#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
GCLM	2730	hgsc.bcm.edu	37	1	94362176	94362176	+	Missense_Mutation	SNP	G	G	C			TCGA-CC-A8HS-01A-11D-A35Z-10	TCGA-CC-A8HS-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	eec73def-9c6d-487a-b4b5-d9e879138027	4de9ebd4-2594-4178-b695-344708a55698	g.chr1:94362176G>C	ENST00000370238.3	-	5	784	c.538C>G	c.(538-540)Cag>Gag	p.Q180E	GCLM_ENST00000467772.1_5'UTR	NM_002061.2	NP_002052.1	P48507	GSH0_HUMAN	glutamate-cysteine ligase, modifier subunit	180					apoptotic mitochondrial changes (GO:0008637)|cellular nitrogen compound metabolic process (GO:0034641)|cysteine metabolic process (GO:0006534)|glutamate metabolic process (GO:0006536)|glutathione biosynthetic process (GO:0006750)|glutathione derivative biosynthetic process (GO:1901687)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of neuron apoptotic process (GO:0043524)|positive regulation of glutamate-cysteine ligase activity (GO:0035229)|regulation of blood vessel size (GO:0050880)|regulation of mitochondrial depolarization (GO:0051900)|response to drug (GO:0042493)|response to nitrosative stress (GO:0051409)|response to oxidative stress (GO:0006979)|small molecule metabolic process (GO:0044281)|sulfur amino acid metabolic process (GO:0000096)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)|glutamate-cysteine ligase complex (GO:0017109)	glutamate-cysteine ligase activity (GO:0004357)|glutamate-cysteine ligase catalytic subunit binding (GO:0035226)			endometrium(2)|kidney(1)|large_intestine(1)|lung(3)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	10		all_lung(203;0.000815)|Lung NSC(277;0.00363)		all cancers(265;0.00566)|GBM - Glioblastoma multiforme(16;0.0203)|Epithelial(280;0.131)	L-Cysteine(DB00151)	TCCCTCACCTGTGCCCACTGA	0.478																																					p.Q180E		Atlas-SNP	.											.	GCLM	20	.	0			c.C538G						.						210.0	180.0	190.0					1																	94362176		2203	4300	6503	SO:0001583	missense	2730	exon5			TCACCTGTGCCCA	L35546	CCDS746.1	1p21	2008-02-05			ENSG00000023909	ENSG00000023909	6.3.2.2		4312	protein-coding gene	gene with protein product	"""gamma-glutamylcysteine synthetase"""	601176		GLCLR		7826375	Standard	NM_002061		Approved		uc001dqg.1	P48507	OTTHUMG00000010562	ENST00000370238.3:c.538C>G	chr1.hg19:g.94362176G>C	ENSP00000359258:p.Gln180Glu	114.0	0.0		162.0	76.0	NM_002061	A8K334|D3DT45|M5A959|Q6FHC1|Q9NPX9|Q9NU74	Missense_Mutation	SNP	ENST00000370238.3	hg19	CCDS746.1	.	.	.	.	.	.	.	.	.	.	G	15.67	2.903022	0.52227	.	.	ENSG00000023909	ENST00000370238	T	0.21932	1.98	5.32	4.39	0.52855	NADP-dependent oxidoreductase domain (3);	0.156175	0.64402	D	0.000018	T	0.06142	0.0159	L	0.37750	1.13	0.58432	D	0.999998	B	0.30146	0.27	B	0.25506	0.061	T	0.05241	-1.0897	10	0.06891	T	0.86	.	15.6097	0.76707	0.0:0.0:0.8613:0.1387	.	180	P48507	GSH0_HUMAN	E	180	ENSP00000359258:Q180E	ENSP00000359258:Q180E	Q	-	1	0	GCLM	94134764	1.000000	0.71417	1.000000	0.80357	0.936000	0.57629	6.242000	0.72376	1.343000	0.45638	0.655000	0.94253	CAG	.	.		0.478	GCLM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029169.1	NM_002061	
CGN	57530	hgsc.bcm.edu	37	1	151506476	151506476	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A8HS-01A-11D-A35Z-10	TCGA-CC-A8HS-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	eec73def-9c6d-487a-b4b5-d9e879138027	4de9ebd4-2594-4178-b695-344708a55698	g.chr1:151506476A>G	ENST00000271636.7	+	15	2901	c.2768A>G	c.(2767-2769)cAg>cGg	p.Q923R		NM_020770.2	NP_065821.1	Q9P2M7	CING_HUMAN	cingulin	917					transforming growth factor beta receptor signaling pathway (GO:0007179)	cell junction (GO:0030054)|myosin complex (GO:0016459)|tight junction (GO:0005923)	actin binding (GO:0003779)|motor activity (GO:0003774)			NS(1)|central_nervous_system(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|liver(1)|lung(14)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	45	Ovarian(49;0.0273)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		LUSC - Lung squamous cell carcinoma(543;0.181)			CAGGCCCTGCAGGCATCCCAG	0.632																																					p.Q923R		Atlas-SNP	.											.	CGN	106	.	0			c.A2768G						.						29.0	32.0	31.0					1																	151506476		2195	4290	6485	SO:0001583	missense	57530	exon15			CCCTGCAGGCATC	AB037740	CCDS999.1	1q21	2008-02-05			ENSG00000143375	ENSG00000143375			17429	protein-coding gene	gene with protein product		609473				11042084, 12529927	Standard	NM_020770		Approved	KIAA1319	uc009wmw.3	Q9P2M7	OTTHUMG00000012497	ENST00000271636.7:c.2768A>G	chr1.hg19:g.151506476A>G	ENSP00000271636:p.Gln923Arg	391.0	0.0		563.0	70.0	NM_020770	A6H8L3|A7MD22|Q5T386|Q9NR25	Missense_Mutation	SNP	ENST00000271636.7	hg19	CCDS999.1	.	.	.	.	.	.	.	.	.	.	A	16.64	3.179826	0.57800	.	.	ENSG00000143375	ENST00000271636	T	0.78246	-1.16	5.25	5.25	0.73442	Myosin tail (1);	0.261922	0.38326	N	0.001736	T	0.72510	0.3469	L	0.31420	0.93	0.44454	D	0.997384	D	0.71674	0.998	D	0.67900	0.954	T	0.71331	-0.4625	10	0.21014	T	0.42	-27.2151	13.994	0.64386	1.0:0.0:0.0:0.0	.	917	Q9P2M7	CING_HUMAN	R	923	ENSP00000271636:Q923R	ENSP00000271636:Q923R	Q	+	2	0	CGN	149773100	1.000000	0.71417	1.000000	0.80357	0.806000	0.45545	4.166000	0.58203	1.990000	0.58119	0.460000	0.39030	CAG	.	.		0.632	CGN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034900.3	NM_020770	
CELF3	11189	hgsc.bcm.edu	37	1	151678725	151678725	+	Silent	SNP	C	C	T			TCGA-CC-A8HS-01A-11D-A35Z-10	TCGA-CC-A8HS-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	eec73def-9c6d-487a-b4b5-d9e879138027	4de9ebd4-2594-4178-b695-344708a55698	g.chr1:151678725C>T	ENST00000290583.4	-	10	1894	c.1101G>A	c.(1099-1101)caG>caA	p.Q367Q	CELF3_ENST00000392706.3_Silent_p.Q162Q|CELF3_ENST00000290585.4_Silent_p.Q317Q|RP11-98D18.1_ENST00000457548.1_RNA|CELF3_ENST00000470688.1_5'UTR	NM_001172648.1|NM_007185.4	NP_001166119.1|NP_009116.3	Q5SZQ8	CELF3_HUMAN	CUGBP, Elav-like family member 3	367	Gln-rich.				mRNA splicing, via spliceosome (GO:0000398)|positive regulation of mRNA splicing, via spliceosome (GO:0048026)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|RNA splicing (GO:0008380)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)	p.Q367Q(1)		central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(6)|ovary(1)|prostate(1)	21						gctgctgttgctgctgctgct	0.657																																					p.Q367Q		Atlas-SNP	.											CELF3,caecum,carcinoma,0,1	CELF3	49	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1101A						.						18.0	19.0	19.0					1																	151678725		2200	4292	6492	SO:0001819	synonymous_variant	11189	exon10			CTGTTGCTGCTGC	U80759	CCDS1002.1, CCDS53367.1	1q21	2013-02-12	2010-02-19	2010-02-19	ENSG00000159409	ENSG00000159409		"""Trinucleotide (CAG) repeat containing"", ""RNA binding motif (RRM) containing"""	11967	protein-coding gene	gene with protein product	"""expanded repeat domain, CAG/CTG 4"", ""CAG repeat domain"", ""CUG-BP and ETR-3 like factor 3"""	612678	"""trinucleotide repeat containing 4"""	TNRC4		9225980	Standard	XM_005244859		Approved	CAGH4, BRUNOL1, ERDA4, MGC57297	uc001eys.2	Q5SZQ8	OTTHUMG00000013064	ENST00000290583.4:c.1101G>A	chr1.hg19:g.151678725C>T		39.0	0.0		85.0	4.0	NM_007185	B7ZKK6|O15414|Q499Y6|Q5SZQ7|Q6NVK0|Q8IZ98|Q9BZC2|Q9HB30	Silent	SNP	ENST00000290583.4	hg19	CCDS1002.1	.	.	.	.	.	.	.	.	.	.	.	6.031	0.374049	0.11409	.	.	ENSG00000159409	ENST00000420342	.	.	.	4.11	2.19	0.27852	.	.	.	.	.	T	0.38719	0.1051	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.23583	-1.0184	4	.	.	.	-4.4657	5.9572	0.19279	0.0:0.755:0.0:0.245	.	.	.	.	N	368	.	.	S	-	2	0	CELF3	149945349	0.942000	0.31987	1.000000	0.80357	0.747000	0.42532	-0.032000	0.12266	0.496000	0.27904	-0.258000	0.10820	AGC	.	.		0.657	CELF3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000036663.2	NM_007185	
OR10J1	26476	hgsc.bcm.edu	37	1	159409832	159409832	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A8HS-01A-11D-A35Z-10	TCGA-CC-A8HS-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	eec73def-9c6d-487a-b4b5-d9e879138027	4de9ebd4-2594-4178-b695-344708a55698	g.chr1:159409832G>T	ENST00000423932.3	+	1	321	c.284G>T	c.(283-285)aGc>aTc	p.S95I	RP11-550P17.5_ENST00000431862.1_RNA	NM_012351.2	NP_036483.2	P30954	O10J1_HUMAN	olfactory receptor, family 10, subfamily J, member 1	95					G-protein coupled receptor signaling pathway (GO:0007186)|sensory perception of chemical stimulus (GO:0007606)|single fertilization (GO:0007338)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|kidney(1)|large_intestine(5)|lung(13)|ovary(1)|skin(2)|stomach(1)	25	all_hematologic(112;0.0429)					ATGCTCTCCAGCCTCGTAGGT	0.468																																					p.S95I		Atlas-SNP	.											.	OR10J1	118	.	0			c.G284T						.						105.0	92.0	96.0					1																	159409832		2203	4300	6503	SO:0001583	missense	26476	exon1			TCTCCAGCCTCGT	X64995	CCDS1185.1	1q23.2	2012-08-09			ENSG00000196184	ENSG00000196184		"""GPCR / Class A : Olfactory receptors"""	8175	protein-coding gene	gene with protein product						1370859	Standard	NM_012351		Approved	HGMP07J, HSHGMP07J	uc010piv.2	P30954	OTTHUMG00000022737	ENST00000423932.3:c.284G>T	chr1.hg19:g.159409832G>T	ENSP00000399078:p.Ser95Ile	101.0	0.0		166.0	7.0	NM_012351	Q2M1M8|Q5VSV1|Q6IET5|Q96R56	Missense_Mutation	SNP	ENST00000423932.3	hg19	CCDS1185.1	.	.	.	.	.	.	.	.	.	.	G	13.65	2.299844	0.40694	.	.	ENSG00000196184	ENST00000423932	T	0.00411	7.53	4.48	2.99	0.34606	GPCR, rhodopsin-like superfamily (1);	0.132994	0.34314	N	0.004077	T	0.00144	0.0004	N	0.11789	0.175	0.09310	N	1	P	0.49447	0.924	P	0.55345	0.774	T	0.40979	-0.9534	10	0.87932	D	0	.	3.7354	0.08508	0.1838:0.0:0.6112:0.205	.	95	P30954	O10J1_HUMAN	I	95	ENSP00000399078:S95I	ENSP00000399078:S95I	S	+	2	0	OR10J1	157676456	0.000000	0.05858	0.673000	0.29887	0.698000	0.40448	-0.517000	0.06275	0.736000	0.32559	0.655000	0.94253	AGC	.	.		0.468	OR10J1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059020.1	NM_012351	
PTPRC	5788	hgsc.bcm.edu	37	1	198698298	198698298	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A8HS-01A-11D-A35Z-10	TCGA-CC-A8HS-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	eec73def-9c6d-487a-b4b5-d9e879138027	4de9ebd4-2594-4178-b695-344708a55698	g.chr1:198698298G>A	ENST00000367376.2	+	17	2027	c.1856G>A	c.(1855-1857)aGg>aAg	p.R619K	PTPRC_ENST00000442510.2_Missense_Mutation_p.R621K|PTPRC_ENST00000352140.3_Missense_Mutation_p.R571K|PTPRC_ENST00000348564.6_Missense_Mutation_p.R460K|PTPRC_ENST00000594404.1_Missense_Mutation_p.R458K	NM_002838.4	NP_002829.3	P08575	PTPRC_HUMAN	protein tyrosine phosphatase, receptor type, C	619					axon guidance (GO:0007411)|B cell proliferation (GO:0042100)|B cell receptor signaling pathway (GO:0050853)|bone marrow development (GO:0048539)|cell cycle phase transition (GO:0044770)|cell surface receptor signaling pathway (GO:0007166)|defense response to virus (GO:0051607)|dephosphorylation (GO:0016311)|hematopoietic progenitor cell differentiation (GO:0002244)|immunoglobulin biosynthetic process (GO:0002378)|negative regulation of cell adhesion involved in substrate-bound cell migration (GO:0006933)|negative regulation of cytokine-mediated signaling pathway (GO:0001960)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of T cell mediated cytotoxicity (GO:0001915)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of antigen receptor-mediated signaling pathway (GO:0050857)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of hematopoietic stem cell migration (GO:2000473)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of stem cell proliferation (GO:2000648)|positive regulation of T cell proliferation (GO:0042102)|protein dephosphorylation (GO:0006470)|regulation of cell cycle (GO:0051726)|release of sequestered calcium ion into cytosol (GO:0051209)|stem cell development (GO:0048864)|T cell differentiation (GO:0030217)|T cell receptor signaling pathway (GO:0050852)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(7)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(22)|lung(41)|ovary(4)|pancreas(2)|prostate(1)|skin(13)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(3)	111						CTTGTTGAAAGGGGTAAGTAT	0.279																																					p.R621K		Atlas-SNP	.											.	PTPRC	229	.	0			c.G1862A						.						95.0	99.0	98.0					1																	198698298		2203	4300	6503	SO:0001583	missense	5788	exon17			TTGAAAGGGGTAA	Y00062	CCDS1397.1, CCDS1398.1, CCDS44291.1, CCDS1397.2, CCDS1398.2, CCDS44291.2	1q31-q32	2014-09-17			ENSG00000081237	ENSG00000081237		"""CD molecules"", ""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9666	protein-coding gene	gene with protein product		151460		CD45		2169617	Standard	NM_001267798		Approved	LCA, T200, GP180	uc001gur.2	P08575	OTTHUMG00000035702	ENST00000367376.2:c.1856G>A	chr1.hg19:g.198698298G>A	ENSP00000356346:p.Arg619Lys	312.0	0.0		431.0	247.0	NM_002838	A8K7W6|Q16614|Q9H0Y6	Missense_Mutation	SNP	ENST00000367376.2	hg19		.	.	.	.	.	.	.	.	.	.	G	12.49	1.953134	0.34471	.	.	ENSG00000081237	ENST00000367376;ENST00000367366;ENST00000352140;ENST00000535566;ENST00000530727;ENST00000442510;ENST00000367367;ENST00000348564	T	0.02369	4.32	5.37	4.45	0.53987	.	0.275703	0.25925	N	0.027419	T	0.02727	0.0082	L	0.36672	1.1	0.40426	D	0.979895	B;B;B;B;B	0.23806	0.019;0.091;0.001;0.002;0.004	B;B;B;B;B	0.21708	0.034;0.036;0.01;0.01;0.01	T	0.39820	-0.9595	10	0.08381	T	0.77	.	11.3741	0.49717	0.0856:0.0:0.9144:0.0	.	555;555;460;571;619	F5GXZ3;B4DSZ5;B1ALS3;E9PC28;P08575	.;.;.;.;PTPRC_HUMAN	K	621;555;571;571;505;619;553;458	ENSP00000193532:R571K	ENSP00000306782:R458K	R	+	2	0	PTPRC	196964921	1.000000	0.71417	1.000000	0.80357	0.823000	0.46562	2.000000	0.40816	1.406000	0.46857	0.650000	0.86243	AGG	.	.		0.279	PTPRC-202	KNOWN	basic|appris_candidate	protein_coding	protein_coding			
KIF26B	55083	hgsc.bcm.edu	37	1	245771032	245771032	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A8HS-01A-11D-A35Z-10	TCGA-CC-A8HS-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	eec73def-9c6d-487a-b4b5-d9e879138027	4de9ebd4-2594-4178-b695-344708a55698	g.chr1:245771032G>A	ENST00000407071.2	+	7	2077	c.1637G>A	c.(1636-1638)gGc>gAc	p.G546D	KIF26B_ENST00000366518.4_Missense_Mutation_p.G165D	NM_018012.3	NP_060482.2	Q2KJY2	KI26B_HUMAN	kinesin family member 26B	546	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				establishment of cell polarity (GO:0030010)|metabolic process (GO:0008152)|positive regulation of cell-cell adhesion (GO:0022409)|ureteric bud invasion (GO:0072092)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(21)|ovary(4)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	51	all_cancers(71;3.86e-05)|all_epithelial(71;0.000121)|Ovarian(71;0.0412)|all_lung(81;0.0498)|Lung NSC(105;0.0708)|Breast(184;0.127)		OV - Ovarian serous cystadenocarcinoma(106;0.022)			TTCTGTTTCGGCCACGCCAAA	0.567																																					p.G546D		Atlas-SNP	.											.	KIF26B	343	.	0			c.G1637A						.						88.0	103.0	98.0					1																	245771032		2136	4239	6375	SO:0001583	missense	55083	exon7			GTTTCGGCCACGC	AK001019	CCDS44342.1	1q44	2008-02-05			ENSG00000162849	ENSG00000162849		"""Kinesins"""	25484	protein-coding gene	gene with protein product		614026					Standard	NM_018012		Approved	FLJ10157	uc001ibf.1	Q2KJY2	OTTHUMG00000040079	ENST00000407071.2:c.1637G>A	chr1.hg19:g.245771032G>A	ENSP00000385545:p.Gly546Asp	79.0	0.0		99.0	59.0	NM_018012	Q6ZQR9|Q6ZUZ0|Q8IUN3|Q8IVR1|Q9NWB4	Missense_Mutation	SNP	ENST00000407071.2	hg19	CCDS44342.1	.	.	.	.	.	.	.	.	.	.	G	24.7	4.564695	0.86439	.	.	ENSG00000162849	ENST00000407071;ENST00000366518;ENST00000413001	T;T	0.79749	-1.3;-1.3	5.73	5.73	0.89815	Kinesin, motor domain (5);	.	.	.	.	D	0.94634	0.8270	H	0.98701	4.305	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	D	0.96404	0.9299	9	0.87932	D	0	.	19.9747	0.97299	0.0:0.0:1.0:0.0	.	165;546	B7WPD9;Q2KJY2	.;KI26B_HUMAN	D	546;165;162	ENSP00000385545:G546D;ENSP00000355475:G165D	ENSP00000355475:G165D	G	+	2	0	KIF26B	243837655	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	9.869000	0.99810	2.715000	0.92844	0.551000	0.68910	GGC	.	.		0.567	KIF26B-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381037.1	XM_371354	
