083962		Approved	SEF2-1B, ITF2, bHLHb19, E2-2	uc002lga.3	P15884	OTTHUMG00000132713	ENST00000398339.1:c.77A>T	chr18.hg19:g.53303052T>A	ENSP00000381382:p.Tyr26Phe	120.0	0.0		116.0	40.0	NM_001243226	B3KT62|B3KUC0|B4DT37|B4DUG3|B7Z5M6|B7Z6Y1|G0LNT9|G0LNU0|G0LNU1|G0LNU2|G0LNU4|G0LNU5|G0LNU8|G0LNU9|G0LNV0|G0LNV1|G0LNV2|H3BPQ1|Q08AP2|Q08AP3|Q15439|Q15440|Q15441	Missense_Mutation	SNP	ENST00000398339.1	hg19	CCDS58631.1	.	.	.	.	.	.	.	.	.	.	T	8.978	0.974721	0.18736	.	.	ENSG00000196628	ENST00000398339	T	0.29917	1.55	1.91	-0.7	0.11273	.	.	.	.	.	T	0.18800	0.0451	.	.	.	0.09310	N	1	B	0.14805	0.011	B	0.09377	0.004	T	0.28459	-1.0043	8	0.87932	D	0	.	2.2914	0.04139	0.0:0.2126:0.3118:0.4757	.	26	E9PH57	.	F	26	ENSP00000381382:Y26F	ENSP00000381382:Y26F	Y	-	2	0	TCF4	51454050	0.791000	0.28800	0.000000	0.03702	0.028000	0.11728	0.886000	0.28241	-0.161000	0.10983	-0.622000	0.04023	TAC	.	.		0.423	TCF4-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256013.1	NM_003199	
ADNP2	22850	hgsc.bcm.edu	37	18	77896097	77896097	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr18:77896097A>G	ENST00000262198.4	+	4	3256	c.2801A>G	c.(2800-2802)cAt>cGt	p.H934R		NM_014913.3	NP_055728.1	Q6IQ32	ADNP2_HUMAN	ADNP homeobox 2	934					cellular response to oxidative stress (GO:0034599)|cellular response to retinoic acid (GO:0071300)|negative regulation of cell death (GO:0060548)|neuron differentiation (GO:0030182)|positive regulation of cell growth (GO:0030307)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(9)|liver(1)|lung(15)|ovary(5)|prostate(2)	42		all_cancers(4;1.06e-15)|all_epithelial(4;2.36e-10)|all_lung(4;0.000302)|Lung NSC(4;0.000518)|Esophageal squamous(42;0.0212)|Ovarian(4;0.0256)|all_hematologic(56;0.15)|Melanoma(33;0.2)		Epithelial(2;1.1e-11)|OV - Ovarian serous cystadenocarcinoma(15;7.54e-09)|BRCA - Breast invasive adenocarcinoma(31;0.00247)|STAD - Stomach adenocarcinoma(84;0.164)		ATCGCCGTCCATTTGGTGCGC	0.562																																					p.H934R		Atlas-SNP	.											.	ADNP2	102	.	0			c.A2801G						.						88.0	86.0	87.0					18																	77896097		2202	4298	6500	SO:0001583	missense	22850	exon4			CCGTCCATTTGGT	AB020670	CCDS32853.1	18q23	2013-01-07	2007-07-17	2007-07-17	ENSG00000101544	ENSG00000101544		"""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	23803	protein-coding gene	gene with protein product			"""zinc finger protein 508"""	ZNF508			Standard	NM_014913		Approved	KIAA0863	uc002lnw.3	Q6IQ32	OTTHUMG00000172535	ENST00000262198.4:c.2801A>G	chr18.hg19:g.77896097A>G	ENSP00000262198:p.His934Arg	57.0	0.0		78.0	31.0	NM_014913	A8K951|O94943|Q9H9P3	Missense_Mutation	SNP	ENST00000262198.4	hg19	CCDS32853.1	.	.	.	.	.	.	.	.	.	.	A	15.33	2.802419	0.50315	.	.	ENSG00000101544	ENST00000262198	.	.	.	5.03	5.03	0.67393	.	0.000000	0.64402	D	0.000001	T	0.77445	0.4131	M	0.72894	2.215	0.58432	D	0.999997	D	0.89917	1.0	D	0.91635	0.999	T	0.78391	-0.2222	8	.	.	.	-27.7232	14.9181	0.70812	1.0:0.0:0.0:0.0	.	934	Q6IQ32	ADNP2_HUMAN	R	934	.	.	H	+	2	0	ADNP2	75997088	1.000000	0.71417	0.824000	0.32777	0.170000	0.22686	8.031000	0.88826	2.110000	0.64415	0.533000	0.62120	CAT	.	.		0.562	ADNP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418979.1	NM_014913	
DAZAP1	26528	hgsc.bcm.edu	37	19	1434882	1434882	+	Missense_Mutation	SNP	G	G	C			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr19:1434882G>C	ENST00000233078.4	+	12	1356	c.1195G>C	c.(1195-1197)Gtg>Ctg	p.V399L	DAZAP1_ENST00000336761.6_3'UTR	NM_018959.2	NP_061832.2	Q96EP5	DAZP1_HUMAN	DAZ associated protein 1	399					cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|maternal placenta development (GO:0001893)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|RNA stem-loop binding (GO:0035613)			breast(2)|endometrium(2)|large_intestine(1)|lung(3)|upper_aerodigestive_tract(1)	9		Acute lymphoblastic leukemia(61;3.02e-13)|all_hematologic(61;4.32e-09)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GAACCACAACGTGCAAGGGTT	0.682																																					p.V399L		Atlas-SNP	.											.	DAZAP1	52	.	0			c.G1195C						.						12.0	14.0	14.0					19																	1434882		2179	4254	6433	SO:0001583	missense	26528	exon12			CACAACGTGCAAG		CCDS12065.1, CCDS12066.1	19p13.3	2013-07-16			ENSG00000071626	ENSG00000071626		"""RNA binding motif (RRM) containing"""	2683	protein-coding gene	gene with protein product	"""deleted in azoospermia associated protein 1"""	607430				10857750, 23658607	Standard	XM_005259530		Approved	MGC19907	uc002lsn.3	Q96EP5		ENST00000233078.4:c.1195G>C	chr19.hg19:g.1434882G>C	ENSP00000233078:p.Val399Leu	96.0	0.0		80.0	29.0	NM_018959	Q96MJ3|Q9NRR9	Missense_Mutation	SNP	ENST00000233078.4	hg19	CCDS12065.1	.	.	.	.	.	.	.	.	.	.	G	22.3	4.269513	0.80469	.	.	ENSG00000071626	ENST00000233078	T	0.29917	1.55	5.26	5.26	0.73747	.	0.000000	0.85682	D	0.000000	T	0.43211	0.1237	L	0.27053	0.805	0.80722	D	1	P;P;D	0.53312	0.931;0.931;0.959	P;P;D	0.65987	0.872;0.872;0.94	T	0.33369	-0.9871	10	0.51188	T	0.08	.	17.8389	0.88709	0.0:0.0:1.0:0.0	.	466;399;165	Q5IRN4;Q96EP5;B3KS63	.;DAZP1_HUMAN;.	L	399	ENSP00000233078:V399L	ENSP00000233078:V399L	V	+	1	0	DAZAP1	1385882	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	9.039000	0.93777	2.454000	0.82982	0.561000	0.74099	GTG	.	.		0.682	DAZAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449522.3	NM_170711	
THOP1	7064	hgsc.bcm.edu	37	19	2810300	2810300	+	Splice_Site	SNP	A	A	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr19:2810300A>T	ENST00000307741.6	+	10	1658		c.e10-1		THOP1_ENST00000395212.4_De_novo_Start_OutOfFrame|THOP1_ENST00000586677.1_Splice_Site|THOP1_ENST00000591149.1_Splice_Site	NM_003249.3	NP_003240.1	P52888	THOP1_HUMAN	thimet oligopeptidase 1						intracellular signal transduction (GO:0035556)|peptide metabolic process (GO:0006518)	cytoplasm (GO:0005737)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)|peptide binding (GO:0042277)			NS(1)|central_nervous_system(1)|endometrium(1)|lung(8)|ovary(2)|skin(1)	14				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CCATCCCTGCAGGCGGAGTTC	0.677																																					.		Atlas-SNP	.											.	THOP1	49	.	0			c.1456-2A>T						.						34.0	35.0	35.0					19																	2810300		2196	4299	6495	SO:0001630	splice_region_variant	7064	exon10			CCCTGCAGGCGGA		CCDS12095.1	19p13.3	2008-02-05				ENSG00000172009	3.4.24.15		11793	protein-coding gene	gene with protein product		601117				9790774	Standard	NM_003249		Approved		uc002lwj.3	P52888		ENST00000307741.6:c.1456-1A>T	chr19.hg19:g.2810300A>T		61.0	0.0		45.0	19.0	NM_003249	B3KSE2|Q9UCB3	Splice_Site	SNP	ENST00000307741.6	hg19	CCDS12095.1	.	.	.	.	.	.	.	.	.	.	A	11.40	1.627522	0.28978	.	.	ENSG00000172009	ENST00000307741	.	.	.	4.4	4.4	0.53042	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.4333	0.55584	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	THOP1	2761300	1.000000	0.71417	0.980000	0.43619	0.084000	0.17831	8.610000	0.90902	1.615000	0.50252	0.260000	0.18958	.	.	.		0.677	THOP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451587.2		Intron
PLIN4	729359	hgsc.bcm.edu	37	19	4510630	4510630	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr19:4510630C>A	ENST00000301286.3	-	3	3299	c.3300G>T	c.(3298-3300)aaG>aaT	p.K1100N		NM_001080400.1	NP_001073869.1	Q96Q06	PLIN4_HUMAN	perilipin 4	1100						cytoplasm (GO:0005737)|lipid particle (GO:0005811)|plasma membrane (GO:0005886)				NS(2)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(14)|ovary(1)|skin(2)|soft_tissue(1)|stomach(2)	41						TCGCAAGGCCCTTGGTAGTGG	0.692																																					p.K1100N		Atlas-SNP	.											.	PLIN4	191	.	0			c.G3300T						.						22.0	26.0	24.0					19																	4510630		2148	4244	6392	SO:0001583	missense	729359	exon3			AAGGCCCTTGGTA	AB067468	CCDS45927.1	19p13.3	2009-10-06	2009-08-12	2009-08-12	ENSG00000167676	ENSG00000167676		"""Perilipins"""	29393	protein-coding gene	gene with protein product		613247	"""KIAA1881"""	KIAA1881		11572484, 19638644	Standard	NM_001080400		Approved	S3-12	uc002mar.1	Q96Q06	OTTHUMG00000167571	ENST00000301286.3:c.3300G>T	chr19.hg19:g.4510630C>A	ENSP00000301286:p.Lys1100Asn	65.0	0.0		63.0	30.0	NM_001080400	A6NEI2	Missense_Mutation	SNP	ENST00000301286.3	hg19	CCDS45927.1	.	.	.	.	.	.	.	.	.	.	c	9.306	1.054457	0.19907	.	.	ENSG00000167676	ENST00000301286	T	0.04862	3.54	3.6	0.916	0.19373	.	0.604873	0.12274	U	0.483576	T	0.03178	0.0093	N	0.19112	0.55	0.09310	N	1	P	0.38978	0.652	B	0.27887	0.084	T	0.42068	-0.9473	10	0.51188	T	0.08	0.2631	5.0018	0.14268	0.0:0.5713:0.0:0.4287	.	1100	Q96Q06	PLIN4_HUMAN	N	1100	ENSP00000301286:K1100N	ENSP00000301286:K1100N	K	-	3	2	PLIN4	4461630	0.012000	0.17670	0.000000	0.03702	0.003000	0.03518	0.810000	0.27183	-0.095000	0.12351	0.506000	0.49869	AAG	.	.		0.692	PLIN4-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395095.1	XM_170901	
ZNRF4	148066	hgsc.bcm.edu	37	19	5455751	5455751	+	Silent	SNP	C	C	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr19:5455751C>T	ENST00000222033.4	+	1	326	c.249C>T	c.(247-249)gtC>gtT	p.V83V		NM_181710.3	NP_859061.3	Q8WWF5	ZNRF4_HUMAN	zinc and ring finger 4	83						cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)	zinc ion binding (GO:0008270)			NS(1)|kidney(2)|large_intestine(5)|lung(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	16				UCEC - Uterine corpus endometrioid carcinoma (162;0.0002)		TCGTGGCAGTCAAAGCCTTGC	0.667																																					p.V83V		Atlas-SNP	.											.	ZNRF4	59	.	0			c.C249T						.						45.0	55.0	51.0					19																	5455751		2114	4203	6317	SO:0001819	synonymous_variant	148066	exon1			GGCAGTCAAAGCC	AK098722	CCDS42475.1	19p13.3	2013-01-09				ENSG00000105428		"""RING-type (C3HC4) zinc fingers"""	17726	protein-coding gene	gene with protein product		612063					Standard	NM_181710		Approved	spzn, Ssrzf1, RNF204	uc002mca.4	Q8WWF5		ENST00000222033.4:c.249C>T	chr19.hg19:g.5455751C>T		31.0	0.0		25.0	11.0	NM_181710	A8K886|O75866	Silent	SNP	ENST00000222033.4	hg19	CCDS42475.1																																																																																			.	.		0.667	ZNRF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450924.1	NM_181710	
CCL25	6370	hgsc.bcm.edu	37	19	8117950	8117950	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr19:8117950T>A	ENST00000390669.3	+	1	67	c.17T>A	c.(16-18)cTg>cAg	p.L6Q	CCL25_ENST00000315626.4_Missense_Mutation_p.L6Q|CCL25_ENST00000253451.4_Missense_Mutation_p.L6Q			O15444	CCL25_HUMAN	chemokine (C-C motif) ligand 25	6					cell chemotaxis (GO:0060326)|cell surface receptor signaling pathway (GO:0007166)|chemotaxis (GO:0006935)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|inflammatory response (GO:0006954)|leukocyte migration (GO:0050900)|negative regulation of leukocyte tethering or rolling (GO:1903237)|positive regulation of cell-matrix adhesion (GO:0001954)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	CCR10 chemokine receptor binding (GO:0031735)|chemokine activity (GO:0008009)|chemokine receptor binding (GO:0042379)|hormone activity (GO:0005179)			NS(1)|endometrium(1)|lung(1)|skin(1)|urinary_tract(1)	5						CTGTGGCTCCTGGCCTGCCTG	0.662																																					p.L6Q		Atlas-SNP	.											.	CCL25	12	.	0			c.T17A						.						7.0	12.0	10.0					19																	8117950		1818	3955	5773	SO:0001583	missense	6370	exon2			GGCTCCTGGCCTG	U86358	CCDS12194.1, CCDS56080.1	19p13.2	2013-02-25	2002-08-22	2002-08-23	ENSG00000131142	ENSG00000131142		"""Chemokine ligands"", ""Endogenous ligands"""	10624	protein-coding gene	gene with protein product	"""Ck beta-15"", ""thymus expressed chemokine"", ""TECKvar"""	602565	"""small inducible cytokine subfamily A (Cys-Cys), member 25"""	SCYA25		9285413, 9722960	Standard	NM_005624		Approved	TECK, Ckb15	uc002mjd.3	O15444	OTTHUMG00000141287	ENST00000390669.3:c.17T>A	chr19.hg19:g.8117950T>A	ENSP00000375086:p.Leu6Gln	71.0	0.0		46.0	22.0	NM_001201359	A1L4J4|A6NI52|A8K9E7|B5MCA5|Q96KJ7	Missense_Mutation	SNP	ENST00000390669.3	hg19	CCDS12194.1	.	.	.	.	.	.	.	.	.	.	T	17.57	3.423641	0.62733	.	.	ENSG00000131142	ENST00000253451;ENST00000315626;ENST00000390669	T;T;T	0.58506	1.93;0.33;1.91	3.72	2.69	0.31865	.	0.270670	0.30538	N	0.009401	T	0.62624	0.2443	L	0.42245	1.32	0.22666	N	0.998874	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.74023	0.98;0.981;0.982	T	0.50841	-0.8780	10	0.72032	D	0.01	-20.7157	5.9428	0.19201	0.0:0.1199:0.0:0.8801	.	6;6;6	C9JDZ7;O15444;A6NI52	.;CCL25_HUMAN;.	Q	6	ENSP00000253451:L6Q;ENSP00000324756:L6Q;ENSP00000375086:L6Q	ENSP00000253451:L6Q	L	+	2	0	CCL25	8023950	0.400000	0.25295	0.678000	0.29963	0.372000	0.29890	1.595000	0.36708	0.781000	0.33589	0.533000	0.62120	CTG	.	.		0.662	CCL25-003	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000280522.1	NM_005624	
MUC16	94025	hgsc.bcm.edu	37	19	9048117	9048117	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr19:9048117T>C	ENST00000397910.4	-	5	33717	c.33514A>G	c.(33514-33516)Att>Gtt	p.I11172V		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	11174	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						TCAGAAGAAATAGTCAGAGTT	0.448																																					p.I11172V		Atlas-SNP	.											.	MUC16	4315	.	0			c.A33514G						.						72.0	66.0	68.0					19																	9048117		1927	4131	6058	SO:0001583	missense	94025	exon5			AAGAAATAGTCAG	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.33514A>G	chr19.hg19:g.9048117T>C	ENSP00000381008:p.Ile11172Val	112.0	0.0		71.0	28.0	NM_024690	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	hg19	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	t	6.171	0.399806	0.11696	.	.	ENSG00000181143	ENST00000397910	T	0.02236	4.38	3.59	-6.02	0.02192	.	.	.	.	.	T	0.01765	0.0056	L	0.29908	0.895	.	.	.	B	0.16396	0.017	B	0.13407	0.009	T	0.46484	-0.9188	8	0.87932	D	0	.	5.5142	0.16898	0.0:0.2179:0.2804:0.5017	.	11172	B5ME49	.	V	11172	ENSP00000381008:I11172V	ENSP00000381008:I11172V	I	-	1	0	MUC16	8909117	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-5.046000	0.00156	-1.231000	0.02557	-0.373000	0.07131	ATT	.	.		0.448	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
RDH8	50700	hgsc.bcm.edu	37	19	10129508	10129508	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr19:10129508G>T	ENST00000171214.1	+	3	613	c.364G>T	c.(364-366)Gtc>Ttc	p.V122F	RDH8_ENST00000591589.1_Missense_Mutation_p.V142F	NM_015725.2	NP_056540.2	Q9NYR8	RDH8_HUMAN	retinol dehydrogenase 8 (all-trans)	122					estrogen biosynthetic process (GO:0006703)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|steroid biosynthetic process (GO:0006694)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)	estradiol 17-beta-dehydrogenase activity (GO:0004303)|NADP-retinol dehydrogenase activity (GO:0052650)|retinol dehydrogenase activity (GO:0004745)			endometrium(3)|large_intestine(3)|lung(10)|ovary(3)|pancreas(1)|prostate(1)	21			Epithelial(33;4.24e-05)		Vitamin A(DB00162)	TGTCCGTCTCGTCAAAGCTGT	0.597																																					p.V142F		Atlas-SNP	.											.	RDH8	51	.	0			c.G424T						.						95.0	91.0	92.0					19																	10129508		2203	4300	6503	SO:0001583	missense	50700	exon3			CGTCTCGTCAAAG	AF229845	CCDS12223.1, CCDS12223.2	19p13.2	2011-09-14				ENSG00000080511	1.1.1.-	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 2"""	14423	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 28C, member 2"""	608575				10753906, 19027726	Standard	NM_015725		Approved	PRRDH, SDR28C2	uc002mmr.4	Q9NYR8		ENST00000171214.1:c.364G>T	chr19.hg19:g.10129508G>T	ENSP00000171214:p.Val122Phe	81.0	0.0		77.0	25.0	NM_015725	Q9H838	Missense_Mutation	SNP	ENST00000171214.1	hg19		.	.	.	.	.	.	.	.	.	.	G	20.8	4.042827	0.75732	.	.	ENSG00000080511	ENST00000171214	D	0.87729	-2.29	5.34	4.29	0.51040	NAD(P)-binding domain (1);	0.123412	0.53938	D	0.000050	D	0.89594	0.6760	L	0.50333	1.59	0.38422	D	0.946217	D	0.59357	0.985	D	0.69479	0.964	D	0.90106	0.4188	10	0.72032	D	0.01	.	8.7599	0.34667	0.1741:0.0:0.8259:0.0	.	122	Q9NYR8	RDH8_HUMAN	F	122	ENSP00000171214:V122F	ENSP00000171214:V122F	V	+	1	0	RDH8	9990508	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	1.472000	0.35376	2.492000	0.84095	0.491000	0.48974	GTC	.	.		0.597	RDH8-201	KNOWN	basic|appris_principal	protein_coding	protein_coding			
ICAM5	7087	hgsc.bcm.edu	37	19	10404581	10404581	+	Missense_Mutation	SNP	G	G	T	rs147604357		TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr19:10404581G>T	ENST00000221980.4	+	7	1736	c.1673G>T	c.(1672-1674)cGg>cTg	p.R558L		NM_003259.3	NP_003250.3	Q9UMF0	ICAM5_HUMAN	intercellular adhesion molecule 5, telencephalin	558	Ig-like C2-type 6.				phagocytosis (GO:0006909)|single organismal cell-cell adhesion (GO:0016337)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)				breast(3)|endometrium(2)|kidney(1)|large_intestine(4)|lung(8)|prostate(2)|upper_aerodigestive_tract(1)	21			OV - Ovarian serous cystadenocarcinoma(20;2.64e-09)|Epithelial(33;4.31e-06)|all cancers(31;9.75e-06)			ACCAACCCTCGGGGCTCTGCG	0.652																																					p.R558L		Atlas-SNP	.											ICAM5,NS,carcinoma,0,1	ICAM5	53	.	0			c.G1673T						.						42.0	49.0	47.0					19																	10404581		2202	4300	6502	SO:0001583	missense	7087	exon7			ACCCTCGGGGCTC	U72671	CCDS12233.1	19p13.2	2013-01-14				ENSG00000105376		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5348	protein-coding gene	gene with protein product	"""telencephalin"""	601852		TLCN		8995416, 9828136	Standard	NM_003259		Approved	TLN	uc002mnu.4	Q9UMF0		ENST00000221980.4:c.1673G>T	chr19.hg19:g.10404581G>T	ENSP00000221980:p.Arg558Leu	52.0	0.0		41.0	19.0	NM_003259	Q9Y6F3	Missense_Mutation	SNP	ENST00000221980.4	hg19	CCDS12233.1	.	.	.	.	.	.	.	.	.	.	G	8.334	0.827139	0.16749	.	.	ENSG00000105376	ENST00000221980	T	0.13196	2.61	5.37	1.59	0.23543	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.627732	0.13598	N	0.376087	T	0.03608	0.0103	N	0.00630	-1.315	0.09310	N	1	B	0.28128	0.201	B	0.32149	0.141	T	0.42155	-0.9468	10	0.23891	T	0.37	-1.8771	4.8381	0.13474	0.1404:0.0:0.6901:0.1695	.	558	Q9UMF0	ICAM5_HUMAN	L	558	ENSP00000221980:R558L	ENSP00000221980:R558L	R	+	2	0	ICAM5	10265581	0.000000	0.05858	0.001000	0.08648	0.001000	0.01503	-1.409000	0.02483	0.486000	0.27676	0.448000	0.29417	CGG	.	G|1.000;A|0.000		0.652	ICAM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451217.1	NM_003259	
NANOS3	342977	hgsc.bcm.edu	37	19	13988465	13988465	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr19:13988465T>A	ENST00000397555.2	+	2	346	c.346T>A	c.(346-348)Tac>Aac	p.Y116N	NANOS3_ENST00000339133.5_Missense_Mutation_p.Y135N|MIR181C_ENST00000384881.1_RNA|MIR181D_ENST00000384853.1_RNA|NANOS3_ENST00000591727.1_Intron	NM_001098622.2	NP_001092092.1	P60323	NANO3_HUMAN	nanos homolog 3 (Drosophila)	116					germ cell development (GO:0007281)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic signaling pathway (GO:2001234)|oogenesis (GO:0048477)|regulation of cell cycle (GO:0051726)|regulation of translation (GO:0006417)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytoplasmic stress granule (GO:0010494)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			breast(1)|lung(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	7			OV - Ovarian serous cystadenocarcinoma(19;2e-21)			TGGCCAGGGCTACACCTCCGT	0.662																																					p.Y135N		Atlas-SNP	.											.	NANOS3	19	.	0			c.T403A						.						16.0	21.0	20.0					19																	13988465		2120	4219	6339	SO:0001583	missense	342977	exon1			CAGGGCTACACCT	BM702754	CCDS42511.1	19p13.13	2003-12-01				ENSG00000187556			22048	protein-coding gene	gene with protein product		608229					Standard	NM_001098622		Approved	NANOS1L, NOS3	uc002mxj.4	P60323		ENST00000397555.2:c.346T>A	chr19.hg19:g.13988465T>A	ENSP00000380687:p.Tyr116Asn	77.0	0.0		52.0	29.0	NM_001098622	Q495E5	Missense_Mutation	SNP	ENST00000397555.2	hg19		.	.	.	.	.	.	.	.	.	.	T	19.73	3.881759	0.72294	.	.	ENSG00000187556	ENST00000339133;ENST00000397555	T;T	0.46063	0.88;0.89	5.01	5.01	0.66863	.	0.000000	0.85682	D	0.000000	T	0.59878	0.2226	.	.	.	0.51012	D	0.9999	D	0.89917	1.0	D	0.91635	0.999	T	0.57271	-0.7840	9	0.29301	T	0.29	-3.6142	12.7228	0.57152	0.0:0.0:0.0:1.0	.	135	P60323-2	.	N	135;116	ENSP00000341992:Y135N;ENSP00000380687:Y116N	ENSP00000341992:Y135N	Y	+	1	0	NANOS3	13849465	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	6.808000	0.75206	2.119000	0.64992	0.533000	0.62120	TAC	.	.		0.662	NANOS3-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		XM_292819	
CC2D1A	54862	hgsc.bcm.edu	37	19	14029727	14029727	+	Missense_Mutation	SNP	G	G	T	rs369829647		TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr19:14029727G>T	ENST00000318003.7	+	10	1262	c.1021G>T	c.(1021-1023)Gtg>Ttg	p.V341L	CC2D1A_ENST00000589606.1_Missense_Mutation_p.V341L	NM_017721.4	NP_060191.3	Q6P1N0	C2D1A_HUMAN	coiled-coil and C2 domain containing 1A	341	Pro-rich.				positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|signal transducer activity (GO:0004871)			NS(1)|breast(2)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(12)|prostate(2)|skin(2)	27			OV - Ovarian serous cystadenocarcinoma(19;3.49e-23)			CGGCCCAGAGGTGCCCCCACC	0.672																																					p.V341L		Atlas-SNP	.											.	CC2D1A	67	.	0			c.G1021T						.						14.0	22.0	19.0					19																	14029727		2013	4163	6176	SO:0001583	missense	54862	exon10			CCAGAGGTGCCCC	AF536205	CCDS42512.1	19p13.12	2007-01-08				ENSG00000132024			30237	protein-coding gene	gene with protein product	"""mental retardation, nonsyndromic, autosomal recessive, 3"""	610055				12761501, 16033914	Standard	NM_017721		Approved	FLJ20241, MRT3	uc002mxo.2	Q6P1N0		ENST00000318003.7:c.1021G>T	chr19.hg19:g.14029727G>T	ENSP00000313601:p.Val341Leu	211.0	0.0		167.0	64.0	NM_017721	Q7Z435|Q86XV0|Q8NF89|Q9H603|Q9NXI1	Missense_Mutation	SNP	ENST00000318003.7	hg19	CCDS42512.1	.	.	.	.	.	.	.	.	.	.	G	11.36	1.615512	0.28801	.	.	ENSG00000132024	ENST00000318003;ENST00000397486	T	0.43294	0.95	4.75	3.66	0.41972	.	0.930752	0.09169	N	0.839224	T	0.24314	0.0589	N	0.12182	0.205	0.35106	D	0.765706	B;B;B	0.06786	0.001;0.0;0.0	B;B;B	0.09377	0.004;0.002;0.002	T	0.23691	-1.0181	10	0.28530	T	0.3	-5.7378	7.5154	0.27598	0.1017:0.1742:0.7241:0.0	.	341;341;95	Q6P1N0-2;Q6P1N0;C9J1T8	.;C2D1A_HUMAN;.	L	341;95	ENSP00000313601:V341L	ENSP00000313601:V341L	V	+	1	0	CC2D1A	13890727	0.133000	0.22466	0.951000	0.38953	0.349000	0.29174	0.838000	0.27572	2.472000	0.83506	0.561000	0.74099	GTG	.	.		0.672	CC2D1A-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000457954.1	NM_017721	
EMR3	84658	hgsc.bcm.edu	37	19	14772862	14772862	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr19:14772862C>T	ENST00000253673.5	-	4	368	c.268G>A	c.(268-270)Gga>Aga	p.G90R	EMR3_ENST00000599900.1_5'UTR|EMR3_ENST00000344373.4_Intron|EMR3_ENST00000443157.2_Intron	NM_032571.3	NP_115960.2	Q9BY15	EMR3_HUMAN	egf-like module containing, mucin-like, hormone receptor-like 3	90	EGF-like 2; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(1)|autonomic_ganglia(1)|breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(12)|lung(14)|ovary(7)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	50						TAGAAACTTCCTTCGACATTG	0.383																																					p.G90R		Atlas-SNP	.											.	EMR3	99	.	0			c.G268A						.						203.0	169.0	181.0					19																	14772862		2203	4300	6503	SO:0001583	missense	84658	exon4			AACTTCCTTCGAC	AF239764	CCDS12315.1, CCDS74296.1, CCDS74297.1	19p13.1	2014-08-08				ENSG00000131355		"""-"", ""GPCR / Class B : Orphans"""	23647	protein-coding gene	gene with protein product		606101				11279179, 12975309	Standard	XM_005260118		Approved		uc002mzi.4	Q9BY15		ENST00000253673.5:c.268G>A	chr19.hg19:g.14772862C>T	ENSP00000253673:p.Gly90Arg	122.0	0.0		109.0	47.0	NM_032571		Missense_Mutation	SNP	ENST00000253673.5	hg19	CCDS12315.1	.	.	.	.	.	.	.	.	.	.	C	15.90	2.968362	0.53614	.	.	ENSG00000131355	ENST00000253673	D	0.99557	-6.16	4.12	4.12	0.48240	EGF-like calcium-binding, conserved site (1);EGF-like calcium-binding (2);Epidermal growth factor-like, type 3 (1);	.	.	.	.	D	0.99739	0.9897	H	0.97587	4.035	0.58432	D	0.999992	D	0.89917	1.0	D	0.97110	1.0	D	0.97276	0.9914	9	0.87932	D	0	.	11.7465	0.51823	0.0:1.0:0.0:0.0	.	90	Q9BY15	EMR3_HUMAN	R	90	ENSP00000253673:G90R	ENSP00000253673:G90R	G	-	1	0	EMR3	14633862	0.155000	0.22806	0.034000	0.17996	0.034000	0.12701	1.486000	0.35530	2.133000	0.65898	0.508000	0.49915	GGA	.	.		0.383	EMR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466488.1	NM_032571	
CCDC105	126402	hgsc.bcm.edu	37	19	15122107	15122107	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr19:15122107A>G	ENST00000292574.3	+	1	552	c.470A>G	c.(469-471)cAg>cGg	p.Q157R	SLC1A6_ENST00000430939.2_5'Flank	NM_173482.2	NP_775753.2	Q8IYK2	CC105_HUMAN	coiled-coil domain containing 105	157						extracellular vesicular exosome (GO:0070062)				NS(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(10)|ovary(1)|prostate(4)|skin(2)	23						CTGCTGCGCCAGCGCGAGGTC	0.687																																					p.Q157R		Atlas-SNP	.											.	CCDC105	53	.	0			c.A470G						.						7.0	8.0	8.0					19																	15122107		1974	4131	6105	SO:0001583	missense	126402	exon1			TGCGCCAGCGCGA	AK097684	CCDS12322.1	19p13.12	2008-02-05				ENSG00000160994			26866	protein-coding gene	gene with protein product						12477932	Standard	NM_173482		Approved	FLJ40365	uc002nae.2	Q8IYK2		ENST00000292574.3:c.470A>G	chr19.hg19:g.15122107A>G	ENSP00000292574:p.Gln157Arg	58.0	0.0		73.0	26.0	NM_173482	Q8N7T5|Q8NDL5	Missense_Mutation	SNP	ENST00000292574.3	hg19	CCDS12322.1	.	.	.	.	.	.	.	.	.	.	A	14.86	2.661198	0.47572	.	.	ENSG00000160994	ENST00000292574	T	0.02552	4.25	3.82	2.8	0.32819	.	0.000000	0.48286	D	0.000195	T	0.07683	0.0193	M	0.67953	2.075	0.26848	N	0.968221	D	0.63046	0.992	P	0.59643	0.861	T	0.18618	-1.0331	10	0.25106	T	0.35	-22.4254	5.8611	0.18747	0.8726:0.0:0.1274:0.0	.	157	Q8IYK2	CC105_HUMAN	R	157	ENSP00000292574:Q157R	ENSP00000292574:Q157R	Q	+	2	0	CCDC105	14983107	0.900000	0.30661	0.993000	0.49108	0.694000	0.40290	0.984000	0.29565	0.372000	0.24591	-0.464000	0.05259	CAG	.	.		0.687	CCDC105-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466293.1	NM_173482	
NOTCH3	4854	hgsc.bcm.edu	37	19	15281192	15281192	+	Silent	SNP	A	A	G			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr19:15281192A>G	ENST00000263388.2	-	27	5139	c.5064T>C	c.(5062-5064)tcT>tcC	p.S1688S		NM_000435.2	NP_000426.2	Q9UM47	NOTC3_HUMAN	notch 3	1688					forebrain development (GO:0030900)|gene expression (GO:0010467)|glomerular capillary formation (GO:0072104)|negative regulation of neuron differentiation (GO:0045665)|neuron fate commitment (GO:0048663)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|positive regulation of smooth muscle cell proliferation (GO:0048661)|regulation of transcription, DNA-templated (GO:0006355)|transcription initiation from RNA polymerase II promoter (GO:0006367)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)			breast(4)|central_nervous_system(3)|endometrium(10)|kidney(3)|large_intestine(16)|liver(1)|lung(31)|ovary(8)|prostate(3)|skin(7)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	93			OV - Ovarian serous cystadenocarcinoma(3;2.6e-20)|Epithelial(3;1.34e-16)|all cancers(3;5.13e-15)			CCTTGTGACCAGAGGCCACGT	0.652																																					p.S1688S		Atlas-SNP	.											.	NOTCH3	340	.	0			c.T5064C						.						41.0	44.0	43.0					19																	15281192		2203	4300	6503	SO:0001819	synonymous_variant	4854	exon27			GTGACCAGAGGCC	U97669	CCDS12326.1	19p13.2-p13.1	2013-01-10	2010-06-24			ENSG00000074181		"""Ankyrin repeat domain containing"""	7883	protein-coding gene	gene with protein product		600276	"""Notch (Drosophila) homolog 3"", ""Notch homolog 3 (Drosophila)"""	CADASIL		7835890	Standard	NM_000435		Approved	CASIL	uc002nan.3	Q9UM47		ENST00000263388.2:c.5064T>C	chr19.hg19:g.15281192A>G		86.0	0.0		51.0	24.0	NM_000435	Q9UEB3|Q9UPL3|Q9Y6L8	Silent	SNP	ENST00000263388.2	hg19	CCDS12326.1																																																																																			.	.		0.652	NOTCH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465714.1	NM_000435	
ANO8	57719	hgsc.bcm.edu	37	19	17441186	17441186	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr19:17441186A>G	ENST00000159087.4	-	9	1279	c.1121T>C	c.(1120-1122)cTc>cCc	p.L374P		NM_020959.2	NP_066010.1	Q9HCE9	ANO8_HUMAN	anoctamin 8	374	Leu-rich.				chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	intracellular calcium activated chloride channel activity (GO:0005229)			autonomic_ganglia(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(7)|ovary(4)|pancreas(1)|prostate(2)|urinary_tract(3)	27						GCCAAGCATGAGCAAGAAGAC	0.642																																					p.L374P		Atlas-SNP	.											.	ANO8	67	.	0			c.T1121C						.						29.0	28.0	28.0					19																	17441186		2198	4297	6495	SO:0001583	missense	57719	exon9			AGCATGAGCAAGA	AB046843	CCDS32949.1	19p13.12	2014-04-09	2008-08-28	2008-08-28		ENSG00000074855		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	29329	protein-coding gene	gene with protein product		610216	"""KIAA1623"", ""transmembrane protein 16H"""	KIAA1623, TMEM16H		10997877, 24692353	Standard	NM_020959		Approved		uc002ngf.2	Q9HCE9		ENST00000159087.4:c.1121T>C	chr19.hg19:g.17441186A>G	ENSP00000159087:p.Leu374Pro	92.0	0.0		74.0	31.0	NM_020959	A6NIJ0	Missense_Mutation	SNP	ENST00000159087.4	hg19	CCDS32949.1	.	.	.	.	.	.	.	.	.	.	A	18.71	3.682471	0.68157	.	.	ENSG00000074855	ENST00000159087	T	0.66460	-0.21	5.26	5.26	0.73747	.	0.391639	0.23552	N	0.046943	T	0.80523	0.4639	M	0.78637	2.42	0.53005	D	0.999966	D	0.58268	0.982	D	0.66979	0.948	T	0.82540	-0.0406	10	0.62326	D	0.03	.	13.0825	0.59121	1.0:0.0:0.0:0.0	.	374	Q9HCE9	ANO8_HUMAN	P	374	ENSP00000159087:L374P	ENSP00000159087:L374P	L	-	2	0	ANO8	17302186	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	2.386000	0.44380	1.981000	0.57761	0.402000	0.26972	CTC	.	.		0.642	ANO8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462943.1	XM_050644	
PIK3R2	5296	hgsc.bcm.edu	37	19	18273890	18273890	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr19:18273890A>G	ENST00000593731.1	+	10	1783	c.1223A>G	c.(1222-1224)gAg>gGg	p.E408G	PIK3R2_ENST00000222254.8_Missense_Mutation_p.E408G			O00459	P85B_HUMAN	phosphoinositide-3-kinase, regulatory subunit 2 (beta)	408	SH2 1. {ECO:0000255|PROSITE- ProRule:PRU00191}.				blood coagulation (GO:0007596)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)|T cell receptor signaling pathway (GO:0050852)	cytosol (GO:0005829)|phosphatidylinositol 3-kinase complex (GO:0005942)	phosphatidylinositol 3-kinase regulator activity (GO:0035014)|receptor tyrosine kinase binding (GO:0030971)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(12)|ovary(3)|pancreas(1)|stomach(1)	24					Isoprenaline(DB01064)	TACCGCCACGAGTCTCTGGCC	0.572																																					p.E408G		Atlas-SNP	.											.	PIK3R2	48	.	0			c.A1223G						.						106.0	84.0	92.0					19																	18273890		2203	4300	6503	SO:0001583	missense	5296	exon10			GCCACGAGTCTCT		CCDS12371.1	19p13.11	2013-03-28	2008-02-04		ENSG00000105647	ENSG00000105647		"""SH2 domain containing"""	8980	protein-coding gene	gene with protein product		603157				1314371	Standard	NM_005027		Approved	P85B, p85	uc002nia.2	O00459	OTTHUMG00000183383	ENST00000593731.1:c.1223A>G	chr19.hg19:g.18273890A>G	ENSP00000471914:p.Glu408Gly	178.0	0.0		147.0	50.0	NM_005027	Q5EAT5|Q9UPH9	Missense_Mutation	SNP	ENST00000593731.1	hg19	CCDS12371.1	.	.	.	.	.	.	.	.	.	.	A	14.11	2.436878	0.43224	.	.	ENSG00000105647	ENST00000222254	T	0.63417	-0.04	3.69	3.69	0.42338	SH2 motif (3);	0.113373	0.64402	D	0.000014	T	0.67221	0.2870	M	0.63428	1.95	0.58432	D	0.999994	D	0.61080	0.989	P	0.52514	0.701	T	0.70601	-0.4827	10	0.52906	T	0.07	-26.517	12.2662	0.54679	1.0:0.0:0.0:0.0	.	408	O00459	P85B_HUMAN	G	408	ENSP00000222254:E408G	ENSP00000222254:E408G	E	+	2	0	PIK3R2	18134890	1.000000	0.71417	0.808000	0.32385	0.044000	0.14063	7.135000	0.77276	1.641000	0.50575	0.459000	0.35465	GAG	.	.		0.572	PIK3R2-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	nonsense_mediated_decay	protein_coding	OTTHUMT00000466386.2	NM_005027	
