#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
SCNN1D	6339	hgsc.bcm.edu	37	1	1222594	1222594	+	Missense_Mutation	SNP	C	C	G			TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr1:1222594C>G	ENST00000338555.2	+	6	1877	c.733C>G	c.(733-735)Ccc>Gcc	p.P245A	SCNN1D_ENST00000400928.3_Missense_Mutation_p.P245A|SCNN1D_ENST00000379116.5_Missense_Mutation_p.P409A|SCNN1D_ENST00000325425.8_Missense_Mutation_p.P311A			P51172	SCNND_HUMAN	sodium channel, non-voltage-gated 1, delta subunit	245					ion transmembrane transport (GO:0034220)|response to stimulus (GO:0050896)|sensory perception of taste (GO:0050909)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	actin cytoskeleton (GO:0015629)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ligand-gated sodium channel activity (GO:0015280)			lung(6)|skin(1)	7	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		Epithelial(90;3.01e-35)|OV - Ovarian serous cystadenocarcinoma(86;2.46e-21)|Colorectal(212;0.000157)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00229)|BRCA - Breast invasive adenocarcinoma(365;0.00251)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.034)|Lung(427;0.199)	Amiloride(DB00594)|Triamterene(DB00384)	GGCCCTGCTGCCCGCGGCATG	0.662																																					p.P409A		Atlas-SNP	.											.	SCNN1D	60	.	0			c.C1225G						.						31.0	26.0	28.0					1																	1222594		2186	4288	6474	SO:0001583	missense	6339	exon9			CTGCTGCCCGCGG	U38254	CCDS44037.1, CCDS44037.2	1p36.3-p36.2	2012-02-28	2012-02-28		ENSG00000162572	ENSG00000162572		"""Ion channels / Sodium channel, nonvoltage-gated"", ""Sodium channels"""	10601	protein-coding gene	gene with protein product		601328	"""sodium channel, nonvoltage-gated 1, delta"", ""sodium channel, non-voltage-gated 1, delta"""			8661065	Standard	NM_001130413		Approved	ENaCdelta, dNaCh	uc001adt.1	P51172	OTTHUMG00000002081	ENST00000338555.2:c.733C>G	chr1.hg19:g.1222594C>G	ENSP00000339504:p.Pro245Ala	100.0	0.0		83.0	11.0	NM_001130413	A9Z1X6|B1PS44|Q08AQ3|Q09HT0|Q5T7L3|Q8NA24	Missense_Mutation	SNP	ENST00000338555.2	hg19		.	.	.	.	.	.	.	.	.	.	C	14.51	2.556297	0.45487	.	.	ENSG00000162572	ENST00000379110;ENST00000379116;ENST00000338555;ENST00000325425;ENST00000400928;ENST00000379099	T;T;T;T	0.70399	-0.48;-0.44;-0.48;-0.44	4.06	4.06	0.47325	.	0.508245	0.14308	U	0.327889	D	0.83473	0.5262	M	0.76002	2.32	0.43965	D	0.996647	P;D	0.89917	0.943;1.0	P;D	0.83275	0.874;0.996	D	0.84095	0.0392	10	0.56958	D	0.05	.	14.8084	0.69974	0.0:1.0:0.0:0.0	.	245;409	P51172;A6NNF7	SCNND_HUMAN;.	A	276;409;245;311;245;36	ENSP00000368411:P409A;ENSP00000339504:P245A;ENSP00000321594:P311A;ENSP00000383717:P245A	ENSP00000321594:P311A	P	+	1	0	SCNN1D	1212457	0.374000	0.25081	0.135000	0.22099	0.024000	0.10985	2.055000	0.41345	1.819000	0.53055	0.313000	0.20887	CCC	.	.		0.662	SCNN1D-001	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000005802.2	NM_002978	
C1orf127	148345	hgsc.bcm.edu	37	1	11008817	11008817	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr1:11008817C>T	ENST00000377008.4	-	11	1320	c.874G>A	c.(874-876)Gct>Act	p.A292T	C1orf127_ENST00000377004.4_Missense_Mutation_p.A459T			Q8N9H9	CA127_HUMAN	chromosome 1 open reading frame 127	292	Pro-rich.									NS(2)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(9)|ovary(1)|prostate(2)|skin(5)	32	Ovarian(185;0.249)	Lung NSC(185;0.000226)|all_lung(284;0.000302)|Renal(390;0.000469)|Colorectal(325;0.0062)|Breast(348;0.0139)|Hepatocellular(190;0.0305)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0731)	STAD - Stomach adenocarcinoma(5;0.0224)	UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.71e-07)|COAD - Colon adenocarcinoma(227;7.79e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000305)|Kidney(185;0.000785)|KIRC - Kidney renal clear cell carcinoma(229;0.00262)|READ - Rectum adenocarcinoma(331;0.0509)		CCTCGCTGAGCTTGCACCACT	0.627																																					p.A459T		Atlas-SNP	.											.	C1orf127	134	.	0			c.G1375A						.						54.0	63.0	60.0					1																	11008817		2203	4300	6503	SO:0001583	missense	148345	exon12			GCTGAGCTTGCAC	AK094437	CCDS53267.1	1p36.22	2008-02-05			ENSG00000175262	ENSG00000175262			26730	protein-coding gene	gene with protein product						14702039	Standard	NM_001170754		Approved	FLJ37118	uc010oao.2	Q8N9H9	OTTHUMG00000002032	ENST00000377008.4:c.874G>A	chr1.hg19:g.11008817C>T	ENSP00000366207:p.Ala292Thr	73.0	0.0		64.0	19.0	NM_001170754	A0AVG8|A6NKM7|Q5VXJ2	Missense_Mutation	SNP	ENST00000377008.4	hg19		.	.	.	.	.	.	.	.	.	.	C	14.57	2.575797	0.45902	.	.	ENSG00000175262	ENST00000377004;ENST00000377008	T;T	0.25250	1.81;1.81	4.5	1.35	0.21983	.	2.265380	0.02351	N	0.075942	T	0.24736	0.0600	N	0.19112	0.55	0.09310	N	1	P;P;P	0.45827	0.867;0.764;0.867	P;B;P	0.47645	0.553;0.399;0.553	T	0.21177	-1.0253	10	0.54805	T	0.06	0.958	6.8922	0.24236	0.0:0.5576:0.3416:0.1008	.	310;284;292	B7ZLG7;Q8N9H9-2;Q8N9H9	.;.;CA127_HUMAN	T	459;292	ENSP00000366203:A459T;ENSP00000366207:A292T	ENSP00000366203:A459T	A	-	1	0	C1orf127	10931404	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-0.083000	0.11286	0.392000	0.25172	-0.479000	0.04858	GCT	.	.		0.627	C1orf127-202	KNOWN	basic	protein_coding	protein_coding		NM_173507	
VWA5B1	127731	hgsc.bcm.edu	37	1	20664223	20664223	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr1:20664223G>T	ENST00000375079.2	+	14	2223	c.2027G>T	c.(2026-2028)aGt>aTt	p.S676I	VWA5B1_ENST00000289815.8_Missense_Mutation_p.S676I|VWA5B1_ENST00000289825.4_Missense_Mutation_p.S393I|VWA5B1_ENST00000375083.4_Missense_Mutation_p.S676I|VWA5B1_ENST00000525343.1_3'UTR	NM_001039500.2	NP_001034589.2	Q5TIE3	VW5B1_HUMAN	von Willebrand factor A domain containing 5B1	676						extracellular region (GO:0005576)				central_nervous_system(1)|endometrium(3)|kidney(1)|prostate(1)|skin(1)	7						ACCATGGCAAGTGACCCCATG	0.582																																					p.S676I		Atlas-SNP	.											.	VWA5B1	44	.	0			c.G2027T						.						74.0	78.0	76.0					1																	20664223		692	1591	2283	SO:0001583	missense	127731	exon14			TGGCAAGTGACCC	AK125833, AK057346		1p36.12	2014-02-12			ENSG00000158816	ENSG00000158816			26538	protein-coding gene	gene with protein product							Standard	NM_001039500		Approved	FLJ32784	uc009vps.2	Q5TIE3	OTTHUMG00000002835	ENST00000375079.2:c.2027G>T	chr1.hg19:g.20664223G>T	ENSP00000364220:p.Ser676Ile	226.0	0.0		213.0	64.0	NM_001039500	A4IF35|A4IF36|Q3ZCM4|Q6ZUB4|Q96M71	Missense_Mutation	SNP	ENST00000375079.2	hg19		.	.	.	.	.	.	.	.	.	.	G	17.34	3.363669	0.61513	.	.	ENSG00000158816	ENST00000375089;ENST00000289815;ENST00000375083;ENST00000289825;ENST00000375079	T;T;T;T	0.14766	2.48;2.48;2.48;2.48	5.84	5.84	0.93424	.	0.089231	0.85682	D	0.000000	T	0.29749	0.0743	L	0.34521	1.04	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.999;0.999;0.999;1.0	T	0.00651	-1.1626	10	0.59425	D	0.04	-11.2179	18.7006	0.91619	0.0:0.0:1.0:0.0	.	676;676;676;393	Q5TIE3;Q5TIE3-5;Q5TIE3-2;Q5TIE3-3	VW5B1_HUMAN;.;.;.	I	676;676;676;393;676	ENSP00000289815:S676I;ENSP00000364224:S676I;ENSP00000289825:S393I;ENSP00000364220:S676I	ENSP00000289815:S676I	S	+	2	0	VWA5B1	20536810	1.000000	0.71417	0.462000	0.27118	0.032000	0.12392	8.764000	0.91719	2.762000	0.94881	0.549000	0.68633	AGT	.	.		0.582	VWA5B1-001	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000007945.4	XM_001722222	
C1orf94	84970	hgsc.bcm.edu	37	1	34684343	34684343	+	Missense_Mutation	SNP	G	G	T	rs373403037		TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr1:34684343G>T	ENST00000488417.1	+	7	1898	c.1778G>T	c.(1777-1779)gGg>gTg	p.G593V	C1orf94_ENST00000373374.3_Missense_Mutation_p.G403V	NM_001134734.1	NP_001128206.1	Q6P1W5	CA094_HUMAN	chromosome 1 open reading frame 94	593										central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(15)|skin(4)|upper_aerodigestive_tract(2)	32		Myeloproliferative disorder(586;0.0393)				TCTTCCAGTGGGAATGGCATA	0.502																																					p.G593V		Atlas-SNP	.											C1orf94_ENST00000488417,mucosal,malignant_melanoma,0,2	C1orf94	156	.	0			c.G1778T						.						134.0	129.0	131.0					1																	34684343		2203	4300	6503	SO:0001583	missense	84970	exon7			CCAGTGGGAATGG	AK123355	CCDS381.1, CCDS44108.1	1p34.3	2012-06-26			ENSG00000142698	ENSG00000142698			28250	protein-coding gene	gene with protein product						12477932	Standard	NM_001134734		Approved	MGC15882	uc001bxt.3	Q6P1W5	OTTHUMG00000004012	ENST00000488417.1:c.1778G>T	chr1.hg19:g.34684343G>T	ENSP00000435634:p.Gly593Val	79.0	0.0		76.0	19.0	NM_001134734	B3KVT1|D3DPR3|E9PJ76|Q96IC8	Missense_Mutation	SNP	ENST00000488417.1	hg19	CCDS44108.1	.	.	.	.	.	.	.	.	.	.	G	20.8	4.042661	0.75732	.	.	ENSG00000142698	ENST00000373374;ENST00000488417	T;T	0.49720	0.88;0.77	5.32	5.32	0.75619	.	0.000000	0.64402	D	0.000004	T	0.67496	0.2899	M	0.72118	2.19	0.58432	D	0.999999	D	0.89917	1.0	D	0.97110	1.0	T	0.70777	-0.4780	10	0.87932	D	0	-11.7657	14.5004	0.67716	0.0:0.0:1.0:0.0	.	593	Q6P1W5	CA094_HUMAN	V	403;593	ENSP00000362472:G403V;ENSP00000435634:G593V	ENSP00000362472:G403V	G	+	2	0	C1orf94	34456930	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	3.600000	0.54052	2.487000	0.83934	0.655000	0.94253	GGG	.	.		0.502	C1orf94-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000036845.2	NM_032884	
MFSD2A	84879	hgsc.bcm.edu	37	1	40431615	40431615	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr1:40431615G>T	ENST00000372809.5	+	6	825	c.682G>T	c.(682-684)Gac>Tac	p.D228Y	MFSD2A_ENST00000480630.1_3'UTR|MFSD2A_ENST00000372811.5_Missense_Mutation_p.D215Y|MFSD2A_ENST00000420632.2_Missense_Mutation_p.D59Y	NM_001136493.1	NP_001129965.1	Q8NA29	NLS1_HUMAN	major facilitator superfamily domain containing 2A	228					establishment of blood-brain barrier (GO:0060856)|fatty acid transport (GO:0015908)|lipid transport across blood brain barrier (GO:1990379)|transcytosis (GO:0045056)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	phospholipid transporter activity (GO:0005548)|symporter activity (GO:0015293)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(3)|lung(6)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	24						TTGTTTCCAGGACCTCAATAG	0.572																																					p.D228Y		Atlas-SNP	.											.	MFSD2A	53	.	0			c.G682T						.						126.0	100.0	109.0					1																	40431615		2203	4300	6503	SO:0001583	missense	84879	exon6			TTCCAGGACCTCA	AK093223	CCDS446.1, CCDS44118.1, CCDS72762.1	1p34.2	2009-09-08	2009-09-08	2009-09-08	ENSG00000168389	ENSG00000168389			25897	protein-coding gene	gene with protein product		614397	"""major facilitator superfamily domain containing 2"""	MFSD2		18694395	Standard	XM_005271285		Approved	FLJ14490	uc001cev.3	Q8NA29	OTTHUMG00000009293	ENST00000372809.5:c.682G>T	chr1.hg19:g.40431615G>T	ENSP00000361895:p.Asp228Tyr	173.0	0.0		178.0	37.0	NM_001136493	A8K675|Q6UWU5|Q96F59|Q9BRC8	Missense_Mutation	SNP	ENST00000372809.5	hg19	CCDS44118.1	.	.	.	.	.	.	.	.	.	.	G	11.28	1.592290	0.28357	.	.	ENSG00000168389	ENST00000372811;ENST00000420632;ENST00000434861;ENST00000372809	D;D;D;D	0.87809	-2.3;-2.3;-2.3;-2.3	5.94	-1.04	0.10068	Major facilitator superfamily domain, general substrate transporter (1);	0.895788	0.10030	N	0.724829	T	0.80783	0.4689	L	0.29908	0.895	0.09310	N	1	P;P;P	0.41393	0.748;0.743;0.565	B;P;B	0.49140	0.446;0.601;0.317	T	0.69304	-0.5180	10	0.44086	T	0.13	-1.4567	0.7006	0.00907	0.398:0.1261:0.2195:0.2564	.	178;228;215	B4DNN7;Q8NA29;Q8NA29-2	.;MFS2A_HUMAN;.	Y	215;59;213;228	ENSP00000361898:D215Y;ENSP00000391261:D59Y;ENSP00000407606:D213Y;ENSP00000361895:D228Y	ENSP00000361895:D228Y	D	+	1	0	MFSD2A	40204202	0.524000	0.26282	0.079000	0.20413	0.707000	0.40811	0.907000	0.28531	-0.207000	0.10187	0.563000	0.77884	GAC	.	.		0.572	MFSD2A-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000025756.1	NM_032793	
HIVEP3	59269	hgsc.bcm.edu	37	1	42047556	42047556	+	Silent	SNP	C	C	T			TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr1:42047556C>T	ENST00000372583.1	-	4	3798	c.2913G>A	c.(2911-2913)ctG>ctA	p.L971L	HIVEP3_ENST00000247584.5_Silent_p.L971L|HIVEP3_ENST00000372584.1_Silent_p.L971L|HIVEP3_ENST00000460604.1_5'Flank|HIVEP3_ENST00000429157.2_Silent_p.L971L	NM_024503.4	NP_078779.2	Q5T1R4	ZEP3_HUMAN	human immunodeficiency virus type I enhancer binding protein 3	971	No DNA binding activity or transactivation activity, but complete prevention of TRAF-dependent NF-Kappa-B activation; associates with TRAF2 and JUN. {ECO:0000250}.				positive regulation of transcription, DNA-templated (GO:0045893)|skeletal muscle cell differentiation (GO:0035914)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|breast(3)|central_nervous_system(5)|endometrium(13)|kidney(3)|large_intestine(13)|lung(33)|ovary(4)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	85	Ovarian(52;0.00769)|all_hematologic(146;0.109)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0367)				TGTGGGTGCCCAGGGGTTTGG	0.617																																					p.L971L		Atlas-SNP	.											.	HIVEP3	235	.	0			c.G2913A						.						54.0	58.0	57.0					1																	42047556		2203	4300	6503	SO:0001819	synonymous_variant	59269	exon4			GGTGCCCAGGGGT	AF278765	CCDS463.1, CCDS44124.1	1p34	2013-01-08	2001-11-28		ENSG00000127124	ENSG00000127124		"""Zinc fingers, C2H2-type"""	13561	protein-coding gene	gene with protein product	"""kappabinding protein-1"""	606649	"""human immunodeficiency virus type I enhancer-binding protein 3"""			11161801	Standard	NR_038260		Approved	KRC, KBP1, KBP-1, SHN3, FLJ16752, KIAA1555, ZAS3, Schnurri-3, ZNF40C	uc001cha.4	Q5T1R4	OTTHUMG00000006361	ENST00000372583.1:c.2913G>A	chr1.hg19:g.42047556C>T		132.0	0.0		119.0	26.0	NM_024503	A7YY91|Q5T1R5|Q9BZS0|Q9HCL7	Silent	SNP	ENST00000372583.1	hg19	CCDS463.1																																																																																			.	.		0.617	HIVEP3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000016978.1	NM_024503	
TMEM53	79639	hgsc.bcm.edu	37	1	45120308	45120308	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr1:45120308C>T	ENST00000372237.3	-	3	920	c.757G>A	c.(757-759)Gtc>Atc	p.V253I	TMEM53_ENST00000476724.1_5'UTR|TMEM53_ENST00000372243.3_Intron|TMEM53_ENST00000372244.3_Intron|TMEM53_ENST00000372242.3_Intron|TMEM53_ENST00000372235.3_Missense_Mutation_p.V223I	NM_024587.2	NP_078863.2	Q6P2H8	TMM53_HUMAN	transmembrane protein 53	253						integral component of membrane (GO:0016021)|nucleus (GO:0005634)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|liver(1)|lung(3)|ovary(2)|urinary_tract(1)	10	Acute lymphoblastic leukemia(166;0.155)					AGGTGGCTGACGTGTGCAGAT	0.582																																					p.V253I		Atlas-SNP	.											.	TMEM53	40	.	0			c.G757A						.						97.0	106.0	103.0					1																	45120308		2203	4300	6503	SO:0001583	missense	79639	exon3			GGCTGACGTGTGC		CCDS511.1, CCDS72773.1	1p34.1	2008-02-26			ENSG00000126106	ENSG00000126106			26186	protein-coding gene	gene with protein product						12958361	Standard	XR_425151		Approved	FLJ22353, NET4	uc001cmc.3	Q6P2H8	OTTHUMG00000007833	ENST00000372237.3:c.757G>A	chr1.hg19:g.45120308C>T	ENSP00000361311:p.Val253Ile	67.0	0.0		88.0	4.0	NM_024587	B4DKG0|Q5JPH2|Q6IA07|Q9H6E2	Missense_Mutation	SNP	ENST00000372237.3	hg19	CCDS511.1	.	.	.	.	.	.	.	.	.	.	C	33	5.218833	0.95104	.	.	ENSG00000126106	ENST00000372237;ENST00000372235	.	.	.	5.4	5.4	0.78164	.	0.000000	0.85682	D	0.000000	D	0.85712	0.5760	M	0.90309	3.105	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.87759	0.2597	9	0.56958	D	0.05	.	19.1769	0.93605	0.0:1.0:0.0:0.0	.	253	Q6P2H8	TMM53_HUMAN	I	253;223	.	ENSP00000361309:V223I	V	-	1	0	TMEM53	44892895	1.000000	0.71417	0.987000	0.45799	0.942000	0.58702	7.690000	0.84178	2.533000	0.85409	0.462000	0.41574	GTC	.	.		0.582	TMEM53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021599.1	NM_024587	
PTGER3	5733	hgsc.bcm.edu	37	1	71478137	71478137	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr1:71478137T>A	ENST00000306666.5	-	2	1138	c.928A>T	c.(928-930)Aca>Tca	p.T310S	PTGER3_ENST00000460330.1_Missense_Mutation_p.T310S|PTGER3_ENST00000356595.4_Missense_Mutation_p.T310S|PTGER3_ENST00000354608.5_Missense_Mutation_p.T310S|PTGER3_ENST00000370932.2_Missense_Mutation_p.T310S|PTGER3_ENST00000370924.4_Missense_Mutation_p.T310S|PTGER3_ENST00000351052.5_Missense_Mutation_p.T310S|PTGER3_ENST00000414819.1_Missense_Mutation_p.T310S|PTGER3_ENST00000370931.3_Missense_Mutation_p.T310S	NM_198719.1	NP_942012.1	P43115	PE2R3_HUMAN	prostaglandin E receptor 3 (subtype EP3)	310					cell death (GO:0008219)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular receptor signaling pathway (GO:0030522)|positive regulation of fever generation (GO:0031622)|transcription, DNA-templated (GO:0006351)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|nuclear envelope (GO:0005635)|plasma membrane (GO:0005886)	ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|prostaglandin E receptor activity (GO:0004957)			endometrium(2)|large_intestine(5)|lung(14)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	25					Bimatoprost(DB00905)|Dinoprostone(DB00917)|Misoprostol(DB00929)	TCAACTGATGTCTGATTGAAG	0.393																																					p.T310S		Atlas-SNP	.											.	PTGER3	246	.	0			c.A928T						.						108.0	101.0	103.0					1																	71478137		2203	4300	6503	SO:0001583	missense	5733	exon2			CTGATGTCTGATT	X83863	CCDS652.1, CCDS655.1, CCDS656.1, CCDS657.1, CCDS658.1	1p31.2	2012-08-08			ENSG00000050628	ENSG00000050628		"""GPCR / Class A : Prostanoid receptors"""	9595	protein-coding gene	gene with protein product		176806				7759114, 9073510	Standard	NM_001126044		Approved	EP3	uc001dfo.3	P43115	OTTHUMG00000009399	ENST00000306666.5:c.928A>T	chr1.hg19:g.71478137T>A	ENSP00000302313:p.Thr310Ser	57.0	0.0		60.0	15.0	NM_001126044	B0AZN4|B1AK19|B5BUP5|O00326|Q12943|Q12944|Q12945|Q16546|Q5CZ59|Q5CZ61|Q5CZ62|Q5CZ63|Q5CZ64	Missense_Mutation	SNP	ENST00000306666.5	hg19	CCDS657.1	.	.	.	.	.	.	.	.	.	.	T	13.69	2.312343	0.40895	.	.	ENSG00000050628	ENST00000370931;ENST00000370932;ENST00000351052;ENST00000460330;ENST00000370934;ENST00000354608;ENST00000356595;ENST00000414819;ENST00000306666;ENST00000370924	T;T;T;T;T;T;T;T;T	0.71103	-0.54;-0.54;-0.54;-0.54;-0.54;-0.54;-0.54;-0.54;-0.54	5.65	4.45	0.53987	GPCR, rhodopsin-like superfamily (1);	0.313747	0.33792	N	0.004557	T	0.48259	0.1490	L	0.38838	1.175	0.28415	N	0.918008	P;P;P;D;P;P;P;P	0.53151	0.863;0.858;0.911;0.958;0.918;0.9;0.9;0.858	B;P;P;P;B;P;P;P	0.52386	0.338;0.609;0.571;0.697;0.42;0.474;0.571;0.609	T	0.46484	-0.9188	10	0.05721	T	0.95	-5.8685	11.3451	0.49556	0.136:0.0:0.0:0.864	.	310;310;310;310;310;310;310;310	Q147U0;Q6TTN3;F5H821;B1AK19;Q147X8;P43115-3;P43115-4;P43115	.;.;.;.;.;.;.;PE2R3_HUMAN	S	310	ENSP00000359969:T310S;ENSP00000359970:T310S;ENSP00000280208:T310S;ENSP00000418073:T310S;ENSP00000346624:T310S;ENSP00000349003:T310S;ENSP00000401423:T310S;ENSP00000302313:T310S;ENSP00000359962:T310S	ENSP00000302313:T310S	T	-	1	0	PTGER3	71250725	1.000000	0.71417	0.995000	0.50966	0.779000	0.44077	3.451000	0.52964	2.156000	0.67533	0.402000	0.26972	ACA	.	.		0.393	PTGER3-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000026076.1	NM_000957	
ERICH3	127254	hgsc.bcm.edu	37	1	75065587	75065587	+	Silent	SNP	C	C	T			TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr1:75065587C>T	ENST00000326665.5	-	11	1736	c.1518G>A	c.(1516-1518)gaG>gaA	p.E506E	C1orf173_ENST00000420661.2_Silent_p.E309E|RP4-612J11.1_ENST00000416017.1_RNA	NM_001002912.4	NP_001002912.4	Q5RHP9	ERIC3_HUMAN		506	Glu-rich.							p.E506D(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(23)|lung(123)|ovary(3)|prostate(10)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)	184						CTTGTTTCTCCTCATCTACTT	0.338																																					p.E506E		Atlas-SNP	.											C1orf173,NS,carcinoma,0,1	C1orf173	380	.	1	Substitution - Missense(1)	lung(1)	c.G1518A						.						154.0	163.0	160.0					1																	75065587		2203	4300	6503	SO:0001819	synonymous_variant	127254	exon11			TTTCTCCTCATCT																												ENST00000326665.5:c.1518G>A	chr1.hg19:g.75065587C>T		67.0	0.0		83.0	19.0	NM_001002912	Q68DL8|Q6GMR8|Q6ZSF9|Q8ND41	Silent	SNP	ENST00000326665.5	hg19	CCDS30755.1																																																																																			.	.		0.338	C1orf173-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026516.1		
ERICH3	127254	hgsc.bcm.edu	37	1	75065589	75065589	+	Nonsense_Mutation	SNP	C	C	A			TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr1:75065589C>A	ENST00000326665.5	-	11	1734	c.1516G>T	c.(1516-1518)Gag>Tag	p.E506*	C1orf173_ENST00000420661.2_Nonsense_Mutation_p.E309*|RP4-612J11.1_ENST00000416017.1_RNA	NM_001002912.4	NP_001002912.4	Q5RHP9	ERIC3_HUMAN		506	Glu-rich.									NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(23)|lung(123)|ovary(3)|prostate(10)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)	184						TGTTTCTCCTCATCTACTTCA	0.333																																					p.E506X		Atlas-SNP	.											.	C1orf173	380	.	0			c.G1516T						.						151.0	159.0	156.0					1																	75065589		2203	4300	6503	SO:0001587	stop_gained	127254	exon11			TCTCCTCATCTAC																												ENST00000326665.5:c.1516G>T	chr1.hg19:g.75065589C>A	ENSP00000322609:p.Glu506*	66.0	0.0		83.0	19.0	NM_001002912	Q68DL8|Q6GMR8|Q6ZSF9|Q8ND41	Nonsense_Mutation	SNP	ENST00000326665.5	hg19	CCDS30755.1	.	.	.	.	.	.	.	.	.	.	C	21.4	4.138970	0.77775	.	.	ENSG00000178965	ENST00000326665;ENST00000420661	.	.	.	5.74	5.74	0.90152	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.17369	T	0.5	-7.5709	19.5202	0.95182	0.0:1.0:0.0:0.0	.	.	.	.	X	506;309	.	ENSP00000322609:E506X	E	-	1	0	C1orf173	74838177	1.000000	0.71417	0.977000	0.42913	0.006000	0.05464	5.308000	0.65768	2.715000	0.92844	0.650000	0.86243	GAG	.	.		0.333	C1orf173-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026516.1		
CELF3	11189	hgsc.bcm.edu	37	1	151680335	151680335	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr1:151680335G>T	ENST00000290583.4	-	6	1356	c.563C>A	c.(562-564)gCc>gAc	p.A188D	RP11-98D18.1_ENST00000457548.1_RNA|RIIAD1_ENST00000326413.3_5'Flank|AL589765.1_ENST00000442233.2_5'Flank|CELF3_ENST00000392706.3_Missense_Mutation_p.A5D|CELF3_ENST00000290585.4_Missense_Mutation_p.A188D|CELF3_ENST00000470688.1_5'UTR	NM_001172648.1|NM_007185.4	NP_001166119.1|NP_009116.3	Q5SZQ8	CELF3_HUMAN	CUGBP, Elav-like family member 3	188					mRNA splicing, via spliceosome (GO:0000398)|positive regulation of mRNA splicing, via spliceosome (GO:0048026)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|RNA splicing (GO:0008380)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(6)|ovary(1)|prostate(1)	21						CAACTGGGTGGCCACCTGCTG	0.662																																					p.A188D		Atlas-SNP	.											.	CELF3	49	.	0			c.C563A						.						59.0	52.0	54.0					1																	151680335		2203	4300	6503	SO:0001583	missense	11189	exon6			TGGGTGGCCACCT	U80759	CCDS1002.1, CCDS53367.1	1q21	2013-02-12	2010-02-19	2010-02-19	ENSG00000159409	ENSG00000159409		"""Trinucleotide (CAG) repeat containing"", ""RNA binding motif (RRM) containing"""	11967	protein-coding gene	gene with protein product	"""expanded repeat domain, CAG/CTG 4"", ""CAG repeat domain"", ""CUG-BP and ETR-3 like factor 3"""	612678	"""trinucleotide repeat containing 4"""	TNRC4		9225980	Standard	XM_005244859		Approved	CAGH4, BRUNOL1, ERDA4, MGC57297	uc001eys.2	Q5SZQ8	OTTHUMG00000013064	ENST00000290583.4:c.563C>A	chr1.hg19:g.151680335G>T	ENSP00000290583:p.Ala188Asp	106.0	0.0		129.0	23.0	NM_007185	B7ZKK6|O15414|Q499Y6|Q5SZQ7|Q6NVK0|Q8IZ98|Q9BZC2|Q9HB30	Missense_Mutation	SNP	ENST00000290583.4	hg19	CCDS1002.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	26.6|26.6	4.753921|4.753921	0.89843|0.89843	.|.	.|.	ENSG00000159409|ENSG00000159409	ENST00000290585;ENST00000290583;ENST00000392706;ENST00000368833|ENST00000420342	T;T;T|.	0.18338|.	2.23;2.22;2.96|.	3.75|3.75	3.75|3.75	0.43078|0.43078	.|.	0.061993|.	0.64402|.	D|.	0.000004|.	T|T	0.71204|0.71204	0.3312|0.3312	M|M	0.83603|0.83603	2.65|2.65	0.80722|0.80722	D|D	1|1	P;D;D;P;D|.	0.58268|.	0.911;0.974;0.977;0.947;0.982|.	P;P;P;P;P|.	0.61800|.	0.536;0.894;0.848;0.599;0.837|.	T|T	0.75033|0.75033	-0.3460|-0.3460	10|5	0.72032|.	D|.	0.01|.	-10.5358|-10.5358	14.6626|14.6626	0.68882|0.68882	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	188;188;187;188;187|.	Q5SZQ7;Q5SZQ8-2;F8W6B7;Q5SZQ8;Q5SZQ8-3|.	.;.;.;CELF3_HUMAN;.|.	D|T	188;188;5;187|189	ENSP00000290585:A188D;ENSP00000290583:A188D;ENSP00000376470:A5D|.	ENSP00000290583:A188D|.	A|P	-|-	2|1	0|0	CELF3|CELF3	149946959|149946959	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	5.519000|5.519000	0.67074|0.67074	2.098000|2.098000	0.63641|0.63641	0.655000|0.655000	0.94253|0.94253	GCC|CCA	.	.		0.662	CELF3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000036663.2	NM_007185	
RPTN	126638	hgsc.bcm.edu	37	1	152127436	152127436	+	Silent	SNP	A	A	C			TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr1:152127436A>C	ENST00000316073.3	-	3	2203	c.2139T>G	c.(2137-2139)acT>acG	p.T713T		NM_001122965.1	NP_001116437.1	Q6XPR3	RPTN_HUMAN	repetin	713	Gln-rich.					cornified envelope (GO:0001533)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(1)|endometrium(14)|kidney(2)|large_intestine(1)|lung(32)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	59						GTCTATCCCAAGTTTGATGGC	0.552																																					p.T713T		Atlas-SNP	.											RPTN,NS,carcinoma,0,1	RPTN	123	.	0			c.T2139G						.						337.0	274.0	293.0					1																	152127436		1568	3582	5150	SO:0001819	synonymous_variant	126638	exon3			ATCCCAAGTTTGA	AK096436	CCDS41397.1	1q21.3	2013-01-10			ENSG00000215853	ENSG00000215853		"""EF-hand domain containing"""	26809	protein-coding gene	gene with protein product		613259				15854042	Standard	NM_001122965		Approved	FLJ39117	uc001ezs.1	Q6XPR3	OTTHUMG00000154095	ENST00000316073.3:c.2139T>G	chr1.hg19:g.152127436A>C		87.0	0.0		107.0	11.0	NM_001122965	B7ZBZ3	Silent	SNP	ENST00000316073.3	hg19	CCDS41397.1																																																																																			.	.		0.552	RPTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333867.1	XM_371312	
IVL	3713	hgsc.bcm.edu	37	1	152883199	152883199	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr1:152883199A>G	ENST00000368764.3	+	2	990	c.926A>G	c.(925-927)cAg>cGg	p.Q309R	IVL_ENST00000392667.2_Missense_Mutation_p.Q163R			P07476	INVO_HUMAN	involucrin	309	39 X 10 AA approximate tandem repeats of [LP]-[EKG]-[LHVYQEK]-[PLSQE]-[EQDV]- [QHEKRGA]-Q-[EMVQLP]-[GKLE]-[QHVNLD].				isopeptide cross-linking via N6-(L-isoglutamyl)-L-lysine (GO:0018153)|keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)|response to UV-B (GO:0010224)	cornified envelope (GO:0001533)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	protein binding, bridging (GO:0030674)|structural molecule activity (GO:0005198)			breast(1)|endometrium(6)|kidney(1)|large_intestine(5)|lung(11)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	29	Lung NSC(65;3.97e-29)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			CCAGagcagcagatggggcag	0.637																																					p.Q309R		Atlas-SNP	.											.	IVL	100	.	0			c.A926G						.						18.0	18.0	18.0					1																	152883199		2088	4122	6210	SO:0001583	missense	3713	exon2			AGCAGCAGATGGG	BC046391	CCDS1030.1	1q21	2008-02-05			ENSG00000163207	ENSG00000163207			6187	protein-coding gene	gene with protein product		147360				2873896	Standard	NM_005547		Approved		uc001fau.3	P07476	OTTHUMG00000012451	ENST00000368764.3:c.926A>G	chr1.hg19:g.152883199A>G	ENSP00000357753:p.Gln309Arg	219.0	0.0		246.0	32.0	NM_005547	Q5T7P4	Missense_Mutation	SNP	ENST00000368764.3	hg19	CCDS1030.1	.	.	.	.	.	.	.	.	.	.	A	11.96	1.794373	0.31777	.	.	ENSG00000163207	ENST00000368764;ENST00000392667	T;T	0.11385	3.0;2.78	2.9	2.9	0.33743	.	.	.	.	.	T	0.09113	0.0225	M	0.62723	1.935	0.09310	N	1	P	0.52170	0.951	P	0.54431	0.752	T	0.17961	-1.0352	9	0.24483	T	0.36	.	9.1968	0.37233	1.0:0.0:0.0:0.0	.	309	P07476	INVO_HUMAN	R	309;163	ENSP00000357753:Q309R;ENSP00000376435:Q163R	ENSP00000357753:Q309R	Q	+	2	0	IVL	151149823	0.000000	0.05858	0.001000	0.08648	0.002000	0.02628	-0.990000	0.03732	1.088000	0.41272	0.374000	0.22700	CAG	.	.		0.637	IVL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034664.1	NM_005547	
SHE	126669	hgsc.bcm.edu	37	1	154458426	154458426	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr1:154458426C>A	ENST00000304760.2	-	5	1380	c.1294G>T	c.(1294-1296)Gcc>Tcc	p.A432S		NM_001010846.2	NP_001010846.1	Q5VZ18	SHE_HUMAN	Src homology 2 domain containing E	432	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.									breast(4)|central_nervous_system(1)|kidney(2)|large_intestine(2)|lung(2)|ovary(2)|pancreas(1)	14	all_lung(78;1.72e-29)|Lung NSC(65;2.96e-27)|Hepatocellular(266;0.0877)|all_hematologic(923;0.088)		LUSC - Lung squamous cell carcinoma(543;0.185)			TACTTTAGGGCAATGGAGTAC	0.488																																					p.A432S		Atlas-SNP	.											.	SHE	41	.	0			c.G1294T						.						116.0	97.0	103.0					1																	154458426		2203	4300	6503	SO:0001583	missense	126669	exon5			TTAGGGCAATGGA	AK074067	CCDS30877.1	1q21.3	2013-02-14			ENSG00000169291	ENSG00000169291		"""SH2 domain containing"""	27004	protein-coding gene	gene with protein product		610482				9315092	Standard	NM_001010846		Approved		uc001ffb.3	Q5VZ18	OTTHUMG00000036072	ENST00000304760.2:c.1294G>T	chr1.hg19:g.154458426C>A	ENSP00000307369:p.Ala432Ser	90.0	0.0		109.0	16.0	NM_001010846	Q8TEQ5	Missense_Mutation	SNP	ENST00000304760.2	hg19	CCDS30877.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	12.22|12.22	1.873660|1.873660	0.33069|0.33069	.|.	.|.	ENSG00000169291|ENSG00000169291	ENST00000304760|ENST00000486773;ENST00000555188	T|.	0.49139|.	0.79|.	5.41|5.41	5.41|5.41	0.78517|0.78517	SH2 motif (4);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.07279|0.07279	0.0184|0.0184	N|N	0.00201|0.00201	-1.865|-1.865	0.80722|0.80722	D|D	1|1	D|.	0.89917|.	1.0|.	D|.	0.87578|.	0.998|.	T|T	0.36744|0.36744	-0.9735|-0.9735	10|5	0.02654|.	T|.	1|.	-23.2344|-23.2344	17.9533|17.9533	0.89061|0.89061	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	432|.	Q5VZ18|.	SHE_HUMAN|.	S|F	432|32;129	ENSP00000307369:A432S|.	ENSP00000307369:A432S|.	A|C	-|-	1|2	0|0	SHE|SHE	152725050|152725050	1.000000|1.000000	0.71417|0.71417	0.985000|0.985000	0.45067|0.45067	0.943000|0.943000	0.58893|0.58893	3.378000|3.378000	0.52432|0.52432	2.826000|2.826000	0.97356|0.97356	0.561000|0.561000	0.74099|0.74099	GCC|TGC	.	.		0.488	SHE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087910.2	NM_001010846	
NDUFS2	4720	hgsc.bcm.edu	37	1	161172205	161172205	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr1:161172205C>A	ENST00000367993.3	+	2	478	c.30C>A	c.(28-30)ttC>ttA	p.F10L	NDUFS2_ENST00000476409.2_5'UTR|NDUFS2_ENST00000392179.4_Missense_Mutation_p.F10L	NM_004550.4	NP_004541.1	O75306	NDUS2_HUMAN	NADH dehydrogenase (ubiquinone) Fe-S protein 2, 49kDa (NADH-coenzyme Q reductase)	10					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|response to oxidative stress (GO:0006979)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	4 iron, 4 sulfur cluster binding (GO:0051539)|electron carrier activity (GO:0009055)|metal ion binding (GO:0046872)|NAD binding (GO:0051287)|NADH dehydrogenase (ubiquinone) activity (GO:0008137)|quinone binding (GO:0048038)			breast(2)|endometrium(1)|kidney(2)|large_intestine(3)|lung(8)|prostate(1)|skin(1)	18	all_cancers(52;1.16e-17)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00376)		Doxorubicin(DB00997)	TGTGCGGCTTCCGGGGCGTCG	0.657																																					p.F10L		Atlas-SNP	.											.	NDUFS2	33	.	0			c.C30A						.						18.0	20.0	20.0					1																	161172205		2201	4300	6501	SO:0001583	missense	4720	exon1			CGGCTTCCGGGGC	BC008868	CCDS1224.1, CCDS53404.1	1q23.3	2011-07-04	2002-08-29		ENSG00000158864	ENSG00000158864	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7708	protein-coding gene	gene with protein product	"""complex I 49kDa subunit"", ""NADH dehydrogenase [ubiquinone] iron-sulfur protein 2, mitochondrial"""	602985	"""NADH dehydrogenase (ubiquinone) Fe-S protein 2 (49kD) (NADH-coenzyme Q reductase)"""			1832859, 9585441	Standard	NM_004550		Approved	CI-49	uc001fyw.3	O75306	OTTHUMG00000034344	ENST00000367993.3:c.30C>A	chr1.hg19:g.161172205C>A	ENSP00000356972:p.Phe10Leu	118.0	0.0		124.0	29.0	NM_001166159	D3DVG7|J3KPM7|Q5VTW0|Q969P3|Q9UEV3	Missense_Mutation	SNP	ENST00000367993.3	hg19	CCDS1224.1	.	.	.	.	.	.	.	.	.	.	C	6.814	0.519380	0.13005	.	.	ENSG00000158864	ENST00000367993;ENST00000392179	D;D	0.83591	-1.74;-1.74	5.56	-3.32	0.04973	.	0.080811	0.51477	N	0.000099	T	0.31670	0.0804	N	0.08118	0	0.80722	D	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.36163	-0.9759	10	0.02654	T	1	.	6.1434	0.20273	0.1097:0.2064:0.5387:0.1452	.	10;10	Q53HG2;O75306	.;NDUS2_HUMAN	L	10	ENSP00000356972:F10L;ENSP00000376018:F10L	ENSP00000356972:F10L	F	+	3	2	NDUFS2	159438829	0.399000	0.25287	0.043000	0.18650	0.481000	0.33189	-1.076000	0.03420	-1.048000	0.03238	0.655000	0.94253	TTC	.	.		0.657	NDUFS2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000083015.1	NM_004550	
RGS5	8490	hgsc.bcm.edu	37	1	163122329	163122329	+	Intron	SNP	C	C	T			TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr1:163122329C>T	ENST00000313961.5	-	4	662				RGS5_ENST00000527988.1_Intron|RGS5_ENST00000534288.1_5'Flank|RGS5_ENST00000530507.1_Splice_Site_p.W132*|RGS5_ENST00000367903.3_Intron	NM_001254749.1|NM_003617.3	NP_001241678.1|NP_003608.1	O15539	RGS5_HUMAN	regulator of G-protein signaling 5						positive regulation of GTPase activity (GO:0043547)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|signal transduction (GO:0007165)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)			autonomic_ganglia(1)|breast(1)|endometrium(2)|large_intestine(1)|lung(12)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	20			LUSC - Lung squamous cell carcinoma(543;0.187)			CCCACCTACCCAGAGACCAAC	0.468																																					p.W132X		Atlas-SNP	.											.	RGS5	29	.	0			c.G395A						.						240.0	252.0	248.0					1																	163122329		2203	4299	6502	SO:0001627	intron_variant	8490	exon4			CCTACCCAGAGAC	AF030108	CCDS1244.1, CCDS55652.1, CCDS58041.1	1q23.1	2008-02-05	2007-08-14		ENSG00000143248	ENSG00000143248		"""Regulators of G-protein signaling"""	10001	protein-coding gene	gene with protein product		603276	"""regulator of G-protein signalling 5"""			9747037	Standard	NM_003617		Approved		uc021pdt.1	O15539	OTTHUMG00000034441	ENST00000313961.5:c.384+10G>A	chr1.hg19:g.163122329C>T		80.0	0.0		98.0	19.0	NM_001254749	E9PMP5|Q53XA9|Q599J0	Nonsense_Mutation	SNP	ENST00000313961.5	hg19	CCDS1244.1	.	.	.	.	.	.	.	.	.	.	C	13.94	2.385836	0.42308	.	.	ENSG00000143248	ENST00000530507	.	.	.	4.71	-0.625	0.11548	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	3.3656	0.07202	0.3083:0.4364:0.0:0.2553	.	.	.	.	X	132	.	ENSP00000433001:W132X	W	-	2	0	RGS5	161388953	0.000000	0.05858	0.000000	0.03702	0.028000	0.11728	-0.012000	0.12699	-0.022000	0.13986	-0.181000	0.13052	TGG	.	.		0.468	RGS5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000083264.1	NM_003617	
XCL2	6846	hgsc.bcm.edu	37	1	168511286	168511286	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr1:168511286G>A	ENST00000367819.2	-	2	153	c.121C>T	c.(121-123)Cca>Tca	p.P41S		NM_003175.3	NP_003166.1	Q9UBD3	XCL2_HUMAN	chemokine (C motif) ligand 2	41					blood circulation (GO:0008015)|cell chemotaxis (GO:0060326)|immune response (GO:0006955)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	chemokine activity (GO:0008009)			large_intestine(1)|lung(6)|ovary(1)	8	all_hematologic(923;0.215)					CTGCTAACTGGCAGTCGCTGG	0.488																																					p.P41S		Atlas-SNP	.											XCL2,colon,carcinoma,0,1	XCL2	18	.	0			c.C121T						.						138.0	115.0	123.0					1																	168511286		2203	4298	6501	SO:0001583	missense	6846	exon2			TAACTGGCAGTCG	BC070309	CCDS1273.1	1q24.2	2013-02-28	2002-08-22	2002-08-23	ENSG00000143185	ENSG00000143185		"""Endogenous ligands"""	10646	protein-coding gene	gene with protein product		604828	"""small inducible cytokine subfamily C, member 2"""	SCYC2		7875320	Standard	NM_003175		Approved	SCM-1b	uc001gfn.4	Q9UBD3	OTTHUMG00000034549	ENST00000367819.2:c.121C>T	chr1.hg19:g.168511286G>A	ENSP00000356793:p.Pro41Ser	61.0	0.0		66.0	14.0	NM_003175		Missense_Mutation	SNP	ENST00000367819.2	hg19	CCDS1273.1	.	.	.	.	.	.	.	.	.	.	G	14.88	2.668233	0.47677	.	.	ENSG00000143185	ENST00000367819	T	0.07216	3.21	2.49	2.49	0.30216	Chemokine interleukin-8-like domain (3);	0.431115	0.22250	N	0.062578	T	0.13415	0.0325	M	0.76574	2.34	0.27815	N	0.942019	D	0.76494	0.999	D	0.70487	0.969	T	0.01617	-1.1311	9	0.44086	T	0.13	-6.1507	8.4754	0.33009	0.0:0.0:1.0:0.0	.	41	Q9UBD3	XCL2_HUMAN	S	41	ENSP00000356793:P41S	ENSP00000356793:P41S	P	-	1	0	XCL2	166777910	0.964000	0.33143	0.521000	0.27850	0.218000	0.24690	3.906000	0.56340	1.381000	0.46364	0.195000	0.17529	CCA	.	.		0.488	XCL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083613.1	NM_003175	
XCL1	6375	hgsc.bcm.edu	37	1	168549360	168549360	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr1:168549360C>T	ENST00000367818.3	+	2	286	c.121C>T	c.(121-123)Ccg>Tcg	p.P41S		NM_002995.2	NP_002986.1	P47992	XCL1_HUMAN	chemokine (C motif) ligand 1	41					cell-cell signaling (GO:0007267)|cellular response to interleukin-4 (GO:0071353)|cellular response to transforming growth factor beta stimulus (GO:0071560)|immune response (GO:0006955)|mature natural killer cell chemotaxis (GO:0035782)|negative regulation of CD4-positive, alpha-beta T cell proliferation (GO:2000562)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-2 production (GO:0032703)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of T cell cytokine production (GO:0002725)|negative regulation of T-helper 1 cell activation (GO:2000518)|negative regulation of T-helper 1 type immune response (GO:0002826)|negative regulation of transcription, DNA-templated (GO:0045892)|neutrophil chemotaxis (GO:0030593)|positive regulation of B cell chemotaxis (GO:2000538)|positive regulation of CD4-positive, alpha-beta T cell proliferation (GO:2000563)|positive regulation of CD8-positive, alpha-beta T cell proliferation (GO:2000566)|positive regulation of granzyme A production (GO:2000513)|positive regulation of granzyme B production (GO:0071663)|positive regulation of immunoglobulin production in mucosal tissue (GO:2000558)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of leukocyte chemotaxis (GO:0002690)|positive regulation of natural killer cell chemotaxis (GO:2000503)|positive regulation of neutrophil chemotaxis (GO:0090023)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|positive regulation of T cell chemotaxis (GO:0010820)|positive regulation of T cell cytokine production (GO:0002726)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|positive regulation of T-helper 1 cell cytokine production (GO:2000556)|positive regulation of T-helper 2 cell cytokine production (GO:2000553)|positive regulation of thymocyte migration (GO:2000412)|positive regulation of transforming growth factor beta production (GO:0071636)|regulation of inflammatory response (GO:0050727)|release of sequestered calcium ion into cytosol (GO:0051209)|response to virus (GO:0009615)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	chemokine activity (GO:0008009)|chemokine receptor binding (GO:0042379)|protein homodimerization activity (GO:0042803)			kidney(2)|lung(7)|upper_aerodigestive_tract(1)	10	all_hematologic(923;0.208)					CCAGCGACTGCCGGTTAGCAG	0.478																																					p.P41S		Atlas-SNP	.											XCL1,colon,carcinoma,0,1	XCL1	16	.	0			c.C121T						.						155.0	146.0	149.0					1																	168549360		2203	4300	6503	SO:0001583	missense	6375	exon2			CGACTGCCGGTTA	D43768	CCDS1274.1	1q24.2	2014-01-30	2002-08-22	2002-08-23	ENSG00000143184	ENSG00000143184		"""Endogenous ligands"""	10645	protein-coding gene	gene with protein product		600250	"""small inducible cytokine subfamily C, member 1 (lymphotactin)"""	LTN, SCYC1		7602097, 7875320	Standard	NM_002995		Approved	LPTN, ATAC, SCM-1a, SCM-1, lymphotactin	uc001gfo.2	P47992	OTTHUMG00000034548	ENST00000367818.3:c.121C>T	chr1.hg19:g.168549360C>T	ENSP00000356792:p.Pro41Ser	268.0	0.0		345.0	25.0	NM_002995	Q52MA8	Missense_Mutation	SNP	ENST00000367818.3	hg19	CCDS1274.1	.	.	.	.	.	.	.	.	.	.	C	10.86	1.470263	0.26423	.	.	ENSG00000143184	ENST00000367818	T	0.07216	3.21	4.36	3.42	0.39159	Chemokine interleukin-8-like domain (3);	0.431115	0.22250	N	0.062578	T	0.14485	0.0350	M	0.73598	2.24	0.27815	N	0.942019	D	0.76494	0.999	D	0.70487	0.969	T	0.01884	-1.1254	9	0.52906	T	0.07	-6.1507	9.5622	0.39376	0.2095:0.7905:0.0:0.0	.	41	P47992	XCL1_HUMAN	S	41	ENSP00000356792:P41S	ENSP00000356792:P41S	P	+	1	0	XCL1	166815984	0.138000	0.22547	0.345000	0.25642	0.011000	0.07611	3.188000	0.50958	1.153000	0.42468	0.655000	0.94253	CCG	.	.		0.478	XCL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083612.1	NM_002995	
DNM3	26052	hgsc.bcm.edu	37	1	172356293	172356293	+	Silent	SNP	C	C	A			TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr1:172356293C>A	ENST00000355305.5	+	19	2254	c.2097C>A	c.(2095-2097)tcC>tcA	p.S699S	DNM3_ENST00000358155.4_Silent_p.S693S|DNM3_ENST00000367731.1_Silent_p.S689S			Q9UQ16	DYN3_HUMAN	dynamin 3	699	GED. {ECO:0000255|PROSITE- ProRule:PRU00720}.				endocytosis (GO:0006897)|filopodium assembly (GO:0046847)|GTP catabolic process (GO:0006184)|synapse assembly (GO:0007416)	dendritic spine (GO:0043197)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|mitochondrion (GO:0005739)|perinuclear region of cytoplasm (GO:0048471)|postsynaptic density (GO:0014069)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			NS(1)|breast(3)|endometrium(1)|kidney(1)|large_intestine(9)|lung(16)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	37						TCATAAATTCCGAGCTCCTAG	0.453																																					p.S693S		Atlas-SNP	.											DNM3,NS,carcinoma,0,1	DNM3	85	.	0			c.C2079A						.						86.0	85.0	85.0					1																	172356293		1873	4109	5982	SO:0001819	synonymous_variant	26052	exon19			AAATTCCGAGCTC	AL136712	CCDS44276.1, CCDS60356.1	1q24.1	2013-01-10			ENSG00000197959	ENSG00000197959		"""Pleckstrin homology (PH) domain containing"""	29125	protein-coding gene	gene with protein product	"""Dyna III"""	611445				10048485	Standard	NM_015569		Approved	KIAA0820	uc001gie.4	Q9UQ16	OTTHUMG00000034913	ENST00000355305.5:c.2097C>A	chr1.hg19:g.172356293C>A		114.0	0.0		122.0	33.0	NM_015569	A9Z1Y1|O14982|O95555|Q1MTM8|Q5W129|Q6P2G1|Q9H0P3|Q9H548|Q9NQ68|Q9NQN6	Silent	SNP	ENST00000355305.5	hg19																																																																																				.	.		0.453	DNM3-003	NOVEL	not_organism_supported|basic	protein_coding	protein_coding	OTTHUMT00000084531.1	NM_015569	
NPL	80896	hgsc.bcm.edu	37	1	182797868	182797868	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr1:182797868T>A	ENST00000367553.1	+	12	832	c.788T>A	c.(787-789)gTg>gAg	p.V263E	NPL_ENST00000367552.2_Intron|NPL_ENST00000367555.1_Intron|NPL_ENST00000258317.2_Missense_Mutation_p.V263E|NPL_ENST00000367554.3_Missense_Mutation_p.V244E	NM_001200056.1|NM_030769.2	NP_001186985.1|NP_110396.1	Q9BXD5	NPL_HUMAN	N-acetylneuraminate pyruvate lyase (dihydrodipicolinate synthase)	263					carbohydrate metabolic process (GO:0005975)|N-acetylneuraminate catabolic process (GO:0019262)	cytoplasm (GO:0005737)	N-acetylneuraminate lyase activity (GO:0008747)			breast(1)|central_nervous_system(1)|large_intestine(5)|liver(1)|lung(4)|ovary(1)|skin(1)|stomach(1)	15						GGTTTTGGAGTGTCACAGACC	0.483																																					p.V263E		Atlas-SNP	.											.	NPL	55	.	0			c.T788A						.						78.0	77.0	78.0					1																	182797868		2203	4300	6503	SO:0001583	missense	80896	exon13			TTGGAGTGTCACA	AF338436	CCDS1350.1, CCDS55666.1, CCDS55667.1, CCDS72990.1	1q25	2010-11-25	2003-09-16	2003-09-17	ENSG00000135838	ENSG00000135838	4.1.3.3		16781	protein-coding gene	gene with protein product	"""dihydrodipicolinate synthetase homolog 1 (E. coli)"""	611412	"""chromosome 1 open reading frame 13"""	C1orf13		11318611	Standard	NM_001200056		Approved	NPL1, DHDPS1	uc009wyb.3	Q9BXD5	OTTHUMG00000035321	ENST00000367553.1:c.788T>A	chr1.hg19:g.182797868T>A	ENSP00000356524:p.Val263Glu	78.0	0.0		115.0	17.0	NM_030769	B2R839|Q4G0Q8|Q4G0Z2|Q64L88|Q6PEL0	Missense_Mutation	SNP	ENST00000367553.1	hg19	CCDS1350.1	.	.	.	.	.	.	.	.	.	.	T	25.0	4.588361	0.86851	.	.	ENSG00000135838	ENST00000445965;ENST00000367554;ENST00000367553;ENST00000258317	D;D;D	0.95821	-3.82;-3.82;-3.82	5.93	5.93	0.95920	Aldolase-type TIM barrel (1);	0.188069	0.45606	D	0.000341	D	0.96074	0.8721	L	0.50333	1.59	0.50813	D	0.999893	P;D	0.60575	0.906;0.988	P;P	0.58520	0.698;0.84	D	0.96424	0.9314	10	0.87932	D	0	-13.469	14.5964	0.68410	0.0:0.0:0.0:1.0	.	263;244	Q9BXD5;Q9BXD5-2	NPL_HUMAN;.	E	150;244;263;263	ENSP00000356525:V244E;ENSP00000356524:V263E;ENSP00000258317:V263E	ENSP00000258317:V263E	V	+	2	0	NPL	181064491	1.000000	0.71417	0.990000	0.47175	0.912000	0.54170	4.740000	0.62087	2.265000	0.75225	0.460000	0.39030	GTG	.	.		0.483	NPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085463.1	NM_030769	
ZNF281	23528	hgsc.bcm.edu	37	1	200377850	200377850	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr1:200377850C>A	ENST00000294740.3	-	2	1108	c.984G>T	c.(982-984)caG>caT	p.Q328H	ZNF281_ENST00000367352.3_Missense_Mutation_p.Q292H|ZNF281_ENST00000367353.1_Missense_Mutation_p.Q328H	NM_001281293.1|NM_001281294.1|NM_012482.4	NP_001268222.1|NP_001268223.1|NP_036614.1	Q9Y2X9	ZN281_HUMAN	zinc finger protein 281	328					embryonic body morphogenesis (GO:0010172)|negative regulation of gene expression (GO:0010629)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription, DNA-templated (GO:0045893)|stem cell differentiation (GO:0048863)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	core promoter binding (GO:0001047)|metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)			breast(4)|endometrium(3)|kidney(3)|large_intestine(6)|lung(7)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	27						TATGGTACTTCTGAATAAACT	0.383																																					p.Q328H		Atlas-SNP	.											.	ZNF281	74	.	0			c.G984T						.						205.0	214.0	211.0					1																	200377850		2203	4300	6503	SO:0001583	missense	23528	exon2			GTACTTCTGAATA	AF125158	CCDS1402.1, CCDS60384.1	1q32.1	2012-08-08			ENSG00000162702	ENSG00000162702		"""Zinc fingers, C2H2-type"""	13075	protein-coding gene	gene with protein product						10448078	Standard	NM_012482		Approved	ZBP-99	uc001gve.3	Q9Y2X9	OTTHUMG00000035724	ENST00000294740.3:c.984G>T	chr1.hg19:g.200377850C>A	ENSP00000294740:p.Gln328His	65.0	0.0		90.0	18.0	NM_012482	A6NF48|B3KMX2|Q5RKW5|Q9NY92	Missense_Mutation	SNP	ENST00000294740.3	hg19	CCDS1402.1	.	.	.	.	.	.	.	.	.	.	C	17.88	3.497085	0.64186	.	.	ENSG00000162702	ENST00000294740;ENST00000367353;ENST00000367352;ENST00000537759	T;T;T	0.60797	0.16;0.16;0.16	5.76	5.76	0.90799	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.69287	0.3094	L	0.46819	1.47	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.70037	-0.4982	10	0.62326	D	0.03	-3.2994	13.2115	0.59828	0.0:0.9277:0.0:0.0723	.	292;328	A6NF48;Q9Y2X9	.;ZN281_HUMAN	H	328;328;292;33	ENSP00000294740:Q328H;ENSP00000356322:Q328H;ENSP00000356321:Q292H	ENSP00000294740:Q328H	Q	-	3	2	ZNF281	198644473	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.698000	0.84413	2.706000	0.92434	0.655000	0.94253	CAG	.	.		0.383	ZNF281-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000086879.2	NM_012482	
CACNA1S	779	hgsc.bcm.edu	37	1	201020120	201020120	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr1:201020120C>T	ENST00000362061.3	-	33	4331	c.4105G>A	c.(4105-4107)Gcc>Acc	p.A1369T	CACNA1S_ENST00000367338.3_Missense_Mutation_p.A1350T	NM_000069.2	NP_000060.2	Q13698	CAC1S_HUMAN	calcium channel, voltage-dependent, L type, alpha 1S subunit	1369	Dihydropyridine binding. {ECO:0000250}.|Phenylalkylamine binding. {ECO:0000250}.				axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transport (GO:0006816)|endoplasmic reticulum organization (GO:0007029)|extraocular skeletal muscle development (GO:0002074)|membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|myoblast fusion (GO:0007520)|neuromuscular junction development (GO:0007528)|skeletal muscle adaptation (GO:0043501)|skeletal muscle fiber development (GO:0048741)|skeletal system development (GO:0001501)|striated muscle contraction (GO:0006941)	cytoplasm (GO:0005737)|I band (GO:0031674)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|T-tubule (GO:0030315)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(13)|large_intestine(19)|lung(37)|ovary(6)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	102					Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Felodipine(DB01023)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	ACCAGGAAGGCACAGAGCATG	0.582																																					p.A1369T		Atlas-SNP	.											.	CACNA1S	249	.	0			c.G4105A						.						163.0	141.0	149.0					1																	201020120		2203	4300	6503	SO:0001583	missense	779	exon33			GGAAGGCACAGAG	L33798	CCDS1407.1	1q32	2012-03-07			ENSG00000081248	ENSG00000081248		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1397	protein-coding gene	gene with protein product		114208		HOKPP, MHS5, CACNL1A3		7916735, 16382099	Standard	NM_000069		Approved	Cav1.1, hypoPP	uc001gvv.3	Q13698	OTTHUMG00000035784	ENST00000362061.3:c.4105G>A	chr1.hg19:g.201020120C>T	ENSP00000355192:p.Ala1369Thr	75.0	0.0		62.0	8.0	NM_000069	A4IF51|B1ALM2|Q12896|Q13934	Missense_Mutation	SNP	ENST00000362061.3	hg19	CCDS1407.1	.	.	.	.	.	.	.	.	.	.	.	27.2	4.809796	0.90707	.	.	ENSG00000081248	ENST00000362061;ENST00000367338	D;D	0.97505	-4.41;-4.41	4.43	4.43	0.53597	Ion transport (1);	0.104706	0.64402	D	0.000004	D	0.97682	0.9240	L	0.52126	1.63	0.80722	D	1	D	0.67145	0.996	D	0.74023	0.982	D	0.98936	1.0789	10	0.87932	D	0	.	17.4679	0.87638	0.0:1.0:0.0:0.0	.	1369	Q13698	CAC1S_HUMAN	T	1369;1350	ENSP00000355192:A1369T;ENSP00000356307:A1350T	ENSP00000355192:A1369T	A	-	1	0	CACNA1S	199286743	1.000000	0.71417	0.998000	0.56505	0.947000	0.59692	7.773000	0.85462	2.186000	0.69663	0.456000	0.33151	GCC	.	.		0.582	CACNA1S-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087049.1	NM_000069	
IGFN1	91156	hgsc.bcm.edu	37	1	201184917	201184917	+	Silent	SNP	G	G	A			TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr1:201184917G>A	ENST00000335211.4	+	15	9376	c.9246G>A	c.(9244-9246)ctG>ctA	p.L3082L	IGFN1_ENST00000451870.2_Intron|IGFN1_ENST00000295591.8_Silent_p.L242L	NM_001164586.1	NP_001158058.1	Q86VF2	IGFN1_HUMAN	immunoglobulin-like and fibronectin type III domain containing 1	625						nucleus (GO:0005634)|Z disc (GO:0030018)				autonomic_ganglia(2)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(21)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	45						GCGTGACACTGAGGAGTGAGG	0.637																																					p.L3082L		Atlas-SNP	.											.	IGFN1	220	.	0			c.G9246A						.						30.0	32.0	31.0					1																	201184917		2203	4300	6503	SO:0001819	synonymous_variant	91156	exon15			GACACTGAGGAGT	AY245430	CCDS53455.1	1q32.1	2013-02-11			ENSG00000163395	ENSG00000163395		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	24607	protein-coding gene	gene with protein product							Standard	NM_001164586		Approved	DKFZp434B1231, EEF1A2BP1	uc001gwc.3	Q86VF2	OTTHUMG00000035728	ENST00000335211.4:c.9246G>A	chr1.hg19:g.201184917G>A		67.0	0.0		78.0	15.0	NM_001164586	F8WAI1|Q9NT72	Silent	SNP	ENST00000335211.4	hg19	CCDS53455.1	.	.	.	.	.	.	.	.	.	.	G	7.183	0.589965	0.13812	.	.	ENSG00000163395	ENST00000412892	.	.	.	4.83	4.83	0.62350	.	.	.	.	.	T	0.68705	0.3030	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.67730	-0.5595	4	.	.	.	.	13.4953	0.61421	0.0:0.1559:0.8441:0.0	.	.	.	.	K	500	.	.	E	+	1	0	IGFN1	199451540	0.993000	0.37304	0.518000	0.27811	0.028000	0.11728	0.629000	0.24538	2.234000	0.73211	0.561000	0.74099	GAG	.	.		0.637	IGFN1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_178275	
PLEKHA6	22874	hgsc.bcm.edu	37	1	204210607	204210607	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr1:204210607C>A	ENST00000272203.3	-	17	2621	c.2305G>T	c.(2305-2307)Ggc>Tgc	p.G769C	PLEKHA6_ENST00000414478.1_Missense_Mutation_p.G789C	NM_014935.4	NP_055750.2	Q9Y2H5	PKHA6_HUMAN	pleckstrin homology domain containing, family A member 6	769										breast(2)|endometrium(6)|kidney(1)|large_intestine(9)|lung(21)|ovary(3)|pancreas(1)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	53	all_cancers(21;0.0222)|Breast(84;0.179)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|BRCA - Breast invasive adenocarcinoma(75;0.0833)|Kidney(21;0.0934)|Epithelial(59;0.229)			GGCACAACGCCAACTGCAGAA	0.562																																					p.G769C		Atlas-SNP	.											.	PLEKHA6	115	.	0			c.G2305T						.						28.0	25.0	26.0					1																	204210607		2203	4300	6503	SO:0001583	missense	22874	exon17			CAACGCCAACTGC	AB023186	CCDS1444.1	1q32	2013-01-10			ENSG00000143850	ENSG00000143850		"""Pleckstrin homology (PH) domain containing"""	17053	protein-coding gene	gene with protein product		607771				11001876	Standard	NM_014935		Approved	PEPP3, KIAA0969	uc001hau.4	Q9Y2H5	OTTHUMG00000036057	ENST00000272203.3:c.2305G>T	chr1.hg19:g.204210607C>A	ENSP00000272203:p.Gly769Cys	34.0	0.0		36.0	15.0	NM_014935	A7MD51|Q5VTI6	Missense_Mutation	SNP	ENST00000272203.3	hg19	CCDS1444.1	.	.	.	.	.	.	.	.	.	.	C	17.74	3.463166	0.63513	.	.	ENSG00000143850	ENST00000272203;ENST00000414478	T;T	0.29142	1.58;2.05	5.81	5.81	0.92471	.	0.109584	0.64402	D	0.000008	T	0.61337	0.2339	M	0.81497	2.545	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.63994	-0.6511	10	0.87932	D	0	-39.6689	19.6713	0.95912	0.0:1.0:0.0:0.0	.	769	Q9Y2H5	PKHA6_HUMAN	C	769;789	ENSP00000272203:G769C;ENSP00000402046:G789C	ENSP00000272203:G769C	G	-	1	0	PLEKHA6	202477230	1.000000	0.71417	0.998000	0.56505	0.105000	0.19272	6.976000	0.76135	2.756000	0.94617	0.655000	0.94253	GGC	.	.		0.562	PLEKHA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087889.3	NM_014935	
USH2A	7399	hgsc.bcm.edu	37	1	216371684	216371684	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr1:216371684A>T	ENST00000307340.3	-	18	4440	c.4054T>A	c.(4054-4056)Tgg>Agg	p.W1352R	USH2A_ENST00000366943.2_Missense_Mutation_p.W1352R|RP5-1099E6.3_ENST00000420867.1_RNA|USH2A_ENST00000366942.3_Missense_Mutation_p.W1352R	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	1352	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)			NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		TCTGAGACCCAGGCAGAAGAC	0.398										HNSCC(13;0.011)																											p.W1352R		Atlas-SNP	.											.	USH2A	1168	.	0			c.T4054A						.						103.0	99.0	101.0					1																	216371684		2203	4300	6503	SO:0001583	missense	7399	exon18			AGACCCAGGCAGA	AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.4054T>A	chr1.hg19:g.216371684A>T	ENSP00000305941:p.Trp1352Arg	58.0	0.0		101.0	18.0	NM_007123	Q5VVM9|Q6S362|Q9NS27	Missense_Mutation	SNP	ENST00000307340.3	hg19	CCDS31025.1	.	.	.	.	.	.	.	.	.	.	A	20.4	3.981811	0.74474	.	.	ENSG00000042781	ENST00000307340;ENST00000366943;ENST00000366942	T;T;T	0.53423	0.62;0.62;0.62	5.3	5.3	0.74995	Fibronectin, type III (3);Immunoglobulin-like fold (1);	0.000000	0.41001	U	0.000972	T	0.65249	0.2673	M	0.72353	2.195	0.58432	D	0.999999	D;D	0.89917	1.0;0.993	D;P	0.97110	1.0;0.879	T	0.62324	-0.6878	10	0.15066	T	0.55	.	15.2472	0.73513	1.0:0.0:0.0:0.0	.	1352;1352	O75445-2;O75445	.;USH2A_HUMAN	R	1352	ENSP00000305941:W1352R;ENSP00000355910:W1352R;ENSP00000355909:W1352R	ENSP00000305941:W1352R	W	-	1	0	USH2A	214438307	0.998000	0.40836	0.992000	0.48379	0.844000	0.47949	3.882000	0.56160	1.999000	0.58509	0.455000	0.32223	TGG	.	.		0.398	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128138.1	NM_007123	
OBSCN	84033	hgsc.bcm.edu	37	1	228503672	228503672	+	Silent	SNP	C	C	G	rs111746072		TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr1:228503672C>G	ENST00000422127.1	+	50	13181	c.13137C>G	c.(13135-13137)ccC>ccG	p.P4379P	OBSCN_ENST00000366709.4_Silent_p.P1498P|OBSCN_ENST00000570156.2_Silent_p.P5336P|OBSCN_ENST00000366707.4_Silent_p.P2013P|OBSCN_ENST00000284548.11_Silent_p.P4379P	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	4379	Ig-like 45.				apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				ACGACGAACCCGTGCACACCT	0.662																																					p.P5336P		Atlas-SNP	.											.	OBSCN	2142	.	0			c.C16008G						.						25.0	31.0	29.0					1																	228503672		2085	4181	6266	SO:0001819	synonymous_variant	84033	exon61			CGAACCCGTGCAC	AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.13137C>G	chr1.hg19:g.228503672C>G		157.0	0.0		218.0	79.0	NM_001271223	Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Silent	SNP	ENST00000422127.1	hg19	CCDS58065.1																																																																																			.	C|0.500;T|0.500		0.662	OBSCN-204	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_052843	
OBSCN	84033	hgsc.bcm.edu	37	1	228547311	228547311	+	Intron	SNP	A	A	T			TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr1:228547311A>T	ENST00000422127.1	+	80	18705				OBSCN_ENST00000366709.4_Missense_Mutation_p.T3359S|OBSCN_ENST00000570156.2_Intron|OBSCN_ENST00000366707.4_Intron|OBSCN_ENST00000284548.11_Missense_Mutation_p.T6240S	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF						apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				AGAGACCATCACCACTGTGGT	0.647																																					p.T6240S		Atlas-SNP	.											.	OBSCN	2142	.	0			c.A18718T						.						16.0	21.0	19.0					1																	228547311		2140	4246	6386	SO:0001627	intron_variant	84033	exon81			ACCATCACCACTG	AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.18662-2966A>T	chr1.hg19:g.228547311A>T		111.0	0.0		134.0	25.0	NM_052843	Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Missense_Mutation	SNP	ENST00000422127.1	hg19	CCDS58065.1	.	.	.	.	.	.	.	.	.	.	A	27.5	4.839921	0.91117	.	.	ENSG00000154358	ENST00000284548;ENST00000366709	T;T	0.58506	0.33;0.47	4.56	3.41	0.39046	.	.	.	.	.	T	0.64897	0.2640	M	0.76002	2.32	0.35152	D	0.769898	D	0.60575	0.988	P	0.57152	0.814	T	0.68880	-0.5292	9	0.10636	T	0.68	.	10.3416	0.43882	0.9214:0.0:0.0786:0.0	.	6240	Q5VST9-3	.	S	6240;3359	ENSP00000284548:T6240S;ENSP00000355670:T3359S	ENSP00000284548:T6240S	T	+	1	0	OBSCN	226613934	1.000000	0.71417	1.000000	0.80357	0.671000	0.39405	8.049000	0.89443	0.769000	0.33313	0.454000	0.30748	ACC	.	.		0.647	OBSCN-204	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_052843	
HIST3H2A	92815	hgsc.bcm.edu	37	1	228645460	228645460	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr1:228645460G>A	ENST00000366695.2	-	1	100	c.59C>T	c.(58-60)tCg>tTg	p.S20L	HIST3H2BB_ENST00000369160.2_5'Flank	NM_033445.2	NP_254280.1	Q7L7L0	H2A3_HUMAN	histone cluster 3, H2a	20					nucleosome disassembly (GO:0006337)|UV-damage excision repair (GO:0070914)	extracellular vesicular exosome (GO:0070062)|nuclear nucleosome (GO:0000788)	DNA binding (GO:0003677)			endometrium(1)|lung(3)|ovary(1)	5		Prostate(94;0.183)				CCCCGCGCGCGACGAGCGCGA	0.667																																					p.S20L		Atlas-SNP	.											.	HIST3H2A	13	.	0			c.C59T						.						14.0	17.0	16.0					1																	228645460		2137	4221	6358	SO:0001583	missense	92815	exon1			GCGCGCGACGAGC	AY131974	CCDS1573.1	1q42.13	2011-01-27	2006-10-11		ENSG00000181218	ENSG00000181218		"""Histones / Replication-dependent"""	20507	protein-coding gene	gene with protein product		615015	"""histone 3, H2a"""			12408966	Standard	NM_033445		Approved	MGC3165	uc001hsy.3	Q7L7L0	OTTHUMG00000040046	ENST00000366695.2:c.59C>T	chr1.hg19:g.228645460G>A	ENSP00000355656:p.Ser20Leu	258.0	0.0		298.0	64.0	NM_033445	B2R4S4	Missense_Mutation	SNP	ENST00000366695.2	hg19	CCDS1573.1	.	.	.	.	.	.	.	.	.	.	.	14.05	2.419397	0.42918	.	.	ENSG00000181218	ENST00000366695	T	0.47528	0.84	4.07	4.07	0.47477	Histone-fold (2);Histone core (1);Histone H2A (2);	0.000000	0.44285	D	0.000479	T	0.68833	0.3044	M	0.83118	2.625	0.49483	D	0.99979	D	0.65815	0.995	D	0.67900	0.954	T	0.74691	-0.3580	10	0.87932	D	0	.	14.5656	0.68173	0.0:0.0:1.0:0.0	.	20	Q7L7L0	H2A3_HUMAN	L	20	ENSP00000355656:S20L	ENSP00000355656:S20L	S	-	2	0	HIST3H2A	226712083	1.000000	0.71417	0.106000	0.21319	0.300000	0.27592	5.957000	0.70323	2.549000	0.85964	0.655000	0.94253	TCG	.	.		0.667	HIST3H2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096598.1	NM_033445	
C1orf198	84886	hgsc.bcm.edu	37	1	230979535	230979535	+	Silent	SNP	G	G	T			TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr1:230979535G>T	ENST00000366663.5	-	3	632	c.492C>A	c.(490-492)gcC>gcA	p.A164A	C1orf198_ENST00000427697.2_5'UTR|C1orf198_ENST00000523410.1_Silent_p.A34A|C1orf198_ENST00000470540.1_Silent_p.A126A	NM_032800.2	NP_116189.1	Q9H425	CA198_HUMAN	chromosome 1 open reading frame 198	164						cytoplasm (GO:0005737)				breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|prostate(2)|skin(1)|urinary_tract(1)	17	Breast(184;0.0871)|Ovarian(103;0.183)	Prostate(94;0.178)				AGGACTTGAGGGCCTGGGAGC	0.637																																					p.A164A		Atlas-SNP	.											.	C1orf198	29	.	0			c.C492A						.						84.0	96.0	92.0					1																	230979535		2203	4300	6503	SO:0001819	synonymous_variant	84886	exon3			CTTGAGGGCCTGG	BC066649	CCDS1587.1, CCDS44330.1, CCDS44331.1	1q42.2	2008-02-05			ENSG00000119280	ENSG00000119280			25900	protein-coding gene	gene with protein product							Standard	NM_032800		Approved	FLJ14525, MGC10710, FLJ16283, DKFZp667D152, FLJ38847	uc001hub.3	Q9H425	OTTHUMG00000037790	ENST00000366663.5:c.492C>A	chr1.hg19:g.230979535G>T		70.0	0.0		53.0	5.0	NM_032800	A8K8R8|B3KTW1|G5EA08	Silent	SNP	ENST00000366663.5	hg19	CCDS1587.1																																																																																			.	.		0.637	C1orf198-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000092236.2	NM_032800	
