#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
PRAMEF17	391004	hgsc.bcm.edu	37	1	13716967	13716967	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr1:13716967G>T	ENST00000376098.4	+	2	480	c.454G>T	c.(454-456)Gac>Tac	p.D152Y		NM_001099851.1	NP_001093321.1	Q5VTA0	PRA17_HUMAN	PRAME family member 17	152					negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)					kidney(1)|lung(2)	3	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.00224)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;9.86e-06)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|COAD - Colon adenocarcinoma(227;0.000502)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		GGTGTTCATAGACCTCTGCCA	0.537																																					p.D152Y		Atlas-SNP	.											PRAMEF17,right_upper_lobe,carcinoma,0,1	PRAMEF17	12	.	0			c.G454T						.						39.0	47.0	44.0					1																	13716967		2122	4224	6346	SO:0001583	missense	391004	exon2			TTCATAGACCTCT		CCDS41264.1	1p36.21	2013-01-17			ENSG00000204479	ENSG00000204479		"""-"""	29485	protein-coding gene	gene with protein product							Standard	NM_001099851		Approved	OTTHUMG00000007909	uc009vnz.1	Q5VTA0	OTTHUMG00000007909	ENST00000376098.4:c.454G>T	chr1.hg19:g.13716967G>T	ENSP00000365266:p.Asp152Tyr	209.0	0.0		212.0	96.0	NM_001099851	B2RUU4	Missense_Mutation	SNP	ENST00000376098.4	hg19	CCDS41264.1	.	.	.	.	.	.	.	.	.	.	G	8.520	0.868451	0.17322	.	.	ENSG00000204479	ENST00000376098	T	0.44881	0.91	1.09	0.124	0.14714	.	0.377307	0.21405	N	0.075061	T	0.61899	0.2384	M	0.92026	3.265	0.09310	N	1	D	0.69078	0.997	D	0.68192	0.956	T	0.52442	-0.8575	10	0.87932	D	0	.	3.641	0.08166	0.2714:0.0:0.7286:0.0	.	152	Q5VTA0	PRA17_HUMAN	Y	152	ENSP00000365266:D152Y	ENSP00000365266:D152Y	D	+	1	0	PRAMEF17	13589554	0.004000	0.15560	0.004000	0.12327	0.006000	0.05464	0.457000	0.21875	0.047000	0.15862	-0.391000	0.06502	GAC	.	.		0.537	PRAMEF17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021780.2	NM_001099851	
HSPG2	3339	hgsc.bcm.edu	37	1	22172730	22172730	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr1:22172730G>A	ENST00000374695.3	-	64	8414	c.8335C>T	c.(8335-8337)Cgg>Tgg	p.R2779W	HSPG2_ENST00000430507.1_3'UTR	NM_005529.5	NP_005520.4	P98160	PGBM_HUMAN	heparan sulfate proteoglycan 2	2779	Ig-like C2-type 13.				angiogenesis (GO:0001525)|brain development (GO:0007420)|carbohydrate metabolic process (GO:0005975)|cardiac muscle tissue development (GO:0048738)|cartilage development involved in endochondral bone morphogenesis (GO:0060351)|chondrocyte differentiation (GO:0002062)|chondroitin sulfate metabolic process (GO:0030204)|embryonic skeletal system morphogenesis (GO:0048704)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|lipoprotein metabolic process (GO:0042157)|phototransduction, visible light (GO:0007603)|protein localization (GO:0008104)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	basal lamina (GO:0005605)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)			breast(6)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(15)|liver(1)|lung(44)|ovary(10)|pancreas(1)|prostate(10)|skin(9)|upper_aerodigestive_tract(3)|urinary_tract(3)	127		Colorectal(325;3.46e-05)|all_lung(284;7.93e-05)|Lung NSC(340;8.71e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0498)|OV - Ovarian serous cystadenocarcinoma(117;1.14e-26)|Colorectal(126;4.18e-07)|COAD - Colon adenocarcinoma(152;1.82e-05)|GBM - Glioblastoma multiforme(114;3.13e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000756)|STAD - Stomach adenocarcinoma(196;0.00656)|KIRC - Kidney renal clear cell carcinoma(1967;0.00942)|READ - Rectum adenocarcinoma(331;0.0721)|Lung(427;0.223)	Palifermin(DB00039)	TGGTGCAGCCGCAGCCGTGAG	0.642																																					p.R2779W		Atlas-SNP	.											.	HSPG2	311	.	0			c.C8335T						.						14.0	17.0	16.0					1																	22172730		2182	4258	6440	SO:0001583	missense	3339	exon64			GCAGCCGCAGCCG	M85289	CCDS30625.1	1p36.1-p35	2013-01-29	2007-02-16	2007-02-16	ENSG00000142798	ENSG00000142798		"""Proteoglycans / Extracellular Matrix : Other"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5273	protein-coding gene	gene with protein product	"""perlecan proteoglycan"""	142461	"""Schwartz-Jampel syndrome 1 (chondrodystrophic myotonia)"""	SJS1		1685141, 11941538	Standard	XM_005245863		Approved	perlecan, PRCAN	uc001bfj.3	P98160	OTTHUMG00000002674	ENST00000374695.3:c.8335C>T	chr1.hg19:g.22172730G>A	ENSP00000363827:p.Arg2779Trp	76.0	0.0		104.0	5.0	NM_005529	Q16287|Q5SZI3|Q9H3V5	Missense_Mutation	SNP	ENST00000374695.3	hg19	CCDS30625.1	.	.	.	.	.	.	.	.	.	.	G	13.19	2.162458	0.38217	.	.	ENSG00000142798	ENST00000374695;ENST00000453796	T;T	0.69306	-0.39;-0.39	5.22	0.337	0.15966	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.259363	0.20276	N	0.095560	T	0.82010	0.4944	M	0.86502	2.82	0.37636	D	0.921858	D;D	0.89917	1.0;1.0	D;D	0.80764	0.994;0.989	D	0.85944	0.1460	10	0.72032	D	0.01	.	14.1814	0.65577	0.0:0.0:0.5057:0.4943	.	719;2779	Q59EG0;P98160	.;PGBM_HUMAN	W	2779;194	ENSP00000363827:R2779W;ENSP00000396310:R194W	ENSP00000363827:R2779W	R	-	1	2	HSPG2	22045317	0.998000	0.40836	0.267000	0.24556	0.085000	0.17905	1.384000	0.34396	0.165000	0.19558	0.561000	0.74099	CGG	.	.		0.642	HSPG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007598.1	NM_005529	
CELA3B	23436	hgsc.bcm.edu	37	1	22304871	22304871	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr1:22304871A>G	ENST00000337107.6	+	2	72	c.53A>G	c.(52-54)tAt>tGt	p.Y18C	RN7SL421P_ENST00000582599.1_RNA	NM_007352.2	NP_031378.1	P08861	CEL3B_HUMAN	chymotrypsin-like elastase family, member 3B	18					cholesterol metabolic process (GO:0008203)|proteolysis (GO:0006508)		peptidase activity (GO:0008233)|serine-type endopeptidase activity (GO:0004252)			breast(2)|kidney(2)|large_intestine(1)|lung(1)|ovary(1)|urinary_tract(1)	8						GCCTCAGGCTATGGCCCACCT	0.617																																					p.Y18C		Atlas-SNP	.											.	CELA3B	24	.	0			c.A53G						.						147.0	95.0	113.0					1																	22304871		2203	4300	6503	SO:0001583	missense	23436	exon2			CAGGCTATGGCCC	M18692	CCDS219.1	1p36.12	2009-05-05	2009-05-05	2009-05-05	ENSG00000219073	ENSG00000219073	3.4.21.70		15945	protein-coding gene	gene with protein product	"""proteinase E"", ""elastase 1"", ""cholesterol-binding pancreatic protease"", ""pancreatic endopeptidase E"""		"""elastase 3B, pancreatic"""	ELA3B		2826474, 2460440	Standard	NM_007352		Approved	CBPP	uc001bfk.3	P08861	OTTHUMG00000002758	ENST00000337107.6:c.53A>G	chr1.hg19:g.22304871A>G	ENSP00000338369:p.Tyr18Cys	102.0	0.0		108.0	42.0	NM_007352	B2RE44|P11423|Q5VU28|Q5VU29|Q5VU30	Missense_Mutation	SNP	ENST00000337107.6	hg19	CCDS219.1	.	.	.	.	.	.	.	.	.	.	A	0.005	-2.219679	0.00286	.	.	ENSG00000219073	ENST00000337107;ENST00000374666	D;D	0.87491	-2.26;-1.97	4.87	-0.968	0.10313	Peptidase cysteine/serine, trypsin-like (1);	0.351400	0.33290	N	0.005062	T	0.43612	0.1255	N	0.00089	-2.185	0.23689	N	0.997105	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.59532	-0.7437	10	0.02654	T	1	-3.9411	2.807	0.05430	0.1603:0.2802:0.4313:0.1282	.	18;18	B1AQ52;P08861	.;CEL3B_HUMAN	C	18;34	ENSP00000338369:Y18C;ENSP00000363798:Y34C	ENSP00000338369:Y18C	Y	+	2	0	CELA3B	22177458	1.000000	0.71417	0.549000	0.28204	0.008000	0.06430	3.343000	0.52167	-0.445000	0.07159	-1.080000	0.02220	TAT	.	.		0.617	CELA3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007797.1	NM_007352	
FGR	2268	hgsc.bcm.edu	37	1	27939760	27939760	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr1:27939760G>T	ENST00000374005.3	-	12	1639	c.1351C>A	c.(1351-1353)Ctc>Atc	p.L451I	FGR_ENST00000399173.1_Missense_Mutation_p.L451I|FGR_ENST00000374004.1_Missense_Mutation_p.L451I|FGR_ENST00000545953.1_Missense_Mutation_p.L385I	NM_005248.2	NP_005239.1	P09769	FGR_HUMAN	FGR proto-oncogene, Src family tyrosine kinase	451	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				blood coagulation (GO:0007596)|defense response to Gram-positive bacterium (GO:0050830)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|immune response-regulating cell surface receptor signaling pathway (GO:0002768)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell migration (GO:0030335)|positive regulation of cytokine secretion (GO:0050715)|positive regulation of mast cell degranulation (GO:0043306)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of cell shape (GO:0008360)|regulation of innate immune response (GO:0045088)|regulation of phagocytosis (GO:0050764)|regulation of protein kinase activity (GO:0045859)|response to virus (GO:0009615)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	ATP binding (GO:0005524)|Fc-gamma receptor I complex binding (GO:0034988)|immunoglobulin receptor binding (GO:0034987)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|phosphotyrosine binding (GO:0001784)|protein kinase binding (GO:0019901)|protein tyrosine kinase activity (GO:0004713)			breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(4)|prostate(1)|skin(4)	16		all_lung(284;2.05e-05)|Colorectal(325;3.46e-05)|Lung NSC(340;3.67e-05)|Renal(390;0.00121)|Breast(348;0.0021)|Ovarian(437;0.00503)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0416)|OV - Ovarian serous cystadenocarcinoma(117;1.25e-24)|Colorectal(126;1.24e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|BRCA - Breast invasive adenocarcinoma(304;0.00244)|KIRC - Kidney renal clear cell carcinoma(1967;0.0027)|STAD - Stomach adenocarcinoma(196;0.00303)|READ - Rectum adenocarcinoma(331;0.0419)		TTGGTGATGAGCTCAGTGAGC	0.602																																					p.L451I		Atlas-SNP	.											.	FGR	39	.	0			c.C1351A						.						87.0	87.0	87.0					1																	27939760		2203	4300	6503	SO:0001583	missense	2268	exon12			TGATGAGCTCAGT	BC064382	CCDS305.1	1p36.2-p36.1	2014-06-25	2014-06-25		ENSG00000000938	ENSG00000000938		"""SH2 domain containing"""	3697	protein-coding gene	gene with protein product		164940	"""Gardner-Rasheed feline sarcoma viral (v-fgr) oncogene homolog"", ""v-fgr feline Gardner-Rasheed sarcoma viral oncogene homolog"", ""feline Gardner-Rasheed sarcoma viral oncogene homolog"""	SRC2		3922831	Standard	NM_001042729		Approved	c-fgr, p55c-fgr	uc001bom.3	P09769	OTTHUMG00000003516	ENST00000374005.3:c.1351C>A	chr1.hg19:g.27939760G>T	ENSP00000363117:p.Leu451Ile	111.0	0.0		127.0	62.0	NM_001042729	D3DPL7|Q9UIQ3	Missense_Mutation	SNP	ENST00000374005.3	hg19	CCDS305.1	.	.	.	.	.	.	.	.	.	.	g	10.98	1.503947	0.26949	.	.	ENSG00000000938	ENST00000374005;ENST00000545953;ENST00000399173;ENST00000374004;ENST00000374003	T;T;T;T;T	0.81415	-1.49;-1.49;-1.49;-1.49;-1.49	4.65	3.7	0.42460	Serine-threonine/tyrosine-protein kinase (2);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.45867	D	0.000331	T	0.56746	0.2006	N	0.02379	-0.575	0.30346	N	0.785278	B	0.11235	0.004	B	0.28553	0.091	T	0.48747	-0.9008	10	0.06365	T	0.9	.	12.8845	0.58036	0.0:0.0:0.8356:0.1643	.	451	P09769	FGR_HUMAN	I	451;385;451;451;451	ENSP00000363117:L451I;ENSP00000445302:L385I;ENSP00000382126:L451I;ENSP00000363116:L451I;ENSP00000363115:L451I	ENSP00000363115:L451I	L	-	1	0	FGR	27812347	1.000000	0.71417	0.998000	0.56505	0.994000	0.84299	5.693000	0.68264	1.053000	0.40415	0.586000	0.80456	CTC	.	.		0.602	FGR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000009772.1	NM_005248	
NCDN	23154	hgsc.bcm.edu	37	1	36025987	36025987	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr1:36025987G>T	ENST00000373243.2	+	3	618	c.235G>T	c.(235-237)Gct>Tct	p.A79S	KIAA0319L_ENST00000325722.3_5'Flank|NCDN_ENST00000373253.3_Missense_Mutation_p.A62S|NCDN_ENST00000356090.4_Missense_Mutation_p.A79S|NCDN_ENST00000459931.1_3'UTR	NM_014284.2	NP_055099.1	Q9UBB6	NCDN_HUMAN	neurochondrin	79					bone resorption (GO:0045453)|neuron projection development (GO:0031175)|regulation of neuronal synaptic plasticity (GO:0048168)	cytosol (GO:0005829)|dendrite (GO:0030425)|membrane (GO:0016020)|neuronal cell body (GO:0043025)				breast(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(3)|pancreas(1)|skin(2)	16		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)				GATCTTCGATGCTGTCGGCTT	0.572																																					p.A79S		Atlas-SNP	.											.	NCDN	79	.	0			c.G235T						.						142.0	141.0	141.0					1																	36025987		2203	4300	6503	SO:0001583	missense	23154	exon3			TTCGATGCTGTCG	AB011179	CCDS392.1, CCDS30672.1	1p34.3	2008-02-05			ENSG00000020129	ENSG00000020129			17597	protein-coding gene	gene with protein product		608458				15007648	Standard	NM_014284		Approved	NCDN-1, NCDN-2	uc001bza.3	Q9UBB6	OTTHUMG00000059204	ENST00000373243.2:c.235G>T	chr1.hg19:g.36025987G>T	ENSP00000362340:p.Ala79Ser	129.0	0.0		109.0	36.0	NM_014284	D3DPR9|Q9UBY2|Q9Y4A6|Q9Y4D9	Missense_Mutation	SNP	ENST00000373243.2	hg19	CCDS392.1	.	.	.	.	.	.	.	.	.	.	G	23.2	4.388735	0.82902	.	.	ENSG00000020129	ENST00000373253;ENST00000356090;ENST00000373243;ENST00000437806	T;T;T	0.70749	-0.51;-0.51;-0.51	5.31	5.31	0.75309	.	0.000000	0.85682	D	0.000000	D	0.82646	0.5082	M	0.68593	2.085	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.80686	-0.1272	10	0.33141	T	0.24	-11.8617	17.9511	0.89053	0.0:0.0:1.0:0.0	.	79	Q9UBB6	NCDN_HUMAN	S	62;79;79;62	ENSP00000362350:A62S;ENSP00000348394:A79S;ENSP00000362340:A79S	ENSP00000348394:A79S	A	+	1	0	NCDN	35798574	1.000000	0.71417	0.996000	0.52242	0.991000	0.79684	8.955000	0.93058	2.480000	0.83734	0.561000	0.74099	GCT	.	.		0.572	NCDN-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131298.1	NM_014284	
UQCRH	7388	hgsc.bcm.edu	37	1	46782226	46782226	+	Silent	SNP	G	G	T			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr1:46782226G>T	ENST00000311672.5	+	4	382	c.246G>T	c.(244-246)gtG>gtT	p.V82V		NM_001089591.1|NM_006004.2	NP_001083060.1|NP_005995.2	P07919	QCR6_HUMAN	ubiquinol-cytochrome c reductase hinge protein	82					aerobic respiration (GO:0009060)|cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|mitochondrial electron transport, ubiquinol to cytochrome c (GO:0006122)|oxidation-reduction process (GO:0055114)|oxidative phosphorylation (GO:0006119)|protein heterooligomerization (GO:0051291)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain (GO:0005746)|mitochondrial respiratory chain complex III (GO:0005750)|mitochondrion (GO:0005739)	ubiquinol-cytochrome-c reductase activity (GO:0008121)			large_intestine(1)|lung(1)|skin(1)|urinary_tract(1)	4	Acute lymphoblastic leukemia(166;0.155)					CCATCTAGGTGGCCCACAAAC	0.418																																					p.V82V		Atlas-SNP	.											.	UQCRH	4	.	0			c.G246T						.						163.0	156.0	158.0					1																	46782226		2203	4300	6503	SO:0001819	synonymous_variant	7388	exon4			CTAGGTGGCCCAC	BC001934	CCDS30704.1	1p34.1	2011-07-04			ENSG00000173660	ENSG00000173660	1.10.2.2	"""Mitochondrial respiratory chain complex / Complex III"""	12590	protein-coding gene	gene with protein product	"""ubiquinol-cytochrome c reductase, complex III subunit VIII"""	613844				2826252	Standard	XM_005271167		Approved	QCR6, UQCR8	uc001cpp.3	P07919	OTTHUMG00000007813	ENST00000311672.5:c.246G>T	chr1.hg19:g.46782226G>T		217.0	0.0		228.0	118.0	NM_006004	B2R4V9|D3DQ18|Q5TDF6|Q6LDB8|Q9BQ91	Silent	SNP	ENST00000311672.5	hg19	CCDS30704.1																																																																																			.	.		0.418	UQCRH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021451.1	NM_006004	
CELSR2	1952	hgsc.bcm.edu	37	1	109810616	109810616	+	Silent	SNP	G	G	T			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr1:109810616G>T	ENST00000271332.3	+	17	6313	c.6252G>T	c.(6250-6252)ctG>ctT	p.L2084L		NM_001408.2	NP_001399.1	Q9HCU4	CELR2_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 2	2084					cerebrospinal fluid secretion (GO:0033326)|cilium assembly (GO:0042384)|cilium movement (GO:0003341)|dendrite morphogenesis (GO:0048813)|G-protein coupled receptor signaling pathway (GO:0007186)|homophilic cell adhesion (GO:0007156)|neural plate anterior/posterior regionalization (GO:0021999)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|regulation of cell-cell adhesion (GO:0022407)|regulation of protein localization (GO:0032880)|regulation of transcription, DNA-templated (GO:0006355)|ventricular system development (GO:0021591)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|lung(27)|ovary(5)|prostate(1)|skin(3)|urinary_tract(2)	82		all_epithelial(167;0.000114)|all_lung(203;0.000321)|Lung NSC(277;0.000626)|Breast(1374;0.244)		Colorectal(144;0.0296)|Lung(183;0.067)|COAD - Colon adenocarcinoma(174;0.114)|Epithelial(280;0.193)|all cancers(265;0.219)		CCACGCGGCTGCTGGCCCACG	0.667																																					p.L2084L	NSCLC(158;1285 2011 34800 34852 42084)	Atlas-SNP	.											.	CELSR2	228	.	0			c.G6252T						.						30.0	32.0	31.0					1																	109810616		2203	4300	6503	SO:0001819	synonymous_variant	1952	exon17			GCGGCTGCTGGCC	D87469	CCDS796.1	1p13.3	2014-08-08	2013-02-18		ENSG00000143126	ENSG00000143126		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	3231	protein-coding gene	gene with protein product		604265	"""cadherin, EGF LAG seven-pass G-type receptor 2, flamingo (Drosophila) homolog"""	EGFL2		9693030, 10907856	Standard	NM_001408		Approved	KIAA0279, MEGF3, Flamingo1, CDHF10	uc001dxa.4	Q9HCU4	OTTHUMG00000012003	ENST00000271332.3:c.6252G>T	chr1.hg19:g.109810616G>T		45.0	0.0		32.0	9.0	NM_001408	Q5T2Y7|Q92566	Silent	SNP	ENST00000271332.3	hg19	CCDS796.1																																																																																			.	.		0.667	CELSR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033200.1	NM_001408	
FLG	2312	hgsc.bcm.edu	37	1	152280060	152280060	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr1:152280060G>T	ENST00000368799.1	-	3	7337	c.7302C>A	c.(7300-7302)agC>agA	p.S2434R	FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000420707.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	2434	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TTCCTCCAGTGCTGGTCCCGG	0.602									Ichthyosis																												p.S2434R		Atlas-SNP	.											.	FLG	900	.	0			c.C7302A						.						273.0	250.0	258.0					1																	152280060		2203	4300	6503	SO:0001583	missense	2312	exon3	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	TCCAGTGCTGGTC	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.7302C>A	chr1.hg19:g.152280060G>T	ENSP00000357789:p.Ser2434Arg	145.0	0.0		156.0	47.0	NM_002016	Q01720|Q5T583|Q9UC71	Missense_Mutation	SNP	ENST00000368799.1	hg19	CCDS30860.1	.	.	.	.	.	.	.	.	.	.	G	10.52	1.373430	0.24857	.	.	ENSG00000143631	ENST00000368799	T	0.01767	4.65	4.03	-8.05	0.01106	.	.	.	.	.	T	0.00754	0.0025	M	0.81682	2.555	0.09310	N	1	B	0.19331	0.035	B	0.09377	0.004	T	0.44034	-0.9354	9	0.52906	T	0.07	.	2.9885	0.05975	0.5332:0.1246:0.2159:0.1262	.	2434	P20930	FILA_HUMAN	R	2434	ENSP00000357789:S2434R	ENSP00000357789:S2434R	S	-	3	2	FLG	150546684	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.532000	0.02217	-1.568000	0.01670	-0.300000	0.09419	AGC	.	.		0.602	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033742.1	NM_002016	
CACNA1S	779	hgsc.bcm.edu	37	1	201021743	201021743	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr1:201021743G>T	ENST00000362061.3	-	32	4121	c.3895C>A	c.(3895-3897)Caa>Aaa	p.Q1299K	CACNA1S_ENST00000367338.3_Missense_Mutation_p.Q1280K	NM_000069.2	NP_000060.2	Q13698	CAC1S_HUMAN	calcium channel, voltage-dependent, L type, alpha 1S subunit	1299					axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transport (GO:0006816)|endoplasmic reticulum organization (GO:0007029)|extraocular skeletal muscle development (GO:0002074)|membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|myoblast fusion (GO:0007520)|neuromuscular junction development (GO:0007528)|skeletal muscle adaptation (GO:0043501)|skeletal muscle fiber development (GO:0048741)|skeletal system development (GO:0001501)|striated muscle contraction (GO:0006941)	cytoplasm (GO:0005737)|I band (GO:0031674)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|T-tubule (GO:0030315)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(13)|large_intestine(19)|lung(37)|ovary(6)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	102					Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Felodipine(DB01023)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	CGGTTTATTTGGGTCCCATCC	0.562																																					p.Q1299K		Atlas-SNP	.											.	CACNA1S	249	.	0			c.C3895A						.						266.0	228.0	241.0					1																	201021743		2203	4300	6503	SO:0001583	missense	779	exon32			TTATTTGGGTCCC	L33798	CCDS1407.1	1q32	2012-03-07			ENSG00000081248	ENSG00000081248		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1397	protein-coding gene	gene with protein product		114208		HOKPP, MHS5, CACNL1A3		7916735, 16382099	Standard	NM_000069		Approved	Cav1.1, hypoPP	uc001gvv.3	Q13698	OTTHUMG00000035784	ENST00000362061.3:c.3895C>A	chr1.hg19:g.201021743G>T	ENSP00000355192:p.Gln1299Lys	123.0	0.0		113.0	38.0	NM_000069	A4IF51|B1ALM2|Q12896|Q13934	Missense_Mutation	SNP	ENST00000362061.3	hg19	CCDS1407.1	.	.	.	.	.	.	.	.	.	.	.	16.64	3.178620	0.57692	.	.	ENSG00000081248	ENST00000362061;ENST00000367338	D;D	0.98419	-4.92;-4.92	4.68	4.68	0.58851	Ion transport (1);	0.116892	0.64402	D	0.000017	D	0.97476	0.9174	M	0.72894	2.215	0.39160	D	0.962395	P	0.38473	0.633	B	0.42959	0.403	D	0.98619	1.0666	10	0.49607	T	0.09	.	13.6846	0.62508	0.0:0.1548:0.8451:0.0	.	1299	Q13698	CAC1S_HUMAN	K	1299;1280	ENSP00000355192:Q1299K;ENSP00000356307:Q1280K	ENSP00000355192:Q1299K	Q	-	1	0	CACNA1S	199288366	1.000000	0.71417	0.579000	0.28588	0.957000	0.61999	4.616000	0.61197	2.299000	0.77371	0.551000	0.68910	CAA	.	.		0.562	CACNA1S-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087049.1	NM_000069	
OBSCN	84033	hgsc.bcm.edu	37	1	228525079	228525079	+	Missense_Mutation	SNP	G	G	A	rs34771878		TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr1:228525079G>A	ENST00000422127.1	+	66	16839	c.16795G>A	c.(16795-16797)Ggc>Agc	p.G5599S	OBSCN_ENST00000570156.2_Missense_Mutation_p.G6556S|OBSCN_ENST00000284548.11_Missense_Mutation_p.G5599S|OBSCN_ENST00000366707.4_Missense_Mutation_p.G3233S|OBSCN_ENST00000366709.4_Missense_Mutation_p.G2718S	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	5599					apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				CGATGCCCGAGGCGAGGTGGG	0.652																																					p.G6556S		Atlas-SNP	.											.	OBSCN	2142	.	0			c.G19666A						.						20.0	23.0	22.0					1																	228525079		2052	4173	6225	SO:0001583	missense	84033	exon77			GCCCGAGGCGAGG	AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.16795G>A	chr1.hg19:g.228525079G>A	ENSP00000409493:p.Gly5599Ser	223.0	0.0		165.0	55.0	NM_001271223	Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Missense_Mutation	SNP	ENST00000422127.1	hg19	CCDS58065.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	21.4|21.4	4.139130|4.139130	0.77775|0.77775	.|.	.|.	ENSG00000154358|ENSG00000154358	ENST00000284548;ENST00000422127;ENST00000366707;ENST00000366709|ENST00000441106	T;T;T;T|T	0.62941|0.66638	0.33;-0.01;0.04;0.48|-0.22	4.37|4.37	4.37|4.37	0.52481|0.52481	Src homology-3 domain (1);|.	0.000000|.	0.64402|.	D|.	0.000001|.	T|T	0.74801|0.74801	0.3764|0.3764	L|L	0.54323|0.54323	1.7|1.7	0.58432|0.58432	D|D	0.999999|0.999999	D;D|.	0.89917|.	1.0;1.0|.	D;D|.	0.97110|.	0.999;1.0|.	T|T	0.77395|0.77395	-0.2604|-0.2604	10|7	0.45353|0.59425	T|D	0.12|0.04	.|.	17.4671|17.4671	0.87635|0.87635	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	5599;5599|.	Q5VST9;Q5VST9-3|.	OBSCN_HUMAN;.|.	S|K	5599;5599;3233;2718|214	ENSP00000284548:G5599S;ENSP00000409493:G5599S;ENSP00000355668:G3233S;ENSP00000355670:G2718S|ENSP00000388554:R214K	ENSP00000284548:G5599S|ENSP00000388554:R214K	G|R	+|+	1|2	0|0	OBSCN|OBSCN	226591702|226591702	1.000000|1.000000	0.71417|0.71417	0.407000|0.407000	0.26434|0.26434	0.003000|0.003000	0.03518|0.03518	8.939000|8.939000	0.92951|0.92951	2.437000|2.437000	0.82529|0.82529	0.655000|0.655000	0.94253|0.94253	GGC|AGG	.	.		0.652	OBSCN-204	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_052843	
RYR2	6262	hgsc.bcm.edu	37	1	237947437	237947437	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr1:237947437C>T	ENST00000366574.2	+	90	12742	c.12425C>T	c.(12424-12426)gCc>gTc	p.A4142V	RYR2_ENST00000542537.1_Missense_Mutation_p.A4126V|RYR2_ENST00000609119.1_3'UTR|RYR2_ENST00000360064.6_Missense_Mutation_p.A4148V	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	4142					BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			ATGGGAAGCGCCAAACGCATC	0.498																																					p.A4142V		Atlas-SNP	.											.	RYR2	1273	.	0			c.C12425T						.						76.0	76.0	76.0					1																	237947437		1916	4139	6055	SO:0001583	missense	6262	exon90			GAAGCGCCAAACG	X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.12425C>T	chr1.hg19:g.237947437C>T	ENSP00000355533:p.Ala4142Val	155.0	0.0		106.0	43.0	NM_001035	Q15411|Q546N8|Q5T3P2	Missense_Mutation	SNP	ENST00000366574.2	hg19	CCDS55691.1	.	.	.	.	.	.	.	.	.	.	C	21.9	4.221274	0.79464	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537;ENST00000542288	D;D;D	0.97850	-4.57;-4.57;-4.57	5.54	5.54	0.83059	.	0.000000	0.64402	D	0.000006	D	0.97936	0.9321	L	0.47716	1.5	0.80722	D	1	D;D	0.69078	0.997;0.987	D;P	0.79784	0.993;0.87	D	0.98561	1.0641	10	0.72032	D	0.01	.	15.0213	0.71632	0.0:0.8581:0.1419:0.0	.	1116;4142	B4DGV4;Q92736	.;RYR2_HUMAN	V	4142;4148;4126;1116	ENSP00000355533:A4142V;ENSP00000353174:A4148V;ENSP00000443798:A4126V	ENSP00000353174:A4148V	A	+	2	0	RYR2	236014060	1.000000	0.71417	0.998000	0.56505	0.969000	0.65631	4.853000	0.62911	2.610000	0.88304	0.655000	0.94253	GCC	.	.		0.498	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095402.2	NM_001035	
FAM84A	151354	hgsc.bcm.edu	37	2	14774404	14774404	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr2:14774404G>T	ENST00000295092.2	+	2	589	c.301G>T	c.(301-303)Ggt>Tgt	p.G101C	AC011897.1_ENST00000581929.1_5'Flank|FAM84A_ENST00000331243.4_Missense_Mutation_p.G101C	NM_145175.2	NP_660158.2	Q96KN4	FA84A_HUMAN	family with sequence similarity 84, member A	101										endometrium(1)|kidney(1)|large_intestine(2)|lung(4)|pancreas(1)|upper_aerodigestive_tract(1)	10	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.197)		GBM - Glioblastoma multiforme(1;0.00969)			CAAAGTGAGCGGTGGCCCTCA	0.667																																					p.G101C		Atlas-SNP	.											.	FAM84A	23	.	0			c.G301T						.						14.0	16.0	15.0					2																	14774404		2196	4291	6487	SO:0001583	missense	151354	exon2			GTGAGCGGTGGCC	AJ417080, BC026346	CCDS1684.1	2p24.3	2005-08-09			ENSG00000162981	ENSG00000162981			20743	protein-coding gene	gene with protein product	"""neurological/sensory 1"""	611234				14702039	Standard	NM_145175		Approved	NSE1, FLJ35392	uc002rbz.2	Q96KN4	OTTHUMG00000119093	ENST00000295092.2:c.301G>T	chr2.hg19:g.14774404G>T	ENSP00000295092:p.Gly101Cys	13.0	0.0		14.0	7.0	NM_145175	A6NP76|Q86UZ2|Q8NAH7|Q8TAM5	Missense_Mutation	SNP	ENST00000295092.2	hg19	CCDS1684.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	16.46|16.46	3.128805|3.128805	0.56721|0.56721	.|.	.|.	ENSG00000162981|ENSG00000162981	ENST00000295092;ENST00000331243;ENST00000359969|ENST00000540701	T;T|.	0.03801|.	3.8;3.8|.	4.44|4.44	3.55|3.55	0.40652|0.40652	.|.	0.106113|.	0.64402|.	D|.	0.000005|.	T|T	0.55321|0.55321	0.1913|0.1913	L|L	0.39898|0.39898	1.24|1.24	0.39690|0.39690	D|D	0.971026|0.971026	D|.	0.64830|.	0.994|.	P|.	0.51385|.	0.668|.	T|T	0.59558|0.59558	-0.7432|-0.7432	10|6	0.49607|0.87932	T|D	0.09|0	-27.4376|-27.4376	8.3319|8.3319	0.32191|0.32191	0.2027:0.0:0.7973:0.0|0.2027:0.0:0.7973:0.0	.|.	101|.	Q96KN4|.	FA84A_HUMAN|.	C|L	101|8	ENSP00000295092:G101C;ENSP00000330681:G101C|.	ENSP00000295092:G101C|ENSP00000443261:R8L	G|R	+|+	1|2	0|0	FAM84A|FAM84A	14691855|14691855	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.978000|0.978000	0.69477|0.69477	2.756000|2.756000	0.47549|0.47549	1.190000|1.190000	0.43042|0.43042	0.655000|0.655000	0.94253|0.94253	GGT|CGG	.	.		0.667	FAM84A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239308.2	NM_145175	
DNMT3A	1788	hgsc.bcm.edu	37	2	25464487	25464487	+	Missense_Mutation	SNP	G	G	A	rs375399431		TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr2:25464487G>A	ENST00000264709.3	-	17	2363	c.2026C>T	c.(2026-2028)Cgg>Tgg	p.R676W	DNMT3A_ENST00000380746.4_Missense_Mutation_p.R487W|DNMT3A_ENST00000402667.1_Missense_Mutation_p.R453W|DNMT3A_ENST00000474887.1_5'UTR|DNMT3A_ENST00000321117.5_Missense_Mutation_p.R676W	NM_175629.2	NP_783328.1	Q9Y6K1	DNM3A_HUMAN	DNA (cytosine-5-)-methyltransferase 3 alpha	676	SAM-dependent MTase C5-type. {ECO:0000255|PROSITE-ProRule:PRU01016}.				C-5 methylation of cytosine (GO:0090116)|cellular response to amino acid stimulus (GO:0071230)|DNA methylation (GO:0006306)|DNA methylation involved in embryo development (GO:0043045)|DNA methylation involved in gamete generation (GO:0043046)|DNA methylation on cytosine within a CG sequence (GO:0010424)|hypermethylation of CpG island (GO:0044027)|methylation-dependent chromatin silencing (GO:0006346)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of gene expression by genetic imprinting (GO:0006349)|S-adenosylhomocysteine metabolic process (GO:0046498)|S-adenosylmethioninamine metabolic process (GO:0046499)|spermatogenesis (GO:0007283)	chromosome, centromeric region (GO:0000775)|cytoplasm (GO:0005737)|euchromatin (GO:0000791)|nuclear heterochromatin (GO:0005720)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA (cytosine-5-)-methyltransferase activity (GO:0003886)|DNA (cytosine-5-)-methyltransferase activity, acting on CpG substrates (GO:0051718)|DNA binding (GO:0003677)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|unmethylated CpG binding (GO:0045322)	p.R676W(1)		breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(964)|kidney(3)|large_intestine(10)|lung(29)|ovary(3)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)	1021	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CCCTGGTGCCGCACCATGCCC	0.627			"""Mis, F, N, S"""		AML																																p.R676W		Atlas-SNP	.		Rec	yes		2	2p23	1788	DNA (cytosine-5-)-methyltransferase 3 alpha		L	DNMT3A_ENST00000380746,NS,carcinoma,+2,1	DNMT3A	1807	.	1	Substitution - Missense(1)	haematopoietic_and_lymphoid_tissue(1)	c.C2026T						.	G	TRP/ARG,TRP/ARG,TRP/ARG	0,4406		0,0,2203	149.0	95.0	113.0		2026,1459,2026	5.4	1.0	2		113	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense	DNMT3A	NM_022552.3,NM_153759.2,NM_175629.1	101,101,101	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging,probably-damaging,probably-damaging	676/913,487/724,676/913	25464487	1,13005	2203	4300	6503	SO:0001583	missense	1788	exon17			GGTGCCGCACCAT		CCDS1718.2, CCDS33157.1, CCDS46232.1	2p23	2014-09-17			ENSG00000119772	ENSG00000119772			2978	protein-coding gene	gene with protein product		602769				9662389, 10433969	Standard	NM_175630		Approved		uc002rgc.4	Q9Y6K1	OTTHUMG00000094777	ENST00000264709.3:c.2026C>T	chr2.hg19:g.25464487G>A	ENSP00000264709:p.Arg676Trp	101.0	0.0		80.0	4.0	NM_175629	E9PEB8|Q86TE8|Q86XF5|Q8IZV0|Q8WXU9	Missense_Mutation	SNP	ENST00000264709.3	hg19	CCDS33157.1	.	.	.	.	.	.	.	.	.	.	G	27.5	4.837170	0.91117	0.0	1.16E-4	ENSG00000119772	ENST00000380746;ENST00000321117;ENST00000264709;ENST00000402667	D;D;D;D	0.96619	-4.07;-4.07;-4.07;-4.07	5.44	5.44	0.79542	.	0.115412	0.64402	D	0.000013	D	0.98074	0.9365	M	0.88105	2.93	0.80722	D	1	D;D	0.76494	0.999;0.998	D;D	0.66602	0.935;0.945	D	0.98657	1.0682	10	0.87932	D	0	-10.3061	13.6788	0.62472	0.0:0.0:0.845:0.155	.	676;487	Q9Y6K1;E9PEB8	DNM3A_HUMAN;.	W	487;676;676;453	ENSP00000370122:R487W;ENSP00000324375:R676W;ENSP00000264709:R676W;ENSP00000384237:R453W	ENSP00000264709:R676W	R	-	1	2	DNMT3A	25317991	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.995000	0.57001	2.568000	0.86640	0.555000	0.69702	CGG	.	.		0.627	DNMT3A-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000211587.1	NM_022552	
OTOF	9381	hgsc.bcm.edu	37	2	26699163	26699163	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr2:26699163C>A	ENST00000272371.2	-	23	2825	c.2699G>T	c.(2698-2700)gGc>gTc	p.G900V	OTOF_ENST00000402415.3_Missense_Mutation_p.G210V|OTOF_ENST00000338581.6_Missense_Mutation_p.G153V|OTOF_ENST00000403946.3_Missense_Mutation_p.G900V|OTOF_ENST00000339598.3_Missense_Mutation_p.G153V	NM_194248.2	NP_919224.1	Q9HC10	OTOF_HUMAN	otoferlin	900					membrane fusion (GO:0061025)|sensory perception of sound (GO:0007605)|synaptic vesicle exocytosis (GO:0016079)	cell junction (GO:0030054)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synaptic vesicle membrane (GO:0030672)	calcium ion binding (GO:0005509)			NS(1)|autonomic_ganglia(1)|breast(9)|central_nervous_system(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(14)|lung(35)|ovary(8)|pancreas(1)|prostate(5)|skin(5)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	106	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GCCTGCCGAGCCGAAGCCCCG	0.697																																					p.G900V	GBM(102;732 1451 20652 24062 31372)	Atlas-SNP	.											.	OTOF	524	.	0			c.G2699T						.						25.0	25.0	25.0					2																	26699163		2089	4116	6205	SO:0001583	missense	9381	exon23			GCCGAGCCGAAGC	AF107403	CCDS1724.1, CCDS1725.1, CCDS1726.1, CCDS46241.1, CCDS74497.1	2p23.1	2014-06-27			ENSG00000115155	ENSG00000115155			8515	protein-coding gene	gene with protein product	"""fer-1-like family member 2"""	603681		DFNB9		10192385, 18381613	Standard	NM_194248		Approved	FER1L2, DFNB6	uc002rhk.3	Q9HC10	OTTHUMG00000096977	ENST00000272371.2:c.2699G>T	chr2.hg19:g.26699163C>A	ENSP00000272371:p.Gly900Val	27.0	0.0		27.0	10.0	NM_194248	B4DJX0|B5MCC1|B9A0H6|Q53R90|Q9HC08|Q9HC09|Q9Y650	Missense_Mutation	SNP	ENST00000272371.2	hg19	CCDS1725.1	.	.	.	.	.	.	.	.	.	.	C	19.59	3.856946	0.71834	.	.	ENSG00000115155	ENST00000338581;ENST00000339598;ENST00000402415;ENST00000272371;ENST00000403946	D;D;D;D;D	0.82619	-1.63;-1.63;-1.63;-1.63;-1.63	5.41	5.41	0.78517	Ferlin B-domain (1);	0.000000	0.85682	D	0.000000	D	0.91670	0.7367	M	0.84326	2.69	0.80722	D	1	D;D;D;D	0.89917	1.0;0.994;1.0;1.0	D;P;D;D	0.97110	1.0;0.828;1.0;0.999	D	0.91667	0.5347	10	0.48119	T	0.1	-40.8975	17.7511	0.88434	0.0:1.0:0.0:0.0	.	900;153;210;153	Q9HC10;Q9HC10-2;Q9HC10-3;Q9HC10-4	OTOF_HUMAN;.;.;.	V	153;153;210;900;900	ENSP00000345137:G153V;ENSP00000344521:G153V;ENSP00000383906:G210V;ENSP00000272371:G900V;ENSP00000385255:G900V	ENSP00000272371:G900V	G	-	2	0	OTOF	26552667	1.000000	0.71417	1.000000	0.80357	0.383000	0.30230	7.630000	0.83225	2.546000	0.85860	0.561000	0.74099	GGC	.	.		0.697	OTOF-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000214047.3		
C2orf16	84226	hgsc.bcm.edu	37	2	27804122	27804122	+	Silent	SNP	C	C	A			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr2:27804122C>A	ENST00000408964.2	+	1	4734	c.4683C>A	c.(4681-4683)ccC>ccA	p.P1561P	ZNF512_ENST00000413371.2_5'Flank|ZNF512_ENST00000416005.2_5'Flank|AC074091.1_ENST00000408604.1_RNA|ZNF512_ENST00000556601.1_5'Flank|ZNF512_ENST00000355467.4_5'Flank|RP11-158I13.2_ENST00000505973.1_RNA|ZNF512_ENST00000379717.1_5'Flank	NM_032266.3	NP_115642.3	Q68DN1	CB016_HUMAN	chromosome 2 open reading frame 16	1561	Arg-rich.					extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)				breast(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(33)|urinary_tract(1)	47	Acute lymphoblastic leukemia(172;0.155)					GTCATAACCCCTCTTGGAGAA	0.527																																					p.P1561P		Atlas-SNP	.											.	C2orf16	357	.	0			c.C4683A						.						117.0	118.0	118.0					2																	27804122		1891	4109	6000	SO:0001819	synonymous_variant	84226	exon1			TAACCCCTCTTGG	AL136898	CCDS42666.1	2p23.3	2013-09-20			ENSG00000221843	ENSG00000221843			25275	protein-coding gene	gene with protein product	"""P-S-E-R-S-H-H-S repeats containing"""						Standard	NM_032266		Approved	DKFZp434G118	uc002rkz.4	Q68DN1	OTTHUMG00000159099	ENST00000408964.2:c.4683C>A	chr2.hg19:g.27804122C>A		79.0	0.0		100.0	21.0	NM_032266	B9EIQ4|Q53S01|Q8ND64|Q9H088	Silent	SNP	ENST00000408964.2	hg19	CCDS42666.1																																																																																			.	.		0.527	C2orf16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353292.1	NM_032266	
ADD2	119	hgsc.bcm.edu	37	2	70933425	70933425	+	Missense_Mutation	SNP	G	G	T	rs373392326		TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr2:70933425G>T	ENST00000264436.4	-	3	560	c.116C>A	c.(115-117)gCg>gAg	p.A39E	ADD2_ENST00000473232.1_5'Flank|ADD2_ENST00000413157.2_Missense_Mutation_p.A39E|ADD2_ENST00000430656.1_Missense_Mutation_p.A55E|ADD2_ENST00000355733.3_Missense_Mutation_p.A39E|ADD2_ENST00000407644.2_Missense_Mutation_p.A39E	NM_001617.3	NP_001608.1	P35612	ADDB_HUMAN	adducin 2 (beta)	39					actin cytoskeleton organization (GO:0030036)|actin filament bundle assembly (GO:0051017)|barbed-end actin filament capping (GO:0051016)|hemopoiesis (GO:0030097)|positive regulation of protein binding (GO:0032092)|protein complex assembly (GO:0006461)	cytoplasmic membrane-bounded vesicle (GO:0016023)|F-actin capping protein complex (GO:0008290)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|spectrin binding (GO:0030507)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|large_intestine(11)|lung(13)|ovary(3)|pancreas(1)|skin(2)	36						CCGCAGGTCCGCCGCCCGGTT	0.687																																					p.A55E		Atlas-SNP	.											.	ADD2	261	.	0			c.C164A						.						51.0	52.0	52.0					2																	70933425		2203	4300	6503	SO:0001583	missense	119	exon2			AGGTCCGCCGCCC	X58199	CCDS1906.1, CCDS1909.1, CCDS46318.1, CCDS54365.1	2p13.3	2008-02-05			ENSG00000075340	ENSG00000075340			244	protein-coding gene	gene with protein product		102681				1840603	Standard	NM_001617		Approved	ADDB	uc021vjc.1	P35612	OTTHUMG00000129710	ENST00000264436.4:c.116C>A	chr2.hg19:g.70933425G>T	ENSP00000264436:p.Ala39Glu	104.0	0.0		74.0	31.0	NM_001185055	A8K4P2|B4DM17|D6W5G7|D6W5G8|Q13482|Q16412|Q59G82|Q5U5P4|Q6P0P2|Q6PGQ4|Q7Z688|Q7Z689|Q7Z690|Q7Z691	Missense_Mutation	SNP	ENST00000264436.4	hg19	CCDS1906.1	.	.	.	.	.	.	.	.	.	.	G	13.07	2.126225	0.37533	.	.	ENSG00000075340	ENST00000264436;ENST00000407644;ENST00000456320;ENST00000355733;ENST00000522886;ENST00000264439;ENST00000356565;ENST00000517596;ENST00000413157;ENST00000430656;ENST00000415348;ENST00000425976	T;T;T;T;T;T;T;T	0.30448	1.53;1.53;1.53;1.53;1.53;1.53;1.53;1.53	4.89	4.89	0.63831	.	0.148379	0.44902	D	0.000412	T	0.46639	0.1403	M	0.66297	2.02	0.29846	N	0.828861	P;P;D;P;P;P	0.63046	0.645;0.631;0.992;0.505;0.623;0.904	B;B;P;B;B;B	0.54026	0.177;0.387;0.74;0.177;0.247;0.411	T	0.50841	-0.8780	10	0.87932	D	0	-14.2279	15.9349	0.79694	0.0:0.0:1.0:0.0	.	55;39;39;39;39;39	B4DM17;P35612-4;E9PAN1;Q05DK5;P35612;P35612-3	.;.;.;.;ADDB_HUMAN;.	E	39;39;39;39;39;39;39;39;39;55;39;39	ENSP00000264436:A39E;ENSP00000384677:A39E;ENSP00000347972:A39E;ENSP00000430243:A39E;ENSP00000388072:A39E;ENSP00000398112:A55E;ENSP00000412357:A39E;ENSP00000412681:A39E	ENSP00000264436:A39E	A	-	2	0	ADD2	70786933	0.998000	0.40836	0.018000	0.16275	0.076000	0.17211	5.317000	0.65822	2.690000	0.91761	0.591000	0.81541	GCG	.	.		0.687	ADD2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251918.4	NM_001617	
ACOXL	55289	hgsc.bcm.edu	37	2	111556210	111556210	+	Silent	SNP	T	T	C			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr2:111556210T>C	ENST00000389811.4	+	6	593	c.369T>C	c.(367-369)tgT>tgC	p.C123C	ACOXL_ENST00000439055.1_Silent_p.C123C|ACOXL_ENST00000340561.4_Silent_p.C123C			Q9NUZ1	ACOXL_HUMAN	acyl-CoA oxidase-like	123					fatty acid beta-oxidation (GO:0006635)	peroxisome (GO:0005777)	acyl-CoA dehydrogenase activity (GO:0003995)|acyl-CoA oxidase activity (GO:0003997)			kidney(1)|large_intestine(4)|lung(10)|pancreas(1)|prostate(2)|skin(2)|urinary_tract(1)	21						ACACGCCGTGTGAAAATGCGG	0.438																																					p.C123C		Atlas-SNP	.											.	ACOXL	93	.	0			c.T369C						.						130.0	123.0	125.0					2																	111556210		1926	4137	6063	SO:0001819	synonymous_variant	55289	exon6			GCCGTGTGAAAAT		CCDS46389.1	2q13	2010-06-30	2010-04-30		ENSG00000153093	ENSG00000153093			25621	protein-coding gene	gene with protein product			"""acyl-Coenzyme A oxidase-like"""				Standard	NM_001142807		Approved	FLJ11042	uc010yxk.1	Q9NUZ1	OTTHUMG00000131257	ENST00000389811.4:c.369T>C	chr2.hg19:g.111556210T>C		75.0	0.0		48.0	17.0	NM_001142807	A2RRB7|B7WPB3|B7WPP7|E9PB20|Q53R27|Q53R31|Q53SC6|Q8TCE7	Silent	SNP	ENST00000389811.4	hg19																																																																																				.	.		0.438	ACOXL-001	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000254024.2	NM_018308	
ACVR2A	92	hgsc.bcm.edu	37	2	148684674	148684674	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr2:148684674T>C	ENST00000241416.7	+	11	2009	c.1373T>C	c.(1372-1374)aTt>aCt	p.I458T	ACVR2A_ENST00000404590.1_Missense_Mutation_p.I458T|ACVR2A_ENST00000535787.1_Missense_Mutation_p.I350T|ACVR2A_ENST00000495775.1_3'UTR	NM_001278579.1|NM_001278580.1|NM_001616.3	NP_001265508.1|NP_001265509.1|NP_001607.1	P27037	AVR2A_HUMAN	activin A receptor, type IIA	458	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activin receptor signaling pathway (GO:0032924)|anterior/posterior pattern specification (GO:0009952)|BMP signaling pathway (GO:0030509)|cellular response to BMP stimulus (GO:0071773)|determination of left/right symmetry (GO:0007368)|embryonic skeletal system development (GO:0048706)|gastrulation with mouth forming second (GO:0001702)|mesoderm development (GO:0007498)|penile erection (GO:0043084)|positive regulation of activin receptor signaling pathway (GO:0032927)|positive regulation of bone mineralization (GO:0030501)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of protein phosphorylation (GO:0001934)|regulation of BMP signaling pathway (GO:0030510)|regulation of nitric-oxide synthase activity (GO:0050999)|Sertoli cell proliferation (GO:0060011)|sperm ejaculation (GO:0042713)|spermatogenesis (GO:0007283)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|inhibin-betaglycan-ActRII complex (GO:0034673)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|coreceptor activity (GO:0015026)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|transforming growth factor beta-activated receptor activity (GO:0005024)|transmembrane receptor protein serine/threonine kinase activity (GO:0004675)	p.I458T(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(5)|large_intestine(14)|liver(1)|lung(7)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|stomach(8)	45				BRCA - Breast invasive adenocarcinoma(221;0.0969)		TGTGAAACCATTGAAGAATGT	0.378																																					p.I458T		Atlas-SNP	.											ACVR2A,NS,carcinoma,0,1	ACVR2A	125	.	1	Substitution - Missense(1)	breast(1)	c.T1373C						.						106.0	101.0	103.0					2																	148684674		2203	4299	6502	SO:0001583	missense	92	exon11			AAACCATTGAAGA		CCDS33301.1, CCDS63030.1	2q22.2-q23.3	2008-02-05	2005-05-10	2005-05-10	ENSG00000121989	ENSG00000121989			173	protein-coding gene	gene with protein product		102581	"""activin A receptor, type II"""	ACVR2		1314589, 10702675	Standard	NM_001278579		Approved	ACTRII	uc002twh.3	P27037	OTTHUMG00000150603	ENST00000241416.7:c.1373T>C	chr2.hg19:g.148684674T>C	ENSP00000241416:p.Ile458Thr	121.0	1.0		73.0	18.0	NM_001616	B2RAB8|B4DWQ2|D3DP85|Q53TH4|Q6NWV2|Q92474	Missense_Mutation	SNP	ENST00000241416.7	hg19	CCDS33301.1	.	.	.	.	.	.	.	.	.	.	T	18.74	3.688428	0.68271	.	.	ENSG00000121989	ENST00000241416;ENST00000535787;ENST00000404590	T;T;T	0.71341	-0.56;-0.56;-0.56	6.06	6.06	0.98353	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.80706	0.4674	M	0.76727	2.345	0.80722	D	1	P	0.41345	0.746	P	0.51550	0.673	T	0.82466	-0.0443	10	0.87932	D	0	.	16.6245	0.84952	0.0:0.0:0.0:1.0	.	458	P27037	AVR2A_HUMAN	T	458;350;458	ENSP00000241416:I458T;ENSP00000439988:I350T;ENSP00000384338:I458T	ENSP00000241416:I458T	I	+	2	0	ACVR2A	148401144	1.000000	0.71417	0.998000	0.56505	0.989000	0.77384	8.040000	0.89188	2.323000	0.78572	0.528000	0.53228	ATT	.	.		0.378	ACVR2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319051.1	NM_001616	