ZNF708	7562	hgsc.bcm.edu	37	19	21477081	21477081	+	Nonsense_Mutation	SNP	A	A	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr19:21477081A>T	ENST00000356929.3	-	4	884	c.687T>A	c.(685-687)tgT>tgA	p.C229*		NM_021269.2	NP_067092.2	P17019	ZN708_HUMAN	zinc finger protein 708	165					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(6)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(9)|ovary(2)|skin(2)|stomach(1)	32						AAGCTTTTCCACATTCTTCAC	0.348																																					p.C229X		Atlas-SNP	.											.	ZNF708	66	.	0			c.T687A						.						40.0	43.0	42.0					19																	21477081		2180	4284	6464	SO:0001587	stop_gained	7562	exon4			TTTTCCACATTCT	X52339	CCDS32980.1	19p12	2014-02-14	2006-08-22	2005-08-16	ENSG00000182141	ENSG00000182141		"""Zinc fingers, C2H2-type"", ""-"""	12945	protein-coding gene	gene with protein product			"""zinc finger protein 15-like 1 (KOX 8)"", ""zinc finger protein 708"", ""zinc finger protein 708 (KOX8)"""	ZNF15, ZNF15L1		2014798	Standard	NM_021269		Approved	KOX8	uc002npq.1	P17019	OTTHUMG00000182841	ENST00000356929.3:c.687T>A	chr19.hg19:g.21477081A>T	ENSP00000349401:p.Cys229*	27.0	0.0		32.0	15.0	NM_021269	Q6ZMR0	Nonsense_Mutation	SNP	ENST00000356929.3	hg19	CCDS32980.1	.	.	.	.	.	.	.	.	.	.	.	13.12	2.141164	0.37825	.	.	ENSG00000182141	ENST00000356929	.	.	.	1.05	1.05	0.20165	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	4.1942	0.10435	0.7718:0.0:0.2282:0.0	.	.	.	.	X	229	.	ENSP00000349401:C229X	C	-	3	2	ZNF708	21268921	0.793000	0.28825	0.010000	0.14722	0.009000	0.06853	1.090000	0.30902	0.408000	0.25621	0.397000	0.26171	TGT	.	.		0.348	ZNF708-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463953.1	NM_021269	
CD22	933	hgsc.bcm.edu	37	19	35823773	35823773	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr19:35823773A>T	ENST00000085219.5	+	3	424	c.358A>T	c.(358-360)Agg>Tgg	p.R120W	CD22_ENST00000419549.2_De_novo_Start_OutOfFrame|CD22_ENST00000536635.2_Missense_Mutation_p.R120W|CD22_ENST00000595419.1_3'UTR|CD22_ENST00000594250.1_Missense_Mutation_p.R120W|CD22_ENST00000341773.6_Missense_Mutation_p.R120W|U62631.5_ENST00000597110.1_RNA|CD22_ENST00000544992.2_Missense_Mutation_p.R120W|CD22_ENST00000270311.6_De_novo_Start_InFrame	NM_001771.3	NP_001762.2	P20273	CD22_HUMAN	CD22 molecule	120	Ig-like V-type.				cell adhesion (GO:0007155)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	carbohydrate binding (GO:0030246)			breast(2)|endometrium(2)|kidney(3)|large_intestine(14)|lung(21)|ovary(5)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(1)	54	all_lung(56;9.78e-09)|Lung NSC(56;1.46e-08)|Esophageal squamous(110;0.162)		Epithelial(14;5.83e-19)|OV - Ovarian serous cystadenocarcinoma(14;3.19e-18)|all cancers(14;3.41e-16)|LUSC - Lung squamous cell carcinoma(66;0.0417)			GCTGGGGCTGAGGATGGAGTC	0.537																																					p.R120W	Ovarian(42;1009 1133 23674 26041)	Atlas-SNP	.											.	CD22	129	.	0			c.A358T						.						90.0	79.0	83.0					19																	35823773		2203	4300	6503	SO:0001583	missense	933	exon3			GGGCTGAGGATGG	X52785	CCDS12457.1, CCDS54247.1, CCDS54248.1, CCDS54249.1, CCDS62634.1	19q13.1	2013-01-29	2006-03-28		ENSG00000012124	ENSG00000012124		"""CD molecules"", ""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1643	protein-coding gene	gene with protein product	"""sialic acid binding Ig-like lectin 2"""	107266	"""CD22 antigen"""			8496602, 1691828	Standard	NM_001185099		Approved	SIGLEC-2, SIGLEC2	uc010edt.3	P20273		ENST00000085219.5:c.358A>T	chr19.hg19:g.35823773A>T	ENSP00000085219:p.Arg120Trp	89.0	0.0		76.0	26.0	NM_001185100	F5GYU4|F5H7U3|O95699|O95701|O95702|O95703|Q01665|Q32M46|Q92872|Q92873|Q9UQA6|Q9UQA7|Q9UQA8|Q9UQA9|Q9UQB0|Q9Y2A6	Missense_Mutation	SNP	ENST00000085219.5	hg19	CCDS12457.1	.	.	.	.	.	.	.	.	.	.	A	17.76	3.469521	0.63625	.	.	ENSG00000012124	ENST00000085219;ENST00000536635;ENST00000341773;ENST00000544992	T;T;T;T	0.49139	0.79;0.79;0.79;0.79	5.26	4.23	0.50019	Immunoglobulin subtype (1);Immunoglobulin-like fold (1);	0.000000	0.56097	D	0.000028	T	0.67059	0.2853	M	0.79805	2.47	0.45634	D	0.998566	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;0.999;1.0	T	0.68622	-0.5360	10	0.87932	D	0	.	9.1319	0.36850	0.8154:0.1846:0.0:0.0	.	120;120;120;120	F5GYU4;F5H7U3;P20273;P20273-2	.;.;CD22_HUMAN;.	W	120	ENSP00000085219:R120W;ENSP00000442279:R120W;ENSP00000339349:R120W;ENSP00000441237:R120W	ENSP00000085219:R120W	R	+	1	2	CD22	40515613	1.000000	0.71417	0.981000	0.43875	0.506000	0.33950	2.744000	0.47450	0.819000	0.34492	0.460000	0.39030	AGG	.	.		0.537	CD22-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000466099.1	NM_001771	
APLP1	333	hgsc.bcm.edu	37	19	36370026	36370026	+	Silent	SNP	C	C	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr19:36370026C>A	ENST00000221891.4	+	16	1956	c.1764C>A	c.(1762-1764)atC>atA	p.I588I	APLP1_ENST00000537454.2_Silent_p.I548I|RN7SL402P_ENST00000465059.1_RNA|APLP1_ENST00000586861.1_Silent_p.I581I	NM_001024807.1|NM_005166.3	NP_001019978.1|NP_005157.1	P51693	APLP1_HUMAN	amyloid beta (A4) precursor-like protein 1	587					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|apoptotic process (GO:0006915)|cell adhesion (GO:0007155)|cellular response to norepinephrine stimulus (GO:0071874)|endocytosis (GO:0006897)|extracellular matrix organization (GO:0030198)|forebrain development (GO:0030900)|mRNA polyadenylation (GO:0006378)|negative regulation of cAMP biosynthetic process (GO:0030818)|nervous system development (GO:0007399)|organ morphogenesis (GO:0009887)|regulation of translation (GO:0006417)	basement membrane (GO:0005604)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	alpha-2A adrenergic receptor binding (GO:0031694)|alpha-2B adrenergic receptor binding (GO:0031695)|alpha-2C adrenergic receptor binding (GO:0031696)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|transition metal ion binding (GO:0046914)			breast(4)|endometrium(2)|kidney(2)|large_intestine(12)|liver(1)|lung(9)|ovary(2)|upper_aerodigestive_tract(1)	33	all_lung(56;7.14e-07)|Lung NSC(56;1.12e-06)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			GTCTGCTGATCATGGGAGCGG	0.642																																					p.I588I		Atlas-SNP	.											.	APLP1	77	.	0			c.C1764A						.						50.0	50.0	50.0					19																	36370026		2203	4300	6503	SO:0001819	synonymous_variant	333	exon16			GCTGATCATGGGA	U48437	CCDS32997.1	19q	2008-07-15							597	protein-coding gene	gene with protein product	"""amyloid-like protein 1"", ""amyloid precursor-like protein 1"""	104775				8432545	Standard	NM_001024807		Approved	APLP	uc002ocf.3	P51693		ENST00000221891.4:c.1764C>A	chr19.hg19:g.36370026C>A		44.0	0.0		21.0	9.0	NM_001024807	O00113|Q96A92	Silent	SNP	ENST00000221891.4	hg19	CCDS32997.1																																																																																			.	.		0.642	APLP1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452564.1	NM_001024807	
HKR1	284459	hgsc.bcm.edu	37	19	37854185	37854185	+	Silent	SNP	A	A	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr19:37854185A>T	ENST00000324411.4	+	6	1757	c.1488A>T	c.(1486-1488)ccA>ccT	p.P496P	HKR1_ENST00000544914.1_Silent_p.P223P|HKR1_ENST00000541583.2_Silent_p.P435P|HKR1_ENST00000589392.1_Silent_p.P478P|HKR1_ENST00000591471.1_Silent_p.P223P|HKR1_ENST00000591134.1_Intron|HKR1_ENST00000392153.3_Silent_p.P477P	NM_181786.2	NP_861451.1	P10072	HKR1_HUMAN	HKR1, GLI-Kruppel zinc finger family member	496					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			cervix(1)|endometrium(3)|kidney(2)|large_intestine(10)|lung(9)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	29			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			GGGAGAAGCCATTTGTATGTA	0.527																																					p.P496P		Atlas-SNP	.											.	HKR1	74	.	0			c.A1488T						.						83.0	81.0	82.0					19																	37854185		2203	4300	6503	SO:0001819	synonymous_variant	284459	exon6			GAAGCCATTTGTA	M20675	CCDS12502.1	19q13.13	2013-01-08	2010-05-04			ENSG00000181666		"""Zinc fingers, C2H2-type"", ""-"""	4928	protein-coding gene	gene with protein product	"""oncogene HKR1"""	165250	"""GLI-Kruppel family member HKR1"""			2850480, 9813242	Standard	NM_181786		Approved	ZNF875	uc002ogb.3	P10072		ENST00000324411.4:c.1488A>T	chr19.hg19:g.37854185A>T		103.0	0.0		128.0	50.0	NM_181786	A8MRS7|Q6PJD0|Q9BSW9|Q9UM09	Silent	SNP	ENST00000324411.4	hg19	CCDS12502.1																																																																																			.	.		0.527	HKR1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000458375.1	NM_181786	
SPTBN4	57731	hgsc.bcm.edu	37	19	41071395	41071395	+	Silent	SNP	G	G	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr19:41071395G>A	ENST00000352632.3	+	28	6068	c.5982G>A	c.(5980-5982)cgG>cgA	p.R1994R	SPTBN4_ENST00000338932.3_Silent_p.R1994R|SPTBN4_ENST00000598249.1_Silent_p.R1994R|SPTBN4_ENST00000392025.1_Silent_p.R737R			Q9H254	SPTN4_HUMAN	spectrin, beta, non-erythrocytic 4	1994					actin filament capping (GO:0051693)|adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|axonogenesis (GO:0007409)|cardiac conduction (GO:0061337)|central nervous system projection neuron axonogenesis (GO:0021952)|clustering of voltage-gated sodium channels (GO:0045162)|cytoskeletal anchoring at plasma membrane (GO:0007016)|establishment of protein localization to plasma membrane (GO:0090002)|fertilization (GO:0009566)|negative regulation of heart rate (GO:0010459)|positive regulation of multicellular organism growth (GO:0040018)|regulation of peptidyl-serine phosphorylation (GO:0033135)|regulation of sodium ion transport (GO:0002028)|sensory perception of sound (GO:0007605)|transmission of nerve impulse (GO:0019226)|vesicle-mediated transport (GO:0016192)	adherens junction (GO:0005912)|axon hillock (GO:0043203)|axon initial segment (GO:0043194)|cell body fiber (GO:0070852)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|nuclear matrix (GO:0016363)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|PML body (GO:0016605)|spectrin (GO:0008091)	actin binding (GO:0003779)|ankyrin binding (GO:0030506)|phosphatase binding (GO:0019902)|phospholipid binding (GO:0005543)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			breast(4)|central_nervous_system(1)|endometrium(6)|kidney(7)|large_intestine(9)|lung(32)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	73			Lung(22;0.000114)|LUSC - Lung squamous cell carcinoma(20;0.000384)			TGGAGGCGCGGGTGCCTGAGC	0.632																																					p.R1994R		Atlas-SNP	.											.	SPTBN4	213	.	0			c.G5982A						.						63.0	63.0	63.0					19																	41071395		2203	4300	6503	SO:0001819	synonymous_variant	57731	exon28			GGCGCGGGTGCCT	AF082075	CCDS12559.1, CCDS42569.1	19q13.13	2013-01-10				ENSG00000160460		"""Pleckstrin homology (PH) domain containing"""	14896	protein-coding gene	gene with protein product		606214				11086001	Standard	NM_020971		Approved	SPTBN3, KIAA1642	uc002onz.3	Q9H254		ENST00000352632.3:c.5982G>A	chr19.hg19:g.41071395G>A		110.0	0.0		116.0	48.0	NM_020971	E9PGQ5|Q9H1K7|Q9H1K8|Q9H1K9|Q9H253|Q9H3G8|Q9HCD0	Silent	SNP	ENST00000352632.3	hg19	CCDS12559.1																																																																																			.	.		0.632	SPTBN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462559.2		
GRIK5	2901	hgsc.bcm.edu	37	19	42510881	42510881	+	Silent	SNP	A	A	G			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr19:42510881A>G	ENST00000262895.3	-	15	1952	c.1953T>C	c.(1951-1953)ccT>ccC	p.P651P	GRIK5_ENST00000593562.1_Silent_p.P651P|GRIK5_ENST00000301218.4_Silent_p.P651P	NM_002088.4	NP_002079.3	Q16478	GRIK5_HUMAN	glutamate receptor, ionotropic, kainate 5	651					cellular response to glucose stimulus (GO:0071333)|establishment of localization in cell (GO:0051649)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|positive regulation of neuron apoptotic process (GO:0043525)|protein retention in ER lumen (GO:0006621)|receptor clustering (GO:0043113)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of synaptic vesicle fusion to presynaptic membrane (GO:0031630)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|kainate selective glutamate receptor complex (GO:0032983)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	extracellular-glutamate-gated ion channel activity (GO:0005234)|kainate selective glutamate receptor activity (GO:0015277)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|liver(1)|lung(11)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	35		Prostate(69;0.059)				CCGACTCCACAGGCACCTCCA	0.622																																					p.P651P		Atlas-SNP	.											.	GRIK5	220	.	0			c.T1953C						.						82.0	65.0	70.0					19																	42510881		2203	4300	6503	SO:0001819	synonymous_variant	2901	exon15			CTCCACAGGCACC		CCDS12595.1	19q13.2	2012-08-29			ENSG00000105737	ENSG00000105737		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4583	protein-coding gene	gene with protein product		600283		GRIK2		7527545	Standard	NM_002088		Approved	GluK5, KA2	uc002osj.2	Q16478	OTTHUMG00000044573	ENST00000262895.3:c.1953T>C	chr19.hg19:g.42510881A>G		59.0	0.0		49.0	17.0	NM_002088	Q8WWG8	Silent	SNP	ENST00000262895.3	hg19	CCDS12595.1	.	.	.	.	.	.	.	.	.	.	A	11.14	1.550132	0.27652	.	.	ENSG00000105737	ENST00000454993	.	.	.	5.18	-10.1	0.00402	.	.	.	.	.	T	0.47135	0.1429	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.57602	-0.7783	4	.	.	.	.	9.4213	0.38553	0.1047:0.094:0.6266:0.1747	.	.	.	.	R	28	.	.	C	-	1	0	GRIK5	47202721	0.000000	0.05858	0.855000	0.33649	0.993000	0.82548	-1.786000	0.01766	-1.611000	0.01581	-0.376000	0.06991	TGT	.	.		0.622	GRIK5-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463453.1		
CIC	23152	hgsc.bcm.edu	37	19	42795109	42795109	+	Missense_Mutation	SNP	C	C	G			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr19:42795109C>G	ENST00000575354.2	+	10	2229	c.2189C>G	c.(2188-2190)tCg>tGg	p.S730W	CIC_ENST00000160740.3_Missense_Mutation_p.S730W|CIC_ENST00000572681.2_Missense_Mutation_p.S1639W	NM_015125.3	NP_055940.3	Q96RK0	CIC_HUMAN	capicua transcriptional repressor	730	Pro-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			autonomic_ganglia(1)|breast(5)|central_nervous_system(32)|endometrium(10)|kidney(2)|large_intestine(7)|lung(9)|ovary(7)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	82		Prostate(69;0.00682)				TTAGTGTATTCGGACAAGAAG	0.627			"""Mis, F, S"""		oligodendroglioma																																p.S730W		Atlas-SNP	.		Rec	yes		19	19q13.2	23152	capicua homolog		O	.	CIC	249	.	0			c.C2189G						.						30.0	31.0	30.0					19																	42795109		2202	4299	6501	SO:0001583	missense	23152	exon10			TGTATTCGGACAA	AB002304	CCDS12601.1	19q13.2	2013-03-15	2013-03-15		ENSG00000079432	ENSG00000079432			14214	protein-coding gene	gene with protein product		612082	"""capicua (Drosophila) homolog"", ""capicua homolog (Drosophila)"""			12393275, 15981098	Standard	NM_015125		Approved	KIAA0306	uc002otf.1	Q96RK0		ENST00000575354.2:c.2189C>G	chr19.hg19:g.42795109C>G	ENSP00000458663:p.Ser730Trp	109.0	0.0		104.0	46.0	NM_015125	Q7LGI1|Q9UEG5|Q9Y6T1	Missense_Mutation	SNP	ENST00000575354.2	hg19	CCDS12601.1	.	.	.	.	.	.	.	.	.	.	C	13.05	2.122842	0.37436	.	.	ENSG00000079432	ENST00000160740	.	.	.	4.78	4.78	0.61160	.	.	.	.	.	T	0.49830	0.1580	N	0.14661	0.345	0.54753	D	0.999984	D	0.63880	0.993	P	0.54590	0.756	T	0.57900	-0.7731	8	0.87932	D	0	-8.5816	15.3429	0.74311	0.0:1.0:0.0:0.0	.	730	Q96RK0	CIC_HUMAN	W	730	.	ENSP00000160740:S730W	S	+	2	0	CIC	47486949	0.711000	0.27906	1.000000	0.80357	0.997000	0.91878	4.611000	0.61162	2.480000	0.83734	0.561000	0.74099	TCG	.	.		0.627	CIC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000438532.2		
CEACAM1	634	hgsc.bcm.edu	37	19	43013273	43013273	+	Silent	SNP	T	T	C			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr19:43013273T>C	ENST00000161559.6	-	9	1703	c.1569A>G	c.(1567-1569)gtA>gtG	p.V523V	CEACAM1_ENST00000351134.3_Silent_p.V249V|CEACAM1_ENST00000358394.3_Silent_p.V458V|CEACAM1_ENST00000403444.3_3'UTR|CEACAM1_ENST00000403461.1_3'UTR|LIPE-AS1_ENST00000457234.2_RNA|LIPE-AS1_ENST00000594688.1_RNA|CEACAM1_ENST00000308072.4_Intron|LIPE-AS1_ENST00000594624.2_RNA|CEACAM1_ENST00000488639.2_5'UTR|CEACAM1_ENST00000352591.5_Silent_p.V427V	NM_001712.4	NP_001703.2	P13688	CEAM1_HUMAN	carcinoembryonic antigen-related cell adhesion molecule 1 (biliary glycoprotein)	523					angiogenesis (GO:0001525)|cell migration (GO:0016477)|homophilic cell adhesion (GO:0007156)|integrin-mediated signaling pathway (GO:0007229)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	protein homodimerization activity (GO:0042803)			breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(3)|ovary(1)|pancreas(1)|prostate(1)|urinary_tract(1)	17		Prostate(69;0.00682)		GBM - Glioblastoma multiforme(486;0.00148)	Arcitumomab(DB00113)	ACTGCTTTTTTACTTCTGAAT	0.443																																					p.V523V		Atlas-SNP	.											.	CEACAM1	43	.	0			c.A1569G						.						154.0	138.0	143.0					19																	43013273		2203	4300	6503	SO:0001819	synonymous_variant	634	exon9			CTTTTTTACTTCT	M72238	CCDS12609.1, CCDS46089.1, CCDS54272.1, CCDS54273.1, CCDS54274.1	19q13.2	2014-05-16			ENSG00000079385	ENSG00000079385		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1814	protein-coding gene	gene with protein product		109770		BGP		2457922, 2025273	Standard	NM_001712		Approved	BGP1, CD66a	uc002otv.3	P13688	OTTHUMG00000151078	ENST00000161559.6:c.1569A>G	chr19.hg19:g.43013273T>C		154.0	0.0		126.0	61.0	NM_001712	A6NE38|A8MY49|O60430|Q069I7|Q13854|Q13857|Q13858|Q13859|Q13860|Q15600|Q15601|Q16170|Q5UB49|Q7KYP5|Q96CA7|Q9UQV9	Silent	SNP	ENST00000161559.6	hg19	CCDS12609.1																																																																																			.	.		0.443	CEACAM1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000321190.2	NM_001712	
IRGC	56269	hgsc.bcm.edu	37	19	44223324	44223324	+	Missense_Mutation	SNP	C	C	A	rs574684743	byFrequency	TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr19:44223324C>A	ENST00000244314.5	+	2	813	c.614C>A	c.(613-615)gCc>gAc	p.A205D		NM_019612.3	NP_062558.1	Q6NXR0	IIGP5_HUMAN	immunity-related GTPase family, cinema	205	IRG-type G.					membrane (GO:0016020)	GTP binding (GO:0005525)|hydrolase activity, acting on acid anhydrides (GO:0016817)			central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(16)|ovary(1)|prostate(1)|skin(2)	25		Prostate(69;0.0435)				CTGCGGGAGGCCGGCGTGGCT	0.706																																					p.A205D	Colon(189;350 2037 11447 13433 38914)	Atlas-SNP	.											.	IRGC	67	.	0			c.C614A						.						25.0	27.0	26.0					19																	44223324		2156	4231	6387	SO:0001583	missense	56269	exon2			GGGAGGCCGGCGT	BC066939	CCDS12629.1	19q13.32	2008-02-05	2005-10-31	2005-10-31	ENSG00000124449	ENSG00000124449			28835	protein-coding gene	gene with protein product			"""immunity-related GTPase family, cinema 1"""	IRGC1		12477932	Standard	NM_019612		Approved	Iigp5, CINEMA	uc002oxh.3	Q6NXR0	OTTHUMG00000154587	ENST00000244314.5:c.614C>A	chr19.hg19:g.44223324C>A	ENSP00000244314:p.Ala205Asp	33.0	0.0		34.0	14.0	NM_019612	Q05BR8	Missense_Mutation	SNP	ENST00000244314.5	hg19	CCDS12629.1	.	.	.	.	.	.	.	.	.	.	C	5.968	0.362555	0.11296	.	.	ENSG00000124449	ENST00000244314	T	0.11604	2.76	4.82	0.33	0.15929	.	1.159190	0.06269	N	0.695258	T	0.10809	0.0264	L	0.46819	1.47	0.09310	N	1	B	0.27316	0.175	B	0.30943	0.122	T	0.45011	-0.9290	10	0.15952	T	0.53	.	7.5731	0.27920	0.0:0.5674:0.0:0.4326	.	205	Q6NXR0	IIGP5_HUMAN	D	205	ENSP00000244314:A205D	ENSP00000244314:A205D	A	+	2	0	IRGC	48915164	0.993000	0.37304	0.000000	0.03702	0.078000	0.17371	-0.229000	0.09098	0.079000	0.16929	0.655000	0.94253	GCC	.	.		0.706	IRGC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336191.1	NM_019612	
SMG9	56006	hgsc.bcm.edu	37	19	44241827	44241827	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr19:44241827T>A	ENST00000270066.6	-	9	1259	c.917A>T	c.(916-918)cAg>cTg	p.Q306L	SMG9_ENST00000601170.1_Missense_Mutation_p.Q306L	NM_019108.2	NP_061981.2	Q9H0W8	SMG9_HUMAN	SMG9 nonsense mediated mRNA decay factor	306					gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)	cytosol (GO:0005829)|intracellular (GO:0005622)	identical protein binding (GO:0042802)			kidney(1)|large_intestine(5)|liver(1)|lung(7)|pancreas(1)|prostate(2)|urinary_tract(2)	19						GGCAGCAATCTGGAGTGACTG	0.562																																					p.Q306L		Atlas-SNP	.											.	SMG9	39	.	0			c.A917T						.						139.0	106.0	117.0					19																	44241827		2203	4300	6503	SO:0001583	missense	56006	exon9			GCAATCTGGAGTG	BC008869	CCDS33043.2	19q13.31	2013-07-02	2013-07-02	2011-06-21	ENSG00000105771	ENSG00000105771			25763	protein-coding gene	gene with protein product		613176	"""chromosome 19 open reading frame 61"", ""smg-9 homolog, nonsense mediated mRNA decay factor (C. elegans)"""	C19orf61		11230166, 19417104	Standard	NM_019108		Approved	FLJ12886	uc002oxj.2	Q9H0W8	OTTHUMG00000150337	ENST00000270066.6:c.917A>T	chr19.hg19:g.44241827T>A	ENSP00000270066:p.Gln306Leu	94.0	0.0		70.0	26.0	NM_019108	O60429|Q9H9A9	Missense_Mutation	SNP	ENST00000270066.6	hg19	CCDS33043.2	.	.	.	.	.	.	.	.	.	.	T	21.4	4.145193	0.77888	.	.	ENSG00000105771	ENST00000270066	T	0.38722	1.12	4.07	4.07	0.47477	.	0.000000	0.85682	D	0.000000	T	0.64193	0.2576	M	0.85542	2.76	0.58432	D	0.999999	D	0.67145	0.996	D	0.67382	0.951	T	0.70022	-0.4986	10	0.72032	D	0.01	-8.8864	11.052	0.47896	0.0:0.0:0.0:1.0	.	306	Q9H0W8	SMG9_HUMAN	L	306	ENSP00000270066:Q306L	ENSP00000270066:Q306L	Q	-	2	0	SMG9	48933667	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	6.810000	0.75216	1.709000	0.51313	0.528000	0.53228	CAG	.	.		0.562	SMG9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317668.1	NM_019108	
LYPD5	284348	hgsc.bcm.edu	37	19	44306498	44306498	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr19:44306498C>A	ENST00000377950.3	-	1	115	c.35G>T	c.(34-36)tGc>tTc	p.C12F	LYPD5_ENST00000414615.2_Intron|LYPD5_ENST00000594013.1_5'Flank	NM_001031749.2	NP_001026919.2	Q6UWN5	LYPD5_HUMAN	LY6/PLAUR domain containing 5	12						anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)				breast(3)|kidney(1)|large_intestine(1)|lung(1)|prostate(1)|urinary_tract(1)	8		Prostate(69;0.0352)				CCCAAAGAGGCAGAGCAGAAT	0.597																																					p.C12F		Atlas-SNP	.											.	LYPD5	22	.	0			c.G35T						.						65.0	72.0	70.0					19																	44306498		692	1591	2283	SO:0001583	missense	284348	exon1			AAGAGGCAGAGCA	AK055031	CCDS12631.1, CCDS46096.1	19q13.31	2008-02-05				ENSG00000159871			26397	protein-coding gene	gene with protein product						12477932	Standard	NM_182573		Approved	FLJ30469	uc002oxm.4	Q6UWN5		ENST00000377950.3:c.35G>T	chr19.hg19:g.44306498C>A	ENSP00000367185:p.Cys12Phe	68.0	0.0		38.0	15.0	NM_001031749	Q6PEX9|Q96DR2	Missense_Mutation	SNP	ENST00000377950.3	hg19	CCDS46096.1	.	.	.	.	.	.	.	.	.	.	C	1.408	-0.576207	0.03882	.	.	ENSG00000159871	ENST00000377950	T	0.06933	3.24	3.73	-2.17	0.07059	.	0.719989	0.11799	U	0.528350	T	0.04137	0.0115	N	0.19112	0.55	0.09310	N	0.999997	B	0.18461	0.028	B	0.09377	0.004	T	0.39522	-0.9610	10	0.33940	T	0.23	-3.5099	3.3955	0.07304	0.1802:0.4009:0.0:0.4189	.	12	Q6UWN5	LYPD5_HUMAN	F	12	ENSP00000367185:C12F	ENSP00000367185:C12F	C	-	2	0	LYPD5	48998338	0.641000	0.27251	0.030000	0.17652	0.227000	0.25037	-0.435000	0.06931	-0.280000	0.09154	-0.196000	0.12772	TGC	.	.		0.597	LYPD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463611.1	NM_182573	
ZNF285	26974	hgsc.bcm.edu	37	19	44892183	44892183	+	Missense_Mutation	SNP	T	T	G			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr19:44892183T>G	ENST00000330997.4	-	4	288	c.224A>C	c.(223-225)cAg>cCg	p.Q75P	CTC-512J12.6_ENST00000588212.1_Intron|ZNF285_ENST00000591679.1_Missense_Mutation_p.Q82P|ZNF285_ENST00000544719.2_Missense_Mutation_p.Q75P	NM_152354.3	NP_689567.3	Q96NJ3	ZN285_HUMAN	zinc finger protein 285	75	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(15)|ovary(2)|prostate(5)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	44						TTTCCAAATCTGCCAGCAATG	0.408																																					p.Q75P		Atlas-SNP	.											.	ZNF285	86	.	0			c.A224C						.						90.0	93.0	92.0					19																	44892183		2203	4300	6503	SO:0001583	missense	26974	exon4			CAAATCTGCCAGC	AK055309	CCDS12638.1, CCDS74389.1	19q13.32	2013-01-08	2010-04-14	2010-04-14		ENSG00000267508		"""Zinc fingers, C2H2-type"", ""-"""	13079	protein-coding gene	gene with protein product			"""zinc finger protein 285A"""	ZNF285A			Standard	XM_005258734		Approved			Q96NJ3	OTTHUMG00000178848	ENST00000330997.4:c.224A>C	chr19.hg19:g.44892183T>G	ENSP00000333595:p.Gln75Pro	197.0	0.0		175.0	67.0	NM_152354	Q17RJ3|Q6B0A8|Q6ISR5	Missense_Mutation	SNP	ENST00000330997.4	hg19	CCDS12638.1	.	.	.	.	.	.	.	.	.	.	T	13.65	2.299170	0.40694	.	.	ENSG00000062370	ENST00000544719;ENST00000330997	T	0.07114	3.22	3.44	1.18	0.20946	Krueppel-associated box (1);	.	.	.	.	T	0.04634	0.0126	N	0.17082	0.46	0.09310	N	1	B;B	0.15473	0.013;0.013	B;B	0.09377	0.004;0.004	T	0.41645	-0.9497	9	0.34782	T	0.22	.	3.9353	0.09304	0.0:0.129:0.2183:0.6528	.	99;75	B7ZLR9;Q96NJ3	.;ZN285_HUMAN	P	98;75	ENSP00000333595:Q75P	ENSP00000333595:Q75P	Q	-	2	0	ZNF285	49584023	0.001000	0.12720	0.952000	0.39060	0.668000	0.39293	0.269000	0.18589	0.329000	0.23460	0.373000	0.22412	CAG	.	.		0.408	ZNF285-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443600.1	NM_152354	
CYTH2	9266	hgsc.bcm.edu	37	19	48978146	48978146	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr19:48978146G>T	ENST00000452733.2	+	8	1224	c.748G>T	c.(748-750)Ggg>Tgg	p.G250W	CYTH2_ENST00000427476.1_Missense_Mutation_p.G250W			Q99418	CYH2_HUMAN	cytohesin 2	250					actin cytoskeleton organization (GO:0030036)|endocytosis (GO:0006897)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)|regulation of cell adhesion (GO:0030155)	cytoplasm (GO:0005737)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|inositol 1,4,5 trisphosphate binding (GO:0070679)|lipid binding (GO:0008289)			endometrium(1)|kidney(2)|large_intestine(1)|lung(6)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	15						TGAGGATGACGGGAATGACCT	0.622																																					p.G250W		Atlas-SNP	.											.	CYTH2	33	.	0			c.G748T						.						157.0	130.0	139.0					19																	48978146		2203	4300	6503	SO:0001583	missense	9266	exon8			GATGACGGGAATG	X99753	CCDS12722.1	19q13.32	2014-05-02	2008-08-14	2008-08-14	ENSG00000105443	ENSG00000105443		"""Pleckstrin homology (PH) domain containing"""	9502	protein-coding gene	gene with protein product		602488	"""pleckstrin homology, Sec7 and coiled/coil domains 2 (cytohesin-2)"", ""pleckstrin homology, Sec7 and coiled-coil domains 2"""	PSCD2L, PSCD2		8706128, 8945478, 20525696	Standard	NM_004228		Approved	CTS18.1, Sec7p-L, ARNO, Sec7p-like, cytohesin-2	uc002pjj.4	Q99418	OTTHUMG00000150245	ENST00000452733.2:c.748G>T	chr19.hg19:g.48978146G>T	ENSP00000408236:p.Gly250Trp	127.0	0.0		97.0	4.0	NM_017457	A8K8P0|Q8IXY9|Q92958	Missense_Mutation	SNP	ENST00000452733.2	hg19	CCDS12722.1	.	.	.	.	.	.	.	.	.	.	G	23.9	4.469237	0.84533	.	.	ENSG00000105443	ENST00000452733;ENST00000427476	T;T	0.31769	1.48;1.48	4.35	4.35	0.52113	.	0.000000	0.85682	D	0.000000	T	0.63177	0.2489	M	0.91717	3.235	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.72871	-0.4161	10	0.87932	D	0	.	14.7596	0.69596	0.0:0.0:1.0:0.0	.	250	Q99418-2	.	W	250	ENSP00000408236:G250W;ENSP00000391648:G250W	ENSP00000375753:G250W	G	+	1	0	CYTH2	53669958	1.000000	0.71417	0.711000	0.30485	0.949000	0.60115	9.648000	0.98483	2.421000	0.82119	0.491000	0.48974	GGG	.	.		0.622	CYTH2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000317060.1	NM_004228	
BCAT2	587	hgsc.bcm.edu	37	19	49309901	49309901	+	Missense_Mutation	SNP	C	C	G			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr19:49309901C>G	ENST00000316273.6	-	3	185	c.173G>C	c.(172-174)gGg>gCg	p.G58A	BCAT2_ENST00000599246.1_Intron|BCAT2_ENST00000597011.1_Missense_Mutation_p.G18A|BCAT2_ENST00000598162.1_Missense_Mutation_p.G58A|BCAT2_ENST00000545387.2_Intron|BCAT2_ENST00000402551.1_Missense_Mutation_p.G18A|BCAT2_ENST00000601496.1_5'Flank	NM_001190.3	NP_001181.2	O15382	BCAT2_HUMAN	branched chain amino-acid transaminase 2, mitochondrial	58					branched-chain amino acid biosynthetic process (GO:0009082)|branched-chain amino acid catabolic process (GO:0009083)|cellular nitrogen compound metabolic process (GO:0034641)|isoleucine catabolic process (GO:0006550)|leucine metabolic process (GO:0006551)|regulation of hormone levels (GO:0010817)|small molecule metabolic process (GO:0044281)|valine metabolic process (GO:0006573)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	branched-chain-amino-acid transaminase activity (GO:0004084)|L-isoleucine transaminase activity (GO:0052656)|L-leucine transaminase activity (GO:0052654)|L-valine transaminase activity (GO:0052655)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(5)|ovary(2)|skin(1)	12		all_epithelial(76;7e-07)|all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.000138)|all cancers(93;0.000366)|Epithelial(262;0.0195)|GBM - Glioblastoma multiforme(486;0.0224)	L-Isoleucine(DB00167)|L-Leucine(DB00149)	AAATGTCTTCCCAAACACCAG	0.582																																					p.G58A		Atlas-SNP	.											.	BCAT2	35	.	0			c.G173C						.						115.0	118.0	117.0					19																	49309901		2203	4300	6503	SO:0001583	missense	587	exon3			GTCTTCCCAAACA	U68418	CCDS12735.1, CCDS54290.1, CCDS74416.1	19q13.33	2013-09-20	2010-05-07		ENSG00000105552	ENSG00000105552	2.6.1.42		977	protein-coding gene	gene with protein product		113530	"""branched chain aminotransferase 2, mitochondrial"""	BCT2		9165094	Standard	NM_001190		Approved	BCAM	uc002pkr.3	O15382	OTTHUMG00000183327	ENST00000316273.6:c.173G>C	chr19.hg19:g.49309901C>G	ENSP00000322991:p.Gly58Ala	60.0	0.0		60.0	22.0	NM_001190	B2RB87|O00269|Q96KG1|Q9BTB6|Q9BUU6	Missense_Mutation	SNP	ENST00000316273.6	hg19	CCDS12735.1	.	.	.	.	.	.	.	.	.	.	C	28.1	4.890544	0.91889	.	.	ENSG00000105552	ENST00000316273;ENST00000402551	T;T	0.66995	-0.24;-0.24	5.27	5.27	0.74061	.	0.000000	0.85682	D	0.000000	D	0.86422	0.5929	M	0.93328	3.405	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.89734	0.3928	10	0.87932	D	0	-34.067	16.7525	0.85489	0.0:1.0:0.0:0.0	.	58;58	Q53EW7;O15382	.;BCAT2_HUMAN	A	58;18	ENSP00000322991:G58A;ENSP00000385161:G18A	ENSP00000322991:G58A	G	-	2	0	BCAT2	54001713	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.059000	0.76684	2.626000	0.88956	0.650000	0.86243	GGG	.	.		0.582	BCAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466202.1		
LRRC4B	94030	hgsc.bcm.edu	37	19	51022208	51022208	+	Silent	SNP	G	G	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr19:51022208G>A	ENST00000599957.1	-	3	959	c.762C>T	c.(760-762)agC>agT	p.S254S	LRRC4B_ENST00000389201.3_Silent_p.S254S			Q9NT99	LRC4B_HUMAN	leucine rich repeat containing 4B	254					positive regulation of synapse assembly (GO:0051965)	cell junction (GO:0030054)|cerebellar mossy fiber (GO:0044300)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synapse (GO:0045202)				breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(6)|liver(1)|lung(11)|prostate(4)|skin(1)|urinary_tract(1)	30		all_neural(266;0.131)		OV - Ovarian serous cystadenocarcinoma(262;0.00284)|GBM - Glioblastoma multiforme(134;0.0188)		GCTTGCGCAGGCTGGTGAGAC	0.657																																					p.S254S		Atlas-SNP	.											.	LRRC4B	89	.	0			c.C762T						.						36.0	44.0	41.0					19																	51022208		2143	4243	6386	SO:0001819	synonymous_variant	94030	exon3			GCGCAGGCTGGTG	BC032460	CCDS42595.1	19q13.33	2014-01-30	2004-06-14	2004-06-16	ENSG00000131409	ENSG00000131409		"""Immunoglobulin superfamily / I-set domain containing"", ""Endogenous ligands"""	25042	protein-coding gene	gene with protein product	"""netrin-G3 ligand"""		"""leucine-rich repeats and immunoglobulin-like domains 4"""	LRIG4		11441184	Standard	NM_001080457		Approved	DKFZp761A179, HSM	uc002pss.3	Q9NT99		ENST00000599957.1:c.762C>T	chr19.hg19:g.51022208G>A		77.0	0.0		66.0	21.0	NM_001080457	Q3ZCQ4|Q58F20	Silent	SNP	ENST00000599957.1	hg19	CCDS42595.1																																																																																			.	.		0.657	LRRC4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464907.1	NM_001080457	