OR6F1	343169	hgsc.bcm.edu	37	1	247875822	247875822	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A8HS-01A-11D-A35Z-10	TCGA-CC-A8HS-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	eec73def-9c6d-487a-b4b5-d9e879138027	4de9ebd4-2594-4178-b695-344708a55698	g.chr1:247875822G>A	ENST00000302084.2	-	1	283	c.236C>T	c.(235-237)cCc>cTc	p.P79L	RP11-634B7.4_ENST00000449298.1_RNA	NM_001005286.1	NP_001005286.1	Q8NGZ6	OR6F1_HUMAN	olfactory receptor, family 6, subfamily F, member 1	79						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|kidney(1)|large_intestine(5)|lung(34)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)	47	all_cancers(71;3.24e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)		OV - Ovarian serous cystadenocarcinoma(106;0.0168)			CAGTGCTTTGGGCACTGCTGC	0.473																																					p.P79L		Atlas-SNP	.											.	OR6F1	88	.	0			c.C236T						.						111.0	111.0	111.0					1																	247875822		2203	4300	6503	SO:0001583	missense	343169	exon1			GCTTTGGGCACTG	BK004460	CCDS31095.1	1q44	2012-08-09			ENSG00000169214	ENSG00000169214		"""GPCR / Class A : Olfactory receptors"""	15027	protein-coding gene	gene with protein product							Standard	NM_001005286		Approved	OST731	uc001idj.1	Q8NGZ6	OTTHUMG00000040213	ENST00000302084.2:c.236C>T	chr1.hg19:g.247875822G>A	ENSP00000305640:p.Pro79Leu	70.0	0.0		87.0	22.0	NM_001005286	B2RNV6|Q6IF02|Q96R39	Missense_Mutation	SNP	ENST00000302084.2	hg19	CCDS31095.1	.	.	.	.	.	.	.	.	.	.	G	16.08	3.020799	0.54576	.	.	ENSG00000169214	ENST00000302084	T	0.01854	4.6	3.99	3.99	0.46301	GPCR, rhodopsin-like superfamily (1);	0.000000	0.43416	D	0.000567	T	0.18923	0.0454	H	0.94620	3.56	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.14200	-1.0481	10	0.87932	D	0	-56.0078	15.174	0.72896	0.0:0.0:1.0:0.0	.	79	Q8NGZ6	OR6F1_HUMAN	L	79	ENSP00000305640:P79L	ENSP00000305640:P79L	P	-	2	0	OR6F1	245942445	1.000000	0.71417	0.971000	0.41717	0.013000	0.08279	5.044000	0.64214	2.209000	0.71365	0.591000	0.81541	CCC	.	.		0.473	OR6F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096870.1	NM_001005286	
OR2T4	127074	hgsc.bcm.edu	37	1	248525807	248525807	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A8HS-01A-11D-A35Z-10	TCGA-CC-A8HS-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	eec73def-9c6d-487a-b4b5-d9e879138027	4de9ebd4-2594-4178-b695-344708a55698	g.chr1:248525807T>C	ENST00000366475.1	+	1	925	c.925T>C	c.(925-927)Ttc>Ctc	p.F309L		NM_001004696.1	NP_001004696.1	Q8NH00	OR2T4_HUMAN	olfactory receptor, family 2, subfamily T, member 4	309						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(3)|liver(2)|lung(47)	56	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			GGTATCTGTCTTCTATACCAT	0.488																																					p.F309L		Atlas-SNP	.											.	OR2T4	126	.	0			c.T925C						.						144.0	142.0	143.0					1																	248525807		2203	4300	6503	SO:0001583	missense	127074	exon1			TCTGTCTTCTATA	BK004464	CCDS31113.1	1q44	2012-08-09			ENSG00000196944	ENSG00000196944		"""GPCR / Class A : Olfactory receptors"""	15016	protein-coding gene	gene with protein product							Standard	NM_001004696		Approved	OR2T4Q	uc001ieh.1	Q8NH00	OTTHUMG00000040453	ENST00000366475.1:c.925T>C	chr1.hg19:g.248525807T>C	ENSP00000355431:p.Phe309Leu	716.0	0.0		792.0	234.0	NM_001004696	Q6IEZ8	Missense_Mutation	SNP	ENST00000366475.1	hg19	CCDS31113.1	.	.	.	.	.	.	.	.	.	.	T	14.99	2.700971	0.48307	.	.	ENSG00000196944	ENST00000366475	T	0.00032	8.88	3.0	1.8	0.24995	GPCR, rhodopsin-like superfamily (1);	0.147942	0.31636	N	0.007317	T	0.00144	0.0004	L	0.37630	1.12	0.09310	N	1	P	0.40180	0.705	P	0.46975	0.533	T	0.32107	-0.9919	10	0.62326	D	0.03	.	4.8151	0.13363	0.0:0.4364:0.0:0.5636	.	309	Q8NH00	OR2T4_HUMAN	L	309	ENSP00000355431:F309L	ENSP00000355431:F309L	F	+	1	0	OR2T4	246592430	0.000000	0.05858	1.000000	0.80357	0.674000	0.39518	-0.523000	0.06230	1.228000	0.43614	0.477000	0.44152	TTC	.	.		0.488	OR2T4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097349.2	NM_001004696	
NRXN1	9378	hgsc.bcm.edu	37	2	50280467	50280467	+	Missense_Mutation	SNP	G	G	C	rs200974417		TCGA-CC-A8HS-01A-11D-A35Z-10	TCGA-CC-A8HS-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	eec73def-9c6d-487a-b4b5-d9e879138027	4de9ebd4-2594-4178-b695-344708a55698	g.chr2:50280467G>C	ENST00000406316.2	-	20	5456	c.3980C>G	c.(3979-3981)aCc>aGc	p.T1327S	NRXN1_ENST00000401669.2_Missense_Mutation_p.T1357S|NRXN1_ENST00000404971.1_Missense_Mutation_p.T1397S|NRXN1_ENST00000402717.3_Missense_Mutation_p.T1349S|NRXN1_ENST00000342183.5_Missense_Mutation_p.T292S|NRXN1_ENST00000405472.3_Missense_Mutation_p.T1349S|NRXN1_ENST00000406859.3_Missense_Mutation_p.T1327S|NRXN1_ENST00000401710.1_Missense_Mutation_p.T345S	NM_004801.4	NP_004792.1	Q9ULB1	NRX1A_HUMAN	neurexin 1	1327	Poly-Thr.				adult behavior (GO:0030534)|axon guidance (GO:0007411)|calcium-dependent cell-cell adhesion (GO:0016339)|cerebellar granule cell differentiation (GO:0021707)|establishment of protein localization (GO:0045184)|extracellular matrix organization (GO:0030198)|gamma-aminobutyric acid receptor clustering (GO:0097112)|gephyrin clustering (GO:0097116)|guanylate kinase-associated protein clustering (GO:0097117)|heterophilic cell-cell adhesion (GO:0007157)|learning (GO:0007612)|N-methyl-D-aspartate receptor clustering (GO:0097114)|negative regulation of filopodium assembly (GO:0051490)|neuroligin clustering (GO:0097118)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|neuron maturation (GO:0042551)|neurotransmitter secretion (GO:0007269)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|receptor localization to synapse (GO:0097120)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic vesicle clustering (GO:0097091)|vocal learning (GO:0042297)|vocalization behavior (GO:0071625)	axonal growth cone (GO:0044295)|cell junction (GO:0030054)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	acetylcholine receptor binding (GO:0033130)|calcium channel regulator activity (GO:0005246)|calcium ion binding (GO:0005509)|cell adhesion molecule binding (GO:0050839)|neuroligin family protein binding (GO:0097109)|receptor activity (GO:0004872)			breast(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(33)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	58		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)			AGTAGCCAGGGTCGTGGTAGT	0.473																																					p.T1397S		Atlas-SNP	.											.	NRXN1	1118	.	0			c.C4190G						.						136.0	133.0	134.0					2																	50280467		2203	4300	6503	SO:0001583	missense	9378	exon22			GCCAGGGTCGTGG	AB011150	CCDS1845.1, CCDS46282.1, CCDS54360.1	2p16.3	2008-05-15			ENSG00000179915	ENSG00000179915			8008	protein-coding gene	gene with protein product		600565					Standard	NM_001135659		Approved	KIAA0578, Hs.22998	uc021vhj.1	P58400	OTTHUMG00000129263	ENST00000406316.2:c.3980C>G	chr2.hg19:g.50280467G>C	ENSP00000384311:p.Thr1327Ser	84.0	0.0		77.0	30.0	NM_001135659	A7KRL9|O60323|Q53TJ9|Q53TQ1|Q9C079|Q9C080|Q9C081|Q9H3M2|Q9UDM6	Missense_Mutation	SNP	ENST00000406316.2	hg19	CCDS54360.1	.	.	.	.	.	.	.	.	.	.	G	20.9	4.061504	0.76187	.	.	ENSG00000179915	ENST00000342183;ENST00000536347;ENST00000401710;ENST00000404971;ENST00000406316;ENST00000405472;ENST00000401669;ENST00000536085;ENST00000402717;ENST00000406859	T;T;T;T;T;T;T;T	0.73152	0.79;1.96;-0.0;-0.07;-0.72;-0.61;-0.33;-0.21	5.5	5.5	0.81552	.	0.217355	0.28098	U	0.016618	T	0.80188	0.4577	M	0.72118	2.19	0.44946	D	0.997961	P;D;B;B	0.55172	0.889;0.97;0.324;0.068	P;P;B;B	0.53102	0.686;0.718;0.389;0.097	T	0.81938	-0.0704	10	0.62326	D	0.03	.	19.3964	0.94608	0.0:0.0:1.0:0.0	.	1397;292;1327;1349	Q9ULB1-3;P58400;F8WB18;A7E294	.;NRX1B_HUMAN;.;.	S	292;246;345;1397;1327;1349;1357;1398;1349;1327	ENSP00000341184:T292S;ENSP00000385580:T345S;ENSP00000385142:T1397S;ENSP00000384311:T1327S;ENSP00000434015:T1349S;ENSP00000385017:T1357S;ENSP00000385434:T1349S;ENSP00000385681:T1327S	ENSP00000341184:T292S	T	-	2	0	NRXN1	50133971	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	9.866000	0.99616	2.582000	0.87167	0.655000	0.94253	ACC	.	.		0.473	NRXN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000325291.2		
AAK1	22848	hgsc.bcm.edu	37	2	69784077	69784077	+	Missense_Mutation	SNP	C	C	T	rs371902412		TCGA-CC-A8HS-01A-11D-A35Z-10	TCGA-CC-A8HS-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	eec73def-9c6d-487a-b4b5-d9e879138027	4de9ebd4-2594-4178-b695-344708a55698	g.chr2:69784077C>T	ENST00000409085.4	-	3	573	c.197G>A	c.(196-198)aGc>aAc	p.S66N	AAK1_ENST00000406297.3_Missense_Mutation_p.S66N|AAK1_ENST00000409068.1_Missense_Mutation_p.S66N	NM_014911.3	NP_055726	Q2M2I8	AAK1_HUMAN	AP2 associated kinase 1	66	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				endocytosis (GO:0006897)|positive regulation of Notch signaling pathway (GO:0045747)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|protein stabilization (GO:0050821)|regulation of clathrin-mediated endocytosis (GO:2000369)|regulation of protein localization (GO:0032880)	cell leading edge (GO:0031252)|clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|extrinsic component of plasma membrane (GO:0019897)|terminal bouton (GO:0043195)	AP-2 adaptor complex binding (GO:0035612)|ATP binding (GO:0005524)|Notch binding (GO:0005112)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(6)|prostate(1)	17						CATCCCATTGCTTGTCCTCAC	0.433																																					p.S66N		Atlas-SNP	.											.	AAK1	121	.	0			c.G197A						.	C	ASN/SER	0,3984		0,0,1992	133.0	121.0	125.0		197	5.2	1.0	2		125	1,8365		0,1,4182	no	missense	AAK1	NM_014911.3	46	0,1,6174	TT,TC,CC		0.012,0.0,0.0081	benign	66/962	69784077	1,12349	1992	4183	6175	SO:0001583	missense	22848	exon3			CCATTGCTTGTCC	AB028971	CCDS1893.2	2p13.3	2012-07-10			ENSG00000115977	ENSG00000115977			19679	protein-coding gene	gene with protein product						11877461, 12471243	Standard	NM_014911		Approved	KIAA1048, DKFZp686K16132	uc002sfp.2	Q2M2I8	OTTHUMG00000129648	ENST00000409085.4:c.197G>A	chr2.hg19:g.69784077C>T	ENSP00000386456:p.Ser66Asn	75.0	0.0		84.0	33.0	NM_014911	Q4ZFZ3|Q53RX6|Q9UPV4	Missense_Mutation	SNP	ENST00000409085.4	hg19	CCDS1893.2	.	.	.	.	.	.	.	.	.	.	C	11.49	1.653154	0.29425	0.0	1.2E-4	ENSG00000115977	ENST00000409068;ENST00000409085;ENST00000406297	T;T;T	0.29397	1.57;1.57;1.57	5.25	5.25	0.73442	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.248350	0.47093	D	0.000254	T	0.21801	0.0525	N	0.11927	0.2	0.35491	D	0.799012	B;B;B;B	0.25007	0.052;0.052;0.042;0.116	B;B;B;B	0.30401	0.055;0.115;0.07;0.057	T	0.20107	-1.0285	10	0.33141	T	0.24	-12.2002	16.3823	0.83472	0.0:1.0:0.0:0.0	.	66;66;66;66	B7ZLC4;D6W5G0;Q2M2I8-2;Q2M2I8	.;.;.;AAK1_HUMAN	N	66	ENSP00000386342:S66N;ENSP00000386456:S66N;ENSP00000385181:S66N	ENSP00000385181:S66N	S	-	2	0	AAK1	69637581	1.000000	0.71417	1.000000	0.80357	0.925000	0.55904	2.452000	0.44961	2.724000	0.93272	0.655000	0.94253	AGC	.	.		0.433	AAK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251847.4	NM_014911	
SPEG	10290	hgsc.bcm.edu	37	2	220352988	220352988	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A8HS-01A-11D-A35Z-10	TCGA-CC-A8HS-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	eec73def-9c6d-487a-b4b5-d9e879138027	4de9ebd4-2594-4178-b695-344708a55698	g.chr2:220352988G>A	ENST00000312358.7	+	32	7946	c.7814G>A	c.(7813-7815)tGc>tAc	p.C2605Y	AC053503.11_ENST00000429882.1_RNA|SPEG_ENST00000485813.1_3'UTR	NM_005876.4	NP_005867.3	Q15772	SPEG_HUMAN	SPEG complex locus	2605	Ig-like 9.				cardiac muscle cell development (GO:0055013)|in utero embryonic development (GO:0001701)|muscle organ development (GO:0007517)|negative regulation of cell proliferation (GO:0008285)|respiratory system development (GO:0060541)	nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|central_nervous_system(3)|endometrium(10)|kidney(2)|large_intestine(9)|lung(42)|ovary(5)|pancreas(1)|prostate(8)|skin(1)|stomach(9)|upper_aerodigestive_tract(4)|urinary_tract(4)	100		Renal(207;0.0183)		Epithelial(149;4.5e-10)|all cancers(144;7.93e-08)|Lung(261;0.00639)|LUSC - Lung squamous cell carcinoma(224;0.00829)|READ - Rectum adenocarcinoma(5;0.163)		ACCCTGCTCTGCCTGCCAGCG	0.612																																					p.C2605Y		Atlas-SNP	.											.	SPEG	272	.	0			c.G7814A						.						53.0	57.0	55.0					2																	220352988		2053	4206	6259	SO:0001583	missense	10290	exon32			TGCTCTGCCTGCC	BC006346	CCDS42824.1, CCDS54432.1	2q35	2013-01-11	2006-04-27	2006-04-27	ENSG00000072195	ENSG00000072195		"""Immunoglobulin superfamily / I-set domain containing"""	16901	protein-coding gene	gene with protein product		615950	"""aortic preferentially expressed gene 1"""	APEG1		8663449, 10973969	Standard	NM_005876		Approved	MGC12676, KIAA1297, SPEGalpha, SPEGbeta, BPEG	uc010fwg.3	Q15772	OTTHUMG00000058925	ENST00000312358.7:c.7814G>A	chr2.hg19:g.220352988G>A	ENSP00000311684:p.Cys2605Tyr	55.0	0.0		67.0	32.0	NM_005876	A8K0G6|A8MRU0|Q27J74|Q695L1|Q6FGA6|Q6ZQW1|Q6ZTL8|Q9P2P9	Missense_Mutation	SNP	ENST00000312358.7	hg19	CCDS42824.1	.	.	.	.	.	.	.	.	.	.	G	16.53	3.149030	0.57151	.	.	ENSG00000072195	ENST00000312358;ENST00000265327	D	0.84873	-1.91	4.89	4.89	0.63831	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.42682	D	0.000670	D	0.95582	0.8564	H	0.98027	4.13	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.97596	1.0120	10	0.87932	D	0	.	18.0612	0.89378	0.0:0.0:1.0:0.0	.	2605	Q15772	SPEG_HUMAN	Y	2605	ENSP00000311684:C2605Y	ENSP00000265327:C2605Y	C	+	2	0	SPEG	220061232	1.000000	0.71417	1.000000	0.80357	0.716000	0.41182	9.697000	0.98697	2.282000	0.76494	0.591000	0.81541	TGC	.	.		0.612	SPEG-004	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000130252.2	NM_005876	