TTN	7273	hgsc.bcm.edu	37	2	179517415	179517415	+	Intron	SNP	G	G	T			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr2:179517415G>T	ENST00000591111.1	-	157	34747				TTN-AS1_ENST00000589830.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000359218.5_Intron|TTN_ENST00000460472.2_Intron|TTN_ENST00000589042.1_Missense_Mutation_p.A13003D|TTN_ENST00000342175.6_Intron|TTN-AS1_ENST00000431752.1_RNA|TTN_ENST00000342992.6_Intron|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000589487.1_RNA			Q8WZ42	TITIN_HUMAN	titin						adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TTTAGGAGGAGCCGAGGGCAC	0.383																																					p.A13003D		Atlas-SNP	.											.	TTN	18412	.	0			c.C39008A						.						226.0	231.0	230.0					2																	179517415		876	1991	2867	SO:0001627	intron_variant	7273	exon201			GGAGGAGCCGAGG	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.34523-147C>A	chr2.hg19:g.179517415G>T		80.0	0.0		52.0	20.0	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	hg19																																																																																				.	.		0.383	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
CCDC141	285025	hgsc.bcm.edu	37	2	179701999	179701999	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr2:179701999C>A	ENST00000420890.2	-	23	4064	c.3947G>T	c.(3946-3948)aGt>aTt	p.S1316I	CCDC141_ENST00000295723.5_Missense_Mutation_p.S741I|CCDC141_ENST00000480419.1_5'UTR	NM_173648.3	NP_775919.3	Q6ZP82	CC141_HUMAN	coiled-coil domain containing 141	1316										NS(2)|breast(1)|endometrium(5)|kidney(1)|large_intestine(17)|lung(37)|ovary(8)|pancreas(2)|skin(4)|upper_aerodigestive_tract(1)	78			OV - Ovarian serous cystadenocarcinoma(117;0.0274)|Epithelial(96;0.0531)|all cancers(119;0.147)			ATGTTCAGCACTGATTCTGTG	0.483																																					p.S1316I		Atlas-SNP	.											CCDC141_ENST00000420890,NS,malignant_melanoma,0,2	CCDC141	362	.	0			c.G3947T						.						120.0	105.0	110.0					2																	179701999		2203	4300	6503	SO:0001583	missense	285025	exon23			TCAGCACTGATTC	AK096821		2q31.2	2013-01-14			ENSG00000163492	ENSG00000163492		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	26821	protein-coding gene	gene with protein product	"""coiled-coil protein associated with myosin II and DISC1"""					20956536	Standard	NM_173648		Approved	FLJ39502, CAMDI	uc002une.2	Q6ZP82	OTTHUMG00000132578	ENST00000420890.2:c.3947G>T	chr2.hg19:g.179701999C>A	ENSP00000395995:p.Ser1316Ile	117.0	0.0		81.0	28.0	NM_173648	H7C0P1|J3KNW6|Q8N8H3	Missense_Mutation	SNP	ENST00000420890.2	hg19		.	.	.	.	.	.	.	.	.	.	C	11.13	1.546935	0.27652	.	.	ENSG00000163492	ENST00000420890;ENST00000343876;ENST00000295723	T;T;T	0.49139	0.79;1.35;1.34	5.71	-0.467	0.12150	.	0.737124	0.13245	N	0.402553	T	0.48077	0.1480	L	0.50333	1.59	0.09310	N	1	D;D	0.59767	0.986;0.958	P;P	0.54312	0.66;0.748	T	0.38023	-0.9680	10	0.87932	D	0	-1.0937	5.3175	0.15864	0.0:0.3511:0.1499:0.499	.	741;741	Q6ZP82;Q6ZP82-2	CC141_HUMAN;.	I	1316;760;741	ENSP00000395995:S1316I;ENSP00000344627:S760I;ENSP00000295723:S741I	ENSP00000295723:S741I	S	-	2	0	CCDC141	179410244	0.897000	0.30589	0.021000	0.16686	0.476000	0.33039	0.025000	0.13577	0.052000	0.16007	0.655000	0.94253	AGT	.	.		0.483	CCDC141-202	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_173648	
COL3A1	1281	hgsc.bcm.edu	37	2	189850437	189850437	+	Missense_Mutation	SNP	G	G	C			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr2:189850437G>C	ENST00000304636.3	+	4	550	c.380G>C	c.(379-381)gGa>gCa	p.G127A	COL3A1_ENST00000317840.5_Missense_Mutation_p.G127A	NM_000090.3	NP_000081	P02461	CO3A1_HUMAN	collagen, type III, alpha 1	127					aging (GO:0007568)|axon guidance (GO:0007411)|blood vessel development (GO:0001568)|cell-matrix adhesion (GO:0007160)|cellular response to amino acid stimulus (GO:0071230)|cerebral cortex development (GO:0021987)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|digestive tract development (GO:0048565)|extracellular fibril organization (GO:0043206)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|heart development (GO:0007507)|integrin-mediated signaling pathway (GO:0007229)|negative regulation of immune response (GO:0050777)|negative regulation of neuron migration (GO:2001223)|peptide cross-linking (GO:0018149)|platelet activation (GO:0030168)|positive regulation of Rho protein signal transduction (GO:0035025)|response to cytokine (GO:0034097)|response to mechanical stimulus (GO:0009612)|response to radiation (GO:0009314)|skeletal system development (GO:0001501)|skin development (GO:0043588)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing (GO:0042060)	collagen type III trimer (GO:0005586)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	extracellular matrix structural constituent (GO:0005201)|integrin binding (GO:0005178)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)			NS(2)|breast(1)|central_nervous_system(7)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(60)|ovary(4)|pancreas(1)|prostate(5)|skin(10)|upper_aerodigestive_tract(3)|urinary_tract(3)	126			OV - Ovarian serous cystadenocarcinoma(117;0.0106)|Epithelial(96;0.141)		Collagenase(DB00048)	GGTATTCCAGGACAACCAGGG	0.443																																					p.G127A		Atlas-SNP	.											.	COL3A1	292	.	0			c.G380C						.						41.0	44.0	43.0					2																	189850437		2203	4300	6503	SO:0001583	missense	1281	exon4			TTCCAGGACAACC	X15332	CCDS2297.1	2q32.2	2014-09-17	2008-06-23		ENSG00000168542	ENSG00000168542		"""Collagens"""	2201	protein-coding gene	gene with protein product		120180	"""Ehlers-Danlos syndrome type IV, autosomal dominant"""	EDS4A		2780304, 2834369	Standard	NM_000090		Approved		uc002uqj.1	P02461	OTTHUMG00000132648	ENST00000304636.3:c.380G>C	chr2.hg19:g.189850437G>C	ENSP00000304408:p.Gly127Ala	232.0	0.0		192.0	74.0	NM_000090	D2JYH5|D3DPH4|P78429|Q15112|Q16403|Q53S91|Q541P8|Q6LDB3|Q6LDJ2|Q6LDJ3|Q7KZ56|Q8N6U4|Q9UC88|Q9UC89|Q9UC90|Q9UC91|R4N3C5|V9GZI1	Missense_Mutation	SNP	ENST00000304636.3	hg19	CCDS2297.1	.	.	.	.	.	.	.	.	.	.	G	24.0	4.486957	0.84854	.	.	ENSG00000168542	ENST00000304636;ENST00000317840	D;D	0.99329	-5.75;-5.75	4.62	4.62	0.57501	.	0.000000	0.47455	D	0.000238	D	0.99504	0.9823	M	0.91768	3.24	0.49798	D	0.999828	D	0.89917	1.0	D	0.91635	0.999	D	0.98179	1.0456	10	0.87932	D	0	.	15.8159	0.78599	0.0:0.0:1.0:0.0	.	127	P02461	CO3A1_HUMAN	A	127	ENSP00000304408:G127A;ENSP00000315243:G127A	ENSP00000304408:G127A	G	+	2	0	COL3A1	189558682	1.000000	0.71417	0.997000	0.53966	0.976000	0.68499	9.010000	0.93611	2.414000	0.81942	0.313000	0.20887	GGA	.	.		0.443	COL3A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255899.3	NM_000090	
ESPNL	339768	hgsc.bcm.edu	37	2	239010624	239010624	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr2:239010624C>T	ENST00000343063.3	+	2	600	c.337C>T	c.(337-339)Cgt>Tgt	p.R113C	ESPNL_ENST00000409169.1_Missense_Mutation_p.R113C	NM_194312.2	NP_919288.2	Q6ZVH7	ESPNL_HUMAN	espin-like	113										endometrium(1)|lung(8)|pancreas(2)|skin(2)	13		Breast(86;7.61e-05)|Renal(207;0.00183)|Ovarian(221;0.0481)|all_hematologic(139;0.158)|all_lung(227;0.198)|Melanoma(123;0.203)|Hepatocellular(293;0.244)		Epithelial(121;4.71e-24)|OV - Ovarian serous cystadenocarcinoma(60;3.02e-12)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;5.63e-08)|BRCA - Breast invasive adenocarcinoma(100;0.000109)|Lung(119;0.0108)|LUSC - Lung squamous cell carcinoma(224;0.0253)		CCTGGCCGCCCGTTTTGGACA	0.697																																					p.R113C		Atlas-SNP	.											.	ESPNL	63	.	0			c.C337T						.						18.0	21.0	20.0					2																	239010624		2202	4299	6501	SO:0001583	missense	339768	exon2			GCCGCCCGTTTTG	AK124559	CCDS2525.1	2q37.3	2013-01-10			ENSG00000144488	ENSG00000144488		"""Ankyrin repeat domain containing"""	27937	protein-coding gene	gene with protein product						12975309	Standard	NM_194312		Approved	FLJ42568	uc002vxq.4	Q6ZVH7	OTTHUMG00000133335	ENST00000343063.3:c.337C>T	chr2.hg19:g.239010624C>T	ENSP00000339115:p.Arg113Cys	59.0	0.0		46.0	18.0	NM_194312	Q66K27|Q6ZVG1|Q8IVU2	Missense_Mutation	SNP	ENST00000343063.3	hg19	CCDS2525.1	.	.	.	.	.	.	.	.	.	.	C	24.2	4.500345	0.85176	.	.	ENSG00000144488	ENST00000343063;ENST00000409169	T;T	0.66460	-0.21;-0.21	4.45	4.45	0.53987	Ankyrin repeat-containing domain (4);	0.099656	0.40302	U	0.001123	T	0.77425	0.4128	L	0.54908	1.71	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.79490	-0.1782	10	0.62326	D	0.03	-35.566	14.0307	0.64613	0.0:1.0:0.0:0.0	.	113	Q6ZVH7	ESPNL_HUMAN	C	113	ENSP00000339115:R113C;ENSP00000386577:R113C	ENSP00000339115:R113C	R	+	1	0	ESPNL	238675363	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	2.561000	0.45905	2.039000	0.60335	0.484000	0.47621	CGT	.	.		0.697	ESPNL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257164.2	NM_194312	
HDLBP	3069	hgsc.bcm.edu	37	2	242202212	242202212	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr2:242202212C>T	ENST00000391975.1	-	5	591	c.364G>A	c.(364-366)Gac>Aac	p.D122N	HDLBP_ENST00000391976.2_Missense_Mutation_p.D122N|HDLBP_ENST00000310931.4_Missense_Mutation_p.D122N|HDLBP_ENST00000427183.2_Missense_Mutation_p.D158N	NM_203346.3	NP_976221	Q00341	VIGLN_HUMAN	high density lipoprotein binding protein	122					cholesterol metabolic process (GO:0008203)|lipid transport (GO:0006869)	cytoplasm (GO:0005737)|high-density lipoprotein particle (GO:0034364)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	lipid binding (GO:0008289)|poly(A) RNA binding (GO:0044822)			breast(7)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(11)|lung(8)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	44		all_cancers(19;7.77e-41)|all_epithelial(40;1.74e-18)|Breast(86;1.53e-05)|Renal(207;0.00179)|all_lung(227;0.00338)|Ovarian(221;0.00556)|Lung NSC(271;0.0121)|Esophageal squamous(248;0.129)|all_hematologic(139;0.158)|Melanoma(123;0.16)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;8.13e-34)|all cancers(36;4.71e-31)|OV - Ovarian serous cystadenocarcinoma(60;2.34e-15)|Kidney(56;3.72e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.76e-08)|BRCA - Breast invasive adenocarcinoma(100;3.38e-06)|Lung(119;0.000109)|LUSC - Lung squamous cell carcinoma(224;0.000964)|Colorectal(34;0.0132)|COAD - Colon adenocarcinoma(134;0.0928)		AGGCCTTGGTCTTTGGCCAAA	0.488																																					p.D158N		Atlas-SNP	.											.	HDLBP	118	.	0			c.G472A						.						214.0	180.0	191.0					2																	242202212		2203	4300	6503	SO:0001583	missense	3069	exon6			CTTGGTCTTTGGC		CCDS2547.1, CCDS58760.1	2q37.3	2008-07-18	2008-07-18		ENSG00000115677	ENSG00000115677			4857	protein-coding gene	gene with protein product		142695	"""vigilin"""	VGL		1318310, 8390966	Standard	NM_005336		Approved	HBP	uc002waz.3	Q00341	OTTHUMG00000133391	ENST00000391975.1:c.364G>A	chr2.hg19:g.242202212C>T	ENSP00000375836:p.Asp122Asn	130.0	0.0		96.0	38.0	NM_001243900	B4DTQ2|E7EM71|Q53QU2|Q9UCY3	Missense_Mutation	SNP	ENST00000391975.1	hg19	CCDS2547.1	.	.	.	.	.	.	.	.	.	.	C	32	5.168116	0.94768	.	.	ENSG00000115677	ENST00000391975;ENST00000391976;ENST00000310931;ENST00000427183;ENST00000422933;ENST00000428482;ENST00000452065;ENST00000444092;ENST00000430918;ENST00000441124	T;T;T;T;T;T;T;T;T;T	0.62941	2.32;2.32;2.32;2.2;1.28;0.69;-0.01;0.08;0.08;0.1	5.93	5.06	0.68205	.	0.000000	0.85682	D	0.000000	T	0.73938	0.3651	L	0.53780	1.695	0.80722	D	1	P;D	0.89917	0.614;1.0	P;D	0.97110	0.474;1.0	T	0.71457	-0.4587	10	0.27785	T	0.31	-47.1993	15.192	0.73053	0.0:0.9329:0.0:0.0671	.	158;122	E7EM71;Q00341	.;VIGLN_HUMAN	N	122;122;122;158;122;122;122;122;122;122	ENSP00000375836:D122N;ENSP00000375837:D122N;ENSP00000312042:D122N;ENSP00000399139:D158N;ENSP00000403807:D122N;ENSP00000405109:D122N;ENSP00000387782:D122N;ENSP00000416559:D122N;ENSP00000403913:D122N;ENSP00000396964:D122N	ENSP00000312042:D122N	D	-	1	0	HDLBP	241850885	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.755000	0.85180	1.538000	0.49270	0.655000	0.94253	GAC	.	.		0.488	HDLBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257245.5	NM_203346	
SCN10A	6336	hgsc.bcm.edu	37	3	38743417	38743417	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr3:38743417C>A	ENST00000449082.2	-	26	4569	c.4570G>T	c.(4570-4572)Gtc>Ttc	p.V1524F		NM_006514.2	NP_006505.2	Q9Y5Y9	SCNAA_HUMAN	sodium channel, voltage-gated, type X, alpha subunit	1524					AV node cell to bundle of His cell communication (GO:0086067)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of cardiac muscle contraction (GO:0055117)|regulation of heart rate (GO:0002027)|regulation of ion transmembrane transport (GO:0034765)|sensory perception (GO:0007600)|sensory perception of pain (GO:0019233)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	C-fiber (GO:0044299)|extracellular vesicular exosome (GO:0070062)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(5)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(14)|kidney(5)|large_intestine(33)|lung(54)|ovary(5)|pancreas(1)|prostate(5)|skin(13)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	150				KIRC - Kidney renal clear cell carcinoma(284;0.0769)|Kidney(284;0.0945)	Benzocaine(DB01086)|Bupivacaine(DB00297)|Chloroprocaine(DB01161)|Cinchocaine(DB00527)|Cocaine(DB00907)|Dyclonine(DB00645)|Hexylcaine(DB00473)|Lacosamide(DB06218)|Levobupivacaine(DB01002)|Lidocaine(DB00281)|Mepivacaine(DB00961)|Orphenadrine(DB01173)|Oxybuprocaine(DB00892)|Procaine(DB00721)|Proparacaine(DB00807)|Ropivacaine(DB00296)|Valproic Acid(DB00313)	ATCTTCATGACACATTCGCCT	0.458																																					p.V1524F		Atlas-SNP	.											.	SCN10A	359	.	0			c.G4570T						.						151.0	126.0	135.0					3																	38743417		2203	4300	6503	SO:0001583	missense	6336	exon26			TCATGACACATTC	AF117907	CCDS33736.1	3p22.2	2012-02-26	2007-01-23		ENSG00000185313	ENSG00000185313		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10582	protein-coding gene	gene with protein product		604427	"""sodium channel, voltage-gated, type X, alpha polypeptide"""			9839820, 10198179, 16382098	Standard	NM_006514		Approved	Nav1.8, hPN3, SNS, PN3	uc003ciq.3	Q9Y5Y9	OTTHUMG00000048245	ENST00000449082.2:c.4570G>T	chr3.hg19:g.38743417C>A	ENSP00000390600:p.Val1524Phe	111.0	0.0		97.0	28.0	NM_006514	A6NDQ1	Missense_Mutation	SNP	ENST00000449082.2	hg19	CCDS33736.1	.	.	.	.	.	.	.	.	.	.	C	17.13	3.311079	0.60414	.	.	ENSG00000185313	ENST00000449082	D	0.98807	-5.15	4.96	4.06	0.47325	Ion transport (1);	0.224065	0.38663	N	0.001603	D	0.98757	0.9582	M	0.64630	1.985	0.42012	D	0.990943	D	0.76494	0.999	D	0.74348	0.983	D	0.99881	1.1113	10	0.87932	D	0	.	15.1927	0.73060	0.0:0.8585:0.1415:0.0	.	1524	Q9Y5Y9	SCNAA_HUMAN	F	1524	ENSP00000390600:V1524F	ENSP00000390600:V1524F	V	-	1	0	SCN10A	38718421	0.319000	0.24607	0.994000	0.49952	0.978000	0.69477	0.651000	0.24873	1.261000	0.44149	0.557000	0.71058	GTC	.	.		0.458	SCN10A-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109745.3	NM_006514	
CCDC13	152206	hgsc.bcm.edu	37	3	42750569	42750569	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr3:42750569C>A	ENST00000310232.6	-	16	2134	c.2051G>T	c.(2050-2052)gGa>gTa	p.G684V	HHATL-AS1_ENST00000600839.1_RNA	NM_144719.3	NP_653320.3	Q8IYE1	CCD13_HUMAN	coiled-coil domain containing 13	684										endometrium(1)|kidney(1)|large_intestine(5)|liver(1)|lung(11)|ovary(1)|prostate(3)|skin(1)|urinary_tract(1)	25						CTCCTCCTTTCCCCGCAGGGC	0.587																																					p.G684V		Atlas-SNP	.											.	CCDC13	71	.	0			c.G2051T						.						93.0	81.0	85.0					3																	42750569		2203	4300	6503	SO:0001583	missense	152206	exon16			TCCTTTCCCCGCA	AK058196	CCDS2705.1	3p22.1	2005-01-25			ENSG00000244607	ENSG00000244607			26358	protein-coding gene	gene with protein product						12477932	Standard	NM_144719		Approved	FLJ25467	uc003cly.4	Q8IYE1	OTTHUMG00000133046	ENST00000310232.6:c.2051G>T	chr3.hg19:g.42750569C>A	ENSP00000309836:p.Gly684Val	82.0	0.0		60.0	19.0	NM_144719		Missense_Mutation	SNP	ENST00000310232.6	hg19	CCDS2705.1	.	.	.	.	.	.	.	.	.	.	C	9.128	1.010651	0.19277	.	.	ENSG00000244607	ENST00000310232	T	0.23754	1.89	4.58	3.63	0.41609	.	0.474521	0.20779	N	0.085822	T	0.14787	0.0357	L	0.36672	1.1	0.28566	N	0.910859	B	0.27882	0.192	B	0.24541	0.054	T	0.06534	-1.0821	10	0.31617	T	0.26	.	1.6896	0.02849	0.2154:0.4638:0.1796:0.1412	.	684	Q8IYE1	CCD13_HUMAN	V	684	ENSP00000309836:G684V	ENSP00000309836:G684V	G	-	2	0	CCDC13	42725573	0.003000	0.15002	0.967000	0.41034	0.991000	0.79684	0.212000	0.17497	2.374000	0.81015	0.563000	0.77884	GGA	.	.		0.587	CCDC13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256652.1	NM_144719	
CCDC71	64925	hgsc.bcm.edu	37	3	49201424	49201424	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr3:49201424T>C	ENST00000321895.6	-	2	324	c.218A>G	c.(217-219)tAt>tGt	p.Y73C		NM_022903.3	NP_075054.3	Q8IV32	CCD71_HUMAN	coiled-coil domain containing 71	73										endometrium(1)|large_intestine(4)|lung(3)|ovary(1)|prostate(1)	10				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00217)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)		GCATGAACTATAGCCATAGAC	0.582																																					p.Y73C		Atlas-SNP	.											.	CCDC71	33	.	0			c.A218G						.						109.0	88.0	95.0					3																	49201424		2203	4300	6503	SO:0001583	missense	64925	exon2			GAACTATAGCCAT	AK022862	CCDS2790.1	3p21.31	2014-02-12			ENSG00000177352	ENSG00000177352			25760	protein-coding gene	gene with protein product						12477932	Standard	NM_022903		Approved	FLJ12800	uc003cwg.4	Q8IV32	OTTHUMG00000156815	ENST00000321895.6:c.218A>G	chr3.hg19:g.49201424T>C	ENSP00000319006:p.Tyr73Cys	164.0	0.0		116.0	44.0	NM_022903	Q6IPE2|Q9H8H4|Q9H9F1	Missense_Mutation	SNP	ENST00000321895.6	hg19	CCDS2790.1	.	.	.	.	.	.	.	.	.	.	T	16.07	3.018752	0.54576	.	.	ENSG00000177352	ENST00000321895	T	0.67698	-0.28	5.83	5.83	0.93111	.	0.000000	0.64402	D	0.000003	T	0.80844	0.4701	M	0.68952	2.095	0.58432	D	0.999992	D	0.89917	1.0	D	0.91635	0.999	T	0.82762	-0.0297	10	0.87932	D	0	-5.2511	16.1997	0.82060	0.0:0.0:0.0:1.0	.	73	Q8IV32	CCD71_HUMAN	C	73	ENSP00000319006:Y73C	ENSP00000319006:Y73C	Y	-	2	0	CCDC71	49176428	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.204000	0.77872	2.240000	0.73641	0.528000	0.53228	TAT	.	.		0.582	CCDC71-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345980.1	NM_022903	
RNF123	63891	hgsc.bcm.edu	37	3	49744294	49744294	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr3:49744294G>T	ENST00000327697.6	+	26	2603	c.2459G>T	c.(2458-2460)cGc>cTc	p.R820L	RNF123_ENST00000432042.1_Missense_Mutation_p.R674L	NM_022064.3	NP_071347.2	Q5XPI4	RN123_HUMAN	ring finger protein 123	820					protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			NS(1)|breast(4)|cervix(2)|endometrium(4)|kidney(4)|large_intestine(6)|lung(11)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	38				BRCA - Breast invasive adenocarcinoma(193;4.71e-05)|Kidney(197;0.00227)|KIRC - Kidney renal clear cell carcinoma(197;0.00255)		CACCTGAGCCGCCGTCTTGCC	0.567																																					p.R820L		Atlas-SNP	.											.	RNF123	100	.	0			c.G2459T						.						151.0	125.0	134.0					3																	49744294		2203	4300	6503	SO:0001583	missense	63891	exon26			TGAGCCGCCGTCT	AK022627	CCDS33758.1	3p24.3	2008-02-05			ENSG00000164068	ENSG00000164068		"""RING-type (C3HC4) zinc fingers"""	21148	protein-coding gene	gene with protein product		614472					Standard	NM_022064		Approved	FLJ12565	uc003cxh.4	Q5XPI4	OTTHUMG00000156891	ENST00000327697.6:c.2459G>T	chr3.hg19:g.49744294G>T	ENSP00000328287:p.Arg820Leu	115.0	0.0		92.0	25.0	NM_022064	A1L4Q3|A6NLS5|Q5I022|Q6PFW4|Q71RH0|Q8IW18|Q9H0M8|Q9H5L8|Q9H9T2	Missense_Mutation	SNP	ENST00000327697.6	hg19	CCDS33758.1	.	.	.	.	.	.	.	.	.	.	G	25.1	4.602678	0.87157	.	.	ENSG00000164068	ENST00000327697;ENST00000389066;ENST00000432042	D;D	0.94897	-2.95;-3.55	5.3	5.3	0.74995	.	0.162806	0.41294	D	0.000912	D	0.95300	0.8475	L	0.32530	0.975	0.80722	D	1	D;D	0.63880	0.993;0.993	D;D	0.74023	0.982;0.982	D	0.95987	0.8982	10	0.87932	D	0	-22.7933	16.0911	0.81090	0.0:0.0:1.0:0.0	.	674;820	C9J266;Q5XPI4	.;RN123_HUMAN	L	820;820;674	ENSP00000328287:R820L;ENSP00000392443:R674L	ENSP00000328287:R820L	R	+	2	0	RNF123	49719298	1.000000	0.71417	1.000000	0.80357	0.660000	0.38997	8.678000	0.91211	2.460000	0.83146	0.491000	0.48974	CGC	.	.		0.567	RNF123-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346475.2	NM_022064	
NPHP3	27031	hgsc.bcm.edu	37	3	132438610	132438610	+	Missense_Mutation	SNP	T	T	G			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr3:132438610T>G	ENST00000337331.5	-	2	544	c.458A>C	c.(457-459)cAa>cCa	p.Q153P	NPHP3-AS1_ENST00000489343.1_RNA|NPHP3_ENST00000343113.4_Missense_Mutation_p.Q153P|NPHP3_ENST00000326682.8_Missense_Mutation_p.Q153P|NPHP3_ENST00000476742.1_5'Flank|NPHP3-AS1_ENST00000504440.1_RNA	NM_153240.4	NP_694972.3	Q7Z494	NPHP3_HUMAN	nephronophthisis 3 (adolescent)	153					atrial septum development (GO:0003283)|cilium morphogenesis (GO:0060271)|convergent extension involved in gastrulation (GO:0060027)|determination of intestine left/right asymmetry (GO:0071908)|determination of left/right symmetry (GO:0007368)|determination of liver left/right asymmetry (GO:0071910)|determination of pancreatic left/right asymmetry (GO:0035469)|determination of stomach left/right asymmetry (GO:0071909)|epithelial cilium movement involved in determination of left/right asymmetry (GO:0060287)|establishment or maintenance of cell polarity (GO:0007163)|extracellular matrix organization (GO:0030198)|heart looping (GO:0001947)|kidney development (GO:0001822)|kidney morphogenesis (GO:0060993)|lipid metabolic process (GO:0006629)|lung development (GO:0030324)|maintenance of organ identity (GO:0048496)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|photoreceptor cell maintenance (GO:0045494)|regulation of cAMP metabolic process (GO:0030814)|regulation of planar cell polarity pathway involved in neural tube closure (GO:2000167)|regulation of Wnt signaling pathway, planar cell polarity pathway (GO:2000095)|ureter development (GO:0072189)|Wnt signaling pathway (GO:0016055)	cilium (GO:0005929)|primary cilium (GO:0072372)				NS(1)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(5)|lung(15)|ovary(2)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	42						CTCCATTGCTTGGTATTTCGC	0.333																																					p.Q153P		Atlas-SNP	.											.	NPHP3	110	.	0			c.A458C						.						149.0	141.0	144.0					3																	132438610		2203	4299	6502	SO:0001583	missense	27031	exon2			ATTGCTTGGTATT	AB056657	CCDS3078.1	3q22	2014-07-18			ENSG00000113971	ENSG00000113971		"""Tetratricopeptide (TTC) repeat domain containing"""	7907	protein-coding gene	gene with protein product	"""nephrocystin-3"", ""Meckel syndrome, type 7"", ""cilia and flagella associated protein 31"""	608002				12872122, 15381417	Standard	NM_153240		Approved	NPH3, KIAA2000, FLJ30691, FLJ36696, MKS7, SLSN3, CFAP31	uc003epe.2	Q7Z494	OTTHUMG00000159713	ENST00000337331.5:c.458A>C	chr3.hg19:g.132438610T>G	ENSP00000338766:p.Gln153Pro	107.0	0.0		64.0	28.0	NM_153240	Q5JPE3|Q5JPE6|Q68D99|Q6NVH3|Q7Z492|Q7Z493|Q8N9R2|Q8NCM5|Q96N70|Q96NK2	Missense_Mutation	SNP	ENST00000337331.5	hg19	CCDS3078.1	.	.	.	.	.	.	.	.	.	.	T	23.8	4.453686	0.84209	.	.	ENSG00000113971	ENST00000326682;ENST00000337331;ENST00000343113	D;D;D	0.93763	-3.28;-3.23;-2.01	5.54	5.54	0.83059	.	0.000000	0.85682	D	0.000000	D	0.94568	0.8250	L	0.32530	0.975	0.80722	D	1	D	0.76494	0.999	D	0.83275	0.996	D	0.95442	0.8526	10	0.87932	D	0	-21.2615	15.689	0.77436	0.0:0.0:0.0:1.0	.	153	Q7Z494	NPHP3_HUMAN	P	153	ENSP00000319909:Q153P;ENSP00000338766:Q153P;ENSP00000344802:Q153P	ENSP00000319909:Q153P	Q	-	2	0	NPHP3	133921300	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.040000	0.89188	2.102000	0.63906	0.455000	0.32223	CAA	.	.		0.333	NPHP3-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357020.2	NM_153240	
SMC4	10051	hgsc.bcm.edu	37	3	160134114	160134114	+	Nonsense_Mutation	SNP	G	G	T			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr3:160134114G>T	ENST00000357388.3	+	10	1799	c.1348G>T	c.(1348-1350)Gag>Tag	p.E450*	SMC4_ENST00000344722.5_Nonsense_Mutation_p.E450*|SMC4_ENST00000360111.2_Nonsense_Mutation_p.E450*|RP11-432B6.3_ENST00000483754.1_Intron|SMC4_ENST00000462787.1_Nonsense_Mutation_p.E450*|SMC4_ENST00000469762.1_Nonsense_Mutation_p.E425*	NM_001002800.1	NP_001002800.1	Q9NTJ3	SMC4_HUMAN	structural maintenance of chromosomes 4	450					kinetochore organization (GO:0051383)|meiotic chromosome condensation (GO:0010032)|meiotic chromosome segregation (GO:0045132)|mitotic cell cycle (GO:0000278)|mitotic chromosome condensation (GO:0007076)|mitotic sister chromatid segregation (GO:0000070)	condensin complex (GO:0000796)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein heterodimerization activity (GO:0046982)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(15)|lung(20)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	48			Lung(72;0.00334)|LUSC - Lung squamous cell carcinoma(72;0.00523)			CAATGCCCTCGAGAAGGAAAA	0.313																																					p.E450X		Atlas-SNP	.											.	SMC4	135	.	0			c.G1348T						.						57.0	63.0	61.0					3																	160134114		2201	4291	6492	SO:0001587	stop_gained	10051	exon9			GCCCTCGAGAAGG	AF092564	CCDS3189.1, CCDS75046.1	3q26.1	2006-07-06	2006-07-06	2006-07-06	ENSG00000113810	ENSG00000113810		"""Structural maintenance of chromosomes proteins"""	14013	protein-coding gene	gene with protein product		605575	"""SMC4 (structural maintenance of chromosomes 4, yeast)-like 1"", ""SMC4 structural maintenance of chromosomes 4-like 1 (yeast)"""	SMC4L1		9789013, 10319587	Standard	NM_005496		Approved	hCAP-C, CAP-C	uc003fdh.3	Q9NTJ3	OTTHUMG00000159006	ENST00000357388.3:c.1348G>T	chr3.hg19:g.160134114G>T	ENSP00000349961:p.Glu450*	374.0	0.0		306.0	119.0	NM_005496	A6NLT9|D3DNL8|O95752|Q8NDL4|Q9UNT9	Nonsense_Mutation	SNP	ENST00000357388.3	hg19	CCDS3189.1	.	.	.	.	.	.	.	.	.	.	G	37	6.020685	0.97211	.	.	ENSG00000113810	ENST00000357388;ENST00000360111;ENST00000469762;ENST00000462787;ENST00000344722;ENST00000545277	.	.	.	6.07	5.2	0.72013	.	0.087770	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.30854	T	0.27	-22.4133	16.5359	0.84373	0.0:0.0:0.8682:0.1318	.	.	.	.	X	450;450;425;450;450;44	.	ENSP00000341382:E450X	E	+	1	0	SMC4	161616808	1.000000	0.71417	0.977000	0.42913	0.135000	0.20990	6.667000	0.74451	1.567000	0.49668	-0.169000	0.13324	GAG	.	.		0.313	SMC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352862.1		
KLHL6	89857	hgsc.bcm.edu	37	3	183210427	183210427	+	Silent	SNP	G	G	T			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr3:183210427G>T	ENST00000341319.3	-	6	1454	c.1419C>A	c.(1417-1419)atC>atA	p.I473I		NM_130446.2	NP_569713.2	Q8WZ60	KLHL6_HUMAN	kelch-like family member 6	473					B cell receptor signaling pathway (GO:0050853)|germinal center formation (GO:0002467)					breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(7)|kidney(1)|large_intestine(6)|liver(1)|lung(16)|ovary(2)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	44	all_cancers(143;9.2e-12)|Ovarian(172;0.0172)		all cancers(12;1.29e-44)|Epithelial(37;1.24e-38)|LUSC - Lung squamous cell carcinoma(7;2.58e-24)|Lung(8;1.79e-22)|OV - Ovarian serous cystadenocarcinoma(80;2.32e-22)			GCCCTCCCCCGATCACATACA	0.557																																					p.I473I		Atlas-SNP	.											.	KLHL6	100	.	0			c.C1419A						.						164.0	135.0	145.0					3																	183210427		2203	4300	6503	SO:0001819	synonymous_variant	89857	exon6			TCCCCCGATCACA	AF441792	CCDS3245.2	3q27.3	2013-01-30	2013-01-30		ENSG00000172578	ENSG00000172578		"""Kelch-like"", ""BTB/POZ domain containing"""	18653	protein-coding gene	gene with protein product	"""kelch-like protein KLHL6"""	614214	"""kelch-like 6 (Drosophila)"""			11214971, 12617994	Standard	NM_130446		Approved	FLJ00029	uc003flr.3	Q8WZ60	OTTHUMG00000148673	ENST00000341319.3:c.1419C>A	chr3.hg19:g.183210427G>T		160.0	0.0		118.0	31.0	NM_130446	B2RB31|D3DNS8|Q8N5I1|Q8N892	Silent	SNP	ENST00000341319.3	hg19	CCDS3245.2																																																																																			.	.		0.557	KLHL6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000309024.1	NM_130446	
TMPRSS11BNL	401136	hgsc.bcm.edu	37	4	69057145	69057145	+	Silent	SNP	A	A	G			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr4:69057145A>G	ENST00000432593.3	-	3	388	c.222T>C	c.(220-222)ctT>ctC	p.L74L	RP11-646E20.6_ENST00000510782.1_RNA|FTLP10_ENST00000503647.1_RNA					TMPRSS11B N-terminal like, pseudogene											autonomic_ganglia(1)	1						GAATTTGGCTAAGATAGTTAT	0.313																																					p.L74L		Atlas-SNP	.											.	TMPRSS11BNL	4	.	0			c.T222C						.						159.0	139.0	145.0					4																	69057145		692	1590	2282	SO:0001819	synonymous_variant	401136	exon3			TTGGCTAAGATAG			4q13.2	2014-05-09	2014-05-08		ENSG00000226894	ENSG00000250026			37262	pseudogene	pseudogene			"""TMPRSS11B N terminal-like"", ""TMPRSS11B N-terminal like"""				Standard	NR_104048		Approved	FLJ41562	uc003hdv.1		OTTHUMG00000160802	ENST00000432593.3:c.222T>C	chr4.hg19:g.69057145A>G		50.0	0.0		42.0	8.0	NM_001129907		Silent	SNP	ENST00000432593.3	hg19	CCDS47066.1																																																																																			.	.		0.313	TMPRSS11BNL-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001129907	
PLEKHG4B	153478	hgsc.bcm.edu	37	5	143613	143613	+	Silent	SNP	C	C	A			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr5:143613C>A	ENST00000283426.6	+	3	788	c.738C>A	c.(736-738)atC>atA	p.I246I	Y_RNA_ENST00000362670.1_RNA	NM_052909.3	NP_443141.3	Q96PX9	PKH4B_HUMAN	pleckstrin homology domain containing, family G (with RhoGef domain) member 4B	246							Rho guanyl-nucleotide exchange factor activity (GO:0005089)			endometrium(1)|large_intestine(2)|lung(2)|prostate(3)|skin(3)	11			all cancers(22;0.0253)|Lung(60;0.113)	Kidney(1;0.119)		TCCATAGCATCCCCAGGTGGG	0.662																																					p.I246I		Atlas-SNP	.											.	PLEKHG4B	167	.	0			c.C738A						.						44.0	46.0	45.0					5																	143613		2202	4298	6500	SO:0001819	synonymous_variant	153478	exon3			TAGCATCCCCAGG	BC008352	CCDS34124.1	5p15.33	2013-01-11			ENSG00000153404	ENSG00000153404		"""Pleckstrin homology (PH) domain containing"""	29399	protein-coding gene	gene with protein product						11572484	Standard	NM_052909		Approved	KIAA1909	uc003jak.2	Q96PX9	OTTHUMG00000161570	ENST00000283426.6:c.738C>A	chr5.hg19:g.143613C>A		74.0	0.0		64.0	15.0	NM_052909		Silent	SNP	ENST00000283426.6	hg19	CCDS34124.1																																																																																			.	.		0.662	PLEKHG4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365359.1	NM_052909	
SLC6A3	6531	hgsc.bcm.edu	37	5	1411361	1411361	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr5:1411361G>T	ENST00000270349.9	-	9	1393	c.1266C>A	c.(1264-1266)agC>agA	p.S422R	SLC6A3_ENST00000453492.2_Missense_Mutation_p.S422R	NM_001044.4	NP_001035.1	Q01959	SC6A3_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 3	422					adenohypophysis development (GO:0021984)|aging (GO:0007568)|cation transmembrane transport (GO:0098655)|cell death (GO:0008219)|dopamine biosynthetic process (GO:0042416)|dopamine catabolic process (GO:0042420)|dopamine transport (GO:0015872)|lactation (GO:0007595)|locomotory behavior (GO:0007626)|monoamine transport (GO:0015844)|neurotransmitter biosynthetic process (GO:0042136)|positive regulation of multicellular organism growth (GO:0040018)|prepulse inhibition (GO:0060134)|regulation of dopamine metabolic process (GO:0042053)|response to cAMP (GO:0051591)|response to cocaine (GO:0042220)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to iron ion (GO:0010039)|response to nicotine (GO:0035094)|sensory perception of smell (GO:0007608)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	axon (GO:0030424)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	dopamine binding (GO:0035240)|dopamine transmembrane transporter activity (GO:0005329)|dopamine:sodium symporter activity (GO:0005330)|drug binding (GO:0008144)|monoamine transmembrane transporter activity (GO:0008504)			breast(2)|endometrium(4)|kidney(1)|large_intestine(3)|lung(19)|ovary(4)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	38			OV - Ovarian serous cystadenocarcinoma(19;0.00928)|all cancers(22;0.0262)		Amoxapine(DB00543)|Amphetamine(DB00182)|Atomoxetine(DB00289)|Benzatropine(DB00245)|Benzphetamine(DB00865)|Bupropion(DB01156)|Chloroprocaine(DB01161)|Chlorphenamine(DB01114)|Citalopram(DB00215)|Cocaine(DB00907)|Dexmethylphenidate(DB06701)|Dextroamphetamine(DB01576)|Diethylpropion(DB00937)|Diphenylpyraline(DB01146)|Dopamine(DB00988)|Duloxetine(DB00476)|Ephedra(DB01363)|Escitalopram(DB01175)|Fencamfamine(DB01463)|Imipramine(DB00458)|Ioflupane I 123(DB08824)|Lisdexamfetamine(DB01255)|Loxapine(DB00408)|Mazindol(DB00579)|Methamphetamine(DB01577)|Methylphenidate(DB00422)|Mianserin(DB06148)|Mirtazapine(DB00370)|Modafinil(DB00745)|Nefazodone(DB01149)|Pethidine(DB00454)|Phenmetrazine(DB00830)|Phentermine(DB00191)|Procaine(DB00721)|Pseudoephedrine(DB00852)|Sertraline(DB01104)|Sibutramine(DB01105)|Trimipramine(DB00726)|Venlafaxine(DB00285)	TACTCACGGCGCTGTCGATAC	0.647																																					p.S422R		Atlas-SNP	.											SLC6A3,colon,carcinoma,0,2	SLC6A3	102	.	0			c.C1266A						.						70.0	55.0	60.0					5																	1411361		2117	4150	6267	SO:0001583	missense	6531	exon9			CACGGCGCTGTCG		CCDS3863.1	5p15.3	2013-07-19	2013-07-19		ENSG00000142319	ENSG00000142319		"""Solute carriers"""	11049	protein-coding gene	gene with protein product	"""dopamine transporter"""	126455	"""solute carrier family 6 (neurotransmitter transporter, dopamine), member 3"", ""dopamine transporter 1"""	DAT1		1406597	Standard	NM_001044		Approved	DAT	uc003jck.3	Q01959	OTTHUMG00000131016	ENST00000270349.9:c.1266C>A	chr5.hg19:g.1411361G>T	ENSP00000270349:p.Ser422Arg	54.0	0.0		41.0	26.0	NM_001044	A2RUN4|Q14996	Missense_Mutation	SNP	ENST00000270349.9	hg19	CCDS3863.1	.	.	.	.	.	.	.	.	.	.	G	10.12	1.264169	0.23136	.	.	ENSG00000142319	ENST00000270349;ENST00000453492	T;T	0.81163	-1.46;-1.46	4.5	-9.01	0.00744	.	0.000000	0.85682	D	0.000000	D	0.91975	0.7458	H	0.98218	4.175	0.39335	D	0.965488	D	0.65815	0.995	D	0.74674	0.984	D	0.94058	0.7324	10	0.87932	D	0	.	20.113	0.97915	0.8189:0.0:0.1811:0.0	.	422	Q01959	SC6A3_HUMAN	R	422	ENSP00000270349:S422R;ENSP00000399806:S422R	ENSP00000270349:S422R	S	-	3	2	SLC6A3	1464361	0.004000	0.15560	0.020000	0.16555	0.120000	0.20174	-0.956000	0.03865	-3.115000	0.00240	-2.612000	0.00159	AGC	.	.		0.647	SLC6A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253650.3	NM_001044	
EGFLAM	133584	hgsc.bcm.edu	37	5	38438475	38438475	+	Silent	SNP	C	C	T			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr5:38438475C>T	ENST00000354891.3	+	17	2728	c.2382C>T	c.(2380-2382)gcC>gcT	p.A794A	EGFLAM_ENST00000397202.2_Silent_p.A160A|EGFLAM_ENST00000322350.5_Silent_p.A794A|EGFLAM_ENST00000336740.6_Silent_p.A560A	NM_001205301.1	NP_001192230.1	Q63HQ2	EGFLA_HUMAN	EGF-like, fibronectin type III and laminin G domains	794	EGF-like 3. {ECO:0000255|PROSITE- ProRule:PRU00076}.				extracellular matrix organization (GO:0030198)|peptide cross-linking via chondroitin 4-sulfate glycosaminoglycan (GO:0019800)|positive regulation of cell-substrate adhesion (GO:0010811)	basement membrane (GO:0005604)|cell junction (GO:0030054)|interstitial matrix (GO:0005614)|synapse (GO:0045202)	glycosaminoglycan binding (GO:0005539)			NS(1)|breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(43)|ovary(1)|pancreas(3)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	85	all_lung(31;0.000385)					CCCCTTGTGCCCATGGGGGCA	0.592																																					p.A794A	Colon(62;485 1295 3347 17454)	Atlas-SNP	.											.	EGFLAM	302	.	0			c.C2382T						.						43.0	45.0	44.0					5																	38438475		2203	4300	6503	SO:0001819	synonymous_variant	133584	exon17			TTGTGCCCATGGG	AK097549	CCDS3924.1, CCDS3925.1, CCDS47199.1, CCDS56363.1	5p13.2-p13.1	2014-04-03			ENSG00000164318	ENSG00000164318		"""Fibronectin type III domain containing"""	26810	protein-coding gene	gene with protein product	"""pikachurin"", ""agrin-like"""					18641643, 20078962, 22760553	Standard	NM_182801		Approved	FLJ39155, AGRINL, AGRNL, PIKA	uc003jlc.2	Q63HQ2	OTTHUMG00000131139	ENST00000354891.3:c.2382C>T	chr5.hg19:g.38438475C>T		151.0	0.0		177.0	104.0	NM_001205301	A8K6D7|Q5U643|Q6P3V1|Q8N124|Q8N197|Q8N7Y0|Q8N8N5|Q8NAL2	Silent	SNP	ENST00000354891.3	hg19	CCDS56363.1																																																																																			.	.		0.592	EGFLAM-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000367323.1	NM_152403	
PTGER4	5734	hgsc.bcm.edu	37	5	40692406	40692406	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr5:40692406C>A	ENST00000302472.3	+	3	2417	c.1393C>A	c.(1393-1395)Cct>Act	p.P465T		NM_000958.2	NP_000949.1	P35408	PE2R4_HUMAN	prostaglandin E receptor 4 (subtype EP4)	465				GPA -> WAC (in Ref. 2; AAA36438). {ECO:0000305}.	adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|bone development (GO:0060348)|cellular response to mechanical stimulus (GO:0071260)|ERK1 and ERK2 cascade (GO:0070371)|immune response (GO:0006955)|JNK cascade (GO:0007254)|negative regulation of cytokine secretion (GO:0050710)|negative regulation of eosinophil extravasation (GO:2000420)|negative regulation of inflammatory response (GO:0050728)|negative regulation of integrin activation (GO:0033624)|positive regulation of cytokine secretion (GO:0050715)|positive regulation of inflammatory response (GO:0050729)|regulation of ossification (GO:0030278)|regulation of stress fiber assembly (GO:0051492)|response to lipopolysaccharide (GO:0032496)|response to mechanical stimulus (GO:0009612)|T-helper cell differentiation (GO:0042093)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	prostaglandin E receptor activity (GO:0004957)			breast(1)|endometrium(3)|liver(1)|lung(13)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	23					Dinoprostone(DB00917)|Misoprostol(DB00929)	CAGGGCTGGGCCTGCCCCTAA	0.498																																					p.P465T		Atlas-SNP	.											.	PTGER4	49	.	0			c.C1393A						.						30.0	32.0	31.0					5																	40692406		2203	4300	6503	SO:0001583	missense	5734	exon3			GCTGGGCCTGCCC	L28175	CCDS3930.1	5p13.1	2012-08-08			ENSG00000171522	ENSG00000171522		"""GPCR / Class A : Prostanoid receptors"""	9596	protein-coding gene	gene with protein product		601586				7759114, 8661119	Standard	NM_000958		Approved	EP4	uc003jlz.3	P35408	OTTHUMG00000094769	ENST00000302472.3:c.1393C>A	chr5.hg19:g.40692406C>A	ENSP00000302846:p.Pro465Thr	114.0	0.0		111.0	30.0	NM_000958	Q3MJ87	Missense_Mutation	SNP	ENST00000302472.3	hg19	CCDS3930.1	.	.	.	.	.	.	.	.	.	.	C	8.588	0.883973	0.17467	.	.	ENSG00000171522	ENST00000302472	T	0.51325	0.71	5.81	0.569	0.17340	.	0.216989	0.39909	N	0.001236	T	0.29850	0.0746	L	0.36672	1.1	0.09310	N	1	B	0.06786	0.001	B	0.08055	0.003	T	0.16041	-1.0416	10	0.54805	T	0.06	-1.3758	2.4748	0.04573	0.1178:0.4355:0.1158:0.3309	.	465	P35408	PE2R4_HUMAN	T	465	ENSP00000302846:P465T	ENSP00000302846:P465T	P	+	1	0	PTGER4	40728163	0.000000	0.05858	0.030000	0.17652	0.614000	0.37383	-0.284000	0.08422	0.055000	0.16094	0.655000	0.94253	CCT	.	.		0.498	PTGER4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211578.2	NM_000958	
XRCC4	7518	hgsc.bcm.edu	37	5	82406962	82406962	+	Silent	SNP	G	G	C			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr5:82406962G>C	ENST00000511817.1	+	3	335	c.255G>C	c.(253-255)acG>acC	p.T85T	XRCC4_ENST00000396027.4_Silent_p.T85T|XRCC4_ENST00000338635.6_Silent_p.T85T|XRCC4_ENST00000282268.3_Silent_p.T85T|XRCC4_ENST00000509268.1_3'UTR			Q13426	XRCC4_HUMAN	X-ray repair complementing defective repair in Chinese hamster cells 4	85					cellular response to lithium ion (GO:0071285)|central nervous system development (GO:0007417)|DNA ligation involved in DNA repair (GO:0051103)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via nonhomologous end joining (GO:0006303)|establishment of integrated proviral latency (GO:0075713)|immunoglobulin V(D)J recombination (GO:0033152)|in utero embryonic development (GO:0001701)|isotype switching (GO:0045190)|negative regulation of neuron apoptotic process (GO:0043524)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of ligase activity (GO:0051351)|positive regulation of neurogenesis (GO:0050769)|pro-B cell differentiation (GO:0002328)|response to gamma radiation (GO:0010332)|response to X-ray (GO:0010165)|T cell differentiation in thymus (GO:0033077)|viral process (GO:0016032)	cell junction (GO:0030054)|centrosome (GO:0005813)|cytosol (GO:0005829)|DNA ligase IV complex (GO:0032807)|DNA-dependent protein kinase-DNA ligase 4 complex (GO:0005958)|nonhomologous end joining complex (GO:0070419)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	protein C-terminus binding (GO:0008022)			endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|prostate(2)|skin(3)	17		Lung NSC(167;0.00132)|all_lung(232;0.00154)|Ovarian(174;0.034)		OV - Ovarian serous cystadenocarcinoma(54;1.44e-38)|Epithelial(54;3.72e-33)|all cancers(79;9.22e-28)		ATGTATACACGTTTAATTTTT	0.348								Non-homologous end-joining																													p.T85T		Atlas-SNP	.											.	XRCC4	37	.	0			c.G255C						.						96.0	96.0	96.0					5																	82406962		2203	4300	6503	SO:0001819	synonymous_variant	7518	exon3			ATACACGTTTAAT	AB017445	CCDS4058.1, CCDS4059.1	5q14.2	2008-02-05			ENSG00000152422	ENSG00000152422			12831	protein-coding gene	gene with protein product	"""X-ray repair, complementing defective, repair in Chinese hamster"", ""DNA repair protein XRCC4"""	194363				1697445, 7665175	Standard	NM_022406		Approved		uc003kib.3	Q13426	OTTHUMG00000131319	ENST00000511817.1:c.255G>C	chr5.hg19:g.82406962G>C		111.0	0.0		93.0	20.0	NM_003401	A8K3X4|Q9BS72|Q9UP94	Silent	SNP	ENST00000511817.1	hg19	CCDS4059.1																																																																																			.	.		0.348	XRCC4-003	NOVEL	alternative_5_UTR|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000369624.1	NM_022550	
PCDHA8	56140	hgsc.bcm.edu	37	5	140222692	140222692	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr5:140222692G>T	ENST00000531613.1	+	1	1786	c.1786G>T	c.(1786-1788)Gca>Tca	p.A596S	PCDHA1_ENST00000394633.3_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA8_ENST00000378123.3_Missense_Mutation_p.A596S	NM_018911.2	NP_061734.1	Q9Y5H6	PCDA8_HUMAN	protocadherin alpha 8	596	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(2)|breast(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(10)|lung(31)|ovary(2)|prostate(2)|skin(4)|stomach(2)|upper_aerodigestive_tract(6)	78			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GAAGGTGCGCGCAGTGGACGC	0.701																																					p.A596S		Atlas-SNP	.											.	PCDHA8	366	.	0			c.G1786T						.						70.0	72.0	71.0					5																	140222692		2196	4266	6462	SO:0001583	missense	56140	exon1			GTGCGCGCAGTGG	AF152486	CCDS54919.1	5q31	2010-11-26				ENSG00000204962		"""Cadherins / Protocadherins : Clustered"""	8674	other	complex locus constituent	"""KIAA0345-like 6"""	606314				10380929	Standard	NM_018911		Approved			Q9Y5H6		ENST00000531613.1:c.1786G>T	chr5.hg19:g.140222692G>T	ENSP00000434655:p.Ala596Ser	64.0	0.0		42.0	21.0	NM_031856	B9EGT7|O75281	Missense_Mutation	SNP	ENST00000531613.1	hg19	CCDS54919.1	.	.	.	.	.	.	.	.	.	.	G	17.80	3.479331	0.63849	.	.	ENSG00000204962	ENST00000531613;ENST00000378123	T;T	0.61510	0.1;0.1	3.71	3.71	0.42584	Cadherin (4);Cadherin-like (1);	0.000000	0.36444	U	0.002583	D	0.83018	0.5163	H	0.98178	4.165	0.43372	D	0.99546	D;D	0.71674	0.998;0.99	P;P	0.62435	0.902;0.782	D	0.90541	0.4502	10	0.87932	D	0	.	15.9009	0.79377	0.0:0.0:1.0:0.0	.	596;596	Q9Y5H6;Q9Y5H6-2	PCDA8_HUMAN;.	S	596	ENSP00000434655:A596S;ENSP00000367363:A596S	ENSP00000367363:A596S	A	+	1	0	PCDHA8	140202876	1.000000	0.71417	1.000000	0.80357	0.024000	0.10985	5.926000	0.70070	1.789000	0.52484	0.306000	0.20318	GCA	.	.		0.701	PCDHA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372830.2	NM_018911	