SYT3	84258	hgsc.bcm.edu	37	19	51128790	51128790	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr19:51128790C>A	ENST00000338916.4	-	6	2067	c.1434G>T	c.(1432-1434)gaG>gaT	p.E478D	SYT3_ENST00000593901.1_Missense_Mutation_p.E478D|SYT3_ENST00000544769.1_Missense_Mutation_p.E478D|SYT3_ENST00000600079.1_Missense_Mutation_p.E478D	NM_032298.2	NP_115674.1	Q9BQG1	SYT3_HUMAN	synaptotagmin III	478	C2 2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				calcium ion-dependent exocytosis (GO:0017156)|positive regulation of vesicle fusion (GO:0031340)|response to calcium ion (GO:0051592)	cell junction (GO:0030054)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|synaptic vesicle (GO:0008021)	calcium-dependent phospholipid binding (GO:0005544)|metal ion binding (GO:0046872)|phosphatidylserine binding (GO:0001786)|transporter activity (GO:0005215)			breast(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(16)|ovary(2)|prostate(2)|skin(3)|urinary_tract(2)	35		all_neural(266;0.131)		OV - Ovarian serous cystadenocarcinoma(262;0.00462)|GBM - Glioblastoma multiforme(134;0.0188)		GACGCCGCCCCTCGCTGATCA	0.597																																					p.E478D		Atlas-SNP	.											.	SYT3	85	.	0			c.G1434T						.						53.0	48.0	50.0					19																	51128790		2203	4300	6503	SO:0001583	missense	84258	exon6			CCGCCCCTCGCTG	AL136594	CCDS12798.1	19q13.33	2014-07-02			ENSG00000213023	ENSG00000213023		"""Synaptotagmins"""	11511	protein-coding gene	gene with protein product		600327				7749232	Standard	NM_032298		Approved		uc002psv.3	Q9BQG1	OTTHUMG00000183064	ENST00000338916.4:c.1434G>T	chr19.hg19:g.51128790C>A	ENSP00000340914:p.Glu478Asp	114.0	0.0		84.0	27.0	NM_032298	Q8N5Z1|Q8N640	Missense_Mutation	SNP	ENST00000338916.4	hg19	CCDS12798.1	.	.	.	.	.	.	.	.	.	.	C	0.752	-0.772578	0.02951	.	.	ENSG00000213023	ENST00000338916;ENST00000544769	T;T	0.69806	-0.43;-0.43	3.47	2.42	0.29668	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.289846	0.26103	U	0.026337	T	0.36386	0.0965	N	0.10782	0.045	0.39903	D	0.973925	B	0.06786	0.001	B	0.09377	0.004	T	0.28396	-1.0045	10	0.02654	T	1	.	5.8191	0.18518	0.0:0.6568:0.0:0.3432	.	478	Q9BQG1	SYT3_HUMAN	D	478	ENSP00000340914:E478D;ENSP00000438883:E478D	ENSP00000340914:E478D	E	-	3	2	SYT3	55820602	0.499000	0.26083	1.000000	0.80357	0.798000	0.45092	-0.257000	0.08745	0.600000	0.29862	0.549000	0.68633	GAG	.	.		0.597	SYT3-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464910.1	NM_032298	
SIGLEC7	27036	hgsc.bcm.edu	37	19	51645871	51645871	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr19:51645871A>T	ENST00000317643.6	+	1	314	c.245A>T	c.(244-246)aAc>aTc	p.N82I	SIGLEC7_ENST00000305628.7_Missense_Mutation_p.N82I|SIGLEC7_ENST00000600577.1_Missense_Mutation_p.N82I	NM_014385.2	NP_055200.1	Q9Y286	SIGL7_HUMAN	sialic acid binding Ig-like lectin 7	82	Ig-like V-type.				cell adhesion (GO:0007155)	integral component of plasma membrane (GO:0005887)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)			autonomic_ganglia(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(10)|lung(11)|skin(2)|stomach(1)	29		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.000836)|OV - Ovarian serous cystadenocarcinoma(262;0.00297)		GCCACAAACAACCCAGCTTGG	0.557																																					p.N82I		Atlas-SNP	.											.	SIGLEC7	74	.	0			c.A245T						.						114.0	106.0	109.0					19																	51645871		2203	4300	6503	SO:0001583	missense	27036	exon1			CAAACAACCCAGC	AF170485	CCDS12826.1, CCDS42601.1, CCDS62771.1	19q13.41	2014-03-20			ENSG00000168995	ENSG00000168995		"""Sialic acid binding Ig-like lectins"", ""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10876	protein-coding gene	gene with protein product		604410	"""sialic acid binding Ig-like lectin 19, pseudogene"", ""sialic acid binding Ig-like lectin, pseudogene 2"""	SIGLEC19P, SIGLECP2		10567377	Standard	NM_001277201		Approved	SIGLEC-7, p75/AIRM1, QA79, CD328	uc002pvv.1	Q9Y286	OTTHUMG00000182895	ENST00000317643.6:c.245A>T	chr19.hg19:g.51645871A>T	ENSP00000323328:p.Asn82Ile	139.0	0.0		95.0	9.0	NM_016543	Q9NZQ1|Q9UJ86|Q9UJ87|Q9Y502	Missense_Mutation	SNP	ENST00000317643.6	hg19	CCDS12826.1	.	.	.	.	.	.	.	.	.	.	.	11.84	1.758486	0.31137	.	.	ENSG00000168995	ENST00000317643;ENST00000305628;ENST00000536156	T;T;T	0.49139	0.79;0.79;0.79	2.71	-1.34	0.09143	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like fold (1);	1.309180	0.05595	N	0.575386	T	0.62514	0.2434	M	0.78049	2.395	0.09310	N	1	D;B;P	0.89917	1.0;0.091;0.511	D;B;P	0.85130	0.997;0.13;0.525	T	0.50363	-0.8837	10	0.72032	D	0.01	.	0.3232	0.00306	0.4013:0.2289:0.1459:0.2239	.	82;82;82	Q9Y286-4;Q9Y286-2;Q9Y286	.;.;SIGL7_HUMAN	I	82	ENSP00000323328:N82I;ENSP00000306757:N82I;ENSP00000437609:N82I	ENSP00000306757:N82I	N	+	2	0	SIGLEC7	56337683	0.001000	0.12720	0.001000	0.08648	0.004000	0.04260	0.851000	0.27751	-0.078000	0.12730	-0.525000	0.04345	AAC	.	.		0.557	SIGLEC7-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464226.2	NM_016543	
HAS1	3036	hgsc.bcm.edu	37	19	52219555	52219555	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr19:52219555C>A	ENST00000222115.1	-	4	1049	c.1015G>T	c.(1015-1017)Gac>Tac	p.D339Y	HAS1_ENST00000601714.1_Missense_Mutation_p.D346Y|HAS1_ENST00000594621.1_Intron|HAS1_ENST00000540069.2_Missense_Mutation_p.D338Y	NM_001523.2	NP_001514.2	Q92839	HYAS1_HUMAN	hyaluronan synthase 1	339					carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|cellular response to platelet-derived growth factor stimulus (GO:0036120)|extracellular matrix assembly (GO:0085029)|extracellular polysaccharide biosynthetic process (GO:0045226)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|hyaluronan biosynthetic process (GO:0030213)|hyaluronan metabolic process (GO:0030212)|negative regulation of fibroblast migration (GO:0010764)|small molecule metabolic process (GO:0044281)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	hyaluronan synthase activity (GO:0050501)			breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(13)|ovary(1)|pancreas(1)|prostate(1)|skin(4)	40		all_neural(266;0.0189)|Medulloblastoma(540;0.146)		GBM - Glioblastoma multiforme(134;0.00102)|OV - Ovarian serous cystadenocarcinoma(262;0.0177)		AGGTGCCGGTCATCCCCAAAA	0.532																																					p.D339Y	NSCLC(132;636 2450 45807 47979)	Atlas-SNP	.											.	HAS1	61	.	0			c.G1015T						.						117.0	106.0	110.0					19																	52219555		2203	4300	6503	SO:0001583	missense	3036	exon4			GCCGGTCATCCCC	U59269	CCDS12838.1, CCDS74436.1	19q13.3-q13.4	2013-02-22			ENSG00000105509	ENSG00000105509	2.4.1.212	"""Glycosyltransferase family 2 domain containing"""	4818	protein-coding gene	gene with protein product		601463		HAS		9169154	Standard	XM_005258834		Approved		uc002pxo.1	Q92839		ENST00000222115.1:c.1015G>T	chr19.hg19:g.52219555C>A	ENSP00000222115:p.Asp339Tyr	163.0	0.0		103.0	38.0	NM_001523	Q14470|Q9NS49	Missense_Mutation	SNP	ENST00000222115.1	hg19	CCDS12838.1	.	.	.	.	.	.	.	.	.	.	c	16.53	3.148197	0.57151	.	.	ENSG00000105509	ENST00000540069;ENST00000222115	T;T	0.76186	-1.0;-1.0	3.35	3.35	0.38373	.	0.188629	0.44097	U	0.000494	D	0.89406	0.6706	H	0.96301	3.8	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.79108	0.985;0.992;0.992	D	0.92135	0.5715	10	0.87932	D	0	-12.7644	12.592	0.56447	0.0:1.0:0.0:0.0	.	338;339;338	G3V1S7;Q92839;Q8IYH3	.;HAS1_HUMAN;.	Y	338;339	ENSP00000445021:D338Y;ENSP00000222115:D339Y	ENSP00000222115:D339Y	D	-	1	0	HAS1	56911367	1.000000	0.71417	1.000000	0.80357	0.558000	0.35554	7.614000	0.82996	1.608000	0.50180	0.165000	0.16767	GAC	.	.		0.532	HAS1-005	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000466953.1	NM_001523	
ZNF28	7576	hgsc.bcm.edu	37	19	53303548	53303548	+	Missense_Mutation	SNP	T	T	C	rs369691107		TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr19:53303548T>C	ENST00000457749.2	-	4	1669	c.1550A>G	c.(1549-1551)cAt>cGt	p.H517R	ZNF28_ENST00000438150.2_Missense_Mutation_p.H464R|ZNF28_ENST00000414252.2_Missense_Mutation_p.H464R|ZNF28_ENST00000360272.4_Missense_Mutation_p.H464R	NM_006969.3	NP_008900.3	P17035	ZNF28_HUMAN	zinc finger protein 28	517					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|liver(1)|lung(10)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	34				GBM - Glioblastoma multiforme(134;0.0386)|Lung(386;0.145)		CTCTCCAGTATGAACTCTCTG	0.398																																					p.H517R		Atlas-SNP	.											.	ZNF28	191	.	0			c.A1550G						.	T	ARG/HIS	1,4405		0,1,2202	106.0	107.0	107.0		1550	1.9	0.0	19		107	0,8600		0,0,4300	no	missense	ZNF28	NM_006969.3	29	0,1,6502	CC,CT,TT		0.0,0.0227,0.0077	possibly-damaging	517/719	53303548	1,13005	2203	4300	6503	SO:0001583	missense	7576	exon4			CCAGTATGAACTC	X52355	CCDS33093.1, CCDS33093.2	19q13.41	2013-01-08	2006-05-10		ENSG00000198538	ENSG00000198538		"""Zinc fingers, C2H2-type"", ""-"""	13073	protein-coding gene	gene with protein product			"""zinc finger protein 28 (KOX 24)"""				Standard	NR_036599		Approved	KOX24, DKFZp781D0275	uc002qad.3	P17035	OTTHUMG00000154564	ENST00000457749.2:c.1550A>G	chr19.hg19:g.53303548T>C	ENSP00000397693:p.His517Arg	104.0	0.0		65.0	21.0	NM_006969	A8KAK9|B4E3G0|B9EIK7|Q5H9V1|Q5HYM9|Q6ZML9|Q6ZN56	Missense_Mutation	SNP	ENST00000457749.2	hg19	CCDS33093.2	.	.	.	.	.	.	.	.	.	.	-	14.01	2.408932	0.42715	2.27E-4	0.0	ENSG00000198538	ENST00000438150;ENST00000457749;ENST00000360272;ENST00000414252;ENST00000391783	T;T;T;T;T	0.67523	-0.27;-0.27;-0.27;-0.27;-0.27	1.89	1.89	0.25635	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.81650	0.4867	M	0.92026	3.265	0.26204	N	0.979409	D	0.89917	1.0	D	0.70935	0.971	T	0.68522	-0.5386	9	0.87932	D	0	.	5.838	0.18617	0.0:0.0:0.2728:0.7272	.	517	P17035	ZNF28_HUMAN	R	464;517;464;464;464	ENSP00000412143:H464R;ENSP00000397693:H517R;ENSP00000353410:H464R;ENSP00000444965:H464R;ENSP00000375661:H464R	ENSP00000353410:H464R	H	-	2	0	ZNF28	57995360	0.978000	0.34361	0.028000	0.17463	0.057000	0.15508	2.163000	0.42377	0.861000	0.35504	0.333000	0.21579	CAT	.	.		0.398	ZNF28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336038.2	NM_006969	
LILRB3	11025	hgsc.bcm.edu	37	19	54721082	54721082	+	Silent	SNP	A	A	G			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr19:54721082A>G	ENST00000391750.1	-	14	1912	c.1776T>C	c.(1774-1776)gaT>gaC	p.D592D	LILRB3_ENST00000346401.6_Silent_p.D604D|LILRA6_ENST00000270464.5_Silent_p.D593D|LILRB3_ENST00000469273.1_5'UTR|LILRB3_ENST00000407860.2_Silent_p.D609D|LILRB3_ENST00000245620.9_Silent_p.D593D|LILRB3_ENST00000424807.1_Silent_p.D592D|LILRA6_ENST00000419410.2_Silent_p.D593D|LILRA6_ENST00000440558.2_Silent_p.D592D|LILRA6_ENST00000391735.3_3'UTR			O75022	LIRB3_HUMAN	leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 3	592					cell surface receptor signaling pathway (GO:0007166)|defense response (GO:0006952)|immune system process (GO:0002376)|negative regulation of osteoclast differentiation (GO:0045671)	integral component of plasma membrane (GO:0005887)	receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)			endometrium(3)|kidney(13)|large_intestine(1)|lung(6)|ovary(2)|prostate(5)|skin(2)|stomach(1)|urinary_tract(1)	34	all_cancers(19;0.00723)|all_epithelial(19;0.00389)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		CGTAGGTCACATCCTGGGAGG	0.632																																					p.D593D		Atlas-SNP	.											.	LILRB3	67	.	0			c.T1779C						.						87.0	90.0	89.0					19																	54721082		2203	4300	6503	SO:0001819	synonymous_variant	11025	exon13			GGTCACATCCTGG	U91928	CCDS33105.1, CCDS46175.1	19q13.4	2013-01-11			ENSG00000204577	ENSG00000204577		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6607	protein-coding gene	gene with protein product		604820				9278324, 9382880	Standard	NM_006864		Approved	LIR-3, HL9, ILT5, LIR3, CD85a	uc002qee.1	O75022	OTTHUMG00000066626	ENST00000391750.1:c.1776T>C	chr19.hg19:g.54721082A>G		176.0	0.0		166.0	80.0	NM_001081450	C9J1P3|C9JIP1|O15471|Q86U49	Silent	SNP	ENST00000391750.1	hg19	CCDS33105.1																																																																																			.	.		0.632	LILRB3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000142844.5	NM_006864	
LILRA3	11026	hgsc.bcm.edu	37	19	54803147	54803147	+	Nonsense_Mutation	SNP	G	G	C			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr19:54803147G>C	ENST00000251390.3	-	4	621	c.530C>G	c.(529-531)tCa>tGa	p.S177*	LILRA3_ENST00000391745.1_Nonsense_Mutation_p.S194*|LILRA3_ENST00000391744.3_Intron	NM_006865.3	NP_006856.3	Q8N6C8	LIRA3_HUMAN	leukocyte immunoglobulin-like receptor, subfamily A (without TM domain), member 3	177	Ig-like C2-type 2.				defense response (GO:0006952)|immune system process (GO:0002376)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|plasma membrane (GO:0005886)	antigen binding (GO:0003823)|receptor activity (GO:0004872)			NS(3)|breast(1)|kidney(1)|large_intestine(3)|lung(12)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	28	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		GGCCCGGGATGACCCACGGGC	0.562																																					p.S177X		Atlas-SNP	.											.	LILRA3	65	.	0			c.C530G						.						147.0	120.0	129.0					19																	54803147		2195	4162	6357	SO:0001587	stop_gained	11026	exon4			CGGGATGACCCAC	U91926		19q13.4	2013-01-11						"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6604	protein-coding gene	gene with protein product		604818				9278324, 9548455	Standard	XM_006710242		Approved	LIR-4, HM43, ILT6, HM31, LIR4, CD85e		Q8N6C8		ENST00000251390.3:c.530C>G	chr19.hg19:g.54803147G>C	ENSP00000251390:p.Ser177*	167.0	0.0		129.0	46.0	NM_006865	J3KPM2|O15469|O15470|O75016|Q8N151|Q8N154|Q8NHJ1|Q8NHJ2|Q8NHJ3|Q8NHJ4	Nonsense_Mutation	SNP	ENST00000251390.3	hg19	CCDS12887.1	.	.	.	.	.	.	.	.	.	.	G	20.5	4.004390	0.74932	.	.	ENSG00000170866	ENST00000251390;ENST00000391745	.	.	.	2.21	-4.29	0.03721	.	0.915817	0.09155	N	0.840975	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.39692	T	0.17	.	4.8661	0.13609	0.0:0.4858:0.2096:0.3046	.	.	.	.	X	177;194	.	ENSP00000251390:S177X	S	-	2	0	LILRA3	59494959	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.222000	0.02965	-1.079000	0.03113	-1.081000	0.02215	TCA	.	.		0.562	LILRA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000140236.1		
U2AF2	11338	hgsc.bcm.edu	37	19	56173908	56173908	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr19:56173908G>T	ENST00000308924.4	+	6	567	c.527G>T	c.(526-528)gGg>gTg	p.G176V	U2AF2_ENST00000590551.1_Missense_Mutation_p.G12V|CTD-2537I9.12_ENST00000585940.1_RNA|CTD-2537I9.12_ENST00000589456.1_RNA|U2AF2_ENST00000450554.2_Missense_Mutation_p.G176V			P26368	U2AF2_HUMAN	U2 small nuclear RNA auxiliary factor 2	176	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.				gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	enzyme binding (GO:0019899)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.G176E(1)|p.G176V(1)		biliary_tract(1)|central_nervous_system(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(3)|lung(9)|ovary(1)|prostate(1)|urinary_tract(2)	21		Colorectal(82;0.00244)|Ovarian(87;0.133)	BRCA - Breast invasive adenocarcinoma(297;0.18)	GBM - Glioblastoma multiforme(193;0.107)		ATGCGCCTGGGGGGGCTGACC	0.607																																					p.G176V		Atlas-SNP	.											U2AF2,NS,carcinoma,0,2	U2AF2	62	.	2	Substitution - Missense(2)	lung(2)	c.G527T						.						40.0	48.0	45.0					19																	56173908		2203	4300	6503	SO:0001583	missense	11338	exon6			GCCTGGGGGGGCT	BC008740	CCDS12933.1, CCDS46197.1	19q13.43	2014-09-17	2006-04-11			ENSG00000063244		"""RNA binding motif (RRM) containing"""	23156	protein-coding gene	gene with protein product	"""U2 small nuclear ribonucleoprotein auxiliary factor (65kD)"", ""splicing factor U2AF 65 kD subunit"", ""U2 snRNP auxiliary factor large subunit"""	191318	"""U2 (RNU2) small nuclear RNA auxiliary factor 2"""			1538748	Standard	XM_006722994		Approved	U2AF65	uc002qlu.3	P26368		ENST00000308924.4:c.527G>T	chr19.hg19:g.56173908G>T	ENSP00000307863:p.Gly176Val	156.0	1.0		131.0	52.0	NM_001012478	Q96HC5	Missense_Mutation	SNP	ENST00000308924.4	hg19	CCDS12933.1	.	.	.	.	.	.	.	.	.	.	G	8.764	0.924203	0.18056	.	.	ENSG00000063244	ENST00000308924;ENST00000450554	T;T	0.11604	2.76;2.76	4.13	3.06	0.35304	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.000000	0.85682	D	0.000000	T	0.04998	0.0134	N	0.05441	-0.05	0.80722	D	1	B;B	0.09022	0.002;0.001	B;B	0.08055	0.003;0.001	T	0.34477	-0.9827	10	0.11182	T	0.66	-22.3889	11.8012	0.52128	0.0965:0.0:0.9035:0.0	.	176;176	P26368;P26368-2	U2AF2_HUMAN;.	V	176	ENSP00000307863:G176V;ENSP00000388475:G176V	ENSP00000307863:G176V	G	+	2	0	U2AF2	60865720	1.000000	0.71417	0.984000	0.44739	0.967000	0.64934	7.171000	0.77595	2.023000	0.59567	0.585000	0.79938	GGG	.	.		0.607	U2AF2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000453599.1	NM_007279	
PEG3	5178	hgsc.bcm.edu	37	19	57327366	57327366	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr19:57327366T>C	ENST00000326441.9	-	10	2807	c.2444A>G	c.(2443-2445)cAt>cGt	p.H815R	ZIM2_ENST00000601070.1_Intron|PEG3_ENST00000593695.1_Missense_Mutation_p.H689R|PEG3_ENST00000423103.2_Missense_Mutation_p.H815R|ZIM2_ENST00000391708.3_Intron|ZIM2_ENST00000599935.1_Intron|ZIM2_ENST00000221722.5_Intron|ZIM2_ENST00000593711.1_Intron|PEG3_ENST00000598410.1_Missense_Mutation_p.H691R	NM_006210.2	NP_006201.1	Q9GZU2	PEG3_HUMAN	paternally expressed 3	815					apoptotic process (GO:0006915)|genetic imprinting (GO:0071514)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			NS(1)|biliary_tract(4)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(27)|lung(84)|ovary(8)|pancreas(5)|prostate(6)|skin(8)|stomach(2)|upper_aerodigestive_tract(6)	170		Colorectal(82;0.000256)|all_neural(62;0.103)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0269)		AACTCTCTGATGGTTGATAGC	0.468																																					p.H815R		Atlas-SNP	.											.	PEG3	414	.	0			c.A2444G						.						134.0	127.0	129.0					19																	57327366		2203	4300	6503	SO:0001583	missense	5178	exon9			CTCTGATGGTTGA	AB006625	CCDS12948.1, CCDS58684.1, CCDS58685.1	19q13.4	2013-01-09				ENSG00000198300		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	8826	protein-coding gene	gene with protein product		601483				9149948	Standard	NM_006210		Approved	ZKSCAN22, KIAA0287, ZNF904, ZSCAN24	uc010etr.2	Q9GZU2		ENST00000326441.9:c.2444A>G	chr19.hg19:g.57327366T>C	ENSP00000326581:p.His815Arg	177.0	0.0		148.0	6.0	NM_001146184	A7E2B8|B4DIM4|C9JP50|P78418|Q5H9P9|Q7Z7H7|Q8TF75|Q9GZY2	Missense_Mutation	SNP	ENST00000326441.9	hg19	CCDS12948.1	.	.	.	.	.	.	.	.	.	.	T	11.08	1.533271	0.27387	.	.	ENSG00000198300	ENST00000326441;ENST00000423103	T;T	0.02579	4.24;4.24	3.96	2.85	0.33270	.	1.141450	0.06613	N	0.756038	T	0.04182	0.0116	M	0.61703	1.905	.	.	.	P;B;B	0.37015	0.578;0.0;0.002	B;B;B	0.28305	0.088;0.001;0.002	T	0.34428	-0.9829	9	0.87932	D	0	-1.1202	6.8699	0.24115	0.0:0.1351:0.0:0.8649	.	691;815;750	A7E2B8;Q9GZU2;Q96Q96	.;PEG3_HUMAN;.	R	815	ENSP00000326581:H815R;ENSP00000403051:H815R	ENSP00000326581:H815R	H	-	2	0	ZIM2	62019178	0.001000	0.12720	0.001000	0.08648	0.011000	0.07611	0.951000	0.29135	0.805000	0.34159	0.477000	0.44152	CAT	.	.		0.468	PEG3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416099.2		
ZIM3	114026	hgsc.bcm.edu	37	19	57646378	57646378	+	Nonsense_Mutation	SNP	C	C	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr19:57646378C>A	ENST00000269834.1	-	5	1712	c.1327G>T	c.(1327-1329)Gga>Tga	p.G443*	U3_ENST00000516874.1_RNA	NM_052882.1	NP_443114.1	Q96PE6	ZIM3_HUMAN	zinc finger, imprinted 3	443					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(27)|pancreas(1)|prostate(3)|skin(1)|urinary_tract(1)	52		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.243)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		GGTTTTTGTCCAGTATGGGTT	0.418																																					p.G443X		Atlas-SNP	.											.	ZIM3	107	.	0			c.G1327T						.						139.0	142.0	141.0					19																	57646378		2203	4300	6503	SO:0001587	stop_gained	114026	exon5			TTTGTCCAGTATG	AF365931	CCDS33125.1	19q13.4	2013-01-08				ENSG00000141946		"""Zinc fingers, C2H2-type"", ""-"""	16366	protein-coding gene	gene with protein product							Standard	NM_052882		Approved	ZNF657	uc002qnz.1	Q96PE6		ENST00000269834.1:c.1327G>T	chr19.hg19:g.57646378C>A	ENSP00000269834:p.Gly443*	143.0	0.0		127.0	50.0	NM_052882	Q14CA6	Nonsense_Mutation	SNP	ENST00000269834.1	hg19	CCDS33125.1	.	.	.	.	.	.	.	.	.	.	C	38	7.017602	0.98006	.	.	ENSG00000141946	ENST00000269834	.	.	.	2.16	1.11	0.20524	.	.	.	.	.	.	.	.	.	.	.	0.53005	D	0.999966	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	.	6.5562	0.22462	0.0:0.8376:0.0:0.1624	.	.	.	.	X	443	.	ENSP00000269834:G443X	G	-	1	0	ZIM3	62338190	0.000000	0.05858	0.002000	0.10522	0.281000	0.26958	0.080000	0.14802	0.458000	0.26988	0.313000	0.20887	GGA	.	.		0.418	ZIM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465078.1		
ZNF256	10172	hgsc.bcm.edu	37	19	58452722	58452722	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr19:58452722T>C	ENST00000282308.3	-	3	1650	c.1454A>G	c.(1453-1455)cAt>cGt	p.H485R	ZNF256_ENST00000598928.1_3'UTR	NM_005773.2	NP_005764.2	Q9Y2P7	ZN256_HUMAN	zinc finger protein 256	485					multicellular organismal development (GO:0007275)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(1)|kidney(3)|large_intestine(6)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	19		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Breast(46;0.0389)|Ovarian(87;0.0443)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0155)		TGCTCCAGTATGAACTTTCCA	0.453																																					p.H485R	NSCLC(55;1313 1552 8040 11996)	Atlas-SNP	.											.	ZNF256	117	.	0			c.A1454G						.						87.0	86.0	86.0					19																	58452722		2203	4300	6503	SO:0001583	missense	10172	exon3			CCAGTATGAACTT	AF067165	CCDS12966.1	19q13	2013-01-08				ENSG00000152454		"""Zinc fingers, C2H2-type"", ""-"""	13049	protein-coding gene	gene with protein product		606956					Standard	NM_005773		Approved	BMZF-3	uc002qqu.3	Q9Y2P7		ENST00000282308.3:c.1454A>G	chr19.hg19:g.58452722T>C	ENSP00000282308:p.His485Arg	60.0	0.0		56.0	21.0	NM_005773	B2RA92|Q53Y85|Q9BV71	Missense_Mutation	SNP	ENST00000282308.3	hg19	CCDS12966.1	.	.	.	.	.	.	.	.	.	.	.	23.2	4.384159	0.82792	.	.	ENSG00000152454	ENST00000282308	T	0.67523	-0.27	2.96	2.96	0.34315	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	D	0.84492	0.5484	H	0.94964	3.605	0.36779	D	0.884254	D	0.89917	1.0	D	0.77004	0.989	D	0.89023	0.3436	9	0.87932	D	0	.	10.4264	0.44380	0.0:0.0:0.0:1.0	.	485	Q9Y2P7	ZN256_HUMAN	R	485	ENSP00000282308:H485R	ENSP00000282308:H485R	H	-	2	0	ZNF256	63144534	1.000000	0.71417	0.165000	0.22776	0.798000	0.45092	3.644000	0.54381	1.341000	0.45600	0.383000	0.25322	CAT	.	.		0.453	ZNF256-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466702.1		
SLC27A5	10998	hgsc.bcm.edu	37	19	59022230	59022230	+	Silent	SNP	G	G	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr19:59022230G>A	ENST00000263093.2	-	2	865	c.756C>T	c.(754-756)ctC>ctT	p.L252L	SLC27A5_ENST00000601355.1_Silent_p.L168L	NM_012254.2	NP_036386.1	Q9Y2P5	S27A5_HUMAN	solute carrier family 27 (fatty acid transporter), member 5	252					bile acid and bile salt transport (GO:0015721)|bile acid biosynthetic process (GO:0006699)|bile acid metabolic process (GO:0008206)|ketone body biosynthetic process (GO:0046951)|plasma membrane long-chain fatty acid transport (GO:0015911)|small molecule metabolic process (GO:0044281)|triglyceride mobilization (GO:0006642)|very long-chain fatty acid metabolic process (GO:0000038)	basal plasma membrane (GO:0009925)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)|protein complex (GO:0043234)	ATP binding (GO:0005524)|cholate-CoA ligase activity (GO:0047747)|fatty acid transporter activity (GO:0015245)|very long-chain fatty acid-CoA ligase activity (GO:0031957)			central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(7)|ovary(1)|skin(1)|urinary_tract(1)	19		all_cancers(17;4.4e-22)|all_epithelial(17;2.15e-16)|Lung NSC(17;1.24e-06)|all_lung(17;5.41e-06)|Colorectal(82;3.46e-05)|Renal(17;0.00179)|all_neural(62;0.00607)|Ovarian(87;0.0443)|Breast(46;0.0928)|Medulloblastoma(540;0.184)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0168)|Lung(386;0.181)		AGGTATGGCTGAGGTAGAAGC	0.632																																					p.L252L		Atlas-SNP	.											SLC27A5,bladder,carcinoma,0,1	SLC27A5	58	.	0			c.C756T						.						34.0	35.0	34.0					19																	59022230		2203	4300	6503	SO:0001819	synonymous_variant	10998	exon2			ATGGCTGAGGTAG	AF064255	CCDS12983.1	19q13.43	2013-07-15			ENSG00000083807	ENSG00000083807		"""Acyl-CoA synthetase family"", ""Solute carriers"""	10999	protein-coding gene	gene with protein product	"""fatty-acid-Coenzyme A ligase, very long-chain 3"""	603314				10479480, 10749848	Standard	NM_012254		Approved	FATP5, VLACSR, VLCS-H2, VLCSH2, FACVL3, FLJ22987, ACSVL6, ACSB	uc002qtc.2	Q9Y2P5	OTTHUMG00000183543	ENST00000263093.2:c.756C>T	chr19.hg19:g.59022230G>A		55.0	0.0		52.0	25.0	NM_012254	B3KVP6|B4DPQ1	Silent	SNP	ENST00000263093.2	hg19	CCDS12983.1																																																																																			.	.		0.632	SLC27A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000467060.1	NM_012254	
SOX12	6666	hgsc.bcm.edu	37	20	306791	306791	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr20:306791G>A	ENST00000342665.2	+	1	553	c.223G>A	c.(223-225)Ggc>Agc	p.G75S	RP5-1103G7.4_ENST00000442637.1_RNA|RP5-1103G7.4_ENST00000414676.1_RNA|SOX12_ENST00000544632.1_Missense_Mutation_p.G75S	NM_006943.2	NP_008874.2	O15370	SOX12_HUMAN	SRY (sex determining region Y)-box 12	75					cell fate commitment (GO:0045165)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein-DNA complex assembly (GO:0065004)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|spinal cord development (GO:0021510)	nucleus (GO:0005634)|protein-DNA complex (GO:0032993)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription coactivator activity (GO:0001105)|transcription regulatory region sequence-specific DNA binding (GO:0000976)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)	2		all_cancers(10;0.000331)|Lung NSC(37;0.0496)|all_lung(30;0.0831)|all_epithelial(17;0.0868)|Breast(17;0.231)	OV - Ovarian serous cystadenocarcinoma(29;0.149)			CAAGCGCCTGGGCCGCCGCTG	0.642																																					p.G75S		Atlas-SNP	.											.	SOX12	8	.	0			c.G223A						.						25.0	24.0	24.0					20																	306791		2191	4288	6479	SO:0001583	missense	6666	exon1			CGCCTGGGCCGCC	U35612	CCDS12995.1	20p13	2008-07-28	2002-07-22	2002-07-26	ENSG00000177732	ENSG00000177732		"""SRY (sex determining region Y)-boxes"""	11198	protein-coding gene	gene with protein product		601947	"""SRY (sex determining region Y)-box 22"""	SOX22		9215677	Standard	NM_006943		Approved		uc002wdh.4	O15370	OTTHUMG00000031623	ENST00000342665.2:c.223G>A	chr20.hg19:g.306791G>A	ENSP00000347646:p.Gly75Ser	155.0	0.0		123.0	51.0	NM_006943	Q5D038|Q9NUD4	Missense_Mutation	SNP	ENST00000342665.2	hg19	CCDS12995.1	.	.	.	.	.	.	.	.	.	.	G	25.2	4.617762	0.87359	.	.	ENSG00000177732	ENST00000544632;ENST00000342665	D;D	0.98947	-5.26;-5.26	3.63	3.63	0.41609	High mobility group, superfamily (1);High mobility group, HMG1/HMG2 (4);	0.000000	0.52532	U	0.000070	D	0.99108	0.9693	M	0.89478	3.035	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.99126	1.0851	10	0.87932	D	0	.	12.8184	0.57679	0.0:0.0:1.0:0.0	.	75	O15370	SOX12_HUMAN	S	75	ENSP00000441671:G75S;ENSP00000347646:G75S	ENSP00000347646:G75S	G	+	1	0	SOX12	254791	1.000000	0.71417	1.000000	0.80357	0.897000	0.52465	6.883000	0.75595	1.858000	0.53909	0.313000	0.20887	GGC	.	.		0.642	SOX12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077435.2	NM_006943	
STK35	140901	hgsc.bcm.edu	37	20	2097911	2097911	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr20:2097911A>G	ENST00000381482.3	+	3	1763	c.1492A>G	c.(1492-1494)Atg>Gtg	p.M498V	STK35_ENST00000246032.3_Missense_Mutation_p.M365V|STK35_ENST00000400064.3_Intron			Q8TDR2	STK35_HUMAN	serine/threonine kinase 35	498	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.					cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			large_intestine(2)|liver(2)|lung(6)|ovary(1)|prostate(2)	13						CAGGACTTCCATGTCTGAGGG	0.507																																					p.M498V		Atlas-SNP	.											.	STK35	31	.	0			c.A1492G						.						82.0	79.0	80.0					20																	2097911		2203	4300	6503	SO:0001583	missense	140901	exon3			ACTTCCATGTCTG	AL359916	CCDS13024.1, CCDS13024.2	20p13	2008-07-02			ENSG00000125834	ENSG00000125834			16254	protein-coding gene	gene with protein product	"""CLP-36 interacting kinase"""	609370				11973348	Standard	NM_080836		Approved	bA550O8.2, CLIK1	uc002wfw.4	Q8TDR2	OTTHUMG00000031688	ENST00000381482.3:c.1492A>G	chr20.hg19:g.2097911A>G	ENSP00000370891:p.Met498Val	127.0	0.0		80.0	40.0	NM_080836	B2RBM3|C7ENV8|Q2NKW6|Q5T3R1|Q5T3R2|Q96AB4|Q9BZ06	Missense_Mutation	SNP	ENST00000381482.3	hg19	CCDS13024.2	.	.	.	.	.	.	.	.	.	.	A	9.602	1.128964	0.21041	.	.	ENSG00000125834	ENST00000381482;ENST00000246032	D;D	0.92595	-3.07;-3.07	5.5	5.5	0.81552	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.81683	0.4874	N	0.02420	-0.555	0.80722	D	1	B	0.17852	0.024	B	0.28385	0.089	T	0.77474	-0.2574	10	0.28530	T	0.3	-16.879	13.6097	0.62071	1.0:0.0:0.0:0.0	.	498	Q8TDR2	STK35_HUMAN	V	498;365	ENSP00000370891:M498V;ENSP00000246032:M365V	ENSP00000246032:M365V	M	+	1	0	STK35	2045911	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.139000	0.94554	2.308000	0.77769	0.533000	0.62120	ATG	.	.		0.507	STK35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077574.3	NM_080836	
SMOX	54498	hgsc.bcm.edu	37	20	4155893	4155893	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr20:4155893T>C	ENST00000305958.4	+	2	416	c.191T>C	c.(190-192)gTg>gCg	p.V64A	SMOX_ENST00000346595.2_Missense_Mutation_p.V64A|SMOX_ENST00000484515.1_3'UTR|SMOX_ENST00000379460.2_Missense_Mutation_p.V64A|SMOX_ENST00000339123.6_Missense_Mutation_p.V64A|SMOX_ENST00000278795.3_Missense_Mutation_p.V64A	NM_175839.2	NP_787033.1	Q9NWM0	SMOX_HUMAN	spermine oxidase	64					cellular nitrogen compound metabolic process (GO:0034641)|oxidation-reduction process (GO:0055114)|polyamine biosynthetic process (GO:0006596)|polyamine catabolic process (GO:0006598)|polyamine metabolic process (GO:0006595)|small molecule metabolic process (GO:0044281)|spermine catabolic process (GO:0046208)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	N1-acetylspermine:oxygen oxidoreductase (N1-acetylspermidine-forming) activity (GO:0052895)|norspermine:oxygen oxidoreductase activity (GO:0052894)|polyamine oxidase activity (GO:0046592)|spermine:oxygen oxidoreductase (spermidine-forming) activity (GO:0052901)			breast(1)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(7)|lung(5)|skin(2)|urinary_tract(1)	26					Spermine(DB00127)	GGAGGCCGTGTGCAGAGTGTG	0.582																																					p.V64A		Atlas-SNP	.											.	SMOX	119	.	0			c.T191C						.						64.0	60.0	61.0					20																	4155893		2203	4300	6503	SO:0001583	missense	54498	exon2			GCCGTGTGCAGAG	AK000753	CCDS13075.1, CCDS13076.1, CCDS13077.1, CCDS13078.1, CCDS74702.1	20p13	2003-10-15	2003-10-15	2003-10-15	ENSG00000088826	ENSG00000088826			15862	protein-coding gene	gene with protein product		615854	"""chromosome 20 open reading frame 16"""	C20orf16		11454677, 12398765	Standard	NM_175839		Approved	FLJ20746, dJ779E11.1, PAO, PAOh1, MGC1010, SMO	uc002wkp.3	Q9NWM0	OTTHUMG00000031777	ENST00000305958.4:c.191T>C	chr20.hg19:g.4155893T>C	ENSP00000307252:p.Val64Ala	106.0	0.0		95.0	36.0	NM_175839	A2A2P5|A2A2P6|A8BE87|D3DVZ4|Q5TE26|Q5TE27|Q6UY28|Q8IX00|Q96LC3|Q96LC4|Q96QT3|Q9BW38|Q9H6H1|Q9NP51|Q9NPY1|Q9NPY2	Missense_Mutation	SNP	ENST00000305958.4	hg19	CCDS13075.1	.	.	.	.	.	.	.	.	.	.	T	22.5	4.300427	0.81136	.	.	ENSG00000088826	ENST00000339123;ENST00000305958;ENST00000278795;ENST00000346595;ENST00000379460	D;D;D;D;D	0.93547	-3.24;-3.24;-3.24;-3.24;-3.24	4.91	4.91	0.64330	Amine oxidase (1);	0.000000	0.85682	D	0.000000	D	0.93527	0.7934	L	0.31371	0.925	0.80722	D	1	D;D;P;D;D;D	0.69078	0.997;0.997;0.909;0.997;0.994;0.987	D;D;P;D;D;D	0.79108	0.992;0.96;0.777;0.992;0.954;0.945	D	0.92618	0.6105	9	.	.	.	-15.1479	12.7905	0.57530	0.0:0.0:0.0:1.0	.	64;64;64;64;64;64	B4DE63;Q9NWM0-6;Q9NWM0-3;Q9NWM0;Q9NWM0-2;Q9NWM0-4	.;.;.;SMOX_HUMAN;.;.	A	64	ENSP00000344595:V64A;ENSP00000307252:V64A;ENSP00000278795:V64A;ENSP00000341775:V64A;ENSP00000368773:V64A	.	V	+	2	0	SMOX	4103893	1.000000	0.71417	0.990000	0.47175	0.970000	0.65996	7.838000	0.86804	1.961000	0.56991	0.455000	0.32223	GTG	.	.		0.582	SMOX-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077806.1	NM_175842	