PLD5	200150	hgsc.bcm.edu	37	1	242263975	242263975	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr1:242263975T>A	ENST00000536534.2	-	9	1590	c.1349A>T	c.(1348-1350)tAt>tTt	p.Y450F	PLD5_ENST00000442594.2_Missense_Mutation_p.Y358F|PLD5_ENST00000427495.1_Missense_Mutation_p.Y388F			Q8N7P1	PLD5_HUMAN	phospholipase D family, member 5	450	PLD phosphodiesterase 2.					integral component of membrane (GO:0016021)	catalytic activity (GO:0003824)	p.Y450C(1)|p.Y358C(1)		breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(9)|lung(22)|ovary(6)|skin(3)|urinary_tract(1)	55	Melanoma(84;0.242)		OV - Ovarian serous cystadenocarcinoma(106;0.0329)			CCTACCAATATAAGCTGCTCC	0.502																																					p.Y450F		Atlas-SNP	.											PLD5_ENST00000536534,NS,carcinoma,0,2	PLD5	216	.	2	Substitution - Missense(2)	endometrium(2)	c.A1349T						.						219.0	179.0	193.0					1																	242263975		2203	4300	6503	SO:0001583	missense	200150	exon10			CCAATATAAGCTG	AK098092	CCDS1621.1, CCDS1621.2, CCDS55692.1	1q43	2008-02-05			ENSG00000180287	ENSG00000180287			26879	protein-coding gene	gene with protein product							Standard	NM_001195811		Approved	FLJ40773	uc001hzn.2	Q8N7P1	OTTHUMG00000039867	ENST00000536534.2:c.1349A>T	chr1.hg19:g.242263975T>A	ENSP00000440896:p.Tyr450Phe	64.0	0.0		63.0	16.0	NM_152666	A1KXV0|B7Z324|Q494U9|Q8NB22	Missense_Mutation	SNP	ENST00000536534.2	hg19	CCDS1621.2	.	.	.	.	.	.	.	.	.	.	T	18.03	3.531979	0.64972	.	.	ENSG00000180287	ENST00000427495;ENST00000442594;ENST00000536534	T;T;T	0.19938	2.11;2.11;2.11	5.34	5.34	0.76211	Phospholipase D/Transphosphatidylase (1);	0.000000	0.85682	D	0.000000	T	0.26774	0.0655	L	0.56396	1.775	0.58432	D	0.999995	P;P;P	0.45474	0.859;0.779;0.724	B;B;B	0.43889	0.435;0.232;0.34	T	0.02301	-1.1180	10	0.49607	T	0.09	-16.1727	13.8569	0.63534	0.0:0.0:0.0:1.0	.	358;450;388	Q8N7P1-2;Q8N7P1;Q8N7P1-4	.;PLD5_HUMAN;.	F	388;358;450	ENSP00000401285:Y388F;ENSP00000414188:Y358F;ENSP00000440896:Y450F	ENSP00000401285:Y388F	Y	-	2	0	PLD5	240330598	1.000000	0.71417	0.914000	0.36105	0.968000	0.65278	6.471000	0.73562	2.153000	0.67306	0.528000	0.53228	TAT	.	.		0.502	PLD5-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397213.2	NM_152666	
FAM150B	285016	hgsc.bcm.edu	37	2	283165	283165	+	Missense_Mutation	SNP	T	T	G			TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr2:283165T>G	ENST00000403610.4	-	5	739	c.399A>C	c.(397-399)agA>agC	p.R133S	FAM150B_ENST00000344414.5_Missense_Mutation_p.R41S|FAM150B_ENST00000401503.1_Missense_Mutation_p.R41S|FAM150B_ENST00000405290.1_Missense_Mutation_p.R41S	NM_001002919.2	NP_001002919.2	Q6UX46	F150B_HUMAN	family with sequence similarity 150, member B	133						extracellular region (GO:0005576)				breast(1)|kidney(2)	3	all_hematologic(175;0.0429)|Acute lymphoblastic leukemia(172;0.0627)	all_cancers(51;0.00175)|Lung NSC(108;0.216)|all_epithelial(98;0.236)		all cancers(51;0.00091)|Epithelial(75;0.00656)|OV - Ovarian serous cystadenocarcinoma(76;0.00954)|GBM - Glioblastoma multiforme(21;0.128)		GCCTGGCGCATCTTTTATAGT	0.413																																					p.R133S		Atlas-SNP	.											.	FAM150B	12	.	0			c.A399C						.						57.0	56.0	56.0					2																	283165		1858	4098	5956	SO:0001583	missense	285016	exon5			GGCGCATCTTTTA		CCDS46218.1	2p25.3	2008-05-02			ENSG00000189292	ENSG00000189292			27683	protein-coding gene	gene with protein product							Standard	NM_001002919		Approved		uc002qwi.4	Q6UX46	OTTHUMG00000151366	ENST00000403610.4:c.399A>C	chr2.hg19:g.283165T>G	ENSP00000384604:p.Arg133Ser	123.0	0.0		83.0	18.0	NM_001002919	B5MC76	Missense_Mutation	SNP	ENST00000403610.4	hg19	CCDS46218.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	17.75|17.75	3.467005|3.467005	0.63625|0.63625	.|.	.|.	ENSG00000189292|ENSG00000189292	ENST00000401489|ENST00000436353;ENST00000403610;ENST00000401503;ENST00000405290;ENST00000344414;ENST00000452023	.|.	.|.	.|.	4.69|4.69	-3.15|-3.15	0.05233|0.05233	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.71995|0.71995	0.3406|0.3406	M|M	0.71036|0.71036	2.16|2.16	0.44852|0.44852	D|D	0.997865|0.997865	.|D	.|0.76494	.|0.999	.|D	.|0.83275	.|0.996	T|T	0.70880|0.70880	-0.4752|-0.4752	5|9	.|0.87932	.|D	.|0	.|.	10.4301|10.4301	0.44403|0.44403	0.0:0.5584:0.0:0.4416|0.0:0.5584:0.0:0.4416	.|.	.|133	.|Q6UX46	.|F150B_HUMAN	A|S	84|73;133;41;41;41;133	.|.	.|ENSP00000339565:R41S	D|R	-|-	2|3	0|2	FAM150B|FAM150B	273165|273165	1.000000|1.000000	0.71417|0.71417	0.071000|0.071000	0.20095|0.20095	0.712000|0.712000	0.41017|0.41017	1.400000|1.400000	0.34577|0.34577	-0.818000|-0.818000	0.04329|0.04329	0.533000|0.533000	0.62120|0.62120	GAT|AGA	.	.		0.413	FAM150B-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322394.2	NM_001002919	
CCDC88A	55704	hgsc.bcm.edu	37	2	55571513	55571513	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr2:55571513A>T	ENST00000436346.1	-	11	2020	c.1179T>A	c.(1177-1179)gaT>gaA	p.D393E	CCDC88A_ENST00000263630.8_Missense_Mutation_p.D393E|CCDC88A_ENST00000336838.6_Missense_Mutation_p.D393E|CCDC88A_ENST00000413716.2_Missense_Mutation_p.D393E|AC012358.8_ENST00000594078.1_RNA	NM_001135597.1|NM_001254943.1	NP_001129069.1|NP_001241872.1	Q3V6T2	GRDN_HUMAN	coiled-coil domain containing 88A	393					activation of protein kinase B activity (GO:0032148)|cell migration (GO:0016477)|DNA replication (GO:0006260)|lamellipodium assembly (GO:0030032)|membrane organization (GO:0061024)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cell proliferation (GO:0042127)|regulation of DNA replication (GO:0006275)|regulation of neuron projection development (GO:0010975)|regulation of protein phosphorylation (GO:0001932)|TOR signaling (GO:0031929)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|membrane (GO:0016020)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|microtubule binding (GO:0008017)|phosphatidylinositol binding (GO:0035091)|protein homodimerization activity (GO:0042803)|protein kinase B binding (GO:0043422)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(22)|lung(23)|ovary(3)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|urinary_tract(1)	69						CCATTTCCATATCATGAAGTT	0.373																																					p.D393E		Atlas-SNP	.											.	CCDC88A	336	.	0			c.T1179A						.						109.0	104.0	106.0					2																	55571513		2203	4297	6500	SO:0001583	missense	55704	exon11			TTCCATATCATGA	AB033038, AF112218	CCDS33203.1, CCDS46288.1, CCDS58710.1	2p16.3	2013-03-13	2007-05-31	2007-05-31	ENSG00000115355	ENSG00000115355			25523	protein-coding gene	gene with protein product	"""Galpha-interacting vesicle-associated protein"", ""Akt-phosphorylation enhancer"", ""girdin"", ""girders of actin filaments"""	609736	"""KIAA1212"""	KIAA1212		15749703, 15753085	Standard	NM_001135597		Approved	FLJ10392, APE, GIV, HkRP1, GRDN	uc002ryv.2	Q3V6T2	OTTHUMG00000151915	ENST00000436346.1:c.1179T>A	chr2.hg19:g.55571513A>T	ENSP00000410608:p.Asp393Glu	80.0	0.0		73.0	17.0	NM_018084	A1IGE7|B7ZM78|C9JG83|Q53SF1|Q581G3|Q5HYD0|Q7Z339|Q7Z3C5	Missense_Mutation	SNP	ENST00000436346.1	hg19		.	.	.	.	.	.	.	.	.	.	A	16.63	3.177405	0.57692	.	.	ENSG00000115355	ENST00000336838;ENST00000263630;ENST00000436346;ENST00000413716	T;T;T;T	0.35236	1.32;1.32;1.32;1.32	5.87	3.28	0.37604	.	0.128273	0.34531	U	0.003887	T	0.21347	0.0514	N	0.25426	0.745	0.80722	D	1	B;B;B	0.25904	0.011;0.068;0.137	B;B;B	0.25884	0.03;0.064;0.054	T	0.06006	-1.0851	10	0.21540	T	0.41	-23.6018	6.2193	0.20673	0.7396:0.0:0.1425:0.1179	.	393;393;393	B7ZM78;Q3V6T2-2;Q3V6T2-3	.;.;.	E	393	ENSP00000338728:D393E;ENSP00000263630:D393E;ENSP00000410608:D393E;ENSP00000404431:D393E	ENSP00000263630:D393E	D	-	3	2	CCDC88A	55425017	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.298000	0.33412	0.400000	0.25396	0.477000	0.44152	GAT	.	.		0.373	CCDC88A-203	KNOWN	basic	protein_coding	protein_coding		NM_017571	
LRRTM4	80059	hgsc.bcm.edu	37	2	77746081	77746081	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr2:77746081G>A	ENST00000409093.1	-	3	1250	c.914C>T	c.(913-915)tCc>tTc	p.S305F	LRRTM4_ENST00000409282.1_Missense_Mutation_p.S306F|LRRTM4_ENST00000409884.1_Missense_Mutation_p.S305F|LRRTM4_ENST00000409911.1_Missense_Mutation_p.S306F|LRRTM4_ENST00000409088.3_Missense_Mutation_p.S305F			Q86VH4	LRRT4_HUMAN	leucine rich repeat transmembrane neuronal 4	305					alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor clustering (GO:0097113)|regulation of presynaptic membrane organization (GO:1901629)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|postsynaptic membrane (GO:0045211)				autonomic_ganglia(1)|endometrium(1)|large_intestine(6)|lung(49)|ovary(2)|pancreas(3)|prostate(1)|upper_aerodigestive_tract(1)	64				Colorectal(11;0.059)		CAATGTGATGGATATTAATGA	0.353																																					p.S305F		Atlas-SNP	.											.	LRRTM4	334	.	0			c.C914T						.						45.0	40.0	42.0					2																	77746081		1857	4108	5965	SO:0001583	missense	80059	exon3			GTGATGGATATTA	AK122612	CCDS46346.1, CCDS46347.1, CCDS74530.1	2p12	2008-02-05			ENSG00000176204	ENSG00000176204			19411	protein-coding gene	gene with protein product		610870				12676565	Standard	NM_024993		Approved	FLJ12568	uc002snr.3	Q86VH4	OTTHUMG00000152842	ENST00000409093.1:c.914C>T	chr2.hg19:g.77746081G>A	ENSP00000386357:p.Ser305Phe	78.0	0.0		76.0	19.0	NM_024993	Q4FZ98|Q6UXJ7	Missense_Mutation	SNP	ENST00000409093.1	hg19	CCDS46346.1	.	.	.	.	.	.	.	.	.	.	G	15.98	2.992139	0.54041	.	.	ENSG00000176204	ENST00000409911;ENST00000409884;ENST00000409093;ENST00000409088;ENST00000409282	T;T;T;T;T	0.04603	3.59;3.59;3.59;3.59;3.59	5.84	5.84	0.93424	.	0.178707	0.50627	D	0.000109	T	0.13157	0.0319	L	0.31926	0.97	0.58432	D	0.999995	D;P;D	0.55605	0.972;0.906;0.972	P;P;P	0.62435	0.839;0.751;0.902	T	0.01460	-1.1349	10	0.44086	T	0.13	.	18.6944	0.91594	0.0:0.0:1.0:0.0	.	306;305;305	Q4KMX1;Q86VH4-2;Q86VH4	.;.;LRRT4_HUMAN	F	306;305;305;305;306	ENSP00000387228:S306F;ENSP00000387297:S305F;ENSP00000386357:S305F;ENSP00000386236:S305F;ENSP00000386286:S306F	ENSP00000386236:S305F	S	-	2	0	LRRTM4	77599589	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.817000	0.75252	2.751000	0.94390	0.655000	0.94253	TCC	.	.		0.353	LRRTM4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000328225.1	NM_024993	
GPAT2	150763	hgsc.bcm.edu	37	2	96690205	96690205	+	Silent	SNP	G	G	A			TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr2:96690205G>A	ENST00000434632.1	-	16	2098	c.1639C>T	c.(1639-1641)Ctg>Ttg	p.L547L	FAHD2CP_ENST00000607780.1_RNA|GPAT2_ENST00000453542.1_Silent_p.L476L|GPAT2_ENST00000359548.4_Silent_p.L547L|GPAT2_ENST00000377137.3_Silent_p.L547L			Q6NUI2	GPAT2_HUMAN	glycerol-3-phosphate acyltransferase 2, mitochondrial	547					CDP-diacylglycerol biosynthetic process (GO:0016024)|glycerol-3-phosphate metabolic process (GO:0006072)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidic acid biosynthetic process (GO:0006654)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	integral component of membrane (GO:0016021)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	glycerol-3-phosphate O-acyltransferase activity (GO:0004366)			NS(1)|breast(1)|cervix(1)|endometrium(4)|large_intestine(1)|lung(5)|skin(3)	16						AAGACGGGCAGCAGCTCAGCA	0.642																																					p.L547L		Atlas-SNP	.											.	GPAT2	46	.	0			c.C1639T						.						51.0	57.0	55.0					2																	96690205		2165	4238	6403	SO:0001819	synonymous_variant	150763	exon15			CGGGCAGCAGCTC	BC042847	CCDS42714.1	2q11.2	2010-05-04			ENSG00000186281	ENSG00000186281			27168	protein-coding gene	gene with protein product	"""cancer/testis antigen 123"""					12477932	Standard	NM_207328		Approved	CT123	uc010yuf.1	Q6NUI2	OTTHUMG00000155208	ENST00000434632.1:c.1639C>T	chr2.hg19:g.96690205G>A		80.0	0.0		55.0	11.0	NM_207328	Q6P2E4|Q6ZNI3|Q6ZNI5|Q6ZWJ4	Silent	SNP	ENST00000434632.1	hg19	CCDS42714.1																																																																																			.	.		0.642	GPAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338786.1	NM_207328	
SLC4A10	57282	hgsc.bcm.edu	37	2	162761399	162761399	+	Missense_Mutation	SNP	G	G	T	rs534495211		TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr2:162761399G>T	ENST00000446997.1	+	14	1824	c.1731G>T	c.(1729-1731)aaG>aaT	p.K577N	SLC4A10_ENST00000375514.5_Missense_Mutation_p.K558N|SLC4A10_ENST00000415876.2_Missense_Mutation_p.K547N|SLC4A10_ENST00000272716.5_Missense_Mutation_p.K547N|SLC4A10_ENST00000421911.1_Missense_Mutation_p.K577N	NM_001178015.1	NP_001171486.1	Q6U841	S4A10_HUMAN	solute carrier family 4, sodium bicarbonate transporter, member 10	577					bicarbonate transport (GO:0015701)|chloride transport (GO:0006821)|ion transport (GO:0006811)|regulation of pH (GO:0006885)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	inorganic anion exchanger activity (GO:0005452)|symporter activity (GO:0015293)			endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(9)|lung(35)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	60					Sodium bicarbonate(DB01390)	TGTTTGAAAAGATTTTGTTTA	0.388																																					p.K577N		Atlas-SNP	.											SLC4A10_ENST00000446997,NS,carcinoma,0,2	SLC4A10	309	.	0			c.G1731T						.						159.0	150.0	153.0					2																	162761399		1900	4145	6045	SO:0001583	missense	57282	exon14			TGAAAAGATTTTG		CCDS46438.1, CCDS54411.1, CCDS54412.1	2q24.2	2013-05-22	2008-09-15		ENSG00000144290	ENSG00000144290		"""Solute carriers"""	13811	protein-coding gene	gene with protein product		605556	"""solute carrier family 4, sodium bicarbonate transporter-like, member 10"""			10964153, 18319254	Standard	NM_022058		Approved	NBCn2, NCBE	uc002ubx.4	Q6U841	OTTHUMG00000153938	ENST00000446997.1:c.1731G>T	chr2.hg19:g.162761399G>T	ENSP00000393066:p.Lys577Asn	132.0	0.0		120.0	30.0	NM_001178015	B7Z1R0|B7Z2J0|B7ZLC5|B9EG69|F8W675|Q4ZFX6|Q8TCP2|Q9HCQ6	Missense_Mutation	SNP	ENST00000446997.1	hg19	CCDS54411.1	.	.	.	.	.	.	.	.	.	.	G	22.0	4.224603	0.79576	.	.	ENSG00000144290	ENST00000375514;ENST00000415876;ENST00000272716;ENST00000449513;ENST00000446997;ENST00000421911;ENST00000415711	T;T;T;T;T	0.79845	-1.31;-1.31;-1.31;-1.31;-1.31	5.56	4.69	0.59074	Bicarbonate transporter, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.87533	0.6201	M	0.77406	2.37	0.58432	D	0.999999	D;D;D	0.63046	0.97;0.97;0.992	P;P;D	0.64506	0.844;0.844;0.926	D	0.87864	0.2666	10	0.59425	D	0.04	.	10.409	0.44280	0.1484:0.0:0.8516:0.0	.	558;547;577	F8W675;Q6U841-2;Q6U841	.;.;S4A10_HUMAN	N	558;547;547;546;577;577;576	ENSP00000364664:K558N;ENSP00000395797:K547N;ENSP00000272716:K547N;ENSP00000393066:K577N;ENSP00000404486:K577N	ENSP00000272716:K547N	K	+	3	2	SLC4A10	162469645	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.562000	0.53777	1.350000	0.45770	0.557000	0.71058	AAG	.	.		0.388	SLC4A10-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000333090.1	NM_022058	
XIRP2	129446	hgsc.bcm.edu	37	2	168103206	168103206	+	Silent	SNP	A	A	G			TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr2:168103206A>G	ENST00000409195.1	+	9	5393	c.5304A>G	c.(5302-5304)acA>acG	p.T1768T	XIRP2_ENST00000295237.9_Silent_p.T1768T|XIRP2_ENST00000409043.1_Intron|XIRP2_ENST00000409728.1_Intron|XIRP2_ENST00000409605.1_Intron|XIRP2_ENST00000409756.2_Intron|XIRP2_ENST00000409273.1_Silent_p.T1546T|XIRP2_ENST00000420519.1_Intron	NM_152381.5	NP_689594.4	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2	1593					actin cytoskeleton organization (GO:0030036)|cardiac muscle tissue morphogenesis (GO:0055008)|cell-cell junction organization (GO:0045216)|ventricular septum development (GO:0003281)	cell junction (GO:0030054)|Z disc (GO:0030018)				NS(3)|biliary_tract(2)|breast(5)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(51)|lung(160)|ovary(7)|pancreas(3)|prostate(11)|skin(14)|stomach(5)|upper_aerodigestive_tract(8)|urinary_tract(7)	315						CAAATGAAACACTGACAGCTA	0.403																																					p.T1768T		Atlas-SNP	.											.	XIRP2	914	.	0			c.A5304G						.						120.0	114.0	116.0					2																	168103206		1902	4113	6015	SO:0001819	synonymous_variant	129446	exon9			TGAAACACTGACA	AK056582	CCDS42768.1, CCDS42769.1, CCDS56143.1, CCDS56144.1, CCDS56145.1	2q31.1	2013-10-25	2007-06-27	2007-06-27	ENSG00000163092	ENSG00000163092			14303	protein-coding gene	gene with protein product	"""myomaxin"""	609778	"""cardiomyopathy associated 3"""	CMYA3		17046827, 12203715, 15454575	Standard	NM_001079810		Approved		uc002udx.3	A4UGR9	OTTHUMG00000154027	ENST00000409195.1:c.5304A>G	chr2.hg19:g.168103206A>G		173.0	0.0		203.0	56.0	NM_152381	A0PJ94|B2BBS0|B2BBS1|B2BBS4|B3KVH0|J3KNB1|Q53R52|Q5MJ67|Q702N7|Q86T36|Q86T38|Q86T46|Q86T51|Q86T53|Q86T55|Q86T79|Q86TB6|Q8N1M9|Q8N3R5|Q8TBV6	Silent	SNP	ENST00000409195.1	hg19	CCDS42769.1																																																																																			.	.		0.403	XIRP2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000333547.1	NM_152381	
GPR155	151556	hgsc.bcm.edu	37	2	175309901	175309901	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr2:175309901G>A	ENST00000392552.2	-	13	2255	c.2017C>T	c.(2017-2019)Ctt>Ttt	p.L673F	GPR155_ENST00000459996.1_5'UTR|GPR155_ENST00000295500.4_Missense_Mutation_p.L673F|GPR155_ENST00000392551.2_Missense_Mutation_p.L673F	NM_001267051.1|NM_152529.6	NP_001253980.1|NP_689742.4	Q7Z3F1	GP155_HUMAN	G protein-coupled receptor 155	673					cognition (GO:0050890)|intracellular signal transduction (GO:0035556)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)		p.L673I(1)		breast(2)|endometrium(5)|kidney(1)|large_intestine(4)|lung(8)|ovary(1)|prostate(1)|stomach(2)|urinary_tract(2)	26						CAACTGGAAAGATTCTGTAAA	0.343																																					p.L673F		Atlas-SNP	.											GPR155,rectum,carcinoma,0,1	GPR155	76	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2017T						.						39.0	40.0	40.0					2																	175309901		2203	4300	6503	SO:0001583	missense	151556	exon14			TGGAAAGATTCTG	AY255528	CCDS2259.1, CCDS74605.1	2q31.1	2012-04-10			ENSG00000163328	ENSG00000163328			22951	protein-coding gene	gene with protein product						12679517	Standard	NM_001033045		Approved	DEPDC3, DEP.7, FLJ31819, PGR22	uc002uiu.4	Q7Z3F1	OTTHUMG00000132336	ENST00000392552.2:c.2017C>T	chr2.hg19:g.175309901G>A	ENSP00000376335:p.Leu673Phe	71.0	0.0		60.0	17.0	NM_001033045	B2RCI2|D3DPE2|Q4G0Y6|Q53SJ3|Q53TA8|Q69YG8|Q86SP9|Q8N261|Q8N639|Q8N8K3|Q96MV6	Missense_Mutation	SNP	ENST00000392552.2	hg19	CCDS2259.1	.	.	.	.	.	.	.	.	.	.	G	17.07	3.294451	0.60086	.	.	ENSG00000163328	ENST00000392552;ENST00000510236;ENST00000392551;ENST00000295500	T;T;T	0.61980	0.06;0.06;0.06	5.54	4.67	0.58626	.	0.116810	0.64402	D	0.000012	T	0.71787	0.3381	M	0.72118	2.19	0.51482	D	0.999929	D;P	0.59357	0.985;0.863	P;P	0.57244	0.816;0.594	T	0.74771	-0.3552	10	0.87932	D	0	-13.0178	10.023	0.42055	0.0724:0.1374:0.7902:0.0	.	153;673	F5H464;Q7Z3F1	.;GP155_HUMAN	F	673;153;673;673	ENSP00000376335:L673F;ENSP00000376334:L673F;ENSP00000295500:L673F	ENSP00000295500:L673F	L	-	1	0	GPR155	175018147	1.000000	0.71417	1.000000	0.80357	0.896000	0.52359	3.849000	0.55910	1.356000	0.45884	0.551000	0.68910	CTT	.	.		0.343	GPR155-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255455.1	NM_152529	
TTN	7273	hgsc.bcm.edu	37	2	179447182	179447182	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr2:179447182G>T	ENST00000591111.1	-	264	61302	c.61078C>A	c.(61078-61080)Ccc>Acc	p.P20360T	TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.P22001T|RP11-171I2.2_ENST00000603521.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.P13128T|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000590743.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.P13061T|TTN_ENST00000460472.2_Missense_Mutation_p.P12936T|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000589907.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.P19433T|TTN-AS1_ENST00000591332.1_RNA			Q8WZ42	TITIN_HUMAN	titin	20360	Fibronectin type-III 47. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GCCCAGTTGGGCCTGCTTGTT	0.463																																					p.P22001T		Atlas-SNP	.											.	TTN	18412	.	0			c.C66001A						.						78.0	72.0	74.0					2																	179447182		1911	4130	6041	SO:0001583	missense	7273	exon314			AGTTGGGCCTGCT	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.61078C>A	chr2.hg19:g.179447182G>T	ENSP00000465570:p.Pro20360Thr	158.0	0.0		148.0	28.0	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	hg19		.	.	.	.	.	.	.	.	.	.	G	13.37	2.217876	0.39201	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.56611	0.45;0.45;0.45;0.45	5.86	4.0	0.46444	Fibronectin, type III (4);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.36608	0.0973	N	0.16201	0.385	0.38358	D	0.944526	P;P;P;P	0.36354	0.549;0.549;0.549;0.549	B;B;B;B	0.35182	0.197;0.197;0.197;0.197	T	0.41910	-0.9482	9	0.87932	D	0	.	13.1155	0.59297	0.0:0.1229:0.7491:0.1279	.	12936;13061;13128;20360	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	T	19433;12936;13128;13061;12934	ENSP00000343764:P19433T;ENSP00000434586:P12936T;ENSP00000340554:P13128T;ENSP00000352154:P13061T	ENSP00000340554:P13128T	P	-	1	0	TTN	179155428	1.000000	0.71417	0.995000	0.50966	0.998000	0.95712	4.098000	0.57748	0.748000	0.32831	0.655000	0.94253	CCC	.	.		0.463	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
SLC39A10	57181	hgsc.bcm.edu	37	2	196544891	196544891	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr2:196544891G>T	ENST00000409086.3	+	2	400	c.125G>T	c.(124-126)gGa>gTa	p.G42V	SLC39A10_ENST00000359634.5_Missense_Mutation_p.G42V|SLC39A10_ENST00000541054.1_Intron	NM_001127257.1	NP_001120729.1	Q9ULF5	S39AA_HUMAN	solute carrier family 39 (zinc transporter), member 10	42					transmembrane transport (GO:0055085)|zinc ion transport (GO:0006829)	integral component of membrane (GO:0016021)	metal ion transmembrane transporter activity (GO:0046873)			breast(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(5)|liver(1)|lung(16)|pancreas(1)|prostate(1)|skin(2)	34			OV - Ovarian serous cystadenocarcinoma(117;0.221)			CAGCATCGTGGAATGACAGAA	0.373																																					p.G42V		Atlas-SNP	.											.	SLC39A10	89	.	0			c.G125T						.						48.0	51.0	50.0					2																	196544891		2203	4300	6503	SO:0001583	missense	57181	exon2			ATCGTGGAATGAC		CCDS33353.1	2q33.1	2013-05-22			ENSG00000196950	ENSG00000196950		"""Solute carriers"""	20861	protein-coding gene	gene with protein product		608733	"""solute carrier family 39 (metal ion transporter), member 10"""			12659941	Standard	NM_020342		Approved	KIAA1265, FLJ90515, DKFZp564L2123	uc002utg.4	Q9ULF5	OTTHUMG00000154380	ENST00000409086.3:c.125G>T	chr2.hg19:g.196544891G>T	ENSP00000386766:p.Gly42Val	399.0	0.0		377.0	87.0	NM_020342	A8K5C6|B4DGU0|Q3MJA4|Q68CR5|Q6DKH6|Q9Y3Z1	Missense_Mutation	SNP	ENST00000409086.3	hg19	CCDS33353.1	.	.	.	.	.	.	.	.	.	.	G	13.62	2.292879	0.40594	.	.	ENSG00000196950	ENST00000458054;ENST00000409086;ENST00000359634;ENST00000418005	T;T;T;T	0.66460	0.81;-0.21;-0.21;0.83	4.54	4.54	0.55810	.	0.783507	0.11448	N	0.563053	T	0.77579	0.4151	L	0.51422	1.61	0.80722	D	1	D	0.76494	0.999	D	0.68765	0.96	T	0.75274	-0.3375	10	0.54805	T	0.06	.	14.8192	0.70059	0.0:0.0:1.0:0.0	.	42	Q9ULF5	S39AA_HUMAN	V	42	ENSP00000389640:G42V;ENSP00000386766:G42V;ENSP00000352655:G42V;ENSP00000409272:G42V	ENSP00000352655:G42V	G	+	2	0	SLC39A10	196253136	1.000000	0.71417	0.392000	0.26245	0.986000	0.74619	4.577000	0.60922	2.324000	0.78689	0.650000	0.86243	GGA	.	.		0.373	SLC39A10-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335186.1	XM_047707	
SLC39A10	57181	hgsc.bcm.edu	37	2	196545343	196545343	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr2:196545343A>T	ENST00000409086.3	+	2	852	c.577A>T	c.(577-579)Act>Tct	p.T193S	SLC39A10_ENST00000359634.5_Missense_Mutation_p.T193S|SLC39A10_ENST00000541054.1_Intron	NM_001127257.1	NP_001120729.1	Q9ULF5	S39AA_HUMAN	solute carrier family 39 (zinc transporter), member 10	193	His-rich.				transmembrane transport (GO:0055085)|zinc ion transport (GO:0006829)	integral component of membrane (GO:0016021)	metal ion transmembrane transporter activity (GO:0046873)			breast(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(5)|liver(1)|lung(16)|pancreas(1)|prostate(1)|skin(2)	34			OV - Ovarian serous cystadenocarcinoma(117;0.221)			TCATAACAACACTCACCATTT	0.408																																					p.T193S		Atlas-SNP	.											.	SLC39A10	89	.	0			c.A577T						.						115.0	100.0	105.0					2																	196545343		2203	4300	6503	SO:0001583	missense	57181	exon2			AACAACACTCACC		CCDS33353.1	2q33.1	2013-05-22			ENSG00000196950	ENSG00000196950		"""Solute carriers"""	20861	protein-coding gene	gene with protein product		608733	"""solute carrier family 39 (metal ion transporter), member 10"""			12659941	Standard	NM_020342		Approved	KIAA1265, FLJ90515, DKFZp564L2123	uc002utg.4	Q9ULF5	OTTHUMG00000154380	ENST00000409086.3:c.577A>T	chr2.hg19:g.196545343A>T	ENSP00000386766:p.Thr193Ser	276.0	0.0		296.0	71.0	NM_020342	A8K5C6|B4DGU0|Q3MJA4|Q68CR5|Q6DKH6|Q9Y3Z1	Missense_Mutation	SNP	ENST00000409086.3	hg19	CCDS33353.1	.	.	.	.	.	.	.	.	.	.	A	4.619	0.115116	0.08831	.	.	ENSG00000196950	ENST00000409086;ENST00000359634	T;T	0.64438	-0.1;-0.1	4.91	3.76	0.43208	.	1.458410	0.04213	N	0.332009	T	0.46833	0.1413	L	0.27053	0.805	0.20196	N	0.999922	B	0.14438	0.01	B	0.10450	0.005	T	0.34428	-0.9829	10	0.06891	T	0.86	.	6.6278	0.22839	0.7667:0.1547:0.0787:0.0	.	193	Q9ULF5	S39AA_HUMAN	S	193	ENSP00000386766:T193S;ENSP00000352655:T193S	ENSP00000352655:T193S	T	+	1	0	SLC39A10	196253588	0.989000	0.36119	0.545000	0.28153	0.352000	0.29268	3.293000	0.51779	0.900000	0.36469	0.533000	0.62120	ACT	.	.		0.408	SLC39A10-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335186.1	XM_047707	
ZDBF2	57683	hgsc.bcm.edu	37	2	207169971	207169971	+	Missense_Mutation	SNP	C	C	G			TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr2:207169971C>G	ENST00000374423.3	+	5	1105	c.719C>G	c.(718-720)cCa>cGa	p.P240R		NM_020923.1	NP_065974.1	Q9HCK1	ZDBF2_HUMAN	zinc finger, DBF-type containing 2	240							nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			endometrium(4)|kidney(5)|large_intestine(28)|lung(50)|ovary(4)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	95						AATCCTGTGCCATCATCCCAT	0.378																																					p.P240R		Atlas-SNP	.											.	ZDBF2	531	.	0			c.C719G						.						37.0	37.0	37.0					2																	207169971		1844	4089	5933	SO:0001583	missense	57683	exon5			CTGTGCCATCATC	AB046791	CCDS46501.1, CCDS74637.1	2q33.3	2013-01-10			ENSG00000204186	ENSG00000204186		"""Zinc fingers, DBF-type"""	29313	protein-coding gene	gene with protein product						10997877	Standard	XM_005246711		Approved	FLJ45338, KIAA1571	uc002vbp.2	Q9HCK1	OTTHUMG00000154648	ENST00000374423.3:c.719C>G	chr2.hg19:g.207169971C>G	ENSP00000363545:p.Pro240Arg	247.0	0.0		248.0	65.0	NM_020923	Q6ZNP7|Q6ZSN8	Missense_Mutation	SNP	ENST00000374423.3	hg19	CCDS46501.1	.	.	.	.	.	.	.	.	.	.	C	11.89	1.773495	0.31411	.	.	ENSG00000204186	ENST00000374423	T	0.16597	2.33	5.11	1.97	0.26223	.	1.790210	0.03932	N	0.285394	T	0.13756	0.0333	N	0.22421	0.69	0.09310	N	1	P	0.45902	0.868	B	0.40329	0.326	T	0.27123	-1.0083	10	0.48119	T	0.1	.	7.5635	0.27866	0.0:0.575:0.0:0.425	.	240	Q9HCK1	ZDBF2_HUMAN	R	240	ENSP00000363545:P240R	ENSP00000363545:P240R	P	+	2	0	ZDBF2	206878216	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.070000	0.11523	0.078000	0.16900	-0.157000	0.13467	CCA	.	.		0.378	ZDBF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336458.1	NM_020923	
EPHA4	2043	hgsc.bcm.edu	37	2	222308221	222308221	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr2:222308221A>G	ENST00000281821.2	-	10	1921	c.1880T>C	c.(1879-1881)aTa>aCa	p.I627T	EPHA4_ENST00000409938.1_Missense_Mutation_p.I627T|EPHA4_ENST00000409854.1_Missense_Mutation_p.I627T|EPHA4_ENST00000392071.4_Missense_Mutation_p.I576T	NM_004438.3	NP_004429.1	P54764	EPHA4_HUMAN	EPH receptor A4	627	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				adult walking behavior (GO:0007628)|cell adhesion (GO:0007155)|corticospinal tract morphogenesis (GO:0021957)|fasciculation of motor neuron axon (GO:0097156)|fasciculation of sensory neuron axon (GO:0097155)|glial cell migration (GO:0008347)|motor neuron axon guidance (GO:0008045)|negative regulation of axon regeneration (GO:0048681)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of Rho guanyl-nucleotide exchange factor activity (GO:2001108)|protein autophosphorylation (GO:0046777)|regulation of astrocyte differentiation (GO:0048710)|regulation of axonogenesis (GO:0050770)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of Rac GTPase activity (GO:0032314)|regulation of Rap GTPase activity (GO:0032317)	axon (GO:0030424)|axon terminus (GO:0043679)|axonal growth cone (GO:0044295)|cell junction (GO:0030054)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|early endosome membrane (GO:0031901)|endoplasmic reticulum (GO:0005783)|filopodium (GO:0030175)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|mitochondrial outer membrane (GO:0005741)|neuromuscular junction (GO:0031594)|perikaryon (GO:0043204)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	ATP binding (GO:0005524)|DH domain binding (GO:0097161)|GPI-linked ephrin receptor activity (GO:0005004)|PH domain binding (GO:0042731)|protein kinase activity (GO:0004672)|transmembrane-ephrin receptor activity (GO:0005005)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(9)|liver(1)|lung(21)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	49		Renal(207;0.0183)		Epithelial(121;5.38e-09)|all cancers(144;2.47e-06)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(261;0.0154)		ACCAACTCCTATAACTTTTTC	0.398																																					p.I627T		Atlas-SNP	.											.	EPHA4	263	.	0			c.T1880C						.						142.0	127.0	132.0					2																	222308221		2203	4300	6503	SO:0001583	missense	2043	exon10			ACTCCTATAACTT	L36645	CCDS2447.1	2q36.3	2013-02-11	2004-10-28		ENSG00000116106	ENSG00000116106	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3388	protein-coding gene	gene with protein product		602188	"""EphA4"""	TYRO1		9267020	Standard	NM_004438		Approved	Hek8	uc002vmq.3	P54764	OTTHUMG00000133142	ENST00000281821.2:c.1880T>C	chr2.hg19:g.222308221A>G	ENSP00000281821:p.Ile627Thr	159.0	0.0		147.0	29.0	NM_004438	A8K2P1|B2R601|B7Z6Q8|Q2M380	Missense_Mutation	SNP	ENST00000281821.2	hg19	CCDS2447.1	.	.	.	.	.	.	.	.	.	.	A	26.1	4.706095	0.89018	.	.	ENSG00000116106	ENST00000281821;ENST00000409854;ENST00000409938;ENST00000392071	T;T;T;T	0.70282	-0.47;-0.47;-0.47;-0.47	5.96	5.96	0.96718	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.89406	0.6706	H	0.96208	3.785	0.80722	D	1	D	0.76494	0.999	D	0.91635	0.999	D	0.92601	0.6091	10	0.87932	D	0	.	16.4484	0.83959	1.0:0.0:0.0:0.0	.	627	P54764	EPHA4_HUMAN	T	627;627;627;576	ENSP00000281821:I627T;ENSP00000386276:I627T;ENSP00000386829:I627T;ENSP00000375923:I576T	ENSP00000281821:I627T	I	-	2	0	EPHA4	222016465	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.339000	0.96797	2.285000	0.76669	0.533000	0.62120	ATA	.	.		0.398	EPHA4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256836.3		
SETD5	55209	hgsc.bcm.edu	37	3	9485064	9485064	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr3:9485064G>A	ENST00000406341.1	+	10	1340	c.1150G>A	c.(1150-1152)Gag>Aag	p.E384K	SETD5_ENST00000402198.1_Missense_Mutation_p.E384K|SETD5_ENST00000402466.1_Missense_Mutation_p.E286K|SETD5_ENST00000407969.1_Missense_Mutation_p.E403K|SETD5_ENST00000302463.6_Missense_Mutation_p.E286K			Q9C0A6	SETD5_HUMAN	SET domain containing 5	384	SET. {ECO:0000255|PROSITE- ProRule:PRU00190}.									NS(2)|breast(3)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(10)|lung(11)|ovary(3)|prostate(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	47	Medulloblastoma(99;0.227)			OV - Ovarian serous cystadenocarcinoma(96;0.112)		CAAGGATGCTGAGGTCACCAT	0.423																																					p.E384K		Atlas-SNP	.											.	SETD5	210	.	0			c.G1150A						.						62.0	62.0	62.0					3																	9485064		1953	4135	6088	SO:0001583	missense	55209	exon11			GATGCTGAGGTCA	BC020956	CCDS46741.1, CCDS74892.1	3p25.3	2011-12-13			ENSG00000168137	ENSG00000168137			25566	protein-coding gene	gene with protein product		615743				11214970	Standard	XM_005265299		Approved	FLJ10707	uc003brt.3	Q9C0A6	OTTHUMG00000150491	ENST00000406341.1:c.1150G>A	chr3.hg19:g.9485064G>A	ENSP00000383939:p.Glu384Lys	56.0	0.0		74.0	25.0	NM_001080517	Q6AI17|Q8WUB6|Q9H3X4|Q9H6V7|Q9H7S3|Q9NVI9	Missense_Mutation	SNP	ENST00000406341.1	hg19	CCDS46741.1	.	.	.	.	.	.	.	.	.	.	G	37	6.132865	0.97310	.	.	ENSG00000168137	ENST00000402198;ENST00000402466;ENST00000406341;ENST00000407969;ENST00000302463	D;D;D;D;D	0.94723	-3.5;-3.5;-3.5;-3.5;-3.5	6.03	6.03	0.97812	SET domain (3);	0.000000	0.85682	D	0.000000	D	0.97782	0.9272	M	0.87328	2.875	0.80722	D	1	D;D;D;D;D	0.89917	0.999;1.0;0.999;0.999;1.0	D;D;D;D;D	0.97110	0.998;0.998;0.997;0.995;1.0	D	0.97818	1.0255	10	0.87932	D	0	-5.0038	20.5568	0.99304	0.0:0.0:1.0:0.0	.	53;286;286;384;403	B3KXG4;B3KRD6;Q9C0A6-3;Q9C0A6;E7EWN3	.;.;.;SETD5_HUMAN;.	K	384;286;384;403;286	ENSP00000385852:E384K;ENSP00000384429:E286K;ENSP00000383939:E384K;ENSP00000384114:E403K;ENSP00000302028:E286K	ENSP00000302028:E286K	E	+	1	0	SETD5	9460064	1.000000	0.71417	0.990000	0.47175	0.999000	0.98932	9.869000	0.99810	2.861000	0.98227	0.655000	0.94253	GAG	.	.		0.423	SETD5-001	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318425.1	XM_371614	
SCN5A	6331	hgsc.bcm.edu	37	3	38616808	38616808	+	Silent	SNP	G	G	A			TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr3:38616808G>A	ENST00000333535.4	-	20	3795	c.3646C>T	c.(3646-3648)Cta>Tta	p.L1216L	SCN5A_ENST00000425664.1_Silent_p.L1216L|SCN5A_ENST00000423572.2_Silent_p.L1215L|SCN5A_ENST00000414099.2_Silent_p.L1216L|SCN5A_ENST00000455624.2_Silent_p.L1215L|SCN5A_ENST00000443581.1_Silent_p.L1215L|SCN5A_ENST00000450102.2_Silent_p.L1162L|SCN5A_ENST00000451551.2_Silent_p.L1162L|SCN5A_ENST00000413689.1_Silent_p.L1216L|SCN5A_ENST00000449557.2_Silent_p.L1162L			Q14524	SCN5A_HUMAN	sodium channel, voltage-gated, type V, alpha subunit	1216					AV node cell to bundle of His cell communication (GO:0086067)|brainstem development (GO:0003360)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cardiac muscle cell action potential involved in contraction (GO:0086002)|cardiac muscle contraction (GO:0060048)|cardiac ventricle development (GO:0003231)|cellular response to calcium ion (GO:0071277)|cerebellum development (GO:0021549)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|membrane depolarization during SA node cell action potential (GO:0086046)|neuronal action potential (GO:0019228)|odontogenesis of dentin-containing tooth (GO:0042475)|positive regulation of action potential (GO:0045760)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of sodium ion transport (GO:0010765)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of atrial cardiac muscle cell membrane repolarization (GO:0060372)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of heart rate (GO:0002027)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of sodium ion transmembrane transport (GO:1902305)|regulation of ventricular cardiac muscle cell membrane depolarization (GO:0060373)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to denervation involved in regulation of muscle adaptation (GO:0014894)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|telencephalon development (GO:0021537)|ventricular cardiac muscle cell action potential (GO:0086005)	caveola (GO:0005901)|cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|intercalated disc (GO:0014704)|lateral plasma membrane (GO:0016328)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)	ankyrin binding (GO:0030506)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|fibroblast growth factor binding (GO:0017134)|ion channel binding (GO:0044325)|nitric-oxide synthase binding (GO:0050998)|protein kinase binding (GO:0019901)|scaffold protein binding (GO:0097110)|ubiquitin protein ligase binding (GO:0031625)|voltage-gated sodium channel activity (GO:0005248)|voltage-gated sodium channel activity involved in cardiac muscle cell action potential (GO:0086006)			NS(3)|breast(2)|central_nervous_system(3)|cervix(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(25)|lung(27)|ovary(6)|pancreas(3)|prostate(10)|skin(9)|upper_aerodigestive_tract(4)	107	Medulloblastoma(35;0.163)			KIRC - Kidney renal clear cell carcinoma(284;0.0822)|Kidney(284;0.1)	Ajmaline(DB01426)|Aprindine(DB01429)|Benzonatate(DB00868)|Carbamazepine(DB00564)|Cinchocaine(DB00527)|Cocaine(DB00907)|Disopyramide(DB00280)|Encainide(DB01228)|Ethotoin(DB00754)|Flecainide(DB01195)|Fosphenytoin(DB01320)|Hexylcaine(DB00473)|Indecainide(DB00192)|Lidocaine(DB00281)|Mexiletine(DB00379)|Moricizine(DB00680)|Oxcarbazepine(DB00776)|Phenytoin(DB00252)|Prilocaine(DB00750)|Procainamide(DB01035)|Propafenone(DB01182)|Quinidine barbiturate(DB01346)|Quinidine(DB00908)|Ranolazine(DB00243)|Riluzole(DB00740)|Tocainide(DB01056)|Valproic Acid(DB00313)|Verapamil(DB00661)|Zonisamide(DB00909)	CTGCTGAGTAGGATCATGAAG	0.617																																					p.L1216L		Atlas-SNP	.											.	SCN5A	634	.	0			c.C3646T						.						46.0	48.0	47.0					3																	38616808		2203	4300	6503	SO:0001819	synonymous_variant	6331	exon20			TGAGTAGGATCAT	AJ310893	CCDS46796.1, CCDS46797.1, CCDS46798.1, CCDS46799.1, CCDS54569.1, CCDS54570.1	3p21	2014-09-17	2007-01-23		ENSG00000183873	ENSG00000183873		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10593	protein-coding gene	gene with protein product	"""long QT syndrome 3"""	600163	"""sodium channel, voltage-gated, type V, alpha (long QT syndrome 3)"""	CMD1E		7842012, 15466643, 16382098	Standard	NM_198056		Approved	Nav1.5, LQT3, HB1, HBBD, PFHB1, IVF, HB2, HH1, SSS1, CDCD2, CMPD2, ICCD	uc021wvl.1	Q14524	OTTHUMG00000156166	ENST00000333535.4:c.3646C>T	chr3.hg19:g.38616808G>A		98.0	0.0		87.0	23.0	NM_198056	A5H1P8|A6N922|A6N923|B2RTU0|E7ET19|E9PEF3|E9PEK2|E9PFW7|Q59H93|Q75RX9|Q75RY0|Q86UR3|Q8IZC9|Q96J69	Silent	SNP	ENST00000333535.4	hg19	CCDS46796.1																																																																																			.	.		0.617	SCN5A-014	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000377958.1	NM_198056	
TOPAZ1	375337	hgsc.bcm.edu	37	3	44285485	44285485	+	Missense_Mutation	SNP	A	A	G	rs553067005		TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr3:44285485A>G	ENST00000309765.4	+	2	1655	c.1487A>G	c.(1486-1488)tAt>tGt	p.Y496C		NM_001145030.1	NP_001138502.1	Q8N9V7	TOPZ1_HUMAN	testis and ovary specific PAZ domain containing 1	496						cytoplasm (GO:0005737)	metal ion binding (GO:0046872)										ACTTGGCCCTATTATTCATGT	0.413													A|||	1	0.000199681	0.0008	0.0	5008	,	,		18728	0.0		0.0	False		,,,				2504	0.0				p.Y496C		Atlas-SNP	.											.	.	.	.	0			c.A1487G						.						100.0	85.0	90.0					3																	44285485		692	1591	2283	SO:0001583	missense	375337	exon2			GGCCCTATTATTC	AK093476	CCDS46809.1	3p21.33	2012-10-08	2012-10-08	2012-10-08	ENSG00000173769	ENSG00000173769			24746	protein-coding gene	gene with protein product		614412	"""chromosome 3 open reading frame 77"""	C3orf77		22069478	Standard	NM_001145030		Approved	FLJ36157	uc003cna.4	Q8N9V7	OTTHUMG00000156172	ENST00000309765.4:c.1487A>G	chr3.hg19:g.44285485A>G	ENSP00000310303:p.Tyr496Cys	178.0	0.0		178.0	56.0	NM_001145030		Missense_Mutation	SNP	ENST00000309765.4	hg19	CCDS46809.1	.	.	.	.	.	.	.	.	.	.	A	7.403	0.633073	0.14322	.	.	ENSG00000173769	ENST00000309765	T	0.09163	3.01	5.55	-0.59	0.11679	.	0.885835	0.09946	N	0.735333	T	0.04452	0.0122	N	0.02916	-0.46	0.23298	N	0.997954	B	0.02656	0.0	B	0.04013	0.001	T	0.42241	-0.9463	10	0.39692	T	0.17	2.2434	8.444	0.32830	0.0874:0.0:0.5607:0.3519	.	496	Q8N9V7	CC077_HUMAN	C	496	ENSP00000310303:Y496C	ENSP00000310303:Y496C	Y	+	2	0	C3orf77	44260489	0.033000	0.19621	0.912000	0.35992	0.977000	0.68977	-0.562000	0.05950	-0.459000	0.07013	-0.417000	0.06048	TAT	.	.		0.413	TOPAZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343247.1	NM_001145030	
BSN	8927	hgsc.bcm.edu	37	3	49691918	49691918	+	Silent	SNP	C	C	T			TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr3:49691918C>T	ENST00000296452.4	+	5	5043	c.4929C>T	c.(4927-4929)tgC>tgT	p.C1643C		NM_003458.3	NP_003449.2	Q9UPA5	BSN_HUMAN	bassoon presynaptic cytomatrix protein	1643					synaptic transmission (GO:0007268)	axon (GO:0030424)|cell junction (GO:0030054)|dendrite (GO:0030425)|neuron projection terminus (GO:0044306)|nucleus (GO:0005634)|presynaptic cytoskeletal matrix assembled at active zones (GO:0048788)	metal ion binding (GO:0046872)			breast(8)|central_nervous_system(2)|cervix(2)|endometrium(16)|kidney(3)|large_intestine(17)|lung(37)|ovary(7)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	106				BRCA - Breast invasive adenocarcinoma(193;6.66e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.0032)|Kidney(197;0.00336)		TCTCCCTGTGCCGGATCTCCT	0.647																																					p.C1643C		Atlas-SNP	.											.	BSN	272	.	0			c.C4929T						.						49.0	47.0	48.0					3																	49691918		2203	4300	6503	SO:0001819	synonymous_variant	8927	exon5			CCTGTGCCGGATC	AF052224	CCDS2800.1	3p21	2013-01-07	2013-01-07		ENSG00000164061	ENSG00000164061			1117	protein-coding gene	gene with protein product	"""zinc finger protein 231"", ""neuronal double zinc finger protein"""	604020	"""bassoon (presynaptic cytomatrix protein)"""	ZNF231		9806829, 10329005	Standard	NM_003458		Approved		uc003cxe.4	Q9UPA5	OTTHUMG00000133750	ENST00000296452.4:c.4929C>T	chr3.hg19:g.49691918C>T		56.0	0.0		42.0	11.0	NM_003458	O43161|Q7LGH3	Silent	SNP	ENST00000296452.4	hg19	CCDS2800.1																																																																																			.	.		0.647	BSN-001	KNOWN	NMD_exception|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000258164.1	NM_003458	
BSN	8927	hgsc.bcm.edu	37	3	49692087	49692087	+	Missense_Mutation	SNP	C	C	G			TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr3:49692087C>G	ENST00000296452.4	+	5	5212	c.5098C>G	c.(5098-5100)Ctg>Gtg	p.L1700V		NM_003458.3	NP_003449.2	Q9UPA5	BSN_HUMAN	bassoon presynaptic cytomatrix protein	1700					synaptic transmission (GO:0007268)	axon (GO:0030424)|cell junction (GO:0030054)|dendrite (GO:0030425)|neuron projection terminus (GO:0044306)|nucleus (GO:0005634)|presynaptic cytoskeletal matrix assembled at active zones (GO:0048788)	metal ion binding (GO:0046872)			breast(8)|central_nervous_system(2)|cervix(2)|endometrium(16)|kidney(3)|large_intestine(17)|lung(37)|ovary(7)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	106				BRCA - Breast invasive adenocarcinoma(193;6.66e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.0032)|Kidney(197;0.00336)		TGGTCTTGCCCTGGATCCAAT	0.582																																					p.L1700V		Atlas-SNP	.											.	BSN	272	.	0			c.C5098G						.						111.0	103.0	106.0					3																	49692087		2203	4300	6503	SO:0001583	missense	8927	exon5			CTTGCCCTGGATC	AF052224	CCDS2800.1	3p21	2013-01-07	2013-01-07		ENSG00000164061	ENSG00000164061			1117	protein-coding gene	gene with protein product	"""zinc finger protein 231"", ""neuronal double zinc finger protein"""	604020	"""bassoon (presynaptic cytomatrix protein)"""	ZNF231		9806829, 10329005	Standard	NM_003458		Approved		uc003cxe.4	Q9UPA5	OTTHUMG00000133750	ENST00000296452.4:c.5098C>G	chr3.hg19:g.49692087C>G	ENSP00000296452:p.Leu1700Val	49.0	0.0		59.0	14.0	NM_003458	O43161|Q7LGH3	Missense_Mutation	SNP	ENST00000296452.4	hg19	CCDS2800.1	.	.	.	.	.	.	.	.	.	.	C	8.005	0.756301	0.15846	.	.	ENSG00000164061	ENST00000296452	T	0.18960	2.18	5.16	-2.04	0.07343	.	0.454750	0.21838	N	0.068378	T	0.11324	0.0276	L	0.43152	1.355	0.26432	N	0.975925	P	0.48407	0.91	B	0.39217	0.294	T	0.40979	-0.9534	10	0.12766	T	0.61	.	6.0504	0.19783	0.2033:0.2652:0.0:0.5315	.	1700	Q9UPA5	BSN_HUMAN	V	1700	ENSP00000296452:L1700V	ENSP00000296452:L1700V	L	+	1	2	BSN	49667091	0.000000	0.05858	0.951000	0.38953	0.792000	0.44763	-1.386000	0.02537	-0.305000	0.08831	-1.193000	0.01689	CTG	.	.		0.582	BSN-001	KNOWN	NMD_exception|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000258164.1	NM_003458	
NEK4	6787	hgsc.bcm.edu	37	3	52786310	52786310	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr3:52786310C>A	ENST00000233027.5	-	7	1208	c.1006G>T	c.(1006-1008)Ggt>Tgt	p.G336C	NEK4_ENST00000383721.4_Missense_Mutation_p.G336C|NEK4_ENST00000535191.1_Missense_Mutation_p.G247C	NM_001193533.1|NM_003157.4	NP_001180462.1|NP_003148.2	P51957	NEK4_HUMAN	NIMA-related kinase 4	336					mitotic nuclear division (GO:0007067)|protein phosphorylation (GO:0006468)	nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(9)|lung(10)	26				BRCA - Breast invasive adenocarcinoma(193;7.44e-05)|Kidney(197;0.000711)|KIRC - Kidney renal clear cell carcinoma(197;0.00086)|OV - Ovarian serous cystadenocarcinoma(275;0.0513)		TTCAAGAGACCAGAGGCCCTG	0.423																																					p.G336C		Atlas-SNP	.											.	NEK4	51	.	0			c.G1006T						.						92.0	101.0	98.0					3																	52786310		2203	4300	6503	SO:0001583	missense	6787	exon7			AGAGACCAGAGGC	L20321	CCDS2863.1, CCDS54593.1	3p21.1	2012-11-15	2012-11-15	2002-05-10	ENSG00000114904	ENSG00000114904	2.7.11.1		11399	protein-coding gene	gene with protein product	"""serine/threonine protein kinase-2"""	601959	"""serine/threonine kinase 2"", ""NIMA (never in mitosis gene a)-related kinase 4"""	STK2		8208544	Standard	NM_001193533		Approved	NRK2, pp12301	uc003dfq.4	P51957	OTTHUMG00000158836	ENST00000233027.5:c.1006G>T	chr3.hg19:g.52786310C>A	ENSP00000233027:p.Gly336Cys	131.0	0.0		125.0	30.0	NM_003157	A5YM70|B2R633|B7Z200|Q6P576	Missense_Mutation	SNP	ENST00000233027.5	hg19	CCDS2863.1	.	.	.	.	.	.	.	.	.	.	C	2.022	-0.424554	0.04734	.	.	ENSG00000114904	ENST00000233027;ENST00000535191;ENST00000383721;ENST00000461689	T;T;T;T	0.73152	-0.63;-0.72;-0.64;-0.72	4.64	-0.731	0.11151	.	0.905827	0.09484	N	0.795977	T	0.54515	0.1863	L	0.45137	1.4	0.09310	N	0.999999	B;B;B	0.20368	0.044;0.001;0.001	B;B;B	0.16722	0.016;0.004;0.004	T	0.45891	-0.9230	10	0.42905	T	0.14	.	0.4339	0.00475	0.2258:0.3307:0.143:0.3005	.	247;336;336	B7Z200;P51957-2;P51957	.;.;NEK4_HUMAN	C	336;247;336;247	ENSP00000233027:G336C;ENSP00000437703:G247C;ENSP00000373227:G336C;ENSP00000419666:G247C	ENSP00000233027:G336C	G	-	1	0	NEK4	52761350	0.000000	0.05858	0.000000	0.03702	0.019000	0.09904	0.001000	0.13038	0.153000	0.19213	-0.339000	0.08088	GGT	.	.		0.423	NEK4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000352386.2	NM_003157	
FEZF2	55079	hgsc.bcm.edu	37	3	62358201	62358201	+	Missense_Mutation	SNP	C	C	G			TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr3:62358201C>G	ENST00000283268.3	-	2	637	c.343G>C	c.(343-345)Ggc>Cgc	p.G115R	FEZF2_ENST00000475839.1_Missense_Mutation_p.G115R|FEZF2_ENST00000486811.1_Missense_Mutation_p.G115R	NM_018008.3	NP_060478.3	Q8TBJ5	FEZF2_HUMAN	FEZ family zinc finger 2	115	Gly-rich.				axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|cerebral cortex GABAergic interneuron migration (GO:0021853)|dendrite development (GO:0016358)|dentate gyrus development (GO:0021542)|forebrain anterior/posterior pattern specification (GO:0021797)|locomotory behavior (GO:0007626)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(8)|lung(8)|skin(1)	20		Lung SC(41;0.0262)		BRCA - Breast invasive adenocarcinoma(55;0.000221)|KIRC - Kidney renal clear cell carcinoma(15;0.00834)|Kidney(15;0.00957)		GCCCCCccgccgccgccgccg	0.746																																					p.G115R	NSCLC(170;1772 2053 12525 15604 23984)	Atlas-SNP	.											.	FEZF2	46	.	0			c.G343C						.						1.0	2.0	2.0					3																	62358201		606	1706	2312	SO:0001583	missense	55079	exon2			CCCCGCCGCCGCC	AF064845	CCDS2897.1	3p21.1	2013-01-08	2006-08-15	2006-08-15	ENSG00000153266	ENSG00000153266		"""Zinc fingers, C2H2-type"""	13506	protein-coding gene	gene with protein product		607414	"""zinc finger protein 312"""	ZNF312			Standard	NM_018008		Approved	FLJ10142, FKSG36, TOF, FEZL, Zfp312	uc003dli.2	Q8TBJ5	OTTHUMG00000158705	ENST00000283268.3:c.343G>C	chr3.hg19:g.62358201C>G	ENSP00000283268:p.Gly115Arg	22.0	0.0		19.0	4.0	NM_018008	A8K349|Q9BZ91|Q9NWB9	Missense_Mutation	SNP	ENST00000283268.3	hg19	CCDS2897.1	.	.	.	.	.	.	.	.	.	.	C	9.951	1.220055	0.22373	.	.	ENSG00000153266	ENST00000486811;ENST00000283268;ENST00000475839	D;D;D	0.86627	-2.15;-2.15;-2.15	3.21	1.28	0.21552	.	0.250031	0.27966	N	0.017125	T	0.68531	0.3011	N	0.22421	0.69	0.22866	N	0.99864	P	0.43826	0.818	B	0.30495	0.116	T	0.61926	-0.6962	10	0.30078	T	0.28	-11.9517	5.1556	0.15032	0.0:0.7207:0.0:0.2793	.	115	Q8TBJ5	FEZF2_HUMAN	R	115	ENSP00000418589:G115R;ENSP00000283268:G115R;ENSP00000418804:G115R	ENSP00000283268:G115R	G	-	1	0	FEZF2	62333241	0.937000	0.31787	1.000000	0.80357	0.954000	0.61252	0.000000	0.12993	1.414000	0.47017	0.289000	0.19496	GGC	.	.		0.746	FEZF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351813.1	NM_018008	
MAGI1	9223	hgsc.bcm.edu	37	3	65365036	65365036	+	Silent	SNP	C	C	T			TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr3:65365036C>T	ENST00000497477.2	-	17	2894	c.2895G>A	c.(2893-2895)gtG>gtA	p.V965V	MAGI1_ENST00000330909.8_Silent_p.V993V|MAGI1_ENST00000402939.2_Silent_p.V965V|MAGI1_ENST00000483466.1_Silent_p.V993V			Q96QZ7	MAGI1_HUMAN	membrane associated guanylate kinase, WW and PDZ domain containing 1	993					cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|neuron death (GO:0070997)|protein complex assembly (GO:0006461)	cell junction (GO:0030054)|cell projection (GO:0042995)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	alpha-actinin binding (GO:0051393)|ATP binding (GO:0005524)|protein C-terminus binding (GO:0008022)			breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|liver(1)|lung(21)|pancreas(1)|skin(5)	51		Lung NSC(201;0.0016)		BRCA - Breast invasive adenocarcinoma(55;0.00138)|KIRC - Kidney renal clear cell carcinoma(15;0.0988)|Kidney(15;0.133)		AGGGCTGCACCACGGTGCTGA	0.697																																					p.V993V		Atlas-SNP	.											.	MAGI1	481	.	0			c.G2979A						.						36.0	31.0	32.0					3																	65365036		2202	4299	6501	SO:0001819	synonymous_variant	9223	exon18			CTGCACCACGGTG	AB010894	CCDS33780.1, CCDS33781.1, CCDS2904.1	3p14.1	2009-10-06	2005-05-10	2005-05-10	ENSG00000151276	ENSG00000151276			946	protein-coding gene	gene with protein product		602625	"""BAI1-associated protein 1"""	BAIAP1		9647739, 9225980	Standard	XM_005265563		Approved	BAP1, MAGI-1, TNRC19, AIP3, WWP3	uc003dmn.3	Q96QZ7	OTTHUMG00000157554	ENST00000497477.2:c.2895G>A	chr3.hg19:g.65365036C>T		88.0	0.0		89.0	23.0	NM_015520	A8K188|O00309|O43863|O75085|Q96QZ8|Q96QZ9	Silent	SNP	ENST00000497477.2	hg19		.	.	.	.	.	.	.	.	.	.	C	8.800	0.932657	0.18131	.	.	ENSG00000151276	ENST00000460329	.	.	.	5.33	-1.69	0.08186	.	.	.	.	.	.	.	.	.	.	.	0.58432	D	0.999993	.	.	.	.	.	.	.	.	.	.	.	.	.	-6.0203	4.4422	0.11579	0.1144:0.4208:0.334:0.1307	.	.	.	.	X	874	.	.	W	-	2	0	MAGI1	65340076	0.250000	0.23951	0.051000	0.19133	0.713000	0.41058	0.020000	0.13466	-0.042000	0.13535	0.460000	0.39030	TGG	.	.		0.697	MAGI1-007	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000349132.2	NM_004742	
EPHA6	285220	hgsc.bcm.edu	37	3	97251373	97251374	+	Missense_Mutation	DNP	GG	GG	CT	rs369130484		TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr3:97251373_97251374GG>CT	ENST00000514100.1	+	8	790_791	c.548_549GG>CT	c.(547-549)gGG>gCT	p.G183A	EPHA6_ENST00000442602.2_Missense_Mutation_p.G157A|EPHA6_ENST00000389672.5_Missense_Mutation_p.G791A|EPHA6_ENST00000502694.1_Missense_Mutation_p.G183A	NM_001278300.1	NP_001265229.1	Q9UF33	EPHA6_HUMAN	EPH receptor A6	697	Eph LBD. {ECO:0000255|PROSITE- ProRule:PRU00883}.					integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|liver(2)|lung(60)|ovary(3)|skin(11)|stomach(5)|upper_aerodigestive_tract(2)	101						CGCCTAGAAGGGGTTGTCACCA	0.371																																					p.G791A|p.G791G		Atlas-SNP	.											.	EPHA6	439	.	0			c.G2372C|c.G2373T						.																																			SO:0001583	missense	285220	exon11			TAGAAGGGGTTGT|AGAAGGGGTTGTC	AK092565	CCDS46876.1, CCDS54616.1, CCDS63697.1	3q12.1	2013-02-11	2004-10-28		ENSG00000080224	ENSG00000080224		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	19296	protein-coding gene	gene with protein product		600066				12471243	Standard	NM_001080448		Approved	FLJ35246	uc010how.1	Q9UF33	OTTHUMG00000159208	Exception_encountered	chr3.hg19:g.97251373_97251374delinsCT	ENSP00000421711:p.Gly183Ala	165.0	0.0		146.0|147.0	37.0	NM_001080448	D6RAL5	Missense_Mutation|Silent	SNP	ENST00000514100.1	hg19																																																																																				.	.		0.371	EPHA6-007	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000359997.1	NM_001080448	
OR5K2	402135	hgsc.bcm.edu	37	3	98216699	98216699	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr3:98216699A>T	ENST00000427338.1	+	1	252	c.175A>T	c.(175-177)Atg>Ttg	p.M59L		NM_001004737.1	NP_001004737.1	Q8NHB8	OR5K2_HUMAN	olfactory receptor, family 5, subfamily K, member 2	59						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|large_intestine(1)|lung(10)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	18						TCACACACCAATGTACATCTT	0.443																																					p.M59L		Atlas-SNP	.											.	OR5K2	56	.	0			c.A175T						.						228.0	234.0	232.0					3																	98216699		2203	4300	6503	SO:0001583	missense	402135	exon1			ACACCAATGTACA	AC021660	CCDS33804.1	3q11.2	2013-09-23			ENSG00000231861	ENSG00000231861		"""GPCR / Class A : Olfactory receptors"""	14774	protein-coding gene	gene with protein product							Standard	NM_001004737		Approved		uc011bgx.2	Q8NHB8	OTTHUMG00000160049	ENST00000427338.1:c.175A>T	chr3.hg19:g.98216699A>T	ENSP00000393889:p.Met59Leu	130.0	0.0		131.0	41.0	NM_001004737	B2RN70|Q6IF47	Missense_Mutation	SNP	ENST00000427338.1	hg19	CCDS33804.1	.	.	.	.	.	.	.	.	.	.	A	12.25	1.882331	0.33255	.	.	ENSG00000231861	ENST00000427338	T	0.08458	3.09	2.91	2.91	0.33838	GPCR, rhodopsin-like superfamily (1);	0.000000	0.52532	D	0.000076	T	0.17152	0.0412	M	0.92367	3.3	0.26165	N	0.979947	B	0.28636	0.218	B	0.28385	0.089	T	0.14783	-1.0460	10	0.87932	D	0	-19.3782	9.6296	0.39772	1.0:0.0:0.0:0.0	.	59	Q8NHB8	OR5K2_HUMAN	L	59	ENSP00000393889:M59L	ENSP00000393889:M59L	M	+	1	0	OR5K2	99699389	0.998000	0.40836	0.991000	0.47740	0.672000	0.39443	3.834000	0.55798	1.580000	0.49851	0.248000	0.18094	ATG	.	.		0.443	OR5K2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359020.2		
ABI3BP	25890	hgsc.bcm.edu	37	3	100513777	100513777	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr3:100513777C>A	ENST00000284322.5	-	22	1987	c.1878G>T	c.(1876-1878)caG>caT	p.Q626H	ABI3BP_ENST00000383691.4_Missense_Mutation_p.Q580H|ABI3BP_ENST00000471714.1_Missense_Mutation_p.Q1303H	NM_015429.3	NP_056244.2	Q7Z7G0	TARSH_HUMAN	ABI family, member 3 (NESH) binding protein	626	Pro-rich.				extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)	extracellular space (GO:0005615)|interstitial matrix (GO:0005614)	heparin binding (GO:0008201)			central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(18)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	50						CCAGAGTGGTCTGTAGTTCCT	0.378																																					p.Q626H		Atlas-SNP	.											.	ABI3BP	305	.	0			c.G1878T						.						52.0	49.0	50.0					3																	100513777		1805	4065	5870	SO:0001583	missense	25890	exon22			AGTGGTCTGTAGT	AB056106	CCDS46880.1	3q12.2	2013-02-11	2008-09-12		ENSG00000154175	ENSG00000154175		"""Fibronectin type III domain containing"""	17265	protein-coding gene	gene with protein product	"""target of Nesh-SH3"""	606279				11501947	Standard	NM_015429		Approved	NESHBP, DKFZP586L2024, TARSH	uc003dun.3	Q7Z7G0	OTTHUMG00000159094	ENST00000284322.5:c.1878G>T	chr3.hg19:g.100513777C>A	ENSP00000284322:p.Gln626His	298.0	0.0		264.0	71.0	NM_015429	B3KSL4|Q6ZW20|Q6ZW22|Q9C082|Q9UFI6	Missense_Mutation	SNP	ENST00000284322.5	hg19	CCDS46880.1	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	C|C|C	13.39|13.39|13.39	2.222393|2.222393|2.222393	0.39300|0.39300|0.39300	.|.|.	.|.|.	ENSG00000154175|ENSG00000154175|ENSG00000154175	ENST00000497395;ENST00000466947|ENST00000471714;ENST00000284322;ENST00000383692;ENST00000429331;ENST00000383691;ENST00000486770;ENST00000482765|ENST00000495591;ENST00000471901;ENST00000527943;ENST00000478235	.|T;T;T|.	.|0.59083|.	.|2.13;0.29;1.78|.	5.82|5.82|5.82	0.77|0.77|0.77	0.18497|0.18497|0.18497	.|.|.	.|0.803834|.	.|0.11767|.	.|N|.	.|0.531490|.	T|T|T	0.36524|0.36524|0.36524	0.0970|0.0970|0.0970	L|L|L	0.43152|0.43152|0.43152	1.355|1.355|1.355	0.09310|0.09310|0.09310	N|N|N	1|1|1	.|D;P;D;D|.	.|0.69078|.	.|0.997;0.77;0.997;0.994|.	.|P;B;P;P|.	.|0.62014|.	.|0.854;0.423;0.897;0.784|.	T|T|T	0.28170|0.28170|0.28170	-1.0052|-1.0052|-1.0052	5|10|5	.|0.46703|.	.|T|.	.|0.11|.	-1.2595|-1.2595|-1.2595	7.8465|7.8465|7.8465	0.29428|0.29428|0.29428	0.0:0.3522:0.0:0.6478|0.0:0.3522:0.0:0.6478|0.0:0.3522:0.0:0.6478	.|.|.	.|580;626;1303;310|.	.|B4DSV9;Q7Z7G0;D3YTG3;D3YTD6|.	.|.;TARSH_HUMAN;.;.|.	Y|H|I	42;184|1303;626;310;12;580;64;155|682;206;148;184	.|ENSP00000420524:Q1303H;ENSP00000284322:Q626H;ENSP00000373189:Q580H|.	.|ENSP00000284322:Q626H|.	D|Q|R	-|-|-	1|3|2	0|2|0	ABI3BP|ABI3BP|ABI3BP	101996467|101996467|101996467	0.684000|0.684000|0.684000	0.27642|0.27642|0.27642	0.041000|0.041000|0.041000	0.18516|0.18516|0.18516	0.577000|0.577000|0.577000	0.36160|0.36160|0.36160	-0.048000|-0.048000|-0.048000	0.11944|0.11944|0.11944	-0.086000|-0.086000|-0.086000	0.12550|0.12550|0.12550	-0.302000|-0.302000|-0.302000	0.09304|0.09304|0.09304	GAC|CAG|AGA	.	.		0.378	ABI3BP-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000353260.1		
KIAA2018	205717	hgsc.bcm.edu	37	3	113378345	113378345	+	Silent	SNP	T	T	C			TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr3:113378345T>C	ENST00000478658.1	-	5	2201	c.2184A>G	c.(2182-2184)caA>caG	p.Q728Q	KIAA2018_ENST00000491165.1_Intron|KIAA2018_ENST00000316407.4_Silent_p.Q728Q			Q68DE3	K2018_HUMAN	KIAA2018	728						membrane (GO:0016020)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|DNA binding (GO:0003677)|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity (GO:0004571)			NS(1)|breast(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|liver(1)|lung(30)|ovary(8)|skin(5)|upper_aerodigestive_tract(4)|urinary_tract(2)	80						TAATAGACAATTGTACACAGC	0.448																																					p.Q728Q		Atlas-SNP	.											.	KIAA2018	180	.	0			c.A2184G						.						55.0	54.0	54.0					3																	113378345		1910	4129	6039	SO:0001819	synonymous_variant	205717	exon7			AGACAATTGTACA	AB095938	CCDS43133.1	3q13.2	2014-01-02			ENSG00000176542	ENSG00000176542			30494	protein-coding gene	gene with protein product							Standard	XM_005247208		Approved		uc003eam.3	Q68DE3	OTTHUMG00000159322	ENST00000478658.1:c.2184A>G	chr3.hg19:g.113378345T>C		111.0	0.0		113.0	28.0	NM_001009899	Q7Z3L9|Q8IVF3|Q9H8T4	Silent	SNP	ENST00000478658.1	hg19	CCDS43133.1																																																																																			.	.		0.448	KIAA2018-003	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000354591.1	NM_001009899	
ACPP	55	hgsc.bcm.edu	37	3	132061418	132061418	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr3:132061418A>G	ENST00000336375.5	+	6	668	c.578A>G	c.(577-579)aAa>aGa	p.K193R	ACPP_ENST00000475741.1_Missense_Mutation_p.K160R|ACPP_ENST00000351273.7_Missense_Mutation_p.K193R	NM_001099.4	NP_001090.2	P15309	PPAP_HUMAN	acid phosphatase, prostate	193					adenosine metabolic process (GO:0046085)|dephosphorylation (GO:0016311)|nucleotide metabolic process (GO:0009117)|positive regulation of adenosine receptor signaling pathway (GO:0060168)|purine nucleobase metabolic process (GO:0006144)|regulation of sensory perception of pain (GO:0051930)|thiamine metabolic process (GO:0006772)	apical part of cell (GO:0045177)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|Golgi cisterna (GO:0031985)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|lysosomal membrane (GO:0005765)|multivesicular body (GO:0005771)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|secretory granule (GO:0030141)|vesicle membrane (GO:0012506)	5'-nucleotidase activity (GO:0008253)|acid phosphatase activity (GO:0003993)|choline binding (GO:0033265)|identical protein binding (GO:0042802)|lysophosphatidic acid phosphatase activity (GO:0052642)|phosphatase activity (GO:0016791)|thiamine phosphate phosphatase activity (GO:0042131)			NS(1)|breast(1)|endometrium(2)|large_intestine(5)|lung(13)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	27						ACCTTGGGAAAACTTTCAGGA	0.358																																					p.K193R		Atlas-SNP	.											.	ACPP	118	.	0			c.A578G						.						123.0	130.0	128.0					3																	132061418		2203	4300	6503	SO:0001583	missense	55	exon6			TGGGAAAACTTTC		CCDS3073.1, CCDS46916.1	3q22.1	2012-05-16			ENSG00000014257	ENSG00000014257	3.1.3.2		125	protein-coding gene	gene with protein product		171790					Standard	NM_001099		Approved	ACP3, ACP-3	uc003eop.4	P15309	OTTHUMG00000159650	ENST00000336375.5:c.578A>G	chr3.hg19:g.132061418A>G	ENSP00000337471:p.Lys193Arg	82.0	0.0		67.0	18.0	NM_001099	D3DNC6|Q5FBY0|Q96KY0|Q96QK9|Q96QM0	Missense_Mutation	SNP	ENST00000336375.5	hg19	CCDS3073.1	.	.	.	.	.	.	.	.	.	.	A	14.53	2.561473	0.45590	.	.	ENSG00000014257	ENST00000336375;ENST00000495911;ENST00000475741;ENST00000351273	T;T;T;T	0.23950	2.19;1.88;2.19;2.19	6.08	-0.583	0.11706	.	1.022660	0.07743	N	0.947279	T	0.28896	0.0717	L	0.40543	1.245	0.21604	N	0.999622	B;B;P	0.39920	0.176;0.146;0.695	B;B;B	0.43274	0.064;0.038;0.414	T	0.44498	-0.9324	10	0.45353	T	0.12	.	16.0565	0.80809	0.3:0.7:0.0:0.0	.	193;193;160	P15309;P15309-2;Q5FBY0	PPAP_HUMAN;.;.	R	193;164;160;193	ENSP00000337471:K193R;ENSP00000418366:K164R;ENSP00000417744:K160R;ENSP00000323036:K193R	ENSP00000337471:K193R	K	+	2	0	ACPP	133544108	0.048000	0.20356	0.799000	0.32177	0.959000	0.62525	0.113000	0.15499	-0.027000	0.13873	0.482000	0.46254	AAA	.	.		0.358	ACPP-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000356699.2	NM_001099	