GEMIN5	25929	hgsc.bcm.edu	37	5	154287212	154287212	+	Silent	SNP	T	T	C			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr5:154287212T>C	ENST00000285873.7	-	16	2409	c.2334A>G	c.(2332-2334)tcA>tcG	p.S778S		NM_001252156.1|NM_015465.4	NP_001239085.1|NP_056280.2	Q8TEQ6	GEMI5_HUMAN	gem (nuclear organelle) associated protein 5	778					gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|ncRNA metabolic process (GO:0034660)|protein complex assembly (GO:0006461)|RNA metabolic process (GO:0016070)|spliceosomal snRNP assembly (GO:0000387)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMN complex (GO:0032797)|SMN-Sm protein complex (GO:0034719)	poly(A) RNA binding (GO:0044822)|snRNA binding (GO:0017069)			breast(1)|central_nervous_system(2)|endometrium(5)|kidney(3)|large_intestine(10)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	38	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.147)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)			CTTCTTGGTCTGACACACCAT	0.498																																					p.S778S		Atlas-SNP	.											.	GEMIN5	120	.	0			c.A2334G						.						167.0	149.0	155.0					5																	154287212		2203	4300	6503	SO:0001819	synonymous_variant	25929	exon16			TTGGTCTGACACA	AK022748	CCDS4330.1	5q34	2013-01-10			ENSG00000082516	ENSG00000082516		"""WD repeat domain containing"""	20043	protein-coding gene	gene with protein product		607005				11714716	Standard	NM_015465		Approved		uc003lvx.3	Q8TEQ6	OTTHUMG00000130189	ENST00000285873.7:c.2334A>G	chr5.hg19:g.154287212T>C		172.0	0.0		131.0	44.0	NM_015465	Q14CV0|Q8WWV4|Q969W4|Q9H9K3|Q9UFI5	Silent	SNP	ENST00000285873.7	hg19	CCDS4330.1																																																																																			.	.		0.498	GEMIN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252507.1		
COL23A1	91522	hgsc.bcm.edu	37	5	177669082	177669082	+	Silent	SNP	G	G	T	rs551123931		TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr5:177669082G>T	ENST00000390654.3	-	27	1899	c.1542C>A	c.(1540-1542)ggC>ggA	p.G514G		NM_173465.3	NP_775736.2	Q86Y22	CONA1_HUMAN	collagen, type XXIII, alpha 1	514	Collagen-like 5.|Gly-rich.				collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(3)|lung(6)|ovary(1)|skin(2)|urinary_tract(1)	19	all_cancers(89;0.00188)|Renal(175;0.000159)|Lung NSC(126;0.00814)|all_lung(126;0.0129)	all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	OV - Ovarian serous cystadenocarcinoma(192;0.153)|all cancers(165;0.172)		GTCCCGGCTCGCCCTTCTGGC	0.662																																					p.G514G		Atlas-SNP	.											.	COL23A1	47	.	0			c.C1542A						.						14.0	19.0	18.0					5																	177669082		1929	4066	5995	SO:0001819	synonymous_variant	91522	exon27			CGGCTCGCCCTTC	AL137461	CCDS4436.1	5q35.3	2013-01-16			ENSG00000050767	ENSG00000050767		"""Collagens"""	22990	protein-coding gene	gene with protein product		610043				12644459	Standard	NM_173465		Approved	DKFZp434K0621	uc021yiz.1	Q86Y22	OTTHUMG00000130890	ENST00000390654.3:c.1542C>A	chr5.hg19:g.177669082G>T		53.0	0.0		46.0	8.0	NM_173465	Q8IVR4|Q9NT93	Silent	SNP	ENST00000390654.3	hg19	CCDS4436.1																																																																																			.	.		0.662	COL23A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253475.1	NM_173465	
GNMT	27232	hgsc.bcm.edu	37	6	42928679	42928679	+	Silent	SNP	C	C	T			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr6:42928679C>T	ENST00000372808.3	+	1	184	c.174C>T	c.(172-174)tgC>tgT	p.C58C		NM_018960.4	NP_061833.1	Q14749	GNMT_HUMAN	glycine N-methyltransferase	58					cellular protein modification process (GO:0006464)|glycogen metabolic process (GO:0005977)|methionine metabolic process (GO:0006555)|one-carbon metabolic process (GO:0006730)|protein homotetramerization (GO:0051289)|regulation of gluconeogenesis (GO:0006111)|S-adenosylmethionine metabolic process (GO:0046500)	cytoplasm (GO:0005737)	folic acid binding (GO:0005542)|glycine binding (GO:0016594)|glycine N-methyltransferase activity (GO:0017174)			kidney(2)|large_intestine(1)|lung(1)	4	Colorectal(47;0.196)		all cancers(41;0.00196)|Colorectal(64;0.00237)|COAD - Colon adenocarcinoma(64;0.00473)|KIRC - Kidney renal clear cell carcinoma(15;0.02)|Kidney(15;0.0388)|OV - Ovarian serous cystadenocarcinoma(102;0.0461)		Glycine(DB00145)|S-Adenosylmethionine(DB00118)	AGCACGGCTGCCAGCGGGTGC	0.706																																					p.C58C		Atlas-SNP	.											.	GNMT	13	.	0			c.C174T						.						4.0	5.0	5.0					6																	42928679		1887	3821	5708	SO:0001819	synonymous_variant	27232	exon1			CGGCTGCCAGCGG	AF101475	CCDS4876.1	6p12	2008-02-05			ENSG00000124713	ENSG00000124713			4415	protein-coding gene	gene with protein product		606628				10843803, 9495250	Standard	NM_018960		Approved		uc003otd.3	Q14749	OTTHUMG00000014712	ENST00000372808.3:c.174C>T	chr6.hg19:g.42928679C>T		17.0	0.0		24.0	10.0	NM_018960	Q5T8W2|Q9NNZ1|Q9NS24	Silent	SNP	ENST00000372808.3	hg19	CCDS4876.1																																																																																			.	.		0.706	GNMT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040568.1	NM_018960	
DLK2	65989	hgsc.bcm.edu	37	6	43418725	43418725	+	Missense_Mutation	SNP	T	T	A	rs80187636		TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr6:43418725T>A	ENST00000357338.3	-	6	1404	c.704A>T	c.(703-705)gAc>gTc	p.D235V	DLK2_ENST00000414245.1_Missense_Mutation_p.D229V|DLK2_ENST00000372488.3_Missense_Mutation_p.D235V|DLK2_ENST00000372485.1_Missense_Mutation_p.D229V	NM_206539.1	NP_996262.1	Q6UY11	DLK2_HUMAN	delta-like 2 homolog (Drosophila)	235	EGF-like 6; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				negative regulation of Notch signaling pathway (GO:0045746)|regulation of fat cell differentiation (GO:0045598)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)			breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(1)|upper_aerodigestive_tract(1)	7	all_lung(25;0.00536)		Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0152)|OV - Ovarian serous cystadenocarcinoma(102;0.0804)			GCAGAGGCAGTCGAAGTCGTG	0.632																																					p.D235V		Atlas-SNP	.											.	DLK2	22	.	0			c.A704T						.						61.0	65.0	63.0					6																	43418725		2203	4300	6503	SO:0001583	missense	65989	exon6			AGGCAGTCGAAGT	AK055380	CCDS4897.1, CCDS75461.1	6p21.1	2008-02-05	2007-07-05	2007-07-05	ENSG00000171462	ENSG00000171462			21113	protein-coding gene	gene with protein product			"""EGF-like-domain, multiple 9"""	EGFL9			Standard	NM_001286656		Approved	MGC2487	uc003ovb.3	Q6UY11	OTTHUMG00000014735	ENST00000357338.3:c.704A>T	chr6.hg19:g.43418725T>A	ENSP00000349893:p.Asp235Val	102.0	0.0		114.0	50.0	NM_023932	B3KNZ7|Q5T3T8|Q9BQ54	Missense_Mutation	SNP	ENST00000357338.3	hg19	CCDS4897.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	15.51|15.51	2.854689|2.854689	0.51376|0.51376	.|.	.|.	ENSG00000171462|ENSG00000171462	ENST00000372485;ENST00000372488;ENST00000357338;ENST00000414245|ENST00000430324	D;D;D;D|.	0.91407|.	-2.84;-2.84;-2.84;-2.84|.	4.94|4.94	3.77|3.77	0.43336|0.43336	EGF-like calcium-binding, conserved site (1);EGF (1);EGF-like calcium-binding (1);Epidermal growth factor-like, type 3 (1);|.	0.359485|.	0.32120|.	N|.	0.006554|.	T|T	0.08403|0.08403	0.0209|0.0209	N|N	0.01473|0.01473	-0.845|-0.845	0.50813|0.50813	D|D	0.999896|0.999896	B|.	0.25272|.	0.122|.	B|.	0.25614|.	0.062|.	T|T	0.13629|0.13629	-1.0502|-1.0502	10|5	0.18276|.	T|.	0.48|.	.|.	10.4748|10.4748	0.44659|0.44659	0.0:0.0776:0.0:0.9224|0.0:0.0776:0.0:0.9224	.|.	235|.	Q6UY11|.	DLK2_HUMAN|.	V|S	229;235;235;229|141	ENSP00000361563:D229V;ENSP00000361566:D235V;ENSP00000349893:D235V;ENSP00000398906:D229V|.	ENSP00000349893:D235V|.	D|T	-|-	2|1	0|0	DLK2|DLK2	43526703|43526703	1.000000|1.000000	0.71417|0.71417	0.987000|0.987000	0.45799|0.45799	0.693000|0.693000	0.40251|0.40251	2.411000|2.411000	0.44600|0.44600	0.844000|0.844000	0.35094|0.35094	0.379000|0.379000	0.24179|0.24179	GAC|ACT	.	.		0.632	DLK2-003	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040618.1	NM_023932	
CASP8AP2	9994	hgsc.bcm.edu	37	6	90577673	90577673	+	RNA	SNP	G	G	A			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr6:90577673G>A	ENST00000551025.1	+	0	6101									caspase 8 associated protein 2											NS(1)|endometrium(7)|kidney(6)|large_intestine(12)|lung(21)|ovary(2)|urinary_tract(2)	51		all_cancers(76;3.64e-09)|Prostate(29;1.16e-10)|Acute lymphoblastic leukemia(125;1.45e-10)|all_hematologic(105;7.74e-07)|all_epithelial(107;4.69e-05)|Lung NSC(302;0.238)		BRCA - Breast invasive adenocarcinoma(108;0.0953)		ACCTCTTCTGGCCTTAAACAG	0.408																																					p.G1555D	Colon(187;1656 2025 17045 31481 39901)	Atlas-SNP	.											.	CASP8AP2	108	.	0			c.G4664A						.						158.0	141.0	146.0					6																	90577673		1926	4129	6055			9994	exon8			CTTCTGGCCTTAA	AB037736		6q15	2012-04-19	2008-10-30		ENSG00000118412	ENSG00000118412			1510	protein-coding gene	gene with protein product	"""FLICE-associated huge protein"""	606880	"""CASP8 associated protein 2"""			10235259, 17245429, 17003126	Standard	NM_001137668		Approved	FLASH, CED-4, RIP25, FLJ11208, KIAA1315	uc011dzz.2	Q9UKL3	OTTHUMG00000015212		chr6.hg19:g.90577673G>A		84.0	0.0		68.0	21.0	NM_001137667		Missense_Mutation	SNP	ENST00000551025.1	hg19																																																																																				.	.		0.408	CASP8AP2-202	KNOWN	basic	processed_transcript	processed_transcript		NM_001137667	
ESR1	2099	hgsc.bcm.edu	37	6	152129176	152129176	+	Nonsense_Mutation	SNP	C	C	A			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr6:152129176C>A	ENST00000206249.3	+	1	491	c.129C>A	c.(127-129)taC>taA	p.Y43*	ESR1_ENST00000427531.2_5'Flank|ESR1_ENST00000443427.1_Nonsense_Mutation_p.Y43*|ESR1_ENST00000406599.1_Nonsense_Mutation_p.Y43*|ESR1_ENST00000338799.5_Nonsense_Mutation_p.Y43*|ESR1_ENST00000456483.2_Nonsense_Mutation_p.Y43*|ESR1_ENST00000440973.1_Nonsense_Mutation_p.Y43*	NM_000125.3	NP_000116.2	P03372	ESR1_HUMAN	estrogen receptor 1	43	Interaction with DDX5; self-association.|Modulating (transactivation AF-1); mediates interaction with MACROD1.|Required for interaction with NCOA1.				androgen metabolic process (GO:0008209)|antral ovarian follicle growth (GO:0001547)|cellular response to estradiol stimulus (GO:0071392)|chromatin remodeling (GO:0006338)|epithelial cell development (GO:0002064)|epithelial cell proliferation involved in mammary gland duct elongation (GO:0060750)|gene expression (GO:0010467)|intracellular estrogen receptor signaling pathway (GO:0030520)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|male gonad development (GO:0008584)|mammary gland alveolus development (GO:0060749)|mammary gland branching involved in pregnancy (GO:0060745)|negative regulation of gene expression (GO:0010629)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of phospholipase C activity (GO:0010863)|positive regulation of retinoic acid receptor signaling pathway (GO:0048386)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|prostate epithelial cord arborization involved in prostate glandular acinus morphogenesis (GO:0060527)|prostate epithelial cord elongation (GO:0060523)|regulation of apoptotic process (GO:0042981)|regulation of branching involved in prostate gland morphogenesis (GO:0060687)|regulation of transcription, DNA-templated (GO:0006355)|response to estradiol (GO:0032355)|response to estrogen (GO:0043627)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|uterus development (GO:0060065)|vagina development (GO:0060068)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|transcriptionally active chromatin (GO:0035327)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|core promoter sequence-specific DNA binding (GO:0001046)|enzyme binding (GO:0019899)|estrogen receptor activity (GO:0030284)|estrogen response element binding (GO:0034056)|estrogen-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0038052)|identical protein binding (GO:0042802)|nitric-oxide synthase regulator activity (GO:0030235)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid binding (GO:0005496)|steroid hormone receptor activity (GO:0003707)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(9)|kidney(1)|large_intestine(11)|lung(19)|ovary(1)|prostate(2)|skin(1)	49		Ovarian(120;0.0448)	BRCA - Breast invasive adenocarcinoma(37;0.0841)	OV - Ovarian serous cystadenocarcinoma(155;4.55e-10)	Allylestrenol(DB01431)|Clomifene(DB00882)|Conjugated Estrogens(DB00286)|Danazol(DB01406)|Desogestrel(DB00304)|Dienestrol(DB00890)|Diethylstilbestrol(DB00255)|Estradiol(DB00783)|Estramustine(DB01196)|Estriol(DB04573)|Estrone(DB00655)|Estropipate(DB04574)|Ethinyl Estradiol(DB00977)|Ethynodiol(DB00823)|Etonogestrel(DB00294)|Fluoxymesterone(DB01185)|Fulvestrant(DB00947)|Levonorgestrel(DB00367)|Medroxyprogesterone Acetate(DB00603)|Melatonin(DB01065)|Mestranol(DB01357)|Naloxone(DB01183)|Norgestimate(DB00957)|Ospemifene(DB04938)|Progesterone(DB00396)|Quinestrol(DB04575)|Raloxifene(DB00481)|Tamoxifen(DB00675)|Toremifene(DB00539)|Trilostane(DB01108)	GCGAGGTGTACCTGGACAGCA	0.677																																					p.Y43X		Atlas-SNP	.											.	ESR1	94	.	0			c.C129A						.						24.0	27.0	26.0					6																	152129176		2203	4300	6503	SO:0001587	stop_gained	2099	exon1			GGTGTACCTGGAC	X03635	CCDS5234.1	6q24-q27	2013-01-16			ENSG00000091831	ENSG00000091831		"""Nuclear hormone receptors"""	3467	protein-coding gene	gene with protein product		133430		ESR		3754034	Standard	NM_000125		Approved	NR3A1, Era	uc003qon.4	P03372	OTTHUMG00000016103	ENST00000206249.3:c.129C>A	chr6.hg19:g.152129176C>A	ENSP00000206249:p.Tyr43*	57.0	0.0		62.0	26.0	NM_000125	Q13511|Q14276|Q5T5H7|Q6MZQ9|Q9NU51|Q9UDZ7|Q9UIS7	Nonsense_Mutation	SNP	ENST00000206249.3	hg19	CCDS5234.1	.	.	.	.	.	.	.	.	.	.	C	39	7.630277	0.98399	.	.	ENSG00000091831	ENST00000404742;ENST00000440973;ENST00000338799;ENST00000456483;ENST00000446550;ENST00000443427;ENST00000206249;ENST00000406599	.	.	.	5.06	4.18	0.49190	.	0.242112	0.43919	D	0.000507	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	8.9107	0.35552	0.0:0.7734:0.0:0.2265	.	.	.	.	X	43	.	ENSP00000206249:Y43X	Y	+	3	2	ESR1	152170869	0.960000	0.32886	1.000000	0.80357	0.985000	0.73830	-0.056000	0.11787	2.359000	0.80004	0.563000	0.77884	TAC	.	.		0.677	ESR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043308.1		
EZR	7430	hgsc.bcm.edu	37	6	159210363	159210363	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr6:159210363A>T	ENST00000367075.3	-	3	221	c.53T>A	c.(52-54)tTt>tAt	p.F18Y	EZR_ENST00000476189.1_5'UTR|EZR_ENST00000337147.7_Missense_Mutation_p.F18Y|EZR_ENST00000392177.4_Missense_Mutation_p.F18Y	NM_001111077.1	NP_001104547.1	P15311	EZRI_HUMAN	ezrin	18	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				actin filament bundle assembly (GO:0051017)|axon guidance (GO:0007411)|cytoskeletal anchoring at plasma membrane (GO:0007016)|establishment of endothelial barrier (GO:0061028)|establishment or maintenance of apical/basal cell polarity (GO:0035088)|filopodium assembly (GO:0046847)|leukocyte cell-cell adhesion (GO:0007159)|membrane to membrane docking (GO:0022614)|positive regulation of gene expression (GO:0010628)|receptor internalization (GO:0031623)|regulation of cell shape (GO:0008360)	actin cytoskeleton (GO:0015629)|actin filament (GO:0005884)|apical part of cell (GO:0045177)|apical plasma membrane (GO:0016324)|astrocyte projection (GO:0097449)|basolateral plasma membrane (GO:0016323)|cell body (GO:0044297)|cell tip (GO:0051286)|ciliary basal body (GO:0036064)|cortical cytoskeleton (GO:0030863)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|microspike (GO:0044393)|microvillus (GO:0005902)|microvillus membrane (GO:0031528)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|Schwann cell microvillus (GO:0097454)|T-tubule (GO:0030315)|uropod (GO:0001931)|vesicle (GO:0031982)	actin filament binding (GO:0051015)|cell adhesion molecule binding (GO:0050839)|poly(A) RNA binding (GO:0044822)		EZR/ROS1(4)	breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(4)|large_intestine(2)|lung(1)|ovary(1)|prostate(2)	15		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;2.16e-17)|BRCA - Breast invasive adenocarcinoma(81;6.58e-06)		CTGGATTGCAAACTCCAGCTC	0.378			T	ROS1	NSCLC																																p.F18Y		Atlas-SNP	.		Dom	yes		6	6q25.3	7430	ezrin		E	.	EZR	44	.	0			c.T53A						.						102.0	92.0	95.0					6																	159210363		2203	4300	6503	SO:0001583	missense	7430	exon2			ATTGCAAACTCCA	AF187552	CCDS5258.1	6q25.3	2010-12-10	2007-11-29	2007-11-29	ENSG00000092820	ENSG00000092820		"""A-kinase anchor proteins"""	12691	protein-coding gene	gene with protein product	"""cytovillin 2"""	123900	"""villin 2 (ezrin)"""	VIL2			Standard	NM_003379		Approved		uc003qrt.4	P15311	OTTHUMG00000015917	ENST00000367075.3:c.53T>A	chr6.hg19:g.159210363A>T	ENSP00000356042:p.Phe18Tyr	140.0	0.0		126.0	36.0	NM_003379	E1P5A8|P23714|Q4VX75|Q96CU8|Q9NSJ4	Missense_Mutation	SNP	ENST00000367075.3	hg19	CCDS5258.1	.	.	.	.	.	.	.	.	.	.	A	31	5.097975	0.94197	.	.	ENSG00000092820	ENST00000337147;ENST00000367075;ENST00000392177	T;T;T	0.78924	-1.22;-1.22;-1.15	4.78	4.78	0.61160	FERM, N-terminal (1);Band 4.1 domain (1);FERM domain (1);	0.000000	0.85682	D	0.000000	D	0.89001	0.6591	M	0.92784	3.345	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.91709	0.5380	10	0.87932	D	0	.	14.7544	0.69552	1.0:0.0:0.0:0.0	.	18;18	E7EQR4;P15311	.;EZRI_HUMAN	Y	18	ENSP00000338934:F18Y;ENSP00000356042:F18Y;ENSP00000376016:F18Y	ENSP00000338934:F18Y	F	-	2	0	EZR	159130351	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.644000	0.91044	2.131000	0.65755	0.454000	0.30748	TTT	.	.		0.378	EZR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042878.1	NM_003379	
MAP3K4	4216	hgsc.bcm.edu	37	6	161507445	161507445	+	Nonsense_Mutation	SNP	G	G	T			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr6:161507445G>T	ENST00000392142.4	+	8	2555	c.2407G>T	c.(2407-2409)Gag>Tag	p.E803*	MAP3K4_ENST00000366919.2_Nonsense_Mutation_p.E803*|MAP3K4_ENST00000348824.7_Nonsense_Mutation_p.E803*|MAP3K4_ENST00000366920.2_Nonsense_Mutation_p.E803*	NM_005922.2	NP_005913	Q9Y6R4	M3K4_HUMAN	mitogen-activated protein kinase kinase kinase 4	803					activation of MAPKK activity (GO:0000186)|chorionic trophoblast cell differentiation (GO:0060718)|intracellular signal transduction (GO:0035556)|male germ-line sex determination (GO:0019100)|MAPK cascade (GO:0000165)|placenta development (GO:0001890)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of p38MAPK cascade (GO:1900745)|regulation of gene expression (GO:0010468)|response to UV-C (GO:0010225)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|MAP kinase kinase kinase activity (GO:0004709)|metal ion binding (GO:0046872)			breast(6)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(20)|lung(28)|ovary(3)|skin(2)|stomach(1)	77		Breast(66;0.000776)|Ovarian(120;0.0367)|Prostate(117;0.0771)		OV - Ovarian serous cystadenocarcinoma(65;1.85e-18)|BRCA - Breast invasive adenocarcinoma(81;3.04e-05)		AGCCCTGAAGGAGCTCTTCCA	0.433																																					p.E803X		Atlas-SNP	.											.	MAP3K4	364	.	0			c.G2407T						.						57.0	61.0	59.0					6																	161507445		2203	4300	6503	SO:0001587	stop_gained	4216	exon8			CTGAAGGAGCTCT	AF002715	CCDS34565.1, CCDS34566.1, CCDS75544.1	6q26	2012-10-02			ENSG00000085511	ENSG00000085511		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6856	protein-coding gene	gene with protein product		602425		MEKK4		9305639	Standard	XM_005266988		Approved	MTK1, MAPKKK4, KIAA0213	uc003qtn.3	Q9Y6R4	OTTHUMG00000015968	ENST00000392142.4:c.2407G>T	chr6.hg19:g.161507445G>T	ENSP00000375986:p.Glu803*	80.0	0.0		95.0	34.0	NM_006724	A6H8W0|B7ZLD3|B9EG75|Q5VTT8|Q5VTT9|Q92612|Q9H408	Nonsense_Mutation	SNP	ENST00000392142.4	hg19	CCDS34565.1	.	.	.	.	.	.	.	.	.	.	G	40	8.251123	0.98727	.	.	ENSG00000085511	ENST00000366919;ENST00000392142;ENST00000540111;ENST00000366920;ENST00000348824	.	.	.	5.6	5.6	0.85130	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.26408	T	0.33	-36.3925	19.6017	0.95566	0.0:0.0:1.0:0.0	.	.	.	.	X	803	.	ENSP00000297332:E803X	E	+	1	0	MAP3K4	161427435	1.000000	0.71417	1.000000	0.80357	0.943000	0.58893	9.476000	0.97823	2.622000	0.88805	0.655000	0.94253	GAG	.	.		0.433	MAP3K4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000042988.3		
AP5Z1	9907	hgsc.bcm.edu	37	7	4825905	4825905	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr7:4825905A>T	ENST00000348624.4	+	10	1251	c.1157A>T	c.(1156-1158)gAa>gTa	p.E386V	MIR4656_ENST00000579503.1_RNA|AP5Z1_ENST00000401897.1_Missense_Mutation_p.E386V	NM_014855.2	NP_055670.1	O43299	AP5Z1_HUMAN	adaptor-related protein complex 5, zeta 1 subunit	386					cell death (GO:0008219)|double-strand break repair via homologous recombination (GO:0000724)|endosomal transport (GO:0016197)|protein transport (GO:0015031)	AP-5 adaptor complex (GO:0044599)|AP-type membrane coat adaptor complex (GO:0030119)|cytoplasm (GO:0005737)|nucleus (GO:0005634)											GTGGACTCGGAAGCCGTCTAC	0.627																																					p.E386V		Atlas-SNP	.											.	.	.	.	0			c.A1157T						.						41.0	49.0	46.0					7																	4825905		1986	4145	6131	SO:0001583	missense	9907	exon10			ACTCGGAAGCCGT	AB007875	CCDS47528.1	7p22.1	2012-03-20	2012-03-20	2012-03-20	ENSG00000242802	ENSG00000242802			22197	protein-coding gene	gene with protein product		613653	"""KIAA0415"""	KIAA0415		20613862, 22022230	Standard	NM_014855		Approved	SPG48, zeta	uc003sne.3	O43299	OTTHUMG00000151754	ENST00000348624.4:c.1157A>T	chr7.hg19:g.4825905A>T	ENSP00000297562:p.Glu386Val	64.0	0.0		73.0	30.0	NM_014855	Q8N3X2|Q96H80	Missense_Mutation	SNP	ENST00000348624.4	hg19	CCDS47528.1	.	.	.	.	.	.	.	.	.	.	A	20.8	4.044372	0.75732	.	.	ENSG00000242802	ENST00000348624;ENST00000401897	T;T	0.53206	0.65;0.63	5.29	2.89	0.33648	.	0.408719	0.26079	N	0.026467	T	0.58623	0.2135	M	0.78049	2.395	0.38295	D	0.94281	D	0.59357	0.985	P	0.55713	0.782	T	0.62110	-0.6923	10	0.72032	D	0.01	.	7.7425	0.28849	0.8331:0.0:0.1669:0.0	.	386	O43299	K0415_HUMAN	V	386	ENSP00000297562:E386V;ENSP00000384980:E386V	ENSP00000297562:E386V	E	+	2	0	KIAA0415	4792431	1.000000	0.71417	0.007000	0.13788	0.968000	0.65278	4.534000	0.60622	0.327000	0.23409	0.459000	0.35465	GAA	.	.		0.627	AP5Z1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323771.1		
IGF2BP3	10643	hgsc.bcm.edu	37	7	23509624	23509624	+	Nonsense_Mutation	SNP	T	T	A			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr7:23509624T>A	ENST00000258729.3	-	1	462	c.106A>T	c.(106-108)Aag>Tag	p.K36*	IGF2BP3_ENST00000491719.1_5'Flank	NM_006547.2	NP_006538.2	O00425	IF2B3_HUMAN	insulin-like growth factor 2 mRNA binding protein 3	36	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.				anatomical structure morphogenesis (GO:0009653)|gene expression (GO:0010467)|mRNA transport (GO:0051028)|negative regulation of translation (GO:0017148)|regulation of cytokine biosynthetic process (GO:0042035)|translation (GO:0006412)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	mRNA 3'-UTR binding (GO:0003730)|mRNA 5'-UTR binding (GO:0048027)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|translation regulator activity (GO:0045182)			breast(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(14)|ovary(2)|prostate(2)|skin(4)|stomach(1)	34						TAGCCAGTCTTCACCAGGAAG	0.637																																					p.K36X		Atlas-SNP	.											.	IGF2BP3	71	.	0			c.A106T						.						57.0	64.0	62.0					7																	23509624		2203	4300	6503	SO:0001587	stop_gained	10643	exon1			CAGTCTTCACCAG	AF117108	CCDS5382.1	7p15.3	2014-02-19			ENSG00000136231	ENSG00000136231		"""RNA binding motif (RRM) containing"""	28868	protein-coding gene	gene with protein product	"""IGF II mRNA binding protein 3"", ""cancer/testis antigen 98"""	608259				9891060, 9178771	Standard	NM_006547		Approved	IMP-3, CT98, IMP3	uc003swg.3	O00425	OTTHUMG00000128445	ENST00000258729.3:c.106A>T	chr7.hg19:g.23509624T>A	ENSP00000258729:p.Lys36*	87.0	0.0		80.0	30.0	NM_006547	A0A4Z5|Q63HM0|Q6MZZ2|Q86VB1	Nonsense_Mutation	SNP	ENST00000258729.3	hg19	CCDS5382.1	.	.	.	.	.	.	.	.	.	.	T	41	9.041004	0.99046	.	.	ENSG00000136231	ENST00000258729	.	.	.	3.82	2.59	0.31030	.	0.000000	0.85682	U	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-10.4517	9.817	0.40858	0.0:0.0:0.1736:0.8264	.	.	.	.	X	36	.	ENSP00000258729:K36X	K	-	1	0	IGF2BP3	23476149	1.000000	0.71417	0.999000	0.59377	0.982000	0.71751	7.613000	0.82986	0.305000	0.22832	0.455000	0.32223	AAG	.	.		0.637	IGF2BP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250243.2	NM_006547	
AMPH	273	hgsc.bcm.edu	37	7	38457451	38457451	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr7:38457451C>A	ENST00000356264.2	-	17	1587	c.1372G>T	c.(1372-1374)Gct>Tct	p.A458S	AMPH_ENST00000471913.1_Intron|AMPH_ENST00000325590.5_Intron|AMPH_ENST00000428293.2_Intron	NM_001635.3	NP_001626.1	P49418	AMPH_HUMAN	amphiphysin	458					endocytosis (GO:0006897)|learning (GO:0007612)|synaptic transmission (GO:0007268)|synaptic vesicle endocytosis (GO:0048488)	actin cytoskeleton (GO:0015629)|cell junction (GO:0030054)|leading edge membrane (GO:0031256)|synaptic vesicle (GO:0008021)	phospholipid binding (GO:0005543)			breast(1)|endometrium(3)|kidney(3)|large_intestine(12)|liver(3)|lung(27)|ovary(3)|prostate(1)|skin(7)|upper_aerodigestive_tract(2)	62						GGCTCCTCAGCCCGAGTGTCC	0.597																																					p.A458S		Atlas-SNP	.											.	AMPH	157	.	0			c.G1372T						.						115.0	92.0	100.0					7																	38457451		2203	4300	6503	SO:0001583	missense	273	exon17			CCTCAGCCCGAGT		CCDS5456.1, CCDS47574.1	7p14-p13	2007-06-19	2007-06-19		ENSG00000078053	ENSG00000078053			471	protein-coding gene	gene with protein product		600418	"""amphiphysin (Stiff-Mann syndrome with breast cancer 128kD autoantigen)"", ""amphiphysin (Stiff-Man syndrome with breast cancer 128kDa autoantigen)"""			8245793	Standard	NM_139316		Approved		uc003tgu.3	P49418	OTTHUMG00000023725	ENST00000356264.2:c.1372G>T	chr7.hg19:g.38457451C>A	ENSP00000348602:p.Ala458Ser	74.0	0.0		67.0	19.0	NM_001635	A4D1X8|A4D1X9|O43538|Q75MJ8|Q75MK5|Q75MM3|Q8N4G0	Missense_Mutation	SNP	ENST00000356264.2	hg19	CCDS5456.1	.	.	.	.	.	.	.	.	.	.	C	14.07	2.424877	0.43020	.	.	ENSG00000078053	ENST00000356264	T	0.59083	0.29	4.75	2.87	0.33458	.	.	.	.	.	T	0.25457	0.0619	N	0.08118	0	0.80722	D	1	B	0.32245	0.361	B	0.24155	0.051	T	0.10359	-1.0633	9	0.07030	T	0.85	9.8062	5.0881	0.14693	0.0:0.4882:0.2886:0.2231	.	458	P49418	AMPH_HUMAN	S	458	ENSP00000348602:A458S	ENSP00000348602:A458S	A	-	1	0	AMPH	38423976	0.164000	0.22935	0.920000	0.36463	0.973000	0.67179	0.102000	0.15272	0.990000	0.38787	0.609000	0.83330	GCT	.	.		0.597	AMPH-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000226953.2	NM_001635	
NPTX2	4885	hgsc.bcm.edu	37	7	98256508	98256508	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr7:98256508G>T	ENST00000265634.3	+	4	1085	c.920G>T	c.(919-921)gGc>gTc	p.G307V		NM_002523.2	NP_002514.1	P47972	NPTX2_HUMAN	neuronal pentraxin II	307	Pentaxin.				synaptic transmission (GO:0007268)	extracellular region (GO:0005576)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(2)|endometrium(1)|large_intestine(5)|lung(5)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	18	all_cancers(62;2.28e-09)|all_epithelial(64;4.86e-10)|Esophageal squamous(72;0.00918)|Lung NSC(181;0.0128)|all_lung(186;0.0142)		STAD - Stomach adenocarcinoma(171;0.215)			GTCAGTGACGGCAAGTGGCAC	0.642																																					p.G307V		Atlas-SNP	.											.	NPTX2	45	.	0			c.G920T						.						86.0	72.0	76.0					7																	98256508		2203	4300	6503	SO:0001583	missense	4885	exon4			GTGACGGCAAGTG		CCDS5657.1	7q21.3-q22.1	2008-04-30			ENSG00000106236	ENSG00000106236			7953	protein-coding gene	gene with protein product	"""apexin"""	600750				8530029	Standard	NM_002523		Approved		uc003upl.2	P47972	OTTHUMG00000154369	ENST00000265634.3:c.920G>T	chr7.hg19:g.98256508G>T	ENSP00000265634:p.Gly307Val	64.0	0.0		64.0	30.0	NM_002523	A4D267|Q86XV7|Q96G70	Missense_Mutation	SNP	ENST00000265634.3	hg19	CCDS5657.1	.	.	.	.	.	.	.	.	.	.	G	31	5.099807	0.94197	.	.	ENSG00000106236	ENST00000265634	T	0.66099	-0.19	5.38	5.38	0.77491	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);	0.000000	0.85682	D	0.000000	D	0.86661	0.5986	H	0.96777	3.88	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.90623	0.4561	10	0.66056	D	0.02	-12.8195	18.4772	0.90797	0.0:0.0:1.0:0.0	.	307	P47972	NPTX2_HUMAN	V	307	ENSP00000265634:G307V	ENSP00000265634:G307V	G	+	2	0	NPTX2	98094444	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	9.813000	0.99286	2.677000	0.91161	0.650000	0.86243	GGC	.	.		0.642	NPTX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334982.1	NM_002523	
DGKI	9162	hgsc.bcm.edu	37	7	137080389	137080389	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr7:137080389C>A	ENST00000288490.5	-	33	3036	c.3036G>T	c.(3034-3036)caG>caT	p.Q1012H	DGKI_ENST00000494390.1_5'UTR|DGKI_ENST00000424189.2_Missense_Mutation_p.Q1025H|DGKI_ENST00000453654.2_Missense_Mutation_p.Q681H|DGKI_ENST00000446122.1_Missense_Mutation_p.Q994H	NM_004717.2	NP_004708.1	O75912	DGKI_HUMAN	diacylglycerol kinase, iota	1012					blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|platelet activation (GO:0030168)|positive regulation of Ras protein signal transduction (GO:0046579)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of Rap GTPase activity (GO:0032317)	cytoplasm (GO:0005737)|guanyl-nucleotide exchange factor complex (GO:0032045)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|diacylglycerol kinase activity (GO:0004143)|GTPase inhibitor activity (GO:0005095)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)			breast(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(46)|ovary(2)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	84						CCACCAGAAGCTGGCACACAG	0.567																																					p.Q1012H		Atlas-SNP	.											.	DGKI	335	.	0			c.G3036T						.						77.0	67.0	71.0					7																	137080389		2203	4300	6503	SO:0001583	missense	9162	exon33			CAGAAGCTGGCAC	AF061936	CCDS5845.1	7q32.3-q33	2013-01-10			ENSG00000157680	ENSG00000157680		"""Ankyrin repeat domain containing"""	2855	protein-coding gene	gene with protein product		604072				9830018	Standard	NM_004717		Approved	DGK-IOTA	uc003vtt.3	O75912	OTTHUMG00000155697	ENST00000288490.5:c.3036G>T	chr7.hg19:g.137080389C>A	ENSP00000288490:p.Gln1012His	132.0	0.0		142.0	37.0	NM_004717	A4D1Q9|Q9NZ49	Missense_Mutation	SNP	ENST00000288490.5	hg19	CCDS5845.1	.	.	.	.	.	.	.	.	.	.	C	4.387	0.071385	0.08436	.	.	ENSG00000157680	ENST00000453654;ENST00000540376;ENST00000424189;ENST00000288490;ENST00000446122	T;T;T	0.65916	-0.18;-0.18;-0.18	5.35	3.16	0.36331	Ankyrin repeat-containing domain (3);	0.127182	0.53938	D	0.000053	T	0.48714	0.1515	L	0.45744	1.44	0.35490	D	0.798896	B;B	0.09022	0.001;0.002	B;B	0.14023	0.006;0.01	T	0.48747	-0.9008	10	0.12103	T	0.63	.	8.9371	0.35706	0.0:0.7282:0.0:0.2718	.	681;1012	E9PFX6;O75912	.;DGKI_HUMAN	H	681;929;1015;1012;994	ENSP00000392161:Q681H;ENSP00000288490:Q1012H;ENSP00000399131:Q994H	ENSP00000288490:Q1012H	Q	-	3	2	DGKI	136730929	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	0.585000	0.23879	1.384000	0.46424	-0.145000	0.13849	CAG	.	.		0.567	DGKI-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000341286.3	NM_004717	
TPK1	27010	hgsc.bcm.edu	37	7	144150676	144150676	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr7:144150676C>A	ENST00000360057.3	-	9	796	c.694G>T	c.(694-696)Gac>Tac	p.D232Y	RNU6ATAC40P_ENST00000408580.1_RNA|TPK1_ENST00000378099.3_Missense_Mutation_p.D183Y|TPK1_ENST00000549981.1_3'UTR|TPK1_ENST00000547966.1_5'UTR|TPK1_ENST00000538212.2_Missense_Mutation_p.D178Y	NM_022445.3	NP_071890.2	Q9H3S4	TPK1_HUMAN	thiamin pyrophosphokinase 1	232					small molecule metabolic process (GO:0044281)|thiamine diphosphate biosynthetic process (GO:0009229)|thiamine metabolic process (GO:0006772)|thiamine-containing compound metabolic process (GO:0042723)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)	ATP binding (GO:0005524)|kinase activity (GO:0016301)|thiamine binding (GO:0030975)|thiamine diphosphokinase activity (GO:0004788)			large_intestine(3)|lung(12)|ovary(2)|urinary_tract(2)	19					Thiamine(DB00152)	AGTGGGTGGTCAGTTTCCACA	0.453																																					p.D232Y	Ovarian(45;88 1034 2073 5829 28455)	Atlas-SNP	.											.	TPK1	41	.	0			c.G694T						.						204.0	180.0	188.0					7																	144150676		2203	4300	6503	SO:0001583	missense	27010	exon9			GGTGGTCAGTTTC	AB028138	CCDS5888.1, CCDS55178.1	7q34-q35	2008-07-18			ENSG00000196511	ENSG00000196511			17358	protein-coding gene	gene with protein product	"""placental protein 20"", ""thiamine pyrophosphokinase 1"", ""thiamine kinase"", ""thiamine diphosphokinase"""	606370				11342111	Standard	NM_022445		Approved	HTPK1, PP20	uc003weq.3	Q9H3S4	OTTHUMG00000152774	ENST00000360057.3:c.694G>T	chr7.hg19:g.144150676C>A	ENSP00000353165:p.Asp232Tyr	119.0	0.0		122.0	29.0	NM_022445	A8K0T7|D3DWG0|I6L9B8|Q6NUR5|Q9H602	Missense_Mutation	SNP	ENST00000360057.3	hg19	CCDS5888.1	.	.	.	.	.	.	.	.	.	.	C	24.7	4.563419	0.86335	.	.	ENSG00000196511	ENST00000360057;ENST00000538212;ENST00000378099	T;T;T	0.78707	-1.2;-1.2;-1.2	5.79	5.79	0.91817	Thiamin pyrophosphokinase, vitamin B1-binding domain (3);	0.000000	0.85682	D	0.000000	D	0.90738	0.7093	M	0.91872	3.25	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.994;0.999;0.995	D	0.92218	0.5782	10	0.87932	D	0	-24.9542	17.5252	0.87798	0.0:1.0:0.0:0.0	.	183;232;178	F5GZG6;Q9H3S4;Q6ZQX6	.;TPK1_HUMAN;.	Y	232;178;183	ENSP00000353165:D232Y;ENSP00000438813:D178Y;ENSP00000367339:D183Y	ENSP00000353165:D232Y	D	-	1	0	TPK1	143781609	0.977000	0.34250	0.969000	0.41365	0.967000	0.64934	3.298000	0.51818	2.746000	0.94184	0.655000	0.94253	GAC	.	.		0.453	TPK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327777.1	NM_022445	
NOS3	4846	hgsc.bcm.edu	37	7	150696315	150696315	+	Missense_Mutation	SNP	G	G	C			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr7:150696315G>C	ENST00000484524.1	+	8	994	c.994G>C	c.(994-996)Gcc>Ccc	p.A332P	NOS3_ENST00000467517.1_Missense_Mutation_p.A332P|NOS3_ENST00000461406.1_Missense_Mutation_p.A126P|NOS3_ENST00000297494.3_Missense_Mutation_p.A332P	NM_001160111.1	NP_001153583.1	P60323	NANO3_HUMAN	nitric oxide synthase 3 (endothelial cell)	0					germ cell development (GO:0007281)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic signaling pathway (GO:2001234)|oogenesis (GO:0048477)|regulation of cell cycle (GO:0051726)|regulation of translation (GO:0006417)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytoplasmic stress granule (GO:0010494)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			NS(3)|breast(3)|central_nervous_system(5)|endometrium(1)|kidney(4)|large_intestine(6)|liver(2)|lung(11)|ovary(3)|prostate(3)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	50	all_neural(206;0.219)		OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		GCGCTGGTACGCCCTCCCGGC	0.642																																					p.A332P		Atlas-SNP	.											.	NOS3	131	.	0			c.G994C						.						61.0	68.0	66.0					7																	150696315		2201	4295	6496	SO:0001583	missense	4846	exon8			TGGTACGCCCTCC		CCDS5912.1, CCDS55182.1, CCDS55183.1	7q36	2007-02-15			ENSG00000164867	ENSG00000164867	1.14.13.39		7876	protein-coding gene	gene with protein product	"""endothelial nitric oxide synthase"""	163729				1379542	Standard	NM_000603		Approved	ECNOS, eNOS	uc003wif.3	P29474	OTTHUMG00000158343	ENST00000484524.1:c.994G>C	chr7.hg19:g.150696315G>C	ENSP00000420215:p.Ala332Pro	42.0	0.0		51.0	32.0	NM_001160111	Q495E5	Missense_Mutation	SNP	ENST00000484524.1	hg19	CCDS55182.1	.	.	.	.	.	.	.	.	.	.	N	28.3	4.911772	0.92178	.	.	ENSG00000164867	ENST00000297494;ENST00000461406;ENST00000484524;ENST00000467517	T;T;T;T	0.35605	1.3;1.47;1.3;1.3	5.59	5.59	0.84812	Nitric oxide synthase, oxygenase domain (2);	0.000000	0.64402	D	0.000014	T	0.67373	0.2886	M	0.89353	3.025	0.58432	D	0.999996	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.91635	0.999;0.999;0.997;0.995;0.973	T	0.73681	-0.3906	10	0.87932	D	0	-9.7199	17.0996	0.86645	0.0:0.0:1.0:0.0	.	332;332;332;126;332	A0S0A6;E9PFR2;A0S0A8;E7ESA7;P29474	.;.;.;.;NOS3_HUMAN	P	332;126;332;332	ENSP00000297494:A332P;ENSP00000417143:A126P;ENSP00000420215:A332P;ENSP00000420551:A332P	ENSP00000297494:A332P	A	+	1	0	NOS3	150327248	0.997000	0.39634	0.958000	0.39756	0.847000	0.48162	6.771000	0.74996	2.620000	0.88729	0.639000	0.83563	GCC	.	.		0.642	NOS3-004	NOVEL	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000351550.1	NM_000603	
POLR3D	661	hgsc.bcm.edu	37	8	22105780	22105780	+	Nonsense_Mutation	SNP	G	G	T	rs199704064		TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr8:22105780G>T	ENST00000397802.4	+	4	690	c.475G>T	c.(475-477)Gag>Tag	p.E159*	POLR3D_ENST00000306433.4_Nonsense_Mutation_p.E159*			P05423	RPC4_HUMAN	polymerase (RNA) III (DNA directed) polypeptide D, 44kDa	159					defense response to virus (GO:0051607)|gene expression (GO:0010467)|innate immune response (GO:0045087)|positive regulation of innate immune response (GO:0045089)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of type I interferon production (GO:0032481)|termination of RNA polymerase III transcription (GO:0006386)|transcription elongation from RNA polymerase III promoter (GO:0006385)|transcription from RNA polymerase III promoter (GO:0006383)	cytosol (GO:0005829)|DNA-directed RNA polymerase III complex (GO:0005666)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)			central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(5)|prostate(1)|stomach(1)	13				Colorectal(74;0.0146)|COAD - Colon adenocarcinoma(73;0.061)		GCGTATGCTGGAGAAGGACGA	0.502																																					p.E159X		Atlas-SNP	.											.	POLR3D	26	.	0			c.G475T						.						102.0	109.0	107.0					8																	22105780		2203	4300	6503	SO:0001587	stop_gained	661	exon5			ATGCTGGAGAAGG	M17754	CCDS34858.1	8q21	2013-01-21	2003-04-01	2003-04-04	ENSG00000168495	ENSG00000168495		"""RNA polymerase subunits"""	1080	protein-coding gene	gene with protein product		187280	"""BN51 (BHK21) temperature sensitivity complementing"""	BN51T		12391170, 11279001	Standard	NM_001722		Approved	TSBN51, RPC4	uc003xbl.3	P05423	OTTHUMG00000163778	ENST00000397802.4:c.475G>T	chr8.hg19:g.22105780G>T	ENSP00000380904:p.Glu159*	117.0	0.0		966.0	46.0	NM_001722	Q6FI28|Q9BPV7|Q9BPZ1|Q9BXB3	Nonsense_Mutation	SNP	ENST00000397802.4	hg19	CCDS34858.1	.	.	.	.	.	.	.	.	.	.	G	38	6.713816	0.97784	.	.	ENSG00000168495	ENST00000306433;ENST00000519237;ENST00000397802	.	.	.	5.74	5.74	0.90152	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.09084	T	0.74	-36.3725	18.7009	0.91620	0.0:0.0:1.0:0.0	.	.	.	.	X	159	.	ENSP00000303088:E159X	E	+	1	0	POLR3D	22161725	1.000000	0.71417	1.000000	0.80357	0.815000	0.46073	7.373000	0.79623	2.695000	0.91970	0.655000	0.94253	GAG	.	G|1.000;A|0.000		0.502	POLR3D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375434.2	NM_001722	
FER1L6	654463	hgsc.bcm.edu	37	8	125074249	125074249	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr8:125074249G>T	ENST00000522917.1	+	25	3510	c.3304G>T	c.(3304-3306)Gtg>Ttg	p.V1102L	FER1L6-AS2_ENST00000520031.1_RNA|FER1L6-AS2_ENST00000601180.1_RNA|FER1L6_ENST00000399018.1_Missense_Mutation_p.V1102L	NM_001039112.2	NP_001034201.2	Q2WGJ9	FR1L6_HUMAN	fer-1-like family member 6	1102						integral component of membrane (GO:0016021)				NS(2)|breast(3)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(18)|liver(1)|lung(49)|ovary(5)|prostate(3)|skin(8)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(1)	118	Lung NSC(37;4.1e-12)|Ovarian(258;0.00438)|all_neural(195;0.0741)		STAD - Stomach adenocarcinoma(47;0.00186)			CATCACACAGGTGGATGGAAC	0.517																																					p.V1102L		Atlas-SNP	.											.	FER1L6	268	.	0			c.G3304T						.						82.0	85.0	84.0					8																	125074249		1956	4151	6107	SO:0001583	missense	654463	exon25			ACACAGGTGGATG	AB196633	CCDS43767.1	8q24.13	2014-06-27	2014-06-27		ENSG00000214814	ENSG00000214814			28065	protein-coding gene	gene with protein product			"""fer-1-like 6 (C. elegans)"""				Standard	NM_001039112		Approved	C8ORFK23	uc003yqw.3	Q2WGJ9	OTTHUMG00000164998	ENST00000522917.1:c.3304G>T	chr8.hg19:g.125074249G>T	ENSP00000428280:p.Val1102Leu	111.0	0.0		268.0	213.0	NM_001039112		Missense_Mutation	SNP	ENST00000522917.1	hg19	CCDS43767.1	.	.	.	.	.	.	.	.	.	.	G	2.569	-0.300040	0.05532	.	.	ENSG00000214814	ENST00000522917;ENST00000399018	T;T	0.80824	-1.42;-1.42	5.51	0.735	0.18300	C2 calcium/lipid-binding domain, CaLB (1);	.	.	.	.	T	0.62380	0.2423	N	0.12182	0.205	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.46857	-0.9161	9	0.27785	T	0.31	0.0988	9.3562	0.38168	0.3681:0.0:0.6319:0.0	.	1102	Q2WGJ9	FR1L6_HUMAN	L	1102	ENSP00000428280:V1102L;ENSP00000381982:V1102L	ENSP00000381982:V1102L	V	+	1	0	FER1L6	125143430	0.402000	0.25311	0.003000	0.11579	0.001000	0.01503	0.134000	0.15932	0.142000	0.18901	-0.122000	0.15005	GTG	.	.		0.517	FER1L6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381400.1	NM_001039112	
COL22A1	169044	hgsc.bcm.edu	37	8	139737668	139737668	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr8:139737668G>A	ENST00000303045.6	-	24	2601	c.2155C>T	c.(2155-2157)Cct>Tct	p.P719S	COL22A1_ENST00000435777.1_Missense_Mutation_p.P719S	NM_152888.1	NP_690848.1	Q8NFW1	COMA1_HUMAN	collagen, type XXII, alpha 1	719	Collagen-like 5.|Gly-rich.|Pro-rich.				extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(14)|large_intestine(29)|lung(107)|ovary(13)|pancreas(1)|prostate(3)|skin(12)|upper_aerodigestive_tract(15)|urinary_tract(4)	211	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0517)			GGGACACCAGGGGGTCCTGGA	0.582										HNSCC(7;0.00092)																											p.P719S		Atlas-SNP	.											COL22A1,mucosal,malignant_melanoma,0,1	COL22A1	390	.	0			c.C2155T						.						51.0	59.0	56.0					8																	139737668		2203	4300	6503	SO:0001583	missense	169044	exon24			CACCAGGGGGTCC	AF406780	CCDS6376.1	8q24.3	2013-01-16			ENSG00000169436	ENSG00000169436		"""Collagens"""	22989	protein-coding gene	gene with protein product		610026					Standard	NM_152888		Approved		uc003yvd.3	Q8NFW1	OTTHUMG00000150035	ENST00000303045.6:c.2155C>T	chr8.hg19:g.139737668G>A	ENSP00000303153:p.Pro719Ser	92.0	0.0		212.0	10.0	NM_152888	B7ZMH0|C9K0G4|Q8IVT9	Missense_Mutation	SNP	ENST00000303045.6	hg19	CCDS6376.1	.	.	.	.	.	.	.	.	.	.	G	12.83	2.054787	0.36277	.	.	ENSG00000169436	ENST00000303045;ENST00000435777;ENST00000545577	D;D	0.98649	-5.05;-5.05	4.94	4.07	0.47477	.	0.000000	0.49916	D	0.000132	D	0.97414	0.9154	M	0.77820	2.39	0.44485	D	0.997428	B;B	0.31931	0.347;0.186	B;B	0.35859	0.135;0.212	D	0.96101	0.9069	10	0.20046	T	0.44	.	9.9387	0.41567	0.0965:0.0:0.9035:0.0	.	719;719	Q8NFW1-2;Q8NFW1	.;COMA1_HUMAN	S	719;719;432	ENSP00000303153:P719S;ENSP00000387655:P719S	ENSP00000303153:P719S	P	-	1	0	COL22A1	139806850	0.982000	0.34865	0.638000	0.29380	0.820000	0.46376	2.896000	0.48656	1.390000	0.46547	-0.140000	0.14226	CCT	.	.		0.582	COL22A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000315905.2	XM_291257	
KCNK9	51305	hgsc.bcm.edu	37	8	140631020	140631020	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr8:140631020G>T	ENST00000520439.1	-	2	669	c.606C>A	c.(604-606)ttC>ttA	p.F202L	KCNK9_ENST00000303015.1_Missense_Mutation_p.F202L|KCNK9_ENST00000523477.1_5'Flank	NM_001282534.1	NP_001269463.1	Q9NPC2	KCNK9_HUMAN	potassium channel, subfamily K, member 9	202					cochlea development (GO:0090102)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)	potassium channel activity (GO:0005267)|voltage-gated ion channel activity (GO:0005244)			NS(1)|endometrium(9)|kidney(1)|large_intestine(9)|lung(17)|ovary(2)|prostate(3)|skin(1)	43	all_cancers(97;3.94e-14)|all_epithelial(106;4.81e-13)|Lung NSC(106;8.18e-05)|all_lung(105;0.00015)|Ovarian(258;0.00235)|Acute lymphoblastic leukemia(118;0.155)	Ovarian(118;0.134)	BRCA - Breast invasive adenocarcinoma(115;0.0855)		Doxapram(DB00561)|Halothane(DB01159)	CGTAGTCCCCGAACCCAATGG	0.587																																					p.F202L		Atlas-SNP	.											.	KCNK9	100	.	0			c.C606A						.						75.0	76.0	75.0					8																	140631020		2203	4300	6503	SO:0001583	missense	51305	exon2			GTCCCCGAACCCA	AF212829	CCDS6377.1	8q24.3	2012-03-07			ENSG00000169427	ENSG00000169427		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	6283	protein-coding gene	gene with protein product		605874				10734076, 16382106	Standard	NM_001282534		Approved	K2p9.1, TASK3, TASK-3	uc003yvf.1	Q9NPC2	OTTHUMG00000164186	ENST00000520439.1:c.606C>A	chr8.hg19:g.140631020G>T	ENSP00000430676:p.Phe202Leu	93.0	0.0		283.0	214.0	NM_016601	Q2M290|Q540F2	Missense_Mutation	SNP	ENST00000520439.1	hg19	CCDS6377.1	.	.	.	.	.	.	.	.	.	.	G	19.36	3.813097	0.70912	.	.	ENSG00000169427	ENST00000522317;ENST00000303015;ENST00000520439	T;T;T	0.28069	1.63;1.63;1.63	5.85	1.55	0.23275	Ion transport 2 (1);	0.000000	0.85682	D	0.000000	T	0.40743	0.1129	L	0.56340	1.77	0.80722	D	1	D	0.64830	0.994	D	0.64237	0.923	T	0.11743	-1.0575	10	0.41790	T	0.15	.	6.5738	0.22553	0.5716:0.0:0.4284:0.0	.	202	Q9NPC2	KCNK9_HUMAN	L	202	ENSP00000429847:F202L;ENSP00000302166:F202L;ENSP00000430676:F202L	ENSP00000302166:F202L	F	-	3	2	KCNK9	140700202	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	1.107000	0.31110	0.382000	0.24878	0.655000	0.94253	TTC	.	.		0.587	KCNK9-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378473.1	NM_016601	