PLCB4	5332	hgsc.bcm.edu	37	20	9288511	9288511	+	Missense_Mutation	SNP	T	T	G			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr20:9288511T>G	ENST00000378493.1	+	1	65	c.50T>G	c.(49-51)tTg>tGg	p.L17W	PLCB4_ENST00000378473.3_Missense_Mutation_p.L17W|PLCB4_ENST00000492632.1_3'UTR|PLCB4_ENST00000414679.2_Missense_Mutation_p.L17W|PLCB4_ENST00000278655.4_Missense_Mutation_p.L17W|PLCB4_ENST00000378501.2_Missense_Mutation_p.L17W|PLCB4_ENST00000334005.3_Missense_Mutation_p.L17W			Q15147	PLCB4_HUMAN	phospholipase C, beta 4	17					inositol phosphate metabolic process (GO:0043647)|intracellular signal transduction (GO:0035556)|lipid catabolic process (GO:0016042)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|dendrite (GO:0030425)|nucleus (GO:0005634)|postsynaptic density (GO:0014069)|smooth endoplasmic reticulum (GO:0005790)	calcium ion binding (GO:0005509)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|signal transducer activity (GO:0004871)			NS(2)|breast(4)|cervix(1)|endometrium(2)|kidney(4)|large_intestine(11)|liver(4)|lung(34)|ovary(3)|pancreas(1)|prostate(1)|skin(19)|upper_aerodigestive_tract(1)	87						CCCTCCTTTTTGCAAGAAGGA	0.299																																					p.L17W		Atlas-SNP	.											.	PLCB4	204	.	0			c.T50G						.						63.0	59.0	61.0					20																	9288511		2203	4298	6501	SO:0001583	missense	5332	exon2			CCTTTTTGCAAGA		CCDS13104.1, CCDS13105.1, CCDS54447.1	20p12	2008-03-18			ENSG00000101333	ENSG00000101333	3.1.4.11		9059	protein-coding gene	gene with protein product		600810				8530101	Standard	NM_000933		Approved		uc021wam.1	Q15147	OTTHUMG00000031853	ENST00000378493.1:c.50T>G	chr20.hg19:g.9288511T>G	ENSP00000367754:p.Leu17Trp	80.0	0.0		80.0	51.0	NM_182797	B7ZLK6|E2QRH8|Q17R56|Q5JYS8|Q5JYS9|Q5JYT0|Q5JYT3|Q5JYT4|Q9BQW5|Q9BQW6|Q9BQW8|Q9UJQ2	Missense_Mutation	SNP	ENST00000378493.1	hg19	CCDS13105.1	.	.	.	.	.	.	.	.	.	.	T	21.4	4.138684	0.77775	.	.	ENSG00000101333	ENST00000407043;ENST00000441846;ENST00000334005;ENST00000378473;ENST00000437503;ENST00000416836;ENST00000278655;ENST00000378493;ENST00000378501	T;T;T;T;T;T;T;T;T	0.64618	-0.11;-0.11;-0.11;-0.11;-0.11;-0.11;-0.11;-0.11;-0.11	5.87	5.87	0.94306	Pleckstrin homology-type (1);	0.118259	0.64402	D	0.000010	T	0.80099	0.4561	M	0.80847	2.515	0.38024	D	0.934958	P;P;D	0.67145	0.95;0.661;0.996	P;B;D	0.76071	0.621;0.221;0.987	D	0.84824	0.0798	10	0.87932	D	0	.	15.2632	0.73640	0.0:0.0:0.0:1.0	.	17;17;17	E2QRH8;Q15147;Q15147-4	.;PLCB4_HUMAN;.	W	17	ENSP00000385805:L17W;ENSP00000412982:L17W;ENSP00000334105:L17W;ENSP00000367734:L17W;ENSP00000391614:L17W;ENSP00000395753:L17W;ENSP00000278655:L17W;ENSP00000367754:L17W;ENSP00000367762:L17W	ENSP00000278655:L17W	L	+	2	0	PLCB4	9236511	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.792000	0.69052	2.248000	0.74166	0.533000	0.62120	TTG	.	.		0.299	PLCB4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000077948.2		
PLCB4	5332	hgsc.bcm.edu	37	20	9352961	9352961	+	Silent	SNP	T	T	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr20:9352961T>A	ENST00000378493.1	+	8	612	c.597T>A	c.(595-597)atT>atA	p.I199I	PLCB4_ENST00000378473.3_Silent_p.I199I|PLCB4_ENST00000492632.1_3'UTR|PLCB4_ENST00000414679.2_Silent_p.I199I|PLCB4_ENST00000278655.4_Silent_p.I199I|PLCB4_ENST00000378501.2_Silent_p.I199I|PLCB4_ENST00000334005.3_Silent_p.I199I			Q15147	PLCB4_HUMAN	phospholipase C, beta 4	199					inositol phosphate metabolic process (GO:0043647)|intracellular signal transduction (GO:0035556)|lipid catabolic process (GO:0016042)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|dendrite (GO:0030425)|nucleus (GO:0005634)|postsynaptic density (GO:0014069)|smooth endoplasmic reticulum (GO:0005790)	calcium ion binding (GO:0005509)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|signal transducer activity (GO:0004871)			NS(2)|breast(4)|cervix(1)|endometrium(2)|kidney(4)|large_intestine(11)|liver(4)|lung(34)|ovary(3)|pancreas(1)|prostate(1)|skin(19)|upper_aerodigestive_tract(1)	87						ATGATGAAATTGAGCCCACAG	0.373																																					p.I199I		Atlas-SNP	.											.	PLCB4	204	.	0			c.T597A						.						78.0	79.0	79.0					20																	9352961		2202	4300	6502	SO:0001819	synonymous_variant	5332	exon9			TGAAATTGAGCCC		CCDS13104.1, CCDS13105.1, CCDS54447.1	20p12	2008-03-18			ENSG00000101333	ENSG00000101333	3.1.4.11		9059	protein-coding gene	gene with protein product		600810				8530101	Standard	NM_000933		Approved		uc021wam.1	Q15147	OTTHUMG00000031853	ENST00000378493.1:c.597T>A	chr20.hg19:g.9352961T>A		186.0	0.0		165.0	80.0	NM_182797	B7ZLK6|E2QRH8|Q17R56|Q5JYS8|Q5JYS9|Q5JYT0|Q5JYT3|Q5JYT4|Q9BQW5|Q9BQW6|Q9BQW8|Q9UJQ2	Silent	SNP	ENST00000378493.1	hg19	CCDS13105.1																																																																																			.	.		0.373	PLCB4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000077948.2		
PAK7	57144	hgsc.bcm.edu	37	20	9525119	9525119	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr20:9525119A>G	ENST00000378429.3	-	9	2312	c.1766T>C	c.(1765-1767)tTc>tCc	p.F589S	PAK7_ENST00000353224.5_Missense_Mutation_p.F589S|PAK7_ENST00000378423.1_Missense_Mutation_p.F589S	NM_020341.3	NP_065074.1	Q9P286	PAK7_HUMAN	p21 protein (Cdc42/Rac)-activated kinase 7	589	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic process (GO:0006915)|cell growth (GO:0016049)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cytoskeleton organization (GO:0007010)|learning (GO:0007612)|locomotory behavior (GO:0007626)|memory (GO:0007613)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|signal transduction (GO:0007165)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|central_nervous_system(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(44)|ovary(2)|skin(13)|stomach(1)|upper_aerodigestive_tract(3)	81			COAD - Colon adenocarcinoma(9;0.194)			TTGAGCACAGAAACCAAAATC	0.413																																					p.F589S		Atlas-SNP	.											.	PAK7	194	.	0			c.T1766C						.						96.0	93.0	94.0					20																	9525119		2203	4300	6503	SO:0001583	missense	57144	exon8			GCACAGAAACCAA	AB033090	CCDS13107.1	20p12	2008-06-17	2008-06-17		ENSG00000101349	ENSG00000101349			15916	protein-coding gene	gene with protein product		608038	"""p21(CDKN1A)-activated kinase 7"""			11756552, 10574462	Standard	NM_020341		Approved	KIAA1264, PAK5	uc002wnk.2	Q9P286	OTTHUMG00000031857	ENST00000378429.3:c.1766T>C	chr20.hg19:g.9525119A>G	ENSP00000367686:p.Phe589Ser	169.0	0.0		139.0	48.0	NM_177990	A8K5T6|D3DW14|Q5W115|Q9BX09|Q9ULF6	Missense_Mutation	SNP	ENST00000378429.3	hg19	CCDS13107.1	.	.	.	.	.	.	.	.	.	.	A	29.5	5.011681	0.93346	.	.	ENSG00000101349	ENST00000378429;ENST00000353224;ENST00000378423	T;T;T	0.64803	-0.12;-0.12;-0.12	5.97	5.97	0.96955	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.73125	0.3547	L	0.42686	1.345	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.71411	-0.4601	9	.	.	.	.	16.4608	0.84044	1.0:0.0:0.0:0.0	.	589	Q9P286	PAK7_HUMAN	S	589	ENSP00000367686:F589S;ENSP00000322957:F589S;ENSP00000367679:F589S	.	F	-	2	0	PAK7	9473119	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.278000	0.95766	2.288000	0.76882	0.533000	0.62120	TTC	.	.		0.413	PAK7-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077962.1		
SEC23B	10483	hgsc.bcm.edu	37	20	18491619	18491619	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr20:18491619A>G	ENST00000336714.3	+	2	572	c.140A>G	c.(139-141)gAa>gGa	p.E47G	SEC23B_ENST00000377475.3_Missense_Mutation_p.E47G|SEC23B_ENST00000262544.2_Missense_Mutation_p.E47G|SEC23B_ENST00000377465.1_Missense_Mutation_p.E47G	NM_006363.4|NM_032985.4|NM_032986.3	NP_006354.2|NP_116780.1|NP_116781.1	Q15437	SC23B_HUMAN	Sec23 homolog B (S. cerevisiae)	47					ER to Golgi vesicle-mediated transport (GO:0006888)|intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)	COPII vesicle coat (GO:0030127)|endomembrane system (GO:0012505)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)	zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(6)|liver(2)|lung(14)|ovary(1)|pancreas(1)|prostate(2)|skin(1)	32						CCTTTGAAAGAACGTCCAGAC	0.493																																					p.E47G		Atlas-SNP	.											.	SEC23B	70	.	0			c.A140G						.						169.0	149.0	155.0					20																	18491619		2203	4300	6503	SO:0001583	missense	10483	exon2			TGAAAGAACGTCC	X97065	CCDS13137.1	20p11.23	2010-02-09	2001-11-28		ENSG00000101310	ENSG00000101310			10702	protein-coding gene	gene with protein product		610512	"""Sec23 (S. cerevisiae) homolog B"", ""congenital dyserythropoietic anemia, type II"""	CDAN2		8898360, 10329445, 19621418	Standard	NM_032985		Approved	CDA-II, CDAII, HEMPAS	uc002wrb.2	Q15437	OTTHUMG00000031976	ENST00000336714.3:c.140A>G	chr20.hg19:g.18491619A>G	ENSP00000338844:p.Glu47Gly	216.0	0.0		239.0	106.0	NM_032985	D3DW33|Q503A9|Q5W183|Q9BS15|Q9BSI2|Q9H1D7	Missense_Mutation	SNP	ENST00000336714.3	hg19	CCDS13137.1	.	.	.	.	.	.	.	.	.	.	A	28.3	4.908899	0.92107	.	.	ENSG00000101310	ENST00000450074;ENST00000336714;ENST00000262544;ENST00000377475;ENST00000377465	D;D;D;D;D	0.83250	-1.7;-1.7;-1.7;-1.7;-1.7	5.29	5.29	0.74685	Zinc finger, Sec23/Sec24-type (1);	0.000000	0.85682	D	0.000000	D	0.83087	0.5178	M	0.78916	2.43	0.80722	D	1	B;B	0.27316	0.175;0.01	B;B	0.24269	0.052;0.019	T	0.82833	-0.0262	10	0.66056	D	0.02	-20.9293	14.5693	0.68202	1.0:0.0:0.0:0.0	.	47;47	B4DJW8;Q15437	.;SC23B_HUMAN	G	47	ENSP00000403971:E47G;ENSP00000338844:E47G;ENSP00000262544:E47G;ENSP00000366695:E47G;ENSP00000366685:E47G	ENSP00000262544:E47G	E	+	2	0	SEC23B	18439619	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.087000	0.94110	2.234000	0.73211	0.533000	0.62120	GAA	.	.		0.493	SEC23B-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078184.5		
CFAP61	26074	hgsc.bcm.edu	37	20	20144825	20144825	+	Silent	SNP	T	T	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr20:20144825T>A	ENST00000245957.5	+	11	1234	c.1158T>A	c.(1156-1158)gcT>gcA	p.A386A	C20orf26_ENST00000389656.3_5'UTR|C20orf26_ENST00000451767.2_Silent_p.A386A|C20orf26_ENST00000377309.2_5'UTR|C20orf26_ENST00000377306.1_Silent_p.A386A	NM_015585.3	NP_056400.3	Q8NHU2	CT026_HUMAN		386										NS(2)|breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|lung(42)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	77				READ - Rectum adenocarcinoma(2;0.171)		GAGCCTCAGCTGCTTTTTGTA	0.493																																					p.A386A		Atlas-SNP	.											.	C20orf26	188	.	0			c.T1158A						.						116.0	116.0	116.0					20																	20144825		2203	4300	6503	SO:0001819	synonymous_variant	26074	exon11			CTCAGCTGCTTTT																												ENST00000245957.5:c.1158T>A	chr20.hg19:g.20144825T>A		77.0	0.0		60.0	19.0	NM_015585	A6NHA1|Q5JXV4|Q5TE18|Q8N5R9|Q96M59|Q9BQL2|Q9H127|Q9H128|Q9NQH4|Q9UFV8|Q9Y4V7	Silent	SNP	ENST00000245957.5	hg19	CCDS33447.1																																																																																			.	.		0.493	C20orf26-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078228.3		
CFAP61	26074	hgsc.bcm.edu	37	20	20269371	20269371	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr20:20269371T>C	ENST00000245957.5	+	23	2991	c.2915T>C	c.(2914-2916)aTa>aCa	p.I972T	C20orf26_ENST00000377309.2_Intron	NM_015585.3	NP_056400.3	Q8NHU2	CT026_HUMAN		972										NS(2)|breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|lung(42)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	77				READ - Rectum adenocarcinoma(2;0.171)		ACCAACGACATAGCCATCAGA	0.428																																					p.I972T		Atlas-SNP	.											.	C20orf26	188	.	0			c.T2915C						.						157.0	144.0	149.0					20																	20269371		2203	4300	6503	SO:0001583	missense	26074	exon23			ACGACATAGCCAT																												ENST00000245957.5:c.2915T>C	chr20.hg19:g.20269371T>C	ENSP00000245957:p.Ile972Thr	218.0	0.0		166.0	66.0	NM_015585	A6NHA1|Q5JXV4|Q5TE18|Q8N5R9|Q96M59|Q9BQL2|Q9H127|Q9H128|Q9NQH4|Q9UFV8|Q9Y4V7	Missense_Mutation	SNP	ENST00000245957.5	hg19	CCDS33447.1	.	.	.	.	.	.	.	.	.	.	T	8.966	0.971824	0.18736	.	.	ENSG00000089101	ENST00000343997;ENST00000389655;ENST00000245957	T	0.40225	1.04	5.75	5.75	0.90469	.	0.750513	0.13155	N	0.409512	T	0.30355	0.0762	L	0.40543	1.245	0.25111	N	0.990712	B	0.26547	0.152	B	0.21708	0.036	T	0.24190	-1.0167	10	0.14252	T	0.57	.	7.0755	0.25201	0.1316:0.0709:0.0:0.7975	.	972	Q8NHU2	CT026_HUMAN	T	912;938;972	ENSP00000245957:I972T	ENSP00000245957:I972T	I	+	2	0	C20orf26	20217371	0.000000	0.05858	0.780000	0.31762	0.913000	0.54294	0.860000	0.27871	2.205000	0.71048	0.528000	0.53228	ATA	.	.		0.428	C20orf26-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078228.3		
NANP	140838	hgsc.bcm.edu	37	20	25596957	25596957	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr20:25596957C>A	ENST00000304788.3	-	2	577	c.351G>T	c.(349-351)atG>atT	p.M117I		NM_152667.2	NP_689880.1	Q8TBE9	NANP_HUMAN	N-acetylneuraminic acid phosphatase	117					carbohydrate metabolic process (GO:0005975)|dephosphorylation (GO:0016311)|N-acetylglucosamine biosynthetic process (GO:0006045)|N-acetylneuraminate biosynthetic process (GO:0046380)		N-acylneuraminate-9-phosphatase activity (GO:0050124)			endometrium(2)|lung(2)|prostate(1)	5						GTTCAGTAAGCATGGCTTTGA	0.448																																					p.M117I		Atlas-SNP	.											.	NANP	10	.	0			c.G351T						.						116.0	114.0	115.0					20																	25596957		2203	4300	6503	SO:0001583	missense	140838	exon2			AGTAAGCATGGCT	AL031673	CCDS13173.1	20p11.1	2006-10-24	2006-01-24	2006-01-24	ENSG00000170191	ENSG00000170191			16140	protein-coding gene	gene with protein product		610763	"""chromosome 20 open reading frame 147"", ""haloacid dehalogenase-like hydrolase domain containing 4"""	C20orf147, HDHD4		16237198	Standard	NM_152667		Approved	dJ694B14.3, MGC26833	uc002wuy.3	Q8TBE9	OTTHUMG00000032132	ENST00000304788.3:c.351G>T	chr20.hg19:g.25596957C>A	ENSP00000302441:p.Met117Ile	121.0	0.0		89.0	37.0	NM_152667	B3KP12|Q5JYN8|Q8TE97|Q9Y3N0	Missense_Mutation	SNP	ENST00000304788.3	hg19	CCDS13173.1	.	.	.	.	.	.	.	.	.	.	C	19.10	3.762103	0.69763	.	.	ENSG00000170191	ENST00000304788	T	0.04862	3.54	5.4	5.4	0.78164	Haloacid dehalogenase-like hydrolase (1);HAD-like domain (2);	0.043012	0.85682	D	0.000000	T	0.16981	0.0408	L	0.56199	1.76	0.48762	D	0.999702	P	0.47545	0.897	P	0.55112	0.769	T	0.00088	-1.2091	10	0.48119	T	0.1	-7.247	16.7324	0.85438	0.0:1.0:0.0:0.0	.	117	Q8TBE9	NANP_HUMAN	I	117	ENSP00000302441:M117I	ENSP00000302441:M117I	M	-	3	0	NANP	25544957	1.000000	0.71417	1.000000	0.80357	0.894000	0.52154	4.290000	0.59019	2.528000	0.85240	0.485000	0.47835	ATG	.	.		0.448	NANP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078457.2	NM_152667	
TM9SF4	9777	hgsc.bcm.edu	37	20	30738606	30738606	+	Silent	SNP	G	G	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr20:30738606G>T	ENST00000398022.2	+	12	1408	c.1173G>T	c.(1171-1173)gtG>gtT	p.V391V	TM9SF4_ENST00000217315.5_Silent_p.V374V	NM_014742.3	NP_055557.2	Q92544	TM9S4_HUMAN	transmembrane 9 superfamily protein member 4	391						integral component of membrane (GO:0016021)				central_nervous_system(2)|kidney(1)|large_intestine(4)|lung(8)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	20			UCEC - Uterine corpus endometrioid carcinoma (5;0.0241)			CCCACAGGGTGTTTGGCGGAT	0.567																																					p.V391V		Atlas-SNP	.											.	TM9SF4	65	.	0			c.G1173T						.						120.0	113.0	115.0					20																	30738606		2203	4300	6503	SO:0001819	synonymous_variant	9777	exon12			CAGGGTGTTTGGC	BC021107	CCDS13196.2	20q11.21	2004-04-19			ENSG00000101337	ENSG00000101337			30797	protein-coding gene	gene with protein product						9039502	Standard	NM_014742		Approved	KIAA0255, dJ836N17.2	uc002wxj.2	Q92544	OTTHUMG00000032206	ENST00000398022.2:c.1173G>T	chr20.hg19:g.30738606G>T		133.0	0.0		110.0	50.0	NM_014742	B0QYT7|Q9NUA3	Silent	SNP	ENST00000398022.2	hg19	CCDS13196.2																																																																																			.	.		0.567	TM9SF4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323568.1	NM_014742	
NCOA6	23054	hgsc.bcm.edu	37	20	33324500	33324500	+	Nonsense_Mutation	SNP	T	T	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr20:33324500T>A	ENST00000374796.2	-	13	8526	c.5956A>T	c.(5956-5958)Aga>Tga	p.R1986*	NCOA6_ENST00000359003.2_Nonsense_Mutation_p.R1986*			Q14686	NCOA6_HUMAN	nuclear receptor coactivator 6	1986	EP300/CRSP3-binding region.				brain development (GO:0007420)|cellular lipid metabolic process (GO:0044255)|cellular response to DNA damage stimulus (GO:0006974)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA-templated transcription, initiation (GO:0006352)|glucocorticoid receptor signaling pathway (GO:0042921)|heart development (GO:0007507)|intracellular estrogen receptor signaling pathway (GO:0030520)|labyrinthine layer blood vessel development (GO:0060716)|myeloid cell differentiation (GO:0030099)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|response to hormone (GO:0009725)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)	histone methyltransferase complex (GO:0035097)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|retinoid X receptor binding (GO:0046965)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)			NS(2)|breast(6)|central_nervous_system(3)|cervix(1)|endometrium(9)|kidney(8)|large_intestine(16)|lung(37)|ovary(4)|prostate(5)|skin(13)|upper_aerodigestive_tract(2)|urinary_tract(1)	107						TTACCTGGTCTGGCAACAGAG	0.453																																					p.R1986X		Atlas-SNP	.											.	NCOA6	219	.	0			c.A5956T						.						93.0	82.0	86.0					20																	33324500		2203	4300	6503	SO:0001587	stop_gained	23054	exon12			CTGGTCTGGCAAC	AF128458	CCDS13241.1, CCDS74720.1	20q11	2008-08-01			ENSG00000198646	ENSG00000198646			15936	protein-coding gene	gene with protein product	"""nuclear receptor coactivator RAP250"", ""activating signal cointegrator-2"", ""peroxisome proliferator-activated receptor interacting protein"""	605299				8724849, 8263591	Standard	NM_014071		Approved	KIAA0181, RAP250, ASC2, AIB3, PRIP, TRBP, NRC	uc002xaw.3	Q14686	OTTHUMG00000032311	ENST00000374796.2:c.5956A>T	chr20.hg19:g.33324500T>A	ENSP00000363929:p.Arg1986*	146.0	0.0		123.0	54.0	NM_014071	A6NLF1|B2RMN5|E1P5P7|Q9NTZ9|Q9UH74|Q9UK86	Nonsense_Mutation	SNP	ENST00000374796.2	hg19	CCDS13241.1	.	.	.	.	.	.	.	.	.	.	T	57	29.943585	0.99976	.	.	ENSG00000198646	ENST00000374796;ENST00000359003	.	.	.	5.82	4.72	0.59763	.	0.000000	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-10.0306	8.9205	0.35607	0.0:0.084:0.0:0.916	.	.	.	.	X	1986	.	ENSP00000351894:R1986X	R	-	1	2	NCOA6	32788161	1.000000	0.71417	1.000000	0.80357	0.627000	0.37826	2.001000	0.40825	2.232000	0.73038	0.482000	0.46254	AGA	.	.		0.453	NCOA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078811.2	NM_014071	
RBM12	10137	hgsc.bcm.edu	37	20	34242510	34242510	+	Silent	SNP	C	C	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr20:34242510C>T	ENST00000374114.3	-	3	998	c.735G>A	c.(733-735)ccG>ccA	p.P245P	CPNE1_ENST00000397442.1_Intron|CPNE1_ENST00000317677.5_5'Flank|CPNE1_ENST00000397446.1_Intron|CPNE1_ENST00000317619.3_Intron|RBM12_ENST00000374104.3_Silent_p.P245P|CPNE1_ENST00000397445.1_Intron|CPNE1_ENST00000397443.1_Intron|RP1-309K20.6_ENST00000541176.2_Intron|RBM12_ENST00000359646.1_Silent_p.P245P|CPNE1_ENST00000352393.4_Intron	NM_001198838.1|NM_001198840.1|NM_006047.5	NP_001185767.1|NP_001185769.1|NP_006038.2	Q9NTZ6	RBM12_HUMAN	RNA binding motif protein 12	245	Pro-rich.					nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(3)|endometrium(7)|kidney(1)|large_intestine(3)|lung(14)|ovary(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	36	Lung NSC(9;0.00608)|all_lung(11;0.00918)		BRCA - Breast invasive adenocarcinoma(18;0.00953)			GATTCAAGGGCGGCATGCCCG	0.552																																					p.P245P		Atlas-SNP	.											RBM12,NS,carcinoma,0,1	RBM12	93	.	0			c.G735A						.						73.0	72.0	72.0					20																	34242510		2203	4300	6503	SO:0001819	synonymous_variant	10137	exon2			CAAGGGCGGCATG	AJ289772	CCDS13261.1	20q11.21	2013-02-12			ENSG00000244462	ENSG00000244462		"""RNA binding motif (RRM) containing"""	9898	protein-coding gene	gene with protein product		607179				11435693	Standard	NM_006047		Approved	HRIHFB2091, KIAA0765, SWAN	uc021wcq.1	Q9NTZ6	OTTHUMG00000032350	ENST00000374114.3:c.735G>A	chr20.hg19:g.34242510C>T		81.0	2.0		72.0	26.0	NM_001198840	B3KRU2|E1P5R6|O94865|Q8N3B1|Q9H196	Silent	SNP	ENST00000374114.3	hg19	CCDS13261.1																																																																																			.	.		0.552	RBM12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078894.1	NM_006047	
RBL1	5933	hgsc.bcm.edu	37	20	35632146	35632146	+	Nonsense_Mutation	SNP	T	T	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr20:35632146T>A	ENST00000373664.3	-	21	3061	c.2995A>T	c.(2995-2997)Aga>Tga	p.R999*	RBL1_ENST00000344359.3_Nonsense_Mutation_p.R999*	NM_002895.2	NP_002886.2	P28749	RBL1_HUMAN	retinoblastoma-like 1	999					chromatin modification (GO:0016568)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell cycle (GO:0051726)|regulation of lipid kinase activity (GO:0043550)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	transcription factor binding (GO:0008134)			NS(1)|breast(1)|endometrium(7)|large_intestine(6)|lung(16)|ovary(2)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)	42		Myeloproliferative disorder(115;0.00878)				AGAGCGCTTCTTGGTGTAAGG	0.453																																					p.R999X		Atlas-SNP	.											.	RBL1	114	.	0			c.A2995T						.						136.0	127.0	130.0					20																	35632146		2203	4300	6503	SO:0001587	stop_gained	5933	exon21			CGCTTCTTGGTGT	L14812	CCDS13289.1, CCDS13290.1	20q11.23	2014-03-11	2014-03-11		ENSG00000080839	ENSG00000080839			9893	protein-coding gene	gene with protein product		116957				1833063	Standard	NM_183404		Approved	p107, cp107, PRB1	uc002xgi.3	P28749	OTTHUMG00000032406	ENST00000373664.3:c.2995A>T	chr20.hg19:g.35632146T>A	ENSP00000362768:p.Arg999*	213.0	0.0		228.0	97.0	NM_183404	A8K2W5|Q4VXA0|Q8N5K6|Q9H1L5|Q9H1M1	Nonsense_Mutation	SNP	ENST00000373664.3	hg19	CCDS13289.1	.	.	.	.	.	.	.	.	.	.	T	38	7.228267	0.98150	.	.	ENSG00000080839	ENST00000373664;ENST00000344359	.	.	.	5.04	3.92	0.45320	.	0.401929	0.25651	N	0.029218	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-5.8928	6.6761	0.23095	0.0:0.0875:0.261:0.6515	.	.	.	.	X	999	.	ENSP00000343646:R999X	R	-	1	2	RBL1	35065560	0.238000	0.23825	1.000000	0.80357	0.984000	0.73092	1.003000	0.29809	0.927000	0.37143	0.528000	0.53228	AGA	.	.		0.453	RBL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079067.2	NM_002895	
WFDC3	140686	hgsc.bcm.edu	37	20	44405762	44405762	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr20:44405762A>T	ENST00000243938.4	-	5	528	c.445T>A	c.(445-447)Tgc>Agc	p.C149S	WFDC3_ENST00000372632.2_Intron|RNU6ATAC38P_ENST00000408119.1_RNA|WFDC3_ENST00000481847.1_Intron|WFDC3_ENST00000372630.2_Intron	NM_080614.1	NP_542181.1	Q8IUB2	WFDC3_HUMAN	WAP four-disulfide core domain 3	149	WAP 3. {ECO:0000255|PROSITE- ProRule:PRU00722}.					extracellular region (GO:0005576)	serine-type endopeptidase inhibitor activity (GO:0004867)			endometrium(1)|large_intestine(3)|prostate(1)	5		Myeloproliferative disorder(115;0.0122)				GTGCTGCAGCATTTATGCCCC	0.547																																					p.C149S		Atlas-SNP	.											.	WFDC3	18	.	0			c.T445A						.						71.0	57.0	62.0					20																	44405762		2203	4300	6503	SO:0001583	missense	140686	exon5			TGCAGCATTTATG	AL050348	CCDS33478.1	20q13.12	2013-01-21			ENSG00000124116	ENSG00000124116		"""WAP four-disulfide core domain containing"""	15957	protein-coding gene	gene with protein product						12206714, 10680116	Standard	NM_080614		Approved	dJ447F3.3, WAP14	uc002xpf.1	Q8IUB2	OTTHUMG00000032614	ENST00000243938.4:c.445T>A	chr20.hg19:g.44405762A>T	ENSP00000243938:p.Cys149Ser	190.0	0.0		151.0	62.0	NM_080614	A6PVF2|Q0P6A5|Q3T1C5|Q8TC52|Q9BQP3|Q9BQP4	Missense_Mutation	SNP	ENST00000243938.4	hg19	CCDS33478.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	21.5|21.5	4.152045|4.152045	0.78001|0.78001	.|.	.|.	ENSG00000124116|ENSG00000124116	ENST00000243938|ENST00000337205	D|.	0.99239|.	-5.61|.	4.62|4.62	4.62|4.62	0.57501|0.57501	Whey acidic protein, 4-disulphide core (4);|.	0.000000|.	0.44097|.	D|.	0.000482|.	D|D	0.86372|0.86372	0.5917|0.5917	H|H	0.96833|0.96833	3.89|3.89	0.80722|0.80722	D|D	1|1	D|.	0.89917|.	1.0|.	D|.	0.87578|.	0.998|.	D|D	0.89494|0.89494	0.3759|0.3759	10|5	0.87932|.	D|.	0|.	-9.9257|-9.9257	10.6189|10.6189	0.45467|0.45467	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	149|.	Q8IUB2|.	WFDC3_HUMAN|.	S|K	149|142	ENSP00000243938:C149S|.	ENSP00000243938:C149S|.	C|N	-|-	1|3	0|2	WFDC3|WFDC3	43839169|43839169	1.000000|1.000000	0.71417|0.71417	0.999000|0.999000	0.59377|0.59377	0.991000|0.991000	0.79684|0.79684	3.903000|3.903000	0.56318|0.56318	2.096000|2.096000	0.63516|0.63516	0.533000|0.533000	0.62120|0.62120	TGC|AAT	.	.		0.547	WFDC3-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316858.1		
WFDC3	140686	hgsc.bcm.edu	37	20	44418554	44418554	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr20:44418554A>T	ENST00000243938.4	-	2	144	c.61T>A	c.(61-63)Tgg>Agg	p.W21R	WFDC3_ENST00000372632.2_Missense_Mutation_p.W21R|DNTTIP1_ENST00000372622.3_5'Flank|WFDC3_ENST00000481847.1_Intron|WFDC3_ENST00000372630.2_Missense_Mutation_p.W21R	NM_080614.1	NP_542181.1	Q8IUB2	WFDC3_HUMAN	WAP four-disulfide core domain 3	21						extracellular region (GO:0005576)	serine-type endopeptidase inhibitor activity (GO:0004867)			endometrium(1)|large_intestine(3)|prostate(1)	5		Myeloproliferative disorder(115;0.0122)				GCAGTTATCCAGGATTCCAGA	0.488																																					p.W21R		Atlas-SNP	.											.	WFDC3	18	.	0			c.T61A						.						116.0	98.0	104.0					20																	44418554		2203	4300	6503	SO:0001583	missense	140686	exon2			TTATCCAGGATTC	AL050348	CCDS33478.1	20q13.12	2013-01-21			ENSG00000124116	ENSG00000124116		"""WAP four-disulfide core domain containing"""	15957	protein-coding gene	gene with protein product						12206714, 10680116	Standard	NM_080614		Approved	dJ447F3.3, WAP14	uc002xpf.1	Q8IUB2	OTTHUMG00000032614	ENST00000243938.4:c.61T>A	chr20.hg19:g.44418554A>T	ENSP00000243938:p.Trp21Arg	115.0	0.0		66.0	20.0	NM_080614	A6PVF2|Q0P6A5|Q3T1C5|Q8TC52|Q9BQP3|Q9BQP4	Missense_Mutation	SNP	ENST00000243938.4	hg19	CCDS33478.1	.	.	.	.	.	.	.	.	.	.	A	13.49	2.253518	0.39797	.	.	ENSG00000124116	ENST00000243938;ENST00000372630;ENST00000372632	T;T;T	0.25085	1.82;1.94;1.91	4.13	3.02	0.34903	Whey acidic protein, 4-disulphide core (1);	0.000000	0.36034	N	0.002827	T	0.18467	0.0443	L	0.48877	1.53	0.24784	N	0.992799	P	0.41673	0.759	B	0.35899	0.213	T	0.12268	-1.0554	10	0.48119	T	0.1	-19.2611	6.9637	0.24611	0.7969:0.0:0.0:0.2031	.	21	Q8IUB2	WFDC3_HUMAN	R	21	ENSP00000243938:W21R;ENSP00000361713:W21R;ENSP00000361715:W21R	ENSP00000243938:W21R	W	-	1	0	WFDC3	43851961	0.956000	0.32656	0.994000	0.49952	0.782000	0.44232	1.869000	0.39519	0.913000	0.36797	0.533000	0.62120	TGG	.	.		0.488	WFDC3-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316858.1		
ZNF334	55713	hgsc.bcm.edu	37	20	45130946	45130946	+	Silent	SNP	T	T	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr20:45130946T>A	ENST00000347606.4	-	5	1214	c.1032A>T	c.(1030-1032)acA>acT	p.T344T	ZNF334_ENST00000457685.2_Silent_p.T306T|ZNF334_ENST00000593880.1_Silent_p.T367T	NM_018102.4	NP_060572.3	Q9HCZ1	ZN334_HUMAN	zinc finger protein 334	344					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(2)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(8)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	32		Myeloproliferative disorder(115;0.0122)				GCTTCTCCCCTGTGTGTGACC	0.438																																					p.T344T		Atlas-SNP	.											.	ZNF334	101	.	0			c.A1032T						.						158.0	162.0	161.0					20																	45130946		2203	4300	6503	SO:0001819	synonymous_variant	55713	exon5			CTCCCCTGTGTGT	AK001331	CCDS33480.1, CCDS74736.1	20q13.12	2013-09-20			ENSG00000198185	ENSG00000198185		"""Zinc fingers, C2H2-type"", ""-"""	15806	protein-coding gene	gene with protein product							Standard	NM_018102		Approved	bA179N14.1	uc002xsc.4	Q9HCZ1	OTTHUMG00000032654	ENST00000347606.4:c.1032A>T	chr20.hg19:g.45130946T>A		107.0	0.0		97.0	40.0	NM_018102	Q5T6U2|Q9NVW4	Silent	SNP	ENST00000347606.4	hg19	CCDS33480.1																																																																																			.	.		0.438	ZNF334-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079575.1		
PSMA7	5688	hgsc.bcm.edu	37	20	60718284	60718284	+	Missense_Mutation	SNP	C	C	G			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr20:60718284C>G	ENST00000370873.4	-	1	202	c.76G>C	c.(76-78)Gtc>Ctc	p.V26L	SS18L1_ENST00000421564.1_5'Flank|SS18L1_ENST00000331758.3_5'Flank|PSMA7_ENST00000370858.3_Missense_Mutation_p.V26L|PSMA7_ENST00000370861.1_5'Flank|PSMA7_ENST00000484488.1_5'UTR	NM_002792.3	NP_002783.1	O14818	PSA7_HUMAN	proteasome (prosome, macropain) subunit, alpha type, 7	26					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome complex (GO:0000502)|proteasome core complex (GO:0005839)|proteasome core complex, alpha-subunit complex (GO:0019773)	identical protein binding (GO:0042802)|threonine-type endopeptidase activity (GO:0004298)			large_intestine(1)|lung(2)	3	Breast(26;3.97e-09)		BRCA - Breast invasive adenocarcinoma(19;1.28e-07)			CCCTTCTTGACGGCCTCCTGC	0.766																																					p.V26L		Atlas-SNP	.											.	PSMA7	13	.	0			c.G76C						.						6.0	7.0	7.0					20																	60718284		2122	4182	6304	SO:0001583	missense	5688	exon1			TCTTGACGGCCTC	AF022815	CCDS13489.1	20q13.33	2008-07-02			ENSG00000101182	ENSG00000101182		"""Proteasome (prosome, macropain) subunits"""	9536	protein-coding gene	gene with protein product	"""proteasome subunit XAPC7"", ""proteasome subunit RC6-1"""	606607				8764072	Standard	NM_002792		Approved	XAPC7, C6, HSPC, RC6-1	uc002ybx.2	O14818	OTTHUMG00000032895	ENST00000370873.4:c.76G>C	chr20.hg19:g.60718284C>G	ENSP00000359910:p.Val26Leu	9.0	0.0		18.0	14.0	NM_002792	B2R515|Q5JXJ2|Q9BR53|Q9H4K5|Q9UEU8	Missense_Mutation	SNP	ENST00000370873.4	hg19	CCDS13489.1	.	.	.	.	.	.	.	.	.	.	C	17.59	3.427494	0.62733	.	.	ENSG00000101182	ENST00000370873;ENST00000370858	T;T	0.26957	1.7;1.7	4.66	0.327	0.15913	.	0.080710	0.48767	U	0.000161	T	0.64238	0.2580	H	0.99922	4.955	0.45962	D	0.998784	D	0.76494	0.999	D	0.75484	0.986	T	0.58423	-0.7639	10	0.72032	D	0.01	.	3.6509	0.08203	0.1367:0.58:0.1322:0.1512	.	26	O14818	PSA7_HUMAN	L	26	ENSP00000359910:V26L;ENSP00000359895:V26L	ENSP00000359895:V26L	V	-	1	0	PSMA7	60151679	1.000000	0.71417	0.006000	0.13384	0.004000	0.04260	4.785000	0.62418	-0.176000	0.10707	-1.368000	0.01194	GTC	.	.		0.766	PSMA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079975.1	NM_002792	
PSMA7	5688	hgsc.bcm.edu	37	20	60718296	60718296	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr20:60718296C>A	ENST00000370873.4	-	1	190	c.64G>T	c.(64-66)Gcg>Tcg	p.A22S	SS18L1_ENST00000421564.1_5'Flank|SS18L1_ENST00000331758.3_5'Flank|PSMA7_ENST00000370858.3_Missense_Mutation_p.A22S|PSMA7_ENST00000370861.1_5'Flank|PSMA7_ENST00000484488.1_5'UTR	NM_002792.3	NP_002783.1	O14818	PSA7_HUMAN	proteasome (prosome, macropain) subunit, alpha type, 7	22					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome complex (GO:0000502)|proteasome core complex (GO:0005839)|proteasome core complex, alpha-subunit complex (GO:0019773)	identical protein binding (GO:0042802)|threonine-type endopeptidase activity (GO:0004298)			large_intestine(1)|lung(2)	3	Breast(26;3.97e-09)		BRCA - Breast invasive adenocarcinoma(19;1.28e-07)			GCCTCCTGCGCGTACTCCACT	0.751																																					p.A22S		Atlas-SNP	.											.	PSMA7	13	.	0			c.G64T						.						8.0	9.0	9.0					20																	60718296		2158	4227	6385	SO:0001583	missense	5688	exon1			CCTGCGCGTACTC	AF022815	CCDS13489.1	20q13.33	2008-07-02			ENSG00000101182	ENSG00000101182		"""Proteasome (prosome, macropain) subunits"""	9536	protein-coding gene	gene with protein product	"""proteasome subunit XAPC7"", ""proteasome subunit RC6-1"""	606607				8764072	Standard	NM_002792		Approved	XAPC7, C6, HSPC, RC6-1	uc002ybx.2	O14818	OTTHUMG00000032895	ENST00000370873.4:c.64G>T	chr20.hg19:g.60718296C>A	ENSP00000359910:p.Ala22Ser	11.0	0.0		16.0	12.0	NM_002792	B2R515|Q5JXJ2|Q9BR53|Q9H4K5|Q9UEU8	Missense_Mutation	SNP	ENST00000370873.4	hg19	CCDS13489.1	.	.	.	.	.	.	.	.	.	.	C	18.14	3.558143	0.65538	.	.	ENSG00000101182	ENST00000370873;ENST00000370858	T;T	0.57273	0.41;0.41	4.84	1.81	0.25067	Proteasome, alpha-subunit, conserved site (3);	0.000000	0.64402	U	0.000001	T	0.73745	0.3626	M	0.93808	3.46	0.44694	D	0.997681	D	0.67145	0.996	D	0.71870	0.975	T	0.72250	-0.4348	10	0.87932	D	0	.	6.6484	0.22949	0.145:0.6986:0.0:0.1564	.	22	O14818	PSA7_HUMAN	S	22	ENSP00000359910:A22S;ENSP00000359895:A22S	ENSP00000359895:A22S	A	-	1	0	PSMA7	60151691	1.000000	0.71417	0.022000	0.16811	0.005000	0.04900	4.707000	0.61852	0.119000	0.18210	-0.443000	0.05667	GCG	.	.		0.751	PSMA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079975.1	NM_002792	