NCK1	4690	hgsc.bcm.edu	37	3	136664512	136664512	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr3:136664512A>G	ENST00000481752.1	+	3	478	c.314A>G	c.(313-315)tAt>tGt	p.Y105C	NCK1_ENST00000288986.2_Missense_Mutation_p.Y105C|NCK1_ENST00000469404.1_Missense_Mutation_p.Y41C			P16333	NCK1_HUMAN	NCK adaptor protein 1	105					actin filament organization (GO:0007015)|axon guidance (GO:0007411)|cell migration (GO:0016477)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|lamellipodium assembly (GO:0030032)|negative regulation of cell death (GO:0060548)|negative regulation of protein kinase activity (GO:0006469)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of translation (GO:0006417)|response to other organism (GO:0051707)|signal complex assembly (GO:0007172)|T cell activation (GO:0042110)|T cell receptor signaling pathway (GO:0050852)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|vesicle membrane (GO:0012506)	cytoskeletal adaptor activity (GO:0008093)|protein kinase inhibitor activity (GO:0004860)|receptor binding (GO:0005102)|receptor signaling complex scaffold activity (GO:0030159)|receptor tyrosine kinase binding (GO:0030971)			cervix(1)|endometrium(1)|large_intestine(2)|lung(6)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	13						GAACGTCTCTATGACCTCAAC	0.413																																					p.Y105C		Atlas-SNP	.											.	NCK1	26	.	0			c.A314G						.						125.0	126.0	126.0					3																	136664512		2203	4300	6503	SO:0001583	missense	4690	exon3			GTCTCTATGACCT	X17576	CCDS3092.1, CCDS54644.1	3q21	2013-02-14			ENSG00000158092	ENSG00000158092		"""SH2 domain containing"""	7664	protein-coding gene	gene with protein product		600508		NCK		7806213, 9737977	Standard	XM_005247498		Approved	NCKalpha	uc003erh.3	P16333	OTTHUMG00000159781	ENST00000481752.1:c.314A>G	chr3.hg19:g.136664512A>G	ENSP00000417273:p.Tyr105Cys	217.0	0.0		183.0	55.0	NM_006153	B7Z751|D3DNE3	Missense_Mutation	SNP	ENST00000481752.1	hg19	CCDS3092.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	19.41|19.41	3.821736|3.821736	0.71028|0.71028	.|.	.|.	ENSG00000158092|ENSG00000158092	ENST00000496489|ENST00000288986;ENST00000481752;ENST00000491539;ENST00000485096;ENST00000488930;ENST00000469404;ENST00000467911	.|T;T;T;T;T;T;T	.|0.69306	.|-0.32;-0.32;1.39;0.78;2.29;-0.39;2.29	6.16|6.16	6.16|6.16	0.99307|0.99307	.|Src homology-3 domain (1);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.76593|0.76593	0.4009|0.4009	M|M	0.66939|0.66939	2.045|2.045	0.80722|0.80722	D|D	1|1	.|D;D	.|0.62365	.|0.975;0.991	.|P;P	.|0.57776	.|0.67;0.827	T|T	0.76242|0.76242	-0.3031|-0.3031	5|10	.|0.40728	.|T	.|0.16	-11.1531|-11.1531	14.7581|14.7581	0.69583|0.69583	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|41;105	.|B7Z751;P16333	.|.;NCK1_HUMAN	V|C	93|105;105;105;105;105;41;41	.|ENSP00000288986:Y105C;ENSP00000417273:Y105C;ENSP00000419302:Y105C;ENSP00000419677:Y105C;ENSP00000417729:Y105C;ENSP00000419631:Y41C;ENSP00000418060:Y41C	.|ENSP00000288986:Y105C	M|Y	+|+	1|2	0|0	NCK1|NCK1	138147202|138147202	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.995000|0.995000	0.86356|0.86356	8.859000|8.859000	0.92264|0.92264	2.367000|2.367000	0.80283|0.80283	0.528000|0.528000	0.53228|0.53228	ATG|TAT	.	.		0.413	NCK1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357307.1	NM_006153	
ZBBX	79740	hgsc.bcm.edu	37	3	167083713	167083713	+	Silent	SNP	T	T	C			TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr3:167083713T>C	ENST00000392766.2	-	6	574	c.234A>G	c.(232-234)caA>caG	p.Q78Q	ZBBX_ENST00000392767.2_Silent_p.Q78Q|ZBBX_ENST00000307529.5_Silent_p.Q78Q|ZBBX_ENST00000455345.2_Silent_p.Q78Q|ZBBX_ENST00000392764.1_Silent_p.Q49Q|ZBBX_ENST00000469220.1_Intron	NM_001199201.1|NM_024687.3	NP_001186130.1|NP_078963.2	A8MT70	ZBBX_HUMAN	zinc finger, B-box domain containing	78						intracellular (GO:0005622)	zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(5)|kidney(5)|large_intestine(9)|liver(1)|lung(38)|ovary(2)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)	70						TCATATATGATTGATTGACCA	0.289																																					p.Q78Q		Atlas-SNP	.											.	ZBBX	299	.	0			c.A234G						.						117.0	109.0	112.0					3																	167083713		1824	4071	5895	SO:0001819	synonymous_variant	79740	exon6			ATATGATTGATTG	AK026702	CCDS3199.2, CCDS56295.1, CCDS56296.1	3q26.1	2010-03-23			ENSG00000169064	ENSG00000169064			26245	protein-coding gene	gene with protein product						12477932	Standard	NM_024687		Approved	FLJ23049	uc011bpc.2	A8MT70	OTTHUMG00000133560	ENST00000392766.2:c.234A>G	chr3.hg19:g.167083713T>C		350.0	0.0		362.0	96.0	NM_024687	A8MV69|B3KSC1|B5MDJ6|F2Z370|Q9H5T8	Silent	SNP	ENST00000392766.2	hg19	CCDS3199.2																																																																																			.	.		0.289	ZBBX-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000257657.3	NM_024687	
LRRC31	79782	hgsc.bcm.edu	37	3	169574626	169574626	+	Silent	SNP	C	C	T			TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr3:169574626C>T	ENST00000316428.5	-	4	579	c.522G>A	c.(520-522)gaG>gaA	p.E174E	LRRC31_ENST00000397805.2_5'UTR|LRRC31_ENST00000523069.1_Silent_p.E174E|LRRC31_ENST00000264676.5_Silent_p.E118E	NM_001277127.1|NM_024727.2	NP_001264056.1|NP_079003.2	Q6UY01	LRC31_HUMAN	leucine rich repeat containing 31	174										cervix(3)|endometrium(3)|large_intestine(8)|lung(9)|ovary(2)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	31	all_cancers(22;2.76e-22)|all_epithelial(15;4.73e-27)|all_lung(20;9.24e-17)|Lung NSC(18;3.85e-16)|Ovarian(172;0.000223)|Breast(254;0.197)		Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.00943)			ACAAATTTAGCTCTTCAAGTT	0.393																																					p.Q174Q		Atlas-SNP	.											.	LRRC31	66	.	0			c.A522A						.						143.0	130.0	134.0					3																	169574626		1843	4096	5939	SO:0001819	synonymous_variant	79782	exon4			ATTTAGCTCTTCA	AK026912	CCDS43167.1, CCDS63832.1, CCDS63833.1	3q26.2	2005-01-24			ENSG00000114248	ENSG00000114248			26261	protein-coding gene	gene with protein product						12975309	Standard	NM_001277127		Approved	FLJ23259	uc003fgc.2	Q6UY01	OTTHUMG00000164421	ENST00000316428.5:c.522G>A	chr3.hg19:g.169574626C>T		78.0	0.0		55.0	12.0	NM_024727	B7ZL44|E5RJA9|Q17RA3|Q8N848|Q9H5N5|V9HW14	Silent	SNP	ENST00000316428.5	hg19	CCDS43167.1																																																																																			.	.		0.393	LRRC31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378699.1	NM_024727	
SLC7A14	57709	hgsc.bcm.edu	37	3	170198647	170198647	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr3:170198647C>A	ENST00000231706.5	-	7	1739	c.1424G>T	c.(1423-1425)gGc>gTc	p.G475V	CLDN11_ENST00000486975.1_Intron|CLDN11_ENST00000451576.1_Intron	NM_020949.2	NP_066000.2	Q8TBB6	S7A14_HUMAN	solute carrier family 7, member 14	475					negative regulation of phosphatase activity (GO:0010923)	integral component of membrane (GO:0016021)|lysosome (GO:0005764)	amino acid transmembrane transporter activity (GO:0015171)			central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(9)|liver(1)|lung(23)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(4)	53	all_cancers(22;2.41e-22)|all_epithelial(15;4.2e-27)|all_lung(20;1.17e-16)|Lung NSC(18;4.91e-16)|Ovarian(172;0.000902)|Breast(254;0.137)		Lung(28;6.23e-13)|LUSC - Lung squamous cell carcinoma(14;1.48e-12)			GGTGGCTGGGCCAGAAAACTC	0.502																																					p.G475V		Atlas-SNP	.											SLC7A14,colon,carcinoma,0,1	SLC7A14	110	.	0			c.G1424T						.						150.0	150.0	150.0					3																	170198647		2203	4300	6503	SO:0001583	missense	57709	exon7			GCTGGGCCAGAAA	BC022968	CCDS33892.1	3q26.2	2014-06-13	2013-07-19		ENSG00000013293	ENSG00000013293		"""Solute carriers"""	29326	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 142"""	615720					Standard	NM_020949		Approved	KIAA1613, PPP1R142	uc003fgz.2	Q8TBB6	OTTHUMG00000158941	ENST00000231706.5:c.1424G>T	chr3.hg19:g.170198647C>A	ENSP00000231706:p.Gly475Val	107.0	1.0		82.0	30.0	NM_020949	B3KV33|Q9HCF9	Missense_Mutation	SNP	ENST00000231706.5	hg19	CCDS33892.1	.	.	.	.	.	.	.	.	.	.	C	14.41	2.526503	0.44969	.	.	ENSG00000013293	ENST00000231706	D	0.87103	-2.21	5.03	5.03	0.67393	.	0.105272	0.64402	D	0.000003	D	0.91260	0.7245	L	0.51422	1.61	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	D	0.89380	0.3681	10	0.27785	T	0.31	.	18.3552	0.90355	0.0:1.0:0.0:0.0	.	475	Q8TBB6	S7A14_HUMAN	V	475	ENSP00000231706:G475V	ENSP00000231706:G475V	G	-	2	0	SLC7A14	171681341	1.000000	0.71417	0.968000	0.41197	0.362000	0.29581	7.178000	0.77657	2.337000	0.79520	0.655000	0.94253	GGC	.	.		0.502	SLC7A14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352598.2	NM_020949	
CLCN2	1181	hgsc.bcm.edu	37	3	184073263	184073263	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr3:184073263G>T	ENST00000265593.4	-	12	1396	c.1225C>A	c.(1225-1227)Cag>Aag	p.Q409K	CLCN2_ENST00000344937.7_Missense_Mutation_p.Q409K|EIF2B5_ENST00000444495.1_Intron|CLCN2_ENST00000423355.2_Missense_Mutation_p.Q50K|CLCN2_ENST00000457512.1_Missense_Mutation_p.Q409K|CLCN2_ENST00000475279.1_5'UTR|CLCN2_ENST00000434054.2_Missense_Mutation_p.Q365K	NM_004366.5	NP_004357.3	P51788	CLCN2_HUMAN	chloride channel, voltage-sensitive 2	409					cell differentiation involved in salivary gland development (GO:0060689)|ion transmembrane transport (GO:0034220)|regulation of anion transport (GO:0044070)|retina development in camera-type eye (GO:0060041)|transmembrane transport (GO:0055085)|transport (GO:0006810)	chloride channel complex (GO:0034707)|plasma membrane (GO:0005886)	adenyl nucleotide binding (GO:0030554)|voltage-gated chloride channel activity (GO:0005247)			breast(2)|central_nervous_system(4)|endometrium(1)|kidney(3)|large_intestine(4)|lung(9)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	27	all_cancers(143;6.66e-11)|Ovarian(172;0.0339)		Epithelial(37;2.22e-33)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)		Lubiprostone(DB01046)	ACCAGGCCCTGGCGGACCCAC	0.577																																					p.Q409K		Atlas-SNP	.											.	CLCN2	74	.	0			c.C1225A						.						130.0	116.0	121.0					3																	184073263		2203	4300	6503	SO:0001583	missense	1181	exon12			GGCCCTGGCGGAC	S77770	CCDS3263.1, CCDS54690.1, CCDS54691.1, CCDS54692.1	3q27.1	2013-09-19	2012-02-23		ENSG00000114859	ENSG00000114859		"""Ion channels / Chloride channels : Voltage-sensitive"""	2020	protein-coding gene	gene with protein product		600570	"""chloride channel 2"""			7795595	Standard	NM_004366		Approved	CLC2, EJM6, ClC-2	uc003foi.4	P51788	OTTHUMG00000156747	ENST00000265593.4:c.1225C>A	chr3.hg19:g.184073263G>T	ENSP00000265593:p.Gln409Lys	114.0	0.0		99.0	4.0	NM_001171087	B4DQT9|B4DZ58|E9PBD9|E9PCD2|O14864|Q6IPA9|Q8WU13	Missense_Mutation	SNP	ENST00000265593.4	hg19	CCDS3263.1	.	.	.	.	.	.	.	.	.	.	g	21.1	4.099745	0.76983	.	.	ENSG00000114859	ENST00000265593;ENST00000344937;ENST00000423355;ENST00000434054;ENST00000457512	D;D;T;D;D	0.84660	-1.83;-1.78;-0.33;-1.88;-1.86	5.6	5.6	0.85130	Chloride channel, core (2);	0.053535	0.85682	D	0.000000	D	0.82893	0.5136	N	0.21324	0.655	0.58432	D	0.999999	B;P;P;P;P	0.50066	0.03;0.931;0.536;0.835;0.863	B;P;B;B;P	0.52454	0.038;0.699;0.42;0.295;0.524	T	0.78370	-0.2230	10	0.11485	T	0.65	-21.8536	19.2283	0.93825	0.0:0.0:1.0:0.0	.	409;365;409;409;409	B4DYE3;E9PBD9;E9PCD2;P51788-3;P51788	.;.;.;.;CLCN2_HUMAN	K	409;409;50;365;409	ENSP00000265593:Q409K;ENSP00000345056:Q409K;ENSP00000412226:Q50K;ENSP00000400425:Q365K;ENSP00000391928:Q409K	ENSP00000265593:Q409K	Q	-	1	0	CLCN2	185555957	1.000000	0.71417	1.000000	0.80357	0.750000	0.42670	7.876000	0.87215	2.653000	0.90120	0.563000	0.77884	CAG	.	.		0.577	CLCN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000345571.1		
ACAP2	23527	hgsc.bcm.edu	37	3	195101743	195101743	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr3:195101743G>T	ENST00000326793.6	-	4	510	c.280C>A	c.(280-282)Cac>Aac	p.H94N		NM_012287.5	NP_036419.3	Q15057	ACAP2_HUMAN	ArfGAP with coiled-coil, ankyrin repeat and PH domains 2	94	BAR.				cellular response to nerve growth factor stimulus (GO:1990090)|protein localization to endosome (GO:0036010)|regulation of ARF GTPase activity (GO:0032312)	endosome membrane (GO:0010008)|membrane (GO:0016020)	ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)			cervix(2)|endometrium(2)|kidney(4)|large_intestine(5)|lung(10)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(2)	27						CTTACTGTGTGAAAATTTATC	0.294																																					p.H94N		Atlas-SNP	.											.	ACAP2	72	.	0			c.C280A						.						81.0	81.0	81.0					3																	195101743		2203	4300	6503	SO:0001583	missense	23527	exon4			CTGTGTGAAAATT		CCDS33924.1	3q29	2013-01-10	2008-09-22	2008-09-22	ENSG00000114331	ENSG00000114331		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	16469	protein-coding gene	gene with protein product		607766	"""centaurin, beta 2"""	CENTB2		11050434, 11062263	Standard	NM_012287		Approved	KIAA0041, CNT-B2	uc003fun.4	Q15057	OTTHUMG00000155885	ENST00000326793.6:c.280C>A	chr3.hg19:g.195101743G>T	ENSP00000324287:p.His94Asn	508.0	1.0		497.0	124.0	NM_012287	A8K2V4|Q8N5Z8|Q9UQR3	Missense_Mutation	SNP	ENST00000326793.6	hg19	CCDS33924.1	.	.	.	.	.	.	.	.	.	.	G	23.4	4.417707	0.83449	.	.	ENSG00000114331	ENST00000326793;ENST00000439666	T;T	0.04603	3.59;3.59	5.42	5.42	0.78866	.	0.138359	0.64402	D	0.000003	T	0.23649	0.0572	M	0.79805	2.47	0.80722	D	1	D;D	0.61080	0.989;0.984	D;P	0.72982	0.979;0.889	T	0.00313	-1.1825	10	0.72032	D	0.01	.	16.7133	0.85391	0.0:0.0:1.0:0.0	.	50;94	C9J8L1;Q15057	.;ACAP2_HUMAN	N	94;50	ENSP00000324287:H94N;ENSP00000411336:H50N	ENSP00000324287:H94N	H	-	1	0	ACAP2	196583032	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	5.963000	0.70372	2.533000	0.85409	0.561000	0.74099	CAC	.	.		0.294	ACAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342126.2	NM_012287	
SH3TC1	54436	hgsc.bcm.edu	37	4	8229789	8229789	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr4:8229789A>G	ENST00000245105.3	+	12	2435	c.2368A>G	c.(2368-2370)Acc>Gcc	p.T790A	SH3TC1_ENST00000539824.1_Missense_Mutation_p.T714A	NM_018986.3	NP_061859	Q8TE82	S3TC1_HUMAN	SH3 domain and tetratricopeptide repeats 1	790										NS(1)|breast(3)|endometrium(4)|kidney(4)|large_intestine(6)|lung(10)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	33						CCCCCTCTACACCAGCTTGGC	0.682																																					p.T790A	NSCLC(145;2298 2623 35616 37297)	Atlas-SNP	.											.	SH3TC1	105	.	0			c.A2368G						.						31.0	30.0	30.0					4																	8229789		2202	4299	6501	SO:0001583	missense	54436	exon12			CTCTACACCAGCT	AK074093	CCDS3399.1	4p16.1	2013-01-11			ENSG00000125089	ENSG00000125089		"""Tetratricopeptide (TTC) repeat domain containing"""	26009	protein-coding gene	gene with protein product							Standard	NM_018986		Approved	FLJ20356	uc003gkv.4	Q8TE82	OTTHUMG00000160934	ENST00000245105.3:c.2368A>G	chr4.hg19:g.8229789A>G	ENSP00000245105:p.Thr790Ala	141.0	0.0		112.0	35.0	NM_018986	Q4W5G5	Missense_Mutation	SNP	ENST00000245105.3	hg19	CCDS3399.1	.	.	.	.	.	.	.	.	.	.	a	0.016	-1.538051	0.00942	.	.	ENSG00000125089	ENST00000382516;ENST00000245105;ENST00000539824;ENST00000535265	T;T	0.63255	-0.03;-0.03	4.14	-0.0128	0.13987	Tetratricopeptide-like helical (1);	1.034550	0.07626	N	0.927881	T	0.21186	0.0510	N	0.00419	-1.52	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.21621	-1.0240	10	0.13470	T	0.59	-8.0674	1.6741	0.02818	0.1797:0.2463:0.3797:0.1943	.	790	Q8TE82	S3TC1_HUMAN	A	528;790;714;619	ENSP00000245105:T790A;ENSP00000441045:T714A	ENSP00000245105:T790A	T	+	1	0	SH3TC1	8280689	0.101000	0.21875	0.328000	0.25416	0.030000	0.12068	0.397000	0.20883	0.215000	0.20761	-0.400000	0.06385	ACC	.	.		0.682	SH3TC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000206991.2	NM_018986	
HTRA3	94031	hgsc.bcm.edu	37	4	8293260	8293260	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr4:8293260T>A	ENST00000307358.2	+	4	1076	c.872T>A	c.(871-873)aTg>aAg	p.M291K	HTRA3_ENST00000382512.3_Missense_Mutation_p.M291K	NM_053044.3	NP_444272.1	P83110	HTRA3_HUMAN	HtrA serine peptidase 3	291	Serine protease.				negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|proteolysis (GO:0006508)|regulation of cell growth (GO:0001558)	extracellular region (GO:0005576)	endopeptidase activity (GO:0004175)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(2)|liver(1)|lung(6)|ovary(2)|prostate(1)|urinary_tract(1)	18						GACTCCGACATGGACTACATC	0.637																																					p.M291K		Atlas-SNP	.											.	HTRA3	39	.	0			c.T872A						.						35.0	31.0	32.0					4																	8293260		2202	4299	6501	SO:0001583	missense	94031	exon4			CCGACATGGACTA	AY040094	CCDS3400.1, CCDS75105.1	4p16.1	2008-02-05			ENSG00000170801	ENSG00000170801			30406	protein-coding gene	gene with protein product	"""pregnancy-related serine protease"""	608785				12513693, 14500695	Standard	XM_005248040		Approved	Tasp, Prsp	uc003gla.3	P83110	OTTHUMG00000090561	ENST00000307358.2:c.872T>A	chr4.hg19:g.8293260T>A	ENSP00000303766:p.Met291Lys	115.0	0.0		96.0	30.0	NM_053044	Q7Z7A2	Missense_Mutation	SNP	ENST00000307358.2	hg19	CCDS3400.1	.	.	.	.	.	.	.	.	.	.	t	19.88	3.909966	0.72983	.	.	ENSG00000170801	ENST00000307358;ENST00000382512	D;D	0.88664	-2.41;-2.41	4.08	4.08	0.47627	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (1);	0.092720	0.64402	D	0.000001	D	0.88735	0.6517	N	0.13198	0.31	0.80722	D	1	D;D	0.76494	0.999;0.998	D;D	0.83275	0.995;0.996	D	0.90434	0.4426	10	0.87932	D	0	-54.1374	13.0698	0.59055	0.0:0.0:0.0:1.0	.	291;291	P83110;P83110-2	HTRA3_HUMAN;.	K	291	ENSP00000303766:M291K;ENSP00000371952:M291K	ENSP00000303766:M291K	M	+	2	0	HTRA3	8344160	1.000000	0.71417	1.000000	0.80357	0.891000	0.51852	5.720000	0.68470	1.497000	0.48584	0.373000	0.22412	ATG	.	.		0.637	HTRA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092669.1	NM_053044	
KIT	3815	hgsc.bcm.edu	37	4	55598097	55598097	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr4:55598097A>G	ENST00000288135.5	+	16	2391	c.2294A>G	c.(2293-2295)gAc>gGc	p.D765G		NM_000222.2|NM_001093772.1	NP_000213.1|NP_001087241.1	P10721	KIT_HUMAN	v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog	765	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				actin cytoskeleton reorganization (GO:0031532)|activation of MAPK activity (GO:0000187)|cell chemotaxis (GO:0060326)|cellular response to thyroid hormone stimulus (GO:0097067)|cytokine-mediated signaling pathway (GO:0019221)|dendritic cell cytokine production (GO:0002371)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|digestive tract development (GO:0048565)|ectopic germ cell programmed cell death (GO:0035234)|embryonic hemopoiesis (GO:0035162)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial cell proliferation (GO:0050673)|erythrocyte differentiation (GO:0030218)|erythropoietin-mediated signaling pathway (GO:0038162)|Fc receptor signaling pathway (GO:0038093)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|germ cell migration (GO:0008354)|glycosphingolipid metabolic process (GO:0006687)|hemopoiesis (GO:0030097)|immature B cell differentiation (GO:0002327)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|Kit signaling pathway (GO:0038109)|lamellipodium assembly (GO:0030032)|lymphoid progenitor cell differentiation (GO:0002320)|male gonad development (GO:0008584)|mast cell chemotaxis (GO:0002551)|mast cell cytokine production (GO:0032762)|mast cell degranulation (GO:0043303)|mast cell differentiation (GO:0060374)|mast cell proliferation (GO:0070662)|megakaryocyte development (GO:0035855)|melanocyte adhesion (GO:0097326)|melanocyte differentiation (GO:0030318)|melanocyte migration (GO:0097324)|myeloid progenitor cell differentiation (GO:0002318)|negative regulation of programmed cell death (GO:0043069)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ovarian follicle development (GO:0001541)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|pigmentation (GO:0043473)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase C activity (GO:0010863)|positive regulation of pseudopodium assembly (GO:0031274)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of tyrosine phosphorylation of Stat1 protein (GO:0042511)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|protein autophosphorylation (GO:0046777)|regulation of cell proliferation (GO:0042127)|regulation of cell shape (GO:0008360)|regulation of developmental pigmentation (GO:0048070)|signal transduction (GO:0007165)|signal transduction by phosphorylation (GO:0023014)|somatic stem cell division (GO:0048103)|somatic stem cell maintenance (GO:0035019)|spermatid development (GO:0007286)|spermatogenesis (GO:0007283)|stem cell differentiation (GO:0048863)|stem cell maintenance (GO:0019827)|T cell differentiation (GO:0030217)|visual learning (GO:0008542)	acrosomal vesicle (GO:0001669)|cell-cell junction (GO:0005911)|cytoplasmic side of plasma membrane (GO:0009898)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|mast cell granule (GO:0042629)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cytokine binding (GO:0019955)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|stem cell factor receptor activity (GO:0005020)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			NS(8)|autonomic_ganglia(1)|bone(21)|breast(2)|central_nervous_system(4)|endometrium(10)|eye(12)|genital_tract(18)|haematopoietic_and_lymphoid_tissue(1820)|kidney(17)|large_intestine(17)|lung(27)|ovary(23)|pancreas(4)|prostate(1)|salivary_gland(15)|skin(228)|soft_tissue(4117)|stomach(3)|testis(55)|thymus(7)|upper_aerodigestive_tract(1)	6411	all_cancers(7;0.00453)|all_lung(4;0.000565)|Lung NSC(11;0.00129)|all_epithelial(27;0.0104)|Glioma(25;0.08)|all_neural(26;0.101)		LUSC - Lung squamous cell carcinoma(32;0.000276)|Epithelial(7;0.209)	Colorectal(1;0.0276)|COAD - Colon adenocarcinoma(1;0.171)	Dasatinib(DB01254)|Imatinib(DB00619)|Nilotinib(DB04868)|Pazopanib(DB06589)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	TTGGCCCTAGACTTAGAAGAC	0.458		1	"""Mis, O"""		"""GIST, AML, TGCT, mastocytosis, mucosal melanoma"""	"""GIST, epithelioma"""	Piebald trait		Piebaldism;Mast Cell disease, Familial Clustering of;Gastrointestinal Stromal Tumors, Sporadic Multiple Primary;Familial Gastrointestinal Stromal Tumors																												p.D765G		Atlas-SNP	.	yes	Dom	yes	Familial gastrointestinal stromal tumour	4	4q12	3815	v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog	yes	"""L, M, O, E"""	.	KIT	7396	.	0			c.A2294G						.						120.0	101.0	107.0					4																	55598097		2203	4299	6502	SO:0001583	missense	3815	exon16	Familial Cancer Database	Piebald trait;incl.: Familial Cutaneous Mastocytosis (Urticaria Pigmentosum);Sporadic Multiple GIST;Familial GIST, incl. Multiple Familial Gastrointestinal Autonomic Nerve Tumors (GANT)	CCCTAGACTTAGA	S67773	CCDS3496.1, CCDS47058.1	4q12	2014-09-17			ENSG00000157404	ENSG00000157404		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6342	protein-coding gene	gene with protein product		164920	"""piebald trait"""	PBT		9027509	Standard	NM_001093772		Approved	CD117, SCFR, C-Kit	uc010igr.3	P10721	OTTHUMG00000128713	ENST00000288135.5:c.2294A>G	chr4.hg19:g.55598097A>G	ENSP00000288135:p.Asp765Gly	95.0	0.0		130.0	22.0	NM_000222	B5A956|D5LXN2|D5M931|F5H8F8|Q6IQ28|Q99662|Q9UM99	Missense_Mutation	SNP	ENST00000288135.5	hg19	CCDS3496.1	.	.	.	.	.	.	.	.	.	.	A	18.64	3.667928	0.67814	.	.	ENSG00000157404	ENST00000288135;ENST00000412167	D;D	0.89746	-2.56;-2.56	5.96	5.96	0.96718	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.084488	0.50627	D	0.000116	D	0.90195	0.6935	N	0.25485	0.75	0.80722	D	1	P;D	0.54772	0.929;0.968	P;P	0.61940	0.644;0.896	D	0.91544	0.5252	10	0.72032	D	0.01	.	16.4484	0.83959	1.0:0.0:0.0:0.0	.	761;765	P10721-2;P10721	.;KIT_HUMAN	G	765;761	ENSP00000288135:D765G;ENSP00000390987:D761G	ENSP00000288135:D765G	D	+	2	0	KIT	55292854	1.000000	0.71417	0.990000	0.47175	0.070000	0.16714	9.190000	0.94934	2.285000	0.76669	0.533000	0.62120	GAC	.	.		0.458	KIT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000250618.1		
CSN1S1	1446	hgsc.bcm.edu	37	4	70810724	70810724	+	Splice_Site	SNP	T	T	C			TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr4:70810724T>C	ENST00000246891.4	+	15	606		c.e15+2		CSN1S1_ENST00000507763.1_Splice_Site|CSN1S1_ENST00000505782.1_Splice_Site|CSN1S1_ENST00000444405.3_Splice_Site|CSN1S1_ENST00000507772.1_Splice_Site	NM_001890.1	NP_001881.1	P47710	CASA1_HUMAN	casein alpha s1							extracellular region (GO:0005576)|extracellular space (GO:0005615)	transporter activity (GO:0005215)			lung(5)|prostate(1)|upper_aerodigestive_tract(1)	7						ACAGTGGTGGTAAGTTCATTT	0.358																																					.		Atlas-SNP	.											.	CSN1S1	20	.	0			c.530+2T>C						.						110.0	103.0	105.0					4																	70810724		1856	4099	5955	SO:0001630	splice_region_variant	1446	exon14			TGGTGGTAAGTTC	X78416	CCDS47067.1, CCDS54769.1	4q21.1	2014-02-19	2003-01-24	2003-01-31	ENSG00000126545	ENSG00000126545			2445	protein-coding gene	gene with protein product		115450	"""casein, alpha"""	CASA, CSN1		9050925, 7619062	Standard	NM_001890		Approved		uc003hep.1	P47710	OTTHUMG00000160843	ENST00000246891.4:c.555+2T>C	chr4.hg19:g.70810724T>C		111.0	0.0		110.0	33.0	NM_001025104	A1A510|A1A511|E9PB60|Q4PNR5	Splice_Site	SNP	ENST00000246891.4	hg19	CCDS47067.1																																																																																			.	.		0.358	CSN1S1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000362629.1		Intron
GRSF1	2926	hgsc.bcm.edu	37	4	71698027	71698027	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr4:71698027C>A	ENST00000254799.6	-	4	928	c.811G>T	c.(811-813)Gca>Tca	p.A271S	GRSF1_ENST00000502323.1_Missense_Mutation_p.A109S|GRSF1_ENST00000439371.1_Missense_Mutation_p.A109S|GRSF1_ENST00000545193.1_Missense_Mutation_p.A153S|GRSF1_ENST00000508091.1_Intron	NM_002092.3	NP_002083	Q12849	GRSF1_HUMAN	G-rich RNA sequence binding factor 1	271	RRM 2. {ECO:0000255|PROSITE- ProRule:PRU00176}.				anterior/posterior pattern specification (GO:0009952)|morphogenesis of embryonic epithelium (GO:0016331)|mRNA polyadenylation (GO:0006378)|tRNA processing (GO:0008033)	cytoplasm (GO:0005737)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(9)|upper_aerodigestive_tract(2)	17		all_hematologic(202;0.21)	Lung(101;0.235)			AAAGTACCTGCAAAGAAGTCT	0.423																																					p.A271S		Atlas-SNP	.											.	GRSF1	35	.	0			c.G811T						.						123.0	120.0	121.0					4																	71698027		1900	4119	6019	SO:0001583	missense	2926	exon4			TACCTGCAAAGAA	BC040485	CCDS47069.1, CCDS47070.1	4q13	2013-07-16				ENSG00000132463		"""RNA binding motif (RRM) containing"""	4610	protein-coding gene	gene with protein product		604851				8036161	Standard	NM_001098477		Approved		uc010iia.1	Q12849		ENST00000254799.6:c.811G>T	chr4.hg19:g.71698027C>A	ENSP00000254799:p.Ala271Ser	109.0	0.0		102.0	22.0	NM_002092	B3KPW0|Q4W5S5|Q6ZST3|Q8IWD6|Q8NBD2	Missense_Mutation	SNP	ENST00000254799.6	hg19	CCDS47069.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	8.094|8.094	0.775119|0.775119	0.16051|0.16051	.|.	.|.	ENSG00000132463|ENSG00000132463	ENST00000254799;ENST00000439371;ENST00000540657;ENST00000499044;ENST00000502323;ENST00000545193|ENST00000514161	T;T;T;T;T|.	0.06528|.	3.29;3.29;3.29;3.29;3.29|.	5.93|5.93	5.93|5.93	0.95920|0.95920	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);|.	0.053759|.	0.85682|.	D|.	0.000000|.	T|T	0.36386|0.36386	0.0965|0.0965	N|N	0.04387|0.04387	-0.21|-0.21	0.40915|0.40915	D|D	0.984266|0.984266	B;B|.	0.28026|.	0.016;0.198|.	B;B|.	0.34873|.	0.021;0.191|.	T|T	0.33854|0.33854	-0.9852|-0.9852	10|5	0.05959|.	T|.	0.93|.	.|.	14.5816|14.5816	0.68295|0.68295	0.265:0.735:0.0:0.0|0.265:0.735:0.0:0.0	.|.	184;271|.	B7Z5F9;Q12849|.	.;GRSF1_HUMAN|.	S|F	271;109;203;244;109;153|207	ENSP00000254799:A271S;ENSP00000389219:A109S;ENSP00000427354:A244S;ENSP00000425430:A109S;ENSP00000443380:A153S|.	ENSP00000254799:A271S|.	A|L	-|-	1|3	0|2	GRSF1|GRSF1	71916891|71916891	0.961000|0.961000	0.32948|0.32948	1.000000|1.000000	0.80357|0.80357	0.995000|0.995000	0.86356|0.86356	1.057000|1.057000	0.30492|0.30492	2.808000|2.808000	0.96608|0.96608	0.655000|0.655000	0.94253|0.94253	GCA|TTG	.	.		0.423	GRSF1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362642.1	NM_002092	
ALB	213	hgsc.bcm.edu	37	4	74285989	74285989	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr4:74285989G>T	ENST00000503124.1	+	12	1561	c.1354G>T	c.(1354-1356)Gca>Tca	p.A452S	ALB_ENST00000415165.2_Missense_Mutation_p.A410S|ALB_ENST00000509063.1_Intron|ALB_ENST00000295897.4_Missense_Mutation_p.A602S|ALB_ENST00000505649.1_3'UTR|ALB_ENST00000401494.3_Missense_Mutation_p.A487S			Q8TES7	FBF1_HUMAN	albumin	0					apical junction assembly (GO:0043297)|cilium assembly (GO:0042384)|establishment of epithelial cell polarity (GO:0090162)	cell junction (GO:0030054)|centriole (GO:0005814)|ciliary transition fiber (GO:0097539)|spindle pole (GO:0000922)				NS(1)|endometrium(4)|kidney(1)|large_intestine(6)|liver(9)|lung(16)|ovary(3)|prostate(2)|skin(4)|stomach(1)|urinary_tract(1)	48	Breast(15;0.00102)		Epithelial(6;4.8e-05)|OV - Ovarian serous cystadenocarcinoma(6;0.000263)|all cancers(17;0.000472)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			ACTTGTTGCTGCAAGTCAAGC	0.274																																					p.A602S		Atlas-SNP	.											.	ALB	132	.	0			c.G1804T						.						88.0	87.0	87.0					4																	74285989		2201	4300	6501	SO:0001583	missense	213	exon14			GTTGCTGCAAGTC	V00494	CCDS3555.1	4q13.3	2008-02-05	2006-06-30	2006-06-30	ENSG00000163631	ENSG00000163631			399	protein-coding gene	gene with protein product		103600				6292049, 6192711	Standard	NM_000477		Approved		uc003hgs.4	P02768	OTTHUMG00000129919	ENST00000503124.1:c.1354G>T	chr4.hg19:g.74285989G>T	ENSP00000421027:p.Ala452Ser	191.0	0.0		167.0	35.0	NM_000477	B5MEM5|Q96IF6|Q96JG4|Q96MA8	Missense_Mutation	SNP	ENST00000503124.1	hg19		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	0.011|0.011	-1.732458|-1.732458	0.00687|0.00687	.|.	.|.	ENSG00000163631|ENSG00000163631	ENST00000295897;ENST00000415165;ENST00000329326;ENST00000503124;ENST00000401494;ENST00000430202|ENST00000511370	T;T;T;T|.	0.58060|.	0.36;0.36;0.36;0.36|.	5.54|5.54	-11.1|-11.1	0.00147|0.00147	Serum albumin-like (1);|.	.|2.578920	.|0.00997	.|N	.|0.003611	T|T	0.14013|0.14013	0.0339|0.0339	N|N	0.04203|0.04203	-0.255|-0.255	0.09310|0.09310	N|N	1|1	B;B;B;B|.	0.02656|.	0.0;0.0;0.0;0.0|.	B;B;B;B|.	0.06405|.	0.001;0.002;0.001;0.001|.	T|T	0.10245|0.10245	-1.0638|-1.0638	9|6	0.08381|.	T|.	0.77|.	17.2539|17.2539	8.6814|8.6814	0.34212|0.34212	0.3562:0.0:0.094:0.5498|0.3562:0.0:0.094:0.5498	.|.	487;410;452;602|.	B7WNR0;C9JKR2;D6RHD5;P02768|.	.;.;.;ALBU_HUMAN|.	S|F	602;410;389;452;487;611|446	ENSP00000295897:A602S;ENSP00000401820:A410S;ENSP00000421027:A452S;ENSP00000384695:A487S|.	ENSP00000295897:A602S|.	A|C	+|+	1|2	0|0	ALB|ALB	74504853|74504853	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.104000|0.104000	0.19210|0.19210	-4.042000|-4.042000	0.00307|0.00307	-3.470000|-3.470000	0.00157|0.00157	-0.806000|-0.806000	0.03193|0.03193	GCA|TGC	.	.		0.274	ALB-011	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000365419.1	NM_000477	
FRAS1	80144	hgsc.bcm.edu	37	4	79387360	79387360	+	Splice_Site	SNP	A	A	C			TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr4:79387360A>C	ENST00000264895.6	+	50	7469		c.e50-1			NM_025074.6	NP_079350.5	Q86XX4	FRAS1_HUMAN	Fraser extracellular matrix complex subunit 1						cell communication (GO:0007154)|embryonic limb morphogenesis (GO:0030326)|metanephros morphogenesis (GO:0003338)|morphogenesis of an epithelium (GO:0002009)|palate development (GO:0060021)|protein transport (GO:0015031)|skin development (GO:0043588)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|sublamina densa (GO:0061618)	metal ion binding (GO:0046872)			breast(2)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(5)|lung(54)|prostate(7)|skin(2)|urinary_tract(4)	103						CCTTCCGGACAGGCCGAGTCT	0.537																																					.		Atlas-SNP	.											.	FRAS1	779	.	0			c.7030-2A>C						.						56.0	56.0	56.0					4																	79387360		2122	4240	6362	SO:0001630	splice_region_variant	80144	exon50			CCGGACAGGCCGA	AB040933	CCDS54772.1	4q21.21	2014-06-25	2014-06-25		ENSG00000138759	ENSG00000138759			19185	protein-coding gene	gene with protein product		607830	"""Fraser syndrome 1"""			12766769, 3118036	Standard	NM_025074		Approved	FLJ22031, FLJ14927, KIAA1500	uc003hlb.2	Q86XX4	OTTHUMG00000160856	ENST00000264895.6:c.7030-1A>C	chr4.hg19:g.79387360A>C		107.0	0.0		84.0	14.0	NM_025074	A2RRR8|Q86UZ4|Q8N3U9|Q8NAU7|Q96JW7|Q9H6N9|Q9P228	Splice_Site	SNP	ENST00000264895.6	hg19	CCDS54771.1	.	.	.	.	.	.	.	.	.	.	A	21.9	4.209385	0.79240	.	.	ENSG00000138759	ENST00000264895;ENST00000512123	.	.	.	5.53	5.53	0.82687	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.954	0.79865	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	FRAS1	79606384	1.000000	0.71417	0.996000	0.52242	0.794000	0.44872	8.987000	0.93497	2.235000	0.73313	0.477000	0.44152	.	.	.		0.537	FRAS1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			Intron
PDLIM5	10611	hgsc.bcm.edu	37	4	95507590	95507590	+	Silent	SNP	G	G	A			TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr4:95507590G>A	ENST00000317968.4	+	7	1051	c.915G>A	c.(913-915)aaG>aaA	p.K305K	PDLIM5_ENST00000380180.3_Silent_p.K202K|PDLIM5_ENST00000542407.1_Silent_p.K183K|PDLIM5_ENST00000514743.1_Silent_p.K202K|PDLIM5_ENST00000437932.1_Silent_p.K196K|PDLIM5_ENST00000318007.5_Silent_p.K182K|PDLIM5_ENST00000508216.1_Silent_p.K202K|PDLIM5_ENST00000538141.1_Silent_p.K182K|PDLIM5_ENST00000450793.1_Silent_p.K202K|PDLIM5_ENST00000380176.3_3'UTR	NM_001256428.1|NM_006457.4	NP_001243357.1|NP_006448	Q96HC4	PDLI5_HUMAN	PDZ and LIM domain 5	305					regulation of dendritic spine morphogenesis (GO:0061001)|regulation of synapse assembly (GO:0051963)	actin cytoskeleton (GO:0015629)|cell junction (GO:0030054)|cytosol (GO:0005829)|membrane (GO:0016020)|neuron projection (GO:0043005)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	actin binding (GO:0003779)|actinin binding (GO:0042805)|protein kinase C binding (GO:0005080)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(3)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	22		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;1.84e-09)		ATACAAAGAAGGCAAAGTAAG	0.284																																					p.K305K		Atlas-SNP	.											.	PDLIM5	76	.	0			c.G915A						.						120.0	131.0	127.0					4																	95507590		2203	4300	6503	SO:0001819	synonymous_variant	10611	exon7			AAAGAAGGCAAAG	AF061258	CCDS3641.1, CCDS47103.1, CCDS47104.1, CCDS58915.1, CCDS58916.1, CCDS58917.1, CCDS75166.1	4q22	2006-04-12			ENSG00000163110	ENSG00000163110			17468	protein-coding gene	gene with protein product		605904				15346770	Standard	NM_006457		Approved	LIM, Enh	uc003htk.4	Q96HC4	OTTHUMG00000130973	ENST00000317968.4:c.915G>A	chr4.hg19:g.95507590G>A		70.0	0.0		80.0	14.0	NM_006457	A8K6F9|D6RB78|E9PBF5|O60705|Q56VN4|Q5UW38|Q8WVK0	Silent	SNP	ENST00000317968.4	hg19	CCDS3641.1	.	.	.	.	.	.	.	.	.	.	G	7.740	0.701066	0.15172	.	.	ENSG00000163110	ENST00000513341	.	.	.	5.24	2.55	0.30701	.	.	.	.	.	T	0.59059	0.2166	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.54234	-0.8324	4	.	.	.	.	10.0519	0.42221	0.2235:0.0:0.7765:0.0	.	.	.	.	K	164	.	.	R	+	2	0	PDLIM5	95726613	1.000000	0.71417	1.000000	0.80357	0.774000	0.43823	2.877000	0.48506	0.703000	0.31848	-0.140000	0.14226	AGG	.	.		0.284	PDLIM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253586.1		
ZGRF1	55345	hgsc.bcm.edu	37	4	113540196	113540196	+	Silent	SNP	C	C	T			TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr4:113540196C>T	ENST00000505019.1	-	6	1127	c.1002G>A	c.(1000-1002)caG>caA	p.Q334Q	C4orf21_ENST00000445203.2_Silent_p.Q303Q|C4orf21_ENST00000309071.5_Silent_p.Q334Q	NM_018392.4	NP_060862.3	Q86YA3	ZGRF1_HUMAN		334						integral component of membrane (GO:0016021)	zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|endometrium(3)|kidney(5)|large_intestine(6)|lung(21)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	45		Ovarian(17;0.156)		OV - Ovarian serous cystadenocarcinoma(123;0.000676)		TAGGTGAACTCTGTGAGGATA	0.383																																					p.Q334Q		Atlas-SNP	.											.	C4orf21	223	.	0			c.G1002A						.						78.0	83.0	81.0					4																	113540196		2201	4300	6501	SO:0001819	synonymous_variant	55345	exon6			TGAACTCTGTGAG																												ENST00000505019.1:c.1002G>A	chr4.hg19:g.113540196C>T		120.0	0.0		102.0	30.0	NM_018392	B3KQX2|B4DSN6|B4DYU8|E9PDE1|G5EA02|Q6ZU11|Q9NSW3|Q9NUJ4	Silent	SNP	ENST00000505019.1	hg19																																																																																				.	.		0.383	C4orf21-003	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000256413.1		
FAT4	79633	hgsc.bcm.edu	37	4	126238464	126238464	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr4:126238464C>T	ENST00000394329.3	+	1	911	c.898C>T	c.(898-900)Cct>Tct	p.P300S		NM_024582.4	NP_078858.4	Q6V0I7	FAT4_HUMAN	FAT atypical cadherin 4	300	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|cerebral cortex development (GO:0021987)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|inner ear receptor stereocilium organization (GO:0060122)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|plasma membrane organization (GO:0007009)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(6)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(93)|liver(3)|lung(120)|ovary(9)|pancreas(2)|prostate(21)|skin(31)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(6)	355						CCAAATGGACCCTGAGACGGG	0.662											OREG0016317	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.P300S		Atlas-SNP	.											FAT4_ENST00000394329,NS,carcinoma,0,2	FAT4	1752	.	0			c.C898T						.						23.0	28.0	26.0					4																	126238464		2004	4156	6160	SO:0001583	missense	79633	exon1			ATGGACCCTGAGA	AY356402	CCDS3732.3	4q28.1	2013-05-31	2013-05-31		ENSG00000196159	ENSG00000196159		"""Cadherins / Cadherin-related"""	23109	protein-coding gene	gene with protein product	"""cadherin-related family member 11"""	612411	"""FAT tumor suppressor homolog 4 (Drosophila)"""			15003449	Standard	NM_024582		Approved	CDHF14, FAT-J, CDHR11	uc003ifj.4	Q6V0I7	OTTHUMG00000133100	ENST00000394329.3:c.898C>T	chr4.hg19:g.126238464C>T	ENSP00000377862:p.Pro300Ser	98.0	0.0	1548	86.0	14.0	NM_024582	A8K5Z6|B5MDG4|Q3LIA6|Q8TCK7|Q9H5T6	Missense_Mutation	SNP	ENST00000394329.3	hg19	CCDS3732.3	.	.	.	.	.	.	.	.	.	.	C	14.32	2.498986	0.44455	.	.	ENSG00000196159	ENST00000394329	T	0.53423	0.62	5.02	4.15	0.48705	Cadherin (4);Cadherin-like (1);	0.000000	0.34362	U	0.004027	T	0.51160	0.1658	N	0.17278	0.47	0.80722	D	1	P	0.49358	0.923	D	0.65874	0.939	T	0.50676	-0.8800	10	0.34782	T	0.22	.	15.2765	0.73745	0.0:0.8592:0.1408:0.0	.	300	Q6V0I7	FAT4_HUMAN	S	300	ENSP00000377862:P300S	ENSP00000377862:P300S	P	+	1	0	FAT4	126457914	1.000000	0.71417	0.993000	0.49108	0.430000	0.31655	3.692000	0.54727	1.048000	0.40298	0.655000	0.94253	CCT	.	.		0.662	FAT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256765.2	NM_024582	
C4orf45	152940	hgsc.bcm.edu	37	4	159836450	159836450	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr4:159836450G>T	ENST00000434826.2	-	4	502	c.418C>A	c.(418-420)Cat>Aat	p.H140N	C4orf45_ENST00000508011.1_5'UTR	NM_152543.2	NP_689756.2	Q96LM5	CD045_HUMAN	chromosome 4 open reading frame 45	140										large_intestine(2)|lung(3)	5						GCACTCATATGCCAGGCAAAA	0.438																																					p.H140N		Atlas-SNP	.											.	C4orf45	8	.	0			c.C418A						.						87.0	80.0	82.0					4																	159836450		1910	4132	6042	SO:0001583	missense	152940	exon4			TCATATGCCAGGC		CCDS47156.1	4q32.1	2012-03-02			ENSG00000164123	ENSG00000164123			26342	protein-coding gene	gene with protein product							Standard	NM_152543		Approved	FLJ25371	uc003iqf.1	Q96LM5	OTTHUMG00000161988	ENST00000434826.2:c.418C>A	chr4.hg19:g.159836450G>T	ENSP00000412215:p.His140Asn	97.0	0.0		148.0	32.0	NM_152543	A8MPU3|C9J0T8	Missense_Mutation	SNP	ENST00000434826.2	hg19	CCDS47156.1	.	.	.	.	.	.	.	.	.	.	G	0.624	-0.819843	0.02776	.	.	ENSG00000164123	ENST00000434826	T	0.11930	2.73	5.83	-1.44	0.08856	.	0.719586	0.12927	N	0.427699	T	0.07188	0.0182	N	0.16743	0.435	0.09310	N	0.999994	B	0.06786	0.001	B	0.06405	0.002	T	0.40646	-0.9552	9	.	.	.	-20.633	9.6433	0.39853	0.0789:0.0:0.2185:0.7026	.	140	Q96LM5	CD045_HUMAN	N	140	ENSP00000412215:H140N	.	H	-	1	0	C4orf45	160055900	0.959000	0.32827	0.184000	0.23157	0.008000	0.06430	0.268000	0.18571	-0.175000	0.10725	-0.137000	0.14449	CAT	.	.		0.438	C4orf45-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366636.1	NM_152543	
FAT1	2195	hgsc.bcm.edu	37	4	187628856	187628856	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr4:187628856A>G	ENST00000441802.2	-	2	2335	c.2126T>C	c.(2125-2127)gTc>gCc	p.V709A		NM_005245.3	NP_005236.2	Q14517	FAT1_HUMAN	FAT atypical cadherin 1	709					actin filament organization (GO:0007015)|anatomical structure morphogenesis (GO:0009653)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|cell-cell signaling (GO:0007267)|establishment or maintenance of cell polarity (GO:0007163)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(38)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(33)|lung(88)|ovary(13)|pancreas(2)|prostate(16)|skin(2)|upper_aerodigestive_tract(11)|urinary_tract(4)	228						GTGAGCATTGACAGAGTGAGA	0.458										HNSCC(5;0.00058)																											p.V709A	Colon(197;1040 2055 4143 4984 49344)	Atlas-SNP	.											.	FAT1	500	.	0			c.T2126C						.						50.0	48.0	49.0					4																	187628856		1918	4136	6054	SO:0001583	missense	2195	exon2			GCATTGACAGAGT	X87241	CCDS47177.1	4q35.2	2013-05-31	2013-05-31	2008-10-30	ENSG00000083857	ENSG00000083857		"""Cadherins / Cadherin-related"""	3595	protein-coding gene	gene with protein product	"""cadherin-related family member 8"""	600976	"""FAT tumor suppressor (Drosophila) homolog"", ""FAT tumor suppressor homolog 1 (Drosophila)"""	FAT		8586420	Standard	XM_005262834		Approved	CDHF7, CDHR8	uc003izf.3	Q14517	OTTHUMG00000160320	ENST00000441802.2:c.2126T>C	chr4.hg19:g.187628856A>G	ENSP00000406229:p.Val709Ala	91.0	0.0		64.0	15.0	NM_005245		Missense_Mutation	SNP	ENST00000441802.2	hg19	CCDS47177.1	.	.	.	.	.	.	.	.	.	.	A	10.12	1.264387	0.23136	.	.	ENSG00000083857	ENST00000441802;ENST00000260147	T	0.71341	-0.56	5.4	5.4	0.78164	Cadherin (1);Cadherin-like (1);	0.424017	0.25714	N	0.028783	T	0.65260	0.2674	L	0.59436	1.845	0.43114	D	0.994826	B	0.30455	0.28	B	0.32980	0.156	T	0.61884	-0.6971	10	0.23891	T	0.37	.	9.9872	0.41849	0.9252:0.0:0.0748:0.0	.	709	Q14517	FAT1_HUMAN	A	709	ENSP00000406229:V709A	ENSP00000260147:V709A	V	-	2	0	FAT1	187865850	1.000000	0.71417	1.000000	0.80357	0.099000	0.18886	7.383000	0.79741	2.263000	0.75096	0.533000	0.62120	GTC	.	.		0.458	FAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360209.3	NM_005245	
SLC12A7	10723	hgsc.bcm.edu	37	5	1073787	1073787	+	Silent	SNP	C	C	T	rs564599238	byFrequency	TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr5:1073787C>T	ENST00000264930.5	-	17	2245	c.2202G>A	c.(2200-2202)acG>acA	p.T734T		NM_006598.2	NP_006589.2	Q9Y666	S12A7_HUMAN	solute carrier family 12 (potassium/chloride transporter), member 7	734					cell volume homeostasis (GO:0006884)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transport (GO:0006811)|potassium ion transport (GO:0006813)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	potassium:chloride symporter activity (GO:0015379)|protein kinase binding (GO:0019901)			breast(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(14)|ovary(2)|prostate(1)|skin(4)|urinary_tract(2)	32	Lung NSC(6;2.47e-13)|all_lung(6;1.67e-12)|all_epithelial(6;5.44e-09)		Epithelial(17;0.000497)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|all cancers(22;0.00241)|Lung(60;0.165)		Potassium Chloride(DB00761)	TGTCCAGGTACGTCCCCTCCA	0.697													C|||	3	0.000599042	0.0	0.0	5008	,	,		15054	0.0		0.0	False		,,,				2504	0.0031				p.T734T		Atlas-SNP	.											.	SLC12A7	97	.	0			c.G2202A						.						57.0	61.0	60.0					5																	1073787		2201	4298	6499	SO:0001819	synonymous_variant	10723	exon17			CAGGTACGTCCCC	AF105365	CCDS34129.1	5p15	2013-07-18	2013-07-18		ENSG00000113504	ENSG00000113504		"""Solute carriers"""	10915	protein-coding gene	gene with protein product		604879				10347194	Standard	NM_006598		Approved	KCC4, DKFZP434F076	uc003jbu.3	Q9Y666	OTTHUMG00000161931	ENST00000264930.5:c.2202G>A	chr5.hg19:g.1073787C>T		124.0	0.0		110.0	25.0	NM_006598	A6NDS8|Q4G0F3|Q96I81|Q9H7I3|Q9H7I7|Q9UFW2	Silent	SNP	ENST00000264930.5	hg19	CCDS34129.1	.	.	.	.	.	.	.	.	.	.	c	4.157	0.027531	0.08054	.	.	ENSG00000113504	ENST00000513223	.	.	.	4.04	0.916	0.19373	.	.	.	.	.	T	0.55114	0.1900	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.46884	-0.9159	4	.	.	.	.	8.0386	0.30508	0.0:0.1417:0.4439:0.4144	.	.	.	.	I	92	.	.	V	-	1	0	SLC12A7	1126787	1.000000	0.71417	0.997000	0.53966	0.366000	0.29705	0.655000	0.24933	0.281000	0.22233	-1.468000	0.01013	GTA	.	.		0.697	SLC12A7-001	KNOWN	non_canonical_TEC|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366446.2	NM_006598	
ADAMTS16	170690	hgsc.bcm.edu	37	5	5232631	5232631	+	Splice_Site	SNP	T	T	C			TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr5:5232631T>C	ENST00000274181.7	+	12	1988		c.e12+2			NM_139056.2	NP_620687.2	Q8TE57	ATS16_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 16						branching involved in ureteric bud morphogenesis (GO:0001658)	proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(72)|ovary(4)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	107						CAACCCCAAGTAAGTATGCCT	0.512																																					.		Atlas-SNP	.											.	ADAMTS16	543	.	0			c.1850+2T>C						.						93.0	104.0	100.0					5																	5232631		2167	4278	6445	SO:0001630	splice_region_variant	170690	exon12			CCCAAGTAAGTAT	AJ315734	CCDS43299.1	5p15	2008-07-18	2005-08-19		ENSG00000145536	ENSG00000145536		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17108	protein-coding gene	gene with protein product		607510	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 16"""			11867212	Standard	NM_139056		Approved	ADAMTS16s	uc003jdl.3	Q8TE57	OTTHUMG00000161663	ENST00000274181.7:c.1850+2T>C	chr5.hg19:g.5232631T>C		33.0	0.0		27.0	11.0	NM_139056	C6G490|Q8IVE2	Splice_Site	SNP	ENST00000274181.7	hg19	CCDS43299.1	.	.	.	.	.	.	.	.	.	.	T	12.37	1.919008	0.33908	.	.	ENSG00000145536	ENST00000274181;ENST00000536857	.	.	.	5.18	5.18	0.71444	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.0292	0.64604	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	ADAMTS16	5285631	1.000000	0.71417	0.916000	0.36221	0.031000	0.12232	7.653000	0.83643	1.959000	0.56917	0.402000	0.26972	.	.	.		0.512	ADAMTS16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365657.1	NM_139056	Intron
FBN2	2201	hgsc.bcm.edu	37	5	127680112	127680112	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr5:127680112C>A	ENST00000508053.1	-	31	4282	c.3308G>T	c.(3307-3309)gGc>gTc	p.G1103V	FBN2_ENST00000262464.4_Missense_Mutation_p.G1103V|FBN2_ENST00000508989.1_Missense_Mutation_p.G1070V			P35556	FBN2_HUMAN	fibrillin 2	1103	EGF-like 15; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				anatomical structure morphogenesis (GO:0009653)|bone trabecula formation (GO:0060346)|embryonic limb morphogenesis (GO:0030326)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|sequestering of TGFbeta in extracellular matrix (GO:0035583)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(37)|liver(1)|lung(89)|ovary(9)|pancreas(2)|prostate(6)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	197		all_cancers(142;0.0216)|Prostate(80;0.0551)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)		TAGAGCAAAGCCACTATTGCA	0.418																																					p.G1103V		Atlas-SNP	.											.	FBN2	858	.	0			c.G3308T						.						148.0	143.0	144.0					5																	127680112		2203	4300	6503	SO:0001583	missense	2201	exon25			GCAAAGCCACTAT	U03272	CCDS34222.1	5q23-q31	2008-08-01	2008-08-01			ENSG00000138829			3604	protein-coding gene	gene with protein product	"""fibrillin 5"""	612570	"""congenital contractural arachnodactyly"""	CCA		1852206, 8120105	Standard	NM_001999		Approved	DA9	uc003kuu.3	P35556		ENST00000508053.1:c.3308G>T	chr5.hg19:g.127680112C>A	ENSP00000424571:p.Gly1103Val	177.0	0.0		127.0	35.0	NM_001999	B4DU01|Q59ES6	Missense_Mutation	SNP	ENST00000508053.1	hg19	CCDS34222.1	.	.	.	.	.	.	.	.	.	.	C	14.70	2.612793	0.46631	.	.	ENSG00000138829	ENST00000262464;ENST00000508053;ENST00000508989	D;D;D	0.92965	-3.14;-3.14;-3.14	4.54	3.67	0.42095	EGF-like region, conserved site (1);EGF-like calcium-binding (2);Epidermal growth factor-like, type 3 (1);	0.000000	0.64402	D	0.000005	D	0.97114	0.9057	H	0.95224	3.64	0.80722	D	1	D;B	0.89917	1.0;0.035	D;B	0.91635	0.999;0.061	D	0.98417	1.0575	10	0.87932	D	0	.	14.9775	0.71286	0.1442:0.8558:0.0:0.0	.	1070;1103	D6RJI3;P35556	.;FBN2_HUMAN	V	1103;1103;1070	ENSP00000262464:G1103V;ENSP00000424571:G1103V;ENSP00000425596:G1070V	ENSP00000262464:G1103V	G	-	2	0	FBN2	127708011	1.000000	0.71417	1.000000	0.80357	0.025000	0.11179	7.548000	0.82154	1.495000	0.48549	-0.324000	0.08512	GGC	.	.		0.418	FBN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371618.2	NM_001999	
SLC6A7	6534	hgsc.bcm.edu	37	5	149580667	149580667	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr5:149580667G>T	ENST00000230671.2	+	6	1110	c.739G>T	c.(739-741)Gcc>Tcc	p.A247S	SLC6A7_ENST00000524041.1_Missense_Mutation_p.A247S	NM_014228.3	NP_055043.2	Q99884	SC6A7_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 7	247					proline transport (GO:0015824)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	neurotransmitter:sodium symporter activity (GO:0005328)			NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|liver(1)|lung(4)|skin(1)|stomach(1)	16		all_hematologic(541;0.224)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)		L-Proline(DB00172)	GTATTTCACGGCCACGTTCCC	0.562																																					p.A247S		Atlas-SNP	.											.	SLC6A7	52	.	0			c.G739T						.						210.0	150.0	170.0					5																	149580667		2203	4300	6503	SO:0001583	missense	6534	exon6			TTCACGGCCACGT	S80071	CCDS4305.1	5q32	2013-07-19	2013-07-19		ENSG00000011083	ENSG00000011083		"""Solute carriers"""	11054	protein-coding gene	gene with protein product	"""brain-specific L-proline transporter"", ""sodium-dependent proline transporter"""	606205	"""solute carrier family 6 (neurotransmitter transporter, L-proline), member 7"""			7651355	Standard	NM_014228		Approved	PROT	uc003lrr.3	Q99884	OTTHUMG00000130046	ENST00000230671.2:c.739G>T	chr5.hg19:g.149580667G>T	ENSP00000230671:p.Ala247Ser	54.0	0.0		60.0	16.0	NM_014228	Q0VG81|Q52LU6	Missense_Mutation	SNP	ENST00000230671.2	hg19	CCDS4305.1	.	.	.	.	.	.	.	.	.	.	G	34	5.323535	0.95708	.	.	ENSG00000011083	ENST00000230671;ENST00000524041	T;T	0.76448	-1.02;-1.02	5.24	5.24	0.73138	.	0.000000	0.85682	D	0.000000	D	0.88377	0.6420	M	0.77616	2.38	0.80722	D	1	D	0.65815	0.995	D	0.70935	0.971	D	0.89715	0.3915	10	0.87932	D	0	.	18.8226	0.92103	0.0:0.0:1.0:0.0	.	247	Q99884	SC6A7_HUMAN	S	247	ENSP00000230671:A247S;ENSP00000428200:A247S	ENSP00000230671:A247S	A	+	1	0	SLC6A7	149560860	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	9.841000	0.99482	2.436000	0.82500	0.561000	0.74099	GCC	.	.		0.562	SLC6A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252325.1	NM_014228	
TIMD4	91937	hgsc.bcm.edu	37	5	156378589	156378589	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr5:156378589G>T	ENST00000274532.2	-	3	669	c.613C>A	c.(613-615)Ctt>Att	p.L205I	TIMD4_ENST00000407087.3_Missense_Mutation_p.L205I	NM_138379.2	NP_612388.2	Q96H15	TIMD4_HUMAN	T-cell immunoglobulin and mucin domain containing 4	205	Thr-rich.					integral component of membrane (GO:0016021)				NS(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(23)|ovary(2)|skin(2)	37	Renal(175;0.00488)	Medulloblastoma(196;0.0523)|all_neural(177;0.21)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			TCCTCCGGAAGGGTGCTTGGG	0.537																																					p.L205I		Atlas-SNP	.											.	TIMD4	94	.	0			c.C613A						.						288.0	255.0	267.0					5																	156378589		2203	4300	6503	SO:0001583	missense	91937	exon3			CCGGAAGGGTGCT	BC008988	CCDS4332.1, CCDS54943.1	5q33.3	2013-01-11			ENSG00000145850	ENSG00000145850		"""Immunoglobulin superfamily / V-set domain containing"""	25132	protein-coding gene	gene with protein product		610096				12477932	Standard	NM_001146726		Approved		uc003lwh.2	Q96H15	OTTHUMG00000130244	ENST00000274532.2:c.613C>A	chr5.hg19:g.156378589G>T	ENSP00000274532:p.Leu205Ile	256.0	0.0		245.0	75.0	NM_138379	B5MCL9	Missense_Mutation	SNP	ENST00000274532.2	hg19	CCDS4332.1	.	.	.	.	.	.	.	.	.	.	G	15.78	2.933883	0.52866	.	.	ENSG00000145850	ENST00000274532;ENST00000407087	T;T	0.22336	1.96;2.07	4.7	0.642	0.17765	.	1.288300	0.05518	N	0.561561	T	0.15998	0.0385	L	0.29908	0.895	0.09310	N	1	P;P	0.41978	0.767;0.767	B;B	0.40940	0.344;0.344	T	0.19321	-1.0309	10	0.41790	T	0.15	-0.925	4.3172	0.10998	0.2465:0.0:0.5886:0.1649	.	205;205	B5MCL9;Q96H15	.;TIMD4_HUMAN	I	205	ENSP00000274532:L205I;ENSP00000385973:L205I	ENSP00000274532:L205I	L	-	1	0	TIMD4	156311167	0.000000	0.05858	0.000000	0.03702	0.048000	0.14542	0.363000	0.20301	-0.016000	0.14127	0.561000	0.74099	CTT	.	.		0.537	TIMD4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252568.1	NM_138379	
FNDC9	408263	hgsc.bcm.edu	37	5	156770032	156770032	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr5:156770032C>A	ENST00000312349.4	-	2	700	c.513G>T	c.(511-513)agG>agT	p.R171S	CYFIP2_ENST00000435847.2_Intron|CYFIP2_ENST00000521420.1_Intron|CYFIP2_ENST00000318218.6_Intron|CYFIP2_ENST00000522463.1_Intron|CYFIP2_ENST00000541131.1_Intron|CYFIP2_ENST00000442283.2_Intron|CYFIP2_ENST00000377576.3_Intron|CYFIP2_ENST00000347377.6_Intron	NM_001001343.3	NP_001001343.2	Q8TBE3	FNDC9_HUMAN	fibronectin type III domain containing 9	171						integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(1)|prostate(1)|skin(1)|urinary_tract(1)	9						GGTCTTCCTCCCTCTGACCAA	0.612											OREG0016977	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.R171S		Atlas-SNP	.											.	FNDC9	22	.	0			c.G513T						.						82.0	85.0	84.0					5																	156770032		2203	4300	6503	SO:0001583	missense	408263	exon2			TTCCTCCCTCTGA	BC022570	CCDS4337.1	5q33.3	2013-02-11	2011-01-25	2011-01-25	ENSG00000172568	ENSG00000172568		"""Fibronectin type III domain containing"""	33547	protein-coding gene	gene with protein product			"""chromosome 5 open reading frame 40"""	C5orf40			Standard	NM_001001343		Approved	MGC27121	uc003lwu.2	Q8TBE3	OTTHUMG00000130248	ENST00000312349.4:c.513G>T	chr5.hg19:g.156770032C>A	ENSP00000310594:p.Arg171Ser	118.0	0.0	1781	116.0	28.0	NM_001001343	A8K0Y6	Missense_Mutation	SNP	ENST00000312349.4	hg19	CCDS4337.1	.	.	.	.	.	.	.	.	.	.	C	12.14	1.848354	0.32699	.	.	ENSG00000172568	ENST00000312349;ENST00000520782	T;T	0.63580	-0.05;-0.05	5.08	0.0721	0.14385	.	0.760320	0.12187	N	0.491536	T	0.39759	0.1090	N	0.14661	0.345	0.29734	N	0.83767	B	0.22414	0.069	B	0.21917	0.037	T	0.30592	-0.9973	10	0.22706	T	0.39	-6.3422	8.0343	0.30482	0.0:0.3929:0.0:0.6071	.	171	Q8TBE3	FNDC9_HUMAN	S	171	ENSP00000310594:R171S;ENSP00000429434:R171S	ENSP00000310594:R171S	R	-	3	2	FNDC9	156702610	0.890000	0.30428	0.683000	0.30040	0.908000	0.53690	-0.159000	0.10056	-0.070000	0.12908	0.491000	0.48974	AGG	.	.		0.612	FNDC9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252573.2	NM_001001343	
GABRA6	2559	hgsc.bcm.edu	37	5	161116767	161116767	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr5:161116767A>T	ENST00000274545.5	+	6	1088	c.655A>T	c.(655-657)Aca>Tca	p.T219S	RP11-348M17.2_ENST00000521984.1_RNA|GABRA6_ENST00000523217.1_Missense_Mutation_p.T209S			Q16445	GBRA6_HUMAN	gamma-aminobutyric acid (GABA) A receptor, alpha 6	219					gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	benzodiazepine receptor activity (GO:0008503)|chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			breast(1)|central_nervous_system(2)|endometrium(6)|large_intestine(9)|liver(2)|lung(22)|ovary(7)|skin(6)|urinary_tract(2)	57	Renal(175;0.00259)	Medulloblastoma(196;0.0208)|all_neural(177;0.0672)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)		Acamprosate(DB00659)|Alprazolam(DB00404)|Amobarbital(DB01351)|Amoxapine(DB00543)|Aprobarbital(DB01352)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Chlordiazepoxide(DB00475)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Flumazenil(DB01205)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methylphenobarbital(DB00849)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Secobarbital(DB00418)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Thiopental(DB00599)|Topiramate(DB00273)|Triazolam(DB00897)	ATCTAGTGAGACAATTAAATC	0.363										TCGA Ovarian(5;0.080)																											p.T219S		Atlas-SNP	.											.	GABRA6	139	.	0			c.A655T						.						70.0	78.0	75.0					5																	161116767		2203	4299	6502	SO:0001583	missense	2559	exon6			AGTGAGACAATTA		CCDS4356.1	5q34	2012-06-22			ENSG00000145863	ENSG00000145863		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4080	protein-coding gene	gene with protein product	"""GABA(A) receptor, alpha 6"""	137143				8020978	Standard	NM_000811		Approved		uc003lyu.2	Q16445	OTTHUMG00000130351	ENST00000274545.5:c.655A>T	chr5.hg19:g.161116767A>T	ENSP00000274545:p.Thr219Ser	188.0	0.0		177.0	36.0	NM_000811	A8K096|Q4VAV2	Missense_Mutation	SNP	ENST00000274545.5	hg19	CCDS4356.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	17.98|17.98	3.520195|3.520195	0.64747|0.64747	.|.	.|.	ENSG00000145863|ENSG00000145863	ENST00000520000|ENST00000274545;ENST00000523217;ENST00000517823;ENST00000523691	.|T;T;T;T	.|0.79141	.|-1.24;-1.24;-1.24;-1.24	5.41|5.41	5.41|5.41	0.78517|0.78517	.|Neurotransmitter-gated ion-channel ligand-binding (3);	.|0.244270	.|0.44688	.|D	.|0.000437	D|D	0.82291|0.82291	0.5005|0.5005	L|L	0.48260|0.48260	1.515|1.515	0.41055|0.41055	D|D	0.985335|0.985335	.|P	.|0.43412	.|0.806	.|P	.|0.55667	.|0.781	D|D	0.83661|0.83661	0.0161|0.0161	5|10	.|0.56958	.|D	.|0.05	.|.	15.4372|15.4372	0.75155|0.75155	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|219	.|Q16445	.|GBRA6_HUMAN	S|S	158|219;209;166;139	.|ENSP00000274545:T219S;ENSP00000430527:T209S;ENSP00000430212:T166S;ENSP00000427989:T139S	.|ENSP00000274545:T219S	R|T	+|+	3|1	2|0	GABRA6|GABRA6	161049345|161049345	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.990000|0.990000	0.78478|0.78478	5.069000|5.069000	0.64370|0.64370	2.043000|2.043000	0.60533|0.60533	0.533000|0.533000	0.62120|0.62120	AGA|ACA	.	.		0.363	GABRA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252707.2		
DOCK2	1794	hgsc.bcm.edu	37	5	169494671	169494671	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr5:169494671G>T	ENST00000256935.8	+	45	4705	c.4625G>T	c.(4624-4626)gGc>gTc	p.G1542V	DOCK2_ENST00000540750.1_Missense_Mutation_p.G603V|DOCK2_ENST00000523351.1_3'UTR|DOCK2_ENST00000520908.1_Missense_Mutation_p.G1034V	NM_004946.2	NP_004937.1	Q92608	DOCK2_HUMAN	dedicator of cytokinesis 2	1542	DHR-2.				actin cytoskeleton organization (GO:0030036)|alpha-beta T cell proliferation (GO:0046633)|chemotaxis (GO:0006935)|establishment of T cell polarity (GO:0001768)|immunological synapse formation (GO:0001771)|macropinocytosis (GO:0044351)|membrane raft polarization (GO:0001766)|myeloid dendritic cell activation involved in immune response (GO:0002277)|negative thymic T cell selection (GO:0045060)|positive regulation of phagocytosis (GO:0050766)|positive thymic T cell selection (GO:0045059)|regulation of defense response to virus by virus (GO:0050690)|small GTPase mediated signal transduction (GO:0007264)|viral process (GO:0016032)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|T cell receptor binding (GO:0042608)			NS(2)|breast(5)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(42)|liver(2)|lung(63)|ovary(5)|pancreas(3)|prostate(7)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)	160	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			GTCATGGGAGGCTTCGCCAAG	0.552																																					p.G1542V		Atlas-SNP	.											.	DOCK2	389	.	0			c.G4625T						.						144.0	137.0	139.0					5																	169494671		2203	4300	6503	SO:0001583	missense	1794	exon45			TGGGAGGCTTCGC	BC016996	CCDS4371.1	5q35.1	2008-02-05			ENSG00000134516	ENSG00000134516			2988	protein-coding gene	gene with protein product		603122	"""dedicator of cyto-kinesis 2"""				Standard	NM_004946		Approved	KIAA0209	uc003maf.3	Q92608	OTTHUMG00000130437	ENST00000256935.8:c.4625G>T	chr5.hg19:g.169494671G>T	ENSP00000256935:p.Gly1542Val	93.0	0.0		91.0	23.0	NM_004946	Q2M3I0|Q96AK7	Missense_Mutation	SNP	ENST00000256935.8	hg19	CCDS4371.1	.	.	.	.	.	.	.	.	.	.	G	17.95	3.513180	0.64522	.	.	ENSG00000134516	ENST00000256935;ENST00000520908;ENST00000540750	T;T;T	0.72835	-0.69;-0.69;-0.69	4.83	3.95	0.45737	Cytochrome c domain (1);	0.000000	0.85682	D	0.000000	D	0.87700	0.6243	H	0.94698	3.57	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.90715	0.4630	10	0.87932	D	0	.	13.7225	0.62737	0.0762:0.0:0.9238:0.0	.	1034;98;1542	E7ERW7;B3KY14;Q92608	.;.;DOCK2_HUMAN	V	1542;1034;603	ENSP00000256935:G1542V;ENSP00000429283:G1034V;ENSP00000438827:G603V	ENSP00000256935:G1542V	G	+	2	0	DOCK2	169427249	1.000000	0.71417	0.998000	0.56505	0.543000	0.35085	9.809000	0.99208	1.147000	0.42369	0.563000	0.77884	GGC	.	.		0.552	DOCK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252828.2	NM_004946	