SCRIB	23513	hgsc.bcm.edu	37	8	144891811	144891811	+	Silent	SNP	G	G	A	rs546935238		TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr8:144891811G>A	ENST00000320476.3	-	14	1614	c.1608C>T	c.(1606-1608)ccC>ccT	p.P536P	SCRIB_ENST00000356994.2_Silent_p.P536P|SCRIB_ENST00000377533.3_Silent_p.P455P	NM_015356.4	NP_056171	Q14160	SCRIB_HUMAN	scribbled planar cell polarity protein	536	Sufficient for targeting to adherens junction and to inhibit cell proliferation.				activation of Rac GTPase activity (GO:0032863)|apoptotic process involved in morphogenesis (GO:0060561)|astrocyte cell migration (GO:0043615)|asymmetric protein localization (GO:0008105)|auditory receptor cell stereocilium organization (GO:0060088)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cochlear nucleus development (GO:0021747)|establishment of apical/basal cell polarity (GO:0035089)|mammary gland duct morphogenesis (GO:0060603)|negative regulation of mitotic cell cycle (GO:0045930)|neural tube closure (GO:0001843)|positive chemotaxis (GO:0050918)|positive regulation of apoptotic process (GO:0043065)|positive regulation of receptor recycling (GO:0001921)|protein localization to adherens junction (GO:0071896)|single organismal cell-cell adhesion (GO:0016337)|synaptic vesicle endocytosis (GO:0048488)|synaptic vesicle targeting (GO:0016080)|viral process (GO:0016032)|wound healing (GO:0042060)	basolateral plasma membrane (GO:0016323)|cell projection (GO:0042995)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|myelin sheath abaxonal region (GO:0035748)|plasma membrane (GO:0005886)|Scrib-APC-beta-catenin complex (GO:0034750)				NS(1)|autonomic_ganglia(1)|central_nervous_system(2)|endometrium(3)|kidney(3)|large_intestine(3)|lung(20)|ovary(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	42	all_cancers(97;2.31e-11)|all_epithelial(106;1.58e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;1.23e-39)|all cancers(56;1.12e-34)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.18)			ACGGGCCCTCGGGCTCAGCCT	0.662													G|||	1	0.000199681	0.0	0.0	5008	,	,		16028	0.0		0.0	False		,,,				2504	0.001				p.P536P	Pancreas(51;966 1133 10533 14576 29674)	Atlas-SNP	.											.	SCRIB	192	.	0			c.C1608T						.						57.0	55.0	55.0					8																	144891811		2203	4300	6503	SO:0001819	synonymous_variant	23513	exon14			GCCCTCGGGCTCA	AY062238	CCDS6411.1, CCDS6412.1	8q24.3	2013-03-05	2013-03-05		ENSG00000180900	ENSG00000180900			30377	protein-coding gene	gene with protein product		607733	"""scribbled homolog (Drosophila)"""			11027293, 14681682	Standard	NM_182706		Approved	KIAA0147, SCRB1, Vartul	uc003yzo.1	Q14160	OTTHUMG00000165154	ENST00000320476.3:c.1608C>T	chr8.hg19:g.144891811G>A		51.0	0.0		121.0	94.0	NM_015356	Q6P496|Q7Z5D1|Q8WWV8|Q96C69|Q96GG1	Silent	SNP	ENST00000320476.3	hg19	CCDS6411.1																																																																																			.	.		0.662	SCRIB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000382215.1	NM_015356	
SMARCA2	6595	hgsc.bcm.edu	37	9	2097384	2097385	+	Splice_Site	DNP	GG	GG	TC			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr9:2097384_2097385GG>TC	ENST00000382203.1	+	21	3200_3201	c.2991_2992GG>TC	c.(2989-2994)aaGGgg>aaTCgg	p.997_998KG>NR	SMARCA2_ENST00000357248.2_Splice_Site_p.997_998KG>NR|SMARCA2_ENST00000349721.2_Splice_Site_p.997_998KG>NR|SMARCA2_ENST00000382194.1_Splice_Site_p.997_998KG>NR			P51531	SMCA2_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2	997					aortic smooth muscle cell differentiation (GO:0035887)|ATP catabolic process (GO:0006200)|chromatin remodeling (GO:0006338)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)	intermediate filament cytoskeleton (GO:0045111)|intracellular membrane-bounded organelle (GO:0043231)|nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	ATP binding (GO:0005524)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)|RNA polymerase II transcription coactivator activity (GO:0001105)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(11)|liver(2)|lung(19)|ovary(3)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	56		all_lung(10;2.06e-09)|Lung NSC(10;2.43e-09)		GBM - Glioblastoma multiforme(50;0.0475)		CTGGTTCTTAGGGGAAAGGAGG	0.381																																					.|p.G998R		Atlas-SNP	.											.	SMARCA2	313	.	0			c.2992-1G>T|c.G2992C						.																																			SO:0001630	splice_region_variant	6595	exon21			TTCTTAGGGGAAA|TCTTAGGGGAAAG	D26155	CCDS34977.1, CCDS34978.1, CCDS75807.1, CCDS75808.1	9p24.3	2008-11-11	2006-11-09		ENSG00000080503	ENSG00000080503			11098	protein-coding gene	gene with protein product		600014		SNF2L2		8012116	Standard	NM_003070		Approved	BAF190, hSNF2a, hBRM, Sth1p, SNF2LA, BRM, SNF2, SWI2	uc003zhc.3	P51531	OTTHUMG00000019445	Exception_encountered	chr9.hg19:g.2097384_2097385delinsTC		50.0	0.0		84.0	38.0	NM_003070|NM_139045	B1ALG3|B1ALG4|D3DRH4|D3DRH5	Splice_Site|Missense_Mutation	SNP	ENST00000382203.1	hg19	CCDS34977.1																																																																																			.	.		0.381	SMARCA2-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000051505.1	NM_003070	Missense_Mutation
KIAA2026	158358	hgsc.bcm.edu	37	9	5923025	5923025	+	Silent	SNP	A	A	G			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr9:5923025A>G	ENST00000399933.3	-	8	2970	c.2971T>C	c.(2971-2973)Ttg>Ctg	p.L991L	KIAA2026_ENST00000381461.2_Silent_p.L961L	NM_001017969.2	NP_001017969.2	Q5HYC2	K2026_HUMAN	KIAA2026	991										breast(6)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(11)|lung(15)|ovary(2)|prostate(2)|skin(1)	46		Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.00155)|Lung(218;0.124)		ACTGAATCCAATGAGGCAAAT	0.398																																					p.L991L		Atlas-SNP	.											.	KIAA2026	231	.	0			c.T2971C						.						144.0	135.0	137.0					9																	5923025		1903	4127	6030	SO:0001819	synonymous_variant	158358	exon8			AATCCAATGAGGC	AB095946		9p24.1	2014-01-10			ENSG00000183354	ENSG00000183354			23378	protein-coding gene	gene with protein product							Standard	NM_001017969		Approved	FLJ20375	uc003zjq.4	Q5HYC2	OTTHUMG00000019507	ENST00000399933.3:c.2971T>C	chr9.hg19:g.5923025A>G		146.0	0.0		167.0	61.0	NM_001017969	A8MTP2|B9EGW7|Q4VXA2|Q8IVE5	Silent	SNP	ENST00000399933.3	hg19																																																																																				.	.		0.398	KIAA2026-002	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000051652.2	NM_001017969	
VCP	7415	hgsc.bcm.edu	37	9	35068346	35068346	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr9:35068346C>T	ENST00000358901.6	-	2	926	c.31G>A	c.(31-33)Gac>Aac	p.D11N		NM_007126.3	NP_009057.1	P55072	TERA_HUMAN	valosin containing protein	11					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|aggresome assembly (GO:0070842)|cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER to Golgi vesicle-mediated transport (GO:0006888)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|establishment of protein localization (GO:0045184)|positive regulation of Lys63-specific deubiquitinase activity (GO:1903007)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein complex assembly (GO:0031334)|positive regulation of protein K63-linked deubiquitination (GO:1903006)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein homooligomerization (GO:0051260)|protein N-linked glycosylation via asparagine (GO:0018279)|protein ubiquitination (GO:0016567)|regulation of apoptotic process (GO:0042981)|retrograde protein transport, ER to cytosol (GO:0030970)|translesion synthesis (GO:0019985)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|Hrd1p ubiquitin ligase complex (GO:0000836)|intracellular membrane-bounded organelle (GO:0043231)|lipid particle (GO:0005811)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|proteasome complex (GO:0000502)|site of double-strand break (GO:0035861)	ADP binding (GO:0043531)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|deubiquitinase activator activity (GO:0035800)|lipid binding (GO:0008289)|poly(A) RNA binding (GO:0044822)|polyubiquitin binding (GO:0031593)|protein domain specific binding (GO:0019904)|protein phosphatase binding (GO:0019903)|ubiquitin-specific protease binding (GO:1990381)			breast(3)|endometrium(2)|kidney(1)|large_intestine(4)|lung(10)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	24			LUSC - Lung squamous cell carcinoma(32;0.00343)|Lung(28;0.00778)			GTTGATAGGTCATCACCTTTT	0.458																																					p.D11N		Atlas-SNP	.											.	VCP	64	.	0			c.G31A						.						222.0	202.0	209.0					9																	35068346		2203	4300	6503	SO:0001583	missense	7415	exon2			ATAGGTCATCACC	AC004472	CCDS6573.1	9p13.3	2014-09-17	2011-01-25		ENSG00000165280	ENSG00000165280		"""ATPases / AAA-type"""	12666	protein-coding gene	gene with protein product		601023	"""valosin-containing protein"""			8595912, 7553851	Standard	NM_007126		Approved	IBMPFD, p97	uc003zvy.2	P55072	OTTHUMG00000019855	ENST00000358901.6:c.31G>A	chr9.hg19:g.35068346C>T	ENSP00000351777:p.Asp11Asn	57.0	0.0		93.0	34.0	NM_007126	B2R5T8|Q0V924|Q2TAI5|Q969G7|Q9UCD5	Missense_Mutation	SNP	ENST00000358901.6	hg19	CCDS6573.1	.	.	.	.	.	.	.	.	.	.	C	21.6	4.168585	0.78339	.	.	ENSG00000165280	ENST00000358901	D	0.95137	-3.62	6.06	6.06	0.98353	.	0.000000	0.85682	D	0.000000	D	0.94778	0.8314	M	0.80746	2.51	0.80722	D	1	B	0.15719	0.014	B	0.19946	0.027	D	0.91181	0.4976	10	0.52906	T	0.07	-6.7381	18.8014	0.92018	0.0:1.0:0.0:0.0	.	11	P55072	TERA_HUMAN	N	11	ENSP00000351777:D11N	ENSP00000351777:D11N	D	-	1	0	VCP	35058346	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	7.703000	0.84585	2.882000	0.98803	0.655000	0.94253	GAC	.	.		0.458	VCP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052290.1	NM_007126	
KIAA1958	158405	hgsc.bcm.edu	37	9	115421771	115421771	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr9:115421771G>A	ENST00000337530.6	+	4	1869	c.1573G>A	c.(1573-1575)Gcg>Acg	p.A525T	KIAA1958_ENST00000536272.1_Missense_Mutation_p.A553T	NM_133465.2	NP_597722.1	Q8N8K9	K1958_HUMAN	KIAA1958	525										endometrium(1)|large_intestine(9)|lung(10)|prostate(2)|skin(3)	25						CATGTCGGGCGCGCGTTCTCG	0.577																																					p.A525T		Atlas-SNP	.											.	KIAA1958	52	.	0			c.G1573A						.						61.0	50.0	54.0					9																	115421771		2203	4300	6503	SO:0001583	missense	158405	exon4			TCGGGCGCGCGTT	AB075838	CCDS35108.1, CCDS69642.1	9q33.1	2009-09-22			ENSG00000165185	ENSG00000165185			23427	protein-coding gene	gene with protein product							Standard	NM_001287038		Approved	FLJ39294	uc004bgf.1	Q8N8K9	OTTHUMG00000020508	ENST00000337530.6:c.1573G>A	chr9.hg19:g.115421771G>A	ENSP00000336940:p.Ala525Thr	117.0	0.0		159.0	69.0	NM_133465	B7ZKW6|Q2M336|Q5T252|Q8TF43|Q96N02	Missense_Mutation	SNP	ENST00000337530.6	hg19	CCDS35108.1	.	.	.	.	.	.	.	.	.	.	G	9.400	1.077732	0.20227	.	.	ENSG00000165185	ENST00000337530;ENST00000536272	.	.	.	5.66	5.66	0.87406	.	.	.	.	.	T	0.17577	0.0422	N	0.08118	0	0.23972	N	0.996306	P;B	0.35226	0.491;0.198	B;B	0.25405	0.06;0.016	T	0.07849	-1.0751	8	0.13853	T	0.58	.	14.2383	0.65941	0.0:0.0:0.8507:0.1493	.	553;525	B7ZKW6;Q8N8K9	.;K1958_HUMAN	T	525;553	.	ENSP00000336940:A525T	A	+	1	0	KIAA1958	114461592	1.000000	0.71417	0.961000	0.40146	0.924000	0.55760	4.771000	0.62318	2.676000	0.91093	0.655000	0.94253	GCG	.	.		0.577	KIAA1958-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000053690.1	NM_133465	
MRPS2	51116	hgsc.bcm.edu	37	9	138392921	138392921	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr9:138392921C>T	ENST00000371785.1	+	3	330	c.121C>T	c.(121-123)Ctt>Ttt	p.L41F	MRPS2_ENST00000488610.1_3'UTR|RP11-426A6.5_ENST00000415062.1_RNA|C9orf116_ENST00000429260.2_5'Flank|C9orf116_ENST00000371789.3_5'Flank|MRPS2_ENST00000241600.5_Missense_Mutation_p.L41F|C9orf116_ENST00000371791.1_Intron			Q9Y399	RT02_HUMAN	mitochondrial ribosomal protein S2	41					translation (GO:0006412)	mitochondrion (GO:0005739)|small ribosomal subunit (GO:0015935)	structural constituent of ribosome (GO:0003735)			large_intestine(2)|lung(1)|prostate(2)|urinary_tract(1)	6				OV - Ovarian serous cystadenocarcinoma(145;1.46e-53)|Epithelial(140;2.04e-47)|all cancers(34;1.23e-42)		CCGCAGGACGCTTGGAAGCGC	0.701																																					p.L41F		Atlas-SNP	.											.	MRPS2	17	.	0			c.C121T						.						9.0	11.0	10.0					9																	138392921		2146	4231	6377	SO:0001583	missense	51116	exon2			AGGACGCTTGGAA	AB051627	CCDS6990.1	9q34	2012-09-13			ENSG00000122140	ENSG00000122140		"""Mitochondrial ribosomal proteins / small subunits"""	14495	protein-coding gene	gene with protein product		611971					Standard	NM_016034		Approved	CGI-91	uc004cfv.5	Q9Y399	OTTHUMG00000020910	ENST00000371785.1:c.121C>T	chr9.hg19:g.138392921C>T	ENSP00000360850:p.Leu41Phe	68.0	0.0		89.0	29.0	NM_016034	Q5T899|Q9BSQ4	Missense_Mutation	SNP	ENST00000371785.1	hg19	CCDS6990.1	.	.	.	.	.	.	.	.	.	.	C	13.67	2.306675	0.40795	.	.	ENSG00000122140	ENST00000371785;ENST00000241600;ENST00000453385	T;T;T	0.34667	1.84;1.84;1.35	4.17	-2.89	0.05665	.	2.045970	0.02694	U	0.111049	T	0.24812	0.0602	L	0.48642	1.525	0.09310	N	1	B	0.09022	0.002	B	0.04013	0.001	T	0.06954	-1.0798	10	0.10636	T	0.68	-1.7267	1.6937	0.02857	0.1388:0.3989:0.1476:0.3147	.	41	Q9Y399	RT02_HUMAN	F	41;41;55	ENSP00000360850:L41F;ENSP00000241600:L41F;ENSP00000400082:L55F	ENSP00000241600:L41F	L	+	1	0	MRPS2	137532742	0.000000	0.05858	0.002000	0.10522	0.091000	0.18340	-0.389000	0.07342	-0.154000	0.11118	0.484000	0.47621	CTT	.	.		0.701	MRPS2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000054998.1		
PTGDS	5730	hgsc.bcm.edu	37	9	139873558	139873558	+	Silent	SNP	C	C	A			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr9:139873558C>A	ENST00000371625.3	+	2	302	c.228C>A	c.(226-228)ggC>ggA	p.G76G	RP11-229P13.19_ENST00000413913.2_RNA|PTGDS_ENST00000460340.1_3'UTR|PTGDS_ENST00000224167.2_Silent_p.G76G	NM_000954.5	NP_000945.3	P41222	PTGDS_HUMAN	prostaglandin D2 synthase 21kDa (brain)	76					arachidonic acid metabolic process (GO:0019369)|cyclooxygenase pathway (GO:0019371)|prostaglandin biosynthetic process (GO:0001516)|regulation of circadian sleep/wake cycle, sleep (GO:0045187)|response to glucocorticoid (GO:0051384)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)	endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|rough endoplasmic reticulum (GO:0005791)	fatty acid binding (GO:0005504)|prostaglandin-D synthase activity (GO:0004667)|retinoid binding (GO:0005501)|transporter activity (GO:0005215)			endometrium(2)|kidney(1)|lung(3)|ovary(1)	7	all_cancers(76;0.11)	Myeloproliferative disorder(178;0.0511)	STAD - Stomach adenocarcinoma(284;0.19)	OV - Ovarian serous cystadenocarcinoma(145;2.94e-05)|Epithelial(140;0.00048)		CGGATGGTGGCCTCAACCTGA	0.662																																					p.G76G		Atlas-SNP	.											.	PTGDS	15	.	0			c.C228A						.						70.0	71.0	71.0					9																	139873558		2203	4300	6503	SO:0001819	synonymous_variant	5730	exon2			TGGTGGCCTCAAC	AA621632	CCDS7019.1	9q34.2-q34.3	2011-11-15	2002-08-29		ENSG00000107317	ENSG00000107317	5.3.99.2	"""Lipocalins"""	9592	protein-coding gene	gene with protein product	"""lipocalin-type prostaglandin D synthase"""	176803	"""prostaglandin D2 synthase (21kD, brain)"""			1902577	Standard	NM_000954		Approved	PGDS, L-PGDS	uc004cke.3	P41222	OTTHUMG00000020957	ENST00000371625.3:c.228C>A	chr9.hg19:g.139873558C>A		67.0	0.0		79.0	28.0	NM_000954	B2R727|Q5SQ10|Q7M4P3|Q9UC22|Q9UCC9|Q9UCD9	Silent	SNP	ENST00000371625.3	hg19	CCDS7019.1	.	.	.	.	.	.	.	.	.	.	c	7.848	0.723455	0.15439	.	.	ENSG00000107317	ENST00000446677	.	.	.	4.44	-2.1	0.07210	.	.	.	.	.	T	0.20901	0.0503	.	.	.	0.09310	N	0.999994	.	.	.	.	.	.	T	0.28933	-1.0028	4	.	.	.	-7.4149	3.3462	0.07136	0.4232:0.3251:0.1661:0.0856	.	.	.	.	T	99	.	.	P	+	1	0	PTGDS	138993379	0.001000	0.12720	0.004000	0.12327	0.050000	0.14768	0.583000	0.23849	-0.016000	0.14127	0.457000	0.33378	CCT	.	.		0.662	PTGDS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055188.1	NM_000954	
FAM208B	54906	hgsc.bcm.edu	37	10	5803296	5803296	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr10:5803296T>C	ENST00000328090.5	+	19	7661	c.7036T>C	c.(7036-7038)Ttt>Ctt	p.F2346L		NM_017782.4	NP_060252	Q5VWN6	F208B_HUMAN	family with sequence similarity 208, member B	2346																	GTTGAAGTCATTTCAGAGTGC	0.318																																					p.F2346L		Atlas-SNP	.											.	.	.	.	0			c.T7036C						.						114.0	108.0	110.0					10																	5803296		1876	4107	5983	SO:0001583	missense	54906	exon19			AAGTCATTTCAGA	BX649177	CCDS41485.1	10p15.1	2011-09-14	2011-09-14	2011-09-14	ENSG00000108021	ENSG00000108021			23484	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 18"""	C10orf18		12477932	Standard	NM_017782		Approved	FLJ20360, bA318E3.2, KIAA2006	uc001iij.3	Q5VWN6	OTTHUMG00000017605	ENST00000328090.5:c.7036T>C	chr10.hg19:g.5803296T>C	ENSP00000328426:p.Phe2346Leu	54.0	0.0		35.0	13.0	NM_017782	Q2YD91|Q5VWN5|Q6ZRQ8|Q8IVG4|Q9BUZ7|Q9H5J9|Q9H7A4|Q9H996|Q9NXA1	Missense_Mutation	SNP	ENST00000328090.5	hg19	CCDS41485.1	.	.	.	.	.	.	.	.	.	.	T	11.66	1.705558	0.30232	.	.	ENSG00000108021	ENST00000328090;ENST00000442808	T	0.44083	0.93	6.06	6.06	0.98353	.	0.546345	0.18169	N	0.149519	T	0.27933	0.0688	N	0.08118	0	0.09310	N	1	B	0.16802	0.019	B	0.14023	0.01	T	0.23691	-1.0181	10	0.49607	T	0.09	.	16.2741	0.82634	0.0:0.0:0.0:1.0	.	2346	Q5VWN6	F208B_HUMAN	L	2346;1541	ENSP00000328426:F2346L	ENSP00000328426:F2346L	F	+	1	0	C10orf18	5843302	0.304000	0.24472	0.026000	0.17262	0.115000	0.19883	3.773000	0.55333	2.322000	0.78497	0.528000	0.53228	TTT	.	.		0.318	FAM208B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046571.2	NM_017782	
ITIH5	80760	hgsc.bcm.edu	37	10	7679202	7679202	+	Missense_Mutation	SNP	C	C	A	rs374950629		TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr10:7679202C>A	ENST00000256861.6	-	5	719	c.641G>T	c.(640-642)gGg>gTg	p.G214V	ITIH5_ENST00000397146.2_Missense_Mutation_p.G214V|ITIH5_ENST00000446830.2_5'UTR|ITIH5_ENST00000397145.2_Missense_Mutation_p.G214V|ITIH5_ENST00000434980.1_5'UTR	NM_030569.6	NP_085046.5	Q86UX2	ITIH5_HUMAN	inter-alpha-trypsin inhibitor heavy chain family, member 5	214					hyaluronan metabolic process (GO:0030212)	extracellular region (GO:0005576)	serine-type endopeptidase inhibitor activity (GO:0004867)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(5)|kidney(6)|large_intestine(21)|lung(25)|ovary(4)|pancreas(1)|skin(2)|stomach(1)|urinary_tract(3)	75						TTCCCCGCGCCCACTGCCCCT	0.622																																					p.G214V		Atlas-SNP	.											ITIH5_ENST00000397145,right_upper_lobe,carcinoma,0,2	ITIH5	343	.	0			c.G641T						.						97.0	102.0	100.0					10																	7679202		2203	4300	6503	SO:0001583	missense	80760	exon5			CCGCGCCCACTGC			10p14	2011-10-26	2011-10-26		ENSG00000123243	ENSG00000123243			21449	protein-coding gene	gene with protein product		609783	"""inter-alpha (globulin) inhibitor H5"""			14744536	Standard	NM_001001851		Approved	MGC10848	uc021pmv.1	Q86UX2	OTTHUMG00000017635	ENST00000256861.6:c.641G>T	chr10.hg19:g.7679202C>A	ENSP00000256861:p.Gly214Val	51.0	1.0		37.0	15.0	NM_001001851	Q5T664|Q5T665|Q5T666|Q6AI60|Q6UXB7|Q8TF48|Q8WYV2|Q96K70	Missense_Mutation	SNP	ENST00000256861.6	hg19		.	.	.	.	.	.	.	.	.	.	C	2.503	-0.314641	0.05422	.	.	ENSG00000123243	ENST00000256861;ENST00000397146;ENST00000397145	T;T;T	0.02579	4.78;4.24;4.25	5.88	3.99	0.46301	.	0.601900	0.19381	N	0.115661	T	0.02571	0.0078	.	.	.	0.30486	N	0.771832	B;B	0.14438	0.01;0.009	B;B	0.20384	0.029;0.01	T	0.25779	-1.0122	9	0.30078	T	0.28	-25.4834	7.8408	0.29397	0.0:0.726:0.1343:0.1397	.	214;214	G5E9D8;Q86UX2	.;ITIH5_HUMAN	V	214	ENSP00000256861:G214V;ENSP00000380333:G214V;ENSP00000380332:G214V	ENSP00000256861:G214V	G	-	2	0	ITIH5	7719208	0.000000	0.05858	0.047000	0.18901	0.181000	0.23173	0.735000	0.26115	0.783000	0.33636	0.655000	0.94253	GGG	.	.		0.622	ITIH5-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000046688.1	NM_030569	
FRMPD2	143162	hgsc.bcm.edu	37	10	49450281	49450281	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr10:49450281C>T	ENST00000374201.3	-	5	792	c.490G>A	c.(490-492)Gaa>Aaa	p.E164K	FRMPD2_ENST00000305531.3_Missense_Mutation_p.E140K|FRMPD2_ENST00000407470.4_Missense_Mutation_p.E133K	NM_001018071.3|NM_001042512.2	NP_001018081|NP_001035977.2	Q68DX3	FRPD2_HUMAN	FERM and PDZ domain containing 2	164	KIND. {ECO:0000255|PROSITE- ProRule:PRU00709}.				tight junction assembly (GO:0070830)	basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|tight junction (GO:0005923)	1-phosphatidylinositol binding (GO:0005545)	p.E164K(1)		NS(2)|autonomic_ganglia(2)|breast(5)|cervix(1)|endometrium(3)|kidney(7)|large_intestine(15)|lung(24)|ovary(2)|prostate(1)|skin(3)|urinary_tract(1)	66				Kidney(211;0.201)		ACAGACACTTCTTTCTCATGA	0.557																																					p.E164K		Atlas-SNP	.											FRMPD2,NS,NS,0,1	FRMPD2	157	.	1	Substitution - Missense(1)	NS(1)	c.G490A						.						105.0	102.0	103.0					10																	49450281		2203	4300	6503	SO:0001583	missense	143162	exon5			ACACTTCTTTCTC	AK123038	CCDS31195.1	10q11	2010-10-13			ENSG00000170324	ENSG00000170324			28572	protein-coding gene	gene with protein product		613323	"""PDZ domain containing 5C"""	PDZD5C, PDZK5C			Standard	NM_001018071		Approved	MGC35285	uc001jdv.3	Q68DX3	OTTHUMG00000018171	ENST00000374201.3:c.490G>A	chr10.hg19:g.49450281C>T	ENSP00000363317:p.Glu164Lys	178.0	0.0		112.0	40.0	NM_001018071	B7WNW0|B7ZML5|Q2VY07|Q6GMQ9|Q6ZN38|Q6ZWI2|Q8N5T9	Missense_Mutation	SNP	ENST00000374201.3	hg19	CCDS31195.1	.	.	.	.	.	.	.	.	.	.	C	22.1	4.244293	0.79912	.	.	ENSG00000170324	ENST00000374201;ENST00000305531;ENST00000407470	T;T;T	0.32988	1.43;1.43;1.43	5.19	5.19	0.71726	KIND (2);	.	.	.	.	T	0.38374	0.1038	L	0.46157	1.445	0.24214	N	0.99546	D;P;D	0.55385	0.971;0.839;0.971	P;B;P	0.49752	0.621;0.298;0.621	T	0.25676	-1.0125	9	0.66056	D	0.02	.	14.2141	0.65781	0.0:1.0:0.0:0.0	.	140;164;133	Q68DX3-2;Q68DX3;F8WCT2	.;FRPD2_HUMAN;.	K	164;140;133	ENSP00000363317:E164K;ENSP00000307079:E140K;ENSP00000384339:E133K	ENSP00000307079:E140K	E	-	1	0	FRMPD2	49120287	0.989000	0.36119	0.213000	0.23690	0.979000	0.70002	2.979000	0.49313	2.430000	0.82344	0.655000	0.94253	GAA	.	.		0.557	FRMPD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047923.3	NM_152428	
TET1	80312	hgsc.bcm.edu	37	10	70405127	70405127	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr10:70405127A>G	ENST00000373644.4	+	4	2850	c.2641A>G	c.(2641-2643)Atg>Gtg	p.M881V		NM_030625.2	NP_085128.2	Q8NFU7	TET1_HUMAN	tet methylcytosine dioxygenase 1	881					chromatin modification (GO:0016568)|DNA demethylation (GO:0080111)|inner cell mass cell differentiation (GO:0001826)|negative regulation of methylation-dependent chromatin silencing (GO:0090310)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein O-linked glycosylation (GO:0006493)|regulation of DNA methylation (GO:0044030)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	iron ion binding (GO:0005506)|methylcytosine dioxygenase activity (GO:0070579)|structure-specific DNA binding (GO:0043566)|zinc ion binding (GO:0008270)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(2)|ovary(5)|prostate(1)|upper_aerodigestive_tract(2)	21						CTTATCGTTAATGAAAGATAG	0.418																																					p.M881V		Atlas-SNP	.											.	TET1	255	.	0			c.A2641G						.						114.0	119.0	117.0					10																	70405127		2203	4300	6503	SO:0001583	missense	80312	exon4			TCGTTAATGAAAG	AF430147	CCDS7281.1	10q21	2014-02-18	2011-09-30	2008-03-12	ENSG00000138336	ENSG00000138336			29484	protein-coding gene	gene with protein product	"""leukemia-associated protein with a CXXC domain"", ""ten-eleven translocation-1"""	607790	"""CXXC zinc finger 6"", ""tet oncogene 1"""	CXXC6		12124344, 12646957	Standard	NM_030625		Approved	LCX, KIAA1676, bA119F7.1	uc001jok.4	Q8NFU7	OTTHUMG00000018359	ENST00000373644.4:c.2641A>G	chr10.hg19:g.70405127A>G	ENSP00000362748:p.Met881Val	71.0	0.0		62.0	24.0	NM_030625	Q5VUP7|Q7Z6B6|Q8TCR1|Q9C0I7	Missense_Mutation	SNP	ENST00000373644.4	hg19	CCDS7281.1	.	.	.	.	.	.	.	.	.	.	A	7.620	0.676566	0.14841	.	.	ENSG00000138336	ENST00000373644	T	0.06608	3.28	5.79	3.43	0.39272	.	0.315990	0.29884	N	0.010949	T	0.05456	0.0144	L	0.34521	1.04	0.28600	N	0.909208	B	0.09022	0.002	B	0.08055	0.003	T	0.27606	-1.0069	10	0.31617	T	0.26	.	9.2148	0.37339	0.8572:0.0:0.1428:0.0	.	881	Q8NFU7	TET1_HUMAN	V	881	ENSP00000362748:M881V	ENSP00000362748:M881V	M	+	1	0	TET1	70075133	1.000000	0.71417	0.477000	0.27303	0.555000	0.35460	4.048000	0.57390	0.449000	0.26747	0.455000	0.32223	ATG	.	.		0.418	TET1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048354.1	NM_030625	
CHST3	9469	hgsc.bcm.edu	37	10	73767615	73767615	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr10:73767615C>A	ENST00000373115.4	+	3	1263	c.826C>A	c.(826-828)Cgc>Agc	p.R276S		NM_004273.4	NP_004264.2	Q7LGC8	CHST3_HUMAN	carbohydrate (chondroitin 6) sulfotransferase 3	276					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)|sulfur compound metabolic process (GO:0006790)|T cell homeostasis (GO:0043029)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	chondroitin 6-sulfotransferase activity (GO:0008459)|proteoglycan sulfotransferase activity (GO:0050698)|sulfotransferase activity (GO:0008146)			endometrium(1)|lung(5)	6						CAAGGCGGTGCGCATCCGGCA	0.721																																					p.R276S		Atlas-SNP	.											.	CHST3	36	.	0			c.C826A						.						8.0	9.0	9.0					10																	73767615		2161	4181	6342	SO:0001583	missense	9469	exon3			GCGGTGCGCATCC	AB017915	CCDS7312.1	10q22.1	2007-03-14			ENSG00000122863	ENSG00000122863		"""Sulfotransferases, membrane-bound"""	1971	protein-coding gene	gene with protein product		603799				9883891, 9714738	Standard	NM_004273		Approved	C6ST, C6ST1	uc001jsn.3	Q7LGC8	OTTHUMG00000018431	ENST00000373115.4:c.826C>A	chr10.hg19:g.73767615C>A	ENSP00000362207:p.Arg276Ser	19.0	0.0		25.0	10.0	NM_004273	O75099|Q52M30	Missense_Mutation	SNP	ENST00000373115.4	hg19	CCDS7312.1	.	.	.	.	.	.	.	.	.	.	C	20.9	4.066645	0.76301	.	.	ENSG00000122863	ENST00000373115	D	0.84146	-1.81	5.8	5.8	0.92144	Sulfotransferase domain (1);	0.000000	0.85682	D	0.000000	D	0.94112	0.8112	M	0.91663	3.23	0.80722	D	1	D	0.71674	0.998	D	0.70716	0.97	D	0.94771	0.7945	10	0.87932	D	0	-29.025	19.0419	0.93004	0.0:1.0:0.0:0.0	.	276	Q7LGC8	CHST3_HUMAN	S	276	ENSP00000362207:R276S	ENSP00000362207:R276S	R	+	1	0	CHST3	73437621	0.998000	0.40836	0.994000	0.49952	0.980000	0.70556	3.110000	0.50352	2.758000	0.94735	0.561000	0.74099	CGC	.	.		0.721	CHST3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048563.1	NM_004273	
SLC16A12	387700	hgsc.bcm.edu	37	10	91196032	91196032	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr10:91196032C>A	ENST00000341233.4	-	7	1373	c.983G>T	c.(982-984)gGa>gTa	p.G328V	SLC16A12_ENST00000371790.4_Missense_Mutation_p.G358V	NM_213606.3	NP_998771.3	Q6ZSM3	MOT12_HUMAN	solute carrier family 16, member 12	328						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	symporter activity (GO:0015293)			central_nervous_system(1)|endometrium(1)|large_intestine(6)|lung(4)|skin(1)|stomach(1)	14						CCCATCCATTCCCACGGCAAA	0.458																																					p.G358V		Atlas-SNP	.											.	SLC16A12	40	.	0			c.G1073T						.						124.0	110.0	115.0					10																	91196032		2203	4300	6503	SO:0001583	missense	387700	exon7			TCCATTCCCACGG		CCDS7404.1, CCDS7404.2	10q23.32	2013-07-18	2013-07-18		ENSG00000152779	ENSG00000152779		"""Solute carriers"""	23094	protein-coding gene	gene with protein product	"""monocarboxylic acid transporter 12"""	611910	"""solute carrier family 16 (monocarboxylic acid transporters), member 12"", ""solute carrier family 16, member 12 (monocarboxylic acid transporter 12)"""				Standard	NM_213606		Approved	MCT12	uc001kgm.3	Q6ZSM3	OTTHUMG00000018714	ENST00000341233.4:c.983G>T	chr10.hg19:g.91196032C>A	ENSP00000343022:p.Gly328Val	122.0	0.0		80.0	37.0	NM_213606	Q5M9M9|Q5T7J2|Q6ZV76	Missense_Mutation	SNP	ENST00000341233.4	hg19		.	.	.	.	.	.	.	.	.	.	C	19.04	3.749959	0.69533	.	.	ENSG00000152779	ENST00000341233;ENST00000371790	T;T	0.79554	-1.28;-1.28	5.81	4.9	0.64082	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.352154	0.29165	N	0.012949	T	0.77691	0.4168	L	0.39898	1.24	0.80722	D	1	P	0.41748	0.761	P	0.48368	0.575	T	0.72962	-0.4132	10	0.07175	T	0.84	.	15.6609	0.77188	0.0:0.8579:0.1421:0.0	.	328	Q6ZSM3	MOT12_HUMAN	V	328;358	ENSP00000343022:G328V;ENSP00000360855:G358V	ENSP00000343022:G328V	G	-	2	0	SLC16A12	91186012	0.980000	0.34600	1.000000	0.80357	0.972000	0.66771	1.655000	0.37345	1.418000	0.47098	0.591000	0.81541	GGA	.	.		0.458	SLC16A12-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_213606	
NEURL1	9148	hgsc.bcm.edu	37	10	105350084	105350084	+	Nonsense_Mutation	SNP	C	C	A			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr10:105350084C>A	ENST00000369780.4	+	6	2089	c.1680C>A	c.(1678-1680)tgC>tgA	p.C560*	NEURL_ENST00000369777.2_Nonsense_Mutation_p.C543*|SH3PXD2A_ENST00000427662.2_Intron	NM_004210.4	NP_004201.3	O76050	NEUL1_HUMAN		560					brain development (GO:0007420)|cellular response to amino acid stimulus (GO:0071230)|lactation (GO:0007595)|negative regulation of cell proliferation (GO:0008285)|negative regulation of Notch signaling pathway (GO:0045746)|nervous system development (GO:0007399)|Notch signaling pathway (GO:0007219)|positive regulation of apoptotic process (GO:0043065)|positive regulation of dendritic spine development (GO:0060999)|positive regulation of epidermal growth factor-activated receptor activity (GO:0045741)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|positive regulation of synapse maturation (GO:0090129)|protein monoubiquitination (GO:0006513)|skeletal muscle tissue development (GO:0007519)|sperm axoneme assembly (GO:0007288)|sperm motility (GO:0030317)	apical dendrite (GO:0097440)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	ligase activity (GO:0016874)|translation factor activity, non-nucleic acid binding (GO:0045183)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(4)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	17				Epithelial(162;2.12e-09)|all cancers(201;6.99e-08)|BRCA - Breast invasive adenocarcinoma(275;0.125)		GCCCCATCTGCCGCCGCCCCA	0.637																																					p.C560X		Atlas-SNP	.											.	NEURL	38	.	0			c.C1680A						.						67.0	55.0	59.0					10																	105350084		2203	4300	6503	SO:0001587	stop_gained	9148	exon6			CATCTGCCGCCGC																												ENST00000369780.4:c.1680C>A	chr10.hg19:g.105350084C>A	ENSP00000358795:p.Cys560*	77.0	0.0		63.0	17.0	NM_004210	Q5TDR2|Q5TDR3|Q8TAN0|Q9H463	Nonsense_Mutation	SNP	ENST00000369780.4	hg19	CCDS7551.1	.	.	.	.	.	.	.	.	.	.	C	36	5.739640	0.96873	.	.	ENSG00000107954	ENST00000369780;ENST00000369777	.	.	.	5.84	4.89	0.63831	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-20.168	10.3372	0.43856	0.0:0.8432:0.0:0.1568	.	.	.	.	X	560;543	.	ENSP00000358792:C543X	C	+	3	2	NEURL	105340074	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	2.507000	0.45442	1.383000	0.46405	-0.367000	0.07326	TGC	.	.		0.637	NEURL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050170.1		
SORCS1	114815	hgsc.bcm.edu	37	10	108431023	108431023	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr10:108431023A>G	ENST00000263054.6	-	16	2168	c.2161T>C	c.(2161-2163)Tgt>Cgt	p.C721R	SORCS1_ENST00000344440.6_Missense_Mutation_p.C721R|SORCS1_ENST00000369698.1_Missense_Mutation_p.C256R	NM_001206570.1|NM_052918.4	NP_001193499.1|NP_443150.3	Q8WY21	SORC1_HUMAN	sortilin-related VPS10 domain containing receptor 1	721					neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	neuropeptide receptor activity (GO:0008188)			breast(5)|central_nervous_system(1)|cervix(2)|endometrium(9)|kidney(2)|large_intestine(24)|lung(69)|ovary(1)|prostate(8)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	127		Breast(234;0.0256)|Colorectal(252;0.09)|Lung NSC(174;0.168)		Epithelial(162;1.66e-05)|all cancers(201;0.000689)		GTGCAGACACAGGGTTCAGAT	0.433																																					p.C721R		Atlas-SNP	.											.	SORCS1	534	.	0			c.T2161C						.						224.0	192.0	203.0					10																	108431023		2203	4300	6503	SO:0001583	missense	114815	exon16			AGACACAGGGTTC	AF284756	CCDS7559.1	10q23-q25	2004-04-20			ENSG00000108018	ENSG00000108018			16697	protein-coding gene	gene with protein product		606283				11499680	Standard	NM_001206570		Approved	sorCS1	uc001kyl.3	Q8WY21	OTTHUMG00000019018	ENST00000263054.6:c.2161T>C	chr10.hg19:g.108431023A>G	ENSP00000263054:p.Cys721Arg	129.0	0.0		83.0	26.0	NM_001206572	A2RRF4|Q59GG7|Q5JVT7|Q5JVT8|Q5VY14|Q86WQ1|Q86WQ2|Q9H1Y1|Q9H1Y2	Missense_Mutation	SNP	ENST00000263054.6	hg19	CCDS7559.1	.	.	.	.	.	.	.	.	.	.	A	21.7	4.192206	0.78902	.	.	ENSG00000108018	ENST00000369698;ENST00000263054;ENST00000344440	T;T;T	0.61274	0.12;0.32;0.31	5.45	5.45	0.79879	VPS10 (1);	0.000000	0.85682	D	0.000000	T	0.81074	0.4747	M	0.91561	3.22	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	0.999;1.0;1.0;0.999;1.0	D	0.85414	0.1139	9	.	.	.	-16.8096	15.8205	0.78638	1.0:0.0:0.0:0.0	.	721;721;721;721;721	A8K182;Q8WY21-4;Q8WY21-3;Q8WY21;Q8WY21-2	.;.;.;SORC1_HUMAN;.	R	256;721;721	ENSP00000358712:C256R;ENSP00000263054:C721R;ENSP00000345964:C721R	.	C	-	1	0	SORCS1	108421013	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	8.910000	0.92685	2.201000	0.70794	0.533000	0.62120	TGT	.	.		0.433	SORCS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050232.4	NM_052918	
CTBP2	1488	hgsc.bcm.edu	37	10	126715003	126715003	+	Intron	SNP	G	G	A			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr10:126715003G>A	ENST00000337195.5	-	3	458				CTBP2_ENST00000494626.2_Intron|CTBP2_ENST00000411419.2_Intron|CTBP2_ENST00000309035.6_Silent_p.P442P|CTBP2_ENST00000531469.1_Intron	NM_001329.2	NP_001320.1	P56545	CTBP2_HUMAN	C-terminal binding protein 2						negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)|viral genome replication (GO:0019079)|white fat cell differentiation (GO:0050872)	cell junction (GO:0030054)|nucleus (GO:0005634)|synapse (GO:0045202)|transcriptional repressor complex (GO:0017053)	NAD binding (GO:0051287)|oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor (GO:0016616)|transcription corepressor activity (GO:0003714)			breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(7)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	25		all_lung(145;0.0132)|Lung NSC(174;0.0193)|all_neural(114;0.116)|Colorectal(57;0.173)		Colorectal(40;0.00572)|COAD - Colon adenocarcinoma(40;0.0127)|GBM - Glioblastoma multiforme(135;0.147)		CGCAAGGGGTGGGAGAGCTGT	0.677																																					p.P442P		Atlas-SNP	.											.	CTBP2	100	.	0			c.C1326T						.						35.0	38.0	37.0					10																	126715003		2202	4300	6502	SO:0001627	intron_variant	1488	exon1			AGGGGTGGGAGAG	AF016507	CCDS7643.1, CCDS7644.1	10q26.13	2008-08-01			ENSG00000175029	ENSG00000175029			2495	protein-coding gene	gene with protein product		602619				9479502, 11864595	Standard	NM_022802		Approved	ribeye	uc001lie.4	P56545	OTTHUMG00000019224	ENST00000337195.5:c.58+12562C>T	chr10.hg19:g.126715003G>A		117.0	0.0		99.0	44.0	NM_022802	A8K2X5|D3DRF5|O43449|Q5SQP7|Q69YI3|Q86SV0|Q9H2T8	Silent	SNP	ENST00000337195.5	hg19	CCDS7643.1																																																																																			.	.		0.677	CTBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050900.3	NM_001083914	
OR51G1	79324	hgsc.bcm.edu	37	11	4945191	4945191	+	Missense_Mutation	SNP	C	C	A	rs148836962	byFrequency	TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr11:4945191C>A	ENST00000321961.2	-	1	446	c.379G>T	c.(379-381)Gcc>Tcc	p.A127S	MMP26_ENST00000380390.1_Intron|MMP26_ENST00000477339.1_Intron	NM_001005237.1	NP_001005237.1	Q8NGK1	O51G1_HUMAN	olfactory receptor, family 51, subfamily G, member 1	127						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|endometrium(1)|large_intestine(2)|lung(11)|ovary(2)|prostate(3)|skin(4)|soft_tissue(1)	25		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;2.58e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0284)|LUSC - Lung squamous cell carcinoma(625;0.19)		TTGCAGACGGCCACGTAGCGG	0.517																																					p.A127S		Atlas-SNP	.											.	OR51G1	74	.	0			c.G379T						.						112.0	98.0	103.0					11																	4945191		2201	4298	6499	SO:0001583	missense	79324	exon1			AGACGGCCACGTA	AB065793	CCDS31366.1	11p15.4	2012-08-09			ENSG00000176879	ENSG00000176879		"""GPCR / Class A : Olfactory receptors"""	14738	protein-coding gene	gene with protein product				OR51G3P			Standard	NM_001005237		Approved		uc010qyr.2	Q8NGK1	OTTHUMG00000066532	ENST00000321961.2:c.379G>T	chr11.hg19:g.4945191C>A	ENSP00000322546:p.Ala127Ser	103.0	0.0		104.0	26.0	NM_001005237	B9EGW8|Q6IFH6	Missense_Mutation	SNP	ENST00000321961.2	hg19	CCDS31366.1	.	.	.	.	.	.	.	.	.	.	C	14.92	2.678186	0.47886	.	.	ENSG00000176879	ENST00000321961	T	0.52983	0.64	4.2	4.2	0.49525	GPCR, rhodopsin-like superfamily (1);	0.000000	0.39020	U	0.001481	T	0.77994	0.4214	H	0.96175	3.78	0.38309	D	0.943194	D	0.89917	1.0	D	0.91635	0.999	D	0.87237	0.2264	10	0.87932	D	0	.	15.2651	0.73654	0.0:1.0:0.0:0.0	.	127	Q8NGK1	O51G1_HUMAN	S	127	ENSP00000322546:A127S	ENSP00000322546:A127S	A	-	1	0	OR51G1	4901767	1.000000	0.71417	1.000000	0.80357	0.090000	0.18270	4.450000	0.60041	2.169000	0.68431	0.557000	0.71058	GCC	.	C|0.999;T|0.001		0.517	OR51G1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142345.1	NM_001005237	
IGSF22	283284	hgsc.bcm.edu	37	11	18743087	18743087	+	Silent	SNP	G	G	A			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr11:18743087G>A	ENST00000513874.1	-	4	512	c.373C>T	c.(373-375)Ctg>Ttg	p.L125L	RP11-1081L13.4_ENST00000527285.1_RNA	NM_173588.3	NP_775859	Q8N9C0	IGS22_HUMAN	immunoglobulin superfamily, member 22	125	Ig-like 1.									NS(2)|autonomic_ganglia(1)|breast(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(20)|ovary(4)|prostate(4)|skin(3)	56						CGCACCTTCAGCACGTGTTCC	0.602											OREG0020822	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.L125L		Atlas-SNP	.											.	IGSF22	211	.	0			c.C373T						.						125.0	128.0	127.0					11																	18743087		1951	4135	6086	SO:0001819	synonymous_variant	283284	exon4			CCTTCAGCACGTG	AK095113	CCDS41625.1, CCDS41625.2	11p15.1	2014-06-06			ENSG00000179057	ENSG00000179057		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	26750	protein-coding gene	gene with protein product							Standard	NM_173588		Approved	FLJ37794	uc009yht.2	Q8N9C0	OTTHUMG00000160502	ENST00000513874.1:c.373C>T	chr11.hg19:g.18743087G>A		83.0	0.0	90	101.0	30.0	NM_173588	A6NNA0|D6RGV7	Silent	SNP	ENST00000513874.1	hg19	CCDS41625.2																																																																																			.	.		0.602	IGSF22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360850.2	NM_173588	
FSHB	2488	hgsc.bcm.edu	37	11	30255242	30255242	+	Silent	SNP	A	A	T			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr11:30255242A>T	ENST00000417547.1	+	3	324	c.285A>T	c.(283-285)ccA>ccT	p.P95P	FSHB_ENST00000254122.3_Silent_p.P95P|FSHB_ENST00000533718.1_Silent_p.P95P	NM_001018080.1	NP_001018090.1	P01225	FSHB_HUMAN	follicle stimulating hormone, beta polypeptide	95					cellular protein metabolic process (GO:0044267)|female gamete generation (GO:0007292)|female pregnancy (GO:0007565)|follicle-stimulating hormone signaling pathway (GO:0042699)|peptide hormone processing (GO:0016486)|positive regulation of bone resorption (GO:0045780)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|progesterone biosynthetic process (GO:0006701)|regulation of osteoclast differentiation (GO:0045670)|Sertoli cell proliferation (GO:0060011)|signal transduction (GO:0007165)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	hormone activity (GO:0005179)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(5)|ovary(3)|skin(1)	12						ATACATACCCAGTGGCCACCC	0.522																																					p.P95P		Atlas-SNP	.											.	FSHB	28	.	0			c.A285T						.						102.0	83.0	90.0					11																	30255242		2202	4299	6501	SO:0001819	synonymous_variant	2488	exon3			ATACCCAGTGGCC		CCDS7868.1	11p13	2013-02-26				ENSG00000131808		"""Endogenous ligands"""	3964	protein-coding gene	gene with protein product	"""follitropin, beta chain"", ""follicle-stimulating hormone beta subunit"""	136530				2885163, 3151250	Standard	NM_000510		Approved		uc001msm.3	P01225		ENST00000417547.1:c.285A>T	chr11.hg19:g.30255242A>T		117.0	0.0		152.0	32.0	NM_000510	A2TF08|A5JVV3|Q14D61	Silent	SNP	ENST00000417547.1	hg19	CCDS7868.1																																																																																			.	.		0.522	FSHB-003	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389757.1	NM_000510	
ABTB2	25841	hgsc.bcm.edu	37	11	34378765	34378765	+	Silent	SNP	G	G	A			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr11:34378765G>A	ENST00000435224.2	-	1	790	c.366C>T	c.(364-366)gcC>gcT	p.A122A	ABTB2_ENST00000298992.2_5'UTR	NM_145804.2	NP_665803.2	Q8N961	ABTB2_HUMAN	ankyrin repeat and BTB (POZ) domain containing 2	122					cellular response to toxic substance (GO:0097237)	nucleus (GO:0005634)				breast(2)|central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(1)|lung(6)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	25		Acute lymphoblastic leukemia(5;0.0508)|all_hematologic(20;0.0691)				TCACCGCCTCGGCGGAGAACT	0.756																																					p.A122A		Atlas-SNP	.											.	ABTB2	101	.	0			c.C366T						.																																			SO:0001819	synonymous_variant	25841	exon1			CGCCTCGGCGGAG	AK056863	CCDS7890.1, CCDS7890.2	11p13	2013-10-02			ENSG00000166016	ENSG00000166016		"""BTB/POZ domain containing"", ""Ankyrin repeat domain containing"""	23842	protein-coding gene	gene with protein product							Standard	NM_145804		Approved	DKFZP586C1619, BTBD22, ABTB2A	uc001mvl.2	Q8N961	OTTHUMG00000044382	ENST00000435224.2:c.366C>T	chr11.hg19:g.34378765G>A		7.0	0.0		19.0	8.0	NM_145804	A8K6S9|E9PRW7|Q52LD6|Q6MZW4|Q8NB44	Silent	SNP	ENST00000435224.2	hg19	CCDS7890.2																																																																																			.	.		0.756	ABTB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388703.3	NM_145804	