COL20A1	57642	hgsc.bcm.edu	37	20	61947981	61947981	+	Silent	SNP	T	T	C			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr20:61947981T>C	ENST00000358894.6	+	21	2701	c.2601T>C	c.(2599-2601)tcT>tcC	p.S867S	COL20A1_ENST00000326996.6_Silent_p.S867S|COL20A1_ENST00000422202.1_Silent_p.S874S|COL20A1_ENST00000435874.1_Silent_p.S874S	NM_020882.2	NP_065933.2	Q9P218	COKA1_HUMAN	collagen, type XX, alpha 1	867	Laminin G-like.				extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)				NS(3)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(21)|ovary(1)|prostate(3)|urinary_tract(2)	36	all_cancers(38;1.39e-10)					TGGAGCCCTCTGCCTTCGGTG	0.642																																					p.S867S		Atlas-SNP	.											.	COL20A1	137	.	0			c.T2601C						.						29.0	32.0	31.0					20																	61947981		2024	4154	6178	SO:0001819	synonymous_variant	57642	exon21			GCCCTCTGCCTTC	BC043183	CCDS46628.1	20q13.33	2014-02-12			ENSG00000101203	ENSG00000101203		"""Collagens"", ""Fibronectin type III domain containing"""	14670	protein-coding gene	gene with protein product						10819331	Standard	NM_020882		Approved	KIAA1510	uc011aau.2	Q9P218	OTTHUMG00000032964	ENST00000358894.6:c.2601T>C	chr20.hg19:g.61947981T>C		77.0	0.0		38.0	16.0	NM_020882	Q4VXQ4|Q6PI59|Q8WUT2|Q96CY9|Q9BQU6|Q9BQU7	Silent	SNP	ENST00000358894.6	hg19	CCDS46628.1																																																																																			.	.		0.642	COL20A1-006	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000144595.2	NM_020882	
HELZ2	85441	hgsc.bcm.edu	37	20	62203527	62203527	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr20:62203527T>A	ENST00000467148.1	-	1	281	c.212A>T	c.(211-213)gAc>gTc	p.D71V	HELZ2_ENST00000479540.1_5'UTR	NM_001037335.2	NP_001032412.2	Q9BYK8	HELZ2_HUMAN	helicase with zinc finger 2, transcriptional coactivator	71					cellular lipid metabolic process (GO:0044255)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	membrane (GO:0016020)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)										CAGGGCCTGGTCGAAGGCCAC	0.642																																					p.D71V		Atlas-SNP	.											.	.	.	.	0			c.A212T						.						36.0	31.0	33.0					20																	62203527		2184	4294	6478	SO:0001583	missense	85441	exon2			GCCTGGTCGAAGG	AB201715	CCDS13527.1, CCDS33508.1	20q13.33	2012-09-26			ENSG00000130589	ENSG00000130589			30021	protein-coding gene	gene with protein product	"""peroxisomal proliferator activated receptor A interacting complex 285"", ""PPARG-DBD-interacting protein 1"""	611265				11214970, 12189208, 16239304	Standard	NM_001037335		Approved	PDIP1, PRIC285, KIAA1769	uc002yfm.2	Q9BYK8	OTTHUMG00000032969	ENST00000467148.1:c.212A>T	chr20.hg19:g.62203527T>A	ENSP00000417401:p.Asp71Val	79.0	0.0		83.0	23.0	NM_001037335	Q3C2G2|Q4VXQ1|Q8TEF3|Q96ND3|Q9C094	Missense_Mutation	SNP	ENST00000467148.1	hg19	CCDS33508.1	.	.	.	.	.	.	.	.	.	.	T	10.95	1.494512	0.26774	.	.	ENSG00000130589	ENST00000467148	T	0.02472	4.28	3.91	2.8	0.32819	.	0.328568	0.28952	U	0.013616	T	0.12220	0.0297	M	0.79475	2.455	0.51767	D	0.999932	D;D	0.89917	1.0;0.967	D;P	0.70016	0.967;0.622	T	0.00205	-1.1922	10	0.87932	D	0	-21.1577	8.9447	0.35751	0.0:0.0908:0.0:0.9092	.	71;71	Q4VXQ0;Q9BYK8	.;PR285_HUMAN	V	71	ENSP00000417401:D71V	ENSP00000417401:D71V	D	-	2	0	RP4-697K14.7	61673971	1.000000	0.71417	0.138000	0.22173	0.002000	0.02628	3.195000	0.51013	0.409000	0.25649	0.533000	0.62120	GAC	.	.		0.642	HELZ2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354127.1	NM_001037335	
ZGPAT	84619	hgsc.bcm.edu	37	20	62366141	62366141	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr20:62366141G>T	ENST00000328969.5	+	5	1143	c.1016G>T	c.(1015-1017)aGa>aTa	p.R339I	RP4-583P15.15_ENST00000490623.2_Missense_Mutation_p.D225Y|ZGPAT_ENST00000357119.4_Missense_Mutation_p.R310I|LIME1_ENST00000309546.3_5'Flank|ZGPAT_ENST00000478385.1_3'UTR|ZGPAT_ENST00000369967.3_Missense_Mutation_p.R319I|ZGPAT_ENST00000448100.2_Missense_Mutation_p.R319I|ZGPAT_ENST00000355969.6_Missense_Mutation_p.R319I	NM_032527.4	NP_115916.3	Q8N5A5	ZGPAT_HUMAN	zinc finger, CCCH-type with G patch domain	339	G-patch. {ECO:0000255|PROSITE- ProRule:PRU00092}.				negative regulation of epidermal growth factor-activated receptor activity (GO:0007175)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|kidney(1)|large_intestine(1)|lung(7)|ovary(2)|prostate(1)	14	all_cancers(38;1.13e-12)|all_epithelial(29;2.64e-14)|Lung NSC(23;4.79e-10)|all_lung(23;1.7e-09)					ATAGGCTCCAGACTCCTCACC	0.597																																					p.R339I		Atlas-SNP	.											.	ZGPAT	57	.	0			c.G1016T						.						90.0	74.0	79.0					20																	62366141		2203	4300	6503	SO:0001583	missense	84619	exon5			GCTCCAGACTCCT	AK027878	CCDS13534.1, CCDS13535.1, CCDS56203.1	20q13.3	2013-01-28	2004-12-01	2004-12-01	ENSG00000197114	ENSG00000197114		"""Zinc fingers, CCCH-type domain containing"", ""G patch domain containing"""	15948	protein-coding gene	gene with protein product			"""KIAA1847"""	KIAA1847		16952911	Standard	NM_181485		Approved	dJ583P15.3, MGC44880, FLJ14972, ZC3HDC9, ZC3H9, GPATC6, GPATCH6, ZIP	uc002ygk.3	Q8N5A5	OTTHUMG00000032998	ENST00000328969.5:c.1016G>T	chr20.hg19:g.62366141G>T	ENSP00000332013:p.Arg339Ile	88.0	0.0		94.0	35.0	NM_032527	E1P5K1|Q4VXN9|Q5JWI9|Q5JWJ0|Q8NC55|Q8WUV4|Q96JI0|Q96JU4|Q9H401	Missense_Mutation	SNP	ENST00000328969.5	hg19	CCDS13534.1	.	.	.	.	.	.	.	.	.	.	G	17.05	3.290266	0.59976	.	.	ENSG00000197114	ENST00000448100;ENST00000355969;ENST00000357119;ENST00000369967;ENST00000328969	T;T;T;T;T	0.36878	1.23;1.23;1.23;1.23;1.23	5.06	-0.654	0.11443	D111/G-patch (3);	0.196141	0.52532	D	0.000076	T	0.48241	0.1489	M	0.75447	2.3	0.47037	D	0.999299	P;D;P	0.60575	0.875;0.988;0.938	P;P;P	0.57846	0.571;0.828;0.555	T	0.50759	-0.8790	10	0.87932	D	0	-10.9626	8.9195	0.35604	0.7729:0.0:0.2271:0.0	.	310;339;319	Q8N5A5-3;Q8N5A5;Q8N5A5-2	.;ZGPAT_HUMAN;.	I	319;319;310;319;339	ENSP00000391176:R319I;ENSP00000348242:R319I;ENSP00000349634:R310I;ENSP00000358984:R319I;ENSP00000332013:R339I	ENSP00000332013:R339I	R	+	2	0	ZGPAT	61836585	0.999000	0.42202	0.598000	0.28837	0.983000	0.72400	2.479000	0.45197	0.014000	0.14944	0.563000	0.77884	AGA	.	.		0.597	ZGPAT-006	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000080214.1	NM_181484	
HSPA13	6782	hgsc.bcm.edu	37	21	15746215	15746215	+	Missense_Mutation	SNP	T	T	G			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr21:15746215T>G	ENST00000285667.3	-	5	1206	c.1139A>C	c.(1138-1140)aAa>aCa	p.K380T	HSPA13_ENST00000544452.1_Missense_Mutation_p.K172T	NM_006948.4	NP_008879.3	P48723	HSP13_HUMAN	heat shock protein 70kDa family, member 13	380						endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)	ATP binding (GO:0005524)			NS(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(5)|skin(1)|upper_aerodigestive_tract(1)	13						TACCAGTATTTTCTGAAAGAG	0.418																																					p.K380T		Atlas-SNP	.											.	HSPA13	44	.	0			c.A1139C						.						147.0	159.0	155.0					21																	15746215		2203	4300	6503	SO:0001583	missense	6782	exon5			AGTATTTTCTGAA		CCDS13567.1	21q11.1	2011-09-02	2008-06-17	2008-06-17	ENSG00000155304	ENSG00000155304		"""Heat shock proteins / HSP70"""	11375	protein-coding gene	gene with protein product		601100	"""stress 70 protein chaperone, microsome-associated, 60kD"", ""stress 70 protein chaperone, microsome-associated, 60kDa"""	STCH		8825657	Standard	NM_006948		Approved		uc002yjt.3	P48723	OTTHUMG00000074261	ENST00000285667.3:c.1139A>C	chr21.hg19:g.15746215T>G	ENSP00000285667:p.Lys380Thr	153.0	0.0		149.0	71.0	NM_006948	B2R616|Q8NE40	Missense_Mutation	SNP	ENST00000285667.3	hg19	CCDS13567.1	.	.	.	.	.	.	.	.	.	.	T	15.98	2.993556	0.54041	.	.	ENSG00000155304	ENST00000285667;ENST00000544452	T;T	0.01119	5.31;5.31	5.67	5.67	0.87782	.	0.000000	0.85682	D	0.000000	T	0.08980	0.0222	M	0.88031	2.925	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.04678	-1.0934	10	0.38643	T	0.18	-25.6802	16.215	0.82206	0.0:0.0:0.0:1.0	.	380	P48723	HSP13_HUMAN	T	380;172	ENSP00000285667:K380T;ENSP00000441986:K172T	ENSP00000285667:K380T	K	-	2	0	HSPA13	14668086	1.000000	0.71417	1.000000	0.80357	0.106000	0.19336	6.295000	0.72744	2.288000	0.76882	0.533000	0.62120	AAA	.	.		0.418	HSPA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157815.1		
CCT8	10694	hgsc.bcm.edu	37	21	30437364	30437364	+	Silent	SNP	A	A	C	rs143385323		TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr21:30437364A>C	ENST00000286788.4	-	7	893	c.687T>G	c.(685-687)ggT>ggG	p.G229G	CCT8_ENST00000470450.1_5'UTR|CCT8_ENST00000540844.1_Silent_p.G156G|CCT8_ENST00000542732.1_Silent_p.G210G	NM_006585.2	NP_006576.2	P50990	TCPQ_HUMAN	chaperonin containing TCP1, subunit 8 (theta)	229					'de novo' posttranslational protein folding (GO:0051084)|ATP catabolic process (GO:0006200)|binding of sperm to zona pellucida (GO:0007339)|cellular protein metabolic process (GO:0044267)|protein folding (GO:0006457)	aggresome (GO:0016235)|cell body (GO:0044297)|centrosome (GO:0005813)|chaperonin-containing T-complex (GO:0005832)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intermediate filament cytoskeleton (GO:0045111)|microtubule (GO:0005874)|zona pellucida receptor complex (GO:0002199)	ATP binding (GO:0005524)|ATPase activity, coupled (GO:0042623)			breast(3)|endometrium(1)|kidney(1)|large_intestine(4)|liver(1)|lung(1)|prostate(3)	14						ATGTTACATCACCTTCGGTTT	0.388																																					p.G229G		Atlas-SNP	.											.	CCT8	38	.	0			c.T687G						.						173.0	157.0	162.0					21																	30437364		2203	4300	6503	SO:0001819	synonymous_variant	10694	exon7			TACATCACCTTCG	Z37163	CCDS33528.1, CCDS68180.1	21q21.3	2011-09-02			ENSG00000156261	ENSG00000156261		"""Heat Shock Proteins / Chaperonins"""	1623	protein-coding gene	gene with protein product			"""chromosome 21 open reading frame 112"""	C21orf112		7890169	Standard	NM_006585		Approved	Cctq, PRED71	uc002ynb.3	P50990	OTTHUMG00000044595	ENST00000286788.4:c.687T>G	chr21.hg19:g.30437364A>C		90.0	0.0		75.0	38.0	NM_006585	A6NN54|B4DEM7|B4DQH4|Q4VBP8	Silent	SNP	ENST00000286788.4	hg19	CCDS33528.1																																																																																			.	A|0.999;G|0.001		0.388	CCT8-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000171822.1		
IFNAR1	3454	hgsc.bcm.edu	37	21	34715660	34715660	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr21:34715660A>T	ENST00000270139.3	+	4	615	c.463A>T	c.(463-465)Atg>Ttg	p.M155L	IFNAR1_ENST00000442357.2_Missense_Mutation_p.M155L|IFNAR1_ENST00000416947.2_Missense_Mutation_p.M86L	NM_000629.2	NP_000620.2	P17181	INAR1_HUMAN	interferon (alpha, beta and omega) receptor 1	155	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell surface receptor signaling pathway (GO:0007166)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|JAK-STAT cascade (GO:0007259)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-1 beta secretion (GO:0050718)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|response to virus (GO:0009615)|T cell activation (GO:0042110)|type I interferon biosynthetic process (GO:0045351)|type I interferon signaling pathway (GO:0060337)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	type I interferon receptor activity (GO:0004905)			breast(2)|central_nervous_system(1)|cervix(1)|kidney(2)|large_intestine(3)|liver(1)|lung(2)|skin(2)	14					"""""""Interferon Alfa-2a(DB00034)|""""Interferon Alfa-2b(DB00105)|Interferon alfa-n1(DB00011)|Interferon alfa-n3(DB00018)|Interferon alfacon-1(DB00069)|Interferon beta-1a(DB00060)|Interferon beta-1b(DB00068)|Natural alpha interferon(DB05258)|Peginterferon alfa-2a(DB00008)|Peginterferon alfa-2b(DB00022)"""	AGATAGTGTTATGTGGGCTTT	0.358																																					p.M155L	Esophageal Squamous(73;817 1211 32990 35667 42746)	Atlas-SNP	.											.	IFNAR1	44	.	0			c.A463T						.						170.0	173.0	172.0					21																	34715660		2203	4300	6503	SO:0001583	missense	3454	exon4			AGTGTTATGTGGG		CCDS13624.1	21q22.1	2008-05-02			ENSG00000142166	ENSG00000142166		"""Interferons"""	5432	protein-coding gene	gene with protein product		107450		IFNAR		8181059	Standard	NM_000629		Approved	IFRC	uc002yrn.3	P17181	OTTHUMG00000065126	ENST00000270139.3:c.463A>T	chr21.hg19:g.34715660A>T	ENSP00000270139:p.Met155Leu	98.0	0.0		113.0	48.0	NM_000629	B2R6L9|B4DNT3|D3DSF0|Q53GW9|Q53H11|Q6PKD7|Q7M4L2|Q8WTZ2	Missense_Mutation	SNP	ENST00000270139.3	hg19	CCDS13624.1	.	.	.	.	.	.	.	.	.	.	A	10.71	1.427283	0.25726	.	.	ENSG00000142166	ENST00000416947;ENST00000270139;ENST00000442357	T;T;T	0.27104	1.69;1.69;1.69	5.86	4.64	0.57946	Fibronectin, type III (2);Interferon alpha/beta receptor, beta chain (1);Immunoglobulin-like fold (1);	0.388090	0.33364	N	0.005000	T	0.22551	0.0544	M	0.64997	1.995	0.35502	D	0.799853	P	0.36874	0.572	B	0.31751	0.135	T	0.27262	-1.0079	10	0.33940	T	0.23	-20.2627	8.6037	0.33760	0.8294:0.0:0.0:0.1705	.	155	P17181	INAR1_HUMAN	L	86;155;155	ENSP00000395606:M86L;ENSP00000270139:M155L;ENSP00000407406:M155L	ENSP00000270139:M155L	M	+	1	0	IFNAR1	33637530	0.941000	0.31946	0.927000	0.36925	0.090000	0.18270	1.975000	0.40569	2.237000	0.73441	0.528000	0.53228	ATG	.	.		0.358	IFNAR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000139823.4		
UMODL1	89766	hgsc.bcm.edu	37	21	43496123	43496123	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr21:43496123T>A	ENST00000408910.2	+	2	86	c.86T>A	c.(85-87)cTc>cAc	p.L29H	UMODL1_ENST00000400427.1_5'UTR|UMODL1_ENST00000400424.2_5'UTR|UMODL1_ENST00000408989.2_Missense_Mutation_p.L29H	NM_001004416.2	NP_001004416	Q5DID0	UROL1_HUMAN	uromodulin-like 1	29					adipose tissue development (GO:0060612)|cellular response to gonadotropin-releasing hormone (GO:0097211)|multicellular organismal reproductive process (GO:0048609)|regulation of apoptotic process (GO:0042981)|regulation of gene expression (GO:0010468)|regulation of ovarian follicle development (GO:2000354)|single fertilization (GO:0007338)	cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|peptidase inhibitor activity (GO:0030414)			breast(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(5)|lung(22)|ovary(2)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	47						GAAAAAGGCCTCTCCCTGTTG	0.577																																					p.L29H	Pancreas(122;680 807 13940 14411 22888 25505 31742 36028 36332 38435)	Atlas-SNP	.											.	UMODL1	186	.	0			c.T86A						.						128.0	139.0	135.0					21																	43496123		2048	4192	6240	SO:0001583	missense	89766	exon2			AAGGCCTCTCCCT		CCDS42935.1, CCDS42936.1, CCDS56214.1, CCDS56215.1	21q22.3	2008-07-04			ENSG00000177398	ENSG00000177398			12560	protein-coding gene	gene with protein product	"""olfactorin"""	613859				16026467	Standard	NM_173568		Approved		uc002zag.1	Q5DID0	OTTHUMG00000086788	ENST00000408910.2:c.86T>A	chr21.hg19:g.43496123T>A	ENSP00000386147:p.Leu29His	131.0	0.0		92.0	34.0	NM_173568	C9JCE6|Q5DIC9|Q6LA40|Q6LA41|Q8N216	Missense_Mutation	SNP	ENST00000408910.2	hg19	CCDS42936.1	.	.	.	.	.	.	.	.	.	.	T	15.91	2.971243	0.53614	.	.	ENSG00000177398	ENST00000408989;ENST00000408910	D;D	0.81996	-1.56;-1.53	4.44	3.31	0.37934	.	0.000000	0.40554	N	0.001070	T	0.81875	0.4915	N	0.19112	0.55	0.44946	D	0.997961	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.996	T	0.82230	-0.0560	10	0.87932	D	0	-32.1966	7.4516	0.27242	0.0:0.1031:0.0:0.8969	.	29;29	Q5DID0-2;Q5DID0	.;UROL1_HUMAN	H	29	ENSP00000386126:L29H;ENSP00000386147:L29H	ENSP00000386147:L29H	L	+	2	0	UMODL1	42369192	1.000000	0.71417	0.967000	0.41034	0.496000	0.33645	3.115000	0.50391	1.939000	0.56221	0.533000	0.62120	CTC	.	.		0.577	UMODL1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195292.2		
ARVCF	421	hgsc.bcm.edu	37	22	19969151	19969151	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr22:19969151T>C	ENST00000263207.3	-	5	770	c.479A>G	c.(478-480)gAt>gGt	p.D160G	ARVCF_ENST00000487793.1_5'UTR|ARVCF_ENST00000344269.3_Missense_Mutation_p.D97G|ARVCF_ENST00000406259.1_Missense_Mutation_p.D160G|ARVCF_ENST00000406522.1_Missense_Mutation_p.D97G|ARVCF_ENST00000401994.1_Missense_Mutation_p.D97G	NM_001670.2	NP_001661.1	O00192	ARVC_HUMAN	armadillo repeat gene deleted in velocardiofacial syndrome	160					calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|multicellular organismal development (GO:0007275)|single organismal cell-cell adhesion (GO:0016337)	cytoplasm (GO:0005737)|intracellular (GO:0005622)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(1)|cervix(1)|endometrium(3)|liver(1)|lung(4)|prostate(1)|urinary_tract(2)	13	Colorectal(54;0.0993)					CAGGGCACCATCTGCAAAAGG	0.662																																					p.D160G		Atlas-SNP	.											.	ARVCF	54	.	0			c.A479G						.						32.0	39.0	36.0					22																	19969151		2174	4253	6427	SO:0001583	missense	421	exon5			GCACCATCTGCAA		CCDS13771.1	22q11.21	2013-02-14	2010-04-28		ENSG00000099889	ENSG00000099889		"""Armadillo repeat containing"""	728	protein-coding gene	gene with protein product		602269				9126485, 15456900	Standard	NM_001670		Approved		uc002zqz.3	O00192	OTTHUMG00000030426	ENST00000263207.3:c.479A>G	chr22.hg19:g.19969151T>C	ENSP00000263207:p.Asp160Gly	44.0	0.0		38.0	19.0	NM_001670	B7WNV2	Missense_Mutation	SNP	ENST00000263207.3	hg19	CCDS13771.1	.	.	.	.	.	.	.	.	.	.	T	17.77	3.471749	0.63737	.	.	ENSG00000099889	ENST00000263207;ENST00000344269;ENST00000401994;ENST00000406522;ENST00000406259	T;T;T;T;T	0.32023	1.47;1.47;1.47;1.47;1.47	4.43	4.43	0.53597	.	3.396280	0.03899	N	0.279958	T	0.51449	0.1675	L	0.41236	1.265	0.80722	D	1	D	0.69078	0.997	D	0.77004	0.989	T	0.07908	-1.0748	9	.	.	.	-14.2188	14.1392	0.65308	0.0:0.0:0.0:1.0	.	160	O00192	ARVC_HUMAN	G	160;97;97;97;160	ENSP00000263207:D160G;ENSP00000342042:D97G;ENSP00000384341:D97G;ENSP00000384732:D97G;ENSP00000385444:D160G	.	D	-	2	0	ARVCF	18349151	1.000000	0.71417	0.930000	0.37139	0.841000	0.47740	7.263000	0.78421	1.984000	0.57885	0.450000	0.29827	GAT	.	.		0.662	ARVCF-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000075314.5	NM_001670	
HPS4	89781	hgsc.bcm.edu	37	22	26860234	26860234	+	Silent	SNP	G	G	C			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr22:26860234G>C	ENST00000398145.2	-	11	1978	c.1362C>G	c.(1360-1362)ccC>ccG	p.P454P	HPS4_ENST00000493455.2_5'Flank|HPS4_ENST00000402105.3_Silent_p.P449P|HPS4_ENST00000336873.5_Silent_p.P454P|HPS4_ENST00000398141.1_Silent_p.P467P	NM_022081.5	NP_071364.4	Q9NQG7	HPS4_HUMAN	Hermansky-Pudlak syndrome 4	454					blood coagulation (GO:0007596)|hemostasis (GO:0007599)|lysosome organization (GO:0007040)|melanocyte differentiation (GO:0030318)|positive regulation of eye pigmentation (GO:0048075)|protein stabilization (GO:0050821)|protein targeting (GO:0006605)	BLOC-3 complex (GO:0031085)|cytoplasm (GO:0005737)|lysosome (GO:0005764)|melanosome (GO:0042470)|membrane (GO:0016020)|platelet dense granule (GO:0042827)	protein dimerization activity (GO:0046983)|protein homodimerization activity (GO:0042803)			breast(2)|endometrium(3)|kidney(5)|large_intestine(4)|lung(12)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	32						CTCTGGGAATGGGGGCTTGGC	0.607									Hermansky-Pudlak syndrome																												p.P454P		Atlas-SNP	.											.	HPS4	123	.	0			c.C1362G						.						113.0	112.0	113.0					22																	26860234		2203	4300	6503	SO:0001819	synonymous_variant	89781	exon11	Familial Cancer Database	HPS, HPS1-8	GGGAATGGGGGCT		CCDS13835.1, CCDS46677.1	22q12.1	2014-09-17			ENSG00000100099	ENSG00000100099			15844	protein-coding gene	gene with protein product		606682				11836498, 12663659	Standard	NM_022081		Approved	KIAA1667, LE	uc003aci.4	Q9NQG7	OTTHUMG00000030459	ENST00000398145.2:c.1362C>G	chr22.hg19:g.26860234G>C		82.0	0.0		52.0	20.0	NM_022081	B1AHQ4|Q5H8V6|Q96LX6|Q9BY93|Q9UH37|Q9UH38	Silent	SNP	ENST00000398145.2	hg19	CCDS13835.1																																																																																			.	.		0.607	HPS4-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320778.1	NM_022081	
PLA2G3	50487	hgsc.bcm.edu	37	22	31533830	31533830	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr22:31533830C>A	ENST00000215885.3	-	4	1184	c.932G>T	c.(931-933)gGg>gTg	p.G311V		NM_015715.3	NP_056530.2	Q9NZ20	PA2G3_HUMAN	phospholipase A2, group III	311					acrosome assembly (GO:0001675)|cilium morphogenesis (GO:0060271)|glycerophospholipid biosynthetic process (GO:0046474)|lipid catabolic process (GO:0016042)|lipoxygenase pathway (GO:0019372)|mast cell degranulation (GO:0043303)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylglycerol acyl-chain remodeling (GO:0036148)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|sperm axoneme assembly (GO:0007288)	centriole (GO:0005814)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|mast cell granule (GO:0042629)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|calcium-dependent phospholipase A2 activity (GO:0047498)			large_intestine(1)|lung(10)|ovary(1)|prostate(2)|skin(3)|urinary_tract(1)	18						ATGTGGTGGCCCCTTCCGAAG	0.647																																					p.G311V		Atlas-SNP	.											.	PLA2G3	85	.	0			c.G932T						.						102.0	113.0	109.0					22																	31533830		2203	4300	6503	SO:0001583	missense	50487	exon4			GGTGGCCCCTTCC	AF220490	CCDS13889.1	22q12.2	2008-09-19			ENSG00000100078	ENSG00000100078	3.1.1.4		17934	protein-coding gene	gene with protein product		611651				10713052	Standard	NM_015715		Approved	GIII-SPLA2	uc003aka.3	Q9NZ20	OTTHUMG00000151255	ENST00000215885.3:c.932G>T	chr22.hg19:g.31533830C>A	ENSP00000215885:p.Gly311Val	144.0	0.0		90.0	37.0	NM_015715	O95768	Missense_Mutation	SNP	ENST00000215885.3	hg19	CCDS13889.1	.	.	.	.	.	.	.	.	.	.	C	5.061	0.196859	0.09599	.	.	ENSG00000100078	ENST00000215885	T	0.11169	2.8	4.16	3.11	0.35812	.	1.421980	0.04002	N	0.296604	T	0.07638	0.0192	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.32214	-0.9915	10	0.27785	T	0.31	-0.2407	11.2433	0.48982	0.0:0.8136:0.1864:0.0	.	311	Q9NZ20	PA2G3_HUMAN	V	311	ENSP00000215885:G311V	ENSP00000215885:G311V	G	-	2	0	PLA2G3	29863830	0.000000	0.05858	0.023000	0.16930	0.005000	0.04900	0.613000	0.24299	1.050000	0.40346	0.655000	0.94253	GGG	.	.		0.647	PLA2G3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321938.1	NM_015715	
RFPL2	10739	hgsc.bcm.edu	37	22	32586882	32586882	+	Silent	SNP	C	C	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr22:32586882C>T	ENST00000400237.1	-	5	1949	c.1014G>A	c.(1012-1014)gaG>gaA	p.E338E	RFPL2_ENST00000489846.1_5'UTR|RFPL2_ENST00000400236.3_Silent_p.E248E|RFPL2_ENST00000248980.4_Silent_p.E277E|RFPL2_ENST00000248983.4_Silent_p.E248E			O75678	RFPL2_HUMAN	ret finger protein-like 2	338	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.						zinc ion binding (GO:0008270)			endometrium(2)|kidney(4)|large_intestine(3)|lung(9)|ovary(1)|skin(2)	21						GGCGCAATGGCTCCTCAGCAG	0.473																																					p.E338E		Atlas-SNP	.											.	RFPL2	81	.	0			c.G1014A						.						50.0	73.0	65.0					22																	32586882		2203	4299	6502	SO:0001819	synonymous_variant	10739	exon5			CAATGGCTCCTCA	AJ010231	CCDS43009.1, CCDS46694.1, CCDS43009.2	22q12.3	2008-06-12				ENSG00000128253		"""RING-type (C3HC4) zinc fingers"""	9979	protein-coding gene	gene with protein product		605969				10508838	Standard	NM_001098527		Approved	RNF79	uc003amg.3	O75678		ENST00000400237.1:c.1014G>A	chr22.hg19:g.32586882C>T		250.0	1.0		264.0	116.0	NM_001098527		Silent	SNP	ENST00000400237.1	hg19	CCDS43009.2																																																																																			.	.		0.473	RFPL2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000075262.2	NM_006605	
ENTHD1	150350	hgsc.bcm.edu	37	22	40257983	40257983	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr22:40257983C>A	ENST00000325157.6	-	3	629	c.379G>T	c.(379-381)Gtc>Ttc	p.V127F		NM_152512.3	NP_689725.2	Q8IYW4	ENTD1_HUMAN	ENTH domain containing 1	127	ENTH. {ECO:0000255|PROSITE- ProRule:PRU00243}.									breast(2)|endometrium(1)|kidney(6)|large_intestine(6)|lung(11)|ovary(3)|skin(3)	32	Melanoma(58;0.0749)					AATGTGATGACTTGCTTAGAT	0.363																																					p.V127F		Atlas-SNP	.											.	ENTHD1	83	.	0			c.G379T						.						58.0	50.0	53.0					22																	40257983		2203	4300	6503	SO:0001583	missense	150350	exon3			TGATGACTTGCTT	AK093154	CCDS13998.1	22q13.1	2006-06-26			ENSG00000176177	ENSG00000176177			26352	protein-coding gene	gene with protein product						12477932	Standard	NM_152512		Approved	FLJ25421	uc003ayg.3	Q8IYW4	OTTHUMG00000151098	ENST00000325157.6:c.379G>T	chr22.hg19:g.40257983C>A	ENSP00000317431:p.Val127Phe	209.0	0.0		194.0	81.0	NM_152512	B0QYD5|Q5H9F7|Q96LK3	Missense_Mutation	SNP	ENST00000325157.6	hg19	CCDS13998.1	.	.	.	.	.	.	.	.	.	.	C	19.16	3.773075	0.69992	.	.	ENSG00000176177	ENST00000325157	T	0.50001	0.76	6.17	1.65	0.23941	Epsin domain, N-terminal (1);ENTH/VHS (2);Epsin-like, N-terminal (2);	0.351702	0.25164	N	0.032645	T	0.55305	0.1912	M	0.75777	2.31	0.40263	D	0.978202	P	0.46656	0.882	P	0.53146	0.719	T	0.58819	-0.7569	10	0.87932	D	0	-3.336	6.8145	0.23822	0.0:0.5406:0.3319:0.1275	.	127	Q8IYW4	ENTD1_HUMAN	F	127	ENSP00000317431:V127F	ENSP00000317431:V127F	V	-	1	0	ENTHD1	38587929	0.995000	0.38212	0.999000	0.59377	0.823000	0.46562	0.046000	0.14035	0.874000	0.35823	0.655000	0.94253	GTC	.	.		0.363	ENTHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321302.1	NM_152512	
TNRC6B	23112	hgsc.bcm.edu	37	22	40708962	40708962	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr22:40708962G>T	ENST00000454349.2	+	19	4850	c.4639G>T	c.(4639-4641)Gcc>Tcc	p.A1547S	TNRC6B_ENST00000301923.9_Missense_Mutation_p.A743S|TNRC6B_ENST00000335727.9_Missense_Mutation_p.A1437S|TNRC6B_ENST00000402203.1_Missense_Mutation_p.A743S	NM_001162501.1	NP_001155973.1	Q9UPQ9	TNR6B_HUMAN	trinucleotide repeat containing 6B	1547	Silencing domain; interaction with CNOT1 and PAN3.				epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|innate immune response (GO:0045087)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|regulation of translation (GO:0006417)	cytosol (GO:0005829)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)	1						GCCCTACAGTGCCTCTGACAA	0.428																																					p.A1547S		Atlas-SNP	.											.	TNRC6B	195	.	0			c.G4639T						.						93.0	87.0	89.0					22																	40708962		2002	4169	6171	SO:0001583	missense	23112	exon19			TACAGTGCCTCTG	AB029016	CCDS46712.1, CCDS46713.1, CCDS54533.1	22q13	2006-08-22			ENSG00000100354	ENSG00000100354		"""Trinucleotide (CAG) repeat containing"""	29190	protein-coding gene	gene with protein product		610740					Standard	NM_015088		Approved	KIAA1093	uc011aor.2	Q9UPQ9	OTTHUMG00000151114	ENST00000454349.2:c.4639G>T	chr22.hg19:g.40708962G>T	ENSP00000401946:p.Ala1547Ser	110.0	0.0		106.0	39.0	NM_001162501	B0QY73|B0QY78|B4DGC0|Q5TH52|Q8TBX2	Missense_Mutation	SNP	ENST00000454349.2	hg19	CCDS54533.1	.	.	.	.	.	.	.	.	.	.	G	22.4	4.286900	0.80803	.	.	ENSG00000100354	ENST00000301923;ENST00000402203;ENST00000454349;ENST00000400140;ENST00000335727	T;T;T;T	0.45276	0.9;0.9;0.9;0.9	5.55	5.55	0.83447	.	0.000000	0.85682	D	0.000000	T	0.50616	0.1626	L	0.31752	0.955	0.80722	D	1	D;D;D;D	0.76494	0.995;0.999;0.999;0.996	D;D;D;D	0.80764	0.978;0.987;0.994;0.987	T	0.28681	-1.0036	10	0.07030	T	0.85	-7.5731	19.516	0.95165	0.0:0.0:1.0:0.0	.	1547;1437;1437;743	Q9UPQ9;A8MYY3;Q9UPQ9-1;Q9UPQ9-2	TNR6B_HUMAN;.;.;.	S	743;743;1547;1437;1437	ENSP00000306759:A743S;ENSP00000384795:A743S;ENSP00000401946:A1547S;ENSP00000338371:A1437S	ENSP00000306759:A743S	A	+	1	0	TNRC6B	39038908	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.361000	0.97122	2.623000	0.88846	0.655000	0.94253	GCC	.	.		0.428	TNRC6B-202	KNOWN	basic|CCDS	protein_coding	protein_coding			
FBLN1	2192	hgsc.bcm.edu	37	22	45970507	45970507	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr22:45970507C>T	ENST00000327858.6	+	15	1909	c.1814C>T	c.(1813-1815)aCc>aTc	p.T605I	FBLN1_ENST00000348697.2_Intron	NM_006486.2	NP_006477	P23142	FBLN1_HUMAN	fibulin 1	605					embryo implantation (GO:0007566)|extracellular matrix organization (GO:0030198)|viral process (GO:0016032)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)|peptidase activator activity (GO:0016504)			biliary_tract(1)|central_nervous_system(1)|endometrium(4)|kidney(5)|large_intestine(7)|lung(8)|ovary(2)|prostate(1)|skin(1)	30		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0182)		TCGCTGCCTACCTTCCGCGAG	0.647																																					p.T605I		Atlas-SNP	.											.	FBLN1	143	.	0			c.C1814T						.						170.0	96.0	121.0					22																	45970507		2203	4300	6503	SO:0001583	missense	2192	exon15			TGCCTACCTTCCG		CCDS14067.1, CCDS14068.1, CCDS14069.1, CCDS43028.1	22q13.31	2010-06-15			ENSG00000077942	ENSG00000077942		"""Fibulins"""	3600	protein-coding gene	gene with protein product		135820				2269669, 1400330	Standard	NM_006485		Approved	FBLN	uc003bgj.1	P23142	OTTHUMG00000151340	ENST00000327858.6:c.1814C>T	chr22.hg19:g.45970507C>T	ENSP00000331544:p.Thr605Ile	82.0	0.0		57.0	22.0	NM_006486	B0QY42|B1AHL4|P23143|P23144|P37888|Q5TIC4|Q8TBH8|Q9HBQ5|Q9UC21|Q9UGR4|Q9UH41	Missense_Mutation	SNP	ENST00000327858.6	hg19	CCDS14067.1	.	.	.	.	.	.	.	.	.	.	C	23.6	4.434874	0.83885	.	.	ENSG00000077942	ENST00000327858	D	0.83837	-1.77	5.12	5.12	0.69794	.	0.247951	0.39834	N	0.001258	D	0.86485	0.5944	L	0.34521	1.04	0.80722	D	1	D	0.76494	0.999	D	0.85130	0.997	D	0.86268	0.1659	10	0.41790	T	0.15	.	16.3351	0.83056	0.0:1.0:0.0:0.0	.	605	P23142	FBLN1_HUMAN	I	605	ENSP00000331544:T605I	ENSP00000331544:T605I	T	+	2	0	FBLN1	44349171	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	6.453000	0.73488	2.371000	0.80710	0.563000	0.77884	ACC	.	.		0.647	FBLN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000322287.1	NM_006486	
GTSE1	51512	hgsc.bcm.edu	37	22	46719148	46719148	+	Silent	SNP	G	G	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr22:46719148G>T	ENST00000454366.1	+	8	1706	c.1494G>T	c.(1492-1494)acG>acT	p.T498T		NM_016426.6	NP_057510	Q9NYZ3	GTSE1_HUMAN	G-2 and S-phase expressed 1	479					DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|microtubule-based process (GO:0007017)	cytoplasmic microtubule (GO:0005881)|membrane (GO:0016020)				NS(1)|breast(1)|endometrium(1)|kidney(3)|large_intestine(5)|lung(8)|ovary(1)|prostate(1)|skin(2)|stomach(1)|urinary_tract(3)	27		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00462)		AGTCGTGCACGTCAGTTGGCA	0.542																																					p.T498T	GBM(153;542 1915 12487 29016 50495)	Atlas-SNP	.											.	GTSE1	100	.	0			c.G1494T						.						144.0	146.0	145.0					22																	46719148		2203	4300	6503	SO:0001819	synonymous_variant	51512	exon8			GTGCACGTCAGTT	AF223408	CCDS14074.2	22q13.2-q13.3	2008-06-10			ENSG00000075218	ENSG00000075218			13698	protein-coding gene	gene with protein product		607477				10974554, 10984615, 12750368	Standard	NM_016426		Approved	GTSE-1, B99	uc011aqy.2	Q9NYZ3	OTTHUMG00000150486	ENST00000454366.1:c.1494G>T	chr22.hg19:g.46719148G>T		82.0	0.0		57.0	23.0	NM_016426	B0QYM3|Q20WK2|Q53GX5|Q5R3I6|Q6DHX4|Q9BRE0|Q9UGZ9|Q9Y557	Silent	SNP	ENST00000454366.1	hg19	CCDS14074.2																																																																																			.	.		0.542	GTSE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318360.2	NM_016426	