CDHR2	54825	hgsc.bcm.edu	37	5	175995968	175995968	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr5:175995968A>G	ENST00000510636.1	+	5	546	c.272A>G	c.(271-273)tAc>tGc	p.Y91C	CDHR2_ENST00000506348.1_Missense_Mutation_p.Y91C|CDHR2_ENST00000261944.5_Missense_Mutation_p.Y91C	NM_001171976.1	NP_001165447.1	Q9BYE9	CDHR2_HUMAN	cadherin-related family member 2	91	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|negative regulation of cell growth (GO:0030308)	cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(4)|large_intestine(8)|liver(1)|lung(23)|ovary(3)|prostate(5)|skin(4)|urinary_tract(1)	56						CAGACACTCTACACATTCAAA	0.637																																					p.Y91C		Atlas-SNP	.											.	CDHR2	152	.	0			c.A272G						.						69.0	64.0	66.0					5																	175995968		2203	4300	6503	SO:0001583	missense	54825	exon5			CACTCTACACATT	AB047004	CCDS34297.1	5q35.2	2011-07-01	2010-01-25	2010-01-25		ENSG00000074276		"""Cadherins / Cadherin-related"""	18231	protein-coding gene	gene with protein product	"""protocadherin LKC"""		"""protocadherin 24"""	PCDH24		11082270, 12117771	Standard	NM_001171976		Approved	PC-LKC, FLJ20124, FLJ20383, PCLKC	uc003mem.2	Q9BYE9		ENST00000510636.1:c.272A>G	chr5.hg19:g.175995968A>G	ENSP00000424565:p.Tyr91Cys	64.0	0.0		68.0	20.0	NM_017675	A1L3U4|A6NC80|Q9NXP8	Missense_Mutation	SNP	ENST00000510636.1	hg19	CCDS34297.1	.	.	.	.	.	.	.	.	.	.	A	12.13	1.845260	0.32606	.	.	ENSG00000074276	ENST00000510636;ENST00000261944;ENST00000506348	T;T;T	0.60797	0.16;0.16;0.16	3.97	-7.93	0.01156	Cadherin (3);Cadherin-like (1);	.	.	.	.	T	0.40743	0.1129	L	0.43152	1.355	0.09310	N	1	P	0.48640	0.913	B	0.43103	0.408	T	0.37934	-0.9684	9	0.52906	T	0.07	-0.405	2.9253	0.05783	0.1617:0.441:0.0867:0.3106	.	91	Q9BYE9	CDHR2_HUMAN	C	91	ENSP00000424565:Y91C;ENSP00000261944:Y91C;ENSP00000421078:Y91C	ENSP00000261944:Y91C	Y	+	2	0	CDHR2	175928574	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-1.488000	0.02308	-1.484000	0.01856	0.454000	0.30748	TAC	.	.		0.637	CDHR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372201.1	NM_017675	
MDC1	9656	hgsc.bcm.edu	37	6	30672768	30672768	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr6:30672768T>C	ENST00000376406.3	-	10	4839	c.4192A>G	c.(4192-4194)Aga>Gga	p.R1398G	MDC1-AS1_ENST00000442150.1_RNA|MDC1_ENST00000376405.2_Missense_Mutation_p.R1134G	NM_014641.2	NP_055456.2	Q14676	MDC1_HUMAN	mediator of DNA-damage checkpoint 1	1398	Interaction with the PRKDC complex.|Pro-rich.				DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|intra-S DNA damage checkpoint (GO:0031573)	chromosome (GO:0005694)|focal adhesion (GO:0005925)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	FHA domain binding (GO:0070975)|protein C-terminus binding (GO:0008022)			breast(2)|kidney(1)|ovary(1)	4						CCAGAGGATCTATTTTTTCTT	0.562								Other conserved DNA damage response genes																													p.R1398G		Atlas-SNP	.											.	MDC1	218	.	0			c.A4192G						.						92.0	100.0	97.0					6																	30672768		2203	4300	6503	SO:0001583	missense	9656	exon10			AGGATCTATTTTT	D79992	CCDS34384.1	6p21.3	2010-02-17	2009-06-12		ENSG00000137337	ENSG00000137337			21163	protein-coding gene	gene with protein product		607593				10975465, 12607005	Standard	NM_014641		Approved	NFBD1, KIAA0170, Em:AB023051.5	uc003nrg.4	Q14676	OTTHUMG00000031075	ENST00000376406.3:c.4192A>G	chr6.hg19:g.30672768T>C	ENSP00000365588:p.Arg1398Gly	120.0	0.0		106.0	5.0	NM_014641	A2AB04|A2BF04|A2RRA8|A7YY86|B0S8A2|Q0EFC2|Q2L6H7|Q2TAZ4|Q5JP55|Q5JP56|Q5ST83|Q68CQ3|Q86Z06|Q96QC2	Missense_Mutation	SNP	ENST00000376406.3	hg19	CCDS34384.1	.	.	.	.	.	.	.	.	.	.	T	13.15	2.151365	0.38021	.	.	ENSG00000137337	ENST00000376406;ENST00000376405;ENST00000422104	T;T	0.15603	2.41;2.41	2.8	2.8	0.32819	.	.	.	.	.	T	0.19087	0.0458	M	0.62723	1.935	0.09310	N	1	D;D	0.65815	0.995;0.982	D;P	0.64321	0.924;0.624	T	0.03534	-1.1027	9	0.59425	D	0.04	-3.3366	7.361	0.26745	0.0:0.0:0.0:1.0	.	1134;1398	Q14676-2;Q14676	.;MDC1_HUMAN	G	1398;1134;964	ENSP00000365588:R1398G;ENSP00000365587:R1134G	ENSP00000365587:R1134G	R	-	1	2	MDC1	30780747	0.243000	0.23878	0.026000	0.17262	0.023000	0.10783	3.434000	0.52841	1.300000	0.44818	0.248000	0.18094	AGA	.	.		0.562	MDC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000076103.1	NM_014641	
NCR3	259197	hgsc.bcm.edu	37	6	31557387	31557387	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr6:31557387T>C	ENST00000340027.5	-	3	675	c.412A>G	c.(412-414)Aca>Gca	p.T138A	NCR3_ENST00000376071.4_Missense_Mutation_p.T113A|NCR3_ENST00000376072.3_Missense_Mutation_p.T138A|NCR3_ENST00000491161.1_5'UTR|NCR3_ENST00000376073.4_Missense_Mutation_p.T138A	NM_147130.2	NP_667341.1	O14931	NCTR3_HUMAN	natural cytotoxicity triggering receptor 3	138					cell recognition (GO:0008037)|immune response (GO:0006955)|inflammatory response (GO:0006954)|positive regulation of natural killer cell mediated cytotoxicity (GO:0045954)	integral component of plasma membrane (GO:0005887)		p.T138A(1)		cervix(1)|large_intestine(2)|liver(1)|lung(2)|ovary(1)|skin(2)	9						AGGAGGACTGTACCAGCCCCT	0.582																																					p.T138A		Atlas-SNP	.											NCR3,NS,carcinoma,0,1	NCR3	21	.	1	Substitution - Missense(1)	cervix(1)	c.A412G						.						57.0	55.0	56.0					6																	31557387		1510	2709	4219	SO:0001583	missense	259197	exon3			GGACTGTACCAGC	AB055881	CCDS34397.1, CCDS47401.1, CCDS47402.1	6p21.3	2013-01-11	2002-11-13	2002-11-15	ENSG00000204475	ENSG00000204475		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"""	19077	protein-coding gene	gene with protein product		611550	"""lymphocyte antigen 117"""	LY117		8824804, 11782277	Standard	NM_001145466		Approved	1C7, NKp30, CD337	uc003nuv.2	O14931	OTTHUMG00000031123	ENST00000340027.5:c.412A>G	chr6.hg19:g.31557387T>C	ENSP00000342156:p.Thr138Ala	60.0	0.0		92.0	41.0	NM_001145466	B0S8F2|B0S8F4|B0S8F5|O14930|O14932|O95667|O95668|O95669|Q5ST89|Q5ST90|Q5ST91|Q5ST92|Q5STA3	Missense_Mutation	SNP	ENST00000340027.5	hg19	CCDS34397.1	.	.	.	.	.	.	.	.	.	.	T	8.756	0.922368	0.17982	.	.	ENSG00000204475	ENST00000340027;ENST00000376073;ENST00000376072;ENST00000376071	T;T;T;T	0.41400	1.56;1.0;1.02;1.9	4.12	-1.46	0.08800	.	0.671525	0.12081	N	0.501286	T	0.10337	0.0253	L	0.34521	1.04	0.09310	N	1	B;B;B	0.20052	0.041;0.002;0.024	B;B;B	0.20184	0.028;0.004;0.012	T	0.29305	-1.0016	10	0.35671	T	0.21	-0.0271	3.9419	0.09331	0.0:0.2159:0.3773:0.4068	.	138;138;138	O14931-2;Q05D23;O14931	.;.;NCTR3_HUMAN	A	138;138;138;113	ENSP00000342156:T138A;ENSP00000365241:T138A;ENSP00000365240:T138A;ENSP00000365239:T113A	ENSP00000342156:T138A	T	-	1	0	NCR3	31665366	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-1.031000	0.03578	-0.028000	0.13850	-0.313000	0.08912	ACA	.	.		0.582	NCR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000076210.2		
DOPEY1	23033	hgsc.bcm.edu	37	6	83846990	83846990	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr6:83846990G>T	ENST00000349129.2	+	21	3489	c.3229G>T	c.(3229-3231)Gac>Tac	p.D1077Y	DOPEY1_ENST00000369739.3_Missense_Mutation_p.D1068Y|DOPEY1_ENST00000237163.5_Missense_Mutation_p.D1058Y	NM_015018.3	NP_055833.2	Q5JWR5	DOP1_HUMAN	dopey family member 1	1077					protein transport (GO:0015031)					breast(4)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(16)|ovary(5)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)	67		all_cancers(76;2.29e-06)|Acute lymphoblastic leukemia(125;3.41e-06)|all_hematologic(105;0.000865)|all_epithelial(107;0.00203)		BRCA - Breast invasive adenocarcinoma(397;0.053)		TCCATTAAGTGACAGACTTTC	0.398																																					p.D1077Y		Atlas-SNP	.											.	DOPEY1	190	.	0			c.G3229T						.						102.0	97.0	99.0					6																	83846990		2203	4299	6502	SO:0001583	missense	23033	exon21			TTAAGTGACAGAC	AK027030	CCDS4996.1, CCDS64467.1	6q15	2013-03-05	2006-02-02	2006-02-02	ENSG00000083097	ENSG00000083097			21194	protein-coding gene	gene with protein product			"""KIAA1117"""	KIAA1117		16301316, 16303751, 10931277	Standard	NM_015018		Approved	dJ202D23.2	uc011dyy.2	Q5JWR5	OTTHUMG00000016365	ENST00000349129.2:c.3229G>T	chr6.hg19:g.83846990G>T	ENSP00000195654:p.Asp1077Tyr	260.0	0.0		266.0	59.0	NM_015018	Q86XV1|Q9H5J5|Q9NSL4|Q9UPN5|Q9Y414	Missense_Mutation	SNP	ENST00000349129.2	hg19	CCDS4996.1	.	.	.	.	.	.	.	.	.	.	G	15.70	2.910507	0.52439	.	.	ENSG00000083097	ENST00000349129;ENST00000237163;ENST00000369739	T;T	0.27256	1.68;1.69	5.48	5.48	0.80851	.	0.092779	0.64402	D	0.000001	T	0.43010	0.1228	L	0.60455	1.87	0.80722	D	1	D;D;D	0.89917	0.997;0.993;1.0	D;P;D	0.85130	0.942;0.888;0.997	T	0.34551	-0.9824	10	0.72032	D	0.01	.	19.3515	0.94389	0.0:0.0:1.0:0.0	.	968;1068;1077	E1P545;B2RWN9;Q5JWR5	.;.;DOP1_HUMAN	Y	1077;1058;1058	ENSP00000195654:D1077Y;ENSP00000237163:D1058Y	ENSP00000237163:D1058Y	D	+	1	0	DOPEY1	83903709	1.000000	0.71417	1.000000	0.80357	0.893000	0.52053	9.471000	0.97696	2.567000	0.86603	0.460000	0.39030	GAC	.	.		0.398	DOPEY1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043785.2	NM_015018	
BEND3	57673	hgsc.bcm.edu	37	6	107390740	107390740	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr6:107390740T>C	ENST00000369042.1	-	4	1845	c.1655A>G	c.(1654-1656)gAc>gGc	p.D552G	BEND3_ENST00000429433.2_Missense_Mutation_p.D552G			Q5T5X7	BEND3_HUMAN	BEN domain containing 3	552	BEN 3. {ECO:0000255|PROSITE- ProRule:PRU00784}.									central_nervous_system(1)|cervix(2)|endometrium(3)|large_intestine(7)|lung(10)|ovary(4)|prostate(3)	30						GAGCAGGCAGTCGGCACCGGG	0.647																																					p.D552G		Atlas-SNP	.											.	BEND3	70	.	0			c.A1655G						.						35.0	34.0	35.0					6																	107390740		2202	4300	6502	SO:0001583	missense	57673	exon5			AGGCAGTCGGCAC	AB046773	CCDS34507.1	6q21	2012-11-22	2008-10-03	2008-10-03	ENSG00000178409	ENSG00000178409		"""BEN domain containing"""	23040	protein-coding gene	gene with protein product			"""KIAA1553"""	KIAA1553			Standard	NM_001080450		Approved		uc003prs.2	Q5T5X7	OTTHUMG00000015308	ENST00000369042.1:c.1655A>G	chr6.hg19:g.107390740T>C	ENSP00000358038:p.Asp552Gly	49.0	0.0		35.0	10.0	NM_001080450	A2RRH2|Q9HCL9	Missense_Mutation	SNP	ENST00000369042.1	hg19	CCDS34507.1	.	.	.	.	.	.	.	.	.	.	T	14.19	2.462512	0.43736	.	.	ENSG00000178409	ENST00000369042;ENST00000429433	.	.	.	5.06	5.06	0.68205	BEN domain (1);	0.189333	0.47852	D	0.000203	T	0.31918	0.0812	N	0.22421	0.69	0.54753	D	0.999986	B	0.20780	0.048	B	0.23018	0.043	T	0.33085	-0.9882	9	0.66056	D	0.02	-4.0128	14.9624	0.71166	0.0:0.0:0.0:1.0	.	552	Q5T5X7	BEND3_HUMAN	G	552	.	ENSP00000358038:D552G	D	-	2	0	BEND3	107497433	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	7.477000	0.81069	2.121000	0.65114	0.459000	0.35465	GAC	.	.		0.647	BEND3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041686.1	NM_020913	
ELFN1	392617	hgsc.bcm.edu	37	7	1784532	1784532	+	Missense_Mutation	SNP	G	G	C			TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr7:1784532G>C	ENST00000424383.2	+	3	787	c.300G>C	c.(298-300)gaG>gaC	p.E100D	AC074389.9_ENST00000453348.1_lincRNA|ELFN1_ENST00000561626.1_Missense_Mutation_p.E100D|ELFN1_ENST00000541472.1_Missense_Mutation_p.E100D			P0C7U0	ELFN1_HUMAN	extracellular leucine-rich repeat and fibronectin type III domain containing 1	100					negative regulation of phosphatase activity (GO:0010923)|synapse organization (GO:0050808)	dendrite (GO:0030425)|excitatory synapse (GO:0060076)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	phosphatase binding (GO:0019902)|protein phosphatase inhibitor activity (GO:0004864)			endometrium(1)	1						GCTACATCGAGGACGGCGCCT	0.632																																					p.E100D		Atlas-SNP	.											.	ELFN1	22	.	0			c.G300C						.						117.0	105.0	109.0					7																	1784532		692	1591	2283	SO:0001583	missense	392617	exon2			CATCGAGGACGGC		CCDS59046.1	7p22.3	2013-02-11	2011-10-27	2011-10-27	ENSG00000225968	ENSG00000225968		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Fibronectin type III domain containing"""	33154	protein-coding gene	gene with protein product		614964	"""extracellular leucine-rich repeat and fibronectin type III containing 1"", ""extracellular leucine-rich repeat and fibronectin type III domain containing 1"", ""protein phosphatase 1, regulatory subunit 28"""	PPP1R28		17868438	Standard	NM_001128636		Approved		uc010ksg.2	P0C7U0	OTTHUMG00000151495	ENST00000424383.2:c.300G>C	chr7.hg19:g.1784532G>C	ENSP00000456548:p.Glu100Asp	93.0	0.0		89.0	20.0	NM_001128636	H3BS57	Missense_Mutation	SNP	ENST00000424383.2	hg19	CCDS59046.1																																																																																			.	.		0.632	ELFN1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322893.2	NM_001128636	
SDK1	221935	hgsc.bcm.edu	37	7	4056922	4056922	+	Missense_Mutation	SNP	C	C	G			TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr7:4056922C>G	ENST00000404826.2	+	17	2679	c.2540C>G	c.(2539-2541)gCg>gGg	p.A847G	SDK1_ENST00000389531.3_Missense_Mutation_p.A847G	NM_152744.3	NP_689957.3	Q7Z5N4	SDK1_HUMAN	sidekick cell adhesion molecule 1	847	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				NS(1)|breast(6)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(42)|lung(55)|ovary(4)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(4)	153		all_cancers(1;0.127)|Ovarian(82;0.0177)|Myeloproliferative disorder(862;0.194)		UCEC - Uterine corpus endometrioid carcinoma (126;0.121)|OV - Ovarian serous cystadenocarcinoma(56;9.65e-15)		CAGGTGGCGGCGTACAACGGG	0.592																																					p.A847G		Atlas-SNP	.											.	SDK1	361	.	0			c.C2540G						.						79.0	69.0	73.0					7																	4056922		2203	4300	6503	SO:0001583	missense	221935	exon17			TGGCGGCGTACAA	AK074077	CCDS34590.1	7p22.3	2013-02-11	2011-12-09		ENSG00000146555	ENSG00000146555		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	19307	protein-coding gene	gene with protein product		607216	"""sidekick homolog 1 (chicken)"", ""sidekick homolog 1, cell adhesion molecule (chicken)"""			12230981, 17307840, 15213259	Standard	NM_001079653		Approved	FLJ31425	uc003smx.3	Q7Z5N4	OTTHUMG00000151733	ENST00000404826.2:c.2540C>G	chr7.hg19:g.4056922C>G	ENSP00000385899:p.Ala847Gly	139.0	0.0		170.0	30.0	NM_152744	Q8TEN9|Q8TEP5|Q96N44	Missense_Mutation	SNP	ENST00000404826.2	hg19	CCDS34590.1	.	.	.	.	.	.	.	.	.	.	C	24.6	4.551867	0.86127	.	.	ENSG00000146555	ENST00000404826;ENST00000389531	T;T	0.76060	-0.99;-0.99	6.07	6.07	0.98685	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.075397	0.51477	D	0.000087	D	0.88815	0.6539	M	0.88842	2.985	0.58432	D	0.999999	D;D	0.63880	0.986;0.993	D;P	0.65987	0.94;0.862	D	0.89511	0.3771	10	0.87932	D	0	.	20.6439	0.99570	0.0:1.0:0.0:0.0	.	847;847	F8W6X9;Q7Z5N4	.;SDK1_HUMAN	G	847	ENSP00000385899:A847G;ENSP00000374182:A847G	ENSP00000374182:A847G	A	+	2	0	SDK1	4023448	1.000000	0.71417	0.268000	0.24571	0.517000	0.34286	7.726000	0.84824	2.884000	0.98904	0.655000	0.94253	GCG	.	.		0.592	SDK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323702.1	NM_152744	
HDAC9	9734	hgsc.bcm.edu	37	7	18801900	18801900	+	Splice_Site	SNP	G	G	T			TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr7:18801900G>T	ENST00000432645.2	+	14	2155	c.2155G>T	c.(2155-2157)Ggt>Tgt	p.G719C	HDAC9_ENST00000406451.4_Splice_Site_p.G719C|HDAC9_ENST00000401921.1_Splice_Site_p.G678C|HDAC9_ENST00000441542.2_Splice_Site_p.G722C	NM_058176.2	NP_478056.1	Q9UKV0	HDAC9_HUMAN	histone deacetylase 9	719	Histone deacetylase.				B cell activation (GO:0042113)|B cell differentiation (GO:0030183)|cellular response to insulin stimulus (GO:0032869)|heart development (GO:0007507)|histone deacetylation (GO:0016575)|histone H3 deacetylation (GO:0070932)|histone H4 deacetylation (GO:0070933)|inflammatory response (GO:0006954)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|peptidyl-lysine deacetylation (GO:0034983)|positive regulation of cell migration involved in sprouting angiogenesis (GO:0090050)|regulation of skeletal muscle fiber development (GO:0048742)|regulation of striated muscle cell differentiation (GO:0051153)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|histone deacetylase complex (GO:0000118)|histone methyltransferase complex (GO:0035097)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	histone deacetylase activity (GO:0004407)|histone deacetylase binding (GO:0042826)|metal ion binding (GO:0046872)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|NAD-dependent histone deacetylase activity (H3-K18 specific) (GO:0097372)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|NAD-dependent histone deacetylase activity (H4-K16 specific) (GO:0046970)|protein deacetylase activity (GO:0033558)|protein kinase C binding (GO:0005080)|repressing transcription factor binding (GO:0070491)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)			breast(3)|central_nervous_system(4)|cervix(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(18)|liver(2)|lung(37)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	82	all_lung(11;0.187)				Valproic Acid(DB00313)	GATACTCCTAGGTCTGTACGG	0.498																																					p.G722C		Atlas-SNP	.											.	HDAC9	560	.	0			c.G2164T						.						49.0	49.0	49.0					7																	18801900		1969	4148	6117	SO:0001630	splice_region_variant	9734	exon14			CTCCTAGGTCTGT	AF124924	CCDS47553.1, CCDS47554.1, CCDS47555.1, CCDS47557.1, CCDS56465.1, CCDS56466.1, CCDS56467.1, CCDS56468.1, CCDS75565.1	7p21.1	2008-05-15			ENSG00000048052	ENSG00000048052			14065	protein-coding gene	gene with protein product		606543				10523670, 10487760	Standard	NM_178425		Approved	KIAA0744, HDAC, MITR, HD7, HDAC7B	uc003sui.3	Q9UKV0	OTTHUMG00000152487	ENST00000432645.2:c.2155+1G>T	chr7.hg19:g.18801900G>T		169.0	0.0		155.0	28.0	NM_178425	A7E2F3|B7Z4I4|B7Z917|B7Z928|B7Z940|C9JS87|E7EX34|F8W9E0|O94845|O95028|Q2M2R6|Q86SL1|Q86US3	Missense_Mutation	SNP	ENST00000432645.2	hg19	CCDS47555.1	.	.	.	.	.	.	.	.	.	.	G	24.0	4.486952	0.84854	.	.	ENSG00000048052	ENST00000406451;ENST00000401921;ENST00000432645;ENST00000441542;ENST00000341009	T;T;T;T	0.70164	-0.46;-0.46;-0.46;-0.46	5.56	5.56	0.83823	Histone deacetylase domain (2);	0.000000	0.64402	D	0.000005	D	0.85919	0.5809	M	0.90082	3.085	0.80722	D	1	P;D;D;D;D;D	0.89917	0.943;1.0;1.0;1.0;1.0;1.0	B;D;D;D;D;D	0.81914	0.15;0.992;0.992;0.995;0.992;0.933	D	0.88023	0.2770	10	0.87932	D	0	-23.0363	19.9052	0.97004	0.0:0.0:1.0:0.0	.	719;678;722;719;719;697	Q9UKV0-4;Q9UKV0-6;Q9UKV0-7;Q9UKV0;Q9UKV0-5;Q8N879	.;.;.;HDAC9_HUMAN;.;.	C	719;678;719;722;631	ENSP00000384657:G719C;ENSP00000383912:G678C;ENSP00000410337:G719C;ENSP00000408617:G722C	ENSP00000339165:G631C	G	+	1	0	HDAC9	18768425	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	8.151000	0.89636	2.776000	0.95493	0.655000	0.94253	GGT	.	.		0.498	HDAC9-023	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000376176.1		Missense_Mutation
ITGB8	3696	hgsc.bcm.edu	37	7	20406804	20406804	+	Missense_Mutation	SNP	G	G	T	rs139414321		TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr7:20406804G>T	ENST00000222573.4	+	3	1067	c.383G>T	c.(382-384)cGt>cTt	p.R128L	ITGB8_ENST00000537992.1_5'UTR	NM_002214.2	NP_002205.1	P26012	ITB8_HUMAN	integrin, beta 8	128					cartilage development (GO:0051216)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|ganglioside metabolic process (GO:0001573)|integrin-mediated signaling pathway (GO:0007229)|negative regulation of gene expression (GO:0010629)|placenta blood vessel development (GO:0060674)|positive regulation of gene expression (GO:0010628)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integrin alphav-beta8 complex (GO:0034686)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)	extracellular matrix protein binding (GO:1990430)|receptor activity (GO:0004872)			NS(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(17)|prostate(2)|skin(4)|stomach(2)|urinary_tract(1)	37						ATCCAGCTGCGTCCAGGTTTG	0.338																																					p.R128L		Atlas-SNP	.											.	ITGB8	159	.	0			c.G383T						.						85.0	86.0	85.0					7																	20406804		2203	4300	6503	SO:0001583	missense	3696	exon3			AGCTGCGTCCAGG		CCDS5370.1	7p15.3	2010-03-23			ENSG00000105855	ENSG00000105855		"""Integrins"""	6163	protein-coding gene	gene with protein product		604160					Standard	XM_005249751		Approved		uc003suu.3	P26012	OTTHUMG00000023594	ENST00000222573.4:c.383G>T	chr7.hg19:g.20406804G>T	ENSP00000222573:p.Arg128Leu	55.0	0.0		78.0	28.0	NM_002214	A4D133|B4DHD4	Missense_Mutation	SNP	ENST00000222573.4	hg19	CCDS5370.1	.	.	.	.	.	.	.	.	.	.	G	15.59	2.878497	0.51801	.	.	ENSG00000105855	ENST00000222573	D	0.95069	-3.6	5.71	1.89	0.25635	Integrin beta subunit, N-terminal (2);	0.357573	0.27715	N	0.018157	D	0.92935	0.7752	M	0.83953	2.67	0.80722	D	1	P;B	0.37781	0.608;0.213	B;B	0.34652	0.187;0.154	D	0.89432	0.3717	10	0.87932	D	0	-9.7637	9.5068	0.39051	0.3515:0.0:0.6485:0.0	.	128;128	P26012;Q9BUG9	ITB8_HUMAN;.	L	128	ENSP00000222573:R128L	ENSP00000222573:R128L	R	+	2	0	ITGB8	20373329	0.999000	0.42202	0.987000	0.45799	0.992000	0.81027	1.353000	0.34045	0.068000	0.16574	0.655000	0.94253	CGT	.	G|1.000;A|0.000		0.338	ITGB8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059915.3	NM_002214	
HIBADH	11112	hgsc.bcm.edu	37	7	27570940	27570940	+	Silent	SNP	A	A	G			TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr7:27570940A>G	ENST00000265395.2	-	7	929	c.723T>C	c.(721-723)gcT>gcC	p.A241A		NM_152740.3	NP_689953.1	P31937	3HIDH_HUMAN	3-hydroxyisobutyrate dehydrogenase	241					branched-chain amino acid catabolic process (GO:0009083)|cellular nitrogen compound metabolic process (GO:0034641)|pentose-phosphate shunt (GO:0006098)|small molecule metabolic process (GO:0044281)|valine catabolic process (GO:0006574)	mitochondrial matrix (GO:0005759)	3-hydroxyisobutyrate dehydrogenase activity (GO:0008442)|NAD binding (GO:0051287)|phosphogluconate dehydrogenase (decarboxylating) activity (GO:0004616)			endometrium(4)|kidney(2)|lung(3)|ovary(2)|prostate(1)	12			GBM - Glioblastoma multiforme(3;0.0368)			TTAGGATTTTAGCCAGTAGTT	0.433																																					p.A241A		Atlas-SNP	.											.	HIBADH	28	.	0			c.T723C						.						102.0	88.0	93.0					7																	27570940		2203	4300	6503	SO:0001819	synonymous_variant	11112	exon7			GATTTTAGCCAGT	AF529362	CCDS5414.1	7p15	2009-06-12			ENSG00000106049	ENSG00000106049	1.1.1.31		4907	protein-coding gene	gene with protein product		608475					Standard	NM_152740		Approved	NS5ATP1	uc003szf.3	P31937	OTTHUMG00000097035	ENST00000265395.2:c.723T>C	chr7.hg19:g.27570940A>G		117.0	0.0		132.0	27.0	NM_152740	Q546Z2|Q9UDN3	Silent	SNP	ENST00000265395.2	hg19	CCDS5414.1	.	.	.	.	.	.	.	.	.	.	A	4.729	0.135482	0.09032	.	.	ENSG00000106049	ENST00000425715	.	.	.	6.17	1.05	0.20165	.	.	.	.	.	T	0.40297	0.1111	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.23440	-1.0188	4	.	.	.	-13.8618	0.4451	0.00492	0.2993:0.2044:0.2975:0.1988	.	.	.	.	P	184	.	.	L	-	2	0	HIBADH	27537465	0.998000	0.40836	1.000000	0.80357	0.595000	0.36748	0.498000	0.22530	0.176000	0.19873	-1.303000	0.01326	CTA	.	.		0.433	HIBADH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214132.1	NM_152740	
HIP1	3092	hgsc.bcm.edu	37	7	75183415	75183415	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr7:75183415C>A	ENST00000336926.6	-	21	2181	c.2155G>T	c.(2155-2157)Gac>Tac	p.D719Y	HIP1_ENST00000434438.2_Missense_Mutation_p.D719Y	NM_005338.5	NP_005329.3	O00291	HIP1_HUMAN	huntingtin interacting protein 1	719					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cell differentiation (GO:0030154)|clathrin coat assembly (GO:0048268)|endocytosis (GO:0006897)|positive regulation of receptor-mediated endocytosis (GO:0048260)|regulation of apoptotic process (GO:0042981)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	clathrin-coated vesicle (GO:0030136)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)	clathrin binding (GO:0030276)|phosphatidylinositol binding (GO:0035091)|structural constituent of cytoskeleton (GO:0005200)			breast(3)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(25)|ovary(2)|pancreas(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51						TACTCACAGTCGGCAGGCTCA	0.612			T	PDGFRB	CMML																																p.D719Y		Atlas-SNP	.		Dom	yes		7	7q11.23	3092	huntingtin interacting protein 1		L	.	HIP1	91	.	0			c.G2155T						.						39.0	37.0	38.0					7																	75183415		2203	4300	6503	SO:0001583	missense	3092	exon21			CACAGTCGGCAGG	AF052288	CCDS34669.1, CCDS59060.1	7q11.23	2008-07-18			ENSG00000127946	ENSG00000127946			4913	protein-coding gene	gene with protein product		601767				9140394, 9147654	Standard	NM_005338		Approved	ILWEQ	uc003uds.2	O00291	OTTHUMG00000156050	ENST00000336926.6:c.2155G>T	chr7.hg19:g.75183415C>A	ENSP00000336747:p.Asp719Tyr	41.0	0.0		54.0	7.0	NM_005338	B4E3I7|E7ES17|O00328|Q2TB58|Q8TDL4	Missense_Mutation	SNP	ENST00000336926.6	hg19	CCDS34669.1	.	.	.	.	.	.	.	.	.	.	c	24.6	4.544608	0.86022	.	.	ENSG00000127946	ENST00000336926;ENST00000434438	T;T	0.25250	2.36;1.81	5.39	5.39	0.77823	.	0.144766	0.64402	D	0.000008	T	0.52948	0.1766	M	0.78456	2.415	0.80722	D	1	D;D	0.76494	0.999;0.979	D;P	0.68765	0.96;0.818	T	0.53627	-0.8412	10	0.59425	D	0.04	.	17.8977	0.88893	0.0:1.0:0.0:0.0	.	719;719	E7ES17;O00291	.;HIP1_HUMAN	Y	719	ENSP00000336747:D719Y;ENSP00000410300:D719Y	ENSP00000336747:D719Y	D	-	1	0	HIP1	75021351	1.000000	0.71417	0.989000	0.46669	0.850000	0.48378	6.603000	0.74145	2.810000	0.96702	0.650000	0.86243	GAC	.	.		0.612	HIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342863.2	NM_005338	
SEMA3D	223117	hgsc.bcm.edu	37	7	84636185	84636185	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr7:84636185A>G	ENST00000284136.6	-	16	1884	c.1841T>C	c.(1840-1842)aTa>aCa	p.I614T	SEMA3D_ENST00000484038.1_5'UTR	NM_152754.2	NP_689967.2	O95025	SEM3D_HUMAN	sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3D	614	Ig-like C2-type.				cell differentiation (GO:0030154)|nervous system development (GO:0007399)	extracellular region (GO:0005576)|membrane (GO:0016020)	receptor activity (GO:0004872)			NS(1)|breast(2)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(19)|lung(29)|ovary(3)|pancreas(1)|prostate(4)|skin(2)	73						GGATTTAGGTATACATTCCAG	0.383																																					p.I614T	Ovarian(63;442 1191 17318 29975 31528)	Atlas-SNP	.											.	SEMA3D	177	.	0			c.T1841C						.						190.0	175.0	180.0					7																	84636185		2203	4300	6503	SO:0001583	missense	223117	exon16			TTAGGTATACATT	BC029590	CCDS34676.1	7q21.11	2013-01-11			ENSG00000153993	ENSG00000153993		"""Semaphorins"", ""Immunoglobulin superfamily / V-set domain containing"""	10726	protein-coding gene	gene with protein product		609907					Standard	NM_152754		Approved	coll-2, Sema-Z2	uc003uic.3	O95025	OTTHUMG00000154569	ENST00000284136.6:c.1841T>C	chr7.hg19:g.84636185A>G	ENSP00000284136:p.Ile614Thr	110.0	0.0		110.0	21.0	NM_152754	A6NK46|Q6UW77|Q8NCQ1	Missense_Mutation	SNP	ENST00000284136.6	hg19	CCDS34676.1	.	.	.	.	.	.	.	.	.	.	A	8.047	0.765096	0.15914	.	.	ENSG00000153993	ENST00000284136	T	0.63096	-0.02	6.01	6.01	0.97437	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.173757	0.64402	D	0.000007	T	0.43277	0.1240	N	0.17312	0.475	0.80722	D	1	B	0.09022	0.002	B	0.12156	0.007	T	0.37454	-0.9705	10	0.09843	T	0.71	.	12.3054	0.54900	0.9328:0.0:0.0672:0.0	.	614	O95025	SEM3D_HUMAN	T	614	ENSP00000284136:I614T	ENSP00000284136:I614T	I	-	2	0	SEMA3D	84474121	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	4.112000	0.57845	2.307000	0.77673	0.528000	0.53228	ATA	.	.		0.383	SEMA3D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336084.2	NM_152754	
PDK4	5166	hgsc.bcm.edu	37	7	95217044	95217044	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr7:95217044T>A	ENST00000005178.5	-	8	1062	c.865A>T	c.(865-867)Att>Ttt	p.I289F		NM_002612.3	NP_002603.1	Q16654	PDK4_HUMAN	pyruvate dehydrogenase kinase, isozyme 4	289	Histidine kinase. {ECO:0000255|PROSITE- ProRule:PRU00107}.				cellular metabolic process (GO:0044237)|cellular response to fatty acid (GO:0071398)|cellular response to starvation (GO:0009267)|glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|insulin receptor signaling pathway (GO:0008286)|negative regulation of anoikis (GO:2000811)|protein phosphorylation (GO:0006468)|pyruvate metabolic process (GO:0006090)|reactive oxygen species metabolic process (GO:0072593)|regulation of acetyl-CoA biosynthetic process from pyruvate (GO:0010510)|regulation of bone resorption (GO:0045124)|regulation of cellular ketone metabolic process (GO:0010565)|regulation of fatty acid biosynthetic process (GO:0042304)|regulation of fatty acid oxidation (GO:0046320)|regulation of glucose metabolic process (GO:0010906)|regulation of pH (GO:0006885)|response to starvation (GO:0042594)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|pyruvate dehydrogenase (acetyl-transferring) kinase activity (GO:0004740)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|liver(1)|lung(4)|skin(1)|upper_aerodigestive_tract(1)	15	all_cancers(62;1.06e-10)|all_epithelial(64;1.04e-09)|Lung NSC(181;0.128)|all_lung(186;0.151)		STAD - Stomach adenocarcinoma(171;0.0151)			GTTACCTTAATGGTAAGGTCT	0.383																																					p.I289F		Atlas-SNP	.											.	PDK4	42	.	0			c.A865T						.						73.0	68.0	69.0					7																	95217044		2203	4300	6503	SO:0001583	missense	5166	exon8			CCTTAATGGTAAG	U54617	CCDS5643.1	7q21.3-q22.1	2008-07-18	2005-11-16		ENSG00000004799	ENSG00000004799			8812	protein-coding gene	gene with protein product		602527	"""pyruvate dehydrogenase kinase, isoenzyme 4"""			7499431	Standard	NM_002612		Approved		uc003uoa.3	Q16654	OTTHUMG00000153977	ENST00000005178.5:c.865A>T	chr7.hg19:g.95217044T>A	ENSP00000005178:p.Ile289Phe	110.0	0.0		111.0	26.0	NM_002612		Missense_Mutation	SNP	ENST00000005178.5	hg19	CCDS5643.1	.	.	.	.	.	.	.	.	.	.	T	15.01	2.705964	0.48412	.	.	ENSG00000004799	ENST00000005178;ENST00000542888	T	0.61040	0.14	5.47	5.47	0.80525	Signal transduction histidine kinase, core (1);ATPase-like, ATP-binding domain (4);	0.000000	0.85682	D	0.000000	T	0.76198	0.3954	M	0.82923	2.615	0.80722	D	1	D	0.76494	0.999	D	0.78314	0.991	T	0.79890	-0.1612	10	0.87932	D	0	.	11.8038	0.52143	0.0:0.0:0.1465:0.8535	.	289	Q16654	PDK4_HUMAN	F	289;253	ENSP00000005178:I289F	ENSP00000005178:I289F	I	-	1	0	PDK4	95054980	0.998000	0.40836	1.000000	0.80357	0.265000	0.26407	2.022000	0.41030	2.202000	0.70862	0.482000	0.46254	ATT	.	.		0.383	PDK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333298.1	NM_002612	
MUC17	140453	hgsc.bcm.edu	37	7	100683981	100683981	+	Missense_Mutation	SNP	T	T	G			TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr7:100683981T>G	ENST00000306151.4	+	3	9348	c.9284T>G	c.(9283-9285)aTg>aGg	p.M3095R		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	3095	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)			NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					GGTACCAGCATGCCAATCTCA	0.493																																					p.M3095R		Atlas-SNP	.											.	MUC17	804	.	0			c.T9284G						.						263.0	266.0	265.0					7																	100683981		2203	4300	6503	SO:0001583	missense	140453	exon3			CCAGCATGCCAAT	AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.9284T>G	chr7.hg19:g.100683981T>G	ENSP00000302716:p.Met3095Arg	59.0	0.0		75.0	24.0	NM_001040105	O14761|Q685J2|Q8TDH7	Missense_Mutation	SNP	ENST00000306151.4	hg19	CCDS34711.1	.	.	.	.	.	.	.	.	.	.	t	3.822	-0.037642	0.07497	.	.	ENSG00000169876	ENST00000306151	T	0.01887	4.58	0.863	-1.73	0.08081	.	.	.	.	.	T	0.02156	0.0067	N	0.19112	0.55	0.09310	N	1	P	0.39520	0.676	P	0.49047	0.599	T	0.40194	-0.9576	9	0.15952	T	0.53	.	2.7502	0.05279	0.0:0.3099:0.2554:0.4347	.	3095	Q685J3	MUC17_HUMAN	R	3095	ENSP00000302716:M3095R	ENSP00000302716:M3095R	M	+	2	0	MUC17	100470701	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-1.060000	0.03475	-0.977000	0.03537	0.102000	0.15555	ATG	.	.		0.493	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347161.1	NM_001040105	
DLD	1738	hgsc.bcm.edu	37	7	107556141	107556141	+	Splice_Site	SNP	C	C	T	rs201652869		TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr7:107556141C>T	ENST00000205402.5	+	9	1156	c.875C>T	c.(874-876)tCt>tTt	p.S292F	DLD_ENST00000440410.1_Splice_Site_p.S269F|DLD_ENST00000437604.2_Splice_Site_p.S244F|DLD_ENST00000537148.1_Splice_Site_p.S193F	NM_000108.3	NP_000099.2	P09622	DLDH_HUMAN	dihydrolipoamide dehydrogenase	292					branched-chain amino acid catabolic process (GO:0009083)|cell redox homeostasis (GO:0045454)|cellular metabolic process (GO:0044237)|cellular nitrogen compound metabolic process (GO:0034641)|gastrulation (GO:0007369)|lysine catabolic process (GO:0006554)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|proteolysis (GO:0006508)|pyruvate metabolic process (GO:0006090)|regulation of acetyl-CoA biosynthetic process from pyruvate (GO:0010510)|regulation of membrane potential (GO:0042391)|small molecule metabolic process (GO:0044281)|sperm capacitation (GO:0048240)|tricarboxylic acid cycle (GO:0006099)	acrosomal matrix (GO:0043159)|cilium (GO:0005929)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	dihydrolipoyl dehydrogenase activity (GO:0004148)|flavin adenine dinucleotide binding (GO:0050660)	p.S292F(1)		NS(1)|breast(1)|central_nervous_system(1)|kidney(5)|large_intestine(1)|lung(10)|prostate(1)	20					Flavin adenine dinucleotide(DB03147)	ATTGATGTTTCGTAAGTATAC	0.313																																					p.S292F		Atlas-SNP	.											DLD,rectum,carcinoma,0,1	DLD	72	.	1	Substitution - Missense(1)	large_intestine(1)	c.C875T						.	C	PHE/SER	0,4406		0,0,2203	48.0	49.0	49.0		875	3.5	1.0	7		49	1,8599	1.2+/-3.3	0,1,4299	yes	missense-near-splice	DLD	NM_000108.3	155	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	possibly-damaging	292/510	107556141	1,13005	2203	4300	6503	SO:0001630	splice_region_variant	1738	exon9			ATGTTTCGTAAGT	AB209703	CCDS5749.1	7q31-q32	2006-05-22	2006-05-22		ENSG00000091140	ENSG00000091140	1.8.1.4		2898	protein-coding gene	gene with protein product	"""E3 component of pyruvate dehydrogenase complex, 2-oxo-glutarate complex, branched chain keto acid dehydrogenase complex"""	238331	"""dihydrolipoamide dehydrogenase (E3 component of pyruvate dehydrogenase complex, 2-oxo-glutarate complex, branched chain keto acid dehydrogenase complex)"""	LAD, GCSL			Standard	NM_000108		Approved	DLDH	uc003vet.3	P09622	OTTHUMG00000154813	ENST00000205402.5:c.875+1C>T	chr7.hg19:g.107556141C>T		94.0	1.0		107.0	22.0	NM_000108	B2R5X0|B4DHG0|B4DT69|Q14131|Q14167|Q59EV8|Q8WTS4	Missense_Mutation	SNP	ENST00000205402.5	hg19	CCDS5749.1	.	.	.	.	.	.	.	.	.	.	C	19.89	3.910567	0.72983	0.0	1.16E-4	ENSG00000091140	ENST00000205402;ENST00000417551;ENST00000537148;ENST00000440410;ENST00000437604;ENST00000539590	T;T;T;T;T	0.66460	-0.21;-0.21;0.34;-0.21;0.34	5.3	3.51	0.40186	Pyridine nucleotide-disulphide oxidoreductase, NAD-binding domain (1);Pyridine nucleotide-disulphide oxidoreductase, FAD/NAD(P)-binding domain (1);	0.208574	0.49916	N	0.000138	T	0.76681	0.4021	M	0.82056	2.57	0.58432	D	0.999999	P;P;D	0.63880	0.879;0.513;0.993	P;B;P	0.55455	0.544;0.329;0.776	T	0.79240	-0.1885	10	0.72032	D	0.01	-1.8583	11.8398	0.52346	0.0:0.8586:0.0:0.1414	.	269;244;292	E9PEX6;B4DT69;P09622	.;.;DLDH_HUMAN	F	292;292;193;269;244;242	ENSP00000205402:S292F;ENSP00000390667:S292F;ENSP00000442399:S193F;ENSP00000417016:S269F;ENSP00000387542:S244F	ENSP00000205402:S292F	S	+	2	0	DLD	107343377	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	3.247000	0.51422	0.812000	0.34326	0.591000	0.81541	TCT	.	.		0.313	DLD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337194.3	NM_000108	Missense_Mutation
FAM3C	10447	hgsc.bcm.edu	37	7	121002990	121002990	+	Nonsense_Mutation	SNP	C	C	A			TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr7:121002990C>A	ENST00000359943.3	-	7	556	c.343G>T	c.(343-345)Gaa>Taa	p.E115*		NM_001040020.1|NM_014888.2	NP_001035109.1|NP_055703.1	Q92520	FAM3C_HUMAN	family with sequence similarity 3, member C	115					multicellular organismal development (GO:0007275)	cytoplasmic vesicle (GO:0031410)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)	cytokine activity (GO:0005125)			kidney(1)|lung(8)	9	all_neural(327;0.117)					TCTAATACTTCTCCTGTTTTT	0.323																																					p.E115X		Atlas-SNP	.											.	FAM3C	29	.	0			c.G343T						.						143.0	126.0	132.0					7																	121002990		2203	4299	6502	SO:0001587	stop_gained	10447	exon7			ATACTTCTCCTGT	D87120	CCDS5782.1	7q22.1-q31.1	2014-08-14			ENSG00000196937	ENSG00000196937			18664	protein-coding gene	gene with protein product	"""predicted osteoblast protein"", ""interleukin-like EMT inducer"", ""interleukin-like epithelial-mesenchymal transition inducer"""	608618				12160727	Standard	NM_014888		Approved	GS3876, ILEI	uc010lkm.3	Q92520	OTTHUMG00000156979	ENST00000359943.3:c.343G>T	chr7.hg19:g.121002990C>A	ENSP00000353025:p.Glu115*	116.0	0.0		90.0	23.0	NM_014888	A6NDN2|A8K3R7	Nonsense_Mutation	SNP	ENST00000359943.3	hg19	CCDS5782.1	.	.	.	.	.	.	.	.	.	.	C	31	5.070424	0.93950	.	.	ENSG00000196937	ENST00000359943;ENST00000412653;ENST00000426156	.	.	.	5.51	4.61	0.57282	.	0.389466	0.33180	N	0.005183	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.19590	T	0.45	-27.5175	16.4252	0.83812	0.0:0.8683:0.1317:0.0	.	.	.	.	X	115;115;85	.	ENSP00000353025:E115X	E	-	1	0	FAM3C	120790226	1.000000	0.71417	0.952000	0.39060	0.996000	0.88848	3.240000	0.51368	1.396000	0.46663	0.650000	0.86243	GAA	.	.		0.323	FAM3C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346945.1	NM_001040020	
EPHB6	2051	hgsc.bcm.edu	37	7	142563351	142563351	+	Silent	SNP	G	G	C			TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr7:142563351G>C	ENST00000392957.2	+	8	1855	c.1068G>C	c.(1066-1068)cgG>cgC	p.R356R	EPHB6_ENST00000442129.1_Silent_p.R356R|EPHB6_ENST00000411471.2_Silent_p.R79R	NM_004445.3	NP_004436.3	O15197	EPHB6_HUMAN	EPH receptor B6	356	Cys-rich.					extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)|receptor activity (GO:0004872)	p.R341R(1)		NS(1)|breast(1)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(9)|lung(46)|ovary(2)|pancreas(2)|prostate(1)|skin(9)|stomach(1)|upper_aerodigestive_tract(1)	87	Melanoma(164;0.059)					GCTTCTACCGGGCCAGTTCCG	0.647																																					p.R356R		Atlas-SNP	.											EPHB6,NS,carcinoma,+1,1	EPHB6	168	.	1	Substitution - coding silent(1)	pancreas(1)	c.G1068C						.						30.0	30.0	30.0					7																	142563351		2203	4300	6503	SO:0001819	synonymous_variant	2051	exon8			CTACCGGGCCAGT	D83492	CCDS5873.2, CCDS75672.1	7q33-q35	2013-02-11	2004-10-28		ENSG00000106123	ENSG00000106123		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3396	protein-coding gene	gene with protein product		602757	"""EphB6"""				Standard	XM_006715881		Approved	HEP	uc011kst.2	O15197	OTTHUMG00000155707	ENST00000392957.2:c.1068G>C	chr7.hg19:g.142563351G>C		64.0	0.0		41.0	6.0	NM_004445	A4D2I7|A8CDT5|D3DXD3|Q2TB23|Q2TB24	Silent	SNP	ENST00000392957.2	hg19	CCDS5873.2																																																																																			.	.		0.647	EPHB6-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341329.1		
EPHB6	2051	hgsc.bcm.edu	37	7	142565796	142565796	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr7:142565796G>A	ENST00000392957.2	+	13	2694	c.1907G>A	c.(1906-1908)aGc>aAc	p.S636N	EPHB6_ENST00000442129.1_Missense_Mutation_p.S636N|EPHB6_ENST00000411471.2_Missense_Mutation_p.S359N	NM_004445.3	NP_004436.3	O15197	EPHB6_HUMAN	EPH receptor B6	636						extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)|receptor activity (GO:0004872)			NS(1)|breast(1)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(9)|lung(46)|ovary(2)|pancreas(2)|prostate(1)|skin(9)|stomach(1)|upper_aerodigestive_tract(1)	87	Melanoma(164;0.059)					CAGCAATACAGCAGCCCAGGT	0.627																																					p.S636N		Atlas-SNP	.											EPHB6,NS,malignant_melanoma,0,1	EPHB6	168	.	0			c.G1907A						.						39.0	38.0	38.0					7																	142565796		2202	4297	6499	SO:0001583	missense	2051	exon13			AATACAGCAGCCC	D83492	CCDS5873.2, CCDS75672.1	7q33-q35	2013-02-11	2004-10-28		ENSG00000106123	ENSG00000106123		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3396	protein-coding gene	gene with protein product		602757	"""EphB6"""				Standard	XM_006715881		Approved	HEP	uc011kst.2	O15197	OTTHUMG00000155707	ENST00000392957.2:c.1907G>A	chr7.hg19:g.142565796G>A	ENSP00000376684:p.Ser636Asn	284.0	0.0		259.0	68.0	NM_004445	A4D2I7|A8CDT5|D3DXD3|Q2TB23|Q2TB24	Missense_Mutation	SNP	ENST00000392957.2	hg19	CCDS5873.2	.	.	.	.	.	.	.	.	.	.	G	9.226	1.034634	0.19590	.	.	ENSG00000106123	ENST00000392957;ENST00000442129;ENST00000411471	T;T;T	0.10960	2.82;2.82;2.82	4.73	1.7	0.24286	.	0.514302	0.18045	N	0.153485	T	0.08088	0.0202	L	0.49350	1.555	0.29514	N	0.853981	B;B	0.02656	0.0;0.0	B;B	0.04013	0.0;0.001	T	0.23511	-1.0186	10	0.16896	T	0.51	.	4.0361	0.09730	0.0946:0.1328:0.5596:0.213	.	636;359	O15197;O15197-2	EPHB6_HUMAN;.	N	636;636;359	ENSP00000376684:S636N;ENSP00000410789:S636N;ENSP00000409061:S359N	ENSP00000376684:S636N	S	+	2	0	EPHB6	142275918	1.000000	0.71417	1.000000	0.80357	0.926000	0.56050	0.955000	0.29188	0.959000	0.37980	0.561000	0.74099	AGC	.	.		0.627	EPHB6-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341329.1		
GPR124	25960	hgsc.bcm.edu	37	8	37688996	37688996	+	Missense_Mutation	SNP	G	G	A	rs372154008		TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr8:37688996G>A	ENST00000412232.2	+	8	1001	c.988G>A	c.(988-990)Gtg>Atg	p.V330M	GPR124_ENST00000315215.7_Missense_Mutation_p.V330M	NM_032777.9	NP_116166.9	Q96PE1	GP124_HUMAN	G protein-coupled receptor 124	330	Ig-like.				central nervous system development (GO:0007417)|endothelial cell migration (GO:0043542)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of vascular endothelial growth factor signaling pathway (GO:1900747)|neuropeptide signaling pathway (GO:0007218)|positive regulation of endothelial cell migration (GO:0010595)|regulation of angiogenesis (GO:0045765)|regulation of chemotaxis (GO:0050920)|regulation of establishment of blood-brain barrier (GO:0090210)|sprouting angiogenesis (GO:0002040)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(4)|lung(16)|ovary(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	37			BRCA - Breast invasive adenocarcinoma(5;2.75e-24)|LUSC - Lung squamous cell carcinoma(8;3.5e-10)			GGAGTGCACCGTGTCCATGGC	0.662																																					p.V330M		Atlas-SNP	.											.	GPR124	85	.	0			c.G988A						.	G	MET/VAL	0,4406		0,0,2203	145.0	103.0	117.0		988	5.2	1.0	8		117	1,8599	1.2+/-3.3	0,1,4299	no	missense	GPR124	NM_032777.9	21	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	330/1339	37688996	1,13005	2203	4300	6503	SO:0001583	missense	25960	exon8			TGCACCGTGTCCA	AB040964	CCDS6097.2	8p11.22	2014-08-08			ENSG00000020181	ENSG00000020181		"""-"", ""GPCR / Class B : Orphans"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	17849	protein-coding gene	gene with protein product	"""tumor endothelial marker 5"""	606823				11559528, 12565841	Standard	NM_032777		Approved	TEM5, DKFZp434C211, DKFZp434J0911, KIAA1531, FLJ14390	uc003xkj.3	Q96PE1	OTTHUMG00000156182	ENST00000412232.2:c.988G>A	chr8.hg19:g.37688996G>A	ENSP00000406367:p.Val330Met	84.0	0.0		62.0	22.0	NM_032777	A6H8W3|D3DSW4|Q8N3R1|Q8TEM3|Q96KB2|Q9P1Z7|Q9UFY4	Missense_Mutation	SNP	ENST00000412232.2	hg19	CCDS6097.2	.	.	.	.	.	.	.	.	.	.	G	20.7	4.038315	0.75617	0.0	1.16E-4	ENSG00000020181	ENST00000416514;ENST00000315215;ENST00000412232	T;T	0.54479	0.57;0.57	5.22	5.22	0.72569	Immunoglobulin subtype (1);Immunoglobulin-like (1);GPCR, family 2, extracellular hormone receptor domain (1);Immunoglobulin-like fold (1);	0.154508	0.41823	D	0.000810	T	0.58991	0.2161	M	0.62723	1.935	0.43214	D	0.995087	D;D	0.55385	0.963;0.971	P;P	0.51016	0.656;0.595	T	0.63251	-0.6679	10	0.66056	D	0.02	-16.9956	11.8794	0.52566	0.1269:0.0:0.8731:0.0	.	330;330	Q96PE1-2;Q96PE1	.;GP124_HUMAN	M	323;330;330	ENSP00000323508:V330M;ENSP00000406367:V330M	ENSP00000323508:V330M	V	+	1	0	GPR124	37808154	1.000000	0.71417	1.000000	0.80357	0.924000	0.55760	4.080000	0.57620	2.458000	0.83093	0.449000	0.29647	GTG	.	.		0.662	GPR124-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343331.2		
SPIDR	23514	hgsc.bcm.edu	37	8	48508432	48508432	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr8:48508432A>T	ENST00000297423.4	+	9	1541	c.1157A>T	c.(1156-1158)gAg>gTg	p.E386V	SPIDR_ENST00000541342.1_Missense_Mutation_p.E316V|SPIDR_ENST00000521214.1_3'UTR|SPIDR_ENST00000518074.1_Missense_Mutation_p.E326V	NM_001080394.2|NM_001282916.1	NP_001073863.1|NP_001269845.1	Q14159	SPIDR_HUMAN	scaffolding protein involved in DNA repair	386	Necessary for interaction with RAD51.				cellular response to camptothecin (GO:0072757)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to hydroxyurea (GO:0072711)|cellular response to ionizing radiation (GO:0071479)|double-strand break repair via homologous recombination (GO:0000724)|positive regulation of double-strand break repair (GO:2000781)|positive regulation of protein complex assembly (GO:0031334)|regulation of double-strand break repair via homologous recombination (GO:0010569)|regulation of establishment of protein localization to chromosome (GO:0070202)	nuclear chromosome (GO:0000228)											TACTTTTGTGAGAAAGTTGTT	0.383																																					p.E386V		Atlas-SNP	.											.	KIAA0146	64	.	0			c.A1157T						.						98.0	91.0	93.0					8																	48508432		1821	4093	5914	SO:0001583	missense	23514	exon9			TTTGTGAGAAAGT	AK055680	CCDS43737.1, CCDS64890.1, CCDS64891.1	8q11.21	2013-07-02	2013-07-02	2013-07-02	ENSG00000164808	ENSG00000164808			28971	protein-coding gene	gene with protein product		615384	"""KIAA0146"""	KIAA0146		8590280, 23509288	Standard	XM_005251189		Approved		uc003xqd.3	Q14159	OTTHUMG00000164176	ENST00000297423.4:c.1157A>T	chr8.hg19:g.48508432A>T	ENSP00000297423:p.Glu386Val	173.0	0.0		187.0	46.0	NM_001080394	B4DFV2|B4E0Y6|Q96BI5	Missense_Mutation	SNP	ENST00000297423.4	hg19	CCDS43737.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	16.27|16.27	3.075840|3.075840	0.55646|0.55646	.|.	.|.	ENSG00000164808|ENSG00000164808	ENST00000297423;ENST00000518074;ENST00000541342;ENST00000524006|ENST00000519401	.|.	.|.	.|.	5.3|5.3	5.3|5.3	0.74995|0.74995	.|.	0.243014|.	0.34291|.	N|.	0.004082|.	T|.	0.43100|.	0.1232|.	L|L	0.29908|0.29908	0.895|0.895	0.29979|0.29979	N|N	0.817881|0.817881	P;P;P;P|.	0.35982|.	0.531;0.531;0.531;0.531|.	B;B;B;B|.	0.32805|.	0.153;0.153;0.153;0.153|.	T|.	0.41716|.	-0.9493|.	9|.	0.87932|.	D|.	0|.	.|.	13.0538|13.0538	0.58969|0.58969	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	326;316;386;386|.	B4E0Y6;B4DFV2;B4DEV5;Q14159|.	.;.;.;K0146_HUMAN|.	V|X	386;326;316;75|68	.|.	ENSP00000297423:E386V|.	E|R	+|+	2|1	0|2	KIAA0146|KIAA0146	48670985|48670985	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.656000|0.656000	0.38851|0.38851	5.135000|5.135000	0.64777|0.64777	2.133000|2.133000	0.65898|0.65898	0.533000|0.533000	0.62120|0.62120	GAG|AGA	.	.		0.383	SPIDR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000377611.1	NM_001080394	
TOX	9760	hgsc.bcm.edu	37	8	59764302	59764302	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr8:59764302C>A	ENST00000361421.1	-	4	694	c.474G>T	c.(472-474)atG>atT	p.M158I		NM_014729.2	NP_055544.1	O94900	TOX_HUMAN	thymocyte selection-associated high mobility group box	158						nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(13)|prostate(1)|skin(2)|stomach(1)	33		all_cancers(86;0.165)|Myeloproliferative disorder(644;0.00452)|all_lung(136;0.036)|Lung NSC(129;0.0464)|all_epithelial(80;0.0607)				CCCTTGGTCTCATGGCTGCCA	0.438																																					p.M158I	Pancreas(161;610 1969 17913 21374 22725)	Atlas-SNP	.											.	TOX	83	.	0			c.G474T						.						117.0	100.0	106.0					8																	59764302		2203	4300	6503	SO:0001583	missense	9760	exon4			TGGTCTCATGGCT		CCDS34897.1	8q12.2-q12.3	2009-04-17			ENSG00000198846	ENSG00000198846			18988	protein-coding gene	gene with protein product		606863				9872452, 11850626	Standard	NM_014729		Approved	KIAA0808, TOX1	uc003xtw.1	O94900	OTTHUMG00000164331	ENST00000361421.1:c.474G>T	chr8.hg19:g.59764302C>A	ENSP00000354842:p.Met158Ile	62.0	0.0		75.0	16.0	NM_014729	Q96AV5	Missense_Mutation	SNP	ENST00000361421.1	hg19	CCDS34897.1	.	.	.	.	.	.	.	.	.	.	C	11.62	1.691497	0.30052	.	.	ENSG00000198846	ENST00000361421	T	0.41065	1.01	5.82	4.04	0.47022	.	0.658299	0.17842	N	0.160180	T	0.37839	0.1018	L	0.54323	1.7	0.37032	D	0.896738	B	0.02656	0.0	B	0.01281	0.0	T	0.27123	-1.0083	9	.	.	.	.	12.4044	0.55430	0.0:0.8655:0.0:0.1345	.	158	O94900	TOX_HUMAN	I	158	ENSP00000354842:M158I	.	M	-	3	0	TOX	59926856	1.000000	0.71417	0.983000	0.44433	0.960000	0.62799	2.549000	0.45803	0.816000	0.34421	0.555000	0.69702	ATG	.	.		0.438	TOX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378307.1	NM_014729	
PREX2	80243	hgsc.bcm.edu	37	8	69011946	69011946	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr8:69011946G>T	ENST00000288368.4	+	23	2860	c.2583G>T	c.(2581-2583)gaG>gaT	p.E861D	PREX2_ENST00000529398.1_3'UTR	NM_024870.2|NM_025170.4	NP_079146.2|NP_079446.3	Q70Z35	PREX2_HUMAN	phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 2	861					adult locomotory behavior (GO:0008344)|dendrite morphogenesis (GO:0048813)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|positive regulation of Rac GTPase activity (GO:0032855)		Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)			NS(6)|biliary_tract(1)|breast(4)|endometrium(11)|kidney(16)|large_intestine(25)|liver(4)|lung(57)|ovary(2)|pancreas(4)|prostate(3)|skin(42)|upper_aerodigestive_tract(1)|urinary_tract(2)	178						AAAGTGATGAGCATTTTGTAC	0.398																																					p.E861D		Atlas-SNP	.											.	PREX2	614	.	0			c.G2583T						.						158.0	138.0	145.0					8																	69011946		2203	4300	6503	SO:0001583	missense	80243	exon23			TGATGAGCATTTT	AK024079	CCDS6201.1	8q13.1	2014-06-13	2008-09-15	2008-09-15	ENSG00000046889	ENSG00000046889		"""Rho guanine nucleotide exchange factors"""	22950	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 129"""	612139	"""DEP domain containing 2"""	DEPDC2		15304342, 15304343	Standard	NM_024870		Approved	DEP.2, FLJ12987, P-REX2, PPP1R129	uc003xxv.1	Q70Z35	OTTHUMG00000164402	ENST00000288368.4:c.2583G>T	chr8.hg19:g.69011946G>T	ENSP00000288368:p.Glu861Asp	92.0	0.0		115.0	24.0	NM_025170	B4DFX0|Q32KL0|Q32KL1|Q6R7Q3|Q6R7Q4|Q9H805|Q9H961	Missense_Mutation	SNP	ENST00000288368.4	hg19	CCDS6201.1	.	.	.	.	.	.	.	.	.	.	G	9.898	1.206102	0.22205	.	.	ENSG00000046889	ENST00000288368;ENST00000396539;ENST00000354677	T	0.35973	1.28	5.66	-3.04	0.05412	.	0.275519	0.36268	N	0.002681	T	0.16214	0.0390	N	0.22421	0.69	0.45307	D	0.998305	B;B;B	0.09022	0.0;0.0;0.002	B;B;B	0.14578	0.002;0.001;0.011	T	0.03993	-1.0986	10	0.29301	T	0.29	.	3.0037	0.06021	0.3619:0.0728:0.3959:0.1694	.	861;861;861	Q70Z35-2;Q70Z35;Q70Z35-3	.;PREX2_HUMAN;.	D	861	ENSP00000288368:E861D	ENSP00000288368:E861D	E	+	3	2	PREX2	69174500	0.348000	0.24861	0.996000	0.52242	0.522000	0.34438	-0.219000	0.09228	-0.154000	0.11118	-1.740000	0.00687	GAG	.	.		0.398	PREX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378620.1	NM_025170	
PMP2	5375	hgsc.bcm.edu	37	8	82356797	82356797	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr8:82356797G>T	ENST00000256103.2	-	3	422	c.286C>A	c.(286-288)Cag>Aag	p.Q96K	PMP2_ENST00000519260.1_Missense_Mutation_p.A38E|RP11-157I4.4_ENST00000524085.2_RNA	NM_002677.3	NP_002668.1	P02689	MYP2_HUMAN	peripheral myelin protein 2	96					membrane organization (GO:0061024)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	cholesterol binding (GO:0015485)|fatty acid binding (GO:0005504)|transporter activity (GO:0005215)			endometrium(1)|kidney(1)|large_intestine(1)|lung(3)	6			Epithelial(68;0.186)			TCCCATCTCTGCACTTGATTC	0.403																																					p.Q96K		Atlas-SNP	.											PMP2,NS,carcinoma,0,1	PMP2	21	.	0			c.C286A						.						153.0	137.0	142.0					8																	82356797		2203	4300	6503	SO:0001583	missense	5375	exon3			ATCTCTGCACTTG	X62167	CCDS6229.1	8q21.3-q22.1	2013-03-01			ENSG00000147588	ENSG00000147588		"""Fatty acid binding protein family"""	9117	protein-coding gene	gene with protein product		170715				1720307, 8288226	Standard	NM_002677		Approved	MP2, FABP8, M-FABP	uc003ycb.1	P02689	OTTHUMG00000164600	ENST00000256103.2:c.286C>A	chr8.hg19:g.82356797G>T	ENSP00000256103:p.Gln96Lys	136.0	0.0		152.0	64.0	NM_002677	Q6FHL4	Missense_Mutation	SNP	ENST00000256103.2	hg19	CCDS6229.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	17.28|17.28	3.350624|3.350624	0.61183|0.61183	.|.	.|.	ENSG00000147588|ENSG00000147588	ENST00000519260|ENST00000256103	.|T	.|0.09163	.|3.01	5.89|5.89	5.89|5.89	0.94794|0.94794	.|Calycin-like (1);Lipocalin/cytosolic fatty-acid binding protein domain (1);Calycin (1);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.40619|0.40619	0.1124|0.1124	M|M	0.84846|0.84846	2.72|2.72	0.43982|0.43982	D|D	0.996674|0.996674	.|D	.|0.89917	.|1.0	.|D	.|0.71870	.|0.975	T|T	0.27157|0.27157	-1.0082|-1.0082	6|10	0.87932|0.72032	D|D	0|0.01	.|.	20.2508|20.2508	0.98407|0.98407	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|96	.|P02689	.|MYP2_HUMAN	E|K	38|96	.|ENSP00000256103:Q96K	ENSP00000429917:A38E|ENSP00000256103:Q96K	A|Q	-|-	2|1	0|0	PMP2|PMP2	82519352|82519352	1.000000|1.000000	0.71417|0.71417	0.991000|0.991000	0.47740|0.47740	0.885000|0.885000	0.51271|0.51271	7.984000|7.984000	0.88150|0.88150	2.788000|2.788000	0.95919|0.95919	0.585000|0.585000	0.79938|0.79938	GCA|CAG	.	.		0.403	PMP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379365.1	NM_002677	
RAD54B	25788	hgsc.bcm.edu	37	8	95384520	95384520	+	Missense_Mutation	SNP	G	G	C			TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr8:95384520G>C	ENST00000336148.5	-	15	2735	c.2611C>G	c.(2611-2613)Ctg>Gtg	p.L871V	RAD54B_ENST00000519348.1_5'UTR	NM_012415.3	NP_036547.1	Q9Y620	RA54B_HUMAN	RAD54 homolog B (S. cerevisiae)	871					ATP catabolic process (GO:0006200)|DNA duplex unwinding (GO:0032508)|double-strand break repair via homologous recombination (GO:0000724)|mitotic recombination (GO:0006312)|reciprocal meiotic recombination (GO:0007131)	nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA translocase activity (GO:0015616)|RNA helicase activity (GO:0003724)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(10)|lung(15)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	39	Breast(36;4.5e-05)		BRCA - Breast invasive adenocarcinoma(8;0.00217)			CATTGCTTCAGCTGGGACATA	0.353								Direct reversal of damage;Homologous recombination																													p.L871V		Atlas-SNP	.											.	RAD54B	88	.	0			c.C2611G						.						93.0	92.0	92.0					8																	95384520		2203	4300	6503	SO:0001583	missense	25788	exon15			GCTTCAGCTGGGA	AF112481	CCDS6262.1, CCDS56546.1, CCDS75768.1	8q22.1	2014-08-08			ENSG00000197275	ENSG00000197275			17228	protein-coding gene	gene with protein product		604289				10362364, 10851248	Standard	NM_012415		Approved	RDH54	uc003ygk.3	Q9Y620	OTTHUMG00000133658	ENST00000336148.5:c.2611C>G	chr8.hg19:g.95384520G>C	ENSP00000336606:p.Leu871Val	107.0	0.0		150.0	29.0	NM_012415	F6WBS8	Missense_Mutation	SNP	ENST00000336148.5	hg19	CCDS6262.1	.	.	.	.	.	.	.	.	.	.	G	17.78	3.473171	0.63737	.	.	ENSG00000197275	ENST00000336148;ENST00000546218	D	0.91237	-2.81	5.65	3.53	0.40419	.	0.000000	0.64402	D	0.000001	D	0.95059	0.8400	M	0.89414	3.03	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.94735	0.7913	10	0.72032	D	0.01	-5.5327	8.9996	0.36074	0.2644:0.0:0.7356:0.0	.	871	Q9Y620	RA54B_HUMAN	V	871;543	ENSP00000336606:L871V	ENSP00000336606:L871V	L	-	1	2	RAD54B	95453696	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	0.830000	0.27462	1.397000	0.46682	0.563000	0.77884	CTG	.	.		0.353	RAD54B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257806.3	NM_012415	
RGS22	26166	hgsc.bcm.edu	37	8	101011556	101011556	+	Missense_Mutation	SNP	C	C	G	rs371559852		TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr8:101011556C>G	ENST00000360863.6	-	19	3077	c.2883G>C	c.(2881-2883)agG>agC	p.R961S	RGS22_ENST00000523287.1_Missense_Mutation_p.R780S|RGS22_ENST00000519421.1_5'Flank|RGS22_ENST00000523437.1_Missense_Mutation_p.R949S	NM_015668.3	NP_056483.3	Q8NE09	RGS22_HUMAN	regulator of G-protein signaling 22	961	RGS 1. {ECO:0000255|PROSITE- ProRule:PRU00171}.				positive regulation of GTPase activity (GO:0043547)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)		RGS22/SYCP1(2)	breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(9)|lung(33)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	68			Epithelial(11;6.71e-08)|all cancers(13;4.19e-06)|OV - Ovarian serous cystadenocarcinoma(57;0.000469)|STAD - Stomach adenocarcinoma(118;0.169)			CATTTTCTAGCCTATTTTGCA	0.383																																					p.R961S		Atlas-SNP	.											.	RGS22	319	.	0			c.G2883C						.						86.0	83.0	84.0					8																	101011556		1859	4108	5967	SO:0001583	missense	26166	exon19			TTCTAGCCTATTT	AY009106	CCDS43758.1, CCDS69521.1, CCDS75775.1	8q22.2	2014-01-21	2007-08-14		ENSG00000132554	ENSG00000132554		"""Regulators of G-protein signaling"""	24499	protein-coding gene	gene with protein product		615650	"""regulator of G-protein signalling 22"""				Standard	XM_005250856		Approved	DKFZP434I092, PRTD-NY2, CT145	uc003yjb.1	Q8NE09	OTTHUMG00000164802	ENST00000360863.6:c.2883G>C	chr8.hg19:g.101011556C>G	ENSP00000354109:p.Arg961Ser	107.0	0.0		118.0	27.0	NM_015668	A8K944|Q569L2|Q86Y71|Q9BYZ4|Q9UFN6	Missense_Mutation	SNP	ENST00000360863.6	hg19	CCDS43758.1	.	.	.	.	.	.	.	.	.	.	C	14.53	2.563471	0.45694	.	.	ENSG00000132554	ENST00000360863;ENST00000427793;ENST00000523287;ENST00000523437	T;T;T	0.21543	2.0;2.0;2.0	5.1	0.182	0.15077	Regulator of G protein signalling (3);Regulator of G protein signalling superfamily (1);	0.135740	0.47455	D	0.000223	T	0.28632	0.0709	M	0.71581	2.175	0.26408	N	0.976315	P;P;D	0.55172	0.892;0.892;0.97	P;P;P	0.51657	0.575;0.575;0.676	T	0.14531	-1.0469	10	0.87932	D	0	.	6.3177	0.21200	0.0:0.5105:0.1194:0.3701	.	949;961;780	A8K944;Q8NE09;G3V112	.;RGS22_HUMAN;.	S	961;948;780;949	ENSP00000354109:R961S;ENSP00000429382:R780S;ENSP00000428212:R949S	ENSP00000354109:R961S	R	-	3	2	RGS22	101080732	1.000000	0.71417	0.763000	0.31416	0.853000	0.48598	1.006000	0.29847	-0.289000	0.09038	-0.140000	0.14226	AGG	.	.		0.383	RGS22-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000380365.1	NM_015668	
PKHD1L1	93035	hgsc.bcm.edu	37	8	110408332	110408332	+	Silent	SNP	T	T	C			TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr8:110408332T>C	ENST00000378402.5	+	11	992	c.888T>C	c.(886-888)gaT>gaC	p.D296D		NM_177531.4	NP_803875.2	Q86WI1	PKHL1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)-like 1	296	IPT/TIG 3.				immune response (GO:0006955)	cytosol (GO:0005829)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			NS(4)|breast(13)|central_nervous_system(6)|cervix(1)|endometrium(19)|kidney(17)|large_intestine(34)|lung(122)|ovary(11)|pancreas(3)|prostate(9)|skin(3)|stomach(4)|upper_aerodigestive_tract(13)|urinary_tract(4)	263			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			GTTTCTTTGATCAGACAGATT	0.403										HNSCC(38;0.096)																											p.D296D		Atlas-SNP	.											.	PKHD1L1	522	.	0			c.T888C						.						78.0	68.0	71.0					8																	110408332		1992	4187	6179	SO:0001819	synonymous_variant	93035	exon11			CTTTGATCAGACA	AY219181	CCDS47911.1	8q23	2003-03-28			ENSG00000205038	ENSG00000205038			20313	protein-coding gene	gene with protein product		607843				12620974	Standard	NM_177531		Approved		uc003yne.3	Q86WI1	OTTHUMG00000164934	ENST00000378402.5:c.888T>C	chr8.hg19:g.110408332T>C		70.0	0.0		90.0	14.0	NM_177531	Q567P2|Q9UF27	Silent	SNP	ENST00000378402.5	hg19	CCDS47911.1																																																																																			.	.		0.403	PKHD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381017.1	NM_177531	