PACSIN3	29763	hgsc.bcm.edu	37	11	47201773	47201773	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr11:47201773C>A	ENST00000539589.1	-	6	909	c.567G>T	c.(565-567)caG>caT	p.Q189H	PACSIN3_ENST00000298838.6_Missense_Mutation_p.Q189H	NM_001184975.1	NP_001171904.1	Q9UKS6	PACN3_HUMAN	protein kinase C and casein kinase substrate in neurons 3	189	F-BAR domain. {ECO:0000250}.				endocytosis (GO:0006897)|membrane tubulation (GO:0097320)|negative regulation of calcium ion transport (GO:0051926)|negative regulation of endocytosis (GO:0045806)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	calcium channel inhibitor activity (GO:0019855)|cytoskeletal protein binding (GO:0008092)|lipid binding (GO:0008289)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(5)	11						CCACCCGTTCCTGCAGTTTGC	0.652											OREG0020952	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.Q189H		Atlas-SNP	.											.	PACSIN3	28	.	0			c.G567T						.						105.0	90.0	95.0					11																	47201773		2201	4298	6499	SO:0001583	missense	29763	exon6			CCGTTCCTGCAGT	AF130979	CCDS31481.1	11p12-p11	2008-02-05				ENSG00000165912			8572	protein-coding gene	gene with protein product	"""syndapin III"""	606513				10531379	Standard	NM_016223		Approved	SDPIII	uc001ndx.3	Q9UKS6		ENST00000539589.1:c.567G>T	chr11.hg19:g.47201773C>A	ENSP00000440945:p.Gln189His	23.0	0.0	945	30.0	13.0	NM_016223	A6NH84|Q9H331|Q9NWV9	Missense_Mutation	SNP	ENST00000539589.1	hg19	CCDS31481.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	13.25|13.25	2.180563|2.180563	0.38511|0.38511	.|.	.|.	ENSG00000165912|ENSG00000165912	ENST00000298838;ENST00000539589;ENST00000528462|ENST00000415232	T;T;T|.	0.45668|.	0.89;0.89;0.89|.	5.52|5.52	3.31|3.31	0.37934|0.37934	.|.	0.186773|.	0.53938|.	D|.	0.000053|.	T|T	0.56659|0.56659	0.2000|0.2000	L|L	0.34521|0.34521	1.04|1.04	0.39448|0.39448	D|D	0.967355|0.967355	P|.	0.46327|.	0.876|.	B|.	0.34093|.	0.175|.	T|T	0.62927|0.62927	-0.6750|-0.6750	10|6	0.41790|0.62326	T|D	0.15|0.03	-40.0996|-40.0996	13.0496|13.0496	0.58948|0.58948	0.0:0.8465:0.0:0.1535|0.0:0.8465:0.0:0.1535	.|.	189|.	Q9UKS6|.	PACN3_HUMAN|.	H|M	189|188	ENSP00000298838:Q189H;ENSP00000440945:Q189H;ENSP00000437252:Q189H|.	ENSP00000298838:Q189H|ENSP00000405352:R188M	Q|R	-|-	3|2	2|0	PACSIN3|PACSIN3	47158349|47158349	0.937000|0.937000	0.31787|0.31787	1.000000|1.000000	0.80357|0.80357	0.971000|0.971000	0.66376|0.66376	0.134000|0.134000	0.15932|0.15932	1.351000|1.351000	0.45789|0.45789	0.561000|0.561000	0.74099|0.74099	CAG|AGG	.	.		0.652	PACSIN3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391632.1	NM_016223	
ZFP91	80829	hgsc.bcm.edu	37	11	58384203	58384203	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr11:58384203A>G	ENST00000316059.6	+	10	1288	c.1117A>G	c.(1117-1119)Atc>Gtc	p.I373V	ZFP91-CNTF_ENST00000389919.4_Missense_Mutation_p.I373V	NM_001197051.1|NM_053023.4	NP_001183980.1|NP_444251.1	Q96JP5	ZFP91_HUMAN	ZFP91 zinc finger protein	373					activation of NF-kappaB-inducing kinase activity (GO:0007250)|protein K63-linked ubiquitination (GO:0070534)	nucleus (GO:0005634)	ligase activity (GO:0016874)|metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|ubiquitin-protein transferase activity (GO:0004842)			cervix(1)|endometrium(4)|kidney(4)|large_intestine(4)|lung(10)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	26		Breast(21;0.00725)|all_epithelial(135;0.0101)|all_lung(304;0.24)				AAGGGATTATATCTGTGAATA	0.408																																					p.I373V		Atlas-SNP	.											.	ZFP91	66	.	0			c.A1117G						.						69.0	68.0	69.0					11																	58384203		2201	4295	6496	SO:0001583	missense	80829	exon10			GATTATATCTGTG	AB056107	CCDS31553.1	11q12	2012-11-27	2012-11-27		ENSG00000186660	ENSG00000186660		"""Zinc fingers, C2H2-type"""	14983	protein-coding gene	gene with protein product			"""zinc finger protein homologous to Zfp91 in mouse"", ""zinc finger protein 91 homolog (mouse)"""			12738986, 20682767	Standard	NM_053023		Approved	PZF, ZNF757	uc001nmx.4	Q96JP5	OTTHUMG00000137391	ENST00000316059.6:c.1117A>G	chr11.hg19:g.58384203A>G	ENSP00000339030:p.Ile373Val	81.0	0.0		102.0	21.0	NM_053023	A6NHC4|A8MSG7|Q86V47|Q96JP4|Q96QA3	Missense_Mutation	SNP	ENST00000316059.6	hg19	CCDS31553.1	.	.	.	.	.	.	.	.	.	.	A	24.0	4.480550	0.84747	.	.	ENSG00000186660	ENST00000316059;ENST00000389918	T	0.14391	2.51	5.79	5.79	0.91817	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.16085	0.0387	N	0.03084	-0.415	0.58432	D	0.999993	P;D	0.53151	0.948;0.958	D;D	0.70716	0.949;0.97	T	0.45991	-0.9223	10	0.25106	T	0.35	-10.1966	15.127	0.72489	1.0:0.0:0.0:0.0	.	373;373	Q96JP5-2;Q96JP5	.;ZFP91_HUMAN	V	373	ENSP00000339030:I373V	ENSP00000374569:I373V	I	+	1	0	ZFP91	58140779	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.962000	0.93254	2.223000	0.72356	0.455000	0.32223	ATC	.	.		0.408	ZFP91-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268674.1	NM_053023	
MPEG1	219972	hgsc.bcm.edu	37	11	58980026	58980026	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr11:58980026C>T	ENST00000361050.3	-	1	398	c.313G>A	c.(313-315)Gca>Aca	p.A105T	RN7SL42P_ENST00000579786.1_RNA	NM_001039396.1	NP_001034485.1	Q2M385	MPEG1_HUMAN	macrophage expressed 1	105	MACPF. {ECO:0000255|PROSITE- ProRule:PRU00745}.					integral component of membrane (GO:0016021)				NS(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(21)|ovary(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	39		all_epithelial(135;0.125)				TGGTAATTTGCCCAGGATTCC	0.448																																					p.A105T		Atlas-SNP	.											.	MPEG1	72	.	0			c.G313A						.						207.0	194.0	198.0					11																	58980026		1913	4121	6034	SO:0001583	missense	219972	exon1			AATTTGCCCAGGA	AK097211	CCDS41650.1	11q12.1	2013-07-31				ENSG00000197629			29619	protein-coding gene	gene with protein product	"""macrophage expressed gene 1"""	610390				7888681, 23257510	Standard	NM_001039396		Approved	MPG1	uc001nnu.4	Q2M385		ENST00000361050.3:c.313G>A	chr11.hg19:g.58980026C>T	ENSP00000354335:p.Ala105Thr	84.0	0.0		83.0	7.0	NM_001039396	Q2M1T6|Q8TEF8	Missense_Mutation	SNP	ENST00000361050.3	hg19	CCDS41650.1	.	.	.	.	.	.	.	.	.	.	C	0.198	-1.047352	0.01981	.	.	ENSG00000197629	ENST00000361050;ENST00000545098	T	0.21932	1.98	5.05	-3.91	0.04168	Membrane attack complex component/perforin (MACPF) domain (1);	0.467745	0.21099	N	0.080188	T	0.07908	0.0198	N	0.08118	0	0.24352	N	0.994912	B	0.02656	0.0	B	0.01281	0.0	T	0.36696	-0.9737	10	0.14252	T	0.57	-1.897	11.2463	0.48998	0.0:0.2422:0.0:0.7578	.	105	Q2M385	MPEG1_HUMAN	T	105	ENSP00000354335:A105T	ENSP00000354335:A105T	A	-	1	0	MPEG1	58736602	0.050000	0.20438	0.174000	0.22961	0.009000	0.06853	0.176000	0.16782	-0.545000	0.06224	-0.825000	0.03093	GCA	.	.		0.448	MPEG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370027.1	NM_001039396	
TECTA	7007	hgsc.bcm.edu	37	11	120996428	120996428	+	Missense_Mutation	SNP	G	G	A	rs370652301		TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr11:120996428G>A	ENST00000392793.1	+	8	1892	c.1621G>A	c.(1621-1623)Gtg>Atg	p.V541M	TECTA_ENST00000264037.2_Missense_Mutation_p.V541M			O75443	TECTA_HUMAN	tectorin alpha	541					cell-matrix adhesion (GO:0007160)|sensory perception of sound (GO:0007605)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)			TECTA/TBCEL(2)	NS(1)|breast(9)|central_nervous_system(1)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(38)|liver(1)|lung(46)|ovary(3)|prostate(4)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	135	all_hematologic(175;0.208)	Breast(109;0.000766)|Medulloblastoma(222;0.0427)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;8.04e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.166)		TGGCACTGTCGTGGACCCCAC	0.587																																					p.V541M		Atlas-SNP	.											.	TECTA	329	.	0			c.G1621A						.	G	MET/VAL	0,4406		0,0,2203	136.0	135.0	135.0		1621	3.0	0.5	11		135	1,8597	1.2+/-3.3	0,1,4298	no	missense	TECTA	NM_005422.2	21	0,1,6501	AA,AG,GG		0.0116,0.0,0.0077	possibly-damaging	541/2156	120996428	1,13003	2203	4299	6502	SO:0001583	missense	7007	exon7			ACTGTCGTGGACC	AF055136	CCDS8434.1	11q22-q24	2008-02-05			ENSG00000109927	ENSG00000109927			11720	protein-coding gene	gene with protein product		602574		DFNA12, DFNA8, DFNB21		9503015, 9590290	Standard	NM_005422		Approved		uc010rzo.2	O75443	OTTHUMG00000149908	ENST00000392793.1:c.1621G>A	chr11.hg19:g.120996428G>A	ENSP00000376543:p.Val541Met	88.0	0.0		77.0	11.0	NM_005422		Missense_Mutation	SNP	ENST00000392793.1	hg19	CCDS8434.1	.	.	.	.	.	.	.	.	.	.	G	16.11	3.030471	0.54790	0.0	1.16E-4	ENSG00000109927	ENST00000392793;ENST00000264037	D;D	0.83419	-1.72;-1.72	4.91	3.04	0.35103	Uncharacterised domain, cysteine-rich (2);	0.136631	0.49305	N	0.000153	D	0.91019	0.7175	M	0.91510	3.215	0.34529	D	0.708962	D	0.76494	0.999	D	0.63192	0.912	D	0.93874	0.7165	10	0.72032	D	0.01	.	11.3331	0.49487	0.1492:0.0:0.8508:0.0	.	541	O75443	TECTA_HUMAN	M	541	ENSP00000376543:V541M;ENSP00000264037:V541M	ENSP00000264037:V541M	V	+	1	0	TECTA	120501638	1.000000	0.71417	0.546000	0.28166	0.829000	0.46940	3.367000	0.52350	0.613000	0.30089	-0.251000	0.11542	GTG	.	.		0.587	TECTA-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313850.1	NM_005422	
OR4D5	219875	hgsc.bcm.edu	37	11	123811018	123811018	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr11:123811018G>T	ENST00000307033.2	+	1	769	c.695G>T	c.(694-696)gGc>gTc	p.G232V		NM_001001965.1	NP_001001965.1	Q8NGN0	OR4D5_HUMAN	olfactory receptor, family 4, subfamily D, member 5	232						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			autonomic_ganglia(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(17)|ovary(1)|pancreas(1)|prostate(7)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	41		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0399)		TCACGGGAGGGCCGCAGCAAG	0.527																																					p.G232V		Atlas-SNP	.											.	OR4D5	94	.	0			c.G695T						.						224.0	194.0	204.0					11																	123811018		2202	4299	6501	SO:0001583	missense	219875	exon1			GGGAGGGCCGCAG	BK004316	CCDS31699.1	11q24.1	2012-08-09			ENSG00000171014	ENSG00000171014		"""GPCR / Class A : Olfactory receptors"""	14852	protein-coding gene	gene with protein product							Standard	NM_001001965		Approved		uc001pzk.1	Q8NGN0	OTTHUMG00000165961	ENST00000307033.2:c.695G>T	chr11.hg19:g.123811018G>T	ENSP00000305970:p.Gly232Val	145.0	0.0		143.0	35.0	NM_001001965	B9EGZ4|Q6IFE6	Missense_Mutation	SNP	ENST00000307033.2	hg19	CCDS31699.1	.	.	.	.	.	.	.	.	.	.	G	12.28	1.891291	0.33442	.	.	ENSG00000171014	ENST00000307033	T	0.00299	8.22	5.49	-0.146	0.13432	GPCR, rhodopsin-like superfamily (1);	0.720448	0.12266	N	0.484316	T	0.00754	0.0025	H	0.94964	3.605	0.48571	D	0.999678	P	0.46020	0.871	D	0.64687	0.928	T	0.59542	-0.7435	10	0.87932	D	0	0.0461	5.36	0.16083	0.3139:0.1613:0.5248:0.0	.	232	Q8NGN0	OR4D5_HUMAN	V	232	ENSP00000305970:G232V	ENSP00000305970:G232V	G	+	2	0	OR4D5	123316228	0.004000	0.15560	0.176000	0.23000	0.284000	0.27059	0.438000	0.21559	-0.323000	0.08602	-0.355000	0.07637	GGC	.	.		0.527	OR4D5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387263.1	NM_001001965	
PDZRN4	29951	hgsc.bcm.edu	37	12	41966302	41966302	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr12:41966302C>A	ENST00000402685.2	+	10	1729	c.1721C>A	c.(1720-1722)gCc>gAc	p.A574D	PDZRN4_ENST00000539469.2_Missense_Mutation_p.A316D|PDZRN4_ENST00000298919.7_Missense_Mutation_p.A314D	NM_001164595.1	NP_001158067.1	Q6ZMN7	PZRN4_HUMAN	PDZ domain containing ring finger 4	574							ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(23)|lung(29)|ovary(3)|pancreas(1)|prostate(2)|skin(4)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	77	all_cancers(12;0.000673)	Lung NSC(34;0.0205)|all_lung(34;0.0264)				GAGAATGCAGCCGAGGACCCC	0.498																																					p.A574D		Atlas-SNP	.											.	PDZRN4	346	.	0			c.C1721A						.						101.0	89.0	93.0					12																	41966302		2203	4300	6503	SO:0001583	missense	29951	exon10			ATGCAGCCGAGGA	AK094690	CCDS8739.1, CCDS53777.1	12q12	2008-08-14	2008-08-14			ENSG00000165966		"""RING-type (C3HC4) zinc fingers"""	30552	protein-coding gene	gene with protein product	"""similar to semaF cytoplasmic domain associated protein 3"""	609730				11230166, 15010864	Standard	NM_013377		Approved	DKFZp434B0417, LNX4, FLJ33777, IMAGE5767589	uc010skn.2	Q6ZMN7		ENST00000402685.2:c.1721C>A	chr12.hg19:g.41966302C>A	ENSP00000384197:p.Ala574Asp	200.0	1.0		161.0	81.0	NM_001164595	Q52LY3|Q52LY4|Q6N052|Q8IUU1|Q9NTP7	Missense_Mutation	SNP	ENST00000402685.2	hg19	CCDS53777.1	.	.	.	.	.	.	.	.	.	.	C	7.081	0.570320	0.13560	.	.	ENSG00000165966	ENST00000402685;ENST00000539469;ENST00000298919	T;T;T	0.72505	-0.66;3.83;3.82	5.05	3.21	0.36854	.	1.424160	0.04150	N	0.321150	T	0.68192	0.2974	L	0.50333	1.59	0.09310	N	1	P;B;B	0.34462	0.454;0.061;0.061	B;B;B	0.32022	0.105;0.139;0.139	T	0.57763	-0.7755	10	0.59425	D	0.04	-3.8108	11.4137	0.49939	0.0:0.8482:0.0:0.1518	.	574;314;316	Q6ZMN7;Q6ZMN7-4;Q6ZMN7-2	PZRN4_HUMAN;.;.	D	574;316;314	ENSP00000384197:A574D;ENSP00000439990:A316D;ENSP00000298919:A314D	ENSP00000298919:A314D	A	+	2	0	PDZRN4	40252569	0.186000	0.23225	0.006000	0.13384	0.505000	0.33919	1.444000	0.35068	0.776000	0.33473	-0.143000	0.13931	GCC	.	.		0.498	PDZRN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403701.1	NM_013377	
KRT76	51350	hgsc.bcm.edu	37	12	53170525	53170525	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr12:53170525C>A	ENST00000332411.2	-	1	604	c.551G>T	c.(550-552)cGg>cTg	p.R184L		NM_015848.4	NP_056932.2	Q01546	K22O_HUMAN	keratin 76	184	Coil 1A.|Rod.				cytoskeleton organization (GO:0007010)	extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|keratin filament (GO:0045095)|nucleus (GO:0005634)	structural molecule activity (GO:0005198)			breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(10)|prostate(1)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	27						GATCTGTTCCCGCTCCTGGGC	0.557																																					p.R184L		Atlas-SNP	.											.	KRT76	72	.	0			c.G551T						.						109.0	113.0	112.0					12																	53170525		2203	4298	6501	SO:0001583	missense	51350	exon1			TGTTCCCGCTCCT	M99063	CCDS8838.1	12q13.13	2013-06-25			ENSG00000185069	ENSG00000185069		"""-"", ""Intermediate filaments type II, keratins (basic)"""	24430	protein-coding gene	gene with protein product						1282112, 16831889	Standard	NM_015848		Approved	HUMCYT2A, KRT2B, KRT2P	uc001sax.3	Q01546	OTTHUMG00000169797	ENST00000332411.2:c.551G>T	chr12.hg19:g.53170525C>A	ENSP00000330101:p.Arg184Leu	136.0	0.0		116.0	38.0	NM_015848	B4DRR3|Q7Z795	Missense_Mutation	SNP	ENST00000332411.2	hg19	CCDS8838.1	.	.	.	.	.	.	.	.	.	.	C	17.69	3.451878	0.63290	.	.	ENSG00000185069	ENST00000332411	D	0.90133	-2.62	4.2	2.38	0.29361	Filament (1);	0.187921	0.26140	N	0.026104	D	0.94801	0.8321	M	0.87547	2.89	0.33466	D	0.585523	D	0.89917	1.0	D	0.85130	0.997	D	0.95259	0.8367	10	0.87932	D	0	.	9.2398	0.37489	0.0:0.7323:0.0:0.2677	.	184	Q01546	K22O_HUMAN	L	184	ENSP00000330101:R184L	ENSP00000330101:R184L	R	-	2	0	KRT76	51456792	0.992000	0.36948	0.955000	0.39395	0.985000	0.73830	1.362000	0.34148	0.730000	0.32425	0.462000	0.41574	CGG	.	.		0.557	KRT76-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405928.1	NM_015848	
KRT4	3851	hgsc.bcm.edu	37	12	53207647	53207647	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr12:53207647C>T	ENST00000551956.1	-	1	688	c.196G>A	c.(196-198)Gct>Act	p.A66T	KRT4_ENST00000458244.2_Intron|KRT4_ENST00000293774.4_Missense_Mutation_p.A140T			P19013	K2C4_HUMAN	keratin 4	66	Gly-rich.|Head.				cytoskeleton organization (GO:0007010)|epithelial cell differentiation (GO:0030855)|negative regulation of epithelial cell proliferation (GO:0050680)	cell surface (GO:0009986)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|keratin filament (GO:0045095)|nucleus (GO:0005634)	structural molecule activity (GO:0005198)			endometrium(3)|kidney(4)|large_intestine(6)|lung(8)|ovary(4)|prostate(2)|skin(2)	29						CGTGACCCAGCCACACTCATG	0.587																																					p.A66T	Pancreas(190;284 2995 41444 45903)	Atlas-SNP	.											.	KRT4	110	.	0			c.G196A						.						112.0	130.0	124.0					12																	53207647		2101	4247	6348	SO:0001583	missense	3851	exon1			ACCCAGCCACACT		CCDS41787.1, CCDS41787.2	12q13.13	2013-01-16			ENSG00000170477	ENSG00000170477		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6441	protein-coding gene	gene with protein product	"""cytokeratin 4"", ""keratin, type II cytoskeletal 4"""	123940		CYK4		16831889	Standard	NM_002272		Approved	CK4, K4	uc031qhk.1	P19013		ENST00000551956.1:c.196G>A	chr12.hg19:g.53207647C>T	ENSP00000448220:p.Ala66Thr	93.0	0.0		70.0	38.0	NM_002272	F8VS64|Q6GTR8|Q96LA7|Q9BTL1	Missense_Mutation	SNP	ENST00000551956.1	hg19	CCDS41787.2	.	.	.	.	.	.	.	.	.	.	C	18.97	3.735155	0.69189	.	.	ENSG00000170477	ENST00000551956;ENST00000293774	T;T	0.80653	-1.4;2.14	5.0	5.0	0.66597	.	0.000000	0.47852	D	0.000220	D	0.88485	0.6449	M	0.83384	2.64	0.80722	D	1	.	.	.	.	.	.	D	0.89183	0.3545	8	0.56958	D	0.05	.	14.6034	0.68460	0.0:0.8424:0.1576:0.0	.	.	.	.	T	66;140	ENSP00000448220:A66T;ENSP00000293774:A140T	ENSP00000293774:A140T	A	-	1	0	KRT4	51493914	0.000000	0.05858	0.981000	0.43875	0.591000	0.36615	1.006000	0.29847	2.705000	0.92388	0.585000	0.79938	GCT	.	.		0.587	KRT4-001	KNOWN	upstream_ATG|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000405931.1	NM_002272	
DTX3	196403	hgsc.bcm.edu	37	12	58002913	58002913	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr12:58002913C>T	ENST00000548198.1	+	5	2526	c.1022C>T	c.(1021-1023)gCg>gTg	p.A341V	DTX3_ENST00000551632.1_Missense_Mutation_p.A344V|ARHGEF25_ENST00000333972.7_5'Flank|AC025165.8_ENST00000356672.3_RNA|ARHGEF25_ENST00000286494.4_5'Flank|DTX3_ENST00000337737.3_Missense_Mutation_p.A341V|DTX3_ENST00000548804.1_Missense_Mutation_p.A341V			Q8N9I9	DTX3_HUMAN	deltex 3, E3 ubiquitin ligase	341					Notch signaling pathway (GO:0007219)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|large_intestine(1)|lung(6)|urinary_tract(1)	12	Melanoma(17;0.122)					GAGCTGAGAGCGAAGGGTATC	0.562																																					p.A341V		Atlas-SNP	.											.	DTX3	27	.	0			c.C1022T						.						117.0	119.0	118.0					12																	58002913		1991	4159	6150	SO:0001583	missense	196403	exon7			TGAGAGCGAAGGG	AK094385	CCDS41800.1, CCDS66410.1	12q13.2	2014-01-28	2014-01-28			ENSG00000178498		"""RING-type (C3HC4) zinc fingers"""	24457	protein-coding gene	gene with protein product		613142	"""deltex 3 homolog (Drosophila)"", ""deltex homolog 3 (Drosophila)"""			12670957	Standard	XM_005268697		Approved	FLJ34766, RNF154	uc001sow.1	Q8N9I9		ENST00000548198.1:c.1022C>T	chr12.hg19:g.58002913C>T	ENSP00000447873:p.Ala341Val	94.0	0.0		87.0	38.0	NM_178502	Q53ZZ2|Q8NAU6|Q8NDS8	Missense_Mutation	SNP	ENST00000548198.1	hg19	CCDS41800.1	.	.	.	.	.	.	.	.	.	.	c	10.18	1.278463	0.23307	.	.	ENSG00000178498	ENST00000548804;ENST00000337737;ENST00000548198;ENST00000551632	T;T;T;T	0.52295	0.67;0.67;0.67;0.67	3.19	3.19	0.36642	.	0.522770	0.16601	U	0.207326	T	0.41050	0.1142	M	0.71920	2.185	0.32394	N	0.552796	P	0.40302	0.712	B	0.18263	0.021	T	0.63950	-0.6521	10	0.87932	D	0	.	13.9819	0.64310	0.0:1.0:0.0:0.0	.	341	Q8N9I9	DTX3_HUMAN	V	341;341;341;344	ENSP00000449294:A341V;ENSP00000338050:A341V;ENSP00000447873:A341V;ENSP00000448696:A344V	ENSP00000338050:A341V	A	+	2	0	DTX3	56289180	0.999000	0.42202	1.000000	0.80357	0.132000	0.20833	2.113000	0.41902	1.751000	0.51876	0.586000	0.80456	GCG	.	.		0.562	DTX3-003	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000407848.1	NM_178502	
SYT1	6857	hgsc.bcm.edu	37	12	79689884	79689884	+	Silent	SNP	C	C	T	rs369758844		TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr12:79689884C>T	ENST00000261205.4	+	7	1167	c.510C>T	c.(508-510)ccC>ccT	p.P170P	SYT1_ENST00000393240.3_Silent_p.P170P|SYT1_ENST00000457153.2_Silent_p.P167P|SYT1_ENST00000552744.1_Silent_p.P170P	NM_005639.2	NP_005630.1	P21579	SYT1_HUMAN	synaptotagmin I	170	C2 1. {ECO:0000255|PROSITE- ProRule:PRU00041}.|Phospholipid binding. {ECO:0000305}.				calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|detection of calcium ion (GO:0005513)|glutamate secretion (GO:0014047)|neurotransmitter secretion (GO:0007269)|positive regulation of calcium ion-dependent exocytosis (GO:0045956)|positive regulation of synaptic transmission (GO:0050806)|positive regulation of vesicle fusion (GO:0031340)|protein homooligomerization (GO:0051260)|regulation of exocytosis (GO:0017157)|regulation of regulated secretory pathway (GO:1903305)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission (GO:0007268)|synaptic vesicle exocytosis (GO:0016079)|vesicle docking (GO:0048278)	cell junction (GO:0030054)|clathrin-sculpted acetylcholine transport vesicle membrane (GO:0060201)|clathrin-sculpted gamma-aminobutyric acid transport vesicle membrane (GO:0061202)|clathrin-sculpted glutamate transport vesicle membrane (GO:0060203)|clathrin-sculpted monoamine transport vesicle membrane (GO:0070083)|dense core granule (GO:0031045)|endocytic vesicle membrane (GO:0030666)|excitatory synapse (GO:0060076)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)|synaptic vesicle (GO:0008021)|synaptic vesicle membrane (GO:0030672)	1-phosphatidylinositol binding (GO:0005545)|calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|low-density lipoprotein particle receptor binding (GO:0050750)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|phosphatidylserine binding (GO:0001786)|SNARE binding (GO:0000149)|syntaxin-1 binding (GO:0017075)|transporter activity (GO:0005215)	p.P170P(1)		NS(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(11)|ovary(1)|pancreas(2)|skin(6)	25						CCGAACTGCCCGCCTTGGACA	0.428																																					p.P170P		Atlas-SNP	.											SYT1,NS,NS,0,1	SYT1	70	.	1	Substitution - coding silent(1)	pancreas(1)	c.C510T						.	C	,,	0,4406		0,0,2203	97.0	92.0	94.0		510,510,510	-5.2	0.9	12		94	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous,coding-synonymous	SYT1	NM_001135805.1,NM_001135806.1,NM_005639.2	,,	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	,,	170/423,170/423,170/423	79689884	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	6857	exon8			ACTGCCCGCCTTG		CCDS9017.1	12q21.2	2013-09-20			ENSG00000067715	ENSG00000067715		"""Synaptotagmins"""	11509	protein-coding gene	gene with protein product		185605		SYT, SVP65		1840599	Standard	NM_001135805		Approved	P65	uc001syv.3	P21579	OTTHUMG00000134326	ENST00000261205.4:c.510C>T	chr12.hg19:g.79689884C>T		107.0	1.0		71.0	28.0	NM_001135805	Q6AI31	Silent	SNP	ENST00000261205.4	hg19	CCDS9017.1	.	.	.	.	.	.	.	.	.	.	C	8.327	0.825609	0.16749	0.0	1.16E-4	ENSG00000067715	ENST00000549559	T	0.16897	2.31	5.52	-5.19	0.02832	.	0.000000	0.85682	D	0.000000	T	0.25457	0.0619	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.13176	-1.0519	7	0.72032	D	0.01	.	11.069	0.47993	0.1104:0.1236:0.0:0.766	.	.	.	.	L	72	ENSP00000449415:P72L	ENSP00000449415:P72L	P	+	2	0	SYT1	78214015	0.004000	0.15560	0.919000	0.36401	0.947000	0.59692	-1.268000	0.02836	-0.888000	0.03956	-1.134000	0.01955	CCG	.	.		0.428	SYT1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000259415.1	NM_005639	
PTPRQ	374462	hgsc.bcm.edu	37	12	80887176	80887176	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr12:80887176C>A	ENST00000266688.5	+	15	1470	c.1470C>A	c.(1468-1470)agC>agA	p.S490R				Q9UMZ3	PTPRQ_HUMAN	protein tyrosine phosphatase, receptor type, Q	536	Fibronectin type-III 5. {ECO:0000255|PROSITE-ProRule:PRU00316}.				regulation of fat cell differentiation (GO:0045598)	integral component of membrane (GO:0016021)	protein tyrosine phosphatase activity (GO:0004725)			breast(1)|endometrium(7)|kidney(9)|lung(2)|prostate(1)|skin(2)|stomach(2)	24						TATATAACAGCCATCCAGATA	0.378																																					p.S322R		Atlas-SNP	.											.	PTPRQ	119	.	0			c.C966A						.						103.0	94.0	96.0					12																	80887176		692	1591	2283	SO:0001583	missense	374462	exon7			TAACAGCCATCCA	AF169351	CCDS73501.1	12q21.31	2013-02-11	2001-12-04		ENSG00000139304	ENSG00000139304		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9679	protein-coding gene	gene with protein product		603317	"""deafness, autosomal recessive 84"""	DFNB84		20346435	Standard	NM_001145026		Approved		uc001sze.2	Q9UMZ3	OTTHUMG00000170171	ENST00000266688.5:c.1470C>A	chr12.hg19:g.80887176C>A	ENSP00000266688:p.Ser490Arg	78.0	0.0		77.0	21.0	NM_001145026		Missense_Mutation	SNP	ENST00000266688.5	hg19		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	4.023|4.023	0.001752|0.001752	0.07819|0.07819	.|.	.|.	ENSG00000139304|ENSG00000139304	ENST00000532722|ENST00000266688	.|T	.|0.36520	.|1.25	5.73|5.73	-4.29|-4.29	0.03721|0.03721	.|Fibronectin, type III (2);	.|.	.|.	.|.	.|.	T|T	0.16385|0.16385	0.0394|0.0394	.|.	.|.	.|.	0.09310|0.09310	N|N	1|1	.|B	.|0.28552	.|0.215	.|B	.|0.26517	.|0.07	T|T	0.30031|0.30031	-0.9992|-0.9992	4|8	.|0.16420	.|T	.|0.52	.|.	6.1889|6.1889	0.20513|0.20513	0.217:0.4185:0.0:0.3645|0.217:0.4185:0.0:0.3645	.|.	.|536	.|Q9UMZ3	.|PTPRQ_HUMAN	D|R	191|490	.|ENSP00000266688:S490R	.|ENSP00000266688:S490R	A|S	+|+	2|3	0|2	PTPRQ|PTPRQ	79411307|79411307	0.001000|0.001000	0.12720|0.12720	0.012000|0.012000	0.15200|0.15200	0.004000|0.004000	0.04260|0.04260	0.042000|0.042000	0.13949|0.13949	-0.723000|-0.723000	0.04915|0.04915	-0.294000|-0.294000	0.09567|0.09567	GCC|AGC	.	.		0.378	PTPRQ-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_001145026	
STAB2	55576	hgsc.bcm.edu	37	12	104077060	104077060	+	Silent	SNP	C	C	A			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr12:104077060C>A	ENST00000388887.2	+	26	3087	c.2883C>A	c.(2881-2883)acC>acA	p.T961T		NM_017564.9	NP_060034.9			stabilin 2									p.T961T(2)		NS(4)|breast(7)|central_nervous_system(1)|cervix(1)|endometrium(15)|kidney(11)|large_intestine(26)|lung(77)|ovary(10)|pancreas(1)|prostate(5)|skin(14)|stomach(2)	174						TGGAACAAACCGGGAAATGTC	0.333																																					p.T961T		Atlas-SNP	.											STAB2,NS,carcinoma,0,2	STAB2	370	.	2	Substitution - coding silent(2)	lung(2)	c.C2883A						.						171.0	156.0	161.0					12																	104077060		2203	4300	6503	SO:0001819	synonymous_variant	55576	exon26			ACAAACCGGGAAA	AF160476	CCDS31888.1	12q23.3	2007-01-29				ENSG00000136011			18629	protein-coding gene	gene with protein product	"""hyaluronic acid receptor for endocytosis"""	608561				11829752, 12077138	Standard	XR_429107		Approved	DKFZP434E0321, FELL, STAB-2, HARE, FEEL-2	uc001tjw.3	Q8WWQ8	OTTHUMG00000170056	ENST00000388887.2:c.2883C>A	chr12.hg19:g.104077060C>A		141.0	0.0		183.0	59.0	NM_017564		Silent	SNP	ENST00000388887.2	hg19	CCDS31888.1																																																																																			.	.		0.333	STAB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407089.1		
SSH1	54434	hgsc.bcm.edu	37	12	109192797	109192797	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr12:109192797T>C	ENST00000326495.5	-	13	1421	c.1328A>G	c.(1327-1329)tAt>tGt	p.Y443C	SSH1_ENST00000326470.5_Missense_Mutation_p.Y454C|SSH1_ENST00000360239.3_Missense_Mutation_p.Y131C|SSH1_ENST00000551165.1_Missense_Mutation_p.Y443C	NM_018984.3	NP_061857.3	Q8WYL5	SSH1_HUMAN	slingshot protein phosphatase 1	443	Tyrosine-protein phosphatase.				actin cytoskeleton organization (GO:0030036)|cell morphogenesis (GO:0000902)|cellular response to ATP (GO:0071318)|protein dephosphorylation (GO:0006470)|regulation of actin polymerization or depolymerization (GO:0008064)|regulation of axonogenesis (GO:0050770)|regulation of cellular protein metabolic process (GO:0032268)|regulation of lamellipodium assembly (GO:0010591)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|DNA binding (GO:0003677)|phosphoprotein phosphatase activity (GO:0004721)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			breast(1)|endometrium(5)|kidney(3)|large_intestine(9)|lung(8)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	38						GATGCCTTCATACTCAGACAG	0.577																																					p.Y454C		Atlas-SNP	.											.	SSH1	144	.	0			c.A1361G						.						72.0	70.0	70.0					12																	109192797		2203	4300	6503	SO:0001583	missense	54434	exon12			CCTTCATACTCAG	BC062341	CCDS9121.1, CCDS53825.1, CCDS55882.1	12q24.12	2013-03-05	2013-03-05			ENSG00000084112		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Slingshots"""	30579	protein-coding gene	gene with protein product		606778	"""slingshot homolog 1 (Drosophila)"""			10718198, 11832213	Standard	NM_018984		Approved	KIAA1298	uc001tnm.3	Q8WYL5	OTTHUMG00000169371	ENST00000326495.5:c.1328A>G	chr12.hg19:g.109192797T>C	ENSP00000315713:p.Tyr443Cys	55.0	0.0		60.0	18.0	NM_001161331	Q6P6C0|Q8N9A7|Q8WYL3|Q8WYL4|Q9P2P8	Missense_Mutation	SNP	ENST00000326495.5	hg19	CCDS9121.1	.	.	.	.	.	.	.	.	.	.	T	23.7	4.445052	0.83993	.	.	ENSG00000084112	ENST00000360239;ENST00000326495;ENST00000551165;ENST00000326470	T;T;T;T	0.63096	1.01;-0.02;-0.02;-0.02	5.11	5.11	0.69529	Dual specificity phosphatase, catalytic domain (1);Dual specificity phosphatase, subgroup, catalytic domain (2);	0.000000	0.85682	D	0.000000	D	0.84955	0.5587	H	0.95574	3.69	0.58432	D	0.999991	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	D	0.89698	0.3903	10	0.87932	D	0	-20.7526	15.2215	0.73313	0.0:0.0:0.0:1.0	.	454;443;443;131	Q8WYL5-5;Q8WYL5-2;Q8WYL5;Q8WYL5-4	.;.;SSH1_HUMAN;.	C	131;443;443;454	ENSP00000353374:Y131C;ENSP00000315713:Y443C;ENSP00000448824:Y443C;ENSP00000326107:Y454C	ENSP00000326107:Y454C	Y	-	2	0	SSH1	107716926	1.000000	0.71417	0.950000	0.38849	0.988000	0.76386	8.040000	0.89188	2.066000	0.61787	0.533000	0.62120	TAT	.	.		0.577	SSH1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000403724.1	NM_018984	
EP400	57634	hgsc.bcm.edu	37	12	132445446	132445446	+	Silent	SNP	G	G	T			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr12:132445446G>T	ENST00000333577.4	+	2	391	c.282G>T	c.(280-282)ctG>ctT	p.L94L	EP400_ENST00000332482.4_Silent_p.L94L|EP400_ENST00000330386.6_Silent_p.L94L|EP400_ENST00000389561.2_Silent_p.L94L|EP400_ENST00000389562.2_Silent_p.L94L			Q96L91	EP400_HUMAN	E1A binding protein p400	94					chromatin organization (GO:0006325)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)	NuA4 histone acetyltransferase complex (GO:0035267)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|Swr1 complex (GO:0000812)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			NS(1)|breast(6)|central_nervous_system(10)|cervix(1)|endometrium(21)|kidney(13)|large_intestine(25)|lung(56)|ovary(5)|prostate(8)|skin(6)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	161	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.198)		OV - Ovarian serous cystadenocarcinoma(86;3.01e-08)|Epithelial(86;3.43e-07)|all cancers(50;2.01e-06)		TGGCCCCACTGCCGCTCCCCA	0.617																																					p.L94L		Atlas-SNP	.											.	EP400	370	.	0			c.G282T						.						44.0	44.0	44.0					12																	132445446		2203	4300	6503	SO:0001819	synonymous_variant	57634	exon2			CCCACTGCCGCTC	U80743	CCDS31929.1, CCDS31929.2	12q24.33	2008-02-01	2002-02-05	2002-02-08		ENSG00000183495			11958	protein-coding gene	gene with protein product		606265	"""trinucleotide repeat containing 12"""	TNRC12		9225980, 11509179	Standard	NM_015409		Approved	CAGH32, KIAA1498, P400, KIAA1818, DKFZP434I225	uc001ujn.3	Q96L91		ENST00000333577.4:c.282G>T	chr12.hg19:g.132445446G>T		304.0	1.0		245.0	126.0	NM_015409	O15411|Q6P2F5|Q8N8Q7|Q8NE05|Q96JK7|Q9P230	Silent	SNP	ENST00000333577.4	hg19																																																																																				.	.		0.617	EP400-203	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_015409	
RNF17	56163	hgsc.bcm.edu	37	13	25416232	25416232	+	Missense_Mutation	SNP	C	C	T	rs140457030		TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr13:25416232C>T	ENST00000255324.5	+	19	2588	c.2536C>T	c.(2536-2538)Cct>Tct	p.P846S	RNF17_ENST00000339524.3_5'Flank|RNF17_ENST00000381921.1_Missense_Mutation_p.P846S	NM_001184993.1|NM_031277.2	NP_001171922.1|NP_112567.2	Q9BXT8	RNF17_HUMAN	ring finger protein 17	846					multicellular organismal development (GO:0007275)|spermatid development (GO:0007286)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	hydrolase activity, acting on ester bonds (GO:0016788)|nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(15)|ovary(1)|prostate(3)|skin(6)	36		Lung SC(185;0.0225)|Breast(139;0.077)		all cancers(112;0.0114)|OV - Ovarian serous cystadenocarcinoma(117;0.0311)|Epithelial(112;0.0524)		TCTTGGTGCTCCTGAAATGAC	0.343																																					p.P846S		Atlas-SNP	.											.	RNF17	259	.	0			c.C2536T						.	C	SER/PRO,SER/PRO	4,4402	8.1+/-20.4	0,4,2199	158.0	149.0	152.0		2536,2536	5.3	1.0	13	dbSNP_134	152	0,8600		0,0,4300	yes	missense,missense	RNF17	NM_001184993.1,NM_031277.2	74,74	0,4,6499	TT,TC,CC		0.0,0.0908,0.0308	possibly-damaging,possibly-damaging	846/1620,846/1624	25416232	4,13002	2203	4300	6503	SO:0001583	missense	56163	exon19			GGTGCTCCTGAAA	AF285602, AK001907	CCDS9308.2	13q12.13	2013-01-23			ENSG00000132972	ENSG00000132972		"""RING-type (C3HC4) zinc fingers"", ""Tudor domain containing"""	10060	protein-coding gene	gene with protein product	"""spermatogenesis associated 23"""	605793	"""tudor domain containing 4"""	TDRD4		11279525	Standard	NM_001184993		Approved	Mmip-2, SPATA23, FLJ11045	uc001upr.3	Q9BXT8	OTTHUMG00000016589	ENST00000255324.5:c.2536C>T	chr13.hg19:g.25416232C>T	ENSP00000255324:p.Pro846Ser	78.0	0.0		63.0	20.0	NM_001184993	Q5T2J9|Q6P1W3|Q9BXT7|Q9NUY9	Missense_Mutation	SNP	ENST00000255324.5	hg19	CCDS9308.2	.	.	.	.	.	.	.	.	.	.	C	8.103	0.777141	0.16120	9.08E-4	0.0	ENSG00000132972	ENST00000255324;ENST00000381921;ENST00000429047;ENST00000418120	T;T;T	0.11712	3.55;3.55;2.75	5.29	5.29	0.74685	Staphylococcal nuclease (SNase-like) (1);	0.277119	0.29459	N	0.012097	T	0.19366	0.0465	L	0.27053	0.805	0.80722	D	1	B;D;B	0.89917	0.068;1.0;0.083	B;D;B	0.87578	0.014;0.998;0.02	T	0.07233	-1.0783	10	0.12430	T	0.62	-8.1118	16.2019	0.82087	0.0:1.0:0.0:0.0	.	846;846;846	B7Z7S1;Q9BXT8-5;Q9BXT8	.;.;RNF17_HUMAN	S	846;846;705;170	ENSP00000255324:P846S;ENSP00000371346:P846S;ENSP00000388892:P170S	ENSP00000255324:P846S	P	+	1	0	RNF17	24314232	0.663000	0.27448	0.996000	0.52242	0.013000	0.08279	0.689000	0.25437	2.638000	0.89438	0.585000	0.79938	CCT	.	C|1.000;T|0.000		0.343	RNF17-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044217.1	NM_031994	
LINC00283	100874057	hgsc.bcm.edu	37	13	103398453	103398453	+	RNA	SNP	C	C	T	rs141118373	byFrequency	TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr13:103398453C>T	ENST00000430111.1	+	0	3894									long intergenic non-protein coding RNA 283																		TCTAAAGGACCCATTTGGAGA	0.408																																					p.G1532S		Atlas-SNP	.											.	.	.	.	0			c.G4594A						.						111.0	96.0	101.0					13																	103398453		692	1590	2282			643677	exon4			AAGGACCCATTTG			13q33.1	2012-10-12	2011-08-10	2011-08-10	ENSG00000231633	ENSG00000231633		"""Long non-coding RNAs"""	38809	non-coding RNA	RNA, long non-coding			"""non-protein coding RNA 283"""	NCRNA00283			Standard			Approved				OTTHUMG00000017311		chr13.hg19:g.103398453C>T		84.0	0.0		81.0	25.0	NM_001146197		Missense_Mutation	SNP	ENST00000430111.1	hg19																																																																																				.	C|0.991;A|0.009		0.408	LINC00283-001	KNOWN	not_organism_supported|basic	antisense	antisense	OTTHUMT00000045714.1		
PRKD1	5587	hgsc.bcm.edu	37	14	30100159	30100159	+	Silent	SNP	G	G	A			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr14:30100159G>A	ENST00000331968.5	-	10	1690	c.1461C>T	c.(1459-1461)gcC>gcT	p.A487A	PRKD1_ENST00000415220.2_Silent_p.A495A	NM_002742.2	NP_002733.2	Q15139	KPCD1_HUMAN	protein kinase D1	487	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|cellular response to oxidative stress (GO:0034599)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|Golgi organization (GO:0007030)|Golgi vesicle transport (GO:0048193)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|intracellular signal transduction (GO:0035556)|negative regulation of cell death (GO:0060548)|negative regulation of endocytosis (GO:0045806)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of endothelial cell chemotaxis (GO:2001028)|positive regulation of endothelial cell chemotaxis by VEGF-activated vascular endothelial growth factor receptor signaling pathway (GO:0038033)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of histone deacetylase activity (GO:1901727)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of neuron projection development (GO:0010976)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein autophosphorylation (GO:0046777)|regulation of integrin-mediated signaling pathway (GO:2001044)|regulation of keratinocyte proliferation (GO:0010837)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	cell cortex (GO:0005938)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(21)|lung(32)|ovary(2)|prostate(1)|skin(4)|urinary_tract(2)	78	Hepatocellular(127;0.0604)		LUAD - Lung adenocarcinoma(48;0.00527)|Lung(238;0.0252)	GBM - Glioblastoma multiforme(265;0.00888)		AATGAGGATTGGCCCCATTAG	0.363																																					p.A487A		Atlas-SNP	.											.	PRKD1	316	.	0			c.C1461T						.						115.0	111.0	112.0					14																	30100159		2203	4300	6503	SO:0001819	synonymous_variant	5587	exon10			AGGATTGGCCCCA		CCDS9637.1	14q11	2013-01-10	2004-10-28	2004-10-30	ENSG00000184304	ENSG00000184304	2.7.11.1	"""Pleckstrin homology (PH) domain containing"""	9407	protein-coding gene	gene with protein product		605435	"""protein kinase C, mu"""	PRKCM		8119958, 10965134	Standard	NM_002742		Approved	PKCM, PKD, PKC-mu	uc001wqh.3	Q15139	OTTHUMG00000140203	ENST00000331968.5:c.1461C>T	chr14.hg19:g.30100159G>A		188.0	0.0		130.0	43.0	NM_002742	A6NL64|B2RAF6	Silent	SNP	ENST00000331968.5	hg19	CCDS9637.1																																																																																			.	.		0.363	PRKD1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000276611.2	NM_002742	
ESR2	2100	hgsc.bcm.edu	37	14	64727461	64727461	+	Silent	SNP	G	G	T			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr14:64727461G>T	ENST00000341099.4	-	5	1075	c.658C>A	c.(658-660)Cgg>Agg	p.R220R	ESR2_ENST00000353772.3_Silent_p.R220R|ESR2_ENST00000357782.2_Silent_p.R220R|ESR2_ENST00000555278.1_Silent_p.R220R|ESR2_ENST00000554572.1_Silent_p.R220R|ESR2_ENST00000542956.1_Silent_p.R220R|ESR2_ENST00000557772.1_Silent_p.R220R|ESR2_ENST00000555483.1_5'UTR|ESR2_ENST00000358599.5_Silent_p.R220R|ESR2_ENST00000267525.6_Silent_p.R220R|ESR2_ENST00000553796.1_Silent_p.R220R	NM_001437.2	NP_001428.1	Q92731	ESR2_HUMAN	estrogen receptor 2 (ER beta)	220	Steroid-binding.				brain development (GO:0007420)|cell-cell signaling (GO:0007267)|epithelial cell maturation involved in prostate gland development (GO:0060743)|extracellular negative regulation of signal transduction (GO:1900116)|gene expression (GO:0010467)|hormone-mediated apoptotic signaling pathway (GO:0008628)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of cell growth (GO:0030308)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron migration (GO:0001764)|ovarian follicle development (GO:0001541)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|prostate gland epithelium morphogenesis (GO:0060740)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)|uterus development (GO:0060065)|vagina development (GO:0060068)	extracellular region (GO:0005576)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	core promoter sequence-specific DNA binding (GO:0001046)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|estrogen receptor activity (GO:0030284)|estrogen response element binding (GO:0034056)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|receptor antagonist activity (GO:0048019)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid binding (GO:0005496)|steroid hormone receptor activity (GO:0003707)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(5)|ovary(1)|prostate(1)|skin(3)|stomach(1)|urinary_tract(1)	23				all cancers(60;0.00916)|OV - Ovarian serous cystadenocarcinoma(108;0.0111)|BRCA - Breast invasive adenocarcinoma(234;0.0437)	Diethylstilbestrol(DB00255)|Estradiol(DB00783)|Estramustine(DB01196)|Estriol(DB04573)|Estropipate(DB04574)|Raloxifene(DB00481)|Tamoxifen(DB00675)|Trilostane(DB01108)	CTCTCTCTCCGGGAGCCTGAA	0.577																																					p.R220R		Atlas-SNP	.											.	ESR2	82	.	0			c.C658A						.						28.0	29.0	29.0					14																	64727461		2191	4281	6472	SO:0001819	synonymous_variant	2100	exon4			CTCTCCGGGAGCC	X99101	CCDS9762.1, CCDS32096.1, CCDS55920.1, CCDS61469.1, CCDS61470.1	14q21-q22	2013-01-16			ENSG00000140009	ENSG00000140009		"""Nuclear hormone receptors"""	3468	protein-coding gene	gene with protein product		601663				8769313	Standard	NM_001214902		Approved	NR3A2, Erb	uc001xha.1	Q92731	OTTHUMG00000141306	ENST00000341099.4:c.658C>A	chr14.hg19:g.64727461G>T		45.0	0.0		39.0	7.0	NM_001214902	A8K8K5|G3V5M5|O60608|O60685|O60702|O60703|O75583|O75584|Q0MWT5|Q0MWT6|Q86Z31|Q9UEV6|Q9UHD3|Q9UQK9	Silent	SNP	ENST00000341099.4	hg19	CCDS9762.1																																																																																			.	.		0.577	ESR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000280621.1		
AHNAK2	113146	hgsc.bcm.edu	37	14	105413999	105413999	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr14:105413999C>A	ENST00000333244.5	-	7	7908	c.7789G>T	c.(7789-7791)Ggc>Tgc	p.G2597C	AHNAK2_ENST00000557457.1_Intron	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	2597						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)				cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			GCCTTGGGGCCTTTCAGGTCC	0.617																																					p.G2597C		Atlas-SNP	.											.	AHNAK2	719	.	0			c.G7789T						.						123.0	135.0	131.0					14																	105413999		1861	4092	5953	SO:0001583	missense	113146	exon7			TGGGGCCTTTCAG	AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.7789G>T	chr14.hg19:g.105413999C>A	ENSP00000353114:p.Gly2597Cys	198.0	0.0		183.0	76.0	NM_138420	Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Missense_Mutation	SNP	ENST00000333244.5	hg19	CCDS45177.1	.	.	.	.	.	.	.	.	.	.	c	11.90	1.777164	0.31411	.	.	ENSG00000185567	ENST00000333244	T	0.03468	3.92	3.56	3.56	0.40772	.	.	.	.	.	T	0.19248	0.0462	M	0.88775	2.98	0.09310	N	1	D	0.63046	0.992	P	0.60473	0.875	T	0.04103	-1.0977	9	0.54805	T	0.06	.	14.1715	0.65512	0.0:1.0:0.0:0.0	.	2597	Q8IVF2	AHNK2_HUMAN	C	2597	ENSP00000353114:G2597C	ENSP00000353114:G2597C	G	-	1	0	AHNAK2	104485044	0.000000	0.05858	0.059000	0.19551	0.263000	0.26337	0.184000	0.16939	1.543000	0.49345	0.485000	0.47835	GGC	.	.		0.617	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410300.1	NM_138420	
GOLGA6L6	727832	hgsc.bcm.edu	37	15	20740171	20740171	+	Silent	SNP	G	G	T			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr15:20740171G>T	ENST00000427390.2	-	8	1669	c.1579C>A	c.(1579-1581)Cgg>Agg	p.R527R		NM_001145004.1	NP_001138476.1	A8MZA4	GG6L6_HUMAN	golgin A6 family-like 6	527	Gln-rich.|Glu-rich.									NS(3)|endometrium(4)|kidney(1)|skin(3)	11						tcctgctcccgtatcttctcc	0.547																																					p.R527R		Atlas-SNP	.											.	GOLGA6L6	37	.	0			c.C1579A						.						121.0	121.0	121.0					15																	20740171		674	1564	2238	SO:0001819	synonymous_variant	727832	exon8			GCTCCCGTATCTT	AK093450	CCDS45184.1	15q11.2	2014-02-12	2010-02-12		ENSG00000215405	ENSG00000277322			37225	protein-coding gene	gene with protein product			"""golgi autoantigen, golgin subfamily a, 6-like 6"""				Standard	NM_001145004		Approved	FLJ36131	uc001ytk.2	A8MZA4	OTTHUMG00000171663	ENST00000427390.2:c.1579C>A	chr15.hg19:g.20740171G>T		302.0	0.0		213.0	72.0	NM_001145004	D3YTC0	Silent	SNP	ENST00000427390.2	hg19	CCDS45184.1																																																																																			.	.		0.547	GOLGA6L6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414660.3	NM_001145004	