C2orf57	165100	hgsc.bcm.edu	37	2	232458829	232458829	+	Silent	SNP	G	G	A			TCGA-CC-A8HS-01A-11D-A35Z-10	TCGA-CC-A8HS-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	eec73def-9c6d-487a-b4b5-d9e879138027	4de9ebd4-2594-4178-b695-344708a55698	g.chr2:232458829G>A	ENST00000313965.2	+	1	1255	c.1167G>A	c.(1165-1167)caG>caA	p.Q389Q		NM_152614.2	NP_689827.2	Q53QW1	CB057_HUMAN	chromosome 2 open reading frame 57	389										endometrium(1)|kidney(2)|large_intestine(1)|lung(7)|ovary(1)|pancreas(1)|prostate(4)|skin(2)	19		Renal(207;0.025)|all_hematologic(139;0.0735)|Acute lymphoblastic leukemia(138;0.164)		Epithelial(121;1.33e-11)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(119;0.014)		GCCAGGCCCAGGCTGACCCCA	0.657																																					p.Q389Q		Atlas-SNP	.											.	C2orf57	35	.	0			c.G1167A						.						31.0	30.0	30.0					2																	232458829		2202	4300	6502	SO:0001819	synonymous_variant	165100	exon1			GGCCCAGGCTGAC	BC034405	CCDS2487.1	2q37.1	2008-02-05			ENSG00000177673	ENSG00000177673			28563	protein-coding gene	gene with protein product						12477932	Standard	NM_152614		Approved	MGC35154	uc002vrz.3	Q53QW1	OTTHUMG00000133226	ENST00000313965.2:c.1167G>A	chr2.hg19:g.232458829G>A		107.0	0.0		74.0	35.0	NM_152614	Q8N4F2	Silent	SNP	ENST00000313965.2	hg19	CCDS2487.1																																																																																			.	.		0.657	C2orf57-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256962.1	NM_152614	
SUSD5	26032	hgsc.bcm.edu	37	3	33194727	33194727	+	Missense_Mutation	SNP	G	G	A	rs377664152		TCGA-CC-A8HS-01A-11D-A35Z-10	TCGA-CC-A8HS-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	eec73def-9c6d-487a-b4b5-d9e879138027	4de9ebd4-2594-4178-b695-344708a55698	g.chr3:33194727G>A	ENST00000309558.3	-	5	1814	c.1397C>T	c.(1396-1398)aCg>aTg	p.T466M		NM_015551.1	NP_056366.1	O60279	SUSD5_HUMAN	sushi domain containing 5	466					cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)	hyaluronic acid binding (GO:0005540)			breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(4)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	24						CTGGTACTTCGTCAAGTCACC	0.507																																					p.T466M		Atlas-SNP	.											.	SUSD5	53	.	0			c.C1397T						.	G	MET/THR	1,4017		0,1,2008	93.0	94.0	94.0		1397	2.1	0.0	3		94	0,8356		0,0,4178	no	missense	SUSD5	NM_015551.1	81	0,1,6186	AA,AG,GG		0.0,0.0249,0.0081	possibly-damaging	466/630	33194727	1,12373	2009	4178	6187	SO:0001583	missense	26032	exon5			TACTTCGTCAAGT	AB011099	CCDS46787.1	3p23	2014-02-12	2006-01-13		ENSG00000173705	ENSG00000173705			29061	protein-coding gene	gene with protein product							Standard	NM_015551		Approved	KIAA0527	uc003cfo.1	O60279	OTTHUMG00000155829	ENST00000309558.3:c.1397C>T	chr3.hg19:g.33194727G>A	ENSP00000308727:p.Thr466Met	67.0	0.0		48.0	12.0	NM_015551		Missense_Mutation	SNP	ENST00000309558.3	hg19	CCDS46787.1	.	.	.	.	.	.	.	.	.	.	G	13.46	2.245184	0.39697	2.49E-4	0.0	ENSG00000173705	ENST00000309558	T	0.08102	3.13	5.29	2.06	0.26882	.	0.514704	0.18978	N	0.125958	T	0.07593	0.0191	L	0.57536	1.79	0.09310	N	1	B	0.30211	0.273	B	0.20184	0.028	T	0.25916	-1.0118	10	0.72032	D	0.01	-6.1251	4.3885	0.11328	0.1302:0.1397:0.5873:0.1428	.	466	O60279	SUSD5_HUMAN	M	466	ENSP00000308727:T466M	ENSP00000308727:T466M	T	-	2	0	SUSD5	33169731	0.001000	0.12720	0.009000	0.14445	0.696000	0.40369	0.703000	0.25646	1.206000	0.43276	0.650000	0.86243	ACG	.	.		0.507	SUSD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341902.1	XM_171054	
HTR1F	3355	hgsc.bcm.edu	37	3	88040772	88040772	+	Silent	SNP	A	A	G			TCGA-CC-A8HS-01A-11D-A35Z-10	TCGA-CC-A8HS-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	eec73def-9c6d-487a-b4b5-d9e879138027	4de9ebd4-2594-4178-b695-344708a55698	g.chr3:88040772A>G	ENST00000319595.4	+	1	927	c.873A>G	c.(871-873)gcA>gcG	p.A291A		NM_000866.3	NP_000857.1	P30939	5HT1F_HUMAN	5-hydroxytryptamine (serotonin) receptor 1F, G protein-coupled	291					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|serotonin receptor signaling pathway (GO:0007210)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	serotonin binding (GO:0051378)|serotonin receptor activity (GO:0004993)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(12)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	25	all_cancers(8;0.147)	Lung NSC(201;0.0283)		LUSC - Lung squamous cell carcinoma(29;0.00353)|Lung(72;0.00664)	Eletriptan(DB00216)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Ketamine(DB01221)|Methysergide(DB00247)|Mianserin(DB06148)|Naratriptan(DB00952)|Rizatriptan(DB00953)|Sumatriptan(DB00669)|Zolmitriptan(DB00315)	AACGGAAAGCAGCCACTACCC	0.363																																					p.A291A		Atlas-SNP	.											.	HTR1F	66	.	0			c.A873G						.						70.0	80.0	76.0					3																	88040772		2203	4300	6503	SO:0001819	synonymous_variant	3355	exon2			GAAAGCAGCCACT	L05597	CCDS2920.1	3p12	2012-08-08	2012-02-03		ENSG00000179097	ENSG00000179097		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5292	protein-coding gene	gene with protein product		182134	"""5-hydroxytryptamine (serotonin) receptor 1F"""			8384716, 8380639	Standard	NM_000866		Approved	HTR1EL, 5-HT1F	uc003dqr.2	P30939	OTTHUMG00000159008	ENST00000319595.4:c.873A>G	chr3.hg19:g.88040772A>G		91.0	0.0		87.0	29.0	NM_000866		Silent	SNP	ENST00000319595.4	hg19	CCDS2920.1																																																																																			.	.		0.363	HTR1F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352890.1	NM_000866	
BOC	91653	hgsc.bcm.edu	37	3	112991482	112991482	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A8HS-01A-11D-A35Z-10	TCGA-CC-A8HS-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	eec73def-9c6d-487a-b4b5-d9e879138027	4de9ebd4-2594-4178-b695-344708a55698	g.chr3:112991482G>A	ENST00000495514.1	+	7	1597	c.893G>A	c.(892-894)cGc>cAc	p.R298H	BOC_ENST00000273395.4_Missense_Mutation_p.R298H|BOC_ENST00000355385.3_Missense_Mutation_p.R298H			Q9BWV1	BOC_HUMAN	BOC cell adhesion associated, oncogene regulated	298	Ig-like C2-type 3.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|muscle cell differentiation (GO:0042692)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of myoblast differentiation (GO:0045663)|smoothened signaling pathway (GO:0007224)	axonal growth cone (GO:0044295)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)				NS(1)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(17)|lung(18)|ovary(4)|pancreas(1)|prostate(2)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	68			Epithelial(53;0.227)			GGCACCTACCGCTGCATGGCC	0.602																																					p.R298H		Atlas-SNP	.											.	BOC	139	.	0			c.G893A						.						106.0	94.0	98.0					3																	112991482		2203	4300	6503	SO:0001583	missense	91653	exon7			CCTACCGCTGCAT	AY027658	CCDS2971.1	3q13.2	2013-02-11	2012-12-07		ENSG00000144857	ENSG00000144857		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	17173	protein-coding gene	gene with protein product	"""brother of CDO"", ""brother of CDON"", ""cell adhesion associated, oncogene regulated 2"""	608708	"""Boc homolog (mouse)"""			11782431	Standard	NM_033254		Approved	CDON2	uc003dzy.3	Q9BWV1	OTTHUMG00000159305	ENST00000495514.1:c.893G>A	chr3.hg19:g.112991482G>A	ENSP00000418663:p.Arg298His	120.0	0.0		95.0	22.0	NM_033254	A6NJ30|B2RMS8|D3DN70|Q6UXJ5|Q8N2P7|Q8NF26	Missense_Mutation	SNP	ENST00000495514.1	hg19	CCDS2971.1	.	.	.	.	.	.	.	.	.	.	g	19.88	3.910048	0.72983	.	.	ENSG00000144857	ENST00000495514;ENST00000273395;ENST00000355385	T;T;T	0.30981	1.51;1.51;1.51	5.92	5.05	0.67936	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.407363	0.26911	N	0.021874	T	0.37461	0.1004	L	0.35341	1.055	0.27754	N	0.944064	D;D	0.61697	0.987;0.99	P;P	0.59595	0.781;0.86	T	0.16276	-1.0408	10	0.37606	T	0.19	.	10.8782	0.46923	0.0678:0.1293:0.8028:0.0	.	298;298	Q9BWV1-3;Q9BWV1	.;BOC_HUMAN	H	298	ENSP00000418663:R298H;ENSP00000273395:R298H;ENSP00000347546:R298H	ENSP00000273395:R298H	R	+	2	0	BOC	114474172	1.000000	0.71417	1.000000	0.80357	0.793000	0.44817	2.175000	0.42491	1.530000	0.49136	-0.127000	0.14921	CGC	.	.		0.602	BOC-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000354485.3	NM_033254	
GPR149	344758	hgsc.bcm.edu	37	3	154146570	154146570	+	Missense_Mutation	SNP	C	C	G			TCGA-CC-A8HS-01A-11D-A35Z-10	TCGA-CC-A8HS-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	eec73def-9c6d-487a-b4b5-d9e879138027	4de9ebd4-2594-4178-b695-344708a55698	g.chr3:154146570C>G	ENST00000389740.2	-	1	934	c.835G>C	c.(835-837)Gcg>Ccg	p.A279P		NM_001038705.1	NP_001033794.1	Q86SP6	GP149_HUMAN	G protein-coupled receptor 149	279					antral ovarian follicle growth (GO:0001547)|estrous cycle phase (GO:0060206)|negative regulation of ovulation (GO:0060280)|preantral ovarian follicle growth (GO:0001546)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			autonomic_ganglia(1)|breast(1)|endometrium(4)|kidney(2)|large_intestine(6)|lung(22)|ovary(7)|prostate(1)|skin(1)|urinary_tract(2)	47			LUSC - Lung squamous cell carcinoma(72;0.114)|Lung(72;0.173)			GCAGCGGGCGCACCCGGTCCG	0.682																																					p.A279P		Atlas-SNP	.											.	GPR149	134	.	0			c.G835C						.						34.0	37.0	36.0					3																	154146570		1898	4116	6014	SO:0001583	missense	344758	exon1			CGGGCGCACCCGG	AY255534	CCDS43162.1	3q25.2	2012-08-21			ENSG00000174948	ENSG00000174948		"""GPCR / Class A : Orphans"""	23627	protein-coding gene	gene with protein product						12679517	Standard	NM_001038705		Approved	PGR10, IEDA	uc003faa.3	Q86SP6	OTTHUMG00000159131	ENST00000389740.2:c.835G>C	chr3.hg19:g.154146570C>G	ENSP00000374390:p.Ala279Pro	181.0	0.0		177.0	95.0	NM_001038705		Missense_Mutation	SNP	ENST00000389740.2	hg19	CCDS43162.1	.	.	.	.	.	.	.	.	.	.	C	6.852	0.526405	0.13066	.	.	ENSG00000174948	ENST00000389740	.	.	.	4.51	1.53	0.23141	GPCR, rhodopsin-like superfamily (1);	1.526850	0.03495	N	0.217157	T	0.12305	0.0299	N	0.00155	-1.965	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.25293	-1.0136	9	0.10902	T	0.67	5.8061	17.5242	0.87795	0.0:0.6386:0.3614:0.0	.	279	Q86SP6	GP149_HUMAN	P	279	.	ENSP00000374390:A279P	A	-	1	0	GPR149	155629264	0.002000	0.14202	0.000000	0.03702	0.006000	0.05464	1.404000	0.34623	0.517000	0.28361	0.655000	0.94253	GCG	.	.		0.682	GPR149-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353430.1	XM_293580	
TMA16	55319	hgsc.bcm.edu	37	4	164436503	164436503	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A8HS-01A-11D-A35Z-10	TCGA-CC-A8HS-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	eec73def-9c6d-487a-b4b5-d9e879138027	4de9ebd4-2594-4178-b695-344708a55698	g.chr4:164436503A>G	ENST00000358572.5	+	5	619	c.278A>G	c.(277-279)gAg>gGg	p.E93G	TMA16_ENST00000508268.1_Missense_Mutation_p.E93G|TMA16_ENST00000513134.1_Intron|TMA16_ENST00000511562.1_3'UTR|TMA16_ENST00000513272.1_Intron	NM_018352.2	NP_060822.2	Q96EY4	TMA16_HUMAN	translation machinery associated 16 homolog (S. cerevisiae)	93						nucleus (GO:0005634)											GAGCAGATTGAGTTACATAAC	0.463																																					p.E93G		Atlas-SNP	.											.	.	.	.	0			c.A278G						.						115.0	117.0	116.0					4																	164436503		1949	4138	6087	SO:0001583	missense	55319	exon5			AGATTGAGTTACA		CCDS43278.1	4q32.3	2012-03-02	2012-03-02	2012-03-02	ENSG00000198498	ENSG00000198498			25638	protein-coding gene	gene with protein product			"""chromosome 4 open reading frame 43"""	C4orf43		12477932	Standard	NM_018352		Approved	FLJ11184	uc003iqq.4	Q96EY4	OTTHUMG00000161528	ENST00000358572.5:c.278A>G	chr4.hg19:g.164436503A>G	ENSP00000351380:p.Glu93Gly	378.0	0.0		230.0	90.0	NM_018352	Q0P6E4|Q0P6J1|Q9NUR7	Missense_Mutation	SNP	ENST00000358572.5	hg19	CCDS43278.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	19.73|19.73	3.882904|3.882904	0.72410|0.72410	.|.	.|.	ENSG00000198498|ENSG00000198498	ENST00000358572;ENST00000508268|ENST00000509657	T;T|.	0.32753|.	1.44;1.44|.	5.71|5.71	5.71|5.71	0.89125|0.89125	.|.	0.085246|.	0.85682|.	D|.	0.000000|.	T|.	0.76948|.	0.4059|.	M|M	0.81239|0.81239	2.535|2.535	0.80722|0.80722	D|D	1|1	B|.	0.06786|.	0.001|.	B|.	0.06405|.	0.002|.	T|.	0.78440|.	-0.2203|.	10|.	0.48119|.	T|.	0.1|.	-20.9634|-20.9634	15.2636|15.2636	0.73643|0.73643	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	93|.	Q96EY4|.	CD043_HUMAN|.	G|W	93|131	ENSP00000351380:E93G;ENSP00000423375:E93G|.	ENSP00000351380:E93G|.	E|X	+|+	2|3	0|0	C4orf43|C4orf43	164655953|164655953	1.000000|1.000000	0.71417|0.71417	0.999000|0.999000	0.59377|0.59377	0.997000|0.997000	0.91878|0.91878	8.124000|8.124000	0.89588|0.89588	2.307000|2.307000	0.77673|0.77673	0.528000|0.528000	0.53228|0.53228	GAG|TGA	.	.		0.463	TMA16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365208.1	NM_018352	
MYO10	4651	hgsc.bcm.edu	37	5	16689975	16689975	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A8HS-01A-11D-A35Z-10	TCGA-CC-A8HS-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	eec73def-9c6d-487a-b4b5-d9e879138027	4de9ebd4-2594-4178-b695-344708a55698	g.chr5:16689975T>A	ENST00000513610.1	-	28	4308	c.3854A>T	c.(3853-3855)gAt>gTt	p.D1285V	MYO10_ENST00000505695.1_Missense_Mutation_p.D624V|MYO10_ENST00000274203.9_Missense_Mutation_p.D642V|MYO10_ENST00000427430.2_Missense_Mutation_p.D642V|MYO10_ENST00000515803.1_Missense_Mutation_p.D624V	NM_012334.2	NP_036466.2	Q9HD67	MYO10_HUMAN	myosin X	1285	PH 1. {ECO:0000255|PROSITE- ProRule:PRU00145}.				ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|cytoskeleton-dependent intracellular transport (GO:0030705)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|metabolic process (GO:0008152)|positive regulation of cell-cell adhesion (GO:0022409)|regulation of cell shape (GO:0008360)|regulation of filopodium assembly (GO:0051489)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|filopodium tip (GO:0032433)|myosin complex (GO:0016459)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)	actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|plus-end directed microfilament motor activity (GO:0060002)|spectrin binding (GO:0030507)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(19)|lung(28)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	86						GAAAGTCCTATCGGCCATAAT	0.483																																					p.D1285V		Atlas-SNP	.											.	MYO10	198	.	0			c.A3854T						.						172.0	172.0	172.0					5																	16689975		2098	4225	6323	SO:0001583	missense	4651	exon28			GTCCTATCGGCCA	AF247457	CCDS54834.1	5p15.1-p14.3	2013-01-10				ENSG00000145555		"""Myosins / Myosin superfamily : Class X"", ""Pleckstrin homology (PH) domain containing"""	7593	protein-coding gene	gene with protein product		601481				8884266	Standard	NM_012334		Approved	KIAA0799	uc003jft.4	Q9HD67		ENST00000513610.1:c.3854A>T	chr5.hg19:g.16689975T>A	ENSP00000421280:p.Asp1285Val	77.0	0.0		105.0	33.0	NM_012334	A7E2D1|O94893|Q8IVX5|Q9NYM7|Q9P110|Q9P111|Q9UHF6	Missense_Mutation	SNP	ENST00000513610.1	hg19	CCDS54834.1	.	.	.	.	.	.	.	.	.	.	T	15.55	2.867102	0.51588	.	.	ENSG00000145555	ENST00000513610;ENST00000515803;ENST00000274203;ENST00000505695;ENST00000427430	T;T;T;T;T	0.14266	2.52;2.52;2.52;2.52;2.52	5.52	5.52	0.82312	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	.	.	.	.	T	0.29223	0.0727	L	0.57130	1.785	0.80722	D	1	B;P;D	0.60575	0.14;0.813;0.988	B;B;P	0.58077	0.066;0.413;0.832	T	0.00907	-1.1519	9	0.46703	T	0.11	.	15.307	0.74001	0.0:0.0:0.0:1.0	.	164;926;1285	B4DIJ5;Q69YP8;Q9HD67	.;.;MYO10_HUMAN	V	1285;624;642;624;642	ENSP00000421280:D1285V;ENSP00000425051:D624V;ENSP00000274203:D642V;ENSP00000421170:D624V;ENSP00000391106:D642V	ENSP00000274203:D642V	D	-	2	0	MYO10	16742975	1.000000	0.71417	0.454000	0.27019	0.045000	0.14185	6.258000	0.72487	2.104000	0.64026	0.533000	0.62120	GAT	.	.		0.483	MYO10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366167.1	NM_012334	