TRPS1	7227	hgsc.bcm.edu	37	8	116599386	116599386	+	Missense_Mutation	SNP	C	C	T	rs377704400		TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr8:116599386C>T	ENST00000220888.5	-	4	2662	c.2503G>A	c.(2503-2505)Gcc>Acc	p.A835T	TRPS1_ENST00000519674.1_Missense_Mutation_p.A835T|TRPS1_ENST00000395715.3_Missense_Mutation_p.A848T|TRPS1_ENST00000519076.1_Missense_Mutation_p.A589T|TRPS1_ENST00000520276.1_Missense_Mutation_p.A839T			Q9UHF7	TRPS1_HUMAN	trichorhinophalangeal syndrome I	835					chondrocyte differentiation (GO:0002062)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|NLS-bearing protein import into nucleus (GO:0006607)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|regulation of chondrocyte differentiation (GO:0032330)|regulation of histone deacetylation (GO:0031063)|skeletal system development (GO:0001501)|transcription from RNA polymerase II promoter (GO:0006366)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(25)|lung(58)|ovary(3)|pancreas(1)|prostate(1)|skin(6)|urinary_tract(2)	111	all_cancers(13;5.44e-23)|all_epithelial(1;2.14e-27)|Lung NSC(37;2.55e-05)|Ovarian(258;0.0219)		Epithelial(1;9.78e-37)|all cancers(1;3.14e-31)|BRCA - Breast invasive adenocarcinoma(1;2.56e-12)			AGATGGGCGGCCTCCACATTG	0.617									Langer-Giedion syndrome																												p.A848T		Atlas-SNP	.											.	TRPS1	516	.	0			c.G2542A						.	C	THR/ALA	1,3749		0,1,1874	54.0	56.0	56.0		2542	5.8	1.0	8		56	0,8204		0,0,4102	no	missense	TRPS1	NM_014112.2	58	0,1,5976	TT,TC,CC		0.0,0.0267,0.0084	probably-damaging	848/1295	116599386	1,11953	1875	4102	5977	SO:0001583	missense	7227	exon5	Familial Cancer Database	Trichorhinophalangeal syndrome type 2, TRPS II	GGGCGGCCTCCAC	AF183810	CCDS6318.2, CCDS64957.1	8q23.3	2014-06-23			ENSG00000104447	ENSG00000104447		"""GATA zinc finger domain containing"", ""Zinc fingers, C2H2-type"""	12340	protein-coding gene	gene with protein product		604386				8530105, 10615131, 10647898	Standard	NM_001282903		Approved	LGCR	uc003yny.3	Q9UHF7	OTTHUMG00000142829	ENST00000220888.5:c.2503G>A	chr8.hg19:g.116599386C>T	ENSP00000220888:p.Ala835Thr	77.0	0.0		89.0	35.0	NM_014112	B4E1Z5|Q08AU2|Q9NWE1|Q9UHH6	Missense_Mutation	SNP	ENST00000220888.5	hg19		.	.	.	.	.	.	.	.	.	.	C	22.5	4.299244	0.81025	2.67E-4	0.0	ENSG00000104447	ENST00000395715;ENST00000220888;ENST00000519076;ENST00000520276;ENST00000519674	D;D;D;D;T	0.98474	-4.95;-4.92;-4.9;-4.92;0.87	5.76	5.76	0.90799	.	0.179181	0.47852	D	0.000218	D	0.97879	0.9303	L	0.29908	0.895	0.41908	D	0.990457	D;D;D	0.67145	0.996;0.993;0.996	P;P;P	0.60609	0.829;0.679;0.877	D	0.99453	1.0941	10	0.72032	D	0.01	.	19.9813	0.97326	0.0:1.0:0.0:0.0	.	839;835;848	Q9UHF7-3;Q9UHF7;Q9UHF7-2	.;TRPS1_HUMAN;.	T	848;835;589;839;835	ENSP00000379065:A848T;ENSP00000220888:A835T;ENSP00000428910:A589T;ENSP00000428680:A839T;ENSP00000429174:A835T	ENSP00000220888:A835T	A	-	1	0	TRPS1	116668561	1.000000	0.71417	0.999000	0.59377	0.654000	0.38779	5.359000	0.66074	2.726000	0.93360	0.655000	0.94253	GCC	.	.		0.617	TRPS1-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000286436.3	NM_014112	
LRRC14	9684	hgsc.bcm.edu	37	8	145746557	145746557	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr8:145746557G>A	ENST00000292524.1	+	4	1323	c.1177G>A	c.(1177-1179)Gcc>Acc	p.A393T	LRRC14_ENST00000529022.1_Missense_Mutation_p.A393T	NM_001272036.1|NM_014665.2	NP_001258965.1|NP_055480.1	Q15048	LRC14_HUMAN	leucine rich repeat containing 14	393										endometrium(1)|lung(3)|prostate(1)	5	all_cancers(97;5.56e-11)|all_epithelial(106;3.54e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.48e-41)|Epithelial(56;1.85e-40)|all cancers(56;3.59e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0483)|Colorectal(110;0.055)			GACTCAGTGCGCCAGTCTCCG	0.607																																					p.A393T		Atlas-SNP	.											LRRC14,NS,carcinoma,0,1	LRRC14	25	.	0			c.G1177A						.						77.0	67.0	70.0					8																	145746557		2203	4300	6503	SO:0001583	missense	9684	exon5			CAGTGCGCCAGTC	BC011377	CCDS6432.1	8q24.3	2012-08-20			ENSG00000160959	ENSG00000160959			20419	protein-coding gene	gene with protein product						7584026	Standard	NM_001272036		Approved	KIAA0014, LRRC14A	uc003zdk.3	Q15048	OTTHUMG00000165179	ENST00000292524.1:c.1177G>A	chr8.hg19:g.145746557G>A	ENSP00000292524:p.Ala393Thr	59.0	0.0		58.0	20.0	NM_001272036	A8K0A8|D3DWM8	Missense_Mutation	SNP	ENST00000292524.1	hg19	CCDS6432.1	.	.	.	.	.	.	.	.	.	.	G	0	-2.621997	0.00117	.	.	ENSG00000160959	ENST00000529022;ENST00000292524	T;T	0.09255	3.0;3.0	4.61	-3.77	0.04346	.	0.608394	0.17343	N	0.177692	T	0.02888	0.0086	N	0.02539	-0.55	0.09310	N	1	B	0.18013	0.025	B	0.12156	0.007	T	0.32508	-0.9904	10	0.32370	T	0.25	.	4.5321	0.12010	0.3629:0.0:0.3217:0.3154	.	393	Q15048	LRC14_HUMAN	T	393	ENSP00000434768:A393T;ENSP00000292524:A393T	ENSP00000292524:A393T	A	+	1	0	LRRC14	145717365	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.824000	0.04438	-1.100000	0.03030	-2.067000	0.00394	GCC	.	.		0.607	LRRC14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382494.1	NM_014665	
KANK1	23189	hgsc.bcm.edu	37	9	711564	711564	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr9:711564G>T	ENST00000382303.1	+	7	1450	c.798G>T	c.(796-798)caG>caT	p.Q266H	KANK1_ENST00000489369.1_3'UTR|KANK1_ENST00000382297.2_Missense_Mutation_p.Q266H|KANK1_ENST00000382293.3_Missense_Mutation_p.Q108H	NM_001256876.1	NP_001243805.1	Q14678	KANK1_HUMAN	KN motif and ankyrin repeat domains 1	266					negative regulation of actin filament polymerization (GO:0030837)|negative regulation of cell migration (GO:0030336)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of lamellipodium morphogenesis (GO:2000393)|negative regulation of neuron projection development (GO:0010977)|negative regulation of Rho protein signal transduction (GO:0035024)|negative regulation of ruffle assembly (GO:1900028)|negative regulation of substrate adhesion-dependent cell spreading (GO:1900025)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of Wnt signaling pathway (GO:0030177)|positive regulation of wound healing (GO:0090303)|regulation of establishment of cell polarity (GO:2000114)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|ruffle membrane (GO:0032587)	beta-catenin binding (GO:0008013)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(3)|large_intestine(9)|lung(8)|ovary(3)|pancreas(1)|prostate(3)|stomach(4)|upper_aerodigestive_tract(1)	43		Lung NSC(10;9.84e-12)|all_lung(10;1.02e-11)|Breast(48;0.128)		Epithelial(6;0.000153)|OV - Ovarian serous cystadenocarcinoma(1;0.000358)|Lung(218;0.0222)		TCCGCGAGCAGATGGCCATTG	0.597																																					p.Q266H		Atlas-SNP	.											.	KANK1	231	.	0			c.G798T						.						75.0	72.0	73.0					9																	711564		2203	4300	6503	SO:0001583	missense	23189	exon7			CGAGCAGATGGCC	AL833161	CCDS6441.1, CCDS34976.1	9p24.3	2013-01-10	2008-01-29	2008-01-29	ENSG00000107104	ENSG00000107104		"""KN motif and ankyrin repeat domain containing"", ""Ankyrin repeat domain containing"""	19309	protein-coding gene	gene with protein product		607704	"""ankyrin repeat domain 15"""	ANKRD15		12133830, 17996375, 19554261	Standard	NM_015158		Approved	KIAA0172, KANK	uc003zgn.2	Q14678	OTTHUMG00000019434	ENST00000382303.1:c.798G>T	chr9.hg19:g.711564G>T	ENSP00000371740:p.Gln266His	66.0	0.0		70.0	11.0	NM_001256876	A2A2W8|D3DRH3|Q5W0W0|Q8IY65|Q8WX74	Missense_Mutation	SNP	ENST00000382303.1	hg19	CCDS34976.1	.	.	.	.	.	.	.	.	.	.	G	16.91	3.252651	0.59212	.	.	ENSG00000107104	ENST00000382303;ENST00000354485;ENST00000382297;ENST00000382293	T;T;T	0.00966	5.49;5.49;5.49	5.82	3.67	0.42095	.	0.000000	0.53938	D	0.000055	T	0.05044	0.0135	M	0.83953	2.67	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.05225	-1.0898	10	0.87932	D	0	-6.5511	9.3378	0.38060	0.2512:0.0:0.7488:0.0	.	266;266	Q5W0W1;Q14678	.;KANK1_HUMAN	H	266;266;266;108	ENSP00000371740:Q266H;ENSP00000371734:Q266H;ENSP00000371730:Q108H	ENSP00000346479:Q266H	Q	+	3	2	KANK1	701564	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.457000	0.45005	1.485000	0.48380	0.655000	0.94253	CAG	.	.		0.597	KANK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051484.2	NM_015158	
KANK1	23189	hgsc.bcm.edu	37	9	713298	713298	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr9:713298C>A	ENST00000382303.1	+	7	3184	c.2532C>A	c.(2530-2532)aaC>aaA	p.N844K	KANK1_ENST00000489369.1_3'UTR|KANK1_ENST00000382297.2_Missense_Mutation_p.N844K|KANK1_ENST00000382293.3_Missense_Mutation_p.N686K	NM_001256876.1	NP_001243805.1	Q14678	KANK1_HUMAN	KN motif and ankyrin repeat domains 1	844					negative regulation of actin filament polymerization (GO:0030837)|negative regulation of cell migration (GO:0030336)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of lamellipodium morphogenesis (GO:2000393)|negative regulation of neuron projection development (GO:0010977)|negative regulation of Rho protein signal transduction (GO:0035024)|negative regulation of ruffle assembly (GO:1900028)|negative regulation of substrate adhesion-dependent cell spreading (GO:1900025)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of Wnt signaling pathway (GO:0030177)|positive regulation of wound healing (GO:0090303)|regulation of establishment of cell polarity (GO:2000114)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|ruffle membrane (GO:0032587)	beta-catenin binding (GO:0008013)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(3)|large_intestine(9)|lung(8)|ovary(3)|pancreas(1)|prostate(3)|stomach(4)|upper_aerodigestive_tract(1)	43		Lung NSC(10;9.84e-12)|all_lung(10;1.02e-11)|Breast(48;0.128)		Epithelial(6;0.000153)|OV - Ovarian serous cystadenocarcinoma(1;0.000358)|Lung(218;0.0222)		TGGCTGAGAACTACAGTGAAC	0.532																																					p.N844K		Atlas-SNP	.											.	KANK1	231	.	0			c.C2532A						.						146.0	139.0	141.0					9																	713298		2203	4300	6503	SO:0001583	missense	23189	exon7			TGAGAACTACAGT	AL833161	CCDS6441.1, CCDS34976.1	9p24.3	2013-01-10	2008-01-29	2008-01-29	ENSG00000107104	ENSG00000107104		"""KN motif and ankyrin repeat domain containing"", ""Ankyrin repeat domain containing"""	19309	protein-coding gene	gene with protein product		607704	"""ankyrin repeat domain 15"""	ANKRD15		12133830, 17996375, 19554261	Standard	NM_015158		Approved	KIAA0172, KANK	uc003zgn.2	Q14678	OTTHUMG00000019434	ENST00000382303.1:c.2532C>A	chr9.hg19:g.713298C>A	ENSP00000371740:p.Asn844Lys	115.0	0.0		113.0	27.0	NM_001256876	A2A2W8|D3DRH3|Q5W0W0|Q8IY65|Q8WX74	Missense_Mutation	SNP	ENST00000382303.1	hg19	CCDS34976.1	.	.	.	.	.	.	.	.	.	.	C	22.9	4.347522	0.82022	.	.	ENSG00000107104	ENST00000382303;ENST00000354485;ENST00000382297;ENST00000382293	T;T;T	0.16597	2.33;2.33;2.33	5.64	5.64	0.86602	.	0.000000	0.64402	D	0.000017	T	0.42040	0.1185	M	0.74258	2.255	0.80722	D	1	D;P	0.89917	1.0;0.853	D;B	0.87578	0.998;0.406	T	0.25257	-1.0137	10	0.72032	D	0.01	.	13.4043	0.60903	0.0:0.919:0.0:0.081	.	844;844	Q5W0W1;Q14678	.;KANK1_HUMAN	K	844;844;844;686	ENSP00000371740:N844K;ENSP00000371734:N844K;ENSP00000371730:N686K	ENSP00000346479:N844K	N	+	3	2	KANK1	703298	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	2.635000	0.46537	2.654000	0.90174	0.655000	0.94253	AAC	.	.		0.532	KANK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051484.2	NM_015158	
C9orf131	138724	hgsc.bcm.edu	37	9	35044802	35044802	+	Silent	SNP	C	C	T			TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr9:35044802C>T	ENST00000312292.5	+	2	2223	c.2176C>T	c.(2176-2178)Cta>Tta	p.L726L	C9orf131_ENST00000354479.5_Silent_p.L653L|C9orf131_ENST00000421362.2_Silent_p.L678L|FLJ00273_ENST00000595331.1_5'Flank	NM_001040410.1|NM_203299.2	NP_001035500.1|NP_976044.2	Q5VYM1	CI131_HUMAN	chromosome 9 open reading frame 131	726										cervix(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(23)|prostate(2)|skin(2)|stomach(1)	39	all_epithelial(49;0.22)		LUSC - Lung squamous cell carcinoma(32;0.00117)|Lung(28;0.00309)			AGTGGATCCCCTACACCCAGT	0.552																																					p.L726L		Atlas-SNP	.											.	C9orf131	71	.	0			c.C2176T						.						65.0	64.0	64.0					9																	35044802		2203	4300	6503	SO:0001819	synonymous_variant	138724	exon2			GATCCCCTACACC	BC045643	CCDS6572.2, CCDS47961.1, CCDS47962.1	9p13.3	2008-02-05			ENSG00000174038	ENSG00000174038			31418	protein-coding gene	gene with protein product							Standard	NM_001287391		Approved	MGC41945	uc003zvw.3	Q5VYM1	OTTHUMG00000019853	ENST00000312292.5:c.2176C>T	chr9.hg19:g.35044802C>T		61.0	0.0		67.0	11.0	NM_203299	A6NLE6|E9PB26|Q86XC6|Q9UF74	Silent	SNP	ENST00000312292.5	hg19	CCDS6572.2																																																																																			.	.		0.552	C9orf131-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000052283.5	NM_203299	
ALDOB	229	hgsc.bcm.edu	37	9	104187850	104187850	+	Silent	SNP	C	C	T			TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr9:104187850C>T	ENST00000374855.4	-	7	808	c.684G>A	c.(682-684)ctG>ctA	p.L228L	ALDOB_ENST00000468981.3_5'UTR	NM_000035.3	NP_000026.2	P05062	ALDOB_HUMAN	aldolase B, fructose-bisphosphate	228					carbohydrate metabolic process (GO:0005975)|fructose 1,6-bisphosphate metabolic process (GO:0030388)|fructose catabolic process (GO:0006001)|fructose metabolic process (GO:0006000)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|NADH oxidation (GO:0006116)|positive regulation of ATPase activity (GO:0032781)|small molecule metabolic process (GO:0044281)|vacuolar proton-transporting V-type ATPase complex assembly (GO:0070072)	centriolar satellite (GO:0034451)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|microtubule organizing center (GO:0005815)	ATPase binding (GO:0051117)|cytoskeletal protein binding (GO:0008092)|fructose binding (GO:0070061)|fructose-1-phosphate aldolase activity (GO:0061609)|fructose-bisphosphate aldolase activity (GO:0004332)|identical protein binding (GO:0042802)			central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(6)|liver(1)|lung(5)|prostate(2)|skin(4)|urinary_tract(1)	24		Acute lymphoblastic leukemia(62;0.0559)				TGGGCTTTAGCAGGGTGCCCT	0.527																																					p.L228L		Atlas-SNP	.											.	ALDOB	69	.	0			c.G684A						.						196.0	158.0	171.0					9																	104187850		2203	4300	6503	SO:0001819	synonymous_variant	229	exon7			CTTTAGCAGGGTG	X01098	CCDS6756.1	9q21.3-q22.2	2008-02-05			ENSG00000136872	ENSG00000136872	4.1.2.13		417	protein-coding gene	gene with protein product		612724					Standard	NM_000035		Approved		uc004bbk.2	P05062	OTTHUMG00000020378	ENST00000374855.4:c.684G>A	chr9.hg19:g.104187850C>T		90.0	0.0		70.0	12.0	NM_000035	Q13741|Q13742|Q5T7D6	Silent	SNP	ENST00000374855.4	hg19	CCDS6756.1																																																																																			.	.		0.527	ALDOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053434.2		
TNFSF15	9966	hgsc.bcm.edu	37	9	117554792	117554792	+	Intron	SNP	G	G	T			TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr9:117554792G>T	ENST00000374045.4	-	3	367				TNFSF15_ENST00000374044.1_5'Flank|AL390240.1_ENST00000408807.1_RNA	NM_001204344.1|NM_005118.3	NP_001191273.1|NP_005109.2	O95150	TNF15_HUMAN	tumor necrosis factor (ligand) superfamily, member 15						activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of NF-kappaB-inducing kinase activity (GO:0007250)|cytokine metabolic process (GO:0042107)|immune response (GO:0006955)|positive regulation of cytokine secretion (GO:0050715)|signal transduction (GO:0007165)	extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	receptor binding (GO:0005102)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(4)|skin(1)	11						AAATGAAGACGGCCCTTTGTG	0.483																																					p.R7S		Atlas-SNP	.											.	TNFSF15	23	.	0			c.C19A						.						102.0	92.0	95.0					9																	117554792		692	1591	2283	SO:0001627	intron_variant	9966	exon1			GAAGACGGCCCTT	AF039390	CCDS6809.1	9q32	2008-07-21			ENSG00000181634	ENSG00000181634		"""Tumor necrosis factor (ligand) superfamily"""	11931	protein-coding gene	gene with protein product	"""vascular endothelial cell growth inhibitor"", ""TNF superfamily ligand TL1A"", ""TNF ligand-related molecule 1"", ""vascular endothelial growth inhibitor-192A"""	604052				9434163	Standard	NM_005118		Approved	TL1, VEGI, TL1A, VEGI192A, MGC129934, MGC129935	uc004bjh.3	O95150	OTTHUMG00000021011	ENST00000374045.4:c.254-58C>A	chr9.hg19:g.117554792G>T		52.0	0.0		54.0	10.0	NM_001204344	Q3SX69|Q5VJK8|Q5VWH1|Q8NFE9	Missense_Mutation	SNP	ENST00000374045.4	hg19	CCDS6809.1																																																																																			.	.		0.483	TNFSF15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055424.2	NM_005118	
INPP5E	56623	hgsc.bcm.edu	37	9	139333590	139333590	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr9:139333590C>A	ENST00000371712.3	-	1	684	c.282G>T	c.(280-282)agG>agT	p.R94S	SEC16A_ENST00000467838.1_5'Flank	NM_019892.4	NP_063945.2	Q10713	MPPA_HUMAN	inositol polyphosphate-5-phosphatase, 72 kDa	0					cellular protein metabolic process (GO:0044267)|protein targeting to mitochondrion (GO:0006626)|proteolysis (GO:0006508)	extracellular space (GO:0005615)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)			NS(1)|endometrium(1)|lung(4)|skin(3)	9		Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;8.36e-06)|Epithelial(140;1.4e-05)		CTCGAAAACGCCTCCTCCTCC	0.731																																					p.R94S		Atlas-SNP	.											.	INPP5E	18	.	0			c.G282T						.						5.0	5.0	5.0					9																	139333590		1958	3868	5826	SO:0001583	missense	56623	exon1			AAAACGCCTCCTC	AF187891	CCDS7000.1	9q34.3	2011-02-11			ENSG00000148384	ENSG00000148384			21474	protein-coding gene	gene with protein product		613037	"""Joubert syndrome 1"""	JBTS1		10764818, 10577920, 19668216	Standard	NM_019892		Approved	PPI5PIV, CORS1	uc004cho.3	Q9NRR6	OTTHUMG00000020927	ENST00000371712.3:c.282G>T	chr9.hg19:g.139333590C>A	ENSP00000360777:p.Arg94Ser	518.0	0.0		395.0	101.0	NM_019892	B4DKL3|E7ET61|Q16639|Q5SXM9|Q8N513	Missense_Mutation	SNP	ENST00000371712.3	hg19	CCDS7000.1	.	.	.	.	.	.	.	.	.	.	C	15.77	2.931158	0.52866	.	.	ENSG00000148384	ENST00000371712	T	0.42900	0.96	3.98	1.92	0.25849	.	2.353540	0.02539	N	0.094378	T	0.59715	0.2214	L	0.55990	1.75	0.44373	D	0.997277	D;D	0.76494	0.999;0.998	D;D	0.80764	0.994;0.987	T	0.50215	-0.8854	10	0.87932	D	0	-30.922	6.157	0.20344	0.0:0.6564:0.1563:0.1873	.	94;94	Q9NRR6-2;Q9NRR6	.;INP5E_HUMAN	S	94	ENSP00000360777:R94S	ENSP00000360777:R94S	R	-	3	2	INPP5E	138453411	0.883000	0.30277	0.851000	0.33527	0.059000	0.15707	0.031000	0.13710	0.778000	0.33520	0.558000	0.71614	AGG	.	.		0.731	INPP5E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055058.1	NM_019892	
FAM208B	54906	hgsc.bcm.edu	37	10	5791217	5791217	+	Silent	SNP	A	A	C			TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr10:5791217A>C	ENST00000328090.5	+	15	6458	c.5833A>C	c.(5833-5835)Agg>Cgg	p.R1945R		NM_017782.4	NP_060252	Q5VWN6	F208B_HUMAN	family with sequence similarity 208, member B	1945																	ACACGGCCTGAGGAGGCACCC	0.522																																					p.R1945R		Atlas-SNP	.											.	.	.	.	0			c.A5833C						.						40.0	42.0	41.0					10																	5791217		2051	4186	6237	SO:0001819	synonymous_variant	54906	exon15			GGCCTGAGGAGGC	BX649177	CCDS41485.1	10p15.1	2011-09-14	2011-09-14	2011-09-14	ENSG00000108021	ENSG00000108021			23484	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 18"""	C10orf18		12477932	Standard	NM_017782		Approved	FLJ20360, bA318E3.2, KIAA2006	uc001iij.3	Q5VWN6	OTTHUMG00000017605	ENST00000328090.5:c.5833A>C	chr10.hg19:g.5791217A>C		81.0	0.0		87.0	23.0	NM_017782	Q2YD91|Q5VWN5|Q6ZRQ8|Q8IVG4|Q9BUZ7|Q9H5J9|Q9H7A4|Q9H996|Q9NXA1	Silent	SNP	ENST00000328090.5	hg19	CCDS41485.1																																																																																			.	.		0.522	FAM208B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046571.2	NM_017782	
FBXO18	84893	hgsc.bcm.edu	37	10	5945032	5945032	+	Missense_Mutation	SNP	G	G	C			TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr10:5945032G>C	ENST00000362091.4	+	2	166	c.51G>C	c.(49-51)ttG>ttC	p.L17F	FBXO18_ENST00000379999.5_Missense_Mutation_p.L68F|FBXO18_ENST00000397269.3_5'UTR|FBXO18_ENST00000470089.1_Intron	NM_001258453.1|NM_178150.2	NP_001245382.1|NP_835363.1	Q8NFZ0	FBX18_HUMAN	F-box protein, helicase, 18	17					DNA catabolic process, endonucleolytic (GO:0000737)|positive regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902231)|positive regulation of protein phosphorylation (GO:0001934)|response to intra-S DNA damage checkpoint signaling (GO:0072429)	nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)			NS(2)|breast(2)|kidney(2)|large_intestine(16)|lung(9)|ovary(2)|prostate(3)|skin(3)|stomach(1)	40						GCCAGCATTTGGCTCGGAGTC	0.478																																					p.L68F		Atlas-SNP	.											.	FBXO18	108	.	0			c.G204C						.						105.0	92.0	96.0					10																	5945032		2203	4300	6503	SO:0001583	missense	84893	exon3			GCATTTGGCTCGG	AK095343	CCDS7072.1, CCDS7073.1, CCDS73064.1	10p15.1	2004-08-24	2004-06-15		ENSG00000134452	ENSG00000134452		"""F-boxes /  ""other"""""	13620	protein-coding gene	gene with protein product		607222	"""F-box only protein 18"""			10531037, 11956208	Standard	NM_032807		Approved	FBH1, FLJ14590, Fbx18	uc001iit.4	Q8NFZ0	OTTHUMG00000017609	ENST00000362091.4:c.51G>C	chr10.hg19:g.5945032G>C	ENSP00000355415:p.Leu17Phe	119.0	0.0		96.0	29.0	NM_032807	Q5JVB0|Q5JVB1|Q7Z4Q6|Q7Z4R0|Q8N1P5|Q8N586|Q96E82|Q96K67|Q96SW7|Q9UFB2	Missense_Mutation	SNP	ENST00000362091.4	hg19	CCDS7072.1	.	.	.	.	.	.	.	.	.	.	G	15.64	2.893268	0.52121	.	.	ENSG00000134452	ENST00000362091;ENST00000379999	.	.	.	5.42	2.29	0.28610	.	0.000000	0.64402	D	0.000004	T	0.66819	0.2828	L	0.58101	1.795	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.997	T	0.67284	-0.5709	9	0.87932	D	0	-13.0962	6.659	0.23004	0.1508:0.2834:0.5657:0.0	.	68;17	Q8NFZ0-2;Q8NFZ0	.;FBX18_HUMAN	F	17;68	.	ENSP00000355415:L17F	L	+	3	2	FBXO18	5985038	0.063000	0.20901	0.998000	0.56505	0.345000	0.29048	0.119000	0.15626	1.268000	0.44264	0.655000	0.94253	TTG	.	.		0.478	FBXO18-009	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046596.1	NM_032807	
CUBN	8029	hgsc.bcm.edu	37	10	17113474	17113474	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr10:17113474G>A	ENST00000377833.4	-	19	2641	c.2576C>T	c.(2575-2577)aCt>aTt	p.T859I		NM_001081.3	NP_001072.2	O60494	CUBN_HUMAN	cubilin (intrinsic factor-cobalamin receptor)	859	CUB 4. {ECO:0000255|PROSITE- ProRule:PRU00059}.				cholesterol metabolic process (GO:0008203)|cobalamin metabolic process (GO:0009235)|cobalamin transport (GO:0015889)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|tissue homeostasis (GO:0001894)|vitamin D metabolic process (GO:0042359)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|extrinsic component of external side of plasma membrane (GO:0031232)|Golgi apparatus (GO:0005794)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|cobalamin binding (GO:0031419)|protein homodimerization activity (GO:0042803)|receptor activity (GO:0004872)|transporter activity (GO:0005215)			breast(8)|central_nervous_system(4)|cervix(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(42)|liver(1)|lung(107)|ovary(9)|pancreas(2)|prostate(3)|skin(9)|stomach(3)|upper_aerodigestive_tract(11)|urinary_tract(8)	241					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	TTCAAAGACAGTGAAGTTGAG	0.398																																					p.T859I		Atlas-SNP	.											.	CUBN	515	.	0			c.C2576T						.						88.0	86.0	87.0					10																	17113474		2203	4300	6503	SO:0001583	missense	8029	exon19			AAGACAGTGAAGT	AF034611	CCDS7113.1	10p12	2014-09-17			ENSG00000107611	ENSG00000107611			2548	protein-coding gene	gene with protein product		602997		MGA1		9572993, 9478979	Standard	NM_001081		Approved	IFCR, gp280	uc001ioo.3	O60494	OTTHUMG00000017741	ENST00000377833.4:c.2576C>T	chr10.hg19:g.17113474G>A	ENSP00000367064:p.Thr859Ile	134.0	0.0		103.0	21.0	NM_001081	B0YIZ4|Q5VTA6|Q96RU9	Missense_Mutation	SNP	ENST00000377833.4	hg19	CCDS7113.1	.	.	.	.	.	.	.	.	.	.	G	7.077	0.569519	0.13560	.	.	ENSG00000107611	ENST00000377833	T	0.18810	2.19	5.47	4.56	0.56223	CUB (5);	0.000000	0.41605	D	0.000858	T	0.14743	0.0356	L	0.41824	1.3	0.80722	D	1	P	0.35383	0.498	B	0.32677	0.15	T	0.03240	-1.1057	10	0.32370	T	0.25	.	7.1499	0.25604	0.1383:0.0:0.7177:0.144	.	859	O60494	CUBN_HUMAN	I	859	ENSP00000367064:T859I	ENSP00000367064:T859I	T	-	2	0	CUBN	17153480	0.994000	0.37717	0.986000	0.45419	0.500000	0.33767	2.635000	0.46537	2.576000	0.86940	0.502000	0.49764	ACT	.	.		0.398	CUBN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047009.1	NM_001081	
NRP1	8829	hgsc.bcm.edu	37	10	33619799	33619799	+	Missense_Mutation	SNP	C	C	T	rs374276976		TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr10:33619799C>T	ENST00000265371.4	-	3	610	c.85G>A	c.(85-87)Gat>Aat	p.D29N	NRP1_ENST00000374823.5_Missense_Mutation_p.D29N|NRP1_ENST00000432372.2_Missense_Mutation_p.D29N|NRP1_ENST00000395995.1_Missense_Mutation_p.D29N|NRP1_ENST00000374875.1_5'UTR|NRP1_ENST00000374821.5_Missense_Mutation_p.D29N|NRP1_ENST00000374867.2_Missense_Mutation_p.D29N|NRP1_ENST00000374816.3_Missense_Mutation_p.D29N|NRP1_ENST00000374822.4_Missense_Mutation_p.D29N			O14786	NRP1_HUMAN	neuropilin 1	29	CUB 1. {ECO:0000255|PROSITE- ProRule:PRU00059}.				angiogenesis (GO:0001525)|angiogenesis involved in coronary vascular morphogenesis (GO:0060978)|artery morphogenesis (GO:0048844)|axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|axonogenesis involved in innervation (GO:0060385)|branchiomotor neuron axon guidance (GO:0021785)|cell adhesion (GO:0007155)|cell migration involved in sprouting angiogenesis (GO:0002042)|cell-cell signaling (GO:0007267)|cellular response to hepatocyte growth factor stimulus (GO:0035729)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|commissural neuron axon guidance (GO:0071679)|coronary artery morphogenesis (GO:0060982)|dendrite development (GO:0016358)|dichotomous subdivision of terminal units involved in salivary gland branching (GO:0060666)|endothelial cell chemotaxis (GO:0035767)|endothelial tip cell fate specification (GO:0097102)|facial nerve structural organization (GO:0021612)|gonadotrophin-releasing hormone neuronal migration to the hypothalamus (GO:0021828)|hepatocyte growth factor receptor signaling pathway (GO:0048012)|negative regulation of axon extension involved in axon guidance (GO:0048843)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of neuron apoptotic process (GO:0043524)|nerve development (GO:0021675)|neural crest cell migration involved in autonomic nervous system development (GO:1901166)|neuron migration (GO:0001764)|organ morphogenesis (GO:0009887)|patterning of blood vessels (GO:0001569)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive chemotaxis (GO:0050918)|positive regulation of axon extension involved in axon guidance (GO:0048842)|positive regulation of cytokine activity (GO:0060301)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of retinal ganglion cell axon guidance (GO:1902336)|positive regulation of smooth muscle cell migration (GO:0014911)|protein localization to early endosome (GO:1902946)|regulation of retinal ganglion cell axon guidance (GO:0090259)|regulation of vesicle-mediated transport (GO:0060627)|renal artery morphogenesis (GO:0061441)|response to wounding (GO:0009611)|retina vasculature morphogenesis in camera-type eye (GO:0061299)|retinal ganglion cell axon guidance (GO:0031290)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|semaphorin-plexin signaling pathway involved in neuron projection guidance (GO:1902285)|signal transduction (GO:0007165)|sprouting angiogenesis (GO:0002040)|sympathetic ganglion development (GO:0061549)|sympathetic neuron projection extension (GO:0097490)|sympathetic neuron projection guidance (GO:0097491)|trigeminal nerve structural organization (GO:0021637)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|VEGF-activated neuropilin signaling pathway (GO:0038190)|VEGF-activated neuropilin signaling pathway involved in axon guidance (GO:1902378)	axon (GO:0030424)|cell surface (GO:0009986)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|early endosome (GO:0005769)|extracellular space (GO:0005615)|focal adhesion (GO:0005925)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|neurofilament (GO:0005883)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|semaphorin receptor complex (GO:0002116)|sorting endosome (GO:0097443)	coreceptor activity (GO:0015026)|cytokine binding (GO:0019955)|growth factor binding (GO:0019838)|heparin binding (GO:0008201)|metal ion binding (GO:0046872)|semaphorin receptor activity (GO:0017154)|vascular endothelial growth factor binding (GO:0038085)|vascular endothelial growth factor-activated receptor activity (GO:0005021)			NS(2)|breast(6)|central_nervous_system(4)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(16)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|stomach(2)	48					Palifermin(DB00039)|Pegaptanib(DB04895)	TTTATAGTATCGCCACATTTA	0.373																																					p.D29N	Melanoma(104;886 1489 44640 45944 51153)	Atlas-SNP	.											.	NRP1	126	.	0			c.G85A						.	C	ASN/ASP,ASN/ASP,ASN/ASP	1,4405	2.1+/-5.4	0,1,2202	79.0	88.0	85.0		85,85,85	5.1	0.9	10		85	0,8598		0,0,4299	no	missense,missense,missense	NRP1	NM_001024628.2,NM_001024629.2,NM_003873.5	23,23,23	0,1,6501	TT,TC,CC		0.0,0.0227,0.0077	possibly-damaging,possibly-damaging,possibly-damaging	29/645,29/610,29/924	33619799	1,13003	2203	4299	6502	SO:0001583	missense	8829	exon2			TAGTATCGCCACA	AF016050	CCDS7177.1, CCDS31179.1, CCDS31180.1	10p12	2006-02-23			ENSG00000099250	ENSG00000099250		"""CD molecules"""	8004	protein-coding gene	gene with protein product		602069				9529250, 9331348	Standard	NM_003873		Approved	NRP, VEGF165R, CD304	uc001iwx.4	O14786	OTTHUMG00000019343	ENST00000265371.4:c.85G>A	chr10.hg19:g.33619799C>T	ENSP00000265371:p.Asp29Asn	117.0	0.0		148.0	28.0	NM_001244973	B0LPG9|O60461|Q5T7F1|Q5T7F2|Q5T7F3|Q86T59|Q96I90|Q96IH5	Missense_Mutation	SNP	ENST00000265371.4	hg19	CCDS7177.1	.	.	.	.	.	.	.	.	.	.	C	16.93	3.258284	0.59321	2.27E-4	0.0	ENSG00000099250	ENST00000265371;ENST00000374867;ENST00000395995;ENST00000374822;ENST00000374821;ENST00000374823;ENST00000374816	T;T;T;T;T;T;T	0.17854	2.25;2.25;2.25;2.25;2.25;2.25;2.25	5.99	5.09	0.68999	CUB (5);	0.242175	0.47455	N	0.000234	T	0.17874	0.0429	L	0.28344	0.845	0.47659	D	0.999481	P;P;D;B;B;B;P;P	0.55800	0.808;0.95;0.973;0.316;0.002;0.002;0.808;0.808	B;P;P;B;B;B;B;B	0.46585	0.305;0.521;0.521;0.146;0.002;0.004;0.305;0.305	T	0.01444	-1.1353	10	0.72032	D	0.01	-5.9915	15.2411	0.73471	0.0:0.9331:0.0:0.0669	.	29;29;29;29;29;29;29;29	A8K9V7;E7EX60;Q5T7F0;Q5T7F1;O14786-2;Q68DN3;O14786;E9PEP6	.;.;.;.;.;.;NRP1_HUMAN;.	N	29	ENSP00000265371:D29N;ENSP00000364001:D29N;ENSP00000379317:D29N;ENSP00000363955:D29N;ENSP00000363954:D29N;ENSP00000363956:D29N;ENSP00000363949:D29N	ENSP00000265371:D29N	D	-	1	0	NRP1	33659805	1.000000	0.71417	0.944000	0.38274	0.999000	0.98932	5.731000	0.68554	1.540000	0.49301	0.655000	0.94253	GAT	.	.		0.373	NRP1-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051203.2		
GPRIN2	9721	hgsc.bcm.edu	37	10	46999960	46999960	+	Silent	SNP	G	G	T			TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr10:46999960G>T	ENST00000374317.1	+	3	1353	c.1080G>T	c.(1078-1080)ctG>ctT	p.L360L	GPRIN2_ENST00000374314.4_Silent_p.L360L	NM_014696.3	NP_055511.2	O60269	GRIN2_HUMAN	G protein regulated inducer of neurite outgrowth 2	360										breast(2)|central_nervous_system(1)|endometrium(6)|kidney(1)|large_intestine(1)|lung(6)|prostate(1)	18						CTGCAGCCCTGCATGTGTTCC	0.667																																					p.L360L		Atlas-SNP	.											.	GPRIN2	94	.	0			c.G1080T						.						110.0	101.0	104.0					10																	46999960		2203	4300	6503	SO:0001819	synonymous_variant	9721	exon3			AGCCCTGCATGTG	BC011672	CCDS73101.1	10q11.22	2006-08-24	2006-08-24	2006-08-24	ENSG00000204175	ENSG00000204175			23730	protein-coding gene	gene with protein product		611240	"""KIAA0514"""	KIAA0514		9628581	Standard	NM_014696		Approved	MGC15171	uc001jec.3	O60269	OTTHUMG00000018107	ENST00000374317.1:c.1080G>T	chr10.hg19:g.46999960G>T		84.0	0.0		61.0	9.0	NM_014696	Q5SVF0	Silent	SNP	ENST00000374317.1	hg19	CCDS31192.1																																																																																			.	.		0.667	GPRIN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047836.1	NM_014696	
RBP3	5949	hgsc.bcm.edu	37	10	48383926	48383926	+	Missense_Mutation	SNP	T	T	G			TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr10:48383926T>G	ENST00000224600.4	-	3	3419	c.3306A>C	c.(3304-3306)gaA>gaC	p.E1102D		NM_002900.2	NP_002891.1	P10745	RET3_HUMAN	retinol binding protein 3, interstitial	1102	4 X approximate tandem repeats.				lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|transport (GO:0006810)|visual perception (GO:0007601)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|interphotoreceptor matrix (GO:0033165)|vesicle (GO:0031982)	retinal binding (GO:0016918)|retinoid binding (GO:0005501)|retinol binding (GO:0019841)|serine-type peptidase activity (GO:0008236)			central_nervous_system(3)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(30)|ovary(1)|prostate(7)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	59					Vitamin A(DB00162)	CTGGAGGGCCTTCATCAAAGA	0.547																																					p.E1102D		Atlas-SNP	.											.	RBP3	152	.	0			c.A3306C						.						122.0	100.0	108.0					10																	48383926		2203	4300	6503	SO:0001583	missense	5949	exon3			AGGGCCTTCATCA	M22453	CCDS73119.1	10q11.2	2014-05-06	2001-11-28		ENSG00000107618	ENSG00000265203			9921	protein-coding gene	gene with protein product		180290	"""retinol-binding protein 3, interstitial"""				Standard	NM_002900		Approved	D10S64, D10S65, D10S66, RP66	uc001jez.3	P10745	OTTHUMG00000188321	ENST00000224600.4:c.3306A>C	chr10.hg19:g.48383926T>G	ENSP00000224600:p.Glu1102Asp	136.0	0.0		78.0	26.0	NM_002900	Q0QD34|Q5VSR0|Q8IXN0	Missense_Mutation	SNP	ENST00000224600.4	hg19	CCDS7218.1	.	.	.	.	.	.	.	.	.	.	T	12.60	1.987859	0.35036	.	.	ENSG00000107618	ENST00000224600	T	0.63913	-0.07	5.44	0.427	0.16489	Interphotoreceptor retinol-binding (2);	0.187424	0.48286	D	0.000189	T	0.65281	0.2676	L	0.55743	1.74	0.32204	N	0.577401	D	0.63880	0.993	P	0.57620	0.824	T	0.69465	-0.5138	10	0.66056	D	0.02	-18.6071	8.4746	0.33005	0.0:0.354:0.0:0.646	.	1102	P10745	RET3_HUMAN	D	1102	ENSP00000224600:E1102D	ENSP00000224600:E1102D	E	-	3	2	RBP3	48003932	0.994000	0.37717	0.461000	0.27105	0.421000	0.31385	0.163000	0.16520	-0.169000	0.10834	-0.379000	0.06801	GAA	.	.		0.547	RBP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047888.1	NM_002900	
OBFC1	79991	hgsc.bcm.edu	37	10	105658711	105658711	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr10:105658711C>T	ENST00000224950.3	-	6	672	c.505G>A	c.(505-507)Gag>Aag	p.E169K	OBFC1_ENST00000466828.1_5'UTR|OBFC1_ENST00000369764.1_Missense_Mutation_p.E169K	NM_024928.4	NP_079204.2	Q9H668	STN1_HUMAN	oligonucleotide/oligosaccharide-binding fold containing 1	169					positive regulation of DNA replication (GO:0045740)|telomere maintenance (GO:0000723)|telomere maintenance via telomere lengthening (GO:0010833)	intermediate filament cytoskeleton (GO:0045111)|intracellular membrane-bounded organelle (GO:0043231)|nuclear chromosome, telomeric region (GO:0000784)|nucleolus (GO:0005730)|nucleus (GO:0005634)|Stn1-Ten1 complex (GO:0070188)	single-stranded DNA binding (GO:0003697)|single-stranded telomeric DNA binding (GO:0043047)			large_intestine(3)|lung(7)|ovary(1)|pancreas(2)	13		Colorectal(252;0.178)		Epithelial(162;3.39e-10)|all cancers(201;1.32e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0151)		GTGGGCAGCTCAAGCATCCTT	0.418																																					p.E169K		Atlas-SNP	.											.	OBFC1	33	.	0			c.G505A						.						134.0	121.0	125.0					10																	105658711		2203	4300	6503	SO:0001583	missense	79991	exon6			GCAGCTCAAGCAT	BC017400	CCDS7552.1	10q25.1	2011-06-14				ENSG00000107960			26200	protein-coding gene	gene with protein product		613128				12477932	Standard	NM_024928		Approved	FLJ22559, bA541N10.2	uc001kxm.3	Q9H668		ENST00000224950.3:c.505G>A	chr10.hg19:g.105658711C>T	ENSP00000224950:p.Glu169Lys	132.0	0.0		79.0	23.0	NM_024928	D3DR99|Q5TCZ0	Missense_Mutation	SNP	ENST00000224950.3	hg19	CCDS7552.1	.	.	.	.	.	.	.	.	.	.	C	24.2	4.507558	0.85282	.	.	ENSG00000107960	ENST00000224950;ENST00000369764	T;T	0.54071	0.59;0.59	5.79	5.79	0.91817	Nucleic acid-binding, OB-fold-like (1);Domain of unknown function DUF1879, CTS complex STN1 subunit (1);	0.095986	0.64402	D	0.000001	T	0.70168	0.3193	M	0.66506	2.035	0.53005	D	0.999964	D	0.76494	0.999	D	0.74674	0.984	T	0.69975	-0.4999	10	0.51188	T	0.08	-22.9178	15.531	0.75960	0.0:1.0:0.0:0.0	.	169	Q9H668	STN1_HUMAN	K	169	ENSP00000224950:E169K;ENSP00000358779:E169K	ENSP00000224950:E169K	E	-	1	0	OBFC1	105648701	0.998000	0.40836	0.999000	0.59377	0.995000	0.86356	3.464000	0.53057	2.734000	0.93682	0.555000	0.69702	GAG	.	.		0.418	OBFC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050174.1	NM_024928	
ZRANB1	54764	hgsc.bcm.edu	37	10	126631222	126631222	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr10:126631222G>T	ENST00000359653.4	+	1	531	c.160G>T	c.(160-162)Gat>Tat	p.D54Y	RP11-298J20.4_ENST00000508096.1_RNA|RP11-298J20.3_ENST00000449984.1_RNA	NM_017580.2	NP_060050.2	Q9UGI0	ZRAN1_HUMAN	zinc finger, RAN-binding domain containing 1	54					cell migration (GO:0016477)|cytoskeleton organization (GO:0007010)|positive regulation of Wnt signaling pathway (GO:0030177)|protein deubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0071947)|protein K29-linked deubiquitination (GO:0035523)|protein K33-linked deubiquitination (GO:1990168)|protein K63-linked deubiquitination (GO:0070536)|regulation of cell morphogenesis (GO:0022604)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	K63-linked polyubiquitin binding (GO:0070530)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(5)|kidney(5)|large_intestine(2)|lung(3)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	23		all_lung(145;0.0132)|Lung NSC(174;0.0193)|all_neural(114;0.116)|Colorectal(57;0.172)		Colorectal(40;0.113)|COAD - Colon adenocarcinoma(40;0.119)		TAGAGATTGGGATCCTTCCAG	0.413																																					p.D54Y		Atlas-SNP	.											.	ZRANB1	60	.	0			c.G160T						.						155.0	143.0	147.0					10																	126631222		2203	4300	6503	SO:0001583	missense	54764	exon1			GATTGGGATCCTT	AJ252060	CCDS7642.1	10q26.12	2014-02-24			ENSG00000019995	ENSG00000019995		"""Zinc fingers, RAN-binding domain containing"", ""OTU domain containing"""	18224	protein-coding gene	gene with protein product		611749				11463333	Standard	NM_017580		Approved	TRABID	uc001lic.3	Q9UGI0	OTTHUMG00000019223	ENST00000359653.4:c.160G>T	chr10.hg19:g.126631222G>T	ENSP00000352676:p.Asp54Tyr	219.0	0.0		123.0	11.0	NM_017580	B4DZ98|D3DRF4|Q5SQP6|Q69YK3	Missense_Mutation	SNP	ENST00000359653.4	hg19	CCDS7642.1	.	.	.	.	.	.	.	.	.	.	G	13.68	2.310539	0.40895	.	.	ENSG00000019995	ENST00000359653	T	0.18502	2.21	5.81	4.91	0.64330	.	0.170149	0.50627	D	0.000113	T	0.12390	0.0301	N	0.22421	0.69	0.47994	D	0.999563	P	0.44090	0.826	B	0.38562	0.276	T	0.04811	-1.0925	10	0.46703	T	0.11	-29.6117	13.077	0.59093	0.0743:0.0:0.9257:0.0	.	54	Q9UGI0	ZRAN1_HUMAN	Y	54	ENSP00000352676:D54Y	ENSP00000352676:D54Y	D	+	1	0	ZRANB1	126621212	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.845000	0.69437	1.457000	0.47850	0.655000	0.94253	GAT	.	.		0.413	ZRANB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050898.1	NM_017580	
OR51A7	119687	hgsc.bcm.edu	37	11	4929380	4929380	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr11:4929380C>T	ENST00000359350.4	+	1	781	c.781C>T	c.(781-783)Cat>Tat	p.H261Y	MMP26_ENST00000477339.1_Intron|MMP26_ENST00000380390.1_Intron	NM_001004749.1	NP_001004749.1	Q8NH64	O51A7_HUMAN	olfactory receptor, family 51, subfamily A, member 7	261						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(1)|large_intestine(7)|lung(13)|ovary(1)|skin(4)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	33		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;4.77e-12)|BRCA - Breast invasive adenocarcinoma(625;0.00435)|LUSC - Lung squamous cell carcinoma(625;0.19)		GGCTGCCATGCATCACTTTGC	0.488																																					p.H261Y		Atlas-SNP	.											.	OR51A7	86	.	0			c.C781T						.						222.0	214.0	216.0					11																	4929380		2201	4298	6499	SO:0001583	missense	119687	exon1			GCCATGCATCACT	AB065525	CCDS31364.1	11p15.4	2012-08-09			ENSG00000176895	ENSG00000176895		"""GPCR / Class A : Olfactory receptors"""	15188	protein-coding gene	gene with protein product							Standard	NM_001004749		Approved		uc010qyq.2	Q8NH64	OTTHUMG00000066502	ENST00000359350.4:c.781C>T	chr11.hg19:g.4929380C>T	ENSP00000352305:p.His261Tyr	97.0	0.0		84.0	34.0	NM_001004749	Q6IFH8	Missense_Mutation	SNP	ENST00000359350.4	hg19	CCDS31364.1	.	.	.	.	.	.	.	.	.	.	C	12.26	1.884265	0.33255	.	.	ENSG00000176895	ENST00000359350;ENST00000545959;ENST00000544684	T	0.71934	-0.61	5.02	4.11	0.48088	GPCR, rhodopsin-like superfamily (1);	0.000000	0.48767	D	0.000164	T	0.69052	0.3068	M	0.61703	1.905	0.09310	N	1	B	0.20052	0.041	B	0.28991	0.097	T	0.64715	-0.6342	10	0.62326	D	0.03	.	12.2195	0.54425	0.0:0.9172:0.0:0.0828	.	261	Q8NH64	O51A7_HUMAN	Y	261;261;250	ENSP00000352305:H261Y	ENSP00000352305:H261Y	H	+	1	0	OR51A7	4885956	0.000000	0.05858	0.983000	0.44433	0.983000	0.72400	0.573000	0.23699	1.340000	0.45581	0.655000	0.94253	CAT	.	.		0.488	OR51A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142175.1	NM_001004749	
TRIM51	84767	hgsc.bcm.edu	37	11	55655563	55655563	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr11:55655563C>A	ENST00000449290.2	+	4	655	c.563C>A	c.(562-564)gCa>gAa	p.A188E	TRIM51_ENST00000244891.3_Missense_Mutation_p.A45E	NM_032681.3	NP_116070.2	Q9BSJ1	TRI51_HUMAN	tripartite motif-containing 51	188						intracellular (GO:0005622)	zinc ion binding (GO:0008270)										AAGATGCCTGCATTTCTCCAT	0.403																																					p.A188E		Atlas-SNP	.											.	.	.	.	0			c.C563A						.						36.0	35.0	36.0					11																	55655563		2201	4293	6494	SO:0001583	missense	84767	exon4			TGCCTGCATTTCT	BC005014		11p11	2013-01-09	2012-05-18	2012-05-18	ENSG00000124900	ENSG00000124900		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	19023	protein-coding gene	gene with protein product			"""SPRY domain containing 5"""	SPRYD5			Standard	NM_032681		Approved	TRIM51A	uc010rip.2	Q9BSJ1	OTTHUMG00000156437	ENST00000449290.2:c.563C>A	chr11.hg19:g.55655563C>A	ENSP00000395086:p.Ala188Glu	379.0	0.0		397.0	112.0	NM_032681	A6NMG2	Missense_Mutation	SNP	ENST00000449290.2	hg19		.	.	.	.	.	.	.	.	.	.	.	0.006	-2.040004	0.00402	.	.	ENSG00000124900	ENST00000449290;ENST00000244891	T;T	0.04758	3.56;3.56	.	.	.	.	.	.	.	.	T	0.05547	0.0146	M	0.79475	2.455	0.09310	N	1	B	0.24618	0.107	B	0.28784	0.094	T	0.50857	-0.8778	7	0.02654	T	1	.	.	.	.	.	188	Q9BSJ1	SPRY5_HUMAN	E	188;45	ENSP00000395086:A188E;ENSP00000244891:A45E	ENSP00000244891:A45E	A	+	2	0	SPRYD5	55412139	0.010000	0.17322	0.002000	0.10522	0.601000	0.36947	-0.452000	0.06787	-0.673000	0.05259	0.152000	0.16155	GCA	.	.		0.403	TRIM51-004	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000391522.1	NM_032681	
AHNAK	79026	hgsc.bcm.edu	37	11	62288122	62288122	+	Silent	SNP	C	C	T			TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr11:62288122C>T	ENST00000378024.4	-	5	14041	c.13767G>A	c.(13765-13767)aaG>aaA	p.K4589K	AHNAK_ENST00000257247.7_Intron|AHNAK_ENST00000530124.1_Intron	NM_001620.1	NP_001611.1	Q09666	AHNK_HUMAN	AHNAK nucleoprotein	4589					protein oligomerization (GO:0051259)|regulation of RNA splicing (GO:0043484)|regulation of voltage-gated calcium channel activity (GO:1901385)	actin cytoskeleton (GO:0015629)|cell-cell contact zone (GO:0044291)|costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|vesicle (GO:0031982)	poly(A) RNA binding (GO:0044822)|S100 protein binding (GO:0044548)|structural molecule activity conferring elasticity (GO:0097493)			NS(3)|autonomic_ganglia(1)|breast(10)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(33)|large_intestine(40)|liver(1)|lung(108)|ovary(13)|pancreas(4)|prostate(5)|skin(16)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	268		Melanoma(852;0.155)				TCTTCGGTGCCTTGAGGTGTA	0.483																																					p.K4589K		Atlas-SNP	.											.	AHNAK	532	.	0			c.G13767A						.						102.0	102.0	102.0					11																	62288122		2202	4299	6501	SO:0001819	synonymous_variant	79026	exon5			CGGTGCCTTGAGG	M80899	CCDS31584.1, CCDS44625.1	11q12-q13	2008-02-05	2007-03-30		ENSG00000124942	ENSG00000124942			347	protein-coding gene	gene with protein product	"""desmoyokin"""	103390	"""AHNAK nucleoprotein (desmoyokin)"""			7987395, 12153988	Standard	NM_024060		Approved	MGC5395	uc001ntl.3	Q09666	OTTHUMG00000167558	ENST00000378024.4:c.13767G>A	chr11.hg19:g.62288122C>T		98.0	0.0		90.0	20.0	NM_001620	A1A586	Silent	SNP	ENST00000378024.4	hg19	CCDS31584.1																																																																																			.	.		0.483	AHNAK-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395572.1	NM_024060	
TUT1	64852	hgsc.bcm.edu	37	11	62344401	62344401	+	Silent	SNP	C	C	A			TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr11:62344401C>A	ENST00000476907.1	-	7	2050	c.1359G>T	c.(1357-1359)gtG>gtT	p.V453V	MIR3654_ENST00000496634.2_Silent_p.V453V|EEF1G_ENST00000329251.4_5'Flank|EEF1G_ENST00000378019.3_5'Flank|EEF1G_ENST00000532986.1_5'Flank|TUT1_ENST00000308436.7_Silent_p.V491V			Q9H6E5	STPAP_HUMAN	terminal uridylyl transferase 1, U6 snRNA-specific	453					mRNA cleavage (GO:0006379)|mRNA polyadenylation (GO:0006378)|snRNA processing (GO:0016180)	intercellular bridge (GO:0045171)|nuclear speck (GO:0016607)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|enzyme binding (GO:0019899)|metal ion binding (GO:0046872)|mRNA 3'-UTR binding (GO:0003730)|polynucleotide adenylyltransferase activity (GO:0004652)|RNA binding (GO:0003723)|RNA uridylyltransferase activity (GO:0050265)			breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(3)|lung(15)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	29						TGAGCTGGGACACAGTGGGCA	0.522																																					p.V491V		Atlas-SNP	.											.	TUT1	122	.	0			c.G1473T						.						68.0	70.0	69.0					11																	62344401		2202	4299	6501	SO:0001819	synonymous_variant	64852	exon7			CTGGGACACAGTG	BC005013	CCDS8021.1, CCDS8021.2	11q12.2	2014-03-05	2006-10-06	2006-10-06	ENSG00000149016	ENSG00000149016	2.7.7.52	"""RNA binding motif (RRM) containing"""	26184	protein-coding gene	gene with protein product	"""RNA uridylyltransferase"", ""U6 TUTase"", ""TUTase 6"""	610641	"""RNA binding motif protein 21"""	RBM21		16790842	Standard	NM_022830		Approved	FLJ22347, FLJ22267, FLJ21850, PAPD2, TUTase	uc001nto.2	Q9H6E5	OTTHUMG00000158564	ENST00000476907.1:c.1359G>T	chr11.hg19:g.62344401C>A		157.0	0.0		137.0	35.0	NM_022830	A1A527|A8K995|Q2NL65|Q7L583|Q9H6H7	Silent	SNP	ENST00000476907.1	hg19																																																																																				.	.		0.522	TUT1-001	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000351319.2	NM_022830	
MACROD1	28992	hgsc.bcm.edu	37	11	63883778	63883778	+	Intron	SNP	G	G	A	rs575714111		TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr11:63883778G>A	ENST00000255681.6	-	3	584				RP11-21A7A.3_ENST00000543817.1_RNA|FLRT1_ENST00000246841.3_Silent_p.T13T	NM_014067.3	NP_054786.2	Q9BQ69	MACD1_HUMAN	MACRO domain containing 1						cellular response to DNA damage stimulus (GO:0006974)|protein de-ADP-ribosylation (GO:0051725)|purine nucleoside metabolic process (GO:0042278)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	deacetylase activity (GO:0019213)|hydrolase activity, acting on glycosyl bonds (GO:0016798)			breast(1)|large_intestine(3)|lung(6)|skin(1)	11						ccaccaccacgcccactgcca	0.672																																					p.T13T		Atlas-SNP	.											.	FLRT1	46	.	0			c.G39A						.						63.0	37.0	46.0					11																	63883778		2200	4297	6497	SO:0001627	intron_variant	23769	exon2			CACCACGCCCACT	AF202922	CCDS8056.1	11q13.1	2007-07-24	2007-06-11		ENSG00000133315	ENSG00000133315			29598	protein-coding gene	gene with protein product		610400				15691879	Standard	NM_014067		Approved	LRP16	uc001nyh.3	Q9BQ69	OTTHUMG00000167843	ENST00000255681.6:c.517+34932C>T	chr11.hg19:g.63883778G>A		31.0	0.0		29.0	8.0	NM_013280	Q9UH96	Silent	SNP	ENST00000255681.6	hg19	CCDS8056.1																																																																																			.	.		0.672	MACROD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396570.1	NM_014067	
RPS6KA4	8986	hgsc.bcm.edu	37	11	64138858	64138858	+	Missense_Mutation	SNP	G	G	T	rs111697527		TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr11:64138858G>T	ENST00000334205.4	+	17	2290	c.2225G>T	c.(2224-2226)cGc>cTc	p.R742L	MIR1237_ENST00000408346.1_RNA|RPS6KA4_ENST00000528057.1_Missense_Mutation_p.R735L|RPS6KA4_ENST00000294261.4_Missense_Mutation_p.R494L	NM_003942.2	NP_003933.1	O75676	KS6A4_HUMAN	ribosomal protein S6 kinase, 90kDa, polypeptide 4	742	Required for nuclear targeting and association with MAPK14.				axon guidance (GO:0007411)|histone H3-S10 phosphorylation (GO:0043987)|histone H3-S28 phosphorylation (GO:0043988)|histone phosphorylation (GO:0016572)|inflammatory response (GO:0006954)|interleukin-1-mediated signaling pathway (GO:0070498)|intracellular signal transduction (GO:0035556)|negative regulation of cytokine production (GO:0001818)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of histone acetylation (GO:0035066)|positive regulation of histone phosphorylation (GO:0033129)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein phosphorylation (GO:0006468)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|mitogen-activated protein kinase p38 binding (GO:0048273)|protein serine/threonine kinase activity (GO:0004674)|ribosomal protein S6 kinase activity (GO:0004711)			breast(1)|endometrium(3)|lung(7)|ovary(1)|prostate(1)	13						ACCGCCTCCCGCCGGGGCTCC	0.726																																					p.R742L		Atlas-SNP	.											.	RPS6KA4	85	.	0			c.G2225T						.						15.0	19.0	18.0					11																	64138858		2025	4020	6045	SO:0001583	missense	8986	exon17			CCTCCCGCCGGGG	AJ010119	CCDS8073.1, CCDS73313.1	11q11-q13	2011-04-05	2002-08-29		ENSG00000162302	ENSG00000162302			10433	protein-coding gene	gene with protein product		603606	"""ribosomal protein S6 kinase, 90kD, polypeptide 4"""			9792677, 9687510	Standard	XM_005274379		Approved	RSK-B, MSK2	uc001oae.3	O75676	OTTHUMG00000046094	ENST00000334205.4:c.2225G>T	chr11.hg19:g.64138858G>T	ENSP00000333896:p.Arg742Leu	169.0	0.0		126.0	22.0	NM_003942	A8K7Z8|O75585|Q53ES8	Missense_Mutation	SNP	ENST00000334205.4	hg19	CCDS8073.1	.	.	.	.	.	.	.	.	.	.	g	18.60	3.658420	0.67586	.	.	ENSG00000162302	ENST00000528057;ENST00000334205;ENST00000294261	T;T;T	0.68479	-0.33;-0.27;-0.32	4.72	4.72	0.59763	.	0.250878	0.32918	N	0.005482	T	0.61553	0.2356	L	0.58101	1.795	0.33638	D	0.606918	P;P;B;P	0.52170	0.773;0.918;0.026;0.951	B;B;B;B	0.38264	0.269;0.139;0.008;0.269	T	0.78104	-0.2334	10	0.87932	D	0	.	15.1434	0.72630	0.0:0.0:1.0:0.0	.	494;735;742;736	G3XAA9;E9PJN1;O75676;O75676-2	.;.;KS6A4_HUMAN;.	L	735;742;494	ENSP00000435580:R735L;ENSP00000333896:R742L;ENSP00000294261:R494L	ENSP00000294261:R494L	R	+	2	0	RPS6KA4	63895434	1.000000	0.71417	0.718000	0.30602	0.213000	0.24496	4.546000	0.60705	2.150000	0.67090	0.491000	0.48974	CGC	.	T|1.000;|0.000		0.726	RPS6KA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000106246.2	NM_003942	
VPS51	738	hgsc.bcm.edu	37	11	64863897	64863897	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr11:64863897G>T	ENST00000279281.3	+	1	267	c.175G>T	c.(175-177)Gac>Tac	p.D59Y		NM_013265.2	NP_037397.2	Q9UID3	VPS51_HUMAN	vacuolar protein sorting 51 homolog (S. cerevisiae)	59					autophagy (GO:0006914)|lipid transport (GO:0006869)|protein transport (GO:0015031)|retrograde transport, endosome to Golgi (GO:0042147)	GARP complex (GO:0000938)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)											CGACCCCCTGGACCCGACTGA	0.701																																					p.D59Y		Atlas-SNP	.											.	.	.	.	0			c.G175T						.						5.0	7.0	7.0					11																	64863897		2031	4084	6115	SO:0001583	missense	738	exon1			CCCCTGGACCCGA	AF024631	CCDS8093.1	11q13.1	2012-07-19	2012-07-19	2012-07-19	ENSG00000149823	ENSG00000149823			1172	protein-coding gene	gene with protein product	"""fat-free homolog (zebrafish)"""	615738	"""chromosome 11 open reading frame 3"", ""chromosome 11 open reading frame 2"""	C11orf3, C11orf2		9286704, 20685960	Standard	NM_013265		Approved	ANG2, ANG3, FFR	uc001ocr.2	Q9UID3	OTTHUMG00000165600	ENST00000279281.3:c.175G>T	chr11.hg19:g.64863897G>T	ENSP00000279281:p.Asp59Tyr	155.0	0.0		141.0	44.0	NM_013265	Q6PJV5|Q7L8A6|Q8WZ35|Q96DF4|Q96GR3	Missense_Mutation	SNP	ENST00000279281.3	hg19	CCDS8093.1	.	.	.	.	.	.	.	.	.	.	G	34	5.378941	0.95945	.	.	ENSG00000149823	ENST00000528588;ENST00000530773;ENST00000279281;ENST00000529180	.	.	.	5.34	5.34	0.76211	.	0.052577	0.85682	D	0.000000	T	0.55097	0.1899	N	0.19112	0.55	0.80722	D	1	D	0.67145	0.996	P	0.61201	0.885	T	0.58702	-0.7590	9	0.66056	D	0.02	-16.66	14.3843	0.66934	0.0:0.0:1.0:0.0	.	59	Q9UID3	FFR_HUMAN	Y	89;59;59;59	.	ENSP00000279281:D59Y	D	+	1	0	C11orf2	64620473	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	8.553000	0.90686	2.773000	0.95371	0.655000	0.94253	GAC	.	.		0.701	VPS51-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385217.1	NM_013265	
C2CD3	26005	hgsc.bcm.edu	37	11	73760482	73760482	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr11:73760482C>A	ENST00000334126.7	-	27	5487	c.5261G>T	c.(5260-5262)tGc>tTc	p.C1754F	C2CD3_ENST00000313663.7_Missense_Mutation_p.C1754F			Q4AC94	C2CD3_HUMAN	C2 calcium-dependent domain containing 3	1754					brain development (GO:0007420)|centriole elongation (GO:0061511)|embryonic digit morphogenesis (GO:0042733)|heart looping (GO:0001947)|in utero embryonic development (GO:0001701)|neural plate axis specification (GO:0021997)|neural tube development (GO:0021915)|nonmotile primary cilium assembly (GO:0035058)|protein localization to centrosome (GO:0071539)|protein processing (GO:0016485)|regulation of proteolysis (GO:0030162)|regulation of smoothened signaling pathway (GO:0008589)	centriolar satellite (GO:0034451)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)				NS(1)|breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(16)|lung(26)|ovary(4)|pancreas(2)|prostate(1)|skin(3)	64	Breast(11;4.16e-06)					CTGCCCCTGGCACTCTCCACT	0.512																																					p.C1754F		Atlas-SNP	.											.	C2CD3	288	.	0			c.G5261T						.						92.0	78.0	83.0					11																	73760482		2200	4293	6493	SO:0001583	missense	26005	exon27			CCCTGGCACTCTC	BC035599	CCDS31636.1, CCDS66167.1	11q13.4	2014-02-12	2007-10-17		ENSG00000168014	ENSG00000168014			24564	protein-coding gene	gene with protein product		615944					Standard	XM_005273897		Approved	DKFZP586P0123	uc001ouu.2	Q4AC94	OTTHUMG00000168110	ENST00000334126.7:c.5261G>T	chr11.hg19:g.73760482C>A	ENSP00000334379:p.Cys1754Phe	99.0	0.0		90.0	28.0	NM_015531	C9JR55|E2QRD1|Q2NLE1|Q3C1U9|Q6ZU92|Q8IYM4|Q8NB87|Q8NDH7|Q9Y4M2	Missense_Mutation	SNP	ENST00000334126.7	hg19		.	.	.	.	.	.	.	.	.	.	C	26.4	4.729858	0.89390	.	.	ENSG00000168014	ENST00000334126;ENST00000313663;ENST00000313681;ENST00000414160	T;T;T	0.40476	1.03;1.03;1.03	5.58	5.58	0.84498	.	0.000000	0.85682	D	0.000000	T	0.68540	0.3012	M	0.81802	2.56	0.58432	D	0.999998	D	0.71674	0.998	D	0.81914	0.995	T	0.72218	-0.4357	10	0.87932	D	0	-7.4595	19.1566	0.93514	0.0:1.0:0.0:0.0	.	1754	Q4AC94-1	.	F	1754;1754;1735;562	ENSP00000334379:C1754F;ENSP00000323339:C1754F;ENSP00000388750:C562F	ENSP00000323339:C1754F	C	-	2	0	C2CD3	73438130	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.796000	0.85898	2.632000	0.89209	0.655000	0.94253	TGC	.	.		0.512	C2CD3-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_015531	
OR10G9	219870	hgsc.bcm.edu	37	11	123893761	123893761	+	Silent	SNP	C	C	A			TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr11:123893761C>A	ENST00000375024.1	+	1	42	c.42C>A	c.(40-42)ggC>ggA	p.G14G		NM_001001953.1	NP_001001953.1	Q8NGN4	O10G9_HUMAN	olfactory receptor, family 10, subfamily G, member 9	14						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(33)|prostate(2)|skin(4)|stomach(8)|urinary_tract(1)	61		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0399)		TCCTCACGGGCCTTCCCCATG	0.567																																					p.G14G		Atlas-SNP	.											.	OR10G9	80	.	0			c.C42A						.						183.0	177.0	179.0					11																	123893761		2201	4299	6500	SO:0001819	synonymous_variant	219870	exon1			CACGGGCCTTCCC	AB065756	CCDS31703.1	11q24.1	2012-08-09			ENSG00000236981	ENSG00000236981		"""GPCR / Class A : Olfactory receptors"""	15129	protein-coding gene	gene with protein product				OR10G10P			Standard	NM_001001953		Approved		uc010sad.2	Q8NGN4	OTTHUMG00000165967	ENST00000375024.1:c.42C>A	chr11.hg19:g.123893761C>A		215.0	0.0		220.0	46.0	NM_001001953		Silent	SNP	ENST00000375024.1	hg19	CCDS31703.1																																																																																			.	.		0.567	OR10G9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387269.1	NM_001001953	
OR8A1	390275	hgsc.bcm.edu	37	11	124440061	124440061	+	Missense_Mutation	SNP	G	G	C			TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr11:124440061G>C	ENST00000284287.3	+	1	169	c.97G>C	c.(97-99)Ggt>Cgt	p.G33R		NM_001005194.1	NP_001005194.1	Q8NGG7	OR8A1_HUMAN	olfactory receptor, family 8, subfamily A, member 1	33					axon guidance (GO:0007411)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			haematopoietic_and_lymphoid_tissue(1)|lung(16)|ovary(2)|prostate(1)|skin(2)	22		Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0214)		CATTCTCAAGGGTTTAACGAA	0.522																																					p.G33R		Atlas-SNP	.											.	OR8A1	61	.	0			c.G97C						.						91.0	85.0	87.0					11																	124440061		2201	4299	6500	SO:0001583	missense	390275	exon1			CTCAAGGGTTTAA	BK004495	CCDS31712.1	11q24.2	2012-08-09			ENSG00000196119	ENSG00000196119		"""GPCR / Class A : Olfactory receptors"""	8469	protein-coding gene	gene with protein product							Standard	NM_001005194		Approved	OST025	uc010san.2	Q8NGG7	OTTHUMG00000165923	ENST00000284287.3:c.97G>C	chr11.hg19:g.124440061G>C	ENSP00000284287:p.Gly33Arg	86.0	0.0		72.0	15.0	NM_001005194	Q6IEW7|Q96RC6	Missense_Mutation	SNP	ENST00000284287.3	hg19	CCDS31712.1	.	.	.	.	.	.	.	.	.	.	G	15.17	2.753271	0.49362	.	.	ENSG00000196119	ENST00000284287	T	0.00659	5.94	5.08	5.08	0.68730	.	0.000000	0.44902	D	0.000407	T	0.07279	0.0184	M	0.93016	3.37	0.58432	D	0.999993	D	0.89917	1.0	D	0.79784	0.993	T	0.01081	-1.1458	10	0.87932	D	0	.	18.2469	0.89989	0.0:0.0:1.0:0.0	.	33	Q8NGG7	OR8A1_HUMAN	R	33	ENSP00000284287:G33R	ENSP00000284287:G33R	G	+	1	0	OR8A1	123945271	0.999000	0.42202	0.152000	0.22495	0.007000	0.05969	3.710000	0.54860	2.636000	0.89361	0.585000	0.79938	GGT	.	.		0.522	OR8A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387062.1	NM_001005194	
PRMT8	56341	hgsc.bcm.edu	37	12	3701519	3701519	+	Splice_Site	SNP	G	G	A			TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr12:3701519G>A	ENST00000382622.3	+	9	1491		c.e9+1		PRMT8_ENST00000452611.2_Splice_Site|PRMT8_ENST00000261252.4_Splice_Site	NM_019854.4	NP_062828.3	Q9NR22	ANM8_HUMAN	protein arginine methyltransferase 8						histone arginine methylation (GO:0034969)|histone H4-R3 methylation (GO:0043985)|histone methylation (GO:0016571)|peptidyl-arginine methylation (GO:0018216)|peptidyl-arginine methylation, to asymmetrical-dimethyl arginine (GO:0019919)|regulation of protein binding (GO:0043393)|regulation of transcription, DNA-templated (GO:0006355)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	histone methyltransferase activity (H4-R3 specific) (GO:0044020)|histone-arginine N-methyltransferase activity (GO:0008469)|identical protein binding (GO:0042802)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein-arginine omega-N asymmetric methyltransferase activity (GO:0035242)|protein-arginine omega-N monomethyltransferase activity (GO:0035241)|S-adenosylmethionine-dependent methyltransferase activity (GO:0008757)			breast(1)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(9)|lung(14)|ovary(3)|skin(5)|upper_aerodigestive_tract(1)	37			OV - Ovarian serous cystadenocarcinoma(31;0.0109)|COAD - Colon adenocarcinoma(12;0.0264)			CAAAAATGTGGTAAGTGCCGA	0.532																																					.		Atlas-SNP	.											.	PRMT8	97	.	0			c.1074+1G>A						.						65.0	66.0	66.0					12																	3701519		2203	4300	6503	SO:0001630	splice_region_variant	56341	exon9			AATGTGGTAAGTG	AF263539	CCDS8521.2, CCDS58200.1	12p13.3	2006-03-03	2006-02-16	2006-02-16	ENSG00000111218	ENSG00000111218		"""Protein arginine methyltransferases"""	5188	protein-coding gene	gene with protein product		610086	"""HMT1 hnRNP methyltransferase-like 3 (S. cerevisiae)"", ""HMT1 hnRNP methyltransferase-like 4 (S. cerevisiae)"""	HRMT1L3, HRMT1L4		16051612	Standard	NM_019854		Approved		uc001qmf.4	Q9NR22	OTTHUMG00000128493	ENST00000382622.3:c.1101+1G>A	chr12.hg19:g.3701519G>A		76.0	0.0		66.0	17.0	NM_001256536	B2RDP0|Q8TBJ8	Splice_Site	SNP	ENST00000382622.3	hg19	CCDS8521.2	.	.	.	.	.	.	.	.	.	.	G	26.8	4.773810	0.90108	.	.	ENSG00000111218	ENST00000452611;ENST00000382622	.	.	.	5.38	5.38	0.77491	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.6208	0.84929	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	PRMT8	3571780	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	9.797000	0.99108	2.509000	0.84616	0.655000	0.94253	.	.	.		0.532	PRMT8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250297.2	NM_019854	Intron