GABRA5	2558	hgsc.bcm.edu	37	15	27128577	27128577	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr15:27128577C>A	ENST00000335625.5	+	6	1258	c.370C>A	c.(370-372)Ctt>Att	p.L124I	GABRA5_ENST00000355395.5_Missense_Mutation_p.L124I|GABRA5_ENST00000400081.3_Missense_Mutation_p.L124I|GABRA5_ENST00000557449.1_Intron|GABRB3_ENST00000541819.2_Intron	NM_000810.3	NP_000801.1	P31644	GBRA5_HUMAN	gamma-aminobutyric acid (GABA) A receptor, alpha 5	124					associative learning (GO:0008306)|behavioral fear response (GO:0001662)|brain development (GO:0007420)|cochlea development (GO:0090102)|gamma-aminobutyric acid signaling pathway (GO:0007214)|inner ear receptor cell development (GO:0060119)|innervation (GO:0060384)|ion transmembrane transport (GO:0034220)|negative regulation of neuron apoptotic process (GO:0043524)|sensory perception of sound (GO:0007605)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|neuronal cell body membrane (GO:0032809)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|receptor complex (GO:0043235)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)|receptor activity (GO:0004872)|transporter activity (GO:0005215)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(26)|ovary(1)|upper_aerodigestive_tract(1)	49		all_lung(180;4.59e-13)|Breast(32;0.000563)|Colorectal(260;0.227)		all cancers(64;1.45e-08)|Epithelial(43;4.96e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0232)|Lung(196;0.182)	Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amobarbital(DB01351)|Amoxapine(DB00543)|Aprobarbital(DB01352)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methylphenobarbital(DB00849)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Secobarbital(DB00418)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Thiopental(DB00599)|Topiramate(DB00273)|Triazolam(DB00897)|Zopiclone(DB01198)	CAACAACCTCCTTGCCAGCAA	0.547																																					p.L124I		Atlas-SNP	.											.	GABRA5	127	.	0			c.C370A						.						91.0	102.0	98.0					15																	27128577		2195	4296	6491	SO:0001583	missense	2558	exon6			AACCTCCTTGCCA		CCDS45194.1	15q12	2012-06-22			ENSG00000186297	ENSG00000186297		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4079	protein-coding gene	gene with protein product	"""GABA(A) receptor, alpha 5"""	137142				1321750	Standard	NM_000810		Approved		uc021sgi.1	P31644	OTTHUMG00000171824	ENST00000335625.5:c.370C>A	chr15.hg19:g.27128577C>A	ENSP00000335592:p.Leu124Ile	119.0	0.0		89.0	40.0	NM_001165037	A8K338|Q14DC2|Q53XL6|Q9NYT3|Q9NYT4|Q9NYT5	Missense_Mutation	SNP	ENST00000335625.5	hg19	CCDS45194.1	.	.	.	.	.	.	.	.	.	.	C	21.2	4.109478	0.77096	.	.	ENSG00000186297	ENST00000335625;ENST00000355395;ENST00000555182;ENST00000400081;ENST00000554596;ENST00000554599	T;T;T;T;T;T	0.78003	-1.14;-1.14;-1.14;-1.14;-1.14;-1.14	5.4	4.47	0.54385	Neurotransmitter-gated ion-channel ligand-binding (3);	0.000000	0.85682	D	0.000000	D	0.83119	0.5185	L	0.50919	1.6	0.53688	D	0.999974	P	0.51147	0.942	P	0.60068	0.868	D	0.85076	0.0943	10	0.87932	D	0	.	14.8695	0.70444	0.1446:0.8554:0.0:0.0	.	124	P31644	GBRA5_HUMAN	I	124;124;92;124;124;124	ENSP00000335592:L124I;ENSP00000347557:L124I;ENSP00000450653:L92I;ENSP00000382953:L124I;ENSP00000450806:L124I;ENSP00000450717:L124I	ENSP00000335592:L124I	L	+	1	0	GABRA5	24679670	0.991000	0.36638	0.042000	0.18584	0.969000	0.65631	2.953000	0.49105	1.384000	0.46424	0.561000	0.74099	CTT	.	.		0.547	GABRA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415234.1		
DUOX1	53905	hgsc.bcm.edu	37	15	45437120	45437120	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr15:45437120C>T	ENST00000321429.4	+	19	2571	c.2164C>T	c.(2164-2166)Cgg>Tgg	p.R722W	DUOX1_ENST00000561166.1_Missense_Mutation_p.R368W|DUOX1_ENST00000389037.3_Missense_Mutation_p.R722W	NM_017434.3	NP_059130.2	Q9NRD9	DUOX1_HUMAN	dual oxidase 1	722					cuticle development (GO:0042335)|cytokine-mediated signaling pathway (GO:0019221)|hormone biosynthetic process (GO:0042446)|hydrogen peroxide biosynthetic process (GO:0050665)|hydrogen peroxide catabolic process (GO:0042744)|oxidation-reduction process (GO:0055114)|response to cAMP (GO:0051591)|superoxide anion generation (GO:0042554)|thyroid hormone generation (GO:0006590)	apical plasma membrane (GO:0016324)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|heme binding (GO:0020037)|NAD(P)H oxidase activity (GO:0016174)|NADP binding (GO:0050661)|peroxidase activity (GO:0004601)			breast(2)|central_nervous_system(1)|endometrium(5)|kidney(5)|large_intestine(13)|lung(16)|ovary(6)|prostate(1)|skin(3)|stomach(4)|upper_aerodigestive_tract(1)	57		all_cancers(109;5.7e-11)|all_epithelial(112;4.65e-09)|Lung NSC(122;3.55e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)		all cancers(107;5.77e-18)|GBM - Glioblastoma multiforme(94;5.11e-07)|COAD - Colon adenocarcinoma(120;0.071)|Colorectal(133;0.0717)		GGAGGAAGAGCGGCAGGCGCT	0.567																																					p.R722W		Atlas-SNP	.											.	DUOX1	125	.	0			c.C2164T						.						83.0	97.0	92.0					15																	45437120		2198	4298	6496	SO:0001583	missense	53905	exon19			GAAGAGCGGCAGG	AF213465	CCDS32221.1	15q21	2013-01-10				ENSG00000137857		"""EF-hand domain containing"""	3062	protein-coding gene	gene with protein product	"""NADPH thyroid oxidase 1"", ""flavoprotein NADPH oxidase"", ""nicotinamide adenine dinucleotide phosphate oxidase"""	606758				10806195	Standard	XM_005254463		Approved	NOXEF1, THOX1, LNOX1	uc001zut.1	Q9NRD9		ENST00000321429.4:c.2164C>T	chr15.hg19:g.45437120C>T	ENSP00000317997:p.Arg722Trp	84.0	0.0		59.0	25.0	NM_017434	A6NH28|Q14C94|Q6ZMB3|Q6ZR09|Q9NZC1	Missense_Mutation	SNP	ENST00000321429.4	hg19	CCDS32221.1	.	.	.	.	.	.	.	.	.	.	C	16.39	3.111177	0.56398	.	.	ENSG00000137857	ENST00000431588;ENST00000321429;ENST00000389037	D;D	0.87887	-2.31;-2.31	4.81	2.88	0.33553	.	0.155171	0.53938	D	0.000048	D	0.90445	0.7008	M	0.62723	1.935	0.80722	D	1	D	0.89917	1.0	D	0.76575	0.988	D	0.88917	0.3363	10	0.62326	D	0.03	-35.7814	8.1009	0.30857	0.1809:0.6448:0.1743:0.0	.	722	Q9NRD9	DUOX1_HUMAN	W	722	ENSP00000317997:R722W;ENSP00000373689:R722W	ENSP00000317997:R722W	R	+	1	2	DUOX1	43224412	0.999000	0.42202	0.997000	0.53966	0.507000	0.33981	1.990000	0.40717	0.713000	0.32060	-0.181000	0.13052	CGG	.	.		0.567	DUOX1-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416251.1	NM_017434	
ANKDD1A	348094	hgsc.bcm.edu	37	15	65208032	65208032	+	Missense_Mutation	SNP	G	G	A	rs553148491		TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr15:65208032G>A	ENST00000380230.3	+	2	100	c.71G>A	c.(70-72)cGc>cAc	p.R24H	ANKDD1A_ENST00000491145.1_3'UTR|ANKDD1A_ENST00000496660.1_Intron|ANKDD1A_ENST00000357698.3_Missense_Mutation_p.R24H|AC069368.3_ENST00000437723.1_Intron|ANKDD1A_ENST00000395720.1_Missense_Mutation_p.R24H|ANKDD1A_ENST00000319580.8_Intron	NM_182703.3	NP_874362.3	Q495B1	AKD1A_HUMAN	ankyrin repeat and death domain containing 1A	24					signal transduction (GO:0007165)					NS(1)|endometrium(1)|large_intestine(10)|liver(2)|lung(4)|ovary(1)|prostate(2)	21						GAGGCCGCCCGCCAGAACAAT	0.597													G|||	1	0.000199681	0.0008	0.0	5008	,	,		18846	0.0		0.0	False		,,,				2504	0.0				p.R24H		Atlas-SNP	.											ANKDD1A,NS,carcinoma,0,3	ANKDD1A	47	.	0			c.G71A						.						34.0	38.0	37.0					15																	65208032		1925	4132	6057	SO:0001583	missense	348094	exon2			CCGCCCGCCAGAA		CCDS10197.2	15q22.31	2013-01-10	2006-02-16		ENSG00000166839	ENSG00000166839		"""Ankyrin repeat domain containing"""	28002	protein-coding gene	gene with protein product						12477932	Standard	NM_182703		Approved	FLJ25870	uc002aoa.3	Q495B1	OTTHUMG00000133051	ENST00000380230.3:c.71G>A	chr15.hg19:g.65208032G>A	ENSP00000369579:p.Arg24His	57.0	0.0		43.0	13.0	NM_182703	Q495B2|Q495B3|Q8N7A0|Q8NBS5	Missense_Mutation	SNP	ENST00000380230.3	hg19	CCDS10197.2	.	.	.	.	.	.	.	.	.	.	G	15.22	2.769437	0.49680	.	.	ENSG00000166839	ENST00000380230;ENST00000357698;ENST00000395720	T;T;T	0.66460	-0.21;-0.21;-0.21	3.94	2.06	0.26882	Ankyrin repeat-containing domain (4);	.	.	.	.	T	0.66147	0.2760	L	0.37697	1.125	0.09310	N	0.999997	D;D	0.76494	0.999;0.999	D;D	0.66847	0.947;0.911	T	0.53858	-0.8379	9	0.14656	T	0.56	-9.5593	6.0201	0.19625	0.238:0.0:0.762:0.0	.	24;24	Q495B1;Q495B1-1	AKD1A_HUMAN;.	H	24	ENSP00000369579:R24H;ENSP00000350329:R24H;ENSP00000379070:R24H	ENSP00000350329:R24H	R	+	2	0	ANKDD1A	62995085	0.098000	0.21812	0.018000	0.16275	0.787000	0.44495	1.223000	0.32527	0.363000	0.24346	0.484000	0.47621	CGC	.	.		0.597	ANKDD1A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256705.2	NM_182703	
LOXL1	4016	hgsc.bcm.edu	37	15	74235272	74235272	+	Missense_Mutation	SNP	C	C	T	rs566197761		TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr15:74235272C>T	ENST00000261921.7	+	2	1506	c.1180C>T	c.(1180-1182)Cgc>Tgc	p.R394C		NM_005576.2	NP_005567.2	Q08397	LOXL1_HUMAN	lysyl oxidase-like 1	394	Lysyl-oxidase like.				extracellular matrix organization (GO:0030198)|oxidation-reduction process (GO:0055114)|protein deamination (GO:0018277)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	copper ion binding (GO:0005507)|oxidoreductase activity, acting on the CH-NH2 group of donors, oxygen as acceptor (GO:0016641)			NS(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|lung(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	10						GTACTCCCTGCGCTGTGCTGC	0.587													C|||	1	0.000199681	0.0	0.0014	5008	,	,		20777	0.0		0.0	False		,,,				2504	0.0				p.R394C		Atlas-SNP	.											.	LOXL1	25	.	0			c.C1180T						.						174.0	163.0	166.0					15																	74235272		2198	4297	6495	SO:0001583	missense	4016	exon2			TCCCTGCGCTGTG	L21186	CCDS10253.1	15q24-q25	2008-07-18			ENSG00000129038	ENSG00000129038			6665	protein-coding gene	gene with protein product		153456				7689553	Standard	NM_005576		Approved	LOXL, LOL	uc002awc.1	Q08397	OTTHUMG00000137595	ENST00000261921.7:c.1180C>T	chr15.hg19:g.74235272C>T	ENSP00000261921:p.Arg394Cys	136.0	0.0		91.0	29.0	NM_005576	Q6NUL3|Q96BW7	Missense_Mutation	SNP	ENST00000261921.7	hg19	CCDS10253.1	.	.	.	.	.	.	.	.	.	.	C	19.01	3.744866	0.69418	.	.	ENSG00000129038	ENST00000261921;ENST00000395162	T	0.33438	1.41	3.91	3.91	0.45181	.	0.067785	0.64402	D	0.000019	T	0.53174	0.1780	M	0.80982	2.52	0.58432	D	0.999994	D	0.89917	1.0	D	0.81914	0.995	T	0.57653	-0.7774	10	0.87932	D	0	.	9.0924	0.36619	0.2186:0.7814:0.0:0.0	.	394	Q08397	LOXL1_HUMAN	C	394;256	ENSP00000261921:R394C	ENSP00000261921:R394C	R	+	1	0	LOXL1	72022325	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	1.752000	0.38349	2.180000	0.69256	0.561000	0.74099	CGC	.	.		0.587	LOXL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268995.2	NM_005576	
ISLR	3671	hgsc.bcm.edu	37	15	74467261	74467261	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr15:74467261A>G	ENST00000249842.3	+	2	419	c.62A>G	c.(61-63)gAg>gGg	p.E21G	RP11-665J16.1_ENST00000561647.1_RNA|ISLR_ENST00000395118.1_Missense_Mutation_p.E21G	NM_005545.3	NP_005536.1	O14498	ISLR_HUMAN	immunoglobulin superfamily containing leucine-rich repeat	21	LRRNT.				cell adhesion (GO:0007155)	extracellular vesicular exosome (GO:0070062)				central_nervous_system(1)|large_intestine(7)|lung(8)|ovary(1)|prostate(2)|skin(1)	20						GCCTGCCCTGAGCCCTGCGAC	0.627																																					p.E21G		Atlas-SNP	.											.	ISLR	49	.	0			c.A62G						.						46.0	43.0	44.0					15																	74467261		2198	4297	6495	SO:0001583	missense	3671	exon2			GCCCTGAGCCCTG	AB003184	CCDS10260.1	15q23-q24	2013-01-11			ENSG00000129009	ENSG00000129009		"""Immunoglobulin superfamily / I-set domain containing"""	6133	protein-coding gene	gene with protein product		602059				9325048	Standard	NM_005545		Approved	HsT17563	uc002axh.1	O14498	OTTHUMG00000137623	ENST00000249842.3:c.62A>G	chr15.hg19:g.74467261A>G	ENSP00000249842:p.Glu21Gly	57.0	0.0		41.0	10.0	NM_201526		Missense_Mutation	SNP	ENST00000249842.3	hg19	CCDS10260.1	.	.	.	.	.	.	.	.	.	.	A	10.78	1.446065	0.25987	.	.	ENSG00000129009	ENST00000249842;ENST00000395118	T;T	0.62105	0.05;0.05	3.91	2.67	0.31697	Leucine-rich repeat-containing N-terminal (1);	0.252672	0.25922	U	0.027435	T	0.43277	0.1240	L	0.28054	0.825	0.45354	D	0.998349	B	0.09022	0.002	B	0.11329	0.006	T	0.32428	-0.9907	10	0.36615	T	0.2	.	6.0472	0.19766	0.6112:0.2978:0.091:0.0	.	21	O14498	ISLR_HUMAN	G	21	ENSP00000249842:E21G;ENSP00000378550:E21G	ENSP00000249842:E21G	E	+	2	0	ISLR	72254314	0.997000	0.39634	0.952000	0.39060	0.597000	0.36814	2.940000	0.49003	1.413000	0.46997	0.260000	0.18958	GAG	.	.		0.627	ISLR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269044.1	NM_005545	
ARID3B	10620	hgsc.bcm.edu	37	15	74836781	74836781	+	Silent	SNP	C	C	T			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr15:74836781C>T	ENST00000346246.5	+	2	735	c.504C>T	c.(502-504)gtC>gtT	p.V168V		NM_006465.2	NP_006456.1	Q8IVW6	ARI3B_HUMAN	AT rich interactive domain 3B (BRIGHT-like)	168						nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)			NS(1)|breast(1)|endometrium(1)|large_intestine(2)|lung(7)|prostate(2)	14						CACCTTCTGTCTCCACAGCAG	0.517																																					p.V168V		Atlas-SNP	.											.	ARID3B	35	.	0			c.C504T						.						70.0	56.0	61.0					15																	74836781		2197	4296	6493	SO:0001819	synonymous_variant	10620	exon2			TTCTGTCTCCACA		CCDS10264.1	15q24	2013-02-07	2006-11-08		ENSG00000179361	ENSG00000179361		"""-"""	14350	protein-coding gene	gene with protein product		612457	"""AT rich interactive domain 3B (BRIGHT- like)"""				Standard	NM_006465		Approved	BDP, DRIL2	uc002ayd.3	Q8IVW6	OTTHUMG00000141321	ENST00000346246.5:c.504C>T	chr15.hg19:g.74836781C>T		104.0	0.0		77.0	27.0	NM_006465	O95443|Q59HC9|Q6P9C9	Silent	SNP	ENST00000346246.5	hg19	CCDS10264.1																																																																																			.	.		0.517	ARID3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000280688.2	NM_006465	
PDE8A	5151	hgsc.bcm.edu	37	15	85681082	85681082	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr15:85681082G>T	ENST00000310298.4	+	23	2690	c.2438G>T	c.(2437-2439)tGg>tTg	p.W813L	PDE8A_ENST00000394553.1_Missense_Mutation_p.W813L|PDE8A_ENST00000339708.5_Missense_Mutation_p.W767L|PDE8A_ENST00000557957.1_Missense_Mutation_p.W741L			O60658	PDE8A_HUMAN	phosphodiesterase 8A	813	Catalytic. {ECO:0000250}.				cAMP catabolic process (GO:0006198)|cyclic nucleotide metabolic process (GO:0009187)|phosphorelay signal transduction system (GO:0000160)|regulation of transcription, DNA-templated (GO:0006355)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)			NS(1)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(4)|lung(8)|ovary(2)|pancreas(1)|prostate(1)|skin(2)	25	Colorectal(223;0.227)		BRCA - Breast invasive adenocarcinoma(143;0.0608)		Caffeine(DB00201)|Ketotifen(DB00920)	TTTAAATACTGGAAAGGACTG	0.468																																					p.W813L		Atlas-SNP	.											.	PDE8A	50	.	0			c.G2438T						.						101.0	85.0	91.0					15																	85681082		2203	4299	6502	SO:0001583	missense	5151	exon22			AATACTGGAAAGG	AF056490	CCDS10336.1, CCDS10337.1, CCDS58397.1	15q25.3	2008-05-14			ENSG00000073417	ENSG00000073417	3.1.4.17	"""Phosphodiesterases"""	8793	protein-coding gene	gene with protein product		602972				9618252	Standard	NM_001243137		Approved	HsT19550	uc002blh.3	O60658	OTTHUMG00000148670	ENST00000310298.4:c.2438G>T	chr15.hg19:g.85681082G>T	ENSP00000311453:p.Trp813Leu	146.0	0.0		103.0	36.0	NM_002605	B3KXE6|H0YMZ7|Q6P9H3|Q969I1|Q96PC9|Q96PD0|Q96PD1|Q96T71|Q9UMB7|Q9UMC3	Missense_Mutation	SNP	ENST00000310298.4	hg19	CCDS10336.1	.	.	.	.	.	.	.	.	.	.	G	18.92	3.725813	0.69074	.	.	ENSG00000073417	ENST00000310298;ENST00000394553;ENST00000339708	T;T;T	0.81330	-1.48;-1.48;-1.48	5.49	5.49	0.81192	5&apos (1);-cyclic nucleotide phosphodiesterase, catalytic domain (1);3&apos (1);	0.000000	0.85682	D	0.000000	D	0.90068	0.6898	M	0.80746	2.51	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	D	0.90735	0.4645	10	0.87932	D	0	.	16.9239	0.86170	0.0:0.0:1.0:0.0	.	767;813	O60658-2;O60658	.;PDE8A_HUMAN	L	813;813;767	ENSP00000311453:W813L;ENSP00000378056:W813L;ENSP00000340679:W767L	ENSP00000311453:W813L	W	+	2	0	PDE8A	83482086	1.000000	0.71417	1.000000	0.80357	0.013000	0.08279	9.185000	0.94900	2.865000	0.98341	0.655000	0.94253	TGG	.	.		0.468	PDE8A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000309018.1	NM_002605	
AGBL1	123624	hgsc.bcm.edu	37	15	87097615	87097615	+	Silent	SNP	G	G	A			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr15:87097615G>A	ENST00000441037.2	+	20	2798	c.2703G>A	c.(2701-2703)aaG>aaA	p.K901K	AGBL1_ENST00000389298.3_Silent_p.K632K|AGBL1_ENST00000421325.2_Silent_p.K901K	NM_152336.2	NP_689549.2	Q96MI9	CBPC4_HUMAN	ATP/GTP binding protein-like 1	901					C-terminal protein deglutamylation (GO:0035609)|protein side chain deglutamylation (GO:0035610)	cytoplasm (GO:0005737)	metallocarboxypeptidase activity (GO:0004181)|tubulin binding (GO:0015631)|zinc ion binding (GO:0008270)			NS(3)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|liver(2)|lung(28)|ovary(2)|prostate(4)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	62						TCCTTGATAAGCTAGCACCAG	0.463																																					p.K901K		Atlas-SNP	.											.	AGBL1	151	.	0			c.G2703A						.						31.0	31.0	31.0					15																	87097615		1870	4103	5973	SO:0001819	synonymous_variant	123624	exon20			TGATAAGCTAGCA	AK056872	CCDS58398.1	15q25.3	2014-06-23			ENSG00000166748	ENSG00000166748			26504	protein-coding gene	gene with protein product	"""cytosolic carboxypeptidase 4"""	615496				21074048, 24094747	Standard	NM_152336		Approved	FLJ32310, CCP4	uc002blz.1	Q96MI9	OTTHUMG00000149978	ENST00000441037.2:c.2703G>A	chr15.hg19:g.87097615G>A		72.0	0.0		61.0	23.0	NM_152336	A1A4X5|A6NJH6|C9JHL5	Silent	SNP	ENST00000441037.2	hg19	CCDS58398.1																																																																																			.	.		0.463	AGBL1-001	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000314929.5	NM_152336	
SSTR5	6755	hgsc.bcm.edu	37	16	1129560	1129560	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr16:1129560C>A	ENST00000293897.4	+	1	780	c.692C>A	c.(691-693)gCg>gAg	p.A231E	SSTR5-AS1_ENST00000569832.1_RNA|SSTR5_ENST00000397547.2_Missense_Mutation_p.A231E|SSTR5_ENST00000562758.1_Intron	NM_001053.3	NP_001044.1	P35346	SSR5_HUMAN	somatostatin receptor 5	231					G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|glucose homeostasis (GO:0042593)|negative regulation of cell proliferation (GO:0008285)|positive regulation of cytokinesis (GO:0032467)|regulation of insulin secretion (GO:0050796)|somatostatin signaling pathway (GO:0038170)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	somatostatin receptor activity (GO:0004994)			endometrium(2)|lung(5)|prostate(1)|skin(1)	9		Hepatocellular(780;0.00369)			Octreotide(DB00104)|Pasireotide(DB06663)|Vapreotide(DB04894)	GTGAGGGCGGCGGGCGTGCGC	0.672																																					p.A231E		Atlas-SNP	.											.	SSTR5	36	.	0			c.C692A						.						78.0	75.0	76.0					16																	1129560		2190	4294	6484	SO:0001583	missense	6755	exon2			GGGCGGCGGGCGT	D16827	CCDS10429.1	16p13.3	2012-08-08			ENSG00000162009	ENSG00000162009		"""GPCR / Class A : Somatostatin receptors"""	11334	protein-coding gene	gene with protein product		182455				7607700	Standard	NM_001053		Approved		uc021taf.1	P35346	OTTHUMG00000047842	ENST00000293897.4:c.692C>A	chr16.hg19:g.1129560C>A	ENSP00000293897:p.Ala231Glu	70.0	0.0		63.0	46.0	NM_001172560	P34988|Q541E0|Q9UJI5	Missense_Mutation	SNP	ENST00000293897.4	hg19	CCDS10429.1	.	.	.	.	.	.	.	.	.	.	C	11.16	1.556218	0.27827	.	.	ENSG00000162009	ENST00000397547;ENST00000293897	T;T	0.39056	1.1;1.1	4.76	3.79	0.43588	GPCR, rhodopsin-like superfamily (1);	0.229561	0.37955	N	0.001875	T	0.48132	0.1483	L	0.45744	1.44	0.09310	N	1	P	0.40107	0.703	P	0.50570	0.644	T	0.41106	-0.9527	10	0.56958	D	0.05	.	12.4082	0.55451	0.0:0.9164:0.0:0.0836	.	231	P35346	SSR5_HUMAN	E	231	ENSP00000380680:A231E;ENSP00000293897:A231E	ENSP00000293897:A231E	A	+	2	0	SSTR5	1069561	0.017000	0.18338	0.002000	0.10522	0.004000	0.04260	2.500000	0.45381	0.980000	0.38523	0.561000	0.74099	GCG	.	.		0.672	SSTR5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000420836.1		
ALG1	56052	hgsc.bcm.edu	37	16	5121883	5121883	+	Silent	SNP	G	G	A			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr16:5121883G>A	ENST00000262374.5	+	1	64	c.33G>A	c.(31-33)ctG>ctA	p.L11L	ALG1_ENST00000544428.1_5'Flank|ALG1_ENST00000588623.1_Intron	NM_019109.4	NP_061982.3	Q9BT22	ALG1_HUMAN	ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase	11					cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|lipopolysaccharide biosynthetic process (GO:0009103)|mannosylation (GO:0097502)|post-translational protein modification (GO:0043687)|protein glycosylation (GO:0006486)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	chitobiosyldiphosphodolichol beta-mannosyltransferase activity (GO:0004578)|mannosyltransferase activity (GO:0000030)			breast(1)|cervix(1)|endometrium(1)|large_intestine(1)|lung(5)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	13		Ovarian(90;0.0164)				TGCTGGCGCTGTGTctgctgc	0.721																																					p.L11L		Atlas-SNP	.											.	ALG1	35	.	0			c.G33A						.						11.0	12.0	11.0					16																	5121883		2174	4256	6430	SO:0001819	synonymous_variant	56052	exon1			GGCGCTGTGTCTG	AB019038	CCDS10528.1	16p13.3	2013-02-22	2013-02-22		ENSG00000033011	ENSG00000033011	2.4.1.142	"""Glycosyltransferase group 1 domain containing"""	18294	protein-coding gene	gene with protein product		605907	"""asparagine-linked glycosylation 1 homolog (yeast, beta-1,4-mannosyltransferase)"", ""asparagine-linked glycosylation 1, beta-1,4-mannosyltransferase homolog (S. cerevisiae)"""			10704531	Standard	NM_019109		Approved	HMT-1, HMAT1	uc002cym.3	Q9BT22	OTTHUMG00000129529	ENST00000262374.5:c.33G>A	chr16.hg19:g.5121883G>A		29.0	0.0		18.0	14.0	NM_019109	B4DP08|Q6UVZ9|Q8N5Y4|Q9P2Y2	Silent	SNP	ENST00000262374.5	hg19	CCDS10528.1																																																																																			.	.		0.721	ALG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251716.2	NM_019109	
GSG1L	146395	hgsc.bcm.edu	37	16	27840186	27840186	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr16:27840186G>A	ENST00000447459.2	-	5	838	c.754C>T	c.(754-756)Cgc>Tgc	p.R252C	GSG1L_ENST00000569166.1_Missense_Mutation_p.R97C|GSG1L_ENST00000380898.2_Missense_Mutation_p.R97C|GSG1L_ENST00000380897.3_Missense_Mutation_p.R97C|GSG1L_ENST00000395724.3_Missense_Mutation_p.R201C	NM_001109763.1	NP_001103233.1	Q6UXU4	GSG1L_HUMAN	GSG1-like	252					regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)	asymmetric synapse (GO:0032279)|cell junction (GO:0030054)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				endometrium(2)|large_intestine(2)|lung(8)|ovary(1)|prostate(4)	17						AAGACCTTGCGCTTGTGCCGG	0.587																																					p.R252C		Atlas-SNP	.											.	GSG1L	82	.	0			c.C754T						.						103.0	76.0	85.0					16																	27840186		2197	4300	6497	SO:0001583	missense	146395	exon5			CCTTGCGCTTGTG	AK128775	CCDS10631.1, CCDS45450.1	16p11.2	2014-01-20			ENSG00000169181	ENSG00000169181			28283	protein-coding gene	gene with protein product						22813734	Standard	NM_001109763		Approved	MGC18079, PRO19651, KTSR5831	uc002doz.2	Q6UXU4	OTTHUMG00000131676	ENST00000447459.2:c.754C>T	chr16.hg19:g.27840186G>A	ENSP00000394954:p.Arg252Cys	159.0	0.0		145.0	41.0	NM_001109763	Q7Z6F8|Q8TB81	Missense_Mutation	SNP	ENST00000447459.2	hg19	CCDS45450.1	.	.	.	.	.	.	.	.	.	.	G	33	5.207335	0.95033	.	.	ENSG00000169181	ENST00000447459;ENST00000395724;ENST00000380898;ENST00000380897	T;T	0.35605	1.33;1.3	5.24	5.24	0.73138	.	0.000000	0.85682	D	0.000000	T	0.55940	0.1952	L	0.49778	1.585	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.77557	0.949;0.967;0.99	T	0.58188	-0.7680	10	0.87932	D	0	0.6619	17.5938	0.88005	0.0:0.0:1.0:0.0	.	201;97;252	Q6UXU4-3;Q6UXU4-4;Q6UXU4	.;.;GSG1L_HUMAN	C	252;201;97;97	ENSP00000394954:R252C;ENSP00000379074:R201C	ENSP00000370282:R97C	R	-	1	0	GSG1L	27747687	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.898000	0.87363	2.455000	0.83008	0.650000	0.86243	CGC	.	.		0.587	GSG1L-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433832.2	NM_144675	
ITGAD	3681	hgsc.bcm.edu	37	16	31405619	31405619	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr16:31405619G>T	ENST00000389202.2	+	2	143	c.94G>T	c.(94-96)Gca>Tca	p.A32S		NM_005353.2	NP_005344.2	Q13349	ITAD_HUMAN	integrin, alpha D	32					activated T cell proliferation (GO:0050798)|extracellular matrix organization (GO:0030198)|heterotypic cell-cell adhesion (GO:0034113)|immune response (GO:0006955)|integrin-mediated signaling pathway (GO:0007229)	cell surface (GO:0009986)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|liver(2)|lung(43)|ovary(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	71						CCAGGAGGATGCAGGCGGCTT	0.572																																					p.A32S		Atlas-SNP	.											.	ITGAD	154	.	0			c.G94T						.						103.0	86.0	91.0					16																	31405619		2197	4300	6497	SO:0001583	missense	3681	exon2			GAGGATGCAGGCG	U40274	CCDS32438.1	16p13.1-p11	2010-03-23				ENSG00000156886		"""CD molecules"", ""Integrins"""	6146	protein-coding gene	gene with protein product		602453				8666289, 9598326	Standard	NM_005353		Approved	CD11d, ADB2	uc002ebv.1	Q13349		ENST00000389202.2:c.94G>T	chr16.hg19:g.31405619G>T	ENSP00000373854:p.Ala32Ser	132.0	0.0		104.0	15.0	NM_005353	Q15575|Q15576	Missense_Mutation	SNP	ENST00000389202.2	hg19	CCDS32438.1	.	.	.	.	.	.	.	.	.	.	G	9.722	1.160041	0.21454	.	.	ENSG00000156886	ENST00000444228;ENST00000389202	T	0.72394	-0.65	4.54	4.54	0.55810	.	.	.	.	.	T	0.60856	0.2301	L	0.42581	1.335	0.09310	N	1	B;B;B	0.29590	0.25;0.038;0.021	B;B;B	0.25506	0.061;0.056;0.056	T	0.48258	-0.9051	9	0.20046	T	0.44	.	12.7695	0.57412	0.0:0.0:1.0:0.0	.	32;48;32	B7Z6V7;Q59H14;Q13349	.;.;ITAD_HUMAN	S	48;32	ENSP00000373854:A32S	ENSP00000373854:A32S	A	+	1	0	ITGAD	31313120	0.030000	0.19436	0.048000	0.18961	0.505000	0.33919	2.474000	0.45154	2.064000	0.61679	0.561000	0.74099	GCA	.	.		0.572	ITGAD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000432836.1	NM_005353	
ABCC12	94160	hgsc.bcm.edu	37	16	48119516	48119516	+	Silent	SNP	G	G	T			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr16:48119516G>T	ENST00000311303.3	-	27	4161	c.3816C>A	c.(3814-3816)ctC>ctA	p.L1272L	ABCC12_ENST00000448542.1_3'UTR|ABCC12_ENST00000532355.1_5'UTR|ABCC12_ENST00000416054.1_3'UTR	NM_033226.2	NP_150229.2	Q96J65	MRP9_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 12	1272	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.					integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)			NS(1)|breast(5)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(15)|liver(1)|lung(43)|ovary(2)|prostate(3)|skin(7)|urinary_tract(1)	90		all_cancers(37;0.0474)|all_lung(18;0.047)				TTGAATTACGGAGAAGAGCTC	0.453																																					p.L1272L		Atlas-SNP	.											.	ABCC12	190	.	0			c.C3816A						.						151.0	148.0	149.0					16																	48119516		2201	4300	6501	SO:0001819	synonymous_variant	94160	exon27			ATTACGGAGAAGA	AY040220	CCDS10730.1	16q12.1	2012-03-14			ENSG00000140798	ENSG00000140798		"""ATP binding cassette transporters / subfamily C"""	14640	protein-coding gene	gene with protein product		607041				11435397, 11483364	Standard	NM_033226		Approved	MRP9	uc002efc.1	Q96J65	OTTHUMG00000133143	ENST00000311303.3:c.3816C>A	chr16.hg19:g.48119516G>T		191.0	0.0		144.0	43.0	NM_033226	Q49AL2|Q8TAF0|Q8TEY2	Silent	SNP	ENST00000311303.3	hg19	CCDS10730.1																																																																																			.	.		0.453	ABCC12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256837.1	NM_033226	
CNTNAP4	85445	hgsc.bcm.edu	37	16	76592443	76592443	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr16:76592443A>G	ENST00000476707.1	+	23	3938	c.3799A>G	c.(3799-3801)Att>Gtt	p.I1267V	CNTNAP4_ENST00000478060.1_Missense_Mutation_p.I1191V|CNTNAP4_ENST00000469589.1_3'UTR|CNTNAP4_ENST00000307431.8_Missense_Mutation_p.I1263V|RP11-58C22.1_ENST00000563764.1_Intron|CNTNAP4_ENST00000377504.4_Missense_Mutation_p.I1215V			Q9C0A0	CNTP4_HUMAN	contactin associated protein-like 4	1264					cell adhesion (GO:0007155)|regulation of grooming behavior (GO:2000821)|regulation of synaptic transmission, dopaminergic (GO:0032225)|regulation of synaptic transmission, GABAergic (GO:0032228)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|presynaptic membrane (GO:0042734)				breast(4)|central_nervous_system(1)|cervix(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(6)|lung(33)|ovary(2)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(1)	64						AGCTGTTCGCATTTATCAGCA	0.358																																					p.I1191V		Atlas-SNP	.											.	CNTNAP4	600	.	0			c.A3571G						.						85.0	84.0	84.0					16																	76592443		1959	4197	6156	SO:0001583	missense	85445	exon23			GTTCGCATTTATC	AB051550	CCDS10924.1, CCDS10924.2, CCDS73915.1	16q23.1	2008-02-05			ENSG00000152910	ENSG00000152910			18747	protein-coding gene	gene with protein product		610518				12093160	Standard	NM_033401		Approved	CASPR4, KIAA1763	uc010chb.1	Q9C0A0	OTTHUMG00000137617	ENST00000476707.1:c.3799A>G	chr16.hg19:g.76592443A>G	ENSP00000417628:p.Ile1267Val	172.0	0.0		176.0	52.0	NM_138994	E9PFZ6|Q86YZ7	Missense_Mutation	SNP	ENST00000476707.1	hg19		.	.	.	.	.	.	.	.	.	.	A	12.32	1.902010	0.33535	.	.	ENSG00000152910	ENST00000307431;ENST00000377504;ENST00000478060;ENST00000476707	T;T;T;T	0.57436	0.4;0.4;0.4;0.4	5.65	4.54	0.55810	.	0.000000	0.42053	D	0.000772	T	0.43831	0.1265	.	.	.	0.36153	D	0.84761	B;B;B	0.26547	0.017;0.046;0.152	B;B;B	0.25987	0.02;0.023;0.065	T	0.49263	-0.8958	9	0.38643	T	0.18	.	12.1231	0.53903	0.8716:0.0:0.0:0.1284	.	1191;1267;1264	E9PFZ6;E9PDN6;Q9C0A0	.;.;CNTP4_HUMAN	V	1263;1215;1191;1267	ENSP00000306893:I1263V;ENSP00000439733:I1215V;ENSP00000418741:I1191V;ENSP00000417628:I1267V	ENSP00000306893:I1263V	I	+	1	0	CNTNAP4	75149944	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.984000	0.56923	1.111000	0.41721	0.533000	0.62120	ATT	.	.		0.358	CNTNAP4-005	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000348216.1	NM_033401	
ADAMTS18	170692	hgsc.bcm.edu	37	16	77355100	77355100	+	Splice_Site	SNP	C	C	T			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr16:77355100C>T	ENST00000282849.5	-	15	2582		c.e15-1			NM_199355.2	NP_955387.1	Q8TE60	ATS18_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 18						eye development (GO:0001654)|negative regulation of platelet aggregation (GO:0090331)	proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(5)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(9)|large_intestine(26)|lung(44)|ovary(2)|pancreas(1)|prostate(1)|skin(19)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	118						ATCCCACTAGCTGTGACAAAA	0.378																																					.		Atlas-SNP	.											.	ADAMTS18	270	.	0			c.2164-1G>A						.						73.0	73.0	73.0					16																	77355100		2198	4300	6498	SO:0001630	splice_region_variant	170692	exon16			CACTAGCTGTGAC	AJ311903	CCDS10926.1	16q23	2008-07-29	2005-08-19		ENSG00000140873	ENSG00000140873		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17110	protein-coding gene	gene with protein product		607512	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 18"""	ADAMTS21		11867212, 17546048	Standard	NM_199355		Approved		uc002ffc.4	Q8TE60	OTTHUMG00000137619	ENST00000282849.5:c.2164-1G>A	chr16.hg19:g.77355100C>T		102.0	0.0		111.0	34.0	NM_199355	Q6P4R5|Q6ZWJ9	Splice_Site	SNP	ENST00000282849.5	hg19	CCDS10926.1	.	.	.	.	.	.	.	.	.	.	C	16.07	3.019772	0.54576	.	.	ENSG00000140873	ENST00000282849	.	.	.	5.71	5.71	0.89125	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.8324	0.92145	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	ADAMTS18	75912601	1.000000	0.71417	1.000000	0.80357	0.529000	0.34654	7.409000	0.80053	2.696000	0.92011	0.655000	0.94253	.	.	.		0.378	ADAMTS18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269037.1		Intron
ADAMTS18	170692	hgsc.bcm.edu	37	16	77401346	77401346	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr16:77401346C>T	ENST00000282849.5	-	4	1188	c.770G>A	c.(769-771)cGc>cAc	p.R257H	ADAMTS18_ENST00000567121.1_5'Flank	NM_199355.2	NP_955387.1	Q8TE60	ATS18_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 18	257					eye development (GO:0001654)|negative regulation of platelet aggregation (GO:0090331)	proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(5)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(9)|large_intestine(26)|lung(44)|ovary(2)|pancreas(1)|prostate(1)|skin(19)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	118						ACATTTCTTGCGTCGTCCACA	0.443																																					p.R257H		Atlas-SNP	.											.	ADAMTS18	270	.	0			c.G770A						.						77.0	76.0	76.0					16																	77401346		2198	4300	6498	SO:0001583	missense	170692	exon4			TTCTTGCGTCGTC	AJ311903	CCDS10926.1	16q23	2008-07-29	2005-08-19		ENSG00000140873	ENSG00000140873		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17110	protein-coding gene	gene with protein product		607512	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 18"""	ADAMTS21		11867212, 17546048	Standard	NM_199355		Approved		uc002ffc.4	Q8TE60	OTTHUMG00000137619	ENST00000282849.5:c.770G>A	chr16.hg19:g.77401346C>T	ENSP00000282849:p.Arg257His	91.0	0.0		76.0	32.0	NM_199355	Q6P4R5|Q6ZWJ9	Missense_Mutation	SNP	ENST00000282849.5	hg19	CCDS10926.1	.	.	.	.	.	.	.	.	.	.	C	32	5.175432	0.94807	.	.	ENSG00000140873	ENST00000282849;ENST00000449265	T;T	0.61392	0.11;2.09	4.99	4.99	0.66335	.	0.000000	0.85682	D	0.000000	T	0.76608	0.4011	M	0.78049	2.395	0.58432	D	0.999999	D	0.89917	1.0	D	0.79784	0.993	T	0.78242	-0.2280	10	0.52906	T	0.07	.	17.4456	0.87577	0.0:1.0:0.0:0.0	.	257	Q8TE60	ATS18_HUMAN	H	257	ENSP00000282849:R257H;ENSP00000392540:R257H	ENSP00000282849:R257H	R	-	2	0	ADAMTS18	75958847	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.447000	0.66606	2.603000	0.88011	0.555000	0.69702	CGC	.	.		0.443	ADAMTS18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269037.1		
TP53	7157	hgsc.bcm.edu	37	17	7577534	7577534	+	Missense_Mutation	SNP	C	C	A	rs28934571		TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr17:7577534C>A	ENST00000269305.4	-	7	936	c.747G>T	c.(745-747)agG>agT	p.R249S	TP53_ENST00000359597.4_Missense_Mutation_p.R249S|TP53_ENST00000420246.2_Missense_Mutation_p.R249S|TP53_ENST00000455263.2_Missense_Mutation_p.R249S|TP53_ENST00000413465.2_Missense_Mutation_p.R249S|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000445888.2_Missense_Mutation_p.R249S	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	249	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		R -> G (in sporadic cancers; somatic mutation).|R -> I (in a sporadic cancer; somatic mutation).|R -> K (in sporadic cancers; somatic mutation).|R -> M (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:17224074}.|R -> N (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|R -> S (in sporadic cancers; somatic mutation; does not induce SNAI1 degradation; dbSNP:rs28934571). {ECO:0000269|PubMed:1694291, ECO:0000269|PubMed:16959974}.|R -> T (in sporadic cancers; somatic mutation).|R -> W (in sporadic cancers; somatic mutation).|RP -> SA (in a sporadic cancer; somatic mutation).|RP -> SS (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R249S(348)|p.0?(8)|p.R249R(5)|p.?(5)|p.M246_P250delMNRRP(2)|p.R248_P250delRRP(1)|p.R249_P250delRP(1)|p.R249_P250insR(1)|p.R249_P250>SS(1)|p.N247_R249delNRR(1)|p.N247_P250delNRRP(1)|p.R249fs*14(1)|p.R249_T256delRPILTIIT(1)|p.P250fs*14(1)|p.R249_I251delRPI(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TGAGGATGGGCCTCCGGTTCA	0.572		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.R249S	Pancreas(47;798 1329 9957 10801)	Atlas-SNP	.	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53_ENST00000455263,right_lower_lobe,carcinoma,-2,1	TP53	33396	.	378	Substitution - Missense(348)|Deletion - In frame(8)|Whole gene deletion(8)|Unknown(5)|Substitution - coding silent(5)|Insertion - Frameshift(1)|Insertion - In frame(1)|Deletion - Frameshift(1)|Complex - compound substitution(1)	liver(240)|lung(44)|upper_aerodigestive_tract(12)|breast(12)|central_nervous_system(10)|stomach(7)|ovary(6)|prostate(6)|cervix(5)|haematopoietic_and_lymphoid_tissue(5)|large_intestine(5)|biliary_tract(5)|urinary_tract(5)|bone(4)|endometrium(3)|oesophagus(3)|skin(2)|peritoneum(1)|kidney(1)|salivary_gland(1)|pancreas(1)	c.G747T						.						155.0	113.0	127.0					17																	7577534		2203	4300	6503	SO:0001583	missense	7157	exon7	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	GATGGGCCTCCGG	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.747G>T	chr17.hg19:g.7577534C>A	ENSP00000269305:p.Arg249Ser	87.0	0.0		50.0	22.0	NM_000546	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	hg19	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	C	17.26	3.344264	0.61073	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	D;D;D;D;D;D;D	0.99865	-7.29;-7.29;-7.29;-7.29;-7.29;-7.29;-7.29	4.62	-0.0929	0.13654	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99792	0.9912	M	0.92367	3.3	0.50039	D	0.999848	D;D;D;D;D	0.89917	0.996;0.996;0.997;0.99;1.0	D;D;D;D;D	0.79108	0.968;0.966;0.981;0.955;0.992	D	0.98720	1.0708	10	0.72032	D	0.01	-3.0658	3.2479	0.06803	0.1392:0.5551:0.1362:0.1695	rs28934571	249;249;249;249;249	P04637-2;P04637-3;P04637;Q1MSW8;E7EQX7	.;.;P53_HUMAN;.;.	S	249;249;249;249;249;249;238;117	ENSP00000410739:R249S;ENSP00000352610:R249S;ENSP00000269305:R249S;ENSP00000398846:R249S;ENSP00000391127:R249S;ENSP00000391478:R249S;ENSP00000425104:R117S	ENSP00000269305:R249S	R	-	3	2	TP53	7518259	0.011000	0.17503	0.998000	0.56505	0.783000	0.44284	-1.379000	0.02554	0.253000	0.21552	0.462000	0.41574	AGG	.	.		0.572	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
DNAH2	146754	hgsc.bcm.edu	37	17	7721980	7721980	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr17:7721980T>C	ENST00000572933.1	+	70	12016	c.10556T>C	c.(10555-10557)cTg>cCg	p.L3519P	DNAH2_ENST00000389173.2_Missense_Mutation_p.L3519P			Q9P225	DYH2_HUMAN	dynein, axonemal, heavy chain 2	3519	AAA 5. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(3)|breast(11)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(16)|large_intestine(53)|liver(2)|lung(49)|ovary(7)|prostate(7)|skin(15)|upper_aerodigestive_tract(1)|urinary_tract(1)	189		all_cancers(10;4.66e-07)|Prostate(122;0.081)				GCCCAGCTGCTGGGCATTGTG	0.592																																					p.L3519P		Atlas-SNP	.											.	DNAH2	498	.	0			c.T10556C						.						101.0	97.0	98.0					17																	7721980		2203	4300	6503	SO:0001583	missense	146754	exon69			AGCTGCTGGGCAT	U83570, AK128517	CCDS32551.1	17p13.1	2007-10-05	2006-09-04			ENSG00000183914		"""Axonemal dyneins"""	2948	protein-coding gene	gene with protein product		603333	"""dynein, axonemal, heavy polypeptide 2"", ""dynein heavy chain domain 3"""	DNHD3		9256245	Standard	XM_005256470		Approved	KIAA1503, FLJ46675	uc002giu.1	Q9P225		ENST00000572933.1:c.10556T>C	chr17.hg19:g.7721980T>C	ENSP00000458355:p.Leu3519Pro	47.0	0.0		24.0	13.0	NM_020877	A8K992|B5MDX5|O15434|Q6PIH3|Q6ZR42	Missense_Mutation	SNP	ENST00000572933.1	hg19	CCDS32551.1	.	.	.	.	.	.	.	.	.	.	T	19.41	3.821380	0.71028	.	.	ENSG00000183914	ENST00000360606;ENST00000389173	T	0.35789	1.29	4.34	4.34	0.51931	.	0.000000	0.64402	D	0.000014	T	0.75657	0.3879	H	0.99444	4.57	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.85621	0.1264	10	0.87932	D	0	.	12.6744	0.56884	0.0:0.0:0.0:1.0	.	3480;3519	Q9P225-2;Q9P225	.;DYH2_HUMAN	P	3480;3519	ENSP00000373825:L3519P	ENSP00000353818:L3480P	L	+	2	0	DNAH2	7662705	1.000000	0.71417	0.980000	0.43619	0.854000	0.48673	4.435000	0.59941	1.819000	0.53055	0.460000	0.39030	CTG	.	.		0.592	DNAH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440241.1	NM_020877	
MYH3	4621	hgsc.bcm.edu	37	17	10534941	10534941	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr17:10534941T>C	ENST00000583535.1	-	36	5360	c.5273A>G	c.(5272-5274)aAg>aGg	p.K1758R	MYH3_ENST00000226209.7_Missense_Mutation_p.K1758R	NM_002470.3	NP_002461.2	P11055	MYH3_HUMAN	myosin, heavy chain 3, skeletal muscle, embryonic	1758					actin filament-based movement (GO:0030048)|ATP catabolic process (GO:0006200)|embryonic limb morphogenesis (GO:0030326)|face morphogenesis (GO:0060325)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|sarcomere organization (GO:0045214)|skeletal muscle contraction (GO:0003009)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)|sarcomere (GO:0030017)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|ATPase activity, coupled (GO:0042623)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(5)|large_intestine(18)|lung(30)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	83						CGTGATGGCCTTCTTGGCCTT	0.567											OREG0024180	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.K1758R		Atlas-SNP	.											.	MYH3	227	.	0			c.A5273G						.						173.0	118.0	137.0					17																	10534941		2203	4300	6503	SO:0001583	missense	4621	exon36			ATGGCCTTCTTGG		CCDS11157.1	17p13.1	2013-09-19	2006-09-29		ENSG00000109063	ENSG00000109063		"""Myosins / Myosin superfamily : Class II"""	7573	protein-coding gene	gene with protein product	"""myosin, skeletal, heavy chain, embryonic 1"", ""muscle embryonic myosin heavy chain 3"""	160720	"""myosin, heavy polypeptide 3, skeletal muscle, embryonic"""			2726495	Standard	NM_002470		Approved	MYHC-EMB, MYHSE1, HEMHC, SMHCE	uc002gmq.2	P11055	OTTHUMG00000130367	ENST00000583535.1:c.5273A>G	chr17.hg19:g.10534941T>C	ENSP00000464317:p.Lys1758Arg	122.0	0.0	665	48.0	25.0	NM_002470	Q15492	Missense_Mutation	SNP	ENST00000583535.1	hg19	CCDS11157.1	.	.	.	.	.	.	.	.	.	.	T	29.8	5.040387	0.93630	.	.	ENSG00000109063	ENST00000226209	T	0.80214	-1.35	5.0	5.0	0.66597	Myosin tail (1);	.	.	.	.	D	0.87791	0.6266	M	0.82433	2.59	0.42409	D	0.992596	P	0.45212	0.853	P	0.53760	0.734	D	0.90043	0.4143	9	0.87932	D	0	.	15.1557	0.72739	0.0:0.0:0.0:1.0	.	1758	P11055	MYH3_HUMAN	R	1758	ENSP00000226209:K1758R	ENSP00000226209:K1758R	K	-	2	0	MYH3	10475666	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	7.864000	0.87037	2.216000	0.71823	0.459000	0.35465	AAG	.	.		0.567	MYH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252734.2	NM_002470	
TBX21	30009	hgsc.bcm.edu	37	17	45820045	45820045	+	Silent	SNP	G	G	A			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr17:45820045G>A	ENST00000177694.1	+	2	772	c.561G>A	c.(559-561)gtG>gtA	p.V187V		NM_013351.1	NP_037483.1	Q9UL17	TBX21_HUMAN	T-box 21	187					cellular response to organic substance (GO:0071310)|lymphocyte migration (GO:0072676)|multicellular organismal development (GO:0007275)|positive regulation of isotype switching to IgG isotypes (GO:0048304)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|response to virus (GO:0009615)|T cell differentiation (GO:0030217)|transcription, DNA-templated (GO:0006351)	neuronal cell body (GO:0043025)|nucleus (GO:0005634)	sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|endometrium(1)|large_intestine(3)|lung(14)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	22						GGATGTTTGTGGACGTGGTCT	0.632																																					p.V187V		Atlas-SNP	.											.	TBX21	50	.	0			c.G561A						.						46.0	37.0	40.0					17																	45820045		2203	4300	6503	SO:0001819	synonymous_variant	30009	exon2			GTTTGTGGACGTG	AF093098	CCDS11514.1	17q21.2	2008-06-23				ENSG00000073861		"""T-boxes"""	11599	protein-coding gene	gene with protein product		604895					Standard	NM_013351		Approved	TBLYM, T-bet	uc002ilv.1	Q9UL17		ENST00000177694.1:c.561G>A	chr17.hg19:g.45820045G>A		93.0	0.0		56.0	7.0	NM_013351		Silent	SNP	ENST00000177694.1	hg19	CCDS11514.1																																																																																			.	.		0.632	TBX21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441365.1	NM_013351	
EVPL	2125	hgsc.bcm.edu	37	17	74014602	74014602	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr17:74014602C>A	ENST00000301607.3	-	12	1617	c.1364G>T	c.(1363-1365)gGg>gTg	p.G455V	EVPL_ENST00000586740.1_Missense_Mutation_p.G455V	NM_001988.2	NP_001979.2	Q92817	EVPL_HUMAN	envoplakin	455	Globular 1.				epidermis development (GO:0008544)|keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)	cell junction (GO:0030054)|cornified envelope (GO:0001533)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	protein binding, bridging (GO:0030674)|structural molecule activity (GO:0005198)			breast(4)|central_nervous_system(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|lung(14)|ovary(2)|pancreas(2)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)	54						CTTGGTCTCCCCGCCAGGGCC	0.652																																					p.G455V		Atlas-SNP	.											.	EVPL	155	.	0			c.G1364T						.						20.0	21.0	21.0					17																	74014602		2202	4298	6500	SO:0001583	missense	2125	exon12			GTCTCCCCGCCAG	U53786	CCDS11737.1	17q25	2008-07-18				ENSG00000167880			3503	protein-coding gene	gene with protein product		601590				8938451, 10409435	Standard	NM_001988		Approved	EVPK	uc002jqi.2	Q92817		ENST00000301607.3:c.1364G>T	chr17.hg19:g.74014602C>A	ENSP00000301607:p.Gly455Val	108.0	0.0		104.0	32.0	NM_001988	A0AUV5	Missense_Mutation	SNP	ENST00000301607.3	hg19	CCDS11737.1	.	.	.	.	.	.	.	.	.	.	C	26.8	4.768759	0.90020	.	.	ENSG00000167880	ENST00000301607	T	0.74002	-0.8	5.12	5.12	0.69794	.	0.052170	0.85682	D	0.000000	D	0.87334	0.6151	M	0.80982	2.52	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.87578	0.998;0.945	D	0.88852	0.3320	10	0.87932	D	0	-59.6834	18.9474	0.92627	0.0:1.0:0.0:0.0	.	455;455	B7ZLH8;Q92817	.;EVPL_HUMAN	V	455	ENSP00000301607:G455V	ENSP00000301607:G455V	G	-	2	0	EVPL	71526197	0.983000	0.35010	0.954000	0.39281	0.781000	0.44180	3.524000	0.53495	2.573000	0.86826	0.561000	0.74099	GGG	.	.		0.652	EVPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449483.1	NM_001988	