TENM2	57451	hgsc.bcm.edu	37	5	167654929	167654929	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-A8HS-01A-11D-A35Z-10	TCGA-CC-A8HS-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	eec73def-9c6d-487a-b4b5-d9e879138027	4de9ebd4-2594-4178-b695-344708a55698	g.chr5:167654929A>T	ENST00000518659.1	+	25	5353	c.5314A>T	c.(5314-5316)Aat>Tat	p.N1772Y	TENM2_ENST00000545108.1_Missense_Mutation_p.N1771Y|TENM2_ENST00000519204.1_Missense_Mutation_p.N1651Y|TENM2_ENST00000403607.2_Missense_Mutation_p.N1596Y|TENM2_ENST00000520394.1_Missense_Mutation_p.N1533Y|CTB-178M22.2_ENST00000519795.1_RNA	NM_001122679.1	NP_001116151.1	Q9NT68	TEN2_HUMAN	teneurin transmembrane protein 2	1772					axon guidance (GO:0007411)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|heterophilic cell-cell adhesion (GO:0007157)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of filopodium assembly (GO:0051491)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cell-cell junction (GO:0005911)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|endoplasmic reticulum (GO:0005783)|filopodium (GO:0030175)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|PML body (GO:0016605)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)										CCAGCTCTGTAATAATGGTAC	0.488																																					p.N1763Y		Atlas-SNP	.											.	.	.	.	0			c.A5287T						.						57.0	57.0	57.0					5																	167654929		1923	4146	6069	SO:0001583	missense	57451	exon25			CTCTGTAATAATG	AB032953		5q35	2012-10-02	2012-10-02	2012-10-02	ENSG00000145934	ENSG00000145934			29943	protein-coding gene	gene with protein product		610119	"""odz, odd Oz/ten-m homolog 2 (Drosophila)"""	ODZ2		10625539	Standard	NM_001122679		Approved	KIAA1127, Ten-M2	uc010jjd.3	Q9NT68	OTTHUMG00000162928	ENST00000518659.1:c.5314A>T	chr5.hg19:g.167654929A>T	ENSP00000429430:p.Asn1772Tyr	169.0	0.0		95.0	32.0	NM_001122679	Q9ULU2	Missense_Mutation	SNP	ENST00000518659.1	hg19		.	.	.	.	.	.	.	.	.	.	A	1.128	-0.653277	0.03480	.	.	ENSG00000145934	ENST00000518659;ENST00000545108;ENST00000519204;ENST00000520394;ENST00000403607	D;D;D;D;D	0.89270	-2.02;-2.01;-2.12;-2.49;-2.49	5.66	5.66	0.87406	.	0.172324	0.64402	N	0.000008	T	0.78685	0.4322	N	0.05510	-0.035	0.41217	D	0.986487	B;B;B	0.30146	0.0;0.0;0.27	B;B;B	0.25140	0.001;0.001;0.058	T	0.77851	-0.2434	10	0.40728	T	0.16	.	15.8895	0.79286	1.0:0.0:0.0:0.0	.	1771;1772;1533	F5H2D1;Q9NT68;F8VNQ3	.;TEN2_HUMAN;.	Y	1772;1771;1651;1533;1596	ENSP00000429430:N1772Y;ENSP00000438635:N1771Y;ENSP00000428964:N1651Y;ENSP00000427874:N1533Y;ENSP00000384905:N1596Y	ENSP00000384905:N1596Y	N	+	1	0	ODZ2	167587507	1.000000	0.71417	0.149000	0.22428	0.840000	0.47671	6.097000	0.71452	2.153000	0.67306	0.459000	0.35465	AAT	.	.		0.488	TENM2-001	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000376096.1	NM_001122679	
DPCR1	135656	hgsc.bcm.edu	37	6	30919613	30919613	+	Missense_Mutation	SNP	G	G	C			TCGA-CC-A8HS-01A-11D-A35Z-10	TCGA-CC-A8HS-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	eec73def-9c6d-487a-b4b5-d9e879138027	4de9ebd4-2594-4178-b695-344708a55698	g.chr6:30919613G>C	ENST00000462446.1	+	2	3400	c.3372G>C	c.(3370-3372)gaG>gaC	p.E1124D	HCG21_ENST00000419481.1_RNA|DPCR1_ENST00000304311.2_5'UTR			Q3MIW9	DPCR1_HUMAN	diffuse panbronchiolitis critical region 1	297						integral component of membrane (GO:0016021)				endometrium(1)|kidney(2)|large_intestine(3)|lung(3)|pancreas(1)	10						CTGCAGCAGAGTCTACAGAAC	0.488																																					p.E1124D		Atlas-SNP	.											.	DPCR1	99	.	0			c.G3372C						.						185.0	165.0	171.0					6																	30919613		692	1591	2283	SO:0001583	missense	135656	exon2			AGCAGAGTCTACA	AB064272	CCDS4692.1, CCDS4692.2	6p21.32	2008-02-05			ENSG00000168631	ENSG00000168631			21666	protein-coding gene	gene with protein product		613928				12185533, 10677310	Standard	NM_080870		Approved	PBLT, bCX105N19.6	uc003nsg.2	Q3MIW9	OTTHUMG00000031104	ENST00000462446.1:c.3372G>C	chr6.hg19:g.30919613G>C	ENSP00000417182:p.Glu1124Asp	69.0	0.0		69.0	33.0	NM_080870	C9IZC0|Q658M7|Q8WYN2	Missense_Mutation	SNP	ENST00000462446.1	hg19	CCDS4692.2	.	.	.	.	.	.	.	.	.	.	g	5.334	0.246863	0.10130	.	.	ENSG00000168631	ENST00000462446	T	0.48522	0.81	1.86	-1.96	0.07525	.	.	.	.	.	T	0.30293	0.0760	L	0.44542	1.39	0.09310	N	0.999999	D	0.61697	0.99	D	0.72982	0.979	T	0.10660	-1.0620	9	0.21014	T	0.42	0.0038	1.9518	0.03368	0.3889:0.0:0.3475:0.2636	.	1124	E9PEI6	.	D	1124	ENSP00000417182:E1124D	ENSP00000417182:E1124D	E	+	3	2	DPCR1	31027592	0.000000	0.05858	0.000000	0.03702	0.094000	0.18550	-0.329000	0.07935	-0.267000	0.09325	-0.408000	0.06270	GAG	.	.		0.488	DPCR1-001	NOVEL	not_organism_supported|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000076173.3	NM_080870	
KLHDC3	116138	hgsc.bcm.edu	37	6	42986657	42986657	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A8HS-01A-11D-A35Z-10	TCGA-CC-A8HS-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	eec73def-9c6d-487a-b4b5-d9e879138027	4de9ebd4-2594-4178-b695-344708a55698	g.chr6:42986657C>T	ENST00000326974.4	+	8	1072	c.877C>T	c.(877-879)Cgc>Tgc	p.R293C	KLHDC3_ENST00000332245.8_Missense_Mutation_p.R234C|RRP36_ENST00000244496.5_5'Flank|KLHDC3_ENST00000244670.8_Missense_Mutation_p.R159C	NM_057161.3	NP_476502.1	Q9BQ90	KLDC3_HUMAN	kelch domain containing 3	293					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|reciprocal meiotic recombination (GO:0007131)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear chromatin (GO:0000790)	chromatin binding (GO:0003682)			cervix(1)|endometrium(1)|large_intestine(1)|lung(4)|prostate(1)|upper_aerodigestive_tract(1)	9			Colorectal(64;0.00237)|all cancers(41;0.0034)|COAD - Colon adenocarcinoma(64;0.00473)|OV - Ovarian serous cystadenocarcinoma(102;0.0539)|KIRC - Kidney renal clear cell carcinoma(15;0.133)|Kidney(15;0.188)			TCCCCGCCGGCGCCAGTGCTG	0.512																																					p.R293C		Atlas-SNP	.											.	KLHDC3	23	.	0			c.C877T						.						65.0	77.0	73.0					6																	42986657		2202	4299	6501	SO:0001583	missense	116138	exon8			CGCCGGCGCCAGT	AB055925	CCDS4880.1	6p21.1	2003-06-12			ENSG00000124702	ENSG00000124702			20704	protein-coding gene	gene with protein product		611248				12444059, 12606021	Standard	NM_057161		Approved	PEAS, hPeas, dJ20C7.3	uc003otl.3	Q9BQ90	OTTHUMG00000014714	ENST00000326974.4:c.877C>T	chr6.hg19:g.42986657C>T	ENSP00000313995:p.Arg293Cys	121.0	0.0		106.0	20.0	NM_057161	A8K2W9	Missense_Mutation	SNP	ENST00000326974.4	hg19	CCDS4880.1	.	.	.	.	.	.	.	.	.	.	C	17.08	3.297416	0.60086	.	.	ENSG00000124702	ENST00000326974;ENST00000432243;ENST00000244670;ENST00000394096;ENST00000426116;ENST00000332245	T;T;T	0.66638	-0.22;-0.22;-0.22	5.31	5.31	0.75309	.	0.000000	0.85682	D	0.000000	T	0.76219	0.3957	M	0.93197	3.39	0.80722	D	1	P;P;P;P	0.52170	0.951;0.861;0.489;0.917	P;B;B;B	0.50708	0.648;0.391;0.105;0.391	T	0.82703	-0.0326	10	0.72032	D	0.01	-7.2709	12.9393	0.58333	0.2828:0.7172:0.0:0.0	.	293;234;159;293	E7ENU0;E7ERR0;F8W6A4;Q9BQ90	.;.;.;KLDC3_HUMAN	C	293;293;159;293;266;234	ENSP00000313995:R293C;ENSP00000244670:R159C;ENSP00000331562:R234C	ENSP00000244670:R159C	R	+	1	0	KLHDC3	43094635	1.000000	0.71417	0.999000	0.59377	0.919000	0.55068	1.762000	0.38451	2.648000	0.89879	0.205000	0.17691	CGC	.	.		0.512	KLHDC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040570.1	NM_057161	
ROS1	6098	hgsc.bcm.edu	37	6	117746713	117746713	+	Nonsense_Mutation	SNP	G	G	T	rs371523377		TCGA-CC-A8HS-01A-11D-A35Z-10	TCGA-CC-A8HS-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	eec73def-9c6d-487a-b4b5-d9e879138027	4de9ebd4-2594-4178-b695-344708a55698	g.chr6:117746713G>T	ENST00000368508.3	-	1	305	c.107C>A	c.(106-108)tCg>tAg	p.S36*	GOPC_ENST00000467125.1_Intron|ROS1_ENST00000368507.3_Nonsense_Mutation_p.S36*	NM_002944.2	NP_002935.2	P08922	ROS1_HUMAN	ROS proto-oncogene 1 , receptor tyrosine kinase	36					cell differentiation (GO:0030154)|cell growth (GO:0016049)|cell proliferation (GO:0008283)|columnar/cuboidal epithelial cell development (GO:0002066)|negative regulation of gene expression (GO:0010629)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein phosphorylation (GO:0006468)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of phosphate transport (GO:0010966)|regulation of TOR signaling (GO:0032006)|spermatogenesis (GO:0007283)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)		TPM3_ENST00000368530/ROS1(4)|LRIG3/ROS1(2)|CD74_ENST00000009530/ROS1(32)|SLC34A2/ROS1(14)|EZR/ROS1(4)|GOPC/ROS1(14)|SDC4/ROS1(7)	NS(2)|breast(7)|central_nervous_system(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(28)|lung(56)|ovary(8)|prostate(5)|skin(19)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(3)	162		all_cancers(87;0.00846)|all_epithelial(87;0.0242)		GBM - Glioblastoma multiforme(226;0.0387)|OV - Ovarian serous cystadenocarcinoma(136;0.0954)|all cancers(137;0.137)		AGTTACACACGACTTTAGGCA	0.363			T	"""GOPC, SDC4, SLC34A2, EZR, LRIG3"""	"""glioblastoma, NSCLC"""																																p.S36X		Atlas-SNP	.		Dom	yes		6	6q22	6098	v-ros UR2 sarcoma virus oncogene homolog 1 (avian)		"""O, E"""	.	ROS1	728	.	0			c.C107A						.						140.0	135.0	137.0					6																	117746713		2203	4300	6503	SO:0001587	stop_gained	6098	exon1			ACACACGACTTTA	M13599	CCDS5116.1	6q21-q22	2014-06-26	2014-06-26		ENSG00000047936	ENSG00000047936		"""Fibronectin type III domain containing"""	10261	protein-coding gene	gene with protein product		165020	"""v-ros avian UR2 sarcoma virus oncogene homolog 1"", ""v-ros UR2 sarcoma virus oncogene homolog 1 (avian)"", ""c-ros oncogene 1 , receptor tyrosine kinase"""			1611909	Standard	NM_002944		Approved	MCF3, ROS, c-ros-1	uc003pxp.1	P08922	OTTHUMG00000016188	ENST00000368508.3:c.107C>A	chr6.hg19:g.117746713G>T	ENSP00000357494:p.Ser36*	120.0	0.0		103.0	53.0	NM_002944	Q15368|Q5TDB5	Nonsense_Mutation	SNP	ENST00000368508.3	hg19	CCDS5116.1	.	.	.	.	.	.	.	.	.	.	G	37	6.304748	0.97458	.	.	ENSG00000047936	ENST00000368508;ENST00000368507	.	.	.	5.11	2.4	0.29515	.	0.309329	0.23953	N	0.042923	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.14656	T	0.56	.	8.0708	0.30689	0.205:0.0:0.795:0.0	.	.	.	.	X	36	.	ENSP00000357493:S36X	S	-	2	0	ROS1	117853406	0.998000	0.40836	0.995000	0.50966	0.702000	0.40608	0.848000	0.27710	0.435000	0.26365	-1.202000	0.01658	TCG	.	.		0.363	ROS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000043464.1		
ABCA13	154664	hgsc.bcm.edu	37	7	48443322	48443322	+	Missense_Mutation	SNP	G	G	C			TCGA-CC-A8HS-01A-11D-A35Z-10	TCGA-CC-A8HS-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	eec73def-9c6d-487a-b4b5-d9e879138027	4de9ebd4-2594-4178-b695-344708a55698	g.chr7:48443322G>C	ENST00000435803.1	+	39	11940	c.11916G>C	c.(11914-11916)caG>caC	p.Q3972H		NM_152701.3	NP_689914.2	Q86UQ4	ABCAD_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 13	3972	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(13)|central_nervous_system(8)|endometrium(25)|haematopoietic_and_lymphoid_tissue(4)|kidney(20)|large_intestine(51)|lung(100)|ovary(5)|pancreas(2)|prostate(22)|skin(10)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	270						AGCACAAACAGACCCGAGCTC	0.493																																					p.Q3972H		Atlas-SNP	.											.	ABCA13	1192	.	0			c.G11916C						.						105.0	105.0	105.0					7																	48443322		1956	4142	6098	SO:0001583	missense	154664	exon39			CAAACAGACCCGA	AY204751	CCDS47584.1	7p12.3	2012-03-14			ENSG00000179869	ENSG00000179869		"""ATP binding cassette transporters / subfamily A"""	14638	protein-coding gene	gene with protein product		607807				12697998	Standard	NM_152701		Approved	FLJ33876, FLJ33951	uc003toq.2	Q86UQ4	OTTHUMG00000155840	ENST00000435803.1:c.11916G>C	chr7.hg19:g.48443322G>C	ENSP00000411096:p.Gln3972His	90.0	0.0		63.0	26.0	NM_152701	K9LC76|K9LC79|K9LCX7|K9LDK8|K9LDY4|Q6ZTT7|Q86WI2|Q8N248	Missense_Mutation	SNP	ENST00000435803.1	hg19	CCDS47584.1	.	.	.	.	.	.	.	.	.	.	G	6.187	0.402590	0.11696	.	.	ENSG00000179869	ENST00000435803	D	0.93366	-3.21	6.17	-5.84	0.02318	ATPase, AAA+ type, core (1);ABC transporter-like (2);	0.467204	0.18100	N	0.151724	D	0.83774	0.5327	L	0.39397	1.21	0.09310	N	1	B;B	0.23128	0.006;0.08	B;B	0.23716	0.01;0.048	T	0.70648	-0.4814	10	0.35671	T	0.21	.	1.37	0.02209	0.4404:0.1644:0.1071:0.2881	.	1674;3972	Q86UQ4-3;Q86UQ4	.;ABCAD_HUMAN	H	3972	ENSP00000411096:Q3972H	ENSP00000411096:Q3972H	Q	+	3	2	ABCA13	48413868	0.000000	0.05858	0.000000	0.03702	0.110000	0.19582	-1.642000	0.02006	-0.498000	0.06632	0.655000	0.94253	CAG	.	.		0.493	ABCA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341964.2	NM_152701	
GNAQ	2776	hgsc.bcm.edu	37	9	80537112	80537112	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A8HS-01A-11D-A35Z-10	TCGA-CC-A8HS-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	eec73def-9c6d-487a-b4b5-d9e879138027	4de9ebd4-2594-4178-b695-344708a55698	g.chr9:80537112T>A	ENST00000286548.4	-	2	508	c.286A>T	c.(286-288)Aca>Tca	p.T96S		NM_002072.3	NP_002063.2	P50148	GNAQ_HUMAN	guanine nucleotide binding protein (G protein), q polypeptide	96					action potential (GO:0001508)|activation of phospholipase C activity (GO:0007202)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|blood coagulation (GO:0007596)|developmental pigmentation (GO:0048066)|embryonic digit morphogenesis (GO:0042733)|forebrain neuron development (GO:0021884)|glutamate receptor signaling pathway (GO:0007215)|heart development (GO:0007507)|maternal behavior (GO:0042711)|negative regulation of protein kinase activity (GO:0006469)|neuron remodeling (GO:0016322)|phospholipase C-activating dopamine receptor signaling pathway (GO:0060158)|platelet activation (GO:0030168)|positive regulation of GTPase activity (GO:0043547)|post-embryonic development (GO:0009791)|protein stabilization (GO:0050821)|regulation of catenin import into nucleus (GO:0035412)|regulation of melanocyte differentiation (GO:0045634)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|heterotrimeric G-protein complex (GO:0005834)|lysosomal membrane (GO:0005765)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	G-protein beta/gamma-subunit complex binding (GO:0031683)|GTP binding (GO:0005525)|GTPase activator activity (GO:0005096)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)|type 2A serotonin receptor binding (GO:0031826)	p.T96S(1)		NS(1)|endometrium(3)|eye(229)|kidney(1)|large_intestine(4)|lung(6)|meninges(11)|ovary(1)|prostate(1)|skin(44)|upper_aerodigestive_tract(1)	302						ATCTTGAGTGTGTCCATGGCT	0.473			Mis		uveal melanoma																																p.T96S		Atlas-SNP	.		Dom	yes		9	9q21	2776	"""guanine nucleotide binding protein (G protein), q polypeptide"""		E	GNAQ,NS,carcinoma,0,2	GNAQ	384	.	1	Substitution - Missense(1)	prostate(1)	c.A286T						.																																			SO:0001583	missense	2776	exon2			TGAGTGTGTCCAT		CCDS6658.1	9q21	2010-03-17			ENSG00000156052	ENSG00000156052			4390	protein-coding gene	gene with protein product		600998				8825633	Standard	NM_002072		Approved	G-ALPHA-q, GAQ	uc004akw.3	P50148	OTTHUMG00000020059	ENST00000286548.4:c.286A>T	chr9.hg19:g.80537112T>A	ENSP00000286548:p.Thr96Ser	45.0	0.0		44.0	3.0	NM_002072	O15108|Q13462|Q6NT27|Q92471|Q9BZB9	Missense_Mutation	SNP	ENST00000286548.4	hg19	CCDS6658.1	.	.	.	.	.	.	.	.	.	.	T	13.12	2.141103	0.37825	.	.	ENSG00000156052	ENST00000286548;ENST00000411677	D;D	0.87809	-2.3;-2.3	5.86	5.86	0.93980	G protein alpha subunit, helical insertion (2);	0.000000	0.85682	D	0.000000	D	0.84170	0.5413	L	0.52126	1.63	0.80722	D	1	B	0.02656	0.0	B	0.04013	0.001	T	0.79122	-0.1933	10	0.29301	T	0.29	.	16.2652	0.82574	0.0:0.0:0.0:1.0	.	96	P50148	GNAQ_HUMAN	S	96;67	ENSP00000286548:T96S;ENSP00000391501:T67S	ENSP00000286548:T96S	T	-	1	0	GNAQ	79726932	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.145000	0.64839	2.241000	0.73720	0.528000	0.53228	ACA	.	.		0.473	GNAQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052761.1	NM_002072	