MOV10L1	54456	hgsc.bcm.edu	37	22	50580530	50580530	+	Silent	SNP	C	C	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr22:50580530C>T	ENST00000262794.5	+	16	2174	c.2091C>T	c.(2089-2091)gaC>gaT	p.D697D	MOV10L1_ENST00000540615.1_Silent_p.D677D|MOV10L1_ENST00000395843.1_5'UTR|MOV10L1_ENST00000545383.1_Silent_p.D697D|MOV10L1_ENST00000395858.3_Silent_p.D697D	NM_018995.2	NP_061868.1	Q9BXT6	M10L1_HUMAN	Mov10 RISC complex RNA helicase like 1	697					ATP catabolic process (GO:0006200)|germ cell development (GO:0007281)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	intracellular (GO:0005622)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|magnesium ion binding (GO:0000287)|RNA binding (GO:0003723)			breast(2)|endometrium(2)|kidney(5)|large_intestine(18)|lung(20)|ovary(3)|prostate(1)|skin(9)|stomach(4)|urinary_tract(3)	67		all_cancers(38;3.31e-11)|all_epithelial(38;5.69e-10)|all_lung(38;3.73e-05)|Breast(42;0.000525)|Lung NSC(38;0.000954)|Ovarian(80;0.0367)|Lung SC(80;0.114)		LUAD - Lung adenocarcinoma(64;0.0215)|BRCA - Breast invasive adenocarcinoma(115;0.24)		CAATGACGGACCAAGCTGAGC	0.453																																					p.D697D		Atlas-SNP	.											.	MOV10L1	238	.	0			c.C2091T						.						93.0	82.0	86.0					22																	50580530		2203	4300	6503	SO:0001819	synonymous_variant	54456	exon16			GACGGACCAAGCT	AF285604	CCDS14084.1, CCDS54541.1, CCDS54542.1, CCDS54543.1	22q13.33	2014-07-02	2014-07-02		ENSG00000073146	ENSG00000073146			7201	protein-coding gene	gene with protein product	"""cardiac helicase activated by MEF2C protein"""	605794	"""Mov10 (mouse)-like 1"", ""Mov10l1, Moloney leukemia virus 10-like 1, homolog (mouse)"""			11279525	Standard	NM_018995		Approved	DJ402G11.8, DKFZp434B0717, CHAMP	uc003bjj.3	Q9BXT6	OTTHUMG00000044648	ENST00000262794.5:c.2091C>T	chr22.hg19:g.50580530C>T		85.0	0.0		79.0	37.0	NM_018995	A7E211|A8MXC6|B7WPP1|B7Z7R1|F5H403|Q5TGD5|Q8NBD4|Q9NXW3|Q9UFB3|Q9UGX9	Silent	SNP	ENST00000262794.5	hg19	CCDS14084.1																																																																																			.	.		0.453	MOV10L1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000075009.2	NM_018995	
ACR	49	hgsc.bcm.edu	37	22	51178223	51178223	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr22:51178223T>C	ENST00000216139.5	+	3	423	c.383T>C	c.(382-384)aTc>aCc	p.I128T	AC002056.5_ENST00000532913.1_RNA|AC000036.4_ENST00000449652.1_RNA|ACR_ENST00000529621.1_Missense_Mutation_p.I128T	NM_001097.2	NP_001088.2	P10323	ACRO_HUMAN	acrosin	128	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				acrosome matrix dispersal (GO:0002077)|acrosome reaction (GO:0007340)|activation of adenylate cyclase activity (GO:0007190)|binding of sperm to zona pellucida (GO:0007339)|multicellular organism reproduction (GO:0032504)|response to steroid hormone (GO:0048545)|single fertilization (GO:0007338)	acrosomal matrix (GO:0043159)|extracellular region (GO:0005576)|Golgi-associated vesicle (GO:0005798)|nucleus (GO:0005634)|protein complex (GO:0043234)	amidase activity (GO:0004040)|copper ion binding (GO:0005507)|DNA binding (GO:0003677)|drug binding (GO:0008144)|fucose binding (GO:0042806)|mannose binding (GO:0005537)|serine-type endopeptidase activity (GO:0004252)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(1)|large_intestine(2)|lung(1)|skin(1)	7		all_cancers(38;8.8e-15)|all_epithelial(38;1.12e-12)|all_lung(38;3.07e-05)|Breast(42;6.27e-05)|Lung NSC(38;0.000813)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;1.1e-06)|LUAD - Lung adenocarcinoma(64;0.247)		GTGGAGAAAATCATCATTCAT	0.473																																					p.I128T		Atlas-SNP	.											.	ACR	28	.	0			c.T383C						.						81.0	87.0	85.0					22																	51178223		2203	4300	6503	SO:0001583	missense	49	exon3			AGAAAATCATCAT	CR456366	CCDS14101.1	22q13.33	2012-10-23	2012-10-23		ENSG00000100312	ENSG00000100312	3.4.21.10		126	protein-coding gene	gene with protein product	"""preproacrosin"", ""acrosin light and heavy chain prepropeptide"""	102480				2298447, 12398221	Standard	NM_001097		Approved		uc003bnh.4	P10323	OTTHUMG00000150155	ENST00000216139.5:c.383T>C	chr22.hg19:g.51178223T>C	ENSP00000216139:p.Ile128Thr	156.0	0.0		126.0	58.0	NM_001097	Q6ICK2	Missense_Mutation	SNP	ENST00000216139.5	hg19	CCDS14101.1	.	.	.	.	.	.	.	.	.	.	T	15.07	2.724271	0.48728	.	.	ENSG00000100312	ENST00000216139;ENST00000529621	D;D	0.90004	-2.6;-2.6	4.52	4.52	0.55395	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.000000	0.39985	N	0.001219	D	0.91855	0.7422	L	0.51853	1.615	0.36578	D	0.873397	D;D	0.89917	0.997;1.0	D;D	0.81914	0.978;0.995	D	0.94054	0.7320	10	0.87932	D	0	-25.7551	12.1301	0.53938	0.0:0.0:0.0:1.0	.	128;128	E9PLV5;P10323	.;ACRO_HUMAN	T	128	ENSP00000216139:I128T;ENSP00000435120:I128T	ENSP00000216139:I128T	I	+	2	0	ACR	49525089	0.202000	0.23423	0.779000	0.31741	0.393000	0.30537	3.915000	0.56409	2.043000	0.60533	0.374000	0.22700	ATC	.	.		0.473	ACR-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000316605.2	NM_001097	
NLGN4X	57502	hgsc.bcm.edu	37	X	6069058	6069058	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chrX:6069058G>T	ENST00000381095.3	-	2	1077	c.450C>A	c.(448-450)aaC>aaA	p.N150K	NLGN4X_ENST00000275857.6_Missense_Mutation_p.N150K|NLGN4X_ENST00000469740.1_5'UTR|NLGN4X_ENST00000381093.2_Missense_Mutation_p.N150K|NLGN4X_ENST00000381092.1_Missense_Mutation_p.N150K|NLGN4X_ENST00000538097.1_Missense_Mutation_p.N150K	NM_001282145.1|NM_001282146.1|NM_181332.1	NP_001269074.1|NP_001269075.1|NP_851849.1	Q8N0W4	NLGNX_HUMAN	neuroligin 4, X-linked	150					adult behavior (GO:0030534)|brainstem development (GO:0003360)|cell-cell junction organization (GO:0045216)|cerebellum development (GO:0021549)|learning (GO:0007612)|negative regulation of excitatory postsynaptic membrane potential (GO:0090394)|neuron cell-cell adhesion (GO:0007158)|neuron differentiation (GO:0030182)|organ growth (GO:0035265)|presynaptic membrane assembly (GO:0097105)|social behavior (GO:0035176)|synapse organization (GO:0050808)|vocalization behavior (GO:0071625)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|excitatory synapse (GO:0060076)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|chloride ion binding (GO:0031404)|neurexin family protein binding (GO:0042043)|protein homodimerization activity (GO:0042803)|receptor activity (GO:0004872)			breast(1)|cervix(2)|endometrium(4)|large_intestine(21)|lung(39)|ovary(4)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)	81						GCACGTAGATGTTTAAGTAAA	0.423																																					p.N150K		Atlas-SNP	.											.	NLGN4X	191	.	0			c.C450A						.						134.0	114.0	121.0					X																	6069058		2203	4300	6503	SO:0001583	missense	57502	exon2			GTAGATGTTTAAG	AB033086	CCDS14126.1	Xp22.33	2008-02-05	2004-05-21	2004-05-26	ENSG00000146938	ENSG00000146938			14287	protein-coding gene	gene with protein product		300427	"""neuroligin 4"""	NLGN4		10574462	Standard	XM_005274564		Approved	KIAA1260, NLGN, HLNX	uc004crr.3	Q8N0W4	OTTHUMG00000021093	ENST00000381095.3:c.450C>A	chrX.hg19:g.6069058G>T	ENSP00000370485:p.Asn150Lys	74.0	0.0		51.0	41.0	NM_181332	Q6UX10|Q9ULG0	Missense_Mutation	SNP	ENST00000381095.3	hg19	CCDS14126.1	.	.	.	.	.	.	.	.	.	.	G	17.91	3.504444	0.64410	.	.	ENSG00000146938	ENST00000381095;ENST00000381093;ENST00000275857;ENST00000381092;ENST00000538097	D;D;D;D;D	0.83591	-1.74;-1.74;-1.74;-1.74;-1.74	4.08	2.27	0.28462	Carboxylesterase type B, conserved site (1);Carboxylesterase, type B (1);	.	.	.	.	D	0.93874	0.8040	H	0.99668	4.69	0.58432	D	0.999996	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.994;1.0;0.995	D	0.90293	0.4324	9	0.87932	D	0	.	4.8961	0.13751	0.4897:0.0:0.5103:0.0	.	150;150;150	A6NMU8;Q8N0W4;Q8N0W4-2	.;NLGNX_HUMAN;.	K	150	ENSP00000370485:N150K;ENSP00000370483:N150K;ENSP00000275857:N150K;ENSP00000370482:N150K;ENSP00000439203:N150K	ENSP00000275857:N150K	N	-	3	2	NLGN4X	6079058	1.000000	0.71417	0.962000	0.40283	0.962000	0.63368	1.917000	0.39996	0.582000	0.29556	0.594000	0.82650	AAC	.	.		0.423	NLGN4X-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000055673.1	NM_020742	
PTCHD1	139411	hgsc.bcm.edu	37	X	23397834	23397834	+	Silent	SNP	C	C	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chrX:23397834C>T	ENST00000379361.4	+	2	1338	c.478C>T	c.(478-480)Cta>Tta	p.L160L		NM_173495.2	NP_775766.2	Q96NR3	PTHD1_HUMAN	patched domain containing 1	160					cognition (GO:0050890)|smoothened signaling pathway (GO:0007224)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	hedgehog receptor activity (GO:0008158)			NS(1)|breast(4)|endometrium(3)|kidney(3)|large_intestine(9)|lung(14)|ovary(4)|skin(2)|urinary_tract(2)	42						CCTGGAAGAGCTAAAGAATGC	0.468																																					p.L160L		Atlas-SNP	.											.	PTCHD1	213	.	0			c.C478T						.						99.0	85.0	89.0					X																	23397834		2203	4300	6503	SO:0001819	synonymous_variant	139411	exon2			GAAGAGCTAAAGA	AK054858	CCDS35215.2	Xp22.13	2008-02-05			ENSG00000165186	ENSG00000165186			26392	protein-coding gene	gene with protein product		300828					Standard	NM_173495		Approved	FLJ30296	uc004dal.4	Q96NR3	OTTHUMG00000021251	ENST00000379361.4:c.478C>T	chrX.hg19:g.23397834C>T		358.0	0.0		242.0	204.0	NM_173495	B4DQH0|Q0IJ60|Q6P6B8	Silent	SNP	ENST00000379361.4	hg19	CCDS35215.2																																																																																			.	.		0.468	PTCHD1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056047.2	NM_173495	
SUPT20HL1	100130302	hgsc.bcm.edu	37	X	24383280	24383280	+	IGR	SNP	G	G	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chrX:24383280G>T								AC004552.1 (16257 upstream) : PDK3 (100057 downstream)																							tgcaaccgcagtggcagccaa	0.637																																					p.Q801H		Atlas-SNP	.											.	.	.	.	0			c.G2403T						.						4.0	7.0	6.0					X																	24383280		1344	3106	4450	SO:0001628	intergenic_variant	100130302	exon1			ACCGCAGTGGCAG																													chrX.hg19:g.24383280G>T		121.0	1.0		77.0	66.0	NM_001136234		Missense_Mutation	SNP		hg19																																																																																				.	.	0	0.637								
MAGEB5	347541	hgsc.bcm.edu	37	X	26235588	26235588	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chrX:26235588T>C	ENST00000602297.1	+	2	417	c.170T>C	c.(169-171)aTg>aCg	p.M57T	MAGEB5_ENST00000379029.2_Missense_Mutation_p.M57T	NM_001271752.1	NP_001258681.1	Q9BZ81	MAGB5_HUMAN	melanoma antigen family B, 5	57	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.									lung(1)|ovary(1)	2						AAGTTCAAAATGAAACAGCGT	0.418																																					p.M57T		Atlas-SNP	.											.	MAGEB5	5	.	0			c.T170C						.																																			SO:0001583	missense	347541	exon2			TCAAAATGAAACA	AF333705	CCDS65233.1	Xp22	2012-04-20			ENSG00000188408	ENSG00000188408			23795	protein-coding gene	gene with protein product	"""cancer/testis antigen family 3, member 3"""	300466				10861452	Standard	NM_001271752		Approved	MAGE-B5, CT3.3	uc031thc.1	Q9BZ81	OTTHUMG00000021288	ENST00000602297.1:c.170T>C	chrX.hg19:g.26235588T>C	ENSP00000473493:p.Met57Thr	124.0	0.0		132.0	111.0	NM_001271752		Missense_Mutation	SNP	ENST00000602297.1	hg19		.	.	.	.	.	.	.	.	.	.	T	1.843	-0.466841	0.04476	.	.	ENSG00000188408	ENST00000379029	T	0.04654	3.58	4.06	1.58	0.23477	.	0.122077	0.52532	U	0.000073	T	0.05181	0.0138	L	0.46670	1.46	0.09310	N	1	.	.	.	.	.	.	T	0.31110	-0.9955	8	0.32370	T	0.25	.	2.7404	0.05252	0.2255:0.1239:0.0:0.6506	.	.	.	.	T	57	ENSP00000368315:M57T	ENSP00000368315:M57T	M	+	2	0	MAGEB5	26145509	0.034000	0.19679	0.000000	0.03702	0.012000	0.07955	0.766000	0.26560	0.201000	0.20466	0.486000	0.48141	ATG	.	.		0.418	MAGEB5-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000056126.2	XM_293407	
PPP1R3F	89801	hgsc.bcm.edu	37	X	49143177	49143177	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chrX:49143177A>G	ENST00000055335.6	+	4	2041	c.2025A>G	c.(2023-2025)atA>atG	p.I675M	PPP1R3F_ENST00000495799.1_Missense_Mutation_p.I329M|PPP1R3F_ENST00000376188.1_Missense_Mutation_p.I329M|PPP1R3F_ENST00000466508.1_Missense_Mutation_p.I329M|PPP1R3F_ENST00000438316.1_Missense_Mutation_p.I346M	NM_033215.4	NP_149992.3	Q6ZSY5	PPR3F_HUMAN	protein phosphatase 1, regulatory subunit 3F	675					regulation of glycogen (starch) synthase activity (GO:2000465)|regulation of glycogen biosynthetic process (GO:0005979)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	glycogen binding (GO:2001069)|protein phosphatase binding (GO:0019903)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(8)|ovary(2)|skin(4)	27	Ovarian(276;0.236)					AAGCCCAGATAGAGGTCACCA	0.592																																					p.I675M		Atlas-SNP	.											.	PPP1R3F	56	.	0			c.A2025G						.						47.0	32.0	37.0					X																	49143177		2202	4299	6501	SO:0001583	missense	89801	exon4			CCAGATAGAGGTC		CCDS35254.1, CCDS55415.1	Xp11.23	2012-04-17	2011-10-04		ENSG00000049769	ENSG00000049769		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14944	protein-coding gene	gene with protein product			"""protein phosphatase 1, regulatory (inhibitor) subunit 3F"""			11948623	Standard	NM_033215		Approved	Hb2E	uc004dnh.2	Q6ZSY5	OTTHUMG00000024139	ENST00000055335.6:c.2025A>G	chrX.hg19:g.49143177A>G	ENSP00000055335:p.Ile675Met	134.0	0.0		115.0	99.0	NM_033215	A2VDJ8|B3KPW2|E9PCM3	Missense_Mutation	SNP	ENST00000055335.6	hg19	CCDS35254.1	.	.	.	.	.	.	.	.	.	.	A	0.001	-3.035642	0.00040	.	.	ENSG00000049769	ENST00000466508;ENST00000438316;ENST00000055335;ENST00000495799;ENST00000376188	T;T;T;T;T	0.53206	1.06;1.05;0.63;1.06;1.06	4.8	1.92	0.25849	.	0.639785	0.15112	N	0.279920	T	0.14013	0.0339	N	0.01352	-0.895	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.33085	-0.9882	10	0.02654	T	1	-3.8068	5.6646	0.17689	0.3537:0.0:0.6463:0.0	.	346;360;675	F5H262;A2VDJ8;Q6ZSY5	.;.;PPR3F_HUMAN	M	329;346;675;329;329	ENSP00000420687:I329M;ENSP00000415548:I346M;ENSP00000055335:I675M;ENSP00000417535:I329M;ENSP00000365359:I329M	ENSP00000055335:I675M	I	+	3	3	PPP1R3F	49030121	.	.	0.074000	0.20217	0.375000	0.29983	.	.	0.520000	0.28426	-0.383000	0.06682	ATA	.	.		0.592	PPP1R3F-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000060819.2	NM_033215	
APEX2	27301	hgsc.bcm.edu	37	X	55033578	55033578	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chrX:55033578A>T	ENST00000374987.3	+	6	1333	c.1267A>T	c.(1267-1269)Acc>Tcc	p.T423S	ALAS2_ENST00000498636.1_5'Flank	NM_014481.2	NP_055296.2	Q9UBZ4	APEX2_HUMAN	APEX nuclease (apurinic/apyrimidinic endonuclease) 2	423					base-excision repair (GO:0006284)|cell cycle (GO:0007049)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA catabolic process, exonucleolytic (GO:0000738)|DNA recombination (GO:0006310)	mitochondrial inner membrane (GO:0005743)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-(apurinic or apyrimidinic site) lyase activity (GO:0003906)|double-stranded DNA 3'-5' exodeoxyribonuclease activity (GO:0008311)|zinc ion binding (GO:0008270)			breast(1)|endometrium(8)|large_intestine(4)|lung(6)|prostate(1)|urinary_tract(1)	21						CGCCCTCATGACCCCGAAGAC	0.547								Other BER factors																													p.T423S		Atlas-SNP	.											.	APEX2	50	.	0			c.A1267T						.						53.0	47.0	49.0					X																	55033578		2203	4300	6503	SO:0001583	missense	27301	exon6			CTCATGACCCCGA	AB021260	CCDS14365.1	Xp11.23	2014-02-18			ENSG00000169188	ENSG00000169188	4.2.99.18		17889	protein-coding gene	gene with protein product	"""zinc finger, GRF-type containing 2"""	300773				11376153	Standard	NM_014481		Approved	APEXL2, APE2, XTH2, ZGRF2	uc004dtz.4	Q9UBZ4	OTTHUMG00000021642	ENST00000374987.3:c.1267A>T	chrX.hg19:g.55033578A>T	ENSP00000364126:p.Thr423Ser	124.0	0.0		86.0	62.0	NM_014481	Q9Y5X7	Missense_Mutation	SNP	ENST00000374987.3	hg19	CCDS14365.1	.	.	.	.	.	.	.	.	.	.	A	0.485	-0.877881	0.02550	.	.	ENSG00000169188	ENST00000374987	T	0.59364	0.27	4.46	1.76	0.24704	.	0.831979	0.11053	N	0.604765	T	0.40297	0.1111	L	0.38838	1.175	0.09310	N	1	B	0.16166	0.016	B	0.09377	0.004	T	0.23119	-1.0197	10	0.15066	T	0.55	-3.4926	5.0712	0.14608	0.6345:0.1841:0.0:0.1813	.	423	Q9UBZ4	APEX2_HUMAN	S	423	ENSP00000364126:T423S	ENSP00000364126:T423S	T	+	1	0	APEX2	55050303	0.000000	0.05858	0.002000	0.10522	0.018000	0.09664	0.544000	0.23253	0.621000	0.30232	-0.527000	0.04329	ACC	.	.		0.547	APEX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056845.1		
KIF4A	24137	hgsc.bcm.edu	37	X	69572476	69572476	+	Silent	SNP	A	A	G			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chrX:69572476A>G	ENST00000374403.3	+	14	1540	c.1458A>G	c.(1456-1458)gcA>gcG	p.A486A	KIF4A_ENST00000374388.3_Silent_p.A486A	NM_012310.4	NP_036442.3	O95239	KIF4A_HUMAN	kinesin family member 4A	486					anterograde axon cargo transport (GO:0008089)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|organelle organization (GO:0006996)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinesin complex (GO:0005871)|membrane (GO:0016020)|midbody (GO:0030496)|nucleus (GO:0005634)|spindle microtubule (GO:0005876)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)			breast(6)|endometrium(9)|kidney(3)|large_intestine(8)|lung(15)|ovary(4)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	51						GCATGGCTGCAGCCATTGATA	0.418																																					p.A486A		Atlas-SNP	.											.	KIF4A	118	.	0			c.A1458G						.						97.0	87.0	90.0					X																	69572476		2203	4300	6503	SO:0001819	synonymous_variant	24137	exon14			GGCTGCAGCCATT	AF179308	CCDS14401.1	Xq13.1	2008-08-11			ENSG00000090889	ENSG00000090889		"""Kinesins"""	13339	protein-coding gene	gene with protein product	"""chromokinesin"""	300521				10773663	Standard	NM_012310		Approved	KIF4-G1, KIF4, HSA271784, FLJ12530, FLJ12655, FLJ14204, FLJ20631	uc004dyg.3	O95239	OTTHUMG00000021775	ENST00000374403.3:c.1458A>G	chrX.hg19:g.69572476A>G		104.0	0.0		152.0	77.0	NM_012310	B2R7V5|D3DVU4|Q86TN3|Q86XX7|Q9NNY6|Q9NY24|Q9UMW3	Silent	SNP	ENST00000374403.3	hg19	CCDS14401.1																																																																																			.	.		0.418	KIF4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057068.1	NM_012310	
TEX11	56159	hgsc.bcm.edu	37	X	69772028	69772028	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chrX:69772028A>T	ENST00000395889.2	-	29	2668	c.2513T>A	c.(2512-2514)cTg>cAg	p.L838Q	TEX11_ENST00000374320.2_Missense_Mutation_p.L513Q|TEX11_ENST00000374333.2_Missense_Mutation_p.L823Q|TEX11_ENST00000344304.3_Missense_Mutation_p.L838Q	NM_001003811.1	NP_001003811.1	Q8IYF3	TEX11_HUMAN	testis expressed 11	838					chiasma assembly (GO:0051026)|fertilization (GO:0009566)|male gonad development (GO:0008584)|male meiosis chromosome segregation (GO:0007060)|meiotic gene conversion (GO:0006311)|negative regulation of apoptotic process (GO:0043066)|reciprocal meiotic recombination (GO:0007131)|resolution of meiotic recombination intermediates (GO:0000712)|synaptonemal complex assembly (GO:0007130)	central element (GO:0000801)				breast(4)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(12)|lung(13)|ovary(3)|prostate(3)|skin(3)	48	Renal(35;0.156)					AACTTCTTCCAGGGGACAGAG	0.403																																					p.L838Q		Atlas-SNP	.											.	TEX11	132	.	0			c.T2513A						.						80.0	71.0	74.0					X																	69772028		2203	4300	6503	SO:0001583	missense	56159	exon29			TCTTCCAGGGGAC	AF285594	CCDS35323.1, CCDS43968.1	Xp11	2008-02-05	2007-03-13		ENSG00000120498	ENSG00000120498			11733	protein-coding gene	gene with protein product		300311	"""testis expressed sequence 11"""			11279525	Standard	NM_001003811		Approved	TSGA3, TGC1	uc004dyl.3	Q8IYF3	OTTHUMG00000021782	ENST00000395889.2:c.2513T>A	chrX.hg19:g.69772028A>T	ENSP00000379226:p.Leu838Gln	326.0	1.0		467.0	215.0	NM_001003811	A8K8V6|Q5JQQ8|Q96LZ4|Q96M47|Q9BXU6	Missense_Mutation	SNP	ENST00000395889.2	hg19	CCDS35323.1	.	.	.	.	.	.	.	.	.	.	A	9.317	1.057101	0.19907	.	.	ENSG00000120498	ENST00000374333;ENST00000395889;ENST00000374320;ENST00000344304	T;T;T;T	0.52295	1.23;1.24;0.67;1.24	4.96	2.52	0.30459	.	0.444700	0.20340	N	0.094244	T	0.36413	0.0966	L	0.49350	1.555	0.09310	N	1	P;P	0.46512	0.879;0.807	B;B	0.41571	0.36;0.197	T	0.23833	-1.0177	9	.	.	.	0.1952	3.4912	0.07638	0.5497:0.0:0.097:0.3532	.	823;838	Q8IYF3-3;Q8IYF3	.;TEX11_HUMAN	Q	823;838;513;838	ENSP00000363453:L823Q;ENSP00000379226:L838Q;ENSP00000363440:L513Q;ENSP00000340995:L838Q	.	L	-	2	0	TEX11	69688753	0.956000	0.32656	0.006000	0.13384	0.828000	0.46876	3.147000	0.50639	0.226000	0.20979	-0.396000	0.06452	CTG	.	.		0.403	TEX11-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000359072.1		
P2RY10	27334	hgsc.bcm.edu	37	X	78216943	78216943	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chrX:78216943C>A	ENST00000171757.2	+	4	1206	c.926C>A	c.(925-927)gCt>gAt	p.A309D	P2RY10_ENST00000544091.1_Missense_Mutation_p.A309D	NM_014499.2	NP_055314.1	O00398	P2Y10_HUMAN	purinergic receptor P2Y, G-protein coupled, 10	309						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled purinergic nucleotide receptor activity (GO:0045028)			breast(2)|central_nervous_system(1)|endometrium(3)|large_intestine(9)|lung(22)|ovary(3)|skin(2)	42						TACTTTATGGCTTCAGAGTTT	0.473																																					p.A309D		Atlas-SNP	.											.	P2RY10	99	.	0			c.C926A						.						153.0	140.0	144.0					X																	78216943		2203	4300	6503	SO:0001583	missense	27334	exon2			TTATGGCTTCAGA	AF000545	CCDS14442.1	Xq21.1	2012-08-23			ENSG00000078589	ENSG00000078589		"""Purinergic receptors"", ""GPCR / Class A : Purinergic receptors, P2Y"""	19906	protein-coding gene	gene with protein product		300529				11004484, 9755289	Standard	NM_014499		Approved	P2Y10	uc004edf.3	O00398	OTTHUMG00000021896	ENST00000171757.2:c.926C>A	chrX.hg19:g.78216943C>A	ENSP00000171757:p.Ala309Asp	125.0	0.0		188.0	84.0	NM_198333	D3DTE5|Q4VBN7|Q86V16	Missense_Mutation	SNP	ENST00000171757.2	hg19	CCDS14442.1	.	.	.	.	.	.	.	.	.	.	C	16.92	3.255739	0.59321	.	.	ENSG00000078589	ENST00000544091;ENST00000171757	T;T	0.36340	1.26;1.26	4.99	4.99	0.66335	.	0.588494	0.17181	N	0.183871	T	0.23532	0.0569	N	0.08118	0	0.44395	D	0.9973	P	0.38020	0.615	B	0.38156	0.266	T	0.12837	-1.0532	10	0.37606	T	0.19	.	15.8593	0.79009	0.0:1.0:0.0:0.0	.	309	O00398	P2Y10_HUMAN	D	309	ENSP00000443138:A309D;ENSP00000171757:A309D	ENSP00000171757:A309D	A	+	2	0	P2RY10	78103599	0.997000	0.39634	1.000000	0.80357	0.991000	0.79684	3.518000	0.53451	2.311000	0.77944	0.597000	0.82753	GCT	.	.		0.473	P2RY10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057323.1		
PCDH11X	27328	hgsc.bcm.edu	37	X	91131828	91131828	+	Nonsense_Mutation	SNP	A	A	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chrX:91131828A>T	ENST00000373094.1	+	2	1434	c.589A>T	c.(589-591)Aag>Tag	p.K197*	PCDH11X_ENST00000373088.1_Nonsense_Mutation_p.K197*|PCDH11X_ENST00000373097.1_Nonsense_Mutation_p.K197*|PCDH11X_ENST00000406881.1_Nonsense_Mutation_p.K197*|PCDH11X_ENST00000395337.2_Nonsense_Mutation_p.K197*|PCDH11X_ENST00000298274.8_Nonsense_Mutation_p.K197*|PCDH11X_ENST00000504220.2_Nonsense_Mutation_p.K197*|PCDH11X_ENST00000361724.1_Nonsense_Mutation_p.K197*|PCDH11X_ENST00000361655.2_Nonsense_Mutation_p.K197*	NM_032968.3	NP_116750.1	Q9BZA7	PC11X_HUMAN	protocadherin 11 X-linked	197	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|negative regulation of phosphatase activity (GO:0010923)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|autonomic_ganglia(1)|biliary_tract(1)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(30)|liver(4)|lung(92)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	159						AGAAGGAGACAAGATGCCACA	0.358																																					p.K197X	NSCLC(38;925 1092 2571 38200 45895)	Atlas-SNP	.											.	PCDH11X	714	.	0			c.A589T						.						79.0	72.0	75.0					X																	91131828		2202	4296	6498	SO:0001587	stop_gained	27328	exon2			GGAGACAAGATGC	AB026187	CCDS14461.1, CCDS14462.1, CCDS55458.1, CCDS55459.1, CCDS55460.1, CCDS55461.1	Xq21.3	2014-06-13	2002-05-22	2002-05-24	ENSG00000102290	ENSG00000102290		"""Cadherins / Protocadherins : Non-clustered"""	8656	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 119"""	300246	"""protocadherin 11"""	PCDH11		10644456	Standard	NM_001168360		Approved	PCDH-X, PCDHX, PPP1R119	uc004efm.2	Q9BZA7	OTTHUMG00000021965	ENST00000373094.1:c.589A>T	chrX.hg19:g.91131828A>T	ENSP00000362186:p.Lys197*	333.0	1.0		554.0	238.0	NM_001168363	A6NIQ4|Q2TJH0|Q2TJH1|Q2TJH3|Q5JVZ0|Q70LR8|Q70LS7|Q70LS8|Q70LS9|Q70LT7|Q70LT8|Q70LT9|Q70LU0|Q70LU1|Q96RV4|Q96RW0|Q9BZA6|Q9H4E0|Q9P2M0|Q9P2X5	Nonsense_Mutation	SNP	ENST00000373094.1	hg19	CCDS14461.1	.	.	.	.	.	.	.	.	.	.	A	16.29	3.080250	0.55753	.	.	ENSG00000102290	ENST00000395337;ENST00000373094;ENST00000373097;ENST00000361724;ENST00000373088;ENST00000504220;ENST00000361655;ENST00000406881;ENST00000356934;ENST00000298274	.	.	.	4.69	4.69	0.59074	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	12.4567	0.55708	1.0:0.0:0.0:0.0	.	.	.	.	X	197	.	ENSP00000298274:K197X	K	+	1	0	PCDH11X	91018484	1.000000	0.71417	0.878000	0.34440	0.172000	0.22775	8.999000	0.93557	1.526000	0.49068	0.441000	0.28932	AAG	.	.		0.358	PCDH11X-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000057436.1	NM_032969	
PCDH11X	27328	hgsc.bcm.edu	37	X	91873264	91873264	+	Splice_Site	SNP	T	T	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chrX:91873264T>A	ENST00000373094.1	+	7	4214	c.3369T>A	c.(3367-3369)gcT>gcA	p.A1123A	PCDH11X_ENST00000373088.1_Splice_Site_p.A1086A|PCDH11X_ENST00000373097.1_Splice_Site_p.A1113A|PCDH11X_ENST00000406881.1_Splice_Site_p.T1115T|PCDH11X_ENST00000298274.8_Silent_p.A1086A|PCDH11X_ENST00000504220.2_3'UTR|PCDH11X_ENST00000361655.2_Splice_Site_p.T1105T	NM_032968.3	NP_116750.1	Q9BZA7	PC11X_HUMAN	protocadherin 11 X-linked	1123					homophilic cell adhesion (GO:0007156)|negative regulation of phosphatase activity (GO:0010923)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|autonomic_ganglia(1)|biliary_tract(1)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(30)|liver(4)|lung(92)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	159						CCCCAACAGCTGCAGAAATAA	0.378																																					p.A1123A	NSCLC(38;925 1092 2571 38200 45895)	Atlas-SNP	.											.	PCDH11X	714	.	0			c.T3369A						.						34.0	28.0	30.0					X																	91873264		2201	4297	6498	SO:0001630	splice_region_variant	27328	exon7			AACAGCTGCAGAA	AB026187	CCDS14461.1, CCDS14462.1, CCDS55458.1, CCDS55459.1, CCDS55460.1, CCDS55461.1	Xq21.3	2014-06-13	2002-05-22	2002-05-24	ENSG00000102290	ENSG00000102290		"""Cadherins / Protocadherins : Non-clustered"""	8656	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 119"""	300246	"""protocadherin 11"""	PCDH11		10644456	Standard	NM_001168360		Approved	PCDH-X, PCDHX, PPP1R119	uc004efm.2	Q9BZA7	OTTHUMG00000021965	ENST00000373094.1:c.3368-1T>A	chrX.hg19:g.91873264T>A		112.0	0.0		245.0	116.0	NM_032968	A6NIQ4|Q2TJH0|Q2TJH1|Q2TJH3|Q5JVZ0|Q70LR8|Q70LS7|Q70LS8|Q70LS9|Q70LT7|Q70LT8|Q70LT9|Q70LU0|Q70LU1|Q96RV4|Q96RW0|Q9BZA6|Q9H4E0|Q9P2M0|Q9P2X5	Silent	SNP	ENST00000373094.1	hg19	CCDS14461.1																																																																																			.	.		0.378	PCDH11X-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000057436.1	NM_032969	Silent
COL4A6	1288	hgsc.bcm.edu	37	X	107464587	107464587	+	Silent	SNP	A	A	G			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chrX:107464587A>G	ENST00000372216.4	-	4	265	c.165T>C	c.(163-165)atT>atC	p.I55I	COL4A6_ENST00000538570.1_Silent_p.I54I|COL4A6_ENST00000545689.1_Silent_p.I54I|COL4A6_ENST00000394872.2_Silent_p.I54I|COL4A6_ENST00000334504.7_Silent_p.I54I	NM_001847.2	NP_001838.2	Q14031	CO4A6_HUMAN	collagen, type IV, alpha 6	55	Triple-helical region.				cell adhesion (GO:0007155)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(20)|lung(41)|ovary(7)|prostate(1)|skin(1)|stomach(1)|urinary_tract(2)	92						CTTGAATTCCAATTGGTCCAG	0.478									Alport syndrome with Diffuse Leiomyomatosis																												p.I55I	Melanoma(87;1895 1945 2589 7165)	Atlas-SNP	.											.	COL4A6	270	.	0			c.T165C						.						114.0	98.0	103.0					X																	107464587		2203	4300	6503	SO:0001819	synonymous_variant	1288	exon4	Familial Cancer Database		AATTCCAATTGGT	U04845	CCDS14541.1, CCDS14542.1, CCDS76008.1, CCDS76009.1, CCDS76010.1	Xq22	2014-09-17			ENSG00000197565	ENSG00000197565		"""Collagens"""	2208	protein-coding gene	gene with protein product		303631				8356449	Standard	NM_033641		Approved		uc004env.4	Q14031	OTTHUMG00000022179	ENST00000372216.4:c.165T>C	chrX.hg19:g.107464587A>G		89.0	0.0		153.0	73.0	NM_001847	Q12823|Q14053|Q5JYH6|Q5JYH8|Q9NQM5|Q9NTX3|Q9UJ76|Q9UMG6|Q9Y4L4	Silent	SNP	ENST00000372216.4	hg19	CCDS14541.1																																																																																			.	.		0.478	COL4A6-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000057875.2		
GPC4	2239	hgsc.bcm.edu	37	X	132458433	132458433	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chrX:132458433C>A	ENST00000370828.3	-	3	975	c.451G>T	c.(451-453)Gtg>Ttg	p.V151L	GPC4_ENST00000535467.1_Missense_Mutation_p.V81L	NM_001448.2	NP_001439.2	O75487	GPC4_HUMAN	glypican 4	151					anatomical structure morphogenesis (GO:0009653)|carbohydrate metabolic process (GO:0005975)|cell proliferation (GO:0008283)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	anchored component of membrane (GO:0031225)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|lysosomal lumen (GO:0043202)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(16)|skin(1)|upper_aerodigestive_tract(1)	28	Acute lymphoblastic leukemia(192;0.000127)					TTTCCCACCACGTAGTAACGT	0.433																																					p.V151L		Atlas-SNP	.											.	GPC4	58	.	0			c.G451T						.						173.0	176.0	175.0					X																	132458433		2203	4300	6503	SO:0001583	missense	2239	exon3			CCACCACGTAGTA	AF030186	CCDS14637.1	Xq26.1	2008-02-05			ENSG00000076716	ENSG00000076716		"""Proteoglycans / Cell Surface : Glypicans"""	4452	protein-coding gene	gene with protein product	"""glypican proteoglycan 4"""	300168				9787072	Standard	NM_001448		Approved	K-glypican	uc004exc.1	O75487	OTTHUMG00000022434	ENST00000370828.3:c.451G>T	chrX.hg19:g.132458433C>A	ENSP00000359864:p.Val151Leu	118.0	0.0		200.0	91.0	NM_001448	B2R6J7|B4E2C0|Q6ZMA6|Q96L43|Q9NU08|Q9UJN1|Q9UPD9	Missense_Mutation	SNP	ENST00000370828.3	hg19	CCDS14637.1	.	.	.	.	.	.	.	.	.	.	C	9.882	1.201945	0.22121	.	.	ENSG00000076716	ENST00000370828;ENST00000536418;ENST00000535467	T;T	0.46819	0.86;0.86	5.94	5.94	0.96194	.	0.398190	0.28766	N	0.014206	T	0.44644	0.1303	L	0.39898	1.24	0.39044	D	0.960181	B	0.13594	0.008	B	0.20577	0.03	T	0.33266	-0.9875	10	0.48119	T	0.1	0.1747	18.1511	0.89675	0.0:1.0:0.0:0.0	.	151	O75487	GPC4_HUMAN	L	151;149;81	ENSP00000359864:V151L;ENSP00000444959:V81L	ENSP00000359864:V151L	V	-	1	0	GPC4	132286099	0.022000	0.18835	0.880000	0.34516	0.412000	0.31113	1.003000	0.29809	2.509000	0.84616	0.529000	0.55759	GTG	.	.		0.433	GPC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058338.1	NM_001448	
GPR112	139378	hgsc.bcm.edu	37	X	135488040	135488040	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chrX:135488040A>T	ENST00000394143.1	+	23	9135	c.8844A>T	c.(8842-8844)ttA>ttT	p.L2948F	GPR112_ENST00000412101.1_Missense_Mutation_p.L2743F|GPR112_ENST00000287534.4_Missense_Mutation_p.L2701F|GPR112_ENST00000370652.1_Missense_Mutation_p.L2948F|GPR112_ENST00000394141.1_Missense_Mutation_p.L2743F	NM_153834.3	NP_722576.3	Q8IZF6	GP112_HUMAN	G protein-coupled receptor 112	2948					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(2)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(33)|lung(97)|ovary(5)|pancreas(2)|prostate(4)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(2)	199	Acute lymphoblastic leukemia(192;0.000127)					TGACATTCTTACTTGGCCTCA	0.438																																					p.L2948F		Atlas-SNP	.											.	GPR112	459	.	0			c.A8844T						.						159.0	141.0	147.0					X																	135488040		2203	4300	6503	SO:0001583	missense	139378	exon23			ATTCTTACTTGGC	AY140954	CCDS35409.1	Xq26.3	2014-08-08			ENSG00000156920	ENSG00000156920		"""-"", ""GPCR / Class B : Orphans"""	18992	protein-coding gene	gene with protein product						12435584	Standard	XM_005262367		Approved	RP1-299I16, PGR17	uc004ezu.1	Q8IZF6	OTTHUMG00000022508	ENST00000394143.1:c.8844A>T	chrX.hg19:g.135488040A>T	ENSP00000377699:p.Leu2948Phe	76.0	0.0		157.0	26.0	NM_153834	A2A2J1|A2A2J2|Q5EGP2|Q86SM6	Missense_Mutation	SNP	ENST00000394143.1	hg19	CCDS35409.1	.	.	.	.	.	.	.	.	.	.	A	18.45	3.626427	0.66901	.	.	ENSG00000156920	ENST00000394143;ENST00000370652;ENST00000412101;ENST00000287534;ENST00000394141	T;T;T;T;T	0.68181	-0.31;-0.31;-0.31;-0.31;-0.31	4.71	-2.15	0.07102	GPCR, family 2-like (1);	.	.	.	.	D	0.84497	0.5485	H	0.96833	3.89	0.32878	D	0.510135	D;D	0.89917	1.0;1.0	D;D	0.97110	0.998;1.0	T	0.83267	-0.0045	9	0.87932	D	0	.	8.3267	0.32162	0.4221:0.1183:0.4596:0.0	.	2743;2948	Q8IZF6-3;Q8IZF6	.;GP112_HUMAN	F	2948;2948;2743;2701;2743	ENSP00000377699:L2948F;ENSP00000359686:L2948F;ENSP00000416526:L2743F;ENSP00000287534:L2701F;ENSP00000377697:L2743F	ENSP00000287534:L2701F	L	+	3	2	GPR112	135315706	0.346000	0.24844	0.978000	0.43139	0.978000	0.69477	-0.176000	0.09811	-0.441000	0.07201	-0.314000	0.08810	TTA	.	.		0.438	GPR112-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000286639.1		