DUS1L	64118	hgsc.bcm.edu	37	17	80019565	80019565	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr17:80019565C>T	ENST00000354321.7	-	6	1111	c.626G>A	c.(625-627)gGg>gAg	p.G209E	DUS1L_ENST00000306796.5_Missense_Mutation_p.G209E			Q6P1R4	DUS1L_HUMAN	dihydrouridine synthase 1-like (S. cerevisiae)	209							flavin adenine dinucleotide binding (GO:0050660)|tRNA dihydrouridine synthase activity (GO:0017150)			breast(1)|endometrium(1)|lung(2)|ovary(1)|skin(1)	6	all_neural(118;0.0878)|Ovarian(332;0.227)|all_lung(278;0.246)		BRCA - Breast invasive adenocarcinoma(99;0.0114)|OV - Ovarian serous cystadenocarcinoma(97;0.0211)			CTGGATGTTCCCGTTAGCAAA	0.657																																					p.G209E		Atlas-SNP	.											.	DUS1L	25	.	0			c.G626A						.						96.0	91.0	93.0					17																	80019565		2203	4300	6503	SO:0001583	missense	64118	exon7			ATGTTCCCGTTAG		CCDS32775.1	17q25.3	2005-08-09				ENSG00000169718			30086	protein-coding gene	gene with protein product						12477932	Standard	NM_022156		Approved	PP3111, DUS1	uc002kdr.4	Q6P1R4		ENST00000354321.7:c.626G>A	chr17.hg19:g.80019565C>T	ENSP00000346280:p.Gly209Glu	81.0	0.0		50.0	18.0	NM_022156	A6NHV4|Q96AI3	Missense_Mutation	SNP	ENST00000354321.7	hg19	CCDS32775.1	.	.	.	.	.	.	.	.	.	.	C	15.61	2.883179	0.51908	.	.	ENSG00000169718	ENST00000354321;ENST00000306796;ENST00000542088;ENST00000538833	T;T;T	0.70869	-0.52;-0.52;-0.52	3.83	3.83	0.44106	Aldolase-type TIM barrel (1);	0.000000	0.85682	D	0.000000	D	0.90734	0.7092	H	0.99225	4.475	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.94905	0.8060	10	0.87932	D	0	-39.3762	16.2497	0.82475	0.0:1.0:0.0:0.0	.	82;209;78	B4DPG7;Q6P1R4;Q9BTJ3	.;DUS1L_HUMAN;.	E	209;209;82;77	ENSP00000346280:G209E;ENSP00000303515:G209E;ENSP00000445110:G77E	ENSP00000303515:G209E	G	-	2	0	DUS1L	77612854	1.000000	0.71417	1.000000	0.80357	0.903000	0.53119	7.093000	0.76937	2.126000	0.65437	0.563000	0.77884	GGG	.	.		0.657	DUS1L-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442347.1	NM_022156	
CDH20	28316	hgsc.bcm.edu	37	18	59217241	59217241	+	Missense_Mutation	SNP	C	C	A	rs373889945		TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr18:59217241C>A	ENST00000262717.4	+	11	2077	c.1679C>A	c.(1678-1680)tCt>tAt	p.S560Y	CDH20_ENST00000536675.2_Missense_Mutation_p.S560Y|CDH20_ENST00000538374.1_Missense_Mutation_p.S560Y			Q9HBT6	CAD20_HUMAN	cadherin 20, type 2	560	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(12)|lung(33)|ovary(1)|pancreas(1)|skin(3)	61		Colorectal(73;0.186)				ACCAGGAGGTCTGGTTTCCGG	0.512																																					p.S560Y		Atlas-SNP	.											.	CDH20	117	.	0			c.C1679A						.						47.0	49.0	49.0					18																	59217241		2203	4300	6503	SO:0001583	missense	28316	exon10			GGAGGTCTGGTTT	AF217289	CCDS11977.1	18q21.33	2010-01-26			ENSG00000101542	ENSG00000101542		"""Cadherins / Major cadherins"""	1760	protein-coding gene	gene with protein product		605807				10995570	Standard	NM_031891		Approved	CDH7L3, Cdh7	uc010dps.1	Q9HBT6	OTTHUMG00000132768	ENST00000262717.4:c.1679C>A	chr18.hg19:g.59217241C>A	ENSP00000262717:p.Ser560Tyr	95.0	0.0		117.0	48.0	NM_031891	Q495S3	Missense_Mutation	SNP	ENST00000262717.4	hg19	CCDS11977.1	.	.	.	.	.	.	.	.	.	.	C	19.88	3.909440	0.72868	.	.	ENSG00000101542	ENST00000536675;ENST00000538374;ENST00000262717	T;T;T	0.53640	0.61;0.61;0.61	5.93	5.93	0.95920	Cadherin (4);Cadherin-like (1);	0.257806	0.40818	N	0.001002	T	0.70002	0.3174	M	0.76574	2.34	0.42829	D	0.99401	D	0.55385	0.971	D	0.65323	0.934	T	0.70769	-0.4782	10	0.66056	D	0.02	.	20.3539	0.98825	0.0:1.0:0.0:0.0	.	560	Q9HBT6	CAD20_HUMAN	Y	560	ENSP00000444767:S560Y;ENSP00000442226:S560Y;ENSP00000262717:S560Y	ENSP00000262717:S560Y	S	+	2	0	CDH20	57368221	0.999000	0.42202	0.998000	0.56505	0.992000	0.81027	5.413000	0.66399	2.826000	0.97356	0.655000	0.94253	TCT	.	.		0.512	CDH20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256141.2	NM_031891	
FAM129C	199786	hgsc.bcm.edu	37	19	17657556	17657556	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr19:17657556G>T	ENST00000335393.4	+	14	1847	c.1709G>T	c.(1708-1710)gGc>gTc	p.G570V	FAM129C_ENST00000332386.5_Missense_Mutation_p.G570V|FAM129C_ENST00000601861.1_Missense_Mutation_p.G539V|FAM129C_ENST00000595684.1_Missense_Mutation_p.G570V|FAM129C_ENST00000600871.1_Missense_Mutation_p.G516V|FAM129C_ENST00000599124.1_Missense_Mutation_p.G503V|FAM129C_ENST00000599164.1_Missense_Mutation_p.G539V|FAM129C_ENST00000449408.2_Missense_Mutation_p.G296V|FAM129C_ENST00000352727.3_Missense_Mutation_p.G534V	NM_173544.4	NP_775815	Q86XR2	NIBL2_HUMAN	family with sequence similarity 129, member C	570										autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(8)|liver(2)|lung(14)|ovary(1)|skin(3)|stomach(1)	33						ACCACTGAGGGCATCTATGAG	0.637																																					p.G570V		Atlas-SNP	.											.	FAM129C	110	.	0			c.G1709T						.						71.0	48.0	56.0					19																	17657556		2203	4299	6502	SO:0001583	missense	199786	exon14			CTGAGGGCATCTA	AY254198	CCDS12362.1, CCDS42521.1	19p13.11	2008-02-05				ENSG00000167483			24130	protein-coding gene	gene with protein product	B cell novel protein 1	609967				12886250	Standard	NM_173544		Approved	FLJ39802, BCNP1	uc021uqj.1	Q86XR2		ENST00000335393.4:c.1709G>T	chr19.hg19:g.17657556G>T	ENSP00000335040:p.Gly570Val	42.0	0.0		42.0	12.0	NM_001098524	B4DNU3|B4DVN7|Q7Z6H6|Q86XR3|Q86XR4|Q8TEQ3	Missense_Mutation	SNP	ENST00000335393.4	hg19	CCDS12362.1	.	.	.	.	.	.	.	.	.	.	G	10.38	1.335235	0.24253	.	.	ENSG00000167483	ENST00000335393;ENST00000332386;ENST00000352727;ENST00000449408;ENST00000435646	T;T;T;T	0.38077	2.09;2.1;1.16;1.73	4.62	1.09	0.20402	.	0.744958	0.11957	N	0.513183	T	0.51312	0.1667	M	0.72479	2.2	0.09310	N	0.999993	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.77557	0.985;0.99;0.99;0.99;0.985	T	0.29579	-1.0007	10	0.56958	D	0.05	-17.2637	3.9466	0.09350	0.2199:0.2004:0.5797:0.0	.	516;570;570;534;570	E7ENP6;Q86XR2;Q86XR2-3;Q86XR2-4;Q86XR2-2	.;NIBL2_HUMAN;.;.;.	V	570;570;534;296;516	ENSP00000335040:G570V;ENSP00000333447:G570V;ENSP00000341067:G534V;ENSP00000394929:G296V	ENSP00000333447:G570V	G	+	2	0	FAM129C	17518556	0.239000	0.23836	0.006000	0.13384	0.067000	0.16453	0.880000	0.28159	1.086000	0.41228	-0.275000	0.10095	GGC	.	.		0.637	FAM129C-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000464206.1	NM_173544	
ANKRD27	84079	hgsc.bcm.edu	37	19	33096767	33096767	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr19:33096767G>A	ENST00000306065.4	-	24	2625	c.2467C>T	c.(2467-2469)Cac>Tac	p.H823Y	SNORA68_ENST00000364518.1_RNA	NM_032139.2	NP_115515.2	Q96NW4	ANR27_HUMAN	ankyrin repeat domain 27 (VPS9 domain)	823					early endosome to late endosome transport (GO:0045022)|positive regulation of GTPase activity (GO:0043547)	cytoplasm (GO:0005737)|early endosome (GO:0005769)|lysosome (GO:0005764)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)|guanyl-nucleotide exchange factor activity (GO:0005085)			breast(3)|endometrium(7)|kidney(2)|large_intestine(6)|lung(15)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(2)	42	Esophageal squamous(110;0.137)					ACAAGCTCGTGATGGCCACCG	0.587																																					p.H823Y		Atlas-SNP	.											.	ANKRD27	86	.	0			c.C2467T						.						123.0	109.0	114.0					19																	33096767		2203	4300	6503	SO:0001583	missense	84079	exon24			GCTCGTGATGGCC	AK054561	CCDS32986.1	19q13.12	2013-01-10				ENSG00000105186		"""Ankyrin repeat domain containing"""	25310	protein-coding gene	gene with protein product	"""Vps9 domain and ankyrin-repeat-containing protein"""					11230166, 16525121	Standard	NM_032139		Approved	FLJ00040, DKFZp434L0718, VARP	uc002ntn.1	Q96NW4		ENST00000306065.4:c.2467C>T	chr19.hg19:g.33096767G>A	ENSP00000304292:p.His823Tyr	166.0	0.0		454.0	292.0	NM_032139	Q71MF5|Q86UC3|Q8ND80|Q9H0I4	Missense_Mutation	SNP	ENST00000306065.4	hg19	CCDS32986.1	.	.	.	.	.	.	.	.	.	.	G	0.416	-0.910890	0.02434	.	.	ENSG00000105186	ENST00000306065	T	0.64438	-0.1	5.92	5.92	0.95590	Ankyrin repeat-containing domain (4);	0.095833	0.45606	D	0.000348	T	0.38348	0.1037	N	0.04132	-0.27	0.80722	D	1	B	0.13145	0.007	B	0.14578	0.011	T	0.34625	-0.9821	10	0.10902	T	0.67	-29.3388	14.4765	0.67548	0.072:0.0:0.928:0.0	.	823	Q96NW4	ANR27_HUMAN	Y	823	ENSP00000304292:H823Y	ENSP00000304292:H823Y	H	-	1	0	ANKRD27	37788607	1.000000	0.71417	0.784000	0.31847	0.024000	0.10985	6.296000	0.72751	2.809000	0.96659	0.650000	0.86243	CAC	.	.		0.587	ANKRD27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450329.1	NM_032139	
KMT2B	9757	hgsc.bcm.edu	37	19	36222992	36222992	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr19:36222992G>T	ENST00000222270.7	+	27	5621	c.5621G>T	c.(5620-5622)cGg>cTg	p.R1874L	KMT2B_ENST00000607650.1_RNA|KMT2B_ENST00000420124.1_Missense_Mutation_p.R1874L	NM_014727.1	NP_055542.1	Q9UMN6	KMT2B_HUMAN	lysine (K)-specific methyltransferase 2B	1874					chromatin-mediated maintenance of transcription (GO:0048096)|gene silencing (GO:0016458)|histone H3-K4 methylation (GO:0051568)|histone H3-K4 trimethylation (GO:0080182)|oocyte differentiation (GO:0009994)|ovarian follicle development (GO:0001541)|ovulation (GO:0030728)|regulation of histone H3-K4 methylation (GO:0051569)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)										TCGCCATCCCGGAGGCCCTTG	0.687																																					p.R1874L		Atlas-SNP	.											.	MLL4	229	.	0			c.G5621T						.						12.0	14.0	13.0					19																	36222992		1865	4087	5952	SO:0001583	missense	8085	exon27			CATCCCGGAGGCC	AJ007041	CCDS46055.1	19q13.1	2014-02-18			ENSG00000105663	ENSG00000272333		"""Chromatin-modifying enzymes / K-methyltransferases"""	15840	protein-coding gene	gene with protein product	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila) 4"""	606834				10409430, 10637508	Standard	XM_006723513		Approved	KIAA0304, MLL2, TRX2, HRX2, WBP7, MLL1B, MLL4		Q9UMN6	OTTHUMG00000048119	ENST00000222270.7:c.5621G>T	chr19.hg19:g.36222992G>T	ENSP00000222270:p.Arg1874Leu	71.0	0.0		218.0	50.0	NM_014727	O15022|O95836|Q96GP2|Q96IP3|Q9UK25|Q9Y668|Q9Y669	Missense_Mutation	SNP	ENST00000222270.7	hg19	CCDS46055.1	.	.	.	.	.	.	.	.	.	.	G	4.654	0.121565	0.08881	.	.	ENSG00000105663	ENST00000222270;ENST00000420124	D;D	0.86562	-2.14;-2.14	5.33	4.29	0.51040	.	0.000000	0.40554	N	0.001069	D	0.83695	0.5310	M	0.63843	1.955	0.51012	D	0.999906	P	0.37122	0.583	B	0.29353	0.101	D	0.84772	0.0768	10	0.66056	D	0.02	.	14.5411	0.67995	0.0:0.0:0.8519:0.1481	.	1874	Q9UMN6	MLL4_HUMAN	L	1874	ENSP00000222270:R1874L;ENSP00000398837:R1874L	ENSP00000222270:R1874L	R	+	2	0	AD000671.1	40914832	1.000000	0.71417	1.000000	0.80357	0.036000	0.12997	5.498000	0.66931	1.366000	0.46076	-0.181000	0.13052	CGG	.	.		0.687	KMT2B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_014727	
MAP4K1	11184	hgsc.bcm.edu	37	19	39105049	39105049	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr19:39105049A>G	ENST00000591517.1	-	5	378	c.350T>C	c.(349-351)gTc>gCc	p.V117A	MAP4K1_ENST00000589002.1_5'Flank|MAP4K1_ENST00000586296.1_Missense_Mutation_p.V117A|MAP4K1_ENST00000423454.2_5'Flank|MAP4K1_ENST00000396857.2_Missense_Mutation_p.V117A|MAP4K1_ENST00000589130.1_Missense_Mutation_p.V113A	NM_007181.4	NP_009112.1	Q92918	M4K1_HUMAN	mitogen-activated protein kinase kinase kinase kinase 1	117	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of JUN kinase activity (GO:0007257)|activation of MAPKKK activity (GO:0000185)|cell proliferation (GO:0008283)|intracellular signal transduction (GO:0035556)|peptidyl-serine phosphorylation (GO:0018105)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|response to stress (GO:0006950)	membrane (GO:0016020)	ATP binding (GO:0005524)|MAP kinase kinase kinase kinase activity (GO:0008349)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|small GTPase regulator activity (GO:0005083)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(3)|lung(24)|ovary(1)|prostate(1)|skin(5)|stomach(1)|urinary_tract(1)	44	all_cancers(60;6.42e-06)|Ovarian(47;0.103)		Lung(45;0.000751)|LUSC - Lung squamous cell carcinoma(53;0.00272)			TTCCCGGCAGACATAGCTAAT	0.632																																					p.V117A		Atlas-SNP	.											.	MAP4K1	165	.	0			c.T350C						.						98.0	104.0	102.0					19																	39105049		1926	4141	6067	SO:0001583	missense	11184	exon5			CGGCAGACATAGC	U66464	CCDS42564.1, CCDS59385.1	19q13.1-q13.4	2011-06-09				ENSG00000104814	2.7.11.1	"""Mitogen-activated protein kinase cascade / Kinase kinase kinase kinases"""	6863	protein-coding gene	gene with protein product	"""hematopoietic progenitor kinase 1"""	601983				8824585	Standard	NM_001042600		Approved	HPK1	uc002oix.1	Q92918		ENST00000591517.1:c.350T>C	chr19.hg19:g.39105049A>G	ENSP00000465039:p.Val117Ala	63.0	0.0		206.0	23.0	NM_007181		Missense_Mutation	SNP	ENST00000591517.1	hg19	CCDS59385.1	.	.	.	.	.	.	.	.	.	.	A	16.75	3.208738	0.58343	.	.	ENSG00000104814	ENST00000396857;ENST00000221409	T	0.25912	1.77	4.87	4.87	0.63330	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.140996	0.47455	D	0.000239	T	0.33614	0.0869	L	0.60067	1.865	0.80722	D	1	P;P	0.43857	0.571;0.819	B;P	0.45913	0.229;0.497	T	0.17018	-1.0383	10	0.87932	D	0	.	13.7588	0.62952	1.0:0.0:0.0:0.0	.	117;117	Q92918-2;Q92918	.;M4K1_HUMAN	A	117	ENSP00000380066:V117A	ENSP00000221409:V117A	V	-	2	0	MAP4K1	43796889	0.992000	0.36948	1.000000	0.80357	0.950000	0.60333	5.549000	0.67261	1.958000	0.56883	0.368000	0.22195	GTC	.	.		0.632	MAP4K1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000453390.1	NM_001042600	
ATP1A3	478	hgsc.bcm.edu	37	19	42492257	42492257	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr19:42492257G>T	ENST00000302102.5	-	4	338	c.188C>A	c.(187-189)gCc>gAc	p.A63D	ATP1A3_ENST00000545399.1_Missense_Mutation_p.A76D|ATP1A3_ENST00000543770.1_Missense_Mutation_p.A74D|ATP1A3_ENST00000602133.1_Missense_Mutation_p.A33D|ATP1A3_ENST00000468774.2_5'UTR	NM_152296.4	NP_689509.1	P13637	AT1A3_HUMAN	ATPase, Na+/K+ transporting, alpha 3 polypeptide	63					adult locomotory behavior (GO:0008344)|ATP biosynthetic process (GO:0006754)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular potassium ion homeostasis (GO:0030007)|cellular response to steroid hormone stimulus (GO:0071383)|cellular sodium ion homeostasis (GO:0006883)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|memory (GO:0007613)|potassium ion import (GO:0010107)|response to drug (GO:0042493)|sodium ion export from cell (GO:0036376)|transmembrane transport (GO:0055085)|visual learning (GO:0008542)	axon (GO:0030424)|dendritic spine head (GO:0044327)|dendritic spine neck (GO:0044326)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|myelin sheath (GO:0043209)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sodium:potassium-exchanging ATPase complex (GO:0005890)|synapse (GO:0045202)|vesicle (GO:0031982)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|metal ion binding (GO:0046872)|sodium:potassium-exchanging ATPase activity (GO:0005391)|steroid hormone binding (GO:1990239)			NS(1)|breast(2)|endometrium(7)|kidney(2)|large_intestine(11)|liver(1)|lung(19)|ovary(1)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	52						CCCATCCCGGGCCAGGATCTC	0.632																																					p.A76D		Atlas-SNP	.											.	ATP1A3	117	.	0			c.C227A						.						92.0	96.0	95.0					19																	42492257		2203	4300	6503	SO:0001583	missense	478	exon4			TCCCGGGCCAGGA		CCDS12594.1, CCDS58663.1, CCDS58664.1	19q13.2	2012-10-22			ENSG00000105409	ENSG00000105409	3.6.3.9	"""ATPases / P-type"""	801	protein-coding gene	gene with protein product	"""sodium/potassium-transporting ATPase subunit alpha-3"", ""sodium pump subunit alpha-3"", ""sodium-potassium ATPase catalytic subunit alpha-3"""	182350	"""dystonia 12"""	DYT12		17282997	Standard	NM_152296		Approved		uc002osh.4	P13637	OTTHUMG00000137384	ENST00000302102.5:c.188C>A	chr19.hg19:g.42492257G>T	ENSP00000302397:p.Ala63Asp	96.0	0.0		63.0	49.0	NM_001256214	B7Z2T0|B7Z401|F5H6J6|Q16732|Q16735|Q969K5	Missense_Mutation	SNP	ENST00000302102.5	hg19	CCDS12594.1	.	.	.	.	.	.	.	.	.	.	G	8.773	0.926333	0.18056	.	.	ENSG00000105409	ENST00000302102;ENST00000441343;ENST00000545399;ENST00000368080;ENST00000543770;ENST00000448429	T;T;T;T	0.79940	-1.32;-1.32;-1.32;-1.32	4.09	3.02	0.34903	ATPase, P-type cation-transporter, N-terminal (2);	0.057698	0.64402	D	0.000002	T	0.74711	0.3752	L	0.56396	1.775	0.47547	D	0.999451	B;B;B;B	0.06786	0.001;0.0;0.001;0.0	B;B;B;B	0.13407	0.003;0.001;0.009;0.002	T	0.67530	-0.5647	10	0.24483	T	0.36	.	11.67	0.51395	0.0:0.1816:0.8184:0.0	.	76;74;63;63	B7Z2T0;F5H6J6;E9PC51;P13637	.;.;.;AT1A3_HUMAN	D	63;63;76;33;74;76	ENSP00000302397:A63D;ENSP00000411503:A63D;ENSP00000444688:A76D;ENSP00000437577:A74D	ENSP00000302397:A63D	A	-	2	0	ATP1A3	47184097	1.000000	0.71417	1.000000	0.80357	0.302000	0.27658	3.247000	0.51422	0.822000	0.34565	-0.479000	0.04858	GCC	.	.		0.632	ATP1A3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000268107.1	NM_152296	
HIF3A	64344	hgsc.bcm.edu	37	19	46825090	46825090	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr19:46825090C>A	ENST00000377670.4	+	10	1233	c.1202C>A	c.(1201-1203)gCc>gAc	p.A401D	HIF3A_ENST00000339613.2_Missense_Mutation_p.A345D|AC007193.10_ENST00000596807.1_RNA|HIF3A_ENST00000472815.1_Missense_Mutation_p.A332D|HIF3A_ENST00000420102.2_Missense_Mutation_p.A350D|HIF3A_ENST00000244303.6_Missense_Mutation_p.A332D|HIF3A_ENST00000600383.1_Missense_Mutation_p.A332D|HIF3A_ENST00000300862.3_Missense_Mutation_p.A399D	NM_152795.3	NP_690008.2	Q9Y2N7	HIF3A_HUMAN	hypoxia inducible factor 3, alpha subunit	401					cellular response to hypoxia (GO:0071456)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|transcription from RNA polymerase II promoter (GO:0006366)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(7)|lung(14)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)	33		Ovarian(192;0.00965)|all_neural(266;0.0887)		OV - Ovarian serous cystadenocarcinoma(262;0.00204)|all cancers(93;0.0107)|GBM - Glioblastoma multiforme(486;0.0489)|Epithelial(262;0.136)		AGCGAGGCTGCCCTGGCCGCT	0.687																																					p.A401D		Atlas-SNP	.											.	HIF3A	154	.	0			c.C1202A						.						41.0	49.0	47.0					19																	46825090		2203	4298	6501	SO:0001583	missense	64344	exon10			AGGCTGCCCTGGC	AK027725	CCDS12681.2, CCDS12682.1, CCDS42580.1, CCDS42580.2	19q13	2013-05-21			ENSG00000124440	ENSG00000124440		"""Basic helix-loop-helix proteins"""	15825	protein-coding gene	gene with protein product		609976				11573933, 11734856	Standard	NM_152794		Approved	IPAS, MOP7, PASD7, bHLHe17	uc002peh.3	Q9Y2N7	OTTHUMG00000141296	ENST00000377670.4:c.1202C>A	chr19.hg19:g.46825090C>A	ENSP00000366898:p.Ala401Asp	91.0	0.0		123.0	68.0	NM_152795	B0M185|B4DNA2|Q58A43|Q66K72|Q8WXA1|Q96K34|Q9H7Z9|Q9HAI2	Missense_Mutation	SNP	ENST00000377670.4	hg19	CCDS12681.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	8.441|8.441	0.850781|0.850781	0.17034|0.17034	.|.	.|.	ENSG00000124440|ENSG00000124440	ENST00000244302;ENST00000377670;ENST00000244303;ENST00000339613;ENST00000291300;ENST00000300862;ENST00000420102|ENST00000472815	T;T;T;T;T|.	0.64438|.	0.62;-0.09;0.51;0.62;-0.1|.	4.45|4.45	2.33|2.33	0.28932|0.28932	.|.	1.084810|.	0.07166|.	N|.	0.851496|.	T|.	0.20618|.	0.0496|.	N|N	0.14661|0.14661	0.345|0.345	0.09310|0.09310	N|N	1|1	P;B;B;B;B;B;B|.	0.37276|.	0.589;0.089;0.152;0.089;0.201;0.201;0.089|.	B;B;B;B;B;B;B|.	0.33454|.	0.164;0.055;0.058;0.055;0.039;0.039;0.016|.	T|.	0.23476|.	-1.0187|.	10|.	0.27082|.	T|.	0.32|.	.|.	6.9583|6.9583	0.24583|0.24583	0.0:0.7906:0.0:0.2094|0.0:0.7906:0.0:0.2094	.|.	350;332;399;350;345;401;401|.	F5H884;B4DNA2;Q9Y2N7-2;B4DSD9;A8MPQ1;Q9Y2N7;B0M185|.	.;.;.;.;.;HIF3A_HUMAN;.|.	D|X	401;401;332;345;345;399;350|373	ENSP00000366898:A401D;ENSP00000244303:A332D;ENSP00000341877:A345D;ENSP00000300862:A399D;ENSP00000407771:A350D|.	ENSP00000244302:A401D|.	A|C	+|+	2|3	0|2	HIF3A|HIF3A	51516930|51516930	0.023000|0.023000	0.18921|0.18921	0.355000|0.355000	0.25773|0.25773	0.799000|0.799000	0.45148|0.45148	0.921000|0.921000	0.28718|0.28718	0.634000|0.634000	0.30469|0.30469	-0.140000|-0.140000	0.14226|0.14226	GCC|TGC	.	.		0.687	HIF3A-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000280556.3		
ARHGAP35	2909	hgsc.bcm.edu	37	19	47424838	47424838	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr19:47424838A>T	ENST00000404338.3	+	1	2906	c.2906A>T	c.(2905-2907)aAc>aTc	p.N969I		NM_004491.4	NP_004482.4	Q9NRY4	RHG35_HUMAN	Rho GTPase activating protein 35	969					axon guidance (GO:0007411)|camera-type eye development (GO:0043010)|forebrain development (GO:0030900)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of vascular permeability (GO:0043116)|neural tube closure (GO:0001843)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|transcription, DNA-templated (GO:0006351)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|nucleus (GO:0005634)	DNA binding (GO:0003677)|GTP binding (GO:0005525)|Rho GTPase activator activity (GO:0005100)|transcription corepressor activity (GO:0003714)										GAGGTGTTTAACTCCCCCCGG	0.473																																					p.N969I		Atlas-SNP	.											.	.	.	.	0			c.A2906T						.						55.0	55.0	55.0					19																	47424838		1926	4130	6056	SO:0001583	missense	2909	exon1			TGTTTAACTCCCC	M73077	CCDS46127.1	19q13.32	2011-06-29	2011-06-07	2011-06-07	ENSG00000160007	ENSG00000160007		"""Rho GTPase activating proteins"""	4591	protein-coding gene	gene with protein product		605277	"""glucocorticoid receptor DNA binding factor 1"""	GRLF1		1894621, 20675588	Standard	NM_004491		Approved	GRF-1, p190ARhoGAP, P190A, KIAA1722, p190RhoGAP	uc010ekv.3	Q9NRY4		ENST00000404338.3:c.2906A>T	chr19.hg19:g.47424838A>T	ENSP00000385720:p.Asn969Ile	111.0	0.0		130.0	68.0	NM_004491	A7E2A4|Q14452|Q9C0E1	Missense_Mutation	SNP	ENST00000404338.3	hg19	CCDS46127.1	.	.	.	.	.	.	.	.	.	.	A	10.99	1.506344	0.26949	.	.	ENSG00000160007	ENST00000317082;ENST00000404338	T	0.07216	3.21	5.86	3.79	0.43588	.	0.300009	0.33272	N	0.005086	T	0.03959	0.0111	N	0.08118	0	0.32820	D	0.50265	P	0.36465	0.554	B	0.31869	0.137	T	0.19745	-1.0296	10	0.72032	D	0.01	-39.5541	7.3702	0.26798	0.7635:0.0:0.2365:0.0	.	969	Q9NRY4-2	.	I	969	ENSP00000385720:N969I	ENSP00000324820:N969I	N	+	2	0	ARHGAP35	52116678	0.621000	0.27077	0.992000	0.48379	0.975000	0.68041	1.285000	0.33261	1.058000	0.40530	0.533000	0.62120	AAC	.	.		0.473	ARHGAP35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466652.1	NM_004491	
FAM83E	54854	hgsc.bcm.edu	37	19	49104612	49104613	+	Missense_Mutation	DNP	CC	CC	AA			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr19:49104612_49104613CC>AA	ENST00000263266.3	-	5	1379_1380	c.1190_1191GG>TT	c.(1189-1191)tGG>tTT	p.W397F		NM_017708.3	NP_060178.2	Q2M2I3	FA83E_HUMAN	family with sequence similarity 83, member E	397										NS(1)|endometrium(2)|large_intestine(1)|lung(3)|ovary(1)|urinary_tract(2)	10		all_epithelial(76;2.38e-06)|all_lung(116;4.89e-06)|Lung NSC(112;9.34e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.000102)|all cancers(93;0.000117)|GBM - Glioblastoma multiforme(486;0.00627)|Epithelial(262;0.0158)		CCTTGGAGCCCCAGGATTTCTT	0.673																																					p.W397C|p.W397L		Atlas-SNP	.											FAM83E,NS,carcinoma,0,1|.	FAM83E	34	.	0			c.G1191T|c.G1190T						.																																			SO:0001583	missense	54854	exon5			GGAGCCCCAGGAT|GAGCCCCAGGATT	AK000207	CCDS42587.1	19q13.33	2013-10-24			ENSG00000105523	ENSG00000105523			25972	protein-coding gene	gene with protein product							Standard	NM_017708		Approved	FLJ20200	uc002pjn.2	Q2M2I3	OTTHUMG00000183315	ENST00000263266.3:c.1190_1191delinsAA	chr19.hg19:g.49104612_49104613delinsAA	ENSP00000263266:p.Trp397Phe	146.0|147.0	0.0		175.0|176.0	38.0	NM_017708	Q9NXK1	Missense_Mutation	SNP	ENST00000263266.3	hg19	CCDS42587.1																																																																																			.	.		0.673	FAM83E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466145.1	NM_017708	
ZNF28	7576	hgsc.bcm.edu	37	19	53302982	53302982	+	Missense_Mutation	SNP	G	G	C			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr19:53302982G>C	ENST00000457749.2	-	4	2235	c.2116C>G	c.(2116-2118)Ctt>Gtt	p.L706V	ZNF28_ENST00000414252.2_Missense_Mutation_p.L653V|ZNF28_ENST00000438150.2_Missense_Mutation_p.L653V|ZNF28_ENST00000360272.4_Missense_Mutation_p.L653V	NM_006969.3	NP_008900.3	P17035	ZNF28_HUMAN	zinc finger protein 28	706					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|liver(1)|lung(10)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	34				GBM - Glioblastoma multiforme(134;0.0386)|Lung(386;0.145)		TGGTATACAAGGTTTGACATC	0.413																																					p.L706V		Atlas-SNP	.											.	ZNF28	191	.	0			c.C2116G						.						111.0	105.0	107.0					19																	53302982		2203	4298	6501	SO:0001583	missense	7576	exon4			ATACAAGGTTTGA	X52355	CCDS33093.1, CCDS33093.2	19q13.41	2013-01-08	2006-05-10		ENSG00000198538	ENSG00000198538		"""Zinc fingers, C2H2-type"", ""-"""	13073	protein-coding gene	gene with protein product			"""zinc finger protein 28 (KOX 24)"""				Standard	NR_036599		Approved	KOX24, DKFZp781D0275	uc002qad.3	P17035	OTTHUMG00000154564	ENST00000457749.2:c.2116C>G	chr19.hg19:g.53302982G>C	ENSP00000397693:p.Leu706Val	73.0	0.0		71.0	41.0	NM_006969	A8KAK9|B4E3G0|B9EIK7|Q5H9V1|Q5HYM9|Q6ZML9|Q6ZN56	Missense_Mutation	SNP	ENST00000457749.2	hg19	CCDS33093.2	.	.	.	.	.	.	.	.	.	.	-	7.267	0.606462	0.14002	.	.	ENSG00000198538	ENST00000438150;ENST00000457749;ENST00000360272;ENST00000414252	T;T;T;T	0.12255	2.7;2.7;2.7;2.7	1.65	0.473	0.16763	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.23094	0.0558	M	0.85299	2.745	0.09310	N	1	P	0.38223	0.623	B	0.41666	0.363	T	0.12811	-1.0533	9	0.87932	D	0	.	8.8067	0.34943	0.0:0.2347:0.7653:0.0	.	706	P17035	ZNF28_HUMAN	V	653;706;653;653	ENSP00000412143:L653V;ENSP00000397693:L706V;ENSP00000353410:L653V;ENSP00000444965:L653V	ENSP00000353410:L653V	L	-	1	0	ZNF28	57994794	0.381000	0.25140	0.001000	0.08648	0.001000	0.01503	0.308000	0.19314	0.041000	0.15688	-0.989000	0.02550	CTT	.	.		0.413	ZNF28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336038.2	NM_006969	
ZNF677	342926	hgsc.bcm.edu	37	19	53740851	53740851	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr19:53740851A>G	ENST00000598513.1	-	5	1279	c.1129T>C	c.(1129-1131)Tgt>Cgt	p.C377R	ZNF677_ENST00000333952.4_Missense_Mutation_p.C377R	NM_182609.2	NP_872415.1	Q86XU0	ZN677_HUMAN	zinc finger protein 677	377					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(13)|lung(6)|ovary(1)|pancreas(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	36				GBM - Glioblastoma multiforme(134;0.00352)		CATTCATTACATTTGTAAGGT	0.393																																					p.C377R		Atlas-SNP	.											.	ZNF677	94	.	0			c.T1129C						.						92.0	85.0	87.0					19																	53740851		2203	4300	6503	SO:0001583	missense	342926	exon5			CATTACATTTGTA	BC050038	CCDS12861.1	19q13.42	2013-01-08				ENSG00000197928		"""Zinc fingers, C2H2-type"", ""-"""	28730	protein-coding gene	gene with protein product	"""hypothetical protein MGC48625"""					12477932	Standard	NM_182609		Approved	MGC48625	uc002qbg.1	Q86XU0		ENST00000598513.1:c.1129T>C	chr19.hg19:g.53740851A>G	ENSP00000469391:p.Cys377Arg	122.0	0.0		118.0	25.0	NM_182609		Missense_Mutation	SNP	ENST00000598513.1	hg19	CCDS12861.1	.	.	.	.	.	.	.	.	.	.	A	16.58	3.162684	0.57368	.	.	ENSG00000197928	ENST00000333952	D	0.85258	-1.96	2.14	2.14	0.27477	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.38111	N	0.001810	D	0.94308	0.8171	H	0.98594	4.275	0.54753	D	0.999981	D	0.89917	1.0	D	0.97110	1.0	D	0.93465	0.6814	10	0.87932	D	0	.	8.2235	0.31556	1.0:0.0:0.0:0.0	.	377	Q86XU0	ZN677_HUMAN	R	377	ENSP00000334394:C377R	ENSP00000334394:C377R	C	-	1	0	ZNF677	58432663	1.000000	0.71417	0.977000	0.42913	0.976000	0.68499	7.473000	0.81007	1.249000	0.43950	0.496000	0.49642	TGT	.	.		0.393	ZNF677-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464189.1	NM_182609	
ZNF71	58491	hgsc.bcm.edu	37	19	57133835	57133835	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr19:57133835C>A	ENST00000328070.6	+	3	1414	c.1180C>A	c.(1180-1182)Cgc>Agc	p.R394S		NM_021216.4	NP_067039.1	Q9NQZ8	ZNF71_HUMAN	zinc finger protein 71	394					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R394S(1)		endometrium(3)|large_intestine(5)|lung(13)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	26				GBM - Glioblastoma multiforme(193;0.062)|Lung(386;0.0681)|LUSC - Lung squamous cell carcinoma(496;0.18)		CTTCACGGGGCGCTCGTCCCT	0.627																																					p.R394S		Atlas-SNP	.											ZNF71,NS,carcinoma,0,1	ZNF71	69	.	1	Substitution - Missense(1)	prostate(1)	c.C1180A						.						88.0	70.0	76.0					19																	57133835		2203	4300	6503	SO:0001583	missense	58491	exon3			ACGGGGCGCTCGT	X60074	CCDS12947.1	19q13.4	2013-01-08	2006-05-12			ENSG00000197951		"""Zinc fingers, C2H2-type"""	13141	protein-coding gene	gene with protein product		194545	"""zinc finger protein 71 (Cos26)"""			1639391	Standard	NM_021216		Approved	Cos26, EZFIT	uc002qnm.4	Q9NQZ8		ENST00000328070.6:c.1180C>A	chr19.hg19:g.57133835C>A	ENSP00000328245:p.Arg394Ser	56.0	0.0		55.0	28.0	NM_021216	Q15919|Q9UC09|Q9UQD3	Missense_Mutation	SNP	ENST00000328070.6	hg19	CCDS12947.1	.	.	.	.	.	.	.	.	.	.	C	2.611	-0.290711	0.05568	.	.	ENSG00000197951	ENST00000328070	T	0.08102	3.13	3.58	2.45	0.29901	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.02119	0.0066	N	0.01209	-0.955	0.09310	N	1	B	0.29301	0.241	B	0.20184	0.028	T	0.34453	-0.9828	9	0.02654	T	1	.	8.5263	0.33307	0.3659:0.6341:0.0:0.0	.	394	Q9NQZ8	ZNF71_HUMAN	S	394	ENSP00000328245:R394S	ENSP00000328245:R394S	R	+	1	0	ZNF71	61825647	0.000000	0.05858	0.994000	0.49952	0.995000	0.86356	-0.497000	0.06428	1.815000	0.52974	0.561000	0.74099	CGC	.	.		0.627	ZNF71-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459798.2	NM_021216	
NCOA6	23054	hgsc.bcm.edu	37	20	33329288	33329288	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr20:33329288G>A	ENST00000374796.2	-	12	7342	c.4772C>T	c.(4771-4773)cCc>cTc	p.P1591L	NCOA6_ENST00000359003.2_Missense_Mutation_p.P1591L			Q14686	NCOA6_HUMAN	nuclear receptor coactivator 6	1591					brain development (GO:0007420)|cellular lipid metabolic process (GO:0044255)|cellular response to DNA damage stimulus (GO:0006974)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA-templated transcription, initiation (GO:0006352)|glucocorticoid receptor signaling pathway (GO:0042921)|heart development (GO:0007507)|intracellular estrogen receptor signaling pathway (GO:0030520)|labyrinthine layer blood vessel development (GO:0060716)|myeloid cell differentiation (GO:0030099)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|response to hormone (GO:0009725)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)	histone methyltransferase complex (GO:0035097)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|retinoid X receptor binding (GO:0046965)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)			NS(2)|breast(6)|central_nervous_system(3)|cervix(1)|endometrium(9)|kidney(8)|large_intestine(16)|lung(37)|ovary(4)|prostate(5)|skin(13)|upper_aerodigestive_tract(2)|urinary_tract(1)	107						TGGGGGCAAGGGAGTGGAAAT	0.468																																					p.P1591L		Atlas-SNP	.											NCOA6,NS,haematopoietic_neoplasm,0,3	NCOA6	219	.	0			c.C4772T						.						130.0	117.0	122.0					20																	33329288		2203	4300	6503	SO:0001583	missense	23054	exon11			GGCAAGGGAGTGG	AF128458	CCDS13241.1, CCDS74720.1	20q11	2008-08-01			ENSG00000198646	ENSG00000198646			15936	protein-coding gene	gene with protein product	"""nuclear receptor coactivator RAP250"", ""activating signal cointegrator-2"", ""peroxisome proliferator-activated receptor interacting protein"""	605299				8724849, 8263591	Standard	NM_014071		Approved	KIAA0181, RAP250, ASC2, AIB3, PRIP, TRBP, NRC	uc002xaw.3	Q14686	OTTHUMG00000032311	ENST00000374796.2:c.4772C>T	chr20.hg19:g.33329288G>A	ENSP00000363929:p.Pro1591Leu	71.0	0.0		130.0	54.0	NM_014071	A6NLF1|B2RMN5|E1P5P7|Q9NTZ9|Q9UH74|Q9UK86	Missense_Mutation	SNP	ENST00000374796.2	hg19	CCDS13241.1	.	.	.	.	.	.	.	.	.	.	G	18.03	3.532212	0.64972	.	.	ENSG00000198646	ENST00000374796;ENST00000359003	T;T	0.25579	1.79;1.79	5.55	5.55	0.83447	.	0.077816	0.56097	D	0.000034	T	0.21590	0.0520	N	0.24115	0.695	0.80722	D	1	P	0.43094	0.799	B	0.38378	0.272	T	0.02391	-1.1166	10	0.62326	D	0.03	-7.102	19.7069	0.96076	0.0:0.0:1.0:0.0	.	1591	Q14686	NCOA6_HUMAN	L	1591	ENSP00000363929:P1591L;ENSP00000351894:P1591L	ENSP00000351894:P1591L	P	-	2	0	NCOA6	32792949	1.000000	0.71417	0.982000	0.44146	0.910000	0.53928	8.686000	0.91250	2.894000	0.99253	0.591000	0.81541	CCC	.	.		0.468	NCOA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078811.2	NM_014071	
GDF5	8200	hgsc.bcm.edu	37	20	34025505	34025505	+	Silent	SNP	C	C	G			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr20:34025505C>G	ENST00000374372.1	-	3	707	c.204G>C	c.(202-204)ggG>ggC	p.G68G	GDF5_ENST00000374369.3_Silent_p.G68G			P43026	GDF5_HUMAN	growth differentiation factor 5	68					cell-cell signaling (GO:0007267)|chondrocyte differentiation (GO:0002062)|embryonic limb morphogenesis (GO:0030326)|extracellular matrix organization (GO:0030198)|forelimb morphogenesis (GO:0035136)|growth (GO:0040007)|hindlimb morphogenesis (GO:0035137)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of mesenchymal cell apoptotic process (GO:2001054)|negative regulation of neuron apoptotic process (GO:0043524)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of neuron differentiation (GO:0045666)|regulation of multicellular organism growth (GO:0040014)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)	growth factor activity (GO:0008083)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(3)|lung(9)|skin(3)	26	Lung NSC(9;0.00642)|all_lung(11;0.0094)		BRCA - Breast invasive adenocarcinoma(18;0.00663)			CATTGGTGGCCCCCCCACCAT	0.662																																					p.G68G		Atlas-SNP	.											.	GDF5	66	.	0			c.G204C						.						29.0	28.0	28.0					20																	34025505		2203	4300	6503	SO:0001819	synonymous_variant	8200	exon1			GGTGGCCCCCCCA	X80915	CCDS13254.1	20q11.2	2008-05-22	2007-04-12		ENSG00000125965	ENSG00000125965			4220	protein-coding gene	gene with protein product	"""cartilage-derived morphogenetic protein-1"""	601146				9288091, 9288098	Standard	NM_000557		Approved	CDMP1, BMP14	uc002xck.1	P43026	OTTHUMG00000032341	ENST00000374372.1:c.204G>C	chr20.hg19:g.34025505C>G		60.0	0.0		89.0	38.0	NM_000557	E1P5Q2|Q96SB1	Silent	SNP	ENST00000374372.1	hg19	CCDS13254.1																																																																																			.	.		0.662	GDF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078875.2		
ZNF831	128611	hgsc.bcm.edu	37	20	57768554	57768554	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr20:57768554T>C	ENST00000371030.2	+	1	2480	c.2480T>C	c.(2479-2481)gTg>gCg	p.V827A		NM_178457.1	NP_848552.1	Q5JPB2	ZN831_HUMAN	zinc finger protein 831	827							metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(15)|lung(71)|ovary(2)|pancreas(1)|prostate(4)|skin(16)|upper_aerodigestive_tract(2)|urinary_tract(3)	125	all_lung(29;0.0085)					AAGCTGAAAGTGGAGGACCTG	0.622																																					p.V827A		Atlas-SNP	.											.	ZNF831	287	.	0			c.T2480C						.						33.0	41.0	39.0					20																	57768554		2039	4193	6232	SO:0001583	missense	128611	exon1			TGAAAGTGGAGGA	AL121919	CCDS42894.1	20q13.32	2008-10-20	2008-03-25	2008-03-25	ENSG00000124203	ENSG00000124203			16167	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 174"""	C20orf174			Standard	NM_178457		Approved	dJ492J12.1	uc002yan.3	Q5JPB2	OTTHUMG00000032864	ENST00000371030.2:c.2480T>C	chr20.hg19:g.57768554T>C	ENSP00000360069:p.Val827Ala	81.0	0.0		140.0	62.0	NM_178457	Q5TDR4|Q8TCP0	Missense_Mutation	SNP	ENST00000371030.2	hg19	CCDS42894.1	.	.	.	.	.	.	.	.	.	.	T	13.34	2.208871	0.39003	.	.	ENSG00000124203	ENST00000371030	T	0.13538	2.58	4.92	3.82	0.43975	.	0.389415	0.21720	N	0.070134	T	0.14570	0.0352	L	0.36672	1.1	0.19300	N	0.999977	P	0.51791	0.948	P	0.47786	0.557	T	0.06661	-1.0814	10	0.66056	D	0.02	-11.5444	8.2457	0.31686	0.0:0.0909:0.0:0.9091	.	827	Q5JPB2	ZN831_HUMAN	A	827	ENSP00000360069:V827A	ENSP00000360069:V827A	V	+	2	0	ZNF831	57201949	0.984000	0.35163	0.952000	0.39060	0.150000	0.21749	1.615000	0.36922	0.737000	0.32582	0.368000	0.22195	GTG	.	.		0.622	ZNF831-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000079916.2	NM_178457	
EVA1C	59271	hgsc.bcm.edu	37	21	33829933	33829933	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr21:33829933G>A	ENST00000300255.2	+	3	859	c.386G>A	c.(385-387)cGg>cAg	p.R129Q	EVA1C_ENST00000382699.3_Missense_Mutation_p.R129Q|EVA1C_ENST00000401402.3_Missense_Mutation_p.R129Q	NM_058187.3	NP_478067.2	P58658	EVA1C_HUMAN	eva-1 homolog C (C. elegans)	129	SUEL-type lectin 1. {ECO:0000255|PROSITE- ProRule:PRU00260}.					integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)										CAGAACCAGCGGGCCTGCCAC	0.527																																					p.R129Q		Atlas-SNP	.											.	.	.	.	0			c.G386A						.						110.0	94.0	100.0					21																	33829933		2203	4300	6503	SO:0001583	missense	59271	exon3			ACCAGCGGGCCTG	AF358258	CCDS13614.1, CCDS68186.1	21q22.11	2012-11-05	2012-11-05	2012-11-05	ENSG00000166979	ENSG00000166979			13239	protein-coding gene	gene with protein product			"""chromosome 21 open reading frame 64"", ""chromosome 21 open reading frame 63"", ""family with sequence similarity 176, member C"""	C21orf64, C21orf63, FAM176C		11707072, 19470522	Standard	NM_058187		Approved	B18, PRED34, B19	uc002ypr.1	P58658	OTTHUMG00000064922	ENST00000300255.2:c.386G>A	chr21.hg19:g.33829933G>A	ENSP00000300255:p.Arg129Gln	205.0	0.0		160.0	28.0	NM_058187	A6ND58|Q8IXZ0	Missense_Mutation	SNP	ENST00000300255.2	hg19	CCDS13614.1	.	.	.	.	.	.	.	.	.	.	G	26.2	4.712689	0.89112	.	.	ENSG00000166979	ENST00000300255;ENST00000401402;ENST00000382699;ENST00000412833	T;T;T;T	0.16073	2.37;2.37;2.37;2.37	5.07	5.07	0.68467	D-galactoside/L-rhamnose binding SUEL lectin domain (2);	0.000000	0.85682	D	0.000000	T	0.29556	0.0737	N	0.21324	0.655	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;1.0;1.0	T	0.05273	-1.0895	10	0.34782	T	0.22	-15.943	18.4733	0.90782	0.0:0.0:1.0:0.0	.	129;129;129	A6ND58;P58658;B5MC74	.;CU063_HUMAN;.	Q	129;129;129;34	ENSP00000300255:R129Q;ENSP00000384594:R129Q;ENSP00000372146:R129Q;ENSP00000389269:R34Q	ENSP00000300255:R129Q	R	+	2	0	C21orf63	32751804	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.446000	0.97590	2.349000	0.79799	0.462000	0.41574	CGG	.	.		0.527	EVA1C-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000139403.1	NM_058187	
DSCAM	1826	hgsc.bcm.edu	37	21	42064797	42064797	+	Silent	SNP	G	G	A			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr21:42064797G>A	ENST00000400454.1	-	3	924	c.447C>T	c.(445-447)tcC>tcT	p.S149S		NM_001271534.1|NM_001389.3	NP_001258463.1|NP_001380.2	O60469	DSCAM_HUMAN	Down syndrome cell adhesion molecule	149	Ig-like C2-type 2.				cell adhesion (GO:0007155)|dendrite morphogenesis (GO:0048813)|dendrite self-avoidance (GO:0070593)|locomotory behavior (GO:0007626)|negative regulation of cell adhesion (GO:0007162)|nervous system development (GO:0007399)|positive regulation of axon extension involved in axon guidance (GO:0048842)|positive regulation of phosphorylation (GO:0042327)|post-embryonic retina morphogenesis in camera-type eye (GO:0060060)	axon (GO:0030424)|extracellular region (GO:0005576)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)				NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(22)|lung(47)|ovary(7)|pancreas(2)|prostate(3)|skin(14)|upper_aerodigestive_tract(6)|urinary_tract(4)	142		all_cancers(19;0.186)|Prostate(19;1.15e-05)|all_epithelial(19;0.0103)				CCTCCACCGAGGAGGGGATAA	0.532																																					p.S149S	Melanoma(134;970 1778 1785 21664 32388)	Atlas-SNP	.											.	DSCAM	347	.	0			c.C447T						.						138.0	134.0	136.0					21																	42064797		2018	4173	6191	SO:0001819	synonymous_variant	1826	exon3			CACCGAGGAGGGG	AF023449	CCDS42929.1	21q22.2-q22.3	2013-02-11			ENSG00000171587	ENSG00000171587		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	3039	protein-coding gene	gene with protein product		602523				9426258	Standard	NM_001271534		Approved	CHD2-42, CHD2-52	uc002yyq.1	O60469	OTTHUMG00000086732	ENST00000400454.1:c.447C>T	chr21.hg19:g.42064797G>A		104.0	0.0		64.0	19.0	NM_001271534	O60468	Silent	SNP	ENST00000400454.1	hg19	CCDS42929.1																																																																																			.	.		0.532	DSCAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195029.1	NM_001389	
TRPM2	7226	hgsc.bcm.edu	37	21	45820191	45820191	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr21:45820191T>A	ENST00000397928.1	+	15	2703	c.2258T>A	c.(2257-2259)cTg>cAg	p.L753Q	TRPM2_ENST00000397932.2_Missense_Mutation_p.L753Q|TRPM2_ENST00000300481.9_Missense_Mutation_p.L733Q|TRPM2_ENST00000300482.5_Missense_Mutation_p.L753Q|TRPM2_ENST00000498430.1_3'UTR	NM_003307.3	NP_003298	O94759	TRPM2_HUMAN	transient receptor potential cation channel, subfamily M, member 2	753					calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|ion transmembrane transport (GO:0034220)|response to hydroperoxide (GO:0033194)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ADP-ribose diphosphatase activity (GO:0047631)|calcium channel activity (GO:0005262)|manganese ion transmembrane transporter activity (GO:0005384)|sodium channel activity (GO:0005272)			breast(3)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(15)|lung(29)|ovary(3)|pancreas(1)|prostate(5)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(1)	76						GACAATGGGCTGTGGCGTGTG	0.677																																					p.L753Q		Atlas-SNP	.											.	TRPM2	196	.	0			c.T2258A						.						121.0	86.0	98.0					21																	45820191		2203	4299	6502	SO:0001583	missense	7226	exon15			ATGGGCTGTGGCG	AB001535	CCDS13710.1	21q22.3	2011-12-14		2002-01-18	ENSG00000142185	ENSG00000142185		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Nudix motif containing"""	12339	protein-coding gene	gene with protein product		603749		TRPC7		9806837, 11385575, 16382100	Standard	NR_038257		Approved	KNP3, LTRPC2, NUDT9L1, NUDT9H, EREG1	uc002zew.1	O94759	OTTHUMG00000040840	ENST00000397928.1:c.2258T>A	chr21.hg19:g.45820191T>A	ENSP00000381023:p.Leu753Gln	53.0	0.0		47.0	16.0	NM_003307	D3DSL6|Q5KTC2|Q6J3P5|Q96KN6|Q96Q93	Missense_Mutation	SNP	ENST00000397928.1	hg19	CCDS13710.1	.	.	.	.	.	.	.	.	.	.	T	9.357	1.066995	0.20067	.	.	ENSG00000142185	ENST00000300482;ENST00000397928;ENST00000300481;ENST00000397932	T;T;T;T	0.71103	-0.54;-0.54;-0.54;-0.54	4.87	2.45	0.29901	.	0.510940	0.18958	N	0.126464	T	0.71367	0.3331	M	0.72894	2.215	0.09310	N	1	D;P;D	0.60160	0.987;0.918;0.977	P;P;P	0.50896	0.653;0.472;0.653	T	0.61969	-0.6953	10	0.46703	T	0.11	-14.3568	5.8132	0.18477	0.1486:0.0837:0.0:0.7678	.	753;539;753	E9PGK7;Q5KTC1;O94759	.;.;TRPM2_HUMAN	Q	753;753;733;753	ENSP00000300482:L753Q;ENSP00000381023:L753Q;ENSP00000300481:L733Q;ENSP00000381026:L753Q	ENSP00000300481:L733Q	L	+	2	0	TRPM2	44644619	0.039000	0.19947	0.096000	0.21009	0.272000	0.26649	1.619000	0.36965	0.217000	0.20800	0.496000	0.49642	CTG	.	.		0.677	TRPM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098086.1	NM_003307	