RPL7A	6130	hgsc.bcm.edu	37	9	136216547	136216547	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A8HS-01A-11D-A35Z-10	TCGA-CC-A8HS-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	eec73def-9c6d-487a-b4b5-d9e879138027	4de9ebd4-2594-4178-b695-344708a55698	g.chr9:136216547G>T	ENST00000323345.6	+	3	296	c.266G>T	c.(265-267)cGc>cTc	p.R89L	MED22_ENST00000343730.5_5'Flank|SNORD36A_ENST00000362874.1_RNA|SNORD24_ENST00000383884.1_RNA|MED22_ENST00000344469.5_5'Flank|MED22_ENST00000371999.1_5'Flank|RPL7A_ENST00000463740.1_3'UTR|SNORD36B_ENST00000363961.1_RNA|RPL7A_ENST00000315731.4_Intron|MED22_ENST00000491289.1_5'Flank|MED22_ENST00000471524.1_5'Flank|SURF1_ENST00000495952.1_5'Flank|SNORD36C_ENST00000516733.1_RNA|MED22_ENST00000476080.1_5'Flank	NM_000972.2	NP_000963.1	P62424	RL7A_HUMAN	ribosomal protein L7a	89					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|ribosome biogenesis (GO:0042254)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleus (GO:0005634)|polysomal ribosome (GO:0042788)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)			cervix(1)|endometrium(1)|kidney(1)|lung(3)|upper_aerodigestive_tract(1)	7				OV - Ovarian serous cystadenocarcinoma(145;4.93e-07)|Epithelial(140;4.09e-06)|all cancers(34;3.78e-05)		GCCCTGGACCGCCAAACAGGT	0.527																																					p.R89L		Atlas-SNP	.											.	RPL7A	9	.	0			c.G266T						.						47.0	53.0	51.0					9																	136216547		2196	4299	6495	SO:0001583	missense	6130	exon3			TGGACCGCCAAAC	BC005128	CCDS6965.1	9q34	2011-04-06			ENSG00000148303	ENSG00000148303		"""L ribosomal proteins"""	10364	protein-coding gene	gene with protein product	"""surfeit 3"", ""PLA-X polypeptide"", ""surfeit locus protein 3"", ""60S ribosomal protein L7a"", "";"", ""thyroid hormone receptor uncoupling protein"""	185640				2403926, 2966065	Standard	NM_000972		Approved	SURF3, TRUP, L7A	uc004cde.1	P62424	OTTHUMG00000020864	ENST00000323345.6:c.266G>T	chr9.hg19:g.136216547G>T	ENSP00000361076:p.Arg89Leu	131.0	0.0		115.0	5.0	NM_000972	P11518|Q5T8U4	Missense_Mutation	SNP	ENST00000323345.6	hg19	CCDS6965.1	.	.	.	.	.	.	.	.	.	.	G	18.30	3.593234	0.66219	.	.	ENSG00000148303	ENST00000323345;ENST00000426651	T;T	0.58506	0.33;0.7	4.03	4.03	0.46877	.	0.000000	0.85682	D	0.000000	T	0.67590	0.2909	M	0.92970	3.365	0.80722	D	1	B	0.10296	0.003	B	0.11329	0.006	T	0.73341	-0.4013	10	0.87932	D	0	.	15.1827	0.72972	0.0:0.0:1.0:0.0	.	89	P62424	RL7A_HUMAN	L	89;116	ENSP00000361076:R89L;ENSP00000416638:R116L	ENSP00000361076:R89L	R	+	2	0	RPL7A	135206368	1.000000	0.71417	0.999000	0.59377	0.979000	0.70002	8.833000	0.92089	1.816000	0.52996	0.313000	0.20887	CGC	.	.		0.527	RPL7A-009	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054869.1	NM_000972	
RNF208	727800	hgsc.bcm.edu	37	9	140115059	140115059	+	Silent	SNP	G	G	A	rs540686797		TCGA-CC-A8HS-01A-11D-A35Z-10	TCGA-CC-A8HS-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	eec73def-9c6d-487a-b4b5-d9e879138027	4de9ebd4-2594-4178-b695-344708a55698	g.chr9:140115059G>A	ENST00000392827.1	-	2	774	c.606C>T	c.(604-606)gcC>gcT	p.A202A	RNF208_ENST00000391553.1_Silent_p.A202A			Q9H0X6	RN208_HUMAN	ring finger protein 208	202					protein autoubiquitination (GO:0051865)		ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			lung(1)	1	all_cancers(76;0.0926)		STAD - Stomach adenocarcinoma(284;0.0698)	OV - Ovarian serous cystadenocarcinoma(145;6.37e-05)|Epithelial(140;0.00057)		CAGCCAGCGCGGCCAGGCCGT	0.667													G|||	1	0.000199681	0.0008	0.0	5008	,	,		14448	0.0		0.0	False		,,,				2504	0.0				p.A202A		Atlas-SNP	.											.	RNF208	11	.	0			c.C606T						.						51.0	40.0	44.0					9																	140115059		2190	4293	6483	SO:0001819	synonymous_variant	727800	exon1			CAGCGCGGCCAGG	AF416715	CCDS7037.2	9q34.3	2007-01-19				ENSG00000212864		"""RING-type (C3HC4) zinc fingers"""	25420	protein-coding gene	gene with protein product						11230166	Standard	NM_031297		Approved	DKFZP761H1710	uc004clz.2	Q9H0X6		ENST00000392827.1:c.606C>T	chr9.hg19:g.140115059G>A		247.0	0.0		356.0	18.0	NM_031297	A2BFA0	Silent	SNP	ENST00000392827.1	hg19	CCDS7037.2																																																																																			.	.		0.667	RNF208-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254714.1	NM_031297	
NLRP10	338322	hgsc.bcm.edu	37	11	7981277	7981277	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A8HS-01A-11D-A35Z-10	TCGA-CC-A8HS-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	eec73def-9c6d-487a-b4b5-d9e879138027	4de9ebd4-2594-4178-b695-344708a55698	g.chr11:7981277T>C	ENST00000328600.2	-	2	2043	c.1882A>G	c.(1882-1884)Aaa>Gaa	p.K628E		NM_176821.3	NP_789791.1	Q86W26	NAL10_HUMAN	NLR family, pyrin domain containing 10	628					defense response to fungus (GO:0050832)|defense response to Gram-negative bacterium (GO:0050829)|dendritic cell migration (GO:0036336)|helper T cell enhancement of adaptive immune response (GO:0035397)|innate immune response (GO:0045087)|positive regulation of interleukin-6 secretion (GO:2000778)|positive regulation of interleukin-8 secretion (GO:2000484)|positive regulation of T-helper 1 type immune response (GO:0002827)|positive regulation of T-helper 17 type immune response (GO:2000318)	cytoplasm (GO:0005737)|extrinsic component of plasma membrane (GO:0019897)	ATP binding (GO:0005524)			breast(1)|endometrium(2)|kidney(2)|large_intestine(8)|liver(1)|lung(28)|ovary(2)|pancreas(1)|prostate(2)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	58				Epithelial(150;1.47e-07)|BRCA - Breast invasive adenocarcinoma(625;0.189)		ATATTATCTTTGCCCTCCTTC	0.388																																					p.K628E		Atlas-SNP	.											.	NLRP10	146	.	0			c.A1882G						.						97.0	90.0	92.0					11																	7981277		2201	4294	6495	SO:0001583	missense	338322	exon2			TATCTTTGCCCTC	AY154465	CCDS7784.1	11p15.4	2006-12-08	2006-12-08	2006-12-08		ENSG00000182261		"""Nucleotide-binding domain and leucine rich repeat containing"""	21464	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 10"""	609662	"""NACHT, leucine rich repeat and PYD containing 10"""	NALP10		12563287	Standard	NM_176821		Approved	NOD8, PAN5, Pynod, CLR11.1	uc001mfv.1	Q86W26		ENST00000328600.2:c.1882A>G	chr11.hg19:g.7981277T>C	ENSP00000327763:p.Lys628Glu	103.0	0.0		96.0	5.0	NM_176821	Q2M3C4|Q6JGT0	Missense_Mutation	SNP	ENST00000328600.2	hg19	CCDS7784.1	.	.	.	.	.	.	.	.	.	.	T	6.341	0.431031	0.12045	.	.	ENSG00000182261	ENST00000328600	T	0.80566	-1.39	3.02	-4.18	0.03846	.	.	.	.	.	T	0.54208	0.1844	N	0.12182	0.205	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.46373	-0.9196	9	0.07482	T	0.82	.	5.0267	0.14389	0.0:0.3562:0.3729:0.2709	.	628	Q86W26	NAL10_HUMAN	E	628	ENSP00000327763:K628E	ENSP00000327763:K628E	K	-	1	0	NLRP10	7937853	0.000000	0.05858	0.000000	0.03702	0.189000	0.23516	-0.276000	0.08514	-0.935000	0.03728	0.383000	0.25322	AAA	.	.		0.388	NLRP10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385705.1	NM_176821	
GALNT18	374378	hgsc.bcm.edu	37	11	11643115	11643115	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A8HS-01A-11D-A35Z-10	TCGA-CC-A8HS-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	eec73def-9c6d-487a-b4b5-d9e879138027	4de9ebd4-2594-4178-b695-344708a55698	g.chr11:11643115G>A	ENST00000227756.4	-	1	437	c.26C>T	c.(25-27)aCt>aTt	p.T9I	GALNT18_ENST00000526064.1_5'UTR	NM_198516.2	NP_940918.2	Q6P9A2	GLT18_HUMAN	polypeptide N-acetylgalactosaminyltransferase 18	9					protein glycosylation (GO:0006486)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)										GGACACCAAAGTTTTGGTCTT	0.597																																					p.T9I		Atlas-SNP	.											.	.	.	.	0			c.C26T						.						74.0	58.0	63.0					11																	11643115		2201	4294	6495	SO:0001583	missense	374378	exon1			ACCAAAGTTTTGG	AK055111	CCDS7807.1	11p15	2014-03-13	2014-03-13	2013-01-25	ENSG00000110328	ENSG00000110328	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	30488	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 18"""	615136	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 4"", ""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 18"""	GALNTL4		22186971	Standard	NM_198516		Approved	MGC71806, GALNT15, GalNAc-T18	uc001mjo.2	Q6P9A2	OTTHUMG00000165707	ENST00000227756.4:c.26C>T	chr11.hg19:g.11643115G>A	ENSP00000227756:p.Thr9Ile	76.0	0.0		106.0	40.0	NM_198516	O95903|Q8NDY9	Missense_Mutation	SNP	ENST00000227756.4	hg19	CCDS7807.1	.	.	.	.	.	.	.	.	.	.	G	28.0	4.885978	0.91814	.	.	ENSG00000110328	ENST00000227756	T	0.58060	0.36	4.95	4.95	0.65309	.	0.183891	0.36628	N	0.002489	T	0.62780	0.2456	L	0.41492	1.28	0.52099	D	0.999942	D	0.71674	0.998	D	0.73708	0.981	T	0.55897	-0.8068	10	0.22109	T	0.4	.	16.9065	0.86130	0.0:0.0:1.0:0.0	.	9	Q6P9A2	GLTL4_HUMAN	I	9	ENSP00000227756:T9I	ENSP00000227756:T9I	T	-	2	0	GALNTL4	11599691	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.263000	0.95617	2.572000	0.86782	0.561000	0.74099	ACT	.	.		0.597	GALNT18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385848.1	NM_198516	
WDR74	54663	hgsc.bcm.edu	37	11	62607038	62607038	+	Missense_Mutation	SNP	G	G	A	rs545160528	byFrequency	TCGA-CC-A8HS-01A-11D-A35Z-10	TCGA-CC-A8HS-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	eec73def-9c6d-487a-b4b5-d9e879138027	4de9ebd4-2594-4178-b695-344708a55698	g.chr11:62607038G>A	ENST00000525239.1	-	2	542	c.5C>T	c.(4-6)gCg>gTg	p.A2V	WDR74_ENST00000529106.1_Missense_Mutation_p.A2V|WDR74_ENST00000540620.1_5'UTR|RNU2-2P_ENST00000410396.1_RNA|WDR74_ENST00000311713.7_Missense_Mutation_p.A2V|WDR74_ENST00000278856.4_Missense_Mutation_p.A2V|WDR74_ENST00000525752.1_5'UTR			Q6RFH5	WDR74_HUMAN	WD repeat domain 74	2					blastocyst formation (GO:0001825)|RNA metabolic process (GO:0016070)	nucleolus (GO:0005730)|nucleus (GO:0005634)				kidney(2)|large_intestine(1)|liver(1)|lung(3)|ovary(1)	8						AGCAGCAGCCGCCATGACAAA	0.642													G|||	3	0.000599042	0.0	0.0	5008	,	,		17818	0.0		0.0	False		,,,				2504	0.0031				p.A2V		Atlas-SNP	.											.	WDR74	36	.	0			c.C5T						.						34.0	40.0	38.0					11																	62607038		2161	4262	6423	SO:0001583	missense	54663	exon2			GCAGCCGCCATGA		CCDS44630.1	11q12.3	2013-01-09				ENSG00000133316		"""WD repeat domain containing"""	25529	protein-coding gene	gene with protein product							Standard	NM_018093		Approved	FLJ10439	uc001nvm.2	Q6RFH5		ENST00000525239.1:c.5C>T	chr11.hg19:g.62607038G>A	ENSP00000432119:p.Ala2Val	69.0	0.0		80.0	33.0	NM_018093	A8K8G5|Q9BRC9|Q9H6X8|Q9NVY2	Missense_Mutation	SNP	ENST00000525239.1	hg19	CCDS44630.1	.	.	.	.	.	.	.	.	.	.	G	16.41	3.116044	0.56505	.	.	ENSG00000133316	ENST00000311713;ENST00000529106;ENST00000525239;ENST00000278856;ENST00000538098	.	.	.	4.28	3.34	0.38264	.	0.124803	0.50627	D	0.000113	T	0.23846	0.0577	N	0.22421	0.69	0.26885	N	0.967456	D;P;P	0.56287	0.975;0.814;0.883	B;B;B	0.43082	0.407;0.148;0.285	T	0.08932	-1.0698	9	0.34782	T	0.22	-18.1912	10.2014	0.43087	0.1017:0.0:0.8983:0.0	.	2;2;2	B4E018;Q6RFH5;Q6RFH5-2	.;WDR74_HUMAN;.	V	2	.	ENSP00000278856:A2V	A	-	2	0	WDR74	62363614	0.993000	0.37304	0.850000	0.33497	0.007000	0.05969	2.105000	0.41825	2.213000	0.71641	0.655000	0.94253	GCG	.	.		0.642	WDR74-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395678.1	NM_018093	
SUV420H1	51111	hgsc.bcm.edu	37	11	67957487	67957487	+	Silent	SNP	G	G	T			TCGA-CC-A8HS-01A-11D-A35Z-10	TCGA-CC-A8HS-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	eec73def-9c6d-487a-b4b5-d9e879138027	4de9ebd4-2594-4178-b695-344708a55698	g.chr11:67957487G>T	ENST00000304363.4	-	2	410	c.57C>A	c.(55-57)ggC>ggA	p.G19G	SUV420H1_ENST00000402789.1_Silent_p.G19G|SUV420H1_ENST00000401547.2_Silent_p.G19G|SUV420H1_ENST00000402185.2_Silent_p.G19G|SUV420H1_ENST00000405515.1_Silent_p.G19G	NM_017635.3	NP_060105	Q4FZB7	SV421_HUMAN	suppressor of variegation 4-20 homolog 1 (Drosophila)	19					histone H4-K20 trimethylation (GO:0034773)|muscle organ development (GO:0007517)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	condensed nuclear chromosome, centromeric region (GO:0000780)	histone methyltransferase activity (H4-K20 specific) (GO:0042799)|histone-lysine N-methyltransferase activity (GO:0018024)			NS(1)|breast(3)|endometrium(4)|kidney(3)|large_intestine(9)|lung(15)|ovary(2)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	46						TAGACAACTTGCCTCCATTTC	0.488																																					p.G19G		Atlas-SNP	.											.	SUV420H1	125	.	0			c.C57A						.						330.0	279.0	296.0					11																	67957487		2200	4294	6494	SO:0001819	synonymous_variant	51111	exon2			CAACTTGCCTCCA	AL512763	CCDS31623.1, CCDS44660.1	11q13.2	2011-07-01			ENSG00000110066	ENSG00000110066		"""Chromatin-modifying enzymes / K-methyltransferases"""	24283	protein-coding gene	gene with protein product		610881				10810093, 11401438	Standard	NM_016028		Approved	CGI-85, KMT5B	uc001onm.1	Q4FZB7	OTTHUMG00000150484	ENST00000304363.4:c.57C>A	chr11.hg19:g.67957487G>T		76.0	0.0		66.0	4.0	NM_017635	B7WNX7|Q3SX56|Q4V775|Q6P150|Q96E44|Q9BUL0|Q9H022|Q9H2K3|Q9NXV3|Q9Y393	Silent	SNP	ENST00000304363.4	hg19	CCDS31623.1																																																																																			.	.		0.488	SUV420H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318319.1	NM_017635	