MAGEC3	139081	hgsc.bcm.edu	37	X	140969387	140969387	+	Silent	SNP	C	C	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chrX:140969387C>T	ENST00000298296.1	+	4	714	c.714C>T	c.(712-714)ggC>ggT	p.G238G	MAGEC3_ENST00000443323.2_Intron|MAGEC3_ENST00000448920.1_Intron|MAGEC3_ENST00000536088.1_Intron	NM_138702.1	NP_619647.1	Q8TD91	MAGC3_HUMAN	melanoma antigen family C, 3	238	MAGE 1. {ECO:0000255|PROSITE- ProRule:PRU00127}.									NS(2)|breast(3)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(6)|liver(1)|lung(32)|ovary(1)|prostate(1)|skin(5)|stomach(1)|urinary_tract(2)	69	Acute lymphoblastic leukemia(192;6.56e-05)					TTCTTTTTGGCATTTCCCTGA	0.473																																					p.G238G		Atlas-SNP	.											.	MAGEC3	228	.	0			c.C714T						.						154.0	138.0	144.0					X																	140969387		2203	4300	6503	SO:0001819	synonymous_variant	139081	exon4			TTTTGGCATTTCC	AF490508	CCDS14676.1, CCDS14677.1	Xq27.2	2009-03-25			ENSG00000165509	ENSG00000165509			23798	protein-coding gene	gene with protein product	"""cancer/testis antigen family 7, member 2"""	300469				10861452	Standard	NM_138702		Approved	HCA2, MAGE-C3, CT7.2	uc011mwp.2	Q8TD91	OTTHUMG00000022570	ENST00000298296.1:c.714C>T	chrX.hg19:g.140969387C>T		89.0	0.0		141.0	60.0	NM_138702	Q3SYA7|Q5JZ43|Q9BZ80	Silent	SNP	ENST00000298296.1	hg19	CCDS14676.1																																																																																			.	.		0.473	MAGEC3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058606.1	NM_138702	
AFF2	2334	hgsc.bcm.edu	37	X	147743516	147743516	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chrX:147743516A>G	ENST00000370460.2	+	3	747	c.268A>G	c.(268-270)Aat>Gat	p.N90D	AFF2_ENST00000370457.5_Missense_Mutation_p.N86D|AFF2_ENST00000342251.3_Missense_Mutation_p.N86D|AFF2_ENST00000370458.1_Missense_Mutation_p.N86D	NM_001169123.1|NM_002025.3	NP_001162594.1|NP_002016.2	P51816	AFF2_HUMAN	AF4/FMR2 family, member 2	90					brain development (GO:0007420)|learning or memory (GO:0007611)|mRNA processing (GO:0006397)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	nuclear speck (GO:0016607)	G-quadruplex RNA binding (GO:0002151)			breast(5)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(29)|liver(2)|lung(39)|ovary(4)|pancreas(5)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	109	Acute lymphoblastic leukemia(192;6.56e-05)					TAACCATTCTAATCAGAATCA	0.368																																					p.N90D		Atlas-SNP	.											.	AFF2	679	.	0			c.A268G						.						130.0	132.0	131.0					X																	147743516		2203	4300	6503	SO:0001583	missense	2334	exon3			CATTCTAATCAGA	U48436	CCDS14684.1, CCDS55521.1, CCDS76040.1	Xq28	2008-02-05	2005-06-27	2005-06-27	ENSG00000155966	ENSG00000155966			3776	protein-coding gene	gene with protein product		300806	"""fragile X mental retardation 2"""	FMR2			Standard	NM_002025		Approved	FRAXE	uc004fcp.3	P51816	OTTHUMG00000022613	ENST00000370460.2:c.268A>G	chrX.hg19:g.147743516A>G	ENSP00000359489:p.Asn90Asp	248.0	0.0		394.0	176.0	NM_002025	A2RTY4|B4DXD5|B7WNQ1|B7ZLD6|B7ZLD9|O43786|O60215|P78407|Q13521|Q14323|Q7Z2F7|Q7Z400|Q9UNA5	Missense_Mutation	SNP	ENST00000370460.2	hg19	CCDS14684.1	.	.	.	.	.	.	.	.	.	.	A	18.15	3.560822	0.65538	.	.	ENSG00000155966	ENST00000370460;ENST00000370457;ENST00000342251;ENST00000370458	T;T;T;T	0.65732	-0.17;-0.17;-0.17;-0.17	5.63	5.63	0.86233	.	0.053377	0.64402	D	0.000001	T	0.60379	0.2264	L	0.39898	1.24	0.80722	D	1	P;P;P;P;P;P	0.49862	0.592;0.592;0.592;0.787;0.822;0.929	B;B;B;B;P;P	0.46419	0.322;0.322;0.322;0.322;0.451;0.516	T	0.64266	-0.6448	10	0.59425	D	0.04	.	14.8595	0.70369	1.0:0.0:0.0:0.0	.	90;86;86;86;90;86	P51816-6;P51816-3;P51816-2;P51816-5;P51816;P51816-4	.;.;.;.;AFF2_HUMAN;.	D	90;86;86;86	ENSP00000359489:N90D;ENSP00000359486:N86D;ENSP00000345459:N86D;ENSP00000359487:N86D	ENSP00000345459:N86D	N	+	1	0	AFF2	147551208	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	8.983000	0.93477	1.891000	0.54761	0.486000	0.48141	AAT	.	.		0.368	AFF2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058673.2	NM_002025	
EMD	2010	hgsc.bcm.edu	37	X	153607910	153607910	+	Silent	SNP	G	G	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chrX:153607910G>T	ENST00000369842.4	+	1	354	c.66G>T	c.(64-66)ccG>ccT	p.P22P	EMD_ENST00000369835.3_Silent_p.P22P	NM_000117.2	NP_000108.1	P50402	EMD_HUMAN	emerin	22	LEM. {ECO:0000255|PROSITE- ProRule:PRU00313}.				cellular response to growth factor stimulus (GO:0071363)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mitotic nuclear envelope reassembly (GO:0007084)|muscle contraction (GO:0006936)|muscle organ development (GO:0007517)|negative regulation of catenin import into nucleus (GO:0035414)|negative regulation of fibroblast proliferation (GO:0048147)|positive regulation of protein export from nucleus (GO:0046827)|regulation of canonical Wnt signaling pathway (GO:0060828)|skeletal muscle cell differentiation (GO:0035914)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|microtubule (GO:0005874)|nuclear envelope (GO:0005635)|nuclear inner membrane (GO:0005637)|nuclear membrane (GO:0031965)|nuclear outer membrane (GO:0005640)	actin binding (GO:0003779)|beta-tubulin binding (GO:0048487)			lung(5)	5	all_cancers(53;3.7e-16)|all_epithelial(53;2.97e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					ACAACATCCCGCACGGGCCTG	0.726																																					p.P22P		Atlas-SNP	.											.	EMD	25	.	0			c.G66T						.						25.0	20.0	22.0					X																	153607910		2075	4069	6144	SO:0001819	synonymous_variant	2010	exon1			CATCCCGCACGGG	X82434	CCDS14745.1	Xq27.3-q28	2014-09-17	2008-07-29		ENSG00000102119	ENSG00000102119			3331	protein-coding gene	gene with protein product	"""LEM domain containing 5"""	300384	"""Emery-Dreifuss muscular dystrophy"""				Standard	NM_000117		Approved	STA, LEMD5	uc004fkl.3	P50402	OTTHUMG00000033186	ENST00000369842.4:c.66G>T	chrX.hg19:g.153607910G>T		77.0	0.0		100.0	46.0	NM_000117	Q6FI02	Silent	SNP	ENST00000369842.4	hg19	CCDS14745.1																																																																																			.	.		0.726	EMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080921.1		
CTAG2	30848	hgsc.bcm.edu	37	X	153880820	153880820	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chrX:153880820G>T	ENST00000247306.4	-	2	418	c.355C>A	c.(355-357)Cca>Aca	p.P119T	CTAG2_ENST00000369585.3_Missense_Mutation_p.P119T	NM_020994.3	NP_066274.2	O75638	CTAG2_HUMAN	cancer/testis antigen 2	119						centrosome (GO:0005813)				central_nervous_system(1)|endometrium(1)|lung(6)|ovary(1)|pancreas(1)	10	all_cancers(53;5.05e-16)|all_epithelial(53;1.87e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					ACCGCCCCTGGTCGGGGGAGA	0.647																																					p.P119T		Atlas-SNP	.											.	CTAG2	88	.	0			c.C355A						.						48.0	47.0	47.0					X																	153880820		2203	4298	6501	SO:0001583	missense	30848	exon2			CCCCTGGTCGGGG	AJ012833	CCDS14759.1, CCDS35455.1	Xq28	2009-08-18			ENSG00000126890	ENSG00000126890			2492	protein-coding gene	gene with protein product	"""CTL-recognized antigen on melanoma"", ""LAGE-1a protein"", ""cancer/testis antigen family 6, member 2a"", ""cancer/testis antigen family 6, member 2b"""	300396				9626360, 10399963	Standard	NM_020994		Approved	LAGE-1, CAMEL, LAGE1, ESO2, MGC3803, MGC138724, CT6.2a, CT6.2b, LAGE-1a, LAGE-1b	uc004fmi.2	O75638	OTTHUMG00000024239	ENST00000247306.4:c.355C>A	chrX.hg19:g.153880820G>T	ENSP00000247306:p.Pro119Thr	134.0	0.0		178.0	88.0	NM_020994	O75637|Q0VIL6|Q14CD6|Q2Z1N4|Q9BU80|Q9UJ89|Q9Y479	Missense_Mutation	SNP	ENST00000247306.4	hg19	CCDS14759.1	.	.	.	.	.	.	.	.	.	.	G	11.21	1.570117	0.28003	.	.	ENSG00000126890	ENST00000247306;ENST00000369585;ENST00000454505	T;T	0.31247	1.5;1.5	1.59	1.59	0.23543	.	.	.	.	.	T	0.22126	0.0533	L	0.51422	1.61	0.09310	N	1	P;P	0.47350	0.894;0.689	B;B	0.32762	0.152;0.065	T	0.17653	-1.0362	9	0.72032	D	0.01	1.1791	8.7212	0.34441	0.0:0.0:1.0:0.0	.	119;119	O75638;O75638-2	CTAG2_HUMAN;.	T	119;119;61	ENSP00000247306:P119T;ENSP00000358598:P119T	ENSP00000247306:P119T	P	-	1	0	CTAG2	153534014	0.001000	0.12720	0.001000	0.08648	0.001000	0.01503	0.804000	0.27098	1.110000	0.41699	0.377000	0.23210	CCA	.	.		0.647	CTAG2-001	PUTATIVE	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000061176.1	NM_020994	
VBP1	7411	hgsc.bcm.edu	37	X	154444801	154444801	+	Silent	SNP	C	C	G			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chrX:154444801C>G	ENST00000286428.5	+	1	159	c.42C>G	c.(40-42)gcC>gcG	p.A14A	VBP1_ENST00000535916.1_Intron	NM_003372.5	NP_003363.1	P61758	PFD3_HUMAN	von Hippel-Lindau binding protein 1	14					'de novo' posttranslational protein folding (GO:0051084)|cellular protein metabolic process (GO:0044267)|protein folding (GO:0006457)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|prefoldin complex (GO:0016272)				NS(1)|endometrium(3)|lung(5)|prostate(1)|skin(1)|urinary_tract(1)	12	all_cancers(53;1.86e-17)|all_epithelial(53;2.71e-11)|all_lung(58;1.84e-07)|Lung NSC(58;5.62e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)					GAGAAATGGCCACAGGGAATG	0.642																																					p.A14A		Atlas-SNP	.											.	VBP1	20	.	0			c.C42G						.						46.0	34.0	38.0					X																	154444801		2154	4200	6354	SO:0001819	synonymous_variant	7411	exon1			AATGGCCACAGGG	U56833	CCDS14765.1	Xq28	2008-07-07			ENSG00000155959	ENSG00000155959			12662	protein-coding gene	gene with protein product	"""prefoldin 3"""	300133				8674032, 9339366	Standard	NM_003372		Approved	PFD3, PFDN3	uc004fnc.3	P61758	OTTHUMG00000022666	ENST00000286428.5:c.42C>G	chrX.hg19:g.154444801C>G		69.0	0.0		130.0	72.0	NM_003372	B2R8L5|O55228|Q15765|Q5JT81|Q86X96	Silent	SNP	ENST00000286428.5	hg19	CCDS14765.1																																																																																			.	.		0.642	VBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058806.1		
C9orf50	375759	hgsc.bcm.edu	37	9	132375462	132375471	+	Frame_Shift_Del	DEL	GAACAGAAGG	GAACAGAAGG	-			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	GAACAGAAGG	GAACAGAAGG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr9:132375462_132375471delGAACAGAAGG	ENST00000372478.4	-	6	1304_1313	c.1103_1112delCCTTCTGTTC	c.(1102-1113)cccttctgttcafs	p.PFCS368fs	NTMT1_ENST00000372486.1_Intron	NM_199350.3	NP_955382.3	Q5SZB4	CI050_HUMAN	chromosome 9 open reading frame 50	368				P -> S (in Ref. 3; AAI12354). {ECO:0000305}.						central_nervous_system(1)|endometrium(4)|large_intestine(2)|ovary(1)|skin(1)|urinary_tract(1)	10		Ovarian(14;0.00556)				CTTCTTCCATGAACAGAAGGGCAGGCTGCT	0.6																																					p.368_371del		Atlas-Indel,Pindel	.											.	C9orf50	25	.	0			c.1104_1113del						.																																			SO:0001589	frameshift_variant	375759	exon6			.	AK093122	CCDS35159.1	9q34.2	2012-03-15			ENSG00000179058	ENSG00000179058			23677	protein-coding gene	gene with protein product							Standard	NM_199350		Approved	FLJ35803	uc004byc.4	Q5SZB4	OTTHUMG00000020786	ENST00000372478.4:c.1103_1112delCCTTCTGTTC	chr9.hg19:g.132375462_132375471delGAACAGAAGG	ENSP00000361556:p.Pro368fs	105.0	0.0		87.0	25.0	NM_199350	Q2M1I2|Q8NA65	Frame_Shift_Del	DEL	ENST00000372478.4	hg19	CCDS35159.1																																																																																			.	.		0.600	C9orf50-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054593.1	NM_199350	
LMBRD1	55788	hgsc.bcm.edu	37	6	70411411	70411411	+	Frame_Shift_Del	DEL	C	C	-			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr6:70411411delC	ENST00000370577.3	-	11	1236	c.1007delG	c.(1006-1008)ggafs	p.G336fs	LMBRD1_ENST00000370570.1_Frame_Shift_Del_p.G263fs	NM_018368.3	NP_060838.3	Q9NUN5	LMBD1_HUMAN	LMBR1 domain containing 1	336					cobalamin metabolic process (GO:0009235)|insulin receptor internalization (GO:0038016)|negative regulation of glucose import (GO:0046325)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of protein kinase B signaling (GO:0051898)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	clathrin-coated endocytic vesicle (GO:0045334)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|plasma membrane (GO:0005886)	cobalamin binding (GO:0031419)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(7)|lung(11)|ovary(2)|upper_aerodigestive_tract(1)	31						AGAATCTATTCCAGCTGAATG	0.249																																					p.G336fs		Atlas-Indel,Pindel	.											.	LMBRD1	61	.	0			c.1008delA						.						47.0	47.0	47.0					6																	70411411		2198	4288	6486	SO:0001589	frameshift_variant	55788	exon11			.	AF113224	CCDS4969.1	6q13	2011-05-12	2005-07-25	2005-07-25	ENSG00000168216	ENSG00000168216			23038	protein-coding gene	gene with protein product		612625	"""chromosome 6 open reading frame 209"""	C6orf209		19136951	Standard	NM_018368		Approved	FLJ11240, bA810I22.1, cblF	uc003pfa.3	Q9NUN5	OTTHUMG00000014985	ENST00000370577.3:c.1007delG	chr6.hg19:g.70411411delC	ENSP00000359609:p.Gly336fs	211.0	0.0		240.0	99.0	NM_018368	A8K204|E1P531|Q5VUN6|Q86Y70|Q96FW4|Q9BY56|Q9NZD6	Frame_Shift_Del	DEL	ENST00000370577.3	hg19	CCDS4969.1																																																																																			.	.		0.249	LMBRD1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041124.1	NM_018368	
CTNNB1	1499	hgsc.bcm.edu	37	3	41266127	41266150	+	In_Frame_Del	DEL	ACAGCTCCTTCTCTGAGTGGTAAA	ACAGCTCCTTCTCTGAGTGGTAAA	-	rs121913407|rs121913409		TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	ACAGCTCCTTCTCTGAGTGGTAAA	ACAGCTCCTTCTCTGAGTGGTAAA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr3:41266127_41266150delACAGCTCCTTCTCTGAGTGGTAAA	ENST00000349496.5	+	3	404_427	c.124_147delACAGCTCCTTCTCTGAGTGGTAAA	c.(124-147)acagctccttctctgagtggtaaadel	p.TAPSLSGK42del	CTNNB1_ENST00000396185.3_In_Frame_Del_p.TAPSLSGK42del|CTNNB1_ENST00000396183.3_In_Frame_Del_p.TAPSLSGK42del|CTNNB1_ENST00000405570.1_In_Frame_Del_p.TAPSLSGK42del|CTNNB1_ENST00000453024.1_In_Frame_Del_p.TAPSLSGK35del	NM_001904.3	NP_001895.1	P35222	CTNB1_HUMAN	catenin (cadherin-associated protein), beta 1, 88kDa	42					adherens junction assembly (GO:0034333)|androgen receptor signaling pathway (GO:0030521)|anterior/posterior axis specification (GO:0009948)|apoptotic process (GO:0006915)|bone resorption (GO:0045453)|branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of cardiac outflow tract cell proliferation (GO:0061324)|canonical Wnt signaling pathway involved in positive regulation of epithelial to mesenchymal transition (GO:0044334)|cell adhesion (GO:0007155)|cell fate specification (GO:0001708)|cell maturation (GO:0048469)|cell-matrix adhesion (GO:0007160)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to growth factor stimulus (GO:0071363)|cellular response to indole-3-methanol (GO:0071681)|cellular response to mechanical stimulus (GO:0071260)|central nervous system vasculogenesis (GO:0022009)|cytoskeletal anchoring at plasma membrane (GO:0007016)|determination of dorsal/ventral asymmetry (GO:0048262)|dorsal/ventral axis specification (GO:0009950)|ectoderm development (GO:0007398)|embryonic axis specification (GO:0000578)|embryonic digit morphogenesis (GO:0042733)|embryonic foregut morphogenesis (GO:0048617)|embryonic forelimb morphogenesis (GO:0035115)|embryonic heart tube development (GO:0035050)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal limb joint morphogenesis (GO:0036023)|endodermal cell fate commitment (GO:0001711)|endothelial tube morphogenesis (GO:0061154)|epithelial cell differentiation involved in prostate gland development (GO:0060742)|epithelial to mesenchymal transition (GO:0001837)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|fungiform papilla formation (GO:0061198)|gastrulation with mouth forming second (GO:0001702)|genitalia morphogenesis (GO:0035112)|glial cell fate determination (GO:0007403)|hair cell differentiation (GO:0035315)|hair follicle morphogenesis (GO:0031069)|hair follicle placode formation (GO:0060789)|hindbrain development (GO:0030902)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|layer formation in cerebral cortex (GO:0021819)|lens morphogenesis in camera-type eye (GO:0002089)|liver development (GO:0001889)|lung cell differentiation (GO:0060479)|lung induction (GO:0060492)|lung-associated mesenchyme development (GO:0060484)|male genitalia development (GO:0030539)|mesenchymal cell proliferation involved in lung development (GO:0060916)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|midgut development (GO:0007494)|muscle cell differentiation (GO:0042692)|myoblast differentiation (GO:0045445)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of heart induction by canonical Wnt signaling pathway (GO:0003136)|negative regulation of neuron death (GO:1901215)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein sumoylation (GO:0033234)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephron tubule formation (GO:0072079)|neural plate development (GO:0001840)|neuron migration (GO:0001764)|odontogenesis of dentin-containing tooth (GO:0042475)|oocyte development (GO:0048599)|osteoclast differentiation (GO:0030316)|oviduct development (GO:0060066)|pancreas development (GO:0031016)|patterning of blood vessels (GO:0001569)|positive regulation of apoptotic process (GO:0043065)|positive regulation of branching involved in lung morphogenesis (GO:0061047)|positive regulation of determination of dorsal identity (GO:2000017)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of epithelial cell proliferation involved in prostate gland development (GO:0060769)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of heparan sulfate proteoglycan biosynthetic process (GO:0010909)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein heterooligomerization (GO:0051291)|protein localization to cell surface (GO:0034394)|proximal/distal pattern formation (GO:0009954)|regulation of angiogenesis (GO:0045765)|regulation of calcium ion import (GO:0090279)|regulation of centriole-centriole cohesion (GO:0030997)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of fibroblast proliferation (GO:0048145)|regulation of myelination (GO:0031641)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of protein localization to cell surface (GO:2000008)|regulation of secondary heart field cardioblast proliferation (GO:0003266)|regulation of smooth muscle cell proliferation (GO:0048660)|regulation of T cell proliferation (GO:0042129)|renal inner medulla development (GO:0072053)|renal outer medulla development (GO:0072054)|renal vesicle formation (GO:0072033)|response to cadmium ion (GO:0046686)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|Schwann cell proliferation (GO:0014010)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle cell differentiation (GO:0051145)|synapse organization (GO:0050808)|synaptic vesicle transport (GO:0048489)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tongue morphogenesis (GO:0043587)|trachea formation (GO:0060440)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	adherens junction (GO:0005912)|apical part of cell (GO:0045177)|basolateral plasma membrane (GO:0016323)|beta-catenin destruction complex (GO:0030877)|beta-catenin-TCF7L2 complex (GO:0070369)|catenin complex (GO:0016342)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell periphery (GO:0071944)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microvillus membrane (GO:0031528)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein-DNA complex (GO:0032993)|Scrib-APC-beta-catenin complex (GO:0034750)|synapse (GO:0045202)|tight junction (GO:0005923)|transcription factor complex (GO:0005667)|Z disc (GO:0030018)|zonula adherens (GO:0005915)	alpha-catenin binding (GO:0045294)|androgen receptor binding (GO:0050681)|cadherin binding (GO:0045296)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|I-SMAD binding (GO:0070411)|ion channel binding (GO:0044325)|kinase binding (GO:0019900)|nuclear hormone receptor binding (GO:0035257)|protein C-terminus binding (GO:0008022)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|R-SMAD binding (GO:0070412)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|structural molecule activity (GO:0005198)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.S45F(384)|p.S45P(168)|p.S45del(54)|p.A5_A80del(53)|p.S45C(19)|p.S45Y(17)|p.S45A(11)|p.K49R(9)|p.G48D(9)|p.A5_A80>D(7)|p.A5_Q143del(7)|p.T42R(5)|p.Q28_H134del(5)|p.A43V(5)|p.P44A(5)|p.A43T(4)|p.?(4)|p.P44S(4)|p.L46L(3)|p.S47N(3)|p.T42I(3)|p.W25_I140del(3)|p.T42fs*7(3)|p.T3_A126del(2)|p.M5_N141>D(2)|p.K49*(2)|p.D32_S47del(2)|p.G48V(2)|p.S45_S47>C(2)|p.P44_S45del(2)|p.S47T(2)|p.A43P(2)|p.A5_Y142>D(2)|p.A5fs*7(2)|p.T42_A43insSS(2)|p.L10_N141del(2)|p.P44L(2)|p.S37_G48>C(1)|p.Q28_Q61del(1)|p.A20_N141del(1)|p.D11_Y142>H(1)|p.K49E(1)|p.K49K(1)|p.Y30_A97del(1)|p.K49L(1)|p.T40_L46del(1)|p.Q28_A43del(1)|p.E15_I140>V(1)|p.H24_M131del(1)|p.P44del(1)|p.A13_R151del(1)|p.M1_A87del(1)|p.L46_S47del(1)|p.P44_N51del(1)|p.V22_T102del(1)|p.S45fs*2(1)|p.T42T(1)|p.S45E(1)|p.T42S(1)|p.S45T(1)|p.A21_A80del(1)|p.S45S(1)|p.T42A(1)|p.A39_T42del(1)|p.I35_K170del(1)|p.L46V(1)|p.M14_S45del(1)|p.T42_G48del(1)|p.P44_S45insAP(1)|p.S45_G48del(1)|p.T42_K49>Q(1)|p.S45_D58del(1)|p.P16_K133del(1)|p.A20_A80del(1)|p.A5_T59del(1)|p.M1_V173del(1)|p.S47C(1)|p.S47G(1)|p.S47R(1)|p.A5_Q143>E(1)|p.H36_E53>L(1)|p.Y30_A80del(1)|p.A43del(1)|p.S45_L46del(1)|p.T41_N51del(1)|p.A5_E54del(1)|p.M8_A80del(1)|p.V22_S71>A(1)|p.V22_Y64del(1)|p.A20_S111del(1)	CTNNB1/PLAG1(60)	NS(4)|adrenal_gland(103)|biliary_tract(43)|bone(21)|breast(7)|central_nervous_system(260)|cervix(9)|endometrium(293)|eye(1)|haematopoietic_and_lymphoid_tissue(60)|kidney(202)|large_intestine(269)|liver(1010)|lung(63)|oesophagus(6)|ovary(106)|pancreas(126)|parathyroid(11)|pituitary(111)|pleura(2)|prostate(31)|salivary_gland(13)|skin(103)|small_intestine(17)|soft_tissue(792)|stomach(165)|thyroid(55)|upper_aerodigestive_tract(2)|urinary_tract(8)	3893				KIRC - Kidney renal clear cell carcinoma(284;0.0028)|Kidney(284;0.00294)		TGCCACTACCACAGCTCCTTCTCTGAGTGGTAAAGGCAATCCTG	0.5	S45F(HCC15_LUNG)|S45F(LS180_LARGE_INTESTINE)	15	"""H, Mis, T"""	PLAG1	"""colorectal, cvarian,  hepatoblastoma, others, pleomorphic salivary adenoma"""				Pilomatrixoma, Familial Clustering of																												p.41_49del	Colon(6;3 56 14213 18255)	Atlas-Indel,Pindel	.		Dom	yes		3	3p22-p21.3	1499	"""catenin (cadherin-associated protein), beta 1"""		"""E, M, O"""	CTNNB1,gallbladder,other,+2,3	CTNNB1	4904	.	866	Substitution - Missense(664)|Deletion - In frame(158)|Complex - deletion inframe(20)|Unknown(7)|Deletion - Frameshift(6)|Substitution - coding silent(6)|Insertion - In frame(3)|Substitution - Nonsense(2)	soft_tissue(284)|liver(213)|large_intestine(104)|kidney(98)|adrenal_gland(34)|endometrium(28)|thyroid(22)|skin(16)|haematopoietic_and_lymphoid_tissue(15)|stomach(12)|pituitary(7)|ovary(7)|biliary_tract(5)|lung(3)|cervix(3)|prostate(3)|central_nervous_system(2)|pancreas(2)|small_intestine(2)|bone(2)|breast(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	c.123_146del						.																																			SO:0001651	inframe_deletion	1499	exon3	Familial Cancer Database	Pilomatricoma, Familial Clustering of, Epithelioma Calcificans of Malherbe	.	X87838	CCDS2694.1	3p21	2013-02-15	2002-08-29		ENSG00000168036	ENSG00000168036		"""Armadillo repeat containing"""	2514	protein-coding gene	gene with protein product		116806	"""catenin (cadherin-associated protein), beta 1 (88kD)"""	CTNNB		7829088	Standard	NM_001098210		Approved	beta-catenin, armadillo	uc003ckr.2	P35222	OTTHUMG00000131393	ENST00000349496.5:c.124_147delACAGCTCCTTCTCTGAGTGGTAAA	chr3.hg19:g.41266127_41266150delACAGCTCCTTCTCTGAGTGGTAAA	ENSP00000344456:p.Thr42_Lys49del	195.0	0.0		95.0	63.0	NM_001098210	A8K1L7|Q8NEW9|Q8NI94|Q9H391	In_Frame_Del	DEL	ENST00000349496.5	hg19	CCDS2694.1																																																																																			.	.		0.500	CTNNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254182.2	NM_001098210	
IFIT5	24138	hgsc.bcm.edu	37	10	91174557	91174558	+	Start_Codon_Ins	INS	-	-	GA			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr10:91174557_91174558insGA	ENST00000371795.4	+	0	215_216				IFIT5_ENST00000416601.1_Start_Codon_Ins|LIPA_ENST00000371837.1_5'Flank	NM_012420.2	NP_036552.1	Q13325	IFIT5_HUMAN	interferon-induced protein with tetratricopeptide repeats 5						defense response to virus (GO:0051607)|innate immune response (GO:0045087)	actin cytoskeleton (GO:0015629)|apical part of cell (GO:0045177)|ruffle membrane (GO:0032587)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|single-stranded RNA binding (GO:0003727)|tRNA binding (GO:0000049)			endometrium(1)|large_intestine(4)|lung(4)	9						GCTGCCATCATGAGGTAAGGGT	0.649																																					p.M1fs		Atlas-Indel,Pindel	.											.	IFIT5	32	.	0			c.2_3insGA						.																																			SO:0001582	initiator_codon_variant	24138	exon1			.	U34605	CCDS7403.1	10q23.31	2013-01-10			ENSG00000152778	ENSG00000152778		"""Tetratricopeptide (TTC) repeat domain containing"""	13328	protein-coding gene	gene with protein product	"""retinoic acid- and interferon-inducible protein (58kD)"""					9398535	Standard	NM_012420		Approved	RI58	uc010qnh.2	Q13325	OTTHUMG00000018713	ENST00000371795.4:c.3_4dupGA	chr10.hg19:g.91174558_91174559dupGA		40.0	0.0		78.0	45.0	NM_012420	B2R5X9|B4DDV1|Q5T7I9|Q6IAX3	Frame_Shift_Ins	INS	ENST00000371795.4	hg19	CCDS7403.1																																																																																			.	.		0.649	IFIT5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049303.1	NM_012420	
NCSTN	23385	hgsc.bcm.edu	37	1	160314603	160314606	+	Frame_Shift_Del	DEL	GATT	GATT	-			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	GATT	GATT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr1:160314603_160314606delGATT	ENST00000294785.5	+	2	302_305	c.177_180delGATT	c.(175-180)cagattfs	p.QI59fs	COPA_ENST00000241704.7_5'Flank|NCSTN_ENST00000368063.1_Frame_Shift_Del_p.QI39fs|NCSTN_ENST00000535857.1_Frame_Shift_Del_p.QI59fs|NCSTN_ENST00000392212.4_Frame_Shift_Del_p.QI39fs|COPA_ENST00000368069.3_5'Flank	NM_015331.2	NP_056146.1	Q92542	NICA_HUMAN	nicastrin	59					amyloid precursor protein catabolic process (GO:0042987)|apoptotic signaling pathway (GO:0097190)|beta-amyloid metabolic process (GO:0050435)|epithelial cell proliferation (GO:0050673)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|membrane protein ectodomain proteolysis (GO:0006509)|membrane protein intracellular domain proteolysis (GO:0031293)|myeloid cell homeostasis (GO:0002262)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|positive regulation of apoptotic process (GO:0043065)|positive regulation of catalytic activity (GO:0043085)|protein processing (GO:0016485)|proteolysis (GO:0006508)|T cell proliferation (GO:0042098)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|plasma membrane (GO:0005886)	endopeptidase activity (GO:0004175)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(16)|ovary(1)|prostate(1)|skin(2)	34	all_cancers(52;8.15e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			CCACTCATCAGATTGGCTGCCAGT	0.451																																					p.59_60del		Atlas-Indel,Pindel	.											.	NCSTN	64	.	0			c.176_179del						.																																			SO:0001589	frameshift_variant	23385	exon2			.	AF240468	CCDS1203.1	1q22-q23	2014-09-17			ENSG00000162736	ENSG00000162736			17091	protein-coding gene	gene with protein product		605254				9039502, 10993067	Standard	XM_005245053		Approved	KIAA0253, APH2	uc001fvx.3	Q92542	OTTHUMG00000033110	ENST00000294785.5:c.177_180delGATT	chr1.hg19:g.160314603_160314606delGATT	ENSP00000294785:p.Gln59fs	122.0	0.0		180.0	116.0	NM_015331	Q5T207|Q5T208|Q86VV5	Frame_Shift_Del	DEL	ENST00000294785.5	hg19	CCDS1203.1																																																																																			.	.		0.451	NCSTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080622.1	NM_015331	
DGAT1	8694	hgsc.bcm.edu	37	8	145540683	145540684	+	Splice_Site	INS	-	-	CC			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr8:145540683_145540684insCC	ENST00000332324.4	-	15	1522		c.e15+1		GS1-393G12.12_ENST00000525023.1_RNA|DGAT1_ENST00000527438.1_Splice_Site	NM_012079.4	NP_036211.2	O75907	DGAT1_HUMAN	diacylglycerol O-acyltransferase 1						acylglycerol acyl-chain remodeling (GO:0036155)|cellular lipid metabolic process (GO:0044255)|diacylglycerol metabolic process (GO:0046339)|glycerophospholipid biosynthetic process (GO:0046474)|lipid storage (GO:0019915)|long-chain fatty-acyl-CoA metabolic process (GO:0035336)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|triglyceride metabolic process (GO:0006641)|very-low-density lipoprotein particle assembly (GO:0034379)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	diacylglycerol O-acyltransferase activity (GO:0004144)|retinol O-fatty-acyltransferase activity (GO:0050252)|transferase activity, transferring acyl groups (GO:0016746)			breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(4)|prostate(1)	9	all_cancers(97;6.64e-12)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;3.94e-40)|Epithelial(56;7.67e-40)|all cancers(56;7.88e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0441)|Colorectal(110;0.055)			CAGAGCACTGACCTCGTGGAAG	0.639																																					.		Atlas-Indel,Pindel	.											.	DGAT1	26	.	0			c.1248+2->GG						.																																			SO:0001630	splice_region_variant	8694	exon16			.	AF059202	CCDS6420.1	8q24.3	2014-05-06	2010-06-24	2001-11-09	ENSG00000185000	ENSG00000185000	2.3.1.20		2843	protein-coding gene	gene with protein product		604900	"""diacylglycerol O-acyltransferase homolog 1 (mouse)"""			9756920	Standard	NM_012079		Approved	ARGP1, DGAT	uc003zbv.3	O75907	OTTHUMG00000174606	ENST00000332324.4:c.1248+1->GG	chr8.hg19:g.145540684_145540685dupCC		68.0	0.0		116.0	58.0	NM_012079	B2RWQ2|D3DWL6|Q96BB8	Splice_Site	INS	ENST00000332324.4	hg19	CCDS6420.1																																																																																			.	.		0.639	DGAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382059.3	NM_012079	Intron
LGSN	51557	hgsc.bcm.edu	37	6	63990332	63990334	+	In_Frame_Del	DEL	TCT	TCT	-			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	TCT	TCT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr6:63990332_63990334delTCT	ENST00000370657.4	-	4	1155_1157	c.1122_1124delAGA	c.(1120-1125)aaagac>aac	p.374_375KD>N	LGSN_ENST00000370658.5_3'UTR			Q5TDP6	LGSN_HUMAN	lengsin, lens protein with glutamine synthetase domain	374					glutamine biosynthetic process (GO:0006542)	plasma membrane (GO:0005886)	glutamate-ammonia ligase activity (GO:0004356)			NS(1)|endometrium(2)|large_intestine(5)|lung(16)|prostate(4)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	34						CTTCTTCAGGTCTTTCCTGTCCT	0.458																																					p.375_375del		Atlas-Indel,Pindel	.											.	LGSN	82	.	0			c.1123_1125del						.																																			SO:0001651	inframe_deletion	51557	exon4			.	AF242388	CCDS4964.1, CCDS55027.1	6q12	2013-09-19	2008-09-19	2008-09-19	ENSG00000146166	ENSG00000146166			21016	protein-coding gene	gene with protein product		611470	"""glutamate-ammonia ligase (glutamine synthetase) domain containing 1"""	GLULD1		12107412	Standard	NM_016571		Approved	LGS	uc003peh.3	Q5TDP6	OTTHUMG00000014946	ENST00000370657.4:c.1122_1124delAGA	chr6.hg19:g.63990332_63990334delTCT	ENSP00000359691:p.Lys374_Asp375delinsAsn	74.0	0.0		76.0	39.0	NM_016571	A1L421|Q0PVN9|Q0PVP0|Q9NYJ0	In_Frame_Del	DEL	ENST00000370657.4	hg19	CCDS4964.1																																																																																			.	.		0.458	LGSN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041076.2	NM_016571	