ZNF74	7625	hgsc.bcm.edu	37	22	20749677	20749677	+	Missense_Mutation	SNP	C	C	G			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr22:20749677C>G	ENST00000400451.2	+	2	603	c.89C>G	c.(88-90)tCg>tGg	p.S30W	ZNF74_ENST00000403682.3_Intron|ZNF74_ENST00000357502.5_Missense_Mutation_p.I35M|ZNF74_ENST00000356671.5_Missense_Mutation_p.S30W|ZNF74_ENST00000405993.1_Missense_Mutation_p.S30W	NM_003426.3	NP_003417.2	Q16587	ZNF74_HUMAN	zinc finger protein 74	30					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	actin cytoskeleton (GO:0015629)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA binding (GO:0003723)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(4)|lung(7)|ovary(1)|skin(1)|urinary_tract(1)	19	Melanoma(16;0.000465)|Ovarian(15;0.0025)|Colorectal(54;0.0221)|all_neural(72;0.219)	Lung SC(17;0.0262)|all_lung(157;0.248)	LUSC - Lung squamous cell carcinoma(15;0.00102)|Lung(15;0.0173)			GAGGATATATCGGGTTGGGGT	0.542																																					p.S30W		Atlas-SNP	.											ZNF74,NS,carcinoma,0,1	ZNF74	54	.	0			c.C89G						.						141.0	147.0	145.0					22																	20749677		1964	4140	6104	SO:0001583	missense	7625	exon2			ATATATCGGGTTG	X71623	CCDS42982.1, CCDS58794.1	22q11.2	2013-01-08	2006-05-12		ENSG00000185252	ENSG00000185252		"""Zinc fingers, C2H2-type"", ""-"""	13144	protein-coding gene	gene with protein product		194548	"""zinc finger protein 74 (Cos52)"""			1639391, 10591208	Standard	NM_003426		Approved	Cos52, Zfp520, ZNF520	uc010gsm.4	Q16587	OTTHUMG00000150687	ENST00000400451.2:c.89C>G	chr22.hg19:g.20749677C>G	ENSP00000383301:p.Ser30Trp	161.0	0.0		138.0	62.0	NM_003426	B5MCE3|B7Z5Y2|Q6IBV2|Q6PJP1|Q9UC04|Q9UF05|Q9UF06|Q9UF07	Missense_Mutation	SNP	ENST00000400451.2	hg19	CCDS42982.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	c|c	9.387|9.387	1.074424|1.074424	0.20227|0.20227	.|.	.|.	ENSG00000185252|ENSG00000185252	ENST00000357502|ENST00000400451;ENST00000356671;ENST00000405993	.|T;T;T	.|0.06068	.|3.41;3.41;3.35	3.8|3.8	0.075|0.075	0.14397|0.14397	.|.	.|1.382960	.|0.05998	.|N	.|0.647249	T|T	0.03263|0.03263	0.0095|0.0095	N|N	0.08118|0.08118	0|0	0.09310|0.09310	N|N	1|1	.|B	.|0.12630	.|0.006	.|B	.|0.06405	.|0.002	T|T	0.44390|0.44390	-0.9331|-0.9331	6|10	0.56958|0.37606	D|T	0.05|0.19	-0.2226|-0.2226	2.9108|2.9108	0.05736|0.05736	0.0:0.2863:0.2435:0.4702|0.0:0.2863:0.2435:0.4702	.|.	.|30	.|Q16587	.|ZNF74_HUMAN	M|W	35|30	.|ENSP00000383301:S30W;ENSP00000349098:S30W;ENSP00000385855:S30W	ENSP00000350101:I35M|ENSP00000349098:S30W	I|S	+|+	3|2	3|0	ZNF74|ZNF74	19079677|19079677	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.010000|0.010000	0.07245|0.07245	0.130000|0.130000	0.15850|0.15850	0.037000|0.037000	0.15575|0.15575	0.591000|0.591000	0.81541|0.81541	ATC|TCG	.	.		0.542	ZNF74-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319648.2	NM_003426	
MYO18B	84700	hgsc.bcm.edu	37	22	26298603	26298603	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr22:26298603C>A	ENST00000407587.2	+	30	5019	c.4850C>A	c.(4849-4851)gCc>gAc	p.A1617D	CTA-125H2.2_ENST00000597548.1_RNA|CTA-125H2.2_ENST00000609889.1_RNA|CTA-125H2.2_ENST00000599792.1_RNA|MYO18B_ENST00000335473.7_Missense_Mutation_p.A1616D|CTA-125H2.2_ENST00000609570.1_RNA|CTA-125H2.2_ENST00000609275.1_RNA|CTA-125H2.2_ENST00000597284.1_RNA|CTA-125H2.2_ENST00000607895.1_RNA|MYO18B_ENST00000536101.1_Missense_Mutation_p.A1616D|CTA-125H2.2_ENST00000609823.1_RNA|CTA-125H2.2_ENST00000594585.1_RNA|CTA-125H2.2_ENST00000608257.1_RNA|CTA-125H2.2_ENST00000600211.1_RNA|CTA-125H2.2_ENST00000453457.3_RNA|MYO18B_ENST00000536204.1_3'UTR|CTA-125H2.2_ENST00000595093.1_RNA|CTA-125H2.2_ENST00000599080.1_RNA|CTA-125H2.2_ENST00000609157.1_RNA|CTA-125H2.2_ENST00000600269.1_RNA|CTA-125H2.2_ENST00000608115.1_RNA			Q8IUG5	MY18B_HUMAN	myosin XVIIIB	1616	Tail.					cytoplasm (GO:0005737)|nucleus (GO:0005634)|unconventional myosin complex (GO:0016461)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(2)|breast(6)|central_nervous_system(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(27)|liver(2)|lung(60)|ovary(7)|prostate(8)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(2)	146						CTGGCCCAGGCCCTAGGTGAG	0.622																																					p.A1616D		Atlas-SNP	.											.	MYO18B	322	.	0			c.C4847A						.						41.0	44.0	43.0					22																	26298603		1981	4162	6143	SO:0001583	missense	84700	exon30			CCCAGGCCCTAGG	AJ310931	CCDS54507.1	22q12.1	2011-09-27			ENSG00000133454	ENSG00000133454		"""Myosins / Myosin superfamily : Class XVIII"""	18150	protein-coding gene	gene with protein product		607295				12209013, 12547197	Standard	NM_032608		Approved	BK125H2.1	uc003abz.1	Q8IUG5	OTTHUMG00000151129	ENST00000407587.2:c.4850C>A	chr22.hg19:g.26298603C>A	ENSP00000386096:p.Ala1617Asp	66.0	0.0		50.0	13.0	NM_032608	B2RWP3|F5GYU7|Q8NDI8|Q8TE65|Q8WWS0|Q96KH2|Q96KR8|Q96KR9	Missense_Mutation	SNP	ENST00000407587.2	hg19		.	.	.	.	.	.	.	.	.	.	C	26.7	4.760173	0.89932	.	.	ENSG00000133454	ENST00000536101;ENST00000335473;ENST00000407587	D;D;D	0.87729	-2.27;-2.27;-2.29	5.3	5.3	0.74995	.	0.000000	0.85682	D	0.000000	D	0.93481	0.7920	M	0.80422	2.495	0.52501	D	0.999956	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.81914	0.993;0.989;0.988;0.995	D	0.94151	0.7405	10	0.72032	D	0.01	.	16.4582	0.84029	0.0:1.0:0.0:0.0	.	1129;1616;1617;1616	Q8IUG5-2;Q8IUG5;F5GXR6;F5GYU7	.;MY18B_HUMAN;.;.	D	1616;1616;1617	ENSP00000441229:A1616D;ENSP00000334563:A1616D;ENSP00000386096:A1617D	ENSP00000334563:A1616D	A	+	2	0	MYO18B	24628603	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	4.860000	0.62961	2.464000	0.83262	0.655000	0.94253	GCC	.	.		0.622	MYO18B-006	NOVEL	non_canonical_conserved|basic|appris_candidate_longest|exp_conf	protein_coding	protein_coding	OTTHUMT00000400691.1	NM_032608	
TCF20	6942	hgsc.bcm.edu	37	22	42608089	42608089	+	Missense_Mutation	SNP	G	G	C			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr22:42608089G>C	ENST00000359486.3	-	1	3359	c.3223C>G	c.(3223-3225)Cct>Gct	p.P1075A	TCF20_ENST00000404876.1_5'Flank|TCF20_ENST00000335626.4_Missense_Mutation_p.P1075A	NM_005650.1	NP_005641.1	Q9UGU0	TCF20_HUMAN	transcription factor 20 (AR1)	1075					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(7)|large_intestine(13)|lung(22)|ovary(5)|prostate(1)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(5)	66						CCTGCGTTAGGGTCCCCATAA	0.493																																					p.P1075A		Atlas-SNP	.											.	TCF20	164	.	0			c.C3223G						.						68.0	68.0	68.0					22																	42608089		2203	4300	6503	SO:0001583	missense	6942	exon1			CGTTAGGGTCCCC	U19345	CCDS14032.1, CCDS14033.1	22q13.3	2011-02-08			ENSG00000100207	ENSG00000100207			11631	protein-coding gene	gene with protein product	"""stromelysin-1 platelet-derived growth factor-responsive element binding protein"""	603107				9730594, 10995766	Standard	NM_005650		Approved	AR1, SPBP	uc003bcj.1	Q9UGU0	OTTHUMG00000150920	ENST00000359486.3:c.3223C>G	chr22.hg19:g.42608089G>C	ENSP00000352463:p.Pro1075Ala	101.0	0.0		115.0	54.0	NM_181492	A9JX12|O14528|Q13078|Q4V353|Q9H4M0	Missense_Mutation	SNP	ENST00000359486.3	hg19	CCDS14033.1	.	.	.	.	.	.	.	.	.	.	G	21.3	4.123331	0.77436	.	.	ENSG00000100207	ENST00000359486;ENST00000335626	T;T	0.72394	-0.65;-0.65	5.81	5.81	0.92471	.	0.000000	0.64402	D	0.000002	T	0.77545	0.4146	N	0.24115	0.695	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.85130	0.997;0.994	T	0.79923	-0.1598	10	0.87932	D	0	-14.2081	20.0628	0.97684	0.0:0.0:1.0:0.0	.	1075;1075	Q9UGU0-2;Q9UGU0	.;TCF20_HUMAN	A	1075	ENSP00000352463:P1075A;ENSP00000335561:P1075A	ENSP00000335561:P1075A	P	-	1	0	TCF20	40938033	1.000000	0.71417	0.997000	0.53966	0.987000	0.75469	6.716000	0.74702	2.745000	0.94114	0.655000	0.94253	CCT	.	.		0.493	TCF20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320531.1	NM_181492	
KIAA1644	85352	hgsc.bcm.edu	37	22	44681337	44681337	+	Silent	SNP	C	C	A			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr22:44681337C>A	ENST00000381176.4	-	4	702	c.570G>T	c.(568-570)ccG>ccT	p.P190P		NM_001099294.1	NP_001092764.1	Q3SXP7	K1644_HUMAN	KIAA1644	190						integral component of membrane (GO:0016021)				breast(1)|endometrium(1)|large_intestine(2)|lung(3)|ovary(1)|skin(1)	9		all_neural(38;0.0762)|Ovarian(80;0.105)|Glioma(61;0.222)				AGGTCATCAGCGGTGGGCTGT	0.617																																					p.P190P		Atlas-SNP	.											KIAA1644,colon,carcinoma,0,1	KIAA1644	39	.	0			c.G570T						.						68.0	71.0	70.0					22																	44681337		2117	4237	6354	SO:0001819	synonymous_variant	85352	exon4			CATCAGCGGTGGG	AB051431	CCDS43025.1	22q13	2009-02-06	2009-02-06		ENSG00000138944	ENSG00000138944			29335	protein-coding gene	gene with protein product						11258795	Standard	NM_001099294		Approved		uc003bet.2	Q3SXP7	OTTHUMG00000030991	ENST00000381176.4:c.570G>T	chr22.hg19:g.44681337C>A		137.0	1.0		130.0	34.0	NM_001099294	A6NHP0|A9Z1Z0|Q3SXP8|Q5JZ71|Q9BYB5	Silent	SNP	ENST00000381176.4	hg19	CCDS43025.1																																																																																			.	.		0.617	KIAA1644-006	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000075879.2	NM_001099294	
PHF21B	112885	hgsc.bcm.edu	37	22	45279146	45279146	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr22:45279146C>A	ENST00000313237.5	-	13	1566	c.1416G>T	c.(1414-1416)caG>caT	p.Q472H	PHF21B_ENST00000404079.2_Missense_Mutation_p.Q418H|PHF21B_ENST00000403565.1_Missense_Mutation_p.Q268H|PHF21B_ENST00000396103.3_Missense_Mutation_p.Q430H	NM_138415.4	NP_612424.1	Q96EK2	PF21B_HUMAN	PHD finger protein 21B	472							zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(14)|ovary(2)|prostate(1)|skin(2)	25		all_neural(38;0.00802)|Glioma(61;0.0353)|Ovarian(80;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0203)		GGGTGCCCCTCTGGCGGGCCA	0.627																																					p.Q472H		Atlas-SNP	.											.	PHF21B	61	.	0			c.G1416T						.						44.0	51.0	48.0					22																	45279146		2203	4300	6503	SO:0001583	missense	112885	exon13			GCCCCTCTGGCGG	AK091480	CCDS14061.1, CCDS56234.1, CCDS63504.1	22q13.31	2013-01-28			ENSG00000056487	ENSG00000056487		"""Zinc fingers, PHD-type"""	25161	protein-coding gene	gene with protein product			"""PHD finger protein 4"""	PHF4		12477932	Standard	NM_138415		Approved	BHC80L, FLJ34161	uc011aql.2	Q96EK2	OTTHUMG00000151199	ENST00000313237.5:c.1416G>T	chr22.hg19:g.45279146C>A	ENSP00000324403:p.Gln472His	29.0	0.0		38.0	10.0	NM_138415	B0QYW3|B0QYW4|B3KRU4|B7Z4F8|Q5TFL2|Q6ICC0	Missense_Mutation	SNP	ENST00000313237.5	hg19	CCDS14061.1	.	.	.	.	.	.	.	.	.	.	c	17.64	3.439142	0.63067	.	.	ENSG00000056487	ENST00000403565;ENST00000313237;ENST00000396103;ENST00000404079	D;D;D;D	0.88046	-2.33;-1.66;-1.71;-1.71	3.49	0.682	0.17992	.	0.094539	0.42420	U	0.000705	D	0.89315	0.6680	M	0.62723	1.935	0.80722	D	1	D;D;D;D	0.58970	0.984;0.973;0.973;0.966	P;P;P;P	0.62740	0.906;0.807;0.807;0.751	D	0.86671	0.1910	10	0.87932	D	0	-28.2465	7.8319	0.29347	0.0:0.7522:0.0:0.2478	.	430;418;472;268	Q96EK2-3;B7Z4F8;Q96EK2;B1AHC5	.;.;PF21B_HUMAN;.	H	268;472;430;418	ENSP00000385053:Q268H;ENSP00000324403:Q472H;ENSP00000379410:Q430H;ENSP00000385105:Q418H	ENSP00000324403:Q472H	Q	-	3	2	PHF21B	43657810	1.000000	0.71417	0.998000	0.56505	0.950000	0.60333	2.556000	0.45862	-0.002000	0.14469	0.299000	0.19835	CAG	.	.		0.627	PHF21B-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000321731.2	NM_138415	
CRELD2	79174	hgsc.bcm.edu	37	22	50312939	50312939	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr22:50312939C>T	ENST00000328268.4	+	2	265	c.191C>T	c.(190-192)aCg>aTg	p.T64M	CRELD2_ENST00000407217.3_Missense_Mutation_p.T64M|ALG12_ENST00000330817.6_5'Flank|CRELD2_ENST00000403427.3_Missense_Mutation_p.T64M|CRELD2_ENST00000404488.3_Missense_Mutation_p.T64M	NM_024324.3	NP_077300.3	Q6UXH1	CREL2_HUMAN	cysteine-rich with EGF-like domains 2	64						endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)	calcium ion binding (GO:0005509)			endometrium(1)|large_intestine(1)|lung(3)|ovary(1)|stomach(3)	9		all_cancers(38;5.53e-07)|all_epithelial(38;3.84e-06)|all_lung(38;0.00208)|Breast(42;0.0104)|Lung NSC(38;0.0199)|Ovarian(80;0.0907)|Lung SC(80;0.236)		BRCA - Breast invasive adenocarcinoma(115;0.198)|LUAD - Lung adenocarcinoma(64;0.247)		GAGGAAAAGACGCTGTCCAAG	0.612																																					p.T64M		Atlas-SNP	.											.	CRELD2	57	.	0			c.C191T						.						77.0	66.0	70.0					22																	50312939		2203	4300	6503	SO:0001583	missense	79174	exon2			AAAAGACGCTGTC	BC050675	CCDS14082.1, CCDS46730.1, CCDS63515.1, CCDS63516.1	22q13.33	2005-12-08			ENSG00000184164	ENSG00000184164			28150	protein-coding gene	gene with protein product		607171				12137942	Standard	XM_005261737		Approved	MGC11256	uc010hal.2	Q6UXH1	OTTHUMG00000150292	ENST00000328268.4:c.191C>T	chr22.hg19:g.50312939C>T	ENSP00000332223:p.Thr64Met	182.0	0.0		268.0	17.0	NM_024324	A5GZA2|A5GZA3|A5GZA4|A5GZA5|A5GZA6|Q4W0V0|Q86UC0|Q9BU47	Missense_Mutation	SNP	ENST00000328268.4	hg19	CCDS14082.1	.	.	.	.	.	.	.	.	.	.	C	22.6	4.305788	0.81247	.	.	ENSG00000184164	ENST00000450207;ENST00000404488;ENST00000328268;ENST00000407217;ENST00000403427	T;T;T;T;T	0.36157	1.27;1.27;1.27;1.27;1.27	4.51	4.51	0.55191	.	0.170117	0.50627	D	0.000102	T	0.58018	0.2093	M	0.63428	1.95	0.38075	D	0.936483	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.73380	0.972;0.976;0.972;0.98;0.976;0.978	T	0.65928	-0.6049	10	0.66056	D	0.02	.	17.5664	0.87921	0.0:1.0:0.0:0.0	.	64;64;64;64;64;64	Q6UXH1-2;Q6UXH1-5;Q6UXH1-4;A5GZA6;Q6UXH1;Q6UXH1-3	.;.;.;.;CREL2_HUMAN;.	M	64	ENSP00000387769:T64M;ENSP00000383938:T64M;ENSP00000332223:T64M;ENSP00000386034:T64M;ENSP00000384111:T64M	ENSP00000332223:T64M	T	+	2	0	CRELD2	48698943	0.613000	0.27009	0.940000	0.37924	0.991000	0.79684	1.204000	0.32296	2.216000	0.71823	0.655000	0.94253	ACG	.	.		0.612	CRELD2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000317409.1	NM_024324	
DMD	1756	hgsc.bcm.edu	37	X	32834720	32834720	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chrX:32834720T>A	ENST00000357033.4	-	6	601	c.395A>T	c.(394-396)cAa>cTa	p.Q132L	DMD_ENST00000288447.4_Missense_Mutation_p.Q124L|DMD_ENST00000378677.2_Missense_Mutation_p.Q128L	NM_000109.3|NM_004006.2|NM_004011.3|NM_004012.3|NM_004014.2	NP_000100.2|NP_003997|NP_004002.2|NP_004003.1|NP_004005.1	P11532	DMD_HUMAN	dystrophin	132	Actin-binding.				cardiac muscle cell action potential (GO:0086001)|cardiac muscle contraction (GO:0060048)|cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|extracellular matrix organization (GO:0030198)|motile cilium assembly (GO:0044458)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|peptide biosynthetic process (GO:0043043)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of heart rate (GO:0002027)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of skeletal muscle contraction (GO:0014819)|regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion (GO:0014809)|regulation of voltage-gated calcium channel activity (GO:1901385)	cell junction (GO:0030054)|cell surface (GO:0009986)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dystrophin-associated glycoprotein complex (GO:0016010)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|syntrophin complex (GO:0016013)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|dystroglycan binding (GO:0002162)|myosin binding (GO:0017022)|nitric-oxide synthase binding (GO:0050998)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)			NS(2)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|liver(1)|lung(25)|ovary(3)|pancreas(3)|prostate(2)|skin(1)|urinary_tract(2)	77		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				GTTGGTTTGTTGCAATCCAGC	0.373																																					p.Q132L		Atlas-SNP	.											.	DMD	2127	.	0			c.A395T						.						163.0	141.0	149.0					X																	32834720		2202	4300	6502	SO:0001583	missense	1756	exon6			GTTTGTTGCAATC	AF047505	CCDS14231.1, CCDS14232.1, CCDS14233.1, CCDS14234.1, CCDS48091.1, CCDS55394.1, CCDS55395.1, CCDS75965.1	Xp21.2	2014-09-17	2008-08-01		ENSG00000198947	ENSG00000198947			2928	protein-coding gene	gene with protein product	"""muscular dystrophy, Duchenne and Becker types"""	300377	"""dystrophin (muscular dystrophy, Duchenne and Becker types), includes DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272"", ""mental retardation, X-linked 85"""	MRX85		3282674, 3607877, 23900271	Standard	NM_004019		Approved	BMD, DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272	uc004dda.1	P11532	OTTHUMG00000021336	ENST00000357033.4:c.395A>T	chrX.hg19:g.32834720T>A	ENSP00000354923:p.Gln132Leu	107.0	0.0		87.0	56.0	NM_004006	E9PDN1|Q02295|Q14169|Q14170|Q5JYU0|Q6NSJ9|Q7KZ48|Q8N754|Q9UCW3|Q9UCW4	Missense_Mutation	SNP	ENST00000357033.4	hg19	CCDS14233.1	.	.	.	.	.	.	.	.	.	.	T	24.4	4.528591	0.85706	.	.	ENSG00000198947	ENST00000534884;ENST00000378677;ENST00000357033;ENST00000542849;ENST00000535280;ENST00000288447	D;D;D	0.95724	-3.79;-3.79;-3.79	5.44	5.44	0.79542	Calponin homology domain (2);	0.000000	0.35495	U	0.003162	D	0.96809	0.8958	M	0.63169	1.94	0.80722	D	1	D;D;D;P;D	0.61080	0.989;0.979;0.988;0.892;0.979	P;P;D;B;P	0.65233	0.841;0.858;0.933;0.237;0.858	D	0.97321	0.9944	10	0.87932	D	0	.	14.5467	0.68035	0.0:0.0:0.0:1.0	.	132;124;124;132;128	F5H6K1;Q4G0X0;P11532-4;P11532;E9PDN5	.;.;.;DMD_HUMAN;.	L	124;128;132;132;9;124	ENSP00000367948:Q128L;ENSP00000354923:Q132L;ENSP00000288447:Q124L	ENSP00000288447:Q124L	Q	-	2	0	DMD	32744641	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	8.036000	0.88901	1.816000	0.52996	0.486000	0.48141	CAA	.	.		0.373	DMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056182.2	NM_004006	
NXF3	56000	hgsc.bcm.edu	37	X	102334693	102334693	+	Silent	SNP	G	G	A			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chrX:102334693G>A	ENST00000395065.3	-	13	1259	c.1158C>T	c.(1156-1158)gcC>gcT	p.A386A	NXF3_ENST00000425644.1_Silent_p.A58A	NM_022052.1	NP_071335.1	Q9H4D5	NXF3_HUMAN	nuclear RNA export factor 3	386	NTF2. {ECO:0000255|PROSITE- ProRule:PRU00137}.				mRNA export from nucleus (GO:0006406)|poly(A)+ mRNA export from nucleus (GO:0016973)	cytoplasm (GO:0005737)|nuclear RNA export factor complex (GO:0042272)|nucleus (GO:0005634)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)			NS(1)|central_nervous_system(1)|cervix(1)|kidney(1)|large_intestine(2)|lung(15)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	26						ATACTCACGGGGCTGAGTCCT	0.572																																					p.A386A		Atlas-SNP	.											.	NXF3	81	.	0			c.C1158T						.						99.0	91.0	94.0					X																	102334693		2203	4300	6503	SO:0001819	synonymous_variant	56000	exon13			TCACGGGGCTGAG	AJ277527	CCDS14503.1	Xq22	2008-02-05			ENSG00000147206	ENSG00000147206			8073	protein-coding gene	gene with protein product		300316				11073998	Standard	NM_022052		Approved		uc004eju.3	Q9H4D5	OTTHUMG00000022088	ENST00000395065.3:c.1158C>T	chrX.hg19:g.102334693G>A		108.0	0.0		77.0	58.0	NM_022052	B4DYS7|Q5H9I1|Q9H1A9	Silent	SNP	ENST00000395065.3	hg19	CCDS14503.1	.	.	.	.	.	.	.	.	.	.	G	7.117	0.577203	0.13686	.	.	ENSG00000147206	ENST00000427570	.	.	.	4.44	0.315	0.15852	.	.	.	.	.	T	0.32406	0.0828	.	.	.	0.09310	N	0.999999	.	.	.	.	.	.	T	0.27971	-1.0058	4	.	.	.	12.3355	8.1428	0.31093	0.4187:0.0:0.5813:0.0	.	.	.	.	S	263	.	.	P	-	1	0	NXF3	102221349	0.331000	0.24713	0.000000	0.03702	0.026000	0.11368	0.695000	0.25527	-0.202000	0.10268	-0.380000	0.06706	CCC	.	.		0.572	NXF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057684.1	NM_022052	
TATDN3	128387	hgsc.bcm.edu	37	1	212965299	212965315	+	Frame_Shift_Del	DEL	CTGCCACCTCTCCGCCC	CTGCCACCTCTCCGCCC	-	rs377084448		TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	CTGCCACCTCTCCGCCC	CTGCCACCTCTCCGCCC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr1:212965299_212965315delCTGCCACCTCTCCGCCC	ENST00000366974.4	+	1	130_146	c.36_52delCTGCCACCTCTCCGCCC	c.(34-54)cactgccacctctccgccccgfs	p.CHLSAP13fs	NSL1_ENST00000473995.1_5'Flank|TATDN3_ENST00000531963.1_Frame_Shift_Del_p.CHLSAP13fs|TATDN3_ENST00000530441.1_Frame_Shift_Del_p.CHLSAP13fs|TATDN3_ENST00000532324.1_Frame_Shift_Del_p.CHLSAP13fs|TATDN3_ENST00000366973.4_Frame_Shift_Del_p.CHLSAP13fs|TATDN3_ENST00000526997.1_Frame_Shift_Del_p.CHLSAP13fs|NSL1_ENST00000422588.2_5'Flank|NSL1_ENST00000366976.1_5'Flank|TATDN3_ENST00000526641.1_Frame_Shift_Del_p.CHLSAP13fs|NSL1_ENST00000366975.6_5'Flank|NSL1_ENST00000366978.1_5'Flank|NSL1_ENST00000366977.3_5'Flank	NM_001042552.2|NM_001042553.2|NM_001146169.1|NM_001146171.1	NP_001036017.1|NP_001036018.1|NP_001139641.1|NP_001139643.1	Q17R31	TATD3_HUMAN	TatD DNase domain containing 3	13					DNA catabolic process (GO:0006308)	intracellular organelle (GO:0043229)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	deoxyribonuclease activity (GO:0004536)|endodeoxyribonuclease activity, producing 5'-phosphomonoesters (GO:0016888)|metal ion binding (GO:0046872)			endometrium(1)|large_intestine(2)|lung(6)	9				OV - Ovarian serous cystadenocarcinoma(81;0.00699)|all cancers(67;0.0118)|GBM - Glioblastoma multiforme(131;0.0801)|Epithelial(68;0.104)		TGGACTGTCACTGCCACCTCTCCGCCCCGGACTTTGA	0.659																																					p.12_17del		Atlas-Indel,Pindel	.											.	TATDN3	23	.	0			c.35_51del						.																																			SO:0001589	frameshift_variant	128387	exon1			.	AL832248	CCDS31019.1, CCDS41465.1, CCDS53475.1, CCDS53476.1, CCDS53477.1	1q32.3	2008-02-05			ENSG00000203705	ENSG00000203705			27010	protein-coding gene	gene with protein product							Standard	NM_001042552		Approved		uc001hjo.2	Q17R31	OTTHUMG00000036805	ENST00000366974.4:c.36_52delCTGCCACCTCTCCGCCC	chr1.hg19:g.212965299_212965315delCTGCCACCTCTCCGCCC	ENSP00000355941:p.Cys13fs	180.0	0.0		140.0	25.0	NM_001042552	A6NGS3|B7Z1C1|B7Z978|B7ZLQ6|E9PJE5|E9PNH3|G3V151|Q4G0L1	Frame_Shift_Del	DEL	ENST00000366974.4	hg19	CCDS31019.1																																																																																			.	.		0.659	TATDN3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000089396.2	XM_375838	
MYO1F	4542	hgsc.bcm.edu	37	19	8619381	8619395	+	In_Frame_Del	DEL	CTCACAGTCGATAAG	CTCACAGTCGATAAG	-	rs201539438		TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	CTCACAGTCGATAAG	CTCACAGTCGATAAG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr19:8619381_8619395delCTCACAGTCGATAAG	ENST00000338257.8	-	4	559_573	c.292_306delCTTATCGACTGTGAG	c.(292-306)cttatcgactgtgagdel	p.LIDCE98del		NM_012335.3	NP_036467.2	O00160	MYO1F_HUMAN	myosin IF	98	Myosin motor.				defense response to Gram-positive bacterium (GO:0050830)|negative regulation of cell adhesion (GO:0007162)|neutrophil degranulation (GO:0043312)|positive regulation of cell migration (GO:0030335)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of innate immune response (GO:0045088)	cortical actin cytoskeleton (GO:0030864)|filamentous actin (GO:0031941)|unconventional myosin complex (GO:0016461)	actin binding (GO:0003779)|ATP binding (GO:0005524)|motor activity (GO:0003774)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(7)|lung(13)|ovary(3)|prostate(3)|skin(3)|urinary_tract(1)	42						CACACTGGTTCTCACAGTCGATAAGCATGTTCCGG	0.609																																					p.98_103del		Atlas-Indel,Pindel	.											.	MYO1F	128	.	0			c.293_307del						.																																			SO:0001651	inframe_deletion	4542	exon4			.	X98411	CCDS42494.1	19p13.3-p13.2	2011-09-27			ENSG00000142347	ENSG00000142347		"""Myosins / Myosin superfamily : Class I"""	7600	protein-coding gene	gene with protein product		601480				9119401, 8884266	Standard	NM_012335		Approved		uc002mkg.3	O00160	OTTHUMG00000156005	ENST00000338257.8:c.292_306delCTTATCGACTGTGAG	chr19.hg19:g.8619381_8619395delCTCACAGTCGATAAG	ENSP00000344871:p.Leu98_Glu102del	55.0	0.0		46.0	14.0	NM_012335	Q8WWN7	In_Frame_Del	DEL	ENST00000338257.8	hg19	CCDS42494.1																																																																																			.	.		0.609	MYO1F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342716.2		
TMPRSS13	84000	hgsc.bcm.edu	37	11	117789435	117789449	+	In_Frame_Del	DEL	GCTGGAGATGCCTGG	GCTGGAGATGCCTGG	-			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	GCTGGAGATGCCTGG	GCTGGAGATGCCTGG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr11:117789435_117789449delGCTGGAGATGCCTGG	ENST00000430170.2	-	2	213_227	c.126_140delCCAGGCATCTCCAGC	c.(124-141)gcccaggcatctccagct>gct	p.42_47AQASPA>A	TMPRSS13_ENST00000445164.2_In_Frame_Del_p.42_47AQASPA>A|TMPRSS13_ENST00000524993.1_In_Frame_Del_p.42_47AQASPA>A|TMPRSS13_ENST00000528626.1_In_Frame_Del_p.42_47AQASPA>A|TMPRSS13_ENST00000526090.1_In_Frame_Del_p.42_47AQASPA>A	NM_001244995.1	NP_001231924.1	Q9BYE2	TMPSD_HUMAN	transmembrane protease, serine 13	42	13 X 5 AA repeats of A-S-P-A-[GLQR].|4 X 5 AA repeats of T-P-P-G-R.|Ala-rich.					blood microparticle (GO:0072562)|integral component of membrane (GO:0016021)	scavenger receptor activity (GO:0005044)|serine-type endopeptidase activity (GO:0004252)			endometrium(1)|kidney(3)|large_intestine(6)|lung(7)|pancreas(1)|prostate(1)|urinary_tract(1)	20	all_hematologic(175;0.0487)	Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;1.78e-05)|Epithelial(105;0.00106)		AGGTGTCCCAGCTGGAGATGCCTGGGCTGGAGATG	0.66																																					p.43_47del		Atlas-INDEL	.											.	TMPRSS13	75	.	0			c.127_141del						.																																			SO:0001651	inframe_deletion	84000	exon2			.	AB048796	CCDS41721.1, CCDS55788.1, CCDS55789.1, CCDS58185.1	11q23	2010-04-13	2005-03-11	2005-03-12	ENSG00000137747	ENSG00000137747		"""Serine peptidases / Transmembrane"""	29808	protein-coding gene	gene with protein product		610050	"""transmembrane protease, serine 11"""	TMPRSS11		11267681	Standard	NM_001077263		Approved	MSPL	uc001prs.2	Q9BYE2	OTTHUMG00000166992	ENST00000430170.2:c.126_140delCCAGGCATCTCCAGC	chr11.hg19:g.117789435_117789449delGCTGGAGATGCCTGG	ENSP00000387702:p.Ala42_Pro46del	42.0	0.0		29.0	11.0	NM_001206789	B4DTM9|E9PIJ5|F8WAJ3|Q86YM4|Q96JY8|Q9BYE1	In_Frame_Del	DEL	ENST00000430170.2	hg19	CCDS58185.1																																																																																			.	.		0.660	TMPRSS13-006	PUTATIVE	basic|appris_candidate|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000392318.1	NM_032046	
POLDIP3	84271	hgsc.bcm.edu	37	22	42983538	42983538	+	Frame_Shift_Del	DEL	A	A	-			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr22:42983538delA	ENST00000252115.5	-	8	1166	c.1062delT	c.(1060-1062)gttfs	p.V354fs	POLDIP3_ENST00000491021.1_5'UTR|POLDIP3_ENST00000451060.2_Intron|POLDIP3_ENST00000339677.6_Intron|POLDIP3_ENST00000348657.2_Frame_Shift_Del_p.V325fs	NM_032311.3	NP_115687.2	Q9BY77	PDIP3_HUMAN	polymerase (DNA-directed), delta interacting protein 3	354					poly(A)+ mRNA export from nucleus (GO:0016973)|positive regulation of translation (GO:0045727)	cytoplasm (GO:0005737)|nuclear speck (GO:0016607)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			biliary_tract(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(3)|upper_aerodigestive_tract(1)	16						CTGAGGTGATAACATTCCCAT	0.512																																					p.I355fs	Ovarian(52;967 1128 5875 19997 42537)	Atlas-Indel,Pindel	.											.	POLDIP3	58	.	0			c.1063delA						.						157.0	156.0	156.0					22																	42983538		2203	4300	6503	SO:0001589	frameshift_variant	84271	exon8			.		CCDS14038.1, CCDS14039.1, CCDS74873.1	22q13.31	2013-02-12			ENSG00000100227	ENSG00000100227		"""RNA binding motif (RRM) containing"""	23782	protein-coding gene	gene with protein product		611520				12522211	Standard	NM_032311		Approved	PDIP46, KIAA1649	uc003bcu.3	Q9BY77	OTTHUMG00000150887	ENST00000252115.5:c.1062delT	chr22.hg19:g.42983538delA	ENSP00000252115:p.Val354fs	140.0	0.0		124.0	37.0	NM_032311	A8K6F8|A8K6V9|Q009A7|Q5H972|Q6PGN6|Q7Z6Z0|Q9NSP5|Q9NSP6	Frame_Shift_Del	DEL	ENST00000252115.5	hg19	CCDS14038.1																																																																																			.	.		0.512	POLDIP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320433.1	NM_032311	
DDX12P	440081	hgsc.bcm.edu	37	12	9580257	9580257	+	IGR	DEL	C	C	-			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr12:9580257delC								RP13-735L24.1 (30044 upstream) : SNORA75 (17396 downstream)																							GTCGATCTGGCTCTGGAAGAG	0.488																																					.		Atlas-Indel,Pindel	.											.	.	.	.	0			.						.						159.0	163.0	162.0					12																	9580257		692	1591	2283	SO:0001628	intergenic_variant	440081	.			.																													chr12.hg19:g.9580257delC		374.0	0.0		338.0	51.0	.		RNA	DEL		hg19																																																																																				.	.	0	0.488								
ITGAV	3685	hgsc.bcm.edu	37	2	187455211	187455222	+	In_Frame_Del	DEL	TCGGCTTCGCCG	TCGGCTTCGCCG	-	rs61763606	byFrequency	TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	TCGGCTTCGCCG	TCGGCTTCGCCG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr2:187455211_187455222delTCGGCTTCGCCG	ENST00000261023.3	+	1	420_431	c.146_157delTCGGCTTCGCCG	c.(145-159)ttcggcttcgccgtg>ttg	p.49_53FGFAV>L	ITGAV_ENST00000374907.3_In_Frame_Del_p.49_53FGFAV>L	NM_002210.3	NP_002201	P06756	ITAV_HUMAN	integrin, alpha V	49					angiogenesis (GO:0001525)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apolipoprotein A-I-mediated signaling pathway (GO:0038027)|apoptotic cell clearance (GO:0043277)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|cell adhesion (GO:0007155)|cell growth (GO:0016049)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|cell-substrate adhesion (GO:0031589)|endodermal cell differentiation (GO:0035987)|entry of symbiont into host cell by promotion of host phagocytosis (GO:0052066)|ERK1 and ERK2 cascade (GO:0070371)|extracellular matrix organization (GO:0030198)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|negative chemotaxis (GO:0050919)|negative regulation of entry of bacterium into host cell (GO:2000536)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of lipid storage (GO:0010888)|negative regulation of lipid transport (GO:0032369)|negative regulation of lipoprotein metabolic process (GO:0050748)|negative regulation of low-density lipoprotein particle receptor biosynthetic process (GO:0045715)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of osteoblast proliferation (GO:0033690)|regulation of apoptotic cell clearance (GO:2000425)|regulation of phagocytosis (GO:0050764)|substrate adhesion-dependent cell spreading (GO:0034446)|viral entry into host cell (GO:0046718)	alphav-beta3 integrin-IGF-1-IGF1R complex (GO:0035867)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|integrin alphav-beta3 complex (GO:0034683)|integrin alphav-beta5 complex (GO:0034684)|integrin alphav-beta8 complex (GO:0034686)|integrin complex (GO:0008305)|lamellipodium membrane (GO:0031258)|membrane (GO:0016020)|microvillus membrane (GO:0031528)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	extracellular matrix binding (GO:0050840)|extracellular matrix protein binding (GO:1990430)|fibronectin binding (GO:0001968)|metal ion binding (GO:0046872)|protease binding (GO:0002020)|transforming growth factor beta binding (GO:0050431)|virus receptor activity (GO:0001618)|voltage-gated calcium channel activity (GO:0005245)	p.F51F(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(6)|lung(19)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	47			OV - Ovarian serous cystadenocarcinoma(117;0.0185)|Epithelial(96;0.072)|all cancers(119;0.189)	STAD - Stomach adenocarcinoma(3;0.106)|COAD - Colon adenocarcinoma(31;0.108)	Antithymocyte globulin(DB00098)	GGAAGTTACTTCGGCTTCGCCGTGGATTTCTT	0.637																																					p.49_52del	Melanoma(58;108 1995 6081)	Atlas-Indel,Pindel	.											.	ITGAV	124	.	1	Substitution - coding silent(1)	urinary_tract(1)	c.145_156del						.																																			SO:0001651	inframe_deletion	3685	exon1			.		CCDS2292.1, CCDS46470.1, CCDS46471.1	2q31-q32	2012-04-20	2012-04-20		ENSG00000138448	ENSG00000138448		"""CD molecules"", ""Integrins"""	6150	protein-coding gene	gene with protein product		193210	"""antigen identified by monoclonal antibody L230"", ""vitronectin receptor"", ""integrin, alpha V (vitronectin receptor, alpha polypeptide, antigen CD51)"""	VNRA, MSK8, VTNR		2454952	Standard	NM_001144999		Approved	CD51	uc002upq.4	P06756	OTTHUMG00000132635	ENST00000261023.3:c.146_157delTCGGCTTCGCCG	chr2.hg19:g.187455211_187455222delTCGGCTTCGCCG	ENSP00000261023:p.Phe49_Val53delinsLeu	219.0	0.0		175.0	36.0	NM_001145000	A0AV67|B0LPF4|B7Z883|B7ZLX0|D3DPG8|E7EWZ6|Q53SK4|Q59EB7|Q6LD15	In_Frame_Del	DEL	ENST00000261023.3	hg19	CCDS2292.1																																																																																			.	.		0.637	ITGAV-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255882.2	NM_002210	
ZNF829	374899	hgsc.bcm.edu	37	19	37383281	37383281	+	Frame_Shift_Del	DEL	T	T	-			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr19:37383281delT	ENST00000391711.3	-	6	776	c.412delA	c.(412-414)attfs	p.I138fs	ZNF345_ENST00000526123.1_Intron|ZNF829_ENST00000520965.1_Frame_Shift_Del_p.I219fs|ZNF345_ENST00000432005.2_Intron	NM_001037232.3	NP_001032309.2	Q3KNS6	ZN829_HUMAN	zinc finger protein 829	138					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(2)|kidney(1)|large_intestine(11)|lung(8)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	29	Esophageal squamous(110;0.183)		COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			GTGGGCTGAATAAAAGTAGAC	0.338																																					p.I219fs		Atlas-Indel,Pindel	.											.	ZNF829	70	.	0			c.656delT						.						63.0	55.0	58.0					19																	37383281		1837	4084	5921	SO:0001589	frameshift_variant	374899	exon6			.	BC107131	CCDS42557.1, CCDS59380.1	19q13.12	2013-01-08			ENSG00000185869	ENSG00000185869		"""Zinc fingers, C2H2-type"", ""-"""	34032	protein-coding gene	gene with protein product							Standard	NM_001037232		Approved	DKFZp779O175	uc021utr.1	Q3KNS6	OTTHUMG00000048161	ENST00000391711.3:c.412delA	chr19.hg19:g.37383281delT	ENSP00000429266:p.Ile138fs	39.0	0.0		96.0	15.0	NM_001171979	Q3KNS7|Q6ZNN0|Q7Z657	Frame_Shift_Del	DEL	ENST00000391711.3	hg19	CCDS42557.1																																																																																			.	.		0.338	ZNF829-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109575.3	NM_001037232	
LRRK2	120892	hgsc.bcm.edu	37	12	40714888	40714889	+	Frame_Shift_Ins	INS	-	-	T			TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr12:40714888_40714889insT	ENST00000298910.7	+	35	5126_5127	c.5068_5069insT	c.(5068-5070)attfs	p.I1690fs		NM_198578.3	NP_940980	Q5S007	LRRK2_HUMAN	leucine-rich repeat kinase 2	1690					activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|autophagy (GO:0006914)|cellular protein localization (GO:0034613)|cellular response to dopamine (GO:1903351)|cellular response to manganese ion (GO:0071287)|cellular response to oxidative stress (GO:0034599)|determination of adult lifespan (GO:0008340)|endocytosis (GO:0006897)|exploration behavior (GO:0035640)|GTP catabolic process (GO:0006184)|intracellular distribution of mitochondria (GO:0048312)|intracellular signal transduction (GO:0035556)|locomotory exploration behavior (GO:0035641)|MAPK cascade (GO:0000165)|negative regulation of GTPase activity (GO:0034260)|negative regulation of hydrogen peroxide-induced cell death (GO:1903206)|negative regulation of late endosome to lysosome transport (GO:1902823)|negative regulation of peroxidase activity (GO:2000469)|negative regulation of protein binding (GO:0032091)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of protein processing (GO:0010955)|negative regulation of protein processing involved in protein targeting to mitochondrion (GO:1903217)|negative regulation of protein targeting to mitochondrion (GO:1903215)|negative regulation of thioredoxin peroxidase activity by peptidyl-threonine phosphorylation (GO:1903125)|neuromuscular junction development (GO:0007528)|neuron death (GO:0070997)|neuron projection morphogenesis (GO:0048812)|olfactory bulb development (GO:0021772)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of autophagy (GO:0010508)|positive regulation of dopamine receptor signaling pathway (GO:0060161)|positive regulation of GTPase activity (GO:0043547)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of programmed cell death (GO:0043068)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein autoubiquitination (GO:1902499)|positive regulation of protein binding (GO:0032092)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination (GO:0031398)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|reactive oxygen species metabolic process (GO:0072593)|regulation of branching morphogenesis of a nerve (GO:2000172)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of dopamine receptor signaling pathway (GO:0060159)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of kidney size (GO:0035564)|regulation of locomotion (GO:0040012)|regulation of membrane potential (GO:0042391)|regulation of mitochondrial depolarization (GO:0051900)|regulation of neuroblast proliferation (GO:1902692)|regulation of neuron death (GO:1901214)|regulation of neuron maturation (GO:0014041)|regulation of protein kinase A signaling (GO:0010738)|regulation of synaptic transmission, glutamatergic (GO:0051966)|regulation of synaptic vesicle exocytosis (GO:2000300)|regulation of synaptic vesicle transport (GO:1902803)|response to oxidative stress (GO:0006979)|small GTPase mediated signal transduction (GO:0007264)|tangential migration from the subventricular zone to the olfactory bulb (GO:0022028)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytoplasmic side of mitochondrial outer membrane (GO:0032473)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendrite (GO:0030425)|dendrite cytoplasm (GO:0032839)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|inclusion body (GO:0016234)|lysosome (GO:0005764)|membrane raft (GO:0045121)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial membrane (GO:0031966)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)|terminal bouton (GO:0043195)|trans-Golgi network (GO:0005802)	actin binding (GO:0003779)|ATP binding (GO:0005524)|clathrin binding (GO:0030276)|glycoprotein binding (GO:0001948)|GTP binding (GO:0005525)|GTP-dependent protein kinase activity (GO:0034211)|GTPase activator activity (GO:0005096)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)|ion channel binding (GO:0044325)|kinase activity (GO:0016301)|MAP kinase kinase activity (GO:0004708)|peroxidase inhibitor activity (GO:0036479)|protein homodimerization activity (GO:0042803)|protein kinase A binding (GO:0051018)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|Rho GTPase binding (GO:0017048)|SNARE binding (GO:0000149)|syntaxin-1 binding (GO:0017075)|tubulin binding (GO:0015631)			NS(3)|biliary_tract(1)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(23)|large_intestine(31)|lung(55)|ovary(15)|pancreas(2)|prostate(4)|skin(4)|stomach(9)|upper_aerodigestive_tract(7)|urinary_tract(2)	181	all_cancers(12;0.00108)|Breast(8;0.218)	Lung NSC(34;0.0942)|all_lung(34;0.11)				GAACTCTGAAATTATCATCCGA	0.396																																					p.I1690fs		Atlas-Indel,Pindel	.											.	LRRK2	763	.	0			c.5068_5069insT						.																																			SO:0001589	frameshift_variant	120892	exon35			.	AK026776	CCDS31774.1	12q12	2011-07-21			ENSG00000188906	ENSG00000188906		"""Parkinson disease"""	18618	protein-coding gene	gene with protein product		609007	"""Parkinson disease (autosomal dominant) 8"""	PARK8		15541308	Standard	NM_198578		Approved	ROCO2, DKFZp434H2111, FLJ45829, RIPK7	uc001rmg.4	Q5S007	OTTHUMG00000059742	ENST00000298910.7:c.5070dupT	chr12.hg19:g.40714890_40714890dupT	ENSP00000298910:p.Ile1690fs	108.0	0.0		74.0	33.0	NM_198578	A6NJU2|Q6ZS50|Q8NCX9	Frame_Shift_Ins	INS	ENST00000298910.7	hg19	CCDS31774.1																																																																																			.	.		0.396	LRRK2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000277179.1	XM_058513	
WIF1	11197	hgsc.bcm.edu	37	12	65449809	65449854	+	Splice_Site	DEL	GTAGCCCAGATTGGCAATGTGTATGGGGTACTTACGCTTTGAACAG	GTAGCCCAGATTGGCAATGTGTATGGGGTACTTACGCTTTGAACAG	-	rs201141383		TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	GTAGCCCAGATTGGCAATGTGTATGGGGTACTTACGCTTTGAACAG	GTAGCCCAGATTGGCAATGTGTATGGGGTACTTACGCTTTGAACAG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr12:65449809_65449854delGTAGCCCAGATTGGCAATGTGTATGGGGTACTTACGCTTTGAACAG	ENST00000286574.4	-	8	1253_1297	c.879_923delCTGTTCAAAGCGTAAGTACCCCATACACATTGCCAATCTGGGCTAC	c.(877-924)aactgttcaaagcgtaagtaccccatacacattgccaatctgggctac>aac	p.CSKRKYPIHIANLGY294fs		NM_007191.4	NP_009122.2	Q9Y5W5	WIF1_HUMAN	WNT inhibitory factor 1	294	EGF-like 4. {ECO:0000255|PROSITE- ProRule:PRU00076}.				multicellular organismal development (GO:0007275)|positive regulation of fat cell differentiation (GO:0045600)|signal transduction (GO:0007165)|Wnt signaling pathway (GO:0016055)	extracellular region (GO:0005576)		p.G299C(2)		cervix(1)|large_intestine(4)|lung(10)|ovary(3)|skin(1)|stomach(1)|urinary_tract(1)	21			LUAD - Lung adenocarcinoma(6;0.0234)|LUSC - Lung squamous cell carcinoma(43;0.0975)	GBM - Glioblastoma multiforme(28;0.0231)		TGGGGTACTTACGCTTTGAACAGAGGTCTCCCTGGTAACCTTTGGAACACTTACATTTGCTTTTAC	0.455			T	HMGA2	pleomorphic salivary gland adenoma																																p.305_308del	Esophageal Squamous(148;1595 1816 48559 49439 49664)	Pindel	.		Dom	yes		12	12q14.3	11197	WNT inhibitory factor 1		E	.	WIF1	96	.	2	Substitution - Missense(2)	lung(2)	c.913_922del						.																																			SO:0001630	splice_region_variant	11197	exon8			.	AF122922	CCDS8971.1	12q14.2	2008-04-11			ENSG00000156076	ENSG00000156076			18081	protein-coding gene	gene with protein product		605186				10201374	Standard	NM_007191		Approved		uc001ssk.3	Q9Y5W5	OTTHUMG00000168832	ENST00000286574.4:c.922+1CTGTTCAAAGCGTAAGTACCCCATACACATTGCCAATCTGGGCTAC>-	chr12.hg19:g.65449809_65449854delGTAGCCCAGATTGGCAATGTGTATGGGGTACTTACGCTTTGAACAG		65.0	0.0		55.0	14.0	NM_007191	Q6UXI1|Q8WVG4	Frame_Shift_Del	DEL	ENST00000286574.4	hg19	CCDS8971.1																																																																																			.	.		0.455	WIF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401258.2		Frame_Shift_Del
ADPRHL1	113622	hgsc.bcm.edu	37	13	114107605	114107632	+	Frame_Shift_Del	DEL	GCGAGAGTACGAGGTGGTCCAGGCCCCC	GCGAGAGTACGAGGTGGTCCAGGCCCCC	-	rs34085933|rs546248843|rs35745409|rs141431509|rs148683938|rs558010517	byFrequency	TCGA-CC-A7II-01A-11D-A33K-10	TCGA-CC-A7II-10A-01D-A33K-10	GCGAGAGTACGAGGTGGTCCAGGCCCCC	GCGAGAGTACGAGGTGGTCCAGGCCCCC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	38404863-430b-43e1-9349-5e50adbe47bd	67f74191-95ad-4192-a479-4cd21b1cdfa4	g.chr13:114107605_114107632delGCGAGAGTACGAGGTGGTCCAGGCCCCC	ENST00000375418.3	-	1	207_234	c.121_148delGGGGGCCTGGACCACCTCGTACTCTCGC	c.(121-150)gggggcctggaccacctcgtactctcgccafs	p.GGLDHLVLSP41fs		NM_138430.3	NP_612439.2	Q8NDY3	ARHL1_HUMAN	ADP-ribosylhydrolase like 1	41					protein de-ADP-ribosylation (GO:0051725)		ADP-ribosylarginine hydrolase activity (GO:0003875)|magnesium ion binding (GO:0000287)	p.L46L(1)		endometrium(1)|kidney(2)|large_intestine(1)|lung(6)|skin(1)	11	Lung NSC(43;0.0161)|all_neural(89;0.0337)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.0395)|all_epithelial(44;0.011)|all_lung(25;0.0271)|Lung NSC(25;0.0977)|Breast(118;0.188)	all cancers(43;0.0195)|GBM - Glioblastoma multiforme(44;0.116)			CATTCTCCTGGCGAGAGTACGAGGTGGTCCAGGCCCCCGGAACGTTGC	0.623																																					p.41_50del		Pindel	.											.	ADPRHL1	30	.	1	Substitution - coding silent(1)	lung(1)	c.122_149del						.																																			SO:0001589	frameshift_variant	113622	exon1			.	AJ313429	CCDS9535.1, CCDS9536.1	13q34	2003-06-19			ENSG00000153531	ENSG00000153531			21303	protein-coding gene	gene with protein product		610620				12070318	Standard	NM_138430		Approved	ARH2	uc001vtq.1	Q8NDY3	OTTHUMG00000017386	ENST00000375418.3:c.121_148delGGGGGCCTGGACCACCTCGTACTCTCGC	chr13.hg19:g.114107605_114107632delGCGAGAGTACGAGGTGGTCCAGGCCCCC	ENSP00000364567:p.Gly41fs	114.0	0.0		97.0	15.0	NM_138430	Q5JUG2|Q96GD1	Frame_Shift_Del	DEL	ENST00000375418.3	hg19	CCDS9535.1																																																																																			.	.		0.623	ADPRHL1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045915.2	NM_138430	