PDE3A	5139	hgsc.bcm.edu	37	12	20782946	20782946	+	Missense_Mutation	SNP	G	G	C			TCGA-CC-A8HS-01A-11D-A35Z-10	TCGA-CC-A8HS-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	eec73def-9c6d-487a-b4b5-d9e879138027	4de9ebd4-2594-4178-b695-344708a55698	g.chr12:20782946G>C	ENST00000359062.3	+	6	1685	c.1645G>C	c.(1645-1647)Gaa>Caa	p.E549Q	PDE3A_ENST00000544307.1_3'UTR	NM_000921.4|NM_001244683.1	NP_000912.3|NP_001231612.1	Q14432	PDE3A_HUMAN	phosphodiesterase 3A, cGMP-inhibited	549					blood coagulation (GO:0007596)|cAMP catabolic process (GO:0006198)|cAMP-mediated signaling (GO:0019933)|cellular response to cGMP (GO:0071321)|cellular response to transforming growth factor beta stimulus (GO:0071560)|cGMP-mediated signaling (GO:0019934)|diterpenoid metabolic process (GO:0016101)|lipid metabolic process (GO:0006629)|negative regulation of apoptotic process (GO:0043066)|negative regulation of vascular permeability (GO:0043116)|oocyte maturation (GO:0001556)|positive regulation of oocyte development (GO:0060282)|positive regulation of vascular permeability (GO:0043117)|regulation of meiosis (GO:0040020)|response to cAMP (GO:0051591)|response to drug (GO:0042493)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|cAMP binding (GO:0030552)|cGMP-inhibited cyclic-nucleotide phosphodiesterase activity (GO:0004119)|metal ion binding (GO:0046872)			NS(1)|breast(3)|endometrium(4)|kidney(3)|large_intestine(7)|lung(29)|ovary(4)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	58	Esophageal squamous(101;0.125)	Breast(259;0.134)			Aminophylline(DB01223)|Amrinone(DB01427)|Anagrelide(DB00261)|Caffeine(DB00201)|Cilostazol(DB01166)|Enoximone(DB04880)|Ibudilast(DB05266)|Levosimendan(DB00922)|Milrinone(DB00235)|Oxtriphylline(DB01303)|Theophylline(DB00277)|Tofisopam(DB08811)	GCAGTTTCCAGAATCTGCTGA	0.522																																					p.E549Q		Atlas-SNP	.											.	PDE3A	184	.	0			c.G1645C						.						131.0	131.0	131.0					12																	20782946		2203	4300	6503	SO:0001583	missense	5139	exon6			TTTCCAGAATCTG		CCDS31754.1	12p12.2	2011-04-15			ENSG00000172572	ENSG00000172572	3.1.4.17	"""Phosphodiesterases"""	8778	protein-coding gene	gene with protein product		123805				1315035, 10679291	Standard	NM_000921		Approved	CGI-PDE	uc001reh.2	Q14432	OTTHUMG00000168962	ENST00000359062.3:c.1645G>C	chr12.hg19:g.20782946G>C	ENSP00000351957:p.Glu549Gln	87.0	0.0		54.0	20.0	NM_000921	O60865|Q13348|Q17RD1	Missense_Mutation	SNP	ENST00000359062.3	hg19	CCDS31754.1	.	.	.	.	.	.	.	.	.	.	G	23.8	4.455775	0.84209	.	.	ENSG00000172572	ENST00000359062	T	0.54479	0.57	5.44	5.44	0.79542	.	0.702082	0.14966	N	0.288062	T	0.51873	0.1700	L	0.48642	1.525	0.43708	D	0.996178	P	0.48764	0.915	B	0.42771	0.397	T	0.55854	-0.8075	10	0.56958	D	0.05	.	17.2299	0.86982	0.0:0.0:1.0:0.0	.	549	Q14432	PDE3A_HUMAN	Q	549	ENSP00000351957:E549Q	ENSP00000351957:E549Q	E	+	1	0	PDE3A	20674213	1.000000	0.71417	0.996000	0.52242	0.855000	0.48748	8.421000	0.90259	2.834000	0.97654	0.650000	0.86243	GAA	.	.		0.522	PDE3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401756.2		
HECTD4	283450	hgsc.bcm.edu	37	12	112685925	112685925	+	Missense_Mutation	SNP	C	C	G			TCGA-CC-A8HS-01A-11D-A35Z-10	TCGA-CC-A8HS-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	eec73def-9c6d-487a-b4b5-d9e879138027	4de9ebd4-2594-4178-b695-344708a55698	g.chr12:112685925C>G	ENST00000430131.2	-	26	4073	c.2928G>C	c.(2926-2928)atG>atC	p.M976I	HECTD4_ENST00000377560.5_Missense_Mutation_p.M1226I|HECTD4_ENST00000550722.1_Missense_Mutation_p.M1252I			Q9Y4D8	HECD4_HUMAN	HECT domain containing E3 ubiquitin protein ligase 4	976					glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)										GTTTCCCCTGCATGGCATCAT	0.338																																					p.M1264I		Atlas-SNP	.											.	.	.	.	0			c.G3792C						.						101.0	95.0	97.0					12																	112685925		1893	4131	6024	SO:0001583	missense	283450	exon27			CCCCTGCATGGCA	AK091473		12q24.13	2013-07-17	2012-08-14	2012-08-14	ENSG00000173064	ENSG00000173064			26611	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 51"""	C12orf51		21270382	Standard	NM_001109662		Approved	FLJ34154, KIAA0614	uc021reb.1	Q9Y4D8	OTTHUMG00000150719	ENST00000430131.2:c.2928G>C	chr12.hg19:g.112685925C>G	ENSP00000404379:p.Met976Ile	135.0	0.0		151.0	7.0	NM_001109662	L8B0P6|Q3MJD5|Q6P0A0|Q7L530|Q8NB70|Q8WU73|Q96NT9|Q9NZS4|Q9UFT6	Missense_Mutation	SNP	ENST00000430131.2	hg19		.	.	.	.	.	.	.	.	.	.	C	9.595	1.127237	0.20959	.	.	ENSG00000173064	ENST00000377560;ENST00000430131;ENST00000550722	T;T;T	0.41758	0.99;0.99;0.99	5.79	-2.1	0.07210	.	.	.	.	.	T	0.16041	0.0386	N	0.08118	0	0.23903	N	0.996516	B	0.02656	0.0	B	0.01281	0.0	T	0.22382	-1.0218	9	0.16896	T	0.51	.	2.045	0.03558	0.205:0.4615:0.0996:0.2339	.	976	Q9Y4D8	K0614_HUMAN	I	1226;976;1252	ENSP00000366783:M1226I;ENSP00000404379:M976I;ENSP00000449784:M1252I	ENSP00000366783:M1226I	M	-	3	0	C12orf51	111170308	0.955000	0.32602	0.883000	0.34634	0.870000	0.49936	0.126000	0.15769	-0.415000	0.07484	-0.263000	0.10527	ATG	.	.		0.338	HECTD4-202	KNOWN	basic	protein_coding	protein_coding		NM_173813	
STOML3	161003	hgsc.bcm.edu	37	13	39564842	39564842	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A8HS-01A-11D-A35Z-10	TCGA-CC-A8HS-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	eec73def-9c6d-487a-b4b5-d9e879138027	4de9ebd4-2594-4178-b695-344708a55698	g.chr13:39564842G>A	ENST00000379631.4	-	1	361	c.17C>T	c.(16-18)tCt>tTt	p.S6F	STOML3_ENST00000423210.1_5'UTR	NM_145286.2	NP_660329.1	Q8TAV4	STML3_HUMAN	stomatin (EPB72)-like 3	6					signal transduction (GO:0007165)	cilium (GO:0005929)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)				breast(1)|large_intestine(2)|lung(5)|ovary(1)|prostate(1)|skin(1)	11		Lung NSC(96;1.42e-05)|Prostate(109;0.00851)|Breast(139;0.0199)|Lung SC(185;0.0743)		all cancers(112;2.93e-08)|Epithelial(112;3.64e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.00107)|BRCA - Breast invasive adenocarcinoma(63;0.00349)|GBM - Glioblastoma multiforme(144;0.0137)		CTCAGGTGAAGACACCCTAGA	0.403																																					p.S6F		Atlas-SNP	.											.	STOML3	47	.	0			c.C17T						.						138.0	132.0	134.0					13																	39564842		2203	4300	6503	SO:0001583	missense	161003	exon1			GGTGAAGACACCC	BC025760	CCDS9367.1, CCDS45040.1	13q13.2	2004-03-05			ENSG00000133115	ENSG00000133115			19420	protein-coding gene	gene with protein product		608327				12122055	Standard	NM_145286		Approved	SRO, Epb7.2l	uc001uwx.3	Q8TAV4	OTTHUMG00000016763	ENST00000379631.4:c.17C>T	chr13.hg19:g.39564842G>A	ENSP00000368952:p.Ser6Phe	87.0	0.0		56.0	37.0	NM_145286	B4E285|Q5JS35	Missense_Mutation	SNP	ENST00000379631.4	hg19	CCDS9367.1	.	.	.	.	.	.	.	.	.	.	G	8.222	0.802790	0.16397	.	.	ENSG00000133115	ENST00000379631	D	0.98567	-5.0	4.71	4.71	0.59529	.	2.132240	0.01386	N	0.013090	D	0.95373	0.8498	N	0.08118	0	0.25424	N	0.98824	B	0.22480	0.07	B	0.28011	0.085	D	0.87485	0.2423	10	0.59425	D	0.04	0.2834	10.481	0.44693	0.0:0.0:0.8061:0.1939	.	6	Q8TAV4	STML3_HUMAN	F	6	ENSP00000368952:S6F	ENSP00000368952:S6F	S	-	2	0	STOML3	38462842	0.256000	0.24012	0.097000	0.21041	0.300000	0.27592	0.354000	0.20146	2.153000	0.67306	0.650000	0.86243	TCT	.	.		0.403	STOML3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000044604.2		
DZIP1	22873	hgsc.bcm.edu	37	13	96239841	96239841	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A8HS-01A-11D-A35Z-10	TCGA-CC-A8HS-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	eec73def-9c6d-487a-b4b5-d9e879138027	4de9ebd4-2594-4178-b695-344708a55698	g.chr13:96239841T>C	ENST00000376829.2	-	20	3021	c.2170A>G	c.(2170-2172)Acc>Gcc	p.T724A	DZIP1_ENST00000347108.3_Missense_Mutation_p.T724A|DZIP1_ENST00000361156.3_Missense_Mutation_p.T705A|DZIP1_ENST00000361396.2_Missense_Mutation_p.T705A	NM_198968.3	NP_945319.1	Q86YF9	DZIP1_HUMAN	DAZ interacting zinc finger protein 1	724					cilium assembly (GO:0042384)|germ cell development (GO:0007281)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)			endometrium(1)|kidney(1)|large_intestine(20)|lung(11)|ovary(2)|pancreas(1)|skin(1)|stomach(1)	38	all_neural(89;0.0878)|Breast(111;0.148)|Medulloblastoma(90;0.163)		BRCA - Breast invasive adenocarcinoma(86;0.141)			CTTCCCTCGGTCCCGTCCGCG	0.552																																					p.T724A		Atlas-SNP	.											.	DZIP1	195	.	0			c.A2170G						.						183.0	155.0	164.0					13																	96239841		2203	4300	6503	SO:0001583	missense	22873	exon20			CCTCGGTCCCGTC	AB023213	CCDS9477.1, CCDS9478.1	13q32.1	2013-05-22	2013-05-22		ENSG00000134874	ENSG00000134874		"""Zinc fingers, C2H2-type"""	20908	protein-coding gene	gene with protein product		608671	"""DAZ interacting protein 1"""				Standard	NM_014934		Approved	KIAA0996, DZIP	uc001vmk.4	Q86YF9	OTTHUMG00000017224	ENST00000376829.2:c.2170A>G	chr13.hg19:g.96239841T>C	ENSP00000366025:p.Thr724Ala	90.0	0.0		142.0	69.0	NM_198968	Q5W078|Q5W079|Q8WY45|Q8WY46|Q9UGA5|Q9Y2K0	Missense_Mutation	SNP	ENST00000376829.2	hg19	CCDS9478.1	.	.	.	.	.	.	.	.	.	.	T	7.446	0.641623	0.14451	.	.	ENSG00000134874	ENST00000347108;ENST00000361156;ENST00000361396;ENST00000376829	T;T;T;T	0.34859	1.34;1.34;1.34;1.34	5.35	4.15	0.48705	.	0.571979	0.18370	N	0.143293	T	0.34716	0.0907	M	0.72894	2.215	0.25802	N	0.984495	P;B	0.35307	0.494;0.361	B;B	0.32465	0.146;0.069	T	0.35276	-0.9795	10	0.59425	D	0.04	-13.0104	7.2039	0.25897	0.1452:0.0:0.152:0.7029	.	705;724	Q86YF9-2;Q86YF9	.;DZIP1_HUMAN	A	724;705;705;724	ENSP00000257312:T724A;ENSP00000355018:T705A;ENSP00000355175:T705A;ENSP00000366025:T724A	ENSP00000257312:T724A	T	-	1	0	DZIP1	95037842	1.000000	0.71417	0.916000	0.36221	0.003000	0.03518	2.004000	0.40854	0.845000	0.35118	-0.316000	0.08728	ACC	.	.		0.552	DZIP1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000045496.3	NM_014934	
ZIC2	7546	hgsc.bcm.edu	37	13	100637726	100637726	+	Silent	SNP	G	G	T			TCGA-CC-A8HS-01A-11D-A35Z-10	TCGA-CC-A8HS-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	eec73def-9c6d-487a-b4b5-d9e879138027	4de9ebd4-2594-4178-b695-344708a55698	g.chr13:100637726G>T	ENST00000376335.3	+	3	1682	c.1389G>T	c.(1387-1389)gcG>gcT	p.A463A	ZIC2_ENST00000477213.1_3'UTR	NM_007129.3	NP_009060.2	O95409	ZIC2_HUMAN	Zic family member 2	463	Poly-Ala.				brain development (GO:0007420)|developmental pigmentation (GO:0048066)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube closure (GO:0001843)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription, DNA-templated (GO:0045893)|retinal ganglion cell axon guidance (GO:0031290)|transcription, DNA-templated (GO:0006351)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			large_intestine(2)|liver(2)|lung(5)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	13	all_neural(89;0.0837)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)					cggcggcggcggctgcggcgg	0.816																																					p.A463A	Pancreas(97;119 1522 31925 44771 48764)	Atlas-SNP	.											.	ZIC2	25	.	0			c.G1389T						.						2.0	3.0	3.0					13																	100637726		765	1850	2615	SO:0001819	synonymous_variant	7546	exon3			GGCGGCGGCTGCG	AF104902	CCDS9495.1	13q32	2013-01-08	2011-05-19		ENSG00000043355	ENSG00000043355		"""Zinc fingers, C2H2-type"""	12873	protein-coding gene	gene with protein product	"""Zinc finger protein of the cerebellum 2"""	603073	"""Zic family member 2 (odd-paired Drosophila homolog)"", ""Zic family member 2 (odd-paired homolog, Drosophila)"""			9771712	Standard	NM_007129		Approved	HPE5	uc001von.3	O95409	OTTHUMG00000017279	ENST00000376335.3:c.1389G>T	chr13.hg19:g.100637726G>T		92.0	0.0		113.0	5.0	NM_007129	Q5VYA9|Q9H309	Silent	SNP	ENST00000376335.3	hg19	CCDS9495.1																																																																																			.	.		0.816	ZIC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045618.2	NM_007129	
TEP1	7011	hgsc.bcm.edu	37	14	20850191	20850191	+	Silent	SNP	C	C	T			TCGA-CC-A8HS-01A-11D-A35Z-10	TCGA-CC-A8HS-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	eec73def-9c6d-487a-b4b5-d9e879138027	4de9ebd4-2594-4178-b695-344708a55698	g.chr14:20850191C>T	ENST00000262715.5	-	30	4345	c.4305G>A	c.(4303-4305)ctG>ctA	p.L1435L	TEP1_ENST00000545983.1_5'UTR|TEP1_ENST00000556935.1_Silent_p.L1327L	NM_007110.4	NP_009041.2	Q99973	TEP1_HUMAN	telomerase-associated protein 1	1435	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.				RNA-dependent DNA replication (GO:0006278)|telomere maintenance via recombination (GO:0000722)	chromosome, telomeric region (GO:0000781)|cytoplasm (GO:0005737)|nuclear matrix (GO:0016363)|ribonucleoprotein complex (GO:0030529)|telomerase holoenzyme complex (GO:0005697)	ATP binding (GO:0005524)|RNA binding (GO:0003723)			NS(4)|breast(1)|central_nervous_system(4)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(48)|ovary(7)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	96	all_cancers(95;0.00123)	all_lung(585;0.235)	Epithelial(56;7.42e-08)|all cancers(55;6.46e-07)	GBM - Glioblastoma multiforme(265;0.028)|READ - Rectum adenocarcinoma(17;0.233)		GCCACACACTCAGCACTCCGT	0.597																																					p.L1435L		Atlas-SNP	.											.	TEP1	224	.	0			c.G4305A						.						127.0	105.0	113.0					14																	20850191		2203	4300	6503	SO:0001819	synonymous_variant	7011	exon30			CACACTCAGCACT		CCDS9548.1	14q11.2	2013-01-10			ENSG00000129566	ENSG00000129566		"""WD repeat domain containing"""	11726	protein-coding gene	gene with protein product	"""TROVE domain family, member 1"""	601686				9403057	Standard	NM_007110		Approved	TP1, TLP1, VAULT2, p240, TROVE1	uc001vxe.3	Q99973	OTTHUMG00000029515	ENST00000262715.5:c.4305G>A	chr14.hg19:g.20850191C>T		67.0	0.0		112.0	60.0	NM_007110	A0AUV9	Silent	SNP	ENST00000262715.5	hg19	CCDS9548.1																																																																																			.	.		0.597	TEP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000073563.2	NM_007110	
PTPN21	11099	hgsc.bcm.edu	37	14	88970830	88970830	+	Missense_Mutation	SNP	G	G	C			TCGA-CC-A8HS-01A-11D-A35Z-10	TCGA-CC-A8HS-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	eec73def-9c6d-487a-b4b5-d9e879138027	4de9ebd4-2594-4178-b695-344708a55698	g.chr14:88970830G>C	ENST00000556564.1	-	6	810	c.526C>G	c.(526-528)Caa>Gaa	p.Q176E	PTPN21_ENST00000328736.3_Missense_Mutation_p.Q176E|PTPN21_ENST00000554628.1_5'UTR|RP11-507K2.2_ENST00000555444.1_RNA	NM_007039.3	NP_008970.2	Q16825	PTN21_HUMAN	protein tyrosine phosphatase, non-receptor type 21	176	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	protein tyrosine phosphatase activity (GO:0004725)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(13)|liver(1)|lung(7)|ovary(4)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	45						TTTTCATCTTGTAACCATCCC	0.383																																					p.Q176E		Atlas-SNP	.											.	PTPN21	113	.	0			c.C526G						.						166.0	154.0	158.0					14																	88970830		2203	4299	6502	SO:0001583	missense	11099	exon6			CATCTTGTAACCA	X79510	CCDS9884.1	14q31	2011-06-09				ENSG00000070778		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9651	protein-coding gene	gene with protein product		603271				7519780	Standard	NM_007039		Approved	PTPD1, PTPRL10	uc001xwv.4	Q16825		ENST00000556564.1:c.526C>G	chr14.hg19:g.88970830G>C	ENSP00000452414:p.Gln176Glu	113.0	0.0		76.0	59.0	NM_007039		Missense_Mutation	SNP	ENST00000556564.1	hg19	CCDS9884.1	.	.	.	.	.	.	.	.	.	.	G	9.674	1.147392	0.21288	.	.	ENSG00000070778	ENST00000328736;ENST00000556564;ENST00000555243	T;T;T	0.26957	1.7;1.7;1.7	5.18	5.18	0.71444	Band 4.1 domain (1);FERM central domain (2);FERM domain (1);FERM/acyl-CoA-binding protein, 3-helical bundle (1);	0.148278	0.47455	D	0.000240	T	0.41719	0.1171	M	0.78916	2.43	0.46901	D	0.999244	B;P	0.43938	0.022;0.822	B;P	0.46718	0.022;0.525	T	0.28396	-1.0045	10	0.34782	T	0.22	.	19.0577	0.93072	0.0:0.0:1.0:0.0	.	176;176	G3V3S6;Q16825	.;PTN21_HUMAN	E	176	ENSP00000330276:Q176E;ENSP00000452414:Q176E;ENSP00000451401:Q176E	ENSP00000330276:Q176E	Q	-	1	0	PTPN21	88040583	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.124000	0.94394	2.574000	0.86865	0.655000	0.94253	CAA	.	.		0.383	PTPN21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410303.1		