PZP	5858	hgsc.bcm.edu	37	12	9349002	9349002	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr12:9349002A>T	ENST00000261336.2	-	10	1044	c.1016T>A	c.(1015-1017)aTc>aAc	p.I339N	PZP_ENST00000381997.2_Missense_Mutation_p.I208N	NM_002864.2	NP_002855.2	P20742	PZP_HUMAN	pregnancy-zone protein	339					female pregnancy (GO:0007565)|negative regulation of endopeptidase activity (GO:0010951)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	endopeptidase inhibitor activity (GO:0004866)|serine-type endopeptidase inhibitor activity (GO:0004867)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(21)|lung(46)|ovary(3)|prostate(2)|skin(6)|stomach(3)|upper_aerodigestive_tract(5)	102						AATGTTTGTGATTTCACTGAT	0.343																																					p.I339N	Melanoma(125;1402 1695 4685 34487 38571)	Atlas-SNP	.											.	PZP	422	.	0			c.T1016A						.						116.0	106.0	109.0					12																	9349002		2203	4300	6503	SO:0001583	missense	5858	exon10			TTTGTGATTTCAC	X54380, M24416, X51541	CCDS8600.1	12p13-p12.2	2008-02-01			ENSG00000126838	ENSG00000126838			9750	protein-coding gene	gene with protein product		176420					Standard	NM_002864		Approved	CPAMD6	uc001qvl.3	P20742	OTTHUMG00000154915	ENST00000261336.2:c.1016T>A	chr12.hg19:g.9349002A>T	ENSP00000261336:p.Ile339Asn	62.0	0.0		54.0	8.0	NM_002864	A6ND27|Q15273|Q2NKL2|Q7M4N7	Missense_Mutation	SNP	ENST00000261336.2	hg19	CCDS8600.1	.	.	.	.	.	.	.	.	.	.	A	15.91	2.970919	0.53614	.	.	ENSG00000126838	ENST00000261336;ENST00000381997	T;T	0.46451	1.08;0.87	3.12	3.12	0.35913	.	0.222679	0.29417	U	0.012220	T	0.66167	0.2762	M	0.90145	3.09	0.23304	N	0.997941	D;D	0.89917	1.0;0.992	D;P	0.85130	0.997;0.864	T	0.57458	-0.7808	10	0.87932	D	0	.	8.3273	0.32165	1.0:0.0:0.0:0.0	.	208;339	P20742-2;P20742	.;PZP_HUMAN	N	339;208	ENSP00000261336:I339N;ENSP00000371427:I208N	ENSP00000261336:I339N	I	-	2	0	PZP	9240269	0.975000	0.34042	0.898000	0.35279	0.230000	0.25150	4.747000	0.62141	1.408000	0.46895	0.254000	0.18369	ATC	.	.		0.343	PZP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337624.1	NM_002864	
PZP	5858	hgsc.bcm.edu	37	12	9356498	9356498	+	Nonsense_Mutation	SNP	T	T	A			TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr12:9356498T>A	ENST00000261336.2	-	2	161	c.133A>T	c.(133-135)Aag>Tag	p.K45*	PZP_ENST00000381997.2_5'Flank	NM_002864.2	NP_002855.2	P20742	PZP_HUMAN	pregnancy-zone protein	45					female pregnancy (GO:0007565)|negative regulation of endopeptidase activity (GO:0010951)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	endopeptidase inhibitor activity (GO:0004866)|serine-type endopeptidase inhibitor activity (GO:0004867)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(21)|lung(46)|ovary(3)|prostate(2)|skin(6)|stomach(3)|upper_aerodigestive_tract(5)	102						ACACAGCCCTTCTTAGGGGCC	0.512																																					p.K45X	Melanoma(125;1402 1695 4685 34487 38571)	Atlas-SNP	.											.	PZP	422	.	0			c.A133T						.						89.0	90.0	90.0					12																	9356498		2203	4300	6503	SO:0001587	stop_gained	5858	exon2			AGCCCTTCTTAGG	X54380, M24416, X51541	CCDS8600.1	12p13-p12.2	2008-02-01			ENSG00000126838	ENSG00000126838			9750	protein-coding gene	gene with protein product		176420					Standard	NM_002864		Approved	CPAMD6	uc001qvl.3	P20742	OTTHUMG00000154915	ENST00000261336.2:c.133A>T	chr12.hg19:g.9356498T>A	ENSP00000261336:p.Lys45*	125.0	0.0		131.0	33.0	NM_002864	A6ND27|Q15273|Q2NKL2|Q7M4N7	Nonsense_Mutation	SNP	ENST00000261336.2	hg19	CCDS8600.1	.	.	.	.	.	.	.	.	.	.	T	16.56	3.156838	0.57259	.	.	ENSG00000126838	ENST00000261336	.	.	.	2.22	2.22	0.28083	.	0.000000	0.46442	U	0.000292	.	.	.	.	.	.	0.42116	D	0.991408	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	6.4277	0.21778	0.0:0.0:0.0:1.0	.	.	.	.	X	45	.	ENSP00000261336:K45X	K	-	1	0	PZP	9247765	0.186000	0.23225	0.536000	0.28039	0.432000	0.31715	0.225000	0.17757	1.298000	0.44778	0.383000	0.25322	AAG	.	.		0.512	PZP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337624.1	NM_002864	
ARID2	196528	hgsc.bcm.edu	37	12	46285641	46285641	+	Nonsense_Mutation	SNP	T	T	A			TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr12:46285641T>A	ENST00000334344.6	+	17	5173	c.5001T>A	c.(4999-5001)tgT>tgA	p.C1667*	ARID2_ENST00000422737.1_Nonsense_Mutation_p.C1518*|ARID2_ENST00000444670.1_Nonsense_Mutation_p.C1277*|ARID2_ENST00000457135.1_Nonsense_Mutation_p.C275*|ARID2_ENST00000479608.1_3'UTR	NM_152641.2	NP_689854.2	Q68CP9	ARID2_HUMAN	AT rich interactive domain 2 (ARID, RFX-like)	1667					chromatin modification (GO:0016568)|nucleosome disassembly (GO:0006337)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(3)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(21)|liver(20)|lung(34)|ovary(7)|pancreas(1)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	116	Lung SC(27;0.192)|Renal(347;0.236)	Lung NSC(34;0.106)|all_lung(34;0.22)	OV - Ovarian serous cystadenocarcinoma(5;0.00691)	GBM - Glioblastoma multiforme(48;0.0153)		CAGGGCAGTGTCTTTGGGAAG	0.393			"""N, S, F"""		hepatocellular carcinoma																																p.C1667X		Atlas-SNP	.		Rec	yes		12	12q12	196528	AT rich interactive domain 2		E	ARID2,NS,carcinoma,0,1	ARID2	311	.	0			c.T5001A						.						157.0	155.0	156.0					12																	46285641		2203	4300	6503	SO:0001587	stop_gained	196528	exon17			GCAGTGTCTTTGG		CCDS31783.1	12q13.11	2013-02-07			ENSG00000189079	ENSG00000189079		"""-"""	18037	protein-coding gene	gene with protein product		609539					Standard	NM_152641		Approved	KIAA1557, DKFZp686G052, FLJ30619, BAF200	uc001ros.1	Q68CP9	OTTHUMG00000150487	ENST00000334344.6:c.5001T>A	chr12.hg19:g.46285641T>A	ENSP00000335044:p.Cys1667*	154.0	0.0		90.0	29.0	NM_152641	Q15KG9|Q5EB51|Q645I3|Q6ZRY5|Q7Z3I5|Q86T28|Q96SJ6|Q9HCL5	Nonsense_Mutation	SNP	ENST00000334344.6	hg19	CCDS31783.1	.	.	.	.	.	.	.	.	.	.	T	46	12.312171	0.99656	.	.	ENSG00000189079	ENST00000334344;ENST00000549153;ENST00000338636;ENST00000422737;ENST00000444670;ENST00000457135	.	.	.	5.42	2.96	0.34315	.	0.143616	0.64402	D	0.000005	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-5.902	9.8049	0.40786	0.0:0.2087:0.0:0.7913	.	.	.	.	X	1667;784;784;1518;1277;275	.	ENSP00000335044:C1667X	C	+	3	2	ARID2	44571908	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.133000	0.31430	0.946000	0.37632	0.533000	0.62120	TGT	.	.		0.393	ARID2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318380.2	XM_350875	
ESPL1	9700	hgsc.bcm.edu	37	12	53684210	53684210	+	Missense_Mutation	SNP	G	G	A	rs542853803		TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr12:53684210G>A	ENST00000257934.4	+	24	5412	c.5321G>A	c.(5320-5322)cGa>cAa	p.R1774Q	ESPL1_ENST00000552462.1_Missense_Mutation_p.R1774Q	NM_012291.4	NP_036423.4	Q14674	ESPL1_HUMAN	extra spindle pole bodies homolog 1 (S. cerevisiae)	1774					apoptotic process (GO:0006915)|cytokinesis (GO:0000910)|establishment of mitotic spindle localization (GO:0040001)|homologous chromosome segregation (GO:0045143)|meiotic spindle organization (GO:0000212)|mitotic cell cycle (GO:0000278)|mitotic sister chromatid segregation (GO:0000070)|negative regulation of sister chromatid cohesion (GO:0045875)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)	centrosome (GO:0005813)|cytosol (GO:0005829)|nucleus (GO:0005634)	catalytic activity (GO:0003824)|cysteine-type peptidase activity (GO:0008234)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(10)|large_intestine(12)|lung(21)|ovary(2)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(8)	70						ACTGACAAGCGAGAATGGTGG	0.577																																					p.R1774Q	Colon(53;1069 1201 2587 5382)	Atlas-SNP	.											.	ESPL1	158	.	0			c.G5321A						.						117.0	106.0	110.0					12																	53684210		2203	4300	6503	SO:0001583	missense	9700	exon24			ACAAGCGAGAATG	D79987	CCDS8852.1	12q13.13	2014-08-04	2013-05-03		ENSG00000135476	ENSG00000135476	3.4.22.49		16856	protein-coding gene	gene with protein product	"""separin"", ""separase"", ""separin, cysteine protease"""	604143	"""extra spindle poles like 1 (S. cerevisiae)"""			8724849, 16258266	Standard	NM_012291		Approved	KIAA0165, ESP1, SEPA	uc001sck.2	Q14674	OTTHUMG00000169674	ENST00000257934.4:c.5321G>A	chr12.hg19:g.53684210G>A	ENSP00000257934:p.Arg1774Gln	57.0	0.0		38.0	8.0	NM_012291		Missense_Mutation	SNP	ENST00000257934.4	hg19	CCDS8852.1	.	.	.	.	.	.	.	.	.	.	G	17.52	3.411292	0.62399	.	.	ENSG00000135476	ENST00000257934;ENST00000552671;ENST00000552462	T;T	0.12255	2.7;2.7	5.4	3.5	0.40072	.	0.613068	0.16292	N	0.220879	T	0.09862	0.0242	N	0.26130	0.795	0.09310	N	1	D	0.54397	0.966	P	0.44921	0.464	T	0.16453	-1.0402	10	0.49607	T	0.09	.	4.3227	0.11025	0.2619:0.186:0.5521:0.0	.	1774	Q14674	ESPL1_HUMAN	Q	1774;1449;1774	ENSP00000257934:R1774Q;ENSP00000449831:R1774Q	ENSP00000257934:R1774Q	R	+	2	0	ESPL1	51970477	0.962000	0.33011	0.984000	0.44739	0.990000	0.78478	1.512000	0.35812	1.518000	0.48934	0.650000	0.86243	CGA	.	.		0.577	ESPL1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406899.2	NM_012291	
PPM1H	57460	hgsc.bcm.edu	37	12	63061108	63061108	+	Splice_Site	SNP	A	A	T			TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr12:63061108A>T	ENST00000228705.6	-	9	1547	c.1247T>A	c.(1246-1248)gTa>gAa	p.V416E	PPM1H_ENST00000551214.1_5'UTR	NM_020700.1	NP_065751.1	Q9ULR3	PPM1H_HUMAN	protein phosphatase, Mg2+/Mn2+ dependent, 1H	416	PP2C-like.						phosphoprotein phosphatase activity (GO:0004721)			breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(9)|ovary(1)	18			GBM - Glioblastoma multiforme(1;0.000443)|BRCA - Breast invasive adenocarcinoma(9;0.209)	GBM - Glioblastoma multiforme(28;0.0126)		GTAGATTCTTACCTGAAAAAA	0.393																																					p.V416E		Atlas-SNP	.											.	PPM1H	42	.	0			c.T1247A						.						60.0	57.0	58.0					12																	63061108		1870	4113	5983	SO:0001630	splice_region_variant	57460	exon9			ATTCTTACCTGAA	AB032983	CCDS44934.1	12q14.1	2012-04-17	2010-03-05	2004-03-26	ENSG00000111110	ENSG00000111110	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"""	18583	protein-coding gene	gene with protein product	"""neurite extension-related protein phosphatase related to PP2C"""		"""ras homolog gene family, member C like 1"", ""protein phosphatase 1H (PP2C domain containing)"""	ARHCL1			Standard	NM_020700		Approved	KIAA1157, FLJ13253, NERPP-2C	uc001srk.3	Q9ULR3	OTTHUMG00000169990	ENST00000228705.6:c.1246-1T>A	chr12.hg19:g.63061108A>T		36.0	0.0		42.0	12.0	NM_020700	B1Q2A9|B2RXG4|Q6PI86	Missense_Mutation	SNP	ENST00000228705.6	hg19	CCDS44934.1	.	.	.	.	.	.	.	.	.	.	A	24.1	4.490987	0.84962	.	.	ENSG00000111110	ENST00000228705	T	0.21361	2.01	5.74	5.74	0.90152	Protein phosphatase 2C-like (5);	0.000000	0.85682	D	0.000000	T	0.64136	0.2571	H	0.98111	4.15	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.79029	-0.1970	9	.	.	.	1.2876	16.0274	0.80553	1.0:0.0:0.0:0.0	.	416	Q9ULR3	PPM1H_HUMAN	E	416	ENSP00000228705:V416E	.	V	-	2	0	PPM1H	61347375	1.000000	0.71417	0.999000	0.59377	0.825000	0.46686	8.826000	0.92034	2.185000	0.69588	0.528000	0.53228	GTA	.	.		0.393	PPM1H-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406760.2	NM_020700	Missense_Mutation
TMEM19	55266	hgsc.bcm.edu	37	12	72083445	72083445	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr12:72083445C>A	ENST00000266673.5	+	2	799	c.205C>A	c.(205-207)Ctt>Att	p.L69I	TMEM19_ENST00000549735.1_Missense_Mutation_p.L69I|RP11-293I14.2_ENST00000548802.1_3'UTR	NM_018279.3	NP_060749.2	Q96HH6	TMM19_HUMAN	transmembrane protein 19	69						integral component of membrane (GO:0016021)				large_intestine(1)|lung(8)	9		Breast(359;0.0889)		GBM - Glioblastoma multiforme(134;0.044)		CTCTAATGGCCTTAAAAAGAA	0.363																																					p.L69I		Atlas-SNP	.											.	TMEM19	35	.	0			c.C205A						.						209.0	199.0	202.0					12																	72083445		2203	4300	6503	SO:0001583	missense	55266	exon2			AATGGCCTTAAAA	BC008596	CCDS9002.1	12q15	2004-03-04				ENSG00000139291			25605	protein-coding gene	gene with protein product						12477932	Standard	NM_018279		Approved	FLJ10936	uc001sws.3	Q96HH6	OTTHUMG00000169558	ENST00000266673.5:c.205C>A	chr12.hg19:g.72083445C>A	ENSP00000266673:p.Leu69Ile	133.0	0.0		103.0	40.0	NM_018279	B2RDL2|Q53FY3|Q9NV41	Missense_Mutation	SNP	ENST00000266673.5	hg19	CCDS9002.1	.	.	.	.	.	.	.	.	.	.	C	10.75	1.437668	0.25900	.	.	ENSG00000139291	ENST00000266673;ENST00000550524;ENST00000549735	.	.	.	5.35	2.95	0.34219	.	0.427456	0.26844	N	0.022214	T	0.25232	0.0613	N	0.25332	0.735	0.28958	N	0.890014	B;B	0.02656	0.0;0.0	B;B	0.08055	0.003;0.002	T	0.12941	-1.0528	9	0.35671	T	0.21	-9.4499	4.9133	0.13833	0.3086:0.0792:0.0:0.6122	.	69;69	Q96HH6;Q96HH6-2	TMM19_HUMAN;.	I	69	.	ENSP00000266673:L69I	L	+	1	0	TMEM19	70369712	0.882000	0.30256	1.000000	0.80357	0.932000	0.56968	0.820000	0.27323	0.315000	0.23110	-0.302000	0.09304	CTT	.	.		0.363	TMEM19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404801.1	NM_018279	
EEA1	8411	hgsc.bcm.edu	37	12	93213181	93213181	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr12:93213181T>C	ENST00000322349.8	-	14	1895	c.1631A>G	c.(1630-1632)aAa>aGa	p.K544R		NM_003566.3	NP_003557	Q15075	EEA1_HUMAN	early endosome antigen 1	544	Gln/Glu/Lys-rich.				early endosome to late endosome transport (GO:0045022)|endocytosis (GO:0006897)|synaptic vesicle to endosome fusion (GO:0016189)|vesicle fusion (GO:0006906)	axonal spine (GO:0044308)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|early endosome (GO:0005769)|extracellular vesicular exosome (GO:0070062)|extrinsic component of plasma membrane (GO:0019897)|membrane (GO:0016020)|recycling endosome (GO:0055037)|serine-pyruvate aminotransferase complex (GO:0005969)	1-phosphatidylinositol binding (GO:0005545)|calmodulin binding (GO:0005516)|GTP-dependent protein binding (GO:0030742)|protein homodimerization activity (GO:0042803)|zinc ion binding (GO:0008270)			endometrium(5)|kidney(5)|large_intestine(11)|lung(7)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)	36						TTCTCTTTCTTTTTCTAGTAA	0.353																																					p.K544R		Atlas-SNP	.											.	EEA1	104	.	0			c.A1631G						.						65.0	66.0	66.0					12																	93213181		2201	4298	6499	SO:0001583	missense	8411	exon14			CTTTCTTTTTCTA	L40157	CCDS31874.1	12q22	2007-02-23	2007-02-23			ENSG00000102189		"""Zinc fingers, FYVE domain containing"""	3185	protein-coding gene	gene with protein product		605070	"""early endosome antigen 1, 162kD"""			7768953, 9697774	Standard	NM_003566		Approved	ZFYVE2	uc001tck.3	Q15075	OTTHUMG00000170110	ENST00000322349.8:c.1631A>G	chr12.hg19:g.93213181T>C	ENSP00000317955:p.Lys544Arg	122.0	0.0		110.0	24.0	NM_003566	Q14221	Missense_Mutation	SNP	ENST00000322349.8	hg19	CCDS31874.1	.	.	.	.	.	.	.	.	.	.	T	13.61	2.289240	0.40494	.	.	ENSG00000102189	ENST00000322349	T	0.77229	-1.08	5.55	4.42	0.53409	.	0.107006	0.40222	N	0.001144	T	0.61160	0.2325	N	0.17082	0.46	0.32696	N	0.513536	B	0.15141	0.012	B	0.12156	0.007	T	0.63497	-0.6624	10	0.27785	T	0.31	.	10.8898	0.46990	0.0:0.0735:0.0:0.9265	.	544	Q15075	EEA1_HUMAN	R	544	ENSP00000317955:K544R	ENSP00000317955:K544R	K	-	2	0	EEA1	91737312	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	3.556000	0.53734	2.120000	0.65058	0.377000	0.23210	AAA	.	.		0.353	EEA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407304.1	NM_003566	
CEP83	51134	hgsc.bcm.edu	37	12	94772626	94772626	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr12:94772626C>T	ENST00000397809.5	-	7	1291	c.742G>A	c.(742-744)Gcc>Acc	p.A248T	CCDC41_ENST00000339839.5_Missense_Mutation_p.A248T|CCDC41_ENST00000549352.1_5'UTR|CCDC41_ENST00000397807.2_Missense_Mutation_p.A215T|CCDC41_ENST00000547575.1_Missense_Mutation_p.A248T	NM_016122.2	NP_057206.2	Q9Y592	CEP83_HUMAN		240					cilium assembly (GO:0042384)|protein localization to centrosome (GO:0071539)|vesicle docking (GO:0048278)	centriole (GO:0005814)|ciliary transition fiber (GO:0097539)|Golgi apparatus (GO:0005794)				breast(1)|central_nervous_system(3)|kidney(3)|large_intestine(8)|lung(8)|prostate(2)|skin(2)	27						ATTCTTTGGGCATTTTCCACC	0.423																																					p.A248T		Atlas-SNP	.											.	CCDC41	59	.	0			c.G742A						.						131.0	129.0	130.0					12																	94772626		1882	4123	6005	SO:0001583	missense	51134	exon7			TTTGGGCATTTTC																												ENST00000397809.5:c.742G>A	chr12.hg19:g.94772626C>T	ENSP00000380911:p.Ala248Thr	96.0	0.0		125.0	26.0	NM_016122	A4FVB1|Q08AP1	Missense_Mutation	SNP	ENST00000397809.5	hg19	CCDS41820.1	.	.	.	.	.	.	.	.	.	.	C	14.51	2.557333	0.45590	.	.	ENSG00000173588	ENST00000339839;ENST00000397809;ENST00000397807;ENST00000547575	T;T;T;T	0.21932	1.98;1.98;1.98;1.98	5.69	3.81	0.43845	.	.	.	.	.	T	0.11024	0.0269	N	0.08118	0	0.22591	N	0.99896	B;B;B	0.19200	0.034;0.034;0.034	B;B;B	0.21708	0.036;0.022;0.036	T	0.35549	-0.9784	9	0.15066	T	0.55	0.996	11.1071	0.48210	0.0:0.8436:0.0:0.1564	.	248;215;240	F8VYN8;Q9Y592-2;Q9Y592	.;.;CCD41_HUMAN	T	248;248;215;248	ENSP00000344655:A248T;ENSP00000380911:A248T;ENSP00000380909:A215T;ENSP00000448913:A248T	ENSP00000344655:A248T	A	-	1	0	CCDC41	93296757	1.000000	0.71417	0.947000	0.38551	0.810000	0.45777	3.957000	0.56730	0.703000	0.31848	0.585000	0.79938	GCC	.	.		0.423	CCDC41-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408147.3		
ACACB	32	hgsc.bcm.edu	37	12	109616910	109616910	+	Silent	SNP	A	A	G			TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr12:109616910A>G	ENST00000338432.7	+	10	1574	c.1455A>G	c.(1453-1455)ccA>ccG	p.P485P	ACACB_ENST00000377848.3_Silent_p.P485P|ACACB_ENST00000543080.1_3'UTR|ACACB_ENST00000377854.5_Silent_p.P485P			O00763	ACACB_HUMAN	acetyl-CoA carboxylase beta	485	ATP-grasp. {ECO:0000255|PROSITE- ProRule:PRU00409}.|Biotin carboxylation.				acetyl-CoA metabolic process (GO:0006084)|biotin metabolic process (GO:0006768)|carnitine shuttle (GO:0006853)|cellular lipid metabolic process (GO:0044255)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|malonyl-CoA biosynthetic process (GO:2001295)|positive regulation of cellular metabolic process (GO:0031325)|protein homotetramerization (GO:0051289)|response to drug (GO:0042493)|response to organic cyclic compound (GO:0014070)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	acetyl-CoA carboxylase activity (GO:0003989)|ATP binding (GO:0005524)|biotin binding (GO:0009374)|biotin carboxylase activity (GO:0004075)|metal ion binding (GO:0046872)			NS(1)|breast(2)|endometrium(9)|kidney(5)|large_intestine(20)|lung(40)|ovary(6)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95					Adenine(DB00173)|Biotin(DB00121)	GTGAGATCCCAGGCTCGCCCA	0.542																																					p.P485P		Atlas-SNP	.											.	ACACB	330	.	0			c.A1455G						.						49.0	40.0	43.0					12																	109616910		2203	4300	6503	SO:0001819	synonymous_variant	32	exon9			GATCCCAGGCTCG	U89344	CCDS31898.1	12q24.1	2010-05-07	2010-04-30		ENSG00000076555	ENSG00000076555	6.4.1.2		85	protein-coding gene	gene with protein product	"""acetyl-CoA carboxylase 2"""	601557	"""acetyl-Coenzyme A carboxylase beta"""			8670171	Standard	NM_001093		Approved	HACC275, ACC2, ACCB	uc001toc.3	O00763	OTTHUMG00000169250	ENST00000338432.7:c.1455A>G	chr12.hg19:g.109616910A>G		82.0	0.0		52.0	11.0	NM_001093	A6NK36|Q16852|Q1HEC1|Q6KE87|Q6KE89|Q6TY48	Silent	SNP	ENST00000338432.7	hg19	CCDS31898.1																																																																																			.	.		0.542	ACACB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403077.1	NM_001093	
PTPN11	5781	hgsc.bcm.edu	37	12	112926248	112926248	+	Splice_Site	SNP	G	G	T	rs121918468		TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr12:112926248G>T	ENST00000351677.2	+	12	1579	c.1381G>T	c.(1381-1383)Gct>Tct	p.A461S		NM_002834.3	NP_002825.3	Q06124	PTN11_HUMAN	protein tyrosine phosphatase, non-receptor type 11	465	Tyrosine-protein phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00160}.				abortive mitotic cell cycle (GO:0033277)|activation of MAPK activity (GO:0000187)|atrioventricular canal development (GO:0036302)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|brain development (GO:0007420)|cytokine-mediated signaling pathway (GO:0019221)|DNA damage checkpoint (GO:0000077)|ephrin receptor signaling pathway (GO:0048013)|epidermal growth factor receptor signaling pathway (GO:0007173)|ERBB signaling pathway (GO:0038127)|face morphogenesis (GO:0060325)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|genitalia development (GO:0048806)|glucose homeostasis (GO:0042593)|heart development (GO:0007507)|hormone metabolic process (GO:0042445)|hormone-mediated signaling pathway (GO:0009755)|innate immune response (GO:0045087)|inner ear development (GO:0048839)|insulin receptor signaling pathway (GO:0008286)|integrin-mediated signaling pathway (GO:0007229)|interferon-gamma-mediated signaling pathway (GO:0060333)|leukocyte migration (GO:0050900)|megakaryocyte development (GO:0035855)|multicellular organismal reproductive process (GO:0048609)|negative regulation of cell adhesion mediated by integrin (GO:0033629)|negative regulation of cortisol secretion (GO:0051463)|negative regulation of growth hormone secretion (GO:0060125)|negative regulation of insulin secretion (GO:0046676)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ growth (GO:0035265)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet formation (GO:0030220)|positive regulation of glucose import in response to insulin stimulus (GO:2001275)|positive regulation of hormone secretion (GO:0046887)|regulation of cell adhesion mediated by integrin (GO:0033628)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|regulation of multicellular organism growth (GO:0040014)|regulation of protein export from nucleus (GO:0046825)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|T cell costimulation (GO:0031295)|triglyceride metabolic process (GO:0006641)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|protein complex (GO:0043234)	insulin receptor binding (GO:0005158)|non-membrane spanning protein tyrosine phosphatase activity (GO:0004726)|phosphoprotein phosphatase activity (GO:0004721)|protein tyrosine phosphatase activity (GO:0004725)|SH3/SH2 adaptor activity (GO:0005070)			NS(1)|autonomic_ganglia(2)|breast(1)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(406)|kidney(2)|large_intestine(6)|lung(16)|ovary(1)|skin(1)|soft_tissue(3)|stomach(3)	451						TGCCCGCAGTGCTGGAATTGG	0.453			Mis		"""JMML, AML, MDS"""		Noonan Syndrome		Noonan syndrome																												p.A461S		Atlas-SNP	.		Dom	yes		12	12q24.1	5781	"""protein tyrosine phosphatase, non-receptor type 11"""	yes	L	PTPN11,NS,carcinoma,-1,1	PTPN11	623	.	0			c.G1381T	GRCh37	CM043335	PTPN11	M	rs121918468	.						122.0	110.0	114.0					12																	112926248		2203	4300	6503	SO:0001630	splice_region_variant	5781	exon12	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome	CGCAGTGCTGGAA	D13540	CCDS9163.1, CCDS58280.1	12q24.1	2014-09-17	2008-07-31		ENSG00000179295	ENSG00000179295		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"", ""SH2 domain containing"""	9644	protein-coding gene	gene with protein product		176876	"""Noonan syndrome 1"""	NS1		7894486, 1280823	Standard	NM_080601		Approved	BPTP3, SH-PTP2, SHP-2, PTP2C, SHP2	uc001ttx.3	Q06124	OTTHUMG00000134334	ENST00000351677.2:c.1380-1G>T	chr12.hg19:g.112926248G>T		59.0	0.0		60.0	13.0	NM_002834	A8K1D9|Q96HD7	Missense_Mutation	SNP	ENST00000351677.2	hg19	CCDS9163.1	.	.	.	.	.	.	.	.	.	.	G	27.9	4.869259	0.91587	.	.	ENSG00000179295	ENST00000351677	D	0.99567	-6.18	5.05	5.05	0.67936	.	0.057274	0.64402	D	0.000001	D	0.99753	0.9901	H	0.94620	3.56	0.80722	D	1	D	0.57899	0.981	D	0.79784	0.993	D	0.97162	0.9838	10	0.87932	D	0	.	18.7696	0.91885	0.0:0.0:1.0:0.0	.	461	Q06124-2	.	S	461	ENSP00000340944:A461S	ENSP00000340944:A461S	A	+	1	0	PTPN11	111410631	1.000000	0.71417	1.000000	0.80357	0.953000	0.61014	9.237000	0.95368	2.508000	0.84585	0.650000	0.86243	GCT	.	.		0.453	PTPN11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259496.2		Missense_Mutation
CAMKK2	10645	hgsc.bcm.edu	37	12	121687622	121687622	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr12:121687622G>A	ENST00000324774.5	-	13	2119	c.1291C>T	c.(1291-1293)Ccc>Tcc	p.P431S	CAMKK2_ENST00000402834.4_Missense_Mutation_p.P431S|CAMKK2_ENST00000412367.2_Missense_Mutation_p.P431S|CAMKK2_ENST00000392473.2_Missense_Mutation_p.P431S|CAMKK2_ENST00000337174.3_Missense_Mutation_p.P431S|CAMKK2_ENST00000392474.2_Missense_Mutation_p.P431S|CAMKK2_ENST00000404169.3_Missense_Mutation_p.P431S|CAMKK2_ENST00000446440.2_Missense_Mutation_p.P431S|CAMKK2_ENST00000347034.2_Missense_Mutation_p.P431S|CAMKK2_ENST00000538733.1_Missense_Mutation_p.P431S|CAMKK2_ENST00000545538.1_Missense_Mutation_p.P218S	NM_006549.3	NP_006540.3	Q96RR4	KKCC2_HUMAN	calcium/calmodulin-dependent protein kinase kinase 2, beta	431	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				calcium-mediated signaling (GO:0019722)|MAPK cascade (GO:0000165)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of transcription, DNA-templated (GO:0045893)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of protein kinase activity (GO:0045859)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|intracellular (GO:0005622)|nucleus (GO:0005634)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|calmodulin-dependent protein kinase activity (GO:0004683)|protein tyrosine kinase activity (GO:0004713)			endometrium(2)|kidney(1)|large_intestine(2)|liver(2)|lung(4)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	17	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)					CTCGACTCGGGGTTCTTGTCC	0.617																																					p.P431S		Atlas-SNP	.											.	CAMKK2	87	.	0			c.C1291T						.						178.0	165.0	169.0					12																	121687622		2203	4300	6503	SO:0001583	missense	10645	exon13			ACTCGGGGTTCTT	AF101264	CCDS9216.1, CCDS9217.1, CCDS9218.1, CCDS9219.1, CCDS44999.1, CCDS53837.1, CCDS58283.1	12q24.2	2002-08-13				ENSG00000110931			1470	protein-coding gene	gene with protein product		615002				9662074	Standard	NM_172226		Approved	CAMKK, KIAA0787, CAMKKB, MGC15254	uc001tzu.3	Q96RR4		ENST00000324774.5:c.1291C>T	chr12.hg19:g.121687622G>A	ENSP00000312741:p.Pro431Ser	99.0	0.0		93.0	16.0	NM_153500	A8K7Q7|O94883|Q8IUG2|Q8IUG3|Q8N3I4|Q8WY03|Q8WY04|Q8WY05|Q8WY06|Q96RP1|Q96RP2|Q96RR3|Q9BWE9|Q9UER3|Q9UES2|Q9Y5N2	Missense_Mutation	SNP	ENST00000324774.5	hg19	CCDS9216.1	.	.	.	.	.	.	.	.	.	.	G	26.1	4.708776	0.89018	.	.	ENSG00000110931	ENST00000392474;ENST00000347034;ENST00000538733;ENST00000337174;ENST00000324774;ENST00000545538;ENST00000412367;ENST00000404169;ENST00000360452;ENST00000446440;ENST00000392473	T;T;T;T;T;T;T;T;T;T	0.60920	0.15;0.15;0.15;0.15;0.15;0.48;0.15;0.15;0.15;0.15	5.74	4.85	0.62838	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.75737	0.3890	M	0.76938	2.355	0.80722	D	1	D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;0.996;0.993;1.0;1.0;1.0	D;D;D;D;D;D;D;D	0.87578	0.993;0.997;0.993;0.935;0.944;0.998;0.997;0.993	T	0.79376	-0.1829	10	0.87932	D	0	-4.9585	13.8045	0.63223	0.0732:0.0:0.9268:0.0	.	431;431;431;218;431;431;431;431	Q96RR4-6;Q96RR4-2;Q96RR4-7;F5GZ00;Q96RR4-5;Q96RR4-4;Q96RR4;Q96RR4-3	.;.;.;.;.;.;KKCC2_HUMAN;.	S	431;431;431;431;431;218;431;431;414;431;431	ENSP00000376266:P431S;ENSP00000321230:P431S;ENSP00000445944:P431S;ENSP00000336634:P431S;ENSP00000312741:P431S;ENSP00000441352:P218S;ENSP00000388368:P431S;ENSP00000384600:P431S;ENSP00000388273:P431S;ENSP00000376265:P431S	ENSP00000312741:P431S	P	-	1	0	CAMKK2	120172005	1.000000	0.71417	0.994000	0.49952	0.906000	0.53458	9.209000	0.95087	1.438000	0.47492	0.561000	0.74099	CCC	.	.		0.617	CAMKK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000402563.1	NM_172226	
KDM2B	84678	hgsc.bcm.edu	37	12	121947514	121947514	+	Missense_Mutation	SNP	C	C	G			TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr12:121947514C>G	ENST00000377071.4	-	11	1575	c.1503G>C	c.(1501-1503)gaG>gaC	p.E501D	KDM2B_ENST00000538046.2_Missense_Mutation_p.E411D|KDM2B_ENST00000377069.4_Missense_Mutation_p.E470D|KDM2B_ENST00000536437.1_Missense_Mutation_p.E384D|KDM2B_ENST00000542973.1_5'Flank	NM_032590.4	NP_115979.3	Q8NHM5	KDM2B_HUMAN	lysine (K)-specific demethylase 2B	501					embryonic camera-type eye morphogenesis (GO:0048596)|forebrain development (GO:0030900)|fourth ventricle development (GO:0021592)|hindbrain development (GO:0030902)|histone demethylation (GO:0016577)|histone H2A monoubiquitination (GO:0035518)|initiation of neural tube closure (GO:0021993)|lateral ventricle development (GO:0021670)|midbrain development (GO:0030901)|midbrain-hindbrain boundary morphogenesis (GO:0021555)|negative regulation of neural precursor cell proliferation (GO:2000178)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|spermatogenesis (GO:0007283)|third ventricle development (GO:0021678)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone demethylase activity (GO:0032452)|histone demethylase activity (H3-K36 specific) (GO:0051864)|rRNA binding (GO:0019843)|zinc ion binding (GO:0008270)			breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(8)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	19						TGGCAGAGACCTCCGTGGCGG	0.542																																					p.E501D		Atlas-SNP	.											.	KDM2B	218	.	0			c.G1503C						.						70.0	77.0	75.0					12																	121947514		1904	4108	6012	SO:0001583	missense	84678	exon11			AGAGACCTCCGTG	AJ459424	CCDS41849.1, CCDS41850.1	12q24.31	2014-02-18	2009-04-06	2009-04-06	ENSG00000089094	ENSG00000089094		"""F-boxes / Leucine-rich repeats"", ""Chromatin-modifying enzymes / K-demethylases"""	13610	protein-coding gene	gene with protein product	"""jumonji C domain-containing histone demethylase 1B"""	609078	"""F-box and leucine-rich repeat protein 10"""	FBXL10		10799292	Standard	NM_032590		Approved	PCCX2, CXXC2, Fbl10, JHDM1B	uc001uat.3	Q8NHM5	OTTHUMG00000169071	ENST00000377071.4:c.1503G>C	chr12.hg19:g.121947514C>G	ENSP00000366271:p.Glu501Asp	114.0	0.0		76.0	24.0	NM_032590	A8MRS1|Q8NCI2|Q96HC7|Q96SL0|Q96T03|Q9NS96|Q9UF75	Missense_Mutation	SNP	ENST00000377071.4	hg19	CCDS41850.1	.	.	.	.	.	.	.	.	.	.	C	2.720	-0.266704	0.05754	.	.	ENSG00000089094	ENST00000397480;ENST00000377069;ENST00000377071;ENST00000536437;ENST00000397478;ENST00000261824;ENST00000446152	T;T;T;T	0.47177	2.42;1.83;0.85;0.86	5.14	3.27	0.37495	.	0.351880	0.24059	N	0.041933	T	0.24275	0.0588	N	0.15975	0.35	0.34767	D	0.733323	B;B;B;B	0.06786	0.001;0.001;0.001;0.001	B;B;B;B	0.06405	0.002;0.001;0.002;0.001	T	0.20605	-1.0270	10	0.08179	T	0.78	-15.4273	7.9911	0.30242	0.0:0.5786:0.3001:0.1213	.	501;384;501;470	E7EML5;Q1RLM7;Q8NHM5;A8MRS1	.;.;KDM2B_HUMAN;.	D	501;470;501;384;501;501;464	ENSP00000366269:E470D;ENSP00000366271:E501D;ENSP00000445196:E384D;ENSP00000398279:E464D	ENSP00000261824:E501D	E	-	3	2	KDM2B	120431897	0.997000	0.39634	0.771000	0.31576	0.276000	0.26787	1.387000	0.34430	1.301000	0.44836	0.655000	0.94253	GAG	.	.		0.542	KDM2B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000402132.2	NM_032590	
AMER2	219287	hgsc.bcm.edu	37	13	25744099	25744099	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr13:25744099G>T	ENST00000515384.1	-	1	2326	c.1659C>A	c.(1657-1659)gaC>gaA	p.D553E	AMER2-AS1_ENST00000413501.1_lincRNA|AMER2_ENST00000381853.3_Missense_Mutation_p.D434E|AMER2_ENST00000357816.2_Missense_Mutation_p.D434E			Q8N7J2	AMER2_HUMAN	APC membrane recruitment protein 2	553					ectoderm development (GO:0007398)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|Wnt signaling pathway (GO:0016055)	plasma membrane (GO:0005886)	phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)										CATAGAGCGCGTCCCCGCTGT	0.642																																					p.D553E		Atlas-SNP	.											.	.	.	.	0			c.C1659A						.						66.0	63.0	64.0					13																	25744099		2203	4300	6503	SO:0001583	missense	219287	exon1			GAGCGCGTCCCCG	AK055049	CCDS9312.1, CCDS53859.1	13q12.13	2013-10-11	2012-12-03	2012-12-03	ENSG00000165566	ENSG00000165566		"""-"""	26360	protein-coding gene	gene with protein product		614659	"""family with sequence similarity 123A"""	FAM123A		20843316	Standard	XM_005266279		Approved	FLJ25477	uc001uqb.3	Q8N7J2	OTTHUMG00000016602	ENST00000515384.1:c.1659C>A	chr13.hg19:g.25744099G>T	ENSP00000426528:p.Asp553Glu	52.0	0.0		46.0	13.0	NM_152704	Q5RL80|Q5VX56|Q8N593|Q96NN5	Missense_Mutation	SNP	ENST00000515384.1	hg19	CCDS53859.1	.	.	.	.	.	.	.	.	.	.	G	14.69	2.609889	0.46527	.	.	ENSG00000165566	ENST00000357816;ENST00000381853;ENST00000515384	T;T;T	0.52295	0.67;0.67;0.67	5.57	-4.09	0.03951	.	0.000000	0.85682	D	0.000000	T	0.64394	0.2594	M	0.81497	2.545	0.34556	D	0.711819	D;D	0.89917	1.0;0.999	D;D	0.74674	0.984;0.956	T	0.73148	-0.4074	10	0.87932	D	0	-31.5622	14.5557	0.68100	0.749:0.0:0.251:0.0	.	553;434	Q8N7J2;Q8N7J2-2	F123A_HUMAN;.	E	434;434;553	ENSP00000350469:D434E;ENSP00000371277:D434E;ENSP00000426528:D553E	ENSP00000350469:D434E	D	-	3	2	FAM123A	24642099	0.847000	0.29606	0.003000	0.11579	0.400000	0.30750	0.183000	0.16919	-0.733000	0.04850	-0.367000	0.07326	GAC	.	.		0.642	AMER2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000370229.1	NM_152704	
FREM2	341640	hgsc.bcm.edu	37	13	39438522	39438522	+	Nonsense_Mutation	SNP	G	G	T			TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr13:39438522G>T	ENST00000280481.7	+	16	7978	c.7762G>T	c.(7762-7764)Gaa>Taa	p.E2588*		NM_207361.4	NP_997244.3	Q5SZK8	FREM2_HUMAN	FRAS1 related extracellular matrix protein 2	2588					cell communication (GO:0007154)|homophilic cell adhesion (GO:0007156)|inner ear development (GO:0048839)|morphogenesis of an epithelium (GO:0002009)	basement membrane (GO:0005604)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(35)|lung(39)|ovary(9)|pancreas(2)|prostate(12)|skin(11)|upper_aerodigestive_tract(7)|urinary_tract(2)	148		Lung NSC(96;1.04e-07)|Prostate(109;0.00384)|Breast(139;0.00396)|Lung SC(185;0.0565)|Hepatocellular(188;0.114)		all cancers(112;3.32e-07)|Epithelial(112;1.66e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00154)|BRCA - Breast invasive adenocarcinoma(63;0.00631)|GBM - Glioblastoma multiforme(144;0.0312)		GGATTATACTGAAGTGAAGAC	0.448																																					p.E2588X		Atlas-SNP	.											.	FREM2	385	.	0			c.G7762T						.						128.0	117.0	121.0					13																	39438522		2203	4300	6503	SO:0001587	stop_gained	341640	exon16			TATACTGAAGTGA	BX538150	CCDS31960.1	13q13.3	2004-12-15			ENSG00000150893	ENSG00000150893			25396	protein-coding gene	gene with protein product		608945				15345741	Standard	NM_207361		Approved	DKFZp686J0811	uc001uwv.3	Q5SZK8	OTTHUMG00000016759	ENST00000280481.7:c.7762G>T	chr13.hg19:g.39438522G>T	ENSP00000280481:p.Glu2588*	138.0	0.0		128.0	24.0	NM_207361	Q4QQG1|Q5H9N8|Q5T6Q1|Q6N057|Q6ZSB4|Q7Z305|Q7Z341	Nonsense_Mutation	SNP	ENST00000280481.7	hg19	CCDS31960.1	.	.	.	.	.	.	.	.	.	.	G	50	16.934631	0.99875	.	.	ENSG00000150893	ENST00000280481	.	.	.	5.81	4.95	0.65309	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	.	16.1575	0.81676	0.0:0.0:0.8656:0.1344	.	.	.	.	X	2588	.	ENSP00000280481:E2588X	E	+	1	0	FREM2	38336522	1.000000	0.71417	0.584000	0.28653	0.951000	0.60555	9.837000	0.99465	1.424000	0.47217	0.650000	0.86243	GAA	.	.		0.448	FREM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044599.2	NM_207361	
KBTBD6	89890	hgsc.bcm.edu	37	13	41705442	41705442	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr13:41705442C>A	ENST00000379485.1	-	1	1440	c.1206G>T	c.(1204-1206)agG>agT	p.R402S	KBTBD6_ENST00000499385.2_Missense_Mutation_p.R336S	NM_152903.4	NP_690867.3	Q86V97	KBTB6_HUMAN	kelch repeat and BTB (POZ) domain containing 6	402										NS(1)|breast(1)|endometrium(8)|kidney(4)|large_intestine(9)|lung(9)|ovary(1)|prostate(2)|skin(4)|urinary_tract(4)	43		Lung NSC(96;4.52e-06)|Breast(139;0.00123)|Prostate(109;0.0181)|Lung SC(185;0.0262)|Hepatocellular(98;0.114)		all cancers(112;4.08e-09)|Epithelial(112;4.74e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000131)|GBM - Glioblastoma multiforme(144;0.000876)|BRCA - Breast invasive adenocarcinoma(63;0.0673)		AGAGGTCTGTCCTGGGCTGAG	0.512																																					p.R402S		Atlas-SNP	.											.	KBTBD6	83	.	0			c.G1206T						.						112.0	104.0	107.0					13																	41705442		2203	4300	6503	SO:0001583	missense	89890	exon1			GTCTGTCCTGGGC	AK056633	CCDS9376.1	13q13.3	2013-01-08			ENSG00000165572	ENSG00000165572		"""BTB/POZ domain containing"""	25340	protein-coding gene	gene with protein product						12477932	Standard	NM_152903		Approved	DKFZp547E1912	uc001uxu.1	Q86V97	OTTHUMG00000016786	ENST00000379485.1:c.1206G>T	chr13.hg19:g.41705442C>A	ENSP00000368799:p.Arg402Ser	128.0	0.0		99.0	28.0	NM_152903	Q5T6Y8|Q8N8L0|Q8NDM5|Q96MP6	Missense_Mutation	SNP	ENST00000379485.1	hg19	CCDS9376.1	.	.	.	.	.	.	.	.	.	.	c	7.762	0.705690	0.15172	.	.	ENSG00000165572	ENST00000379485;ENST00000499385	T;T	0.63096	-0.02;-0.02	3.8	1.99	0.26369	Kelch-type beta propeller (1);	0.451876	0.23561	N	0.046849	T	0.40067	0.1102	L	0.28274	0.84	0.33816	D	0.628451	B;B	0.23058	0.079;0.017	B;B	0.23852	0.049;0.009	T	0.35400	-0.9790	10	0.08381	T	0.77	.	6.108	0.20084	0.1861:0.7088:0.0:0.1051	.	336;402	F5GZN7;Q86V97	.;KBTB6_HUMAN	S	402;336	ENSP00000368799:R402S;ENSP00000444326:R336S	ENSP00000368799:R402S	R	-	3	2	KBTBD6	40603442	1.000000	0.71417	0.998000	0.56505	0.656000	0.38851	0.987000	0.29603	0.372000	0.24591	-0.379000	0.06801	AGG	.	.		0.512	KBTBD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044657.1	NM_152903	
FRMD6	122786	hgsc.bcm.edu	37	14	52174893	52174893	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr14:52174893A>G	ENST00000344768.5	+	7	852	c.656A>G	c.(655-657)tAt>tGt	p.Y219C	FRMD6_ENST00000395718.2_Missense_Mutation_p.Y211C|FRMD6_ENST00000356218.4_Missense_Mutation_p.Y211C|FRMD6_ENST00000554167.1_Missense_Mutation_p.Y142C			Q96NE9	FRMD6_HUMAN	FERM domain containing 6	219	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				apical constriction (GO:0003383)|cellular protein localization (GO:0034613)|regulation of actin filament-based process (GO:0032970)	apical junction complex (GO:0043296)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(1)|endometrium(7)|large_intestine(7)|lung(11)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34	all_epithelial(31;0.0163)|Breast(41;0.089)					CATCTTAAATATATCAAAGAG	0.423																																					p.Y219C		Atlas-SNP	.											.	FRMD6	100	.	0			c.A656G						.						101.0	88.0	92.0					14																	52174893		2203	4300	6503	SO:0001583	missense	122786	exon7			TTAAATATATCAA	BI465118	CCDS9704.1, CCDS58318.1, CCDS58319.1	14q22.1	2011-06-22	2005-07-20	2005-07-20	ENSG00000139926	ENSG00000139926			19839	protein-coding gene	gene with protein product	"""expanded homolog"""	614555	"""chromosome 14 open reading frame 31"""	C14orf31			Standard	NM_152330		Approved	MGC17921, willin, EX1	uc001wzd.3	Q96NE9	OTTHUMG00000140294	ENST00000344768.5:c.656A>G	chr14.hg19:g.52174893A>G	ENSP00000343899:p.Tyr219Cys	121.0	0.0		69.0	22.0	NM_001267046	D3DSB9|Q5HYF2|Q8N2X1|Q8WUH7	Missense_Mutation	SNP	ENST00000344768.5	hg19	CCDS58318.1	.	.	.	.	.	.	.	.	.	.	A	22.0	4.225516	0.79576	.	.	ENSG00000139926	ENST00000356218;ENST00000395718;ENST00000344768;ENST00000554167;ENST00000557405	D;D;D;D;D	0.85258	-1.96;-1.96;-1.96;-1.96;-1.96	5.42	5.42	0.78866	Band 4.1 domain (1);FERM central domain (2);FERM domain (1);FERM/acyl-CoA-binding protein, 3-helical bundle (1);	0.000000	0.85682	D	0.000000	D	0.91257	0.7244	M	0.67397	2.05	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.79108	0.99;0.992;0.987	D	0.92255	0.5812	10	0.87932	D	0	.	15.4492	0.75259	1.0:0.0:0.0:0.0	.	142;219;211	G3V4T7;Q96NE9;Q96NE9-2	.;FRMD6_HUMAN;.	C	211;211;219;142;109	ENSP00000348550:Y211C;ENSP00000379068:Y211C;ENSP00000343899:Y219C;ENSP00000451977:Y142C;ENSP00000450667:Y109C	ENSP00000343899:Y219C	Y	+	2	0	FRMD6	51244643	1.000000	0.71417	0.964000	0.40570	0.710000	0.40934	7.513000	0.81739	2.063000	0.61619	0.482000	0.46254	TAT	.	.		0.423	FRMD6-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000276881.1	NM_152330	
MAP3K9	4293	hgsc.bcm.edu	37	14	71216737	71216737	+	Missense_Mutation	SNP	A	A	C			TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr14:71216737A>C	ENST00000554752.2	-	4	1062	c.1063T>G	c.(1063-1065)Tta>Gta	p.L355V	MAP3K9_ENST00000553414.1_Missense_Mutation_p.L49V|MAP3K9_ENST00000381250.4_Missense_Mutation_p.L355V|MAP3K9_ENST00000555993.2_Missense_Mutation_p.L355V|MAP3K9_ENST00000554146.1_Missense_Mutation_p.L92V	NM_001284230.1	NP_001271159.1	P80192	M3K9_HUMAN	mitogen-activated protein kinase kinase kinase 9	355	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of JNKK activity (GO:0007256)|activation of JUN kinase activity (GO:0007257)|apoptotic process (GO:0006915)|positive regulation of apoptotic process (GO:0043065)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)		ATP binding (GO:0005524)|JUN kinase kinase kinase activity (GO:0004706)|MAP kinase kinase activity (GO:0004708)|protein homodimerization activity (GO:0042803)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(25)|ovary(2)|prostate(1)|skin(3)|stomach(2)	46				all cancers(60;0.00779)|BRCA - Breast invasive adenocarcinoma(234;0.00884)|OV - Ovarian serous cystadenocarcinoma(108;0.08)		GCGACTGCTAAGCCATCAATG	0.488																																					p.L355V	GBM(114;411 1587 13539 28235 50070)	Atlas-SNP	.											.	MAP3K9	109	.	0			c.T1063G						.						152.0	134.0	140.0					14																	71216737		2203	4300	6503	SO:0001583	missense	4293	exon4			CTGCTAAGCCATC	AF251442	CCDS32112.1, CCDS61485.1, CCDS61488.1, CCDS73650.1	14q24.2	2012-10-02			ENSG00000006432	ENSG00000006432		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6861	protein-coding gene	gene with protein product		600136		MLK1			Standard	NM_001284231		Approved	PRKE1, MEKK9	uc001xml.3	P80192	OTTHUMG00000171249	ENST00000554752.2:c.1063T>G	chr14.hg19:g.71216737A>C	ENSP00000451612:p.Leu355Val	213.0	0.0		126.0	43.0	NM_033141	A3KN85|Q0D2G7|Q6EH31|Q9H2N5	Missense_Mutation	SNP	ENST00000554752.2	hg19		.	.	.	.	.	.	.	.	.	.	A	15.61	2.884617	0.51908	.	.	ENSG00000006432	ENST00000554752;ENST00000005198;ENST00000553414;ENST00000381250;ENST00000554146;ENST00000542284	D;D;D;D	0.82526	-1.62;-1.62;-1.62;-1.62	5.91	3.6	0.41247	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.80171	0.4574	N	0.13003	0.285	0.49130	D	0.99975	D;D;D;D	0.89917	0.997;1.0;1.0;1.0	D;D;D;D	0.87578	0.985;0.997;0.996;0.998	T	0.78295	-0.2259	10	0.48119	T	0.1	.	5.5105	0.16878	0.6442:0.0:0.3558:0.0	.	92;355;355;49	G3V4P9;P80192;P80192-4;G3V347	.;M3K9_HUMAN;.;.	V	355;355;49;355;92;83	ENSP00000451612:L355V;ENSP00000451038:L49V;ENSP00000370649:L355V;ENSP00000451921:L92V	ENSP00000005198:L355V	L	-	1	2	MAP3K9	70286490	1.000000	0.71417	1.000000	0.80357	0.039000	0.13416	3.461000	0.53035	1.067000	0.40740	0.533000	0.62120	TTA	.	.		0.488	MAP3K9-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000412550.2		
VPS39	23339	hgsc.bcm.edu	37	15	42453011	42453011	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr15:42453011G>A	ENST00000348544.4	-	26	2601	c.2602C>T	c.(2602-2604)Ccc>Tcc	p.P868S	VPS39_ENST00000318006.5_Missense_Mutation_p.P857S			Q96JC1	VPS39_HUMAN	vacuolar protein sorting 39 homolog (S. cerevisiae)	868					intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)	endosome (GO:0005768)|HOPS complex (GO:0030897)|lysosomal membrane (GO:0005765)	small GTPase regulator activity (GO:0005083)			breast(2)|kidney(5)|large_intestine(4)|lung(8)|ovary(1)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	28		all_cancers(109;6.78e-16)|all_epithelial(112;1.81e-14)|Lung NSC(122;5.01e-09)|all_lung(180;2.24e-08)|Melanoma(134;0.0574)|Colorectal(260;0.152)		GBM - Glioblastoma multiforme(94;3.05e-06)		ACTCCATTGGGGTATCTTGCA	0.537																																					p.P857S		Atlas-SNP	.											.	VPS39	53	.	0			c.C2569T						.						127.0	113.0	117.0					15																	42453011		2203	4299	6502	SO:0001583	missense	23339	exon25			CATTGGGGTATCT	AF280814	CCDS10083.1, CCDS73710.1	15q14	2008-02-05	2006-12-19		ENSG00000166887	ENSG00000166887			20593	protein-coding gene	gene with protein product		612188	"""vacuolar protein sorting 39 (yeast)"""			11448994	Standard	XM_005254259		Approved	KIAA0770, VAM6	uc001zpc.3	Q96JC1	OTTHUMG00000130467	ENST00000348544.4:c.2602C>T	chr15.hg19:g.42453011G>A	ENSP00000335193:p.Pro868Ser	117.0	0.0		110.0	21.0	NM_015289	O94869|Q71SQ6|Q7Z3V3|Q96B93|Q96RM0	Missense_Mutation	SNP	ENST00000348544.4	hg19	CCDS10083.1	.	.	.	.	.	.	.	.	.	.	G	26.9	4.786091	0.90282	.	.	ENSG00000166887	ENST00000318006;ENST00000348544	T;T	0.58506	0.33;0.34	6.04	6.04	0.98038	Vacuolar sorting protein 39/Transforming growth factor beta receptor-associated domain 2 (1);	0.000000	0.85682	D	0.000000	T	0.78310	0.4263	M	0.81179	2.53	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.74023	0.982;0.969	T	0.78989	-0.1986	10	0.62326	D	0.03	-19.4284	18.7597	0.91845	0.0:0.0:1.0:0.0	.	868;857	Q96JC1;Q96JC1-2	VPS39_HUMAN;.	S	857;868	ENSP00000326534:P857S;ENSP00000335193:P868S	ENSP00000326534:P857S	P	-	1	0	VPS39	40240303	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.920000	0.92779	2.873000	0.98535	0.561000	0.74099	CCC	.	.		0.537	VPS39-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000420472.1	NM_015289	
SPATA8	145946	hgsc.bcm.edu	37	15	97326945	97326945	+	Silent	SNP	C	C	A			TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr15:97326945C>A	ENST00000328504.3	+	1	327	c.60C>A	c.(58-60)gcC>gcA	p.A20A	SPATA8_ENST00000558553.1_Intron|SPATA8-AS1_ENST00000558722.1_RNA|SPATA8-AS1_ENST00000560888.1_RNA	NM_173499.3	NP_775770.1	Q6RVD6	SPAT8_HUMAN	spermatogenesis associated 8	20										large_intestine(4)|lung(8)|ovary(1)|skin(3)	16	Melanoma(26;0.0142)|Lung NSC(78;0.041)|all_lung(78;0.0468)		OV - Ovarian serous cystadenocarcinoma(32;0.0718)			AGGAAATTGCCCCCTCTTTTC	0.557																																					p.A20A		Atlas-SNP	.											.	SPATA8	42	.	0			c.C60A						.						81.0	71.0	74.0					15																	97326945		2197	4298	6495	SO:0001819	synonymous_variant	145946	exon1			AATTGCCCCCTCT	AY489187	CCDS10376.1	15q26	2008-02-05			ENSG00000185594	ENSG00000185594			28676	protein-coding gene	gene with protein product		613948					Standard	NM_173499		Approved	MGC44294	uc002bue.3	Q6RVD6	OTTHUMG00000149847	ENST00000328504.3:c.60C>A	chr15.hg19:g.97326945C>A		99.0	0.0		80.0	22.0	NM_173499	Q2KJ07	Silent	SNP	ENST00000328504.3	hg19	CCDS10376.1																																																																																			.	.		0.557	SPATA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313533.1	NM_173499	
BBS2	583	hgsc.bcm.edu	37	16	56539942	56539942	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr16:56539942T>C	ENST00000245157.5	-	7	1144	c.724A>G	c.(724-726)Aat>Gat	p.N242D	BBS2_ENST00000568104.1_Missense_Mutation_p.N242D|BBS2_ENST00000561951.1_5'UTR	NM_031885.3	NP_114091	Q9BXC9	BBS2_HUMAN	Bardet-Biedl syndrome 2	242					adult behavior (GO:0030534)|artery smooth muscle contraction (GO:0014824)|brain morphogenesis (GO:0048854)|cartilage development (GO:0051216)|cerebral cortex development (GO:0021987)|cilium morphogenesis (GO:0060271)|fat cell differentiation (GO:0045444)|Golgi to plasma membrane protein transport (GO:0043001)|hippocampus development (GO:0021766)|melanosome transport (GO:0032402)|negative regulation of appetite by leptin-mediated signaling pathway (GO:0038108)|negative regulation of gene expression (GO:0010629)|negative regulation of multicellular organism growth (GO:0040015)|nonmotile primary cilium assembly (GO:0035058)|photoreceptor cell maintenance (GO:0045494)|positive regulation of multicellular organism growth (GO:0040018)|protein localization (GO:0008104)|protein localization to organelle (GO:0033365)|regulation of cilium beat frequency involved in ciliary motility (GO:0060296)|sperm axoneme assembly (GO:0007288)|striatum development (GO:0021756)|vasodilation (GO:0042311)|visual perception (GO:0007601)	BBSome (GO:0034464)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|motile cilium (GO:0031514)|plasma membrane (GO:0005886)	RNA polymerase II repressing transcription factor binding (GO:0001103)			breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(10)|ovary(1)|skin(3)	26						ATGGCATGATTTTTCGACTGA	0.343									Bardet-Biedl syndrome																												p.N242D		Atlas-SNP	.											.	BBS2	67	.	0			c.A724G						.						79.0	80.0	79.0					16																	56539942		2198	4300	6498	SO:0001583	missense	583	exon7	Familial Cancer Database	BBS, Bardet-Biedl syndrome, type 1-12: BBS1-12,Laurence-Moon-Biedl syndrome	CATGATTTTTCGA	AF342736	CCDS32451.1	16q21	2013-01-08				ENSG00000125124			967	protein-coding gene	gene with protein product		606151		BBS		11285252	Standard	NM_031885		Approved		uc002ejd.2	Q9BXC9		ENST00000245157.5:c.724A>G	chr16.hg19:g.56539942T>C	ENSP00000245157:p.Asn242Asp	105.0	0.0		68.0	25.0	NM_031885	Q96CM0|Q96SN9	Missense_Mutation	SNP	ENST00000245157.5	hg19	CCDS32451.1	.	.	.	.	.	.	.	.	.	.	T	25.3	4.618986	0.87460	.	.	ENSG00000125124	ENST00000245157	D	0.86230	-2.09	5.7	5.7	0.88788	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	D	0.92984	0.7767	M	0.77103	2.36	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.71184	0.972;0.972	D	0.92872	0.6315	10	0.45353	T	0.12	-18.2174	15.9668	0.79979	0.0:0.0:0.0:1.0	.	242;242	A8K0N9;Q9BXC9	.;BBS2_HUMAN	D	242	ENSP00000245157:N242D	ENSP00000245157:N242D	N	-	1	0	BBS2	55097443	1.000000	0.71417	1.000000	0.80357	0.727000	0.41649	7.805000	0.86005	2.173000	0.68751	0.533000	0.62120	AAT	.	.		0.343	BBS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000434386.2	NM_031885	
PSKH1	5681	hgsc.bcm.edu	37	16	67942761	67942761	+	Missense_Mutation	SNP	C	C	T	rs374100286		TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr16:67942761C>T	ENST00000291041.5	+	2	279	c.109C>T	c.(109-111)Cac>Tac	p.H37Y		NM_006742.2	NP_006733.1	P11801	KPSH1_HUMAN	protein serine kinase H1	37						cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|endometrium(2)|large_intestine(1)|lung(7)|pancreas(1)	12		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0044)|Epithelial(162;0.0197)|all cancers(182;0.128)		CGTGTACAAGCACTTCATCAC	0.592																																					p.H37Y		Atlas-SNP	.											.	PSKH1	28	.	0			c.C109T						.						118.0	89.0	99.0					16																	67942761		2198	4300	6498	SO:0001583	missense	5681	exon2			TACAAGCACTTCA	M14504	CCDS10851.1	16q22.1	2008-02-05			ENSG00000159792	ENSG00000159792			9529	protein-coding gene	gene with protein product		177015				8268911	Standard	NM_006742		Approved		uc002euv.3	P11801	OTTHUMG00000137548	ENST00000291041.5:c.109C>T	chr16.hg19:g.67942761C>T	ENSP00000291041:p.His37Tyr	168.0	0.0		97.0	35.0	NM_006742	Q9NY19	Missense_Mutation	SNP	ENST00000291041.5	hg19	CCDS10851.1	.	.	.	.	.	.	.	.	.	.	C	14.86	2.660567	0.47572	.	.	ENSG00000159792	ENST00000291041	T	0.67698	-0.28	5.8	5.8	0.92144	.	0.097482	0.64402	D	0.000001	T	0.56877	0.2015	L	0.40543	1.245	0.40157	D	0.977011	B	0.32829	0.386	B	0.25759	0.063	T	0.61783	-0.6992	10	0.72032	D	0.01	-29.9324	14.4963	0.67691	0.1469:0.8531:0.0:0.0	.	37	P11801	KPSH1_HUMAN	Y	37	ENSP00000291041:H37Y	ENSP00000291041:H37Y	H	+	1	0	PSKH1	66500262	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	3.733000	0.55029	2.755000	0.94549	0.655000	0.94253	CAC	.	.		0.592	PSKH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268882.3	NM_006742	
SNAI3	333929	hgsc.bcm.edu	37	16	88747782	88747782	+	Silent	SNP	C	C	A			TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr16:88747782C>A	ENST00000332281.5	-	2	503	c.417G>T	c.(415-417)ctG>ctT	p.L139L	SNAI3-AS1_ENST00000563261.1_RNA	NM_178310.3	NP_840101.1	Q3KNW1	SNAI3_HUMAN	snail family zinc finger 3	139					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	copper ion binding (GO:0005507)|DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|central_nervous_system(1)|kidney(1)|lung(1)|ovary(1)|skin(1)	6				BRCA - Breast invasive adenocarcinoma(80;0.048)		CAGCCCCAAGCAGTTTTTCCG	0.687																																					p.L139L	Colon(27;366 710 19748 23199 27567)	Atlas-SNP	.											.	SNAI3	23	.	0			c.G417T						.						38.0	49.0	46.0					16																	88747782		2198	4299	6497	SO:0001819	synonymous_variant	333929	exon2			CCCAAGCAGTTTT	BC041461	CCDS32505.1	16q24.3	2013-05-23	2013-05-23			ENSG00000185669		"""Snail homologs"", ""Zinc fingers, C2H2-type"""	18411	protein-coding gene	gene with protein product		612741	"""zinc finger protein 293"", ""snail homolog 3 (Drosophila)"""	ZNF293		12579345	Standard	NM_178310		Approved	SMUC, Zfp293	uc002flj.3	Q3KNW1		ENST00000332281.5:c.417G>T	chr16.hg19:g.88747782C>A		111.0	0.0		64.0	21.0	NM_178310	Q86SU5	Silent	SNP	ENST00000332281.5	hg19	CCDS32505.1																																																																																			.	.		0.687	SNAI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000422582.1		
PITPNM3	83394	hgsc.bcm.edu	37	17	6386917	6386917	+	Silent	SNP	G	G	A	rs367702668		TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr17:6386917G>A	ENST00000262483.8	-	6	594	c.507C>T	c.(505-507)ttC>ttT	p.F169F	PITPNM3_ENST00000421306.3_Silent_p.F133F	NM_031220.3	NP_112497.2	Q9BZ71	PITM3_HUMAN	PITPNM family member 3	169					phosphatidylinositol metabolic process (GO:0046488)|phospholipid transport (GO:0015914)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)	calcium ion binding (GO:0005509)|lipid binding (GO:0008289)|phosphatidylinositol transporter activity (GO:0008526)|receptor tyrosine kinase binding (GO:0030971)			autonomic_ganglia(1)|central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(9)|lung(10)|ovary(3)|prostate(3)|skin(2)	36				Colorectal(2;0.000372)|READ - Rectum adenocarcinoma(2;0.0276)|LUAD - Lung adenocarcinoma(2;0.0836)|COAD - Colon adenocarcinoma(228;0.185)		GGGCAGCAGGGAAATGGGCTC	0.597																																					p.F169F		Atlas-SNP	.											.	PITPNM3	91	.	0			c.C507T						.						152.0	101.0	118.0					17																	6386917		2203	4300	6503	SO:0001819	synonymous_variant	83394	exon6			AGCAGGGAAATGG	AF334586	CCDS11076.1, CCDS54080.1	17p13	2013-07-18	2013-07-18	2013-07-18	ENSG00000091622	ENSG00000091622		"""GPCR / Class A : Chemokine receptors : Atypical"""	21043	protein-coding gene	gene with protein product	"""atypical chemokine receptor 6"""	608921	"""cone rod dystrophy 5"""	CORD5		10022914	Standard	NM_031220		Approved	NIR1, RDGBA3, ACKR6	uc002gdd.4	Q9BZ71	OTTHUMG00000102039	ENST00000262483.8:c.507C>T	chr17.hg19:g.6386917G>A		126.0	0.0		67.0	29.0	NM_031220	A1A5D0|F8WEW5|Q59GH9|Q9NPQ4	Silent	SNP	ENST00000262483.8	hg19	CCDS11076.1																																																																																			.	.		0.597	PITPNM3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000219824.2	NM_031220	
TP53	7157	hgsc.bcm.edu	37	17	7577570	7577570	+	Missense_Mutation	SNP	C	C	A	rs587782664		TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr17:7577570C>A	ENST00000269305.4	-	7	900	c.711G>T	c.(709-711)atG>atT	p.M237I	TP53_ENST00000445888.2_Missense_Mutation_p.M237I|TP53_ENST00000455263.2_Missense_Mutation_p.M237I|TP53_ENST00000413465.2_Missense_Mutation_p.M237I|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000359597.4_Missense_Mutation_p.M237I|TP53_ENST00000420246.2_Missense_Mutation_p.M237I	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	237	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		M -> I (in LFS; germline mutation and in sporadic cancers; somatic mutation).|M -> K (in sporadic cancers; somatic mutation).|M -> L (in sporadic cancers; somatic mutation).|M -> R (in sporadic cancers; somatic mutation).|M -> T (in sporadic cancers; somatic mutation).|M -> V (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.M237I(109)|p.0?(8)|p.?(5)|p.M144I(4)|p.M237_N239delMCN(4)|p.Y236_M237delYM(1)|p.H233fs*6(1)|p.M144_N146delMCN(1)|p.Y236_M243delYMCNSSCM(1)|p.C238fs*2(1)|p.V225fs*23(1)|p.M237_C238insX(1)|p.H233_C242del10(1)|p.M237fs*1(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	AACTGTTACACATGTAGTTGT	0.567		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.M237I	Pancreas(47;798 1329 9957 10801)	Atlas-SNP	.	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53_ENST00000545858,NS,adenocarcinoma,0,1	TP53	33396	.	139	Substitution - Missense(113)|Deletion - In frame(8)|Whole gene deletion(8)|Unknown(5)|Deletion - Frameshift(3)|Insertion - Frameshift(1)|Insertion - In frame(1)	upper_aerodigestive_tract(23)|ovary(22)|lung(18)|breast(18)|central_nervous_system(11)|haematopoietic_and_lymphoid_tissue(9)|large_intestine(9)|stomach(6)|biliary_tract(5)|bone(5)|oesophagus(4)|urinary_tract(3)|pancreas(2)|thyroid(1)|testis(1)|soft_tissue(1)|liver(1)	c.G711T	GRCh37	CM011014	TP53	M		.						130.0	102.0	112.0					17																	7577570		2203	4300	6503	SO:0001583	missense	7157	exon7	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	GTTACACATGTAG	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.711G>T	chr17.hg19:g.7577570C>A	ENSP00000269305:p.Met237Ile	88.0	0.0		51.0	22.0	NM_000546	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	hg19	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	C	22.4	4.282984	0.80692	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944	D;D;D;D;D;D;D;D	0.99793	-6.77;-6.77;-6.77;-6.77;-6.77;-6.77;-6.77;-6.77	4.09	3.12	0.35913	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99697	0.9885	M	0.86953	2.85	0.54753	D	0.999982	D;D;D;D;D;D	0.89917	1.0;0.975;0.999;1.0;0.998;1.0	D;P;D;D;D;D	0.91635	0.999;0.864;0.999;0.999;0.999;0.998	D	0.97922	1.0315	10	0.72032	D	0.01	-32.6033	10.0519	0.42221	0.0:0.8993:0.0:0.1007	.	237;237;144;237;237;237	P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;P53_HUMAN;.;.	I	237;237;237;237;237;237;226;144;105;144	ENSP00000410739:M237I;ENSP00000352610:M237I;ENSP00000269305:M237I;ENSP00000398846:M237I;ENSP00000391127:M237I;ENSP00000391478:M237I;ENSP00000425104:M105I;ENSP00000423862:M144I	ENSP00000269305:M237I	M	-	3	0	TP53	7518295	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.556000	0.82233	1.305000	0.44909	0.462000	0.41574	ATG	.	.		0.567	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
PER1	5187	hgsc.bcm.edu	37	17	8053380	8053380	+	Missense_Mutation	SNP	C	C	G			TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr17:8053380C>G	ENST00000317276.4	-	4	675	c.438G>C	c.(436-438)aaG>aaC	p.K146N	PER1_ENST00000354903.5_Missense_Mutation_p.K130N|PER1_ENST00000581082.1_Missense_Mutation_p.K146N	NM_002616.2	NP_002607.2	O15534	PER1_HUMAN	period circadian clock 1	146	Interaction with BTRC. {ECO:0000269|PubMed:15917222}.				circadian regulation of gene expression (GO:0032922)|circadian regulation of translation (GO:0097167)|circadian rhythm (GO:0007623)|entrainment of circadian clock (GO:0009649)|entrainment of circadian clock by photoperiod (GO:0043153)|histone H3 acetylation (GO:0043966)|histone H3 deacetylation (GO:0070932)|histone H4 acetylation (GO:0043967)|negative regulation of glucocorticoid receptor signaling pathway (GO:2000323)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of JNK cascade (GO:0046329)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|posttranscriptional regulation of gene expression (GO:0010608)|regulation of circadian rhythm (GO:0042752)|regulation of cytokine production involved in inflammatory response (GO:1900015)|regulation of hair cycle (GO:0042634)|regulation of p38MAPK cascade (GO:1900744)|regulation of sodium ion transport (GO:0002028)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|E-box binding (GO:0070888)|kinase binding (GO:0019900)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|signal transducer activity (GO:0004871)|transcription factor binding transcription factor activity (GO:0000989)|ubiquitin protein ligase binding (GO:0031625)			breast(4)|central_nervous_system(1)|endometrium(2)|kidney(7)|large_intestine(3)|lung(15)|ovary(4)|pancreas(1)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	47						GCAGTCGAAGCTTGAGCTCTC	0.607			T	ETV6	"""AML, CMML"""			Other conserved DNA damage response genes																													p.K146N		Atlas-SNP	.		Dom	yes		17	17p13.1-17p12	5187	period homolog 1 (Drosophila)		L	.	PER1	104	.	0			c.G438C						.						109.0	121.0	117.0					17																	8053380		2203	4300	6503	SO:0001583	missense	5187	exon4			TCGAAGCTTGAGC	AB002107	CCDS11131.1	17p13.1	2012-12-13	2012-12-13			ENSG00000179094			8845	protein-coding gene	gene with protein product		602260	"""period (Drosophila) homolog 1"", ""period homolog 1 (Drosophila)"""	PER		9323128	Standard	NM_002616		Approved	RIGUI	uc002gkd.3	O15534		ENST00000317276.4:c.438G>C	chr17.hg19:g.8053380C>G	ENSP00000314420:p.Lys146Asn	85.0	0.0		41.0	16.0	NM_002616	B2RPA8|B4DI49|D3DTR3	Missense_Mutation	SNP	ENST00000317276.4	hg19	CCDS11131.1	.	.	.	.	.	.	.	.	.	.	C	20.3	3.972943	0.74246	.	.	ENSG00000179094	ENST00000317276;ENST00000354903	T;T	0.61627	1.31;0.09	4.93	2.79	0.32731	.	0.000000	0.85682	D	0.000000	T	0.70202	0.3197	M	0.72894	2.215	0.46609	D	0.999126	D;D;D	0.89917	1.0;1.0;0.993	D;D;D	0.85130	0.996;0.997;0.977	T	0.71567	-0.4554	10	0.87932	D	0	-24.6327	7.9204	0.29843	0.0:0.7752:0.0:0.2248	.	146;130;146	Q6IN51;B4DI49;O15534	.;.;PER1_HUMAN	N	146;130	ENSP00000314420:K146N;ENSP00000346979:K130N	ENSP00000314420:K146N	K	-	3	2	PER1	7994105	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	2.430000	0.44766	1.283000	0.44513	0.563000	0.77884	AAG	.	.		0.607	PER1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441481.2		