ACSM5	54988	hgsc.bcm.edu	37	16	20432662	20432663	+	Frame_Shift_Ins	INS	-	-	C			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr16:20432662_20432663insC	ENST00000331849.4	+	5	853_854	c.706_707insC	c.(706-708)gccfs	p.A236fs		NM_017888.2	NP_060358.2	Q6NUN0	ACSM5_HUMAN	acyl-CoA synthetase medium-chain family member 5	236					fatty acid metabolic process (GO:0006631)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|butyrate-CoA ligase activity (GO:0047760)|GTP binding (GO:0005525)|metal ion binding (GO:0046872)			breast(1)|endometrium(6)|kidney(2)|large_intestine(6)|lung(28)|ovary(3)|prostate(1)|skin(3)|urinary_tract(1)	51						AACCACCGGGGCCCCCAAGATG	0.545																																					p.A236fs		Atlas-Indel,Pindel	.											.	ACSM5	101	.	0			c.706_707insC						.																																			SO:0001589	frameshift_variant	54988	exon5			.		CCDS10585.1	16p12.3	2007-10-17			ENSG00000183549	ENSG00000183549		"""Acyl-CoA synthetase family"""	26060	protein-coding gene	gene with protein product		614361				17762044	Standard	NM_017888		Approved	FLJ20581	uc002dhe.3	Q6NUN0	OTTHUMG00000131551	ENST00000331849.4:c.711dupC	chr16.hg19:g.20432667_20432667dupC	ENSP00000327916:p.Ala236fs	86.0	0.0		67.0	30.0	NM_017888	Q96AV1|Q96CX8|Q9NWV3	Frame_Shift_Ins	INS	ENST00000331849.4	hg19	CCDS10585.1																																																																																			.	.		0.545	ACSM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254413.1	NM_017888	
NFAT5	10725	hgsc.bcm.edu	37	16	69703941	69703943	+	In_Frame_Del	DEL	AGA	AGA	-			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	AGA	AGA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr16:69703941_69703943delAGA	ENST00000354436.2	+	7	1695_1697	c.1377_1379delAGA	c.(1375-1380)ggagaa>gga	p.E462del	NFAT5_ENST00000567239.1_In_Frame_Del_p.E480del|NFAT5_ENST00000349945.1_In_Frame_Del_p.E386del|NFAT5_ENST00000393742.2_In_Frame_Del_p.E386del|NFAT5_ENST00000566899.1_In_Frame_Del_p.E386del|NFAT5_ENST00000432919.1_In_Frame_Del_p.E480del	NM_006599.3	NP_006590.1	O94916	NFAT5_HUMAN	nuclear factor of activated T-cells 5, tonicity-responsive	462					cytokine production (GO:0001816)|excretion (GO:0007588)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of calcineurin-NFAT signaling cascade (GO:0070884)|signal transduction (GO:0007165)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(11)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	37						CAGTGAAAGGAGAAGAAGAAGTG	0.374																																					p.477_478del		Atlas-Indel,Pindel	.											.	NFAT5	184	.	0			c.1430_1432del						.																																			SO:0001651	inframe_deletion	10725	exon8			.	AF134870	CCDS10881.1, CCDS10882.1, CCDS45519.1	16q22.1	2009-11-24			ENSG00000102908	ENSG00000102908		"""Nuclear factor of activated T-cells"""	7774	protein-coding gene	gene with protein product		604708				10377394	Standard	NM_173214		Approved	TONEBP, KIAA0827, NFATL1, OREBP, NFATZ, NF-AT5	uc002exl.2	O94916	OTTHUMG00000137572	ENST00000354436.2:c.1377_1379delAGA	chr16.hg19:g.69703947_69703949delAGA	ENSP00000346420:p.Glu462del	305.0	0.0		233.0	85.0	NM_001113178	A2RRB4|A6H8V5|E9PHR7|O95693|Q7LA65|Q969Q8|Q96QH3|Q9UN18	In_Frame_Del	DEL	ENST00000354436.2	hg19	CCDS10881.1																																																																																			.	.		0.374	NFAT5-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000268952.2	NM_138714	
PI4KB	5298	hgsc.bcm.edu	37	1	151262629	151262630	+	IGR	INS	-	-	G			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr1:151262629_151262630insG	ENST00000368873.1	-	0	3340				ZNF687_ENST00000368879.2_Frame_Shift_Ins_p.R1000fs			Q9UBF8	PI4KB_HUMAN	phosphatidylinositol 4-kinase, catalytic, beta						phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|receptor-mediated endocytosis (GO:0006898)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|Golgi membrane (GO:0000139)|mitochondrial outer membrane (GO:0005741)|plasma membrane (GO:0005886)	1-phosphatidylinositol 4-kinase activity (GO:0004430)|ATP binding (GO:0005524)			breast(3)|endometrium(5)|kidney(3)|large_intestine(2)|lung(7)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	27	Lung SC(34;0.00471)|Ovarian(49;0.0147)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.112)|LUSC - Lung squamous cell carcinoma(543;0.181)			CGCCTGTGTGAGCGCTCCTTCT	0.599																																					p.E999fs	Colon(154;765 1838 9854 28443 37492)	Atlas-Indel,Pindel	.											.	ZNF687	94	.	0			c.2996_2997insG						.																																			SO:0001628	intergenic_variant	57592	exon7			.	AB005910	CCDS993.1, CCDS55637.1, CCDS55638.1	1q21	2008-02-05	2007-08-14	2007-08-02	ENSG00000143393	ENSG00000143393			8984	protein-coding gene	gene with protein product		602758		PIK4CB		9020160, 9405938	Standard	NM_002651		Approved	PI4K-BETA, pi4K92	uc001exu.3	Q9UBF8	OTTHUMG00000012348		chr1.hg19:g.151262630_151262630dupG		114.0	0.0		164.0	30.0	NM_020832	B4DGI2|O15096|P78405|Q5VWB9|Q5VWC0|Q5VWC1|Q9BWR6	Frame_Shift_Ins	INS	ENST00000368873.1	hg19																																																																																				.	.		0.599	PI4KB-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000034400.3	NM_002651	
XPO6	23214	hgsc.bcm.edu	37	16	28137133	28137141	+	In_Frame_Del	DEL	CGGCAGTCG	CGGCAGTCG	-			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	CGGCAGTCG	CGGCAGTCG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr16:28137133_28137141delCGGCAGTCG	ENST00000304658.5	-	13	2135_2143	c.1635_1643delCGACTGCCG	c.(1633-1644)aacgactgccgg>aag	p.545_548NDCR>K	XPO6_ENST00000565698.1_In_Frame_Del_p.531_534NDCR>K	NM_015171.3	NP_055986.1	Q96QU8	XPO6_HUMAN	exportin 6	545					protein export from nucleus (GO:0006611)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein transporter activity (GO:0008565)			breast(2)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(4)|lung(6)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	25						GTGCAGCCGCCGGCAGTCGTTCTCCGCCG	0.565																																					p.546_548del		Atlas-Indel,Pindel	.											.	XPO6	177	.	0			c.1636_1644del						.																																			SO:0001651	inframe_deletion	23214	exon13			.	AY026388	CCDS42135.1, CCDS59266.1	16p11.2	2011-04-13	2003-03-11	2003-03-14		ENSG00000169180		"""Exportins"""	19733	protein-coding gene	gene with protein product		608411	"""RAN binding protein 20"""	RANBP20		14592989	Standard	NM_001270940		Approved	KIAA0370, FLJ22519	uc002dpa.2	Q96QU8		ENST00000304658.5:c.1635_1643delCGACTGCCG	chr16.hg19:g.28137133_28137141delCGGCAGTCG	ENSP00000302790:p.Asn545_Arg548delinsLys	70.0	0.0		50.0	17.0	NM_015171	A1L3W4|D3DWF9|Q2YDX3|Q53G88|Q68G50|Q76N88|Q96CP8|Q9BT21	In_Frame_Del	DEL	ENST00000304658.5	hg19	CCDS42135.1																																																																																			.	.		0.565	XPO6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433732.1	XM_055195	
CCDC83	220047	hgsc.bcm.edu	37	11	85622367	85622411	+	In_Frame_Del	DEL	TTCATGAACTGGAAGCAGAAAATTTGGTGCTTATTGATCAACTAT	TTCATGAACTGGAAGCAGAAAATTTGGTGCTTATTGATCAACTAT	-	rs143833799|rs141851299|rs537726488		TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	TTCATGAACTGGAAGCAGAAAATTTGGTGCTTATTGATCAACTAT	TTCATGAACTGGAAGCAGAAAATTTGGTGCTTATTGATCAACTAT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr11:85622367_85622411delTTCATGAACTGGAAGCAGAAAATTTGGTGCTTATTGATCAACTAT	ENST00000342404.3	+	8	932_976	c.716_760delTTCATGAACTGGAAGCAGAAAATTTGGTGCTTATTGATCAACTAT	c.(715-762)attcatgaactggaagcagaaaatttggtgcttattgatcaactatcc>acc	p.239_254IHELEAENLVLIDQLS>T	CCDC83_ENST00000280245.4_In_Frame_Del_p.239_254IHELEAENLVLIDQLS>T|CCDC83_ENST00000529676.2_3'UTR|CCDC83_ENST00000376067.1_In_Frame_Del_p.140_155IHELEAENLVLIDQLS>T			Q8IWF9	CCD83_HUMAN	coiled-coil domain containing 83	239										breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(12)|skin(3)|upper_aerodigestive_tract(2)	29		Acute lymphoblastic leukemia(157;4.88e-06)|all_hematologic(158;0.00572)				AAAAATGCTATTCATGAACTGGAAGCAGAAAATTTGGTGCTTATTGATCAACTATCCAACTGTAG	0.318																																					p.239_253del		Atlas-Indel,Pindel	.											.	CCDC83	48	.	0			c.715_759del						.																																			SO:0001651	inframe_deletion	220047	exon8			.	AK124113	CCDS8271.1, CCDS66196.1	11q14.1-q14.2	2014-01-21			ENSG00000150676	ENSG00000150676			28535	protein-coding gene	gene with protein product						12477932	Standard	XM_005273842		Approved	MGC34732, FLJ42119, CT148	uc001pbg.1	Q8IWF9	OTTHUMG00000166978	ENST00000342404.3:c.716_760delTTCATGAACTGGAAGCAGAAAATTTGGTGCTTATTGATCAACTAT	chr11.hg19:g.85622367_85622411delTTCATGAACTGGAAGCAGAAAATTTGGTGCTTATTGATCAACTAT	ENSP00000344512:p.Ile239_Ser254delinsThr	228.0	0.0		139.0	15.0	NM_173556	B2RA49|Q6X7T2|Q6ZVT5|Q8N9Y1	In_Frame_Del	DEL	ENST00000342404.3	hg19																																																																																				.	.		0.318	CCDC83-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000392215.1	NM_173556	
SLC41A3	54946	hgsc.bcm.edu	37	3	125775394	125775416	+	Intron	DEL	ATGGCCAGGCAATGCACCACGAT	ATGGCCAGGCAATGCACCACGAT	-	rs371771556|rs201025311|rs200888748|rs185228572	byFrequency	TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	ATGGCCAGGCAATGCACCACGAT	ATGGCCAGGCAATGCACCACGAT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr3:125775394_125775416delATGGCCAGGCAATGCACCACGAT	ENST00000315891.6	-	3	512				SLC41A3_ENST00000346785.5_Intron|SLC41A3_ENST00000383598.2_Start_Codon_Del|SLC41A3_ENST00000360370.4_Intron|SLC41A3_ENST00000508835.1_Intron|SLC41A3_ENST00000514023.1_Intron|RP11-158I23.1_ENST00000508263.1_RNA	NM_001008485.1|NM_017836.3	NP_001008485|NP_060306.3	Q96GZ6	S41A3_HUMAN	solute carrier family 41, member 3							integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	cation transmembrane transporter activity (GO:0008324)			breast(1)|endometrium(4)|large_intestine(6)|lung(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	18				GBM - Glioblastoma multiforme(114;0.167)		GGTGACCACCATGGCCAGGCAATGCACCACGATCCCAGGAGCA	0.587																																					.		Atlas-Indel,Pindel	.											.	SLC41A3	80	.	0			.						.																																			SO:0001627	intron_variant	54946	wholegene			.		CCDS33842.1, CCDS33843.1, CCDS33844.1, CCDS43144.1, CCDS54635.1	3q21.2	2013-09-02			ENSG00000114544	ENSG00000114544		"""Solute carriers"""	31046	protein-coding gene	gene with protein product		610803					Standard	NM_001164475		Approved	FLJ20473	uc003eij.3	Q96GZ6	OTTHUMG00000162678	ENST00000315891.6:c.274-5501ATCGTGGTGCATTGCCTGGCCAT>-	chr3.hg19:g.125775394_125775416delATGGCCAGGCAATGCACCACGAT		139.0	0.0		75.0	14.0	NM_001008487	A6ND60|B3KSD9|B7Z4Y2|C9JE96|E7ENY4|Q8N342|Q8NB27|Q9H9I6|Q9HAB1|Q9NX30	Frame_Shift_Del	DEL	ENST00000315891.6	hg19	CCDS33843.1																																																																																			.	.		0.587	SLC41A3-024	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000370886.1	NM_017836	
KCNN3	3782	hgsc.bcm.edu	37	1	154842221	154842222	+	In_Frame_Ins	INS	-	-	CTGCTGCTGCTGCTGCTA			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr1:154842221_154842222insCTGCTGCTGCTGCTGCTA	ENST00000271915.4	-	1	534_535	c.219_220insTAGCAGCAGCAGCAGCAG	c.(217-222)cagcag>cagTAGCAGCAGCAGCAGCAGcag	p.72_73insQ*QQQQ	KCNN3_ENST00000358505.2_5'Flank	NM_001204087.1|NM_002249.5	NP_001191016.1|NP_002240.3	Q9UGI6	KCNN3_HUMAN	potassium intermediate/small conductance calcium-activated channel, subfamily N, member 3	72	Gln-rich.				potassium ion transmembrane transport (GO:0071805)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	calmodulin binding (GO:0005516)|small conductance calcium-activated potassium channel activity (GO:0016286)			cervix(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(11)|prostate(4)|skin(1)	28	all_lung(78;2.29e-27)|all_hematologic(923;0.088)|Hepatocellular(266;0.108)|all_neural(408;0.245)		BRCA - Breast invasive adenocarcinoma(34;0.00819)		Miconazole(DB01110)|Procaine(DB00721)	tgctgctgctgctgctgctgct	0.708																																					p.Q74delinsX		Atlas-Indel,Pindel	.											.	KCNN3	141	.	0			c.220_221insTAGCAGCAGCAGCAGCAG						.																																			SO:0001652	inframe_insertion	3782	exon1			.	AF031815	CCDS1072.1, CCDS30880.1, CCDS72928.1	1q21.3	2012-07-05			ENSG00000143603	ENSG00000143603		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	6292	protein-coding gene	gene with protein product		602983				9491810, 16382103	Standard	NM_002249		Approved	KCa2.3, hSK3, SKCA3	uc021pah.1	Q9UGI6	OTTHUMG00000037260	ENST00000271915.4:c.219_220insTAGCAGCAGCAGCAGCAG	chr1.hg19:g.154842221_154842222insCTGCTGCTGCTGCTGCTA	ENSP00000271915:p.Gln72_Gln73insGln*GlnGlnGlnGln	73.0	0.0		136.0	41.0	NM_001204087	B1ANX0|O43517|Q86VF9|Q8WXG7	In_Frame_Ins	INS	ENST00000271915.4	hg19	CCDS30880.1																																																																																			.	.		0.708	KCNN3-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090688.3	NM_002249	
SHOC2	8036	hgsc.bcm.edu	37	10	112724768	112724768	+	Frame_Shift_Del	DEL	A	A	-			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr10:112724768delA	ENST00000369452.4	+	2	997	c.652delA	c.(652-654)agcfs	p.S218fs	SHOC2_ENST00000489390.1_Intron|SHOC2_ENST00000265277.5_Frame_Shift_Del_p.S218fs	NM_007373.3	NP_031399.2	Q9UQ13	SHOC2_HUMAN	soc-2 suppressor of clear homolog (C. elegans)	218					fibroblast growth factor receptor signaling pathway (GO:0008543)|positive regulation of Ras protein signal transduction (GO:0046579)|Ras protein signal transduction (GO:0007265)|regulation of catalytic activity (GO:0050790)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|protein phosphatase type 1 complex (GO:0000164)	protein phosphatase binding (GO:0019903)|protein phosphatase regulator activity (GO:0019888)			breast(1)|endometrium(1)|kidney(2)|large_intestine(6)|lung(4)|ovary(1)|skin(2)	17				Epithelial(162;0.000796)|all cancers(201;0.011)|BRCA - Breast invasive adenocarcinoma(275;0.126)		GTCAAAACTCAGCATGCTTAG	0.358																																					p.L217fs		Atlas-Indel,Pindel	.											.	SHOC2	49	.	0			c.651delC						.						68.0	69.0	69.0					10																	112724768		2203	4299	6502	SO:0001589	frameshift_variant	8036	exon2			.	AB020669	CCDS7568.1, CCDS58095.1	10q25	2014-09-17	2001-11-28		ENSG00000108061	ENSG00000108061			15454	protein-coding gene	gene with protein product		602775	"""soc-2 (suppressor of clear, C.elegans) homolog"""			9618511, 9674433, 10783161	Standard	NM_007373		Approved	KIAA0862, SOC2, SUR-8, SOC-2, SUR8	uc001kzl.4	Q9UQ13	OTTHUMG00000019047	ENST00000369452.4:c.652delA	chr10.hg19:g.112724768delA	ENSP00000358464:p.Ser218fs	99.0	0.0		132.0	42.0	NM_007373	A8K9W8|B3KR23|O76063|Q5VZS8|Q5VZS9	Frame_Shift_Del	DEL	ENST00000369452.4	hg19	CCDS7568.1																																																																																			.	.		0.358	SHOC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050355.1	NM_007373	
KRTAP5-6	440023	hgsc.bcm.edu	37	11	1718512	1718532	+	In_Frame_Del	DEL	GGCTGTGGGGGCTGTGGCTCT	GGCTGTGGGGGCTGTGGCTCT	-	rs545751292		TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	GGCTGTGGGGGCTGTGGCTCT	GGCTGTGGGGGCTGTGGCTCT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr11:1718512_1718532delGGCTGTGGGGGCTGTGGCTCT	ENST00000382160.1	+	1	88_108	c.37_57delGGCTGTGGGGGCTGTGGCTCT	c.(37-57)ggctgtgggggctgtggctctdel	p.GCGGCGS20del		NM_001012416.1	NP_001012416.1	Q6L8G9	KRA56_HUMAN	keratin associated protein 5-6	20						keratin filament (GO:0045095)		p.G16C(1)|p.G15G(1)		endometrium(1)|large_intestine(2)|lung(6)|skin(1)	10		all_epithelial(84;0.00018)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00136)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		CTGTGGCTCCGGCTGTGGGGGCTGTGGCTCTGGCTGTGGGG	0.643																																					p.12_19del		Atlas-Indel,Pindel	.											.	KRTAP5-6	18	.	2	Substitution - Missense(1)|Substitution - coding silent(1)	lung(2)	c.36_56del						.			394,3824		8,378,1723						3.1	1.0			76	270,7968		4,262,3853	no	coding	KRTAP5-6	NM_001012416.1		12,640,5576	A1A1,A1R,RR		3.2775,9.3409,5.3308				664,11792				SO:0001651	inframe_deletion	440023	exon1			.	AB126075	CCDS31332.1	11p15.5	2008-02-05			ENSG00000205864	ENSG00000205864		"""Keratin associated proteins"""	23600	protein-coding gene	gene with protein product						15144888	Standard	NM_001012416		Approved	KRTAP5.6	uc001lua.3	Q6L8G9	OTTHUMG00000043932	ENST00000382160.1:c.37_57delGGCTGTGGGGGCTGTGGCTCT	chr11.hg19:g.1718512_1718532delGGCTGTGGGGGCTGTGGCTCT	ENSP00000371595:p.Gly20_Ser26del	154.0	0.0		140.0	44.0	NM_001012416	A1L452	In_Frame_Del	DEL	ENST00000382160.1	hg19	CCDS31332.1																																																																																			.	.		0.643	KRTAP5-6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000102339.2		
ASXL1	171023	hgsc.bcm.edu	37	20	31023559	31023580	+	Frame_Shift_Del	DEL	AGGCTGACACTAGAGAAGCTGC	AGGCTGACACTAGAGAAGCTGC	-	rs527562446|rs560170731|rs545071926		TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	AGGCTGACACTAGAGAAGCTGC	AGGCTGACACTAGAGAAGCTGC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr20:31023559_31023580delAGGCTGACACTAGAGAAGCTGC	ENST00000375687.4	+	13	3468_3489	c.3044_3065delAGGCTGACACTAGAGAAGCTGC	c.(3043-3066)gaggctgacactagagaagctgcafs	p.EADTREAA1015fs	ASXL1_ENST00000306058.5_Frame_Shift_Del_p.EADTREAA1010fs	NM_015338.5	NP_056153	Q8IXJ9	ASXL1_HUMAN	additional sex combs like transcriptional regulator 1	1015					bone development (GO:0060348)|monoubiquitinated histone H2A deubiquitination (GO:0035522)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of peroxisome proliferator activated receptor signaling pathway (GO:0035359)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of retinoic acid receptor signaling pathway (GO:0048386)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to retinoic acid (GO:0032526)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nuclear chromatin (GO:0000790)|PR-DUB complex (GO:0035517)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|peroxisome proliferator activated receptor binding (GO:0042975)|retinoic acid receptor binding (GO:0042974)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)	p.D1017A(1)		NS(1)|breast(2)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(655)|kidney(5)|large_intestine(18)|liver(1)|lung(27)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	722						GACAGCAGTGAGGCTGACACTAGAGAAGCTGCAGTGACAAAG	0.518			"""F, N, Mis"""		"""MDS, CMML"""																																p.1015_1022del		Atlas-Indel,Pindel	.		Rec	yes		20	20q11.1	171023	additional sex combs like 1		L	.	ASXL1	1114	.	1	Substitution - Missense(1)	haematopoietic_and_lymphoid_tissue(1)	c.3043_3064del						.																																			SO:0001589	frameshift_variant	171023	exon12			.	AJ438952	CCDS13201.1	20q11	2014-09-17	2014-06-17		ENSG00000171456	ENSG00000171456			18318	protein-coding gene	gene with protein product		612990	"""additional sex combs like 1 (Drosophila)"""			12657473	Standard	NM_015338		Approved	KIAA0978	uc002wxs.3	Q8IXJ9	OTTHUMG00000032218	ENST00000375687.4:c.3044_3065delAGGCTGACACTAGAGAAGCTGC	chr20.hg19:g.31023559_31023580delAGGCTGACACTAGAGAAGCTGC	ENSP00000364839:p.Glu1015fs	75.0	0.0		59.0	24.0	NM_015338	B2RP59|Q5JWS9|Q8IYY7|Q9H466|Q9NQF8|Q9UFJ0|Q9UFP8|Q9Y2I4	Frame_Shift_Del	DEL	ENST00000375687.4	hg19	CCDS13201.1																																																																																			.	.		0.518	ASXL1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000078624.2	NM_015338	
NSUN4	387338	hgsc.bcm.edu	37	1	46810731	46810732	+	Frame_Shift_Ins	INS	-	-	T			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr1:46810731_46810732insT	ENST00000474844.1	+	2	1002_1003	c.352_353insT	c.(352-354)ccafs	p.P118fs	NSUN4_ENST00000536062.1_Frame_Shift_Ins_p.P69fs|NSUN4_ENST00000498008.1_3'UTR|NSUN4_ENST00000537428.1_Frame_Shift_Ins_p.P69fs	NM_199044.3	NP_950245.2	Q96CB9	NSUN4_HUMAN	NOP2/Sun domain family, member 4	118					rRNA methylation (GO:0031167)	mitochondrial large ribosomal subunit (GO:0005762)	methyltransferase activity (GO:0008168)|rRNA binding (GO:0019843)			endometrium(2)|kidney(1)|large_intestine(2)|lung(2)|prostate(1)	8	Acute lymphoblastic leukemia(166;0.155)					ATCTGCAGCCCCATCCCCTGCC	0.559																																					p.P118fs		Atlas-Indel,Pindel	.											.	NSUN4	26	.	0			c.352_353insT						.																																			SO:0001589	frameshift_variant	387338	exon2			.	AK021577	CCDS534.1, CCDS57996.1	1p34	2012-02-24	2009-11-23		ENSG00000117481	ENSG00000117481		"""NOP2/Sun domain containing"""	31802	protein-coding gene	gene with protein product	"""sperm head and tail associated protein"""	615394	"""NOL1/NOP2/Sun domain family 4"", ""NOL1/NOP2/Sun domain family, member 4"""				Standard	NM_199044		Approved	MGC22960, SHTAP	uc001cpr.2	Q96CB9	OTTHUMG00000007808	Exception_encountered	chr1.hg19:g.46810731_46810732insT	ENSP00000419740:p.Pro118fs	74.0	0.0		83.0	36.0	NM_199044	A8K6S6|B3KQ50|B4DHA4|Q5TDF7|Q96AN8|Q9HAJ8	Frame_Shift_Ins	INS	ENST00000474844.1	hg19	CCDS534.1																																																																																			.	.		0.559	NSUN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021427.1	NM_199044	
HECW1	23072	hgsc.bcm.edu	37	7	43484497	43484497	+	Frame_Shift_Del	DEL	G	G	-			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr7:43484497delG	ENST00000395891.2	+	11	2331	c.1726delG	c.(1726-1728)ggcfs	p.G576fs	HECW1_ENST00000453890.1_Frame_Shift_Del_p.G576fs	NM_015052.3	NP_055867.3	Q76N89	HECW1_HUMAN	HECT, C2 and WW domain containing E3 ubiquitin protein ligase 1	576					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			NS(2)|breast(10)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(17)|lung(57)|ovary(8)|pancreas(2)|prostate(2)|skin(6)|urinary_tract(3)	125						CGCCCAGGGCGGCAGCGCGGC	0.697																																					p.G575fs		Pindel	.											.	HECW1	540	.	0			c.1725delC						.						29.0	35.0	33.0					7																	43484497		2136	4239	6375	SO:0001589	frameshift_variant	23072	exon11			.	AB048365	CCDS5469.2, CCDS69286.1	7p13	2004-12-13			ENSG00000002746	ENSG00000002746			22195	protein-coding gene	gene with protein product		610384				12690205, 14684739	Standard	XM_005249665		Approved	KIAA0322, NEDL1	uc003tid.1	Q76N89	OTTHUMG00000128917	ENST00000395891.2:c.1726delG	chr7.hg19:g.43484497delG	ENSP00000379228:p.Gly576fs	50.0	0.0		53.0	14.0	NM_015052	A7E2X0|A8MYS3|B4DH42|O15036|Q9HCC7	Frame_Shift_Del	DEL	ENST00000395891.2	hg19	CCDS5469.2																																																																																			.	.		0.697	HECW1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250893.2	NM_015052	
LRRC7	57554	hgsc.bcm.edu	37	1	70504419	70504419	+	Frame_Shift_Del	DEL	C	C	-			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr1:70504419delC	ENST00000035383.5	+	19	2828	c.2798delC	c.(2797-2799)tccfs	p.S933fs	LRRC7_ENST00000415775.2_Frame_Shift_Del_p.S217fs|LRRC7_ENST00000310961.5_Frame_Shift_Del_p.S938fs	NM_020794.2	NP_065845.1	Q96NW7	LRRC7_HUMAN	leucine rich repeat containing 7	933						cell junction (GO:0030054)|cytoplasm (GO:0005737)|postsynaptic membrane (GO:0045211)				breast(11)|central_nervous_system(3)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(25)|liver(3)|lung(81)|ovary(9)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	162						GAGAGGCTTTCCCCCCTAATG	0.368																																					p.S933fs		Pindel	.											.	LRRC7	400	.	0			c.2797delT						.						56.0	57.0	57.0					1																	70504419		2203	4300	6503	SO:0001589	frameshift_variant	57554	exon19			.		CCDS645.1	1p31.1	2008-02-05			ENSG00000033122	ENSG00000033122			18531	protein-coding gene	gene with protein product		614453				12525888	Standard	NM_020794		Approved	KIAA1365, densin-180	uc001dep.3	Q96NW7	OTTHUMG00000059194	ENST00000035383.5:c.2798delC	chr1.hg19:g.70504419delC	ENSP00000035383:p.Ser933fs	303.0	0.0		258.0	66.0	NM_020794	Q5VXC2|Q5VXC3|Q68D07|Q86VE8|Q8WX20|Q9P2I2	Frame_Shift_Del	DEL	ENST00000035383.5	hg19	CCDS645.1																																																																																			.	.		0.368	LRRC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131261.1	NM_020794	
TRPM2	7226	hgsc.bcm.edu	37	21	45811258	45811258	+	Frame_Shift_Del	DEL	C	C	-			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr21:45811258delC	ENST00000397928.1	+	11	1989	c.1544delC	c.(1543-1545)accfs	p.T515fs	TRPM2_ENST00000300481.9_Frame_Shift_Del_p.T515fs|TRPM2_ENST00000300482.5_Frame_Shift_Del_p.T515fs|TRPM2_ENST00000397932.2_Frame_Shift_Del_p.T515fs|TRPM2_ENST00000498430.1_3'UTR	NM_003307.3	NP_003298	O94759	TRPM2_HUMAN	transient receptor potential cation channel, subfamily M, member 2	515					calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|ion transmembrane transport (GO:0034220)|response to hydroperoxide (GO:0033194)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ADP-ribose diphosphatase activity (GO:0047631)|calcium channel activity (GO:0005262)|manganese ion transmembrane transporter activity (GO:0005384)|sodium channel activity (GO:0005272)			breast(3)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(15)|lung(29)|ovary(3)|pancreas(1)|prostate(5)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(1)	76						GAGTTTGTCACCTGGGACACC	0.582																																					p.T515fs		Pindel	.											.	TRPM2	196	.	0			c.1543delA						.						155.0	113.0	127.0					21																	45811258		2203	4300	6503	SO:0001589	frameshift_variant	7226	exon11			.	AB001535	CCDS13710.1	21q22.3	2011-12-14		2002-01-18	ENSG00000142185	ENSG00000142185		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Nudix motif containing"""	12339	protein-coding gene	gene with protein product		603749		TRPC7		9806837, 11385575, 16382100	Standard	NR_038257		Approved	KNP3, LTRPC2, NUDT9L1, NUDT9H, EREG1	uc002zew.1	O94759	OTTHUMG00000040840	ENST00000397928.1:c.1544delC	chr21.hg19:g.45811258delC	ENSP00000381023:p.Thr515fs	140.0	0.0		98.0	29.0	NM_003307	D3DSL6|Q5KTC2|Q6J3P5|Q96KN6|Q96Q93	Frame_Shift_Del	DEL	ENST00000397928.1	hg19	CCDS13710.1																																																																																			.	.		0.582	TRPM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098086.1	NM_003307	
MEN1	4221	hgsc.bcm.edu	37	11	64573793	64573793	+	Frame_Shift_Del	DEL	G	G	-			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr11:64573793delG	ENST00000337652.1	-	7	1478	c.975delC	c.(973-975)cccfs	p.P325fs	MEN1_ENST00000315422.4_Frame_Shift_Del_p.P320fs|MEN1_ENST00000377313.1_Frame_Shift_Del_p.P325fs|MEN1_ENST00000394376.1_Frame_Shift_Del_p.P325fs|MEN1_ENST00000478548.1_5'UTR|MEN1_ENST00000377321.1_Frame_Shift_Del_p.P285fs|MEN1_ENST00000377316.2_Frame_Shift_Del_p.P320fs|MEN1_ENST00000394374.2_Frame_Shift_Del_p.P325fs|MEN1_ENST00000312049.6_Frame_Shift_Del_p.P320fs|MEN1_ENST00000377326.3_Frame_Shift_Del_p.P320fs|MEN1_ENST00000443283.1_Frame_Shift_Del_p.P325fs	NM_130803.2	NP_570715	O00255	MEN1_HUMAN	multiple endocrine neoplasia I	325	Interaction with FANCD2.		P -> L (in MEN1). {ECO:0000269|PubMed:9506756}.|P -> R (in MEN1). {ECO:0000269|PubMed:15714081}.		brain development (GO:0007420)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|chromatin remodeling (GO:0006338)|DNA repair (GO:0006281)|embryonic skeletal system morphogenesis (GO:0048704)|gene expression (GO:0010467)|hemopoiesis (GO:0030097)|histone lysine methylation (GO:0034968)|leukocyte homeostasis (GO:0001776)|MAPK cascade (GO:0000165)|maternal process involved in female pregnancy (GO:0060135)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of JNK cascade (GO:0046329)|negative regulation of organ growth (GO:0046621)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of telomerase activity (GO:0051974)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|osteoblast development (GO:0002076)|osteoblast fate commitment (GO:0002051)|palate development (GO:0060021)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell division (GO:0051781)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of histone methylation (GO:0031062)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of protein binding (GO:0032092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|regulation of activin receptor signaling pathway (GO:0032925)|response to gamma radiation (GO:0010332)|response to UV (GO:0009411)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	chromatin (GO:0000785)|cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|histone methyltransferase complex (GO:0035097)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|four-way junction DNA binding (GO:0000400)|protein binding, bridging (GO:0030674)|protein N-terminus binding (GO:0047485)|R-SMAD binding (GO:0070412)|sequence-specific DNA binding (GO:0043565)|transcription regulatory region DNA binding (GO:0044212)|Y-form DNA binding (GO:0000403)	p.Y321fs*47(1)		NS(7)|adrenal_gland(5)|breast(2)|central_nervous_system(5)|endometrium(1)|gastrointestinal_tract_(site_indeterminate)(15)|large_intestine(2)|lung(21)|ovary(1)|pancreas(64)|parathyroid(181)|pituitary(7)|prostate(4)|retroperitoneum(1)|skin(1)|small_intestine(13)|soft_tissue(4)|stomach(1)|thymus(2)	337						GGTACATGTAGGGGTAGATGT	0.622			"""D, Mis, N, F, S"""		"""parathyroid tumors, Pancreatic neuroendocrine tumors"""	"""parathyroid adenoma, pituitary adenoma, pancreatic islet cell, carcinoid"""			Multiple Endocrine Neoplasia, type 1;Hyperparathyroidism, Familial Isolated		OREG0004014	type=REGULATORY REGION|Gene=MEN1|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																									p.Y326fs	Esophageal Squamous(1;83 158 15500 18603 18803 29295)	Pindel	.	yes	Rec	yes	Multiple Endocrine Neoplasia Type 1	11	11q13	4221	multiple endocrine neoplasia type 1 gene		E	.	MEN1	442	.	1	Deletion - Frameshift(1)	pancreas(1)	c.976delT						.						264.0	230.0	241.0					11																	64573793		2201	4297	6498	SO:0001589	frameshift_variant	4221	exon7	Familial Cancer Database	MEN1, Wermer disease;FIHP, FIHPT, HRPT1, Familial Isolated Primary Hyperparathyroidism	.	U93236	CCDS8083.1, CCDS31600.1	11q13	2014-09-17			ENSG00000133895	ENSG00000133895			7010	protein-coding gene	gene with protein product	"""menin"""	613733					Standard	NM_130799		Approved		uc001obn.3	O00255	OTTHUMG00000045366	ENST00000337652.1:c.975delC	chr11.hg19:g.64573793delG	ENSP00000337088:p.Pro325fs	201.0	0.0	1077	94.0	45.0	NM_130800	A5HBC6|A5HBC7|A5HBC8|A5HBC9|A5HBD0|A5HBD1|A5HBD2|O00632|Q9BUF0|Q9BUK2	Frame_Shift_Del	DEL	ENST00000337652.1	hg19	CCDS8083.1																																																																																			.	.		0.622	MEN1-201	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000143881.1		
OR2F2	135948	hgsc.bcm.edu	37	7	143633258	143633258	+	Frame_Shift_Del	DEL	A	A	-			TCGA-CC-A7IH-01A-11D-A33K-10	TCGA-CC-A7IH-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6d3ad3bc-b5be-4233-a04b-909afa0302cf	aa24c0b3-7197-431d-b840-98fb061c54f6	g.chr7:143633258delA	ENST00000408955.2	+	1	1000	c.933delA	c.(931-933)ttafs	p.L311fs		NM_001004685.1	NP_001004685.1	O95006	OR2F2_HUMAN	olfactory receptor, family 2, subfamily F, member 2	311						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(19)|ovary(3)|skin(2)|stomach(1)|urinary_tract(1)	32	Melanoma(164;0.0903)					TCTCTGGGTTAACATCCAAGC	0.413																																					p.L311X		Pindel	.											.	OR2F2	63	.	0			c.932delT						.						39.0	38.0	39.0					7																	143633258		1981	4209	6190	SO:0001589	frameshift_variant	135948	exon1			.		CCDS43666.1	7q33-q35	2012-08-09			ENSG00000221910	ENSG00000221910		"""GPCR / Class A : Olfactory receptors"""	8247	protein-coding gene	gene with protein product							Standard	NM_001004685		Approved	OR7-1	uc011ktv.2	O95006	OTTHUMG00000157768	ENST00000408955.2:c.933delA	chr7.hg19:g.143633258delA	ENSP00000386222:p.Leu311fs	50.0	0.0		59.0	19.0	NM_001004685	A4D2G0|Q6IFP8	Frame_Shift_Del	DEL	ENST00000408955.2	hg19	CCDS43666.1																																																																																			.	.		0.413	OR2F2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349570.1		