AHNAK2	113146	hgsc.bcm.edu	37	14	105408769	105408769	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A8HS-01A-11D-A35Z-10	TCGA-CC-A8HS-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	eec73def-9c6d-487a-b4b5-d9e879138027	4de9ebd4-2594-4178-b695-344708a55698	g.chr14:105408769T>C	ENST00000333244.5	-	7	13138	c.13019A>G	c.(13018-13020)gAc>gGc	p.D4340G	AHNAK2_ENST00000557457.1_Intron	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	4340						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)				cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			GGTCTTCAGGTCCCCCTGCAT	0.622																																					p.D4340G		Atlas-SNP	.											.	AHNAK2	719	.	0			c.A13019G						.						146.0	155.0	152.0					14																	105408769		1979	4145	6124	SO:0001583	missense	113146	exon7			TTCAGGTCCCCCT	AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.13019A>G	chr14.hg19:g.105408769T>C	ENSP00000353114:p.Asp4340Gly	110.0	0.0		93.0	4.0	NM_138420	Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Missense_Mutation	SNP	ENST00000333244.5	hg19	CCDS45177.1	.	.	.	.	.	.	.	.	.	.	t	13.44	2.238841	0.39598	.	.	ENSG00000185567	ENST00000333244	T	0.02177	4.41	3.31	2.14	0.27477	.	.	.	.	.	T	0.09642	0.0237	M	0.75884	2.315	0.09310	N	1	D	0.89917	1.0	D	0.91635	0.999	T	0.13150	-1.0520	9	0.45353	T	0.12	.	7.3174	0.26507	0.0:0.1144:0.0:0.8856	.	4340	Q8IVF2	AHNK2_HUMAN	G	4340	ENSP00000353114:D4340G	ENSP00000353114:D4340G	D	-	2	0	AHNAK2	104479814	0.000000	0.05858	0.001000	0.08648	0.010000	0.07245	0.336000	0.19823	0.218000	0.20820	0.254000	0.18369	GAC	.	.		0.622	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410300.1	NM_138420	
RPL4	6124	hgsc.bcm.edu	37	15	66795056	66795056	+	Silent	SNP	G	G	C			TCGA-CC-A8HS-01A-11D-A35Z-10	TCGA-CC-A8HS-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	eec73def-9c6d-487a-b4b5-d9e879138027	4de9ebd4-2594-4178-b695-344708a55698	g.chr15:66795056G>C	ENST00000307961.6	-	4	407	c.315C>G	c.(313-315)acC>acG	p.T105T	SNORD16_ENST00000362803.1_RNA|ZWILCH_ENST00000307897.5_5'Flank|SNORD18C_ENST00000362704.1_RNA|SNORD18B_ENST00000365659.1_RNA|ZWILCH_ENST00000446801.2_5'Flank|RPL4_ENST00000564517.1_5'Flank|RPL4_ENST00000568588.1_Silent_p.T11T|ZWILCH_ENST00000535141.2_5'Flank|ZWILCH_ENST00000565627.1_5'Flank|SNORD18A_ENST00000363753.1_RNA	NM_000968.3	NP_000959.2	P36578	RL4_HUMAN	ribosomal protein L4	105					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)			endometrium(2)|kidney(1)|large_intestine(3)|lung(8)|skin(1)|stomach(1)|urinary_tract(1)	17						GCCAGGTTTTGGTTGGTGCAA	0.463																																					p.T105T		Atlas-SNP	.											.	RPL4	29	.	0			c.C315G						.						117.0	108.0	111.0					15																	66795056		2201	4299	6500	SO:0001819	synonymous_variant	6124	exon4			GGTTTTGGTTGGT	AB007167	CCDS10218.1	15q22	2011-04-06			ENSG00000174444	ENSG00000174444		"""L ribosomal proteins"""	10353	protein-coding gene	gene with protein product	"""60S ribosomal protein L4"""	180479				9582194, 8268230	Standard	NM_000968		Approved	L4	uc002apv.3	P36578	OTTHUMG00000133193	ENST00000307961.6:c.315C>G	chr15.hg19:g.66795056G>C		189.0	0.0		123.0	49.0	NM_000968	A8K502|P39029|Q4VBR0|Q969Z9	Silent	SNP	ENST00000307961.6	hg19	CCDS10218.1																																																																																			.	.		0.463	RPL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256903.2	NM_000968	
SCNN1B	6338	hgsc.bcm.edu	37	16	23364163	23364163	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A8HS-01A-11D-A35Z-10	TCGA-CC-A8HS-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	eec73def-9c6d-487a-b4b5-d9e879138027	4de9ebd4-2594-4178-b695-344708a55698	g.chr16:23364163T>A	ENST00000343070.2	+	3	529	c.353T>A	c.(352-354)cTg>cAg	p.L118Q	SCNN1B_ENST00000569789.1_3'UTR|SCNN1B_ENST00000307331.5_Missense_Mutation_p.L163Q|SCNN1B_ENST00000568923.1_Missense_Mutation_p.L118Q|SCNN1B_ENST00000568085.1_Missense_Mutation_p.L118Q	NM_000336.2	NP_000327.2	P51168	SCNNB_HUMAN	sodium channel, non-voltage-gated 1, beta subunit	118					excretion (GO:0007588)|ion transmembrane transport (GO:0034220)|multicellular organismal water homeostasis (GO:0050891)|response to stimulus (GO:0050896)|sensory perception of taste (GO:0050909)|sodium ion homeostasis (GO:0055078)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|sodium channel complex (GO:0034706)	ligand-gated sodium channel activity (GO:0015280)|WW domain binding (GO:0050699)			breast(2)|endometrium(3)|kidney(2)|large_intestine(5)|liver(2)|lung(8)|ovary(3)|pancreas(1)|prostate(3)|skin(1)|stomach(1)|urinary_tract(1)	32				GBM - Glioblastoma multiforme(48;0.0465)	Amiloride(DB00594)|Triamterene(DB00384)	CTGGATGAGCTGATGGAAGCT	0.517																																					p.L118Q		Atlas-SNP	.											.	SCNN1B	81	.	0			c.T353A						.						107.0	96.0	100.0					16																	23364163		2197	4300	6497	SO:0001583	missense	6338	exon3			ATGAGCTGATGGA	X87159	CCDS10609.1	16p12.2-p12.1	2012-02-28	2012-02-28		ENSG00000168447	ENSG00000168447		"""Ion channels / Sodium channel, nonvoltage-gated"", ""Sodium channels"""	10600	protein-coding gene	gene with protein product	"""Liddle syndrome"""	600760	"""sodium channel, nonvoltage-gated 1, beta"", ""sodium channel, non-voltage-gated 1, beta"""				Standard	NM_000336		Approved	ENaCbeta	uc002dln.3	P51168	OTTHUMG00000131608	ENST00000343070.2:c.353T>A	chr16.hg19:g.23364163T>A	ENSP00000345751:p.Leu118Gln	95.0	0.0		57.0	23.0	NM_000336	C5HTZ2|O60891|Q96KG2|Q9UJ32|Q9UMU5	Missense_Mutation	SNP	ENST00000343070.2	hg19	CCDS10609.1	.	.	.	.	.	.	.	.	.	.	T	20.8	4.050835	0.75960	.	.	ENSG00000168447	ENST00000343070;ENST00000307331	T;T	0.61392	0.11;0.11	5.0	5.0	0.66597	.	3.762580	0.00935	N	0.002776	T	0.80681	0.4669	M	0.78637	2.42	0.46376	D	0.999018	D	0.89917	1.0	D	0.97110	1.0	T	0.59804	-0.7385	10	0.62326	D	0.03	-6.5618	13.8924	0.63747	0.0:0.0:0.0:1.0	.	118	P51168	SCNNB_HUMAN	Q	118;163	ENSP00000345751:L118Q;ENSP00000302874:L163Q	ENSP00000302874:L163Q	L	+	2	0	SCNN1B	23271664	1.000000	0.71417	0.987000	0.45799	0.970000	0.65996	5.028000	0.64115	1.857000	0.53885	0.460000	0.39030	CTG	.	.		0.517	SCNN1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254495.2		
GLG1	2734	hgsc.bcm.edu	37	16	74640738	74640739	+	Missense_Mutation	DNP	AG	AG	CT			TCGA-CC-A8HS-01A-11D-A35Z-10	TCGA-CC-A8HS-10A-01D-A35Z-10	A|G	A|G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	eec73def-9c6d-487a-b4b5-d9e879138027	4de9ebd4-2594-4178-b695-344708a55698	g.chr16:74640738_74640739AG>CT	ENST00000422840.2	-	1	253_254	c.254_255CT>AG	c.(253-255)cCT>cAG	p.P85Q	GLG1_ENST00000447066.2_Missense_Mutation_p.P85Q|GLG1_ENST00000205061.5_Missense_Mutation_p.P85Q	NM_001145667.1	NP_001139139.1	Q92896	GSLG1_HUMAN	golgi glycoprotein 1	85	Poly-Gln.			P -> L (in Ref. 1; AAB06460). {ECO:0000305}.	blood coagulation (GO:0007596)|bone morphogenesis (GO:0060349)|leukocyte migration (GO:0050900)|negative regulation of protein processing (GO:0010955)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|regulation of chondrocyte differentiation (GO:0032330)	extracellular matrix (GO:0031012)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	receptor binding (GO:0005102)			breast(2)|cervix(2)|endometrium(6)|kidney(8)|large_intestine(6)|lung(28)|ovary(3)|prostate(1)|skin(1)	57						gcggcggctgaggctgctgttg	0.733																																					p.P85P|p.P85H		Atlas-SNP	.											.	GLG1	106	.	0			c.T255G|c.C254A						.																																			SO:0001583	missense	2734	exon1			CGGCTGAGGCTGC|GGCTGAGGCTGCT		CCDS32485.1, CCDS45526.1, CCDS45527.1	16q22-q23	2010-02-12	2010-02-12			ENSG00000090863			4316	protein-coding gene	gene with protein product		600753	"""golgi apparatus protein 1"""			8530051, 7531823	Standard	NM_012201		Approved	MG-160, ESL-1, CFR-1	uc002fcx.3	Q92896		ENST00000422840.2:c.254_255delinsCT	chr16.hg19:g.74640738_74640739delinsCT	ENSP00000405984:p.Pro85Gln	77.0	0.0		52.0|53.0	15.0|16.0	NM_001145667	B7Z8Y4|D3DUJ7|Q13221|Q6P9D1	Silent|Missense_Mutation	SNP	ENST00000422840.2	hg19	CCDS45527.1																																																																																			.	.		0.733	GLG1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000435750.1	NM_012201	
GLG1	2734	hgsc.bcm.edu	37	16	74640753	74640753	+	Silent	SNP	T	T	C	rs546611688|rs374123768	byFrequency	TCGA-CC-A8HS-01A-11D-A35Z-10	TCGA-CC-A8HS-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	eec73def-9c6d-487a-b4b5-d9e879138027	4de9ebd4-2594-4178-b695-344708a55698	g.chr16:74640753T>C	ENST00000422840.2	-	1	239	c.240A>G	c.(238-240)caA>caG	p.Q80Q	GLG1_ENST00000447066.2_Silent_p.Q80Q|GLG1_ENST00000205061.5_Silent_p.Q80Q	NM_001145667.1	NP_001139139.1	Q92896	GSLG1_HUMAN	golgi glycoprotein 1	80	Poly-Gln.				blood coagulation (GO:0007596)|bone morphogenesis (GO:0060349)|leukocyte migration (GO:0050900)|negative regulation of protein processing (GO:0010955)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|regulation of chondrocyte differentiation (GO:0032330)	extracellular matrix (GO:0031012)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	receptor binding (GO:0005102)			breast(2)|cervix(2)|endometrium(6)|kidney(8)|large_intestine(6)|lung(28)|ovary(3)|prostate(1)|skin(1)	57						gctgttgctgttgctgctgct	0.736																																					p.Q80Q		Atlas-SNP	.											.	GLG1	106	.	0			c.A240G						.						5.0	6.0	6.0					16																	74640753		2053	4079	6132	SO:0001819	synonymous_variant	2734	exon1			TTGCTGTTGCTGC		CCDS32485.1, CCDS45526.1, CCDS45527.1	16q22-q23	2010-02-12	2010-02-12			ENSG00000090863			4316	protein-coding gene	gene with protein product		600753	"""golgi apparatus protein 1"""			8530051, 7531823	Standard	NM_012201		Approved	MG-160, ESL-1, CFR-1	uc002fcx.3	Q92896		ENST00000422840.2:c.240A>G	chr16.hg19:g.74640753T>C		72.0	0.0		53.0	22.0	NM_001145667	B7Z8Y4|D3DUJ7|Q13221|Q6P9D1	Silent	SNP	ENST00000422840.2	hg19	CCDS45527.1																																																																																			.	.		0.736	GLG1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000435750.1	NM_012201	
GLG1	2734	hgsc.bcm.edu	37	16	74640777	74640778	+	Missense_Mutation	DNP	AA	AA	CT			TCGA-CC-A8HS-01A-11D-A35Z-10	TCGA-CC-A8HS-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	eec73def-9c6d-487a-b4b5-d9e879138027	4de9ebd4-2594-4178-b695-344708a55698	g.chr16:74640777_74640778AA>CT	ENST00000422840.2	-	1	214_215	c.215_216TT>AG	c.(214-216)cTT>cAG	p.L72Q	GLG1_ENST00000447066.2_Missense_Mutation_p.L72Q|GLG1_ENST00000205061.5_Missense_Mutation_p.L72Q	NM_001145667.1	NP_001139139.1	Q92896	GSLG1_HUMAN	golgi glycoprotein 1	72	Poly-Gln.				blood coagulation (GO:0007596)|bone morphogenesis (GO:0060349)|leukocyte migration (GO:0050900)|negative regulation of protein processing (GO:0010955)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|regulation of chondrocyte differentiation (GO:0032330)	extracellular matrix (GO:0031012)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	receptor binding (GO:0005102)			breast(2)|cervix(2)|endometrium(6)|kidney(8)|large_intestine(6)|lung(28)|ovary(3)|prostate(1)|skin(1)	57						gttgctgctgAAGCTGCGATGA	0.733																																					p.L72L|p.L72H		Atlas-SNP	.											.	GLG1	106	.	0			c.T216G|c.T215A						.																																			SO:0001583	missense	2734	exon1			CTGCTGAAGCTGC|TGCTGAAGCTGCG		CCDS32485.1, CCDS45526.1, CCDS45527.1	16q22-q23	2010-02-12	2010-02-12			ENSG00000090863			4316	protein-coding gene	gene with protein product		600753	"""golgi apparatus protein 1"""			8530051, 7531823	Standard	NM_012201		Approved	MG-160, ESL-1, CFR-1	uc002fcx.3	Q92896		ENST00000422840.2:c.215_216delinsCT	chr16.hg19:g.74640777_74640778delinsCT	ENSP00000405984:p.Leu72Gln	75.0	0.0		53.0|54.0	14.0	NM_001145667	B7Z8Y4|D3DUJ7|Q13221|Q6P9D1	Silent|Missense_Mutation	SNP	ENST00000422840.2	hg19	CCDS45527.1																																																																																			.	.		0.733	GLG1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000435750.1	NM_012201	
MUC16	94025	hgsc.bcm.edu	37	19	9074011	9074011	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A8HS-01A-11D-A35Z-10	TCGA-CC-A8HS-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	eec73def-9c6d-487a-b4b5-d9e879138027	4de9ebd4-2594-4178-b695-344708a55698	g.chr19:9074011G>T	ENST00000397910.4	-	3	13638	c.13435C>A	c.(13435-13437)Cct>Act	p.P4479T		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	4481	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						GCAGAAACAGGAGAGGATGTA	0.473																																					p.P4479T		Atlas-SNP	.											.	MUC16	4315	.	0			c.C13435A						.						137.0	130.0	132.0					19																	9074011		2031	4174	6205	SO:0001583	missense	94025	exon3			AAACAGGAGAGGA	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.13435C>A	chr19.hg19:g.9074011G>T	ENSP00000381008:p.Pro4479Thr	129.0	0.0		121.0	63.0	NM_024690	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	hg19	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	g	2.511	-0.312868	0.05422	.	.	ENSG00000181143	ENST00000397910	T	0.23348	1.91	2.22	-0.211	0.13172	.	.	.	.	.	T	0.25531	0.0621	L	0.55481	1.735	.	.	.	P	0.40282	0.711	P	0.45276	0.475	T	0.31971	-0.9924	8	0.87932	D	0	.	3.1	0.06323	0.1824:0.2895:0.5281:0.0	.	4479	B5ME49	.	T	4479	ENSP00000381008:P4479T	ENSP00000381008:P4479T	P	-	1	0	MUC16	8935011	0.000000	0.05858	0.000000	0.03702	0.011000	0.07611	-0.866000	0.04245	0.024000	0.15214	0.313000	0.20887	CCT	.	.		0.473	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
ZNF676	163223	hgsc.bcm.edu	37	19	22363152	22363152	+	Missense_Mutation	SNP	T	T	G			TCGA-CC-A8HS-01A-11D-A35Z-10	TCGA-CC-A8HS-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	eec73def-9c6d-487a-b4b5-d9e879138027	4de9ebd4-2594-4178-b695-344708a55698	g.chr19:22363152T>G	ENST00000397121.2	-	3	1684	c.1367A>C	c.(1366-1368)aAa>aCa	p.K456T		NM_001001411.2	NP_001001411.2	Q8N7Q3	ZN676_HUMAN	zinc finger protein 676	456					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(49)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(2)	67		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.114)				GGTGAAGGCTTTGCCACATTC	0.433																																					p.K456T		Atlas-SNP	.											.	ZNF676	146	.	0			c.A1367C						.						119.0	123.0	122.0					19																	22363152		2152	4274	6426	SO:0001583	missense	163223	exon3			AAGGCTTTGCCAC	AK097798	CCDS42539.1	19p12	2013-01-08				ENSG00000196109		"""Zinc fingers, C2H2-type"""	20429	protein-coding gene	gene with protein product							Standard	NM_001001411		Approved		uc002nqs.1	Q8N7Q3		ENST00000397121.2:c.1367A>C	chr19.hg19:g.22363152T>G	ENSP00000380310:p.Lys456Thr	52.0	0.0		63.0	19.0	NM_001001411	A8MVX5	Missense_Mutation	SNP	ENST00000397121.2	hg19	CCDS42539.1	.	.	.	.	.	.	.	.	.	.	.	12.19	1.862253	0.32884	.	.	ENSG00000196109	ENST00000397121	T	0.35236	1.32	0.85	0.85	0.18980	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.61223	0.2330	M	0.90019	3.08	0.28590	N	0.909714	D	0.76494	0.999	D	0.87578	0.998	T	0.52719	-0.8538	9	0.72032	D	0.01	.	6.592	0.22651	0.0:0.0:0.0:1.0	.	456	Q8N7Q3	ZN676_HUMAN	T	456	ENSP00000380310:K456T	ENSP00000380310:K456T	K	-	2	0	ZNF676	22154992	0.957000	0.32711	0.098000	0.21074	0.098000	0.18820	2.902000	0.48703	0.166000	0.19597	0.164000	0.16699	AAA	.	.		0.433	ZNF676-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464392.1	NM_001001411	