MYH13	8735	hgsc.bcm.edu	37	17	10227448	10227448	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr17:10227448G>T	ENST00000418404.3	-	22	2988	c.2825C>A	c.(2824-2826)gCc>gAc	p.A942D	MYH13_ENST00000252172.4_Missense_Mutation_p.A942D|RP11-401O9.3_ENST00000577743.1_RNA			Q9UKX3	MYH13_HUMAN	myosin, heavy chain 13, skeletal muscle	942					cellular response to starvation (GO:0009267)|metabolic process (GO:0008152)|muscle contraction (GO:0006936)	extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			breast(3)|cervix(2)|endometrium(11)|kidney(7)|large_intestine(21)|lung(48)|ovary(7)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(2)	108						CCTCTTCTTGGCAACCAATTC	0.448																																					p.A942D		Atlas-SNP	.											.	MYH13	533	.	0			c.C2825A						.						139.0	143.0	142.0					17																	10227448		2163	4282	6445	SO:0001583	missense	8735	exon23			TTCTTGGCAACCA	AF075248	CCDS45613.1	17p13	2011-09-27	2006-09-29			ENSG00000006788		"""Myosins / Myosin superfamily : Class II"""	7571	protein-coding gene	gene with protein product	"""extraocular muscle myosin heavy chain"", ""extraocular myosin heavy chain"""	603487	"""myosin, heavy polypeptide 13, skeletal muscle"""			9806854	Standard	NM_003802		Approved	MyHC-eo	uc002gmk.1	Q9UKX3		ENST00000418404.3:c.2825C>A	chr17.hg19:g.10227448G>T	ENSP00000404570:p.Ala942Asp	103.0	0.0		65.0	19.0	NM_003802	O95252|Q9P0U8	Missense_Mutation	SNP	ENST00000418404.3	hg19	CCDS45613.1	.	.	.	.	.	.	.	.	.	.	G	22.6	4.306054	0.81247	.	.	ENSG00000006788	ENST00000252172;ENST00000418404	D	0.94138	-3.36	4.37	3.4	0.38934	.	.	.	.	.	D	0.95446	0.8521	M	0.83012	2.62	0.46478	D	0.999061	P;D	0.57899	0.955;0.981	P;P	0.56343	0.707;0.796	D	0.95440	0.8524	9	0.72032	D	0.01	.	12.2713	0.54708	0.0821:0.0:0.9179:0.0	.	568;942	B4DFX9;Q9UKX3	.;MYH13_HUMAN	D	942;568	ENSP00000252172:A942D	ENSP00000252172:A942D	A	-	2	0	MYH13	10168173	1.000000	0.71417	0.935000	0.37517	0.922000	0.55478	7.663000	0.83820	1.177000	0.42855	0.655000	0.94253	GCC	.	.		0.448	MYH13-003	KNOWN	alternative_3_UTR|alternative_5_UTR|NMD_exception|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442255.1	NM_003802	
MYO15A	51168	hgsc.bcm.edu	37	17	18036653	18036653	+	Silent	SNP	C	C	T			TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr17:18036653C>T	ENST00000205890.5	+	12	4773	c.4435C>T	c.(4435-4437)Ctg>Ttg	p.L1479L		NM_016239.3	NP_057323.3	Q9UKN7	MYO15_HUMAN	myosin XVA	1479	Myosin motor.				inner ear morphogenesis (GO:0042472)|locomotory behavior (GO:0007626)|sensory perception of sound (GO:0007605)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)|stereocilium (GO:0032420)	ATP binding (GO:0005524)|motor activity (GO:0003774)			breast(5)|central_nervous_system(2)|endometrium(17)|kidney(3)|large_intestine(16)|lung(27)|ovary(3)|pancreas(1)|prostate(6)|skin(13)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	99	all_neural(463;0.228)					CTTCCGCATCCTGGCCTCCAT	0.607																																					p.L1479L		Atlas-SNP	.											.	MYO15A	268	.	0			c.C4435T						.						49.0	53.0	52.0					17																	18036653		2097	4219	6316	SO:0001819	synonymous_variant	51168	exon11			CGCATCCTGGCCT	AF144094	CCDS42271.1	17p11.2	2011-09-27			ENSG00000091536	ENSG00000091536		"""Myosins / Myosin superfamily : Class XV"""	7594	protein-coding gene	gene with protein product		602666		DFNB3, MYO15		9603736	Standard	NM_016239		Approved		uc021trl.1	Q9UKN7	OTTHUMG00000059390	ENST00000205890.5:c.4435C>T	chr17.hg19:g.18036653C>T		60.0	0.0		57.0	18.0	NM_016239	B4DFC7	Silent	SNP	ENST00000205890.5	hg19	CCDS42271.1																																																																																			.	.		0.607	MYO15A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132048.1	NM_016239	
GGNBP2	79893	hgsc.bcm.edu	37	17	34923515	34923515	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr17:34923515G>A	ENST00000304718.4	+	6	857	c.541G>A	c.(541-543)Gat>Aat	p.D181N		NM_024835.3	NP_079111.1	Q9H3C7	GGNB2_HUMAN	gametogenetin binding protein 2	181					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	cytoplasmic vesicle (GO:0031410)|nucleus (GO:0005634)				breast(1)|endometrium(4)|kidney(3)|large_intestine(7)|liver(1)|lung(14)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|stomach(1)	38		Breast(25;0.00957)|Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0193)		TTGTTGGATGGATGTATGGGA	0.348																																					p.D181N		Atlas-SNP	.											.	GGNBP2	72	.	0			c.G541A						.						148.0	140.0	143.0					17																	34923515		2203	4300	6503	SO:0001583	missense	79893	exon6			TGGATGGATGTAT	AF126964	CCDS11314.1	17q21.1	2014-05-06	2007-08-20	2007-08-20	ENSG00000005955	ENSG00000278311			19357	protein-coding gene	gene with protein product		612275	"""zinc finger protein 403"""	ZNF403		11728448	Standard	NM_024835		Approved	ZFP403, LZK1, FLJ22561, FLJ21230, DIF-3, DIF3	uc002hnb.3	Q9H3C7	OTTHUMG00000188440	ENST00000304718.4:c.541G>A	chr17.hg19:g.34923515G>A	ENSP00000307617:p.Asp181Asn	248.0	0.0		203.0	38.0	NM_024835	B2RPK7|Q96T90|Q9GZR8|Q9H767	Missense_Mutation	SNP	ENST00000304718.4	hg19	CCDS11314.1	.	.	.	.	.	.	.	.	.	.	G	28.6	4.936419	0.92458	.	.	ENSG00000005955	ENST00000304718	.	.	.	5.48	5.48	0.80851	.	0.098933	0.64402	D	0.000002	T	0.78941	0.4363	M	0.65498	2.005	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.76575	0.988;0.974	T	0.80291	-0.1444	9	0.72032	D	0.01	-8.1271	19.4017	0.94632	0.0:0.0:1.0:0.0	.	181;181	Q9H3C7;Q9H3C7-3	GGNB2_HUMAN;.	N	181	.	ENSP00000307617:D181N	D	+	1	0	GGNBP2	31997628	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.092000	0.94157	2.577000	0.86979	0.558000	0.71614	GAT	.	.		0.348	GGNBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256684.2	NM_024835	
GGNBP2	79893	hgsc.bcm.edu	37	17	34945736	34945736	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr17:34945736A>T	ENST00000304718.4	+	14	2305	c.1989A>T	c.(1987-1989)gaA>gaT	p.E663D	DHRS11_ENST00000590554.1_5'Flank|DHRS11_ENST00000251312.5_5'Flank	NM_024835.3	NP_079111.1	Q9H3C7	GGNB2_HUMAN	gametogenetin binding protein 2	663					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	cytoplasmic vesicle (GO:0031410)|nucleus (GO:0005634)				breast(1)|endometrium(4)|kidney(3)|large_intestine(7)|liver(1)|lung(14)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|stomach(1)	38		Breast(25;0.00957)|Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0193)		GCAATAGAGAACAATACCGAC	0.393																																					p.E663D		Atlas-SNP	.											.	GGNBP2	72	.	0			c.A1989T						.						139.0	154.0	149.0					17																	34945736		2203	4300	6503	SO:0001583	missense	79893	exon14			TAGAGAACAATAC	AF126964	CCDS11314.1	17q21.1	2014-05-06	2007-08-20	2007-08-20	ENSG00000005955	ENSG00000278311			19357	protein-coding gene	gene with protein product		612275	"""zinc finger protein 403"""	ZNF403		11728448	Standard	NM_024835		Approved	ZFP403, LZK1, FLJ22561, FLJ21230, DIF-3, DIF3	uc002hnb.3	Q9H3C7	OTTHUMG00000188440	ENST00000304718.4:c.1989A>T	chr17.hg19:g.34945736A>T	ENSP00000307617:p.Glu663Asp	113.0	0.0		132.0	24.0	NM_024835	B2RPK7|Q96T90|Q9GZR8|Q9H767	Missense_Mutation	SNP	ENST00000304718.4	hg19	CCDS11314.1	.	.	.	.	.	.	.	.	.	.	A	12.46	1.944414	0.34283	.	.	ENSG00000005955	ENST00000304718	.	.	.	5.85	5.85	0.93711	.	0.283334	0.39615	N	0.001317	T	0.41259	0.1151	N	0.14661	0.345	0.80722	D	1	B	0.09022	0.002	B	0.09377	0.004	T	0.31696	-0.9934	9	0.59425	D	0.04	-15.9473	12.0645	0.53580	0.9315:0.0:0.0685:0.0	.	663	Q9H3C7	GGNB2_HUMAN	D	663	.	ENSP00000307617:E663D	E	+	3	2	GGNBP2	32019849	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.320000	0.59203	2.237000	0.73441	0.459000	0.35465	GAA	.	.		0.393	GGNBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256684.2	NM_024835	
PLEKHM1	9842	hgsc.bcm.edu	37	17	43516880	43516880	+	Missense_Mutation	SNP	C	C	A	rs200261737		TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr17:43516880C>A	ENST00000430334.3	-	11	3155	c.3022G>T	c.(3022-3024)Gac>Tac	p.D1008Y	PLEKHM1_ENST00000580404.1_5'UTR|PLEKHM1_ENST00000421073.2_Missense_Mutation_p.D919Y	NM_014798.2	NP_055613.1	Q9Y4G2	PKHM1_HUMAN	pleckstrin homology domain containing, family M (with RUN domain) member 1	1008					intracellular signal transduction (GO:0035556)	cytoplasm (GO:0005737)	metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(6)|large_intestine(1)|lung(10)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	26	Renal(3;0.0405)					AAGATGATGTCGTGGTGCTGG	0.602																																					p.D1008Y		Atlas-SNP	.											.	PLEKHM1	69	.	0			c.G3022T						.						114.0	90.0	98.0					17																	43516880		2203	4300	6503	SO:0001583	missense	9842	exon11			TGATGTCGTGGTG	X85792	CCDS32671.1	17q21.31	2013-01-11				ENSG00000225190		"""Pleckstrin homology (PH) domain containing"""	29017	protein-coding gene	gene with protein product		611466				9205841, 12820725	Standard	NM_014798		Approved	KIAA0356	uc002ija.3	Q9Y4G2		ENST00000430334.3:c.3022G>T	chr17.hg19:g.43516880C>A	ENSP00000389913:p.Asp1008Tyr	56.0	0.0		54.0	12.0	NM_014798	Q6P2R5|Q8TEL9|Q9NPP5|Q9NYA0	Missense_Mutation	SNP	ENST00000430334.3	hg19	CCDS32671.1	.	.	.	.	.	.	.	.	.	.	C	29.1	4.979830	0.92982	.	.	ENSG00000225190	ENST00000430334;ENST00000421073	T;T	0.68331	-0.32;-0.32	5.2	5.2	0.72013	Protein kinase C-like, phorbol ester/diacylglycerol binding (2);	0.100604	0.64402	D	0.000003	D	0.82889	0.5135	M	0.84082	2.675	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.77557	0.99;0.987	D	0.85204	0.1017	10	0.87932	D	0	.	16.362	0.83271	0.0:1.0:0.0:0.0	.	919;1008	F8W648;Q9Y4G2	.;PKHM1_HUMAN	Y	1008;919	ENSP00000389913:D1008Y;ENSP00000414352:D919Y	ENSP00000414352:D919Y	D	-	1	0	PLEKHM1	40872663	1.000000	0.71417	0.997000	0.53966	0.920000	0.55202	4.727000	0.61993	2.720000	0.93068	0.556000	0.70494	GAC	.	C|0.999;T|0.001		0.602	PLEKHM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444659.1	NM_014798	
TBC1D16	125058	hgsc.bcm.edu	37	17	77921558	77921558	+	Silent	SNP	C	C	T			TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr17:77921558C>T	ENST00000310924.2	-	9	1729	c.1614G>A	c.(1612-1614)gcG>gcA	p.A538A	TBC1D16_ENST00000340848.7_Silent_p.A176A|TBC1D16_ENST00000576768.1_Silent_p.A163A|TBC1D16_ENST00000570373.1_Silent_p.A177A|TBC1D16_ENST00000572862.1_Silent_p.A176A	NM_001271844.1|NM_001271845.1|NM_019020.2	NP_001258773.1|NP_001258774.1|NP_061893.2	Q8TBP0	TBC16_HUMAN	TBC1 domain family, member 16	538	Rab-GAP TBC. {ECO:0000255|PROSITE- ProRule:PRU00163}.						Rab GTPase activator activity (GO:0005097)	p.A538A(1)		NS(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(13)|ovary(1)|prostate(3)	28	all_neural(118;0.167)		OV - Ovarian serous cystadenocarcinoma(97;0.00739)|BRCA - Breast invasive adenocarcinoma(99;0.0819)			CCAAGATGGGCGCCACCAGGT	0.602																																					p.A538A	Ovarian(14;397 562 4850 31922 49378)	Atlas-SNP	.											TBC1D16,colon,carcinoma,0,1	TBC1D16	48	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1614A						.						116.0	87.0	97.0					17																	77921558		2203	4300	6503	SO:0001819	synonymous_variant	125058	exon9			GATGGGCGCCACC	AL157485	CCDS11766.1, CCDS62351.1, CCDS62352.1, CCDS62353.1	17q25.3	2013-07-10				ENSG00000167291			28356	protein-coding gene	gene with protein product						23019362	Standard	NM_019020		Approved	MGC25062, FLJ20748	uc002jxj.4	Q8TBP0		ENST00000310924.2:c.1614G>A	chr17.hg19:g.77921558C>T		148.0	0.0		127.0	36.0	NM_019020	B9A6L7|I3L1E0|I3L4U2|Q8N3Z4|Q96DH7	Silent	SNP	ENST00000310924.2	hg19	CCDS11766.1																																																																																			.	.		0.602	TBC1D16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437145.1	NM_019020	
METRNL	284207	hgsc.bcm.edu	37	17	81052084	81052084	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr17:81052084C>T	ENST00000320095.7	+	4	825	c.700C>T	c.(700-702)Cgg>Tgg	p.R234W	METRNL_ENST00000571940.1_3'UTR|METRNL_ENST00000571814.1_Missense_Mutation_p.R152W|METRNL_ENST00000570778.1_Missense_Mutation_p.R152W	NM_001004431.1	NP_001004431.1	Q641Q3	METRL_HUMAN	meteorin, glial cell differentiation regulator-like	234					brown fat cell differentiation (GO:0050873)|fat cell differentiation (GO:0045444)|negative regulation of inflammatory response (GO:0050728)|positive regulation of brown fat cell differentiation (GO:0090336)|positive regulation of energy homeostasis (GO:2000507)|response to cold (GO:0009409)|response to muscle activity (GO:0014850)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	hormone activity (GO:0005179)			endometrium(1)|kidney(1)|large_intestine(1)|lung(3)|skin(1)|upper_aerodigestive_tract(1)	8	Breast(20;0.000443)|all_neural(118;0.0779)		BRCA - Breast invasive adenocarcinoma(99;0.0517)|OV - Ovarian serous cystadenocarcinoma(97;0.0868)			CAGACTCTATCGGCAGAAAAG	0.672																																					p.R234W		Atlas-SNP	.											.	METRNL	29	.	0			c.C700T						.						54.0	56.0	56.0					17																	81052084		2202	4292	6494	SO:0001583	missense	284207	exon4			CTCTATCGGCAGA	AK093748	CCDS32779.1	17q25.3	2004-12-01				ENSG00000176845			27584	protein-coding gene	gene with protein product							Standard	NM_001004431		Approved		uc002kgh.3	Q641Q3		ENST00000320095.7:c.700C>T	chr17.hg19:g.81052084C>T	ENSP00000315731:p.Arg234Trp	212.0	0.0		155.0	44.0	NM_001004431	B3KSJ5|Q86VM0	Missense_Mutation	SNP	ENST00000320095.7	hg19	CCDS32779.1	.	.	.	.	.	.	.	.	.	.	C	12.24	1.878071	0.33162	.	.	ENSG00000176845	ENST00000320095	T	0.32515	1.45	5.12	3.02	0.34903	.	0.000000	0.85682	U	0.000000	T	0.32912	0.0845	L	0.58101	1.795	0.58432	D	0.999998	D	0.55800	0.973	P	0.46110	0.504	T	0.06006	-1.0851	9	.	.	.	-25.8411	11.285	0.49216	0.4709:0.5291:0.0:0.0	.	234	Q641Q3	METRL_HUMAN	W	234	ENSP00000315731:R234W	.	R	+	1	2	METRNL	78645504	0.291000	0.24352	0.911000	0.35937	0.372000	0.29890	0.020000	0.13466	0.599000	0.29845	0.561000	0.74099	CGG	.	.		0.672	METRNL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438902.1	NM_001004431	
PTPRM	5797	hgsc.bcm.edu	37	18	8370961	8370961	+	Missense_Mutation	SNP	A	A	T	rs551645103		TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr18:8370961A>T	ENST00000332175.8	+	22	4126	c.3089A>T	c.(3088-3090)gAa>gTa	p.E1030V	PTPRM_ENST00000400060.4_Missense_Mutation_p.E1044V|PTPRM_ENST00000400053.4_Missense_Mutation_p.E968V|PTPRM_ENST00000580170.1_Missense_Mutation_p.E1043V|PTPRM_ENST00000444013.1_Missense_Mutation_p.E817V	NM_002845.3	NP_002836.3	P28827	PTPRM_HUMAN	protein tyrosine phosphatase, receptor type, M	1030	Tyrosine-protein phosphatase 1. {ECO:0000255|PROSITE-ProRule:PRU00160}.				homophilic cell adhesion (GO:0007156)|negative regulation of angiogenesis (GO:0016525)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of endothelial cell proliferation (GO:0001937)|neuron projection development (GO:0031175)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of vasodilation (GO:0045909)|protein dephosphorylation (GO:0006470)|response to drug (GO:0042493)|retina layer formation (GO:0010842)|retinal ganglion cell axon guidance (GO:0031290)|signal transduction (GO:0007165)	cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|perinuclear region of cytoplasm (GO:0048471)	cadherin binding (GO:0045296)|identical protein binding (GO:0042802)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(3)|central_nervous_system(1)|cervix(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(32)|lung(25)|ovary(2)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	90		Colorectal(10;0.234)				ATAGAAACAGAACTACTGGCA	0.338													A|||	1	0.000199681	0.0	0.0	5008	,	,		20012	0.001		0.0	False		,,,				2504	0.0				p.E1043V		Atlas-SNP	.											.	PTPRM	185	.	0			c.A3128T						.						100.0	99.0	99.0					18																	8370961		2203	4300	6503	SO:0001583	missense	5797	exon24			AAACAGAACTACT	X58288	CCDS11840.1, CCDS58613.1	18p11.2	2013-02-11			ENSG00000173482	ENSG00000173482		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	9675	protein-coding gene	gene with protein product		176888		PTPRL1		1655529, 8404049	Standard	NM_002845		Approved	RPTPU, hR-PTPu	uc010dkv.3	P28827	OTTHUMG00000131575	ENST00000332175.8:c.3089A>T	chr18.hg19:g.8370961A>T	ENSP00000331418:p.Glu1030Val	107.0	0.0		98.0	29.0	NM_001105244	A7MBN1|D3DUH8|J3QL11	Missense_Mutation	SNP	ENST00000332175.8	hg19	CCDS11840.1	.	.	.	.	.	.	.	.	.	.	A	22.6	4.315533	0.81469	.	.	ENSG00000173482	ENST00000332175;ENST00000400060;ENST00000400053;ENST00000444013	D;D;D;D	0.84070	-1.8;-1.8;-1.8;-1.8	5.56	5.56	0.83823	Protein-tyrosine phosphatase, receptor/non-receptor type (3);	0.048422	0.85682	D	0.000000	D	0.86385	0.5920	L	0.60455	1.87	0.58432	D	0.999999	D;P;P	0.63046	0.992;0.956;0.952	D;P;P	0.63793	0.918;0.525;0.618	T	0.82780	-0.0288	10	0.02654	T	1	.	16.0068	0.80367	1.0:0.0:0.0:0.0	.	817;1043;1030	E7EVX9;A7MBN1;P28827	.;.;PTPRM_HUMAN	V	1030;1044;968;817	ENSP00000331418:E1030V;ENSP00000382933:E1044V;ENSP00000382927:E968V;ENSP00000387608:E817V	ENSP00000331418:E1030V	E	+	2	0	PTPRM	8360961	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.255000	0.95524	2.240000	0.73641	0.528000	0.53228	GAA	.	.		0.338	PTPRM-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000254456.1		
TTC39C	125488	hgsc.bcm.edu	37	18	21660787	21660787	+	Silent	SNP	G	G	A			TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr18:21660787G>A	ENST00000317571.3	+	5	935	c.699G>A	c.(697-699)gtG>gtA	p.V233V	RP11-403A21.3_ENST00000578443.1_RNA|TTC39C_ENST00000304621.6_Silent_p.V172V	NM_001135993.1	NP_001129465.1	Q8N584	TT39C_HUMAN	tetratricopeptide repeat domain 39C	233										breast(1)|endometrium(3)|kidney(3)|large_intestine(4)|lung(5)|ovary(1)|prostate(1)|skin(1)	19						TATCCATGGTGCCCCCAAACC	0.483																																					p.V233V		Atlas-SNP	.											TTC39C_ENST00000317571,NS,neuroblastoma,0,2	TTC39C	83	.	0			c.G699A						.						103.0	99.0	100.0					18																	21660787		2203	4300	6503	SO:0001819	synonymous_variant	125488	exon5			CATGGTGCCCCCA	AK091080	CCDS32804.1, CCDS45839.1, CCDS58616.1	18q11.2	2014-02-07	2008-06-23	2008-06-23	ENSG00000168234	ENSG00000168234		"""Tetratricopeptide (TTC) repeat domain containing"""	26595	protein-coding gene	gene with protein product			"""chromosome 18 open reading frame 17"""	C18orf17		14702039	Standard	NM_153211		Approved	FLJ33761, HsT2697	uc002kuw.3	Q8N584	OTTHUMG00000179403	ENST00000317571.3:c.699G>A	chr18.hg19:g.21660787G>A		95.0	0.0		106.0	34.0	NM_001135993	B7WP63|J3QRR1|Q0VAJ2|Q8N284	Silent	SNP	ENST00000317571.3	hg19	CCDS45839.1																																																																																			.	.		0.483	TTC39C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446107.1	NM_153211	
ZNF521	25925	hgsc.bcm.edu	37	18	22805355	22805355	+	Nonsense_Mutation	SNP	C	C	A			TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr18:22805355C>A	ENST00000361524.3	-	4	2675	c.2527G>T	c.(2527-2529)Gga>Tga	p.G843*	ZNF521_ENST00000584787.1_Nonsense_Mutation_p.G623*|ZNF521_ENST00000538137.2_Nonsense_Mutation_p.G843*|ZNF521_ENST00000579111.1_5'Flank	NM_015461.2	NP_056276.1	Q96K83	ZN521_HUMAN	zinc finger protein 521	843					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein domain specific binding (GO:0019904)			NS(1)|breast(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(21)|lung(97)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	149	all_cancers(21;0.0025)|all_epithelial(16;3.62e-05)|Ovarian(20;0.0991)					CCATTTGTTCCACAGTTGGGT	0.478			T	PAX5	ALL																																p.G843X		Atlas-SNP	.		Dom	yes		18	18q11.2	25925	zinc finger protein 521		L	.	ZNF521	269	.	0			c.G2527T						.						183.0	175.0	178.0					18																	22805355		2203	4300	6503	SO:0001587	stop_gained	25925	exon4			TTGTTCCACAGTT	AK027354	CCDS32806.1	18q11.2	2013-01-08				ENSG00000198795		"""Zinc fingers, C2H2-type"""	24605	protein-coding gene	gene with protein product	"""early hematopoietic zinc finger"""	610974				11984006, 14630787	Standard	NM_015461		Approved	EHZF, Evi3	uc002kvk.2	Q96K83		ENST00000361524.3:c.2527G>T	chr18.hg19:g.22805355C>A	ENSP00000354794:p.Gly843*	127.0	0.0		114.0	26.0	NM_015461	A3QVP7|B0YJB7|Q8IXI0|Q8TES6|Q9C065|Q9HAL5|Q9UFK4	Nonsense_Mutation	SNP	ENST00000361524.3	hg19	CCDS32806.1	.	.	.	.	.	.	.	.	.	.	C	37	6.138049	0.97315	.	.	ENSG00000198795	ENST00000361524;ENST00000538137;ENST00000399425	.	.	.	5.93	5.93	0.95920	.	0.106321	0.64402	D	0.000003	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	-23.3642	13.5312	0.61623	0.0:0.9294:0.0:0.0706	.	.	.	.	X	843;877;843	.	ENSP00000354794:G843X	G	-	1	0	ZNF521	21059353	0.994000	0.37717	0.900000	0.35374	0.082000	0.17680	4.675000	0.61619	2.826000	0.97356	0.655000	0.94253	GGA	.	.		0.478	ZNF521-001	KNOWN	overlapping_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446781.2	NM_015461	
NOL4	8715	hgsc.bcm.edu	37	18	31709985	31709985	+	Splice_Site	SNP	C	C	A			TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr18:31709985C>A	ENST00000261592.5	-	2	562		c.e2-1		NOL4_ENST00000538587.1_Splice_Site|NOL4_ENST00000535475.1_Splice_Site|NOL4_ENST00000589544.1_Splice_Site|NOL4_ENST00000269185.4_Splice_Site	NM_001198546.1|NM_003787.4	NP_001185475.1|NP_003778.2	O94818	NOL4_HUMAN	nucleolar protein 4							nucleolus (GO:0005730)	RNA binding (GO:0003723)			NS(1)|breast(2)|endometrium(6)|kidney(1)|large_intestine(7)|lung(20)|ovary(4)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	51						CTACGCCATCCTGGAAACAAA	0.343																																					.		Atlas-SNP	.											.	NOL4	139	.	0			c.265-1G>T						.						50.0	47.0	48.0					18																	31709985		2202	4299	6501	SO:0001630	splice_region_variant	8715	exon3			GCCATCCTGGAAA	AB017800	CCDS11907.2, CCDS56058.1, CCDS56059.1, CCDS59308.1	18q12	2010-05-04			ENSG00000101746	ENSG00000101746			7870	protein-coding gene	gene with protein product	"""cancer/testis antigen 125"""	603577				9813152	Standard	NM_003787		Approved	NOLP, HRIHFB2255, CT125	uc010dmi.3	O94818	OTTHUMG00000132291	ENST00000261592.5:c.265-1G>T	chr18.hg19:g.31709985C>A		105.0	0.0		85.0	20.0	NM_001198546	B4DSQ0|B7Z3Z7|F5H1E3|Q6IBS2|Q9BWF1	Splice_Site	SNP	ENST00000261592.5	hg19	CCDS11907.2	.	.	.	.	.	.	.	.	.	.	C	23.0	4.359656	0.82353	.	.	ENSG00000101746	ENST00000261592;ENST00000538587	.	.	.	5.72	5.72	0.89469	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.866	0.92292	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	NOL4	29963983	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	6.772000	0.75001	2.710000	0.92621	0.585000	0.79938	.	.	.		0.343	NOL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255386.1	NM_003787	Intron
NFATC1	4772	hgsc.bcm.edu	37	18	77170794	77170794	+	Silent	SNP	G	G	T	rs571313182		TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr18:77170794G>T	ENST00000427363.2	+	2	519	c.519G>T	c.(517-519)ccG>ccT	p.P173P	NFATC1_ENST00000587635.1_Silent_p.P173P|NFATC1_ENST00000586434.1_Silent_p.P160P|NFATC1_ENST00000545796.1_Intron|NFATC1_ENST00000253506.5_Silent_p.P173P|NFATC1_ENST00000318065.5_Silent_p.P160P|NFATC1_ENST00000542384.1_Silent_p.P173P|NFATC1_ENST00000591814.1_Silent_p.P173P|NFATC1_ENST00000329101.4_Silent_p.P160P|NFATC1_ENST00000592223.1_Silent_p.P160P|NFATC1_ENST00000397790.2_Intron			O95644	NFAC1_HUMAN	nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 1	173	Trans-activation domain A (TAD-A).				calcium ion transport (GO:0006816)|epithelial to mesenchymal transition (GO:0001837)|Fc-epsilon receptor signaling pathway (GO:0038095)|G1/S transition of mitotic cell cycle (GO:0000082)|heart development (GO:0007507)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|osteoclast differentiation (GO:0030316)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)	FK506 binding (GO:0005528)|mitogen-activated protein kinase p38 binding (GO:0048273)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			NS(2)|breast(1)|endometrium(7)|kidney(1)|large_intestine(4)|lung(17)|ovary(2)|prostate(4)|skin(1)|soft_tissue(1)	40		Esophageal squamous(42;0.0157)|Melanoma(33;0.144)		OV - Ovarian serous cystadenocarcinoma(15;3.73e-07)|BRCA - Breast invasive adenocarcinoma(31;0.0257)	Pseudoephedrine(DB00852)	GCCTGAGCCCGGCCAGCAGCC	0.662																																					p.P173P	GBM(151;1210 2593 28719 45011)	Atlas-SNP	.											.	NFATC1	105	.	0			c.G519T						.						40.0	43.0	42.0					18																	77170794		2203	4299	6502	SO:0001819	synonymous_variant	4772	exon2			GAGCCCGGCCAGC	U08015	CCDS12015.1, CCDS12016.1, CCDS32850.1, CCDS59326.1, CCDS59327.1, CCDS62467.1, CCDS62468.1, CCDS62469.1, CCDS62470.1, CCDS62471.1	18q23	2009-11-24			ENSG00000131196	ENSG00000131196		"""Nuclear factor of activated T-cells"""	7775	protein-coding gene	gene with protein product		600489				8202141	Standard	NM_001278669		Approved	NF-ATC, NFATc, NFAT2	uc002lnf.3	O95644	OTTHUMG00000132897	ENST00000427363.2:c.519G>T	chr18.hg19:g.77170794G>T		58.0	0.0		42.0	14.0	NM_006162	B5B2M4|B5B2M5|B5B2M6|B5B2M7|B5B2M8|B5B2M9|B5B2N1|Q12865|Q15793|Q2M1S3	Silent	SNP	ENST00000427363.2	hg19																																																																																				.	.		0.662	NFATC1-007	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000450507.1	NM_172390	
EVI5L	115704	hgsc.bcm.edu	37	19	7923102	7923102	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr19:7923102C>T	ENST00000270530.4	+	12	1422	c.1226C>T	c.(1225-1227)gCg>gTg	p.A409V	EVI5L_ENST00000600802.1_3'UTR|EVI5L_ENST00000538904.2_Missense_Mutation_p.A420V	NM_145245.3	NP_660288.1	Q96CN4	EVI5L_HUMAN	ecotropic viral integration site 5-like	409					negative regulation of cilium assembly (GO:1902018)|positive regulation of GTP catabolic process (GO:0033126)|positive regulation of Rab GTPase activity (GO:0032851)		Rab GTPase activator activity (GO:0005097)|Rab GTPase binding (GO:0017137)			breast(1)|lung(9)|ovary(1)|upper_aerodigestive_tract(1)	12						GCGCAGGAGGCGGAGGAGAAC	0.701																																					p.A420V		Atlas-SNP	.											.	EVI5L	43	.	0			c.C1259T						.						30.0	20.0	23.0					19																	7923102		2171	4270	6441	SO:0001583	missense	115704	exon12			AGGAGGCGGAGGA	BC014111	CCDS12188.1, CCDS54209.1	19p13	2013-07-09				ENSG00000142459			30464	protein-coding gene	gene with protein product						23669355	Standard	NM_001159944		Approved		uc010xjz.2	Q96CN4		ENST00000270530.4:c.1226C>T	chr19.hg19:g.7923102C>T	ENSP00000270530:p.Ala409Val	186.0	0.0		148.0	35.0	NM_001159944	B9A6I9	Missense_Mutation	SNP	ENST00000270530.4	hg19	CCDS12188.1	.	.	.	.	.	.	.	.	.	.	C	21.1	4.098626	0.76870	.	.	ENSG00000142459	ENST00000270530;ENST00000538904	D;T	0.97186	-4.28;3.39	5.0	5.0	0.66597	.	0.000000	0.85682	D	0.000000	D	0.97312	0.9121	L	0.59436	1.845	0.58432	D	0.999991	D;D	0.89917	1.0;1.0	D;D	0.63033	0.91;0.91	D	0.95837	0.8863	10	0.18276	T	0.48	-21.4401	15.8352	0.78793	0.0:1.0:0.0:0.0	.	420;409	B9A6I9;Q96CN4	.;EVI5L_HUMAN	V	409;420	ENSP00000270530:A409V;ENSP00000445905:A420V	ENSP00000270530:A409V	A	+	2	0	EVI5L	7829102	1.000000	0.71417	0.959000	0.39883	0.764000	0.43329	7.526000	0.81920	2.607000	0.88179	0.498000	0.49722	GCG	.	.		0.701	EVI5L-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000461347.1	NM_145245	
MAP2K7	5609	hgsc.bcm.edu	37	19	7975602	7975602	+	Nonsense_Mutation	SNP	G	G	T			TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr19:7975602G>T	ENST00000397979.3	+	6	643	c.589G>T	c.(589-591)Gag>Tag	p.E197*	CTD-3193O13.13_ENST00000595655.1_RNA|MAP2K7_ENST00000545011.1_Nonsense_Mutation_p.E239*|MAP2K7_ENST00000397983.3_Nonsense_Mutation_p.E213*|MAP2K7_ENST00000397981.3_Nonsense_Mutation_p.E197*	NM_145185.2	NP_660186.1	O14733	MP2K7_HUMAN	mitogen-activated protein kinase kinase 7	197	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of JUN kinase activity (GO:0007257)|apoptotic process (GO:0006915)|cellular response to sorbitol (GO:0072709)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|JNK cascade (GO:0007254)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|positive regulation of neuron apoptotic process (GO:0043525)|response to heat (GO:0009408)|response to osmotic stress (GO:0006970)|response to tumor necrosis factor (GO:0034612)|response to UV (GO:0009411)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|JUN kinase kinase activity (GO:0008545)|magnesium ion binding (GO:0000287)|MAP kinase kinase activity (GO:0004708)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)			breast(2)|central_nervous_system(3)|endometrium(1)|large_intestine(8)|lung(4)|ovary(1)	19						CATCGCCATGGAGCTCATGGG	0.662																																					p.E197X		Atlas-SNP	.											.	MAP2K7	66	.	0			c.G589T						.						15.0	17.0	16.0					19																	7975602		2052	4178	6230	SO:0001587	stop_gained	5609	exon6			GCCATGGAGCTCA	AF006689	CCDS42491.1, CCDS74277.1, CCDS74278.1	19p13.3-p13.2	2011-06-09			ENSG00000076984	ENSG00000076984	2.7.12.2	"""Mitogen-activated protein kinase cascade / Kinase kinases"""	6847	protein-coding gene	gene with protein product		603014		PRKMK7		9312068	Standard	XM_005272489		Approved	MKK7, Jnkk2	uc002mit.3	O14733	OTTHUMG00000137368	ENST00000397979.3:c.589G>T	chr19.hg19:g.7975602G>T	ENSP00000381066:p.Glu197*	105.0	0.0		108.0	22.0	NM_145185	B2R9S5|D6W659|O14648|O14816|O60452|O60453|Q1PG43|Q8IY10	Nonsense_Mutation	SNP	ENST00000397979.3	hg19	CCDS42491.1	.	.	.	.	.	.	.	.	.	.	G	37	6.073297	0.97256	.	.	ENSG00000076984	ENST00000397981;ENST00000397983;ENST00000545011;ENST00000425613;ENST00000397979	.	.	.	4.75	4.75	0.60458	.	0.053841	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-6.3089	15.6565	0.77140	0.0:0.0:1.0:0.0	.	.	.	.	X	197;213;239;213;197	.	ENSP00000381066:E197X	E	+	1	0	MAP2K7	7881602	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	9.325000	0.96381	2.378000	0.81104	0.555000	0.69702	GAG	.	.		0.662	MAP2K7-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000267980.1		
MUC16	94025	hgsc.bcm.edu	37	19	9058023	9058023	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr19:9058023G>A	ENST00000397910.4	-	3	29626	c.29423C>T	c.(29422-29424)cCt>cTt	p.P9808L		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	9810	Ser-rich.|Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						GTTTGAGGAAGGATGAATTTT	0.453																																					p.P9808L		Atlas-SNP	.											.	MUC16	4315	.	0			c.C29423T						.						98.0	96.0	97.0					19																	9058023		1970	4154	6124	SO:0001583	missense	94025	exon3			GAGGAAGGATGAA	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.29423C>T	chr19.hg19:g.9058023G>A	ENSP00000381008:p.Pro9808Leu	148.0	0.0		128.0	37.0	NM_024690	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	hg19	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	g	5.191	0.220872	0.09863	.	.	ENSG00000181143	ENST00000397910	T	0.26957	1.7	2.58	-2.55	0.06288	.	.	.	.	.	T	0.13756	0.0333	N	0.24115	0.695	.	.	.	B	0.16603	0.018	B	0.15484	0.013	T	0.25641	-1.0126	8	0.87932	D	0	.	3.4806	0.07601	0.4848:0.2136:0.3016:0.0	.	9808	B5ME49	.	L	9808	ENSP00000381008:P9808L	ENSP00000381008:P9808L	P	-	2	0	MUC16	8919023	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.831000	0.04405	-0.522000	0.06417	-0.259000	0.10710	CCT	.	.		0.453	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
OR7G3	390883	hgsc.bcm.edu	37	19	9237267	9237267	+	Silent	SNP	A	A	G			TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr19:9237267A>G	ENST00000305444.2	-	1	359	c.360T>C	c.(358-360)taT>taC	p.Y120Y		NM_001001958.1	NP_001001958.1	Q8NG95	OR7G3_HUMAN	olfactory receptor, family 7, subfamily G, member 3	120						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(2)|endometrium(1)|large_intestine(3)|liver(1)|lung(5)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	15						CAAATCGATCATAGGCCATCA	0.478																																					p.Y120Y		Atlas-SNP	.											.	OR7G3	41	.	0			c.T360C						.						109.0	104.0	106.0					19																	9237267		2203	4300	6503	SO:0001819	synonymous_variant	390883	exon1			TCGATCATAGGCC		CCDS32899.1	19p13.2	2013-09-24			ENSG00000170920	ENSG00000170920		"""GPCR / Class A : Olfactory receptors"""	8467	protein-coding gene	gene with protein product							Standard	NM_001001958		Approved	OST085	uc010xkl.2	Q8NG95	OTTHUMG00000165520	ENST00000305444.2:c.360T>C	chr19.hg19:g.9237267A>G		152.0	0.0		116.0	24.0	NM_001001958	Q6IFJ6|Q96R99	Silent	SNP	ENST00000305444.2	hg19	CCDS32899.1																																																																																			.	.		0.478	OR7G3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384611.1		
RAVER1	125950	hgsc.bcm.edu	37	19	10439536	10439536	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr19:10439536A>G	ENST00000293677.6	-	3	670	c.589T>C	c.(589-591)Tac>Cac	p.Y197H		NM_133452.2	NP_597709.2	Q8IY67	RAVR1_HUMAN	ribonucleoprotein, PTB-binding 1	180	RRM 2. {ECO:0000255|PROSITE- ProRule:PRU00176}.					cytoplasm (GO:0005737)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(3)|large_intestine(1)|lung(8)|ovary(2)|skin(1)|upper_aerodigestive_tract(2)	18			OV - Ovarian serous cystadenocarcinoma(20;1.81e-09)|Epithelial(33;3.65e-06)|all cancers(31;8.35e-06)			TTCTTCATGTACTCAGCAAAG	0.637																																					p.Y197H		Atlas-SNP	.											.	RAVER1	67	.	0			c.T589C						.						34.0	40.0	38.0					19																	10439536		2125	4240	6365	SO:0001583	missense	125950	exon3			TCATGTACTCAGC		CCDS45960.1	19p13.2	2013-02-12				ENSG00000161847		"""RNA binding motif (RRM) containing"""	30296	protein-coding gene	gene with protein product		609950				11853319, 11724819	Standard	NM_133452		Approved	KIAA1978	uc002moa.3	Q8IY67		ENST00000293677.6:c.589T>C	chr19.hg19:g.10439536A>G	ENSP00000293677:p.Tyr197His	137.0	0.0		108.0	28.0	NM_133452	A6NMU4|Q8IY60|Q8TF24	Missense_Mutation	SNP	ENST00000293677.6	hg19	CCDS45960.1	.	.	.	.	.	.	.	.	.	.	A	23.0	4.363784	0.82353	.	.	ENSG00000161847	ENST00000293677;ENST00000331131	T	0.21031	2.03	5.07	5.07	0.68467	.	0.000000	0.85682	D	0.000000	T	0.58963	0.2159	H	0.96518	3.835	0.49483	D	0.999792	D	0.89917	1.0	D	0.97110	1.0	T	0.72424	-0.4298	10	0.87932	D	0	-24.5206	12.8059	0.57614	1.0:0.0:0.0:0.0	.	197	E9PAU2	.	H	197;180	ENSP00000293677:Y197H	ENSP00000293677:Y197H	Y	-	1	0	RAVER1	10300536	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	8.849000	0.92178	1.911000	0.55334	0.528000	0.53228	TAC	.	.		0.637	RAVER1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451227.1	NM_133452	
C19orf80	55908	hgsc.bcm.edu	37	19	11352206	11352206	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr19:11352206A>G	ENST00000252453.8	+	3	564	c.545A>G	c.(544-546)cAt>cGt	p.H182R	DOCK6_ENST00000294618.7_Intron|C19orf80_ENST00000591200.1_Missense_Mutation_p.H83R	NM_018687.6	NP_061157.3	Q6UXH0	BETAT_HUMAN	chromosome 19 open reading frame 80	182					cellular lipid metabolic process (GO:0044255)|glucose metabolic process (GO:0006006)|positive regulation of protein processing (GO:0010954)|regulation of lipoprotein metabolic process (GO:0050746)|triglyceride homeostasis (GO:0070328)|type B pancreatic cell proliferation (GO:0044342)	extracellular region (GO:0005576)	hormone activity (GO:0005179)			NS(1)|breast(1)|endometrium(2)	4						GCACAGCAGCATCGGCTGCGA	0.662																																					p.H182R		Atlas-SNP	.											.	C19orf80	8	.	0			c.A545G						.						9.0	14.0	12.0					19																	11352206		2095	4099	6194	SO:0001583	missense	55908	exon3			AGCAGCATCGGCT		CCDS54220.1	19p13.2	2014-02-13			ENSG00000130173	ENSG00000130173			24933	protein-coding gene	gene with protein product	"""lipasin"", ""betatrophin"""					22809513, 23150577, 24262987	Standard	NM_018687		Approved	TD26, RIFL, ANGPTL8	uc021upg.1	Q6UXH0		ENST00000252453.8:c.545A>G	chr19.hg19:g.11352206A>G	ENSP00000252453:p.His182Arg	113.0	0.0		87.0	19.0	NM_018687	Q9NQZ1	Missense_Mutation	SNP	ENST00000252453.8	hg19	CCDS54220.1	.	.	.	.	.	.	.	.	.	.	A	7.988	0.752637	0.15778	.	.	ENSG00000130173	ENST00000397785;ENST00000252453	T	0.28895	1.59	4.07	3.05	0.35203	.	0.813446	0.10613	N	0.654272	T	0.20333	0.0489	L	0.38175	1.15	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.35325	-0.9793	10	0.11182	T	0.66	-8.8099	5.7922	0.18367	0.8772:0.0:0.1228:0.0	.	182	Q6UXH0	TD26_HUMAN	R	107;182	ENSP00000252453:H182R	ENSP00000252453:H182R	H	+	2	0	C19orf80	11213206	0.020000	0.18652	0.064000	0.19789	0.776000	0.43924	0.320000	0.19540	0.642000	0.30620	0.254000	0.18369	CAT	.	.		0.662	C19orf80-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453175.1	NM_018687	
ZNF442	79973	hgsc.bcm.edu	37	19	12461479	12461479	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr19:12461479G>A	ENST00000242804.4	-	6	1502	c.920C>T	c.(919-921)tCc>tTc	p.S307F	CTD-3105H18.13_ENST00000563695.2_lincRNA|ZNF442_ENST00000438182.1_Missense_Mutation_p.S238F	NM_030824.2	NP_110451.1	Q9H7R0	ZN442_HUMAN	zinc finger protein 442	307					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(3)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(8)|lung(8)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	31						TATTCGAAGGGAACTGGAAAC	0.413																																					p.S307F		Atlas-SNP	.											.	ZNF442	102	.	0			c.C920T						.						157.0	153.0	154.0					19																	12461479		2203	4300	6503	SO:0001583	missense	79973	exon6			CGAAGGGAACTGG	AK024418	CCDS12271.1	19p13.13	2013-01-08			ENSG00000198342	ENSG00000198342		"""Zinc fingers, C2H2-type"", ""-"""	20877	protein-coding gene	gene with protein product							Standard	NM_030824		Approved	FLJ14356	uc002mtr.1	Q9H7R0	OTTHUMG00000156411	ENST00000242804.4:c.920C>T	chr19.hg19:g.12461479G>A	ENSP00000242804:p.Ser307Phe	78.0	0.0		98.0	25.0	NM_030824	B4DJ48	Missense_Mutation	SNP	ENST00000242804.4	hg19	CCDS12271.1	.	.	.	.	.	.	.	.	.	.	G	5.744	0.321792	0.10845	.	.	ENSG00000198342	ENST00000242804;ENST00000438182	T;T	0.07567	3.18;3.18	0.832	-1.66	0.08265	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.07638	0.0192	M	0.61703	1.905	0.09310	N	1	B	0.14805	0.011	B	0.16289	0.015	T	0.42137	-0.9469	9	0.25106	T	0.35	.	2.4995	0.04630	0.2607:0.3136:0.4256:0.0	.	307	Q9H7R0	ZN442_HUMAN	F	307;238	ENSP00000242804:S307F;ENSP00000388634:S238F	ENSP00000242804:S307F	S	-	2	0	ZNF442	12322479	0.003000	0.15002	0.000000	0.03702	0.451000	0.32288	0.585000	0.23879	-0.832000	0.04251	0.313000	0.20887	TCC	.	.		0.413	ZNF442-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344109.1	NM_030824	
TECR	9524	hgsc.bcm.edu	37	19	14674897	14674897	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr19:14674897A>G	ENST00000215567.5	+	6	508	c.371A>G	c.(370-372)cAt>cGt	p.H124R	TECR_ENST00000436007.2_Missense_Mutation_p.H139R|TECR_ENST00000600083.1_5'UTR|TECR_ENST00000596073.1_5'UTR	NM_138501.5	NP_612510.1	Q9NZ01	TECR_HUMAN	trans-2,3-enoyl-CoA reductase	124					cellular lipid metabolic process (GO:0044255)|fatty acid elongation (GO:0030497)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|very long-chain fatty acid biosynthetic process (GO:0042761)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)|nucleus (GO:0005634)	oxidoreductase activity, acting on the CH-CH group of donors (GO:0016627)			endometrium(1)|large_intestine(1)|ovary(1)	3						TCCAGTCGGCATACAGTGGTG	0.587																																					p.H124R		Atlas-SNP	.											.	TECR	22	.	0			c.A371G						.						133.0	138.0	136.0					19																	14674897		2203	4300	6503	SO:0001583	missense	9524	exon6			GTCGGCATACAGT	AK001416	CCDS12313.1	19p13.12	2014-05-27	2009-07-21	2009-07-21	ENSG00000099797	ENSG00000099797			4551	protein-coding gene	gene with protein product		610057	"""glycoprotein, synaptic 2"""	SC2, GPSN2		9653160, 12482854	Standard	NM_138501		Approved	TER, MRT14	uc002mza.3	Q9NZ01		ENST00000215567.5:c.371A>G	chr19.hg19:g.14674897A>G	ENSP00000215567:p.His124Arg	39.0	0.0		30.0	7.0	NM_138501	B2RD55|O75350|Q6IBB2|Q9BWK3|Q9Y6P0	Missense_Mutation	SNP	ENST00000215567.5	hg19	CCDS12313.1	.	.	.	.	.	.	.	.	.	.	A	19.00	3.741547	0.69304	.	.	ENSG00000099797	ENST00000215567;ENST00000436007	T;T	0.26373	1.75;1.74	5.03	5.03	0.67393	.	0.000000	0.85682	D	0.000000	T	0.31638	0.0803	M	0.73319	2.225	0.80722	D	1	P;P;P	0.49961	0.84;0.93;0.84	B;B;B	0.43809	0.432;0.432;0.432	T	0.11348	-1.0591	10	0.37606	T	0.19	-18.2031	12.6983	0.57016	1.0:0.0:0.0:0.0	.	124;139;124	B3KM97;B3KSQ1;Q9NZ01	.;.;TECR_HUMAN	R	124;139	ENSP00000215567:H124R;ENSP00000397206:H139R	ENSP00000215567:H124R	H	+	2	0	TECR	14535897	1.000000	0.71417	0.998000	0.56505	0.815000	0.46073	8.347000	0.90062	1.892000	0.54788	0.374000	0.22700	CAT	.	.		0.587	TECR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466000.1	NM_138501	
ZNF93	81931	hgsc.bcm.edu	37	19	20044671	20044671	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr19:20044671C>T	ENST00000343769.5	+	4	935	c.907C>T	c.(907-909)Cat>Tat	p.H303Y	AC007204.2_ENST00000592245.1_lincRNA	NM_031218.3	NP_112495.2	P35789	ZNF93_HUMAN	zinc finger protein 93	303					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			endometrium(6)|kidney(2)|large_intestine(4)|lung(8)|pancreas(1)|prostate(1)|skin(1)|stomach(1)	24						ACTTACTAAACATAAGAAAAT	0.368																																					p.H303Y		Atlas-SNP	.											.	ZNF93	81	.	0			c.C907T						.						33.0	36.0	35.0					19																	20044671		2199	4291	6490	SO:0001583	missense	81931	exon4			ACTAAACATAAGA	M61873	CCDS32973.1	19p12	2014-02-12	2006-05-12		ENSG00000184635	ENSG00000184635		"""Zinc fingers, C2H2-type"", ""-"""	13169	protein-coding gene	gene with protein product		603975	"""zinc finger protein 505"", ""zinc finger protein 93 (HTF34)"""	ZNF505		8467795, 2023909	Standard	NM_031218		Approved	HPF34, TF34, FLJ12488	uc002non.3	P35789	OTTHUMG00000182371	ENST00000343769.5:c.907C>T	chr19.hg19:g.20044671C>T	ENSP00000342002:p.His303Tyr	64.0	0.0		50.0	9.0	NM_031218	A6NMY2|B9EGT2|Q8N8Q4|Q9H9X5|Q9Y2N8	Missense_Mutation	SNP	ENST00000343769.5	hg19	CCDS32973.1	.	.	.	.	.	.	.	.	.	.	c	15.44	2.832924	0.50951	.	.	ENSG00000184635	ENST00000343769;ENST00000427325	D	0.86769	-2.17	0.85	0.85	0.18980	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	D	0.94427	0.8207	H	0.96175	3.78	0.26448	N	0.975667	D	0.89917	1.0	D	0.91635	0.999	D	0.85531	0.1209	9	0.87932	D	0	.	6.9971	0.24789	0.0:1.0:0.0:0.0	.	303	P35789	ZNF93_HUMAN	Y	303	ENSP00000342002:H303Y	ENSP00000342002:H303Y	H	+	1	0	ZNF93	19905671	0.959000	0.32827	0.488000	0.27440	0.486000	0.33341	2.741000	0.47426	0.192000	0.20272	0.195000	0.17529	CAT	.	.		0.368	ZNF93-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460808.2	NM_031218	
HNRNPL	3191	hgsc.bcm.edu	37	19	39330912	39330912	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr19:39330912G>A	ENST00000221419.5	-	8	1423	c.1057C>T	c.(1057-1059)Cgt>Tgt	p.R353C	AC104534.3_ENST00000594769.1_5'Flank|HNRNPL_ENST00000600873.1_Missense_Mutation_p.R220C	NM_001533.2	NP_001524.2	P14866	HNRPL_HUMAN	heterogeneous nuclear ribonucleoprotein L	353	Pro-rich.				gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|pronucleus (GO:0045120)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(4)|large_intestine(10)|lung(9)|ovary(1)|prostate(1)|urinary_tract(1)	30	all_cancers(60;6.83e-06)|Ovarian(47;0.0454)		Lung(45;0.00342)|LUSC - Lung squamous cell carcinoma(53;0.00575)			GGGCCCCGACGGTGACCCCCC	0.682																																					p.R353C		Atlas-SNP	.											.	HNRNPL	67	.	0			c.C1057T						.						6.0	7.0	7.0					19																	39330912		1846	3643	5489	SO:0001583	missense	3191	exon8			CCCGACGGTGACC	X16135	CCDS33015.1, CCDS33016.1	19q13.2	2013-06-12		2007-08-16	ENSG00000104824	ENSG00000104824		"""RNA binding motif (RRM) containing"""	5045	protein-coding gene	gene with protein product		603083		HNRPL		2687284	Standard	NM_001533		Approved		uc021uuh.1	P14866	OTTHUMG00000182612	ENST00000221419.5:c.1057C>T	chr19.hg19:g.39330912G>A	ENSP00000221419:p.Arg353Cys	127.0	0.0		129.0	8.0	NM_001533	A6ND69|A6NIT8|Q9H3P3	Missense_Mutation	SNP	ENST00000221419.5	hg19	CCDS33015.1	.	.	.	.	.	.	.	.	.	.	G	21.6	4.173300	0.78452	.	.	ENSG00000104824	ENST00000221419;ENST00000388749;ENST00000388750	T	0.44881	0.91	5.09	5.09	0.68999	.	0.047994	0.85682	D	0.000000	T	0.45256	0.1333	L	0.36672	1.1	0.80722	D	1	D;D;D	0.76494	0.988;0.993;0.999	B;B;P	0.50490	0.353;0.348;0.642	T	0.41520	-0.9504	10	0.54805	T	0.06	.	17.4286	0.87533	0.0:0.0:1.0:0.0	.	353;220;336	P14866;A6NIT8;Q6NTA2	HNRPL_HUMAN;.;.	C	353;220;220	ENSP00000221419:R353C	ENSP00000221419:R353C	R	-	1	0	HNRNPL	44022752	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.187000	0.58344	2.652000	0.90054	0.555000	0.69702	CGT	.	.		0.682	HNRNPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462670.1		
EGLN2	112398	hgsc.bcm.edu	37	19	41313170	41313170	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr19:41313170A>G	ENST00000593726.1	+	3	2119	c.1091A>G	c.(1090-1092)tAt>tGt	p.Y364C	EGLN2_ENST00000303961.4_Missense_Mutation_p.Y364C|EGLN2_ENST00000594140.1_Missense_Mutation_p.Y82C|RAB4B-EGLN2_ENST00000594136.1_3'UTR|CTC-490E21.12_ENST00000601627.1_Intron|EGLN2_ENST00000406058.2_Missense_Mutation_p.Y364C			Q96KS0	EGLN2_HUMAN	egl-9 family hypoxia-inducible factor 2	364	Fe2OG dioxygenase. {ECO:0000255|PROSITE- ProRule:PRU00805}.				cell redox homeostasis (GO:0045454)|cellular response to hypoxia (GO:0071456)|intracellular estrogen receptor signaling pathway (GO:0030520)|peptidyl-proline hydroxylation to 4-hydroxy-L-proline (GO:0018401)|positive regulation of protein catabolic process (GO:0045732)|regulation of cell growth (GO:0001558)|regulation of neuron apoptotic process (GO:0043523)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|response to hypoxia (GO:0001666)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ferrous iron binding (GO:0008198)|L-ascorbic acid binding (GO:0031418)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|oxygen sensor activity (GO:0019826)|peptidyl-proline 4-dioxygenase activity (GO:0031545)			breast(2)|endometrium(1)|large_intestine(2)|lung(3)|ovary(2)	10			LUSC - Lung squamous cell carcinoma(20;0.000219)|Lung(22;0.000959)		Vitamin C(DB00126)	AAGCCAGCCTATGCCACCAGG	0.597											OREG0025478	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.Y364C		Atlas-SNP	.											.	EGLN2	31	.	0			c.A1091G						.						83.0	81.0	82.0					19																	41313170		2203	4300	6503	SO:0001583	missense	112398	exon4			CAGCCTATGCCAC	AJ310544	CCDS12567.1	19q13.2	2013-08-21	2013-08-21		ENSG00000269858	ENSG00000269858			14660	protein-coding gene	gene with protein product	"""HIF prolyl hydroxylase 1"""	606424	"""EGL nine (C.elegans) homolog 2"", ""egl nine homolog 2 (C. elegans)"""				Standard	NM_080732		Approved	PHD1, HIFPH1	uc002oph.3	Q96KS0		ENST00000593726.1:c.1091A>G	chr19.hg19:g.41313170A>G	ENSP00000469686:p.Tyr364Cys	57.0	0.0	900	55.0	15.0	NM_053046	A8K5S0|Q8WWY4|Q9BV14	Missense_Mutation	SNP	ENST00000593726.1	hg19	CCDS12567.1	.	.	.	.	.	.	.	.	.	.	A	15.82	2.946141	0.53079	.	.	ENSG00000171570	ENST00000303961;ENST00000406058	T;T	0.58797	0.31;0.31	4.93	4.93	0.64822	Oxoglutarate/iron-dependent oxygenase (2);Prolyl 4-hydroxylase, alpha subunit (1);	0.187832	0.45606	D	0.000345	T	0.60170	0.2248	M	0.63208	1.945	0.46478	D	0.99906	P	0.48294	0.908	P	0.49252	0.604	T	0.62932	-0.6749	10	0.51188	T	0.08	-7.1554	9.161	0.37023	0.8374:0.0:0.0:0.1626	.	364	Q96KS0	EGLN2_HUMAN	C	364	ENSP00000307080:Y364C;ENSP00000385253:Y364C	ENSP00000307080:Y364C	Y	+	2	0	EGLN2	46005010	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	2.890000	0.48609	2.072000	0.62099	0.533000	0.62120	TAT	.	.		0.597	EGLN2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463218.1		
LIPE	3991	hgsc.bcm.edu	37	19	42909571	42909571	+	Silent	SNP	C	C	T	rs148306456	byFrequency	TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr19:42909571C>T	ENST00000244289.4	-	8	2784	c.2508G>A	c.(2506-2508)ggG>ggA	p.G836G	LIPE-AS1_ENST00000599276.1_RNA|LIPE-AS1_ENST00000594624.2_RNA|LIPE_ENST00000602000.1_5'Flank|LIPE-AS1_ENST00000593491.2_RNA|LIPE-AS1_ENST00000597203.1_RNA	NM_005357.2	NP_005348.2	Q05469	LIPS_HUMAN	lipase, hormone-sensitive	836					cholesterol metabolic process (GO:0008203)|diacylglycerol catabolic process (GO:0046340)|lipid catabolic process (GO:0016042)|long-chain fatty acid catabolic process (GO:0042758)|protein phosphorylation (GO:0006468)|small molecule metabolic process (GO:0044281)|triglyceride catabolic process (GO:0019433)	cytosol (GO:0005829)|lipid particle (GO:0005811)|plasma membrane (GO:0005886)	hormone-sensitive lipase activity (GO:0033878)|triglyceride lipase activity (GO:0004806)			breast(2)|endometrium(4)|kidney(7)|large_intestine(6)|lung(8)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	32		Prostate(69;0.00682)				GGGACTTGCGCCCACTTAACT	0.622																																					p.G836G		Atlas-SNP	.											.	LIPE	83	.	0			c.G2508A						.						56.0	48.0	50.0					19																	42909571		2203	4300	6503	SO:0001819	synonymous_variant	3991	exon8			CTTGCGCCCACTT	L11706	CCDS12607.1	19q13.1-q13.2	2014-03-14			ENSG00000079435	ENSG00000079435	3.1.1.3		6621	protein-coding gene	gene with protein product		151750				8506334	Standard	NM_005357		Approved	HSL	uc002otr.3	Q05469	OTTHUMG00000182814	ENST00000244289.4:c.2508G>A	chr19.hg19:g.42909571C>T		89.0	0.0		84.0	13.0	NM_005357	Q3LRT2|Q6NSL7	Silent	SNP	ENST00000244289.4	hg19	CCDS12607.1																																																																																			.	C|1.000;A|0.000		0.622	LIPE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463861.1	NM_005357	
SHANK1	50944	hgsc.bcm.edu	37	19	51175305	51175305	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr19:51175305G>A	ENST00000293441.1	-	21	2662	c.2644C>T	c.(2644-2646)Cct>Tct	p.P882S	SHANK1_ENST00000391814.1_Missense_Mutation_p.P890S|SHANK1_ENST00000359082.3_Missense_Mutation_p.P873S|SHANK1_ENST00000391813.1_Missense_Mutation_p.P269S	NM_016148.2	NP_057232.2	Q9Y566	SHAN1_HUMAN	SH3 and multiple ankyrin repeat domains 1	882					adult behavior (GO:0030534)|associative learning (GO:0008306)|cytoskeletal anchoring at plasma membrane (GO:0007016)|dendritic spine morphogenesis (GO:0060997)|determination of affect (GO:0050894)|habituation (GO:0046959)|long-term memory (GO:0007616)|negative regulation of actin filament bundle assembly (GO:0032232)|neuromuscular process controlling balance (GO:0050885)|olfactory behavior (GO:0042048)|positive regulation of dendritic spine development (GO:0060999)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|protein complex assembly (GO:0006461)|protein localization to synapse (GO:0035418)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|righting reflex (GO:0060013)|social behavior (GO:0035176)|synapse maturation (GO:0060074)|vocalization behavior (GO:0071625)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|excitatory synapse (GO:0060076)|intracellular (GO:0005622)|membrane (GO:0016020)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	ankyrin repeat binding (GO:0071532)|GKAP/Homer scaffold activity (GO:0030160)|identical protein binding (GO:0042802)|ionotropic glutamate receptor binding (GO:0035255)|protein C-terminus binding (GO:0008022)|protein complex binding (GO:0032403)|scaffold protein binding (GO:0097110)|SH3 domain binding (GO:0017124)|somatostatin receptor binding (GO:0031877)	p.P882S(1)		breast(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(15)|liver(1)|lung(21)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)	64		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.00493)|GBM - Glioblastoma multiforme(134;0.0199)		ATCAACCCAGGTCCTGGAGGC	0.577																																					p.P882S		Atlas-SNP	.											SHANK1,rectum,carcinoma,0,1	SHANK1	210	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2644T						.						107.0	91.0	97.0					19																	51175305		2203	4300	6503	SO:0001583	missense	50944	exon21			ACCCAGGTCCTGG	AF163302	CCDS12799.1	19q13.3	2013-01-10			ENSG00000161681	ENSG00000161681		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	15474	protein-coding gene	gene with protein product	"""somatostatin receptor-interacting protein"""	604999				10551867	Standard	NM_016148		Approved	SSTRIP, SPANK-1, synamon	uc002psx.1	Q9Y566	OTTHUMG00000137380	ENST00000293441.1:c.2644C>T	chr19.hg19:g.51175305G>A	ENSP00000293441:p.Pro882Ser	86.0	1.0		98.0	23.0	NM_016148	A8MXP5|B7WNY6|Q9NYW9	Missense_Mutation	SNP	ENST00000293441.1	hg19	CCDS12799.1	.	.	.	.	.	.	.	.	.	.	G	16.65	3.181707	0.57800	.	.	ENSG00000161681	ENST00000293441;ENST00000391813;ENST00000359082;ENST00000391814	T;T;T;T	0.38722	1.24;1.64;1.22;1.12	3.87	3.87	0.44632	.	1.972760	0.04376	N	0.359926	T	0.43322	0.1242	L	0.47190	1.495	0.39149	D	0.962181	P;P	0.47253	0.507;0.892	B;B	0.44224	0.116;0.444	T	0.48833	-0.9000	10	0.08381	T	0.77	-2.5979	15.1098	0.72346	0.0:0.0:1.0:0.0	.	882;269	Q9Y566;Q9Y566-2	SHAN1_HUMAN;.	S	882;269;873;890	ENSP00000293441:P882S;ENSP00000375689:P269S;ENSP00000351984:P873S;ENSP00000375690:P890S	ENSP00000293441:P882S	P	-	1	0	SHANK1	55867117	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	3.752000	0.55172	2.161000	0.67846	0.491000	0.48974	CCT	.	.		0.577	SHANK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268071.1	NM_016148	
NLRP12	91662	hgsc.bcm.edu	37	19	54313287	54313287	+	Silent	SNP	G	G	A			TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr19:54313287G>A	ENST00000324134.6	-	3	1794	c.1626C>T	c.(1624-1626)acC>acT	p.T542T	NLRP12_ENST00000354278.3_Silent_p.T542T|NLRP12_ENST00000391772.1_Silent_p.T542T|NLRP12_ENST00000345770.5_Silent_p.T542T|NLRP12_ENST00000535162.1_Silent_p.T542T|NLRP12_ENST00000351894.4_Silent_p.T542T|NLRP12_ENST00000391773.1_Silent_p.T542T|NLRP12_ENST00000391775.3_Silent_p.T542T	NM_001277126.1|NM_144687.2	NP_001264055.1|NP_653288.1	P59046	NAL12_HUMAN	NLR family, pyrin domain containing 12	542					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|cellular response to cytokine stimulus (GO:0071345)|dendritic cell migration (GO:0036336)|negative regulation of cytokine secretion (GO:0050710)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-1 secretion (GO:0050711)|negative regulation of interleukin-6 biosynthetic process (GO:0045409)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of NIK/NF-kappaB signaling (GO:1901223)|negative regulation of protein autophosphorylation (GO:0031953)|negative regulation of signal transduction (GO:0009968)|negative regulation of Toll signaling pathway (GO:0045751)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interleukin-1 beta secretion (GO:0050718)|positive regulation of MHC class I biosynthetic process (GO:0045345)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043122)|regulation of interleukin-18 biosynthetic process (GO:0045381)|release of cytoplasmic sequestered NF-kappaB (GO:0008588)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)			NS(1)|breast(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|liver(1)|lung(36)|ovary(5)|pancreas(2)|skin(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	80	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(134;0.026)		TCAACAGCCTGGTCACGTCCT	0.567																																					p.L542F		Atlas-SNP	.											.	NLRP12	236	.	0			c.G1626T						.						100.0	95.0	97.0					19																	54313287		2203	4300	6503	SO:0001819	synonymous_variant	91662	exon3			CAGCCTGGTCACG	AY095146	CCDS12864.1, CCDS62784.1, CCDS62785.1	19q13.42	2014-09-17	2006-12-08	2006-12-08	ENSG00000142405	ENSG00000142405		"""Nucleotide-binding domain and leucine rich repeat containing"""	22938	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 12"""	609648	"""NACHT, leucine rich repeat and PYD containing 12"""	NALP12		12563287, 12019269	Standard	NM_001277129		Approved	RNO2, PYPAF7, Monarch1, PAN6, CLR19.3	uc002qcj.5	P59046	OTTHUMG00000060776	ENST00000324134.6:c.1626C>T	chr19.hg19:g.54313287G>A		67.0	0.0		69.0	14.0	NM_144687	A8MTQ2|B3KTE7|Q8NEU4|Q9BY26	Missense_Mutation	SNP	ENST00000324134.6	hg19	CCDS12864.1																																																																																			.	.		0.567	NLRP12-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000134340.1	NM_144687	
STK35	140901	hgsc.bcm.edu	37	20	2083558	2083558	+	Missense_Mutation	SNP	A	A	C			TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr20:2083558A>C	ENST00000381482.3	+	2	710	c.439A>C	c.(439-441)Agc>Cgc	p.S147R	STK35_ENST00000400064.3_5'UTR|STK35_ENST00000246032.3_Missense_Mutation_p.S14R			Q8TDR2	STK35_HUMAN	serine/threonine kinase 35	147	Ala-rich.					cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			large_intestine(2)|liver(2)|lung(6)|ovary(1)|prostate(2)	13						AGGTACACAAAGCCCGGAGCG	0.761																																					p.S147R		Atlas-SNP	.											.	STK35	31	.	0			c.A439C						.						4.0	5.0	5.0					20																	2083558		1805	3759	5564	SO:0001583	missense	140901	exon2			ACACAAAGCCCGG	AL359916	CCDS13024.1, CCDS13024.2	20p13	2008-07-02			ENSG00000125834	ENSG00000125834			16254	protein-coding gene	gene with protein product	"""CLP-36 interacting kinase"""	609370				11973348	Standard	NM_080836		Approved	bA550O8.2, CLIK1	uc002wfw.4	Q8TDR2	OTTHUMG00000031688	ENST00000381482.3:c.439A>C	chr20.hg19:g.2083558A>C	ENSP00000370891:p.Ser147Arg	11.0	0.0		13.0	7.0	NM_080836	B2RBM3|C7ENV8|Q2NKW6|Q5T3R1|Q5T3R2|Q96AB4|Q9BZ06	Missense_Mutation	SNP	ENST00000381482.3	hg19	CCDS13024.2	.	.	.	.	.	.	.	.	.	.	A	18.03	3.532569	0.64972	.	.	ENSG00000125834	ENST00000381482;ENST00000246032	T;T	0.70399	-0.25;-0.48	5.07	3.97	0.46021	.	0.213391	0.38381	N	0.001701	T	0.45458	0.1343	N	0.08118	0	0.80722	D	1	B	0.14438	0.01	B	0.10450	0.005	T	0.37033	-0.9723	10	0.25106	T	0.35	-3.087	6.9699	0.24642	0.8986:0.0:0.1014:0.0	.	147	Q8TDR2	STK35_HUMAN	R	147;14	ENSP00000370891:S147R;ENSP00000246032:S14R	ENSP00000246032:S14R	S	+	1	0	STK35	2031558	0.988000	0.35896	1.000000	0.80357	0.996000	0.88848	0.906000	0.28517	2.047000	0.60756	0.533000	0.62120	AGC	.	.		0.761	STK35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077574.3	NM_080836	
CHD6	84181	hgsc.bcm.edu	37	20	40050513	40050513	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr20:40050513T>C	ENST00000373233.3	-	31	4939	c.4762A>G	c.(4762-4764)Act>Gct	p.T1588A		NM_032221.3	NP_115597.3	Q8TD26	CHD6_HUMAN	chromodomain helicase DNA binding protein 6	1588					ATP catabolic process (GO:0006200)|chromatin modification (GO:0016568)|positive regulation of transcription from RNA polymerase II promoter in response to oxidative stress (GO:0036091)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|transcription cofactor binding (GO:0001221)			breast(8)|central_nervous_system(2)|cervix(2)|endometrium(5)|kidney(4)|large_intestine(24)|lung(53)|ovary(8)|prostate(5)|skin(8)|stomach(1)|urinary_tract(9)	129		Myeloproliferative disorder(115;0.00425)				TGTTTGGCAGTGCCGATGAGC	0.562																																					p.T1588A		Atlas-SNP	.											.	CHD6	312	.	0			c.A4762G						.						111.0	76.0	88.0					20																	40050513		2203	4300	6503	SO:0001583	missense	84181	exon31			TGGCAGTGCCGAT	AF525085	CCDS13317.1	20q12	2003-03-07			ENSG00000124177	ENSG00000124177			19057	protein-coding gene	gene with protein product						11889561	Standard	NM_032221		Approved	KIAA1335, FLJ22369, dJ620E11.1, CHD5, RIGB	uc002xka.1	Q8TD26	OTTHUMG00000032487	ENST00000373233.3:c.4762A>G	chr20.hg19:g.40050513T>C	ENSP00000362330:p.Thr1588Ala	95.0	0.0		84.0	23.0	NM_032221	Q5JYQ0|Q5TGZ9|Q5TH00|Q5TH01|Q8IZR2|Q8WTY0|Q9H4H6|Q9H6D4|Q9NTT7|Q9P2L1	Missense_Mutation	SNP	ENST00000373233.3	hg19	CCDS13317.1	.	.	.	.	.	.	.	.	.	.	T	5.145	0.212360	0.09757	.	.	ENSG00000124177	ENST00000373233	D	0.83591	-1.74	5.89	5.89	0.94794	.	0.090574	0.48767	D	0.000174	T	0.68339	0.2990	N	0.13168	0.305	0.80722	D	1	B	0.02656	0.0	B	0.04013	0.001	T	0.64668	-0.6353	10	0.02654	T	1	-13.5213	16.3499	0.83199	0.0:0.0:0.0:1.0	.	1588	Q8TD26	CHD6_HUMAN	A	1588	ENSP00000362330:T1588A	ENSP00000362330:T1588A	T	-	1	0	CHD6	39483927	1.000000	0.71417	0.997000	0.53966	0.990000	0.78478	4.695000	0.61767	2.270000	0.75569	0.529000	0.55759	ACT	.	.		0.562	CHD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079270.1		
SRSF6	6431	hgsc.bcm.edu	37	20	42088512	42088512	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr20:42088512C>T	ENST00000244020.3	+	3	464	c.358C>T	c.(358-360)Cgg>Tgg	p.R120W		NM_006275.5	NP_006266.2	Q13247	SRSF6_HUMAN	serine/arginine-rich splicing factor 6	120	RRM 2. {ECO:0000255|PROSITE- ProRule:PRU00176}.				alternative mRNA splicing, via spliceosome (GO:0000380)|gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA splice site selection (GO:0006376)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of cell death (GO:0060548)|negative regulation of keratinocyte differentiation (GO:0045617)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|positive regulation of epithelial cell proliferation involved in lung morphogenesis (GO:0060501)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|regulation of keratinocyte proliferation (GO:0010837)|regulation of wound healing (GO:0061041)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|pre-mRNA binding (GO:0036002)|RNA binding (GO:0003723)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|upper_aerodigestive_tract(2)	5						TCTTTCTAGTCGGTGCAGTTG	0.378																																					p.R120W		Atlas-SNP	.											.	SRSF6	37	.	0			c.C358T						.						132.0	124.0	127.0					20																	42088512		2203	4300	6503	SO:0001583	missense	6431	exon3			TCTAGTCGGTGCA	U30883	CCDS13318.1	20q12-q13.1	2013-02-12	2010-06-22	2010-06-22	ENSG00000124193	ENSG00000124193		"""Serine/arginine-rich splicing factors"", ""RNA binding motif (RRM) containing"""	10788	protein-coding gene	gene with protein product	"""pre-mRNA splicing factor SRP55"", ""SR splicing factor 6"""	601944	"""splicing factor, arginine/serine-rich 6"""	SFRS6		7556075, 20516191	Standard	NM_006275		Approved	SRP55, B52	uc010zwg.2	Q13247	OTTHUMG00000032502	ENST00000244020.3:c.358C>T	chr20.hg19:g.42088512C>T	ENSP00000244020:p.Arg120Trp	135.0	0.0		94.0	26.0	NM_006275	B7Z6J3|E1P5W6|Q13244|Q13245|Q96J06|Q9UJB8|Q9Y3N7	Missense_Mutation	SNP	ENST00000244020.3	hg19	CCDS13318.1	.	.	.	.	.	.	.	.	.	.	C	15.94	2.980437	0.53827	.	.	ENSG00000124193	ENST00000244020	T	0.16324	2.35	5.86	5.86	0.93980	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.046784	0.85682	D	0.000000	T	0.59432	0.2193	H	0.98276	4.19	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	T	0.74328	-0.3701	10	0.87932	D	0	.	13.871	0.63619	0.1528:0.8472:0.0:0.0	.	120;120	Q13247;A8K588	SRSF6_HUMAN;.	W	120	ENSP00000244020:R120W	ENSP00000244020:R120W	R	+	1	2	SRSF6	41521926	1.000000	0.71417	1.000000	0.80357	0.605000	0.37080	5.539000	0.67199	2.777000	0.95525	0.591000	0.81541	CGG	.	.		0.378	SRSF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079292.1	NM_006275	
WISP2	8839	hgsc.bcm.edu	37	20	43355822	43355822	+	Silent	SNP	G	G	A			TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr20:43355822G>A	ENST00000372868.2	+	5	970	c.627G>A	c.(625-627)ggG>ggA	p.G209G	RP11-445H22.4_ENST00000427598.1_RNA|WISP2_ENST00000190983.4_Silent_p.G209G|WISP2_ENST00000372865.4_Missense_Mutation_p.G127D|RP11-445H22.4_ENST00000427303.1_RNA|WISP2_ENST00000471629.1_3'UTR|RP11-445H22.4_ENST00000445420.1_RNA			O76076	WISP2_HUMAN	WNT1 inducible signaling pathway protein 2	209	TSP type-1. {ECO:0000255|PROSITE- ProRule:PRU00210}.				cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|regulation of cell growth (GO:0001558)|signal transduction (GO:0007165)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)				skin(1)	1		Myeloproliferative disorder(115;0.0122)				CCACCTGTGGGCTGGGCATGG	0.687																																					p.G209G		Atlas-SNP	.											.	WISP2	28	.	0			c.G627A						.						50.0	50.0	50.0					20																	43355822		2202	4298	6500	SO:0001819	synonymous_variant	8839	exon4			CTGTGGGCTGGGC	AF100780	CCDS13336.1	20q13.12	2007-05-14			ENSG00000064205	ENSG00000064205			12770	protein-coding gene	gene with protein product		603399				9843955	Standard	NM_003881		Approved	CT58, CTGF-L, CCN5	uc002xmp.3	O76076	OTTHUMG00000033071	ENST00000372868.2:c.627G>A	chr20.hg19:g.43355822G>A		81.0	0.0		60.0	14.0	NM_003881	B2R9N4|E1P612|Q6PEG3	Silent	SNP	ENST00000372868.2	hg19	CCDS13336.1	.	.	.	.	.	.	.	.	.	.	G	13.37	2.217237	0.39201	.	.	ENSG00000064205	ENST00000372865	T	0.70164	-0.46	4.05	2.04	0.26737	.	0.000000	0.85682	D	0.000000	T	0.78342	0.4268	.	.	.	0.80722	D	1	D	0.63880	0.993	P	0.58721	0.844	T	0.82096	-0.0626	9	0.87932	D	0	-22.4119	15.8618	0.79032	0.0:0.4864:0.5135:0.0	.	127	Q6PEG3	.	D	127	ENSP00000361956:G127D	ENSP00000361956:G127D	G	+	2	0	WISP2	42789236	0.165000	0.22948	0.999000	0.59377	0.645000	0.38454	0.615000	0.24329	0.354000	0.24105	0.561000	0.74099	GGC	.	.		0.687	WISP2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000127824.1	NM_003881	
SAMSN1	64092	hgsc.bcm.edu	37	21	15858279	15858279	+	Missense_Mutation	SNP	A	A	C			TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr21:15858279A>C	ENST00000400566.1	-	8	1157	c.1076T>G	c.(1075-1077)cTg>cGg	p.L359R	SAMSN1_ENST00000285670.2_Missense_Mutation_p.L427R|SAMSN1_ENST00000400564.1_Missense_Mutation_p.L191R	NM_022136.4	NP_071419.3	Q9NSI8	SAMN1_HUMAN	SAM domain, SH3 domain and nuclear localization signals 1	359					negative regulation of adaptive immune response (GO:0002820)|negative regulation of B cell activation (GO:0050869)|negative regulation of peptidyl-tyrosine phosphorylation (GO:0050732)	cell projection (GO:0042995)|cytosol (GO:0005829)|nucleus (GO:0005634)	phosphotyrosine binding (GO:0001784)|poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(1)|kidney(1)|large_intestine(3)|lung(9)|ovary(3)|pancreas(1)|prostate(3)|urinary_tract(1)	24				Epithelial(23;0.000155)|COAD - Colon adenocarcinoma(22;0.00118)|Colorectal(24;0.00961)|Lung(58;0.164)		CATGTCAGACAGATTTTCAGA	0.383																																					p.L427R		Atlas-SNP	.											.	SAMSN1	112	.	0			c.T1280G						.						171.0	156.0	161.0					21																	15858279		1866	4116	5982	SO:0001583	missense	64092	exon9			TCAGACAGATTTT	AF222927	CCDS42906.1, CCDS58786.1, CCDS74774.1	21q11	2013-01-10	2006-12-13		ENSG00000155307	ENSG00000155307		"""SAM and SH3 domain containing"", ""Sterile alpha motif (SAM) domain containing"""	10528	protein-coding gene	gene with protein product	"""nuclear localization signals, SAM and SH3 domain containing 1"", ""SAM and SH3 domain containing 2"", ""hematopoietic adapter-containing SH3 and sterile &#945;-motif (SAM) domains 1"", ""Src homology domain 3 (SH3)-containing adapter protein SH3 lymphocyte protein 2"""	607978				11536050, 11594764	Standard	NM_022136		Approved	NASH1, SASH2, SH3D6B, HACS1, SLy2	uc002yjv.1	Q9NSI8	OTTHUMG00000074317	ENST00000400566.1:c.1076T>G	chr21.hg19:g.15858279A>C	ENSP00000383411:p.Leu359Arg	84.0	0.0		67.0	14.0	NM_001256370	B3KWJ3|F8WAA1|Q8NFF7|Q9C041	Missense_Mutation	SNP	ENST00000400566.1	hg19	CCDS42906.1	.	.	.	.	.	.	.	.	.	.	A	16.38	3.107243	0.56291	.	.	ENSG00000155307	ENST00000285670;ENST00000400566;ENST00000400564	T;T	0.55588	0.51;0.63	6.08	6.08	0.98989	.	0.232716	0.36519	N	0.002542	T	0.73202	0.3557	M	0.75447	2.3	0.46298	D	0.998978	D;D;D	0.89917	0.999;1.0;0.999	D;D;D	0.91635	0.974;0.999;0.942	T	0.75031	-0.3461	10	0.56958	D	0.05	-8.2454	16.6512	0.85203	1.0:0.0:0.0:0.0	.	191;427;359	Q9NSI8-2;F8WAA1;Q9NSI8	.;.;SAMN1_HUMAN	R	427;359;191	ENSP00000285670:L427R;ENSP00000383411:L359R	ENSP00000285670:L427R	L	-	2	0	SAMSN1	14780150	1.000000	0.71417	0.999000	0.59377	0.170000	0.22686	4.794000	0.62482	2.333000	0.79357	0.482000	0.46254	CTG	.	.		0.383	SAMSN1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157914.1		
C21orf59	56683	hgsc.bcm.edu	37	21	33984425	33984425	+	Silent	SNP	G	G	A			TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr21:33984425G>A	ENST00000290155.3	-	1	751	c.129C>T	c.(127-129)cgC>cgT	p.R43R	C21orf59_ENST00000540881.1_Silent_p.R43R|C21orf59_ENST00000382549.4_Silent_p.R43R|AP000275.65_ENST00000553001.1_Silent_p.R43R	NM_021254.2	NP_067077.1	P57076	CU059_HUMAN	chromosome 21 open reading frame 59	43						cytosol (GO:0005829)|nucleus (GO:0005634)				endometrium(2)|large_intestine(1)|prostate(1)|skin(1)	5						CTGAGCAGAGGCGCTGCACCT	0.677																																					p.R43R		Atlas-SNP	.											.	C21orf59	11	.	0			c.C129T						.						11.0	11.0	11.0					21																	33984425		2158	4242	6400	SO:0001819	synonymous_variant	56683	exon1			GCAGAGGCGCTGC	AF282851	CCDS13617.1	21q22.11	2014-02-03	2003-07-22		ENSG00000159079	ENSG00000159079			1301	protein-coding gene	gene with protein product		615494	"""chromosome 21 open reading frame 48"""	C21orf48		24094744	Standard	NM_021254		Approved	FLJ20467, FBB18, CILD26	uc002yqc.3	P57076	OTTHUMG00000179510	ENST00000290155.3:c.129C>T	chr21.hg19:g.33984425G>A		86.0	0.0		82.0	21.0	NM_021254	Q53FH0	Silent	SNP	ENST00000290155.3	hg19	CCDS13617.1	.	.	.	.	.	.	.	.	.	.	G	10.28	1.306556	0.23736	.	.	ENSG00000159079	ENST00000431216	.	.	.	4.85	2.96	0.34315	.	.	.	.	.	T	0.61813	0.2377	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.57458	-0.7808	4	.	.	.	-27.2964	11.4906	0.50379	0.0755:0.5252:0.3993:0.0	.	.	.	.	V	11	.	.	A	-	2	0	C21orf59	32906296	0.010000	0.17322	0.991000	0.47740	0.852000	0.48524	-0.141000	0.10327	0.559000	0.29153	0.455000	0.32223	GCC	.	.		0.677	C21orf59-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000139431.1	NM_021254	
DOPEY2	9980	hgsc.bcm.edu	37	21	37603416	37603416	+	Silent	SNP	G	G	A			TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr21:37603416G>A	ENST00000399151.3	+	14	2419	c.2334G>A	c.(2332-2334)acG>acA	p.T778T		NM_005128.2	NP_005119.2	Q9Y3R5	DOP2_HUMAN	dopey family member 2	778					cognition (GO:0050890)|endoplasmic reticulum organization (GO:0007029)|Golgi to endosome transport (GO:0006895)|multicellular organismal development (GO:0007275)|protein transport (GO:0015031)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)				autonomic_ganglia(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(5)|large_intestine(6)|lung(25)|ovary(2)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	58						TCTGTGCAACGCTCTTCCAGC	0.587																																					p.T778T		Atlas-SNP	.											.	DOPEY2	184	.	0			c.G2334A						.						44.0	41.0	42.0					21																	37603416		2183	4275	6458	SO:0001819	synonymous_variant	9980	exon14			TGCAACGCTCTTC	AJ237839	CCDS13643.1	21q22.2	2013-03-05	2006-02-02	2006-02-02	ENSG00000142197	ENSG00000142197			1291	protein-coding gene	gene with protein product		604803	"""chromosome 21 open reading frame 5"""	C21orf5		16301316, 16303751, 10931277	Standard	NM_005128		Approved	KIAA0933	uc002yvg.3	Q9Y3R5	OTTHUMG00000086619	ENST00000399151.3:c.2334G>A	chr21.hg19:g.37603416G>A		106.0	0.0		108.0	22.0	NM_005128	D3DSG5|Q6PJQ7|Q9UEZ3	Silent	SNP	ENST00000399151.3	hg19	CCDS13643.1																																																																																			.	.		0.587	DOPEY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000194636.1	NM_005128	
KRTAP10-12	386685	hgsc.bcm.edu	37	21	46117302	46117302	+	Nonsense_Mutation	SNP	C	C	A			TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr21:46117302C>A	ENST00000400365.3	+	1	216	c.186C>A	c.(184-186)tgC>tgA	p.C62*	TSPEAR_ENST00000323084.4_Intron	NM_198699.1	NP_941972.1	P60413	KR10C_HUMAN	keratin associated protein 10-12	62	19 X 5 AA repeats of C-C-X(3).					keratin filament (GO:0045095)				large_intestine(1)|lung(8)	9						CCAGCCCCTGCTGCCGAGTGA	0.692																																					p.C62X		Atlas-SNP	.											.	KRTAP10-12	21	.	0			c.C186A						.						66.0	77.0	73.0					21																	46117302		2197	4295	6492	SO:0001587	stop_gained	386685	exon1			CCCCTGCTGCCGA	AB076364	CCDS42967.1	21q22.3	2006-03-13	2004-07-12	2004-07-14	ENSG00000189169	ENSG00000189169		"""Keratin associated proteins"""	20533	protein-coding gene	gene with protein product			"""keratin associated protein 18-12"""	KRTAP18-12			Standard	NM_198699		Approved	KRTAP18.12, KAP10.12	uc002zfw.1	P60413	OTTHUMG00000057629	ENST00000400365.3:c.186C>A	chr21.hg19:g.46117302C>A	ENSP00000383216:p.Cys62*	44.0	0.0		64.0	13.0	NM_198699	B2RPA3	Nonsense_Mutation	SNP	ENST00000400365.3	hg19	CCDS42967.1	.	.	.	.	.	.	.	.	.	.	N	11.13	1.548431	0.27652	.	.	ENSG00000189169	ENST00000400365	.	.	.	1.57	0.462	0.16695	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	5.8249	0.18548	0.0:0.6664:0.3336:0.0	.	.	.	.	X	62	.	ENSP00000383216:C62X	C	+	3	2	KRTAP10-12	44941730	0.002000	0.14202	0.354000	0.25760	0.198000	0.23893	1.114000	0.31196	-0.484000	0.06763	0.298000	0.19748	TGC	.	.		0.692	KRTAP10-12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128032.1	NM_198699	
MAPK1	5594	hgsc.bcm.edu	37	22	22221631	22221631	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr22:22221631C>A	ENST00000215832.6	-	1	288	c.100G>T	c.(100-102)Ggc>Tgc	p.G34C	MAPK1_ENST00000398822.3_Missense_Mutation_p.G34C|MAPK1_ENST00000544786.1_Missense_Mutation_p.G34C	NM_002745.4	NP_002736.3	P28482	MK01_HUMAN	mitogen-activated protein kinase 1	34	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|B cell receptor signaling pathway (GO:0050853)|blood coagulation (GO:0007596)|caveolin-mediated endocytosis (GO:0072584)|cell cycle (GO:0007049)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to granulocyte macrophage colony-stimulating factor stimulus (GO:0097011)|chemotaxis (GO:0006935)|cytosine metabolic process (GO:0019858)|epidermal growth factor receptor signaling pathway (GO:0007173)|ERBB signaling pathway (GO:0038127)|ERK1 and ERK2 cascade (GO:0070371)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|labyrinthine layer blood vessel development (GO:0060716)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|mammary gland epithelial cell proliferation (GO:0033598)|MAPK cascade (GO:0000165)|MAPK import into nucleus (GO:0000189)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of cell differentiation (GO:0045596)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ morphogenesis (GO:0009887)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|platelet activation (GO:0030168)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of translation (GO:0045727)|Ras protein signal transduction (GO:0007265)|regulation of cytoskeleton organization (GO:0051493)|regulation of early endosome to late endosome transport (GO:2000641)|regulation of Golgi inheritance (GO:0090170)|regulation of protein stability (GO:0031647)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|regulation of stress-activated MAPK cascade (GO:0032872)|response to epidermal growth factor (GO:0070849)|response to estrogen (GO:0043627)|response to exogenous dsRNA (GO:0043330)|response to stress (GO:0006950)|response to toxic substance (GO:0009636)|sensory perception of pain (GO:0019233)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|stress-activated MAPK cascade (GO:0051403)|synaptic transmission (GO:0007268)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription, DNA-templated (GO:0006351)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|viral process (GO:0016032)	caveola (GO:0005901)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendrite cytoplasm (GO:0032839)|early endosome (GO:0005769)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|late endosome (GO:0005770)|microtubule cytoskeleton (GO:0015630)|mitochondrion (GO:0005739)|mitotic spindle (GO:0072686)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perikaryon (GO:0043204)|protein complex (GO:0043234)|pseudopodium (GO:0031143)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|MAP kinase activity (GO:0004707)|phosphatase binding (GO:0019902)|protein serine/threonine kinase activity (GO:0004674)|RNA polymerase II carboxy-terminal domain kinase activity (GO:0008353)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(2)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	17	Colorectal(54;0.105)	all_lung(157;3.89e-05)		READ - Rectum adenocarcinoma(21;0.0689)	Arsenic trioxide(DB01169)|Isoprenaline(DB01064)	CCGTAGGCGCCCTCGCCGATG	0.786																																					p.G34C		Atlas-SNP	.											.	MAPK1	38	.	0			c.G100T						.						10.0	8.0	9.0					22																	22221631		2015	4006	6021	SO:0001583	missense	5594	exon1			AGGCGCCCTCGCC	M84489	CCDS13795.1	22q11.2	2014-09-17			ENSG00000100030	ENSG00000100030	2.7.11.1	"""Mitogen-activated protein kinase cascade / Kinases"""	6871	protein-coding gene	gene with protein product		176948		PRKM2, PRKM1			Standard	NM_138957		Approved	ERK, ERK2, p41mapk, MAPK2	uc002zvn.3	P28482	OTTHUMG00000030508	ENST00000215832.6:c.100G>T	chr22.hg19:g.22221631C>A	ENSP00000215832:p.Gly34Cys	72.0	0.0		42.0	10.0	NM_002745	A8CZ64	Missense_Mutation	SNP	ENST00000215832.6	hg19	CCDS13795.1	.	.	.	.	.	.	.	.	.	.	C	24.3	4.520411	0.85495	.	.	ENSG00000100030	ENST00000215832;ENST00000415911;ENST00000398822;ENST00000544786	D;D;D	0.96365	-3.99;-3.99;-3.99	4.71	3.67	0.42095	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.98966	0.9648	H	0.99379	4.54	0.80722	D	1	D;D	0.65815	0.995;0.991	D;D	0.72982	0.979;0.978	D	0.98797	1.0738	10	0.87932	D	0	.	13.9758	0.64273	0.0:0.8469:0.1531:0.0	.	34;34	A8CZ64;P28482	.;MK01_HUMAN	C	34;22;34;34	ENSP00000215832:G34C;ENSP00000381803:G34C;ENSP00000440842:G34C	ENSP00000215832:G34C	G	-	1	0	MAPK1	20551631	1.000000	0.71417	1.000000	0.80357	0.872000	0.50106	4.140000	0.58031	1.173000	0.42796	0.467000	0.42956	GGC	.	.		0.786	MAPK1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000075396.2		
MCHR1	2847	hgsc.bcm.edu	37	22	41077826	41077826	+	Missense_Mutation	SNP	G	G	A	rs199697488		TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr22:41077826G>A	ENST00000249016.4	+	2	1859	c.1163G>A	c.(1162-1164)cGc>cAc	p.R388H	MCHR1_ENST00000381433.2_Missense_Mutation_p.R262H|MCHR1_ENST00000498400.1_3'UTR	NM_005297.3	NP_005288.3	Q99705	MCHR1_HUMAN	melanin-concentrating hormone receptor 1	388					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|feeding behavior (GO:0007631)|G-protein coupled receptor signaling pathway (GO:0007186)|generation of precursor metabolites and energy (GO:0006091)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cytosolic calcium ion concentration (GO:0007204)	integral component of plasma membrane (GO:0005887)|nonmotile primary cilium (GO:0031513)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|hormone binding (GO:0042562)|melanin-concentrating hormone receptor activity (GO:0030273)|neuropeptide receptor activity (GO:0008188)			endometrium(5)|large_intestine(7)|lung(6)|pancreas(1)|urinary_tract(1)	20						GAGACGTTCCGCAAACGCTTG	0.572																																					p.R388H		Atlas-SNP	.											MCHR1,caecum,carcinoma,0,3	MCHR1	45	.	0			c.G1163A						.						111.0	90.0	97.0					22																	41077826		2203	4300	6503	SO:0001583	missense	2847	exon2			CGTTCCGCAAACG		CCDS14004.1	22q13.3	2014-06-05	2006-02-15	2006-02-15	ENSG00000128285	ENSG00000128285		"""GPCR / Class A : MCH receptors"""	4479	protein-coding gene	gene with protein product		601751	"""G protein-coupled receptor 24"""	GPR24			Standard	XM_005261581		Approved	SLC1, MCH1R	uc003ayz.3	Q99705	OTTHUMG00000150256	ENST00000249016.4:c.1163G>A	chr22.hg19:g.41077826G>A	ENSP00000249016:p.Arg388His	51.0	0.0		53.0	16.0	NM_005297	B2RBX6|Q5R3J1|Q96S47|Q9BV08	Missense_Mutation	SNP	ENST00000249016.4	hg19	CCDS14004.1	.	.	.	.	.	.	.	.	.	.	G	21.8	4.209252	0.79240	.	.	ENSG00000128285	ENST00000249016;ENST00000381433	T;T	0.58358	0.34;0.34	5.4	5.4	0.78164	.	0.101947	0.64402	D	0.000008	T	0.57286	0.2043	N	0.19112	0.55	0.41286	D	0.986946	D	0.76494	0.999	P	0.62184	0.899	T	0.62955	-0.6744	10	0.87932	D	0	.	17.0403	0.86487	0.0:0.0:1.0:0.0	.	388	Q99705	MCHR1_HUMAN	H	388;262	ENSP00000249016:R388H;ENSP00000370841:R262H	ENSP00000249016:R388H	R	+	2	0	MCHR1	39407772	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	4.226000	0.58606	2.698000	0.92095	0.655000	0.94253	CGC	.	.		0.572	MCHR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317142.1	NM_005297	
EFCAB6	64800	hgsc.bcm.edu	37	22	43986003	43986003	+	Missense_Mutation	SNP	C	C	G			TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr22:43986003C>G	ENST00000262726.7	-	24	3236	c.2983G>C	c.(2983-2985)Gaa>Caa	p.E995Q	EFCAB6_ENST00000396231.2_Missense_Mutation_p.E843Q	NM_022785.3	NP_073622.2	Q5THR3	EFCB6_HUMAN	EF-hand calcium binding domain 6	995	EF-hand 11. {ECO:0000255|PROSITE- ProRule:PRU00448}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	calcium ion binding (GO:0005509)			breast(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(16)|lung(25)|ovary(4)|pancreas(1)|prostate(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	68		Ovarian(80;0.0247)|all_neural(38;0.025)				CATCCACATTCTTCCAGCACT	0.423																																					p.E995Q		Atlas-SNP	.											.	EFCAB6	177	.	0			c.G2983C						.						299.0	258.0	272.0					22																	43986003		2203	4300	6503	SO:0001583	missense	64800	exon24			CACATTCTTCCAG	Z82201	CCDS14049.1, CCDS14050.1	22q13.2	2013-01-10			ENSG00000186976	ENSG00000186976		"""EF-hand domain containing"""	24204	protein-coding gene	gene with protein product						11258795, 12612053	Standard	NM_022785		Approved	FLJ23588, DJBP, HSCBCIP1, KIAA1672, dJ185D5.1	uc003bdy.2	Q5THR3	OTTHUMG00000150522	ENST00000262726.7:c.2983G>C	chr22.hg19:g.43986003C>G	ENSP00000262726:p.Glu995Gln	142.0	0.0		130.0	33.0	NM_022785	A8K8P6|A8K8Y3|B0QYI4|B0QYI6|Q5U5T6|Q9BY88|Q9H5C4|Q9NSF5	Missense_Mutation	SNP	ENST00000262726.7	hg19	CCDS14049.1	.	.	.	.	.	.	.	.	.	.	C	14.94	2.684606	0.47991	.	.	ENSG00000186976	ENST00000396231;ENST00000262726	D;D	0.82344	-1.6;-1.6	4.87	3.85	0.44370	EF-hand-like domain (1);	0.651897	0.14965	N	0.288132	D	0.87904	0.6295	M	0.66939	2.045	0.33808	D	0.627484	D;P	0.89917	1.0;0.454	D;B	0.74023	0.982;0.282	D	0.86390	0.1735	10	0.15499	T	0.54	-14.2413	11.4244	0.50001	0.0:0.9163:0.0:0.0837	.	843;995	Q5THR3-2;Q5THR3	.;EFCB6_HUMAN	Q	843;995	ENSP00000379533:E843Q;ENSP00000262726:E995Q	ENSP00000262726:E995Q	E	-	1	0	EFCAB6	42317336	0.038000	0.19896	0.006000	0.13384	0.234000	0.25298	1.499000	0.35671	1.199000	0.43173	0.555000	0.69702	GAA	.	.		0.423	EFCAB6-010	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353176.1	NM_022785	
EFCAB6	64800	hgsc.bcm.edu	37	22	44168801	44168801	+	Nonsense_Mutation	SNP	G	G	A	rs372200947		TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr22:44168801G>A	ENST00000262726.7	-	4	575	c.322C>T	c.(322-324)Cga>Tga	p.R108*	EFCAB6_ENST00000356087.4_Intron|EFCAB6_ENST00000396231.2_Intron|EFCAB6_ENST00000358439.4_Intron	NM_022785.3	NP_073622.2	Q5THR3	EFCB6_HUMAN	EF-hand calcium binding domain 6	108					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	calcium ion binding (GO:0005509)			breast(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(16)|lung(25)|ovary(4)|pancreas(1)|prostate(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	68		Ovarian(80;0.0247)|all_neural(38;0.025)				AACTGTTCTCGTGTGAGCGGC	0.463													G|||	1	0.000199681	0.0	0.0014	5008	,	,		18475	0.0		0.0	False		,,,				2504	0.0				p.R108X		Atlas-SNP	.											.	EFCAB6	177	.	0			c.C322T						.	G	stop/ARG,	0,4406		0,0,2203	179.0	137.0	151.0		322,	-1.1	0.0	22		151	1,8599	1.2+/-3.3	0,1,4299	no	stop-gained,intron	EFCAB6	NM_022785.3,NM_198856.2	,	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	,	108/1502,	44168801	1,13005	2203	4300	6503	SO:0001587	stop_gained	64800	exon4			GTTCTCGTGTGAG	Z82201	CCDS14049.1, CCDS14050.1	22q13.2	2013-01-10			ENSG00000186976	ENSG00000186976		"""EF-hand domain containing"""	24204	protein-coding gene	gene with protein product						11258795, 12612053	Standard	NM_022785		Approved	FLJ23588, DJBP, HSCBCIP1, KIAA1672, dJ185D5.1	uc003bdy.2	Q5THR3	OTTHUMG00000150522	ENST00000262726.7:c.322C>T	chr22.hg19:g.44168801G>A	ENSP00000262726:p.Arg108*	121.0	0.0		88.0	27.0	NM_022785	A8K8P6|A8K8Y3|B0QYI4|B0QYI6|Q5U5T6|Q9BY88|Q9H5C4|Q9NSF5	Nonsense_Mutation	SNP	ENST00000262726.7	hg19	CCDS14049.1	.	.	.	.	.	.	.	.	.	.	G	20.8	4.050463	0.75960	0.0	1.16E-4	ENSG00000186976	ENST00000262726	.	.	.	4.28	-1.1	0.09872	.	0.520250	0.17345	N	0.177606	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	0.21014	T	0.42	-13.8913	11.8982	0.52667	0.0:0.0:0.6984:0.3016	.	.	.	.	X	108	.	ENSP00000262726:R108X	R	-	1	2	EFCAB6	42500134	0.000000	0.05858	0.001000	0.08648	0.474000	0.32979	0.115000	0.15540	-0.042000	0.13535	-0.457000	0.05445	CGA	.	.		0.463	EFCAB6-010	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353176.1	NM_022785	
LDOC1L	84247	hgsc.bcm.edu	37	22	44893314	44893314	+	Silent	SNP	C	C	A			TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr22:44893314C>A	ENST00000341255.3	-	2	632	c.123G>T	c.(121-123)cgG>cgT	p.R41R		NM_032287.2	NP_115663.2	Q6ICC9	LDOCL_HUMAN	leucine zipper, down-regulated in cancer 1-like	41										breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(2)|ovary(3)|prostate(2)	11		Ovarian(80;0.024)|all_neural(38;0.0416)		LUAD - Lung adenocarcinoma(64;0.0161)		TGGAAGCCTCCCGCCTCAGCG	0.627																																					p.R41R		Atlas-SNP	.											.	LDOC1L	24	.	0			c.G123T						.						37.0	32.0	34.0					22																	44893314		2202	4300	6502	SO:0001819	synonymous_variant	84247	exon2			AGCCTCCCGCCTC	CR456439	CCDS33662.1	22q13.3	2006-09-06			ENSG00000188636	ENSG00000188636			13343	protein-coding gene	gene with protein product						15716091, 16093683	Standard	NM_032287		Approved	dJ1033E15.2, DKFZp761O17121, Mart6, Mar6	uc003beu.1	Q6ICC9	OTTHUMG00000150465	ENST00000341255.3:c.123G>T	chr22.hg19:g.44893314C>A		70.0	0.0		72.0	11.0	NM_032287	Q6ZTR1	Silent	SNP	ENST00000341255.3	hg19	CCDS33662.1																																																																																			.	.		0.627	LDOC1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318222.1	NM_032287	
ARSA	410	hgsc.bcm.edu	37	22	51065813	51065813	+	Silent	SNP	C	C	T			TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr22:51065813C>T	ENST00000547307.1	-	2	645	c.240G>A	c.(238-240)cgG>cgA	p.R80R	ARSA_ENST00000356098.5_Silent_p.R82R|ARSA_ENST00000547805.1_Silent_p.R80R|ARSA_ENST00000395621.3_Silent_p.R82R|ARSA_ENST00000395619.3_Silent_p.R82R|ARSA_ENST00000453344.2_5'UTR|ARSA_ENST00000216124.5_Silent_p.R82R			P15289	ARSA_HUMAN	arylsulfatase A	80					autophagy (GO:0006914)|binding of sperm to zona pellucida (GO:0007339)|cellular protein metabolic process (GO:0044267)|central nervous system development (GO:0007417)|glycosphingolipid metabolic process (GO:0006687)|post-translational protein modification (GO:0043687)|response to estrogen (GO:0043627)|response to ethanol (GO:0045471)|response to methylmercury (GO:0051597)|response to nutrient (GO:0007584)|response to pH (GO:0009268)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	acrosomal vesicle (GO:0001669)|endoplasmic reticulum lumen (GO:0005788)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of external side of plasma membrane (GO:0031232)|integral component of membrane (GO:0016021)|lysosomal lumen (GO:0043202)|lysosome (GO:0005764)	arylsulfatase activity (GO:0004065)|calcium ion binding (GO:0005509)|cerebroside-sulfatase activity (GO:0004098)|sulfuric ester hydrolase activity (GO:0008484)			endometrium(1)|large_intestine(1)|lung(5)|pancreas(1)|skin(1)	9		all_cancers(38;8.8e-15)|all_epithelial(38;1.12e-12)|all_lung(38;3.07e-05)|Breast(42;6.27e-05)|Lung NSC(38;0.000813)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)	Micafungin(DB01141)|Suramin(DB04786)	GAACCGGGAGCCGGCCGGTCA	0.672																																					p.R82R		Atlas-SNP	.											.	ARSA	19	.	0			c.G246A						.						8.0	9.0	9.0					22																	51065813		2159	4231	6390	SO:0001819	synonymous_variant	410	exon3			CGGGAGCCGGCCG	X52150	CCDS14100.1, CCDS46736.1, CCDS14100.2	22q13.33	2013-09-19			ENSG00000100299	ENSG00000100299	3.1.6.8	"""Arylsulfatase family"""	713	protein-coding gene	gene with protein product	"""metachromatic leucodystrophy"""	607574				15772092	Standard	NM_000487		Approved		uc003bmz.5	P15289	OTTHUMG00000150180	ENST00000547307.1:c.240G>A	chr22.hg19:g.51065813C>T		79.0	0.0		87.0	19.0	NM_001085426	B2RCA6|B7XD04|F8WCC8|Q6ICI5|Q96CJ0	Silent	SNP	ENST00000547307.1	hg19																																																																																				.	.		0.672	ARSA-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_000487	
ZRSR2	8233	hgsc.bcm.edu	37	X	15809111	15809111	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chrX:15809111G>T	ENST00000307771.7	+	2	120	c.96G>T	c.(94-96)caG>caT	p.Q32H	ZRSR2_ENST00000468028.1_3'UTR|ZRSR2_ENST00000380308.3_Missense_Mutation_p.Q32H	NM_005089.3	NP_005080.1	Q15696	U2AFM_HUMAN	zinc finger (CCCH type), RNA-binding motif and serine/arginine rich 2	32					mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|spliceosomal complex assembly (GO:0000245)	U12-type spliceosomal complex (GO:0005689)	metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)|pre-mRNA 3'-splice site binding (GO:0030628)			breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(38)|kidney(1)|large_intestine(2)|ovary(2)	48	Hepatocellular(33;0.183)					AACGTCGGCAGGAACTTGCTC	0.483			"""F, S, Mis"""		"""MDS, CLL"""																																p.Q32H	NSCLC(197;1631 3042 5741 31152)	Atlas-SNP	.		Rec	yes		X	Xp22.1	8233	"""zinc finger (CCCH type), RNA-binding motif and serine/arginine rich 2"""		L	.	ZRSR2	78	.	0			c.G96T						.						87.0	77.0	80.0					X																	15809111		2203	4300	6503	SO:0001583	missense	8233	exon2			TCGGCAGGAACTT	BC050451	CCDS14172.1	Xp22.1	2014-09-17	2006-09-26	2006-09-26	ENSG00000169249	ENSG00000169249		"""Zinc fingers, CCCH-type domain containing"", ""RNA binding motif (RRM) containing"""	23019	protein-coding gene	gene with protein product		300028	"""U2(RNU2) small nuclear RNA auxiliary factor 1-like 2"", ""U2 small nuclear RNA auxiliary factor 1-like 2"""	U2AF1L2		8586425, 9237760, 15146077	Standard	NM_005089		Approved	U2AF1-RS2, URP	uc004cxg.4	Q15696	OTTHUMG00000021184	ENST00000307771.7:c.96G>T	chrX.hg19:g.15809111G>T	ENSP00000303015:p.Gln32His	226.0	0.0		214.0	104.0	NM_005089	Q14D69	Missense_Mutation	SNP	ENST00000307771.7	hg19	CCDS14172.1	.	.	.	.	.	.	.	.	.	.	G	15.03	2.711698	0.48517	.	.	ENSG00000169249	ENST00000307771;ENST00000380308	D;T	0.85629	-2.01;4.96	5.02	4.15	0.48705	.	0.000000	0.85682	D	0.000000	D	0.91758	0.7393	M	0.86953	2.85	0.52099	D	0.99994	D	0.61697	0.99	D	0.70487	0.969	D	0.91573	0.5273	10	0.87932	D	0	.	8.8273	0.35063	0.1075:0.0:0.8925:0.0	.	32	Q15696	U2AFM_HUMAN	H	32	ENSP00000303015:Q32H;ENSP00000369664:Q32H	ENSP00000303015:Q32H	Q	+	3	2	ZRSR2	15719032	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	1.623000	0.37008	1.037000	0.40024	0.429000	0.28392	CAG	.	.		0.483	ZRSR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055889.1	NM_005089	
CTPS2	56474	hgsc.bcm.edu	37	X	16707658	16707658	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chrX:16707658C>A	ENST00000443824.1	-	8	1530	c.787G>T	c.(787-789)Gtg>Ttg	p.V263L	CTPS2_ENST00000359276.4_Missense_Mutation_p.V263L|CTPS2_ENST00000380241.3_Missense_Mutation_p.V263L	NM_001144002.1	NP_001137474.1	Q9NRF8	PYRG2_HUMAN	CTP synthase 2	263					'de novo' CTP biosynthetic process (GO:0044210)|glutamine metabolic process (GO:0006541)|nucleobase-containing small molecule interconversion (GO:0015949)|nucleobase-containing small molecule metabolic process (GO:0055086)|pyrimidine nucleotide metabolic process (GO:0006220)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|CTP synthase activity (GO:0003883)			breast(1)|endometrium(3)|large_intestine(4)|lung(6)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	19	Hepatocellular(33;0.0997)					AAATATTTCACAATGCTTTGT	0.398																																					p.V263L		Atlas-SNP	.											.	CTPS2	49	.	0			c.G787T						.						129.0	116.0	120.0					X																	16707658		2203	4300	6503	SO:0001583	missense	56474	exon8			ATTTCACAATGCT	AF086422	CCDS14175.1	Xp22	2012-05-02	2012-05-02		ENSG00000047230	ENSG00000047230	6.3.4.2		2520	protein-coding gene	gene with protein product		300380	"""CTP synthase II"""			10899599	Standard	NM_001144002		Approved		uc004cxm.3	Q9NRF8	OTTHUMG00000021193	ENST00000443824.1:c.787G>T	chrX.hg19:g.16707658C>A	ENSP00000401264:p.Val263Leu	283.0	0.0		247.0	123.0	NM_001144002	B3KWM2|Q9BRI0|Q9H809|Q9H8K9	Missense_Mutation	SNP	ENST00000443824.1	hg19	CCDS14175.1	.	.	.	.	.	.	.	.	.	.	c	0.044	-1.272067	0.01421	.	.	ENSG00000047230	ENST00000443824;ENST00000380241;ENST00000359276	T;T;T	0.40225	1.04;1.04;1.04	5.83	2.81	0.32909	CTP synthase, N-terminal (1);	0.326238	0.25951	N	0.027252	T	0.24967	0.0606	L	0.28344	0.845	0.09310	N	0.999999	B	0.10296	0.003	B	0.17979	0.02	T	0.27434	-1.0074	10	0.10636	T	0.68	-15.2566	8.0937	0.30816	0.0:0.4482:0.0:0.5518	.	263	Q9NRF8	PYRG2_HUMAN	L	263	ENSP00000401264:V263L;ENSP00000369590:V263L;ENSP00000352222:V263L	ENSP00000352222:V263L	V	-	1	0	CTPS2	16617579	0.778000	0.28640	0.001000	0.08648	0.203000	0.24098	1.484000	0.35508	0.118000	0.18165	0.597000	0.82753	GTG	.	.		0.398	CTPS2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055906.1	NM_019857	
TRO	7216	hgsc.bcm.edu	37	X	54949458	54949458	+	Nonsense_Mutation	SNP	C	C	T			TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chrX:54949458C>T	ENST00000173898.7	+	3	605	c.493C>T	c.(493-495)Cag>Tag	p.Q165*	TRO_ENST00000375041.2_Intron|TRO_ENST00000319167.8_Nonsense_Mutation_p.Q165*|TRO_ENST00000399736.1_Intron|TRO_ENST00000375022.4_Nonsense_Mutation_p.Q165*|TRO_ENST00000484031.1_Intron|TRO_ENST00000420798.2_Intron	NM_001039705.2	NP_001034794.1	Q12816	TROP_HUMAN	trophinin	165					embryo implantation (GO:0007566)|homophilic cell adhesion (GO:0007156)|negative regulation of cell growth (GO:0030308)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(19)|ovary(2)|skin(2)|urinary_tract(1)	37						TGGCACTATACAGCTGAAGTC	0.507																																					p.Q165X		Atlas-SNP	.											.	TRO	246	.	0			c.C493T						.						42.0	41.0	42.0					X																	54949458		2066	4204	6270	SO:0001587	stop_gained	7216	exon3			ACTATACAGCTGA	U04811	CCDS43958.1, CCDS43959.1, CCDS59527.1, CCDS59528.1, CCDS59529.1	Xp11.22-p11.21	2008-02-05			ENSG00000067445	ENSG00000067445			12326	protein-coding gene	gene with protein product		300132				9533028, 11454705	Standard	NM_001039705		Approved	MAGE-D3, KIAA1114, MAGED3	uc004dtq.4	Q12816	OTTHUMG00000021640	ENST00000173898.7:c.493C>T	chrX.hg19:g.54949458C>T	ENSP00000173898:p.Gln165*	136.0	0.0		106.0	58.0	NM_016157	B1AKE9|B1AKF1|F5GY27|Q96SX2|Q9NU89|Q9UPN8	Nonsense_Mutation	SNP	ENST00000173898.7	hg19	CCDS43959.1	.	.	.	.	.	.	.	.	.	.	C	10.26	1.300474	0.23650	.	.	ENSG00000067445	ENST00000411534;ENST00000430420;ENST00000442098;ENST00000173898;ENST00000319167;ENST00000375022;ENST00000440759;ENST00000449980;ENST00000416704;ENST00000427099	.	.	.	3.3	1.46	0.22682	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	0.999999	.	.	.	.	.	.	.	.	.	.	0.54805	T	0.06	.	3.1836	0.06593	0.2613:0.5906:0.0:0.148	.	.	.	.	X	121;121;165;165;165;165;165;121;165;121	.	ENSP00000173898:Q165X	Q	+	1	0	TRO	54966183	0.001000	0.12720	0.006000	0.13384	0.439000	0.31926	-0.026000	0.12392	0.237000	0.21200	0.506000	0.49869	CAG	.	.		0.507	TRO-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000056837.3	NM_016157	
PFKFB1	5207	hgsc.bcm.edu	37	X	54975557	54975558	+	Missense_Mutation	DNP	GC	GC	TA			TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	G|C	G|C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chrX:54975557_54975558GC>TA	ENST00000375006.3	-	9	1013_1014	c.943_944GC>TA	c.(943-945)GCc>TAc	p.A315Y	PFKFB1_ENST00000374992.2_Intron|PFKFB1_ENST00000545676.1_Missense_Mutation_p.A250Y	NM_002625.2	NP_002616.2	P16118	F261_HUMAN	6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 1	315	Fructose-2,6-bisphosphatase.				carbohydrate metabolic process (GO:0005975)|dephosphorylation (GO:0016311)|energy reserve metabolic process (GO:0006112)|fructose 2,6-bisphosphate metabolic process (GO:0006003)|fructose metabolic process (GO:0006000)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|intracellular signal transduction (GO:0035556)|organ regeneration (GO:0031100)|positive regulation of glucokinase activity (GO:0033133)|response to cAMP (GO:0051591)|response to glucagon (GO:0033762)|response to glucocorticoid (GO:0051384)|response to insulin (GO:0032868)|response to starvation (GO:0042594)|small molecule metabolic process (GO:0044281)	6-phosphofructo-2-kinase/fructose-2,6-biphosphatase complex (GO:0043540)|cytosol (GO:0005829)	6-phosphofructo-2-kinase activity (GO:0003873)|ATP binding (GO:0005524)|fructose-2,6-bisphosphate 2-phosphatase activity (GO:0004331)|fructose-6-phosphate binding (GO:0070095)			central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(11)|ovary(1)	24						GACACCCAGGGCCTCAGCTGTC	0.564																																					p.A315D|p.A315S		Atlas-SNP	.											.	PFKFB1	64	.	0			c.C944A|c.G943T						.																																			SO:0001583	missense	5207	exon9			CCCAGGGCCTCAG|CCAGGGCCTCAGC		CCDS14364.1, CCDS65273.1	Xp11.21	2012-07-13			ENSG00000158571	ENSG00000158571	2.7.1.105, 3.1.3.46		8872	protein-coding gene	gene with protein product		311790		PFRX		9119406	Standard	NM_002625		Approved		uc004dty.2	P16118	OTTHUMG00000021643	ENST00000375006.3:c.943_944delinsTA	chrX.hg19:g.54975557_54975558delinsTA	ENSP00000364145:p.Ala315Tyr	118.0|119.0	0.0		114.0|112.0	70.0|69.0	NM_002625	B2RA88|B4DUN5|Q5JXS5|Q99951	Missense_Mutation	SNP	ENST00000375006.3	hg19	CCDS14364.1																																																																																			.	.		0.564	PFKFB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056847.1		
NLGN3	54413	hgsc.bcm.edu	37	X	70375180	70375180	+	Missense_Mutation	SNP	G	G	C	rs201424510		TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chrX:70375180G>C	ENST00000358741.3	+	5	997	c.694G>C	c.(694-696)Gtc>Ctc	p.V232L	NLGN3_ENST00000374051.3_Missense_Mutation_p.V212L|NLGN3_ENST00000476589.1_3'UTR|NLGN3_ENST00000536169.1_Missense_Mutation_p.V192L	NM_181303.1	NP_851820.1	Q9NZ94	NLGN3_HUMAN	neuroligin 3	232					adult behavior (GO:0030534)|axon extension (GO:0048675)|learning (GO:0007612)|neuron cell-cell adhesion (GO:0007158)|oligodendrocyte differentiation (GO:0048709)|positive regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000969)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|receptor-mediated endocytosis (GO:0006898)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of inhibitory postsynaptic membrane potential (GO:0060080)|regulation of long-term synaptic potentiation (GO:1900271)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|regulation of synaptic transmission (GO:0050804)|regulation of terminal button organization (GO:2000331)|rhythmic synaptic transmission (GO:0060024)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synapse organization (GO:0050808)|visual learning (GO:0008542)|vocalization behavior (GO:0071625)	cell junction (GO:0030054)|cell surface (GO:0009986)|endocytic vesicle (GO:0030139)|excitatory synapse (GO:0060076)|integral component of plasma membrane (GO:0005887)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|neurexin family protein binding (GO:0042043)|receptor activity (GO:0004872)			biliary_tract(1)|breast(1)|central_nervous_system(2)|endometrium(4)|large_intestine(10)|lung(14)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	37	Renal(35;0.156)					CAATGTCATCGTCATCACCCT	0.537																																					p.V232L	Esophageal Squamous(103;760 1488 16849 22250 40351)	Atlas-SNP	.											.	NLGN3	159	.	0			c.G694C						.						300.0	196.0	231.0					X																	70375180		2203	4300	6503	SO:0001583	missense	54413	exon5			GTCATCGTCATCA	AB040913	CCDS14407.1, CCDS55441.1, CCDS55442.1	Xq13.1	2008-08-01			ENSG00000196338	ENSG00000196338			14289	protein-coding gene	gene with protein product		300336				10767552, 10819331	Standard	NM_181303		Approved	HNL3, KIAA1480, ASPGX1, AUTSX1	uc004dzd.2	Q9NZ94	OTTHUMG00000021790	ENST00000358741.3:c.694G>C	chrX.hg19:g.70375180G>C	ENSP00000351591:p.Val232Leu	72.0	0.0		73.0	31.0	NM_181303	B2RBK1|D2X2H6|D3DVV0|D3DVV1|Q86V51|Q8NCD0|Q9NZ95|Q9NZ96|Q9NZ97|Q9P248	Missense_Mutation	SNP	ENST00000358741.3	hg19	CCDS55441.1	.	.	.	.	.	.	.	.	.	.	G	25.2	4.613969	0.87359	.	.	ENSG00000196338	ENST00000536169;ENST00000542063;ENST00000374051;ENST00000395855;ENST00000358741	T;T;T;T	0.67865	-0.29;-0.29;-0.29;-0.29	4.43	4.43	0.53597	Carboxylesterase, type B (1);	0.000000	0.85682	D	0.000000	T	0.78836	0.4346	L	0.60012	1.86	0.80722	D	1	D;D;D;D	0.89917	0.999;1.0;1.0;0.997	D;D;D;P	0.91635	0.953;0.999;0.982;0.86	T	0.80094	-0.1526	10	0.49607	T	0.09	.	16.4473	0.83942	0.0:0.0:1.0:0.0	.	192;192;232;212	D3DVV1;B7Z5Y1;Q9NZ94;Q9NZ94-2	.;.;NLGN3_HUMAN;.	L	192;95;212;192;232	ENSP00000445298:V192L;ENSP00000363163:V212L;ENSP00000379196:V192L;ENSP00000351591:V232L	ENSP00000351591:V232L	V	+	1	0	NLGN3	70291905	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.601000	0.98297	2.051000	0.60960	0.540000	0.68198	GTC	.	G|1.000;A|0.000		0.537	NLGN3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057121.1	NM_018977	
COL4A6	1288	hgsc.bcm.edu	37	X	107464563	107464563	+	Silent	SNP	A	A	G			TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chrX:107464563A>G	ENST00000372216.4	-	4	289	c.189T>C	c.(187-189)ccT>ccC	p.P63P	COL4A6_ENST00000334504.7_Silent_p.P62P|COL4A6_ENST00000538570.1_Silent_p.P62P|COL4A6_ENST00000545689.1_Silent_p.P62P|COL4A6_ENST00000394872.2_Silent_p.P62P	NM_001847.2	NP_001838.2	Q14031	CO4A6_HUMAN	collagen, type IV, alpha 6	63	Triple-helical region.				cell adhesion (GO:0007155)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(20)|lung(41)|ovary(7)|prostate(1)|skin(1)|stomach(1)|urinary_tract(2)	92						TGAATCCTTGAGGACCTGTTG	0.468									Alport syndrome with Diffuse Leiomyomatosis																												p.P63P	Melanoma(87;1895 1945 2589 7165)	Atlas-SNP	.											.	COL4A6	270	.	0			c.T189C						.						131.0	112.0	119.0					X																	107464563		2203	4300	6503	SO:0001819	synonymous_variant	1288	exon4	Familial Cancer Database		TCCTTGAGGACCT	U04845	CCDS14541.1, CCDS14542.1, CCDS76008.1, CCDS76009.1, CCDS76010.1	Xq22	2014-09-17			ENSG00000197565	ENSG00000197565		"""Collagens"""	2208	protein-coding gene	gene with protein product		303631				8356449	Standard	NM_033641		Approved		uc004env.4	Q14031	OTTHUMG00000022179	ENST00000372216.4:c.189T>C	chrX.hg19:g.107464563A>G		102.0	0.0		82.0	46.0	NM_001847	Q12823|Q14053|Q5JYH6|Q5JYH8|Q9NQM5|Q9NTX3|Q9UJ76|Q9UMG6|Q9Y4L4	Silent	SNP	ENST00000372216.4	hg19	CCDS14541.1																																																																																			.	.		0.468	COL4A6-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000057875.2		
MT-CO1	4512	hgsc.bcm.edu	37	M	7382	7382	+	Silent	SNP	G	G	A			TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chrM:7382G>A	ENST00000361624.2	+	1	1479	c.1479G>A	c.(1477-1479)gaG>gaA	p.E493E	MT-CO2_ENST00000361739.1_5'Flank|MT-TW_ENST00000387382.1_RNA|MT-ND3_ENST00000361227.2_5'Flank|MT-TC_ENST00000387405.1_RNA|MT-ATP8_ENST00000361851.1_5'Flank|MT-TY_ENST00000387409.1_RNA|MT-ATP6_ENST00000361899.2_5'Flank|MT-TM_ENST00000387377.1_RNA|MT-TD_ENST00000387419.1_RNA|MT-TN_ENST00000387400.1_RNA|MT-CO3_ENST00000362079.2_5'Flank|MT-TK_ENST00000387421.1_RNA|MT-TG_ENST00000387429.1_RNA|MT-TA_ENST00000387392.1_RNA|MT-TQ_ENST00000387372.1_RNA|MT-TS1_ENST00000387416.2_RNA			P00395	COX1_HUMAN	mitochondrially encoded cytochrome c oxidase I	493					aerobic respiration (GO:0009060)|cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|oxidative phosphorylation (GO:0006119)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex IV (GO:0005751)|respiratory chain complex IV (GO:0045277)	cytochrome-c oxidase activity (GO:0004129)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			breast(4)|endometrium(25)|kidney(19)|lung(3)|prostate(3)	54						ATAAACCTGGAGTGACTATAT	0.408																																					p.E493E		Atlas-SNP	.											.	.	.	.	0			c.G1479A						.																																			SO:0001819	synonymous_variant	5742	exon1			CCTGGAGTGACTA			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198804	ENSG00000198804		"""Mitochondrial respiratory chain complex / Complex IV"""	7419	protein-coding gene	gene with protein product		516030	"""cytochrome c oxidase I"""	MTCO1		7219534	Standard			Approved	COX1, COI		P00395		ENST00000361624.2:c.1479G>A	chrM.hg19:g.7382G>A		13.0	0.0		13.0	7.0	ENST00000361624	Q34770	Silent	SNP	ENST00000361624.2	hg19																																																																																				.	.		0.408	MT-CO1-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024028	
ST7	7982	hgsc.bcm.edu	37	7	116759650	116759653	+	Frame_Shift_Del	DEL	TTCA	TTCA	-	rs368082187		TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	TTCA	TTCA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr7:116759650_116759653delTTCA	ENST00000393446.2	+	3	573_576	c.270_273delTTCA	c.(268-273)acttcafs	p.TS90fs	ST7_ENST00000422922.1_Frame_Shift_Del_p.TS44fs|ST7_ENST00000465133.1_Frame_Shift_Del_p.TS47fs|ST7-AS2_ENST00000432541.1_RNA|ST7-AS2_ENST00000442719.1_RNA|ST7_ENST00000393447.4_Frame_Shift_Del_p.TS47fs|ST7_ENST00000432298.1_Frame_Shift_Del_p.TS44fs|ST7_ENST00000393443.1_Frame_Shift_Del_p.TS40fs|ST7-AS2_ENST00000434993.1_RNA|ST7_ENST00000487459.1_3'UTR|ST7_ENST00000393444.3_Frame_Shift_Del_p.TS47fs|ST7_ENST00000393449.1_Frame_Shift_Del_p.TS90fs|ST7_ENST00000265437.5_Frame_Shift_Del_p.TS90fs|ST7_ENST00000393451.3_Frame_Shift_Del_p.TS90fs|ST7_ENST00000323984.3_Frame_Shift_Del_p.TS90fs			Q9Y561	LRP12_HUMAN	suppression of tumorigenicity 7	0	CUB 1. {ECO:0000255|PROSITE- ProRule:PRU00059}.				endocytosis (GO:0006897)|receptor-mediated endocytosis (GO:0006898)|regulation of growth (GO:0040008)|signal transduction (GO:0007165)	coated pit (GO:0005905)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	low-density lipoprotein receptor activity (GO:0005041)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|liver(2)|lung(5)|ovary(1)|skin(1)	21	all_cancers(3;3.88e-07)|all_epithelial(6;3.42e-07)|Lung NSC(10;0.00072)|all_lung(10;0.000847)		STAD - Stomach adenocarcinoma(10;0.000512)	LUSC - Lung squamous cell carcinoma(290;0.133)		AATACGGAACTTCATTCATTGAAC	0.417																																					p.90_91del		Atlas-INDEL	.											.	ST7	64	.	0			c.269_272del						.																																			SO:0001589	frameshift_variant	7982	exon3			.	AJ277291	CCDS5769.1, CCDS5770.1	7q31.2	2008-06-06			ENSG00000004866	ENSG00000004866			11351	protein-coding gene	gene with protein product		600833		FAM4A1		8105370, 8938430	Standard	NM_021908		Approved	TSG7, SEN4, ETS7q, HELG, RAY1, FAM4A	uc003vin.3	Q9NRC1	OTTHUMG00000023888	ENST00000393446.2:c.270_273delTTCA	chr7.hg19:g.116759654_116759657delTTCA	ENSP00000377092:p.Thr90fs	80.0	0.0		92.0	19.0	NM_018412	A8K137|B4DRQ2	Frame_Shift_Del	DEL	ENST00000393446.2	hg19																																																																																				.	.		0.417	ST7-013	NOVEL	not_organism_supported|basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000319687.1	NM_021908	
TSC2	7249	hgsc.bcm.edu	37	16	2137899	2137899	+	Frame_Shift_Del	DEL	G	G	-	rs35118875|rs137854382	byFrequency	TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr16:2137899delG	ENST00000219476.3	+	39	5655	c.5025delG	c.(5023-5025)ccgfs	p.P1675fs	TSC2_ENST00000568454.1_Frame_Shift_Del_p.P1619fs|TSC2_ENST00000382538.6_Frame_Shift_Del_p.P1560fs|MIR1225_ENST00000408729.1_RNA|TSC2_ENST00000439673.2_Frame_Shift_Del_p.P1572fs|TSC2_ENST00000353929.4_Frame_Shift_Del_p.P1632fs|TSC2_ENST00000350773.4_Frame_Shift_Del_p.P1652fs|TSC2_ENST00000401874.2_Frame_Shift_Del_p.P1608fs	NM_000548.3	NP_000539.2	P49815	TSC2_HUMAN	tuberous sclerosis 2	1675	Rap-GAP. {ECO:0000255|PROSITE- ProRule:PRU00165}.		P -> L (in TSC2). {ECO:0000269|PubMed:10570911, ECO:0000269|PubMed:15024740, ECO:0000269|PubMed:9302281}.		acute-phase response (GO:0006953)|cell cycle arrest (GO:0007050)|cell projection organization (GO:0030030)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin-like growth factor receptor signaling pathway (GO:0048009)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell size (GO:0045792)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of TOR signaling (GO:0032007)|negative regulation of Wnt signaling pathway (GO:0030178)|neural tube closure (GO:0001843)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive chemotaxis (GO:0050918)|positive regulation of Ras GTPase activity (GO:0032320)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|protein import into nucleus (GO:0006606)|protein kinase B signaling (GO:0043491)|protein localization (GO:0008104)|regulation of cell cycle (GO:0051726)|regulation of endocytosis (GO:0030100)|regulation of insulin receptor signaling pathway (GO:0046626)|response to hypoxia (GO:0001666)|vesicle-mediated transport (GO:0016192)	caveola (GO:0005901)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|TSC1-TSC2 complex (GO:0033596)	GTPase activator activity (GO:0005096)|phosphatase binding (GO:0019902)|protein homodimerization activity (GO:0042803)			NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(4)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(3)|lung(19)|ovary(2)|pancreas(1)|prostate(2)|skin(7)|soft_tissue(1)	56		Hepatocellular(780;0.0202)				TCGTCACCCCGCTGGACTACG	0.632			"""D, Mis, N, F, S"""			"""hamartoma, renal cell"""			Tuberous Sclerosis																												p.P1675fs		Atlas-INDEL	.	yes	Rec		Tuberous sclerosis 2	16	16p13.3	7249	tuberous sclerosis 2 gene		"""E, O"""	TSC2,NS,other,0,1	TSC2	364	.	0			c.5024delC	GRCh37	CD982989	TSC2	D	rs35118875	.						66.0	49.0	55.0					16																	2137899		2194	4299	6493	SO:0001589	frameshift_variant	7249	exon39	Familial Cancer Database	TS, Tuberous Sclerosis Complex, TSC, Bourneville-Pringle disease	.	AB014460	CCDS10458.1, CCDS45384.1, CCDS58408.1	16p13.3	2014-09-17			ENSG00000103197	ENSG00000103197			12363	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 160"""	191092		TSC4		1303246, 7558029	Standard	NM_001077183		Approved	tuberin, LAM, PPP1R160	uc002con.3	P49815	OTTHUMG00000128745	ENST00000219476.3:c.5025delG	chr16.hg19:g.2137899delG	ENSP00000219476:p.Pro1675fs	171.0	0.0		102.0	45.0	NM_000548	A7E2E2|B4DIL8|B4DIQ7|B4DRN2|B7Z2B8|C9J378|O75275|Q4LE71|Q8TAZ1	Frame_Shift_Del	DEL	ENST00000219476.3	hg19	CCDS10458.1																																																																																			.	.		0.632	TSC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000250657.2	NM_000548	
PER1	5187	hgsc.bcm.edu	37	17	8046658	8046694	+	Frame_Shift_Del	DEL	CAGCAGCCCCCTCAGCACGGGGGAGCTCCTCCAGCTG	CAGCAGCCCCCTCAGCACGGGGGAGCTCCTCCAGCTG	-	rs3027194|rs112474322|rs112185134|rs571320541|rs376885431	byFrequency	TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	CAGCAGCCCCCTCAGCACGGGGGAGCTCCTCCAGCTG	CAGCAGCCCCCTCAGCACGGGGGAGCTCCTCCAGCTG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr17:8046658_8046694delCAGCAGCCCCCTCAGCACGGGGGAGCTCCTCCAGCTG	ENST00000317276.4	-	19	3199_3235	c.2962_2998delCAGCTGGAGGAGCTCCCCCGTGCTGAGGGGGCTGCTG	c.(2962-3000)cagctggaggagctcccccgtgctgagggggctgctgttfs	p.QLEELPRAEGAAV988fs	PER1_ENST00000578089.1_5'Flank|PER1_ENST00000581082.1_Frame_Shift_Del_p.QLEELPRAEGAAV965fs	NM_002616.2	NP_002607.2	O15534	PER1_HUMAN	period circadian clock 1	988	Pro-rich.				circadian regulation of gene expression (GO:0032922)|circadian regulation of translation (GO:0097167)|circadian rhythm (GO:0007623)|entrainment of circadian clock (GO:0009649)|entrainment of circadian clock by photoperiod (GO:0043153)|histone H3 acetylation (GO:0043966)|histone H3 deacetylation (GO:0070932)|histone H4 acetylation (GO:0043967)|negative regulation of glucocorticoid receptor signaling pathway (GO:2000323)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of JNK cascade (GO:0046329)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|posttranscriptional regulation of gene expression (GO:0010608)|regulation of circadian rhythm (GO:0042752)|regulation of cytokine production involved in inflammatory response (GO:1900015)|regulation of hair cycle (GO:0042634)|regulation of p38MAPK cascade (GO:1900744)|regulation of sodium ion transport (GO:0002028)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|E-box binding (GO:0070888)|kinase binding (GO:0019900)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|signal transducer activity (GO:0004871)|transcription factor binding transcription factor activity (GO:0000989)|ubiquitin protein ligase binding (GO:0031625)			breast(4)|central_nervous_system(1)|endometrium(2)|kidney(7)|large_intestine(3)|lung(15)|ovary(4)|pancreas(1)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	47						CCTCCTGCAACAGCAGCCCCCTCAGCACGGGGGAGCTCCTCCAGCTGCAGCAGATTG	0.671			T	ETV6	"""AML, CMML"""			Other conserved DNA damage response genes																													p.988_1000del		Atlas-INDEL	.		Dom	yes		17	17p13.1-17p12	5187	period homolog 1 (Drosophila)		L	.	PER1	104	.	0			c.2963_2999del						.																																			SO:0001589	frameshift_variant	5187	exon19			.	AB002107	CCDS11131.1	17p13.1	2012-12-13	2012-12-13			ENSG00000179094			8845	protein-coding gene	gene with protein product		602260	"""period (Drosophila) homolog 1"", ""period homolog 1 (Drosophila)"""	PER		9323128	Standard	NM_002616		Approved	RIGUI	uc002gkd.3	O15534		ENST00000317276.4:c.2962_2998delCAGCTGGAGGAGCTCCCCCGTGCTGAGGGGGCTGCTG	chr17.hg19:g.8046658_8046694delCAGCAGCCCCCTCAGCACGGGGGAGCTCCTCCAGCTG	ENSP00000314420:p.Gln988fs	117.0	0.0		88.0	19.0	NM_002616	B2RPA8|B4DI49|D3DTR3	Frame_Shift_Del	DEL	ENST00000317276.4	hg19	CCDS11131.1																																																																																			.	.		0.671	PER1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441481.2		
PHF14	9678	hgsc.bcm.edu	37	7	11076165	11076165	+	Frame_Shift_Del	DEL	G	G	-			TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr7:11076165delG	ENST00000403050.3	+	9	2175	c.1723delG	c.(1723-1725)gctfs	p.A575fs	PHF14_ENST00000445996.2_Frame_Shift_Del_p.A290fs	NM_014660.3	NP_055475.2	O94880	PHF14_HUMAN	PHD finger protein 14	575					lung alveolus development (GO:0048286)|negative regulation of mesenchymal cell proliferation involved in lung development (GO:2000791)|negative regulation of platelet-derived growth factor receptor-alpha signaling pathway (GO:2000584)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)	nucleus (GO:0005634)	zinc ion binding (GO:0008270)			NS(2)|breast(1)|endometrium(4)|kidney(5)|large_intestine(5)|lung(14)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	35				UCEC - Uterine corpus endometrioid carcinoma (126;0.205)		CAGTGCTTCAGCTATTCGTAA	0.483																																					p.S574fs		Atlas-INDEL	.											.	PHF14	90	.	0			c.1722delA						.						88.0	85.0	86.0					7																	11076165		1901	4132	6033	SO:0001589	frameshift_variant	9678	exon9			.	AB018326	CCDS47542.1	7p21.3	2013-01-28			ENSG00000106443	ENSG00000106443		"""Zinc fingers, PHD-type"""	22203	protein-coding gene	gene with protein product						9872452	Standard	NM_014660		Approved	KIAA0783	uc003sry.2	O94880	OTTHUMG00000150463	ENST00000403050.3:c.1723delG	chr7.hg19:g.11076165delG	ENSP00000385795:p.Ala575fs	197.0	0.0		252.0	54.0	NM_014660	A7MCZ3|B4DI82	Frame_Shift_Del	DEL	ENST00000403050.3	hg19	CCDS47542.1																																																																																			.	.		0.483	PHF14-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000318212.1	NM_014660	
PDE11A	50940	hgsc.bcm.edu	37	2	178879182	178879194	+	Splice_Site	DEL	TCGATCCTAAAAA	TCGATCCTAAAAA	-	rs76865936		TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	TCGATCCTAAAAA	TCGATCCTAAAAA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr2:178879182_178879194delTCGATCCTAAAAA	ENST00000286063.6	-	2	1230_1235	c.913_918delTTTTTAGGATCGA	c.(913-918)tttttadel	p.FL305fs	PDE11A_ENST00000358450.4_Splice_Site_p.FL55fs|AC011998.1_ENST00000457053.1_RNA	NM_016953.3	NP_058649.3	Q9HCR9	PDE11_HUMAN	phosphodiesterase 11A	305	GAF 1.				blood coagulation (GO:0007596)|cAMP catabolic process (GO:0006198)|cGMP catabolic process (GO:0046069)|signal transduction (GO:0007165)	cytosol (GO:0005829)|perikaryon (GO:0043204)	3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|cAMP binding (GO:0030552)|cGMP binding (GO:0030553)|cGMP-stimulated cyclic-nucleotide phosphodiesterase activity (GO:0004118)|cyclic-nucleotide phosphodiesterase activity (GO:0004112)|metal ion binding (GO:0046872)	p.D305Y(1)|p.D55Y(1)		breast(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(13)|lung(28)|ovary(4)|skin(3)|upper_aerodigestive_tract(3)	58			OV - Ovarian serous cystadenocarcinoma(117;0.00121)|Epithelial(96;0.00455)|all cancers(119;0.02)		Caffeine(DB00201)|Tadalafil(DB00820)	CATTGAATCGTCGATCCTAAAAATAAGACAAAG	0.413									Primary Pigmented Nodular Adrenocortical Disease, Familial																												p.305_307del		Atlas-INDEL	.											.	PDE11A	283	.	2	Substitution - Missense(2)	large_intestine(2)	c.913_919del						.																																			SO:0001630	splice_region_variant	50940	exon2	Familial Cancer Database	iPPNAD, PPNAD1, incl. familial micronodular adrenocortical hyperplasia, PPNAD2	.	AJ251509	CCDS33334.1, CCDS42785.1, CCDS42786.1, CCDS46459.1	2q31.3	2010-06-22			ENSG00000128655	ENSG00000128655	3.1.4.17	"""Phosphodiesterases"""	8773	protein-coding gene	gene with protein product		604961				10725373	Standard	NM_001077196		Approved		uc002ulq.3	Q9HCR9	OTTHUMG00000154188	ENST00000286063.6:c.913-1TTTTTAGGATCGA>-	chr2.hg19:g.178879182_178879194delTCGATCCTAAAAA		48.0	0.0		55.0	19.0	NM_016953	Q14CD1|Q53T16|Q96S76|Q9GZY7|Q9HB46|Q9NY45	Frame_Shift_Del	DEL	ENST00000286063.6	hg19	CCDS33334.1																																																																																			.	.		0.413	PDE11A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334313.2		Frame_Shift_Del
SYNE1	23345	hgsc.bcm.edu	37	6	152690719	152690719	+	Frame_Shift_Del	DEL	C	C	-			TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr6:152690719delC	ENST00000367255.5	-	60	10139	c.9538delG	c.(9538-9540)gtafs	p.V3180fs	SYNE1_ENST00000341594.5_Frame_Shift_Del_p.V3219fs|SYNE1_ENST00000265368.4_Frame_Shift_Del_p.V3180fs|SYNE1_ENST00000448038.1_Frame_Shift_Del_p.V3187fs|SYNE1_ENST00000423061.1_Frame_Shift_Del_p.V3187fs	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	3180					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		TCAGCACTTACTTCAAAGTCC	0.438										HNSCC(10;0.0054)																											p.V3187fs		Atlas-INDEL	.											.	SYNE1	3227	.	0			c.9560delT						.						96.0	90.0	92.0					6																	152690719		2203	4300	6503	SO:0001589	frameshift_variant	23345	exon60			.	AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.9538delG	chr6.hg19:g.152690719delC	ENSP00000356224:p.Val3180fs	89.0	0.0		83.0	18.0	NM_033071	E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Frame_Shift_Del	DEL	ENST00000367255.5	hg19	CCDS5236.2																																																																																			.	.		0.438	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000334755.2	NM_182961	
PER1	5187	hgsc.bcm.edu	37	17	8049299	8049299	+	Frame_Shift_Del	DEL	C	C	-			TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr17:8049299delC	ENST00000317276.4	-	17	2432	c.2195delG	c.(2194-2196)ggafs	p.G732fs	PER1_ENST00000354903.5_Frame_Shift_Del_p.G716fs|PER1_ENST00000578089.1_5'UTR|PER1_ENST00000581082.1_Frame_Shift_Del_p.G712fs	NM_002616.2	NP_002607.2	O15534	PER1_HUMAN	period circadian clock 1	732	Required for phosphorylation by CSNK1E. {ECO:0000250}.				circadian regulation of gene expression (GO:0032922)|circadian regulation of translation (GO:0097167)|circadian rhythm (GO:0007623)|entrainment of circadian clock (GO:0009649)|entrainment of circadian clock by photoperiod (GO:0043153)|histone H3 acetylation (GO:0043966)|histone H3 deacetylation (GO:0070932)|histone H4 acetylation (GO:0043967)|negative regulation of glucocorticoid receptor signaling pathway (GO:2000323)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of JNK cascade (GO:0046329)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|posttranscriptional regulation of gene expression (GO:0010608)|regulation of circadian rhythm (GO:0042752)|regulation of cytokine production involved in inflammatory response (GO:1900015)|regulation of hair cycle (GO:0042634)|regulation of p38MAPK cascade (GO:1900744)|regulation of sodium ion transport (GO:0002028)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|E-box binding (GO:0070888)|kinase binding (GO:0019900)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|signal transducer activity (GO:0004871)|transcription factor binding transcription factor activity (GO:0000989)|ubiquitin protein ligase binding (GO:0031625)			breast(4)|central_nervous_system(1)|endometrium(2)|kidney(7)|large_intestine(3)|lung(15)|ovary(4)|pancreas(1)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	47						CTTCTTGTCTCCCACATGGAC	0.637			T	ETV6	"""AML, CMML"""			Other conserved DNA damage response genes																													p.G732fs		Atlas-INDEL	.		Dom	yes		17	17p13.1-17p12	5187	period homolog 1 (Drosophila)		L	.	PER1	104	.	0			c.2196delA						.						69.0	68.0	69.0					17																	8049299		2203	4300	6503	SO:0001589	frameshift_variant	5187	exon17			.	AB002107	CCDS11131.1	17p13.1	2012-12-13	2012-12-13			ENSG00000179094			8845	protein-coding gene	gene with protein product		602260	"""period (Drosophila) homolog 1"", ""period homolog 1 (Drosophila)"""	PER		9323128	Standard	NM_002616		Approved	RIGUI	uc002gkd.3	O15534		ENST00000317276.4:c.2195delG	chr17.hg19:g.8049299delC	ENSP00000314420:p.Gly732fs	64.0	0.0		50.0	17.0	NM_002616	B2RPA8|B4DI49|D3DTR3	Frame_Shift_Del	DEL	ENST00000317276.4	hg19	CCDS11131.1																																																																																			.	.		0.637	PER1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441481.2		
ST8SIA5	29906	hgsc.bcm.edu	37	18	44260286	44260293	+	Frame_Shift_Del	DEL	TGACCAGG	TGACCAGG	-	rs200781006		TCGA-CC-A8HT-01A-11D-A35Z-10	TCGA-CC-A8HT-10A-01D-A35Z-10	TGACCAGG	TGACCAGG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	278e9596-350e-4dc0-be6a-009ab7846250	c14f9d6e-16bb-499c-b83b-d97d1da50b37	g.chr18:44260286_44260293delTGACCAGG	ENST00000315087.7	-	7	1503_1510	c.843_850delCCTGGTCA	c.(841-852)tacctggtcaacfs	p.YLVN281fs	ST8SIA5_ENST00000536490.1_Frame_Shift_Del_p.YLVN250fs|ST8SIA5_ENST00000538168.1_Frame_Shift_Del_p.YLVN317fs|ST8SIA5_ENST00000590497.1_5'UTR	NM_013305.4	NP_037437.2	O15466	SIA8E_HUMAN	ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 5	281					carbohydrate metabolic process (GO:0005975)|glycosphingolipid biosynthetic process (GO:0006688)|protein glycosylation (GO:0006486)|sialylation (GO:0097503)	integral component of Golgi membrane (GO:0030173)	alpha-N-acetylneuraminate alpha-2,8-sialyltransferase activity (GO:0003828)|sialyltransferase activity (GO:0008373)			kidney(1)|large_intestine(10)|lung(7)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(2)	22						CGCGACACGTTGACCAGGTACTGCGGAT	0.615																																					p.282_284del		Atlas-INDEL	.											.	ST8SIA5	57	.	0			c.844_851del						.																																			SO:0001589	frameshift_variant	29906	exon7			.	U91641	CCDS11930.1	18q12.3	2013-03-01	2003-01-14	2005-02-07	ENSG00000101638	ENSG00000101638		"""Sialyltransferases"""	17827	protein-coding gene	gene with protein product	"""ST8Sia V"""	607162	"""sialyltransferase 8E (alpha-2, 8-polysialytransferase)"""	SIAT8E		9199191	Standard	XM_005258250		Approved		uc002lcj.1	O15466	OTTHUMG00000132643	ENST00000315087.7:c.843_850delCCTGGTCA	chr18.hg19:g.44260286_44260293delTGACCAGG	ENSP00000321343:p.Tyr281fs	99.0	0.0		84.0	18.0	NM_013305	B7Z1K9|Q6IAW7	Frame_Shift_Del	DEL	ENST00000315087.7	hg19	CCDS11930.1																																																																																			.	.		0.615	ST8SIA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255892.1	NM_013305	