C19orf33	64073	hgsc.bcm.edu	37	19	38795301	38795301	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A8HS-01A-11D-A35Z-10	TCGA-CC-A8HS-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	eec73def-9c6d-487a-b4b5-d9e879138027	4de9ebd4-2594-4178-b695-344708a55698	g.chr19:38795301C>A	ENST00000301246.5	+	3	277	c.176C>A	c.(175-177)tCc>tAc	p.S59Y	C19orf33_ENST00000588605.1_Missense_Mutation_p.P79T|CTB-102L5.4_ENST00000591889.1_Silent_p.L146L	NM_033520.1	NP_277055.1	Q9GZP8	IMUP_HUMAN	chromosome 19 open reading frame 33	59						nucleus (GO:0005634)						all_cancers(60;1.07e-06)		Lung(45;0.000246)|LUSC - Lung squamous cell carcinoma(53;0.000292)			AGCAGCAGCTCCAGCGATTCG	0.667																																					p.S59Y		Atlas-SNP	.											.	C19orf33	9	.	0			c.C176A						.						41.0	46.0	44.0					19																	38795301		2203	4300	6503	SO:0001583	missense	64073	exon3			GCAGCTCCAGCGA	AF213678	CCDS12511.1	19q13.2	2012-10-26			ENSG00000167644	ENSG00000167644			16668	protein-coding gene	gene with protein product	"""immortalization-upregulated protein"", ""HAI-2 related small protein"", ""hepatocyte growth factor activator inhibitor type 2-related small protein"""					11080599	Standard	NM_033520		Approved	IMUP-1, IMUP-2, H2RSP, IMUP	uc002ohu.1	Q9GZP8	OTTHUMG00000181894	ENST00000301246.5:c.176C>A	chr19.hg19:g.38795301C>A	ENSP00000301246:p.Ser59Tyr	150.0	0.0		231.0	165.0	NM_033520	Q0P6G2|Q96H58|Q9HCR4	Missense_Mutation	SNP	ENST00000301246.5	hg19	CCDS12511.1	.	.	.	.	.	.	.	.	.	.	C	12.37	1.918526	0.33908	.	.	ENSG00000167644	ENST00000301246	.	.	.	4.23	0.63	0.17693	.	1.043110	0.07588	N	0.921454	T	0.41696	0.1170	L	0.34521	1.04	0.22803	N	0.998719	D	0.67145	0.996	P	0.60286	0.872	T	0.31613	-0.9937	9	0.87932	D	0	-10.0071	6.1672	0.20396	0.0:0.5283:0.3666:0.105	.	59	Q9GZP8	IMUP_HUMAN	Y	59	.	ENSP00000301246:S59Y	S	+	2	0	C19orf33	43487141	1.000000	0.71417	0.989000	0.46669	0.330000	0.28571	0.826000	0.27407	0.129000	0.18514	0.555000	0.69702	TCC	.	.		0.667	C19orf33-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000458168.1	NM_033520	
SSC5D	284297	hgsc.bcm.edu	37	19	56029616	56029616	+	Missense_Mutation	SNP	C	C	A	rs35104581|rs150781976	byFrequency	TCGA-CC-A8HS-01A-11D-A35Z-10	TCGA-CC-A8HS-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	eec73def-9c6d-487a-b4b5-d9e879138027	4de9ebd4-2594-4178-b695-344708a55698	g.chr19:56029616C>A	ENST00000389623.6	+	14	3996	c.3973C>A	c.(3973-3975)Ccc>Acc	p.P1325T		NM_001144950.1	NP_001138422.1	A1L4H1	SRCRL_HUMAN	scavenger receptor cysteine rich family, 5 domains	1325	Pro-rich.|Thr-rich.				defense response to Gram-negative bacterium (GO:0050829)|defense response to Gram-positive bacterium (GO:0050830)|detection of bacterial lipoprotein (GO:0042494)|innate immune response (GO:0045087)|multicellular organismal development (GO:0007275)|negative regulation of interleukin-8 secretion (GO:2000483)|receptor-mediated endocytosis (GO:0006898)	cytoplasm (GO:0005737)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|intracellular (GO:0005622)|membrane (GO:0016020)	extracellular matrix binding (GO:0050840)|fibronectin binding (GO:0001968)|laminin binding (GO:0043236)|scavenger receptor activity (GO:0005044)			NS(1)|breast(1)|skin(2)	4						gacccctcaccccACAACTCC	0.597																																					p.P1325T		Atlas-SNP	.											.	SSC5D	65	.	0			c.C3973A						.						343.0	327.0	332.0					19																	56029616		692	1591	2283	SO:0001583	missense	284297	exon14			CCTCACCCCACAA		CCDS46196.1, CCDS59424.1	19q13.42	2014-07-09	2014-07-09		ENSG00000179954	ENSG00000179954			26641	protein-coding gene	gene with protein product	"""soluble scavenger with 5 domains"""		"""scavenger receptor cysteine rich domain containing (5 domains)"""			19535143	Standard	NM_001144950		Approved	FLJ35258	uc002qlg.4	A1L4H1		ENST00000389623.6:c.3973C>A	chr19.hg19:g.56029616C>A	ENSP00000374274:p.Pro1325Thr	70.0	0.0		114.0	6.0	NM_001144950	B5MDQ5|C7S7T9|C7S7U0|K7EP70	Missense_Mutation	SNP	ENST00000389623.6	hg19	CCDS46196.1	.	.	.	.	.	.	.	.	.	.	-	10.40	1.340729	0.24339	.	.	ENSG00000179954	ENST00000389623	T	0.01902	4.57	2.21	2.21	0.28008	.	.	.	.	.	T	0.02119	0.0066	L	0.27053	0.805	0.09310	N	1	B	0.23854	0.092	B	0.14023	0.01	T	0.42361	-0.9456	9	0.72032	D	0.01	.	8.4195	0.32692	0.0:1.0:0.0:0.0	.	1325	A1L4H1	SRCRL_HUMAN	T	1325	ENSP00000374274:P1325T	ENSP00000374274:P1325T	P	+	1	0	SSC5D	60721428	0.006000	0.16342	0.012000	0.15200	0.113000	0.19764	0.520000	0.22878	1.174000	0.42811	0.165000	0.16767	CCC	.	.		0.597	SSC5D-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000453345.2	XM_001718392	
NLRP5	126206	hgsc.bcm.edu	37	19	56539531	56539531	+	Silent	SNP	C	C	T			TCGA-CC-A8HS-01A-11D-A35Z-10	TCGA-CC-A8HS-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	eec73def-9c6d-487a-b4b5-d9e879138027	4de9ebd4-2594-4178-b695-344708a55698	g.chr19:56539531C>T	ENST00000390649.3	+	7	1932	c.1932C>T	c.(1930-1932)gaC>gaT	p.D644D		NM_153447.4	NP_703148.4	P59047	NALP5_HUMAN	NLR family, pyrin domain containing 5	644					cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|embryo implantation (GO:0007566)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|neuron death (GO:0070997)|organ morphogenesis (GO:0009887)|regulation of protein stability (GO:0031647)|regulation of RNA stability (GO:0043487)	apical cortex (GO:0045179)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|protein complex (GO:0043234)	ATP binding (GO:0005524)			breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|ovary(5)|skin(2)|stomach(4)|upper_aerodigestive_tract(2)	25		Colorectal(82;3.46e-05)|Ovarian(87;0.0481)|Renal(1328;0.157)		GBM - Glioblastoma multiforme(193;0.0326)		TGAGCGAAGACGTAAGGAGGC	0.552																																					p.D644D		Atlas-SNP	.											.	NLRP5	217	.	0			c.C1932T						.						61.0	63.0	62.0					19																	56539531		1976	4149	6125	SO:0001819	synonymous_variant	126206	exon7			CGAAGACGTAAGG	AY154460	CCDS12938.1	19q13.43	2008-10-30	2006-12-08	2006-12-08	ENSG00000171487	ENSG00000171487		"""Nucleotide-binding domain and leucine rich repeat containing"""	21269	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 5"""	609658	"""NACHT, leucine rich repeat and PYD containing 5"""	NALP5		12563287, 11925379	Standard	NM_153447		Approved	PYPAF8, MATER, PAN11, CLR19.8	uc002qmj.3	P59047	OTTHUMG00000149887	ENST00000390649.3:c.1932C>T	chr19.hg19:g.56539531C>T		80.0	0.0		75.0	8.0	NM_153447	A8MTY4|Q86W29	Silent	SNP	ENST00000390649.3	hg19	CCDS12938.1																																																																																			.	.		0.552	NLRP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313735.1	NM_153447	
ZNF814	730051	hgsc.bcm.edu	37	19	58386258	58386258	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A8HS-01A-11D-A35Z-10	TCGA-CC-A8HS-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	eec73def-9c6d-487a-b4b5-d9e879138027	4de9ebd4-2594-4178-b695-344708a55698	g.chr19:58386258C>A	ENST00000435989.2	-	3	734	c.500G>T	c.(499-501)gGg>gTg	p.G167V	ZNF814_ENST00000597342.1_Intron|ZNF814_ENST00000595295.1_Intron|ZNF814_ENST00000596604.1_Intron|ZNF814_ENST00000597832.1_Intron|ZNF814_ENST00000600634.1_Intron	NM_001144989.1	NP_001138461.1	B7Z6K7	ZN814_HUMAN	zinc finger protein 814	167					regulation of transcription, DNA-templated (GO:0006355)	intracellular (GO:0005622)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|central_nervous_system(2)|endometrium(3)|kidney(9)|lung(2)|prostate(4)|skin(1)|urinary_tract(3)	25						AGATGACTCCCCTGACACATG	0.498																																					p.G167V		Atlas-SNP	.											ZNF814,NS,carcinoma,0,1	ZNF814	93	.	0			c.G500T						.						108.0	81.0	89.0					19																	58386258		692	1590	2282	SO:0001583	missense	730051	exon3			GACTCCCCTGACA		CCDS46212.1	19q13.43	2013-01-08			ENSG00000204514	ENSG00000204514		"""Zinc fingers, C2H2-type"", ""-"""	33258	protein-coding gene	gene with protein product							Standard	NM_001144989		Approved		uc002qqo.2	B7Z6K7		ENST00000435989.2:c.500G>T	chr19.hg19:g.58386258C>A	ENSP00000410545:p.Gly167Val	327.0	0.0		310.0	159.0	NM_001144989	A6NF35	Missense_Mutation	SNP	ENST00000435989.2	hg19	CCDS46212.1	.	.	.	.	.	.	.	.	.	.	.	11.16	1.555809	0.27827	.	.	ENSG00000204514	ENST00000435989;ENST00000376205	T	0.07688	3.17	2.27	-4.54	0.03452	.	.	.	.	.	T	0.05090	0.0136	N	0.14661	0.345	0.09310	N	1	P	0.50528	0.936	P	0.47827	0.558	T	0.13282	-1.0515	9	0.66056	D	0.02	.	1.3582	0.02186	0.1613:0.1936:0.16:0.4851	.	167	B7Z6K7	ZN814_HUMAN	V	167	ENSP00000410545:G167V	ENSP00000365378:G167V	G	-	2	0	ZNF814	63078070	0.000000	0.05858	0.000000	0.03702	0.068000	0.16541	-2.636000	0.00867	-1.214000	0.02614	-1.152000	0.01820	GGG	.	.		0.498	ZNF814-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466976.1	XM_001725708	
OR5AU1	390445	hgsc.bcm.edu	37	14	21623894	21623895	+	Frame_Shift_Ins	INS	-	-	GA			TCGA-CC-A8HS-01A-11D-A35Z-10	TCGA-CC-A8HS-10A-01D-A35Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	eec73def-9c6d-487a-b4b5-d9e879138027	4de9ebd4-2594-4178-b695-344708a55698	g.chr14:21623894_21623895insGA	ENST00000304418.3	-	1	327_328	c.290_291insTC	c.(289-291)ttcfs	p.F97fs		NM_001004731.1	NP_001004731.1	Q8NGC0	O5AU1_HUMAN	olfactory receptor, family 5, subfamily AU, member 1	97						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(12)|pancreas(1)	21	all_cancers(95;0.00238)		Epithelial(56;6.88e-07)|all cancers(55;6.02e-06)	GBM - Glioblastoma multiforme(265;0.0192)		GGATCAGGAGGAACATGACCAG	0.589																																					p.F97fs		Atlas-INDEL	.											.	OR5AU1	46	.	0			c.291_292insTC						.																																			SO:0001589	frameshift_variant	390445	exon1			.	AL157687	CCDS32042.1	14q11.2	2013-09-23			ENSG00000169327	ENSG00000169327		"""GPCR / Class A : Olfactory receptors"""	15362	protein-coding gene	gene with protein product							Standard	NM_001004731		Approved		uc010tlp.2	Q8NGC0	OTTHUMG00000170753	ENST00000304418.3:c.290_291insTC	chr14.hg19:g.21623894_21623895insGA	ENSP00000302057:p.Phe97fs	136.0	0.0		149.0	11.0	NM_001004731	B2RP78|Q6IEU2|Q96R10	Frame_Shift_Ins	INS	ENST00000304418.3	hg19	CCDS32042.1																																																																																			.	.		0.589	OR5AU1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410213.1		
HPGD	3248	hgsc.bcm.edu	37	4	175414376	175414376	+	Frame_Shift_Del	DEL	T	T	-			TCGA-CC-A8HS-01A-11D-A35Z-10	TCGA-CC-A8HS-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	eec73def-9c6d-487a-b4b5-d9e879138027	4de9ebd4-2594-4178-b695-344708a55698	g.chr4:175414376delT	ENST00000296522.6	-	6	1034	c.588delA	c.(586-588)aaafs	p.K196fs	HPGD_ENST00000296521.7_Intron|HPGD_ENST00000510901.1_Frame_Shift_Del_p.K75fs|HPGD_ENST00000542498.1_Intron|HPGD_ENST00000541923.1_Frame_Shift_Del_p.K75fs|HPGD_ENST00000422112.2_Frame_Shift_Del_p.K128fs	NM_000860.5|NM_001145816.2|NM_001256301.1|NM_001256307.1	NP_000851.2|NP_001139288.1|NP_001243230.1|NP_001243236.1	P15428	PGDH_HUMAN	hydroxyprostaglandin dehydrogenase 15-(NAD)	196					arachidonic acid metabolic process (GO:0019369)|cyclooxygenase pathway (GO:0019371)|ductus arteriosus closure (GO:0097070)|female pregnancy (GO:0007565)|lipoxin metabolic process (GO:2001300)|lipoxygenase pathway (GO:0019372)|negative regulation of cell cycle (GO:0045786)|ovulation (GO:0030728)|parturition (GO:0007567)|prostaglandin metabolic process (GO:0006693)|small molecule metabolic process (GO:0044281)|thrombin receptor signaling pathway (GO:0070493)|transforming growth factor beta receptor signaling pathway (GO:0007179)	basolateral plasma membrane (GO:0016323)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	15-hydroxyprostaglandin dehydrogenase (NAD+) activity (GO:0016404)|catalytic activity (GO:0003824)|NAD binding (GO:0051287)|NAD+ binding (GO:0070403)|prostaglandin E receptor activity (GO:0004957)|protein homodimerization activity (GO:0042803)			kidney(1)|lung(3)|prostate(3)	7		Prostate(90;0.00763)|Melanoma(52;0.0179)|Renal(120;0.0376)|Breast(14;0.0991)|all_hematologic(60;0.124)|all_neural(102;0.196)		all cancers(43;2.6e-18)|Epithelial(43;4.19e-16)|OV - Ovarian serous cystadenocarcinoma(60;5.23e-09)|GBM - Glioblastoma multiforme(59;0.00176)|STAD - Stomach adenocarcinoma(60;0.00299)|LUSC - Lung squamous cell carcinoma(193;0.0253)		TGTTTTCTTCTTTTTCAATTG	0.333																																					p.E197fs		Atlas-INDEL	.											.	HPGD	19	.	0			c.589delG						.						91.0	89.0	90.0					4																	175414376		2203	4299	6502	SO:0001589	frameshift_variant	3248	exon6			.		CCDS3821.1, CCDS54821.1, CCDS58933.1, CCDS58934.1, CCDS58935.1	4q34-q35	2011-09-14			ENSG00000164120	ENSG00000164120	1.1.1.141	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 1"""	5154	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 36C, member 1"""	601688				19027726	Standard	NM_000860		Approved	SDR36C1	uc003itu.3	P15428	OTTHUMG00000160772	ENST00000296522.6:c.588delA	chr4.hg19:g.175414376delT	ENSP00000296522:p.Lys196fs	66.0	0.0		56.0	37.0	NM_000860	B4DTA4|B4DU74|B4DV57|D3DP43|E7EV11|O00749|Q06F08|Q12998	Frame_Shift_Del	DEL	ENST00000296522.6	hg19	CCDS3821.1																																																																																			.	.		0.333	HPGD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362228.3		
OR5AU1	390445	hgsc.bcm.edu	37	14	21623890	21623890	+	Frame_Shift_Del	DEL	G	G	-			TCGA-CC-A8HS-01A-11D-A35Z-10	TCGA-CC-A8HS-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	eec73def-9c6d-487a-b4b5-d9e879138027	4de9ebd4-2594-4178-b695-344708a55698	g.chr14:21623890delG	ENST00000304418.3	-	1	332	c.295delC	c.(295-297)ctgfs	p.L99fs		NM_001004731.1	NP_001004731.1	Q8NGC0	O5AU1_HUMAN	olfactory receptor, family 5, subfamily AU, member 1	99						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(12)|pancreas(1)	21	all_cancers(95;0.00238)		Epithelial(56;6.88e-07)|all cancers(55;6.02e-06)	GBM - Glioblastoma multiforme(265;0.0192)		ACATGGATCAGGAGGAACATG	0.587																																					p.L99fs		Atlas-INDEL	.											.	OR5AU1	46	.	0			c.296delT						.						107.0	87.0	94.0					14																	21623890		2203	4300	6503	SO:0001589	frameshift_variant	390445	exon1			.	AL157687	CCDS32042.1	14q11.2	2013-09-23			ENSG00000169327	ENSG00000169327		"""GPCR / Class A : Olfactory receptors"""	15362	protein-coding gene	gene with protein product							Standard	NM_001004731		Approved		uc010tlp.2	Q8NGC0	OTTHUMG00000170753	ENST00000304418.3:c.295delC	chr14.hg19:g.21623890delG	ENSP00000302057:p.Leu99fs	134.0	0.0		149.0	11.0	NM_001004731	B2RP78|Q6IEU2|Q96R10	Frame_Shift_Del	DEL	ENST00000304418.3	hg19	CCDS32042.1																																																																																			.	.		0.587	OR5AU1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410213.1		
